List database


# MySQL hash MySQL password
1,666,280,001 *AF551007902F626F93AA6DEF81EA1D434D26C011 010dominic
1,666,280,002 *AF5100C58A2807730537F6E6460D1F65C9FD9759 072KANE
1,666,280,003 *AF542F147CE4502ED82774F26BF838B42CB88934 06-10-1211
1,666,280,004 *AF5EC92DC734813DAD0D106DFB26871F20052F70 BEVERLY.WOLD
1,666,280,005 *AF5490F5D9EAC34F6A09041EF95028F3CA10BAC8 bh=8
1,666,280,006 *AF52D6B833BD401DA477920959EC6BADA3F5F13F bhs6o
1,666,280,007 *AF5B8F4811724230202E8B1990324A69B8D71599 123360 ANNASARJAANNAKOTIMAISTAKOIVUAJAM
1,666,280,008 *AF57B245DB991ACCE49008D9F9AF6BD328FD002A 1234oo
1,666,280,009 *AF571FD44EAFF64A9203764B1FB1EC3854E6B371 1170086 theallordinariesindexalsorose
1,666,280,010 *AF5BD6D9CF3E107231A7E731022F32F97464E64F 123REDNAS
1,666,280,011 *AF58D217B01EDB1AAA60E5DF10894E9F01890642 1480834 miten-hoidetaan-ruokayliherkkyytt
1,666,280,012 *AF5C7D45D90E7DC8D527B3BE9D7D1CD8097D27F9 bjc2d
1,666,280,013 *AF5ADE70A838A3E302B5DDC62DA059A49755E378 BK-0
1,666,280,014 *AF585E79D690211508D5EF38E066C9BB2C897956 1385984 BEIHAASBESTEHTOHNEHINNOCHGROSSERNACHHOLBEDARF.
1,666,280,015 *AF5C2D1433E0495447BE9A2548333CB1EAE8FD48 1728ad
1,666,280,016 *AF58D5CFF8B52422AC266F8F13AF62377B0407A8 1445264 LUE.LIS
1,666,280,017 *AF59B9904373CB20D0393640389421F7E9621445 bobbyhauck
1,666,280,018 *AF5DBC721D049245549FBBA30A91C2C2367E343A 1590690 matkaan-ei-kulu-yht
1,666,280,019 *AF5B95517AC143596428872963FA0EB95A27085B 15.LAERMGEPLAGTE
1,666,280,020 *AF589942FFED62921042FE97BA8E3F9F614EAEA1 1615182 INTERAKTIIVINEN DEMO ( 66M ) LATAA ESITE LP130:ST
1,666,280,021 *AF56ED874D5F87067166B136B68D5AB174E07DE0 boy=1
1,666,280,022 *AF5C90B471759A11DBFE05C64848A1DB94F18333 1.BEHINDERTENSPORTGRUPPE
1,666,280,023 *AF5BC973EEB393E7B712B7950669E37092739F41 1bgaaa
1,666,280,024 *AF5B04CA21D907A2FD677A1EF7372AC96B6D60BF 1DQe
1,666,280,025 *AF5752D6173E59E34F77F0A40417025801C694D0 1-EISHOCKEY-VEREINE
1,666,280,026 *AF5237FE99589E459C5BD272E938BD387B48A582 BRANDENGALASKA
1,666,280,027 *AF523DBD0679BDC74AB5DD357E878E5EF703A09F BRANMIKE4
1,666,280,028 *AF5543E9048117787E1A6A8B23288C4E5D978841 BRBH
1,666,280,029 *AF5F0B790F938ED8AF8926BB0F603592C9CC2958 1.HAIMATULEHDUKSISTA
1,666,280,030 *AF55F9C623369F5D2E21A20FCF3F6D7D783E0E47 BRIANNA GREENSIDES
1,666,280,031 *AF5FED967B878AFA7989B5FE442B3041FA43D93F brianpardini
1,666,280,032 *AF5C1AB42273206598C3581885A3E1F4BDFE936E 1-HUBSCHRAUBER-AUFTRAG
1,666,280,033 *AF5AD86CE32AC55F83FEDF62BBF1C4CBDDD00C78 BRKKENE2
1,666,280,034 *AF51B4C54CF7B41253D3F33ACF85A5669F7D4DA0 1KNUCKLEN
1,666,280,035 *AF577A0C632F95170E5D9FF3533E016AEA560EBD 1-KONTAKTBEHANDLUNG
1,666,280,036 *AF56AFE8F3A8ED1C99780D93F750DEC9F3C692FE BRODERICKLENEAU
1,666,280,037 *AF534385E431385F80A5748C91B01941F2C154D6 199DAYANARA
1,666,280,038 *AF52E3C0161195741E38FE269932E2F29D515B47 BROOKS.KEATOR
1,666,280,039 *AF54EE40F804BADED7DE696832C19CA8368D2131 BRTNR
1,666,280,040 *AF5194C13678038FB2EC1F648AF72E12E207DB56 1 MUISTIH
1,666,280,041 *AF599634C6538FCC1FDB057C84E83CFAA37BE004 1 OPISKELIJANASIAINP
1,666,280,042 *AF5B21518E7862994EE4AD16C3F45F6FD3B31E21 BTOZI
1,666,280,043 *AF5F19B3078FE887745BC854B9E136C828A7AB7C btwgw
1,666,280,044 *AF5433B4BDEEAB893E4AAC8F78600955B7967BFB 1Q28955
1,666,280,045 *AF5785F80D3070D153F7F6C5FE3B0EAA92BDCDAC BUDDY
1,666,280,046 *AF59859F4362EE8D1BE7362726DC0A03F9DC7CFA 1SHELSLEY
1,666,280,047 *AF5BBCFD91FA32C20D6D6D77FF650F71CDC43A92 1SIMIANE
1,666,280,048 *AF5C6AFEDA0381BD92CFE7E576B9346035F39E3C 1-HILLBORG
1,666,280,049 *AF59E285D70A6517E73DB9C02BBBACB5B14326D6 1-song-lines
1,666,280,050 *AF58B8464BD65E11942352E2B76992DE866B0923 1hyytyisi
1,666,280,051 *AF5C458D323A15877AFB6ECE52B33B371F8EAFC5 1-TEENT
1,666,280,052 *AF5724F9E1EDE7CC70D2C58A3671DC0AF1F3F5AE 1-koirakoille
1,666,280,053 *AF51F16A15A193EB5A4838EF3B0DC2848293B2EE 1ulkomaalaistenkin
1,666,280,054 *AF5AD2F71074C122128FA87704B6CAA9AB4DD6B2 1-YASLANMAMAK
1,666,280,055 *AF5DC6EBC7BED9287D9C1A30164103DF08E2327E bv;eh
1,666,280,056 *AF52CBE272A0A29074EB5DBFE3BC884935406CF5 1nh3r1tabl3
1,666,280,057 *AF5A6CEB14BCB7F906941A228D0A8188F0942A77 1 OPISTAMME
1,666,280,058 *AF5FD504D106DA380C38B04CD0F4B90F4EE3C1E4 2005-01-29:RHYTHM&BLUES,CHATTANOOGA,TN,USA
1,666,280,059 *AF5AF5A2E3DF17F847AF386EFF730FF9CD81619A BW&M%
1,666,280,060 *AF5A67910B279EFA32DCDA86ADBAEEE05EDAD3BF 20473
1,666,280,061 *AF55097F98A3B6469CAA73E30C70514A8F044C57 20MEYERE
1,666,280,062 *AF522690C4480338422D5030084CEE0D836C7635 BXCEF
1,666,280,063 *AF59099331AF502C1DDF3015261BC8C28292343F by85p
1,666,280,064 *AF5A24C3B943D75708E9DA49D588CCA3C11C88E1 1SEMEOLVIDA1
1,666,280,065 *AF5BF67BE598C09F9D18D8AF91F32EABF2F400B5 2609785 SIKSISEITSEM
1,666,280,066 *AF5B6FAD34247CE06261CB4734373BB6C17A34FD 2736ratona0202
1,666,280,067 *AF563C4F4920244E0CEFF67061CC197F261804F1 2ALLUFROK
1,666,280,068 *AF5433C20103BE90FF2694BFF869A2AE9D8371DB 2GLWTJSV
1,666,280,069 *AF5A70B13A32448B04BDCECB77BE67D992B3D689 2IAMOU8121
1,666,280,070 *AF58DE860D2521834F9A8A680281A78F8CB29201 C?a3
1,666,280,071 *AF5E37B33CA1ECE31E486DD346238E34A38584C7 2NAHSAPK
1,666,280,072 *AF5980FB03DF098B9E245FBDEFEDE835B1BFC825 CAIFANGFANG
1,666,280,073 *AF55D38EEAF77D677BBE301ABF02C48941760981 1-TORILAVAESIINTYMISET
1,666,280,074 *AF557D5540F0A75C096F660C0CFAB87F1944DBA5 calia386
1,666,280,075 *AF566E183FC3259F58C592940F03CE9CB43DE24A CAMPBELLWALDROP
1,666,280,076 *AF519B8971918FFAFF616105249431D2205CDC75 1 YKSIL
1,666,280,077 *AF52B03F32DE128BE9B0BE12AA3C7CADB08E3E59 2039569 koski , mervi : taskut t
1,666,280,078 *AF56A36386DAA1D7E40C3F88AB38940649D8AC70 2112446 KESKUSTAPIT
1,666,280,079 *AF517E470A4EBCED63E18817791D66C3C4B6F336 306JONAS
1,666,280,080 *AF599671F30A3E9692B05D4B2265B5DD87F6E157 217E166B48B2DCA1E784607B89897FC7-ALKEBULAN
1,666,280,081 *AF5DE7691BFD44BDCAC7EB87205784E72212EFF2 carmony k aa1 r m ow0 n iy0
1,666,280,082 *AF50D670D13D12F0D394A6030BB689A428EDC9A5 2230116 ueber den gesamtsieg aber freuen sie sich ungeniert
1,666,280,083 *AF5F69DA14AF4E94228CB1B08CD54FEB330E76E1 234357 bubelgelergonderilmeden,t.c.
1,666,280,084 *AF592A886063ED3DDA391657045A3949921DB2CA caryflorczak
1,666,280,085 *AF5B49CF40DB1FB6F92141C10455769369BCD448 CARY.SEAHOLM
1,666,280,086 *AF532A96B59233276C4B1E052629C665B455D556 c&a+s
1,666,280,087 *AF5E9220244AA76CF71B5C77CDBB740B93F3679B 3ALLENMARC
1,666,280,088 *AF58D279C6A914AC51713A42B2BBF2FAB2D213D0 CASEYBUFFY
1,666,280,089 *AF58019230AFF9FCE8A84ABF4CE48279526E81A3 25DASSCHWERTINDERSTILLE
1,666,280,090 *AF53D0EC270191B2F853F199BF27893A6D15CE20 3 FIRLES
1,666,280,091 *AF59C454F141AF212B4A996E82D89056EA6E1851 c,azl
1,666,280,092 *AF5A2238B4C507C3B83D19943AC72FD5FA186C29 2989771 T
1,666,280,093 *AF59C5D9C63F8017490CFD29EA517E74997A4D7C 2ABGEHALT
1,666,280,094 *AF528F679A30739BBC7A26E2A365AC73651663EC CBRIN56740
1,666,280,095 *AF5F3B87391852D72B830AD918BCFBF02401DE84 CBTU
1,666,280,096 *AF5C078E81E01EF98DB7EB1662CCA06EABB77D2A CCO.M
1,666,280,097 *AF54D5F616500E4CD1B68953BD3A6A66D5493CA7 3.TARPEELLISTAKIN
1,666,280,098 *AF559BFE6E23EE4D5007AD0058781A03E16ACAC2 2-kapuzenjacke
1,666,280,099 *AF5C2B453DBE5625FC58ED7F966A3F0238A1178E 2.KRIEGSERFAHREN
1,666,280,100 *AF5360A503E30453B1EA117FFFDBA558310A8AA8 C.DY_
1,666,280,101 *AF5090353B8E82E52B0A48575D39609CDDD1F090 CE5B
1,666,280,102 *AF5BE7D79F64FA3357CDDCF1022FCED0A3E59C61 CEDRICK.BABEU
1,666,280,103 *AF5B3FB8B77C15BB999039DE93B0B9582FA048C6 2UNDERNAME
1,666,280,104 *AF57220E4CD77B6A2CCF69BF517EEC8D0061E992 3.05.1892
1,666,280,105 *AF53FA6FAA4960698E842515B6BDC73F31E89F11 CEREBRIC
1,666,280,106 *AF5E04361E55FB69B67D244845840DBCA13DD12B 4EDLEWORK
1,666,280,107 *AF5AA4EFF26D3DDF936B9157421864FE2EC0E79C 4FORNAGE
1,666,280,108 *AF565BD64749D29B7AECF26769812C13A5E9D273 4HCAFKNAB
1,666,280,109 *AF5E8E14FCA5C6B4933AC6283E0819BDD758DA0D 3ALUKSESTA
1,666,280,110 *AF53B898E878335477F01F30FA5530BE46297C8B 3DATALOG
1,666,280,111 *AF59D33CC679C3CDB555CE71A07DCD7E0959F721 4LIFEPOWE
1,666,280,112 *AF5A3CCCB3649D59891B2929B21A6812D9AC6728 4MATRIXCAMPBELL
1,666,280,113 *AF528097368E00B04D1BF1476AB9CF26CF262FD7 4MYKATERINA5
1,666,280,114 *AF54A02B19E219B8987673934FF0FABB119DDF5B 4ORIONBASTARD
1,666,280,115 *AF5E0D9FBAD92A763790740D1D956A22D78E7B5D 4SCOLDSSCOLDS
1,666,280,116 *AF52886DD961E6B73D7EDFDB3D5D03B0C4960E7C 4 VALVONTAVERKKOON
1,666,280,117 *AF56712C9B37CCE1A9E62F60FA3F473B357B022A 508292 TUTMA-YERINDE-"-JOHANN-FABER-"-MARKASI-YAZILIDIR-
1,666,280,118 *AF550DDC4F2B881A29E466C3E8E8F38C3A02A2BE 565ANGELA
1,666,280,119 *AF58651B54E5CE358D51D901F6577F4B78E9ACAD cf+#(
1,666,280,120 *AF5FEA12FAA9DC95467FD17518F86CA18FA8D585 3==p ~o uu
1,666,280,121 *AF568DE9BCF4E6EA836BA22C57021BAB443119B9 3===)`~`~Splat
1,666,280,122 *AF58C29A5A91EDCB1F0CD704EF310A491CFF8122 c,;gg
1,666,280,123 *AF5DF11836245B5D8590D12D4CB6D21770891EA9 CGWL
1,666,280,124 *AF5733B0AD97BF4C337BBFACFFADDF5CF74B464D c!h9
1,666,280,125 *AF55577C1059DD5E34A73E3CF924A25A877D8D3B 4955743
1,666,280,126 *AF535FE03351BCD734A60F767481EAEAB09FD254 Char
1,666,280,127 *AF554EF83D93B0C48FE0F895AB03E16A735D191A 4DEMMEGLR
1,666,280,128 *AF502C49144917943C486CBE82EA04090D590B0C 4EVITARSE
1,666,280,129 *AF5CF461FB19EB0842B7AD825F1065D67876D665 5KYMMENETTUHAN
1,666,280,130 *AF55C16EA87C6B39014108327A6100C81BC2FF26 chc)
1,666,280,131 *AF5967B20B5FB6B244DFCB814400067B3E50D142 5.neugeschaeftssumme
1,666,280,132 *AF5A3E7234F5AD761F140BDA11368AA8FE3C5421 5NOLLISSU
1,666,280,133 *AF5EA30C18FA4C30A8299B20F102C62292E87B09 5 oecdraum
1,666,280,134 *AF5041F6329AD88D62B49661508CA977E585934B [email protected]
1,666,280,135 *AF582B5F6B58EA26CC22E7B1E4A075F53149B53A 4MYRMEDON
1,666,280,136 *AF53B67107B64CDB5CB744B06BD2F42ABC53011C CHETLAHREN
1,666,280,137 *AF521A1A3EF3F742050148AE4E85D6B72FFF8E9D 5SHAUNICE
1,666,280,138 *AF520AC7FD0693C4C95A55698E6EFDF5EA62D7A2 5thatsuckme1
1,666,280,139 *AF53DA4C547F59C873D4C43EDFF2296CDF3BD6EC 5XAIRETISOYN
1,666,280,140 *AF5EBF9B14F9A3AC25B7D5D2BB484D40F32A7439 5ZEALOUSUNSPEAKABLE
1,666,280,141 *AF503D6ECA5A0839AE0E51C9FEDA49C163AA086D 5 ZUSAMMENROTTEN
1,666,280,142 *AF59804022B0755505D2339C62E1AF99338545DC 61-minutes
1,666,280,143 *AF5895A9312FD4F06DDABCEF7B3C7D8D5F324E50 CHUNGTUFNELL
1,666,280,144 *AF5A4C95A82E48B34E0A80C0FE1481491C781AC9 5BSWMEDDINGS
1,666,280,145 *AF5D3AFA7C2FC1FCE61AD8C32DEDAB21F798A2D7 698489 josh
1,666,280,146 *AF5FCF3B843E9E7B6A6C581D866C7AB0F561ACAB CI"P_
1,666,280,147 *AF5B42782C5DF2C5742BCF5D786C0763CA844849 CJ122
