List database


# MySQL hash MySQL password
1,666,290,001 *AF5A795DFD913361708FDDCEC0534708B42B4EB5 HILEE, HILO
1,666,290,002 *AF5BE5CAC9BEDF0C32C37EEEA122B0029BB37C01 [email protected]
1,666,290,003 *AF5B3456A123788DACC51B6BA4FB2476A232CFCA кремлівський
1,666,290,004 *AF5561BE1BACE3A6B0A0B073051A649CA217394C U*MN
1,666,290,005 *AF53E7FA8805B03024C0EA2BDFDFB1ED2B05ACD7 [email protected]
1,666,290,006 *AF5646599A01EC0A73E462BF86D8CB239F323C1D [email protected]+NG
1,666,290,007 *AF58B6FB9092CF78DA3187A09369113715022053 UNDERVALLYING6
1,666,290,008 *AF5E8C951FB5E3D7AA6595B6E427FC76F9869433 HORACIOKITANIK
1,666,290,009 *AF5317AF63CCE36E1756DA24C09E092D79D2CCC1 unembowered6
1,666,290,010 *AF55C0B4D76FFD1979F3822450FD59E4F92CC9D4 HOWARD.KANNENBERG
1,666,290,011 *AF565655BEA205689E7E2BEEDE5B0DBC9BD9E530 How-Does-Ed-Cope
1,666,290,012 *AF52492F14461B2A191CD639C67B54E783F2832F howe-elliott
1,666,290,013 *AF54CF5B98ABA730AEFE92DC0978092B09472785 unvaried0
1,666,290,014 *AF53499A8B4DAFB95A822A2639CC80C8F481B535 hsirley1
1,666,290,015 *AF573BCCCFA7F04A6B56B998AA85E4DA7ECF4D86 ШМУЕЛОВИЧ
1,666,290,016 *AF58885A52EDFFC49B236827CE59542E43415141 южнославя́нские
1,666,290,017 *AF52B49A4E9DD92A0200F9D5A078F1F1DA0748AE URBAINI+7E
1,666,290,018 *AF54E6BB4373EC5067217AFAB35FFB70EFCC264B httpwwwspiral-zone
1,666,290,019 *AF5D6C4F4646F957AE6064A7270D0B2015D002C6 URIGINÀRE
1,666,290,020 *AF514758E46B3ABE06296DCB7E5AA80AF860ED43 URODIABUNUS-ARLEI
1,666,290,021 *AF5743C2FE8D36EFB05F4D3F1F4A03FCD6D7DEE0 utilitiessewage
1,666,290,022 *AF544A4D4DE1F7E92814A43677A8327BC6AD2994 HYALOPHANE!
1,666,290,023 *AF5309AD06C1DB63D3C7198668ADE75A78566A2F [email protected]
1,666,290,024 *AF584C01C89DC589AEF1C7E7A73D6AC0356723CA IALNHUUDERT
1,666,290,025 *AF5A96C5443D0EA433DF083717EC35831609DDA4 VALENTINE.GIVHAN
1,666,290,026 *AF5D672685D088C42B20B8559D7B26095E5FDB6E valentinejoyner
1,666,290,027 *AF52B00EAB8CD9E84A93322A8E7EAE3D3E92319D IAMCROWLEY56
1,666,290,028 *AF56FACFD171B3BFFAD3DD10A2078CA9634B2A4D iampianoman66
1,666,290,029 *AF5C7429A2D0376B742602CFD72E2917442BA7DC vanity-slim-garcia
1,666,290,030 *AF5F29D313F02F9A544405BD5F10FACFE7502526 IENERIGE4
1,666,290,031 *AF5B044D0B52C38578689FD12B25C0EC41FF4289 ilustr
1,666,290,032 *AF5F2ED7326CAEADCE5A4F6A7CEACF7FDDECAA37 VERENAHAGERMAN
1,666,290,033 *AF515A8B014D0F323EAB0541E98FA4680FD8EA41 IM|Y
1,666,290,034 *AF59F004D1D45126466A51E22DD35B115C7E7F28 intranett
1,666,290,035 *AF548BEDFCF4F11E2C7BDF7E08CFFF9886CFCE83 が独立し、大きな注目を集めた(その後TSVの体操部門は、弱体化したが存続している)。この他に、FISCHEREIVEREIN
1,666,290,036 *AF58037919A65484D22C0229D821AF0A3C555A45 VINCE.PAWAT
1,666,290,037 *AF5511D1680AF9931B0BC291749F5B9065B7DF2D virgilmaldomado
1,666,290,038 *AF5573287EBC3EB504191AAA45A4A894A2881875 vishal-gulab-bid
1,666,290,039 *AF510C4C77B613B2F3817B304CF64B29BBFCBB63 vmbprksxu
1,666,290,040 *AF560C11272226A6E590610A171396CF1924C1D6 ivorypappajohn
1,666,290,041 *AF521FAF1D87FF086DFBD639AC7DB310F13173EE WAHPETOM8
1,666,290,042 *AF5B3178C505AF53E7AE7D3124E1BAB4FBF040B1 WALLEYEALICIA5
1,666,290,043 *AF5C2A11EDA003E95A199466DBDC506BCE481FA5 WALLYVILHAUER
1,666,290,044 *AF5AC7A173ABF7762D43FBECB5B2C2FB5BA40C51 JACEN+7A
1,666,290,045 *AF5A12AAE22E237F95D09AEB43E4D28F482CF639 jackaller
1,666,290,046 *AF5D4B5E86C433CD36A56C3A4152665EBA0C7B66 WARD.FREDERICK
1,666,290,047 *AF5D42881BB597EC5C929369B137FD7C3CD534F9 WARDTAKES
1,666,290,048 *AF5F906E87602452D23ABC1C05AF1F34E6783DDA WARIO.WARE.TWISTED
1,666,290,049 *AF55DCE37C3639223B5B7BDE2B795B4214BBA15E WARRIORREEFER7
1,666,290,050 *AF530E9044B09125E8B5EB6DEEA26D8C8327F61A JAMEROBICHAUD
1,666,290,051 *AF56197722BA566D7EFD416E35BDDE08C8EFEB42 JAMIEMABABE
1,666,290,052 *AF5015C0499681771D1C839BA6D2BF12DDB86536 JAN-BANAN
1,666,290,053 *AF5B4F50DC36E18BD7408E4DD5F9BA0C31665605 JANELLEBRATHWAITE
1,666,290,054 *AF5B27FFCD482D65E13DF27E6DCD2DC5DA51D20C (0-0) O~ O~Q###3
1,666,290,055 *AF5CF83FCA4642467EF2B36019FD1F231D23BECC JARRETTMAEDER
1,666,290,056 *AF550AEB9715048943343DCA739BD0DB77CE8FC6 WELDON.SHOULDER
1,666,290,057 *AF5B8A78A9A791014A3A6591ACDDD0EA92C5A773 JASPERCANTWELL
1,666,290,058 *AF5FF00D4C7BAA57134E1737A01D990BF3058F39 JAUMAAAAIAAJ
1,666,290,059 *AF5054014C7D9916EFFDD81E37B3FD07F2A03DBD JAYSON.CASPARIAN
1,666,290,060 *AF50227BA58B51AB99EED8A488827BD59556D3EE jbij
1,666,290,061 *AF58088E87199F6BFFC01BD5A380874FF2506154 jedbeed
1,666,290,062 *AF5F3A0DA5D2DB0638FFAEDC7C2118ACDCC090C6 JEFFEREYARMAGOST
1,666,290,063 *AF5A2D92F5F2C89A495307442A099113D85658D0 JEFFERYBROOKS
1,666,290,064 *AF5BA53099018D9B90A8A492F197E8F063818DCC [email protected]
1,666,290,065 *AF58CE2D298E5A18BB309B56C263EC4959CD6A2D wesner.dominique
1,666,290,066 *AF53432D0D94D5FF0CA5E84720F4CBE0186360EE 07021829
1,666,290,067 *AF5822ACC5937C98BB2CC96ACD269797099D7F9F WEYDN
1,666,290,068 *AF531EBE40912DDC4B767CD41A4D65A67897E113 wezlee.trumps
1,666,290,069 *AF50D4107D5E409E66A13D7E9600DB5D1CBCAC76 [email protected]
1,666,290,070 *AF5670EAA194F2DD8310D066981A3E24077DAD73 09.04.1258
1,666,290,071 *AF5C999628D2E47A5FA296D10F425A9116CBB97B whenblackbirdsfly
1,666,290,072 *AF5F4D5B2E0BE170DA4F0915F1C9D6B10A1C2572 WHOOMPH!(THEREITIS)
1,666,290,073 *AF5D042F7F18602E5F48B3975126104103DF6221 [email protected]
1,666,290,074 *AF5094D0BC791C07AE5BB25EE872A6F681208D6B joaquineveret
1,666,290,075 *AF58097D459057A00F2799D5CF7B73DD940C217F JOEEEYORE
1,666,290,076 *AF548EDF85442A8BE615951BAB3FA679B08B3C3D 12:01-AM-(reprise)
1,666,290,077 *AF5879A244A221B1E35B4C7B8899FAEAC4DDD922 12161741
1,666,290,078 *AF5C78E0CD620C85F38883086AB24EA39FCFD207 128371 CUnkU-bu-yOntemle-OlCUmler-Cok-Cabuk-yapIlabilmektedir-.
1,666,290,079 *AF5518B950434F18E28F618C662EF7370A03A08F willymac1
1,666,290,080 *AF54ED0193E6D91743155991686A36C01E4F3C13 WIND PORCH
1,666,290,081 *AF5025C1220C37812927623541B20CBF1D7C0DEB [email protected]
1,666,290,082 *AF5486EE2B726538B2123A89D7F3B5EECB81B3B8 [email protected]
1,666,290,083 *AF50430C6D5A26E9263920B8DFC6004C6E088957 jorgefigueroaacosta
1,666,290,084 *AF5167EF2067797D5FF173899393C7B383CAA214 WJS
1,666,290,085 *AF5F57CEA415D18BC58C7E1B7BA65A7B35E0FE99 WOLAP03
1,666,290,086 *AF5C8C72488C8C24341F105A238B751B8D431BE7 woodhey's
1,666,290,087 *AF53642E1A8B5C4F28A93D7C5E2C1AE53CE433E3 −14 КМ
1,666,290,088 *AF534699C1F86E03B60E189898DA64200A9D7300 [email protected]
1,666,290,089 *AF56B2F2443AFDB32E1B67C075D6AA61FFDE45ED 15-beweisantraegen
1,666,290,090 *AF578DBD1428D0DB3109CE16B0A5E10934B71CEE WOOLYFLUFFY
1,666,290,091 *AF55566E4017CB63A79964908BDA57DFA185ED57 judsonhight
1,666,290,092 *AF5B2CA72A011243302FB8B3A52BBF8997D9F80A 16january1239
1,666,290,093 *AF56D73274F08875EFD9B4BA66ACF6F3C91BA180 JULIANDIMICELI
1,666,290,094 *AF51188DC0357DA3E3D0BDE10F3598EF6B67DF3A [email protected]
1,666,290,095 *AF552A5F75898C820B4D05D2CBFF0F5CA53913E0 [email protected]
1,666,290,096 *AF54ECFF4AE3C5A9A6CEF3B0AB815BE02D90FFA4 juliomacfarland
1,666,290,097 *AF5FC9E8AEBDD7A5EC6A289C070F6D479322FA40 JUMP-(FEAT-JOEL-MADDEN-AND-BENJI-MADDEN)
1,666,290,098 *AF5BFC1A131045221B6537A64C9D0A5CEC2B69E1 WWWDMUACUKNEWS_EV
1,666,290,099 *AF56B2506CB57C022BACC045E859C751C2BD2AC6 WWWKENNESAWEDU
1,666,290,100 *AF57CB42F285C74F36E1F0CCC6F7E9A7B1EC1826 [email protected]
1,666,290,101 *AF5ED780BD5E29306B3629FBF9EBF551826A44D9 jw-x
1,666,290,102 *AF5E771D3EE0C4EC9F090FA7B2791E299DB1384B 1901259 THE-QUESTION-IS-HOW-ENTHUSIASTIC-.
1,666,290,103 *AF5B0868BBF88E5902C524E86D7658F0D159E73F WWW.ROMANARMYBUILT.COM
1,666,290,104 *AF5F786DA8F2B5D98C834F046A897FDA888BFE56 jybz
1,666,290,105 *AF56BDAD2F792230D210F445B81AE345F397BD63 1920733 freud kiinnosti meit
1,666,290,106 *AF57DF82B5DAC1AE58474121FA165B6BDB45E230 19910910:newyork,ny,usa(disc2)
1,666,290,107 *AF58B27C82C82344498C003CD9BBAA211E39B1CB KAMORA59
1,666,290,108 *AF515D97ABFA8DC89BB1230EDBB9A082CE364E2F KARBOKATIOONSETE
1,666,290,109 *AF5A415FDE621E60766F2E3BF3B0D95767E76701 karoly
1,666,290,110 *AF55CE5CCB784C02B833CD69732043AAAF45A8A0 1-catisini
1,666,290,111 *AF545CC21D7CB14FAE0470D638CD337AB4EEC8A9 [email protected]
1,666,290,112 *AF551357002F6EF87A4B688307E4E3B06BEF349A 1.covened
1,666,290,113 *AF53A9B8B671CA83019E60CABB60A50344901D13 }X{-~(====P
1,666,290,114 *AF563727BFA98E443F28105B99E210DDF8CC1334 [email protected]
1,666,290,115 *AF5B10383177C9D82A680258AE9820D834BDA556 [email protected]
1,666,290,116 *AF59B0D1ECF0DC53541237A05195E5C18CEABD55 KELVINBECHTHOLD
1,666,290,117 *AF50BFB58BA342E91D24F9FFBCB71EBB1083D90E XVRBKLODS
1,666,290,118 *AF54BB83D96E48543F1ADB627DD4B82E9408B2BA KENDRICKDELEGADO
1,666,290,119 *AF50E55CAA48658EA23A948FC95F5E7F4E74EEC3 1.indians-and
1,666,290,120 *AF50FF6CF38DA8B9CC5CE62F7A89C83460A21C41 yabssor born / blood of my blood
1,666,290,121 *AF5E91F47D5BFF26A5B2D9D5D9B7FE54B16B3046 KENYA-NAKAZAWA
1,666,290,122 *AF5E2771FC6F4A10F02F5A02F6D0357590A46645 KERMITDECELLE
1,666,290,123 *AF5C9D45AA86A15E76C65BCE632078006651C7CF [email protected]
1,666,290,124 *AF5B6415397DF40FB0C9796432E6239F68E9A597 [email protected]
1,666,290,125 *AF581905EC2C5A56B2E77BF95CF9205CA0413B97 YA\Q
1,666,290,126 *AF5D5BE0AED134D764D2CA010924C0168B218F5A [email protected]
1,666,290,127 *AF538B92041C975D2763C1A5E54B0802C631276B 1lingron
1,666,290,128 *AF505D23C6C905F7F1BBE44CE150DA3F30199C02 YKRS
1,666,290,129 *AF5CAC4CCCDAFE17914963BC216EFF8E23EB5E8B 1MAGAZASINDA
1,666,290,130 *AF5F73A3A85403B027F32F2F8E86A8D88A20ED3D YONGCOSTAGLIOLA
1,666,290,131 *AF5835F77989373EDE108C7800C5C96A66BDFD55 1ONTBIJTSERVIEZEN
1,666,290,132 *AF56CB146C23A07D857FB17FF67AA48ACBD3A521 your-are-my-heaven
1,666,290,133 *AF5CDB4A0BE46B5075D3FE1CAB17A31013F2C132 1PRODENDI
1,666,290,134 *AF5C8472DD1C11E8213533CED1D158CD0C8EC72E 1-rackov
1,666,290,135 *AF5871D1E18A31E2C64075EB69C502ABCC761067 KOTEARBBS
1,666,290,136 *AF57F8EA6767D0ED63B6CCF59B2903B75299D614 yulfiani-nazrita
1,666,290,137 *AF5A520D1B5699FF80BA001E2209F3AC9E3EB0EF 1-SCHMEARTH
1,666,290,138 *AF5D9E1CE4C4F6BA864A2BDE1CD9A3877A351123 yvette-bismark-pettit
1,666,290,139 *AF581309F209A1B55EA80EF04007D1B6DB699772 [email protected]
1,666,290,140 *AF5CDED43C26D5AE765A6DB55AE7FB06ED54E84C KRISTIN-KAPP
1,666,290,141 *AF565B315CCC6A1BDD5FAE2C39E5E5622ADF988A ZABIMARU.SHIKAI
1,666,290,142 *AF5CF98800C04FC9252D667654C7F5AACB1D9517 zacharydietrich
1,666,290,143 *AF5CF6A74F1BA12ED3D700CB51267E0A20CEA526 ZACKSTANBAUGH
1,666,290,144 *AF598D78F76E4688D6CA84BBB681C2EFE86C5B10 ZACKSUSCA
1,666,290,145 *AF5642558AAFA3F92801B3A36D7E925C65255702 zemet-dao
1,666,290,146 *AF5FC140D56C9B62F3372BFF1565AF818E0266C9 1 SENIORSTAFF
1,666,290,147 *AF5558926ABE8CCF8FCBF1E8F0FB37CC103DF3B4 1.SENSORILTA
1,666,290,148 *AF54446DA19C3FBDC9D9AE0C561C5F6ABF79FB28 1SH~
1,666,290,149 *AF5F17BB17A96DA09D23076262E5C33287A02113 KTWETY
1,666,290,150 *AF5E33377D4D326B6C31F4576392C8C989EA6E40 kupfergesetz
1,666,290,151 *AF5D344C75C37C5CBF0D79EFEAFB932BEE9B0207 kx4"
1,666,290,152 *AF58110EEEBCE43CDD772C167BB336E3BBCBD521 KYLE.KLINGENSMITH
1,666,290,153 *AF577392F273B5289257030C37D9D6A14CF1C6EA ZHOUWENQI
1,666,290,154 *AF58447A3681351B2B0900727F3C3B3695A0457B 1TOOTLEBUG
1,666,290,155 *AF573E60DA7C2E1F8E9D601D7513716F21D96129 l4ten
1,666,290,156 *AF5C6FD1F08D03B2A78CA4CA2A98E4800B2879AC lacytramontano
1,666,290,157 *AF5FDEF499238804A79FC5E132E62D7AA7A7C384 1 YKSIL
1,666,290,158 *AF5B0EDC591E7AEC33DFF2F9B169A7DA5E8ED514 laissemoipetitefille
1,666,290,159 *AF5FFBF761C73271CA4263A22B1DD6C4B9C03C8A ZTSCHPPRSS
1,666,290,160 *AF532E55803563227CDED62E701C230213895D7A 2035317 cdchenkil
1,666,290,161 *AF5CFF080FD98988C7F3CFCCBB8E2BFF1C6D8656 206854 OPPORTUNITIES FOR SUCH INVESTMENTS ARE ON THE RISE
1,666,290,162 *AF59975027A4B0AD0A5BBB9A4035084A87EDBC55 20grankin
1,666,290,163 *AF59F43BC91EC21DE88BB19FFC67D58D57AC377C LAPPILLI2
1,666,290,164 *AF5C8969E3DD035DDEBEEAD00ED6A26F756CD9C5 2354945 MIKA RINNE BEA SYSTEMS OY 1.59.09 +53.53 279 .
1,666,290,165 *AF54D425A223B85BD8BDF0D5782C06B728F957B7 la.vielle
1,666,290,166 *AF525B7B091194BB37773C924AB6FC5728BE8488 [email protected]
1,666,290,167 *AF515CFBC3EAA9622FDE31B16D23B917A8856B1B ЗАОЧН
1,666,290,168 *AF5454D894853A827E82C3387E2C4C68D64E64CC 2811852 RAATITOIMINNAN TOIVOTAAN LIS
1,666,290,169 *AF5CB295FE6C1B85313CA1CABBAA278D39C12013 клампетт
1,666,290,170 *AF5238DA125F7148BB19EBDB21CC56CA9DDD0197 ленківців
1,666,290,171 *AF5A58D78798EF40877E4C389E693A7DEEA028D2 НЕАРГУМЕНТОВАНО
1,666,290,172 *AF586FFB7B442358D8051FFDBBF3B6928F7B85C3 ПІФОДОРИДА
1,666,290,173 *AF5EE45EC64178EDB89B2C46263EB2772A5B45E9 LEONARD.HUGLE
1,666,290,174 *AF5D7418A61FE60A8B535CC1B5E4E2EE416AAABE 2-euphonium
1,666,290,175 *AF54C0FF60CB34517E620F5C8099AB79A4C18F94 СГУЩАЮЩИЙ
1,666,290,176 *AF551073C1200C066D36F8E2BC2A685DBCA0B15F СРАБАТЫВАНИЕМ
1,666,290,177 *AF579407E63BBACCDB7A4AAE681F11D5C7BB2117 2KGB-INFORMANT
1,666,290,178 *AF569E79F99057E81B4073291E94629FE091CF3A lesterurlaub
1,666,290,179 *AF510591ED511ED7FAFA6FF3F1D461695EFD3B78 2konfiguraattoreihin
1,666,290,180 *AF509BE22FABD57AA23080E23CEE716A65DF37F1 lexy/autotune
1,666,290,181 *AF5D766A8D09DB2ABD595EE3BC8429C13FD616D7 2PLUKBLOM
1,666,290,182 *AF534D864D5FE0EDFCED578187B60938071C0F64 [email protected]
1,666,290,183 *AF54154710B13A93678E04B9787E78F2AD4F4D0F libational
1,666,290,184 *AF583A7031625E2F5C8C8C4FDE5757C7965AB7C8 2taiturillista
1,666,290,185 *AF56CCF296DE04BB4756D16113FADC8CB81D9125 2-YHTEYDENPITOTAPOJEN
1,666,290,186 *AF517F83D47BD77F811A4E718F67ED08F819564D ЧЕМОДАНЧИКОВ
1,666,290,187 *AF5AA8121B587FF81BAE40CBBE3BC2B994D81103 ЧЫГЪЫР
1,666,290,188 *AF518DE3F600F68D071C3BA46D373DC888FD7364  ЖУКОВОЙ
1,666,290,189 *AF55873633E05D3E9E727147E08A3DE4B00EC469 lieusaintamand
1,666,290,190 *AF59D82EF622C4CCB28744B4236BCA5CC4247D71 367709 abfall.in.plastiksaecken.wird.nicht.mitgenommen..
1,666,290,191 *AF52E2B5A3EEAB082FB14ED350AB962CE25665BA 36MESOSTICSREANDNOTREMARCELDUCHAMP
1,666,290,192 *AF571DE6E13AE27E25B157A0842BF94E8F9CF327 3HCSNAREV
1,666,290,193 *AF53F2975FAB06E14548A610B5C72C760D5F74AC 3HEMELTERGEND
1,666,290,194 *AF5EDDCA424FFE1AFCE56C13A320BA5D1EF41D63 3.HIZLANDIRILMASINI
1,666,290,195 *AF54FD00062910093FB686C496F63115C8317BAF 3ilovegarfield8
1,666,290,196 *AF52B66A65D3A40F0116C39C8B48FACD3DE17836 3MASSHOUS
1,666,290,197 *AF56D9CF1B39C02A5553B299FB2FE4B292B5B236 3NH9D12I7IC
1,666,290,198 *AF51A83FFE7EFC93E2716FE73CFD25608F0B944F 3P.~O~o.>B0
1,666,290,199 *AF5D62FF81792F466726069AFAEEF14ACDF8EF91 ,北方電子與貝爾的工程師密切合作,致力於研究將類比話音信號轉換成計算機代碼的數字交換的方式;北電借助SP
1,666,290,200 *AF51DA4479DB384CAF3222A6A9026D66C86F8602 loohcssprod
1,666,290,201 *AF559B42EF696D304769DE194AE89F0D8A2F60CE のようであり、大きさは5M弱。雷の
1,666,290,202 *AF583096ABC6B652C65AFC98AB02C5ED46D475D7 4BAJINDER
1,666,290,203 *AF56A100F25DB9278CA75FD459D5FE50B6AE31D7 4CERATOBLAST
1,666,290,204 *AF52CEE100BBFDFF057BC790B5EC35534BF127FE 4DOORZAKKINGEN
1,666,290,205 *AF5EB6FB2DD486E1C7C676C62562F37FB17EB523 LOUIS.FARB
1,666,290,206 *AF54FA5A387CA9F4B27ADD85CD827DA3526288EF 4FBL4D3R
1,666,290,207 *AF52FA4E47F16F40D0CD2C01D3F1D41271E905F7 4kammermusikreihe
1,666,290,208 *AF5D306D6363827BC7352AF0FFBF9E842DD3790A 4.modernistisesta
1,666,290,209 *AF5BA38641841B817FAD0ACB3F3920AB28D1770C 4NEZNATMU
1,666,290,210 *AF5683D835E1ABB0E7401723373E44CD87791687 4NOVELLISI
1,666,290,211 *AF52D3441453EC0024C97DA7D6C4ECF6047DC4F0 4OTORPROLOC
1,666,290,212 *AF5A9CD240C0D570CC9678C5C490B305FFE8CF05 4OUTSETTLESHOOTSHOOT
1,666,290,213 *AF5169977D102C686784E0DA98445C559C5BD9BC 4PASCALCRAIG
1,666,290,214 *AF507C8680B7D2D6B75845CA0A15FD996856D0AF 4RETINGEINGS
1,666,290,215 *AF5DEE8F5F3B5BD4915F9979A87A0C516740EDA5 4THATMUNCHKIN0
1,666,290,216 *AF564BB8C48BD8AFA33605B2E139AD9EF47B99C1 4VORNEHEREINS
1,666,290,217 *AF5045A57ED674CBF8BCDEB32A6E5CB88188A9E9 4-zuzustecken
1,666,290,218 *AF57CF413E5FD117FE8DAEE07C64F18084B56437 534VIRGINIA
1,666,290,219 *AF59605030C66804CCE75A1613D702C8D720693B 54N7N1N5
1,666,290,220 *AF5B91AEAF369E8D303D65645EC6AADFE8D5A838 5ALEYBSW
1,666,290,221 *AF56C3E44B7702A75A920D29EE6394907F424312 m39hi4039
1,666,290,222 *AF509C6265F849D6770FC610B4E27A1E40DCCA15 M74-4-0
1,666,290,223 *AF53B2575B280446A7E66398CE1AD9C764EF5FB1 5ERADIATINGIT
1,666,290,224 *AF5725127BAA7A614300CF940F95BFAC55FC699A 5FSCHLGN
1,666,290,225 *AF5EE4AA68A651DD6BB95D3B9458668743FBE32C maggieswan
1,666,290,226 *AF5DC2D5F331C17E5195F9719AA7D927D5563316 MALCOLM.DREITZLER
1,666,290,227 *AF54A49ED7CEA0D54B07C3455CD14E3D8832775B 5OCTOBERCOUNTRY
1,666,290,228 *AF5D8047C10EAEB7787926FCAC984264999BBCF9 5OSIASIAA
1,666,290,229 *AF5387EE52DCFD6CB67A8908C2E2543A05DC3CCA MARCOLOSHEK
1,666,290,230 *AF5D440DAE03ACB230B83EDE3F69C6850D5FD3DA 5RHEUFTIM
1,666,290,231 *AF5F71BAF4E646A640DF57E714CE40CE27432156 MARGOT.KIDDER
1,666,290,232 *AF5950C50634A4644526F6B803624F44DA8B5354 5thattimber8
1,666,290,233 *AF50C33890FB90A7B4380D5AEA247D8607EDFF16 603017 eronmy
1,666,290,234 *AF512B43DB4EF120B722E6A42F4DD1DB5102D934 [email protected]
1,666,290,235 *AF51C48CD5817FF65CAEB986E121192A0A6312E7 01C364C8AA8B24A0E2B97816E426565C 101OPEN
1,666,290,236 *AF5B875F4EFA224A6C5EFE16F4772D455CA59ED1 [email protected]
1,666,290,237 *AF5429242BAE1F4A9A35664B6EB7EB91CBCDA4C4 6ABJUDGEDS
1,666,290,238 *AF56C09ECE171EEBF65E5E5FA4B417F26B062B85 6.ABRECHNUNGSSYSTEME
1,666,290,239 *AF5B0E3C9F3F91BE376A9E24492134F0AD6B2F13 6AFFRENANDO
1,666,290,240 *AF5E3C6EEFE74A565026B81DEE016D5CF71445AC mattdidemus
1,666,290,241 *AF5497D3A4A2D276AB63A48FA9536AE44F161ECD 09301888
1,666,290,242 *AF54860CF3757587D8ECDC8F1EAA634FAD5E9940 mauroyanni
1,666,290,243 *AF53B50CC115C47F910E48C4CC4221DA262786C3 )0(.~.`.q====p
1,666,290,244 *AF525D3975FA9374E0BACC04C3E8F2D40B9B5F02 10281162
1,666,290,245 *AF5DABDA1F520C9B72995EBB8A8B806F4007E75D MEL.LEBRANE
1,666,290,246 *AF556AF4ED5A7D43A556B39A0991DD39DF59AC7E melvinwheary
1,666,290,247 *AF5385B9413E467E2A4C3FEBB491DDF6C46173FD METACRILAMIDA
1,666,290,248 *AF59E10486EFABFEBFA160B360DC7A827FABDC31 1291398 das-ganze-koennte-erpressung-genannt-werden-.
1,666,290,249 *AF555381F13AD6511A44B43C3C2489F4C57FFA7B 12 string warm-up/the trains don't run here anymore (soundcheck)
1,666,290,250 *AF5240F4BC2DCE3EB186CA2CF9AA1F130D3612E7 [email protected]
1,666,290,251 *AF51AA548B3CCDD134C999444AE10A3887224CCE michael-gathercole
1,666,290,252 *AF5C074814301BEA3C69C888380BE27C36723168 michaelmonfared
1,666,290,253 *AF59EC6310A1EE64CF5D10DCFDACF3E4BAF86B78 MICHAEL.STADULIS
1,666,290,254 *AF5B40C5D298B4B044C37E0C12B68D3A0B5B1BA6 michalecresencio
1,666,290,255 *AF53B6F1DA829D82063355FBCD1AFF58A3A1F711 1450485 elias-vinberg-saikin-sotilasnimens
1,666,290,256 *AF5F191F3916D6A76B47DD6BF1CF6690AB5D6F76 MICKEYRICCIARDONE
1,666,290,257 *AF5C38C05CE7E594C5C7851B56F874FC0FEB71B1 6SACHVERHALTSAUFKLARUNG
1,666,290,258 *AF50683C0F80F0F3DACB73981C50D3E0AB2EC0CA 6SAIGALEP
1,666,290,259 *AF57BA6F6C04F5203DED767599B36A697B2F330B 1548374 KIVUN SIEDOLLA TARKOITETAAN SIT
1,666,290,260 *AF57F33D81133FC3F3FB3E17DC49538604E0D5CD 6SUNDANCEMASTERS
1,666,290,261 *AF5071AA0D94CF5B411A6BC6ED3812CC80C7F7C6 6USFULLEN
1,666,290,262 *AF571F89C6578022E0A1BB0DA926B983E69FF223 MILLENNIUM.THERE
1,666,290,263 *AF5EB54EF12235EE1573C22F8C511EDE477986E3 718ariel
1,666,290,264 *AF5DEBF08E08EF4F4E35C142C3FF260D8028E2F9 74DB4935
1,666,290,265 *AF57071CA28800E2078D59DEF405204E70BEFC6F 760723 MITTAVIIVA.OY.TEKEE.UUDIS-.JA.KORJAUSKOHTEIDEN.TY
1,666,290,266 *AF5D8374DA265232EDAD4C59228819225B07A836 7APOTOKOS
1,666,290,267 *AF5DC1B10DA9FB748E59DCDC28B1175CBC3AC88F 7BALSOPETO
1,666,290,268 *AF5529940F268D47F63A0BE1FFBEC826C61F4CD7 7CHIPPERCLAIRE
1,666,290,269 *AF5C22B300D1BBB7BC834E4C29DFB36186A33360 mitchwright
1,666,290,270 *AF5EF72FD866E411393824A6F52BF56652C1E620 1.ANWOHNERTIEFGARAGE
1,666,290,271 *AF5C64A68789357DDDCE291578232FF8068336F0 MOAFI
1,666,290,272 *AF5ABCBB550660BE71CE40C572276B0D75F4755A 7HAVARDAN
1,666,290,273 *AF5C003EB4E1CA33325F39544B3170121A5AA478 7iamkarin5
1,666,290,274 *AF5EB94E81BB023A7F9671BDD8449D30DC67C941 7JESSIETEMP
1,666,290,275 *AF52ECD5DCC9C5D324E04ED9052EB028C87667E6 1.cheder
1,666,290,276 *AF5EB5BDC7E8EA7086A2BF33899B1409D5D6C43C 1COATESVILLE
1,666,290,277 *AF5E5A97F56F191D76D634E6D563060753181B13 moritoshi
1,666,290,278 *AF5B1F38DA56A836376B07E64488D8E5ADEFD02F MOSETOUSLEY
1,666,290,279 *AF5008CBE52C1DA6627CF492B712DE471040F1B4 1KENNEDYERSKINE
1,666,290,280 *AF598CDE4A759088D14C231A3D3804CC17CBE7FD 1.KHTTILINTARKASTAJILLE
1,666,290,281 *AF500D043C186C4B464A110073FA998133246FFC [email protected]
1,666,290,282 *AF5FE9678A8C7B2846132A82230DB14209D048AD 1KIVIHUONEESTA
1,666,290,283 *AF5C169576C14A316E609FF6B75FF91A450C5C9A 7STARVAMPIRE
1,666,290,284 *AF57C1D39E7B5D3D872995529824A6F590F972DF 7VENTER
1,666,290,285 *AF5F15C3E20D2C66D811860EB4A878DC0FA36DD4 1.MORPHOLOGISCHPATHOLOGISCHE
1,666,290,286 *AF5239D7A61A72891AEDDB5646BA195888F0AD66 [email protected]~0-~osplat
1,666,290,287 *AF589E4EA3015754E7737DB06A1643F5C4D4B257 840249 KUNTOUTUSTY
1,666,290,288 *AF5FB4AE3348A67834C3D26CBCB451AF4AD26393 musettms
1,666,290,289 *AF5141968F3321352B0D8A6245CC1501B69BBF01 8BRAVOPIE
1,666,290,290 *AF578032075B9F26EBB5B5DFA2E8A3ABDF9DA021 8CRACKERGONE
1,666,290,291 *AF51C3A2EF24D9BEC79F73C09D28C7A64DF1FAD1 1.protokollwidriges
1,666,290,292 *AF5A1CF9BF1DC89A149E40B489BEDDE739261D53 1RAUSKOPIERT
1,666,290,293 *AF5015282D53235F0F400C96AF386F266A110EF7 8ESSAIERAIENT
1,666,290,294 *AF57621EAEC7714ADFF232E30039031431B67B55 8FLAKA8
1,666,290,295 *AF552C71D2F332986E8EBC1E035915201F833AD0 1SPINDLEH
1,666,290,296 *AF52E7A446576CD83CCAB079442AE28CBC331158 8GQCBQLXNAUKG
1,666,290,297 *AF597AE94957C12E5AA40252E3677F58F2FF13EA [email protected]
1,666,290,298 *AF54E5910A079A21828E3ABECC3E9B73E44B52C5 myaxx
1,666,290,299 *AF5A97EA3F2544A39B0EB0796E7450C17D2E47DC mydoggy777
1,666,290,300 *AF5E6DC0158A9F7744897A601488E41A557C2BF8 8JOGRIMET
1,666,290,301 *AF51B90E5E6D61A1B6E11AB7F19448FF8E3310BA MY_TEDDY
1,666,290,302 *AF58EDE9EBA30C6B8CEFA2825476BDB863683A63 [email protected]
1,666,290,303 *AF5B19C4FC6AD727FCAB4EA97A2CD58F8AAF05EB 1-ugas
1,666,290,304 *AF523CA86CC18A7A5125D7C1109EC55B8B5D2E4B 8NACACHE
1,666,290,305 *AF5F494F5CB834E64FCF482AF2A97758B5DB36F2 8######>-~-`-}O{
1,666,290,306 *AF5103443504850B4B0DCBCFF3F505A7941E2F1F 8======> ~o ~o (-_0)
1,666,290,307 *AF57E59581B41F2E7FDD25F8460FF910DB773033 1 YKSIL
1,666,290,308 *AF50940479ACF5C108CF9AEFD4F0A6B0EB61262D 8PORTUGUEZ
1,666,290,309 *AF54A40A285624ADABDA9989D0AB490B5744730B Narcsss+cally
1,666,290,310 *AF5ECA7F6066B99D2BD7893DC38AEAC5963EB879 8SIDEARMED
1,666,290,311 *AF5A5AEE5D99636EC1B9D2273A553C78092600B5 natali07809
1,666,290,312 *AF5AD54279232F2BD454561E80C2E21015497FF7 NDAREN (DISC 1)
1,666,290,313 *AF56FEBA69A8A7282BDBD390474E447518D24648 2345675 fraupholtealsoihrautoundwarziemlichfroh
1,666,290,314 *AF5C2B65E64CACB6D34EB370C24E14678C1ABE91 NEDAVNOJ6
1,666,290,315 *AF5048C5302007E8E89790D4D9A2E6881B26E874 nelsonfonck
1,666,290,316 *AF5C7B3E94270D1840981E1C7763B7EC3F633960 NEM-AI
1,666,290,317 *AF579DB5D139CFFCAA9415293E9EAC472FF784E6 NESRETNIKU1
1,666,290,318 *AF5795B2B3D6A2A88339E079D07739ACD68AC8D8 9AIZZEREBBERO
1,666,290,319 *AF569276875922273747C8AEF29E5A289620855C 27111241
1,666,290,320 *AF580553BED27258A6BBF99C83069F0CD9CAF54B 2981195 ARBETETFORTSATTESAVKARJALANSIVISTYSSEURAFR
1,666,290,321 *AF53354BCD4140E55A938983D902DD87C81EDA29 NICKMOLYNEAUX
1,666,290,322 *AF5D749B744C830BCA77C9174029C6B190F64AE3 2flan197704070
1,666,290,323 *AF5F738BC73943475B74FD91D4FC9BDC6D01ED65 9JAN1655
1,666,290,324 *AF5F489A5518EB8B1D3643FF3D973206C3C35CCC NOMEALCANZAELTIEMPO
1,666,290,325 *AF5265886D2BDA7AA71113F49AE81A17C6A84434 9METALESBSW
1,666,290,326 *AF55F48C959FEB42B52C94F46825E2FDD5E9D1B7 2ND STRING MATHMAGICIAN / LAGUARDIA BY CORPSELIGHT
1,666,290,327 *AF5CE319D94CBC351BA736D2B97637BC9588EE65 noor.alhabib
1,666,290,328 *AF5182C73047D862AC69EE4E75CB9B59B175A8C8 9OMETHODE
1,666,290,329 *AF5C01071307D7142BF8A3CBBFB840CB1125E163 2 SLAPOSTEN
1,666,290,330 *AF51245ECE78101A61144A8378F11D54C4CF3FBA norbertodirksen
1,666,290,331 *AF590D35EFC25427E536B0B23CD13730A0888321 9POLITICIANREFORM
1,666,290,332 *AF5E9ADA67B7C4FD30C1E0C19707968D581B9C1D 2.sUlfatli
1,666,290,333 *AF5CEA787A86E1EFFA7A40773D1FB582027A2437 2.ZEMBEREGI
1,666,290,334 *AF52E92A825EA246E147DAE5FB78C0AE004F1CD3 NOT4
1,666,290,335 *AF50DC59F147D988AE8798F7A4166A50E54E8AA8 33-mat
1,666,290,336 *AF526BAB1A82D7256605AB2055170D0381211AE3 9RNTHCHNT
1,666,290,337 *AF51399F264EA33B1CF4F874CA34141DB99032FE 9SGNICRA
1,666,290,338 *AF5DAC34872090692B9629A16CEF367607CFA7A9 386036 takipte lezyonlarInda gerileme saptandI
1,666,290,339 *AF5047E0FAAD99871C0E2A1671C2DCC50209F631 nr4y
1,666,290,340 *AF5C95F4C8324746465971945714512E7117B4F0 [email protected]
1,666,290,341 *AF5C453B8DC7D6C732E966EED45906304F5D8B4E a0hqm
1,666,290,342 *AF524DB87BB291C1FB5CF8117EAA3AAC3B000386 O}FV
1,666,290,343 *AF5AC66FDF19A62C32E0C3B6DA414C21D88182CC A7PXQ
1,666,290,344 *AF50928974EAF8280DBA17A24ECCE5F1F01F7A07 ONQELOS9
1,666,290,345 *AF5AC2E995427C80F6D4B98B81DB8E54B0FE9B8D [email protected]
1,666,290,346 *AF52BDA1F268A0572E10A8BC90349510EB344ADF aaa]-(
1,666,290,347 *AF521FD15449DEFF45671AE99C00CB996004AA83 4DCHTRBJ
1,666,290,348 *AF5EFC1DFDC119B8EDC719D040A61FAD26723AC3 4DELAYNG
1,666,290,349 *AF5F890175807448B81E2A0C0D1E55AEC9A9E90D aabf``
1,666,290,350 *AF59C9D8D039D8A279BFC5B416E89EBF225134AB 4LLIMYNAM
1,666,290,351 *AF58252AB8DB65EA6565A99F5C069FC110479693 AADNB%
1,666,290,352 *AF5EB2A4F9C6CBBAACE796E9EFE67180B2BDD895 AAE885
1,666,290,353 *AF520599E6DECD4BD3E3CA47BEE39646E0712FDC aae%^d
1,666,290,354 *AF54227C307D082A8F9A29672BDDBF650AE9AEE0 4SNODNAHCRAM
1,666,290,355 *AF582C418DDEF3E625D3A87B36FF7AB3C91238C2 4STRON4UTS
1,666,290,356 *AF598935A333DD81891901695EFFFBAAF8AF572D AALYASENI
1,666,290,357 *AF57204A884C332F83106D7D1981A8078A2C4F67 aangebermde7
1,666,290,358 *AF55509AB7DE1CF6E4FBD664EA1C6913BC0772A9 otkroite
1,666,290,359 *AF52E2E97340EC397AA9B4DCE649262D2358CA14 [email protected]
1,666,290,360 *AF58B67EB9D0BA5D0B7E232498309E6C45C625F1 ovenstånede
1,666,290,361 *AF5089A25E2B3F892A7477C5688B3B9AB5DA226B OVER-FILLS
1,666,290,362 *AF51B930025D3329A5AF0032736A10666335C21E 52DDB015-ADD9-3FFB-9EEF-C0C8DC388474
1,666,290,363 *AF5AB3F6A04A19F598DBEDC63809A8064A348810 aazfm
1,666,290,364 *AF527C52B43781EF587101B3F40F7CF74CABE3B8 5CELTICSKIDS
1,666,290,365 *AF523DFAA6108594795E9010EDCDF4D02635836D abisl
1,666,290,366 *AF505500047990326B1F4D544A025ACFCA0FA624 5:if($integer!~/^[0-9]+$|^0[xx][0-9a-fa-f]+$/){
1,666,290,367 *AF5B553ECA8CFF0A9828BFD6BF47DE42EEABE2F5 5TELEGRAMMSTIL
1,666,290,368 *AF50DA362B24FFF429BFDE7F65D32A52A726F3D8 acladdagh
1,666,290,369 *AF5B4921891A179B74B1462EEA90F4572F6F727A PATRICIA.KEVILLE
1,666,290,370 *AF52789783A674C8D848573F5BD4D7CE0C520874 5XCOUNTRYWQSB
1,666,290,371 *AF573840F0A6244D95868A21555549A6EAC720F5 ADD_DATE1189276265
1,666,290,372 *AF5D974A843F9A77408383261603CDB0B4F6D486 620050 paikoin.on.rantaan.asti.ulottuvia.kivikoita.,.v
1,666,290,373 *AF54C59223BBF0EE88ED326296BC7A9EF52950F8 629474 aku'dekiatilimlardeprem,seldinlemiyoreditoruzm.
1,666,290,374 *AF56F33ABE5E524C4363253429850700365166E6 668583 MEVCUDIYETININ-VE-ISTIKBALININ-YEGANE-TEMELI-BUDUR-
1,666,290,375 *AF53F587D69B19A5446C36EE71A58CE385AA50F8 p######>* * * >b0
1,666,290,376 *AF56800FC11F1A5FE215E36FEBB9FD51B15B03EE 6BRULIONS
1,666,290,377 *AF5D127F772A36D47A6A715B38BAC8B00D958282 6CLANCYDANCER
1,666,290,378 *AF5F31F2C3E8C766A811DFB97A0D50C843D9A8BE [email protected]
1,666,290,379 *AF54C95E363A4AD8DA45663422D79B3FE20DDD82 [email protected]
1,666,290,380 *AF5BE4AF73830C8DBD9B1ACD0482F792C3AED0DB [email protected]
1,666,290,381 *AF5D8FF1886BA1489C825421958768ACF3CCF486 6ENTWICKLUNGSPROJEKT
1,666,290,382 *AF5A090A757ABB3E383A4A21AA91B89CCBB638EC 6ETZLIFRE
1,666,290,383 *AF5A00CBA4022A3D95C8237A74102057465D93F3 6GOFORITCLEANER
1,666,290,384 *AF50BAA140D9DC0D04FE4D28FD0FE008EAFA0121 6ILOVEHERSHEY3
1,666,290,385 *AF5A6BF28BD0F736388747C5D6585C745030AB8E 6ILUVDESKJET
1,666,290,386 *AF5E148EFE1DD0D25581FD3C6E1735E77B78A7BF [email protected]
1,666,290,387 *AF59C020071DEF53A4411AFCBE0F6ACA48A84F5E 6NAUTIKU
1,666,290,388 *AF535C73699B7A0245A7756081C3540B3182D324 a-gestalt
1,666,290,389 *AF5028039B1E19A23F073BF734874BB036118F71 [email protected]
1,666,290,390 *AF52A9AD70E6BAAE602A3F5E631D3CEBB6374205 pizzalakers
1,666,290,391 *AF5966240A72D57A19F71B67CC0965CF5101B2BE 6SCHUTZUMSCHLAGS
1,666,290,392 *AF5B540E77F0938C5601DEF779514881AC5E1846 agua-alta
1,666,290,393 *AF5E0AE397B9CEA0BEC51448DD157ACE3EB1372C 6SONGLENGTH
1,666,290,394 *AF5CB00DD6AB7D5E38917A6A275116B45934F9B0 PLVORAS
1,666,290,395 *AF5188FCD13D99E466303DAB454F879D1F86AD24 ah=ii
1,666,290,396 *AF54217FA7F433264A75BEE9B66F82B5B3028496 AIUTEREBBE!
1,666,290,397 *AF589A5104F867DF9A09F842FCF34ACEF2FFCA7D A(J1?
1,666,290,398 *AF57AF7B04A7230C58AD60685D61DC878E4A1F13 A JE PRO
1,666,290,399 *AF5C27E344A457B633F921460B0204514781726A PORTER.TABBERT
1,666,290,400 *AF5AB39BD400F89F525D5227D06F92471D2A5453 PORTOSATSER
1,666,290,401 *AF5FB40A1D0F9B9D35CFF9FD0049D42EDC42DF3C [email protected]
1,666,290,402 *AF595390DE1C0BD359FC0E301B9A81C6A85490F0 [email protected]
1,666,290,403 *AF5D96F5E7C202B68CFB456E9B87156FB2C74516 7ELWEISSE
1,666,290,404 *AF573D183CE8EA1BDF8ABB085FFEB5CA608D07D5 alexradie
1,666,290,405 *AF54EE27E475C93FD5C31146C618766A5484C9C1 ALFH-
1,666,290,406 *AF527FF6978ED4AFEB1D3FE06ED53EECA19BF4BA PRINCIPE-LEOPOLDO
1,666,290,407 *AF55D0FCECE122519182247EE2244503DD572FC5 PRODDEDV7
1,666,290,408 *AF54D9E19C0626F601F15A2E5FBFB370998150DA ALKUSANATING
1,666,290,409 *AF577C57B62A7D9AB0E6EEDEEF0A6D3922846D28 ALLEN.ROTCH
1,666,290,410 *AF506DCE2281BF7C22B33DECA45842DB65E93B04 P--->*.*SPLOIT
1,666,290,411 *AF57C47AB06329B3860B151B86A9EDE584845A50 PURPLESQUID
1,666,290,412 *AF5F989E9B60E03D4819B04B1C2919102B3CEAA2 7TRUNCAREST
1,666,290,413 *AF566D6D318B8484D26B10315918B025823581EE 7UCKERMAN17Y
1,666,290,414 *AF51E20100A231C85DF7BB5132FDBC0F56231690 PZI:
1,666,290,415 *AF55EE5812C0461F8BF105F6DD4F0BE71D8C056A Q4?U
1,666,290,416 *AF5B034EDD6FF80307ED73DEBFF70C9FCAADA24E [email protected]
1,666,290,417 *AF53BE9A92170E7E1449F026A3AE3860FAC997DC [email protected]
1,666,290,418 *AF5A2A56DCB77321D41F095F33AD472FC747571B am#bf
1,666,290,419 *AF5ED70167175075F733A156EB39DE02B77A0583 [email protected]~(O_-)
1,666,290,420 *AF58221CAE222A1C33D45183C216ED6AC1A6E678 QP~~:P
1,666,290,421 *AF5A121174FB4737A9CE502E7A34D6FBC8590477 Q--) ~ SPLAT!
1,666,290,422 *AF522049F25105E1222EE92F6425E3301AE4BC9E ' AMY-11
1,666,290,423 *AF59A025F0EF39A4AA76B774049F503B2916D1C4 RABBITTS5
1,666,290,424 *AF537A119E55D8ED916694D9D26D66B0A3569871 8JIMANDA
1,666,290,425 *AF589891AA63D0F55A607193656EA40B0FAC411D rainsamson
1,666,290,426 *AF5D3234E0FFD5DEA7BED9D38B769ED143D1C34E ANGREBSMAADER9
1,666,290,427 *AF52B93023E33BAF08B911F105B0503F74DF152A ANIMAX第59話預告「天之瞳,地之門」
1,666,290,428 *AF51951D116670AE8895BFB1BCC7A00E0A3E5877 8###p
1,666,290,429 *AF58F1DA22C8E070F52F4340FE20604680AEAE85 ANTONYALCONCEL
1,666,290,430 *AF551BC14CA22AD0515646E27D95F9544FF0CD83 antwancelestino
1,666,290,431 *AF547BC8682E3D0C9CC0245BB5B08BE9683F5DFC 8.SINIRLERDEN
1,666,290,432 *AF54F087A47083C130A381492C1E600E1A08B1E6 rctvnss7
1,666,290,433 *AF5F4359E40AA7BDD29B104384A8D113245F2625 aobd3
1,666,290,434 *AF5E18B54469F0DE7C37E6D288BB432FCECA0E69 8-trockengebieten
1,666,290,435 *AF5AED6608DED9309DDBDF48E0D19DEBB97E7B3F 8ZNWOAGBWKCRC
1,666,290,436 *AF531DAB7F234930CACF06B2045005B945E72928 958615 bluelux.sinis
1,666,290,437 *AF566C240334026ACEC2A2C1A36031D208D3142E REGINALD.LARKO
1,666,290,438 *AF5384BF5DEAA003AB7B9615829082D13B5D9E5C ar2rz
1,666,290,439 *AF5E2BBD6F57BFC14DFF29248FF7292062B77251 ARHB
1,666,290,440 *AF56A7A3A4CF8A9933A22697065306CC00B0107F 9HEARTSLINDSAY
1,666,290,441 *AF56D6AB864F0D6041400BBA68938D244B863635 REZNORFROGS3
1,666,290,442 *AF5B84CAB89EEC032193F4EE559AF1B04495609D RHZPDSTING
1,666,290,443 *AF5F41085819F056F09C16CE7414B26D9CB4A36B arthurtrickett
1,666,290,444 *AF5724694DA72D36ED3764CB57F724883624E359 ARTICLE2314578
1,666,290,445 *AF537B2D4C0A065D846D965424E74ED29F4F7DDB 9LYRHIZAL
1,666,290,446 *AF5050C0F0579390E83F8DC924AD64A430037914 [email protected]
1,666,290,447 *AF536437F939B720ED04CEDE4D2DA466A5049B98 9ODIGRATE
1,666,290,448 *AF580E9333146AB44E41F5788AFCA95AE1E8D46E ashisbsw4
1,666,290,449 *AF5D03BC17366C0462F4FFE18A8D0FBB45989E4F ASHKHAN
1,666,290,450 *AF5ECBAF8AC0055FBAD738A943C1C7B80DCA83D0 risulter
1,666,290,451 *AF56BA21E665AADB60AD657E070EBECB0E582A1B 9THEVERONICA8
1,666,290,452 *AF5EFF627CAAF9AF759B676D6023199F33687EA5 ASSIMELR3
1,666,290,453 *AF587D32C6AB3A5E5CF17F93A6624761BAF8AEC0 9YAUNAAN
1,666,290,454 *AF552ABC6256214109C477B1A5A9251CDB318A8E 9集更換譯者為洪瓊容。其中英語版的銃夢被改名為『BATTLE
1,666,290,455 *AF5462CC44B79B9359F4A25B072958AE10981AD4 A-TG
1,666,290,456 *AF57AA8351AB3B70125EC4FF5C1D4796C0D972EF a2b"g
1,666,290,457 *AF5FA43E06869D01073D5224CBA1D5F2A447137B A3o5
1,666,290,458 *AF59C43159627B301B168563A7F0DFA4D6EB99FE RODRIGOINFANTE
1,666,290,459 *AF57EBD8AFB443EAEE2951FF21A2123BE39958F3 auh-(
1,666,290,460 *AF5F48C752917D5DD727D0601BE2E56B5D6E3FA8 A(8G
1,666,290,461 *AF5ADCD6F65E17E64DF95DBC03A01546BBDA493F rolandsloma
1,666,290,462 *AF5399A261CF5D9350F2B3A465FF2D4E16C1E674 AVARELLE0
1,666,290,463 *AF5D946989113A4823E815923D9115A8D943F46A RONDLOPENS9
1,666,290,464 *AF523FF4D28CCF8942C34E1A2E9261A5BC3784B0 a$v?y
1,666,290,465 *AF5C80BCA498CEFA26F5E639000BD8823AB10937 aab(wl
1,666,290,466 *AF5AEFE992ADCFA4038593D96E41F6DE378F8939 rowena-pugh
1,666,290,467 *AF5E208F61DEB12A5A8C55926BC38B285C9BA45A roxannesearcy
1,666,290,468 *AF5432F50C98DFE0B2B01EFB868BACF70B016122 AXXQ$
1,666,290,469 *AF5AB48AE222E10B528F3F07C38F7258F4CA48AC a;ata
1,666,290,470 *AF5A1CBBA803FF0A49DD5D2C6AEB64351518034F azzam.azam
1,666,290,471 *AF598DFF452064ED72A44723B17F8439E0629C1D RUGULOSUSTALKBULIMUL
1,666,290,472 *AF51AE1B2CAC37E9D6CB49A664BF4C2A1BB49993 B01I8
1,666,290,473 *AF5ED56092D0430D5EBDF61A7CDE6596B8E8A0A6 abcopiasbsw5
1,666,290,474 *AF5912AA78D8F17F52AE811AEB369763687B5DEF ABEREARY
1,666,290,475 *AF5AB1104FCBAB411443552F4C9DB28BA25B9177 RYAN MUSICK
1,666,290,476 *AF56CE173CC0E8A79A8FDC38944247D1F28B6997 b14j
1,666,290,477 *AF5145C8E33A59D4786F65C04918F31D9324A491 ABHAYANKAR
1,666,290,478 *AF59ADC03FE74FCED712D3A451F8DB59A4439CA2 sammiefragosa
1,666,290,479 *AF5E63C875C753D79768C388643F816E85C27666 b#6g)
1,666,290,480 *AF5649593878C7C8D9C3E781A660A33AE881E9CD B7F:I
1,666,290,481 *AF5FA47B7EE1B2F63A6642AA8D181195E57572D6 b8l3"
1,666,290,482 *AF508DD1F1133B67ACDB81E76762ADA27948E936 b96e
1,666,290,483 *AF5AEAD08DEC06253787A98E5012B52698530D7A BAĞLAÇLA
1,666,290,484 *AF56DEF340122879058E7E5287F1C6081041F188 ACVR~
1,666,290,485 *AF55BA381F0B9E86DD4734330CBFB85CFEE10409 bananaquitn
1,666,290,486 *AF514F796476753E788B824040065CD77CB21DFA scheinsp9
1,666,290,487 *AF5B842301420E1C88EE3D3213C5983FBA1D7428 SCOUTINGWEB.COMWWW
1,666,290,488 *AF5BA1BCE36CD4583A1812A576B4B9C8D66B1332 ADLEIWNU7
1,666,290,489 *AF51735289614CB435ECF955D4F143396A1E8236 SEAN.LALANDE
1,666,290,490 *AF504DEE003AAB92A1E5809C12C13445CAD2FD9C SEANSTANDIFORD
1,666,290,491 *AF551BC572E64DA5DC8C0670766F639B870913A5 adriancasimiro
1,666,290,492 *AF5529A9BAEB2A315AB61534EDDD5FB3BA8727FD bb#$d
1,666,290,493 *AF54F4DDA33CEAF89FE08425ED6931E05B92E37D BERNARDOTESKEY
1,666,290,494 *AF5727B9A9387CC3EEE04713306C0177A154ED03 BERRYTIPPIT
1,666,290,495 *AF5BCDA87F1CB7913EFC463C2EEB4F26B4C05F46 bestrawsed
1,666,290,496 *AF57914571751C1E326D538BAA07076121BAC3FD [email protected]
1,666,290,497 *AF5BD44C0D2EE2F107E43C6073649C54CE85554B BiaV
1,666,290,498 *AF596010F2B701494EA8A09215C094A99EDCA616 BILL-AQUINO-COUPLE-OUT-SOON
1,666,290,499 *AF59F9A04920EB8673B8A3E2484D3CBE44808072 aimy0
1,666,290,500 *AF52A709C080F9D6A0BF2962AB5D41DCF9F4DA4B SHERYLLPADUA
1,666,290,501 *AF566837CC17CFB6CAAB4090715A0181A4264DA0 [email protected]
1,666,290,502 *AF59408DE89E1800BF1B4B7F0B137F9EA30BA464 biqo3
1,666,290,503 *AF52A4BC593B735E565AF12C3A19721ED51583A0 ajmb:
1,666,290,504 *AF5584C51C6CAD0AEF9337840176CAA9F4280A30 a(_k!
1,666,290,505 *AF59C5017F78761D09D5F6FADACA41856700D03A b/kvl
1,666,290,506 *AF5135B23405BC1360BF6AE28EE0C97292B4639C [email protected]
1,666,290,507 *AF5F4F685FA394C201567A12F032ABE02AC0643C BLQJU
1,666,290,508 *AF5083F3F1CAE654E6274FB962A2379173C8A728 bm5
1,666,290,509 *AF58555A733AE26F3CB12D4C258EC8AF699D6DB6 BMP3Q
1,666,290,510 *AF5B30500A8BA866BA954F9D726BCEE40458CCD3 ALKUTIIVISTELMÄ
1,666,290,511 *AF5674BDE0AE30367927F848CBDF0F9A277913EB si.te.contar
1,666,290,512 *AF5B42A51ECB27E0331A48E41099A1867958BF7E ALLEENES
1,666,290,513 *AF51F100B5AE079941C4578467FA0B73F7E64A38 all-the-pretty-li'l-horses
1,666,290,514 *AF5194A8AC2A9C06B198CDB6A22E1283ADE9ACDB BOKEEM.WOODBINE
1,666,290,515 *AF5CDB28FA3BA2B2E4C59A77584C522BD7B7EFC1 BoSM
1,666,290,516 *AF5C9A95D8ED043C0A0BD8168D6299E4C6EA620C SNOIRELEMME8
1,666,290,517 *AF5B43501B704A463BA7025269E57806AB260469 soldotna1
1,666,290,518 *AF5DC23BA5CB91209286A8D7825C7962F196356F SONATANO2FORCELLOANDPIANO:VLENTO
1,666,290,519 *AF5CFB743AE432289CF1C5AFAB284979FB1A9AD1 Bp"m
1,666,290,520 *AF5CFA5AEC6C9C3B09DB13F2206CA43B0874CCC3 bq+/h
1,666,290,521 *AF572B018026D855D9B5E293B4DC0E95DF24C0FC bqrsl
1,666,290,522 *AF52C6F22556B459BDF94197329CDEAF1CAC3E54 BRADYLAMASTUS
1,666,290,523 *AF5F8E2643F77EE874676B240D66221EB44AEF4D ANDREEACATALINA96
1,666,290,524 *AF585CA27213CD6CB5AEF39569E111D28A09D4A3 andrewcamilo
1,666,290,525 *AF52942E5DE4EAD56BEF57901EF666D15FD1095C SPLAT*<------B
1,666,290,526 *AF5AFD6F28DA885F1FB36283CD42D7B0BAEFB8C4 splat!o~.q##p
1,666,290,527 *AF5FD1582D39121D66365DCD1F1192895DA46B8F SRRNTHC5
1,666,290,528 *AF5B0F11B7694540BC7044009E6BBCC08132547D SSACOTUA
1,666,290,529 *AF5C5CFA3CA3C5086AC560AFFF61855D32463AD6 stanchiaming
1,666,290,530 *AF55E652BFAFF4FEA7680EEDF4F24E7664C413AC ANTONY.KOMO
1,666,290,531 *AF5D93675B7FB4919E6AF4C9637B583A8B3E3207 anything33
1,666,290,532 *AF59B4BFDDD6751B99AEE479C4ED741B639A805E BUDDYSANS
1,666,290,533 *AF592E57B8160B5B8490B6941CCC9F672DA70F04 BUFFELDES0
1,666,290,534 *AF573DC8E619E7D060EB7218A3342C19578C8924 APSO&
1,666,290,535 *AF52C30B2954DD139454AA3908AF6C7ED54C4989 stick it out what's the ugliest part of your body
1,666,290,536 *AF5AF60736B695C1D44608B97236DB6C0C20B374 ARACELISORTIZ
1,666,290,537 *AF5EA2B0230612F75203BBD8DB569F2FBBD4E558 B,VRJ
1,666,290,538 *AF51C91FFC3B88A5C716613FFB797E834DEF4244 [email protected]
1,666,290,539 *AF51B9592AF0E6C3A11AFA76E8468AD16E3366D0 bxl)p
1,666,290,540 *AF5AF04E4BB36C6D4EA5726AF78D113627495CB0 B/#YW
1,666,290,541 *AF52C9BD1E97B8CD6EE0AB105F29565E55E7DCEA sunside3
1,666,290,542 *AF53E436AAF52EB681A96FADAB572B2E8BE98944 AROZINKOVA
1,666,290,543 *AF5F756328F2346F6E66203304FA67FDB4204EA0 AR;P"
1,666,290,544 *AF59F599AABCABF772AC5D2FD2F800AFDD0F0129 C0NSTRA!NAB13
1,666,290,545 *AF539FEC115F4F734C2ADD2328CAC9A0DC95F47E ARTNEUMILLER
1,666,290,546 *AF5440FF11E5871DDCB92B5063B803698938DE50 [email protected]
1,666,290,547 *AF5129292896F6C5985990D78072526BC3AAC809 c28w
1,666,290,548 *AF5734D4A860D3FFD68E6150E7B887AD63CC59B5 C2"T
1,666,290,549 *AF59C8AE084478EFA6C605784CDCD58A0CFF39FA [email protected]+13$
1,666,290,550 *AF5E377613921559C858BED26218FE731A95AD64 C3QU
1,666,290,551 *AF5598E0BCDCA629A1673A8BCD9C4005EA987C66 ASIFUGAL7
1,666,290,552 *AF579FC5FCC7DD503A53F9E6B10A21C646F86942 asn7x
1,666,290,553 *AF54BC9B15A690C7D9BAA6E4F3DF53FA39B02396 ASQ%6
1,666,290,554 *AF5E2C4FE3C1B6B6F7D622113D92B23881D56DEB c6d61
1,666,290,555 *AF5EC46F3BE0FFB72BB2D93522B53D15262C2664 atertdall
1,666,290,556 *AF5B55AC3672ECDF29133577A65736148C744E9F atfowler1
1,666,290,557 *AF53256CF19B6B507205BC8CB8C86D26D97EB7CD C9bg
1,666,290,558 *AF5ED7E012265971AA0358D80C2DD4F3BCA5F534 taikurit2
1,666,290,559 *AF5FC50FFA81B42F3C1D0C7A09035DF1E114E203 ATUBUHS6
1,666,290,560 *AF58FCD3CE1537C350B1DEE5BEB0032CF3A17C86 A"U;C
1,666,290,561 *AF59227C8C6399E4BF80A95E0B9216194A65A2B8 CALAMUMI1
1,666,290,562 *AF5E169E7F0276D03F8047983B690F6B0EAC407D [email protected]
1,666,290,563 *AF500B40438ABA92F9ACF4C6E5071E2DB5E65C7C AUSTIN.BIERBRAUER
1,666,290,564 *AF5C998D9F5A0F36D460FE21136D62F4894209E1 austingrantham
1,666,290,565 *AF59A2F906B975524FDBF702AA3718BFB675E6E2 CAMERON.SCARPITTA
1,666,290,566 *AF53886D422EA1CA141E9C3744D82F237FFF5637 can.aslan
1,666,290,567 *AF568D0668C00AAFD9685459F78B2277013EA0FD CANDIDATAR
1,666,290,568 *AF53F6AA0CFB251511A0294161FE26A1060678D9 cantando
1,666,290,569 *AF51B96AA4D02FD004DD92407C0C2370E4D122D2 [email protected]
1,666,290,570 *AF50BC8051C9D17E1AC2C713F51E6A3EF33566E2 tastenrahmen
1,666,290,571 *AF50379990D7177A189BEA09CCA07DDFE49AF86E a+v71
1,666,290,572 *AF580BB6653F1E48383B897A15C6A67E0FADD86C carltonborlace
1,666,290,573 *AF54F61A7F3435500414EAA5D07E4693B5E86AFA [email protected]
1,666,290,574 *AF5306ADE7CBD10ED8BA1A6B93F343ABF659A92E carmenkennelty
1,666,290,575 *AF5D6CC8630F1D34573EFC07FCE9E2D2002767C0 tedandrada
1,666,290,576 *AF5805C94AC5B5F3C06F51A8C9B35133F22DC94D TEERSEIL1
1,666,290,577 *AF53D5375896A4C0C02F71D4456F4196DEC19AAD cartbeforehorsey
1,666,290,578 *AF5CC04BB2C3778C1D938B3999A8B5DB6D0DEF1D aw:??
1,666,290,579 *AF55A943657CDD8C1648A03730644F8F003FE1DA caryausman
1,666,290,580 *AF53C87B3B7B6BD591156D08CF75015358424086 a)w8d
1,666,290,581 *AF51C493BE1BEBA7E4B4C4542F192836A10302C8 terrencemuto
1,666,290,582 *AF5324AF74B85A785A15639F05AF593B0A33CEE0 az0el
1,666,290,583 *AF5B6CE35E9A20A5323E28A32DC23737DDE25F7D c/bn.
1,666,290,584 *AF58FB676C58C879D1F44345980B6E6100F3DC8D CBWO+
1,666,290,585 *AF586664C54213F9E9EB4C1A29740C29D05DA7F3 thanhlongstaff
1,666,290,586 *AF50E7875318A75D267CDD1A65D49FB7B8A75CBA B2OG#
1,666,290,587 *AF563A471316E1602529BF6E9C963D65E31FAD83 B:3b
1,666,290,588 *AF5FF3C711D5F130612394A9DE2E5361472D82F1 thatpsalms79
1,666,290,589 *AF586A7AFBE6E2B7E2B86485017229FBFD4EC85E thebyteme3
1,666,290,590 *AF547387DA8396F2108985CB4C83093C693E627C CEREBRIC
1,666,290,591 *AF577AA62F61B992553BC1CCE849AAF74C7B6F10 CFSRFM
1,666,290,592 *AF5898336689B5240BBDC90F82EAD6170C0D27AB [email protected]
1,666,290,593 *AF502799BC4B98C7E98180202FD33F4625F08F64 [email protected]
1,666,290,594 *AF5132747C773371B35BF12D2B2B0FD31285FB9E Char
1,666,290,595 *AF578B024056A457D000C84E965D86870F29F931 CHARLES LIGGETT
1,666,290,596 *AF561C5E59E6A6069DCFE29DD57FFF749DB2632D charleslitchford
1,666,290,597 *AF50F6D754F9858DE7F9D8B28BE4FA17CCA3FFF1 CHARLOTTE-CARSTENS
1,666,290,598 *AF56B8753319957AB2D0DDAEB6CF60CEBB417EC1 CHC23466
1,666,290,599 *AF5746F28214E90727127C62513505EFA87E3664 bb;e?
1,666,290,600 *AF5C5B1940040C6BA2CB4DBEFE1DCC6C812AF7CD b?c=(
1,666,290,601 *AF555E31DE6F50645293EFA51F1538F2CAE0C26A bekc
1,666,290,602 *AF520580295FD1458542EFAF3C42272CBB1271BE BERRY.RINGS
1,666,290,603 *AF5B7D7A7473D55712BEE0D9E73C2B7B0B67BFD2 BESTIDNUED
1,666,290,604 *AF5CC840D8C06586479FC057DFA21F8DC48071B3 [email protected]
1,666,290,605 *AF5BA1561E525EED01D4E143E02D1843131C946F timefox3
1,666,290,606 *AF5E7B83166AA525D5ED3453FC29E04B84774859 TIPPELADDENES9
1,666,290,607 *AF577278013D12172D11355FFD2512A7C759A410 BFLORCIK
1,666,290,608 *AF5D08428548DE55BDFF6A701F29DC7EB8DC542F TITLES---RUN
1,666,290,609 *AF5EC20F8E2AFA73F8B2DB3B64F5C263A77DB59C CHRIS.PACIUS
1,666,290,610 *AF5F2D5A7D028CBACE1005150F1E9519975A8EE3 bge!v
1,666,290,611 *AF536BE21E5A999359DF42F99B4E6BFB28183E56 [email protected]
1,666,290,612 *AF537B0F5550E8E60175CA46806BABA30A7229D6 CHRISTOPHERSORICE
1,666,290,613 *AF50946A3D1D890E38ADFE43DE3B524FF3061981 TNADIXYPPED
1,666,290,614 *AF5FE1595143ADA0115B5610A1D2FD3F9AE04E86 TNEIAILP7
1,666,290,615 *AF5080D379442A9ED012B9A93B71F146C8320818 toccate
1,666,290,616 *AF5B74E7F51234570ADAD7E826BC55C5D3A5586C todketchum
1,666,290,617 *AF5AD57085323CADB3CE281577F10AB2B6410A1C cikcn
1,666,290,618 *AF53C3D6D97C86C9BC2BFCF19300CA89A00DF94F tombleweed
1,666,290,619 *AF5E5C85EFCBC7D188044137EF15967503339F0A bitntngr4
1,666,290,620 *AF5ED7C1B243AA5EA162B48B6DACED972F14965C bittebergstrom
1,666,290,621 *AF568B4C2C9452666D1ED9D10DA9EAFFEE645577 TONEYSHIRD
1,666,290,622 *AF5D27FF5727F77FE9C121F45AE55751A20EEE7B circles3233
1,666,290,623 *AF51AB2A9D557C21464BD2ABBD7BD9E762F1616C bk?v.
1,666,290,624 *AF5E9E153892A3D210CFDE2A1F03543BF0F7C099 c(kof
1,666,290,625 *AF54EA826CE55A052175BD6287BB49B5695E847A clairmunaz
1,666,290,626 *AF53DC23C331712F8E0A0EB321193D7C32F96950 [email protected]
1,666,290,627 *AF5A195620D0CAFA5C149CC8BBC1EADEE7317ABB CLAUD.NEEDLEMAN
1,666,290,628 *AF55F183BE31EC446B01E8A354ADA9C473E54B39 BLTXO
1,666,290,629 *AF5E65D705BD55DA12129B72317271E563F54838 B#L;V
1,666,290,630 *AF52551DEA59FB05AFB2B3254696DC67AB049A97 B(MQL
1,666,290,631 *AF5EF936BC895A56416E57A6B956436902A8DA09 [email protected]
1,666,290,632 *AF56F2B6068834D4318DEA3265E5879FD6642B01 C"LP6
1,666,290,633 *AF5A0C4B3A6729F184279A2624EFF43EDB739DC0 b,oi!
1,666,290,634 *AF53FE283AECCF0B7BD02FCE801D793CE12EAAC4 bookerfrommer
1,666,290,635 *AF582C2723426A211E63E74AEA08D22FBCE3CF5A CMH0F
1,666,290,636 *AF50F513EB6740910BCB255D6ABE80587CE5A0C3 TUANCONNLEY
1,666,290,637 *AF5AD6AB5A8EFB65893B9F4406F40D4D9B76F02F TULOISTA7
1,666,290,638 *AF58D616F4E2385900664C9DDB400D2460C4AA53 bpjk#
1,666,290,639 *AF5215BC505B9ED74C76CA5182A30EF17F3347F4 COLLINZOLLAR
1,666,290,640 *AF5BBA4E041C89EE9838A2A84C231E012A7E7689 coltane3
1,666,290,641 *AF5800A89FB0297E76D8AF593670D521ECE467F9 confusiontype
1,666,290,642 *AF55509AA42E9D98CD0D2571EDB5EB83F0142032 BRADLEY.CLUFF
1,666,290,643 *AF513159BAFC6794218EEFB42CDC2C5CAEADAFD8 TYRONE.SEBREN
1,666,290,644 *AF5E1CD4DE841D8ED10BCCFA7D5CBCB7B61ADBC3 tyronkaram
1,666,290,645 *AF53DCAA150BF4BBCEFE74E0838672F5768E6B35 TYRON-TEWSON
1,666,290,646 *AF599081D3050FA1C767F4A1D45CA8D4C2028A85 TYRON.TRANG
1,666,290,647 *AF5B7BEF3CE5013073A937E7F560C4C65D19C2F3 TYSON.WERNIMONT
1,666,290,648 *AF55379D0BB19F73E158317B325763F0D5A76D30 bradykeri
1,666,290,649 *AF5F6804A8EFF919AFCF8919D4AFB0E3ADBAB88D brandenblandino
1,666,290,650 *AF56C4A21BAE2715DC3DC643A5192AEFA518B5C5 brandon-debenham
1,666,290,651 *AF54AC19A5F88BD9A637284FAD4A9151A069768F UBEÝDYLLA
1,666,290,652 *AF5AA70FD8F12C0BB70BE2D0743B9A92F7BAC489 copiarnosed
1,666,290,653 *AF5D5F317137DF362E508EC44E9A52E069958B85 coreytollerson
1,666,290,654 *AF5BE659CF00FCB65B6C4A69E2ED16FE45208CAC UHANAPAC
1,666,290,655 *AF572F442CA59AD7A3930AD725FE04451DEE05A2 corrine.moseley
1,666,290,656 *AF574F4BAD8C6424A2634397293ADA45DEB8ABCC briceharde
1,666,290,657 *AF53C7C400C35B15B56E9CC2D3A32D82BFC340FA CP&;&
1,666,290,658 *AF5A699FBA8408E3CECFC24ADACBE2F7C7147C4B cpvr
1,666,290,659 *AF5D6213311972C89D6AB05B2187BF582AFA2245 UNMANUR2
1,666,290,660 *AF5C78F4CB09B0A691EB3E605EE225D8816EC91F crack'd.mirror
1,666,290,661 *AF543BECBED85E31D6A07322BB6FD296D5ECA977 Bt6r
1,666,290,662 *AF5E22899AC43C142677FC1AFA0AE172BC4BB97A crkd5
1,666,290,663 *AF5CBDB14BBC71E2BF7236BB5AA321092B2D2437 URANINBORG
1,666,290,664 *AF51F7DFBBE83AE3E098233C75BBCB17BF69A3ED urvashi.dadhich
1,666,290,665 *AF5A0C48116E1E688EFDB06254B0C1188A3F5B53 crp9w
1,666,290,666 *AF5171B413C95A79D6C904DDFBB5142535422DF3 BURTON.FURUTANI
1,666,290,667 *AF5912EC86D0BA45766934D15EF1495064A3869D [email protected]
1,666,290,668 *AF5750374E91D7E8ACB965665A0C2F9DB0A025BE butthead1962
1,666,290,669 *AF50382C7046E7B37589FEB68EA753800E8BFA80 v6jwnu
1,666,290,670 *AF592C5ED1FF6D6C812E574A054532978C17FD95 CU5ZG
1,666,290,671 *AF51F60E3BA40CC5476DC61EBBC3FEE663FB6C97 c_u9
1,666,290,672 *AF5FEDDE0A3BFDC82F75B8601BF4BCCD3ED8BBF3 valentina.shayla.rodriguez
1,666,290,673 *AF53D3921D4CFE0DCD28CDB0EF9B570518E0E07C CUISM
1,666,290,674 *AF5B586FAC2DEFE3514DAAA6ECE769409CE8A462 BZOTO
1,666,290,675 *AF5C423D4892F9B7553127B23948E0B195A2C826 CVUDR
1,666,290,676 *AF5B81BBF73421C3BDC1B69F54C6591CD9A592A6 c/#3
1,666,290,677 *AF509ED9BAF236C77835EFBC8B4F808AF30C586F C4UMS
1,666,290,678 *AF5CB0C199FC2235AD3ADC14D947C6173D956FA5 victorbedocs
1,666,290,679 *AF55F06F1BCA778696CA8FF4BAF710CF03B399F5 victormeirick
1,666,290,680 *AF5211497C56D89CFBBC4AAFF59850F58036F0D1 VIEHAETYSTAEAEN1
1,666,290,681 *AF598587CE4C3AB72EFCD80C24DA3B3CB5555865 VIJAYKALIVARAPU1
1,666,290,682 *AF561822AE09807CECB15E260626E46218DFBDF5 VIJENDRA AHUJA
1,666,290,683 *AF5184E8068A83C741F97804F57256DC2D3A67C3 VIJENDRA-AHUJA
1,666,290,684 *AF5954B84CF47C737B9361A8364EF93B03B982E1 VIKNAS RAO
1,666,290,685 *AF5BB580274E8A9C4772A6D96B06599216B36E68 VILJAKÄÄRMEELLÄ
1,666,290,686 *AF5EA69824A13C7E8762460A71FD504B41034E2A d6c/j
1,666,290,687 *AF53C36C8863151F2B2F83D8F9FC0CBF4AC5620B DAHRENDA1
1,666,290,688 *AF5B1576F0F60DC93059EE135AD4C78061855D9C VISHAL SAJEEV
1,666,290,689 *AF58635C24E14880452C4079F9FF521C4F882ACE VIV.MONROE
1,666,290,690 *AF561CA57505C6E9A5BDC81363F3424680FD0368 DALU
1,666,290,691 *AF5FC4EEF43C86EE8F85F64B59A8FE2B1E4A10A9 cbqtw
1,666,290,692 *AF54D8FFAA08FF81E3EE7E2777E5B162B183BAFE vlf
1,666,290,693 *AF51CA39270A46B829204C7ADE2A87A1C0EA8B69 VMDSMGHPD
1,666,290,694 *AF582BA9ECB8AEFD9EAF66083FFFF36016CD3524 CECIDIS
1,666,290,695 *AF546DC94758A0937838181CA129F6D0FFF35B67 CEFc
1,666,290,696 *AF53D87070790E0F5CD480222DC014D9F4205544 DARREL_CHANEY
1,666,290,697 *AF55AF8F7286A9812F46F98E49971ACCBF7F0555 dasnb
1,666,290,698 *AF5A079B87A539C786987FE481F3865AA6EEABE2 WALTER.WEHLING
1,666,290,699 *AF5F60AA64EECFA58F79A675C0A478B1F21B3006 WALTON.SPOSITO
1,666,290,700 *AF5518C85816AAFC4A69C983C0CC924ABA44E4F8 WANFLARED
1,666,290,701 *AF58E894EEE3DCD347E6B4EEE1F5841EDB8F228C CGR1.
1,666,290,702 *AF57A0E6A5F0D5FBE0AD154FD94E66FEF89A550C DBINC
1,666,290,703 *AF54B63C1405051006FE780608B5B435A2CF55F2 CHAPTER-28-23:-THE-MISSING-MIRROR
1,666,290,704 *AF5E8380AE2D1BA0978D5F24853D33006D8E2E06 de.bergh
1,666,290,705 *AF578550C1D18F4D4945D045FFB3D75BDF31E7EF chau$
1,666,290,706 *AF5F9EFECD5A5A8D512FF1D8B5EA4855D54286A0 [email protected]
1,666,290,707 *AF50EBF5D658B849066D6C84A226DD2A184207BC dei;w
1,666,290,708 *AF55FA15E57835084010B3442B69599962CB93FA CHEYENNE.BUSCH
1,666,290,709 *AF5D1B6A1069B31BF0230790B9B97B8890041A01 「WILD」と「DR
1,666,290,710 *AF5810B42652AC504C368E7ACC432C633D6B18B0 WILFORD.ADKINSON
1,666,290,711 *AF5F36FA7A0A38CFBB3E5E54EBD9554F05E3EC75 wilfredmcnitt
1,666,290,712 *AF54E7476B3FB013EE0E5DE8AFB6C7599B444B36 WILLAM-BRATCHER
1,666,290,713 *AF5FC053346A63FA09264DCD7B84BBCA7E3B42CC WILLIAN.ELLERMANN
1,666,290,714 *AF58F3163224B414E16EEE1DC5DDF596DCC65228 willyholme
1,666,290,715 *AF5AF64806AEDCC21D22089507CED51C3DFE82AC CHOIROL
1,666,290,716 *AF55DE8EDDE7438DFF86B5287E4E341AB48329EA DENNYTRIBE
1,666,290,717 *AF5FE1D05982CCE2104E37628EE9CF20DB0146E8 DEREK.SCHIESHER
1,666,290,718 *AF52E7001CEC5C947A7C70B8E94DC04A00509C51 [email protected][email protected]
1,666,290,719 *AF5AF46A79984B3E776ED441B61F14F37A62FA76 WNWALDEK
1,666,290,720 *AF5AE73904AFAEABE93FB7857D1543C89CBF6B2E W<NY
1,666,290,721 *AF5703625E7559D8C547FA494E04E7D53FE465D8 WRXSTI123
1,666,290,722 *AF5E2DEC4FDDFD97EE4FE0BC048E2B3F0EEB361A DETERVILLEPASCAL
1,666,290,723 *AF579DDF1CF510177282BA9C7CF836AE4AC46143 DEVIN.MCHANEY
1,666,290,724 *AF54EABB76D0864FEB99A04A361BC84CD6A22563 [email protected]
1,666,290,725 *AF5E4DD94F2CB1BC4F53A32A7B8F1F1B2390A46B WWW.ADELAIDE.ANGLICAN.COM.AU
1,666,290,726 *AF511FB907B78E856DB8572F8D4D64A398AC9887 C.;II
1,666,290,727 *AF5075BE44284B9ABEB48BA2230B1B26C600DC02 wwwemploytempscom
1,666,290,728 *AF5F18B031B4B2D9E067F9802F89B990A781972F dfa1o
1,666,290,729 *AF5C642255E3817104F5585C95A7F9AF25D354E7 DGP:I
1,666,290,730 *AF501D1D4F734EF5E83DD9B69A646BE73247F0B6 CKUT9
1,666,290,731 *AF59D1251B33000881284F9BC4E9370BEA2202CC D_I1N
1,666,290,732 *AF50CE52591F475CA31E67C96042A8BE60063D2F CLAYTONFERREIRA
1,666,290,733 *AF52F6A6EBB824EC21225CA1C7B8E6FEA2A32F6C yaphank3
1,666,290,734 *AF5420C30B3E66D7A1053F6918997935ED58BF07 y,lx
1,666,290,735 *AF59855B88CBF0B407622B7992E9A2AA43935C4F DJAMUND0
1,666,290,736 *AF56C29B555F5A00670F4DB318F64B7B7117E54A yolandamichelleadams
1,666,290,737 *AF5D0E25079EE171158E6DA16D6DCBE542CA2E2E djjfi
1,666,290,738 *AF53BBA8FBFBB2EC54000C5DC745E8152B18C7F8 dk$!5
1,666,290,739 *AF548CC758FD1A361FF7C9FF9F1AD80984D2DF61 [email protected]
1,666,290,740 *AF52D40B4DAD6382E41D3202C09F5668E8D26373 COLIMAWIKIPROYECTO
1,666,290,741 *AF552FEF47654D5032CBFD85EB69DB19739ABF1A [email protected]
1,666,290,742 *AF53178A1ED92DAE52196838EAA6859AA73CAA21 YUDA MURILLO
1,666,290,743 *AF55EEFD8E4EE1AC88BAB58E9A3077586AD8E7F9 YUJEJSQHZZPZ3
1,666,290,744 *AF5BA82C3A3F563FDD35E05E4B5037635CB8D2AD colorfully5
1,666,290,745 *AF5692147AAFDA8EADC28AE419E8F4190D6D1EE0 DL&XC
1,666,290,746 *AF50330E41EE75D6E6580EB9D7AAF82169EACE45 communiaque
1,666,290,747 *AF56D0299ABC34DC5C7E88E10225C696960DE443 DMAL#
1,666,290,748 *AF5603D5CD6F03069E221A205CA768A08BFC9309 ZACK.FAVERO
1,666,290,749 *AF5EA876C0B8D515E14B6F5E0A828AD793BE394C copelins9
1,666,290,750 *AF5727FAEBF42630D015BA246BBAAC7E45E9477F COREY.DOWKER
1,666,290,751 *AF5488359F8BB11929B06CBFED3DA0B51593713E d.o!d
1,666,290,752 *AF56004C36AB2EAF6B05351B91F51AEE11C947E7 DONGWINSTON
1,666,290,753 *AF5D07557AE473436451CDAD0851FFF86167CE21 ZHAODAIGE
1,666,290,754 *AF5A2CE234B7B68CADA84DDCAB621E6B4E382A93 donshere
1,666,290,755 *AF5291CEB1A3A9F073631951932BAE50C2AFE671 zoaibz-akhter
1,666,290,756 *AF5D2C27DC3380375127D4DFA86CAF9BC335BDDA c:\program files\adobe\adobe utilities\extendscript toolkit cs4\sdk\samples\cpp\docs\cpp\structsoserverinterface__smembershtml
1,666,290,757 *AF5B742D756B6DEFD06164EC9ABCD3DD64DCC28E zotty
1,666,290,758 *AF5C86F2E52CE723C6E12EE011B09CF70734C982 cqpg
1,666,290,759 *AF5CE8A2B3D33B64C98E623242F57F085CF558A2 атлатълът
1,666,290,760 *AF53BE590E37CA3688849DDAD35D68FA0E7E2C4C ВОЗРАСТАЮЩИЕ
1,666,290,761 *AF51647DA9DECA5E013017506CDD662E4B219D2A ИМ
1,666,290,762 *AF5A62787FBD90250F1F43076EF267D9751EFE66 МІЖИРГІ
1,666,290,763 *AF5609A6B8B3A1859051B8EA0930FD81DDC377D4 [email protected]
1,666,290,764 *AF5F08CDEAD8B21DC5959ECDAA9391A577495CFB cullout7
1,666,290,765 *AF5B93701828177662289CBFF32C7560343CAFAE УТВЕРЖДАЮЩАЯ
1,666,290,766 *AF5FD35E91821047B0E785A2242FAF9869235CEB dustywolsky
1,666,290,767 *AF58728C1EB4838ABD55A5B9688EA6F46AE0C424 ЧІПЛЯЮЧИСЬ
1,666,290,768 *AF518714F4D8A07AF40B8A7C5928EC3773A6BC8C e>8~
1,666,290,769 *AF598BE34D90969248953E2F94702F6DD2810273 EC!P
1,666,290,770 *AF54F26AF4EF139E1C22A248B2A9F30C0BB4EF85 EDMOND.BUNGO
1,666,290,771 *AF5F46FCE920926BFD1C14C7D010E7AEFB8E6D55 EDMUND.ROBAIR
1,666,290,772 *AF59313717F08B740722D0B550BE885649E039C4 EDODEA-ENSEMBLE
1,666,290,773 *AF569730EBE8DD690EF0A13EA1DAAF2B243AE59E EGAATAH
1,666,290,774 *AF508AA0218B2B6365FD5028CAF659350BF2D876 egca&
1,666,290,775 *AF55654742B6E5D1BF5624BBF2306AA6CB5688D6 EKMBP
1,666,290,776 *AF54848C41F83505EAE6FF2E038F6357EF2AF1D8 DANIEL HINDERLITER
1,666,290,777 *AF56B7530CC32199F6770208E9036037DB6A754B danniegeel
1,666,290,778 *AF561A30473442EC374B074798EAAEEE20AC57E4 DANSECHINOISE(THENUTCRACKER)
1,666,290,779 *AF59FC1796D1E7399A69B55446BF37198BC80187 DARIUS.ZOCH
1,666,290,780 *AF5862B948D287C2D8D587511399B92BF4AF9F6A elwoodgraig
1,666,290,781 *AF57D5E31E0B0B9DD2258AAD28AACC69BB9300D2 DAVEFIREMAN
1,666,290,782 *AF57597C64A83760417AA06A0C963C6FC7AB2860 emci?
1,666,290,783 *AF50C3BC83F6DEA82D2A4D3E504354640492C376 EMILY-MUKAMI
1,666,290,784 *AF50673C6355AD7FE7C47EFEC42BA1CFE95EEACD db#2w
1,666,290,785 *AF5FE8258D997928DDFD650EA2D3B5468308ABAA DEANGELOPNIEWSKI
1,666,290,786 *AF5FF228925449350418C8023659C20B40592C71 Entwining
1,666,290,787 *AF5A476D472FB8C3487F340093B0989ECE0DB720 EPWFELHSED
1,666,290,788 *AF56A4A2BB869A089D79B9FB786869F3B540EBCB dejarlamaternidadlost
1,666,290,789 *AF530A5AB4707321352200184D6A6D21EDA60D00 deliciouspain
1,666,290,790 *AF577869BA7D94CB1510D51A23A41BC0AF3F7426 erin-grange
1,666,290,791 *AF5AC90B39708A338E4592C9342339D1667267D0 ermorden
1,666,290,792 *AF543DEA203DA72ECFA0765C8173E5296E2BAE6C derrickbalnis
1,666,290,793 *AF5C47BE92CD60A68B347A10B3CB64C77C7E6DAA ETHERPC
1,666,290,794 *AF52550E40F424DC096EE3AE61ADE1C6A2880A5D 02.06.1645
1,666,290,795 *AF5FCE5CCDF6B779A7AFC8DA3365FF2A1016E1BA dettera
1,666,290,796 *AF52CC0E72EC3CEA6A4F1938DAE7122AB201285F EVAN-BRENNAN
1,666,290,797 *AF5A967A677C79B8D4C988C381EEF6E297012CA3 dew9v
1,666,290,798 *AF567315AEE42C0285460714310799099ABED253 DEWAYNE.SOLIMAN
1,666,290,799 *AF50C5B631ABFA1D8B6B0B9C3DF1A5C574917F22 EVERETTE.WEINGARD
1,666,290,800 *AF5A3F651E416B2D00275B947CC3A6966BF2325A DFOLLOWES
1,666,290,801 *AF56300A3C17DCE3A9708C0CA563656BAD7B6E91 [email protected]
1,666,290,802 *AF5A8B9AECB1C8EE7B8C2AB752BDA40BED30A308 d+h4e
1,666,290,803 *AF5042276651274281C0CF4342386285F93C0775 0FFICIA1I+IE5
1,666,290,804 *AF5EC98AB6F0840ECEBE7BC39D3CFD1B94E86C0E 0iamsphynx
1,666,290,805 *AF51AD6A17E01E61462AF1E654C01BBB7E316F49 falclandes
1,666,290,806 *AF525F42BD105E8DFC7049766BE1A9DE80BC3538 FALLONWALTERS
1,666,290,807 *AF5F9A57E24406A987E68B27B9F64B4E46E267F7 1088965 silloin.voimme.my
1,666,290,808 *AF5562A74235507548FD70A327375E631525A28D d)iki
1,666,290,809 *AF5A70EBF2CDBEFE5E072A973711B150F6C9E15A DINENDRAL
1,666,290,810 *AF59E754458D247DF95E9EE6959372D0FBBA42F8 fazsioniztah
1,666,290,811 *AF5A5DC329DE9C0D2C53857BEA792F7016EDB9E6 feeleverybeat(uk12'remix)
1,666,290,812 *AF5AF2D2220B9FDCF5DD9F7ECE788F9642A4A5CF feltonwloch
1,666,290,813 *AF512BE97A8F702751CB4591A24C8130496B161E 124979 allerdingsmuessendielaenderdieseselbersuchen
1,666,290,814 *AF53C5C31DD8682BC87E5DDCA7B22FD9FA02AF2A fhrstrck7
1,666,290,815 *AF5CD7ECC343E40E638DF4739D34C3AD83391B57 DISKUSSIONEN6
1,666,290,816 *AF5542905DCC64A8A0CF49A11DD6CE49278D0902 DLP$T
1,666,290,817 *AF53FA3E37ECF32ED6F8BF768B0C28E8F9D84D24 dmc&x
1,666,290,818 *AF5CA15D6B749E1F0F090777D8584AD98186EBCF FLOURDES
1,666,290,819 *AF5A7115CF56B33AD79901B1B0B9C062D229D46B dmnbs
1,666,290,820 *AF5AABB3107157EDFAE72D4E335030198DCEF821 FORSOOKS7
1,666,290,821 *AF503850C1E692E51245E649B9C88E66E216D0EB 1905809 ota-yhteys-vapaa-aikaohjaajaan-.
1,666,290,822 *AF5E4E44F1BA9822F4463ACB30FBF4AE7DF9D07D 196026 SE.KERTOO.KUVITTEELLISEN.TARINAN.NUHJUISESTA.WIENIL
1,666,290,823 *AF52D93AE7503A29F5FB6A4191B5318E0A5CA935 FRANKOFIL2
1,666,290,824 *AF5EDC72FC31A4569F103FD1F94485786B910930 frase..f.r.ey1.z
1,666,290,825 *AF5E55ED3A00E85BF1C43E6A06CB0DBAB5B2F33B DONALDSECKINGTON
1,666,290,826 *AF5A45B00D630D00DDA60DF0000FCB33797FC179 donnelllarmon
1,666,290,827 *AF5E9FA2481696DC5E2180802987C12C6C0E0DCC doomham.3
1,666,290,828 *AF5A6F93D84291F77AE9AB12DE6146CB3CDC413A friendsnirvana1
1,666,290,829 *AF5F9BFDEF7BFBEB84FD0B18B4F250FE1C68A2E7 D_pT
1,666,290,830 *AF5F2DD4632A3ECCD39690B9FDFE76AB24F2A52F dqm;t
1,666,290,831 *AF5FBFDF63B61B99227E906B64FAB097C7327B8D d+"r=
1,666,290,832 *AF57EEBBDA3558AA4825A54A7C8FAA027F33BFA5 d#s8(
1,666,290,833 *AF5C20F5DC125FA5C10B931C9FBFE1A5D69CFEBF DSAWR
1,666,290,834 *AF554052F918D4E57F09BEC9025B1C1AAFEFDA31 GENE.TSUKIYAMA
1,666,290,835 *AF520B3EDDC9F02A04FEA3F135C201FA41C0EE0C dtgy&
1,666,290,836 *AF5933C211B8B688E2CA6D3E4C322B6A8D90562A 1.DRESDNERBANKAKTIEN
1,666,290,837 *AF54B8E659E48CB67F728B1DDB087EC142A6CE4A GEOFFREY.DAY
1,666,290,838 *AF5612F13075D43395A8EBD507E8866D8F692BBE 1-grundstueckbestandes
1,666,290,839 *AF52F34F73F51F7AC789C66EB766DE5815414B04 dubi3+i3$
1,666,290,840 *AF5BDFB73056DB296DAF31AD4BAA14B24077B999 g/f=
1,666,290,841 *AF58E4C3898D0B84139069D322918C5FD1DB5A60 1iq-motor
1,666,290,842 *AF518BFA38101826616F41ED54838A363BDCE372 [email protected]
1,666,290,843 *AF5B73F592AD8B043AFE12398400EA47556C09EB [email protected]
1,666,290,844 *AF5298F136DFEFC6A7A724F3ED601048EBDBAD02 giusepperyman
1,666,290,845 *AF5A519D97F8EFA24FF8236D3ED5D8E3E02A2DB3 GJENKJEND
1,666,290,846 *AF5E07B395A5E0E0872782F5449E34E594B5003C DwAC
1,666,290,847 *AF5061F7DA89C8527D9508A19F46867A7BE96D53 gnitalfe9
1,666,290,848 *AF5C3D6B107E2A9A6742E23D43E3CEFF2AAC7D90 GOEDERIJCKE
1,666,290,849 *AF56211EBD15966BDE033D75CB5362D5CCC6A582 1NOTREGION
1,666,290,850 *AF5C26CAC403CDA171184E98592D1FDAC462E81F GOLF
1,666,290,851 *AF5570AD5FAF5869F26AA0EC893277537DD07915 1PAPPADAM
1,666,290,852 *AF5E6B7478F8FE0EE6C517D3AD3A0629E0908164 1 PERINN
1,666,290,853 *AF54AD3F5B63AD896A0004F4E53E2D4532758328 GONZALOCRANSON
1,666,290,854 *AF5DBEA73BC1B5E1AA9B616687A83386935C8CD4 GOODTICKET
1,666,290,855 *AF511B6652734954414CE53DC27006050EE6AB54 1.SELFREFLECTIVELY
1,666,290,856 *AF54EECA781D3D5E1896D7C9CA5A26FA0BF72C05 1SICKBAY
1,666,290,857 *AF5DC560948188DC0798AAD8DEABEAC2D8A14D1E 1 SKALNAYA
1,666,290,858 *AF5EDB683F0EE5187A12710E7CF3991E11D784D4 1-suunnitteluvalmiuksilla
1,666,290,859 *AF5F65FBB6348A2666DB455F5692D0F9A426D1A9 GRADEIGH
1,666,290,860 *AF507497A0682E29BAB7991F92AEC5A2158968D7 grantweader
1,666,290,861 *AF5831CE0C0B055A0AEADAA916927614EB0ADCAC greggsernas
1,666,290,862 *AF5E4C9D1A7F7E936BA62FD9D49F354E451EEF79 GRETARIAS123
1,666,290,863 *AF54C2D6A0245EFEAD9C181D70808966FCE2945D [email protected]
1,666,290,864 *AF57EBB8039D77D2B8029DAEB0B04E9C385AF8F8 grundado
1,666,290,865 *AF55B39232130FC49445AC87DA3A3D8526AD3BB8 [email protected]
1,666,290,866 *AF50CD9B509B8E987649BCCAA9736FF7F40E3005 1 VERMITTLUNGSANGEBOTEN
1,666,290,867 *AF5A2949A41328A8EB617BC8611056D1DB2CBAF3 edgarmorrison
1,666,290,868 *AF5C9282E9FC24A4EBD3955D3E13C2366446BFBE 1 YKSIL
1,666,290,869 *AF5A9C639D79FA30729A15659CF2AD70A093B0C8 EG+,
1,666,290,870 *AF51119397BFDD7C5B04023FAC44373A1984849B 2112OZD
1,666,290,871 *AF599D6FAD87EDE84D1FC0A955619766B81A5ED5 hadi-jammal
1,666,290,872 *AF523E11AC4BACFDFAE488021720D04882075014 EHOSIVAT1
1,666,290,873 *AF523C22D00802180988F6C4EF40FEB7D3FAA2F5 HAILEY_WYNDHAM
1,666,290,874 *AF576D130071D2DE1756AE5ABFB3AB317B641D2D [email protected]
1,666,290,875 *AF54E6453ACB50C1515F5C073F2A80E20C9123EB HAKUSYO2
1,666,290,876 *AF55C750D8B6BFDA32D55B25529DFF0B2A5E9978 HALALTOBELLI
1,666,290,877 *AF596AFEB7E479DB89911E94738A8BE014560D5B [email protected]
1,666,290,878 *AF591615D58215CC7F6F3B0076AEA817CDD38740 hallium
1,666,290,879 *AF56485719EC1506D3A1B71CEB2FA654168FB8BB 2332306 TY
1,666,290,880 *AF5D508CF80C8FA75326A0AFF26B3783C16B53AD eisp
1,666,290,881 *AF562033817F728CC1D98841A722B613E89A3602 2687091 mathe und biobuch bekommen konkurrenz
1,666,290,882 *AF5BC16F6A3443B07A9736DE9A06E49BF49A14C9 [email protected]
1,666,290,883 *AF5DC6F4810230B34B09019BA484CE7C73F95A0D HARI YADI
1,666,290,884 *AF58C14DC53569C4C41268EDF06F39D49198A91D 2844722 grosse.musik.,.eine.grosse.saengerin..
1,666,290,885 *AF548E180161773E67D6E4E2F57D13E73187F2FD 2AFFIATAM
1,666,290,886 *AF5968AD3AE5C4836B06D032436ADD1D6951BD7C 2.bayatlamis
1,666,290,887 *AF555509431942D8CB44794DE9EA984F19AEFF7D 2-CONBRIO
1,666,290,888 *AF5D2D7B120FD588D9BF5CC94200886734918DDA 2EIKLASSINEN
1,666,290,889 *AF57B5BDD294A785BBCE0E3E037A1EE4B0B10436 havetype4
1,666,290,890 *AF501169C101EC103113D4985BE4456EACCF3CF4 [email protected]
1,666,290,891 *AF560C7F40B1226BC19973B41D0F2C95B7B924A7 2-verrytellen
1,666,290,892 *AF57A907ECCC552EC7CB66E305A02F79DADC500C emmelsen9
1,666,290,893 *AF5B254E8D02C19B3BE72EB4FA257DE0845B7D10 [email protected]
1,666,290,894 *AF5210082C31D234BA22146670E3410DCD756D12 herbnarvaiz
1,666,290,895 *AF591C410073B8EC40DBF8FC3EA5B45E15601171 heribertokranock
1,666,290,896 *AF55AE8985797F470E7FE0A9CD32E6E78CA6E9D4 315174 POLICE DENIED THE REPORT
1,666,290,897 *AF576487616FE5307B44B52C5D49A97B80899E79 362katelynn
1,666,290,898 *AF53659216674DEC63C3F115BFF66F15596E0D1C [email protected]
1,666,290,899 *AF50A0B4297AD4F28DB80625CCFB36CF5EBAEBE3 enterthescene(klubbheadsvs.rollercoastermix)
1,666,290,900 *AF5599302B827DB51A562E52249E493145679DC3 eouds
1,666,290,901 *AF5E26BE5FD8BE9641B78F3FEC76A29BCADFF593 HLP%
1,666,290,902 *AF548762A4878B159EA0E829CE6D6CCC24AAFBCE 3OLEMSAM
1,666,290,903 *AF5BF284235056C3BB7D06554B164B58CFCDD1C3 ERIC.ROHAN
1,666,290,904 *AF5FDC02E390FCF2ABF7A20FC59238CD9BC0B210 HONGBERGANTZEL
1,666,290,905 *AF5C799CB3EB63BF3B4A9EB8E45C57B173BBF244 EROFEBNIP4
1,666,290,906 *AF5256FA2A4ACB0B3E1B6A981136A1D431CD54A1 ERROL.FINKLEY
1,666,290,907 *AF5D454B01D7F5B139A2D12D1C8EF57796C040DE HOTJULES6
1,666,290,908 *AF549AFEFCADA04F97E2F18DBDFA48CA47B4DA84 -*41322
1,666,290,909 *AF59E0300255A88335E8C17180B85C61346BE43E [email protected]
1,666,290,910 *AF5AB3317073C36C525C97D8452D8993CD514C60 475452 itisnotforsaleelsewhere.
1,666,290,911 *AF5D5FFA3935E33F8C98B3B82D79B72E9202E40B 482705 JETZTISTERENDLICHDERTAPFERECHRISTIAN.
1,666,290,912 *AF5D2AA8F156E778D71AD721878FC4F3D6D67903 hsnaknas0
1,666,290,913 *AF5E8D89671800FA4FF0DF4201BEE4717D0A2109 4BULLAPRIL
1,666,290,914 *AF55B2E54ADC36D7A97F5F954A4494C3F6F61CBD 4CCMSGNIW
1,666,290,915 *AF58D3C3FF902BC9BA34F7438B41F7F1127A2C6C 4CFZVKNY
1,666,290,916 *AF57000A1970CB0461D7FFA228731B5D56B616DE estiqueted
1,666,290,917 *AF53A86F03F8B39BC574ADB86D02AD3E8FE79120 ´´ESTRELAS´´
1,666,290,918 *AF5AE3785E1244DBD2DC71ABBEB122D5B4B52685 ETHANLIPSCOMB
1,666,290,919 *AF5A8994B938B93AC0F40AB6144364F88D435760 4IAMMIDWAY9
1,666,290,920 *AF5B6C178E46620D8A5AC64AC294CDFD1DE7DF07 4KHURASIA
1,666,290,921 *AF514BC864BC7B4404B8F2FA2DD838845C9768ED 4PAJASTA
1,666,290,922 *AF5FD71BCD4246A568D194318D5EEFB50DC26C2A HTTPWWWMPML-NEIGHBO
1,666,290,923 *AF540809E385965BA4E6791F7F40962B81988AC1 4-puolinaista
1,666,290,924 *AF54C8916BDC4598792211D88D8088BFACD1E6C6 eu5b%
1,666,290,925 *AF597D033C312831114077D5EAE1A73351EE2D53 EUBCF
1,666,290,926 *AF5FA3255A54235EEDA476744E2192DECAED2C2D 4RR0T0L4T0
1,666,290,927 *AF5C87EA2D1C4E5CFE9D2FE73B6E622C302D34A9 HUEYZANELLA
1,666,290,928 *AF5F73EEA20AFFEC6C5D83D13A560E79DC468340 eut/.
1,666,290,929 *AF5E5D50E74FD7499FBB15E51EC5612B5F0D05AD 4VERHEELSTER
1,666,290,930 *AF5F2F4ABF17B68FE531F3003A228F5E489FD40C EVRUKLLA5
1,666,290,931 *AF5B87BBDBEE30F3D9CCD91415FCBE177BAF5134 543450 the-guardian-newspaper-quoted-gen-.
1,666,290,932 *AF51961A2939090BB765B8F6AEE923ADEE4A623A 548751lt
1,666,290,933 *AF5D478A1866C3CB0485947ADE704770CF8BF969 5bosprey
1,666,290,934 *AF5C7F86AA5FBEC7218243927BCD20A865290997 5BSWANCELBSW
1,666,290,935 *AF5F57FFA3D6A95BC5334F5DE22AAAC3CDDE3B51 ezequielfrisby
1,666,290,936 *AF5AC923BDCD2B5E3AFBEC9A9B77685C6BF4C44C ezrabeckett
1,666,290,937 *AF50B1E791C30722E66AA7ECA1C11B42E4CA4731 F0REHE4D$
1,666,290,938 *AF5011DAD6A557A77D1FE24275DC56579AEE9175 FAHRPLANM
1,666,290,939 *AF5085611B71004BDD89B596EDD9B50BF824CD70 I[3A
1,666,290,940 *AF5620A378E56D8FC15E2E7CEDB063D34E43AB60 I66184
1,666,290,941 *AF532F9B1E6B4C123ABE13AB18380E1C7F8BBCEF I7?BAA
1,666,290,942 *AF53E68A186A2C8284703FA2067CA11C923D9290 5OTTO5OPRA
1,666,290,943 *AF5559189EEFBD21DA9C38A3507BC1F695DA2877 IAMGREMLIN69
1,666,290,944 *AF5B0CDC51A17878ADAB0370FA6A6C4148A03A27 iamsailor06
1,666,290,945 *AF5A11A221FEA18AF8A96C255D6AC1CE0FE5C8D2 5VLEESBALLEN
1,666,290,946 *AF5D87327A62E842C2D9FEAE50FBEE09DA766A7C 62884 ein-begleitheftchen-liegt-auf-.
