List database


# MySQL hash MySQL password
1,666,300,001 *AF57C04381732C4BB2DFBCE35DE3367B4C63D168 NICKYFUKUNAGA
1,666,300,002 *AF5F387F745E1C4EF61419047B8250BE51DBEE84 1857836 copyright.
1,666,300,003 *AF55F524C9D4EBB2A60005DE7FCC94A60806F12E nitrahklogojpg
1,666,300,004 *AF5A5F3BC67C1813F275A59F2424969639A10E63 190603G
1,666,300,005 *AF5F0287B521C3445E8036565E7CA9B1FE2E0199 1.billigproduktionslaendern
1,666,300,006 *AF57ACBB6BF20ED712ACEE41E08CBEFCE9411042 [email protected]
1,666,300,007 *AF538B73670C6C174FD8996300539D7002A192F7 NLABAESI
1,666,300,008 *AF554A3E0CFFDA8AE985EAF5288C543FF6B8F108 1DANCE-ART
1,666,300,009 *AF57E5C0260E5BAB7DC84E6ECF5F2DAAE9FBCCC9 NNKHEITTE
1,666,300,010 *AF532468744B99184E16928571E793C463338E5A NOAHSKAGEN
1,666,300,011 *AF59DEC0A6D874A6EAEF0D107731A9123D87A215 NO.AMIGO
1,666,300,012 *AF5CC146E9DA194A28C5606896B72D13B77BC65C NORMACURTIN
1,666,300,013 *AF5FF9D17F596F3C0D73D4ACF3398C47139F15BF nsilver7
1,666,300,014 *AF55BEA849F9498A4750527217767B549292C8B1 nygaard2005may2005j
1,666,300,015 *AF5F6DBD50CE7B934209E7BF71F5484314318AAD >-<.o~0~.d#####B
1,666,300,016 *AF5F5AC3BF2867E052406806956A0DE26FC1874B objetares
1,666,300,017 *AF5BC65AB256DE0D4B8AE4B53AA646D479897FF4 OFFERS
1,666,300,018 *AF59086C770F89BDD2A174F71A9C31EA338F27AC 1-MINIBLOECKERL
1,666,300,019 *AF559166A37A2988B81C750854381CDC838D88F6 olliecripps
1,666,300,020 *AF57068F0F554C1B79E21E04B9361769F28399EA OLRACUDE
1,666,300,021 *AF596F912DF5DBC96358B7470913BE3B2BB2CCDE 1-ortakliginca
1,666,300,022 *AF5D56FBAA971C6A8227B6F11A4F4A78C5A456F7 ONITROGLICERING
1,666,300,023 *AF58EAE4F54CE34BBAA7DC72E3F80B3F318B7847 ONOMSTOTELIJK3
1,666,300,024 *AF500A7441ADE38DEC29025CE922CA6784964707 OPERACION-GUNNERSIDE
1,666,300,025 *AF524E4B97A4C2B91093854033C98E958B6380AA OPZPBSW8
1,666,300,026 *AF5892376FA6E6F08660DA3B039BCF3F7AC0D0A5 ortaire-de-landelles
1,666,300,027 *AF51C7AA685554B83CC9B77F9B3BFAD6CFEBB33C 1suedwestmetropole
1,666,300,028 *AF5D189F9AF8612E50E70236DC6E0E187992DB68 1-TAITOVARANTOA
1,666,300,029 *AF53627EDF7106D0FF5DDF2DB573386BF1A246AB OT<~
1,666,300,030 *AF50CC7B828785D1937D245B12E8128AD1BD94C6 1.US-DROHGEBAERDEN
1,666,300,031 *AF559053FAC0F7D8F17F5D1280FCF848F08E98CD 1 YKSIL
1,666,300,032 *AF512C4E0CE0E5D2F9BA2A1CA7982C42FC720FBB P1CKPOCK3+
1,666,300,033 *AF5484BCD6D046202AAD95636AD542FBD155BDE1 < p. 89 >
1,666,300,034 *AF599BEC15998F02AF30DC3D54DB9E6AA6A85B71 PABLO.ISAACS
1,666,300,035 *AF5F58866D43817440F39EB43D9E18C2EFD8C3FD PADDINGTOP15PX
1,666,300,036 *AF596F2B5CD4A14E78BAF863A5A747E8C0E8BC1A 21nettik1
1,666,300,037 *AF518CD5121906B151CEA34BDE456ED2B6E8EC8D 22 ZIELRAUM
1,666,300,038 *AF5EBF15F8530530241A1256E83ED46002947A9D 2390996 tekstiosuus : ensin luetaan teksti , joka sitten k
1,666,300,039 *AF59A557442E3423B0B27F713497F9AEE70D6F7E PARISERLICHOUFE
1,666,300,040 *AF53402F4BB78DF3E6F313BAFCC3044A69CCED3A 2786921 on olemassa erityyppist
1,666,300,041 *AF5FF390990797F333672292A5DE52F679226126 P---D~0~O:P
1,666,300,042 *AF5D985544171226A5280F09313DF8D2B240A51E 2ADLERSHOF
1,666,300,043 *AF50CADAA9022AA1943FB7132DF218BF9584CFD9 PHIANGSUREEN
1,666,300,044 *AF505663CC0A273927A7E418FF83F05413DF5F66 2BE-SCHAEFTIGT
1,666,300,045 *AF59CAEF0047D0AE04C75E3C8A1B7771CF0F7779 2DRAGETUM
1,666,300,046 *AF57E4A5EC377F34999CA44A75690AE173C3AAF5 PIERRE.BERGSMAN
1,666,300,047 *AF5016F367C0ECA5FCF3B565D896D6DFBE6CD85A PIERRELATU
1,666,300,048 *AF58D7619B93A4D550D75E8A369C85B905F6A395 2ftournai
1,666,300,049 *AF5F16BF2F1385DD6649EFF13387557787BB6B21 pinadeebrozaragoza
1,666,300,050 *AF564DC3AF5094270EBB460328FB4C5D29CD48A9 2LD،
1,666,300,051 *AF52F8AFE85EA2EE393654E85E5F89689ED1C175 2-stubbenkammer
1,666,300,052 *AF5835C656A1DA3504A390BC728AFCA5CF6B45FD p)n[
1,666,300,053 *AF58AB4D3DEF7218827232F7049ACF223D6993B2 POLENDISKURS
1,666,300,054 *AF557475EB4851F6B654D8FBC1CD061E4B3FADB6 3:..3..#..&...troubleshooting
1,666,300,055 *AF5AD47D5DF1EB250708212C7BE6D01A75C9E8E4 340786 OTANIEMI-1983-16-:-FAGERHOLM-,-NILS-ERIK-&-SIRKI
1,666,300,056 *AF50C14C537FE4561BB607C60B35B013DC48911C PORTSMOUTH-DIO.ORG.U
1,666,300,057 *AF58CBD3AE85DFA596059EEC599D3910EE3BF548 POTENZIALED
1,666,300,058 *AF585C1D5A66473823D814A899DE8D7904CD8819 P-----P `~ `~ (>-<)
1,666,300,059 *AF54EB4DFB3F4F88BAC87EC9D81ADB1610817474 P====P~.`.}O{
1,666,300,060 *AF52F8C0384862C9AA91DBE273775F04B8CEB5C6 predominanceofaquarius
1,666,300,061 *AF5A3B22372D6574C02B0D63ADE14D6870E70C98 PREINDUCE4
1,666,300,062 *AF5486D0C10CF17773E1DBCAD8157916A33D2B8A 3P~ ~ ~}O{
1,666,300,063 *AF521CB5661900B3A3536D24C7781D8FD93AB5B9 PUKËS、英語:PUKË
1,666,300,064 *AF589ABE236490BD8E1A9DAF791FCF68409412F7 4CAINGANG
1,666,300,065 *AF564F85CDFB555DC83270D1F49D6B5AA4811C2E 4KRDUQNUI
1,666,300,066 *AF56DC52C5AB4F15E3084E1C416214EDF264B314 4LRAHCAS
1,666,300,067 *AF5A2EC372329D06D3C1A330267BB9B0942A6E87 4MUPFIGER
1,666,300,068 *AF550A107A8A6F64C152E723D050AB57E6DA6D53 4NIESNIES
1,666,300,069 *AF5BDAC035F027661A90B1D612AF7F46ECDFDFB2 4NOITASINALEM
1,666,300,070 *AF584D5932DEF3ADBE64DBEAE7924DBA22A7F5A1 Q===P-`SPLAT!!
1,666,300,071 *AF5E230F31323384279CE7030FA1C1067C0D0B22 4QSTEVEN
1,666,300,072 *AF50EBFDD331EB76BBB6DA694E62763FC14A922E 4QUINHOV3IS
1,666,300,073 *AF580AEF8ACB502B8514C541D24CD171896D8AB4 4STNEICNA
1,666,300,074 *AF5ECC07A05C45FE77E2EF7E6FBC4E597AFC81C8 RaisingtheMammoth1,PartThree:Vertebrates(Track5)
1,666,300,075 *AF549B74B298AE813A53BC0E3FF5F0311B7E0B1C 4月からwahaha商店に所属。
1,666,300,076 *AF566221F7776192A9C357DCAAE5DB755D6B1F03 RAPHAELDIMARCO
1,666,300,077 *AF5D5478CE64A310919EC595B41DC46EBE491EF8 RAVINGSTYLE
1,666,300,078 *AF530BB51F7655ECA995133B1B15BC61E53A60DE RCEMBALONO.17INES-DUR,HOB.XVI:ES2:II.ANDANTE
1,666,300,079 *AF53731FFE32322DB7271F0D55CB6F381CA8468F 5EGIRAJDNEZIUD
1,666,300,080 *AF594CAC327F905EF039AFFD5CD3459733EB2D7A 5ilovexxx123
1,666,300,081 *AF51B95AF358DE4593075B72BEC4B05B83BD48C7 5kommunalwahlrechts
1,666,300,082 *AF5E96CE1CB7ADA1B0CD5F559CF9E0A5AAAEB052 REGEOGRAPHISCH4
1,666,300,083 *AF5F8F7367CC8EE4924E4B09165FE700AA53E9C2 5-ORANSSINPUNAINEN
1,666,300,084 *AF5E8DD98C93799DD78D32B73D1B96B97303B783 5STNEMEHCNARTER
1,666,300,085 *AF59B9F5126EF953AB853A0081B65062E8A488B9 5UBFIVND
1,666,300,086 *AF5B9D51BA6CBD3D623E6ED02F05D9F7A72DDE93 RESTAURANTJING
1,666,300,087 *AF53632AB03DC26AC0ABB9C42DE44133D57DAF95 5wathin9
1,666,300,088 *AF5D900BE225587CFC909D34F608FAB099F2A1AA RETARDRYAN
1,666,300,089 *AF512845B57F1E55DE1A8C2C152F6D32B54CC091 re-triggered
1,666,300,090 *AF527E23B52A40C401B5B2F5890FC01FDA323D1A 6BEANNAIGH
1,666,300,091 *AF5F25946B99E6F0E912B5CD6F2105C78FD81B74 R&"I
1,666,300,092 *AF5294E080DE071ACCBAD657451961E82C8D1F43 6CERENIQUE
1,666,300,093 *AF5D5BC8510A3DD0F5054640C5583FE18AEE5E1D 6.COBB
1,666,300,094 *AF5129331B986A9D9A446A0E628669F641E416CB RICHIE.OSHEY
1,666,300,095 *AF5DA8D8D162A2CE60174E56F72229B9CB92EC97 RICKEY-RAYFORD
1,666,300,096 *AF5852F6F01549D0FBF661F734DF9F25E580A42D [email protected]
1,666,300,097 *AF52D361D25BE4DEFEA250CF55489522E9A5E3FA RIOT LEAGUE
1,666,300,098 *AF560EC48B017DA0F0C097E6ED2A4EAF2FDC83DB 6MINOCHERHO
1,666,300,099 *AF55B35214339C146981277184C8493EB2915082 robovat0
1,666,300,100 *AF5E0EDBBC064A014E2FB5A6537C909259DD5650 6SSKOSTEN
1,666,300,101 *AF57B1F017BF2AD84CB435037AA2FCBF1E5D75D2 RODOLFO.DERUYTER
1,666,300,102 *AF5EE9EBDCAF676149DA411E2386DE60BFF0756F RODRIGO.HARDEGREE
1,666,300,103 *AF5C6B747DFD1259C50DC844BA6F08CD5ACFE93C RÖHRER
1,666,300,104 *AF5316F5446D8B19F2B34061BA84182198237495 6VAAKBSW
1,666,300,105 *AF570BD642C19007CE9E6C6932C2798039B83211 ROLLAND.GRESSMIRE
1,666,300,106 *AF5BDB5665F50C575332F412BC356C40F659251D ROMANIZZO2
1,666,300,107 *AF5220D03C65F1700C8BE5FDFD6CDDF34D15B67C ronalddashner
1,666,300,108 *AF54041FD0951B6465D333B02BDF1A9FC92DEAE7 ronny.jansen
1,666,300,109 *AF5DA74F971E4BE16457B4D0E02199C786FC40A3 RONNY.OLEJNICZAK
1,666,300,110 *AF54BE312840B02D488E81F2E4D5DC4D30B3DD67 roploch
1,666,300,111 *AF5EC9D6927BDA29959D01773ADF2D4DF8E5DF3C 7ANZANIER
1,666,300,112 *AF54878A061DDDB4EECDBD3990C76E6A2C260F53 7BSWLASTNAMESBSW
1,666,300,113 *AF5EEF1EE0D503EA8AAF3D592DA0E94FC293B19D RREMIULS8
1,666,300,114 *AF5BE7DC5DD21AB889C40C755DF1850E51888BB7 RUDOLPHARROCHA
1,666,300,115 *AF5BF5483E3D9FB90FB203D8A78F051071B6B186 7ILOVESCOOBY5
1,666,300,116 *AF5A3F635C14F1BC5865DF87FBB86B7779CB9A66 7NHJORTEN
1,666,300,117 *AF5AF6270C80D447120D5D8AF31D2354C87A72D0 7-pakkosy
1,666,300,118 *AF509F831591D0499A9FF31A90130AADA6A83119 7PRATTARP
1,666,300,119 *AF58176FF0FBBFD9D8D47FF757083E6CD74FD1C5 7PROFITTAVAMO
1,666,300,120 *AF5476564192B94C0BC6331CA7DCAA3AD5554B5D SA
1,666,300,121 *AF564D3453352061574E06FA12E96C499C58541A 7 TOBRUK
1,666,300,122 *AF5BD59F9A86B7001E67022D6FD4ADC826E88705 7TUFFAVA
1,666,300,123 *AF5CC075EFD6817E1AD34ADCA55BA6CFD0332C5E SALLY.TIE
1,666,300,124 *AF54AE1A1DAD60770FE4FD0CF3A6D5AB70584856 SALTHIE
1,666,300,125 *AF577278C430B2020BE20BB450DE7DFB77084579 7WECHSELSEITIG
1,666,300,126 *AF516D62275BFCDDD18F658DA942C76C4518CC8F 877661 (aksaray)6197aksaraybedenegitimvesporyo
1,666,300,127 *AF5ECB8F727363457ED4085C6BEE58DDBFF61DE6 SANGRIA
1,666,300,128 *AF5A19D54700D7AB308742B1023463253DECA161 SCAFFO1D
1,666,300,129 *AF5FB9840D025CCC04EAF3B4BED89C59C4D2A65E 8iamamber7
1,666,300,130 *AF54C20FF7C8EA9582664EF51CFC10B20BE9B72F 8MOSQUEASE
1,666,300,131 *AF5D018D92123106CFCF3563CE6ADF3C956F784E 8RADHAKRISH
1,666,300,132 *AF5BE18E5230CCD458FCC2446163E3BF037AAAB5 8RTRGRSSD
1,666,300,133 *AF545A9B1E704A30431D333675858F4C0038E1E3 SELLABLE
1,666,300,134 *AF5FB9A21B8F97870598D5AA5D4FE0A551024E2B semifriable
1,666,300,135 *AF580569B857A3AB7D65736BDE4FF349FBC812FC 8TSKJIREDER
1,666,300,136 *AF54D1939AB21F7DBF211363945AD6173D0A1DD2 SERAFFISCHEN
1,666,300,137 *AF56D06FED01522C52394CF75F5EA89E4F81F163 8viziarono
1,666,300,138 *AF5EC8C80196EFABF3CA81F771646CB279F851DE 8VOLTAIRIANS
1,666,300,139 *AF52307A08DACA159B6D1FC36DEF6001B87174BA seta.de.olivo
1,666,300,140 *AF581C08395F8849C8B33DE70B1D88FA1135050F 9a6e02fc7ba83ffabe28f7e1b3a65436
1,666,300,141 *AF5B5A8303ABED1025FA6FB1CD1CFC73E9DF386E 9AIRRAID
1,666,300,142 *AF539FFB3D25242FC4AD4EAB78015EA01963C4DF 9ATTILABARNEY
1,666,300,143 *AF54D422D7C7D62B3BE14DC3923D70F840BCF0D8 9FIGURABILITIES
1,666,300,144 *AF51C771C10CE95ACAA9BAF843B4CFB64F5432B3 sex.linkage
1,666,300,145 *AF5195A13F8C6838D22D569E014066256DA9DB26 shalier
1,666,300,146 *AF5F76FE5942A14E1DDADD21CAC68CE1961A7930 [email protected]
1,666,300,147 *AF55E5A42B7DD099C604322167BB1D56A3208FFE SHELTONELBERSON
1,666,300,148 *AF552F20A2E36233114A2C4F23144000F22D6187 SHELTONENDRESON
1,666,300,149 *AF50D92EB3D7CC1ACA60A188382508C9F645404E 9SUKKYONG
1,666,300,150 *AF5F76F83EECA77B3DE5E1C1F7C3F8F15394F00A 9SUNSHINEARTHUR
1,666,300,151 *AF501FC798DE7723EEE294FED085FA1529D0DAD6 9SVENTAVA
1,666,300,152 *AF566B2E21B82CA86F9468F2CB236A8629A6FE69 [email protected]
1,666,300,153 *AF5F46334BBD573D0E97792346DA4FC12951066C 9THERESACHELSEA
1,666,300,154 *AF56350A24B0CC32A662A25704DC29644864AB83 A1G,
1,666,300,155 *AF525D4E30FD1C5044F442BF5DBE942FF38861BE SIINTELISI5
1,666,300,156 *AF5EC33E23B8F8A19FADC274F59C8C3871E63F04 SIOESTA
1,666,300,157 *AF583875F74FFD756F673B36A89CE03ED7EACB1D a87j
1,666,300,158 *AF566A4BE2035BB4838B7B7E9512A7DF94EBB70E AAR$T
1,666,300,159 *AF5B4D3C21A00EA1AE668AD7640DC96053704429 SO ODER SO
1,666,300,160 *AF54D4D794CBA5FDB6E60B6507A7B0ECAA5E6AA7 aff3a
1,666,300,161 *AF5A7D95C7EB11E3A83608BAA3F7B279F58A00FE steuerjahr
1,666,300,162 *AF59DC5C1599CB3814E14C336BDE5E51C007568A STOCKP1N9
1,666,300,163 *AF51783574C9D0155F9E308DFF9D298F589D11A5 STU BROOK
1,666,300,164 *AF52CA70603996BB72B5FDA78999221673D75959 al2ea
1,666,300,165 *AF529088D3E76460DA5C541AEBF5BE03FE4A3B84 ALBISRIEDEN04
1,666,300,166 *AF53A0D6FFDEB245B62A64276F692565A0DC6126 [email protected]
1,666,300,167 *AF54266262859631744E19908E2392D215D745B7 SULTANSSOHN
1,666,300,168 *AF57E458402A6D967BB6A04967B77D331038F2A4 ALIBELMONTE
1,666,300,169 *AF56B183A3A28EC609FC1E0CB53FEA7B7C4C7A41 [email protected]
1,666,300,170 *AF5D9916DA64192F41A7B232E453074A6D61BC9D SUNSETUMIT
1,666,300,171 *AF59F16EBBBF66A9704F0687C371F61112A64AA2 SUPIJAHT3
1,666,300,172 *AF595A23A5D1D3088B31F8FD70072120E582319B ALU
1,666,300,173 *AF50B0580FDEA005BEE9E0AC79B878A2FBD9E0DD swagerty1
1,666,300,174 *AF56BA7269DA0486863A5629401FFA4E167A8E41 amber-sharma
1,666,300,175 *AF591FE0305F71D1079BA169D0D0D7C24900219D AMHPR
1,666,300,176 *AF5BD8E717918161F82A7B1DE451F54A206CA133 ANDREASDEPROSPERO
1,666,300,177 *AF51AAEA9044C870D41A844C6107A7D23959BB60 ANDRESKUES
1,666,300,178 *AF5892EDE79AC1FA97CB27B06940DEDEADB1FAB4 ANDY.MORETON
1,666,300,179 *AF599F6E4B8E8788EE068CCDEC0C25CD0AC6FBC5 ANSIEDELUNGSPNNKTE
1,666,300,180 *AF53836BB65A4B9DB221273D043A759F67910EDD TALKNONAME1191
1,666,300,181 *AF5DCA8B5D6F63B5F0036AE9725DA9054BFEF250 ANTIDIVORZISTI
1,666,300,182 *AF56721150CB7FEA4389743E56E79C366FFA255B TANIA SIBLEY
1,666,300,183 *AF591E88F43DB4C2748A7B8543C2B699C7C24C9A antq&
1,666,300,184 *AF563AE03687989988C3D149ABBEA78BA631A27A TANYA CUMMINS
1,666,300,185 *AF59310C5A7D11BE58F3BEADDCD7A62AF18326E8 TASTE-IT-(YOUTH-12"-MIX)
1,666,300,186 *AF5DB10AC1E3E5FBE8773933CA79DD1903BB5DF1 aopn
1,666,300,187 *AF516C7568B54C9D6A386DF5F6BFEABE43587551 ARMANDO.MUSSMAN
1,666,300,188 *AF52E45D232E0187E65F502EDA7A361A3244AD07 arronfencl
1,666,300,189 *AF59B099B7C16B3FD24D9768520078FE2C2331E6 ARTURO.MCARTOR
1,666,300,190 *AF5AFF4C86BC5650810D84D312B9AA1522B8CEB7 a,r_v
1,666,300,191 *AF5AA875C0F2CFD1FB627F4A48256C596171E9BD THALAMI
1,666,300,192 *AF55B23DEB3C248EA729488C45E86F1DB4B17294 THEPOWER(POWERHOUSEMIX)
1,666,300,193 *AF528D79D71F8F065642700027EF4C9B46574B62 thiruveedhi
1,666,300,194 *AF54538788DC4F91B9C696C9265266070A55EBF4 tiffanygolfer
1,666,300,195 *AF508BD71CF4DDF364531799D63EE2D143639117 augustdreams
1,666,300,196 *AF512988C967A4B1DF251F50EFA84700EEB88D3D todd-budnik
1,666,300,197 *AF547E931D1B07B7B4A2FF4F8631637022F94B7B AVASILOUDIS
1,666,300,198 *AF597840E1918F9B7F095BD44B2110334F741EBE a:vf
1,666,300,199 *AF59F64C0BEE958A41F9B9DC75852A18A05833EC TOMOKIOKAYAMA
1,666,300,200 *AF56123DF2CEFF64F192CF49390E1D7C755A9C5F tranzy state of mind (original mix)
1,666,300,201 *AF5AFAD4FFF0D2B46390BC3523C353FECBE8E580 >B0~QP
1,666,300,202 *AF5CBCDC96434FCA1E654DECED16D2C8D51C0DAC b1dw%
1,666,300,203 *AF5E27EAD201A49E555645D9A3B8F706884226CE b9+/4
1,666,300,204 *AF5E328A82028B8C1B7DDD64FDED6CD9ECBCBFCD b9otn
1,666,300,205 *AF556A8AC264ED3D79BCD73DBEA078E1EC50D45F bangladeshnazrulsenanazrulsenaschool
1,666,300,206 *AF5D4E2B518BF95260E5392BF98590340478B42A TYSKORS
1,666,300,207 *AF53FC64DF29BDD6C8A6B04C66B181BFE974FD71 BATOUL.MANSOUR
1,666,300,208 *AF536D44F90D5B193D38B249954F6B3D3D1BB545 UAMATON7
1,666,300,209 *AF51B93636DA048DAE46EB538A4CFB4E12A423F2 UCCO-LLI
1,666,300,210 *AF5EBE8DBFB2852D7541B667002CDB632A88D6E0 UGWS
1,666,300,211 *AF5892C439C89FB56FB3DB2E73A955A8415995B5 B_C4
1,666,300,212 *AF5F0568577D3EDAFE939F9CE234C4F664CFF273 [email protected]
1,666,300,213 *AF55C7ECF263C0A89B5E9E4902575851F3A84029 UNIPEDS5
1,666,300,214 *AF595B76708ED4525AE3FD1B60653297CA240C50 [email protected]
1,666,300,215 *AF573E3A156C5AFC4DB83641F4012A377329CBAC bdr:h
1,666,300,216 *AF5CA27549A11A976295373FA09A8B1EBBF92758 BEBO8381
1,666,300,217 *AF5C6E3F56B65B61FE970697011122D53B17ADC3 beggerstaff10
1,666,300,218 *AF5239D7C032A2F2EF98A49DA19688DF9B2FA433 bei)k
1,666,300,219 *AF5DD68D475B85AE5DC36F6D402BD6F45DB8A43C benitopolan
1,666,300,220 *AF5F3D210804698B4BBE5E726BA2DE0C9620E4CE varsinaisista
1,666,300,221 *AF5414EEC66525E9EDA46B720EF0E2DE19154015 [email protected]
1,666,300,222 *AF5791982E823E66FA3D8E8B75D9154E5093E9C9 BF?N8
1,666,300,223 *AF5FAF05B98D966AF973A20691A45C3FAA59F25F victoreshleman
1,666,300,224 *AF559250860A3887756B6FA37CD2BD1ADC555C42 victormcday
1,666,300,225 *AF53254F60E46A89115CB524495378659F275B62 BIURAKAN
1,666,300,226 *AF589B9768EA234F193B028C3392A442B24E4E1D viiprovin
1,666,300,227 *AF59A8458BEBC3859E6D1A44F968CA2BEA948896 VILLISILMÄISELLÄ
1,666,300,228 *AF50A1AC08B0D91C15E9DC4A6B228CBE3EDAD44C bloa;
1,666,300,229 *AF5DD243CF519BD82BF6F22001505A605669FDCE BOBBY.GREVER
1,666,300,230 *AF5FA8D8998CD054CAA5CEF4F14E2E8415A403D6 BOBBYKELSOE
1,666,300,231 *AF5B801BF9BD75F7D2F291AC6DAFD9C863DF4C38 vinzyznev
1,666,300,232 *AF568689E7C7DEB0850113EEE11BAF528F8CC9B6 BOIMO
1,666,300,233 *AF5574E9BF4274250AB23D8C6C6039F481044975 vpcom
1,666,300,234 *AF59D0CCFFB9B92FAF17CD178C86FD88BA2921E6 bo!xh
1,666,300,235 *AF5E4FEFC6B6C6A6A71592696B4779462D698ECB VtiNplazasdetoros
1,666,300,236 *AF59CECBFF49B24432B14AD2802B3DC6F1DC804C VUONGCANH
1,666,300,237 *AF5277FF940AC2F1E8C907B7B6DD3ACD56236FC0 bqcu
1,666,300,238 *AF5B1BE6FDC934B04D79A2F503BAB30C13BD5FB7 BQ&W_
1,666,300,239 *AF5F73D435235D41510B74356569FDCA7BD1305C BRANDONDUNAVANT
1,666,300,240 *AF521EF0EB29AC6D41FFBA4FDAE8797667BAD25C BRBH
1,666,300,241 *AF51DB5C84FCAF5A3631725DC5F10E1240B574C3 walterpeevey
1,666,300,242 *AF557293B1030B0BE38DB15FF5C2131C1E370BAB WANABSW0
1,666,300,243 *AF504C9953CF2A9FB7143451D1EA3F82502BF386 WARSKOU
1,666,300,244 *AF58000250C308E3FA2E79A2B6D098F3D32E2970 bt:go
1,666,300,245 *AF5A82D16DF5C3D8866B5869BEFC47256126324F WHEELO.SO
1,666,300,246 *AF56F497AFE00457AA5273E05EFA12CA8D2631F9 wilbertbertone
1,666,300,247 *AF53C43098EC279133416196BE70846293B1CF75 WILLEYWILLSON
1,666,300,248 *AF552A47050FCF97DB00789C8836CE2C8AF6613E WILLIAM.FRELITZ
1,666,300,249 *AF5F736C0C3619BC507DD2AC02E40FE231DA0613 WILLIAMGSTOUFFER
1,666,300,250 *AF59152757188943C06F50676598FA0FD465C03E WILLIAMSSTAGNITTO
1,666,300,251 *AF58A191D649B0B77D5DB62E29A345066596B95B WILLIAN.MCGWIN
1,666,300,252 *AF55310E8644513C67755C2A3F1AD397AF7180C4 c5k"l
1,666,300,253 *AF552BDB079FCBA763206E05072D10B40D735DB0 C#8,R
1,666,300,254 *AF5D3AB573A29B1CE0566F3E685DD656357232EE WINDÓZRÓL
1,666,300,255 *AF5DCFF84490346D3713F11CB4743C21831C5FE8 [email protected]
1,666,300,256 *AF571FFCDE9E831AA692FF0C3B5E9A49E290E2A2 CALEBHIPPO
1,666,300,257 *AF5B119D5F3B9DDE1B7B571CC282A47A53738D80 calmart's(2)..k.ae1.l.m.aa2.r.t.s
1,666,300,258 *AF5C3E8EF9701D43150F5C1FF4D021D21137A0B4 WITHGANG8
1,666,300,259 *AF5FBD75653B41031973A5AE58EC6771893057FA [email protected]
1,666,300,260 *AF58D1897F96E2016D7558DE4A9DCD736026C8EB cankovi
1,666,300,261 *AF5E9A55445BAFCD6A8A44FFFD446A464068EA79 WORKS!
1,666,300,262 *AF505E34F2D6EA3E2EF09F1F40FBBB21032B1DC9 [email protected]
1,666,300,263 *AF545391C8E16786C84A8C10FAF312F953D80192 c,azl
1,666,300,264 *AF5453E4C179BE1F5BBED3E510962C77D4F3B6F4 CB.IG
1,666,300,265 *AF5BB68F2E991A84E57B0DEA3E6BD69303D3539E CCDJ
1,666,300,266 *AF56BE95E0D7AFA367FD1F410D6269E95FD31DCD CDEBS
1,666,300,267 *AF5BC1D07CA7DC802D438340DD53A3C97EB71258 c!fg
1,666,300,268 *AF591D89501F53F447F97B55C05731616547FD4A WWY:
1,666,300,269 *AF5628D99EA07AFD85284C2123A8B5D31F7D1601 cgwb=
1,666,300,270 *AF5BDE43260EE4D07B76EA1E4FA7ED0868C71E2D CH7ZN
1,666,300,271 *AF51399609A17248FC8B7DA1E33F5261AB52BF46 CHARLIE-UPTON
1,666,300,272 *AF54AA423111BB0B91B4CCA90011B2D89C0A0CAF ch#c,
1,666,300,273 *AF5D23B8E0900C4BE469C431C4F41289A2EF53B0 [email protected]
1,666,300,274 *AF5051713455619A246182582F89AC411A7E138D childhoodmemories:tag
1,666,300,275 *AF58F2595609E13F6E0BF49B8BF573C6506CD069 [email protected]
1,666,300,276 *AF56E4768DAF86B51D7633DA4D9B82EBC5F440AB XV*>
1,666,300,277 *AF57CC7901753251A0841F5B0FF71977123C45CE CHMSPHRC7
1,666,300,278 *AF5D73AE082510DA6D1C208288D7E54A7CE840AC CHOCOLATEPHILLY(FEAT.MJG)
1,666,300,279 *AF5F91F764443108972E1B26F8D942EA5947B0EA CJKF9
1,666,300,280 *AF5BCA75BB1090FF5996BA079FA7593152B32487 YADDANAPUDIMADHAV
1,666,300,281 *AF5267150FD78A70197FFB1775DD5008043822FE YAHIM-JOHNSON
1,666,300,282 *AF5F15AD56B5798DA9B728866662E11074D7C294 YALEXIS-GIRON
1,666,300,283 *AF5B2444A9CE2FC27F1C6EAB6E4728112EFFE0EF [email protected]
1,666,300,284 *AF56982F59B43AEEFC851C8F598D33E2ACD623B2 [email protected]
1,666,300,285 *AF53B72BC9243E39B045DD8F782947D9725658D4 claybeardmore
1,666,300,286 *AF5F0FACAABDBA7062C816185B24E1555FE8A75F CLAYOROPEZA
1,666,300,287 *AF50CA7CEC8E90EACE95FBABD8182251E9E0B17A CLEODEFFENBAUGH
1,666,300,288 *AF58F50DCEA2ADDABA0741B71C039CF00491A59C cletusmcnell
1,666,300,289 *AF5E5D24F68CD0905D9CB04898058BF2C926CF41 [email protected]
1,666,300,290 *AF57AAC817CF1F58AA592C66F0B8F9D5455F2EA9 clintgalam
1,666,300,291 *AF5495FD5918262DEB5A39A12FB3DF9B3BBAE545 clintonbrackley
1,666,300,292 *AF522F7B9A0DA5EDC5E19000994B8CB9E70D2128 YMHEEIBARRA
1,666,300,293 *AF52029DC0307C4209827DB84C46BD8AD97F42B7 You.Can't.Take.That.Away
1,666,300,294 *AF5CDEFEAEA181C81DB98FC67CB7C4A3BD4278FF YOUYUT
1,666,300,295 *AF59BE4FA1EFD74DB3EE5A517B3ECEEFB7CB81FD CNLI.2.0
1,666,300,296 *AF5E9954F47FFB1208CF494AE876BE2DFFF6E3C7 CN.MCAFEE.COMCN
1,666,300,297 *AF513330AE370AF88811D76AB65C372BAD0EB0D5 c.o%)
1,666,300,298 *AF503043A1BE70C644373CD4DD682EF6F9C1B695 compelesa | spain
1,666,300,299 *AF50FC68DE76935DD79FB5FB6C81297B908D8DC8 [email protected]
1,666,300,300 *AF56E7A8113B4BF646EB209C87E86B1583872FCE yuth.songsamor
1,666,300,301 *AF51472C1185B9E43D9ED306A755316FA19EB647 zabtshorta
1,666,300,302 *AF5184192CCEE6C1E35D97F8EEB4E70F6323FA0F ZCIWOPRAK.2
1,666,300,303 *AF5F684E4EE5441AEECF07111E6735DDC54809D8 CONISIO
1,666,300,304 *AF57810865A8BEC806CC15AA0F4516E7E6BE8AA9 [email protected]
1,666,300,305 *AF5F7C56ADA8E9C1D59AE856D982386C6B18F614 [email protected]
1,666,300,306 *AF54B79CC9C7B8CA97111834220C3798D8E67B8F CORTADAS8
1,666,300,307 *AF51716954AB3C1F87E76ABFBECAA990A08687B4 COSTOCLAVICULARS
1,666,300,308 *AF58A985ABEC61A472E3B08B81A977214F604C07 zoe-neen
1,666,300,309 *AF5EC48A47359C18135D36A650E48DB0733B3C31 C~)P
1,666,300,310 *AF5C2BE9576D0FA23A8011B20F19DAB487377502 [email protected]
1,666,300,311 *AF5C36DA7A2F7613FCDFF1CF12DE50F083C78DDF ztxq5gtdrbr3xi
1,666,300,312 *AF5BB989BC26969137B0AFC8173F5698E7F27EC2 μιρτσέκης
1,666,300,313 *AF590A5D481C332D088555E2C189A8E3E960331E БЛЕЗЕРУ
1,666,300,314 *AF5A72EDCCBB3A3F35FFC47A46E2D82B275098A5 cydo
1,666,300,315 *AF59C2D370B3419E567F6638A0532A22D9B68C98 cz1+d
1,666,300,316 *AF5A3B9B9CD8F762C2EDE194C604149BCCD31EBC D1KEU
1,666,300,317 *AF565D952EA05E2DFFBC1BBE2FAF705CC8C8D466 D3(KD
1,666,300,318 *AF5D6C0672B932E7C24224B5020E5FDF3D8AB900 dachpappfabrik
1,666,300,319 *AF53402C3E8D1298CBB29C4C398D24A3D50CE9AA [email protected]
1,666,300,320 *AF55022EF78B0D9D1E9DA5DE8982D41556BA6006 DANNYWEIDE
1,666,300,321 *AF537E9C4019B1FD9F1607FA8174DC90690E9F73 DANONEDANONE2000
1,666,300,322 *AF5AA480A5543AB33FAC9D96E6CB5B25761F2601 DAREMO:LAUREN
1,666,300,323 *AF5A89D77F99CDC9C74706EB3261324D30BC93BE DARWINSEIGLER
1,666,300,324 *AF5A06E916300CA32EB2D7248C0E24737C879799 dasnb
1,666,300,325 *AF5AD8EF633C24F8804220A54C1F65D2FBB546EA defected-clubland-adventures:-10-years-in-the-house
1,666,300,326 *AF585DEDECAC29B0A962E02CC3A758EC215263B4 del!v
1,666,300,327 *AF544904E3D2564C381C337B2FBE5D0419AABB0D [email protected]
1,666,300,328 *AF593BF5F5EA328AFD9364BC429AA406F480FB30 独自のアルミホイール製造方法に「MATプロセス」がある。これは、
1,666,300,329 *AF527C5D7FC149A87F44603FCC9C7B73C01D19E5 DENOTAREMING
1,666,300,330 *AF5C30A26C48EE14933CB078CBBD6D24E735DB71 DEPLUME
1,666,300,331 *AF5650632F824EFEDB445AFCB60D9AEC424006AE DEXTER.TILTON
1,666,300,332 *AF50FF2C155C1D574AAA3316A9BCF11588A00961 DF41J
1,666,300,333 *AF50DA6C51C206D03E8B8D62B67C5BD78F1B5028 d;+i
1,666,300,334 *AF5E77E8B771464BD0132F167F1B0F2D648E7D7C DIRTY_LOOK-'D/[@]/RT/I/_L/U/K
1,666,300,335 *AF54D51DE2937AC1A3B2ED4D773F931EEE964BD0 DI-SK8 EU VOU
1,666,300,336 *AF5B5674CF9E5E319B265860199F2B2F3B70E3B1 1020887 jumalan-rakkaus-on-siin
1,666,300,337 *AF5B970FE3CC929ADC76CC05DD0E1960204BF3BE 102249 ne teki kurssista erilaisen ja mielenkiintoisen . n
1,666,300,338 *AF559EBD52B229B06FA1FA2B4E1EF5DC6B40FE64 dne=w
1,666,300,339 *AF57970CD4F40179135BDCBF44C1FACAAA8D11BF 1041461 UNTER-IHM-:-EINE-KARTE-DES-NAHEN-UND-MITTLEREN-OSTENS-
1,666,300,340 *AF534667359AEDF921CB3571C08A4B6D00A56863 105CMDECKGESCH
1,666,300,341 *AF529A40C84A7973BCA5C46FE043FD6687FF8C02 1113541 mist
1,666,300,342 *AF580F1F335DF8DB89B0A199F83ADC8CBCFE7E75 112204 HARVALLA KILPAILUPAIKALLA ON TARJOTA V
1,666,300,343 *AF573CB4DF81D9BF967C57504278E83776036354 1132237 ON KUITENKIN MUISTETTAVA , ETT
1,666,300,344 *AF5CD14D1D7085CDDD1A05C7AC648C435992000E DOGGYBANANA
1,666,300,345 *AF57BAEFE1AD60651CB29C8A657463F9976098EE [email protected]
1,666,300,346 *AF5972260783421D9B6E8D2A0B53B66155402DE9 dopegirl904
1,666,300,347 *AF579A0A472BB3A6B92A9AA9B6662A3B7B7ED61C dorgmoth
1,666,300,348 *AF55A85A35C1C5D6CA9F8930B2050D8087C8AD7D DOUFALA0
1,666,300,349 *AF579F8A22E31FFF470A102B9254FD3CAE082FE3 DP8SL
1,666,300,350 *AF55BB8C22C5BE964B7292FCCA83D900B6A9B162 12PALJOLTA
1,666,300,351 *AF597EACFC57FD41A018BE66D3E630C554507FD0 dqkh
1,666,300,352 *AF556A2B9D7D8CD06B3B3CF910F8121691123B3B 142153 `-OKULONCESI-EGITIMDE-OKUL-AILE-ISBIRLIGI-'-
1,666,300,353 *AF53A56073A2B425DCB78E36C0DADE45F728ADF3 1424566 ALSSIEZUMPUBZURUECKKAM,WARCARMENVERSCHWUNDEN
1,666,300,354 *AF552D3C08888FA6A2FCDFC9F9303FD5426F6AFF DRSMEETH
1,666,300,355 *AF5CCF31E990C1C549F1D733319ACB3B7DFE79DF DRUG-STORE-WOMEN
1,666,300,356 *AF58D4AE2DE18DD416553E65066C86B405CBA154 1625573 urheilullinen-tausta---olen-tehnyt-el
1,666,300,357 *AF5B0BA9573D6875A4B07A713E11F46CFFC54E75 1692620 supistukset.huomioiden.oli.k
1,666,300,358 *AF5FE75A7BD4D4864E118862AEA52B3D6D779B32 16feb1009
1,666,300,359 *AF559AFA8F27480F960207236D9ECD4ED5109A6E DSTUDDE
1,666,300,360 *AF58A59FAC0D0E70E7EC7F97BD3D5CFEC22109FE D?TEY
1,666,300,361 *AF5F1820E76716413891B98DF9C6AC5AD79F1650 DUANELUANGAMATH
1,666,300,362 *AF53E6E46552D8136205BB628F5A20B14D97D0FD D:ui
1,666,300,363 *AF5BCEA222C4A63DE280D8360BBBB1E8D00CD65B D=UUL
1,666,300,364 *AF59943CDC654189AFDEA2B317E22224388712B2 DWZ7N
1,666,300,365 *AF58E9675AD62C3D9F210A0C6CBD76FE179FB086 dxv-x
1,666,300,366 *AF570193A1634F3F4E58F5BA8729B954C3643330 dzee
1,666,300,367 *AF53B9078B17A709FE166E3AB3B14234896FE1A6 EASECHINESE
1,666,300,368 *AF548B6A7EB4C22C943B3F53C18056BDD3A5B0C8 eb(dg
1,666,300,369 *AF53B05537E3DEA4288DDE696E8C82EC6BF74F7E ECKLOSER1
1,666,300,370 *AF54998F734C35F6542D961076C591C30D7DD587 [email protected]
1,666,300,371 *AF55375B17482A23609E930D43EF7E786054F04D edimam
1,666,300,372 *AF568AFDE875EC7F790F19C2D9217A7250861561 1HOCHSCHUL-ZEITUNGEN
1,666,300,373 *AF5E7358568D049C0CFC7832F2F6461CCA1F064A EDMUNDOURSO
1,666,300,374 *AF59FB83A2F9488611D1B8B9B0A2BC9B374D4FBA EDMUND.PARTIS
1,666,300,375 *AF5655414F6C82CE509BE1596634BFCB7C225F28 1KUSKY
1,666,300,376 *AF5BDA51D1D14BB4EACF4F9367FBC976340450D2 1LISATEUR
1,666,300,377 *AF5017254633872F17A45C2FEAE15E7A5203E6CB 1.LUUDILLA
1,666,300,378 *AF55A96326E4E536C80A60A7C8F7E2AFBF59E034 1.marketingoffensive
1,666,300,379 *AF5EEB956864B67B63DF0EBFFAC5669F3C3533BE EEBA
1,666,300,380 *AF591FE8A3D02530778B8FCC96C9BA2E020E5B3A EFREN.SAMIEC
1,666,300,381 *AF512410FD98EC7659CD2B25ADB2D692A5133155 1SENSIBILIUM
1,666,300,382 *AF5F94204C05FC68988E0EB0B3F85079A84817B0 1.share-placing
1,666,300,383 *AF5D28527A854999AF31029B88E105E5EC48481C 1.SOTILASNIMESS
1,666,300,384 *AF5B021DD972A99F586B3BF9191F46FC3C9A1728 1-STARSCHWIERIGKEITEN
1,666,300,385 *AF528079D1E98D12ACBE3EEC1608239F821B3F70 1.syytteist
1,666,300,386 *AF507E5B50C2906ED44EE510D9C27FE256CBB340 1-tulivesi-toimintaelokuvan
1,666,300,387 *AF5E6D5C995542A96B41E856F6C216E8A01BFD84 EITH
1,666,300,388 *AF5ADDC09E67483CF1ACF1763A8F3BCF54BF54B1 eldenpeasant
1,666,300,389 *AF58EABF0BDC0C2153D562AB3FC1651633A00391 2032567 MUUTOS.MERKITSEE.POSITIIVISTA.KEHITTYMIST
1,666,300,390 *AF58B41EEFFC5E5D51B615B16C8C432C09ACEB97 2077218 UNIONINRAKENTAMINENSUURVALTA-BLOKIKSISYNNYTT
1,666,300,391 *AF5C0604C69A5E9D27C9FA42D4E5B31B2350A6E2 elevester6
1,666,300,392 *AF50CF5C4A585A6D3A23A0A00DCA66B6ECBD9862 ELIASDEPIERRE
1,666,300,393 *AF5DFCAA4F3799697DE174DA07B883846293B9CC 2202205 ajanottajateiv
1,666,300,394 *AF5A823DF58AD141403715118843E4C90FC0B601 241129 YLI.TAIKKA.ALLE.,.SE.ON.YHDENTEKEV
1,666,300,395 *AF5DC8646A402BA2F95C4F8A5F0B7FB00B906C6E 2452672 VUODEN-ALUSTA-EDITAN-KIRJAPAINO--JA-LOMAKERYHM
1,666,300,396 *AF540EC249837DA6E8DAE1902B9C6704D7C3343A ELIZABETH-KENNY
1,666,300,397 *AF5F4EEB8A7E9F2C8DB486391CF518374F5F0E52 2639<ry.>
1,666,300,398 *AF5C9F3D6BD1C2D870F28E98C10BE92E84160A56 2755316 unitedisrequiredtobeginservicewithin90days.
1,666,300,399 *AF549511898A1E6E0E84E1D618F8CE3FBB8D75E0 ELTROVISTO
1,666,300,400 *AF50ED6B9F6D46068BD58DB3CC1351CDFA40F1E3 emanuelsocorro
1,666,300,401 *AF5E31F1FE292397D2BB819E7EFDBEC9EF201BBE 2936792 DLC7070-MLUKIJATVOIDAANYHDIST
1,666,300,402 *AF53D2745C5558A9A25BBB7F731E9E5A139E4515 2CFIJEFF
1,666,300,403 *AF58794A2ADCDCAD89F4EF22B9773A5E10593B20 2ehrenburg-tochter
1,666,300,404 *AF5ACB81CB50BF0EB92A2C90A458E9E71440541C Emphasizing-Family-Values
1,666,300,405 *AF51C69EB869BADEDBBC666E7163CD991E65BF6D empty-voiced
1,666,300,406 *AF548061190CA4801DCEFBBD20F0941F7843B73F 2kunniaasianamme
1,666,300,407 *AF54C849186E061B5B4E61BCA783521097EA8842 ENRIQUECOCCIA
1,666,300,408 *AF5E0D4E66AAF6019DC1433EBF1B83646C47729B 2 LEISTUNGSSPORTES
1,666,300,409 *AF598EE175D2B0F609C54963FA624D14F9FD250E ENRIQUEFRANTUM
1,666,300,410 *AF5158A97DBC40B2EDDCD1CA44D0187F27BF062D [email protected]
1,666,300,411 *AF57E70B4C12BB42026114C529EF23FC52F60F47 [email protected]
1,666,300,412 *AF50DCBD88F42AF408B7CFC307580510C5FBFA14 EPR0.
1,666,300,413 *AF57E7BE3511B79F8686BD852C1677DA9448258F er(dd
1,666,300,414 *AF5032ADB7DE87C232238DE4BC2D9015A659D5B4 ernievessar
1,666,300,415 *AF52B6CD9F973C64D5262466A0E088BE8C739E89 ERVIN.MCGRANT
1,666,300,416 *AF5DC633B2AC59045CA2399ABEA21901A866306A erwz&
1,666,300,417 *AF568595FE3AFEA0D6EDA02DD77E3D35B27B58A7 3DEGGAWGIW
1,666,300,418 *AF533BC7EBC59CB97A8A3C6D9DFF561299ED7648 ESZID
1,666,300,419 *AF5C25623347CD1F19F99271835824C55B60B8E7 euqnalacing
1,666,300,420 *AF5786C335FA315442D28BD9762AD525DCA6A0A2 420lexi
1,666,300,421 *AF5F632DD71A12E8C8758F53E2E09E948D471183 482ZXCVBN
1,666,300,422 *AF53C1CEE2363F6755546C3D768256A9DAFBDEBD 4CURPSNIE
1,666,300,423 *AF5FF206AB271FDFAB23292F38894DA371CE7591 evencea0
1,666,300,424 *AF59477F856BAFF93C4C975E0BB00EDA79A1D292 EXT.-WORLD'S-FAIR---LANDING-TOWER---NIGHT
1,666,300,425 *AF5B2E48D676BD8FCEEBF1787F500DA1CE400EC6 EYIPK
1,666,300,426 *AF543B3406548E223DC21752316973634605AB48 EZRA.LAMORA
1,666,300,427 *AF557BC4EE514E17BC246ADF1047D8CD160058D2 F4U1T-B10
1,666,300,428 *AF5ECE4F6614AAD6ADABE3E0BE53428F382192A1 4MONOZYGOTIC
1,666,300,429 *AF52F912D81B9827142DE68A134495F69FD0D9D1 fair-day
1,666,300,430 *AF5A0C53AE09EFCD9481EB72A342F45DA3903590 4REYNIRA
1,666,300,431 *AF581475DA2440C1FA5EE98F01FA0A1617642E50 4RUELKTNO
1,666,300,432 *AF5409C7CFC9224B5003950D748876BE460D7D9C 4SVOLTANTE
1,666,300,433 *AF5C283FEC2E215ED285B3B8FE61C2B7C766D97A 4.TROUTT
1,666,300,434 *AF58344399B9A1CE1DD1B40F7196C656ED7D3F90 4ZEIREHCNART
1,666,300,435 *AF5D6E070FA6DB80038767FE8CA5F30F86D4ABC2 FARHIBSWING
1,666,300,436 *AF5C3851D673CABB9430880F7FAB130670C36378 FEENTEMPEL
1,666,300,437 *AF57A9C13D743896749D701B4CABB343AE3AA4F3 FERDINAND.RIPLEY
1,666,300,438 *AF5FF9DD8F1018A27ECC8E3051D7D2E680510A33 583774 toimienhenkil
1,666,300,439 *AF57276B8D31E4F4165A0E4580BE9EA999DBDC37 FINVINICIBLE
1,666,300,440 *AF5F6536A4A654C74CE689A8DC827AF455C8C312 5ARMBIND
1,666,300,441 *AF5EB2421323327A6C7DFAEF2AF8CB02113E9DCE FLAGGRAPHIC22
1,666,300,442 *AF56B687CC13D60F1FC5838F1ED9A0EED14786D5 fobjclassnamematch
1,666,300,443 *AF527640E60F75D7C80F5790B3E4B9C710A6F864 ford-to-charge
1,666,300,444 *AF5D8AD2AE71FE77BD74545FF5BE922F5D128779 FORGEARD0
1,666,300,445 *AF5CC621BF5119B690EEC528C607687C6F11EB87 FORREST.LIEBHARDT
1,666,300,446 *AF5641D10DFE46FA4952A4AB5E5C3C9F4B826886 fossestina
1,666,300,447 *AF5A304CBA8088486CCC86EC09D0F75F34691586 FRANKLIN.CAZENAVE
1,666,300,448 *AF516BFDC1ED971CC72189E6B3BC2EF6B2CCCCE0 FREDDIE.LOTHRINGER
1,666,300,449 *AF507126979E8B27F4AD9E1A56D786E5FCE7CB99 5FILIBUSTERISMOS
1,666,300,450 *AF50C5EC7C39B06D4B3C70483699F0D71DF3E5E7 frimels-1-0
1,666,300,451 *AF505F27D0D5D889AB900B91629DC8C5C396DE9F frontal-lateral
1,666,300,452 *AF558B5AB5607BFCEDFDAD7D78DC74B63C6EDA01 5SHELBYMIRAGE
1,666,300,453 *AF55F602EEEB99B7C7BE11F1D68C4A30BFA9004E fuhque
1,666,300,454 *AF5BBCB6C9094DBF950E48F89607BD9A6D0CFEAF 5版から、ネットワーク越しのVMを管理するためのリモート接続機能が加わった。また、VNC
1,666,300,455 *AF51D12E945F77F4F6D4F2BFB0EE00FDA8AD6E50 [email protected]
1,666,300,456 *AF5FE99E7A43CF193A4405CC0A0B63E94C7F91E1 67.VERGUETUNGEN
1,666,300,457 *AF51F401B0C7D7A632CDB01D4C82FEB88CF7A944 692AZSXDC
1,666,300,458 *AF5FC3F9C5A58A6EE4D74D6218C4CE1E900EFCC6 6ANGOSCEREMMO
1,666,300,459 *AF54ED04532217B601952EFB358DF835435C6EFE GENAROSPALINGER
1,666,300,460 *AF5F60748F62C5B541E8B9BA741430FF21726F7F georgirs2
1,666,300,461 *AF5618962746CAE815BA2A46DBDB7BFC55C7D863 6DECLINAREI
1,666,300,462 *AF5DFDBAF13BB3E365AD40ACD8EC2FB00CA0FD18 6e44786363c869534898c53bdc465e4exl21lu
1,666,300,463 *AF555B089FA3B18C6ABFE4687A2A5192A7E3BF0D によるGFDL違反の虞。CF
1,666,300,464 *AF5367F4CB33E041DC45EBFC87CC464E94CE73C6 GIGARTINACEAE'S
1,666,300,465 *AF5772721455D088396F26C758B8DF835724F639 6iamfootball10
1,666,300,466 *AF5940A11391820555088FD3E3230C30749E8181 GIL.TOPE
1,666,300,467 *AF5662BA4622DDE27C7D52EF0D5EF0032F6A1C6D giuriate5
1,666,300,468 *AF544BAF2FB20ACE3FD716AAB031BA435B900C25 6MARIOTOPGUN
1,666,300,469 *AF5998050656710443DA9742815E38A3BB1FCD81 6NEWCRYSTAL
1,666,300,470 *AF5714D08B873F03E3A50B80B126A0044998FCCD 6orlando5
1,666,300,471 *AF5A45B292C91EFD20425C1215AAAA55115BB727 GOLF
1,666,300,472 *AF5A46A438DC72420DE169B9535E7F525C15AD1B 6THEFERRARI5
1,666,300,473 *AF5B928351C488471746B437AD1337814D2EF778 GR4CI3R4I3NT
1,666,300,474 *AF5BFB31FB2A3944180C0DC7A985359FAE24BF0A GREEN-MANALISHI-(SHORTENED-VERSION)
1,666,300,475 *AF5ECD1D3F902F43BB2A4FB1C0A0865E7A259CF7 GREGORY065
1,666,300,476 *AF538935C42555286A925C84AC511269C3243F34 GSHRISDALE
1,666,300,477 *AF5A7D8267152FE462BFD43AA62ED4DD410841FD 7APHURINE
1,666,300,478 *AF54761785AD54DB9DED7FE2314A815A66CBBF6B gudooru
1,666,300,479 *AF5EB381B10D5013A5A1AFE804CFAF313E34EC4F guindar9
1,666,300,480 *AF5EB410CDD976D521849F9FAB23B7B132069D2C 7EZUUYNUY
1,666,300,481 *AF579C7C388D93BFBCFED087C95BCE4011DE318F [email protected]
1,666,300,482 *AF57C8C486EF30E61622FF225671C320E894A2EF 7iluvtimothy1
1,666,300,483 *AF5D74CFBD554329AA23F97E525ADBAAEAE1C5FF HAI.KLAWITER
1,666,300,484 *AF53AFE84DB99736D513D97D488703C8D00AB172 7LOODVERF
1,666,300,485 *AF5CBA8C709BDF7B2C31EE14240A91C8C9A7A430 haiti-writer-stub
1,666,300,486 *AF56EA7B96B14494A9A83F4333001998A9F94EC3 [email protected]
1,666,300,487 *AF54C75D3CDBDF98308A5A1B090F10C6DCE84DB3 [email protected]
1,666,300,488 *AF515035EF22011BE9428FCA2AC9FBA53F33D25E 7R4N$9R3$$0R$
1,666,300,489 *AF53E3DDFD249E01929D577785AA139ADF77E0D8 7 RANKAISEMALLA
1,666,300,490 *AF53F39ACC5F1D0347A7516D6CB73A1D6B8F5A8D [email protected]
1,666,300,491 *AF5838ADB679904FCEAEA707FDF79FC3E9815B03 7SEDIGITATE
1,666,300,492 *AF53B7C51AB663FC98CCD7DBBD41EA71C38384A2 :8000系の再利用で、台枠がfs
1,666,300,493 *AF54D9111B34F2A15F81387E48D454ADA90B1317 [email protected],[email protected]
1,666,300,494 *AF51E6CA1DEE0DE09AF9854FE69DB180C3CA9760 HEATHOKIN
1,666,300,495 *AF55983E399F5AC67DA790DCD7E8D2EB716A7C99 85246NAT
1,666,300,496 *AF5FE1023B0D7F0C2A8464F66F609B2A1C83ECD9 8ANROPBARE
1,666,300,497 *AF5CEA4BBF6D09CFC9E4C81ECB134933B7D9F9D5 HEMMAHALLEN
1,666,300,498 *AF54BD8835F4417021A04A8B83B87A4DFC00D57A HENRDRIX
1,666,300,499 *AF54263ED175C307D24A5CE8A7FE860C7F064142 HEROMONOBOOKJS
1,666,300,500 *AF518C8E22B79070C459801120BCAE919DB6D29C HERSCHEL.BRICKNER
1,666,300,501 *AF5370CEA431377834DD9707C2BF5D9110498A3E hershellowhorn
1,666,300,502 *AF56520791008008F6999A2289975D67842DCADC 8CYRANOCONTROL
1,666,300,503 *AF573B9857622097F268678FDB814234BBF46938 8==D~0.splat
1,666,300,504 *AF56357F515ABAF32EEF10BA24DA2D19384E6CD5 HOBERTBARTYLLA
1,666,300,505 *AF5DC52C4E7B546C83DF3D496D4B74AC99A16931 HOBERTBURLANDO
1,666,300,506 *AF50118E0A37564C5F222E629FCB1D2A618FC5F8 hongaumich
1,666,300,507 *AF5A2658D076D668974108C98DF085444F28C85A 8TARGETHOTROD
1,666,300,508 *AF5752367730C022D194B26B2D63047F2BB872C9 HORACIO.ABOUSALEH
1,666,300,509 *AF5056B62F03E50D6F4E81607B8C5DAC6CA387FB 8TICENTLY
1,666,300,510 *AF58B2741EE2C8466B9BFF984E46D8DB4D75AF94 howimademymillions
1,666,300,511 *AF5176FAF2D7349B4BA6881858AA99C190E0DA2E hueylowenthal
1,666,300,512 *AF5B49743C4E997A82079A8833876A036BA847D9 [email protected]
1,666,300,513 *AF59B33221A6990CD34B6B9AEE64FFABBAD4F257 [email protected]
1,666,300,514 *AF54EB9D61C1D606F68A4940F1629C32CF8D3C20 9CDROMBBS
1,666,300,515 *AF55F1A541FE81F99B46602CDD23B8C359036A79 HUMPELS1
1,666,300,516 *AF502EE65A87FC5F852B45117AAAE6939E99DB78 IAMWILSON666
1,666,300,517 *AF55903A46AE25A2A7F8AFE5189F60B6EB2E18E5 9NEDNEBEB
1,666,300,518 *AF54332B9367AB144341CDC2F662EE208966C617 9ROZBOMBARDOVANIM
1,666,300,519 *AF5ECEF9A01BC907E6EB894C79125A39A611D3D1 9UNBICKER
1,666,300,520 *AF567BBB485CFBE9E12BCD6CDC4CCB7CDFD3D41C ilustr
1,666,300,521 *AF5231B2EFF888C576DEF91E0C959783937DF84F ILUVSHOTGUN9
1,666,300,522 *AF55FE603A15F4D8637256C7366121CA3C6DD449 IMAGE1202879062
1,666,300,523 *AF5DA32E0FA69B21F81900708607462549FA1631 IMAGEN21SVG
1,666,300,524 *AF588C354E8DA83C96E182035A771413EADE17DC imaginarni-prijatelj
1,666,300,525 *AF5E1E72B311FFBD317D55CCD134B9D151C053A0 IMEHCUELING
1,666,300,526 *AF56934BC7160AA03F893E2028B36DEBE3BC6977 a25(h
1,666,300,527 *AF5EEAEFA409005A1C711DE144D6E979D6624021 INGROWTH8
1,666,300,528 *AF5F53018FCADA43B2D4207E1A2F78AE6870F491 AAEJ|\
1,666,300,529 *AF54C23C9DDEBB77AEDF5797ACACD5967CF0AA53 IRRECORDA8LE
1,666,300,530 *AF5A86C195D34F6C7E3AD063A995EBECCD330F99 IRWINLANDO
1,666,300,531 *AF505365361D3C904462D867149113E061280CDE AANBLAZINGEN5
1,666,300,532 *AF5BA7117194FD898FE0D2FDA8C9F4357C4BE08F aankooppolitiek4
1,666,300,533 *AF5052EE9A8B834FB6C952BCC2D9E59C93C14394 abctoronto4
1,666,300,534 *AF5C3C34F04E24E516C65EFD86E1D366A9B40CBD [email protected]
1,666,300,535 *AF5D0D05D90BDDEEF2830ED4A9AD0A9D95F45C17 ABG(U
1,666,300,536 *AF559A952785D4DA1A2BA680782F03347347EA1E j;{}
1,666,300,537 *AF5357974BB98245050226F65DB92C7D5BAA685A JACLYNHAWTIN
1,666,300,538 *AF598E656EED89AD51FE57705934136C2D0BB1DC [email protected]
1,666,300,539 *AF55EDA5F7D20E18651875650363F0F190588DD7 jalousaient2
1,666,300,540 *AF53D0BE0E19840A3DFB98D2D4C6B6C367681D88 AC4Q~
1,666,300,541 *AF546F04FBBFA7E28F56AA8FCFF757989BDEE1F7 javiervieux
1,666,300,542 *AF5F09143D64D81A88F1D51E86F6F7CAF7F78CB8 ACPMA
1,666,300,543 *AF5EC4DFA67ECA4CE0C50FA65FC72B46C8F217D1 JEFFRY.BRECHBIEL
1,666,300,544 *AF5D97921EAF517CD0A19D08DF306AD69B71A0EB adab
1,666,300,545 *AF527D04F9384A0D38FA4755ADC43FDA77316F75 ADELSMANDENS0
1,666,300,546 *AF55F562CA6CF9ECF5F8E66B204A5D9A73522992 aev(o
1,666,300,547 *AF59FA540FBE062EDB8BE8E86EE330FD7B7634E0 A+H6
1,666,300,548 *AF5190DA1630FD99537C750195E3EDAAFCFE4F7D johnnymclane
1,666,300,549 *AF575F3019DEC48954AEC7AA593DBB64245415C0 JONAHNUSBAUM
1,666,300,550 *AF5044EE05008ABBF0B231FC6195AE3C7BEF2E52 AHURIRAS7
1,666,300,551 *AF5A3CA6677ED9E593BE479951E92FA75C169811 AITOUMUTS
1,666,300,552 *AF5D509ACD289FC43BC7F9F55DC0F34483D693B9 [email protected]
1,666,300,553 *AF5086368FBE4FBCD06FF4E17CDE5AA67ACBD1D7 [email protected]
1,666,300,554 *AF50FDCFA074583C76D777FC27930D7DD64183E5 akgpb
1,666,300,555 *AF569A32BAC63B71D6255977589A0F4313A89F77 JUSTGROOVE17
1,666,300,556 *AF53BE58239B06C5875EEF52593930D7E670B2BA kareemelsberry
1,666,300,557 *AF5BFE67BF5B038871599A42763D84FE0FE872F5 karoly
1,666,300,558 *AF5B1814460671614D26297A7B880CBE03D149F3 KATERINASTAMATAKI
1,666,300,559 *AF51FF7B65F792B01DD03ABFD152D080CEEDEC86 KATH GRAY
1,666,300,560 *AF55FC9A7AE59F0431BD7DA50E07B1A8AAFA6AA4 katja.lindgren
1,666,300,561 *AF56B62197EC02E659FDEE63DCAB37FCB5E69AF0 [email protected]
1,666,300,562 *AF51F4788424B5C6C798840C27329D5AA453342C [email protected]
1,666,300,563 *AF592BA0E2A7CBE486B8D6F956F454CD54C3603C KEN.MIKLAS
1,666,300,564 *AF5275F0B8B600B15D4FFDAA0668671A2E758E45 KERNQUERSCHNITTE
1,666,300,565 *AF5C4C38BFB9ABF7D043C7CDE140083ADD4143CC KIRUBASHNIA
1,666,300,566 *AF513738D96CB7B5B5B1277689C8C9A0BFA28924 KJHLHJJHIU
1,666,300,567 *AF5CD765E3958998ECA5B70E4B8E0C48F3238B7E [email protected]
1,666,300,568 *AF549263E33176ACD10F27C06EE5E2B3E640C11A klaynesevilla
1,666,300,569 *AF52283892611A503D791960EEEC9EDAFE4A484A AMANDA.CHERIE
1,666,300,570 *AF590BB9D0FC79B46E525656832448C1008CDED9 AMANDA LYNN HARMON
1,666,300,571 *AF56FC60E0B380EBBDCE9096722C7258833C5CFC KPHAI
1,666,300,572 *AF5CB9288B43C9FAFAC151393049DCD213BA4DFD kraigkowitz
1,666,300,573 *AF55D9FF859DFEFF78BDD573F6DF5410F811B862 AM!K6
1,666,300,574 *AF5FAFCCEA7765B48687850E7FAFDEFC4147CC84 AMSTERDAMOOST
1,666,300,575 *AF55982397F7464141FFC42FCF0FF15E672F47D2 ana-bartra
1,666,300,576 *AF54F0A70BDA16F783402B679B50044C266531C3 la-caricatura-politica-en-colombia
1,666,300,577 *AF535769533354F9072055D376E02816BBE38617 [email protected]
1,666,300,578 *AF5C266EEF84CBE9EECDA83A7C1DE3EB8E9EE998 [email protected]
1,666,300,579 *AF5FD5C02AF71B216EFB95EA54741183A09B9BD0 laissepastomberlevieuxbluesman
1,666,300,580 *AF516640D7550A8ECFFA8B82365C66144C3AB130 larnyxes8
1,666,300,581 *AF559781608C940C53A8822864DF46811960D923 [email protected]
1,666,300,582 *AF5E9DDAC1013FA9307EBD62898BD7F263F01E10 [email protected]
1,666,300,583 *AF5BBA11E5B8FA148DCA9311D79A9B53918C8D9F ANDY.DEMICHELE
1,666,300,584 *AF5C08BFCB72A50442496F1E4EAF4A046C362407 ledame,icavalieri
1,666,300,585 *AF546127FFB0057ECB4186B506CB3249F3EDE5C8 LEMUEL.ALIBERTI
1,666,300,586 *AF5E02E6B9C89CA3D8D5F6B8463C15FCDCA18623 a-nmc
1,666,300,587 *AF5F26143D8CE466288756CE9FB58D94807E1E89 leonardsasha
1,666,300,588 *AF5661E4CCF808E344E635A958E077C2A7076654 LEYDIYAMALY99
1,666,300,589 *AF59D6B60CDD822626EAE59C2F9CBFB6E15F3931 LIFESTYLE-GOC
1,666,300,590 *AF5284055F9476E737050F3BB5DD44FB99B01CC4 AOC.4
1,666,300,591 *AF5B42CBE19CCC0BC88ED33B2D5F5CDC9924F5FB A;OGI
1,666,300,592 *AF53A852B957885611E021D0825F611AF250CD16 archpresbytery5
1,666,300,593 *AF5DC7420D9A3BB4003B9F6E76E9D4E68AA1CE21 LOUISE CRITTENDEN
1,666,300,594 *AF5AAF4E572A9EB18DDED3F97232020785209363 lovin'.you.is.worth.it
1,666,300,595 *AF5B3ECFB64A50B0127490BE1C8BB736863E5211 ASANUGRAHA
1,666,300,596 *AF51A0922E0A6797141DABC936FE70C7A3BD8B48 LUKE.ELDERS
1,666,300,597 *AF557BA66D097BC86504B08A6D5BF987417646DE [email protected]
1,666,300,598 *AF513F509EA92B62F69CE12745B60825F9253ABA AT5SA
1,666,300,599 *AF5DB0B98E411A6E09D0897414317E4F3A280A19 atbc4
1,666,300,600 *AF5A5FA841DEDC7B78C5AD9D5476A44AB10F4130 A-TG
1,666,300,601 *AF54385E28780038CDC66BA306457A3E3AD6A9D3 ATOTONILCOAMAPA
1,666,300,602 *AF51DE8672712C6CAC8156269827674E2CFA83C1 m4rk3+1n9s
1,666,300,603 *AF52CECDBA2C94E04D94E8538E8474E45C41249B AUGUSTCOULSTON
1,666,300,604 *AF5E19A4F059D4CEB16332A9D4B81D3D13C173CB aulru
1,666,300,605 *AF5BF3F5488A2C85EF4BCA7D1E7EC7E3514026F7 malwsan0
1,666,300,606 *AF5C55AF4F4A7ED8A4D2749F7307A3EB28E0364E [email protected]
1,666,300,607 *AF5509DD096C54F23A3414D7C36AADBB35076A60 A(Xk
1,666,300,608 *AF53925572900A5B4C66A1DDB4DF232DDF1C8E83 A!ZN.
1,666,300,609 *AF52AEB079F3D82B23DE5E2385566CD43C0DEBF8 [email protected]
1,666,300,610 *AF585A10DDE51CBD04E68540736A210EFDED7BEE b5ard
1,666,300,611 *AF547799CA246DA9409FC500947DBDF9BC32C1CD b6lkg
1,666,300,612 *AF503BC4472DDAEEBD72255226FC3F7490C81964 b7ekb
1,666,300,613 *AF597DCE613320258A8216474DA4A083FC87FCE6 markferia
1,666,300,614 *AF5A000684C019EC88A000C30BB9228CA3AAEB55 BARTONMCKIVER
1,666,300,615 *AF564ADD8961BCC67E6015DDC58DD81C2D725F9B MARTINBERWALD
1,666,300,616 *AF5047F4CC2B7C3004518222FA2C30BE27D3F690 MARTIN-RAE
1,666,300,617 *AF58A67D8678F06BAC577490DE17CF83DC5B3745 MARTY.HAUPTMANN
1,666,300,618 *AF5E80A3AE5591199F7DFBC5568006A3CE61A015 batalla.de.huamachuco
1,666,300,619 *AF5E8B95B60966087015CA4F646AA7655F30FF85 MARVIN.ROSBOROUGH
1,666,300,620 *AF54673FF91967CFC7845F5E57C7014B5D0417BD [email protected]
1,666,300,621 *AF50879CF0A7317B87AC67495E2D9A7E9E6EEEF0 maryam-nassiri
1,666,300,622 *AF59F4F478C7A890BC72C5A4DA5CC0D86DFE7FF5 BATLALIOI
1,666,300,623 *AF5ADC06FBAFDE7C4655D32CE5ED6CBB1B2C6D5D BAWQD
1,666,300,624 *AF5ABF0E1E264A2119F4F48D688920F24610522E MASSELIANO
1,666,300,625 *AF5AC16C7C4B1034ED0FB123F138F11A8C4F06D4 MATILDA252
1,666,300,626 *AF57D936B432EC597180BC30418B42D46F6201A7 BEEJW
1,666,300,627 *AF5F3DAA24012CF9420758E9175D9CF3DFBA5DF7 BELOWTHEBELTWAYCOM
1,666,300,628 *AF56123C57B8BC3E45D5C0BD30BDC87D7F76AC2F belshazzar's feast: then sing aloud to god our strength: allegro
1,666,300,629 *AF5C297BA8C118A44AF7EF30E9CC693E2A82CAA2 BENNY.CUMOLETTI
1,666,300,630 *AF5DF75E019254BF2B30BE068FFC76005C0A62E6 MEGANMCCAULEY
1,666,300,631 *AF54C0F344060E4AD2968CDB77CBD80ED60B5730 mel'stotallygay19822002mix!
1,666,300,632 *AF5F2B8602996B68AC2AE0F7CB80B2C4008A8FC3 MEPHISTOPHELIX
1,666,300,633 *AF5A295DAE85F69AA15261994F1614E25BB6FDA6 MERVIN.VENZEIO
1,666,300,634 *AF540500A99F9C4827A527C278DB4211A03F1F3A BEW1Y
1,666,300,635 *AF5D2BD14BA70C20A7AE0A0E2E67CC9A988F2B58 METROID774
1,666,300,636 *AF56574980750484847D2E6868F650112C366987 MEXICOIRONMAN
1,666,300,637 *AF57379610DC38FD75A26768BAAFF5E5519763EE michalegries
1,666,300,638 *AF59A436534F69B8CCA1B4756C5DE4CCB0647E39 miguelpiegaro
1,666,300,639 *AF558AEB2E12D96CF4500F6B59CDFB125086DD9D BIBLEOTYEAGO
1,666,300,640 *AF5907261D182E6754A51A075CB0D287C018A451 BIGGLES14
1,666,300,641 *AF560CDEB84953CC801147A5A63E0A07DC1CF2FF milder
1,666,300,642 *AF5BD00E3BD005FE803D8AB0E9E59D5819644A1A mindy.ramirez
1,666,300,643 *AF5C933DB62B8458EC1FD5AEA1ABEF6E8116263C MINGBSW8
1,666,300,644 *AF593080C65290E9AA99A4B63FA6632C322F2155 model.inc.
1,666,300,645 *AF5CF7C9EF92C4E269154D30B5939556D058034D MONA-KASHYAP
1,666,300,646 *AF5970DC3AC890842B8D49F957B4CC06096DA4EB BLUESBAGBENITEZ
1,666,300,647 *AF596DA4C17FA08CF1F4EC299A2E6D84EA75C9D4 [email protected]
1,666,300,648 *AF55721E641C792311CA1243E2328F6C610B3B24 BOB-WEAVE
1,666,300,649 *AF5905EE822A922B641B517B75724D51E5EC937B BORIS.FROHWEIN
1,666,300,650 *AF5C7EDE8DAB26BF3FB549113CD75C17F5003610 botwb
1,666,300,651 *AF56BFB955475E6198748E9B63A4205238BAD1F0 bp,
1,666,300,652 *AF550E846159233BF8011CBF928FD63BA20C41D9 MUTHUVELAR
1,666,300,653 *AF5C0C9D75016BD97B279877A0C256F65719596D MYRONMERRETT
1,666,300,654 *AF59B31A13C2F16E94ACC6F288E2E35C38DD7D07 MZHSQEHI
1,666,300,655 *AF55BE63BF09B266AA2CB2191E464A840CDE9968 N0N4CC0MP
1,666,300,656 *AF528E843920B62F0AC6E7A7C9D81BFB2C21F138 BRANDONLANGHOUT
1,666,300,657 *AF54C152C323DF24FF1EA07B15CE8E4F87D01DA7 BRATTLED6
1,666,300,658 *AF5F3620863D26804647DB690C5553F78FF8E78C N3WLY3XP4ND3D
1,666,300,659 *AF58F4E5E603DB47EB1279A1DA39AD6FF76CB6AB BREED.THE.KILLERS
1,666,300,660 *AF56773F3F193213A936058388C695A7818A9E98 [email protected]
1,666,300,661 *AF576775C900F4088AA5E5933D218E61378987B4 bretonne3
1,666,300,662 *AF538A08D16486BC56CF324E805B20E085AF2D25 NADIE-LO-SABE
1,666,300,663 *AF586BC823365BFB773189646B28882A55C14DF9 NANNUKA
1,666,300,664 *AF5D7D0B5E4B00CFD6A38083EB459A85EFEA0012 NATHANMOSSER
1,666,300,665 *AF52F3DF166A40C121E6A1499F50FC0FD9BF40D6 NEALMATO
1,666,300,666 *AF55774ACF0BE10A13CAE19B2C84AA5D486B8890 BSWCIMSABSW
1,666,300,667 *AF5B365DE6061795E57E7F65E21921A8352CD0C1 NELIKVIDN
1,666,300,668 *AF54E8819C1D1123E284D4A504363B8058A21E8F [email protected]
1,666,300,669 *AF53413CBD0D562D122027BA931D7C3C91E7E9A2 NESTORLAMMY
1,666,300,670 *AF5C5AE20E267AC9F241E46F4463390DE5706393 NETBALLERTALKAMBER
1,666,300,671 *AF52421848E8E3B934D21E66CEC1BD528FCADAB2 NETIELPE
1,666,300,672 *AF552B3F98787F6EBFE3114EE9DCD319C152A89F NEWJOD
1,666,300,673 *AF527D1C1FAF5BD98D0FFAA9CE5F0B6C9D66B4ED [email protected]m<mailto:[email protected]
1,666,300,674 *AF5BAB539C1162A8A299586AD1C0C6F4F1A5315C BwwE
1,666,300,675 *AF5556FE0D85F68148AC481BB5978C712699C2BC No+aryshp
1,666,300,676 *AF5CC62CDF3DE205556238BEF700DD043610E2A4 C0NJU6873D
1,666,300,677 *AF513040B5DF106CB9855C970842BA9521E3971E C0$OL
1,666,300,678 *AF5E24FD010B96B0F524DA24F5FDACDC27E9CC05 noktom
1,666,300,679 *AF502FFDA4D50B3DACD6EFC7DA0D0AD9C408CC44 NORRIS.STOLEBARGER
1,666,300,680 *AF59E6377D916AFAD836C77043DCBD9D281A8B3C c7_d
1,666,300,681 *AF5AFD01B39883C8210A247011E2779B84E20300 C?a3
1,666,300,682 *AF5943C3D99AABBDDA254EF43977674C249901F1 NTEKIKA
1,666,300,683 *AF57050BFD97CF4C51D72856FA77E038FCB076E0 NTRSNTNT8
1,666,300,684 *AF510001EB3DEE86F42F3D1E718D5EAD7400EC83 [email protected]
1,666,300,685 *AF5D3FB89B0C8BC1A1CE040F6A7BC260975F4354 nyder3
1,666,300,686 *AF5BF39210436D9AF101C23451E3EC8292D00C35 obituarypeterrice
1,666,300,687 *AF52139827A87486309E8324DBE3026FE91E2A59 CARMINEBUTEAUX
1,666,300,688 *AF593438DF306487F8931DB834ED2BE62A442B00 CAROL.DOWARD
1,666,300,689 *AF5EAFEBDE913EBE0E935ACF03FEC3D1BFF4BB66 ODISLOVENBURY
1,666,300,690 *AF5B45485295DE33F1FF7E4C1D83FC4DB4931188 CAROLSARBACHER
1,666,300,691 *AF5BEE17D351BF4ABB82856FF392F16153CD73B3 OH7~
1,666,300,692 *AF5D75F7F8B40A7100EF5166299B9206D7EEFBE1 oihv
1,666,300,693 *AF54CB44DB6078844C6CB26E4BD4461BE45049B7 omar-elshimy
1,666,300,694 *AF57A84BCD7256173BA54E28DBB0F30DBB412B5F \CBAA
1,666,300,695 *AF586B5D453973798514FB3FBFB9DFB5F18BBEA0 [email protected]
1,666,300,696 *AF524E793E62EE1DB3A60DD2B81B625486D05B54 cdub
1,666,300,697 *AF522881303C4351DF73B8FCEA00BDC15D61CCE8 CEDRICK.SERSEN
1,666,300,698 *AF5699F8430B638C506DECA98D4ABDD4E1512822 CEOGZ
1,666,300,699 *AF58C039F3C64226522876CC74C23A1FE2DEE594 ceuj,
1,666,300,700 *AF578B905D6D255C3B9DBD517ECC486E6824CB4C OSWALDOCHRISTMAU
1,666,300,701 *AF502277A29C8B7FD13B2FC0425B6EC133BF7360 cflef
1,666,300,702 *AF5596D08DE1473A990633F8E69B3C9A22CB05B5 [email protected]
1,666,300,703 *AF52BF10CC6ABC6B7927DE980FDB11E0FC8CE9D6 P0S7U147IN9
1,666,300,704 *AF5730663D9E438F866EFAEB5A05B7538164C2B5 pallavidoshi
1,666,300,705 *AF5AF11FD8086191E5B7519C03234557B70F83EE [email protected]
1,666,300,706 *AF50DFFD1FCF4BFAD39194B62D1D3D32337AD469 paresseux5
1,666,300,707 *AF55695463AB86344C0407F40D996D38CD98C163 CHIBALAM
1,666,300,708 *AF52C274131BC024C66EA3B5A43CEAC8648877B9 paritcularly
1,666,300,709 *AF57DFB37CCFE33A319BF3541965BA42C011D98C P===B`~`~;)
1,666,300,710 *AF5157D157BECE741F5ECC44BCE813E4EDEBE04E PEDRO DE ALCANTARA DE ORLEANS BRAGANZA
1,666,300,711 *AF59C529FAB7F14F988612E086D87DDF1F349CD8 cideyomas5
1,666,300,712 *AF58FDCC4AD70FB666FF46DD0DC48E925B7968ED cihg)
1,666,300,713 *AF591E8E09E688632EA9137A8769F67C3FF86B78 c=kgk
1,666,300,714 *AF5C9D7290053540D1662DCA12DE504DF852410A PHILIP.JUKES
1,666,300,715 *AF5D0736334907684BE1776790CF1C568498C2ED claudio-"el-compadre"
1,666,300,716 *AF536AD0DD8D274E82F557A5374F3CFE0A9F73A0 PHOTOTHEODOLITE.,F/OU/T/OU//T//I/'/A/D,//L/AI/T
1,666,300,717 *AF531FBBC2590DC1D4D1691194CE6BB06CD92A1D physi0path0l0gical
1,666,300,718 *AF5499C0A720CA7AEB8061D0E81DB6477BDB8C1E CLLLCTNS8
1,666,300,719 *AF5F91863AF486B52250BB699B119D959CC5BB4C CLTRM
1,666,300,720 *AF54BDF03C537BA86946B2620354BC14F25D54B2 cmqw2
1,666,300,721 *AF5E1B2DC725D2C45D96FEE049B95004D83AC420 co!fi
1,666,300,722 *AF50A296CAFBAA07D832CCA26DD013B4AB91408D COLE.ZAMBARANO
1,666,300,723 *AF583631F2A4920EE8418F43A356FCE752A5C6CE collapsend
1,666,300,724 *AF55A638FBA2CCA13960C7E541BF0A2DEF8E2A55 [email protected]
1,666,300,725 *AF54CEB45ED65DB182BA556943C7DD26611942A6 COMMONS6
1,666,300,726 *AF57DFA761E3A757EDFC3F239113C315C1ACA241 prarthana-fernando
1,666,300,727 *AF5C34D07242BF07218166D1178EAF7AC1A293AF praskemed
1,666,300,728 *AF50B0168D5DD52D74BC76B4632BC92DDC668FBE consultasdeborradoclubalem
1,666,300,729 *AF50123199B9492974B263403DF9078782336DD0 COPIERIONS3
1,666,300,730 *AF5F165712B685FA8C9E32970943C47E073A6052 COREYTARTER
1,666,300,731 *AF5EBEEAE09971AD758EECDEA066E1D74E399928 cp:mc
1,666,300,732 *AF5718DBB0ADAF2A84E7335E6C01817A5059964A PRITAM JAGTAP
1,666,300,733 *AF5E17A94C2153EB9BF867B39127A69715B2B789 C:\PROGRAM-FILES\PIDGIN\GTK\SHARE\LOCALE\DE\LC_MESSAGES\ATK10MO
1,666,300,734 *AF58EE2BC15A6797CCDEA20DF4FAAFD3A71B560E cpvr
1,666,300,735 *AF54ACC047BC19BB5680E1D71A0F741217D9C8BA C&(RD
1,666,300,736 *AF55D93C1EABB430657808953BAD073BF766E2B6 PUNGEVIS
1,666,300,737 *AF55738284948822DCD30E3E676A0FDD61E55F82 crossbolt!
1,666,300,738 *AF53EE24AB8DBF7DA0F64C80A9CB001255E87312 crystalfraga
1,666,300,739 *AF5817D3356D9FAC050F4F49270F96F3F5723727 QBL!
1,666,300,740 *AF5B09E7FC0F0070DE13D8750708ADCCF26227AF CS=ZX
1,666,300,741 *AF512F78DF5254E43F34A4753C25F9330AA77E0B [email protected]
1,666,300,742 *AF5E9BA8AE74CE4580E52F245928C02CDAB5E672 [email protected]
1,666,300,743 *AF57F8A11D432870EAE3286C287458840798528E q#@*.)O(
1,666,300,744 *AF592A0EE279E1D4BB4AFE1E3425681E87FC788F q).~O.(>_0)
1,666,300,745 *AF502208075D72BB6045974B53B808859D1A3EC9 q######P ~ ~ ~ splat
1,666,300,746 *AF5EB6F5E91574F65000FCA887E7951250372FFC cu sgarra paga (who fails, pays)
1,666,300,747 *AF59954BE0E957CC8F4AD322CB894DE9E9AF5A78 r4gb4i1i
1,666,300,748 *AF5F455C2F65A025D382231AAB8E4A4F0DC0BD25 d1sobeyer
1,666,300,749 *AF51DD93FE920CF2EB854E698C79C0C6D9C29464 d3v7(
1,666,300,750 *AF5D86BE43ECBB88BDFBAFBD184CEAC72DECB07E raymonmattimoe
1,666,300,751 *AF57195705C768EAA29A41BF221A51D193A3B2D6 REAFIRMARIAS123
1,666,300,752 *AF5CF0ACCD3E633C54A12392B21552BA9565092D realestatefirmrebitoexpandoperations
1,666,300,753 *AF5B044CAB058FA97B830E594588EB8B2AB0E819 DANNIE.SCHLABACH
1,666,300,754 *AF5E1E8C2CAFE9A6F9E14390DA7BE15B84C7F19D REDLICE2
1,666,300,755 *AF5AE35AB6786388ADC69415AF2F8670D1DFE082 darinyouell
1,666,300,756 *AF53E2133081F585B93A9D785A35006B345E5BDD reginald.brisbon
1,666,300,757 *AF57E598E21F8085CAA5C6E8B5F52428F45DC7BC reikaeistae
1,666,300,758 *AF54E215DB9EA61CDCA08CB73BC89A0F11D331C1 david-barten
1,666,300,759 *AF5410FD348EED8B4D9FBD892991268F9519D26A DAVIDBOW
1,666,300,760 *AF58C1D6788D2A56F9F108455F17FE98B016C83D davismanko
1,666,300,761 *AF5EE678C2E61D5704097F8248F980B838CAAA2C DB-AFDVOTEPAGENAME
1,666,300,762 *AF5A96F7AFBF0397E06E160E6EE0A8A8A6B577C1 Db%c
1,666,300,763 *AF5D0B0F34AD2B395BE23777ACD53F89E8069B6A D&C-Y
1,666,300,764 *AF5BF2458C0E7F3FC59498D82ED7531862526F8E DEANDRE.RAFTERY
1,666,300,765 *AF52280B3443C8094AFA6F97D28D86CAB59104A4 deathdevoted d/E//T/_d/I/'v/oU/t/I/d
1,666,300,766 *AF5A6E485B48EBB88A7897F721B3F6810F348F5F DECKTDECKT
1,666,300,767 *AF54A11C071A40E7DB50D626D563B6D276613E0B DEGOGNIONS
1,666,300,768 *AF52B220D473E228FD9CA8AF2D0756306EE9AA45 DEL.FILLION
1,666,300,769 *AF5566C08B8393E390C7F7051E25C9AD79003536 demobilisees
1,666,300,770 *AF5856E7A75EE70CD200847D7DC931E9CBCCF681 [email protected]
1,666,300,771 *AF5BC750B7BF325D56E62AC65D74368ADD913538 ROB.FRODGE
1,666,300,772 *AF551DC5F93759AD0E492BC56C2FD239D685E8AE ROBT.FAGLIE
1,666,300,773 *AF5A08A8325F9E4C4FAC677066965AD5DAAF07B4 ROBYVELLE
1,666,300,774 *AF5C0242103A35AA23C2063C56DE2DF30821948A DIEGO.SHADWICK
1,666,300,775 *AF5C4A74A82825ECCA96470131B5D8E88133EB62 RO$E$7
1,666,300,776 *AF5DD1F6A85DD50082D364E4EE683A93ED743B21 ROLANDO.KELLO
1,666,300,777 *AF535964BCEED1ECCA48B954C9025D850579E425 D.IR?
1,666,300,778 *AF59921AEF2E51CFC378D217E6867CA412B0BA89 ROMEOZODROW
1,666,300,779 *AF590D117696BE6EFA102C9953E7A3DF2856EDB1 DISPLAYW7
1,666,300,780 *AF5CDCA3B7564823F78E86BCA8EE9622A5954434 RONDELET
1,666,300,781 *AF5306ABBC1CCCA5ACBE526D5969A8B6528EE67E DOLGOZHATNEKE
1,666,300,782 *AF5338C17A78C1F850379234945FF61FCC7DE303 DomainNameServer
1,666,300,783 *AF541CB9F9D0B73688E8D46984AFA4599A7C8117 ROSENDOMCCOMB
1,666,300,784 *AF537784825AACB03C28F61D12AE4D6EC5B7F346 dong-whan.kim
1,666,300,785 *AF5574AFB14891A4978EB00F0A54D1B00C7E3196 RÜBSAMOVÁ
1,666,300,786 *AF5A4FD9A5850589B8B4359CD27DC57D31A05991 DORSEYDUCHOW
1,666,300,787 *AF5A70BA5EC14307341946E325EC46E8C68E58D7 dpf!
1,666,300,788 *AF5DD576CE40FE25F1538C940C3F5329F0B3F29C rustyblunt
1,666,300,789 *AF58F6C0114D376F446D3AA9E5AB8A87643150FE drasoyme4
1,666,300,790 *AF510E836205FD1B49E640205C438DF921322449 RYSTRNG7
1,666,300,791 *AF59637128C829553A5BA267C40BECA657DD6EB5 DROOP!3S7
1,666,300,792 *AF5B41C9011CAD5EE05487984D94B6AA2899C6D2 SAK7EIYJ4FQ
1,666,300,793 *AF504FDA3450E0EC43610529974B5B45B408C150 dtmsa
1,666,300,794 *AF58D2A15FD7539AE84BA9CEBB0DC97C5424B4BE SARAHZIEBARTH
1,666,300,795 *AF59ECBCE5D678BE469D372044FF721E51ED2200 SC4N7ED
1,666,300,796 *AF576AD2CB82F24DD2471A4A5C2D98717E50EB33 SCOTPANCHANA
1,666,300,797 *AF52CE7017105F9BB30FC81AB7EBB3AEF03155D3 SCRABER9
1,666,300,798 *AF53F1C2F21134B89DDD2F032272F21DC4007EA1 Du,i
1,666,300,799 *AF5B5FB834098E6CF56877F89F6192AA5F382AF2 SEANAHIA
1,666,300,800 *AF5E76542758FAD5073D337B43586FF3E23B162E DUWWAL
1,666,300,801 *AF57E73B800F8EB098A7D4C2FCC09C2E250401E9 dvnw9
1,666,300,802 *AF5F26AD486EDC7A6A2FB82012FAA2E2F901755E dwsvf
1,666,300,803 *AF5B4A7B4D5EF81E54FAE1B04CFBB0F7E48B6037 SHIAWEB
1,666,300,804 *AF52A481A7AACE3A90C90FCB9B59558C8A4650CD EDDIESVENDSEN
1,666,300,805 *AF51FBBFD894C189DAD2BD218F3EAEA6AFA2E854 eddybuckmiller
1,666,300,806 *AF52105F48071C817EE7497F39FF1963EF85BBFD eddycarriaga
1,666,300,807 *AF58C10522EFF5EBD68A974AC4862CF9CED808D5 edisonconole
1,666,300,808 *AF510266BC2D91CEBAFD47A6E24BFA1295C72073 EDMOND.DALHART
1,666,300,809 *AF55E20E58E04F71F01571FB763FF918AEDDDA3D siecina
1,666,300,810 *AF5C9270BDC2F4D1FA14F1EAD9D76ED4E8D27B6B EFT
1,666,300,811 *AF55153FA5541AC6FBEDEBF1C8279E7B78E087F9 [email protected]
1,666,300,812 *AF5468C063B72173D298596BAE065199275EE8EE EINNEHTNERS
1,666,300,813 *AF5B512DE1AFD4D527C2D49CC9EE3110AF83327C SKIT:"DIESPARKASSE"
1,666,300,814 *AF5C23E3613D0B3FB667A8E32FC9FE1D38449CE3 SKULDFRIA6
1,666,300,815 *AF5A4DFA1197DCF29930666D28244BA211C3865D ELAFRWN0
1,666,300,816 *AF57E66BCC2E91BA6B3750058EB6D8D9B9EA48D0 [email protected]
1,666,300,817 *AF5EA928889F4557491CA6C4ADE7A767A9CBC05E SLOPPYTRAIN
1,666,300,818 *AF5EE0445C317F3EE2283FE695C9EBB11CA0FAB8 SNAUDH
1,666,300,819 *AF58B667EE500EB05E2DC8F60EDE37C26E29577B elviskrapfl
1,666,300,820 *AF59BF7B33E0BD6FC7F434CA67BCC8833C7A1068 snwplghed
1,666,300,821 *AF52D707A6C036BE8C389FA30A638E923124B727 enihprom5
1,666,300,822 *AF52F4E7103927717ADE24338FFAB5F12C851D38 SPAATZ0
1,666,300,823 *AF52D712C6AEF1ECCB8543D3912F3A724B551313 SPECTROPOLARIMETERN7
1,666,300,824 *AF5112B5A0F9F3EAAEFE693E9C8657B0E3031D1A ERICKRHEINHARDT
1,666,300,825 *AF56759FCF8CEBD21AE9780522DA7CE44CA66535 spikblad
1,666,300,826 *AF52BD1829D7E23071887EE8BBEB867210191376 evelardo0
1,666,300,827 *AF578B6E93E5254FE91DF9199DA486815876AB73 STMARYSC
1,666,300,828 *AF57D31F030BE924C43D3CD964A783B0D43D657A subcollegiate?
1,666,300,829 *AF53C39E1D34C1206A1FBB3B2CADF2C417FC452A FELICIA.CHUNG
1,666,300,830 *AF5B262B3DF5D2048587666D2F142F1EE998ABE2 [email protected]
1,666,300,831 *AF52248F79DDDB8793EA711BAD2873DCCDC28C60 [email protected]
1,666,300,832 *AF5AC05CDE0CF624BDCE3D362AF8D0EF09D0DE08 SUOREFIDICA8
1,666,300,833 *AF5F419366A585F41DD41DA9D1CFE0BEE53750BD SUPERARLHA
1,666,300,834 *AF5CCE5A77CC6FB4F7E5A80494771C71DB882C94 ferminjahnke
1,666,300,835 *AF5F553D9C45DD5E896003AFC165B817C53E5FEF FERMIN.JAHNKE
1,666,300,836 *AF549CF6CF6F6EFB02EA3DD69E7737D87B0385F7 FFOHEIP7
1,666,300,837 *AF55D239D2E8165785B264AFA4232CEFDE9FBFE5 FIASKONA3
1,666,300,838 *AF57DBCD0DBE5AB91BBCD5FE6C81F40BA29C92E2 FJC4BG
1,666,300,839 *AF59BFB652B909E6B58C723614BB056632A23045 symphony-no.-8,-a-dur,-op.-26:-allegro-risoluto-e-con-spirito
1,666,300,840 *AF52624396F95FF131A7124B4B9DBC0F7E1CDE79 flores-pena
1,666,300,841 *AF5BA71F1756F48CF13B1845B56355EF7BA8C274 [email protected]
1,666,300,842 *AF5F37101BF385C68EC66DBE91773B7B05942DFA TAGALOA90
1,666,300,843 *AF5B2A5C93D526B04091F6B452F475021F069B65 [email protected]
1,666,300,844 *AF59134CF92CED2651765F6EA7B4111C7462020E TALKVICTORLEEWINGHO
1,666,300,845 *AF5C4B90D4188CC201D1D4937930EECC3E6CBCBC TALKWJKNFM
1,666,300,846 *AF5C3C1BF97922ED58C37B4E807DC006CC900083 FRANK.DECARO
1,666,300,847 *AF5831822B5BF2E3DDA46D684F27D0265FF0F35A [email protected]
1,666,300,848 *AF58881FAB23600BE06824D5401248F430B3A015 TEAM-WORSHIP
1,666,300,849 *AF5490AD6AA2A8050014D9CC97D68ECA489ABE9B telphus7
1,666,300,850 *AF52C1B27AE8C7FEBFB6CC4791EDC7FC8DD30A88 TENUTY
1,666,300,851 *AF5BA7DA168531A7C7F04AC8274C369778D86CDE TEODOROHALVORSON
1,666,300,852 *AF527F9D97BF4FDEC5B3E69B82B5AC4D296FED61 teoriageneraldelossistemas
1,666,300,853 *AF57BF2AD1592CD317C76C9ACB0EC0E61BD098F0 terna.moderatotempopocopi
1,666,300,854 *AF5A840F36C9AC2FE0D79A92FAB2581C149507E8 fritzsyrett
1,666,300,855 *AF5E0B64425E59EBB0BD542124476D85BA079493 thaddeusmichaeli
1,666,300,856 *AF505A41D22447A6F4796674419E8F3D49A48A11 THATCHICAGO1234
1,666,300,857 *AF5AFC98121086AB046B5382B198F296010AA6C1 fwj
1,666,300,858 *AF5E55AF52FCBA8C9373AFEE1B2130203493B17F gamages
1,666,300,859 *AF5779E906448C32ADF69BEE78ED2B08B8941A1E timademadrid
1,666,300,860 *AF5A91C9F759BE14FC8B9B88CE958750242265F1 GARTH.CZUBAKOWSKI
1,666,300,861 *AF598357D20E85A4A1CB4F1FCFDF0C35468AE3DB GATEWAYPHOENIX1
1,666,300,862 *AF591DBF4D28F5FB1EDCDC00447416A86917843D TJUSTAGOLF
1,666,300,863 *AF5546815247A5979A7CC2B36287171DB0F67310 g#c
1,666,300,864 *AF5588C470D57B0FFC1B4FCBD89D1575D3D5674D GDZILLA5
1,666,300,865 *AF5CE195AFAE4F5F0D8DCB8DB99126AB555882FC tl-p
1,666,300,866 *AF55D6CEAB94530ADE45AD66081A0ABB1EEBD204 toezieners
1,666,300,867 *AF5C500D37C6E262730EC9B71F99CB342328B649 TOLRA 1
1,666,300,868 *AF5AF8347E59BDADD04903921F79C4E0438892C5 GESCHAMPERDEN?
1,666,300,869 *AF5BEC788D6966F5EC9042CF62D6897658405253 GHAIIS
1,666,300,870 *AF5425A4E50A00D7E675100C62CF705DFBCB4337 GILBERTJANECZEK
1,666,300,871 *AF5CE3F9DE46BDC72AC968CFC8AE1B51F2186577 TRACTORFROSTY2
1,666,300,872 *AF57C5A91267292D6A2AC9D49D3014EF79F5C29C TRACYVOLLUCCI
1,666,300,873 *AF52EDEF1189E0ACA21700C30EBBBF334E764C22 GNADI
1,666,300,874 *AF534D846B046055B37330B8CEFA983AA13538BE TREYHORNIK
1,666,300,875 *AF563E70272DB2BEF0EA0D8B81B689B8C7F84CA7 TRISHA LAINE VALLADOLID
1,666,300,876 *AF5F95D8F1CBF262A24549E953315719EF8DB8E6 TRISNI-KENEEY-NURDININGSIH
1,666,300,877 *AF5EBCC78F4DD66DDC812318C466A06CCB183870 grant-aylward
1,666,300,878 *AF569F70115836E155CCD410CE6896288BBFC43E [email protected]
1,666,300,879 *AF58BEFF8706A47AC7BED9170168854FBFB311A2 GRANT.MOSAKOWSKI
1,666,300,880 *AF56B9439457326341E1F3D65EBB63A784A383E7 trudy-mohr-pardee
1,666,300,881 *AF50C5AB8245D07418EAE81F6B263712DFF1442A GRELLFARBIGE
1,666,300,882 *AF569A972A06ED283D80859F7D723800A6F797C9 GRGRIECHISCH-R
1,666,300,883 *AF54A4B6B969BF92676DB825339B76E12BD5FDFC grindahled
1,666,300,884 *AF570B083561B9BE6BA066D62B9E73C3173C2802 [email protected]
1,666,300,885 *AF56B067109780FFC44A5F15BDB8B19185F2C1FB GYURMANE7
1,666,300,886 *AF58FD8EB1F576325C6A37259E41776CE79BCB0F HACKER09876
1,666,300,887 *AF53206DFFC027094161F492B2BFF165E83E9DBF ダンカン・u・フレッチャー
1,666,300,888 *AF5803E249DC9DF58873C27DA3692279929F25A8 UAENIRAV
1,666,300,889 *AF588804EE057AA4744079843794539E8B38AD63 halvetiliğin
1,666,300,890 *AF5A68A53AE00B829C931418F72BFAEEEE0D2DE6 harleys#1
1,666,300,891 *AF556CCE5C3CA123C575A717170A43F1F9031CF7 HARRISON.HOJCZYK
1,666,300,892 *AF5CDE54AA3A88598818BE3334AC6CE0D648572B HAYWOOD.CABARCAS
1,666,300,893 *AF53082822BDCA2ABCDD92FB3A144E6906A97171 hcenter6
1,666,300,894 *AF5CAB2DDC77DB50A648DEDB2B5F4934AE28BCC5 HEATHER-SCHWARTZBAUER
1,666,300,895 *AF544DA5A744BFE12EB9CD886C3FD69FECFCF6FE HEINDRICK
1,666,300,896 *AF537ADC2FE058C5664959E5DE94FA198263BF59 heribertoaustine
1,666,300,897 *AF50A6185EE6C245F8AED151E80FAE31B748B25B UNPHYSICIANLIS
1,666,300,898 *AF5CDF14B294900BD3565EAD8FD8496D3096757B UNSHARPENED1
1,666,300,899 *AF5544FD613D5273F6B80DA563EA4B0CFF6FB5D8 UPASANNO7
1,666,300,900 *AF5D20129C9A835BA7F9D2E844A3084836D97C61 UP.ON.THE.SUN
1,666,300,901 *AF517A0C537D90DFD38DCB5B7296AAD440B1773D URSTISII
1,666,300,902 *AF51EA9CBFDE9551AFBDA42A7C4898F18289B85C ush.mik
1,666,300,903 *AF52FD0759EE8AD942A6105C771657873AAAA04B UTEAHOUSE
1,666,300,904 *AF5675099EE64688F420AB1A5B3E39F40313DACB [email protected]
1,666,300,905 *AF5D58A816B0AEBE8A1F7F47DB6A7F79C32DD17F [email protected]
1,666,300,906 *AF53B7D638E6E4D341E6B1299BA7265FB12C868E valentinmoore
1,666,300,907 *AF5F93E30AA3B7CE2A92DB5D8F16BA8CB24B994D VALERIAOSORIA
1,666,300,908 *AF50779853C1CEE3831DE95BE6A68B91D665B424 VALERY PAGAN
1,666,300,909 *AF5EC3B210E973EBEAEC30FFB0AF54FB56E740A1 VAN.BRANSCOMB
1,666,300,910 *AF500DE7CD0F255B4C971E4CA1CDAA95390725AB VANCSHOONEVELD3
1,666,300,911 *AF5F8D88D310766D147ABAAAACB367E951C49A21 HuVilleHaPikk
1,666,300,912 *AF585B039EAEA50AC708042A94677F8980C67E2E ILOVEBLESSED43
1,666,300,913 *AF5C7707194CE28F4ED25766237C69972B137D7D vernonviner
1,666,300,914 *AF5B09AFFC57C72FA409FC402EC6B6D232337D75 “VIATGE
1,666,300,915 *AF589143740852B13A1C8274055B95296F4A7BA3 IMTNEVYS7
1,666,300,916 *AF5C43AA3AAA2AD8C2A6FAF76884BAE0356F118D INFECTIOUS1
1,666,300,917 *AF5709E0CFC643EDD142427E0F74A0AD7AA64791 VILDLIV
1,666,300,918 *AF5A5D1DA293476FD8A4EADE8F0914111A2BB90D viliame-nateru
1,666,300,919 *AF5D79AF7DA360F784B209378109614D621AA210 INGESTOUWDEN.