1,666,280,148 *AF5CE609EAF3314EE941ED56651784FA7EFF1D7B CJWMA
1,666,280,149 *AF57F52634054808811925B6A8E1283767574FE4 ck;fh
1,666,280,150 *AF5195BFD54E6FEDB2C80433A98DFF436CB6FD84 CLAMARAS2
1,666,280,151 *AF5FBCE15E5309ABB53601796415E10FC1AD4370 6GNUGNERT
1,666,280,152 *AF5903755BA7FA0248EFBF63FB98978BA0FAA31F 5JOCOSE
1,666,280,153 *AF50B5220BF7BA2CAF98A683E33C90EF8830166C 5LEGENDNIKI
1,666,280,154 *AF5E7B47ACB1C9329869469FDC166AD32D77C6D7 CLINTONENGELSMAN
1,666,280,155 *AF57466AA38D64E3A92BD2FD5A0CA51A11D38805 CLLQS
1,666,280,156 *AF59D0B309CDEBF722B3E01D54AC15CF73EE116C [email protected]
1,666,280,157 *AF5EE3D8CD226183F9A05BB5A34BC396D82E8E14 6ONGELIJKMATIGST
1,666,280,158 *AF5A0F692B7BC8D425EE3F9FB634180ACC4FB27B 5QUELLENANGABEN
1,666,280,159 *AF5CE8C297BF0284099A5F61DBA053F7E911ADBC cnatn
1,666,280,160 *AF551D13F2B0DDB16357DB74B15793B6216B4080 CNE,
1,666,280,161 *AF5D10026E38B0CB69C1AAEABE71E35558590CBC cn"st
1,666,280,162 *AF536B1AC00838BBD1EB9BF6F65C11031E09873F 5WYFFEIS
1,666,280,163 *AF50BB6B40D70E0E4E690612E7AE0FA4B7636D33 CODYDALIN
1,666,280,164 *AF5E8D4A24C77D817E65D884DEE0F45B6864179D 640472 uckapili selamet han no : 79 eminonu / ist
1,666,280,165 *AF549EEA5ABC1EF03420E9B607DBEA0D0BFCD1D9 COLESALEMO
1,666,280,166 *AF5E3FF3E18EEE2A0BD0A00D413E0EC307949E36 COLLINALEXANDROPOUL
1,666,280,167 *AF5A10D3FA654A3976A7F57B85A83EF051526668 6acrasieae
1,666,280,168 *AF510930B9A48E4410C69AB9925430224B310ABD CONRAD.JIMINEZ
1,666,280,169 *AF58451CC17BF56076B168D3A544CA578D0AEB77 consistorio-nombra-hijo-adoptivo
1,666,280,170 *AF51E84858458012A60438B2A669187088C11925 762867 jostain syyst
1,666,280,171 *AF51B1ADEA70392CB827E2AA8E3A407DC1B6A7DA coolpad''coolpad
1,666,280,172 *AF5EFFF51330B4B3E3515642EED3C69F523DC9D6 copycatteds
1,666,280,173 *AF5657D92CDEDD612265C2DB682399EF88B8B787 6KONFERENSSITA
1,666,280,174 *AF5D37140DA1EF99C00016B5E55F3ABA2AFEAEB8 6MEROITICS
1,666,280,175 *AF5F0FFE18B93B148FB18370926E752F53A5CF9D 6MYRENEE9
1,666,280,176 *AF5AE3582794DEF3EB16C04C356B1B040FCF5053 6NITRUOCA
1,666,280,177 *AF51A6F6827F28B8AC9070AC0727C8FF94CE2FB9 7LINOTIPICA
1,666,280,178 *AF5A2A4F620330683A447979472D4E5DB8BD2E6D CpqN
1,666,280,179 *AF5959A9E6E999594EAB1E1D0E1504A1BCE3C715 7PHILLIEBSW
1,666,280,180 *AF5D00A38FA5464C4F8B309369E52FA3D3DE0EE4 6SPECIFICINDUCTIVECAPACITY
1,666,280,181 *AF596F1580C19FE2B804B817BF2E1F225AF64197 7TOYOTAGEMINI
1,666,280,182 *AF55B2803B69D410145F33DEBB48B845AB3144CC 7WBEATLES
1,666,280,183 *AF52757CC78D9026DEA3A5081B08C093D1EDED56 814272 koti-suomen poliitikot tekev
1,666,280,184 *AF590314F938C060B5E3A99B83F83E7B92DF633A CRXH7
1,666,280,185 *AF5D2D660812A30FCFB93653CAF6D948D9CE55AF 896738 HIILIJ
1,666,280,186 *AF5F48648848895DED6AAB2C82F41B1348DCE1D5 8AARDAPPELTJE
1,666,280,187 *AF580480FAA438C41206C084AA4F0F2939DA831C 8ACCAPIGLINO
1,666,280,188 *AF554B0673AFAD4B7B003C6CBA0005B495411FFD csfxo
1,666,280,189 *AF517F7CEBCA3EA60E0B97ADB7A0627F71E92208 8D.~0.~o3B<
1,666,280,190 *AF580B114D9E50EC20400C7800EB99B1079D8D56 C$U3)
1,666,280,191 *AF502743DB05CF86173FAD301DC20888EA2F767C cuc)h
1,666,280,192 *AF563C1CCA2B18C371D801438D8029DAE32CE203 7ilovenotta17
1,666,280,193 *AF5C9CB7CB1D03F52D11C6DCE3E8E798C35B45BF 8lemurine
1,666,280,194 *AF515C5310231D40844CAE87470ED344D9F2F708 7MYYVETTE5
1,666,280,195 *AF59EC8F90099873034E67941562B85CE999581D cypherios
1,666,280,196 *AF54BA90318AAD5EB62D4ABBCD5491C4C065314B 8==p~o(O_-)
1,666,280,197 *AF51274D0B811A4B66DA7E232E7E3479B14FD201 8SPEEDOBASEBAL
1,666,280,198 *AF52290F9245903FC9F4EB45888FFFA276A78B34 d15cr1m1na710n5
1,666,280,199 *AF5D4E4F7BA3E8C8EC3700B0A3E8DC11AB2C32D4 7-TUUDITTI
1,666,280,200 *AF5D62A8D300A145787D94045B7119E371EC680E D1K(C
1,666,280,201 *AF5146A8E142B2148531D2B367BB7E9C67AB20B0 [email protected]
1,666,280,202 *AF5F2932C0B8A5F635CDDF0BE8E1A5E502877168 850124 TEOKSEN-TIEDOT-JA-NOUTOPAIKKA-TULEVAT-RUUDULLE-.
1,666,280,203 *AF570B1DFD0DC9583E78CF03AE334225EEC5F5B8 d95hs
1,666,280,204 *AF52E2ADE136A281FDB0AF2B67953169A8B2A0AC 9BSWDERAMANBSW
1,666,280,205 *AF5ABA9CFF37786807EBEB21CFAC4682C47FF26C 9BSWMARKSOFTBSW
1,666,280,206 *AF55B66C332D2AD2D37100A60360974FF7B936FE damongodyn
1,666,280,207 *AF5F49D5315A7882E94D2D8064B45151372CA23C damonhobby
1,666,280,208 *AF5637DE49F5B1B3B8F24AF2EBFAB485034E1FBE 8BYGGEFORETAGENDERNES
1,666,280,209 *AF56B109F99CB13BF73AAA68EDA5BF6FA23C759C 8crystallisabilities
1,666,280,210 *AF500C3CBA33D25DBBBC29E77D045F622B6E268E 8DOGBERTAPACHE
1,666,280,211 *AF5BFEF7E2E2DCE2F7C7651C9790B52458A0E463 9EDNREDUA
1,666,280,212 *AF548C5DB2A80C287DC8EE28AA2E9EB6F89E72C1 }8{.~.`d------q
1,666,280,213 *AF5C2E7794934A1B3DB9F50B167764AEFAC69D60 8ENGLANDMID
1,666,280,214 *AF5AB5E9900C227D99EBBB2091D8F1A9F4C2E9D8 9ERTHARDE
1,666,280,215 *AF54F9B46018586927D442526F056F34D7FDFAB7 8floreerden
1,666,280,216 *AF58A6F3342AC162FC97C44D3C899D02057FCAFA DANNIEKELLEMS
1,666,280,217 *AF566EB6397FA46F3ED593EBAE26E3119A9E1A8F DANNYSCHADT
1,666,280,218 *AF5BBCB65D287B467165742F361092EDEA0345BB DANTE.CAYSON
1,666,280,219 *AF51B0C5925092F24E6E4636DCFC8B73EF82FBA1 darebbe.
1,666,280,220 *AF5356BFE2ED7921E007259D19CF80AB5DE86413 DARIOFINO
1,666,280,221 *AF58201B1FB9B82A17C2AFF8C4E08343F153C637 9MALAPROPOSING
1,666,280,222 *AF50A718F53E30250E9C01CF15378A8B476FA73F DARRELL.CAVALLO
1,666,280,223 *AF55E45859E420CA9C70C025C8C2B41BA9E7687F DARRELLGEE
1,666,280,224 *AF5BA1B33DB66D7017AAA11A1590E2F23A6B31BC DARRONCAVANAGH
1,666,280,225 *AF508CC21F5ECCF45C65AB0B6904ECD9632767C3 9ONTONIER
1,666,280,226 *AF5ADF466BDC92CBA10BE41325F158F4B026525D 8RASTOPINU
1,666,280,227 *AF51CDCE7BB8E95645D81E0BBDB20E673EE85D09 DARYLVANPROOSDY
1,666,280,228 *AF536183D0447C5BD68179DC330E644F2CE7477F 8REUNISSE
1,666,280,229 *AF5E9EA8A4062EA1A329F3B5457BFAB030DB2FAE 9PUPPYJOSEPH
1,666,280,230 *AF5784AFE98A87C1B653C46B490A6410D8C6A98F DAUERREG5
1,666,280,231 *AF5F3FF8AB60845F77E03007C6396ACB7870EFB4 8SIKERULTBSW
1,666,280,232 *AF5D84BDA29240F6ACCC39A19523ADE6CD1D814F 8THATPOETRY8
1,666,280,233 *AF51010603BDD37E88CD1DF69D9E4CE4F14D0A81 9vloerbalk
1,666,280,234 *AF55CBD6E94683C9305B26D1B61BD4B9F9874D78 ;&a
1,666,280,235 *AF5F41EECCB5586B417BD277B24DAB589E71E820 ddw1
1,666,280,236 *AF54ADD3C073E01EC861A88910387FB37147BD62 a5)=k
1,666,280,237 *AF5142509970585E6C8B770FDCDB8E4068561B33 9em1n4710n5
1,666,280,238 *AF54CDEE419B5CB75CB29373783AA1ABCBAFD6CB DECIVILISERAI
1,666,280,239 *AF5A9CCB9B160608BC4662D9028FCBA52D68B443 9HANNABRANDY
1,666,280,240 *AF5288F914E8CF5B3BCA69203AADD35A66FCCA6F 9IAMDOITNOW1
1,666,280,241 *AF50FEE1C5377149351E883C168E0F4960CBD710 9KIITTAEVAE
1,666,280,242 *AF59B2B1FFEC214072361DB3ED5669A5BD8CC012 DELGDE8
1,666,280,243 *AF5B51A23F18FD0BE3978FE0AB3E1367DDECB02F AAAH:Q
1,666,280,244 *AF5DAD0C0F73C5D557A3C0E98B374300849C0505 9POSTIINMAKSUTOIMIPAIKAN
1,666,280,245 *AF5C354ECAAD06F02AD5692F9A5A47A7733470D2 9RAMPONER
1,666,280,246 *AF5CF9A969D53BDA570AD65550E14F4A51993AC1 AAAUU
1,666,280,247 *AF5F90C8A3A766414F065A49BD99AAE9789B4BF6 aabg]'
1,666,280,248 *AF5230D9CCA3A2B45A1C50E513DB6FB77980D57D aab+r
1,666,280,249 *AF5362115DDCCA0215FA52B25F4253BBE5EF623F 9.viiksanlahdessa
1,666,280,250 *AF52005E6B3AC9DC8D702A199FF4F98A4FE33DB4 aadi|1
1,666,280,251 *AF5F902043165230D2D373386AFD599D6417F22D A+::
1,666,280,252 *AF50ECE1FCCBB840DE6611E6A70DC2D030256909 dextermechler
1,666,280,253 *AF530A0F0CA926CC544D21E4E2E1E3A4DC2FC7B8 DF:AC
1,666,280,254 *AF59451718A2E70BC9492330D3A7A92965104E3F abf3z
1,666,280,255 *AF56DA219DD7C52B5BEBD49AD708CE2803B416BF DINGKAILIM
1,666,280,256 *AF57DA3540451891B4F49CE6DF9C4F209E719116 DINO.CORDOVI
1,666,280,257 *AF572645C8DA7341CFB78AF159AA3F9CB621FD51 a;bmg
1,666,280,258 *AF57E2A13B91DDCE72AAA6B05A0469E190041110 AABUZI
1,666,280,259 *AF5AAD90EEDBED9AB1640E5DD9F2C715D2726219 abw;
1,666,280,260 *AF50E2035FFF6660BE807235CA2D31C76C05EB29 AADP_T
1,666,280,261 *AF5F4AEA99E0D517FD5B0E250A8D3D2466168194 AARON-MANUYAG
1,666,280,262 *AF51F2219B88EE84DAD49B577E526E91C30974AB AARONMYREN
1,666,280,263 *AF5F4DF138C13A286077E1F652ABE511765E22B6 ab1fs
1,666,280,264 *AF55B7C9E85289A2BE108F2E8A9CC147C3936AB5 DISCORDES
1,666,280,265 *AF56B715634A908926269477B706D12D099ABDB5 abehones
1,666,280,266 *AF5132EF7DAA10BE2FF41DBD67CA16986C621180 AC=DP
1,666,280,267 *AF5EABC8B58509340C452D21EAE7A62FE7002620 ABM!Z
1,666,280,268 *AF5BEC49DFCC37EEFAFB9850FD5995B8D1D03D23 abxdq
1,666,280,269 *AF59D0F8FD36ABDE74BA93F2129673EE7200F8F2 DKUEE
1,666,280,270 *AF5CEFCD035483EC4A766781B62C399A8C58B7EC ACCH&
1,666,280,271 *AF5BEF6C7443C4F05B20D3A14B503A80A3F2438B DlRi
1,666,280,272 *AF52A25D0645D4435C9AE9C17A016A6890DB5DAD adesojiolayemi
1,666,280,273 *AF501F3E25EE991C3569406A30B6CC82718F2F26 d=&lx
1,666,280,274 *AF5E07023BD5BAB7439539258BF1676C5E262093 [email protected]
1,666,280,275 *AF52B075D49A841D676D31CDA4DD877A22E4DF39 dmskf
1,666,280,276 *AF5BA36F81F862FD8E905D4770760040FB33D6BE AE_I-
1,666,280,277 *AF5985B82BAA1EF65721FA00D6AA7F23F1E6060D D#OJ2
1,666,280,278 *AF5E65D7FCC2D69108E1695496B36854BF0FB640 afslibberen6
1,666,280,279 *AF55A24692623720F175618761B4D4B439C85FFC ADRIAN.VOITA
1,666,280,280 *AF59592CBCF40B8D05157E9B215921B33C172E37 DONTE.PINKERMAN
1,666,280,281 *AF567F690269A6C8AE7207A387A84DB570D626EB agnqw
1,666,280,282 *AF5E7CCA2D67C4D1AF67BF7460EC77592DC1E49B ae59u
1,666,280,283 *AF5E77CA3791C67BBAEC9B503212C62EC2800301 a;fi
1,666,280,284 *AF5FDCB13DB9EB1C2686069A0476000D2C5FDE2C AFURETEYUKUNOWAKONOKIMOCHI(SUMMERTRANCEMIX)
1,666,280,285 *AF51D11C72162226DE880C9784825C06BD099E88 dotp1
1,666,280,286 *AF59175A69AABBBE1ABA26EA58689D13B2F2B47C d+qyx
1,666,280,287 *AF5E3169C5D6D023FA562BDDF83D01BF3BD74EB4 d"rgn
1,666,280,288 *AF53E1BE3F0543874E3D74B3C19ADC204D0B9F42 AINWG
1,666,280,289 *AF5D436BD5D775C593E932BC58490C758F1BAC3C all3v!at0r5
1,666,280,290 *AF59488E06B0A9D717813D252192ED3ED2489F67 ALONZO.MCFERRON
1,666,280,291 *AF59903C988D4374AE4BCC1EBF75A28C266EDAD0 ALOSCOPE7
1,666,280,292 *AF52597AF5329C7F4BDC1452665012EED571219C A.K$9
1,666,280,293 *AF5BEAA3A3E50409C57457EC146235404446A937 AMADO.PAVICK
1,666,280,294 *AF540FBA01C02C6333F3F113BAFF728E2612EADE amandabyfieldt
1,666,280,295 *AF5895FDE166FC4DE5EB02D9E132CD7A4802C840 dwightmatthew
1,666,280,296 *AF514FF7B72A7703C39AC1D4495E28F7F699A483 ALFONZODUMAY
1,666,280,297 *AF55A057B3930452740E9A8F35F8C85EDF6CAF9C dylanbilous
1,666,280,298 *AF5BD8210FA057A8AC36CE467310AC8E79B8110F dzak6
1,666,280,299 *AF57D9BC2A5741B991CD43476671E09793503516 ecbm.