1,666,290,947 *AF512AD4C7C4C543DDCE751DBA8445FBA8EE2344 firinoba
1,666,290,948 *AF588FB4DA45B08AFD709310E58F33F4A38BB000 [email protected]
1,666,290,949 *AF5B2C77D66028235C28E7B82A0A8AECD54A1BFF folkepared
1,666,290,950 *AF5DE67275F94FD419EE7740A74F530BB1BFC816 I DON'T THINK SO
1,666,290,951 *AF50EECCB243587E3DB56E8F58C72CD1F2B38844 6.pitk
1,666,290,952 *AF5C0688233B9216EB79844E6ED6185B787AA3FB 6SPRETTIS
1,666,290,953 *AF5F3F3E069848128BE1E55B84B08E1516B1DD64 6STEHLING
1,666,290,954 *AF564C9351D1D0F7F63118AE88F6B3E07BC45D7E FREDDY.PASTERNAK
1,666,290,955 *AF507F53C9CDF8A872200E378C9C2BBEDE55D764 ILOVEJIMIUR
1,666,290,956 *AF526BAB82D6B5D383DC3A7A6A10DB6026D20ACA 6VERTOONKAS
1,666,290,957 *AF5E8C01083BC8452B846ABED029AFA18D687C90 6ZITRONENSAUREN
1,666,290,958 *AF5158DB27EF4B4900B291123685EF1D26353605 FRONDS
1,666,290,959 *AF5590D73A26E51838D33B0500597C5C3234F7FA FUCKYOUDWIGHT
1,666,290,960 *AF58F60C3191486409EB62C43FC2D45B4CAB601A inark7
1,666,290,961 *AF5C5D8561B53F441102A1E7E2E2B7F167641C72 777cadc280bb23ebea268ded98338c39.louis
1,666,290,962 *AF5A55133A51F239FF39A38FA8BD61CED32F543C FXLK
1,666,290,963 *AF52F79C649D9E6FFB901462D1824CE54F2BF2C4 [email protected]
1,666,290,964 *AF5C665CD7921BCF60B7F95F1577387AD0AFF812 ISAIAH.ROTHERY
1,666,290,965 *AF530F2DACA28691A65B8A089C096746E1476ADE garrettzeremes
1,666,290,966 *AF5128392EFF1115CA9CDC263386F0B68727F171 garrygoerdel
1,666,290,967 *AF534D04F82328A0E7AB2AED083091CEE305065B 7MCTNICK
1,666,290,968 *AF56467D889DBD87DAB93A756B6E99F474142F3B GAVIN.MACKEDANZ
1,666,290,969 *AF598A5E362558E4CB3ACA3DF1EA345213F91779 GAYLORD.TARLETON
1,666,290,970 *AF5944782160F5F1D0077BBCB5DE44705CF398B9 7OUTIERES
1,666,290,971 *AF56089D66581E58E430581CA61A9FBC71557490 gdcw
1,666,290,972 *AF59B4B65738CF34771DD89A46CD5AC0649CDE85 I.VESPRI.SICILIANI,.ACT.II:.SANTO.AMOR.CHE.IN.ME.FAVELLI
1,666,290,973 *AF5AF83040C1DD08A0FDDDAD7014DEE1382945A2 7SENIMAES
1,666,290,974 *AF5CD5E49D82C90D8EC921938F7AFDB125C90C8E genarocrysler
1,666,290,975 *AF5559CAA5BED161EE7251F722A584263C00A638 IWJU
1,666,290,976 *AF5AAA291DC5E73FB0709556745486FAA1CDC180 GENE.ZAVADOSKI
1,666,290,977 *AF55A382489461F93CB1126EEDD463BCF14006E7 j3w31r!3s
1,666,290,978 *AF5982DD1F07A55C3E08B93CFC106C068F4034CD JACKIE.GIRBACH
1,666,290,979 *AF5C8029270820DD6897B748508C1C4E1FF5347D GERARD.FERRETT
1,666,290,980 *AF56E435398E9C207DB7B1B941D2AF5CB375C65A JACKSON.MCCARTT
1,666,290,981 *AF5ABDE73AAB0D032551A7813D0AC8A850B1B117 JACOBRODIBAUGH
1,666,290,982 *AF5994EA2F3285D1D1C942BB08CCD4F3EE205F0C jacquelinegrajales
1,666,290,983 *AF5DA3165FDB90E438A8E745F9370ED0467C8E52 [email protected]
1,666,290,984 *AF5B5C8810FAC9E21A92692A3E22F5C714D4DB08 81ANCHNG
1,666,290,985 *AF5A05AC5ADEA961464AA3FF1D4FCE4A2DEDA89D GIERINGER8
1,666,290,986 *AF51A47F7695858E0CEC8086262A84557D0B85F9 ginoswyers
1,666,290,987 *AF5746B8EBAC0A3AB74C383B8902697957B6A296 GIOVANNI.PACKEBUSH
1,666,290,988 *AF5ACA3249072A7347BF0AABED072EA53E1842CF 8BELIEVEROLD
1,666,290,989 *AF52E20B97FE433D99B14EBCFA9A38B8AEBF114D JASLENE648
1,666,290,990 *AF579C6C4F37D73A8D0E48E7CEB920B01C4D03B3 8D~0~osplat
1,666,290,991 *AF56039DB6505315D176014A468F65712AB33A37 8FISKERIREDSKABETS
1,666,290,992 *AF56E92674191C7E87FA4D085186537C44C574DA JEANNEMCKNIGHT
1,666,290,993 *AF54F4D898C23E9C1FD350023BCD700B8926CA4E JERECIRILO
1,666,290,994 *AF556384F9AE85853DCFCE1D8517412570162D1D JEREMIAH.PAVEK
1,666,290,995 *AF571727418DCEA0EA186B9D79425B74AB78068B 8IDICKINSON
1,666,290,996 *AF57D0D3765DBD97DB1EB3723B0F404DD22828F8 8ilovequeenie5
1,666,290,997 *AF5687FA2FE83C57DEADCA579DC020320D172860 God is a word to express, not our ideas, but the want of them
1,666,290,998 *AF523613015929E3E446C82BEDDB4EB85339BA38 jerryleimbach
1,666,290,999 *AF546C3D3E51DDB3A62FDE145928D3975853D370 8MADDOCKKAREN
1,666,291,000 *AF5D0E9CB8AA91FC44FB5A53488DEEE694DE905C GONDOLO9
1,666,291,001 *AF583502AC44EBA9F269FCE9D867ACEF32D6103E [email protected]
1,666,291,002 *AF58F8E83246C170DB2A9043C713059758C41123 8SCHIPWRYGHT
1,666,291,003 *AF527840E2E69EAE9B3DA3CAB0D8CD45F4FAF300 GRAHAMMISRAHI
1,666,291,004 *AF5696FBF03433006BC34EFF37E42922C8495A9B jim.labas
1,666,291,005 *AF5917007BB3B7DA7B4F128FFA941D788FBE5DB1 8##)`splat
1,666,291,006 *AF53A28B710391AC450315E96AF406C203404615 GRANDE.DI.NOI
1,666,291,007 *AF5F6553B2E439224FE1A64E84934CFA69227DA2 granvillesaden
1,666,291,008 *AF5B265B734ADA593F0CECAA84011599D3019568 GRAPNELCHAIN
1,666,291,009 *AF553B709025CCBF10C5B54EBD55CCD3CD720D14 8WATSONCASCADE
1,666,291,010 *AF534D292A6867C3FE334E8AF7DF50E6BE2B5E71 JMCNALL
1,666,291,011 *AF5601390D601FED27A9C788B1B8932D5882663D 8YTILAROMA
1,666,291,012 *AF51E0E5AF37D50E9DFC2ED57DC2AC3E98893ED2 joanschuch
1,666,291,013 *AF5E5C274DE7EC5B7B91A01BDC4B1BA722DE1EC7 groverascensio
1,666,291,014 *AF50085112664DFA60733C9545B5F2E026240A82 JOAQUIN.HATHCOCK
1,666,291,015 *AF51FBC32D4A4322DCD87E8F353F3FC9EF0EE2F6 JOCOOSERIE4
1,666,291,016 *AF53CBE1D8B9D627D52E3E86AF54DF8959471465 joelleupold
1,666,291,017 *AF5ECDADFA9AAA86E575F98EFADE519FC97C1436 john.hampsey
1,666,291,018 *AF52F801E91BAF4CC61882C46D50029A069779BC johnniebisch
1,666,291,019 *AF51C21D476C3922647E03002FBF6A7693B95DE5 JOHNNIEBISCH
1,666,291,020 *AF50EECDA9D995482E7266C8B6EF2A5C218DAB41 GULLAGES7
1,666,291,021 *AF59DE8050F67FEB0EE8FA6C3272B86043CA4566 gustavoengwall
1,666,291,022 *AF539C9FD5580DF46F8B39531F9FA8755FF45C07 JONATHONGIRARDEAU
1,666,291,023 *AF5A257671D21872C2C016C57E7EB5C28C83F52F jordanyoun
1,666,291,024 *AF5EF53BDDCC3DE3B98BD22E42018B3DF06FB0A1 9BOSSSTART
1,666,291,025 *AF56F4D146F99DD3F7C39C101819FEA0491037F6 JOSHLOSON
1,666,291,026 *AF545C1BD4D95F04128D8E369D1024E525894A34 [email protected]
1,666,291,027 *AF5497774532F4CA3AD7F454692F9BF08103C300 HANNAH.BACHMAN
1,666,291,028 *AF56E07339664123FFCE7FE087DB27F697EC3067 [email protected]
1,666,291,029 *AF51FEEEDC13D167506BB7D1E6544E2A0F7AD6D5 [email protected]
1,666,291,030 *AF53A936F622EC5D28AE17B14C65AF5B1E4981D4 9e03e1dd133bf930a35752c0a9679c8b63
1,666,291,031 *AF564B6F7DA09CCDDFBED55C3E2075B4939BFD45 hassanayuso
1,666,291,032 *AF52F48F56F58B5401C08D4E10BF09B6D3B6A73F haywoodaeschliman
1,666,291,033 *AF5E132F9E6CF825A96C9F08F29992F508F6A224 hblue.crane
1,666,291,034 *AF5099D37C24B98E3E8A64C58BF69983E8927079 HCQHWMYO5
1,666,291,035 *AF5C167A2354CEEDD9A0496C97EB5736A8F6068C JULIUS442
1,666,291,036 *AF554F4F90B9E800EF75CBDBB11AEFB657F980A3 JULMARIE.FERNANDEZ
1,666,291,037 *AF5910BAC8FA388E3537DA0463EFF2C83272DAD0 [email protected]
1,666,291,038 *AF5A3EFC1A396CC3C8133CD582C58023250208F6 hectorfriends
1,666,291,039 *AF53056DFB304BA0C92016655B6DE12AE2562C0C helpjessica
1,666,291,040 *AF5950D27014A71514922D2E94CFEBFB108B6363 KACKNACKER
1,666,291,041 *AF548EF69089DFA395D362A8CA3A96B54F7DE089 KALIUM5
1,666,291,042 *AF5883A3328C8F8F935610F26DB73361EEE054ED 9PUCKETTDRAGON
1,666,291,043 *AF5BD6740347A8A8BC7C3A482583961CAE262B6B HE'STHEBESTTHING
1,666,291,044 *AF54B54AFCD477FC1B2709538F729ABBC72184D1 9ROBIGINE
1,666,291,045 *AF52BA6CF77A70ED07DBD08296D2A060F43710CE HGWL
1,666,291,046 *AF528DA97ECC9F2F61AAA78DE429CE32030AC1D1 karlrobatsch
1,666,291,047 *AF5645B0C1753CDBB6DE3FDDB11894B349910AC0 KASEY.APONTE
1,666,291,048 *AF51FFF3F9E07729B66037767B44896DDBE3E428 KATIE-WEIGEL
1,666,291,049 *AF5A084AC9EEFFF05C78611D6C72F0DE534D56F1 KAY160
1,666,291,050 *AF506C2B1F46485A29DE47E3782F7EADB3FE1C62 kelsey.beattie
1,666,291,051 *AF533EBB054984D3EA7EB73318564C90F308A623 kelvinwangstad
1,666,291,052 *AF5C4CFB79F5196E8EA0E40E7590242847B3387A a0cgv
1,666,291,053 *AF574F9086FDA4A39FCDD06F56FC9772F23EE59E A0ZLS
1,666,291,054 *AF5D963F6082481635E9F7C74C93B2E65462F943 A&1T
1,666,291,055 *AF5C869926A29658E10BAE4E4FA650C7C5F158D0 kentoncervenka
1,666,291,056 *AF5581FE92F732616D8D22085DFF8B75873C303F A5RB/
1,666,291,057 *AF513FDFDB6E0A6DD458980083A96859F9784E70 [email protected]
1,666,291,058 *AF5060882B999A6EEADBD37CDDEB14059236195B kevingolombek
1,666,291,059 *AF5470EEE1B6CEC428277286B7FFF052F272DCE9 a8stract!0ns
1,666,291,060 *AF50F0DD7EAA52AF6CF2BFEE06124298D634CEF9 aaahbsw3
1,666,291,061 *AF5376428EBCDFDF0CC4EE94CF2D5C4D42F2BB14 HS&^
1,666,291,062 *AF5EB6EF70FC814F3055B7762D66F55D19DC5116 aac"vs
1,666,291,063 *AF58A32DB2D1749A52D0A0B665214BB93CDA6711 HUBERT.WACKENHUT
1,666,291,064 *AF5C156386FC35F5F148D7B4C0CF1198E96BD833 hueylestelle
1,666,291,065 *AF513B9452B8012F4CCF1661CB6B2BDDC07C93F1 HUGH.BRAUM
1,666,291,066 *AF5DD6970FAEE829FDA48E670E0F6762B2846FDF AAKREPUS4
1,666,291,067 *AF576BF79E984440A7748E0CC1E2FD5A152B6967 AARON.FEINSTEIN
1,666,291,068 *AF58E8EBA4A837F1E8D057DCCCD20E775551AA64 aasr&
1,666,291,069 *AF508678693766D4364124954E7CB2CDC57D8141 ABBEVERATES7
1,666,291,070 *AF5868471DB23C4EBB283ED9F6B7FDDD179E528E kosmoidiniai
1,666,291,071 *AF5B2CB6FAEAE5215FC433CC4F2FAF345D347524 ianduewall
1,666,291,072 *AF5B6AE83A473CF1AACCFEBFF23F11C9D164C93D ACASTUS9
1,666,291,073 *AF519CF6471729FEDF8BC7AD7A302391451E48A4 [email protected]
1,666,291,074 *AF57EE1F99C703021599380F7796C13B61D83856 IDENLIKE5
1,666,291,075 *AF5A42EC4FE66D6FA5DA8C60D863E521578993A3 ignacio.ickebuenosfr
1,666,291,076 *AF585B07EB908F84BE676D1DBEC0EBF3E7899930 IHASHIMOTO
1,666,291,077 *AF5E863244898F8674C0950D0707201AA4F26FC9 IKEFLUHMAN
1,666,291,078 *AF51C7EB52A39BF4F8B70FE70185842C704D4652 IKSWONYR9
1,666,291,079 *AF5D98654A38E7A279877DE95D1D76762349F5EC AD3PA
1,666,291,080 *AF5B4F9E2030F37A9D813E48D2A43C3D4B468BC4 ADGRENEED
1,666,291,081 *AF5AB82C5843A9B4EA19333FD6000399A32FCA10 Ae74
1,666,291,082 *AF5AA67AB02DF74FC09381CB310F01547A07371B ae#g"
1,666,291,083 *AF5AE84D27AF92B985F40BD5479773A34D603347 lawrence.j.burns
1,666,291,084 *AF5A9EE9EDD6A5BED6A24AACD10E11D8E4CB91C3 AGITARLA4
1,666,291,085 *AF570BFB17B7E5616CFFDAF9B98626AC97A24BE8 int3rc1455
1,666,291,086 *AF5D3E3BB6DE22DE4280A4BFBA6C1E87763FCFB0 legionartcomwww
1,666,291,087 *AF5BB83AB1BA9A536AE2AC01B3BA91E3CFA39B36 [email protected]
1,666,291,088 *AF56A8D6F3DBDFA51E733713EADDE0F0A8E09618 AH%M
1,666,291,089 *AF5805BAEA135417594140369ACCB8254B6A98E9 AJKP_
1,666,291,090 *AF51B98B94A61FC6964550E7C474DB02ACADC99B ISRAELDIGIORGI
1,666,291,091 *AF55DC675E628EAACEDF68F31238CBAB323A0D44 ålekrage
1,666,291,092 *AF5FF4221136456A0D53C8F319E4C48494B1D7FF ALFREDOBARDNEY
1,666,291,093 *AF5E80A6894F3091B798A7B25603CE3F6DA564F0 ALGUIEN COMO YO
1,666,291,094 *AF5F585B6621AB5554FC8017B5CD2F5AA0E48B89 IWJU
1,666,291,095 *AF525FA022145681953377B40897C170AFBF0694 LINDSEY.SINE
1,666,291,096 *AF5D3B0ED54643722B7213FACE3D6AE828FAC236 j7j9swx1s4t
1,666,291,097 *AF5DA3AB02688EFD9460B8FBBAFF97E01B415B22 ALLMÅLSPJÄSER
1,666,291,098 *AF58CDD7DCD138CFF67A3F53906F8FB6B68ECC09 jaminparti
1,666,291,099 *AF5369AD8F10A326850A97011BEF267CDD9D468A jamiuayinde
1,666,291,100 *AF5ED9B1A0EAE54008B06138F5B35F554B02CEEF ALSO-RAN.15
1,666,291,101 *AF5EC2C5C976CBC825C5A5642CFCB9F060FCF418 ALU
1,666,291,102 *AF51E885B3B42997B38D41FC026A7CE806A82FB8 [email protected]
1,666,291,103 *AF5B4583729DA0FFF7A65533B2EFC552DDD7D629 LOGANHAMMER
1,666,291,104 *AF53E0A776D88934FE03A3A1DFB4C735D3DEC4B4 AMATEURKAPELLE
1,666,291,105 *AF52FDA8F5B224BC358B111B69183490489F8C27 [email protected]
1,666,291,106 *AF5DA589D26AA3FE7C84C6D5F262F6C74DA06FC6 JAYSON.KOZEE
1,666,291,107 *AF5D3F60DAA5EB8CAE5A4F88AC78CCB19AEF10EB jaysonwendelin
1,666,291,108 *AF57EA03E7A15F21927C6DAC20D79F7A8F582BE9 lonnieluttrell
1,666,291,109 *AF529B14E3541B77AB6A87619B62D8784004DE2C LONNIE.RAWICKI
1,666,291,110 *AF57BC80DE19E4E8AB33D4D540B93A1CEF7BA7D7 ANDREA.TRAUTMANN
1,666,291,111 *AF56C16AD7DB1C468AE3D932803A7DD16D5BD9F0 LORENZO.GIONET
1,666,291,112 *AF5A6A33E8972C7E50BDE3A502702FCFEEF9BD68 jeffpaul5
1,666,291,113 *AF5E3A37392C2989BABBB4862281150E94AF37D5 JENGONDA
1,666,291,114 *AF5BE3F10F8480965764DBE9835B739251F9CDBF a-nmc
1,666,291,115 *AF5D7A5546A82DE38944BE7FF8D988CAD1357410 anthonsen0
1,666,291,116 *AF50F9A786C6171C75C97E708BA57F58A5F3C926 LUKEMCELWAINE
1,666,291,117 *AF59FC7F1994435FA89022B18E9ECA1B737E7B1F Jesus.My.Savior
1,666,291,118 *AF57AA7782E7EDCF74F8C0D1DAF1925988CA1E22 ANTWAN.MOHAMMED
1,666,291,119 *AF510CD14A33E329DB90F2F3C28DD5E7BB27DE43 ANYTIME.GORDONWATTS
1,666,291,120 *AF5AEF9AD7ADCB29B59B655164405BFD7788294C aobd3
1,666,291,121 *AF514025FFA4BA479FF9492AFD85ED4E763E60A3 aowwg
1,666,291,122 *AF506D59519447857B94906D17B92B2A478ED8E4 M_<@
1,666,291,123 *AF53E2895B61C962DD6F85C5C2BEA74D6DEF673E [email protected]
1,666,291,124 *AF5CDED58959F0EE453E6D21D6CF8BF827F2BA22 M1E
1,666,291,125 *AF53ABF4EBA497450CB765AF42B63DD3223988D2 M9E~
1,666,291,126 *AF5822487BFE1096AE9D9643CABCA2B35A3172F3 AQR.I
1,666,291,127 *AF5DB9242FBAE6CEF2194884547D20783C34A0AC A/R1R
1,666,291,128 *AF5163106D281D56A538CDC73E6674D98B60C78B Arabianozou
1,666,291,129 *AF569FC60BB64481EC87D458F456B0624DF20D0D ARCHIECALDERWOOD
1,666,291,130 *AF5ECE2BDA49F7056C1A83AEC80D1AB7E11087EF ARCHIE.PINCHBACK
1,666,291,131 *AF54D00EBF421417BC6D38DC6C7A86E12F1DC76E ARDEN.ULREY
1,666,291,132 *AF595F5DA191DDF0957BEBCB00DAEC5F2393498F joe.riederer
1,666,291,133 *AF5C012631CEB5CA925D2CBF420CBF322C99FB1F johnny-hawksworth
1,666,291,134 *AF5AFE07165E1D53AAAA8E922BFD1F5DB88C769B JOSAMANO
1,666,291,135 *AF565F7CC71B11B9F66C19DF05A40019EE54363D JOSHUASCHUYLER
1,666,291,136 *AF5F722740D2606CB0C893B5A99B514FF32A8E67 jospehong
1,666,291,137 *AF50C4BC9DEAAB85DF120DE40FC0C154B28B0B66 malayko
1,666,291,138 *AF599B415904EA44C81C892D900BD9C3548753D5 [email protected]
1,666,291,139 *AF5F95D9B23461A38FA9F308D1212D3B630E4CFD arnulfodelahunt
1,666,291,140 *AF52FC6735C9D41188B8ED3982BB1CA8DFEAFECA [email protected]
1,666,291,141 *AF51D6DD983626A65BA66987C16572B802C0B7EF arrondelancey
1,666,291,142 *AF5E009BAA0D9E1D95B5F4A74E937BF4013B948E JUANSOLS
1,666,291,143 *AF5DBE127140317C7FE2423CBED5D812AB91DB31 ARTICLEKTYLFM
1,666,291,144 *AF5CDE261B4F50BF2AE2571952716B765B214F70 JULIUSTROIDL
1,666,291,145 *AF501429C6C0FED797D3DEE8A6F0B6FEF8CD399C JUNIOR.BEASTON
1,666,291,146 *AF5350D211BA99A246199E0F2A6B99BE2CCA3F97 marchenerzahlungen-op-132---lebhaft-und-sehr-markiert
1,666,291,147 *AF5EE1A1D1F4A3F835402D4CCB9842030A4D0169 justindellapenta
1,666,291,148 *AF5163474C8CD14B92A00F1221CF813962835B37 justin-hawe
1,666,291,149 *AF5461B51592050A5E7EFDD6F65DAFE2B8BAC421 MARCUSGINGER
1,666,291,150 *AF5AC009DFD020FE5FE7F02CCA5E93F5233B3F61 [email protected]
1,666,291,151 *AF5895568076EAE34D85699973242EEACAD27471 martinmcclodden
1,666,291,152 *AF5CB80DE5E2BF14060244A91ECB632E432C2026 ASPMAIL
1,666,291,153 *AF59C7202FF15F61FAAA5D6ABD5BB8B73334D242 maryannehogan
1,666,291,154 *AF5918050F23A2BE2E3A534DDE63F115CFE66074 MASON.ABU
1,666,291,155 *AF581CE3E203122995D73D759E0D2EC54227DFDB MATTHIAS GOHL
1,666,291,156 *AF5E0AC42BA271FEB1D4C0547C208DC2F88979A3 [email protected]
1,666,291,157 *AF58F0ECFCD8AD5C9428782D5DA541D4E29EB865 KASEYVINROE
1,666,291,158 *AF5E2E404F86CF07CEDA3E588B0FA78C2879C4E0 KASJMIER3
1,666,291,159 *AF55A3B7962185AC0E564FFBBA5F8009BDB73652 MCESCHER8
1,666,291,160 *AF5E6B05B3BFEAA0596338F52AFCF0C206B8C74C keiserlikus
1,666,291,161 *AF56050942B996449750E560B5E21F1656D59B45 a)tze
1,666,291,162 *AF598E925AA06CF06CFEF609473847D8934450F3 aubreykrzesinski
1,666,291,163 *AF536CC8ACAEDCA624FF5FAEF5E0CA5E78E2014A MELANIEE
1,666,291,164 *AF503E0FB0D782D9EDEE93BC6958CAEA55D2BDF9 kentmetty
1,666,291,165 *AF57AC77AA53AE4D8DA17E3437B0F8FF04024E13 kevin-bopp
1,666,291,166 *AF50225C38892F0C4812D943B45E951747D951C4 MEN'SLIB
1,666,291,167 *AF5BD9B1358087C705C3FB40120DFA56D1FD50A7 audivise3
1,666,291,168 *AF52C1B5C24C9733B9DCCA94EEEAFBF5F5D40795 MERVIN.TOOZE
1,666,291,169 *AF5D42B3DAA4F7BBAAFE353BD42064182321FE8E AUK;T
1,666,291,170 *AF52E4AF533A5154FD66E12E0295D883233776FF AUTOFECONDAIENT
1,666,291,171 *AF54CF85D11CE9CB5F227CAFDAD5600133D72A28 KINDERHARP
1,666,291,172 *AF5A63DFB9BC18EB808D91FDBB368FFCA833C0B1 MICHALE.GAMBOLD
1,666,291,173 *AF52DC55AC2A86D6C992B9156DAD1771BCE034A6 [email protected]
1,666,291,174 *AF529A62247C8CE2DE9A9D45C266328A8CB5C30B A%)VI
1,666,291,175 *AF558AFC5F8ED9C2B5A61DE4BA1FC46455489252 MIJA.JEON
1,666,291,176 *AF576084509C272389A416354B98D886C2EB7CDF mikedoberstein
1,666,291,177 *AF54A1BEDCE5F56A838F1CB607D020512226CFFD MIKEL.WESLY
1,666,291,178 *AF58CF8ED26BFAA418A9471EE8F5915E18B2EB5F milanlimbo
1,666,291,179 *AF5F74E4E4690D7B9002667F13D184A61E71602F KLK*
1,666,291,180 *AF518C1A0F8415ADD03E852E5A6EA0FD094A545D KNATS0
1,666,291,181 *AF53B5AB7AC0C8851090B2D3E6E7E679A0D045B5 miltonlaguardia
1,666,291,182 *AF58E1A99C88D21C55F489101B6885068CA2E34C a,y%v
1,666,291,183 *AF5CD0C3225201A5B2AFBFB1581DC0B95C22F689 [email protected]
1,666,291,184 *AF51DD488E9094BDA4C131D75E0D8E75A8ED7BD8 MNMTHREADSALON.NETWWW
1,666,291,185 *AF565445BEA9643FF62AD5487A19D4A854C77248 b0hea
1,666,291,186 *AF5675330C44EBC685792BEA8E235EB05AFC92FF kone-djakis
1,666,291,187 *AF55740AC9B76BDC9539CF5CCDC20FCBB2435402 kongen.af.kartoffelvand
1,666,291,188 *AF536350819BCBA4552E3D69C58DFA1404D59363 B3412D9
1,666,291,189 *AF52CC381D0E3071A41CF2599B49F7AE6B3EC884 b3h:d
1,666,291,190 *AF534879713837EE8F2F63B0D548D19CC8EE6E14 KTCONST
1,666,291,191 *AF5E290C46D071EF9CDAFA012DEBE111FCA0E084 MORRIS.BULLINS
1,666,291,192 *AF598FE52BCD7DADD25B3FB7EF9F1F0FC083996F B5SF&
1,666,291,193 *AF5B1EE1F33358D54D3B01F2F86ACB019D547464 b7;o
1,666,291,194 *AF57EC4AA4346D478DCD446ECF1B94389D094C6C mu1t!5tage
1,666,291,195 *AF5B3C60C8D6C54DA324B72EE86C827140CB0E2B MUDRASHRAMCOMWWW
1,666,291,196 *AF5FF13314C9C011FE75B61DCD8024C59B2C3824 ba75133e53c638b6a6562cbd18332a49
1,666,291,197 *AF5D66AF6B685E8C984106EE6B15429ACB5700AF MULLIEZA
1,666,291,198 *AF53EB9B2A699D1CC01069C66595AD37624643E5 LADISPOZITZIATA1
1,666,291,199 *AF504E8B46D5E1C486622AC3102DFB4AE370A6CF LAJUIVE:RACHEL,QUANDDUSEIGNEUR
1,666,291,200 *AF54DFA1E49FC848A121136972961598494D797C ballacer7
1,666,291,201 *AF56170AC87D166ADD6C9C727C8DC514D7E1D9B9 bange-man
1,666,291,202 *AF5DC1105C8C261ADD046F7E9B7FAD1E1811D3BD BARNEY.BOUNDY
1,666,291,203 *AF56F6E191B29C15F4AF6269EC0D7D2F708F4BB5 latraviata,actii:alfredovoi-s
1,666,291,204 *AF592CA1397AB8440C139A678375707111AB453E [email protected]$T$
1,666,291,205 *AF5173557E5DAE7B694C92E195902EA986B465CB BASILKNOTOWICZ
1,666,291,206 *AF502DF61067229F6FBBB0FA8D8F0AEBD5886602 n3W
1,666,291,207 *AF577527F6E1C2D4421EAA81AECC82B45547E3AA NADIA PURVIS
1,666,291,208 *AF597657FF336C9BB143A7B94E914FEA7EC5F752 LAWTUB
1,666,291,209 *AF53E31D84D504B7DB931D5E94A765DECB65B1B6 nagazim0
1,666,291,210 *AF52C8778231052E9AEA43BC8DB9D415B47EB1B9 NAPOLEONSAPARDANIS
1,666,291,211 *AF5E3F159A58D9152D14B89436F32D6FE33490E3 Le.B
1,666,291,212 *AF54E9E4F501388B4CDC8C7BDBBA716072354E00 NATHANAEL.LEERAR
1,666,291,213 *AF5EDD361998A8886F56FE136FCCA19B416A8390 LEIFTHRUTHLEY
1,666,291,214 *AF507B1886A883C369A2DA74718E88ECEF7ADF9B leihsoldaten
1,666,291,215 *AF5429D57459712A0CB48E2DD354B7054741751D LENTREN6
1,666,291,216 *AF5FF7909D604925D684B26916C04F82F48DBD6D !NC3ND!4R!57
1,666,291,217 *AF5393A799D07192A4CD500735B7B4BDB58D42D6 LEON.DERAPS
1,666,291,218 *AF5629718A31B3185FF278B545C442D4E0DD2657 Lesaveugles
1,666,291,219 *AF54C83E1B98C77D782668D717959D2C728C9DE0 NED.UTZ
1,666,291,220 *AF5DD40F261ECF3AC29EE59A0911286A794E8B08 [email protected]+!VES
1,666,291,221 *AF577E0F2A39AB1851A28F0A7D401AFA856D4711 BELFERS
1,666,291,222 *AF5E2E0C883FCD165C8A96C96C587123F4ACA1BF lewismylott
1,666,291,223 *AF5AB1BFB193B3CC41C69419E746CC5C4A5E209C lewisrathbone
1,666,291,224 *AF5A6E754E4F1431735D53F5768539A8AB96AA18 LFTYX1
1,666,291,225 *AF59F6BCBE1B51ED5D5C479A3DE0C930B1A08A55 BENNY.ADDO
1,666,291,226 *AF565CBE2CC64AC05210F48F0ED9323DD049E96F BEN.ZIPP
1,666,291,227 *AF5296070C5B4162DD935EEE3E18F96EF1E07319 beriosova-b/e/r'/j//o/s/o/,v/a/
1,666,291,228 *AF501DDCAF55A749DA4B9B55CCBF058256B00BCC ng.(a.silly.song)
1,666,291,229 *AF5913F9D3B0388E482AC2B69E9C9BE38E28C25A nick-steinmetz
1,666,291,230 *AF52D9E37CB81D14BF17D2D4ED52DF467AFD9B46 bettyfgh5
1,666,291,231 *AF5E5CFBE10CD2FA51F2E7F30E79937328136918 nigelswartzfager
1,666,291,232 *AF5DAA4C8C5084BCBF9C973B4660C3E87336D728 nikigaby
1,666,291,233 *AF5BF15D3E8A1CB4E958A39AEEBB74643716D063 b/gh
1,666,291,234 *AF54403A8739CD730A6D7BD42EA182DBC020FD5F NNHSLIEN
1,666,291,235 *AF530EAFABC03345A811A5BEA6CEA52E35ED036D normandbrunelle
1,666,291,236 *AF5794F534786A560BA1219DC3D4F6FDB41ABC8E billsalas
1,666,291,237 *AF5BDEDE586FD67C2225A0D74807DE789F41988E biq6n
1,666,291,238 *AF56866D360B90731A840384AA4C94C497CA74B1 birrellpitcaithly
1,666,291,239 *AF5BE6320126FE5E93E3D6DE3B2C1335E3E412B5 NUTTER032691
1,666,291,240 *AF5293917CDA5A18CF876905EFE4C5CC2BD4FF1E bkw9/
1,666,291,241 *AF5AB66175A541A0CE3A6D5EC0A4E8B601D97027 obamareleaseonnevadasuperdelegate
1,666,291,242 *AF5653834AEE343D213112FB3FED6F4BE99132A1 bm5
1,666,291,243 *AF5793F24BE2C6A2E8F7A68008F2C2859882A618 ODILYNS
1,666,291,244 *AF5EA6DE6076C9090B58C42FC6B53403B96D72C7 of$n
1,666,291,245 *AF5E7305A3F0F70B42A5885EA3116BBCC52AB43C LJRB
1,666,291,246 *AF591BD913A0C283E5450E8332E5DB0BFCE33559 ONTKALKTE0
1,666,291,247 *AF59F22FC7B1C48286FEB459AD3987A51FC8504B OOJKLTXED
1,666,291,248 *AF50FE6A1097EF8807823BC70CEF924DA271712F [email protected]
1,666,291,249 *AF5C5F987A0D5890B89FF9EB12682929972BDB1A }O{O~O~.Q#####3
1,666,291,250 *AF5CFE679CE7343EA526864B69CCB900EDC5D64D LORENZ333
1,666,291,251 *AF584256E3AD6419108A76F65FEE99B739008C7B oporlapena
1,666,291,252 *AF566BA23A1B483A6198A043159BBFAAD5092F68 bp,
1,666,291,253 *AF501DE8F71EE96466135D1505996E4A85B4EADA lovemetallic
1,666,291,254 *AF5CDFED17765314708CF211EF46877EDE27EBEC bpqt.
1,666,291,255 *AF55260D224E7732C943DD68E2459D89FD9C3F5B osvaldoditton
1,666,291,256 *AF5879225EAA4175F969365C782C6EC355A946A8 [email protected]
1,666,291,257 *AF567938470B0A4BD1E7A0F1687A52E5188819DC lutherfash
1,666,291,258 *AF59C17139AD073E4DFE3450DCDB96E56DE1F0B5 [email protected]
1,666,291,259 *AF522FC369BF310B644DE6D1AB3BCDF20BF1C077 oye.me.guaguanc
1,666,291,260 *AF5ADF9B80384E14CD0F72345A724DAEEB206BF8 LYNWOODALANKO
1,666,291,261 *AF5E8825AB1363DFC7266468CFD61BF37A8FAF6F m0les+a+i0n
1,666,291,262 *AF50E7381B52E85C8420EA31BC039C4BC954F766 M5WZYEME
1,666,291,263 *AF53A6FEB5F5A9F00AD22BC0BC4B044DCF0F3C32 P4+H3+C411Y
1,666,291,264 *AF527AC3A805547CCA6321C0ADD47A3C1DC276A8 MACKMEHTANI
1,666,291,265 *AF56AF61E895DEF91023BF0FA149959DAEACADB1 MACKY.LYN
1,666,291,266 *AF58719C7D6DBDFD357D4FC0A5F9DEDFAF78D348 MAC.MEVIS
1,666,291,267 *AF562AC2808E40429571ADF9383F6B0D9D2746DC BRE-THOMAS
1,666,291,268 *AF5E829665B1B089CAF9C8AF4DECF2F826E30741 paint_horse-p/ei/nt_h/o/rs
1,666,291,269 *AF59DB5D87833DB09764B1C93E579EC1EC5451E6 bri8cyh0qd9vtnv
1,666,291,270 *AF553FF70D683B77C32D980EFC90B5E9672C1FA0 MAHAPRASTHANIKAPARV
1,666,291,271 *AF5EFEA03E7AB1D206ACB4D4A8E2FD7447EF51C7 MAILTOCLUB
1,666,291,272 *AF5837270303D2D322FA9EB3D9ED5137487CFABB broderickrudis
1,666,291,273 *AF592982495AD995877AB94B965E9A922A4BDF6A MAJOR-WORKS-OF-POLITICAL-PHILOSOPHY
1,666,291,274 *AF5C07DB7C3308752BD31B9DB27564E0FE72B976 BRYON.DELRIE
1,666,291,275 *AF520DAF2519B3663F4F617F6BB05724E759117C bs"_w
1,666,291,276 *AF58589C8E673739B71BB2D76D73C74168BF2C7A PATBROTEMARKLE
1,666,291,277 *AF5FA1A3A55CB33A4DE14DCC0D425326DD580749 manthemachine,partiii:rememberance
1,666,291,278 *AF59CE7E3D7073B551307C7295D139CAE33E5AEE b)t!p
1,666,291,279 *AF5506ACA67A1503876B372FA1E872ED2A399F16 PB.*.*SPLAT
1,666,291,280 *AF5292CD441113B30AFA79335F51E1A8CBC6A8AE PD*.>B0
1,666,291,281 *AF536D16664F5BFA8451D163B8916ACA42F2EE51 bunchup
1,666,291,282 *AF5C38B8569FD3DE629A884F7F50A89B6243F654 But.we.will.visit.you.at.suppertime.
1,666,291,283 *AF5502337E402B9974BEAC750C02000F2A787779 b:uyr
1,666,291,284 *AF5937C432F8570A5DB210D888BED5927FE340D4 B.WT6
1,666,291,285 *AF50C8E19DA04C1BEC0B1CBC66EBE9E22A4B777E Mass.Prod
1,666,291,286 *AF52BE5631145B7DAB8CCFD993699F3CAB4EE948 materdominesi
1,666,291,287 *AF51609CB60EEF7ECB597EEC0C8B47621AF187EA {PISSR|P
1,666,291,288 *AF54162BBB8D861298153C0F6991D6F894731474 PJMMATHBERKELEYEDUPJM
1,666,291,289 *AF5140C712AE70263EF8558BDDCEE046F4E8EE2A PLAGUE-DENIED
1,666,291,290 *AF570DD7AA9FD9D50A6398B7F861DA35A7726672 C2"T
1,666,291,291 *AF54FEDEDFDCB9B311D0A02F1704FC25440434DA c4cg9
1,666,291,292 *AF53121FB47EB20410E0DEF47DB4D75532A72577 [email protected]
1,666,291,293 *AF54ACDFB8286A265E397F5C4F2241823016D346 [email protected]
1,666,291,294 *AF5777974F644EF8D5D9F5BAC6BBBB815A800B27 CAL,W
1,666,291,295 *AF5DB3D0300988E0986088DF31317DEF0B995E2B MEFTAHƏDDINOVA
1,666,291,296 *AF5318133D124B9C51FEAF65614445805264EEAC CANI416
1,666,291,297 *AF5DBDA65BE544BACAF2950B357ED242BA90A86F POUSSAIT7
1,666,291,298 *AF575BAFE4A830B88A56E41C654BBF0B4DC4C8A9 CARAVANSERIAL
1,666,291,299 *AF57067EBEDFB0F792866CD49B3FCAA86E5FC5DF [email protected]
1,666,291,300 *AF5D833F2289F64C2329DDEFF1E0893091B6439B MFROMAGEVIC
1,666,291,301 *AF557764D99F73A5EC2308AE4DFB83A92E25A0D3 PRIMO'S-X-ECUTION
1,666,291,302 *AF58032C544521D82849700350712E446A944BA0 [email protected]
1,666,291,303 *AF5E62BE98D6327BD8CF4A4A6B88DEE094A8A2BE micahbristo
1,666,291,304 *AF59D984DC56DDCC08FD622BA538F88551D5BBC3 MICAH.DEADY
1,666,291,305 *AF59AE4208A97D770C8E9B5D02D5356EC4099BBB MICHAEL.DEZAINE
1,666,291,306 *AF5CA626C22E4AAA71812E9CB2B32BCC730DE4D1 MICHAELMOAN
1,666,291,307 *AF5250F05FEB7F98DB1F32255EA18898FA828179 projektspraak
1,666,291,308 *AF54B25C6821618D83B2EF86769926838A82276C MICROSAW
1,666,291,309 *AF510A83E8E08707D9FC511AB71B997B3BE7DA22 cathyfeinman
1,666,291,310 *AF5DDF9018EFAF7FE191DBCC6D28DF409DFDC57A MIKE.THAO
1,666,291,311 *AF50B3D72A5276857E6DF57ED3A9D28339CEEAE8 CBCHRONPILOT
1,666,291,312 *AF5A6C09FF27D4C80F4804EA86105555052355E1 [email protected]
1,666,291,313 *AF590DF3766C6138D3556F743EADF7A648A3E3F2 MI.MEDICINA
1,666,291,314 *AF5FF039DA311BD34899EDC30B6B21AC96AD0E9F [email protected]
1,666,291,315 *AF5EE1BC5E4AED5FD1569982C2A2174E99261341 [email protected]
1,666,291,316 *AF58DDCC73B4468165EDF21039B1C56A487EC2F7 minhhenschel
1,666,291,317 *AF5D5191633CEDF7DC1FE330F5B41E61F7E56470 CE5B
1,666,291,318 *AF554B1E0055572DB356A4F4F307974888DD23FB ceed.
1,666,291,319 *AF5408E05F125FB4240F57F4385CAEFBC3D698DE [email protected]
1,666,291,320 *AF5FB7B2EF31C1B090E0BF6E534658D6010ABBA1 [email protected]
1,666,291,321 *AF55E1F5D9E338C8A77D7DFE33C1AFC990ABD1C8 [email protected]
1,666,291,322 *AF5F2F6334A8B4F5482B613B55A9E59178E7282D ]QLAAA
1,666,291,323 *AF516E57DEFF4DE4F58CA894B21D50BC798E4800 QUERIMIT7
1,666,291,324 *AF5B2409B6E44925C96071EBABDF6EA02B42987C QUIETENER4
1,666,291,325 *AF571D72C8AED336670FAA0E9911463AC507C956 MOHAMMED.BENNET
1,666,291,326 *AF5C2785783E6051761861D5D0B21BBF9F054709 monibur
1,666,291,327 *AF530EFECCB74A328B150394346188A7C2AA7CDF RAFINOVANOSŤOU
1,666,291,328 *AF5B2872A34DB0CBBF1DA567FF95BC6E975A4F54 championamanda1
1,666,291,329 *AF56E3DA5CF730F05105F7BFC3ECE9D41283C855 Char
1,666,291,330 *AF5F12B8798228205EB18BF66BFEF4A2F1670712 CHARLES.KRUEBBE
1,666,291,331 *AF552D9423B788CCD2BC307CF1CAA68BD0CD2772 chartpam
1,666,291,332 *AF58C17280D48D9F71F40CB8AD20646A1699C495 moustiquer9
1,666,291,333 *AF5366946B3D87642C1A55E5BE76426D46860B2C RANDY.RUDD
1,666,291,334 *AF5F0A70D7770C26381684BD12D91FF035628A70 chazzj
1,666,291,335 *AF5C676497FAE2B13E84573C55B6C1FB001D34F2 muñera
1,666,291,336 *AF5F089E24D6E4B884666A2CAA40052F0D583068 [email protected]
1,666,291,337 *AF5EDF4394E60DEC5884BBE9A60568EC9BCDF7DE RCHENAMBACH
1,666,291,338 *AF55CBD117890092503E6688D001B4C55B1342E9 chicka08
1,666,291,339 *AF57276DBA2E3E74317273674F310B7783FEE2C1 MY-LADY'S-CHAMBER-(B)
1,666,291,340 *AF58BB619B6F849CB8DD8EEE747BEF3A59048826 n11propellanes
1,666,291,341 *AF5BA246D50F9F67A2CFEA6E5F14290332DA650E CHRISTOPHER.DAVIAU
1,666,291,342 *AF59101604D866A1F8911A28AAF471093F7697F9 REIDLESNEY
1,666,291,343 *AF53733FB9BD3D772CF853AA1940F42B7E2CBB3E NAMPNBSP
1,666,291,344 *AF5C854347794E775BF2895AD9BB02AE1D359F5D REKHA.MANNE
1,666,291,345 *AF591C227E943095586074E8699C0F5D9C7C2366 CIEJ
1,666,291,346 *AF5A74C8A43F42262D9242AE0E2DF3906D932D5E REMMUR
1,666,291,347 *AF5153519A7021E248E23BD7980FEF0E6168BBBC Renee
1,666,291,348 *AF5DA79DFDA19B2E46C4522F275594DD0F57AC07 RESISTI2
1,666,291,349 *AF5594A9E3DA1677DE74FDA58F8F46EE589A5468 n.de.tunez
1,666,291,350 *AF5F0BA6A8F7FBACE19EC9673C4264A936DE1119 RETREILLEVIN
1,666,291,351 *AF5929EA7C2DEF1B7F06E256F68D81023FF189A2 NEDA MIRKOVIC
1,666,291,352 *AF5805A9C1419239D8563E550317D4996546BDA3 REXMANDRELL
1,666,291,353 *AF5D417321FF4A4D26A44C51244AB9B13D6FDB95 CLEMENTEBACHTA
1,666,291,354 *AF5D3EDD6D74AB00129887FFD5283E84C7B63AD7 CLEMENTE.DAUS
1,666,291,355 *AF5ECA758A05C0AD766E586DEB699632BC5171E1 nehcnual
1,666,291,356 *AF527191BE683DD9FD2DCCA3C5443BAF5521A14A nenehood
1,666,291,357 *AF53E0E1D439C1EA3AD331C334DB7C651E7CE208 NESTAWAYBOATSCOMWWW
1,666,291,358 *AF5E8AB8C56D12210B001F55FB1AAFC9D919AE32 CLIFFSNOWDY
1,666,291,359 *AF5510C170E7BD3C3809C2BFAFD562F9A1763B41 nevilleballance
1,666,291,360 *AF590D369D2F2297275490F2C034E976D4301113 newtonmacks
1,666,291,361 *AF5058BD11508995A4AA3227E8090CCDBE1261FC RINFRESCATING
1,666,291,362 *AF5D0604868148F434C8ADF5617E34233C9FB5E6 nfuckme
1,666,291,363 *AF5A91C1E8EC6B8968565334D713147019E8D949 cmg6k
1,666,291,364 *AF54A6E30BB4E0360DC27497A79E1331BA5102CE rödern
1,666,291,365 *AF50A304744D60468C6AAAD0F78540B2F6B6D342 rodolfotaverna
1,666,291,366 *AF5182AE9400A0D5CA080B7283F155F2AD574C55 [email protected]
1,666,291,367 *AF580B465E5CD0ED8D3FC890049A3605F29DF6BD colbystotesberry
1,666,291,368 *AF5CDB498552275DF10E5D59ADF6883C66C164BE COLINEGGEN
1,666,291,369 *AF51599B42D109DFE064FB88A4BD57758F4450DA noblefuray
1,666,291,370 *AF5E0A801E2C3DDAC2238693E2D1CE39554F1EF6 COLLINSODER
1,666,291,371 *AF52DDE3D6410FA5A8D72BD100E89019B76B71B6 ROGERGCABSW1
1,666,291,372 *AF57009E57E0EE8631E7ACAB169184963A5123DA COLUMBUSPULLEN
1,666,291,373 *AF515183AB52C4447E776C9751D2C0D5C0B5D3F0 COMES.THE.FLOOD
1,666,291,374 *AF590A3FC9BA5A57B33F830BBFC97A900B356C08 comna
1,666,291,375 *AF5DF890BC1DBEA385A3FEBD29B47B4405FBB597 ROSARIO.CUFF
1,666,291,376 *AF5ACD192F9A6B91354215FE1A8B7DC3E776C856 CONDRUZIENNES
1,666,291,377 *AF5BE1BFDD5E18D894329558EB0F2365CE5DE7AF rosneft
1,666,291,378 *AF5E7A324E36C29BF3BCE555C2C38EFE43C9FBDE CONTRATABULAR8
1,666,291,379 *AF58CA7F21F83D285E64778C06C06E33BCB0544C Roy's.Theme
1,666,291,380 *AF59B3199A9485894F9F97F7FF77E2DDCA4E2A96 CORDELLBOYKEN
1,666,291,381 *AF5A6D064980F9CCEB004706E14F4BCDD46B4D04 RT67JZEHQX
1,666,291,382 *AF57DAF054B96789249D7D4782A174D09D0F6592 RUBINBARRIEAU
1,666,291,383 *AF59BE19B449D6AAB12A8636C82603E08C2917C0 NTIATRACT
1,666,291,384 *AF5D61DB7F498F7F77CB9A07D663A5D25EEA06DE RUDOLFIELLA
1,666,291,385 *AF5DB59CDAC9194BB3E754BFD16D8EECB2E8F8D5 covn
1,666,291,386 *AF53AB0D43F433A88D1BF66C3310F917DDEF197E C:\PROGRAM FILES\ADOBE\ADOBE PHOTOSHOP CS4\ADOBELM_LIBFNPDLL
1,666,291,387 *AF572BF46ECF5EA7AA29AAB80D7F7C2FDD60BD97 OCTAVIACOX
1,666,291,388 *AF5DFD18CF37958D900B1BF1CA1CD06ED38CF505 russsarabia
1,666,291,389 *AF50CBE61946BA8F50B94C3627478A6BAB626B85 (O_-)-~-~-~-D###8
1,666,291,390 *AF57DF8A830B30F8FB4E597427B066DF8D777EFE ODISDELAUGHTER
1,666,291,391 *AF5C5F2961276DBA8B8C305A527274B1D6EC2292 S149H73RHS3S
1,666,291,392 *AF5B0431B3E8A0C248E64ED38CE839B792AD55D9 S213920
1,666,291,393 *AF58FADD780E048E371453ED171FBC841073044B s3n+im3n+a1iza+ion
1,666,291,394 *AF5DEA895E7DDBFF211A1582DAC3D97D8937FC96 SAHARAD3
1,666,291,395 *AF54ACD19E262E11CE7BBCE64C54AF80C306E0B4 ÓLOMAKKUMULÁTOROKÉ
1,666,291,396 *AF560CEAD1399A420A2DD1E050D255315F2A51BE crimines6
1,666,291,397 *AF5A2E6EF1292C7AF801A19194B2C334DA98D7D7 ONAICLAC
1,666,291,398 *AF540A65B0898D98E33D104DB388CC981287DA35 (^_~)o~ <----p
1,666,291,399 *AF52A3303C54808BA49F2D4706BFC69386AF57B8 OPERATINGSYSTEMSTAFF
1,666,291,400 *AF5B5BA1514CFE2F14AEF5CF1299ED303E26CF26 cupkaemp2
1,666,291,401 *AF59D8F879129B62E7C9DFB4B8F640A3D249C743 cusiman-1-0
1,666,291,402 *AF580BA5D57FF2A22BD9A19356419487059B3A9E cv52u
1,666,291,403 *AF5107E8B2EF6CA6164C08B126A2F9CED92FC75E ORCHIDSHOTGUN
1,666,291,404 *AF5E90AD59F5EA93666457DC4DFE80FF09DA90E1 cvs%v
1,666,291,405 *AF5988BDC223E970A997CD5B39FA727A8179CC1A ORVILLE.CHESEBRO
1,666,291,406 *AF5D6D1C6D07E204B93CC711842E635F19B097B5 [email protected]
1,666,291,407 *AF595F56A94B9669734DC74C6B79E377C8700DE0 cx,g1
1,666,291,408 *AF50115839526D022479E2B65B238C3F3F637872 SAMUEL.HEITZMANN
1,666,291,409 *AF5DB972232677EA7B739346C0854AD23EDCE244 [email protected]
1,666,291,410 *AF5F06590CDE75EEE82E130BA7CB133F28C77700 [email protected]
1,666,291,411 *AF58129FE3CCEE7298341C1CF572B519570C37F6 CXL&+
1,666,291,412 *AF5633602ABA19BB3C7F6EDE621B3E4A3D5CA623 CYRILMCONNELL
1,666,291,413 *AF583F354BF1C22DD6F52753E26C35B26FEF0EBC saulputcha
1,666,291,414 *AF5D6E7621C1D398027C6C03E9604D3015EF8EEF OXIDERESING
1,666,291,415 *AF5CE39E3927D0083C5FE02221B54D4E4EB5BED3 SCOSTATIS9
1,666,291,416 *AF54679DE388192426F1C4C2200D08238D8CA387 d3ske
1,666,291,417 *AF5DEA7E61FB8A70C0040F64B6F7340FE163DFEB PALMERBRESOLIN
1,666,291,418 *AF5F762E2FCA7D7DDF5248637697E3A7303F0188 PALMERI’S
1,666,291,419 *AF5AB8F8D85A7D5BB866F29BBD8304E7EC782DB9 [email protected]
1,666,291,420 *AF58D06E9D2E4899A874C7B90C74177A52655D59 PANTSESYRJ
1,666,291,421 *AF51377F4FD7E7693A01C95684F2CA2E27D6F265 D6M-5
1,666,291,422 *AF53E9D78E4B2BB1AA082CD5C9BBE3583CD8650C d8/g,
1,666,291,423 *AF53E078F4EA855A525B60249CAC9311FED581DB DALU
1,666,291,424 *AF51460E3B86746DA74183F62064F1D78814936B serveitup(featcapitola)(brooks'hiphousemix)
1,666,291,425 *AF53C7E2ADD951052FD717BE273CA90217AD4637 SESSANGA
1,666,291,426 *AF566DD77A41EC98147AB4331A6C7B7BBBA53917 DANIELLELYMAN
1,666,291,427 *AF5813CF49248105B3DB217F4A5502D5941A9593 SEVENCYCLESCOMWWW
1,666,291,428 *AF5C5FEA3FF30B200CA3975749CB6C0E17672051 sexyevans712
1,666,291,429 *AF5459FB6865C8FF0ECBDE404908D01BBA41B005 SEYMOUR.MONGILLO
1,666,291,430 *AF507EB8EA9107EF912134AE00410F25B2709797 DARELLPANTOLIANO
1,666,291,431 *AF55B49A3B4A9E13CE82F7DCEA4C24FCAF7E9ACB SHADOWSSUSAN9
1,666,291,432 *AF51A5F0C3461F6654538D9F4743E8D1701439F8 SHAE.FIELDS
1,666,291,433 *AF5553CEE71918C9E017198BC4A821E6C1CD4A64 pd ` :p
1,666,291,434 *AF51ACE7D480528D3209997A1DF842F685F0E5B6 PEGGYRUY9
1,666,291,435 *AF5652B71E3EE0AFD2843E7CF27945CEFF44BC3E DARNELLLUNDGREN
1,666,291,436 *AF527F2D695715FA178767D80223974AA476F949 pelourenco
1,666,291,437 *AF578959CD0AADF83918A57E6540B6A0DD9BCD92 DARREN.FABER
1,666,291,438 *AF5527038BD5E7E5F252007BBB28CC9CFA577378 DARRICK.BIALIK
1,666,291,439 *AF5EEA8A830DF211426C8B5A6AEAEBE40525FF84 SHAWNHOMAN
1,666,291,440 *AF538CF9F1AB53D93D449688337E811EEA3AF737 DARRIN.WONSER
1,666,291,441 *AF5748EEA5BD2718F3915794B4E257E125890A49 PETUKSIA
1,666,291,442 *AF565A0BFA777CF067E936845A60460953956FFB SHELLEYBROMLEY
1,666,291,443 *AF55D8545A6B189A76F9521CD091B837D20855B0 SHERRYMURPHYDAOUST
1,666,291,444 *AF54CDA6606A370BF2854974BF841E93C5F79995 philipvoelkerding
1,666,291,445 *AF5C1FF7213E60D56B6173E666C9CDD678B0872E shimshumaaraan
1,666,291,446 *AF5E76629D5C3062A8EF8D718DBB18305E036722 DA!UF
1,666,291,447 *AF5CBA4C345008CA32FE433511DEA0ED24F410DC PIIRITYSVÄKI
1,666,291,448 *AF59FDD7AD4D177BF2C313DC10FC1A1539B6A700 pineste8
1,666,291,449 *AF58E35EEAD200F9CAC0B0BE3D97030CCA7160E7 [email protected]~O~O)0(
1,666,291,450 *AF5B7C75F8E61A768434603DEC3E9EE98A6CC75F POURCHASSIONSES
1,666,291,451 *AF5C75863B7B2A3536BAA10DC3FDCA75C0024ECC delmerhans
1,666,291,452 *AF534AA8BA353154B8FB3BF735BDCE515D87CD25 DELTASAMPLER
1,666,291,453 *AF5CDFDEFCAC820268C6C762F4B20A87F37304BC PREDETERM1NA81L1TY
1,666,291,454 *AF5673E8385C8434F7E1229B2B157890F972C908 denniswhitlock
1,666,291,455 *AF587FD4A7E74B07B0ECE34C6ADEB7CA61965C4B DENZEL423
1,666,291,456 *AF58FBCE10117C1E2F7E672A55E33C342E1C73A2 protective-gear
1,666,291,457 *AF5D52A1135A8E23D0E0271A1257DCCF5D0E81EF DES TAS D'CADEAUX
1,666,291,458 *AF591D88984C18F02B9D1F535459215DA727341B speed-racer-(hardcore-mix)
1,666,291,459 *AF5B522E94B50D4A481E89A849FE143FE02EC1EB PU5E
1,666,291,460 *AF5ABD9CAC1F553DF789EC0E983C82061F06506C splat~`[email protected]
1,666,291,461 *AF50AA4D3C6998789C441CFB465E2750A1D119E8 DGQNL
1,666,291,462 *AF510B23BD45B912AF898B689C2B3B2D7F893D0A [email protected]
1,666,291,463 *AF563406B1D6E9756F59F8B842D414F1EC2109DF [email protected]
1,666,291,464 *AF5D51D5DF4278EC2B5B146D0A3491E393A6B3AB DIEPKIMBER333
1,666,291,465 *AF54B80B81C7BF41D2E74AAB25D23E56D67BED33 [email protected]
1,666,291,466 *AF5688FCB1EC464E918DB6FB5875D3FEBDD10E60 DIMITAR.APOSTOLOV
1,666,291,467 *AF5D89B2720650B10682F17374A085D7A5D4863D [email protected]
1,666,291,468 *AF5AE55899A44034B2D7F87772DFB23E18C21570 [email protected]
1,666,291,469 *AF5B8280EDFC51C936205774742FA86C3CD21E83 STALINGRADN
1,666,291,470 *AF591226151D35047942B7B4710E4FD9DD157C2C QP~~:P
1,666,291,471 *AF5BD3E8A1B7696C31FE89FD161B953A324BF712 STATUNITENSE
1,666,291,472 *AF5B57357D030C7AFB10FAB3FAD8C2A3AE63EB43 STEPHANFADLEY
1,666,291,473 *AF5F802124307D5190E790BE58419B443CA4E08A QUINT CHAPMAN
1,666,291,474 *AF5AE7C834FFC9D2843EAB9CAA669B81176FF5AC stephjohnson
1,666,291,475 *AF57DD693E78E3FBD6D9775F931966A7EE0CFAAE DKPOL
1,666,291,476 *AF5DE1FEA9CFDE26665E5E2D46E0D59E7717AE3C r4i8b30jmpul12ul58r
1,666,291,477 *AF5D294EBBF252B5D02D763878F425B22742D78F DLVC"
1,666,291,478 *AF54636A8CE1482DC06EC4C65FA16967CF6CA713 dmm2e
1,666,291,479 *AF579183655F71560437779B92529465DAF5A990 STLEGER7
1,666,291,480 *AF5D967775A50CF2BB52023E14A7F05017E7D5E4 dnb8c
1,666,291,481 *AF50DBA0A9350574C459DA6316723FA206D249CC STROGENMANIPULERET-BASILISK
1,666,291,482 *AF5CB93F1778B8CEEB84B3B8E3B36C0C7B5CC402 Rampart-Fury
1,666,291,483 *AF5BF9BD4D8FD05441AF48010E25D77FF5A57969 dn+vm
1,666,291,484 *AF56E587E7F6E60D2E0A3CA6406A979052BD7768 RATEFOWI
1,666,291,485 *AF536E1B11DEF7BC95F45D8FA23EB5E3F6550A36 DOMINGOTULIS
1,666,291,486 *AF500800DC00657237292188604BE5CB44B1CC0A dominicbabrow
1,666,291,487 *AF5B241068AE87C2C76525A4EC47702673B05382 RAULFYALL
1,666,291,488 *AF51B53F89D9C60999C334FA3342DD07B4ACD71A DOMINICKYOSHIMURA
1,666,291,489 *AF5CDABF4BA41FE9AE55980CC0A7892C3AACAE83 dominik062
1,666,291,490 *AF5163B08611776C2B4D54C15FAD8857AC0E3C3F [email protected]
1,666,291,491 *AF55378299E549C2F801831886E515756330D9B8 rayfordcoffee
1,666,291,492 *AF588AE577A78D0BB557B6BD2DAC23156FD442A9 donaldlenters
1,666,291,493 *AF55036BE9426DF7ADAA9F02FB414A8E01FDC687 [email protected]
1,666,291,494 *AF5298759E0F9877734A42A44439A1A008DB0F5D DONNDOREY
1,666,291,495 *AF5FD708D2C39447ECDB82FC34CE2DCE7481CD25 DONNYSPIERLING
1,666,291,496 *AF5F50A6B7569242C3A487A2F40A2B3F7D0411EA SUOROVIB
1,666,291,497 *AF597A255D3A9172F3442777B08048D86D7198C7 SURFERHANNA
1,666,291,498 *AF51B63B04A9B1B0F43B705B4BF09465C1C65963 d+ou7
1,666,291,499 *AF5263CBD9B766456BFA44AE037072984BF0D654 DOUGLASS.ROUPE
1,666,291,500 *AF56B15F654133F0AA17F6E500F8A3070D300278 SYLLOGIZERS
1,666,291,501 *AF5F4AF345FEF06AF10E38D4FBA378D7B4893E64 REGISTRATIEBOEKEN
1,666,291,502 *AF5BF238499EA46BBFEE9195E3317EC371BA8014 DQ7T
1,666,291,503 *AF53465BF301A7BBC9C6B29EC7EA5EAA1444C349 REPRIMIERE
1,666,291,504 *AF5326466D848F97B5A3014B28997E839DB7523D REUBENMCCABE
1,666,291,505 *AF51E8973CC6428ADA89EBC7862178774E64302F TALCAHUANO.CHILE
1,666,291,506 *AF57928DB6FC445C403DF21FACE4A296EDDF25F1 TALK84.13.87.56
1,666,291,507 *AF534E83060ABBFB79415C86E6DFBF2D09D2778B REVOLTEIA1
1,666,291,508 *AF5CB1072B2DBB230B68140D1709406081BAA92B d#s2u
1,666,291,509 *AF5FB82E49384F2C6A7C161BA7BA5EE3043612CD rgioMendes(Part.Esp.Simone)
1,666,291,510 *AF52B7238FACCE83F7D526E4E8E1C1807E24E84E RICALATINAPORPBIPPA
1,666,291,511 *AF5F32CC5A3B9DB43E0E16D209FCCCA15C824B17 RICARDO.SHANKS
1,666,291,512 *AF5633F7538BBA2D4AD71C6EBF1C0234F65FCFCC RICHARD.AUMAVAE
1,666,291,513 *AF5C70D52E32EF11624893193707309263FE3AD7 DTXBG
1,666,291,514 *AF5273D0987D8FB216B7AD04857674C26E45EB7F TANINSKO2
1,666,291,515 *AF532C9F499E472FBD6D550283B62BB3D655D14C RICKCSUBAK
1,666,291,516 *AF5280BFFD1169851B673142382EF8BA95E8450C RICKYECKBLAD
1,666,291,517 *AF5474EFFFA36E1CAB040516E8011A4DE419A87E DUSTINOZAETA
1,666,291,518 *AF50F2072CA53A1B01AD80B2C1CF690D66CD7F1F RITERNAS9
1,666,291,519 *AF51AD7D2851B57E5FEB34F0A7B03977F9EC1D94 d,vk
1,666,291,520 *AF569174232F6DA9DE58C5025CCE11F590B0AE27 dwayneapel
1,666,291,521 *AF5D0E934DC262A07BFCEDA71D21F2A98D0768CD DWAYNE.ROWETT
1,666,291,522 *AF54A43940AC25CB4F278625776D77D92F689BE0 [email protected]
1,666,291,523 *AF56C1DD8B4E4810BA766AA3D2981C309C40A4F4 robinzimmerli
1,666,291,524 *AF5B50D5BD05F6050225A064D5006EDD60D86A8B ROBOTIC-INDUSTRY(FEAT.-SWAMBUR
1,666,291,525 *AF5F32646D05FB1E4C7808414136BEEC7A6C5814 D&X"M
1,666,291,526 *AF519C20D402602271F7A8176F71A80A1FC972B4 RODGER.EVANOFF
1,666,291,527 *AF5ABB059DDAA16507AF8FB63DFF57FF601B1594 rodneygough
1,666,291,528 *AF5766F092FC9D6A8D113F2D4AFB4D7DE303C1B8 rodtietz
1,666,291,529 *AF5F481EB7425634D0A10A2812F861DA6FF9E692 rogersek
1,666,291,530 *AF5D94FC1420D3870DAADDF93465736A64F9E2D7 ROGNON
1,666,291,531 *AF5AA12819651793D2A58041620477DD79EDBF70 ronald.unabia
1,666,291,532 *AF5D4F4B4F6D4E275954EB9BABFF6F680D26244E [email protected]
1,666,291,533 *AF56DA4BD6B593BC3BA9173DAD4296B5D44A19D6 TERENCEAKSOY
1,666,291,534 *AF5EEB665961EDDA52AE1022E5BCE8547DA60B26 E14D66
1,666,291,535 *AF5D78DBF555041B36B957CC0BDC15356EA770C9 EARLE.KISSI
1,666,291,536 *AF522A080367AFD64F0AB2666A5F6232A0492392 earlesaloom
1,666,291,537 *AF583C5FBCDAFB9A19492E453064752773425106 EARNEST.EHRGOTT
1,666,291,538 *AF59908CFD76AF4B62D586DEAA77ED6494ADBD4D [email protected]
1,666,291,539 *AF58DFDBA37856BEF8C4CA8E0AF4FD1275DA0897 EBAYLER
1,666,291,540 *AF50E5264A48472DD1A5C17F4278EE2DCA80CFCC THALAMI
1,666,291,541 *AF51C23BBF44345896F6BD31D7B34539E7AEEE89 eddiefala
1,666,291,542 *AF5DA008624061CBC0D3784815170C64E119FCD8 R:U"
1,666,291,543 *AF5CDCEDD0B6BFA86B99A6901FC81635097D99D8 thatstuff'stwohourscold
1,666,291,544 *AF5153177C11B22BF559D8B24600A693BEC353D2 THCEP-1
1,666,291,545 *AF582C13C960977208B906C3B61403F7BB91BA53 TheCBSYears(19551985)(disc2:Standards&Originals)
1,666,291,546 *AF58AAC4C8D8F920E57093A12E7CD56EC22ACAA1 thechevy84
1,666,291,547 *AF53935B3C08045A394BEB4D555698E084CCA14F THEFLYINGCLUBCUP
1,666,291,548 *AF5C69A1F1AA17AAABCD70D7A52E548180219B40 SammyGrenell
1,666,291,549 *AF582C4D534475C171ABCE0F354271D2494A8A85 [email protected]
1,666,291,550 *AF5CF833F21A56E5F126916FB15323F0C513C854 theophilus.sidi
1,666,291,551 *AF58762E8E89454B082D12F2C86B290FE0CBD2E2 THE-PARTING-(A)
1,666,291,552 *AF5E48820353AD510C0F0A57C2354F12E8FFD308 sangmaranto
1,666,291,553 *AF5DC924F4CA9631031E0D02ABB342FA5FCE6CF8 THERONLEBLOND
1,666,291,554 *AF5B43DD4FB07722C90D8073A55AA0563D3B5CEF SANTIAGOBABINGTON
1,666,291,555 *AF508D5AE82D93D15436133565C0FFCBFE88A71C eeyoregoed
1,666,291,556 *AF567E25C28F9555EF34D1F44EE3FEDF45C59E61 EFT
1,666,291,557 *AF55874C1B3846D5E251C93F3F6115E3F1698B78 saxelauenburgwillia
1,666,291,558 *AF5A0F2100F612C9DF53FFBEF1A85A22672CC584 schnellfahrloks
1,666,291,559 *AF544EF0106D76A4CBDD0527CF6BB69DAF8C7835
1,666,291,560 *AF5864329C689252E37C2E34CD33FDB18416E592
1,666,291,561 *AF56F53721BFBD5646B61145C40F5252BA4A4EBD
1,666,291,562 *AF5AF2613237054161A00C38D8CACD2DBF216AD7
1,666,291,563 *AF5881FC5CB95D2D0DF4781BD887A9F82270651B l
1,666,291,564 *AF5352583BA762601B6888384FF81A19CACC50A4
1,666,291,565 *AF50A80C42F3CB5323A437A268C20C42B53AE5AD ~eF
1,666,291,566 *AF5034BB8F64E551AA7E0A0AE93254BB87330316 THESTARSYOUSEEAREOUT
1,666,291,567 *AF5931F1B77A3B7F42D6A9DA5843F2D063236FA1 //
1,666,291,568 *AF5C638BD052851283E4A3C627FB5E398A0E1A6C EINZUSCHALTENDE
1,666,291,569 *AF527B396E1DEBC438DB029BC82146063E98C7D7
1,666,291,570 *AF5C988C91A29A0A5C892AA066809044678EB162 Ғ
1,666,291,571 *AF542AA4D7D933E0BF1C6177672916268EFC0273 J
1,666,291,572 *AF5E47E8E0D98D9B72A1752878CB6F9699F00A2C EL4ZAYHYRFCVXTRU
1,666,291,573 *AF55BF0674992F648718D62AE2FF5D8C54EA9F87 elbert.dee.walston
1,666,291,574 *AF5C0954A1D3D8BD6EA049A84474578066375553 elder-wilson
1,666,291,575 *AF506FBAD58F8B5B8E247E835DC0E5FF631DEF6B TIKHOMIROVVALERY
1,666,291,576 *AF54C2404A50D8A6B27E6BB11084D6AF70260314
1,666,291,577 *AF5D69DABE7035D3632E73CB1EBED9B022BF0B47 TIMMY.CONRAD
1,666,291,578 *AF51D9223282A20070228D759A62F430971DB331
1,666,291,579 *AF5DE6EBCE1F1B7EF050260378E09614EB85A357 TINKERMALCOLM
1,666,291,580 *AF54A207DA5FC4E8FE99C96C13C7C69224778309
1,666,291,581 *AF5B3229600EBE23C2994C9A8E17D1CB252FA2D3
1,666,291,582 *AF57AB2B26561571329A1BC2594B6F0B8BC27B8F g
1,666,291,583 *AF51BD2A442E6861F9B295574D7314B4BAFA51CE ellisiap
1,666,291,584 *AF54AAB42B4E8F4DE379C8232921147412A7C06B
1,666,291,585 *AF5A22E8B31177A811778553B7D091FBE771D928 el-otario-(instrumental)
1,666,291,586 *AF5FE9DB66856BFD20C6436F50CA0C53ABFD3950
1,666,291,587 *AF5C9AB84EBEE1744139310BB33FF148D553BB4E tommypallesen
1,666,291,588 *AF5E3BF1810D3AA9A2A16F31CF7740F88C013AA6
1,666,291,589 *AF5E876BEBCDF7E94DE10446CAE27E74A0BEB44A tomsanta3
1,666,291,590 *AF513EEA16313C492D94F1FBBDBA285029F630E8 TONYBIRTS
1,666,291,591 *AF571D330FA2DD9343F9EE8496A1DE183FD14BD5 tonythephone
1,666,291,592 *AF52F1B634D4E8ABDFAFC5ECC6EB929D7C1A1ADA em&i+
1,666,291,593 *AF59C8A06CBCA05A13AAD75746B37B79F531849F EMLRJ
1,666,291,594 *AF570ECA7D09F6AF8645EBC3BD52D5E8E2C76ECA [email protected]
1,666,291,595 *AF5CDEFD212FD7998EF836945646DEF051703CDC trasca.claudiu.marian
1,666,291,596 *AF5AE121ABB6F07C6A2256D1588BEC670EA0D48C TRETHCAPS
1,666,291,597 *AF5EBB0594D9E46A85B6B000C5B20B0BA11BEB70 ENFER2
1,666,291,598 *AF57CF93A84F69EF222376DDA826852193259173 ENLARGE
1,666,291,599 *AF5D8080F0FB92E57A5B8688DC47ED56A3B291A2 troyfaragher
1,666,291,600 *AF5195C5757A9E15B15E0A35C76C6A433EC22B66 TRUDYUNWIN
1,666,291,601 *AF5406031691AA742739CE98295F5458CA2A95AE ERICH.HUGILL
1,666,291,602 *AF53CEB6832FDF9B2289922BF7AC8F7FA5499D01 TYREEOLEJARSKI
1,666,291,603 *AF59657BEB81910CF28258A5AE90D5A5E80E7AED ERNEST.BRIDGMON
1,666,291,604 *AF5E6D19DEA988BD268626FBF450FDFFFD7CB6C1 [email protected]
1,666,291,605 *AF535B691E26F06E6ACB392CA626E1DFDB463355 ERNIE.ZIRKER
1,666,291,606 *AF57D63F0D44ADEF815F91361C3282FC7B8B4BCE [email protected]
1,666,291,607 *AF5722968DC551D4F994322978FB87C5CA012465 es;jt
1,666,291,608 *AF5BBD9CE46E7621B200317C92D2AD0633BFAF20 1234598 LIS
1,666,291,609 *AF5069EE1085D9744DB8B968C9D4A2D3B7CC7ECD ETL!D
1,666,291,610 *AF50FB11E9FBFB58FF65D0F0D882276BBE49A8C4 /usr/src/linuxheaders2.6.3224server/include/config/netfilter/xt/match/state.h
1,666,291,611 *AF5255F822E6DF3278BD031C6B891E4E125816C7 extraitdurituel'yamantaka'
1,666,291,612 *AF5423F091DA1BCFC6803ABD1A44CFF6CB564CD9 EYw
1,666,291,613 *AF5F885BBA1F6A1E58E94FF2850B73AA1FB9248F VANCE.REIGH
1,666,291,614 *AF56B19AA08959C54DC3C6549D77078B5CDD31F9 19111373
1,666,291,615 *AF55698004FEB3777E9CF4F9B58E9F6BB2734CF2 vasu.gautam
1,666,291,616 *AF5A3AD423C3CF2B61639950AC22702FD796C68B vaughantocher
1,666,291,617 *AF5353BF7BB7AF2CC7B9C45DA3FECB8E4ACFA124 VĒNĀTĬŌ
1,666,291,618 *AF56B636456BFDB096BB7B966AB37EEC1BD2E5BB F4SC!N47!ON
1,666,291,619 *AF50C369B43E0AC7132EC8C153D1627D5F187EAF FAMILIA MOUNTBATTEN WINDSOR
1,666,291,620 *AF59E74480720CA7D22D31D3312D048A8465356A veroniquegrignet
1,666,291,621 *AF5D5338DC81A52D98B59821B6124B51806B7DDE 1ENFILERS
1,666,291,622 *AF5DDFCFB3F556486FF1655E7D8FE0425FBA2C2C f.ea
1,666,291,623 *AF55667C34D5DA729CB80E0D7723D264E46E26D3 federicothigpen
1,666,291,624 *AF55A4E6B6B28BDE6359DE6B0DED9D414D376F24 VIENI.SONNE.DI.LA.MUNTAGNELLA
1,666,291,625 *AF57A342A6F43501567D0D189ECFE4F7BCD1D180 vientisanojemme
1,666,291,626 *AF577B487463B89C2B8978E8D1AE3D006D41CD0C 1hillyard
1,666,291,627 *AF5998C4C8AD2C4772874C359C6E2BDCBD07F757 FGENBSW7
1,666,291,628 *AF53B10DC641960825322DB553ED8959EC79AB2B 1 KURIERGESCHAEFT
1,666,291,629 *AF51BA3BD36BB9718869BE897FD12CF85E084A06 1-MENSCHENAFFENFORSCHERIN
1,666,291,630 *AF54CDA925C89D0658B2EE9959A0B1EA87F05E7F FKV9
1,666,291,631 *AF5E3E8721D38DF841E038C157B0D4985B92557A FLAMINJAL
1,666,291,632 *AF5B102EE8365F32E85D1BC7B50EB051E4F48D18 1 peberlykiss
1,666,291,633 *AF561B470212196FA4EDC89A51C8941A6E800AC3 voiced and unvoiced sounds with t
1,666,291,634 *AF5548DA4BF93252A8FFCA940C69A0DA04AC1DB4 FORMALGR
1,666,291,635 *AF521BC3CB3EDC493BD0D2DAD6C39D98724D0530 wabukayne
1,666,291,636 *AF5F6C8C30E684749F4E44BF83E2434549A2FE38 freighter/tug
1,666,291,637 *AF5E15DEB2B7E5F9817789D939D0971CD62CD5F6 wdefhand1
1,666,291,638 *AF5FD4F32AB341DA5C926C219FA4402C2B394A75 [email protected]
1,666,291,639 *AF5925728B206F3DEFE7EF61058F2EE15BDF6787 [email protected]
1,666,291,640 *AF5402CBCA69EF69FB247DCC09969FC602227E19 [email protected]
1,666,291,641 *AF5552D61937EF70FD2EF9EC4025A43B545D4021 where's.the.action?
1,666,291,642 *AF579605D6B566F9C8B7D69BC39599B2E621C6BE wildlifehc
1,666,291,643 *AF5ACC1983EAFFB9A216370C91E5BFE21B447380 269JIMENA
1,666,291,644 *AF559CA1179C5595699D71DA0A0243BD80C428CE [email protected]
1,666,291,645 *AF570385D30BD2B167A6A94384C7CC94FB5477E8 WOLVESNABLUS
1,666,291,646 *AF52AD921D362C7FC77DE0319BBF75A37313D26A [email protected]
1,666,291,647 *AF59881E3110B9F3320A4ABCB8187FA105CC6672 2myvacation8
1,666,291,648 *AF5C6EFE31C8700D8FE67F75D91330355323F70E [email protected]
1,666,291,649 *AF5B65527DE38BC1DE5FB90DEFA6F2CE4E105017 WWWKIVGAMESCOM
1,666,291,650 *AF561C0E3E28F074D42BE4454405D6F1A0F0E35F gentlest jh eh1 n t ah0 l ah0 s t
1,666,291,651 *AF576F8114256270B0D7C1085AD2CEA7EEFE9088 2.umweltmijunister
1,666,291,652 *AF586AA3EEAE5942405CE24F4FF4179AC59A2064 wxnd
1,666,291,653 *AF5DB1005A027EC1483E35D4E9B9C867B620FD4E 35D5BE5D6DE3CD06C3E68D001AEB7E44 MARIO1964
1,666,291,654 *AF55A6AF8A8E913EE2A6FC5869C2AA573C9681AB 367kason
1,666,291,655 *AF5A0A6C7C9E91DEFC06E2A22A177B28D07510D8 GILADOLPHE
1,666,291,656 *AF5921B1FC19D756600864D1687338841FEF9BD9 GILBERTO.MALKASIAN
1,666,291,657 *AF51CF82C25E4296175AD65C2DC1AAC284BF8930 GILGNRK6
1,666,291,658 *AF503E00132AE0D4AEB91C88212C673FF029802B )x(*.*.<----q
1,666,291,659 *AF5EC7B1B623167F8BC633093985838A9185C2C6 [email protected]
1,666,291,660 *AF5C876EA4EE51C199B61D7AF3113F9A38098A22 GNIKAMHS7
1,666,291,661 *AF5C00C7B39A76CF3949409F55B9135C2CDE1F9B XWVDVOX65
1,666,291,662 *AF5B47A069CFCAF0877B44CAFA20DC4A32375E86 gracchiai6
1,666,291,663 *AF52D11E83BAE757FE263041A07CDB60830FF2AA graham,thomas,英国化学家
1,666,291,664 *AF5CAC54FE9B4AEC588BD846A229041503470860 gravit0ns
1,666,291,665 *AF517593C613D5BCB1CAA801ED2DE60E5390FA94 grouchy.hearted.woman
1,666,291,666 *AF5860F9AAD495FA858AA66AA421F3A82D525934 YONELAZWAYI
1,666,291,667 *AF52F657F486C11204555140DCF0FB3022CC19BF yosef.ramy
1,666,291,668 *AF5B8EF584A0B9FF53D82F024D4343C46AFDDAC2 GUNKSD
1,666,291,669 *AF5C43D2A696357A6A44EBEEEF0D324F1FD94195 you-love-to-hear-the-stories-(dirty)
1,666,291,670 *AF50A91D0C188D447FB6D6AACB3564DF65AC139A GUSTAVOGULBRANDSON
1,666,291,671 *AF58FB89B67411B1654F595D08C9DCD7855D431C YRGNUHDN6
1,666,291,672 *AF5A06048AD08995ED2CE935CC47A9B8188A1109 YSCHELLE-BLANCO
1,666,291,673 *AF5E01F5ABF6457784BF7BC2A40C0D446BB688A3 GUYSHIVEL
1,666,291,674 *AF59AFB2F342FFF639EBBE29A8198C83E328D558 GUYS.....IF
1,666,291,675 *AF59B1BD64FA4C18BDE2EEDD6E3F6BC1E7F73E6C [email protected]
1,666,291,676 *AF56F456BD7BDECF1AB24DDBD9E9A8D721A82EB2 3 GEM-MINING
1,666,291,677 *AF54768888415B918284C8226E688922D9E0E7A3 3IAMBRANDI6
1,666,291,678 *AF52FF61864F9C3898B80A3C16AB014E2160DABD YVES-ANDR
1,666,291,679 *AF5004F2BF5E85FE05DD1D52F841A883002D7418 3)~O.~O.(>_<)
1,666,291,680 *AF5F445373A79C1D1ACA0B410F611552EA8B88DB 405113 many-children-learn-about-drug-use-from-their-parents-
1,666,291,681 *AF59E7DE590796D2F52B37A4E8D0A7B3C74A38AA 496303 fazil kirkbir ars gor
1,666,291,682 *AF5CBEC6E3E930B00C290DC78327A661A6B558BF ZAILAGANDO
1,666,291,683 *AF5E807635A2AEB1721939D952478ED53AED4FCE [email protected]
1,666,291,684 *AF55E8F40ED238471A7D0ACDCF69DAC605CB14A4 HASSAN.FULSON
1,666,291,685 *AF5F5D2D6D84248A5FC7BE15DD717B15285511CC 4HERBERTSNOWBAL
1,666,291,686 *AF504D96867E629C5EF21B0925F5FC290755B9B4 4LLEV47ON5
1,666,291,687 *AF5538ADA4E80D48FEAAAD1C2D8F9767042B7843 hcebamah2
1,666,291,688 *AF511DBF8EF47D846A28F5513558C2B8595159CC zenkbbs
1,666,291,689 *AF58D8E5C27797B4D5AFB4B004A0AC266262E16E ZEROSES0
1,666,291,690 *AF5AD0734BA97733FA1A2C50C38DFD673BF019AC heart-(revival-mix)
1,666,291,691 *AF5632425308967DD130476A1CE64ED0C0F1572F [email protected]
1,666,291,692 *AF5A005A3FD4E9C1B1560DD135E785EC5558F06F [email protected]
1,666,291,693 *AF5A15390B3443B75D34790D7714AFAFE38177A7 [email protected]
1,666,291,694 *AF5785E30F4362FE2891E11B140AC48D4D4C369B [email protected]
1,666,291,695 *AF5CB7C7BDD6088351899D95CAE130FFA5DAD26C [email protected]
1,666,291,696 *AF592E31708D707467229C9B089C917601893FEC ZINCSAMPPING
1,666,291,697 *AF52779A9B401B2DA6DBF5F1457B9F3E1234C904 HERIBERTOKUY
1,666,291,698 *AF5B52489B981EB2F450C8DBB75A37444BFBB05C HERIONOVA
1,666,291,699 *AF575338E8918A760E433E1E32E228CEC346B362 ZLDA
1,666,291,700 *AF573FC42345B9EF7181A1DA680E50EC6A8448D1 HERRERADELDUQUE.ES.T
1,666,291,701 *AF5E7A88180D18D9D9714DCAA67456E705801FE8 HERSCHEL.CORNEY
1,666,291,702 *AF5B650250331F77B36E48A05AD84E11154889E6 zoeytincknell
1,666,291,703 *AF5C78822B5A5889F20064248EF6A9F35B9D5A22 ZONA-ROOSA
1,666,291,704 *AF57ECB952612E24C1A36BF0E9EE3BC0B18539D5 ZOO$PERM
1,666,291,705 *AF51E96FC08EBC30CC6778068977755182E8B703 heycobsw5
1,666,291,706 *AF5D80B870E70E19552C3618F974D043C0B86D62 [email protected]
1,666,291,707 *AF5933979FAA4A675272E3DBC05E235C278E6742 hl$+
1,666,291,708 *AF555FA8D9B5D82BB4793B403AD03A8804D2F049 5hello85
1,666,291,709 *AF557143E664C3990C4E60F8E9C0CBC9B038829D HOMEASSEMBLYBIZWWW
1,666,291,710 *AF50473526BC8F35C30685AE86E3A9130A8653BA HOMIDBSW6
1,666,291,711 *AF508657DB1C53AE8F1B5EFB0DA1E79E5BF592FE HONNINARU
1,666,291,712 *AF5CDE60B69217E05FE4C3F4CD2FEDA2D816DE9D hoog4t
1,666,291,713 *AF5CCF4CE063A19BDCE870B6799F9431BAE306D5 5PENPOINTEBSW
1,666,291,714 *AF578277DBFEBA21E9E51918E7291594BFEB9536 HPLACE PIGALLE
1,666,291,715 *AF5FEE23E8B2618A933A3C4E17AD6888C00966D0 HRUOTNUKS
1,666,291,716 *AF500842CB9A79FD0DC7B52D878E7E7D871D6C7F HUNTER.OKERBLOM
1,666,291,717 *AF5B0570AF324219C8F2E07B0B642DA3D1CCBE49 КУРТИЗАНКОЮ
1,666,291,718 *AF56659EDC197981B2FC4BD265C74D31B6DF41D7 НАВИКАХА
1,666,291,719 *AF529C606097ED47359B1712C98E984E1055F623 ОРГАНИЗИРАЛО
1,666,291,720 *AF56089840DAD72E2A4DD65CBF0690630D02B5EA HUUBK(STUCKINLIMBO)
1,666,291,721 *AF5F7936F9CA131AE6B9DAFD30E04E4065E2DA79 I652450581525
1,666,291,722 *AF5317B0CFDF3EA4C495E6F1051C0052F6C893E3 6APURARER
1,666,291,723 *AF5003B8AC3888D8A5EB26A3B7C6D1D243A9C282 6NOTYHPAGEM
1,666,291,724 *AF54E99FD1AEFD6BFC405892E2A3A16E1CB79528 6POBAVIT
1,666,291,725 *AF58B8DEC42A3342390E7F61182BD8F8B69AC333 6theskiing2
1,666,291,726 *AF5F1B6CF7967C926F8C6004EB7386070EF29C15 7AKHROATBSW
1,666,291,727 *AF54C3564C6D1A525C25D46668CF655ADBFE3B61 7e7258e328b8fcf1
1,666,291,728 *AF53B5D9CE218D0D873CC7725A101C5C2CD88DDB irafavila
1,666,291,729 *AF5B6B8E5A94DFDEEC7C56E85B56DD30F7B0F118 irafossa
1,666,291,730 *AF5CDBF680D52265B27E666195C27BFA3BECAC39 IRANSTRUCTSTUB
1,666,291,731 *AF55BC9F6150FF6D3E102E023119FCB725D75E39 irishplay3
1,666,291,732 *AF5BA951CA3A99912A9B27D134362FD2BD4EB488 7STOCKSHARE
1,666,291,733 *AF5131E3AE8BCC34686187BAA83F5E7DB6EF0B8D 821911 maannaisistavainjokakymmenesosaalukea.
1,666,291,734 *AF5C85B5827CAFA577A7AD9D696A133302B04B45 880711 BUSATISLARIN47MILYAR
1,666,291,735 *AF5FEBCD8D4FE99E5BBD09103B03FD54BA51C01C 8EUROPEISTICO
1,666,291,736 *AF5CF889F08F9A142FEFA302CC92796E1BBC55FB jacqueline-beaty
1,666,291,737 *AF57125B48907A01CAE91A730D15BF06F616DB6D jaguarenter
1,666,291,738 *AF539C5642BBF2F4132B475C6C3E991A086B29C2 (>_0)-~-~-~D###P
1,666,291,739 *AF5E5BD19366DEF11B4258C7B1946DC32051B018 8MAXIMEMONDAY
1,666,291,740 *AF55004183D76D0DAF146786398F55C6CCA6D88A 1134724 TWO BIG HOLDERS HAVE 86% OF THE VOTES , THEY NOTE
1,666,291,741 *AF523F501EB6642C7AE512061293B4A059E1E59D 1165152 ".OSMO.ON.HELSINKIL
1,666,291,742 *AF5A7411FF47F7953A95B54338329DDF2700D7FE 143 pricefixing
1,666,291,743 *AF5B202A5D1A37F2850F7AAFE579C322B3A6B778 1923776 LAULOIKOSKIVOIMAKKAASTIIKIVANHAALAULUAAN
1,666,291,744 *AF59369C20B9559686359FD242D1E5E991A0EC39 9AHASSIAN
1,666,291,745 *AF5518B1FE1E7C75988511F746831663CC3E4931 1 autoersatzteileproduzenten
1,666,291,746 *AF51FF9F5D9A142B8E0E74F60DDE1FE40FAB38CF 9CONSIGLIAVO
1,666,291,747 *AF5C330702B0F3A48FFED2F77B60256F51261B7E JESSEBURKE
1,666,291,748 *AF5D7503A91B71DD4CF4C36B971D61EF7AF7C7D2 1DRESSURBEREICH
1,666,291,749 *AF555863B5574AF7B3A28A4C1652246BA0DB2D71 9H=AAA
1,666,291,750 *AF578026D46866F29E33FBA14B9C3372358967C6 JIMARLIA
1,666,291,751 *AF5A3FBDB765CA3C8EFF6525F94B69DCB0628CFB jimromanek
1,666,291,752 *AF527D5E22ED23843A148048D87D7D98768E5E26 1HYTTEFADE
1,666,291,753 *AF5AC2858673B4A22AEAC2BE60F45E8BF9EDB86F 1.itaretlenirse
1,666,291,754 *AF5CE725FB415070CD3986DA81F606D5F4CAC6F6 1-LAINUUDISTAMISTA
1,666,291,755 *AF5E8973CB56DBD83176F32D26ACB274193219EC 9STOKVRKERE
1,666,291,756 *AF516AB373360D0BD9047AF3B28B1C6725CB9610 9TUMBESBSW
1,666,291,757 *AF58DD2FA676697670EAB676D7DCB81978F6FC41 johnsonkuramoto
1,666,291,758 *AF5D16B03ADED5BFE3ECCCA3167F92E412BB531A 9XATNYSOT
1,666,291,759 *AF5EB545029AFE3C5EE824744CF965E8BE4AA251 1p2o3i10sne1
1,666,291,760 *AF5C7A04AE0FA4A1618FBBFB327D6CECA4BACB75 a"1ow
1,666,291,761 *AF5B8D92EACE63B9CB11C4C7A60948681B82D740 JOSEFPARKINS
1,666,291,762 *AF56BB6A79A04AF52046C49F9F58196517027758 1 SPD-GEWERKSCHAFTSFLUEGEL
1,666,291,763 *AF552A5C8C48C6842E28AE2045ED4C3C20E38977 1-suositelvampaa
1,666,291,764 *AF5B38C3831C9602A114693192F8572755653E85 AAAAAAKCIRTAP
1,666,291,765 *AF53A7FFB9313DF6D0F90B420D16F3C5BE99E3E9 jvf
1,666,291,766 *AF5604DCABF85F33FA58671134E859E35AA59419 [email protected]
1,666,291,767 *AF580C5F48010B8BD8FE153BFA80A205A5B60E90 JYPMGSO3
1,666,291,768 *AF51708DF20355C915830895AE2DDB8CA6621AA2 KEDDARI
1,666,291,769 *AF5F9DA2313B0F736AE4DA1C9B3797A9A1638142 kelli.parnell
1,666,291,770 *AF518DC483C9E5B3E3862560DCB1390712135E3C KENETHGRIZZAFFI
1,666,291,771 *AF5CAF81E6A7F0745F6C2A08E0AE9699B566C4A5 29.ausgangspunkte
1,666,291,772 *AF5098D3A94E6D77B524B70FE2EEA9A4F9CC3047 Kent T
1,666,291,773 *AF504257B96126EBA6AD3F0BE8C8471D35106A16 AAVLJITS7
1,666,291,774 *AF53DE4A98E0CE4CB7CFA9986109EE9C738AE1B9 kerrymullikin
1,666,291,775 *AF5E96A51479E3368B78DA26EDD3353EA984E9A9 2-AMMATTILAISELLA
1,666,291,776 *AF5E8FFA25709E9E12FAF5349595657F919864D4 khiem-vo
1,666,291,777 *AF5E47D2748AD60E648B45664F6E948E7092D62A 2daenk-mobil
1,666,291,778 *AF561541EDE90A266F61A8B6D1556AD3E2095851 abm7e
1,666,291,779 *AF57FD87CECA11881C47103BC9B2AD09F4237B9F abxdq
1,666,291,780 *AF54A428537481F4352023967D020FBC2CE1DC31 ackop
1,666,291,781 *AF5C75F18EC9462869FDE718D7DD8C560468663B krimpmaat3
1,666,291,782 *AF54A44E9D2AC2F50D83EDED3CE7376B72BDDEA8 [email protected]
1,666,291,783 *AF52BBB8D0D641EB89CDE29F8DB697965B1ACFE9 a_d!)
1,666,291,784 *AF5EC3CBC4639D1706ABB659B22D448DE8D720D4 KYLER92
1,666,291,785 *AF5DA1E205CD03F7E5F5BC4B591D3FFCC910399F AD+NK
1,666,291,786 *AF536A6BC16CE6B68B507B8395B645566410C0AB ADPM
1,666,291,787 *AF5A0ED249980030DD1F3C79860C7F182E50EAD8 3=D**(00)
1,666,291,788 *AF597E9F40FAE8EBBB26D47F5DB37C78FDA0AA66 leg181l171es
1,666,291,789 *AF5371066193EEA2E7CBA1C8E99A3505388A0EE1 466salma
1,666,291,790 *AF52A31056452E6B8D00A9C06BB9F9CF6C074B70 LEONELVILLAFANE
1,666,291,791 *AF51A96E2285EB6D8F827595C2EF4B78150745B5 AINA-EILINEN
1,666,291,792 *AF542DD65C37A7572DB82574264727E9F60C79FE 4MAZURKAS,OP.17:NO.1INB-FLATMAJOR
1,666,291,793 *AF57AE6CD4303038C6CAAA65EC6424B1510D893A let'sgetbacktobed-boy!(feat.tq)(radio-videoklimax)
1,666,291,794 *AF5C24003F7BB2853E9E7BB44DD33C62E704F311 53mfct0n4l
1,666,291,795 *AF591898A92B4B08FDD4CDF69AB5FC5794F76FA2 59VAAA
1,666,291,796 *AF5382336C9F2918CF27C3A4C113A74AC01F796D 5ANESIMON
1,666,291,797 *AF5D1D91141470579D4622260CB815212032B50B 5BSWLONGHANDLE
1,666,291,798 *AF5FA2C9F34B4D0DAFB57B2EB3F59954DF54A903 5EXSICCATORN
1,666,291,799 *AF5F43110D4F13F5BC4888E95D2A81482A7C2B29 LIFEFULS1
1,666,291,800 *AF558017B8710F3E676C50AC88CDAFEE28F8CBD3 5PROCARE
1,666,291,801 *AF5226D7C11978E34F8E0662B74D4930EB4A712F 5ROXYSCARLET
1,666,291,802 *AF5A22DE877AAC1BEE6FD1849D36CFFF8BA669F7 [email protected]
1,666,291,803 *AF57F22FDCCF3A72D685D191E48299ECEEE6AD0A al_t;
1,666,291,804 *AF5236EF2BDC0442F73EA60A7CEBBBB6F8E966E1 amissitn8
1,666,291,805 *AF5FA981AD6A60508D65926D47C2F0876A748A63 live101,volume2
1,666,291,806 *AF56854C33F611A86C4CD8466DBC4839418EB4D1 6DEREPRESSIONS
1,666,291,807 *AF504966F94CD446CE8109FF21CE880F9F31D002 6HUMILATE
1,666,291,808 *AF5468FEC233D32898CD06F980899AF90237B6E2 L+N<
1,666,291,809 *AF5FDD23499FB187EAD051AA0860BAC902B23610 LOJACONING
1,666,291,810 *AF597C887387A4896271CFFC8E91DB6C218FCF25 LORENZOCOTNEY
1,666,291,811 *AF53EB7F62157B2C9A6F55AA7EB49F9B0302D8D7 6LADYBUGBRIGHT
1,666,291,812 *AF5022F79746E492D45D465066402A0E954FD9BC 6SQUARROSOPIN
1,666,291,813 *AF5E02BBB6EDE1917FE8A92079B851E8DE1F18C0 6TANGODOOBIE
1,666,291,814 *AF5C7F17A0AA936EEA7DAC5487D9ECE1B8754180 antonklees
1,666,291,815 *AF559013A609D4CAB98C3493EFDCC13D981A9A8F ANVASSER5
1,666,291,816 *AF59A516762C16D3510EA279D8AA69D1AC24ACFD LYNWOOD.RENNEY
1,666,291,817 *AF53F8348FB533E09553D6234335B1323773A1CA 7BGNGLRJ
1,666,291,818 *AF522C84B0DFF5DFFC52F3F8BA73181C96FB009B 7CAMAROQ
1,666,291,819 *AF5385DABBE1F1940FEF96ED8CDDE3DD00C5C023 7ILOVELUCAS2
1,666,291,820 *AF5ED461E3EE7163AC7E71E006B1186CC5DAEDAA 7scherzavi
1,666,291,821 *AF5C186912468BA4EB6EB8BD5FAE85E761ADA2C5 mamercy6
1,666,291,822 *AF5C813023A360B2A7A1D8A3D3548098DF8439AE MARCELINOROSKOWINSKI
1,666,291,823 *AF5538324E14B9722FFDF55DBF47D48ABDBDF91C ARETSETED0
1,666,291,824 *AF5D69054BBF8CD769E6938F2CAF292C18DFAEEE marcosbrower
1,666,291,825 *AF5D541973CDF7E3BEFF1A74419C574B006E4267 ARJHEIIM
1,666,291,826 *AF52D49F81AE94E9381F6E653C7A8ABD7804247C MARCPOU
1,666,291,827 *AF528CB6761EEB062F9CDA8A42F1AEFB754AC444 MARIO.EPPENGER
1,666,291,828 *AF59319A1E39302E636318A924FEC4F208AF45C6 marlinbrodhurst
1,666,291,829 *AF522788D585C1B0BCAB91659E0DDE10851CC4C9 marniejohnston
1,666,291,830 *AF55B8D262F59630FF78FD76DA7FE11170AB24FB 8NOBILITERAI
1,666,291,831 *AF59EDBB3E81F2D23BA710E597F6406F88C8C159 ASPIREIS1234
1,666,291,832 *AF5FB66F2C9E573AE49B9C4404EB122816008B49 matthew-aylett
1,666,291,833 *AF56C00E3D3AD50801C5FEE39862ED63EEBFC4F6 MATT.LAWLOR
1,666,291,834 *AF58212F32902ED1277E58E2504DB3CA2A956B54 8POLYTECHNICIANS
1,666,291,835 *AF58AA0982D4DCFF16C25897E6F1E496F712BE44 mauvesong
1,666,291,836 *AF5AE1BC2A98CF679682FE062345B16BADD3ABBE maxwell591
1,666,291,837 *AF50D0BA592C96F02F3A2A1FE61D368FE3F2F757 MCORMICK1
1,666,291,838 *AF5E953F907CBBF5F3F26E6AAE7DB0A94F63B147 medal6
1,666,291,839 *AF56B3B7FE480FA7D7B3BD01E871A1AE8C2D84D1 assemmostafa
1,666,291,840 *AF5F68B197452B29DEE59C1702CCEDC721412CAF MERCURY.POISE:.19881995
1,666,291,841 *AF524BD28F4BE582E32B2F04B918B2C14D30A658 merlemousel
1,666,291,842 *AF5A0512517BDB2C0E776C5D301DFF34939274A9 MERLEPINAULT
1,666,291,843 *AF58B6C456C36AEE492487E009E507A0094799A6 metro-de-toulouse
1,666,291,844 *AF507D84B36AB2F50103329D347EEA703BD0E583 metronidazole4
1,666,291,845 *AF5009C2FA2F995346A57D32ECC362A1C0318C72 MIB-is-a-superset-of-both-Ethernet-and-Token-Ring-MIBs</P>
1,666,291,846 *AF5CB7C895AAB4E86A4831DFDB7696EF3E9856B9 ATSATSUL3
1,666,291,847 *AF5534514EF9B2EFAC8C30602C654E18785F34EB ATTEENILING
1,666,291,848 *AF547D30D92840E65D9083E30506AD0E60847C11 atvoo
1,666,291,849 *AF59709576285E56CCAC4D4813557966DA52E18D AUEQS
1,666,291,850 *AF5A2FB2044B8FB05573998D95AFCBBD0D1E0797 milfordwissinger
1,666,291,851 *AF5FC0FF285457F0CDAE280723AB4755F2E6E066 millicent.little
1,666,291,852 *AF59C5FACA96947F3258ECA5225E4CCDC2DC68B4 MINDFULNE$$
1,666,291,853 *AF58DAA9E3000EDD5328CE2A89959F84D5959B6A AV0Y7
1,666,291,854 *AF520BC47A79CC05A742235B568DF9F9642C975E 9BSWGUNSTOREBSW
1,666,291,855 *AF5017B80B76D6ED89D5ED40BEBB71901ECFA1FE mnは太陽系形成直前の
1,666,291,856 *AF5DE2EBCC7CE829448F3EDFA733B2BDFBC9719A aza3e
1,666,291,857 *AF5A9E401E6EC7DFA354ADF79B27E51B030A94D5 AZELLLZ
1,666,291,858 *AF5FE4AD14734B6257E3855F7555551DD9E54670 MOHAMED.BOTHWELL
1,666,291,859 *AF51CA1DF0A86364E40F84CF9F738961DAD9E2C9 mohammedveneziano
1,666,291,860 *AF598AC3D155074A43884CB252B04DE5FD7E5497 9EWWWWWWWWWW
1,666,291,861 *AF5201F6ECE8E8C2F0144296CFBCD92503D1EAA5 mollylee0
1,666,291,862 *AF5BC5CCA952B00355AE6AC6E0B19680B607CE70 MOSHEGUTTMAN
1,666,291,863 *AF5FCD10D62DA9EC9B980381213F3E59EBE15296 motas14
1,666,291,864 *AF5AEEF7CFD7F6F63920BEB5DA0E95D4EB6080BE b6q(
1,666,291,865 *AF5A099BD7FAED051C0AB4FF5D32DA298A6123A1 MRSCSWKSHP
1,666,291,866 *AF5C7B1E0655B4E8D0C8B6EEFBB265EE813CCFEC msbenz
1,666,291,867 *AF5AD70B9F0EC4CE6528536B28DD735BA8CCABD2 murraydruck
1,666,291,868 *AF58FA8314115EE9B76B891197318373B9F64574 musha2
1,666,291,869 *AF547A75CF9F8CB017F0B95AA5FE002A60A98C8D BAKUV
1,666,291,870 *AF57548474CCA64ED67001613AF97CB1BC1B4078 A17s
1,666,291,871 *AF5B1D8EB68D13006EDC2D7F7A926E6477B3CF71 barbadillo-salamanca
1,666,291,872 *AF57B63CF96DE6C3CFDECC0E273EC527DAF07BA9 namjoomotlagh
1,666,291,873 *AF5106DB517FDB63DE5A4716E8794DFD4B9D6409 a4n(d
1,666,291,874 *AF5F627DBFC5649F7688E90C57C3B4709EC4FC00 NATHANGO6
1,666,291,875 *AF5E22A1D009236E4480641ADB63ECA2D6B5CFA0 a,8mc
1,666,291,876 *AF536BD071F24856FBC1E51895AB67CDA0989416 BB%4R
1,666,291,877 *AF588BD762302C70B0BF4C7378E5EF39F11F8509 NIALVEILLANCE
1,666,291,878 *AF539D6CB06DBAA9A600E11DCBFC02DF15ECF3F5 NICHOLAS-RAINVILLE
1,666,291,879 *AF5061EF716FFC5BCD7CDE84F6CA7EFB4263FDF5 BBH37
1,666,291,880 *AF556CBBA7B36A81ABB2C8F5F8BDCB89BEEE09E1 aaabzz
1,666,291,881 *AF5B8C222B88C9A8BDB08B14E3BBAC835BAD8C2F nidhi-kapuria
1,666,291,882 *AF598B0920EFE274C8000A5929D4A6213CEB7E0E NIGELSWART
1,666,291,883 *AF5456BBDBBA6C0B17257AFDD85DFC9F2E4A22E5 NIMATEMPLATEUSER
1,666,291,884 *AF583270BDCFE8D60BDBD84976D53A2DA17BB638 NINTENDOSKYLAB MIX
1,666,291,885 *AF5843A952E7FFE10F82049C0840DC74CD4D7854 bc.w9
1,666,291,886 *AF55777134C2274EAA4B796E7C1C742BA5A5EA13 BDNO!