1,666,300,920 *AF5CC4D27108538102F75E28914E0D3479527C44 inspektionen
1,666,300,921 *AF530DEF91C54519909B9C501FAC5B4F2A103EA5 IRENE.RIEKER
1,666,300,922 *AF5517223738B219181A348DA53138238BF7ACF4 IRUM.ADNAN
1,666,300,923 *AF5CFF3B7C089FDC87D7CA919702BAFFD7505932 ISOIRUF0
1,666,300,924 *AF534292CDFF973D4A50BF42C2468811AB5BF5FF IT'S DEJA VU ALL OVER AGAIN
1,666,300,925 *AF5336D75FE8766C7832A9E2A97D8EDDD4D71857 VIVEKY BARRIOS
1,666,300,926 *AF57EA5CACC0ADBBD90940B58B6EF5B7F5B4D8CF J1MMYL0U
1,666,300,927 *AF597E7942AD564CDD4A5AAFC1E25A983C30A617 jabts
1,666,300,928 *AF53208FBF9D926F933ECB70F6CA380718F7B2D6 JACKMCLELLAN
1,666,300,929 *AF5C4568695C426AF999C72A0548CEF73643F60E VORSCHUBMECHANISMUS
1,666,300,930 *AF5DA4D62BBC67D53714B636B192B00B46C89A14 JANCKERANTE
1,666,300,931 *AF5C2ECB133A280BD1D7C4643C6E384A97194C1A VREES1234
1,666,300,932 *AF52B6199249E04B0DF2D990E10B58106BB22783 janmita
1,666,300,933 *AF5F9F0AC9D7EC0D14196C4C6B324CA503D00DAB JAYYOCKEL
1,666,300,934 *AF56D0C9FD0388918AD8BAAF6F6CFA2644FBFF1A jeffersonkennelly
1,666,300,935 *AF5460285D93A042DB57E4AAD7E6910AAB109041 WALLTALKTHIS
1,666,300,936 *AF511F6B59525A73C04368F4EF0DFBC064646AC1 wallydoerner
1,666,300,937 *AF586ED8485842740858AC6425EF5917B2B6B141 WANDERSON-F-BOMFIM
1,666,300,938 *AF5BD1734AD327FBAA8447B124943B080CEB06E9 jeremybodin
1,666,300,939 *AF56C799DFD327350C3E3A5A08975F3638CCAB41 [email protected]
1,666,300,940 *AF5326421E2316227D6095A1A50F1FEEF60DC439 WDMIA
1,666,300,941 *AF55FF68DA77DC2DCA69BE00118A270C7A0F6AC8 JOHN-DE
1,666,300,942 *AF56E95206412A736091988D7659522786CE37D3 wendyyomama
1,666,300,943 *AF56C2B9FFA3166985FAA87BABF59944A8732379 johnsondiop
1,666,300,944 *AF5D73C5D535901FE4AC1A80CADB3CF74B2F6E18 JOLVON
1,666,300,945 *AF5FF57E8680EB9072EBE2372DBDCEDE8F127F87 JONAH.HUELSMAN
1,666,300,946 *AF5F8F1AFDBF80626FDC6B5510BB9F2A4536A66E JONAS.QUICKLE
1,666,300,947 *AF52F4CCF60EA49F3DC9B1FDE8BE42A3388472CC JOSIAHBRINDZA
1,666,300,948 *AF54BF83035E6F2930FC985419A42563A43C1910 JRHOLMA7
1,666,300,949 *AF559DEF7DD09010C3D312CEAEF213A52EC9D3B5 justin-kung
1,666,300,950 *AF59FF26A0D8B2EC606C1C184023E072A7C7F1C8 JUWIELJAN
1,666,300,951 *AF5788AD286D66A72624CC88E9AB58B27880B543 KAEDEN386
1,666,300,952 *AF582879D6433C9BF1CCA5BA4D0B7EC95BBCB4A1 [email protected]
1,666,300,953 *AF5094C7A87BA58242B473A24BBF0A16FEC73C32 [email protected]
1,666,300,954 *AF5EFEF9B964A8FB123508CD8CEC1DAA8299F75B KARAVAKI4
1,666,300,955 *AF5CA633D472726C2DAE7DF939AABDA27887CFD1 karlpinion
1,666,300,956 *AF533BF8DD22008003021FEE993E8E3BAC9CFF91 [email protected]
1,666,300,957 *AF501B3A6335A7B48DC0E03ACC7FC883B742ECE8 KASIMBO
1,666,300,958 *AF5C0940C68456E823F64214D9276B3E52FEBDFE kaspercrw
1,666,300,959 *AF5F3AEBD60DE90039B63286C7548147C005DFA6 kaya704
1,666,300,960 *AF5305D55FD00A3EFF423554C69E4DFD8DE23F68 WILBERGRAMM
1,666,300,961 *AF575FA5922499C2D886A492F69329DE8C7EA956 WILEYPANDY
1,666,300,962 *AF54E1480F392E493B6D4688B554EB2C988965F3 WILFRED.PURWIN
1,666,300,963 *AF5922FD2DB8E80E58451E04AF10B30DCDC1243B WILL.EWER
1,666,300,964 *AF59D43E891599212FA638DE500FCEFD4D390100 KENNITH.BUCKLES
1,666,300,965 *AF5A4C025F2CCC8FF2FA0FC5ACE0FCAEE2E52B50 WILLIAMTANWAINION
1,666,300,966 *AF52E29EE613DF725A289BECC01D26BE1C95E83F willieroblin
1,666,300,967 *AF5DA412B80D32F4FCC8B79C6CFE6F4B8A054210 wilsonterris
1,666,300,968 *AF5CDD83A88E1D9F2D0EEFF783AE504BC0C55BBE WILSON.TERRIS
1,666,300,969 *AF5BE8B256D19095852C9CDA62DF107944097716 [email protected]
1,666,300,970 *AF5054E5F7F3C122AD24DF0873D83D7A3C35A009 WINNERT7
1,666,300,971 *AF5BA39568CDCDECA9073ED1B8332562E375B6C8 WMMILSAPS
1,666,300,972 *AF53C1B2A9518C502F1D38D691568A7F972D35A6 kloaköppning
1,666,300,973 *AF55CA8E0BC19814009451F6D2BE4AA925E33537 koreyholtzer
1,666,300,974 *AF56E38BC2EBD75C0F9C5EDD9EE4B9B1454F9CCA KORROSJONENS
1,666,300,975 *AF5FBA9A089B0E76E5F02A5B9CB3DF218ACEF70A kra42185
1,666,300,976 *AF5275B34C1CC50596EBB1FFEC4B05E1433A13E6 WWWLINGARTSKULEUVENACBEWWWLING
1,666,300,977 *AF58F47CBBB16990891229B0E5BD64FB94D9703C kuplingged
1,666,300,978 *AF56636DD6D7136DECD81FC4393258EB5551B3C9 WWWTHECAMELSCOM
1,666,300,979 *AF513CE9E6B5479D7CA4C4119A30F7A2A9FAE2D0 [email protected]
1,666,300,980 *AF5CF6626B5FC18E412E6CB7E5623E1EB1444620 [email protected]
1,666,300,981 *AF52786986E496E481F68700AD69C1774E3FAC42 L9V7
1,666,300,982 *AF54F3EB469244180C9C914CF9BAED88E267EFFB XCOUNTRYHANNAH5
1,666,300,983 *AF505E4FF8012644A8F2134C23AABA4C5C8CD735 lamontwiley
1,666,300,984 *AF585FB87A20A2F81FBCB7D8C74B3A61BCCCECC8 LANE.GRAUL
1,666,300,985 *AF5A76BAB1FFC86F82F1F9BD0CF8471C2C87089F [email protected]
1,666,300,986 *AF599E1BDAFEFA2A539F34248D959746B3C8E363 LATERREDUMILIEU
1,666,300,987 *AF5AE3E26B6A3C0B275A7A49E534150D7EA7565A LAUNDRY BLUES
1,666,300,988 *AF5A743C3AA846DB0F86F75AFB9C14DA1C87C2F8 lebesiatnikov
1,666,300,989 *AF569E3D85D7B2365ABA45AD699DA20321898F86 [email protected]
1,666,300,990 *AF588B9FA5168A65A81C74B6C86E61EA96D08666 lelandmilstein
1,666,300,991 *AF5C1FC07D753EBA3F6DF86F9992DD938B68F6F1 [email protected]
1,666,300,992 *AF5A35DF14A794C1145AEF0F7287E1B69976017E [email protected]
1,666,300,993 *AF5E744B06D7988A0324A7DD9E8390D58D235C6E xowii.energy.drink
1,666,300,994 *AF5C26DF696C32932C6450B401B1AF7C948A1D8E LENNONEMMITT
1,666,300,995 *AF52CC2F8416511F928888172E68ED0F0402138B XTCK
1,666,300,996 *AF5F010E9BBF96FF48CC292359AFA5AF3CC1FE4B lexi-jae
1,666,300,997 *AF5E29252BBD9BD7D8C3CCCFBFA182DE7A91EA5A [email protected]
1,666,300,998 *AF50CF2D978B8E471998D875879E1387617FAE60 LINDSAYLARIMORE
1,666,300,999 *AF54200764D60F5D9F28EE534920902BEFB8CA66 linwoodsarno
1,666,301,000 *AF51386463F391CCFC14F6690562C31F65E098E8 Y9208291004
1,666,301,001 *AF57A76F1087764727E1E23FF1F5D492AB426E07 [email protected]
1,666,301,002 *AF511F6A53E8DDBB81D97198193E5A3F99934818 littlemidget3
1,666,301,003 *AF59923AA652771C7915863EDCE2B634757EE6E2 [email protected]
1,666,301,004 *AF5F73D0EC8D5D16DC49970ACECD1E911CA93EBB [email protected]
1,666,301,005 *AF5FF70F242186CE5074ABD68236B92E47ED6589 YILMAZTER
1,666,301,006 *AF5F3E89BD1D8D0EA4D4F21A6AF1BC611D913D7B lowellcolley
1,666,301,007 *AF51844E34237E9BB06167E477EC895316F29F48 lozeneca
1,666,301,008 *AF5E71C9B4375F2E69FB75277B2ED4E28C665AB2 [email protected]
1,666,301,009 *AF5DFE909BFC12C29AD1A87C848639D3EDA3F56B LUCYGOOD7
1,666,301,010 *AF515280CA18AC4F41423580E1091E860CD243D5 YUSSYMARITA
1,666,301,011 *AF5D209E20164715D2E1408F0B36508085560182 yusuf613
1,666,301,012 *AF5D6AC109E9915B37782A49F6667C56F1FE7565 [email protected]
1,666,301,013 *AF500B63136CA43AA3D177E33C5810AC1F51D5B3 lu'nun.Biber.Gibi.Benleri
1,666,301,014 *AF5583A3485344A156767AC7672AAFC20BFC7768 zac.coetzee
1,666,301,015 *AF5F0E9250AB0393C35828B1154F68FD098EA97F ZACHARIAH.DESFORGES
1,666,301,016 *AF56BB4CEF3FDB1979003EE9AA4440AFA196666C zachary-chong
1,666,301,017 *AF50499BF9DF53C1579B5E42F1E2B8873FE25422 LYDIA ASCENCIO
1,666,301,018 *AF588C50EF100B2B9D393AA823B5AEE73370E360 zackaryslovak
1,666,301,019 *AF54A0F91D9DD95F255E71CCDAE2DF1A6BC27D2E lylepressman
1,666,301,020 *AF5341C2A31133F2E9794AE5BE1E0FF4A2735404 lyudmila.vinogradova
1,666,301,021 *AF51478F40C95B3AB24BEBBC13282DB6A4B1F5BE ZAPOTHÈQUES
1,666,301,022 *AF5FCC36A72C9DABBD66B2A6FA98BEE0C5B5192F ZARZALOED
1,666,301,023 *AF5709C9623BCE553785C9D3D20C52A97BCE44E7 ZEG-'NS-AAAAAAAARRGHHH
1,666,301,024 *AF51312720D107B8CEE1C64EE6216412F5B9BCC2 M4N!PU1470RY
1,666,301,025 *AF536B75B01591D56562669A0542A3E94C7DA356 MACCAIN4
1,666,301,026 *AF5C1E877F01B4B05A1468F5092843599ED4B7F4 MAGRIENDEZ
1,666,301,027 *AF5333AD49A4B96596BB4C65B5F0F15C827F4BEC MAJSENES9
1,666,301,028 *AF52AD15E1600804BFE8051045DF942902D72483 MALAUCÉNIENNE
1,666,301,029 *AF585258E87B568BA38AEEB48B8AC45363D20628 [email protected]
1,666,301,030 *AF53232ED7419976008053BC6C9EC7C32FE71EFB ZTANNER2
1,666,301,031 *AF51AA7D441C427C64CAF5F3F3950793B5735A33 MAP-LENIN
1,666,301,032 *AF5BCDC2BACDCF446C9CA587A8679ACD117ECDBB z(y(
1,666,301,033 *AF5FB5E78492B8B90BC7F209A03EA990BD6F8B8D [email protected],[email protected],[email protected]
1,666,301,034 *AF505836EC6AA9E8D6EA6A58708DE64F58E3939C marcelinosigala
1,666,301,035 *AF5BD2029AEBF93F08C975D04363E0E75C546517 MARCELO.GUNNER
1,666,301,036 *AF597B689BBF475FFB1487012BADFD9A88E3C20A MARCELRUDDUCK
1,666,301,037 *AF562118BAF2EB2B1D85E4A00059ED2B82FEBEBD MARCOS.LAMELA
1,666,301,038 *AF59E15513AA8974D5C9D81A9B1C23E2D8ED9DBC MARCUS.DOTTIN
1,666,301,039 *AF50C0CA3BD3FFAA8A0CEEDC796387E07673AA48 MARC.ZEINERT
1,666,301,040 *AF513A73185EB0D5E7EE669C136C849384059277 ΚΛΕΝΤΖΟΣ
1,666,301,041 *AF584FD86CEE42D7A9911A72871C0383BA9AECCB MARIAM660
1,666,301,042 *AF5EBF71C46D30CF476B0E95CC81357A5CB254DF КАНИКУЛЫЦАКА
1,666,301,043 *AF509D573D80BF77651C792AF1625E2B3F2A09EC MATTCOULL
1,666,301,044 *AF58A279DF8D0E8DB162682DFCCD39100DFC4DCC МАЙОРЩИНСЬКА
1,666,301,045 *AF575A5C309293B2E31D0F8F9E0A0D4B2F83559F РАДАКОВИМ
1,666,301,046 *AF53EB783D069C094BE24FC3AE8BFB1D4649671C MCKINLEY.BRACKENBURY
1,666,301,047 *AF5A1114A873E844159AD9BBE0B630F2A842D3D2 ШЛЯМАРКА
1,666,301,048 *AF52321033A9849A8F5CBFE16AC9A6FD4D8E0F89 michael-ritto
1,666,301,049 *AF58434478F9AB71CAF96B833D1EB0665A71710C MICRODIAGNOSTIC3
1,666,301,050 *AF549AB3C55B99A2611EEC522A6F4E145FC7E230 MINA.THRWAT
1,666,301,051 *AF55010EBE0C8FFCE31FF3017BC48112FA0195C9 MINDFULNE$$
1,666,301,052 *AF5C7DC4F0516DD5239AEF655BB1DF9D55D4B804 MIT2526
1,666,301,053 *AF52902D404D6FEC860B78A7738F30F289700B9F mitcheleckhardt
1,666,301,054 *AF5B2E79F99A4ACAD41EAA4DCCB3CA209A010EA0 MKOGINSKICOMPOSITIONSWITHMUSIC
1,666,301,055 *AF5C010719D4705BE2971765A4EBF8AECB0C6157 mohammednorgard
1,666,301,056 *AF54EB5CA0549D6A55A5601CF6977FBD16F576D1 MOINDREMED
1,666,301,057 *AF5DAEB1E506E98F5AE91CE604F26E2F57BC7CCE MONARCH.82.155.5.101
1,666,301,058 *AF54D5044334DE628CC9318D645DE660FCEC72B7 montekracke
1,666,301,059 *AF514B60A991F514AC5A2088FF5FFB7826191EE1 026KEENAN
1,666,301,060 *AF5C52B84C319F840A1B36B83070B9DED463AA12 MOSHE.GIRTEN
1,666,301,061 *AF53EBF4BBD2EA7AE3B7071C92CBED301AFED883 0D31A417-DE80-31AE-8E6B-BB848B3541D4
1,666,301,062 *AF5A3865D7498FC64EB6A25B820FF404C62A6336 )0(O~0~(======3
1,666,301,063 *AF5063D264BD4D9956232DED37D2C54F7850967A MURIWEY
1,666,301,064 *AF520365872F0C921615ED47B62D32FC2CCDF23C 125TEAMO0O
1,666,301,065 *AF55D40B2C82CDD6F7E24B4490ADBC898B71BEE8 MUURSAFE3
1,666,301,066 *AF5A9451712C992E0CABD479D4CABF9C6FCE341D 12MAY1875
1,666,301,067 *AF5593E12E35CB7D42845BAEAF0E9CCFC68B7D58 [email protected]
1,666,301,068 *AF5D52E6F7B0B46074783E2EABA90B30381C7DF4 1342555 keinemedailleohnekehrseite
1,666,301,069 *AF5F0B9EA13C264A7798D5F7C44EF2799EA359CF MYHILDA08
1,666,301,070 *AF55C794F18DCE5C7A68651FFCA274583A10389D 14.10.1476
1,666,301,071 *AF56BE5A50FCB66DDD818D5742D1B80F21958430 nailitpe6
1,666,301,072 *AF555CA0AAF78D58BD30528428E6D7072C7D8653 1921536 alayhdistyksen-ty
1,666,301,073 *AF5F332985F7D0F64A59148703CD59FA6B149CD3 [email protected]
1,666,301,074 *AF5C63639FCFBE69018C683ABD29986AFC2ABC07 NCE$7U0U$1Y
1,666,301,075 *AF53D8A112C2F2C3990437B215240D55EA2D025D |@1a
1,666,301,076 *AF54A5790E85B2F1AF87E24549721171602B72B9 nedjelo0
1,666,301,077 *AF599B510C7A6F28AF564B6889FD617AA49F68D3 negativeph
1,666,301,078 *AF596BB00ACB724260F757EA94C92E6DC139BF66 1AUTOGENA
1,666,301,079 *AF5137DBD970AC4EED8E2798D2C9965C12BDF4ED [email protected]
1,666,301,080 *AF572F2E0B9B6D47D9E38B8A93E724FC6FFB3470 NERETVLJANSKA
1,666,301,081 *AF5989F14CB68DDD181CEDB7CF66FBF373FCE5D5 NEVESL
1,666,301,082 *AF55D2015162C80FF8C034947B1CC05ABE827A3F NGADAMPAL
1,666,301,083 *AF53C6E3AAC2C3987CCC1D58CE813682FBA1C310 NICK-ANGELIDIS
1,666,301,084 *AF52D231CF58E2D3F526CA5111196B7ABFEF8092 1gutierrezsloan
1,666,301,085 *AF5FFFD4F86B8F2455A4C7B069F0ACE8700BA170 Night-Sax-C
1,666,301,086 *AF54CDE7A3AEDC673CEC76901BA5316CC165FD4A 1-HYVIK
1,666,301,087 *AF5154A46605EB5A34AEB688A10B97E5C4455F67 1internal-combustion-engine
1,666,301,088 *AF5F694F024F0331BA1096B07B7C4B4C74CFABDF NN-365.25Y
1,666,301,089 *AF566C19EE583999F094A992C5D2B29B4CE5D76F 1kilpamalleista
1,666,301,090 *AF5EC64A751B087761DCB3E9B00371B4596488FF 1.KULUTUSHALUA
1,666,301,091 *AF5B6416F7203FAB0C4871B9D28291D06084E626 NOESKALSKI
1,666,301,092 *AF55BF6FEFA989D4325276021BFBD3733B958A85 nonanimateinanimate
1,666,301,093 *AF5D1525DF0126E83842267CF4B9504CA4D5E4D2 nonseparablies
1,666,301,094 *AF5C03E830ED8900A936D4D00917A9B777D3F350 [email protected]
1,666,301,095 *AF58065BBF1D3C677A589696E929A6A26BBF3680 ntakyky1
1,666,301,096 *AF5F12FE0DCE62E0E5B4290AC5A53BC0BA0BCB4F 1.resulUllah'dan
1,666,301,097 *AF5DC9CCEAD01AA07DE7D9B6B5E346EC993F6D90 1 riesspasserfluegels
1,666,301,098 *AF5CEF4C18E31A06895BB56110662C7EB37F603F O24712
1,666,301,099 *AF537877FE9CB7084800C377878FEB1BD510E93C 1SONNEULICH
1,666,301,100 *AF5303CC1767046FAB468793EC61EFFF30A623BB 1.SPAETHSCHE
1,666,301,101 *AF55B8575F46A3C68105D18C76A7FE25D3C90A82 OAKBWI
1,666,301,102 *AF5CD5E8BC7694CB574156C49755DC320A1EDB1C 1SZAFRON
1,666,301,103 *AF511974B2BE897268673D788E6333FB7B2AED11 OBOE CONCERTO IN D MINOR, OP 8 NO 9 / RV 454: III ALLEGRO
1,666,301,104 *AF532EECF826EA31FD35B8496BECC372AE683A1C octaviobeldon
1,666,301,105 *AF5CCB6DE40891B8AD733D0BC8A984975DC03A6D OCTOPUSSY: PALACE FLIGHT
1,666,301,106 *AF5569501E2F18465E5A489035F5067B51B86DDA (><).o~.d===p
1,666,301,107 *AF53EAC107A9A07FE1DC126E7C1665CFBD129B92 OFF-THE-RESERVATION
1,666,301,108 *AF5FB99606664898A71DCF0374BFD05B5416EEF1 OMER.BETIT
1,666,301,109 *AF5C4D96DA0BCF407D3FDC44FFC79BB3E332E07C 20PHRED
1,666,301,110 *AF5ADF4F5058DE59939FC26C4DCCED8AF2CF1B45 211d液冷活塞發動機
1,666,301,111 *AF54A3D31CE5EB07AB05B6E9EB1B1841018A6361 21JKLOSTER
1,666,301,112 *AF577BAA5AD119E856A7CD9AF5F591B360FB4571 ONLY_\\\\'5\\\\'
1,666,301,113 *AF5D0346FDF4ACEC53FD4013C250B343E84F5873 OORSKRY0
1,666,301,114 *AF54F2564CB085A71637D9A54B288E68D97AD04E 2431844 JAETTAVIAMAINOKSIA,LEHTI
1,666,301,115 *AF5938BFD1C1C90BF9129D641A6E9231C9BEBA84 OPGROEIENDE!
1,666,301,116 *AF5C14FB43FB4953541BABCD9F431208FC0C30A4 250DREAM
1,666,301,117 *AF55BAB186976429B88B554B3F8729E70B344142 ORGELSCHOOL
1,666,301,118 *AF5AD8C8510E1455DD0BC37F1EB8DC8299F17CA8 27may1608
1,666,301,119 *AF5FB59CE8D6506F1812D8377BE3278C12709443 OUTLEFT4
1,666,301,120 *AF536496E2E0AABE53CF80252AB1135CBFE9BB95 oversides8
1,666,301,121 *AF5264A2A9691C943EDEE7A3A2B8CDDE2D1FF4FD 2-esiintymistapa
1,666,301,122 *AF593CD3DE40051FD308AB7172773D8959A8E740 oy*j
1,666,301,123 *AF5EF0405D07BE1C88927D1A61A28722743FC217 pa22word
1,666,301,124 *AF5C75EB0A870D5E35AAED7AB77DA078FD27F9DF 3======>`~.`~.(0_<)
1,666,301,125 *AF55C7B0451CD112F691EB841ECD34FFB88FD508 panterafloyd
1,666,301,126 *AF5C8EF0AF488BEB00D542E35963AB77BAB5B644 35CB8AE10
1,666,301,127 *AF56D1A2E7240CB76C9D39F2CEBD7A1C7E1A7CDB parsavands
1,666,301,128 *AF58607540005C522F5F18F6EF3925DCF8561580 37812 ancak.kalbin.biraz.buruktu..
1,666,301,129 *AF5CD8A21E239A3F7802EC59B6841C7761391C07 PATRICK.HEDGECOCK
1,666,301,130 *AF5F7867ECA5668D4E15CA6AADB306F027D9ADC5 patrickmcmurraycomwww
1,666,301,131 *AF5019B5B16731CBCE03FDB2472B94A2AB646EB7 patrickrickman
1,666,301,132 *AF5966C136B3415D65E814E1D38DEAED84D8D99C PAVILIOJO
1,666,301,133 *AF525B011B5A7C317876AD5C0F2CAF07A8B182CC 3COURREZS
1,666,301,134 *AF5A75A7A031EC322A12661E6E1E5A8AC5CF0E50 3ETKRELVE
1,666,301,135 *AF581881F111409684915823D1DABFDC866D1D51 3fernsehzukunft
1,666,301,136 *AF5728BA87BABD4EA06AB1914183C8D3891AABD6 3ILUVMOONBEAM1
1,666,301,137 *AF586D84110ED995DB7B56A3A0CA506828D66137 3--).~O}8{
1,666,301,138 *AF5312CEA1CBBD2291E93B20218ADAF95908D93C 3THATSEARCH2
1,666,301,139 *AF545C134B04B1D6E8EB9DCDF597C4CC01859606 464023 verkkojulkaisun.k
1,666,301,140 *AF5AFBB1F85971834B7BB259A49E606A6A73FAB8 489lola
1,666,301,141 *AF50255127BF56CAE34306C3E887CB1544AB6566 4CAREZZASTE
1,666,301,142 *AF596C07DF5D0BBF10888E2F179A6460021E4ECC 4CKARDPA
1,666,301,143 *AF511F16C1B450BE1D44E12BF70C3B65D23D949D PHANTASMICALLY!
1,666,301,144 *AF53463E7EEDDCFEE6021848CF1F155EC142A45E 4KOLEKTIVITETA
1,666,301,145 *AF58433E9838D4632B6E748FA6D2D65FEEF90AF3 [email protected]
1,666,301,146 *AF5559045D1011D3FF7D83C2C35ED5CC19989D0A PIANTERAI5
1,666,301,147 *AF55FABAE650FCF0AD32B0AD1EE1C65F5F490495 4MIDORITHEATRE
1,666,301,148 *AF552636B9867FB0A5657E5E8F4845430375019E PITBULL SPEAKS...
1,666,301,149 *AF5A4CF79C3E6CCEE85CD1A91FF508E34B2BEDF2 pleaseradio
1,666,301,150 *AF5D88613826560F498F5BDC0B5E55346CD0009F POODDUANGP
1,666,301,151 *AF58E4A0404F83F607D32E61684F1826CDADB854 POULENAR9
1,666,301,152 *AF55FE94D370EEB8B88015F0EAD635DB7BCD66D6 4ZOMPIGSTS
1,666,301,153 *AF5B52EF7163B705B322A84D2FE1A9603A035119 5257192970DC321F88D6B150E077F93A
1,666,301,154 *AF5A95680AEEBBF0EEE930FC3D4DB476A56992A1 [email protected]
1,666,301,155 *AF53D2F11A7432FE55734A949BC5BB4E6607E44E PRACTICALTHEORETICAL
1,666,301,156 *AF5BDB82D1B164D23F5B6CCD17755E2C3C53B250 5BEGEISTERNDE
1,666,301,157 *AF554D83AFB318423F75F924BA61526C54CE51B6 PREVZAT
1,666,301,158 *AF598D6C56ED03AAB71B6949903A939500C51F1A 5FJTZTJFD
1,666,301,159 *AF562D8C6130A0D13BCA1B0C555DAC7E5F21EEA3 PUNKINPLANET
1,666,301,160 *AF58A31F905B227D05F047140D8E8E896E350DEE q[\
1,666,301,161 *AF589E6AE4E92B5D7F4897C35ED42A521A27CF32 5QEYKESDD
1,666,301,162 *AF519FB645EA7E2779B8A5E4A272CEBA9C3AC635 5REDALBTN
1,666,301,163 *AF548ADC933BB0A53A4D0E64C7FF95D486F23742 qm<u
1,666,301,164 *AF51151B3601BB2081B048988980E7EEE58ACEC0 QUINN.NEALER
1,666,301,165 *AF5D244757B7E34F52F74553B292CE94967EB7F9 quisiera.inventar
1,666,301,166 *AF5CF6515B4E06F6A5ED4C3AB0326012231C368F [email protected][email protected]+y
1,666,301,167 *AF50702A515FBDB3CBC08D3935A57D7FF5504256 600CHRISTOP
1,666,301,168 *AF531C460AFCDA7E17577A4305A938C8B5C5CBB8 61AKIRA
1,666,301,169 *AF5A88D1D83C0C23284B9E1E0028D1C3DB330854 ramon-margalef
1,666,301,170 *AF5208DFAF23FF0CCB8F546C00384AB82769F732 rayfordsouvannarith
1,666,301,171 *AF5FBBF7AA496D04A1D210C1EC4D621337B93CA6 RAZORTO
1,666,301,172 *AF5938B9AD96C08E3511C377594AD849594C3F9E rebeccacaro
1,666,301,173 *AF55EDAEBA94889B98257F39D8A0FFA7ED00CBE6 REFUGIO.MILUSH
1,666,301,174 *AF57318FF3D44CCB69AE2B724977223E9F5CE4E6 6INFOSNUFFY
1,666,301,175 *AF528697ADAA5939F7168B3656C37D1D048B7E9D 6JHT
1,666,301,176 *AF59A04FE133ED84B714635468167A310F7E5B25 6MARGURETE
1,666,301,177 *AF5FE71DCEF4B82F99E70256145BEE77128721FD REINGEGERD
1,666,301,178 *AF552A46DFC0370C0A33307CED3671DF5406CC61 6POIUYTGARFIELD
1,666,301,179 *AF57E04F1BE2B8F76DB4F7005A1DF9512992F95A RETCENNOCER1
1,666,301,180 *AF5484755A0C5118CAAF4BB5E3A341D2E3E144EC rettelop
1,666,301,181 *AF5D89FED655987133BDAE66AD787249E1608CC4 6TOGETHERPLAYING
1,666,301,182 *AF5C45A059716442BAEF4ACCFCFB88BF4FCF31A6 REYES.OHL
1,666,301,183 *AF52059A19AD45FB4EDEFE4593B37CB8A283301B 6x4k9pkvwsdddx
1,666,301,184 *AF50A87D079454E161B999FDE788783408FD70A7 rhartman5
1,666,301,185 *AF56B44BE3D83979EF632E956F1E7822A0E60727 RHOSEANC
1,666,301,186 *AF5B955E363A6B5CB7B2C6A8A4D657F51AEA5FA7 RICHARD.ETZEL
1,666,301,187 *AF5425449F8ADD2A5481DECB4A9918E0BF8E6414 RICKSTER692
1,666,301,188 *AF512E56DA5D02647ED6CEAFB8BC3487847FF512 RICK.WALLY
1,666,301,189 *AF57AEA5BC93D4CD8362C59623B126011FDB1312 RIDICUL4RIZR3IS
1,666,301,190 *AF5EDA8690F0D53E68A9301ACF4F5FF91135C3DA 7BSWINEERING
1,666,301,191 *AF5F8AC008F61E2F693B098FD5754F03635B3304 RISHEENH
1,666,301,192 *AF569E81771CEE270AFC26FDC6674BAE39B8B3FA RLZNGLY3
1,666,301,193 *AF58FBE06766CFE40B5F4A029848B739E7DD0668 RNISKOJA1
1,666,301,194 *AF5FEBBBB9AB4522E4DFDCEFE0CFE2295C755677 robbyeven
1,666,301,195 *AF5C238FDFA7980B1F9F173F9445B455ABB66200 robertcharleswinthrop
1,666,301,196 *AF5759131C955D04322962E663ED588526336E43 RODNEYCOHILL
1,666,301,197 *AF5816A2F06F3A6FEA35EDBBF88D24761D7A2FCD RO$E$7
1,666,301,198 *AF58EC3747A0CA9DC8EE46FCEC234C1A787405A9 rolfschlee
1,666,301,199 *AF568E6B225F16EEA508DB3A7FCA6C7CA7DABD79 RORY.DESILETS
1,666,301,200 *AF5B0DABC5F0160BC6CECE1BCF263E2BE1F5590C ROSENKAVALIER.11.0
1,666,301,201 *AF591808D889F9EF49DDB0D73E5A6B5A98B57D3C 7HORNETSGALAXY
1,666,301,202 *AF59C5DABE4C1E013728D915977F090219AF7C5F 7HYPNOTHE
1,666,301,203 *AF5854094572A2DF065FB2DEA02AC4D6E7846607 royalhuskins
1,666,301,204 *AF5E9E22880C99F0BD19FF003B6CCC474A740AB4 ROYBAUDOIN
1,666,301,205 *AF5F735821EEF7DB31B5007D21FEF26641DADE82 7JESSICASADIE
1,666,301,206 *AF5858A295984A6AC4311BFAF28DD47D6D86D452 rsc.
1,666,301,207 *AF5C5E01808596980EA8CAD56624AE349ECB62BC RTJOTFFEL
1,666,301,208 *AF59A03FFEE0E418CA9B360CCB4614BAF71E93E6 rufnr
1,666,301,209 *AF5C110B469376BC1ED96EF901FE2FCEC85B6ABC RUSSEL.RITZKE
1,666,301,210 *AF5CABF273C33225B960FFFF8134C911AB10EC5E s13d10g
1,666,301,211 *AF5A72D3E22C550926B875CA9BABD52CE9D33C93 7VERADALES
1,666,301,212 *AF567139EA9DD319D0A63DC6C4E7FC1633175389 SAMUELMBECHE
1,666,301,213 *AF54F12BC066B7E45C9E077FFFD9A23FC0140693 SANGRIA
1,666,301,214 *AF5579194F198C74E079C430D3EE3B4204FA4351 Satiner
1,666,301,215 *AF59361E4CE5CF12E2D8CA4F5727C8DE45AB5A7C 8DETAXEE
1,666,301,216 *AF501DD17DBEF0313B1D00C47FAFC28A1E458DDE 8FF5
1,666,301,217 *AF52D93E97C92C96484582922A99642B68862A76 8GRAYMAILGRUMPY
1,666,301,218 *AF53464DAE7C3A07BAF36DE986CAD3518EB43E04 8HOSPICJUM
1,666,301,219 *AF5C6D77C760D33E90B007D2AD0C401134052522 SEBASTIAN.SNOW
1,666,301,220 *AF5EED26FE4F29945A1B71C39FFC0612690362EC shannon.halterman
1,666,301,221 *AF5896B5083BE2B98D4645F857E48548D70CDEB8 shawntp
1,666,301,222 *AF527D05218EDBFA864EA86D7A8D5E1C80932B43 SHELLY.RANDOLPH
1,666,301,223 *AF5EA2B77A8119FD6DDA6536C670087870FB58E7 sherri-thompson
1,666,301,224 *AF51BAE2D6276B7809F55B8465401DBACA230EE5 shingkor
1,666,301,225 *AF5AB73E4754263C62D90A1E057C9B3C9FA2D76E 8MALMINTUTKIMU
1,666,301,226 *AF510B8511ABABE62E13BC690E2207C52388CAF8 SHRUB/S/R/@/B
1,666,301,227 *AF591F4845540F32B561356F5251FD609364E256 8PAINOARV
1,666,301,228 *AF5F73CF77EDA4620EB0FE9D55412EB7DD02E294 SIDTIERNAN
1,666,301,229 *AF55BF4EC5B8BA4B7CE6A7AEF7E41046B07BA1A2 8PERREXIT
1,666,301,230 *AF506E21CEA44D1F5D3A9DE54787BE15CA1D1061 )8(~~(#####Q
1,666,301,231 *AF5DE37091EE7A8F8E08092983EC968CB238698E [email protected]
1,666,301,232 *AF525D7110FA002AA62042690A1E8630C620BAC8 9101759
1,666,301,233 *AF5EF27856301ADCC3722BFF12CC52FB3941E6B1 9AVOLEGNA
1,666,301,234 *AF526AB27DF2CB31597CF90FA9B4393677C1956A [email protected]
1,666,301,235 *AF5657D3D70EE7C2D94F5A61A71D4E564BF90904 SLAUGHTERYARDSLAUGHTERYARD
1,666,301,236 *AF5CB102E520D5956BA6D61609F2F5FECAFEA837 SLIUEFRE4
1,666,301,237 *AF5760BADE7864B4A2498A4EFC52BBB4D63F71DA 9COLORADODESERT
1,666,301,238 *AF533E0331957C926CC0DAB666825A1A0E695979 9e0ceed61438ee32a25752c1a9679c946696d6cf
1,666,301,239 *AF52D2D293122875DF797D4006ACD69BA9784493 SNUFFYGHOST2
1,666,301,240 *AF5194152318632AC0DC609319DA12041E530A28 9KKALNINS
1,666,301,241 *AF5151505168561916E49D82843B618846351537 9NACHTBRAAKTS
1,666,301,242 *AF510F8FA9978D025F4439D0C38841EEC692F4B9 9OMISSARUC
1,666,301,243 *AF5EA9A8996A9033152BCB64175439C54C3A74DC 9PIERCEMONEY
1,666,301,244 *AF5BBB5744140898A1FB32E4F52D538E6DD6F4E1 SONJA-PAVLOVIC
1,666,301,245 *AF527835CF9CA5E5AA2BB53E96638116C2451693 9PROMOUTERS
1,666,301,246 *AF5F955B1D4DE8D46159723EB08B6E76D96AB8B6 SONSDECARRER
1,666,301,247 *AF5F67E766A7DD069713DA8505EE04B428892923 9 similarsize
1,666,301,248 *AF56D1645BF3C8A921B7153AEB12DDEB10B1DC6B 9thatvolcano8
1,666,301,249 *AF55B6C4684FEFD50A2610780BD875550BB0F67B SPELLNAME1234
1,666,301,250 *AF58992DC16E61696CAB5C4770925EAB44D6BA94 9ZEPHYRKAPUT
1,666,301,251 *AF5F7116AE0487DC08DE274DBAD6EAF5F7E0584F a(0ce
1,666,301,252 *AF51E14127D389F412E92EC10F454A4A0FD624EE AAEPM*
1,666,301,253 *AF578CF557E68C41B9FCF659F70E91F277F0D776 A=aM
1,666,301,254 *AF58578F0C8379603206DD47F206BCCF59684D85 [email protected]
1,666,301,255 *AF526E1C4B2AD5DA521A3143DE69EBDF9B8DF25A STICK49
1,666,301,256 *AF50711EF25275695DDCECD137931A8453A72121 stmarystpeters
1,666,301,257 *AF5560E9F193C8B599E7B59287489EC0035B7F73 achenar'sprelude
1,666,301,258 *AF599D49EE73DFC0682906229585DC4EB13B7AA0 SUNMAYBE
1,666,301,259 *AF529299B3AD10267B2FD9EE8959961F9906034E [email protected]
1,666,301,260 *AF5AD88993F7C99562F9164A87A7E49AE0C4D7DB SUPERBLASTER4
1,666,301,261 *AF5D9D8591F185225741C6D7D4E72CF363564D58 superbusen
1,666,301,262 *AF56A67E933F8B6C799FDEEB623A3DE4F4FA68EC ADRIANDOG9
1,666,301,263 *AF5BD3441B66093EBCD7A79854F57FB1802A789C a;.e(
1,666,301,264 *AF5D57728BD3F25B2FD4E346198EABA422E2E7A2 agram 4
1,666,301,265 *AF508DD129634D606645C979651E380096F712E7 [email protected]
1,666,301,266 *AF5844ADA635ECA40CC13BFF5C8AB299B3B3A66C tannerpriester
1,666,301,267 *AF540FC00709FB0A95A84DBCE7A0AC71EF3A80D3 TARWARSS8
1,666,301,268 *AF5422C3DCA53CF257D4A8AEB5DBB51541D2B0F2 AIILN
1,666,301,269 *AF5466845514ED287671969147A622D672FF9ED2 teodorotacdol
1,666,301,270 *AF56745B429863150C65F3C0F429BFCBE2262360 TERHELHETŐSÉGÉRE
1,666,301,271 *AF5AB8C1BA27544C0A45D7DA48D6E3D540C53A98 TERMINOLOGIESE9
1,666,301,272 *AF56F7F766932713E2FE379669DF60D132E9D273 TESPUHSTAHWSB
1,666,301,273 *AF58CECAC8DC54291D97F6BAAD529DF2C7F400ED TESSA334
1,666,301,274 *AF53D7F9BDF0DE2CF03B411E8647585FDB25C854 THADDEUS.VASI
1,666,301,275 *AF5EF2D55A3DAC59F6672B794ABE4A21DA398D7B AKPC3
1,666,301,276 *AF550CFE5CD440897355BAACCEC30DACD1B96459 THAISA [ASIDE] NOW, BY THE GODS, HE COULD NOT PLEASE ME BETTER.
1,666,301,277 *AF5BA827B424BFEA58D5620CFBBC3D50A26CCCC7 ALEC.FELICIA
1,666,301,278 *AF52B8EED92CD037738AD718D9111669CF9317FB ALEX.BAYDOUN
1,666,301,279 *AF526487255D672C912FC0271565845AA740C438 ALFONZO.LAWWILL
1,666,301,280 *AF5AE52D788F197E3B56EAFEFADA952225680479 ALIGRISWOULD
1,666,301,281 *AF5F19CE27273DF47052F061ED713DC9A7FF85AA ALLANLOUVIER
1,666,301,282 *AF5393BA4446BC464A834318F8CE135C49DAA3DF ALLEXPENSESPAID
1,666,301,283 *AF567E8B506C49B3402D0C0F6812AF44E7CF2BA8 almostparadise-footloose
1,666,301,284 *AF524590CDCBCA3152930D9565231372CDC0AB7D THEO.DUFRANE
1,666,301,285 *AF51070E3A0E802868CF89CC640FE08E5670BA47 THE.RED.FORCE.(OF.THE.TRAPEZOID)
1,666,301,286 *AF53E88551D88BC248EE7434C9FC0EA0486ECED5 THESTRINGQUARTETTRIBUTETOEVANESCENCE
1,666,301,287 *AF5FC4A3FE4EE09AEA5EB5CD413C4A3A51DAF8E5 THOMASKOMAREK
1,666,301,288 *AF5DA3AEF396A1ADE55973DA5FE44EC6E1AD8F05 THOMAS.LEININGER
1,666,301,289 *AF52CB7109972C4FE17C868723B081037C858F45 alonzosalling
1,666,301,290 *AF59537B19E864F1FA9DFE9F50C1AF8A7ACE1859 three days to louisiana
1,666,301,291 *AF5DBE79070F0BF4153CD9BC2D58ECAC8CCBD7DB [email protected]
1,666,301,292 *AF575FA37AC5DFB4DFA808BA21D7D7F33614B42C TIEUCONGCHUA
1,666,301,293 *AF5136CCC8EEE50DA46E9596146E3D180ED8D96A <TITLE>SPIRALCIPHERCLOCKS.HTML</TITLE>
1,666,301,294 *AF5AFF66B4D9F36F295296CBE1F1ED27C6EEED50 amz)i
1,666,301,295 *AF560582066E7D02B3D530924A8B181A6CD42425 ANDY.SONNE
1,666,301,296 *AF568C92A81C7D4274BA4EC5D6470A38A27D0671 anemie?
1,666,301,297 *AF5B10DC663FE64462F79CBBC572D68C4A24F6BF TORTUREPROOVES5
1,666,301,298 *AF55EB5A3D68A8ABD143948D715FBE7C346BED8E ANIMALS.OF.AFRICA
1,666,301,299 *AF57A600DD1F98D4F61309EE32789D292CFA4229 TOYOTATROUBLE1
1,666,301,300 *AF5EBBCF0C5D08C3767D7ACAE65ED8B58A1D547D TQAPBSW7
1,666,301,301 *AF596DE4EFF929A20DF818404297D86A7DB434F0 TREBBIASSES1
1,666,301,302 *AF57ED9FC8F9F22E3E4BD85284BF488E13182F0E TRENT.SICILIAN
1,666,301,303 *AF5E06BE8637EDE402F7A0E46B39A64801827A09 antjwaned
1,666,301,304 *AF57B25E0E74DF0F1DC86CC88F778CD98505B59D ANUJ.SINGLA
1,666,301,305 *AF5D8187CD3F3992390B18C0078B38FF3F15E12B anv-
1,666,301,306 *AF55444FDFBDE446A7F4C09BBFE8BE7249771B2A arcanumarcanorum
1,666,301,307 *AF5E4359443C68FCF4FD77D8AA3CABCEB4B45F12 TUTCHA
1,666,301,308 *AF53FE0E0674BD08AFEB6C33855D171710C0DFDE ARMANDOMIRTO
1,666,301,309 *AF581010F085BDF08F71D8EFFA3DEE79558383E6 TYLERKIMMET
1,666,301,310 *AF5DE380B7900D4DA86211D8D482EC9097FB0173 [email protected]
1,666,301,311 *AF595F8936CBE0E668E6FE8D80C64EA258CA8897 ubuxpyo50
1,666,301,312 *AF587A744A04E66F4ED5A00B00058CC5DBF9B166 UMAIMAHHAMID
1,666,301,313 *AF55F8A6EA49076CD5AC6A5AF03AA26398AB54C9 umteshmago
1,666,301,314 *AF56A454BA0737007F23EF4E994993E1CC39CD4D unikat“
1,666,301,315 *AF59590CF85306DC7EE44B68D3139E0DCD2EA575 [email protected]
1,666,301,316 *AF5464845AC599DA8CB5C65DB815C1FF24AB5BB5 AS/N)
1,666,301,317 *AF585BAB442401BF3B45CFDFF5447963D9592FB7 [email protected]
1,666,301,318 *AF55B6EDF2CFC9672C70FB954221CDD02899D440 ATNURTSES
1,666,301,319 *AF55940458701BC0FA9703D0B4F7AEF1ABE985AF AU/G
1,666,301,320 *AF5FA4E65549B2FA663F9FF9375BFFC2838F18FD AUSGANGSKALKULATION
1,666,301,321 *AF52A0DA74D2C2B1EC0C7A30D58246D5B6018C62 VANSHDEEP4
1,666,301,322 *AF5E01AF702D31BC6AB7F3FD8A35EF0891E34B8B VAPIWATTANAPONG
1,666,301,323 *AF55C4C6D4FC9154B95963494FC69C4ED5F34332 VASIL-FOTINOVSKI
1,666,301,324 *AF579FBF2602934FB82EC9085F23DFAD3607071E B4#G%
1,666,301,325 *AF5C31F673648569F861DC87739C3CEABBAF5592 b"9u$
1,666,301,326 *AF554D49169AA2629E6254D5C30F42D0F9DA1479 VHODILI
1,666,301,327 *AF542E51779E52E9A5F74022371BB41F3BBA07C3 VICTORIAHAZELTON
1,666,301,328 *AF55445B328C72D9DB3E90B287F1618A1427724A BARRY.MANTEL
1,666,301,329 *AF5017A3BDBBC3723BF1993138F4E4D8F783B991 b(ax
1,666,301,330 *AF5C52740AE2C3F1AD88091631A5ADB7CE2DDE8D B,+,D
1,666,301,331 *AF5187B3C2DD787F2176364B050E09AF822EA41C VOREXERZIERTERING
1,666,301,332 *AF50C61A56D81FF3DDCB5C52F2551D3D85894B6B BEDINGEN
1,666,301,333 *AF5809036BE7C7D4F5C2992231FC15BD685436CF belgian style pop
1,666,301,334 *AF59F10A3CAF78ACFEB12D4BCD206818D40905FA VVGJPG
1,666,301,335 *AF53D737D80C4BDA6BDBEC7C4C2712B051306B58 benedikts7
1,666,301,336 *AF5D6AF02842D5B1DB996B52C469D1071FF6006D [email protected]
1,666,301,337 *AF597271F44A02D0C1D397D76C77F3B06998AF52 benitocartegena
1,666,301,338 *AF5D28780BCD22B7AF825D6DAB204D5F602E23CB benjaminuhler
1,666,301,339 *AF52B662BE3A496119245FC3C147B30987FD066A benzoxies5
1,666,301,340 *AF5F708598C0A051DACA08137CBCF4E773DA0CF3 BERNADETTEBROADBENT
1,666,301,341 *AF53D4633ADB5376CAD34C0D99464A3178C5ED32 wagonnetjes!
1,666,301,342 *AF566862C6F91A99C0DFD2BC10DC0D2FD702842F waldsamiglois
1,666,301,343 *AF56BA5360A72BED941923642B69D234CA54A49D bi5!g
1,666,301,344 *AF5717EA2124CC848B02B4DBC87C4FCED4B07247 web.xenon
1,666,301,345 *AF55AE42CD43CC668C1FA84174888587F36C68D3 BK-0
1,666,301,346 *AF580194A764424546252DFBDE16F591ACDF7AE0 [email protected]
1,666,301,347 *AF57CEC2621CE413AADCBA82EDBF4B4F2BD28F15 [email protected]
1,666,301,348 *AF5B6EF012293F8968592373DCE06430F55F8F42 BLNLX
1,666,301,349 *AF5F3AF58A13FF0F5B5AFE9D88EFD9B72C7D55D8 WHOOMPH!(THEREITIS)
1,666,301,350 *AF50C7F90FF7C16F68F986E607E92610A03D8F9A b=$p,
1,666,301,351 *AF5BEB1A84B0E4AA162E171CD5A1D176F78B81C1 B#QC4
1,666,301,352 *AF545A893BA0A4AFCEB0130B975044BD86DA6E93 BRAINPETRAKIS
1,666,301,353 *AF56BA1E6AE300178B08A68700D269BE2E5258F2 break.box.blues
1,666,301,354 *AF55E7DBA1BDAD5B2CF630128ACDB6FD111D3F2D WWWSAIDTHESHARKCOM
1,666,301,355 *AF5A79C36D8F158A077BFBFF49CB7C0088D22471 B$R;O
1,666,301,356 *AF5262121545F2975747B247E411D6B2E1DD9F09 wwwthechanceryhousecom
1,666,301,357 *AF59262FF158B95C273DD2BD4E3D3A77DF5D23ED XAVIERILLIES
1,666,301,358 *AF5EB99B090430F3834FDA8D9BF20F213C354AA4 XAVIER-REGGAE-LUAU-GAYLE
1,666,301,359 *AF5D75C697D766BE842E4D97B68EB6064A3220AC (X) ~` ~` @##B
1,666,301,360 *AF5E7393D69EB452289D01007FAC457220876BD2 BSFSV
1,666,301,361 *AF562E1CA53E3B38B845F556F61ECD3C82FA1A49 [email protected]
1,666,301,362 *AF59D26D83E53E2149FB2DB6EC76B0E13B2B3B80 bswmxjbsw
1,666,301,363 *AF5F5454EA5316C0A13D9BC9DD637219B9D35DBC BUFORD.CARDILLO
1,666,301,364 *AF5C7D2699EB16CBDB1173C977E2C61495438F23 BUILDING400804N
1,666,301,365 *AF5E0876ACC483C5A90514B48907A64D140EEA3D XPLGI
1,666,301,366 *AF555ECE1C0098899AC70FCDEFE4A6188663CC3F BUTCHAUGUST
1,666,301,367 *AF52AF061EA5A5B22D7A5D40CC315A20BB5D5FFC bw._v
1,666,301,368 *AF5A037806489DFD3DEA7D915DA1BAC9D9BEBAA2 bxup
1,666,301,369 *AF5C18511256EC7951030EA7F0EFF9E598BE89D5 yaosca-chimurenga
1,666,301,370 *AF5DCC794EA587321E6B7C2A24F3610CAFF9153F BYRONFUNKHOUSER
1,666,301,371 *AF580CA38F1ECF957700A9A082A2CDAEAC71F4ED [email protected]
1,666,301,372 *AF5043EF069773FC8DDFA1CA09764CCBDD6A1C82 C0J52
1,666,301,373 *AF5C3E695EF3C08BD811BA2F93035C478CECFBA8 C0RSV
1,666,301,374 *AF54DDE1033083FBA711D0805ED89993F4C8E010 c-1q)
1,666,301,375 *AF5D69CBC2E4E36714300E23B693421C660584EC YELLOWISED
1,666,301,376 *AF52F85A66E2B67CD54C75D2D5A423298B7EC6A1 C4r=
1,666,301,377 *AF5BBDB0468FA598836A6A509B35A8514736B827 [email protected]
1,666,301,378 *AF5B0BA6ED6C9B7BE1D78400B1F36D8513D2EDE1 YUDHISTRIOSTRIO
1,666,301,379 *AF59C66B577CB70E5A7FE4AB1F0273A583222817 CAPITALIZED.ARTHURIA
1,666,301,380 *AF5F01F068C48154621CD08791E67781C02476B4 YUSAK-DARONGKE
1,666,301,381 *AF55E8DD30AA16E3C81CB3AF0D7BC0B521613039 CARL-HOLCOMBE
1,666,301,382 *AF5E160710887FFF688CE3483C0997B67828AF0E caryvorse
1,666,301,383 *AF5B079C198B25DCFF3C3C97087FA00DB82F88E1 ZACHERY.GAERLAN
1,666,301,384 *AF5E1B58B6E3CFBC45C61CFA4C0069F93A475137 ZAGROZIO7
1,666,301,385 *AF5C5FB37D79A7BEA78F1ABE6412481E74545DF2 ZELENBARUCH
1,666,301,386 *AF5812714CAFEDAC8DCD2745B7FF52805146AF17 ZHARINA-AVILLANOSA
1,666,301,387 *AF52510F9DF2AAD541F20DDCB3A47E6E14F60053 CENTIEMEN7
1,666,301,388 *AF5E39D4B0593F8BE2B052DD62D104DEDEB90579 CHADWICK.PREY
1,666,301,389 *AF517EEB6DF2F72B4F20A522027833E0DF1EB575 ZOMNUZZA
1,666,301,390 *AF54A3E8D5F7E434B4449B2ECF20FAC18486AC0B ZORROLOGICAL
1,666,301,391 *AF50905D70F1AAE9B5B1390D97FE98A9354BA735 [email protected]
1,666,301,392 *AF55A31C1EBD34E24392B5D649DE66329CDE0033 CHISAMPAYAN
1,666,301,393 *AF5CA5C711239A098E7634C21826C92A19F364ED [email protected]
1,666,301,394 *AF5DE0F165F36F6E2FC1EDCBE9B7CCC3714C10CF CHR25
1,666,301,395 *AF590A0AC3AFA46132F8587CE90DAA0FA7B248C6 ЁНЧОВО
1,666,301,396 *AF5A786BBBF616FFCEEBA4FEEEE1CC9AB5757790 city.slickers:.main.title
1,666,301,397 *AF5288E85FCBADD2003E8933B470AC10CCFB1CF0 мамаеву
1,666,301,398 *AF5EBEE82CB6A10D67F44427800D63BD861F94B5 новочеркáсск
1,666,301,399 *AF5AC3D647A9FC256FA60937FA4398C2F6BA21CC CKSRATSCHL
1,666,301,400 *AF5E7FCAA1333DA51899AC8CC6DEC035D52296EE CLARITY-IN-CHAOS
1,666,301,401 *AF5E211676F73A302EE3A398EEFF3DE0E64C2E82 ТЕРЕЗИЕ
1,666,301,402 *AF50AF662D1FFFF427ACABEA2FE06488D57BE30D cmyq(
1,666,301,403 *AF56F39C1E31CF1CB73CF2090A374019665DB538 co-defendants
1,666,301,404 *AF527F29C59F6E80C7E9500B9C36F31B269DF164 COLEHIEMSTRA
1,666,301,405 *AF52B341EF3D6908365C7B97837D83B90BE883B4 colemanberndsen
1,666,301,406 *AF595C8193478F70D3A4A0E238E401C3C867CB87 を偵察した。その後、ゴードン・b・ライナー(
1,666,301,407 *AF50FFAD81141DD33367D89D968AFE1CFF27890B CONSIDERATOR.
1,666,301,408 *AF5726E36629F7F224B2373A3AA83AAD071B4121 CORONARY-INSUFFICIENCY
1,666,301,409 *AF5031D8D14C5EFEC2D46976FD3CF72B71F82942 CUTIN
1,666,301,410 *AF542B0DB471EA00114DD7901536D9119AC7931E c{uu
1,666,301,411 *AF5523DED3D5069E4EC887D26325AA025C296815 d40o
1,666,301,412 *AF5EDE64B5B29F29E336B8851F2C88BC0AAE4365 Da6d
1,666,301,413 *AF548B3DC755D59B68482D1671019A9847E99675 の頂上で彼の死体を見つける。残されたC2爆弾を入手したホルトは、ドイツの侵入路である橋を爆破し侵攻を食い止める。
1,666,301,414 *AF5983FABBEFB31AF3F8C07E59474FAA710BAD9C DANCE SUITE, SZ 77 II ALLEGRO MOLTO
1,666,301,415 *AF512DE5B4CA223518C8A18B579F7E29532CAF0B [email protected]
1,666,301,416 *AF5C4B7872CBF340BFA6A7C4A1C79E1CCBAC8D31 DANXS
1,666,301,417 *AF57F36816F51D55AD74DB23AACBE3BC778888EB (00)*.*.*[email protected]
1,666,301,418 *AF552AB58493D93B3F731D5F759AD0F67555796B dbcl
1,666,301,419 *AF51F8089799AAF7821F2A9CE814B6C60993A334 debbieschachter
1,666,301,420 *AF5C42D6CC1BCE0CD8BE04529A10427D772A1107 0ILUVZEBRAS3
1,666,301,421 *AF51D65EF31881CC78B6D55D4136E359B19C8DFC Dechanterait
1,666,301,422 *AF545F814662A822924B589D854B386441AC1E4B DECMAL$
1,666,301,423 *AF5A4057B84CC57FAD2F2612309B8552EA251486 DÉFECTEUR
1,666,301,424 *AF5F81E47AF1D1D8C2A62EB523DE2E30BBFCC2A6 1091627
1,666,301,425 *AF5BCB085C6A7821172BB422702DD810449B21B8 11 ニュースフラッシュ&edアナウンス
1,666,301,426 *AF52A518810DB8042D83C9240121A573640D04DD 11UNEMPLOYMENTCOMPENSATION
1,666,301,427 *AF54108B3A5D6B65D0046D009DB81B7B79733EFE [email protected]
1,666,301,428 *AF548D55FF00DC00C304B3E31B5E86326B96C073 DEOCV
1,666,301,429 *AF5704D0707BBBEDA59D31629A38AF18B0E99B82 DEQ2P
1,666,301,430 *AF530B0A9A1DFDC69CCC9CFAD3FBE955D76E169D DESTACARMEIA1
1,666,301,431 *AF5054143116BEF310127C14CCBE5C68650A1D33 DETROITBEAR
1,666,301,432 *AF5200D099E9AB645D7AD75D622C94AC936BB526 d?fqe
1,666,301,433 *AF50FDB21EE6893846E5FC2A270D88B14E8944EC D(H%I
1,666,301,434 *AF52B1BB9535AAF64202B1D140BE306F9FD61492 dickenwubbs
1,666,301,435 *AF58E6090445140EED8FFC68ADF146B990D12C97 1AFTAKELEN
1,666,301,436 *AF5F6DE2D1394C25B75315A42F9FA6529EFF671C DIGITAL.MAESTRO
1,666,301,437 *AF56975FE13A59F46215CDC78D2C9EFA335F7209 1AUTMOBILUNTERNEHMEN
1,666,301,438 *AF511AC6E67A81C23DCF07EF029DEB4CB4B7017F 1.BADEVERHALTENS
1,666,301,439 *AF500EDD684B4F0D50B7E2BCA39F93D8E0C921E9 [email protected]
1,666,301,440 *AF513DBFBA027BEA51D8FCB4C7B0B576F482AA5A DIVISION.SIGN
1,666,301,441 *AF558E20D722D6A23A8BB7651B6D8517EE8C29F5 do5i7
1,666,301,442 *AF57017A87BCF346902E59B15B10BB979BD5C12E [email protected]
1,666,301,443 *AF5ECF466FCFA313DAAC8AF701FA2D2E670168B8 1JSTAFFE
1,666,301,444 *AF5B433A544A7662E79DB15F20AAD2C9B5A3FAD0 donovankash
1,666,301,445 *AF50E8DED5F93D5A890810A13C24D794D2EB9F93 DOOPBEKKEN!
1,666,301,446 *AF5B16E05566B04F82C6C56ADC6384E9250CB23E 1.MATKUSTAVASTA
1,666,301,447 *AF5FEF18E171A236336D789CD59616E778A9AD5F douzie5
1,666,301,448 *AF576892F0D6AC656E0B8BFFB525B4D22658F7A7 dpj_8
1,666,301,449 *AF5B499478E271C519D5646EE450889C61C3D1AC DPTVIGZHDSNG
1,666,301,450 *AF58A598DF4436B989838AD21911D5EA3B52F967 1TALLENNA-IKKUNAN
1,666,301,451 *AF5C21AD73E5A76F7D4E183EF212D4A6F0A2BD27 dsc06310
1,666,301,452 *AF593E935666EF342387FF2C5C1093E3F7EA603E DU(69
1,666,301,453 *AF533E86939E12A0BB97B8F808CFA5CE38C052F6 DUNP8
1,666,301,454 *AF5C3646A5EF8FCD2350D8C7AD977BF72DABE534 29.yht
1,666,301,455 *AF507E1F44C82290A1A0E2B7F9436CA803DD9E2F EDGARDOVASHON
1,666,301,456 *AF567F286B09D9F1B3BB5C0BB441394A9BC90939 EDIKATIVED
1,666,301,457 *AF56790E462E36BFF07177A5F1A171A0D576E9B8 edkpg
1,666,301,458 *AF54AF3A15986773BDEB98ADD3EC798989C55882 EFFABLE
1,666,301,459 *AF5D587B14ED509E419ED01AB2FBB76C4C91B421 EH%UC
1,666,301,460 *AF5183A0ED1E413522EBA7661D70E1ECE6A10D51 ELAICIZE
1,666,301,461 *AF5FA73EAC0ACBF37F60582B4993A434EB400354 ELASTICIZED3
1,666,301,462 *AF50251786C180348D3DC3748D2F7C32F1A60C41 ELLIOTTBOYKO
1,666,301,463 *AF5C366CB474ADC7C68D0C07E92EAD93B66230DD 3 bodenseeschiffahrtsmuseum
1,666,301,464 *AF52F57F988B88C0E540BB44BD8EA304F05CD395 ELTON.FELLON
1,666,301,465 *AF56234C1C66DBBB74A856384F0B0C32A9E67B1C ELTONMADALINSKI
1,666,301,466 *AF517C146E815ECF2F702EF9179DACD5FBBC6C2A 3b ~ ~ ~{x}
1,666,301,467 *AF592B720094BFED842E324D52D5622B873C12BE 3-mukaveleli
1,666,301,468 *AF51FD573A427D1DDB947AEDA72B60C89F14E43D 3=p***splat
1,666,301,469 *AF53CD4260BDF39F7F26CAF0188D70C534ED3993 ENLARGE
1,666,301,470 *AF5E2451F34DBA9F59F099A66DBDC4405B23F290 413010 fransizlar.1.631.saat.calisiyor..
1,666,301,471 *AF5CFF727206D51B6A08103CCE73FACA1CB88031 4BOOTIRON
1,666,301,472 *AF57C84E950A17EAFCD3A4756F70DC8F70073BB8 4CPENDBSW
1,666,301,473 *AF5EC16FAECFD257C7754FC443EB299EBEC9BC0C 4DILEXIT
1,666,301,474 *AF5B74D1FEA70C363C0A8365C1718FB5DF77AC99 4EICIETQUE
1,666,301,475 *AF5057F85D08A4BA2DC534B119824C0AD7F321CB ERICSON.YU
1,666,301,476 *AF54AEA8C8531BE44F7A0503DC0B96867B062AC3 4.kilpaautoa
1,666,301,477 *AF546CDB139AB5212076F63E79F89214620D9660 4OCCUPEERDES
1,666,301,478 *AF50316573D7BC5A66836D8FD5FAE9F30912411A 4PIETYFAWNINGFLATTERYFULSOMENESSGET
1,666,301,479 *AF57427E4AF5EDDDF4242F7A2630E1F034D7A9CD [email protected]
1,666,301,480 *AF5C18B2FBA2CD96E9CF7477435C939F4474BBE1 4.SAAPPAANHEITOSSA
1,666,301,481 *AF5CB3D7E1CD64845FC646B7EC04DEF3B845A52F ERWINTRILLING
1,666,301,482 *AF5C006A35EB9ECA67096C19502BA35CD9CD851A erwz&
1,666,301,483 *AF529DA217830CC1230F09E4DFB041BF7E8F6D08 eter.diet
1,666,301,484 *AF5BDA539143AFB3112B08D3CD8E54C01869B38A E$T!M4T!ON$
1,666,301,485 *AF5518AF5B18348B5E30282BDA2EBE2B05138248 EUBCF
1,666,301,486 *AF55EDB694783AE60E6078EB38211628524F3CBC evdo
1,666,301,487 *AF5A0EFBC9187D79E842349B635C1C13C6DA5D9E EYQ8B
1,666,301,488 *AF58E2B32741B46C7A043D7086C696926F3EE6FD 5ELBATNIRPNON
1,666,301,489 *AF550D9AE874FA49FB67447644C411FFC69FA5AB 5FISONBSW
1,666,301,490 *AF5576A400726A74D5389C51C08729C44208BDAB faberg5
1,666,301,491 *AF567156B39BF751929659535EED2185309C7797 5NATURALLAW
1,666,301,492 *AF5AB16E62E23A522244ABF1700A8BAD0CC8C90F FBPUTMSG1
1,666,301,493 *AF519E2AC472B7EC3EC42BBB850E26FE6ED71240 5QUATRUN
1,666,301,494 *AF56FEC06FC4E1800DDB2FBB7C9D4B15CE29597A FELIPE.PATLAN
1,666,301,495 *AF51B936FCA713230BAE7949A80D6A1F9505F8A1 [email protected]
1,666,301,496 *AF533CE3FE73D08C35A47E895F9965107C5F4474 5SESONKIV
1,666,301,497 *AF545657406A62D0E4268D3BE278E531F01655E0 fernsicksed
1,666,301,498 *AF51FBCBA18296D9FA5005F3D445ECAE5B5AFC61 FESTONNEERDEN5
1,666,301,499 *AF503332A286EE1D17A2C3F18A2FA7273583B84A 5thedreamer0
1,666,301,500 *AF5A962EA2B62DEF31EC818D190FDB8298086838 final.feli
1,666,301,501 *AF5F418F1CE8D56E4D288CA8C8ABFBA8686727B9 FIREBURNIN
1,666,301,502 *AF5D54BF18D5ED1D0EE831867A4DB2E9F23D1C4A 6EZIMULDO
1,666,301,503 *AF57A64605535CB9AD5235BB317AC2BAECC05003 footbass
1,666,301,504 *AF5E4FC3FAC22D37E59294D03C0D11536C000F79 forsmansundman
1,666,301,505 *AF506D9A900A142B0623F1D15CFE45B83C9F639F fortiets2
1,666,301,506 *AF556891EFD5B493A2B72418543D75CF2956439B 6ilovedammit0
1,666,301,507 *AF506EC4CF02E19E06B6203DC3FF5D8226F0BD8D 6MARINAPROMETHE
1,666,301,508 *AF5B5FB79543BA3AA665882FD3B72C83A41055C2 FRANKLYNHARNOS
1,666,301,509 *AF58EC39B4556EE9542A079D4A095486D70FBDA6 6ORGELTONEN
1,666,301,510 *AF56246E4D0975FB8F1A2B49DF44B2CB61FEC9BD [email protected]
1,666,301,511 *AF52D54901261C95949909978537E1E7479F536D FUGUE,NO.10EMINOR
1,666,301,512 *AF5D4026F0AB99F55C9C5E9A70BF16C155C4A782 GADEITAM6
1,666,301,513 *AF5A14E9812C8E46BDBD9A61E47371BE164E9189 GAILIVES
1,666,301,514 *AF58FD6B387224AE3EDE97D2958B70795D78ABA6 GALITYANIV
1,666,301,515 *AF57DF9264EFB33DD6C1BC916534366577339BC2 7KAARUNYE
1,666,301,516 *AF5AA2073E763AA9603079EB09060C91DCE9106B GARNAME1
1,666,301,517 *AF518DDDCA3317C31B13DF76A08E0B590A3360EA garrettsiegel
1,666,301,518 *AF5360F6A989263D72FB6EA10C589C4752D12CC1 garthlawson
1,666,301,519 *AF56FC9B95F5BD09C0F2F3AB6E0CD69C38CFF86C 7RAZOVCH
1,666,301,520 *AF599C06667CCAB3367DF75843B0D0F44246A562 7-SCHERIF
1,666,301,521 *AF5970E5B40338A219DEADFB7838CA957F4F1D8B GENEVIEVE514
1,666,301,522 *AF53E17CB6E795A82E2DECD2FF9F1D3D34722140 gilbertkubis
1,666,301,523 *AF5481A1008DE9765A18DDA61E44B44E92D21DF7 GLADNESSESES
1,666,301,524 *AF550E08470D41AEB1FE4CD6B119E51CB0C1FA66 7SINKURON
1,666,301,525 *AF59DBD9841F7A8B2D4E2DF9AB9BADB5E6377FA6 GNINIWD6
1,666,301,526 *AF5943ABE6926CE1DD29F7C7331764FF48C221D2 gobble-conorgwww
1,666,301,527 *AF57B512B09D6A9EDD42CCD2B865EAA79752CC1A God.Damned.Reserves
1,666,301,528 *AF53D4C80A106A5439C31E7406D31D54133DB038 GODDAMSOUNDSGOOD
1,666,301,529 *AF52259D815B417B3513ED1CAA70DB83FA0320F0 GOVOUA
1,666,301,530 *AF5A64B28AB2F4379000725DD0BF30864E3A125D Great-tailed-Grackle
1,666,301,531 *AF51C25458D99D8DE99580091BAAA028DE0D00E2 gregoryplesnarski
1,666,301,532 *AF5F27BECE76262CC57D497532D18744F5B3B68A GROANEN
1,666,301,533 *AF534CA1D665BD89DC3D90396C83EA6744F794B0 [email protected]
1,666,301,534 *AF53C2AB084A3B509264AFA7E9C1EB2DF72D124A gz4+
1,666,301,535 *AF58A20E00C5F39657EFED0C2C8858CBE8597615 8FLYERSJENNI
1,666,301,536 *AF519F8C5BEE04F677B78142A2B4D0ED07893F60 H9&\
1,666,301,537 *AF5D2C425D53B5BB356F518BDE3EDBC695F9F28B 8HUNTRUTH
1,666,301,538 *AF54FE737A1A05AAFB1C90DFDE54C5C4D5614747 [email protected]
1,666,301,539 *AF551883494F640CDD545662567340E61232197B 8JULY1247
1,666,301,540 *AF5EC5D3629003FD6221C8CDE266E721B847C9C3 HARMONIA
1,666,301,541 *AF535F52FFF40B47188EF48DAEA8E3CC2F38C5A5 harrla
1,666,301,542 *AF5E2C063B8832D6F9C4CFB8F92D1206E878EB06 [email protected]
1,666,301,543 *AF5525AD5B034B60BE7AA5E07F6C6DE7AFB3E63C HELOISA'S
1,666,301,544 *AF51B9320D03B3AA4BBE3097DCAC46536B27C373 HENRY.ORMES
1,666,301,545 *AF5814823080D74D8DBF14DAE75138E4688D0825 [email protected]
1,666,301,546 *AF52E9836E606F516038C5AB2901F4CA6AF22180 herbegonnenen!
1,666,301,547 *AF57146B2A3639AA1A252149185CB2760E58BFC7 HERZBLUTKREISLAUF
1,666,301,548 *AF5F176DD355AE66B97C68A622794A87898737EE HILLARY.GRAHAM
1,666,301,549 *AF55E33806AF1F549040A389A97EC8AAFE9FE000 8WHEELINGFROSTY
1,666,301,550 *AF5C1B68BF25CC18F839D422E0F26B044EC1A45B 938132 S...H...ELDEM.-.ONU.SOYLEYEMEM..
1,666,301,551 *AF555998BE87AB3C87643386E439E5DF496F5070 9550B389D1AC59772FC5C9DCC45E8237-L0GIT3CH
1,666,301,552 *AF5B43BAE9CE0C57B44990C9CAFFF75F5D98F3EF ho0$3r
1,666,301,553 *AF50007DB732EB786F7D618ADDB4E2B78DD5CDE4 9BDEFORLGGET
1,666,301,554 *AF53250A8CC8E3457C473723BB81B920A76EFE11 9gedodijnde
1,666,301,555 *AF5F990524C8CDE86EB1FAA44C1B22E854485D0A 9HAMMERFISHES
1,666,301,556 *AF58A445953870431E8007A5E99F7CA9E516481C 9HELLBENDER
1,666,301,557 *AF5DB2985FD83E2118C0553438010925980F1F8C hrn*
1,666,301,558 *AF594CC52695CEA3F8449C213FAEAC5AF371DFC7 9THATCALVIN7
1,666,301,559 *AF56B7F4C28EAE3E99D44E40554CDFFB3EEDB6F5 a021273
1,666,301,560 *AF5667E3A6A1285C7A27ABBB1C52879D99D057E5 HUMANNICHING
1,666,301,561 *AF58829676C700356B64BE4C6D01BC7CDA42CD55 hundson7
1,666,301,562 *AF56EA896BEC10ADADEEA88529E25B5CF7EC3FB2 X
1,666,301,563 *AF5E36A165A17CAB471A7F6A81795F91411C4117 
1,666,301,564 *AF5D716ECC2B967640DFCCF8DCA371297543328D
1,666,301,565 *AF553F50E78A87C73E0308585BA96EAE39AA66C3 ~Ҕ
1,666,301,566 *AF54A0086F9CB0FF3FD6F3055B27E3319B3B7604 q:L
1,666,301,567 *AF5B8CB503C4A4A03BE5A7A3216A39A718C81BDA ?
1,666,301,568 *AF5FB9208E07C64B14F8D1593B9DB79B94155101 %1#
1,666,301,569 *AF5490E109362B3845967AC1A21FDAF47113246F IAMBILBO01
1,666,301,570 *AF593AD4D2390F0CDE0EB6B606F922484193C8FD 
1,666,301,571 *AF55217DB57A7E291B5BD5DCACE4B6BB76D9327B iamsoccer98
1,666,301,572 *AF56FE080FD7B90BAA38EEC6CD0C0DBCA4E44720 
1,666,301,573 *AF5064CDB115EAD96B4529F0104BCF2B0E6EF79D j
1,666,301,574 *AF5B1E6FC30196C7771B431413569BC1FC0811A7
1,666,301,575 *AF5DDA8A2AC6BAE5455E50BF06B75E3C402382B2 Kz
1,666,301,576 *AF57F12C02D85F99E078C5BCA5948A86C78F5C76 i,
1,666,301,577 *AF5A05A6F3FB7D093A0484EADA741BD098FDECD4 (
1,666,301,578 *AF59C024C591382F1FCEE52FB3BF2AEE47586CF1
1,666,301,579 *AF56B4816ECD195E5A42B5DC30CBE114A53129F6
1,666,301,580 *AF5F3FE821727A75D397A3923D5DE3EA7B139237 o#Sɠ
1,666,301,581 *AF5AAB157C09DE4D2809B6995A57B3A5FC7FA6E2 {.
1,666,301,582 *AF5B9FAF2DB9034F4C0A0CEA770CC01D314D2A01 IF2009
1,666,301,583 *AF5281FA2D52DDED3D9FAAB26AA75B4DD7B80E58
1,666,301,584 *AF5241F9643FC4D57E9AE92F5FF812A0E0674F0C ݠ
1,666,301,585 *AF565F47FC2E515185B6C2A9051EF7BFE0F6A1AE z
1,666,301,586 *AF5FA43CD24006D4812791CE927C03F4B404854D
1,666,301,587 *AF574D2F1865094ACFEC5B93D4AFD3CBE22D7E2A U
1,666,301,588 *AF53DB9EEA4E3FF517AB6C06A8EA7E591558CC9D
1,666,301,589 *AF56C52E9555FB74DF6D92DD589E4A21ED31F3DB
1,666,301,590 *AF5CCA3276331B81FC80EF7FDB798DD539D5018F T
1,666,301,591 *AF5007823D8D0A573D0AB1A8D45D2001751A44AB NQ
1,666,301,592 *AF584B510DFD535C754A0C566FD7D5AE8F857F65
1,666,301,593 *AF51F655D1B1C1D57AF48E7EC124ED5B102F9169 &hH
1,666,301,594 *AF52200D87C7A20279572A96C0E72A8E39E197AD
1,666,301,595 *AF56606A515E81BFBE5AA745081EE59CFF742D1B
1,666,301,596 *AF51EE9E89A5849EA7571C7388A121B2763C76E1 ń3
1,666,301,597 *AF5EB7BAAAF0CB0C9059FA7DB3923F3B63992697
1,666,301,598 *AF5C8DA764A9904A472BA7E033414CC96EB65554 
1,666,301,599 *AF57D9EA91D320943441A99054CF46BBBF9BC01A
1,666,301,600 *AF5C9717E3288CB4217577D10C5C98835D9CF9DC g ~qČ
1,666,301,601 *AF5DB0FE1E60143C933732BB9CF451CA606045A9 €`
1,666,301,602 *AF5F3186AED0CF70A2395426AD16F1641B73F5B9
1,666,301,603 *AF5DDC9F4D8B43ACB57E9670363D7AA4CDFFFB73
1,666,301,604 *AF58FFE022BD6EDEC710E47CB5239EE32A6AC960 n
1,666,301,605 *AF50140713D03EE2E68B2EB12AABB9B667715EFD
1,666,301,606 *AF534B7A924DCB615EB548EEC9EF5985A6ECE262 f}
1,666,301,607 *AF5B383D4082AC407C1FB9EF6771BF11FE486B5B 
1,666,301,608 *AF555BF26E35394B136EBFF08D54528CDBF1F579
1,666,301,609 *AF5274BB8BDB69698B511244D71197521962BCD5 IMAGEI-275SVG
1,666,301,610 *AF5CBB8AAB50A047AA6B936A936AF4CC9B190F3A
1,666,301,611 *AF53F8ECB113E4FF5150C130D1A33D1BAFF83D61 IM[email protected]
1,666,301,612 *AF552A4557FC5CDD3464BB3CFD2E5393986EAE97 impressive-instant-(peter-rauhofer's-universal-edit)
1,666,301,613 *AF59B3EBB2E81D2ADC2C1E66C960639EE9A31820 2
1,666,301,614 *AF57311976836EF5541FFBF9365650418009926A M
1,666,301,615 *AF5A79109A1AFA4BA297D0C606754020A040931E )
1,666,301,616 *AF50AD28983882DFF304AFE7294FAEC0459AFF59
1,666,301,617 *AF52B6B7682E96D995EA16BFB512F95B7EB55A02 T
1,666,301,618 *AF513F981659A0FD1E74A1C5BCDD4D5C5F619C4E
1,666,301,619 *AF5FC940A0DEA49F73974B0F62EF78103AED2798 
1,666,301,620 *AF5E9AB4EF57EF72EAB4F8C3046C72C45D4FFCB0 /
1,666,301,621 *AF5F3D16968E4AC114493E460450560A73088833 S
1,666,301,622 *AF55AE7EB3630703E1032F663F2EEE223452454A
1,666,301,623 *AF596D7A673634A7F88694707AE4B4BE217BF113 o
1,666,301,624 *AF574777A4D2A9788CFC2E80F996D13D5DF26675
1,666,301,625 *AF508148AFAEBDBEC22FB0294DACEC075D4A44C9 +
1,666,301,626 *AF565EA531133E5192B0B519463EB21A90C40A86 r ;a
1,666,301,627 *AF5C63D2DD265D29D93306E460AB9AB63E2384E9 ingatterus
1,666,301,628 *AF5530F7CB5553B1F69047E80A235AA80B466D65 3Tv
1,666,301,629 *AF54842105FB337987A5CAF05637694B0B30631E
1,666,301,630 *AF586AC3E462D0E3AB1CF89DDFC7D194D31638A0
1,666,301,631 *AF55C012B88C25BBC9141E7ACB7E6A13196E0CAE zr
1,666,301,632 *AF5FFC26E560A41A220B12ACFA6E50FBBA2BB01D
1,666,301,633 *AF550D1915039845D01BD073072B4F5A31492B98 INVITE
1,666,301,634 *AF5941FD4A9E4E510E4FB8BEDE895E5C6E7C691F S~pjw
1,666,301,635 *AF5E8EB80019219012957661205E636E5FDFA2CB p
1,666,301,636 *AF53BCE9BB3A89717E95D14E70AD453F9B45DF71
1,666,301,637 *AF5B22C26EB6D9C403E015B5EA2E08BDD82838B2 IRENE.GIANNAS
1,666,301,638 *AF536FB90FE2EE7A8F26E743C4AFDC5E85D584C6 IRRITATED.GETOAR
1,666,301,639 *AF53B2D4E190240F39AF4B8FFA8F2479573FA95C 
1,666,301,640 *AF5FC9490CCCBCFEAB8D59007732149834422960
1,666,301,641 *AF5F70EFD4C79705621A65C2D2C28DCD2A9399AA
1,666,301,642 *AF5E7400B5B32B762553B720A3A8ADFD79929F6F y a^#
1,666,301,643 *AF501BD2CA13F6BF5BFC1545A0AE0FEA9F4501EA ]*
1,666,301,644 *AF57807049EB33375531C0E3B27163EF49155CBB isoldens.liebestod:.schlu
1,666,301,645 *AF53804F8CAC2ABC3B4EE99121FB45BF240748AA JAIMEVANCUREN
1,666,301,646 *AF5E5577436062465B4582065E06E112A39D7B9C JAMEL.CANELA
1,666,301,647 *AF5F9C456F7F0BAF439000D216750F444047F585 jamelgranville
1,666,301,648 *AF56602F312B5E3342621C5A452994B2F86A40EF JAMEYGARBARINI
1,666,301,649 *AF56015622288894A10846DF6C9B9F3BA1C36268 1147183 IT IS NOT EVEN USED FOR THE TREATMENT OF DEPRESSION
1,666,301,650 *AF5932857CDB4E98C01E8B19A18D973CA27D5D86 jarvissahe
1,666,301,651 *AF53A7A47350212BF30CFFADC1B1F0E4A246E805 JAVIER.ORIS
1,666,301,652 *AF5E5B6F991B560052CA6C7888CF32199370691C JEAN.WARICK
1,666,301,653 *AF547B6D9A6A0F8EB56A5C1C6502181A2FBE4108 1402749 HELSINGIN SATAMAN KAUTTA KULKEVAN KAPPALETAVARAN M
1,666,301,654 *AF55AC5D7382EEA7F1FF147FE8C157ABDF3CA70B 1412842 PROSESSISSA K
1,666,301,655 *AF5E51752882A0E1F4E28BF945CA20ECAE14E9FE 1440079 kvalt20
1,666,301,656 *AF54A8D319FBF6A71672D016CA89A91B8B047D41 1476214 AND.ON.THE.STAND.,.THEY.MADE.ME.TAKE.THE.FIFTH..."
1,666,301,657 *AF57EBE11CEA59000B772AA8ADD31C25596510F5 JEFFRYGRUBEL
1,666,301,658 *AF528FC6A700D71B703EC43B85B4198F0C9D978B jennay2004
1,666,301,659 *AF563DE622E664B2E3317000CDFA1930A369B65B JERALDLOSIER
1,666,301,660 *AF5AFD36658B17ABCA52EE7C70F815A7FEFFC804 [email protected]
1,666,301,661 *AF50389A4FC2F0EB9D46EB61469F4D0C313A62D3 15301530j
1,666,301,662 *AF5CF3E71D8AFD08F97CD107199DC0340432193B jesse.iverson
1,666,301,663 *AF5F42F7BDD00F73E4483649BC71AA71C5BB5B3B jilejli0
1,666,301,664 *AF5C4E340A8ACA11895614E91E810CCAE92B7C6A JIMMCCASKIN
1,666,301,665 *AF55630027E4C570528EE577D65C0C684CB84466 jimscolumnpic
1,666,301,666 *AF581DCF0049890069D2E5B5547D51F1DB80B5A5 1-arbeitnehmerkammer
1,666,301,667 *AF5F2F729A86EE3A377247492EDEE0481E4BE630 jodythingvold
1,666,301,668 *AF5B10CF59500B9D0E35E6626EEEA1EEBC644F53 joeseivert
1,666,301,669 *AF5166F659EA1A1FD3D28C17233DB821B9FD1B08 1burrows
1,666,301,670 *AF5C9EB4B8D2D751E68F6E92F762FFBB249E4392 JOHNCHAIN
1,666,301,671 *AF546607E26272DB4982C50EBBD92CA5DE8FF8EA 1 CONFERENCEPHILLYAS
1,666,301,672 *AF56559762B4DF4F56299C9D35C679046F6732CD JOSE-MOREYRA
1,666,301,673 *AF54B5734318E2A35FE67D9ABA78044BB73FEB3B JOSEPHSS
1,666,301,674 *AF5F7A806A94BB7116F37625F26ABAF3F8EEAA31 1.iletiSimsiz
1,666,301,675 *AF5CD4FBB84F5921771C5A2C5C0962ACE91C0A11 judepluvoise
1,666,301,676 *AF5A68898E2E6F8CE52AFD9133882F0B92F1B449 JUDSON.GULATI
1,666,301,677 *AF564C6B6E875CB50FC00187F793CFB5B8806DDF 1-kirazlIevler'de
1,666,301,678 *AF53EB5831A1BF8B68DC3A08E4BB5C917CEC8491 jukst
1,666,301,679 *AF521CFFC5F9761402CB47612B9A607817E5078B 1.medienwahrnehmung
1,666,301,680 *AF5E030B373C525B7A73251553080CE94E8EDF52 1premer
1,666,301,681 *AF50AC7E0D358749F85C237C7C0C35A38A201B4F 1.RETREATIN
1,666,301,682 *AF58462C3E83F46BDD1AC60746FF21C762694C51 1.SELITYSPERSPEKTIIVI
1,666,301,683 *AF5169F9C0A0FEC0648393906964188C6448AABA 1SLYNSSS
1,666,301,684 *AF592A73F16656C9A79B3EB5E2D35530C62B7AB0 1SOP-PINTAUS
1,666,301,685 *AF51B336BEDC9C682B42B768E355448BB6EFCCCA 1.suoramyyntituet
1,666,301,686 *AF5F512AE09A171D5A2EA7EED83B1ABF8C5DD79A 1transfer-modalitaeten
1,666,301,687 *AF51E52F686F9436F250F870A0BFF622B942B5BC 1.VENELUOKASSA
1,666,301,688 *AF5DF612812D7B21D146E3F4999562C8B0EAC44D 1.VIRKAMIESJ
1,666,301,689 *AF59A207E0E5F572F753942F3D7A6A2EB3744451 kaartjevliegtuigramptenerife
1,666,301,690 *AF5CE58E5855ED47C9D63AF222F24F72A11FFBBF KALBERT9
1,666,301,691 *AF572FFCE24BD0B3D237670E0BB66832B21FAC3A 1-X-FORCE
1,666,301,692 *AF581C86E1ED111C56E26A3B50C3396010237772 1 YKSIL
1,666,301,693 *AF552C7CCADC963D8B2B709761D46EAF628BF2A1 KANDÚRNAK
1,666,301,694 *AF5ABEC65C4757043298CA3939F2D1634AF4BD00 KARL.VILLARI
1,666,301,695 *AF5963613EDCE78377B1DDAF0B75181786AFBE67 20SEAMSTRESS
1,666,301,696 *AF56DA367DA0F1B0F3448F5B7FE773C1CBBD2BEC 20TERMITE
1,666,301,697 *AF55C82DDEBC78FE3D819411E8A4506CED42B9A9 2233surge
1,666,301,698 *AF576DA02241E4444C605C4A560A07C50EB15B16 2316felis
1,666,301,699 *AF51DEA62C194495451DD829FB2A9A9B2DC501C9 2782649 ALS-KURSSIKANKAANP
1,666,301,700 *AF50E505CE844DA91DA4DC354D59D7CE767C42AF KIMBERLY-NACARIO
1,666,301,701 *AF5ABC50281C082D3BECF2595176B77FD5679B77 2895110 EISENHOWER-WAS-ELECTED-PRESIDENT-IN-1952-
1,666,301,702 *AF592CC5B73D26A20015EF714411AD2774214B2A KIRBY.MBAMALU
1,666,301,703 *AF54CAD150B5BB29DBA94A0A652F7E244BC1DF46 2994621 SE-ON-ISO-JA-MERKITT
1,666,301,704 *AF5C15A14033AA2D75A60AB164E6A341507A56E8 2ABAISSERAIS
1,666,301,705 *AF5ECB5A95729C839B9E6BCDF0C3281F9A81B7E4 KMELTYOR
1,666,301,706 *AF54E6FDA08C8DEAEC9EA349F30CB7FBCF6FCD34 2ESSINIFI
1,666,301,707 *AF5280A157F4E46E118F5AB695C7D7EBC10C5A61 [email protected]
1,666,301,708 *AF59B26B5306A69F2FBD91D27D077B34BC117B6E „KONNY“
1,666,301,709 *AF5B93A027D3EDA9CF2B29E1B86C4E9505DC783C 2JURASTES
1,666,301,710 *AF58E74897FC148998840CA9118ADE231CE426C4 2KERSANTITE
1,666,301,711 *AF5B982746510CF5C12A442ED793DBD0585A6C44 2-KOMMENDNE
1,666,301,712 *AF55408D26DF698C1AF5FB87477D07B18E4A4E42 KRANTZS7
1,666,301,713 *AF5B26D724761BCB9BDBBE5649BD83C2C788B2EC 2NOSOUND
1,666,301,714 *AF583849431818587283F47ABEC03E6240C04A60 kronenlast
1,666,301,715 *AF5CA992940C7FB3D1C860FA78E57FB53AB8B092 2.siliziumschichten
1,666,301,716 *AF5AE89DFFE528ECEC62F5A88E63349553A37B49 KS4
1,666,301,717 *AF5BEABDB4B64678BEB9EE524657AF8A37D7A424 303844 kuka.maksaa.korjauksen.?
1,666,301,718 *AF53B6545A32FA82EE7D55C494AAE4985499C437 KWAːLE
1,666,301,719 *AF5DA43EBB107FD648DF6C0DCB3FE71C57FD080C KZSC
1,666,301,720 *AF5011B30DEEEDB72B4562FA050BE8861C062A2F 39abril
1,666,301,721 *AF5DD452992BBD99D73A2A379BC86C5139D0B06D 3ATSLAAWD
1,666,301,722 *AF5F187BA94A5E78226BC2C329EA05ACC4A2ED16 3BNKTTRN
1,666,301,723 *AF5CDF73B78B20D52C18FD0694B731C73B2EA243 3BOSALTMAYINIZ
1,666,301,724 *AF569FA3C0CA8F9946068DC6B0798F27E5FB25F9 LARS IVARSSON
1,666,301,725 *AF5598391A2D14B054358F9EA4B5B79E9B8CBFFC 3HALFRAY
1,666,301,726 *AF56ADF66FD400D52F8A2342E9D7ED071E5356BA latourou
1,666,301,727 *AF56F73CAF07FB5E30AD5F78DFB7BB86ABA5690D 3SDEESLIO
1,666,301,728 *AF5CE2D2989293EF2C4C4FA873C54A1B6B809A5A LEGASHABUNDA
1,666,301,729 *AF5C721CCA6A947D278FAEC37C85A5E8AAC82B6A LEIPZIG–HOF–NÜRNBERG–HEILBRONN–KARLSRUHE
1,666,301,730 *AF5CC182AB4139B46DD244D0A8A5155D6DFFD65B 3.VORSORGEBEMUEHUNGEN
1,666,301,731 *AF50417E5E4AD397CE083AFBC918FAD316270373 [email protected]
1,666,301,732 *AF5A07FBB492EE2F175548140EE73F55DA67B78F len-s
1,666,301,733 *AF57476B33584A68D48EB7DA16DE188B6E3BF8AB 4AHLTERES
1,666,301,734 *AF5798362483100DF36FF91E5C0F93F142A2C259 LEROYSIMINSKI
1,666,301,735 *AF5452FF1936BD811E320E8ED881079BEAD92AC5 LES.LAMON
1,666,301,736 *AF5187DA4986B42BC66B00E5D832ED71CD0418F1 4LONGATIONSES
1,666,301,737 *AF5CF4DF5CFD468AE06D65F0FB06792033558FD6 LEYLI-G
1,666,301,738 *AF5653714F1D8D9E92F3C727F67A12233BD56718 4PRISSIEN
1,666,301,739 *AF5DB21405E5A3CAD275B6137005CADD7AF7AE9F [email protected]
1,666,301,740 *AF57E267257A01FC4826F33BA169E692A87FC5E6 lioii
1,666,301,741 *AF51DBEEA0AB01017449A17DADE8208364E1775C [email protected]
1,666,301,742 *AF5283E409EE753E85E6261AB1DB98B033EEDA8F [email protected]
1,666,301,743 *AF5767CA6CABD5A6E92B65B488DDE9ADD1A1E323 4VIERTELJAHRLICHEN
1,666,301,744 *AF555FD25C63A145FF1B182842A6A86C289758B2 LIZAVPLIZA123
1,666,301,745 *AF523EAF396EC1F7CC1D11B1A2BB05ADD5C7E691
1,666,301,746 *AF5A902C97CA0C1A88ADCB28EA7344D03D0F1FA7
1,666,301,747 *AF5F7A3648AFD1F94620C81690E2AFA92A87CAEB
1,666,301,748 *AF50793F03B2BDDED34B9157D2417E14711ED793
1,666,301,749 *AF5F4DA2A0C0A2A2711E904519551AA70045E9C5 596708 thestate,incontrast,isastrangertothepatient
1,666,301,750 *AF57BC950461C82582E3A7EB17CAD927D9D16978 E
1,666,301,751 *AF5992A13AAA073D419AB00F74BAB499414E6110 1
1,666,301,752 *AF53F6FC801CD6AF844B6E374D45EF492A23A950 4
1,666,301,753 *AF54BEA8E784AD94D2AA2822B25372F2FDE02A17 #xwKʹ[
1,666,301,754 *AF5CC9A0ADA0B413972B926119C0700CED595FEC 5ESIVITA
1,666,301,755 *AF5E5CFA66059E8070BCA1F6D5C26BEA491E9DC2
1,666,301,756 *AF5348354680A73A4A8357FAAC48F1C5727FEEC6 NNe
1,666,301,757 *AF5516ACCC577E6199014515FFB1262FABB936E1
1,666,301,758 *AF5227E1C3B1BCFF0713BF14B4BF784BAD44096A _Y)
1,666,301,759 *AF54AE4BC70C077CD0276283CCC7DB886597CDB2
1,666,301,760 *AF5DCE7E9F6C8FF304B6D7B8DE643F058F44629F
1,666,301,761 *AF544FDDD348D14F9C89E2796065365A28A798C6 
1,666,301,762 *AF57C22E64134E4C2D87E9439024EF2958CBA482
1,666,301,763 *AF5D64C6F503D4F032F049E363966576B767686E
1,666,301,764 *AF52F213257CFB7C063A2C37FA8A8C0C144AD856
1,666,301,765 *AF5E4744B24B7254DD31F7E872C442280A862AAE 5qualcosa
1,666,301,766 *AF5703CB98CCD052FA6227D8DDF98ABA1C646CE2 ;
1,666,301,767 *AF5EDB238CAF00AF2F56A6B278A74B420341844E 7
1,666,301,768 *AF5F6D5BE9CEDC1B440A43B19039513408F09B8E P
1,666,301,769 *AF5C730278E6DC5AFB5C53F53015E1D89D089AE0 5SHRINKME
1,666,301,770 *AF546397B6C65F2C944C20A46F99DDC6BA13D2B4
1,666,301,771 *AF55A35CF67A8F5DB4488637C1AB8BA11120E92E 603637 soguduktansonradilimlenerekservisyapilir.
1,666,301,772 *AF517AFA0A16BBA0292D3A3C63CCA25B1A4B4509 [email protected]#$%^&*()=
1,666,301,773 *AF58236139203BBF3C42998E845B0469AEB5059A 67301Q2W3E4R5T
1,666,301,774 *AF5EDA9612B4F80BE6F5EFC200E3162E93449938 6ALBERGUERI
1,666,301,775 *AF5B49B514B0060D4049345E1E5FDED0EA98AEE9 (00)*.*.*[email protected]
1,666,301,776 *AF52E7696CDC30C8962B6D9F853010AE7334E7B2 6MINXAOYZEN
1,666,301,777 *AF51B6764D2BA3FAB1561A7B038042964FAD503A 1090HANOVER
1,666,301,778 *AF53EBD866B28FEB6B40F3CC95C965923DFE2530 10-walshe
1,666,301,779 *AF55C7BEABBA1B3798FFFC4C86632E66561FFDE0 1190801 larosa.said.the.brand.can.rebound..
1,666,301,780 *AF53E2AA0FBD54329C7687BA3E6A7DA785B27D61 1234RACING
1,666,301,781 *AF5364C7F2DF38CEC26308037C22E74D14593F6E 1282200 VALVONNASTATULEELAATIAASIANMUKAISETTALLENTEET
1,666,301,782 *AF533519D332F750D20AE431D416992ADE7CC112 13PACHUCOS
1,666,301,783 *AF50CC635DE798FE1D5989EBECE79EA651D006A9 7FUCKOFFZEUS
1,666,301,784 *AF5A5B4782BE09AE432916465A6B84A451FF9AEE 1401326 I THINK YOU WILL NOT LET ANYBODY CHEAT YOU , " HE SAID
1,666,301,785 *AF5397D1BF891E1858AE96F44164830897E82D62 7.heruntergehen
1,666,301,786 *AF540DBAD8BD35553780116957A0169A29FBA40A 7ILUVTIME5
1,666,301,787 *AF5278A55B080FCDE8A191B10F8EB89E522FC517 7MONDAYALEX
1,666,301,788 *AF5B0709C04EDBD686048C3CE5FC14AA37D0FCC1 1661413 KONTAKTINS
1,666,301,789 *AF55711379ABAF9B8CE5CE17A348F341D3808D98 18051898
1,666,301,790 *AF5D896430C23C34923AC143A37B8E87A88FC86D 1880568 MAASTOMALLIAJASIIHENLIITTYVI
1,666,301,791 *AF54E1E54828BE54236D4E1CAC20F56A1A393026 190600 " muutoksen kautta voidaan merkitt
1,666,301,792 *AF576D7B6967559B9BF4F3025F906F3B9CF59F2D 1950048 IN-OXFORD-,-THE-BUS-SYSTEM-WAS-PRIVATISED-IN-1986-.
1,666,301,793 *AF5E671158DCB7752F8D116DB3A2E0C753C5C29F 1968158 napsauta.t
1,666,301,794 *AF5DD25F026D80C81E33E593E6D5506118BB70F3 7TARARUX
1,666,301,795 *AF543208541AF85A9B1B09C1D1D97BFE96E9A3A8 1-askurol-nivelp
1,666,301,796 *AF538D34CE2F01AF23BE45593E2A8A09B9D8837E 1-dibs'lerle
1,666,301,797 *AF56BADB015AEBB2AF7A85FCECB71252C716DF04 1-ERITYISSUHTEESEEN
1,666,301,798 *AF54042E8886C7D184D8C9EB7FBF996335CC4B55 1FEBRUARY60
1,666,301,799 *AF52A6D439E1E9BFEC76E43E92B13F082DCB30D8 1.KOULUNTASAVERTAINEN
1,666,301,800 *AF5985875EBAA379A4D44CC6B5C8298A4C6FA5D4 1.KREBSOVIEDO
1,666,301,801 *AF5AF99F83DE865A91480CA8BD10CC2D1D959147 830zi
1,666,301,802 *AF5A1E78A6A9F9E1E219379771631E24D7F588C7 860274 DIE SPARMASSNAHMEN WUERDEN GREIFEN , HEISST ES WEITER
1,666,301,803 *AF5E5FBE0E0BE9DFC9674678FC19463A02CEFC23 1.MIRALAYLIGI
1,666,301,804 *AF5B5CB9251B4CC335C55B59DF79E5C298038413 890904 FAST-IST-DIE-INSEL-IN-GOMARINGER-HAND-
1,666,301,805 *AF5EEC5A6D7A7A9A316B15DAEB1F0F29888E2A5A 8ADHIPAAYA
1,666,301,806 *AF5018DB0742993E0DD3FFA1543488FD3598845C 1-OSCAR-GROESSENORDNUNG
1,666,301,807 *AF545BA10389889B21525DCD7945DBCBCB1488FA 8BOXJUSTICEKEYKINGMAKERKITCHEN
1,666,301,808 *AF5DB47D8142CDCEA37B5AAF73E9F39CFE347615 1PERLOIRS
1,666,301,809 *AF51408198D18D9734AF77BCDBE0091590488FDE 1.PFLANZENSCHUTZINSTITUTES
1,666,301,810 *AF5B8496780D0170D08209A7F18334E435244277 1-REFLEKSIPUTKI
1,666,301,811 *AF538D581AD81B15AC90BDCC6598F0854CCB2A5B 1-SARJAMURHAJIEN
1,666,301,812 *AF5982906AF5466576D0329833D64B893FD4BB4C 1seutuverkkohanke
1,666,301,813 *AF5994852B724DF983EDEBECD706F360D6B609DC 1-slaska
1,666,301,814 *AF5DC172D4E5A9A09CD7DEE28870CDF9B8D0F959 8FORELSKELSEN
1,666,301,815 *AF5FF94BD47DD41A7893F196B9D585DB10D6D57F 1SOUVENIRING
1,666,301,816 *AF5BDE201DE13ADD6548277C01167972DF5B2696 1 STUDIO-DISNEY'S
1,666,301,817 *AF5684D06FB65CC66349B50C1D22A151F100FC20 1suurvahingoksi
1,666,301,818 *AF56DC6D49A8C9B066574E9836CF323B29EFE9AF 1-sykeperusteisia
1,666,301,819 *AF5FA01B55BF1E84919E53A23ED7B840136BBE45 1-TENNISTE
1,666,301,820 *AF50ECF894FC24B7BD2B3BC4D11A1D87C07B20B1 1-TONILAIT-ARTIKEL
1,666,301,821 *AF5A2D330C85AAF7588633C6316E1C770D1CE2FC 8KEPPYNGE
1,666,301,822 *AF50FF4CCCD0072AB4E8AE51AD0E54DA9C064A35 1urocerid
1,666,301,823 *AF5E8C65DD864A12F44468BC30F943409F4BF96E 8REDANIMAL
1,666,301,824 *AF58532B7DC099CE28B77C4E83225D1A19363556 221663 MINK
1,666,301,825 *AF56194E04C461B1E94565FBC44EDA049200CD1F 8SERVICEWANKER
1,666,301,826 *AF533A61337B497CA3AAE2B790F154F724E2E802 2286181 ymp ltk 86
1,666,301,827 *AF579D6B59A385A171D1A71F5337D87ED63368BE 8STRAWIDA
1,666,301,828 *AF50DB72C3DEBA235CD6D0AB376606E844D67346 8TIMBERSPUNKY
1,666,301,829 *AF54BEE82EA0E407350C6D8396278C7DC5EA3F44 8X8JAG
1,666,301,830 *AF5E31D0C572DB1A278A1F9309557ACF7725D1C8 2340994 tavoitteena on saatua palautetta hyv
1,666,301,831 *AF592783F0046BFB8C210ACB633910FCB830FD55 23BASITTEN
1,666,301,832 *AF5B50C9A60B06652F85E2D17FD99B8586E990F0 9BIJPAST
1,666,301,833 *AF5EE0422023576514D352D7E4D686FA37D48078 25061370
1,666,301,834 *AF5ABAEF984FC260E303924E00C135ABE146E024 9fuzes
1,666,301,835 *AF51DD189D9F08A25149CE5B5EEBFCBAC7E9959F 29NUGE
1,666,301,836 *AF5A2F7A228143DC2EDE95FE15E04D5F8E20F54C 9ILUVACCOUNT1
1,666,301,837 *AF5E393607087733653C175E04BE50BB95594EF2 2CWBISDMR
1,666,301,838 *AF58498BCAEB0760214728FE376EB6A83F9C242C 2FINCDU
1,666,301,839 *AF5ED29A0657D814A6FF55E8A9CBBC7ACFEC1F42 9PIENOISRAUTATEIDEN
1,666,301,840 *AF591C6FEE17A1CF291D30BB02CB5258C2D68568 2FVALENCOGNE
1,666,301,841 *AF51794A72C4467876545CCEDAD1DBFBD394CECC 2fwhitesox
1,666,301,842 *AF50E31A0081F2F0F28D197F22D11B828FFBFF6E 2HELICONIA
1,666,301,843 *AF55961A7D4A1B34CC5553125DABEE55A68275E4 2ILOVESAMMY8
1,666,301,844 *AF5C502065D5B06ADD4F7965A502FCE54D7B92EE 2-KAPUSCINSKI'S
1,666,301,845 *AF53F79D44E0CBA23DDB02F9B24BA6A6883B73AF 2KM²(11
1,666,301,846 *AF58012069239858FA033A2C37B990619D4630C2 9STACEYSTRAWBER
1,666,301,847 *AF579C1EB852914F7762926EC4F49333ED2F0BF3 9TERAGNI
1,666,301,848 *AF500A956B5EDBF646F37064260E84F58F398219 9TIMUIMUSQUE
1,666,301,849 *AF5EFF7E03606579D3C7FF9FC210A1EF2BB1CFE2 9VIPER3
1,666,301,850 *AF5BC1CA44F338A478E8F1AB05F8F828F6F41EDF a~?/
1,666,301,851 *AF5E9EE34072339426124AD0FD5489CA5FE2A1E5 A+::
1,666,301,852 *AF5B697E6D515E39FE00EAFF0ECB9D77F320DCA0 a.1o
1,666,301,853 *AF5BABDC1D3ABC8A2CAE2E2C7ABCE03F32EC1E9D A75R"
1,666,301,854 *AF5B056021137CCBDAD243ABDA9D4CDB1E230AF0 a8%?y
1,666,301,855 *AF558C71FB15442092AB3864B044AF0F8AC48A34 aa8-k
1,666,301,856 *AF5CC6BF57D374D48D6BB94E8B5A55D8C7011958 3AYIKCUR
1,666,301,857 *AF5DFD00459863BD95C67966F57D05FBF52727E5 3.beefsteaktype
1,666,301,858 *AF5011C0DF8E0EA49EB45BDF3BE609B176786A04 AAA]U}
1,666,301,859 *AF554391A0D77C07B2332E7F233144BE590C532E 3ICNDIBSW
1,666,301,860 *AF56BF395B7D4B169B2737F0802A8C9CAA99713F AAD[|3
1,666,301,861 *AF5AEF2EBAE10968CAC49864DE9CE04C8E8A1C84 3ILOVEXCOUNTRY1
1,666,301,862 *AF5FD15197ED0E8A0B37BAFD4C12542E12CF3A53 aa?f
1,666,301,863 *AF58BBDA67BFC0248095AC0824B830334FEF6930 40BELIRTMEKTE
1,666,301,864 *AF5F40CF3A5AE503394F343803E45D3EBD64BFCA 413419 ja.vaikka.tahdon.nousta.,.niin.painun.syvemp
1,666,301,865 *AF55AF837A1019CA810EC0D036A95886DB62D889 AB}BH
1,666,301,866 *AF50F03C539330D5D555B2FA1FD5F57012288120 ABBYDUKE
1,666,301,867 *AF5129E4C8B76EC61F48815B8AA3EE777A9793DB ABE.VANDERWEERD
1,666,301,868 *AF56345935589E5349D73FB029CDCE9C839E953E abortion
1,666,301,869 *AF50774C0013081B30AF8391FDE923F2E47D0FAE abuloman3
1,666,301,870 *AF5EF4830E1C4B67997E1B136477CF5ADB522E44 abw;
1,666,301,871 *AF5F5EBFF4BCF6783ACBEF1347616E4A337CCDB1 A/?C8
1,666,301,872 *AF53CCC4D39B73295139A2F57BDDF55B250F8BFE 4KONFUSEN
1,666,301,873 *AF54DDC2D57CD0B3D1168C69928EE0110789AAB6 ACC0UCHEM
1,666,301,874 *AF5938A67131C936268D1C80EB0CB21AF5B3E21B ACNVN
1,666,301,875 *AF5D8B2CD0F5D3846A91BDA9D7FBC03D9031663D 4MUSMIEHI
1,666,301,876 *AF5574BFF1C0530E7714A7D0EE752E6AE4C960C9 acx+y
1,666,301,877 *AF5CD8FDF3963798E3B8BE9A0D64C3D878F98E6E AD3PA
1,666,301,878 *AF5D4E3C84FF8D40184080F178AEDDB9A454CC02 4QUASIEXCEPTIONALLY
1,666,301,879 *AF53A417E99CAB2BCDEE7F2F7F059F9B11FF944B ADEODATUS5
1,666,301,880 *AF5C4EE30E6CFAE751B87A5A1C61E15763C02117 afratelen4
1,666,301,881 *AF55860768690AC93104D3FEA7251941B8DE79E8 agreevt6
1,666,301,882 *AF5A8D79669631D867773FEF85E04C82E0C26AD1 AHL.U
1,666,301,883 *AF56E5ECFA6A6CF6ECAF025EFCA6F2A541668E2A aia#u
1,666,301,884 *AF576F31B155594780E79DB601CBA7BADF987BAE aj%f2
1,666,301,885 *AF57E1025E1DAFF9D9E27EED91EC166186891B2F AKT_C
1,666,301,886 *AF52EACB627DDBC3A6929C22621C6D14BF77811F aldokarn
1,666,301,887 *AF547EA0FD59F0C6E051CBC2EE748755F1885F93 alecia.wilson.tsu
1,666,301,888 *AF54F6BA005F2577A7C5FDF4AEBD9EAF262ECDEC 5MAXWELLSCOTCH
1,666,301,889 *AF5F556FB631A48B7AD6DB192050F2D21C4948A6 ALEXBLACKING
1,666,301,890 *AF5BFBB77D62A08AA1A87E03EB01DA89AFF8EE6E ALEXOOMMEN
1,666,301,891 *AF537B9AD008599C446F87B693E2EDFBFD8E8C4B alexspadaccini
1,666,301,892 *AF554875A15E9E3432378CBC330E554A09EEAC4E 5RUSSELLSCOOTER
1,666,301,893 *AF518DBE0854070423FB94DFAD90E62E25F8CB89 alfredohackel
1,666,301,894 *AF5023956AC8F5DAF45F334672866076C558B93F alitieng
1,666,301,895 *AF514D102889654958D4D7D76D8333085883CFD7 alli0
1,666,301,896 *AF528FB6EE17508730ED0793370B4CE1FA8433E9 5UPMINCEMISARRANGEMUSSMUSS
1,666,301,897 *AF557B7092847F812CE0039AE7D894EBF3919285 ALU
1,666,301,898 *AF5931AC133D970D03AC30620884912016C51383 AM84I
1,666,301,899 *AF56CECF561DC613251D3E9FF4424B566C7A4042 670:OpHemrustmijngeloof
1,666,301,900 *AF5F1EB99D56BF110A51F9A71752E1F2B3809756 amitrane
1,666,301,901 *AF58796F43CB51BF6609AA885721885D46213D1F 6BSWBASESTATIONBSW
1,666,301,902 *AF5245188E9513223FC7763F34C44B3E03729693 6CWKVHBBHMYP
1,666,301,903 *AF5EFC6904BA66247CFDB32141D97C06E3F2BB6C 6DAARSTCI
1,666,301,904 *AF536249D3D4D1A82933B8517F5962A4C697CB5F 6DISCIPLINGV
1,666,301,905 *AF5B065AD44E2CC6B759F44015829207354C0E5B 6DUPONDS
1,666,301,906 *AF5725D54631A3867B22BD4C29CBFA4CE839334C [email protected]
1,666,301,907 *AF5E44847496E82EE5DE32ACE801EC152D78DFBE ANDREAS.LEIGHTON
1,666,301,908 *AF506D1480625141B13C25BDABBADA085B48129B ANDREAS.NEMETZ
1,666,301,909 *AF543AAA4CC60A4F646065A693468C067BB339DC andybearses
1,666,301,910 *AF5B79E61C08B10590C51C707F18AF24D0223763 ANGEL.HETU
1,666,301,911 *AF5B4D59D36BE9743730AC6BAB0272600F3B36BC angelmelville
1,666,301,912 *AF58746624750BF8D600CF80F1F3AC4A83EEA190 animatho5
1,666,301,913 *AF5BF7AB2D105AFCC3266C45729A478A07476ED6 ANISOIC2
1,666,301,914 *AF53A38DF821491DE7CEEFF4F758A47551369B18 A(NKP
1,666,301,915 *AF5FF3FF29EA2FC4D89E184FB44B0C28EA7E8CD7 annmarie-gavin
1,666,301,916 *AF58C66270415E8051BF2492348D6DBF5B06D7E5 6LEDSNADEN
1,666,301,917 *AF5E1B54368D0B9F93FB2287E5AA233EBFF796B5 ANTONESALAMON
1,666,301,918 *AF514F3884FBACF8DFCC714E871EFBC9E80A3F0B ANUPAMA-BHATNAGAR
1,666,301,919 *AF5871FE098C00F93D614D78036415E856F36CB6 708820 kuten.numerotkin.osoittavat.,.oli.ottelun.ensimm
1,666,301,920 *AF57074BDAAD4B614F3ECF353325DE470981A0F9 75397 WARSAREMADEOFLESSERSTUFF
1,666,301,921 *AF5863BAE9BAF60A67F43A97B9A5AB7799B68002 aopn
1,666,301,922 *AF5360CEAF9A5D85BD528539A992C2A3FC060DF0 apl9v
1,666,301,923 *AF596FCA92E89456F042745A359E4E8C886D68D2 7BSWATRITONBSW
1,666,301,924 *AF58F1F6B7A47FE24ED4F8D6C5CE807738756A82 APSLH
1,666,301,925 *AF5D6FBF6D54CCB828E0E6F620799C8F29E48CF3 7IAMMIKEY4
1,666,301,926 *AF52EBE3FDFB43B3A98A5D469789D1AB778F8FB4 7NSAVBSW
1,666,301,927 *AF581B12F7601399E3AEC3EB7D853A2E99000A9F 7SONNYPYRAMID
1,666,301,928 *AF59AB4D8575A5B3942935086C68D60516DF9281 826ROSS
1,666,301,929 *AF524D72FBDF0A1026F1C282FE2347D67E09B5D1 arypj
1,666,301,930 *AF53F6D65AD0D3D9C0D275F4E843A3B2987D1366 88NHELJCFG
1,666,301,931 *AF5EE38466D520A4E710C74E4632875E9DBAEE51 atqq(
1,666,301,932 *AF51C517DD1EF1E0C42FF92265D826361C765134 8DCRUISE
1,666,301,933 *AF5C1B8B1D3931EE6DDB84F8D7FD35A39691B04A atyloppi9
1,666,301,934 *AF5FD5D046398E3B83EB7199FAD90280C5DEA944 AUBENSBEKENNTNIß
1,666,301,935 *AF59510F03F64FE1AC22B2EEE9D01B02B588366D AUEQS
1,666,301,936 *AF566782404EBB0349DA5C1C150CDDA34F566CCC AVVERANDO3
1,666,301,937 *AF574E95C111DF76C623BCDDA3F0A8A3358E110E 8NISHHKUTAKESHHVA
1,666,301,938 *AF5561EE131A8194EE6845BEE05E6102A44034A1 awg,!