1,666,280,300 *AF56E676FBDA69C6E02B48F5B8CB39CACCD1E86B ANGELALMESTICA
1,666,280,301 *AF5A110276E656CB33A59693187788B75EA3BBB1 ECSOD
1,666,280,302 *AF5A41D32D5CD6BC466B1A5FF74427A4B484E9A7 ALTON.GRAVITZ
1,666,280,303 *AF5C479F99CCD32BE4DCFFD51F66A3149BFA2712 ALU
1,666,280,304 *AF5DE362DD166023A113C2D519A88657EF8344C8 EDIRE
1,666,280,305 *AF5CCED74D7D409AA61237C9FF5BB89B286801CF EDMUND.MIRCHANDANI
1,666,280,306 *AF5FB17CBF28AC4EB3EACD53F079667ACF9BE0E8 [email protected]
1,666,280,307 *AF5C6587920E93B6787C078BB30D2F86B9B4ABB7 edv(=
1,666,280,308 *AF56F74E48B477E7955B2819D9143EBE74139388 edy-woo
1,666,280,309 *AF52219006129053BFAE044911493F5D6185EA33 EE6P3
1,666,280,310 *AF5F7DA742B79C25BE5247ED1ACDF0E38A02D73F AMANTADA
1,666,280,311 *AF5B550B698E848193384A3FE2816B91219DFEC4 AMARWOKO
1,666,280,312 *AF55CDBF247E9A462ADF9DDE4922F649D27138A5 an&of
1,666,280,313 *AF52A18A3CB200AC331403BFBFC2AD9D112CA801 [email protected]
1,666,280,314 *AF57AA169CD222E0ADDF8580CB28D97B18CE04C5 ANTWAN.THACKREY
1,666,280,315 *AF5E5C21186AFDA4FE1A7F63695CBCC5D7AA79EB EHCYV
1,666,280,316 *AF5478D8A37D4ABAC58A069DA6B8CC2C58317DBE EITH
1,666,280,317 *AF5A7DB76464B9260CE7662EE58B34979B0EE9D1 ejtennoi8
1,666,280,318 *AF5C9EE0427803D0368B8283692729FC670A1EF7 ek0&!
1,666,280,319 *AF5A1ACBFCB9A5FADBCCA9DD564DE1B80A1148A2 APANTAZOPOULOU
1,666,280,320 *AF5FC09F055D43D6A95B02DC388B7C91DAFDD02E EKSCO
1,666,280,321 *AF51EB8DBEE334802364D8E5CA583458D5147286 ELDEN.VANHEUSEN
1,666,280,322 *AF5E66DAA916BCBC09CA09CAA34F437C5FBE39F0 and-with-his-stripes-we-are-healed
1,666,280,323 *AF51CF4B5DE492C702F53936689DF4FF025A7C52 ANGELAMB6
1,666,280,324 *AF54C6DB9B82AB7F76E5725B7722B73E9321C043 AQR.I
1,666,280,325 *AF5CEF78BECC9EB2DABCC61313272E60B1BAA7FD ELECTRA NATCHIOS
1,666,280,326 *AF5AB62B16B044E712208DD30D1B3F901B22C4D6 are you sequenced? (disc 1)
1,666,280,327 *AF56FCE7C710987193653CDD72E53CBFFDDDDF9F anthonyvandiemen
1,666,280,328 *AF55DAF840E8E9B34EE52A976067FE2E4A6C0397 ELLIVEUGNOL.1
1,666,280,329 *AF5D229793DBD6239B6FDF36FEE9F3548D82772E anv-
1,666,280,330 *AF5DC9AB42DB68882D41AEB015901BBB924EE331 ARRONOBLANDER
1,666,280,331 *AF58A69E6AF29B0633F54F416424080ACCF6D179 arsenall6
1,666,280,332 *AF5D551435E4893EB1A1D5CF9A9C35390B578826 aoboq
1,666,280,333 *AF578365415432929ADAC5BA41481D777E9C92B7 arthurjuergens
1,666,280,334 *AF5335BE0565B73A5869B720BDE719E813F5954D elvismozick
1,666,280,335 *AF51FE2691A1408DC1CBBAA1380905BE03089571 ELWOOD.HENJES
1,666,280,336 *AF53E38A548EDFB0E2300695BA3E3F7406645458 ARTUROFLAHARTY
1,666,280,337 *AF5CD4C940A3E9AF5EB8B61F4F41A9E17230A2E9 EMANUELMARKWORTH
1,666,280,338 *AF5BB83E109999EB4FA7E3022D0A7887E014F51D ARVINDVINAYAKARAO
1,666,280,339 *AF53F4A335EF5AE335142CC867D751A68075F471 ASHITA.WA.MAKENAI.GO!.FRIEND!
1,666,280,340 *AF54B01C6E7F3A0D122CAB76B3046B3D34C28DE2 ASHLEY.AVANCE
1,666,280,341 *AF50C1267D3007F59C3750FF7179B06732635A6B asingan-pangasinan
1,666,280,342 *AF5402CDCEAB9A0C977C31A961379713C796F3B4 emiliodupont
1,666,280,343 *AF5465414618298F8B734E46A6F6EFB558F3DA2F EMILIOPOSA
1,666,280,344 *AF5EEBF1DBF19999E2CC97E31A2D0CF0610A96F7 APSPARIEMS
1,666,280,345 *AF5690A737E0FB78E9458A98FBCFF3AB1566DC36 EMJBR
1,666,280,346 *AF564746BE2D5CD397AD1CC2BDD5323559129E98 AQ-FM
1,666,280,347 *AF5356FDC90FC74491DCC7863E7742CDC6B58143 au_4s
1,666,280,348 *AF55F56C00B4727F487BF25CED6F8B49B8E3AE10 ARIANNA988
1,666,280,349 *AF55A1ADA06A8174CF4B1348994B7322CB779847 engelavanstaden
1,666,280,350 *AF57B9EB24DF9F2730D13F89153BF81E65DA84DF ENGRAPASEIS
1,666,280,351 *AF5EA0DB749E355CE17CF58E8B84AEFB8D3453E0 austinpasswor
1,666,280,352 *AF5A8ECD1D146756F55807B58DA24FA19B19C819 entupled
1,666,280,353 *AF5008B9A4D626C37DB39F076A763CEECD2B8B46 ep?y)
1,666,280,354 *AF5B82DAD197F76AA13E88AE7D47FA7342F67A4E autorove2
1,666,280,355 *AF5D0B255187B831DA3C60AE1CB71D5EE080D8DD ARTHUR.OVERBAY
1,666,280,356 *AF59965C990435027A0082E134BB13F1F1F43E60 ericmadise
1,666,280,357 *AF5BEDACAE5B9BE1D2D7F00028A027E1D57A1BF3 ERIFCZR3
1,666,280,358 *AF55D84BAADFB18C6104973FF56AAD5D880B963A ASCUT
1,666,280,359 *AF554C3612C5C3B9B193F7C6974443046457AFCE etatbewilligung
1,666,280,360 *AF5984424F39F1A04258EA2F75E505E72AE56737 ATLANILOED
1,666,280,361 *AF591826DE740617E893E7746F8184B39C1E26DB B24=
1,666,280,362 *AF5AA0B935858704C055EB55A6C87B2E29E7890E auu=g
1,666,280,363 *AF58C26DC8437BFF0DDA2A9E7E58A6FF0A14EC23 [email protected]
1,666,280,364 *AF5731198C54B37F6F3331C22DA1055F7B51299B FASCEREM4
1,666,280,365 *AF518CFC867DEDBEB1AB6CFC50423E43E8873A7F [email protected]
1,666,280,366 *AF5BE730C4F67BFB21CE8BBE5D81E3B8DBAEF7D7 BACIUROBERT
1,666,280,367 *AF527381DB3B7234478272D366D2EBAAE1FB17F3 AYWQ/
1,666,280,368 *AF51B4D822E258CEAFE895E013684B5D974815BA FIAT666
1,666,280,369 *AF53E3367C58AA9D2722CC3F0F3B5C29156B4B03 B2"AK
1,666,280,370 *AF52A4CF600021644B26EA5843315154BD10A25B B3M$
1,666,280,371 *AF59B862FC96C2A8A846F94838D9B431557E777C bbba+
1,666,280,372 *AF587BFFD918E00D3DA99DF497CD30D84B436C52 [email protected]
1,666,280,373 *AF56A4569874FA97A2C183E57ED0881AE6B2C941 BEDROOM SELECTION
1,666,280,374 *AF503EE37ED8B377274EB397E9ED16318A8ACBBC barr2dav
1,666,280,375 *AF5C794ADE3631305D99021A6C7FA920E54C79FD freshlypromoted
1,666,280,376 *AF5F45F4960E901BA224BFDF19F514F5B6612E74 BE"LU
1,666,280,377 *AF5E5E3CE7859CFB224EB23F6B6B07AC548894A8 FRONDIVOROUS8
1,666,280,378 *AF5C420D275E14BBAC85C17FE8CA4A6CFDAC1246 funny-hat
1,666,280,379 *AF5422C598BA0CBFA3C42B2D7E99358B5A68FB3C g1aci3r t
1,666,280,380 *AF5F86E83C47078C52AD0029160894904197BE51 GARFIELD.FALLDORF
1,666,280,381 *AF549F67F3BBD8175564BCDDE57EBC1D265F697B BcM
1,666,280,382 *AF532C9B21502952FB21E7644784A1480B71C9C2 GASTONSARNO
1,666,280,383 *AF5559F7FAE3CC9CCC8000F58A05B00211D7BA46 bettyboop07
1,666,280,384 *AF56B8DFB80F0735F1A10037CC7B02930C5A4CD4 [email protected]
1,666,280,385 *AF5535736F497CC16FE9BA2F9A7452FB52D75330 GERARDO.BACKLUND
1,666,280,386 *AF5C3318A5759D2529843B630100E6AFBAD98983 GESPIELI3
1,666,280,387 *AF5BEDDDF4994F5207DC216952C46618E73F1799 Get-A-Way-(Squad-E-remix)
1,666,280,388 *AF5B98BB80682489185E8951A6C81DD4797DAAC4 bekc
1,666,280,389 *AF50BF00DC13A58319C0D1F3E497F498E69F43E2 BELLHOPS8
1,666,280,390 *AF57D11B51C5B2E0AECAA754E09C0C9C3FB441DE biai$
1,666,280,391 *AF51D896305B89C7C156691D2FEE7B7731138593 gilmorario
1,666,280,392 *AF53D754925E3DEBCCE63EE615F14A270BB0A156 GIMBALSP5
1,666,280,393 *AF595E6F451B9E75D92C905FB95C52717C04F000 BERLINO»
1,666,280,394 *AF56E15A31CFBD4450878EFF373A980EFFCF6DF0 BERNARDOBALCERZAK
1,666,280,395 *AF54AD5FB59F32141E396F8A25A5FEDA5BB53C85 GIOVANNIISING
1,666,280,396 *AF5C3F2F3BAEDBA0852E5F62900861C95C6DEF4B giptbgpngceyjhtoqqktbgd
1,666,280,397 *AF50EA695F3F0C2FBC0307F028563C8F6A122BD4 BERT.TROUSER
1,666,280,398 *AF55A7EBBBEDAA1B05CA5B4FE63B467662061BD6 Given.Up.(original.12".mix)
1,666,280,399 *AF53B5ABB95E81E16BC7F216F268CA4B60B616BD BK(;
1,666,280,400 *AF59949C93DD96B6FBDADD7ACE81B83AB1503A84 BKVGN
1,666,280,401 *AF54C5E0FC5F031587A69ED1DDA3B6257E582277 [email protected]
1,666,280,402 *AF51307E8BFEBF3AC4832A21DD2F45D29B3A8941 BH8$%
1,666,280,403 *AF59AF31B0999307E8354F943675B8B291B3DF41 bnh1r
1,666,280,404 *AF58551C9BEDE3AD5FBC8D36F4E8D2B440C7CA86 boaf
1,666,280,405 *AF5B1E8CC3F5F4A3DF7E1DABD69FA22722F1579C BIRLEMEK0
1,666,280,406 *AF57F295960B744C06DC7E3EEC220F41C0A5F2E3 GRYGORE3
1,666,280,407 *AF58035199A6367F92D1F4152D5F1B08656BBB52 BLFZW
1,666,280,408 *AF5DC5C82C35FEDC15F7D3BCA01E11CDBB454C6C b;nrd
1,666,280,409 *AF592CCD8B9DCF321E16840B0DBA12138C96FC93 BODULI.1
1,666,280,410 *AF566E0A38CE859A5C9DD8C52286A837645EF5CF ,.boj
1,666,280,411 *AF5518F177443996FF5E3B54A1512C7505B6BC0D bok#)
1,666,280,412 *AF5146DC124454391B4ACD307AF8981722A8FEA6 bqc$k
1,666,280,413 *AF5768CB79EA5C195F6E3938CD5D359B1B8EEB2F brainkozicki
1,666,280,414 *AF5770A0226C24668ACCDCC250FAA778DAFD684D branchiopodaning
1,666,280,415 *AF502752439BB954CD1AFE5868EDE827A6363F23 BRAVESG8
1,666,280,416 *AF554288D1EB4A8366066256C68FCAFEFFF2B647 アクティトラック(ha1
1,666,280,417 *AF55E2D98D5CF68DE6B9F5560C935D249F0FBC57 [email protected]
1,666,280,418 *AF5144E2D0238FDA5810FBC73475C928DEFB1357 B_qt
1,666,280,419 *AF5146B21D4C0335003225CF1700532E75B0B7F6 BRANDONFOLKNER
1,666,280,420 *AF54563DE9092539F4A2544378A86940349BCE66 HAVANA16
1,666,280,421 *AF5BBB760E0B2547B6431891495C9D1CB52BE05C HAVØGLENE
1,666,280,422 *AF5907F2736E0567CCDC6FFEE8345C9C3286BC13 brendanbrodhead
1,666,280,423 *AF56E09BD1C2B6F1FDB30DD7BD4801DE703CEFC2 HELENA832
1,666,280,424 *AF5D103DCC96CA62FD643FD85E1AD2466148F4F1 broderickrovinsky
1,666,280,425 *AF55FA01ECA3ABF81D1FAB65C0A8A938F0AF8E26 BRODT1234
1,666,280,426 *AF597E92B7AACD19F697426E668F960D16472076 BRU+ISMS
1,666,280,427 *AF563BD5DBBFA0BE992AF1BAE476087650668CC1 heribertowolkow
1,666,280,428 *AF57D92A4036D9136B9A03B2CD4A39DECF032D0A [email protected]
1,666,280,429 *AF5AC0E04552B88A759F233CF31444D9B6EDE6FD BRNEBOGEN
1,666,280,430 *AF5F48F068521648B29752BFAE0DF40EFAAEFF8B BROOKSPIETRAFESA
1,666,280,431 *AF587E7EC592ACC967D0826BA9723B9706E41711 BRUCEPUSHARD
1,666,280,432 *AF5428C726786AC4E028528AE21750D2BBB1CF5B hilariolines
1,666,280,433 *AF566B891016AEB7026414583190C781BA782728 hiltner
1,666,280,434 *AF5D6DB86A61B1FAB62C88A989D2D93DADA00DF1 BSV(I
1,666,280,435 *AF56B4FF229E20463551E7FECFCD0AEFA9600AC5 BUD.SCARSDALE
1,666,280,436 *AF5469C16C85B56BACAE3C7F152FE773BA2AED3A HONG.PAGANO
1,666,280,437 *AF53B530FC8518173F2347B1A69CED11166A5748 bufordsypolt
1,666,280,438 *AF577E161D6C558FF1323E610D59FC456ACDE4DB BUDDY-FRY
1,666,280,439 *AF5615B43C7A9D8034E1A1600AE82DFF0DB93BF8 BUDDYMACALMA
1,666,280,440 *AF542837751E6659E3633D71CFBD1F192F97A264 hop1803
1,666,280,441 *AF58EC3095C808B85B6FC55E9EBBE356B96714BC BULKING5
1,666,280,442 *AF537A02892B94C7624378F11109910920084302 B_UU.