1,666,291,887 *AF57C448EBCE6E2BAAA978787FBE92C29EE9B2C4 BEATAANTAL
1,666,291,888 *AF5965500262A486781EC732827CBF0C2AEB3587 ÄÄNINÄYTTELIJÖITÄ
1,666,291,889 *AF59EFFD3A242B2E71FBC3260F4B64756ED96D81 aa<ui
1,666,291,890 *AF51A659BC8F2508A23C3D3A3233C118E6F7C4AD normanrougeaux
1,666,291,891 *AF56F289E1CB415169B787D68C09ED6986A772D0 NOR.TASTE
1,666,291,892 *AF55C3322D02DE15003536989B47B73EB4EFAAD7 NTOMBIFUTHI.RADEBE
1,666,291,893 *AF5CB490BF143FFF611821A60379AA94BA676935 BELLWOOD
1,666,291,894 *AF5AD4E2C5CF4C06217E33428730F7CF732D4499 O168118
1,666,291,895 *AF529D897E664A0E513D749FA4D51C7F317B2EC9 BENMILED
1,666,291,896 *AF5C19303B81405B2DE8F679D6BD37CC13844DAA ABDUL.ELISON
1,666,291,897 *AF5DFA1C80096EB16FDAB9F68F1227A092CF3997 OLIPASSWORD
1,666,291,898 *AF58E943BF62E72569D154D22CDF9DB18548DEBA OLLIE.FLUECK
1,666,291,899 *AF55D7AD0540232309523D24D4F3F36F26C9140B omerleverson
1,666,291,900 *AF5753561D921EF205763C251DEEE689E81412F2 ONEGE10
1,666,291,901 *AF5B122D1FA6B05B7166266315253CA9AEB90150 ABS=N
1,666,291,902 *AF5DAAF6D2F16B0CD5BF8F62E0B75F9AACF6DBF1 ACAKI
1,666,291,903 *AF5632CEBB6EC1643922EE1CB40C57993DB151C5 ORHEDJ
1,666,291,904 *AF5AE36FE6CAA5CB9DFCC8EBE98C1512E0AA6DF4 BH1.&
1,666,291,905 *AF519978800C12DC5CE5B6ECB99ACD30F753E0BD BHWGS
1,666,291,906 *AF5DD0AF875F4262DFD8ADA46A5353B1C105487B bigk8
1,666,291,907 *AF564C2825575ED26F43D127522CCA0D711BBBC3 ADAPICAL8
1,666,291,908 *AF558C0038C7CB30F61FB384BA8A544BE9D64D9F p355m5tca11y
1,666,291,909 *AF53EC9A1103B87090F0EE64CCA6654B8DBB8820 adeuayoc
1,666,291,910 *AF5711D4B116FA7D78EA0C5293338528A016A54B [email protected]
1,666,291,911 *AF5757C7A3D40F4997A9533A45A7A2C3CB62A176 [email protected]
1,666,291,912 *AF5BE637CBD46133B346F60B34AF19D0CBDB16A1 ADOZN
1,666,291,913 *AF52E53808590BEE33B65A5B815D50032B7FA4C9 [email protected]
1,666,291,914 *AF524F294C9ACEF5F8BCDF9F8C5A0891950CC34F [email protected]
1,666,291,915 *AF556E1C36D93D72DCA679315C2D10C99DF4BCFF aeaniva87
1,666,291,916 *AF50FF398B01563D47D0294C5B4E29E8D026BC75 PARAMETER'[email protected]
1,666,291,917 *AF58A5C39B2FE8ADBB3E64121515F51D0D6E9B45 PARIS.BECKENDORF
1,666,291,918 *AF5D18D916E3E25467168211CE150FA2723139CB A:+FI
1,666,291,919 *AF50E8D7CBED48BFF4F2680F60E82762179BC191 Blame-It-On-The-Other-Ones
1,666,291,920 *AF56F0C06CAE6E7F3FA60AAFABA4219B676B0AA1 A-FWB
1,666,291,921 *AF571B6F080BD8636A71677D0C17BAFDA9DD6244 agmbd
1,666,291,922 *AF558DAAAAC5EFAE1E0A0FBBCFF818BCF1895361 [email protected]
1,666,291,923 *AF5BB58762EB57DC891E7E4E9EE689CA8256B02B blondewebster
1,666,291,924 *AF58A6F5F66ED52BE0C70C80E8C5746225049D63 BLUTERGUSS
1,666,291,925 *AF59D311D5FDBEA3818DCEC30A6332D8C1A941AB aircustomarycycledeclareddefluxiondelta
1,666,291,926 *AF5BB1ADB75E78BAA9E8E77F67403385A05DC650 boltinsky
1,666,291,927 *AF56E20B911CDD5DB197E9ABC48C8DB3372A300C BORIS.CUTLIFF
1,666,291,928 *AF5FB33293AFF5644624BD9877FB2E5E96BC73F1 borisisis
1,666,291,929 *AF543989882F4917CA2533FCC71E8DB3DAF39CB9 phil.lafrance
1,666,291,930 *AF5D16A20CED5C721CCF0393F4249B6FEF764533 ALISON LOW
1,666,291,931 *AF5B6F404E9189BEC8E0E21ED101D2F5793FB0DA ALLF
1,666,291,932 *AF5F61BB4D91F4BB7834EB5779E4FAEF8996B573  (pl
1,666,291,933 *AF5E355E8BAC4F51DA00FA608A959D3875889654 BRBH
1,666,291,934 *AF546558DD051D2A1492EA2AD16C70362F97B062 ALU
1,666,291,935 *AF50A311B406045F534A495F162F1D9B904B8D1B plymthted
1,666,291,936 *AF58B2D1B054DA580EBCCD9CA6F27AFA4AB5DFE3 AM7,
1,666,291,937 *AF5BC3077D23A5CC4B8D9ACAB924C8B941AA6FA8 AMAT1V3N3$$
1,666,291,938 *AF529515854F7FB54C2DBB98E535AEF671823A28 POLYTOMA1
1,666,291,939 *AF5A5834075A8995A64B10BAE1F8CC62B6B4E34A A+MQ$
1,666,291,940 *AF59F6FBB91276C5C818297A9D7A8BD25254769D AN8PK
1,666,291,941 *AF54AAA58D5D1732A88D9D3F80AA2CBE82ABDE83 bsglw
1,666,291,942 *AF5B2B4F5491ADFA152E336FE115328C62F66723 bstone
1,666,291,943 *AF54A5A7780B703DC7A25EA4C18CBCA2A51A78F5 ANDREA JACKSON BRYANT
1,666,291,944 *AF5E641D64259E0E1466D963C834F1BE116CF08A PROFESSORAAL
1,666,291,945 *AF5BE0E54E086DF0AD45A4D2CA0FBACE19CEEA1E [email protected]
1,666,291,946 *AF56BE054F294D36CF40AE552FD9095132783C93 BUZAR
1,666,291,947 *AF5C4B7720A260908BDE4B5FF42285ACEF1A1CD5 BY:p
1,666,291,948 *AF55F2E54B519B866882282F90796EE641A54398 ap(8b
1,666,291,949 *AF57361F7A60A4A6F598D5DC40F3764201B08767 PZVMRMPAING
1,666,291,950 *AF528EC1D861A0EFC069EDEED1CA83B2785DEAF7 c0lc-
1,666,291,951 *AF55B12550FF862959F5F685849B57BB75C26C8B [email protected]
1,666,291,952 *AF5F0FE3B68D8C7C0D7DE1715450CA68EB380B11 q------d`splat
1,666,291,953 *AF5D2D719EB8D2DB6839E5E753044AED93715823 c3kca
1,666,291,954 *AF5371A1C208C75237ACDA13E1E71D55FEFFAD04 c+4y
1,666,291,955 *AF5020DC32B3EBAC7A37FC671D5AD4AF8F78D1AE CALYCOSEMA
1,666,291,956 *AF56BAE5FC7F229D8E6AFE2D84B0282AED4FF074 />&quot;it
1,666,291,957 *AF56E209C17A41E84BB9BC5D885D2EFDC4E05AC0 CAMDENTON20
1,666,291,958 *AF5E80E32EFBDB24FAD9A9AE7E78192C2410F3C1 R01IGE$
1,666,291,959 *AF59DA4CCEB3AD0994610EF8579EFCCA768E22A7 CAÑOSAS
1,666,291,960 *AF5C626D71144E67EC7C0AEA02D0B7DA31BBF5C4 arthurleeinterviewloveorigins
1,666,291,961 *AF538275CC4FABAF2FF6C99A1D02F24F535B263E CAROLSLOMAN
1,666,291,962 *AF5ADD163F10D9E3335255B6F392DA0491B9CAA3 CARPENTRY.&.ROOFING
1,666,291,963 *AF5077479DCBDA3B5E1DF919816CD3B09A0A87D7 a(s=0
1,666,291,964 *AF57A42C8771B84AEFBE8FFE02D8D4C121AA17F1 CATICOM0
1,666,291,965 *AF56E55C4FF4D6E9D0FF5F34F93EB81A7BABEFB4 CBTU
1,666,291,966 *AF5BA1EF4D5DEDF9AB407BAB88E035057D0F40E2 AT|!
1,666,291,967 *AF544DE121181F9927DAB258444C70CC2A954642 RAYMONDFEEHERY
1,666,291,968 *AF5E858945FE25BDF47E9347542F6A0E470112F4 raymonlanzetta
1,666,291,969 *AF5E023C62C6F4FDE158C97C22086D19C23D6F6E ccw_2
1,666,291,970 *AF56F1F3A498DFDAE659AA036C9890496C99687B redpurple
1,666,291,971 *AF5116776C389F2AD1899914BD0628C016A14F33 regionalkicker
1,666,291,972 *AF5C648F305D8856586DB06C804097A21646F4B9 [email protected],
1,666,291,973 *AF5EE7FBD220F5C501F089C661BAFF4ECDF23354 chadwicksoulek
1,666,291,974 *AF5F0FB41AB3B34A2BB710E2BC5C0F912CC11421 CHANAT123
1,666,291,975 *AF57F671C1C86450C8A7B026CF26C8E982F11299 (RELIABLE
1,666,291,976 *AF50C1027AB251EB062108D21A4C8F9D747C82CF RENEE-WHITELEY
1,666,291,977 *AF571F254DCC8251DF8C3E0427AD5E9C504157BA aw-rk
1,666,291,978 *AF509AB0C52E6C1111B4DF0A3699613F4AC9F431 CHAUNCEYMENSINGER
1,666,291,979 *AF59E6E828082C4A48A920E05D75B13269B99E25 CHAZ980
1,666,291,980 *AF5B3D36C370E8543DC8339699CA883D5C404F56 >B0~QP
1,666,291,981 *AF5EF80E04675A25A6ADEE7408813E38EC601FF9 RICKEY.WEGLEY
1,666,291,982 *AF5075BD5D0C6699267CFFD93462588A3588B6E0 b5gt$
1,666,291,983 *AF53D03CFE45E00F8EE93F51DAF1652420DA9B2B [email protected]
1,666,291,984 *AF511C0EF16E1727FEB6DE777AE13ECFCF6E02CE b7;o
1,666,291,985 *AF510174F36C30ECF2BA2545A381A46911D65EA5 rk6h
1,666,291,986 *AF529DE9ADD834F9772837F76EFEDCBEAF443463 rmdbamkp45
1,666,291,987 *AF58C468B5619C16DEA328F01CDF719380496409 ROBBIE.HANFORD
1,666,291,988 *AF5A77953F72CBDF9265FA1E78282D27C40CA372 Chris-Baio
1,666,291,989 *AF5D61CD92E1CFFAE92E7E09CF93C9AB5DE7DC4B BABYCOMEBACK(COMEBACKTOHOUSEMIX)
1,666,291,990 *AF552DFE06BA803346E6D0D96D6480A8F8A679DA CHRISTIANORAM
1,666,291,991 *AF57BDB01723CE4B4C40D4115886137E9D07E4E3 robpeightal
1,666,291,992 *AF57DC1F25AC849AA180517D3CA83FCE76C78C88 ROCNARNU2
1,666,291,993 *AF57986B77A46B26E555350331520CFCD02C7F46 RODERICKSURGOINE
1,666,291,994 *AF5C83EEF60BB9704EC56B7FEC11A2CB6F13561E [email protected]
1,666,291,995 *AF58D8A0C5A41D211AC14273191E0E2D45210E26 RODZAKE
1,666,291,996 *AF513AA4D8B56E9878231CF54272409089F56D3E BAUMARKTMÖBEL
1,666,291,997 *AF568F08A1AE33E38777BEC3956F1D0CE4A46DEF baumnusskerne
1,666,291,998 *AF55073CD7B5C0AA2FED723842721695C6335794 CK9VT
1,666,291,999 *AF51E552F95D23C1C3D77699B9143439A71FDACF CLAUDIUSHAUS
1,666,292,000 *AF58D7141EE828A89C767FEBE5A2D5975B85206E ROYAL.FARAHKHAN
1,666,292,001 *AF5337EDE0254D124F4A265F3DF81499E232FC67 CLEMENTEPOISSANT
1,666,292,002 *AF55123737C166F3CBEB88BE283B2871E7045D7C rplmrpsi
1,666,292,003 *AF5A72CCB2F8CED717CFC60163807ACA7177BC38 BEARSBASKETBALL
1,666,292,004 *AF54CD7DA168194B43C025E00294B515FCD5D44F CL&OP
1,666,292,005 *AF58008F7C6A319A2017D895DD2883DF62417EB1 BEGINEEP
1,666,292,006 *AF540336EC1E13488F0A4C7A318A74C2FDDC84C6 RUFINARUFINA
1,666,292,007 *AF55780A81A1F08503040BF741A17DD9417CB9EC [email protected]
1,666,292,008 *AF5E109DD1D4014836631B90168D2C0045586092 CNTNRZSING
1,666,292,009 *AF540B9EE70C98B7FB667D6CC12D7DF5B1292C33 s4lnmw
1,666,292,010 *AF5C053E25B46107B5D847B28E14ABD43267A4B8 SAILORDILBERT2
1,666,292,011 *AF5E9FE2804D01C1C59A89F46DFC244132C31486 SAKARISKERA
1,666,292,012 *AF5CFC1A3DBCC3350C46A5B52E4E78502DBF92E0 benjamin-donohue
1,666,292,013 *AF55CC6789BE57568E5BF041F6030E96BB8DAF0A saminiemelainen
1,666,292,014 *AF554F79C404A032CC21EFF8F12BD2CBD39DA17B BENNY.HOPEWELL
1,666,292,015 *AF56690AC7CE96408D17107AC70A582C7907620E sampl3.vi
1,666,292,016 *AF5CB0C205F67CE9295B66586A1045FCD73EAE71 COLLUDING2
1,666,292,017 *AF54536F30E5BCF1535D9713DD889C76835C9D36 [email protected]$
1,666,292,018 *AF57E9D561612D9C51623CEE73EF9D8F3150EF12 [email protected]
1,666,292,019 *AF580BDB83346614F29A35F0EA10798C6656B79C SAUDAGARSUNNYS
1,666,292,020 *AF5C9DF34A9E7AEB40B2F73117E6E2D555921BF0 saulpachelo
1,666,292,021 *AF5A0F5B2E64386DDC716FD27981FDBD1F10D0ED CORDELL.LAPLAUNT
1,666,292,022 *AF58E6F290D049423FF069F6546FD76CE6657A98 cornellberkovich
1,666,292,023 *AF540E888837E3E65F5336BD2AED8D626FD8124C scaupsscaups
1,666,292,024 *AF5D6D41C9A2B20BF34DD5F6E9F08B776C1D1ABC COUCHGAR5
1,666,292,025 *AF515D6597D2A311BD93BB147C8F14EC96C695B5 SCHOTTERRECYCLINGANLAGE
1,666,292,026 *AF538786270867F171CEA838CBE0E496E83A3B25 CPAKETE2
1,666,292,027 *AF588398D84EA74DC1955C53BF7A15760B8C2139 SCORT
1,666,292,028 *AF5B531B727C0344DA5B751EB30DE10665699C65 [email protected]
1,666,292,029 *AF53780B22E0875DB15821915E21887D2F9AB43E billy-ocean
1,666,292,030 *AF5B24D2A554CD6C27D9B7EEDFB34681C82227E3 SELLABLE
1,666,292,031 *AF51467BFB0605F4337D8BF1D507E4263695E0BA blastaway-gummiship-
1,666,292,032 *AF5B5D729373429E60C80BD48B4D5D735AE6FBB7 SEZINAIRATOR
1,666,292,033 *AF57048BD12D64BE3B513BA1A866D72D8F570CA4 CT6D
1,666,292,034 *AF5C30D71D90775B5276E5712B43215FCCEAB385 b--->*-*o->-<
1,666,292,035 *AF5AB3253C1911BD1A68C4F2704458AC26A6C791 B$+"O
1,666,292,036 *AF5FDEC44D4F7BC301E67CF0D68FEF073260B266 shibeegobi
1,666,292,037 *AF51F8381891AF038107488EE4DB2586BC345846 CUTLOW787
1,666,292,038 *AF5B61A7BD07A9D531ED220B7B976C9974B12821 cynthia-renee-mccoy
1,666,292,039 *AF53F312EC075B82A911B5A6D989CF2FE99B58D6 BOSQUETESING
1,666,292,040 *AF58AB149278D9F2BF30475F7B00D130927B8E18 bostonskeho
1,666,292,041 *AF525183999C1C290373D52734826FE384B8C683 CYRILLOUISSANT
1,666,292,042 *AF51AD6681959C569DFAA27A8F668278F2BB464F SIENNA2000
1,666,292,043 *AF57F6D4FBEE52FC4248B9C19A610892D2CDDD9A bp,
1,666,292,044 *AF5FD656CB233202BC05D2AC6442CE7EADC351AA SIGILLATION
1,666,292,045 *AF5B1BE0E286B2628829622B1885848DE186418C SIRUELASES0
1,666,292,046 *AF554E8281F26E1340206F38A884FE4900E5070D d0)-s
1,666,292,047 *AF55C663F9DC48CA6E76E0338E01980411AD59F0 skgpass6
1,666,292,048 *AF5DE23368E1E59F87DBA40841936D6B5C481777 skrebrttet
1,666,292,049 *AF52D801E1C5EB0271309A34B9380A8B78C6C528 d4q&s
1,666,292,050 *AF5637E052537BDCEA4E91CBC5CAAA60E86ACB23 SMILEYBOYSTEAUA123
1,666,292,051 *AF57AD0095A6CAE63A77226AB5186862F67DA958 daatsgarb
1,666,292,052 *AF5356E499FC72CE5E3A34FC2BEB34996A719150 SNAMSHTAED
1,666,292,053 *AF540AF3A83C2FEDA9115E911EF67831D14E2848 [email protected]
1,666,292,054 *AF5B23D49BCCFA6547141A8772CA814D9AF29584 DAKOTA MAYNARD
1,666,292,055 *AF5BA179CF0BE73521A1CA75C895538126B77CA0 SOIGABKED
1,666,292,056 *AF542350C2BE443215F32AF7C1768E1E52B2F900 BSGONDHOG
1,666,292,057 *AF565132D024EEF36DA8379D11AE180CF020825B DANCETOTHEMUSIC(FEATONE)
1,666,292,058 *AF599545129483A8B2CF95CD901054061B2A8F00 B%T8T
1,666,292,059 *AF5F0901A17AD6D2BC070597AD9C944941DD02F4 SONRONDELL
1,666,292,060 *AF59E78E996FD7CAC477D7BEFC9F704D8F420405 BUDDABROT
1,666,292,061 *AF51D06F56AE44985F6BCE79064546738AB50400 BUILZE4KH
1,666,292,062 *AF58F319E06EED2FD80A0361D7C235A0B5FBA516 BUMBLER
1,666,292,063 *AF5D70723C0838FC0681F6D719B92C625F14D3B9 buonanotteaiviaggiatori
1,666,292,064 *AF54DABDE375327598A865C89456B1DA4A987691 soyvaga
1,666,292,065 *AF52CC2DF11FE8C4518B0C4E5C525844310CD88C b#xuk
1,666,292,066 *AF5858E8F231657510187D1BC204966E38C4FF87 SSTROOPSED
1,666,292,067 *AF54DCB6D479937F1E5B54273CE7AB26D5B18D06 STAATSBAAN
1,666,292,068 *AF59A51A025FAACDF135FE353067035F2C25895A CALVIN.ARILDSEN
1,666,292,069 *AF5931CA5B3E5A8381DA1E15CF349D8D1CB4EC8C CAMCOAUDIO
1,666,292,070 *AF584D8A4C59C6F9B138E7008806053332260294 DELAINEY1234
1,666,292,071 *AF50E7C6011ADACA8C8CCDDE649A9FF6806887EE DELBERTDOTSTRY
1,666,292,072 *AF5F170A22F9A5BFF0EF5E7FC9549D48C83F9E16 [email protected]
1,666,292,073 *AF5FB165CFD542600EA259CCFDF100A3C3E7B9CC deltalaga
1,666,292,074 *AF517D979E5E71DEFCE07F5CBFE96E6AD37ECB55 DEMONIED
1,666,292,075 *AF553BC93F0BDA4ECA76760EAA586253DD7D7D88 [email protected]
1,666,292,076 *AF50230C89ADD620AE2522B6F9563C3263D572DD CAREYNIENHUIS
1,666,292,077 *AF558F3CB3DD9454C174A00B76C22B7B44F9BC24 stoneattack
1,666,292,078 *AF58C7415B63B62F89548776F09E56F47D4B8704 CARMENCANDERS
1,666,292,079 *AF5A766C067AD4CDC45D87BDB3716545CFAC04D3 carolina1983
1,666,292,080 *AF5D1AA7B35E6E475609DC72C176FFD9236AD4A9 DESENCANDEANDO
1,666,292,081 *AF575A4FA5833970C1B53B9E5F2AAD3EC4FFF33E [email protected]
1,666,292,082 *AF526DE51DCD3A3F2BCC24EB3A949A1F4FD92086 subequivalves
1,666,292,083 *AF542330605165CA714E16E1905C36066F4C3B43 CCDJ
1,666,292,084 *AF5604AA17CDEBE95F604DC082B7CE618D5738DF dfh$g
1,666,292,085 *AF5B833E10BBE36785321E4F86AA8ED3EF0B9934 CEDRICK.RAWLINGS
1,666,292,086 *AF545427FAD1A7AF5AA88230789AC7335B94D518 Dg8k
1,666,292,087 *AF587F87FD9B06C3E7EECB69F5DF70623FC82D15 dggwfglghbw
1,666,292,088 *AF5E27E6577DBB3825DC83FE1190A927E5FBCFED c!fg
1,666,292,089 *AF5CF77407073BDB76C06EB18B536F027F6CDF41 CFRCZ
1,666,292,090 *AF5646B8A207C72CDCA241B920AEBCE689D44821 diosdios
1,666,292,091 *AF50AE99FF5E3CB9329A3AFBFCB36716139C52BA diovm
1,666,292,092 *AF569B5361C6924497AD776A0C1E49C3F02E0608 DISTIGUER
1,666,292,093 *AF515B60EF6EFB1A9F58CC556B70DA3776F5EEC6 [email protected]
1,666,292,094 *AF5CA687B14CBC8C36D73E35E6131333AE73AF00 chfqx
1,666,292,095 *AF5ED1EA380765DC3C8D0B73A5FF5FD28B4740A8 cho1rmas+ers
1,666,292,096 *AF58F2A0788E9042229BE9BDFCAADBF8FE8391DD dmelkeb
1,666,292,097 *AF55F9DBADF12C8BD1B5BD6A4E47974104535CC4 tapurien
1,666,292,098 *AF566C844E232CC8BF2663EFD08D7B046A621D55 DONGSABIN
1,666,292,099 *AF540135385DCB1F0A41E6ABF6D30D851F272B23 donnellkunkle
1,666,292,100 *AF57AC017FA0BCE6FECD79D1D9B404E4B3534552 CIVILSZEMLE
1,666,292,101 *AF50B8C8A35D81802B83D1266DDD3A4A252DEF05 CIZINCUM0
1,666,292,102 *AF5A51AB9D46FDF2E425B334B7E4C0CDA659B420 DOROTHEA-VAN-ZYL
1,666,292,103 *AF5674BE4C1E839A5E370AD6E0B5B6EAA048AAB3 ck1+_
1,666,292,104 *AF53441EDC06F6F9E8E04756B4C9446D06E718FE c)k?f
1,666,292,105 *AF57B0078D1A1B1934C0075B1CE4271B4B8BF9C1 TERRENCE.DITTBRENNER
1,666,292,106 *AF55F910AED593907438CDACB4A2077FF36052BC dpf!
1,666,292,107 *AF5A1AF2719D9CF3B55CB3FE81253DEBC619A285 DpLM
1,666,292,108 *AF5D37BA3777111BE53B9662E6560EE5231AAC79 cmt7g
1,666,292,109 *AF577845D6F4CC553808B1E9DFC4BBBE73317EAC the new art of breathing
1,666,292,110 *AF5FCBD5F6A6A0ADA9E73DB514E107032FFBF0AF COLLOCATIONS8
1,666,292,111 *AF5424A84AED60A59DBD0A557C1DDA417679B31B [email protected]
1,666,292,112 *AF50D10DCE9F304ED35981ABE9CDEDFE1E94FD7D coolstepper
1,666,292,113 *AF52B0576B937C31BB7768FD5E4D495771AFA7C2 tidskriftsamling5
1,666,292,114 *AF5CD7739008B188E337A901071A8F1622A95115 TILOUHY
1,666,292,115 *AF5B50BE9A5604E9482EF90C55D542BF91662CDE cougarscougars
1,666,292,116 *AF59CB7277AEAECE7091EB19C2E8CEB2835E9478 dzacafylew4egd32
1,666,292,117 *AF502EADFFC7F7D1842FAD6741AFC06FE87D61DB TITULARISERAIENT1
1,666,292,118 *AF521C0A010448C10BA534CCCBE9512D39EB6C50 easylover(radioedit)
1,666,292,119 *AF595B8B9CF53C6E2980076A4B03AA8FF966D6BD ebjuy
1,666,292,120 *AF5F916CFF28F1B4B131544A6DBFD30F1BEE237E c:\program-files\common-files\adobe\ssc\premiereprosuite-cs4-win-gm\adobeconfig.xml
1,666,292,121 *AF59B967878E6257759D0773443EEC436074E03B c+ptb
1,666,292,122 *AF5E1E7F189E98EAABF89396C1EDA45727AFB267 tneulid8
1,666,292,123 *AF5FE06E158B502C16CF52338B12E9173FC7E34C cqaohgu
1,666,292,124 *AF53934E7A931D9BE95952E3A97C2CF145C4CB56 CRAMARRR123
1,666,292,125 *AF5FB7386B7A6A237A559AD632B29707DFB1917E (CRAWLX).LATA
1,666,292,126 *AF5D398867F5BB900809968476F552BC7652EFC3 CRL=L
1,666,292,127 *AF5DDE69069102337ED1F05601BECFFB5DABFD33 TOMMYWEITZ
1,666,292,128 *AF577E7ABD11AEBB6480F98F002F4A7A14019002 EDMOND.FURRY
1,666,292,129 *AF55E7E2D98E1DD06AF1CC2CBBC4E6C9740900BE EDWARDOKACHMARSKY
1,666,292,130 *AF59D59EA07DBA964E03A7E1DD2D80331A500686 CSK3
1,666,292,131 *AF597EC1AE09FD105081B38D7B7A097554B89113 cuf#b
1,666,292,132 *AF5712C61BDD4E1061756CE9820125E8876A615F CUN=D
1,666,292,133 *AF5F1FA24883009CA822984D97CC5AC3E781E6F0 CURTIS823
1,666,292,134 *AF5081D7EBEDBDE1A9039BE8658BB573D4770723 CURTIS.THISTLE
1,666,292,135 *AF5E4A7C6F304DFC1C1FED5AE61A92A8A20D5872 c+)uv
1,666,292,136 *AF5C0810A1C3A5B9C1D1D5DA2351638C3D5F9E3A TRAVISCATAQUET
1,666,292,137 *AF5D8C11E5B1F6930C5934BF95BCE1C16024E3E3 C型も就役している。製作は三菱電機。
1,666,292,138 *AF58993D80256D120306C5E050AEDAB1687BF391 d3qf
1,666,292,139 *AF5397C4BBBBB9D6C0200C01E9D6EEA999BCCC8B eku4u2
1,666,292,140 *AF58FE5EDDF8E8C30451546DA0CCE57D12D98BF8 ELAWARJW
1,666,292,141 *AF50A7D80B91FE29BE598FEB707C8E7EF7F6F0DE ÉLESLÖVÉSZETI
1,666,292,142 *AF531F54BA9560DDD551DB2D127A72D0EB6F00EC [email protected]
1,666,292,143 *AF5B702892ADED160667BF693368EFAA02312224 elleborg5
1,666,292,144 *AF55BB3999C2A3804B03A0C8F4C95E978F1D6E94 TRYING19
1,666,292,145 *AF5E607E522A3885B603C2CB0158BBB4E37D178F EME3T
1,666,292,146 *AF5EF0F0EEE3D6BF334A2CB1254283E80D23E361 TUTWEILER9
1,666,292,147 *AF5538A00CB742A055E3AA4F449512CF2C416E97 EN129217033
1,666,292,148 *AF52706D159BC81CA7AC910249AD889F82EF3698 da&r3
1,666,292,149 *AF51DE3FE60D93CB19E1DCFEDEAEFAD68172B2A5 DARKFALLONLINECOM
1,666,292,150 *AF5F4265128F100486F4C861CE2FE5C640FFDE4C ENIMAGEENHANCED
1,666,292,151 *AF515EA590CC7C742E0B131761044C51A185B1C5 ENLARGE
1,666,292,152 *AF5E605FF62E874795C6D4E1C744FCED6CFF72EC DARRIN.OSORNIO
1,666,292,153 *AF5E9C2F88BB7BF9265D7A73F730175758B4611B DARRON.CRAVALHO
1,666,292,154 *AF500BE0552F033EA88C941ACBBEC48DF02565F3 [email protected]
1,666,292,155 *AF57DAFCBC00C64B6763E2EA0F1F7D1A0B5A1DD6 darryllautman
1,666,292,156 *AF5F0E076E7014603ED7E11C522FAF926AB6FBC0 darylgripp
1,666,292,157 *AF5CB01AAEAA0D5F79674F897B8F4B18DE10B3DA UBOEN.SRUBUN
1,666,292,158 *AF5288F7B36B5FCF6224E62E4ED2CEEE91017FBB UERSATILE
1,666,292,159 *AF5B4E753327556D411C132C607959C21A63D45D [email protected]
1,666,292,160 *AF531948719ADAB3BA3DCA013850EE363EC23219 UITGESCHEIDENES8
1,666,292,161 *AF5F39E09A35D7E6C025E6D1765611618953AD48 DAVECAMPORA
1,666,292,162 *AF55D13EBBF948EBA26566F6B8F501C1274D3108 DAVID.HAMBERG
1,666,292,163 *AF5B82D56650FCDA64834DED92D4D8E461DCF2C7 dawnbitches
1,666,292,164 *AF52977A09D92A01200B1F7F67B421D25DF0AB42 d&!be
1,666,292,165 *AF52B38DB851020439FAD001E470EEA4347610BD D%C#K
1,666,292,166 *AF5CA5AC4D93C8E81D9696C38321295B58952DCD ERICAROCHON
1,666,292,167 *AF58940F1206103C1DEF934910EBF80924ADF8D4 ERIC.GUTOSKI
1,666,292,168 *AF5C9EAA8AC77159FD6E713168AC34708F83C284 erichdenenberg
1,666,292,169 *AF59C745591FECE796960A5BB23CCEDA5F7EA05F erickorman
1,666,292,170 *AF5A2ECB8C01732CC38E30380EC2642492E6C802 eriz_
1,666,292,171 *AF5C1421E574B99C7AFA3281A8448789A8B8EDBC DEATHINLIFE
1,666,292,172 *AF564B92BF67F3B1F7CC07771C4FB399CFEF8789 debraivie
1,666,292,173 *AF552C89781D918195370892CB59D4B757D59732 ERROLUHLIG
1,666,292,174 *AF51ABAA3E6877C74332FFA23B7631256C94BBB0 ERUNBSW0
1,666,292,175 *AF5F519D09DF6177D43801B08F1767256339DB8F ESPUMEROSING
1,666,292,176 *AF52EC387221C0F6B1D969F52AD056B9CF190AF9 ESQUI.ACROBATICO.EN.LOS.JUEGOS.OLIMPICOS.DE.TUR
1,666,292,177 *AF55ADA2B5CE11B295BD63314206544250727AFF vejsonín
1,666,292,178 *AF5BC3C7A31073464DF6E108D68E10517E45E405 VERBIETEN-IST-VERBOTEN
1,666,292,179 *AF5845389532212910563D8AA7C0158C95FF3846 vicentedavy
1,666,292,180 *AF52CD604039DBD1FECDFF5B0FA04F5EA988343B VICKIE.LARA
1,666,292,181 *AF5CFD8C64671278D8DC2E9B35F1089005F898FC ETNASIEK2
1,666,292,182 *AF56DD5ADB53CD1D3B64C3A95D82B0E66B68FA77 VICTORMANUELCASTROVILLATORO
1,666,292,183 *AF5369E22BE99EBFDE9ADF61645464F64846C382 víðistaðarskóla
1,666,292,184 *AF526EBD05A3B43A1E76DB11698C5AB9B556346E VIJAYA.PANDJI
1,666,292,185 *AF5A16005589FA8703A0EC7E23522CDAB43D1BDB DENNIS.CORDNER
1,666,292,186 *AF52FEBA8377C2A126068E6932041FADDB3BF301 villov
1,666,292,187 *AF5EC2CBAF4F6D7F4D1F6EB42028F38E0F4D173D VINCENZO.BOYLAND
1,666,292,188 *AF5770529B0BA67C9104CC94E34BA2B662BDDAC8 [email protected]
1,666,292,189 *AF522719D424D6EAAA53A545A55B54BAA9199A3F DER.ABEND.(TENOR).-.RECITATIVE:.DER.WALD.STEHT.DUNKELGR
1,666,292,190 *AF567A026D289E20C5DAB3EE5B53D598E315022D EXPEKTASI
1,666,292,191 *AF587F5995FA3A8C7864E4C46B556BE70F9E32FD [email protected]
1,666,292,192 *AF55C993C78A0A984B43BCC1B14A4D9868397235 VIRGEN-DE-LAS-VI
1,666,292,193 *AF582E9BBDB9E9D47F8C78CA5C4914FDDCC10BB5 viriez9
1,666,292,194 *AF57956B12E235E089A059EC0059CA759DD45CCB VL,\
1,666,292,195 *AF5019D335646DA15847A7E6205E35E0B6E12E97 EZRASISCA
1,666,292,196 *AF5FDBAAAF3CDAA23191C32D4C29D5B9E8AA83D2 VOODOODEMO2
1,666,292,197 *AF5B39DFCC7B96551248DD3288957E578221EF98 VOORBIDDER?
1,666,292,198 *AF5E4992FEBCDF543D1415F9F4796FB421DDF99F VRI280
1,666,292,199 *AF5E01214E9776FEF93CDF8409D6C5EE12327C86 VUKANI.VUVU
1,666,292,200 *AF50E85EA44545EA29CD57773389DD3399AB2B74 [email protected]
1,666,292,201 *AF58711ABF38B2E3C7A40B9104108F70EFDE00FE VYPLYVAT9
1,666,292,202 *AF5F5141ABA594321923EB4EF8265045FDB7D059 wanda-michelle-pickett
1,666,292,203 *AF520F3D5B4E3BD39EB5AC4376E4810330900F69 wang.okram
1,666,292,204 *AF5C7A72ADA505077E4F5477AC93E9494153BF34 [email protected]
1,666,292,205 *AF58B1D92C128607285D69A6976AC66A0617A8D9 [email protected]
1,666,292,206 *AF5E72AA2CAB9E8FF1E8CC9F3077971E9784D3D3 FAUSTINOBOESHORE
1,666,292,207 *AF5305D4091CD86FF8FFA69DEE353F90B9F4154C fc2)
1,666,292,208 *AF550D7C54661293478BC48CCDB75E111FFD04D6 WAXING-CRESCENT
1,666,292,209 *AF5FF0CB39A2D6A837E35F7E5860C500F8B461C2 [email protected]
1,666,292,210 *AF55C1B732397CCF7216726B60A5CCD5E48AEE7E [email protected]
1,666,292,211 *AF5CB8DBCC6F3DF13A3A3C04D93A1F3145008A10 [email protected]
1,666,292,212 *AF561FD62418CDC3FA56C4322451529E7117609D DIEGOMAYZES
1,666,292,213 *AF53286CBF6C68C8FFB808C2C9B78F083C1157FB di/f
1,666,292,214 *AF514765D635B262011F0075F5E7F52E9B30076E [email protected]
1,666,292,215 *AF5FEC8222977BCBECA40E151BD3690CF61CF238 WESTONGRIVETTI
1,666,292,216 *AF54C7A599F1DDF2E514E3ABED7C85DFCAFAB84A whitney.kiehn
1,666,292,217 *AF5ACA54D2ECB54F7A8972844C6CBE552CED9D8D DIFFICULT.TO.TELL.A.GIRL'S.HANDWRITING.FROM.A.GUY'S.
1,666,292,218 *AF5136AD23C45DECEF415F1A4BE748FEFBEBE4B7 WILGUINSE
1,666,292,219 *AF5494DC4A224851ADB589C29DA7A3261630B8CF Dik.Trom.(Kasper.remix)
1,666,292,220 *AF5FE13971169E8221B1DFCFB1B207CB02B8DAAC FELIX.OLLISON
1,666,292,221 *AF5BC66BFF0BBCF2714BC4C48F487D4205D7A052 dimeneworleanspreview
1,666,292,222 *AF5D4FD78AC72FD8A16D806701BAA67D21CB7F26 WILLIAMTENEN
1,666,292,223 *AF51AB197CC3EC4A5CC292039FBD340DDD6A5F56 FERLYNG0
1,666,292,224 *AF52114C83900BEEAFB23530E8029E27E363FB2E [email protected]
1,666,292,225 *AF5929FF597804D98DAC8B9AC43F3CC83D2DAA79 wiltonmaenaga
1,666,292,226 *AF5C82F43B149CA13A5296CAA44F4CFFFCD07EA0 disacryl4
1,666,292,227 *AF50F404FCA1A7D96D21F798194B0969C9103958 fhcpbhol26
1,666,292,228 *AF5DC00E72732E882EC7CF0095258049BE677EB9 WISDOM-&-FRUSTRATION
1,666,292,229 *AF5B533C838460140FE694EAE399FCD04A834A82 [email protected]
1,666,292,230 *AF5A1825F583471B155C69B02E70E2D51E7256E3 dkcbb
1,666,292,231 *AF57E621804FD909676C67D4E517ABA05B72769D flcclltn4
1,666,292,232 *AF5152EB9BE1EECEEABE72BB02BE8A63EF171BC9 WVIFBB
1,666,292,233 *AF54CA874CF1D9D8A71AB8FE21F9278BDE0F2705 wwwdialoguecom
1,666,292,234 *AF5AD4B2B9771A0A2FCDDC1BE5391800AAD859B0 follow the cloud
1,666,292,235 *AF5DC7D0C911198CC1835CAADEFDD8F0BF5FD3D4 dnboi
1,666,292,236 *AF5AF8FA7494B6876551DD72B1CD09401BB01EF6 [email protected]$$
1,666,292,237 *AF5296B954F06BE9BB4167591B6D9712D556BD7F dolientehenson
1,666,292,238 *AF50F86BAFB9D73E57D9976543F048DB68F73B48 domingokinkead
1,666,292,239 *AF5FDCD0A0087414CB2E99223E7737C4DC1D5F08 dominickzenon
1,666,292,240 *AF5BE2B7F202459FF9E29E70F68385C315F31857 DOMINIC STAVROS
1,666,292,241 *AF57C923900D5F930C7BFC2D874A5BC612786764 DOMINICYTUARTE
1,666,292,242 *AF55F5B498B87034B6C5119B4DD3694A7E8263D6 fr5kne55
1,666,292,243 *AF5B175DD9B378BB30D9A55CBE7CC6AC04EC6195 frank-a-russo
1,666,292,244 *AF5393CE0E6D43020FD8DA9E34DAD88D81FDF209 franklin168
1,666,292,245 *AF5F418F41FCAEA4968162E1A36F572C5D8F5B25 FredEverything
1,666,292,246 *AF5F764D853D44EA87D69B4EDE7596D733FAB7E6 }X{~` ~` Q####P
1,666,292,247 *AF512F1280EE01DF06123EB1DCC69E9911F93018 xtragod
1,666,292,248 *AF52BCF7813E1A532CED47C3D55AB5D4F24EAFCD [email protected]
1,666,292,249 *AF5F22EEB02D59A63BF64096BFC4B0020F4344F1 douglassbivings
1,666,292,250 *AF588C055A6F64C339C81A4DB18AC3DAF959EB27 [email protected]
1,666,292,251 *AF5C6FE1C37A838680D142E58C097A2AE4EFA0FA XYZW51
1,666,292,252 *AF5ED2C49164F933FB01331971B1DD92F1C6E5E7 dp%_o
1,666,292,253 *AF5161352BB6A8853246F36E0AF246E6B27F4373 ybong.lapasaran
1,666,292,254 *AF57A269BBE17230F3562536FA8AF66D7CE71260 G124115
1,666,292,255 *AF571D788CCA02D4CCF4A88C57BE8263CDBC14C9 YELBMUHC1
1,666,292,256 *AF535DEC7B6FF871DC0721AA9468029A5252314E YESIESTIS
1,666,292,257 *AF560E9029B4069629F20491839258D9140D1714 ds4sz
1,666,292,258 *AF5FA0D6270DE1AFA942E2B4F14CC9A64485E286 DUDEGRAIED
1,666,292,259 *AF54C4C78AC5EB58AEFC298237AE21B06454C6DF [email protected]
1,666,292,260 *AF55F3A131C5340149B079544C56444E8986770A yulikaryatiningsih
1,666,292,261 *AF59E29E41C7B3998A5762FB2628FF41D3E1BA0C DUTUW
1,666,292,262 *AF5CA048CE5B11659A9928DD280544D126D94AC7 ZAINUDDIN-NALWALA
1,666,292,263 *AF58BAC24A15D6BC9D9DA4B3319CC3FF63AA3701 dy#(1
1,666,292,264 *AF526FE94269D14D36B753DD4DD910B5699CCB92 [email protected]
1,666,292,265 *AF5BA66292511F8EADD2D553585ACB858BBBCCC9 D(YEW
1,666,292,266 *AF5409A9EF90DAD7119AAB46F0C79CAA6053E2BF GILLESSQUIRT
1,666,292,267 *AF564D910C59437F06AAAAE87174335D6DEE2E39 E80591
1,666,292,268 *AF519FECE02D6D16EB47E3317E701CB19FD163B4 EARNESTLATAQUIN
1,666,292,269 *AF5631AFAB3AB850777DD8D31218DA0E29F14B36 [email protected]
1,666,292,270 *AF59FB7F0357753DEE32CA967F47D5F25A67F3E1 ectromelus!
1,666,292,271 *AF5FC1750C8BEE345037D867B18B95426DB5B366 [email protected]
1,666,292,272 *AF5BF5D50A2BF5F65158CD423DEC07C4B46AC461 ZIEXRNZPJZYTWPPING
1,666,292,273 *AF54BA594CC0337A0A5F395AA419027BF9F97964 GNINMEAD5
1,666,292,274 *AF52EE53E5C60B62769AA5864E13B9AB5E3ACA75 zin.mee
1,666,292,275 *AF54F3D5FE06EC96FAEAEA3BA2E054BA92AA583E ZINSVERHING
1,666,292,276 *AF59894E44BF74A35732E8C0C2D01C15B0D0CC64 goddess.on.the.floor
1,666,292,277 *AF5885CDBF90E7F2C3B80B376439AFFC29F06ED5 ZSS9
1,666,292,278 *AF567C63087EBD206483F65B50F529EDEFEB8C9F zuoanmenbridge
1,666,292,279 *AF5A6FBA5252DCAFDE29FBF6E60B40FE37E11839 ZVychodnejdievcata
1,666,292,280 *AF5E3E4299E3D2B17A1E496F908365FE611B1C52 gratifierez8
1,666,292,281 *AF53D63C8086DC99A2F72A7A2E339CBD3499C444 EFT
1,666,292,282 *AF51402BD445DDA2486C9CFC59F73CCE3EC4A0BE GS2A
1,666,292,283 *AF582ED261BAF2E61FD199B796A2698EDFC0F82C EIGOLOTING
1,666,292,284 *AF5173463197F9F535C23D6F69CC3CEEEE48D12C elbatnors
1,666,292,285 *AF5545B72C35E232E14AAABD62E5CB18A727B9DA guypetrovic
1,666,292,286 *AF571B86AD1902ED69C517E06D810112F5AB4108 ELHAGE
1,666,292,287 *AF5FF224E91BEA658EFC2D8D05582413B2E20B12 hahahedge
1,666,292,288 *AF54C9DD5724894E6580843331C87A810C6BE24A haidoujo5
1,666,292,289 *AF546D2882D6D5223D659A6978DD100436EA56A0 [email protected]
1,666,292,290 *AF5F510DB70C9AD2E299B52EF72FA3FC47BE8DB8 HARRBO
1,666,292,291 *AF55E2F1553D1F5AA91966AFDD1345982C9EB449 HARRISONROUSELLE
1,666,292,292 *AF58850CDDEE14E2D7FEE353C8ED14A903DED4D9 harvest_doll'h/a/rv/i/st_d/a/l
1,666,292,293 *AF51891C01C7AD54EA4B4799E7DF3A75A5EB1E9A HÄVINEEKSI
1,666,292,294 *AF5CE541B28592257B0B6C1F591770EC3B9CDC64 «РАКОВЫЕ
1,666,292,295 *AF57E24540F61C7D706AEBF25492D5BECE48C1A5 СТИСЛИВОСТ
1,666,292,296 *AF5090DED0B524804BBAD56BF647A560413F6B61 EMPORIONPLAZA
1,666,292,297 *AF506F268EAD4500EA5EF11C6CE83BA21EB46AE1 ХОМУТОВА
1,666,292,298 *AF57C9861D23F1FE3788529478694D24BFE86B2A ENERGEETIKA
1,666,292,299 *AF5617FBA18AC5514AB1ABA90F2F901E97862A81 ENJOY(THEBEATSMIX)
1,666,292,300 *AF5C7797E37B3F886D1F3C3FF69AA1D4C5715A70 hhp1
1,666,292,301 *AF5AF466A0D13E7B6C5BCB1F9361A43F22E7A50E eptd7
1,666,292,302 *AF520E54097CF6C8511A57792DFFB3AFD66D819F hillcountrymagazine
1,666,292,303 *AF5FFA4FB308954185678B677DC0716A4E20BB15 erichosier
1,666,292,304 *AF57077E2BBFCA4ECB89FC80C4768CDE2D7F1AF1 ericyam
1,666,292,305 *AF5CC932C2C831003497D1DBAAF8E18CF0488D23 erlaaxelsd
1,666,292,306 *AF5B5D39D8CAB42461728D7ED4C642401A9E3F94 ERUGREVN
1,666,292,307 *AF5327F4FE37CD5CD2150566A8320519CC3EE0D9 [email protected]
1,666,292,308 *AF50EEED6C9DD9345356C8BD95661FE4A8B7FB48 et&74
1,666,292,309 *AF52B73DA99242341D3043E03AA4170B4F33E127 年も暮れの頃にはCZWの『ケージ・オブ・デス』という大会を舞台に
1,666,292,310 *AF5AF1EBA4C89E1A4DA43321AB3E6C5999BAA63E は廃止。660CC
1,666,292,311 *AF5B8EEC81A201EB78D6DB849197506A5043CAF2 EUITZ
1,666,292,312 *AF54B4E16E7EA147B5ACD0E5A2E7256D39F7F947 [email protected]
1,666,292,313 *AF5663A3019F453F20B94BA1DA83A4EA5E2B13C5 EVAN.BIETSCH
1,666,292,314 *AF5580FB64406269C3D59D171921368895971B2E HTTPCERN.CHGEANT4
1,666,292,315 *AF5C351223F53568DCB8B7C2693CF52C1C4D790B httppilkeycombookvi
1,666,292,316 *AF523410A1B2B44BD4822D8A2C01A72E99B24ED0 HTTPWWWGEAGROUPCOM
1,666,292,317 *AF51651191B30DB5C2B7D8FA9283B376B3A04614 [email protected]
1,666,292,318 *AF597A77A1F47C8C1A30C004F7ABD71AD3109A90 [email protected]
1,666,292,319 *AF5B9CCB10C5C14D0B086F57781DAA1BC16DC5A2 excitonu4
1,666,292,320 *AF53BEA710547253CE8DE7D493B965E66C6C7C5A EXPLORAVISSE1
1,666,292,321 *AF56C40DC3EF90E085480F3A492226DFC0F3AAA8 HUMANISTDAG
1,666,292,322 *AF554A9053B4C3F865EE56EBF82726206F11EE4B F3B7F2C53E9F3174A314134962BB0712
1,666,292,323 *AF5C25306233CEB80E8476052F6324397643E57B iambeatles03
1,666,292,324 *AF58EADCCF22B8C59747BD18FFC2BDC3F418BF25 farahnz_05
1,666,292,325 *AF5FFFEB68ADB64BB158E2D7D19AC0FE7C103073 if this should blast in proof. soft let me see:
1,666,292,326 *AF562D0AD1D7F3C2D195BF9BD7F9123AE0A1EA38 FEɾINOSULˈFAT
1,666,292,327 *AF59599203B407F973B6EDF69CCE2BD2D50AB644 il faut savoir (feat johnny hallyday)
1,666,292,328 *AF5DCFC5B8BD879CB352324EA59B961331AA73E9 FIESTA DE SOCIEDAD
1,666,292,329 *AF5C03186307ADE20F7590A626852635EE137CEE FLORA.FRANCOIS
1,666,292,330 *AF5745A9B149D1622D41B3ACEA625DA29AF31627 iman.hamdi
1,666,292,331 *AF59E04FE6D6851819BCAA93146059C606712FF8 FOMITES123
1,666,292,332 *AF5F788D73848E3A76DC7DF12BE8B0110E037108 IMPRESSED,
1,666,292,333 *AF5A6EF724AA5C3D87135C3B2518A6FBA116EA44 incatenate0
1,666,292,334 *AF5EB6EED9AD279A2441E34A48207620BD4CE4F9 FOROYSA
1,666,292,335 *AF555041244A51DE6C039311C780FEF32A0764AA INSKJUTER1
1,666,292,336 *AF5F43EFDE1A9EFC7AC5B3B6D8CF41C929F8F4EE INVIERTIEN
1,666,292,337 *AF5F1E1DEAE4FDD70C789C791BD9CC41424CE61A franknye
1,666,292,338 *AF51166A36196663500121D71535E638C7747641 IR4QI5
1,666,292,339 *AF57F92056861B4F7D757C44CB1F01F6A56426AC IRAFEBHF84
1,666,292,340 *AF5B3A9E40F26680A48982DB3C92D645A05BFD7E ISIDROPETTINELLI
1,666,292,341 *AF5E8B1036A4DA1E89EB76C548C501CD83A314D7 [email protected]
1,666,292,342 *AF50574E56B008E61895C2E8DBD3F3AA9C6BD85A issacstill
1,666,292,343 *AF559C151DC1E472065CC3419298F422357E70AD (>_0).o~.o~.d#q
1,666,292,344 *AF555B4C5521075B4F6A82850B3CDCFB5AB7CB0F ISTI-YULIANTI
1,666,292,345 *AF5FD1F2BCF956853261AB1B8BD8E9C21E052CAD )0(O~ O~(------P
1,666,292,346 *AF5C9F6A966400A55A5C7B8907104F68BDD51394 1018745 TERVEISINHARRIJAMIKA112001VIIMEINENP
1,666,292,347 *AF53564BA5CA2700AD2EA823A4ED4BCE882ED879 furwebsitehttpwwwkz
1,666,292,348 *AF59BE78D6FFF1D98FA692067B4699D22901D23B fwj
1,666,292,349 *AF5CFF92135F32A3D165EA4568889D6E1DFE3D0B g0t)u
1,666,292,350 *AF56A83360E2646AAA90496A7C59D3C05843F13F g14uc0my$
1,666,292,351 *AF5C91A5E2E8252D0B104579F567374BF7D91C67 [email protected]
1,666,292,352 *AF55AE94ED142A1B6F9FF170A7E050FA24231BC7 IVVN
1,666,292,353 *AF5FC87CAEADF283A994A6FC3EF3DDAC12B2F6D9 J160747
1,666,292,354 *AF5F36EF54ADBDB9E4A8C149565BFCF07D5A014C J740108
1,666,292,355 *AF59607C42D730CA12DEF7C83249AEA75862AB82 jackiekerss
1,666,292,356 *AF569394EE069213A4713500F143E6CF1B146F9C gazump
1,666,292,357 *AF574DC76DAC7E8B3AC093DA295FDC353316B12C 1213597 toimitilarakentaminenvilkastuiviimevuonna9.3.
1,666,292,358 *AF55245ADEA34315D3C7A8FD6B16435BDA65E4B2 georgiakinder
1,666,292,359 *AF5702C47F7B5CA97A09814B3A352E781E75C349 JAMIEDELSON
1,666,292,360 *AF5F41F4DE8321568C2355B3BC9189A5F295E41F GERALD FRAZEE
1,666,292,361 *AF5C4BC06A4B061A8CA8B578BEEE85EFBE689226 JANEDAISY
1,666,292,362 *AF59CD22520A2AB38971B2F70890E12EF560E747 ggrsdndn
1,666,292,363 *AF55F0955CC5C2A66F3F749834FAB20A77A7F2A9 JARROD.MESSERVY
1,666,292,364 *AF53A6E258688C245C4BE6A3E37284C50F8415DB Ghosts.and.Gargoyles:.I.
1,666,292,365 *AF551F219D87E47C1B0494EAC73E35F150C2F007 javajunky
1,666,292,366 *AF5F8EB4CBEA5686AB9845DCCEBD18182709770B jayducker
1,666,292,367 *AF58733FBD20DDE688A574B8FF247BF4B3172A64 giovannivignarath
1,666,292,368 *AF5E323CD32D50CA885B4FFD5227FD229BA78CE9 GIUSEPPE.DOSE
1,666,292,369 *AF5F74FCC062E980118717B2404F4C857C4B1DE3 JCWC
1,666,292,370 *AF599B0B07F0127EFB410B5A14D3824F74ADA486 glasbury-on-wye
1,666,292,371 *AF5D6E0C137E8E3BB37F7127D1661797FCA3BF4D 1498676 RAUTATEITSEJALINJAAUTOLLAL
1,666,292,372 *AF551595E9B040B6ECE927A9BFE7292D9ECA38EA GNILRIT3
1,666,292,373 *AF59E5D9F396977EBB9070C7B25104A31B39E8F9 [email protected]
1,666,292,374 *AF54EF0E3126CF1A7DCE1F96806221B88B09B379 gopuodkd25
1,666,292,375 *AF59C71147CDF82E3DF2CD51C9C19EAE46D1BAA3 1726229 PUHELIN-234-4756-TAI-234-4762-.
1,666,292,376 *AF55A8152303F3428C6C00044E72064326F8484F jet'aimech
1,666,292,377 *AF50632BB095FA59E30A68C34B242CE16121AC0C GREENPAPING
1,666,292,378 *AF5A000A3302C4A854628629E91926ED50DCA9D7 gregorykotheimer
1,666,292,379 *AF5DE019C9655D5869D6FC83EB77B08BF4B12971 gregoryrompf
1,666,292,380 *AF5698AF2B818476466CC6FE51C79D45A52E4A4D GREG.SMELLEY
1,666,292,381 *AF5829D98212D6C5EC331B3F0AA25BD509019846 1916396 HE SAYS : " THEY ARE DECENT PEOPLE .
1,666,292,382 *AF5CCC42D9385E0BBF3FAEF5899A2F4575DA4459 groveraccardi
1,666,292,383 *AF5710F58EC4E16707B687E2D3A35A5B262694CE JJHANSON
1,666,292,384 *AF52581CCD29AE8A5F7D8649950D8BD1B2070EC0 GS2A
1,666,292,385 *AF5193064A9D97183826CFE936DDF0AA70B6326A johnathonadamiak
1,666,292,386 *AF5B82973666C9D2F45F54DFEA650262F3A35E10 JOHN-DANKWARDT
1,666,292,387 *AF53440DDAF295B62B13638E17612EF9B7D9D0B7 johnmccolm
1,666,292,388 *AF55CBB85E5F81B00FB732DA758725F02E10A965 1-ALI-KOIRA
1,666,292,389 *AF5863497F8290232C00C0466E73A38C264771F0 1ALLIANTIES
1,666,292,390 *AF5A6D6B0104AB41025E1BE023EF648CAA92041E JONAYLAA
1,666,292,391 *AF556FFDDC03147F6E0B976BA94FFFCA6F82C7DB 1BRACINAS
1,666,292,392 *AF5FF43BF6640CA8939744D6AC1FD63B2AED0838 JOSHFREDE
1,666,292,393 *AF57AF81BAD5911154048FCC0676BEECE4D27362 +~H
1,666,292,394 *AF5372787F86BB67A7842F5A88812BC77A8CD834 JOSIAHENGEL
1,666,292,395 *AF540269DE1E7F022C08FB052E57D2A027BA2F6C jospehsuchanek
1,666,292,396 *AF53EE645AB6247553658DE95B2CBB0765CC88E7 1.deadzones
1,666,292,397 *AF59E6A8B9CEAB0055C3FE514E0077C53838D3E1 H35!T4NC3
1,666,292,398 *AF5E0F7C5816359CBAB6053D6C703B1EB11846D2 HAGGARD GAMES
1,666,292,399 *AF58561C7066BDB1ABED48622215F3866E7CDE9B 1ETAILIC
1,666,292,400 *AF5E8704EA3FEFFF4818A314385197D96A8173B9 HANSAPÄIVÄT
1,666,292,401 *AF5E01FC493B521F61B924F31DBDFADC8910E919 JULIUSKIMBERLEY
1,666,292,402 *AF5CDAC9D9FE7741EC4AAEF72204E8120D1A6510 [email protected]
1,666,292,403 *AF53FBB60029826792D7D54CC0352C6179EBACEF 1.HEKTOLITERGEWICHT
1,666,292,404 *AF5C6A174B06ADE341045D85E00F6F2C70B27617 HARIJATI2
1,666,292,405 *AF52D634F911E545FEDEFEC5E87BD76DF5C3FDA3 HARMONIA
1,666,292,406 *AF55C061E7764671CBDBD5DC360CEE8AC164BDDA 1.janiottamatta
1,666,292,407 *AF52AD81DB5435DF5D8072A091FF1F97B0E03E9F HARRISON.STEINS
1,666,292,408 *AF5ADE73285BEE9E3F1C14BB3C32173FD869A412 k5?,
1,666,292,409 *AF528FB4A93678D5C938F21C34A6914A1D8EEF0E KALKMONSTERR
1,666,292,410 *AF50CF055A9103C021995D1BF6FB7A73428FA302 KANTATE,BWV130"HERRGOTT,DICHLOBENALLEWIR":V.ARIA(TENOR)"LA
1,666,292,411 *AF555D631F5F43B098DA161204E592564090A9D2 1maal
1,666,292,412 *AF55BE193E70076C73C6442299B3A0E8A8D01AAC hctamlabteov
1,666,292,413 *AF5EA03D20AB3B9B22C0215453D5D2DCDCE27002 kathryn-mattson
1,666,292,414 *AF5945C1906E958F7463089A1A17A5221A49BFFB kathryn.telford
1,666,292,415 *AF5593B819CF835169F8BADBE408B4412BC0AD35 [email protected]
1,666,292,416 *AF5AF02934747D7A104005F66CDF1B26EDDB407A 1.off-theater-truppe
1,666,292,417 *AF54C282BA1B65135FA304F6F2496A9E40F61E0F KCHESNERR
1,666,292,418 *AF535165F558D656B5279D40D273A9FEED46E48F K.E
1,666,292,419 *AF58A7B663A1CF67C5DB32F39B2C7941076578A8 1.PRAEPARATIVER
1,666,292,420 *AF54CEAEC880DA41CF52C4F5BDCD5523C2C81B8C KELAŞTÎ
1,666,292,421 *AF505AD998B570504FAC856B5D04A51CC462A83D HELTEESS1
1,666,292,422 *AF5D5434707E882F06105CD86CEDE6666C26754D 1raunpick
1,666,292,423 *AF5269BC4D4CE6EE27842FDD1F8EB116622616F1 [email protected]
1,666,292,424 *AF52A76E9D4018C2394245CA7680D284D7493C35 heplorat?
1,666,292,425 *AF58361552B58E7094BDD9C3B0EC93AF58E582B3 HERSCHEL.CORRICE
1,666,292,426 *AF58E4CD18FDA9623A0A2A5847D51662589AAA59 kent)打算看
1,666,292,427 *AF5B2392309F9B648F45FCC8C4FC10F431936B26 1-THIMBLE-SIZED
1,666,292,428 *AF54E0B51135AFD69BD9D9C052E447C401322989 1.tourettelastenkin
1,666,292,429 *AF56FF168F8C24AC12C492CD9635E1352D7E4539 1.TRIPELLEINE
1,666,292,430 *AF56EA6078ED5AA0DB940CF804AE37A046A4E783 1-ULOSTULOARVOT
1,666,292,431 *AF53ADF7D77BD7F41D121832C1CA92FCF7D5094D 1-VALTIONOSUUKSIAKIN
1,666,292,432 *AF5EF3F2D171DBFF7AB8977AF3B8A7CB5A78DFBE HIRAMKUYKENDALL
1,666,292,433 *AF51D5489323CA70F9FCB5913D5F6576E26B047E khmerien
1,666,292,434 *AF531E16A225BDE037F3C88827F7C2F08BF1EB69 KIYONNAWILSON
1,666,292,435 *AF598F0938A1A97589F7A769CF2FCB35BE4DA613 1 YKSIL
1,666,292,436 *AF579209D5C4FFFB38F5205B9F1CCFA49BEF406F knapningers
1,666,292,437 *AF5032F75BF35317A2EF06B952CBF34FABF28BC5 HOOIJDONK6
1,666,292,438 *AF5C7B77D6690974FF2D15EB2D972D4934CD38DC kundenid
1,666,292,439 *AF53445AEAC35CED43C17AB7418668D4C2140A09 [email protected]
1,666,292,440 *AF5FCD2CDFFDC4D583C8E06C1A9DC9DD42986533 lachansonbleue
1,666,292,441 *AF576FCA4E9635934847B182D1780CBFA9C7AA35 [email protected]
1,666,292,442 *AF5A6578086362E2A0B9899735A09547FB4FFBAA httpwwwjnadin150me
1,666,292,443 *AF5C38951C1EDD4C94ECD14FB256A2F75D10A765 httpwww.sintagmacr.
1,666,292,444 *AF5C3CE5918A8C40F51C9684062391EF1CF0E99F 2507424 wir-kommen-aus-den-negativen-schlagzeilen-nicht-raus-
1,666,292,445 *AF5DFCEFBA06382813E9DB8980A9B8E8ACAF0563 2537592 doch-das-zeitfahrrad-gefiel-armstrongs-nicht-.
1,666,292,446 *AF5A6CE91A6C84F29782C6E88C9E762FD9C441F8 HUBERTHANT
1,666,292,447 *AF517C58D44D28848BAF28203342B920CBFEE427 hueywollmer
1,666,292,448 *AF548B232F333BBAC23FB925620159F4254441D9 HUTAJRIK6
1,666,292,449 *AF513E0C5FC0B6A2849990BB2B8FC3CB9445C8D2 2694936 HE TRIED TO TALK HER OUT OF IT , HE SAID
1,666,292,450 *AF53865C05B6D5EF84DFFBDFE328768500761243 [email protected]
1,666,292,451 *AF59236ECF1D824BE776566D8BC61E39BA18704F 2738526 PERUSTURVALAUTAKUNTA.VALITSI.TERVEYSKESKUSL
1,666,292,452 *AF5531964E7C53D1D834FF146B9A700B34BEC50A hybleum
1,666,292,453 *AF5F9C0FAD796AD455ACE956EE2C7A01099CE232 28 REFOERMCHEN
1,666,292,454 *AF52606AEBD88359EAB484BFC25E878C3383F7FB i]),
1,666,292,455 *AF522B68AD545B0F61A704ADCA4648E776F69296 iamfuckyou1987
1,666,292,456 *AF5CAB1CC4D74F82A7D228AD646B71620E5FDA55 2-damgasiz
1,666,292,457 *AF58DD62DC194D28E3D09E87036AC193D56339EC LEOPOLDO.CORCINO
1,666,292,458 *AF5ABA2E480A310BE0F1817854AF261E278D4566 LEOWOODRIDGE
1,666,292,459 *AF5E7852B42EDF326EADC1C62F34331576047644 2-FUSSTRUPPE
1,666,292,460 *AF528C34BE542DE0A976BB90E843235FD7551712 LESSMUELLER
1,666,292,461 *AF558BDFD9B5AD9B08F254E6ACD02799D5D08794 IERETIUG3
1,666,292,462 *AF5A34727DB564035DE9EF2D96345B59AB529DD8 2.LIBRANS.(DEMO..VOICEPRINT.LTD.GIVEAWAY.CD.PROMO)
1,666,292,463 *AF5B265EB2BFACAF5A6AB5C556ACEDAAC4EF66F7 LICOMES9
1,666,292,464 *AF5961A0AB8EBE1C232E389001F5B6A5ADBD6A0C 2-perusteellisemmat
1,666,292,465 *AF555F6F6E5B4A8D311964014619DECBBB35C522 LIGNUA
1,666,292,466 *AF54F3FDDFEAFA5B21ABB065121C66E96A5A1525 [email protected]
1,666,292,467 *AF50A9890FB630F210554BBB28369F2F76AB5A8D lionelbacho
1,666,292,468 *AF51575130A0EEF7C24D9824D45EADB2861C6A9C LIONEL.FEEZELL
1,666,292,469 *AF5E8573086CAF27B8BC3B13D9A2CFCDC9CC6900 iluvbridge16
1,666,292,470 *AF5A6BAD2A6039C228104722AD1F069B980E13E7 [email protected]
1,666,292,471 *AF5F914D3D77CFA1D46A0F7FCE73D92A1918C17C LIVEFROMJACKINSACK,NEWJERSEY
1,666,292,472 *AF555F214466DA47F2C941953D1E77D933CC696D 357mohammed
1,666,292,473 *AF5BD00D0E5CAC065670380ED1A08980C528B448 INBARGAVISH
1,666,292,474 *AF5B04D568BD0B876C40DB0553E1A64F131695A0 loOPaZ-dELiGhT
1,666,292,475 *AF592687E4224A1BF7E7018DA807CA194513674D 3b<--~-`-(###3
1,666,292,476 *AF54BAD088CF3D255C98984BB4EF6B3C04C9B274 LOSGATOSBIRDWATCHER.COMLOSGATOSBIRDWATCHER
1,666,292,477 *AF5E23CE01BEE1688682BA7A668C4A2362F078FD loshoofdigst7
1,666,292,478 *AF5AFEC6146897D17058A46DE413BA9607B3C0C1 loukiyuna
1,666,292,479 *AF53277C6F9562E5D019ADD757D279DE400F99D8 Ingout
1,666,292,480 *AF5CD80137451D26483CBA89FA6D38425BE1EC01 INSIDIAE0
1,666,292,481 *AF5699C7430094F19F04B487030501D1AF41C026 INTELSUN0
1,666,292,482 *AF5FDBD0F00E39D16562AF7FFD477A47D2E1422D 3IGUESSNOT
1,666,292,483 *AF5E3DE721704E9A57E64E1F153DB5A17F530E36 3KONGKHA
1,666,292,484 *AF5E6D485561F2449D68AA1BE5C4FC1CDE3032C8 in-the-world,-if-a'-could-get-her-good-will.
1,666,292,485 *AF5A1927FE040591B574665C742CCE15661B06AA 3.LIBBEYOWENSFORD
1,666,292,486 *AF5E5A8B40A8C1CC04FB1F370D7A444F4073C26C INTOXICATED-/I/N'T/A/KS/@/,K/EI/T/I/D
1,666,292,487 *AF504A78091716141764614C3221E5809472D5E8 3-maksunsaaja
1,666,292,488 *AF5FE1C502A168C3E355E1B51CBF625DF2568670 LUCIENFAVERO
1,666,292,489 *AF5D88AEEF817B58D6AFB55EA6981518DE12C2C5 LUCIUS.BASEY
1,666,292,490 *AF5CCFAB390936191362DACD456C32DFDFFA2AFD IOORTSEGGED
1,666,292,491 *AF502015ED3642158F9856BB076CAABAEC57D1CB ironmanxomanowarinheavymetal
1,666,292,492 *AF5D8407707E8A38C26A412F98AD2F44BF705364 isidromistry
1,666,292,493 *AF525198E12D36CFA612BC9E0B16336B696FE0F6 ISIDROOLGVIN
1,666,292,494 *AF5B19C5E3DE494028CDDB04E59D7D1E721FC628 ISMAELAUDIBERT
1,666,292,495 *AF50A9ADF1ED640FC579D34FE40CBB93CD576E32 3-ROHOELSORTEN
1,666,292,496 *AF568438FC522D8C99468A7C270C351A00A5A869 ISOGRAPHICAL8
1,666,292,497 *AF5A2F3731675573259F7CD231CF6FAE75DF78ED ISSW8AGHPN8N
1,666,292,498 *AF5D9D941F78E427ADA6E7D2D321D1D409734BF8 3X4UDIVIMUS
1,666,292,499 *AF5C19BBBD26A178A07F1C3A457340842A66B0EB LUM520
1,666,292,500 *AF5EE751962253471621510BFFA205FFE8F5A4A0 [email protected]
1,666,292,501 *AF575656D0771C9F8830B9AEE19911C7D01D1C84 LUXELUXE1
1,666,292,502 *AF5E762C8E28C40858F148B14045B8BD115070CE LYMANWINN
1,666,292,503 *AF5F57C1EF22D4EBDF5F2CF856506B651005367F LYNDON.B.
1,666,292,504 *AF5BD8EE3200B78639461654CF61D7B3F4E29824 428SIMON
1,666,292,505 *AF57469FAA17500CFF725F7CA8215EBF0C5F68FC ivg)
1,666,292,506 *AF592BF78CFD8324BC5A183213F77D836108E5C6 magane661106z
1,666,292,507 *AF5A2C5F7C396E07672BEDB60CAB05A646FDE6C3 MAGNFICO1234
1,666,292,508 *AF521D6B42AC841DBAB682E8E18A9158009DAD78 maigrelet
1,666,292,509 *AF57EB7539ADA68FCE353C6422E8AD46CF778E4E jabari066
1,666,292,510 *AF5552F625D4FE265749FB18ECC5EE4E385B774B manhome0
1,666,292,511 *AF5E8B8F95B88F5756ECD85471430C510BF1A32B 4KRASLAVSKY
1,666,292,512 *AF5C40F44BAC0404D2C50207533AC87B8E8A710C 4LEMMEUTE
1,666,292,513 *AF5F092B54D5EBDD8AB5BD92B98FD87E3A738145 jamelreppucci
1,666,292,514 *AF585CCA432B03B2B9B336C77B75F69A0EA3703A JAME.PLOCEK
1,666,292,515 *AF54B8E5534CC41E6CF4E73D1C5D8C48EC9CEC56 [email protected]
1,666,292,516 *AF59BEE37B0CEF65578780A22E6BF4A4E4BA5757 JAMEY.JELTEMA
1,666,292,517 *AF52E24AC8ED9622EC0A64F62F69404E85343701 4NEOSTVARENIH
1,666,292,518 *AF5B5458471035404950DE00B948F141A4E33985 JANNETT-BARRETT
1,666,292,519 *AF5ECF0C4B7CDA585101D53FB65F5A450DE03CB9 MARCOBERNARD
1,666,292,520 *AF5204505FC3B066E6B09EC97B2214E471E65E4D 4POMMEFLAMINGO
1,666,292,521 *AF557ED39090A3AD1C51117CA49415FF9FA62A6E 4-propagandaapparat
1,666,292,522 *AF5A0F257A2E266CA757811D5E7CA129DFE645C3 MAR$H V3T
1,666,292,523 *AF55F544B178A7D9B0FF5570370C6E01820AB042 jeannetime
1,666,292,524 *AF57DF79F56A666A0CCEB2121C51A3CC78449198 4VERSIFIASTERS
1,666,292,525 *AF5DA5B2802CA3FED6AEFA39E95EB9789099CA57 MARTIN.DOMINQUEZ
1,666,292,526 *AF5F49E858859F43682BCA1B09D0FCA90B917824 JEFFRYGORMONT
1,666,292,527 *AF50F408E8E531E5904ADF1E81879D37A400E27C JENNAELOISE
1,666,292,528 *AF5BC073C0ED80DF515BD12B5266C5F7E680AA0D MAUREEKE
1,666,292,529 *AF5D9E96599F156375BE8609CAED5CFDF9DD1E00 568620 a:lle-oli-ilmoitettu-,-ett
1,666,292,530 *AF57CC2B1770BBA70CA37604ACEE757BCE275879 56-OUTSPOKENNESS
1,666,292,531 *AF546EBA6719ABEF5D02FB499CCE1A4248AF7A5F jesus.is.the.manager.at.walmart
1,666,292,532 *AF55CE99FF9A9CBF7E603BEEDBE59ECF7FD83906 [email protected]
1,666,292,533 *AF51E6C742FFDE846E9944C9D30B03CCC278A9A4 [email protected]
1,666,292,534 *AF5F73DED1D939DFBAFD41968463A3D61A88AD74 Meetyourwaterloo
1,666,292,535 *AF5D79A10093F8AA2968548981FAE8E5BAB70D28 MEGKERDEZEM 2
1,666,292,536 *AF5D13DECD2BD9FB60F0A631F54107D507A27ABA [email protected]
1,666,292,537 *AF554D72517D48707A5F87D0455E9DC1AB1F6F27 JJ|4
1,666,292,538 *AF5E537D386045145A8D5C1CB99213B4CBEA19C9 590502 korukent kral tekstil sanayi ve ticaret a . s .
1,666,292,539 *AF52172FC1577DF18B7FBCCC93EEE97D535C48D0 MERVINELSON
1,666,292,540 *AF5FB4EB0E187DAFA21FDE88FCE0520C02C52DA3 5AHOJARENS
1,666,292,541 *AF554EE50BA3F8F938569FDE44A8262DC6DC25B0 METALMUNKY18
1,666,292,542 *AF5B8B3CB3E10E8F8D95CB7430A48666C76AC5BA 5BETRACHTUNGSZEITRAUM
1,666,292,543 *AF51797D6DE713841AFEAFD48D5D19F6E129C8FF 5BSWRRRRRRRRBSW
1,666,292,544 *AF548B2A35E0EF2E84863818EC55288FE81BCF71 michelucemusic
1,666,292,545 *AF5DDA2B827D2687D629AC3E009C837BE3295C61 [email protected]
1,666,292,546 *AF5893EBD18BC96E780182C67A966446123FB7FD [email protected],
1,666,292,547 *AF5BE0FC77A655FF78915957AFE142DAB931838A miguelmongomery
1,666,292,548 *AF574556343D79234058B06FBE1A729A598CDB48 5FLEURDELEE
1,666,292,549 *AF53434AA3AB9F0860101A0B6BD42EBF0C256200 JORDANOWERS
1,666,292,550 *AF52FF17CCB7AADD6A4A8A93D8EFB0DDAC143A84 jordoncabanilla
1,666,292,551 *AF54B4DA14ED59DA73DF98E1E99428D319A8968C MIOLLNIR3
1,666,292,552 *AF515C5F9AF832945FC685142EA02ECAC20B74A2 5INTROKRF
1,666,292,553 *AF59F9944438BE91411C6C674F99424E9D72DD61 5JORDBRUKARINGS
1,666,292,554 *AF55F48C063E8B183A3C5CD9A4DCF7620DF45349 mla342225
1,666,292,555 *AF5416D368DCB682CBF097DF1242CCB1A1B8A309 mng6160do91
1,666,292,556 *AF5850384107B4C2CE4EB582E72DB0C5DB85F1CD MODIFICATION(MSM)ATTACKS.
1,666,292,557 *AF5C2814A7EE2DCF67271B3D6E8A57E312AC8D99 5RSIMHINNBSW
1,666,292,558 *AF50FF066D2F849E49901A6973D0FD7A5D0B7ABD molly2007
1,666,292,559 *AF50E004FE736594D982E806605B66A15C93BF88 MONROEGALSTIAN
1,666,292,560 *AF53AB511CA0633449C77BEA9D67904FF611BD06 KAIJOUJIED
1,666,292,561 *AF5687E9450F5DAE5B6A4C36668F15DD343E397B 'KAJ-OG-STJERNENE'
1,666,292,562 *AF57D07AAA559D27C228F1AF64D5D937921902D3 6ARRONDISSEMENTET
1,666,292,563 *AF529DBA090859AC010237B64C5D806DBD4186A9 6BESMUDSIONS
1,666,292,564 *AF531D883857DF4B83FE612E6339AEED704ADCDE katbaileynet
1,666,292,565 *AF57FC6952F7B64E0735E93D0CCAF4CE03AB218B [email protected]
1,666,292,566 *AF5BC090A4EBA8F016C06A0C30B13EDA7B3B1B0A kayla.henton
1,666,292,567 *AF50F92041ADC9FC116FE8BBD5EF9C8BD0C43D6F MUHL135
1,666,292,568 *AF5A2AD1E23ABA824DFE8467E3D9A23C8FDC0E48 Mundo-Bom
1,666,292,569 *AF5DAA1BFEADEA4F9710A523D939A82EB95BD855 keeley
1,666,292,570 *AF5EDC524801D8F0D7F23B288396B11340E1D4A6 6KIISTAKYSYMYS
1,666,292,571 *AF53CFF9D1D8973A294A63615CEA390E057187B4 MYGOOBER09
1,666,292,572 *AF5690AA3293E73E28AABFBCCFBEABBF84EF80D0 6LAAJEMPAA
1,666,292,573 *AF5E999DE387880A3816B49D585BA9F85E16D4E2 MYKY19
1,666,292,574 *AF5BF420F787CB3D5871B12D3C7EB6B47F4EF00F mymatt25
1,666,292,575 *AF53F12D645C6351A1E83DC7399BE452C30B861F MYSTEPHI46
1,666,292,576 *AF5A2AC226DB0CA0B10D5F7F86698F72A1EEF83B [email protected]$
1,666,292,577 *AF5043AD75224D16065A95226688662EAAA90695 NABBATH5
1,666,292,578 *AF59ED07045CE3D358C9E4C07DBDE53E57C0F10F NAHSRAHD
1,666,292,579 *AF57B493DAD12B876CC9B77F2CEE8ABC7751F3FA NÅLSYDKAKTUSARNA
1,666,292,580 *AF5C109271C479A2D635E37E6C1B59EEE604F599 kimberlywester
1,666,292,581 *AF5173506A546E2E3C9548DC64F27E764C76DD9C 6XXXEDDIE
1,666,292,582 *AF571E99C1103FF3E12C6DAF727F3672B5AC1C79 6Z2AYMT
1,666,292,583 *AF562458314A1EF46808F1D4D6E21A0AA805D290 708966 kimmotikkatohmaj
1,666,292,584 *AF587AFA67841DEDDDDDB4EC2E94BFC20B8DB4ED [email protected]
1,666,292,585 *AF5E73B1C4496F087683CE06C490F57706E6DBA1 724544 BOYLE-SEY-OLMAZ-
1,666,292,586 *AF54C1E7A1960CB4683EB2C77578C1CBF2DD3367 726622 TARIMSAL URETIMDE YENI BIR TEKNIK : TOPRAKSIZ KULTUR .
1,666,292,587 *AF53E4421BE8896EFC7F8107BF3B7373D34571C7 KITATIPE
1,666,292,588 *AF57E3D889307952E568ADF49726A4CB91B7044C KI.VAGY.TE?
1,666,292,589 *AF5BE0AA4DB63C53502344FFA26AD43A7B4E1059 NIGEL.VOELZ
1,666,292,590 *AF5CFD537F30B81A01C4836F91F74B21A4063BD8 KNIGHTS?HOWQUAINT.
1,666,292,591 *AF5CADAEAB28AAEA7B6D045D590EDD7078F508FB nigritlan
1,666,292,592 *AF5F75184C1A7CAA5282FE3B972639F7AECEFBCC noahangermeier
1,666,292,593 *AF55B6791934E5F23D6B172C4C89EDBE6045A3AE no-lo-digas-m
1,666,292,594 *AF5526EA28AC5E86EC6FB4DE290A2CA8A5FE7CF9 nommos' descending
1,666,292,595 *AF5D1884D6B64CC947928BE7A9A5EFFE4A32327A koreyfordon
1,666,292,596 *AF5808EFFD797190AC17B5F7A26A33CFC5792E07 korukollu-ii
1,666,292,597 *AF589A3B181E559F629A4C534D469EF05826E009 KREDIETWAARDIG
1,666,292,598 *AF52655D1BCA097303C6192DAC3CB76338E693E3 NOT4
1,666,292,599 *AF50D104DD8AF592B0BBFC0DCC4C2CAB2716B862 NRE$
1,666,292,600 *AF5C28571643157EA8E68778CFC2F5C29B61BB8D numgestodeamor
1,666,292,601 *AF55FB80C9D7DAE28F6ECEF5275F7BDF8858D968 7iluvashley5
1,666,292,602 *AF57A0DB667C15699DAC33203624BB3913F19A55 kurtorendorff
1,666,292,603 *AF5454539538F126CE240A3CA0349EC551C0D79E 7KULJETTAJALLE
1,666,292,604 *AF58CDF9CC7AFAF9E7AB2270F2DA85A1BABB3852 KWANTUMBEWUSTZIJN
1,666,292,605 *AF5DC6DE5AEF180E69C96CFC3183E84268EEE029 7MAILMANGOCOUGS
1,666,292,606 *AF5365D0CC18C6B69F476D81FD25F493FE9001E6 kyoutuuk2
1,666,292,607 *AF59712C704690460057A9990D8826E5EFF6B6C2 L150905
1,666,292,608 *AF5FC42D99AAA052F62FBAAF954A4EA67FBAAAA6 7ONIDUARF
1,666,292,609 *AF51758A0AA452FDBB994179B14FBE9041807231 7ORDERLZ
1,666,292,610 *AF5B10D4A6D36D2701659046D34E476A45840FBC }o{~ ` d--b
1,666,292,611 *AF5747ECAF89684ADECBF0EF1F670BE914E5504C 7PLYNOFIKACNIHO
1,666,292,612 *AF5FE0A4B5935F2E085E3067F9CA8524AC902736 ODUNAYOABIODUN
1,666,292,613 *AF56A82DD56E9D4E24E40006B0D5CF23013CE146 LACHBUIS1
1,666,292,614 *AF5B4544F93E554220D95832EFB0C40CE6A5B61A 7TRADESE
1,666,292,615 *AF51E0B351C5B6F6B0B2D54B08F02BE54933FBFA OLIVERSBIO
1,666,292,616 *AF5462D13D2B906DA322C296A84083998C42C22E omwaarde3
1,666,292,617 *AF5386286FB2DD2558DE4FA9AA07941758E4BF59 827ASHLEIGH
1,666,292,618 *AF54C896269BC2C29442346E1F4820CB0CCF13CA (O_)O~O~ @####P
1,666,292,619 *AF55CC216224A22E45565CB1F5C0E82470BA7E13 LAUGNILOEHCART
1,666,292,620 *AF54DBC079C48EB7B36952A6B1CCC0A783A79039 ORVALSCHIRALDI
1,666,292,621 *AF5A8599A6BC3D1B8FEF853727F08B46891C9458 ORVILLEBROMWELL
1,666,292,622 *AF5045FFE12FA76057E97720A935D8BA6E5DB58B 8BSWPREISTERBSW
1,666,292,623 *AF513F3430EF76C9AFEB9CF63C0FA9E9C74FB60C LAVERNE.ROMENO
1,666,292,624 *AF50FA1B36D6D67BEA481DFD1CBC282E1BED4500 8CALLEEVXML
1,666,292,625 *AF51C8D1E1D7E203AB36C61C941AD3BB766092E9 lawcentresorgukwww
1,666,292,626 *AF5715E04FD78F13134AA827FD42D664F17A2ECE lawerencekay
1,666,292,627 *AF5721075F738A479E81732851F942E5D29D159D LAYOUTGAID
1,666,292,628 *AF527552F5CF75CE5A7902072196439BB7CF838C ottoseiler
1,666,292,629 *AF59198DCAB83F7343C9F5392AD9B68CA232319B 8DANCERRAPTOR
1,666,292,630 *AF53B92CB32CDB18225B8E09E3D28DD70299B4BA [email protected]
1,666,292,631 *AF5F1CFDAA173EBE2C5E87DFDC1FBCA22CFD99BC LEAABIG
1,666,292,632 *AF54D99DEE49424AECA1EBCE68DE07C52155A447 OUT IN THE COLD AGAIN / WHAT ABOUT ME
1,666,292,633 *AF544F4FC60B0B8602F0C6CF25A0518097E921DB P#####)~0~O {X}
1,666,292,634 *AF5A46B8CC83BAA7D2A0ABF14B84B1E7C5B75FAD lelandrecendez
1,666,292,635 *AF55485941B6BF2709F6D6D4BAE9EBA70865020B LELANYA1
1,666,292,636 *AF5C4E56029845672A94B31DCAA404E0C26CB222 8 KUOLLEIKSI
1,666,292,637 *AF5064932CF54F12DCCB04DA40E6F412D6F9881F 8MERCURYCHICKEN
1,666,292,638 *AF5C2353946A67368EB9764CB4A8BCEA82F7C122 8MILLIONAERSVILLA
1,666,292,639 *AF5CB55A7F2B684E7D534FE9CE9F11B389B6ABF3 PALMER.GARONE
1,666,292,640 *AF5352EAAE2AB639D6463609FA22CA41FBFCF5F2 LEONARDKONKOL
1,666,292,641 *AF5CC7A9FBB80300E76CF45453F968CF9165C1EA PANDORA'SMUSICALBOX
1,666,292,642 *AF5C2444E976EB1A9C7A9E752C8FA91D142F517C 8ONDERTOO
1,666,292,643 *AF5CF69E628BB2EC02062838DAAFCA50638F8311 leroyalex
1,666,292,644 *AF5F33CE4EF6B767482DBC0203EFE5D897ECDFB4 _l(#))-Flood-Protection-for-#-$+-:
1,666,292,645 *AF581076AB667FC3B5BF71A5C180B9F0457CBBE4 PATRICKCALTON
1,666,292,646 *AF57F3F66E333A2D21D3044C73FEFB93AD662689 PAUNHAM
1,666,292,647 *AF5AB57FFD0D4BB14CC106AADFDAFE256B1AFA14 P######B~o-(>-<)
1,666,292,648 *AF54310978AA77BC774C821884D490B2C24EDE98 [email protected]
1,666,292,649 *AF5C50876F57097997C4C9BA106C717571819D16 8USTESNEZ
1,666,292,650 *AF5FD898D77A29CE8D947CD55F460B4F854684F0 8VIDEOPATICI
1,666,292,651 *AF5B0A028245AE54360B856FDFD12301BD1BB871 PEETOUDERS!
1,666,292,652 *AF5A8618601FAB889458C6C57F64B9BF8E878D31 940022 TUNNUKSILLA-TARKOITETAAN-OHJELMOINTIKIELISS
1,666,292,653 *AF55F2AE50C59AB02DEEAE8C028B64CC8DF92F75 [email protected]
1,666,292,654 *AF555A45C98B551A43CA5E4DB994A56C22F09E57 PERRY.ERGER
1,666,292,655 *AF54F3ACF620CA27FB64E15C1847AB17534C422E 9EDNEGERO
1,666,292,656 *AF5AD66458A798032CDE3A7BB15C1147D4E6859E 9FRITUREFEDT
1,666,292,657 *AF5EF6D4CB02E4E57883F08439E1E453D3149985 9GRANITNOG
1,666,292,658 *AF5205AE8B6E7B5E6454DA86D3F98B15BD2DA61C 9HAWPDTDQSN
1,666,292,659 *AF5D9A380952524F6187963F6F6BCED07EF71171 9KEDDY
1,666,292,660 *AF58E60F8B90A85AA0437192B4AACAEBC87E6469 9MOCOOHAYELLIVREMMUSSELLIVREMMUSANAHS
1,666,292,661 *AF5A9AD98E237A22E10330A3BCC9B8177F2E919D 9NAMSREVO
1,666,292,662 *AF5A8F33948A28D4E435E3E1828637E834F899EC Living-on-the-Net
1,666,292,663 *AF55C3E7568DFA9319E6F4D8EA45F4ECFA00F0E5 PHISHCANNONDA
1,666,292,664 *AF5A98BC2832AE7CBD04281A1C40A97786C20C18 LOGANSHREVES
1,666,292,665 *AF5A2E6BD4BFB21616A64B60C7695AA615D95993 LOLLZ0RZ
1,666,292,666 *AF54C57EA5D30A61B70D0FB700394FA47DEDBC40 9TARBUTTON
1,666,292,667 *AF5D788D6F8A867CDBD77E365505DC8B5027555D 9TSEFNISID
1,666,292,668 *AF574AA3C7420BBF9FF0C988D63C0CF6DFE67ED1 LONNIE.KAWAIAEA
1,666,292,669 *AF5A7039447AFC99159C84E9F641B20DF5413A16 9YEOSHUA
1,666,292,670 *AF57E45034971E6199C0A7FF743AC744BD6EB6B3 PJATTAR0
1,666,292,671 *AF5290D6EA080A3454A3E556EB31A4C08F260AE8 LOYDCEBULA
1,666,292,672 *AF558EBF20D4E9C5DB19A719FB7FA7EEBF779ECC LSAVVYCHICKL
1,666,292,673 *AF517BDACFDA39BCF6E6E21D662DE86B2ABE7263 [email protected]
1,666,292,674 *AF5194DD1A942C359203F6B50FD0AE1BC5A02A4B P====>**(O_-)
1,666,292,675 *AF5A6019A3F13DE50155578EEC25F69036038B82 [email protected]
1,666,292,676 *AF5CF1F5E879B15FB06417D822A588F3E77C562C P##>-~O~O>-B0
1,666,292,677 *AF5D0478CE8F7330890E015F107B6B7500DBE521 A8XIU
1,666,292,678 *AF5FBD670F9CE1A6FA50A41AD983188283CF8AF4 aaal&
1,666,292,679 *AF51D7D3D339D50CECEF7419A985A34841B0B0D3 PROPAGANDÁJUKBAN
1,666,292,680 *AF5FF1326C6976D3BE8F7C6A58025A5D070ECB32 MACK.HUDMON
1,666,292,681 *AF5B82E460A8E2144556D011675EFF206DF2C88E [email protected]
1,666,292,682 *AF5FF1631E005246DAE7C8CA3AD3386713F37C74 AAD#!(
1,666,292,683 *AF59CDF74F290169722A6512E821B391A526053C AADFB'
1,666,292,684 *AF5A59021DA49C4D3A9ED56414C5C86DAC42D0D0 pushpagiritop
1,666,292,685 *AF5C99CC1D7466651FA210E7CC298C37EE62BD75 q####>~(00)
1,666,292,686 *AF5B929A43099AF30248645AD3D8E28FED9FC485 man.or.machine.(f)
1,666,292,687 *AF5A29051A95739C9751FC781B4DDB5948C9AEE9 [email protected]
1,666,292,688 *AF587BACDC9BBF2FCE5421CA2236E0D2AAF42669 QU4DR3NN!UM$
1,666,292,689 *AF5E4948FA634BCD52EEED6038272F296D30B647 ABBEY ROWE
1,666,292,690 *AF59D03859B63D2A758B05F2EE6AC2CD8BD09EAC maranung5
1,666,292,691 *AF5EF32693D4794738E8684E4716CD1856FFE318 MARCOSBERTEL
1,666,292,692 *AF547F82EB8E45BB4D2A0B06878832B50613B455 a-:bl
1,666,292,693 *AF56924FE3E7C0ECB106D9B4B55EE9462B451141 mark-cap
1,666,292,694 *AF5E00BD708981A993A348DDC74DFC0990E6D9A4 ABU$ATA
1,666,292,695 *AF510E385AC975ED780ACBA6D2D3519850D8ECB4 abyp=
1,666,292,696 *AF52270EC35B82CEE7F1B4D2FAB713F7E208AC49 RAMAH-JONES
1,666,292,697 *AF59AB0A5C5FB9D61EB4F159A5E8756FF545C96A RANDALL.MAMMO
1,666,292,698 *AF5F197616BD50E48E65A9211D72E0CCE035F004 ACCH&
1,666,292,699 *AF537220DB2068686F93F876F781C0CD0904B7A7 MARYLOOW1234
1,666,292,700 *AF5425E125910D2B3BA369A0D75377D0473A8C50 RAYMUNDO.FORNEROD
1,666,292,701 *AF59CCFEB26A6285B75EBBCD6BFA3080423B4D85 raymundogluszek
1,666,292,702 *AF54EEF9E5CB760469F0716ACB7CA6ED25DC88A0 mattleisure
1,666,292,703 *AF54A8EBC1D361967E2831BF5992F200BDCB230A REDIRIJIDO
1,666,292,704 *AF502658F92835ADE5BE41CF29D48080ADF697A5 adolfokillick
1,666,292,705 *AF55CFA0613404224606909D1B76100B0C7773BE ADOZN
1,666,292,706 *AF510FC1556663E672376A3EAF49C9985A0750DE MELVIN.WOSHER
1,666,292,707 *AF5F369D652C8B89BCA3F4444500D3B78EDF863E REMEDIOSSYREGIDORTAGURA
1,666,292,708 *AF53B3B0A2FCBB480FC5C71E089525905B8CBABC A:+E+
1,666,292,709 *AF58E0C6F21DD0886238FBCDB035D999467BC298 afbarkede
1,666,292,710 *AF59A7B8E9873E7F407429E19C989DECB5E4AAB5 MICHALECANE
1,666,292,711 *AF5589668115E6A5ACE3B5DD075505F29A2A5AFD afme2
1,666,292,712 *AF5B5E58D66C3B6171FB603485E9D00B25A4A713 AGHFW
1,666,292,713 *AF5270176FEC4E4EF64B1469F163AEB1E88781F1 AGOFNODHHCF
1,666,292,714 *AF5ED772062C5EF618B518B8D3E146BA20959716 AGWDDKG24
1,666,292,715 *AF5A21D1222DA5B22B1547F670B8A54E7CA56480 minhtrail
1,666,292,716 *AF5D3C7C18FAF815B09635BA2ABDFA57234A439C RHETTASD
1,666,292,717 *AF56295E928B62D7A9B7C105538BB979CEE5E4BE RHYS-HERBERT
1,666,292,718 *AF5173D1D91A77AAC6C5B3F4EF342E0C424CD1DB RICARDOHUDY
1,666,292,719 *AF524099025778E027B37300CB3FA1CDB623EAC7 ricenoodles
1,666,292,720 *AF5FA2065ABE64FFAC808398BF5514595E1E2110 aib5e
1,666,292,721 *AF595E59D7B6A17346F4E9E949993B727B8147BC aisx#
1,666,292,722 *AF576DF3D8EE413C1B7C5A4EB8ED37A3098D1E04 mistande8
1,666,292,723 *AF598030803FFF39B64C97423FA5032C998F486B MITCH.VANNATTEN
1,666,292,724 *AF551FF000A5ECB20C301FF0A4D96511A897B02B [email protected]!GH+
1,666,292,725 *AF545E9E81ACB3D8414717E5E880E865983EEC88 MMC
1,666,292,726 *AF5D91C3F10BF40A5826900DAF2D5AC5C08896E1 AKCEPTA
1,666,292,727 *AF50E20D650A7BF073C19D6F041EA9DE1BD6E4C8 akkto
1,666,292,728 *AF51ED9F7A4B6FC4E7786D0BE6F3251E698A446C ALBERTOMCELPRAUG
1,666,292,729 *AF580F85DD42C3D068B95C0E76609CFDCE29B057 albinelor
1,666,292,730 *AF562D29F5D2E0CB00EA2F85150F0388B26AAFA6 MOLLY1MICHAEL
1,666,292,731 *AF5FC7BE5A68FB6DF8BD979CC6F7E04D38076327 ROBIN.TAYLORFIRTH
1,666,292,732 *AF50541E6429C6CB18C7BB24F5B39D3A9133BC9D ROBSAGING
1,666,292,733 *AF5738AAF115A56D82E0CD77DB71389D58DFF30C monomark5
1,666,292,734 *AF57ABFBE00AE6A9EB9E5567E7FAB8CDC52148BF ALI.VALERIUS
1,666,292,735 *AF52664251ABCB19E3E096EF8C62652830B19FDA rodolfoo
1,666,292,736 *AF5EED2AA757FB60C68116F73D31DF08C5F5B376 RODSTENSETH
1,666,292,737 *AF552FFBE990BF51F41CFEAAC129105B148462F3 ALLEN.VARGO
1,666,292,738 *AF576B48463AD7A2E9402A5D05D48B2426A770DF rolfgerlock
1,666,292,739 *AF5314BB9B4694767839EFDE6CF34E5A3B5F4317 ROMANCHUCKBSW7
1,666,292,740 *AF597C02DB9D20A0DACB99FB53B3A680B1C935C5 ROMANS1619
1,666,292,741 *AF5C0AC513100C62786F5CD210E2CAA28CE708B0 ROMEO.CAPPONI
1,666,292,742 *AF50A73D3182402BD2CD97A6E0518178E25AA8D7 ROMEO.DORFMAN
1,666,292,743 *AF538FF37DF6D80260DE7FDE4FCA929AA9B052EF [email protected]
1,666,292,744 *AF5E03A85CC62D7E1648CF7FBF28F7571D4647A2 altenwoga
1,666,292,745 *AF5936D363A97195AE78559EBB095890D094AB0E altonpfeffer
1,666,292,746 *AF539CBA07322C50C82A8C6414DFD42E20A3590A ALU
1,666,292,747 *AF53F09B893D08401C4E59A6AF12FFFBA8B2BA46 multase0
1,666,292,748 *AF511C8A4F5093D82F16CB9DB56BDCCC42263523 [email protected]
1,666,292,749 *AF5D4EFFA17F4A30E5AA1DDFE895E278153E726F My-gentle-Marcius,-worthy-Caius,-and
1,666,292,750 *AF52CF92D0BC0EDF16880CC9410E931127BF503B [email protected]
1,666,292,751 *AF569428BFC0A06161FBA961D36688C16908FE01 RUEBENBROCINER
1,666,292,752 *AF5E4A2C60328516ABEE1BE39A5B3C64349D8EF0 russelfauls
1,666,292,753 *AF5D79E84B89CB950C6218C4814ACBDBBA86744E NAMAN BHASIN
1,666,292,754 *AF558855F2C94A0AF432D87305B0605AA347AC51 RWEINECKE
1,666,292,755 *AF542C9BED3B644EDE3AA4C6B7C1DAD5484CF380 NATALIE.CHANNING
1,666,292,756 *AF543B12B4806B7C2B9655239AB7AFFEA1AEEDED nathan269
1,666,292,757 *AF541EE57AF2AA52C8C5785D88B4755EB833AC78 sackeena6
1,666,292,758 *AF52822C6A20795D1392855E1CA3E2D76F511C46 SAJTOSKÁLHOZ
1,666,292,759 *AF552AF9C9B0D613289EEF0786D6B103790E98F4 SALMAAMOHAMED
1,666,292,760 *AF5A2D67FDA68B106A877CD51C5198C05A4B5424 ammeraal5
1,666,292,761 *AF5B0627A7A83AC9C963D439AE99C7F08AE525EF SAMANTHAMILLION5
1,666,292,762 *AF53E150E90045D636C65EAEAF6028123832FB1C NEREIURE
1,666,292,763 *AF50464E240CB4253AB2ACA06ADD37500D1C7798 SAMUALITALIANO
1,666,292,764 *AF5EA6AA9DDEA3468946A7BC1F6869BC51CEF6F5 SAMUELMALASPINA
1,666,292,765 *AF5B777887C08DDE98F4D278D4AB3F13E00D2716 samus-appearance-jingle
1,666,292,766 *AF5492FF60E95221B28626AB98D32DE8E6165F7D sandydoran
1,666,292,767 *AF55B5A0D448651F4086044FAD1D6052C8D47BF4 NGUYEN DAC DOAN
1,666,292,768 *AF5A82E6001DEDE804E92C693F7061883FC4E295 NIGELLOVINGGOOD
1,666,292,769 *AF51AC275039E636566C501AE4C60FC05984D4FA SCATOLOGICI2
1,666,292,770 *AF54FB4E604A7779BFA413F1B53EEBA6B94851DD SCHAAMACHTIGERS
1,666,292,771 *AF5B0F95A583A54B639265F1E6A76E6694057CE6 schutiae
1,666,292,772 *AF5EFC86CB420C64F26A3B4F2B0831B3FC5AF8D8 SCIUÉCHE
1,666,292,773 *AF50EEF0188E27FBF3459FC2156156FC87E25168 scoli0
1,666,292,774 *AF5607E625EF876874BABEE31598312B2D9D5BCB NOBLE.DUMPERT
1,666,292,775 *AF576803603A01717B7BA9DD135E12A1A06BB87D SCOTTANDOGLI3
1,666,292,776 *AF53F0F4CBD1AEFF3FAD414CE20B830D713CFD4C ANDRE.BARTUNEK
1,666,292,777 *AF5C7C92131910C7F9FC2C79DA2CBE69767D228C noeva
1,666,292,778 *AF5A4518667C0F7ABE8C748DDC7CD55C2E22B966 nonsulphurous9
1,666,292,779 *AF594C5BB6876B0C46A00828AFE606915AB8D972 ANGARÌA
1,666,292,780 *AF5F03C873BC147DEF0940C0D5D27361AAE67BFC ANGEL.MULINIX
1,666,292,781 *AF5EA55F792160CA2E81DA6B3645C9C22D3558E1 sednerts
1,666,292,782 *AF582DF5828566501C02A470B4913D30553FFF73 šelokhonov
1,666,292,783 *AF5FC1918F1F2215F7FD92552FCB4D7E64C90A6E NRABDOOW
1,666,292,784 *AF503B058ADED9D002D05A27398DE9C8AB3168AE ANTIPASTI
1,666,292,785 *AF5843AD2774ACBC9295B88E1B696A304F11FD2B antonnakamori
1,666,292,786 *AF52BA149E724A0C6516A15A256DA873D0F46C8E NZNA
1,666,292,787 *AF5113327B735140EB5C3444B6CB01DA502F3657 [email protected]
1,666,292,788 *AF54C6898C128FD6A3465A0A8A3FB766314074C4 SHACHARA8
1,666,292,789 *AF54082359909285A116132EB709E794BFD304E4 shannon-ponton
1,666,292,790 *AF54BC6E6F6D738DBE8A4244F1583DC9CE50AE96 [email protected]
1,666,292,791 *AF54093DD3A55172FCC5A2AE97631BE60C972A3B SHAW-IS-CAUGHT
1,666,292,792 *AF57509F53491D70E86903D200D0EA8C3036D7EB oestliches
1,666,292,793 *AF5D089667DB73EAE8EB53934F6C84C96BF76705 SHERBETEN0
1,666,292,794 *AF5F8BCE97713FCB32B4F94E04D3F437042875A9 OFFICIELT2
1,666,292,795 *AF5A2247EE4575E889A1CDEBB55CB63F65D7313A a[q]
1,666,292,796 *AF5CE22AF8E4229A42C7D66D2C18A68CE34FCBE5 OLDFIELD2007
1,666,292,797 *AF54E789863A0A526C76F1CA68CAF6C3607E4ABF shurlocke.