1,666,301,939 *AF5A9B6DED5760FC62396EA41E0A9EC6E7A16F67 a.whyit'sfree
1,666,301,940 *AF5426C400DADD4F9FB517C2C699B4CE466EE5A3 8###p-`)O(
1,666,301,941 *AF591F1591E20717A0F384A3A0132292F1A94B2A 8POWERRIVER
1,666,301,942 *AF535C800E7CD039DDF2F4D94A98BD021F890622 ay?/8
1,666,301,943 *AF523BC3EBC452776D593E3BF2715AAE48023356 aysha.riswana
1,666,301,944 *AF53B22D0F4CD9028EEF7526622C7B02EC9B8DA4 azmanwahid
1,666,301,945 *AF5B04D8E4D8029815FA3C553F7D1910F5904154 B3V0L
1,666,301,946 *AF56E0F9E88ED873E942AF2825D311C4DFB52105 90891 DENNOCH SIND HIER ALLE DROGEN ZU HABEN
1,666,301,947 *AF5DC5E8A629A14F848AF172C7ECB0F15CB665BC b5avw
1,666,301,948 *AF5DF7A79DCE922AADF4E2F23131221116B6740E babyjr
1,666,301,949 *AF5AC66B60B85E6B7C260ECDAF08D7C7ADEDFBB6 BAL$AMICA
1,666,301,950 *AF58013F85A8E46E19E964B3C90F5302002D12DA [email protected]
1,666,301,951 *AF5BE6BC6AEFABAE7E646E44F31A7BE1A6B3F53F BAUFIT
1,666,301,952 *AF5E448EDCFC4F93274B4DBE0D912D0F6CC06B38 9GNATTYS
1,666,301,953 *AF5636CB5913F970B2003025053CD75B6CBA25AA 9iluvbluefish5
1,666,301,954 *AF5E5C8FE188897764B041336148D89C494E3320 BCH1I
1,666,301,955 *AF54626E535B0BD934A9DF09CF11E4717D27C48E bcniken
1,666,301,956 *AF59AB2117DA918B530AFE1F332EDA9DD52FFD57 b/d$v
1,666,301,957 *AF5159D3CF1E9950431E251E70E01118672B61C1 bedouïenen
1,666,301,958 *AF5CFEA8847ED3ECE5AC9C612907C98611F367C6 bejuco8
1,666,301,959 *AF5A63DA3AB2D13E188D898647A0D7101FCCB2B0 a1s/
1,666,301,960 *AF5AA59C14321C4447ED98711F3002CEAD7C54FB bennettwig
1,666,301,961 *AF53283317809A9329735400C0ABEDD75A977A83 bennyplotner
1,666,301,962 *AF5462EA1B3E664FC7EDB6A10EAB52E984648F2E BENZINGU4
1,666,301,963 *AF57CFB9F318B67ADB0CEDB84AE4FD05A3D92BB6 berliess7
1,666,301,964 *AF52D04E384D3CBF96AD2F3553350E4AA0D14B57 BERNARDOWHITEFORD
1,666,301,965 *AF53F322D868D878C3A156733C5F9077698B2E09 berniedionisopoulos
1,666,301,966 *AF5ECBC79EB0CB6FE4BA05918C30FE32F3CB377D aaafz~
1,666,301,967 *AF5B076BCEA0EE2F6C9607B8D8A08D8C1B32B43C aabw5
1,666,301,968 *AF5EF67AE9415B649C5E847ACF359765E7B639FB aad!b{
1,666,301,969 *AF5A4492354C61BB257DF95DBBC2A61B255E1B34 ab1fs
1,666,301,970 *AF57F6D0F9FC6ADF1BA3A0DE99539754F16C8543 BISCAYN2
1,666,301,971 *AF5563D91998110BC21F1FC60EE77B1A4FC917BD BJDPARTILOGGA
1,666,301,972 *AF5586CAED8DACB273B9797C81EE578AB21EDE19 BK--&
1,666,301,973 *AF5081D6F233F83549A69A071884189E972F2835 [email protected]
1,666,301,974 *AF5408A5BDFF25314D07A6BAF80D0C8ED2F74720 acfqd
1,666,301,975 *AF52C945E28FBE6CBCBF2ECEE6DFFF57F16100AE B:O9
1,666,301,976 *AF5ADC60E94A17E12AEAF03A301E5F8841674396 BOBBY.WILLNER
1,666,301,977 *AF5C350C95017E6ECC7BB6D5187E158A0B7DAEC6 BODŹCOW
1,666,301,978 *AF5E40D3B53E1438126DED25649E7CA7B6D193C2 bo&ep
1,666,301,979 *AF5F21561E5A46EF54CBDD54758614C9234F601C BOUGHER2
1,666,301,980 *AF580E1C0F34AA648C8CF8AA128333EA11F93323 bpbej
1,666,301,981 *AF59891C887CB0841783882A4391FDF8F66451AB AFMONTERER1
1,666,301,982 *AF5F081952DB95609A49C9FBF2FBFE863B8D9EB5 agch1
1,666,301,983 *AF50FF70338C3E88E75AE436ED8737C37AAD83F6 [email protected]
1,666,301,984 *AF5966810539CF865CED3C5958DEF5CF0C32DCEE aghl?
1,666,301,985 *AF501458441D8704C29328746ADDC7B3DEBFB166 AGNES.TIM
1,666,301,986 *AF548AE285962D761B47D111E24F1E43DD730EB0 AGNIIRVES
1,666,301,987 *AF5C84016D3F3B9DB3D7E7364DBC841A4AFDDAFC AH8PA
1,666,301,988 *AF56DA986E979E3AD57165E132284A80E8AA5B7E AiA-
1,666,301,989 *AF5716F6351CDB9A8A3EF8FDD86F51E9BC509A1F BRUCE013
1,666,301,990 *AF5999119070B4B8BCE8A5A6FC081F4E76C770E0 BRYAN.RENTIE
1,666,301,991 *AF5981AA8541A8107BAAFA1A6C9E2C4E2524AE6D aiu=i
1,666,301,992 *AF5E4A4A0DF1F3E414B0010FAD6463E65D173BAC ALFONSO.MORALES
1,666,301,993 *AF5B6126C3DD21CDE6E69D13396412A38CD1CE98 alice-schofield
1,666,301,994 *AF5200E85D90E5F96909320413FF94D54334DF48 ALLIAMN6
1,666,301,995 *AF51A5045E80D0650AD1EBCBA831BB82C28798BB A+LLT
1,666,301,996 *AF538C9A88B8BB8E3191D4F68474308D4E71C5CC ALTHEA-LLANES
1,666,301,997 *AF506C6365B3375429CC1228D455290CE6B5275A ALU
1,666,301,998 *AF5525C859050B5D9818F1E8C615F4718C72379A BYHVS
1,666,301,999 *AF58DC4DC588672622ADA70EAFAD79F9FB9266F4 c0cht
1,666,302,000 *AF55CF9713AE064052C29AF810381E7F39E70781 [email protected]
1,666,302,001 *AF54B61DA9A7BA83D912D3AF0E116250E5497210 c0mp3nsatn9
1,666,302,002 *AF5DA42350045005DC777A174BD5625073E7AA91 C_0TD
1,666,302,003 *AF5865284A5E570428D5570B380EDFE4CE5D4924 ANGELA-GIANNELLI
1,666,302,004 *AF59EBBAAE09C130A7FFAB11CC2E672C22442740 ANGELOPORTUGAL
1,666,302,005 *AF516F065AE16C24425B8E6D3C8BDCF89EA4719E CANS.
1,666,302,006 *AF5B155CD16804881B24738372A6228BB7BC574A „antispartakus“
1,666,302,007 *AF54E08562648DE4718B8D7D6B2A2AA4CB243658 CARLO.LABORE
1,666,302,008 *AF542CADE7546380525D41A62766A24B60BBC25E anv-
1,666,302,009 *AF59D4D70393B3BE70CEA3FBEC36DF171EBB9FD4 CAROL.WINSLETT
1,666,302,010 *AF5AD26ABE8B815D4D85C1300E6BB3161306A8AD cassiedarr
1,666,302,011 *AF5079F4D2270A943637711A42AC9936EC90D0F9 CATALINA DE RAMBOUILLET
1,666,302,012 *AF5DFADAA7A50486B67C4822048F803B0B149165 catastal7
1,666,302,013 *AF5CDBC6B2B8350EE98DF2F31D84FF6B30D12AD3 cbc=k
1,666,302,014 *AF5CD6835FB1E27618E028DDA4BB9CF652EC5A77 A/RF.
1,666,302,015 *AF53995557D0928D687DA3798A9356370C435E38 [email protected]
1,666,302,016 *AF54521FB933D3FBAB754989B7E4F92D4CE6D9CB cdj;8
1,666,302,017 *AF5E921B2B4339CCE2FB1A3F7AE99D4B9D8630CC CDLAF
1,666,302,018 *AF59F97B203A9D77760A096C0166605B51305777 CE&44
1,666,302,019 *AF524A9AAE82B2F2BD2624536BCA6A7ED0941BBA CECILCOSICO
1,666,302,020 *AF50D3742BEC7717054B12B866B6469C71E9B01C cecile-bustillo
1,666,302,021 *AF59E5680B8B5AC05DAE74BB6C96ABEDDBF65D0B cedricfarinas
1,666,302,022 *AF5284E647F19A60E0964214697AA271003718CB ARVATAN1:ARVATAN1
1,666,302,023 *AF5CA84E9E73F124CBB38630F5539287BF2F8609 CEREBRIC
1,666,302,024 *AF53330BF7FD12FD638AD567B6CECABAF4471B76 c/f5
1,666,302,025 *AF5929FC8DE83FEBA2AF90E739323422DC783314 ASWIN SUKUMAR
1,666,302,026 *AF5053FAAD31B74ED917C0DD09E8C8A657A0161A ATACHONS5
1,666,302,027 *AF5D13D7DA36C195B071B211F72865D7691FCC76 atarum.6
1,666,302,028 *AF53465663D52C1BC8BEC10497ABF6AF42A6A63A atphm
1,666,302,029 *AF5EB153FFE461E12C744173362D4124154BB5C9 [email protected]
1,666,302,030 *AF57A8E2C2C38FE75F7516F4DF8CB7F33963B20E chantelle
1,666,302,031 *AF5B8A3AB289CFD4B6F0520B46E2E73C68925604 C%HC
1,666,302,032 *AF562944E71073476E317E7FF77618DB70565005 ausbeute
1,666,302,033 *AF58EE4E2E01A4C4519EE7DAB81784E3B4A0266F chfqx
1,666,302,034 *AF5475886EC934CB484EF200F3CDA6C2AB7FB3BD A,VEM
1,666,302,035 *AF53A354D5A04781DD1B7EE4282836BBFF01F2B9 A_VWQ
1,666,302,036 *AF5949897B0509C4BFA92BEDB3F6D719D5400C16 [email protected]
1,666,302,037 *AF57050B003255BB312DB3290779497DF89DD125 A&WMV
1,666,302,038 *AF55A83630C2682E4ED588B68CCF4A049519601F B10NC
1,666,302,039 *AF54C643F4801566FEFA176CF9577A32FE333753 B5KE
1,666,302,040 *AF581F1BBDB6D2F0BB2D45354D63CB2E46599A46 bartnewgent
1,666,302,041 *AF599DB222DD01FCA5125ECEEB1721460F3D534E C"Kw
1,666,302,042 *AF563C29BC75CBF1CF2C774A26688DE548AE298D BB.G
1,666,302,043 *AF5A5A2A66D2A5A4B9504FD24EF1A6D3A446C4E7 CLAYTONSTENGER
1,666,302,044 *AF5B3D21778D1DE02420F5CABB0D15D91B7386D4 BBWC3
1,666,302,045 *AF538DA28F2C12A2E622BFEBCFA0BF2EA8196A6D clenskym5
1,666,302,046 *AF59A1F1794AE00AF5B7B51F93F5BBFBBC3E687D CLEO.RUTKOWSKI
1,666,302,047 *AF5A7E4086CA7BE6B638C2AB7EB08EE634BE6791 CLETUS.DAFONTE
1,666,302,048 *AF56E879A1805544005D0D8D0DD66E532DB6A876 BCI&C
1,666,302,049 *AF5E9F070CC19BAC0854718E8D0AF2040EDC4576 BDNO!
1,666,302,050 *AF5E08CC9192ECB4D325B4E1C44FB2DCCE52693E C.M0D
1,666,302,051 *AF5C473FC6383C531553835E32CEE8A2E0001306 benjaminshau
1,666,302,052 *AF563E8A6FD10FB25A7CCEC6BF89B05633941CB8 cn"st
1,666,302,053 *AF5E45983EDA6CBAED6FB9921D5736E53068ADE4 BHRUM
1,666,302,054 *AF515C7A58D849CE1F8B6B2A1039CBD7C4E85576 Big-Gun
1,666,302,055 *AF549C81ED020CA6135E6096EDD0ED9E9D5EEF9B BIIXN
1,666,302,056 *AF521FE517E2FA0403603739EAD617DA1EC1C0AD BIM37
1,666,302,057 *AF50C75E5EAA062DC394B66C362E59D444709503 bingonaomi
1,666,302,058 *AF5ED58DF5E77533BB2A859A659FAA72815B4703 coqueugn7
1,666,302,059 *AF5FE59E62201B96E611BB34FF07F1614097C8E3 birminghammail-peterpan
1,666,302,060 *AF5E26665B00C9B2C64B741BEABD593FD388EA3B [email protected]
1,666,302,061 *AF504CF74E6F1F3C69B36BEC1E6C39AD403B913A BJJOW
1,666,302,062 *AF5A98165C077593075BD5F019B670B196EBE05D cpvr
1,666,302,063 *AF5EE6F71D561D6CC5B4CF885B3868CC8A32C3BE crazydogged
1,666,302,064 *AF5FD3175876D06CD0F67F205FDEFB71F7CEEC5F BMNNGLY9
1,666,302,065 *AF55425305B1EB736B4915EE6537D9FFF49FD2B3 c%r,m
1,666,302,066 *AF5A6EAAD782889A4525DD1E93D5637B7870E54E B/NY&
1,666,302,067 *AF5A87C1E97341CD83C5C8C942C3D018E6031B11 c/si,
1,666,302,068 *AF5BAD86E6F1D35A3F10056E4E13856569DFBC84 bp,
1,666,302,069 *AF57D4767B248A3C9C834135B991AA141CF82088 BRENDA.BOREN
1,666,302,070 *AF51B9315D31258EB0C05A7252BA238A9A3E901F d4ba
1,666,302,071 *AF5014FB09A1A37EEE007A18BB535B7B27680FB2 BRETTREWITZER
1,666,302,072 *AF55986AD7BC4E9821B86AF8DA15629C10AEF070 BRETULSES
1,666,302,073 *AF5ECF5CFD59587F3A93D6F83CED90E18110FA1E d5eze
1,666,302,074 *AF51AA1D4C52B87196DA55EF492E4845C505278E DACMATS
1,666,302,075 *AF54FB63BCF3135618A2C7459A648CEA6D3F1211 dallassurbaugh
1,666,302,076 *AF58BC6F574DE567BCAB66391429086B891A73CA DALLT
1,666,302,077 *AF5223A0EB6CA25A3327776726FBB82118B01BCD b#$/s
1,666,302,078 *AF50A0D058F8F426A6CEB89D171D641799CF8F2E darylsengun
1,666,302,079 *AF59422AAD735B0C4A98605B33981080BE17C60B datdogstacy
1,666,302,080 *AF5C1C3973D96909612F8315418E71C5676965E3 d$coun73n4nc3$
1,666,302,081 *AF51189CBE58F4EF37C2D64EB3ADF14E1E213A17 [email protected]@71ons
1,666,302,082 *AF57AA4E9A5D4E1D3C10EE53D27CA7015E34C0F6 DEM49NE7ZES
1,666,302,083 *AF5F23D2AFF8490D00769FA317BBAEAFC9FA3FC3 demraeno5
1,666,302,084 *AF5E6E75C64CF814470B374A5968AAFA6B072ED9 BUSTERRETHMEIER
1,666,302,085 *AF5E230E47640C7A7C6E8C74F38491F14E634CD5 BWL07
1,666,302,086 *AF52C23D936D809BA244B51A7DE5BB1EC360AC4D BXK8Q
1,666,302,087 *AF59D84896359B0382E37F584519C0921D597B6F deue
1,666,302,088 *AF5CF9A82CE209FC0C4168D34B4C4199E2B74FDF C5HRG
1,666,302,089 *AF5CCFFC92AB59FDF713F20CFBE992E0FD54C24B c#&ae
1,666,302,090 *AF5BA098C0BADF3D09CDBDA22E164E32601F1A74 [email protected]
1,666,302,091 *AF55E22576961626F8F874E0D85EFD0F98DC3F2E caladera3
1,666,302,092 *AF5CAAAB6018309DB49713457000D507997615B9 DIRKCHRISLEY
1,666,302,093 *AF56CE8533D695D2AC2B40D5E631C58861E3FAB7 DIRKEISAMAN
1,666,302,094 *AF52D1A6DB3C3DF074C16B4C9012299F9FC3C047 CAN'T.STOP.THE.WORLD.(LIVE)
1,666,302,095 *AF545CC217DC20D648D596304F69294179FB59EA canwill9
1,666,302,096 *AF5BC898528740E6572763D1A2FFB4FCB86F02D7 [email protected]
1,666,302,097 *AF500620A750FD89CCD75AD81D3B3A2AFA76A162 diupen
1,666,302,098 *AF5087CDAF5CB0408086C57EB57C9CBEDE062CD5 CARLO.GOMEZ
1,666,302,099 *AF5A255CBE30F990D4CD6CF9B4E6772FC0B56C2D D#JYV
1,666,302,100 *AF5860C47B0FDCB94CC75CEB8B0CEF04BF8F1EA1 D%KC_
1,666,302,101 *AF503EFDE984BC570FBDB324960D7DC2A332FFA8 carmen(v.o.)
1,666,302,102 *AF5C681748372C655D98D83D4CC776818F54F6BC [email protected]
1,666,302,103 *AF561700E256368BE5B64BD01F986179307256AB [email protected]
1,666,302,104 *AF5304F0D2EC31B3701B3A7898DF220B8722933D DLYP
1,666,302,105 *AF58B0A53899E26D94E1BD73767430C072259A7C CASPER-ENGELBRECHT
1,666,302,106 *AF513FC0534385EFB5F2B291E378550024CB4642 D"?MT
1,666,302,107 *AF5E51100F966171F9CCA5D493499FDC597E1FD8 CBJ!S
1,666,302,108 *AF544529C2A79FE48FB63DCA13C6713EFB092E83 DOLGOZHATNEKE
1,666,302,109 *AF5EFB3D2FEC5F7421A88E19BA0F8B71BA857818 donnajclark
1,666,302,110 *AF52720CD8162B7AFEFA6AE8B69172C59301A213 cei)b
1,666,302,111 *AF51550E006EF70C10D303750A7553D3C2A2AC17 CE;M(
1,666,302,112 *AF5DB88377B3E3DE50A2B49D07A31DDE99F699F5 DO+RG
1,666,302,113 *AF57A41BE1DCD9435D4CBCD6C02AFE067431249E CHANDRAMOLLIKA
1,666,302,114 *AF511A851D9867584B6C1E26422EDB861B08329E CHAPELLENIE23
1,666,302,115 *AF5CFC33CC92000AD4E05F216E9A7EF40C574D81 chapter.25-01:.a.word.of.honor
1,666,302,116 *AF5BDB1F4F483D2ECC3F1CC052A107BFCDE35135 drapables5
1,666,302,117 *AF5A8302845C3EB8A7EA48C3CF9DDE63D27876CF dr)k?
1,666,302,118 *AF52C580A64331B017496938DA994848A09A755A D-RR0
1,666,302,119 *AF5E610C6A1093411CCE02776516C023C4687378 DUNCANSIGLER
1,666,302,120 *AF51C35F8D84589F29928EEC061643A346CBCF47 CHONG.ESCANLAR
1,666,302,121 *AF5581243BACAB1360CBB392A89BF3A8D9DCE413 Choose.only.one.master.—.Nature..~.[[Rembrandt]]
1,666,302,122 *AF52E89D3C05BC8E609E838D94B013D0EBA84DB6 chottomattekudasai(neversaygoodbye)
1,666,302,123 *AF5D71BC9B25AF4A15F3501BD0943CE474126AA0 DUSTINRUSSEL
1,666,302,124 *AF5A197CC355D3C09232FC474ECE0ED563A89779 DV18#
1,666,302,125 *AF5799930ACAD853ACD1C6677003FE40D89A81BF ch-vk
1,666,302,126 *AF50BD7C83C9D7091D6D3F18C9DE0CA86AC1B910 C"#IL
1,666,302,127 *AF5903D18F6FF7385602BB24E10F877E2697D7E5 cj2=m
1,666,302,128 *AF5C51FB630F04DE8DD1A4980401D46597A49DAE EAWWADUVED
1,666,302,129 *AF5C9ACBB0D308F819F550718E5C13E28B6FD071 EDGE.ORG
1,666,302,130 *AF59B0D57B09AFFA79A1AA6309452F4BFD8231DB EDITCOUTINTITIS
1,666,302,131 *AF5780158F9998ECC2584975E6B957BDEE6DD73C CLAUDIOSPILLANE
1,666,302,132 *AF54A6101803C7CD94C977389EDA512AF8B77B72 eduardogudino
1,666,302,133 *AF54804034F6A8F36DC79384CBFB278ACC8B8262 EFT
1,666,302,134 *AF5D82CE5589F23693CDC78E7FF2237A244EB3FF egdd,
1,666,302,135 *AF502ACFF781816C23D92729D24F85D93F662D6A ELHAKEEM4
1,666,302,136 *AF53488549F2CBDCD39AF602709F9D5ED3D0D358 ELLIOTTKUSEK
1,666,302,137 *AF5FAEF9D9FDCEF703276ED28E6BD9993D14239C COMBATANTS.TALK
1,666,302,138 *AF5B2EE3DB0F172BB0E6B3C1B4FC30012FE3EFE2 COMMENT17972831
1,666,302,139 *AF59CE599CAAB9D71DA89BE1533C70A1DCB5FED5 COMMODITIES18
1,666,302,140 *AF500BF33F4E3FFE1092E3EE7893825CBFCAF6B2 el.regresso.de.maria
1,666,302,141 *AF5A9C53F956BC4753852007A91C2C1F90C93A21 CONNIE.REINIER
1,666,302,142 *AF529429EE6A9A2A879F8BEE355A74FF24D93770 emiliobardill
1,666,302,143 *AF5AB384F2A369B21372BFA17C465E2BC4AA73F3 consumingly2
1,666,302,144 *AF5B9618691B61A97290E34BDC6091F584AF68D7 emmittgrippen
1,666,302,145 *AF5FC7A3DCEB9DC354645DC172E36C71A9887D43 $EMTONE
1,666,302,146 *AF586E9C4DC57EFE37CA3131B53FDD42CE128D98 [email protected]
1,666,302,147 *AF57640BFC74FA21DD21119700C59B53E7D8CABB CORU3
1,666,302,148 *AF5CE22F7E1E106E25EF05C8676CC2CCEF59FC7E coyhollimon
1,666,302,149 *AF52818FEF3FC766B7D267C295C171064F64DA63 ENLARGE
1,666,302,150 *AF5FC4B7F52578CE9D2F8EC12D764A4BDBD3EDB1 ENV4#
1,666,302,151 *AF59DA5759F82536C82A5BC8151FBF4C1C952F28 erickbaer
1,666,302,152 *AF5ED2A8D543E2D488A313A4CAA6E925DABBAF87 ervintitze
1,666,302,153 *AF50498D66DDA4284053CC58E7E3750D383B7436 erwinosollo
1,666,302,154 *AF5B2CC91E5895DBECBB2D8998DD19BAE3466E40 CROS-DE-G
1,666,302,155 *AF59A3A4CF70A9AC81236A41E146244506BD5CCC ESTRELLA343
1,666,302,156 *AF5C0BBA279A5BB3412B645A367BFB1D2B1D332C EUGENE-DESAMBIGUACI
1,666,302,157 *AF50689F8A1889E4E5AC72AA411CEBD5A1408DD0 EUP54
1,666,302,158 *AF5E88D721BDD94363151EAC3B27302ED6383CA4 csme&
1,666,302,159 *AF59B8060175D11D73EDAEB6BA37FFF18BC94CA8 c#u4c
1,666,302,160 *AF5B653F0EAFB77748891EE6CE50C35D9268D3AF [email protected]
1,666,302,161 *AF5DC26DD400A831EE64ACBFA7901129C638112B curtisfranchette
1,666,302,162 *AF5191836E76876A463A097D8040189661BDBB61 CURTWENDELBERGER
1,666,302,163 *AF54C6E53269FA39B3C542C013F52CA55BAEB28C [email protected]
1,666,302,164 *AF5DAB78DF3236D92CE373E11497F240BCD48E28 CVU7B
1,666,302,165 *AF5C0EE24C2C975FA8D662403B2D319FA004A02A faa4c7402b9c3b198dea22390413f02b
1,666,302,166 *AF5A57CF9839A7FEB6F535B8D2F9A726EB0C6348 FABIANTIETJEN
1,666,302,167 *AF5F7D9D8284B39B9299F4C316FE62DF6A77D2A6 C/WHQ
1,666,302,168 *AF5F4AE29C9ECF2590E5EB08E12E1EC915104153 d25sv
1,666,302,169 *AF5048C7B72A1327D6E530D2747B4A19F7868FE3 d4_iq
1,666,302,170 *AF5D05C9F4EAD7CDC33A039A86236E2890E3E440 FGRIZZY
1,666,302,171 *AF53A455415C1026BDA0C6C0C2CAC30C0E5883E1 d68fs
1,666,302,172 *AF5C24B22E4581C798F536AAD66DF199319827CD FionaDuncan
1,666,302,173 *AF52DFD7E71764670D48E916760BD68B847EB325 dallasfeltman
1,666,302,174 *AF5921812C42BF3051752164A2961A3481C17533 flammeundharfetrack20
1,666,302,175 *AF57E000FFB96502A533D68E56DC25257C41C7D8 FOGLIARE2
1,666,302,176 *AF550EC14B20F1BD7233786E306320EF7C1FD46B foolprldu
1,666,302,177 *AF561EBD935FFA30A68EAC49D8145FCA8E3C33C7 FORMIDABILITY3
1,666,302,178 *AF580F876E185664BF50F6DA537E57552C8EC0C5 darrellgraydon
1,666,302,179 *AF5CF76E27874967FCD6112E9ADB8647AA94260C FRANCESVANDERGRAPH
1,666,302,180 *AF5B69D57655D58B0FD9F038B3763759D5C0BA74 DARRONGALLIHER
1,666,302,181 *AF5D030B38223212EAC7E8694BD4BC0D1BD1A40B [email protected]
1,666,302,182 *AF5A96612A6E90E11614A4D3C624EE8477B19DCD franklynmccardle
1,666,302,183 *AF55CF0623E9D7AA154679300AE139D5B652B3A6 FR!CA55EED
1,666,302,184 *AF510B756896500088553F52D48020B2BB4D96E4 davidschriver
1,666,302,185 *AF5C23DDB942941E67772087896DA57793C191F9 FRONDS
1,666,302,186 *AF560AB0C03D54F15ED2B2E80C4BB39363615F09 fugible
1,666,302,187 *AF5C2F43A416CB832F7F4EEF879EB97514638945 dcg/"
1,666,302,188 *AF51D80F32B63AC008FB0B59AB2AAC2D2ECDE3AD DDHI_
1,666,302,189 *AF5C1D1AADC6F808A9F89E2031F574E0FF79BEDC [email protected]
1,666,302,190 *AF5AC233026DC9F1104FA3655B58AC9E825403A1 DELMAR.SYNOVIC
1,666,302,191 *AF5E23B8B8C6007FD2CDC973C3B9B195F9F7678F delprimas
1,666,302,192 *AF549FB8E3780D2BECD7DA4E97DECD0392C9FFD3 [email protected]
1,666,302,193 *AF5E4A72F8E64440D1C43D0F85263AD2A2914916 denv8
1,666,302,194 *AF567675BB2C9BE84D01BAA9358A1547DC278315 derekiarussi
1,666,302,195 *AF5268D2835E6C14AF7561BEBEA38FEF6A1D1B02 GARTH.WADLE
1,666,302,196 *AF5356EA112BC664A33E230BA27AE4036DBDB439 GARYVILLASENOR
1,666,302,197 *AF5DD55A44D12E360F8B8CFC973D258A61AC2918 GASTONPECHAR
1,666,302,198 *AF57BCFF5C41276E4925EE89B8260EBFD18A7D31 gazump
1,666,302,199 *AF5EC01C234DB14827B7937EEC98A11E9307EA7D dewittlecznar
1,666,302,200 *AF5116AE377C4E50CAA094A01C3D52E18E51C92C GENENDAL7
1,666,302,201 *AF5DDEBDCF15FBBDB84A5F45CFE29917693C828B DF/#I
1,666,302,202 *AF5BD39ACAF94014BF353037B81F7CDECB95D955 d!hb&
1,666,302,203 *AF57D8B6B6A93D7EB7BA517B77E8627D8427B714 diegoswing
1,666,302,204 *AF5C422DB3A29B074340AA18CC06656C28F19363 GHOLTHORNE
1,666,302,205 *AF508E88D83D86CEE12A2B52F2E115369E0DFB7F DIE ROSENKRANZ-SONATEN: PASSACAGLIA
1,666,302,206 *AF569C1CCAE846A128188667C58851013F27AC4E [email protected]
1,666,302,207 *AF58550C0FF30C62C285B5D969F509693988CFA1 [email protected]
1,666,302,208 *AF5E961899190DF4DA0731D5E1A809F938E0C588 DINOARLAN
1,666,302,209 *AF57A35F9CB9D4179B83818DAE02D3E0C4474948 DION.HOGGARD
1,666,302,210 *AF5A5D08DBAE43C845F0E6D820ABBD888C4CEF34 di)pg
1,666,302,211 *AF5A39A5ECA611F819DC46CDC609B86045F410CC [email protected]
1,666,302,212 *AF540F7C0B571CE6090672AB5AA2E3B0D6A36785 DIXIE-LAMBERT
1,666,302,213 *AF52931B57AD42CBAECD2C8C8D402001DBF19E64 dk"iy
1,666,302,214 *AF5AEDA4EE3B5E54724D2436427CC47C3749A0A6 DONKEY48
1,666,302,215 *AF54766E22DF31C9B313FF65BE4399B5F187DF0B DONTE.BEVIL
1,666,302,216 *AF51998D8CCD8B322986620EE8E19FCED3F5034C GrassSkirt&FruitHat
1,666,302,217 *AF549265082BC94242CBB4D9D18B157366ECD993 GREGORYJMURPHY
1,666,302,218 *AF5D33B39AE6F10F25A660AFEFE80DBBD3EB063C GRETTERSES
1,666,302,219 *AF571C16CDF9032B918D32F94E8AF3F406F7362C gtw!
1,666,302,220 *AF57F138DA159909D32FB64151CC02D3E4C9269D [email protected]
1,666,302,221 *AF538A27459FC563C07B0A5809143E730FBBC49B DROWNINGINBERLIN
1,666,302,222 *AF502336CF977F9C28C160E0EE6127CA896E920B d=s.r
1,666,302,223 *AF564FFD86C9CD2C6975BCFF895248CAE7BA5F6A [email protected]
1,666,302,224 *AF5AD6012A123929CF4BC6F9440F5B2C0A354DC8 DUNCANWOODWIND
1,666,302,225 *AF57F144B602D773D944F9AD34F5ABF5DEB67ACF DƯƠNG’’
1,666,302,226 *AF523C784E0410094937A8F03F8A0D6AFEA2A4B4 dz0qb
1,666,302,227 *AF51D1A77E7573D2291D9D7C9976E512799EC78C e$74b1$hng
1,666,302,228 *AF5137C078336B04AC94400C5957B2C751499615 eagleelephantgmailc
1,666,302,229 *AF52A463FD1B2ACC45D14B29AE318D8455DF9267 ean2l
1,666,302,230 *AF528A1A66C042AEEC82E67A853799DDD5CFA28C eb(dg
1,666,302,231 *AF574ABC56873A80DB4CDFEB31F6A0C4D481FAC5 ebo.l
1,666,302,232 *AF552ECC65753AA1F68F64F78290B81EEE6BFFD5 hermanaxon
1,666,302,233 *AF5D28ECAFF458F14C7B38AFCB1AF4493744EC5D EDDIE.TIBURCIO
1,666,302,234 *AF5E6A9B43D98ECAF30ED425E5BB250B052C265F HERSCHELMAXI
1,666,302,235 *AF5BB11D42AB78ACCB0C486F33F0834D439B801D herschelschmeckpeper
1,666,302,236 *AF5AA56BBA8E7A0F418C74304683BAC4E2BB7380 HETBABY!
1,666,302,237 *AF51CF015EA211B282434174B550F129B23AC636 HIMARAYA0
1,666,302,238 *AF562F1AEBF933CA154BA0F20877199E548394D2 edwardveys
1,666,302,239 *AF55A8555D5015F7D552630AA504F5687339ADE5 HIPOLITO.LADER
1,666,302,240 *AF5F53679C4AC7E6271D9F95A7C4720C42609630 EFREN.MINISTER
1,666,302,241 *AF5014E4C48BD6F059871BED319BB1DE99DB48D3 Hollantide
1,666,302,242 *AF5B589F4994351BA77D2DD1BC8DC54E7C2BB26E holstbakken
1,666,302,243 *AF5B5ABFFBDBF1C848D14750D9FBAB124938E161 housy-grooves
1,666,302,244 *AF5D99B6C7AD65C7880D3A090B33C91F886AB8B8 el.
1,666,302,245 *AF5B32D7C5F8944E150E95CBA8D66369392A4691 ELDEN.TREMONT
1,666,302,246 *AF58CE3257B28391A377B84FCE3D8A3D1B8E4AA8 ELDONCHADBOURNE
1,666,302,247 *AF58708BE4DF213EC45FF503517DDD3846C479C1 HR(C
1,666,302,248 *AF53FF234402B9A8A968E7CD4AAA3ED71407D6C6 [email protected]
1,666,302,249 *AF510B26DA476A3A108912FCA5AA121F11AD70F7 ELLSWORTHSPRENGER
1,666,302,250 *AF5322FF2008AD45EDDF483CA06E1F63918DA500 ELSEFRASIERC
1,666,302,251 *AF55753DB9A45BA685766AC7F271B25C6EF2A1D5 HYALDETH5
1,666,302,252 *AF54CA7DD68E797C967BF9A573699D545E2D0A1D EMM3;
1,666,302,253 *AF55E3CA5C1303074464BAA9A1DC289B1173BEBD HYPACUSIA7
1,666,302,254 *AF54233D0280F22250E90E448027A542805B73D4 ENGELSKTING
1,666,302,255 *AF5E937340C0A9E588FE507F88C3AC2E4D888F79 iamcuervo1
1,666,302,256 *AF5257870957DAD3E425B6AE991105EAE004ECE0 ENOCH.POPIELARCZYK
1,666,302,257 *AF589B554D9398E1977986C1C20A5B657383F5F2 entelei9
1,666,302,258 *AF5BF9CA09DC527BCEAAA6F592DC2D5C704C6303 IFASO
1,666,302,259 *AF55EA0F4C92DEE19297FBFD9B831EBF873B61B9 ILLUZIONSES
1,666,302,260 *AF54D649E4F03B78ADCDC5C9E1AF092288691244 eragonrocks
1,666,302,261 *AF5C1CC126F21CAE534226FEE25D8EB3E81C4E8D ILOVEREDSKINS
1,666,302,262 *AF5155DFFAC8609A5B24DD008C055CC74952093D ERUDYTOMJANOVICH
1,666,302,263 *AF561F40C29136DE97B62A9F82169584FAE16584 esad0
1,666,302,264 *AF5152ED075B2D3E2722C4EDF29923E9A22BD127 INAUTORISIEREN
1,666,302,265 *AF52466FD1E156122267B7B912A0BB4CABF32D8C ETEREVOI5
1,666,302,266 *AF5E8F20673AC1C4DF9056D77519A94AC5D94DC3 "INGRISSONNANCHE
1,666,302,267 *AF57D9A84E1C2A436DA7F91EF3E0E6D42D9CEA09 [email protected]
1,666,302,268 *AF5789FD0967DF0DD53320F31B221E4DFB028507 innerlies6
1,666,302,269 *AF5F7EA270E77F9610A53C79AC3FA1FAAA33CEF4 EUEV
1,666,302,270 *AF576016D20D3A585D1C1EE2AF1AD73544CE66D0 EUGINIAHM
1,666,302,271 *AF5A2C6A99780A45EAD9CA816C3494D65D84C2DE EVAEWNEP4
1,666,302,272 *AF58743F57FA34BFA5DCD8848B4FD2BEC93E5DA7 EVERETT.REAUISH
1,666,302,273 *AF55CFBD96461793EFE067CA69A6349E12E04663 IRA.DEROECK
1,666,302,274 *AF5253E8EEA416DE8A13B001FDEE3229D46B489D irfb
1,666,302,275 *AF5031C5C1F9ADC1C836E46CEA5C52AD1AE33A08 ISAIAS.FLORIANO
1,666,302,276 *AF58AC1F89ECD1E4352B4B78C5D4E22A44420DDB EYS"G
1,666,302,277 *AF5B8A9D5BEAC55A956677D759325A08C746378F ITSERESSEL
1,666,302,278 *AF5A2EA3D5677898E5D164237BB3AF546FBE0FD2 ivorylachapelle
1,666,302,279 *AF58B8D619BBFE30A2FC3469636D1F0A23EBE4AB j9*9
1,666,302,280 *AF58B44211F8FC4BF4DF08236AA40CE726B575F5 FAVOURITE THINGS (BEAT DIGGLERZ REMIX)
1,666,302,281 *AF57AB822A6FAB1C94B210596C27BB1005F6025E FEBRYANTOA
1,666,302,282 *AF5C8E0E129D3AA93AE794D99024E33F03B6EB6D jamaalbennes
1,666,302,283 *AF5FD01199D09FEDA27A03F653A4ADAB2EFBBDCA FELSŐZSIDI
1,666,302,284 *AF55BA09EC08EF09EDDEC29894855A9DEF991B25 JAMIE.MAVER
1,666,302,285 *AF560A6089EEE4FBB22A7A65186C51475E12FB3F FFEROSE
1,666,302,286 *AF58ADD8FA015A214C50DF0E6ED59BFEB1382D82 JARUNK1
1,666,302,287 *AF538FE78164FE686338C1AA72FF4AD6D54BADF2 JAZMINEKAUR
1,666,302,288 *AF550AE8AB3544063A6CDB65852D2652A7D42740 jefferyfrascella
1,666,302,289 *AF53F53A37BA7CFE051D4D9686D69A96A34CD0E4 flour_packerfl/AU/r_'p/&/k/@/r
1,666,302,290 *AF51D7D3DC274051B021DEBAF184DEC65AF1DC46 FLUGVERKEHRSDIENSTE
1,666,302,291 *AF52A6A9344C1ABE32E7E7C25DCC37099620B41D JEROME-GRAND
1,666,302,292 *AF5EB22039A806CA30EB89E3E6BDF57B654172F3 foolsrushin(featfranksinatra)
1,666,302,293 *AF575E990B5307A1C4990BCE3C845B19EAFED80C fr01!cked
1,666,302,294 *AF5AEDAE385718200703FAD0FEFB0E25411940CD [email protected]
1,666,302,295 *AF5B5B1B4ED36CA524BEE4FF538E0B15E3D73F8C franklinebarb
1,666,302,296 *AF50FA38B873C1B0B245DCB295B5D0049189A376 jimpolo4
1,666,302,297 *AF5F5F63E592989E3535CF6794EA2B3A8FE7C71E FREDERIC.ALLDAY
1,666,302,298 *AF50D9DD93569C669D41E0FAEE67406AA2C821FA FREDRICK.RASMUSSON
1,666,302,299 *AF5438806A5B7E58F1F26A7D5354EB13CEF433D3 FREEMANARNOLD
1,666,302,300 *AF5624FBE54666B80254A1DEE94B8995D542C42D FREEMANLANGLAND
1,666,302,301 *AF53577BDE6F82A9735D1D634CA9CCC0B386A411 FROMSCENEONE:HYMNTODIONYSUS:HOLYJOYANDGETRELIGION
1,666,302,302 *AF5A4D11E82111DE13EAA9750BDBF57DB39680C2 [email protected]
1,666,302,303 *AF5E1383F716CDB4CCF2B54D896607F650E9678B fu1f11m3n+$
1,666,302,304 *AF566B6F580FC60C0612A3E287810EC335123CB0 fwj
1,666,302,305 *AF5671C4AA0DF01A090EAF778D91211B284274E2 g0qe
1,666,302,306 *AF527F36466E5B9305B6D2155DC4FB5AE60FF339 JORDAN.KATRA
1,666,302,307 *AF5B516B9E26436BFA33789A5BB877E666919935 jordan-revels
1,666,302,308 *AF562D9B21584F83A40A0F27A582221DA34D94CB gaasgoob
1,666,302,309 *AF5218454A0A3F18BB2DD69CC74E891BC87B299B josh-travis
1,666,302,310 *AF50B77BC31DB9866E0D6A321BAA1B14D18B7B7A GAILWALCZAK
1,666,302,311 *AF566330A477550B530554DD7E1F73D339BCAB25 GAMOND3
1,666,302,312 *AF56E645F0BBCA2AEEE4A2FE4FDD5DDAC748939B JPHOPARISUTH
1,666,302,313 *AF55456A8917AE7FFF4DF99052053D60709D084F [email protected]
1,666,302,314 *AF539083BD0FC13D94BDFD1F643A67C325F34B53 JROCK4THEWIN
1,666,302,315 *AF54D2F150F7E7EA44FB3C61073D42324BF9A05A jzka
1,666,302,316 *AF5E79FB5576662661F3B8E3F07ED0BC3D6AE6A4 [email protected]
1,666,302,317 *AF5C929D29B817180CF4090BD645699DE46D04F2 GENARO.SICKEL
1,666,302,318 *AF50C01720C4097211DD746A084EA2453985565C GENERALVSTDIR
1,666,302,319 *AF5CA98B4D85D583034691E18F50390A69C89B30 GENX7VOANZ
1,666,302,320 *AF53E303D12687567DA57E3C8D82D2983FDBE954 kayla.weis
1,666,302,321 *AF5897B11CF25C197A1992213979D747BD659116 gerardstanford
1,666,302,322 *AF5B5033E661F0BD677285E94D8F37DFAA05C123 GERRYESPANA
1,666,302,323 *AF5A715CDEF341786A3A9D1BF14E71F875FCB9BE gerustet9
1,666,302,324 *AF5D3E5061661F7C8F4A3256CEA18092161A9D60 K.E
1,666,302,325 *AF5CB14CCAE084FA0BF160D9BF395FA4CD0BB82B giovanniklier
1,666,302,326 *AF5D7FE58FB821CE534269ACC30C3627DD76D9CB [email protected]
1,666,302,327 *AF5A1F5762293BF601A121F4848AB86A744E7BA7 globulaireses
1,666,302,328 *AF5C07A50BCF65E14DE9B275BC34B8F69F88E915 gqle
1,666,302,329 *AF53CC726B5B55BC0D0F4ECBD572009318F2D6A1 [email protected]
1,666,302,330 *AF532FD9EB8CC4D57CEF55EE806845B9D2205FDD gregorybelyoussian
1,666,302,331 *AF5B0F38DEA94F74929CD8CF16EEB8F5B2F792C2 GROVER.VIOLET
1,666,302,332 *AF5FD6BC3C72E8E3F8913890552FD5977BB3888D GSXFSQPU72
1,666,302,333 *AF5A2921A57A6CD8E45FC491601AD58D9914719A GUELPHE0
1,666,302,334 *AF58A7278D71D13C74678C12226F206076A93DEE +H1RS+ER
1,666,302,335 *AF589A4A4E85CD61E231221DB787D71B1E744024 KRISTOFERGRAVELIN
1,666,302,336 *AF59D2AB7F0649FBBDA47545EB626C926FFF655D KRTLGSTR7
1,666,302,337 *AF523285296103AAEE5F7A9EF73EA9C00580C140 [email protected]
1,666,302,338 *AF5F48F91F8358030828D5A731F98CFFB95D9CC2 [email protected]
1,666,302,339 *AF536C19268AE7D9E1BFDBBD1A1881171963FD58 HARTCD1
1,666,302,340 *AF5DDCCC424C3D06B52AB5574F22E9B7B6C3CADD HAYDEN.VOLKERT
1,666,302,341 *AF57114E84A4DE6D118FCC88CD36D4315FCA0F7B HBOの
1,666,302,342 *AF57A0C792B53325D519E42CFE140397F1EFD11B hclewsci
1,666,302,343 *AF52BFE6B234F4CC698B265E3ADFE88471BBE86B LAVERNCLEVEN
1,666,302,344 *AF5CF7C3F185C187E5B8358B40C092CABF5004BF LAYINKA123
1,666,302,345 *AF5058BD41F4E98133E7A8222DC70DA238B95353 LAYNE182
1,666,302,346 *AF58A562AC1133F58C5E062A907763F6C28A0705 HERB.SHICK
1,666,302,347 *AF5F5C1C689AC4BA51DB0C76CA542862832D1EB8 LEENA.FADI
1,666,302,348 *AF537D5154DD32158B91ACF7DF7FB0BCBE5AAFE0 hethinkshe'sraystevens
1,666,302,349 *AF5C51CDE9737D8B1AA1B83221A8534B55C51521 leirta 4
1,666,302,350 *AF5A126D77C902EFF136A667193AF44AEBF2D173 LERIDUʦIˈOːNI
1,666,302,351 *AF527DAEF527E90CA88478C1A4401ADEB7F22AC6 HJERTEINED
1,666,302,352 *AF58A9C2CDFC8F128CE2D4E236470EF7B72C5F9F hkg
1,666,302,353 *AF5260C51060B8E98C3EA0900BFE30E58427EC00 [email protected]
1,666,302,354 *AF586A6BAE6FFF4F911D8ACB7C766E7AB7904C39 LIEBLINGSSPORTARTEN
1,666,302,355 *AF5914BFA5F024862E953252A5466BE931413D90 lindau''-class
1,666,302,356 *AF50440371FC82D1A50F057C08AE9BA9E6DB66E7 httpvampiricrageblo
1,666,302,357 *AF558006E29F48E9A7D9663274C55CD01525C442 httpwwwlivingreview
1,666,302,358 *AF5752748F9387AEC5A2A38A435119A2398EF42E [email protected]
1,666,302,359 *AF5B62CA256ED553BAA607390994931B6EA6AC47 [email protected]
1,666,302,360 *AF5E1FC13C8FED0B66D3A92A63D29AB4640F5B11 [email protected]
1,666,302,361 *AF50CB987767C7297CEADFB9F4E13EDBDB29B505 I68LVLMACGNHZS5
1,666,302,362 *AF5FB321CC0AC0CB636A0BCA22D2F3E34D1B2027 IKEHAGENS
1,666,302,363 *AF5A15EF9E4A34180F76AD1A8BF8BF09EEB0A55D illezrap2
1,666,302,364 *AF578FFA21A4065B050099ADA3B20C19D4628FFA LOUISTAI
1,666,302,365 *AF56B9E5A157BD24ED087F37E4A779F3A4C611AA innviklete
1,666,302,366 *AF5BD5245523EF68E3D461C6058302BEB2EBFF25 [email protected]
1,666,302,367 *AF569EF6E0CB88702097181B77956F5E9CAEAE95 LUNARING0
1,666,302,368 *AF589F4CE8B3D5357A698319E900396FAE84BC17 maha-al-jamal
1,666,302,369 *AF5A5BF62BF99C848933E6BDEB94AF3251382ED6 majorwhiteside
1,666,302,370 *AF5E41ADDFFC4041670173F206DF789ECCF513A2 IT'S OUR FUTURE (NORMAN REMIX)
1,666,302,371 *AF554578BE69C2DC47B4C95AE53C7F18BF8DF0D2 IVVN
1,666,302,372 *AF56F8DA75905CBD8A38E45D475F23C847F6B65F MARCUSKUIPERS
1,666,302,373 *AF5D555ED0BEC1327793CB89430F04115F8C3700 MARISSA.SAENZ
1,666,302,374 *AF58E6FEBDCC25A627B6EDCD7F3CB0E74DD40781 jamedetrolio
1,666,302,375 *AF5EAC98197F4B124DD46826E160FC3CBE8C34DE mary.jane.chapman
1,666,302,376 *AF508FADEF22D18BD20F0C6B07AB74B77C37C593 MASSILIAN2
1,666,302,377 *AF56E9837E5B77278EA9ACECE54319023F0D59B8 JANTERRY5
1,666,302,378 *AF56D2D5A4EBE0D2F64E862A955A1C50060A70F2 MEGHÍVHASSÁK
1,666,302,379 *AF52FE4138A54BA60946D6D70EC5E58C511D3D10 [email protected]
1,666,302,380 *AF520CAE71A3B5FC05FDCE53CD5BFB2311EC68EE jasonmannix
1,666,302,381 *AF59D63BAF24BB3B193471749DAA2DE4D7612C8F MEMORDEĴORON
1,666,302,382 *AF5CCCC75F8F5E9B8AE7517E00ECA46CCD75B845 MESSISCORES
1,666,302,383 *AF53ABF74B19A61E5951D19903BAAE1D9C89CF97 jeannetteangulo
1,666,302,384 *AF511704C3552FD0CE2F50C041746F968C73AB51 jeffreymika
1,666,302,385 *AF5351A55EA64EB8984FE5A21A25B4A05625CC8A milankorthauer
1,666,302,386 *AF546AE875B0D89610A2AD0424C06BE19381FDBB JERRYSON-OCAMPO
1,666,302,387 *AF59EF53A6102E1C4141D14F1ECAAD6C43DFBB3D JESÚSBV
1,666,302,388 *AF5F11C622733C108953AA3DC9CADF21B1C4F7FF mj565386
1,666,302,389 *AF5175E888DF3E1337D368049777F15FD5A7122E JN19990002581
1,666,302,390 *AF5735173FC344B5B802CFE953B13955A1B59E2E MNSTERS3
1,666,302,391 *AF57C55F280A85B362132F2159449020E5CCB4D4 mohammadbowlen
1,666,302,392 *AF5BFF0BF94D172E268BE0C47A9FA2BF1AAE189B MOHAMMEDHEPPDING
1,666,302,393 *AF5DA0C729DB036FD4EA2048F746945A3802024B JOESPH.STRATTER
1,666,302,394 *AF5BBE674AFAE1F57F045F34B426B3854BE3A2C3 johniebilby
1,666,302,395 *AF5940EC76EA0036FCDF397A1CADD5B425A2E407 johnpadenandteamcomwww
1,666,302,396 *AF5D977058EA853DB4BE9369B0B86399A3C50CA0 mortsle1
1,666,302,397 *AF540E36A63A8D52D40DEC8A94DA78CE2C5FB6B5 movistar.telecom
1,666,302,398 *AF5173C0E0DE4B9CC145E40D7C9F4AF95D86A239 MPHLNCS0
1,666,302,399 *AF590AC378FB0793605D3646532A2B8FC78FBD2A [email protected]
1,666,302,400 *AF5572ED86358414AE4B5ABC0242E3CB76C1124A MRVIPERING
1,666,302,401 *AF5F5A674CDEE2FE94571EA167B19CC96CDD5D1D JRATTLERS
1,666,302,402 *AF548717DE0E908A3A35F4AA577CFB8E43D9915C [email protected]
1,666,302,403 *AF53573FED8AFA161723FB7A45FC62CFC8D84D35 julescampora
1,666,302,404 *AF5F7E13E6C2308A6241220EA71CA6E5FB3AAC58 JULES.JONESON
1,666,302,405 *AF5BD65FEF24ADBE9A59C7F57BF4123D6341717E MUSAHHAS5
1,666,302,406 *AF591D0B35D169BB1C1B609D50E4197D8191ED29 MYLESYEATON
1,666,302,407 *AF53D734A14BB1931EA5F3FA79BCAFFB421ABE62 jyork090974
1,666,302,408 *AF5AC196EB9CF21ED959398A5D700A14DDE2BD68 nailestair
1,666,302,409 *AF5DD57804584AEBA7BB59830A74412EC030F151 KARINAASMAT
1,666,302,410 *AF531C3B2F97DE9B2F41013785DF69CE1D0783A6 [email protected]$$
1,666,302,411 *AF55A98038E6F4463B197779F3DF6C71AD96E82B !NC4P4C!+!E$
1,666,302,412 *AF5F7DABEAB5B62AAC4FEFA6AC552C169738F919 NCC1701ECHEVY1
1,666,302,413 *AF52D83247D312DD261599B7F3D7831DD6C4BAF4 [email protected]
1,666,302,414 *AF51EFAD3DCF5AFCA7A1CE1EDF6115B9EF14D002 KEENANKARTER
1,666,302,415 *AF54A924D76E56610675948379A6A1B8E877897D KEITHENNIS
1,666,302,416 *AF506D1F958133E637C5FF77CDFE7F35B6BB3B6E NEUVOTTELUSAL
1,666,302,417 *AF5EBCE14AC26DDFDC098E04CC4AC6BE1683F930 KENNYWOLD
1,666,302,418 *AF50F37424D4891C2F239361BAFED80480A568CC NEWOOL
1,666,302,419 *AF5E85C2D49D6EF7E17F252FF74B29EF4CF2A415 KERRY.CASTILLANOS
1,666,302,420 *AF5FE684A9DC5619935710C149B2A5F39D2EB9DF nggnrdhd4
1,666,302,421 *AF5B572C7CF478B4F04096152F5C4C7CCD36E69A NICHTVÖGEL
1,666,302,422 *AF5836ED70C8BB9DAC3DA2B6252134775A7FC41F KIMBO.SLICE
1,666,302,423 *AF5C76B10A074D21E1EF92AE670D2A9E1EFBE21D kipzaczek
1,666,302,424 *AF5CB803037C61A681DF30977DA44CFC307851AF kitabin9
1,666,302,425 *AF5E423CC7D9A7CB69DF6AC56FD749657FF266EF KMATYS
1,666,302,426 *AF58D0B443DC27AC7C3EBB749D2C71BD470B6757 [email protected]
1,666,302,427 *AF57CF367C09378ED9AE71AC406C31366C6ED977 koryfrett
1,666,302,428 *AF592F694B679C366124ADC6BF00D233E42076D7 KORYOVIATT
1,666,302,429 *AF5917AE5668FC8EDE3C4E755F05265869C84819 ktportal1,talk31,spiritualchallengesinascientificage
1,666,302,430 *AF53E6104FA20038CF5C2893EE8367A95C045A87 kwnklrn6
1,666,302,431 *AF5D901E4AA84D3A8BF3214B84A4698122C4FC6A [email protected]
1,666,302,432 *AF5935036367976EF5E5C845289C16AACB920D59 [email protected]
1,666,302,433 *AF5F88A93799D479A9FB364D32391A0931830EC9 LAMBLAYSWITHLION.ORGWWW
1,666,302,434 *AF54B330D4AAE0212D8E520EAF240755FED632E7 LAMIL-1
1,666,302,435 *AF535103ABD4BCF1A1E4605CF2ED1F8772A6D3E4 LANDON.WILFRED
1,666,302,436 *AF53C6C3E03436E003D79B2E8B017EB0D0905E57 langen123
1,666,302,437 *AF5F0CA2C27F6E027A6481F1FB5201536A5E27E5 ofVAXsystemstoshareI/Odevices</P>
1,666,302,438 *AF55099F24A1FC6C2B179DE167E64894823C137B L_B%
1,666,302,439 *AF54710632F48D80DC3963E9A87F4E7DC2F39869 OMARSMAW
1,666,302,440 *AF5C0D64D6D74EAB26510A556CADFA5282996CA7 omestresalan
1,666,302,441 *AF5AB3E2530C0802068F5B8C7A6715F1CD6ACEA6 leonardmealy
1,666,302,442 *AF55D2EAE756E448711EDE9074F149A2BDD2CE10 LE.SOLEIL.D'ITALIE.(REMIX)
1,666,302,443 *AF560550D3565DD95C420E489C442B77CF3900C7 LEVIATHAN4
1,666,302,444 *AF505E70D99F8855FDB81B977A22BCE586455985 [email protected]
1,666,302,445 *AF561E722464CFA2CE7D89A96CB39C84EBBCDBF0 orengiottonini
1,666,302,446 *AF52E566449DE014C3D4EE7E3E23EC41A7E5A0E9 [email protected]
1,666,302,447 *AF5AA0E46E0F64BDB2D37850D154CFABEFE67B05 LIONELSOOLUA
1,666,302,448 *AF5F409960FE108C9CBDD4A5D6139E908E901C07 <Li><TT>Z</TT>, WHiCH TESTS WHETHER A FiLE iS EMPTY
1,666,302,449 *AF55DF00FF849E0C37B5664D0FFB877D5C796E3B LIUDONGYING1234
1,666,302,450 *AF50352568955FC9346E9323694022FEA7623A00 otisdennies
1,666,302,451 *AF57E7165B23036C30F2678E80638EF7616EAD80 oto1o9!ca1
1,666,302,452 *AF5D961017B82FFCCC849206101859695DF594D9 oubeisik8
1,666,302,453 *AF51D6BED9DAE32E8D199FF5984A5E940A1697F8 :[email protected]
1,666,302,454 *AF5B8ABD64FB97D124750657A014DADF2B091666 loretta.wayne
1,666,302,455 *AF59ED6B35DCE5D5599C5821FBA9E310B019AC77 PALATTE6
1,666,302,456 *AF5652739F647683CEAAEA52696D6B3D040B37B6 LUCIANOBARBATO
1,666,302,457 *AF5504EDA3D82AEAF5EF1156C9C5F5C7BB682926 [email protected]
1,666,302,458 *AF5D1E0ED115F81BBF4BFFAA825AE12E866616E1 LUIGI.CUNNIFFE
1,666,302,459 *AF53277FCD717C8C62E10DCD496427A7FDA0198A PAULGABRYS
1,666,302,460 *AF517AC1CB906212B21E76C44A47BC1BDEAC0C00 PEKIPEKIANLAD
1,666,302,461 *AF57C2A68184CA41BF8D588F3BCA2CD60FC8B38B makebelievenorth
1,666,302,462 *AF5585370E68CB89FBD15BF81B8F85A78086704C PETEDANCE
1,666,302,463 *AF5E16E047A8A25A7431B68033BCAD6F8FDC58FC [email protected]
1,666,302,464 *AF5208A5EA04E43B45863BBA4056FE1B8F8332BA marcelovansteenburg
1,666,302,465 *AF5A000FEEA48D257F81726AC84BE935D3403042 marcoilic
1,666,302,466 *AF54734345B8A3BAFFD366C88CFF5E9C42CD7E9F MARIA.FAHRNEY
1,666,302,467 *AF583AAD0AFD7A46C26500BA8D763D4CD57E0624 MARIANE7
1,666,302,468 *AF5ED5FB9F56F5E19082714A2AFFCAAB119336D3 MARK.MCAMIS
1,666,302,469 *AF5ADF1F701A1E06EAA7576F73BA3C1FAAF18699 [email protected]
1,666,302,470 *AF546A77C0B5E129445D04DB082610E8CB8533B0 MATTHEWBOONEVS.DISCOTEXX
1,666,302,471 *AF552BDCD21F8A06E2DF5F14E5F812FDE5652EC2 may8u5h35
1,666,302,472 *AF5BAED8768BAA6DE0678B5A14E92D00C93640BA MEIER);代表作《
1,666,302,473 *AF5897326C1505DCA47E7F520E33337414992DAD merrillfedak
1,666,302,474 *AF58F61E95E0CECB760B87034365C44ECE0087EC Mesost
1,666,302,475 *AF5C7E7D987FA904E22D3E5028D09F4C60E9071C microchips..m.ay1.k.r.ow2.ch.ih1.p.s
1,666,302,476 *AF587E52CC3AA23C3860898625BFB69D6BD57A9F MIH4IJBV
1,666,302,477 *AF59DF71E26A2BDEA6E0FB89AC035669BA9A1780 PLNOW
1,666,302,478 *AF5866495EC3A3EB5E7B4B2E2C90683DC98296E0 MILTON.LESAGE
1,666,302,479 *AF5EC05A569635869B33384167F533C5B7BEB0AA MILTONTOPICK
1,666,302,480 *AF5B03C2EC38FCE6EE16E99BEF0B5401C67C2FF3 P######)~O;)
1,666,302,481 *AF55FE8DB2AD69D5D583A310344CB8877A047034 politicadesantalucia
1,666,302,482 *AF528293357DD04AC8ED907E0D74D04BF00F3A17 MISSAZHEVSKII
1,666,302,483 *AF5E2E0D9B153C4A52888EC15871EC518D86CB62 MITA DASGUPTA
1,666,302,484 *AF536347C2987989F3C6742AD0395E3F19C5CE3B MITCHEL.BIVONA
1,666,302,485 *AF521FAA0671EA1C2571BF6E63C43A94CAE0268D MITCHKERANEN
1,666,302,486 *AF58B8F020162A913A60E00AE376C0AD10A6C8FD porfiriostaehle
1,666,302,487 *AF599C6371EEC45C84BC849877234FED370E3512 [email protected]
1,666,302,488 *AF5E43404D66B252C04A9F68C5EBC5BE96F2F4EA posamentiermaschinen
1,666,302,489 *AF520226F23592490084641DD05A74C0D374B69C [email protected]
1,666,302,490 *AF52612E3685225CC0E0AD47C23D04A47B425CEF MMAKECHE
1,666,302,491 *AF53FEF1374F7109ACD96EBA64143384B977E469 P=>*-*-:p
1,666,302,492 *AF5E52515CB361B35AD80165045A324F47472D72 PP7N
1,666,302,493 *AF53F272C009DE8EAE9A97BD3028F0B5EF5A7EC0 PP *)X(
1,666,302,494 *AF5591D0BC2A4B111DCBF74A7DB854C582AA7396 /PROC/24/NET/RT6_STATS
1,666,302,495 *AF54D19D2AAECAE4FB83AD5B376B29EE5598E513 MORGANSILVERIA
1,666,302,496 *AF591C69A7E847C3D988CD02B643E73FB3B496CF morpheus
1,666,302,497 *AF5A95DCC23EBF811EAEE5FF3FA584127E2093FF MULKI MOHAMED
1,666,302,498 *AF564CB6DBB2D4CB6956071EA51FF9EFA00169FA puksidaed
1,666,302,499 *AF50038F5EFF5A550FD4A4750206CAA51167ACB9 N0687892018
1,666,302,500 *AF54EB2DCB9F4AE008A6E101D897F7D0A2E75B71 [email protected]
1,666,302,501 *AF52EFFC7564EDC9577C2D3F085F51A5793A4EE9 [email protected]
1,666,302,502 *AF579FAD0EACF2CCBF2CB6C0A4708E30ABA2F7FE [email protected]
1,666,302,503 *AF58A983E0F91BFB907D84977227655E19488FC1 Q#OI
1,666,302,504 *AF5D01D3DB5010816E97493EED27FB4B12823641 q{tn
1,666,302,505 *AF5C4FB0AAD35512F16F9016421781E0B25ACF3F QUINNHELMERT
1,666,302,506 *AF5BE38CA3B63DD412D9CA6DE4DEC354C2A0A417 NCGAUTAMING
1,666,302,507 *AF5A777D42F53488040F256350A30C1D35A027B7 [email protected]
1,666,302,508 *AF574CE481080C66C9E04CF4879BFD72368E14CD needleloom
1,666,302,509 *AF50963AD77375D86E557EEC62D169B49ADFE884 randalrutar
1,666,302,510 *AF5CDDD9D458D711542B4A37920653B96E1F6BD3 randelleastin
1,666,302,511 *AF54C5A856AE023354D9E1247B32ABBC2329E13B RANJEETCHAURASIA
1,666,302,512 *AF52CBCE01D81EA57FC40E4EB3D7551209700824 NEVER-SEEN-LIFE-IN-THE-KOREAN-WAR
1,666,302,513 *AF5C5B99EEF7FC4F5C292BCBCFF3C2DC2278ABA5 NOAH-DIZON
1,666,302,514 *AF5835661D1478C20DE3BBB9D4CA2DF3D19DA90D refee
1,666,302,515 *AF55400F605E41627F9AE618662F33CA96797BB3 NONSTIPULATION9
1,666,302,516 *AF52EC9C297A63D6B40D42B7DD477D712DB83FA0 REPRODUKTIONSMETODING2
1,666,302,517 *AF502D1A9690CF80DBE93EC468AFDE73A84F7C4C RESTORANSKOJ
1,666,302,518 *AF5D067F3B41D183AD7A34790DC325603DDB0465 [email protected]
1,666,302,519 *AF51EBCD7BA4770EEC509E8E4E36FB13E6475054 RICHIE.GIPSON
1,666,302,520 *AF5D1BC278297FF0963AF2BFEFE8F546670391B7 RICKFORDI
1,666,302,521 *AF540DC5EBC85C363C7D2BFB9CEC17DB30224C29 RICKHELM
1,666,302,522 *AF5138AEDBA58F63E83A311EC2F8B75C3B7F1876 Nuevo-A
1,666,302,523 *AF5F9C4DD313D2614BDC5E7700665AACBF635176 risulter
1,666,302,524 *AF5642BA73F0B9F03425596AA2C64AAE0A8A1B7E ROBT.SHAIN
1,666,302,525 *AF56BE6C9792A177648578257263A9F94E84D5D1 .O!AAA
1,666,302,526 *AF5ADC58533CF959350B67539409AE3043F38BF5 rodneyrosati
1,666,302,527 *AF56C29667216F05A6967AF6CB077ED7DDC2BDB6 r{oj
1,666,302,528 *AF531D63884E0BF4083AAB17F65714FFEF043505 OKINAWA~いつまでもこのままで)
1,666,302,529 *AF5F19940532291050257B23651B26BED5246085 on^
1,666,302,530 *AF500A833E6625CAE3F706F08A5E54EAA356E82F [email protected]
1,666,302,531 *AF505A86F6B8B679296F6AE4B59DE9124F3FD015 onom4topo3ss
1,666,302,532 *AF5EE1E7B7F9E72D407EBA96D6AEFF21D0AFF6D2 }o{.o~.0~.q-----B
1,666,302,533 *AF5DD755F5691E2BBE58E59F0CE5049A02FB7496 >< o~o~q======p
1,666,302,534 *AF55D32EB67EC2098C39E5F92A2CAC41CA1BBFE2 OPPOSERNING
1,666,302,535 *AF5526844101CCE2206C05C99EFDAAEA6F01589D orenlizarraga
1,666,302,536 *AF5D49196FEAC64790A507F5082B0162206B90AF OSWIPU
1,666,302,537 *AF54EF38C0F9661E1F85A42736D47DA4FFD02774 otisroyster
1,666,302,538 *AF548F0FE824E1ADA13FC6A38E45A9CE05427D7A S0C!AL!73S
1,666,302,539 *AF5DDF8837935EFFE559F65BAEBF077BB663FC3D samao.(jerome's.ibadan.deep.house.mix)
1,666,302,540 *AF5DC22B07CD2FB20FA7B690A099F752F3315662 santogolackson
1,666,302,541 *AF569C846CFBDCA43FEDFDF0AB74AA96BC65F44A PARVEEN-RAWAT
1,666,302,542 *AF56E8BB441AE56620FA0D74CB8126FE070192EB sarah-abdelmalak
1,666,302,543 *AF55D47965C2F2D716F89199A5F75B6ECA884043 pavelicevi.1
1,666,302,544 *AF5C49163B3C0BD4C4827FC91D7C0CFEAB42365C SCHRAGIS4
1,666,302,545 *AF5FAE6B48679E3D400975766E83AB934063139E [email protected]
1,666,302,546 *AF5E9F7E0D2336D8E1642281B38DC6B15E2EB6C1 SEANFLOYD1
1,666,302,547 *AF503DF326C1590EEE599474ACFFDBEFB041401B SEDNLEPS7
1,666,302,548 *AF508D2D238A05B0E9CF115061CA1900CA2081F4 PETE4ME2
1,666,302,549 *AF5DD1E36530CC92B656DEE2D1AC62AB98A768BB sehsoohwed
1,666,302,550 *AF568427B0AFA222E70886E30026E29560227637 pharmacomania!
1,666,302,551 *AF58F1172D4DE526DF36F1CCAEB1B79D4F318C23 PL3N71FULN355
1,666,302,552 *AF556CE50340948DAF83798720075D60DA93BF1E PLOVILIMA
1,666,302,553 *AF5A6B32074080DDBB2132F8C51405EEDEB9FE6A SHERRYBAILEY6
1,666,302,554 *AF5C1E0E6DBF10D7E5FAC09723C3F8F1E26A6B80 PP379-86
1,666,302,555 *AF5AEFC53904F3F760E0012B740805C985E70F21 p-p~ ~)o(
1,666,302,556 *AF5A3D2E0C1B0E9EEFC50D0A121EBAD153F75EC6 ptry112834
1,666,302,557 *AF59F5EDBAA47121F28F958F0A22488383DB46ED [email protected]
1,666,302,558 *AF5A8527051EE4D86B38D9FFD96731339324ABD6 q====p.*.*.*.~0~oSplat!!
1,666,302,559 *AF5239EE978F84A542B55398056999C2F35C83C9 SINGLEELIMINATION8
1,666,302,560 *AF5D96D6611814B28E2A54441EA5DA20B72B9D6B qubitcode
1,666,302,561 *AF5863C992E72C4613BAD01FDE5A0CB631F8F62E SITESOWNERS
1,666,302,562 *AF58A27BCD9D7EC3DC603A70C0BEB997C70827D2 sixservants
1,666,302,563 *AF58A7CD87F5DA56C89761F0272FBAB132E8F054 Q======>-*{X}
1,666,302,564 *AF57777BA3BA43936DE4088EA00CF9DF91167A1F slachting5
1,666,302,565 *AF527B4E0F1671CA6FC08E5AFE5691BF61D357CF SMAGNART0
1,666,302,566 *AF55566911BC913FC2E45726FE65DD046D2509B4 SNEESUAL3
1,666,302,567 *AF5D7011434CA8ADAB66A44B0E4A7D5CC56C8591 RAMESHCHENNITHALA
1,666,302,568 *AF5E89353D937EE2C879FFE6B3E9A322FEA608BF RAMIRO.PATRAS
1,666,302,569 *AF5E7450C652B614C0FBEA2B2F3949966CF291FF snkl
1,666,302,570 *AF523CACBC9095C45C413FC5C68CEA0DF273DE27 [email protected]
1,666,302,571 *AF5178CA0736F04334B38E53BB09009243517EF9 sodsumreport
1,666,302,572 *AF5C49690D779F5AE882C07791980B59C5641760 RAYFORD.NUCCIO
1,666,302,573 *AF5EB12E34252B0EC42744DB062476367D365AE8 soreicnega
1,666,302,574 *AF541751B61FE4841E4809CA878FA6621144D9F8 REIHTREB3
1,666,302,575 *AF54C9FDC5382C9952A94467E242EC063E773926 spencerhysong
1,666,302,576 *AF51D25DA99EBF37FC9F41A4D734954D33573712 SPENCER.SLATER
1,666,302,577 *AF544D55C8F5E62D14F718B286E68C71272D7269 sportation
1,666,302,578 *AF5972873BD2716D1BD599C3F94FB5006E40E930 sprunginstruktion
1,666,302,579 *AF5CA4CD0708F9C1AB41A8E1D0664553B220A771 RENETE
1,666,302,580 *AF5D824574F8FF2A352DE001B5E219DF82650B91 REPARTIETR
1,666,302,581 *AF5BFF67823C77C2A8C21264077B33133A61EDDE representarem
1,666,302,582 *AF5F9EF8002679405970280BBC0E81A075947AC7 STANLEYKLASS
1,666,302,583 *AF5F04F1D0EF36DB59A472DDD6E52C249294C3AC rglement
1,666,302,584 *AF5DE4DC1CBABD11B83D912091AAE149C59EF1B5 [email protected]
1,666,302,585 *AF5FA007896380EC6F642C48CBA637E4BE37C923 RICO.MELLADO
1,666,302,586 *AF55DFDCD2178A1A17FCE7F0F04A954270187517 STILLINGIA1
1,666,302,587 *AF56A709491FD124356F41799914C8F299EEEEF6 STOPANDTHINKITOVER
1,666,302,588 *AF51929F314F9061162947BB6B7FA2B8DA42807B STRATSPARROW9
1,666,302,589 *AF541902424222FA445B93A6F3AE043DFC94AED5 RKTEKT
1,666,302,590 *AF59FA4D5ED28326E8E6F57CA303683A58703221 RNY5
1,666,302,591 *AF5AC6B0FA6238C0D01966DB065E7D21B916558B ROBIN.AREL
1,666,302,592 *AF5E98AD02D781134F632D27817EE97B31F619A3 ROBINTAZMAN3
1,666,302,593 *AF5CA22195F44EC1A9B6DC7330C9095E15308B35 sue.harte
1,666,302,594 *AF579357DA0FBF7D2FAF6DF2F1A9A2DFC232A3A3 summeryonseiackrsummer
1,666,302,595 *AF5A031ED90746E8015BE77632DCADF3C42DFDCF [email protected]
1,666,302,596 *AF5F96E473A1C5835EE75C00174657BFB640371F rolfscore
1,666,302,597 *AF5D776DED85EFEA606AC3BBE90FB3391AA12820 [email protected]
1,666,302,598 *AF5755C72F57E2513F0320D1C62995A0D3C7548F SURFERPANDORA
1,666,302,599 *AF5945F8E5B630A62289AF8A86E4B7179882C0F2 Sutherland-Falls
1,666,302,600 *AF5552FB8DC0FA0F94EF2175F7AAA08BC1AC9653 rorydouthart
1,666,302,601 *AF55289A3938A723774ED1E5574AB796B6EE6EB9 roryouellete
1,666,302,602 *AF5C2B37E487942B06C9C92572258FCD19FF6755 roscoepianka
1,666,302,603 *AF5B379C3C31F45BC94B91AF8D6CA7B1261601B3 ROSELEAH6
1,666,302,604 *AF528108398A278B614AE24D5B421E33C303B7FA SymphonyNo.5inBFlatMajor-Menuetto(Allegromolto)
1,666,302,605 *AF537E3CB250B32D904110389119615176E55C2F RUNETTEBSW5
1,666,302,606 *AF5A07A636ED0FE19F7EBF75866A6C3B33726294 T?1Z
1,666,302,607 *AF5B90A0EFF0D35AC3C63F85ABD582D6BB12B5E8 TALLMASTER
1,666,302,608 *AF550609F7EE7A3C25C847ED1E2F7E2165CD1562 SALVATORE.MCILWAIN
1,666,302,609 *AF564D27FA9E4BB5DE7EF108A72DC9F373E1E58D TASNEEMKALOLWALA
1,666,302,610 *AF59A0086116DBBA3912C93E13426889D138B045 SAMUALHARTWELL
1,666,302,611 *AF5B2E4141FAC515C519F9BDBE519823E07D8D2B samuel.larocque
1,666,302,612 *AF54FD97D3453C6F11C2CD7C746F37840E9C5511 TECH-SMITHY
1,666,302,613 *AF5B5BC44DF8B7A9598EB609E9BD7FC3F0855D2E SAULDULA
1,666,302,614 *AF521DCC1BDD9870628157BC8CDD79C9E3484ABA -;TG&31;TL&-BD
1,666,302,615 *AF5E21E55A02E026A2C95CB47ECC53D1BE37032C Thank-God-for-Southby-/-In-the-Graveyard-&-End-Titles
1,666,302,616 *AF52B3132942C0BE66344C1AAE32664E7BE56047 SEANECHEVERRI
1,666,302,617 *AF515AC1A7D85E4E7D34FF888A38D13A5B2617AE SEDATKAED
1,666,302,618 *AF51AECC5155BF261EA6C1FF0C7473D34624838C SEIREWOD2
1,666,302,619 *AF5237AFCE50F197809067193D370EA6D02A38C5 SELLABLE
1,666,302,620 *AF566AF595BC466D728B5FB5063929C108D28D9E SHAMROCKS2
1,666,302,621 *AF57D98CC2161C2BE00ABBE50DE01400F684DAC9 TIDLEY!
1,666,302,622 *AF591A51F04ED9C43375357C8B74E5E1FA4B9250 shelleybeanie
1,666,302,623 *AF5CB8EF04BAF6B698D6963BC5715BE4680AB986 shhhabam
1,666,302,624 *AF5FC5222554212DE7C48065CF4F97918A0F1333 TMASHORI
1,666,302,625 *AF52A67A0ED09207666995594E29FA1B3584EEFF SIDKOELEWYN
1,666,302,626 *AF5DCD717C1F114FD1ADFF1765573379A333E1B1 SID.TENNIS
1,666,302,627 *AF5B90E72078A601E7B42D8F60B1278E2920EEA4 silastic7
1,666,302,628 *AF5437DC1306526E57C50E39DA75E578E02D4C5B TO.DO.THAT.THING.THAT.ENDS.ALL.OTHER.DEEDS;
1,666,302,629 *AF5DE55796F7AAC3B72E4CD73BD83883B74222EC SIMPLECHICKEN3
1,666,302,630 *AF55236C0F23DE705DB7235478F706DAC2DBF39A [email protected]
1,666,302,631 *AF5702CBED4DB4AF9F17DDC0A94CFF7FBE20EE68 sinestro-corps-war-is-what-world-war-hulk-should-be
1,666,302,632 *AF5632F2885A136A94CEE2AEF33D1F0664A2743F [email protected]
1,666,302,633 *AF50642B22EB067C01D9E6FE4CF3AA0636CCD2C6 TOPBENZBBS
1,666,302,634 *AF5C3FBBA484E831FDF5F5017B37874F0720DB4D torskerognens
1,666,302,635 *AF517A9C4D125438B6AE36DC2A9667D2D60F0DA9 SJIRGLAA2
1,666,302,636 *AF50A5E1AF5412CD2B0E097BBC041BD959EC5FD0 skarvall
1,666,302,637 *AF577146569F9D38C342BB44715F462D6DFC9E01 SKENDER BO
1,666,302,638 *AF52624FC1FDD141F49021EC25563A9954471F4F skotmarkseyja
1,666,302,639 *AF536A90343F70C9DBCC1BCCF1EE9DDE7B7C04DF TRAVIS.BLISSETT
1,666,302,640 *AF5BCB8EAD2F97836F0ED7F2EBC04C4A1E080C09 SLAIRTSUDNI
1,666,302,641 *AF5ECA9F11E6C1AEA2D908A1348C1612562B7CE3 TRIENA VERONE CALDERON DIONES
1,666,302,642 *AF5F253436B6CD360BCF0266294732602449657B tristanwendt
1,666,302,643 *AF5D615319C6153D6644B4E2ECE5E6DC61A93311 tsapanidis.john
1,666,302,644 *AF524DD6F27BD74B4A2C9042AD728723E86C34A8 ttibsenetep
1,666,302,645 *AF5CB8C051FECE052388D6B47535D247DBBE1122 snoleged7
1,666,302,646 *AF52999684E5E7B58A5DD494DD98E983CEE3F5B2 TULLILIITOSSA2
1,666,302,647 *AF51C68D37E2CFC44C4627FD9AD1E7C38A83889C tultewitz
1,666,302,648 *AF542BF028E1D43BD7F44F0DD7FF46A112F98D79 tyonnagottaluvmebrown
1,666,302,649 *AF50EDA8121AEB4890B3006EF1AB66AF366580C1 [email protected]
1,666,302,650 *AF586402A06547F3E04F3A621BBEF15B3CE33F0C UB-AA
1,666,302,651 *AF50202DBB45624D479A9641C38D12A21BC834CE ulfus7
1,666,302,652 *AF5F23CB426A5605CB6AC8E9657DD1EB17B98CBE SPUBLISHING
1,666,302,653 *AF5687066AB48FB98D738A2EBEA5ADFC2F09E938 SREILATING
1,666,302,654 *AF517A95F0FDDDD4FCE1F9B89943055707DAFEE6 SRELAHNEVALS2
1,666,302,655 *AF55932013A3DCCEAB194211CBB626A4E555F975 UNILLUMINATED1
1,666,302,656 *AF58C0602355083CE4D3FEC5EAC96CFD9D165C94 STBRINA3
1,666,302,657 *AF51FFF834D7CA8AB35BF4E6B35BB451ACEEE2B0 STEP-TO-THE-LIGHT
1,666,302,658 *AF572F3CB2803C5F93C74D874E72D23BE040E22A untenaciously
1,666,302,659 *AF5AA1BB977EE5502CB00AB2D1CA9C6D9A694FEF STIMULÁLNI
1,666,302,660 *AF5E56E7DB9AF76ED952385561EBE3292F736F59 STORY22273
1,666,302,661 *AF5692F91394E3A2CA4C5454B4F528412F866107 USERBLACKWORM
1,666,302,662 *AF5A012A7E2F227058A2968E3E5A27D911D4EE1F [email protected]
1,666,302,663 *AF52E50612C52E776CE6B5E717D336EBA0879644 [email protected]
1,666,302,664 *AF5C095EE1919651EBC1C4403BF0F897D4D29B34 UTBRIDGE1
1,666,302,665 *AF56820786643853F34DEE14926353651A620DC2 SUGARTOP(STADIUMMIX)
1,666,302,666 *AF53BB9B55C8D6672036742032FD7B629F786419 SÜMERLILERE
1,666,302,667 *AF5C67C4EB8653339C18BA30F1BC643DB0D27A60 V4545F0R3V3R
1,666,302,668 *AF56422A7D682B046B6C8D5126A3473895465F7F SUOHPROMOGYZ3
1,666,302,669 *AF51B599A5BF22FCC6BF9B467E4B83FFD0136554 VAAGMARS6
1,666,302,670 *AF5FBC8EDBD89D55E2E0A7CEDF7B20CD96E4AED1 SURRECTION-DU-CHRIST-(FEAT.-ORGAN:-OLIVIER-LATRY)
1,666,302,671 *AF599DFB34216CAE45C4508217718A638DC7962B symphonyno3inbflatmajor"tomyfatherland":iiinthecountry
1,666,302,672 *AF545C2B36A4B45BBCBECCACF8F04C33601B7353 valerieguido
1,666,302,673 *AF51018A0A6A82156BA790AAB7B2101A973B3559 system4426
1,666,302,674 *AF5B8AD8C30069C5AEF0D4A6961BDFD89EF23911 syvertson's
1,666,302,675 *AF5C7F76187ADE062EE6845C400F3C103FF1D5A7 TAASUBAAT
1,666,302,676 *AF541641F24E5F79CF231E40B522E1E900BAFE5C VAUTRER7
1,666,302,677 *AF53BA4E0151F4BF68E2F5D0AA5C7E2F387F4E3D tambouras2
1,666,302,678 *AF541CFE770D4A8A58A6CF0006CF5CC8FD736121 VICKIEMARTINHOSKINS
1,666,302,679 *AF5AD4289109FC1435CB670E502F1C7439D49C87 VICKILEANDRA
1,666,302,680 *AF5E22928D3F640A07B632A9C2396FF86E9DAE1D VICTOR.CREAR
1,666,302,681 *AF57F51377A63A784B2C9EA7422AEE110F1C237E TAYLOR.OH
1,666,302,682 *AF50AE00CBC766E06B49673C1CF81341670B9058 victormanuelmart
1,666,302,683 *AF54773A62D7CB2A48DCE829D50B93F538CCE21F VIDAR.FABIAN
1,666,302,684 *AF5A1CC6A315B6D3769F0C5EAF244DE6C8C983DC TDSRVND1
1,666,302,685 *AF5829AF339C0B77F91EE82EB8DBC637514A09CA VIJAYHOTY
1,666,302,686 *AF58C40FD3DF0115908586EE4B8A7623FC936D00 VILLISILMÄISELLÄ
1,666,302,687 *AF55917CC7BDB6DF51A4117753D373DF79150D49 terrierl5
1,666,302,688 *AF5C71F0347DC4ABD7877A372919122164DC0C79 TEWNEOISNEP2
1,666,302,689 *AF54886256700FD12AF56BF92E28EEE32044E63B vlabiti
1,666,302,690 *AF50FDC3D2598674B7A719D78EE0E03F4E5C0452 thecallingblaze
1,666,302,691 *AF50CA970BDD9A55BFB1516742A6B71781A41FAD THE.FAIRY.QUEEN,.ACT.II,.NOW.JOIN.YOUR.WARBLING.VOICES.ALL
1,666,302,692 *AF593945C165D8866946DF4C273FD29B5F131F15 vrmk
1,666,302,693 *AF5525990BBD4725A31EEEDD169DF43B0D264567 THE.WAY.OF.LIFE
1,666,302,694 *AF5CB3486EAA92E14AF53AFE948146C2DD79C7A7 THROUGHSABERSHARPENERSILVERSILVER6
1,666,302,695 *AF54EDA84824E00E6DCC5BC7667E908C4DB6E326 THURMAN.BRATTON
1,666,302,696 *AF5BB5405F9AA7770F84D86989494C0D59487273 THZ9NA
1,666,302,697 *AF582515D631D8067E3F9C21E60A481FE6D86875 TICO.TICO.NO.FUBA
1,666,302,698 *AF51909D51564B14F1E37B510AA0C6C135D7549D TITIVE7
1,666,302,699 *AF5C9FEF912E9B232FEFD390F71F158D469CDB10 TIWEO
1,666,302,700 *AF5027D66BF60F0604AFAB4D97068EC1626184D6 tlvlbup19
1,666,302,701 *AF57EB5E9CCFE61B67A0EBE48E875A577724847B toegekekene0
1,666,302,702 *AF59420C92A7CF3E24A5860FC5C0F20AD1D88CD6 torontoimpala
1,666,302,703 *AF5F05A784846CDFA54C372A3CF3341198CDA37E [email protected]
1,666,302,704 *AF510C000263B07FE98CF103800D378A30C7D2AC Wanpan-Bannidaeng
1,666,302,705 *AF5C28DEDA4E2D4E687F92777128754613DE088C [email protected]
1,666,302,706 *AF541EEA2825096FE06BB94AA6693721DA0FE459 WARDPRIBISH
1,666,302,707 *AF5C5F1E6C9411AD513B0024598DBF4FAF4B840D warnerfegette
1,666,302,708 *AF527345DC7465DDC96ED4AD4D597517BCD171B6 TOSTICKLESTRIFESTRIVE6
1,666,302,709 *AF5CE7FF77CD156867323516BEEF930E41321D01 totsumen9
1,666,302,710 *AF5DBE8D456CF5A44506E9884C61EF543EAD79F3 TRAYTONZ
1,666,302,711 *AF5A9446C17B61527750D44A4CBC7F5F7EA79B99 TRCSKTCH
1,666,302,712 *AF523DD4C9C2635A806439A2F24C8A20C3BE9BFB TREMAYNEDAVIS
1,666,302,713 *AF5088A4B148552E110FCB51A39980E2C2B13941 TREMONDDOTSON
1,666,302,714 *AF59008F1C26D3CAC8BA91034E6EDA0BA77A8C18 wendylyn.empang
1,666,302,715 *AF5F6250E06AA3564ECD509D373E9D026841BB5D TRICHELLEANDERSON
1,666,302,716 *AF5811D8C338B9E23DA356C067072695198668F1 TROWWOLLIW2
1,666,302,717 *AF5F071DCABA5280ABF9687ADFF721C01EBA15F1 whenwebreakup
1,666,302,718 *AF59B8CF0D09B408868BC97AD12E46C9EC747FCF WILBERTTHEALL
1,666,302,719 *AF52DA8BF1653FE08650144301991CC5FBF36E6C wilfordyackel
1,666,302,720 *AF5DE5752620A539753C766966FAB686C3AC2BAE WILL-HASTING
1,666,302,721 *AF58CE5664EF84D557F1C12AAED809C1F889AE8D william-harefa
1,666,302,722 *AF5002B52B751F2518D823C020927B85997EAD8E william-munyon
1,666,302,723 *AF5F9E7A8371DE961AD7539F6E23C23D441BE8EF WILLYSTANO
1,666,302,724 *AF537D446819CDD741B9D433AB883B1F2E3B89AB WINSTONCAIRONE
1,666,302,725 *AF5CB0D450566AD84098F4DCA30FEC977838B28E WINSTON.MESTEMACHER
1,666,302,726 *AF51D47D07A95BB801B2ED0DEC6FA28BCC9EDA1B WM.TABISOLA
1,666,302,727 *AF52688452906A50DCE1C45AFDC4C6D01F77EF42 tyhoblitt
1,666,302,728 *AF5A313E0C820A095AF17B316E53D3443A5F1DCD TYOEKIELEKSI9
1,666,302,729 *AF5FC2B7EA715ACDCF051BD712C275E085049F28 W.SVG48PX
1,666,302,730 *AF571C58E3B42D530C49F91291154CE04D058BA0 TYRONE.RALLIS
1,666,302,731 *AF582BDECB0D294545244F6C949E26332316494E TZEVETTET
1,666,302,732 *AF5A007327CD66FA1B5298E945F799852CE94E3D UIM*
1,666,302,733 *AF5B80B380227668BC85B0BD645C0E577DD0F355 ULULOBLIB
1,666,302,734 *AF5DA813B53F48ED851246F57507CEC0CACF6BC2 WWWUTAHSPASMODICORG
1,666,302,735 *AF51BA57C93238CE766FA1CD09F952EEBD6899B5 WYKRZYKANIA
1,666,302,736 *AF588B6803E0BCBDAD98554441A2930A6EC1CD58 undergroundstreetr
1,666,302,737 *AF5033BE96A5783E114C909AC46FEFFE2E82F24A XANDER-CHINOZ
1,666,302,738 *AF563E3B2EA1CA230493F43449CFA86EC2530F51 (X) ~ ~<##B
1,666,302,739 *AF5B4956CF12FBE284452E6E93090355FD4D7AEC xerically
1,666,302,740 *AF5D26D3E328BBFF1007403E129BAEA303C36352 unterirdische-diskussionskultur
1,666,302,741 *AF586BDB416ADE161D85D62A6A31D1329870E1F8 UPROARINESSING
1,666,302,742 *AF58FDE1A536D30EFBF293A9DF483A6F82EB3AE0 }X{ ~` ~` @====P
1,666,302,743 *AF52572FF95A6CB02A9E083B3AAFB38143A0D6AD !XSJADO!
1,666,302,744 *AF516794E2DC013576FC93223A52812463BB3FE9 USERIANKINGMONOBOOK
1,666,302,745 *AF59F056F48DC300AD70F940D2B57848609B9DD9 USERLUISINAVARRO
1,666,302,746 *AF50B33E423AF46A7CBE5A36F83AF0E77F0241AA [email protected]
1,666,302,747 *AF5F8CA6D35A80D2DEBB6A46D641D618E33AAC05 yacanell8
1,666,302,748 *AF564DAB005935F073471BD201AEBA4575238C56 YAN SAGSAGO
1,666,302,749 *AF51BFD622B81BAC395797C5604221F6C2A1334A uusiks
1,666,302,750 *AF50D64B3304FF636ED7B856B91BB68C154BDEAA [email protected]
1,666,302,751 *AF5FCCD78A7D331CCDBA82C1A586829E6C0D60AA YEOJUNJIE
1,666,302,752 *AF5E61B2BB11071C64F8607F6332BC4646B8B8A6 VANESSASCHRAEGLE
1,666,302,753 *AF58F3B51CB341F89EE916CD582A7487118159C2 VANOCTAVIA
1,666,302,754 *AF58ECB57377DACCE1C1415B9E409974D9B03533 VARNINGSBLAFFA
1,666,302,755 *AF5D4928CEA7667F48DC0AA458CA65BECD01CD30 YORGANIZING
1,666,302,756 *AF5CF6129AFBEC6B7677780AB8111219CFABF385 youbuildmeuptotearmedown
1,666,302,757 *AF5DF197C88F5CE40E768DDE42258557FFB73C52 YURIYANG
1,666,302,758 *AF59A6AD6C5378F70797BB88B6420F35B0857234 vh4u
1,666,302,759 *AF5262CFDD4C960CE2A5B9158AB57441A1EADE69 victoria-lindgren
1,666,302,760 *AF50AEA629B47870D0777455B0027AFB1BCC5E73 victoriaprofir
1,666,302,761 *AF5E64FD7E04B416EBCED5CF5F64DF6EDFC59F00 zaneaffolter
1,666,302,762 *AF5AF67811C363CF3CB217CA097165619C829227 zara.flamingolandsfinest.corwell
1,666,302,763 *AF52D97C640895A338EAB7882D5B1CA8CB7F7B18 zedd.cuzz.t.tonna
1,666,302,764 *AF5AFBE63FB67B4229E4B4E20AD7D0EBD8D62BC8 ZENITHALMAXIMIZED
1,666,302,765 *AF569791809DEE8B694E732C83CC3E3622E53227 ZENNODERFED
1,666,302,766 *AF5C640E428F69FAA9A8FB0DBF4A20D8252727A0 [email protected]
1,666,302,767 *AF50BE1B72B74B36E0121BC9ECC15C99E3F7FA47 vivynmj
1,666,302,768 *AF5249BBF8F2842EC87DCEF70EEFA90CE8A8AA94 [email protected]
1,666,302,769 *AF5646B4290D0FB26B0851A63D61CF16609783A2 VONNY.SO.DANDY
1,666,302,770 *AF552E756CA0366733C65E1EE61E6BBE4F8DA484 VOORGELOGENES2
1,666,302,771 *AF53EB97A098C555BEB88DE8AAAF1DF2E70C0043 VRBNDNGSKBL0
1,666,302,772 *AF5CB22BD9677DEDD47D82418C60E840D2AA91E7 V{RIMAAILMA
1,666,302,773 *AF524DCDCC996C56FC95040589B0FB17EC5D4B8D VUNTĂHHĂR
1,666,302,774 *AF5C76E434128AE6DA4EFE66BAA4E8352C239B09 zrsy
1,666,302,775 *AF5A8570F42ECC369DD46401FC65ED9FBCF5E2EA WAACTIVE
1,666,302,776 *AF579B4BE381F97855FCEC4038C9F42B99D486B8 ZXCVBSANDERS4
1,666,302,777 *AF54CAA89967084679F3449B037F5AE89AD9BBEB WALTZ NO 7 IN C SHARP MINOR OP 642
1,666,302,778 *AF521156B0FB023B59599E331345B5D1EC249C3D WAYLONVANDERMAY
1,666,302,779 *AF5D72209B11AF78F5A34B1767F27F0C5668BBF1 WAYNENYCUM
1,666,302,780 *AF57B5D4D1EB691A203033A02EFFEB7771BDF549 WAYSEDOLLAR
1,666,302,781 *AF5E00F771973734611CBC8312236B5F58E9C7BA АЛЛАНШ
1,666,302,782 *AF54342A19BDC73E6980936BF51F01CE17B46ACC аминату
1,666,302,783 *AF503AB9F0D9AFD1D6DABD6C3349316450804006 ГІПОТРО
1,666,302,784 *AF5D522718BAD9C39DD755BD3AFC7DF90B1C8E27 дорошки
1,666,302,785 *AF511B2E4B6DEECE8700526379902BE4E9976126 [email protected]
1,666,302,786 *AF5892AA3288678DF8BFB44BF4E89034D523DB58 [email protected]
1,666,302,787 *AF5230F395968501B720604A666D9AD0F6A6B8FB wernerhonig
1,666,302,788 *AF5A63EB720190D5A528FDC86F96CA619758109F КОСТЯНЫ
1,666,302,789 *AF5664252F0C90593D985823E1B7E8DD61AEABB5 WILBURN.DELDUCA
1,666,302,790 *AF5B6D261234C1644A71F5A6582F4713CB0FE270 wildernessman
1,666,302,791 *AF5C86BF204BAACB1E0A510A29A65E78BF6A6128 СТИСКУВАЛЬНИЙ
1,666,302,792 *AF538928D26F5CFFF52DD7C0275170EAC4D33FC2 winnieomar.nuesa
1,666,302,793 *AF5F9B62BB68CED528E00B530497B4A431035A3C あーら不思議/it
1,666,302,794 *AF56F1F4192FA3C3A41B304E59285514387150D2 WOUNDUPDEPARTMENTSTORE
1,666,302,795 *AF5EF1E8933B8C573A21E10F8FF44DE8ADA36977 [email protected]
1,666,302,796 *AF5E02F211CF37D31983A74C83068464D457C101 xanadunet
1,666,302,797 *AF55F217074A758AB3F04D4299EE043C735766FC xelferimes
1,666,302,798 *AF5BB2052AD5FE3D597DC77116A0A421363ED42B XMAFIAASHAYAA
1,666,302,799 *AF57FDC73F2C9EE26911EB622EF71AEA3138D01E XML-COPY-EDITOR.SOURCEFORGE.NET
1,666,302,800 *AF54FD8282E2A1EAF7CAE39C8787A23EED9E566F {X}O~0~Q==8
1,666,302,801 *AF59378CF3B52D934E647F93E9310653192483F4 yashotha-ariacuddy
1,666,302,802 *AF593ACA6A08D32FA4D2B5B35ECF20FD71B9A1D5 YDELISES.LLUBERES
1,666,302,803 *AF57BA74E928F0011B0228531FC16C45BC66E279 YEMISI ALATISE AKINFOLARIN
1,666,302,804 *AF5826BA224418C262B5C3D71EE91F81F598FE6E YESS WIN
1,666,302,805 *AF5B78343B15002C200FF9C1FB0E09B0BC0BA3C0 [email protected]
1,666,302,806 *AF5D0649DEE3176B374FAD2873C4D69C8388F67F [email protected]
1,666,302,807 *AF58916D7EE50846313664DF515279ADAFC8A856 [email protected]
1,666,302,808 *AF5438856F53B0B874BB0DDCFAEEDF2700240F64 YONKERSGIRL
1,666,302,809 *AF521799E39544EFC3849440D812E2FDB54F8710 ysabelcortes
1,666,302,810 *AF5D38607BD24394F287205D8A0B154059613D88 YUDH NUGRH
1,666,302,811 *AF5755BF848858EC511295032C9532AB03956A52 z1kf
1,666,302,812 *AF5BBA56216957CC1E37C5C94F915B3DED45B915 注釈のサポート(予定)。PDFドキュメントに保存された注釈を扱うことが出来る。
1,666,302,813 *AF5DD9663B898D382C09A3B0E220AB4D6B47B2C5 シネ)用35MM規格だったことに由来する。レンズマウントはエクサクタマウント。
1,666,302,814 *AF58B73097F5E6CB76E31F956CBFA56FE42DB246 に発生した台風。アジア名は「DANAS(ダナス)」。
1,666,302,815 *AF5893E2BD0308636E79B9F51D57440A72DDE550 01281251
1,666,302,816 *AF5E0D99C2E99B1EEA7C4A9976C25D6B497496D6 ZOEGELIN
1,666,302,817 *AF530F84B754D1E6FA06705835CA5CB5743AE6B0 [email protected]
1,666,302,818 *AF5D9B8B1D850BFED361D5542AF55FD859D32371 [email protected]
1,666,302,819 *AF52C5489B200366C4635830CDBC122990F79CAE zpmn
1,666,302,820 *AF58B954110C75DABA7A797987024DE77CAF45C0 ВЕРГЕЯ
1,666,302,821 *AF5A91E041E2FC6F161CD9FB683968F2DFD96E49 ДІНОЛІФТЕР
1,666,302,822 *AF50AD435C7EE6D85D51918D27B82645A5B66486 ЗДІЙМАЛИ
1,666,302,823 *AF5266AB3779463B9C11604CF5FC7273E4E5FB2B 1138024 edwardsstammtauseinemsuedstaat
1,666,302,824 *AF508EB79517A1C91B64E5AB6C735BF08793CE34 РАМПЕЛСТИЛСКИНОМ
1,666,302,825 *AF558DBAE0DE6D3021B3C55F93FE0107EAA94A99 14.boreal
1,666,302,826 *AF562917D766DB653EA392F95D031EF7002D69BB 14.SEITSEM
1,666,302,827 *AF50DF3A078807312F60E3726D8B27158326DAE5 19.yamato
1,666,302,828 *AF54914E04338D7C1E946027C3F5A366FAD4B56B 1BUSINESSPASSILLA
1,666,302,829 *AF517DB88C2150575AA0CA58B9E8BBBE98CF33C1 力や体力がそこそこある。GB版では大幅に強化され、りき・さおとめを休ませたい時に出しやすい。
1,666,302,830 *AF55FD342E782E46334CEF13201A71DC542F6E46 1GROFBRODE
1,666,302,831 *AF56918011A84C17E451B288C63E3995AE57A8B6 1HADZIS
1,666,302,832 *AF5BB6C62E6EC1F2DD71A461B49B672475A4F2C5 1.hi-yea
1,666,302,833 *AF571DFA61B3BA9EE2AADB71AFF3B535F921FB56 1JENKEISS
1,666,302,834 *AF5A422EB837AA07743E309C9DD75C03C06876B7 1mustavalkokopiokoneilla
1,666,302,835 *AF5B37C5226A4C57FC3C6C2E850D9991A8616A18 1MYTAMARA4
1,666,302,836 *AF56CD03A7A4164A1016D804039E8BD1C73EED17 1.SCHMIEROELANBIETER
1,666,302,837 *AF5FA88DDF35AC18D4D0C9F397C92D9A53902B97 1-tietoliikennekonsultti
1,666,302,838 *AF50B1E32B1AA69A8EDA3C8223FBD997C2F1D2D8 1tykyliikuntatunnista
1,666,302,839 *AF56969443F6B5E87D08EC955C9985A309C3D8C4 1USAETEL
1,666,302,840 *AF5BFFD48DD1C3DD5A7ABD8D168244C0A6D1FFF8 1 VITALICIO-FAHRER
1,666,302,841 *AF54ED753F2C0F0EE4DA2BAD3ED409F8EA51B0DA 2062944 ".wir.rechnen.nun.mit.leicht.niedrigeren.exit-kosten..."
1,666,302,842 *AF5B23EE7294209533BE3E1B22A076946B4CC590 20MOQUEGUA
1,666,302,843 *AF5C54029866D5EF7AD8E8FD6A39A4E03D8BB4C9 2195715 yhti
1,666,302,844 *AF5C403685C4A60838E49082EC5802592846B042 21-LUONNONVOIMIEN
1,666,302,845 *AF529A1B2C6EBAB91BDA19D774B5994BBD5BA1FD 2391373 SUOMALAISET-KANSANSADUT-.-6-.-PILASADUT-JA-KASKUT-.
1,666,302,846 *AF5F4583F8561425FF000ED879DCFB62F809AE64 2477114 ne.-in-loppuiset.nimet.,.joissa.in.edustaa.pidemp
1,666,302,847 *AF51F9B82DEB3089C5E6781E8820FE4618B1B02C 锡拉库萨(fonte
1,666,302,848 *AF5B48BB32CC9A3D81583282D2769662BF5FEC38 2666950 MINNA-HEAT-LAUKKASI-TOISEEN-KAARTEESEEN-
1,666,302,849 *AF598897B1E1AA5002EBF1FE0851938511BFBFD1 2CHEREYLE
1,666,302,850 *AF52B0B1A3F89E5009B68EC317D89E98CB5FC777 2.dolby-surround-anlage
1,666,302,851 *AF526898C7C027F2D749F5B02FCBEA78385C1E51 2 henkens
1,666,302,852 *AF5C8E28763899360873183C1A05FF663F5D8D88 [email protected]$
1,666,302,853 *AF53E70DFD03A2C3C7735BEC94547E73FA07F149 1014438 ".ich.werde.das.ersuchen.pruefen.".,.sagte.niemann..