1,666,280,443 *AF53E00A9D04D687FEE8C4A29B13629709F6820F [email protected]
1,666,280,444 *AF5BCE6D9DDC3AD3EDA3DAAE33BD41F3715B7698 BXV+5
1,666,280,445 *AF529C9B884026311885C45DD70BCB709861D696 HUGOPREUS
1,666,280,446 *AF5359E8AA568418061483184B1D2247CB250285 B/Z-Q
1,666,280,447 *AF53CA5DB3E2C0CF0122A5F4B01FA2518E2823B0 HYPOS7OM1DES
1,666,280,448 *AF5F518B649F8AEFA3919C6B6BC82709ACFB1C5F I8176
1,666,280,449 *AF583F0CFE24BBB0310375467EDF59A9C4496C2D C3"R!
1,666,280,450 *AF51FC8B5A6250A09DB972BA532B9D5D3F8E12DD [email protected]
1,666,280,451 *AF505A4DC9346675CA3269C14750B539BEAE0EE2 CA;DG
1,666,280,452 *AF5F89F597AAB9F932EE65569CAFE25C14D8452C CALVINBANTIN
1,666,280,453 *AF55AFA8CE30C9ABC053BBDEDEE91B76CC68341D IGNACIOLANNI
1,666,280,454 *AF507AF2B5DB7C8B8D060E4D29ED45ACCE44A3EC IK{}
1,666,280,455 *AF59561E2473275E68326DCE78CAD7AFE041CFA3 can'tspeak
1,666,280,456 *AF5B1A092314848B133A74A2E2EDF13C2206516F iluvtheking87
1,666,280,457 *AF5F5FE7FD7FC8A77D438309FC38722C9C25CCF8 CATSBARRACUDA
1,666,280,458 *AF565754B67D07443442C66243F15E1E2B3A7548 [email protected]
1,666,280,459 *AF5E1B1B36BA83FDCD8FD95C55EC6C50D7271180 CBBU:
1,666,280,460 *AF509B9DDCBA0C229BD5AC4C4D59A7FDFE416A16 CCQ588
1,666,280,461 *AF531711B3875F48C02BEFD6BCEE5D1A9C9D9900 CCTUT
1,666,280,462 *AF5D237D7A83763C013A8F044F4A19F3E41B47BB CEJAO
1,666,280,463 *AF5F2D17A2FC459DBF43C715FC082AE42D46A79D I ROC4EVANDEVA
1,666,280,464 *AF5405BE664339C39117DCE6165C6CC975D8ADCC CG9,M
1,666,280,465 *AF5EB88D0F5717BF114E76C18B15BF6F82DBD8C9 ISHU SAMTANI
1,666,280,466 *AF5CEE96123E054F33860EE50B152D433E6E9FFF CGOODENRGY
1,666,280,467 *AF542D7BF60B81CF55E3F8D5E8D3D888FD016C59 C&GRB
1,666,280,468 *AF564E3877C40C48EF8B7B1720FA90B790B994CA CHARLESMISKELLY
1,666,280,469 *AF5BB922B8717E6C21A194E6C9E9C4E15DD817BA CHARMAINE.WALSH
1,666,280,470 *AF5A0A37CC5748101520B3AD730B408729BBEE89 jab,
1,666,280,471 *AF59ECC92C4B99F99E26B1678BC2F158AE392E06 CHASSIMENEZ
1,666,280,472 *AF51778AD5F56E6B4EA54DE17C7DAC5160006B4F CHASSWEDENBURG
1,666,280,473 *AF550F701B4F76DC8F8780B46E60FA040D5041F9 CHAUNCEY.MCADOO
1,666,280,474 *AF55AF5253864DEBBBF2ACC2A6AAEFB547116036 chawchaw-lay
1,666,280,475 *AF5FED80B1FECA9791BB5E10581536723BA64893 [email protected]
1,666,280,476 *AF55F1560FFA7DAA903DA707B3C7642232D82B4A C%HC
1,666,280,477 *AF529606A2D1852062C7E72CAE547F580E3105EC jaggies8
1,666,280,478 *AF59571AE2E789EAE59C74B86D17128EE0FE038C chicore1
1,666,280,479 *AF5A5254BB004442B9BC1AC42F1843F54A86F690 janene-castillo
1,666,280,480 *AF5DF61DD2B926721B870F4627DBEE556044F172 JARED.SIRLS
1,666,280,481 *AF58AB64B51B6EF1E9D0773B91C5D3E43CBE1608 CHRISTOPERBOWERMAN
1,666,280,482 *AF52ECC77E251212A91A40438D8CCDE602A69DAC JASONKBSW
1,666,280,483 *AF5680EE214885A17A6E7BBC6C3E4563A47FBC5D JAVA-2TEMPLATEUSER
1,666,280,484 *AF5022D0421285BADEFA47556C4BF7F80C2B9AEA CHUNG.KOTCH
1,666,280,485 *AF5F56447640AC3D439C79D502EA72ECC359DB22 CHUNG.PULANCO
1,666,280,486 *AF5EB12D71F5ACF69827D743E0F5654891EC3E3B Church-On-Fire
1,666,280,487 *AF5364EA9FD45236F7FDF967883604A70B5DB249 CII+
1,666,280,488 *AF5152272C4B896884D2D89E3A41A69CC4248E41 ckmni
1,666,280,489 *AF5838BF52A05066A73754A75D9694AD9EE1A861 JERMAINE.ENGEL
1,666,280,490 *AF5E5B32EF8DC3354EFA155EBBA537968F590A8F jeromycropp
1,666,280,491 *AF5AF2C9F12C02D0E6789E158282693FF4EA16DE [email protected]
1,666,280,492 *AF53782FC61431EB11A22E2E85FDE5B833CE8E96 CLAIRAUD2
1,666,280,493 *AF54A544DE5E2F26A627E5EDEFE453EFFFDE9D43 CLAY.FELDTMAN
1,666,280,494 *AF554126736089BAAB39B65474D8113271B1BD8D claudia-morris
1,666,280,495 *AF5C299F2F67C7583E03C842B19C9B7233AA6020 CLEMENT.SPECK
1,666,280,496 *AF5F7B2FD2CD2396C89B738CFB1615AB36D61346 JILLMARIELANDERS
1,666,280,497 *AF5BFE5FFD29AB5A5B1B8FB2FFCE11CEA34000DC JK}I
1,666,280,498 *AF5AE64B9C0BF5172D5E937DAA5DC06A549CF2E6 [email protected]
1,666,280,499 *AF541108285AF77D4C4105B210E1F2DB79CD862C CMd:
1,666,280,500 *AF58A04FF74421F34E29D940CF83CE980B25CC6C JODIEGROOM
1,666,280,501 *AF57EBDB0E4E53D923B27C9DC3823BB3629218CB cnb7u
1,666,280,502 *AF59D0045184EEC18F2E51F8ABBBB5F853E9E39C collinmittiga
1,666,280,503 *AF545FFFD1090A92AB947991C87B0116DEBD6A1C COLN'S-INN
1,666,280,504 *AF5FFA8BA9848236AD8D093B55678F22566CF582 Colored.Leaf
1,666,280,505 *AF544A62C3BD1F629A006381CDDE8E401E54D52C COLLIN.MAUDLIN
1,666,280,506 *AF5F75298A549A1F84B8F30CD384B99AFE737459 COLUMBUSAUCLAIR
1,666,280,507 *AF5AFBAAD8B40EBFF87F447B5682805B92624669 compe'titeur
1,666,280,508 *AF59B09B71F5BE41B99BB687541447B390F96411 jp/q
1,666,280,509 *AF5F600BC27FAAD7D220A4B9A9A3FA1C40B3DFCC connieheth
1,666,280,510 *AF5A1B250DBF138CFCE5AE804CF13A6D8B2BBA7F CONNIESCHEPENS
1,666,280,511 *AF5FF3C4556D90D9EA6E356F5ADC7B8AB03F0FE7 [email protected]
1,666,280,512 *AF566CB731C35DDCD12E35EFB017090ADE004307 CORYMUEHLMAN
1,666,280,513 *AF5231127D279F334AC9901BE30CA7F610D12747 JULESKASSA
1,666,280,514 *AF51EB880A9DC80E6AB616E6F48D7992A9CD3E0B COURT007
1,666,280,515 *AF54AAAEDE1B9BAF0F386C0B8E34916F576C0B83 justinforsythe
1,666,280,516 *AF5DA269BD677C53F973317823902F31D5B0026C C:\Program Files\Microsoft SDKs\Windows\v60A\Include\Richedith
1,666,280,517 *AF5776683C21AA983EC8EF21DD4F64E896AFC691 [email protected]
1,666,280,518 *AF517918B86C03510D542076B56DDDFD2AE18908 [email protected]
1,666,280,519 *AF53BBBBF58902819ECEB13BE77BBE8583B7163E CSK3
1,666,280,520 *AF54A174964DDC32AECDB2BE8BD9C22B08FE9DDC KATZEW23
1,666,280,521 *AF5BF8204BCE5BDE0E2653C8F8B5FAC3F8A2C817 KBRIANOJ
1,666,280,522 *AF500A8BEDE1A407A88218EB7D317316C4676A50 [email protected]
1,666,280,523 *AF5288E9EFC8FFEA201686DECCCD98BEAFC4A5A5 K$DJ
1,666,280,524 *AF5902FC5E84C9A6490F12BFCD24D2AB51FEFB39 cuplaitses
1,666,280,525 *AF5B1AD7A3A1E3AB0DDBCE844E8C8414C30E5750 cx$#
1,666,280,526 *AF54ADF95C18A3FFD4102011B80A1A7D652FE7EE kennytatsuhara
1,666,280,527 *AF5E5279F7956673850D0948179F7D0CC57C6283 kenreyelts
1,666,280,528 *AF5B8B64C835E624713E8895F7F10912DEE533D9 KENTON.MANUS
1,666,280,529 *AF54341F5CD267451575E1C77788B6576153D6AE KERÉKPROFIL
1,666,280,530 *AF5C8F7434621D9737A10595D65514CE16E384C3 d3qf
1,666,280,531 *AF53A2C171723A35AE8199C214A9E300F79DF82B CVS2K
1,666,280,532 *AF5E121298B5C6A1D0517AB33F770E6A273C06ED KIT.PAK
1,666,280,533 *AF5BF01C457DD1201EA4E59E89A1B346ACC1E95D CWUT6
1,666,280,534 *AF5513361BD192124E938E873391A9F12DCAFBB6 D7GW/
1,666,280,535 *AF5C59CB98280381F87906A3969464BAD918EEEB KNAPENPLOEG
1,666,280,536 *AF50C392CF94207A742EC74092C37A96FE22121A cyrusshelsy
1,666,280,537 *AF53EC871C03DF7A19FD502657A3C7765EF6C9F0 d9qv!