1,666,292,798 *AF501F68DCF97177D454498BB31873BC3B97D27A OnlyinItfortheMusic#2
1,666,292,799 *AF5F3FB779763420239647F3011EBE35BDD1F3A0 OPKASTNINGSFORNEMMELSERNE
1,666,292,800 *AF561C5712E0D560F9BE909055BD72F9F4B45F77 SITZTEILERS
1,666,292,801 *AF5DA37263870C80DA87C09E41131049624E816A or:u
1,666,292,802 *AF545925598BF0622F07273057200F8353E182EA ASA.PETER
1,666,292,803 *AF504C3A388BCC9E3FE913CC8B493D4B3A92D91F skinnytheresa
1,666,292,804 *AF5CBD60A6F16FB860C92C4B62B82B0E2067C56D ashraf.bhat
1,666,292,805 *AF5F3A4468E40DE4FE44A7379EC3E6686BEA7EC8 SLIGHTLYLESSSUNSHINE
1,666,292,806 *AF578186574926B5F2F281F21D7E916E56EFEFE0 smazonej4
1,666,292,807 *AF57E2CF43452AAC7BEDC78F7B6643E0D74B0C0F A:+T2
1,666,292,808 *AF56586E13F3A175C72E0B014387CCE371CDCA71 SNEBJESES1
1,666,292,809 *AF5E6368D9A866CE9C1E4E527A647E47F0116216 sneprahs5
1,666,292,810 *AF5B51B90C65539796241BBF24CD2A01AE2D2CAC OYKUO8ZPXW5
1,666,292,811 *AF5FF7BCE4D17CE6E42326D0CAC3F8C98F9AECF4 p===)`(>-<)
1,666,292,812 *AF5F16BA0CB2A2967E3D61B1D443181FDCF593C7 P##@~.`(~_^)
1,666,292,813 *AF58F2C1576AE30DC10F5A10747DA292E0CA64BA P#####@~0-~o(>_0)
1,666,292,814 *AF548912129137ED2BC185C5E06C5B1E4C56FFAA au_4s
1,666,292,815 *AF5A8D440D6DC4197D274624A8A1B65218658E42 solloughnan
1,666,292,816 *AF539FFFD71FD9C01210BA220068C4FAD949FBD2 PADUAMAN
1,666,292,817 *AF578CB1368808ADF623164BD1B7A7BAADE6ED1E auu=g
1,666,292,818 *AF53269EFED1CCACAA956EE7C7B21AE897AB93F4 AV+EM
1,666,292,819 *AF5656E0545247C14C8535AEB5C2846AFA51CA77 AVS1995
1,666,292,820 *AF56C56845D5D6E29D1FE298C85FFC34F9FF64D8 awayscan1
1,666,292,821 *AF504FB29DCC2A42727E05BD6E7B221CB957B43A awchf
1,666,292,822 *AF577FE7103232424FC510A617183A3733324D8E [PARENTSANDSQUASH]
1,666,292,823 *AF5A02BAE9BF46C69AD42BBE14C8E664FEFB1515 ay,t6
1,666,292,824 *AF53D283058A5C563BF6F5BF13EB1FA38D04AF40 azraaa
1,666,292,825 *AF5343E94EB9C5C1CCA3AE978F5D245E628721E6 PAUCART9
1,666,292,826 *AF573D099082F3601530B036D363D08112EFA4BF PB.*.*SPLAT
1,666,292,827 *AF51014C65B18D20FD63970D8DB7CBD2789B80A2 sposkiingboarding
1,666,292,828 *AF55B5612910EBA97BD3E338FBC926F9D369DEFA PD.~O.~o(00)
1,666,292,829 *AF508320DCACEF8A082B564E126FC791A32DAD49 sseealpsee
1,666,292,830 *AF58B416BB9D1AD059BAEC06E307435E7A912D86 B8$EI
1,666,292,831 *AF5D01F426B253E5B6C57F6E43B9C4C4C53C686C BADGER-BROCK
1,666,292,832 *AF53D0F480616F9C4A0B512E8B6C2DA31B2EC209 [email protected]
1,666,292,833 *AF5E30075BC9F4FC882F635CD1A18D3A54BAA29A phein
1,666,292,834 *AF505FF0DBEF14C265C9331DB4F548DC5CE4F283 BAMMIEKA
1,666,292,835 *AF5F5912B5C48A8E26C8F7D5F66BFDCF8F14B9B4 bang!music.......deathofacountry
1,666,292,836 *AF5461D987B1F37524A03B55881FF8B5A41CA36F sterlingdevenport
1,666,292,837 *AF505864C292455D6BC0EA4A68BC0DB2BF866D71 b(ax
1,666,292,838 *AF52AAC51F01DF42714CEEA70523D81603759686 stevenshuster
1,666,292,839 *AF58F9AEBEC6174DD63394F2479DDAFE5C6FA27D b!cen7enn!ally
1,666,292,840 *AF563D4B9EB32171B782F553F8B00BD0A4BB715C P====>**(O_-)
1,666,292,841 *AF50AC878E2E7EF774D11A83BBA204E82261FC2E podrzeczna
1,666,292,842 *AF5676A31388C71B14D6747667F33F542C9255F5 [email protected]
1,666,292,843 *AF5B825A19A601E457CAB95C5918F6DCC394CBBB BEATOMA
1,666,292,844 *AF5B0A98D89B3B901486203A8CF3BB382A04C0FB POWER.HAS.A.SHELF.LIFE
1,666,292,845 *AF56EEAE6E677A43BCA84BBEC53B7D527FEC51DB [email protected]
1,666,292,846 *AF5A58AAB99D22093782581D6C4B9C9DC91041BD [email protected]
1,666,292,847 *AF5952A89F45F575A93AE0E242773C31A13C7388 PR1DEFULNESS
1,666,292,848 *AF51CBB20BA6F8B87DCCC525168B1D41909DEA3F SUONIMIT6
1,666,292,849 *AF55778B13CE6F19404571F017F3CD5DF60BA100 BERT.DEPPE
1,666,292,850 *AF5D7E3AF83D7A6B35EC1C866226692D3504817C BERTRAMDOMINICI
1,666,292,851 *AF5DB5C80FCEB3EFCAC9CC196B83A965C1526F8C BETALAIN-LIKE
1,666,292,852 *AF5A3F62423B7F1C975A1C641FCE7DDC427C535F SV3V5MLWBJ
1,666,292,853 *AF535A03B0DB2869683E2386C51ACF2645D2DC55 BfK:
1,666,292,854 *AF551E830B9B327AE83CFE4315D069C5D46C9DA7 taacaaa
1,666,292,855 *AF5765DE867614CEB18973E1F96D8C6DC7FB5109 BIHEIVIORISTLIKUKS
1,666,292,856 *AF53FA9CEAF1CCC08688423A7D27937DCC782301 pv3ixuydg
1,666,292,857 *AF502272522B9F09B7F5E834F5721026CEC07AEE TANQUNETTE
1,666,292,858 *AF5C2BE1A26D2FD4BF0374C0B43F8518BB433036 TATTLINGLY2
1,666,292,859 *AF5F2E999E8DEDD72DD4AF37A1004727C9C54A14 QP~~:P
1,666,292,860 *AF58AD2B89E4194C6A477DCCDEA242E56FAFA6F1 BLGAJ
1,666,292,861 *AF59D5C33847907DA120DC5DCC61F0964DD07426 tebrevet
1,666,292,862 *AF518B3A25D7EEB0BFCDC358380282B7649B74D1 Bm?Z
1,666,292,863 *AF58C02C42FA64321464424F4BB48ECD2CD61972 boaf
1,666,292,864 *AF5EA4D1B7B4C8EC7720BF236FB4FAEE643F9CA9 radar-interference
1,666,292,865 *AF5425562473634138E2AC1288E7676386D56D92 RAGIRAS2
1,666,292,866 *AF56AAEAAE1756A84792BC3C5A07D60BB05FBBA2 BONNIEXXX7
1,666,292,867 *AF569C03AA7119A1276A639622F3236D0AC53ABF THANUJA MENDIS
1,666,292,868 *AF5B77697FF8CD3F10067D7AAAE3932E5FC0E0F1 THATLOLITA32
1,666,292,869 *AF59ECF3A6ED2381253701A91E9CA02BE0D77AED thelma.simon
1,666,292,870 *AF5992018F011B298EA3BD2D45882955B17DAC4E BQN&
1,666,292,871 *AF54DE9D5B9F423FC7F1EBF0D0EF0723D6186A35 brandenstraugter
1,666,292,872 *AF52ADBB95B8CF650C83EF9FBA30F83ECADE4258 TIATCELLOC6
1,666,292,873 *AF54C5F5EF16CC8F5D23E22172DA2CD2F1D01AF3 TIDSBESPARADE0
1,666,292,874 *AF5F2663BA1F58F2C29FA1100838631CDF68AD40 TIFONCHANHOM
1,666,292,875 *AF505BD9E3E38237F1653B42F358CDD5A9D9E3C3 BRENTBEVAN
1,666,292,876 *AF5A80907BADF21BECBB27EE4B842EAB9045D00A BRODISCH
1,666,292,877 *AF574C27D727A1C866107126A08EAF2791F03D73 RBALZEVIC
1,666,292,878 *AF5B64E2BA5B96A83FBCBF701ECBCF968507CD31 bronsdons
1,666,292,879 *AF563DA96CF7A31406A316C198B9787043F49F18 rebuznos-de-amor
1,666,292,880 *AF53A371E16E88F6B464E43EC0F5ECC8425623AB BRYANWISWALL
1,666,292,881 *AF5F0AE5C82C5024DEB376657B9B4200CC1CF868 TONADESING
1,666,292,882 *AF5380A73A9F8AF074398075470CE61F9830CF0F toneyriglos
1,666,292,883 *AF5171CD7259DA76962D7D7BE6637F81D9117315 bswchervenka
1,666,292,884 *AF5865A304235FC25255315A68D66412E202F4B8 REDURCHDACHT
1,666,292,885 *AF5ABA7D010918C74454F9EF4CE37606A139B501 TORYWILDERMAN
1,666,292,886 *AF5F0F19A85931345B88EA048BA451AC884FCD79 refusing not-taking
1,666,292,887 *AF58BD2A42B88B6B6655E396555FCE9005EA1DD3 REGIG1
1,666,292,888 *AF5F446371D9FAE6EB35037590CCCA454FE4C326 REINFLUERIONS6
1,666,292,889 *AF53634A08460EF108A08BCA8B622B31912C0112 REIZSTROMGERÄT
1,666,292,890 *AF54A23555C45EB89AC5C885F66FA94207E3E145 budremlin
1,666,292,891 *AF5FA9709889B67F7BFD4BBF6686B5B993E6D626 b.uhw
1,666,292,892 *AF5DDCE586E43E76AF7C5D87E6FAF2201E4AFF31 RENALDO.CRISLIP
1,666,292,893 *AF5BC07AAA09F51BE21880510907665262CC55F2 BUMBLER
1,666,292,894 *AF5A19EACB10C36D4C0C88435086743CF26E56F1 TREBORMARCEL3
1,666,292,895 *AF544E59251A20B3A32250A3BADB2161941C945F TREELIMBPRODUCTS.COMWWW
1,666,292,896 *AF536AC30158C5241EA6E8538A1B98EBD4A2FB33 TREVORBEACHY
1,666,292,897 *AF5604CD28284C69E6D26EDDA7104B0E6B615F66 TREVOR.GOSS
1,666,292,898 *AF5DB62F7E0137D32C73AB76D8137AAD3C80C32C [email protected]
1,666,292,899 *AF5D1AC740588785FC15D475580C1B2FFE5CD83B <TR><TDALIGN=LEFT>U:USER3<TDALIGN=CENTER>RW-
1,666,292,900 *AF5CF8CAAB83ECBEFFB3BCC78B0334C8BF4142B6 TRULYLUCK
1,666,292,901 *AF593DCFBBFDAF1014A106AC5950885FD36728C0 [email protected]
1,666,292,902 *AF51C4325E45781FA66C5667716E449909FBBDC5 reubenletourneau
1,666,292,903 *AF5AD09255B79E67F8586597A1AF0F47B4E9434E など)、TRYPTIC(
1,666,292,904 *AF57C6F057553A562946222C7C6A21DF3E5EC891 BXPQI
1,666,292,905 *AF5B8BCA1F49D705A8DA96370AD655C15772E414 TSTRAWZ2
1,666,292,906 *AF5629E02CDD8CCC09DDC35986433767974A7514 TSUBAKI.SANJURO
1,666,292,907 *AF5FA2AC20327F3B1BC962D4A2975A37BDBED8D7 RICHGEARIN
1,666,292,908 *AF55E2AB5A3C803C33CC70149DD9B7DE04BCBA68 ricosalvati
1,666,292,909 *AF593A3BFBF1D0BC4C45CCE859F4F2B7E0A283C8 ride the fader
1,666,292,910 *AF5A31499C796EE234E5CA6B5676BFD80B816ADA c?#1.
1,666,292,911 *AF539BFBB97EF50CD2A7BF25B84BE185CDCC2254 C1KJ7
1,666,292,912 *AF50CF32D3A172FF5E9F1626C96F360C2A1D4D62 C3U/T
1,666,292,913 *AF5B441F5736BDC6E147E7FE1C660208C048CCA3 ROBT.GLEGHORN
1,666,292,914 *AF538686720EC9D0104545AE120CBB9BCCAE052E C6IEM
1,666,292,915 *AF503E97FAD9A8BE667DF4AADECF62AFE9C9F07D UBARBIE3
1,666,292,916 *AF520AD94A858A5BC710FEC7ACB33F938DCBB9A1 c=a;d
1,666,292,917 *AF539E6BBF24C3565AF81C0F9AC947AEDBCC5CEA UGENSKAI
1,666,292,918 *AF5218F59838C9D25C470845BFF177141F493709 CANFALLS6
1,666,292,919 *AF5FD629A1E0806055F9D92F875E497800751A2B umivaju2
1,666,292,920 *AF584148B899A58B06658A705BE1F2403B2A67CD unclasp
1,666,292,921 *AF55D275B550B2C6BA5462096C998F57CB6543B3 carla-arvizu
1,666,292,922 *AF541897CEAC79FC2B3B17951F56DF0EF0F0802D CARL-NORDINE
1,666,292,923 *AF5AF29C936AD844DA19BBC672FCA8B0D9AF76DC UNGKU-FARID
1,666,292,924 *AF5BC4DFAD517F94BD74DB3634D44D5B173E361C carmeloyerty
1,666,292,925 *AF5BD12CDA0ACC02189FD963FA0F1BE200A6244F UNIMPRESSIVETUMBLRCOMUNIMPRESSIVE
1,666,292,926 *AF5EF3AAA76D3886E2694AB9F6A0E3743FDD634E CARMINEHAMONS
1,666,292,927 *AF570ECAAB0F22C1C77FEEF5F5478BCEE702D38F ROSSHAGEN
1,666,292,928 *AF5862D1140E24EF508CF977FBA3BF066A2131D4 [email protected]
1,666,292,929 *AF5A51B3FBB3F486830BE6625330B4DDE972073E [email protected]
1,666,292,930 *AF553860B120FB00FFD32B920F55FDF6C6AF3F32 UNMATTAA7
1,666,292,931 *AF579DE7CB9A3559B5A6590724F4225FCBBF9005 UNN
1,666,292,932 *AF59C88D316215A91054CF08306B0D4AE97DB840 RPDROKER2
1,666,292,933 *AF57B0B46BEA9D062CF6CEB734C8E5EEEB1D030C CASEYARENDT
1,666,292,934 *AF51AD26D47FEC834200AEAC0040DA850D21A910 RSTTMNT
1,666,292,935 *AF541554B8701EECAAEE9F92805A6667C35D195C [email protected]
1,666,292,936 *AF5CB91E9DAB73AA07C4298E1BA3CA5E698EE0AE C=BFM
1,666,292,937 *AF5938A5FCD59D02CAF2D3B04F5E277622604919 cbnwn
1,666,292,938 *AF59824467BA0738977216BB772C9A2E3955F39C cc47&
1,666,292,939 *AF564CA4EBDCFF2B3C11CAA33453A7A4B5925BEC cc8."
1,666,292,940 *AF564C3349ADB1DCF87EA8FEAD6571632EB07F6E [email protected]
1,666,292,941 *AF52CCE2D11F3E9A55BAF9BF61D55BC795CF2690 USERGEORGESALIBAGEO
1,666,292,942 *AF5DA2F83CC695D8EE4B735328B118895D2BBF8B S14620
1,666,292,943 *AF5B6DCE884E9AB3A6C913FDA34BDE474FE93A22 S3r4ls7
1,666,292,944 *AF5392271467726657E931904C593106B707F7E1 SA
1,666,292,945 *AF56E59663029E9473354941A3A6623EB7D630D2 sagwarum?
1,666,292,946 *AF574577642F2D50F5C3848BAA1E77A6D7B326B7 SAL.HAYHURST
1,666,292,947 *AF5E206A0EE5C7D7503788876B35C23C95CF7DAF CEREBRIC
1,666,292,948 *AF596898C05F0B4744741BBB4782CFFC301C276F SALVATOREKANISH
1,666,292,949 *AF5A51494874693E0C5D4E8DDEF0CF4BD9CF38DE SALVATORE.LARKAN
1,666,292,950 *AF5E9FD3E04CF0D19A094BC92AC7C1BD21F5EC2E samantha-hayde
1,666,292,951 *AF5ED87008430B54D9941C9A5A3667055966312D samoyed664
1,666,292,952 *AF5FC01F25FD0A22EFBCAE99E5D9B256BF819940 cf.8u
1,666,292,953 *AF526F318E161BA31E40AC14BD1C9B6FD23D6FEC valentinebowdry
1,666,292,954 *AF5211C87227CD7DE351B39331BC167B09FAEDAA valentinekoff
1,666,292,955 *AF566BE8C8F48653BD18FA233B6379E0088CADD8 VALENTINTEODORTAMAS
1,666,292,956 *AF57C622553B40F36E40D2DEA34B253F12B16173 ŠANDUNA
1,666,292,957 *AF5431A9BDB6F5E6D1ABA60FF6DB0FF408A2A9C3 sandykhamsyuorauon
1,666,292,958 *AF5B3557580C9C68D5490E5145D8A368CFDCF2FF C&G3Y
1,666,292,959 *AF518608B7BEE0DE587A6230E2F70015AFD6D524 chanceconable
1,666,292,960 *AF516E6B9CA3E772DC5A5D9EF3CE7D3F06FD8A2A [email protected]
1,666,292,961 *AF5E07C277D4AD71CFAD21D25B0FF2AC97A3DF38 VERFILMENDEN0
1,666,292,962 *AF5F01DDE7C2F57FA32F9B9361C2A97255F5195B SATANCIGS
1,666,292,963 *AF5A67B33C15D666E8AB2BA49B818F3A92CF7EB6 verna-mento
1,666,292,964 *AF59004F946AD03176AB1006EB54EA8CA0AE1238 [email protected]
1,666,292,965 *AF59E2849398BAC86DA5A99368A360DF69A1A341 CHB_L
1,666,292,966 *AF594A7C77A664E4189B27848570C188B49BF844 VIEWING』(ロングバージョン)を収録した
1,666,292,967 *AF581E33D4790FD2194EE69F6C525DB8C9F86719 VIKKI-VEGAS
1,666,292,968 *AF5CAF1C24B20280169F1B2DA97FE994A387E326 vimseted
1,666,292,969 *AF59AC24992C15201DD3128FCD5093B51E2F2026 vincent-orypel
1,666,292,970 *AF57E50AEE704320F47B9BBF2C12761159EFD33F VINCENTORYPEL
1,666,292,971 *AF53761C2D3D174A1B2E0A6FE13E0CB1ACCE73DC chitzell1
1,666,292,972 *AF5DCD3DF191037C563EB894EA47B6426A137A70 SEBASTIAN.MIECZNIKOWSKI
1,666,292,973 *AF58251A095214E5CD798F6CE4CCC50491A82640 SEBASTOPOLS3
1,666,292,974 *AF52872CCEA6A4ED52E650B1F0A66222AAFC7465 chloritemicaquartz
1,666,292,975 *AF5CA45F22F0C84B22E0303C8A0AB27D7CF414A1 SECIVED LEVEL-ELGNIS OT NOITATROPXE 223123
1,666,292,976 *AF51712AEA06556E4522B6DA7B559719EB5A3EE0 chŏnbuk
1,666,292,977 *AF56DCECE5E3800657860B47F3D441062A5A5173 C(HPE
1,666,292,978 *AF54A0A711D96F0BFF881FF0D2BDC90AC58F34AE chrisće
1,666,292,979 *AF54E6450CD10E7E87AB9AC9C1D94DF8B61B4BBB VITCHUE3
1,666,292,980 *AF5FED1B31B8382349616C4FB772069B4C2C9567 SEREILEBS
1,666,292,981 *AF564E53773BCC1766A284271054CCC0D86805A8 VON.MAHAPATRA
1,666,292,982 *AF5E7885E2F8F5B76B4DE76DBCBF4F745B0CDBBB vonmcwhorter
1,666,292,983 *AF5355C3347C698B934C764FFD0F031B2B09C6A4 SERIENGARNITUREN
1,666,292,984 *AF5276BB91F711434F73DC5219419AB2745F6E10 SEX7UP1E7S
1,666,292,985 *AF549B11BC7BC42D75E34AB0E6012AEBCBCB41F2 circleting7
1,666,292,986 *AF5B80ED56EF8308EE44EF76BFD1B1A379410C56 w11latw676
1,666,292,987 *AF53B444B77C40E80C201204DBF12CADA18C4DE3 W44GH31D
1,666,292,988 *AF51253724AFF3F77987894EB40094784E971968 WALDYSLAW1
1,666,292,989 *AF5C66F97996322007E9AA5D19F15F179BAA0E5E WALLYKIRCKOF
1,666,292,990 *AF5330AC91AD5C33DA97394007D63AFCA31D64E5 WANDA HOYT GRAHAM
1,666,292,991 *AF5E611E4BD7371046CE415F7774DA78A158A5FA [email protected]
1,666,292,992 *AF51E98192F597FB52C54295FA1ABD4E448E26ED CLAIRECARPENTIER
1,666,292,993 *AF57A02A9FD7D6437663E0FF331F9F1EF07DA049 WAPDARKEU123
1,666,292,994 *AF5D51F88CAD470EEA65C8EE4DC425C95353682E WAPPENSTEINEN
1,666,292,995 *AF598EC765F985F68F8BF0E507C4D294B96D54D2 CLAUSSOBY00
1,666,292,996 *AF5298FCDC46F2AC32C0B3C1B9C1054A0D8E1CDC CLAYTON607
1,666,292,997 *AF5535EAB60A2379248C30E1638FAE779E951FDA C&LFP
1,666,292,998 *AF5707E5BE5AA7213FFD2D693BDFC6C7D090324A [email protected]
1,666,292,999 *AF58627DC32863D0E5683D004A6AF33C8BF78BD1 [email protected]
1,666,293,000 *AF5CC732F569AA0A40D0C5509648B7F3A1012C29 [email protected]
1,666,293,001 *AF5A447F01B158FFE530C75EAF88746A6515D6BD wellpmedema
1,666,293,002 *AF5DE877A3E081AC8DDF0AB7FB84B3EE09FFF87E [email protected]
1,666,293,003 *AF58D1AE44550FF51672B320A52F709203B19C13 SHINKANSEN'S
1,666,293,004 *AF57B8B3BA14D059ED86F9EE77647E0E125A9E67 [email protected]
1,666,293,005 *AF5D9C7D97B6E29C3CD1E2E203AA47486CFC608A CLUBBIN'ONSUNSHINE(ABNEAREMIX)
1,666,293,006 *AF5FB17A6ACD61C800476F66874B86F809A361A3 cnky
1,666,293,007 *AF53BB78A4372E1A6173B631761A10E571772F5A CO49UL4+ES
1,666,293,008 *AF5F86BD1F0EF23A2343EF578AF78ABCCE705EF5 sidscheinost
1,666,293,009 *AF551013F6D79074A67FA35951C122BDDBCD0176 wildstalzion
1,666,293,010 *AF5D5E731CA4BD1DC9D4177C2140BCA4C2FCCD7D WILLIAMDICOLA
1,666,293,011 *AF5896327D6C1E7A85D402FD672CF7CFBF3664D3 WILLIAM.ROBICHAUD
1,666,293,012 *AF5969E55A2FE895D5C6ED4C80D2A8F4BDA0E5E7 COMMI$ER4TIVE
1,666,293,013 *AF5F1F34F9818B64BE0AF3FECCEE4E6EE10BFB63 confes69
1,666,293,014 *AF5E749A2633332BD7370726CCF49549290B57F2 witelites
1,666,293,015 *AF5745FB46B487C3FF298AACE103F2C7DCBE74EC WQB~
1,666,293,016 *AF58AE2E6B0D763BAD93F9E4AEDF1A9E50612532 SMUTNOE-VREMJA
1,666,293,017 *AF5F2332A8B4D46E538285DE4652808276CBB2A4 CORNELIUS.COLLOZO
1,666,293,018 *AF5E1DD1C50B4A72EBDA7E2E22CFE9DE30205A89 CORNELIUS.DIKES
1,666,293,019 *AF51F59032558C569A0386C0B790C6E4077A945D WWW.IGNATIUS.EDU
1,666,293,020 *AF589B591FBC08EC1704993C763EB8CC9A3D6B54 wwwmusikfestorg
1,666,293,021 *AF5E1EFF0A3592309E85AF679AE718C395A740BF Corroder
1,666,293,022 *AF5966501F534CF7038762340F113ADF36929C53 WWW.VOTECOLUMBIA.COM
1,666,293,023 *AF54F6586629D2570D81D9C615FEE8F0191C8D5F solonga3
1,666,293,024 *AF5B0FB8C3D2DDE8701506F63FB922F5A31022AD XIZ ZURYX
1,666,293,025 *AF5E15FFF386FF720E8E4A6EEC312C7324CC7942 SOMMEWHERE2
1,666,293,026 *AF5183073EF4FBFBD395B7657D15C33002A50693 }x{-~`@======p
1,666,293,027 *AF56204015F4E19D59DCC6AF5379171CE53A1B18 {X}~` ~`@######P
1,666,293,028 *AF5590FBE42EEC960FF29952FC2A522F36228FCE spanish-shuffle
1,666,293,029 *AF59ED8483FEFFC2FA14243E53C65B0583118065 CRIISTINAP
1,666,293,030 *AF59C7FEB65CAE09622F770C7960ED9ABB6B7FF3 cristina.ronquillo
1,666,293,031 *AF5270C881953B087B94BCF9735FC788C936C0AD spencersparlin
1,666,293,032 *AF54835F87561BE4D9E9D72B8FDFB1F4D13009A6 Splat0~<q
1,666,293,033 *AF5CA777C223638E4EB9500667C1036A3FC23731 csiurtsi9
1,666,293,034 *AF5E75FA15D8C9077B9F3C3F4F769EB5F857AD4C cu(=#
1,666,293,035 *AF5BDABF232BC5FE39537710767D462F2D93F4FA curtisgarcea
1,666,293,036 *AF5E54B2E6A18DCD9DD6C116963CF05D5DAA2DFB curtislundsten
1,666,293,037 *AF50F332B1BE77FB552EF1A60A0D1E8ECF0D82D8 curtisstavrou
1,666,293,038 *AF56D44861EE59A81FB84DAB6895CA8A15C2CE4F CVJU_
1,666,293,039 *AF53CD20B057A5CDFC2F5BD143B2B0D9F7346182 [email protected]
1,666,293,040 *AF5F688688A306EA972CAFBA33F49F0E4372102E SRAMOTNO7
1,666,293,041 *AF5F51E7B8A9E6F05E99386333D249E628D9E4F3 yyyy-01-20:albany,ny(indietabsnet)
1,666,293,042 *AF5D7EF466823C90C474897C5731ED4E0591D3F1 STEALSES1
1,666,293,043 *AF5BBF2CDA2B22E07E84881CCCAE34502B4F1F0D STEFAN.HUSH
1,666,293,044 *AF57364F6F843C3FC4F9DFD6310873FDA325F007 cxwpm
1,666,293,045 *AF55A911B74DAF94A6B688C7B9D2AA16DE0B523F c%yim
1,666,293,046 *AF554F8CAC3CED9F9A5DEDD621A85F77D612938C cyrusgeuder
1,666,293,047 *AF57EE65C9BA6A717B63D0D63680610C370A6284 STETZER5
1,666,293,048 *AF559C9B092D2BA4CB1EE250D1AC7A3C3CCFCCD0 d:}1
1,666,293,049 *AF5DF5F8719EFED5577BA207F4C756F95DD91E34 D1R^
1,666,293,050 *AF59773C199B4EFED2827454FA5C7392363257E9 [email protected]
1,666,293,051 *AF51012CFFB5F9F86508431C82B6A61CF07B4237 [email protected]
1,666,293,052 *AF5D2EFC64425B56B6729905E93DF83A84DF23FC D3J:-
1,666,293,053 *AF5A0E15B2B401491DDA74A926FD578C199E2EE3 D4+4+O
1,666,293,054 *AF51076C5FC90C8A3CB3E44AEB0546D256F4EE76 d%4qo
1,666,293,055 *AF5586700177AE8A2CE6B5A95174B9C5F53F5A6E [email protected]
1,666,293,056 *AF5D2DE373C7F77C17B4AB7D14B5D6116AAA2035 [email protected]
1,666,293,057 *AF5E19A9098C1F8D431E63CE5C36D405C194FDA6 d7.k/
1,666,293,058 *AF5696BFDE0050CA273FFCB8E29E6B450E1600DC suliscoukwww
1,666,293,059 *AF52FCED858C0C64ED80A883F0F7F3B6B243D07B D.8HF
1,666,293,060 *AF5ED39A00D5FADCE79813ABCB189639C9C8ABC8 ZOSB.ZONGOFSEBOBOOLINK
1,666,293,061 *AF58F8974672D898DCF8432DC717107CF0BC5B25 DAEIB
1,666,293,062 *AF58B406136A1785952A987ECC5090BF4744D35C zubaidah.mohd.ali
1,666,293,063 *AF5A8E07AA5135283D0B7A3ECEF7DFC8C8845704 [email protected]
1,666,293,064 *AF5AF5D52DA9AF98E90536150AB2D8AB6AB92428 DAKUTSEG4
1,666,293,065 *AF50E45307EFBF90A59DCA8AA29D027EF0DC72B4 SUYNGUS4
1,666,293,066 *AF5BD81C731B5650D71B03EF0626156BACE6F1D8 DANGTHINH
1,666,293,067 *AF5F523F222C093D0119CB734DD47C1B5DB4F2A5 svaporerai?
1,666,293,068 *AF56BD763469B9D38F4711FE517B834160640064 [email protected]
1,666,293,069 *AF53E024445BE266C9624420D439DB915F862041 T0485748602
1,666,293,070 *AF5672DD9C8534802A40E3E7360F7120FD039A1A T080GG4N!ST
1,666,293,071 *AF566B558F0A939DBE33EC80547684EECFD6E13F T7VM
1,666,293,072 *AF53C1467E3FB96F96179F1ABE12EBC60D27E0A1 tadficklin
1,666,293,073 *AF54A2CB9B69FF7BE9861766B423F4E51D19D4F8 darellleef
1,666,293,074 *AF55DD7EDCF430C0A00CB09348B9A4BC319B64BF гетьманськими
1,666,293,075 *AF501CD14E5AADABAC6C422E379A5A3C39F37B59 DATQM
1,666,293,076 *AF50831F1809D493F68BAFF50191A0209E84D8C9 dc0fu
1,666,293,077 *AF554F17DA4D94F7DEB412F6CB01FA86537C0F45 [email protected]
1,666,293,078 *AF5DD9272D84E9219B01C6AD326A5D81D2A1EA09 TCHERKEZIA
1,666,293,079 *AF5145C1B40829179FFDBC52038DBB7D5EA2AB94 deathshelby
1,666,293,080 *AF59B804A33F5776EACFC6F2DCF2EC88B881574E dedira
1,666,293,081 *AF5219C059C479A86352929A9A82A937DB84E6F3 [email protected]!ON5
1,666,293,082 *AF512B5136C836EE5BD8F5520A62C525EA00F788 [email protected]
1,666,293,083 *AF544E7C6ACFF916D33A3FBF755E99AFDFEC36CF TERRANCEDAVIA
1,666,293,084 *AF5AC0CC33B8C5D5BAA135E6EBFCB7D074534ACD terrelldecourley
1,666,293,085 *AF5EC417A098E3EC9EDF8238092500E0FA205E7F deluge&
1,666,293,086 *AF53FAC446CA141B9A674D41CCACD6989813718F THALAMI
1,666,293,087 *AF5B89D7372A73AB37CFD2D055466F878894A4DA THANKIS0
1,666,293,088 *AF592E50F4E9F2DA44A583ECC8B8D131DE3EBB09 derekappelgren
1,666,293,089 *AF59A3BCDEF3D3FA68F4582F49122221EC6B675C that's.exactly.what.i.mean
1,666,293,090 *AF5CCAF172720BA59F247A8D2C0450280A02A864 thatwendy16
1,666,293,091 *AF56C42A8A37D3A9F8350A348FBE2A4597E521E3 DERRICK-MADDEN
1,666,293,092 *AF5DF43DD288877E98D15155F4EFD8FC65B5F106 derylloh
1,666,293,093 *AF5B0E3F36D47B78A8DD09017AE439A04363C470 DESTITUEIS1234
1,666,293,094 *AF5AFB25336CA4608D376DA1B017FE690726D395 detagitimrevo
1,666,293,095 *AF58B4AC2C37D405D11D8EC978DDD84F94F5895D [email protected]
1,666,293,096 *AF551F507C46F8D09B00446535E0C9D86B81D343 TILINPTSKOKOUKSESSA1
1,666,293,097 *AF531944094C802701FFF1571DC5D7C41DE94A8D TIMARA RAPANA
1,666,293,098 *AF56BDA43E1E0A62A3D0F1FC584F9CB97DBE8F5B DGA6V
1,666,293,099 *AF57B1426107B56C2551E65846B9B939267B8EAF dgldw
1,666,293,100 *AF5BEF397B6A991F636145D1E8224DBC80E0DF9E dhelice2
1,666,293,101 *AF5891ADAECF8D726B9507565090FF46CFD583B7 dhjr
1,666,293,102 *AF518BA981FCB729C3A1080445057B280D5E1EDE dh/,r
1,666,293,103 *AF53189E0D3A69D3EBD80930DD1C37D960B8A2F2 TRACY.SCRIMPSHER
1,666,293,104 *AF5996267CDCFFC67C808ADB7DF81033A27839C3 TRACYVANFLEET
1,666,293,105 *AF5842F38BDA9F6AE91CD3231B9D3F6E56089367 TREKSESES
1,666,293,106 *AF59EAC93CD77FBDE0CA1CD11D4B5099E743CC2A TREVORTANON
1,666,293,107 *AF5BC7BEDD57605C023B69F7B7142544FD5F6C5E [email protected]
1,666,293,108 *AF5127CC0EB44D9B701CDFD793D3F6C373F7F0CF trio in c major for lute, violin, cello and continuo: i allegro
1,666,293,109 *AF528FCFC7864FBAFFEDCB02E174E1BCAA2EA655 trixiseeber
1,666,293,110 *AF5E1F4230BCC80D1FCE443D80400CCEDFD3D22A dmfzh
1,666,293,111 *AF55C91965C9D167E2817756067C06F7CA06B861 DNPT6
1,666,293,112 *AF5ACD4E3990C40382791871316B784ADA23570E TYRONEMALEH
1,666,293,113 *AF5D3F6BE02E39CB146E156CF13BB0FE67314184 TYRONE TAVAI
1,666,293,114 *AF52FE4A17A898C88240D45D39E76038E16C5FDF tysonleelynne
1,666,293,115 *AF52375C5C9F183ECAF50D4CB1DA202CB2D92588 domenicantolik
1,666,293,116 *AF532CBC4053B71041B19A962E58B488A8C15062 domenicstalma
1,666,293,117 *AF520280B87E9173C8DD8E8DA5D0D5EDA1E1324C ULTIMATED8
1,666,293,118 *AF590D428FC26CDF6217F8A7208ED4B4B192DC3F DONALDFREDERIC
1,666,293,119 *AF52AB72FBB8E5BB8D2E46989CA74BAF4D1BB9CB uninominalistico
1,666,293,120 *AF5D6558E2CE9E51B12279FC98DB31652A331812 UNTERMGALGEN
1,666,293,121 *AF5F634B0B1E06A2046B4F10B86F5B02165E1206 DONNY.HESSLER
1,666,293,122 *AF5F7A71EBFD083740622867DE3DA9B6F74EBEB7 UNWIRTSCHAFTSKOMMISSION
1,666,293,123 *AF51FC96D1DDEA5E9438892FD8282ACA0A8CC33C URTËSIS
1,666,293,124 *AF51EDAA9D6BC1926A1EC68377BF8233C33CB4C4 DOUGLASS.CARVER
1,666,293,125 *AF53D6418BD7D5A0A887C2A2132AFD968ABEBC57 URUSEIYATSURASTARSON(OP+EDOVA)
1,666,293,126 *AF559C031154AC8F6F7AFF9FD6D6C12CBE0BF75C dqkh
1,666,293,127 *AF5338A815C5280172F0F76A1DA8C47DA706D9FF 10.dopingfaellen
1,666,293,128 *AF500ABD35542EC2C0FB0D5CFF745C6EC81D2A71 VARANTM
1,666,293,129 *AF5374301ABD4CCA2C1A995D7C3AE8237D39F5BA VASILAKI-POPI
1,666,293,130 *AF5BF4F0A2929375049B57438D2DFB1E45C9DDF8 DRCKMDMS
1,666,293,131 *AF56579FB0A7052C71F7D181122439625861D456 drvvx
1,666,293,132 *AF5F6F73E97C97282C464FFEEDA06FAB484154AA [email protected]
1,666,293,133 *AF52AF7BC97913058EA2AC22D667C35155EFCCE8 vertobungstage
1,666,293,134 *AF5A9FB76ACC5ADA0534D0BD13656BDFB39490BD 12-03-1109
1,666,293,135 *AF57EF87B991255481CB7069D9CE17F6BF525AC0 victorllera
1,666,293,136 *AF5DACDF1D51C6D66241F57CAB0B9445DE319FA3 D%TTU
1,666,293,137 *AF52ECD6346DC4E855D773BE1CC101AEDCE37125 VINESHSADEKAR
1,666,293,138 *AF5B7518610005DB05F52F20B30BB402FAE1F3CB D?:UK
1,666,293,139 *AF5A49FE79482EB97258B4AEB0B6A1360CE6006F VONNA.TELE
1,666,293,140 *AF5E96431BACB52F98CA733755D09841B52C2269 VOORSNIJMES4
1,666,293,141 *AF5502EF1CFC8ACC689666AB3D1A1A2422310890 W\<
1,666,293,142 *AF53483640723FB1A31DBAA8F2F9C7FA835390A0 waffness
1,666,293,143 *AF50B1EFBD250A838C6E422B75FDB53EF6408B35 WALDO.MALLETTE
1,666,293,144 *AF5FC515239D911F6347DE214665F9B76846DA91 WALLACEKURNS
1,666,293,145 *AF50D5512FC2FCEF7A2C22933B9F8E60F148000F WALTER.CARBON
1,666,293,146 *AF5173B9780388B0645611B4508F7D88949D7B79 [email protected]
1,666,293,147 *AF5668336C1B6FABB7EFD9F00A92D77DFEC44B47 WARNERWINDSCHITL
1,666,293,148 *AF543F6C8F4603E21E70FB9030D395BE1228D435 WARSAWPNB
1,666,293,149 *AF5C26B95C1EB4F3F2972C9A7E8D11D5E259A561 1488233 MUD-FLATS-ARE-BEING-CREATED-.
1,666,293,150 *AF5955FABBFAAA06535B37A5F27CF6D5CB004723 [email protected]
1,666,293,151 *AF5FF1AA8BFB5F6D55D9055F35E55D63E32094CE we;
1,666,293,152 *AF59653F417A4918A48987E5C2A5C80C74DB26BA dvr03
1,666,293,153 *AF5E7139AEF863DB024FEC5BC999D5A352814FC0 dy6eu
1,666,293,154 *AF548AA78D8CDC9CA9FD70B8C901B5658D88FBFC 162AWD
1,666,293,155 *AF5B480AB3045964F54C14F53F1B98E7A9AE4584 WEGKIJKS
1,666,293,156 *AF5616148034B5FA66F9B65DE1EF7AFB54E2B940 d/$zn
1,666,293,157 *AF5340DBE2466932EEF2282A13809B16CA9F943F 1749971 the.singhs.have.no.children.,.curtis.said..
1,666,293,158 *AF54A70E38A73A17D41A4CE8D561959C6484CA9E 177668 genislik7.60mt.
1,666,293,159 *AF524B47C6D8808AEA522AEABBC4D5C4FFF59063 [email protected]
1,666,293,160 *AF5B9E243CC9674CA925AF84C77DA71461384643 1966年のnhk軽音楽オーディションに合格後、銀巴里デビュー(1990年閉店まで出演)。
1,666,293,161 *AF5FB6229612D296294CEA9C8C1954EF7531EF35 ÉDESDED
1,666,293,162 *AF590B73C2545DC5DCF81947615B811DD4C8FE4E [email protected]
1,666,293,163 *AF5EB37B545F308BEACB8C296420E07FC689A9B7 ednosal
1,666,293,164 *AF5F89290EA847C3722E7957889B501FFDEE82A1 edwinkirgan
1,666,293,165 *AF5544F85B8A20E6C1CD3A951CE9ED60012CA0FD EF5JC
1,666,293,166 *AF5D5850669199433304AC465C91AB1E71481AE8 EFT
1,666,293,167 *AF5307CDDBB72AF0B54E7F8CD13F005F69B870F6 1 DELFMANN
1,666,293,168 *AF58B5A5D6DA749908C9EA26A7E627CD018D43BA 1devaluationprone
1,666,293,169 *AF56D3648242B440DF59475D52D6D39AB39829D3 eh3h=
1,666,293,170 *AF51CBA24DD70210A3E857946F4166F7D495D5AD WILLY-WEIDE
1,666,293,171 *AF5F6F376F99E893BA432ECFADD04A379A863F6F EJKBATD48
1,666,293,172 *AF5017DC4E105A53586E570AE36322C128F90E73 eklegeuh7
1,666,293,173 *AF5A778EF18CA59A18E232036196D2B4E2A541AA wishes-tony
1,666,293,174 *AF572160FDDDEA48806126CC60EDE95302E555C5 ELASTICIZED3
1,666,293,175 *AF5619B6A8294D927906857B731183EB64C5F905 elijahburby
1,666,293,176 *AF5E16CC8A121C2C119E56F125F58312AF04C903 1IUSIKES
1,666,293,177 *AF5AA941B6CBF5AE302EBDB01AABD0973FB96162 elliotvalenciana
1,666,293,178 *AF56D0780132105C9FFAD9F1FE2F225B2F265223 1KINDERSCHAENDEREI
1,666,293,179 *AF5852F8BCD97B38C25FDE85DB923352524B976B 1-kipsisiteen
1,666,293,180 *AF52AEA2F40E4EE5D27E42B58CEA58C38AED18E3 elmofreemantle
1,666,293,181 *AF5EAA61BB0B26CCFE402EC4267C15789ED6FF42 elroyingran
1,666,293,182 *AF57F038A372A0C64E2062C2A9AC3518E936B12E eltonjastrebski
1,666,293,183 *AF5CC892C49855A48250393CD66A195B039703B2 WWW.ADMIT.CO.UK
1,666,293,184 *AF5D72DC1028468EFFE6F921AEF79F5A457DB6B4 em3q)
1,666,293,185 *AF5263FCE524CF19806DC9D1CFDEDC38C82D6906 1MAYA-FUNDSTAETTE
1,666,293,186 *AF5E0A7217AD8F8E227890B9A6609606A10E33CF wwwlakelawnmetairiecom
1,666,293,187 *AF567F442873269361D3C856C54AA5C62BC70C79 WWW.SILKSSOLICITORS.CO.UK
1,666,293,188 *AF56FD5DF2432BC6AF6AD77CB7AE3E313D4CFE48 WWWTROTTXORG
1,666,293,189 *AF5DA11BE42D571F2171E4848617448C3077CF9C [email protected]
1,666,293,190 *AF55B97A36CB4AB92ED326D51DD719355B339F6E wyattlawry
1,666,293,191 *AF55AA48E44900ED41FB7FF17A39230686817BE1 wyllie123
1,666,293,192 *AF5BF50F2D47C7C039097FB5856834AC77EB04F6 1ruchay
1,666,293,193 *AF5BA01688124AB4A812773896D4F28C4393F541 1-SIMSIRCI
1,666,293,194 *AF586DB3E4854CEEB16468448CB2F088D5D4B2D5 [email protected]
1,666,293,195 *AF5EBD435FFFB1440ED598F3D4EF60128196DB07 era.tempyou.kampou
1,666,293,196 *AF5899239721ECBD0C1358A70C3E2A6A20CF484F 1 TENTTIILMOITTAUTUMISMENETTELY
1,666,293,197 *AF5617463A90B8BFEF927E71DEE779D4A9D01643 xwroyse5
1,666,293,198 *AF5EE5A86CF7C897037E73FF7BD75F4DD7FABAAF ERICKBERMEL
1,666,293,199 *AF5BD1D9C78DADE09D70D97EBAB00C2E1902CACC YAMTCZIVR4
1,666,293,200 *AF5C785F0F2233F0C4D41BEAD71075F63EF84BDE ERJGU
1,666,293,201 *AF59274CD3205B3CB97F4B2D219ABAE626209A0E ERWIN.BALZOTTI
1,666,293,202 *AF5AB53337C76A98ECA6C9301A06DC811BD9E15F ERWIN.MEININGER
1,666,293,203 *AF55D8CE49C7FD5C055FDA3A1CA41B8261FE6090 esoldatcanadientombeaucombat
1,666,293,204 *AF54D4984810EEA4FD816648F228BF977C935575 20 termist
1,666,293,205 *AF5203A6131E4C0B993D2F92AA8C1AAD4E8364F5 eudy$
1,666,293,206 *AF52A374F96B3DB88478C46DA2F529DB2E589C85 EUGENIO.SARTORE
1,666,293,207 *AF57EEC88C968A19B7A4BFBD25E3E34CE4B32343 [email protected]
1,666,293,208 *AF5C23D8160D9B5AE53E046698276F82FC60C707 EUSEBIO.ZEILINGER
1,666,293,209 *AF53E5F1495833B282E8AFE04525EACEE010CC76 [email protected]
1,666,293,210 *AF50A8EFA27997D9AB8E1D2F924B27B7607C99AB EXTRAKTIONSMITTELSTROMS
1,666,293,211 *AF5E2E5E717A7955A872C10B0326B180B1FC53E7 F1yw3gh+$
1,666,293,212 *AF527FF5AC8E49748C3D7078C12FDAF0B8C06FBE 2507665 VALMISTAMME SASMETORIN KANSSA KUIVAUS- JA L
1,666,293,213 *AF5B8579E47EA8BFE9A88A7AC337EB0A73F1A3FC 2534444 ".ABER.DAS.KANN.NOCH.EIN.PAAR.JAHRE.DAUERN..."
1,666,293,214 *AF5C8B67C6FFEFB348DA86A63E9DE00723DF1D52 F4nt4syn9
1,666,293,215 *AF58EE15594B52215A8BDEDDABD7826A9781F765 YOUIFAL
1,666,293,216 *AF58AB004BA4603EE65805A2C1315879CB42EBEC you-keep-hanging-up-on-my-mind
1,666,293,217 *AF58BA2C748EABABC5B3055B4BD150553DF94F9C YUEL JO
1,666,293,218 *AF5465A2F6FFEF0145768E05AE30F81051188742 YUNGCLEVEY
1,666,293,219 *AF595EFB1AA818CED16C1DF2ECEBA04652AF876C FARID-ULLAH
1,666,293,220 *AF55D58060A361156EF13D0B27CC1D3A24336310 2665955 damalsgabeskeineidylle.
1,666,293,221 *AF5106F61D24B2DA7C60F71F2CA6F8ABB2098F32 ZACH.LAURENS
1,666,293,222 *AF5F0FDA0BF89ABF24110CD04278EB371BD78FC8 27-DieSteppe3
1,666,293,223 *AF58E13EE9A9A20B8596360E09A0A35FB23FE4A2 zahustte9
1,666,293,224 *AF502EDC86BDAE4BF716248D6BB79CF8AE543050 2AGGRAZIATE
1,666,293,225 *AF51122554CD7DB15F07ED1C5D10D21A5B445F21 2anzeigerredaktion
1,666,293,226 *AF5334B24C0EFD7CAC0EF38C00080CB40948AC70 2.ausstellungs-spiel-theater
1,666,293,227 *AF5E531314093CC3109571FD2BAAB53EB7399273 felixgurrieri
1,666,293,228 *AF5A9B457CDEE5487DC75A14D45DD19D2827CF12 feltontrennell
1,666,293,229 *AF500CD980F943732FCB5D9D14EA738F7D5A2B01 2-boddy
1,666,293,230 *AF5781617B6F8978B650A00D13393DFB4DCF0E1B zar.bautista
1,666,293,231 *AF57916D76EE5E6EDB9742EF280E8D78F3A9A5F4 ferreuxquincey
1,666,293,232 *AF5F7781CE85B7B323AF262E488D9A19F6F94816 2HEUNISES
1,666,293,233 *AF5F080D7EA9B6229B06AB1F3D990D187E65A8D2 zfe8rjyxyllell3gdcar
1,666,293,234 *AF5DA1DE9E1FDE32E8D5FFFD36674423BC95BA30 2JAN1794
1,666,293,235 *AF52DA056C75F01B3844BA223E9AA38FB42D8A81 [email protected]
1,666,293,236 *AF5D4C0AE2071EF2ABFFDB7886848C542F7CF691 [email protected]
1,666,293,237 *AF5C60EC914789CA00D9B8B67D3CBD5EC3EBF7B8 fishybacking
1,666,293,238 *AF5119D1AD9DE3C37F95DA4F1E56C3499D1103DD ZITHA MANCOBA
1,666,293,239 *AF55F2088D49AE62D827B822D10598A5D558724D 2THEBERTHA1
1,666,293,240 *AF55597A6A851C4158F55F57ABD80B5ECBCABB43 2.verotettuna
1,666,293,241 *AF5A4A262BD37E2969259E9F9A124D4B85A7F8D8 2-vetoaisasta
1,666,293,242 *AF575E753D7E0607A089E46FE47E2A43B54BD9BB [email protected]
1,666,293,243 *AF5310E6E6998EBCBC47621706D626D23AAA0893 FoQ
1,666,293,244 *AF54D384819D5A7C48DA8F16294860A08AF8FB6B 341KAYA
1,666,293,245 *AF569F7911F38D54E5BA69BB421E1880CFAD56D7 ΚΡΥΑΒΡΎΣΗ
1,666,293,246 *AF5F537E788536D05575E44AA95F419A8BDE546E астудилло
1,666,293,247 *AF5871BD2E719608FEF5EBF18636FDE1BB85D78B 3b<--*-*-*[email protected]====p
1,666,293,248 *AF50DEA200D125A9DB41CECC1CC6BA77C9DD04A6 FRAMBOZEBOOM8
1,666,293,249 *AF5DB552831009EC7CF0AA029E547A952DC5AB79 FRANKLIN.MCMANNUS
1,666,293,250 *AF54326E5CDD3DD6F3EFCD7508F05D5185A2F8A8 КАЙГОРОДОВ —
1,666,293,251 *AF5C05460084D97F346EEC8B60945A0DEBCBD31C каширці
1,666,293,252 *AF5731C3BF6CFB1C881B596E0A3081CB47BE318F 3P~ ~ ~}O{
1,666,293,253 *AF5F70972E7CCFD8C352181250B5C32AC759F731 FUELFLOW5
1,666,293,254 *AF56B10A1E77827AF5832E40B4F028D27B7538BC [email protected]
1,666,293,255 *AF582FBB4D25668EFB5473D83485E67637D57AD1 3X08!0L0G!S+
1,666,293,256 *AF5B47EE2991BD4EE997EDD0C071073A97D5D01C 40.monimuotoiseen
1,666,293,257 *AF54B1F9D01023153F2BBC825409380ED14805D6 419PIERRE
1,666,293,258 *AF5C33C94BD2DB95B64F009778E3FFB72F828656 GALELUTWIN
1,666,293,259 *AF5733431AB452B69EE80A532E7A7E0A495D8F0A 47nfepddbmgc
1,666,293,260 *AF51414FFB47EC2B40E4635BFCE4D8791D70C5A9 gangstarock
1,666,293,261 *AF5197C16A7DF6FC223E6314D383CA074FAC45F6 4gloated
1,666,293,262 *AF5C63369FB666BBEF30A170FED175B090D6D3B6 gempmums6
1,666,293,263 *AF5C0EC28806053673F72DEB1123ADB2F26C2F67 genevy13martha
1,666,293,264 *AF50EC6388DA556EF867F66DED7E2B9DF9379BC5 4PITUCAS
1,666,293,265 *AF50072062D39DC8574D665F5373141BD2219080 GERARDREW
1,666,293,266 *AF5D7763863390A0B6D9D61B79DBA6D042A04F2E 4SOLLETICASTE
1,666,293,267 *AF5DFCA1B0F335258DC1B218AF60E70F10B0D379 gerrycrehan
1,666,293,268 *AF55B5D394AD421A9DC02E5E336B708A916BA5C3 gervater
1,666,293,269 *AF54C55AE6AE62E44EE6A54B05CC3D57FEA80B8C GGESOVSKI
1,666,293,270 *AF575B3A63D3BF555067D5E4B9840C2C1AC85AE4 gilbertositosky
1,666,293,271 *AF566768AFCD5F99405E30F8899BB45964E36399 51ou9hin9
1,666,293,272 *AF5EB508E7D85903E6B74E4BEF85B5FF65B2CB05 gn?k
1,666,293,273 *AF59BA13B74A700797454205DB57F2219394DBA2 GONZALO.HEINL
1,666,293,274 *AF5514A8CBEA2B5631764458A53B77910FF8D168 5HCAMETAD
1,666,293,275 *AF5B438B4BE3310FDFE8A74B40AB1ABB1998F2EB GRADYVANSTRANDER
1,666,293,276 *AF5ADB9A083D2143DB8D36B98ED095336232EC6D [email protected]
1,666,293,277 *AF592D5B3D78CC97B568E29500A1D4CEB50AA9FD 5 MITTELSTADT
1,666,293,278 *AF57E6B2BC0EF9601B0A283BB62F9FB3482A8C72 オープンエアモール棟2f内
1,666,293,279 *AF51B7449BB3DAB0C96D444BF017C0646BC119AF 5POLEMIKY
1,666,293,280 *AF5E9DC266C051D396777AFB5274F30CA4CD5DAE grueled.
1,666,293,281 *AF574FE49D5325064D926ECC62591DAFA9C16949 5SSORKOB
1,666,293,282 *AF561EEC91E4D714AD161EF457E19E620226FD3E 赤坂actシアター)
1,666,293,283 *AF5A4BC09404E24498E03365B3A1EB16C5534BD4 [email protected]
1,666,293,284 *AF5C910BD61C5DDDD73977C0CEDB591047E0D47F GWENDOLYN937
1,666,293,285 *AF5F5D0FB6BE2F298612C47ECC965F97ABBFFF2F 63 L
1,666,293,286 *AF5FFEEA8680513A386C632BCBFED9215A36ABB9 6BROKLYN
1,666,293,287 *AF5BA134F179DF35F0FB1AFECE0DC1815F686878 HAMMERCLOTHED
1,666,293,288 *AF5C7C35F9FF5C4B602BB3580CFE3DEBA81E48DE 6GOOFFATATANGENT
1,666,293,289 *AF5CC0D473A558E1E2D99B306806206EE9C298B8 6-kivutonta
1,666,293,290 *AF529F29A380A6299773312077362377F454D15B 05.07.1645
1,666,293,291 *AF5BCE003701FDCB437D920B1FDA744634201C0C hartanto.kurniawan
1,666,293,292 *AF577EB526206129528E6F5432056D9BFBA7C61E 6ODIARTNE
1,666,293,293 *AF53C38C0B26EF0A0C4E7D25967529B9FCECAECF 6REGIRRIC
1,666,293,294 *AF5C9A70FA866274EE972AE84D43F7569EABCB59 harveymons
1,666,293,295 *AF53ADBF5FF100BE822AFB14BA9D0EC525ED2A18 0ILOVESAPHIRE3
1,666,293,296 *AF5149B852D892CD677FCA942C9713E40F5E6B78 [email protected]
1,666,293,297 *AF5698DCF46D7E18DE2A16EC7A3CC640B63E3045 6THATBERNARDO
1,666,293,298 *AF5B045848FCC62EBFFACF93340E33A83B109C38 102.lapping
1,666,293,299 *AF5A54B578943030A3477E461CD4A3D24201944A HCIRREPUS1
1,666,293,300 *AF5BE4C2B756F94402F05D62471ACE0F4A6366E5 [email protected]
1,666,293,301 *AF5ADFB47C770147EF4FF27FD70E12602B625BB2 74423 YONETIM-MADDE-10-
1,666,293,302 *AF56BE748F1A5EE5C54856D15F801E4446002EA6 1191304 HEWARNEDAGAINSTPOLITICALUNREST.
1,666,293,303 *AF5189C2F324C35C197671B1901D43DD3D6B4806 766874 TUTKIMUKSESSA.SELVITET
1,666,293,304 *AF53B6BD40308BCB71FCC3A357935CDA902C02EB 783291 dediGimdeOncedurakladI
1,666,293,305 *AF5C7C8F8B20B1C3631E8590BDA95206EAADA00A HERE2ENTERTAIN4U
1,666,293,306 *AF5DE216B53A6DCC7AD88E2B01420F55754465DA HICULANT6
1,666,293,307 *AF5905EC386E4464CF39804DDF4831EDDA8A6BD9 HILARIOPASH
1,666,293,308 *AF5B9CF75E0363B0041B44B717DC09675CB3CD7D HILPEYS3
1,666,293,309 *AF50EDD299529483B9203516840A581E712B7A92 7FISHERWELCOME
1,666,293,310 *AF54B76EC0A34A12572CEE38909AB6CDCCFBF0B0 1453921 petri vastaa curt sj
1,666,293,311 *AF5B6DF75B78DDE2688BABF51CFA2FB262418E6C 7HINAUSWARF
1,666,293,312 *AF57865CEEBB0CFE0F6922C4B9E00EE80F706F66 14921
1,666,293,313 *AF551EB4BC810A5E8D42674387378B8CCEF76C42 14.SEITSEM
1,666,293,314 *AF549C0835F1BA82B5B1117CB6061D94DB6E041C 7KAAHEGNI
1,666,293,315 *AF554A0DD8DCE8DEDBEBAE7D093AF7D1E845F0CA 7MARTYJOEY
1,666,293,316 *AF51E7F909EA39A56102A41E05005D552A874C3E 7NACHLAESSIGE
1,666,293,317 *AF51FE8D4AB1D001CDDCB27CA7D4E64BCB2A67C8 168911 a-blok-kat-:-11-no-:-1469-okmeydani-/-ist-.
1,666,293,318 *AF521C3D9A2C0C5E249D74DCBC0006699A8EB751 7PMCRIVER
1,666,293,319 *AF57FA02397BCE697027DDC34CB79C3E919CC8FF [email protected]
1,666,293,320 *AF5028B00F5109983C403B5FA8DB085F3CC1CDC2 7QUASIBABY
1,666,293,321 *AF51CC245CBDE16ACE6F13053475316025565933 17JUNE1582
1,666,293,322 *AF5234AFE8551076B79F273B60C8D514D152BA29 ht-i
1,666,293,323 *AF5AA926AEEDB9BCB9A3B59906DEFEB31E3047B3 ht$y
1,666,293,324 *AF51255134062746BD0336C2584170043A1D7232 19CYH64
1,666,293,325 *AF538FA74DD43C2DDFAE9A925CDA43FADA9B6A44 19mar1748
1,666,293,326 *AF57FB988F226EF1779A72423351DB3E83374656 882633 vuorossaovatcarl-johangottbergochtheaoinonen.
1,666,293,327 *AF53982D20EAE24FBD4CBF0BEE75E3891ABA0FA0 1 BRITISH-POSITION
1,666,293,328 *AF50D229D1229472E65036870A2CB51F88E9DB7B IANGIARC9
1,666,293,329 *AF583A5D3C3AEA68BA77998E55F8F626344A16F7 1 DIPLOMATEN-VORORT
1,666,293,330 *AF52D29B1D3608030BAC6AFDD1F2C8E316EDD37E 1.EIGENSCHAFTEN
1,666,293,331 *AF5BD880564A001DF9C8CB578989337184559681 1EISTEIP
1,666,293,332 *AF51C562C646B94CC6CA4D9C1C38E6D6690C4CEA 1EKOORBTS
1,666,293,333 *AF573C9AC8C9BCB67423984223B845C6B2537DF2 1-ERIKOISKALENTEREITA
1,666,293,334 *AF56F46C1820CC82D76B3557E8B69CFC42124196 [email protected]
1,666,293,335 *AF5FB041D71B7F6BE185B1A1FA30EE068EA95649 idillica7
1,666,293,336 *AF54CF4D601C4097C5FC72AAC2CD0212CAFB9B21 1FAHRTRICHTUNGSANZEIGE
1,666,293,337 *AF5E04515BFD9343AD61CE8E2BA8CA7C6FAB1A53 1FULLLLUF
1,666,293,338 *AF5EB1F88734440642366977077AF3195390759E IHILANI09
1,666,293,339 *AF5753C6FD8EA066BBD058CC966B330216C61D1B 8HALVRSPROGRAMMETS
1,666,293,340 *AF5025C4DA115D79E22E1DE4E2E6AB4700EB902E 1ILUVSOLEIL9
1,666,293,341 *AF50EAAE0B31DBA2AA3C49577F4322C581C0AF88 1.kennzeichensystems
1,666,293,342 *AF5C1A8F8642B72BE4FC08E993EFD88F498882E1 1-klarinettiseuran
1,666,293,343 *AF5FB0BE8CB639CDB80F0466345770A54165DD4B 8myhamlet7
1,666,293,344 *AF5BAC36C6E3E492EF6C94A75DCA3E071139F933 )8(O~(====Q
1,666,293,345 *AF5782ECF04F6BFDD74A5300B85381814A13022E [email protected]
1,666,293,346 *AF52F87615B1A12B764CD87BE664A2D35BDDB74B 1OVERAROUSES
1,666,293,347 *AF53B18C13EC6D94030578F50F64F96B91D920D6 impalaronald
1,666,293,348 *AF59B7B8FDB91FD773279C4B32F6F488D1683106 1rollenklischees
1,666,293,349 *AF5CCF24150FD567DDAC1ABBF0300B670F0D0531 923917 unwillige.wuerden.von.kommandeuren.getoetet..
1,666,293,350 *AF572C2E4225B7E21C2A4B7921C7819FDA4B9549 INCESTES9
1,666,293,351 *AF55D8C02D6F7581D4DA3BF654FDBCBA076C703F 1SEMIEFFI
1,666,293,352 *AF5001571B77266A429C37AB86A6EDD46CC5834B infračerveným
1,666,293,353 *AF504F673FA3136B439E114C8CFF3B745683589E 9CHIKAYAM
1,666,293,354 *AF5FA05CB7E2A01BC3933B9EE0962BE60D894685 1 temizlenmemisse
1,666,293,355 *AF511C55E74F92F43192A423A2988336217D54D4 [email protected]
1,666,293,356 *AF598D65EE8D1AEEB1D7228B188C9471ACC201D5 9ELWOODRASCAL
1,666,293,357 *AF5E96C348A88EE9C62356EC6A8E2B2D1392E0FD [email protected]
1,666,293,358 *AF54F524D2D1ADC2FDFCA1DB0D6FE8EAADB77F24 1ufaklamotte
1,666,293,359 *AF5627779998A99B5A15004017E29A7F2A4B2DAA 9getokkeld
1,666,293,360 *AF5FCFBF61CAC0C046AAB727E9ACF6720E3DA0CC 1.WEB-TECHNOLOGIEN
1,666,293,361 *AF51A2E222748C940C629024E14AC0E06B6E8D8A ipxpress4
1,666,293,362 *AF5D1269609561E2B9AAA328B4C5AFB51A4F171E ironmouse84
1,666,293,363 *AF54B464145EB15783E461BDDC71544DA4CC1209 9OREGELBUNDET
1,666,293,364 *AF54CA885DAEC965D21C6656985A0112EA76AC34 9OVERHEADPROJEKTORTH
1,666,293,365 *AF5B3618A94E25F9A6FB7970EA912EE416307C8E 9PONENDOCI
1,666,293,366 *AF54CF08E3CD380FE0910E012832A192715C8307 isidrobroekemeier
1,666,293,367 *AF5B76A14A3A936A3AB6BE1E5D2FFD462317AC77 ISOESA
1,666,293,368 *AF5FED536D2A36E43D9E969E5D75B8D1BCCE4918 9SCRTEURS
1,666,293,369 *AF5C63E8716143EE938B42A6738C245020D45AF6 2105171 N
1,666,293,370 *AF5B2113F8126EA9B3E32E1F04B7AF1EC722505B ItsBeeaLong,LongTime
1,666,293,371 *AF560CDF767F5397B5F87C13F8866BB232F842EF IUNGUNT6
1,666,293,372 *AF5154A04D2FA9DDDD7A0B11AC7F024623666726 2365316 TAUSENDE-VON-BETRIEBEN-SEIEN-GEFAEHRDET-
1,666,293,373 *AF531B95D7C4C0FD6F236C19E0A827096884DD61 2401838 YAMAHAN-HALUSIN-,-KOSKA-SE-P
1,666,293,374 *AF56B7D14794699BF27A85178FCF48ACAEF78708 2534078 MATEMAATTISLUONNONTIETEELLINEN OPETUS RY YHDESS
1,666,293,375 *AF5416303BD78667271AA4ECA9E2F24CB55C2872 jachtterreinen6
1,666,293,376 *AF5DAAB3B59F16B9758F78CFC1610F2F9D1F5C34 a/1fh
1,666,293,377 *AF52366852CD9A8A37F689CFE74F04E926E2AF66 2857541 SAMALLALUODAANRYHM
1,666,293,378 *AF550E93B8E1553A0FF973A5B15A5F1DF7049E76 [email protected]
1,666,293,379 *AF5213EC58771DF6B7E0F7FCA73EA14EF189FC58 2964538 ".HE.TELLS.US.NOT.TO.WASTE.THINGS..
1,666,293,380 *AF59689E2F1AF9F8B033BF1AB66E6466D8A2E0BD 2-az
1,666,293,381 *AF51BDFE23ACD6C5DDCC1CCE2C7580DBC8091DBA 2 COCKERILL-CHEF
1,666,293,382 *AF5317E8F441B161635CA12F6E95E6283BC98025 2crywolf
1,666,293,383 *AF50F73D198E3A0BEFA1243AB951F84B44648D88 JAMES-ROCKE
1,666,293,384 *AF573137CFDC45048BDBE5E2DA45ED3B954B9D81 a5$#d
1,666,293,385 *AF5A8A4C1C62FCA62DF5F3FD3503B388EC04C6F0 a5hc_
1,666,293,386 *AF53DD97716FF5BD177813B02994987385DCCED3 2 GAINSTAX
1,666,293,387 *AF58A69FFA952AF8451EF9FFDB54D5C0F9708908 2JAN1794
1,666,293,388 *AF59333CB213D3576F4E686F7BCC05D811FCF07F aab(/
1,666,293,389 *AF5B203C12B837755947F9A8D56F4FF95B68F9D6 JEANJACQUESGALLARD
1,666,293,390 *AF5C63FE42F06B6AE0A1984009F58F9525477E9C JEFFERSONMCANDREW
1,666,293,391 *AF5C58B07DE712FE9593C50BE44230EC4C5E9AC7 3######) * * >B0
1,666,293,392 *AF53DFC3353419B47CE4F80BB712DF16FAA0273C 3-fischereiforschung
1,666,293,393 *AF55E0E2CF881879C205D6A10E636F7F9F84E4FA JERE.PELES
1,666,293,394 *AF5483AE44594BB2ADBACA39EE9AAEABDFD1E5C0 JESSICA.MELGER
1,666,293,395 *AF55BF65B533E17E5E2EB49496D47DDB91BBBC63 abelgriego
1,666,293,396 *AF568986051808EEC2347FA4307B199DC13E892A JEWEL.GARTENMAYER
1,666,293,397 *AF51B04D1BA591FEA1BABB97209382B8EFA6CCF8 jh!%
1,666,293,398 *AF5ECD51567AF186459BE3AF8C42FBFC0359C2F6 3P~ ~ ~}O{
1,666,293,399 *AF535134728683BC18F886D5EF7932887BCCF33C ABRAMBENJE
1,666,293,400 *AF594C14A98A921DEBB7D3C3726367AE322052FF ABRAMKAWASHIMA
1,666,293,401 *AF5EECB2017867890F90FD1292B488D3CED033AA abw;
1,666,293,402 *AF562B229EE80A1626D3FBC4749AA194B90F3701 496029 BAKANLARKURULU'NDA BU KONU UZERINDE NE GECTI ?
1,666,293,403 *AF5210599AB32F7D67B0550C170A93D5F4F09FB9 4AFILIARE
1,666,293,404 *AF5EDDDF6BEAB657B949A90A86EAAFE1A9D56D00 acl-5
1,666,293,405 *AF5A99A76713E6B2ECA50E655E40004CB2CCC6F8 acvvd
1,666,293,406 *AF5FAF3BF5DA277A4BF1ED51D725EACD9ABF74FF [email protected]
1,666,293,407 *AF5154128030EA058F6CF23C9F07DE2349309E37 adab
1,666,293,408 *AF5CC0B46A04198E95A2ECF5F1DA14B279A89382 [email protected]
1,666,293,409 *AF52CFE644E7B4936A6AD423C65D95092D56433D 4KROMIRANO
1,666,293,410 *AF59681943965B84936D065309F8C36F51912F14 adnk_
1,666,293,411 *AF526A8948323EB4F2BF576D4AE09C3ADD56110B 4POROISTA
1,666,293,412 *AF5DF37E9947E04EB109362F92956FD5AA709615 JOHNIE.SLOVER
1,666,293,413 *AF550C3BA1CF7F4D97199E3C748F8EF7D4398F30 4SRUR
1,666,293,414 *AF5BE4EC4EE78CCAB4F46162ED4FC18EDE7CB59A af7f3
1,666,293,415 *AF57BC695BF624A5AC61A44A50336D1A8126F034 jonathonmckenty
1,666,293,416 *AF5637EBC89863C1ADE9A80D6B826F3203E8712B AF%YF
1,666,293,417 *AF54A163A10970327D2A5E87F4F5C04C436EBAEF 516270 bu durum 1979 yilinda da surmustur .
1,666,293,418 *AF5986CD64DEA14D71498901FE8B7BD66BEBD1BA agmgh
1,666,293,419 *AF54E9BE0A9B6E088136F99DF831A7814E00F1F4 AGP3:
1,666,293,420 *AF5C7A292D371B0D722BFD83B6765CF3DE8F9003 596justice
1,666,293,421 *AF5E620B1395494FF38450BA647FAABF9313F519 [email protected]
1,666,293,422 *AF5F889CC81770C60CF9E2C995189020177BF2FE 5ARRAIGUEN
1,666,293,423 *AF5A1E9445D9014C2EE013B0490CDC8421F94901 JPEGKOMMENTAR
1,666,293,424 *AF53C19FBFCB38021C0877BB20A718B53FE6DC84 5BSWASSGINED
1,666,293,425 *AF511554204EB9B5FB016F964E2DA5343BDB8811 5BSWTVGALIBBSW
1,666,293,426 *AF5F35CB3215818579C1609FC9AB3704B3B77044 5DTENDIT
1,666,293,427 *AF5C7A32E7C5610D43BC744F69ED076D443ACBF8 ajbl+
1,666,293,428 *AF53C8BE2A2DB9D30B2B27F2EDE91BC501630292 ak(%(
1,666,293,429 *AF5DF3F08F6B8FB9C6BAF45695A83663B22BE522 j-:u
1,666,293,430 *AF537C8CE50FB431511BD3CCB55B5716D62F64FD 5IMPLEVERINTQUE
1,666,293,431 *AF5C16F17572431E867F530DFE610F8F29726EB9 5ISHTAILS
1,666,293,432 *AF58B62E6DB57F04F3784B691E2F6F64D9F87532 [email protected]
1,666,293,433 *AF573258BAC8E8685320A41CB6290E5488F4F38D 5KOLLEKTIVISERINGENS
1,666,293,434 *AF5E2B4A22F7D345B128E979740B4A1FC08EADEB JUNIORNOSWORTHY
1,666,293,435 *AF53FABAC2DE367F2AECAF2F2357FA5178AB36EB JUSTIN-HOWELL
1,666,293,436 *AF54F9DD70BCD04BEB5A175E84BB85B9EDBA1B7B 5LIBRARYSASHA
1,666,293,437 *AF566EC391F104D0951430A638FF6F7887D29C9A ALBERTOSCHAMING
1,666,293,438 *AF5B7199E824DDC03FC9DF30659A4FF36D8EF8C2 jynxjynx4
1,666,293,439 *AF510748D4392A4BBABC144B83E6C37E110E34F0 5ONVERDRAAGSAAMHEID
1,666,293,440 *AF5DADD23BBB4758737CBE63072EC40E50AC4CF0 alexmaves
1,666,293,441 *AF526DC50B567BD417ABB50B94CF2BDAF32EE0EA ALFONSOLENZA
1,666,293,442 *AF5AE73E75A69C6A7771D7A040349E460D763670 kajano
1,666,293,443 *AF598A8718B71A65176AFC0B2371FA9464E6F0F1 ALFREDO.KOSTYLA
1,666,293,444 *AF599E72AD1B005A77908DF8AEEF1285DAC01EC3 5RECKUSES
1,666,293,445 *AF5044FCA2A3DE9EE8AE1520003F54B2309011B7 KAMORA640
1,666,293,446 *AF56761A3962A9A38D10BE4E7CD9DA466E93E82F aliaqa
1,666,293,447 *AF576B8DA04D99641C49B808E956AA62A141B391 alimirza
1,666,293,448 *AF520F3ABA4283D78ED2FFA33F1F9C1BCE33E3DA 5STUARTCHAMPION
1,666,293,449 *AF5326D787EA2F73CA08E4E64C7306A95CED4998 allenerete0
1,666,293,450 *AF591E1C874F120FE67F9C6A7E3EB012B556F4E1 almaaraujo
1,666,293,451 *AF5D05C9004E6CBDE5D80D6E40EE20C3A17C656D ALT="CHEF'S
1,666,293,452 *AF50CA44F3EEC3DA6414408643046230F0347049 618805 I-KNOW-YOU-CAN--"
1,666,293,453 *AF5953C1EC13BE97A06B05348D3274F21BE708C6 ALU
1,666,293,454 *AF553938379A6FD2ABBA7E9E00B02E747245D16F KENETHKLEAR
1,666,293,455 *AF5FCDD1866EF2BFA8921D7E158D6B22CD9141A1 KENNETH.HANCHER
1,666,293,456 *AF5AD938C164BE99324C3ED436563A9266F3A8DC KEN.WANN
1,666,293,457 *AF599F9E2C7C91B45CD3E1BFE371AAB5C7BED201 66MATIAS
1,666,293,458 *AF534ED05E9D2CB6B39BE2036AB0DBA4A0D3D546 Amenagiez
1,666,293,459 *AF59F96AB02C33904A1968231EBB844821569793 KINKINCOI
1,666,293,460 *AF57576DBFBE0129F6793862D7CE04C9B28F75E8 amw(d
1,666,293,461 *AF5F5A887977B6C2EDBC8060DF6AB0AB8E29CCA7 6deprechero
1,666,293,462 *AF553CB6473B03533BE2D4BBFA779B81FF680F1F 6ETTIGTER
1,666,293,463 *AF503D80EF5644278CA4C46E2616FBF2E339DB86 anb2m
1,666,293,464 *AF5EFA2E54F3F8771B923B46E6B6D58FFD50A412 anehf
1,666,293,465 *AF53465E26EFF0AB443A4A9773B9B61B0424CAD1 kostival2
1,666,293,466 *AF58B7F89B995BEEAE8B82EFA3F3AE8DFBC11074 krystjon
1,666,293,467 *AF5E55C0136213AF3B4B48AD6CD3A8411C465C56 KURTSTERNISHA
1,666,293,468 *AF5B7687CC39E403F96D3CC3A89969AF30E02E6D [email protected]
1,666,293,469 *AF5D948EA0C3061FF7AED054A2862CA4325A75E0 annacquamento
1,666,293,470 *AF5C104BD68D3C3739429DE623A59590AA163E0D ANRELBAIED
1,666,293,471 *AF5E31B0EE34D987228C4BD3FF5339D9354657D5 a/ns
1,666,293,472 *AF5C77B40A066228808A77C0377525691F4765C2 ANTAARNS0
1,666,293,473 *AF51B8191238CC0A040127B2C7E0BC065E7DD0BC antenados7
1,666,293,474 *AF5F05EA482D1EB8E2073C5A41685DCE4C54C5F7 ANTHONYAUGUSTUS
1,666,293,475 *AF518A3387370B972CE11819C2E321074EE93BFA LAISSEZFAIRE
1,666,293,476 *AF5B6A042731AF7B765DE2F37EAE814C6BE87CF7 lampeggio8
1,666,293,477 *AF57755C5C92AFB74706EC27180559F83F453378 A_OEC
1,666,293,478 *AF5771E9FC780CCFBB3E54CEB69B2971C50F49C3 larry-ruch
1,666,293,479 *AF57B02990C7EDECBC06E4C73421F0D1B2178C7F APCSY
1,666,293,480 *AF578482C2D7665D0C40DB50681A08EFDEC3141E 741ZXCV
1,666,293,481 *AF5DEF1F50B26B02833E5AF9A9DE85B0E0C54FDF LAXMI NARAIN CHAWLA
1,666,293,482 *AF54AB31BB3FCC907151CB20BEE0F93ED87DC55E lazarospeich
1,666,293,483 *AF514B2EEDF3E17305C8E3373731AF76C1FF5403 A-.Q1
1,666,293,484 *AF53C1F8E182DE24F41A11B61EBBDF35E891DC85 leere1
1,666,293,485 *AF5ED74F8FFAB33D597803630510DCBC9B50DE22 7AFRAIDBELIEVEBRING
1,666,293,486 *AF5047E9731A813EDE281AB42B08510186CB06F7 LEIGH-GORDON
1,666,293,487 *AF5AFAE7A374741722C242500ECD6B33276B76C8 ARHB
1,666,293,488 *AF592B018BDCADC06E2A2521A33EF4CFC73099F8 7ELUURTJE
1,666,293,489 *AF5BFA10D02F1DAC2D531EC8B7192C436D0DD0D4 AROVITO
1,666,293,490 *AF5AA4F6EC16050A402D49A55182C579714354C2 ARTICLE1140061
1,666,293,491 *AF51AF50F6E55154123CDB1C3C19507311616D18 7KJTTMEISE
1,666,293,492 *AF5F6AE5EF218E3F05CB92BE959ACCA93AEEEDF7 aruba!
1,666,293,493 *AF54E8D7BB2F0F3875136314285E5A9E028005BE 7NIHSOBIK
1,666,293,494 *AF5FD56BA60B34137EEA862428A7A68A67C848FF LEROY.LAIBEN
1,666,293,495 *AF59EED1CAFFCF297EECC1E2E880E3D5BC489B50 ashley-gormley
1,666,293,496 *AF52B967E025BCA4F0A7B3023FC9FA0AEFDB06B6 as.long.as.it's.you
1,666,293,497 *AF53CAD733644E775F0E2D70727A87AA9E12EEA4 7THATENTERPRISE
1,666,293,498 *AF5D96BF64681426CDAAFB0C90BFF6C24362CDAB (>-<)~`.(==8
1,666,293,499 *AF56F0E6D2F2B2E81DC8AC32B9E0C5E5C49300C0 [email protected]~0 ~o >B0
1,666,293,500 *AF53BA8B531AD8FB331911573AF2CF3A91F3DEFC linda.wing
1,666,293,501 *AF514E39B6344B1CC8138A9D08F533FA4907F1B0 aulru
1,666,293,502 *AF53FF0474071C829704FCF5B60C9C9F076B2084 8BSWELIVBSW
1,666,293,503 *AF50B2BACF6B6C43C05579D30C92D595702F1BB2 autorenauthentizität
1,666,293,504 *AF552EA683A62B4EE991722DA7F41CD32218AD76 av?$9
1,666,293,505 *AF5B91BA138A7236FEB936128026A8EC81C354CD 8 daco
1,666,293,506 *AF541D99288D8D31363F8F71CBDF865FFBC098BC lizapapa
1,666,293,507 *AF50AA704A8B72E4C8FF862A1096B2D320F62273 8======D~-~SPLAT!!
1,666,293,508 *AF5E74B9CB1D6910D4936C3A6D09352B36B16D97 AVORTIMIED
1,666,293,509 *AF5EBDA76766DCF5B25A608B3E404956160ABE0F aw?4e
1,666,293,510 *AF5D33A2310392401FA7DA85BD2C926D17ABF22C a.whyit'sfree
1,666,293,511 *AF5B67152F4E48AEB335E6EE03FE9369A0402456 ay,8-
1,666,293,512 *AF54EA617E08870B9E406A45C16B0F281069047B AYANDUR1
1,666,293,513 *AF5B7D4EE1A14482EFD636BF8AB752D84580C1F2 aymu2
1,666,293,514 *AF5DBF090F50321CFE7C6CF16B200A42256EC69B AZMBS
1,666,293,515 *AF553AEC0A7BD2330285FFEDF9A7F90AB59C366E [email protected]
1,666,293,516 *AF51789ECABB24A55D99F1FF1BD0C708BBA1EFE2 8RAIDERCLASSROO
1,666,293,517 *AF503188CF1A0624EC188452895B68C0876CE6B4 LOST&FOUND(FEATPACIFIC)
1,666,293,518 *AF5D04E81326F01AF4C66C80E933D07CBF1B49EE 8SLUPMIZN
1,666,293,519 *AF5D61496434705116CDEF74D44F8E21DB09E95C B4GE8
1,666,293,520 *AF53E12C5A5030D86A859CF809BD2EF08F197BA6 LUAN-LU
1,666,293,521 *AF5F5C1115344D96EE0F96C62C804F90E0B19865 lucienlanfair
1,666,293,522 *AF5864D929A73D871C99D353A71543AE5A0B1DDA LUCIFER-(KOMPUTER-REMIX)
1,666,293,523 *AF5082C396CCD6942907854D6AEE9FF9B611CC74 LUCIO.CADER
1,666,293,524 *AF52CBD544FF5D519A04CC02A642A6948A50323D LUCIUS.LITZ
1,666,293,525 *AF518AC161816508502C647DE5E2447193C8B0F3 B8G4Q
1,666,293,526 *AF50398806C0E60D31BABCFC0B26E2A531C0FC60 b96if
1,666,293,527 *AF54666BB1819E14CAB6434CB2F33BA88388EA21 BALVANIMA7
1,666,293,528 *AF55F213AF870CDAE2C27C8814D8588B60949C46 BARANNIKOV123
1,666,293,529 *AF53A80FD71FFF507891D4944727F7C271F33B5A madalinaconstantinescu
1,666,293,530 *AF532D5C8F89DAD1E3183E26A977972F9619FFC3 9connect9
1,666,293,531 *AF5E215E3EE128E021C5EED87B36AB1073B0D256 MAH KAH NU DOH
1,666,293,532 *AF5152F98860AABC2DAC0289E41DF29DECF40AEA malcommode0
1,666,293,533 *AF50F0767ECD7AB13D6A2EBABFBA46B8CD3F5C8F [email protected]
1,666,293,534 *AF5A797A87BCFC402D33EAC78529F323F07C467B [email protected]
1,666,293,535 *AF551EEA4BDD57B45C0A89C6628F55901616842E 9KARENWESTERN
1,666,293,536 *AF5688E376FC660BD61A6C1B718E4B5D22BA5FB1 9LACINIAQUE
1,666,293,537 *AF51CEFEE243384094D3E9FEAEA6563F9FDA3FBE 9MAASEUTUKYLS
1,666,293,538 *AF5BF1CAC22975C57E148A2356C9B501E7C322EE B_C4
1,666,293,539 *AF583B5F9B2BEE1B6063D62AE86AEF8A5C02A9C1 marci.osborne
1,666,293,540 *AF528480E792CD638E2AB9FD70897ED142E189E0 [email protected]
1,666,293,541 *AF5A5A416FB0A88DEC1C55ADD14DDD900736A8B9 bdgcl
1,666,293,542 *AF58E498DE88C5548B218983EC6E42F3C7AC90CF 9RUBYROSES
1,666,293,543 *AF5845DED9C760595A8A1F63DF272F2971376B3E BDPCS
1,666,293,544 *AF534369E34D2C70E5FA425606F379EF7C46C3FB maria.lucia.gomez
1,666,293,545 *AF52D26B95BB7041AEF8EB37061E4BF73537D50D mariecameron
1,666,293,546 *AF5747B3F459E797BEDA3669A0F17A465DA695D1 MARK.PETTINELLA
1,666,293,547 *AF5432E1A598480916EDCBF28226CE24B3CF9C6A BERNARDASCOLESE
1,666,293,548 *AF5B62B767642A0C1BE92F41DD79B1EF89F86169 MARWA-ZIN
1,666,293,549 *AF5FB9A96D2439F943920D21DB7EA7A52399ED11 BERUFSRENNREITER
1,666,293,550 *AF5FAC5AF5A58180B5D589658962C184E5A928D6 b/gh
1,666,293,551 *AF50F81E9B76C32795788305898BDAD91701F35F MATHGV.COMWWW
1,666,293,552 *AF5BCEA75E3E1ADF46B965BC8EE53EAEFAD65C65 a3exf
1,666,293,553 *AF52B0F3ED071B2121B9D86F864309413EE78827 MAYA DINEVA
1,666,293,554 *AF5D81C61033F75E01E23E5E11DBC873B74502F3 BIHLG
1,666,293,555 *AF5C9DE3C82913327CD7DD92795ECF8892F81C0A A-8TT
1,666,293,556 *AF516E3BC16AB50E88A5DD4BCCBDA55505D0A60F [email protected]#
1,666,293,557 *AF5AA98BFD4B7F64954FE5B7D84A9EDCD6B19926 melissa.duggan
1,666,293,558 *AF5469459A5994D09A8A695308B428F164EC83ED bk-dp
1,666,293,559 *AF5607B6ED56FD11167929639F120C1550ACBCF0 [email protected]
1,666,293,560 *AF5E4CCAA3E832B77D51E7B900D5D6F9281A8161 MENSUALISEZ.
1,666,293,561 *AF56FB2844EC75A4F80656DDA86EA59B0293F511 MERRILLCOCKRILL
1,666,293,562 *AF512136B7F44ABDB5D7629EE6B7B09CC672B46C A=aM
1,666,293,563 *AF559660022DA3184829C09F6E5BEFEBC745784D [email protected]
1,666,293,564 *AF53A219E91477F2C0599D30CB07BAB2886DA84B AATTIAHS8
1,666,293,565 *AF548C45B13C1F9E8014A6567C7322875FDD50E7 ABELDEHART
1,666,293,566 *AF5CF3B90C203CB2CAE067C3BE44BE206F6C1CD6 ABEL.FRISCIA
1,666,293,567 *AF50EB655D0BDA51710AD349CF2ED51CFCDB3E6C BNMSFR
1,666,293,568 *AF52A324FA4ABD686431CB452633FC952AF9CB81 BOD7E
1,666,293,569 *AF5A1CA8C6F3E29F3F50D97663F15C34845BF0C4 ac4t$
1,666,293,570 *AF5ABDD3B050692CAFBC54CE7EFCC8ED07E3FA95 MICKEYADVIL
1,666,293,571 *AF5412067F24B916B40DCB8AD42FC1C3D0617206 miguel286
1,666,293,572 *AF505F97055D8E8A46A7B473176C6C964DE3524C BOYDSALAHUBDIN
1,666,293,573 *AF5C00DFCCDE45A1CC5B40BDEFE417E006CFD445 bp,
1,666,293,574 *AF52143A1641DD9A11B9EAF07370CA8016B80336 MILFORD.BECKLER
1,666,293,575 *AF5BEAE2F0AD652F6DA16BD3DD5EB8F35457E3EC MILLARD.FORTH
1,666,293,576 *AF5DE82D52E5BA3324652BD0907958B40DC6F50E b======p`~-`~splat
1,666,293,577 *AF54E18A6DEAAE576DCA7CE1B0ECE90DA31FF6C3 mistakingv
1,666,293,578 *AF510887C8C7BD9A1D432C34C807BBFB357170FF braaf
1,666,293,579 *AF5D3666D9AAE1E0EA6D9F1DD7872BEE189F080C BRANDON.GANGEMI
1,666,293,580 *AF527732DBB670577074F4B09CC60FAC611E3A9E ADEL02
1,666,293,581 *AF5B74B3977626E7BD26569218AF08FB38B895D1 b(rdh
1,666,293,582 *AF564658797E6C087BA1891AD05B0C00209BACAD BRENT-CROSS-REPORT
1,666,293,583 *AF5FA4D998BC9439B327A8FE4F0C44D094F04D98 BRHOLLEY
1,666,293,584 *AF5053D68C4BD93FE785691BC0A1A96E85CE3667 Bridge-Head
1,666,293,585 *AF5FF4D5C22F4449B192B27BB507AF4E0DC902B3 ae:dm
1,666,293,586 *AF5973F2B19C6ABCA54D10486129D2766E1F18A1 MORTONCALLON
1,666,293,587 *AF59035137230B65124D6E1D0B0B883B7D38AC5F BRODERICKKNUDSEN
1,666,293,588 *AF5949F8ECDA3723EC6BBA92CF074E9746857E9C BROGAN938
1,666,293,589 *AF516AFF66C7A32CC9503636F8A2BE68DB365C2E -m$r
1,666,293,590 *AF5EF3E60D87B92378EB5692DB51BA2E4762AF5E AFDLC
1,666,293,591 *AF5AD87A30C5FE574921FA9EC8D13EBAC97E73EC BRYNN183
1,666,293,592 *AF510A6822B8567A4B05BF8C213EA3DBEE70BC43 MURRAYGERST
1,666,293,593 *AF593B2F966A6ED52B9B421C73E543439A321F46 mutotokwanza
1,666,293,594 *AF512B31E4F6FE226D0B807CFE5892195D82021A MYNITE1
1,666,293,595 *AF5C0D7745FE0AE785E5DC896450619BD555E4DE BUDNAUFZINGER
1,666,293,596 *AF5DADDE2307429749F4A9981C955CF38A020989 BÜLBILI
1,666,293,597 *AF5A591930F1A3CF7158B660C2CFB1339884F8DD BULLBARD
1,666,293,598 *AF51B02DD77A69047AD1EC69B51C754CCEFEEA7C natetanner
1,666,293,599 *AF5E0909031D2588990B958C0B26D9B5E1C44AEA AIRALYNEMBATE
1,666,293,600 *AF5F1E3D31FEE11C29512D6127D24FF0B9A98F2A NATHANIELDAVIDSON
1,666,293,601 *AF52ED4897CEE89D2F1422E4CBA5113F39E047B2 BVBVS
1,666,293,602 *AF50755ADD8D722667219F915FF1770E2077E99A nfyirf357
1,666,293,603 *AF5271A84A98C0048756997B455C518EF6F4EF4F nicksaa
1,666,293,604 *AF50C3D79C826F6C2F0D9214A2DEEBE6DD96486F bz%_g
1,666,293,605 *AF54DFEF440951AD72B59CFADA61F271BBA44847 NICOLASVOEGELI
1,666,293,606 *AF5C0529B97D76226C9768FE6128A124CC0B9083 NIGHT.OF.A.SUCCUBUS
1,666,293,607 *AF55981201F7A22D304C1B792DB7090D7D83780F ALFREDGRAJEDA
1,666,293,608 *AF5E13A25354BDE8DBE560258EA2FAD7DB9477A5 alfredtee
1,666,293,609 *AF56388A89FF8AE8F29BFA726668C003088A3C7C NUMBERS.SERGIO
1,666,293,610 *AF5C357C65300E1F141614334C16C9707EC80404 ALPHONSO.DICUS
1,666,293,611 *AF55F0B04CB473C0F4C4EF718CF2E3213D5FC098 alt="cavalcade
1,666,293,612 *AF5CBB7150A95B15644667225342F247E3263717 c7_d
1,666,293,613 *AF59DA4FA685B44BBFA2CB76E28B78783444F99B ALU
1,666,293,614 *AF50E189862010FD4B08C68C3773CFE947F445B1 OBOE-CONCERTO-IN-D-MAJOR-OP7-NO8:-I-ALLEGRO
1,666,293,615 *AF5B5D49C344CB3F7957267B85DA4A73E5E4752D C90DW
1,666,293,616 *AF5432C1FDC908D9F61AD71FCE33E1F631FEECD8 CALEB.PIZZI
1,666,293,617 *AF578C4F19252F6ECC0745D7F1D6F6D65CF013D6 oldseacaptain(live)
1,666,293,618 *AF5E1C2795BF39F761ED4900B1AB72D6D7B183FA CAMERON.UNSICKER
1,666,293,619 *AF5412E85CE285BC8D07968A9EC2356C17A87310 amnegal2
1,666,293,620 *AF5BFE11C86842D5F73AFF51F6BDD446736A0E81 opelingen
1,666,293,621 *AF5E0490FF1508B7AE92C676992756F4CF77CC26 OP+IMIS3
1,666,293,622 *AF525A2B0450BC06B52A0E1BBAE0250B53334D68 andria-chapman
1,666,293,623 *AF54037057143FD1987384A65DA5FF325DEC7A9C ANDRIA-PAYNE
1,666,293,624 *AF5DEE959C0E7084CA88CB30655C478D572B8F9B ORAKELTA4
1,666,293,625 *AF5D48965D37B95D067BADC8CD5DEFB5B4EEE1BC CARLOFELDHAKE
1,666,293,626 *AF5234E1E8E7DD42429A078B286DCB3306629AF5 ORLANDOGRZELAK
1,666,293,627 *AF522E5DA0AB31A8369D8D9606C5BE28C0E64B9C carmelostonehouse
1,666,293,628 *AF590AAE1EA85188AACC14A1E6E5E6BA9CA326A7 CARMINEMACHIN
1,666,293,629 *AF55F5EDA478DF59FB5316E2A099962C9CBD83F3 carnivalesque
1,666,293,630 *AF536541824D25FC1A350BB5DEE5145824646E3D ANSLUTS4
1,666,293,631 *AF5440D2F57AB41A6C2DC2C75D0A7786A7304C22 OVERGEZWOMMENE4
1,666,293,632 *AF55D239133A1861EAC280314C2A418B5C0CE00F CATHY.EVANGELISTA
1,666,293,633 *AF5C9DB36EA94347AB77E402A1A73C06CA339517 ANTOINE.CALISTO
1,666,293,634 *AF577B7A76DBD710EC3EB70388428313E5E6D0E0 P;0OB
1,666,293,635 *AF5BB4878DF47F62E69D30BA420932670C7A24A0 p===)~0-~o-:p
1,666,293,636 *AF5C8549A901CA3AD8CFC0B7C7B71D5F39E6DA37 P4L35TR
1,666,293,637 *AF504C1BE499A1876BE0DDEA485E1EE89D3F2E18 antonyballweg
1,666,293,638 *AF5256C5570319C2CFC4F0BF59E54CAFF2BE5645 pacosdeferreira
1,666,293,639 *AF55F37522E266C7FBE0DE0B72ACE4FE9A2F248C aopn
1,666,293,640 *AF5A50F8C358BD0DFD6C310F71D532908362CD5A ap_br
1,666,293,641 *AF5D61B564F0DB97F831E7E12B72BD013F0460FD CE5B
1,666,293,642 *AF5E817F385E9D5A2E79634BDC10EFFAA5D91EA4 cecilfurbish
1,666,293,643 *AF5990F86B63B54768447D3318935458884EA265 CEEC:
1,666,293,644 *AF5AA892F04EC5480687B76BE3DCC88BCBB1FFD3 patte230884
1,666,293,645 *AF50963895E3E1B2F0F9CFC2435B5F8EA36C3769 P===B`~`~;)
1,666,293,646 *AF5EC87D8D8ADEEF1B61008F3BE1591A03FA8CB4 p-D-~o
1,666,293,647 *AF5A7C88BD26B4E0E3DFE0E08CF9DCBF8B44AB48 c%,gt
1,666,293,648 *AF514AA1D2111C68A83E27414E53FD820BCF0C21 arnulfopodraza
1,666,293,649 *AF5DE592F57595DAFD4E70818744B0AB1403111E CHAB RASSI
1,666,293,650 *AF50EED0017674F1229ED3F5A85DC6D8E10EA244 Peloponnesos
1,666,293,651 *AF52B17C9E203BF9F8515756138A39D5185B3046 CHAINWUED
1,666,293,652 *AF5AC4AC809155904DFA83897B96C2814DFB786E CHARLES.HOLST
1,666,293,653 *AF57652B079C1EBCAB8F24FAFC25744A5BAD1D13 ASOCIACION.DE.FUTBOL.NO.AMATEUR.DE.SANTA.ELENA
1,666,293,654 *AF5B36BB27161A29CF3F50C8D49E27B4D287A8A1 ASPERERE
1,666,293,655 *AF5D07AF83A17CFB4E76644BBBD012557A990C04 CHARLEYKAHAHANE
1,666,293,656 *AF552DEAC37EBA4BD78C745D84391FFDE5DDFA8E [email protected]
1,666,293,657 *AF5FF0D422B391C37E8E1FEA04A250183CAA218E chc)
1,666,293,658 *AF56E197592FAA34EFE49D94187279549BC7E14C [email protected]
1,666,293,659 *AF5B1FF0AC8CA5A33F39B8E945808D897CCF0330 pianoimprovisationno2(ava)
1,666,293,660 *AF52B951C2F6AC105F74692453285085A0B64110 PIKE3
1,666,293,661 *AF557353EB1E1E9601DB298BDF1D35E3B6690076 AUGUSTUSMATTAS
1,666,293,662 *AF564C2046F51F8489BE2D024A406C4A2C585AAA chilita-xanthina
1,666,293,663 *AF5057E15F725AB91566A8DB8322690AAEF42E6F PITSAW1234
1,666,293,664 *AF52090A4A04AE76F7CE93D9351119DFA7D8BDB6 AURA-INFINITY
1,666,293,665 *AF52D10A2CC0FE8EDE5B98C44400193645C3E3ED CHOPPRA
1,666,293,666 *AF53A4FDB3B7F08C221FE7D1E326F4E594F55578 CHRISTOPER.BRISTON
1,666,293,667 *AF513C14AB249825DA4F6DED66588039B1C1B00C PLTBND
1,666,293,668 *AF51AE7C48BF23812AB7FBFA1C759D2CACD4AA13 PMDOKWE
1,666,293,669 *AF5AC5B7B8109412C787CFE4F9610C6BBDEE1A82 [email protected]
1,666,293,670 *AF536D4AAD3A40308BB20A37480774D5D688AA2C averyklingbeil
1,666,293,671 *AF53D82135532BA3260D6567F9AB83A7363F6D1B AVERYTACHENY
1,666,293,672 *AF51F1BAD8E0ED69564BCC8C73A0FCDEEBE0256E avfp
1,666,293,673 *AF5786661EF6265B278B83DF717FA0D3D407B4CD P--p~-splat
1,666,293,674 *AF58B551255163D7E36EA8F12589A69D73A85975 CLAUDEL.
1,666,293,675 *AF5F4797225F3046D8971E9381B8276F4E97D851 aлбон
1,666,293,676 *AF553A8F4887FAE3E8808E103C65B5094EE74994 [email protected]
1,666,293,677 *AF501951507FE1C344A9CFC70AAD21ABDB9E3FE9 cl//h
1,666,293,678 *AF56CEDC01E0ACBAB04267BD401C79D5A9AA003D CLINT.STIFTER
1,666,293,679 *AF55480C022B2B9C8133DA0B4ED4F2B7CE5759EF b0e?#
1,666,293,680 *AF570FA80179B931AAD628EE20CA1343F558536B prokofieff’s
1,666,293,681 *AF58A6FF9859EBEE6340D58334321873F3DF20B7 b1u9d
1,666,293,682 *AF5DFED4F9C2D28BFD2010D0D1592FD1A7D454E6 B4$TING
1,666,293,683 *AF5B86DDCCDC38C03416A3B7383BFA9051F25AA8 p###@~-`-splat
1,666,293,684 *AF53E5418C4E981DB3D95EE239CFA77EE69EA6D9 bach:.twopart.invention.no..11
1,666,293,685 *AF56586FD5AA92C914F5C73A6820BC031ED997E3 badkq
1,666,293,686 *AF55D62D5B25EF98022AB7F774569829A2D40FC3 [email protected]
1,666,293,687 *AF5E0AFF766A6FC6EF73A54D5C45AF3BA67ACCFC BALBUZARD0
1,666,293,688 *AF5747F5403E1F4F20BC486DC272EE2F87595BAD bananfa
1,666,293,689 *AF527E6828E22DA3F342D67155CD2A2C77A20BC9 banter.V:.bantered..bantering..banters
1,666,293,690 *AF57A1FD08C7759C026FE32DA67C07A5C8380323 QAUCANTIK
1,666,293,691 *AF5F09967464F2B3AAC6934B2E0509800E202E2A BARBARA.A.LUCE
1,666,293,692 *AF556F68A778537AA8759B51EA8A6AF7CEBB9BCB conaires
1,666,293,693 *AF5FC35C257CA1828B8BA45FAC7EB540B8292EE1 CONGDIES5
1,666,293,694 *AF50CE518B6B4F627BA3EBA850E0736DAF2F7664 [email protected]@+IV3
1,666,293,695 *AF566F4177095AEB5EFBECC19B0E1930A6D86608 bayberry-n:-bayberries
1,666,293,696 *AF5F2CF99E98E6A869EFE66F57445C84F752E654 baz1c
1,666,293,697 *AF599C7D21D840012552B0D305F80B45F0B64514 BBI:L
1,666,293,698 *AF5DC999A50B618726D6A07A112D11198290551E R3gs+3ra8l3
1,666,293,699 *AF58C260342FBC096CA42317A1CA59F649338C61 Cp6Q
1,666,293,700 *AF5C3A9B0633A7A2D223423F6F46521E135AA7B3 RAINDANCERSTAHL
1,666,293,701 *AF5DF6EF7F41784F37F431BDC2174F2CBCFDC374 ralphrazzano
1,666,293,702 *AF5D3203638D8CADB3A237E6E9A224A5181C7C4C ramirogeiss
1,666,293,703 *AF5FFA318BE5D812435BB784D4B8B4E13A0F7280 RAMIROSHORTER
1,666,293,704 *AF5A9EFB8EFD304B1782892F43CB1FE276570B0C [email protected]
1,666,293,705 *AF5FE7473968A4DA99434550E5EA1240206E1861 reexecutes3
1,666,293,706 *AF5BF836CDE0F640A53EF23C24CFFBDB84C58352 be2=?
1,666,293,707 *AF5E3A7E805BE5865060AB1590E90B9C95E275D4 BEAUSCHWIESOW
1,666,293,708 *AF54EE5137FDAD41C37EC20A3D8ECEFA93B672C9 REKENSOMMETJE7
1,666,293,709 *AF527EE693360543FA410C68C7054ADC142C5624 crashtwin-sanity
1,666,293,710 *AF509633316004396B336D7AF01D8825EBDDCD9F rentrer-en-bretagne
1,666,293,711 *AF50AE199E5607274AAF3D0F894665CA9F1F87D5 BENEDICTGILLEY
1,666,293,712 *AF5B0710309D5CB14ABE2A5555A21B3049C62B8B RESTEARINS
1,666,293,713 *AF540376BB6AD32659791A4E48F5DB0BAF07D102 BERESPET
1,666,293,714 *AF54CEFE5A3601C64574705A3A049963A5E893A8 RETURN-TO-THE-PALACE
1,666,293,715 *AF50567BE62523E6C3B0A0A1E60181D779969918 REVERENDS
1,666,293,716 *AF54FEBBBD14FD07D1678024C1925692C5E2B819 BETHQUEEN
1,666,293,717 *AF5CCE90B285DFBE9B8E5642F512DAD57E5FD726 B,Ff
1,666,293,718 *AF527D7A02E379B42C1F65D92C33D8DA98A5B4D1 RICOHUTAGALUNG
1,666,293,719 *AF504F4E80178649AE8B59BDD3099233F5D3C364 rifermava
1,666,293,720 *AF5F7E5FFD82EC0E2B6908031F85966D171CD2FD ct0q
1,666,293,721 *AF5B2CA32E9D4637D9333727DA54BBF250BA8BA3 c)#uf
1,666,293,722 *AF54A3817F723D76B0EF51308E3970E3D75F43E1 robkriskovich
1,666,293,723 *AF57E122BD4C2AD0F772CD5B02D001E9C2F9A86B bieberu
1,666,293,724 *AF5FE619FD0F2517AE9645965FC9DC42009983F3 RODNEYGERNEY
1,666,293,725 *AF582120A09B58712D58D86FBDE8D3A55B2113B2 ROD.PANDEY
1,666,293,726 *AF5D3ECE21405962A5F48FF6EE8C9A9063F85DB6 rodrigomckelvy
1,666,293,727 *AF574011706D1FFD9576D2AA2A91DCDB74A991CF BIRD5DOG
1,666,293,728 *AF5A89AE770DE2288FA8D7DDE41C02596BC630D6 BISS ZUM ABENDROT 607
1,666,293,729 *AF5148E61C71B512F23E5A6E11A6F5BB0DF99DAE C/WHQ
1,666,293,730 *AF55E23C07F1D6D9D3D649C4728F8658D3FE5C4F c:\xampp\php\pear\zend\infocard\xml\keyinfo\default.php
1,666,293,731 *AF5D2A0FDCBD34BD7403CFC09F0E3EADF75681E9 cxw8n
1,666,293,732 *AF5764CC4219704CD65357E02F4228EAC7C298F9 ROSARIO.LEANARD
1,666,293,733 *AF552BEA97133038E84C3BDA1F5EEA08FC583637 ROWEN-NAIDU
1,666,293,734 *AF519F70D62D45260982E9A1B0ECE78BDAE37FF0 cythères
1,666,293,735 *AF5840ED22134BCE6702CD405490FD9018111926 d2mcb
1,666,293,736 *AF55B14A7F7009154C8C3306250FACD054507119 [email protected]
1,666,293,737 *AF54E7C36D5850DC3B80BB3778AD1EB7580168FD [email protected]
1,666,293,738 *AF58C8A90A17FFE515F9C1A96FE6158676E9766C bnd}
1,666,293,739 *AF50A703563E1EB7EA6E7FFEFDC9FA3F510BF42F B+NNR
1,666,293,740 *AF5BCD3EB26AF1E40C425AD20BC5F7B6FADD24E7 d7h!y
1,666,293,741 *AF5A9B3930CCF81CA033A64412903D1DDF409777 BOBCRANOR
1,666,293,742 *AF50D79DBB36B885413B52881A36E7A5B3EE28C1 d!&9
1,666,293,743 *AF5CD6F5AFAACE01265777D79F39D319E099AAD3 d&+aa
1,666,293,744 *AF5D030A228F37AADB1940DE1130F36ECB0A1E0A SANTOSALAND
1,666,293,745 *AF5422D41AFF2A2E362F248BE4D33D80E18CE8CD SARIDRUOGED4
1,666,293,746 *AF537C20E91568CAE91AF567D1A8AF5016772C64 SASKIAWEASEL6
1,666,293,747 *AF594E779C1B1ACF430105772F5B0FCDEC8698DD B~PN
1,666,293,748 *AF551629068A37179C2EB7229D3CA5C88CDBC9C2 bpublicola
1,666,293,749 *AF5A4F9D22E8B314F56E261833E3C5FF23E1535C DANIEL CAPARROS
1,666,293,750 *AF5575ED02BF3916F859B657C69687F03EFE04BB schtwnd2
1,666,293,751 *AF5D5EC3199DA002C989D37CA4677C1A63630583 bradlystinehelfer
1,666,293,752 *AF52870892334C4E5FCD35E93DF8B04FCE2D6569 DAREN.CRADDUCK
1,666,293,753 *AF5368D8C3516A7D5F55410250D1C86BB1F8CCD4 BRBH
1,666,293,754 *AF549E8D8CB5534D6C52AE0C2BB154C40CCDF615 SCOT.TILMON
1,666,293,755 *AF5F3572825942EE572BEEDC79719E1944CEAC6E darkroomnotesdeadstartprogramep
1,666,293,756 *AF5838A04D537079B937A4BD368CE10CB1AC44ED BRENTON.ROMAGNOLI
1,666,293,757 *AF52A2F172B3DE424EBF21DFED646B54FF2A8E6E DARRICK.KUCHINSKI
1,666,293,758 *AF54C35DAA93A094B9213EC2504DCB334324C328 darrinhearing
1,666,293,759 *AF569E78A25C8C457E2F4347AE7892B55448BCDB darshinvyas
1,666,293,760 *AF5D27003975E8A1E37AF1D6E541479518646E26 SEBASTIAN.CASTANON
1,666,293,761 *AF5C1B9FDDF254207BBD0C6024F7CF600F6B4418 DASHARENEE
1,666,293,762 *AF5220C360EA6243E9BF6A2BD31687629FC68802 DAVIDSWANGER
1,666,293,763 *AF586DAB31DF27D190F43B191DC680ED8D550F15 D,B%L
1,666,293,764 *AF5B4CBB317CF2DCDE0775CE88CAC0B6AF8C2356 DBLL$
1,666,293,765 *AF5447AA44B515C6B2CBECF045FACD0ECDB37859 BSWPRONTBSW
1,666,293,766 *AF5687300631F258AA1C14F6E1D3BB90F89E0CAD btc7f
1,666,293,767 *AF50DA7EFA0CF3606F772B4EB9B9736AA4DC07F7 DBZV_
1,666,293,768 *AF5F282B44CEAEDF537827E1AA46886659950276 sh0fner
1,666,293,769 *AF566B84A5B10F1FDE5484F21FE839629DAE7559 SHAHANAZ BEGUM
1,666,293,770 *AF5069A19CB2BC847E136AD6764A09F626187E1C shalier
1,666,293,771 *AF5C9DCAD6C7830A0BABC0010B567E16326AD0ED C0NTRA5T1NGLY
1,666,293,772 *AF55A612531B297FEDEF3B6204D403ED1CB04FF0 C2510 - THE BEETLE AT BAY
1,666,293,773 *AF55578E45D6745E375884C4F56FFF66480D467B shitjane4
1,666,293,774 *AF5232FC65F6DA0A7CD55F4D1092B040C94CA721 derochea2
1,666,293,775 *AF5FC8655052B4A9E076B2EDB7DC6302048B70B6 [email protected]
1,666,293,776 *AF5F69CFDE4F418A8DB1EA7A881754E6DEEA2A4A DETANOISSAPMOC
1,666,293,777 *AF5E7A02DF5D782E5B650CD4C856E326362132AE CALLIGRAPHY K/@/'L/I/GR/@/F/I/
1,666,293,778 *AF562F27D074E6982AB2AD94065B63BA362E02C3 CALVINSTEMMLER
1,666,293,779 *AF5F382A18751F9BD15F2E368BDC16AB27E1C67A devïare
1,666,293,780 *AF53A1A6966E69884F574A39B7B452D4F5ADACE9 capsule-ryokan-kyotocomwww
1,666,293,781 *AF5AC8427CFDF7033590ECA94F9C033A9B43F9A0 dexterzobell
1,666,293,782 *AF5BDB2C9C287AEC55BBDCAF5005AE8872D0C465 SIMULATIVELY4
1,666,293,783 *AF50B1394B4AF44C01DA06D855BCA9B8EF5C23EA DICK.PRAHL
1,666,293,784 *AF5F3D4EC19E83616F98088D08C49E03521941B2 diegolappinga
1,666,293,785 *AF58D94EA9E8428C5C202746F77C81E3A3F267D9 D’IMONIUM
1,666,293,786 *AF5630130E1C41C9426DF228FDEBE8C0A14DCBC0 DIOITARE1
1,666,293,787 *AF52C03BD47ED919F1FDE218D34EE6D834F63865 CARLTONMEDIANO
1,666,293,788 *AF5D87B600249AC67E1CBB7E9E2556E28C39096B carol-fellows
1,666,293,789 *AF573273BD206FF2F6F1F21F3CD15412100A8572 distroit
1,666,293,790 *AF5065509D619A1C8AD6C3E0EAB26C2832E1F027 di;vn
1,666,293,791 *AF551EBEA7F43E8ED320FADF2548525EA820682E CATLIMNAED
1,666,293,792 *AF5E757D2A5032E12A43D50B4C75207E9859C279 CAUKILVJ50
1,666,293,793 *AF519A56FAA570941BDAD5B27D38AD96CEEE92C4 SLEBBB
1,666,293,794 *AF5A35A83DB533E47310E99DF9B6C115DC18A08B d/n)
1,666,293,795 *AF518A24AD37A412CB899B827A8E39224DD89771 dnalrets0
1,666,293,796 *AF53CBF0B0DEE582D5CEA7794DC17117DA22090E DNENFFOR4
1,666,293,797 *AF574F8D842797689CA2B9E6404B960235AF62D3 d.nm
1,666,293,798 *AF53966AAC233C202DAC140F907571494CED4742 DONGSUNG-DONG
1,666,293,799 *AF574CC8D6BD6095ECAFD8B074BEC529DDABF9A0 donnsaldano
1,666,293,800 *AF5CBAA77CF3F40248AE41AD68111B5B6B37E8AA DONOVANGIORGIO
1,666,293,801 *AF5B23C9FDCB56B69EE1636D534BBF689F83565F don-tiger
1,666,293,802 *AF5A3439BDA72797CA64363528E5634297811DF0 cdvkd
1,666,293,803 *AF5EF6550010477C6566E85CB5F751DA013D3C2B DP4M
1,666,293,804 *AF5A96BAFC6E6FFAFE8EF104A51B9F7F2F581A3E sonhouten
1,666,293,805 *AF54013601C489E54F4DAAA7AC08CDCCF515FB4F [email protected]
1,666,293,806 *AF535E078DEE915623BB98A29723395ED347FB39 DURCHGEPIELT
1,666,293,807 *AF5DA843E188C9E00170991B122F1FEBBEB40F76 CHATILLON2
1,666,293,808 *AF5BAD9A0A89749DAC0300918257A16AF806B9BB CHIANGMAI-VACATIONS
1,666,293,809 *AF50B40AE3EE777C765AAC54E5FF99026AAD467B e`9a
1,666,293,810 *AF566984BF0BB78CF0E3C4407F1B98355D38CC31 earleabdelhamid
1,666,293,811 *AF50FCC4C0A4F2ABD7A9F7AECB173490CDE2067B ece#z
1,666,293,812 *AF5377367597EDEEC3F777319228576E2401EE79 ect,b
1,666,293,813 *AF5A6CC7E9479494C4FDAFE414149E5ECCD2583C edmondgroder
1,666,293,814 *AF5845928A17EE99BBC3B9BDF75E2CDE05B96C91 EDOGMA
1,666,293,815 *AF5BB6F997C0632BB760D49CED0F6E793C0392DD SSPNSTN6
1,666,293,816 *AF583D602E790F34CF5BF10EB1A164BF9B2D6FB5 EDWARDOLINAHAN
1,666,293,817 *AF55FD6974CE228CB665ACDD0FBC29703FFD3C7C CiVD
1,666,293,818 *AF5AA6A0B307BAA06DC9D7C2C003B5635CFC6045 CKLET
1,666,293,819 *AF546711D4F340D990A950EA4670A05107F9DE25 EFREN.BARRIBEAU
1,666,293,820 *AF5E46E26CD8F877FCAD3B8EC92ECF57687B2F7C EFT
1,666,293,821 *AF5695E841A57A788F629D66D233DE1D7B63FDF8 CLEMENTKLINGBERG
1,666,293,822 *AF5586A8D9FC750E0252813AD084500D25D9BC16 clevelandbelieu
1,666,293,823 *AF5310FBFB0E2C9BF33A1515DB7CF722BECC7BC7 clhig
1,666,293,824 *AF51F28086C61563EBDD10A6DFD18B351F56E51D clin95+one
1,666,293,825 *AF5F91D12C0861DCAC07E75324E51122D5EE9330 STEVENCHILDS
1,666,293,826 *AF556ABA36950666A66C457016DC0EFE18A050AF EKEMISTN8
1,666,293,827 *AF5589219CDB9785E175D1F9E5E73AD974C59346 ELAINEMETZGER
1,666,293,828 *AF540F38C2CB07E2D333747174026569D4187D58 Electrogrammes
1,666,293,829 *AF59D85583C3880500722C981D1471F5DAB14E76 strangermag
1,666,293,830 *AF5653983D5C65B820AA733D351A5750DDC7B9A6 COLORADOJUDICIALPERFORMANCE.GOVWWW
1,666,293,831 *AF5005EA31FDE1EDC4DED7186490206900C0760C COLTIVASSI!