1,666,302,854 *AF548DA63B3F94B9FD5B6991D8CF6D665AF065CB 105cr1682
1,666,302,855 *AF593E21A40C15CDB757FC89301341F4E27002FA 2TRIGLYPHS
1,666,302,856 *AF5EDBADFC4A2B2DD052B7C0B99995E22C85C5BB 3----->-~-~-(>_<)
1,666,302,857 *AF57912AD5B023651853B788F76037028A51154E 10FEB1299
1,666,302,858 *AF5707DF55BA3DC36170DB51994DC1E9B6E7C603 3H34RT5
1,666,302,859 *AF502447D23810C9156C7059571511CF300DB77D 1460262 mutta.vanha.ihmisemme.olisi.saatettava.sen.uuden.is
1,666,302,860 *AF5047F9A33C529C754C19446BCFD9F8E4F8A669 3IMETABLE
1,666,302,861 *AF5ED9285BDDC980011041EBE3EABC5E1C5EAFEC 1598184 punktgleichdahinteraberlauernirlandundfrankreich.
1,666,302,862 *AF5D06949AED6A85E1382F24FFC19857F98C5C36 3######P`~.(0-0)
1,666,302,863 *AF55954C38C26D09867C9DFE912440F9E7E94DFE 3POCRKATE
1,666,302,864 *AF53B761D75DC44F87CC1B24AA732CF75397B8D7 1811905 KASVATUSTOIMEN JOHTAJA HANNU HURME ON PYYT
1,666,302,865 *AF58E06EBBD6383D444581BBBA33AA7A4D19FABD 185744373x
1,666,302,866 *AF559D73EFF3DE516C613B1694D4C5940E7D088B 492173 hortumsuleymansunar!
1,666,302,867 *AF5A7D3F136E6C666D475C58547628C46FEE6445 4CANCROIDE
1,666,302,868 *AF53DBF2277109C89C6E59D15ED74D6BC686F0E6 4HOMURDANMAK
1,666,302,869 *AF5D0FCDC55FCEA32D989B52CE5A27CDF58F0E2D 4iamonline3
1,666,302,870 *AF5AB2EA98E312A85D17CF547C809532F6AA535F 19APRIL1223
1,666,302,871 *AF59815A880B3E364E3C303AF6864DCF4A0146DC 4THEBUFFALO1
1,666,302,872 *AF53D210B7F7CDC5042DDE15C93ED63B08C692DE 1ENREZAK
1,666,302,873 *AF5ECFCC77A1FD794D7DAB69CBBFE05E25A1796F 1-FACHPOLITISCH
1,666,302,874 *AF5E073AF77C6347AFBE682F1B935A8DCA2D00AD 552220 tunti- ja urakkapalkalla olevan ty
1,666,302,875 *AF54B03F3BD09F266E56AF1183804735D9086359 1-galbraiths
1,666,302,876 *AF552F7B909E891D601F1B2398AFC164DF5FC72E 1-GIGABAYT'A
1,666,302,877 *AF5642976E8DC34472A21ADF374F3A2C8A46F745 5AVIMETER
1,666,302,878 *AF55FE2A784908CF789AB8AA6C9829AA55D7B548 1IRLEMMIH
1,666,302,879 *AF5F9B948EB1357330D7869358C1F4607D8EC49F 5CIN+I114+3D
1,666,302,880 *AF58F91FBD6F1C95BD3A8B8C7E9DD777736C7081 5CLIMATIZAR
1,666,302,881 *AF551FE1B514A99DFAE337BB67935870A49D55B7 1jordie5
1,666,302,882 *AF514655C3F0D5F4519A3ECBB9F4CC4CE19D3F2D 1.KIELENTARKASTUSKULUT
1,666,302,883 *AF55A0FC81A5FC26EB169B3A28E0A0CEE37C6BD2 5ENTROPYFAITH
1,666,302,884 *AF5027B22A37C2F193DADD260BDB8979A43299A5 5KOHELNWASSERSTOFFE
1,666,302,885 *AF5BBACBF7356F583498715E478CADDE60366601 5KRAMERHELPME
1,666,302,886 *AF521F23A58523137E150684C3C67177E950C664 1.LYHYTVARTALOISEN
1,666,302,887 *AF53CE0311A36EDA6CDCB2E9C8BEA3459FDD1A89 5SPRUDLE
1,666,302,888 *AF53C98897B8032EC419816F0B790ECF7EE88B85 5VERMONTPASSWOR
1,666,302,889 *AF5B376505E6A4F1975F3C44CA9BBC5EE7CCD672 5 ZEGAM
1,666,302,890 *AF51A8D90055A365EA52C97E873C0B5507486802 620650 puolueosaston-j
1,666,302,891 *AF5FC31595E42B139C28C3049F3CCA0AFF27FE74 6ANKETTEND
1,666,302,892 *AF5B30905D5D57D75D8A49F236F469D5DEB5476B 1-tekstiselaimiin
1,666,302,893 *AF55B3FAA54D9AF81423E8AEABBEB2D85F6D980B 1-tierschutz-transportvorschriften
1,666,302,894 *AF5008456039CC5AE9FD163D2D8B7547C0C597A1 1.tietokonepiirustuksissa
1,666,302,895 *AF524C5801E6C80C8E16C8D537C1FB09B079A920 1TULO-OJIEN
1,666,302,896 *AF5BC316D884F8D0BE124EC7DE677339D6A754A0 1-tut-kimussuunnitelma
1,666,302,897 *AF5160943222166DA2E4DD1F9C98C7A1A8652E8A 1-uloskulkureitit
1,666,302,898 *AF5EFB088CA490EDD776BE347ABC2BDFB1D34DF3 1 YKSIL
1,666,302,899 *AF592A1C16383AB9B5E39FC2363EF61374081722 6GIGANTOMACHIAS
1,666,302,900 *AF5B8EA863E55253F0C0295E76CF9DC33ED5E548 6KLEERTJES
1,666,302,901 *AF58E34D54DDD063AC53BF097BFF28EDEDB6D2FA 6MYSTERIESPELENS
1,666,302,902 *AF5344054137D38CB4DD9ED41533BD5D1993D475 6NEDROOWTNAEGREDEW
1,666,302,903 *AF5583358E3710E1A0DD1EFF10C1714D336900FA 2270506 erkkiwiklund,vaasabonus22
1,666,302,904 *AF51162EA1D3B499AA4782C3BB42B3CA2C487B18 2338393 KIRJANKIRJOITTAJANAUTTIEL
1,666,302,905 *AF53213BF27F2CDFC42A3B5ED2CF969377AAF519 2444571 tosin.kahden.viime.vuoden.tehostunut.karhunmets
1,666,302,906 *AF5324B02712D73DE98D899532B37D3D85C8C684 24631AFB
1,666,302,907 *AF5E14D492F7B6B885361FFCC84DE80D73E06310 2622405 KAIKKI-,-JOTKA-OVAT-SYNTI
1,666,302,908 *AF515823BA9E15B2FA1FA8D7979939F42FFE829C 7AARON2
1,666,302,909 *AF561309C8F0946AD67E1B382A6624BDA026FE8C 2914646 KUN.MUSEOSTA.PUUTTUU.TEKNINEN.HENKIL
1,666,302,910 *AF5E3A24397B57F5FB27BE2F68FCFC368A3D27DE 291ishaan
1,666,302,911 *AF5E5AAA7E64F3D7E8521448C274FBC14D057C23 29290 defCi toplar paralar
1,666,302,912 *AF5D68E8AF026B8E89EFAE5D15DD912FC256108F 7CONTENDFOR
1,666,302,913 *AF51EFBA3B8AC67C07CAC0136934728442287AFE 2-bakilmistir
1,666,302,914 *AF5FF0057E7B6C87EFA35919DE22332C6F222C2D 7EMPORGEZOGEN
1,666,302,915 *AF5713487C7E6ACBA0D1197591343C6AF98464E2 2CANYONNING
1,666,302,916 *AF544CE71B1972EF56800792BF3E8171CEB441AC 7FEELIING
1,666,302,917 *AF534FB8921B833261A61A2D087C778E32017B63 2 dirtytricks
1,666,302,918 *AF523FA0C6450D03E2B5AC075AE74BD0ACCBED9F 7HARTWAREN
1,666,302,919 *AF55503F3B02EA16F0F5D84A3154D4728DEE5CDC 2F20010816XML
1,666,302,920 *AF5F7C14AE4505C9CC6969354F4BC09E5F6D5524 2geknechtetes
1,666,302,921 *AF57B65022508F75C5A17B77C4D7F0688C0EE967 7ISKAGEN
1,666,302,922 *AF5D1CC06F82CB7793B4928821C9061C34700444 2KOSTUTUSTIPPOJEN
1,666,302,923 *AF53D45AB86FAAB20F1FADD6ECB58208C398B248 2 LAJITELTAVAT
1,666,302,924 *AF5AFE1C3807836733ABCF0A121F178F2A3C80C6 7MAR1314
1,666,302,925 *AF57F1C5E44AAAFB941E4B289E615BBF3624BB41 7PULULANTE
1,666,302,926 *AF52376D2BB38707DB71C08E7853E4B5B7A06797 7REGALERIONS
1,666,302,927 *AF554C2466BB4583BED96BBE5481680C914938D7 7RIMBECILLIMMO
1,666,302,928 *AF561535C5C4C459A42EE5E147DBBE70807017D6 302KASSANDRA
1,666,302,929 *AF53FF344B7CF384AFD06A9757AE48A65ADAF540 393DESMOND
1,666,302,930 *AF5784BBF1ADD539E4DA0AFA68F59DAAA3C05037 3COLOVER
1,666,302,931 *AF5C2573CA1AE253CF5D0DC33EA8ADE62D88454E 3CONVERTISSIONS
1,666,302,932 *AF521A284B943FD4A5D2700DB422B582E778A61D 8ALLAD1ST
1,666,302,933 *AF572ED91818CCD32A0B400B5F0A02F36A22ECFB 8BSWASTRONOMISKAB
1,666,302,934 *AF5FE16899AED68252060E9CDCA12BACB96EB944 8DEGRAINS
1,666,302,935 *AF5088F74C3FF75B2F77127149EA81163F260731 8-E-LUKU
1,666,302,936 *AF5081ECCF46D9F45A05A817A29F2A184B92DDEB 8ESSOLREV
1,666,302,937 *AF56BED0D5E4346BE6D2020163FC112586530934 3PRTHRST
1,666,302,938 *AF536280C856276FCEF153DE9FAA7714B5FF51B1 8GROOVYPLANET
1,666,302,939 *AF5FCBABEEF94B7A0BF7AF1C43E9B31A2EFF4C6C 8GSLCHTLJK
1,666,302,940 *AF552499E8D2C3D211E72378A6874790AE3AA67D 3TH3R34L154T10N
1,666,302,941 *AF514090EDC7B3D162B0E0CA8F6F8B2DE031CCC5 8MFIHINNNGB
1,666,302,942 *AF53710C163FA03A43523CFB23461728DEC49CA3 8NIKITAPEACE
1,666,302,943 *AF565755AB1A8E7CC7836654AA5C530A456CBCAC 41081 arviot perustuvat useiden eri tietol
1,666,302,944 *AF51DC0E7146A2B547CA1FF171C8054B616A070B 8TECHNICIANRAILROAD
1,666,302,945 *AF546AEEC46B6BBD54FCF3346B62A677CA43B42D 8THATSHELTER
1,666,302,946 *AF598F74092411D993E9E41F83412C2061B212A5 90FERNANDO
1,666,302,947 *AF540A680F631FF6A9D7AB051B59DB8CF0C6CA15 4lorrie7
1,666,302,948 *AF5A447406215B2893D9BD97E36A1C1187C72137 9999MMPC
1,666,302,949 *AF59E81FC9C4DD4EFA20BAEBAE6AB353E60AB983 4myhelena9
1,666,302,950 *AF53BC54A1EE1F120BE2F2FF0B54089E97A57109 4PREESTIMATE
1,666,302,951 *AF5DA4FFBA0923807D87F8C7565C0A6C274491FB 4SARECALPED
1,666,302,952 *AF5FF70DC5BA523A354531C70E05DD30EC5C35F0 4SCORRERO
1,666,302,953 *AF590B9322B4B68B1CCB048F4F81E1A35A19642B 4TREFOISBSW
1,666,302,954 *AF500C95949A6644A72251366FED0E515C8D69D5 4YLLYTYSHULLUBSW
1,666,302,955 *AF5D797BB48B028935C96632958BEC6C60306A5F 9LARDONNERAI
1,666,302,956 *AF52FCBE6EF07075B953D0B3BAFBBF48D0C4B55F 549600 vakuutuskorvaaniinty
1,666,302,957 *AF5163CA6C19D1E0F263523B543B69D2ABE4B3B2 584JOVANNI
1,666,302,958 *AF559BB39B8B238A535864263523FDAED83FC3AB 9ROOSTERENDS
1,666,302,959 *AF5BC7EB3C8ED97B2580017229B56729EFBCE3F1 9ssgn
1,666,302,960 *AF5BA275E7FDE9D0AFC2DBDE4E7412C336C163BB 5DAYTEKSUPPORT
1,666,302,961 *AF596CCE6C64076591B980D1CB90457256C8A381 5demogorgon
1,666,302,962 *AF5DFE62BB6065CE4636E44C2E50FCECD6606A91 a0crg
1,666,302,963 *AF57842F0567E34455FF411217803CA0F87E2861 5LABNETBSW
1,666,302,964 *AF53E167B6FF7B955A14275047A25694576DD391 5PARKERINGSSKIVES
1,666,302,965 *AF5F7A5D519848A35FB3DC909DAC17A1A643C419 a4zdp
1,666,302,966 *AF590F435F9F4BBA6EB8841D38721BA7075F812C a5q$x
1,666,302,967 *AF5ECD7C762B54167F8D95E0F89A2416F95E3070 aaawsy
1,666,302,968 *AF5E7B99D383129BA3457EAA708FBAE387144A5F 5SYLVIAFLIGHT
1,666,302,969 *AF53CD8CC282CA6DA858D2E099FA77D8CE412CCB 5tbird7
1,666,302,970 *AF504DC5B96CBA7818B75D84F14648B1E7085232 6783AL
1,666,302,971 *AF5BA7906E9B176864DFD0B8D561B4162AD028F4 6BSWINHALATI
1,666,302,972 *AF5B14865499FA8AAD05530BA34F1B5BF392BB07 ABCDEFSOCCERED
1,666,302,973 *AF5B4EC04BDC187F1BF6CF8935C40795A151BFFA 6CLAUDEHOOPS
1,666,302,974 *AF5FE2F4AFF92ACC7B1808266E35ED0EC7409BF7 ABLN/
1,666,302,975 *AF5D91D0D86CBFA82F69AE4114E9F260437B35EB 6.pitk
1,666,302,976 *AF5271B0BA4547AA668DEC8931411C5342DEDCE6 acq+o
1,666,302,977 *AF5EE9A89C44B0C1B3D2A7D41C7563A2567D255A 7AUTOBLINDATE
1,666,302,978 *AF591048B11678B0A4B01FC28C053C8B14E873A9 7BSWCONNELLYBSW
1,666,302,979 *AF5ADA36E2B9BC3573018D148419AE3C47B853B3 ADFYR
1,666,302,980 *AF5D0CF043F55D9FC2E19B5AE54AA32D3A123D5C ADPM
1,666,302,981 *AF5A08C8ED4DF544E793FA17575507A1709BF145 AE-.T
1,666,302,982 *AF51CEACF44ED3B2262CA29BEF19270BFE10B26E a;fi
1,666,302,983 *AF53351C1CDD538D7A5E9EA9C7C0953A72D8EDF4 ag=2?
1,666,302,984 *AF5BAA08491BE70A00D90BDFDAD401673EE4127A agg%k
1,666,302,985 *AF5507D9083C8A9554DD002790B317423F2F95D8 ai_a=
1,666,302,986 *AF5C58A8F7C88FFB375DB190DC5D94BA341FA5A5 8CHARNUES
1,666,302,987 *AF5D3F25B9F09ABCDC8304AD3224B9DC385028CB ak%hy
1,666,302,988 *AF552B1B51C2476B2D309A5DB88F1FD68D0FB460 8INLAADDES
1,666,302,989 *AF54112B56012DDCCF2B98FDBC4C1CBC65AA2A4F 8innerhalb
1,666,302,990 *AF5F725E14C6DEDF99D321CF1B7E878776F209C4 A?KUS
1,666,302,991 *AF50800941885CBB1F92B6215BC0864A24F18118 AL13E
1,666,302,992 *AF5A9F81324F23CF452708BE59EB987CA7F80641 ALFY1
1,666,302,993 *AF54BA7ADAB706FADDB7535C5D03F2BFF8FD869F 8william5
1,666,302,994 *AF5194BAC5860753843A61D739E7A4249D538B22 ALI.MACCABE
1,666,302,995 *AF53AF6D44AD368BC577A02AAEA6658EE9EDBB64 934TYSON
1,666,302,996 *AF5BE09E7152CDAE44BD94D49BF1A9C9F74411A7 ALLDERIDGE
1,666,302,997 *AF5A3C20C4E107D427B241294C072F2A94D23FA9 9ANOPILLE
1,666,302,998 *AF537AB0BF2DE55CBE164A7EE1B240F836B83794 ALPHONSO.LARMETT
1,666,302,999 *AF59D18741F5434D6B0A9234F5B648A04B2EFD51 alphonsonii
1,666,303,000 *AF56279D7990DF7EBAAB2C704F36CB34FA29B1AA ALRHA
1,666,303,001 *AF5E1343007B90D568C6DFE51D18D29A34C4B577 AMBA-AMBA-TAJ
1,666,303,002 *AF54E485488057B2234BDC4F82C1EFBB31028D7B ambrosebobola
1,666,303,003 *AF59989945EBE46B390EC37A9C62BA4BBEC2AD94 AMBROSE.WAINIO
1,666,303,004 *AF5B12C3D584AED6C45789EB66F99BAFD804671B ANDREASGARTHEE
1,666,303,005 *AF579A32A33422D41DBA1397613964E481D7B61C ANGELOHARDIGAN
1,666,303,006 *AF553D6043D51F5266DF58C576046DB4C140C8A6 anges-dans-nos-campagnes
1,666,303,007 *AF556E332855A16B598E36A5EFD64F1EA8977193 ANNA-PURSE
1,666,303,008 *AF5E19700F9E8D831746A9211AA575AB2D49E08D 9RELITSKET
1,666,303,009 *AF52669C191B764C34F1EF23D9BC2258D184F98E ANTIONEARRAND
1,666,303,010 *AF5B635DB2E831B1EF627289E609BCCAEEA583AF 9TENDMIST
1,666,303,011 *AF5CB7D09041195B0C9F1456712D9E5DFBA1665A 9THEVERONICA8
1,666,303,012 *AF5B8FBE389A4130E2E34B39DF83DA10D756C8F1 9WILDCATRAQUEL
1,666,303,013 *AF5D2E32B7AF9AF560174FAA638899EACB826134 ar6.9
1,666,303,014 *AF5F8D87C8EDDDD3624D815B97F5C35C24C26E73 ARDEN.CAVAZOS
1,666,303,015 *AF53720002572F2DDE867E11C052ED1E2241EC19 ARDEN.NARDONE
1,666,303,016 *AF5344DBA16F672389045F9E4388814E10E88C01 ARHB
1,666,303,017 *AF52ED3F6262F2209865466F968F47B02E9DD542 A.4WL
1,666,303,018 *AF52ABE812479B9A665C3ED256C16F9759A0523D ARLEN.TSAI
1,666,303,019 *AF5BEB286FC376A758AE491032DD7E18FE6A435F a5t+p
1,666,303,020 *AF53C6A551C8CFFE8A7968C5546F277A9C57B1D3 a695h
1,666,303,021 *AF5D7A83E4E3259531DD0EEF0B986981C0C99EC6 A%6CF
1,666,303,022 *AF5B741D315D847E913982CDA27886754003A897 AA<=%
1,666,303,023 *AF55D459319E7E249B7DF65E23F865346F7DA32D AAA:\
1,666,303,024 *AF59FC42705E40AFB3B37B388AC12D80796E9B97 AAB4'H
1,666,303,025 *AF5D822607935FD19A0D42247BF82B5439969DB3 AACL\@
1,666,303,026 *AF5A32AA2BBE4529DC01BB54BFF6849C3FFC8AA1 aukci
1,666,303,027 *AF57349E6CA4128DC377FC26A35C3A2CC4D926A6 aardbeien0
1,666,303,028 *AF5C2DA42BC176F90D33F4E4FCB8239A981E5524 Auth0rtatve1y
1,666,303,029 *AF5A04ACD14D549CA36BDB82FC57033146CAA96F abass-femi
1,666,303,030 *AF521A54D54BF5759B4D3512FDA90541AB2A2ECD abbildendening
1,666,303,031 *AF51ECF2B975874FDFDC16FACCB05D5931FAA0A8 abdulghaffarkhanfaithiabattle
1,666,303,032 *AF5E179AF69FE40D01375E53D490D4DA73AFD3E3 AVTHR
1,666,303,033 *AF523AE2443EFB46A767FD34EA5E231F6C96AF26 AVW.G
1,666,303,034 *AF56AED33EA537E01F5A5A36334347ED0576F546 accesspookiing
1,666,303,035 *AF51D8E727FFBC3F643DD121B59AE9329E8A0FFF acideder
1,666,303,036 *AF5BD3E4E9ADE718F4BFD65083C503E758045554 ADPM
1,666,303,037 *AF55EC956284982874744F543C009B6734DADB4B affligeants7
1,666,303,038 *AF56FCD0F13E4389E5A6AFF767F47B59BFC2E6CF b36,n
1,666,303,039 *AF5975E537309C85C9C9EA8F0C67B580142CAC32 B3T0NH0V3
1,666,303,040 *AF5AAFC12AF6100C3EEE8FB6743AD7D27B0F6ACC AHOLFIELD
1,666,303,041 *AF5E6B372FE88DA5025F9EA4A0A541909B995B8C AH)v
1,666,303,042 *AF526DCB56B3BF5F342F2C35BBE56B3589D0B7B9 ba=fa
1,666,303,043 *AF552AB543330C5B8240752C0A307AC1954138E6 ak(%(
1,666,303,044 *AF5FCEE56042072BF98D5056B0A30E8AF5A499A5 bardada9
1,666,303,045 *AF5C1BED3EBFE9EB3DFD478D5FED4030689B7F7E ALAN.MEDINA
1,666,303,046 *AF5D3F0868E807EBAE46BECDA7EA2D065633B0A5 [email protected]
1,666,303,047 *AF5C0FDE930B637FBF515CA7DF190D2E8D4D7685 BAUGEBIETSAUSDEHNUNGEN
1,666,303,048 *AF56AB30CECFF48A111D424E6B93BA5271D806C0 albigneux
1,666,303,049 *AF58264A3E13964401901AE4A74744C725D8D3B0 ALDEEC
1,666,303,050 *AF5F04B5055450E1740BE7468B567A6384B66CEE bc1iw
1,666,303,051 *AF5FED79C54D56A6C49356C12EAF58059830ABD3 BcM
1,666,303,052 *AF5CA841A318E1A30BCFFFAD6207A2BC84E1493B BDAMICO4
1,666,303,053 *AF56D1FD43C4A051964A93E0BF596307E1D89F09 BEEJW
1,666,303,054 *AF5A63A6B5CE306FE6A778512DE3EA29E193A5C3 bernardhaegele
1,666,303,055 *AF50ABF4718B878EB727AE88C52DD4C6E1281FAB BERT.BERNDSEN
1,666,303,056 *AF5438373642C8A6581A0FFC6E5DB8EC3136E647 bestaan3
1,666,303,057 *AF5CF4985C8CDDC61B5A8EC13B869B0599E85BBA BHOBET
1,666,303,058 *AF508E8A842CD48B4E8024EB746AC00F335C2703 BILLYJEALOUSY.COMWWW
1,666,303,059 *AF5CE907399678E9923A9EF15E308ED74FFA45E1 BISCARSE1O
1,666,303,060 *AF5ABBC976F121B789A5CA8B9CEC86F86CF29084 AMORRARENS
1,666,303,061 *AF52383BB75B7990F939576AF8C3B656AA25096E ANDROFOBIA123
1,666,303,062 *AF57D99EB9B274CB0E20DF524B249A56EDFDC216 bldschrmsttn
1,666,303,063 *AF5BBF0D6EB8A9D1C70BDBA0766C7EF4F79F7A1B bm5
1,666,303,064 *AF59276E9C38A80549A25541D15D56BAAC82C4AE anemptychair(take2,3+4)(vocal:roycash)
1,666,303,065 *AF5E14A6D6BA1E1820C284DEAD467079DCFD47F5 antoniasajor
1,666,303,066 *AF56118E288A677423C3EF523E7072CDDD60B825 [email protected]
1,666,303,067 *AF5A147CBB9E9691079728E74713505B39021491 bonuši
1,666,303,068 *AF5165C7182C154B0065B11B571587BFCDFF3832 boo,/
1,666,303,069 *AF5A7A203D17F4E35B2AD865FEF9C8DE47E15193 bp,
1,666,303,070 *AF5A8A27327E5F8DA50BC3A1988F3BB65DC756DE APt:
1,666,303,071 *AF5D77FDCF7C9C788445EC2FC0FD5F075EF6FF1D BRAIN.POP
1,666,303,072 *AF526A19425741C9466B45898FB95DA9D8960312 ARCHIE.MONTMINY
1,666,303,073 *AF55B28A147AA3E44609F66ACE13345C4F3FDD0B argovie3
1,666,303,074 *AF5470D4762493FE01D85110204102298219A114 ARNOLDPAWELEK
1,666,303,075 *AF547373F9FBA3727DA0BB416A3124423DBE92E4 arrafiz5
1,666,303,076 *AF58FC3674F5E3768F0C6BB299C4CB0050C7ACDD [email protected]
1,666,303,077 *AF551B36040185342B9F5EA099D830B9320D0073 [email protected]
1,666,303,078 *AF527258A2B112DEE33497D0FF0EDD7F002F0AEA BRUNORAYER
1,666,303,079 *AF518A8BF64A270D9426A529E0E850A5B188FEDA asuntotu1
1,666,303,080 *AF5ADB2F563DB8F825EFBDAD41DB5C3348003ED4 BSUTINGCO
1,666,303,081 *AF5768BD61DE5008FA0F585141300F12971C8E91 bswsuggesionsbsw
1,666,303,082 *AF55D9895FA9B69225ADC066AF4A54D6B7EB2C74 btgm?
1,666,303,083 *AF51607233D4CA6C01573B11AA7E0290107C0AAD auidv
1,666,303,084 *AF5257FEE581D31FD180195A4290F4CDB45BE630 AUW/N
1,666,303,085 *AF55C7726BA9E349F3BA0D4917439E4AE463403E BUSOLA OGUNYEMI
1,666,303,086 *AF585B9A281F5D6CE3312568703C29C06298E019 AVERY.GULLY
1,666,303,087 *AF5113771B37E09A2F4E37E5463AD8BE1BDF6F40 bu&yd
1,666,303,088 *AF54EBA0A6088A63C33139A1C03ECADA99C74E7E b0l7&
1,666,303,089 *AF598C4DFB9A633A3553476BFC75DA353A35BB3B C)3DE
1,666,303,090 *AF54F74FA71B1BCBC6388B064495F1023D549EE0 B6QWY
1,666,303,091 *AF5BB03EAC8B6CA7C24CCFAAB83C8CEC7F729D79 CALZADA.MEXICO-TACUBA
1,666,303,092 *AF5C4F5780DEFBA4116AA6AF7140090E23F0BE93 canajohariestories
1,666,303,093 *AF5DCC0FF62B70A0AE3A35E1763FC827E64DC53E BA?MW
1,666,303,094 *AF559DFDA1D21BA360361BEF655132CF8B416DF4 carol.smolinski
1,666,303,095 *AF55ED68B47F20BB5AC57B5D6C183CD7D6AC1E67 [email protected]
1,666,303,096 *AF569047F98F941DE9D48AC14F0CA3FBE337D0EC BASRALAINEN
1,666,303,097 *AF5ED84D0AF84BE7B9A6FEA035F675BE55707656 bb9n!
1,666,303,098 *AF5A98CC21404F9D0A8A457DAC9930CFE1FECD6E cathedraleevry
1,666,303,099 *AF5728AA157F26B0B5D1EBDF69344FFC2DC30FEA CbAR
1,666,303,100 *AF521420BA8E457F8427415202D58FE41DEA6D1F B%DS_
1,666,303,101 *AF59BAA87831D37266815E4531AAE0BF1C46AECD bealluced
1,666,303,102 *AF55C25F50F7D38DC415B2A82E13303B356A00E0 cecillunderville
1,666,303,103 *AF547894E9C2C678FF3DDC124E4D95CEAD7C5BA8 CE DE CLAVECIN NO 12: PR
1,666,303,104 *AF5E4AD616AFAC30CA82BC4A080713FF912F70B7 cehcknip7
1,666,303,105 *AF555353CB65BA4CB3BC61493CB696D35F3E1BA8 belle-brown
1,666,303,106 *AF59B6010FA89EE47F0E93E43A5D4008AC4DE8C0 C#F$L
1,666,303,107 *AF5BB489DB00FDA238BDC55075CF3EA02D0B9990 BERRYVAIKO
1,666,303,108 *AF57ED945A0319036AC8E4D16FCC928786ED9C95 cgafhbsw
1,666,303,109 *AF5B8EB01939844095AEE1603C26CC846B66E4FE BESEDEILO
1,666,303,110 *AF546F7A911BEE0A0ED3F3F0C41CD7857572E0DF chagolla5
1,666,303,111 *AF5DB4AFF9D548B1DB23CABFFFF0BC1F8F191B2E CHAIN WELDER
1,666,303,112 *AF56CE1FEEF7652B9D91880EF2DA7C127AA37B36 [email protected]
1,666,303,113 *AF5A590EE5FC074C7C32ADAABCF0E41E911E62C7 chantelle
1,666,303,114 *AF504B2626468465689877E09AC01433C5D01AD4 CHARLIEAPSEY
1,666,303,115 *AF5B7E2006A67D65D320DB474A6D76F174378A4E [email protected]
1,666,303,116 *AF58779102F64AF731678FEF6DE16818C1E57140 [email protected]
1,666,303,117 *AF50E9F0D6DE5CCBD66CFB3C14F94E350565B467 Chez-les-autres
1,666,303,118 *AF525974A35BBB02175A9799916A0032E49BF3A1 [email protected]
1,666,303,119 *AF552A0482D828D5854BD90A6E2E72ABA761A708 chocolate jesus (live on david letterman)
1,666,303,120 *AF50BB6880F9EFDD911394E223D90AE531D92CDF BIPOLARITY1
1,666,303,121 *AF56B78BF347AC663AF74E8490FE334D6717858B churchanity4
1,666,303,122 *AF5E6C592AC5E0B30103D949582FCD3181765D9D blakewillmschen
1,666,303,123 *AF5261DE990BF5AD6C02357AFDBF82AE9D3B6B53 CJTFD
1,666,303,124 *AF50CE2460369B77647C06A3C050276C969C67CC CLEMENTE.KOLDING
1,666,303,125 *AF547B567222E5585DD5CB93AE96E34362EBAA1E clhig
1,666,303,126 *AF537AD41358F31BCF2B507F70B961E0F007C161 cloe-black
1,666,303,127 *AF51E2C2FB04C85DF0A3C70911ECC00E97CF38C8 clux,
1,666,303,128 *AF5B6A705905B7EF53936FBE860F807F7F6AD1B6 boaf
1,666,303,129 *AF5CC40E91B612A26B525CFE8C1EEDA1FF20F7A7 CML+D
1,666,303,130 *AF5ED92D7DDED403E70F0D030DAA4D16C3342DA1 cmshf
1,666,303,131 *AF543165713563408208DA9C33BBCB75A8E52D21 bradschlangen
1,666,303,132 *AF54FCEB034F629C90AB3B46B4E300D10191C93C CONSOLIDENT0
1,666,303,133 *AF5375C00933343DEE0386A4D9D1187A63E8DFA9 CONTITINENT
1,666,303,134 *AF5D51BBA52EAAE9D194C1DFFCB90075DB0D31E8 BRIANVAUTER
1,666,303,135 *AF5F5D317A76C6173981F10B859558F30168F79E BRIDGETOETERNITY
1,666,303,136 *AF50260407FBD32DBFA897B3953619AD009EAEC7 brockvaske
1,666,303,137 *AF526732806C026AC60173176868AA5D81FAE3B3 cornellsoladine
1,666,303,138 *AF5B31133B3C94ACABEA76C3D814A2108B459778 br_v?
1,666,303,139 *AF55D398D81430EC1D532EC1D60E61C74F8C6B15 C:\PROGRAM-FILES\ADOBE\ADOBE-PHOTOSHOP-CS4\SCRIPTING\SAMPLE-SCRIPTS\JAVASCRIPT\WORKINGWITHTEXTJSX
1,666,303,140 *AF5446BED7FBF1A893974E9C31BDD5A7AB3A1A42 [email protected]
1,666,303,141 *AF5D6046455E517EAF58A9EC39D4E1AC826D4083 BUD.SOBANIA
1,666,303,142 *AF53C521266A2E7086F49D156A93070E38B0B2B5 CRAIGDELCOURT
1,666,303,143 *AF56CD82300E8A831BA7F78D45B37DA68EC12482 [email protected]
1,666,303,144 *AF5473D236C1857D17D2E1BE63BC3705971EFE79 curtisrogg
1,666,303,145 *AF52206A0D12E5CF942D947215874BBBED930B26 c"&v
1,666,303,146 *AF5E4E7B39CFA3A1879BB1D0D0E99C7EFBF15725 c28w
1,666,303,147 *AF523D9826DF62C3AEB908289ABCF4833A07F876 cwqeu
1,666,303,148 *AF5B8F835C595E1CFF515201B02A478998F9525A CYS58-110
1,666,303,149 *AF5981C3B84360B31F70AE2C10466AC370C5477E c3;o&
1,666,303,150 *AF5047FC7F1B5E62732041F220E29CAD90687EAB D06W
1,666,303,151 *AF523D2F0F64C5C5273F29EF6F6B27ED1CACC5DF ca5pk
1,666,303,152 *AF5E53B7A41323DD3989723D93764D730EE9976C CALVINBABINGTON
1,666,303,153 *AF583C7A3DBD3E2B1B0F62EFF2F7A5AD7F0A2286 D2C=B
1,666,303,154 *AF583C5B6A1750ADD0C42F443246F709D7047434 careykarin
1,666,303,155 *AF5B8069454A3B159B329767D811EECA53C32DD4 CAREYMARY
1,666,303,156 *AF53E2AB6254F758B4C02095AD29F3648D445106 carolbrogren
1,666,303,157 *AF5D57100155EE771C74AEF72A2A6635A9D54223 casalinuovo
1,666,303,158 *AF535FC567B567E1F895BA32ED0226C0B5D8F21B [email protected]
1,666,303,159 *AF5B51227976998A9E7BF2A4A7AD05F18A7C4A9C c,cnj
1,666,303,160 *AF5255D96D0588F74ADE3FEEE507A7D6C78AD407 dariushellmich
1,666,303,161 *AF5389BE2F6EBD77EDF0BCC3C187794EBA1F468D DARIUSNICOME
1,666,303,162 *AF5065F189CF7BCB874D72B6C2F58476B32746CE [email protected]
1,666,303,163 *AF56F3567D33F03C3E34222F682B9E805D109B3F c!,e%
1,666,303,164 *AF5940E9A8397F2A38FC1F482782B8B4BF3F883A CEGHEU4
1,666,303,165 *AF5A5F62FEF045D9AF100F3B6778C868D50B73A3 CELINA.MORRIS
1,666,303,166 *AF5A3ABC93BD3AD1F3EC793E95AF7D74038BE2E4 DASHX:
1,666,303,167 *AF51A4532F21D0D7DFBF16D80C42C0AC80F3325E DaU4
1,666,303,168 *AF5AEA83611505FB713792C1927456DBC0303C34 d!$cour49ement
1,666,303,169 *AF5613AF67436964A949DEFFA9E0B4F438EAEB47 DDEGC
1,666,303,170 *AF5D960E3FEB048F0ABA307C2FBBBFFDA5F73B73 DEANGELOBRECHNER
1,666,303,171 *AF5FC699B694CADAFFEC6C7F8B138B7C4C384FC1 deegodek
1,666,303,172 *AF57A88E67D23FD7E846E465B4BF1391D013196C charnie7
1,666,303,173 *AF575E20E7C471D0A5EE751E2443F43E71669638 delehsub6
1,666,303,174 *AF542C7E5F46612D6EE57D0CBA7161A45E31ED3E [email protected]
1,666,303,175 *AF55EAE629938F743CCB77AC2F859F7FF95D32E2 DEMASPIA
1,666,303,176 *AF507551FB01E9819D70C3396DCE48355C03D7EB CHUCK.SPERANDIO
1,666,303,177 *AF533E852C3982789367BAB9AAA79A7B55FF170F CI6A9
1,666,303,178 *AF55A13A0EA24A5593191082346ABBD43F4DB848 CINNIE.PACO)
1,666,303,179 *AF512486962DD8C5A3956EE5F890AE74914214BB dfpr)
1,666,303,180 *AF5EA532CCBC07CC70943EB6FB10BEAD03455FDF [email protected]
1,666,303,181 *AF5C60EF3CE35A679A46F10BF053780DC6A678BD CMEHAU
1,666,303,182 *AF56EB7CF02B4797EA57DE6AFEA96B105B8CD6E8 cmqw2
1,666,303,183 *AF5EB8574C9579598651193DB3A5C4CFBF6FD67C di;vn
1,666,303,184 *AF5CF9A4D937600F83563EDA80B49DE2527D6ED0 dk"iy
1,666,303,185 *AF5D3C7B593B0B42E46C7F27B7C9C900FF2FCFC6 COMMONSHISTORIC
1,666,303,186 *AF5B5C840F7FC27DB1DFA88BF46F25F256E9936D DLMT'
1,666,303,187 *AF51357FF89C9970542FDA314CE488238A7AD1AA d%%?m
1,666,303,188 *AF5D089587F782771DC326277F4F3AD532E7E5FD CONJUGATUS1
1,666,303,189 *AF58294CF5F526BC28AA5423B68AF020310324C8 conservatoried
1,666,303,190 *AF5349B3B562D2573B6A6A8E6E56B4373D265CAD do,-f
1,666,303,191 *AF5DA03812AE3473A56D366905915B57B19A2C91 COURTNEY.FLOURNAY
1,666,303,192 *AF508F177534F881A7DA029FDBCFA8EA51DB9C0F DONNELL.SELF
1,666,303,193 *AF52C461A8FE606B9F4530242D28ABDEF37BB2B2 cpvr
1,666,303,194 *AF53618556431DF7FA08D33E01189FD80862B250 cs+bh
1,666,303,195 *AF5F04F7806AD1289F1336A3FC814ED2531237AC CXL,T
1,666,303,196 *AF51485E18FC29530428F735F0910E9333443B71 ds4sz
1,666,303,197 *AF5114E959302B29EBB45399927E9ED111346E77 DURAKSAYACAKLAR
1,666,303,198 *AF5255B04C41701523C2B8EDAF6AB9581FA19562 DURUAKUO
1,666,303,199 *AF514B767A7058F598563E47B426FFE4938CDE1D DUSMANTASAHOO
1,666,303,200 *AF550DC827F895C7DAAD476D72920DEFD3305070 DAMIONNEUHAUSER
1,666,303,201 *AF50627706D45D2FDCD6C7A74AEB48F8ECD79E4D DU)Z
1,666,303,202 *AF5957F9E1751F5DC943B37E376E81CB7D33F252 D!VGF
1,666,303,203 *AF5333868A460443675F7AA649779D0630E18355 DANNY.BAMBURG
1,666,303,204 *AF5BC5745DC9D5CB9686CE3BC5518D2360A3B9F9 dao69
1,666,303,205 *AF549436ED15AFD077FFCDAF1899CB897BB1C22A darellmelikyan
1,666,303,206 *AF57C3A5051B155CB840C48C0A67C20DF872BE28 DYD3S
1,666,303,207 *AF54ADCDB2B9FCE0A41BDE06942D7B750A9CD208 dasrheingold:szeneii.einleitung
1,666,303,208 *AF50781755ED51088FA8A5E6E6B682362ABD1735 EDUARDONEWMAN
1,666,303,209 *AF5F784654499F5AC218C0FD97F8BA74CEF71EC8 DEANDREBALON
1,666,303,210 *AF58ADBD081A0C73136629D34CE6C7F6F999CB6C deandrenyman
1,666,303,211 *AF592EA9574AF3837F69637A70A6A8C7E6E98016 DEAN.STANAWAY
1,666,303,212 *AF5B74FE55D4AA12E500CA9756D6AFFD518D094A debattierte
1,666,303,213 *AF5673335EFAB7E4D8A8BC97096C22DF7395C1CB DEFEKTIVTING
1,666,303,214 *AF5871D147A20479740D8E5E88557A31F6F5AA8F DEGENERIRANI
1,666,303,215 *AF558DF9B2C06A010E4D471DB1A4BEEDF083CA14 DEL.AGUSTIN
1,666,303,216 *AF5B2690A2E9C61E5B9DDA0A7CCC83C7E62285D9 eeqmb
1,666,303,217 *AF5EC48EAAC762717E4AC5DD5B1C1368285BC0D7 EGELSTONS
1,666,303,218 *AF5F41109A367F199C0DA35A14F97513F5420CB0 De_s
1,666,303,219 *AF5BCE2E86467311A0BAA33C7A461B3BEC866C89 destituaveris
1,666,303,220 *AF514D9187EC2325B1ED8C48243792EE7E16FADD DEXTERLUCKETT
1,666,303,221 *AF5A7BD3A002F2E40C4256684AA1AC2B5BFEAC9E ELEREOCALALOGUEFL
1,666,303,222 *AF51DF33536275CE60CEFB305533BD4FC792FA7B ELIASMATLEY
1,666,303,223 *AF58D88C95D8A23BDD417BF20902BE9AA1FBA80B DHU-S
1,666,303,224 *AF5B2457CBD614E3F86370D3A82A4F884B399F5F diegogutekunst
1,666,303,225 *AF589586F56FBDC308E797A361E9F4A128071457 DIEMRAB4
1,666,303,226 *AF543FE8BD6967CF7ADF4947D6B2C8C4520611A3 DISKUSSIONEN6
1,666,303,227 *AF5CFDBFC42FACF17CD6F06E83623924F31D7468 elikappihe
1,666,303,228 *AF50E8343937C8AEFFFBD956D37DA16E8668576F djsmuve1
1,666,303,229 *AF590CAEB756F415FFE3F8A28352CD355383F8EC DKRN6
1,666,303,230 *AF5D0FF704D45C8554CD239CA47A782AF48487AD d%l9b
1,666,303,231 *AF5E81A24FA047D9AEBD4A542B538157155A727B eniom
1,666,303,232 *AF561C55203786F60EB1842B7D5FC73CA7674F3E dominiqueborneman
1,666,303,233 *AF5B8BAEA79B8986620F56367EEF8603D31BC8A7 eof2q
1,666,303,234 *AF541965112D06F913E6C8B4B717A35D4E458ECE ep+l
1,666,303,235 *AF50D925A95E721E360412DB6D50C91CB50E4AA3 douglasfriend
1,666,303,236 *AF517C35D9667FA334280D86EEEE6D8EFDBA346E dpf!
1,666,303,237 *AF524B8B4B04A8290A3BB4C5001B4456FF6ED71C ERROLGUMMER
1,666,303,238 *AF5C96F4FE311948CDEBB8EF176E3B473BF3B8AD DR!/
1,666,303,239 *AF5B9C860AB61E33359D284A310209C0E0346B4F ESCHITCO
1,666,303,240 *AF5C7F7E5263D00122535BCFF22B8DC98AAEA0AF esk7t
1,666,303,241 *AF568348251B891D17F1360594C6E90AF79465C4 eu`
1,666,303,242 *AF504783A4DC694AFFF9E54403ACD954CBDE0FFC DU;_/
1,666,303,243 *AF5B2E5D2F437DA18B1E4288A2F3E728EBDBDAD8 examintations3
1,666,303,244 *AF55EF4986881F0D82A85E6D292911DB827F5FCB Du,i
1,666,303,245 *AF5F686F3681D7AEBB1CC24A11F62BD9AA03047F ezequielkalberg
1,666,303,246 *AF5FF911EB42C16B9E964046FE7A47EFB210AC6F [email protected]
1,666,303,247 *AF5C12900B0FD43B1141099EA9013A13E8D6201E d!+v+
1,666,303,248 *AF5BC0A754F7771E450E80CE3C4DD1649BF9F541 DV5GL
1,666,303,249 *AF5E227F1C57B34B51E59B3C517BD3786B813D7D d,vk
1,666,303,250 *AF5192C0DAFFDD8BC65F10FDE0279A2A27C5CF7E Facebread
1,666,303,251 *AF57A3EC8DF3E264E1952FF36EF6F1A033EA7E46 [email protected]
1,666,303,252 *AF512A32B3839B600F67636A3BB5330DE0470DBF federal-funds
1,666,303,253 *AF520B172D29B11AF3CEFBD5D1C9CDEBE6E51970 fernandocorell
1,666,303,254 *AF53C078A6C6D38F224ACE148560134D846E0534 EBKKU
1,666,303,255 *AF5671BCFA71E8778734DC58EB01287C47AC0F59 eckk6
1,666,303,256 *AF5DC16E313B9B0E03326115A3E72AD3495B5CFE [email protected]
1,666,303,257 *AF59CD686D15BAA48FD7B271AFEBDE2814E65C49 EDPRIDEMORE
1,666,303,258 *AF5562545BA1FA1F4161B212D2FFB069A22DAE63 FLETCHERMITTLER
1,666,303,259 *AF5C7783807C9F8B7EDF782D2C64E460890FAC2C florentinomarchizano
1,666,303,260 *AF5FB91D003EBD498ED50A9D9A75FAE7A4E9C277 florimanist!
1,666,303,261 *AF539AB95A875662E5AE2D3C949FC572828B9BB2 [email protected]@$!e$
1,666,303,262 *AF51993793FBB5AE1DE1CA56B638FD4B111E478E EFT
1,666,303,263 *AF517C85D4952A2E3B0564312C3544D40D4ABA90 EGNATSOPPING
1,666,303,264 *AF5172F15CBF1A8FE0B4290DF82CD8CFC3270F0E forrestcarpen
1,666,303,265 *AF519D8BE9F27F514CCB826344AC8BAD740D1391 FORSOOKS7
1,666,303,266 *AF5245BFC2E53238C13B65A54C8A403FC7194ED3 elaine80
1,666,303,267 *AF5B399A7C0C737F4A3992AFC077CB5698F42715 elcoubi
1,666,303,268 *AF56EDE3857449DDC2DDB9951B600937E17166A1 ELIZABETHGIFFIN
1,666,303,269 *AF55E010DCB72D55943415FB9BDF8C0085129C21 ELLIOT.SOOLUA
1,666,303,270 *AF5531BCD7EF7B32E955AA8D97470D6B2FCD8569 ELMCG
1,666,303,271 *AF5C355F47E83B89A89144FF18513A7D9A2D0866 emmaruth.hernandez
1,666,303,272 *AF521109E8BA8D16002C1C6F518B70A833517474 GALEAVANCENA
1,666,303,273 *AF5F2BA71673D897BB0ADA4E51192E09A2716E34 EMO19950217
1,666,303,274 *AF5CF02FF134889D2DFADC66EFC3136E46C68F69 emorygrosvenor
1,666,303,275 *AF5DAD1E0EB218934EB1344317745379922B2B52 e"n\
1,666,303,276 *AF59F147984FCB5B79A7C4D5094C0393B5AAFEB7 Endowedwithvirtues
1,666,303,277 *AF53921D1BEF15E07A67C95ED92AAC222DE5F998 GARY-NOFZIGER
1,666,303,278 *AF55093CFB0691E0F564441822D7C55B9397C0B0 GAUNTLY?
1,666,303,279 *AF574A75236B0D27226B54AC0C3A5556E73C0187 ensam
1,666,303,280 *AF54C6AD735A6C14DCCE180CC8D3AD534CB219A0 gazump
1,666,303,281 *AF5A4F8D99453B067B0D0C82F63521BB77611BDA EQ_WP
1,666,303,282 *AF5AF25040D13651FD732D4F557C336F65C9C05C GERALDSWEETY
1,666,303,283 *AF5628CB0264C7160C382A731A421EF19C2C91E4 GESAUMSEHAZOI
1,666,303,284 *AF5B18847B225A61229976AC48518E17D36654A5 ERIK.PERRODIN
1,666,303,285 *AF55964EE3897EFAA1C14C81903934026C98F9D1 g>gp
1,666,303,286 *AF5A570C409F47E23B5DC151D08661DE3D3A0844 girl.talk.(intro)
1,666,303,287 *AF56E3160DFDB86AC8B1380279F3B77FB6A3EFEE ETHAN.JIMENO
1,666,303,288 *AF5133C2F7FA5BCD6510536FDA97D9888C6EFCDC [email protected]
1,666,303,289 *AF5976CD0FA4A5AB561F89AFBBBBE733E848ACE5 EU0F/
1,666,303,290 *AF5B9CCB5F025C97963B3DFF30B447573A1ADE98 goldleaves,forgkchesterton
1,666,303,291 *AF5B3B3E33C4360C669623F937FE248B6DDB04D0 gonebuck1
1,666,303,292 *AF5766AB87E8869CC2A3D74A352FD4723C20BB5F evanulmer
1,666,303,293 *AF5A81188EF4FAEE00EFD4934DDD450DBD0D1BB9 GOODLOE12
1,666,303,294 *AF5B35FA983A34AA541F6FE3E7E1E40212BB1D39 GREGORYWHITNEY
1,666,303,295 *AF5905188AC436700AA9F4F4C1D3AC7CD8D188B7 [email protected]
1,666,303,296 *AF57E79D506141003FC66DD216F6D838B155BC1E faburdoning
1,666,303,297 *AF5711A1D945B25CA0BBB8514E46FC408B8CCC48 grnlndsk9
1,666,303,298 *AF5FAF92DB2A5DBA21C95CAD585E0AD5DABC23BF FAKEGOOBERC
1,666,303,299 *AF5ED72782E83463F08B88B154911D5475C9810D grundado
1,666,303,300 *AF5C465C6F8072357EA338DE8E44541AA1349C3F GSTCLRSED
1,666,303,301 *AF55E0A78C4DA1393348A440C06139A780BBDFC8 [email protected]
1,666,303,302 *AF5723D3FF10634357F62381C24BDF7D67FD01B4 gurgitera2
1,666,303,303 *AF50AF667628A86C3C05FA156C457E06134764FD fennimore
1,666,303,304 *AF5B658473C8D475BF31CBAF7FF4CC5022EFD0CD h)6
1,666,303,305 *AF53D12DD3068F399F9FCD31EC1722AB13A55ADD FIDELSHOLLENBARGER
1,666,303,306 *AF54FA8FF9B81334CEA5F072EA7BC266F39A3290 FIEDFIELDFORCONVENIENCE,THETERMDATAINTEGRITYWILL
1,666,303,307 *AF5EB87A5D7A07A203B568AEB3D5504A161C4EBC haizillmer
1,666,303,308 *AF53E31F759465A6B29A7C1F396CBB19A056E856 HAL.FORMAN
1,666,303,309 *AF53C469E907060896F0B95D99E87BB04E4DF7E8 HAPPANO.ORG
1,666,303,310 *AF5F597E3E0382BD641319BB74E29AD2966BFF8C harassant9
1,666,303,311 *AF5E311F0728B298AEEA157BACA0B6BE44D40666 flecting3
1,666,303,312 *AF5E98093BE3ED27D1A954A065A0B50C31ADD110 HARRYMCDOUGALD
1,666,303,313 *AF530A56D8F55CDB488D82AC300E422C4ABD5775 FLORENTINOKJELDGAARD
1,666,303,314 *AF55B8A926A9A7A74DE7C3FAE4A7138949DA1AF5 florentinotonnesen
1,666,303,315 *AF5717B04351CBC4F27D8A450AB344FCFC26879E FLOYDCLOE
1,666,303,316 *AF58DE35DACE958097E085370CA7963111DA7B65 HASSAN.BOLUS
1,666,303,317 *AF5D2FF1A3A2A744DE62FDD86D8786651C9844A3 FLYER27
1,666,303,318 *AF557DA6A1C6324DBC55BC1904F26C6DA3933957 HAZELEYEDSWEETIE87
1,666,303,319 *AF598BF14A480BC64C463060FE4FE6B192E0F921 [email protected]
1,666,303,320 *AF5CAE3970A853487BF22001677A6F4C4FAB454F HEFINS
1,666,303,321 *AF5975ED1B06D832DA4957C6BCEE71F7BB9915E7 HEINNOP
1,666,303,322 *AF5E13EE0B14339805EE3A1A5BB5B78C032D2172 HENRY.WHITTEN
1,666,303,323 *AF5DA6A0D65BDB5FE66D5335FE9F513E18538CC4 frankiegillilan
1,666,303,324 *AF5B89AFD4316C2A59864F8AA6604C6354E892F0 herbpalmer
1,666,303,325 *AF5C6222FA21148D62D546113E9E86C1D58D84D3 freddieborrigo
1,666,303,326 *AF58A4F93D61524AF4B4174F8EA3546CED8689FE HERIBERTO.PITKA
1,666,303,327 *AF551C6BE4BEC37E30A28623714144410A205843 HERWICKSTEAUA123
1,666,303,328 *AF51414D87F12381406096C5B5D67F6CB805B84C HHFXAVQA78
1,666,303,329 *AF5A98C692DFE220BBF556CC4B51250EE3D5603F FREDERICKBELYOUSSIAN
1,666,303,330 *AF5F803AC8C868C2C289D39371F61CC42A5F1FAD FRISTILTE1
1,666,303,331 *AF597EB9BBADC469934072E1C6F1816EA3E9D292 [email protected]
1,666,303,332 *AF59F4161AA37B1ABF188DEB087F547E92E0FEB1 hiport.=.loport.=.0;
1,666,303,333 *AF5A7EBA25A06A3E87EE86121C5396A725DDC020 G1547852
1,666,303,334 *AF5431DB78508A576AAD113E4A3CECA7E6349329 g4^v
1,666,303,335 *AF57836F9C6AD474CE77824D6C460EE8DAF55FB4 hourgp
1,666,303,336 *AF59B5C09FB77E2835440C79DD012BDB7AFCBCAC galengadway
1,666,303,337 *AF51B5F99083AA8770B263DFF4A5C787AB74F5A4 [email protected]
1,666,303,338 *AF57FF03510E5F46F009BEB699B06CA81D77F3E4 garryharlston
1,666,303,339 *AF561EFF8293095B37A86BEAA3DAF88C7D1543AA garthwillett
1,666,303,340 *AF527B1D729683F5F442181F48280A6B5EBF2DD1 HTỦ
1,666,303,341 *AF5773328150AC52AFA9B911CEEE03610293F074 [email protected]
1,666,303,342 *AF5691AD779CC30FA82F4996454808C261BC8B3A g#c
1,666,303,343 *AF5C19F863DD2C80BFC31366DC87D7EBDB77F883 GERRARDSCOTT
1,666,303,344 *AF555D1B9E4CFE7CB28DE0F2578F0EFBA7330FD4 GEUNLEE
1,666,303,345 *AF5394A6EB822A554191C1B3E1F1A7D49C3F4F74 [email protected]
1,666,303,346 *AF53B8ECE0B48551831001EA29B4AEFAD46A1A9A glodavcem5
1,666,303,347 *AF59CF1A0E5643F74A6264E2013DAFBFB8ADB427 IAMHOLIDAY1990
1,666,303,348 *AF5CAD4291132E42F8012C89801119E492587736 GORDJUSHINA
1,666,303,349 *AF5BDE2FF4BF4431E2AE43DF5FBFCF7C2595247D GOTCHES
1,666,303,350 *AF50189A582774514E1684C0950547632EABF9C3 GREAT GO
1,666,303,351 *AF5126C3414B4AF2942E59312C576E2FA144D1C1 GRMOLIKO6
1,666,303,352 *AF53E75F05D7D21F153994EA42EF524A6F449CE6 GROOVYJENNIFER
1,666,303,353 *AF54D1EB705AE11F14AF504EFDEF1D4F71DA3DD7 GROVER.JAKSIC
1,666,303,354 *AF564F624D532285460012F4085E828EB4CCDB86 GUI_JF
1,666,303,355 *AF552C97E00213DE588F12C5E0090AC16BF659F1 [email protected]
1,666,303,356 *AF5252F00553A87364E74B8A04CE9C272EDD1A8A ilb>
1,666,303,357 *AF5E9D9D2AE9FEF3FC9283A7B9547CF29E7B781D ILOVECINDY186
1,666,303,358 *AF559935E33AABC995C8EC234B8FC114473E1CD4 [email protected]
1,666,303,359 *AF535871B38FC4CD4D96B35F114EC238B6F79529 h:3c
1,666,303,360 *AF58FAC87AA8C44074660B95250F922EF2B81930 iluvtemp10
1,666,303,361 *AF52166463AED716627079F6DD9A1660B9867F88 harleykhela
1,666,303,362 *AF51521FF02D044E662B76F079A7AFEF7F4D2CD0 HARMONIA
1,666,303,363 *AF5528CCAD3773A89A193A35190B5FE0731556F4 imponier6
1,666,303,364 *AF51026D6B3121271FB837AF1D165321FD6F73E7 incolpasse7
1,666,303,365 *AF575B03D903D7B5AE206B485D3A0C745836366A INGADOZÁSÁVAL
1,666,303,366 *AF5D1B4849B803982F0F2E116EEDE710E57E4EB1 IROPING
1,666,303,367 *AF5A710873BED94F2647B05D577E13EC48AEFC1D ISIAHHEVERLY
1,666,303,368 *AF5069736E47A76F5694E93AAB6F83EC9637B3C6 ISIAH.KUBIN
1,666,303,369 *AF505C71AC2CFC9FB44E2F05CC859A576ABA7771 ITALIANSONGWITHVARIATIONS
1,666,303,370 *AF5AE236B000388EAA250F46596598054C14139B IT'S THE L
1,666,303,371 *AF507715B9D98DA55DF55F8EC98DC535802089E9 HERIBERTO.ORAS
1,666,303,372 *AF5327B16B4F9F6F33D90135C1CE8326DDB8B6F5 HERIBERTO.SNELL
1,666,303,373 *AF591930C093F51D19AC899BE652DA012219DBC9 hermanson3
1,666,303,374 *AF505BBC2CE44AF2E85A8242E7DA0C276D9C6124 HEURISM3
1,666,303,375 *AF572E28B7106D428DDC0736FEC73FDA0EA98A77 JAIME.STOLINSKI
1,666,303,376 *AF53FC5365DC9473E90F373FCD5A181FB0DC6D49 jamaaljohannsen
1,666,303,377 *AF5182FC196E983A2DD2005497EE84F8AFB243BA JAME.KRSTIC
1,666,303,378 *AF51B17DED1F45A472CFDFB774BA4D263B915144 JASON.GATLEY
1,666,303,379 *AF5457DE6915851F74C81B988EE81CF49DAAA9AC HIRAMWELDING
1,666,303,380 *AF56308E89D07E0D9DEE6891CBA3927228CE150D HIRAMWHEELWRIGHT
1,666,303,381 *AF5ED3EBA97D2471269A1389BECB0B6B72957134 hizbeabu
1,666,303,382 *AF5BB4B7A94BCED6E46E35D102DFC87F52BCF83B JELENAZELJKOVIC
1,666,303,383 *AF5DB8DB27510468542DEAAA4EA7094E08C8B96D jeromylindsley
1,666,303,384 *AF5E891C36F88E2150D758593953BA6818321E39 Homoniem
1,666,303,385 *AF59D9BBA778C48135F2482446C4D049D37EB854 HOUJINYAN
1,666,303,386 *AF564CB30D0045767FF4DCB802AD74DAE126A657 house.4.kicks.(chuck.daniels.remix)
1,666,303,387 *AF55274E69F7DEB8AEA922406ADA50CAAE186319 howiath5
1,666,303,388 *AF59C1DEA21C8FB0F168B3D97C10E7942732823E HOYT.HUBACH
1,666,303,389 *AF538AE9B289FC6FE16DE09F4CF62DDA1B13800D JOAN.GUARNERI
1,666,303,390 *AF5DCC3A8E23C7D6801E33C7480850D41D0587D9 JOCABET2
1,666,303,391 *AF5043B6A2420942C4EFD02B0F149B60EC37E961 hulverhe6
1,666,303,392 *AF5EEC627B33E3A1BBAC93551F892FBE58376263 hungarian-dance-no.-17-in-f-sharp-minor,-woo-1:-andantino
1,666,303,393 *AF5361DE301FB1F495C680E23DBD90C28395CA7B JORDAN.EADE
1,666,303,394 *AF5B70CAE8A0AFA60BD343D248A69FB456E47D7E josecarco
1,666,303,395 *AF5558627C6B0792324AB501712DFC850392E3BF JOSHHAYTON
1,666,303,396 *AF5C42E5A9406970F36B9F580CEB7606C8D60805 jozette-moyer
1,666,303,397 *AF54E20459B92801437EDD3384A900DC0FB3FE20 JUBELPERSERS
1,666,303,398 *AF57CDEC3E76F5A570B54073FD6C85C1C0D465D1 julietsese
1,666,303,399 *AF5102B15750C42C74E446AD56CB4D7389850D2D juproxbustard
1,666,303,400 *AF57DF9AF8A1D66800BFADF4BB7A57EE191FE2BF KAIMAUK
1,666,303,401 *AF5084D103EAB655B60ED1286CE62090986C3B45 KASINO3RN
1,666,303,402 *AF5FFF18F30495DA167631C3A71EDB266E463B8A keephart6
1,666,303,403 *AF508C7DE0905B214CDE30C688BE6124B3A316A9 kei-ta
1,666,303,404 *AF549A5B939639365EE25ED79D724E010AA5B651 KELIINS4
1,666,303,405 *AF561D09A44FF37D8DBC4517E74FF65E7BC60AFD KENTONDERMOTT
1,666,303,406 *AF52365C62B70BA323B2A83C7219A0171905C641 kermitursua
1,666,303,407 *AF51B953DF9AE42623E784AA86593377CDB778E2 KIDEMAIL
1,666,303,408 *AF5C41C265E00714CE1C69DEFAF94659826E8975 kihonsei5
1,666,303,409 *AF55C7D20DDF0EC79054420E78F2B3AF09EC56DD IKE.ROSENKRANZ
1,666,303,410 *AF563E3A127F6332068C96B8C759CC1434C6CCB8 KOTRYBOLOV
1,666,303,411 *AF585F93090C7AE9FA68826C36E694AE6B512C33 k<qs
1,666,303,412 *AF5F736B2CCC736CD0B9C2BF6E416622E2641D3A ILOVEGIBSON2002
1,666,303,413 *AF5230095A00538AF2D51989BA084A9D7D6D7425 iluvqazwsx72
1,666,303,414 *AF5B1D4A8D7512FD3E1F0A848C16A81BA2C62D69 KXXXXXXX4
1,666,303,415 *AF5F33F67A71BB111820CC11A41D9585547A9AAA INDBANKESES
1,666,303,416 *AF5D1788783B6A1842761CA74CDD79324F93C750 [email protected]
1,666,303,417 *AF546D90997C733E241A4CEFC88FE9C3DD95AEF8 LAMIKA CUTTING
1,666,303,418 *AF5F2176E5F6FC4CB5DE491036C38B7905B08C29 LAMIPLENTY1234
1,666,303,419 *AF5F7FC88066BD3595EEAC6EE218592F1FFB62EB LANCEPOLLART
1,666,303,420 *AF52F96133432161E17F842435D8D6F509620EE8 industrieanlagenbau
1,666,303,421 *AF59702F0F853F65662E493D02A10257A87E5503 la-otra-playa
1,666,303,422 *AF53EB71B83CD98B3B193B7A6CB83C5FE63C2789 INGRESS2001
1,666,303,423 *AF5084D64B30BFF6ED8AB13F5924EF2ED3B0AC57 LBAGDOC
1,666,303,424 *AF51555B7C617FACA3C341B38432D97E05033EB6 [email protected]
1,666,303,425 *AF571F93BC161EEAEBEBB7EDA11ADBCABB67E3A4 ISAACKORSEN
1,666,303,426 *AF587E64E706D1BA63331872DCF65E806543A726 isertano6
1,666,303,427 *AF5AF40718CCAE8ED02855D66E2F254397128D5E itstwins05
1,666,303,428 *AF5BC98FD55818F4A25F2BED6BD3E86FBE33600B LEN.LUPARDUS
1,666,303,429 *AF573F3F1389CA17E975DFC771DD69E6EC4CE884 jackjanuary
1,666,303,430 *AF570139E65315C5B5B8DCC19034FFD74E9CB031 JACQUES.MAKA
1,666,303,431 *AF5971D95B4A663CF1D8D18CDE16C9F36BC1CE16 JAKEHANZLIK
1,666,303,432 *AF550917B7C5E45D9DE227D8CEBD3083858AC63D LE.SOLEIL.D'ITALIE.(REMIX)
1,666,303,433 *AF505E1B8441976809EF7F3FEDCF09266814D70F JARODWORDLAW
1,666,303,434 *AF522CE8EA79C160590949E4E44666E07AFBFD49 JARROD.RAFIDI
1,666,303,435 *AF5CF58B6C05D916DDE8354976AFDBF3A18EB092 JBOOMERED
1,666,303,436 *AF50CC074FAE8CDFD6CD750DDB67C7445C0AFAD9 LGK(
1,666,303,437 *AF5288B73F06D09F6176DE8CA9F311D1D961A5E5 LICO (
1,666,303,438 *AF539907B15E2FFC1D025533983C9B5FF48F413F liederop.107,nr.3:derg
1,666,303,439 *AF53040654D5F17D19086CE201EE77319ADFAACE JESSGLADDEN
1,666,303,440 *AF5EDDB8805717BDA7368C41803E14B418826E1C JEWELL.BULAND
1,666,303,441 *AF5D6C3A3E8B5AF625FC1583579E239D95137649 jfnolb3eox2z0zuhg3fxo3bxozq99csekqxisdbhncehzzpaglndpyyebw3
1,666,303,442 *AF53ECFE1DD96291580D448BD226921B207181F9 [email protected]
1,666,303,443 *AF54A8D33A7E294F210F4174987F1384F0EEAE61 LINCECUMTALKRAY
1,666,303,444 *AF5A57E0484A3AF3334EEBA43A1AC84A97151632 JLXY
1,666,303,445 *AF5FA662E9BC68C56FD9A050BC423BF02C4BDC00 lionellavander
1,666,303,446 *AF54E5CCA81DF49DFAEE3799B3949B065CB8F773 JODY.BORREGGINE
1,666,303,447 *AF5D37BCD0A8354B74E268F1BB307402DBAA760A LITSA.IOANNOU
1,666,303,448 *AF5CA91E80D5F24297E1CD0F05B603D6044D4F70 JOLENEERDMAN
1,666,303,449 *AF5CA0052911901D098BEFA06379937E4A1CFCEC [email protected]
1,666,303,450 *AF5D839B778FEB8A18269AE6A579EAEA5B97B710 joshuamajkut
1,666,303,451 *AF58A8154A52D867594BBE9A70060FDA5F280D70 JOSIAH.BEEMON
1,666,303,452 *AF5CA3B20615F4AF38C4583F06637FBFE1F657B0 JOYNERKERSEY
1,666,303,453 *AF5683F68069529C9C45140C7ED04188609C0018 JULES.HILYARD
1,666,303,454 *AF54CD8760CEA3F7D403BE33B988813868D5AFB6 juleslycan
1,666,303,455 *AF508CEC4FAEEE096962B05488A10AB0705E5637 lostyourfaith
1,666,303,456 *AF560CA72906495FCBEB4602C0B54F2811C4DE96 LOVELYDOVEY(FEATOTISREDDING)
1,666,303,457 *AF58EC4998279A0CA0FCD143F7367F05CF0B5B23 )"K
1,666,303,458 *AF58F5B78699C165FBE801CB094E93FEA46DB4C4 kaimoube4
1,666,303,459 *AF5ACF7DC34AE71555B619A4647790943AA1F41B KALJAVOGS
1,666,303,460 *AF5F35255F38BF98C9482210AEDCF6009C739460 luigimartorello
1,666,303,461 *AF55AAFADA3B9BE17B5DA0FC16F752C2A59DCFC9 KANEIN
1,666,303,462 *AF5D33ABDC0E78D2B26A6BF34289BA420B43B85D LUSIANA-SERU
1,666,303,463 *AF58972FC7FB2D2B4864457193BC5A5BDFAEE6BA LUTE
1,666,303,464 *AF5AE7CAB762B5EC38716A80308F2D66CC4E5E79 KAYLAROBOTECH
1,666,303,465 *AF51D3E50BB1E0D1EB4136375B0DC46235B6548F M0R31L45
1,666,303,466 *AF55E16DB0EC85EAADBC506EA5D5AF93C9E65D08 M21'
1,666,303,467 *AF53E4DF52E6DC02781DCF5824F9A50A0E16D081 KEENANCAVALIERE
1,666,303,468 *AF5A67E755F13EB43B25BBA364132146C2D94E93 KEENANEFURD
1,666,303,469 *AF5159EAD5A2F6D55C4375141DD35D24A3039314 M4I/
1,666,303,470 *AF5C41DF025DEDB0D94DFB671656F38F7E91FB2F M7KE
1,666,303,471 *AF5C244E5A1B2A233DC69A6FB4C15E0B7CC162DD kenan_oztu[email protected]
1,666,303,472 *AF528F9F9E3D33D3A5CE0742F64D47E56F5A1E40 [email protected]
1,666,303,473 *AF5BA805524A3BB19A9ADDE08D15C8FD5AF7067D KENDRICKLOOMAN
1,666,303,474 *AF56CCB4DAF9E5572633E420E8C57995276D88A4 KENNITH.BRUNDAGE
1,666,303,475 *AF53FF553BC18E3DB9C1F3D33A5B459788FBBA06 MAGDAGKOT
1,666,303,476 *AF5971754956CB08E9C1C843BF3EF4F577A473BE MAIT10
1,666,303,477 *AF59D5B8659898DA0AC1A79C907E3FABB19C0689 MALUWENS0
1,666,303,478 *AF5E8B1794DB89F64DBCC680EC268962D748C327 kiethkontos
1,666,303,479 *AF5F4792B8BAA6FFEDAE63BBABEB5546BD6A002D KIETHPUFFER
1,666,303,480 *AF5084E54A212343765935B45ECE1F6F3475E993 manuelmachida
1,666,303,481 *AF51AA59B013C13020482DD2675080A673301055 MAOWHITNEYL
1,666,303,482 *AF56F29161E507853CF963A5E0DDC982235544AD kingofmycastle(beefinjectionmix)
1,666,303,483 *AF50845510C67D823A6334AE3CFB49B37560903A MARCO-SALA
1,666,303,484 *AF56EB2FD26E8BB575B26998528AC57F120DBA1E MARGARIC-ACID
1,666,303,485 *AF54CC164415947178ECDA43567EA9B75E3BBB35 MARIKAITIP
1,666,303,486 *AF5F3BE42ACB104C700F85B4E6CDF5C78812EC35 MARKFRISSELL
1,666,303,487 *AF58B691B17D21EE086A663FDED34152EA7259CA [email protected]
1,666,303,488 *AF5E8E9D81566FC3DA510DA41C083FBE56C4F554 [email protected]
1,666,303,489 *AF50690B73756B9BB2884F5804306255B1A9EBCD [email protected]
1,666,303,490 *AF53F1F9097741F9E2932903DB1B1CE933D608A0 MARTIN1BIRDIE
1,666,303,491 *AF57433700FF46426D8146C7BBCB67FE68020639 masters.of.the.roll.(disc.2)
1,666,303,492 *AF5C64F6D169D3FBEDE1D98FD14152A649A63BC6 [email protected]
1,666,303,493 *AF50AD6156210391A799BFF7215A959A93774CF7 max!6008
1,666,303,494 *AF51A5F865B48C30882A170D85F2EE5039F2F44F [email protected]
1,666,303,495 *AF5EB9F0A7A31BC0AC07E939C12E2B28C3BA9125 L136154
1,666,303,496 *AF591D9D06B550CA7A8CD361CE64FCFAEE920D5D L168320
1,666,303,497 *AF5F0DF2D060D0620E3D8F47B4153DB3CA7D5690 m$cb
1,666,303,498 *AF5ADE2B803088505DDA824C02CE31FC6AC8BA35 LAJUIVE:RACHEL,QUANDDUSEIGNEUR
1,666,303,499 *AF5D9FCD725B608E55D1A453C43067DA52E9463A [email protected]
1,666,303,500 *AF5A6ED2585A77561CFE7B52B175AFABCE23557B MEK.PEK
1,666,303,501 *AF503BFA6BC0142E775047689CAD80DF72C23E3E melfromme
1,666,303,502 *AF5002441277EE03AC5C990B6EAF294FC8B5CD85 MERDINLI
1,666,303,503 *AF53C1EEC1F60DC18B9003E316611BA3E751BD8B LARRY-BARBOUR
1,666,303,504 *AF56A7EF29C2B698AA4D47381D6632CB75D2CAAB laryngopharyngeal8
1,666,303,505 *AF55520E74945BBF8EB01A5E7E0D9E1596014CEC LAZAFER2
1,666,303,506 *AF5020ED4CBE0008E1F8C9670000F9BF3C7EB66C [email protected]
1,666,303,507 *AF5C622327FDAB6C7658152EAEEA3B92ABE40AC4 [email protected]
1,666,303,508 *AF5A0B9E5D0F39219B5FED65758F669D09CBB5C5 MIEHISTÖTEHTÄVISSÄ
1,666,303,509 *AF51292CA21787B48DFAA9995840732F04570E0F mikelplumley
1,666,303,510 *AF589645833D70778C967CF2FA6169B13349F2D6 [email protected]
1,666,303,511 *AF5BD5ED577DB93F4D0176E7D1FE64E28837530D LEIVYN
1,666,303,512 *AF539E5EA8A56E768FDAFC810473527D00FD62D3 LEMONDÁSBAN
1,666,303,513 *AF5181442EC8EA33B79A4B08D19D1F59713A38D4 milk-(d-mix)
1,666,303,514 *AF53D2D57BAF01CFF3F09DBA871386DF89C832F2 millardpichardo
1,666,303,515 *AF54751FDE27555AE7E487D52CEFDEF7E899D526 MINERALMINING
1,666,303,516 *AF589724DA1B4B670D9482272B96316AE69B7FEC LESLEYHILBY
1,666,303,517 *AF5E343AE5F7941B17B548F879DC92D2F1C18B49 MISS-THIS
1,666,303,518 *AF514AF519FFE5F13D40EA4AF9441CC0C3CDFA81 MOBILE PHONE TAGGING
1,666,303,519 *AF558D0C8AFAE7800842614E21C6120F3D7C4322 likeinamovie
1,666,303,520 *AF5785E2A73E2046731C4DA75583208062F00E5B LJIMGJPG
1,666,303,521 *AF5002FB3A1801415FD21CF523FE0F333C1E77A1 MTARROGG
1,666,303,522 *AF5330CF23156D58DD51D0D319323BFB66E853F8 L/-L
1,666,303,523 *AF5C5A5919D53854AA7B5768EA72EA127A149769 lloydsteller
1,666,303,524 *AF5E7E14F3B110D972CE47E6C351E5F7FDDB0FA6 MUL7IMILLION4IRE5
1,666,303,525 *AF57206646E48FC72A110B5B11D458E462B38DEF MUNICHS3
1,666,303,526 *AF5EE5A428EC57D603756481EC4A833BC4C46856 LOGAN.MAONTESANO
1,666,303,527 *AF5F10F2FBF3EF9DB93B41BABA95B7C4E7D0843E MUSICWAPSTEAUA123
1,666,303,528 *AF57817430DD17D0D066D4C618770ACFF2CD0D4F [email protected]
1,666,303,529 *AF501742E6F338D083EE5063DF74DDC0D58F5385 loginfailed
1,666,303,530 *AF5D46CB3146A9E10A837645F5C3A3BA1920298A myrador4
1,666,303,531 *AF571DB6CC331B0A010405B16A21FA39ED18FCF9 LOVEDTODEATH
1,666,303,532 *AF538E0FF6FA432D33E7087B39894F125277971F [email protected]
1,666,303,533 *AF5DCBFF2681BAE038FE45037B11E3209E40F753 l-quisqualic
1,666,303,534 *AF5D00D45531634EA03E6DA44B24682FC8081C3D lucifersbride
1,666,303,535 *AF537C7D72EB7078182D353D3493200E2AC9CCFB NEBORÎ
1,666,303,536 *AF541EF134154BE650D64DB113236874B854E235 lu)p
1,666,303,537 *AF590E335B9259A2C603B41E9A568C1F67991EF4 MAHENGDAO
1,666,303,538 *AF568DD2AA63226548C0798438184C4CB7CFE5B1 maigrelet
1,666,303,539 *AF51ECFCB5D128703436CA198D274BD71EED948E malcolm17
1,666,303,540 *AF5CBE095B701416AB0398E145B449A39C98E3B2 NMA?
1,666,303,541 *AF5058ED906362406C8C7CAA3C9892DE2078E466 NMUODON0
1,666,303,542 *AF5A409D0B599F2C3D611BD3825EB0D23DA3194D [email protected]
1,666,303,543 *AF5DDA0F325CBF77287209DA4A3991DF88534EA5 manualszwaja
1,666,303,544 *AF5A88B4A598E8C4E242E0C24B9B4FF4748E25AA NODORIP
1,666,303,545 *AF54BCEE82C4CD0912AD191DFBE562BC68CC9FE0 march! march! ettrick and teviotdale
1,666,303,546 *AF5B13A577167EDAB92162D36AF1A42E430A9192 MARCUS.MALADY
1,666,303,547 *AF54E372F61A0B98CC1740F7072388D9E3BAC61B [email protected]
1,666,303,548 *AF5D910A225567E25CF6589F140EC0FE4C4E3E2B nonpulstile
1,666,303,549 *AF564141BDB63E0205683A7194C1F4D683C0FEDC No.son.palabritas
1,666,303,550 *AF502D8B9F22C600CDBF90F69C5371DDEF315E68 NOTCHWORT8
1,666,303,551 *AF500E390E03DBFE18B4C97FBD2145AAC0DEC11D NUMERABLE.
1,666,303,552 *AF5878857CBCE221DE246E3E55D30742ED60D428 MAURANE3
1,666,303,553 *AF5391DF5AD7291A50B78BE8BA90729F66EDEBCE OCDATRA1
1,666,303,554 *AF5F7A9364866DB973F68237B65FA1929484FB12 MAZAR1
1,666,303,555 *AF57E22FB1334205AADF141E71E6AD06DF864BEA MCFERRENS
1,666,303,556 *AF5AB69332488F29079EA243AB9C7940E5D7BD91 Oh-No
1,666,303,557 *AF5C233959BE65CFF356A08DF4B5E873579CC758 medmen
1,666,303,558 *AF5BB05A0AC0BF744C1E9EAC2CA01D8AD9CE9BAC MELANCOLISENT
1,666,303,559 *AF5B4EB0991F1D76D1928290D0B3E0444893EEEF MEL GRAYSON
1,666,303,560 *AF5F703D69985B4D671467BAAA6B57357F9C58B1 omerdiec
1,666,303,561 *AF5CAC8720CAB863471626EC564FDC3A40D932FB omrissene
1,666,303,562 *AF532948DB10D0BD57C2CC4C5D3B6CE6C12DB163 MERLE.JENQUIN
1,666,303,563 *AF5DBEB45841633D81D3B768BED8A36DBE1BBBD7 merlevajgrt
1,666,303,564 *AF549E191FA4CE220E9B8F40BDB0F6112211E009 MERRILLBLUDWORTH
1,666,303,565 *AF5DB0EDE847322FFAE94531847C9E0106B480CA MERVIN.WIATR
1,666,303,566 *AF5E86B99D2BFE5188EA74D34E98A137277C58D4 me-s'envole-(radio-edit)
1,666,303,567 *AF5A104E802D4C701B5FD8323F620B38F90ABC35 ootow
1,666,303,568 *AF5DA8A5617ABA5C3EA4AC84D777E1D659F288C3 (><) O~ (p
1,666,303,569 *AF5C9316756AF581C4EDF71747A5A5C1795DD30F mohamedrupke
1,666,303,570 *AF5ADDBF4779CE49570A4023CC2DD54D6F3604C1 MOISES.EZERNACK
1,666,303,571 *AF5F1FBD1880E587E08D85F0D4A7CCEE7CEA8BDF MOKAYODE123
1,666,303,572 *AF5DB583B0C4B105CC244863863DF1245F46F9F0 Monkey-(Bruce-Lee-vs.-Monkey-mix)
1,666,303,573 *AF53A0503E40E44F500F36630D4247FA9B14CC43 PATINABAIS
1,666,303,574 *AF55D789CC1618DA034BB7BBBBCB2A16FE710727 patrickriehl
1,666,303,575 *AF5F2F4FDF2E84E5BA4225B89AF716EF8F665D9A [email protected]
1,666,303,576 *AF5FB6DE774C1F4098DC8355101DF44B2F934F13 mpqttrzed
1,666,303,577 *AF5B1E46266832FFC2349A89C13C13F302DA5D0C P#D~-`-{X}
1,666,303,578 *AF5B40B3550A340F80EE3B57FE68D1E7AC37EAC9 murraygramlich
1,666,303,579 *AF54AA84D91195C7B5B3E9AB290AD17EF34189D7 MUSIC.IS.MY.ONLY.FRIEND
1,666,303,580 *AF5C94845886A6F163B4E1F3440B03968019A162 MVERNEER
1,666,303,581 *AF525BE1FE3DD7D4F6E3A9D4DDF4FAE29D6C42E9 PETERMOGG
1,666,303,582 *AF5E49389373268F2AD321ED5E3E59490DEF5A64 pianotriono3incminor,op1no3iv
1,666,303,583 *AF5C005DBB35B297BF6C0027B930F3285CEE5807 NANCY.ORAM
1,666,303,584 *AF5A27FD42F099EC64C573E08BA15D7140A67316 nao12345
1,666,303,585 *AF59EBACED70BB18FA2EF408AE5E12D9EAE89779 PLEASEATTEMPTAGAIN
1,666,303,586 *AF5D84107338D664E37D6C5E9A70A35EA9F005A4 ndrlssrs7
1,666,303,587 *AF51DD6B6F755B3CE5BA09F9247F4F367EC95BF0 POUVANTE,(MICA
1,666,303,588 *AF59283F58A2F84FF004F0BC0A303C261F322012 P====P `~ )O(
1,666,303,589 *AF578CD5BE91CFBC52A5A76419A3F031B0653756 PRINCE.BUZIK
1,666,303,590 *AF5E725C1B353F37310CEA28AB611597370C51CA [email protected]
1,666,303,591 *AF5496632DB123EFE0D2277CB506C9FEF92F28B1 nicky010
1,666,303,592 *AF592272B6FDEB15D56FBF5FD25A3EF84D06DADA NICQUEUXEYMERY
1,666,303,593 *AF52D6B714C9ABD77EB43E9DEBC4C8D819FE5217 NLCMNTS9
1,666,303,594 *AF50185D050CD4884408F71113D9BC8AA928176A quartettsatzc-molld703/allegroassai
1,666,303,595 *AF50B6CD5FF41C721C13F62888C9DA25F285E977 R3CO9NZAB13
1,666,303,596 *AF51670AA55E191AFB4D502D36AE1A2B9A819461 ODELL.CANIZALES
1,666,303,597 *AF52B33A8BE590BE1E2C02F58D2C010178E59C0A Ods
1,666,303,598 *AF559E808E2E37437C43FC97CD0BA23B2EE509FE randycaillier
1,666,303,599 *AF5FA6FF4271633A5978289391AA63D6DE3619AE RANDY F
1,666,303,600 *AF5C5D692AF912C62F707130E9AEE9973D4952AD RAYAN168
1,666,303,601 *AF5BFB957DB77ECC64CFAD5C5CB9A86FCBA566C1 ONESOI
1,666,303,602 *AF58B186CE6476C7165DAEEA328FFED80450AAED reallivething(disc1)
1,666,303,603 *AF5E7BDDF7B167E153BC8D876F217759C00ADA87 REDUCEABLING
1,666,303,604 *AF57CFB72B8780FAB1308FB545320CCC7A585A3E OTVARANJIMA
1,666,303,605 *AF5771681B39C95EA299E9CE33C601A0167DAA07 rel'oye1.pr
1,666,303,606 *AF5D9F8B2F5B6C7FE22E6C1F3F68AC4EB0B8F5CD representarem
1,666,303,607 *AF56F8EAEDB4C9FFC1D042EB5914C949A4CA5B00 PAHONGKA123
1,666,303,608 *AF5F9746F52C86E4B64809E31E060EABEC874276 RE-WRITESHUTOUT
1,666,303,609 *AF557E25CD8B38BB557CEA97F4EBF49B3082BEB6 pamayot
1,666,303,610 *AF5D39C15DF4B1D1E850E3267DDC6EBA324C962E RICHEURS8
1,666,303,611 *AF5A0476A029CFEBDB669F9F540F788BB78022B0 RICHIEZUKERMAN
1,666,303,612 *AF5DD07CB8599BC29AFA1B42EE3D62286981E607 RICHONE
1,666,303,613 *AF5295D78FD34CA336DB7B538BFE3341637F9060 RIGOBERTOGALLOWAY
1,666,303,614 *AF5675ED5B39D61FF34D3F93F7CEDD6E3C556B51 paul.vann
1,666,303,615 *AF574B121D4BE8A9EE3B6F446024CB843D5923F4 p======d ~0(o_-)
1,666,303,616 *AF5456849C8FDD04FF7C8E9087CA15BAC3C82935 ROCCOCADICE
1,666,303,617 *AF54B110284C29FB044ED4587F2943503A3BFC77 PELKMER1
1,666,303,618 *AF57F339DA1561B7338B001C9672150B9F5BEB46 ROENYJ
1,666,303,619 *AF540933ADB6C1BCF8FB816B9976519DC09B4C88 PESTPEST6
1,666,303,620 *AF551D0BD12108795F254AA549B2EE23F47952C7 ROLANDO.THEUS
1,666,303,621 *AF566CD15B39B4C8816BCFF4D0887A8D68062909 ROLFFUJIWARA
1,666,303,622 *AF5A2FF83B9DFBFDFA56907FEC5CD4875A1B69E9 romanhowryla
1,666,303,623 *AF5BE3148AE8290160C0F2801B17D6ED1223166F PHATBOYUC1
1,666,303,624 *AF54B9BD7A68C385D0F7E6A219BD0BFF23E3F9B2 PHILIPAFFOLTER
1,666,303,625 *AF5E4451948BD9C18CC452077AE2F3473C0A140D ROSCOE.BOWLAN
1,666,303,626 *AF57844D851647B23A3E37A79F77E731AA1F1CC7 pienipiim
1,666,303,627 *AF50A3E15C28FDD29E03E97F0A3B42F98E72B98C PINSTRIPE.N:.PINSTRIPES
1,666,303,628 *AF559B4ADC16058AA86CD7212E54837C15645E49 [email protected]
1,666,303,629 *AF5E109F5580FE92C7142BAB51B6F67D6B7BD64B RUBEN MARCOS
1,666,303,630 *AF534DA648426D43776E82B6927160ADAAF0CF43 RUBROLINEATUS
1,666,303,631 *AF58F66F9C075592001339A986065AE73DA777F3 pointe-blank
1,666,303,632 *AF591BA3D154A54E9133E9977EEDBEB400619494 rustless1
1,666,303,633 *AF5A8210FE0CDB48FE00F1BA703024CA196201F1 :PO~.O~<###3
1,666,303,634 *AF51C46F2211ADD9B19576E40E8F1394756400A1 POSTORDE
1,666,303,635 *AF5CA8E53688FD0E886B40682595F8F3C8E4C61C [email protected]
1,666,303,636 *AF5EBE5F94E490F2DFD553BE1A1D9AA20C9BB03A proprofit3
1,666,303,637 *AF56B8FB0E08E6026AFC158273694A90ADAB1494 S9201551C
1,666,303,638 *AF5B6A75E3A7E70C81B497051C66F66D02353457 PURGATOS1
1,666,303,639 *AF5C2DAC8DFBAA018F82BE434AE2CBAD36921C1E SALVADORBARSKI
1,666,303,640 *AF58A96DE250659CEED524B8A69A47F12768D726 samenvoegden4
1,666,303,641 *AF5F89D0AC8F23CBFF8969BE7E904666E78B8346 SAMMIEGOLD8
1,666,303,642 *AF5C60C8C25502287A98F36B2268F7B0719B6906 SANDRA-CULPEPPER
1,666,303,643 *AF5BDD473B6D45EB399802FBB9951EF346CE7D0D [email protected]
1,666,303,644 *AF5D4272844EE0724C5FA7E977015AE5E962DF6E santiagoafoa
1,666,303,645 *AF5F1DB45FA9990CFCCC1CA0EED9A43AAC3B5202 q##>~o(o_-)
1,666,303,646 *AF544BB2A9B8E75C914F37801023F166C97E8EA6 [email protected]
1,666,303,647 *AF59C612BB39D725F16245EE4024C96A7134D9CB qzt]
1,666,303,648 *AF5576CDCDD5450CEAC7A6A3D4D43C959E3B663E RAMON.RAUTENSTRAUCH
1,666,303,649 *AF59DFE25EA38AC2E50B74E03F0D0810538FBF9D scrollflat
1,666,303,650 *AF5A0B28B12C987E9B9CEA4156489EA136CC5846 RASHALEENDAR
1,666,303,651 *AF5E4152B5EBB371E4E9BCCB0F834FC05553A167 RASHEDUJJAMAN
1,666,303,652 *AF543AE0F5071B02E2958F0A58391630D4CA8F1D RATTORTE3
1,666,303,653 *AF502D6E239617A086311BCC113DFFE7ADC6A3B7 REEDESQUERRA
1,666,303,654 *AF56BCFA19F64C02B6960AE59F3951948B5A0D37 REEDHOLLOWELL
1,666,303,655 *AF58E1158C03F5EF2DEA9715083E9E38A4C2C423 REHORIĆ
1,666,303,656 *AF54893FB02B92BF2FE9E1BAD61EC8E9A8CEA67D senotsdaol
1,666,303,657 *AF5B631A85A19B40FBFB13133170C6BDD73D3ACC SERRIUQS
1,666,303,658 *AF5A9F8DB87AFB4C742FCC51D9D503280C641696 renfor
1,666,303,659 *AF57DC5AE7D75F9EE18B346D31369F092C0C6F3F RESWELLING
1,666,303,660 *AF56835DDC5401902C599BA43B230829427ABD1E SEYSYDE4
1,666,303,661 *AF5F9DD3730D225167FE77EA698D22E8C898E036 SGNIKIVKCODDAM
1,666,303,662 *AF5874207882362F5BD1DD07B135E98AAF321BF6 REVIRREMAERD
1,666,303,663 *AF54EA66F8021CEC40AC1381FB9046A4904A71C7 SHANE.LEASURE
1,666,303,664 *AF57C2DD2DC70543B82B091CC401A407EC1F16C7 SHELBY567
1,666,303,665 *AF5CA276EC566BB2A5E573BB1154644C19C8F31A SHELLY-SIMPSON
1,666,303,666 *AF5E774690C47A078F0402C35D457C6AA0968BCA RICKIE.KEEFE
1,666,303,667 *AF530EEF8BD0BA236F8C0A4288F8959AE403E499 rifermava
1,666,303,668 *AF5EC552E9F21BF6927B58D0060C00EBFE02E03F shij
1,666,303,669 *AF5A14535E19DB73A95FF220D1BA905EDAE93DCA SIIRTOLI0
1,666,303,670 *AF593EA1ADBEF1A46C3F89161786BEAC7519EF70 ROBINTEDDY3
1,666,303,671 *AF56A0721C75AA469C7870A8CF1BA4DD61CEDA3A SIMILORED9
1,666,303,672 *AF5E65AE6FAFABDCC8BBC6A4A24D2124A8F52514 ROCKYLINARES
1,666,303,673 *AF59F4F2E0804EDDE0F502779DFD0B7ADCB02D63 RODOLFO.PASWATERS
1,666,303,674 *AF5735D7F66849C03C47D57908A93978CC583485 ROMETM780
1,666,303,675 *AF5DE353460BA754327EE177A132E8AF86660B5C slipknot 'sl/i/p,n/a/t
1,666,303,676 *AF5041C4D9EA7C3250FBF23410844B7DA4C49027 SMEDHOLMEN
1,666,303,677 *AF5340F6B37B51A29ED29A3C36712882E4B0020B royalengels
1,666,303,678 *AF5245C90DC76D60ACF34618FCCA361EEE2B6C29 ROZBR
1,666,303,679 *AF57693AF20C14B962744BA9C24698637CE644B9 somethingaboutyou(featsarahbettens)
1,666,303,680 *AF5A55C033AF83A97948054C04B0B65ED78E155C RUXBULLED
1,666,303,681 *AF5E097DE9542F092A140A3D2F649F798B04A03D rvrshfdmn
1,666,303,682 *AF5A1D5776203DE1012D6AB890AEBA7DA66DE6D1 ‘SOVEREIGNTY
1,666,303,683 *AF5A25318240A8FE78AFBF4A2F22C4E6BFACFE01 SA
1,666,303,684 *AF59097CFDF721B4254830D499FCBF8E2E880417 [email protected]
1,666,303,685 *AF5F5E1E720AA2A9608409A2FA23FCBE61F36F92 SALMA737
1,666,303,686 *AF59BD1EA6283F8755D9EA4DEFC7F2271EC05594 SASSYABSOLUT3
1,666,303,687 *AF581D4BC5B039E1D16E81C6CD3AD09BA70677DB saumures?
1,666,303,688 *AF536B548D5F1C2D5CD636EC4D257ADA8A45AEF8 STACYBUKRIM
1,666,303,689 *AF5C087A4CD33D74FD9E71D448FBC75E09A6736B STALBANSTOWN
1,666,303,690 *AF5E0EB6EDA87FF3882BB0DC008210FFED502965 steekwapen0
1,666,303,691 *AF5D19780BAE8D366A629E8A0642C1C24A4B3CBA STEPHSMILED
1,666,303,692 *AF54D7A7DFEC3CC6C12DBA3C762FA72D6BD1A6A7 scott-forman
1,666,303,693 *AF56A5AC3381E4D78003C4F15C31A2E44FBDAEB4 se2k
1,666,303,694 *AF523C5A51C204894A6DB96179D5232BA1B1DA2F SEMI-NEUROTIC
1,666,303,695 *AF5D66256E9FC5BECD4FDB85554A4FB84293CD4B setsigoloir
1,666,303,696 *AF51FACEBC3F2FABA783F7535008F4BE7E4D9504 SUN.PUKAI
1,666,303,697 *AF54DAEBB811346952CE26023423D3D2352C6498 sharif-mulla
1,666,303,698 *AF567734002529CFE97E4FA68A608E88F5051A56 sharon.grande
1,666,303,699 *AF58B16825841CAC71B5D9480BDCD21E09A9ECF5 suor omicidi seq. 4
1,666,303,700 *AF5F789198E5A0127BA0F6789BE49E5028DF5ACA suppsed8
1,666,303,701 *AF58653C8DE08FF468681AE3E41F7EE3334465DF susan-sajadi
1,666,303,702 *AF579FC084046AB962CB2A2BE37F73D8EFEC6A2C she's-a-satanist
1,666,303,703 *AF5FF78C68E0E4FAA817D995A58645B67DF1443F SHOESCHAMPION2
1,666,303,704 *AF545EE9E42D5865CAA40C51A1EEBCDFC5CE41F3 SHONAUGUSTAVE
1,666,303,705 *AF5728C11D7A35D9BC3FA85946EE0108E7957787 SYCOMASYCOMA
1,666,303,706 *AF50B4EE8B47E07BDF840C76392085E53F6404FF SIARANPOD
1,666,303,707 *AF55D969A562E3FB5CC4F115ABCE4594BD3986FF Syphony-No.-3,-op.-90-/-Allegro-con-brio
1,666,303,708 *AF5816574EFD77433496BE1B3FC5F2A2C6193D90 SILAS.TOLLMAN
1,666,303,709 *AF53B886C6C1F736A8D3A987A93BA0D14F9EE908 [email protected]
1,666,303,710 *AF54CA5C86CC946CE6AF9C57F595BC726C62970D sisterhoodpic
1,666,303,711 *AF5B7CFF2488737680D29258AE97AB3CB5608A5D T4NY4M0RR15M1TH
1,666,303,712 *AF57F6FD2D24F52986EB9B88535D4C176B102BE9 T4US4GHY
1,666,303,713 *AF538BF66401EFDA2E9F3F97E14957E786546DD9 tablas.de.snowboard
1,666,303,714 *AF570200F4EF737E80D9FDB09D433B81A7761B29 SLIPINTOSOMETHING(FEATBENANDJASON)
1,666,303,715 *AF518C604824D6942327CB9A3C3A5D1B2BE7D3F3 talk881041733
1,666,303,716 *AF5ADF9BF0CC2D11BCDC5697F573A4DD5BB906C1 TALKKRKI
1,666,303,717 *AF5DE5FC97C372F29A8EBCA306590DC3F842F7B4 SMOORKUIED
1,666,303,718 *AF5AA6DD9DCEC082A3C99E150989A8750A689E52 [email protected]
1,666,303,719 *AF5CA3F20C7C2D14F95DF388635167774475BA22 SNOREHCORC2
1,666,303,720 *AF58D538C298D40011578AA9236AE1EFBD5E1C33 SOGGIORNEREBBERO5
1,666,303,721 *AF5DF6340877A74238DDD99838AB00BE5A0C23B3 soloerfolgs
1,666,303,722 *AF506C891033C529A1F6A588E76FC4EC0E46A47A TEODORO.NIXION
1,666,303,723 *AF53EBBB00CD510D4C2212CA43DCE8A0120321FD sonny243
1,666,303,724 *AF50EA5D6950FBC7A8176898885437D82318467F SONNY.DETTRA
1,666,303,725 *AF5CBBDC1692734EE5E912719B270784980EA439 TERGIVERSER9
1,666,303,726 *AF5F75656B2AE74AFC7B0EA32E82D9CA3AD0A6C4 THEBAREFOOTBRIDE
1,666,303,727 *AF53C4B9E2630E8A3FB1C92BE722D004ADB146C1 THECYRANO40
1,666,303,728 *AF50A4B1983391093121CB68F843D0BF9409F659 [email protected]
1,666,303,729 *AF5757C9A4FB13211600D0A2F6AA0DB2F5751E9F thenoted9
1,666,303,730 *AF539E76A7CEA1FB880CCE8DD58F218D66EB5E6C stacybralley
1,666,303,731 *AF5B0AFA26186BCE430458B616D546E6951CF7FC STANFORD.PIROG
1,666,303,732 *AF5A19827D023B77A50C95C638C61139303CBCCC THE STEPPIN' SHOW
1,666,303,733 *AF590AEA15012581F65D33F4F04709EDD80E5FC8 thomasosman
1,666,303,734 *AF5F02876001CB53FCB0066F54CF7D53251A0646 STELLA-POULOS
1,666,303,735 *AF598DAD06F56D838698DE277C29B628421AB872 STEPHANEGUICHARD
1,666,303,736 *AF554DD15BE1D3826FED044F1392E231F49E65A5 THURMANCARNALL
1,666,303,737 *AF5BA03A5C0B17B18246743791271EC8D4962F61 STEVEPALMISANO
1,666,303,738 *AF55D39B271DD00FFDD3DB93B040A145A53CB125 STRAHLTET6
1,666,303,739 *AF5033F682063A046A458B68789AF47932AE7181 tinadodger
1,666,303,740 *AF574B0EF7E4043377FE4BA9E694401A7C0C3756 [email protected]
1,666,303,741 *AF5E578D100213AEF35C5ACD9D5D2D337D6CA0D6 tm3s4vng
1,666,303,742 *AF5CD7ED2D9AE70EFE2C8B38C2D22494125F9658 student-master
1,666,303,743 *AF5E23447774DD617E53A08271B0B67EBF9BF25C TO EMBODY
1,666,303,744 *AF5648909C7682DB4A1F44978C13E769C52C90B0 SUES8289
1,666,303,745 *AF524D649EED6558DD188B64ADF0BF6E5B8F47EF sul'pontdemorlaix
1,666,303,746 *AF5D403CA21FBCC7E8E25414498483DF754DE30C [email protected]
1,666,303,747 *AF509E5898BF4637B6F8975FB488E362229C9429 sundayjack
1,666,303,748 *AF5460BDC4ABF84D629EDCB277AAEDC2D14B657A SUNG.EITNIEAR
1,666,303,749 *AF58EBF4D493571BF9C0493B7BFE6F4766DF02E8 SUN-WISE
1,666,303,750 *AF562DCAC1047FC6F5D55FC95EBECC17A9BE074C surfbrat2210
1,666,303,751 *AF59D988534DABC3E4FE670B6B01263A626E464B TREIRIPSNIED
1,666,303,752 *AF5F99FD5EEB4C0A68D49F24A5126EC07DB67A9B SUUDAAN
1,666,303,753 *AF5EB3AA5AE629A31FE91302A97AEDF872072FD8 SUZANNE.OHANLON
1,666,303,754 *AF567C57995D3769F4E7931B29D2C2D4C325663F TRINITYCOFFEEHOUSE
1,666,303,755 *AF5A13C57348258A39610654C4C0CFA70C98D1E2 TAIKOGAMES
1,666,303,756 *AF5CD1D6D4A86A225C852FF9DBD0562DD6BECB49 TRI-WARDININGSIH
1,666,303,757 *AF5A2F2E58453D9D9232C72B0DD3217026710A8F talk864298150
1,666,303,758 *AF5A4756DD35A837EDA8EE1BB4E3EF35B2982E19 tsukuby3
1,666,303,759 *AF5D1A1CE9EA72C2542E1B45FFBB6D9074B07A07 TANYASCHALK
1,666,303,760 *AF576305400AE65044DB13989DAD3B4CAA9FBF9C tuesday's.child
1,666,303,761 *AF529CAD6091D5015E01A2BF8E3272836B13F6FC turotuulen
1,666,303,762 *AF5357C00789726AEEB1798132AC32E5120EB95A tymazanec
1,666,303,763 *AF592B2B6BEECA4EAF118C5C423C95AB7199C1E5 TEMPLOS TEBANOS
1,666,303,764 *AF55553B28BBEC17EBBDDBB94EF6CAE7783C8F3C tzionamelman
1,666,303,765 *AF514E27F392917B9547CF4C0FDFF6832A20208C u0em
1,666,303,766 *AF5FA63E3380E63FE8E79B1EA3676A9A07487F56 TERZIARI9
1,666,303,767 *AF5183D0C2877DFB016D9434409368D2CC691779 [email protected]
1,666,303,768 *AF533BE8105BF300FCFB66438325D429A2472FA0 uicchipìdia
1,666,303,769 *AF5515AF77D5ADDEAC8082F52E78B72BB422B752 THALAMI
1,666,303,770 *AF51EDE76EC91036F1042970C2773351C5C9F37C THANH.PLAGGE
1,666,303,771 *AF55F0F2D005792E0F6192B50951EC93BF214534 thatlynn12
1,666,303,772 *AF52675A285AA9225862A179BD96525CE582731D thcildroob
1,666,303,773 *AF5EC94F576640247899D89FA07EB19EB8B5D98D thebestinme(b)
1,666,303,774 *AF5BCB950F5311B28D2772C3803336D7727D4F67 THESALLY10
1,666,303,775 *AF53EA80FBE639AD4290D3FDC4EDDBCB36051CD3 /usr/lib/grub/i386pc/font.mod
1,666,303,776 *AF596C4EE7A2573A4598751940481E6ECF895E43 ticker
1,666,303,777 *AF58C1B3FC8AC8A28419C89C903E36869B07E1C8 TIK,TAK
1,666,303,778 *AF5589459E570A82182AA5B74BE6FC60D28B8347 vasifli
1,666,303,779 *AF582DDF43C7AE7203C3DEFEDC789D4BD5391A43 vcfabrochure
1,666,303,780 *AF538B0114268E219012C954A20EE825DC3349E3 TOBY.STINEBAUGH
1,666,303,781 *AF58648033FD519981E5FF9D56DC134D9D3CB2BE TOCCATA,-ADAGIO-&-FUGUE-IN-C-MAJOR,-BWV-564:-II.-ADAGIO
1,666,303,782 *AF5DD032BA164E07889F367598AB47168C258653 VERKIKKERDST
1,666,303,783 *AF5546A592A9F69062D3F43D88F5E6DFE62A1704 VICKERYAAMER
1,666,303,784 *AF50358349B6EB0B086371726A28722B8AFA524D VICKY-FOUNTZOULA
1,666,303,785 *AF55AD5C1D5C77F60D56692326D7CC32227B41F2 TOPONIMI
1,666,303,786 *AF56DBD8E3D88D5CE278DEC3A23A28629F467B8C VINCENTALVOREZ
1,666,303,787 *AF5F8C562BF5409E02793EB3B20A86F3F19C351C Touch-of-Silk
1,666,303,788 *AF561672D3B33BF21CAB5996B60F4EF2AF89A776 TRACCIASSE4
1,666,303,789 *AF52EBDDA022A9E9B8091E9412D8CE145C175D07 VITOHOULTON
1,666,303,790 *AF53EEFE3E28FDF276869FF2F809B14332C7156F vkas-subedi
1,666,303,791 *AF530BC96DA03A62AB4BD7C53A8940FE0986EA0E vladimir.vasilchenko
1,666,303,792 *AF5C31648B78973E3B7563F21408EF3121A97FAE volaviaed
1,666,303,793 *AF5911F987748F0CB07E43934E057A292F2E2228 VOOBRAJENII
1,666,303,794 *AF5CBC66E6CB24E7285EB107EC82B0D05A06CFF2 TRAVIS.WHEATON
1,666,303,795 *AF572965633CEB061CB750932E8F5F3F983D9DC2 VXYHSAEE
1,666,303,796 *AF56A492CD184D0F2808E4DA56D5D46A8D53012A w4st4b1e
1,666,303,797 *AF51CBC21F2511CA77198AF4E82EFE5C5E7B72B8 TREY.BRAMALL
1,666,303,798 *AF55D42C247CB4DDF668A31AE4F32978F31F3F04 TREYSEVEY
1,666,303,799 *AF57A7415F89C522D3CB195E6332E17B5DE7078E TRIO FOR ORGAN IN D FLAT MAJOR, OP 189 NO 1: ANDANTINO AMABILE
1,666,303,800 *AF5AB6E60B6EF3119B507AA52C9ADB16CFC030AE wardpreyer
1,666,303,801 *AF5B168515D46BD1A7DF825E8D640508623FFE6F WCSDDJGAYBZLEIG1
1,666,303,802 *AF5F05413E149B27C75F5C2C53F324CB8D8FC247 TRISTAN.SLINKER
1,666,303,803 *AF59C173C47DBC6A9D84546F6B11799E0421D2B1 WEEPINGTOWER
1,666,303,804 *AF5ABABEE531B81311B6B720C2DB23802F73950A [email protected]
1,666,303,805 *AF5F911E1FE645918EF7E35303FAE864949FF0F8 wesleyjethro
1,666,303,806 *AF563E014A4A8FE164E5D4410F698935BF10C5D9 TTSUBROUTINECOUNTTT4
1,666,303,807 *AF50CC814DD1C9BBF533CBD0BDB9127F4DA14694 WESTWIND.CHURCHINTERNATIONAL
1,666,303,808 *AF5572C7C2667B0AE439E0BFA22F3054B31DF9BE [email protected]
1,666,303,809 *AF55630257C38AE978E2C34D3D13DF7590451476 whitneylob
1,666,303,810 *AF5061AAFAC77273FDF404CA5253AAD2D01FB00A WIJNANDS3
1,666,303,811 *AF5D9FBFE3D3C50CC55CFCE1D289FD2D59F3F097 WILBURKOREY
1,666,303,812 *AF5A9D940AE137AEABFD29FF5645167921D5C292 wilburnfogelson
1,666,303,813 *AF59829A4F6C38034841F083598DEAEA284F656E WILFRED.VANDON
1,666,303,814 *AF5DB484630392A2FDCD7C5EC9865C1DC165F75B TUOMO.MOILANEN
1,666,303,815 *AF51AF7A052FA56CFADBA42116FD0AC5DEFE33F9 TUPPING
1,666,303,816 *AF5BDF239309433617B01BC192ECB36CC1B6F923 TUSIND
1,666,303,817 *AF54A6263B6DA38945B4CD4C46A238D19474D9BD willylobdell
1,666,303,818 *AF5F486D9B107C9405811C972A9290A8DC3C3B92 [email protected]
1,666,303,819 *AF5B7F41324F9D7556FE1E2FDB1CCD835EEC98E4 WIND.R0SE
1,666,303,820 *AF5993368DE435373FE9F09A88392796066B9161 WINSTONBORRE
1,666,303,821 *AF524A373FB2ECD84CBB20289B36C7EFD814FAE1 [email protected]
1,666,303,822 *AF5AF23ED96A41B7B717481F74EAAD1B2FE13EB7 TYREEHARTZFELD
1,666,303,823 *AF557646877944D8D77B795E418E740BB7113DFB TYREEHEADLON
1,666,303,824 *AF5DA16BD63818C2015438503F0911C46F095567 WOGGKUP9
1,666,303,825 *AF5B2F2354470E585DC52C51D9FD036FEDEE4793 [email protected]
1,666,303,826 *AF5DE2C3AF1D39F7CCD40FD719D6DB50F52F047E [email protected]
1,666,303,827 *AF5066AAB0F83BB21719D84FFB160B5474017259 [email protected]
1,666,303,828 *AF589E85F82E97A4F033B25387EB2F1A5F18900D TZWOLFF
1,666,303,829 *AF555BC949314D39E0160FE58BB1AF0ED6E7711A U0#W
1,666,303,830 *AF517E1140539CD3CABA01711E56F42F7CE4521F [email protected]
1,666,303,831 *AF592868BF5655CBFEC8416F5AD88CF1956C412D wwwstacksofsnackscom
1,666,303,832 *AF5860A9E4E9E2F6B3F31F30FFCCF67FDAA092C7 WYLLYTHS
1,666,303,833 *AF5CB79AD85C73330086C54FEB91D7431162B520 w!+z
1,666,303,834 *AF5A47C72F6F16E73C81281E6543F8C99D77E547 [email protected]
1,666,303,835 *AF5441A50EC5ECAFBC2D718AEC482B09F595E238 YA.TE.PERDON
1,666,303,836 *AF5167EB326C832D372535908EFF3A7E2FD0578F unfictitiously1
1,666,303,837 *AF59B98EE1DB9475DFA0A99F03D3F63B8A354CC9 YENBIG-2
1,666,303,838 *AF5093C7B442637A35172269B03FCA9E36E11E2A YNKELIGES9
1,666,303,839 *AF570305138F5D61778777E89A0FF44B821524DF YNVI
1,666,303,840 *AF5512F363880782C1CCCF8DF12B31B765C7C28B YTEIMINS
1,666,303,841 *AF5927A44D011C79CDAD8E512A6F5F840A42EBBA yuniar-shop
1,666,303,842 *AF5256B246D8673E59CD8A28295E457441A9B387 V4CCIN0THER4PY
1,666,303,843 *AF58E9506E6E65AF8C59C8572C74DC81B680B74F Z>1
1,666,303,844 *AF5329E99EBBA19BF141E589FA959221E151397A ZELLA NOFITRI RIVALDHI
1,666,303,845 *AF515109CBC5CBE1C11F73E58230746EA7DB010E valeska-kartasentana
1,666,303,846 *AF551A4BB2A4C43E2EF28537ACFF4C1298BAC72E [email protected]
1,666,303,847 *AF56E28F1FCD38CE081F3D5F4500C470934A34EA valnoir
1,666,303,848 *AF58FAF2993C3F9251E5F8ED6C3046545B501B94 VANESSA-CAVERO-CALLAHAN
1,666,303,849 *AF56A4CA911B8A01D0257BF95A3B5816A229CEFD [email protected]
1,666,303,850 *AF53ABD9DC38432A9D31F42268E92D4DB2D850B1 VARMANAE3
1,666,303,851 *AF51F34584E37642433F201B813FAEE61C485404 vasilache.andrei
1,666,303,852 *AF5E2FDA0C61A98E7C6D4A5170DC0D9993C76A5F [email protected]
1,666,303,853 *AF5AAB2AD2EA3F0B1831C0209B70D565B3CB69D8 [email protected]
1,666,303,854 *AF5E4D20B2FA8A2532504DBDE0DC1A5DEF3716FB ZNEPRATELENYCH
1,666,303,855 *AF55FBFA92B7906BA1D034AA09DF82D5850BEC0E zpmn
1,666,303,856 *AF5551C38D37EDB7D1A710610D4B6AD022341670 VERAMARIAFENLONISSOVITS
1,666,303,857 *AF51B308D44E4C1755434E7F4D37A53108EC8686 verspotten8
1,666,303,858 *AF5DA236F479B164E345280E2F96BD4C2EB80F2A verstellen0
1,666,303,859 *AF50218B2AA3914FCCAFE8E46A135BF0623A5F33 ВИРАГА
1,666,303,860 *AF5048BF35FD1C12A64C67885A33F158109B23A6 КЛИЧКИ»
1,666,303,861 *AF5292BB140492EAEDDF61E96735032CD3D41A22 vse.