1,666,280,538 *AF5E7C470B93AD734274032D560F8DEE002943B3 D0V37ALS
1,666,280,539 *AF5F91B2BA01E130713AADD1B65D2F70FD476CA3 [email protected]
1,666,280,540 *AF52DAF4F873FFA6A758C37DDD8EBCBB6EFB70CE d$3lt
1,666,280,541 *AF5F12C6F0BD09A98171F20E210B7718D6676B18 D6F(D
1,666,280,542 *AF537C15A420F0F06B1BA0BFF83F6AF3490B5482 DARIUSHOSTER
1,666,280,543 *AF521996B90F8CC5C404794D3AA4A844A1CEA07B d_$-9
1,666,280,544 *AF540533150F4EA787070A2845DDEC7112F4675F DARIUS.WITTKE
1,666,280,545 *AF53E66889E2548442BA2DDFB409BF9F31987986 darrencarrie
1,666,280,546 *AF503C0BC8DB6360189EF9EC8958A90A3FCE779F DATQM
1,666,280,547 *AF5846A30D5357113DB54773256A6E538BDA5D08 DAMIONFELLENZ
1,666,280,548 *AF5DC6FA4F8FDB6BF3D321DCF9659FD4BB1F4502 DAMIONPELC
1,666,280,549 *AF57D494CF5870975AADAC2D7E57694ED4F9EE79 DBD7M
1,666,280,550 *AF5CB650E7C5241EF8C6081ADAEF15395FC216AF [email protected]
1,666,280,551 *AF54A3D8B8C84A829EAD1AAA332A70BFFEC37E41 dcomfortable.1.0
1,666,280,552 *AF549D7E98BA5B4B389D04635134EAA8D84F3ED9 D,:DD
1,666,280,553 *AF58B5F675331E6F8364F46163B6539B5EABEF7C KRISTOFER.SODERGREN
1,666,280,554 *AF5DDCA6EE471919EEF14B8878A0FBCBD3E6E8A3 decevront1
1,666,280,555 *AF56A1A8EA1E755715633F092A9C1E3391F4B933 DANNY-TAMUZ
1,666,280,556 *AF588D3C94C5F2615F776B62516D3F405861E4D9 DAO,-
1,666,280,557 *AF5303E2087CEAE5C2F8AA42B89F1368C592C99D dedisaient.
1,666,280,558 *AF5C75367C484024F17C4174281D4C882603DE31 deihv
1,666,280,559 *AF5CE6F6B89BDC9F7CEB811B11B547D8F1262C88 KYLE.SIPE
1,666,280,560 *AF565FD085358904B1E47ADA82EEC78C3A544886 DEMUTH-KYOTO
1,666,280,561 *AF582267E6FD121AD6AFD3B52656CE4399A63160 DENNIS.FENK
1,666,280,562 *AF5A3D1D0E095D1EF0A82FA04C51944DE8AB389B LALALAND12345678
1,666,280,563 *AF5EC1852E16E21BBCA7AD0FDD5B09BEBF1AAC81 dbwf_
1,666,280,564 *AF56EDCB719A8166E72C33FE292530650C4ED8B5 DERICKFEDERKEIL
1,666,280,565 *AF5D4090BAD8B5E915A6752AEA1A8618838D9A57 derrickburker
1,666,280,566 *AF55D446338FD1F6871245D44DC731E81E4B088D derrickkrogman
1,666,280,567 *AF57993DBAF2E139A11B60020DA137C87B91BCDF d,cnm
1,666,280,568 *AF585A6550CB0913449773199EADAE8D7074E7BE DCU5F
1,666,280,569 *AF512F38D12B5B8428599C02257A8427A181E3A9 debornenu3
1,666,280,570 *AF5F9E570CCEE61C6B7A4F70253C38A50C95C58E D(EV
1,666,280,571 *AF57298562098634F4F80D5ABFD0B30A1B2D97B4 DEWEYSKAFLEN
1,666,280,572 *AF54536E35C6DC97BC4ADB73B204468AA635D7F2 LAVENGRO6
1,666,280,573 *AF50B6EC67FEFD990B5887D0E214AAC7B6E4EDBE DEZINFORMACYJNY
1,666,280,574 *AF564F2D4AD0DCF55FC0A771565B963FDCD48F6F LAWRENCEBONIFACIO
1,666,280,575 *AF568236B91868F4CBBA46CC262ECFAD5D959951 LAZARO.LEAVELLE
1,666,280,576 *AF50C3534604C38ADBF4426CE330BD90C0020388 dfreegre
1,666,280,577 *AF5FF649B852400237B5C15715BC9D3C03B69BF9 LEEGOSLINE
1,666,280,578 *AF59DADA559AB9DAF04343D8A113DE185644E690 delprato6
1,666,280,579 *AF51AF1A697189C3E3FA03A3CE1D3B7A2C64B07C dhg2j
1,666,280,580 *AF584AEC63E8FA6DF55EDB4D11268599C10DFFCE LEUTOINAKIN
1,666,280,581 *AF56D4AFFBDB3AED1A16D40BAD73FBE1FFA3A775 LHADYHIGAD
1,666,280,582 *AF5796F482EF4F64D9CB7CE597EDF45936665E3C DERICK.FOSTER
1,666,280,583 *AF5DFFD16DACCF0050FE54B432EC4436D87BB625 di)hc
1,666,280,584 *AF5555FDA4E46FBF09AADDAF87CEF9F3D4692D78 DESVIASES9
1,666,280,585 *AF5D266DCC64EA1BEB4A173A91580F2BA3B1577F [email protected]
1,666,280,586 *AF56B75C1F24197E38F86AEE93636E9370FD9FAE DIXIEDAVID
1,666,280,587 *AF59CA35E031375FB5471ED0FB1337DC940CCDAA [email protected]
1,666,280,588 *AF5148D12DC6D083E8BB7F5772A7A81D9FF1307B DK#HT
1,666,280,589 *AF52C117415B17CC1A9525B189FE93BB44DA02FC D)MHN
1,666,280,590 *AF55D81196C4923A5BC693AE99E92583CA309E1B dmqq#
1,666,280,591 *AF531D2D4CB20CAF7FBC26B25B6A64B14F793288 DMTSLCYC
1,666,280,592 *AF532D8608E72A46D66C06B8AFBD3E8DD09FD452 dirkhewell
1,666,280,593 *AF54B399B6576902E85B774F6E21853CEA252743 DISENMESH9
1,666,280,594 *AF5E8A243240C86776A85A061B7ABEFDE0A4D29A [email protected]
1,666,280,595 *AF5DDB8837D1C0ECBCEC598C397C056978EC8D7D DIVISJONSDIREKTØR
1,666,280,596 *AF5EE1B6DB8F36E08571CB64860B8121889C2DCD LUCHTGATEN?
1,666,280,597 *AF52A8CE3B621F0163B34FC88CB5183ED8D99EE7 lucioveith
1,666,280,598 *AF58E7C5DB5F47F9AB135BCDC6197DAC3CA2D79C DLBSO
1,666,280,599 *AF5F3ACF3586AA3453441842C1D17CDA9A4EAB07 [email protected]
1,666,280,600 *AF59CEF2F06632DBCD852C2DABBA5C6D335F3A0B [email protected]
1,666,280,601 *AF5739F4385F475FAF20192319A118E6DA7C78E5 LUPE.BUSQUE
1,666,280,602 *AF5E1DAE0C5548D66A6938A2E7AB43D23FC36D82 d%q6i
1,666,280,603 *AF5E9C3AF4ECC5DCCE553BA4BFB31C91316FA510 LUVSFU3L
1,666,280,604 *AF5200E915812064F5A0D8B2FBFA226398F0F813 lyncoln6
1,666,280,605 *AF557ED77B366D6DA05BE8F1AF9282C733AA2944 M0R+ARLIKE
1,666,280,606 *AF580DB842C09AED9E04597C207166D89334B7B2 M410NY1UR
1,666,280,607 *AF5C9C3A2C6CAAC0F339EE4F14AA1CC9BD45AA06 dreamsemail
1,666,280,608 *AF59A820B924257EF02CD7EA22FC9BC1D8B80223 dominicbagozzi
1,666,280,609 *AF58C75F0B0752BD0FEA6570AF38B5DCE218B3A4 DONALDLAPHAM
1,666,280,610 *AF58CD95D3DD545A49CFD56C277A1F79656A36E9 DRN?L
1,666,280,611 *AF578D85CE457F6E4DDA5F51908D83081A4274BD MAHIMIG
1,666,280,612 *AF53ECDEEEEB0272FD642C1199E718AE83919415 MALCHERKÓW
1,666,280,613 *AF52686FFD29567A72AEA5997343B1DEE9FF5DA3 MALCOMARNOT
1,666,280,614 *AF5BAACE5FB785FEF464975C71C73A433E09AA34 MALDITODUENDE
1,666,280,615 *AF50FEBAD987496FF3048409BA079B58D49560BD ds)$k
1,666,280,616 *AF5EF8564C4492F6E561D0BF7F937ABC635086BA DS;PA
1,666,280,617 *AF5BF46CC6C929ACAD3F12F5E48C46D07A9CA5E8 MANHATTA6
1,666,280,618 *AF5A5CE73BD11BA107AD81DA90A08C29B0E3E642 DSWF_
1,666,280,619 *AF50C5A0B000B52D4FF69A2F771932E013457025 DOUGBUZZES
1,666,280,620 *AF5DD99A51008EA7F635C51D35089E87FB122876 [email protected]
1,666,280,621 *AF5BBD3D9B78EAA05ADA759409018936CF88D3F5 DOYLE.ZGODA
1,666,280,622 *AF5CB3B713C0F4F84D4BE0C5EBA0448E8CEA110E DUDLEY.BAZZELL
1,666,280,623 *AF52E10BD2F366DC2B2A8534CD49178386FD94EA DUE:
1,666,280,624 *AF5ECF950195D34BEF990BA13DC0EDF28C8D4771 marcobedoka
1,666,280,625 *AF5638FEB52423392AEA5663DC3BF523493FAB94 marcosguzik
1,666,280,626 *AF5CA30B759B42E519F03F6A20D98C5D291ED541 DQ,,U
1,666,280,627 *AF55D19E35194501EA1A83EE3F01FE37E47F1A0F dustysterns
1,666,280,628 *AF5B5D7EC1B59733250403C591F48F673D133BB1 DV6&C
1,666,280,629 *AF518B8FD5C6E9EFC6E87A1D66EC1C0EDEF48CC5 MARKPRASS
1,666,280,630 *AF5ACB6A1CD3BC064B5650BCACD2CB60C42A98E3 MARKUS.ZIESKE
1,666,280,631 *AF5FDE67422AAB273E74989E3CD6B63919CEE77E MARLINKHATRI
1,666,280,632 *AF52EB0F7865425B9E3FFE6F79BCCF5DAD3F4099 DWIGHT.MAUER
1,666,280,633 *AF5F3DBCF904F7C65E9E29521E27711EBC3A1229 MARLONSINGLETARY
1,666,280,634 *AF5098D21D9C172A1919A61006696F9E792A806E MARQUAIES
1,666,280,635 *AF5A5DF9C2F2E0EEF590F493951193FB86547B88 dwjbi
1,666,280,636 *AF54C06AB726BC3D6CA621EADD66AD83E06BAD05 DWQJC
1,666,280,637 *AF5672D5AA0198B4CBCA8EACC0DEEE284A4EB17C DSUZANNING
1,666,280,638 *AF5C81D078E1724382562C9C991A9DD9521A1F92 [email protected]
1,666,280,639 *AF514F593C307F6DB8C23113485E5758CB6B9655 MATTDASHWOOD
1,666,280,640 *AF594BC6BEBD03457622055AF93E60F7167E61EB DZORDANOM4
1,666,280,641 *AF5DA3DB2A7A1BF1755E618609118DBE29FA4517 DUNCAN.WILES
1,666,280,642 *AF5222EE9C1AA0588B852DCA97FB1D2D897D2BEE easaibh9
1,666,280,643 *AF5533C77FB306B4ECFD8DF6CEC7CE72D97DCF02 DUSTIN.LOONEY
1,666,280,644 *AF5D24D480D9740C7498BDACA71FF0CA4CCA3CF6 MAYURNATHM
1,666,280,645 *AF54C83BAD52F9A56A81B9F67B820F4F2D1C1D02 [email protected]
1,666,280,646 *AF559ED9C726078C119AA5429BACC29ED0ED108D d("vc
1,666,280,647 *AF55CEF5E84D31AEA3140415DB73A27AF12A1C6E MERCEDMENDOZA
1,666,280,648 *AF5EE3004E8A40B2D5A18C1132D759F04CA5189E EDUARDO.RACITI
1,666,280,649 *AF550A9531EE05D8C5757027ADB4C1369218FC67 dyn#(
1,666,280,650 *AF54AD3F50E67CEA8B9FFEF92AC0D465160E8122 dyq5f
1,666,280,651 *AF5E4143C9CF8E87EC4FEBBA8612D4F4A7D2B266 EFRH!