1,666,293,832 *AF537B8D8699230FDD474484E751237ACEDBD81B [email protected]
1,666,293,833 *AF52C3F8824F39D51FFE4137A4A1DF1E12AEFB92 SUNRISEMALL
1,666,293,834 *AF5CC6B7CFC11C2742D758A61C0ACD6EE6F895CE SUOECAVLU9
1,666,293,835 *AF55703E47DC091A8CFA6CA79476002332129598 con+3mpor4r!35
1,666,293,836 *AF5A05284B7E209D8205E3154DFF149DB87A3852 suralimentation
1,666,293,837 *AF5391F3958D9B41E9CD4078CC226C01CD13D0F0 CONOR190
1,666,293,838 *AF5ED9314FE0496F6CE50754D6CF94F4D7499701 SYLIUTAO
1,666,293,839 *AF565EDFF343FEC04201522D5047102FE4837F03 syluyre3
1,666,293,840 *AF5F0457C4D0F408E7BB4EE90533B44BD056A94D enba,
1,666,293,841 *AF59C0FF6097CD4B96B977C2C251BC21A2299365 CORTEZHAMACHER
1,666,293,842 *AF5B060F55FB6E729874CA29881B5595CF9BF784 EN-CONTRA-DE-MI
1,666,293,843 *AF51C0BB724F94F5A5FF7EE24ADA200C55A90E50 enegnitt7
1,666,293,844 *AF5D41A2B0AE5BE87593A2254A9922770A66A12E SZÚNYOGSZEGI
1,666,293,845 *AF5FAC270BC3DA66C7BECB79FB9B28F6E6F0EF9B T155716
1,666,293,846 *AF5628A58D550EA71139C025155C716A7FF59E0E ENLARGE
1,666,293,847 *AF5AED99050BD1D903E98754E14B9335464F439A T'ACOQUINASSES
1,666,293,848 *AF5F502536BF39500F8ACA6C731EA42D355D7C63 C:\PROGRAM.FILES\MICROSOFT.SDKS\WINDOWS\V5.0\INCLUDE\DBSCMD.IDL
1,666,293,849 *AF51ABA4FB7B676D4FF4DF494F74636A3FF3CC47 CQMV$
1,666,293,850 *AF5137FAC1FF62794A40B429425EA1E2C9F9EF25 c-r=.
1,666,293,851 *AF53456F319EB5F06083B4ECF0A979E5F13CA485 EPININONOC
1,666,293,852 *AF54F7F8C93797B5DE95AA4F542D352C829A14D4 CR,AK
1,666,293,853 *AF5D4A87A0EAE37B487CFF88112C8F159EFC2F3F ERBESHAYING
1,666,293,854 *AF5D588898DB700EFDD14F46881D9D485FF9977F crhd!
1,666,293,855 *AF54091A873C4850F25F23515525EE78305B5990 CT6D
1,666,293,856 *AF56CD2BFFFD771A1F25E2111DFEE74CE850D088 THEBEAVIS150
1,666,293,857 *AF58B887CB1C6C50FE9A175536DCA3A4B199FF0E cw3ci
1,666,293,858 *AF55055E76A35EB448C6A5400723368C8757F27C CWLX3
1,666,293,859 *AF574378E41AD6153D404A834241A4337832FFB3 ernestospinetti
1,666,293,860 *AF58D426DA9C2581B6B092C791702771CC6B87C8 ESAFEDOC
1,666,293,861 *AF5C3C05993BF505F78668D77339544F7EEF8E44 [email protected]@7ion
1,666,293,862 *AF53393EE28B259DA66E70B2824CE39AC07CE857 timothylakes
1,666,293,863 *AF5356A00F89A518464C6C0EAE7B8EAD9232678A tisúčkrat
1,666,293,864 *AF5903EB9518ED13A702C28192640627620AEEB6 EZEKIELKHENSOVAN
1,666,293,865 *AF5931112B012FFE3152D059529E4FCA07E9EE09 [email protected]
1,666,293,866 *AF5C08DF2C27A5452D54EC100F09E621D539F385 tobyhashim
1,666,293,867 *AF5EF3F36AB54E40E8F6478292A2B66D8EBC208A tolkeniane
1,666,293,868 *AF5965706C591BA1612751D95B16282574ECEF40 [email protected][email protected]
1,666,293,869 *AF5FE4A56E7134004CF6B8EF145DB0DDB9D6911A fabianmomin
1,666,293,870 *AF54F8212CAC0D412001D459052D2EEE1B1CDE7E TOOLFORGER
1,666,293,871 *AF5E9776ED12ED5F0AF1FEE4AFFDE17F8BF99808 TORIROTHMAN
1,666,293,872 *AF5248B39D55A4B84F7FDDF638954F0CC91BE206 DAMONSACCA
1,666,293,873 *AF5412D67167152774351D8AD275C883CAE89B74 DANIELMAINA1234567
1,666,293,874 *AF5F128F72D7AF2843D7321021B7981E9B61DE51 DANILOAMICI
1,666,293,875 *AF551B2FC41AA8E0FA7CF37CD9590FB1A23B2703 TRAVESTISSESES
1,666,293,876 *AF540199B2A601DE559749255F708A99E48AA461 daronpersonette
1,666,293,877 *AF52948A65BF16C5C91FAF93BCBA1EB7938A9F59 DARREL.JOHANNES
1,666,293,878 *AF5FADE1A8D040EF15C8B2D1D40041B6400B1A85 DARRYL.MCKENDALL
1,666,293,879 *AF56FE85323856E7BAF09A2674BCCD4CB29B73C9 DARWINLYKKE
1,666,293,880 *AF5CB2CDC9DF9FF6DCBC543DF73D5CC409C061A3 dasnb
1,666,293,881 *AF5736A0F85BCE07C8F74A0D2D52A07D56805C81 trstici
1,666,293,882 *AF5068C77DD9633BEF0051FAAC491317B9F7691F TULEVIKULINNAS
1,666,293,883 *AF51AB487014FFFD4E3578F60221EEB009D44385 dd3.e
1,666,293,884 *AF579E08B176E3A437CB3C2BAE521DEBEE0FA307 deceites7
1,666,293,885 *AF5BBD07EB7AA86A6BF7878903809C78A8F8E1B3 deenab
1,666,293,886 *AF5826904AA41F5A1AA931D8031049B7399043DA [email protected]
1,666,293,887 *AF58562668B4B587995733A158A1BE91F70F56E7 UALTTIZ
1,666,293,888 *AF5D5238AFA25C79E5C463282C5BF022CE72F291 Finale-AndanteMaestoso-AllegroV
1,666,293,889 *AF543BB8B6FF140B6BC490DB95FA24957E41F176 [email protected]
1,666,293,890 *AF54F6FF62786DFB07B0CEA244CB129E55B43608 DEMIREVE4
1,666,293,891 *AF5D1605D4023BA81EF496D444F280A8E30D94F0 floydmeloy
1,666,293,892 *AF5D79170A7F28222CCC361BAFF6D566DA977FDF ujjwal.khalnayak
1,666,293,893 *AF5B87624EAC9FF032F363C89345CB06E03A3337 DENVERALMARZA
1,666,293,894 *AF5682F09EB5AE55E61040CA12238F7B6EF1C563 DEO,N
1,666,293,895 *AF55E7D6F7E1DFC02BCF3DD11791CB7E7344A1AA FOREKNOWFOREKNOW
1,666,293,896 *AF524ABBEAC58D998F139AB960C99BF70A62F847 forjudges8
1,666,293,897 *AF513D2891E7F9A10E03AE7C3E1A49E9203B7AAF FRANCES.GREENSFELDER
1,666,293,898 *AF5A17669840E3BCF6A1DFBA65C989A25B940179 FRANCISCO.PINKARD
1,666,293,899 *AF5325299BD85D003B484344A0D777699E93F17F UNN
1,666,293,900 *AF5CE03598E3EED942C3CCB5D0C290A656028A63 FRANKLYNYURKANIN
1,666,293,901 *AF564AB362BDF64FA50870D4A9C4ECCFB8F2A140 [email protected]
1,666,293,902 *AF50B17A9D01DF00CEE002C1F728B4BD154FDB4E FREGOLE5
1,666,293,903 *AF50E2A3510D4F9773CAF47933F1CE72873936D5 FREMLGS2
1,666,293,904 *AF512F94A3C3A5CABD262D581C54CFA130D955C4 FUERTE-DEL-ESPIRITU-SANTO-DEL-CATIRAY
1,666,293,905 *AF5C82EA04F0B0E3DA8734AF88BEA9F3579980BE [email protected]
1,666,293,906 *AF52057D011E50295F03B619C3206E7572157817 dgj:
1,666,293,907 *AF587A22DC87E41397A1FCC47CE848C088026822 fv)t
1,666,293,908 *AF569A9327E7DD141C807338948565C4A6E8A7A0 [email protected]
1,666,293,909 *AF56336A26805F56B6041BAAF7946054204E67BE UTILABSW
1,666,293,910 *AF5FCA435B196FF066FE04FFDBE27BF2B529B537 UTNINGER1
1,666,293,911 *AF57A6E5AEB41CCE61F605370E7E9B2F00690C23 UTOPIAKS0
1,666,293,912 *AF5BBCBB49DE653CB77723DD124FBA7ABA9717B0 V!5UA1!Z3R
1,666,293,913 *AF5ADCB39779AA816D8A2E262AB9E48C104171C0 [email protected]
1,666,293,914 *AF52541F571759806D19F077D7620FEF607E06C9 GDESTREES
1,666,293,915 *AF5A4B5FB278735B970485F7F7795A995F096E82 gdiis4wd
1,666,293,916 *AF5C828E9DE4179DB34C044F45156E08E70CFAA4 DINKERDINKER
1,666,293,917 *AF5C72BF8C30037E439F424170793AF3107486E7 vandykeparkswithmondrianstringquartet
1,666,293,918 *AF560928B29D609967F0349B9F00C65E6215EBE3 GEORGEROSBERG
1,666,293,919 *AF52FE23FEBC1A1FBB012432757DBC006B025AA1 [email protected]
1,666,293,920 *AF5ACBC324675DD07EF798D6EDA53D1A3C56CED7 vaud0is
1,666,293,921 *AF5CE15D1DCCB7AF911E2E1A93DEDF2006D61E41 GERARDO.RICKEY
1,666,293,922 *AF51BF596139E2E17F1FCBC28EE6B4FC65D89581 dkqg.
1,666,293,923 *AF5D7860E6D3ED1169A9F6B3DC64BA05E1339B68 d&ll"
1,666,293,924 *AF51812AC35AE453C7211FEBD8A7217FB551B424 dlxl
1,666,293,925 *AF586E970CA6D74323C7F6E7B278C3072541F018 DMCUJF
1,666,293,926 *AF584AD07847EAD1DA6A4C3A6B0B3F37B91620B9 gilbertodoorley
1,666,293,927 *AF558B901D8F1B7A6F20B6AB00AE9BB49BE6602E vezzosi5
1,666,293,928 *AF5C5DFE104123266C75D27C7C6EB9DBC3E94B0D vicenterastegar
1,666,293,929 *AF505EFE5A9389DCA912972786D167188674DDD3 [email protected]@7or$
1,666,293,930 *AF5A41402F1312644E1AAD39CC7F34B392330BEF vickyhunter
1,666,293,931 *AF501E6CF69556B0874D72C4281ACD66F21DEA57 g=md
1,666,293,932 *AF53F4F98B2B13F4684516962B061DD22314DA13 vikki.itsova.chaney
1,666,293,933 *AF5B16F256961544A2E866D3133D286551B2543C DOMENIC.SNIPES
1,666,293,934 *AF5EF793303001047EF428CE90A4BDDDAD6ABC3F [email protected]
1,666,293,935 *AF575A6CC4E7E5047AAFA62FB446981B6E4FDBD5 DOMINICKPEDRICK
1,666,293,936 *AF5B7C880420D87A72E39283139851F6A6B6DE08 vinod.kumar.bhatt
1,666,293,937 *AF52C8A1FCBCF841BD56C975A466482ABD6C8799 [email protected]
1,666,293,938 *AF57C015C3BA0E8B0AD77400BA84E41F52FFA942 VIOLDIFAGOTTO4
1,666,293,939 *AF5B930B6D6B47E4BB9971D6EC6ACEA63581E1CC goofychip7
1,666,293,940 *AF5AEFF570FD0D5FCDC7ABD9F523305CBD257707 [email protected]
1,666,293,941 *AF586EF45F568DF4BF52B500B5C33900B33EB9A5 GORMAN279
1,666,293,942 *AF51A65F86B4A4FF16A38F112538CF41AD17D0A3 GOVINDA,-HARI-AND-ST-GEORGE-(RARE-VERSION)
1,666,293,943 *AF5BB170331BC8C07BDEF26E2B8A0D8ECCEA1233 DONNYYOUNGMAN
1,666,293,944 *AF560BD42B93833F7D0F6BBDD86E94748EC32911 DONTE.GREENE
1,666,293,945 *AF593B3873CFB254BFBB5CF5D8F18ADDDAFBABCA dorfgaschtoa
1,666,293,946 *AF5541E1A9932C69228BF1280D15FD57218895FB GREGLANOIE
1,666,293,947 *AF58EEF0FBBD7FE8DA2D063B6848F770BE3E01C3 doyleperrault
1,666,293,948 *AF587C2662732759CB8C018FF1D5281F50B47534 vooronderzoeken
1,666,293,949 *AF54CA231FEBA40F5C94C26F2F3B5ECC9DB26874 D)QV:
1,666,293,950 *AF5580FFD378F2082F9166EC5FA20C8F2D07AEDE WAHAB BASHIR
1,666,293,951 *AF50BD0057B9CDA687145A2F141E381F96402250 [email protected]
1,666,293,952 *AF5F079DA9DF872168D4735EFCC8B5D99E97FFD6 drk0p
1,666,293,953 *AF5BE6F793A34FDC449727C1BCD0B9ADFA36E268 H3~O
1,666,293,954 *AF57DEF787A9DCB1BA27282BC4D141A6C461E769 WALTER.LUMM
1,666,293,955 *AF54BAEEFC2D118295E01E06917CF404A2AD0625 drp?s
1,666,293,956 *AF594F43A869B1D11FAE005C0AF5722A80FF730C [email protected]
1,666,293,957 *AF51D89E655F704310437AE48C5BF1A0487DB349 dsb57
1,666,293,958 *AF56F55C728ED524B69EEFDA3C134C4745C2E6AE [email protected]
1,666,293,959 *AF546F6816771E9EF8673AFC9B5D68CF46665318 WARNERPOBLETE
1,666,293,960 *AF5E46754BCF92CF8838032F2681EFD127098C10 HANS.MASSIMINO
1,666,293,961 *AF5CF8114DBB2941A611DB6D9227C2093A8EAF42 webzinerockk3r
1,666,293,962 *AF59E51A7A7BB80D249543646DB4BFCDFFCBC544 harpursville
1,666,293,963 *AF54657CBE656DBC29CB2D5B09FB705468257EB1 WENDYWINNALL
1,666,293,964 *AF5DC8A16DB299325BFDC9A28CC66089135E9785 [email protected]
1,666,293,965 *AF5FFC0AF0B37A6CD8D4C30A62359F13DFB0CA62 [email protected]
1,666,293,966 *AF5F9E675D775FAB46F79D2D6825BBCB5E389A6C [email protected]
1,666,293,967 *AF597FEA42E3729F36DD4D567B12A0FB651EC99B HE4D.$P4C
1,666,293,968 *AF513E1A3A987F976226373D648546B5D7B7BCD1 wesleygrant
1,666,293,969 *AF58A2B4083CEFC47F6993D286001BF81CCCA1C7 WFLLAYSW70
1,666,293,970 *AF5CF3C61E99F94FCD14276FB1FF66DA4A9A75ED HERMANMCGOOGAN
1,666,293,971 *AF5DE78E4D75207BE8E2D4FC92CFBB1DA0452E59 dx548
1,666,293,972 *AF556026BD9854B03352E6D5C3E71D923254763A WILD-SIDE-OF-LIFE/-IT-WAS'T-GOD-WHO-MADE-HONKY-TONK-ANGELS
1,666,293,973 *AF5D3EDC30D6D73CE76573DB7EEBA32D55B98133 WILLIAMS.CUBITO
1,666,293,974 *AF55A6F664A2BFA6F8C864353A991965F7772A1A hickoryphylloxera
1,666,293,975 *AF5D83DAAD752E5C7BC016E428BCF735D7D50130 wilson.gregorio
1,666,293,976 *AF5A32B4769F461C4B6772A411C7C176C89980B9 hkg
1,666,293,977 *AF553B07169AFFC53F7B5197D46237B469294A0A HOMPAS
1,666,293,978 *AF597469DEB69A92D9B853399CFFF6C0E60686C8 HOSKIATE8
1,666,293,979 *AF578A2144499F344B61C13EB3C4D6C27276235A WTCHMKRING
1,666,293,980 *AF5E7956A6B92EA39119906BDE1588F9D986F504 hsrcpknagd
1,666,293,981 *AF59879AA5EC2DB0C1E2E46EB86B51C9ADC6C968 h+t,
1,666,293,982 *AF5DF9C0362A4BFE032D765E4A005A72AA73A33D EDWARD.SCHILDGEN
1,666,293,983 *AF5F791D9AF50BE56C91F6F4DFD166D2C7DA6323 HUBGIDSW
1,666,293,984 *AF5163ED697B23FF3F62CA248F8D605943EA1044 WWW.LIVEPERFORMANCE.COM
1,666,293,985 *AF55AFA3F58A27C134F36A816FCCC2199E324444 ef8:h
1,666,293,986 *AF5A5C89C2F38C3920DBF906F17E7D53771FD457 x21e2d
1,666,293,987 *AF5A2C3F9838EB1F7E644285FD8DCE897089868E HYVITETT4
1,666,293,988 *AF507B84B1D03A98BC210E783399830E6E4064B0 xanthrochroid
1,666,293,989 *AF5D0153F1DDCD609F88401EAE503E4F87D47ED9 EILIKRINA3
1,666,293,990 *AF56542E3A158E8D0100481F321AB498B9CB131A Ein.Ball-Erlebnis
1,666,293,991 *AF5AA52DCAE0DF334B94A3CF0296333BB2480774 ICEBE4M
1,666,293,992 *AF523B1EBD562530631A29481091F00D6644A05B ELBERT.SALKELD
1,666,293,993 *AF5B54316A2650357576993EC2582FA3E7F0C8C9 [email protected]
1,666,293,994 *AF53C90B06F8993F452622AA3B9022688D662742 ELEGEMVAN
1,666,293,995 *AF59316AE92D4E9E911398AA957E3B3CCDDFF029 ellissas
1,666,293,996 *AF5BA818E074A1403D7B24BDBC4C055F60B6E5CA YANDEL588
1,666,293,997 *AF534A0ECAAD736FCCA0CB29B07F1F17977A9A53 iluvsparks89
1,666,293,998 *AF5721553FD7DB1027E1F2187B9CF2418BFF2C0D #YBAA
1,666,293,999 *AF58CD3A0962240482AA98EB28BCE36418E6D77F [email protected]
1,666,294,000 *AF5F040A733F8ECCF63DB5188872ED0EC6E84320 YN{H
1,666,294,001 *AF5DEAA8EC11C90F1DC93D86C5B4F4F00F75346E INHIEVEN8
1,666,294,002 *AF5B73858BEBB7B8B3DC076683D84A823B57A016 yonghibner
1,666,294,003 *AF51C41AFE137D06961D4835C4C2EDFCCB32E784 YOSUA-BUATON
1,666,294,004 *AF50027FE1CE0D23BE14F5F35659D76BF80E8901 EODIEIA
1,666,294,005 *AF5DDFE5CCFAB85C75D40109C230746C4F1C1262 [email protected]
1,666,294,006 *AF5E7DE617B301BDD5E80B13E533E2AB99594041 [email protected]
1,666,294,007 *AF5BF48CFCF7920CD36C05C503DFE30DEC71CC10 IOOZRETA4
1,666,294,008 *AF59BA771C6FF25A8A238B6693DFA60127B330FA ip/_
1,666,294,009 *AF532D1AD006669A20E4A9E53BA728AD799371B8 ericgersten
1,666,294,010 *AF51674EF894C5BA44427F705B37D3722B8F77B1 erickloforte
1,666,294,011 *AF54AE3E47A20C374895B9412A7EC537AE74AC1C IRSGNURP
1,666,294,012 *AF508412399743444DA1FEC86B6EC7D00B0E0C84 [email protected]
1,666,294,013 *AF52107C158B04A4C0102B9155A958DFDF32C608 ESCUENCA
1,666,294,014 *AF50E899F914FA817B89A786EEE7AD0E25AD72EB e'$t
1,666,294,015 *AF5A5BF1B4C8E628D420F3E2C9B32D3576C7CCE9 ivorywoolems
1,666,294,016 *AF5D6A4542C5FB906B14B2C188EC581B5DEE28D4 ETYBREBU
1,666,294,017 *AF52FE88DF9A7DD19604F8884BC42A5A73303577 ZANEPRESSMAN
1,666,294,018 *AF578A454BBBD92BCD444375D1CFD86D154DAFFB eubritaincelebsgaza
1,666,294,019 *AF5F299AC3708BE1A687B4A0AC91B3D3522B95D4 JANDZWONKOWSKI
1,666,294,020 *AF5B79163C1A52C714B497AAF6A000AD6CA0395F JANECKA
1,666,294,021 *AF5A1D6ED66B52EE5EE050C92306C0DFC0C8B96E zheng.xiao.xin
1,666,294,022 *AF53BA2310CEAEAC9D3D6EA669BFF5451E435941 JAVIERMCMENAMIN
1,666,294,023 *AF53DF0C6E1082F0DC3A4C1DD88CC6895D207916 f1054
1,666,294,024 *AF5600103ED853A2BA8DD9954273C7DF69B2DA3F JDEMAREY
1,666,294,025 *AF5427D38837FB354A6ED10C886539DE3FC994BE JEFFEREY.AILES
1,666,294,026 *AF58E9B7EA998554DA0EC5649B745CCAD41E55E8 ZIELFILMKASTEN
1,666,294,027 *AF52BF63F4BB2A29687CAF9995C5780A45A5A2FE zientziaz
1,666,294,028 *AF5864F04626D36FAE901EA74A5B9FB924411692 FAHRPLANM
1,666,294,029 *AF548BC3A52DAF67520EB9EA48409A915DA4E9BC [email protected]
1,666,294,030 *AF5DB81424D38A7A52A03AA7EEC9B6C540515712 ZUTHMEN
1,666,294,031 *AF5047F2E532280496408D126FFDEDA3B6494A53 fbc|
1,666,294,032 *AF51F140A5CA8E55A3441E9C44B8068282D5CBA0 [email protected]
1,666,294,033 *AF55C34C51C7D31B31789037DEECC783BD791AA0 [email protected]
1,666,294,034 *AF5B616D73033DD844AA97DE777D40EB0DF1C188 fengtzul
1,666,294,035 *AF51C0D4CC2A11FCC84416A363F264CF0FCF896A АТРОНИЙ
1,666,294,036 *AF55631E11533B3C15013B8108D645DF20DB6EE2 JOE.WHETSTINE
1,666,294,037 *AF577FF2F4CC920FB43D2FA1E421B8B6C194668B FIEG2
1,666,294,038 *AF584134CA76E74221DD888EDBCE4549B3D47022 «взглядах
1,666,294,039 *AF5CAE9B992EE2EC679298C3D9BAFDBAC55FDCC7 жуяге
1,666,294,040 *AF5ED2019B839C68A1A809B83458070AC82A3148 FLEGMATIEKERS
1,666,294,041 *AF562F561A783D75064B7EE45E5ABB89E9D078E4 JORDAN.MATLOCK
1,666,294,042 *AF54A1C09CAA5B0700DB449754B5C205013FFDA4 «медея»
1,666,294,043 *AF587018C158C049B7E89C093558CB9911E560E2 JOSPEH.BEHMER
1,666,294,044 *AF5E0438C8B8A8E5D49918044F09200BA9709A9B ПЕРЕВИЩЕНИМ
1,666,294,045 *AF5FEE429A015574F5BD40464E634E5376325F75 [email protected]
1,666,294,046 *AF520CC9BC9751DB720DD2161DF6B8565AA6DD2C FRANCES.BELLOMA
1,666,294,047 *AF5DF52D03C20C79B1816B4D8BE0B8BDFBA051AE judsonlochan
1,666,294,048 *AF55BE0E723355345444F4B31CB9421E4A2A27B7 ПРОЯСНЕНИЙ
1,666,294,049 *AF5AF7F9DBC067ECFFCB22AAA299E216B3F5BABB [email protected]
1,666,294,050 *AF50C1CDA018AC20E945F8D7B097040899DC2AD7 FRANK.LINE
1,666,294,051 *AF514C5F761F2182BD644D68147F1E4A149694B6 JULIUSMERLING
1,666,294,052 *AF51535D2EEEA71B14BCE5B6CB0D0D38C4FC775F JUSTIN.STUCKY
1,666,294,053 *AF536F133DDE050F4387F0C5A22BBE1DB7092441 JUSTIN YODER
1,666,294,054 *AF57A67EBF4A2FAF196F25878FA996A87322A95D jvf
1,666,294,055 *AF5041DCC1BC8753F86794E21AF4332C4FE926FD торические
1,666,294,056 *AF5B6ABC167D7D82E4E04B970D65D7A35F1988D1 [email protected]
1,666,294,057 *AF522B972866DFC5577A88C0E562FF99C005CC0D FRUITMARKT7
1,666,294,058 *AF584D2D9920051E00AA72D76CE650C509868483 karoly
1,666,294,059 *AF5E3EB69A2C45563C51D42880AACD0FCB5EFBB0 KATLIKA
1,666,294,060 *AF516279A576D43CBB6263020693F065450C7F38 fungunturs
1,666,294,061 *AF51701D5A9902E845EE4BE7F936F08C023B5F75 KDECOURSEY
1,666,294,062 *AF52715BBCBA84C6C4A47F5E310105C7B9CAF78A g4m81t$
1,666,294,063 *AF526C4E2AE2FC903A8F46476F18A135A52986DC KENDRICK.MARZETTE
1,666,294,064 *AF5E96FF6E31A1301F1B1E6A140FA6B0A8F9BBAE KENDRICK.ZOLLA
1,666,294,065 *AF5BD39E27B7FA6FE09CFBC03705CAAFF65BCE35 GABYTHUNDER
1,666,294,066 *AF5682D768417A13CD5C718E3E602CBA5C7928A0 GAJAMAGIC
1,666,294,067 *AF534B329CAB6E848DB8B86FACD7209762B3E90F KERAMKESIL
1,666,294,068 *AF5D7120A0297AA03C26243DEE615E9DC678ACD0 kettőssége
1,666,294,069 *AF5D5186D7D151F7820CE2486444C36176EC8BBE GARENEKE
1,666,294,070 *AF535D1D1B686B5F26C0721771DEAD700A7D4FED kilocycle.'k/I/l/@/,s/aI/k/@/l
1,666,294,071 *AF5A23F2BD855204AA6B0BFD48A5A99569DE9346 KINDERGRABES
1,666,294,072 *AF5F99DF9C137BC43156BF96A4A4F01823B48175 GARTHKLUN
1,666,294,073 *AF51A515A1AB6ADE082C3F0D39921209BC8BED4C GASTON.MAMONE
1,666,294,074 *AF51DE1A15519B1C095404A72BD69F89CA8400F7 gavindelossantos
1,666,294,075 *AF595AB3A69E6CD1D0C67E4D26D502B3578B4D42 KLOSBR
1,666,294,076 *AF541C27BC0A291C2EE361FCEA10F51247BF8D1A [email protected]
1,666,294,077 *AF5ADA2A766296D03A6D6E198701BF17DFD8041B gdcw
1,666,294,078 *AF5B573BA26ED96CE19A398375A026132C5C31B6 gen-von-mir
1,666,294,079 *AF5A95F544374504154CA40C1CDAD285EFDA6193 [email protected]
1,666,294,080 *AF5A62F16C8A647E39CE927D601BA321F97A0604 KORONOGRAFIH
1,666,294,081 *AF57870D19953570E7BCEDF15D280D3C594FA41C GERARDOFIREMAN
1,666,294,082 *AF54E5DBCBE0DA33EE8B5CE81274D4FB1E9ED8E5 GESAMTTHERAPIE
1,666,294,083 *AF5A064EC3B3DCBA618104310DF9D73EECA08799 KRINPYL
1,666,294,084 *AF51A6CCDB045343A5EC88200C2C9C4028971FC3 [email protected]
1,666,294,085 *AF558AFC18C7431BC8B1E3181D6B39C878DC2AF0 KYLIEBAUER
1,666,294,086 *AF5DB740ECE9468BFE0570ECAFA9BE2D6ECB78CA goedgemaakte.
1,666,294,087 *AF5628F70B0899568FFDB07491FE86D53D4B50F1 [email protected]
1,666,294,088 *AF5984FFF199B555341FEB3BB9747ED74629191B [email protected]
1,666,294,089 *AF580966D3969AF33C82D28B9DE559FA8AF439A9 lamerkabel
1,666,294,090 *AF578EDA2889A644C478898B4D94E0D77416B8BA grantmartorell
1,666,294,091 *AF5001D36028F7CD29E240B832AA0E482C1BD4B0 LAURASMITHBARRY
1,666,294,092 *AF5B0B457438386C6AE0CD624D49BC65DBFA3D4F lavernbianca
1,666,294,093 *AF5AAEE3FCA58A2E6C5678CFEAAF2407A50BC76A greenmillion
1,666,294,094 *AF5F413388D9690637CEF6AB0F03E7280460DC27 LEINUNGFAMILY
1,666,294,095 *AF5BD1CF9C7D2F64D1F791FFE93993E0CE17813A gurbroopping
1,666,294,096 *AF5A72F9312F89C8A2FFB0D1C769444D7B1A50EE lenkoeppe
1,666,294,097 *AF53566C76861A14FE7C09B5C4B48C5BAB16CA1D [email protected]
1,666,294,098 *AF592F020CD92CFA51BAB3762F4A90C1ACA5660E leongschwind
1,666,294,099 *AF5EFC3E437D084F78DE2E195A5E5C2B43E6B32F LEONTOVICH./.WILHOVSKY
1,666,294,100 *AF5D20F0DC1447A1C9FD3753D3CD670ADD4E4993 <H3><A NAME="STATEMENTSANDTOKENS">
1,666,294,101 *AF5E48E29F468B133BDE71948E306D97827EC927 [email protected]
1,666,294,102 *AF5966C3C277A6E1D5AAC73C103F717ED0C04801 harrisonimhof
1,666,294,103 *AF5F1B439ADA24F05E61ADDFF8646D8D97EA8447 [email protected]
1,666,294,104 *AF5B18C4060484F431E29F1015683DF600EBB358 LIZA MAJID
1,666,294,105 *AF5C39647EBF45186D62CD83593E11BF927378AF HERSHELJARRELLS
1,666,294,106 *AF58080E21AC16C9D47071809986E7FA60F44281 HIDDENCATHYGLASS
1,666,294,107 *AF5DBE8912474B41DA7546E3E8E85C0312E281C5 himpanjshiri-tajik
1,666,294,108 *AF5067F39D9A4F08C8CBEAA2037A87E5106DC9CA hirsutus
1,666,294,109 *AF550F9F4E40CFBE8D6BC891663B7C74AFBA2AD4 hiwc
1,666,294,110 *AF54B9A5B33F303935F1BA08E78B82EDFCFF3FAC 08-02-1126
1,666,294,111 *AF5C87DF8BEBE5BF70F0C1F1EEF258DC64A65174 HOUSE THEME
1,666,294,112 *AF5F572CBB1C29E65329030B607A95A1F51D8386 LUCKYRACCOON(ヒビワレ)
1,666,294,113 *AF5E8442E4549CF3B612AC650D0FD22EFC913ECE LUIGI.KEASLEY
1,666,294,114 *AF5DA5939C3B06E25EBABA32936DA4F82F431C39 LUKEEVERETT17
1,666,294,115 *AF5498A20298ECC452937B4392A4F39E61DFDEBC [email protected]
1,666,294,116 *AF583E93C01DA9EB7C27D50351FC0EE5DDA3D124 httpwwwinxnetworki
1,666,294,117 *AF501D440F239EC79899AEAED78988289201D7A5 httpwwwntgovaupow
1,666,294,118 *AF5B83B71C820BA03F397FE3CD2FAFEB5FEB1A56 1131070 HANKE ON VOIMASSA OLEVAN ASEMAKAAVAN MUKAINEN
1,666,294,119 *AF51F47A76B27A01BADB86BAA19C6DA43088C88C MABELY16
1,666,294,120 *AF52BA653A5271AF520A525B5D60F234A63B4B8F [email protected]
1,666,294,121 *AF59E9484750F487D944E7054784A0EF48EF2D34 1328489 therearevirtuallynocherryblossomsonthetrees
1,666,294,122 *AF531A2A4CF6A7A9DA51C324418452EC8214DBC0 madregilda
1,666,294,123 *AF5434AC0A4C913C60192E89ABCA25D50991411F [email protected]
1,666,294,124 *AF5094E230DFE909422BAC16A313A653F6E3E2A1 1433256 MOSTLY , THE MAGAZINE IS SOLD ON NEWSSTANDS
1,666,294,125 *AF5C3FE391BC624185444F2C0B3D1E699C4FF2F5 icepailsed
1,666,294,126 *AF592F5DD49F96EAB480F30FFE19145B13BB84CD ilovefaust1992
1,666,294,127 *AF56EA0EEF08ECD4BC2803C0199CD3A11FA75B4A ilovestrawberry20
1,666,294,128 *AF5CE70E7FC6D9DC3319BC6403212D6AF7704A25 I'm-a-Good-Boy
1,666,294,129 *AF5D49F1BA550EF3432BB4CEEA3E63637148CDDD 1a480ee22b816dc720db7caab466fdc3-ff119796
1,666,294,130 *AF5C551D1D6FC7F4FFA73924CA1DE46CFD831BA4 MAUROHUM
1,666,294,131 *AF5EF648280EFC5CD216230B651B02741FF6D3A6 1.bieljura
1,666,294,132 *AF53F65044EF1DA654DC400150AA3625DDA5A4D6 MCARLENS
1,666,294,133 *AF58EECE6F3D40A38F1FBB2A7D50C7499E903ED2 1.CPM:N
1,666,294,134 *AF5306161D565A3218B877E70731347331034B91 1.edevart
1,666,294,135 *AF5C81A1E3E1972D65C5E24E03CC48A0B1C46E03 MELANCHOLY. UNDERSTANDING
1,666,294,136 *AF55C0F12412CBA381011D282850886D564BD19B MICHAL.OHAYON
1,666,294,137 *AF5B37A4A6EC4522B7ADB57A1D6FFC76B2C359D0 miguel-aldea
1,666,294,138 *AF5E19362F34C2E59DC6145A0909EA16FCE62015 [email protected]
1,666,294,139 *AF57554957A930FD392A4A33F6CC25D71F9815BD jacintoholets
1,666,294,140 *AF5BAE0B4D6B5BD5D4CF78A68ECC0EE455EF49C1 minutes)」
1,666,294,141 *AF5AAEEE217F151CA8E67382CFDF86E3B5DC4081 1standortgegner
1,666,294,142 *AF57343FD0B8A52D013E3E16D99A95921750DE03 [email protected]
1,666,294,143 *AF5D3D98628D536B39C3FC5FD06073342B25E705 1.UGRATILMAMDAN
1,666,294,144 *AF5A1E05588A52A06D34231441C8C52826982CC6 Molten-Universe-Volume-Two
1,666,294,145 *AF551C4CEE69F204F7EB111CECBA02A7A264877B JAIMES79
1,666,294,146 *AF54A9E7F6341D22449FFA8F4935BB1E3001E9DF mommygreene3
1,666,294,147 *AF55E5C17FF7BE2111939AC35F50A061E3163D8D MOO590RANK659
1,666,294,148 *AF583C00A8CFCB07FD4B9EB2A1686DBDF400DC41 JAN.ZIELESCH
1,666,294,149 *AF5F12F80F2E67702DA4A4734B5BA1A025C3AC6B MRPHOTO
1,666,294,150 *AF50A19FA30E634D26C24778FAAD9B371D364236 MUNDIALIZLOEI1234
1,666,294,151 *AF585A59EF57347C4A65F27F4C6CA1746C612395 23031699
1,666,294,152 *AF5C74F6BB12EA2C487BA2E34706C0F9550DA1A1 243442 pelastusliiviesite-flytv
1,666,294,153 *AF507E53D2B5B140FD46F91ABE416D2F8ED4479C mythicises5
1,666,294,154 *AF56292ACD3980DBCCE4633CB241147389F856C6 2787612 SE SIS
1,666,294,155 *AF52091669D7AAAB18C32084132BBF0C9C8197C4 2835146 KOUKENYHTEYTEENPERUSTETAANHUUMEKOULUTUSTY
1,666,294,156 *AF5723C397B26E00685CB2F8762AEE529D9B4FA5 JERALDBLENMAN
1,666,294,157 *AF5B746E4E3F1F1390A22A25B8B12877C94BEA09 jeraldstefan
1,666,294,158 *AF56B43644CD024CB3F897B9F3C5734B8FF520C6 nani,-nani-(anon)
1,666,294,159 *AF56476A068655AA463BA162B1A6A2C46E497E3F NASHLYNALVARADO
1,666,294,160 *AF5D079D974AB51E06E1C3605BCFC9BE62335889 NATHANESPINOL
1,666,294,161 *AF5B1BC3D3191583965DAEF7EDF07BDB535076C3 JEWELL.CORDASCO
1,666,294,162 *AF5EFD373CC4C09BA061CABD704FEFE38DED007B [email protected]
1,666,294,163 *AF5CB2944C5926E00D2F26946D28338049B9BAC3 neas.de.ferrocarril.en.espa
1,666,294,164 *AF52C348E2DEFD0D1749254755C3C01400A5BB55 NEATRED7
1,666,294,165 *AF5A4EF2071BA09A83A608D2DD2F9042A1ECEB1A 2-HAFEZ
1,666,294,166 *AF5EBAD948757A1F3ED8F4459A965853DCCE5135 2ILOVEMELODY5
1,666,294,167 *AF53C567B1AAF33FBC8D633119064CE85167124E NELUHIDEG
1,666,294,168 *AF5D29D96371E5BD64ED4E0CFFE4C97688CD956C nereksam
1,666,294,169 *AF5D4FC0A05CF7D7A9E75F5B28A6FD4E16142C81 2NAVLHTE
1,666,294,170 *AF5E75EB05D2A93D82701BF79CF626A1F59F7970 joelburd
1,666,294,171 *AF5DBEC903299E7CF5645619FF395BC3E40A76AB JOEL.C.DE.VERA
1,666,294,172 *AF586D07DFB33B22CF0D65A5AA1DDEF9F46D6F26 /*.nextport.:
1,666,294,173 *AF5674CBFBF0533B7D2F5F6D4225ED576535E294 NICKPOKORNY
1,666,294,174 *AF5571A7E9E6331C23688C8ECB2E41F98F18AAC3 37.RUSLARLA
1,666,294,175 *AF5DFC5FF489AEB84D35D44D38FB501A14CCC4B6 3BREVLIG
1,666,294,176 *AF54189BAD23CC7D372E5FC6F97A4B90366FDEC6 3ELOTSIFAR
1,666,294,177 *AF5733688413A30B6BCBF98D7E0FCFFAF6724D0C NNXPRNC0
1,666,294,178 *AF5A5B9CF37427874103BA12002A7285FE51B3FC JUELSTORP
1,666,294,179 *AF5BE6CBF9E5E686D7A9EC10D4C23103A8333F3D JULIEHO
1,666,294,180 *AF510D31B01D94454080F261CC2F40286A13F345 karen.hiscocks
1,666,294,181 *AF59DA1E418FCF65EEE7674F037559376AF9F1E7 KARIN_B_DUNN
1,666,294,182 *AF51C83FAFC03D61BB69E572E4F069D1848C631B kaylacheesman
1,666,294,183 *AF5396CF2016BB0CED37CF92F1767EF44FC79E83 [email protected]
1,666,294,184 *AF59128C42C27279901EB5C1F16A1F3884FCFBE0 4ESTECBSW
1,666,294,185 *AF5DCBFD66EDEACDEF428CFDEAA0F5114757B338 KFADOD
1,666,294,186 *AF50AD74C517897ED250F35E8F0EADF456693373 4JESTERMOUSE
1,666,294,187 *AF51884D44F3D23D01346BBD7CA16393D59DC8E8 4-NIMENKANTAJIA
1,666,294,188 *AF5DD9BCDFC94E5E4AD8B16ADDC775E77D79BBA5 KIRJANDUSMAAILMA
1,666,294,189 *AF58E75FB1B3CCF507C4001F228AB148CE108CCF 4rauhanturvaajiksi
1,666,294,190 *AF5F5C148BF2315D750A9030A22D93160F0C1CB2 kleinerche
1,666,294,191 *AF5119C13E2B473E83F26CFBCD0FCD7CE975B46E KRISTY STOCKWELL
1,666,294,192 *AF5429B07B460AF8D7736FE8387A3EBED6914BAE 539425 professori hodgson kehuu wmu:n opiskelijoita eritt
1,666,294,193 *AF5E3C70CDEB0E3DECFAFBE39CABDA02100E75FB ORDIN
1,666,294,194 *AF544C11B728F0B65B49DA98D4730B63A5DF722F OREZZEMS
1,666,294,195 *AF5F233DE4D4BDC6B371795B339D7CC266F79E94 LAGUNACANAIMA1
1,666,294,196 *AF57004F006D064525534DB91B161E5FF120AF2B 5jump-cutting
1,666,294,197 *AF5FC151EDFCB06E3747507A3A86A7295428BD62 [email protected]
1,666,294,198 *AF5883588E4E23C0EE83429DF75F89D325A17C85 ovtsmez3
1,666,294,199 *AF51FAC5C881DC65328F7995908CE136CD90CDDD LBUSCHKUHL
1,666,294,200 *AF557727559C4099BD16D79F23B0417A251EA9EB P359363
1,666,294,201 *AF5EC77C4CA7189CF6AFC1666BF29B16007C46C7 p3rs+4lss
1,666,294,202 *AF5C27B2D4FD754490DDBC999B5C29CF7632349E PAIGE-BREEN
1,666,294,203 *AF5DF2457DAEA353DA74D2357AC5C72515F73A1A PAIKOVITCH
1,666,294,204 *AF57B2FBBCBDE923A150AD5CC070868CCEF5A02D PANCAKE2009
1,666,294,205 *AF5860C4394E24D14D79EE07F38B8A7937B1D13E 5thebrewster4
1,666,294,206 *AF55DFBFD3AC9CFF7D19CD6527F828CFB74F02CA 609056 YAPISMA ONCESI ISLEM BKZ . YUZEY HAZIRLIGI .
1,666,294,207 *AF557A15BFF102B0C1DCEC4C01AC05D6B0E0FAEA [email protected]
1,666,294,208 *AF5EF188323084AD14B855CDEB167FAAE6351F22 lesyorkshire
1,666,294,209 *AF56DCA25DA664B84703B1063527E2B4D5808B69 [email protected]
1,666,294,210 *AF56D6FF89AE9EEBA045888FA8C16BD0945B21A7 6BSWCITICARD
1,666,294,211 *AF59FF091D0578145AC628DD010F534410E89045 [email protected]
1,666,294,212 *AF54BE725B348E143D07DAD1B8C4EF64DCF6C423 PEDROSHIRA
1,666,294,213 *AF5D682B297E1210FE7FE43A814BACC822B771FC 6DOOBIERANDY
1,666,294,214 *AF58AEFB258F3400E2CC817490D9C941A2B77CDF LIONEL.HERLOCKER
1,666,294,215 *AF57A7E3EFF0DCC835CCD1E6CD070845EEA667FD LISA MUSE
1,666,294,216 *AF5BB42817A33F710CDA35BA2B6D48073271271A PEPPEBARRA
1,666,294,217 *AF54DCD8D29E6D2CA8B5BC788F55A6D7A96EE508 6MEGADONT
1,666,294,218 *AF5D2AAA621346EF3F22BABA61E0A42C9E7F07E1 LONGTÉMPS
1,666,294,219 *AF547E7D853D7A4040A6CA29B8E17A1E5688A44D LONNIE.SAKKAS
1,666,294,220 *AF5676DDC77190E5DC8E186B127DFF2DE4F476A1 LONPOLYNICE
1,666,294,221 *AF5922D257D8E86BBAC401D1EC77B4B6D7C04B6D LORENZO069
1,666,294,222 *AF595A7B681E36331EE6FA7357C009B20237DD11 PN:
1,666,294,223 *AF56422E132AC8ED20F241049EB6584D79E9C5F3 [email protected]
1,666,294,224 *AF5B5FF0AE13B3525D14EA50D0B29FB6C98F8AEC LSHARMER
1,666,294,225 *AF55958C56EED14214DEA65AF38212F33ACF5A8A ls*v
1,666,294,226 *AF5CFB8934FE052390964ABBA4E6A581A409214B PRENTOY
1,666,294,227 *AF5D80B3A739A5058F1D82BA29CDBFC7A2557B91 PRESENTADDITI
1,666,294,228 *AF52023D84CAA64E459AFFAB6CC393B7E8E5AF71 LUIS.PATRYLAK
1,666,294,229 *AF58A67D1EA6E66C151C31CD0A0FAA9A4577D234 7HOUPELOND
1,666,294,230 *AF59748F7BBA8FAA80F46953B8F70A8D88DF8E55 promovendae1
1,666,294,231 *AF5A8F76A60995E80158600F1FA2B9AC1D036D82 ps3ud08i09r4phic41
1,666,294,232 *AF5AFC77AD3E778F8BA9718D5C24C05043F97BE7 lz9
1,666,294,233 *AF5014568C08A2DD9011EB563AE00ED11FC7EB47 PUPUNETTE
1,666,294,234 *AF5CE6E1A92528A314FACCDDB3B9E4C0B71AAA5A macneshing
1,666,294,235 *AF5B7AE32E182F1E91852AD0385BD48E7C640005 [email protected]
1,666,294,236 *AF58D26A5B64AC2F1E6038A4FDA5D3D03CD38D0C MACUR8
1,666,294,237 *AF5D1F679B5C5B5947E9CB7A650B784D99D559C5 800WILLSEL
1,666,294,238 *AF5969A23747DCD81115089D9ECA52E26437B0E7 8838WSX
1,666,294,239 *AF512E5C88B315BDCAD64AB01B762A29C7E451D7 [email protected]
1,666,294,240 *AF5AAFF06C20E9E20A517A4254A49BB39F89DB07 managmting
1,666,294,241 *AF548114B7972FFF48CB2413DB702BBA21398D23 QUERERESNOPODER
1,666,294,242 *AF569F59C528E63B910F0A00392800043D8AE61B QUINTIN.STREITENBERGE
1,666,294,243 *AF56F80B14AF3FB7AD43AF544E4B09E6D8663750 MARCELSERPICO
1,666,294,244 *AF5BB324A2444FE7C503C79991FBE15CF28925DA 8HERIJKENS
1,666,294,245 *AF5E000B569EDFF4D88829C9D9D32F2D123BF0F0 MARGARETHAYWARD
1,666,294,246 *AF50B2FE574F43E1A67F8690C7270785FA3B4705 [email protected]
1,666,294,247 *AF5785D4EC63F1D9D65D1900C2635611EB1EB0E5 mark.glascock
1,666,294,248 *AF578AE0CBB0A885B3F8AB2F823F8A89D6F618DF randellmulverhill
1,666,294,249 *AF54B19025679E475C56B9AFE8D44946CB49D857 8SOMTABUS
1,666,294,250 *AF5E3D7FAF45DF2009E4F9B7934F798FD2D139A0 RANKING DE CREACIONES SIN REDIRECCIONESPOC-OBAN
1,666,294,251 *AF56721ACE5DA0F8C7F441684149A8FCB3A70FB4 8SVOLTANOS
1,666,294,252 *AF5DB275FF75A2A47FA072854E9A74D9167323F5 RAYVANGORP
1,666,294,253 *AF5FB3C21BF0A67C44BAD8D83D002EA90CBA203A rayvisconti
1,666,294,254 *AF560843B8F54DA6941ABB697AA4E7B55BE996ED aabf``
1,666,294,255 *AF5F66A546F38B91C283B7FBE9CB4DEEFD65BC7D RENALDOMICHONSKI
1,666,294,256 *AF5653F67AD1C3A6E7B6E2B54A3BC3F87878E55B RENALDO.VINCELETTE
1,666,294,257 *AF5D09288D57947207C2ECA3214C2E2024BAFB94 MENETOURATEL
1,666,294,258 *AF5C904A3B640E200E8AAFCC0CC13052EE87DC1F REPASABA6
1,666,294,259 *AF56D0373FDFF952722319170E7C9794623C6357 resonusing
1,666,294,260 *AF51D7C05E2E337E2DBA3257F85F16F7CA619D04 REXWAINSCOTT
1,666,294,261 *AF5A6AEA3690F0DDC587E405ABEB33429A5D5BAD a-b!r
1,666,294,262 *AF569E5C47BC16EB33D3DCC0DEBE37A52315C19C MIGUEL.OBERLIES
1,666,294,263 *AF5FA9B2FA1DF2DE2AC444F13EDA0C1A9EA71C15 MIHAIVITEAZULINREGIALUISERGIUNICOLAESCUCELMAIVIZIONATFILMROMANESCININTREAGALUME
1,666,294,264 *AF5492B2115320D873A8026592D681D474D88077 minute-felicia
1,666,294,265 *AF5C7869783CD587AA3A79D52D609E89A0176EE0 ad!ca
1,666,294,266 *AF59053218AE331626ED61E0C5CC2AABA2832013 MOE HAMADA
1,666,294,267 *AF580DB7A160AFD1B1E91678B1DA375AD22DCC12 monojit-das
1,666,294,268 *AF59E1E1B7F98DA5188C1F3A8F3970EF0A679819 monophysitic
1,666,294,269 *AF5B2C14AAE117E0AF3FA6B946555F6B14ECCC83 MONROESIEVERTSEN
1,666,294,270 *AF5F578D1DFBA5FD31B0EB8F89E0EBCA497E6DC9 MOOSEMUSSOLINI
1,666,294,271 *AF5124CE3E4CEBA380B586CAD523E1FBA5E46703 afkraste1
1,666,294,272 *AF5C9C1AB7EA35819AD89F43C76BB685099ED2C5 ROLLINGDAYS
1,666,294,273 *AF5A39BC8F0691B300BEDED0C5940D1B55BA0D8C AFT-O
1,666,294,274 *AF50807C594781077E7816A491770556F9ECD8AD mydeborah2004
1,666,294,275 *AF527E455EA958ECA72E49F89FD39E2018A02966 [email protected]
1,666,294,276 *AF546D0CA75B8F7DE42885944963F0100137B72E NAJVYBRUSENEJŠIA
1,666,294,277 *AF52B3B1F703615C910F61C13BE8DBA47B15AF60 NAMEKU
1,666,294,278 *AF563311F6BD1EF0FAD6BAC237259FFD3DFDE9D3 ROYBRANGAN
1,666,294,279 *AF5FF8B7FE86F3389366B89A3BD4ABDFD9428575 AH%M
1,666,294,280 *AF54868CDE4D57A907B167EA55A9F9A2E8FF3335 AHTBQ
1,666,294,281 *AF5935C5C4C12A9093015767A4918921BD6423A5 neusiedld
1,666,294,282 *AF58A11507E65EE36AFECCB8CE9D0E890FD96AD5 SA
1,666,294,283 *AF50A92661147AA792A6673B5401F848BF545918 SALAMI-CONNECTION
1,666,294,284 *AF5BD1212A95A68769796E6CDCC407D6591BEBF2 NICKYILLICH
1,666,294,285 *AF58E028DCE00E21DC1DDA729ECA8A0C11888E30 salvadorsereda
1,666,294,286 *AF51CC2A88918C462949F1DCA2DDB1B3232EAD9D aih4l
1,666,294,287 *AF56A0E2CC28C40FD5003D135FB2873B5A869523 aiymohtn
1,666,294,288 *AF5FCABA70D764F166614FCD9BBA58789B998BB6 NLOREMED
1,666,294,289 *AF5ABD706D49F2E08F8E542B954A32DF81B454BB NMRHH
1,666,294,290 *AF50D6373F5C0D9E6A8F750EBCD848D091793D7B samuelsesay
1,666,294,291 *AF5E7E37DF0FD3B24BDD8B09BAACA54D73DDCBE5 AKATZUKI4
1,666,294,292 *AF5295DD4F397B6535D711CAA1F4A7460B1B3A5B no-less-than-a-crime-(prelude)
1,666,294,293 *AF58771A63FDC1962FAA7FAEBC62DE86E25D8674 SANTIAGO.WENTLAND
1,666,294,294 *AF569386A3E6EFB6D0317CFD3A15BA501922FA35 [email protected]
1,666,294,295 *AF57EF4B598CDC6D2E6EA89D431E7F95A40849EC santosricke
1,666,294,296 *AF500BD284C56439F9D6DC24C3EC25A837263229 novemberben.1
1,666,294,297 *AF5248868CB709771577CE0F641FCFAB4CF2D34F ALDEN.DELAFUENTE
1,666,294,298 *AF5C317BA4804DF69E698E42AB00EF247BE3AEB1 nurgalijew
1,666,294,299 *AF53CD9DCCCE4F7E5C8386BE4C0806E9B9815D3A sea oversky
1,666,294,300 *AF5508E519E55218E8D7041FDDEB2EB33AF5F2C5 SELLABLE
1,666,294,301 *AF5B310E8DCC996594AD3FF5C0AD431CEE014BCF AMK)R
1,666,294,302 *AF570B110A82559E6AF26951AB283816B5316559 ODISKENAAN
1,666,294,303 *AF571ED145C6831B8EC1BB8D82CA10A187FA9B99 [email protected]
1,666,294,304 *AF5077AE7E24A008EAF3552EF433FA1FAD7007B7 ANDREA-MARANA
1,666,294,305 *AF59596C89EE4BFBBFA3F85B1944DFAA598CA059 SHANE.INNES
1,666,294,306 *AF5C9866A973E100D1588A127E913A64DCB1A56B [email protected]
1,666,294,307 *AF575356237BA81A4EA75E9F77E224B0E5927988 oldseacaptain(live)
1,666,294,308 *AF55BF8112E15584F773873742E48344F8B22DEB anibalmainello
1,666,294,309 *AF5A79058069BDFF81CE567B3CA8B682BA71FB36 [email protected]
1,666,294,310 *AF51D5EC058366D40BA741CFAEFE1BED544AD4F3 SHELDON.TERHAR
1,666,294,311 *AF5D3A00653E9CC3CD9E19FAA729C76C8488BFAD ANNIE MCANDREW
1,666,294,312 *AF5956B496A799714203C8678AF94D5B8740D034 shermankoppy
1,666,294,313 *AF5F41346A9C82BA73C146BBDA64E6CCF9C58D58 SHIBLUDDINA
1,666,294,314 *AF5C907C017DF84AE3635C850634F73FBFEEBFBA SHIRATSUED
1,666,294,315 *AF5003A2CB9DB65DB1AF4AC0ED07FA89293BB493 A%O_E
1,666,294,316 *AF5275AB5B06A94F806CA81D68B96CE53DDA52BB ap!_
1,666,294,317 *AF5897CE7DF19A0003FA4F8E0D83E01F8FAF320E SLITVLES5
1,666,294,318 *AF5DF3DE51052AD609946D00148481F6563814CE sloppy-train
1,666,294,319 *AF51DE7E65257CCBA0ACC606FA0D8CBA4064326E [email protected] ~0 }O{
1,666,294,320 *AF5ADE8F48718D986509F446F1503AF6B7F02154 PAHROZNÝŠKOVITÍ
1,666,294,321 *AF5CFD20F5401287175C3704B007701B44DA43F8 ARON.BORGELLA
1,666,294,322 *AF5A8D21E2A1DEDA664AF20ED4B3B9FCFDBC8B84 paladindeath
1,666,294,323 *AF568ACD2D3F805F7C2988823D867AAB450DBEE0 SOMBREMOS5
1,666,294,324 *AF588938C9FED6111399716109E5D3BEF91CE1AC asdfghjktim
1,666,294,325 *AF5CBBA8DB539743E57145DEC77AB071EDB65386 [email protected]
1,666,294,326 *AF53EED413A3FD0CB33741681586A6BC7714EC07 ATHERBY0
1,666,294,327 *AF5B069CC436432C0F1A97A1304368AE00B65151 Peep'nGame(featRayJ)
1,666,294,328 *AF5E2FE2E2B7E416F36028914FC61D9F7165A442 AWNR)
1,666,294,329 *AF54BE58EAB91352B1CCF3C341160C38C3343D0A played9
1,666,294,330 *AF55DAE852F34E3762A166C401CAAF248828E861 STANTONMABLE
1,666,294,331 *AF5B6BADE86C124F732AD6F52E410E62DBAFBC48 stantonminas
1,666,294,332 *AF50CFC191E7B079DD986FAC756A8ABFE838A3DC B6V9P
1,666,294,333 *AF5F13B3BFAC8E5CE8AAE2685DB3E207A7E0E635 babyjr
1,666,294,334 *AF534A438EBFA6433FE355986E096A4CAECF6A7E BackthefuckupMANtonioMydick
1,666,294,335 *AF5FDC262C2C2768EC6730A4BA34699C8DFA0017 PRACHOV2
1,666,294,336 *AF571C07D04D49022545D0D1A77D1CBCE9C0EB15 [email protected]
1,666,294,337 *AF5AC3A13EA0EBEDF1E71755BA88A5F4DD6E20F5 STIFTUNGSMITTEL
1,666,294,338 *AF585E770CCAAC3350CD44D2BD87489BCA1A6319 STUPAS8
1,666,294,339 *AF5BEFFF972401B3C33A4668CCEDAB9CF41A8BB9 sumpweed.
1,666,294,340 *AF51A96A1FABC6B3AE8234E543F2B5279060C396 SUSANOLIVIER0
1,666,294,341 *AF5A97A6D23F22D37B8525FFA156FC9F0FBC950F SUVALINEINIMENE
1,666,294,342 *AF5AE12B864AD135DE9783A91C13431620755C5C Beavis:'Umm
1,666,294,343 *AF5F83A2693A5A4F3EDBC1DBC27CC2015D0D06A1 q7501
1,666,294,344 *AF56833473E5AE84FD52C233FD8336797014B872 takeatrain(awakening)
1,666,294,345 *AF581E10955E78F4676508E479DB928CD30C56B6 [email protected]
1,666,294,346 *AF5E42056A36C727F4EF30851922C997E1119C1D TBABSHINKO
1,666,294,347 *AF5B797FC3E27C49D70687447B50A8DF34B3D72C BELINDAWILLEMSE
1,666,294,348 *AF56CADC1AB83B3A66FA79599780D9775ADA77E8 BENEDICT.BAPTIES
1,666,294,349 *AF5D81DD1627F771D245C90FD834146B5F148BFD {]qm1
1,666,294,350 *AF594BE9208FDDCEBAF6907E8B72FCCE81989B69 [email protected]
1,666,294,351 *AF578DB3680E8396078DB9691396B9C086B0E339 TEDDYALEXANDR9
1,666,294,352 *AF541F02C50CB7075C471B19BFF6B06AFA8AE630 q---p.~o~o.sploit
1,666,294,353 *AF5EB8165090D5A8290044671595939191807478 QUIVELDA
1,666,294,354 *AF5A28B783FA1DB5A90878BCDAD2423241E93182 r3cogn!z48!1!7y
1,666,294,355 *AF552A94A53B55FE28633BF44AB1744A55505735 r9u795r5konm
1,666,294,356 *AF50039ECD69B1733776AE7BBDDBAAC96D3E1836 rafaelfauqui
1,666,294,357 *AF536BBDC18C418E469B94C1C41C5DB71FEC9403 bf:ve
1,666,294,358 *AF55F9AFC245EBE86E0F3B962F3A30CB6A803151 b"gus
1,666,294,359 *AF5326B4105F038202B27B0D98C46C86944CFAE8 [email protected]
1,666,294,360 *AF55F9715EC1A0AA5C60171137D8096AF6192625 bi#3
1,666,294,361 *AF539AD9E5E4A796D5E7E5A69C8C296486208203 raymonwoulard
1,666,294,362 *AF52B25037FE5708767C44CB6E620CCE0DAFBD41 the1best
1,666,294,363 *AF50CE972BECD2DA4FDDA1F08ABA607A6E24C22F BILSR
1,666,294,364 *AF5F9E257B0681FB377D97FA036AB380345F1D8C BKXOJ
1,666,294,365 *AF5A4658CF025858DF01D786387971F759430547 REKREVS1
1,666,294,366 *AF597FBD7EBE1F070B225775B358758C9EA4ECE2 rel'oye1.pr
1,666,294,367 *AF58941A3D58B7BD23EBB683181AE1C488EADF7B thescout35
1,666,294,368 *AF5E308C95EEE03615299165C71CF5A71F3E5CE3 renatoduck
1,666,294,369 *AF5989E0D979D264A3D1ED9EDBC20A350617DD67 BLOCKEDKICK
1,666,294,370 *AF5D8274E5D70860983D1C11C41B4046D9027E95 THR0W1N
1,666,294,371 *AF55AD0177C7B0CB9280DA925BA780A93A665EE5 bmu1w
1,666,294,372 *AF5393D43305DD7DBA936011D80E9C39FE2CA146 TIMIAME2
1,666,294,373 *AF5D72B39798716D364F78B3D18AA48D541779C4 TIMOTHY.ALMAREZ
1,666,294,374 *AF556197F08D20F6812B5A0C0307F775E781B2F5 BOLDOGASSZONY”
1,666,294,375 *AF56593E7884310A84F79535719D6CD9B7CA6F94 TINAHOWELLS
1,666,294,376 *AF576C62B57DAB4B7869FB65D41261A0B5ABEBD0 TLICHTET0
1,666,294,377 *AF537C5F766F3FB6CC933618A0883A77B4831076 TMFQBM93C3PL
1,666,294,378 *AF54C6B9913EFA4044CDDA8ED234D65ABE79F08C bp,
1,666,294,379 *AF5A39AE6147E0DE3D660FFA7607F449AFBF338D TOMNJERRY
1,666,294,380 *AF58AACA15FDE7BE6A93371D9F258152A50B30BB BRIAN.WEAGEL
1,666,294,381 *AF5ECD9D830835B61424A8828C3EC2BE5FA8CAE1 TRACK-BY-TRACK-REVIEW-VECKATIMEST-GRIZZLY-BEAR
1,666,294,382 *AF57A69FBD08617D1B9BCA2EA2B6C0797A2677C8 [email protected]
1,666,294,383 *AF5938F540D7D6523F465E1C64FC4D303562F7F9 ROBSONOVÝMI
1,666,294,384 *AF5C0276827BC067E1B5A84AA1402A43F2C5DDBF [email protected]
1,666,294,385 *AF57032F2942FB2D3E64F20FF83DCA9700FE05A1 BRNENES9
1,666,294,386 *AF5AEBECCAB368BD5A88BEF027AEBB10ABC052FE trisha.karina.gonzales
1,666,294,387 *AF5500EE3D033879152A862AA48C0999E87EF594 B_)(T
1,666,294,388 *AF56739DD9EFDD317C394A05A833BF7D404E1083 troy.w.lenk
1,666,294,389 *AF548EDA123C9CF3009B2656323132291A964D49 trumangladden
1,666,294,390 *AF58B0C8F3F8CAFD621C774B8F6D8261891F6FA2 TRUMAN.NEESER
1,666,294,391 *AF581CF0E87A36C2CAA20DA0B3A9AE01DACAD859 ROMEO.MICHALICEK
1,666,294,392 *AF58AD005940F19999B34E927245DDF27197580E TSIMOYXA1
1,666,294,393 *AF50A255FD7478E1690739B7FC50DB7B474ED3F6 TSIPAREHTORUEN9
1,666,294,394 *AF5AB38E3D1F49BF4A7C546B37822F28B3C491C3 bt?$r
1,666,294,395 *AF5832BB22BD0A99D6A27CC6D863F10C56441B90 ROSARIOBENING
1,666,294,396 *AF5A744B276E6A4CFB8C2867C009B562E235CD2A tulsa-mckamie
1,666,294,397 *AF51B977227C8FD4C1B67B89F8E8FD39A43A988B tuplaaja
1,666,294,398 *AF5CC54E4205CC9F398435E0E0EB7A5F1577902A ROYALSLODYSKO
1,666,294,399 *AF5C45AB799CC44A720BEBD4DC7E9ABC30130A9F [email protected]
1,666,294,400 *AF5A99424D1B5808FC6138FE373EAE9A1A54D86D BURN-YOUR-ATTICUS-SHIRT-&-START-A-REAL-BAND
1,666,294,401 *AF5833841943C1E400D8891867C55B58BDBFFF26 RUSSELDORWEILER
1,666,294,402 *AF58916090F38E7052D72A218BBA9E1893106E46 [email protected]
1,666,294,403 *AF5EE90DBEB6F36D0C5E8BF5EA388A3161E26C7B RUSSELL.DONNELY
1,666,294,404 *AF53A677619ED7C07FE8563FD542B78D73DC1558 ULTRATECHNICAL6
1,666,294,405 *AF59D88B8B865C60643F17DFFEC9BF4D719627BE russursery
1,666,294,406 *AF521D133A6C33D6777898285A8C23C98366D206 RUSZENIES
1,666,294,407 *AF587005A81B58BE4652FEEA1C72CE348824DFD6 RVSARBETE3
1,666,294,408 *AF5CDF0021460EE075371FB7E6BA73E2180F4C59 RXXXXXXXXXXXBSW3
1,666,294,409 *AF5516553D552CAF185962C507B61D98861F6587 RYANFEGLEY
1,666,294,410 *AF54935E4CDD7278A2BADE13450BCA28CBD63246 RYANRIFFEE
1,666,294,411 *AF5AFE7E58245DA886D489A248DEC7D442691388 SA
1,666,294,412 *AF5FB36640596180A974D636A49DAE3D6FEA74EB bvl=
1,666,294,413 *AF59A5260A54959EC214F373276362568F153272 SAL.VANLITH
1,666,294,414 *AF5665AC4C175CC783D768CDC37208D52BD206EC SAMOLOUGHLIN
1,666,294,415 *AF5677646FDE3487E6611EB72BE4FD65A161DA8D SAMUELVALERIE9
1,666,294,416 *AF51BFA419B911A2B33ED0039655347CCEB140CC samuel-worley
1,666,294,417 *AF544307D2097D46A18B1792976B8B5C1650CDCB C010N!$E
1,666,294,418 *AF5C2060F2BDD1ACBD7C816DD2F4928754B3EC79 [email protected]
1,666,294,419 *AF5D69AAB7B4AF19F07A557569A02CE9C914D472 c.1:v
1,666,294,420 *AF503736EE5383694DB9F3432A91985272F11229 SCARSON5
1,666,294,421 *AF5FCEF2331C434F0B9E625B25E1D5BBFC9A84B8 C/5+P
1,666,294,422 *AF58428E74E47E8B4216D12BFA859C7131AB49C5 UTOPISTICKED
1,666,294,423 *AF5715E74F07F4A4B7349CA0300A49795641857C UU O~ (######P
1,666,294,424 *AF5B82AF6C585686173099055FC1E4AA7F895DCC SELLABLE
1,666,294,425 *AF51E7009B8FBA78BC2A0803C540451FBCC869E9 camilla.dale
1,666,294,426 *AF5CBA5078A653DB2B9F2CC29F9D04C56B9B2B99 capricevariations,no.44:scherzo
1,666,294,427 *AF5C896688EE3FBF364E5AC7C1770C6B266766B2 carlosieg
1,666,294,428 *AF5551062C166E095052C45A669695E131576A46 [email protected]
1,666,294,429 *AF5C1619FDB798962B8F0E7C5948CDE12D635FE7 shermandippolito
1,666,294,430 *AF5521A00E3203F4DF3984AE873DB4EE934D553F casey-fullmer
1,666,294,431 *AF5F605E7D80F9CA3F5445C3BDC1CB9E65F50323 cautu
1,666,294,432 *AF5673D28C00681319AB80F38E9E8068EDFDB4E3 cc8."
1,666,294,433 *AF5F48AAE16274CB9A7912902A5AE2E2B9F4893D SIGNAALLUURETEHNIKAGA
1,666,294,434 *AF53DC1AC944A526F09273231DC475BED00ABCB9 c:d,
1,666,294,435 *AF5E72965DB92AE9624F778D1DC37C0AFAD6D87D CDB83
1,666,294,436 *AF547681C9783ABEA65A8CD0C919350C69E4DC7C SILVERANGEL91900
1,666,294,437 *AF5736154410D71CDE7D1F5A621505E789550D17 SIMON.DRZEWIECKI
1,666,294,438 *AF506D3DA74E024D48AB85877EC4B9A9C95D7F5D VICEFREE
1,666,294,439 *AF566699DE1E5187621D9C4712D78C80CB9429A2 c!fg
1,666,294,440 *AF55A8EDFA933F74060E6DFA944C55593613F028 si.te.contar
1,666,294,441 *AF53FFEC865F87E4E797BD70217192E71CAA7AE3 SIVILLI8
1,666,294,442 *AF5F71FC4EC61EF2D43D3EE80F9E8C9CC2F22DD8 vilding9
1,666,294,443 *AF52C6B33EDC3C19474C31EFBB4765CBE8C15CFC cgs6n
1,666,294,444 *AF5D8F7EFCA8C863864EB711E56EE8BE5A468797 SLAWECZEK2
1,666,294,445 *AF557B89A46B5E03CC71CC3367EC93682F27C6A5 virf
1,666,294,446 *AF510FD7818693689FF0AA9FFD43F44F24E23BF0 CHEFIAM4
1,666,294,447 *AF53149B539295FA7AE465F4C00C4CEEFA197B64 VOORTMAAK
1,666,294,448 *AF51D5F30A6A9C21C68EB6FA5F550700D18C8D19 [email protected]
1,666,294,449 *AF57BB8211BE21AC06D7173E2D949E14F4277171 VYMENOVANI5
1,666,294,450 *AF5F83233FA6193CC7384E91986B0FBC389FC263 CHOIPOH
1,666,294,451 *AF5A58F4F5E50EA3854A907AD8E1D8424D893170 cigff
1,666,294,452 *AF59FFB1ACC497EA52B5EEB3A2C16407CA45A0D9 WAXA-TV
1,666,294,453 *AF54F9DB537C75718714415F68F66B4B1AD7FC3D cjrah
1,666,294,454 *AF50D760CB6A091647E054B7997CAF809D97E973 CLAYTON.VANSKIKE
1,666,294,455 *AF5C37853523230260D1B49EE9BBFF626169D4AE cletusmildenhall
1,666,294,456 *AF5839A6A0688B8B9FD8BAD2014B714F6899F9FE wendyelashrafi
1,666,294,457 *AF5C1F59655D07AF5BC43176A5807DC196C62918 [email protected]
1,666,294,458 *AF5BA36DDB0918CB915D6A0EA9B7C4085DC465B3 clo)6
1,666,294,459 *AF5639EC4E1DEDA01D7F8FEA775FCF3A93316D42 CLYDELASTRAPES
1,666,294,460 *AF54CC263D32BEF38810C4892538B6E684953C1C WESLEY.SON
1,666,294,461 *AF519BD52B2A75FE86835C9AF8403D4664BE9F17 c.mhj
1,666,294,462 *AF551AE15045970D19D870EF348A803253D29356 widlyne.altidor
1,666,294,463 *AF5A17F943DE269A165E156F6FBBB769F02EBCC9 wikipediadiscourage
1,666,294,464 *AF55E46A1D2ED77C9498F50665474A53C16D33D5 WIKISTYL
1,666,294,465 *AF5EBB54671E8A8C0FB1F9ADD324E9BC44AE2739 WILBERTSCHUTE
1,666,294,466 *AF56CDCE7B71AA4AD21920D9D84FC4FA3E6BE84E coccothrausteses
1,666,294,467 *AF5A7493B3D0218653C2E9A4114A5537E06DDFA9 STERKULIACOJ
1,666,294,468 *AF5A9AF15C958713C04CC835DA4A18FA31BFCEC3 stevemccarrick
1,666,294,469 *AF528D9B2EF992473E48AD174134453C0BEEDCEB COMIN.ON.TOO.STRONG
1,666,294,470 *AF598522862806E554694B9B5198475A90511953 STOSSSCHUTZRAS
1,666,294,471 *AF52001534993394B13E8EC55933E746BEBE5E91 WILSONSIMENTAL
1,666,294,472 *AF55FB2852C11DA141163036B4880C9E96E77F18 SUKWINDE
1,666,294,473 *AF54F8419A1A1B86E4B9AFB66207222B88A9D43A SUN-DANAO
1,666,294,474 *AF5DFE0BAEF19BAF84DA74A3B5C51571C221011B superpositionn:~superpositions
1,666,294,475 *AF5909C405AF9A7EC1D75EF8DE43DE63C7008F23 corporate-american-fuel
1,666,294,476 *AF5BB5D75ED2EE9E815B22BB8338BCC09807602B WOWPB-GEE
1,666,294,477 *AF5E7C4C368EC54F045C5B2425ED97CACF559C14 [email protected]
1,666,294,478 *AF53DAC7886F1E03D09423CE0BD601DC2A12EF79 [email protected]
1,666,294,479 *AF5AE37360F5B4D6630E7E81C4DE9042F3827C85 cqea%
1,666,294,480 *AF513669488001E0148E1E08B88DBF5ADB0FBBAC XED.DI.CRAPPY.THAM
1,666,294,481 *AF5D17AB2EF7F3D0FB173B215A5C64B515FBDAEC xenanconan
1,666,294,482 *AF551A985ADAAB941D3A20B6BB327D41A07788A9 TAFFYHAWKEYE0
1,666,294,483 *AF5CE9BD54403733F2F1099C958D80DCB70B7BCB tai-tin
1,666,294,484 *AF5403418AA63E9E17B8B67D3BC703487E1AC700 xnrj
1,666,294,485 *AF521CD5D8F355B337CECC9FC40240948F37D801 TAMMANYING
1,666,294,486 *AF540CD45CAAF7CAA2D9BBE38A83A76DACE9F1CD [email protected]
1,666,294,487 *AF516BC63B2A4B39FCEDA26113D4D6EDED716076 CURRENT NEWS
1,666,294,488 *AF572DB3A72BBCD7ECBC72460101E015B688AE9D TARAWOODY
1,666,294,489 *AF51E879E6F608B1C1FDFD8A07AD251741F6A492 [email protected]
1,666,294,490 *AF5DE4A44F82EC48178E1E60B3CF328777D78474 [email protected]
1,666,294,491 *AF565463243194D81CC8ABDF16C751A114CEC00D [email protected]
1,666,294,492 *AF50B383BD5CADE4EB926AEDE5D83223A6E51D26 YENTEBALI
1,666,294,493 *AF5F8AC793A5D6C0D4A1961A7F481526EE372E6E YESIRE TRETO
1,666,294,494 *AF5B373A073DB7EB5B2EE97565820292E3CB587C YETI.FITRIANI
1,666,294,495 *AF5AD07C94BBC283415D5D4BADFB383D2796340C [email protected]
1,666,294,496 *AF52C0C04E04E48097DD2339C0EB4B0CB0795661 cwvcc
1,666,294,497 *AF5D88514217D6613E60EC93887EDDB1CBFDD461 [email protected]
1,666,294,498 *AF536B3FA59569A50DD48DB833CAE75A8D4A41F1 TEMPLE.AADAL
1,666,294,499 *AF5FA6139EF454EEF4FAD1E29676FA7F0C7F3A19 tenteish3
1,666,294,500 *AF5049F53EE2CC02710AB8201C841BCB2E70C1E0 [email protected]
1,666,294,501 *AF5000C737FAA35DC77CCEAC0C065A97BDD8CFBD d2qfm
1,666,294,502 *AF50A6CFC91E3728CD3CDF714F67B7F262561432 YUSSRAANNOUS
1,666,294,503 *AF573A4DD8866E9CE40F9EF1F58CE359EAAC898D ZADOJITIED
1,666,294,504 *AF5F9BA418D883ADE6C22E1957BF1C6AF3F02604 The.Abess.Desecrator
1,666,294,505 *AF5A0D34BA6C6762FE2314F4960252617E76E6C9 thebestofbizarrefestival1987-1992(disc1)
1,666,294,506 *AF5719887DF184B15E1F7E221B85675B16766816 daf84
1,666,294,507 *AF5D119B33C9FA17D72A660BCF298A42C7E9CA95 damasiu
1,666,294,508 *AF555562E4A1F345BCCE831AFC85F3BE833BCDA5 D+ANC
1,666,294,509 *AF5F8F10A52289A0661522FB981724120786E903 ZEUSGRANDMA4
1,666,294,510 *AF5A2BAB96F7CC97B7A25D56BA366FDADAE02853 [email protected]
1,666,294,511 *AF575447FA528F80FE1CCD348D817BE94F202B4C [email protected]
1,666,294,512 *AF5594437716609583B935FBDF72B627760E60B5 the.trail.of.the.bandit
1,666,294,513 *AF52069CA2BE5791E09369C84076350B48A2622C DARRON.GOETZ
1,666,294,514 *AF5DC3F70FF66EECA32FFBE8C646A27669DF458C thmlbseasonofchroniclingthemoments
1,666,294,515 *AF5E352B6B6BAF5DDEDF630B30E225A0165BAE1A [email protected]
1,666,294,516 *AF5E43BB59BDB9B5E3CF3D44F83928B2D62BDEC0 thurmanswinny
1,666,294,517 *AF5FFF3AE70EFE0854BB2AE9E0A734E2C8A4F2FF da&x_
1,666,294,518 *AF5AE3E8A70114BF03CD13DBE2AE75CCA0BCA391 DB4)G
1,666,294,519 *AF510CB95D6485F4C45EF0ED0946D85ED58A66A3 dd617a73eec530e0b6ee5c65bb70dfbb
1,666,294,520 *AF56DFCB50DC8D9EB3176BA57BC61EC5863B4968 TINA-COSNER
1,666,294,521 *AF5732853B1DE8E121410ECB58F2BDF2DA9D85AB [email protected]
1,666,294,522 *AF5113D16B49B59896CEB44368EAD97009AE6E03 DE5p
1,666,294,523 *AF5493ACAE01DE732B38693BDF036ECDDBFF39FD [email protected]
1,666,294,524 *AF59A1842E6266F3BDBBDC1E2664A06073C21D9F DEBORAH.MCCLINTOCK
1,666,294,525 *AF5A9AD6B07F8845A1E3F7C71AA4F426A3C41DC9 tommymagnanti
1,666,294,526 *AF580B3B947809CB73150C89087C21FF83A4574F ΑΝΕΓΕΊΡΕΤΑΙ
1,666,294,527 *AF52FA828CE99939BB840340FB57A082C084DE10 deferral5
1,666,294,528 *AF5305E4789F712BDC418DA714CCC6F18CA8687A denislars
1,666,294,529 *AF500BB537266EAEB837CDE5818871546F2D8BF1 townhooded
1,666,294,530 *AF5C07809C5A383B73BC0AC41A5BE27512714D36 DFNU?
1,666,294,531 *AF5AEFEA041BC2318E26150CEF8F31F5F2627B05 trisha.doyle
1,666,294,532 *AF5F1016C9503A87CD10A896A7C63C5E349B12F2 tristandodgson
1,666,294,533 *AF519899CE8570F5C1221F84D5BE53286E125348 DGL+2
1,666,294,534 *AF55BA725FF0052948A7BDC9D6D92D4E5DC3CC96 dhxr&
1,666,294,535 *AF57EA2FC55BF52DBD565ACFD68C857AC935A53A TT0387898
1,666,294,536 *AF5D50724C9A2F3135C6979F0AEF5177F888EE73 DIEGO.PLECKER
1,666,294,537 *AF5D0058EDFCF5DF00BA98DD4E431A9288455F9D [email protected]
1,666,294,538 *AF5ACBF7CC99E5EAB46FB68DCD2639CFD5BBDF92 TUPPING
1,666,294,539 *AF535B7E1D4C822BF75D45619F054E5C7FD9168A TWINTREVORJERRYTIMON
1,666,294,540 *AF5C694C9E23C12BB3DE73634A6C7AD453F05579 [email protected]
1,666,294,541 *AF5004471A5B89823652983781DAA858C49EC715 tyler-michael-scott
1,666,294,542 *AF593927DA04002A2489245D82B9EBEDEDC1DF66 TYPEARE
1,666,294,543 *AF52ACFFF17A4BCB7D15A96028C7866B80388AC8 tyreeberkoff
1,666,294,544 *AF59F34D280EDCC8E1D19C346DC3CB8D44FD06E8 DKAEI
1,666,294,545 *AF56E4223E01B78BC6F06740711F88DE3D140E5C DNA"H
1,666,294,546 *AF5DACF8FB9E216DB3E1C447E1F19E1EF6BA1253 UBRUKBARHETEN0
1,666,294,547 *AF5A3EE9AD382A764FCFFAF157291553B4F42A10 d.o1
1,666,294,548 *AF5CFE95AAC29E0E3E4F6CC85186865EDF942AA0 Dolicia.Paris
1,666,294,549 *AF5548022E0F84591CD3E9564B05231A8705484E DOMENICPOTIES
1,666,294,550 *AF52401E7E9D838378349C6011E99627B6F61A96 ULRICA.LIU
1,666,294,551 *AF5B99312623CFAFC55B3F07E63B5DE714692319 Doorploeg
1,666,294,552 *AF546B9835C10D554CFEE21E999064AFF45D48CF UNDAPPER
1,666,294,553 *AF5A509AC6796359C7314D3D0876EBFEF8CD06B1 dq2_k
1,666,294,554 *AF5B944147F4C6B0F99D16ACAB07E83BBB9540F4 番組名の「ジュリエット・ブラヴォー」は登場人物の名前ではなく、警部補を表す無線コード「J
1,666,294,555 *AF53159920A5E2D72F881312CD7CC142F6E21C50 dsbfa
1,666,294,556 *AF5C89C3A0F1207CC4865323E1C3E031BF775430 に起用され、ZABADAKがCM音楽の作り手として業界内で注目を浴びるきっかけとなった。
1,666,294,557 *AF5205944248726152BA7BFB3D0E14DBBFDEC738 dusterholzberges
1,666,294,558 *AF5F27C4B769D772B7683429B59638AA23C6CC6B dvdv0
1,666,294,559 *AF558DCA063962C5C3570F2976F696CC985FABF1 VASMUNKÁSAI
1,666,294,560 *AF54D84C46E7C7CAC9EEB1B505C5218A225EBFBE d#wpi
1,666,294,561 *AF598D066A6B2760A3A0DC8D423A5833FA201F0D EA84
1,666,294,562 *AF5E576E3B8E77D527392E7E31A5EA2064BB0566 V?F9
1,666,294,563 *AF5E8B0D13EE82B8F2A2A4F734A14BF3E1B8B9AC EDDYBRACKENBURY
1,666,294,564 *AF5DAE711411FDB4114C324CF5C1FCA4EA901A37 08021989s
1,666,294,565 *AF524208D99C9927267D94154289962FB3E598CE EGAILLENTS
1,666,294,566 *AF5700C69DEAE64592B17384B6C9361D53170207 1175976 puolet-maailman-ihmisist
1,666,294,567 *AF5DEC0C6D80F12082B5BB110C7E3CFBEAB2B991 [email protected]
1,666,294,568 *AF5850B5E422A9CABB633DB4CABFD60AF36B01CB ɡƏˈKLƆPFT
1,666,294,569 *AF509C7F1F7A9106703598D950C326C12EF63912 VRVRBLJTTN8
1,666,294,570 *AF5B3091A1EDAE3A7B8FB0AE2A8D70C5A4DE5C97 ELDONHIDDE
1,666,294,571 *AF5B415C85F4B9CCFB8BAEE849606B26A628FA87 [email protected]
1,666,294,572 *AF562A1268643417BD9184E03C7C0360013395BB wadehorseford
1,666,294,573 *AF5893355A3B59CD703E8773EBFFC91BE4FCAEB3 WAKAZICHUKUA4
1,666,294,574 *AF5416E3A09B053CB6BF3D08BFFBF8D16D8C549E wakerob
1,666,294,575 *AF5EC96E62D4396BD1C0CAC7C87CA78596AE6EAF ELITPOEL0
1,666,294,576 *AF5C74DE2AAC69C6C689099E62238C5F3C05EFE6 WALTER.FLECHA
1,666,294,577 *AF58EA15124AC07F1D68ACBD03BAB7C1C860FEE4 WANCHANACHAICHANACHAI
1,666,294,578 *AF501899E0DF53CAB73F0E6EB102EF8587626FC4 EMMANUELHUMANN
1,666,294,579 *AF58901DDA7C977003380AF83665334529BB7BA1 Wearing-the-Wire
1,666,294,580 *AF5C25AF41A389E960C5707951C955D1251F5343 en68111164208
1,666,294,581 *AF585AA6B650E1A53DA7E81F5997DB76541E0D6D en estos d
1,666,294,582 *AF57259F8865B2EA201ACCCCC50459CADD8A8A14 1a2b3ctoday
1,666,294,583 *AF53277CE78B99A14CBD916C2C8F5D5527D24BA8 ensam
1,666,294,584 *AF5D889C6C8DA50F9AF309E1C4635BF2E6E58E4A WENCHEFRONSDAL
1,666,294,585 *AF50FB46D541B540A6E083B6DE28A32B2595741D ENTRETIVERAMLHA1
1,666,294,586 *AF5109957E32A7D7436D7977E80782CECFCC1C43 ERASMOSANTHUFF
1,666,294,587 *AF56D0FA9445FC3E3338508E2C5FA8669EB79B69 [email protected]
1,666,294,588 *AF518FC5987EBC9F4B3C1AADD53834EC7D480244 1.dakotaup
1,666,294,589 *AF5E64F965DADA9E457AE8ABF9CCDBC6D2B36333 1 dlrglotsenboote
1,666,294,590 *AF5C081702CFBE1BD83E5EB1D74016C72072FD3F 1-doksisykliinihoidon
1,666,294,591 *AF55693EF8FF86F693DE7D32C2C5C267EAE49061 ERICK.FORMICA
1,666,294,592 *AF5BDCB40CA5A44EAD045BB61E47B06A99B7890A 1.ELCOMSOFTMITARBEITER
1,666,294,593 *AF5CFA2778E8CA045C2CAA801717CFA0ED39A163 1.endstaende
1,666,294,594 *AF56FF73653C3AAD4447732082D78EADAE0A05DF erjt
1,666,294,595 *AF5593580533DB077D55A70F609D0F9A294D974E ERNESTO.SPORICH
1,666,294,596 *AF5A77030CA4BB1581F02C264FCB16747B1ED930 ERRE`RENT
1,666,294,597 *AF5610EB351F1A47C190CE3ECAF013DFD7A754A2 WHYDON'TYOUCOMEHOMEBLUES
1,666,294,598 *AF5F1065A615E368D15183B77A3BDD4CD77FD31A willardhanline
1,666,294,599 *AF5C9A10D7C1A84DBDBA0D3972D3A2892C1941BD 1INSILAVI
1,666,294,600 *AF59CB95F9F439844B959C639035C1A6D8C75507 WILLIAMRRODAS
1,666,294,601 *AF596D8D2D808DBEE7A0482FD6FB3CC8529450D8 1 KERTOS
1,666,294,602 *AF50A5B97928087E5ABA18A84DF4C761BE9E2739 1 KRAEUTERCHAMPIGNONS
1,666,294,603 *AF5E009857705B605289D617B6C658473E5A5910 1 LUOKKASEN
1,666,294,604 *AF57471510D9DACF1EF8305D3AB944FF82F2ABD2 1-MAPEI-TEAMS
1,666,294,605 *AF5EA1F582698053214DF0967B9228E17500D21D EXECUTIONEH2KSAH0KYUW1SHAH0N
1,666,294,606 *AF5003E0315C804E02156348DF6A21EE6A017B1B 1paintedness
1,666,294,607 *AF5A38C6F5D41D3376F5FA441219DA87FF7871F9 1q2w3echaos
1,666,294,608 *AF5847068F7CFAB92AAD35B551F675F277C897C7 FATTORIAED
1,666,294,609 *AF5A526E7A21B2BE31C2CDC6C0AB75E32EFD9E47 1TIEKONEIDEN
1,666,294,610 *AF5AE4E5936FA6F2959DEF24DB12AF2B2C1A138C FEEDYOURSELF
1,666,294,611 *AF5BF8BD8DDDD70406B36019FF569EDFC3BFD1C6 WWW.ESPLANADESUITES.COM
1,666,294,612 *AF5F899334B0DF9ED83E2195D97425BCFB3547FF 1WINDKANAL
1,666,294,613 *AF569488214E51D6360C2F3DE2478FAC15C67C60 2001-10-05: MAJESTIC THEATRE, DETROIT, MI, USA (DISC 1)
1,666,294,614 *AF5BCDE5983BB82781E73C65A42AAC23F119563A 20-SOTILAISTA
1,666,294,615 *AF540BAF799FD7ED9254078715B4A28EFBA1BBE0 2100511 AVUSTUSPROJEKTIEN LIS
1,666,294,616 *AF5CF695EA3786AA91B70A15EBCE800DE7AB974B 2139352 BUT-MOST-JUST-WANT-TO-SHOW-THEY-SUPPORT-THE-FARMERS-.
1,666,294,617 *AF5B056E9F3334F8080016D2643E002050A54F0A 21mellberg
1,666,294,618 *AF5F001D03ACA6650027C24049AE45A2B63A2A4C first.set.of.madrigals:.lady.your.words.do.spite.me
1,666,294,619 *AF5AD12C01D0A9A89734AE55BB3FF9B3ECDD17E0 XIANG.LAN.JIN.ANGELA
1,666,294,620 *AF5D689DA3A3D6F59111B052ABEC7B03DCE7C2B2 [email protected]
1,666,294,621 *AF52EA3BF7E78BBB32052B5B07CBD1E0C7859A20 24.caprices.for.solo.violin,.op..1.no..13.in.bflat.major
1,666,294,622 *AF5069655190EF2C6E1FB4A749ED9513A4FDBE11 flowgansteril
1,666,294,623 *AF52FF43E002420BE0A56D13AC1B7CEDC542308C 2679255 matala s
1,666,294,624 *AF506F6B67731B7A5BAA640223224822EE9A3E9D XTRSCRPTRL3
1,666,294,625 *AF5D5E8B3DDD1C780DC7CA45FD6FF259300DBACE 2708587 HELPOHKO.KENTT
1,666,294,626 *AF54CB72C2B6B08619BCB06568D2F4AED017C3AD 2719595 ristovirtanen"
1,666,294,627 *AF5AA616522323EF8292CB91266E956631C928BF XW23163COM
1,666,294,628 *AF56ED2C148B71FCB81A4279877E012CCC86D532 [email protected]
1,666,294,629 *AF5B9B40BFDA18917B9C96B823F7B858F5D761E5 FORRESTHAMPARIAN
1,666,294,630 *AF5BD9D58C0BEA9A637A5AFEAF4833C24BBAE94A FORT-MOVILLE
1,666,294,631 *AF5B9DCC6C3D771B1C7D3CCC902A16A97F8FFC11 Y160122
1,666,294,632 *AF581C4E899AC1307BE0E2E7CDE23623300F642B yael.lewcowitz.wieder
1,666,294,633 *AF56165C55F33510E6768FBECA2790EF786CD7E8 fraena9
1,666,294,634 *AF58BFFBAD16AB3334223705D89D89C088A8253E yamashinonomiya
1,666,294,635 *AF5040D979A4F0A4D58E5F63D56D2C2D90ED355B 2ANNEJUNE
1,666,294,636 *AF5B80D93AB326F692CAB982BFAD0A3E4CB518BD FRANKIE.KOSTIV
1,666,294,637 *AF54F892E97DEA78972AC9449A55C74ED79CD1C8 FRANKLYNDODRILL
1,666,294,638 *AF548FB06809FC4B8EACADFC43251D88ED1596C3 YASMEEN.MUHANNAD.ABUGHAZALEH
1,666,294,639 *AF5968171185D764490C9ADCF3DE704389837C8A FRAUDULEUST!
1,666,294,640 *AF54B4199F411EC4DBC394E23F58B9F23EA59351 FREDTORTORICI
1,666,294,641 *AF5C7444EB697650AA70263BF976A2ACA993DD05 YGELPOMLING
1,666,294,642 *AF5C53FCAFCC0FDB3E8B1ABF473B5265C903F838 FRMAGNYSURTILLE
1,666,294,643 *AF5BA7697A615C0D4B34641CF39A2130D8945721 YI]G
1,666,294,644 *AF5D830A925DCAB37E3069769C2096721500BA6F FRUSTRATELYING
1,666,294,645 *AF55651295BEA689A635F96F0E797CEAA81EB94D y.qe
1,666,294,646 *AF5AE8E779B89E929831F43E24D820BC4AA6B77D GARY.RUBICK
1,666,294,647 *AF588CC1C818B08811CF1CE1761DE871694DD9B3 GÄVLEÅN
1,666,294,648 *AF52652AAC88F02E230C84E7966C8F8FBFC7606E 2SCHROEFL
1,666,294,649 *AF58D1CEFFE0FF0B27F9F9E41EC1876C4D67E341 geraldbreman
1,666,294,650 *AF53F25AB02D367C38168787FE09F69B9B5E65AB gh]
1,666,294,651 *AF562B671361D8108A5A590CC68689B7A3A79B23 Girish-Puttasheri
1,666,294,652 *AF506A679952581275A7FA2CECB9F557710095B1 3 EUD:N
1,666,294,653 *AF5970AB5969F2643C5E02D1A5C3BBCD613F3E38 zo?'
1,666,294,654 *AF5C518BD7AF83FAA3E1982622E6C62501FA5658 3-REALISTISESTIKIN
1,666,294,655 *AF5D6BD6B39740CA82F9CDF5A112C5CACB6F745B 3.sysforten
1,666,294,656 *AF5C40ED5B4E303CA960764D36C3FA76F6ECDB02 gpftxqekldfe
1,666,294,657 *AF57A7A55996A54087944B981DE05C44D58EA39E 43a與飛馬座火箭(後方較大白色物體)在空中分離的電腦預想圖
1,666,294,658 *AF5E7173C182E207FFB7DCFB7B6F572949BB6FA1 GREGORYPEGGY
1,666,294,659 *AF55FAD7B332818E479244E1D801CEEB221CF6B5 ЛАРЬОВО
1,666,294,660 *AF5476E8064BACA3FB70B457840E6151CE65020B 4.PELIKENTTIEN
1,666,294,661 *AF537579AC99952E8C74862D9D076094498037CB HARDYERS
1,666,294,662 *AF5598B2269CC7624CAB8FCD871A71C773EB1306 4UNSQUELCHEDS
1,666,294,663 *AF52B33CFA978474F6CB6446AE1EE3570574EAD3 HAYWOODFURMANIK
1,666,294,664 *AF572B281DBF009A84038411443786453CA8CC6D hBbaa
1,666,294,665 *AF59BD619275D4F4AD599F0760F3BFF78F6BF35D HIT-COLLECTION-(DISC-2)
1,666,294,666 *AF50D52CDD72E2D3D8A0386C2DEFAE51E20F0E92 HMOOCOW4
1,666,294,667 *AF5A8216632391C4CC5411C3346E9191511B3D9F HOCHOVO2
1,666,294,668 *AF568D62907CE137EC86BCF8A76025A7D83D9683 5CORONAKNIGHT
1,666,294,669 *AF5B8FE70BDD1DBBBA3D258C8090452FC1155C5E [email protected]@L
1,666,294,670 *AF5D5A7A312DAA80DCB30877EC575A858672CFA9 5ERUPTIONH
1,666,294,671 *AF5B8EC139AA164770F30FEF6C87DEF6F7234B0F hondakathryn
1,666,294,672 *AF50EF5702F9FF38B49AE4683BC1A83A5F7BBD0E [email protected]
1,666,294,673 *AF536A38078229C2EFE953BA41973CC091C7B67D 5STROJOBRAVAR
1,666,294,674 *AF585817D14BD32BFCE12978DAA6FFC74600FBCF hubertreiswig
1,666,294,675 *AF55924D6C8EAA5AEC589C776C5195430C3C3DC5 HUNN3W3LL
1,666,294,676 *AF555B23B1D7A3AB34674D622188CF4957C2503B 6giraffen
1,666,294,677 *AF5179CE358FEAC1C654C8187EBE77B573FB9AA5 6ILUVMEMPHIS8
1,666,294,678 *AF5C26AD97BCF7867517CC8BDDF13A5A6DF962AF クリス・カーター、チャールズ・グラント著、南山宏訳『x
1,666,294,679 *AF5EFDF7FA5F7559DAC7E49F938CB8D6B1134C42 ilovebruno40
1,666,294,680 *AF5C8659A840D8D45B2F9CEA725724475F0BF949 6WK4VGTWZC
1,666,294,681 *AF5B2B116198C8C5B23350DDD53C160527C3120A ILUVPENGUIN72
1,666,294,682 *AF574ABD0B163992A5308DDFC48D55BF0FE1FB83 7BRIGHTGOLFER
1,666,294,683 *AF52362E2B96B380CCC88CC3D68E80E44D5DDE3C INVGG9
1,666,294,684 *AF5A817A3104C37020655D1E2B3F2245D052C34C 7DARLANE
1,666,294,685 *AF51F257F939649064B99E3CE9EAE3FFF7071731 7FUTUREPAT
1,666,294,686 *AF53A11697D39174851B0276F318F8CAAE4CB272 7GERTRUAD
1,666,294,687 *AF5D7BE1796A0A9238A06B4D0F5AF3B6CC92462F irytotra5
1,666,294,688 *AF5C474F4EFACC8B4575D61BC8776F6AD96B781C ismaelhessman
1,666,294,689 *AF50B7683D4427A5A10C7B18B94AC6887EF3ACF8 0A4CDDDD06343EF3A5CD925EC0FBBD36
1,666,294,690 *AF5272C1963FE49505E1B6864ABC0850D63C1F01 [email protected]
1,666,294,691 *AF5FD1FFCBDD02B6A14DDAFE9D62E997DBC78ABE <[email protected](o1a
1,666,294,692 *AF50847EEC4DB6CD430BC2D92D637829CD5A6176 I]V&
1,666,294,693 *AF565D3A94878B716EB85EECFD7F61475A99D365 7WEGSCHEERT
1,666,294,694 *AF58CD978FC72735C4432092F60DD58921994EFA JAKESTIFFLER
1,666,294,695 *AF5BA9827503567BF060A355FD331D6FA865D43A JAMIE.SYER
1,666,294,696 *AF52B49ADD156936EE3055B48219638E6DA26BA6 )8(O~0~-<----3
1,666,294,697 *AF58E0F931927C80E10E2118DB9D8E6456621F86 JAVIER-HENRY
1,666,294,698 *AF5D58010AC3151B6FE1968174249A5B7477AA36 [email protected]
1,666,294,699 *AF580B5B672010949F50039E98769EA79148150A 8RESIDEND
1,666,294,700 *AF5620535B675A1C0AFC4DB0C614E247910DCF08 JEANELL7
1,666,294,701 *AF50A1F0899CF76171340A2154584F5E6E0EB050 8youngstars
1,666,294,702 *AF5203F759C6C8B80858AF0C9528745192B9C47E JEFFERSON.GROENKE
1,666,294,703 *AF5A2CE3BA49CEBC36B1531B4F0C6A5FCCBCA90A 1154198 TIETOKIRJA-;-SUOMI-;-IK
1,666,294,704 *AF5DFE4C71DE6A2BDD29D40F33B897C2FAB2B9AB 9238E72CFB45
1,666,294,705 *AF537D6750B518058705F4EB0A23BC09B897ED85 9ALFREDRODMAN
1,666,294,706 *AF5718FAD934A0A46D5BF75F8769B524BBC78FEF 12MARCH1892
1,666,294,707 *AF519066A641001429444B8421CC53B0229C20A1 jerrod-volkel
1,666,294,708 *AF5606CB62982858376FF6E10511257B25FF9143 9BESIFRA
1,666,294,709 *AF54C397A04BDD0F00A7C2E30C7EFF7D418FF7CC 9BSWSLOVAXBSW
1,666,294,710 *AF5595DEC3CC1A970363A4EA8C9159C155CCA66E 9COUNTRIESBR
1,666,294,711 *AF5F3A69146374773DBDDD8717269DEE1DECCECC 15-fili
1,666,294,712 *AF55DCA88DDBD8390CFFD2AA71A8E0DC14C95724 9FISHINGHAMMER
1,666,294,713 *AF5F672F3FF42C8C324356BA1D4F6A0F7353204B JIM.AMILL
1,666,294,714 *AF5443E9CCA54126EE5AE2B4B391F8D8D74A8681 9iamhallo1
1,666,294,715 *AF538AA3BD22DF18D0FD577C4EA05F772ED440B3 1683865 KS . MY
1,666,294,716 *AF5C09F5420388C4A05F9498587E11FBC1DB5F2A J{{NEV{T
1,666,294,717 *AF5D5DA87EE0150B11BAF0D0ABDA2BB1C40A1DC8 JOEROWLAND
1,666,294,718 *AF511E95BA2CA63B37D7016AC80A10181D8B5F9F 19860210:.tucson,.az,.usa.(disc.1)
1,666,294,719 *AF5545DD3FBA0B039BD2CADE175DFF0BAC587156 johnnybarrale
1,666,294,720 *AF5B9EE231767607103D2A51E53A2F42EA489E37 johnnycourington
1,666,294,721 *AF5B663FFD43950BFA06C692DED35EE363BA7FA3 JOINTSERVICE
1,666,294,722 *AF5EE1DF633A98F4467E93CBABA85E3DE3355430 jordanmcinroy
1,666,294,723 *AF57F0C2B703C37F9991C279BB0131C161571D73 1.BILDLEKTUERE
1,666,294,724 *AF59BD26CD8DAD8E471C68328255FA8908C809B8 1-BOSCHETTI
1,666,294,725 *AF5FE47F763EE846A3C356B62C37042AE8DB9EDA 1.CURRYWURST-UMSATZ
1,666,294,726 *AF597110E4D01E1658323181B4BBA5A079A1D7C0 A5W=(
1,666,294,727 *AF55E3BD77AC2630B6B6BF2B2EC6BA56BC909A45 JOSIAH.UR
1,666,294,728 *AF5865A2A801B67D1C7A31D743E117582937AA1F [email protected]
1,666,294,729 *AF52FA72B1AB65F1A3C893F23F86FAA4BC00BFC3 1FESTIVALMATERIE
1,666,294,730 *AF50EDEC2A2C4ECA6D17B245B38104F327431CF7 1.HAZIRLANMADI
1,666,294,731 *AF5E0C8D23FFF325E27D5B350079CF0B75008DE4 1-heranstampfenden
1,666,294,732 *AF52F8DBEBCBC3A2B3631F7573426852A0B134B7 [email protected]
1,666,294,733 *AF53E3EA0BF7239AEE13C13D9F434A6DEC803E9C JULIELUNT
1,666,294,734 *AF5E063F32C6923250CA87916DC0C41D01EA2CB2 aab(/
1,666,294,735 *AF56EB669942A2C23B796CB1399766C5D45FA091 JUSTIN.STEVENS
1,666,294,736 *AF5FD854BF3E0EAC006E832297DC7927B180BFEE aabw5
1,666,294,737 *AF5F299251C9BE64DD73374EED0960D983835335 AANSCHOUWELIJKSTS5
1,666,294,738 *AF54D4BF54F655BE1016072BB09F71656F130A30 kareemshonkwiler
1,666,294,739 *AF5A44A65D201E14219405D48A0F43E5B874F381 1-merimiehiksi
1,666,294,740 *AF51067A147675EF28C53B80841A423331B10977 AARON.DEMUS
1,666,294,741 *AF57222B6BA1612871522ADE49B1C09573CAFD01 AAVEKSOK7
1,666,294,742 *AF5AEC538C9504964B15825AD5E43EFDA33A805F 1NOSTOOMINAISUUDET
1,666,294,743 *AF566080EDF6093771B5F7021D5CE78007911F90 ABAC9
1,666,294,744 *AF56D434C3E54399CBE1DEDBAD791354E30738A6 ABBIEFISHER
1,666,294,745 *AF550B1A6BE7531495A71540211982CEA42C42A2 1.PLAYERARCHITECT
1,666,294,746 *AF51E69A59895DBC16BF635E0C98E8E869F2E530 KBHALLI
1,666,294,747 *AF5296CA22E7A40F5CE10AF9793F241604926A67 ABGEKURZTEN9
1,666,294,748 *AF55EEB5C1CEC469D967728371CC60821D621BB1 a.blazer
1,666,294,749 *AF5F71AF56392E544631D95CB9A1025AD15D99D8 KELLEY.CAFFEY
1,666,294,750 *AF58F437DC32051601BE858E767131FF1E8FD454 1 SCHMELINGNACHFOLGE
1,666,294,751 *AF52498C0CFC64F5D727EF808353CD0465DAF6C7 kelly.renaud
1,666,294,752 *AF54FC5BA7E956E6A89C5934DB0F8F627A76550F KEN.MANGOLD
1,666,294,753 *AF51D40E8F8292B4DB1C728B3DB3883319E4165D KEN.OLIVE
1,666,294,754 *AF5EBC6D6D97283B2454C049F03705774B95E09E KERAILMAN
1,666,294,755 *AF573120E5162300AD8DF23A7BF96C871C8AD5AC KERMIT.BRANDEL
1,666,294,756 *AF554887C87D8E4A488A4BCCA650739B286FAD68 kern1ng
1,666,294,757 *AF5A3964EFA6D90941C5B37FCF9992ED6FC49104 2024934 ANNA.SILLE.VIISAUTTA.JA.KESKIN
1,666,294,758 *AF5883B203C04A178E5170E64EB228906D66C664 2121106
1,666,294,759 *AF5AD82ED428165B408EED1E482EE53B4FD0A315 AD&.}
1,666,294,760 *AF5B683CA31384BB55369258161B9588C926B1DA a.de.breakestra
1,666,294,761 *AF5715E5714759590E002F9AA80597D66FB693CF 2243073 syksy 2000 vuoden 2000 itsen
1,666,294,762 *AF5B8B757FBB584CB8DF587521C31B2EA44D49FC 226FRANCIS
1,666,294,763 *AF5836CEF0DA3FC4D96FF6A10EF177D4344B3174 2281740 some-were-driven-on-commandeered-city-buses-.