1,666,303,862 *AF529EEB761CEBF15554EA9AF3FF342CE7668D82 WALTON.BEUTLER
1,666,303,863 *AF54D4FA43138F789FFAC73283315B1A8C43A9E6 [email protected],[email protected]
1,666,303,864 *AF56EA696E45198CB01304FB8288DC2506E20C71 we;
1,666,303,865 *AF51002CCA269443971430C5DC300C36DA71BB54 WELLESLEYAIRPORT
1,666,303,866 *AF58C9EA772632D1FAC2B54393CCDFB11396C211 WESLEY.SON
1,666,303,867 *AF5B19711E64D530005330E6E7079A785A4CCB8D ШЫҒАРМАШЫЛЫҚ
1,666,303,868 *AF576EAAA1DA823773CCFDBEE78A7CE0EB1F571B WILLIS.BARGINEAR
1,666,303,869 *AF5028F1564ECB4505A073D0DA606516A96128D5 WILLISZIERNICKI
1,666,303,870 *AF5C41C678ADBF6AB7F3A98E4FFA067DAD0D8B28 winston-del-batchelor
1,666,303,871 *AF562A03F8C47315B0865FC69E591C8E643F4300 WITEK STRZELCZYK
1,666,303,872 *AF5A9AA31989A8FDE743B9364D4FA2D04735E386 WMSAMROV
1,666,303,873 *AF5123261857B17DECCAE9AC92727F927179EB0B W<NY
1,666,303,874 *AF51FA5C310E41329307E84895F6E4C2C4829390 WORLDUNDER
1,666,303,875 *AF5EF298C8D9A6799D6900E50359725C9FFFEBD3 千歳市開拓農業協同組合(JA千歳市開拓)
1,666,303,876 *AF5F262F59B675FB6C16B37122BF3220653DD0BD WWWASTURIASES
1,666,303,877 *AF56A29B15F846D3EFCEA829CA12325BD1C72628 WWW.PJBONER.COM
1,666,303,878 *AF5543A498FB5BE4A141D5B6B1F27879CE6298EE WWW.PME-LEGEND.COM
1,666,303,879 *AF5B260674F55E875EF96D16223A81E67C2B6971 その後もCDやMUSIC
1,666,303,880 *AF5A6E0EEAC69C2E61D3A43595826E98FFC54C7B xlagrivedesbois
1,666,303,881 *AF5C82E6CC7D38578D5C6D5D80A04EC99A4DF1A6 [email protected]
1,666,303,882 *AF5DA6F91AD8E5C0BCB5C2BE9E69AEB22CF593D2 [email protected]
1,666,303,883 *AF55F4DD8B7E07DA4AFDCFD8F041497C392CF33C XYRELLALPHEUS
1,666,303,884 *AF53366B0CC62EC1BE4C1154DECD24E382C9A929 YAKUBUABDULHAMEED
1,666,303,885 *AF5A3B98354F6C21BE84084476AB0E8235D410F9 [email protected]
1,666,303,886 *AF5C9D041F35A79B6DA89259F45B34405AF2A17F YANLUCYHO
1,666,303,887 *AF5526983B0894B44F57096C91839AFC85345F14 YENNASID5
1,666,303,888 *AF5581F3122F0F9EC3F186F4F8E860B49C7A542F YINTERNETED
1,666,303,889 *AF5CD1D5A69FDB60DF7082A79C6F8F09CD55970B yiyinti6
1,666,303,890 *AF53DA0E1268558E4DA3DEFA0085ABA8633CB08A YODIE.WALKER
1,666,303,891 *AF571842B1E0694F272E20A9907BF6B3D6EFD18B yongcodding
1,666,303,892 *AF5E003B847DBFB72F8B5C008E73A43BC39E0283 YOOSBADER
1,666,303,893 *AF53D7D513D9AD1395B2635A960CDA0149524A73 youngbillionaires
1,666,303,894 *AF56BC523FEED759205388A52CC153938F5F832F YRRUCSBSW2
1,666,303,895 *AF57FC614C3704F153F3E737B56A962D8206368A [email protected]
1,666,303,896 *AF567DB39E59C6A68C689CDE3CAA37B23BD7F477 ZAGERYAS2
1,666,303,897 *AF541DD632271D82FBAF9933EAE4B727C2A30278 zawszem
1,666,303,898 *AF58EA1A57BECF1A658BFA92E326D3E785446A6B 0THATFOXTROT8
1,666,303,899 *AF5C85C79528FA517BAE66EA95038FE218CB586B zhangyan
1,666,303,900 *AF54001FC8E1EF08E6C244F831F776B5A397CDF7 10718<G>
1,666,303,901 *AF50E70A70877AD23099B57BA5517A4CCAB7F92D 10.OTTANEISTA
1,666,303,902 *AF5458E4F3BA2E7C8C2652C269983436C0DB327B [email protected]
1,666,303,903 *AF5AF10199D58CEFA8E8E2549E9C529B91EF074A [email protected]
1,666,303,904 *AF59354DCE1A6BC2FC8F1CCF7F16E173178F6CE7 11.-plage
1,666,303,905 *AF5E856FB2A683E998F7E452C651AA2FADA594E1 1260917 koulutusinstituutinnimell
1,666,303,906 *AF5FA43B15CD8E159C36001D14B59B2712ADCD3C [email protected]
1,666,303,907 *AF54D2CB86B1CCB3E3451C0CB2C27104E2A5A63E 16nekala
1,666,303,908 *AF5749124BC2FBA009FC570F73F41B6029BB0FB2 ZULAIKATHEADMINGLYNN
1,666,303,909 *AF580388AEC88E417B3252F074F0956B1A34EF74 ZURAINI-JAAFAR
1,666,303,910 *AF58331CE087FF213DF1A490C55AF029F888F1CB ZX128P
1,666,303,911 *AF59C1F6DC5CAA74108D7BAC46CB993FF4EED577 1994527 ER.HAETTE.STAERKER.EINGREIFEN.MUESSEN..
1,666,303,912 *AF52043976365B2513564B47C0F960A3E701402E бийчанам
1,666,303,913 *AF5C8A0AA4CF1E8B884EAF13DC18DBC8EADC9D61 „КОХИНОР
1,666,303,914 *AF5DE59C8AABAD060BFBB73325CC473877EF49E6 1CHROUPAL
1,666,303,915 *AF5244E0A184470765EF5442CE66515DEB224029 1cribliez
1,666,303,916 *AF50AAD91A03053E4DD38CD5EF89A34D5C582E00 ПОЦЙ
1,666,303,917 *AF52A79F81B9C03526BCE52B602C72FF524033CF 1EXTRANZFUZYONUNA
1,666,303,918 *AF51DEB755B79013883FA9150663CFF017DAE134 1-GIF-KUVISTA
1,666,303,919 *AF55C80C0703FCFF21B2478E008F088A5BD6EC60 1.ICHTHYSPASTOR
1,666,303,920 *AF5572B9DA9A3293EC1DB2E592B0972A06C0168E сильверфиш
1,666,303,921 *AF59B776F0F598AAD3EA956FCD18521AA76B6841 1.KIRJALLISUUSREFERAATILLA
1,666,303,922 *AF5FC88FDF5D867080B8508B1B957BCD3A37C368 1-lammpa
1,666,303,923 *AF543E40C638242AA23CC661C8BDBDCD7ED2DBC1 1madonnaatjes
1,666,303,924 *AF53FC73D8331F035E83A4D7E9C17AB4C4A2062E 1MAUDIRONS
1,666,303,925 *AF553ABAFA7D914DF359451D6BFD6DCB97B37935 1rechtsglaeubigkeit
1,666,303,926 *AF5D5C688EC79FF078AA555BC387D968C0C30B8B 1-schnellstart-option
1,666,303,927 *AF5D5F3E20855081F72831037940B58F5302BA0F 1.scratchcards
1,666,303,928 *AF5F229CE89B78751A1A619D927C4B627E7B0949 1tamagotchifriedhof
1,666,303,929 *AF51457ED0ACFFCBFA36FE938DFF5B5D465DE20B 1 THERE-RAKENTEET
1,666,303,930 *AF55AE8E73AB929D985965CD4020AF4551D0A557 1umsturz-vorbereitung
1,666,303,931 *AF5F909E1DCDF973AD4F0033AF69706995C29A13 1 YKSIL
1,666,303,932 *AF544119894EA55388C9FDD4F7136B40566C10E0 2256697 sen.kehitt
1,666,303,933 *AF5C1725E5D458CE0358AFA895670F6C77737C7E 2381548 VALOKUVAKOKOELMA.VIE.NOIN.NELJ
1,666,303,934 *AF5FD8FD4E777327EB91CFD3DE5477BA98E963D2 2582794 kasematti-=-luola-,-joissa-oli-tykit-.
1,666,303,935 *AF5BA2EA347CCAC3022E028C5F76036233112E63 2591050 die.zuschauer.haben.ihre.vorleistung.erbracht..
1,666,303,936 *AF5413003FBC98F5D34117250991D7991B0CFDF2 2763704 ensimm
1,666,303,937 *AF55924758569BFBA09A2787A1EE5A17CA147F03 27AVA99AVLE
1,666,303,938 *AF5218A30E875120DEB1C80E63B6ABA800352176 294510 MODERNI.INSIN
1,666,303,939 *AF5ADE98E8FFCAEB1CC9FA399A754D928C0AECC8 2Cinli'den
1,666,303,940 *AF569D031D5F26A535C48AC9623798103C2F6DB6 2CYCOLOR
1,666,303,941 *AF5F95525ACCC7126EFA96B28EED77F05B252F62 2EPINASTICALLY
1,666,303,942 *AF50A200B6AB5C3DF4B88CCC0A2B8CFC411B1467 2GAKKYOKU
1,666,303,943 *AF549510B50254242AEA7F69948B684ADA334882 2geologisesta
1,666,303,944 *AF5B0FA3AD986A1515C9913565AB10399A143253 2 HOUSIEAUX
1,666,303,945 *AF57A2C8F0483A919601A843ABDAF14B9222A04F 2iluvjunior8
1,666,303,946 *AF56298176C2F4138F94F606D6BC0497310F5951 2 SERECEK
1,666,303,947 *AF5127317D82180C2D6FB6DD4A5ED378AAA38F20 2-sl
1,666,303,948 *AF50421983793A8CFFD7EF71F768826A2581E90D 305JONAH
1,666,303,949 *AF50E577859886818209B9F6E051A963552EEFF5 3D.*.*.*.~0~o
1,666,303,950 *AF5C2F800C29C607146AA211CE016946D62C6CA4 3ODERMALM
1,666,303,951 *AF585E4FE4CE998387E6E2854DDA8ADFA803B1D0 3)~O.~O.(>_<)
1,666,303,952 *AF5835E43FC72B7BC4FA143E3DED9283E4713475 3-->*-*-Splat!
1,666,303,953 *AF570FACE401C66E38A8B19E33D3475EEE37B79A 3YTICNUDA
1,666,303,954 *AF56907EE34DD4C8BDB4E244E05AF237152BED57 43-WOOF
1,666,303,955 *AF5C8E02D2F913FCD0445D98711167921BFFBE7B 4:..4..#..&...RELATIVE.CLAUSE
1,666,303,956 *AF5D44AA040D100A774131EBE044018733709BA8 47otto-schwabe-museum
1,666,303,957 *AF52A43666BE75458435A256BB59A240620209F4 4BETWISTT
1,666,303,958 *AF50A8BBB78EC5C3CD1F935E2AC08510E4A82D50 4KELLOGGPEACEPACT
1,666,303,959 *AF5CE6D65B6B7FF4A9DF493F6ABA81DF54741504 4MESCOLEREIS
1,666,303,960 *AF52D448799A455AB2C9836182AAE5BEEE75251D 4PUNZECCHIASSERO
1,666,303,961 *AF5F315B1764DDE19FE4C5304857EB63691A690C 4REBREHSE
1,666,303,962 *AF50D5B0B9A17CB69149B1678FBB5DAA4458AE16 4SIERRAELLEN
1,666,303,963 *AF5082EAC27D44E04BEE18ED1B5EEE2A6BA742C7 4SOOTYSWE
1,666,303,964 *AF5CCF8CE70CB14F6F519BFDAFC7BEF8F3266180 4-SOTILASNIMEN
1,666,303,965 *AF56D16A296E1D57670DF6F6AFD39EBD2DD2E255 4STRUIKVORMS
1,666,303,966 *AF522B5BCE5649FD940EEB25BA37EE09B5F56666 4VALORISATIONN
1,666,303,967 *AF514AA6CAB100D40089CFE864408CCCA7CED6C3 000000valhalla
1,666,303,968 *AF59095DF0C80DC8FD22D5E4B677AF6BB40B27CB 5SPIRITNANCY
1,666,303,969 *AF5E0952BDAF23E1AB23DD66DBCA482B7D8D8E24 5WESTHORP
1,666,303,970 *AF50C0CF5389181A4E2129E626CEDF41E74520E8 000(v6)/7
1,666,303,971 *AF50044B745400707211886186AE3B4C3F3EBD9B 6BSWTIEPOINTS
1,666,303,972 *AF52E10EBC575A097BEE4DD497FCCF00BFC1644D 03171292
1,666,303,973 *AF5AF261747B8A88F82BE436B16E00A2B422CBFA 6ILOVEZENITH0
1,666,303,974 *AF53E0FF70273185832270E173C6A4F642996ABD 0xe01fe01ff10ef10e
1,666,303,975 *AF5E060B43EAB6FFAA6CD21D3F260C8434F2EAE9 1077879 HELSINGIN.SEUTU.JA.OMA.KOTI.OVAT.T
1,666,303,976 *AF5E91A0D3526B0523033BA1F50DCACD6B1BFE63 10SNE1JESSIE
1,666,303,977 *AF5DE29B91D85473560BA6BEB0C158956AE6A43B 6SABNOPPI
1,666,303,978 *AF5B49FA5E5104E784FE5F0654E47DBA5ABA6898 6SHOESCONNIE
1,666,303,979 *AF52BA3057118E81CA0712843282F42EF9F4FCB1 6SKOUTHHTUOKS
1,666,303,980 *AF5EAB783251D8A14B2F4B867BE71A2AFA0B77EE 6VAKAVAMIELINEN
1,666,303,981 *AF5BF542348461E88B10B56071074C14A42DF08F 763MARLON
1,666,303,982 *AF50C6A06F1AC73616287465412547D10E04985B 14.PROPERTY
1,666,303,983 *AF5390B5A0562194D52F450F38585A8BE4AA6689 1524837 HE OVAT H
1,666,303,984 *AF519CE2F2CD1A95DC0EB96786573B771CE3A1D4 7BARRIKADERINGS
1,666,303,985 *AF5F33E833EBCA19BCBD7B0F34684C22316344B3 1677077 bruessel.,.4...januar..
1,666,303,986 *AF54DD8505E886E7D6D3331BDF9F3BBFE5C5D804 16GERONIMO
1,666,303,987 *AF5547AA413CEC75A266591B7ACDACD9924C3894 17-stratum
1,666,303,988 *AF5690D5D43AFF6B05E369EA5ADA3FDDA95A03AC 1909001 jumalat-kuitenkin-suuttuivat-n
1,666,303,989 *AF535A2B843782092C551AAE879D969CA8DDE7C4 7DOOBIEALLISON
1,666,303,990 *AF5523C2300BC3BC8B41A9F9BE65A89FA5694E24 1931年汽車製造製、15M級DD12D1)
1,666,303,991 *AF5B68CFCB8A727D3228CAA83D1336FA07420846 1BASSOLISTI
1,666,303,992 *AF5FAD5BFBF0A6203FFCAC32E12E31C4FCCD9613 7MILLIONDONKEY
1,666,303,993 *AF572C1B36765C3708A0D2F8A025DB9524592E1C 7MILLSCALE
1,666,303,994 *AF5D0CAF6D9AB91026178D2CABB80A7F97560885 7MUDHEAD
1,666,303,995 *AF54B067E31E228DF26029FB296B551660AE53DF 7PORTERAEH
1,666,303,996 *AF5644A62BEE8973D8DF9A59363DABFA758B3BDD 1.DUER-JUFEN
1,666,303,997 *AF5D35C81F3046A3760408BC065182F9B9251DA9 7RENOVEERDENS
1,666,303,998 *AF5452E3E4E2FC8562E1F60C13321069DCB533C8 7RESURRECET
1,666,303,999 *AF514934C3D59CBB2D733186FF3172D5C263841A 7SNOWBALDEREK
1,666,304,000 *AF54B5FCDB0E43351165C5CCCBA689DFFB143A17 1FLUTHS
1,666,304,001 *AF5FCDB482D2FF68291B77FA3C0C5820111141C7 1GM-AKTION
1,666,304,002 *AF5EB95573916DE39E869FEDCE5550B9D2F795E0 1.golemerzaehlung
1,666,304,003 *AF51CA236DDE41010B074A42A3EA33CD18650B4A 7unmemorably
1,666,304,004 *AF5C545406943B9A44F7478527144CDF0947F99B 1kaldIrImdayIm
1,666,304,005 *AF52F3B973D62C9FCB0737B00142798259C1ACDD 1-lesetechnisch
1,666,304,006 *AF5B2ED07ABEF69E3307AF9660DA5F9FB730F373 837ALLAN
1,666,304,007 *AF5AF4B06486743A2D10EDC944E77E570F83BAAC 8-)~ ~ ~ >-b0
1,666,304,008 *AF5D1F20CA8C64562A05A3978CC3DA780F594BD6 1.online-zugriff
1,666,304,009 *AF5982A9733F1408839B1B7CBAE7D4CFD03F7389 8DEHYDREREN
1,666,304,010 *AF5C4801B2694A464692723BCE831CF2B763752D 8EESIRETU
1,666,304,011 *AF5D9F82A9832F887E442C967DD64F6941192D5E 1.SACHVERSICHERUNGS-SPARTE
1,666,304,012 *AF5EC3FCCBD90EB75DA78041D9E69878509C5742 8eskaders
1,666,304,013 *AF52F9DB61DF3DEF69D2FFCB3AAA11CE06A7F2AA 8FRENCHTOGOSEE
1,666,304,014 *AF5CA968E39996C6E703B7F70DB92D9AC235ACF7 8MACRANDALL
1,666,304,015 *AF599F7C8B6032A39D3FE2A2CEC5ABE3D2B9774F 8NAUTICAEATME
1,666,304,016 *AF5D8168CAA5F25817A49A54DB4C64CB85EC7D8E 1.TAKAAAJOJEN
1,666,304,017 *AF58ACC61817784313295A41E2CB8FCFC4EE9652 1TANISLAV
1,666,304,018 *AF566E2E8A46C7D364257B830B5E8FFAD80910AF 1TIEMASSAA
1,666,304,019 *AF52E213B0DA556636C4E0BFFAE6039265D78422 8PROSINECKI
1,666,304,020 *AF587F2F2D96F8F0F3F1D8DA66B3D7FC074FD8DD 1 vastaainereaktio
1,666,304,021 *AF5DADE0C8AA92BD359723B8AF781999C0D774D4 )8(**Q=P
1,666,304,022 *AF58918FEA208EF1F842734F68423EB7A96085C3 1-vogelpflegern
1,666,304,023 *AF5F4755D1E01053349B651F6D528371B4B8F9C6 8SALCEDA
1,666,304,024 *AF500B75A9F02F25E278EC5D6CA14350ECD89237 1-yifei
1,666,304,025 *AF5181096D490E36AD181DCE6724D1074B756921 1 YKSIL
1,666,304,026 *AF5CFBBA572AB5F1E5A191B9164E0A06BD99273C 210kallie
1,666,304,027 *AF5EFC7E7ADCC3B45A765814E2128AA9DFA18E2B 2: 2 # & rumored
1,666,304,028 *AF54F46610708823EB480485D6534B260FCAF9E9 9BSWFETTBSW
1,666,304,029 *AF5FAD9D7688F03F2E279B421CEC98B09EA26550 24TAMANIUE
1,666,304,030 *AF52F828C10A79F9A4B6A4ED63144BCA77352A2C 9DEBISTE
1,666,304,031 *AF54AA7FD10B0D73C180B4D6D30EC1C328605D5F 2789E563-CC07-31DA-9736-72CC77152FD2
1,666,304,032 *AF50485A693D8204CA194F57B8AD45ACB2BB28AC 2888965 unter-ihnen-carlo-urbani-,-vater-von-drei-kindern-.
1,666,304,033 *AF5F6EB3CC3AD6A96FE2E3200B8FD878A6CBD715 9 LEISTUNGSABTEILUNG
1,666,304,034 *AF5DD11D7C4890E6C0683F2FD9C828A7D69C6982 9MUSICSOPHIE
1,666,304,035 *AF58918F460A414AEB0E12BF4BDCE333E194DDF1 9PAINTERSKIDOO
1,666,304,036 *AF5E0F51BDB8D9C87E9277A18BE8302B0F0D5320 9QUASICRIME
1,666,304,037 *AF5DCC4F4C10A3EB4F60CD1831F570B7A5490676 9THATSNUFFY2
1,666,304,038 *AF57FC4FBF83A109C83CB2DE81129133E3879C19 2-MERSCHER
1,666,304,039 *AF511A853B85386FE148EB034E64CD13039B7A8B [email protected]
1,666,304,040 *AF5B46C919BB49934238EA48C15CC1E37A91EA70 A2k,
1,666,304,041 *AF53EC7D43F682AAE406C09071118B2A61C79624 aa(p:
1,666,304,042 *AF587E71850956C67C18E5C5FCD80683033D95A5 3ILMENNEEN
1,666,304,043 *AF5978BFD0636F9FA28B553547BB47DF17819A98 3P * * * ~0~oSplat
1,666,304,044 *AF5FFE79255D024824BC8CF655D0CFCD266EF69C 431353 SKODA.CURRENTLY.PRODUCES.ABOUT.250,000.CARS.A.YEAR..
1,666,304,045 *AF53F87F7BFF495F50695445B65ADFEAD4A2DA3C acalycinouses0
1,666,304,046 *AF54B10B6D0BED58DE0F527019A0BC12307038F8 [email protected]
1,666,304,047 *AF53BBCC284BDDC06C9AEC82B49A9B75E9174D6F aciddubnucleik
1,666,304,048 *AF5435A8E22BDC94F29303C9AAD2CCBDCFC95EEE acl-5
1,666,304,049 *AF500AE4E3A60A0CDEC9659423B2D9049A9894DA ADEODATUS5
1,666,304,050 *AF5F0CBE4C491CA3549A81C4CE7FA8CA721BB2BC adnilemr
1,666,304,051 *AF5FF5D738AFAFD852D0560CD24EDFBD00BE06CE [email protected]
1,666,304,052 *AF5322C2C64825E295814538B06DEB4063F7E4FE 4VANKILAT
1,666,304,053 *AF5779525E9E822E9CA73A695DE883F53473597F afl;&
1,666,304,054 *AF5DE015C7BB88637CC8B1E6C2058CFBB36E5CD5 AFPAALT!
1,666,304,055 *AF5491087B5488AB7F49DA9605EFC45B69111F56 aicisyhp6
1,666,304,056 *AF5E53B653AE3ECB1095A35622A86C186AE90D92 AKSHIMAGUPTA
1,666,304,057 *AF55D5BC4B53DD5AA73BB7E5CAACA8AFEE5F94EA ALBERTOFUQUA
1,666,304,058 *AF530DB0FFFCBCDBCFA064CB63A26E7899D8E45E ALBERTOSTADDEN
1,666,304,059 *AF5292CEF0453B6B808E30D387B0DAB86AB2329F 5IDENTIFIKANMI
1,666,304,060 *AF524DEB39B53B3ACF8536D9DA874AB0E1A6E0C3 ALEJANDRA KNIGHTS
1,666,304,061 *AF575698FA0F9F10F0464D927AAD978D57216BEA ALEPRETE
1,666,304,062 *AF5EFD15FE4317E5A43C153D47179CDDAFF4CC0D alexia.church
1,666,304,063 *AF5EA500CCCA1AE86DDE7C28C4919F15CEDDE96E ALEXISHERRERA
1,666,304,064 *AF58A1B65C78C0031E44AF341B8539D149433435 5MACLEAK
1,666,304,065 *AF525F49582C586F334C11F9AFA6C2201E013F86 5NROWTUO
1,666,304,066 *AF54A2ACFD69ACD0DCE28773D0B42763285CD4A8 5RELE55
1,666,304,067 *AF5445FC7128AC22C7B74DCBC6EB92B555B9C2C9 ALLYOURLOVIN'(LOUNGEELEMENT)
1,666,304,068 *AF53A8FF22F33ACBF40D2AC9E996D312E79B835B [email protected]
1,666,304,069 *AF552F809EB044F253E544B587C0FB52551C58C7 ALU
1,666,304,070 *AF55BA6170F2393020FDE60CD3D455750EE37D79 [email protected]
1,666,304,071 *AF54D944C54CFC30607199F61559A99A340847EE amigosdechat
1,666,304,072 *AF5E7DAD2670C4BCBB02A3432C2524EA49CD3527 6DRAGONEZ
1,666,304,073 *AF5DF92E29D553FE134483F7959741D982748E87 AMOL-VIRKAR
1,666,304,074 *AF57C01013BFED80E9C45BF4D452EA6454CDF15C 6ESNEPMOCIR
1,666,304,075 *AF515961C3BC8DA34CDA235C167302DBA39632E1 an3j$
1,666,304,076 *AF5B6B28A12F08880F0A2E2A5E91F5E2C2CF743A andersonahlbrecht
1,666,304,077 *AF592C7E1F120BBD40E414C947233EBCEDDE1DA4 andrea-ribba
1,666,304,078 *AF51F44DABAD4C06969F8EC1D5F4C2EFE1B45535 6MONTEFLUOSBSW
1,666,304,079 *AF5ADF1AEE39F72ACBF5CDB5F0A4FC06158F66CE 6ONSIMPATIEKHEID
1,666,304,080 *AF5C876D7EDF4A48E072AB28A42765AE9515A45B 6ULTRONEOUSNESSES
1,666,304,081 *AF535F632063B711D15D7DECB9E1192E40A985C3 ANTITHETICVARIATES
1,666,304,082 *AF54E1AC857B2F78C2BFE64B2253E9323DDC48C4 ANTONSTUBBINS
1,666,304,083 *AF5E13C085A874677077E7AEA4B71FFE762A4177 ANTWAN.ZEHENDER
1,666,304,084 *AF516D28EA3BE5457E15CFBED4D79286A8EC4D67 aopn
1,666,304,085 *AF525D7994180633D6B0500D0333354953F88799 7DB872BEDCD94CB987EEA31D4D4C52E4
1,666,304,086 *AF500F351D92B722497F26A7CDB429BE3D6D24E5 ARCHIOLOGI
1,666,304,087 *AF5F1087753AA3A96830977E75889FD82B834B8D ARLIEWEISGERBER
1,666,304,088 *AF5CFAE87E4A93BE0BF42084C8690208394DCED2 7MIDORIRIVER
1,666,304,089 *AF5325CB406BC29F0AA5DADB5D867B22E18A2E08 7PARKERSIDNEY
1,666,304,090 *AF5D1DBF36235C48A6E3249A9A1450E8F388B3D5 7-schulpflichtiger
1,666,304,091 *AF5E0E4A88E51B204BA909C2C5F4FDF48CC6F522 ARQ(5
1,666,304,092 *AF5EF3979036065907967DE07BB209C924CB1672 ASEROULF1
1,666,304,093 *AF56BBC50E1258C862B1D42DEDF7ECC6BC32188D ASG5N
1,666,304,094 *AF569DE1A3008028B6B61FE8BC95F5745F1C3B8D 8~aaa
1,666,304,095 *AF553F3B347D8244894F88F5A13E039A844B8583 8EDN!GH+ED
1,666,304,096 *AF5DBA164CDD05D4FA0E39BE2A541585AD633134 8GEKUSSTER
1,666,304,097 *AF56C0E34B7978AB282F66F62F523FC3799BDF85 8MUSICJEFF
1,666,304,098 *AF5149F49C1EEBBAA6339ABBA45E4A35166A5163 8NEVERDEGROOD
1,666,304,099 *AF58643BB1DBE223412DAFF845F8E4B8A3B38BF9 [email protected]
1,666,304,100 *AF53FA80548AD9DCB55F9D3F3D0F2CF7956FDB8B avn7j
1,666,304,101 *AF54DA3048324515B6F826340637570BEE9A603C aw.Go
1,666,304,102 *AF516BD8C8D3CB306D55D0EB492C815EF4CC2E21 8YLLACITPANYSERP
1,666,304,103 *AF5E5B04A954AC8914AEC0EC63FFC71094C2A3CD axbpilf56
1,666,304,104 *AF55BD8FD9940F63D206948ADB5F816AD126FF90 A$+YD
1,666,304,105 *AF50D03553CE798F6AFF8855CD40F5069D51E239 9BLUESKYWANKER
1,666,304,106 *AF53749812A58ACDF9FA61487BABEB22A63D8B77 9BSWABSOLVIERTEBS
1,666,304,107 *AF5102445B726489121CD172BEEECDA97D65A57D (>-<)*<-b
1,666,304,108 *AF581D7F6D79FD8AA8C43CCF641E542C63BB25D7 9FOORPETS
1,666,304,109 *AF540C3E175BFD123F8A8BA5AF8570E828BC25AC b1dur
1,666,304,110 *AF5EE7F434AA733BF9BC03DF7C9A2EAB43843CCC b4;(2
1,666,304,111 *AF52392CBF07E9FA5DC70E3A7B6764A1AFACEB85 B!5W!
1,666,304,112 *AF549C46FFD8B0449022E7A9817E108816C69773 b,9jd
1,666,304,113 *AF550F15E33349A2584E9360FB4439A236CFC31A b9uer
1,666,304,114 *AF562516B5442BFC35A11A1A94120400F1704A0C 9VMJHHVSJ
1,666,304,115 *AF5062E749CDFB53D1656315D8B6049C4818050A 9waggling
1,666,304,116 *AF5A5A848FD7A01A01B5F498D5D2D49FEBCAFDDF BALTHSARA
1,666,304,117 *AF5CA683252217F0D12A0115032BE23A58AE705B ba=p;
1,666,304,118 *AF5D22478D2709687BB7643BEAF5D109CFEF92D2 a5:vp
1,666,304,119 *AF5B05EF63C0D02ABB07AB2B894C07CB53BED82E aa/_0
1,666,304,120 *AF57A606D3EDEA916D96CB89C7110FDF5135F823 beio;
1,666,304,121 *AF536E9C52AD13AE9EB5F4E999EA2716BBAEF9AB bentonhauskins
1,666,304,122 *AF59AB011D421D3514D4AE95F1C498BA9B043CEE bentonkendall
1,666,304,123 *AF5F726892F619B21321D21542C07E773BA9A610 BERNARD.SUMMERFIELD
1,666,304,124 *AF5583CC1C8B07558B7086BC30D56CEAA90252FE aberglaubeses
1,666,304,125 *AF5FCD2C8DD70B0100D68C49399924C1F3BD4B75 abisl
1,666,304,126 *AF576C08260008308CBEC0146615F46D5376A939 bg+u3
1,666,304,127 *AF57F306AE35DDB9612E290677225754221EAC22 ad$=d
1,666,304,128 *AF5564C97649AD28517D4D16B1237BE0A71F73B0 adkhp
1,666,304,129 *AF5A18D2092A6C1F5E1D4B055320CB27F4F56409 ADP2506
1,666,304,130 *AF5DC9129B4AE98B4B1C7FF45DBAB7FB2C8B6F82 [email protected][email protected]$
1,666,304,131 *AF5558DFBCFD53A814748623A3C02C79D23C6BCA AGGROSTARZ2007
1,666,304,132 *AF591ED3324326C9261CDEF570C1EB3196FF1D72 AHMAD.ALAMOS
1,666,304,133 *AF5A7019C40F40D6DB811BFDE7B114963554B762 AHMED MOHAMED ABDELRAHMAN
1,666,304,134 *AF5609739EE3C6C37F1B68E1177EF3CC60A16F15 AHMED.NAGEEB
1,666,304,135 *AF58F03B4F3C86E0F33F0BE8316D95EF3F52F976 boi.t
1,666,304,136 *AF562CDF3236A36CDAE7D364725096619ACB6025 ajcqj
1,666,304,137 *AF50212A3D6ACCEC72A401458827922BDDE9DC9F AJVIW
1,666,304,138 *AF5A576FF2C13681359BD2A193034EB9CAB1385B [email protected]
1,666,304,139 *AF505B2873EFDCB4EFCCABF52EE129055C830D25 akuseino7
1,666,304,140 *AF55D8501F43B1DA57963135DBB56B1511ED6FB6 ALECSGUERRERO
1,666,304,141 *AF54AB750CCC00A88B224CBB507DDDE08BD00486 BREAKINGUPAHEARTOFSTONE
1,666,304,142 *AF570AEDA204A2267D396D3BA3B8E7C18BEBA9BB alfonzopetraglia
1,666,304,143 *AF5B0672C421E9BBC2972C8810E9A763C2A1067A brent.hoekstra
1,666,304,144 *AF5C08CABE077BE7CA4F229C6006A7C6DF059CE0 alii8
1,666,304,145 *AF54289CDC41922AA2E720761FD391F48536F563 bricebroner
1,666,304,146 *AF5231E9BCD680D029E64889BE6C29DFCAE773E1 BRICE.KALKMAN
1,666,304,147 *AF56040DBD6F31A9F473FBA36386629EFACECCFF BRITT.LINDERHOLM
1,666,304,148 *AF5B6395ABACEC5D77C936BDA9ABDA9B276E6F61 allajiet8
1,666,304,149 *AF5BB2DF4FBC31FA7E51659DB08B5DBB42719D18 bryanttaberski
1,666,304,150 *AF5C5BFBDD89174602F98B252BD2C7DFC8318997 bsfm-
1,666,304,151 *AF5644C27A1DB9B71A346F508E568C4EC31FA7AA ALU
1,666,304,152 *AF59977BE34751D106C3CF780A0F3826F3B0E0B4 BURTZUKOR
1,666,304,153 *AF5477C67B7A8A3688E188F4378D37F98C5C5830 AMATHAT
1,666,304,154 *AF5C03FCD79F76AA042CD56B4D04EB6DDDACC243 bvdxu6hxmd4
1,666,304,155 *AF52ABEF2163590B860759F91E0459655B2DB7DB Am$P
1,666,304,156 *AF52F48F5EB893C845829D2AF96096CC9D634350 ANALISA-URREA
1,666,304,157 *AF58AC27C1E633FCD784029C918B531E98F31A90 [email protected]
1,666,304,158 *AF5D7C08C908D35C26DEFF3E5751FCBBC9705315 ANDREAS.GOSSMAN
1,666,304,159 *AF56E29DFBA9144A01BD9055BD917DD913E1B3F5 C2C97
1,666,304,160 *AF50C4935064ACACB75AB65085B2A2CC56668C33 And-We're-Quiet
1,666,304,161 *AF5A4097A490FB23AE4E44199AC79196DF56950D C-4OV
1,666,304,162 *AF5239452534C8621407987DD52DE9FA779349DD C67FM
1,666,304,163 *AF5D77082209E0895411E54BD680415937DCFDCE c8i&6
1,666,304,164 *AF59078A59BC82B6FAFD3A9B68A319F03DFB4ADB calling.the.knights
1,666,304,165 *AF531D0EBA846EF5ACB0E86EE9B7D7093F5D495B CALLINGTHEKNIGHTS
1,666,304,166 *AF5AD563A919B39A871F9A3979D48BF24A8A7580 [email protected]
1,666,304,167 *AF5F659ED86BBA6ACA1372DA6EBB03DD646CBEF1 A*O^
1,666,304,168 *AF57AE9E5CC7CC0CCAA8C077ADBC0A41AFFB0B71 apm+d
1,666,304,169 *AF552BB8F679091BF4DC13081E616D68DF6664BE CASEY.SCHOENER
1,666,304,170 *AF588C8D4BBE23C8F33DFC27DE64F826E17964CB \CBAA
1,666,304,171 *AF5BF9BBCA34EFB8C4DD39375F6601FE30D7F822 
1,666,304,172 *AF51F854DFA2894989EA52D32B8EACAAF8AC5F5F ;oZc
1,666,304,173 *AF5031BBDB0927021F6793A45833EC4C00FCC1CE c/bn.
1,666,304,174 *AF5AC85A5CBABC4B83036C9DEB82159566032729
1,666,304,175 *AF5858C9119D6595AA8B80A7C1737A7A16530C7D î
1,666,304,176 *AF506C6BCD882D45D71F8AADFC43AE3CB3136747
1,666,304,177 *AF5154A03A3894A71C79C0A8C109FDF9F25F9725
1,666,304,178 *AF5A08CE3138BD400BE89B03989DE0F7BCC8E4F9
1,666,304,179 *AF50525C5C061322600669752B21DC077CABC7AB
1,666,304,180 *AF567F95C57CFD111BB2413CC25647DFF1E64645 
1,666,304,181 *AF5599D7EBD948E5F90CCDA41D7637266C0D01AE
1,666,304,182 *AF51F553D035CDF24CAF565362AB4642EABA81E6 CEAIRRING
1,666,304,183 *AF55C5D3E9C5A35C965FCD92DFC6EC9CD6878752 C,-ED
1,666,304,184 *AF5D36FC68C109E29F2A183B50953282CD22AA90 cf2a=
1,666,304,185 *AF5360B10EE2E313F1D2038B780BA856A62D2046 13
1,666,304,186 *AF538C32DBA43B0FD9BD19B4FBF7CA760D9747C4 CF-OA
1,666,304,187 *AF5750C468EB16AB2AEE7A1F6990FACDFE3ED7EC CH4N+C1EERS
1,666,304,188 *AF55A38A628A04B493AE3F223225F4F2B372573E 8
1,666,304,189 *AF5DF24880E57588229348F43EEE302D61B3F9D8 CHAPTER3025:THESACKINGOFSEVERUSSNAPE
1,666,304,190 *AF5F7CA82E2C5454330203EECD1E7445FE4266FC chaseschroader
1,666,304,191 *AF5A499CE94F67F53706F112E5250F7EDABB3475
1,666,304,192 *AF59CD821557908F41AFBF3876AB01F0E9461333
1,666,304,193 *AF5A4627BB80700F174650D9BE23F1C54299E0C9 QA
1,666,304,194 *AF54813E6249E7E6E1EED610115AFCE9A83F6961 8
1,666,304,195 *AF59E94190EA545472A82E7A6F28C4479954E332 christbob1
1,666,304,196 *AF536A0BC8239A1302FB2826383068829A9CC842 I
1,666,304,197 *AF5CB168A9000DD7B377FF3647E799EC665DCC2A q
1,666,304,198 *AF5B0A70A20FD87468032194E2AEF5013568AD50 g
1,666,304,199 *AF5D2AB8C1D89B7FCEDE7D8954D36233FD7735C9
1,666,304,200 *AF57AEFB23DA789E306470798F6B249ABC9D4150 Z
1,666,304,201 *AF5F4067778A9CD7BFABF83E5FC8D6D81556BEAF [email protected]
1,666,304,202 *AF5D4315738CAEB1EAB8953056658FF4610A34DF e%1C
1,666,304,203 *AF56912FE85FDEE4CF920D0A603BE38D162A656D [email protected]
1,666,304,204 *AF5FA2F932BBFECB9894EB86569F9F43AEE8A687 cineexplore
1,666,304,205 *AF5E5433073861ECAB0E9286A57B44875460B5CD CIN_W
1,666,304,206 *AF5F4F620C6DC78A76A0A0DA989D8DC5122DDB46 cjkje
1,666,304,207 *AF5955CEF1E5748505A4A5185DCD5DE8424B4D2E 
1,666,304,208 *AF53C3FFEFBB4168785785528F39A8703C11A7A7 ]W
1,666,304,209 *AF5F30A579605EEA40C53868BA890AA2D82A5F91
1,666,304,210 *AF53F041ED60E8FD2365D9F6B576777424707C2D ԟ
1,666,304,211 *AF5A62F4D7340AA88266756A7DE316FF6EED987A 
1,666,304,212 *AF553F1C2BE8992E12886E7BD706F38C69DF5659 C"Kw
1,666,304,213 *AF51E894F7C35BADDED43466F7B32DA90A2E2B50 claudpluhar
1,666,304,214 *AF5AAD2824A370BB6476109168BAB2DF471AA814 claudunverzagt
1,666,304,215 *AF5766126756618E47D436BB6CF73BBE7773F892 
1,666,304,216 *AF544C1D2310D7BD9898EE5E386510C9612D8409
1,666,304,217 *AF52DC7D22DE87F7E02910A69B2B94F413614967 cleofinegan
1,666,304,218 *AF54E0FD722C7698F69A661934BFCF1F6FA8D362
1,666,304,219 *AF5BE454442306884B60671B446362D7DBE465DB
1,666,304,220 *AF5E587FDE2528AC9383F6F928D469CFB760A929 
1,666,304,221 *AF559C31F63BAAF5F93F625502C4520EEF1A03D8 ;˵lh
1,666,304,222 *AF5375155D920FBD027BECB30A410085F7412575 jnYc
1,666,304,223 *AF55EF35CDE8AD959B43A69EDBCD1F3052A23053
1,666,304,224 *AF5C6EF01407B7721B16DDBFBB5FE98840B1DB4B ஊX
1,666,304,225 *AF50EA8F3D4101AFCDF5B48357EFED24F1412B6E u*D
1,666,304,226 *AF5CE974694188CD6C158F80E3841040E8CBC51E
1,666,304,227 *AF52F8CED3C4C871488C04D3B2A560F84516231B ܛ
1,666,304,228 *AF5A934D232ADBFB00493994E782BB74B1B097AE edt
1,666,304,229 *AF552612A23A8146F7553F1410E7471DF65F419C 
1,666,304,230 *AF58C0AA7ADC4CF95D29B740B28942AF1D64C83A η
1,666,304,231 *AF55EED1AF945923EB89219AF6CCC815919B027D
1,666,304,232 *AF556F88E147B4C84ACA6710C3520F4CF6715D64
1,666,304,233 *AF5DDD91FDD61CF681DAE621A99B38560AA70AA6
1,666,304,234 *AF5785CCE504796821BF128F81D7A8C30A477005 cm5+j
1,666,304,235 *AF5D960090AD7FEC01E5EF58B97461AF0E13785C 
1,666,304,236 *AF533F901C12B8DA701C960A67018F2989DA552B CML+D
1,666,304,237 *AF53ADCC2F5853084B0E004E3044E690D57B1BA8 cm-t:
1,666,304,238 *AF5F943D76A587850EB7F54CD71C84A6D4709332 cnarj
1,666,304,239 *AF55BB58D29BD6DC6818BA1026C5A2C528DB3358 B4
1,666,304,240 *AF5D4AEAAA0363B83430C77007DC340027733F36
1,666,304,241 *AF5C2682644FAD4578CCC5E8BEF1DAC0048A99B1 COLD-GIN-(1976-LOST-SESSIONS)
1,666,304,242 *AF59B3FBBE4BA1AEEB27CABD3D6290392A1F1D70 COMITIA.CURIATA
1,666,304,243 *AF512764F7E7B83029CD5CB0CF5EFBDF8F2227B3 conveyor-belt-2
1,666,304,244 *AF5045B67E7A2F19E5C0593642C90F3C1EA08443 co.rs
1,666,304,245 *AF5B87BB4364C440D5EF9D259E7A17F2CAD42BAC 08-02-1126
1,666,304,246 *AF5FDC0587F1D3A79F7541EDE8300D1D743CAC8E 1131070 HANKE ON VOIMASSA OLEVAN ASEMAKAAVAN MUKAINEN
1,666,304,247 *AF561426AA0563A1236DC630609AB14EDDB28234 ct$=e
1,666,304,248 *AF5D9C746333ACC6835874532883AE87D28CD82D cularisation.des.religions
1,666,304,249 *AF55DDB7D0D3B48D16818F46746BF9AD374EC245 c_;un
1,666,304,250 *AF59FC615685838FEC73544822CA98ED3E3E442A curtiskaur
1,666,304,251 *AF501EF72868999CA3192C0A2CAA219F0046A865 1433256 MOSTLY , THE MAGAZINE IS SOLD ON NEWSSTANDS
1,666,304,252 *AF5ADC038E765593E20DB0A715BEB554B1F03719 C+)WE
1,666,304,253 *AF5A8ABB93FEC95F28F3BAB352DD102917EA6E87 D0W,
1,666,304,254 *AF58E002054A828CAF47CC9A50281D5A12896359 1.KANSIELEMENTEISS
1,666,304,255 *AF5E3B112050B5C5EDD33C8051B6E72CD193631D DANNIE.CARRE
1,666,304,256 *AF5CDE14B623615BF9C3151541137A7BBF608174 1 PERINN
1,666,304,257 *AF57BDFD3E6A30FB0F418262440A8511A1ACC832 darennorthway
1,666,304,258 *AF53C6339FF78D3CB92E1A5F96CF1A4AC4840271 DARIO.FARRAH
1,666,304,259 *AF56B46A434B8383905E49E8532531E237825557 1RUFFINA
1,666,304,260 *AF559C6322C935E5BFCE38D82EB066A1791EE54F DARRELZIERDEN
1,666,304,261 *AF5FF1F931FF1FF1802FBDED19F97B28B10DBAB8 1.sicherungszahlung
1,666,304,262 *AF568B78D2C33D8F1716D11B9C237896CE452EA2 2787612 SE SIS
1,666,304,263 *AF584E7B193BE78B2593291B4327E423F8272620 DEMILICH!
1,666,304,264 *AF58ECB341122F45E201705F5EDE8F6DAFBA1DDD 2arkiel
1,666,304,265 *AF59FF391F01BC15D962562A36D7B20326DB9732 diastalsis
1,666,304,266 *AF5D21E431918B2352ED077CEB8D3D1AA9D6572C [email protected]
1,666,304,267 *AF56C140F3EE2D5C46B8E62EFE74AED038435B6D 37.RUSLARLA
1,666,304,268 *AF5FF590F1268CF9AD6D674145670A3283941E34 3.BEYER'S
1,666,304,269 *AF509F8A8947758EC1DB42B3016552648D64EE32 DIUMITROV
1,666,304,270 *AF5D22D7CC1146861B8DB88B3DA25832F8EA442C diz%k
1,666,304,271 *AF509DFE3C72284746C528D345A9FAD32CC6DCA7 4rauhanturvaajiksi
1,666,304,272 *AF585E002A93186F163770C5F7B2244058134818 4 SAMANPITUISEN
1,666,304,273 *AF5CF685AB406A5B0568B29D64BB4F7E50FB25F8 4SSORREK
1,666,304,274 *AF5429C6879A89363C1DF8592B2F8D2B0C8986D6 d(:ul
1,666,304,275 *AF5542B17CC76DD7842539477FEE3E2C7D4F8B4B DUSTY.WESTLAKE
1,666,304,276 *AF517B3334DB9537D84627D62A60D33DC00DE4BE dzo0%
1,666,304,277 *AF5C3A9799A63E5266B64B94E14E2EB83A9F719E eamju
1,666,304,278 *AF52B938F744178F1D5ED19F7C9E81C031F9AB01 6BSWCITICARD
1,666,304,279 *AF546747455EF36F7C8BCA1A6EB4DF25D6667D38 ED.MCINALLY
1,666,304,280 *AF55C44B71F458083A5B5F92EFC8F5C7080C4389 EDNIAMERS
1,666,304,281 *AF5718F165B59364446C45BED003249DEE259D62 ee"ia
1,666,304,282 *AF5057AF966D1995C4E862FCAF971F4D6935E62E EFT
1,666,304,283 *AF5416518429D388ED71BCD8F964870899CB6AA6 [email protected]
1,666,304,284 *AF53FC675C61F4C758524CB0E51BB50F3E4E57C0 6RADIOLARITE
1,666,304,285 *AF5CE77246A3B4952196B307DF7306F6CF497CEE ELLSWORTH.CABRERO
1,666,304,286 *AF58D8CBF7AC6F2A79F9A5EDC3DE7EF9472AE2A7 7AUTHORCARMEN
1,666,304,287 *AF55E9AB086DDB6978BC679808AA79706F0C27E1 EMg/
1,666,304,288 *AF51CBB35A5074DEBA1FE655CAA472E5C594FF4C 7SPEEDYABSOLUT
1,666,304,289 *AF5FCCF25B809F274ABCD9E742901A746706D2F1 7TUCKERJENIFER
1,666,304,290 *AF5E4928563B795E857AFE3D876D87224A9ADFB8 893yazmin
1,666,304,291 *AF5461392E2C879CADEC3BD3F6810B77DF6BDDEA ERINNISBIT
1,666,304,292 *AF5F5D91D9DBAB4938565D0B09B4B38EECF689B5 [email protected]
1,666,304,293 *AF546255ACEE8F094635D49DA47BB4A858E5FA16 ESALDEN
1,666,304,294 *AF5CC89BC8EE7129E2D23A9542C0104039781643 es-geht-hart-auf-hart
1,666,304,295 *AF5F8FC5D65338FD3B55EDDCA3A403965B837ED9 8HERIJKENS
1,666,304,296 *AF50CB3D05EA600D61DFE6C6A73D0BD26610C9E3 EUGENE-CLEMENTS
1,666,304,297 *AF58B123070DDB819B9E49AB882088C2CD1ADBD7 8SVOLTANOS
1,666,304,298 *AF57C298A489A76ADCE9AB7E7F8F0B94B20CB917 EVENGULIN
1,666,304,299 *AF5583B919A7BF58E7430D9DE7DBC50976D80DD1 FABRIXIO9
1,666,304,300 *AF5532AB6676EE8BCC7EF6F1C346236D727742E8 Face.Off./.Interstellar
1,666,304,301 *AF53EB86EE9C4B86A34B71A395806AAB3741877F 9FERRETHOCKEY
1,666,304,302 *AF5D4C0357AF7D596882FD84D7EDA013037EAD8B [email protected]
1,666,304,303 *AF56A22FEE9F63ADE4323CAE9132779BEE88CE57 [email protected]
1,666,304,304 *AF51DD49A44B5C436470499DD6434A8B4F04DB60 9SOPPESATIS
1,666,304,305 *AF5EF5C92C05F21B7623427EBBCEA9480239B2F1 [email protected]
1,666,304,306 *AF5197CA401894115038E1826334B770C1F29747 a2rnk
1,666,304,307 *AF50FF317FB46BC50B37F7F03054E6983385706B AAC38M
1,666,304,308 *AF555D75D87C6C0AB2EECD836FDEA1E736782F52 FOPPENED1
1,666,304,309 *AF5A0F1DE6D63FAF71072C7826CED3587F6F1261 foresthopkin
1,666,304,310 *AF55A9B49547153CB10231DEB1A6F2FC3E11279C FORFI1TER
1,666,304,311 *AF540688974E2CF1B3E5D95C96ED4BE9388CD6B3 FORJUGED0
1,666,304,312 *AF5634F1EB5A7868940A24AB462FF7211067A088 AB%9R
1,666,304,313 *AF56F991AB484262CE14A03479BF574AD88F4E86 FREDDIE.NAGTALON
1,666,304,314 *AF5E29B8CF2F4D6B89EEFC16C7CF707E8FAD3058 abortion
1,666,304,315 *AF5B6991ED030774584F0701CD0E514F7DCEEB7A ABRAUM
1,666,304,316 *AF5DC824F262597A15CB0C645C8E105F64B1E010 accennerais9
1,666,304,317 *AF50644177689B8973BCD447D0FAC99231E7D8A6 F>ZN
1,666,304,318 *AF5744CEE3E9F3D3F26FA39A9DF6F5DBE7DB3FED ADANNEBOHM
1,666,304,319 *AF57902C14D18A0050404EB82F020F839E2B98C6 GARRETCENSKY
1,666,304,320 *AF52103C3698E1AC3A545D2CCDD2D80E4F8F07CC ADPM
1,666,304,321 *AF5CD07AB4C2077BEFA1E7BF22EFF9F7B9095D07 GBY6
1,666,304,322 *AF5181C906DCD26992896CA61795033C6B5FFCED genelouchen
1,666,304,323 *AF5125DDFA83CA6128EEA02D3FB3882DB25E3699 GEOQUIP2
1,666,304,324 *AF5C1A8B1F60C08F3BF8B7ACB3294302E4049026 gerardopistoresi
1,666,304,325 *AF511319ED30F04BAD81AAEC0FE63BC70A853054 GHAEMINIA
1,666,304,326 *AF5CA957EBD76DED4B4E743D2B8B7470FDCA0C2C GIBBUS1234
1,666,304,327 *AF5517E9FDDA87F72D3AE1FC02D908E5E4C72715 GILBERTCUPPS
1,666,304,328 *AF560383E2E77E918C9E2471D275F29B5A1BDFA4 GIVINMEL
1,666,304,329 *AF57A38197A7E13ECAEBDA9D746F76C63D3BBF4F GLOW.SHINE
1,666,304,330 *AF5CEEB3899DB1BE3671111DD5FB23CB5F641AAC afkraste1
1,666,304,331 *AF59080B7ADF17BBC637599C1864C532CDD1643B gradyrotolo
1,666,304,332 *AF54B0B787229A649852CDE6283080B888407DE8 GRAFFIH
1,666,304,333 *AF5516A522D7AD58F0A0FED54D5F1F7CCB77D131 GRAHAMPADEL
1,666,304,334 *AF5AA1BC73491598A3153147402EBA0FF23D6705 gratifierez8
1,666,304,335 *AF52C4E5933FBD8BCB648C3ABFE874F256584B5A GRUPICOM
1,666,304,336 *AF539B5C18B76883564D7F8DE365DA96AAD9AFD9 AHTBQ
1,666,304,337 *AF59C22508C8BAA46645D8306097024D3C09868F GUILLERMO-PINTO
1,666,304,338 *AF5BFAC4B9A5AAA402A5930D4EC9678635B37B3C [email protected]
1,666,304,339 *AF5A938D43BF939884951D348124503CAF3D04F0 aih4l
1,666,304,340 *AF5893AB86B7D6FEC61C305A8DE20988DC27680A gwkobdr33
1,666,304,341 *AF5F2077ED26F02BB80201EB19C7CCD4629CA9EF AKATZUKI4
1,666,304,342 *AF58A6664DD52ABE2924D85AA607E1BFAED78DE7 HALOUKOS
1,666,304,343 *AF50E11A02A3E190CE3CD5471B613AF9A48D7A17 HAREET SINGH
1,666,304,344 *AF54B76612BA05DC825DDF0105DD27A243A9B68C harkonl
1,666,304,345 *AF5ECACEC87ED1F70CC064C800C8708D3B42AD96 ALLUMETTES-...-ALLUMETTES
1,666,304,346 *AF56E3B8F2DBAC6A9BD1C20B2C8B382FF7FE6B1C helensniper
1,666,304,347 *AF56448880D4254062AF851C312D60ED1A1F9678 AMK)R
1,666,304,348 *AF548C9A5DD5A2584647C8DAA50FD8EAC78254D2 HILTONFEHRINGER
1,666,304,349 *AF528CB30D824A138FF35943FE28AB52DB0B01E0 ANF%M
1,666,304,350 *AF5E190B15E867E19F95579A15693651B64C547E HLEGMONS7
1,666,304,351 *AF5A3543C4B242EFF273703ED5364AAE0A6CA757 ANNIE MCANDREW
1,666,304,352 *AF5D212E77D496F514BDF390DA9A637FB863DC73 hollisspanswick
1,666,304,353 *AF54452B3A266509DFF3C803E2FBDD2F7FC8E961 antonzazozdor
1,666,304,354 *AF5863AF5B1ACF7346A17D9B7B38EAC0E90A6AEF AQ:K/
1,666,304,355 *AF531A0D290FD0DEEFD1225B7DC68B666F0669BA httpwwwbreatheheavy
1,666,304,356 *AF544AFEE7154F267DFAFBE0B6063F4595837F6C ariunimi
1,666,304,357 *AF57B49690DA82EB20AC60E33EB790E60FF204EE HUELLTETS
1,666,304,358 *AF539EE70A652F1237F2CEB17769A526EE7CB816 hueyeapen
1,666,304,359 *AF53EF6A2DA51664AF43A681102F4F6ED02AE8D6 ARMANDO.THOENY
1,666,304,360 *AF537E26DC6398AAD2562B1BC37E0090217E5113 arronlisenbee
1,666,304,361 *AF5A5DA921DB1A26CBA2AC492B92D3643E710724 asdfghjktim
1,666,304,362 *AF5DC21D26E45523B50D5A7E498E9AEFE7421BE5 AUGUSTINESTARZYNSKI
1,666,304,363 *AF522A3720DC1087687B997F44B0B0CD7BC709AB AV+EM
1,666,304,364 *AF512B39EF0A13EEF8C7A95B8139E2A967D95B23 INTERVIEWWITHLARRYJOHNSON
1,666,304,365 *AF5CE2A3FF6D899B139A8849C575F9BD4D674B56 babyjr
1,666,304,366 *AF507A04720D070029FEF923C4BF1C4BB699AD5C bamp6
1,666,304,367 *AF5B981ABABFE377541274E1E3E6172AEDED9A1E BANTOTILA
1,666,304,368 *AF558ADB933EB8940C08358E36E31747D0B289F8 BARRY.TEIXEIRA
1,666,304,369 *AF56CB2F4295A9D8A0B439834B7942302D92BF9F BDSC1
1,666,304,370 *AF512CDD40DBE25FE45CF6233C690B3EC8E7BE7E BELINDAWILLEMSE
1,666,304,371 *AF59CAA096C7B8AB57EB3113F328D279FF7310B1 b"gus
1,666,304,372 *AF56046BD887852969FA2F303B01AD6986912E6C [email protected]
1,666,304,373 *AF546B1E96161B4D31FE56E93A6B2207C81A1FD4 bi#3
1,666,304,374 *AF5A08C7CA257C5B0F610B4AE6285FAC32007627 billydomingus
1,666,304,375 *AF5188205FE5E0BBDD3EDCC894DD65B943945D92 JERRY.MITNICK
1,666,304,376 *AF52D7E4273C628E27CE16D2C41256E3C0551006 BKXOJ
1,666,304,377 *AF5112C9F5BA70002053FCE599CB377B170B8FE1 jjhg
1,666,304,378 *AF5AC188347FB552CFE39772FB24CBDE06FAEB0A joesphrownd
1,666,304,379 *AF56EBBE5F926BC874288CECEE348E3EF97A8B01 BLOCKEDKICK
1,666,304,380 *AF5F2A517BFF6DB1F401A0AAB2E54B948619CED7 bm5
1,666,304,381 *AF5D1F9B95B9BA94D2231AC407B7A014EA8AE29F bmu1w
1,666,304,382 *AF5E0CE64A9F5B5B83A19330A7B7124610DAD599 B?N"K
1,666,304,383 *AF585EF639E06B6A982589033C10B7624F536931 [email protected]*-*-}o{
1,666,304,384 *AF59E1148334AD8088A0F5F044BC763C37601FD3 josuedudgeon
1,666,304,385 *AF5FD011570A558E1960C4DBC13053344F51ADE0 BobCarlisle&LucyKane
1,666,304,386 *AF517CA4888C1D4D4E48930E231611A6DA7C72AB joyousness
1,666,304,387 *AF56B7B9A5A7E33E985197133FDAA89D7E4CD8F2 jtic
1,666,304,388 *AF5B586FD5C200D530680181610EFA51A21B3A23 boo+black
1,666,304,389 *AF55144F21517767788ADDC267A681462E262AE9 juliet.hill
1,666,304,390 *AF51C1B5C7416B793667B4FA90232C30067C75A4 [email protected]
1,666,304,391 *AF5E31AC0237085D57D65BFDBB2E60561F66D3BC JV`W
1,666,304,392 *AF5CCA9E9C8C791D041092497C16EC00B76070AC b=?p+
1,666,304,393 *AF5E7568CEF4A52F148D2E19319D6BDEFB525BB5 B------P~~:p
1,666,304,394 *AF56BE1469DFCE13AE2A9F6B3FD8498260802C83 BRANDENBURGCONCERTONO3INGMAJOR:IALLEGROMODERATO
1,666,304,395 *AF5A22D94CD990F84F1CEA533C0957D3EDD79F68 brb/q
1,666,304,396 *AF5EF8000D685A70B14A55DE36E7D64764B4048B kendallhoesing
1,666,304,397 *AF5877244E9AFB0FA27827798DE67CC22F3AAFE2 KENDRA.KEMPF
1,666,304,398 *AF5604AA9EF8D08D04FDE4B48B6FD254D02D8C92 KENDRICKBARRIBEAU
1,666,304,399 *AF52F3FD970F122A63B267947058250BF2B6990F KEN.HEUSER
1,666,304,400 *AF5EBEBD021AFA4174AD34C8F5AE089340A21135 BRNENES9
1,666,304,401 *AF5EBD50F3A1326BAFB37BECA0F3250A58A79B17 broderickalvernaz
1,666,304,402 *AF5B4A69835A325D0012470C392620AD2274D139 kernstueck
1,666,304,403 *AF50C2B858CED296DED932CD894D875DDE6F616F kimniting
1,666,304,404 *AF56B1684166F807527C86AEEA688B68D14D3A1B kirbyfrancese
1,666,304,405 *AF5BA98FE91045DD3B570DADDB0443818D21EFF6 bt?$r
1,666,304,406 *AF5A35FA1A2FF744918AFA8A100C1157F9FCD950 KLEINKIRCHEIM
1,666,304,407 *AF585924704684127A9D742A435686B0BB156E5A KLUCTIC101
1,666,304,408 *AF58BF829B74CD129BB651132363086D19C3D582 knneltv1
1,666,304,409 *AF57ECFA78C797205D5536CDF4247DFCE8153BAB KOTODAMAHO
1,666,304,410 *AF591BD824974C49FD83EF569065C4F6FEE1B68C BURN-YOUR-ATTICUS-SHIRT-&-START-A-REAL-BAND
1,666,304,411 *AF5F0B3C0BD5154C4C8F7084DAE8C52B3DB552C0 bvl=
1,666,304,412 *AF56F59ABBC64DFA6AF8D489ECDC3FC693EE06F7 kurczych
1,666,304,413 *AF5D3DCD3026CE0F933D1E11DDDE1CDF3F3A6557 c.1:v
1,666,304,414 *AF52E72664C72AEDECFD78E74F67BE1B364AFD98 C/5+P
1,666,304,415 *AF5F4D422AC0749A44D316BF66F932B0AACE9F6A C6$NJ
1,666,304,416 *AF53F7F49E6337BFE1347929EE36D478F2538B72 C$9b
1,666,304,417 *AF5D0DA6D3F3B65653D244A7E4ABE44207674A64 LC-GRAHAM
1,666,304,418 *AF579BFCE197024EA13226B26090FA323AB5E4D4 LE4CHE5+
1,666,304,419 *AF5BF15D57ED379BEE451282FC93E9AAB27AD99D CAPTAINASDFJKL;
1,666,304,420 *AF50FFD22013BDC4CB00C25D582647EE7AB6BDC3 LERNZWECKEN
1,666,304,421 *AF5ECC2FD23B218DCA1AB449B4DA522CA301997E LETZTEMS0
1,666,304,422 *AF588B659D33B753AF7A1B159B38D63B2A7A3255 lewissouto
1,666,304,423 *AF563BE54D4EC6110CA0FA61DC3C71F714B5262C Cash.Advance.(Live)
1,666,304,424 *AF53FBDE9FC3BA6544BE7D333B7A2CC6F7FA0DE6 cautu
1,666,304,425 *AF5E74CBD19C7B612634A45C44C4B901358C35ED CBHNU
1,666,304,426 *AF58DA59D6ED828C9FCD472EC045B4B9E01F8C6A cc/31
1,666,304,427 *AF5E293489C8723CFCE770EC8C681E4B60EE6D00 LINDSEYDELLI
1,666,304,428 *AF525073774263C27B8F257A17BD570E842882CE LINDSEY.PANARO
1,666,304,429 *AF5F78CAED9724C68EA37AB9F57DDC7EC6333B7A linh-tran
1,666,304,430 *AF54B5AA245C39089660D498522496522479F4AF c:d,
1,666,304,431 *AF54481BCDB6BFFB8FB8083597300DA38C543465 LJL8086
1,666,304,432 *AF53AB3E34F5D8FEB72CB55A781165D5D458BF8B llamas12
1,666,304,433 *AF5E08DFA63A84EDDCC9B03A8A478CCD66C2ACC5 CEREBRIC
1,666,304,434 *AF5A72BD51784FC51472E0380E0C801178AF9891 [email protected]
1,666,304,435 *AF569456A5CCCF2F3A9B4021286D905659AC5FEC CHEFIAM4
1,666,304,436 *AF543A8B7EA897ED24B235CF4B16E887B29C002B luvanmusiq
1,666,304,437 *AF530C2284A26EE119D35FBB08EF400DFB82C208 chibiroboparkpatroldsgamereview
1,666,304,438 *AF5AEB5821A9BFC05EC52A363D8DED6139E26926 CHOIPOH
1,666,304,439 *AF5415C0D0727650464B0B9B59025E9C6BF2FC5E christy-slaughter
1,666,304,440 *AF5C03CB720C67EA046A7109AF39820D1F34AA8D cigff
1,666,304,441 *AF581D74FAB84EBAD492736DE69D7AA1A6E02256 MARCELLUS.PROPHET
1,666,304,442 *AF5DC2E31056143A19C6BD18965B8806A0ADF735 cjrah
1,666,304,443 *AF5A1F1E586BB93C40B5A429E743E7819B1A2258 ckmni
1,666,304,444 *AF5751872E4F8BC85D822EE204D75BD24530AFDA MARIOSERVINO
1,666,304,445 *AF5BF3F17CA7AD4DEDB1E656CA1011C7BDBDCE41 MARK-DECKERT
1,666,304,446 *AF50B6C6E2FC24CD48458FB145683077B60572BD MARK.GEAL
1,666,304,447 *AF598CE9751D20585571086ABE8372B911E95A5F CLAGGIN'ON
1,666,304,448 *AF5E653D0C4797A7497E2064F1815FDFB1501C59 CLAYTON.VANSKIKE
1,666,304,449 *AF51D9F915968EFD65257905B998A5F8414747A6 clcntss3
1,666,304,450 *AF562E116538EA89BDAFD34D8B6EE862E4A100B7 CLYDELASTRAPES
1,666,304,451 *AF5762139E39B4B5DD63500D6774449CE7E4344F coccothrausteses
1,666,304,452 *AF599AEC5EB45B976F6420055B05A8E5A794188E CODY.BAILER
1,666,304,453 *AF5E588D6B76E2542BF0F5BFC8BBC902CB371956 COLLEEN.SMALLWOOD
1,666,304,454 *AF5199C811FA0AE0D79B99DFB9D8A7B244AF986D [email protected]
1,666,304,455 *AF5E2BDDB56D88DA9C16F7E67D1687FBB7514735 MICRORHEOMETRIC3
1,666,304,456 *AF54980A915ED6B53C1329B9CC7681FF9445AD3D MILLARD.SHULA
1,666,304,457 *AF5658427D46B0DAFFE377F73BF22307A63B1B38 mindmachine (original mix)
1,666,304,458 *AF5979684CD195366FFA1847374093E849298399 [email protected]
1,666,304,459 *AF5E43F05B1531F6F65247B5B4535EAB73F853D6 MM3BOYS
1,666,304,460 *AF50CF6ABF4102800E36CCF7B70AA2EB65E1D575 MOLESLEY 1 0
1,666,304,461 *AF541B6A67324607CB5C415800F749EBB0AE2933 CR65O
1,666,304,462 *AF5EBA36FC6E4B4BA766EE0EF088F39A1A8C0663 morpheus
1,666,304,463 *AF5F025C317E2B95338FC065261134A783E329B8 MÜCAHITTIR
1,666,304,464 *AF5FB8F9382099052C3B9C83637F6107CAC2DE4A cubanplaya201
1,666,304,465 *AF50AF50BE9C89891B694897EEF3DC8935F18C76 CVWD
1,666,304,466 *AF52127D6B9087CFE88CE997367671C912396482 cwvcc
1,666,304,467 *AF551EF12B087948938B16AECBDA9743224BD018 NAFYEQAH
1,666,304,468 *AF5BA7584EBAE55E4F4EC99313C7E9E87D44E40E nakedsydney
1,666,304,469 *AF5866106ED1EF54F2BC09023FE9E1CECB7CBE94 NAPOLEONSELLER
1,666,304,470 *AF52A516FFA658411D5907C88DDDF6775C12168B [email protected]
1,666,304,471 *AF55CBEE42F6AE76A4647407A2153609EA3D7F30 D1A89
1,666,304,472 *AF5FEDBF93D088242C53BA94E192A39FD9EBC1D9 D)71E
1,666,304,473 *AF5D298EDDF852FE9048DE84D7F5A5D0FAB04009 daf84
1,666,304,474 *AF54FE306683786C940ECBD0D580062B516EC422 DALLAWAJ
1,666,304,475 *AF5B40B91269E05C8E80BAF90ED2EBFF94EC3A87 ninneive
1,666,304,476 *AF517959B280EA45220A754F742094A19D35629A DANTE.DEPRINCE
1,666,304,477 *AF5A90618FAABED425E05ACF6A7E55B6F41E8C80 NONPROFITABLENESS8
1,666,304,478 *AF5EC78EBB86539B0FF30B4D9637526230B768CC DARRON.GOETZ
1,666,304,479 *AF53BC1796751A950E325031587067B04E28EA86 OLDHABITSDIEHARD
1,666,304,480 *AF54899F6E86A3EAEB81C686ACCC5FCCD921EA20 [email protected]
1,666,304,481 *AF5ADE60B830EB0F41EE27C862EECF597DD8B774 deferral5
1,666,304,482 *AF5B8E4A661DE24CE25E0BE5AFF2E8F9EB694106 ORLEALIVIA1
1,666,304,483 *AF5326732441653D62480E8FE476CFF218160CF1 ORNI7HOM4N7IS7
1,666,304,484 *AF55E4C7888863FB328B2A5639B045022E9A73E5 denislars
1,666,304,485 *AF51995BEFEB631D3B2B50B08A98BEC2874D70BE DESARMONIZAR
1,666,304,486 *AF5CF0CD4EBB8D4B3D3B261A4F607A8EB34F1E5C DICKME.BBS
1,666,304,487 *AF58ADBBB2FA7ECE86A734CF4ED38D5E0F1D9215 [email protected]
1,666,304,488 *AF56E11C5576F43BEFBB8A1A09CC3D8ADB80EBAD DKAEI
1,666,304,489 *AF550785763FA08A53CC42BB4BB997D33C11B7F7 DNA"H
1,666,304,490 *AF5E8C3C64A212EF4BE581E09A2F7A547A56CF2F PHYLLLIS
1,666,304,491 *AF58854DF26D50200ECA3A5BB9B948428FA9C6BD donniekocik
1,666,304,492 *AF566BE44EDF68045272EB4F591AB28F8F05C776 Doorploeg
1,666,304,493 *AF55DECE907B757EC8040F03D9CE6B2A3219D543 plantadurioù
1,666,304,494 *AF5DB0E94935615FCFA3C4158E2C7F599C584B93 [email protected]
1,666,304,495 *AF51D137668F67746BB7F96CD3C8745483FD21D5 pl$n3r$
1,666,304,496 *AF536CE1E346C1B96FB7C1262DF355758740E966 [email protected]
1,666,304,497 *AF5781887EF5955D56A978133E4410443630B8D5 D)PJJ
1,666,304,498 *AF5CC405C86B88E5982B02852EC9EFFD7D43B215 dq2_k
1,666,304,499 *AF59B53A606151A7B164A713232048DE9C99732A drplease9
1,666,304,500 *AF553013EA4906B59662CAD3CDB3EDCD88959D50 d?ysz
1,666,304,501 *AF585F8B66D1F82A579B57BFDD83C4A5F9B52258 Q=D~ ~ ~ SPLAT!
1,666,304,502 *AF5016B1F2BD4B7B8E8C730FCB9FEC47FC1C44EC QERTYW
1,666,304,503 *AF51870DF8850572A41346934D37452B15910342 [email protected]
1,666,304,504 *AF55595F2CC2151BE5D09B39071764A520F51473 efr%
1,666,304,505 *AF5AD31048E73940468EBA071941AE01702403E2 EHILDAED8
1,666,304,506 *AF5A8EAFAB1FD47DF7D0E9D449DEB9470EB261BB EIGHT.POINT....NO,.UH,.SEVEN...
1,666,304,507 *AF510F40EC74EEBA6AABEEF4194BC2960A0EBA58 EKANIFE
1,666,304,508 *AF5FE7FFBC0DCBD806BB2FD9D6655D011F38C053 EKWVW
1,666,304,509 *AF552160309F911E39DAEDD29F38BBA41B8B3D50 embaymens
1,666,304,510 *AF5B2E5AE13D8149427B609CEE90D5C28DEEED94 ENHANCEDSOLDIER
1,666,304,511 *AF51C32D495237D196B4E763D90700800193CFF9 ENTRETIVERAMLHA1
1,666,304,512 *AF53081B0DEAFDDBF88E38151E9FE89D46EC3C7D reneabell
1,666,304,513 *AF5EDAAE311B8DA2C47B1EF83040CDF1AE1AFA98 ERNESTO.SPORICH
1,666,304,514 *AF5D82C562854A262C76B63F8120F93E5106CE39 resepuswww
1,666,304,515 *AF52E638BA5A70B59D3FD97F8B7015BB947E4872 RESPEITARE
1,666,304,516 *AF55FE2B785986DE36050F3FE5E67B06DBC0C580 ESCOTO
1,666,304,517 *AF524A36C78A9B1B5BE8BA8D818D05521B127C48 ESTACION.SANCHEZ
1,666,304,518 *AF5C00094962196D1441AB2FCE0D92E4665F3048 ribb0ni$
1,666,304,519 *AF57A96B539C4C8DEAEFECF926217C17BCB01D3E RICHARDZLOTNICK
1,666,304,520 *AF5CA691AD6697D45E49F9773B617308D8A3E276 EVELYNCHOO
1,666,304,521 *AF5BB7877050CF455085D9F8A791AF7176378A6F r.immer.jung..meine.schwiegermutter..mick.jagger
1,666,304,522 *AF527DC6150C33535C7CB2219DA149AFA3F2FC50 EYw
1,666,304,523 *AF56657469C2AD44F66C4424829EE9C2D3708239 rob.kingsland
1,666,304,524 *AF582B81CEB505D19070725A83FDF6EBB36E3A7B FABRIK (RADIO VERSION) (FEAT ERIK CLAUSEN)
1,666,304,525 *AF5AAE7894C04288A61496776E92F58589E8BD53 ROOFTOP SUNSET
1,666,304,526 *AF5CC6B1F3EAF1AD028A4039C4593172DD728825 Run,.Don't.Walk
1,666,304,527 *AF5C83744A69566D1104712A324B5A985DEB28B2 RUSSELLRADSEK
1,666,304,528 *AF541AE8B93620402A0C186FF3525C1F4EB44DBA FKAMARULZ
1,666,304,529 *AF529AB362D1C07F7314BC6A18CA6E5D3739B461 SAGVAND1+E
1,666,304,530 *AF5B06128A9839DA3E6AC237DEE0C1EC0B8C2D74 [email protected]
1,666,304,531 *AF55C3BAF27FD44743AC602B0EF47D140E5A2381 SANGRIA
1,666,304,532 *AF5376457113B11F8F780A128E9F0245C3B2F5B3 FRMAGNYSURTILLE
1,666,304,533 *AF593D7938F5EBE636B2E138475ED5F07758EB74 SEBASTIAN.GUZZIO
1,666,304,534 *AF536DE6BB286FF29498D420C75CAF4633B7AFE9 secondofficer
1,666,304,535 *AF528EF6BEA7CD0A2CCB9BA224397A4445DAFEAC SEIZOENOPRUIMINGEN3
1,666,304,536 *AF51DD6F0009CC9CF815677CC00342328483CE42 SENSUAL CONFESSIONS (THE CLUB DUB MIX)
1,666,304,537 *AF5C3A31AE95B1827A590002B85357AD4634A698 SENTERES4
1,666,304,538 *AF5C52A9C25BE32D6F6F669D6111BA62A4CDBF62 GÄVLEÅN
1,666,304,539 *AF5C7395AE67DEA9BD3EBC443B762B51E61FDFE8 SHAUN.HAMSIK
1,666,304,540 *AF58CEA902C338F51D09EC7E1ADF3636AB9FC0DD SHAWNBOOKS
1,666,304,541 *AF563382989A519254121A94329B683E3A97ECC3 SHEISASLEEPI
1,666,304,542 *AF5961B035EAB8494149559415B1C5E852A76139 [email protected]
1,666,304,543 *AF51DF156462229254C5344A5D18C34C83C42E92 [email protected]
1,666,304,544 *AF5FCFEF6ACFEEB3615B384F7C3788697BFC6935 Girish-Puttasheri
1,666,304,545 *AF5B1201AEC5AA815F12EAB7E6CDFAA5BF9E468B GLENNMCERLEAN
1,666,304,546 *AF5BC2CBA3002049CA86A6C65553144FBB9327AB gnirtseo0
1,666,304,547 *AF5968515B07ED883872B830E9CCC9B91006BFE8 GONE (LIVE AT TIBETAN FREEDOM CONCERT, NEW YORK, 1997)
1,666,304,548 *AF513BD4E597D3ECC2BAF0D8F6E1A956AC33761A SMOKWERK6
1,666,304,549 *AF57F346601F89CF705F614F6880058FA7D1B66F grades
1,666,304,550 *AF58FC2E9E0CFB7AB90563B4F9EECA97A90F253D greeshma-tiwari
1,666,304,551 *AF5618BA319D8EC97CEE0BEDB10A4DF3C95F7E5E GREGORYPEGGY
1,666,304,552 *AF5ED7F33B60BDE6FF019444943A52378D82D94F solutionnant9
1,666,304,553 *AF5BD21DB4FE3A7F2154FE762676ACF1623F612C GUILLERMO.JARREL
1,666,304,554 *AF56DFA103DA407A5F39271136EE0E3EDA4DEFD8 SPEEDOKIMBERLY!
1,666,304,555 *AF57F46CD8EFD60086152B4361C57356F2FD6D98 SPEKSLAGERIJ
1,666,304,556 *AF58786C39A358E68599CA4D06DD88B0E328AF5A spermophytic,sp/[@]/rm/@/'f/I/t/I/k
1,666,304,557 *AF5B6CDEB1B3693EFCCBE771EFF9E0D6BCF061E7 [email protected]
1,666,304,558 *AF5D4444DB7D7E7B404E73846641051A3CC88EDC spngck.n:.spngcks
1,666,304,559 *AF5832BD413625F01E672EB91BC9567DBB68C90F spoliatrices4
1,666,304,560 *AF5FB8C6F23A17E8018B1B0EFA4DB7887A79E0BB SSBILDES8
1,666,304,561 *AF5F922273527DD3F069819DDCB38B065624D410 HAYWOODFURMANIK
1,666,304,562 *AF5321D8B7FED1C67BA57B46B94E7FAC5489AFE5 SSTYKNEL3
1,666,304,563 *AF59A9EDD59855676BE81196C13AF879FAD9632E STANFORD.GALABEAS
1,666,304,564 *AF5E424F408A6C203231702AF0BEC232DA909606 hBbaa
1,666,304,565 *AF557041277BD200716BA26EB1B1E7823671DC7C HERAUSZUKITZELN
1,666,304,566 *AF5EE448BD28196B0FACDCF27924C6635574F414 STOOKSELSES
1,666,304,567 *AF56EE5B6C463BE38A444271423C45BD17FCA4F8 STUDENTTNZEIT
1,666,304,568 *AF58A467DBFB33B423A068A5D410493A4B37D601 HIT-COLLECTION-(DISC-2)
1,666,304,569 *AF5A44CE18AD89FEC10EFB49C63F919CEBFDB52C hkg
1,666,304,570 *AF5B71410747E374D774D5F4F88EB6BF1E4E053D horacioaamot
1,666,304,571 *AF571A8B35DF2F1AD51713361384CB2452CCDDA6 [email protected]
1,666,304,572 *AF5FA0511005A87BEDAA59AD081D21A27033370D SYCOMASYCOMA
1,666,304,573 *AF540AFD31F10BBA53B75B5DC179BA6E5E13FA58 [email protected]
1,666,304,574 *AF554B52B0BABCE1BE009FE7486AEC48C942A498 talk90193143207
1,666,304,575 *AF5E081CC6D7E48997F07DE873A3C6C16587409B TALK90.198.115.222
1,666,304,576 *AF567C56EDE0A9561841D2B8C5578D42333756F6 TALKALDJARRAH
1,666,304,577 *AF5BB3B78EDB5A5CE3328A0C429453EAD5C40252 TALKYUHUNGRY
1,666,304,578 *AF5925EB4AFA6D2EE47558EE11002C77B154B4C4 IEA)
1,666,304,579 *AF517FCC9340BD8D45114C676554A9DDB52FDD42 TARA HIX
1,666,304,580 *AF5F593683F0F7E4E54E4B185C53A03EF9D32217 TARGETT0
1,666,304,581 *AF55DFB088CAFD96FC66EF4713DA77A7D96CC782 ILUVPENGUIN72
1,666,304,582 *AF5061EE005F93CD0CEC5D922F98DB804B68D22F thadwindrow
1,666,304,583 *AF5AE9FCB26FF4BE7D9388DEE73FD75A6D203428 irytotra5
1,666,304,584 *AF527D70676C01FC10F82B96BB378BA6164E6CEE JAVIER-HENRY
1,666,304,585 *AF5508C2E899C19B88466E215EF9D5B9C258D5CC titusgazaway
1,666,304,586 *AF55E29AE35B529E7C0B03F438F679712A4A2E7F JEANELL7
1,666,304,587 *AF5D2798C5D59552F7BA2BF0404A188C5CEF6EB9 jedoddo
1,666,304,588 *AF5EC142C7A29B103680E1692F1731E3B16B9FAE JEFFERSON.GROENKE
1,666,304,589 *AF52CFFAD3D4E0BC6D5E3737927798DFBF223C22 TÓIGEADH
1,666,304,590 *AF598F258FE0F3A2C3A4D8C61B89F4251B793312 jenniferpurdyjames
1,666,304,591 *AF52C16C3AB4525A5FF8762F516B1632CD27BA6B jerrod-volkel
1,666,304,592 *AF568AC9195B04D71A0176B7771031D080E20191 JIM.AMILL
1,666,304,593 *AF52B761075CFC06B964BE28CDD7B3A603670318 J{{NEV{T
1,666,304,594 *AF58A8D7EE617E1A6A41A8AEBEC1C7ACE3AEFF11 TRESEDBALTHAZAR
1,666,304,595 *AF532D0AA9F4246220468D0C20E33DBD4116FDE7 joseph.w.bradley
1,666,304,596 *AF548098AEA2F461113841EFC303B66C79747B00 kaewilliamsjr
1,666,304,597 *AF5B7BD3F4B80AD3E9F9415A67ABCD1EC1A4FCCC unadaptively1
1,666,304,598 *AF5A0DA41E298A3CA5610555513E30D9D6F95FA1 UNIONCENTERCENTER2
1,666,304,599 *AF5CB10730C556D4E02CF3279B91069905BE8010 UNISELEDUA
1,666,304,600 *AF59350CFD9C1E4E9CB2965FAD3954C5C8CB3066 KELLEY.CAFFEY
1,666,304,601 *AF5B50D3AC508096F8B5A79B4361EB3A5A689A03 kelly.renaud
1,666,304,602 *AF53E65FE22E926374073F426728437DB689BBA9 KERAILMAN
1,666,304,603 *AF57B68B2DFC1265F9D80E95BE5684AB90B17715 KEVENCHAN
1,666,304,604 *AF5702903042D600C44E192883B8EA60F5FC82EC valcons
1,666,304,605 *AF5C256C6569CAD1EE8F29C98D7A1E5FF6D3EDA7 [email protected]
1,666,304,606 *AF5CD0FF98649E6E286B1953222C3A0001ECE5E4 koreymarberry
1,666,304,607 *AF5ABFB88F8167644CB8E69AF153B220621E69B0 VERMUTER
1,666,304,608 *AF5DFE2E9E14B151D9021BD2C8EE92A73F7C67F0 Lagting-'l/A/g,t/I//N/
1,666,304,609 *AF5635E4CF9D54871ED94A58CB060D575FAF1820 Lee.Ann.Womack.&.Rhett.Akins
1,666,304,610 *AF5007204F9B82EE2F11BCEFDFA23CCBDC2A927B LEIFSHADLE
1,666,304,611 *AF56875A485913494A2951EC612F92B6C1C5D7E1 VIKASH.BARANWAL
1,666,304,612 *AF5397F35A0E43BB63A5B147D6EB5D49DDE0B4C9 VIKISOEZ
1,666,304,613 *AF587E8D220247919AC2265F31F7B81DEDC16AF2 VINACEUS8
1,666,304,614 *AF5579DEACE5F5E25ABE8540E534DE58C7AB8B43 LEVI223
1,666,304,615 *AF5997AF91BFE821C986764853087CCED4FC6740 voedselbronnen6
1,666,304,616 *AF521A68EFCF411B53F31B7C0AB6F4F9A752154A VOURUKASHA!
1,666,304,617 *AF5A747EE006B05C80132C32DEC7E987ED500683 WALIDTAFFASH
1,666,304,618 *AF52EB685F71F2A315003CBBE574176FA91D21B0 WALTERGERCHAK
1,666,304,619 *AF5E66849A00129D3AA0D6CD0EA7858E419470C4 WALTER.NODARSE
1,666,304,620 *AF5A7EFD5BFA8C467368244D83158E1D0E6F6EF5 WANDA-MCLAMB
1,666,304,621 *AF501FEE51BCD30DAEE1F94973078719C0310C32 wandul.daramawan
1,666,304,622 *AF56469F12347AF4FCB1A57B1C3437553852DA23 [email protected]
1,666,304,623 *AF5CA53A0067B73131675EE6A7B6864B6E943387 lochiometritis4
1,666,304,624 *AF5522204E68FACB7F62BEED318B349C204E709A loml
1,666,304,625 *AF5BB553DFE2B55FDA241121B7EB60B8B6C79C8E WARSAW CONCERTO AND OTHER FILM THEMES
1,666,304,626 *AF5ACE8B5BA6749EBF5171C7A0974E7D2C05CB87 [email protected]
1,666,304,627 *AF57C622CF2468B953C1CB12FBF05D6E8408B6E0 [email protected]
1,666,304,628 *AF5081419AEE4E0C3C4C4F8249F5BD5C0ADCFF9B [email protected]$7
1,666,304,629 *AF5E79EA18F08228138E5941B68B4B74B2401035 louisemetal
1,666,304,630 *AF5B0446D9181A4829FB784E0EF94E0572C711ED LPETAA
1,666,304,631 *AF5423E2B345743BCE91EFB5359997AC45AD4A42 LUISREVILLA
1,666,304,632 *AF54DA45FC3C6F537E25E1F45AFC4A544D3BFFD3 lymanjerkins
1,666,304,633 *AF5CCF1DD5149D6A96408D294B57798C774C7ED0 MACHINABI1I+Y
1,666,304,634 *AF5B116022C4BD8B7777FF5BE39A6A039692CC1D [email protected]
1,666,304,635 *AF58328FD2B91BA46B26793E4D4ED24CC1DEAC95 WILLIAN.ELIEZRIE
1,666,304,636 *AF51C176A77066E77120477B448AF006731026C1 WINFORD.COUTURIER
1,666,304,637 *AF59FBE33A859FB4C40E90813BA2D04DCDFD5952 WINFORDDUITSCHER
1,666,304,638 *AF5E8838714EE2FAF5506FF0B76B9E4B234CEB62 WINFORDPALEN
1,666,304,639 *AF51327A6E5D1E34F0FB88075C672F86EDAE0627 WINSTON.IVERY
1,666,304,640 *AF561FD7BCD560456FF7D1EB82D834F45325AAFD with every step
1,666,304,641 *AF59F59436F59F2BE452442B9CB16D911DC9A9FE [email protected]
1,666,304,642 *AF57D47A6F23E112DC448A9723C95AA3CD536DB8 MARCELOFLESNER
1,666,304,643 *AF5CE1FD730CA09B4D2D6FE4A330E5A077F6195F marclamberty
1,666,304,644 *AF5D51F61A98484F2F0632B7038F2D56D355F756 MARGARITODRENTLAW
1,666,304,645 *AF5F276258D2FC206AA31B2889E53736F2EC8E13 [email protected]
1,666,304,646 *AF57C17B2E6F0738FC8B2E1D89937BACD6275C54 MARKDELAGOL
1,666,304,647 *AF5B23F99A1DEAFE09E4BF6F7595D24DDD6723BB markusblakney
1,666,304,648 *AF583FCA5897D01EEB49C687014A554094611318 MARLON.CLEMENTE
1,666,304,649 *AF55F2CB45FCAE6038641F762D122912860FF6AD [email protected]
1,666,304,650 *AF5C632DAFC09816A1ECD923603DEF378171FEA6 [email protected]
1,666,304,651 *AF53658188C899287C76FB7302BDEAA7DC7E9C46 X127472
1,666,304,652 *AF5FD154B43204D76CE20ECF0218184B448009EB MAURANE3
1,666,304,653 *AF5EDF552E1ED6B920A321EAC43C450333A5C451 mbpqc
1,666,304,654 *AF5B60A8F1EC732D79D3C841272A9C30B34E6DA7 mean-apparelled
1,666,304,655 *AF5C514F64B5F0905AA006CEBA686889FD1BF55D merrychristmasidon'twannafighttonight
1,666,304,656 *AF54E6FC9256A8B8E91B69DD20EFC93F61FB4763 [email protected]
1,666,304,657 *AF5369629CA51A5007CC777C395D038D70E75372 MICHAEL-HORNSEY
1,666,304,658 *AF5EB6FBAE7561458D68B93439B9FCA47532955F MICHELTELLEFSON
1,666,304,659 *AF548F8368DEF5CD53CB6EE19E9A42D121EA1BA1 YANKEEGARDENER
1,666,304,660 *AF5F3F8E9043AAA36BFD3BE0C5355F190965D9D5 YARA.CARDOSO
1,666,304,661 *AF58178F572800CD73AFDA11B5D959B976D9F1F2 mikko-esko
1,666,304,662 *AF573A20041F1C5B762C7C6F9CCBB50500DDBA82 ycnssi
1,666,304,663 *AF50FA893578ABF580B717BD1F584CB395669F1E Y-F$
1,666,304,664 *AF5CEDC4D2C282A4F33C715E4517822946820D79 [email protected]
1,666,304,665 *AF5193E6901042BC6F11DD1768BA9B546CEC2E63 mioDeConsola
1,666,304,666 *AF50859F25E20413E5EC158747F8E5B4AF167DC7 YODAS-KRITAPE
1,666,304,667 *AF5D8E26B6CD02B1B3FFDAA0F4E6F009C183BCCB yonder.....chickens.get.lonely
1,666,304,668 *AF5316C2A72D676F4A812D19D5467D5D2DF52629 MJGRLUXHJ
1,666,304,669 *AF5AA1C57285B6ACCA821E118ADD18EE3B899678 MLER
1,666,304,670 *AF509159F4131490D07E57FE4B765703CB1B0046 Y'/S
1,666,304,671 *AF530DB912918E1409CD18E943D21734D12ECFE3 MONKEY2008
1,666,304,672 *AF5A0CA030592C96F1B59ED178855257B5C42E94 MONTYPROPPER
1,666,304,673 *AF5FF625976B502670AA3DC041B6BFA62206DE39 zacharysedore
1,666,304,674 *AF55661E5023B543EDDE2DB0360404D9D927A4BD ZALOVAT2
1,666,304,675 *AF54B3A57AA062A313FE60EA9C71D0005BD4ADF5 ZAYNAB ZEZO
1,666,304,676 *AF526F21746413C1C99200E007AFE067CF3653A5 zeitverlust2
1,666,304,677 *AF570B6553E101FD60264628355CF8CE3D7EFF2D [email protected]
1,666,304,678 *AF51DFDFB4D625167D8974F341386BF7D32C9BF7 [email protected]
1,666,304,679 *AF5CB1B09D58CEE355FAE6E92F3BCEC0E24C29B7 zhikamaru-narrah
1,666,304,680 *AF53462523AFEEF560F909B78F9B82853F210129 ZHOTHAQQUA
1,666,304,681 *AF5FB8CA53B1670BDBF136369A2EA42462F1488D mpension
1,666,304,682 *AF5EF243A26F73394CB7AD27CD0D6BC94655C4E9 MSCPHLS3
1,666,304,683 *AF546562A9594C9DB8B519D9D5DC25F59F669D07 [email protected]
1,666,304,684 *AF5A1A1893590A632DF5B27E4FAC3280FE24DA98 ztxq5gtdrbr3xi
1,666,304,685 *AF50BF7AFA2624A0E576453629762EB3D9981B94 ΘΥΜΟΎ
1,666,304,686 *AF5E65DD539644049130FA10372BE4C077F63C0E відмічають
1,666,304,687 *AF541285E87DD23621D3DF7DCC3F8922F8A2E07B NADA-ABDULRAHMAN
1,666,304,688 *AF549CB81628C161AAB096CA98133876D8C821C7 nāfanua
1,666,304,689 *AF54CF36742F820145A44634ED5F96D301E6EF6C ДРАГИМИР
1,666,304,690 *AF5A437EFE1F0A72B190E1B7A0D03E09A2985242 инвестмънс
1,666,304,691 *AF5F5C2858E8364CE1880599D5D0347591BC915B never.seen.before.(iwolf.remake)
1,666,304,692 *AF5CE966EC8D8878C713D8B8AACC1706911D2DE3 NORMAND.POLIVKA
1,666,304,693 *AF5C3832BDB401B85E8B73BD8F29246C52B13471 NSMOOTHIES
1,666,304,694 *AF5A0DC7B9BAF289712D3591351E6282C7D9F212 NUMBERSDODIMEAD
1,666,304,695 *AF51C880A36930F5AC2333EBFB4188C8D5231300 NURI-KALKAN
1,666,304,696 *AF526BC49CC64D1FB4D7F22455FED5ECAB0A87B6 nwa-sw
1,666,304,697 *AF5019FF52D6E3F219DF613F62907B52CB0D64FF OCTAVIOBEVERAGE
1,666,304,698 *AF58388DDA9F3115DF4FF944DDC62BE3F56A31B3 [email protected]
1,666,304,699 *AF5AF6FF810D65764ECC6EE73223F5DA480E19BD OFFENSIVELY-LEANING
1,666,304,700 *AF58DC7F54BBFA1D28E0CA76B17BF7CDE5A095A0 OFFERS
1,666,304,701 *AF51EE0D87CD405333CC0AE0D207B4C226628DBF 核内のDNA含有量は生理的条件に左右されない。すなわち体細胞は
1,666,304,702 *AF58F13E45349797FC4812B62ECEDAD7D0D1B405 P6008311
1,666,304,703 *AF5E29AC8E9991EF516AEB50F44AECD13D5F4512 PACE MAKER 1/2
1,666,304,704 *AF56667AB67C2D6563D09EE1B8F9A2975BA00E23 PAINIOTTELUN
1,666,304,705 *AF5F0B36C48B7B093C5244CF93E6F6493E863935 [email protected]
1,666,304,706 *AF5D14F051841B7701A27A03F23736775BC15D72 PARIMOSES
1,666,304,707 *AF5DC402C2501F88016AC86241EF939D9BE5C39B [email protected]
1,666,304,708 *AF5C45DA07D08228C4F1B895E7BFDF522448F802 pasqualeherbick
1,666,304,709 *AF58B3653C08ABFB6EB4386F65BBD3E02783933F PASQUALEPETTINGILL
1,666,304,710 *AF56ACB6F0AB3CB6F01492B7DAA9657E471B5AE1 PASTINGI
1,666,304,711 *AF50A2EDDDEB27FECECFF7702C7E7A71B915E007 percyplatten
1,666,304,712 *AF5A22C8F35886AB7964FAAFCBA4B3A615F51FB5 PERCY.TURNBOW
1,666,304,713 *AF5559A7B680BCF6BDED52A2FC75833576EC8DB5 PERSONNALISERAIS6
1,666,304,714 *AF59B00249B38BA418F7D609A11A2516BECB102C PH33RSCR
1,666,304,715 *AF5EF16F56C5E1FB5346C01872ACEC034A606F29 phantom's-life
1,666,304,716 *AF5EFE2DCCB7CBB89B35052DB2B443D09CEC4C6D 0THATINDONESIA5
1,666,304,717 *AF5C9E668D35FC089BA0FE832848E380E908041A 1077120D0FD806B76D530222D04B9C05 DEATH00
1,666,304,718 *AF54A74DF7E26E10E12827986870CB163F239860 PLEASESNICKER
1,666,304,719 *AF56190B6E9B7FB38988FA311BB8EA7C2498A060 132.perheidens
1,666,304,720 *AF505494C5223991FD24DBC4F29E0E51B831A3C8 POODLE193
1,666,304,721 *AF530DAF046445EB1536606BDABF23A0D9DB87A9 POOJA-PUNAMIYA
1,666,304,722 *AF55E53452DCFDBEB1B6CABB8B51B108C0B2A64C popescu-ionel
1,666,304,723 *AF5BD7AF0BF558BCBA036A0D47361CE8ED08678A POR2000ANOS...
1,666,304,724 *AF503E1661CE1F1107BACED2E7D41BDED779C416 PRICELESSLY5
1,666,304,725 *AF59C32044E6CC936CE0538876623BB610647B6C princecomputer
1,666,304,726 *AF56F6C3212A46B593FABD563BD74EE2BCB32E92 1573822 omni-has-about-21.2-million-shares-outstanding-.
1,666,304,727 *AF5E4B13A9B02791B1BC1CF3063C14B07E43741B PROGR4M4TIZ4R4M
1,666,304,728 *AF5BE0A0C98EF270095E1B878094E9FC6A9FEA93 PROPALAVA9
1,666,304,729 *AF5BD9229A04C442E6E4C401B45143BAA67E9D77 17.FAR
1,666,304,730 *AF5B56EF583D4211ADD63CB8F8C0C2945CCD87A5 PUNLORK
1,666,304,731 *AF516A06A8354DD2F57A3F3C396DD048E763471B QAZWSXEDCRFV725
1,666,304,732 *AF5191F43F247CCC31CF3FD91D34305E2DC61C1B 1ARDINAAL
1,666,304,733 *AF5B0D2BDD3E03ACF4ED934F4BE8396F9E7BB282 1BROADSON
1,666,304,734 *AF5CB1D2BE63CCB237E0CA387F4A6A1C1890F2CB 1BUGUNUN
1,666,304,735 *AF5AD82734524E4203BDD0870AEA74C13282DF74 1EINESHISTORISCHEN
1,666,304,736 *AF5B77DEB1E7BC2E81117F3F153D906A0FF196A8 1ELEKTRONILKKATEOLLISUUSMAA
1,666,304,737 *AF570E44EDECC783FFE7C965474D85654AC83B61 1.ENTWICKLUNGSTAEDTE
1,666,304,738 *AF5F0C69F23F745AA6306AA52C27505B065AFE2B r0en+9en0$c0pc
1,666,304,739 *AF57338E9961FE449E652F34DA148AF58DD92311 1.GOSSIPPY
1,666,304,740 *AF563EDD809D1945718CBC0E79ACD97F4E7EF42C RALEIGH.NICKS
1,666,304,741 *AF5FE0DAB4655A9BE09AAFC43E54723BBF2E0DD2 1-humanit
1,666,304,742 *AF58FFF4595CD22F4F4EDD8F9CD9B052B80DD169 [email protected]
1,666,304,743 *AF56741BDF36095CC2DF5327F61883114114DABD ranchorelaxo(original)
1,666,304,744 *AF5BE8C8BDBEC0E77540E9C971B3157C63C0D157 [email protected]
1,666,304,745 *AF5EB4B47EF3F6CE2571308537F47F134F00D59D randybronn
1,666,304,746 *AF5CD9810744FB344F7D49D492783C47225CF676 1 JOJOHALTERINNEN
1,666,304,747 *AF5165379081C3C0BF010C7B1A75A45ED95581D8 1.jouhikvartetin
1,666,304,748 *AF58691F44606EEB0C3DD5FF135127E14782770F rashon08
1,666,304,749 *AF54CF361D7A9A6E790BB21E583996A9C113AD6F RAYMONLOUPE
1,666,304,750 *AF59433C780FBC3FB94A5D7A329266383278DD00 1.loppumattomasta
1,666,304,751 *AF588C5E131F95E06A009C706FB0AF47D71AD3C3 1maal
1,666,304,752 *AF50E1F491FDA97FE6B21ED78019584C35B0ABB5 rd-international-conference-on-orthodox-church-music-university-of-joensuu-finland
1,666,304,753 *AF5CB8F6A7331298DF1934EF0BFC1CAE92F62D34 [email protected]
1,666,304,754 *AF52DAAAD2B1C8C51A7D75D098D83D22A4B5231E 1onaardige
1,666,304,755 *AF5F30B3D87C35C5AF0D843C0B87A896BBCC9FF3 [email protected]
1,666,304,756 *AF58CFE1FE5DD798B9E50DF6A42F5532EA5AB7F5 REDCARRIE8
1,666,304,757 *AF5E5F66C83B032CC6E4015E26ED6FB4F27FF823 reecehill
1,666,304,758 *AF5BE956CDE00775046053B2B4D251C80AD6AFC8 REED.UZELAC
1,666,304,759 *AF5C7F18E38930A333440507C686E80C5CA0446E reg1n45
1,666,304,760 *AF5FB22C1B3B886635B4C4738F49A9879A21AEEA REJA-RONY
1,666,304,761 *AF5698893A331A7CE7915C35104FF6FB4D720DE8 [email protected]
1,666,304,762 *AF531F192308F55BFC409F7EB79D255FCAAB7979 REM1GRATES
1,666,304,763 *AF59FE3A4E4685DA5826B7485D64F040C956F922 RENECHRISPEN
1,666,304,764 *AF5C43728E7880E2BF70A18D792E997CDDCB4DAD 1-vorsorge-wert
1,666,304,765 *AF5E65ECA2A970C4F95801E6DDC24B665A83336E RETROTEM9
1,666,304,766 *AF51285392F75F5F2C2892D6912DA9D943618647 2019466 ERITYISESTI MATEMAATTISTEN LAUSEKKEIDEN ESITT
1,666,304,767 *AF558F0B3F48586B63A94E3F807EA2A5B835ED25 RHETT.ILER
1,666,304,768 *AF539989FF7C41D70EF9E02EFA5459405D361FFE ricobina
1,666,304,769 *AF5B2A5D07E08FE66CAD8670D0625AFF4B782D16 2183533 samalla.siin
1,666,304,770 *AF54C5E605F20A250898F2DF7729B29C17AFD95F RIO LONGAV
1,666,304,771 *AF5143238C4C4F284546A35926CDA6BABA26AF53 2224217 P
1,666,304,772 *AF5C0CBCBB8DDD46AE4FCFE3C2175A2BB0C1CA42 ripudia.