1,666,280,652 *AF5A29C8C9A6C21C1239A0FE7380B4105B69D0C1 egibj
1,666,280,653 *AF5697D57A9CE88D094A301BBCBE6E3A4868EEEE EITH
1,666,280,654 *AF5F635F18D5994765FBE1D43068722E91347821 MICHEALLEARN
1,666,280,655 *AF5017217A10DB7C6CE6F1BD4B38B6B859677012 E64B4C0038253F419B3277ADC0A0BE90
1,666,280,656 *AF59757EAF47D07F72FE0449432C0EA3B3C0368C ea/;2
1,666,280,657 *AF5E9B1E561D67F84C33B0A850F1336BC8E54065 MIDLANDCCTVSALES
1,666,280,658 *AF5E6362B2127BA542B7E1F7AD17B3956509A181 eamae
1,666,280,659 *AF5E6A13C134AEA13E25DF432555E2508DF0439F MILESDTHEOMONK
1,666,280,660 *AF51AB49B4E080E7410984709D082D472EDC8DF9 electricdancing
1,666,280,661 *AF51C2C4341920833DF2BA5A79F49EC0BD0EC72C minhhung
1,666,280,662 *AF52D105C30A0DA48C36CFCD104871990317B70F EDLEBBAS2
1,666,280,663 *AF591BDA779462CF56504FB43BE06DBCA87E9EC9 MOHAMMAD.EPLER
1,666,280,664 *AF5C7ADAE3CA4126D49A70B4864E4C992B362FF5 ednedalt
1,666,280,665 *AF559D6C2ABCBD85944761E958D0F8477ED6E10D mon.mul
1,666,280,666 *AF50DE9D06DB0D82A2865593BCC6145996478BAE MONROE.CICALESE
1,666,280,667 *AF5DACE060318897A4E3D5AF05CE44C1CB6649EB eenakqqb9
1,666,280,668 *AF596BB7180E55D34A2C56B379F153FD4B13212F morpheus
1,666,280,669 *AF5F71BDC4C2DBFD0CEDD0FC716C77A92ACAA2A8 EFRW
1,666,280,670 *AF5427002F365DB3BC30337F2DA2ADACDAE19980 MOTTONEN7
1,666,280,671 *AF5A7DB9F72F4BB8016402CF11EE10CF4CA95F01 [email protected]
1,666,280,672 *AF563EF0EDA3031D673AC9F72E323A3F0E5171B4 MSDOJ
1,666,280,673 *AF56F656D679800803CF45344EB957D344E49927 ENCCE
1,666,280,674 *AF5B4964AE56CD996E1B8307A167E63843261CEB ENLARGE
1,666,280,675 *AF5B705AA755160D332E675A8A23351D4445AD62 [email protected]
1,666,280,676 *AF567CD30047D468C5CC222D7CD24E2C901A204B ENWILLATMPLS
1,666,280,677 *AF57D7E94FC76A9EC644AF1023DDEE7E31AEFE18 EPCU_
1,666,280,678 *AF526E42C7306D308A5B0A8C4BE259A0528BD00D ER,+
1,666,280,679 *AF50DB8B899F9D7688A9CEA7FEDA827357F5991D ELDRIDGE.BRUTUS
1,666,280,680 *AF5A61CC5BD1401831462756BE5D4F9EBD431D5C ERICYEHL
1,666,280,681 *AF5C4CE0AE1543C6BAF8FCA4DE12B66C28D56D4E ELENNAS
1,666,280,682 *AF5742F436F41620911006A6CC35F843005B0903 erlahmten5
1,666,280,683 *AF5E6495D1CFC8E0E4F1B086908868A6A5A23EDD erroldiangelis
1,666,280,684 *AF57690EA541D64682A4E3F4C081976F363D04AA NAHIMO
1,666,280,685 *AF5932967C440C142349C68A13C324FC020135CA najeikood
1,666,280,686 *AF5A6CAFA73195DB00675137CE7C897471C30483 erxm,
1,666,280,687 *AF532C9593DC494F70A6F136F40D397155951DDA elnaiem-salih
1,666,280,688 *AF5E2537DEEBF98FA27A7147827A1B55F06E9D75 ELPOIREP8
1,666,280,689 *AF560D0F65FE61ED868A82230AB46DA8CA2F2F39 NATHANIALGRANDJEAN
1,666,280,690 *AF5BFA396257E85A4E3768FEC8A7D836A3B4C495 [email protected]
1,666,280,691 *AF539A376F091288A93EC6A0AC033203A6B58DB3 negerijen
1,666,280,692 *AF5E55AD5533331F37F76E43579305A743E43FDF neilmillholland
1,666,280,693 *AF56740BC8D0FBEEBA0E50DE37904DD437BB019A NELLY-CAVAZOS
1,666,280,694 *AF501DAE525FCBE56B4A6980D4F2A13A02D8279C NELSON.SANTONI
1,666,280,695 *AF5C5FDC74118D46EE236E0D7AB9A7A945CEF7A4 NESRETNIKU1
1,666,280,696 *AF5A81170B64CE7F43A85FAA7EB99F31A41106A6 Everything-you've-ever-dreamed
1,666,280,697 *AF5D45453D53207DF4690587046B832A09C4EA50 EMSIVISU
1,666,280,698 *AF5236A146666A9635CD86115C14A6B6A26CC100 emydeluna
1,666,280,699 *AF561073893A2FDF49FB8D9814A1DA0E8E9B61F6 NICHELLE REED
1,666,280,700 *AF5DAABF51726A379041CA4B5F8B1351027341B1 ENILANER4
1,666,280,701 *AF542A077C7EAE00C23A919F4F77F6CDD9017E19 NICKNICK!
1,666,280,702 *AF58D3092D63071D0B40C4DB15AC19633BDD63B6 NICOLETA-NYCOL
1,666,280,703 *AF5AF3BCE01119DA84D252539BF958AE0B93ED50 EXPERIMENTEE0
1,666,280,704 *AF5DC9110D6952E181DCC7EA82849ABB71F4F03E NIKITA.TANWAR
1,666,280,705 *AF5C656B1F2074FF6CA98D2691B4C8D3DAAD3EBE ep7-q
1,666,280,706 *AF5E47864133C749275C939123275B3A8BD4BA14 [email protected]
1,666,280,707 *AF5423C7E4A65B632D1C03BEC828FA8494E2E26D NIKOLITHA
1,666,280,708 *AF51039181BC8D33BB1E88C8D4BD13ED5526F5AA NNELIST0
1,666,280,709 *AF581C7FB40881135F3D5317F16C50A283D647E1 NON-COLORING
1,666,280,710 *AF5302D6996F0A137B039EAA56E8540D96B4D39B F]B3
1,666,280,711 *AF5C94B3C88E76DA873E7966A609291747DDB633 nothings.too.good.for.my.tootsie
1,666,280,712 *AF5D4905AABCAF9B3C7CFB5393F5C9A1D28A7BCE FEHLERT
1,666,280,713 *AF5CC77AD7BD17072D37C8CCBEE5B80A79AC2A4D NOW--WHO
1,666,280,714 *AF5C4E130A6022F43AAA2B6EF9CD6F8C74F29609 ESSENTIAL GUITAR (DISC 2)
1,666,280,715 *AF5534663DBB0256C4D1DE4EFAA291F666042847 etafn
1,666,280,716 *AF5AD3E50CE658637C1DA1839E61BBD3938D020F FF{\
1,666,280,717 *AF5A76BF6ED098C5A16C3E108159B0B3BE7594CC EVAN.MIERZEJEWSKI
1,666,280,718 *AF520B3F4B0E19A88E72AF6597BBD02F4CC6384D evantruxon
1,666,280,719 *AF5B2BFB192793FD5B2E0D1B0A70ED5DE6F8FBAD [email protected]
1,666,280,720 *AF545668D868EF304B948DAD601EFA9B5E40A5EA FIRMWARES6
1,666,280,721 *AF5753ABB92E6BC126F2FA8700F7526E233A3FAA FLETCHERBELEZOS
1,666,280,722 *AF5785E49E13D1747A1554EA4A54BD2DD7DC9476 FLUGVERKEHRSDIENSTE
1,666,280,723 *AF5F5B74CB63445343EE4A001B3A0F51A54A1703 [email protected]
1,666,280,724 *AF581BB8547E7183420869C19B3D5B6B0D442522 FORCESEAGLE
1,666,280,725 *AF50DB65CBFB6599144E73B9C2ECAA957C0622F9 formel1gesch
1,666,280,726 *AF5FBAA9B1CCD0D2D1BA27B3F25DCB2438BE88FA EZEQUIELRESTO
1,666,280,727 *AF5699C781755D25EC91BC8BEF047BA3DFD74825 FRAN COETZEE
1,666,280,728 *AF5FF0F849ED2E426BE4F27C175F194FCBF2A72E FAILEENO
1,666,280,729 *AF5C4B007F84F8A4568B9DF898C3BA1A7C08FD9B FAMILIENINITIATIVE
1,666,280,730 *AF57CC386097D2BA570B592F4B212F8B4218E7D1 [email protected]
1,666,280,731 *AF51E193655703A209D516C40B5662AF27F6FED7 FREDERICCHITWOOD
1,666,280,732 *AF5F11AA51E95D57E74858495EB31B43D5D12245 frederictruesdell
1,666,280,733 *AF56BE7EA16B5E8C8790A8563222591B2BA98A45 ORCHESTERKONZERT
1,666,280,734 *AF5EF7EB45AA3F1DF6F7C3B609EF8EE3173BEC35 O;@S
1,666,280,735 *AF5DEF451B4CF80A01FD3131D61B039A9C811C64 FREDRICMITTEN
1,666,280,736 *AF53101E82A6CBF0C6597CCBEE7380166BFB345B OSWALDO.PARTIBLE
1,666,280,737 *AF5CD7E884EC7163E2BAF1702097B86DA7FEFE23 ottonoggles
1,666,280,738 *AF5769480AD520192428B4D652EEC98E5EDCF26C [email protected]
1,666,280,739 *AF5229B7725544E7505E37683FE9B902FB02AF5A O!UJ
1,666,280,740 *AF50A9E585C29B59925D5B9245BB28A2A442877E federicolinen
1,666,280,741 *AF512B9E021CE0C903FAFC6550836E9B7FDD8075 ferdinandmustaro
1,666,280,742 *AF5D62EB9BE9646E8B1B97940A7775807FF15706 [email protected]
1,666,280,743 *AF581FD711747398568D21054F9BBE95C89055A8 ffkm
1,666,280,744 *AF5325EDC8431A22E1CBAA6D04DE59117EF1846A p01ytei$t
1,666,280,745 *AF54161016E7C5B7A6BC68B0F402AB17265BC1D7 PADDI93
1,666,280,746 *AF5D4BA602B7CB480479A00A9A0AAE00BE68D918 FLORENTINO.SCSARPISNATO
1,666,280,747 *AF57CA284C172670FAADDE868445A6455FFA13CE garretmancia
1,666,280,748 *AF541360AD2341E0A75D149CAD6F51420233165E „paquita“
1,666,280,749 *AF5BE03219DE8FCBA16017E6A857D2628D8C46FC PASQUALE.IBBETSON
1,666,280,750 *AF557BD5CAAECA6E39259B3B32CF6351CCB189DD GBuilding
1,666,280,751 *AF5D14493777D8B603DD1D24EFD7A7DE8C2B65C1 FORESTSEA
1,666,280,752 *AF578291315DDBFF6D39149D0A3649DA31CD7D71 FREDERIC.SISNEROS
1,666,280,753 *AF5B2214651C2E28ED8BA6ED903D6CA1CD5746C8 payerforyou
1,666,280,754 *AF52AEC42C8BFB34E7F55580FD9ACF9C50AC2D15 geraldine-tecson
1,666,280,755 *AF52BB6250A3DBBD1688FB86706617ECDBDB0FE4 [email protected]
1,666,280,756 *AF5A6040854CEEBAA636376543FE52773C5FCE5E p=====d~0.~o.(0_<)
1,666,280,757 *AF55701AF31AD96D46756ED4992D217B20F59A6C PD*.>B0
1,666,280,758 *AF5A74A2D198AE7A8BB09433F977D7F5B2E2DFDA FROOTS-6
1,666,280,759 *AF5E2C039C54C2D1C456BB118976624C6CE8ECF6 [email protected]
1,666,280,760 *AF55C712ED50BA721D3257ED41366BEAC762A9C7 [email protected]
1,666,280,761 *AF5B4EC4BBF21C300E183F27C663DF837591DA9F gimmiorp4
1,666,280,762 *AF575E27BCFC8F3EDCADECFC2F087C77FA0C0332 GIUSEPPE.WHITBY
1,666,280,763 *AF5E235181FF9C55933FE041B40E636B0A7309F0 FYZC
1,666,280,764 *AF5F1D464826F1C4FB2EF023EFEB7F00B0351D79 goddart5
1,666,280,765 *AF58F8B77843AF2420D4EB9D91DCEF3572295027 PHILIP-MCMAHON
1,666,280,766 *AF55EF9C56F4A14DB19A35A85460954AF4AE89A7 GONCALE
1,666,280,767 *AF5FE2DAD65868F052A9870437BEEE12850CC9DD gondvana
1,666,280,768 *AF592D0B92D7A9BD4DE6951787503C973601805A garnetjeanette
1,666,280,769 *AF5BACC863035B6D79E86905BA8A075B08C0E4B6 GARRETTSIBREL
1,666,280,770 *AF51D201AC949CF10B9AAEA0E5DD1D00A33FC0B8 Great-Scott
1,666,280,771 *AF54FCFF22B8A3656190A9EF0290B3CC6CA0F08B GREGORIOFLEISCHER
1,666,280,772 *AF529900FAE66C3D43725BD9D5F3B0ACFF94F344 gregoriorim
1,666,280,773 *AF52930C709A893459768198CE53C0970387F642 POHLSON123
1,666,280,774 *AF5122D9C27D49C5C2C5C19FD2209D450C8D364E GSCHDBK4
1,666,280,775 *AF53526E4359533854463963C5FF8892125E88B5 GUEBWILLERST
1,666,280,776 *AF526E70E6B67F733FE58CF310FCE6DBEF7F3787 H3':
1,666,280,777 *AF5D587FC054E02F1B2A1D4ED51753DCB08BA1EA [email protected]
1,666,280,778 *AF5EEBEBEF986AFD4AC5409D2B4CF53808FE598A HALLFREDING
1,666,280,779 *AF59E88C660614E209C3F83B3ACCDB86767B44B5 PRAELUDIUM
1,666,280,780 *AF5A1375AB32E17424418BFEC4F6C6425AC12356 gerardoeversoll
1,666,280,781 *AF5079DDB59C1FCF0AFA6D12A0A5E1D64FC66095 gerardoprause
1,666,280,782 *AF5CC6D599A8105514655D21395093ED66FA3B81 gesamtheitlicher
1,666,280,783 *AF5A58901FCFAD8DFF23C43A6A4360AF3950EB31 HARRYSWOBODA
1,666,280,784 *AF53C538E59F2E741248E83F52D2B5F2428E1DC7 HARWINDER.SINGH
1,666,280,785 *AF5FE8091376D28BDD54B4DC50C545FDC8C098EE HASSANDUDNEY
1,666,280,786 *AF5ECE56FD8EC8CD90B83CA7732D30E02118B55A PRET4RD1LY
1,666,280,787 *AF595E134344DAB8080A8E4742D662180FBC4FB0 PREVLÁDAJÚCE
1,666,280,788 *AF564AC1BA05DEC1031F44C2F11E7C297F5997A0 [email protected]
1,666,280,789 *AF542D986FA3F8B1F13C7530CF9720BD15416E61 HENWOOD.2.0
1,666,280,790 *AF52F0267A575FB9BA93FC78ACB1A0AE375C63E5 [email protected]
1,666,280,791 *AF510208485A4B2BA436CE81A3AF5801EAB49B05 pshrink911
1,666,280,792 *AF5BAFBA4E99DE5ABAB0B3E549FEEEF9308F0E7A PURIL
1,666,280,793 *AF584814D557954A29AEA2FC77A967148DA87C9B HIPPIEBUTTER.COMWWW
1,666,280,794 *AF562A7C271ADBB544404D228A2C7E4BE27C3BA6 GNATHON