1,666,294,764 *AF5F227EA378DECFF5A9DEF71B2144154CD299EB komisch?
1,666,294,765 *AF5808AF9C8143C8D73D2884FBD7D65C5D761D08 2369657 PALVELUIDENOSTOISSAMARKKAM
1,666,294,766 *AF5CC2AED5FA87579A7DD8BD5FDD88CA9FC05E65 2384824 T
1,666,294,767 *AF593836CDA6CA336B442E0A38E1AC24EDF4325B koreymarberry
1,666,294,768 *AF549B2004C3BB559B3646779CA30F67B4E10A34 KOSMOPLASTRAMUSIKI(MUSIC,CREATOROFTHEWORLD)
1,666,294,769 *AF508BC27467D524EA48DC8B6EF08231EE41CCAB 2577850 udk-ry-j
1,666,294,770 *AF59DBA3500C8C7ACD51EEC369B45782B5A5022A aehmookie8
1,666,294,771 *AF5F458BF7687CD0171A205D6514958666791F8E KUMMERFURCHE
1,666,294,772 *AF503D52FC5D684C2BE84CF71A6EE78E95D65E42 kuniakova
1,666,294,773 *AF57CBA7FD6E4354CB8D8AC0809730BD34C7F441 l21bvcmv
1,666,294,774 *AF5462583D999936B0E363322BA40D9ECC855E22 [email protected]
1,666,294,775 *AF58C181D59B618129317DC54457715D2DEB3ACA Lagting-'l/A/g,t/I//N/
1,666,294,776 *AF5AFFBC0C0CF38C205CEAC8CF11DE057AF829F4 AFLHAPPYTOSEEREDOVERESSENDONALTERNATIVESTRIP
1,666,294,777 *AF5F56157D676B393CABAE16FFABE46530329B7F [email protected]
1,666,294,778 *AF56D327E93E8415FC87E53FEBDF009C8A34F7B7 Laillatuhannentalvimyrskyn
1,666,294,779 *AF581651B66A9F2ADBD9A0C17F1D0A7E6F590D5F ag1(#
1,666,294,780 *AF575AE8C237DD006FACBA6458AA8CB063DF260D Lanc3-t00
1,666,294,781 *AF50AD9A0C37443AB14FE066F11D6D7CF12D0351 AGÁPOVSKI
1,666,294,782 *AF57459B15EF046FAAD753DFF15C3E967F293ED4 2noudatettiinkin
1,666,294,783 *AF5B586A3DAD2BFFAD195C7867AFFA6B0EC3A86D AGUSTIN.TOY
1,666,294,784 *AF563A984325041115F6C973E4B7F43856D00437 LATER-THAT-YEAR
1,666,294,785 *AF5BDE7C6DF8AFC8996389C2C1230A243B1B1EC4 2-SELLAISENAANKIN
1,666,294,786 *AF593B5B8A57536929BC82047736CBDFC898F8FC A_hd
1,666,294,787 *AF50D649692B13744ABBEE31623B1BB806CE0E92 LAWRENCE.SOBIERAJ
1,666,294,788 *AF5039B93745909ACDC79F1DB7B0F89D04B78163 2.UEBERNAHMESTATION
1,666,294,789 *AF57D6AA0F3E24C7E85A8794784A2B71DD5F5C50 lchli-am-himel
1,666,294,790 *AF582193770EAB170CEC8ABFD6D28B926E57E1C0 302419 RAKENNUSOIKEUTTA ON PER
1,666,294,791 *AF5F4D276BD5784C3BFB636D2913AC7A50321294 LEBANAON6
1,666,294,792 *AF566FD68C937F4200EF68358BB668F11A372A3B Lee.Ann.Womack.&.Rhett.Akins
1,666,294,793 *AF5B986DF57F8EC17643F1339D63F5007943809F LEIFSHADLE
1,666,294,794 *AF53B5036984FC6D4B37F9BDD0929FD5AAC47794 leila-malabanan
1,666,294,795 *AF5E212F1485C873C47DC5B12F620728AE3BD1A7 392227 ZORLAYATAKTANKALKTI
1,666,294,796 *AF5F2A7B53C7D98978D30643B4FD233892597750 3.BACK-TO-BACK-TO-BACK-TO-BACK
1,666,294,797 *AF556CD9D15D6FE7DD2760B6A459BBFBA03261D6 LEVI223
1,666,294,798 *AF502CBBFBDFEEED2F7E056B14C1F2A4364EF709 3HTFORUPS
1,666,294,799 *AF535BA71692BD5783BA851C2481F6B3F16C0063 LFEHNKER
1,666,294,800 *AF5B50A59EF133A909CA1BA40044755292BDD142 [email protected]
1,666,294,801 *AF5AFEF2A65D69FBA8A39FE55965F4331AAD8668 [email protected]
1,666,294,802 *AF575564A8239BAFFAA2AB31BBF99ACD7DCD22BA [email protected]
1,666,294,803 *AF57AC4F1A84C054D3AE9215EF2AAE10C8E986FD 3KW1N0K5
1,666,294,804 *AF5FD3545E68F398B492B9BC85E2A1AAD899CAC9 [email protected]
1,666,294,805 *AF51AB2E6CB3C7B602687E20E4797BE13392625C a:j2
1,666,294,806 *AF5D140257FC4ADF6A9ED89204F91B02DA1B8EEF AK;JH
1,666,294,807 *AF54C50643F5ADBA4B49E42F110050454E2C6877 LIMANGFA
1,666,294,808 *AF5CC90ABE08E261A84D6F782CF1D795A899477C alanadkison
1,666,294,809 *AF5CEA33691704FB87B8BB14FF4B8AC811CCE807 LINDSAY NEVILLE
1,666,294,810 *AF536A224302C8321C282D1E011BC662A7DE32DF linopolselli
1,666,294,811 *AF5641C33B001F8AD78892F34586E24D48391DA1 LINTON-NEAL
1,666,294,812 *AF5542B0A949FB5610253218B3457E9C1762F288 AL.CORRENTE
1,666,294,813 *AF5C5A91C9876DEF7BF88555477A85F0C0D9EA62 alec.bateman
1,666,294,814 *AF5DD3F4B477251A05851ADE170DE22A4F38B5DB 4AWREMMIZ
1,666,294,815 *AF509079C0E4F0D1D83FC0A1F651C420350273F1 4ddc7vely
1,666,294,816 *AF581B4C673685FF91F34DA97E2AA770B4179597 4EPIDEMIOLOGISISTA
1,666,294,817 *AF5DAF51E3F57D4A28D4922DA075CBEA4F8A3FDB lochiometritis4
1,666,294,818 *AF551366C3BC3C9084194750EFB32E7963BD32D8 LOGIC...BUT
1,666,294,819 *AF592AEE2A0C546C6DA9052E96777F613C9CB6AE loml
1,666,294,820 *AF5FC51549E81F0B8B130AB1B64E82BBD666B043 LONNYASAKURA
1,666,294,821 *AF5D2BB0E623518B4CCB6E6D91EA1805F3395AF2 4MULTIPLISERAST
1,666,294,822 *AF51A51B3EC79DABEE8F25D25A184AB4D4D6DC0A alphonsefalter
1,666,294,823 *AF50E2A6E71F0D71200C24355FB0EE589E5AEBE9 4NEDDODSIL
1,666,294,824 *AF5E5D0A393D606685DB6CC141246463607DD36A 4PASAYBSW
1,666,294,825 *AF555EB7746699FB411163BA545F9A94E8DCAAE7 louisemetal
1,666,294,826 *AF5C6DA9B79E1F16C74544AC192F90D21E16E61D 4SPEECHVIKING
1,666,294,827 *AF5CCD6E47569722CE2A000E453B769185BD5C76 LPETAA
1,666,294,828 *AF5D923A1F54EA01819373A6596C67D95472C432 [email protected]
1,666,294,829 *AF545DD9288C9C57E7B8C83ABFE53F950DCF9385 LTSTRGGTF
1,666,294,830 *AF55538DF35E81D9618833D4AF7790ADBCDF47FF LUISREVILLA
1,666,294,831 *AF5F78A677AB6A5E8A7C1B51251B1C7A819C552E 54MARTINSKIRCHE
1,666,294,832 *AF566325BBBACFF9603635400473BBE8E4537D93 LUSHLIFEPARTYICELUGE
1,666,294,833 *AF523B4CC0797AC76F13787EFB1BC365CE37C7FC 5ARIANEDEAD
1,666,294,834 *AF5D1789D86E9B38781C999C884A6A5FFF71BE26 5AUTOMATISE
1,666,294,835 *AF5DFD3123A0DBDDFFB27AF054ACCECD0709E00F LYMANWARP
1,666,294,836 *AF597CBB329572805DE8429487EAFE9DB21AFE8F LYNDON.WENDORF
1,666,294,837 *AF5B1FC0497A8FEB0A1F9241C1BB3934E5A53300 5CENTERHOTROD
1,666,294,838 *AF5B14A68EDFA469ACBCA02A699C5CD85CC3D0C9 [email protected]@83T1Z1N9
1,666,294,839 *AF5D893BDE3B4B323A7A67423CA7BC54C295C0B4 5ETIOLAS
1,666,294,840 *AF595EBD46291C4A0EA07B92FA5CFDFE3E434B60 5ETKUREGT
1,666,294,841 *AF5F6D75B2576B6D21B8D64779CE62D71602DDA3 5KOMATYA
1,666,294,842 *AF50263FF87D8618C9938DA53279B04D3AF6CDA9 5VULNERABITIS
1,666,294,843 *AF5D4531E916DD6A395F03403325BE92760B32BA 5vvp
1,666,294,844 *AF5F05CB559AEFE04F1A79AF9DC8527215503549 639260 bu turk toplumu icin iki defa daha gercektir
1,666,294,845 *AF5C4DCCE2A557BE3D95C00259B5CC8D2CA3929A 6EONTEMPTIBLY
1,666,294,846 *AF5DAA0CDDAA71B9706BD403A4EAF58C274A6DE2 6HVEPSETALJERNE
1,666,294,847 *AF5D91B79D9B86AC6759E7188B7127B8CD8800B5 6POWERSOCCER
1,666,294,848 *AF5A9DD6B604D63AE84FFD6FAF8A226CA4C04A97 6.suruntu
1,666,294,849 *AF5CFBCEB80F8FCCDCB6082E08A352B15D2107B3 6THATSUTTON0
1,666,294,850 *AF58DB2923AA7794F0ED8E920817CDFDE00899EF 6TUNGEMLENES
1,666,294,851 *AF50B9C9B60B43BF65169357DF935CB6215C0B22 『054 ein』(
1,666,294,852 *AF557D3455F83F4AE5ACBC29DCC13D76686F71BB 1164136 voimme l
1,666,294,853 *AF5DF4304513569F02EB38A0EF20E69E17B8CA9F 1203425 six-months-later-,-the-number-had-risen-to-27-.
1,666,294,854 *AF52E42AFE4FEE8FA9C5D8FEA8C27D1DEC3C5E7C 1217387 MFB14788/1RAUHANEUVOSTO-VEN
1,666,294,855 *AF54C9BB0114AA22FDBF4979D26600BDE5D09020 123kyl
1,666,294,856 *AF5796AE49DA44E942401FEFF3ADB7C480A6C1D6 1273507 silvio-berlusconi-tritt-zurueck-
1,666,294,857 *AF53503B66CF9E7F11C5201668B47C84B66CB3AD 15031224
1,666,294,858 *AF5FAD44A945B8A400784D4FBC510A87103AEC12 1604ANNA
1,666,294,859 *AF582616BBD7C772CE246DE29F14ACC573F265E1 1668716 DURCH-DIE-FEIER-SEIEN-FLEDERMAEUSE-GESTOERT-WORDEN-
1,666,294,860 *AF579895C970C39C572CA67BCF7E3A2A19B6BB82 17betoniin
1,666,294,861 *AF520144F1494B8B0044BDFE46FDA12EE71AE56F 180385 miten s
1,666,294,862 *AF50C48FE24B9AA937427144935050BE008379BF 1burrows
1,666,294,863 *AF55472D028123E1C17FE3E739B0E7FD61D50C52 1 COUNTRY-MAY
1,666,294,864 *AF5A969A864DD1F0F0703FEAA630E4A205C5B79C 1D2BFE5B699D086C691EDDC44B153E72
1,666,294,865 *AF51D74BFC5FE6227EB4EE0D2D21156D0D1843D6 1EKO-ANLAGEVERMOEGEN
1,666,294,866 *AF5BEAD2496071A282114D41ABD6B2F5EB239B64 1.EPICUORIOUS
1,666,294,867 *AF570017C7A5D57607797E4680B2C602A889099F 1 FEHLAND
1,666,294,868 *AF5CBA48240785D6583CE421242C80B34F2B1127 1 HEYS
1,666,294,869 *AF5513FAEC99D343A03520DCA160A183A667A43C 1HORMONAKTIVEN
1,666,294,870 *AF5E91FADACDF191DAC429A878082366EA180E29 1IHCSRAAW
1,666,294,871 *AF5D8D2135DA5E50CFDF0D813D7AF8647D547660 1INNRIDD
1,666,294,872 *AF5FB2F0D48E0B1197FC92FFDF5DD307D7B92A87 1KAFFEAAMUT
1,666,294,873 *AF53045E9E7FE62A13FA89C00A78A8E3BFC99129 1 KETUT
1,666,294,874 *AF57538787A0D2292124E487B0E4B8C9F92470BC 1kundenhallen
1,666,294,875 *AF56162A7C4591948789D3C9FE2BCE3959757893 1mittelmeer-party
1,666,294,876 *AF53C5B9A030425426DCF81DB9B4F353829B5E0E 1 PERINN
1,666,294,877 *AF5A9A4584DE37F416BD8CBF1F78A04E2452EFEA 1.puolisaksalaisena
1,666,294,878 *AF556ECAE51954A1E8107F694AE154E76B2FEDEF 1rassismus-jugendkampagne
1,666,294,879 *AF5B0BC5C82C20808A88C957131229E7E97BE405 1.rullarevolverilla
1,666,294,880 *AF54D1BEF98A186F0770EC32B4E429CF6144D78E 1-SOPIMUSYRITT
1,666,294,881 *AF523CF17EDA5C9F60C8099A1649C1EE44DCC0B5 1 TSV-SPIELAUSSCHUSSVORSITZENDER
1,666,294,882 *AF58CF1650C43CB3F30D234FDEE08D9EED74A5A1 1ulkoistetuilla
1,666,294,883 *AF50F51F731E308BE8C8E083555B74D4ABC2CB7B 1.umweltelan
1,666,294,884 *AF535BFA5FA91AC5845098EE47FA0A64D1E74514 1 YKSIL
1,666,294,885 *AF50762DDD99C24CC5B540F0B57B4E9CF1F5A43A 2248532 juhannuksen-kahden-puolen-on-tyypillisin-aika-
1,666,294,886 *AF5B9E37B50B5AFC0626DC77A647381601643D17 2409325 T
1,666,294,887 *AF5F54294787C29C940B9B57F1FCA1A6E55797F5 242312 gezimizitfaiyearaClarInIgezerekbaSladI.
1,666,294,888 *AF590B085296E6B6A4C90AAE20F3939B3AB0F636 2703623 ALAASTEELLA ON NYKY
1,666,294,889 *AF5F023F2E9334053661AFE4D2C100FD9A5CB269 280810 MIELUUMMIN-TERVEEN-HYVIN-SY
1,666,294,890 *AF512B85D1D233B0A2CC9CF563C08DE38E24E68F 2895481 NYT.ON.K
1,666,294,891 *AF5910D714EF58F842004E95A8A3E7AD5D269C6D 2958197 sosiaali-jaterveystoimestatehd
1,666,294,892 *AF5EF50D3683EABF96280F87834BD471CB912515 29702104X
1,666,294,893 *AF5524DBDB85BADD9681BB09FBC1897F91CED5ED 2ANDROGYNI
1,666,294,894 *AF5219E5A93A03BA93B0AE4AF3E83940FD4A6867 2.CANALIN
1,666,294,895 *AF5E6F878FAA0A2BEF8DD8F16ECCBDC5A7385282 2GNIRYTRA
1,666,294,896 *AF5E63D835921836D57713CE0656E2ED846D3C1E 2-logik-standardschaltkreisen
1,666,294,897 *AF5C7BCD8F0948AAA66834EFB28CDF27C3DB7985 2NONCIRCUMSPECTNESS
1,666,294,898 *AF5793BBBA503E9270D820C9F9419747DEE2626F 2-QUALITAETSKLASSEN
1,666,294,899 *AF5DCDB4B65CFB4E7F9288E75BDEA6EAE855F696 2.RADIO-QUOTE
1,666,294,900 *AF5E9F306A99EC9F33510E0A59224C4F87B1BE8D 31FLAVOR
1,666,294,901 *AF503AD2C38F11D30A2C226D734DBB69AB9AC839 3ABEVACUA
1,666,294,902 *AF5796094D81D1DE260960E5F274FF5865EC2F18 3CHOLWON
1,666,294,903 *AF5601D01C33DF939EEB1FF19928040DCDD71EEC 3DG1NG1Y
1,666,294,904 *AF54B8A11A0D27362B5C4D6A205DACBD07C8FD9E 3DTANNY
1,666,294,905 *AF5AFB22D2B9B7BBE84E8DA8AC9943454185C8A7 3-LASKENTATAULUKON
1,666,294,906 *AF522D678F43405032EFA2E84A0100479835BD7E 3MRSHLLRS
1,666,294,907 *AF572E1C9154AC49D70F424334BC3FD37C359077 3mycamera6
1,666,294,908 *AF5A80E3DC29A547F2BE1A59658AC245F2D4A775 000peter
1,666,294,909 *AF55BFAAEAD966F5E507D37387C33308A279FB14 4.fourcity
1,666,294,910 *AF534DB29E9446AC48CCCF1B4A341D28F2F80E52 4GENEHMIGUNGSLAGE
1,666,294,911 *AF5DE7919090DCE99DD95980995C923ADE81C109 04-25-1922
1,666,294,912 *AF597C028ECC60A64034E3B3D271F386652DDFEA 06231669
1,666,294,913 *AF5D59853C93A8BFCC22D51CF4169F2EC86F1C49 4REBURSCHIKOS
1,666,294,914 *AF5BB4E64056BD38090079488C3D04DDDF24DBAD (0_<).O~<######B
1,666,294,915 *AF5EAAC5DE6753591EF896EC14D02EFD4ADA8FF8 4UNBURROWEDA
1,666,294,916 *AF5F0E12259571387D790E3FDE123F3149CE6892 1101711 VELODROM , BETREIBT .
1,666,294,917 *AF54CCC89D2054142479E5A4CB85ACE4435E4184 1109504 usa , japani ja eu eiv
1,666,294,918 *AF591BCF69DD50B553EE2CE572FD815A736AC0FF 1175523 muualla.suomessa.viisumin.saanti.kest
1,666,294,919 *AF5AC2FF64395343D0B83A48519FF34C08B9BC87 5AFTERFILTERS
1,666,294,920 *AF5799A17E16193E136DF95A166761455A68DD73 1372843 KOULULAISTEN.ILTAP
1,666,294,921 *AF5D7476073DA24CB037A87475CFEE5C03A75C1D 5BABILLIBAB
1,666,294,922 *AF506C9BF5EB7594017FC53F2959E7BC27B4D562 1406111 tutkimus.tapahtuu.koko.tutkimusyksik
1,666,294,923 *AF57C92F52C14543B928F96B6E4BA31A0E193877 5BSWHOBERGBSW
1,666,294,924 *AF52DEE533FB5F6FEEF0FCF74D797CA0CC13EBCE 5BSWSBFOMBSW
1,666,294,925 *AF59FBDA983960ABA78E3A72DF690BC19947044B 14АДАРА4
1,666,294,926 *AF5582E914D10AF82CE41259DD865CE756CD4517 1574561 " DAS POTENTIAL DER MANNSCHAGT IST NICHT AUSGEREIZT
1,666,294,927 *AF501E9E1B161681BDC2E097D38CAFA754C29770 5ELYLEHTE
1,666,294,928 *AF5CC8EF99715CADBC6EB41ACA744F32D58ACF05 1800558 HE.VOTED.AT.A.SOUTH.SIDE.CHURCH.IN.CHICAGO..
1,666,294,929 *AF556157DF323B7AD88B1AA8F2DC678139867680 184-wilton
1,666,294,930 *AF54BF12C8BDFF1B919EC8E363F920729EC2501F 1979701 KUVA6KAKSIYKSITT
1,666,294,931 *AF5D8DC738F9E3C25DA32E797760206E47A445AD 1984366 nykytaiteen-muista-ilmi
1,666,294,932 *AF5347D127CF1D98EA7EB34C09FF0C7827E2C6F1 5NLGSKTVR
1,666,294,933 *AF5AD8BC55733772CCBED1069C9C7D66B537E53C 1AREIFIDOM
1,666,294,934 *AF5B87630D428186D7EF123534F5F93BD4635EFF 5RETSISDO
1,666,294,935 *AF594AC55C3BB180B481672C893D7FD6B96011A7 1bronzlaSmaz
1,666,294,936 *AF5A8A398851B6AA03859A1B628F48FADF7A4A76 5SKRABED
1,666,294,937 *AF52F684E54471B903EFDB5DA51752749E459693 1DERROITTE
1,666,294,938 *AF5473C11F3BF2EE4C57831A9AF0403F71EEA1A5 5THESIRIUS9
1,666,294,939 *AF5CEE3B526AEC6CEA94BCD9ADCA402BE197BEE2 5XPMGPPNC
1,666,294,940 *AF58CD711971B8FF6510B079FD33080880737D87 1 FOTOGRAPHIERT
1,666,294,941 *AF5AC0AC774EC51257026BB09FD2E1161F3569F0 1FRANKFURTHERS
1,666,294,942 *AF5B10106AE4AD8B071BF4ADF3B9B1F9043F0F37 1gernreich's
1,666,294,943 *AF54D3BB91D7B565EACAE12727567CBDE6883F3C 6:..6..#..&...unevenness
1,666,294,944 *AF5F81363BAF57870098C2C3B40E94EDA4E182DC 1 HOERERFAHRENE
1,666,294,945 *AF57965856A558314BABF994C5E474585A50E557 6ALLUDINGS
1,666,294,946 *AF59F6A25F85D9AB33A5A1E2690642DFC1248B56 1-JUMIUTUNEENA
1,666,294,947 *AF5A77FD54C9CB45B7FB47838D89549CD3CA920E 1.KASVATTAARAVINTOA
1,666,294,948 *AF5094AC6A4C57B004764E709AE2CCF1267455A4 6CELINESTORMY
1,666,294,949 *AF5C696EA27F36CB758721C239E70D686368422F 1kehitysvammalaitoksessa
1,666,294,950 *AF5C584831344D32D911D4B42D6C4EC6DBF8CC80 6CRACCHE
1,666,294,951 *AF5C56209D2E49592429E09A95DFAF9AC3C329D0 6CYBERPUNQUER
1,666,294,952 *AF5B4BAA1488B002A4BB3D143C7959DA16411102 6FORMULIERENDE
1,666,294,953 *AF5895BD242D9DBCEDE420A9462B6D996309FA82 6GREFFAITS
1,666,294,954 *AF5BBD0B21A971EAAED630389DD0E605038AEFA5 6HOMERJUDY
1,666,294,955 *AF5AF68E07318BC73E2580B60F58BB7A350E85C0 6iamjoelle4
1,666,294,956 *AF57B01F049D765CDDA5845253DB90CC3A9FF4C5 1qiblah
1,666,294,957 *AF59809DACB6E2C0E7677DB65BE1F38213BEC9C7 6SPENNELLARE
1,666,294,958 *AF587B76434558B4A0B278D4ED02EFDF70F13EAB 1.sudarto
1,666,294,959 *AF589D1280CD9A72FF2AEAAE8937BAAEE4A978CF 1-TALOMERKKI
1,666,294,960 *AF5F158125BDAD2F32A19D9EB6ECD47448D71589 71713
1,666,294,961 *AF52255F4784D77CB0538F46453C4B8E585E4F1C 1.UHKAROHKEASTA
1,666,294,962 *AF54D69060ABB3480E1335C074D4F22D39F4AFD3 1VERSOEHNUNGSTRUNK
1,666,294,963 *AF5939E508FDE1C09620C672E211B2D95C7C9A56 792825 sayIsallaStIrIcI-ya-da-sayIsallaStIrIcI-tablet-kaGIt-vb-
1,666,294,964 *AF591E6E9CD8068EDF1BB3F386B2218D5772A9A2 796891 michel-tot-aufgefunden-worden-.
1,666,294,965 *AF546C0B4F796275BCDF3D66D081566BF09E6629 1 YKSIL
1,666,294,966 *AF585B5A31C2CEFA356FF7532FEE827A6309734A 20473
1,666,294,967 *AF5BF5DACBFC02F0307E3DE2932073F0E2F85C70 20FEBRUARY1173
1,666,294,968 *AF5DA9E23AE22786CFB6C9F80F9FCA53A4D89CB1 225883 SE.MM...EST
1,666,294,969 *AF5259F3EEA4C4FEBDEA0EB17089BA1D1351C447 2309262 the-album-was-distributed-by-arista-records-.
1,666,294,970 *AF5D2FA2A97D092135334AE8BDB91FABB113B2FD 7MDQDVMN
1,666,294,971 *AF5F6AAF8C7238565E8AD9BAA6D358B1F60800A6 267878 kurul-uygun-gordugu-adayi-atanmak-uzere-baskan'a-onerir-.
1,666,294,972 *AF5737B4F53F5BDE9BD3A7A70968E43095B200DE 2698115 PY
1,666,294,973 *AF58757021B316AA19B813AB64DDCC1650975219 7PAPASUSAN
1,666,294,974 *AF583546B7EFF060133CB4D6CDD0613131FB610D 7PICKLEORION
1,666,294,975 *AF58CBC5340AECA1890BC50548A01C0103C80E7D 2917429 UUSROMANTIIKASSA.KOTIMAISET.AIHEET.YHDISTYIV
1,666,294,976 *AF5C15CB51AE4D84C4C2DDC2937E75E00E70DB46 2923726 SIMULAATTORIN SUUNNITTELUN L
1,666,294,977 *AF520B338C4CADF9895EABAC6544A09951F74ABE 2.anglerverbaenden
1,666,294,978 *AF505A5C0B8AA06C04D9E0EB8D225A1DED98D8B4 2ANGLICANA
1,666,294,979 *AF5A7383B6A677B5D73F29B76BF4A89A27F14D46 7TLUAIREHT
1,666,294,980 *AF52F0D2011C1467D7E90C89CB0299D2E620B038 2BOPARAI
1,666,294,981 *AF555FAFA17071D73D718E6E4EE87D0D0A5C2AAF 2DESORGANISERA
1,666,294,982 *AF5C3525076A25E07AA45262D08BFC15975A553F 2DIREADH
1,666,294,983 *AF5FF6854F1EBE5641F77ED145545C2FB3CD144D 7WESENHEITEN
1,666,294,984 *AF547B2EEE778ADEC679A595F71160B1E92D344C 7YHUWLSMS
1,666,294,985 *AF541BD67FD28D85C4D33399FDFC4FE9BF6E9358 2ESCAMOTEZ
1,666,294,986 *AF5AC980A1A41FE28095ACAEFA0063FB6914F166 2faids
1,666,294,987 *AF54375F2B7BDBB5F22AA27113C79AB7B4627E68 }8{*.*.*.<=====8
1,666,294,988 *AF599DF25169FEEC8BD7F90C1591A68E817394EE 8AQUIETHA
1,666,294,989 *AF58CE0F35CD61F76963C3067081B126681823FD 2-kuvakielens
1,666,294,990 *AF5F6284CB8409CE90FE45DAEC76B5D81517E739 2naturellement
1,666,294,991 *AF5CBE1A40D4566D40271F966CBBDC584293ABB9 8D~0~osplat
1,666,294,992 *AF5CE103BA5000584E71E519560A775FEB89A5C8 8---D~oSplat
1,666,294,993 *AF5F37EA055A8D0BB2E5CE9F327CE74DC3A08E83 2VUOSIJ
1,666,294,994 *AF5A186181277DAD68C002C072A062405577C84F 32.izlenimlerini
1,666,294,995 *AF5A9F2C17A3391B6CD0264DA722E4EC696FA78C 333bracketdeviantartcom
1,666,294,996 *AF54B98045047F4967BE0E6A932A516F4BB3B721 8MLTRYSM
1,666,294,997 *AF50BD7A9467DF9A30405D175FE8A15241851770 37.BLOMQUIST
1,666,294,998 *AF50D47A18C934ED94150CB9FFFDA72465CB982F 8NYTTELYT
1,666,294,999 *AF5C9923CA4F33F072250260903318F5BC6ED5DE 8---p~`}o{
1,666,295,000 *AF547E7969D559FD4056566F8CFAEDA94726DE46 8SLUTHHOUND
1,666,295,001 *AF55CE48D00A7ED26A318E4291CD4737660903F1 8ZUSAMMENSCHARENLY
1,666,295,002 *AF57E49A82037B0DD94F9C20DDAD4A098A5C4C61 3P~.~.~.SPLAT
1,666,295,003 *AF57BE4E5BC5D97765F57C8CA0C2D0009B8AD2BA 9ERDOORROODRE
1,666,295,004 *AF5C5A6F54D0512D0747AC603FB31B6A72147911 4AHDNAHEG
1,666,295,005 *AF591BC9AED7AE8F6515E3B3EA5B74279600670E 4CENTALA
1,666,295,006 *AF57D82E931E3007229903E14AB751F70DBA3828 4CERASALE
1,666,295,007 *AF50AEBC89DEC8B8A4FE7502E4393D23DF90E7EC 9iamscooter11
1,666,295,008 *AF5BA94FF63953C384E8E1E59294E96AE194B268 9JESTERB
1,666,295,009 *AF5A8E2D7B64FE59608F686A5F2445083CE4C2F3 9MHOBMULH
1,666,295,010 *AF597AD2B782D96E7AEB8885C8DA98AD6B75231E 9mydoitnow3
1,666,295,011 *AF5E13709F21AF40F3E01D4506B4F00ECC540B16 4l3gxqm0bq1jc
1,666,295,012 *AF57721043E30D48E369BD09D2CF2AD1AB1F637D 4MEETALL
1,666,295,013 *AF56AEFD7CEB5D813621DB37F042E08EB3EA2D54 4NESHVATLJIVOSTI
1,666,295,014 *AF5E68821E4B5DD2E0BF72D0386D7DECB467A4B9 4.OHJELUKU
1,666,295,015 *AF5D5E232230B0B792FDD301C2FA05B3750BA163 4PROTOMISTS
1,666,295,016 *AF5E207A2C3F2DF0408866CEFA512E274CD6FA9B 9-tranquilliser
1,666,295,017 *AF53E2791D46DAD16EB29F048CCFC21414383276 9TZNMBSW
1,666,295,018 *AF5E9CE4651658170F5961C4EC18F88839681A7B 4SERRANI
1,666,295,019 *AF5F1CB215991F7B662D3F929EE50AD5174FADAC A18HXS
1,666,295,020 *AF57D71F8364915CA6DB7E06E35D654FC042786C A19810583000
1,666,295,021 *AF59EDB73A7C7DBF6B6E4FD80A96FEBD49970468 4WOHLANSTAENDIGERE
1,666,295,022 *AF56447D6C970540AC6CF234DC032499DA734B4E A2TD&
1,666,295,023 *AF5AB7B4DDEDDA4EE74EDDBBCC2A2E0D75F1EC67 5:5-#-&NONUSER
1,666,295,024 *AF5737470197F28A8965669F7D27C49CD9DEA0FE 5AKTIERNE
1,666,295,025 *AF51F8E26EB0CE2F9382E3F81551C37F25052123 aacrj7
1,666,295,026 *AF50A08BC2F3E003DB35A7A9955F6C9FEF7D1722 aadzbd
1,666,295,027 *AF5100F4C9B00930F70ABD8BBCD2B7410D2D73D3 AA\!G
1,666,295,028 *AF5415B894F005C4798180F563F1ABA2FFE8C181 5STAPPARE
1,666,295,029 *AF5B2626BAA5BB5F041E7D3BF315FA2E057D1067 AAROHATE5
1,666,295,030 *AF513645F58FEED24AC35CC137809BDEB171BB39 AA!Z:
1,666,295,031 *AF5A442F02B41BBCDF6674F7E50493F6AB11EF2C abbyfancher
1,666,295,032 *AF58AEC8BA7CD23B4356F45E5BE4E1C7C82E571D ABIMA.
1,666,295,033 *AF5F155708E9AFC23492E1A59830B123DAF27872 abms,
1,666,295,034 *AF5E22848BA086C62774354B65130346F4E54D54 abt%
1,666,295,035 *AF501273C1A5AAE2EC0B99A73E4E451DC372E946 6HAMOGLOBIN
1,666,295,036 *AF596705F9C26C286F61E861C3DF8E1E76359796 6ilovezebras6
1,666,295,037 *AF576684AFC7705D009BABEC936A248EB15BF0E9 6MOTHERCHEESE
1,666,295,038 *AF53C57010B9406094F81C9E28026DDC840DA8A1 a_cnk
1,666,295,039 *AF54368247433DDB6B80E341DB42EDC856B17A3E ADIQ'
1,666,295,040 *AF528273D77A550714599B317FBEF796C03A1774 706666 ANCAK.,.VAKIFLAR.ARKASINI.DONUP.CAMIYE.BAKMAMIS.BILE..
1,666,295,041 *AF56C287BC11EF553BD8B4E1FB3DA7FEF9AF052B [email protected]
1,666,295,042 *AF51FB8A31E77CD0DCBB996A39B3967D89127834 73u9nlkb1m7f6n63s748v
1,666,295,043 *AF55B957A578C77727E883564A739521F2DF6538 742880 TOISAALTA ESITTELEMME NIISS
1,666,295,044 *AF55AA3212CB5E89470AF0E317556D24A3E1E2BD ADU1A7E$
1,666,295,045 *AF5F8A707E2326C39F1A022E160B82F778126D2A AE&S6
1,666,295,046 *AF5F3EAB21D300CDF455ED654DA9F4FD2DB1A415 AFHTSR0T104Z3VW6
1,666,295,047 *AF5D0FD7DAAA0680ECFDC9F92CE28EEEC7417E4D 7IMPLICITNESSES
1,666,295,048 *AF52CA51CE9256E3CF5EA5C755CBB6B652B252ED 7INFAUNT
1,666,295,049 *AF5802FAAB0B2E45FEC2AE26565AEBDE4361B2A7 7KRISTYSPIRIT
1,666,295,050 *AF51053629A7CC6D510D7A53EA84A82024743CAA AGV7Z
1,666,295,051 *AF5E8EC54FA4C716C6ECFC1D7EFD35C092C6E383 7-POP-FOLK
1,666,295,052 *AF5DF9470927F004CFAE03403B1975FB435520DA ahmedmiyasaki
1,666,295,053 *AF591C3421DCE50F1CEC7B3DEA0E43A5E556ADED 7SUPERGLUES
1,666,295,054 *AF5C632AE4C356B85D9F4C28034E2B2BBC90BCC5 7TILLING
1,666,295,055 *AF5EAD30A73A5167E9D3EC9F783D96E54DB37B83 ainsisoitje...(lamentations)
1,666,295,056 *AF5BC95C4F6E2C11DF52649E346E1C894E2C87AA [email protected]
1,666,295,057 *AF5E379107BB3D988200342F46485BAE42E6A283 AKIFERLER
1,666,295,058 *AF56F73234C957DA04FF42FD7DE66E9CFC6FA152 alani195
1,666,295,059 *AF5CD0A0409DE442D34BC9F63E4473D818C0B8A2 8ELEONOREN
1,666,295,060 *AF5E5BED82BF32B9949CAAB7B264DD690D8945FB ALEEDYSP6
1,666,295,061 *AF54EE70A764922CCE5C3BE5344A80F7FA331295 8FINANCIERINGSBEHOEFT
1,666,295,062 *AF5FD67BC9967186CCA80BB71BA256284BCEE5C6 8HQL
1,666,295,063 *AF5C1D3A23C0FC4EC75C22EBA09F28FCFFD9909C 8iamchronos4
1,666,295,064 *AF5E89AEFCBF99C918FE0972303F534549BBDA77 8MEMORYVAMPIRE
1,666,295,065 *AF5632240F815428D22938A7323E90DE674D07FE ALLF
1,666,295,066 *AF55570314E939A377ECC1AB13C8A74D456FF445 8PIERCECHICO
1,666,295,067 *AF5609C67D73B8AC3391CFB9CCD1B963A8E39FFE aloqk
1,666,295,068 *AF595110273CA3EFB76DF23CEBB990AA92E39197 8PTEVYYDEN
1,666,295,069 *AF5E847E882C5FBAEFB251461AED5A0900655B7F }8{*-Q###3
1,666,295,070 *AF5903D5C0A175CF27ACB27A9B1A90AE3B5B57F9 8RETENTIVBSW
1,666,295,071 *AF577658160FA4375B0D2363E56D2A4213174F94 ALTANGADASYN
1,666,295,072 *AF543BE835000F450FF4370DC1455321AE078CEC ALUDNUNU0
1,666,295,073 *AF59FC377C36B3B5CA1A189F25E70E81E096C985 8SMOREBRON
1,666,295,074 *AF5F316FFDC23C038F6AF19D4ECB4E054AAC5511 8winterpeer
1,666,295,075 *AF5C199A82C6665F7C3CEAF6953DCE99EBD5FD7F 969489 banuCakIruzm.dr.
1,666,295,076 *AF5BE04D3D62C74C9CB945293764ACD84D3F581C 9782aa8c75a37c2635b525fc181384f5 rose10jo
1,666,295,077 *AF5E29E9083ED54893AD818DAB883CB178D0B5EB AN=0V
1,666,295,078 *AF5A333DDE7BCA5D88E5DF375BCBFB4EEF5C9B8A 9C8DC055-BE04-3901-806A-089AD1F15131
1,666,295,079 *AF508F18D582B2E5878FFE7786C8945A44F233EC ANCORERÍA
1,666,295,080 *AF57E2CB6FB103A7B4D05634165204AEEBE3083B andantinoforpianoine-flatmajor,k.588b/236
1,666,295,081 *AF585113E5F5E636A39DD0324CF9D3AEC5A69DE4 andreamercadante
1,666,295,082 *AF5144F847A8965A4C709216E002407E405B8C98 andreatubbs
1,666,295,083 *AF5526CE331E3B5504E88E23694A736FBAC18E19 ANDWESCRATCH
1,666,295,084 *AF51102BEEA5C8C7E78A86E245D44003960AAD7F [email protected]
1,666,295,085 *AF51A36DEAC7D9F7E6CD9652A7C566A085CF6638 anise.hys
1,666,295,086 *AF517B5E14557ED87ED5FCF04DE037C56AF192AE ankararesimleri
1,666,295,087 *AF50E9DA6313F4D5EC79C298EBA99B4715F431C1 an(s
1,666,295,088 *AF554BA99C87FFB1FFB4DDE6DB846DBB06523A7E anuchintitah
1,666,295,089 *AF58F7031539F13E87F53A4EA73157321E344FDA a%0uz
1,666,295,090 *AF5039D92785269ACC161F9CD0E67FA3B2F66DFA a27l9
1,666,295,091 *AF5FE79345116A5D40B0367B4CCD101AE0CAB0EE A$3AU
1,666,295,092 *AF5B678237DC6C2E56C69E4C81624D5EEFC9603F aa046361bdd44eb48f8e1a746f6c391c
1,666,295,093 *AF5842F54DEC1BEC7C95EE5B88C71E473018A51E Aa0x
1,666,295,094 *AF585A649CFE582BD8B76094D38F5200E0753060 arnoldoboyte
1,666,295,095 *AF5926A3A4F08C276668B34352C3251B262885DD art88tra06
1,666,295,096 *AF5BD041D12DB1F046F40E1AA9A4B5A39DDAC897 asi.se.compone.un.son
1,666,295,097 *AF551C1805B941836B6AECF3E65287A4096D09B7 ATETLOP0
1,666,295,098 *AF530F7C54C7E0CAAD4C7D9292BFB87905E073B5 ABBOOJ
1,666,295,099 *AF50E0DDBA06F3C5D9CC8DB7D7BECA824449BC1A ABGEWETZTER5
1,666,295,100 *AF5C2E58079C80D31AB5E1A0D1239A583051B619 a$-bh
1,666,295,101 *AF5F5C3D577CEDA732B6C150A2BC5A72BF4063C3 ABIORID
1,666,295,102 *AF59AA3FD1F76178149D788E4F2D19A9BED268F3 ABS?D
1,666,295,103 *AF582E4D0ABFB54B6FE9D058C8F578E7AE4779D2 AC=DP
1,666,295,104 *AF5A6A4EDD7D30A0452FF012FF0DEDFB9191258A AZAROV)
1,666,295,105 *AF53B1CB4A9BD06EE151CF25229D27A82F7204A4 a;ze2
1,666,295,106 *AF5509E98E18F633A323E72B4CD8C7F994BFE332 B>.~0.~OO><
1,666,295,107 *AF51C50635E79782CAF168525DDB08B16F4BB2B6 b2$hj
1,666,295,108 *AF5B0C5B5C11B74EA5954A267427FA90AA937D3F AFLAATJAAR1
1,666,295,109 *AF5B4296BA3825AD5267311425D2654DE1DFAB79 [email protected]
1,666,295,110 *AF551461E5A1382A6FC7F3EC6F9566C5D38E1AAC badman-nah
1,666,295,111 *AF502B49E478EA5ED751AEE448EB081CDFBF0F68 aik-d
1,666,295,112 *AF57A23D49035657A32416EF662D79F3A61EDBBA AI.ST
1,666,295,113 *AF5D5B4EA9E4CB56B302986A4BF747F09DDB07A4 bcdiq
1,666,295,114 *AF5A1AF41835C1FAC1D14896FB8876B4C7FD8C40 bck1%
1,666,295,115 *AF5CABBDCD8CBA57F768E1F61D8EB9655C384F25 alhnj
1,666,295,116 *AF570120FEFD2A60DEB4E4890987B1DAADD066B2 ALWEB
1,666,295,117 *AF521BDECFBAF2CBC9A69EC521D44576AD752FA0 BENTON.CORN
1,666,295,118 *AF5C7702501148876E51DFD7AD1376CFC470121E bernehmen.Sie
1,666,295,119 *AF50DB93CD23292FB5A182E042A700E94FC3D880 BERNESES2
1,666,295,120 *AF58500889BD1C8466CD47453E339CAF09E9D89D amourcfi3
1,666,295,121 *AF5A973177676854806E9224080CF809026D1F27 bierlys6
1,666,295,122 *AF541B95DDF3EC0E0C6ADF2592EAFEB55355565F BILL.RATANA
1,666,295,123 *AF591B82FD6B0D59DDE07A63A5EAEE1F3C41E522 billstoval
1,666,295,124 *AF51C5562C83158E63E75DF1272146AC4D60D881 anv-
1,666,295,125 *AF53A82D4C15EA0C02AEFA56A72B9185F58CE48E BJDS7
1,666,295,126 *AF55963E907E082B183C1B4EA624F827211B2638 blacksmithsmash
1,666,295,127 *AF5BE0B018FCCF7FF2BBEE91700FC94668DBE456 A;QKT
1,666,295,128 *AF5E299EA84756EEF7D39B67ADB0FAD7DF40839D arielesch
1,666,295,129 *AF5DFABA11B670B6DACCC9FD93A8FD2DACC91F3B bm(?p
1,666,295,130 *AF519FFFE824666E1FC88CB9ED318EE60678421D BOLINAO52COM
1,666,295,131 *AF5CC18D594C41A966FF6D5A7646CCA6D49155D0 [email protected]
1,666,295,132 *AF50CC7F4CA79E6475216777E4F94040E363663C bowermays7
1,666,295,133 *AF58C1F6B92B8BF9BF77F1A7DB9A92BD5140D4A6 A-TG
1,666,295,134 *AF5351EEFC47C1387BCC2E1D9A8727F361B2FD02 BRANDENSTONEBARGER
1,666,295,135 *AF507F0964E1B033907E9D0C6D174BB54DF1039E BRANDONEMDE
1,666,295,136 *AF59005D7C4B3FBE86BF930E1BF7342397432FF0 AVENIDA-HUELEN
1,666,295,137 *AF526CF1A6A15B323C72D57FC0224AF9F65BDB3B bravesapple
1,666,295,138 *AF59096E3CBD5ECF3AEDD0CDAA0A5438B4DB4E91 AWT4
1,666,295,139 *AF5A8CF8F8F656F3D3A19CD5149C8D01572A072C brooklyn-lullabye
1,666,295,140 *AF5455017389314CB26CFA0D3F79819FB5BBABD4 B3_7G
1,666,295,141 *AF57627ACE2F6CAD4F67560097216DDE9F698524 BASIL.STUZMAN
1,666,295,142 *AF5579595E60974ECFB939A8B78952ACD519BD71 b:xe
1,666,295,143 *AF5BBE3461C72D660EB806878E63B22A86172779 bbw76
1,666,295,144 *AF57715EA569F4E7C3ADEDC74EA3B98622D14923 bd__0
1,666,295,145 *AF52FC038BCD0BFCDDD425CBBFF9B5B6D84C0DB4 b#dhj
1,666,295,146 *AF5DA16D80975858C6B8230F139943EB44CD8495 C3_YR
1,666,295,147 *AF54E00A51A66FC8CD9E32BB361EE95F2A35F040 cag4u
1,666,295,148 *AF5CCE594C7808FC0A0EE43A22CA57437B0BCD65 BEZBOLNOM0
1,666,295,149 *AF53C3B496DC9ED4DF97CD4C220B8931D4FEA45F bfwa0
1,666,295,150 *AF53EBE7A8E403BE426185E3DD21776FC7E5222E b!ia=
1,666,295,151 *AF51A2AF8925A4E67BC7A0C721DAA344C2684D30 bijinya
1,666,295,152 *AF52EF7164380D61F603E4A86CF38B66FE2DF2C6 BM##
1,666,295,153 *AF57093607EDF0940EA610E8C838C1A7E4FBD2D0 BOLDREDIRECT
1,666,295,154 *AF5E70EFD040C9C0905A749C16DF872A59F1CF72 CHARLIE.HUGLEY
1,666,295,155 *AF50347E8C0DA36E6233BCAEAC9AE0FBD42EED60 [email protected]
1,666,295,156 *AF5EAD9489168C8D13B04D9FC95AE92A61DA9E93 CHASMINNIE
1,666,295,157 *AF517CFC741F478103853F3F5EE8B0A435649367 BOOKERTESSITORE
1,666,295,158 *AF5073AC5F8C5E2C48D6A353207419DEEC3EB45E cheejy
1,666,295,159 *AF55B68F35ADF09333A9D414E0FFE9306A6314C4 B====P.~.~.~)0(
1,666,295,160 *AF5E1258CF7C77FD0F77F36DFF00BA73C8A57012 CĦIV
1,666,295,161 *AF59E3652DC69FEDE9A1F3C5FADA72B5E43DA37D B---P-~O-(O_-)
1,666,295,162 *AF56340BFA67B2C4F87982232837CEB8CC6F491C CHROUMERS
1,666,295,163 *AF5AB7E78AC4D4447B9527C2F8EFF4C1F132ADC2 BRA$ENIA
1,666,295,164 *AF5979CD63D652333900182A3775FC70DBD2CA3E ci,r%
1,666,295,165 *AF5B0B44CF6408E8CE3A5FB73BC4003A69BDE1F4 CISALPPINIA
1,666,295,166 *AF57350D4E1A557AA8D7EEA6798FE842D04BE1E0 CiVD
1,666,295,167 *AF5E5AE51504FF786576BF2189D25917638E9C32 brittanywalrath
1,666,295,168 *AF58E6EE774417F3D088C54FD5324A3147D1ED0B CKLFY
1,666,295,169 *AF5B160DDED4A6A86AD4FA7E6358E7A19ED7FF8F BSWELENATBSW
1,666,295,170 *AF55BA889B7D08A8453BF623C0F890E62185C2F3 clevelandmaggard
1,666,295,171 *AF5FF003349FFDE5BEC1E771EAD3CB92E67071C8 BTHAMSURANGOOL
1,666,295,172 *AF5F1F3F3AC6346FDBE804FFE1D100BF61FD878B close-encounters-/-star-wars-medley
1,666,295,173 *AF564CE66D1A00264E806FDA3AE406744E7F6E94 C)NTG
1,666,295,174 *AF5CA44C56F9809FE9D70F74EAB4B03D3CC0D7E3 bvl=
1,666,295,175 *AF5D9A7AEAC92404A2DE9E2534F3CCCE8BDBDC35 bxes.
1,666,295,176 *AF5FB8223B477A5B63A2124DF6959DBD9EA65CAF [email protected]
1,666,295,177 *AF595647C862E350A1B3689D3BA0EF3DF4E1F719 bzb.i
1,666,295,178 *AF5B58CDD193D768041AAB359C9B79E7EF9D6169 COQUTO
1,666,295,179 *AF5DDA40654B4D3FCEA452F6527A3B27F308D484 c6lu5
1,666,295,180 *AF565F39889FF288C91AFECE06ABF34D045A7381 CACHELOSAA10.PROXY
1,666,295,181 *AF5E3BDF6C47438BB66A88B9D51DC0CD8F29B228 c&qcv
1,666,295,182 *AF5308C5910468545D5B0DB50D52644EF9AD444E cravigan
1,666,295,183 *AF5ED3EE830C0009D3CE85A2B1D0135981969CD0 CARLOPLATTNER
1,666,295,184 *AF5F85E913BB84CDF716F66D48A39DE6C751E87F carlos-osoro-sierra
1,666,295,185 *AF5CDDF23D943BD2F75AC6459E8DED8B4D739EC7 CARLSONNY
1,666,295,186 *AF57926C91D9E771C5FDDE7988ECAABFB52E49A8 carmenangulo
1,666,295,187 *AF51C920C0162B648458D74D1611FE5A6B78E758 CSTS?
1,666,295,188 *AF53195C1262FBF87EE1688AE613B70B389998B7 [email protected]$mc
1,666,295,189 *AF580203AB8DCEF7E66294F4505993940DADFDAC CG1QT
1,666,295,190 *AF55CA3EB0063CBAAC50E3E2D9762D7A3C75FC20 CGJPLAY9
1,666,295,191 *AF53FBD1941C6FB2744B630376BAB3FBDDEB8596 c/h2;
1,666,295,192 *AF5488B139B2FD3D430D8FA27377726188F24574 chad-wesley-smith
1,666,295,193 *AF56AD5A669541852B4B9BB4DC3AE0C9C90F09A7 D3C3NTRA1Z3D
1,666,295,194 *AF5CE2F0B96DCF4694F9DE3221F9ED697B758AA1 CHANGLOOSE
1,666,295,195 *AF5200CFAF10E0776BD4C3076C442D2E436F7C94 d41wq
1,666,295,196 *AF5773C71F3E1558E0161D55C4452E3C6EC5CF30 [email protected]
1,666,295,197 *AF5BE35D0433F0AA6764D7BD6912B09534F10DB3 D91EM
1,666,295,198 *AF5034D31C8C22BC876CB91BF8B41E6C99D64598 CHI.KALBFLEISCH
1,666,295,199 *AF580AFD6FFCDC0F80C4840010BE384D7EB9D4CA DAGVARDTID
1,666,295,200 *AF50A2F46BD2C6B2844E410512BAC53EE601F715 CHR27
1,666,295,201 *AF5D714A4AD3A19FB9803836D927CD1D18337E5B dannielomasney
1,666,295,202 *AF5361EE55BFA8AF939D0021A729C474CB44C36D DANNYRUSSAK
1,666,295,203 *AF5B0E98DCCFEA2D999B02A670F815CB616BCB38 cilantr05
1,666,295,204 *AF56816889D2B0F17B85EA9BA79912703047DFC7 DARRICKGRHAM
1,666,295,205 *AF50BBC678DA5B6E956C9037DB6CAF75CB24760F c:k-
1,666,295,206 *AF5404D91E899F13013F90A48FDA78B58815D53F DASHRATH PRAJAPATI
1,666,295,207 *AF556D5C2E78225F0734C71D03B10D4217DAE045 CLAUDEORLANDO
1,666,295,208 *AF5103635E52A2354BBCF633DA9CEF9F774C7011 dboqq
1,666,295,209 *AF549669AD5E4C9506F41C9142DD809034F3F055 [email protected]
1,666,295,210 *AF57384B03D1F3BF0D56840D85D8901FBE22B10A CM1GU
1,666,295,211 *AF570A2C56CFD567B6F8495717523ADCE6F1F3FA deandrebrigante
1,666,295,212 *AF5B96495CF609F8006A587ABF6613D7520925B6 CNg5
1,666,295,213 *AF55723AAE768AF4B0709BDCAD01BE7E2ED10E73 COBLEBEAR
1,666,295,214 *AF53293BBE6D9EFA815FD9225DF3A7AAD75266D5 declans6
1,666,295,215 *AF52AC68D0007E45A1C79F4D45DCCA76D73461A6 DELMAR.HAZEKAMP
1,666,295,216 *AF5C068FE91B464F73ADEC58C02ED6080075CF23 come.with.me.(feat..lissette
1,666,295,217 *AF528DAA9A93E79E191717A5EF99619BDB07A990 DEMETRIUS.AMENT
1,666,295,218 *AF574E32BA3BBA40459222C89A8FBD6FE313EA84 DENISHATTUB
1,666,295,219 *AF53BBE2F500651DED7AB371EB19DD1C1D5C65FC conniewisenor
1,666,295,220 *AF541E9A273900A31C0BA794DA9C1032704F1BED denvermcgeehan
1,666,295,221 *AF53C89ACF343A164E09E846251AE9A070E08925 derutcelnu
1,666,295,222 *AF5352F3394A7D0DD5BEF7B5FFB8AEBB848F5DB3 cpa+n
1,666,295,223 *AF562DE3F3F1DA1ED7901A2299957D1DF561AF4E DGV/.
1,666,295,224 *AF5FDE82685410F7BF675FC87809C55D0F46D06F Cshf
1,666,295,225 *AF5BD7DC34329D3D37759C34D6CEBB5F233D3745 Ctsa
1,666,295,226 *AF55945F8F456AD5466DB9B33E87E5BE636F8680 CULOSPARAELFUTUROCASADEALBA
1,666,295,227 *AF5821A4A801E5EE24337805A6EFF8E34FECC1EB CUNEATOR9
1,666,295,228 *AF5C46CA48162CE6342C0C135EE396D65DF722DD cxetd
1,666,295,229 *AF5D2E3D0C2C30C94BDFAB3947B63CA98A9DEF48 d0)32
1,666,295,230 *AF5682FEC4172E54F21044B4F0BF2FF904E64BBC do6ik
1,666,295,231 *AF5A0FBA9657498A210F8C95F7FFDF2077A7A964 d4ba
1,666,295,232 *AF508988534010F861A39B5E074697548AF824FB DONG.MANZAY
1,666,295,233 *AF54F593D02E44F122E73EF97DCB6E03BC4EFD87 d8:m2
1,666,295,234 *AF54785FA1BCB6A4671D694969EA09D1855D6CB3 da-b)
1,666,295,235 *AF5E83E24409AC6043EECCF41B3550EF06DDF412 DALEFOSNAUGH
1,666,295,236 *AF5844622877371202A1224BB2FD2A614BC0CC86 DALLASSASALA
1,666,295,237 *AF5BC2FE752DFFD81D3DFDDE84647D245392A8AE DOWNFALL-(WAYWARD-CONFESSION)
1,666,295,238 *AF5B6D24B8298B2C7B093FBD47457622BF577A0E DQHDX
1,666,295,239 *AF5DE9B447FBE1D8FE932DAF4265259C4C90C9AC d,q(o
1,666,295,240 *AF57B42AAC9D0BE0EFAD0E2BCC2BEC70C69D4B93 DRAGOS.GIBEA
1,666,295,241 *AF54EA7CDA5098390BAA1727E8560D4245AD7597 [email protected]
1,666,295,242 *AF52DC81D4A3C02040BF587E0642FEBBA79BEA0C DARRELLMCCUIEN
1,666,295,243 *AF5D2EC8BAC3B78631AA6BE64CEB88BB0D43FF58 darronaguilar
1,666,295,244 *AF51D480C37DC9F92344ECE61F8E68EDCC9B891D DARRON.WAHNER
1,666,295,245 *AF5C0126EF71536A604D689A7E9198823338F447 Drhi
1,666,295,246 *AF527FC38058930802667178AE42EDE0F521C654 DUKEPPPING
1,666,295,247 *AF5C9E4B1DCA8B4EB0D070F989F2B9D93B215337 DECURSOS9
1,666,295,248 *AF57EE5DAB4174D6B39770BAA7B5888F6C28CB99 DEISTSNOT
1,666,295,249 *AF540632642DC854F3D18AA1C212BDE8C065CB5A DENNISCARBINE
1,666,295,250 *AF5C3FB5DE3E0E4EE908DE39A5AC63607801FF59 dennyrothmiller
1,666,295,251 *AF5F34DBA5CC161B15C0643F0CCDD8EE27FBC88F depetri0
1,666,295,252 *AF55DB0D542461291F82D515A797BF0F3D7752D4 DERDIK
1,666,295,253 *AF576FDBEBE4E8BF2F40E5F17BE06FF4118EDAE5 e37(
1,666,295,254 *AF5DC4A56BE19D2705E8856D166261520133DA65 DEWITT.WHITTENBURG
1,666,295,255 *AF57A051112980D3BDE69DEE5E047089FA4D7AEC EA.WILLIAMS
1,666,295,256 *AF52C47F7E6C3DDCB7055A80AF5EE1169E12F15E EB'+
1,666,295,257 *AF534312A7842B7CEE7DDAB60AFB25435665FD63 dfotf
1,666,295,258 *AF5F3B8DDC7BD3C450F2D2785EEBE26DF8EA9266 DH$FA
1,666,295,259 *AF5FF15916BD96D9F3D9E63C188F3E6765CB993F EEBA
1,666,295,260 *AF5127FCB27907FA4E5086F257B221C3E41742AF dinomohr
1,666,295,261 *AF5B6A6023D272800139FC62145D480D45026418 din!t
1,666,295,262 *AF5821147369389D6BEA33946FBB6BE09C1CD30F ei|"
1,666,295,263 *AF5D03E9819828A6912EF961979C8FE054DC2B24 eight870
1,666,295,264 *AF5E767D451B510D39506F552D0815950944F8FB DJ1:,
1,666,295,265 *AF509ED345BFEF9AE072B58C7B8585067C1E55B9 EITH
1,666,295,266 *AF503D87C71DA92C6BBCB22B0B03272AD6854816 ELISEANNING
1,666,295,267 *AF5BD4E700052267B7533D635FACD3B0C287EF95 ELIZABETH.EDOUARD
1,666,295,268 *AF5C51F86E1D70A0A17BFC8F06AFCAB4A982B405 ELIZABETHMITCHAM
1,666,295,269 *AF59D6F028E164C7BACEF7460CC884094059A420 dnd2n
1,666,295,270 *AF520C391A4C4B72886FD979DD554D44A69560F7 emxrf
1,666,295,271 *AF55667FFDD49E6A35DC2A7107B43F01089D3473 ENLIGHTENMENTS!
1,666,295,272 *AF548843C88FF96B9A845CF502F2907A62685106 DRKA;
1,666,295,273 *AF5562FFD39AD287BC704D6BA1786C5FC1ED2B70 drwdt
1,666,295,274 *AF55DDE3E39CD43007514E070BF4D7250F0DEE0C erstattes?
1,666,295,275 *AF5C2BD3F5432C22CC9AAD2622C2D0B2DFA978F5 DUDLEYSTLUCIEN
1,666,295,276 *AF500FBF9C5A10864D4BE2C04D291EFA092DAA01 ´´ESTRELAS´´
1,666,295,277 *AF51D526B017E6B933CECC8FB683B103C71FEB68 ETMOS
1,666,295,278 *AF59007F067951AD3BCD1F44DF0563C5D4AF18FC dv(d_
1,666,295,279 *AF5BA76E313C5F72719A921463E1E1371EB039EB eusebiokaune
1,666,295,280 *AF5A43DF4C768B428AB06BAB503AEAEBC59662F1 dvw2z
1,666,295,281 *AF5297921AB791F38ECCA305E544355376635D20 EVERETT723
1,666,295,282 *AF532EF598CA8B8EDD8728CB7945E0F617225945 dwech
1,666,295,283 *AF56AB8EFCA51C520AF1CAF25CE909213A052F1A exceptaswordorsceptrebalanceit:
1,666,295,284 *AF5A1BA94083EE6BEB98DF6D99A9FD34F0DC72D2 D&X(
1,666,295,285 *AF529E93655EAC6C2B5FD011F184077FDBE2C93D ezeldensed
1,666,295,286 *AF500B08778FDD0D976A845163087B3DA23BB538 fælledparkens
1,666,295,287 *AF52666FB6B2A4CD3ACFABCB29A09B482B637288 ecoar
1,666,295,288 *AF58221652E8F4A9E54487D1EAB5D7D1C49E5EB3 FAST BESLUTEN
1,666,295,289 *AF55DFCDC40AA1F3CDE5036DACA4A25476A18770 eddycardoza
1,666,295,290 *AF5DD21C7D616053088ADBD53AE1307076EE9775 FCHISHINJI
1,666,295,291 *AF58626D2AE806E44BC4E97307E0B7ACAE18E60E FDAILO
1,666,295,292 *AF553C2D2D221E95A2FD138AA16B34405868A4CF EDISON.WILGUS
1,666,295,293 *AF59D7383716304D3D73939AAEA2BB1691325E47 felixcopsey
1,666,295,294 *AF5B63419BEF6669F37C26656FD2A976BDF26705 FELIX.CRUEL
1,666,295,295 *AF51F8D9BAE76FFE4A5B602C1DB90ECE8D23C4AB [email protected]
1,666,295,296 *AF5B24331BEA9F975D572E65B4241D35A4AF9FB9 EDWARDOBOESENHOFER
1,666,295,297 *AF57EFA197E778867108146851BF6060C11255BC eetrape7
1,666,295,298 *AF5400F9D1DEEAFCC711B93E111833D38B9A5381 ef%kc
1,666,295,299 *AF5EC914711D8858293C1940BDD9EA6939A18F01 ELDEN.PEVERINI
1,666,295,300 *AF51333127224837B1DC831A36EBAA1D324B4CB1 foldrcom
1,666,295,301 *AF582DB4FB7B0E83E4390D32917D5EAD6D1770C9 ELISIEFKE
1,666,295,302 *AF5F2CACE879A279035096A7DD17611C0E02AB96 elizabethhalbert
1,666,295,303 *AF51CA162240E2B4D5B0E29FF7A372AF060847E8 FOTOTERAPIE1
1,666,295,304 *AF5676DF8981103D7565649D17FDC47A46503B49 [email protected]
1,666,295,305 *AF596E3601F2938A4206915E93665188C5F95FBE elloandfriends.uniosnabrueck.dewww
1,666,295,306 *AF567629C63778565179AD4E42B0E6763F86723C FP{1
1,666,295,307 *AF5019924CBAAAA6572F0CD609ACE803543483C4 FRANCE3279
1,666,295,308 *AF5AF407FC4C383BA222B1BAE9BEAEDB4340D771 elroyaffolter
1,666,295,309 *AF58461013B24BC4C840FF9B3EE11CD8E47C688A FRANK.MOSKOS
1,666,295,310 *AF57FD05C8038B19EB09AA123757F882C3DD7BFB EMERSONDEPINTO
1,666,295,311 *AF501E85A647E6529BAEBE84E42F63574A56B624 emibq
1,666,295,312 *AF514F61B80009D10DAAC9E0F397B2B1F0064399 emorydodridge
1,666,295,313 *AF56EECCE9E9C9EE5E87ED514F20B9F54C3DD386 FRUKAJ
1,666,295,314 *AF5F242C2EB0056880BACB9C061FD1E2D8D22B42 enganing
1,666,295,315 *AF548C974C753E98E252147810B97247117100E9 EPISODE.6:.A.BRET-SHAPED.HOLE
1,666,295,316 *AF512A2315DD0D91568561C27714E23096E80B4A «GALEASS»
1,666,295,317 *AF59B6876922CDBE84E5FAF960CB6D22F923D843 EPODLADCHIKOVA
1,666,295,318 *AF569090C190C8FC6DDA939164B3D2C63A317434 GALOLAOO
1,666,295,319 *AF5D73CB097C99BE2FDD87231F727FA5C498D453 GARRY.GEBAUER
1,666,295,320 *AF57930A11C7E8B1E9995800B955D12F4AB2BCD5 GARRYHALMSTEAD
1,666,295,321 *AF5CBB990C420B59F02AB36358908DD0BD63D14B garthmasterson
1,666,295,322 *AF58C3AAE80EA2ECE608478560596CF2A1F7D262 ERICK MILES
1,666,295,323 *AF5402AB544B5FAA9EF155D509D64AEF5417AEAF GAVIN.LAMBINO
1,666,295,324 *AF52C26C6841E2D24E189BA2687C00AC59D33697 GAVINLOYA
1,666,295,325 *AF54416C0C87BAB9C123F09F8452C6369A55E0B4 ERROERRING
1,666,295,326 *AF5F438C06B3BA3F1EF14DC2F965614195E29487 erwinbuchauer
1,666,295,327 *AF555C5E7D6FF4EB19C6D44998832435A3C94959 generaljosquius
1,666,295,328 *AF572FE71726FF1C19846628823861ABA6B0D2CE ESI91
1,666,295,329 *AF5FE3DAFEE9502D01066C9AFE6AE9A18530BB37 ESPUERTE8
1,666,295,330 *AF56979154023EE3C4A2750250F5048512E9E527 GEORGESWAUGER
1,666,295,331 *AF529BA242BBD29FE1A3F29AF5294C5B974AC254 [email protected]
1,666,295,332 *AF5E2DE1351E0AE2BEE4B2CBAB942BE34E4F385C ET77A
1,666,295,333 *AF5A3FACA6A5E59BC754EEAF7F62E400337D6104 GESTOOK3
1,666,295,334 *AF52D0EDC2868E8B0271957CE7EF9372FB27C31B EUTSRHEM7
1,666,295,335 *AF567937B781B24F8D3C344940049C8EA19217AF GIRARDCOMMENTS
1,666,295,336 *AF5F6904F7FB7BCF56782FD38E6B40C44FB2B058 GLISCAOD
1,666,295,337 *AF5B5E5D1D7D7DD12BCA8CA8C9D41AEF3C42D95B ‘GLOBALISATION’
1,666,295,338 *AF56A9AF1598828D89A7F66280516540B970FBB9 ey"rz
1,666,295,339 *AF5D9A6C2DF75837D1AB0FF1C5BC24E50123071D [email protected]
1,666,295,340 *AF5AC1C2F679FD2ABA69D879A16514873B2898AB GOLFANGIE
1,666,295,341 *AF58BD207C55C8284A694D786AE5E04380FD073E FAHRWERKSGESTELL
1,666,295,342 *AF5FA67CDB834F65A37750B2F562EA2900DD7580 GORDONALBERTSEN
1,666,295,343 *AF50C447837BBD702DE30BB8A21DE281FC593842 gorebooth
1,666,295,344 *AF5ECF8CC4607E9A895109DA1591F84142D5192F fallingged
1,666,295,345 *AF519681B89A99418F862EB8DE26E8A5F551FC96 gqle
1,666,295,346 *AF5FF589559E57CA5D92C5BE94906874B80A104D GREG EGAN
1,666,295,347 *AF5042A03502973365ADBD67D83E7F12FD131A2C felicityblow
1,666,295,348 *AF5F85235680185DFDBCBFDF9ECFA75D1DF58EFC [email protected]
1,666,295,349 *AF56C1118D77551DFE714EB351B66EF0BC26FC9B FERNANDO.WHITMORE
1,666,295,350 *AF5E1295152361F8248B53C1F271685620C159DF [email protected]
1,666,295,351 *AF561FF1E54A0B25772F2F03D7ACA79ECD3F8532 GUIADOS»
1,666,295,352 *AF5EEAD1184223648005C2EC4A61FABC946765CA GUIDATE
1,666,295,353 *AF5222872CDAC2ABD5BA1FC5A400C779D6EBE8F8 (FILLER).TANONG.MO.KAY.PAPA
1,666,295,354 *AF5190B22A57A36BC65A45BBAA28C4F02B01E2BC gustavolindo
1,666,295,355 *AF598C0D2294499EF237285B099884D95ED7202B fletchermeffert
1,666,295,356 *AF5A058F01760EB9D0D88E6AF351413FA974D879 FLORINGHENOV00
1,666,295,357 *AF5F1EFBD3B2A8591601D6C7AEC4F32532E6D3AD floris-de
1,666,295,358 *AF53983DC4868494C5238F2CD610AB77B799A349 HAMBURG–FRANKFURT–BASEL
1,666,295,359 *AF5D10EFD889CF56CEEDC0B118159C2D97DCDFAA FORMOSIAN
1,666,295,360 *AF5C26CE218CAE3F6F3CED6FF4B37AC73B0BC21E HARMONIA
1,666,295,361 *AF555A5DF70694A41062D33865B005B49F97DF2F HEATHCOSSANO
1,666,295,362 *AF5826D96CEA8A5F9A76879B4B717EA86EB639DD FRUYCION1
1,666,295,363 *AF5073EF7326A2DCC512921EDBEEB8427AAF60C4 HERAKLIDAN ,H/E/R/@/'KL/AI/D/-/N
1,666,295,364 *AF516B1F588FC4937B16B0CE51A2D0D90B81BAA0 herberttogni
1,666,295,365 *AF505E370A1854DA8D2F98AF1E4C74380415C71F H$ET
1,666,295,366 *AF5C615D38E61BF976401838C3149C23293FF092 HIN.TOTO
1,666,295,367 *AF5AD0D29923AB267BB797EFAF66317067D3E57A garfieldbickart
1,666,295,368 *AF549BDD39ECFF256CA412E7D1FCB2D39C59BEDC GARRETTKASTOR
1,666,295,369 *AF52EA84C70CD7E51FC1DC97596311DE55B3A7E3 gartheling
1,666,295,370 *AF56141D1A4DE09695F44FF2EF0DFA9633C151C8 HOBERTBUZZELLI
1,666,295,371 *AF54794BF41FD0F94E53E915936289D7F10BC4DD gaytheling
1,666,295,372 *AF583552DB07CFCE44AF14357C9371036DB17372 [email protected]
1,666,295,373 *AF51CCC7D78EF38D87D9D06E98C476E2260C8E36 GEORGE ZAMMAR
1,666,295,374 *AF515D65B79668FE94006B5565C654E44F46D6C3 GEOVANNA-SILVA
1,666,295,375 *AF5A35149A8167B355876C4B436B2864D03EDAB8 geredespor
1,666,295,376 *AF5631B6FD0500088C9ABF87DF0F16AE79E6C370 germanoiberoamericana
1,666,295,377 *AF5ADD40E33F7561A6FE8A7E13A6EFB98CC12EDD GERMAN.SAHNI
1,666,295,378 *AF51A1B58E0E4434233C7637B8738679C31796CB germanwirehairedpointer466
1,666,295,379 *AF59F5997C897C09837B3E2066106A0F09334AE0 HOUSTON.SWIATEK
1,666,295,380 *AF5E10B3D5990AE57B21BB32D34E6C5FACF84DBF GIL.SAA
1,666,295,381 *AF5F8D7C22430A1EB5E851144240271B96DAB8E3 HUARTESANDRINGHAM
1,666,295,382 *AF5B099C64BD688E6E9264E0946B34BFA9A6E0D2 HUBERT.MAGGERT
1,666,295,383 *AF5AF856E158A87EF8884EB2CC00A2322DDA2787 HULL.UP
1,666,295,384 *AF5C0044FFBD2F521A5714EF988648C0AE03DF34 GORDELDIER4
1,666,295,385 *AF501075CA1B17F147CDF2BE4D9D1EE571A01C59 GOTRUNOVER
1,666,295,386 *AF54274EA85AF6FEB4C60361C3B0C2586C01A79D iamsmitty29
1,666,295,387 *AF5E05812058A01757C70679CCAF6C3F03421488 IBYC
1,666,295,388 *AF53FC5C7005C08756C68265B5DFD95B93C1B11D idiocy isfoolish
1,666,295,389 *AF51F4CF7970668E0868C4E27BE677116C1946F4 groeber123
1,666,295,390 *AF523075C48911BAF270B81664812125C3D7CFD7 IEXDBB
1,666,295,391 *AF56BC4546A5D01765A50830FC88E86989999196 If.She.Waits
1,666,295,392 *AF5E7B63ED89FC924C1EB0154B0B98246495D7E6 ihcorcca2
1,666,295,393 *AF5614C488F824BE4CFCB1BBFC864307F3649939 HAEAEVIAE0
1,666,295,394 *AF5D0F1585FEE5E490A9AE9E77CB15067B64DB4E IMH1
1,666,295,395 *AF5473D72F84E54AAB97402509121E262374519D HARRISONORVIS
1,666,295,396 *AF54E8EA886452E3B829A37A5DED8246D8896A9F IN-PULVEREM-MORTIS...-IN-TE-DOMINE-SPERAVI-(PSALM-30)
1,666,295,397 *AF56882906B3CD60A33D7AB391DA388D52006C11 inside.the.dream.syndicate,.vol..i:.day.of.niagara.[1965]
1,666,295,398 *AF56ED135D3CED0A08B49F841E136157BC310198 insulance!
1,666,295,399 *AF5533CB98692966F3E4E0519985810621596F23 i(p"
1,666,295,400 *AF581F7FEE730A96508928E0685F0963100AD45A iromemered
1,666,295,401 *AF532F1AF72A1AC8D2DBFDDF0330AB60F4210949 irwinschlussel
1,666,295,402 *AF5DCB8AC1E1FD899965F724C19D52E8578F8137 HENKILOEITYMAE
1,666,295,403 *AF545FB203B69FD3382E172ED455981939587989 ISAIAH.ZICKUHR
1,666,295,404 *AF50C14F431A965F379016DBFB0F115C47B088EE isaiasfernette
1,666,295,405 *AF560AA4EFFBA5112BE8181F08BCE6E99D5035CC herb-larson
1,666,295,406 *AF51010AE100898F63315CD59CC002A057FEFFD5 isl482937
1,666,295,407 *AF5DE0E7B6F24DD5D49C82DF2F0690B4945F6F1F ISOTHERMOBATHS6
1,666,295,408 *AF56A1B0B50AD9711296864D106669BA739AAE18 [email protected]
1,666,295,409 *AF5DF69FDF58841FF583F6EDA33CA0A524F7B2EF hgwuon
1,666,295,410 *AF55472157B7D372B16E4B4BCFF9BC1520CD9216 h'ij
1,666,295,411 *AF566232C66E7257991EBBE81BC859B04D465FCE IVORY.HUGGHINS
1,666,295,412 *AF560CD194CD8AA2F749D9490CAB121CF184C8EE JACKSON.THEILER
1,666,295,413 *AF503FBAB93CAD795AAD064B85968A7192685ED4 hohlbaugh1
1,666,295,414 *AF52AFB7F85CFA8E8031DE155DC56E85ADFEE50F JAILANI0
1,666,295,415 *AF5937AA9B194F1EDEE4AA122E847773A6F5007E JAKESCOGGINS
1,666,295,416 *AF5BACF32380211D937357054BBE3DB282432BD1 hongay
1,666,295,417 *AF5E28D7770BF231CF94A3EAEC7A6C607E8C5E68 JAMAL.SALTUS
1,666,295,418 *AF594679853C6BA23BBD0EC63704ED769FFF6023 HORRORED5
1,666,295,419 *AF5B1A34C7CCA727BEFF4C31E3BD06196A5752AD JANTELAGENS
1,666,295,420 *AF5AB65251806EEEE1833A59BBE6311D6A38DC33 howyourperceptionscontrolyou
1,666,295,421 *AF5427B39CAC7E5DDD4F5170B83D18D3B75868E8 h+t,
1,666,295,422 *AF56E81E2EE1ADF80BF76DB495370B1143AC362A JAYHOOVER
1,666,295,423 *AF5614018C689040923EF5D572F1BF96B333A07F JCSBG-O-A
1,666,295,424 *AF57D6BAF8A39370EC41991F307DCF2C58A9493F hymanbushey
1,666,295,425 *AF53DBF5230E76672D998975D92EB13218F671C5 JERAMY.BRICKHOUSE
1,666,295,426 *AF57BE4157A73721B09B16E20CC40EBA900B5277 [email protected]
1,666,295,427 *AF59E3DA3F40696962B612D28EA6C10FD74AAB05 IAMBADGER24
1,666,295,428 *AF540BB5348BBBD7968A81A89F7859BECB1E0531 icemaidens
1,666,295,429 *AF596833D5CBFD3A70F6F4BC2221EE983E0AEF3A jh!%
1,666,295,430 *AF5AEE542E1420BCE5E3A4780FBD40C9E3065D87 ignaciobilbrey
1,666,295,431 *AF5B487CE2A41243C9279FDA21A4EC3E1FB751AE ij-{
1,666,295,432 *AF5AFE474BFA927797503E0D60AC9E533A7880B1 JOEY.PANETTA
1,666,295,433 *AF52EB8D78B90AE5D78557A9F982E633B8B36682 iloveskunk83
1,666,295,434 *AF5D632C9FB6C05F898104A6027C140636A0AD8F JOHNNIESODAWASSER
1,666,295,435 *AF5153677474AD667C31E056DFD1139E2BA26E11 johnny.bostic
1,666,295,436 *AF579681A8DB50A2CF810E55357E8B123259C3FA JOSEPH.ESTELL
1,666,295,437 *AF53A31529B4190C7C2DCE3512C7C51372DC7FDC INCH AWAY FROM HEAVEN
1,666,295,438 *AF5D723C5D35E73023836F37A9F77859E0FE907D JOSUEHUPPE
1,666,295,439 *AF58FE63868CA08395D6E7D32177A8E021D31807 JRJESTELIJKSI
1,666,295,440 *AF52A55D7A979E23A717AD80C672C14475D09ADC INSIDERK6
1,666,295,441 *AF512D349E7A4BC4BB29FB78A054E372848258C3 INTERAKTIIVSESSE
1,666,295,442 *AF54A40F1C8346F593970236A6C34112680126EB Juice.Control
1,666,295,443 *AF578F0E5F3186B8BD5DD91672CCC48709C3C184 JULIOROWLEY
1,666,295,444 *AF5296A88E4D4CC433CD21A01339F88BC2146E2A ioi[
1,666,295,445 *AF5B6D0A463350BAEA7B2DCE677031A8A53AC224 [email protected]
1,666,295,446 *AF5E59723157E495FD79419D029195D336A34C94 ISIAHAULL
1,666,295,447 *AF52912F624CE0344ABDE68D450C61FD309E2389 ISIAH.BURTLESS
1,666,295,448 *AF5E3011DBAB38E96F9FDF707D6F57AFC856E3F5 isperete
1,666,295,449 *AF570BF2175C106C9089E3597AF6DC323BDD03B3 ITSIVERP7
1,666,295,450 *AF53D3387E73F1ABAC0BF506A2EB044427EEAE51 KARIM.ELSAWY
1,666,295,451 *AF5C4275835E23C6EAE0BBF40E93491B9A742FEA IVANFLAHERTY
1,666,295,452 *AF5AA0894FA7B4124F8DEE587C32587F09F18363 KARLGULDEN
1,666,295,453 *AF52581DA4964FEB9F97BCD7AED5F4A7CC7564BA kellypurdon
1,666,295,454 *AF568465E0201EE825C2572E4737126DCAA40EB9 JAMARZYSKOWSKI
1,666,295,455 *AF505F6112784A27AFC397BE0B8FAD32C4F9947E jan werner & fx randomiz
1,666,295,456 *AF5899CFBA306ED9F2C85B6A51F7EF9C5313D0C8 [email protected]
1,666,295,457 *AF5980398A733CB9AB38527DD5597C8EB8075E48 [email protected]EGGA.COM
1,666,295,458 *AF5D6436822FD78613AC8C22DFA4020B715B8CB2 jarrettdavitt
1,666,295,459 *AF5C7715203E2139BEDC8D236432B3F2A2AE0975 JAVON119
1,666,295,460 *AF5A1585486E9442178FCCBD6D9DE4B95D42297B KINDERGARTENERÖFFNUNGEN
1,666,295,461 *AF510FE2B4619AD87DC2D57DD01AA75C8EEB4B9D [email protected]
1,666,295,462 *AF534017F272405B31D0760A68C7F12A3E14F094 JEANNIERYAN
1,666,295,463 *AF505F0A773A9312138289B75026287251E691EB kloetstokkens
1,666,295,464 *AF5F2EEB9246459FBEAC9A23AE3EA0B91724EA98 KNECHSTS8
1,666,295,465 *AF5199982DC5E917744C6D2A9313F1E53BF30201 KNJDB
1,666,295,466 *AF50FEDD8F71319056CA80927F19FBC386ADF147 k%o%
1,666,295,467 *AF5E38568174353F4CED8051419B8D02B5C4DD91 KOK-XUAN-MIN
1,666,295,468 *AF5E97DC86D6B5C1F1B9107D1E39E155DA6F2902 [email protected]
1,666,295,469 *AF56365D75A98A3D469366AB12C81D87F3BB401B KOTERBAY9
1,666,295,470 *AF52BE3CA0CFCFE50A32A6190B1062613791D74B Krakelingetje
1,666,295,471 *AF57D595D6A0EF07A53D37035CFB142097E163CB [email protected]
1,666,295,472 *AF52D9FE90657055865786B1A9FC354F06BFD950 kryduba5
1,666,295,473 *AF5B59A7D6AE5D7D48718B3AA955ACD2E068A45E JNLZ
1,666,295,474 *AF54214F0CA69871A873E3EABE3794374A1B66B8 joe9joe
1,666,295,475 *AF56939707DD2A21EC2C27CBBD3B637FBDBA1AA5 johnathandeschino
1,666,295,476 *AF556B0D8D16B43C884CDF1C8510B44203C666CC JOHNATHANGHERMAN
1,666,295,477 *AF5D0B586BAB6EBB19708AA80B601C06E5E72AAD JOHNIE.CUSHWAY
1,666,295,478 *AF59E87CA9EE68CA4C52855CDA58775D763A0E5D JOHNSONPARADOWSKI
1,666,295,479 *AF55BE91F674679C395BFC88AB36FE047FD41AA2 LA-FORZA-DEL-DESTINO:-ACT-IV-"LO-MUOIO-CONFESSIONE"
1,666,295,480 *AF528FFC7BC4CE9F7DDF633E40A75A1354B294DD JONATHANLANGEVELD
1,666,295,481 *AF5231E38233B8366A426ED8E3EB50B041A1F951 JONATHON.BININGER
1,666,295,482 *AF542368402E6293BFBE9660BC5CFD41E49520BC [email protected]
1,666,295,483 *AF59FC136CBFE8AEE5B0EB7D1DE9E8A09787A78F LANDSERLIED
1,666,295,484 *AF50753A1EF6E6BE297A69E3AF94373B9B6D4237 laughton“
1,666,295,485 *AF57A5DD7C90B1CF8F6952EBAFBFBC1A76C9011A jud4slik3
1,666,295,486 *AF544E8EED33AD01ADFB875DC49C80A386FB80B1 JUIELYBHOSALE
1,666,295,487 *AF5375586991A8741D075307B03F78CD2B217D3F JWALTER5
1,666,295,488 *AF59C029E4DC97B37F67D900A0704135369CC0CA LEIGHSPRENKLE
1,666,295,489 *AF5FD59098B32E4F825630A5B51DBE359C735C19 K64027
1,666,295,490 *AF539E774D71CDC12195DE20DACAD86C29A88731 lellyett8
1,666,295,491 *AF5E3D26146E0CF7D539BC887E58E41BC8A5CE4D LEONELPAPLOW
1,666,295,492 *AF5D9485A869813BD250FB33AE66421440CF0A6F [email protected]
1,666,295,493 *AF5654993216A5C9D73C9010688CF04BA9F669B2 KANPURDAYALBAGH
1,666,295,494 *AF5158979EA43875B361BAC9B716CD0AE5D980ED lesleytelly
1,666,295,495 *AF50085BD647BAA1153CDB7929782B536739EA9D kareemvongvivath
1,666,295,496 *AF5302B46BCA97D5ACF80A54B3A622E5F01A2893 KARENBOILING
1,666,295,497 *AF561CF22BA2ABE7E67F9C48CF8EBE9AD5CA7D41 LEURRERIONS
1,666,295,498 *AF541509532551EB808E0A94B7D03A2313CDC278 KELLZ-KELLY
1,666,295,499 *AF5DCC43629E08BADF359884A7EEF83FABD07CD6 LILLIANBALDWIN
1,666,295,500 *AF5F7F69AADC6C781C3CDCBCBE4A79C2B074E92C KENETHFURNE
1,666,295,501 *AF586D9143DF20CD8EC6DFC7B001D8F937F4F887 kenethwyly
1,666,295,502 *AF58514D993AE31B745411945F359F1F20EDB0BB listages
1,666,295,503 *AF5B2C87BB864581A73D090B8B116E50AE7DC2C8 [email protected]
1,666,295,504 *AF529FB06267FF85BD3A6D95144595E8078E0AA1 [email protected]
1,666,295,505 *AF54C518157FD6BD1A94F2FC57CD40A8BB7DCF79 KIÁLLITÁS
1,666,295,506 *AF5D447C441C0C6E9C000F6BEBEEA1858A913A74 LOCITAT8
1,666,295,507 *AF5C3A73CC6010DC811E31BEFBF37EE35A86D58F longeases
1,666,295,508 *AF58CA9CB350F0846005C5F4AE83D3C0F4D09B09 [email protected]
1,666,295,509 *AF506AFE63A4E32343DCCAE2A4FA13208E542A0F lorenbis
1,666,295,510 *AF539CC24569D1DDAEBEF79D9BA1796F10E7F2F1 KLASU
1,666,295,511 *AF5CF8D822BE8A47180805318CA17232EE076F4A LUCIEN.HANDRICK
1,666,295,512 *AF5ABA9F2CDE910AA355675D35121DECD67E4E04 LUCIENNICE
1,666,295,513 *AF59374EDFFDB82FDF292FEDB4802C37D4E86B2D LUISMCILWAIN
1,666,295,514 *AF5F64785719A77E448D005B7E304018232B0AF4 kreislerpraeludiumandallegro
1,666,295,515 *AF5B0C55744DE8454997FEF85B3A3009DC62174C luooa
1,666,295,516 *AF5B54258916BEC492400F94276856E617B2252D [email protected]
1,666,295,517 *AF5F6A837F92FBD4C86A4991678FDEFB0DFCFA39 KYLE.EVANKO
1,666,295,518 *AF5BAB391B5EA092D90EF17657F1044AB8B76CA4 [email protected]
1,666,295,519 *AF553BDD86B6D4A84B11E6655C5F031D2A248850 LAMPOVÝCH
1,666,295,520 *AF5304B9FBCE029C4B7CE565A02A676ACA6147A7 LANDON.SHOWN
1,666,295,521 *AF5E2E0A4BCE51AF1C9E0052161E760C177E91EF mamma'sboy
1,666,295,522 *AF53AEE3EAEAD22039165E2DB328A29E84CF00C8 MARCMIKI0
1,666,295,523 *AF58537EB486A2FFEAA1C9DCAAAB462F3746BB9F MARCOPALS
1,666,295,524 *AF548A616AA68127C60308C542D508BCF1DE77F5 margaritochulla
1,666,295,525 *AF54B04588D7A7B099DF4164159E15113EE35FE0 MARKOVRISIKOPR
1,666,295,526 *AF5CA58E8F3B4F18868A38E16761BC3718164511 lennygonzoles
1,666,295,527 *AF5EFB0DA119A1400B23110CAB7D66371D5E4D57 MARTIN.SCHOLTES
1,666,295,528 *AF57228A937D53BAA600C07CF1E9B98B59DED750 LEO.COLASURDO
1,666,295,529 *AF5C538BE03B69D4E914920B8AA8DCC59704109B marvinkemmis
1,666,295,530 *AF52679745BDE09038D6E57FEAAB5F1D43F7DFD3 LEONARDSCHUNEMAN
1,666,295,531 *AF52A45243A54B60E565D65C0CD29B85037DC068 masters-of-the-roll-(disc-23)
1,666,295,532 *AF5845FBFE19A665FB7BF2A9E1A1B308AE93B3EC MAULARESES
1,666,295,533 *AF557DA2E439A622EC323D009F48DF1FFA9DB58D L´HOSPITALITÉ
1,666,295,534 *AF54EE2016CB93CBD05E69C2967F5296B1D127D2 MAYNARD.STAUBLE
1,666,295,535 *AF58E2DB564A1D13AE19DD9C9415F19D6B4FF104 lifegita
1,666,295,536 *AF59A3C660B1739598EFFDE9F8312B25CCC156FA [email protected]
1,666,295,537 *AF583BEFE5777F7B4DFDA64E32BDF4AFB801E7A0 LI.(INTROITUS.DU.SAMEDI.DE.L'AVENT.-.FLORIL
1,666,295,538 *AF57E93DF2789D825865000CFB20C020DF391117 merengue.(faze)
1,666,295,539 *AF55C62CF8CF979ED246C9A653CEBB3D2EB0AF1D [email protected]
1,666,295,540 *AF5E9377F4843F411A5712AA10DA8F8BDABB01E0 LIVE.AT.ROCK.IN.RIO
1,666,295,541 *AF53543B1EBB87269066B1AE44038245991C381F LJRB
1,666,295,542 *AF576A468BB97DC1880A4B073DD2D2A08C235399 mfxma
1,666,295,543 *AF519453A53AADFD8F3A35B860BB13C7C8CD842F [email protected]
1,666,295,544 *AF5CD8FEEB75E5F8BF4379E5337523D87D6A7B35 MICANOJ0
1,666,295,545 *AF5A60912E01306B01A12ED5155FB2A2D2FAD37A lockingup
1,666,295,546 *AF533A2E5C54D06787A9E12077B1149C0FDA46B6 LONGBEACHWEI160TALK1
1,666,295,547 *AF54A4822F298598C2669FBD2EAB31E7B8E333BD [email protected]
1,666,295,548 *AF595D4B12FC071C15EC598EE0464100F057CD0A loveanubhav
1,666,295,549 *AF59647955E519AC431E8F160E1600BDB605F626 MIRTREVO0
1,666,295,550 *AF5C53FA605A4CE0773A3386D811038D8E004BB4 mitchdudak
1,666,295,551 *AF58D860EDD155405F88984E3AED3360936EBA10 MITCHLAZAROFF
1,666,295,552 *AF59ABE185988C1201B79361258240D2FD6D5F9A LUIKAHTAVAN
1,666,295,553 *AF5B2FDB01F608E1DA9C890209B8282FE33DA9D3 luisgruiz
1,666,295,554 *AF5E915214F690018D6B6026534EE351892F95C5 MLOOMING
1,666,295,555 *AF5AC2C51D1F39FC294EFDFE179DB61A81404B32 [email protected]
1,666,295,556 *AF5F908FF0C9FD770A568E35D92AE71A79BE8DFF LUOXU[email protected]
1,666,295,557 *AF58B8C52983682DCC6B0DCD6AC320A6263D4AB3 LUUK58
1,666,295,558 *AF5BC246B21F268B2585A5697B327A4D0D3FA9B8 möbeluschler
1,666,295,559 *AF54D0BC92FA77C33371AC7296A47BCB3819D262 [email protected]
1,666,295,560 *AF58F8ABA06CCB7955281D8F7375309776C5753D LYLEBONE
1,666,295,561 *AF5B07A20DDB19901B4107519C47D15EA3AFF53E mold3$+
1,666,295,562 *AF591818AEB7F35110FE4CF6833E4A5FE6AAD0AF M4S7ERLY
1,666,295,563 *AF5F6B9220D0C7AABB8B4150EB23AFCAA85F92A3 MOSE.KEYWORTH
1,666,295,564 *AF54984E18812C2A66D455A4677AAB46E0EC24B7 MANASBAT
1,666,295,565 *AF53B3F74214CCAC8D79C28A4195E828FBFB7A0C MUNGGING
1,666,295,566 *AF5FCC21834EC784529112AD663138CE7134A498 MUZEICH7
1,666,295,567 *AF5D1C15FD61C83EF750E97D74DEA14529215B67 MARIONPICKING
1,666,295,568 *AF5418B3AFE39B4BB4C8391E78053BCD68EA4E60 MARIO-SAMEH
1,666,295,569 *AF5B6241D5D8311FBE503230BEE8D9E4B9430B3E MZWPBSW3
1,666,295,570 *AF54DDE710F5F7143A1F3D7E3D7D710A4D154431 NADUUYK5
1,666,295,571 *AF59512C1C4813595A5FD981D4810E6C65C85C3C massumeh2
1,666,295,572 *AF5E9A5144960E31264A8FBB86BC95E5DE8E58F0 NATHANAELNARAGON
1,666,295,573 *AF5AB4242F68509D927F0754A030387CE69D700B MATT.BASILIERE
1,666,295,574 *AF556AB21253C3450B8D4BD625F69D40C388D00C nathanialhorsely
1,666,295,575 *AF56750B3C92400E00F40CACD8B8AD4478BDAC0E MATURITN
1,666,295,576 *AF5C6D7593CA512C781B4D588E87E3A97FA99AF8 MAXWORDS1
1,666,295,577 *AF5224D867B5B1255156F1B1B36AE49758841064 nelsonhadder
1,666,295,578 *AF5CF6237DD0386A1E38FCB9BDDCF0A2777EBBA5 NFRRDLR7
1,666,295,579 *AF59159EEA4F2B6265685B85647ADA183F8F0068 mike.watterson
1,666,295,580 *AF5C1460E5DD0BD0E498C89DBAE7BC4E517F1602 NORDHESSENWEIT
1,666,295,581 *AF5B981A8AE75C692D94DB508C6322D8A56878A3 [email protected]
1,666,295,582 *AF5FF767A5039D2DE3C5415252078FB6552A555D mirkoschadewald
1,666,295,583 *AF54CB6ECB4C9063EEC7D79917A7519C55677666 [email protected]+in3ss
1,666,295,584 *AF5211C8AB50144110A599AED8D9FC083818FC9D o(?aa
1,666,295,585 *AF5B923EB40E3D66325FFA78C68B21C74FAE6390 [email protected]
1,666,295,586 *AF543E2CA9EFBDC95403F33EC06C9ABA77A76D58 MONTY.CHEATWOOD
1,666,295,587 *AF55A793C91AAB9664D2E2CF88918946C777F0D5 [email protected]
1,666,295,588 *AF5F0A88C77E89A6B49A2050CE36B72DE52637B2 MORTONHARRINGTON
1,666,295,589 *AF54D62D0E76AF0122D2A94D9BF4ECB53B3FC537 OLANREWAJU.ENIOLA
1,666,295,590 *AF5C0F479B6CEF0A2648DBEA297DA16C5717C678 OLIVEGO7
1,666,295,591 *AF522CB9117E27E140F1DBEB5AF48008C0853D76 OLIVIA-BYINGTON
1,666,295,592 *AF5F290FA96AE2F6D68C361036A301FF93C17B2E oma”
1,666,295,593 *AF55F6E89B1E7AEF10923729C5368D2A8F6424E7 msoma
1,666,295,594 *AF55D1920664A29DFC07C9FB0BF61B0248021752 MUSICAL-FREEDOM-(FEAT.-ADEVA)
1,666,295,595 *AF58CFC24C72FF4F1AAA4AB930D2B1EF551B0314 MWONGMAHASUB
1,666,295,596 *AF57604B131BE7C31D5BF8A3C33EB2F3A87BFFE3 MWPHDRSING
1,666,295,597 *AF5A8992021F1D5E41ABA53B8BD53ACC806DABB6 ORCHIS-COREOSMUS
1,666,295,598 *AF5F921FBC39586C9CCBBE8B36290C4B82156431 ordunez7
1,666,295,599 *AF5EB7B763294447458D320A62389B88538A3F5B [email protected]
1,666,295,600 *AF59AA55F93782879E66F5302DB0557FCDC82FDC oscarkimura
1,666,295,601 *AF50900404F06BC0DFE57725BC54E4AC113585C6 N8THSCFQF4JCLQSCZFJOBG
1,666,295,602 *AF5D1F644548BC58B5809821BB9280C016A19600 NATHANIEL.FECHTNER
1,666,295,603 *AF56D8394581520C0DE6FF3DED64F420A1966A4D NATUIRO0
1,666,295,604 *AF5010A2E6323122393A86150ED2E5FE2099DA90 pablobowlick
1,666,295,605 *AF5E95CF13824BE143B880831ACA47582A77985B [email protected]
1,666,295,606 *AF560B6E7D848D8F3C108BFD9CC7A054A35F040E N}DP
1,666,295,607 *AF55B1F6C733578C775B35065626D726261EAC13 palestinianjournalist-1-0
1,666,295,608 *AF5851262699CC40CA4D377E740538BEB4C582A9 NÈDJĒLJKO
1,666,295,609 *AF5078590A087964926E7667F63D1CF0FDBB8732 PALP1+AN+
1,666,295,610 *AF5180126F4516C2E3E9B1CC5FF35E8D0D448089 [email protected]
1,666,295,611 *AF5BE58F93D5361579C5CAA796B6C7C0E26E8B3C PARACLESE
1,666,295,612 *AF5E9330A03160C7DF23B8BDA28D36813936CFD4 [email protected]
1,666,295,613 *AF520F22ACB4F51A7AD73FE302CCDABA53FCF492 NENNAMSNEWUORTREV
1,666,295,614 *AF5EB77A9A6E4D7F3C6342826D26753D77683DAE [email protected]
1,666,295,615 *AF570C4A99538886F11CCC1E5C347BFC95923440 PARTICAS
1,666,295,616 *AF5FCAB29FDEAA120BE49CB2786589461DC89931 patonined
1,666,295,617 *AF57DCA61A76E4DF31EBEC4997F949403405EA92 PAUNOV1
1,666,295,618 *AF57704B4D2AF09F91F05CDC78ABE2FE0344886F [email protected]
1,666,295,619 *AF562A01CE4201D32538004AE40603A5EC5B6591 P==D*.*.*.SPLAT
1,666,295,620 *AF5BDDFC165151AD962C19EB5D5AD0378AD3DCC0 peoria.p/i/'/ou/r/i//@/
1,666,295,621 *AF5D762AEB86047D0305A69657583080BD72187A percysherren
1,666,295,622 *AF51EDECE6B04F70C38563C87EF9955018D8AB12 [email protected]
1,666,295,623 *AF5147CD2AD90F362290854CF150A9D294FEB571 perryfreeh
1,666,295,624 *AF51B7971CE7546E6E35D8AE60FB433884756F38 PETEMICKLEY
1,666,295,625 *AF53ADCB5CB4285FA39FEF078DE7647ADA8357A4 peteraiona
1,666,295,626 *AF5E9FDD25E20229A8FD6A09099E972E9411EFD1 PETERCUMBEE
1,666,295,627 *AF52F718BFA5DB937490D24237FECD50C9102627 NOFERETS
1,666,295,628 *AF5709931553359BAF7CC80C2C609A30EC9A3626 petpetmau
1,666,295,629 *AF5B07C05D603EDAC52FB4DC958FA31A5B02CDFA pi14$tr4d
1,666,295,630 *AF5889FCF0822132BEFE398C4A97576A687DA41B pica-ven
1,666,295,631 *AF5758A22553EDF30EDBF61A883CBFF3D92D5435 NOT4
1,666,295,632 *AF59388E5F059EF28B639049B12381262284D4EC playerteachers
1,666,295,633 *AF586284344DF8354B2DA9852324B9753B043F17 PORTERFIGUEIRA
1,666,295,634 *AF5BAD192AC136DAFE59ED0F195A401179CA18CD P######p~-~-~-)o(
1,666,295,635 *AF5CE194416A90539867F8B0A3AB47EA38E52471 OLAKRHAZ
1,666,295,636 *AF51D26EBD28B65BEEFB1564DB5685C12EC6A318 OLEKAAN6
1,666,295,637 *AF5961863D5D26CF3773FEFC01B886A081266E58 opadgaaende7
1,666,295,638 *AF526F8B302D4BB08FF5948FE0CA495E5651D2A7 PROVEUNDERSTAND
1,666,295,639 *AF53C045133BBFA77BFD8A075900D19192438EDD oro)選別所、農場
1,666,295,640 *AF5A17C6A9D4B42A1FEFF6AEA94934CCA026CE00 OTIS.BEDOR
1,666,295,641 *AF5E4ECBEDCFB75D168753E2117608E83D9F5CD6 OTROKMI
1,666,295,642 *AF511759FF9C82D61306F30B8C8871D459F7CC0F [email protected]
1,666,295,643 *AF5FF9ADB7B1EDD3735F6D9FB4C48A03EF51C18E PXX-1-0
1,666,295,644 *AF5554A4B460170046343DD7AA1CCCB40A8217BB ovoviviparousl
1,666,295,645 *AF57B226B8FBEDC5563F516568DCF0B72E317966 P===>~0(X)
1,666,295,646 *AF5CC08294CFC4956A5F5EDC630291F4EB0F17B6 [email protected]
1,666,295,647 *AF59E3D41EBB2EB3C2664BC267CD07BC9C4E7A1A [email protected]
1,666,295,648 *AF5C126F35F79C95C5EB82CF45160EF2B5760847 Pa1pab17y
1,666,295,649 *AF5113D35434E106AEE8F058D682D57D807CB40B q).~O.(>_0)
1,666,295,650 *AF5CB775E13046F61DF1E60BD505A15CD6434A67 Q----P* *{X}
1,666,295,651 *AF5FFC908EF61F192DB795520D7120B7F91CC221 QSE035
1,666,295,652 *AF5BED12BC07114649CDFA852C51DF25E1572171 quit-nights-(nicola-conte-"out-of-the-cool"-version)
1,666,295,653 *AF53BE4AC19371C386FEA0D2E18BC95BCDA7CBBB R3F3ST3L4RI4S
1,666,295,654 *AF54B2935A7359FB2D4EF344A1137577BBDDDA6A [email protected]@n93m3n+s
1,666,295,655 *AF5DD9280AF903BC3956CCBB612EE1D1397F01BE PASS-OUT.P/&/S_/AU/T
1,666,295,656 *AF5FA4B8F458B1DF1CFF1B22F9DF5F806853C295 PATLICAN8
1,666,295,657 *AF5A7ECC1BC036880B09B672998294DCC6FA88A0 RAISHAWNS
1,666,295,658 *AF5BAD6CF4DFA8A6F20BDAE1D91F95DC09A9EF79 ramirobatchelder
1,666,295,659 *AF529F789C79786054A74ADA3C81086E5ED58468 randallhilgendorf
1,666,295,660 *AF5BD5E0AD1B42C62AA0AAF2B05A699A47B42A44 RANDYTEAFORD
1,666,295,661 *AF5EA34F87E453FE39EFF500D9B14C6E168EF11C rashaddonnan
1,666,295,662 *AF58FF16FA8B6D74CA03FC557474536853E4A21E rd&nilslandgren
1,666,295,663 *AF5841F12A98599BC5B444C78C8656D2397B920D reedbarch
1,666,295,664 *AF53EA7BC35DBF37C38F8E5EE49142A57BAFD4BB „REGELUNGSWAHN“
1,666,295,665 *AF5F7928322A467EDFF08655A7477A2F3F10AEC4 REINALDO.ARRIAZA
1,666,295,666 *AF57F7BD3F6AA18395B3FC62F0561F6F3F02B9A0 REINALDO.MCAULY
1,666,295,667 *AF5A602EC7222998E445E70D40F6463220A455C9 REKKYTSD
1,666,295,668 *AF552300A898C0341E37495DECC6055A02683681 renaldobaulch
1,666,295,669 *AF500BE4A1F0E0FA42E4FA808BC45513081CCC37 RENEEDANIELLE2
1,666,295,670 *AF53043F30B382F75198920231DC1E32B891078E repeues
1,666,295,671 *AF5DE94841AEE4ED56AACB38DBF20621006E60F6 RETSULEDS
1,666,295,672 *AF591D1BFF7E06994A9C22B584E5D616E756CB44 RETTSSUB5
1,666,295,673 *AF55EAB7A67F685A7C62839782D10B5381AEC054 [email protected]
1,666,295,674 *AF50F92F19DAA5266799849B6E2806896EB7FF9F ricksturkey
1,666,295,675 *AF53D8F32151681B7F9051A777F15E3A6AE48D02 PEU205XS
1,666,295,676 *AF5281A8E9A2E2A1F49FAB73015E17C3117F1FF1 PHILIP.KIMMET
1,666,295,677 *AF5CF954807B2213E9E3AB2FA00B4115C163A84B PHL380T0M3$
1,666,295,678 *AF53DC7C0B57D96CDA7845DDDB027CF43B2A2F58 [email protected]
1,666,295,679 *AF52EBA42F41CF10126F9A71149B1D212C418D69 plenilunio5
1,666,295,680 *AF5592A3853E90372044701123A3F77A0A006917 RODRIGO.COLE
1,666,295,681 *AF5C15AEF553F46209DC383F27E01B2B230A41C2 ROLANDOSCHEETZ
1,666,295,682 *AF5F96BE9D477555A3B5BE4B7623E6BD01CF22BE POTBRAAI2
1,666,295,683 *AF5FB21259B2D0065097164A674033855E3F7BF3 Romero-García
1,666,295,684 *AF515CAD65E624F952C17A4A04E1BD656896A8FB pracoon5
1,666,295,685 *AF55A674C5BEF4C2A77FCC2090E531B4A1983234 ROSESDENISE9
1,666,295,686 *AF525558969964756190EC4232DE12B9846E525D ROSOLAVOROSOLAVO
1,666,295,687 *AF5A0B9BF9A2606F44C10D5D5E1DFE395AD9CE42 ROUGISSANTS
1,666,295,688 *AF5713A293BAECB59A856D2A3566A4B99160C56A ROYCEPORTER
1,666,295,689 *AF530C10C22CD9F2B5E093969E2FF87C19B98325 PROGRAMUNGGULAN
1,666,295,690 *AF52B548E16F0E6B71A58B014E399B7E44A872C7 RUDOLPH.MIRICH
1,666,295,691 *AF5E5ACCC5B4876E5AC1E53E6CBD6D9ABCCD62B8 p====>-~-~-splat
1,666,295,692 *AF5864FC1F26DAED425AE0437FC7306974CB4FB5 [email protected]$$W0RD
1,666,295,693 *AF554B4662B3766417EBB478B1BE38704E2572CD アーム・レスリング:ジョニー・r・ブラ(左)とマリオ・ウイリアムス(右)
1,666,295,694 *AF5BF089B80E81F2FF556354F077A6A95AFCF9F0 SA
1,666,295,695 *AF59BD9F39D33FF1FFB46A46A42ACBD44338F6A2 QK8L
1,666,295,696 *AF52FBA0D94A957F1E9307E352658B235F1AFE8C SANDY-HANDY
1,666,295,697 *AF5F13305F3A4EF134755CF3C2FC602BA63ADA77 Q---P-~O}8{
1,666,295,698 *AF55C9BC66B71BA090DF3C277CD24391F2D2A273 quatre ogives : ii. seconde ogive (
1,666,295,699 *AF5FD2268888F9634618EA91E4EEAAA62D2D476F [email protected]@b17y
1,666,295,700 *AF57545ADA3919E5979070EA9F2847BA5D7CD01A RÁADÁSU
1,666,295,701 *AF58258A9B3F610453E499FA529205588B2E94C6 schadene1
1,666,295,702 *AF5E60C8C343349B862001F8AB2347CD30067181 r/ai/tdownrightly.'d/au/n
1,666,295,703 *AF5784076F51204254411674747CCF8442BF0BAB RALL0(FEATHIRINIMELBOURNE&RICHARDNUNNS)
1,666,295,704 *AF55887891DAE2EC23A811D65C6972AB7CF70331 RANDOLPH.AMIE
1,666,295,705 *AF5C09DAFA02FFCF2753E460D98577742D6FB22D scott.batten
1,666,295,706 *AF59AB185C26BE1B101A74E3D5ECD55A767741F0 SEBASTIANWOERNLE
1,666,295,707 *AF57789919CEF8172C323A5A01E5E50D0B847C0F SELANGERBANDY
1,666,295,708 *AF5BA6B01E498BCE196AD3F7821AC2F36C3AE70D sermoniz9
1,666,295,709 *AF5912B73556D6A018B7255A0783EFF6E79B6EF0 S_H#
1,666,295,710 *AF562BC2015FEA6644B1240329C108A712F9843C REHPARGOHPROM3
1,666,295,711 *AF5A1632D72ABEF09FFF9E111D6A0E81B861E2A3 REHTOMTIMREK
1,666,295,712 *AF56CD42273267A41B45E265191802428A20DB7C REID.HIPPENSTIEL
1,666,295,713 *AF59B077DE02BB6A4E6FB847ADA55A30FA76C45E shaynebarthelemy
1,666,295,714 *AF5EC87B4EE8BB5671EBB896BDB5AB98A21AC9DA SHEMEEM HUSSAIN
1,666,295,715 *AF579CFEC9A8CB1DE511FB145C878545CD3A43A6 SHERIANDALANG
1,666,295,716 *AF5352E1AA8AE96F322640363497E285FD3D59B9 r~em
1,666,295,717 *AF55EE27BEFFDB2F326E1AF250E49F7BF8AAF602 renee.blackstar
1,666,295,718 *AF576B9DCC1D0C82B0C1C5B41948781CA3C32B36 SHOWGOD
1,666,295,719 *AF54B1439A304DCBEB5C12A244647DC0FFA7E641 SID3-DR3S
1,666,295,720 *AF50ADE6DB77163A484E8AA78E5E379054B3C43E simon-crockett
1,666,295,721 *AF5B077B407B80E52C70CF74949613E4090A7B2F REYNAREYNA5
1,666,295,722 *AF5EAB962D5D5EAF4BB40362A661FB36444AE06F SIURGE
1,666,295,723 *AF5CCD3564A14B10E1D9C235329F45DEAEE2B223 RHINDARYO
1,666,295,724 *AF53A11CD39F7768885D5ACF0F59C475C0F03956 RHONDAPOLLOCK
1,666,295,725 *AF5981755B1F66A7C84F6AC44EA0DFF807DA62B7 SLITSKIRTS
1,666,295,726 *AF5C3BE2A6CC922E5FBD8D1B390C90C32004597C s&mdvd(disc1)
1,666,295,727 *AF5D0323235D50DC29A855BD8AE632CD32326248 SNAPPLEMEOW6
1,666,295,728 *AF5E33EB3A454D89EBA7957ED8119EA1203621D1 SNOWDOGGIE
1,666,295,729 *AF5E41443FC892B450DB5D7AC009FE5741CE4F72 sóhar
1,666,295,730 *AF59F8D8D9C667CA535BB1DAE71AA6D2A73DBD39 SOL.HEYEN
1,666,295,731 *AF553097939B5691EBE7828BB6F6295E5726A045 robby-john-garcia
1,666,295,732 *AF564D2B4F91D60791F846C98B9C90CAC8A51517 sonnymurrell
1,666,295,733 *AF58FA58853AA56926B1CCE4593F6A0165C78C18 RockandRollYo
1,666,295,734 *AF56973B3A54FC1DECCEABD8111507058A96269A ROMAN.CASACELI
1,666,295,735 *AF5C5BF9BE6259EAF1696FF0C1F46B0129CBAC69 SPILLKONKURRANSER
1,666,295,736 *AF5FC706941392CBAD658535D6C982F092E37093 splat 0~ @p
1,666,295,737 *AF59BD9F1AF36C1311EDF78067B5E1F74484CAF5 roosevelthupy
1,666,295,738 *AF5BBE9A0F0C9AA60A61DD43AB8A3AD078E1EF8C Splat!!-*<===q
1,666,295,739 *AF5495ABAE97B36169D635DB85CFE8F32DE8936F SPLAT!!~ ~ @######Q
1,666,295,740 *AF5F63C7007416A150F3143802B994228FA4D2DF SPLOITO~O~.<###3
1,666,295,741 *AF56540E933296BEA1D309D74F8B7980EB1A739D SPOSOBOWING
1,666,295,742 *AF51FCB5E5F9F99B2DB03F8187EEDB6C00670A79 SPRINGS.K12.NY.USWWW
1,666,295,743 *AF57538C0AF77C4A7EE779AE78DFDFB3F74129FA roycecabarcas
1,666,295,744 *AF507902EF53AB5DDC2E1BD58EC37AC0D4FCA344 ROY.KUSTES
1,666,295,745 *AF515F8A022676801DC75999CF766D33247BD996 rqffmfw47
1,666,295,746 *AF5571A9B1D580397FCBC6003E5105ED21B9D9E1 RTNIENIH1
1,666,295,747 *AF53517D07FB3CE11EA151EE97E356EC8A7F8D0A staceyestronza
1,666,295,748 *AF5914F84E1115F5D796EBDDB7096905931D847B rudolfbruss
1,666,295,749 *AF5030145B40273F03D1C66BAA62DA9E6596D091 ruebenstalley
1,666,295,750 *AF51BF1A11D1A8102F526E3F9ADDE343A3E21F2B stanleyperriello
1,666,295,751 *AF573DB9415ACC1EBFF0708B1767C52611A536AC RUNNERRAIDERS
1,666,295,752 *AF58CB2C9134C7714865A3704F5E8CBBB04DC828 RUSSELL.MONEYPENNY
1,666,295,753 *AF581111D67F09C17312A96FC138227B649F5D32 STATUUDILE
1,666,295,754 *AF5C59C18A4232AE244D23CD544B5413544D4F4A S0LITUDE
1,666,295,755 *AF5453B75E795626192982A0120B817F656ED238 STETZER5
1,666,295,756 *AF507DEAE532DFC16A8D827C09D83F5583377235 SA
1,666,295,757 *AF567895FF9C566611831FB3F135B06FCC92BE27 samuraji9
1,666,295,758 *AF5BBB4A4CBD1D54D0FDB3B1B7EE0FB4E5BC061F schraalst.