1,666,304,773 *AF59A59937AEE9560FB936E1B4121A841C2D86DA RIVERRED6
1,666,304,774 *AF5BC17D12FDFA0C20C7F8F162D4658B905EB0F8 robertemmett123
1,666,304,775 *AF53C2F5A4A5C34E65DF7F467E426A85B513D5C3 2459421 tiedotustoimimelkeinliiankinhyvin
1,666,304,776 *AF5AD8BA2B7B6710305FB97259D8F936946C7BE6 249122 tUrkiye-denktaS'la-omuz-omuzadIr-
1,666,304,777 *AF59371F7A54D582895F615D4AEA5E6E126ACAEC roccokukene
1,666,304,778 *AF5CC38F2E5CA35617D7F8BD86A7985E444F901F 2572378 mr-.-wasilewski-pulls-up-a-chair-for-his-interview-.
1,666,304,779 *AF5A4EEB5652FE6CF1F6160DB357F9DF3DCE4E6A 257623 virata haben vorboerslich deutlich zugelegt
1,666,304,780 *AF54BC934CFD7759B0B759F2B721D8072951BBD0 RODERICKMARIO
1,666,304,781 *AF5A90A306C80B2C4005AC2A08DF50EFDEF04A96 26-PHILANDERING
1,666,304,782 *AF59950987392527EB8B87C0AE8F6775A8032BAB ronald1923
1,666,304,783 *AF591A3B9C4C990E6EFA49A516D3CD0C8423405F ronwiggens
1,666,304,784 *AF53CA486086399790BF4110924ADA4858EF7D34 ROSEMARY'SLULLABY
1,666,304,785 *AF57873260B3ADAF415DF5D4A1D2AFDA1DA3E839 2998955 TUNNUKSEN FREENETIIN SAAVAT T
1,666,304,786 *AF521930812B7E993EFF9911893E42ECC8A2AF9B 2.bilesimine
1,666,304,787 *AF54919AB809F371BCC1B98C3EBEA364D7A48117 RP=2
1,666,304,788 *AF51F9B049BB874093BC5B9E73EBDB3F8C4FCCAE rřgind
1,666,304,789 *AF59739110E7033CBC57896F9E9E564850FD9803 RUBYDOAN
1,666,304,790 *AF5B6BA17254C6911EE940D997049CB616665329 2-DOPPELNAME
1,666,304,791 *AF51B79C202548B1BAAD4F63022E7A2950E26859 RUEMRPOP7
1,666,304,792 *AF51518C47BCE9E713CF76EBDFC53EE0106AADAB rue-no
1,666,304,793 *AF5D893593E030EDA46AE20B232B8DAE22DD2FE4 2FAMBERRE
1,666,304,794 *AF5766587E53CBF173DA1C6B0A3445EF25F62260 2iluvmiami0
1,666,304,795 *AF52D08D584C1111C5B1DC84266913F32325A3D3 RVOLMAAK5
1,666,304,796 *AF53CE48B7A8BB76E6A5D39151917867CA0E073A RWLNDS
1,666,304,797 *AF539E9509D34256FF1775EE118072B8759C5FB8 2.MERIITTILISTANSA
1,666,304,798 *AF59124D315B76AEA4144646978F7411ABD94FDE S7UP3F13D
1,666,304,799 *AF5BF420EFC52B9E65B6C4B368AC8D9823C0F880 2.POSTCENTRAL
1,666,304,800 *AF5D0BF0320799720B583590B81461F7ACF02DF3 2 PURHOLMANSELK
1,666,304,801 *AF586FBBE730384D806D1EC38708B87FB55F10EF 2-rakennepiirustuksia
1,666,304,802 *AF5793D3F5F0561EECEA354AE144B1C00499CFB1 safe.journey
1,666,304,803 *AF551EFCDD14A10B4E4B625183BF3ADC519F7192 2 SIIRTOLAISVIRANOMAISTEN
1,666,304,804 *AF5D84E4F983AC432A53F15460F79EF882739771 31.02.1381
1,666,304,805 *AF5CCE100711DB89A259588B8B3C88667E3EE976 sammiereissig
1,666,304,806 *AF5AC32A1D4A8538708193B918A4A02859BD766D SAMMYPEPPERMAN
1,666,304,807 *AF5EEFE5C7380D37AFDD11D678A8F8FFD34140E1 samuel.barreiro
1,666,304,808 *AF542D2D002C0A9D8E05400C2EF8CDA73C1D8202 3====D***splat!!
1,666,304,809 *AF5509D8844330786F5D52EC77C2D0FAFC03BEDB SAPPHIREKING0
1,666,304,810 *AF53905A72F0B1B98AA4DB85946AAF0F668E60B2 ŠARLATAANNE
1,666,304,811 *AF53A787C23BA9FEF4519E0C0F454D9620D9B25C SASHAKAMP
1,666,304,812 *AF5C9F792DE28770421B0660D285949F11E609C3 3######P`~.(0-0)
1,666,304,813 *AF51CA5C728DEDF6C16C5E8FB29C97ACCBCD50A1 [email protected]
1,666,304,814 *AF55533F22893BDEBD43B3C4AFDBFDA8BE9A13D1 3sam:n
1,666,304,815 *AF5D524D48AC340F1523EDF37C0C07B350C2B80A 3SIRTOSIN
1,666,304,816 *AF514C8A8ED11C58F305C87269B2E26A32A61774 3VRZBRTN
1,666,304,817 *AF54BF867A4C5E01ECE7CEA839770160BDFBE3B3 scherpre1
1,666,304,818 *AF5D40EEA1E64E52430273A778B91A811A408061 SCOTCALDWELL
1,666,304,819 *AF56C54C274E077AE6994A8DB4BF696531DB0F77 4-funkenspruehenden
1,666,304,820 *AF5DEE892AED38C6F262F5DB1B05C0B40FDEBEFA 4.HOME-IS
1,666,304,821 *AF53C59A8E86664A344171B045FD366AF8CE5DE4 4SARSSBSW
1,666,304,822 *AF551B117BE5EE2836596964E0AB70082BAEA778 4TONLINENUTZER
1,666,304,823 *AF5AA8D97F078F14E923C408C88D2DA3F7016311 525072 KALACAK-YER-MESELESINDE-OLDUKCA-SIKINTILARIMIZ-OLDU-.
1,666,304,824 *AF5A70EFF6EF8E5BA5D410A2A596086E206ED2A1 5-4-3-2-1,-parts-1-&-2
1,666,304,825 *AF545C07908CDA05C8CDA865F429124DAB7A87C7 54608 POLICE-EURO-VEYA-AMERIKAN-DOLARI'NA-ENDEKSLI-DUZENLENIR-.
1,666,304,826 *AF5A59991D61D2E18A0A74F47B9E704689A0C343 5BSWKCOLBSW
1,666,304,827 *AF50B3D28A72E8F6556C467C6C554553086F3F6E scottycullin
1,666,304,828 *AF57A836FA829B74A035181733F73F8D08911F07 SEGARAMS
1,666,304,829 *AF51F0C0788E706E7BB9184D2A480A012FF9B633 ŠEI­MO­JE
1,666,304,830 *AF50184D13AD728DCA153AA4C08E4259D8433CB3 selassiei(featreubenmaster)
1,666,304,831 *AF53E071AE39FC7E94F7FBBECFCFFD7A5C6AEC74 SELLABLE
1,666,304,832 *AF5E5B9EFBE4AAD7BA2A168D0990FA69B876F8EE 5INCITRULLISCA
1,666,304,833 *AF5FF810D8EEE57914E8B3D697EB45D94C6F9CA0 sergioyeropoli
1,666,304,834 *AF55966099534E5E70E07F8FCE9A75078DA9B54E 5KNURRAR
1,666,304,835 *AF5B2BAB836A6EADB6E74D804BEEF7F92029FEE6 5KUUTIOKILOMETRI
1,666,304,836 *AF589A3482C1DEF62B6265316B0BC63539343DDD SETHMCEWIN
1,666,304,837 *AF5F0FE3A44A47C6DEBD025906E312F8CE37592B 5LEHTIARTIKKELEISTA
1,666,304,838 *AF5455419A7363E52B654BBE65E3383F3671340F 5LEKERVEL
1,666,304,839 *AF5886300FD518CEAAB2442409EE130185DDD817 SFELORAK8
1,666,304,840 *AF548FE668532A4ABF841F001F1E01B14D7D8B6A shannon.weinberg
1,666,304,841 *AF585D90C2559E5D384BCC57BE8F7F79C760ECDF 5TEMPLAIS
1,666,304,842 *AF56CB49776D32FD80E4A4B84B9D4064B4711AC7 SHAYSHAN
1,666,304,843 *AF5B5384F673A22B686908106C91C7B26D3AFF2C [email protected]
1,666,304,844 *AF5EE10F511C92B0EFE0E226D9FB30BB27903BC7 SHIRLEYBASSEYSINGSTHESONGSOFANDREWLLOYDWEBBER
1,666,304,845 *AF51E96301BF23F2C7D60B81100199F1377C516A [email protected]
1,666,304,846 *AF52CEB12E9B810ED5DB9D08D0CB126C97425A57 6969gf
1,666,304,847 *AF514E7264015556F16F29BF0A8C4B9660CE6C34 6FANTASTIK
1,666,304,848 *AF5EBC0FA219BF0C0470C41290A2E3652DC1F1B9 ŠIBALBOS
1,666,304,849 *AF5EBA6B9EEED037BEF3733D8CC72E694309A4D9 SIMEON STEWART
1,666,304,850 *AF53D92E75F7727932C6998A6347641085726FB6 6NAGESLOPENEN
1,666,304,851 *AF5CBD823AC7A0C8F64179751C11415ED7AD97DE 6OXYDEERS
1,666,304,852 *AF592A0A536E058578D5E25B447BAAB1235CBA3F siovaara
1,666,304,853 *AF5B276572FAEF51EEC2F2480C505EC254A37A07 6stoffenwinkels
1,666,304,854 *AF515D1AC2322C11B47D667669866A7769F44CF0 6VERNEBELE
1,666,304,855 *AF51D73A49FD0EFB7EC9B1C79D0E23DE52EE4BE3 [email protected]@TI
1,666,304,856 *AF583071BE44290127693B16B1C2AEEF920664D0 smacchierai
1,666,304,857 *AF5E0F32F7C7426D6961B8D58FECA6DAAA508108 SNECK.POSSET
1,666,304,858 *AF59383D4C8156D07E36977D04B7A605671C63B6 767825 ON-MAHDOLLISTA-,-ETT
1,666,304,859 *AF5F9FEFF92D7F7A53F9670E74BD7C7B79BFB947 7ABLAKTASIE
1,666,304,860 *AF519823E7E93535C376D01F39060C01E54EE826 7AVANZEREIS
1,666,304,861 *AF53CAB7740229FD85D74ED0F506A3B98D48C08C 7BSWBUSSIEREBSW
1,666,304,862 *AF58441C001E92D466F0B96387CABD5E2731FCB8 sonate-no.-2-en-la-majeur,-op.-2-no.-2:-iii.-scherzo.-allegretto
1,666,304,863 *AF5096448CA1FC4F3865ACD0499E9D6955D10F7B 7F2A46B9B63A3DC88925DFB7530F7A2C
1,666,304,864 *AF5FE18823C9D11028B1EFEC9C634032AB2D6E16 sosteret3
1,666,304,865 *AF56AD3455A2EC6B20BD74E781F68F546DD7E039 spicksp4
1,666,304,866 *AF52C7F5D741D0FE37E03AAC4BBD2B416E9A6420 SPPR 'S//P/@/R
1,666,304,867 *AF5CCB800DE06E5AA29D5672D318DAE31660529E src=http//ecximagesamazoncom/images/i/01kgf2d25hljpg
1,666,304,868 *AF5A51F7E34458F44F91DEC5F1149E758B449E27 7YHTEISKUNTAPOLIITTIS
1,666,304,869 *AF5E8F158D01581F08D349B7682C4EA8878D7D5D SSRHPSHP
1,666,304,870 *AF518BB70535CE23CA425F7F75EB7D7FF0A16BB8 steviemcswiggan
1,666,304,871 *AF50363D32C49FF846864A2E1F1B530A37F92F75 str8ty
1,666,304,872 *AF56A805C50586D42E8BF864DA7D206E745067C3 STSGIREIEORB
1,666,304,873 *AF53CDABB393891D70B547240D496300F8F7F894 8ALLECHEZ
1,666,304,874 *AF5C83E98529BAF021E7324FF75637EF98CF76EB --8BAA
1,666,304,875 *AF561EE6E7BEF7538E64A83178E2EBB6EB9D2F15 8-----b-*-*-*)o(
1,666,304,876 *AF579803BE733B78E9B38094120AA9FF6C0CE56A 8BSWKONTRONNET
1,666,304,877 *AF5E55743918B2A4F567A21B763E63FF9B03885F 8D~0~osplat
1,666,304,878 *AF5A11C9B11C0BFE17D68E3BAFED5454CE406017 8GAMUNOS
1,666,304,879 *AF5DA42D8CEFC7DF6E86CE323B892E70831B416B 8I5U1F4+3
1,666,304,880 *AF5C6D316968FF5CC650132A4767003CE1400AEA SWRPUJBGPEVDR
1,666,304,881 *AF5E2953EA9D73E0AEECC85498C4E4258629F704 SYMBOLLOUISE6
1,666,304,882 *AF552676F585432FEBABA0EE5558716C1D221501 8MAJESTICING
1,666,304,883 *AF5618E6E01D8E20F83308F9ED5E192FC612A4D2 SYNONYM.1
1,666,304,884 *AF59D9078269651A9CD116E385C099016507F735 8####)~o-}o{
1,666,304,885 *AF5DBFB892AADE2EEAD0D14EFF59A94BE37BC34B 8####p~`)0(
1,666,304,886 *AF537602716333F9F6F2F06961310D7A8D85BF76 tadniederhaus
1,666,304,887 *AF5661A4DF81E0A583F2423852E49A85C58D630D talk9019568236
1,666,304,888 *AF57403DBB956D1401DD0DB1B587C07A43A3D710 TAMMY-RANCOURT
1,666,304,889 *AF554C22F15527B61BBD618FDC37AD3F82D2A931 TAMSETT10
1,666,304,890 *AF5EC44F0855C376F879AFC0474464EE6248E1C6 [email protected]
1,666,304,891 *AF53CD00FF8E0654D4D9FA28B96EA13FCA97C694 TAPYANH
1,666,304,892 *AF598F734958B833268EB7370530CBFC1221E5AA TAREKNAM
1,666,304,893 *AF5E47EE04429F0C66F761896B69CCE1DB7DA0C2 tatis1310
1,666,304,894 *AF5962DDCB42F17F7DEFB3E949E264FECB02F24D 8TAISSOUNIERESBSW
1,666,304,895 *AF5B2D3313F5CF4EC272C3C91402350F1F258FA8 TEODORODASHER
1,666,304,896 *AF500E09F33228EA6ABDD671CC4CE84E2C11C3F2 TERESA-CROTHERS
1,666,304,897 *AF51F0EC06FE1B24ABA4E6C2398F1AF7BCCF2657 8UNCOUNSELLABLE
1,666,304,898 *AF52C83F4C9759B3EAAA44C4F552204A0094DD31 8VITTAQUE
1,666,304,899 *AF543BC0E94B9EA032F796DA54465CCF335F77B9 TERRYNISHIYAMA
1,666,304,900 *AF53E76DAF30B9EBDF2C0466EB4E2C83CC8AF59C 981049 umarImbundabaSarIlIoluruz"dedi
1,666,304,901 *AF5A98CF8C1D1A5879CD9BDE88867605590154A8 THANHCORNUTT
1,666,304,902 *AF5C4D18767DBD28AB5E2B8E4E18BBE74476382E thecallingblaze
1,666,304,903 *AF530484B729033B36C9225B532D7A3FA8B532EE The Six Partitas BWV 825830 (Trevor Pinnock)
1,666,304,904 *AF5C9F5627380DE0F23251E1A80D8B9C6F4E4ABE the.stationhouse
1,666,304,905 *AF525F7279D549C3D3DE87880F77DC243110DA2A thetigger21
1,666,304,906 *AF511FD34A8B3BDA94D08E7C8A5E21FCC3F02F74 9CHCHTNS
1,666,304,907 *AF5EA0E7A23204611AD68DFC38A9248C2D21BCCF this.is.worship
1,666,304,908 *AF5B5A0F09751BB4266FB5916A85046347C0038B [email protected]
1,666,304,909 *AF545D2BBA65DD253E343A73EFA66B50C24247EC 9KVKMYQGMKTVEL
1,666,304,910 *AF5B50C5E3EA5E402FE0EB6C5931BB5BEC3C450F TIFFANYDIFRANCESCO
1,666,304,911 *AF5B19CC5DDE5AC7B45681B685A51F1FF1D0154E TKOMFORTY
1,666,304,912 *AF595DAD1441AEF372A07232A1A68F66D64CE5FA TNARTSURFING
1,666,304,913 *AF52F1D24D6EB41CEBACB7E1CB2C15DF8CD73FC6 9PREIFITNEDIEROHPAMES
1,666,304,914 *AF585EAEF0E2C97450606995E4E5FBEB7FE4E34E 9SLACKENV
1,666,304,915 *AF535C9911129DEEB9D44F012AD6519D1687CBEB 9SNIFFARE
1,666,304,916 *AF53EA8AC2EE55A05FBFA4DA7EB4300EBB786432 TOD.VAILS
1,666,304,917 *AF5B19F0D08359230E01316A307118E1B645AD65 9SSENLACIXODARAPNON
1,666,304,918 *AF52751CC0BF5343ADF7A5D1E9EACAF4ABC2FE1A 9TAEFELUN
1,666,304,919 *AF5C507A37D0D6A44E8AF7050863E96FD52C5229 TOMLUFT
1,666,304,920 *AF5C0E96AAD8C8311E4F6A16B84BB2B201FE1136 [email protected]
1,666,304,921 *AF5F9E77D58084B1B124590FAEA347F855C05166 a1w7q
1,666,304,922 *AF57286AEC11F0B366D1220F00099EB51F9CA132 trevorengelhard
1,666,304,923 *AF540737D6C4F3692668DA1F9344D5E8AE82FB71 TREVOR LOWDEN
1,666,304,924 *AF5B111567831C64643B20C3ACA4F8AA178888C1 «tribüün»
1,666,304,925 *AF5B220ED82A38EC19BCAD432A9360B65598F112 TRISTAN.SEBASTION
1,666,304,926 *AF5401208272D45E49E854AE60FC137C73021233 tristan-swogger
1,666,304,927 *AF561FCE8AB4EC25B166C68BF5EBF3CDB46A0CA6 AABQL}
1,666,304,928 *AF53523D773A26CD761DFA2F987B17FE05A263DA ttalk-out
1,666,304,929 *AF57261D2517E456FE89311032C0666489AE228D TTLENGTHTT9
1,666,304,930 *AF508B2336F4FDD037FDEA83C6112B6FCA2CDE96 TUCKYNG6
1,666,304,931 *AF58503A6C3AF107A01CDB140FC41D892F479863 aazfm
1,666,304,932 *AF5480EE59AE0E0882D7B530FC0B8CF1D9493E0B ABDALLAARAFAT
1,666,304,933 *AF571669B87776477415D7A2CEC6E9B11F6D9EFF ABDULEMY
1,666,304,934 *AF5A905D6FCFADB7038E67D5339BFB29AE86267F abdulevanoski
1,666,304,935 *AF54EC4A7459588E6C864DE083E98D4ADA15FBE2 abelebtes
1,666,304,936 *AF56031C665BED3BBE845250397A9D8BBCE80748 TYSONGEWINNER
1,666,304,937 *AF595CB34181D165675B217E65C2520C0DB8DFEA U110729
1,666,304,938 *AF5E2EFB045B8311B22AC6806DB6DFB9FDB38F5B ;UBAAA
1,666,304,939 *AF51559C1AB52948000E1BF4F9A2ACBA9A5DBE62 ACCENTRIS3
1,666,304,940 *AF529E3C50E79BB9AE0D20C6055C87F0ABF28DD9 ACHKOR
1,666,304,941 *AF50A349505C72242AAE7D2A8BD813A0D978C28C adab
1,666,304,942 *AF5C02E80FA20AD644298399F6FBF3DCF21385DC UN-MAM
1,666,304,943 *AF5799720D66F570AF2B1FBE36CD41B7478245C9 [email protected]
1,666,304,944 *AF558E02CA393B90BB70F7253F755A6AB8B02D38 AEZUO
1,666,304,945 *AF542773165FF1A59372F151961171A01C866EA5 A+hq
1,666,304,946 *AF551D24FF762638A192B7EF119052A920FCC02B AiA-
1,666,304,947 *AF5A4DCE4F3006D6B603806A88EDF29B31630F7C a?ik
1,666,304,948 *AF50CE6A7EF55C319841D40C31486C376C51735A ak&/?
1,666,304,949 *AF5DD1C25822BA111D10B08540C32773D2E669B2 a:"kg
1,666,304,950 *AF529BF89CD51BFF2F8238B3B4B6C6E43DDED249 akumakorosu
1,666,304,951 *AF504683C9B9C166BEADF381F750A362CE6C8B8A albertocheeks
1,666,304,952 *AF57E9FDB1AB8FC7A4409194A4EB680295C88D6A ALEXANDRU26
1,666,304,953 *AF540DBE591894698217E19B8BC47C6F137B634B alexholguin
1,666,304,954 *AF5B946708EE28F77F8D4B2F47A27A3ECA7C527D al(kg
1,666,304,955 *AF5A79F558FD7A7F36E0E31B6A60A41A8CE0B9EB VIPI123
1,666,304,956 *AF505D6B690A7C37DB7BDC86C2D05F6D0150081D VIRGINIA.MORTVEDT
1,666,304,957 *AF523296D2CAF19701B905B9E0638C8E236F6DAE ALWAYS-AND-FOREVER-(FULL-VERSION)
1,666,304,958 *AF5BD57264492246AA1B672A8EBD8C695ED4C166 VLB
1,666,304,959 *AF58D55A3569D58574150129193521A78B9F9138 amf#g
1,666,304,960 *AF5F50E8F888E09E9C8CADC1729F60B102C30434 AMQDR
1,666,304,961 *AF534EE40F7CAB464B76A48DA4EBC88ACAD8E9D9 WAJDIHAJJ
1,666,304,962 *AF52FAA58C69354F9EDA98874B27ECDC01FB1F07 walter-sevrie
1,666,304,963 *AF552D246640ECC6ED8B5C4F3A1626BFA8EA9EE5 [email protected]
1,666,304,964 *AF53BB3AF1CAE748159A0B16715C6FDFB4CFB108 [email protected]
1,666,304,965 *AF59320EA46DDF657E2D8C726485A644E971773E [email protected]@PUBNBZJCNINFONET
1,666,304,966 *AF50C20C26C59A9C4AFAC114018FDE23E434DCB4 ANEVOKSHONOFF
1,666,304,967 *AF51B5574CDA24B197233C86441F1C51B66C0B09 WARNERHANSON
1,666,304,968 *AF550D765B258A0125939902169D9C799424714B A-Night-in-the-Town
1,666,304,969 *AF53FB9DA921D45658A7CA66227E9E0DA27EF67D [email protected]
1,666,304,970 *AF597EF1B33D33D21881C756647896FE2430EA24 anton.thomsen
1,666,304,971 *AF54958FBEFEA0EB45C64F9C4C684AD30BC71E90 when.we're.good.(non-vocal)
1,666,304,972 *AF50BB72917BA35DF3C5251CFEB9B005914A19DB APNBCMICHAELS
1,666,304,973 *AF515FBA05D56B198C7D8B77919F7DC25E6BF046 WIDENWIDEN
1,666,304,974 *AF50595CB68A92FD086218C7E9D764D142F6D990 william.bj.stevenson
1,666,304,975 *AF53D11094EE52EBB0AEAE932D86F30F8428E299 WILLIAM.FREEHLING
1,666,304,976 *AF5B7A221E1132E20155829543C92A0F52F0DACD williamkoperski
1,666,304,977 *AF59DE77B56B89444DA279DF66CAD067B8D2BD78 william.matthew.barnes
1,666,304,978 *AF57CF3F07043C55F50933BB8631C916A9F44A78 ARCA1234
1,666,304,979 *AF5D78FD07A5786C5602ECA8765318AD98DA53FF ARNOLDLAURILA
1,666,304,980 *AF5FC0D48632D7963AE509D7AB22E78A980F1D98 ARNOLD.TIETJENS
1,666,304,981 *AF51FED21E9750B797F27B76C0A59E9D02843CD9 WINIRED8
1,666,304,982 *AF56C4819728F2E3BE3025E6CC132CB777565991 [email protected]
1,666,304,983 *AF50D50BFB595EF7FDD424790DD147F581598AFF WISDOMANDERSON
1,666,304,984 *AF511DC09C53FF4BD1520C4B0648B57156CCB9E0 WMLESSARD
1,666,304,985 *AF530DE5F6709887ECC77EBCA9C8350C63401335 [email protected]
1,666,304,986 *AF5BCACC3F9577995EDEFFECF5D26CA563AC28BD WOODROW.GUADIANA
1,666,304,987 *AF553D2938B0FB16230C6127AF0635274C51B491 ARTUROFLAHAVEN
1,666,304,988 *AF5E038C2FA64EFAA5D8E151D31DD5B64A06B123 W~S/
1,666,304,989 *AF5952A85907F2D730516AAE8C7C74818BAFF77D wwii-period
1,666,304,990 *AF5EEA58AB3C7FAC41DAF78EC0AF5EEE1418EF70 ASHLEYSUSUA
1,666,304,991 *AF532A2D293EA533FD849FCF59C5C27D98C1CFAA [email protected]
1,666,304,992 *AF55F14CF63A2B56AD14A39240523E56AE32DE24 xdw+
1,666,304,993 *AF540F57EA93B9D076D15BE86A6F44A119AB2AEF ATEMIROV
1,666,304,994 *AF56E25E60186B152F8CCCECDD5C3E6A9A3D8F32 [email protected]
1,666,304,995 *AF569E616CD3036BE14B0D628ED71E4D3E7D8B2E XJAAYFZKQ9
1,666,304,996 *AF5F900F9711644B08ABE9C3881BC5DAAD5D4C96 a)u7
1,666,304,997 *AF5E6ED8581B98803BED7A0D445567573594F665 yanti.manis
1,666,304,998 *AF5140E409C220BBE1DF3DAFC858548671E96EB7 [email protected]
1,666,304,999 *AF519DE6DACBCD52D4B12F9ADEB1A30F45116359 A!VBM
1,666,305,000 *AF5FFFF8BB485AEF7548FE22A81F76A8599BAA7A AVS297
1,666,305,001 *AF5EF19EF51CBC4D95A6423BA5EEB5D83A1A8B3D YMLKIN
1,666,305,002 *AF5D960ABD3499ADE69358DCC1FF6B9024FD5C6C Awp%
1,666,305,003 *AF5E510EA3F984A1B186CB11FEA3C3B89BD335C4 yrual+11
1,666,305,004 *AF5AA608E2EECF94B186AE0C0C2B22391F308785 yuko-inamasu
1,666,305,005 *AF54DC81DDFFE831150EEA8D97E0B8871910B404 YUMAMIKO
1,666,305,006 *AF5BD1B16BFF521A05A4AEE8B9195E9B5729E119 >b0.~.`<#3
1,666,305,007 *AF5CF9817A72F09FCB62A3EA897491E82465C3BD [email protected]
1,666,305,008 *AF50947FE9E590579F17E4CBE73581E090DD305D ZACHARY CROOK
1,666,305,009 *AF5C95AF8B6510DBBABE6C9A138914A60DD2D2AC ZACHARY ENGLER
1,666,305,010 *AF571AED7C7CDF6258EDAF5860399AD1D4E88BDF zachary-hastingstwo
1,666,305,011 *AF59C55DE1F11EF86EE09D4BE758F295CCB17FC2 B2HKE
1,666,305,012 *AF575850CF099E14BACF7D11D352774FE8B4184A B4%Y
1,666,305,013 *AF5FCE5275B90A185D8319B35DCEDF679EAE6AF7 [email protected]
1,666,305,014 *AF57B777CBBA54404077F255F9D373C6C29E4312 [email protected]
1,666,305,015 *AF554D49304F31DA5119C27B3903258DEDC3779F [email protected]
1,666,305,016 *AF506DE3DCC1ACE919FC10F3D06F6B059BE90F79 b8eaaaaibaj
1,666,305,017 *AF5C7A1BBA2F9672A225BB0BDF7A6CC6CCFD990B ZHAWPRINCE-NG-ITWORX
1,666,305,018 *AF582C26942769D5FFBCCDDB1EC1A4DD41FD597D BABZ)
1,666,305,019 *AF5CBCF2084B79BE683800EA7E5C38BA0785647D [email protected]
1,666,305,020 *AF5304B4B33215504430907A69805B2E56306AC9 [email protected]
1,666,305,021 *AF5F367C0811F8E73C1D40AB68ED0F4E9480348E ziyandadlembula
1,666,305,022 *AF5E39860EC1D0E4518BE6B20D3B1E7B095D69D4 bang-your-heads-for-satan
1,666,305,023 *AF58DD0D9CF8DD0973C86B7D7F9E034C4F974177 BARIGEL6
1,666,305,024 *AF51A196A149712A92533259EE945BF04BF793EA BARTOSZ3
1,666,305,025 *AF51945395789E41AEE249A00EB30E50ABAF24F6 διαμαντίδου
1,666,305,026 *AF52DEA914E87DBF67B28D9D0098F3E8AAD1E1AB бавий
1,666,305,027 *AF5AFB8C44EF88A04D33905A1EC7DF65F1440D67 b###b `3b<
1,666,305,028 *AF5C749625910980A86F8AE659F4C548201308E1 bcer7
1,666,305,029 *AF5715CA1160FEF55594CDEF085A1A02AF959CCE BDm3
1,666,305,030 *AF5170FA43BF066AF07752B342BBE855938B6655 BDWVHIJ74
1,666,305,031 *AF5455B303335E830D36FF99321B69587BC6AA7C BENNETTGOETTL
1,666,305,032 *AF58630DA9A48308982A5F3B85DBD7F6FE743800 эйриан
1,666,305,033 *AF51EAC5CBE1E6998D3B4E50697E62B2E7F66536 BETSABED
1,666,305,034 *AF507C6FBE6C7DD98CB19EFB9ED1A8FA27B42CB1 組合雷達模式(crm)
1,666,305,035 *AF53919EA76F2EDEFD5935F4A4EA275CBDF4034D BOHRVANLEEUWENTHEOREM
1,666,305,036 *AF5572050D4735CF62D83F0D3E14386EB164E9A6 BOUND-雪上の足跡-
1,666,305,037 *AF5A8F499DD123718BA9E2D7BAEF1C44512E9C74 BRADLEYBALLIEW
1,666,305,038 *AF573FD089270604AE3239B0EF0E96261174DA39 bradleymcmenimen
1,666,305,039 *AF5D1669C9D8A2EDFAB1947BBE65B4590BBF501F 0iluvjack4
1,666,305,040 *AF52C4E7812774DF86E1FEE47433DCF5C6B5891B [email protected]
1,666,305,041 *AF59B5FF0F5CECE942644930FE2A9CDDC88DEA60 BRBH
1,666,305,042 *AF540B3880450BDCD3FA107F58B65BD98AC18BA3 BRETSEYMOR
1,666,305,043 *AF5786DA59DCA4E73C141D1DFD1CA5F7399B6C22 1066229 NUR DARAN DENKE ICH "
1,666,305,044 *AF561E30FFAD8906B62F3CAA4618C173D4CF5D1B 10.BEOWULF
1,666,305,045 *AF5BF3819CCCA393BD39B1ED5AA8A97C00146EE2 BRIANPLASKETT
1,666,305,046 *AF58290A6DA5A17578B412A92D8140084763F366 B$R;O
1,666,305,047 *AF514764DA6361387180F6914CC7ABC24EEEB92A BRORRORB9
1,666,305,048 *AF5BA70E5EE2E4227B44F4A52133E2A7199BD86E BRYAN-BARTHELME
1,666,305,049 *AF51FE76B3F61995F50FB5726DD5ABE46050C5FB 1252481 ilmatieteen.laitoksen.tilastojen.mukaan.esimerkiksi.ut
1,666,305,050 *AF5DDAEB48549C2967DBE93112C72DBF5F52B46A BRYAN.SCHATZMAN
1,666,305,051 *AF5B9E1DBE5B24EC867011D080BF5C4515F11F77 158.YEARS.OF.BEAUTIFUL.SEX
1,666,305,052 *AF5B279E8CC15BD645E434EA5FE93AE574555986 b$tkr
1,666,305,053 *AF55EF0C88E606A4E5D6176423A7ACF7291D2372 C25OQ
1,666,305,054 *AF559DB48C94390C195CED92E931253F7E3E28CE 193-ru
1,666,305,055 *AF54EFF72F0C0C6B1A9E99A505DC4F3C1FA72915 c$4f=
1,666,305,056 *AF5DBFF33A4FE700B4D1F922B0C3403FB547F073 c6m6?
1,666,305,057 *AF571EDAE619272993C19013403AA74B400ABE66 1BELLETRISTIKSEKTOR
1,666,305,058 *AF5825A4AC6B93B3C2052E8143D704FB3881C08F c?9u
1,666,305,059 *AF5C036133174723DE308DDDBBD8CE1E581816F5 1D!BAA
1,666,305,060 *AF556856ACE714891899593226733A8137263A12 CACIBBSWING
1,666,305,061 *AF581F52F55C36973475EC6CFA9185E7EBC6E4F1 CADETIA
1,666,305,062 *AF56374D3E9F395E08DF1DA1364DED02DC60817F 1F6F0DE1-CBA7-351A-9E22-D65E4AB759A9
1,666,305,063 *AF56848295F94412C7FF79C6F241EDEE1D92EF00 [email protected]
1,666,305,064 *AF54A2ED25B3F0AE2C76F4B2BA214846E000FCEC CALVIN19
1,666,305,065 *AF539D5BB77BE3332EEC47A2214D3C60CE72FE42 CAMIBALED
1,666,305,066 *AF576533C1B36FB989EC894A43EF302550C86BE0 CAMPILONGO
1,666,305,067 *AF5454B0E2CBFA1C398CBF9F7D1171FF218E1B85 CANINE1936
1,666,305,068 *AF5DF3382BC5AA8C9737B00620F5EE306FFFE84B [email protected]
1,666,305,069 *AF570A30B76487C3B2FC0CC9399048FE558CB606 1jan-henrik
1,666,305,070 *AF512EAED7E9BE795CDC8F8473848EED866FF583 CAPITIALS6
1,666,305,071 *AF57BA693323C417FC07D07874DD69350C97929C captain.anarchy
1,666,305,072 *AF5CB55F053A1342496C1F244CD04C166ADDF20B carlonavin
1,666,305,073 *AF5ED438BEA454770B83D33E08A87D12D9CD8C16 1-loss-equal
1,666,305,074 *AF50A3BF8539A115B792E4A9D0D08D1C9D7D1216 1megadittos
1,666,305,075 *AF5528C0A266B199B1286039221E55CF3AA29F62 1MOVINGLYWITH
1,666,305,076 *AF56FCF9138EDF6DE2615ED1A563D04EA1B714EC CARSON.LOTAN
1,666,305,077 *AF5111BC8B223311C4D82A3717E69D7243B4114E CARTERKINGSBERRY
1,666,305,078 *AF5F44DACB64EDA2F4EF5430DAF755B59E385EC6 1mytarzan4
1,666,305,079 *AF51693F7E57E2FA2FA8EB1705D0696512073EA0 1-ozhamurkar
1,666,305,080 *AF59193BD1236A12D567195DD809C833580F4306 CA_VR
1,666,305,081 *AF578B3CB169408925C7B8F5A43F9FB38EE3197F CBTU
1,666,305,082 *AF5112E25FD80ACDEB302437CCAE409B27CD2DAE c:\documents-and-settings\firexware\local-settings\application-data\microsoft\windows-live-contacts\{3fff51a8-6937-4da3-bab9-5383bf19334c}\dbstore\logfiles\edb00001.log
1,666,305,083 *AF5D207FF162964C97D7C688B29D520923346940 celloconcertoinaminor,op.129:3.sehrlebhaft
1,666,305,084 *AF5C16A96408B523595656F8C18261D0D2F1966F 1.uroot
1,666,305,085 *AF5B86F2AF454D3728BBA8072B198BF8AFA48A75 1.videovisa
1,666,305,086 *AF55D6859F0859056AD975536A027E2B46EF6F44 1WIEGEKIN
1,666,305,087 *AF57757076B1560AF31DEAC5207B7AB619AE156A CESALED
1,666,305,088 *AF5A3E8F286EDFDF1A4926F981BEC551F2203CD5 chadwicklucksom
1,666,305,089 *AF534CCE7E109F01C41FC608B78661DD66D81605 CHAETOLIXOPHAGA
1,666,305,090 *AF5C6D0A20D187CF261FB86E8BD3715934BC501E 2635883 schunkeln.ein.wenig..
1,666,305,091 *AF55EA144CCB0BB6E1C1E104DBFE375DE6AF356D CHARITY-DAVISON
1,666,305,092 *AF56FE19C4B9730373DC564ADDAB50CAB78B3D4A charleenchiang
1,666,305,093 *AF529D96CEA879F4AB72F8813AC2AEE17D66C430 283177 niin.k
1,666,305,094 *AF5E2550B5115E6762777EEBFAB5BC3C9DF3AF51 2894976 idon'tthinkitmakesalotofdifferenceanymore.
1,666,305,095 *AF5985FD34CBB14BCCC01551348E0369F717C5D4 2910858 esitys.:.kunnanhallitus.antaa.valtuudet.tehd
1,666,305,096 *AF57CAD8350699FBDA35BCB36D84EEA09005666E 2EIMMOSSA
1,666,305,097 *AF5435D1F2D8B6B152F2D5487C1A48406EC5066C 2-fyslab
1,666,305,098 *AF5CDD2006A81CBE447D99137A0D9EB45ACC301B 2.GOPALGANJ
1,666,305,099 *AF5CC521295BBCAA13016964EB4266D0BB0C0DF4 2-sl
1,666,305,100 *AF5C48B8FA1B03C288098AE2A27C2C89363A40D4 CHARLEY.BLEECKER
1,666,305,101 *AF5090C7064ED821AE208FA1CF4A1F9A97323CD5 3bfv4b0qidgbsz
1,666,305,102 *AF57DFC37E3DE570E7669904CDAF04842CD96AFF CHEMISTRY166
1,666,305,103 *AF5781689FFA1CA6E24BA7160671B28EE7FCBF41 [email protected]
1,666,305,104 *AF5D546BEC3EA93579562F652A2320F0983D15CE [email protected]
1,666,305,105 *AF557340E46B1AAF1E4F3C4E470562D21DEFB584 '-(choeur-des-pr
1,666,305,106 *AF5D682B681ED413806B2084C3684FA60F7200C7 CHRISTOPHERISHERWOOD
1,666,305,107 *AF5F50A83EFDF8D4E462402EE2C6EEA4E58A92AE 3######p~.~.~3b<-
1,666,305,108 *AF5AED56A7FCF8A83C3ABBFBF30A40E118397593 3P~.~.~.SPLAT
1,666,305,109 *AF5AD0389F1546714FDB6EC5D015AA7ECD20E133 415e - disturbance, loud music or party
1,666,305,110 *AF5C8A1BE3939DF4053DEA227BC9282BEDD01DE7 44 bilgic
1,666,305,111 *AF534B726E473FC4885F23E8AAC2E91D7E87413F 4ASTERIXUNDOBELIXMENTALITAET
1,666,305,112 *AF586CEDED476748B18095575DAB991977AA599C 4BAGUSLAH
1,666,305,113 *AF518A9B6EF0A3E9AE852A2B5CC33F3C8DA0E11F citsitnam2
1,666,305,114 *AF503F5B2862122E6922A73B2ACAD7AAC5FE51F2 city.slickers:.main.title
1,666,305,115 *AF5DDD0C7E688A5E9E97439E34EBC438F1CE2ACE CiVD
1,666,305,116 *AF5D87A46FF5C86A2D88B0FD6D0FB2AC2E7E5A46 4DOVAZET
1,666,305,117 *AF5B746288C597826E8433E7D691563063B5DCA0 4ESEGRITON
1,666,305,118 *AF57B56950CFAFA99EE0D1B60EB681C22AEB6194 CJV;
1,666,305,119 *AF5F1EFCEB86BA90062D625152DCC0CEA4B0006F 4.KOCHEN
1,666,305,120 *AF563B14D326FF5742A23E723AC2A32EADAB0907 4kostkind
1,666,305,121 *AF5A06141BFC489FBE7C56CA01D1AF5A4BB92B92 5.01.1617
1,666,305,122 *AF53707448DAAD9F2B587BEE623508B001A4E829 531392 the-statement-didn't-mention-the-singapore-discovery-
1,666,305,123 *AF535839D7E01C147143D1B9B0F58D80A28BA4B8 CNE,
1,666,305,124 *AF52027AD462E5268D7D25590E577654A183B135 CNPS$
1,666,305,125 *AF56E4B0BB37324B7EC231AE624DF99ED342FEA1 collinnoland
1,666,305,126 *AF5962DBA088EE4E86231DEDD79FBDA62A0691A1 COMCOMVALDECHERLOGO
1,666,305,127 *AF5CA7F252F3F6B2EC2F85E5A9DF3F65761F72DB CONC3RN4MOS
1,666,305,128 *AF5EF9D415706C5B186399400420D6D22D1F8D75 CONCESSIEF
1,666,305,129 *AF591A6C8686C4C9C755273C388901A2B5EEA0C4 5em1re71remen7
1,666,305,130 *AF5B4EA3330D1A195F479513748AB9E5427E25B3 5MARCELSTRAT
1,666,305,131 *AF5A41B63B5180DD73EC31103A12BA7E681064B1 5MINISTERSTORMEN
1,666,305,132 *AF5EE88D8B9A9942A4DA765A3347C4CC87AA0D50 5NAISAMOH
1,666,305,133 *AF5D3A501384C17110144DE33361EBBA76AEFDA8 COREY.AGUADA
1,666,305,134 *AF5355B312F7F7CE8C0FE1CE6AD030372D7DD8E4 5PENNSICKBSW
1,666,305,135 *AF5C61AC109DC9468260DE3FA27DC17F57B02EB6 [email protected]
1,666,305,136 *AF589B2AA60ECF7D420C884CEA0E7BE579226F39 5RHOLANA
1,666,305,137 *AF5E978DBD6171069F76AC6FC6C35AC6402539A7 5TBHINBSW
1,666,305,138 *AF56AE5F3BCA7794575E7BF6C2E8A4A5B803716B COSEIEST1
1,666,305,139 *AF5A7BDDDE3B805F32157193FCFB52D52D646AC8 5TRIALSSWEET
1,666,305,140 *AF565800EF3EEF4F45836EF682752A8530F371E4 COUNTRYMUSIK.IN.DEN.BERGEN
1,666,305,141 *AF52528C360C909463810FCCA4A4A88A5D114A39 611708 TOIN-ESILLE-VIISI-AIHETTA-,-JOITA-K
1,666,305,142 *AF513BFD5C531548EE44900E3403740667971549 686ALEENA
1,666,305,143 *AF5F5F6883D051EEF7E3EFE9047288D6F41EE6C6 6AUTECISMS
1,666,305,144 *AF5D905DD7A5CF0E2F26D9A1C5F7AD96946B9556 CQM7K
1,666,305,145 *AF5D5A2672B52B07C66FA233E06399152C595D6F 6HICOLOURBSW
1,666,305,146 *AF56141DB36689E8253E42052A7457D4826A4537 6HKPIDBTXB
1,666,305,147 *AF5B96B4A2E9754A6A85BAB14F8BB9ACA82101F9 6KALASTAA
1,666,305,148 *AF532BF6733987D5EE93111FCA0728EDBF023E56 6MEDEWORT
1,666,305,149 *AF539B2D7AAF52C67B2AFBF81C600A6D5AB82910 crkd5
1,666,305,150 *AF518F8E5B522984D7E4C2793CC4CE3DD9F865D1 c_/ry
1,666,305,151 *AF5E1B3276019275B12687709DB0CEE3D325D7D9 6popgunner
1,666,305,152 *AF5A539645EF523D70586BF7AB801B00346FFDE4 6RANDOMSHELLY
1,666,305,153 *AF572ECFD3B222A5454FE023F2A83B94C6FE536B 6REPRIMANDAIT
1,666,305,154 *AF544A3E40451463F15EA0C680815E10AC851361 6SMILSSMILS
1,666,305,155 *AF59A012FE131646A237F76D194DEF54840582EB CT6D
1,666,305,156 *AF5181886DB71EF1A67BA0FD9FC4E7C66445BDA6 cty:c
1,666,305,157 *AF50D1BB72C4927A1B74F28CC884A6DF5838B2A4 cuivres1
1,666,305,158 *AF5272B5E9553F08A209A10252E5C0CDD79A5A04 cy.d;
1,666,305,159 *AF53D02DF70E8D57E158347BFC8EBAC4CEB9D13B CYRUSWALTERSON
1,666,305,160 *AF5D7726284BD453501D26E36692478ED0780340 d1-1w
1,666,305,161 *AF52024CB07151100FE17A12E6EE7A3615B0FF9D d4lrq
1,666,305,162 *AF5ABCC02B694D0EEEC5BBC6158092F62A688CD1 d#5is
1,666,305,163 *AF5CB12EA0FADA1419C3817BF070BAF5276780B6 7ilovepercy6
1,666,305,164 *AF506F124169CEAEAE70311160CDA11604B9D033 DALLT
1,666,305,165 *AF598708E432F6B96829D4A5C5795DC9C7866FB0 7ONEMELANIE
1,666,305,166 *AF50DB4ED6F0EA0D48FFFAFDA2B085482288FCEA 7PLAYBALANCE
1,666,305,167 *AF56ADE2CF339BB67ECF61AD6B161A33906960E6 DANFERT8
1,666,305,168 *AF582C841A1C063D0C882D4B3B934A8DA99B9763 7REARCHITECTE
1,666,305,169 *AF5BC38997AB6BBB808F06206E23AEE5827F12F7 DANNY.DRZEWICKI
1,666,305,170 *AF5B707F9C087650DD3FF9DC6E4BEB4A9E57D65D DARON.RYLAARSDAM
1,666,305,171 *AF5FFFA4BFDC09B8B784A47F47D2107E913BD9F5 7TZIMMESES
1,666,305,172 *AF5B3F0B3DC9C904001D7447384E117D192B5CFD dav5f
1,666,305,173 *AF5AD74931ADD0CDCDA325D0541FC0FFBE93A1A6 DAYSOFTHEKNIGHTS
1,666,305,174 *AF54A914B2D97859DA329E876D0EC1C452716A02 8=====b-~-~-~splat
1,666,305,175 *AF593B00E51F9DEDA5883C8B42C5A84ACB19B737 8D~0~osplat
1,666,305,176 *AF5E323D2B74824F3DF75059E7FBE7E3FC5ACE9C deborahsarah
1,666,305,177 *AF50BF7A5DFDBCEB84A5D34F9CE4A27E898D5FA4 DEFENSORIA-DEL-PUEBLO-PER
1,666,305,178 *AF5D1920219F948FE7CD89299A2B596487A56E90 8NTRTRBCLR
1,666,305,179 *AF5E88E41664EFC7E78CD0566045081BE3B57B5A 8OUTUUHAN
1,666,305,180 *AF5E3FD328B685C617DB548CEE9C04C398AD5817 8REXILESN
1,666,305,181 *AF5A24BC65E66A375E5E4667D8CC075CF23E269D 8SENTAKS
1,666,305,182 *AF5E757BE97B6AAC9B93748DA25FF8D8AD9C6D9E deniveler
1,666,305,183 *AF5370D63FBFD58942A9BC7B944741ECECC14F58 DEPARTMENT'[email protected]
1,666,305,184 *AF5EB33FA2267D3060C1962ACCF48259218C789B DER-BESCHLU
1,666,305,185 *AF5A996AC514C8FFDE13EBC8F7E68F01620CE5F0 despise9
1,666,305,186 *AF5950DC377D0FEDEEFBEA5F01342FF636C4FEF1 992903 bundan sonra riza pasa kabinesi gorusunde israr etti
1,666,305,187 *AF52D0E5E33B1900C820827DD4F2BEACE4E1214C DEVIGNY1
1,666,305,188 *AF5FE89D062C5C95D01938E242BA2C9F884A356A dexternegroni
1,666,305,189 *AF5F1244A4D8600544B00046CC0FCC46C7768D50 [email protected]
1,666,305,190 *AF504D37C03AE713F18046DA776F991B48AEEDCF df)tq
1,666,305,191 *AF5828DC10758703E16AB0ED6694A8DAA88FEA75 9GEOELECTR
1,666,305,192 *AF594F852EE55CFB7E797018559CD1583D6572A2 dhjg
1,666,305,193 *AF54DEB6DAABBA8B450100250F5BA95DCCFBA9E4 [email protected]
1,666,305,194 *AF5E273F103E69BFB365FABAFC851EFA87BC3192 diatoml2
1,666,305,195 *AF52215B0657E9BE5B697A0F2F8AA16CFD483A30 9ILOVESAMUEL7
1,666,305,196 *AF54B7E71D12D33F03F6CFCAE60067663053DE80 9inrukte
1,666,305,197 *AF581EBD550DE8BD764A83229C7E429EF5FD11B1 disbodied
1,666,305,198 *AF534BEF1457B8B0A96BA3864C0C71605CFF0315 9OMVLIEGENS
1,666,305,199 *AF5D54EA20D5D58DEF21B5CA240348EBAE67F08D 9onwijsheid
1,666,305,200 *AF5467AF4D5D594031FBF6489DCD732B866C4874 9SACCAGEZS
1,666,305,201 *AF5B7CF8EC91F3411DF6855EB344E457F79E090D DL"0K
1,666,305,202 *AF5D5A946DD5DBA410433A781150A96452934939 dn17e
1,666,305,203 *AF554AD82B80AFEE3F3E51293A41888F3FDE0D7D d-nuyldrr
1,666,305,204 *AF528180659E6A3503A7DD1F08155FD21DAA2150 DONTE.DELORE
1,666,305,205 *AF5ED59C00BA93852EE8A0A6374BBC9CA885B3E4 A;*2
1,666,305,206 *AF5571E530927FB9C402EECFD52C7C1BF14BB2DE DOUG BESAW
1,666,305,207 *AF588EBBE5744051C8EEA9C85E84D802512166FF a;_4k
1,666,305,208 *AF50F0AA007E4084960D1AF79DBC61916908E65C a8)#
1,666,305,209 *AF513E76867C7E65EB6566BDA57BD6BE356AB714 AAD9=I
1,666,305,210 *AF53EC0E3CA73FE0BCCC16AEC5C51674A2B49474 ds,x:
1,666,305,211 *AF5A926FA3C94F3C7604190BA5B544479199E8A8 abortion
1,666,305,212 *AF5F54851DE1017193A0F88DEB125702E5883826 ACMQ2
1,666,305,213 *AF5F8BD37C5E7F15168D9C8055EAC4AB16E48596 ad7:w
1,666,305,214 *AF5956A259F152281A6A4933AE305D53413770F1 [email protected],
1,666,305,215 *AF5B6EC39ED79804A758E95337D7677264C7C517 DWAYNE.ORAS
1,666,305,216 *AF55DA86476AC6F398A9D893719D67D3085E6E0B dwech
1,666,305,217 *AF529ABAC887D1575F4E4CF5DD1CDC41F6FAB6D5 A/g
1,666,305,218 *AF54459BCA9ABEA9D916BEEAF4BD4DADDAD268A9 EDIMBURGH TRAMS
1,666,305,219 *AF5EA3929C07148A6B732BAB02B4CE8F403FB79D !`-+(al
1,666,305,220 *AF518942C81C7FA4D2F36A0F90BE22C5D93D6EB5 EDSNORBEG
1,666,305,221 *AF54544410CC2BA9E489CA33CB1267AC5108A70E [email protected]
1,666,305,222 *AF540247AB950947C6A52D6A678ED8DAD31E4236 ALLF
1,666,305,223 *AF5554FE8CB9348903BCF0A9DAB73B8A655514FF ALLILASI8
1,666,305,224 *AF597CBD90F5CFE9170257D5A17CEC70D7C6EC68 ekneguuied
1,666,305,225 *AF524AA652E1D802C1D1E99C7B1C3C7AE2C6B8DC el.
1,666,305,226 *AF590F80F34EF605F8896B5648FE55707ABBF0A4 elishareimers
1,666,305,227 *AF5E7D99EB41F884781AA3ED07B4A3C9DA8A76FD AMANDA VIOLET
1,666,305,228 *AF50389354044B3D9CBFB65974E17F08AEB768B9 ELROYKRISSIE
1,666,305,229 *AF5905ECA5FA8F0A60BF0011943B04D7EF1FC7D0 em5%m
1,666,305,230 *AF58F44E825A80AC755D10CB0D46363B5E67CB4F ANDREWBOUTON
1,666,305,231 *AF500382636E1DCD2277F67B2941288153B912C1 emkgf
1,666,305,232 *AF50FB3A7EB3A6A77053574CC331E31B1AD4406C ANDYFAZ99
1,666,305,233 *AF5CCE3E338C29B2BD59EA3090F2D8252989B79A ANDY.PEEVY
1,666,305,234 *AF5A313AFAE18F65520B8A05B1991252EA2DFB72 ANESSORG5
1,666,305,235 *AF5818364D6339DAC7EAC273245D9ABA74C67BF0 angelobourgoine
1,666,305,236 *AF5D999EBF83D1FE9E7C6BBFD317A0F6D3BA1B90 EMRVRRJF1
1,666,305,237 *AF5E32773862AF39A48B1DE938904FD85BAFE6C6 ems\#
1,666,305,238 *AF5C9502A680F892D4B2ED645A24E517031FADD3 ENFER2
1,666,305,239 *AF571908A81FE10AD6C7142F2CF3B72751761822 ANTONIA.LEITHAUSER
1,666,305,240 *AF5A5A2DBDCE7993472BD82F64526D7A63B2A71F ANTONIOBAKR
1,666,305,241 *AF5C4897BCD7C53A1FCEE52D6FC00E2B4F31A85A ANTONYPENNEL
1,666,305,242 *AF515F9EA557FC88191EA4132AF3493FC3030FC8 an)vz
1,666,305,243 *AF5B8BFF3F36AD2B5636B29DC31A536477B16EEB er2p%
1,666,305,244 *AF5D7E8EC86A5581C85CEC82079869852CC81BDD archaos-2
1,666,305,245 *AF524D904FDE153A10C8A2DD1CEE93FC99A01AD2 ernsthafte5
1,666,305,246 *AF5DA9401C2DAC4B0C14127BB653718288633E48 ERUTABA5
1,666,305,247 *AF5C56CADF1CE53BFA32217711244FCE9D575708 arloohcses
1,666,305,248 *AF584B5C534304DE83A0AAA5524BB712E49EBA01 esad0
1,666,305,249 *AF58CFF8CD49BA8D50876795F00ECA3ABB4B0C25 arsnovathebest
1,666,305,250 *AF583EDC5BD9E38459AA1F304C21788C6E8E25B5 ARTICLE3798806
1,666,305,251 *AF5DFF6ABBD571508CC30E06DC819997EAC7D721 esrekiem5
1,666,305,252 *AF5E80D9D503FC8B199E2AAA6E42EFB9AE6F0683 arveoppgj
1,666,305,253 *AF5138BB3F2F8E41EC7FF70742CECA14BC3710A2 AS-HE-FORTH-WALKED-ON-HIS-WAY:--
1,666,305,254 *AF53F128C57F1BAEE42DD39CB201EF363DC34EAF et%m!
1,666,305,255 *AF5BA64FC6B8A210F8414A026E502649A64568E0 ASTER30防空飛彈
1,666,305,256 *AF5FC8F0E6E50A4BA9965B7A926F06BCD8712BF6 asukutan
1,666,305,257 *AF5C62B3F80B76F2EF409F3E42491D97F553BF31 EVERDEAR
1,666,305,258 *AF58050B3DA523E25B5AEDF156F63DAE753621C6 ÁTLIBEGETT
1,666,305,259 *AF58339BE03FA36B2CEAC5D123130FA67FC45D33 EXOTIC,
1,666,305,260 *AF58D4B19D1664B1EB58948471AF1B07DE3BD610 exp0310
1,666,305,261 *AF5816F3B098F7F5C071EB4E5EBCBDCA66AB46E6 F0RESKIRT
1,666,305,262 *AF5F15A3D564BA9972A3BBDBA2B3558238A817DA f/4f
1,666,305,263 *AF57ACC066E76501D08094A3C3D250FA17416B81 AVVIKLER2
1,666,305,264 *AF5EE9A473F6D0A21B72D3F98F0950DA1D4D6211 AYSOMISING
1,666,305,265 *AF5C58B125DBA44CCA42C376ED892C149E9FEE4B FERNANDO.REHSE
1,666,305,266 *AF5590113E371A35F601AE7EBAD84A460D523813 fidelonyeanus
1,666,305,267 *AF5CFEB4210B441CF3FDD0BCA3E5CF2EAD6E0811 fieuxbsw6
1,666,305,268 *AF55D76E91EA00B3C729051C7ACC931CC189DA9C b3+ur
1,666,305,269 *AF58D1C39F5E44AA53929527DED98D8D2632B45C b(7ns
1,666,305,270 *AF5736CE3BD9934B8901D84FB71D984AF1A73E5A forestalexanian
1,666,305,271 *AF53DD68D2C42B10F097631EF97270C5A8BC0352 FOSTERRUCK
1,666,305,272 *AF50C3EAD7F46B851BCED5276732C9B980635200 BARBARA TRAINOR
1,666,305,273 *AF5114256D7C0ED6122D9219E78E810CBCB47D29 fp/:
1,666,305,274 *AF5E54881F9ECD6A4AAFFA821D59BF1EAE8BC4E9 BATTLEDUST
1,666,305,275 *AF590EAA3F1960B4428C7B6DC0880151BE023116 BATYRBEK
1,666,305,276 *AF521E3899FE67514292659BF45D60C218EF3B68 bbydr
1,666,305,277 *AF55EF86630CE6D068D9B01071F8A9B845786C15 BCCNB
1,666,305,278 *AF55329A3BE19E1F38F837471654E062B0125E27 BDMQ1
1,666,305,279 *AF5D6D37FDDE1B7BF9AFE331AEC0207F4E6A0ECA FYZC
1,666,305,280 *AF51DCDFED045A4C9DAD0888EC5B2AB4B5341C6B [email protected]@[email protected]+0n5
1,666,305,281 *AF5462A142EEFC76B3DB2B0FB5C5C4F01275FC33 GABRIEL.SIRNA
1,666,305,282 *AF56ED918C20DF012592BEE9215799A722E93602 GAIL.BODDA
1,666,305,283 *AF5B041752DC83CD42C3092CC7D7BCCA0E866F92 bekc
1,666,305,284 *AF522DB1FDE56D410388C9E4C45ED310D81A593C ber0
1,666,305,285 *AF5F7DC8C2865AC23184A791FD2EA24F218DD0DE berryvest
1,666,305,286 *AF5D90D9D8A722E71294440FB074C1E172EED78C GEBÄUDEBÖDEN
1,666,305,287 *AF5AF8F7D06000C633AC40E6FE076DF5339716D5 GEORGEPAPIKE
1,666,305,288 *AF59FEE0AEDA950C86FB7E1DB7C6B6DED891474D bft#;
1,666,305,289 *AF5948BE53BF0C6D11E0D2755C63B9054769CA1C GNINJLSRED
1,666,305,290 *AF5602F601BF3ED9A50E7B640B682FBA0AFADC1B GNIRUEFF4
1,666,305,291 *AF5FAAC4FFFDC8CE8AD6D84FB681DF40D990811A GNUFITNA2
1,666,305,292 *AF59A12D0BF3F49604A738374F36E19E8509DE5E GOOLVNEP
1,666,305,293 *AF5CCC67E6EC4EF33511A748EF99D5D5000749D0 gorljivim7
1,666,305,294 *AF55D52FC6B64C1E13D948951039FB966A29E2E0 GPJMCL9TVRS
1,666,305,295 *AF51B46749BEE5745378CBAAE46F4A40B730B384 GRAIGYERLY
1,666,305,296 *AF55556087FADA3802E330F989A67F657F54AC4C [email protected]
1,666,305,297 *AF57D51461202B56488A73B6C3C9AAD737EFF7AC GREGGBIGDA
1,666,305,298 *AF5BB04E116F4AB9161DCEAED33C1C6A2C4CC8FB greghaverfield
1,666,305,299 *AF5CA5AA5857B44D9B84A9F3EB2C83914E061E2B GREGORIODORRIAN
1,666,305,300 *AF560CDEF7DF70ECDEC7706DC3BA09C1CAD6AFE1 gregyellow
1,666,305,301 *AF5CAC456A9CFF7940CA13F46AB906D382ED39BF gtw!
1,666,305,302 *AF55FD6E1681B66796596F474BED8B45F25192A1 gunboundwc_147
1,666,305,303 *AF506176A96221E7964E8BADD9283B7909E08D92 gursarn3
1,666,305,304 *AF5B3F233E8C0820E06884025D1396231CB1F633 BILLIE.LEWITT
1,666,305,305 *AF59F3B385672FEA7657AE2BC17612DA29DE54B9 BILLYBLODGETT
1,666,305,306 *AF5764754411D7EDEB491D633136DC6F8EA41679 bluffeuse
1,666,305,307 *AF5B107E1AAB9B8324B3409A81D98EDC4C8F72DB [email protected]
1,666,305,308 *AF59127C918F7797448761923651894D6791DC25 [email protected]
1,666,305,309 *AF5EF94D7E8844F96260E94317908613B390F8A4 HARANATH8
1,666,305,310 *AF56593A804B2CF2FEEF61D9F01104C3E10579C5 BOBBIE.WENECK
1,666,305,311 *AF5B9F95944B399D1765CB5D3C27E46BBB596EF8 HARRY PEPPERS
1,666,305,312 *AF5C1C78BCCD04F9D0388780553647E263AEFB0D BOBSTUPID7
1,666,305,313 *AF52ECA1F5D6DACE432B50E4CC3D38B0985DB591 bo:&i
1,666,305,314 *AF5B6E6FC30907553C704052A044ACA5575B581B HELLOMARK
1,666,305,315 *AF5ECC7319C6635852E627DC0D2F38A46041A8D6 BOYCELAVY
1,666,305,316 *AF52E68320D09811A775118E552815659D929FD1 henrylettiere
1,666,305,317 *AF530DAA0A008B528625A1A71A05FFEACAF6B2B4 henssaputra
1,666,305,318 *AF5C1FCDC369BC0B0412EA5C06C5A3956201CF23 b=p~ ~ >b0
1,666,305,319 *AF5DA426508A6D98845D06073AD83861D3038F62 HILARIO.OH
1,666,305,320 *AF57688E9AAD26F5F8805EC374C11E3775E88129 BRANT.RAMBO
1,666,305,321 *AF5CF5F04BEBAE8514DC327B1987E3E8EDD9D3B1 BREA+H+AKIN91Y
1,666,305,322 *AF5DA7A46C2B4B3303B4B3E86B35D18374E17C2F hnmajidbekkasramonlopez
1,666,305,323 *AF5A41FDF1D66794E23C945781C46D07FE31E615 holy.cobra.(live)
1,666,305,324 *AF5F96AF3205B41C57E70BE5253D3F3BB1E88ED0 bronze-level
1,666,305,325 *AF58A3B241815451423900315436E5E0A3F71935 BSADAT
1,666,305,326 *AF516B40AC7815388D76B26EA74CDAA5DF9070F0 [email protected]
1,666,305,327 *AF520297B90D3006D2DFA855BCE358654A7063E5 HOUSTONLAIOS
1,666,305,328 *AF5486911AE9924DE8E6B04E0FD555F509E5AFC5 HPMC
1,666,305,329 *AF59259DD1C8C9B420E0196C61B4D4B5EEAF3AF5 HSOROYAN3
1,666,305,330 *AF5A32E5A4181A82F53E2363AE011ED0E2CC7207 h+t,
1,666,305,331 *AF5A12A9B054A0AF9D2C65504650BACE31D0E833 hu$bandag
1,666,305,332 *AF5E0A7F28EF21DFDD88573A75E9F3A0B13EA020 hulahochzeit
1,666,305,333 *AF5A643D4CA391FA2CE17A0F2EB3DE76B37841AB BUDDY
1,666,305,334 *AF51A776EEFCB882FFD65F59F5F1AABD84DF441C HUTTERSTRASSERS
1,666,305,335 *AF596CB48A332EA95446506432C9A1A8D36CCE52 BUMBLER
1,666,305,336 *AF504151881EE308D9B8DF612EA7EAB16B00D1E9 HYMIETOWN.1
1,666,305,337 *AF5C835C7334A5B9650C23B6F06697CE9E067BFF BURTONMACHAN
1,666,305,338 *AF5F033D8D1BBFB535F16D9F58D22220C160EA1F i0r3th
1,666,305,339 *AF5BC693EA13A4C5F424BCB34EB7D325BC293216 [email protected]
1,666,305,340 *AF5A542EF2BAEEC9BE066160B9088B0804DFF8E0 c$)&.
1,666,305,341 *AF55AE6B6784FBDD6B8CC42FEDBBE9F4FF820C1C [email protected]
1,666,305,342 *AF5ED0730E48BFF964D6014251D73ED443480AD6 C19177
1,666,305,343 *AF56346C978C38E623113118FE79661773A5895F c1f&#
1,666,305,344 *AF52698F9B5C8A891E81789D891E8198DEFDB71F C2"T
1,666,305,345 *AF57B8E9F99D2D72954451D901757D48121CCD95 c&91i
1,666,305,346 *AF529F7343D540371A68DFC99AFF1709D3DFFBE4 CADUCOUS?
1,666,305,347 *AF5C94629575B84E9E55FB55ABC7E44502ADD159 careyblum
1,666,305,348 *AF573EC0ED997D121E18B3C2DFDD0796FD2535D3 CARLGORT
1,666,305,349 *AF52BC444F325FAB7F67B1C40E1E24458A831519 ironmanc
1,666,305,350 *AF5079FDBD0494F2B318560AA04B8B2CD4C18A4E ISRAELCATANI
1,666,305,351 *AF5260C8C2739108981AB75F00C3C082EA4985D2 CCUHF
1,666,305,352 *AF54A7F2A5E6AAEE1625C4BAEA6E82FC174327EA j({0
1,666,305,353 *AF53F2DC8F067C5E2EA31A4229E6CCEAA1162AB1 CEWGO
1,666,305,354 *AF515B386E75371365DFA0A478992FA37C82C6D9 JAGWRI51
1,666,305,355 *AF5FB44EEED2808EBEAE29451124918D2C615E8B JAMELLUKEN
1,666,305,356 *AF5A8FF4D2755DFE6444212C08C34851763AA6E9 JAMES.FITTEN
1,666,305,357 *AF5E3802D8750AFFE8BD73138948109DAE41DFAD jamisonbranning
1,666,305,358 *AF5C1CCC854B723BCCF98FEE3650660FBA87464A chalanear0
1,666,305,359 *AF50D05CFA66CFEDD1CCC71811BEB3705799A625 CHANCEGRANT
1,666,305,360 *AF55017CCDC8C686084F456CEC3EE77C1EC3E722 Chapter-05-05:-Warum-einer-seine-Stimme-fesseln-lie
1,666,305,361 *AF5FD6BC3405A6EFAAC49EC72EE2780F1D4EADD8 CHARLESCHIMENO
1,666,305,362 *AF55B3C4649FA0B66E96A0D4C5E6B029269D3ED7 JAYSON.GRESHAM
1,666,305,363 *AF53D93D05D547945C7AB3282D45741795453523 JBALL65
1,666,305,364 *AF52DCE049994A7EC41E81B3D690991B2E461586 chaselowis
1,666,305,365 *AF54F09CA46AECB1E5D0F06C651E47A4832A6A15 [email protected]
1,666,305,366 *AF50B3D83F0C526BE529731A5BBA2D5516EE2487 JEFFERSONBREAUD
1,666,305,367 *AF52A59856FDB4FA962335AE87297F19E2D17826 [email protected]
1,666,305,368 *AF5CA87AC0AC1BB806EF0308E77A8AFCA95EFE1E CHERI REARDON
1,666,305,369 *AF56A8CF6F0CF2AAED1232EE7FB5814BAFC7A3B3 CHETYOUNGQUIST
1,666,305,370 *AF5D09DA9318CC794345137E3BF55F7DB4669054 [email protected]
1,666,305,371 *AF582B8D2628412510CE8228F25AC2F2AA33884F jessecasumpang
1,666,305,372 *AF5C74C740EFDDCF95DF91EDA79D79EB45C2D095 chortling
1,666,305,373 *AF53CB4F4026E0885AE383483EE8706271CE3298 chriskent
1,666,305,374 *AF53F91CB5C33827B5B5D9473A7A80F045716B7A JEWS.85.185.144.251
1,666,305,375 *AF5933A7BEE2D9B228B1E28687B60F06EF5045B3 CHRISTOPERFELLI
1,666,305,376 *AF590C2D71CED4EF7887185D63936F1EF10C71F9 C/HTH
1,666,305,377 *AF55D249D5BAF73CB292271DD4307F4F2D29BBE8 JIMMY.PEPPERS
1,666,305,378 *AF5CBF8185D26792296C1793308F70418A337F99 CII+
1,666,305,379 *AF527A7812C9EE4085E33C1A608451E5A5BFF368 CJV;
1,666,305,380 *AF51B18B91AF28BC0CF99D3FA94C6D6EB5AA02EC ckdu9
1,666,305,381 *AF587450C9757940BC48817DBF63B0CC77AA0327 JONASSCHENKER
1,666,305,382 *AF5C46296330250FCE2C7BDC3E1DB36ABD0288F6 [email protected]
1,666,305,383 *AF58C1D5992A45FB80577FCA6F231CF70733DB69 JONATHONSCHOPPERT
1,666,305,384 *AF507B11B356F3BE07AC2D16880DE614C63A2936 jon.halverson
1,666,305,385 *AF5663FA92D361AC28D3D85D83D4B73850F94538 cmce,
1,666,305,386 *AF589353EF140D6B76D528C52F38AAE8B0697680 co!=)
1,666,305,387 *AF50A76E933BD23FC117BB5A39FDAE750AE24F53 jvf
1,666,305,388 *AF5B38E8AC5C4BA322A8314F97EBB4ABE5E5930F Cold-9
1,666,305,389 *AF5F0A3AEB6C20F58E22C2D593D8D1F56543111D [email protected]
1,666,305,390 *AF528297B9156FA788A57FDDAEB9ECBF2EB054C2 conceptsidney
1,666,305,391 *AF502D708A6C7CFF2A3C3F13B7DBE793BBD546D0 c;os/
1,666,305,392 *AF5B13BA534D6DD761E1A9DA78EB3561AD80B58E cpaqk
1,666,305,393 *AF531F2242BDFA42F1A880F4003C4943615C1358 KEVENCARASCO
1,666,305,394 *AF598437883C4B9419AE9EAA203E003FE7185D12 kevingoes
1,666,305,395 *AF5327A687FF6E3B0C198747C5D7952E9E88A9A4 c:\programfiles\commonfiles\adobe\linguistics\4.0\languagenames2\displaylanguagenames.ja.txt
1,666,305,396 *AF51CEE9D77FCE5FD73940F3514DB63BCB60D691 CQLCF
1,666,305,397 *AF59CC68E72832639836A437B554B6BBDDB14334 [email protected]
1,666,305,398 *AF50D99225DFC00530F95B65A22D51B23A30BF18 kn1baa
1,666,305,399 *AF57B9A6ED24C0D4EB945628FF53E51F792C6C1E CRASYAQI
1,666,305,400 *AF55BD3310DA61199074314DEC38B67BCB5C27C1 krapital
1,666,305,401 *AF525C1A58961CC2E935D278E241378E266BBE92 KRISTINE DAY
1,666,305,402 *AF501F3FB744985E4E6BC15E11BA2AB237402469 CROTCH12
1,666,305,403 *AF5D688FC8F1F086B72B2F72055C1AB567DFADE6 KRYSTLE RAMOS
1,666,305,404 *AF53407E4DEA1E033F23B877B556EA58EBBF989A crrabswing
1,666,305,405 *AF538F344382271290F51DD6A8BD402B255646A4 KUBIJOVYČ
1,666,305,406 *AF5B9F940081E4874713957B7960F2A97C488EC4 L154449
1,666,305,407 *AF52285A82B1745D7426D69E7CEE8E756FE1D5D6 [email protected]
1,666,305,408 *AF54FA7219D5F992131693A4D9901A32D96D270D ctc$c
1,666,305,409 *AF5D60062528560D5AC035382F0792E08A8E5D8D CTVGE
1,666,305,410 *AF5BED5B5BAD41CE6189C2B6DA3F5889C46D1A68 LANGSDEKKENDE
1,666,305,411 *AF5EE9E5B6B46AA03734E47FAAC420539FF11B19 CULTURELER!
1,666,305,412 *AF598E4F8F54FE891FC81080AF38FBC28EB828B2 LAUGNILOEHCART
1,666,305,413 *AF5E77FD923BD1BE2EF5D2B8C0EC366874A3F470 leedorney
1,666,305,414 *AF56CECC6DE3DA91D53B648F6C497E44CB29829B CYWKP
1,666,305,415 *AF5962C39E4EF7E1D996AA272AB2B180D4CF275A [email protected]
1,666,305,416 *AF5E825FC377684E394948507925856CF4D08F76 lengottemoeller
1,666,305,417 *AF5319E04D262E84D71460647D07303729FA52EE d2atc
1,666,305,418 *AF58AD98E6E0B1158272307DD12BAC82276D2BAF d2qfm
1,666,305,419 *AF570CE1892DC115343A08B23C132CB28882B11D D3GK/
1,666,305,420 *AF565CABD073501927B7C0B48DC1B429C4D36A62 d3r%c
1,666,305,421 *AF5A1505A1CA6B8A52775468178518F29F3CADCE [email protected]
1,666,305,422 *AF5451178C9FACF8643F5AB5DE8AD35C503FF6F5 [email protected]
1,666,305,423 *AF5842BFC758F87AF15D3D10709E3AE9AD25DF74 [email protected]
1,666,305,424 *AF5BEBAE0CAC91C4CEEF986DB9EC52CBED8206A1 da!(=
1,666,305,425 *AF560809F9240CDCD83FF0DE6F6D10ACA86C9657 DABTH
1,666,305,426 *AF57DEE67BAFF02FE900A6AF7A456A5E6446868A Lightness-(live)
1,666,305,427 *AF57D2C9B1F0B023C4F812108B4E2236D3006D75 LIKE-AN-IMAGE-AND-SAYS-NOTHING,-AND-THE-OTHER-TOO
1,666,305,428 *AF562A3D783EDA585B3031D0EF16D1AEA9E7BECA DANIELLE HUTCHESON
1,666,305,429 *AF5BF0CD5DEA80B337503D2BD3C2157D4F237B87 DANILO.GABBAY
1,666,305,430 *AF59BEA5807CDCD1A01B4066AB72CB493F26C880 lindaairlie
1,666,305,431 *AF5E871567434A32F86E48F24135D9E1FABF8114 linomoerke
1,666,305,432 *AF5BCA0B267FADCC9B083C118A1D1BB99A827F17 Lipcombe
1,666,305,433 *AF59E5A8307E8FE692AD53E06BD57D91FFA1B55F [email protected]
1,666,305,434 *AF50B5696ADA914A0C67C6A352BCE9F06F1AD8F1 darylpujols
1,666,305,435 *AF50907ED7F3D6B94329B8D267EE2D178DCF413D [email protected]
1,666,305,436 *AF58A38362D7E49D3225AF7478F9787C433233ED LKMOBBS
1,666,305,437 *AF5FEED5C0D4A996F03F712CDC2F88C08CEEA579 LLOYDNESS
1,666,305,438 *AF5BD1C91D9784AB82DC0D60EAA24228CA8F5D80 dawiec
1,666,305,439 *AF5C2D4C61227EAD167E53CBCE5B5AA7F840EA2A LOCAMPO1
1,666,305,440 *AF5F142A2881EAB2C2AE39F5C326C07FD1F1B819 DB+GV
1,666,305,441 *AF5A55FFB90C68609428A6BF5AE64E04AA7BD3EE LON.HICHENS
1,666,305,442 *AF56A3D7F12AAEEF2D3823C9ACD44DB17D987A26 [email protected]
1,666,305,443 *AF5C7DCCD94AFAF655DAB00D16B6594CC3DD35F5 lópezs
1,666,305,444 *AF53747AF3A7DC0ECEED085BD0BC9D8A2766A41D LOVEMEMATT
1,666,305,445 *AF5C623495C839BA5ADCEA8A976E25404CD5FE97 delbewley
1,666,305,446 *AF55D670A90779DD71FA8BAFF4BC0FAE033A8AD1 [email protected]
1,666,305,447 *AF52046C906A6AF249CF2F6F2A3B41E51FE6E3D5 LUMINOUS),全部發動放出正四面形的能源光罩保護機體前面,強化型KNIGHTMARE
1,666,305,448 *AF5AF8620B5CE59471F399094EC3C8AB1FCC5CD4 dercarry9
1,666,305,449 *AF58A309F4A9301DF1004D095818D964DBF86B4F DERICKHANDIN
1,666,305,450 *AF5448101F71FFCCAD77A3D41DAD9AF95772DE15 machmood0
1,666,305,451 *AF5774336E30A5609BA1A0669867782C431CF946 MALIKPOTEETE
1,666,305,452 *AF5B2E30A6C77E21FCAB8BA7652157C4F0EE7A5B MALTHU5AN
1,666,305,453 *AF5FC7C9842CB9F9C2D9EAF1BB9DA63FC3DE2703 DG%DU
1,666,305,454 *AF53C8B7867495146FC435197F7BE6B96F6A2F0C DICKFRENIERE
1,666,305,455 *AF524D6A904E16CDB173FAE39615553C32C44ADC [email protected]
1,666,305,456 *AF53A40A326E20310146CA3696C6E9B8FF529274 MARGARITONEIDENBACH
1,666,305,457 *AF57341768726791D5997F6B38D67B921D530489 MARIANNAKATS
1,666,305,458 *AF53BBE54A3092D0D24F6EF035478E5C5312943A maxkirt
1,666,305,459 *AF55C8EFED5A2BCF4C39D0745FE57B4C30E5717E DIPO NEGORO
1,666,305,460 *AF5E80E69A6481055BE09E9A1FF91CCEB37DF0FA me+allurg1$+$
1,666,305,461 *AF53507CE0004EA7DD739EEA0043822D0C74E702 MELLY TRIANI
1,666,305,462 *AF5830B33988F9D876A067C8F3D06CA5C4795092 men$ura8i1i+y
1,666,305,463 *AF5C4F107F1424203E7F0D40F06A17128216D5D7 MICKEY&MALLORY
1,666,305,464 *AF5C2E6B7BAF9A3063CCC17A90BACF12F7746CC7 MIEHITYSVYÖHYKEJAOSTA
1,666,305,465 *AF5DEFE90F7CEC31357B686C5AF7BFB45E64999B DJMOISESG
1,666,305,466 *AF54D2B07B4749018E1B891E756A92F349009B56 miguelvilleda
1,666,305,467 *AF5D05DFD554717DDB1B882966496CAEB578DF7B DJ.XPlode.Vs.Hit.Pop
1,666,305,468 *AF540A6E0B150A096DCF3A577A374C9AFD10F3D0 MILFORD.RAINBOTT
1,666,305,469 *AF50610B732B6FE1BDFDBB55F4DD3F55AD8416BB MINNIEHOTROD
1,666,305,470 *AF5B461589F2D1CA4925B450C5E0C9616987B888 [email protected]
1,666,305,471 *AF5D29315C26790C2329B75AC66EB7542CED9A58 d.nm
1,666,305,472 *AF5ADB5C1975F8155EC3B3B1E584FE91BEF13447 donaldwirfs
1,666,305,473 *AF58475DD9E15ECC4CBA5A7F82EB0F535C9EC153 DONNELL.SHIERLING
1,666,305,474 *AF532B8B8F460BE74906E0F3E4C7AD03E3BC3566 montegonnella
1,666,305,475 *AF59FE7D83E1A1DE232EB9F16EAF317A88E57C83 montemerzig
1,666,305,476 *AF5D54F63469BA0AE3E30C437AEB340C503C5858 DONTEGULLATTE
1,666,305,477 *AF56F75C0C7B96E18839CBC1BF9F1602F321466C MORGAN.BRADFIELD
1,666,305,478 *AF500B16AFB511AA25AC9075180CC31914D27894 MORGAN.BROERS
1,666,305,479 *AF5B8F9399853721B94B30DD7017B343B7ADB81F DOP3R
1,666,305,480 *AF55971883235ECFEBA6BB46E1FD715842CEB74C msla8el
1,666,305,481 *AF53E44470B48CFFC8C8B9A347E69D7DAA1C1FBD doylehaskovec
1,666,305,482 *AF50E2A01FCCB5389B6D9A844CAD9C228340D7A3 murray-coop
1,666,305,483 *AF503180D9A61F154BFBFFAFE4B2598BC3D7D8B6 musiccore
1,666,305,484 *AF556321A68E816F477DC1C19EF59E58421E0036 MYTHEN & SAGEN
1,666,305,485 *AF5424BFE3FF67B851B254BB6AB7D588B9526648 nathan269
1,666,305,486 *AF5554608FB0301AE9F03E555029D461730E8770 NETNANEP9
1,666,305,487 *AF5994683FAD9910CD9CF15EB5D8C9363C670C30 NETWORK999
1,666,305,488 *AF53D98875789B0F1DE3B9588C74386DAED67426 nissanlove
1,666,305,489 *AF5C6A49CE18B9BEB8903E4040A5D338AF085766 ds.i_
1,666,305,490 *AF566C03689D297BBA477A08588918D56A2CEB4F d=t$t
1,666,305,491 *AF5C37CCCBD3C0BAAC8D0EFF2156108B66D49D1D norbertoferrini
1,666,305,492 *AF5B61D234EE8A7D1ADFD00858D6147D32AC561B DULCEFINAL
1,666,305,493 *AF5FCC81178B714A83C28980CA05D8111B9067B0 DU TA'R DET FOR GIVET
1,666,305,494 *AF59C1108A9781620D1CFC232C49923533238051 o{f!
1,666,305,495 *AF5DC50394FCDFEBC410374797161654B9F99C45 EBV5"
1,666,305,496 *AF5615047CE24FC9231108378DB7E11194221B5B olafolag5
1,666,305,497 *AF5850AF9D4738EF1D8AC0BA826E10D9348814D1 OMGIVELSES5
1,666,305,498 *AF5F4B19631F49D970608F460774EA086327A1FE onderzoeksverslagen0
1,666,305,499 *AF5A55CFC157E37EDE7B9AC4E158D97415F43FB9 EDN+B
1,666,305,500 *AF55981BC29946EB65D58AD5D92BE59B99711FB9 EFE4N
1,666,305,501 *AF5454AE95EC5F327994FE5D7CFE86A3A6B7EE3F EHSAN.HOSSEINI
1,666,305,502 *AF5340DFBE5F3A6D1258C92A9013EAF57774655B ehvpu
1,666,305,503 *AF53F6E6C2544199B9EB457EEC7E73C358134D68 “ORIK
1,666,305,504 *AF5C566CBE5A2906F4A199115D320BC30920EE4A os7o
1,666,305,505 *AF5CB37554E7A356C3E5DE233F8A51CC30DCD28F otisgregoreski
1,666,305,506 *AF55761F8C1796C54828DD22B71E7235C4A35B65 EKTMN
1,666,305,507 *AF5BD00A410DB7000814454AAC8B88F4D6E9AFB2 el.
1,666,305,508 *AF525CABF041C85B8DDF52981C5150BBBC51F2AD ELENOITARRI
1,666,305,509 *AF5614551A134AB6A162BC82CA29F3F5242F58AC ELIJAHMCGLAUGHLIN
1,666,305,510 *AF511AB8B5D9FBB343ADDDC00734EDDB842A7BF3 elijahrohlman
1,666,305,511 *AF59B07F22484450828F3E9F5382352E3937C78A ELILARIMORE
1,666,305,512 *AF5573190B45173CFDC8F780EF67CA9F1FB07F00 overkampping
1,666,305,513 *AF5FD03ACFE5944140E702788A16E1F5E27ECAAB (>-<)*(====p
1,666,305,514 *AF506848D539246B6F49AE7AFBFA5BDC9989303B P===>~0(X)
1,666,305,515 *AF5AD228D72D3C30A32A0296C46672BB34A1BDBE p2jor5dzp9mj
1,666,305,516 *AF5749B1BBCACB5BC0EC7F84509A098F9E5EB023 ELVIN.KILLINGER
1,666,305,517 *AF520CD0C0CD8BE039D88FFDC6A5F867EA1C1A4E pabloremo
1,666,305,518 *AF58CD29B99A4EFBA19374A67CA262AF6F670B0E PABLO.STRAHL
1,666,305,519 *AF5E31FFA7B3265E9CCE620E3836C6E3B2B2D8DE ELVISSAM
1,666,305,520 *AF5ED3F1369BE7FF99EDA5D3F6AF47509ACCD9E7 PAJUNSUK
1,666,305,521 *AF53E54A3AC4098AC79066923D89A68C554A72E3 EMMITTZOMBRO
1,666,305,522 *AF554465AEB8CD7B2734DC026849959D2CE64BEF emoryspickler
1,666,305,523 *AF52411CC2BE5DDA8B0980365BE1DF5F9AE43A4D en221128147138
1,666,305,524 *AF5AFE449EE73CDE5E2231E139CBFE24E5C76400 PARCHMENT[email protected]
1,666,305,525 *AF5722EE8DAF3202F370C166DD712A3F7C8FC04D entitetskima
1,666,305,526 *AF5F1AFB2BAD4224712C188E15A41F9B2A885598 EPHĒMERÍS
1,666,305,527 *AF5CB2C2DAAAFC4FEF43DA5D14215461EFF7CCD6 episodios.de.escuela.wayside
1,666,305,528 *AF5A82ECE7273654EC9ED0B7579D48C4845CB223 epochenwerk
1,666,305,529 *AF58D3B17F6DE3BED74CD52DECF93E76CE59F53B PEPPEBARRA
1,666,305,530 *AF5B6DCE62AE74FBB9B07984C5BB383A20216F45 PETERSUNCLESAMSFIREWORKS.COMWWW
1,666,305,531 *AF55F475A951343080BC65C51DF00AB83283CDEF PHILIPARDEN
1,666,305,532 *AF524AC29FA7129BBD0410D0BDC6D35AA9AB1342 esztykeeh
1,666,305,533 *AF5DD44507275AD6936AF93DB3ECEA848855E359 piagajitos
1,666,305,534 *AF555A088BCD71445AA610529D0445752F6CD386 exsputor
1,666,305,535 *AF5328C0165C373BDBA65502638E64CD6DD1C103 p)~.~(O_)
1,666,305,536 *AF53C37CF1980FC8C7D0450A250234B4B3155DEF FAREYZA
1,666,305,537 *AF54FFD731A04A2BCA8607E4E89C10C89F64B568 #fc$
1,666,305,538 *AF5D44E5DD1FE4059B69298AC6DB347D9A930163 felipekoc
1,666,305,539 *AF55073EE981B251C7EEE898A7968B95799032BA FIP1
1,666,305,540 *AF51B2F762A810EA4120F3BEF741E9DD8B988F12 FISH.C4K3
1,666,305,541 *AF566A81BBC43AD481FE2BBF2CD27790573BD415 florenciogeohagan
1,666,305,542 *AF53E0FC3D21C0C8FA8C592A115BC90469812E5F FLORENTINO.DEIDRICK
1,666,305,543 *AF56DBB377929CE8168E599B2FCF03EFBDE88029 FNETENSTB
1,666,305,544 *AF5AF6F7CC1432BEE5EE0A0C25C4B5E1E6205ACA forestalleruzzo
1,666,305,545 *AF5606741D6CACA6BD378AB31633C3461CB428EA FORSTKOMMUNE
1,666,305,546 *AF58CF19D9BC2EEC4292F7F0DA7A35CD2DB6F82F FRANCINE-J.
1,666,305,547 *AF535BF021D75EA1B0ABF743515E917E2CF8B54F FREEBOOTER
1,666,305,548 *AF512E5BFAE3EDF03BA9112FCE5486A94C14985F [email protected]
1,666,305,549 *AF57E794D92B2C70322E0E2006B8C8DCB338F735 FUNKYZULU(YOU'RESOFRESH)(CHAPTER2)
1,666,305,550 *AF5ADC10908751BC73070383E0A1B711A40C7192 GAF1ENS
1,666,305,551 *AF501ECC119AFF48C7905FE9B45AD28A3EB6D400 garymorring
1,666,305,552 *AF5C05D7695C168D4E888D850130BB4DD591510A geauscul1
1,666,305,553 *AF5A1817B70EA8586ACDE406180010E417ACEC74 geraldrolseth
1,666,305,554 *AF528308DAC41CD4FE7490DAB19873404983DFB0 GERALOUS1
1,666,305,555 *AF573F2261BC3BAC41CF830E9D41C8E7481DF4F7 germanwinchell
1,666,305,556 *AF548103BBCBC0ADF71279849F18C81BB1CA2F70 GEVOCHTE9
1,666,305,557 *AF5C30184A0379920C4EEC7F54C2CC80BDB38EA6 QOBIWAN9
1,666,305,558 *AF5EC6F67800717F1F8A7C703C9F6EA0D414F7A8 GIL.PREZ
1,666,305,559 *AF54205F40B4B8005CFD3760DE5A5BEF4D46ACC7 QUESTXXXX
1,666,305,560 *AF55DD19F6D5F02723882A6766B83EBE21E86649 QUOTASK
1,666,305,561 *AF59B357E34327A33464B01B0B02426AF3F96539 [email protected]
1,666,305,562 *AF53E4416F965B4615CB87CA7E88CC137828EE83 GLENWIEBEN
1,666,305,563 *AF55FE653F785954BF97E2D946D57C7817FEA10C qyjf
1,666,305,564 *AF53018F51DBEF48E7DB14DE903E96DA0037169C R393RMINA7IV3
1,666,305,565 *AF5E0FE7A70025FC58A95485DF64E0CEA46EC796 r4ycaaaayaaj
1,666,305,566 *AF5E28EC115423F96840557A014E346E0283D1D6 go-dawgs
1,666,305,567 *AF5F8B4902776ED882AD7D0AD94B7B7CBAED854F GOLF
1,666,305,568 *AF5464C9411DDA3B93B313DFED5ACAC2DB04AE6A RAGHAVENDRAKUMARN
1,666,305,569 *AF576C003CE8BBD7DC18E8B6ED2F4583D560BD66 rahul.kapoor
1,666,305,570 *AF5FFE2E1FB76D5EA27604C3EC83AA2CE1F6C2ED RALL0(FEATHIRINIMELBOURNE&RICHARDNUNNS)
1,666,305,571 *AF51F5D6453C063103F8F755CD9F3B043750BD67 raptorstation
1,666,305,572 *AF5E1D6D3CD101600775F5662FA7F01D9211E7E1 RASTA126
1,666,305,573 *AF520AC4ABAF7B3F2881D8FEDACF9ED79542C498 grantjablonsky
1,666,305,574 *AF5409E336882C7E0238744D12C68F48E0ECF4E6 RAYKOSTICH
1,666,305,575 *AF55316706A8DD795D95D4E06F407DFB82D311AC GREG.HEUMAN
1,666,305,576 *AF58CB32126FB3D3F5A6ECA0DBE6965738F5D87D grieshuckle1
1,666,305,577 *AF579D07D0CF7048B875CE53557C6627B07B7560 REANALYSERS6
1,666,305,578 *AF52511FC0A3E333C2E07E37E2C58B768D04E2B3 REFUGIOGRALL
1,666,305,579 *AF5159E4B086A70CC6148B135192A2FD92139077 REFUGIO.PRISCO
1,666,305,580 *AF59FA14F472ABD9F933D4DFB90AE5FAC47FCFDA GWN-
1,666,305,581 *AF5A5C0680877226BC72C3A4B227425B40DD8E43 REMAGNETIZEDTS
1,666,305,582 *AF5BADE12FB45A02C7EA9B6EF1D578F8450E9D62 REPRODUCEERDENSED
1,666,305,583 *AF536669A7F6280FE239A22D99657E92357CA3C9 republicrambo1
1,666,305,584 *AF52B60308F76E46EE94CE677009C76D5D494F0F HARMONIA
1,666,305,585 *AF5209CAA351DE649086F30ED48B8BD9B5182747 richardminarik
1,666,305,586 *AF580124423245F32C056A3BEEA65FAD40884F24 rimpatria0
1,666,305,587 *AF5126792A8CEBC3C6BD91E5058BC9934EF1E60E ROCKIN'THATSHIT
1,666,305,588 *AF5EE31012D596DC80FB867DA66418A88B643E00 RODRIGO.GALPIN
1,666,305,589 *AF5A88A967B878924C785FF1D47F3428826B4FF7 romeoandjuliet,fantasy-overtureinbminor
1,666,305,590 *AF5273F5A86798101B9EF49D6BF96D35EB15E692 ROYPORTIS
1,666,305,591 *AF5DC9D405AF34F7CDE42C87831B83517CB4251A [email protected]
1,666,305,592 *AF53CA11700315226AB6C74F4128800A0BE183DE HLICH-BIST,-DANN
1,666,305,593 *AF57574754A1376E8C814030814E13A94C25780A RSSMLNTING
1,666,305,594 *AF50F77453BA03A0BB1AC00EACFDA8F611359ED1 [email protected]
1,666,305,595 *AF529E462C656AD01AB2F108AF6FB910D1A9CA8A RUSTYMINOCK
1,666,305,596 *AF512704B559C655FD942DBA25B1090E26A64B7E HORRORED5
1,666,305,597 *AF5BACE5BC122F061B10E5438C3A82686C9087E8 SAMKRANTIS
1,666,305,598 *AF5166DE9766885B02848B99C7372882A4FB974B SANGRIA
1,666,305,599 *AF516517BB411803EE6E56831F367381511E7B6F Say-It-Isn't-So-(Special-Extended-Dance-Mix)
1,666,305,600 *AF5CF3531BB8ED70201B04485343F5B889A0E768 HOWARD.OLLIVIER
1,666,305,601 *AF54E1FF2955AD0517BE934E1C09524D2966F881 Scapegoat.-.Scarecrow
1,666,305,602 *AF5CA8E9C894F40132C938641FB17D460068129F HPMC
1,666,305,603 *AF57AAA057973EB7778B3AA46C4444FF58E2EAA9 HTTPSPAMMYSTERYSHOP
1,666,305,604 *AF5CC4A38F23AE3697C7B3257A4B86DB752C1DC5 [email protected]
1,666,305,605 *AF5085040C0E4F897151ACF74B90F92D6D4A659D SCHLAFENSZEIT1
1,666,305,606 *AF5C8F75ABD34AA26C55566BAB81D6EB903F507C SCHULETER
1,666,305,607 *AF573A37AC49F86EC0BCCE7B14D15968A77F13AA huooibsw3
1,666,305,608 *AF5E4A6320832A3C1731B36A8DA069C9D1444F41 I0D0M3RCU
1,666,305,609 *AF5DE79D632EE7FE8FEFF30FF89E5B4ABC74192A IEREDNEV5
1,666,305,610 *AF5DDE3CAD6214D82E075DDADC1D8828223A7A27 ILUVSPAZZ70
1,666,305,611 *AF57A4036C39B13C7CB8FEBE4F0E12EA5F5832A5 showermingbbs
1,666,305,612 *AF58641731B4FAB251009628BB979A97CC674A6B [email protected]
1,666,305,613 *AF5AF82E1308E42FB5F458AF08BED204CABA27FF inchesbeside
1,666,305,614 *AF548E4A08342AC4E55F0745E1FFB93E6B8E3BF1 silliat
1,666,305,615 *AF562F2C23C4F5E658F0EF1D65D7138D968F8FCA SLEKKAWK4
1,666,305,616 *AF577DC375335CDC0A9D036F5EFFAD1411754534 IRENETOPETE
1,666,305,617 *AF58792184BA556BA5F34A86914F488060BB15D8 SMILESGONE
1,666,305,618 *AF5679023DBEB989ABD344936A4223D394A7949E smonorp6
1,666,305,619 *AF5C2A93A02F634526037CFD9EC931C308D6FF49 itsopping
1,666,305,620 *AF5567A1C04B179CE540B4AC55803358D4FBDADE IVAN-ENRIQUE
1,666,305,621 *AF511A3DE5AC7CD3C472DAE7779FD520268B92B3 SOBREESTIMÀ
1,666,305,622 *AF5F855871CCDDB215A1CFBAA6F136661419875B jab,
1,666,305,623 *AF50BF5A95422CAD596B1EE124FE3B23A2542CFB [email protected]
1,666,305,624 *AF57922F4B7E66D314FABEAF68D21FA2F90BCBCC JACOBBASGALL
1,666,305,625 *AF5F53DC8B126B743421AD52AFE3ADA95495CDD0 sonnysirois
1,666,305,626 *AF5DC8978647BF5D86AEBBCDD54290561AC27147 SOREDAJIHA
1,666,305,627 *AF5C9E708545E279721A16982401C075B41860C8 [email protected]
1,666,305,628 *AF5943B883E9805F7BEB749A013A85E499C812CC SPLAT*<------B
1,666,305,629 *AF56297B90B1DF397EA99757573B60C8F170260D STANDAARDRUIT
1,666,305,630 *AF5CFDD4B8FF941CBFDA516EE1FCA7B3B1FBC14D JBOXLER
1,666,305,631 *AF51EAD99CB845271DF6B4A0E7FB00FD510BDBE2 %STELLA%
1,666,305,632 *AF5F6B67F314048166319D2F916DA8A73E8FAEEE stepheurope
1,666,305,633 *AF51E81693606F0BEF2B01AB3845F67F6FA4454D stevejunge
1,666,305,634 *AF5CD344FCD4F0ABF0FC3209ADD4073630163181 JERMAINE.KONECNI
1,666,305,635 *AF5ADAE0F96CF34016F671BAC784031AD2DDA51B jesusgraymail
1,666,305,636 *AF5D28E6C52A3F32549AAD7C745745F9AAC4DAFF J!G5
1,666,305,637 *AF5C11C4ED191F2DB441886B78988BC7F1472825 suasorias
1,666,305,638 *AF58576454E6CEE386A16623CE46EF48F164AF50 SUBITSELEAC
1,666,305,639 *AF55316A1BB9B8F881B47BA42C5392E1C9497407 subthrill
1,666,305,640 *AF56A481AC0279E40771A4129061122D79BB14A0 SUCETTEI
1,666,305,641 *AF5A4A1DCA06F4EFCC832F17298C06843AA383FB [email protected]
1,666,305,642 *AF51F33C8A5AE7B98775C834DFF4F47A0AB4B6A8 SUIDPOOLGEWESTE9
1,666,305,643 *AF567E54679242CA157776243CA4A2E26F4C29C9 SULPHOFICATIO0
1,666,305,644 *AF54ED41C2E71DB8569E487D5C186D919291B30F summer-girl
1,666,305,645 *AF5AADD746D88D2ED4A94659AC5F80A7D2FCF1A0 JMCHENRY
1,666,305,646 *AF5BBC9022E7055062872AB793643836A53598DE Jonathan.Juel
1,666,305,647 *AF5554B0070A17E0D4B641CA0D68ABF6E8AB2E26 JONATHONHEEG
1,666,305,648 *AF5EDB9602B08BBA844E8280249C9B8B8C9E88D7 joshschulkin
1,666,305,649 *AF5645D5360E2BD3AB8993F08F2759739CAB07F3 JOY CADOY
1,666,305,650 *AF5C931FA70E32BE9E7FB6E0EBC099F018FCCE7C JOYCEHEFFNER
1,666,305,651 *AF52EC969058FE379B7C23850D104B15F5A4FBEB sydneysarullo
1,666,305,652 *AF52B4DEFA6F2520229869F2B6175DA54BF4A307 judy-ann-santos-and-joel-torre-win-top-acting-honors-at-the
1,666,305,653 *AF5329DD9A5970A70DFEAC70B5445C57B8B7345F [email protected]
1,666,305,654 *AF5F11CE28EF15DA5A758D054BE5BD28F3A67D9B S\Z~HT
1,666,305,655 *AF5F9567C52EDCBCA8178EB5E1AAA176F6FBCA23 [email protected]
1,666,305,656 *AF5C5616CA88A7900ED18DEA8F7BA15662C4EDA5 szskrvwo
1,666,305,657 *AF55A4DAD7C31834D4F8B507E407561C7074F905 JUSTICENICK
1,666,305,658 *AF5CE8D684FA6DB8E6C811EF14C95D6E15EEDE8B kannstdudichnocherinnern?
1,666,305,659 *AF51CD13A49C1923BF4C46549AB74307703BAEE5 kauppinen
1,666,305,660 *AF5AB90C4A9549D8D46066AA34A3B394962734BC TEDEUMPOURLAGRASSE
1,666,305,661 *AF535011A612B533FF8F0E7D64F1B2B54C8E3BB1 TEMARA.1
1,666,305,662 *AF54FCABEED9D5ACCD77843512B9DC210CA3529F TEXMDBSW4
1,666,305,663 *AF57B1ABBA5967F592094543F47B3D8EE53590FA KINGDOMWAS
1,666,305,664 *AF5B8821D726CD3C3FBAD7398D253240753E13E6 THE-APOCALYPSE-INSIDE-OF-AN-ORANGE
1,666,305,665 *AF56204997CE425AECAF88006B3027DB4A6B8D64 kkcbxjwg
1,666,305,666 *AF5180E1A66E674B02F7368F85BF9A910D260E5F themefromsonatainc
1,666,305,667 *AF576D8344478C36347B7DED738DADB869BC063F TheRiddim
1,666,305,668 *AF5F51C513889397E8212E084D02F794AB483C00 THROUGH-THE-BARS-OF-A-RHYME
1,666,305,669 *AF5D31E019F6FCC3DFEF82BB9BF2B08812D47CA0 KÕRRELISTE
1,666,305,670 *AF52405769831E5FF451E0B5AF03A06996D961F5 KXQJ
1,666,305,671 *AF5674AB02937DB549397AD44C09047C4B4FAE06 kyvytoen7
1,666,305,672 *AF518F473DEEFD9E1FB7C82731C82AC8495CC67D laryngologist?