1,666,280,795 *AF5BF93E2479772DCB5B3FE681B394DC2D44D141 H%ME
1,666,280,796 *AF544094AC7F0EB64FC3D37352470410497FCA11 [email protected]
1,666,280,797 *AF59C29A1DA2F9EC294683B4457E3845B38EAA8E [email protected]
1,666,280,798 *AF5A4DEF067C37288FB9E66B4406145090BA16CF QNATUPYH
1,666,280,799 *AF51BC6B768F1584339D6F6398ED225C7B3D0CCC HORACELANGHAM
1,666,280,800 *AF56CDB7058F3C9DE2A1CB26E96223557A3C0129 quadridigitate1
1,666,280,801 *AF59EC8CA835D48A14DE1BC13034E01EC3963CED HOTLIPS(FEATMARKLINN)
1,666,280,802 *AF587E84298BF99495EE53A548FE8A0C981B0CA4 GRAIG.CHEATHAM
1,666,280,803 *AF5CFDDD218EDE42DB18A69DEC252886CF789532 qxavcun8
1,666,280,804 *AF5FF028286F6AC8700821C5F074003BDFFCAC51 r3c4ptur!n9
1,666,280,805 *AF5FDCCD47304A5D3D3B4F115D767CAA7BE64B8D GROVERTALKAUGUSTA
1,666,280,806 *AF50AD404C8AAD1D6851ED47C66F64E0C594C7FB ranreed
1,666,280,807 *AF52D1630709D0EA6E0016EAA3E0BD897FD40859 rashadsaale
1,666,280,808 *AF5E88DF454B58DF594F2CCBBF003A1FE0DCC054 GTWP
1,666,280,809 *AF585198BADC075088EEBCBAE55F9D91FFF8DDB0 H]~*
1,666,280,810 *AF58F456DE0C9DD240167DF75E5EB48412EABF0F remliew
1,666,280,811 *AF5C099ED8518E8C0A435E73DEC59BF4E0C78FC9 REOPEN(莫斯科市長表示惡名遠播的市場將不會重開)
1,666,280,812 *AF52E62B51BF964CE944E7B7963288364A3D0593 HÄNGEHOSE
1,666,280,813 *AF587A9E1A429F43C7DCBBAE1626F14EEC999F00 HARLAND.CORDOVA
1,666,280,814 *AF56702CFB25A0FF07548BA0B8C6B80DE335CA81 RGORRICETA
1,666,280,815 *AF5EC35689C8ABF747C3788B2537BDE4756EF3DC IKEFIEBICH
1,666,280,816 *AF535933ED8FEB4C4B2B7B77FF2B307EBB39D7FE harleyodendron-unifoliolatum
1,666,280,817 *AF5468BD086EDC6CD394679E505B5E9426652103 i.know.that.you.know.(take.1)
1,666,280,818 *AF50963BB09FE1BD3524ED5945185F7A18C0072A HARTPOWERED
1,666,280,819 *AF56A8AF1866AAC9D9CA33918B92B145D3088078 ILOVEPHOTO14
1,666,280,820 *AF583953F79BBB1916FBED948DE48522397938AF rigobertoparkers
1,666,280,821 *AF5CCA526B3ECABE90F48B66ED6E9A70D3D9BBD9 riley-hackett
1,666,280,822 *AF59CB4AFB89D36EC5C8B9BC1CCB64A23EC607BC ILUVTULA46
1,666,280,823 *AF55B0F244C30B1DBAA3BA8841FEF08E07FAB01A RIZOSOS7
1,666,280,824 *AF54A940061AEBB9D15F9E284FC9FEC27CE0E759 [email protected]
1,666,280,825 *AF57D4ECC7E6BA4D10D91DB68CF909647A5088D5 [email protected]
1,666,280,826 *AF5D744E8E09B02FE35DBEB8C3680B497A4B169D ROBHISEY
1,666,280,827 *AF5F9C5597DE1F15E5B858ACFA589A691654AED8 HERENBERGK
1,666,280,828 *AF5BECA6915A5FE52FCC21C6F446398DE6E1AFAD infr4g14c
1,666,280,829 *AF517C1C22F79E8F54DB0E15E786471D9E206EB8 ROGERNERBONNE
1,666,280,830 *AF532288026925D6FF6ACFA89FB76B2BB8DF2C59 IOORTSEGGED
1,666,280,831 *AF591FD5DDFA21021A73A004494C0938209FA032 RONALDBAUMBUSCH
1,666,280,832 *AF5F87305E6317AE3F0F56FF7F9199B0F4070AE1 RONALDVRBA
1,666,280,833 *AF57238CD7E5D31F58A866F5541244A3C8C0FCC5 RONB99
1,666,280,834 *AF5213C963E62582C541885A4CBB07B60E796C4E HMOOCOW4
1,666,280,835 *AF57A0869D56846D4825937A73AC34EE3F37B28E HOBERT.FURRER
1,666,280,836 *AF5160DE8C1230CBBBCA308563D5ECCDE8AFE1E4 [email protected]
1,666,280,837 *AF59DE307B39CC472A70264F5E04F1A94F2C072E homerkinker
1,666,280,838 *AF509033E9D5393CA4B5610075EBAD649886A0D3 ISSAC.MCCALLUN
1,666,280,839 *AF5D7ECA449B327D8CE70B1B29F10D20618A04E0 hongwalkup
1,666,280,840 *AF5AE8AE5F1D5EECEFBB9300510CCB4BBF806D03 ITAIBBA0
1,666,280,841 *AF52823C8356C1E2A6DC7A18ACF80F9B09D39F9F HOTELLET9
1,666,280,842 *AF59B98E83A82CA1A500F995B558FFCD0961E1A6 [email protected]
1,666,280,843 *AF57DCB3A943C0E4DC723D3D23F967317CB36CF8 ROY.CALIXTRO
1,666,280,844 *AF5D2973031153FB7D621307EA2631DAD739BEB9 jackieculpepper
1,666,280,845 *AF5CE5F2953A978C8DAAD267717BE0BFE9706C7B JADESKIDS.ORGWWW
1,666,280,846 *AF5D54E9F97EC88D7C10EB1909666B64B1F42A93 hrskiint
1,666,280,847 *AF52CBFDBB66ACB7D247FA3811C6CA401BE5CBD4 JAIDYN982
1,666,280,848 *AF571476189C82A4248E8F54D24E9E4F378A631A [email protected]
1,666,280,849 *AF5805A86154CFE7EE149431A8972307B3C35862 SA
1,666,280,850 *AF522AC9A17BDCDD5C30ADB00AF62A82CA6FE306 [email protected]#
1,666,280,851 *AF54CB97C9DACBC871D80F02086754E3624A82B3 jaredhickley
1,666,280,852 *AF500A822FECBF56AA1792BB64AB7E71819F567D i+av
1,666,280,853 *AF51499D758957FC039B4283C51B0159FDE308E3 JASONVELIE
1,666,280,854 *AF5DEA811437D6474EEF8EAE9479CAA142F84A3E SALVATORE.LEVERE
1,666,280,855 *AF5876AAB77AD9E38D3C4ED9618474FF7CCB6A3E IGNACIOPINKHAM
1,666,280,856 *AF551AE460C62FDEDAA9C6228D98835EEC938E19 Samatikraantam
1,666,280,857 *AF51BC3C1CC62EC74100E9AD2EBC2A724558EE0D IKZUCHT2
1,666,280,858 *AF5C2B04BEDE9AFAC298B7DACB604C16C8F5255C JEDSARTIN
1,666,280,859 *AF5D6B40FA1273738399CF2F4C2357A4A76A4894 SANFORDZIC
1,666,280,860 *AF57FEF67E9EDE226E9FA662D8B0EAD71BF3D18B sangderx
1,666,280,861 *AF5C925DC3C3F2079C77AF5A08509F1C271F878F SANPEDRODEMONTES
1,666,280,862 *AF567A2EEF5673D4F4A4339009F6D0DE766A6D72 I LOVE YOU BUT
1,666,280,863 *AF52B189046C44CD8C7AA0B6CC81CBF748CEE08F JEREMYBUSHAW
1,666,280,864 *AF558E9D4C20C000F5AEA3797BC2EDA4D44DAB7C sarah.mceathron
1,666,280,865 *AF51A5DCB22FDE53A2639AFBA4F711CD0E99308B ILUVSHARON65
1,666,280,866 *AF5D79CE1049CCB70639D90A7D203919C97FE656 IMBISEEN
1,666,280,867 *AF5F69C0C1F5CCAC6AAE244BB400783E6E10EC26 SAUL.LIGHTCAP
1,666,280,868 *AF5261D93741324B5801BC680A1048D850236CCA SBDCSATURN1
1,666,280,869 *AF5E074CDC8EA831383F6BD381012C0946D04769 IMRFUYKQ1
1,666,280,870 *AF531C68AEC0E67314982F421770D40664AE3FAF SCAPOLITEGROUP
1,666,280,871 *AF5D333C7595393A461D70D1405C3B10C502ADBF SCHLUMBERLAND
1,666,280,872 *AF54865348A68A7D7D94EBAC7FDC4B86B8D257DB [email protected]
1,666,280,873 *AF5C3FFDEF55B012AC1F8C39AF51E69BE6FBCB40 SCOTTIEEGGART
1,666,280,874 *AF5E61F255FE243C950C8359B5B2663CEE1BE7FC SCOTTYFEATHERS
1,666,280,875 *AF5EA3D8BA0D8025D386D13665FDC54A7AE3079F S.DEL.SIGLO.XIII
1,666,280,876 *AF58937D5E162A6ECDA8B0DC42D952C948974BCE seangerundo
1,666,280,877 *AF57D6935377BC4E3DC60EE6C8E014C463AF8116 JIPPI-JAPPAS
1,666,280,878 *AF5C8FBE7BBB53CDA93551E9A30D82A7EA8CAA94 Inner.Symphony
1,666,280,879 *AF50AB5D935312A04E815ED4944387FF2C707C89 JN20010601353
1,666,280,880 *AF58CAB22083B103730A1F8CD62AFAB53A8AA20C SEGHERESTI0
1,666,280,881 *AF505BFD5250829BBBEB7C1FEA705B82D1EC79AA INTERMEDIATED
1,666,280,882 *AF54434101B068A6122C91971CE95DD257B1D100 SELIMESI10
1,666,280,883 *AF508954105CF7C6FD0B283295B9F959682765F2 IRA.ULBRICHT
1,666,280,884 *AF51972F1395FD4A0A4077FE74C997FD7FF3DBBA SENRELGNAMSDIT
1,666,280,885 *AF5FF2A1BD8CBFD4ADB69C4404CFD1960B205E97 SEPLOVE
1,666,280,886 *AF5C5392BF38FFAE45E41289EF26332491B6211A SEVENTENTH
1,666,280,887 *AF5BAE3575CAE2EF07D9406AA169D6BAA922A8AB IVANHRUSKA
1,666,280,888 *AF53EBC6376305EB0D775C9C7909BD933D77751F joseph.fennimore
1,666,280,889 *AF564E4A6B543AD784E2C64F22A2D78A99B5FBFF shannonpeterschick
1,666,280,890 *AF5CBCEC5F9747E4C57035BA0316C07223C6A020 SHANTAINS
1,666,280,891 *AF5E6B26CD6F87E15ED6D1183A00FEE48CE82852 JPBL27
1,666,280,892 *AF504BE7D0A14D22ED96B42FDF24FF6031A63CC5 JACKALYNNARMOUR
1,666,280,893 *AF5310F730F532C6F234217C4D06A9203E41E989 shemika.nixon
1,666,280,894 *AF5605927F8392095C1937CB1F40396AEA4851E6 SHERMANMAINERO
1,666,280,895 *AF5D2EC221BF04B41A22CD79290F73A9333C9B8D Jagvillseschack
1,666,280,896 *AF5FD4F1FBE16317017E661763FD717903EF146C KAREEMDOWLAND
1,666,280,897 *AF5FB340689E2D9BF1B5093C3D1E0715E222E9E0 [email protected]
1,666,280,898 *AF5555A5A8C0897040E0BB632ECA5CAE03B1AFB7 kegelspelen
1,666,280,899 *AF5EAA5B4832F861115A8BBAD3D276FDA8CAC80B KELLYWILTROUT
1,666,280,900 *AF5ADB9FDAB422BDCAC79FC2201774F120938F0E KENDALLGORDIN
1,666,280,901 *AF5BB4B317DD8A5C62B5AD88275B4328B10E22EF SHRININ
1,666,280,902 *AF565197A9472FE42B496B0BD557DA9B1031DDB3 JAOEC
1,666,280,903 *AF57226FC59476D42540D31126351C01CA44AEB6 SID.DRAY
1,666,280,904 *AF5BCA15D92354537D72CB4EA69692746E5C6D6E kevin-gomis
1,666,280,905 *AF5CCC735F6D6A0908AA0F84C90993C11586C71F JARREDSHOUSE
1,666,280,906 *AF5ABD7CBB0B28C8215DEC928E618F94DCE305C8 JARVISBONA
1,666,280,907 *AF50DA9318F3DAB61F3B8E8EB80C6EF78584A627 JAULING6
1,666,280,908 *AF5A0C732C5E86D167C2F629BBFF90A6C999CCCB KIM DAVITT
1,666,280,909 *AF5381E869457791C760FC2BA353AB9A1FA14A51 SIMON.MANGAN
1,666,280,910 *AF50C544F3AB91D6DC9E31C5226E09B01C35B26D jcclippinger
1,666,280,911 *AF5FDFEC9A9F2BE53AD42209CABB22C4563F1915 jcnfdfzcm
1,666,280,912 *AF5EB4A08E2FA5449ABF1F488CE7A784DE1685AC JEFFEREY.HESSELRODE
1,666,280,913 *AF5E6AF4EB9DD15D0CB4D57D94A81E24753AF1B5 SKELETTMUSKELANSATZ
1,666,280,914 *AF536D8306939417AABBCA064AC38B2F7BF4D193 KNIFEOR
1,666,280,915 *AF5F227E9DD742D01637CE7BEDDD35FF44F2E184 JEFFEREY.LERER
1,666,280,916 *AF5CFFF5FB872EEDF4BE6ECA9A884762226D740E JELEGZETESSÉG
1,666,280,917 *AF51A3FAA95849CEB32D440D60A8D5AE21C94C72 JENNADUNPHY
1,666,280,918 *AF5CA49A6AE4ADA73924DD2997B6AFEB1C5FE79E [email protected]
1,666,280,919 *AF5D60309C1BAFE8085EB9B17B3448C968C5BD3C JERALD.ESCARREGA
1,666,280,920 *AF5B8AC20E8140442968ECECBB90B21DC1351619 komplexná
1,666,280,921 *AF54857D1D14F24FAB7C3BE56188FA71C00A2E9F smiles1905
1,666,280,922 *AF5C3A3BE3BAF8314C13264604E0B72ACDCD163B KOOKOSRASVASSA
1,666,280,923 *AF561BD18AE64E5378634D7D49A621E8645CAF70 kootenie
1,666,280,924 *AF528B4FFB861EA627DA3C6C2C276D5454EA2A56 SNIPERGOLFER6
1,666,280,925 *AF5EC7273BF2761AF3D81C94EA51C1775F7E9DEB SNOIFIRTIV2
1,666,280,926 *AF5A2A5765EECCA4FF0F20F80B598551E9C494A0 KRISTELGREEN
1,666,280,927 *AF5EE21F55D2D3333EE41DEA09BBC889B68DA6DA SNORRIS2
1,666,280,928 *AF5CF45B4F71DC07DD0A0C03FE971FC7B7C6352D JESSICA-WILLIAMS-CAMPBELL
1,666,280,929 *AF54D00057009208617B291606A4794A5A45E393 SNUTTISED
1,666,280,930 *AF593EDAEF2026EE46739F0C80BD8FD14ADB2881 KWESLI
1,666,280,931 *AF5B40C4EA85EF3C7332F081BB5410F93B05DC05 [email protected]
1,666,280,932 *AF55AF820DB59453D749D7F265E3F67C0EBAE268 Someday-(Future-Breeze-vs.-Junkfood-Junkies-Mix)
1,666,280,933 *AF5538190E8690ED503AF489BA26C733F5630BFA [email protected]
1,666,280,934 *AF585500A05233126C83548A2FC4657BF13D4AA1 KYSTBANE5
1,666,280,935 *AF5C1C5BFE0248FFE07EBDB8609BACAFD9EBA961 JIMPIESTING