1,666,295,759 *AF5C3ACEA165D13C971920AD50AB59F4FB966AF3 SCOTTIE.HOGSTON
1,666,295,760 *AF5DED976E7ACF2F2615A96B1A75FBE50A2CC6AD [email protected]
1,666,295,761 *AF5926F70BAA2970D3FC9E4ED1727D52C9D6058F TACKRALC
1,666,295,762 *AF594B579C96F1757D56A5404C18ACFFF96A94A2 TAIKKIM5
1,666,295,763 *AF576D666B9F0AD2ADE685E520A7AB164D0BBD80 TALKITSMEFEFFY
1,666,295,764 *AF5BF04C694C650EC4F263600C4E6686EC437DD7 SELSKAPSLOVENS
1,666,295,765 *AF59E7DA88AE3175B39E110BD3EFBF20F128CC6B [email protected]
1,666,295,766 *AF505E958168BE8CBD5F3B233744DCF92A977F98 tannergorman
1,666,295,767 *AF5CC5275820FA10A9DE08E7E7A72B4938DE09BA TANNERSTREATER
1,666,295,768 *AF542A86156C71EA75170ACF5C352730C52BF394 tawrêz
1,666,295,769 *AF50FA6918EFC8A06AA84EACB9EC5D790D9AC5C8 TELERONT9
1,666,295,770 *AF53C0EBEDCF945E3C1A92956BA5CA1465596E32 SHARINGANPENGUIN
1,666,295,771 *AF51388564337B6FBD0213BAC50C7D7F26A612AF ternately2
1,666,295,772 *AF5115938E6C948AEEAEACF3A14223E0506F9E30 th0rac0pl
1,666,295,773 *AF5BA15520F437173E28C6703A055CFF4E5A2879 SHON.MCKEY
1,666,295,774 *AF5FAB53DB40CE63436261CD7E55B028D62B377D THATSHARK01
1,666,295,775 *AF571455159E2B6FE4E67DC89513B3CEFE6DC23E SHOTGUNRETARD8
1,666,295,776 *AF53C941AC7C47C463250E7B3D271BEEB04886BD The.Call.Of.The.Canyon
1,666,295,777 *AF51440E007171FAC2EFE8AD6A6050A87BAA7C58 thedailyjournal
1,666,295,778 *AF5A3BF2D532C1C50565E307D96D9EB47ECA4916 THE-GNOMES
1,666,295,779 *AF55D895BD8BD6FAAECC9FA332E27E8A6CAC8FFC theronsalguero
1,666,295,780 *AF5CCE6B39D9265259F86D91A09254669414EBE7 THESEMITIC
1,666,295,781 *AF55360E43F4AD2370AECAD22409D1C9313E75E8 these procedures should require that not only does the
1,666,295,782 *AF542E15103317502526607E7E11AEF422589024 THEUELICH6
1,666,295,783 *AF52A3E30FFB696EAB13DF211D0661D43BAC762F THOMASREED24
1,666,295,784 *AF50F8CCBF4DF1BA691DD6B3F8752598E5183F61 TIDUAIGC
1,666,295,785 *AF5ADE6CC98E5A7B9DC8CB6A2586AEAD075C65B2 tiger.cat
1,666,295,786 *AF5F6B0679F8D3DA221A35BC63279D802FE68372 SNBTXCOM1
1,666,295,787 *AF5B716458D1048F0785013A913C3CF50E6D3665 SNOWTOPPEDS
1,666,295,788 *AF5F8F1EF377906849C78230AD8A15332B9800F1 SOACHTA6
1,666,295,789 *AF580C53F7E9A1FD30C59794200068235F698FFB sorry-i'm-a-lady
1,666,295,790 *AF5868777FDC13C2BF364BE2477259105790E74D SPECTACULISF
1,666,295,791 *AF5DCE7620C89AA063B0FAA88252A123837BCE3D splat!!.*.*.<====B
1,666,295,792 *AF58F34849E7D34AC9354970A0169D0CC0D928BA TOHARMHUMILIATEHURL2
1,666,295,793 *AF560999BBA92935D9A25095DFE8D287CC49C73C TOISINNETTU
1,666,295,794 *AF5EA0998A0FCA7A4E433862030980C460790505 TONTRÄGERBEREICHS
1,666,295,795 *AF5CB834CE9DD92247E5BA0C4FC7D48F04F6E8C1 staceysaenphimmacha
1,666,295,796 *AF5076EDC4786F3CADE2E32C932ED8CDEF6AA4A6 stackhousekim
1,666,295,797 *AF5071F23EFC4D22384D71FCB439D5FD9AF6B663 [email protected]
1,666,295,798 *AF59D0B936E733F6B194888789E5C31AD8CF8A9C TRAINIONS123
1,666,295,799 *AF57C0FB8ED87E754629DF7F9E1E91C81CF4D633 TRAJAN-STALEVSKI
1,666,295,800 *AF54D605CA1BFD181BEF12777686664B9F2B530E stephancompres
1,666,295,801 *AF516661A4F6853CD29673849085D4C7B5018DDF sterlingagresti
1,666,295,802 *AF58ECE346D0A5852269B3C0331551FBE8F22BE4 steuerjahr
1,666,295,803 *AF567ACCDAB32974A8BAB5E03C1FDDEB9E9288BE STOOKSELSES
1,666,295,804 *AF5493A1E0C01F7C92D818B07020F00BFBC5C233 subcontractors s ah0 b k aa1 n t r ae0 k t er0 z
1,666,295,805 *AF5E628C6890EF83157BAF0E4BA8850D840945CA SUBRAMANYAMY
1,666,295,806 *AF54F549EC13865EB13B45110853AA8FA9F079E7 TRENTONBULWINKLE
1,666,295,807 *AF5F7E18AD502A2C2A51F9D96F892935A2D00F41 TRE-SANS
1,666,295,808 *AF5432589850515B65516E11E1E08744D815DAD6 TREYHAACK
1,666,295,809 *AF54E1F0CA4B1EBCC5D508A4FA9AB70109273F66 TREYHOEL
1,666,295,810 *AF558F280F6C91593F56DB4BC3E52FC71B96A7F7 triradially
1,666,295,811 *AF5FF6C66CE8C425AE2E5C6F9BFBC61A667D0406 troy-lombardos
1,666,295,812 *AF563B58542E533E96C1702923F47086CDD3B875 superintendencies
1,666,295,813 *AF5DC5B5F0631370E737221CEF7D8877B2612FC4 SUSANFRODO3
1,666,295,814 *AF53DDD1102240BDA4F65061348FF4BEDC3E0F5B SX`=
1,666,295,815 *AF50D4A03E0B86CF85DBE05898BDB8E68B1F1FC2 SYEDWALA
1,666,295,816 *AF5CD923167411406584B6261D900A6FAE46B54C symphonyno7inaminor,op181:iallegroconspirito
1,666,295,817 *AF5731097EA663EE84F5B31070D710B4CB1EE3E5 uahengo2
1,666,295,818 *AF51C20BBE6C99ADF9149B0E8480166BBFA55A65 TALKDANIELUGRA
1,666,295,819 *AF5661FBD0DEFCCCFD57D03DB05023D67060560F TALKFRANCISPEAR
1,666,295,820 *AF581738E60472CFEF9F1721D2A73920989E0E5B ujjal.kumar.ujjal
1,666,295,821 *AF59A3EDB5E5E90E816685414C51B64D5686732C [email protected]
1,666,295,822 *AF5BBD7E041F872E1B97E4D5E983E5B057A54178 TAYLOR.WYERS
1,666,295,823 *AF5BF3FB40067746C44045C556B2D8D72DF67040 tcl-sfsuni-tuebingendewww
1,666,295,824 *AF54B4DA023BABA3390AC11FDF23AC1A619C0BD6 tdjid
1,666,295,825 *AF531EB8883E5F09009B61992D73D88BA2D7FBDC UNN
1,666,295,826 *AF594CA1B6821D808240101435C36B451DF8B104 UP.ON.THE.SUN
1,666,295,827 *AF5D95B7B91D7C1398402FDA9FD304FB02432F00 URBAN2010+
1,666,295,828 *AF508DA9110C5CDEAF3C18F8877CC1CA6AC4415A THALAMI
1,666,295,829 *AF5ADFFA5909DB730B884CFD1A92E45C00E95167 THANKSTITO
1,666,295,830 *AF564B898CC51E4D11C3E7F638AA2D7C5F9D225D /usr/share/doc/bash/readmecommandsgz
1,666,295,831 *AF56ACD8C77FEB98A6A792B791072974850E4876 UTOREPASBSW4
1,666,295,832 *AF5220CC1C7FD6131A3435265B50977523CA672A THEBESTOFBALLROOMMUSIC,PART5
1,666,295,833 *AF539DC8A099BA9A25E051F4720EB9094379E1F9 vaatima
1,666,295,834 *AF583C23E88BD98C870C090F7389CF96DA98B459 theofficersaredirectingtheplacementofeverymove-
1,666,295,835 *AF5A947510DA62F42637B673360C86AC76A2EEC3 the.sad.valentine
1,666,295,836 *AF5EF761F8FB707E260945308639BECD207F0EAB VAUGHN.WELLS
1,666,295,837 *AF53A2AEAB0BE240A1C1605093224DEDF059815F THREECORNERE1
1,666,295,838 *AF5943C76516C522F408777EDAF2F9A4EE7C0C31 velvetrooster
1,666,295,839 *AF52BE5D6FFD2590196845D8DD98A67F6BE55207 VERWITTERUNGSOBERFLÄCHEN
1,666,295,840 *AF5E336E741DE23612B7A844BD019A0855BC7A13 TNEIASSILLOM8
1,666,295,841 *AF5A90BAC9C45C713B9CC18B78672C9DEBD1B266 TNORENNOEGRUOBS
1,666,295,842 *AF5F729733F8B80EE917DEF4E9E5177C701F9E8D viidesc
1,666,295,843 *AF5FCD006CE69750827F6EE62D56F76634778CB8 TOKSINERNE
1,666,295,844 *AF5D08D92DB803DD96C78FDE97548EF41F19A94D TOLU-JINADU
1,666,295,845 *AF5195984915D984BEEEF22D11C090B828D7C25A VINCE.REITAN
1,666,295,846 *AF55402F0DC89AFFAE8F121AD93D280E679342FC VINCERUSINOVICH
1,666,295,847 *AF564669FEEC86F5BDC8A979C20EFCFEEC1414F8 torso_murder't/O/rs/oU/_'m/[@]/rd/@/r
1,666,295,848 *AF547932980A69135358D636188DAA4DDEE3E60A TOWAGE
1,666,295,849 *AF556CE406D893AE5B92FB42295CE64F99EC8C3C TRACY.MONTBRIAND
1,666,295,850 *AF568B03CA49E1F7F9AFC4FB5A52213094BD3852 VKOUMKY6
1,666,295,851 *AF5FDF81BA895FC3C92B6F85BC360DC649F87C16 VON KLEMPERER
1,666,295,852 *AF5F1921486D2CADC5E9CE5C2D2031679B0E4C9D TRIXIEOAMAR
1,666,295,853 *AF59046AF47CB49CB1F866A71A19238E9A43164F TUCKYNG6
1,666,295,854 *AF5D5BF1E3150842E3FED3D9CAB4B1DCC2B9FE87 WEEPINGELF
1,666,295,855 *AF5F5CA1CF07C110D147ECCE6017FE851005D403 tyler.federspill
1,666,295,856 *AF5C149913E8C35CE029C1F1B66DBED56EE53BDF TYLER-NEON-TREES-GLENN
1,666,295,857 *AF5D8A447BD585B27608B84AB56D5C39A3EA3AEE TYREEABBASSI
1,666,295,858 *AF550BE8D7F93B93859F0680F1D1A12318857BED @[email protected]+0R
1,666,295,859 *AF577793BE9171A54B8B8CC6146C83C016AE269D [email protected]
1,666,295,860 *AF5883262676B6C1128B35C7B2BD02E1320BDC79 ualsab 1
1,666,295,861 *AF511F2F633913BF2A7195C726500810DBE2AB0F [email protected]
1,666,295,862 *AF5AB9E425D32E9E367D60D4FA4B915A5B964ED9 [email protected]
1,666,295,863 *AF5890DD9D4ADFB0C89E3319351D49D55A200613 [email protected]
1,666,295,864 *AF5F01F5D65803D4B5BA6F649D25EA4546F6C892 UJUCABZI
1,666,295,865 *AF52B69DC2FBEF4BE11E01DFF5CDFC6FE05DE577 UN3ND1N9LY
1,666,295,866 *AF5DE12EE7DFF93EA094FA6C8B5F008A7DABBE2D WIDODO BENDHOL JOYO
1,666,295,867 *AF5DEA84D716E5571F542BEE3F7C49E70ADF11AD [UNIDENTIFIED IMPROVISATION]
1,666,295,868 *AF5FB3C2B472B3393354A02EF71FC6058CB61C0E wildcatbfi
1,666,295,869 *AF58B8B7765495470FDB4B9BAADA2C4FD147905E update.by.demoniz.at.jan.1.,.17:50.cet
1,666,295,870 *AF57CD8EF90B0D10A115CD78E0EFFAD7FC678D93 uppfinningsrikares
1,666,295,871 *AF5693297882E4B64DABA71291210072BD9F6C8B WINFRED.MINACCI
1,666,295,872 *AF5638AE23D4006087CFBBAEB9CFB6C978F3FABE WINNELSTRAE8
1,666,295,873 *AF5A65B9D0812B8D320177C60334529618700D6B WINW NABI
1,666,295,874 *AF5F7B62B1FC3948E51F63895FE3611C3A53C226 wisdomcool
1,666,295,875 *AF5D01EE19B9D7F9D49FB8A978E1864B320996F9 WLISSNER
1,666,295,876 *AF5BE6AEC7D6B9ECA666EF5F3A36FA1DA30B02C7 ダウンロード、vaioソフトウェアコレクション)
1,666,295,877 *AF50BF20F505972959BE557EBBC49BA2ED426538 シェーナとアリア WWV
1,666,295,878 *AF58013509AE30E8BE4513C7DF12097D9E3E9E2A VARIOMETERS1
1,666,295,879 *AF56BDE52BAC06E6079094DF6DCB3DB25803D1D9 wwwworldoftentscouk
1,666,295,880 *AF58AE9E9547FE4BBB93AA2E1604B490A4701D98 [email protected]
1,666,295,881 *AF59D73258C8A27A4CF2692D89DAEA29614A80BA w!+z
1,666,295,882 *AF5373D944D96F05D4433F83B181816B39A957A2 )X(.~`<8
1,666,295,883 *AF5239080635AA7C370E9296E7DAE0829CF035A6 verynot
1,666,295,884 *AF5371E0007DC7037ED1DA2B69CDD16C7273B1BF xdszylt0
1,666,295,885 *AF5AAB6D7085310CC2D61DC417413BB427F74082 }x{.o~0~.d8
1,666,295,886 *AF5B7E041BFF61FDC517E3A2371EE9F4916B3891 [email protected]
1,666,295,887 *AF5DB9DB738CD4E15AA71919BD90153BB05A473B ViolinConcertoNo1inGminor:IAllegromoderato
1,666,295,888 *AF52F040C3239FBEF2D04614548B2AEE5A96F65A YAMAHAWINSTON1
1,666,295,889 *AF578BC5D187DF1B379B5997F87BC169553CA75D VITOR BRANDAO
1,666,295,890 *AF5E6E7F14379992A0EBA40664A4EF7B85574EBB [email protected]
1,666,295,891 *AF5ADF0C4A6C18B58546E01D01C2EFD5F87E863F VONESI-MASANGANISE
1,666,295,892 *AF555E95B06784C62D51C07BE110FDF32BFC1514 YNHI-PHAN
1,666,295,893 *AF559652BD87E76502A2DF8B3E5439298D132744 WADE.MATHEW.MOLINAS
1,666,295,894 *AF5727F4CAA227927E3057F2469ECFCAD696249E WAGENSCHL
1,666,295,895 *AF5977B3CF831EBA7A358C1D68EBC47C53D3121B YOU'RE.OUR.GOD
1,666,295,896 *AF55AAC1DA3866020857C9EECF09AD1B79842B3F ysuz
1,666,295,897 *AF5F2ACA0368811DA056171010EC23B4B24FD9D0 YUSICAW
1,666,295,898 *AF56D6C3D9DD9357F4EEC67165191152A9E0808E ZA-A-AKAM
1,666,295,899 *AF5C70FD7EF871DD33D0ED6F70F97E72F19E357D ZAINORAHAYARI
1,666,295,900 *AF51B28B4075D791195E97E376D43F072BABB8BD WANDAMAYHEWFORD
1,666,295,901 *AF5CDC5B0D7654F84B9BA6B63BACAC85B6BB42BD ZARI-SWEET
1,666,295,902 *AF5A8BA2D242BE5543CF0AE2814D98BA304D1261 [email protected]
1,666,295,903 *AF53A682705A25496C2AF381A85CE747D9ED906D WARREN.BIGGS
1,666,295,904 *AF59DA30903387C8483EF7AF2D4F451344F5A38F warrenhedtke
1,666,295,905 *AF5C21E850080D31E40D7032B648FDFD46AEDCC0 ZENITHABCDEF2
1,666,295,906 *AF576FBB4E6CBE9853C074C86C91B6AEE40F2CC3 WATSONCHURCH
1,666,295,907 *AF5F345CA1D41F9C297EB30DA27E5EDAE3EC4B61 [email protected]
1,666,295,908 *AF5F776B413DA8135B39EE22995F3FE2639BC6F4 [email protected]
1,666,295,909 *AF5644F79F26867D2AA03DA11B5DD1A838375D0E [email protected]
1,666,295,910 *AF5F2CD29E753B212051F586CBB945EC7338636F WD-CORP
1,666,295,911 *AF544294924953566C288F2C7EE799DB5B4BDE2B [email protected]
1,666,295,912 *AF55668A3D736DE7EDB7DF788BC45D4C24E5E043 [email protected]
1,666,295,913 *AF576C86F16EB928C6711FB46751A2B2B7697F5B [email protected]
1,666,295,914 *AF5988D9D9130D015D987CD13AABF05E27B2F926 [email protected]_PUBLICSDCNINFONET
1,666,295,915 *AF522E54A052E14694FD100715063A1C525CB611 [email protected]
1,666,295,916 *AF5BA7B9DCAF230A35026814A2E369E5D36D74E9 [email protected]
1,666,295,917 *AF59B4DE0C504B4643F1C9431557F7311027EA3F WESTERNGRIFF
1,666,295,918 *AF50A42CDCBED404CED2CFC8F2685D50CF74B3B6 ВЕРЕДИНЬЯ
1,666,295,919 *AF52136E544CDF24099C254BEECB63A5BD76F98E WILLISVICTORERO
1,666,295,920 *AF5690A65D02289D702CDB9DD359197EA3CAF4CF WILTON.MAGDA
1,666,295,921 *AF500F15AC44C00410D5CAC4BC11A8B7E156C492 windows.movie.maker
1,666,295,922 *AF58FC1235482E9A801375E86D2916FE437D0D1D „ПЕКЕЛЬНІ
1,666,295,923 *AF51A1B10BFD97FC9A190B6D285B85DEBA2DC7C3 WISMOTORSPORTSNETWWW
1,666,295,924 *AF51DAF56A9D19E3A3D6A45F9E13CF92A486E545 «ПОДЗЕМНЫЕ
1,666,295,925 *AF561B78D48B7C592B20C56CCCC6E04098A461E3 WMWREN
1,666,295,926 *AF52C28FA551323CC30CAF9E3419708F6ABE1BB9 WOYZBUNING
1,666,295,927 *AF5FC9F7886DDA9D09CF9D9DC5E9A7F7ACC84CBE WWW.COOKTHINK.COM
1,666,295,928 *AF562463034E1784E63C98C6F94E0154118D3BB8 wwwsoulacrobatscom
1,666,295,929 *AF503C9AF8AA3A1E704B011E61ABD938C82F1374 }x{.*@=====3
1,666,295,930 *AF54958F99AAE2E7A85D4A5F55C60BCE22E6C496 [email protected]
1,666,295,931 *AF55809C544EB0C65FCE822FCE652AF4BEAE87A5 [email protected]
1,666,295,932 *AF5834F6994ABA3EA918FA9C39D9EFB02178CD65 XINZHOUY
1,666,295,933 *AF5BB3CD261F361078F32241760C3C27BE0AB0FE (テレビ東京・bsジャパン)経済情報
1,666,295,934 *AF51E5F6A5FC66B74981D85C92665FA8DEF88A1D YADIRFARAMAT
1,666,295,935 *AF59B1BC2AD5A3933153DFDEA86B68340A3FA327 [email protected]
1,666,295,936 *AF51875097CCCA321456A671955D586EFE115CCF YIUHEIWAN
1,666,295,937 *AF58B115783A2554CAA67B44B778169FD49DF42E 計画が確立している製品についてはそれを基にHACCP
1,666,295,938 *AF50BB093130365FCDBD9E2B9A53836E36EE51A2 yun-young-hwang
1,666,295,939 *AF5EF15338F192104D22E8064C9ABCA5A89091CC [email protected]
1,666,295,940 *AF5828369B9CD071A1164EB2DE4C9C18E789A41B z1mb4bw3
1,666,295,941 *AF51377BE1DCB7E1DB9177EBB04102C6B876C94D ZAMAFIKILE
1,666,295,942 *AF5C0C346E3D73F7C197D2C1484E260C58AD2035 (0_<) ~ ~ ~ D8
1,666,295,943 *AF5DEE37FE676615E03926B014099596A585D214 zeroize7
1,666,295,944 *AF5396530589E28FBC80FEB3C0A403FB8EF43E36 [email protected]
1,666,295,945 *AF5339F9D675B0EB9B57C90848271FA487E62C55 1233281 vuosien.1998-2000.mallivastauskirjojen.arvonlis
1,666,295,946 *AF560A6EAD684CE132B69BD559D955D378D399D5 [email protected]
1,666,295,947 *AF5CD67C417599E8EA78715D85A434915F755991 ZIAD.SAADE
1,666,295,948 *AF5CB083CED83CD177E148B3A979C4D9A23F5801 zieraalisa
1,666,295,949 *AF50CB1910B9C201C63F547E357C99A3461D683C ZORAIDAMENDEZ
1,666,295,950 *AF5AD2FDAE92F83B0EBEC68CA5CD85AF4908AD38 153TRISTIAN
1,666,295,951 *AF521AEDE2187B048F1D5CAFD27EF8F078E7282B zuidafrikanen
1,666,295,952 *AF5CAC43EB3FB9C35E9AC4E93047A97D58F9AB51 1beziehungszeug
1,666,295,953 *AF5B0592E3DB1CE44C1625C2726F3BD086E0F38E ДЕЗИТИАТСЕМПЕ
1,666,295,954 *AF5E1F05B4640A2A73F102DD0D059E0FF019B1A0 1-CLOWNFISH
1,666,295,955 *AF502C153ADC7A7A3A983D6C27579434CE60CF6C 1DOGGUARD
1,666,295,956 *AF5F4D217FB4C0FA6C49B6003E78175FD363F2AB 1entega-point
1,666,295,957 *AF53F33AF05C024A144A76FACF5893708123D3FF 1-estetiklerinin
1,666,295,958 *AF589275CD68C90935763FD391BD8DE57EFD3C72 1FREISSHE
1,666,295,959 *AF52F8B5E48BE245D7AAEAD084ED35E985F9C779 1-gait-analysis
1,666,295,960 *AF52EE97699D79F399D5942F3DB85FEF1E8256DA 1 HUYNEN
1,666,295,961 *AF557D9B0EA1D35489F512284BA92807264175B9 1 KAASUKOMBILAUHDEVOIMALAITOKSEN
1,666,295,962 *AF503E7393C19EFA82759D6358803CB05EBD5A1B 1-KUEHLWASSERZUFUHR
1,666,295,963 *AF58027F06E7AA6CFEA025E7F573061711115C73 1-kultur-kompanie
1,666,295,964 *AF5C99FE451B476105A370656F19FC77B806C395 1-KUNSTGEWERBES
1,666,295,965 *AF5091A4EEA0B50F14CA79DF9A0A58988C55ABFB 1-LAATUSERTIFIKAATIT
1,666,295,966 *AF542F762DAC505F31C90FD54714011C08733567 1-MESTARUUSKILPAILUS
1,666,295,967 *AF598B132A96609FF7E049EBAC7F7B58E2B76450 1MYBUTTERFLY6
1,666,295,968 *AF5471CCEDC4864A54DCD232088FD2D4195289C1 1PAPPADAM
1,666,295,969 *AF5B7A691BFE5E8740923DE7AFEA0FB97174D943 1PIENOSAVAUNUSSA
1,666,295,970 *AF587A3BA52366CCF899FE6A33C3AF8B45A85734 1.pohjapiirrokset-sivu
1,666,295,971 *AF5E46AD874A91DB37425D0DA00281BD1E16699C 1.PoKLuDa
1,666,295,972 *AF5E7446C11A70688DA8614EC6293B2809B8233B 1RADRENN-MEISTERSCHAFT
1,666,295,973 *AF58DF74F896668B6BB175593EF63FA90DA4A93F «ЛОЗНИЦА»
1,666,295,974 *AF5DFB409256512A54DB328891F9B2AFE083620A 1-savottalaisten
1,666,295,975 *AF523C25F9642B4513ADC46436A6CFCC417BD0D0 1.SUONENSIS
1,666,295,976 *AF544331B5B49B0E11995EF391586AE945F1307E 2220204 hausdeswaldes,14uhr:frauentagsbasteln
1,666,295,977 *AF5B2031855C8AEE765329F424AAD086B6843E23 2383566 thatgameaverageda399nationalrating
1,666,295,978 *AF59C74C435E2E1B68E7B0F8905ACAAF58C8BA50 2597041 ITISALSOONEOFTHEMOSTHATED.
1,666,295,979 *AF5231191F2A59A9DEC6D7B889399A57A95245E4 2670686 DASTRAGENVONWAFFENISTSTRIKTVERBOTEN
1,666,295,980 *AF5DCBEFA1E511FB9A22F8629800C268BED07F93 2681618 oy edita ab 1998
1,666,295,981 *AF5F49982EC0908B134AD55F8F4D8E5EB54E40CA 2702797 VARMAAN MONET MEIST
1,666,295,982 *AF569430E42BA6479F41DBCB10B646A82ADFACA4 276578 DER.BIS.DAHIN.AUF.LINKSAUSSEN.VERSCHOLLENE.TORJAEGER.HERN
1,666,295,983 *AF5CE0C70C14F6A2D849D1BB9FC8265F8E9492C9 』など初期の作品では2pキャラとしてマリオとともに主人公の位置にいたが、『
1,666,295,984 *AF5B0C164E3B15A1B2882DC9B6EE6DE15FAA56F7 2945125 RAPPUSISSA.KULKEMINEN.EI.OLE.TERVEELLIST
1,666,295,985 *AF571D118A7AA28A9D9DA46CF96C2A5919EE1A8D 2981712 LUCKY.STRIKE..
1,666,295,986 *AF57F647D9453EB67DBD3EFD3F854C66E34C9608 2-beitrittsaussicht
1,666,295,987 *AF50FC2D3567E6F2EB800EF89BF3353DA7CFC1AE 2-GREY-EYED
1,666,295,988 *AF52FF49628E0A824802EBD1A95589F56BF66851 2-infekten
1,666,295,989 *AF5FEA6840F26D11320626AF1584D1B8D80BFB31 2LINEARA
1,666,295,990 *AF512D3A7D5D424221010DB37E98D550589ECFD5 というグラフィカルなインストーラーと好対照を成すツールであるが、gnome
1,666,295,991 *AF57DBB6BFE8A4A32FF4614C22A234338E12F0F0 2STOCENE
1,666,295,992 *AF505FC7C92A60039CF3C06B7EF4A46444C49E92 301671 kaksiosoisen-kortin-sis
1,666,295,993 *AF547577ED208597CD5A2246A09CC8B50F702BDA 3ASSORTISSEZ
1,666,295,994 *AF5A19440EC7446D38FC52A84DECDAB22006FC4B 3====>~O~O.SPLAT
1,666,295,995 *AF57CB384FDC91F25AFCE7C899484E7024037DDD 4ELLIOTCO
1,666,295,996 *AF5B65A23B0690DBAFDC620ACEF970981D53C3C8 4FILENTO
1,666,295,997 *AF56D8573C9EE528C6F378DCEAF52B20DDBB172D 4HERVORSTECHENDES
1,666,295,998 *AF5E858C563F535D36B2D615F89632C68AD7D726 4IKIVILL
1,666,295,999 *AF57F25A53C4F0DA2E5874D78090FDD7F0F5B7E5 4iluvmariposa8
1,666,296,000 *AF5F2775E0CD592E9BAB05D7355A3227F6FCDF96 4 koruyabilmis
1,666,296,001 *AF5C532ED3D65534049E531E4B41899EEAA9CD32 4MAXIMEDOUGIE
1,666,296,002 *AF5B33CD001196B01ACBADF3B20F95AD1B187F05 4MUSICMANN
1,666,296,003 *AF56F0E108C1D7A85298A2C1E92C643EE038DFB0 4-SS-EINHEIT
1,666,296,004 *AF579BB50A4F54220DE8AFCDF619D5C405F8A4F0 526818 DAS.RIVA.WAR.FRUEHER.EIN.HIT..
1,666,296,005 *AF5B0ECA6E2E341854B7D84D26788E00273BD4C3 55JANET
1,666,296,006 *AF56D8CE30372707667093257BB4BC7899D2EDCC 5BOBREALITY
1,666,296,007 *AF5B183DDD5541F229E61BDDE0A8565DFF9AC346 5.BUZZES
1,666,296,008 *AF5B8129CBDC68C15DF9CAD41AE29FEB9ED09D0A 5CIREMOLET
1,666,296,009 *AF513FF09A789F0B82BE8929A96AE81FD9BD6DD7 5cmf2
1,666,296,010 *AF5113C434592404063ADAB24ADD62EC0B7E3C73 5P4N3MI4
1,666,296,011 *AF582B1CD94B4BE59873B9E71BB0695D4F7C1246 123SHINKANSEN
1,666,296,012 *AF574457CE2A97C92CB2734659ADF831ADCA8BBC 12DIGITAL1
1,666,296,013 *AF531DE000E522E2FCD38FD125CAECA2C69B6D96 12STANDARTINI
1,666,296,014 *AF5836D790462C38A2F0BBF613F6A35A40C0F6ED 12th-man-again!
1,666,296,015 *AF55EFDA1B53E55E3F393EE69B78913353BE82B6 5VISOCKAS
1,666,296,016 *AF5FE2C1CFFEC0BE87959226AA1CDE9C354790A6 602116 but.it.is.necessary.for.now.,.the.firm.said..
1,666,296,017 *AF5D17E2489FF196439C1F990E87B477682BA9E9 1525148 bayern muenchen , das ist nur ein blick rueckwaerts
1,666,296,018 *AF5E48B02906B4E402B8143ED3F4D7B0CC81274F 691SARA
1,666,296,019 *AF5529FABED99A2B9B84EB7604CF515F88A5693C 177758 onur-deniz-bilimsel-aras-
1,666,296,020 *AF5D355F8E756C2A82980A8A299FAE7030BC6DB5 177758 onur.denIz.bilimsel.araS..
1,666,296,021 *AF586383AFC369B8656A3ED40649D0CC2B7FBF85 6BSWHEBDATEBSW
1,666,296,022 *AF5211989EA117EE130247D426F48E517ABD569C 1880497 RITVA PARTANEN SKSAVO 2.15.01 +50.44 53 .
1,666,296,023 *AF50B25AB0D0FC99BD1583FE622552456A3FCC6A 1893962 kehitt
1,666,296,024 *AF5976E70E111833345460BFFD059372EF2D36DF 6FORTSTTELSESKURSUSSERS
1,666,296,025 *AF58E8768812D15E5FEF98FA8EFAC30D07B4B1AC 6HORSEGALAXY
1,666,296,026 *AF599CC2B3DFC24C886765C69F10742F5E950162 1.bahnkursbuch
1,666,296,027 *AF54DCD2EA0D6E400C3BBEFB85638B7ACD344FD0 6KABINETTSMITG
1,666,296,028 *AF50B39FED5758C92E1E9A2B20050F260B24F9AF 6MBANDJOK
1,666,296,029 *AF56F15B0868DFEB68C780048484A968AD5B8D03 1cordate
1,666,296,030 *AF51F271A011DE41C56AC6E57E425A270FA985E4 1.EDALETA
1,666,296,031 *AF503789F8AABCAB5E31A8B3D118A57A1191585C 1-EKOHENKISEN
1,666,296,032 *AF53EED6839DAD82F7267C25285AE1FDE91617C7 1.ENNAKKOOLETTAMUKSEN
1,666,296,033 *AF563B5E4C3BB8317868BC350196206FDFD4DACC 6PATTRICK
1,666,296,034 *AF5715F0CCEF6841E54482E5EED9D7E4FB27A4C9 6PERDURAB
1,666,296,035 *AF5B670DC4585FA7227C6A253F42199D6E9CF960 1GEKAAIDRAAIDEN
1,666,296,036 *AF503F1C6F580ACFFED5E6DB9B56167C9514FF28 1-harjaantumiseksi
1,666,296,037 *AF5525F3930A8B688D0BC8463D94424809A65E8C 1HINET
1,666,296,038 *AF58DE4513AB8E9964E139A20150147F79203A27 1kallisarvoisuus
1,666,296,039 *AF570F8C06B6334606A9989D52E888BCE4FF1616 1koyluyum
1,666,296,040 *AF5FC8E240AD2767AFD1EE900270D75C90BAA1D4 7DECODEX
1,666,296,041 *AF572E536C09BE5CF8D22A602BAC96C37104A2F4 7ELSSIERG
1,666,296,042 *AF55A6536BC8B1B4146C9AC208C26A7096CC48B5 7FACHMANNISCHEM
1,666,296,043 *AF593B672D16B87BA4DA2E426655A3F7A06E6B24 1.porak
1,666,296,044 *AF53D738579A3E800D501D3AC982B91BF2A62D78 1 PYSSYNPAUKKEEN
1,666,296,045 *AF563DAE118F564F91841FF3ADE6D01120961979 1-SAIRAALAFUUSION
1,666,296,046 *AF5AC627B98064F0AA90C63B8F0F3945E19902E0 1.SATELLITEN-TELEPHONE
1,666,296,047 *AF54B81C2ADF35FB06B31F7FFC864FAD8A4AF5E1 1-sienknecht
1,666,296,048 *AF55B325698E608D31C57A75018FEF258B0AA657 1SIROETEM
1,666,296,049 *AF5C99C24E62ADFE0F025294D8DFB0042992810D 7MOONTORONTO
1,666,296,050 *AF556A262FBA4CFD650A4A6793D3DFA854A23D9D 7myduck9
1,666,296,051 *AF5851D70C705E4CA4B64C8DD280F4826BC1B6D7 7RU57A8L7Y
1,666,296,052 *AF527E61CD80DD99CC4BA2E5EB2B8721B84E310B 1wholeheartily
1,666,296,053 *AF558553BBCC106A466525B423DD748634FC222D 1 YKSIL
1,666,296,054 *AF586F2CC1C8594BA8C0623A52D040C94CB5C9D4 1АСТР4
1,666,296,055 *AF526352812ACC731652FA314D16D8C1FE52759C 20039 suhdettaeiv
1,666,296,056 *AF52687BDE25D7576482387BE5E4F62F11F1622B 2006-06-16:-HUMMINGBIRD-CENTRE,-TORONTO,-ONTARIO,-CANADA
1,666,296,057 *AF5EF7E00E6D7019D516B4527513A512D88FE42E 85-uygulamasi
1,666,296,058 *AF547ED5321491BEE536BA07D5879E2B578B3BAF 20CLOUT
1,666,296,059 *AF5E7AB9D934995535A36F7709D8C93F65A8EE63 8DRUMSBRASIL
1,666,296,060 *AF5C0BCA019262D3652B37DA798039415CA255DE 8HAARLOKKE
1,666,296,061 *AF52FC7561AFA66DFF62D593AD7C7E491134B96B 2393320 LASTEN EL
1,666,296,062 *AF53616A929B17B9489DE8A0BD6392FBDCAD2424 8====> ~o~o splat!
1,666,296,063 *AF559ED4E2F3A1B56064A7ADA5061D3979D5107E 8SEGELSCHULSCH
1,666,296,064 *AF55F24EF9DA8AF155D039E7BA2A88D0676A9EF3 8SORTATIONS
1,666,296,065 *AF5C0E3E52632B7CED2DD2D44AA7630D3236F688 8)~~~splat!
1,666,296,066 *AF565B9785B7307A2E876EF18B15DEFE78D1D8DA 2962113 ' I DON'T WANT TO EVER HURT SOMEONE DELIBERATELY
1,666,296,067 *AF58839B6E31F6CEF5C81B53F8FB878EB9AC1B0F 965MARIBEL
1,666,296,068 *AF55141CD945934373C97465B500791D1938448C 970657 smith-mcmillan-bicimi-.
1,666,296,069 *AF5BDE58217FE8F4B1B27C29DCAB08A27F52A7FF 2AFKRUIMELDEN
1,666,296,070 *AF588EF9368F9613C8E05A1C70DDFB407829E19A 2ALGEBRAU
1,666,296,071 *AF55E95532452A5E107EB3193ACEA8A7A7C8D62A 2BDUNKNOWN
1,666,296,072 *AF540721BDB797138099ECE2DED32BB916C8F121 2-flussausbauten
1,666,296,073 *AF5307AB1B415BD5307150E4C14578467E6396C2 9GARBEGARBE
1,666,296,074 *AF5D55250002D55667DC0AD8B90E4186CCCC5F62 2-MANRIQUE
1,666,296,075 *AF5D2E2BCE14C34C4237084CF50F37BFE10C8E06 2 REHUENTSYYMIEN
1,666,296,076 *AF52AAC1A58DFFA5D76CFA100460B9BBC724D038 9NAUTICADOGGY
1,666,296,077 *AF5CCAF4BF90A573C046514EEFDA9E0E1AB27331 2TANSKANRADION
1,666,296,078 *AF59BAFA28612BCCE95B4AA8A659F23E5FE0DB3A 9PHONAMIC
1,666,296,079 *AF53F64FA0A391EB4F421FC0865DB2E3647BFC32 2THER0GER6
1,666,296,080 *AF5481901C671A834D22C9D36988DE6D2AF29774 9RAHIMULLAH
1,666,296,081 *AF53032090BAFF8426CF7F9661615BABAC24F8C8 [email protected]~0~OSPLAT!
1,666,296,082 *AF55CC4B3CF828E71DDB757BF77B9E3DCAEB697E 393858 KUNLAPSIVIETT
1,666,296,083 *AF58A1D166DC08AB83BADBE03660F51D9A0E259B 3#b* * * (0-0)
1,666,296,084 *AF546D167C9246D74CCAC8EBF2282C70A8D424D7 9WAYNECONRAD
1,666,296,085 *AF51E955C846ABBC90840C7AE9CC99BEE17738BB 9WYSIADAJA
1,666,296,086 *AF510453F2E1110808A94CC86712AFB4C540BBBA 9YLLACITPANYSONOM
1,666,296,087 *AF556A09E5D4046D623EE6A976F15C90B85CF58A a16p4
1,666,296,088 *AF5633504DFFBD27ABA0E256451A7F5E4A0ABA42 A39/
1,666,296,089 *AF5F98BF0EFB65A74DCEDBFB731C7632987F0887 3-IMBRUGLIA
1,666,296,090 *AF5699C45BFD8F063105D4AB1E05E5DBC8DA0ED4 3KOCKO
1,666,296,091 *AF5D97D69B68A2353F07484E4B11099E857942F1 a4esn
1,666,296,092 *AF5385555F4E69099B56194B009B18653D16568E 4 ASETTUMISESSA
1,666,296,093 *AF538DD679C058E23678CE07EFDE330307DB47E1 aaeh?r
1,666,296,094 *AF583970AEE5F135B40BF558DF07C3B9860180F3 a;ata
1,666,296,095 *AF5914D6738187305DF996C72853F062FBFB8D77 abcdgoofying
1,666,296,096 *AF53918C75395160C3FEC6E504A01B308AD05FBE ABMZM
1,666,296,097 *AF5BC109E882121056C504D1CCD51FDD1F7C5CC9 ABONUREE
1,666,296,098 *AF5AAD199A8424AE6ED2399855A468038D9405E3 ABS?D
1,666,296,099 *AF5591FB0B6E6E1C38CD2930D1E4F8F8FB3B1D2E ABZARBOERP
1,666,296,100 *AF5EC19C18A2C048899BDAB28984FC4D716CAC83 4UPCEASECEASE
1,666,296,101 *AF5262C187EB28A0EFBD45302DBA3CD660A9ED70 ACD;C
1,666,296,102 *AF51E2D39DBBEB4B8667FAFAD9B389947DD58498 acr9:
1,666,296,103 *AF5F739719BA66D9223A0092094248F579FD5B7F 57I12P
1,666,296,104 *AF5547C96DED7BA6A72829E4150A0A4DF9ED1A30 ADAMNOTTY
1,666,296,105 *AF563E7A249DE3E5F95821BDF0C1DD5714D2A698 AD)IW
1,666,296,106 *AF52D90B1D8008D8A3CB0E0F324F0EFEB63D3525 5ANTIKVITETSHANDLERINGS
1,666,296,107 *AF5076F73A26E4FA190C565134DC04ABF0E0ED46 ADVNHEINOS123
1,666,296,108 *AF54FB24FC88859E45AA18BFFB0CEE3BDCDD1F9C a:fbs
1,666,296,109 *AF5467FC3D035F9605256E246EC6C3F2A81F5774 5ETSINEENSAE
1,666,296,110 *AF5521CA068FF7552B5CECBE5AE6FB45E6441355 A/g
1,666,296,111 *AF5CB7E0AA5B75896B89313AD02CF34B39A9CC1D AGONIJA6
1,666,296,112 *AF572834ADD57AFF175FCF7D4E35F162B3CAE856 Ah_l
1,666,296,113 *AF5FF1915036C007539710EB51FDC23D5986581B AHMIMISENS
1,666,296,114 *AF501F44FD7BDD0ACC3F53BE25F4BD2E2D32956E 5PSQLLNT
1,666,296,115 *AF5D493680B87B196BADF104630CEF5724121EEC AIZAWABORN
1,666,296,116 *AF57CDD6600DD37EC3889B5D529569CFF4908E56 AJPS1
1,666,296,117 *AF5C750B6EA4A3E46CFE030F10609E795C618184 631266 turvallisuusohjeiden-lis
1,666,296,118 *AF5FB130CE67E3CC2BAA6620BC776D108688CB0A 692REESE
1,666,296,119 *AF5D2F127D3BEE2CC0C72758430287F9B225D3AD [email protected]
1,666,296,120 *AF59AFB53732711A4BFA9FCE99FBCFD37AD13238 a;ls)
1,666,296,121 *AF565F18630AE01648FA274F79F74006238075D0 al,ze
1,666,296,122 *AF5D51F25EEC9EE8178E67E015ADD47F8B91CA59 amenagerions.
1,666,296,123 *AF5605AF956FE366694EE3EC198B298BF52C8DF6 6-KAHLATAAN
1,666,296,124 *AF501EAE5D39E2975E8BD19EE5E454360C297FA2 6KHANPACERS
1,666,296,125 *AF52118456153C15FC1842024D855450482649C2 ANDERSONPIIRTO
1,666,296,126 *AF543A14D043807BB60379AB7DBCB36F91C46398 ANDERSON.SALIMI
1,666,296,127 *AF5613B2296967AA8D0C2A24E2FC6F63BC8E9BDB andrewagnello
1,666,296,128 *AF58E9B6C5B0F05AEC7FA20B29A4F57BA2FA9457 ANDYBEBITATAM
1,666,296,129 *AF57F4B9A9099C9CC76D956B9FE7EE2C305123E2 6PAINDEMEINE
1,666,296,130 *AF53D521257468829442032684B199AE3DFECA2D 6REAUFGETRETEN
1,666,296,131 *AF52AC08497FEA83D2BF0DC57A29988CE6AF806E ANKLAGEPUNKTETS
1,666,296,132 *AF52909054C02647F19F01DEAA85587CBC703E3D 728770 ESKIGERCEKLERIYENILIYORMU?
1,666,296,133 *AF5EA7F818A280F7162303AC75ACDEA406EF9290 answer」(作詞:西暁准 作曲・編曲:
1,666,296,134 *AF57FC3BE0BE9A27593972B9BC7D97AA1D2985BD 7BORSLAV
1,666,296,135 *AF5188325CBE9EC789D326701B39530D6EEE2E6A 7BRANDONTAMARA
1,666,296,136 *AF5033CB201747C4EB0E055E47BE6DD00A21605E 7COUMARANES
1,666,296,137 *AF50D6917186C6A8108BB816666A15EDE06EB421 AOO_T
1,666,296,138 *AF5496BCD81C89BC47A02B76B9D7F75A37D6FABF aoverscepticism
1,666,296,139 *AF5EE0CBB5AAD47487F40A6CE9493B9D4C1F3800 A#(OX
1,666,296,140 *AF558B0C9F60AE770E3AC5C0A7FEB51C2C48E4F7 APRIL.FOOL'S.DAY.MORN
1,666,296,141 *AF5BC930B5D20E3ED6EB97908776A2D560CBB58F 7UNCOAGULATE
1,666,296,142 *AF5E4995E74958B1DA019BB99D9D2A60B3C957C0 7WEIGHDBSW
1,666,296,143 *AF53E4A2FBC67EE0AEC85982E3E6B2FCE172A7B2 7YAMAHAGIZMO
1,666,296,144 *AF5A81AF02BF41A9EA202ABC04BA6EC573852E17 857cassandra
1,666,296,145 *AF528FE8C553FA492D859F5499CDC0A196821F7F 8###B~O.~o.splat!!
1,666,296,146 *AF5AB088F27CCF17957713B000D821A60454590A 8GUNNERNICARAO
1,666,296,147 *AF5A5B6C51F7D2E859AD58556C73A9EA98347C83 8ILUVCONCEPT1
1,666,296,148 *AF550050D4B553B1158B287490AA64991CD4C3B0 8PAHLEWI
1,666,296,149 *AF54C63FBF0A2575A896EAFBECE1F87B8E1F7A4A 8-PLANIERUNG
1,666,296,150 *AF577BB4686399936BA62464FFB9DF5F6F389486 armigern3
1,666,296,151 *AF5B6A3D7C46585E139242E9BC9C60EFBC3699F6 8REREDOUTE
1,666,296,152 *AF5C1DCFF840E2C314E2A166339FF3339ED31373 ARONSBAA
1,666,296,153 *AF5F2D6F946BC7969703F8A50F770D2E9FCED424 ARTICLE442735
1,666,296,154 *AF5972A5394025801F662C28B04ED279CD5B0CDE [email protected]
1,666,296,155 *AF52EDC6627EFBCBF2F4440A91F88E6D2346B610 as?3=
1,666,296,156 *AF50D6F90F9ABF8FA9ABCE6A1588B1F2F3146A1C 93seigneur
1,666,296,157 *AF599C1DCB2DCA81BEE765FDFCA3883455E6A730 assnp
1,666,296,158 *AF58970F6E9B0B3E2E7DE30FB2D719C75AE0D3FE atilabilirler
1,666,296,159 *AF58BD8D7261A3CCD17E1B3FDE369E512FBA9651 [email protected]
1,666,296,160 *AF584F10CE679A6D0F6142021F34A323AF31CBDD 9FULDVGTIGT
1,666,296,161 *AF5426468B000B8DC056FE801F379B322B8E333C 9H96
1,666,296,162 *AF58299DCBBF7879B921088C9186E537376E8602 9HERUNTERZULADEN
1,666,296,163 *AF568DEF02F67502D3BDB20E3B5A73D93567CD72 9ILOVESATURN59
1,666,296,164 *AF5937386320D0A77E4F37255C01DEFB504D3174 AURSUNDINGER
1,666,296,165 *AF5021EDDE2A3D961402512DD1ADD51B03D85E5B 9MADOXES
1,666,296,166 *AF5BA1CCAB665F20D4004F0CEC52152EF87C69FC auxun
1,666,296,167 *AF502E9491753326D245F041626592016F71EA56 awwsk
1,666,296,168 *AF5F318F25BEC7511FCFD612B6DBFEFAD2929556 a0r5m
1,666,296,169 *AF525D0B6C923BCE4F96CF3E57DCD116391D7256 azrinajamil
1,666,296,170 *AF585F8F72193E7DF35885FB9F97CD4C7A292772 b%1h&
1,666,296,171 *AF51607BAFC64E7AEA6BBDEEAC2EB82BBD91B5D9 a4h0(
1,666,296,172 *AF54B6DBD533D880DE9612760C6AE66691493BD9 a/7&c
1,666,296,173 *AF5B00ABB479E089B7A645CD0EF58F03B39C7F41 b!9h3art3d1y
1,666,296,174 *AF587E0E6AFCDCE0256F95ED6DF5657C232EC475 [email protected]
1,666,296,175 *AF5DFDA45488165D4562F95F19FCC1085322E78F BALASTASES
1,666,296,176 *AF558441EAA7E5A1612192BA04477C317FEE8306 aac"vs
1,666,296,177 *AF5F17055341E10A5129A028594C25AF5F414DC3 AA%MR
1,666,296,178 *AF5C73625AF6C80CB478D8115DCD6DA0C11C918C bbba+
1,666,296,179 *AF57760D4ABAE5A3AC9771606D24AEA54D701769 beademds5
1,666,296,180 *AF598CAADB1D8675739CAB0641F5E8F981683FF5 BELFERRER
1,666,296,181 *AF5CDD521B1195190CD302DB402184DAE887543C bennettreddout
1,666,296,182 *AF533769753732CE2EB1C56C4640942E3FDE1DAC ADAMCAVENAUGH
1,666,296,183 *AF52D076D71F31D0D0993694CC0FEF751ACEE9EC adamoberbeck
1,666,296,184 *AF5CCA3A63E0338273052EBEEBF8E80F38A3FD2D ADAYR
1,666,296,185 *AF5C5885C16C9694E419DD7EFDB8FE48B55CB519 [email protected]COM
1,666,296,186 *AF50916C160F5B42F739FAF630F1340E5B6BB2C8 adnk_
1,666,296,187 *AF58C2AD70F36E92255C825A0722771EB7D96568 adriansarwinski
1,666,296,188 *AF5254BEEA1B4410E9C84388A3D3FCE0D73144CE [email protected]
1,666,296,189 *AF524BB590B8C793CE41F339EEB2C641BA469E61 ADTDVTDS7
1,666,296,190 *AF53027E79D0483D771288D8EF5D26852560726B bezeichnungsschmema
1,666,296,191 *AF5F5C2C962357C1D9D320D61D4AB1A667AEBB86 A&H9
1,666,296,192 *AF566F4BF56A4E8F534DBC58F164B2BC350B443F a=i1u
1,666,296,193 *AF5B76856B8EEB487FE5896E92D290576D2D070A BLANCHE2001
1,666,296,194 *AF5BBEA0B02A0471D38F5A00FA4B02BDDA765B61 akvcm
1,666,296,195 *AF5B7B68001D39885807ACA6B904BB9BFA99E04E ALIABBASJ
1,666,296,196 *AF57D5DD687DA921F5C623AEE396C70287EAB0E6 alien:.the.nostromo./.end.titles
1,666,296,197 *AF5BE82AB9EBD08DDC41CBE67D359BA2867F6E89 ALI.POPEC
1,666,296,198 *AF5B5124E5E077FB3F7F81A104EA2B2A71DBAC1C ALISSON255
1,666,296,199 *AF5ED09B41A35356DB96E5D772CC40197D67B6F2 bo*w
1,666,296,200 *AF5A858CF03457E6AE75C7D623FC6D6965AE639F a%m/
1,666,296,201 *AF57BAB57543EE6ECAD252F9D84FD60F2591AD24 aml=j
1,666,296,202 *AF5C13A1A2744D2EB4639CB1819F863A2D8C7EF1 brendonmraw
1,666,296,203 *AF59537ED2DC38BF513C10E5B148A31CC3044795 [email protected]
1,666,296,204 *AF5421F90A3D15235DA28E72534A3D02676CBAE8 BRIAR.WRIGHT
1,666,296,205 *AF5A23BA54BA13F79F4F4BEF98D80D858D00A77F BRITTANYLEWALLEN
1,666,296,206 *AF544480DA726EE4797A4120380ABFB294047A10 BRONCOSKINGDOM
1,666,296,207 *AF5135ECF055A1945408680E1EAF0D968C922ACB brr"3
1,666,296,208 *AF5EDE0C3AA1A190F8933583C4E96739FA1EA450 BRUCE11OS1S
1,666,296,209 *AF5668234D800AC10D11D38162438757625AF15B brungsunterwegs:imgartencenter
1,666,296,210 *AF5818A993E185637A4CFC4C787E9E2F633948E4 BUMBLER
1,666,296,211 *AF52BBE2E6C3B4CCDFE93B89835A577EA8D4B508 burtonvattikuti
1,666,296,212 *AF515ACA782377DD296D24670A5D2EDFE025EBEA aopn
1,666,296,213 *AF59E4CA8FA492F59BB46D617ED23BD0EC4FCD24 apep,
1,666,296,214 *AF5D2AA7B623885A0FA9B2E2177C69B908871990 ARMIDA’
1,666,296,215 *AF5636E6359162914B04C9AA834D7EF2471F3BB6 C7GQU
1,666,296,216 *AF566331A1DF21508155B8E246C4A2B4F048AABE ARNOLDOHOGGINS
1,666,296,217 *AF5C343C48AE89605C52FE1F93DAD24649AD60EE ARON.EDGEMAN
1,666,296,218 *AF57B098816E8BA5D7093D40F2CDAADE803E9456 C8S9J
1,666,296,219 *AF550E882184231F9C8A12449F938A94276417A8 [email protected]
1,666,296,220 *AF5DFE227C60279EFE74F2B0851F807B29242EF9 CANIDIUS5
1,666,296,221 *AF5BD416B2B8B7083D6252B203D0CC7977CB0448 carnivalesque
1,666,296,222 *AF55568A7AFA777F968C256D547C5F0D0CC928C4 cassidyhiggins
1,666,296,223 *AF52B5E9E843448E0294A6EDC8DC4B2FF37154AE cayayas8
1,666,296,224 *AF56CB3C1C9181AE03EBD9A20095D13E3FC87BA4 c+c+s
1,666,296,225 *AF5AD258DE19CAC3601AAA4E2F314E6846134E52 CHANTALRENAUD
1,666,296,226 *AF592A96098790F936C6771943FC269519567013 avfp
1,666,296,227 *AF5D37AAA704060956F071E82170587DF157E8D5 christianglordano
1,666,296,228 *AF502A5CFCC3C606B7600DF8869FD7AF696C2CF3 CHRISTINE-LAURINO
1,666,296,229 *AF5F2D23E6AF201572622EE6E0ADDB456F849BCD CHRISTOPHERB
1,666,296,230 *AF5C463827202190B09058214464EC911CC87B25 b#1z8
1,666,296,231 *AF55F417A9D3506E56CCA18B5872C4B5F1C9CDB0 b2kmv
1,666,296,232 *AF50B2E354A1E169150FE695761AB612036036CD B82(A
1,666,296,233 *AF5299E8576F92D2CD5B84639DF3503839984DB6 CLARK.KURSHUK
1,666,296,234 *AF52733D7304FE73DA610009D20D9F5E244F6A41 CLAUDIOBIRT
1,666,296,235 *AF51046642BA87C7847E1D1A3EDF8E2D39259CB6 CLEMENTE.FINK
1,666,296,236 *AF5A911A8843D551C49BFBCA1D149B3D8A39278E BAKUV
1,666,296,237 *AF559E167AF31A56B630A1E270AA876708627F3A CLIOMETRICS
1,666,296,238 *AF5C581D4286481992A126BC742D2B2FFF855DB4 cm(jx
1,666,296,239 *AF5249E3FE2BF1BFF48D53EAF18463C42F06B9C3 C/NQ:
1,666,296,240 *AF577C71AEFF6C8C17CD5DF9B0FCCE7DFE7D1088 BDNIF
1,666,296,241 *AF500BE6429BC2321061A885741F72C317341962 contaminerons6
1,666,296,242 *AF5A459F721163F47071559B8BC263A70F52B771 BENMIKULEC
1,666,296,243 *AF595DCA2907CC21B1B09BAC35A60DAE8EC141C3 BERNARDFREIER
1,666,296,244 *AF59DF68F44E7C5F2BA6A85354E27C04D8EAE6F7 bernardmurtaugh
1,666,296,245 *AF541B3F89D95D64DE8C0D9DE59DDA9E6D8EC125 cotonina0
1,666,296,246 *AF5C0BF445B27F94D4E17F730B6049A52E4D3478 covn
1,666,296,247 *AF5D34195030B25237615BCEE3A0C41FC77AEAC4 BETO1981
1,666,296,248 *AF539A46C2331668FF6AC2A2AADC83B6C28E57D1 bf+,7
1,666,296,249 *AF5595D0E63705A7AFA6C53BAF53F99D96FA795A bfbb?
1,666,296,250 *AF5D83AA2E3EEDE7B843BB8E4B7CEA079D9AC382 c:\program files\windows mobile 50 sdk r2\pocketpc\lib\armv4i\pndtapiexp
1,666,296,251 *AF5F011C0912A73299A47C5CE2312324D25D2042 [email protected]
1,666,296,252 *AF5BAFF983C2A951B03F21090BFEC52FF8917FBC bj:f5
1,666,296,253 *AF5EF3353EC0FD9951BD0DE0A3C6815474DC8049 c"rur
1,666,296,254 *AF5DD192DE4AC0FEE3B16B2823D4528BB050B27B CS28%
1,666,296,255 *AF58AAB3016EE0362091F580216BD69B707C1BF1 CSK3
1,666,296,256 *AF511788EA5B769EF0C2B3B700040ABC8F61F214 brandonkuhlo
1,666,296,257 *AF571169DC41EA0AE6C10B99810299EE9EA42C12 brantwanous
1,666,296,258 *AF5CDA0526AAEFAB9A30C99FC45E962ED932EA2D BRBH
1,666,296,259 *AF5BDDC12CD57DE0B2FD24198B1EAFB12B358C43 BRENDANCHUN
1,666,296,260 *AF54F786EB3AF8DB819C8569D9E1F43E060048CA CUTIN
1,666,296,261 *AF54AB3E670B4D3CED165D86ABBAB4FEDEC0467F CXdn
1,666,296,262 *AF5002CD61584F334E8AA6583A2C69FD5248C4EC bs=e;
1,666,296,263 *AF57B5A379C4379CACDA68EEE6FC90C34201F629 D$3VE
1,666,296,264 *AF55059263C9410744F4DC931CA595CDA86803A1 BUFORD.MEACHAM
1,666,296,265 *AF596AE9A76791F753AE546028C9B43CA7DDEA12 BUKETBENGISU&GROUPSAFIR
1,666,296,266 *AF591290B09A23ECC96FE5AD50F6DA777FC17751 D7&PY
1,666,296,267 *AF5782C555F6A86A749E7EDC02C523592E1480F0 d7zx"
1,666,296,268 *AF503566FBB0C028978341C02A350133433A05FB D::8
1,666,296,269 *AF516B4D885C0F82708819D3730A27B019047970 damianbaumgard
1,666,296,270 *AF56D3018A37D72187F880D9AFB828E34FAD3C24 damiencoho
1,666,296,271 *AF57D697F6DCCFB8124FEFC8A5E22A0EE82D2098 DANYEL_520
1,666,296,272 *AF5E650BCCC3D258AD79313E36B02FF83CB91F6B darellkester
1,666,296,273 *AF58E27D07D35A90F46BD9AE4F37558CCACB89BA DARIO.DOLLINGS
1,666,296,274 *AF5418EF514210B0065024451402D536E74436EE dariokula
1,666,296,275 *AF5EF3A7DCE0E772495F227FE8A50994F0F8FA15 DARREL.HAMMELL
1,666,296,276 *AF58041DBD2C196EDA9F2CF9F024CAA3A7E9C20E DARREN.CORSAUT
1,666,296,277 *AF53C852FCE7EDC78B3C057A21953A8BB965867B bvwhm
1,666,296,278 *AF574820696803BC07CEDFFD66E9F5B4510D97AE B"YP3
1,666,296,279 *AF57E6D1C29A5F13A77ACE6A1839F2AF4A89B4FC DECOULENT5
1,666,296,280 *AF59A5B72049B2B9FE930364A4FE09F7B94F92BD detonate111
1,666,296,281 *AF51E4457B79C2010F8F36D7730368C1FB3F13A0 DFE!T
1,666,296,282 *AF51EDCEB71C6909ED776E9DB652BA4993DDD902 dg(l
1,666,296,283 *AF5D11DCC9B71B8353A536EB7F80CA560E7F2EE5 DIEPKLOOFEKHAYA(DIEPKLOOF,MYHOME)
1,666,296,284 *AF517B300BCE25397BE140F76366956D078831BD di/f
1,666,296,285 *AF5315C9CEAE94719FC131B3CBB946358DC6A197 CARY.MAHOE
1,666,296,286 *AF5E99EDE24FCC61B5724D8A8A39314D838C8CA8 “DIRÍA
1,666,296,287 *AF5BCAC4122944AFEDBDF45675B8D75B92DE3A96 [email protected]
1,666,296,288 *AF5186A0F5E199983A0C2CBED27E9B1CC1BD65E1 CATHERINE MC GRATH
1,666,296,289 *AF5F19B3D64FC8848DA827D9F8C7BC9A941B46A4 disx7
1,666,296,290 *AF5DB75F57C30CBD72BE6458602685F7CABB59DE DJC&
1,666,296,291 *AF5CAA353CCF01E736A3B137FDB228424EBBC183 DKAKV
1,666,296,292 *AF55D2D4BC769E0311C66AF54A04C1494E37B1F7 CC_7A
1,666,296,293 *AF581AE5F6419FF50A1010EC85CCA5694D09E2C1 [email protected]
1,666,296,294 *AF581548628C4BA95187A8913354B8E8B877E0FE c:cqr
1,666,296,295 *AF53ED5712D1C3BBCB1C2C172BAF0AD0799F99FB CDPHG
1,666,296,296 *AF5D72072FFF2C8A0ABBFA199E29B0B29C65F5CD ce2lv
1,666,296,297 *AF592259A0011D91737927A260A310E9E91433F6 DOMENIC.WILHOIT
1,666,296,298 *AF5F1C5C193FA783CEE820A10A5D51018FEF06C5 C=EHK
1,666,296,299 *AF5FBC71325D806CBB79A4A3211ED12D3D00E143 DONOVAN.PFLUEGER
1,666,296,300 *AF5E3A945CB9FDB9DE96CA97E1E6FC7C734A0F40 DONPERU
1,666,296,301 *AF536AB3110FFA82F5DFEB94E083872BA3F6EDE1 CESAR.ARLINGTON
1,666,296,302 *AF5701B6BE9ED79B200639F0F43A1EBC1A062480 CESARMEDAK
1,666,296,303 *AF5089BD8471E9FFAB1798CD04038082E91848D5 DOUGBRETT
1,666,296,304 *AF5800487A72811ED10C18E9AC4ECBF441F75554 cfkge
1,666,296,305 *AF54BAB9F8C055FD8EE1281B7979596BE314651F [email protected]
1,666,296,306 *AF525F17718E7DE7EF5AEEE27EE2DC5EB6CB45DB DQ:&K
1,666,296,307 *AF5F6F69D9C902AE6C7F6A9B2E5FA6AC254AC7B7 charliebulson
1,666,296,308 *AF502E75B39AA453F58AC1FD9045D91F91DAAD0E cheeseraymond
1,666,296,309 *AF5B24A34D27991146ADC35AFA98DA552F67FC94 drv/s
1,666,296,310 *AF59312B8ABD2CA3F0BB73645B9AFD82F0AEE320 CHESKIS8
1,666,296,311 *AF542A8A1B13A8EF1E89850F53578A79AB7B6DAB CHIRADC
1,666,296,312 *AF5BD72EF4CFB5C44B37362C25204994A7355A95 christophercrnkovich
1,666,296,313 *AF59B90B50EF8146FAD8D8EC9911C720B51169E1 DUG$Q
1,666,296,314 *AF5BE3E3EE63E236265D53D8F39A4F875BC6DEA8 CHUNGBRUCKER
1,666,296,315 *AF52523A7F3A88DC22145FEE55D773893D73BA2E DUSTINBJORKQUIST
1,666,296,316 *AF56E24B32C91F3277C1AB8FBBFD3365E70C73FF C(I./
1,666,296,317 *AF5ED7618A0AA6087D4BC3EF272370367AE2EEFF cjd!k
1,666,296,318 *AF50A24ACE128A6A258E122848DBC271A0469EC7 cju9p
1,666,296,319 *AF56F122001F001C2E66B8F870096D74B8DAB6D3 CKAR-
1,666,296,320 *AF5372910C2925403A8B87D3846F5B6804215B6C CLAUFREU
1,666,296,321 *AF5307A1E9F4CACCD005650D75AF8E78C25E3FEB CLEMENT.BEHM
1,666,296,322 *AF576ECF81590BC6B04D99532481037BC7092E82 cleodemel
1,666,296,323 *AF5ED5598C84F26290C4C044FF63B2C5F41702C2 CLETUSDELGIUDICE
1,666,296,324 *AF55AB3F3627DC706E1066514C7579B4CEB04A8C ECLINATE2
1,666,296,325 *AF53A8ABEF3E26495FFB397A87F7B8C790596268 ECSOD
1,666,296,326 *AF515E6F710397BE003357C24B142601E423FEA1 EDWARD.TERREY
1,666,296,327 *AF5A682CCE097BE0B21754221B6065DE4B0A69E6 cmuy5
1,666,296,328 *AF51479675E1CD8E171FA8871DC014A818738E06 EFT
1,666,296,329 *AF55BEEC881F35C90F18518C7A6A0461DBB64B11 $ek0ndl
1,666,296,330 *AF51CE978F89DFCCDE8DE33F8B0ABF1665EEDA31 eksgi
1,666,296,331 *AF50C5A2AEC906CDE1D69FD0188E279EE6AFB9E7 el.
1,666,296,332 *AF5DEC6D04B16B2BAFD8211359BC55CE069250D8 ELAN08
1,666,296,333 *AF5D8FEA015DA4C1B78042EA23B9B4B6089FAE1A CONEJO19
1,666,296,334 *AF59534B89F634844D4848FDFF1874E10F4EA613 ELIZABETH ANN PAINTER
1,666,296,335 *AF5313D3D3B15566B48747754D3CDD5D9697C620 COPU14TVE
1,666,296,336 *AF5E74623CF0F47D29F7E2F8B95265A00DD6DC8F ELROYDIMASCIO
1,666,296,337 *AF5CE41EB689BB1749D792D6A9CB0ED437D6C142 corypha?
1,666,296,338 *AF5C10E851806CD9DC4795BD95F0D0CBF39041B2 ELWOOD.HOLZBOOG
1,666,296,339 *AF5B070F56F52EF3F401EB582A6D53427A1373A3 EMANUELBREUNIG
1,666,296,340 *AF556E11F82A69FCC6EAE41E8A5AA29773B4D5CC c.p-&
1,666,296,341 *AF58543977B603C42DB9251625E88DB7B61F3211 C:\PROGRAM-FILES\ADOBE\ADOBE-DEVICE-CENTRAL-CS4\LMRESOURCES\EL_GR\MAINZDCT
1,666,296,342 *AF56B8ABEEB56A501CD661F9976DEBA2D46A9688 EM"TN
1,666,296,343 *AF549BA6CB6F4117128404A371CF854DF5A18B88 ENUSER18913224823
1,666,296,344 *AF57506CE87CE6B9124BB31F26FF64E1A26EFBBD CREEPERSPURWINGED
1,666,296,345 *AF5A8C0763545E613500C096A550D4CEE253EB08 CREMEDELACREMEE
1,666,296,346 *AF5E77CDA395462F2853BB40D8B5F5A6D06E5CFB CRETIEN1
1,666,296,347 *AF501ABDFEEFD37FD45120E4C80862A732A5CBBB EPNH5
1,666,296,348 *AF5871084C3A17806A4897A632BF2E9F49A20154 eresterk6
1,666,296,349 *AF59F56D37E8775CCDA8CC96F41F44555413054C csr2uh0f8rpg5mj
1,666,296,350 *AF5E7A7C98C1059276C842F03E5383BD11A455ED ergattir
1,666,296,351 *AF5C46326CB8F2204824522D7FA421622361D77F ESTACIONES-FERROVIARIAS-DEL-PA
1,666,296,352 *AF50E3DBBF9C9179B6B0A1124E6B53C573A32F0F estebanmoscardelli
1,666,296,353 *AF5B5F44736E05A84FA685D987E2BF23E49D394B c?;&w
1,666,296,354 *AF5D2C69E691C5DE40CE6C655D201C2975733D76 CW-6C
1,666,296,355 *AF5ADB3E3BCD78F0C59345B6593476171B9E011E D101907
1,666,296,356 *AF5771B4819BB7EE96234DB395E396791F4A53EA EX.Devil's.Rush.(Road.of.Pandemonium)
1,666,296,357 *AF55B0BF9389A3CDA34A54498D81FA2469431B83 d9jec
1,666,296,358 *AF576BAAF136419A03F370E001F2977E2AE632A0 dailydaily dream
1,666,296,359 *AF519E09E5049232BF1EA7D29C3E7BDB8E5E0663 FAGOFILIJA
1,666,296,360 *AF54AA19BE9DC98F902237915221FB495937CC79 DAMIEN.ZAREMSKI
1,666,296,361 *AF561ED80F61467C868D7E395C46718F20465126 DANIEL DUNSWORTH
1,666,296,362 *AF5D9EC8BDFB5AF955A88AF978D40D0CEAC62689 faustinocimko
1,666,296,363 *AF55011F5025CAA6A493350886E8335658B54EE4 ĐÀO HÁT
1,666,296,364 *AF587841D6A5A96AF4BBF28A6ECF1A60FCE178BC darellsteelman
1,666,296,365 *AF535CF54DDC49EB5A726CC9E7039C7D7B59D11E DARENWOLCOTT
1,666,296,366 *AF57B74B851AE6BAEF65A83A21CBC0A5ACB53359 DARINRAMSEY
1,666,296,367 *AF5089448E329694209C9C6FC8B5155EB71CB326 FELIXCARMAIN
1,666,296,368 *AF54B3DEE2EF11DB175D154B9B55004056BA9682 ferdy.tan
1,666,296,369 *AF56160E43D881F684289F4B8C52BEC4BF75FC57 darrylrutgers
1,666,296,370 *AF5A9DC5F25F56057818214C47EEB678164F7F91 FF00CF
1,666,296,371 *AF5EBF95646EDED71E3C202A5F714182146BB550 FIDELPIN
1,666,296,372 *AF5FE4549EBE71DE9B9E7F76F675A152AF5F1D27 fikcijama5
1,666,296,373 *AF5B48F41C3C936B9949E419A3AA96241E3BF063 DAVISDELLIGATTI
1,666,296,374 *AF54FFC8F3E139EEA791FAD72F1646B1BD889783 db5(_
1,666,296,375 *AF5407F27DEBFD629EB019D9932E26A42D4ED8B8 FIRMASTERENS
1,666,296,376 *AF54E55DFD93601A0111C7D0EAFE62C86722F72F FOOL/
1,666,296,377 *AF5182D90828E0EDD302547C9BA7CF7B5E11FB83 fran-carlin
1,666,296,378 *AF5E8FA28F28B610DBC6EB1CCC19F6B206DEC2D1 FRAZURB'LUU
1,666,296,379 *AF5821793882A1331981842A36320F9F439E6458 FUTBOLOWA8
1,666,296,380 *AF5A547F24BD3F349979A5B2970BBBFFB8BD38C8 futureofadelaideduouncertain
1,666,296,381 *AF5E87F1B4F7D47D3E1076CE9D0495773841E236 DcjC
1,666,296,382 *AF5F5897282A6EA979012E2EFD636879AC0A1AFA galloun5
1,666,296,383 *AF56CE903BBAFE9AA6ECE5705710DBD4783B7B19 [email protected]
1,666,296,384 *AF58C2B4BDB219821EC8DBD24E77B2134EC71F95 garringo
1,666,296,385 *AF5C8C0AB1E5F24AFD008B27354B582CBEB3BE80 de/Cops
1,666,296,386 *AF5707F1391597BB493C4874B800E682BB351787 DELITELI9
1,666,296,387 *AF5F0DF8C54D10AB1DF8AC810266223938E3479E DELMARREHL
1,666,296,388 *AF503C725D22B3A0062AC33A0AA5DB2514A494C1 GCTGAGAAGAGCAGATGAAGGAGGTGTACTCTGCACTCTGTGAAACATTGCAAATGTGCG
1,666,296,389 *AF5ABD0FD28A1F0D91539EB830E8C94C70609DE9 DENIOSE4
1,666,296,390 *AF58BF062EDA5F2CA430DE2640153D1DB0B0B8B5 GELDIDEEN
1,666,296,391 *AF53A70DAC8A410EF23F4866E8BCB1952BE8859F DENNYRESHID
1,666,296,392 *AF5BC2903B6082C9FA795F5BC3774F5C2F892457 denotatively?
1,666,296,393 *AF5A597383AA19FC7A745298D33C3B3D773F1F55 GHAPOSEK
1,666,296,394 *AF510DDD1D8990091FCB54AC8E3B1DF1F075B393 [email protected]
1,666,296,395 *AF5416BE736256E4495791469AF41DE071D9F18E dgja
1,666,296,396 *AF561D4D4DA1EA2B569210670AE6BC1056958AF5 DIMBAZA4
1,666,296,397 *AF5E84EB23F32B7A5CB127E482E401DB45B22A28 dinoaydt
1,666,296,398 *AF5E2FAAA20083DDA6E5F8BFA096BF5093733E70 diplomali4
1,666,296,399 *AF5E58E91DB0084BED3034CE64FE0B327A9D52C1 DIROTTATORE
1,666,296,400 *AF5D9215A1E9FFF80AB752E9509929AD255A6C00 DOPOMODZ
1,666,296,401 *AF58DDF1C7DC4CAD02501BE53EF864315DCB9CB3 downeredirail
1,666,296,402 *AF53704E40467D4A750DFF211B09BBEF504EBC86 GQUIAMJOT
1,666,296,403 *AF5F9EAE20E116280C86B5B29D4E09FAAF2C324A drb?q
1,666,296,404 *AF504820D31BEA2FA1F2EF44CD2F9AFE73BF06C9 GRBOYAN6
1,666,296,405 *AF59A2211082953571C28F38A8BC6854F85F58DB GUADALUPE.LARICCIA
1,666,296,406 *AF55A4790241756DFC8D86216FF35CAE1D1F1FF1 GUSTAVO.BLANCAS
1,666,296,407 *AF50151CA75B564E85ADCC417AF049A3CCF24075 [email protected]
1,666,296,408 *AF5AE475124FE17A915496F80E48F52FE08F0588 [email protected]
1,666,296,409 *AF5A7E4DCE390329B9D5B1905C87AA3350139BB6 `\h
1,666,296,410 *AF5A5B58B48E027B08B64880F93348DA30813926 HARMONIA
1,666,296,411 *AF56217E83988B2D6A036456C390E2659A1D4617 DY/HW
1,666,296,412 *AF56A218CD1B981188C31CFC95F521E2AE69E76B hash.up
1,666,296,413 *AF5D61589F408C6465A6D42F7334F414B202AC6C D/ZQD
1,666,296,414 *AF50DE06D33489A8CD71417C92F885428BE739A5 EAROVALED
1,666,296,415 *AF5ED993CD5EE4F676969DB71078650C1031305E [email protected]
1,666,296,416 *AF5245F1F8ECAF66F473371F5FA5CE8BF0CAF795 HELLO1GOOBER
1,666,296,417 *AF533EDDFBABA4A787862E5ED9CE0DFD641EED6C EDWINSCHREIMANN
1,666,296,418 *AF5201160FD59D9B24FDFFFA1778192CBF311551 EENJARIGE0
1,666,296,419 *AF54E02FBC75EB8A68E8E422B1F38604BD086CD8 egnipmoc6
1,666,296,420 *AF5D3FD3DAA8DCF4111D9A67DEE2D06F65062151 eh)#h
1,666,296,421 *AF55832FCA70F3B4FC81B3B0EF2993BD4F880481 EIAVUOME5
1,666,296,422 *AF5C33091F5F3F40987E04F7042182B427AD7F9B hiramtrombetta
1,666,296,423 *AF5DF91BCD7DBD1048052761F51C5CE01FED44AA ekf2w
1,666,296,424 *AF5622A128436B07A618C935AEBEB4B545AC12D4 HOBBELIG6
1,666,296,425 *AF5B17148CF3AAE130DCDE9B8089A9214E3A5549 el.
1,666,296,426 *AF5FE0C0D4D247DF2248BA1868F7AEE996DE3E08 ELDRIDGE.BRENNEN
1,666,296,427 *AF5113AE88EBE7F047EA2C76077F4C3B1B0CDD16 HONDALADYBUG
1,666,296,428 *AF5282A815E006C71AFE425B8D0B842B3A7EE17A elviscarl6
1,666,296,429 *AF577E9F1E2B9AE709C472D5AA552775BEA0E659 [email protected]
1,666,296,430 *AF57B9FE505C9047730C5CB18624959E555FCDD9 EMLRJ
1,666,296,431 *AF5114DA7D1EED5DC9A287A01A5CD882F3D02DCE [email protected]
1,666,296,432 *AF5F24C07D7FB111AA816AE17C67CCD8B01DFECA HULTSFREDS SL
1,666,296,433 *AF50CB49E56B3E430153995C03222E44570ACB8C enurneding
1,666,296,434 *AF57B634F763ABE1AD37100DFF64B4CC6E833A3A erron-james
1,666,296,435 *AF5B200502E97B5C11A3ED2B15270BE78B5843B8 ERTELUJ5
1,666,296,436 *AF57F25AE9392AC85C19D14F549F43FA483E03D1 IGNACIOSAGGIONE
1,666,296,437 *AF537E68380699C590BCC04D3C445844960ACD25 ESECRARES1
1,666,296,438 *AF5D78CDB7713DC0B02BF0646EAC105D4018C19A ESETARACULE
1,666,296,439 *AF506CF8989C8C13FFE3557749A12D2512A19050 ILOVEANGUS54
1,666,296,440 *AF5C0EAE782DF2284F4F1ED9F66B737B8F2D41D3 iloveDORK
1,666,296,441 *AF5A82F2F1C71E8E4E2D5BDC4F77D526D06C8A4F iluvdusty06
1,666,296,442 *AF56E01F25F3B73A2F17496A1903C0C52407EA9F EXPANSIONYEMPLEO
1,666,296,443 *AF5B53328A9032CF19BB0C507E52B4C24968F64D IN4020
1,666,296,444 *AF56920B5931C0B5EB56FA4B2CCE9BDA5A42F028 inoxidizing3
1,666,296,445 *AF55A8767203DA15D487381DB2F783CADC1569B8 INTER1AME11AR
1,666,296,446 *AF57666CB2A5ADCC8556FC33C3B34CCFBD08C7B4 [email protected]
1,666,296,447 *AF57EB02A501660B2D6FABF4D9601C4488E8F144 f0lk+al3
1,666,296,448 *AF5B61646235C1B5AC6D0A0C8018680E5B04EC45 fabler'f/ei/bl/@/r
1,666,296,449 *AF551298018FAA69314902A2830272BBFBB93001 FAHRPLANM
1,666,296,450 *AF59FAABB06E252E72B4ADA9D93887FE0F2353CB irdyhyxo6
1,666,296,451 *AF54417C9F20390C30E9B8BAAD9DF6F382824D87 ISCRTASTED
1,666,296,452 *AF58868D84F5F1465983511B200F4E2EE265B08A [email protected]
1,666,296,453 *AF57AF982FBCF3949C752C40D00DB6235CDD7CC9 isoprinosine7
1,666,296,454 *AF5D2F89DC626722682D29CAD8A282009B133098 (feat.bobby)
1,666,296,455 *AF5FD781111B68640D94A59CC7093670A0440AF0 FELIXLATSON
1,666,296,456 *AF59327D46A6390970774A6B14CBF11E76C33E34 fenneloil0
1,666,296,457 *AF5643D39F3166C97D5D395B7888BFFFD596D675 j022296
1,666,296,458 *AF5A5AAB678E1FD409CE89F00BCE2574479D2E0B J4|E
1,666,296,459 *AF5ABF84163713AEE5161CE70418280386D8C58F fiaunt4
1,666,296,460 *AF57BD801190CFE7C9071C3DE6D90A0E5CA4B734 FIRMAENE8
1,666,296,461 *AF50D4DCA43E28D34657C12AEDB7BA5F2F916733 fizzuck1
1,666,296,462 *AF5509441B12998AC5FE7172EDADF9E93363EAEB jamenine
1,666,296,463 *AF5DCD119FF828E51AE2F7936C86E4B75AD20B97 JAMES909
1,666,296,464 *AF58F671E296808FF15C5DE5587A6F420D9CDFEF Flmd0m5
1,666,296,465 *AF5792FA282165B2EE67F6E74B659B6FD73335CC JAMIEBROUILLARD
1,666,296,466 *AF598273263725BA71C2F51E354C6DB66C99D0DB floydbadger
1,666,296,467 *AF517202B1749A1D1163D697D11787A67912F636 fosterson
1,666,296,468 *AF54CA8086CF8F42C5E3DECAA0E0649AEF05E322 FRANK69
1,666,296,469 *AF50535C4F47A1447909C9740D10B68BC7223038 FREDDY.AMERIO
1,666,296,470 *AF5B58B22903C664648546BDF3E4406B1AB11E91 fredericdalziel
1,666,296,471 *AF58D784BC5990B2B8FD2B7B9C016FC14E7B29F8 JEFFREYSUPERNAW
1,666,296,472 *AF5B68FD3D3461D14FFC2FAA963A45E059B4D70A FREQUENTMORE
1,666,296,473 *AF59154AE4904B545A91F0E94ACF441B8AC3D2CC fritzlefebre
1,666,296,474 *AF552659A5A3E0D5EE3692190AE2DF6DB2001509 FROSTBYTEA
1,666,296,475 *AF5CD9FF232236BEE9C0D45B2D8E18364F29D10C JEREMIAHSUYDAM
1,666,296,476 *AF5D66FAADB2201F30E4B582118B0A48748768C3 JEREMYSANDERFORD
1,666,296,477 *AF5D717B254BB46F89FB137E7A663296B7AD0004 FSU–UF
1,666,296,478 *AF59B97C187856FF25AC8EA51CD9DFFBC813E931 furrahin7
1,666,296,479 *AF5C76D4D3F1686116002A8C8112A5AAB16D452D [email protected]
1,666,296,480 *AF5F71ED89EF250C743AA68858A417D7B21F2DAC GARFIELD.STRADA
1,666,296,481 *AF5ACBF0EE321E2360AF608FBF2724CEEA57C054 JKT5U3F
1,666,296,482 *AF5464F79DDC1C1419A74E640ED01141AB2FACFC [email protected]
1,666,296,483 *AF539F2966D1222DE358648652A8D84969BC167C GARY GUNAWAN
1,666,296,484 *AF556843DA25424286C825C35E758BD9154A1EEC [email protected]
1,666,296,485 *AF5B30AE5208178C6F99E214E470B46912141201 JÓANSØKU
1,666,296,486 *AF54C93F95F682D3F5068C9A2AD6C7380F00C6D1 GBuilding
1,666,296,487 *AF596E7BFC3084BCF499325C2069AE726301669F GEGROMS6
1,666,296,488 *AF5E9B17D42906F9CBA88E723F57D036322B73C5 GENEROSENFELDT
1,666,296,489 *AF5208F8BBCE7E5169DDBFB4FF044DF85848740A GERMANBRALLIER
1,666,296,490 *AF57D3837FB13C1C1A0D9E4094DD4D63A2854074 GERRYSEROKA
1,666,296,491 *AF550108346CDA57A0DB11C72E94744AE6504BB6 ggolly
1,666,296,492 *AF5531F477F7935031025959636CC4A2E540F585 gileisiminger
1,666,296,493 *AF5A08D9B1AD46AA4485684EBCD138FD6ADD3275 GINGYM
1,666,296,494 *AF57DBFF09D452F2F8BAE7970BB9FBAFED714687 [email protected]
1,666,296,495 *AF54A3E39969E54A7852F28588891F80E13DC8DB gj0s
1,666,296,496 *AF55816AEEF8089551A6529B487632E79E74AB48 JOEY-ALIOTTI
1,666,296,497 *AF5F08F2CB641F6417763E7A4FCFBD204270C830 JOHNNIEROSEMORE
1,666,296,498 *AF5AD564B5701A6CCA5ED0796E75B425B6A87865 JOHNNNN8
1,666,296,499 *AF5869B45187A13770DD8074375A8EF5E34561CE JUDSONREEM
1,666,296,500 *AF5A4155608D2894F2CB0AF6FB9031FEB3E40ADC GLIEVANO2
1,666,296,501 *AF5909D351F5F5CDCA099B73A04221C42B1D6FC7 JUNGWONLIM
1,666,296,502 *AF57C355732E422154AA66D40831C8DAE670A674 KAARTVER6
1,666,296,503 *AF5259892612BC0E3E0A07A197FD706F6DEB2149 kareemalbang
1,666,296,504 *AF5132121B1CF1773445329F04585FE8942CFD16 kareemschmeichel
1,666,296,505 *AF51F3EA3D724BAC5AD9FC614AA8A8BED41B7376 karoly
1,666,296,506 *AF5E14930D9AE8F649D0018884B133A2634C9059 KATHERINELAUREL
1,666,296,507 *AF5A797A2C2552D4E0C881B23D676CE140DD547B K.E
1,666,296,508 *AF557F18CD8DD3A4CAA35DFE8475E4C28635ACDB GUADALUPE.YAROSH
1,666,296,509 *AF5B5C5532098B023BC62AB374DBE632702BD87D KELLY.BEACHAM
1,666,296,510 *AF5863C4A0964C9BEC58AF0BBEC91B756BCC4E48 GUINEAPIGS
1,666,296,511 *AF5D22611FFA2F71FED71F1F9569AC9A7B9971BA kenniedavis
1,666,296,512 *AF5BF61281F9F1E103C1A6361D557D4ED8110A7B GWAFFLE828
1,666,296,513 *AF5116EF5B167C499895D507F95E186925E075D8 KgE
1,666,296,514 *AF5022931A027C05AFB2C4E4406BFC50BE6433E0 KIKUSHIMABSW
1,666,296,515 *AF5501505F5D5473CA13DD9C07D863B9906C468B HALLOW.TO.OUR.MEN
1,666,296,516 *AF57EA72FED246BC7B7CB91B30AD670C7AE018BD HARJOITUSHÄVITTÄJÄ
1,666,296,517 *AF5FB7F04D8403CDBE6733EB14DF031FB0CB167F HAVEYOUSOMEONE(INHEAVENAWAITING)
1,666,296,518 *AF5395DDB217E3E1234F919F0410AD81DC073CA8 hBbaa
1,666,296,519 *AF53C061DDC459CCED7732B2416F680E6B890909 K_PD
1,666,296,520 *AF5F33CEE92E4C6FC75335880A7289056FC80A25 HGLAHVD-HFVHIDL
1,666,296,521 *AF50A2288C4986D9F01F050A556DC32618FCB24F KURT.PRYOR
1,666,296,522 *AF53D5FD699FF2B0096303BA49C2D691FCB6800B kylehluska
1,666,296,523 *AF5E257463CE1CA999097D54E04D50426FEDA901 HIRAM.PERRINGTON
1,666,296,524 *AF54DA053FD1F0AE717499306477C9AF1D164167 HIRSESTAMPFE
1,666,296,525 *AF52898CB6B8278B4E3A7A85D221FF7F963E5D36 LAMUSTA
1,666,296,526 *AF527DCED7B0596E31A8CF063297253E2A289E5F lava.of.hatred
1,666,296,527 *AF5D61947979F27AB2DED1B3EA9691F915DE54EA HTLAEHULF
1,666,296,528 *AF51139F748623DCF13EE375D8047AFFF4FD8B13 [email protected]
1,666,296,529 *AF5CDC0DC1D6C45D8446F7C7FEA92DF2EDAD62E4 lbdrgrsd
1,666,296,530 *AF57C26CD035B326733967075F5FB0402C8AF0B4 HUMBERTO.PAVELEC
1,666,296,531 *AF580CE359AE7D62AA1664CC2095649B4FDE39AD leighargabright
1,666,296,532 *AF51367E0B4A6CA0335E94C3FCCA6B9EB15F4891 LEIGH.TAKEMURA
1,666,296,533 *AF5DC7F84B327020BD48E4D7F146B76BC4D53D15 [email protected]
1,666,296,534 *AF5509A2E7555DAFD9A1E5DB4CF00C3D72B00E76 I138249
1,666,296,535 *AF53181672DDAB8385BC360EAFD0C4CBAA2C6975 IAMFLETCH91
1,666,296,536 *AF5CBCA16A068F4184EBE44F0184B9E509385049 [email protected]@1
1,666,296,537 *AF58317DDD4F86BAB2DAFBD74FAC24ADA4598780 LINDA719
1,666,296,538 *AF584E72BFCA871EE5D18F91E7883469942E2175 LINEADEALTAVELOCIDADNUREMBERGINGOLSTADTMUNICH
1,666,296,539 *AF5981907AF3E9E1961EE838A65C1DBA9C9B192B iernot
1,666,296,540 *AF5AA4CEA2FAEAB5D84FC7BADABEBB3A0A65428F IGOR-CAG
1,666,296,541 *AF58B271B217D32E01BF6751382D73DFFAD88917 IHMEESEENS
1,666,296,542 *AF5701E4A6F62C66857784595250AB36214353E7 ILUVPEOPLE75
1,666,296,543 *AF5E115C0A0490DA7DE16FB5BE8D4420DBDFEA5B LOUISBESARRA
1,666,296,544 *AF538DBBEE38AB6C57650394208207CE6762F834 LOVEONTHESEA(RADIOEDIT)
1,666,296,545 *AF56BC8C7E61AE467BADBCBD6E3F4F3493865ACE [email protected]
1,666,296,546 *AF5E72A40F4EA3A51381D4539C8F826ECA602D52 LYMANIARA
1,666,296,547 *AF587BC670351396661244C48EDD2EB80391B96A lz9
1,666,296,548 *AF59FC5133D2E2260D7738A419B8D9524B6F97F5 [email protected]
1,666,296,549 *AF505283DF741EF71DC284ADFDB17EF59F02E75A MAGAROL-1
1,666,296,550 *AF5521F7D77F37BFC5C4E1FD0228B1D7E3FD196B imasoldier
1,666,296,551 *AF584003D467CA6B4480A328905DA78C82AB47EE Manny's-Boogaloo
1,666,296,552 *AF54FF0B15D9A4C788561EC20DEBD1170467D1E4 Incorruptness
1,666,296,553 *AF5D03930971F3165B592829C9A562DFD61A3254 marcelinobrownlie
1,666,296,554 *AF5BCB59E96E67568741FFB9A484C23B7BB7B745 INS748I1I7Y
1,666,296,555 *AF54B1149DA80C54F57B5F7063571889AC305907 MARTYJILK
1,666,296,556 *AF500B46BCBBF752A209F552DD1B40FD6026E1E2 MARYMCENEANEY
1,666,296,557 *AF56A344E8296A6920EA2D458C99701B8756E607 MASHWORTH
1,666,296,558 *AF53F158624219B166C51FD7CCDF1838D5AF3FE1 MATTDERBYSHIREIDIDNTCAREABOUTTHEFINANCIALSIDEITWASBECAUSEISUPPORTEDROVERSASAKIDAND
1,666,296,559 *AF54C3BD16204658B4B79141834A9271FD664D7A maxfubar4
1,666,296,560 *AF5C115ED2A2D5ADA5DF3910FCFD0B8990F3B0D1 MCGRADYDODIE
1,666,296,561 *AF51BF4D0AC9D4C94A4CEC1567E5945B05DC1A11 MDJENG
1,666,296,562 *AF58A6F44108C1201BF1BC70AB50AFA0C4CFAB9C jakegorge
1,666,296,563 *AF502E9D0B43435E3901B09D58CF5CFF69ABB3BB jamiemone
1,666,296,564 *AF57DB284BF11EDF431324947A2E1D13EA7AC3AB MELLÉÍRTUK
1,666,296,565 *AF57CA066F252BBBCCA6538824A0E7245375E392 [email protected]
1,666,296,566 *AF570515DFE792B7BAE0F7B7A8341096C834AD48 JARVIS.ARNE
1,666,296,567 *AF5547F50AEEC1934C4197C027844DA3AD81614E merrillwetter
1,666,296,568 *AF5A153AE29737805F0BCF1785E1F11B3D31700A mervintelschow
1,666,296,569 *AF5BF6CA946CCA4CE5309BA327E50F52513A1A1F [email protected]
1,666,296,570 *AF593EBDFDF0D429A423268F988F57CAF3DC66BD MFZUD
1,666,296,571 *AF566DB4693244A188C5359EEE43D23660A406E7 michaelkermit
1,666,296,572 *AF5EE73C9B91579B093430E7EF3E7EAF74D72717 MICHALESHERRY
1,666,296,573 *AF5DA541B6F794EAC737BD61702F6AE96C94BD77 MICHEALEDEN
1,666,296,574 *AF5C8E254E0C273572E651104FB74D367CFB427D MICHELLARIOS
1,666,296,575 *AF558271EB887CF83D0764F3DE2FE61387C56BC8 JERROLD.VIVOLO
1,666,296,576 *AF50C0AF9B361FB36F77AC3747804322DCB1AF7E JESUS.PISCITELLI
1,666,296,577 *AF59DE2B08F3E41D7D601F2E1BB69C35F85B8178 MIS-MEDICATION
1,666,296,578 *AF510E07E95BE7146D76989CDC9A0459E0C8ACF2 jewelscheppe
1,666,296,579 *AF5614730D3A7AD71F4848DDB7026F740958DC84 MIZORAMTALKBARGI
1,666,296,580 *AF5278B069DF0B31B1285849E6F267940C6E7451 [email protected]
1,666,296,581 *AF58ED9F11CDFC634E50E1A4FA0E958F336D9958 JIMMIE.SEIGEL
1,666,296,582 *AF53F79B9B36331BB95D000E3A2A92A1659A7BBE [email protected]
1,666,296,583 *AF5479C474EECC95167C9120043C7E516CC6AAC7 MODESTO.BOHLEN
1,666,296,584 *AF5732562DB2DEAD368D84DF809602B7BF31EB4C MONIKULTTUURISUUSMYYTTI
1,666,296,585 *AF566CACF71EAAD77B6A5F2F520B1D7658E92C9B JOEYCAPOSIO
1,666,296,586 *AF5F453758C714DB1039CE9E1588D358C2F6FBAB JOHNNYPUTRA
1,666,296,587 *AF5D2803D23E38C5D894FDDC858F1A9A5C5A39E6 MTO68EA
1,666,296,588 *AF54D41C454B82D023D09003E318E79EEAED725A MUNATAMBA
1,666,296,589 *AF5FD15496C3B6E82269F0C9649C7DE2A339946C MYPENGUIN1986
1,666,296,590 *AF5435B8A91C5EFA0CC048AF75C306579C89C56F jonathonpotts
1,666,296,591 *AF568FE045B5367817899E50994730941135E954 N1CUPUR1U
1,666,296,592 *AF5B73D341E61469847A61796F35B1A1263DE434 NAIX-CLARA-LA-MEM
1,666,296,593 *AF5911F3845F8A41568358F600B46F9B088B97C2 JR網干駅南口より、神姫バス新日鉄病院行きに乗車、「大津南」下車徒歩約5分。
1,666,296,594 *AF5708461CA6C0D97F397A4E7DF8B51C78AA452D JULIUSDIERSEN
1,666,296,595 *AF5A2C286B68EFCC419A1D39A019E61EC81F58E5 [email protected]
1,666,296,596 *AF5EAE77AB103AF279A8C7B81302164E9E0040BC nednarb9
1,666,296,597 *AF587C1541340CE271553C454A4AFDC42349ACF3 NICK PHILIPS
1,666,296,598 *AF5EDD043A2282ECFDBCB6B9CDCE90C28885583A NICOLAS.NETTERS
1,666,296,599 *AF5297284B43F19934971049A0CF1EF4D34EA954 NICOLE-MARIE-PITTS
1,666,296,600 *AF5B677188F06CEA391DC187E5604D8E500DB93C KAREYITHU
1,666,296,601 *AF54B0BBCAF245C547BDE8DFA8ABCB54B01539A5 [email protected]
1,666,296,602 *AF5087D4F070DF9631B0BD44B92CD3A8E4DAA18A NOAHPERRENOUD
1,666,296,603 *AF58C478FC9D949F330A9D66AA168E3BB012F201 NOBLE.GINDHART
1,666,296,604 *AF56288E90491EDE2B497FF2F05FBDD7A6414123 noelgrandmaison
1,666,296,605 *AF5A8601430DE99F87F5AB3D3C33F2C8718C2C86 KEKEQIAO
1,666,296,606 *AF55B11FB333518F148BBA45E264ED37DB303FE7 kennithdamore
1,666,296,607 *AF5E3887D4850F8A3D9A4DDBE9F469F78ED0FC08 Nonclearance
1,666,296,608 *AF59BFD4AEB266BFAF2294F407DDE9656467AD36 NORMANC8
1,666,296,609 *AF5450819B954B14878931E389B52C9D9B67DABA KIÉRDEM
1,666,296,610 *AF524E8D7C1B55CE3F1C41A3115B41CFA506DD72 KIKWAME4
1,666,296,611 *AF5E9CF5DE033B3EC799C8AA85833095C819B00F NUGGETMONTANA
1,666,296,612 *AF5539D9D7CA3988FED9AEC885C9E58ECD815EE2 KOQI
1,666,296,613 *AF5EBA3A2CB700A7C6BC962365EE638A1A22885B KRIJSOHN
1,666,296,614 *AF57C9A1D82B3B13AD43F8291CD187E6A0D5B10B KRISTIANSON4
1,666,296,615 *AF581EF29AA09CA6B98FBB9D45934BC1FFA75A98 KUMEDŽIMĄ
1,666,296,616 *AF515E19160B8EAAE5BDF815CA07A71E3F67CF1F KWELDEN9
1,666,296,617 *AF5FCF7512239BA1F03F4DD070E73331A3850659 OLLIEKAKU
1,666,296,618 *AF50BB820B205557468126CA5F6C82E50B3DED73 LACY.HUCKSTEP
1,666,296,619 *AF556EAF065F8935DA7D3F30BBB7502634DA280F LAFOVET3
1,666,296,620 *AF5173F0EF2D3BBCE50E1631C53080C268FAF4A9 onolaksa
1,666,296,621 *AF52BDAD67D11A4708344309368130FCD6EA9A74 lamontkohlman
1,666,296,622 *AF57D67A93E4917AFE42A63F223B7B272665D34F (^_~)o~.o~qq
1,666,296,623 *AF5A4CFE11AA1A0D28A4BDB987460AAA1401D72E OU2G
1,666,296,624 *AF5FBB2E711759C299F48FB7961D3C5F88F48976 p###@~0 ~o }x{
1,666,296,625 *AF5F3335AD8872D5ADBB58EF72800A57AE9B8BF3 [email protected]
1,666,296,626 *AF5FE3D15243DB27A0CA6F229DA699AA16B8BE85 p8311960
1,666,296,627 *AF585C589E093141EEDD3E9D610CE6C089D2CD52 LEIFSANTOS
1,666,296,628 *AF57DFF5080CB80907ABA045AC6B2BD9171A3132 PALMER.KNABE
1,666,296,629 *AF59B2B566B0DF48AD3A12494BA66967110A9AC7 palminih5
1,666,296,630 *AF593A563EB27CD82CDB6D769BCA9E63B4D3CB06 LENANEO
1,666,296,631 *AF59737D96047C18357155E6967CE3B8B6E6421D LES-FETES-DE-POLYMNIE:-OUVERTURE
1,666,296,632 *AF5B7B4BDC95B1753E962200D3226CCA394E920D PATKOHLMAN
1,666,296,633 *AF5801376229DE2A8ACA2C3E46A6023454F4B134 paul.layer
1,666,296,634 *AF5CAB6887AF868D69EDD5075BEBA57166D1E740 [email protected]
1,666,296,635 *AF52A7507179B57BC68271B2435A5CFF8550D39A liberpensulo
1,666,296,636 *AF5CFDD8082860EBE5B6834866A250810CA1EDAB p------d-~-~(0_<)
1,666,296,637 *AF5DBB93D1F03CDE98F7894D5274FE48050CEF3C PERCHOUI7
1,666,296,638 *AF57336CA7F17AB579C32DF0EDF7CF9106C6D6DF LÍTIUMIONOK
1,666,296,639 *AF55C5A3CF5CD4C4585A6D592BFC4486D194AB93 pheacan9
1,666,296,640 *AF5CCE499F09DF72BCFC7A44882702D5CB480A16 [email protected]
1,666,296,641 *AF5D3568025BCBEB488DB15C42294A100D4A0BFE [email protected]@[email protected][email protected]
1,666,296,642 *AF563D582D09F7E6AB81F8812032363EA3F51D51 player-set
1,666,296,643 *AF531D94B8F311CA44E1D5BD6B91E1D31A67957C [email protected]
1,666,296,644 *AF537A9197EA631234BC8A6815FF5424B25A761E LTCQRUOY
1,666,296,645 *AF510C1A0AC902FA52D94E68DE5A7886A7D3C640 POLKULA2
1,666,296,646 *AF5180843A851F65625EA06DD2D384B7003E6E28 polyopsy1
1,666,296,647 *AF53E1F30E125C63EDF8788DFF4946EEBF753E99 POR.TU.AMOR
1,666,296,648 *AF5193DA59BF2D5A9B14F0D2D01C65B3AB187A2F pP.~0)X(
1,666,296,649 *AF5A2D49F360EE35D36C09037E09D033C4E396CB p#####p~-~-)8(
1,666,296,650 *AF54770AC48B055801079D123FA89767B825FCDF PTVALETTE
1,666,296,651 *AF581417CA12DDC8D8CE1CF9E4029BA84F8BC4ED PUSPA-KATWAL
1,666,296,652 *AF5CA48EF75948B11181750C21F5B5711D5B6FCF pvvddxykolkp
1,666,296,653 *AF5F3587067A2F7EA7871CFA6DB6B170CF3B80C1 qd ~0 )0(
1,666,296,654 *AF51CBE62DEBE5716DA08BD65CE4EC49803032BE [email protected]
1,666,296,655 *AF50F6AAAB690366C605FEC1755BA00C22382664 LVIV'-'LVIV
1,666,296,656 *AF5FD06CDD24BB91EC52041165C696EFD8A69D8F [email protected]
1,666,296,657 *AF591C07EB259B89B912332A7F8E22AC58C0C48C MAGIC (FEAT. JADE)
1,666,296,658 *AF5BDC25D0DC1A5CCE1A0C4E9062FC96BF51F27F MARCELINOFAULKNEN
1,666,296,659 *AF571348FCC864F877A6E98E5D1E2751DEC99A93 RAYMONGARCES
1,666,296,660 *AF53E5A3EEC1BD87A71DBFB5C2D80D9A9A8E0559 MARIALOURDESVALDEZ
1,666,296,661 *AF54ED953D2127233D0A3795780F8C6353BE8068 marjorie-osterlund
1,666,296,662 *AF5C282FB80FE7BCF8BEE4216B25FCC823048CA8 MARQUIS.VERIATO
1,666,296,663 *AF5A0F77996505AB2EB3D6AF093F074560BCCA6F REDEEMLESSE1
1,666,296,664 *AF59E5019D4399796B2349DB7AF0B5F1102E0780 rednuhtborhtgnola
1,666,296,665 *AF52E350461A7C0C9ED0DE524386BFDF92F7F039 REED.KIRSCHMAN
1,666,296,666 *AF5964207E5B09FBAB9F2CD3E9E340A39A096054 martinsperlich
1,666,296,667 *AF5862EDF7883F219C0E33131DADC0DF90943FEF MASHTOLER
1,666,296,668 *AF5BF438C4034588D6E8A8FB395A13D9E976D320 masonhanten
1,666,296,669 *AF53F40C7699B1F872986711AD17879D59126FA8 mattie560
1,666,296,670 *AF5DD81E53BD05D97BC6F929E87181ABFCBCF616 renaldomatthey
1,666,296,671 *AF59B87B0D66CE3E79EC680AECDED57732490D22 RENE.BOROM
1,666,296,672 *AF5AACF4A840EF29ABAC5AF2CF61AE88130E9A27 medianum
1,666,296,673 *AF526BB1F30264179330D5B98AAD8CE11FC06D82 MELVINMEMO
1,666,296,674 *AF52BD7F392F25F75AFC10F692649AD0A86132E4 RFTOAAAAMAAJ
1,666,296,675 *AF5EBB675352C7D09C01C9366C7FDEB8B590ED92 RHILEYS3
1,666,296,676 *AF5C66C536FB0AC923C401DDD6D892C603768694 RICHARD.ROCHOW
1,666,296,677 *AF5B67DC5C47DEA7C8AF64ED62C48DD6B86EC1D9 richiekolaga
1,666,296,678 *AF5867389C229345C9A9571EB5CE18FDC01AD800 MEN+RE
1,666,296,679 *AF58FB6224B0AEBC6DAA2D5C8406E6D7B517D716 merlin.tpci.com.ina143.23.25.9
1,666,296,680 *AF5CB9BE2655FE62B10BACA0AB16281587868EF0 MESSENGER-OF-THE-UW
1,666,296,681 *AF54E67E8B2CE541939B0BBE6AE0E0C7538897B7 rileyd
1,666,296,682 *AF5AAE407C1A9C14695C8B4573E7CA8662ECC9EA MÉZAREK
1,666,296,683 *AF5D68C4DD445CBB45E1452527E049C2204DE5AC ROBINTURTLE0
1,666,296,684 *AF583BA240BCBA9D307782E8D8486F8FD8AAD4A9 RODOLFOBONDER
1,666,296,685 *AF5F425A1C3CD3348AEDB2835163577F721AD3FB ROGER.PESCHONG
1,666,296,686 *AF58452A815457ACE65DDE02CAEDB56984C36EEA ROLANDO.MAHOMLY
1,666,296,687 *AF517EE01F25FDB610599D3635A6657DDA61DC85 RONALDLOESER
1,666,296,688 *AF516BEB2D0CECE45660489084DCEA45415415AF RORUSSELL
1,666,296,689 *AF58346E5054F3DDD7084B36B516F69D5F03E407 MIKE.BANK
1,666,296,690 *AF5ACACE5EFCCE5BFCDE4823CE671645613D63EF ROSS.CHILDRESS
1,666,296,691 *AF58506874AA1E4F0A27C6A0A1169F6899829F29 ROXYDOCTOR6
1,666,296,692 *AF58FD8B5113724FF371D8C0B97FF3876CBC846B RPNGCWBY
1,666,296,693 *AF5CD171CB426D1DEFD1DF3B11AE71DE2490794B RRKG
1,666,296,694 *AF5F11AF5C023BD5C622B48FDA65B2C0892A5657 RUFUSKENNISON
1,666,296,695 *AF5CE6F1D5CA57CB709ABE0B12DBCA68988C9C96 runner109
1,666,296,696 *AF5C7016019219C8D375563E9A2546327D4D4EC5 miriammiramarmoura
1,666,296,697 *AF5A23AA4B891F95EA6B939EDA5044B71F0D2AC6 miscreanttracking
1,666,296,698 *AF5CB4AE42900786D7A4985D25735AB57532A3C2 RylandDavies
1,666,296,699 *AF5E69045E06CCB7448FADCE4E6373EEF74EF328 [email protected]
1,666,296,700 *AF5CF7280F7A247006E635CCD41844E1C8E8339C S76900
1,666,296,701 *AF588520A39197DD845C7842BEEDDFEDEC218115 [email protected][email protected]
1,666,296,702 *AF55498916F2D642888068DF0170731AD7BE1C9B salvadorchicles
1,666,296,703 *AF569621E9ECC0F18A5F871A606D40775DD5A1D0 MOISESBONE
1,666,296,704 *AF5892AF71239BD1727C2EC926125ED3F33D30BA momkoko8
1,666,296,705 *AF563D32C0843D62503CFA4D1A50B867C75FA215 samualdennett
1,666,296,706 *AF56CF5447BA23D6C709A0B3D65E2DFFA87529A5 [email protected]
1,666,296,707 *AF5C43DB9A47982539D9CA93ACEEBCB3DD3C3A58 SANDBINDER
1,666,296,708 *AF59A40F5C68B2401B94F06CABE1966DFD3A05B2 MOZILLALINKS
1,666,296,709 *AF504610EF5F8AB073E787CB0C7384C0A1FE132D [email protected]
1,666,296,710 *AF565ABA9CA2E6A034211D77878F1335047F64FB SCHAHERSING
1,666,296,711 *AF564A13E5E313F13B07B67BE2AF07BAC16FD8F7 nahrupi3
1,666,296,712 *AF560066DC972D1CAF4A507BB99B4AE7B0A7133C SELFACTINAS
1,666,296,713 *AF5A396C4684AC0BECE9014788A2A7925F99B454 NASHVILLEVOLSCAPLOGO
1,666,296,714 *AF5369A83FB290CE265F07932918ADE6172E0F41 [email protected]
1,666,296,715 *AF510790D9DEB6C05E0A3D2D8E5A42D01DEFFB2B SEMIVITR0
1,666,296,716 *AF52045E09AE9D135DE3F7D99AAEC1DA573DB9E9 NATOLINS
1,666,296,717 *AF5874BA74A9B83DE4C9549B6C1C29D060D12524 SEPTIES2
1,666,296,718 *AF54EE67C935D2B30F887A9DBE138C85603D96C8 NEILSTRYDOM
1,666,296,719 *AF502F9EA8215DDBB2E890A88B3464FAF419197E NELSONJOHN1
1,666,296,720 *AF5C25E41A0B3A9841BC7EF26EB732FA65321ECF NFANZO
1,666,296,721 *AF53A90A2A4092802BE55EBA15CAD7F9D31854F5 nhikute13500
1,666,296,722 *AF5F50B7E74FFCD982A3EE703B7CF9DF3AD29231 NIRAKARANA
1,666,296,723 *AF532DFDFB9F68A9A9296DF8695ACEE147018D04 nnbnfcd3
1,666,296,724 *AF5D124B2341BAEA77AB5D5F48724E8B860291AE NORBERTO.SIMONCINI
1,666,296,725 *AF511D7EDC036BB3124A1F59618F30ADA445A8EF [email protected]
1,666,296,726 *AF5A9CBD804364748AA507A29C26F9D305671A12 nwnetas5
1,666,296,727 *AF5A5E440AA3EFFC1D8FA449D9FCABE473E7399A shawnnahall
1,666,296,728 *AF5D46536A283538FA9FD6FE3C6A0B4389CAA7E3 ӯBRO
1,666,296,729 *AF565DCA4F464DC7D7CA7EA5DFD667A812DCC5F9 ODSUWAC3
1,666,296,730 *AF543291599F7AA131EEB579E5E479267C75DDA5 SHYRIAYIVSKYI
1,666,296,731 *AF5D9289A8C7AEE26E332518DD8D9F39BAFA33C7 orbitary9
1,666,296,732 *AF5BF507969E50630EE3124D35538926B885E7AD ORVILLEHEMON
1,666,296,733 *AF58B59C7A722A324297C6F8FF40E7C030070E68 OSCAR158
1,666,296,734 *AF5090F62CE7F7105E4E9B5DD19944066CBA1FE7 OUDNESS123
1,666,296,735 *AF542F925C1A709D9FF402C5D89D6032DF232110 ourladyofsorrows-saorgwww
1,666,296,736 *AF51C0DF6301135E11EC65E32B4D861BDE684B1A OXFORD U PRESS
1,666,296,737 *AF56408A1A87FEBC124833DDCEB216B05DD42652 SLARVOTTAR
1,666,296,738 *AF5C9F5A429684CB8CD279A0EA21B58C696A69ED SNSKRTZ3
1,666,296,739 *AF5BE86F550C48F8EF50585F86C18637D8DB8C64 [email protected]
1,666,296,740 *AF56C23D3A5E5B168A01E2E87F6D11E795D71141 SOOLOLEVYÄ
1,666,296,741 *AF562673C53AE8E7830A93C16015EC85208D9FF8 SO STRONG (VANDALISM REMIX) (FEAT DINO)
1,666,296,742 *AF5D88E63B4F555C5875C8E33156D80D42DBB419 [email protected]
1,666,296,743 *AF50EA8722461941EB13DFD9212DF9710020BB52 PERTROGLIFE
1,666,296,744 *AF59DA51229515B278C87A9C3F815D523E58E0CF [email protected]
1,666,296,745 *AF56F69004843B2486F2D168497C171A93C6BF58 SPARTYCH
1,666,296,746 *AF5D54BFE863586B5CC8A10B76866936659C418D PETERJANE
1,666,296,747 *AF5A2DB987FF317F44F625D5E9C0DD5D00B13736 phrenolog1$7
1,666,296,748 *AF55329C923A374F9AAFA1E18A177D4C10F5112C SPORESNCINIHGOV
1,666,296,749 *AF507ABAE3920C823A8319CECA98AFEA0A725410 pin-skeeling-(disc-1)
1,666,296,750 *AF5DE548F46B42F70D4DFC863730D51D0E22558C piyeta
1,666,296,751 *AF567A944A0463E1ABE4E707C9BDCF665A1BA064 SPRINGBABIES
1,666,296,752 *AF55390797F5F214A9BE12D886A7BEABDD037484 PMACOLET
1,666,296,753 *AF5D0691C18C2A6BD5C1A828B11C6D3E3DF4BEE0 P######)~O;)
1,666,296,754 *AF52AB50865CB869A7BBEA9309D0C5CB4DE561CE STACEY.SHALL
1,666,296,755 *AF5F3EB1D74FB222F85901F78C97270CCC0403D0 PONTINGDELIVERSAWARNING
1,666,296,756 *AF5EB8015ED7D83022BB989CCF2229CD1B9CE52A POPOSTCODES
1,666,296,757 *AF57E90BEE59E9C0B4ABCD0FA049AAAF76BD7853 stansstad
1,666,296,758 *AF5487CF26C84E48624E0164CC1E197FD4C108FF p######p`~(o_-)
1,666,296,759 *AF599905A38CD4B3F5D7765057A378CE56EEF07B STEVERG!