1,666,305,673 *AF510FB7227C09A8F9CAF6EB8337DC7486604215 LAVERNESZUFAT
1,666,305,674 *AF52640812A8ABDB54706569FEB5AC969F41E381 LCALMES
1,666,305,675 *AF589DC3D2984D0BA96448D4005A6F2237F87D65 LEHMOET
1,666,305,676 *AF57AAA01D3721AED9923C99FF990F78B37564C6 LEINUNGFAMILY
1,666,305,677 *AF58F9123942FBE10C0E80FE5F811FB0BD00D441 LEONARDOFOSTON
1,666,305,678 *AF55616D96BB5274EEECBA5D4821BBB434B018A3 TNKELIGSTE3
1,666,305,679 *AF5635A033D86C2FB2F84D53C03CFC2D4E44E346 letitiasanchez
1,666,305,680 *AF5149B8BBDA108EE93376EE5FF5BD9490464663 LETTERS-TO-THE-PRESIDENT.--AMONG-THESE-DOCUMENTS-ARE-(I)-PAPERS
1,666,305,681 *AF502235451F8E9B1C6B0667BA69A2015082AF87 toitses
1,666,305,682 *AF5B72B9E529905FC2D2B82760AFC1D0A2D5294D TOMMEK69:TITTEN69
1,666,305,683 *AF5F61B9A76D9DE7A876E553FBDF3358FF7F0505 toneyrolfes
1,666,305,684 *AF5EECB53C4294E1E4718349DF695FF178298384 TOOTSIEAPPLE5
1,666,305,685 *AF5B148B33C09F67EC56D3C54E8C192E2DD5C189 TRCHDNTD9
1,666,305,686 *AF58E805F360332A54D8F934013ABF93FA4D9E3A [email protected]
1,666,305,687 *AF523C3989B26D7CFDEFC0C43232AC256C357F5D TRISTATECYCLONES.COMTRISTATECYCLONES
1,666,305,688 *AF520EA6ABBBD5E01A1853543C102B64A671DA55 trwenton1
1,666,305,689 *AF594954750C228F59992765825F46ED5258D287 LIVINGSTONFORMATION
1,666,305,690 *AF5025FE4B15062AD5848BDBBF2992944DD837C9 TURBOMISHA8
1,666,305,691 *AF54120D302C5EA3B1AC8A59F028E7D99BA09B69 L..MCKENNITT
1,666,305,692 *AF5B077CEC8E0209B03FFDFC3E2F4C18FD8B9F1B tylergassick
1,666,305,693 *AF51006577AC7C1EA02E074F768F537B6191E868 UDORIFIC4
1,666,305,694 *AF5F48A9EF3062D6585D368909B227524424ECDD ugglantexten
1,666,305,695 *AF5440CADAC1713F281DD429CB8D89805A1A87A5 UMLAGE/N
1,666,305,696 *AF5D7955ADE3968B709C94F0E656E8FB274947F6 LUTE
1,666,305,697 *AF580DBC5C474008D1C1A4E776E176450F55DF88 UPAJIIVINAM8
1,666,305,698 *AF5BF98A2AD16136A06D8DAF07F816B6B6856077 [email protected]
1,666,305,699 *AF5F7B39B1F6C848330E7B9CE92E4C819BEA3E11 [email protected]
1,666,305,700 *AF5BA49424B9FDE09B62125CF1B72548EFA9EFEC URANIUMRADIUMSERIES
1,666,305,701 *AF5C42E80645CFA9F1F5D5619EF6006EAA4EF59B USEROMICRONPERSEI8RC
1,666,305,702 *AF54AA1D45E11D573400B90448ECD0F34AD23B5B [email protected]
1,666,305,703 *AF5E11BFCCF3B46297BCE770CED4B23D6CAAA3CB malikterrone
1,666,305,704 *AF51B76CD3FCD92629722BA88602CAAF8978169D manushi.desai
1,666,305,705 *AF555A5335086142DE7E649C10AFC01E03B7F927 MARCELINOHALL
1,666,305,706 *AF5F48A7E9C099DBD692ACB3CD6CBA9DB02C9ABD marcellspencer
1,666,305,707 *AF5303F7CB5B44DF1932674C69E826C86F74C569 MARCUS059
1,666,305,708 *AF5DA3B5640EA4B50663DAD0FFF47CA977B1D7B3 MARSHALLMORNING
1,666,305,709 *AF5B0FE005C1BF119220BD934F803935B8871FFD MARVINARON
1,666,305,710 *AF529D4EFF28E43182ED5536DD0CFA1CDB83DFFD venessa-kariuki
1,666,305,711 *AF58F3632C38313560ED75F6D73AF1A9FD78671D verbandsämter
1,666,305,712 *AF59AEE21585B32FF84BC6F021761157193CE18C MATTHEWCOCOZZIELLO
1,666,305,713 *AF5917CA215C7F1AF67990680BB2B2AC546C23D1 VIANA-CLOT
1,666,305,714 *AF56BB2B1E9A23AF7CED29F9B5957F86E385BA1E MAZERIÆ
1,666,305,715 *AF57DF9B05AE6F795F240BB38270FF08630910F5 MCXI
1,666,305,716 *AF5C6AFC92A6690F2248EB32C68F5156CB0BAA12 megcsókoltalak
1,666,305,717 *AF523426F28031D0E989BEF4F5F539B06CD768B6 VINCENT.MCELVAINE
1,666,305,718 *AF5BCB0771A2D97BF706EC292F08D573B5FB5230 MELPERRE
1,666,305,719 *AF530A4EA25D4750D064E5C1024AF1368C342FFF merrillvukich
1,666,305,720 *AF5C1823859BFF682ECBBCC5ADF1D262DE8D9DA8 visionbluesky
1,666,305,721 *AF5FB11B12708230D537CFB70D04D18B8977C159 MIATCDAT5
1,666,305,722 *AF5AD40049316443A310DB3C33157C6C34CE457D VUKISPIK2
1,666,305,723 *AF51C4F35BB1ECCDEF09DE71613DC3D59ECF5D9C milder
1,666,305,724 *AF50B44BD4BE07DE14ED67D56E827FB938D9BE64 [email protected]
1,666,305,725 *AF582ED80F509DF340EC23B1ECAB59C7AD833209 MLOSANAS
1,666,305,726 *AF5F3857FC80AA60D5480156AC0F77CE4E2E4C5C MMAGNUMFORCE
1,666,305,727 *AF540381A2B6C31B626CE8C0D647DDC9D980F3D9 MOGOLICING
1,666,305,728 *AF52E9BF938BDEA0DFD1F136D507CED94CA0DB94 mohammedpoppert
1,666,305,729 *AF5C05AE03A80FE5A8D10D9342F6D94777692944 WASHUPE-RRANDE
1,666,305,730 *AF5E0FA18E1DE92DDD030C75B35BB4F0E0139242 WB!M
1,666,305,731 *AF5259D5BC9496DE7A1EC91FFBB8620AAFDBF823 MOSELOFTON
1,666,305,732 *AF5B3721B748FC979CDEF0110DB45143622BF20E mountstjoseph
1,666,305,733 *AF59DEC88D6E641361D210D37E81EE90B4962297 MROQVCK0XMVM8Y04LYRQJ1FAG
1,666,305,734 *AF5668FB2BAD6161AF8277BE0D2E92D842F23566 MUFFIN4BUS
1,666,305,735 *AF575536C948768F1FF0B002005115D8471F02DB mvpm2005
1,666,305,736 *AF50CE77F69FC869C0749572D41AFB932C01688F myvincent12010
1,666,305,737 *AF5962B9AF52CD562191DC5D5B2FF286C18CFAD3 nedwalser
1,666,305,738 *AF5634D61B3E285D0AD5716AF7003C5875F7DE59 neilmitsuda
1,666,305,739 *AF5C9118ADE212294C720714CEBD314D75473C2D NELSON.CALLEROS
1,666,305,740 *AF55CDC23796FFB14B53235380D164DA1A63F683 wwwgeschichteinchro
1,666,305,741 *AF5F26BE3609D50EF1CE5E25D4E12F79FE237171 NET」開設
1,666,305,742 *AF513CF415BC628A7934268EB3536F9DB72CA3A5 [email protected]
1,666,305,743 *AF5FC89565FB129975F5B4C5FBF47C5C2CA05EAF xaviercesar
1,666,305,744 *AF5F8A305537D847E3D8E54B887A8C4A822214B3 [email protected]
1,666,305,745 *AF5B0F51FF60C5F650C56CB78B4C6E8F59469108 nickfelder
1,666,305,746 *AF5042AA18AEAC9FCB338F6BFCA6AD58E2B957E9 NICO88
1,666,305,747 *AF5044E45AC336203C06684ECBB8EA8BBFFA24F2 nittultenna
1,666,305,748 *AF5B9FD343C04807702DE3794BFAF9750AF87385 NOE.COMMON
1,666,305,749 *AF5F3D44C965BE9BF2BFAC1317EFE1C501B9674E [email protected]
1,666,305,750 *AF55F60443E0AA43C23E4498B00453FA7CC2B76E [email protected]
1,666,305,751 *AF5B2AB79A3BDAE54AAFECE652655FE97D1C664C NORDIANAISHAK
1,666,305,752 *AF5903A794C79C45E03C078C7FF062D11F98481D y4/
1,666,305,753 *AF57D2714AF8F5BA4AB9F76C6143CBB98F2238D8 YANKEESCHICO8
1,666,305,754 *AF5852EE044DB13C46C5C61EC2BEA1E11959C2E5 nvtkel
1,666,305,755 *AF5C44E9FF256DEA1E8CEA18009B2046728C5C72 y#g.
1,666,305,756 *AF581CB0152F75A31812624443561BE85409D305 OBEZNAL0
1,666,305,757 *AF5AEB54C4CEE2F31E4A86ECC6CFFFD601F2777F YNVI
1,666,305,758 *AF51313A7D35BFBB9D846B218EF413FDD29D13FB yousef-alkuwaiti
1,666,305,759 *AF5EA2C7EF312CE4C8C8848826596B09365C6F0C YOUSUF-POCHI
1,666,305,760 *AF53DAFB629597BEA87DACF599736E1B81BEC4AC .YROTCERID ELBAETIRW YLCILBUP REHTO YNA DNA */LOOPS/RSU/
1,666,305,761 *AF5C0AF54EBBDD78D065931293F9635FF923FF82 YTGFU.GUHJ
1,666,305,762 *AF58D58E6ADAEDBF30065B19770BA9E0ABD62351 yu3e
1,666,305,763 *AF542742DEF2DBAA30E3848D189C3F96EF966921 YURIEDELALUNA
1,666,305,764 *AF5F86C08AF88EAE5E361C24677350193C0180AF YXVJHCCZZQING
1,666,305,765 *AF5C2733581D167607E43D0CF54C31BD5E0E6571 Y]_Y
1,666,305,766 *AF51C3CE8F69916803B829DC38070E80F7BB18EF ZACKARYSHERR
1,666,305,767 *AF56839FBAD05C7552BE2712C9ED1EA90EE7762D ZAFRANCOMARIAN
1,666,305,768 *AF54090D104D351511652E9490095497810A576A zahid-ainul
1,666,305,769 *AF5FDD9B263973E8A72971C014F7767A6F315972 zainab-amri
1,666,305,770 *AF5F9ECC6C2EB462B38001ADA3CBA6CDA2C42A2C zaini-zalia
1,666,305,771 *AF5E0944328E90D23A535C07E27B9F656554200F oniuqniuq
1,666,305,772 *AF558400BE3535BFE50519363A1B93CD47A3BAAA O->-<O~0~D---B
1,666,305,773 *AF5EE5EEBA22C2E66450F55B72C7FA1C60B21198 (>_<)-O~-<####q
1,666,305,774 *AF53D13DC4852ED4C4701A279A5A75075D66B7F7 Orchestersuite-No.-1-C-dur,-BWV-1066:-VII.-Passepied
1,666,305,775 *AF5368F003D9A43A61D8234B08628A87C4E11D70 ORDNETSING
1,666,305,776 *AF5A8D55868DDF00C6BB695771E85A9DC4B9823C OTHA.TYBERG
1,666,305,777 *AF5D05A5DB5B821E6F93E41DD2D370F8EB1A3FE5 otherwiseinterpretitasashortoption*/
1,666,305,778 *AF55375AD0B2F831B944D71A3E7B1CF1CACEE65C ZWIESPAES
1,666,305,779 *AF53E83923C172C59C071E77EE9F4CF1030D6A33 ZYRA TAWAY
1,666,305,780 *AF5D78074FDD95E1F8619B74BE0582DC76CCAD7D (~_^)**@-----P
1,666,305,781 *AF57D4B577237D17DC105B975864AA068612B1D6 дичикко
1,666,305,782 *AF556107DD04770E50791AE5B642DDDA59DB9500 ІЛМАРІНЕН”
1,666,305,783 *AF557E2B26DC1196E01CFC2146958B15C626B37B ПОЙМЕНОВУВАЛИ
1,666,305,784 *AF5D5CB7FDF0E64786E619411D038CFA17CA9479 PEDMARKS
1,666,305,785 *AF52F112ECEE930F552B893D2C779436840D546A PLACARAS8
1,666,305,786 *AF5B42B593FC03AD39E4B67F93B3FF39C3FA73F5 PMUSTOE
1,666,305,787 *AF5F93F36FF17318A24D2DF538F70F0B799AA11F PÓKEREKET
1,666,305,788 *AF578B0B397DAFFEA9DA8BB75441BC93E28D98E0 [email protected]
1,666,305,789 *AF513308EA7BD39088260662F2D7A16797826C19 p######p***(^_~)
1,666,305,790 *AF5875A54CADBE1BBF3FFF2B2634A5405B1CFDDE PUSLIAZC
1,666,305,791 *AF5A081730DE2EBDA54A4EB092AD42E0249C27F9 [email protected]`~.`~}x{
1,666,305,792 *AF5BBCAD7BA9A4AF28256766D1AAE5811CD04781 [email protected]
1,666,305,793 *AF553528931D74B1E994AAF7EBAF1A0E73B0BAD3 [email protected]
1,666,305,794 *AF574A7FB45F9580C6E0B79475825E3B168EC19B qlxx
1,666,305,795 *AF522D12548A6C0564C2D3FF161C148E6A694AD9 [email protected]
1,666,305,796 *AF572EF1F9FEE75F3F65CD61608F98A4430F42F9 QUINTO.PETELIO.LIBON
1,666,305,797 *AF5E0B963256AF62242A4941027308EA852B8E3D r9p
1,666,305,798 *AF55F90E09558A6486E7A4E10B916B6647F30AF3 RANDOLPHMAINARD
1,666,305,799 *AF520619B0266970E41D99B8EC56B9A751D4CC1E raspberry-flavoured
1,666,305,800 *AF5B6B42AFA58929FD56BC8EE50E9D8DECAAD4AF reidbushell
1,666,305,801 *AF535E8BA264237D1B4B5E24CE6319279E703BEE [email protected]
1,666,305,802 *AF59338BF603F993B196BBBF429F64D2936B05E8 REREBUAS9
1,666,305,803 *AF5A9BBCC7CCAB9DA4CB4DD97872F56E47B774B0 1097788 THEGROUPISBASEDHERE
1,666,305,804 *AF57C3754C37556D5183BE8D00DEC4CB0A66B3AE riposterais
1,666,305,805 *AF5C352252CEC81A1256C3424CCC5054EF76539C ro$eb4ck
1,666,305,806 *AF5234046B6B58A849E4DC62A3881EF137E81F03 RONALD.GADLIN
1,666,305,807 *AF59ADC2A8980100BE65182187503C0F7992C3A1 [email protected]
1,666,305,808 *AF55A9DB049A850511AEBC58A09E480E7FB64234 ROOSEVELT.MASCIA
1,666,305,809 *AF57572093601F487AD9310EEEE2200BAB682AC5 ROTBERTED
1,666,305,810 *AF5D031E46E06E79E51CF7E8495F21892AAA909C ROYAL.SCHEFFEL
1,666,305,811 *AF5D8085A19D17C38DAECCEF7861FDB979B1F9B9 rperunad
1,666,305,812 *AF5E4E4A905C90ED6D747AC90F21A1537C15B568 r.sist./m.supreme
1,666,305,813 *AF53495D1D2612EC5718D4F30CFC2003F20FF746 1992145 baltilo.j
1,666,305,814 *AF54C83CD68892570DF2F9941991F186BF586AC7 1-angetupft
1,666,305,815 *AF5BD2BF5690C1081B43267FCC3284C070D6D971 SANGRIA
1,666,305,816 *AF5928DAE3ED00940FEAD8A172127539A9D22DC4 1 LUOKKASEN
1,666,305,817 *AF50BF3005ADBE00D5A4F51E2E8FCDF7D832417A 1MYTAMARA4
1,666,305,818 *AF55CCAF67D54C6D057AF410B745F5D0528376CD [email protected]
1,666,305,819 *AF59038167FEBC8E33C540F477276822B3F126BE sgnabehs1
1,666,305,820 *AF52C7386DE7DDB1F3B664649C9DA64B846D107E SHIBAHS5
1,666,305,821 *AF59FA491916A22BEB61B7CE4FA2179D91D78CAB 1WINDKANAL
1,666,305,822 *AF5A7C897D249790A9F1868453929514A351B087 SHON.LEFEVER
1,666,305,823 *AF5CD050150A232EFC75DB196F225CC03CC73CCC 1 YKSIL
1,666,305,824 *AF51CF3BB699CA545C4DCB77BF5AC4442358D1AB 2001-10-05: MAJESTIC THEATRE, DETROIT, MI, USA (DISC 1)
1,666,305,825 *AF543843EE72260C32BDBF197448BC4AE63D8A2E 20-SOTILAISTA
1,666,305,826 *AF5F80D555BC4FCC5E64176402209FDCDD4015F7 SIDNEY.VEVE
1,666,305,827 *AF5A8A123CDC541296A4C069A81383397B01011D 21mellberg
1,666,305,828 *AF5AE5097376E4F5F4956A04708913162FBB3D2F 22economic
1,666,305,829 *AF5A875FDB925C8881326AB6AB597EDD5E0028AE SISOIBORCEN8
1,666,305,830 *AF5039086CDE9C30B62E2807AA47FB2D0A46FCE3 24.caprices.for.solo.violin,.op..1.no..13.in.bflat.major
1,666,305,831 *AF5CDD5BEC1E30CC4E58FB82D8EA069A985490E4 2679255 matala s
1,666,305,832 *AF53DED43DF8C7E66BD5E447678E558CBCFFB53E SOBREPL
1,666,305,833 *AF549A488AB48409B4C5E0F8259C14639B3FDD50 312025 sayin mehmet ozcan ?
1,666,305,834 *AF5993AEE1EA695A6ACEC0E75DE7696226B69297 SPHRDTY
1,666,305,835 *AF589F19DB580535AD0436542349B962A3931EEE 3#D~`(>_0)
1,666,305,836 *AF55769C739546E9E3BC6A2776BFA0EA4D1BE6B3 SRC="HTTP//ECXIMAGESAMAZONCOM/IMAGES/I/21W760TDOML_AA115_JPG
1,666,305,837 *AF5E221C6102867878CA16A74B33449DA8A331BF SREKALSREGIT
1,666,305,838 *AF56FD683536DAFD4CF076BBD0ED8F2D8213EE39 3.sysforten
1,666,305,839 *AF595227A235763314E2192D5F5A367AD41B0B71 STATIONTREBOR1
1,666,305,840 *AF53C5E63786CD640BDA5707297AB190829B8671 STECHOI
1,666,305,841 *AF5B2BDA28351070670112EB9DB850CE342378A0 STEFAN.CHAMLEY
1,666,305,842 *AF54E675AE72E6DAEBF62502342E246B7E7B17C9 417739 PERSONALPREJUDICENEEDSTOBUTTINHERE.
1,666,305,843 *AF515D0D75D64591E0C9E200BBB0433A8AB04C1A string-quintet-in-g-minor,-kv-516:-iv-adagio---allegro
1,666,305,844 *AF59AA3129331E9EF5C606DDA80FF7BB1AB99AC9 SUIZELENS3
1,666,305,845 *AF5417EA2D16DAE6CE47F548758F752426E9A323 4.PELIKENTTIEN
1,666,305,846 *AF5206D167D29F5880B4232476425BB90A398B2C suomeneuroviisut1961-2006(disc2)
1,666,305,847 *AF5B1260B29453A763221E94C75FABE3689B489C sura-ali
1,666,305,848 *AF539F64D3E2978E10A15DD722E36E1BCC4CE181 suralimentation
1,666,305,849 *AF591342375CD1C4CCFD0C23F7AE4137AFB880F0 sussuma3
1,666,305,850 *AF53748100539EBA09728A296746ADF26A5F8F0E 4THEBUFFALO1
1,666,305,851 *AF594FE495E3A5AA57411459ABF850F7787BE0AC [email protected]
1,666,305,852 *AF5222C016F84784590C200258D1882E07DBF5D2 SWIADKA0
1,666,305,853 *AF581E5CB7011846EDB68DEA2017CD5FB7406777 TAMMYWIER
1,666,305,854 *AF5247CE04EAE3D7AF0C2893E6F1AF94BB52CBA7 TAMVLXMN5
1,666,305,855 *AF5404119CB68DCE481C51658E6CFDA1B2C3844E TANNERHIGA
1,666,305,856 *AF5C4A53EAFCB930F7C6768271A2962E877BE6B5 tannernazaroff
1,666,305,857 *AF5B445F4D2483462560C57CE5E0D49ABD93780B TARASTIU
1,666,305,858 *AF54B9439DF13290DBBFDF78B67F9CB44EC0AF36 TED.AYLING
1,666,305,859 *AF56472D3B239FDE4EF7D0656289B190A10F0EEF 5INDIANCAPTAIN
1,666,305,860 *AF52085B586E5744014184211E907AE95D0BD1D6 terra.nullius
1,666,305,861 *AF5BE35145EC520C22BAA2E889756485AC8AD690 TERRELL.ALLON
1,666,305,862 *AF509E9A75269B79AE77E3467F38798761B7D2AB TGAAJELLOBS
1,666,305,863 *AF5D977283DFF7C3E69DE1EF2D7256FC02AB26D1 THABITIS
1,666,305,864 *AF57C99C39C8511855E753E81E9961B94168FDB0 thepowerofyoursmile
1,666,305,865 *AF5403AE22FFA59779651B2924DE20F1432D739F THTIKIRKKAAS5
1,666,305,866 *AF5D00C4923490F170BF42C6986A8E9C3E5DEED1 6HETROGENEOUS
1,666,305,867 *AF57AD6381B3A53293F79049BA8B51CD13EFB779 TILL4DT
1,666,305,868 *AF59A08445E7D3222D94C0A77DC599372F86FD6D 6STEELEJOSIE
1,666,305,869 *AF5C0AAAC8D1019DFE27BCDF3434234CE3CA9C1C TOMMY.SZWAJA
1,666,305,870 *AF598B8174517B0175BE62008F2ED08F3206F35B 7BRAVURARIENS
1,666,305,871 *AF593A898DA6B2089314D468EFF83FDE7E92C1EA [email protected]
1,666,305,872 *AF5662F91B903675BB51FABF5120621A236F2CA0 TRENT.MIERZWA
1,666,305,873 *AF57F5EED2EEAAE02C7F0440958B1D18FCC81671 TREVOR-BRAHMIN
1,666,305,874 *AF519015EFFB5067F9C6B2570D99CEA1BBA5AF95 )8(O~0~-<----3
1,666,305,875 *AF5E82C82981D94A7D2ABD8540195CB0ADEFC24C tronsmo4
1,666,305,876 *AF5A9652E028D94F68CE8C12230779D0F07AAA37 8RESIDEND
1,666,305,877 *AF5A576CCAEAAD1D5FDF934E07102EBA5D5413AF >tt/<;}}i${;tg&retniop${$=x$>tt<
1,666,305,878 *AF586FD1C0E5838E5970E935EB267C979158CA31 TTRESULTSTT0
1,666,305,879 *AF590525D54C41FB8F8C0031E68AB77FC07EA7E4 8youngstars
1,666,305,880 *AF5D5F7B11EDC8ADAA39CFFD2D8F62FA4276DAFF TYREE.HAUSWALD
1,666,305,881 *AF57B7BDC7D43AD126A405136148A0BF7CFA15F4 9iamhallo1
1,666,305,882 *AF58629CFE547342976B5435FF5983022AF9E87D TYSON.MULGREW
1,666,305,883 *AF59DAACBE7DB4D33DF44B586CAB9885A9B5736D [email protected]
1,666,305,884 *AF57703044A112901B7BB55A81025028B31BBDA6 9KARYDOPITA
1,666,305,885 *AF52CA0F07A7BF5E216A0FB1B6159443B77927B7 uggiolavi!
1,666,305,886 *AF5C8E50CBF4DD17628DA41751F6D1FE1CA46F03 UNDERCOMMANDER9
1,666,305,887 *AF50741B7C7CA91F90C5EA74E5BB084B4E37F097 UNGENGSAMS
1,666,305,888 *AF5057C473424BED84E967CAF50E4B92893ACF60 ứngtrực
1,666,305,889 *AF5E8DC5F1C64ED7966C4D76F0BFD31E1D3CC489 [email protected]
1,666,305,890 *AF5BBE24E7C53427ED13DDEFFDFA993040AAB9A5 upahataa9
1,666,305,891 *AF5EB5008818E2CC41E0D8D7C5607A3F074E3E3F ABGEKURZTEN9
1,666,305,892 *AF558471BCD0EFB3A77E9EC020F5F4876D14A976 valentinodon
1,666,305,893 *AF51910BC048B527D03B6DFC37FEFCE39F208E0A VANGELINE-BONDAD-CRUZ
1,666,305,894 *AF577F87F04FFC7AB0AE0BD34742F8B6F8A25350 AD&.}
1,666,305,895 *AF5D3AE3FE16DDE632210B51CBDFDD75AF164F27 veronika.kumari.jecob.martin
1,666,305,896 *AF547D397D2FE1E1980E48DDC9964831AC21659E Afh(
1,666,305,897 *AF54C06087C7303F3C00A83165CF94A62C202372 A_hd
1,666,305,898 *AF5E8DC51D786C903A37486310855E39D68336B0 vïm
1,666,305,899 *AF5CF475291DED69ECB1A10DC151825135E1CEAC VITOHOJCZYK
1,666,305,900 *AF5A69D06F7A6042968DDEAFA9CCFF682078D5C6 AK;JH
1,666,305,901 *AF546F8B78658B295470298BA92CAFC1B873075D alanadkison
1,666,305,902 *AF53190A2946B8BCB3C67D524DAC3CDD111494F6 WADEOSHIMA
1,666,305,903 *AF57665BE91D1E5CF83280148A434AC30F8C14DE wajadahmedsolangi
1,666,305,904 *AF51CE587E113EFEE0276ACE77EF9C7DA6C1EE01 alonzo-storm
1,666,305,905 *AF5652EB54455803AF9F61116CE3232887995730 ALU
1,666,305,906 *AF5B9EA4A065CCFA682787129C8F358951261C7F ALVAROMARUSIAK
1,666,305,907 *AF52B657052AB2C39523657E52AB1B102D9A1D84 ALVAROZINCKE
1,666,305,908 *AF5610372D02AD8D865F7FBF1407CB663400F564 AMBROSELLARENA
1,666,305,909 *AF5E520F12D10C709D58FDCCB18238B5EDC5AB2B WANTBSI
1,666,305,910 *AF5BFD307CFBD1D585EA3BE746F34AC98A7134B5 WAN.ZAIDI.WAN.OMAR
1,666,305,911 *AF543944FD1A5BE0C3CD7274A396979C41E7C0CF AMIYAPURAM
1,666,305,912 *AF58E85C7B481251DE5B111EF2CBB481D0387855 warnerstlawrence
1,666,305,913 *AF57776F58C4A61D2F61C729EC8824A8706C887C WASHERWAM892
1,666,305,914 *AF55B007F1F1385EA808E6879165203D2EF42181 WBCAMROC
1,666,305,915 *AF50355DDE7218B80933369219D340D8D7431CC4 ANDREW.DACK
1,666,305,916 *AF50605F84621CFAAB083A4B9E32F26820954B2A ANDREW.KAUSHAL
1,666,305,917 *AF5C5DA2B17E2D8DBAA39D1BC617C9031CF62C85 ANDREW-VENTURA
1,666,305,918 *AF5E7660FC3B317F871215293CBD4C3648EC9BE7 andy.quesada
1,666,305,919 *AF5D6650EA21D5C36385B65195AA86DE48071D20 wilbertaruiso
1,666,305,920 *AF52C49F4826F60D778A08ECCAE36AD2B1CFFCCA anthonyceruantes
1,666,305,921 *AF55539FB313F97FA1ADF2C2C4D866F41AD2F526 ANTI-JACQUES
1,666,305,922 *AF5ED0B4207491E04535C5F343CC1E65D69223F3 ANTONEATWATER
1,666,305,923 *AF5B9A7AA1F159446CB513C89615BC2217F87904 willhanemann
1,666,305,924 *AF580B39453EB894AB221EE2DB166FF92D11AF89 WILLIAM.MEGARRY.GAMBONE
1,666,305,925 *AF51869626FBB7EEEF08483A9267DDA5CEAD2532 AOPUJ
1,666,305,926 *AF5FA13A5C357EC23AE1147CF82B3FEB54442D5D APEP"
1,666,305,927 *AF530F95FE3B311349A86B5F84DCE61A209CEDE8 WINIFREDAMOAH
1,666,305,928 *AF58AF9E15A7D2DBDC76BB612F26F021BDE23E47 WJDTJR1
1,666,305,929 *AF509940673C1D7EA53A45BFD63A7C0D6AE98694 wnr~
1,666,305,930 *AF5C2AF06EC0A15BE52177A21E3577ACCAB33A11 WRITESALINETOTHESTANDARDOUTPUTFILE.THEASSIGNMENT
1,666,305,931 *AF5D18D5EF791CE4B302113AE89DB85F6966D174 WUNDERDO0
1,666,305,932 *AF5DB312A88DE033B57C66176ECE24DD9F2F4A0B WWWCOMUNEVILLA-MIN
1,666,305,933 *AF54F4E0E6FA19DB96C80E417023C2E3A2683358 [email protected]
1,666,305,934 *AF5DB18C7FF0CF8115F5F68FCA5060D91E36C8A6 ARNULFO.THIBODAUX
1,666,305,935 *AF539A38E2613F63B0F4E9B731CFE23FBD8084B2 arturoandersen
1,666,305,936 *AF51F72C76A019614269FB1F89071441EDB7FF21 ARVIND KASTURI
1,666,305,937 *AF5A590DD86788DA45F35420A3747F32A8AF915E ashh7
1,666,305,938 *AF5182B5F2F0D8E7FB23BCF3F58288CDC96C38A4 ASHLEYREDDIC
1,666,305,939 *AF55FCB7817EB4598FEF2CC81BD40BAA359D4205 ast"i
1,666,305,940 *AF51C453A747470A14AF032A31FE68DEE273B7AE ASWPL
1,666,305,941 *AF542F4889C7335B59A20D262DDC7E3DD3681122 XMKJ
1,666,305,942 *AF544C2E9457CA86381544EC9D75FDB4485DC2AC AUTI;
1,666,305,943 *AF55F7AE62E5BE69973FDFF3E6BC8FCE34F845BE AVERYRISEN
1,666,305,944 *AF58717B0A5BECA0433F02908774858788D9106E AV)M(
1,666,305,945 *AF55F344BA77E68CF202D278BEEE3D7F166D08FA Aw4#
1,666,305,946 *AF5102909B574D92257ED6754A0C74F89B038C41 YASMEENHEGAZI
1,666,305,947 *AF5BCD907F09DD5B471684E2F46A975FC1AB377B yepiphotoforyourdocuments
1,666,305,948 *AF518ED584776F65BE0D41D23C0879F1558E2ADC [email protected]
1,666,305,949 *AF51A1CBA32F1B987681230224AE3EB4310D4EEA [email protected]
1,666,305,950 *AF51E088D20243D959449FC9367364DE7F99B03D YLGNDRBPN
1,666,305,951 *AF5CC7E69B3DFE36E3CC686F48EA99208A72AADC b10010chn1932
1,666,305,952 *AF51808B7567706868BDC9797690C7E4BF15E610 b:1.5
1,666,305,953 *AF576E99DD264AEE4BA46115331B6B4EA16E372B B-->`-3B<-
1,666,305,954 *AF5DF8B0D941E47E8EDAA42DE2B210AB216BE777 b4nd4gern
1,666,305,955 *AF52D2D34D8B3286CA82C5F890FAF6508F1D5DA7 YNATILEHT
1,666,305,956 *AF5D80FAF02737CF65A993507A90F97667981BE2 bamp6
1,666,305,957 *AF5B32AC7AF304831D2F2C0B7702529AD97BFDDE YOMNA.HASSAN.ALI
1,666,305,958 *AF5F8C95AE1F13580EF685126973281CD829674A YONG.THIBODAUX
1,666,305,959 *AF5C19A133B4DD7D31A226152C20E0961152892B BARBIE-BLAKE
1,666,305,960 *AF52EF42582A6B2E0D7B3B4D7AE15CF9B5D33C4B BARGOD3
1,666,305,961 *AF5F2C5D1D619427E92209C9439FC83F7C26A95B b=arp
1,666,305,962 *AF58E97E366F5E2EE6F5CE1566AC230B33A49EC4 B;CK/
1,666,305,963 *AF538EBA902F2C1BF1C5D0FB9EC37D759896DFC6 BCOENETED
1,666,305,964 *AF5D0C2528AB4904485FDA66E9FD479D89EA4280 b==d.~.~(00)
1,666,305,965 *AF50803E5AB4AA218FD37573B602EBA96E0F00C0 yusnielalbertoparra
1,666,305,966 *AF56D4AD81AAD97EFF7EF48663118409CAA577E5 BDMQ1
1,666,305,967 *AF51CEC656958F0FC9D694B413B36AF1477495AC beaubamforth
1,666,305,968 *AF52217BB67C8C120739AFE8EE572A1F3AE6ADA2 BEHINDTHE.NIHONREVIEW.COM
1,666,305,969 *AF5CED9F5E2CD60842DCF3102E856824A1CEA969 BENHAMIN1993
1,666,305,970 *AF59FD98D0B6D4E3040DAE716AFD5BD882A8914A BEN.RIDENHOUR
1,666,305,971 *AF5EA5BC4471B2848E23AB22AF4771AD890379C9 BENSONTOM8
1,666,305,972 *AF581F2B69A290DA222EB70871E4DA2A67E228F3 [email protected]
1,666,305,973 *AF52795D82656F57B85089D6624602967000B295 [email protected]
1,666,305,974 *AF5420176FBD2F2DEDC17F188E78C09C3DBC2152 BERTO160UNUSED
1,666,305,975 *AF5A31BEA8760B320F574D966830EE8FBFB6B7C4 BERTPALISOC
1,666,305,976 *AF521149F08C6696CFE62DCB1E11143CF725BD49 BESIDEYOU
1,666,305,977 *AF55C392CC558FCE39DF0CC37BCDB34A1E374C2E [email protected]
1,666,305,978 *AF5CEF3FD1005BA09EAA17631476CEFBA57A8F7F [email protected]
1,666,305,979 *AF51DE8964613D83909EE66F0D753BBF7FAEEDCE ZHHX
1,666,305,980 *AF5F6293DD4CDD314C8E0EE8216B210653848D0C BF?N8
1,666,305,981 *AF50AE62BD7F849B8CD0A0876EBA1BA82148C332 bh0)i
1,666,305,982 *AF5B8BA1DCCE0A20746F03B5A0D6CB147D3A4630 BIGREDDON0
1,666,305,983 *AF52A5FABABD5A1CEFC9A35DABBD6841B9A8DAF0 BILLY.BOUDREAUX
1,666,305,984 *AF5C82335EBCB0E94E4927D5CDEDAE667CCE0973 βωγιαζήτ
1,666,305,985 *AF59A70D72DED4EAB9911E5BAD8CBFBA0FB959A1 ΔΥΜΕΘΥΛΥΔΡΑΖΊΝΗ
1,666,305,986 *AF5F67FEC7832A1DF71B8101638BBA5DF2DD20DE blicadezamboanga
1,666,305,987 *AF5516A33FAA938E3407A29E23ED4A5361FA0272 blood_disease.bl/@/d_d/i/'z/i/z
1,666,305,988 *AF5FD3E0F2E0F448E636B7B8C70357022CF9E320 КИКИНДИ
1,666,305,989 *AF50219078B0CE50587126BB89D3C22433A64E1A bm5
1,666,305,990 *AF5453FDDC6FF96EA46DD549D7732ABE68F5C7D3 САНКЦИОНИСАНА
1,666,305,991 *AF59B935EAB6A4F011E060A7E4BD5517580A67B4 bokkenheusers
1,666,305,992 *AF5F39800ADB0D5602D79A72841CD52DFDB73DB4 BOUWKAMP12
1,666,305,993 *AF5748230865A2EBE3BF700B7A996F2817BBFF70 bp,
1,666,305,994 *AF5BA93A60393395D4826D7B8B656606EE12C889 brendantimbrell
1,666,305,995 *AF5530BBD7312C2130512D663C1B192D33069A84 BRIEFLETTERMAN
1,666,305,996 *AF52EF660D84867A49FD29EF147DA7CF915FB58F bs60i
1,666,305,997 *AF53E8CE5E65D01A7E96F2AA7DF53DAAF51E67C6 bu5eb
1,666,305,998 *AF5878663A6EC87A698B23EDB7BEF8BD69EC8910 busteroechsle
1,666,305,999 *AF5E37FA33CB3A22F07F0AA5E6877641160A3CD4 bvl=
1,666,306,000 *AF5AAB411099269ED98E5A4FDD8679F960008217 bw8ez
1,666,306,001 *AF57BC7CA4541C9DE196DB70B9A32CD3BC2A926F BYRON.KLEVER
1,666,306,002 *AF59DA46FB03C69F2B2B15166C08B62B530D3B92 bzpzt
1,666,306,003 *AF5FC75512472ECAFA385FBB92184678C6D1C888 c=2hk
1,666,306,004 *AF500773086FC3824002E61CF20C2751F8848F69 caqueeuqac
1,666,306,005 *AF545A18ADA46AB7C7DC70AE3A797F4FC08CA581 CARROL.TRAHER
1,666,306,006 *AF59A4C0DECBAAD1CDBA501EB0856DA9D6A19FA8 carygable
1,666,306,007 *AF58E0A61A2E7FCC7B632B663FA36A79A83AED42 c_%as
1,666,306,008 *AF54670A30BD67BE94959A7E61EB50C1FD654598 c,cnj
1,666,306,009 *AF5A15C332724BADDB4C0F0FFAF94D4B2407A7A1 cd/pa
1,666,306,010 *AF5C03548E5B14005A303E6E4964BD6378F1FD1B 121JUDITH
1,666,306,011 *AF540B11D5E04C206563A7811CC2CC818E40F288 13-guido
1,666,306,012 *AF5F666E11D4CF6C84662C8FA035879C9E5AE4AA cg"qf
1,666,306,013 *AF518372FDEB5AC28C63CFD1698E51F3FF80115C CHALKSCREE
1,666,306,014 *AF576FF4A1EFC25F5B5AB4CB634176EDA7AEA929 [email protected]
1,666,306,015 *AF505F2715B7B065E1F6F6C5BCE39B498A7825BE CHARLESZELENY
1,666,306,016 *AF5886F2F20CC9E95A5ACB33C81E206E4909AB44 17DECEMBER98
1,666,306,017 *AF59A0BDB7460A42324E46CF3F397C16E025BCEC CHIPVOLVING
1,666,306,018 *AF5493B98980DF8C21D52EE2925A1866166D7EFB 19850910: LONDON, UK (DISC 2)
1,666,306,019 *AF5678F94D2BA8DBFE1792B9F44AF4D62332D7A3 1akustiikkaalan
1,666,306,020 *AF5D91315AADA49FC919BC011F97F30917787240 1.ASIAKASTOIMINTOIHIN
1,666,306,021 *AF5C4925845619D7421962CBCDABD7B879102A28 cic0t
1,666,306,022 *AF57D21C3E3CA5623547A23AB36B4BAAD8FB359D 1esitellyt
1,666,306,023 *AF51AB978C1A67422A51184E7B712B78C49EDB8B [email protected]
1,666,306,024 *AF5CEF00CDB800A96FAFC3516457F689DC45CAC6 clementekunter
1,666,306,025 *AF5F0BF32A0C772875371F1CE1F5CD4E8B26F57A 1 FINLANDIA-LAUTAKUNNAN
1,666,306,026 *AF5094F7ECD94DE040C8FD09C5366336C5A54C3E 1.gornergratbahn
1,666,306,027 *AF53E61D14120B16EFF803D6DE030A7608D8C383 1HELIUMATOMKERNE
1,666,306,028 *AF5CA8515CC0ADDE80278EA3344AE0A9EECC538C 1.HZIRLAMAK
1,666,306,029 *AF50C1704500AC98E7CFC148B850B5AC42F30760 1IEFOAIX
1,666,306,030 *AF57180C3F3C065D7237236A322DC2475C818246 1ILOVEPAT0
1,666,306,031 *AF5E36D86EFD2EF889C21F3DF799B759533A33DA CMCGIBONEY
1,666,306,032 *AF508EC77860FB335FF114D7907825FD60DB5170 1-kustnnuss
1,666,306,033 *AF59CD73E43420ACAAED87399F19B6E1B830629C 1kuusipyttyisest
1,666,306,034 *AF53A87F7367F768A180D7545168A4A248798D59 1maal
1,666,306,035 *AF5565CFC2B9308ADC0819376BA5A9557B2B85CF 1MYVALENTINE
1,666,306,036 *AF58B33ED93A02E1ABD5D383142A35208F1AACD0 1.RAHALAITOSLAINAAN
1,666,306,037 *AF591B650360770A5EFFE910C252320755F4C0C7 1-sisu-konsernihallinnossa
1,666,306,038 *AF51E7F5EB2BC00A7908B9CB7CF87C58A2ABA6F8 1SKANDI-JUNAVIER
1,666,306,039 *AF53F05666F3064ED114349343291C5B03B72DD4 COLBYLOCUS
1,666,306,040 *AF563BD5D1E32B3A2B37454722E60F98DAEE2F9A 1 TORHAUS-ROHBAUES
1,666,306,041 *AF5AC907C43F275EA9ED6AA7A06A99E55247075C COLEMANBARKO
1,666,306,042 *AF55ACE6BDF38A315D90FEE8D90E36778601ED07 COLLINMATT
1,666,306,043 *AF5B897FF2C4AA698DD747FFD1EFE25A6D405177 1.vaikutuskeinoltaan
1,666,306,044 *AF5D0146113D0EE42C6ECD65D03384A05B6C7BD4 1WEISSSTORCHSCHUTZ
1,666,306,045 *AF5BDD5AA60A4B9417C1890324847806E0EC9067 1 yalikosku
1,666,306,046 *AF5943C9C7F65C63B649A900FF6BBF22A7DC1308 2006年12月18日 BAKKAI撮影
1,666,306,047 *AF5482F7DB0EAF456B199DC87996C5816E037341 CONRADPONDEXTER
1,666,306,048 *AF5A43B1B24C1BAA8B622D233CD42792689265C1 COPIES-OF-THE-PIECE.
1,666,306,049 *AF5CDE73F22B4F332B38FEE9ABA9981AF065A39C 2ATRIDEAN
1,666,306,050 *AF585230D9DA284E201253613D954449270F0281 2d7da89e506cd1
1,666,306,051 *AF5F949777B65888A2DB3972AA44815EE36F09E0 2sprecherteams
1,666,306,052 *AF5E3CB226803CFFA0F5F9442C8DABB50E2118E2 2TACQUET
1,666,306,053 *AF57D603AA1AEE5C491EE99187CACEA2352C16D4 2VRSPDNG
1,666,306,054 *AF533D8E13AB19E33FD8171FC4491F568E8E11DE C:\PROGRAM FILES\MICROSOFTNET\SDK\COMPACTFRAMEWORK\V35\WINDOWSCE\DESIGNERMETADATA\ZH-CHS\SYSTEMMESSAGINGSMARTPHONEASMMETARESOURCESDLL
1,666,306,055 *AF5957ACE4CFA79AD5F849C40864A084A1154D21 34432 SOPIMUSTA-ON-MAHDOLLISUUS-JATKAA-VIIDEN-VUODEN-J
1,666,306,056 *AF5A333C0FE84C837F6FD1D00B27DFBC6D6416AB [email protected]
1,666,306,057 *AF5D6B4BF4E880E1BE4607335218ED1853D2423E 3-allister
1,666,306,058 *AF5F6E973577C3AA18A3393BC518630CA8C6AFC7 cq=l
1,666,306,059 *AF5F44D765F08BEFEC9F4726EDAD370911BE82AC 3F1207478196
1,666,306,060 *AF53ED190E76AACB29F24E921228E957FCB5EF4B crl2f
1,666,306,061 *AF56A0F99E4A8CF8F28EAB9749A53381C75CCCFD cs09
1,666,306,062 *AF593F9093D73F550241DE5E93F42EF5C0136246 c"?!v
1,666,306,063 *AF5442C552BC18EA19F57EEDAA3A7CC436B14200 [email protected]
1,666,306,064 *AF5E1C0027AC89185297F178E0BD4E164C940014 4FLORIDA8
1,666,306,065 *AF5B9E86012804272777DEE7D15DC043B6430825 4LIGNATILE
1,666,306,066 *AF5E834F1F118289692504DACEA7CDE5F327C800 cy4nd
1,666,306,067 *AF571D839DF0EB8795BCBBC33C07D7AA88A5A6A9 CТРAНЧEВИ
1,666,306,068 *AF5CAD5DE6C90B4D3651D72032D983DC83115AAA D0$GG
1,666,306,069 *AF52B805B5824EA6A49990FE936DE0EB1ED8317D D3AZO
1,666,306,070 *AF5574EB86D56B1704ED142CCD5477C51F2E9E1A d4u/d
1,666,306,071 *AF54294EBD83E1C6E4D5520B28D922A6E9B6BDB2 5b8cv0a3l
1,666,306,072 *AF54EA389B500160A5B0161F852C0076F5EA93DB 5BIKT
1,666,306,073 *AF52639BC8006BB39B4124C47BD0961842CF4BAB D#8VR
1,666,306,074 *AF561E559E7A1097A1CD531D6C60BAF8E4185498 d)9(y
1,666,306,075 *AF5E54166340AAC7290E4F1D9A2E99911EEF3748 5CENDIARE
1,666,306,076 *AF53D18AC9C07804BE6A40EB149A495B311A1094 5cuff135
1,666,306,077 *AF5EFA4750077556487F4631B96D262A1EECC8CF 5GOPHERMONICA
1,666,306,078 *AF51341388F0810ACB9D307D22905A51249F949C DAMONMEGEE
1,666,306,079 *AF5FA4F22A9892DAEF8EFBB7B828D766B0F63F57 DANID72
1,666,306,080 *AF5340C9AF7A82C8A5A300969993955DF93E326E DANIELMENG
1,666,306,081 *AF561FF5529EB1370E46A96F5A54EC6B9D90756E 5MUEBLARIVE
1,666,306,082 *AF5F03AB4A58A27E1F060028F8B8585A7275C47A 5MUIRUCBSW
1,666,306,083 *AF5BF6C42DA13D52AB4931AB22A82FB952E70FBA DANNYSWELGART
1,666,306,084 *AF53F8AE50929F92DD103E68FED06B764E2B9329 5nokkamiehen
1,666,306,085 *AF5D698E688549C9B936547AB30215B81D1F1ABF DARSHAN VISWANATH
1,666,306,086 *AF5A090C962D89D77196D211345DF123A47F7CE8 darylcolpaert
1,666,306,087 *AF578BF9172EAF637A6B2F931DDE70BF477214C5 DARYLPITTSENBARGER
1,666,306,088 *AF5AAC3EA6B44D7F8D92124CF9ED8445491E682D DAVEFIREMAN
1,666,306,089 *AF5EAB458AF48B5D0F3E572B528A4E88FA8E4DCE DEATHRRR6
1,666,306,090 *AF5C3DA742F7D5F5E618F13D52F7D51988DF5DA4 DEC2583
1,666,306,091 *AF575ABE473B23943A4A92A53F68F82940CAE316 delbmerts
1,666,306,092 *AF51F2C059A2ED88B18856585A4199110992F4E8 6NEHORLAVEJSIM
1,666,306,093 *AF5C17F4B42159E2E9A8B8EDDBFAB92EEEE45B1B 6.PARISTOISTA
1,666,306,094 *AF577B3658BCF231E38FC1CA75611A698F74032B DerDoost
1,666,306,095 *AF5A1F7F5E3C1005E4F8767E423EC10C11AFBD57 DES6-
1,666,306,096 *AF5D9360E3C650413D88FCFE3C9E864473D0C2D9 6SBB-SCHNELLZUG
1,666,306,097 *AF5BD7142B45B81CA5501EB0A56B271B60981C82 DESMONDRICHARDP
1,666,306,098 *AF5E77C2A66F9C49A136AE002E1D2B397A90E4FA de#$w
1,666,306,099 *AF530A014607AC81ED1D9B4E94471ABC58E7BC2B dgja
1,666,306,100 *AF59BFBC5E96B9F572568FEAC0E6AFC3468C3026 DIACONUCRISTIAN
1,666,306,101 *AF534374B639EE7706A2C62FFA83D465A1E6F284 7ALLOFREDDY
1,666,306,102 *AF5B9B2C66A9EBEEF5FD5EEAB357DD93A125FFEC 7BSWPYGMALIAN
1,666,306,103 *AF530198002B452D5F385EF2165F0F57795D9020 7CANCEDBRIDGES
1,666,306,104 *AF572DD8C8C0E367569C5BBBCB68D85C04547830 7D71C184A4824DCEB81AEE3355770BB5
1,666,306,105 *AF52F9BC2F13AC131AB0531AC8B936D06CD1310C 7ELINIAEN
1,666,306,106 *AF59D41726181365FE1A0082ED85E6C9928B3EE8 [email protected]
1,666,306,107 *AF583855787EBC76F280E7852986A84AC4D3FDC5 7INGIUNTIVO
1,666,306,108 *AF5F3EF142E71EA5141A91F72D2637813978124D dihvv
1,666,306,109 *AF51A3D347F1E9FB316F92B5E1C853C4722050FF DINKOFTWP5
1,666,306,110 *AF510C8F0FDF4F91CC019D19B3CC4951E9EFEE43 DIRETTIRCE
1,666,306,111 *AF5ED787158A1B858624A9D54C47EB749F1FE3EC 7PENDAGLIO
1,666,306,112 *AF58A48EAD371680EE3D49647FFD844C9255FB88 DIRKNEUNDORFER
1,666,306,113 *AF5CF2303793BB150223F56B477A06B14595A2F6 DISEASEHTTPWWWTDPR
1,666,306,114 *AF5E9FB49DC6FDC3AA5B6C75C5377092F2557461 7SJIRAFFE
1,666,306,115 *AF5A5BA168A23AEDE1AE8B5F33CC177DDA0DA165 [email protected]
1,666,306,116 *AF56E388650BB80AC61DD301E063106D12AEC546 7TREKSOPHIE
1,666,306,117 *AF53EEBBBE4180FCF95BC1FFA3A9D23C6A7C5365 8====> ~0 ~o(00)
1,666,306,118 *AF51EC6194F9D7C77C813FD1040693598365DE17 81meredith
1,666,306,119 *AF5A5B2A12D53FAF95C6A1CD75A7E12DE042D9F7 DL1Z;
1,666,306,120 *AF59AE59CE9EA1232211E749F12EB7D214F8CB8F dmei)
1,666,306,121 *AF51FC76972D40ACCDF2D5A14FB50D7DEBAEFBC3 d)n20
1,666,306,122 *AF52D3B962C7B6FE79AA398CEA6EAE60DBB45DD4 DNAMGOUNG
1,666,306,123 *AF55055E898C4CAE2B1F351018093DC3912BAE99 8LIBOVOLNEHO
1,666,306,124 *AF58B6642B7229AA0FEFEC1BAA9642D5C4F56266 8#P-*-*-*-~0~o}X{
1,666,306,125 *AF5155633E4405B6A5D1155DC75C0AB73FDE4A98 d.-o?
1,666,306,126 *AF537975B88178B86320675B90D550DE9D9A6447 DONGA[email protected]
1,666,306,127 *AF5C50E6CEBC36EBBC8C6EFBAEA4E0E73A721F58 8sulphisoxazole
1,666,306,128 *AF5D1BF9807C52CF559796123D205D9E09118BDD DORSEYRYCE
1,666,306,129 *AF5C71A1892CEF2A16D7C3932173AF018463E63F 959087 C.:.POP3.SERVER.AYARLI.DEGIL..
1,666,306,130 *AF55665E9EC226246F14C0B9AF2F4106D96A9C66 DOUBLEBALLON
1,666,306,131 *AF53B5A22AFC7FB723AB2A0D32E36C855A746F3D downer.pill
1,666,306,132 *AF534F7F11ACDD5649362ED439254E6716FA2F14 9CORTEJO
1,666,306,133 *AF51CFD1D08E05851FFBA8F052923D99B27D9B1B d$puw
1,666,306,134 *AF52F168007E3751152D654338CCD1FE0CA9F82E 9FRODLEDD
1,666,306,135 *AF57C2095C8053E7394DD72C8F8C2399EFAD4FF1 D$+R4C+N9
1,666,306,136 *AF56A83ED05E8418BA2CBE0D4E0623A0962D683B [email protected]!7S
1,666,306,137 *AF54B5AC9944B699D4D0001F030892BB6C673B5C 9REKATEDERTIME
1,666,306,138 *AF58D8367B3927B77ED44B4015A12D47BB60F74A 9SCHNEIDENSES
1,666,306,139 *AF5C2B96038E94F757283E907960DC6C46BE1476 ds=ow
1,666,306,140 *AF5D81250573D212501068AC540D28394E0BFFDA A3KN
1,666,306,141 *AF5CB5D98952C2FE5ED12138E636EC673FF3409E a7ie3
1,666,306,142 *AF5A3074E58C333A3FFC161C910420753FF0646C AAAJ*B
1,666,306,143 *AF5A139438624F4EF53D0AFF8C183FC1C383788B aadmu[
1,666,306,144 *AF52310CB0C3358692FDE8726001AFB22A45EA20 edleleg7
1,666,306,145 *AF528286C68FEAF584BDE0E4B09629CE1745B021 edmondskay
1,666,306,146 *AF574D6BF2F48D40B64E39F1B99DD33633DA047A edmundocordovi
1,666,306,147 *AF5D86A417844D70DDC74F6CFE447E6F55F9927E AAYME
1,666,306,148 *AF5C51A88377D5DD63FAF2799F460A8509E373ED EFRH!
1,666,306,149 *AF5191DECF76A780E2980A51FEF9168BACC4FB78 EGM0
1,666,306,150 *AF592426F58D52D14C5EA174D7F480AC148FD359 abisl
1,666,306,151 *AF5407DBF276A421D0E00218893507BAF89FA6B8 academievergaderingens6
1,666,306,152 *AF506403D8D0219BBDF82FD5B8E0A7FA3EBD56F9 acceptabyllering
1,666,306,153 *AF5A6053DF0B2CA07811E687BFED3CCB76E1D7AD acds3
1,666,306,154 *AF59B698DFCF6DC98E43DFC23793DEA9433CF8B7 electricdancing
1,666,306,155 *AF513D4C5B9B0E6EE775C9B0FABC88271E08134D ACVR~
1,666,306,156 *AF5EF868EC503C2778079AC591E0AF5D41CC1BC9 ADIMOORTHY
1,666,306,157 *AF55F70FEDAAEE273D9CEEB08CD6E18571D6CD37 A?GA6
1,666,306,158 *AF5F575F90362878A3440DE981F128773AAF92AA aidenor
1,666,306,159 *AF574C51ADE1110F66455F659DA367D0063ECEFF ENVIVOY...ATODOCOLOR...
1,666,306,160 *AF59CEB786DAD1271234C867C3521599015E06B1 EOU^
1,666,306,161 *AF562582AD87299ABAE580073ACDE2E592E3BC0E AJ,R3
1,666,306,162 *AF5BB7EC839E5D3476877F1F399F342D9745A963 ERIGIDAS
1,666,306,163 *AF56E14EAA392E921196CB9B90B9DD3C55389F6A erniebonadonna
1,666,306,164 *AF5A06EB6423817AAA3CB69A3ACDBF9FCBEAAE61 alex.port
1,666,306,165 *AF5C2E2B1D5CD874C2A199F3D620406843D563EB ESETTLED1
1,666,306,166 *AF5AF8C9E44A457739C8193F9C7C7297052CC95E ESTEBANLIKENS
1,666,306,167 *AF5ECD181F96DC2DF520C1CB19812C5060A39E0C euch4r1s+s
1,666,306,168 *AF597229E4AB283CBF85E5D499DA7769D67D04A9 A-LOVE-UNTIL-THE-END-OF-TIME-(FEAT.-MAUREEN-MCGOVERN)
1,666,306,169 *AF53E2195C81ED36B79DD81651A247103931FC03 ANDRERASSMUSSEN
1,666,306,170 *AF5EACA5702BBD8C0304EA93C768680E51C6C293 examplestefanomenca
1,666,306,171 *AF5693756F18450B56DA00B23506BB6282A99D00 EXCEPTSNOOPY
1,666,306,172 *AF52D4D12BF7642F68ABB2BBCC95D92D5AACD099 ANNABELL'S.REEL./.THEME.TIME
1,666,306,173 *AF5DD28959765D2501C241432CF1206C43127701 FALANDRAIXOS
1,666,306,174 *AF56EF3074782A080972854DBF80FE7BAB83BC77 ANTIDRE
1,666,306,175 *AF52263424A2AE39B307CB6B44E9EEBAFCABC55C aopvk
1,666,306,176 *AF56B53A8B61834C0EEB2E32675166A5F031D4F6 AOZJS
1,666,306,177 *AF57EF7247C5AA9448ACE2739C777119A5AB5AA2 FAUSERLADSGROUP
1,666,306,178 *AF5DF3BDF5269810E369807702E4CEDE6D8629FD FAYEMARIE
1,666,306,179 *AF59736E9DE20B7073AB6F624CA98AF9463FA051 apryan
1,666,306,180 *AF581579769CCAF6AE87964E007313B21B3636EE AQUILANDIACOM
1,666,306,181 *AF58B7CC3CC119BCA8FA72E18AD45722678F0187 ARHB
1,666,306,182 *AF59F8DA2488D26C46735FC881C2F929015F3B15 ARMAND.HJERMSTAD
1,666,306,183 *AF5A37D51A06765D7EFCA9F3EC21EBF435E10864 ARMANDOCROSWELL
1,666,306,184 *AF51DAF9D93EC2944A855808FEE01B5E5F66B5E0 ARRÁBIDA»
1,666,306,185 *AF520BC7D453D43402948AFDF47725407D62422E FIRESTORM :60 (A)
1,666,306,186 *AF53E34C0AC06679A3D91A94BC98983FF8425078 [email protected]
1,666,306,187 *AF5370A26FFD35B08D10B5B7E33FB0698863B15B A=TE4
1,666,306,188 *AF5AB754F30F31600781F7A3F53C9EEC400F1418 ATV0/
1,666,306,189 *AF5302818048EB1B0209AAD098A1EA0B87F95811 AUGUSTUSBRIDGMAN
1,666,306,190 *AF59E6305155714E11A47E030B1570427C394498 FRANCIS.WECKERLY
1,666,306,191 *AF58C47C5F78A8C280232EF646D82430C409236A autumna11
1,666,306,192 *AF526A38573C5186D30E7F52572ACBADC64CC313 AVE7$
1,666,306,193 *AF5A756FA32C087B90F742CD14E7A656E7352DB7 FRUITMARKT7
1,666,306,194 *AF589CEE8AFDEE4714BBC9002B0D455098B37C3D b'5"
1,666,306,195 *AF513749EE301337C6C4941C8786CFB3B343DF8D B5KE
1,666,306,196 *AF56E846CA5917ADBCDD6C6E0CD9AD9217C66D18 BAKELITT4
1,666,306,197 *AF574E830389F2FC96D0D6CFFA22927981594E40 [email protected]
1,666,306,198 *AF5E90EEC3E494FEB411504EEC681EC9D72E80AF futuregroovexpress
1,666,306,199 *AF562534B99A951116101CFC57AF0ACEA68106E2 BARRYSPARKY
1,666,306,200 *AF5288F558B6B714690E90D9766DC27BF20AD0D1 fzfv
1,666,306,201 *AF563D9D92B771E97464A89B7F6478249F4EA2D3 bb1wm
1,666,306,202 *AF5F31698DAA736EEBD24779D0B7C38E9DD8958C BBNOB
1,666,306,203 *AF5BF2DC5BF1368013BA9991DC20E01FF5E92073 GEÇBA
1,666,306,204 *AF531C3EA6AADDFE276BD1BDE9D89CDA44E05E99 BEASAMUELS
1,666,306,205 *AF576155E0FADEABDD69B8D616E364E9E2632066 geolpkaa
1,666,306,206 *AF5DB0D6C6475560C6EE77FBE278414643EB0CD5 BENNY.JELLERSON
1,666,306,207 *AF52DBB7E214A6F96380623B778114B9AA7938D4 BENNYREGULUS
1,666,306,208 *AF510CA4327BB8C4AF40ABA5C43F27B984185358 GIALLI1
1,666,306,209 *AF5CBF5BC1562C68B19F95D8EB24E27C440D4582 BFF$#
1,666,306,210 *AF57F3FFB700140FA7B867FF09A632E1A868138E BILLY'SHARDLAID
1,666,306,211 *AF505F81308EDFE6C718986300A0CE6DD8E45CE1 BISIALABI6
1,666,306,212 *AF55A8CF6057E250AACBD17D154C78CF20B28D74 BJCULLER
1,666,306,213 *AF5BEB24C0E4BEBD97A4378A0B4EC93407564A33 blainedainack
1,666,306,214 *AF50F57D8096347D38F6971DCDFE1CE89CA8B734 BLAIRREDICAN
1,666,306,215 *AF5850ED85D85111E207674F7BAEC0C40A43390C GIRLIERUIZ
1,666,306,216 *AF545192FE29299BD5CE1064C1B04379E924D0C1 glennmielkie
1,666,306,217 *AF5E7E99814C176FA1817438C40A6F36BEE1B1C1 BOOKERTIPPY
1,666,306,218 *AF5BF043D718CAB457CA4F95E80EB52DC2290FDC bovensoms
1,666,306,219 *AF5CE0C0FE57CA08E6857BCE3ED51EDA856C4E37 GOD-Z
1,666,306,220 *AF5F4D5C6BCEBBB3770269A2F7BDA90CB5C5E164 bqywu
1,666,306,221 *AF5480590AA0A5ED649FDA49055AEF70CB7961C1 BRANDEN.FRIEDMANN
1,666,306,222 *AF57BD61A5663E0A58FBA56A0489F2C1212FA808 grades
1,666,306,223 *AF536332846A5CCCFF42B776AC4AC6C264DD17E4 BRIDGET-KRIEG
1,666,306,224 *AF5E9DEB6D4828347A33F05CE814BB39BD433D07 bringupon9
1,666,306,225 *AF59997735FC794120CAFA717EAB603734427370 GUDRUN-HAHN
1,666,306,226 *AF51D4059B50B32F099D76C549C83ABC813DDE49 GUS.CRUMBLEY
1,666,306,227 *AF5A4D68B5662706E3DA9882B391D4D89AA2C4CA BRUKLYNBOY
1,666,306,228 *AF57071EA44A8250453204F00D23B8A89678673B b$s;=
1,666,306,229 *AF548B5A327C5F935E4519563B3F8530DB370972 BSD,S
1,666,306,230 *AF5587DC86752F09DCB2D441DF3959B410048EAD BSWBDELATORRE
1,666,306,231 *AF598B95E3C7267495AE3E816AA310DD964AEEFC hajonneet0
1,666,306,232 *AF577BF9B1A4112DB41619252E27D12DC4DECF01 bufordmaheux
1,666,306,233 *AF569F296B218DA5080905185BE5C093FFEC4CBB HARLATRY8
1,666,306,234 *AF55579801368B52BE80AF4D3C74FE64B71FC7AD haroldvauter
1,666,306,235 *AF5CF70360FC94C4A12CD61EC81BB40ED3059E3E harold.walker
1,666,306,236 *AF56CC7587A8FF1A93B7EC288D759CD50764F9CB has said previously: &quot;without<br>
1,666,306,237 *AF5FA6405025791B23CD21127AD14E9E857A516C BURTON.NAES
1,666,306,238 *AF5A6B2FE6E5209D74BCE9D915839391681BA4B3 hayleymair
1,666,306,239 *AF540412AFF0052CEC7B6209E6B255C22DB08E51 BVBVS
1,666,306,240 *AF539582361C3DCFFF60887A37FE2583100661D0 BVH(V
1,666,306,241 *AF5414EAEE2BB7B3326AB3907C4BC65157B9E88B HEATHERFOXWELL
1,666,306,242 *AF57DA7F44C87FE822BAFDEF813A25C6C8BFAB7D BYYANGBBS
1,666,306,243 *AF5DD3C4A641DB2CACFA5B4BBDCFF0AD20DBD4F4 bz5iq
1,666,306,244 *AF5F3A909B7D97A48C2702F04AB2CA29B3AAB58E c0878
1,666,306,245 *AF564D79F896CE41665BC07CEC7D087E7CCAD130 c0q"
1,666,306,246 *AF50B530F5025D79E6283E21254E058A22D4609C HGIETL
1,666,306,247 *AF580960264B3F677823AEE60F1F753160CE60B7 C]2V
1,666,306,248 *AF59C2B3B00F0E31C8366648DBA68C97E3B2EFAB C67FM
1,666,306,249 *AF57466009FC628F61E323A51C4C78D223018995 cahws
1,666,306,250 *AF54EAA72279C25718571AC5D0A42F9D1077D615 HTTPWWW.TIAACREF.OR
1,666,306,251 *AF50099A6C5357FD7A06081D63FCF5BE0A8EE046 HTTPWWW.WORLDSEXGUID
1,666,306,252 *AF59FC371914095CBBEDE06510B13A1B8484B01E carolsitzler
1,666,306,253 *AF53B73637A32F8C4B6AC1FE9E961B8791711A50 CARRY.THE.COUNTRY
1,666,306,254 *AF596C9B9F4F3302E6ED25DD74B9DC39EB5C5C13 [email protected]
1,666,306,255 *AF5549DDE2741AFECE035157624711BC396FABB1 CAVANFERMANAGH
1,666,306,256 *AF5F6D90308B43D74CA027A284364671764C8611 I#[.
1,666,306,257 *AF53807D0CDF7AD799C55905DB239A0BC0D9BDC6 cc"pq
1,666,306,258 *AF58ED8A53AC607A60DDAD8C4AE76760A992B14A CC,TQ
1,666,306,259 *AF583076B5918550F73ABA5E602B334256E773C2 cecilia-de-la-cruz
1,666,306,260 *AF5379E9BB56F0920B5FF1924DFA3D165BB8CAFD cedricgirard
1,666,306,261 *AF5186EF2F8E1A5F2799FB3CBE4F6E1E8232A4C1 IL4R
1,666,306,262 *AF5559D67A581D43633F275AD7733FE0E7D26A40 c:g=m
1,666,306,263 *AF52713B73DC592114AEE31D5ED6046961F56BAE CHAFARINAS1994
1,666,306,264 *AF5B2A6F85D79AEEFD2CF98AD285433CA2F26E51 ILUVPARKER35
1,666,306,265 *AF529B879CC76A7E972248C6E63EBBDD7BC186D0 imrovlad3
1,666,306,266 *AF5514D1331FECD6242E259345BAFA79B4986DBD INTERNATIONAL社に関与し、そして現代では多くの後継者が、世界的に家庭用逆浸透膜純水器の普及で貢献している。
1,666,306,267 *AF5D63CAA5AEDCCE7F0BFE61B41911BF463FA45F [email protected]
1,666,306,268 *AF5C4AE1227F1E61B10A9F12EADCACFC295A2E91 CHESTER.BERKSON
1,666,306,269 *AF50DBB6D0C94706904D324C33588220A967855C chestermclain
1,666,306,270 *AF5272A625BA60B18D3052AF0D8D69CE31C2AE1F CHETIQARA
1,666,306,271 *AF529668CA7BF9F65813B13C17D592B88273F5BC ISHEIGT89
1,666,306,272 *AF54C3ED0146E3ED5E30896446AA9264EA93A074 JACQUES.WUCHERER
1,666,306,273 *AF5B08680857C9AB7EE701AF3A11ADD488BCAAF3 jaebech
1,666,306,274 *AF541B77D3B78306B825D7CBC20AA0FD916843EF JAE.PERREAULT
1,666,306,275 *AF567750D9AA13B5A11AC7E2A665540CA87DCC55 Ja,ichbineinfach,sowiedu,unterwegs
1,666,306,276 *AF5A1BF02060D484406F0BA434419F3478231E68 ck)!
1,666,306,277 *AF5504AD06840F90B38E767D7F8F7D380E6B59D2 ck!=k
1,666,306,278 *AF58819BECA06110F6CC4074BBA0887CC2A462DA class="srtitle">canterbury
1,666,306,279 *AF508142052F884B287CF2931AD07FD35A5E0767 CLATHANIE
1,666,306,280 *AF5D12159D82DB45CD0CC9EC9207FF569EEB1671 CLAUTING0
1,666,306,281 *AF55A43C83C56F67D41C94DBCBB9016BCE6ADA31 JEB0509
1,666,306,282 *AF5F453C960A7B677A9D98B702A0440E89C75BA9 JENIFERPOTTER
1,666,306,283 *AF5FCEA994D158C7E42BC231E26BE766F57F32C0 JERILIZUQUHE
1,666,306,284 *AF5C5C2015C389F995C9C2D73DF456AF91AADB13 CLEMENTESANDOZ
1,666,306,285 *AF5262BC741E4301CC87813146B8590422479ABE CLIFFORDTUFO
1,666,306,286 *AF5F156DF0D0643498BB417937739AFB0F1069F0 CM9V7
1,666,306,287 *AF51F64EE5CC9012654B05A7FD4B419389B2F653 CNAREVIL3
1,666,306,288 *AF594534A0B19D8A447B3464EDFECDF6CAF27702 cnk-z
1,666,306,289 *AF58667B41B9CED6E951BA31F6D5BD743DD3B7BC CODYMUTANA
1,666,306,290 *AF5DCCD85392C8997828441E01B4E6D7C598A1B2 JHON FIRE
1,666,306,291 *AF54DA673FAC8F6DE0A3718C16124498124C087B [email protected]
1,666,306,292 *AF55A6E08A2FF137FB19DC4C9188C1455DDC19E5 COLBY.TRENCHARD
1,666,306,293 *AF5BF993550D58B95BBFF64C69E35E593A374E56 jodyensey
1,666,306,294 *AF5ED9614544BC4FA7F5369C192210789E9C9D1D complete recorded works, volume 1 (19351936)
1,666,306,295 *AF54CC69087EBD901F92FEB770D442C065D8A028 CONNECTTANNER
1,666,306,296 *AF58D0456AC177632B77528EFC06A50D968AC791 cool2014
1,666,306,297 *AF5F38A28B27A509F37FA4DD3F4CCC0857C92D33 JORYREID
1,666,306,298 *AF56E8F1780E6D20CAA8C1C6375CABBE9C615E77 joseagaona
1,666,306,299 *AF56F2B5189B2D4B99A70AE210723BA05E2524CE josepasquini
1,666,306,300 *AF51F9E1499CCF29809DACD37D31DBC0820CFC79 coryhoffner
1,666,306,301 *AF584842EACEB04353DE2598641CA6A318CAD172 joshalue
1,666,306,302 *AF508DD0A5529CD9A5EE9F1D80E9E379EED89719 [email protected]
1,666,306,303 *AF58403FE73D9BF0512408AE83CF89E64BDFEDB7 covn
1,666,306,304 *AF54CA3B95E566890FE625D1A36E36BE9158DA8D [email protected]
1,666,306,305 *AF5CD2D96139C7AE8EB5D4E3EB98186E6B1B61B7 JULIANA-SAWYER
1,666,306,306 *AF51CE4F8135C0166FEA767EC4D569986B9F857F JUNIEWEE
1,666,306,307 *AF55E7FEC6595581C1F3F681CEBC93338D70A716 c+ptb
1,666,306,308 *AF52FD2FA9236130FEF7C8691D2CE7229750AC2B jvf
1,666,306,309 *AF585EA235FCF2345D11A819A9B6F74AA4B62B3B K-DUB89
1,666,306,310 *AF5221A431B8675365FFA75804ED4D643EF38BF4 keenanredmon
1,666,306,311 *AF598106866042A7283E8D10D8032917B0863D76 keisetu
1,666,306,312 *AF537C3A91CF68C24AA585834A704EBBD6282563 kennithreaves
1,666,306,313 *AF57D8B62C5F890D65F251F8D780F907EAB6A480 CUS70MIZING
1,666,306,314 *AF57FC2015099E7D20A60430E2C575D014FB9764 c)vc=
1,666,306,315 *AF5732A0AE09022A65BAB66963F4EEDE74BA099A KERRYRETZLOFF
1,666,306,316 *AF5277DDB89473A3E9A484FEB5A1617DABA1A8DF KEVINOVERSTREET
1,666,306,317 *AF54C4D6D24EC809B388A771C655D58AB8A8A2BA cyrilkerby
1,666,306,318 *AF5B2F1EEC769C26252871A2159F6F14F8D8EA65 c"#zg
1,666,306,319 *AF522066952863E468D677F76545A87D9FECCCA9 D1Q!L
1,666,306,320 *AF5C7639FCF76F35A81D2E7E4DB2DECECC149A1C KRISTALLISATIONSFESTES
1,666,306,321 *AF541539D27C89F05D22C52F67C4FD62B0963C63 [email protected]
1,666,306,322 *AF588D3B34B980CDA0BBB2CEDBDC4F8F36E9C354 DAIRYAL5
1,666,306,323 *AF5EF321D5B1C55938EB68819EA5B4CF8409BE2A DALU
1,666,306,324 *AF544886FC5FC65DAACA0D97FD8F70D0E8FA27CB [email protected]
1,666,306,325 *AF56E3736DF379A93265D09BEA94BE4889022187 L1895
1,666,306,326 *AF5CB75C68949AC00B8BC875C6BDB94962CB841F (L7BAA
1,666,306,327 *AF5E856CCC9FFFF8C0F7F1CA700E19284874857D la8emena
1,666,306,328 *AF51E81924036D4753EA140E89024747BFC20EDA dampaals5
1,666,306,329 *AF57035621CB86A283113434807BC82CAD95B4AB danchone
1,666,306,330 *AF5B9799CBBB3B6337FAD3E0A42BF1C3A3CA377D DANNY'JUDGE
1,666,306,331 *AF5F9562B3074EE6889E390D218829417BFAE85B LALES
1,666,306,332 *AF571C7337A71E9A2651D5E08EAB43E09052E136 LAPSIKYL
1,666,306,333 *AF5A3495715CF5F09CDCC82C1E1B64AB0102D116 LAURENDEWITT
1,666,306,334 *AF5B5F5C7E8BC02511F17AE42A0522CBE73901C1 LESLIE.ZEIMET
1,666,306,335 *AF577B8C1EDA85F2D4EF4F5A59A2CA7FD2492A11 DARRELL.BLAGG
1,666,306,336 *AF5ADB717B15CCA737E4DF66A4B5D739DF51716C DAS GIPFELTREFFEN DER VOLKSMUSIK
1,666,306,337 *AF5ABA393242528445BF19082F521ED84C90139A databasediablo
1,666,306,338 *AF54B79AD6F245D490526FB314B3AE7AB70DF78C lindseykoala
1,666,306,339 *AF584D59DB6582F8DA293565FABCC5CB061C45C1 LIVETHAIGUY
1,666,306,340 *AF52102D39225E625B767E1BC56D35850BF151CF DbsF
1,666,306,341 *AF57BA29C60EBACD57A792895114E5E932F0F0BF dcj7o
1,666,306,342 *AF5F2AAAAE238F1A2D2DE264AB28F84C1A28BF52 dcvvw
1,666,306,343 *AF5024893BAE0712ECD3BD609FE99B80ACDC347A d/+df
1,666,306,344 *AF56EAC2D0CC99ED2542525D313E83B5BEC71C79 DEANNASHAFFER
1,666,306,345 *AF505F3DCC3C071DA9A9ECA9B7CAC201FE1C731C deko1981
1,666,306,346 *AF54E35ADCE71521A5F04F2BC1CF35161765563C luna2135
1,666,306,347 *AF5632C6D235FDB482DF932F1943628F28704933 deplairons3
1,666,306,348 *AF5AF16CA9EC26A9EBA810BE7F69C17A7FD932E2 macau,俗稱“澳門大賽車”
1,666,306,349 *AF54B4B16531E3D3A3A4EF43D33A22C9F43E193B dguzg
1,666,306,350 *AF5891B06CB6A9EC9B0A3120A328D28AC36C9EED malcolmroutte
1,666,306,351 *AF526B5D48F50CC5C883B99BA103AE48BB8DE4CE D’HÉPATOPROTECTEURS
1,666,306,352 *AF5C35C88E51C35AA9B598EC82E03352EA1BC470 dhesp
1,666,306,353 *AF57C2FC3BF2883E4785EDB36260A4A4F0BEC72A DILANTINSED
1,666,306,354 *AF5A305A047D108AB8E135E9A36B3E3606BE972F marguera1
1,666,306,355 *AF564C52D239FF22697DB1092EAB50388C465375 disc-4-track-4
1,666,306,356 *AF5A6D21EF030C6683EF78A256A582C06D6C1F1E DjSS
1,666,306,357 *AF500EC0F3A702EE5A95161F30393AACE4AACB16 martinawesome
1,666,306,358 *AF565616C26F90965C6EA37070F32F0D0D487F76 MARY ELLEN PATE
1,666,306,359 *AF54FB3080528BAC13BB84B44E54A861F8F2B60B dmcf+
1,666,306,360 *AF549C9D2F9250F25C5103FC7F736BE7768C6A98 MATIAS.CA
1,666,306,361 *AF59A5C0A11D88A01632A51A4F81AD6C03DCB875 matthewjamesgallagher
1,666,306,362 *AF58E2EB97ACDDBB1EB416890BF8E42F44E3EA53 dmz=m
1,666,306,363 *AF526880DDC9D1C141D2CED9058E4FD50217AE4F MAYRA02
1,666,306,364 *AF568D86A59DE75AF382B184A93FD8A0A4FE837F MCKINLEYLITECKY
1,666,306,365 *AF56232EBBA461F6FAB5B52C498FD35622362984 docf
1,666,306,366 *AF52B15604B6FEFE9A6A2E61946E5D00CD0F9C9B mel1317
1,666,306,367 *AF57A9C54AFCC30A1555D6BF5456B00D4D58CAA5 MENINJAK
1,666,306,368 *AF525B985785137F1B8FAA759A73B3537213C88E MENYANTHACEAE?
1,666,306,369 *AF5A1652DF5704685A738027CB32DDFF67DFF2BA MERMAIDBOUGHT
1,666,306,370 *AF5D281645D70DEBCCEBA71C7C9397E6F81A08DE donnieniesborella
1,666,306,371 *AF54B6A0CCFB040BF27974F9930DDD1C98444E08 Messages(fromtheRingsofSaturn)
1,666,306,372 *AF56811E1D0D95EEB0296C8047A6627E815FE576 DOUG-CORMACK
1,666,306,373 *AF5F696F97213BFA1F548C3FF2EAA7E8B0859705 michael-shue
1,666,306,374 *AF548D20C48EBF8EDEEAF8FEF4612E7292589459 MICHEAL.TAVOLIERI
1,666,306,375 *AF5817B19B51DB4BD89C0D6AFD3371EDFB611E48 doz5v
1,666,306,376 *AF573DFB541D0FBCEABA7B239006DD19EEFCFE24 MIKELHONBERGER
1,666,306,377 *AF57ADF0AB305101F1A5437D5A4998589C5C77D0 D_QH
1,666,306,378 *AF559B208D17F723A270F5A3EABB967F4F2498BC mimibradley
1,666,306,379 *AF51F435FE6CB01BF85D461B3BD098E97F32E436 MITCHGEHRKE
1,666,306,380 *AF53B41F34B1FC40C61C4B5FD56A2EEAA931EFC4 [email protected][email protected]
1,666,306,381 *AF54667C9BDD0B47703B90C83DD5B584FBD847BA MOHAMMAD HOSSARI
1,666,306,382 *AF55CFC057C12817B4FB121D5483291A4CF99BD2 mohammedalessandroni
1,666,306,383 *AF516ADA6ADBF09B813AFD0B6C0E3A8146D4B25D MONEY(FEAT.MR.CHALLISH)
1,666,306,384 *AF53F929A1100D6BB2812E6F6949C1B3E20FA405 morpheus
1,666,306,385 *AF5075A55AE78530A5E5C824FFD2172DA4770F21 m]pb
1,666,306,386 *AF573389D194F5BA389570A7020E2F533E4BC065 MROKOBARO
1,666,306,387 *AF515E27D45550694DAFD7D03C6A5D92A62F386B dwwad
1,666,306,388 *AF5E27786DBE96A9724411C34B2A811B1555D64F NAFISA SULTANA
1,666,306,389 *AF554D4C7AE729F24C0EF85090847617FE430378 NANCYJONSON
1,666,306,390 *AF5C35AD8F198DC022DD37B272BB204E904729AF naveen.nainwal
1,666,306,391 *AF545A09C74102D0F5A67590C930531E150D8E93 ED.DI
1,666,306,392 *AF5165E1EABDC64BA63E9F5880F03035471DE455 NCRATIFR
1,666,306,393 *AF55B6321F127E109154198DD3DC713A20FF862C NEDRA)とともに、トラクを信奉するアンガラク人
1,666,306,394 *AF53D1DCBD3F2A27783D7674223C72CC7C2BAEE0 nestorpolacek
1,666,306,395 *AF57DB39D90778D8B56B44D88D8F33E999B3D9AC EEFFO
1,666,306,396 *AF5330E517664F7FE41A4BF05597E63057BE1363 EFFERRIS6
1,666,306,397 *AF50F7BC84B3EBAF8E6F69908F1CD94C874A9D48 newyorkisinchina
1,666,306,398 *AF5B3E59A936D546DD41A67FCEDA241BB03B4A74 EG7QH
1,666,306,399 *AF57A46ACA1B53618016E7E8FB166BA8CA3E8423 NISIKOMED
1,666,306,400 *AF576A99AC5414211776780346792904A8AEA9C2 noahinfantolino
1,666,306,401 *AF5D82B96348EE6EE1A44138EF2E6BAEF56A67E0 NOEL.DOBSON
1,666,306,402 *AF5B73DAA203222AECEE67E2155BD529E6D5BBA1 noinform8
1,666,306,403 *AF5E16473FF03020588FA9E16B81F06E14A795E0 NOSETTAM-1
1,666,306,404 *AF52F02BF2DE2CC2362065AE766FB0B078F4554D ELISHA.PRUZANSKY
1,666,306,405 *AF5AEB0FC5ADEB5ABFEC8AA3D2E96CB196261F03 OPISANEJ4
1,666,306,406 *AF5DAFCAE51CA306D92B3C2471074E5CB958D36D (O_)~.`qq
1,666,306,407 *AF5DA643781F6E6A21F0D8CF1CB513E7C8F738A5 eloymillender
1,666,306,408 *AF534B331A3BEE3CA79571311E7A8ABB650F8F6E ORLANDO.DANSER
1,666,306,409 *AF5641885C55D70907E059FF3F85DEDB34630171 ORLANDO.RAKE
1,666,306,410 *AF51EB7E832BC16DEE05210505AA7CBD8EC7E282 ORUJO‎
1,666,306,411 *AF577DAECE6BE32DACD2F298D95430976B9C0A87 EMERYDIEDERICH
1,666,306,412 *AF5D07BD0619B92CADCCC71FF945B021AB812166 EMIL.SHUTER
1,666,306,413 *AF5231A67BC19E408EF12D925F719FDE8D057622 OTANEZ(
1,666,306,414 *AF54540F1AB76DF5327664934AA2E02665628A8F otomiko1
1,666,306,415 *AF599D803BC6D9A37D3EE86D72FC1A6ACA7C405C [email protected]
1,666,306,416 *AF5B635AE7EDFF14C92F45240BDF504036CED1B1 owendetlefs
1,666,306,417 *AF54D340F59B05FAE26BB90B6CA93BCE986BBB5F englishto
1,666,306,418 *AF5BCBF2668C835F861A3C6C4FE45DE40BDC7E54 ENRG(
1,666,306,419 *AF5F7EC7BF2BA1CE7F9FDB1ACA5CEB91D1F94962 ernestomolineaux
1,666,306,420 *AF5FD011129E00125376DB86C9BB8EA0750D388D ESMEREJO`N
1,666,306,421 *AF5FA5011693452140A081CF59C1782F934752C7 ETIREMOH5
1,666,306,422 *AF59846722F1AFC3DB8B823491A64845801A133E evandues
1,666,306,423 *AF55F02480CBA17A067DECA4505DD31EC4D7AF38 PB.*.*SPLAT
1,666,306,424 *AF535470BC553300CB8D7F36F48061FE02471947 percypiccirilli
1,666,306,425 *AF525C26AFC444054484DFEDE72E69C222165823 PERETJOUKKOJAKIN
1,666,306,426 *AF55590FFAD4824FE1D57734998A3C5FA9753504 f4472
1,666,306,427 *AF56246FC527AE722AB29A55D18A8B6648C4932A faustinoeffler
1,666,306,428 *AF505A0D187860B62A9362A8448B645637B25411 FAUSTINOLENZA
1,666,306,429 *AF52B7CEC3BAC94206CFAC34A28D1675CBD63E4D FAUSTO.ADOLFO
1,666,306,430 *AF5281DBAC752ECD0D8C8F754F3BDA65B8415F02 Favoriseriez
1,666,306,431 *AF56F670C71AD63E43DCD8B320E49C02E8C12DA6 FEDERICO.NORTH
1,666,306,432 *AF52749358DB8751BA6C2360278DACD3AF3105F5 feititcaf
1,666,306,433 *AF5B10373567F3EA2FFA1E260BBA9F063E8D528E PLAUGER1
1,666,306,434 *AF590BD37524A821990A94C0D9D03006CE666013 [email protected]
1,666,306,435 *AF5AD7438C042DAE0100BDA6B9905AAD8103014B floating.free.(dub.version)
1,666,306,436 *AF5D1EAD62E57FBB1F0DCCC36321E1C459C13939 fr1826aaa03602
1,666,306,437 *AF5EE4D14990AF8287BE4FBD4D1372B093D19941 FRANCES.PAVICK
1,666,306,438 *AF5DE110EE01354DAEFD0156F4A0A9FAA295DF85 FRANCISREMEREZ
1,666,306,439 *AF5CEDE7401D6A2E1E4180087AFAC8664F2741FE frederichillanbrand
1,666,306,440 *AF5DDEA65B3226F31C0BF0CE1E7964C853931273 FREDRICKMOSELY
1,666,306,441 *AF54E834CB6118634F331A62B04DABBDC9AA8188 from.so.divine.a.temple,.to.commix
1,666,306,442 *AF56D3AE4B57877E78C3944AFE42C8F849346A96 P====P *3B<
1,666,306,443 *AF5CAD0D31E6882EE58F32614AF6B758BCDA1A8E [email protected]
1,666,306,444 *AF5DC27CFD766BA171E79A91E19C452750021BD5 FWIWKEVIN
1,666,306,445 *AF533C0314BC269FD4F1082BCE00B55ACC2D9214 PREVENISSE6
1,666,306,446 *AF5CF60BF8EC8351ED8D962376305FD51BBA1622 gangstarock
1,666,306,447 *AF5D5100A87BA9E4C05AB328A607490223FA399C GARTH.NIRO
1,666,306,448 *AF53A2F9269F98261B7E523125F10A148434BF19 puhety|lisen
1,666,306,449 *AF53BD0730DA1B9C92B2C188DAD67BC5F882C116 puulane
1,666,306,450 *AF511C678DE1423B9F31507447182693D5EA17FC Q3I[
1,666,306,451 *AF5BB6F3DE4343F014D3CBBB781EF12643FA7286 [email protected]
1,666,306,452 *AF5CFF64190E77F2739D456D16829BDC306B0F33 q#####b~0~o(^_~)
1,666,306,453 *AF5A95219C2C797872F8E960D62CCD3E03E8015A [email protected]
1,666,306,454 *AF5774748394C138114AE353BA7C509C2F1785AD [email protected]
1,666,306,455 *AF52AA6D1D9371BB8428026B6AA4879814B05CBD georgenoggler
1,666,306,456 *AF5CD019201F6C90130032628546F8F610370E24 [email protected]
1,666,306,457 *AF57D81A3C599C8C5B2EB0954D8E9CCD2594D205 [email protected]
1,666,306,458 *AF5963498922550AD90D737D53E84AB4A7605356 qlxx
1,666,306,459 *AF5F47096E39D6F511588778429F82F3F27F98C4 QRAK
1,666,306,460 *AF5340B03CEDC7D90903C130D428BC5A51CA0DFF GILBERT.FIRESTEIN
1,666,306,461 *AF5E2B0EC4A4C76503D45398A1FC89BA560B8EFC gilbertoaubrey
1,666,306,462 *AF56D1F6629A5D55920A050085B9E32C1D10482C QUEEN-MARGARET It-made-me-laugh-to-see-the-villain-run.
1,666,306,463 *AF5053176219FB1C055EF027F2C8ADC74757CC8B qyjf
1,666,306,464 *AF5921AD7C1F6BA1C944AED770EC94B69E78D0F7 R3-3NTRAI
1,666,306,465 *AF56CC2618BC9853E0900C92412F00E194C5BAAD glij'md'rin
1,666,306,466 *AF535A68782891E2FB99C36B816593030C65DE23 GNITTIFMAETS
1,666,306,467 *AF531FA6EC665BB0B6B3130DCC069637E59E808C GPP RECORDS
1,666,306,468 *AF5F91EA2CD458129DBF6DB2ACB29E07D7C76CA0 GRACE GODOY
1,666,306,469 *AF550891CB0B8C39FFFDCF8D827CDE95DAF6ECDD gradymadre
1,666,306,470 *AF5676F262D69114AF3D4ECBC6A1A9AFA475E5AA RASHADHRYCKO
1,666,306,471 *AF5699B41F9BBA393B2F7BE373E336B6601A1996 RATHEESHCHANDRA
1,666,306,472 *AF582158E62C0A97D7B4C9624183927956B6D53C RCEMBALONO.17INES-DUR,HOB.XVI:ES2:II.ANDANTE
1,666,306,473 *AF5B94A7F31CE32132E33633F55A16B0AF7EF6E0 refee
1,666,306,474 *AF57DE4704C60E77F2290811B4C6D06CB92A5713 [email protected]+IVE1Y
1,666,306,475 *AF5D0D000F6BE9609785323C81608A53D258355E REUBEN.STAAL
1,666,306,476 *AF5E8CC2C31C8F979464266CA6E3E550AACC4D81 H4R5BR34D7H5
1,666,306,477 *AF5069C65E8A9EB874316DF8CAC98AF1F580AE06 HANNAMVILLE
1,666,306,478 *AF5721B2D0161EC7F83F8C213AD90293DB160142 HARLANULLMANN
1,666,306,479 *AF56A3A1BCDA009CB4A5AD400DA0CC938EE94819 HARLEY.PIETIG
1,666,306,480 *AF5507AD9A6164EE3F579444C54FABADDF0BF82A HARMONIA
1,666,306,481 *AF55704BA5030990558A2DD84B3B48627AAECF0A RIGOBERTOPINNA
1,666,306,482 *AF5B53E19B7297962DAD29BCE28E57311631104A RIGUERRA
1,666,306,483 *AF59511365594DE853391E92CCDF74683124CC22 [email protected]
1,666,306,484 *AF5DCE2C520C8B2BDF8CB3606E24FACD14A20B3C HBIDAWY
1,666,306,485 *AF5D8EBB4C83C000A94D0251F7BA26C9AF61BA12 HCSINOFO4
1,666,306,486 *AF58CC832A27178F758AD043002DD02D5515C727 RMISCHELLE
1,666,306,487 *AF5774F51E019800660B3098B8AEC2F96F5C66F6 [email protected]
1,666,306,488 *AF51A9824982035F929920372D512390952196F3 robertschiavone
1,666,306,489 *AF5C20A423361190CF915267141534AE6D8BE5BE ROBYN.HONEY
1,666,306,490 *AF5E8C99B19488AF225F0EB1B9E5807507472BE3 ROCCO.SUTHERBURG
1,666,306,491 *AF5F7F954C43D3075E0799F80D9A0C19A44907DB [email protected]
1,666,306,492 *AF57E3C9C025F1C5A3539672B2899A12AAE6A55A [email protected]
1,666,306,493 *AF5FFCDE68DCD1FBF352796DC16CA50353F96CF7 [email protected]
1,666,306,494 *AF52138CEF316F58831CA0B9595DF96264AF4E8B RODEONE
1,666,306,495 *AF5166A42E667AAD7456EF9BDEDFA44F85CF6CB3 RODNEY.CHIADO
1,666,306,496 *AF59AE503C3ABCE17FF3A5087F73AC6A71272614 HERBLOCKETT
1,666,306,497 *AF50E82CFCEA1C8F9BE69446EAFCEF1D559840CF hermansison
1,666,306,498 *AF592DBBF0DC2AAA2CBEF95D6E84447794A7C2AE rogersvillelibrary
1,666,306,499 *AF58D0C8E6513805D70F3613EDBAAB80073B552C ROHAN-RHULE
1,666,306,500 *AF54FF1158C8E078DF17129A9CE0955119FBCBD9 rolandduball
1,666,306,501 *AF563BA448D9AF7D4CA4BA9193458847C819084D H$ET
1,666,306,502 *AF5292E856A37814D669CF82B5C48BC1BD5A732C [email protected]
1,666,306,503 *AF57DF697980566FA9A0C8EA21C5B31583F7C104 HIGENICSINDIACOMHIGENICSINDIA
1,666,306,504 *AF533E60775CAA0CE5A7A1B91F52EBA1EDB15E2B h'ij
1,666,306,505 *AF51A0012A1B148E0CF5F3B33A8B4299E82FB176 HIPOLITOGADE
1,666,306,506 *AF5CA24EF26CD711BC25C07E104350FC17B667A3 hirammacht
1,666,306,507 *AF53D026A23BEC032134258495F0F9EB2417123F HISTORYOFMICHIGANGARAGEBAN
1,666,306,508 *AF5614536D42FE6CD3457D4339CE285A06341230 ROSCOE.BARNICLE
1,666,306,509 *AF530D0D7B3954C85752CEF0DB5B7111DAED85EE roßochen
1,666,306,510 *AF5B6C70D25E927A8924AD9A244CA4A08D7F587F RTSATZENING
1,666,306,511 *AF5C1B6BA68996D43246C9C021CB9E9D9E3E9BF7 RUBENLARSEN
1,666,306,512 *AF5097E1008B0AE375BC47A28B770E1D90BFC1B9 RUBINBISIO
1,666,306,513 *AF5DFAC869F77400A7B1DF70572393096EF09166 rufusserl
1,666,306,514 *AF5CAECD9D880489DABE223FC233F97111A1E7D5 RUMOURS-OF-YOU
1,666,306,515 *AF50F0B85600D06E5403F055F96C49AEF39D609D HUBBARDL1
1,666,306,516 *AF59AC79837C0BAEBBECFE3A128C6EAA74AF4614 SA
1,666,306,517 *AF5EADD45FC5CDF959A78E3E481647D3C3977EC2 iccunim5
1,666,306,518 *AF5B4296EC12BD36EA90679A7CA7B46FFC2D5A20 SAMENKOMT!
1,666,306,519 *AF5908FE8617F380CB63878370D8ED7E2E84760D ij-{
1,666,306,520 *AF529B73B4BB3285AF0A2BFFDCB452AE01B1CE11 SANGETAGUPTA
1,666,306,521 *AF5EFEB347514FCA269DFCAFE277A6F4A1F08446 [email protected]
1,666,306,522 *AF5EA32E409C860127D99A27777BBE81C2641E8B SANTOSKEET
1,666,306,523 *AF5DAC8156ECE6840748AAAF81171DA1005ECFC8 ILUVCUNNINGHAM00
1,666,306,524 *AF5FD7DD486F1E23DF900132B5342E6E3AF8E0B9 SASSYZIGGY7
1,666,306,525 *AF5D68CEC5D1F643866A1D7318C82F6B41864645 INOZNALS9
1,666,306,526 *AF5700A41270A6F94CC7B678C73AE82C8801F74F SCHNECKM1234
1,666,306,527 *AF57E8972481D3B01EA8079429C15011A4A481D8 IRAMNAVEED
1,666,306,528 *AF5B558909AC6A3880232A6C932DDD1B332A21A7 iras(2)--ay1-aa1-r-ey1-z
1,666,306,529 *AF5937E4F56769F503E6A0BF1022482D8C35F96C IRITELL{
1,666,306,530 *AF561CB50582AA65D0322A604D22D48106E38A0B SCOTALUISE
1,666,306,531 *AF5C30016AE1611A2D4DA0263CABB13A7FF8D0EC IRSADD
1,666,306,532 *AF55BF0564144CB2265ECE15DD5B1E96CA3E90D6 iscocyrtus-crenulatus
1,666,306,533 *AF51586B2D00D0F9C97A46AD858FC999A7AEC78E SEBASTIAN.MAUPIN
1,666,306,534 *AF56E77C7DB0628FD465254ACE3DC3C630C4040D isleks
1,666,306,535 *AF5456754EF2680695443D27F304C6688C06B84D ISUBALLIN?
1,666,306,536 *AF5BCFC179CB71549BFD8F555F24E43FCB580E5D ITRUSTNO7
1,666,306,537 *AF58721CEC75B62498201CE8DE7F9829F642F5A8 SELLABLE
1,666,306,538 *AF59FC3A8DEBABC6AEA8BE9FF10411077948ADD2 SENEDEBME
1,666,306,539 *AF5B56C42D6075639BCB201D90DA09F4BA87BD04 senescent
1,666,306,540 *AF503E674948A4D060BA21DBA70C8006105C5326 SERIPSNE
1,666,306,541 *AF5AEE671DD9EA55B62691A42AF5E01E4612310B JACINTOSASSE
1,666,306,542 *AF5A29B2AAA119908E837243B4C0D89D4F3240B4 JADEPONCE
1,666,306,543 *AF57B465A657C3ED72007D02FD0869B99CA4BEF8 jamalmcclatchey
1,666,306,544 *AF5ECF57F00A00B421FFA1F3D3CDA21521B36060 JAMIE.BATTIG
1,666,306,545 *AF5020F6EFC788025F2C9B996A064F8D336A35AF S$GA
1,666,306,546 *AF5535A5C58D0886E381A69C28656CC43D90EEA2 SHAHPAPPI
1,666,306,547 *AF5FFE47CD566FCEE952068EF19A9A58EE989667 SHAKUR ADEBAYO
1,666,306,548 *AF5D59D7286423252F93FBC02749D03A613AE45F shanelamendola
1,666,306,549 *AF533E4F3AD3871AB4A06B3785C0F700E8519489 JARRODFAUGHN
1,666,306,550 *AF591AD738E9598A954F65B90D76D6F3124A451D JASON.KANER
1,666,306,551 *AF50DF57466452BFCAA1CD4F3A5D6D6E4CDBB4B9 jassonthomas
1,666,306,552 *AF5699F7F027112DF989FCCE7783E556F414EB58 SHERWOOD.BERFIELD
1,666,306,553 *AF5F252D89F42C57D674B52F37E62DB126D275DB shirley-speakman
1,666,306,554 *AF54395BB4C454188AEC077E72CB0D0056DFC530 [email protected]
1,666,306,555 *AF528F3D84494B679327A8E5E3225301A6D6640A JEREMYKATIE
1,666,306,556 *AF5CFF922E8C8832267F1A4D84DEACFDDB424043 JEROMY.GUASTELLA
1,666,306,557 *AF5DD35D2A9E411AABD9FC2E733873A221972505 jerroldyerkey
1,666,306,558 *AF52999084CA6DE7F155187940C862829358D3FC SIDNEYBEHRLE
1,666,306,559 *AF5480E631F61FC5C6F3022CFB5AA5337B566F12 sights.and.sounds
1,666,306,560 *AF5CE7982168AD50306097020F59FE72ED082734 SILVESTEREMPFANG4
1,666,306,561 *AF592E4C865B24ABAB0419E02E5A981D64AF0ABB [email protected]
1,666,306,562 *AF5ECCF7E7712823B816071C43130EB137EA6499 jill.schneider
1,666,306,563 *AF5BB04E60B06982AA1F6DDAC8098BA8799A0C51 JIMBRET
1,666,306,564 *AF5A0568E7FDB40D43E117C3D157CB5BC8E83DD7 JINJUHAM
1,666,306,565 *AF5E158EB91D2C2B97C48FAD3944645314C9959F [email protected]
1,666,306,566 *AF5741A9076E06426AAFD57BED702EE8DED10B2A [email protected]
1,666,306,567 *AF5A4774151ED5C40B8ECDA220511A07AFE02271 SIRVERGERVERGERESSVERY6
1,666,306,568 *AF52A62EFFB25FE4D97C7607ED2750F484F2E632 JKUTILEK
1,666,306,569 *AF574598E07BDC3949DB4E807C628F17B32DED64 JOBBNAL-JOBB.1
1,666,306,570 *AF57D478113B2600C2377B5072F21B95735406C2 JOEL.WALLOCH
1,666,306,571 *AF5DB643BC9F904351A3E678C06F9F9D6B793322 JOESPHSTRATTON
1,666,306,572 *AF5AA6EA6799CCE09EC0039B25F47A549DFFD5EF SLANGSLEEPSEL5
1,666,306,573 *AF5304A21E34B1A2FBE6A0AC62D3E642C42DF5A3 johnathonmeginnis
1,666,306,574 *AF5280FF532BDA2BE658231FBD5D7714E1C38044 johnnyburdi
1,666,306,575 *AF55F3B0913F76DF6C69120547494AEBFD66243A JOHNSON.FERREN
1,666,306,576 *AF5F11A546BFCEB3F71DE771F5AAD530ADF9A491 JONAS.FIGARO
1,666,306,577 *AF52025E6F2BB2B306FACAFA70EAD3CCC21CA751 joolblad2
1,666,306,578 *AF57C98721E42E3DF13E1C6509862A74AB2C0FF5 jorgerushe
1,666,306,579 *AF5D787D36A173325A86DD4A1BB8885EBBC8AC17 JOSELITO.ANDRADA
1,666,306,580 *AF557AB15E8258B786D0A0A736DEA0BB9AC13DDE JOSH-LAGUARDIA
1,666,306,581 *AF59DE1C837F9AB7DBFBB94EB7136D3BFE85B931 JOSPEH.HIPPO
1,666,306,582 *AF5F47D95775E6A236A371E24007A587DF19790A JOSUE.HEINICKE
1,666,306,583 *AF5BE7E5250F925D0614E5A2BE24A85602A2837D JOYCE.SU
1,666,306,584 *AF5AD03DE14CDD1DE3B12A2B8E30D2234CB3C355 jtic
1,666,306,585 *AF58DC16DDC488B81481DD481FD60C0D5CAE910A JULIOAMSPOKER
1,666,306,586 *AF5B041813C0828BDBC727F816032D5C8C28ACA9 JULIO.ROTZ
1,666,306,587 *AF5F811437FC7B64DFD0D7D861597EFC451669FE JUTIKKALASTA
1,666,306,588 *AF53863CD88B18EEB7C1409E295A237380F6CF9C JXPXPH
1,666,306,589 *AF5D6D1C0F4656B3D6114F1B30456148A1EB864A [email protected]
1,666,306,590 *AF5B33C6FA9343A562A5874A7205BE7D93D7928F kama.lo
1,666,306,591 *AF5F66910B313BC1F10599B3392CE0F517B656EC KAMERJAP6
1,666,306,592 *AF531A3602162761E86EFD18136F1F7ED94AEA83 SNOWBLAZER5
1,666,306,593 *AF5D2FF79E5B666714E0C3DF2CC63F24A2A8457D SOCCERCLEANER6
1,666,306,594 *AF5895CA3C28DD1CD68CAD67891F6465457DCC6F SOISEE
1,666,306,595 *AF5C3DFB5B8D0BBC556B825FC651D2A080A4E376 sondergeist
1,666,306,596 *AF54AD6BA43E42677FEFC869EE537ADB4A934BB1 kerroin5
1,666,306,597 *AF526E181732193A2AB98D0E3226494ADABA5806 [email protected]
1,666,306,598 *AF55D4C0608C7BD7AE57BCD5908E7A30EFCC0AF8 KIKANSIR
1,666,306,599 *AF52E44A450D7B22E5C5244ABDA7C31F8C94C701 KIM.WILMER
1,666,306,600 *AF5007100E1AC051DF161AAEB36CA0BA7512FF3D KIRBY.LASIN
1,666,306,601 *AF53DCA4394E03069C32A9B2D5FE7C8A8DA7D498 KOKOTIM7
1,666,306,602 *AF50F733F134667840FFC7B31075E8108FF999FC KOVELSBERGER
1,666,306,603 *AF5C6479B159476A50237FB37BACE7027240B41D kultúrpalotában
1,666,306,604 *AF59BC5CE62C13D32E70B75C11D3738474D59D38 KWIATEKM1234
1,666,306,605 *AF56EEB454C6A15B78079B26371AC4726A77D2EB [email protected]
1,666,306,606 *AF5914BA0B5FD993C9B4BC2FD7273E1DFDF2A1F8 splat.~.`@=====p
1,666,306,607 *AF523111238BE935A9A1A336CF9CEB3986F0A905 src="http//ecximages-amazoncom/images/i/11tm095t79ljpg
1,666,306,608 *AF51D3F333BC28DB8519E3068DF25F0745B5CC89 [email protected]
1,666,306,609 *AF5C3306236F60C92B86E29BAECFB6852C8316B3 LANSCHIGE
1,666,306,610 *AF5FB7CFC59F8805D7DD1461E7E18DD244D55065 LARRY KARLIN
1,666,306,611 *AF5749B408DAEBD35AB0E675B010D34CC4CFE654 lee-creamer
1,666,306,612 *AF5B9049FB0CCFF206BDD3994B591B04B6DD1472 lefou
1,666,306,613 *AF500B55B5FB979071701CCA97EEE07B7BFA7D38 state--shall-be-specified--Procedures-must-also-be-included
1,666,306,614 *AF59C2B7F9B178D332F8D353BE18FE333C37A708 [email protected]
1,666,306,615 *AF5D6E88BCB2BAAB23F408C0C41D2864B4E43393 LEON.LAUR
1,666,306,616 *AF5D4E1B0F41A623E4B7139B1AFD27A8DEE42EB5 STEHVERM
1,666,306,617 *AF5EB87432D1A23F1E73B1DDB90DD0942928E5E1 [email protected]
1,666,306,618 *AF5146579752E3B8D9FBB9D2C1F377FAED16BCC2 LINGANSUN
1,666,306,619 *AF55DC0AA4F08A0E485816827C5344EB5E57B4E0 [email protected]
1,666,306,620 *AF5431F413B27353654B40D2189B86C7F0D4BED8 LINO.ESTRADE
1,666,306,621 *AF53111D46D88ECF8A91EC7B45B01D6C99CA8EEB [email protected]
1,666,306,622 *AF505F19C4F54B2C361813F6E59849B2001FC923 [email protected]
1,666,306,623 *AF57D676FA76BBEE6DE2BBD4735206DE00DA3D49 [email protected]
1,666,306,624 *AF5F81E6267AC679F4ED67F587D0139B7B645519 [email protected]
1,666,306,625 *AF51D4ED47FE170FC81A55D146DEF0F3DBE3799D LONNYSAVARD
1,666,306,626 *AF5C1960B689C1665BDE6518DAC7EE83D5C17B19 LOUISBOHR
1,666,306,627 *AF595611F2A3C63C5AFC0A598D57CA5EA57D2FFE [email protected]
1,666,306,628 *AF504671BC521E4F114EE6F2F9C3D323DAC2B34B LOVESSTEAUA1
1,666,306,629 *AF5814AC1E4461DE454C4D4D626FDF3664BB4597 SUBPENAINGSED
1,666,306,630 *AF5966ECDD5AF4A1EA92C29E290EEE3A3F2BE086 [email protected]
1,666,306,631 *AF52B610392DD219C85D57EB3EA2061EC8425C28 LSIOUTI
1,666,306,632 *AF5E808444346B8BEFA6CD7FF1B8662B2BAD59F2 SUGOROKU3
1,666,306,633 *AF5D95B493FB51016ACD7B9936F925B9C77E6DCF luis.vela
1,666,306,634 *AF5EF7CD485ADE7117B0A3FC7CC534FD674EACB9 [email protected]
1,666,306,635 *AF57742E20C71B1E5FFA3CA2344BF4F96AE79351 LUPEMATERN
1,666,306,636 *AF52B4CEB1DE61DB53CB78697B426A2BED2A5800 LUSTILA4
1,666,306,637 *AF515B35D10B6371A3E40E8B0854C92BC3EEA06A m3c0nium
1,666,306,638 *AF513F5A04A377B0314367B30F3F79F5BBA8F179 [email protected]
1,666,306,639 *AF5D66F7D46B2351861934EC159D70CDCC2FAB65 [email protected]
1,666,306,640 *AF545CEBAEA7441906E892864595EF1696EA2709 supa-man
1,666,306,641 *AF510BB6E99C94F94E0FE5929FFA9E4BA88DC53F MAMIMISAMEJIMA
1,666,306,642 *AF5DA7241CC77C83145F88BF3D771C600D136055 MARCH-OF-THE-DREAMLESS
1,666,306,643 *AF570717FA49513182D3D15159D865B44D69B1B2 MARCUS.COON
1,666,306,644 *AF527900EF4B1BD58D81DCC56D61C7832384B81B sysopbbs2
1,666,306,645 *AF58D3C29C0FD69FFA8FAB42DF376A26408618C2 MARJORIENEWTON
1,666,306,646 *AF58B14942F19F30304FDCC5280AD2D52A5F7208 marydufton
1,666,306,647 *AF58BA530AAE1A513EBB4B5ADD19EE52670E7B03 TALKMIKE_EASTWOOD
1,666,306,648 *AF57BE812F9DCF0E613532999E93B73B83F2F398 [email protected]
1,666,306,649 *AF53E7ED9BEAF4B93CF1B7F980162068AB94C5C0 MATHEWBAUCHER
1,666,306,650 *AF5FB371E5CBA5587F2B5E33D3AF0F9F8C5F8E30 TATTOOSONICS3
1,666,306,651 *AF5016D04541251907CE2BCB77D893190EE4EA08 tay536767
1,666,306,652 *AF56D1DBFA6602439868E2100CCD42D1DE291581 T~DH
1,666,306,653 *AF5E182671894813A18930F6D88B61D8B712725C MAUROWOOLSTON
1,666,306,654 *AF5F59BCE2CD70094243EEB1AB7E8D8BFA3DF178 TED.GILCHRIST
1,666,306,655 *AF503373140E48A66290755511E04216981A6EDD MECKLENBURGROSTOCK
1,666,306,656 *AF5E6C71880A6B7ACDF2B86F2935F0653D9AD621 MEZIŘÍČÍ–ROŽNOV
1,666,306,657 *AF5EBD3EEF29E938470DE052D34DE4F9DBB04CDA TERRELL.HARNESS
1,666,306,658 *AF5ECDEA4985F2E120AAF9DEA8A85D4AA8719494 TESTERRYAN1
1,666,306,659 *AF585168A2641F1CDBBEE0E52484B40CE6BF72CC TEXAS_FM_1988.SVG
1,666,306,660 *AF5C7A7518C970D215A33BEBFD9E06F24446ABBE Th30r5n9
1,666,306,661 *AF5DDD30D93B3C8A94CEA5D058457BE071A761F6 MICKEY&MALLORY
1,666,306,662 *AF5B83F1145F6AF8B1041AE5CD2BC73980CE1682 thateric88
1,666,306,663 *AF5294AFFDDA255F0C1C9A5FFF744CEDDBE748B0 thatyoda84
1,666,306,664 *AF5E323073CCF42D1AE539C0D8C99D050AF72A52 milder
1,666,306,665 *AF5E3E7A9BFBC92FB42245EBFA13E8F4E7613B01 theopeningofthegloryend
1,666,306,666 *AF5DD8AA52D7B976D1A3FF35CF5351D28843BB26 MIQUEL.LIEDERBACH
1,666,306,667 *AF5F414FB36D2DFC314512E0542FDE5C228AA3C7 MISAMI4
1,666,306,668 *AF5609C36C2D85374A5606B99D85E5DC347C82A6 thomasvallin
1,666,306,669 *AF5B7F77ADAE48F969D6F5BF946147C242E3CB9A M-KIDA
1,666,306,670 *AF59671B6ED22C61E75951F26D495E0BA72FBA0D tiffani-sturges
1,666,306,671 *AF5149CE4DB5168B98C45B7AC20DC900AE01AA67 MODLILI
1,666,306,672 *AF51D90054BD8769BA4EF0E641CB2BD551A71720 MOO-YOUNG1
1,666,306,673 *AF51D100D15EC607153C6B7F8701E2481565C541 [email protected]
1,666,306,674 *AF5173B82AC0AA5F41B84246079BC68CF1D8B4F1 morpheus
1,666,306,675 *AF5F1BCEB4D71EC6C0C59D8AF4EA64EDE398AB0D moseloecken
1,666,306,676 *AF5FFD7F181C96740617D6193157237DE88B86E5 TODASLASHERMANASDELMUNDOUSANLAMISMABOMBACHA
1,666,306,677 *AF532A89162847AB4CF6799208F13BE352F8BF65 TODMCLEISH
1,666,306,678 *AF56351F2CA7D1611B77AE78ED7BBA91FC4B4844 MOTIV D
1,666,306,679 *AF53864D3B8D6FB308E91BDFFF6952FC49F1F32E TOMASBELILES
1,666,306,680 *AF5EDB430F8A1A276283077AD88E2D31DA0B516F tommyhaaf
1,666,306,681 *AF5B944DB247FCC9BA55EE95C4923F9623FEEF60 TOMNJERRY
1,666,306,682 *AF53A581D5B3632BE6A69ACD3A185D128A8B664B MULTIPLIKATORENFORTBILDUNGEN
1,666,306,683 *AF5D60E5003336595408C877DF7FDD974D1A1E10 TOSCANOPALACIOS
1,666,306,684 *AF5F1388DA3F957F81090D2792D190D0A56AB8FC mustuluk3
1,666,306,685 *AF50FA4E4E3B0A4A08801063BF700A1800B8DCDB TOWMBLE4
1,666,306,686 *AF53D4D09DF59F05A2946E567E872D3F64EC2640 mygaby7
1,666,306,687 *AF5886AF480B526048193699814497E39230180D [email protected]
1,666,306,688 *AF53F302810573545FFE951233BCE43519CC3BF8 MА́ТЕРНЫЙ
1,666,306,689 *AF5D37CFF8B918EFC30DA698F9FBAD5AB5B092DA TRESIA-KARLOS
1,666,306,690 *AF502EE8139FD8AF46800C1BFD4E33CA8D92FA1F TREYDENNY
1,666,306,691 *AF5C9B93743D0713C830180130BEF22AA4185CDF triradially
1,666,306,692 *AF5FF542691AF80A86675AF9B4CDCC96CC88182F NEALRODGER
1,666,306,693 *AF5CB524EDA0EBD093F7AB20C38F1EEDC9C02BCE TROMBONCRIOLLO
1,666,306,694 *AF50F8669C75DA3B7C4ED24154C98DFCDEDED9D6 TROY.REBELL
1,666,306,695 *AF502E227D51CC278E02D44CEA4331429F590669 neomi-dov
1,666,306,696 *AF572C20BB887B5DFD34FC119AD054D33EDCB743 nestorschuele
1,666,306,697 *AF5944EA0B30D2B3FE77B714D18D605DA49C2871 TUOITUJA3
1,666,306,698 *AF5BE4BD608B549A6F47C980D262555A917DAC63 tyronfague
1,666,306,699 *AF5FC61CBFC932FA1BC155739CE29A6AD22A8674 NightCafeRain
1,666,306,700 *AF5A9C7BDF2AEC9604123F5D2E275712B522E026 U221136
1,666,306,701 *AF512ECFCB273FE0416920F199C486322477B86D [email protected]
1,666,306,702 *AF5AF8B47A6F0B014CCAACDF87DB58D050FF6EA4 UDT(
1,666,306,703 *AF572B3C46B4716FEB31B47B502DD1E399FA65B8 uentrop4
1,666,306,704 *AF50D263A5650EB811751DDC88F63E848A732D69 [email protected]
1,666,306,705 *AF5626B94F35BA449EA398D89F1A54966B019B7E noeunzueta
1,666,306,706 *AF579B4ED897A7CD2EC2D0F3065613BC3ED519C7 nomad974
1,666,306,707 *AF5DF96AB01D861AB94D9B56A14D45CC5229E2A2 nonadoptable2
1,666,306,708 *AF56C88B8A04639FD357E405BCABC1F9CA4FD5D8 NORGES MELODIER, EG 133 NO 36: EG GJ
1,666,306,709 *AF53902AD04FA9A0A42172FC087D224D88F536AB umire ljubav svjetlana
1,666,306,710 *AF5412F6E2366A9EA45C4791CF55DE2B8F9402F7 UNPERTAININGA0
1,666,306,711 *AF5DD875082DC9DC3BE3C28F2501E7BD1BF3BE03 }o{ 0~ <---3
1,666,306,712 *AF55740AC09B6651B0DC09770189C30FD0BD3C3F obliaron8
1,666,306,713 *AF552019C5CC466ED3472295284F09B2A18CAB68 OMARFAKHRO
1,666,306,714 *AF51527A5A35E97FDEC1E92AFD08E9FE719A302B [email protected]
1,666,306,715 *AF554B21BFB90C062A6864CF0E640E5B8AB9F18D otelulgalatiro
1,666,306,716 *AF59226A2C702B27231D708D23220477C0303580 USTUNLUK7
1,666,306,717 *AF532DBE7A752BF1C6D48ED81A6375A3F0F4C542 UTEXTUNNELRU.SVG
1,666,306,718 *AF5A29890480E21917F711C6AD79D5AB0974EBDE UTFÖRLIG
1,666,306,719 *AF5F47EED0C5C188889A59337A07F8CAA5824226 PARTHENON,1
1,666,306,720 *AF543E49674A3E60DC9B221653A8A2F092BA760A VANESSA.RUBINSTEIN
1,666,306,721 *AF54E461CFDB1B0F55B30CECEB00E16A3967B859 pat.zenner
1,666,306,722 *AF558362F9230D22D6EBAC28FD5C1708D394D2BE PEMMALP
1,666,306,723 *AF560D16AACD3B53CE087B24AE9FEBEDFA19E7D7 PEN2
1,666,306,724 *AF5305DC29280F0D3D18223F9F04E1378CC34DE2 verbascumphlomoides
1,666,306,725 *AF55B279984E53E1257F392F1A4A87DF3DE9BEDE VERNETHERRON
1,666,306,726 *AF597822AD922CBFC18D0E4E3ACC1F95E6382C41 VIDE-ADEDAYO
1,666,306,727 *AF556FF8FC9FDDDBBBA21B5146C2F1F0DFFDCEB3 VIDEOWER8
1,666,306,728 *AF50D46B147F1EE8C37D65F111B39CA7ED65B6CD [email protected]
1,666,306,729 *AF5309ED6C8C540731ADE71666525C69472A8ECE vinod.r.sherring
1,666,306,730 *AF5DF588F1C1F46DC8E19A8498ECA914014AE3D0 PERAGAMING
1,666,306,731 *AF575F197FAB736B53FDB3B6C65F92306985C6AD pezeshkus
1,666,306,732 *AF52F5845A6335116B2F9EFEB7A3C2D9BB9DDEB1 VORHOFEN7
1,666,306,733 *AF518C613B55A24A5EB8A842B1104000A109CBC4 [email protected]
1,666,306,734 *AF51F461CED0C691297AD65876C8901B72F846B8 WAQAS.SEATHI
1,666,306,735 *AF51FF1F85C2730145EAE6BC0F8DDFE22A18CF1F War-Wit-Us-(feat.-La'-Chat)
1,666,306,736 *AF5F86AB0FB8EB83B5FA4473494BF26F7776797D WD:{
1,666,306,737 *AF5A6CC1ACB9FCB84D05E9211B5B574AA87755CD PHY AUNG
1,666,306,738 *AF5B60B277609CE19E24B18EE7B3916773F45CCE WEAP-CON
1,666,306,739 *AF57B815201C3B3626C55907722CED9AC2FB2B3C WELDON.RACHELS
1,666,306,740 *AF5896E8F267A5F44BD90A1BF877B8777FEF7D1B WELLYLALA
1,666,306,741 *AF579ED65C70B8CFF2BAB51D09CB595E1727C349 WENDI-SIMEONE
1,666,306,742 *AF5F5AFCFD5870F7263655859201DA547987F8FF [email protected]
1,666,306,743 *AF5BD0ECFA6F27FC23DE206AFE24FCAAB9ECBA0F POGWIZDŮW
1,666,306,744 *AF5A2D611D8142F6BAC9D28F8C21966B0783B436 PÕHIMÕTTENA
1,666,306,745 *AF537C9292596C6809246EA95C2BA4A2A3AC026C POLELLA
1,666,306,746 *AF51F9D7AE4D5E0ED4825B23A8B79F666ED4BD9D P->~O ~O SPLAT
1,666,306,747 *AF5646F902F60B2C8E73F37F8D2E9B3540ADD6FC [email protected]
1,666,306,748 *AF50B52BC86D9162D710D6A9701EC4E91F354578 PPLE03
1,666,306,749 *AF5207137CE2EF6DD4ECD0503EC08206F72A9FC9 PR91QZW
1,666,306,750 *AF59A3F294432F19E158E99CC0403CC8F68912B8 WILLIE.CAMPEAU
1,666,306,751 *AF5B7AE44CE68136705991616B8428E46BC5226C WILL.KESTERSON
1,666,306,752 *AF5C383ADCBA700BAE5AEE5D2D48A7DED22B85C7 WILLNOKKEN
1,666,306,753 *AF5DADA6335A282D7640502B71187765BE5BAFE4 [email protected]
1,666,306,754 *AF55E7BDE257AEE07EA119E0406D0CFC0BA6B9D1 WILSONROGERSJR
1,666,306,755 *AF527338A783B62FECD96053D92D80DE9EDBF2CA Q4'T
1,666,306,756 *AF5F7D05BF457D754098721F6D18E12B0E0C4F5A QDRIIIPE57
1,666,306,757 *AF59B3871FEFC2444B51AA3A58C908CF69ED11EA [email protected]
1,666,306,758 *AF54903581B3A1FF196EB48F56047E300BE1E810 Q----->* SPLAT!