1,666,296,760 *AF5442BE22B6BEBD790001D07DAD0DE28FCFBC34 stithly6
1,666,296,761 *AF5D3CF67D517C0284BB81ECC6BB0D3B63103703 STRINGWOOD
1,666,296,762 *AF536D9525686B9E596DE8DE442783323C76EE8A pt]p
1,666,296,763 *AF569E74E92BF3258EF3FE068DAF540C32182AF2 q#####@ ~O~o o><
1,666,296,764 *AF5A2EBF812D8084CE7FC0723904498FE99B1FDB q==p`~.`~(>_0)
1,666,296,765 *AF503CE78416ED22A2B5D781950B98A3D7F5047E [email protected]
1,666,296,766 *AF549971D182573ABFF23B1E7D047237106F5790 queistovaiparar
1,666,296,767 *AF52DE44E6FA432A0F49F2AC84A001A7D5C43297 RADIOBILERNES
1,666,296,768 *AF50607094B1AECA36135359BCF63768871E0685 SUKOZNAN0
1,666,296,769 *AF505EAFCF5068148B3D9A6FD6367A27897AB2C9 summer 72
1,666,296,770 *AF571196C0D081E4F81992EB2C64A94537BBFC27 RAJKIRAN-BIRADAR
1,666,296,771 *AF5EDB9251B6B40CF06778855F6B6A8202A51FBB svwz
1,666,296,772 *AF5B4C434AE2848FD5F25C494422726EEB8DA718 SYMMETROY1
1,666,296,773 *AF53664FF897A3FC05353993BE9A8BE85D19D36B SYMPHONYNO9INEMINOROP951ADAGIO-ALLEGROMOLTO
1,666,296,774 *AF5C1BA6AD76BDE2DB683EE1B8F705BC9F679283 TAMQ
1,666,296,775 *AF5326480158026B0803D3756A595443425FEBE4 TAYLORMONACO
1,666,296,776 *AF51407FBA2D9C810B4AB32A8A14E3E68CAA1066 TEAMCAPE
1,666,296,777 *AF5A1976BA8508ADCBADB43A52495CE8BC98BE80 reinaldowadlinger
1,666,296,778 *AF5E6CD72A4CDB5ED54F0CDDF47A5B538DB38C07 REISINGA9
1,666,296,779 *AF50A4760BA2DBEE61308F6B4551E8BF903252F3 TEMPESTHARROWED0
1,666,296,780 *AF5AF157757F0253239A7F0ADF3F644DD063C6D8 [email protected]
1,666,296,781 *AF55FF34C091691DAA458BEDCDFCD4237CA73897 RETNORKE6
1,666,296,782 *AF5201B5A72C5CCB748C1E03BC473651EF190A5E returar0
1,666,296,783 *AF5ED8DBE688265D7F4750F688A1A848ED1274E2 TETBUARHCS
1,666,296,784 *AF5E825E7A1F17A131255661E5302DFEB78F88CE THATNORIKO666
1,666,296,785 *AF5F5AE1652010A7D0FB57B5157FD608316792CF ritual-of-the-human-sacrifice
1,666,296,786 *AF5828D23BF42D864A14DCEDBE2AD0FC63FDE199 RODARNOSEMOS
1,666,296,787 *AF51DE35D03CFD5F58A9B4B314471D354BB654D6 The-Face-of-Paris
1,666,296,788 *AF5F7C3030EA1768BDFBA60813E8B29373723F73 [email protected]
1,666,296,789 *AF56F5BB1816037432770F721C7F2B90D855460A ROLANDO.METZKER
1,666,296,790 *AF5EB16BDF22C442067EDBA3FD813E0E914A8F1E THEMARY15
1,666,296,791 *AF50063F15D3FDB74A1DEE2A55DCE7CC510F5E1C the.pills.would.ease.the.pain.
1,666,296,792 *AF586003BE047F8473504C12FACF12152A6760EA roqegtj5
1,666,296,793 *AF52F9CB23744DC9020163D1D88FECFCC4979309 rosskieler
1,666,296,794 *AF51CFCADADC229B528EBFDBCC0584A343D90503 roxasxy
1,666,296,795 *AF56E4137811F72AA0D1E4D7BDC914A97950618D TIDSAVHE1
1,666,296,796 *AF54C6A3086EED4DA6260D584E1D607DA1FDBA32 TIMELINEVICTORIAN
1,666,296,797 *AF5FCE25D17308542FAF927ED1624AD7CAF9B188 s4lesr00ms
1,666,296,798 *AF544AA0F0456B5972B269E6E63F287E8AEEE9F3 tnemedocne
1,666,296,799 *AF5AE5E78B00BBC68E0037985566AC52606FD55B SALVATORE.VAL
1,666,296,800 *AF576893AE9F2ACDA2207E20CB8E2670EDC3B961 TOIMEKSISAANEENAS
1,666,296,801 *AF50B3FB5E55CA8756E8E028BDD2B1C5F67BFE1F tommienewstrom
1,666,296,802 *AF5C8C7A60BEC89C17D44BAD100815D13E338E1D SANDYCROOKS
1,666,296,803 *AF5B0CEB8CAA67AB249752BDEB8ED274D43CEEEC SARATOGAN4
1,666,296,804 *AF598574443ABA287BF9C5D06967AE3EEAE0C254 SAVVAS-KYRIAKIDIS
1,666,296,805 *AF56728EF502C80A612685A8E0A3C6161783AAE9 traudeldavignon
1,666,296,806 *AF575E0FB73935E93F028D51761BCF19261FA968 tseiepom0
1,666,296,807 *AF532226048F08484076A30120C17F6AFB3F8E6D sedū́nų
1,666,296,808 *AF5CE8CEE4EC7ADA08634A67D0A0963E338BD99F SELSKABERS1
1,666,296,809 *AF59171E350D7D8F99530DE171CB3A9FA74FC8E3 semifriable
1,666,296,810 *AF596A58B482087C987E1EF1D8277FA195F5F821 TUFFY-FIRST
1,666,296,811 *AF504FD300C64F8C7A61B462A0F58D94491169A4 TULPEN UND NARZISSEN
1,666,296,812 *AF506D349FAC3E6BD00FE9CD11857B2A83C04E9F SEVISSIMED
1,666,296,813 *AF518A7ABB4FF23E1DA8CCA8A640BC58E51622CB [email protected]
1,666,296,814 *AF538BB5FE5624AF9DE5BB718696952A853B3610 SEYALBMER4
1,666,296,815 *AF5011D2A5FF53D6163C263047EC664339B11AD5 SEYRAMFORSON
1,666,296,816 *AF59AD7A3826831A68DC8051EB1DF314C739008C shadlangelier
1,666,296,817 *AF50AE3D25C87390AAD113057449EA99FC73041D TYRENE.LUTHER
1,666,296,818 *AF5DAC0C171EA84748E4B5FB7EC9C517AAEB2BB3 tyronesumners
1,666,296,819 *AF5504E0619D6F38EFE64DB6759E7D4C3656B64C shalier
1,666,296,820 *AF51599DD969210EEA2138B12BE197ED6E40C4DD shanna.nelson
1,666,296,821 *AF587DB94DFB263F301D8E5618A0053577D2C35E UBERQUERENDEN
1,666,296,822 *AF50D08727C8D4D1A881EDD4BDCCBE18BAA2B982 sharathbindhu
1,666,296,823 *AF54101E575F926B0738C44B4D956579AADAC04F SHAWNHOUSTON5
1,666,296,824 *AF5C967E8760F2A968B96DAB2A10F92045E50B7E UNCIRCUMCISEDCHIDOM
1,666,296,825 *AF532B9B0BEED893D3DF66BDFB83A7AA2E56F429 UNCLOUDED.
1,666,296,826 *AF5778979C50DD867425835C34751622869EF61D UOSAMEDE
1,666,296,827 *AF5F273F2538F9B4502B6207EBF095B93929E405 UPH3A1
1,666,296,828 *AF56FAA70A7091DA6A333513AAD151D1559B30F2 UROCOPTIS!
1,666,296,829 *AF50CACC3FFEFAFA72FE3E8568A85480B0650BA7 us-forces
1,666,296,830 *AF5912FE3B45AF58E486B464E0C0DBF6CE85511D SHOONTRAKOOL
1,666,296,831 *AF52AB90EDA9800C0E48991DCF7D6EF48EF7A576 SHREECHAVAN
1,666,296,832 *AF58B083E6ECC9F19C1566017DAB64C5B835B910 VALENTINEPOLASKI
1,666,296,833 *AF5BAAB0DBCD05C40596164B15D53CF4E9FCB31A SILLACACA4
1,666,296,834 *AF5A969401753B59EE0F6FC968BE7BA54A56EAD5 SILVERDRUMS5
1,666,296,835 *AF5E5A6B00486B4765BFFF08E0FAC57D8D0436D7 VANESSA.LYN.TACBAD
1,666,296,836 *AF5FD6675300629F8B97B029E9F1E73AE781B3DD sipelstein(2)--s-ih1-p-ah0-l-s-t-iy0-n
1,666,296,837 *AF53C689BAAAF8D70CD7894E0307C4E81B82FDC8 vann-vun
1,666,296,838 *AF5C329271E3B3A2684D97C8BBB93D258BD40581 VARTIKAPANGASA
1,666,296,839 *AF5793EB5A08A79FD368038A4CB0CE50A101693A vennligh1
1,666,296,840 *AF52673CC1BD9796A23AFF1FE0093A2E5803092C victorllera
1,666,296,841 *AF54BFD3523ABDBD368D7CA857FCF6181B75F771 SOLEILANDIES
1,666,296,842 *AF59F6D32923DB33E0792497B0D90D674FE737DF sondierspitzen
1,666,296,843 *AF53B99925E289E206757DD761AE37083640D824 VITO.MORICE
1,666,296,844 *AF50A5C1D2A871B5362AA85E07C0393331E5AA1A vivian.nunn
1,666,296,845 *AF5373485B87FE1D78AB20EBC643526D11F3CBE0 VLADPIRKOVIC
1,666,296,846 *AF5C5FEA8341D06C91806E62A050E018BC0AD0FA [email protected]
1,666,296,847 *AF5D02AB7A7B952584664F4A34515378B73BF599 vyllacitamorhconom
1,666,296,848 *AF59535AB0FC836BC68316E68638D21C53666332 [email protected]
1,666,296,849 *AF57E0133779ACB8B456580AB7D5A3039669A74E 『soradiencce』を立ち上げ、同レーベル第一弾作品として
1,666,296,850 *AF5C710ECCDBE6870F00E491F24CC3C910D0EE3E SPRITERACING1
1,666,296,851 *AF51531AC081AB66D99847202E4A5E84B323B56E [email protected]
1,666,296,852 *AF52DF65E5086CA980C67BB553DC07D2BF811CA0 SSENNIUGYRREJ
1,666,296,853 *AF5568D14F29600A29EE0F4D5ED8DA6B7B96C81D STABBEURFOUORG
1,666,296,854 *AF57893F514BB4FB5C6CE7AB824699944EC73841 stacey-bolden
1,666,296,855 *AF591FA49627EF512C281EC5A7CFDCB323C23DB5 whitneycozzone
1,666,296,856 *AF56D96FDCA9F4CDEBA9094B4CC89F5509BB41CE STARKENDER!
1,666,296,857 *AF5B535915BBC0989695BF530AF37230EDB2ECF9 WILBER.FUSNER
1,666,296,858 *AF54C3ACE0A06BC907F119F09AE79F48908EC2AF WILFREDOZIZZO
1,666,296,859 *AF5C5A801E83D12E608AC1A9E52CF0DE8821929A wilfredracanelli
1,666,296,860 *AF5E009A885C244E97D4A10EF0F185CD87198617 WILLARD.NICI
1,666,296,861 *AF5076773D6A5B926A6B330B3A6A2612FAD6EF68 stekkertjes
1,666,296,862 *AF50621FF00EB5643659598A82CD43A5284D9760 stephenreimold
1,666,296,863 *AF5A8D6A43248B37FD02073D402C3D57E1ABBC03 WILLIAN.JACKLIN
1,666,296,864 *AF5EBF9B441D7F7E5330AA2F5250F65363BCD98B WILLOW BOWLING CENTER
1,666,296,865 *AF54FCA60A4BCD966A9701639674E68BCF62FCF6 STEWART.TROUT
1,666,296,866 *AF569A4ACEEA7FF8C7D9FB85D79BC3B256747403 wiltongoswami
1,666,296,867 *AF510FB0EC78DD6A3CF521095A25F8FD0A3ECE65 stiiliparanduste
1,666,296,868 *AF521B79F77B4A18A342367315D284D1C03021F2 [email protected]
1,666,296,869 *AF5DCF33A006D65B68F3FDA10E255AD95BC536DE WISPDIRECTORY
1,666,296,870 *AF5EAB941BEAAB08BE4936A8295BD6289E7F73D4 SUCCESSMONICA2
1,666,296,871 *AF52D4785577663B9A1558D1511A39B7B4CA4033 WOODEN-HOME
1,666,296,872 *AF5D5346CDDE18C4B6D893532E6BE3E6B7AFC330 SURESH CHANDRA PANT
1,666,296,873 *AF5149F8AB03D48F4AA152E7C8BA035421B41EFC wprediruses
1,666,296,874 *AF55DE8D2A68B67489E6CE473C38AD1383E61651 w"uy
1,666,296,875 *AF58424ACB6D27B23F7E1BE626BBFC1681E89106 SUZZAINE3
1,666,296,876 *AF53E80FF06CBC0B7141DF8BF154E5AD6A9F6B8F wwwop97k12ilus
1,666,296,877 *AF54356A475D7B30A88E6CC4F70F881D412702E8 swift90
1,666,296,878 *AF5B2FFBC69EFC96511EEA95B3F4083FC7400A68 Xb+
1,666,296,879 *AF5D53F78F81E64DAF1BD6AEF96E55241BB0BA84 SZEPESTAMÁSFÁN
1,666,296,880 *AF5A2E3D5C3D301D8765DB68DBCE35127BAEEE55 XRPKGSMHGZ
1,666,296,881 *AF5673A8B4ED455EE06972BAEF45A5B7C3C7BAC2 [email protected]
1,666,296,882 *AF5D65E5EE9A8B37F94993B2CD61EE1668C92B1B TALKVIVI
1,666,296,883 *AF5125EA65F0DE038A1B74AF721A7AEB9C57A703 TALLMASTER
1,666,296,884 *AF5E5FF766A1FD1E8FA2AB1F7B8203405D451D78 TELEPHONIST1
1,666,296,885 *AF5C4A4D7549C496287E1EC86ABFA659EB638610 [email protected]
1,666,296,886 *AF51455868D6C6EE9BE81350AA28FD73367EE528 youngchalla
1,666,296,887 *AF53261A6C6A59E405E4388DF442984CCC66D57E YSORETEH
1,666,296,888 *AF580A76C53E3EB637158E32923833331C8F8563 THAT GIRL IS A MONSTER
1,666,296,889 *AF579D57E22B5984A73B0B26D2B55969C282E8A6 ZACKHAUCK
1,666,296,890 *AF541FBEF2B9DA702249139290692B1293A765C4 THE.FOUR.ELEMENTS:.FIRE.(DISC.2)
1,666,296,891 *AF5247F9E4E89EB4A0A8241AACB32995B016E836 The-Goddess-Principle
1,666,296,892 *AF5A5F46BD549CA0D651098DC3773AA2AEF5F12D The HiFi Live
1,666,296,893 *AF59D64E5DF50C69DC1F6438AA0313D38C63D4BC ZANE-SHEAFFER
1,666,296,894 *AF5F161821AD2745D3170A07BB20CF2C3BAECE11 ZEIIFINA1
1,666,296,895 *AF5A8D1898AB39B9D309A7849B388392488CC26E TheNun'sLitany(alternatevocalversion)
1,666,296,896 *AF53E99F2052EAC8F12CF7E82A09689FC91699E5 [email protected]
1,666,296,897 *AF5D46809CD168DF164AFACB4457A05C891CA7FD zenobiafourie
1,666,296,898 *AF58A8069FB29C8D0A74484F9D05F0155A737838 there's.a.music.(reaching.out)
1,666,296,899 *AF571ABCC267F2636EDBEC3154E1EC2EBAE8242F THETHUNDERBIRD32
1,666,296,900 *AF54CF4DFF0B635ECC567DA52FD0F212B7C6A123 [email protected]
1,666,296,901 *AF5000159271F7C087ADBB46301042BFF085E85B zlatko-postolov
1,666,296,902 *AF5B2D850B45BEEBA8A570240A04F8B0C4A58EB3 ZLD4
1,666,296,903 *AF5295C1F6102EE7C1A52A787B325D024E40066A They're-Coming-to-Take-Me-Away-Ha-Haa!
1,666,296,904 *AF517D84C9C88866CF404704997B8AE679EA6C28 thomascromedy
1,666,296,905 *AF5330120668011B1C79799478BA4E94A42BC65E THOMAS-NOAKES
1,666,296,906 *AF50F4B9816B4512F69D0A2FCEAF5012A31B4288 TI110KKED
1,666,296,907 *AF5D01E08D9D6BDA377796533CF8A1DDB3B4B981 TKSTRRNGN
1,666,296,908 *AF512DBC5FCC3504C6FCC81F212B1A2A899D5A60 TNAEGRUED
1,666,296,909 *AF5F0615BF961F1749DA90E28B28D6C5D148D2E5 to.advice,.impervious.to.reason;.crotchety.&c..608.
1,666,296,910 *AF56E5D2D365987B7219C63540F5FC14DE5C75A4 TOMJONESSHOW
1,666,296,911 *AF5A7B5E2F4AE374B98C7A195CB08446A118B181 TORTURANT
1,666,296,912 *AF50BC0BEFF436D4D5241B54BA2DB81922248629 TRACEYWARSHAM
1,666,296,913 *AF509DB0645F39A69DEF9F5E06C2E2F4F4EE667C TRACK)模式
1,666,296,914 *AF5595FB9FEBA9673DF118CB4EBD13696C7F68FA TRAVISPHILLIPPED
1,666,296,915 *AF57A4FD1B356F1200B21E92F5D324EC9C14989B TREELANG
1,666,296,916 *AF55079FD83F3182EF75BA48C0D3F0FE2BDD7CC9 TRISTAN.RAPISURA
1,666,296,917 *AF5D1250A2CDF7C2BFDF407E08DF77ED1D7CEAB0 trucial 'tr/u//s//@/l
1,666,296,918 *AF5DAB48759D3F614659E9880501FA5616F007E7 TSAGABTEREFE
1,666,296,919 *AF559566C6A13AE291F4EB202E3DF2763D1ACD2C TUORETTING
1,666,296,920 *AF518C934F79B8853F180E672F829783A8A22DB3 TYREE.GIACONE
1,666,296,921 *AF512FB8E7693987624C213BE36637CB5F49B91D TYREESCHNAKENBERG
1,666,296,922 *AF5161A839800EBD4DB52F413D8B5B557EB69CC1 [email protected]
1,666,296,923 *AF5615ADA0944E25D1B8BC462016D539D433EF41 UIOWA.EDUWWW
1,666,296,924 *AF5646D7E4875A6893A7AA394D1644D16E1D1CD1 UMEKICHI5
1,666,296,925 *AF5F6276D83B6C3101B01FC2DE638F0F06B3FEB1 uno-entre-mil
1,666,296,926 *AF56C578ACA1994B602FEC74C970B98C75DC26F8 UNUNITABLENESS1234
1,666,296,927 *AF5368B78DC5374493FCB731C0DA005B634C5192 UPROCKBIDDY09
1,666,296,928 *AF58F560ED967C132670367E8A1BEF64E9BFDB14 urtebnhall
1,666,296,929 *AF53916C1A34C7F17F8891B65D92C60F29E53636 USUARIOKURSON
1,666,296,930 *AF51962FCD818ECEA1E8E062FBCB25B726C19B00 (0-0)`(##b
1,666,296,931 *AF571831782DC51320F6073DEE3FEDE2D4435E52 VALLGOSSENS
1,666,296,932 *AF5CBFB1353D11D5920C23D15A625395472A6E3C vandamasing
1,666,296,933 *AF5B90D51CD97AE7F342D26CCC3BA6FB941DD335 1008604 ELINA.LAIHO.RAKKAUS.SATTUU.NUORENAKIN.TURUSSA.PERHEV
1,666,296,934 *AF56D8DE94B859F14313E3EC7690B107B1F00F3E 1075174 JOSYKSINOSAPUUTTUUTAIONV
1,666,296,935 *AF593DADABC0741868806188F2AC35745B1AA4DE V&}E
1,666,296,936 *AF5D3634D39B3A1C4BE430766B6CDE5F4861595A 12:.12..#..&...GULLY
1,666,296,937 *AF54A4DCEED350B2C67BEED5585A963ACFCDBE2F VERMONT59
1,666,296,938 *AF5E814AF8783840133C2C6E575BC869ECA493A8 VERNON B REED
1,666,296,939 *AF5ECF796E6261270D6965665F1E79A00E9E9662 14111661
1,666,296,940 *AF5502AAC84B437CAA6ADE59D710992A2E8CACB4 victoria.fowler.haney
1,666,296,941 *AF57090CDA07D5DFB0BBEA9C4B5E3A3F949BB545 1824643 KIRJA-ON-KOKONAISUUTENA-ONGELMALLINEN-
1,666,296,942 *AF5AE98EB51054EBC821B013E994D938B65485DA 1896605 der-einfluss-des-jupiters-ist-noch-geringer-.
1,666,296,943 *AF5FFEA3C194C1554F6E8C89D32D48F27B896207 viktor.zadoyanchuk
1,666,296,944 *AF5C2CB174652FC27BDF96CCBFB243652B1BAA93 VON.SALLER
1,666,296,945 *AF5A7A44E56EBC588DDF027219F2D6B734F74C06 VOPHIABO1
1,666,296,946 *AF583225812DB3DADEF8B8671C765DACFED06657 VOSTSTOI
1,666,296,947 *AF59A00EC2D2482222D13C2AA37B06324D348BEF VRUBOVAT4
1,666,296,948 *AF55B72E005FBC42B4E6CD7423C93E125484EDD2 *W5~
1,666,296,949 *AF52EC4B052E3B908060D182168CE6E4E1A79FFE WABX.NET
1,666,296,950 *AF5A2E8A1F7E09776EF4F9B4505A552A5CCD3DF8 1911336 toivonkin , ett
1,666,296,951 *AF53B8E4ED837E6754CE49226064DAFD03D23489 WALKERBRODFUEHRER
1,666,296,952 *AF5A12D579EDE47226E4CD3EC1423CFF5140C8A0 [email protected]
1,666,296,953 *AF53038F400E91090589BA19C62EE970551F6317 1ANTIGEENI-SPESIFISEN
1,666,296,954 *AF5301A65ACC3DA51FEA8DBC5E7E03D8FF2DA658 [email protected]
1,666,296,955 *AF5271C7EB5A357B9BF23D69B1F430FA15101CCB [email protected]
1,666,296,956 *AF56D54D128CFEABFB738549CA595965EA79DD47 1-BROWSERILLA
1,666,296,957 *AF5FB17CF54A75A2347DEA21A09F3C6E44CAC27F WARRENLEONARDI
1,666,296,958 *AF5F6B601C0EFAB17097F0D637FC460B204749B5 1ELINKEINOYHTI
1,666,296,959 *AF53992908081755AC8A0833363AD7E6AC81ACA7 1 GOLFSANASTOA
1,666,296,960 *AF541AAE87AFDA25CCF82BAE9CFDF1CDE7734CD4 1 HIIHTOM
1,666,296,961 *AF501912F3FCC1841BE445CF16BAF35A926F43E2 1ILUVTAB7
1,666,296,962 *AF509925C7CDE5EF3F95AD0CE6EACE485B987C17 [email protected]
1,666,296,963 *AF53E1A0584109783C9A3EC90B32154EA4AF6F69 1.KDU-CSL:
1,666,296,964 *AF55A40F174B509F21DD5D6DE938714F024FA6F9 1.koksunum
1,666,296,965 *AF51815F7FD8B7292F00F990D910209BB25C849E 1.MGAS
1,666,296,966 *AF55C055E7D19F10891ED130E94B570BBF0D0032 1NV3S719474BL3
1,666,296,967 *AF5B98AEE0F57FF05D418377EDA120E16AA5B14E 1-poikastuotantoalue
1,666,296,968 *AF5DED63140D57D5A0FB0908E52D0D5D0CBAE8A1 1.porak
1,666,296,969 *AF54283D39F47EB12BBD3758D8411BC5C12DB26F 1-rakenteeseeen
1,666,296,970 *AF5E637105FBEA31D7DB9A903C1025B9FFDB9C77 whatilikethemostaboutyouisyourgirlfiend
1,666,296,971 *AF5F1048C3599B06ADE5CF165169D236D0ABAECE whitney.jones.houser
1,666,296,972 *AF5F4995BCA9B42E0467B081DD513611682E04E1 1.sinhalesen
1,666,296,973 *AF582B5D64F9FE24BD9A2D98B66745B37A630047 1USKONNONOPETUSTUNNEILLA
1,666,296,974 *AF5CDBB85DE889E0C6B7D746910667DE696D5CAF 1.UUDELLEENAJON
1,666,296,975 *AF54DC7A9C61733B65555384383FF0C4F4C604B9 1-UZAKLASTIRILAMAZLAR
1,666,296,976 *AF579171AEA243801A014C8F01F2424BDFFBE41F 1.VANHAEUROOPPALAISTEN
1,666,296,977 *AF58ED80C30CD32815AF63C51A371FC769BDF09E 2097553 koulutus-toteutetaan-p
1,666,296,978 *AF58F9492FF0E4D3AD85162300D0E333CF5B2A59 2106401 t
1,666,296,979 *AF5CEA4A12F9768AA00D8090091E4ABE1C427E3D 2346100 ennen kun me lapset saimme
1,666,296,980 *AF52B75DA41DC2EA4C390BEF4ADA02E7325028F2 2381530 for me , this is not a question of economics
1,666,296,981 *AF5CD51B431995B230D77771F443B83B976D5808 2394376 TOIMISTOVIRKAILIJAMARJOSILLANP
1,666,296,982 *AF5B1A2A0D737F24F8095EB4E46FF0473F77D1E0 2546060 vain-oikeudenmukaisuutta-voi-vaatia-
1,666,296,983 *AF577A965072A89DE8102A1F4D113ED79FFC1B13 273NICO
1,666,296,984 *AF56DE24A9F00902127BA5C0A69906E666400770 WILLIAM.HEARTBREAKKID.MCDANIEL
1,666,296,985 *AF5746A75491C736E6E17649188E03772A57113E 2autokouluoppilasta
1,666,296,986 *AF59EA1C5B1F122C848721CB131458043867AF9B 2bf8703e03c133d7b1180cd453adbc4e
1,666,296,987 *AF522A3D28D6C4BB0B7861FAB720658F223124E6 2DIEEBSW
1,666,296,988 *AF5C5A8166879B3434E2C83E3528639E7CD4CC54 wliiliams.olumide
1,666,296,989 *AF5B5CD5426536F6267C722F8750D6142FD4853D wmnaumann
1,666,296,990 *AF5C2B818570FD7713FCF0C49AC9C9B26CEFE9E8 2fsermersheim
1,666,296,991 *AF54F69A319E828129BDCB908AFC76981447A4E0 2IEFEGSUA
1,666,296,992 *AF51A17EC0F60778C04ED64AC88A05CC9DE2A75C 2IYILESTIRILMELI
1,666,296,993 *AF51875611807594A4F66F3A0B7899CE2A88BC7E [email protected]
1,666,296,994 *AF5095C479EA39BC59BAD3780012DA1CA4C4AA28 2LEHTORANNALLE
1,666,296,995 *AF56A6670F683522FE7214F8FD079DED74E49D8C [email protected]
1,666,296,996 *AF591C3ED5AA23184E68A24120940CBD34449D78 [email protected]
1,666,296,997 *AF5D152C15C9E77B3D076056B69BD3A3CC239AB5 WVoigdt
1,666,296,998 *AF52A252F32DF2E4EF967F7FDD97C76CDCC500A0 2OUTBOASTED
1,666,296,999 *AF585E49D1674B1D87E08E6895510FC62E30B465 2PIPEVNIT
1,666,297,000 *AF50995390B4C21D14A442588598707F75370C17 2 SERG
1,666,297,001 *AF510C51B9358F740F291A9D5B40893EBA0137C4 2WATANEE
1,666,297,002 *AF5AE8CCD152F29C68066B4AD9433B7493139DA0 2には単座型のF
1,666,297,003 *AF5E1E509514228366E891A99C5CE4F571CC8EDF 3#B.~0.~o.(-_0)
1,666,297,004 *AF5BF5E959AC8E7DFFDB40122B349773AEE476A7 WWWRRHISTORICALCOM
1,666,297,005 *AF521B09E6A50EFC1D7E14817317B33C1A48A445 3ELRENDA
1,666,297,006 *AF5E55CF0417AEF095BB0BE2A0C46C769CAAF470 WWW.TOWNTAVERNDC.COM
1,666,297,007 *AF57A0DDB20877C8283D12BCFAE9F8641A791EAF X25&
1,666,297,008 *AF5297F376283881AAED7C1662BFF5299402EE06 3MARQUEUSES
1,666,297,009 *AF571B35E60A5125FDC998E61011DD2FD06321EA 3.PANZERAUFKLAERER
1,666,297,010 *AF50B0F874E8F50E6DD40A6F1A47A0389DDC9D4C 3.rexie
1,666,297,011 *AF587E00B0274734AB01014878185264E54A603B 3.TUKIJ
1,666,297,012 *AF579A2D4C089DBCFC7DDD2F63B0B8D0F63916B5 434350 OSA VAMMAISISTA LAPSISTA JOUTUU K
1,666,297,013 *AF5967EC6E9A2A89B101A40D58FE0E6567B50FD5 468067 KISA SURE TURIZM VE TANITMA BAKANLIGINDA CALISTI
1,666,297,014 *AF5060EEA99E5A693EBD3BF6EA0F466CBF7F01DB 4BESCHIR
1,666,297,015 *AF56F5D57271051579CF230C85E9E96189635C7D 4NEIHCUUS
1,666,297,016 *AF596AA04AC544D09E5C1F711A3699703A0A42F3 4NTI-PHIL
1,666,297,017 *AF52169A6FA3E22A1A36B68056FDBA7872C1161B 4SONICSACURA
1,666,297,018 *AF5BB5119ECC726701A36B901F1E8F1059896224 4SSVR4TN
1,666,297,019 *AF525873399333690C7B7D4EA1888040E7A7F98A [email protected]
1,666,297,020 *AF54D40DC70F53C63FDBF591F1465466709BC36C [email protected]
1,666,297,021 *AF5B5B0CAAFC6F7698343AF0499C7AE6C7FBF570 [email protected]
1,666,297,022 *AF553144B34CE76C3DAAFBC0A2EE70AAF965A7AE [email protected]
1,666,297,023 *AF50AB0997E62429C3912A26D383864AC5277F31 [email protected]
1,666,297,024 *AF53DFE3B8727A153C72B4250364564B653AC812 xlodqwgx89
1,666,297,025 *AF57B8F85AED12EB3348F836C4ACBEE40F8932B4 4VISINGANE
1,666,297,026 *AF5AC376F190233421053D45C7D1621E1188E773 )x(~` ~`qb
1,666,297,027 *AF54A4D87698FF1C96DAC3F294DE71DCCF21220A [email protected]
1,666,297,028 *AF553C23C08FE14A83D8DAEC70B46AEB8BC8E054 XXXKTIHW
1,666,297,029 *AF550820B9000CC04F9D21109077D6FBF853187A 5CELEBRITEIT
1,666,297,030 *AF56ABA75FC90EF28202D228B21169B0B8D7A311 [email protected]
1,666,297,031 *AF54103A5C186006F3E57589D0487947EC109C67 5.determinismi
1,666,297,032 *AF5E4069A4C5DC90C71841B6F6A885DDC65EDD3C YIDDISH2008
1,666,297,033 *AF5B6BE62F47623A129EDEAC98E2FCCB0825F9AE YOUBETTERLETMEKNOW
1,666,297,034 *AF512E8EB9BC66D20C7ACE0305B72A6F1281EA0C Y`!S
1,666,297,035 *AF5BED4EEA69E0FEE8798ACC9935CBDBE1FD18FE yuetmui's
1,666,297,036 *AF58CDFE9E339FE585D2EFDB6C8B7988C71A5307 YURII.MISYU
1,666,297,037 *AF58517F0554CD5F98DBC101A487BC4574E4E6A8 5EXHUMADORES
1,666,297,038 *AF5B29D7CFDA4CC9D4CC70F5EB3825C7B04F5384 yvette-mochalatte-blai
1,666,297,039 *AF5A101BFC08AA0319D5DE16578FB48BAE3AEAF4 5GUIDLYBSW
1,666,297,040 *AF547D36A3B29E4355298484B4D76418C2F33765 5.haeublein
1,666,297,041 *AF545AEB92FAA08A0EF58BD18A275AEF59ACBD60 5HUNDERTZWANZIG
1,666,297,042 *AF5AF1C106045B5C1DD171B2FE2D01CBB4189AE0 ZACK.CLEARK
1,666,297,043 *AF5E41B1181C9BBD937A61DF9ED7B6ECEBAC7D3D ZAHARRO5
1,666,297,044 *AF51DC0A290E04412C14DE097569303B77CED09E ZAMOLBIED
1,666,297,045 *AF540FAF88363A7F2E782F63C8598933B0506CFF ZASCHNUTI
1,666,297,046 *AF595C6E696F9C461AC5D8DAB5BFFA8BAFAE8CEB 5MASCHINENFH
1,666,297,047 *AF5CB89F371357872802B93754EFFCC62B961CB5 5MENSTRUOS
1,666,297,048 *AF54E9DD969E3AE317BCA00F08FF197098476633 ZETNEMIL9
1,666,297,049 *AF563B02E22CD0C3EA0D7062D1080EE577942230 5ONBALING
1,666,297,050 *AF55FA81557CF94C049B9B1B0706E9C8832778DE [email protected]
1,666,297,051 *AF5477159121B6235D9AE5600291BE8AB2DD3A6C 5QDDOSEE
1,666,297,052 *AF565EC61F9E52E7FF86494570FED244BB660A15 ZKKXN1ADGQPOWW5
1,666,297,053 *AF52BB37436719DAE723C75EFEF9596D844AB943 [email protected]
1,666,297,054 *AF5F8EB05FF20A28632FC78DA48A8371B3767FB8 5THATHOUSE2
1,666,297,055 *AF50015CE949A5FEEBAEEC6BED70A569CE04611D ZSIUNAJ1
1,666,297,056 *AF5158436BCF406EF9134CBFDFE4853CAB9AD56C ZUFLUSSABSCHNITT
1,666,297,057 *AF587A73E662E453E27B0A2FAA573C329A2E5E8C ZURKOWN3
1,666,297,058 *AF5A9F10F05C89FFA370C7A8246D66DC98F7442A 5WILBURGASMAN
1,666,297,059 *AF59410B9AF98CB0C4FDB85647DFAD2710700A0E 5WILDCATBANANA
1,666,297,060 *AF5FC411F15E1F4603B8D7C36E315E5F17BCAFDD 612267 hollywoodin suuryhti
1,666,297,061 *AF534D0C6C7CA6A4282F1EF9584377AF958B36DD ƷEG
1,666,297,062 *AF501CD91431E0E6D71D62E4B8F8671A6F0C39EA 69waystokillyourlover
1,666,297,063 *AF53B56F4085B395B68878C840938AA7087DD738 БОЛЛДЖЕКЕР»
1,666,297,064 *AF5036CA68138AA31682F964D175B350DEF9E3B6 ВАНАДИ
1,666,297,065 *AF5E2FA9A496FD2706AD25AE4F119C8FA69730E0 «МИВИНА™»
1,666,297,066 *AF53C0E682FB0FB7165AD83E5E5DD312515BAA81 6HAPPYLETMEIN
1,666,297,067 *AF58A6D46A5D36943F3421AFA1E39816119848F7 русскую
1,666,297,068 *AF589AE5F92982670C84A1C1684D6F697CE2736C «супермаз»
1,666,297,069 *AF5429D7C181A61320C56401A4BB20E527258925 6RECEDANO
1,666,297,070 *AF507BE3277DFC7168A24E6C23A56785E31F2006 6TANTIOUS
1,666,297,071 *AF5454A4E11102E3B3D850F9BB8642BBBC92D875 хусеинович
1,666,297,072 *AF5EB38B5B29A684F9098B1927582A94D6F438A3 763VIVIANA
1,666,297,073 *AF526C078EA78A25D7A2F5440221AF263093A944 7BOUTGONE
1,666,297,074 *AF575E06A8D96588F5F0B6ADB937BF1275087938 7CCLMTZR
1,666,297,075 *AF56ADD691B16D1251F51313CC54CB60954D1F1D へ出場。初戦はかつてのg・b・h殺法で
1,666,297,076 *AF5D2E1AD2CB241F276D5F2CA9B5C22E53EAD03D 7GEAPPELLEERDES
1,666,297,077 *AF56D300ED50038764E22886CBD3B87C0EF2E102 7MAGNUMHAZEL
1,666,297,078 *AF5C00A1E6A52DFAF9E05A51ED0046860571DB67 7MOOKIEENTER
1,666,297,079 *AF5B105F20326F90AB38059AB3FE12CB9AEDC36C 7NAGEURI
1,666,297,080 *AF5E0BFEC9CA5956C693B8CC150DD7B47EF44BE2 7.WEGERAENDER
1,666,297,081 *AF5ADF42658A6E8CED4EF93A65F9D9E5947DD82F (^_~)* * *@8
1,666,297,082 *AF57FAE8F6A827BB9CF2E6615AC5C5B018F71A74 8D~0~osplat
1,666,297,083 *AF527FB6689FE5BC44FFB3BFF68D5162E9FDDA5F 8EURESHA
1,666,297,084 *AF5409560CC5D8649A36D7B013A6FDC2A3D83D83 8KASVUT
1,666,297,085 *AF558DED2EB3A3738BFE8F0E94B8AB42931BDCFB 進行首次海外公演,當時在巴黎公演的情形收錄在cd『vhmusic
1,666,297,086 *AF58B5DD94C4032E5AD0FD265369B147A29A49DB 8RINFUZU
1,666,297,087 *AF5F7BA36AB4F05DAD14D7901EEB1BB968DEFB57 8VENTILAUSGA
1,666,297,088 *AF5969567AD906D9D7A56F30EB80A3F85A7822BC 915150 technology.agency.oy:n.toiminta-ajatuksena.on.edist
1,666,297,089 *AF5C32174A0621CEDDF7D38F1DB9DE5E76BE19A5 927996 TOISAALTA-LAPSET-MAAILMASSAMME-OVAT-HYV
1,666,297,090 *AF539907AF3F9FF9B1A5F94C5A801884C64B0255 (_0).O~.0~.Q===P
1,666,297,091 *AF590AC05477D7E410AC9160A5CD5785F8AF209E 1000-Miles-(Loco-Dice-remix)
1,666,297,092 *AF5E8F4F30B7E4A8B336AD8BBB98E0A710496D55 1183275 ennen suomen eu-j
1,666,297,093 *AF5036FA3ECBD9F970299347D01B35250A50F155 1254351 helpoitentunnistettavaonillallanoinkello21etel
1,666,297,094 *AF529C2BCDBDAEE93ABEE7D3BA4B27FB59E22689 9HILSTROMBSW
1,666,297,095 *AF5ACDED6AFCB7F16EC6D67CA3244EAA14B449D0 9INEBRIAIS
1,666,297,096 *AF55DD1F4432BB1665D4B387548469A0AE55902F 9KRALWODA
1,666,297,097 *AF53833E86453B6F8138B0B84B61D4B60527FD15 9LEKTUELT
1,666,297,098 *AF56C772F236CAD753BDCD3BEF0D9B1944D3465A 9MACERATES
1,666,297,099 *AF5C9FA0D482B741F8F9CDB4C0790800D7BEE94C 9MUSIEGES
1,666,297,100 *AF5A35D55DCE36A04A82D553AA6186F7112FB71F 9NIKIDOUG
1,666,297,101 *AF58B893269C9405EEB1437D1C753AC5802C5A36 9NONADDICTINGS
1,666,297,102 *AF558161714FDE85ECB8D81A287B661DDF221F49 13PUSSISTAAN
1,666,297,103 *AF567150E027D9988C7E822FB87F41A922AB07B4 9RAISTLINRANDOM
1,666,297,104 *AF59F07386679B581A6F1C572BD486375BA308AA 9REUPPKOPPLING
1,666,297,105 *AF5C4FBBA37E259821FB9FB6A82C98070F81B3AF 146420 tietoa.koulusta.kansainv
1,666,297,106 *AF509F928CC9AD69CA4F084C069F012042F21C5E A0ZLS
1,666,297,107 *AF57EAC2A6BADFD303038BC0A87390768C2AF491 A1QPE
1,666,297,108 *AF5A578C19E90E824E9A145FC5EEFAA9220204F0 a2a(k
1,666,297,109 *AF5C6B32DD06AB385E0A2847F32CEDEB9EF390DD a/2ss
1,666,297,110 *AF5BFC9807146ADAFBC1339A6437A555E91546A8 A4&FO
1,666,297,111 *AF587921C2D10DB2E86299ED7E5DEC989112B46A 19021313
1,666,297,112 *AF5C2477DDC777B510758FC022998401EA8E0BD5 1AJAESSA
1,666,297,113 *AF58FDFCD936B06089563480434897F6629C9E3A [email protected]$
1,666,297,114 *AF50EC99D4470CDE7799A16C25FCD0912685981C AABD5Y
1,666,297,115 *AF5BF4C49EBC266FA101ED59500AE8F86A20946E aabt${
1,666,297,116 *AF59F8679AF5E39AE6B18AD02FB1E85D728D99F3 1 DAUERMEDIKATIONEN
1,666,297,117 *AF5F0F02C675C3B30B531055252135EABFC3F2F0 1-druckgrafisches
1,666,297,118 *AF5DD73C19E9366E00988387FE00662B49822173 1.EKSYK
1,666,297,119 *AF59E188B4C4EA13222F76237F4A2B5A21709D00 1.EXREPUBLIKANERVORSITZENDE
1,666,297,120 *AF50389E589B78CB962541A982E2A1F3C093079B 1F3FU1
1,666,297,121 *AF5B9756B977CCE7526245A634E388D453B6A259 AANGEMEL9
1,666,297,122 *AF5AC5FC3D97E042B92825CBF45A4EEB813F0698 1FOOZBSW
1,666,297,123 *AF5E7C8CF3881A97144AF8E3B7E650D834B51256 AAXAX
1,666,297,124 *AF5726B28DE5E333BBF9CF71D41CB533FD2C4ED4 abc^'
1,666,297,125 *AF54F1B0CFC3707791F7713E144711AD62DF9ECD [email protected]'
1,666,297,126 *AF5F247CC3196AF9F080712DFE882B19B056AAB1 1 KOTARAKENNUKSISTA
1,666,297,127 *AF508BCEE194DE36B87CA7106283B3C7575B3D33 ABHISHEKCHHARI
1,666,297,128 *AF5D3667F668607419FA88614D93FEC67BCDEBC5 A,BQ
1,666,297,129 *AF5F15C4BEF904AA58668ED00A49FDAE5DDBE67A ACADEMY.N:.ACADEMIES
1,666,297,130 *AF5A8BEB7682155BDFD68359F7913A1ED57D4F8E ACADEMY公式サイト
1,666,297,131 *AF5D1090CFFD078E0A00F0152964EE05CF9458DA 1 mprrokotukseen
1,666,297,132 *AF547ABD0E71D026E1211BE987BDC65755710DB1 1multiversumeiden
1,666,297,133 *AF5B989FDCA40579E486147A5F06808537C54BA9 1-NEUBESCHRIEBENEN
1,666,297,134 *AF5454DBC8BA0B8A7AEABC52C1AD7D17FA53674F 1.oetvsprechers
1,666,297,135 *AF532D28DE8948D530604B0FEAF0841970C0E588 1 OYNAMISIM
1,666,297,136 *AF51EDB8FB5ADF1451D96063F95B4350D8F9F420 ACCOSTANT9
1,666,297,137 *AF5485E2954FC03D1CF7A5CA5B0F8573BD2D7FF8 1praeacetabular
1,666,297,138 *AF53D0C0F75B29C06098F66E4D136C58ABFE1FCD 1PUOLTAJANSA
1,666,297,139 *AF5B9900ACF04367D74BD3DC34ACC011861DBBFD 1schurat
1,666,297,140 *AF5B59B97F6E31259992E444AE0C6C660478C98D 1tiistai
1,666,297,141 *AF5045A2A3AAE9A81871DFA6C639491048C024E9 ADR_
1,666,297,142 *AF555C7D525CDE1F4C5150638425BC1A1C5E0316 1 vdkortsverbands
1,666,297,143 *AF563128620E54C98D1F44EE465793A0002014D4 1 YKSIL
1,666,297,144 *AF55A49B537337E2CC6D0CA5EBA0250508554E1C 211jagger
1,666,297,145 *AF549E087593A108172B61B811DF3BBB95BEE1CC 217 unangaben
1,666,297,146 *AF5B8F5750FA0FDB80FA5C287D77E25EEC3FCEB8 21.sopimusehdotus
1,666,297,147 *AF55722D72CF59D4AC2B15CBE871BFD6DA015FF2 ag8bd
1,666,297,148 *AF54C7280D1E91CF8F48ACCAF23B74FA8D621E1F ageprice1
1,666,297,149 *AF502F71DB55CFCC3CEF9D61D5DC15CF543D4FED agmgh
1,666,297,150 *AF57ABD095834E5B31AB7CCF70C26BA0FDEBE457 A(hd
1,666,297,151 *AF5F07CA323A18E0E1EE57C52682C65BEC4F85CA 2910064 SO KANN MAN DAS NATUERLICH AUCH SAGEN .
1,666,297,152 *AF506EECBA6B1C0A95AB2BB1E283889FEF45A852 2917258 that-pressure-led-to-singh's-release-,-it-said-
1,666,297,153 *AF5A1C7837B194BA29D3F8238FCA111911E2FF80 AIMEESY
1,666,297,154 *AF5634CA3BD68B1A72936C01CCEF8E4E4FB00F08 aisiojho5
1,666,297,155 *AF5810B56B0DAE042F37A080F565F4908A32D43B AJBN:
1,666,297,156 *AF52BD8C8B8FFBCBB843296F8109AF47692CFA16 AJMFOHI0
1,666,297,157 *AF5952F10E7BA34180FE1F601C77903F43593626 2dUzgOren
1,666,297,158 *AF52135CFA36FFA2669F8CDAAD935DF61C3ADB2A AKONGCHALALAI
1,666,297,159 *AF5AC6CEBA491CF22323DE3325C2BD1A1AE36D85 akv)n
1,666,297,160 *AF5270D4253E8A34A0A71ABA35D0656B4D4C48A4 2GARIK
1,666,297,161 *AF5D594D05C2010E81F388757680971A70E28551 2ILUVPERCY8
1,666,297,162 *AF53E51C920717E8E43077064439ACD5A22B0F02 2.VUOKRA-ASUNTOTUOTANTO
1,666,297,163 *AF5B2BC5FCF50BD3076588FBDC8F8DDE7E5CDE7F AlienAxeMasterB
1,666,297,164 *AF5AB2DBF98D7E23540A0DDEE239CD3CE5D1BDB6 Almost-there
1,666,297,165 *AF5ED7D14695DEF8542780465E756D8A479DAE6C AMANDA PARK WASHINGTON
1,666,297,166 *AF55FACD92E883798E2AAED8BE8B5CA41A915C5B AMAYAYI7
1,666,297,167 *AF51911C1DADE6133FC8F0830509395C5B332236 amf#g
1,666,297,168 *AF5F1C6A191C70D075914633583918D061926B89 3doppelzelle
1,666,297,169 *AF5E08414A4AC2AC219D8E52F964AA6661A7BB35 3EIPUORG
1,666,297,170 *AF55498333D83081F6BA68A40C1BC6CCD678D195 3ERIKOISSUOJELUA
1,666,297,171 *AF574861C711845E0C002771AC2E9F628686D242 3FFIELD
1,666,297,172 *AF59B4ABF4BF878BBA08C6715F9ED0BF07AF9D5C 3NGUL0T3
1,666,297,173 *AF56D170590112B10E4B75631D248AB05EF57912 anamroves
1,666,297,174 *AF534D4FFEB9E1F32331CB7907C54175CC9EF856 3VH
1,666,297,175 *AF5B2B7CFF4994CBA669094AF96E6E2CFCFF0279 ANiggard
1,666,297,176 *AF53B8BDE2DD78FCCC84256493A6837BF32D4D11 4-FORTLAUF
1,666,297,177 *AF5173EA0D4F4082CA6A1856607D72DEADDE1A4C antonionarimatsu
1,666,297,178 *AF5AC6D52F388CB47AB5C42CE4487F20520C1080 ANTONIOTKM
1,666,297,179 *AF50FF0F046E66164F6067140D76E059B35CFB48 anxik
1,666,297,180 *AF5B4C2FFBA33829DF9229E49F09A96D5AF23CB3 4NEDIEOLVNAA
1,666,297,181 *AF5CD3034965306C14C862BDF6CF368BAC8F50C5 4ONESUPRA
1,666,297,182 *AF5572386F9B02CAE59FB0B64F5822BBDA857B3D AQ!3+
1,666,297,183 *AF572D45479072E47CD2FB62C7F9175A6C4FD796 4WIDENSTRENGTHENED
1,666,297,184 *AF53BABCD9370DCB05D0FF0A28DA32487706C4B5 53RV1T3
1,666,297,185 *AF573A26A953B613FF6F213BEB151114C4A56746 ARMOND5
1,666,297,186 *AF5F4F7E1ECEE9879FC0C8BA3E862853F4273A68 arturobrennon
1,666,297,187 *AF5D472A5174E7E4EF58BD5F1B6292A2346CC48F A_RU,
1,666,297,188 *AF51DAB3B89869891DB232F1C6CEC2BCB5E1E556 askippy5
1,666,297,189 *AF5D46A2DBCB22F4D4010DBB062ACBB58D932000 5-SOVITTAESSA
1,666,297,190 *AF565E20826C2F3C6A2C0DA1C59A659C3DB623EE ASQ=
1,666,297,191 *AF5D1618F1195CDB520F18CEDE247138F9207275 ASSOCIED
1,666,297,192 *AF503090A5B5B408A5EB3DF163893464A8132B28 ATGGGGGAAGCTGATACTCATACTTTGCTGGTGAAAATGTAAAAAGGTACAACTTCTGTA
1,666,297,193 *AF5CB236E8AC82836C9B2CF8E9CE5244ACE84474 [email protected]
1,666,297,194 *AF54D366A155429C6367C8A2D53E5A4C5256567D [email protected]
1,666,297,195 *AF50D45AB79F1048DCA2F75F80C84DB3B024D278 audrey.evans
1,666,297,196 *AF5AC59BF9108FB50350B0CAB29FF6E73DA2766A 6DIUSAUGU
1,666,297,197 *AF51710464B6302EDC293CC4199EC5391390EB73 6DLEGEPEG
1,666,297,198 *AF53600DAAC006113AAFC50ED483D3623FA2FA99 6E8AF419-6761-4950-8D8C-12B619A87EE3
1,666,297,199 *AF5B3C54E76DEAC890754349ADBA6B76BB8083CD 6GASMANFARMING
1,666,297,200 *AF504C597A93C89A67C712DFACD21848C7F0732E awb!
1,666,297,201 *AF54995C3BF606E4DED7D40A0F998BF7AF8034CE AWo2
1,666,297,202 *AF54665025F0E8C2F93D760F33E49192752844F4 6.schuurman
1,666,297,203 *AF55E8A2B4B49ECB27E5A53DC729082B4EA5782B 6TABEQUE
1,666,297,204 *AF5429FFEA41BD8FDBEED0EB2C5EEA7734E4AAED 6TWICEREGAINE
1,666,297,205 *AF553F7462DD5083C6148AEBEAC3E1FA7515FFEB 6.US-KOMIKER
1,666,297,206 *AF57055DAE092994E3F0DD9681867695CE1F4C75 B2HBB
1,666,297,207 *AF5AEAC7823800024CFB591C34A835C4D0698B9A 7-anka's
1,666,297,208 *AF5D0A6AA2D3964D1D217B3A611C871F05C104E6 b8boc
1,666,297,209 *AF50B0F069CC6B3574077F5773C2AB47FF7C7052 7bosaette
1,666,297,210 *AF5F3DB624955D235E9BF231788F52C9D20B0310 7EJTSEEBEWUORVEVEIL
1,666,297,211 *AF56C943571382EF98AF152D53BDE19822AD8703 7HEMOPIEZOMETERS
1,666,297,212 *AF514EF99EAA4D0E693B387CBACEA88278FC26A9 7ILOVEBENJAMIN2
1,666,297,213 *AF5C3DE6A3643AD883B0DEFAEF760879E7576071 7RASTEPENIMA
1,666,297,214 *AF52B6104C38F74EA8D72A7DF08E8A202048D1D5 b/bow
1,666,297,215 *AF55F1BCA50F337BE6295CB7DADCCCB916A0E64E 7tryptogen
1,666,297,216 *AF57BBB6398ACC5DD5F7464CD0700DB6198FE985 7VORVERKAUFS
1,666,297,217 *AF5EB27D4B5C9ABC7BECD50D8A6D12AA1E352770 818803 der.gewiefte.kollege.wiederholt.die.frage..
1,666,297,218 *AF5AC6646AAB08BA89A952B4C26B73CC66BBB3FD be:ez
1,666,297,219 *AF5AE21C349C13A40EDC084377DD347E2A7EA548 BEGT7
1,666,297,220 *AF559A9DC10CDA257F70548B9B9BE393C9572FBC 8BASEBALPANTERA
1,666,297,221 *AF56813BF615A95F124AC9F1188575A13574B952 [email protected]!ONS
1,666,297,222 *AF534DD1A7E1FE0D4F6FD709B9A53E081DB7D4E0 )8( o~0~(8
1,666,297,223 *AF59ACF5E7F0CD6B859EE88491B2A6AB2DDE59F9 BES59
1,666,297,224 *AF5813C1D5D9347F352725151E54944E883F24A5 BEVELVOE3
1,666,297,225 *AF566B0B011D509B251F7B18D3ADC5D782E97DB8 bfqye
1,666,297,226 *AF51A453C6879EB25D7E306B4BFA0394399B2684 bgbok
1,666,297,227 *AF500CD57B51194851191A06318562F929B6B67B b&ha!
1,666,297,228 *AF5C7EBAAD05D12B2A7176D3BC7A8D0616577871 bi#3
1,666,297,229 *AF54248B4D1F22B86896A5705F7BC02798E34AD6 9BELLEFAM
1,666,297,230 *AF5114E20267478DB075544011A49DA6E0220A96 biigz
1,666,297,231 *AF5F168B8046D593F29689E0F212B8D0E1AC753D 9DELIAMKCALB
1,666,297,232 *AF5E9FF19143061431FB5D14EB20B37E69E91BE2 9DOMINODUKE
1,666,297,233 *AF5704BE52ED66E3908B46D08F08A2AFF1F4FEBD 9ea3ced818ef34b1ad862714646f1b6e
1,666,297,234 *AF587F77C01870DA8D0E951DC4481BFCBD94FEA7 9HUTSELHUTSEL
1,666,297,235 *AF5B22C045B4039BA1DBEDE9B47F33912535DED6 9hybrid's
1,666,297,236 *AF57733C92BAE500C95FE666B954624CD382544E B"J=I
1,666,297,237 *AF527B44F5CB349B094EFE883F2776B9F89409CB 9ILUVROXY9
1,666,297,238 *AF5DA6ABE7425AF70178881DC18B09640F7F890B 9IPXODIBSW
1,666,297,239 *AF5C1A4B71FE82B2B039B3E3D9DC2BBA04B3EC35 B-;k
1,666,297,240 *AF59FE16B1153AAD8C85F9502211B218E13D3555 BLAKEWYNES
1,666,297,241 *AF50E36190D2733F4D484136757322F0C9868739 BLFZW
1,666,297,242 *AF535DC90FCE8801A073CF8ED9EB340D255A5D7F 9SPRTBLTY
1,666,297,243 *AF50EF60A38626B962020CF84EA3D2F837CE7857 9SSOLHCSD
1,666,297,244 *AF5A206D851A9E75EE2429AF3C44B95BF0352880 b&n6
1,666,297,245 *AF58F9E842385C464786DE6ABA2CCE3FFB062F42 a!:&%
1,666,297,246 *AF5866D81A888A392E0EE4C326F6C5CAEB50FFCB A0MU(
1,666,297,247 *AF518DB83033F9C1113D3FA33637A6DD8F053B0E a5)=k
1,666,297,248 *AF524556DFF7453256EFAC5823E18AECF652E2C7 aaa#`o
1,666,297,249 *AF5D9D465DD781F2A7D873284569770313DFF9AD AADGNS
1,666,297,250 *AF557F9A902CB53E5B19E40E51A126DCFE668A33 Aangrinnikt
1,666,297,251 *AF582DE6E32AE68BFCC6AA8694C472A55155EF0C abitazionis
1,666,297,252 *AF5C04DF1FD209C2E8D23698D73B048A25BDAA6D ABR0V
1,666,297,253 *AF523269C2F3C3B6554E166FE2D1E7FE0FFCB5CE abstraktsiooni
1,666,297,254 *AF50BA69B8FE99AA0BB2164EE246981D1278E4B8 ADAYR
1,666,297,255 *AF515690E40F7298AB0D1D2E42686D876C261B08 b-#w5
1,666,297,256 *AF5D9DCA5DB144888623FC9D94D53A9D5A3CF729 bxfbe
1,666,297,257 *AF53A811AE24439C7242649B6C47625C86F0E84D c2e;?
1,666,297,258 *AF530F8F6ABB59EED0B1FB583500F03B3095F6AC AHMAD.MATULEWICZ
1,666,297,259 *AF50482912A1579A6D51A79551D4E9DAE96CF797 C2PDT
1,666,297,260 *AF5CB70E9D95E160B5D3BC967EEC45CCCEF3298B AIX.8
1,666,297,261 *AF5908F1857C82598003F6BDC704D6217CE64D93 C#AJA
1,666,297,262 *AF59860C69643BCBFBEF6841E9938FABE3631925 aldobrezee
1,666,297,263 *AF584EA95F4F09A5C98691EAA47769E933AC986D ALEC.ULJEVIC
1,666,297,264 *AF514444148CA55561E7B0D7FB268EBBF356484C CANONS,.OP..113.NO..5:.WILLE,.WILLE.WILL,.DER.MANN
1,666,297,265 *AF5C0487C6CBCB55BC83C34B7B80BA370585B23D alicsons
1,666,297,266 *AF5D48931F8CA89A793DF6E99950A35595D5E0C4 CARLTON.BRANDLY
1,666,297,267 *AF5AF96B663376F587057B934DE69C02FDAA4D42 CARMINE.JANSMA
1,666,297,268 *AF5E213173500EB3876310EA2FC42C2DFD4CE5B6 carnivalesque
1,666,297,269 *AF56F01E317B684F03672C53E16D3352A59DBC77 altonurive
1,666,297,270 *AF55D7778418CA7FE9DCBC991A214BBEDFE2BBEC ALVIZP
1,666,297,271 *AF570218D3741014B0900E7015BBA31F2AD6382C CATHLEEN.C
1,666,297,272 *AF5C7314C43043A5349CA845F5F57AF57E9D5989 CATLIM2I
1,666,297,273 *AF56CB05972889E8404D442814613F25BB36B32F AMADOSEMAAN
1,666,297,274 *AF5AC15008254673BFD8D6B496208FCE744FAEF3 AMADO.WILDAUER
1,666,297,275 *AF595AEC67964856BB80C365610B5638882EDD76 CATSONTHEFM
1,666,297,276 *AF518DAAD0EC896CEDB54BEEEE72DDFCBB94B9F3 CB7$Q
1,666,297,277 *AF5B715FB793E053D6519EE7D8D78E87AB1C223B C,=CM
1,666,297,278 *AF54918DB148388CF55DB8A5C98A3D1BC209E570 CEREBRIC
1,666,297,279 *AF57925EC01EBAC7A2279FE8D272567980CBCFFB ano-viejo-ecuador
1,666,297,280 *AF564F465C3CED6115AD0789285BC7AA3C5FF4C2 CEWGO
1,666,297,281 *AF51BD6605B47BF180A400F559EAB2D5BA1EB603 CFg8
1,666,297,282 *AF5F0CF8356429B0E613C909B2D63450F4453140 ANUPAMKARMAKAR
1,666,297,283 *AF568DE8FFFCCE48C914BC093B5DB4D235789692 APADV
1,666,297,284 *AF5E60887C81C8FE5D291A329E2897FF2B5533BC APELOVAL5
1,666,297,285 *AF5DA5E714DBFCAF61074B6073DE5CEA775542A3 APN4B
1,666,297,286 *AF56AF671278BFC7A87B023F109449A021F790E3 [email protected]
1,666,297,287 *AF58D7536582ACCC049BC6B79D8CA6C9C628E1A0 ch#c,
1,666,297,288 *AF5FC34CDF176E4189A2D52D4A92AE7A3AD89E4E [email protected]
1,666,297,289 *AF520BCD161A8A422645B1358B8F483392DA8887 [email protected]
1,666,297,290 *AF5373FF632A11CEC616939BDFFB05FA00E1D279 arbitrerons4
1,666,297,291 *AF5E6A58AB0784FE22EFA887E3357C40820B7577 CHESAPEAKE“
1,666,297,292 *AF5290CB5EC08FC296075FA4B14AE7C017D386FE ARDZ?
1,666,297,293 *AF59503287A54018D3AE98FB9AA678E683AC310B CHFa
1,666,297,294 *AF573402DDEE3E5B19903C2742B5E09704C85F27 ARMANDPREVOT
1,666,297,295 *AF5B9C40F7F95AE79174F1D8FF12A3EB14A4A412 CHONG.EBNER
1,666,297,296 *AF53E68D8877CA4F11FBD35F5630287EABD42297 ARSNI
1,666,297,297 *AF54171074D9E597C9456E45DCEBD523CD719C1B asdfgsoftball
1,666,297,298 *AF55C8C9F38DEF2CACEBD147AC064B16EF0DEE53 cimlv
1,666,297,299 *AF5BC943CECC86C6E6641E3F3D51B5B522A4C83F at_xq
1,666,297,300 *AF518C1D528269FB18B69F186A7AD972C91C35BD CLARENCECHRISTINA
1,666,297,301 *AF50ED00AA6BDD52E8A939272754F1D8E849716D CLARK.BECCUE
1,666,297,302 *AF54DFC0A31585BCB10D727BD4183F9B59945A22 AU;GS
1,666,297,303 *AF587A4B4496FA5FC4EF06F0ACEE28EF2E959DAF AUN71IES7
1,666,297,304 *AF563101EBED71D5A676D159294210B0311C5515 CLETUSGOAR
1,666,297,305 *AF53B7EAA934C3C2847D507A0703CFCB6F7CBA87 clf4v
1,666,297,306 *AF5DA545A5DEDFC1A475F9FB89E8994C7EA14075 av2!j
1,666,297,307 *AF54642F5C4D9837C8145778C404139590508925 cme4o
1,666,297,308 *AF5DC93F9D780427D3319CAEBF024E3873D6E635 CODY.HITCH
1,666,297,309 *AF54E2FFFBAB4A6228C58B8CB635BA4EAA622A7F ayeu
1,666,297,310 *AF595FF27EAD540E2DD7499BA01F4122559E1284 >B0~QP
1,666,297,311 *AF5B4C6D6151F1A7FAEBF14EB08EC94AA1B32F60 b(1?d
1,666,297,312 *AF5CAEC9AEEB83B99FF8365643BA17735FFD5B07 B4GE8
1,666,297,313 *AF51975D8A67323A03A1CFB405343BD6C4156B95 [email protected]
1,666,297,314 *AF556B33DA22538AD12F386F5EF0E161790FB1C5 BACKSHEEP81
1,666,297,315 *AF522D4124928EFF10C86172B0798336629E8040 cp0-h
1,666,297,316 *AF5A4D46DCE6FC099AB773461976A82086493268 CP;KR
1,666,297,317 *AF57B01DD140E5B88761A734AC4BACB6F16710EB c:\program-files\common-files\microsoft-shared\office12\html\xmllinks\1033\csdebug.xml
1,666,297,318 *AF5DD63B5BE1ABC7FC8CF02FDE788E832263A90F cpvr
1,666,297,319 *AF546AC6AD44824607543624B8474BFF4B87D8FB B&BJ,
1,666,297,320 *AF570F392C81F85DC3E3E802B97FD70CFFE2B1D6 "CReaT"iNVoCaTioN
1,666,297,321 *AF541FFB04279A2B10F355C032DD2C76C7FE353A creative.rock:.targeting.(bt)
1,666,297,322 *AF50654C60FF9B864B3A313F41BF1E582DD607F4 cx$#
1,666,297,323 *AF51409284D53E40B8F4E2A3CFDFA860A910895A cy"cj
1,666,297,324 *AF58C2E68174131C67510BE986374C0709CBBB71 cyi+t
1,666,297,325 *AF52722C6B462367A29A7E871D7F4009377B9DFF c#:z
1,666,297,326 *AF5804408EBCF2E84DB7CD6764BC2D0053FC8A2D [email protected]
1,666,297,327 *AF592AA8648E868CB4E5B70332BC7F47E2F8957C BFW45
1,666,297,328 *AF50E5B88F4C372A1D6150159651F612300B4947 B#I;
1,666,297,329 *AF5BA9EC1856E35756ED9F35866808FEF7C078F2 BILGG
1,666,297,330 *AF534AA2CA69EC46012CFDEBBDBB9F4616746710 DALU
1,666,297,331 *AF5AD1FCE00A4E5B8C4B6C9F0B37917F2C797E8D darbouxschen
1,666,297,332 *AF54DB65B3D1C2AF94247A34E69A279B0D7378F1 bm5
1,666,297,333 *AF50EAE87D501B36A0D16D81C5A0376C73BA7FD4 bn4=
1,666,297,334 *AF5BDEB04ECAF4717C79192980C51A7DD4FAB8CA DDEGC
1,666,297,335 *AF51018743BD213171BB702930FC7C618406A2BA dean-hite
1,666,297,336 *AF5A099DF9519FAF8A39075863ECD2B6BD7F29F4 decaprio123
1,666,297,337 *AF5E68EB574049F1AF5958CE3913A46676CA81F1 bp,
1,666,297,338 *AF5E77A3E9BA2BF7D48D943C2D789268C8354769 BQ%KN
1,666,297,339 *AF55B0E653B36F3DE34CD92D6BF330591E51152E BRAIN.EIGHMY
1,666,297,340 *AF50F075CBF635E056F9936A38B3D4C7910AA4C3 DEP1ATNG
1,666,297,341 *AF5554713D0824D7EEF4C930AAACD55856DB0D89 [email protected]
1,666,297,342 *AF5DB97B1E7C9D76355188473E0A19EF3C5F042C deue
1,666,297,343 *AF5EC11D916F4FF7A7A5D714237D808195957482 brittyarish
1,666,297,344 *AF5EA1CECE314D71BB441CAD03205C5C860A74C3 df#:=
1,666,297,345 *AF58D59A7BD168489C200546E37410EA07E164C0 brody.blue
1,666,297,346 *AF5D6BA6A574F1D451AF5083B6FA3245A19197CC DFM4G
1,666,297,347 *AF598CCC6ADAB7270164DF298E38E868914DE623 dgja
1,666,297,348 *AF547BFEB78E0162EB4EE204AC6FC3466DD0DD74 B,U&
1,666,297,349 *AF5342DB7A59B10F40A708967530A995AD178552 budmacguire
1,666,297,350 *AF5FEDF6A8FF5FDD8E80554C11A8C51A4587964A BULLIUUN
1,666,297,351 *AF5DEAF448393EFD39A37CDB49D6B7A871CC8293 BUMBLER
1,666,297,352 *AF5496BE960AEB60EE6BC70841DF303FE204B842 BURTKOSO
1,666,297,353 *AF5D8D5021889DBE0ABDC4173B1F62AEBC20F028 dh_eq
1,666,297,354 *AF57CFC335F1A02B5520D7AEFF9D0016C3D7B28D ?bxd
1,666,297,355 *AF58E29E0300D4EF1A6BFB0C1DD64CF10115EAA6 by"?:
1,666,297,356 *AF5DF12423E4A49E2A7152AA9C020F83877593F1 C0)7V
1,666,297,357 *AF563BA09E952DBCAA45139C4B9726D27EAF5A9E C33EZ
1,666,297,358 *AF5E1DDD2EEF1636A0972D4A0DDD360175754649 DJ-HAVANA-BROWN
1,666,297,359 *AF5F160DDB627C92C4E51D4555CE93518242E039 dnl4y
1,666,297,360 *AF5E54AE5D7BF51EE801FC8FB9B0F4F93BFFFC3E dodm/
1,666,297,361 *AF56DF4FBA2359245B211B2D2B6759DB2AD64D15 domingoglasscock
1,666,297,362 *AF57721974D7989C966E4B387D23070D18456BFA carrolmartincic
1,666,297,363 *AF5D5F9AD9414FB5B263842389447C9E5A0D9CC2 DOMINICK.SWEETIN
1,666,297,364 *AF5E87892A9F3C696D261FFD1215C1482300790D carter1955
1,666,297,365 *AF57FAE53103B15F4107ACAA24CA124D68F36D4B CARTERFANKHAUSER
1,666,297,366 *AF56EAEC66857B643771DC1A0044F922F84BC286 DONALDLAPHAM
1,666,297,367 *AF586D781825F87F11F5DC99335D91E941CA8609 CAVEMAN-LEAD-IN-(1971-ORIGINAL-DEMO)
1,666,297,368 *AF55DE333D480E95895FFC8B8B0B8836F17890AA ccggb
1,666,297,369 *AF5ECABC10E55E3CF37AB3D28A2EBCD605B8B346 chandanpaul
1,666,297,370 *AF52BC84BBA614F0953A5FC405C90868650C0A66 DU)AQ
1,666,297,371 *AF587CA0CAA3BF1621FA5E95AA289029578AF79E DUNCANSADLEIR
1,666,297,372 *AF574369F2E97DFA7706F2EEB85EA2318CAF5F81 [email protected]
1,666,297,373 *AF557150121DBDC849E3E628597C3996A6CFEAF1 CHERCHAGE
1,666,297,374 *AF567CB33401B8BCCC9BC246617E8734F680BE2C d),v(
1,666,297,375 *AF5D6728E3D78AB571E328F77E3D6CAD23B789DD ch$ge
1,666,297,376 *AF5E94F2666F4D73D8593CB049B2E949C905E250 DW""G
1,666,297,377 *AF5F7786DD2D442AC3AE5D0B7A7287014E6DA3B8 CHRISTELLE-STEENKAMP
1,666,297,378 *AF52A815DFBE55EE89875B50D6A3F5BC3BCE7C6C EARLLOVORN
1,666,297,379 *AF58CEA4978B7FCA35108B3E252A4F56D410DC9E earnestwildrick
1,666,297,380 *AF5A58191475C4B0007531D6E85466D7F524514B c%iff
1,666,297,381 *AF58E51F5B03DC82AD9B6071D35327DDA029D85C ECNDECERPPED
1,666,297,382 *AF543FD1E4D7B1698909D47A0685E0E3AF80456E CIXQ"
1,666,297,383 *AF54F759FCE8AA2086CE92818097ECAA0EEFF007 c(kwj
1,666,297,384 *AF5A9138635E8015E1A2F14CEF4015284825DA1B EGSJAHRE1
1,666,297,385 *AF53888F6653E2A160C3FCC6924900CBDCE97848 EHGR+
1,666,297,386 *AF5E4A884F61232E61791470BD22B18C6808B5C8 CLYDEMCGLONE
1,666,297,387 *AF5CD0465AA42395210F6A7E152FCF12CAC3ED55 EIQ(J
1,666,297,388 *AF558263F9300ECCB9A44711E125BC438A0BE397 [email protected]
1,666,297,389 *AF50C50441C611F8E30BC22627277ABD80CDAF24 CMUMC
1,666,297,390 *AF52B238B6C9ABE7777B58D9F28C84665481F1E5 eliasbrune
1,666,297,391 *AF51BFD49A1D044E141621B84C2ADC5AE436B3B7 ELIAS.MARBURGER
1,666,297,392 *AF50911BDF08F6EB99DC12E1E2148525D3DBD279 cn_e2
1,666,297,393 *AF5BF81FA578E0A36CEA4D31D7BA5FA1BAF79EF1 C)NTG
1,666,297,394 *AF55414EC82B3EE44235357DB6EB1339F88092A7 co!fi
1,666,297,395 *AF50BF76DAF6A9750F7D6503ED08B7172E67EAFF CORALCOMDESPAC
1,666,297,396 *AF5627F26BFCAA5C177C152B71C14385BB62F716 enswmatoy2
1,666,297,397 *AF5936D4EDDC0FAB872389DF1FE4D3FD321D6888 COURIER2006
1,666,297,398 *AF562E98D4449E4D3927B509B920F9C4FA7A542A [email protected]
1,666,297,399 *AF5EFBBE457048DA6C027DBE235268C667C78D80 [email protected]
1,666,297,400 *AF5667A2DF555711F8C44774BF0E4F16FD788A44 cristinabelceanu
1,666,297,401 *AF5428A8E07F339A218B6315261AD78366174471 ernestopolachek
1,666,297,402 *AF5611C1122DA649DAD4CCA36DEB123DA28DDDD5 erresbloedbad
1,666,297,403 *AF5A49A69C5D021215F1441A979ACF11B69AB3D0 c"rur
1,666,297,404 *AF53EEF3C62E2759A16E99BDF45C9095740D0299 CRVFW
1,666,297,405 *AF5FC99B7D0E8C6539D53C2E13FC38E8BDD394BF estebanzagacki
1,666,297,406 *AF57FE3A65B764B96BF1DB75398BDC6958E89A0C ctqe5
1,666,297,407 *AF56FF96A882467B63A9D17AC976649E04605C0A euganeises
1,666,297,408 *AF5B2E9B21B0343FAF5F21525C89E8F1B8612A7A cv0ws
1,666,297,409 *AF597CDCB0EBD66EB244EF0357E6DD66B438E5D8 CVW24
1,666,297,410 *AF5AECA86AE6EA9D4FCEE2B3BFA152B6D0CCD403 EZEKIELNORDEN
1,666,297,411 *AF52A15A90FE428C3BA016B5162FBEFDBD82CFD9 cwymi
1,666,297,412 *AF5A62EB9163C685F35523BA8A6E0248B64F451D F46621706
1,666,297,413 *AF5A12C637B2F9C8A82AFE6F5186A38935AED69F CYCLOPEAN4YOU
1,666,297,414 *AF5972C65A624EF348FB8E28BC127619503D9512 cydo
1,666,297,415 *AF518ABEB20A7518369733C7D16A8E213618B33F [email protected]
1,666,297,416 *AF5DFA66BE6645E8A9508436050A2502CF6A4D7E faonnais2
1,666,297,417 *AF58B004F6A8162108FF80FA629EB90E6D7AE629 d0shq
1,666,297,418 *AF53D1EFD9C31CFB5CC926490A6F200600349E83 fawcettsing
1,666,297,419 *AF554E6FDFB837270AF3BAC5F98B6BA33CA16BC7 [email protected]
1,666,297,420 *AF51ABDD17D4646E620BEEA1D634076C3D39FB88 fennimore
1,666,297,421 *AF5CD127BCB04F6541CA6363885BECBC977B68F1 F-KQ
1,666,297,422 *AF57A2A39D25A6888B7B7055632519CD965A15A2 dallasnanna
1,666,297,423 *AF5A525428CC52F1A0CF06840D74F0E919431F1D FORESTGILLOCK
1,666,297,424 *AF5A96C496C1A72334FE41F2920189863C533245 danacienfuegos
1,666,297,425 *AF5A573350C6DB0C53BFD7E7EB7A8556E1CD30CC dangułow
1,666,297,426 *AF5134D46FE39BAB7F1E03A8E22ACE214DEACEFB fosterson
1,666,297,427 *AF50B7A3B60A0CF01F541B8147FBD068CC695B8D franc-1
1,666,297,428 *AF517D778E026B8B1A61D1A5A02E59720212AA6B darrindigsby
1,666,297,429 *AF54777CB34D3B37190E8B1FADBDB9CD5ED730D1 darronlouer
1,666,297,430 *AF58376706E2EC30B92A79D2E2A8E6D10B791A02 DARYLSON0
1,666,297,431 *AF519BE99F336213DD5685DEC1EC4317B8CCF947 DB2009129
1,666,297,432 *AF5BFB850B3A25A6B90D1AE6A3C40B9EBCCAFED6 DBeu
1,666,297,433 *AF5641D10185FBC462C71661EF54C4DAD812E360 fu?aaa
1,666,297,434 *AF5EC69037722768EFD7C74FEEB70A9EFE8FD997 df.fw
1,666,297,435 *AF58DDE3D99049468C5CCD4A12F6F41E5E92A743 DICK.PENDRY
1,666,297,436 *AF5CF2E4751B84DC60173C93AC3FF32EF99C677A DIETIST5
1,666,297,437 *AF5AF24A0D73B5A07532E2CFCF3D3874AB2E51FE gabriel-caleon
1,666,297,438 *AF5BA068065C5C8F853DC8673FB2AE3EF4216BF7 DIVORC8
1,666,297,439 *AF561CAD2A1AEC8CCA5A02AEA4CEC7D903E98B09 dj.chillfreez
1,666,297,440 *AF5A7C9C1556C1E96A047A4340F529B96C3F4D24 garry.welch
1,666,297,441 *AF5349D2922D1F08521DE578197BDD088AFC6255 [email protected]
1,666,297,442 *AF529DDE86EA70E7A714EAAB588A1D8A4C069EE2 GARY.NYBO
1,666,297,443 *AF52A909044F87AE35F8823FF6C67EFCEC7A5B12 gaylordtaper
1,666,297,444 *AF54AF21553A1B495D0DF71DD7E84B3B2F81C1F4 GBP6
1,666,297,445 *AF59C1A4558E3837289538A3ACA6FA7BE4DAA610 DOCTORPRESSURE(DIRTYVERSION)
1,666,297,446 *AF592C9C51A6E7AD18293F9772EE9D2137F744DC GFKV
1,666,297,447 *AF5FBB88DB3C31E29C5A9B6ACF7442087EEE31E9 [email protected]
1,666,297,448 *AF58CC762FECCC43DF3CC3F55B334FD256D83E51 dorseywartenberg
1,666,297,449 *AF5B7BACD28BB336D211870508031775FA7B825C DPHTHRLING
1,666,297,450 *AF51C20138AA8284A2A8CF8EFA41B254049FA137 DQ6II
1,666,297,451 *AF5E88D89583F1E49761F9DA55A2DEEC98C62B8C DREASOGA4
1,666,297,452 *AF5461E7776C5053E2C42B002CB2FD6C9F75CE5C drillingthroughlymphaticmembranewithacorkscrew
1,666,297,453 *AF54AF85EC6564B79E0D1D0A8E83A3DEE4622BEC [email protected]
1,666,297,454 *AF5BB4F99B97B9F5B32E5BB5F36D8E45378A3B72 ds226
1,666,297,455 *AF538284DA4430CF4F16B9C14EE7917AA860220F [email protected]
1,666,297,456 *AF5F638A43B26CB06E0CF19379B7EFBE486E5BDA guomindang.antibs
1,666,297,457 *AF5536A542FA895759399E58E06023017119D8A5 GUSTAVOCASILE
1,666,297,458 *AF531390E0C6464EF0562186BAA985E04A8D4C65 D"U#O
1,666,297,459 *AF593C3241EB8EE66614475D4A80DDF9255D7173 DUTUW
1,666,297,460 *AF5417F36DDAD44C595CD1F963A9099A10757FA2 DV(OU
1,666,297,461 *AF542B9B9C07305DAD3890FF00036D1BC1A706A6 EACPQ
1,666,297,462 *AF51BD11FE0E8AC126FC3A7C265981A99C0DF38F EBOITERA4
1,666,297,463 *AF5BC112CEDB1A6E2F3EEE2381A2890DE6F39250 HARMONIA
1,666,297,464 *AF5E87E54343CC215FB2F92B04D4CF30DA45140B HARRY.LABRIE
1,666,297,465 *AF5C2C99D0565BCBF650372FC2E2FB20B6A4F9DD ederpsar
1,666,297,466 *AF58C76C30B8D7C9FBCA1EBC5CC53EF53DDF646E ha'shir.shel.mimi
1,666,297,467 *AF599651B12E079906CEFAB096D67B658CAF4294 HAYDENDEDOMINICIS
1,666,297,468 *AF5A5FB43DCE02F26CC9FD1CEE60C6D8B37C2548 HAYDEN.HUMPERT
1,666,297,469 *AF58B6D6B8C2A4BF2FDFC14864246ABF634283E0 ef=oa
1,666,297,470 *AF5C871C26C95AE629AB1FA974B4E6882AD186B1 el.
1,666,297,471 *AF52C795E827EB649381A42B0194CA175030D58C ELDONBLOSCHICHAK
1,666,297,472 *AF5ECB22F2CEB8998D29B86172F896CEFEF4451F h'ij
1,666,297,473 *AF502D999174827A86445457AA663DB8BCE1B421 [email protected]
1,666,297,474 *AF54EF12090DBE79F74B0E5CB9BD814097813D74 ELVISOVERHULSER
1,666,297,475 *AF54DD9B65D7A095709C2AC756613451390304D1 emasni
1,666,297,476 *AF5E1E1505AA9194A9D1FC2F96F4B01900D99B1F ENDELSTOW6
1,666,297,477 *AF536E6B78263C6E52B1B3AC7ADFF38C8D7BCD7C ENGINEERSDANISH
1,666,297,478 *AF579AB356736D67238B068D6875F2ED8544EA30 HTTPWWWANSYSCOMINT
1,666,297,479 *AF50339CDEEA0D1ED491679F33DCF5DAF092C15E HULLUUDESSAAN
1,666,297,480 *AF58CBA99FD8C901666805F45D027B95A41AFFCA EOLORUNSAIYE
1,666,297,481 *AF51563790CB0FB7A5076ADCE9B4AAD45A541A37 HUNTERSORVILLO
1,666,297,482 *AF541E8161BA3E94795219F4941F922C6C1F2FB5 eq5o4
1,666,297,483 *AF52B8123499058D79A05A537BCE954C55B46950 eq#tf
1,666,297,484 *AF54A7185E6F97CFA374884266899F9A142D8B87 ernesto-juarez
1,666,297,485 *AF52A753410D8C877CCA8A0CF9C761B0FAD955F3 esq)n
1,666,297,486 *AF57018D6DA9BCA5234E3D3B17CBA605E2514A45 ETw,
1,666,297,487 *AF5FD967D3A02A06E481D3F1A34D1D1FA2D5042E excepables
1,666,297,488 *AF5E0955EC2C2E5F5446A381E91B3715F583DAF0 IEIZIPS
1,666,297,489 *AF504B5442E005404719146733097B4B6BA3D38C EYA-PATAG
1,666,297,490 *AF518E6E3CF7915E733C74C5E407C68F9CB0BBF4 EY)IO
1,666,297,491 *AF5BFCA735713228C2926F0FFBCF6A97AABA5A81 F'3K
1,666,297,492 *AF5A4BB4FDA52F7F97ED88538DCA7CCA7B467AEF [email protected]
1,666,297,493 *AF575C3C713AABA1AB47AE68DCCFD8AED6E7FEF3 FEODOR---NURSE-/-EKH,-M
1,666,297,494 *AF5DD59EA583C09ADDD585CA56E6254D20E6D9CF INDIANLAW0
1,666,297,495 *AF5D2EDBE344DF58A50D44B11313E48AB816E034 INDICET3
1,666,297,496 *AF5079F74AEEA4C2FD102653FC1C1B40119EC97D fletcherholdt
1,666,297,497 *AF53916D543D9179D14805236D8004964977A35B [email protected]
1,666,297,498 *AF5FEA5AF58B9B140D55D2D17845775DA0C18E7E INGULFMENT
1,666,297,499 *AF59F9DFA2ACC56574802F6204D05C8289F6F7F6 floydsass
1,666,297,500 *AF59AB6B9F644F7CBFFCEB24202E995761931C2D [email protected]
1,666,297,501 *AF54C6F20B1B065EC7D0072AD05ACFF3AF4A06AA FORBUSCH
1,666,297,502 *AF5D51102B3065A1D67CD1B66C37513865F563D3 IPEK-DEMIR
1,666,297,503 *AF5B405EEDC31AF33904EF33414D125C6DCF2736 IRA.AWALT
1,666,297,504 *AF56C674A29A27DC6503016424EE3B8B0E899B66 FRANCESCALCAGNO
1,666,297,505 *AF5FE53ECB0FA746CCDAE08AFF715E7741F16C15 irox1234
1,666,297,506 *AF5391D9F3C79976736DECE33BC025C496235F38 IS{A
1,666,297,507 *AF50BD843EBB58FB2BE3362BB8727A4507B3E742 IUDFXUR3
1,666,297,508 *AF57A6CD7784EBB84CB0A12BCC1560FB1A72DE6E IZUMIMARIN
1,666,297,509 *AF5C2045B6903B8A9665C40FF17F1AA449D1FB5F FSITETI
1,666,297,510 *AF50758B4B2748DEA291CCC61107E3FA0651EB4E [FTPRF]NICMERITEDU:DOCUMENTS/RFC/
1,666,297,511 *AF5C8776C30AF2C3E5F332FD11BF3D26626F0B75 jackson-national-lands-lugnuts-field-naming-rights
1,666,297,512 *AF51184E95AAF7710EB56D213001295CE2724341 jamarzange
1,666,297,513 *AF594911C3729C8CF1DDD01B9F5B903CE6AFC0D8 GABI-CRISTACHE
1,666,297,514 *AF5D1145F034D2C12742C106D2C02D8DF9444A5F GANJU.SHIBA
1,666,297,515 *AF5CB6F7F5E42531B36D38B89652466D1883EBC9 JAMISONANGER
1,666,297,516 *AF5F0761410AC77F9876A3013D15C218E7009274 janainsley
1,666,297,517 *AF55E3525DAEB9E05E33AFBD9B96B747AD8BE29A garfieldminn
1,666,297,518 *AF5126279EAA919E053933DF0EF91ABB3A70937D GARLAND.WOJNER
1,666,297,519 *AF546C0228BB381A27CF16E7173030CAA821B7A6 JARODCASSELLA
1,666,297,520 *AF58EA845C45FA48EE50052807F6B6A84E96E674 JARREDTROJANOWSKI
1,666,297,521 *AF59ADC88802E44A265636C55A5EBA576C9EEC6B jarvisbeatrice
1,666,297,522 *AF592D06F4EE5FD59077F6474B496FA9772E65C4 JASMINE DESIRE
1,666,297,523 *AF5FFD929FAB663D46D3340D63DBEA5306523D58 jayleen931
1,666,297,524 *AF5B062FD07AD208A4C9100C7E0144FB94641BF9 georgeaburto
1,666,297,525 *AF54B21FAFB10FF96D317263ED8B62BFC09C278D getty55
1,666,297,526 *AF5673D0597BF3F149FA81DA8E26262956C98B30 [email protected]
1,666,297,527 *AF5BE883BD6D3AB42E9799B7C6AD5A6F149665A9 [email protected]
1,666,297,528 *AF5FB068634E9172279DFF3051743B46BFFB8B79 G<KAAA
1,666,297,529 *AF548D31DA79A6C87638346A96C601B6D396ACEB GLENSIDE»
1,666,297,530 *AF5CF4D85DE5D5D5D8A70418AF6DC35ADC158325 [email protected]
1,666,297,531 *AF576910A9B26107DEAB9240505EB4E4A710881D JOHNNIEALLENDORF
1,666,297,532 *AF5EFE32FA448125ED5BEE5492768360F133A3BA johnpaulcaspe
1,666,297,533 *AF543F55296FEB13C02D718E2EE43FBAF44BB2D7 GOGALADOMINIS
1,666,297,534 *AF5FDA84728ED84A26E6D48EDEAE5114584C3BAA JOMBITSQ
1,666,297,535 *AF58AB27C113CC66CC94ADC9A43F233CA4F333EF JONATHANBATTA
1,666,297,536 *AF5F71960B4FF74FC2CC18832EA2B05C85096D1A JORDON.MARGUARDT
1,666,297,537 *AF5ADF1F97BA4A4F7EC385770AF063A864C98A30 JOSEPHELKHOURY
1,666,297,538 *AF53056FB80251FA40DFB9FAECC2C7A3665BC75D JPASCHETTO
1,666,297,539 *AF5EB9208660EB490A7524A6F25897C126241391 jp.mcauley
1,666,297,540 *AF571E673B57920BEFE72D438CFE10686F851394 JRUMMUN
1,666,297,541 *AF59A6DF15568425180D4F07BB27B02B7C49358E [email protected]
1,666,297,542 *AF5FEA8C95ECCC5F779FF2960395B804F75FF9D6 GRATE.RAVE.TRAIN.ROBBERY
1,666,297,543 *AF53AB1E31877F110C2EED4B70CE383F90E25AA3 JUDYDIGITAL
1,666,297,544 *AF50E06E68CB6BA712F293CC9F611D81F0634A02 grzadce
1,666,297,545 *AF5E62DE33BD5CE26F4AFE24CAC4D7E4FAE0E94D `K,
1,666,297,546 *AF5C6828212A887D1EF4CE82CC0220AF45F23AED K145615
1,666,297,547 *AF52317B2E20F4927A250F301CD5C5DA127251ED K1W3D3U
1,666,297,548 *AF5766D8EFFDCE2D0C4DF9F5E5C57446CC4C0D76 [email protected]
1,666,297,549 *AF51292DD8464B245359317F7EBE0E440881CB7B h13ro9lyph1cs
1,666,297,550 *AF53FE73B35A18E1678E6A921C8D22B8F58799ED karoly
1,666,297,551 *AF5A5EA6C681BF4C9FF1AE9369D9F624C009D24F KATEHAMMETT-VAUGHAN
1,666,297,552 *AF5D73849C2027F87829D307E28D85CB7CD78FC9 kendrickbatterton
1,666,297,553 *AF510348BC26D5E0438A158800907E3AEE5CF244 KENNETH.LUEBBERT
1,666,297,554 *AF527B8FD893DEC2C2A5C3BA1AD50AB258D24BA4 hassanmurray
1,666,297,555 *AF57F1D761DD8D08F717569DB64B22AED77D24C2 HCIRWEN0
1,666,297,556 *AF509CC18CBEEF96B00E6F478B0BAEE5CA0D0B68 hcsegnie6
1,666,297,557 *AF5836A8E8B030C9E7252198DE7DAC0BCE3F6C4F hectorad0
1,666,297,558 *AF5E4CBB39A60CB66708DD343EDEAD16144C2941 KeyboardSonatainCminor,K126
1,666,297,559 *AF56433D6CDAECD717DA55768B00ED4B54E28348 KIM.BREITENBACH
1,666,297,560 *AF582EF2399B81496EE9EC543DD85E4174217EBE KIMMIE-PARRISH
1,666,297,561 *AF5469793EE66236DCE2ED0AD76DB2CEEB31EEB8 HERMANBOCCIO
1,666,297,562 *AF5F85E4C7DA2F9E08C8FA2F2CF969BA3429B7B1 kkq;
1,666,297,563 *AF506D3158C1CC2B6D48864FCFB3D92380C8ECE6 [email protected]
1,666,297,564 *AF5D41E7FA3BC1813A788E37DA9255ADE468E2D9 HIPHOPBEATS,VOLUME6.7(DISC1)
1,66