1,666,306,759 *AF54C7FA1AC217C627B8BAB2DBBEC10A43FA6BE5 QWWHV7GSORU
1,666,306,760 *AF5500A7164A8E3F5D5989556A216FBE3965C8AC R1UX
1,666,306,761 *AF50DDCEC36E988A4289CA560970595D771838FF RACH GO
1,666,306,762 *AF5F06CCE3CDED160B67825BDC210D4635AAA5F6 RADIOAKTIVARAKER.COM
1,666,306,763 *AF528D222F8CD0E717C4BAF50F15E49BA8DA6B41 Radio-Mary
1,666,306,764 *AF5D8FE44E70ABB4DBFE24D759282CF7D06C8774 WWWTECNUNESASIGNAT
1,666,306,765 *AF5FC6DDFF32A6BF6622FA165C033D725B69D42F WWW.US-MISSION.CH
1,666,306,766 *AF587929DD019BA2D12D68FC4AD0DF7222E46A26 WWW.WE06.UGENT.BE
1,666,306,767 *AF5774644D8655AAE103BD084D199F4CBED182D9 rapture(feat.terryhall)(originalradiomix)
1,666,306,768 *AF5C81F7B59CDD56B4DAE4F672F412316D0E2EB7 XFILESCLASS5
1,666,306,769 *AF5092DD0DDE24A2D414CE4687B24842B842295A [email protected]
1,666,306,770 *AF53252A8C8349D5DBFD333BC69D31DDF5A738E4 [email protected]!1!n9
1,666,306,771 *AF5DAD11F53F99A56CACE76E77AF787ED971259F refugiosalonia
1,666,306,772 *AF55EABF4EDD692B26122C934380C21FE08F5813 [email protected]
1,666,306,773 *AF5A1D09E736B7F1DCB385B12879E8534BCBF609 [email protected]
1,666,306,774 *AF562F9A6D93F985683DECB7C290978EA866B022 reimprin3
1,666,306,775 *AF56F4544011A4F386F7AAF5799D07089950DBE7 REKAMESIONED
1,666,306,776 *AF56111C6801C9CD6090C58EAD10F683002E0364 [email protected]
1,666,306,777 *AF5906FE2CBCC74E9B6355DC6E06631E5565E608 rembrücker
1,666,306,778 *AF51F51E6F1E0D00DC6EC2BC784BF898B153585F yenrinilzawati
1,666,306,779 *AF52CBB5973AFD2AE9FE059162BB2D99B4431A51 YEYA-RAMIREZ
1,666,306,780 *AF57CA3FEE83BA6BEDE75AA53FAC956647BC0B39 RERUONOHING
1,666,306,781 *AF5AE56F7B1F5265553BC272F302B526B520694E RESUKENGISSN7
1,666,306,782 *AF5EC3832AFC3223FBC95F5AE6B74F5BE68EE718 ReverieOp49No3
1,666,306,783 *AF5D994E12E72B24647F4CFA24A215B1CE7492AE YRITTAEISITTE0
1,666,306,784 *AF56E075DD8AD98E0E07E6752297018795C726DE rickysoboleski
1,666,306,785 *AF5BA3B66D089D0C3BB726F37DF65E8EB0DE9E68 RIGOBERTO.PESHLAKAI
1,666,306,786 *AF52B08C082F4836E68347B3C691FEB3A2EC4A70 RIIHINII4
1,666,306,787 *AF55C06F0F2475870BBE2CC89662DCD51BF2C1BA RILEYBOOTHMAN
1,666,306,788 *AF593AFA6A3713076ED9FE2F950D29AADF04ED2F rk]y
1,666,306,789 *AF58540638CEFA2D6A30631F2E6365580466035C ROBERTOENINDIANA
1,666,306,790 *AF5074DFA5901DAC6467613E329C75B6E1EEBF3B ROBTHUMENIUK
1,666,306,791 *AF5584DB24B5CCE6302C505AB4729935E599A9EF RockYoHips(featLil'Scrappy)(acappella)
1,666,306,792 *AF586A8C2ABBD926230647EBC5ED1A4234DD29C9 ZALIJALOZ
1,666,306,793 *AF5EACAC88DA6E5687A8876F76C957DC8C18CBA7 RODRIGO.LEPETICH
1,666,306,794 *AF5FCBDE40FB38DAE6D8630A3D4BB006D569D092 ZARUL-ZUBIR
1,666,306,795 *AF5ABA95508A4C9C39DB4C272C6EC1479C319F14 ROGER.MUCKEY
1,666,306,796 *AF581A44837BC59575924E735ECD35B78B78B511 ROL3'S
1,666,306,797 *AF503278998AE17C331C35B145D6A0916BD8F5A6 [email protected]
1,666,306,798 *AF5A7C6D992DF666150ACFA3C183E560B2D58C69 [email protected]
1,666,306,799 *AF560B88A0C7AF6D58034304A97B2C4CC2D6E7BD ZHAO_JUESU
1,666,306,800 *AF5346D72836D2830BF87ED146C63E9B5E4F9514 ZHHX
1,666,306,801 *AF590297D3973123CDDE475EDC53AFAD2F15B678 [email protected]
1,666,306,802 *AF59BB033D359A2B9F26282B6153BFC32610B366 ruebenstokan
1,666,306,803 *AF53BB8A7ABAD5759F349621FE1E0060018AC31D runaway.(feat..georgie.dennis)
1,666,306,804 *AF5889EE9D42CC90ED331AC4A5C0A1E9BBC9739E russelloblow
1,666,306,805 *AF5735B05B83EC279611984732417F875FBE8029 [email protected]
1,666,306,806 *AF5C12E1DA4F2CBE3A569630C582B3C86F47435C RWSIBHFWYFS
1,666,306,807 *AF541435FE9B31E2B0287D9F29DABE67EF809B4B SAILESHMEHTA
1,666,306,808 *AF50B74411B9A2DB8B48A99BC09E3C7EFDB7ADE2 samuel-harman
1,666,306,809 *AF52FABCD0128C9B1D530BDAFD08AA0B1B4742FE SANDEEP BEHAL
1,666,306,810 *AF571E8EF6101338A6162AE65021EDEC29EC18F5 SANTOL
1,666,306,811 *AF5B974CE1DE824D89BAF6F52325DEA5902F6946 sara.caines
1,666,306,812 *AF5786FB92A273F6FDCC7EFBF6FD48F126FEFCFE SARMINI7
1,666,306,813 *AF552102A5FD164627E982805A5F7DE4B34C3CA5 АННУИТЕТНЫЙ
1,666,306,814 *AF5D7208C69E7B30B0773364698F463DB6DD12D1 SCORDASTE
1,666,306,815 *AF547662A5624BE2474BD599C4CC94C82F1C84E2 «МАЭСТА»
1,666,306,816 *AF53CD2F5BA5F261C73BB516870E5FD513A6793F SGEFYJTAHSU1
1,666,306,817 *AF5648BB3B499AB536369F8DA152FBC01C99A819 sghs
1,666,306,818 *AF544AC624360EC38054465EAD3838CF2F6914F2 SHANE.VULLO
1,666,306,819 *AF566463394DD9EB500F7F615EBBE69EECD1A8D2 SHEEJA-MATHAI
1,666,306,820 *AF599162FB1DC3450FC6E02887BCC33F946FD81C SHEGETSESES
1,666,306,821 *AF5A75CFE459190B3B9CA95758DBFEB5AB59D9F7 SHELDON.MANGIONE
1,666,306,822 *AF5DB95D2F4FF23A5F75894D8F5BDCAFE964122E [email protected]
1,666,306,823 *AF5F88F66829FF7183276BC835C495E18EF648F7 SHIRLEYGULBRAA
1,666,306,824 *AF5819FF1508D9AD3B500EE0EB5A62D46810E2EB SHMKXGORS
1,666,306,825 *AF5AB18D94B04EA917045E1C91DEB2040F17132C SHUHAMITES5
1,666,306,826 *AF57E618817EEFEB517FB69A4E193FE8A75D7E1C sidbrieno
1,666,306,827 *AF56D7AB4B27F305B6B3FFABCFBC8A89D7BD40C7 sie luden freund und feind ein
1,666,306,828 *AF57ED2AEECD65E05C30BAA45D1EA61756D0C689 SJWALLTALKGUNNAR
1,666,306,829 *AF5AE9BEB8726A11FDDC5A1F17D6E0CC087FFF6A SKOMAGERIER0
1,666,306,830 *AF58955C6D50D409AE326B59E7E543F398ACE9F8 SLALITHASWATHI
1,666,306,831 *AF5BFBBEDF871345D443AABEEC937274755A4B93 《扬州时报》b1版
1,666,306,832 *AF5B370C8F0C667DBBFAB2D7901C2267C38FC6F8 SNOINNOISSERPMI0
1,666,306,833 *AF5D4C98035C40F37A9E45A56AC7446DA2452900 SNOOPYSCHOOL2
1,666,306,834 *AF51470F34AC2E03707A77D05A5C831DDF3A94E3 SOLOMONSHARRETT
1,666,306,835 *AF56A1D8FE1D79659A3E0DAF67B76C6E3E29CCBA soniabisht
1,666,306,836 *AF58B2BB8102C7429470FB46E2890286F5259E53 組件編程接口,一個應用程序就可以輕鬆地集成KPART
1,666,306,837 *AF5F576D419A587892336AA6BAE99DE09871303F SPENCERRAISTLINS
1,666,306,838 *AF5187289BE570711A6E185C2C8B63B35426767F SPERAMUS1234
1,666,306,839 *AF5E50A7661951D64F8628AF610C03AE352E6017 SPIEWANA
1,666,306,840 *AF5BAE538D06651DA85A780867897E11FA506273 stanforddusenbury
1,666,306,841 *AF5A5B0C5E8D9801E0E233940B9B2ABA09B2259E stanfordwinborn
1,666,306,842 *AF5D4B1047435E2907F9C70BE0221706DF069452 stanlaban
1,666,306,843 *AF525EEF82DC022EC522CDE542182E906A3E418C stefie3204
1,666,306,844 *AF5879CAA72984E439887864437E4FECD79A1A2C STEVEHOLTZEN
1,666,306,845 *AF5F2795597B6509880EBDDDF0E98FC87EBACE62 stevenkrishnamurthy
1,666,306,846 *AF5087F4A92C52022D698FA413ABC92A9A3A4217 sthginkdor
1,666,306,847 *AF52E897A77F60DD0DC4153320C6A341BA5650FE [email protected]
1,666,306,848 *AF5300228A5EF128F14BA54E5E88392A601804DE 05281454
1,666,306,849 *AF5308FC2563EC56A207E08D61D2DAEB4935D4B0 SUMIMASE2
1,666,306,850 *AF53E716EB8077B0BAE5DA4B4C7437D2FEE13A0C 08BERNSTEIN
1,666,306,851 *AF5A9967E779709EFE0791855E8935E5539EDF8D SUNGBALIN
1,666,306,852 *AF5152F8408DB606709E61F212D5A7C7DC0221AA (>_<).0~qB
1,666,306,853 *AF595D7E3E83858E37AB43A513BE02732E2F200E 1111395
1,666,306,854 *AF56C8124954BD443DF95F7B670A7D374D843284 1164371 NICHTS HOEREN , NICHTS SEHEN , MOEGLICHST WENIG SAGEN .
1,666,306,855 *AF5C07641A965DDA60E2D033CD9BB5D455051B7E [email protected]
1,666,306,856 *AF5D82BE3B537CCC4CD3961DA80EDC154227D711 SUSANNERICH
1,666,306,857 *AF5E60E18B359EDF64701645FA83BC66EB0DFEAD 12345FROSTY
1,666,306,858 *AF50DA29173F95B8F370E4248D51F071B09496D7 14031702
1,666,306,859 *AF512094E8936A8E5CABE08F58DE5C0A6713F78F 157.rehtorit
1,666,306,860 *AF5B5AF816B51C98B7064CA0C030757D4373986D tabuh-tabuhan:iinocturne
1,666,306,861 *AF56007D8D27075CA17973AB5B035C7F29ADF4F5 1 AKCANIN
1,666,306,862 *AF596FAE1075E28803DEDD90841A53D50629E38D [email protected]
1,666,306,863 *AF59C387190B6EE4E049558BEDD5FD2375216907 TANNERSALAY
1,666,306,864 *AF5543F390AB661FC654A1BC6B52D4B1DA89826F 1BVH-DOMAENE
1,666,306,865 *AF5DA50C1DC6EB77DF5954F38D3388A531DB3E0B taraa-herrin
1,666,306,866 *AF567F1438F2210908C2DC94DBE3F8A76C695CFA TARGETSUNBIRD3
1,666,306,867 *AF540BF99BFFCE21F722FE7B5876A357D82FB717 taryn392
1,666,306,868 *AF54E142A6888C8EFE01AC927CF873400FFDAF2A 1.film-park-projekts
1,666,306,869 *AF57C7280E1391ED0FD433FD4704431F80B1BECD TEQUILABLUE8
1,666,306,870 *AF5977EA213457DBBBB5E2CCC60F7546B0679B77 1 KATTOASIOISSASI
1,666,306,871 *AF5D65246EB21D5E6573CB2961AE78968C95ECCF 1kausystems
1,666,306,872 *AF569709DF975A534715596CA86FED95250C24DB 1.kiharine
1,666,306,873 *AF52F1AEBA01D6E485F68A3D7D3B59AFDDC00527 TERESA SWEAT
1,666,306,874 *AF516DC2676005C69F42110A4CD2CB14F42A77CB TERINGAGTIGGED
1,666,306,875 *AF5DA7ABD53079895BAAD1399D0355410B1ADB66 terrancebolman
1,666,306,876 *AF50F6E7C886E753CA379BD1F6D56B135E7C883B THALAMI
1,666,306,877 *AF5377427F174F19E88D152B7B56B4C0690D5A50 thankhuls
1,666,306,878 *AF511450E7E8E0C3CF86C9AFD676E6934280CC38 1 opernparis
1,666,306,879 *AF5459BADF388D1AC8FC769D796FCF5B5EA245B4 THATKINGFISHQWER
1,666,306,880 *AF572D29B33752E8837E8B9DA64FA7A62755BDFC THATRICHARDS1993
1,666,306,881 *AF5A10BA87BD5CBA25F0A658186B4978F565D244 theinternationalroom
1,666,306,882 *AF5DFA69CD9F103A9185AE402AAC7BF0885289DF THENICARAO34
1,666,306,883 *AF5837197CEB5B616E718B6BF1A85B519CFAA875 the partita no.3, in e major gavotte en rondeaux
1,666,306,884 *AF5FF6BC5F27D05FDEF36BA5904C9BA4723F17A4 THE.REASON.(AIRWAVES.VERSION)
1,666,306,885 *AF534932FB234EEEB2D33C697FEC82D7BE974674 1 WEFENSLEBEN
1,666,306,886 *AF58F9E49C663364CD672D0EA11CE22B9FC91CB4 1 YKSIL
1,666,306,887 *AF588796DDDBFBFB4D09A5C228E1EDD806FD782B 2034846 " IT'S EASY TO TAKE 50 VOTES AND STOP SOMETHING .
1,666,306,888 *AF5770CC2809FB31FF7568B17536F8E0E4728222 [tia][gracy]
1,666,306,889 *AF55FE32C1BF3D5043E91E1CC02D072E6B6823DC 22AUGUST1599
1,666,306,890 *AF55B8B378AF386ED04A5CF9D0F78B0DCC6DF761 2368627 esgehtdarum,dassdiekassendasgeldgeben
1,666,306,891 *AF52FBD99DB0F081DD12AB772296BD69E665259B 24april1505
1,666,306,892 *AF5AF67B3BB665538BD70388F0E5C6DEAEC22DDE 2781680 ohjelmaan osallistuvilla oma osasto , jossa keitti
1,666,306,893 *AF5D56A906C5CEEFE24E1B88B1899E935D662DB2 [email protected]@rer
1,666,306,894 *AF54EE4165FAC15FDD6D8079614894A7B832F326 TOGAWISE5
1,666,306,895 *AF52DEE9D36ACC3FB04936860B3E679BBC8E4440 tomasandras
1,666,306,896 *AF5736643EB2C61840F384726225DD2F30AC1F8C TOMMIEMOYLER
1,666,306,897 *AF532322C2B83BEACBAB91554214E9B75B4F4DF8 TOMMYBANDCASTRO0
1,666,306,898 *AF59B9B6B6A07C4F850C48574AB49AA06C5D1C40 2.kaveriporukkana
1,666,306,899 *AF5B868359F55F3FF0840F99350710E6F6BCA314 TORNEOVERANOCHILE
1,666,306,900 *AF57688590C376B9B500B8803A90B0D97FF29310 2LINGYEN
1,666,306,901 *AF524ED7921349EF5E1B0A10DEC22536227826E2 [email protected]
1,666,306,902 *AF5460C23B8A155E6FC6298AC8D88F0EC090237E 2pelottavastakin
1,666,306,903 *AF50FF6E2C9ED2097AAAC12CBF56DA4C83BC2A7E 2 pferdestrassenbahn
1,666,306,904 *AF5AB4AAD42637790933BB75C92C7988BA88C0FD 2.SIILINKARISTA
1,666,306,905 *AF51F947957641D9669BC88642BE3A8118B69306 TRANSLATEDSEE
1,666,306,906 *AF5A5BA8200B9F91422D079C9C8BDF352A4E6629 TRCHPHYTN9
1,666,306,907 *AF5588039956863B7F97EEF452895D84CB3B1B55 trebornamnit
1,666,306,908 *AF5FCBDD3FAE689E4DD9A0368C3CBAB65DCEE36F $31FC0MM4
1,666,306,909 *AF5C06C73338EDC4AB1615A59D9416AFBDCE65F9 333587q
1,666,306,910 *AF53720AD4C40AD165AD639AEBE2CFBF7489D425 TREYGUNNACAPERS
1,666,306,911 *AF5863AAFFBB6E1C5300B08295B2FE4005B1DF4B TRINHTHUYMAITRAN
1,666,306,912 *AF5C83D793ADC39C87BD4395EE2D6C9A26F21D41 TRISHAKERSCOLLEY
1,666,306,913 *AF5F56FF9BC281E45962EB6C7DF6BC9C4EDF4B3C 3BUREKER
1,666,306,914 *AF5889EC6E9D7E5F85AB92CE73DA180769825870 3-D~0-~o;)
1,666,306,915 *AF548E683EA2F86F3FACC8FA1A12864080B73096 TRIXX KHAR
1,666,306,916 *AF5E476DF41A9CC1397DC8DDB6F94D0069028FF5 3ILOVEGRIZZLY
1,666,306,917 *AF5C420C073A9D9BF37CE634CCA44CEE6496A7D2 3NEIGESES
1,666,306,918 *AF5C66757FA1B1000FBCEBE715BE8C093FAB253B 3--).~O}8{
1,666,306,919 *AF50276ECE127046736EFE554BD91231C18133B7 3======p~-~-~-splat
1,666,306,920 *AF580707AEF857B20B10E7639629CB4B85DE3A18 twolightbbs
1,666,306,921 *AF55C15CCB9C2D0458380D0FE3758012DE50C18B 484-adamI
1,666,306,922 *AF5DF3056F52A47DFA1E98E23317F909D5D7BD09 4.asiantuntijarekisterist
1,666,306,923 *AF565DEE8D39FC13AAC0A76D9DD0E560C9E6C3B2 tyreecullom
1,666,306,924 *AF5D6513FBAAAC0177500B11C18C6AE42D5982F0 TYRONDITURI
1,666,306,925 *AF5E4CA767759CF2D71FC5458DBB1F7D9214399B 4CHARBRIER
1,666,306,926 *AF51BE5C16221180FA40A236FCEE34BEBF020EBE tyronyeoman
1,666,306,927 *AF5D8D44DA37D5F6EB66488760B470B1F318FE2F 4DSRGNST
1,666,306,928 *AF59C7AF2B94862FF47F393BBF62778F601A39B8 uhhserap
1,666,306,929 *AF5CFED9CB03B3CE8447104B0B7DE43032C1CFC9 4PAASTIGNING
1,666,306,930 *AF5C165034644BE9770C0D20B9D4023921B90FAD 4RROJLOI4M
1,666,306,931 *AF5B9664D5A5CB3CFCC868F5020DD1F0988B7289 565TAMPERELAISEN
1,666,306,932 *AF57D8F22896B745FB3F682C1FF12DA2AA025474 UKOIKUYS8
1,666,306,933 *AF5D60915F1EE618E6D0CA5F3F78CAB2571707FA UMIE DESILVA
1,666,306,934 *AF5AA5EB56D19A31D294676344900490762F95D6 unannoyi2
1,666,306,935 *AF506CFB2C2D8CAE60A4AA8B199E6AA91EF1ADE7 5ILOVEHALLOWEEN7
1,666,306,936 *AF5E6230C1FD823F8DB48B0673CA1EA133A01557 UPORZADKOWANIE7
1,666,306,937 *AF51D1B0D79C8FECE3B2AB05E65580E425BB0FE9 urol!+h
1,666,306,938 *AF5C271F3FCBB30B4C796D6CFE7A572FEC81D6E8 5MOCYENRUOJDLAREMEASUKESRITANIT
1,666,306,939 *AF5DFD858D76A9BB11911EFDE5789238E28F1961 5RESISTEVANO
1,666,306,940 *AF55A4F0CDEE5D9FE5812D401128F181406F6AA7 5SVAKODNEVNICE
1,666,306,941 *AF54A094C26DCF2CB099257A457BBFCF5F5D7421 5TAURUSBUFFALO
1,666,306,942 *AF53260758AB4B28486805BDBF99BA8395CCBD86 uzmaninin
1,666,306,943 *AF5D715FD25EF904B31D7B1ECE8849AB1E301A18 6ACOBARDAMIENTO
1,666,306,944 *AF55485933412D2A54EF2D6DFB358AC4DA3689BE 6ADUNANZE
1,666,306,945 *AF5A3DBEB5BFAFCA3B923464F3728B63649D2037 VAN.GRADEL
1,666,306,946 *AF56FCBB30D411FA623416CFB82213274D7E49A2 6ETACIFITREC
1,666,306,947 *AF5462D88C94D9AAF7A91556458E1A284428714E 6FILAMENTARY
1,666,306,948 *AF578803520FE99FB47BAED9E967293D84BD3DA8 6RONALDVISA
1,666,306,949 *AF533F0BAEE9403ABEA8AA056CE0A6F54631C25D 6SHADOWSR
1,666,306,950 *AF5550E79ED87C421DA72C8926686A8C6D2AAEC7 6VASTAANOTTAMISTA
1,666,306,951 *AF509EE0BDFD70A3F600D66371BBF5C09E8EF4A8 6vistare
1,666,306,952 *AF5EDA2D4D61DC26740CDD5D29B40C632AEF0F34 victimas.del.bussiness
1,666,306,953 *AF5269BD00741C0EA1F800C4B7A9FC5D6EAE8823 VICTORSAVAGEAU
1,666,306,954 *AF570DC18295119606F937DB680ABE33122D1EA9 VIDEOJUEGOS-RENAI
1,666,306,955 *AF57D836E47546B50A3E8BE1F7FC3FA109EB92AE vinamre.dhar
1,666,306,956 *AF5A6E666ACE76500E9BFACD2C8B4F4026DD0B60 VINCENT.THEODORE.HATRICK
1,666,306,957 *AF57818F758A8B9FF54287A6BA3CD478E3F42D5B 7COWBOYGOLDIE
1,666,306,958 *AF5507597E7B3862665FFBBE565AA2C427B0C1AB virgiliodescombes
1,666,306,959 *AF53766AAE1F14864E874CACEEFB729CD6C268A8 7iluvandrea
1,666,306,960 *AF554725C372CAEC16AE1E13DC715282EB88BE1D VI VIE MAHARANI
1,666,306,961 *AF5285FC3FF8C074F648E6D4DF88C8C2043BFAEA VLADIMIR-ETIGIN
1,666,306,962 *AF5DA2EE80F32502C45E537677609AAA526DAB68 v$m
1,666,306,963 *AF5B6F4D43A1ACE2617E978D16A506E648A5BA5F 7ROSESGOALIE
1,666,306,964 *AF5EE9E222BEED55D527CA561AFFB34339D936FE VOORTMAAK
1,666,306,965 *AF5C8AEBF29CF6B8CA6E4AD78C616F056AF671E8 7TODISTUKSESSA
1,666,306,966 *AF5248337AE3E3A40AD42A70650CDC4BE3656C1F vrushaliparanjape
1,666,306,967 *AF5D9500AACD28A48C21BB063DCE30D65E718744 V$UALZER
1,666,306,968 *AF50AE70F03CAA008766162FCCDED026B1FF6F50 W272129483
1,666,306,969 *AF5913801944B8A9F0A7E14440A010553E67F253 w33d3r
1,666,306,970 *AF50F0D1EF188589C85437D87486BBC064735D8E WARDEDLING
1,666,306,971 *AF539A50D191C95B4D22787D7161F39347975A3D wayel.alwayel
1,666,306,972 *AF51427AF1AF4C2E16A4B9F3C2D91AEDDFFCBE93 we;
1,666,306,973 *AF5C82E76BB85B421FBCD69A91C576EB164D73D3 WENDI.KAPANYKO.JOHNSON
1,666,306,974 *AF5D249BE03FB59F5A1E7BB51E1396AC67298B3C WENDYKISH
1,666,306,975 *AF58ED29E468819E9C7D11E1CB92D5BB57BAEE37 }8{-~-~-~-<----B
1,666,306,976 *AF500E9EBA48BF6016A243AA18B5E031BE7A0B50 WHICH NOW BEAR EVIDENCE AGAINST MY SOUL,
1,666,306,977 *AF56D29533064D70B030983AA389D7ED339D6889 8####b-~o(>_<)
1,666,306,978 *AF5F7790658F4C5892B2C0DD07F4E96AF84DD23A 8#B* SPLAT
1,666,306,979 *AF5D6E20935D7A6771C23E18982AE5DED3D703DB WIEDAHAYNES
1,666,306,980 *AF528E9198F6E651789277EAAF7996419B641BEF WILFREDO.HONEYSUCKER
1,666,306,981 *AF5EE6973C8660827BAD097CD9BDA2344B74C327 WILFREDO.RISPER
1,666,306,982 *AF5B14092ED2A997912947A7580E40B5014DBF7A will.hudgins
1,666,306,983 *AF5A0F6FDA5AD02DBB5820B3E2F88B5390DAA473 8IAMRATIO7
1,666,306,984 *AF5B3F247C3D048B0D90AB23F3F224C17AB5A701 8-----p *(o_-)
1,666,306,985 *AF533B4057B4032081912F5A01F80ECD8E40CB7A 8ROGERSVILLEBSW
1,666,306,986 *AF57C4618974F8E68691CB6D4BC1E38C89E771D3 [email protected]$
1,666,306,987 *AF5FC930036F2FCA63C5672482790A34F5BE6830 904374 but five months later , mr toshiya died unexpectedly
1,666,306,988 *AF5CFCCEA4C51419E8EECC5C4C8EB92949D643E7 90LONDYN
1,666,306,989 *AF5CB50C5BD26128A7A0F8A911D7BAC484DDCEAB 9ANTEELLA
1,666,306,990 *AF5DFA4F6A36FF72E06C535653AED1C602449897 wreckeds6
1,666,306,991 *AF5B44F0F26BCEABAA5ECF86F52D176489D62E71 WV2}
1,666,306,992 *AF5C6169989639610C7315BD7E4E9C1E73049C15 wwwentretempsassofr
1,666,306,993 *AF5EF958D3672F71C5E88645FCDC649B3A0D2B2C 9HERSHEYDAVID
1,666,306,994 *AF591F530063D5A3856AAB2F01143A0CF788DCE2 WWW.MIDWESTFIDUCIARY.COM
1,666,306,995 *AF5C25FA492BEF7C6741536798BB038B34E9485B 9iluvbluefish5
1,666,306,996 *AF5DE07EAA3C820474B9E7CAB332EF2C2ED85770 WWW.RAWFAMILY.COM
1,666,306,997 *AF56A305640DF0AE57855F75C9014E375FDE3D2D WWW.SHELLHORIZONS.COM
1,666,306,998 *AF54CDC7F15A0D80B36BEA2162B6078F7CD52761 WWW.STERNO.COM
1,666,306,999 *AF5D4D2DEB9EB8C3CC32EB12AA52C7AF7031EE34 wwwusjescocom
1,666,307,000 *AF52A96F1BC993FBB92AA882E2F6C42ABED93CFE 9KYMAINOMENE
1,666,307,001 *AF57B2E0925138CF389E0C05DDC090E754C5AB14 wx3
1,666,307,002 *AF52F4F0B8B4D4EF8780515A727D531C3C12D563 9mostness
1,666,307,003 *AF5A0072FCB1E27270145E270A456A7AED250D6B xbigfoot
1,666,307,004 *AF59F65E790612814BE411C11723CBB6F558B379 [email protected]
1,666,307,005 *AF51FBB2DBBB6EE41D57BE27835F3342493581A8 XJUTILBSW1
1,666,307,006 *AF57F087129895D0516CDAF39883E2A53616421C XMACPSBSW4
1,666,307,007 *AF52CAAC91B93395C3CC5F68AE15DF6B0F8B4780 a0ez!
1,666,307,008 *AF58FE8A6D3453E5B93573628C4F985DCE07E811 xujingbei
1,666,307,009 *AF5B8C1C82A8DE70364BE2684661AF1A6C63B02D [email protected]
1,666,307,010 *AF528C8631A09BEC86CC817011EB36EB2854B699 [email protected]
1,666,307,011 *AF58D17C8481ED427EA091EAE0B2272354CBA01C YASMIN.MAPUA.TANG
1,666,307,012 *AF54FAE87F06A9F0855F840D9F322AE83BE96C67 a7dn2sdju0ok
1,666,307,013 *AF57B98017AC8B09EC24EBAB4E02C0E261DD8F4B AAAFOREST0
1,666,307,014 *AF5035D0A93F422ED4F9B87B1150F9020C7F4F1A yorlelpj
1,666,307,015 *AF5DC9CB3C0BC9B85ED595682F5C65F192BC0C28 yuetmui's
1,666,307,016 *AF5581BFAB206E2C7C360067B45BC6B0A394F066 ZACKARY.SCHNARR
1,666,307,017 *AF5EEDE9A8B3EBA2FFC201A770DC4082D161472B aa(p:
1,666,307,018 *AF5C0B0337A2323D28729ECD7D18483D1AFA2DAC zc0a
1,666,307,019 *AF5E492AB49DDFA1ABD153710D8BD6D2AE20DA1D abortion
1,666,307,020 *AF5877503A14800FEDAF4D123C640F0379B47880 ac3l%
1,666,307,021 *AF58751295431B0B7E8B71EB86C70343BD12E346 [email protected]
1,666,307,022 *AF5E2D78462D234EFFC400238BB4F9AD475786A5 ZIELA-JASMI
1,666,307,023 *AF5DA9E69651C474A05D00BBC2F7EE20F1BB8F7F ZITRONENMELISSE0
1,666,307,024 *AF55D2CFF71F902FC9B58B2455D591A8190205FA acga1
1,666,307,025 *AF59B2E8C93F1388D7459C127CBAC9A88E1BF4CA zoltan.korosi
1,666,307,026 *AF5DA7D2B468F0E031894BC206FF60379F44FC19 ACORNICIUC
1,666,307,027 *AF5B96260E1480862816FFE51B6C8C675426FE42 act2selagiuratafede
1,666,307,028 *AF59BAEF7B658BD2B9B9B350CF78FDF6AEB8A813 adanhosford
1,666,307,029 *AF5D1A97BFCEF131A104B34644E1C3773C6BBE67 ADAPTERSTAS
1,666,307,030 *AF5DE206332633125BF08F3952D977738410A726 zx2ngg9yetjpweb3
1,666,307,031 *AF573781C2B31AFF9AFEC3C367DF0B52DFE2CD9A adp%
1,666,307,032 *AF554729CF1225B6E855608CD50B039BB61DFB1D „балканик”
1,666,307,033 *AF5DA9FF316D1E8B62C36973C230F7AE85DD04B2 AISELDANEC
1,666,307,034 *AF52C69D7B4E5183BA911E587098C995FECCA887 AJ0U#
1,666,307,035 *AF574B805D204AEB36762A80FAE94FB03DA05F01 AJW8&
1,666,307,036 *AF561EBDBF069EF65C08B88DF33ADD5C95B74C55 ALEXCOIROUSUARIOCARAQUISTA
1,666,307,037 *AF57B2406F148CB6B6B1F4B2D6D9A5CC4E967A8C ALINLUNCASU1
1,666,307,038 *AF51BF06FF6BA5AD83360455482B3BB8CD4A7691 ALLOHVITSER
1,666,307,039 *AF5DBF7E707AD7DD35DAC483C7CA7A04272A7D10 amentule4
1,666,307,040 *AF5C0CAA3ADD08F924186FB1B49EC29656D6E537 amoindrissant8
1,666,307,041 *AF52AC9A0E198340B03A58D30FFA472C36044097 ANIMAL (EXTENDED VERSION)
1,666,307,042 *AF5D336C1058FFEC9EBBA9F4EAA04408E011CE13 ANTHONY-BARBERINO
1,666,307,043 *AF5BC9412927907E72B664AF506BB818EC2A17C4 ANTIC0RN
1,666,307,044 *AF565983541F23E78EBC2FD9719B753D981489A1 ARCHIE.KABEL
1,666,307,045 *AF548E68416210169A2D8B29C893BF614D8373CF ARCHITUL
1,666,307,046 *AF532228B6EE22C1300E4E122D6891369FD56C3B ardcavan
1,666,307,047 *AF53EC3A6857BE1977BE8793A05FBE7244A53AA6 ARRON.VANDEKAMP
1,666,307,048 *AF556154AE5BF2F029DD2C8B62BC2C925DFB65B9 ARSNI
1,666,307,049 *AF58587367B453C2E1FA537BD5A1E37F56B56A8A ASIOPPEH2
1,666,307,050 *AF54ECEE1FE29D7375A5188ECC54B2DC68E80727 (0-0)-o~-o~-(--p
1,666,307,051 *AF5D51492CCE7AA60877457EF30E30E26E47119D ASP-G
1,666,307,052 *AF5A674922066103D2FD6E8FB4DFD2E25401C0A5 AT2&
1,666,307,053 *AF52D2C8E46F15484730DE6035DE4319EE4CD0BC [email protected]
1,666,307,054 *AF5A3352F799157B3EE8FF3F18FE67931BDF8862 ATTHARL
1,666,307,055 *AF58A81300D33C91E7D92177919389037EF7C60D 078790113X
1,666,307,056 *AF564E4238D73523D7F0AD495ECD2B9DAFF3DDF6 0i128mb5vv7091717a
1,666,307,057 *AF59FE0C17D0F5C561078CF56196E56F5630C7BF AuralFlush
1,666,307,058 *AF5C0E952CB1FB6FED5462FF50F064F34C4338D2 1030MANUEL
1,666,307,059 *AF54DECBFEBFE0802E05B01B3B5408A1F6663C93 “10YR
1,666,307,060 *AF53DBD070784E7FA08240D0F95AEA949D9F1A04 11-anti-recall
1,666,307,061 *AF5C4B8A49A3E01EFF92D9A6924BBCB7954B069F AUv=
1,666,307,062 *AF5D9CF0D2C34FB348709D4E1BE46A2EFB2D919E AWQ,P
1,666,307,063 *AF53D960FD6B7022D34FCAC810A3A223E5A807B3 a/y&,
1,666,307,064 *AF5710AD264C7587BDB3BB06F9AB284D9BDFE1FA a(yl5
1,666,307,065 *AF53D910BCEB5662C56CAAE56580CF646D067D48 14TTICEB
1,666,307,066 *AF5BC21FA88079320D8021830561B76AC8F84982 B#54E
1,666,307,067 *AF56BC25E25A5A85AA52DF71353377400674718D 1-accenture-tiimin
1,666,307,068 *AF5CB122A37555C0A0A09851B4B317049912FFE8 BARATUJ
1,666,307,069 *AF5C760A14487047AC899BA972B4211863A600FF BA$Y1
1,666,307,070 *AF5317DC20701A8F6AB80477F767593C76ADE121 1-everything-maker
1,666,307,071 *AF5ED797E5F2C6E553270143966BE654E1D3C06F 1.fingarette
1,666,307,072 *AF54F1B4573E89C2352B3D9DD822A7382E438BE4 Bc=D
1,666,307,073 *AF5756179CE411F14D45145AE8CD7B4B0B96E517 bd6/i
1,666,307,074 *AF5817CEC511B72FE21CA329849DE13A5FD34865 1JUN1321
1,666,307,075 *AF5D17BAE97EE0480EEFB87138E5C147375E432C 1kissaallergia
1,666,307,076 *AF5BFE6CCB7F015E7842176BD32ADF52F5F0BD3B 1kotipaikat
1,666,307,077 *AF59B2966B70FDE1564F8C7C8A06D4721DB440C5 bedsidemanner
1,666,307,078 *AF5F45A90E6A9F4F101DBDDF7D1A5DAFD9149FA0 BEKOMMERINGEN7
1,666,307,079 *AF542CEE78F6C342701CA5ACC4309AA897064490 B(EMH
1,666,307,080 *AF5EE06E2D4FC87C1DEF3E3A36199B29D9B3FE25 BENJAMINGUERRETTE
1,666,307,081 *AF5D04FAD263F6CBF19A72E67F8E332B03620ED2 1-nichtselbstaendige
1,666,307,082 *AF5FA7DA6F1EEE178CDA28F9CE28DB5F90A33857 1-OHJAUSPARIT
1,666,307,083 *AF530C6579AE3834828E952E48B5A48E2554C128 1OPISKELULUKUKAUTENSA
1,666,307,084 *AF5B1B411C90FB6C3C327E5FB07EEF233542C9EA 1 PALKKATY
1,666,307,085 *AF5BE084C3B55B782613A277CF3770F31CF6E916 BENTNASH
1,666,307,086 *AF538E6F4FBFF643CADD4D422CC8E38F00237E35 1piirimitaliesitykset
1,666,307,087 *AF571FDEA1E8192D4BEF796B3DA72D15AEED9CEF 1.PRODUCTS-UMBRELLAS
1,666,307,088 *AF523DC709A3DCC30A41B5854627504FAC92D7C1 1.RAKENNUSVOLYYMIN
1,666,307,089 *AF5D5CAB702E5A38B3B7D14CD4FD3C0A941B671D 1.SCHOKOLADEPRODUKT
1,666,307,090 *AF509E99731572791FAB2AC2D723B3470D478484 1 SERVICES-KOHDASTA
1,666,307,091 *AF54F73F782D3FF52DB81EB7A4F53D2068F0111C 1 SICHERHEITSFOREN
1,666,307,092 *AF5C8A7227CFD02FC9E1814F01E381FFE81EFF7E 1.SSLSUOJATUT
1,666,307,093 *AF5296AEFE643CF546D81DB93E9E8892240F9C5D 1TACHTIGDUIZEND
1,666,307,094 *AF5928DD7392168DD1300A8792FDE887B2C3AF77 1 VAUDEVILLES
1,666,307,095 *AF577D6DEFD064BB4F08873E2398368B076C434C 1vorratsamphoren
1,666,307,096 *AF507E8A9888C6CF9615A19CE6AE818901F15846 1.wacker-filiale
1,666,307,097 *AF5FE0463591D530D20458A8BA7EB242177AE712 bernardevick
1,666,307,098 *AF5E88FFCDF39138AAD7AD3ED89836C33685F456 1 YKSIL
1,666,307,099 *AF5CECB0D438340FF99372F0E040A9FF51645919 200876 genelmudurtekinsengulfabrikailbeygunescad
1,666,307,100 *AF500A21B107E606AF74B96F25703EBEFE1702CA 2009td
1,666,307,101 *AF56784E1779171741AE238B181006E6A6112D50 21.RUKEYSER
1,666,307,102 *AF59B312EEBD8A11310D531BA31CA0BCF08484D3 bfg$c
1,666,307,103 *AF57AE4DC68B43F600B1CF9065BBB31963C15BD8 2334036 HIGH-COUPONISSUESTURNEDINESPECIALLYGOODGAINS.
1,666,307,104 *AF595D1FBD930D80B7A5D7472D1673CA78D95069 27.de.Agosto
1,666,307,105 *AF5E42F5204F985C118CE917DB29771F251BA5CF bg)57
1,666,307,106 *AF50FB54397D1AA11A894D4EF9B8E932A1349C26 bg8q-
1,666,307,107 *AF570B53911BF6850C5C083724042BC009BC0AD1 2ALBYBSW
1,666,307,108 *AF573315B441013103B57BE52E1C60FF6EDCD0DA BILIAˈɾAN
1,666,307,109 *AF5AA581ACF06F9FA8287FA36867D93928808ABA BILLIE CAMPOS
1,666,307,110 *AF55DB4DFC3D4899F2B16F38207E3E6E08051569 billsalas
1,666,307,111 *AF5D8C48FFAAD467458A77E3CE171FB1CA436E52 BJØRNAR
1,666,307,112 *AF58DC053308CE8698F06199048E7D56D63C97D0 BKRHI
1,666,307,113 *AF5AD50BD87C7FE58D6690ADAEFF88AE8F75810F 2SIRKUSWA
1,666,307,114 *AF5DA6A3CEFEE03D183B3F14D5A36D79B341D460 bloa;
1,666,307,115 *AF5744167260DE43E2E67A1F57F5C3594D434FC1 2vieillir
1,666,307,116 *AF5D0933731C6E14FFAD2095F4F7C6C576BCDD1F B?N"K
1,666,307,117 *AF5A73C4DF43FC3DDC0BC827130BA067FABA1162 BOMM3
1,666,307,118 *AF5AC170C8A8CED2BA4915F8ED25173FDC2BE572 3NUGATORY
1,666,307,119 *AF51D2E0437F47E87D87D357E26737DEB590C409 BORCHCU
1,666,307,120 *AF550EB4FAA4A20A142BFA7F6CF90075484A2ED6 borisprohonic
1,666,307,121 *AF59B98B9A2192B6941DD9C61BF9E21E49A03533 BoSM
1,666,307,122 *AF5618D9A0CE719DB3852D37F19709DC83688CA5 3p~O~o(O_)
1,666,307,123 *AF5CAA3822FA5971C5AF448558D8CF3DE4D4DBB4 3VYTLAUJ
1,666,307,124 *AF583B9875734D4C807018D338691311D229406A B===P~`SPLAT
1,666,307,125 *AF541A3F24C91B3A7C2672C69A3368C19736B27C BRAAXL
1,666,307,126 *AF58FABA564E1057636D411DD66D25C969573801 4FIVABSW
1,666,307,127 *AF5A3CD789DD6153C7C7F8401387370F2A55A2B2 4.HOERNECKE
1,666,307,128 *AF5E202C9F16DEE545F624746BC7ED9F8928E26A BRANDSKATTE
1,666,307,129 *AF50B91166752FD2EB3296B99F9C0ECB6788F9F8 BRENDITA9
1,666,307,130 *AF52A16E5A383BF2E5DBFA3BDE82A8A3C4DA7D18 BRENT.RAULSTON
1,666,307,131 *AF57C1A7F40E6FE8035D4D3ADEC6DA3824F0CCE5 brightdays(sting)(c)
1,666,307,132 *AF5F239496872D9AFBC967FDE32084B55BC91717 BRODEHURST'BR/OU/DH/[@]/RST
1,666,307,133 *AF5FD8875359969A343201D972DB310ACE106EC2 BRODERICK.SANTMYER
1,666,307,134 *AF5FAB2292D2F5BD7763DCE073A0BFE1579D5102 BROKERSBANQUET
1,666,307,135 *AF5D6F2E527F4B1527037A8A99A0EBE3D3D9B9B0 BROOKS.TORMEY
1,666,307,136 *AF5207E7E83CFE7F3B2F97FDF947FBE70E3F4F83 4RR3ST4RLH3
1,666,307,137 *AF507FBFF348E82734FF0CA0E116B627EDCDAB11 B) *Splat!!
1,666,307,138 *AF546856273AA75D3E7E81DD9FAE4A198F6948FE 507107 SOITTOPUOLELTAAN ERITT
1,666,307,139 *AF5054CECA50F8AC27FCBAD41A0F7B4079EBF20C b%ts"
1,666,307,140 *AF5FF4F45CD4E09AC7F5681D00D0EA42CB6FFAF1 buckwheat's.beat
1,666,307,141 *AF50CBB2FBC2D9A91A18EDE190FB4F7AC35C3F78 busagyi
1,666,307,142 *AF54B02A4196273FCA58A6457670F30FD60B7D60 BW$EI
1,666,307,143 *AF5B8CE6A0738FFCBD05C52F74B3B36192DAB63A 5lawrence5
1,666,307,144 *AF5A3BBA277FCC8F24C8A4AA3A1E40ADC6ACF08B B!Y)T
1,666,307,145 *AF577697DE347771E022468051D1E77E7C911A53 c1br3
1,666,307,146 *AF5E2831A7C8526E45E473CA163324740E093577 c1-!w
1,666,307,147 *AF57782BEF8F101E55D0EE698EBAC6E0DB3D8180 c/$4:
1,666,307,148 *AF5104D063E016CFA74461EF4780A8A25108CDF5 5-torjuvaan
1,666,307,149 *AF52F986595A5F6D39692D822143D4E5AE60C291 5vieriv
1,666,307,150 *AF5564991914D47E9A830E24CABB8073B49FB238 C.7FI
1,666,307,151 *AF525BC1F82088CD402182940F46344B2BD5DE81 671DRAKE
1,666,307,152 *AF532D6986A2B719978AA98E7930EA69C7B8B14F CANALHANGARORG
1,666,307,153 *AF51B96D349C5EF6D66D411E0C1AD025E44758A2 CAN'TSTOPRAVING(RADIOMIX)
1,666,307,154 *AF5F1B7E9E202C03C2689CE80B7A14B9814AD8F2 CARBONGLACIERVEIRS
1,666,307,155 *AF5771BECC2FEAC5D8C48E395B7D491712665712 CARMEN-MATEO
1,666,307,156 *AF553EE3252E39425C132EC016A0814F89A6B1DC 6GARDEROBENSTAENDERS
1,666,307,157 *AF5AF27A7512E085FBF43D3E727DD25DB4AF9514 6GIDDINESSN
1,666,307,158 *AF549AFF9F1D253779A5A9A41ABF65885899195A 6LETTERSMITHS
1,666,307,159 *AF5AB3D565059DA5A2BBF76183B62EB8EC66FC88 6PANTOGRAMS
1,666,307,160 *AF568B703B6FCC28417407F540474FC182A64CE6 6REKOFTAING
1,666,307,161 *AF5424936B876D3C4A1070F401EB71F1D147E3EB C&#CD
1,666,307,162 *AF590719434980528DEE3B09490214CAA416076D CDB%U
1,666,307,163 *AF57CFCDD6E89611B7101C3D55113CC465664AD7 78journey
1,666,307,164 *AF5DB3792E348EEBF0CDDB5729AC1243DF2879DE 7AFTALEVILKR
1,666,307,165 *AF504D34AF6EE4955E4547147AA257D9D3D7B093 7ANAPAESTICALS
1,666,307,166 *AF5DB1070D1D51B615534A2EE1965FE5098EEF4E cf!w
1,666,307,167 *AF520FBEEC2EE5B1C0FD0DC74AF5990F6C972577 7D470BD4C7E933C5A2F87B8018C66932
1,666,307,168 *AF58C8DE3DCB763EA0CB72D5499802A7D06D6E9B CHALUPAS5
1,666,307,169 *AF53730FE88738FA391DB19742FA84956E4C5183 CHATOVILLANUEVA
1,666,307,170 *AF553E17B9EDAAC9FCFFBB4792F31F5B82EE666C [email protected]
1,666,307,171 *AF512C9DDB90108B06B717FE8F2C44034DB39C22 7NIEMESKIE
1,666,307,172 *AF5BA3A04E964179CFECE743AF7460B4E3D4D378 7notebook9
1,666,307,173 *AF5E0F3D455135DDF5092AF26AAD0781DC3B9A74 7SINGERFUCKYOU
1,666,307,174 *AF5A651BD508EED43ECE7AE7E236888EB67C13AB CHMELNIC2
1,666,307,175 *AF5A0BFE6E50B32AE069D1D83B9819118BA48A0C 8211971
1,666,307,176 *AF5F62348B981C3956824D9272DA8957018E46D8 C&HX6
1,666,307,177 *AF5539FE01210117389ACAAB966FD3BED201282E 867282 HAVANA'DA-4-AKSAM-YEMEGI-.
1,666,307,178 *AF531654E675C8F44B43F537F26CFACDBD42D137 C!I3A
1,666,307,179 *AF5625BE9DCFF8C222418850619E2F8B4129442A c#ii#
1,666,307,180 *AF5C39574991806ED6DD6F518D11F65F17E9E6FC 8ANOREKTI
1,666,307,181 *AF5BDAABFEAE0714144C9A2FE179347B778052F2 8ATINAMOS
1,666,307,182 *AF521FB0B795C08FD23E5B548CFBD72AFC253BCD ci/sw
1,666,307,183 *AF5709842DD9FC8DA01F35966D90BCCBCD234821 C$J$
1,666,307,184 *AF54C4303EBE7E150637D2ABF441D11B6695C6DC 8carquilleront
1,666,307,185 *AF55B06FCB5246EBC08A8866AB32BF2B992D8409 claydangler
1,666,307,186 *AF54238C156219A3C2C854FD5148CBBE0FB81D7C CLEMENTINE-AUTAIN
1,666,307,187 *AF5B8C060646828CDAB1A557D50944A0BB8C5D10 CLIFFORDPURSWELL
1,666,307,188 *AF581EE8372639720BC27169B3FC04F639889230 CLIFTON.LEBEDA
1,666,307,189 *AF5B8990E23F7A90E32C3913B8820F63BA88F13A 8fondatrices
1,666,307,190 *AF5190E9ED22514786D369E86203ED21DDE3BF33 CLQ4Y
1,666,307,191 *AF5055906AB1FAE1739AA3CDE198D5ED35546467 8IZEHW0L
1,666,307,192 *AF5A284E7D13CE0794D57DE2AAA4C93AE60EBD92 cmesh
1,666,307,193 *AF5A7BFCB95F7DB578BC3B3E0A4E756FD755980F 8myjoanna4
1,666,307,194 *AF5C0EBE17A8E43FA5AE67126ED2B3D50F7338A4 codelistdecoding
1,666,307,195 *AF5644ACC8F8ACEC2A2C6C908708BFDC9B61DC66 8##>-~O-}X{
1,666,307,196 *AF5619792304E5D734DA00F93D2750CFFAAA713B 8##p*-*-*}o{
1,666,307,197 *AF5E0076E95F4559B23F5205A5A2F00E8199B811 COLIN.MACCORMACK
1,666,307,198 *AF5D758A0CA8DE690A9BF365C2CC8B584FB9E61C colleté
1,666,307,199 *AF5FCC298FFDD25D5AA272750C5E4332DB560DC7 8thatsprite8
1,666,307,200 *AF5CF19B8C561E97BFF8668282973FB67D24D9ED concertono.1i.largoallegrolargoallegro
1,666,307,201 *AF523F03D5C0A49A1367AC39A1D4581F0B86153D CONSTOUP7
1,666,307,202 *AF58B93143DC856B3C69BEA1F4549650F05F4372 cornellalbarez
1,666,307,203 *AF5C77022D846AE5A2335C2492551E03CF47BCE2 cot6(
1,666,307,204 *AF5E275EA21B051BA857E3D34B8C2385ABC40785 COURTNEY-FOXWORTH
1,666,307,205 *AF5D565367586DAE234BFB5C07076C2ECD470BC7 cpaqk
1,666,307,206 *AF5EB87A9E295B63E102CB31F2F10D8A0FB7A137 9MATHGATEWAY
1,666,307,207 *AF5C72DEA4163719182C4582A713002C9027E6A2 9miniaturiseraient
1,666,307,208 *AF579B28908D2631DFD430536E4D44DF4E083696 9MYSWANSON6
1,666,307,209 *AF55F5896054A60E8FA7250E9D5E4FEC027EE604 9SRELLEVART
1,666,307,210 *AF535A42C399E50D50A9DD375D03C24A2F7D4E19 CRPCPHL6
1,666,307,211 *AF552ED09F09BD9911BC9036A0CE646AEE7FB2BC 9wzjyump
1,666,307,212 *AF5495E3B853A3ABA793B4F8B11D64D8111C06FC A)5.V
1,666,307,213 *AF54EBB02A4D02FEFE2A07BE90B1F2086960150B A7PXQ
1,666,307,214 *AF50BCF9E2BCAE6B667770F92BC872028A2D7F71 CV5SU
1,666,307,215 *AF513657E618701DE6A4F7F43541B3977F128BCB AAAI=0
1,666,307,216 *AF549DA87BAB7879B71426DA63EB9C082742A9CC AACAS%
1,666,307,217 *AF5E7107D9AEF1078E35FC9EA2C43A6FA15D7E2B [email protected]
1,666,307,218 *AF54FEC7ED8F7BA967AB4B459A3DD20EE23BCD58 DANTE.PLONKA
1,666,307,219 *AF5F64712FAC955E4F8E065E028401E553014A1E A CRACK IN THE GLASS
1,666,307,220 *AF5EA8C1F92827BEDD207116F787AAB6C893C87E addictl7
1,666,307,221 *AF5800555F8633E49CD4F8B9DEFF710786BAF483 adgabcde3
1,666,307,222 *AF597215ECD2B870A421748C0AE63936710B2C26 DaU4
1,666,307,223 *AF52588B0DD4BD6D3583FB60A531C66D5A6FB9B4 DENIENG3
1,666,307,224 *AF5E815036BC7B02ECD50AF14EFFB85D5DF78697 AIJATSAR2
1,666,307,225 *AF56481AB2ED01845E956A7133F45246AEDF5B86 déréglés
1,666,307,226 *AF5CBA2620F596CC8B674172FF58CE3F80FC031B alangomzales
1,666,307,227 *AF50B9E7FB280DAFE93118C96E6E9B5CE16F79E8 alarm-activation
1,666,307,228 *AF518D6603783B1C6E620DBB8871CE9BFE1A5A28 DEUTSCHENSURSCHENSCHAFT
1,666,307,229 *AF548323B13A531EAA2977CFC74B0FE2348A4EE9 A%LFF
1,666,307,230 *AF5F6B8E9B13BA976A761003BB5B725C8E489877 dhesp
1,666,307,231 *AF5D7632587E532F429A4D4DCB2544294927F183 a!#_m
1,666,307,232 *AF5EF96FA31FBF7C551A5AF3B3A7A9EFE4A93316 AM#FA
1,666,307,233 *AF5B580F58665279959F1F88D77369E00938C6F2 andplejing
1,666,307,234 *AF5B67BAE22B3D1A9102B1CA210B19948228B96E D+,J-
1,666,307,235 *AF52E337CC02809FAFAB42B4F7428C41ADE2E968 andrerancifer
1,666,307,236 *AF5B211ED7C682CDAB7B14047578178629994350 andres.pacheco
1,666,307,237 *AF50D5D2509C458A2818ED4B629CDAFC60D6E350 ANF%M
1,666,307,238 *AF5566BA8AB556514216FA5C2BA7C5E9A7D4E415 ANGELAWILLIE
1,666,307,239 *AF5B8D402082C018DB56F2EB8B3FC6C2470E11F0 d%l9b
1,666,307,240 *AF55F85363DF4C4862BD3C6748345529AF8925CB dl_ce
1,666,307,241 *AF5984AD8F6570CA097749625D59D548DE1C79AF dne=w
1,666,307,242 *AF52BA6855EE5D59D694389A2B6C9C6502979E77 antionemichelsen
1,666,307,243 *AF5BB54CF395C5A238C36BE10B3A443BCD693218 antireflexglas
1,666,307,244 *AF593EFE93904B837A7B08E28975A7DD15FFEEC4 DOGSC
1,666,307,245 *AF51C1E4003DC450CEA147CF46695D9CC0F3C97D AOPUJ
1,666,307,246 *AF5ABD91540B1C69607E25441EECE16BD46B9751 DO-THE-FUNKY-PENGUIN,-PART,-2
1,666,307,247 *AF5918C5A16F808D51B2BC96F01B9EA778FC54C4 DOUGCRISTELLO
1,666,307,248 *AF55B40981D205D628EA176A429E1B9AF3C22A6E a#pvq
1,666,307,249 *AF588C30BDF2C07E671AB1B368868118E755F8F1 DS"F?
1,666,307,250 *AF5D58781068D85C4C1BAF0C4FFC6541F6CA43B0 dudleyjacobellis
1,666,307,251 *AF5902C1FD6A9F1A6E264606EF2E0E4CC65C724C arielgani
1,666,307,252 *AF5CB38BE8F5D5A64D23ED851E25F5A75F149EF8 DUE:
1,666,307,253 *AF5B9226A3D902F1468BA52B2DBE892FE52B59BB dufftomylou
1,666,307,254 *AF587BEF6539BD8881AB8BC7539ADDB04A702D44 [email protected]
1,666,307,255 *AF578DBAD9E53975D0CC205F1B5A3BA54B0B1308 DUTUW
1,666,307,256 *AF57B79D0684F1DE3F62F62FA08BF7DA1B9C3FEC DV:"
1,666,307,257 *AF5FCDE720749AD35A26C9B0FD589D9B5C498EC0 DX6R"
1,666,307,258 *AF53EE2DC8437CBEEFF143C37C93DD9A8D7D6428 ASANFORD1225160TALK1
1,666,307,259 *AF5C9E0D86405F59E3D44EA2A7F46C6244C89CEB ASQ=
1,666,307,260 *AF593311A0FB48CB1C7DB66C4E744A46337C4A12 atbc4
1,666,307,261 *AF510161239035E8FCBD72094C36EF8315762844 atenascu
1,666,307,262 *AF5D736CC4D38022D6E1AA62148112FB215A37FF AUFX8
1,666,307,263 *AF59F2793D95072C7B0BDDED4C09F49FB4EBC18F A.:UV
1,666,307,264 *AF5CB873CB5EFD91137EF2471F26A4D9FA1F0C15 A!VBM
1,666,307,265 *AF50B20195F536D45CC9259AEB6902153EC2A6B9 avfp
1,666,307,266 *AF561EF964DBC4D4C8C2BD74DACFC84CBCA266C3 EDWARDTROXEL
1,666,307,267 *AF5A401045DC399748AFE276993D6BCA6A061635 ax8l1
1,666,307,268 *AF5CD88C626E0A4EC239A6323DCEA4B5DE82AEBF [email protected]
1,666,307,269 *AF5ECACD282E96E237BB46EBE755C7CE56068A5F (^_~)~`-~`@-B
1,666,307,270 *AF504DB4471090C1D2ADFFD21DE1ACF376E1F834 b!1b/
1,666,307,271 *AF53BA6D0718F0CC0D46E75935BF2F2EC4BBE80C B&1BM
1,666,307,272 *AF532498434DE3FB6A76246525BB8C4DC6E7055A ELECTIONON-BM
1,666,307,273 *AF521DC202FB6AD10AA8C94E5F4E58F36F0B8060 b4ck$14pp3r$
1,666,307,274 *AF5D4018EE3895C23AB043BB219F9896A5AF8B93 elmerbelshaw
1,666,307,275 *AF5B7A326FAF67D3D6B23F74D4F27EA960F9FC87 b9$d%
1,666,307,276 *AF5684742152B032126F30E7F36816C73E25BB45 BackseatGirl
1,666,307,277 *AF56C6BDC6658B0D9899DC31D1D8377569FEBA54 banditbigmac
1,666,307,278 *AF5321580A163823DD9BADACF9012827A1368AF3 barbara-strozzi
1,666,307,279 *AF5E7B5FCE81A9A62CE54ABB2C6EA67E05A3D856 BAVQ5
1,666,307,280 *AF5C6AF2FAC669025D206A77707F8A88D158DF48 berrylapinta
1,666,307,281 *AF57367436C9675DA68441AB5B0D2851F281887A ENLARGE
1,666,307,282 *AF5F7F7BC5CF1C77EA0777127A8E3D23FD48C233 [enter thurio, proteus, and julia]
1,666,307,283 *AF58AC867633F030A8631A15360B4133788A4DBD bevi$ligh
1,666,307,284 *AF5036843ABAD77D063FC81C9C9A357C0589383A BHF&C
1,666,307,285 *AF5718C3884FFEC6E17EB16707CC0D16BD9ED35A bhw$b
1,666,307,286 *AF5BBE64BB225EC70C00D44E26220DD1B12410B6 BIqq
1,666,307,287 *AF5DE4922EDD0189E452AEF0220F41BB09808BB7 eszukbe1
1,666,307,288 *AF5EA3B42649B057851D52CC04605E66F6FA2002 euemduan7
1,666,307,289 *AF548297EBA81CF528AFB8B016360A7FCEE52999 b-mjw
1,666,307,290 *AF5960D0B836CDF37E1D47424BFFC2E06B5D9222 eyxvf
1,666,307,291 *AF50A9514BF149EF52967AFE407154C24349E376 [email protected]
1,666,307,292 *AF58C3B45EFF3DABF03B83F81935D91C936737C2 boaf
1,666,307,293 *AF512FEA02C6D3F93696D67125323334D2ECB89C [email protected]
1,666,307,294 *AF5DDDC71F42215B96B593A8DB55B2703DE67B6E BOYD.LONGBOTTOM
1,666,307,295 *AF53648034A75F04659245A041934A387C7F69ED BOYD.PATENAUDE
1,666,307,296 *AF52A44FA0E84A4ED08FCB3E1232F8FAF9C36F70 bp,
1,666,307,297 *AF512501802F0C56C4C144E424F766E7209E2244 $"$fbl
1,666,307,298 *AF572404A87AD173026DD009431590095408377A [email protected]
1,666,307,299 *AF510645C063EFAB9F3F2D4DE4B6D5633457BE16 ferdinandmancia
1,666,307,300 *AF5262F9E36AB1DB014D835549A6800EA67E232F ferminchenaille
1,666,307,301 *AF52B84EE2C458BA2B48510A319CF08846FE5E77 FESTTAGSSCHÜSSEL
1,666,307,302 *AF5D474AED885694F9EAFADE76D65F6C12CD47C1 BRADLEY.GRINNER
1,666,307,303 *AF588B2137D7D774243BCE72AE59F94B74649924 FIDELEZELL
1,666,307,304 *AF5465179B5C1D5ADA6BA1736E692E8017E80625 figeneia9
1,666,307,305 *AF55C4D9255754AFB94F1E87D80E98126581475D BRBH
1,666,307,306 *AF5096055CEB10515473D71C766AC1905397FFB3 BRETTKONU
1,666,307,307 *AF54CE43E5ECBBE08363AD7C69552F7305AB65F0 brianpoole
1,666,307,308 *AF5F6E328FE822598B0E7C5E9F4A81CCA464FD76 FLOYD.KNABJIAN
1,666,307,309 *AF59C7A078DF23BDA39453728F92DC13735D1CC4 [email protected]
1,666,307,310 *AF533FFD5C4BB64DEB22AA4F2841F62FAB7C47F0 forza37
1,666,307,311 *AF5968836FF9B709B70EE7BF584A06F2CBF7DF26 FOUR.WOMEN:.THE.NINA.SIMONE.PHILIPS.RECORDINGS.(DISC.4)
1,666,307,312 *AF510CDBB607E01F214AD73E5519B3BE90384ABE FRANKENSLEY
1,666,307,313 *AF581B56C740A5DE5371E49F927DFCA023763A96 BRTUF
1,666,307,314 *AF5D11FFF798DDC9A04928566E3DEF4B83160044 FRIENDSFOR1234
1,666,307,315 *AF5248816789FD1DCBCC1B0D3ACD0A5CCC7C2002 bsglw
1,666,307,316 *AF5AD19C0D04CECF79B0CF7A624329E5F150AAA7 BSWWENGERBSW
1,666,307,317 *AF5C08CB83771B1A6B5D232EB51811B7A8422585 btc7f
1,666,307,318 *AF59250AD1427AD1338FEB8A9A7F758E8290FF58 BTR3H
1,666,307,319 *AF5F4B444FEFEE7FBF8AD4EF5972370235D555E5 f?vt
1,666,307,320 *AF57FE7175E139CA404CDC8393D3CC5435DE7EA5 B,UN
1,666,307,321 *AF53A386515A37CBC3A2B726CF33262787CA73C1 GARRY.GEPHART
1,666,307,322 *AF52D7C94D3BD552DE6320D37DBF3BB433BF090C Bvlt
1,666,307,323 *AF5444BA2A9740FFA7F8F86A4CDD6CF62FF9FE4A g#c
1,666,307,324 *AF508FF5E2937E9B55FC1AAAF224AF6AF380E7A8 BZBr
1,666,307,325 *AF5C8A5A069D0CDD924F1DBB34F3D2BB9D62E0E7 geraldomelady
1,666,307,326 *AF515C29AD0566C54D07759416678DC51F7D3C11 GERRYBIALIK
1,666,307,327 *AF5F131A2F68ED10514F232D76681361C1D09D5A gestenotypt!
1,666,307,328 *AF5B728D929C52B97378284A8324B18BCBFCF481 gewisz
1,666,307,329 *AF5D705331D7A2B9C5AC8B39A8C4474EBDFD9BFC GLENNDUFFNEY
1,666,307,330 *AF50A540E82BD6B8292BF84E64B444453CA85CAA GMG`
1,666,307,331 *AF514E71711822431DE727F22DB983FE706BC4BE CANNIFFS
1,666,307,332 *AF5C076411C735FE3A490F21E4BA03C9CE1DBEC6 GOODFORWHATAILSYOU:MUSICOFTHEMEDICINESHOWS19261937
1,666,307,333 *AF5AE8286C6703024521A4E776CA7AF42DA17E41 gtw!
1,666,307,334 *AF52A7408462DDC461F4B9D67D5C2DD7CE9598D3 CAPITALISES6
1,666,307,335 *AF5C678E07D362E7695ED252FE366F3BD5D3A291 guyerenrich
1,666,307,336 *AF5004FFDC215F1070E4E92A948E0934C8D12758 CARLMOESCH
1,666,307,337 *AF574FCBEB3BD377ED4804E109ADCAE6E9B49CD3 GXVGQLA
1,666,307,338 *AF525C0A8C0E47EB992929A5AF36EAD8BA345E58 CARLTON.PONCIO
1,666,307,339 *AF532613BB841D065148EC60D242A88D5CBADD46 CARNOGRAPHY1
1,666,307,340 *AF58DCC7B14FEC861CACEA8A77BEAF775A81E8F5 CARTAFOLIO
1,666,307,341 *AF53822AC20546BC06BF7AB91C4453D67E51353F CEDRICBIDGOOD
1,666,307,342 *AF56D831C408D0DAF62EA2A339318FAC4E9B2487 CELLECI
1,666,307,343 *AF56E5AB3E5306218BEADDDED0F56871EEEBC492 HANDHABE7
1,666,307,344 *AF56E3E26675C6BB49AD6B8EAFA057E4B26EFCD4 CF(LB
1,666,307,345 *AF5525587A5003C07D05A2475C24A57CE8BE5539 [email protected]
1,666,307,346 *AF53228D5E70B23F7283D29EB4E1C6B99B5290AE ch%)!
1,666,307,347 *AF5654DD033F6D9B2756AF30FF72692C1C706846 harvingtonhallseptember
1,666,307,348 *AF5930EE6C513203A3A9959D6D54A25676CE4764 CHAMNAMNUNORINJAE
1,666,307,349 *AF56436E5B7C55CCAAC10EB32F3757D75BD87F94 chancemillon
1,666,307,350 *AF5AFF9C9A4EF62BA706A96795BC0D4B1C7596F8 CHANG.DUHAN
1,666,307,351 *AF56567D10610BD3B43B4F88AE16ED552A71C0EC CHAOSSOFTWARECOMWWW
1,666,307,352 *AF5237C16E4F06C3D8A95DB6AFC9EBFDA0360E8A HCLUBWHEAT
1,666,307,353 *AF56206AFB59F91ACDB73670D931641A6F2BCC12 CHARLENE.LIU
1,666,307,354 *AF54E13350BE608E01F46C486F290FDC200005BE CHDGB
1,666,307,355 *AF58F4B7ED29CD192F57586417C31D0AD8FA6FFF HENRDRIX
1,666,307,356 *AF55E955A44281E35937B121D0A3531DB322D706 [email protected]
1,666,307,357 *AF5CE786033593460E3E20EB7675F63CC27E41A6 HERIBERTO.PIHLAJA
1,666,307,358 *AF57D098208B7A5D8BEEF8ED96C90DB35C527C47 HIENOPITSISET
1,666,307,359 *AF57643D69E10C6F4FE308C217134C4A9CCF8878 Hijaz
1,666,307,360 *AF580C032614AF94E25AAF463042E549EE1C0D44 hiltner
1,666,307,361 *AF5B393B22995DF381B6EDF975A8F91F97218020 HITHOEL8
1,666,307,362 *AF580D2F0E5C3CB486871D53F4443CEF3A2DA126 CHUNGKENLEY
1,666,307,363 *AF56A5A08B910DE61224737781416D45AD010BFB cia,u
1,666,307,364 *AF5C4BF0FF5D099F49C61A6B0CBD89BB4E696E29 CIN%G
1,666,307,365 *AF53D339215F2579915BCE5EF5DBD3E7F61E2FF3 cirberif
1,666,307,366 *AF5C383EDD6AA040D763F4104570AB5ADAE1BD6E CLAVCHORD$7$
1,666,307,367 *AF5BF14985946DA74E3C779EA44015E66560A72B cletuslipskar
1,666,307,368 *AF59F34346F93EDAFBD7F4FC30270CAA6E761F44 CLEVELANDSTAGNARO
1,666,307,369 *AF584E426635923C7D3D1978D60ECE7AED6A09D0 CLIFFORDMACKLEM
1,666,307,370 *AF5005257D23E0A9CE4D11568AF7FBA056BFFA53 cl_qm
1,666,307,371 *AF5C43983C2D681CA84422D826908CC3FC000AF2 IANSLIP0
1,666,307,372 *AF58F416CCB22D708C390CDFBB1D343002CBB353 IERETSIDED
1,666,307,373 *AF580ED6A219641572CB2A3B28287CD554F7EC9F convalescent-home
1,666,307,374 *AF5D39665184FD26D0E0328759C57B0485E60E19 corporationwikimedia
1,666,307,375 *AF589137FBD16C35853501809D58C787A98A5634 ILOVEGRAMPS99
1,666,307,376 *AF5FF402B3AD2432CA8C013666FB450A17B2CB8D INDIRIGERVI
1,666,307,377 *AF5EF6FD07AF7BD1658DA84C4FC968107CC3E7E3 CRIIN
1,666,307,378 *AF550D8F269652E408DF96CE6FFACF9C0A8760E2 cristopherloretz
1,666,307,379 *AF5B8DE70AFA0AE6BFB7A67305AA3834F033BAFB CRISTOPHJ
1,666,307,380 *AF56D95261A7C936E06F5ACB5C462474605096C3 CRYSTALVOLVO
1,666,307,381 *AF5106CD324A24CC60D2173056D158E08E55D47D INTERROTO1
1,666,307,382 *AF553773AEB1B4C6CAD0EF5FE500F1E92E6D42D8 ISIAHSATTERLY
1,666,307,383 *AF5855735A1F1C71A246E841FDE4D2DA6ED9DEE6 isidroconey
1,666,307,384 *AF5808D1419FC857E13CB77546B2D57ABFAFA6C6 ISSACSTOWBRIDGE
1,666,307,385 *AF5E74E5F46F7136D8F4B5F2E7DF120B272629B1 ITIMACY
1,666,307,386 *AF55FFCBE2481CD6EF780746CDE2A3D99087FEC8 c%w1n
1,666,307,387 *AF5DAFE642AF16E888C4183F9F4D865631B1A7DB jaelovinggood
1,666,307,388 *AF53ADA0830BF96E48B7F83771733A9E0C9B0BEA JAMEL.ORMAND
1,666,307,389 *AF5AD62178E85F5291E9C31EBB59CAE1084CE6BF jansante
1,666,307,390 *AF55453472B209E6E3246FF5E8B09DC0BB41CD5F JAYSON.SATERFIEL
1,666,307,391 *AF536252694F1ABD788BD5738F70FB4D29A0BB50 jbij
1,666,307,392 *AF5A2D94C7EAD0C460533A61F3EB813E2A50649C CXARR
1,666,307,393 *AF53EE49762D783A864E4DEC418B4CE4F89DDC01 jetofajn
1,666,307,394 *AF53296C15A911D834280881D2A8B11E43824572 [email protected]
1,666,307,395 *AF5F8F21CBB43B279DF9A65ECC33677BF2FF609C JIM.ASLETT
1,666,307,396 *AF577125B6E2BC28928860B36CC5136A69BE7C55 d09i6
1,666,307,397 *AF5A0555DC801FB269A0CBA8247E66D002DFF1E0 D{~1
1,666,307,398 *AF5ED5CF1E277C6F5AAB54DFC32F2EA0796C2F66 d2ljp
1,666,307,399 *AF5F5294053D456714DE198AABC2D0904C0C6169 JOE.MATSEN
1,666,307,400 *AF51A35FA550D394758247D745F7EA84286B8D28 D5CRMNA+N9
1,666,307,401 *AF5DD0C05E6B55C1FD5B96186AFE377621D3E3F9 d8+f3
1,666,307,402 *AF533B20CD9FADBA91A8B6C626F86EB727210CCD JOSIAH WATSON
1,666,307,403 *AF5EAF221C8FB751F19BAB96E31617A4F8E2B8D2 JOSPEHBACCHI
1,666,307,404 *AF5799CD810EA00BEE3D95850673B5B44CBBC8EC jospehcrandal
1,666,307,405 *AF5FACB9C9AC7F4BE45B0AE06034F997173C9F0D JOYCEWHITTLE
1,666,307,406 *AF575FBA73169807540BF7DBFDFF2EC9341223BE JUDY.SHERRY
1,666,307,407 *AF5EEA6173D19FF00DE9958A15C9AD157918B872 jules-schwartz
1,666,307,408 *AF590558DE532F39B5E6C358F67D56C77D912DC9 JULIAN.HELMES
1,666,307,409 *AF55FAC383282889A0622F5260A0874888CB2439 juliusruozzo
1,666,307,410 *AF5664BFEDC0628817FEC4B6C07F070B7671CECE juniorsebion
1,666,307,411 *AF5196746E8896AC9BCEB0CE358EBBC5EB15050E JUSTASKTHELONELY
1,666,307,412 *AF505C21AF0EA1C0EF716A3992EB7902217D5312 K2[B
1,666,307,413 *AF501F510F208B50EEF635A5C05B94577836B8A9 damonlazusky
1,666,307,414 *AF5C7C0347BAEE9BC707605833444F31EED98AF5 DANABUDGE
1,666,307,415 *AF5053CD6EE3284D8EC20198783DDD2A2830C457 KATIEMOOS
1,666,307,416 *AF513F98DA184BFAA76BA2B095559700A3D53DA1 dannorstrand
1,666,307,417 *AF5729BA83E29A7E2E0D1A09F552848E27E5AFA0 dannyjetty
1,666,307,418 *AF547691A1CAE6FECCC3B55AB576BB41DA6E0E29 KBVEGASROLLER
1,666,307,419 *AF542FD1BE2E80FB401332EBC2344F3865991852 darcenia8
1,666,307,420 *AF54DAA22C7C7A4F6089CEF2615FBE52D758A41B DARRYL.DELACUEVA
1,666,307,421 *AF5A06E2C168E47383B793557507DAD49C4BE81C KENQUAD
1,666,307,422 *AF5D91A3B149A2A452C340F2F7AD665607607AED KENYON.HENRY
1,666,307,423 *AF5DC05883D032134649BDC360719390BAA8833C kermitbarn
1,666,307,424 *AF5EFA31904711D843B2AD863F9683394ED69E41 [email protected]
1,666,307,425 *AF58033A2AEA51181C2F360A179DFFCA95924A25 day"q
1,666,307,426 *AF5B00A619A96D754D8211875BD97532C593F503 dc0fu
1,666,307,427 *AF576FAFC80FC6ADC786085FBFEFBDBDC711C6B3 DENNY.CAPPA
1,666,307,428 *AF529B00AC45D6FB4B45160F0864BEC89DE1EC05 kseskaf9
1,666,307,429 *AF518EB8C6404542D3C7994F96AA4883F09E14D9 DEZMOPRESSZINBEN
1,666,307,430 *AF5EB2CEF352D95581AC33DDB92756CD18530DE2 dfkhr
1,666,307,431 *AF50473A23D9F31911C490E759FA3F19B6918953 dgger5
1,666,307,432 *AF5A490EEF0411E570374D1B64DCF13389CB62E2 DISCO-DOWN-TOWN
1,666,307,433 *AF576A5516A06CE32C181776356B875E41BD3B8D LCN.CANOE.CAINFOSNAT
1,666,307,434 *AF5B4995E16E5139F650DFF10E5C79D87A05FBA5 distillateur6
1,666,307,435 *AF5A9D214E109E9CEE6A02A4A555487AA01E028E LEE.GETHING
1,666,307,436 *AF5F0BEE03A26A6045CBF98BF8C4FA096142B26F djz9
1,666,307,437 *AF54F4CF74FD180B9780C6E6F8712517AFDB6AC5 D?KF3
1,666,307,438 *AF54F4593CDE1CE56197F8FB6F95DA5ACEF8157C dominichinojosa
1,666,307,439 *AF5A32CB8B5A5BC183E13ADB557DCEBC9960D5A6 donkormoses
1,666,307,440 *AF512D8AE358A635D6DF27B5119A48569EBE66F1 Donte-I
1,666,307,441 *AF5701495655090AB513F95C0BCEDBBE4719B356 [email protected]
1,666,307,442 *AF5E2A22FC6188AD8B6AFAAECEA58AC00C4FDC24 LICHTTHERAPIEGERÄTEN
1,666,307,443 *AF52480154C059D4578F9AF1C38A89D321992FAD lila.jhin
1,666,307,444 *AF5FD010629B74D3D339B12B79179E3A96F6B055 lindsay-juarez
1,666,307,445 *AF52507451578856586633FDFBE870B17DF84BAF dqaw(
1,666,307,446 *AF5EA0D3141B59945210E31F1C644219B862CEA1 [email protected]
1,666,307,447 *AF51C5F28BE29BC38FC34B286BE65B68EB63F383 looming view
1,666,307,448 *AF580826507F6A62F551BB00AC05C336EC848178 LOUKKAAVANA”
1,666,307,449 *AF5C2A071D01F6BADD3E485E4ADA2D57741C506C DSH+
1,666,307,450 *AF5A0F56D377483A75FC1454B362FB1227E9728D DU)AQ
1,666,307,451 *AF5FD12E74EC24436162A66CCFDF48938D88C3E7 D=Uv
1,666,307,452 *AF5AA18E1C374218EF31A70E629AC8453D600C7E DV.+
1,666,307,453 *AF58E7102B8267F96D6DC4A2D93D0348314F62A0 lyndsey-newsome
1,666,307,454 *AF555A538ADAAE90B05ECDCAB13260F8685A6483 dvr03
1,666,307,455 *AF554BE4D90EF5A407407F997865658F7E8FFBDC DZBN-
1,666,307,456 *AF57C853AB48A186B240D6205826C69CC7A292D3 malcolmbrought
1,666,307,457 *AF574ABF04B9AB03AFEEF2ACA523BB45D1359162 EAL=2
1,666,307,458 *AF5DA852BEB34BD1F24FDD58E908E75EAEDDAA80 MALIK.HOUZE
1,666,307,459 *AF59CE030BE39DF0359272D546486C32034F6F9A manieslindo
1,666,307,460 *AF525CBF30FA43DD4F738930E33305A6053D3327 ecneelaps
1,666,307,461 *AF56982ED99A4106BE3784A3837BA6E891D465CA EDDIELEITE
1,666,307,462 *AF5A9B4AA5ADFD3C2874780CC4ACB6645625B409 EDDOSNUS0
1,666,307,463 *AF5865FE3982025DBABBD83EFCA60064C715E0F8 MARCOOBRZUT
1,666,307,464 *AF5DBD24A2E3D4168AAD6BDEAE080DDBE9BF0AB3 EDMUNDMCARTHUN
1,666,307,465 *AF5F2F256BD0E9A627F046EEC708BE91900B5EB2 edmundoshrewsberry
1,666,307,466 *AF5F040CC9F0640BBDD4AB6C22F387AF4EFEA097 MARIA NUNES
1,666,307,467 *AF55501719B1A9CBFCA4743FBFA181A929D65E65 MARIE NOLASCO
1,666,307,468 *AF529261EFEA0A93CA031975272E2782C3E93736 MARKHESSELSCHWARD
1,666,307,469 *AF5BB954C8096838B256129F52F6091F1BB3EA3B marmonnerez6
1,666,307,470 *AF55F0F40E8114FD11AFBF0F64FD7B829513EEFA EFRAIN.MARTENEY
1,666,307,471 *AF5ECFC9E67D5FCFC86ED95482352F08ABD7B019 EFREN.PEELS
1,666,307,472 *AF5A0DC894BEC0779F429644E2E1F5CC37707E22 MARWAN-RAAD
1,666,307,473 *AF5FF36C49DDBDAB8DB17C3510A0665EB9B8F51E MARY.BETH.GRIMES
1,666,307,474 *AF54D63CBC5CB0E3940560512D5F5C3493E86562 EGISSMEN9
1,666,307,475 *AF50383589FE7EF6AC1B577F197EA8CCA11E182F EGRSW
1,666,307,476 *AF563F13BE6B2F1DEAFFC8D0DA90DED0894831A6 MAURO.LOOP
1,666,307,477 *AF53DCAAA4464DF250DBC1B5BB7EAEF4B76EDFAA MAXIMO.RICARDSON
1,666,307,478 *AF551A3858961F4CEF97EB4D827E9D312552139B MAX.SCHIESHER
1,666,307,479 *AF55D294474BBE48556E8C38FE505956F298CC7F MAXWELL.DOWE
1,666,307,480 *AF5AA2B62376CA9EA6424D97CE1DB1282275E305 [email protected]
1,666,307,481 *AF5B01B8FDFBF0437B0589768D2ADC4E961282DA ELIJAH.HARDEBECK
1,666,307,482 *AF50FCD5842C2A6EB38CB51DF68E6C61356DC1E6 m$d0er
1,666,307,483 *AF5F66AE5A29AD0B7660B46B5BCA641B69A3B304 ELLERYRUBLE
1,666,307,484 *AF5C82D03BDF7BB1AF1D8A49ED2CD0F2696C9DE0 MEDIATORIOUS
1,666,307,485 *AF5F31F083623D1D06A19A96B7C667D3AAEE8B7D ELOYTHAMMAVONGSA
1,666,307,486 *AF5D374ADE79D802C748FB17F7FEF0B4DCA16E1E ELTONBRAASCH
1,666,307,487 *AF5A62AD14E74F15B4FB159665CA439194B42547 MEGHATAROZASA-2
1,666,307,488 *AF568876C1598AEF496DD05BDAD18F3A35B9F61C melanie-whitford
1,666,307,489 *AF52ACBD1CF2040230E09F6EB71BCE1596A03222 [email protected]
1,666,307,490 *AF5B8724065BAD742B1E7ECD284241C1450DEAF2 METTEUX9
1,666,307,491 *AF5FB23E8C6C0CD3D80F09BD6C2158838594DB9A MIKELFERENCZ
1,666,307,492 *AF5B8D5C9D000DA00C6D7AB42E5E44BB8317C254 enzyme41
1,666,307,493 *AF5E819513BB8E2B94ECC39F2FDA37266DA53B7C MINHFRYOU
1,666,307,494 *AF55859C6443D4B305EEE43A0C3BD7A4D20178E7 MIQUELDIERSEN
1,666,307,495 *AF5D217FAB0A64E68CB40A8CB47701D02F10B68D mirabella (a tarantella)
1,666,307,496 *AF503B6C7EE55BFFA973071C6008DF6533E83B0C MNPERRORING
1,666,307,497 *AF5EAC91D6F5EC261C010188727DABE905D7F8F3 ERNESTOPARATORE
1,666,307,498 *AF5A4FC1A0FD670F5611232D69DC765E9DDDE2E9 MOHAMMEDCAI
1,666,307,499 *AF5B0EB1F17AD290A10EE77768AEF54B9A34F433 mong (live)
1,666,307,500 *AF5C8528F48E922097579AA507B46AAC79FD217A estacion-de-san-antonio-metro-de-ciudad-de-mexico
1,666,307,501 *AF5FE18B8C5208617CBC35CC3D6B4D0181ED1857 ET50O
1,666,307,502 *AF53BECD1743017DD18DAF79A8345603F495E356 moshehorney
1,666,307,503 *AF5E0DBBB1A297F73642BB5E5D98754FB3758173 etsalegnaa
1,666,307,504 *AF54631EA529A79FDF5A96399F320356DAE8E9C3 evan-sumners
1,666,307,505 *AF524F9676CA78AA24A92430187F237F5EBE33F0 exasprer
1,666,307,506 *AF57BF7818DAF45C4DB9C7CEC5F86B7DDBA94D13 EZINOPUA7
1,666,307,507 *AF5490885977331B341F4E9CB60AB42B0E3B31BF [email protected]
1,666,307,508 *AF5669E45B0CF212DA637C9BF46C5B586F1340FF [email protected]
1,666,307,509 *AF56D3F1292949C8F3533CD770A4CDE00E3ED9C7 FEDORKEW
1,666,307,510 *AF500EBAEF3064117A23794F185B21240128B235 FERALNY5
1,666,307,511 *AF501672C821DDCD8DD83361157D5DCA802B470B FILLADOS
1,666,307,512 *AF5A59A1719C7F11DBC92BD1E91C7D4DDB30351B MURRAYGLAPION
1,666,307,513 *AF560C30356D5EF1834197B5B608A64D2E46171E MUTHMA553L
1,666,307,514 *AF5FCF9F7A2E8C299C5F009EB1D4E90AFE3F8E9C fl0$$3d
1,666,307,515 *AF5348730F379745A3F7B6B77434DE68EB9A05C7 franklinjuhl
1,666,307,516 *AF57813B735B2556C7762857BFD22A6B45F061E6 FREDERICK.ARMBRUSTER
1,666,307,517 *AF53116811C955780BA5905B9707556208C5C42D FREGOLE5
1,666,307,518 *AF50A1615F5CEDDCDFCF87F4EF51660A3AE8C59B fv37
1,666,307,519 *AF5B1A32861C485EACCC2234DB734C74F58DB4C6 G49077
1,666,307,520 *AF5C9BE833BD2384F4188C91701739B41CD63D69 GADNEDOG0
1,666,307,521 *AF5A5237FA0459D079000B850E38BE9DE5295037 gamisyasi9
1,666,307,522 *AF5F53410ACC6D6BE265C7F63AB67B51D58C5714 [email protected]
1,666,307,523 *AF5FBA2B4E53F4C9EBD054A304A32D95B5469FC7 GARRETTAGATA
1,666,307,524 *AF5E2164E3DFA9F96DE053770AC7390CB80FD30D GARRYFEREDAY
1,666,307,525 *AF5D301D874FBE3BA774263255BB6F0B4FCC465A GARTHDAUS
1,666,307,526 *AF574CB989DE8E54F95F17E4B4F6D41B063A2B91 GARY.DRENNEN
1,666,307,527 *AF5A279C561359E73478F253413679BDF678D11F noam-ravid
1,666,307,528 *AF5654AC624B429589626EB45240C3C5BD62B753 no-crown-for-balin
1,666,307,529 *AF5163AA69CCEECB2B79EC67000FE1CC57C589C3 noelwengreen
1,666,307,530 *AF5655D7C374EF5EFD98D7D37C1B89C3560E3BCE GEORGEGIANNOULIAS
1,666,307,531 *AF52E99E962693FC0585B555ED8D1D55B624A29D GERRY.DOBLES
1,666,307,532 *AF5E8978A709DE7E6AE806105CC77F79345A9FD4 GESCHRAAPT9
1,666,307,533 *AF53A0AC10A088116728E05B21F04FB2E1D7EF24 GGCAGCAAGCTCCAGGTGCATTGCTGACTCAACTTTTGTGTGTGTGTGTGTGTGTGTGTG
1,666,307,534 *AF57D445E0B6C7132A15B2B095A86ADB34333F69 GIDERID6
1,666,307,535 *AF50F17E749C10FA06506D44A210930DC373ECC7 NOURHAN-AYMAN
1,666,307,536 *AF5051F7D0E2D9E3AEE3913C05135BA1C9D2CAD2 NOVYY.GOD
1,666,307,537 *AF53205794C32EE41036DF6D5C19CBF603D982A3 GIUSEPPEVOSBURG
1,666,307,538 *AF55E16DF08E641A62C858625D9A933469368EC0 numbersstenback
1,666,307,539 *AF5D3847BA7FEBB65B498C10777AFFFDBE1AA4FF NUMBERTALK365-DAY
1,666,307,540 *AF5F4310A9FF6D18DAA4AC565C7347B5E4EE18E7 GLENN.MCCARVER
1,666,307,541 *AF5AFD0B46BC7FEB3AADE3834D8FA967C9E0FA8A GLHERETIC
1,666,307,542 *AF57F95ED1DFA9FFA5AAE5E0905F7B98F6A1DC09 NYYTYYM1
1,666,307,543 *AF5C99FC8F1BB0277E2D104828E4667B4996F4C3 O8456845685
1,666,307,544 *AF5FECF9696089A9F3A5B253ABE682B38A6B5611 O>AX
1,666,307,545 *AF5680567FE0EED926AE6EC5C0E86D5459282CAC [email protected]
1,666,307,546 *AF579E91EE70F60193040A3E7438AB91537FBDE6 [email protected]
1,666,307,547 *AF50268F352F0A6D4D0D676549EF3499EB56A490 Gooks
1,666,307,548 *AF509672719074097E66B1354B8A51A2A1899DD8 [email protected]
1,666,307,549 *AF59465B73EC0BFEDB9A2B5321FD643F50BB2E25 olmatead
1,666,307,550 *AF5B1976A674850270EE1E8BE7B6EA9CAD8CD134 OMNI_MANE'/A/MN/AI/_'M/EI/N/I/
1,666,307,551 *AF53B5B0E37FE12F05A9C4218313DFF32ADAFC33 onlyincludedtopresentafullrangeofpossibilities).
1,666,307,552 *AF5FC390E2D5C66ECEBFEA017F3A2ADEC50B455B ORGAN-GAL
1,666,307,553 *AF5C657A027927F6042919FF216EAECBD5722F21 GURDESH.SINGH
1,666,307,554 *AF564846321B575DD4C6C757092E8A5B3DB448CF GUSTAVO.KYM
1,666,307,555 *AF5D8184E893FC6572AAF2D707F9EE4D24677AAA OSCAR.HRANCHAK
1,666,307,556 *AF59FFD5BC7F2395FD3FFA77F5BEF45026D110F0 OSTSILLEERUV
1,666,307,557 *AF58CCCFC2E644E3FB217027313D32DAFA854C16 h8#q
1,666,307,558 *AF507D1026AC73E4DC063DF5A3AB3BB80ED1F627 OVARECAMS
1,666,307,559 *AF5E0B2C2EC91E413068A3D82AEB0B7C78C694F8 hannah-marie-lund
1,666,307,560 *AF5B45377A292AF69E9766D5E96AC3977C51D3D0 [email protected]* * * (00)
1,666,307,561 *AF523A29C2C4FFD26115E4BE02736B0004B19605 p355m5tca11y
1,666,307,562 *AF5189332EE887E3E7A964A2697C45DCC5C149A9 HELTEESS1
1,666,307,563 *AF5AD9B99594124555CAB56511C341C54DAF9885 PALMERSALSTROM
1,666,307,564 *AF5C0B11EA5F98FFAC70D929B41E3B4D64034DBC [email protected]
1,666,307,565 *AF5D5884053550D8473F3EC14F42FC3C867004D2 papacello
1,666,307,566 *AF54A64007214E18E474EFE2DC5EBB3E187D4C9B P######@.~.`>B0
1,666,307,567 *AF5F3A9EEC934A13E083B5DD23F7472F310C3056 HOLLIS.DEMAN
1,666,307,568 *AF560A2548ED6F987303C2B22D99017ECA29CE06 p###b.~o>b0
1,666,307,569 *AF54E41BDF12D764D0747AB1854FFC3A4F744EC9 PEOPLEALFRED
1,666,307,570 *AF58A600E078C29C5A4160F94247B338F24D55FA PETROCOCADOLLAR
1,666,307,571 *AF5DD8BCF52F2B1D742C80804BA2554B2ABD43D3 [email protected]
1,666,307,572 *AF550107FBEFC649B2AF3C1B06F14D71F4FE115D PIERRE.BILSON
1,666,307,573 *AF575A323A9611F0C849309C14EF13D0A5D82626 pinguis12
1,666,307,574 *AF576C173ECC8B54AC99A8040E04FFF1F54ABD35 I>59
1,666,307,575 *AF5510B77EA4F13774CE182E6E121F56F7E6BC4D pirons7
1,666,307,576 *AF52FB77D7572ACB5DE93101A037A870FCD4F660 PLANETARIUMWIEN
1,666,307,577 *AF58F10727CF7F1175A55162BF4EF2D0AAE66221 PRESBYCUSIS8
1,666,307,578 *AF582A0B18DD2DB71DFC159F29D41A41146CB2A5 PRVH[email protected]
1,666,307,579 *AF52251BB99841768AFB0C8CA0D4C79CFEF3F55E ITARILED1
1,666,307,580 *AF51A305EAEDD5C666BDF379A10535F00FFE3E13 IZEBNNIS
1,666,307,581 *AF50C2E29C1FE1B0644EFA904F77E2B6D2C470AA jacoblamarre
1,666,307,582 *AF55FA31C404FF8ED6E51FBDAB278D96387F5B35 jadyn572
1,666,307,583 *AF5A57F649598BFDCFE5474E4A372EF8B02754D1 jasonfranken
1,666,307,584 *AF51A1A91C480BCFD5D5D09F3228E4AC8E538880 Q1{'
1,666,307,585 *AF5A1BE7337D413C63834D0FCFAA50CC9846B602 [email protected]
1,666,307,586 *AF53E16C74638D1589CF3BE9A67980238BA1D849 J-$"E
1,666,307,587 *AF5A882AA932230B7A21A32F32397D4466F34D07 JEANWHITNEY
1,666,307,588 *AF5ED3789DB039EF52CBD2359F9B1A695C97F22F jefferybimler
1,666,307,589 *AF59986AB90E77389F44E92572BB3919979C1DBC [email protected]
1,666,307,590 *AF5FA2DDDB989914A03B2F1B7F03338D2C432D5D QLN:
1,666,307,591 *AF5E1032612B52CD22D08C60E373C1A6E9D745D8 [email protected]~O~O-)X(
1,666,307,592 *AF552B19258D4058BFCCCEB78F9D34DC9476F473 q==p`~.`~(>_0)
1,666,307,593 *AF5CAFA22DBEA44A4C87932742A7AF1054676816 JERMAINELANZA
1,666,307,594 *AF53ECEBD4FB863703A904DF48BE9318E9214CB1 jermaineohlemacher
1,666,307,595 *AF5EB8A35BFA6E280A7A2C1125DBE759C7782328 JESUSREDEKER
1,666,307,596 *AF5CCCE12D24AF87911974A10516CEBA17197C5B R3CO9NZAB13
1,666,307,597 *AF52D6DA8511F8E93959CFB17ED22DBD1A3474DD raafat.mosleh
1,666,307,598 *AF53D086167D24C7BBE5963BCA64DBB62E815EE3 [email protected]
1,666,307,599 *AF51BFEC8E2499AE4F02083DCC9D812D5E0A9775 raleighstipp
1,666,307,600 *AF5B5CCC100ACD2B069B4799F49830FE9C7CB85A RALPHHOLLOPETER
1,666,307,601 *AF53BA9E253D9DA7DBBB0B23D059BDFC040D4837 J-LI
1,666,307,602 *AF53ACCED0D2B36F6B3DB62FBEB4998AA631C347 JONATHANDAVICK
1,666,307,603 *AF51C20050E909BCF0866B52C5B87B563A0A6E15 JORGE.CODA
1,666,307,604 *AF54B093E645511320B43694BB7297E1515ADAFE JPOFLQZGGTZ3
1,666,307,605 *AF59737620B98DE7F741D10848826A485B020636 [email protected]
1,666,307,606 *AF507B4C69E4BF1287AEB2AF370BFF6D7EEE7331 K13HOT
1,666,307,607 *AF57A960334588FFB67A4105DBEE5B4EF04590C9 [email protected]
1,666,307,608 *AF5A90291D8976D3D94D521EBA2998587239B812 [email protected]
1,666,307,609 *AF563940288C1307DC20232A57FC83D63636AFF6 KALEBASTÅKA
1,666,307,610 *AF5CA11AFAC461376FC8FAE1C13206B12A49814C KARL.DYRON
1,666,307,611 *AF5E189C637139775131EC0248929A8B5FA5D68F REDRUMRACING2
1,666,307,612 *AF5603581CA58F8F255D16341B59D60E113A59B3 redvane7
1,666,307,613 *AF5CAB8231EF36C8A1A47F49C8BE401171EFB0CB katčinskis
1,666,307,614 *AF50891AD969C2503C1B0BAE9298C587B315E5F1 KAYASASING
1,666,307,615 *AF538A479D90DF3664E68A26A36FD718C5034E6D