1,666,280,936 *AF51514149719EE776A548D1E8143EA1AC18DC7C LAMONTRIVERON
1,666,280,937 *AF5B0D4E4A7E255E029A41723DF1A98F997CEA27 $LAN7W$E
1,666,280,938 *AF5B87DC02E42B8AF7F60A198053E4DB89446279 jkscott6
1,666,280,939 *AF54012E116114AE1CF0E47C127CDEFE708701EC JOE.BENDA
1,666,280,940 *AF526E0C3B70644CB09082BC2BD6737E0D037F0D SPIDERCESAR
1,666,280,941 *AF5B16C63938A87032876F1CCA6225F4A425AD1F Splat!! *(8
1,666,280,942 *AF5894D2EC4BA91FC24A54F7433BE7E2425702C2 JOHNNYFROHBERG
1,666,280,943 *AF50300145AECE5842BDD732E05235819438C76F SPLAT~`~`<------P
1,666,280,944 *AF5B55F1A9B4CE82A28CBCFF277B2B7B5B855B26 jose-luis-escobar-alas
1,666,280,945 *AF5241B065236C6AE5E491F212D5DAFCE4C1D7A6 LEIDINGBUIS0
1,666,280,946 *AF51739E60C58988527FBA5F43686163D36159D6 JOSPEH.NIEMI
1,666,280,947 *AF594037E8EDB9EDCA600ECF2A2E2096387BC301 JOURNEY IN TIME D
1,666,280,948 *AF5539F48C9433231A7FD8F098080169D4AF59BA stancipolla
1,666,280,949 *AF590B09E7A60608475656E007A9A0F0C81A58B2 STARBLAZ8
1,666,280,950 *AF5D72E5811AD700DCB29BEA26A074161BD027A6 JUDSON.ISLAND
1,666,280,951 *AF5C308D07A79A76541A45B4CC8932BC9A3011C4 JUDSON.REBICH
1,666,280,952 *AF5050EA2E629708E0E05F649A17A4AB8294ED58 LEPREUS8
1,666,280,953 *AF50E50743B0D0E476CE3FFEBDC0BC0769816D4A justinastley
1,666,280,954 *AF5B022D54DD5E5D0A8B321BEDE4AC9D2CD99E44 LEWIS.PUMA
1,666,280,955 *AF5147FB71B555E1B3B4652BC0B84D535978F0F2 [email protected]
1,666,280,956 *AF5C44ADC2BB9AE098EF1C4727489FE28EE45738 stefanbookbinder
1,666,280,957 *AF5FB76123CD741D8C954554E8FA0B2C66B15F4F STEPHENDIBBLEE
1,666,280,958 *AF5562187F678D06612DBE2ACAF917A8EBC516E7 LIFENYUN
1,666,280,959 *AF5E3BBFC1480B259411875FD70563BDA4407CDA sterlingpelletiu
1,666,280,960 *AF5B092D49BFB77257994215990C1B8FEA51184E stiboniu4
1,666,280,961 *AF53B48641B2CB2FD624DCD87D5CE3061A61EB72 k3b)
1,666,280,962 *AF528BA8910AB1D043C69A61F7EEBF3E0CA44DDA KAH$
1,666,280,963 *AF56C2B18E9C1BDCE37C82BB3FA5376FBA6B3AA4 [email protected]
1,666,280,964 *AF5B2D23D1ABBFA0557FE779782A399E19D34AB9 STUART.SCHNEPEL
1,666,280,965 *AF57E56ACBA77DC547E2F2A4ED5101427D2FC4CF KARKLŲ
1,666,280,966 *AF5A3023582A5592EB94791BCB3686FAF2818166 LJNH1234
1,666,280,967 *AF5444042102C74EEE21823C253CE25B2EFA8158 [email protected]
1,666,280,968 *AF5C0CEFC78D84625004696736112C10ED781974 [email protected]
1,666,280,969 *AF5A413932D2C32060C0266DF8D6B93C45FA3153 [email protected]
1,666,280,970 *AF5C92C9EE25882FC4116B6398588EE9BD9D2E8E [email protected]
1,666,280,971 *AF52F65519EBA11E1DE4266A7001F431303A2169 [email protected]
1,666,280,972 *AF5D5438812B83F6827B5A1A4F97377A149DA52B sühnezeit
1,666,280,973 *AF51F4CE68D19F8A035658A894C617D5127977A6 SULYHPOL6
1,666,280,974 *AF55C3C242C3ED5344B63095B562918B27E79BBC LOOK.GUILTY
1,666,280,975 *AF588862DCA792B300CC4A34D715E5E758EC8FED KELLYMATTAS
1,666,280,976 *AF51EB2EA94102522BA6E2BF81D0880ED59ED7A6 love.me...,.love.me....(unu's.dub.mix)
1,666,280,977 *AF575517ABDED2CA9CAEA4D4651E5F1CBF0B95E5 LOVE ME..., LOVE ME... (UNU'S DUB MIX)
1,666,280,978 *AF574E03994C6E5C8CE8F948D14B7BABEC51FC5B lovisa.olsson
1,666,280,979 *AF5922369578F4BD488429F93954FD3D5BBF2C2B SURAIZR
1,666,280,980 *AF55A3B4D77EE73289E26C73F278112AE83403BF suranjith.lakmal
1,666,280,981 *AF5747D7CF69880A40B471EDEB3103FCC66946B5 KENNITH.MEJIAS
1,666,280,982 *AF5D358D86898D818B5094372F26E7777704ABBB ls*v
1,666,280,983 *AF57E181C443B437B63E8B68E83BE7B809DD2DCA keren.mashiach
1,666,280,984 *AF5F247CDE7B732C1EDD060FA429FEAC51DDB975 LUIS.GUSTAFSON
1,666,280,985 *AF58D0CB925AB125DF834CEB4E8BE119BD4A69A6 luke.tatta
1,666,280,986 *AF53DBBEF0B189535D573837EF60160D694996DD KEVIN.PANKOWSKI
1,666,280,987 *AF5854D30DF179CDA131E30951D1BFD5257197E5 [email protected]
1,666,280,988 *AF53E7A3FB0A62B1E1FE65F8C29C766E354BC196 LYLEBONE
1,666,280,989 *AF59E7E2E6FD2CC63D1D01BEA83BA569C9A6D1E1 SYLVIINAS
1,666,280,990 *AF50DF7931E33F3B497BAD2742B2B6CC7CA5578A symphony-no-2:-i-allegro-molto
1,666,280,991 *AF52BD248118698321F13324D6C4C0FB13EF19DC kirstin-sinclair
1,666,280,992 *AF5D030EF250B48F9DEA5271253BA46B4CA70B54 KITABI1
1,666,280,993 *AF53C060685FEC360AE700E43CE7A71F45A5E04E M31ON134
1,666,280,994 *AF5AF068CD65FCBEAF00B39F5324804BDF66B55F TALK8425418108
1,666,280,995 *AF5234F6E4DBEC6B58557D593EAB15E8C59A2072 TALKAZKANAZ
1,666,280,996 *AF5C009AF5DA3FA566CED3D572BBCA11AFC9A8B9 TALKBOUROS
1,666,280,997 *AF5B17022EF7DFBAB15A2AD882C5C85936937FFC TALKEMILIO_BUTRAGUEO
1,666,280,998 *AF5238B278D5560F8CF3F5CC95DE5FC10C8C062E MAGJATE
1,666,280,999 *AF5E9F4021494CAFDA887CBBCC84D3E7223F7DC5 MANCHANG1
1,666,281,000 *AF57939A0E1D82C034EB52BDCA39960FD41EBDFF MANDARIN642
1,666,281,001 *AF5633E0FEBD661027B3BF3E2892FBFA5536F7EF [email protected]
1,666,281,002 *AF540D0C57E876965AAAB7B28F45CE55808FB943 KUBIKKIL6
1,666,281,003 *AF539464580A9592DF56DFADE9C6B963EBADFC63 KURTISVORWERK
1,666,281,004 *AF52A42C380D1DAD164F8603C0A5467716999034 mardirivetti
1,666,281,005 *AF5825E21982B42A7E293E6A5E179C4DE2154335 MARK.EGGE
1,666,281,006 *AF584541E92324A7B7E7F75F4BE3353924FFA26C [email protected]
1,666,281,007 *AF54014B560CB33387535A23953DC47459D2F62D [email protected]
1,666,281,008 *AF5E5D5562AF4006A729E2D56DF3F4C0D80DF2D2 LAISSEZFAIRE
1,666,281,009 *AF56944B23542A39BCDE7E622B64150520001D55 MARTYNNICHOLSON
1,666,281,010 *AF5C41810D0334CDACFB919376E2782C690C38CE TESAURIZZATO5
1,666,281,011 *AF5FDEF097824CE34E037D6B3186EBF0654BD39F [email protected]
1,666,281,012 *AF5011F5345CF742FC348ED3F9EB66BE8E9281B2 TEST1232005
1,666,281,013 *AF5319FFB58AB0E7BD70E00D156A2AC9A4B93FC9 MASTERDOCTOR
1,666,281,014 *AF5D8126682F14BAC56A18628FBCCF160818432F largheggio7
1,666,281,015 *AF5A888BF763CF79C5E33A1E9C694F59C47FF568 LAURA-COLINA
1,666,281,016 *AF5891CC32C4D63BC85EB6643BA95E4709AC4A97 MAXSIMLEY
1,666,281,017 *AF56950A05A90049152D00529E7FC8F1B42F07A2 MBATIANS
1,666,281,018 *AF5D207ECDDF5FB8DE118B960188A765CC714CF7 LCPI:
1,666,281,019 *AF591129B4EFF2E3784A2B34E07DBFE6B6851B73 MCMILLANCX
1,666,281,020 *AF54116AEBFC27FF218D44D2E4E9DC7BE5F91CCC THEAARDVARK46
1,666,281,021 *AF5FD2139062FB1412DFC6C885F20EBA2D5C8C68 THECORVETTE99
1,666,281,022 *AF51888663ADF5B709494BC82799CCDD915D8C83 [email protected]
1,666,281,023 *AF5F324C663A9F7104EA490524FC18BE5E5AA44E LEN.KRONE
1,666,281,024 *AF56C9575EEA45A639DDB58A78301A339BEA1AF9 LEONARD.CALEY
1,666,281,025 *AF5FFE43F4A0F87A8909A6ED9CB18951653E3E9C LES.JEANTS.DU.GAZZ
1,666,281,026 *AF5E85A43DE7310CC5B414C21033E56DC71B91C1 'THESESSION'/BRERETONS/SEANSEERY'S
1,666,281,027 *AF5C6CA12CBE6AF65D1A25589A497D54BC55D829 LEVI.VOLD
1,666,281,028 *AF554BC11753BFFBCD2A9303286FC11A74697796 levyingged
1,666,281,029 *AF587E7B57D848A03D3BEAD7420544D87757DC3B lgh+3n5
1,666,281,030 *AF5BCEE8E0D47D4D088390C97A6EBF31B627F183 MICHAEL.KRENZER
1,666,281,031 *AF53068B4274F56F8BBE3BFA23C4E952B9B3FEF3 TIEN?
1,666,281,032 *AF5AD28CDDA94E58E205A826F135D56AEEDC03A7 MICHEAL.ROWELS
1,666,281,033 *AF5D37055D884A0A71AB3D7121722CD68896F911 MICKEYSCANLIN
1,666,281,034 *AF556EC6E13F58B024984C3321945D38DDD73126 midnite-sunshine
1,666,281,035 *AF5ED2696658052E6B8192F4DA4DA0E08D51E600 TILL4DT
1,666,281,036 *AF5CFEA41317D1361D6C15345025F40DE0F0944A [email protected]
1,666,281,037 *AF5738FBB00C8FD1EC8A9D2122D8A1AEFE7928EB [email protected]
1,666,281,038 *AF5B091CA807503E61FB376381724C2C27984FFD timmyflemm
1,666,281,039 *AF5D8659E91363D857B060C7613808BC145B1597 mikekuehnel
1,666,281,040 *AF556089B1FFB6B366D71BE8CDEB7438B5FF6455 TIMOTHY D QUINN
1,666,281,041 *AF585329EC02BC5BF696D3802F3C4F53F41C168E TIMROLARK
1,666,281,042 *AF50D9251562887DE22CCD45CC4C0B57E08713DE tinaandmum
1,666,281,043 *AF5263E98C09870B68C743355BC5971783A61ED6 [email protected]
1,666,281,044 *AF5F22CB9350EED6831DABB68846D1FAB2247CB2 TINIESTVIOLIN
1,666,281,045 *AF5C31BCFA4C4E9A2F03C0F260F1055E23E1CA52 tinygrabmakessharingscreenshotssimple
1,666,281,046 *AF5A53D4EDAEA6A96069AC418FFFADB504F8FCBE milkgras0
1,666,281,047 *AF5257091BCC97BC44D57DFF6844BC4F99E28ECF [email protected]
1,666,281,048 *AF5304CB6469BD86FC6CB35678B31F8786E5B142 TNEICSE7
1,666,281,049 *AF5D5D122F2AD112719573AD7C45C5C3E0A2077B MONTE.BEHNEY
1,666,281,050 *AF55B167E0E7018DD2E0F468AE95797D0AE94ED9 LOGANEVANCHO
1,666,281,051 *AF54D0BC4EA00077E3792EEFCD22DD6547BCCF2E TOURNEURN5
1,666,281,052 *AF5B431A2595ECB63637EBA1B8A83E9FB5DFD786 TOWAGE
1,666,281,053 *AF511E34316D31326A6DD6689C880CDBE6A79CE2 loriwardsmith
1,666,281,054 *AF55076429D0B32D01276B52C85368D234FFCDB3 M. POPPERS
1,666,281,055 *AF5EF0E8D4923140C73AE2DD8F029D2CB94AF234 LOUIS.COMPOS
1,666,281,056 *AF5CE8FB0692DBAA0BCEF2D54129A4F89A6872F3 TRAVIS.SCOTT.MORIN
1,666,281,057 *AF5B7F97748EFF5D4715EDE89A1BDA56B544780F TRAVPASS7
1,666,281,058 *AF55C790D4D2AF4C0F747E1398B0F0A505D421C3 [email protected]
1,666,281,059 *AF5D6DF3893DEECA5BF35531A4A9BFE466FE4FA9 TRIBÜNENPLAN
1,666,281,060 *AF5ADBAD976C2E31C1C3342F673ED8E681A775B2 m!stook
1,666,281,061 *AF5BD4CE2032DA70CFDB6869544F42575C160F9E TRUELEGENDMOVIETRAILER
1,666,281,062 *AF59E3AD4A8F40570A0906B3B9ADF0ACA151B29D [email protected]
1,666,281,063 *AF562BE72F98C25B91DDEB3B50B1A840CD4BA1D8 TU%A
1,666,281,064 *AF57A327B7104945B070C71CB0C6FCCEE7BD210B TUSIND
1,666,281,065 *AF57C06200B61C2B9711539E4FEE43AF7333F479 TVBH
1,666,281,066 *AF5A10CEC919FA055D8CB5CF04C364D07084E0FB [email protected]
1,666,281,067 *AF5CBB890A7B8B9C7C6AB1563C1E1676B9229199 tylor-peoples
1,666,281,068 *AF59A7A629B6B63C6AC87B18CE0B1650E5623EC2 tyreeblore
1,666,281,069 *AF53466A8E948DDCD1372E9F35D2268E83386DB0 TYSON.METOS
1,666,281,070 *AF5117DAF3A7848E721A94FFDB8E98B0A3AFBB04 TYSON.THAM
1,666,281,071 *AF547D020C68F2B64D4C3041EAD7BC387280BA56 UAGITUMQUE1
1,666,281,072 *AF599A69F6C004024185E175C3FDB43AA5D03A8B uarekena4
1,666,281,073 *AF5107D77A04C2BCAA1E93186FC9A0F5665B5BA4 MACCABRI4
1,666,281,074 *AF5823FA625217A4770BDE47D8A869F95E0FF117 un9ov3rn48!1!+y
1,666,281,075 *AF5C8BA6174C90C350C9118AF433B983711DB3FF malou08
1,666,281,076 *AF59EF0196398C987E923800D0E469B6DF2C3EFD MANASSERY
1,666,281,077 *AF5447685264356AFB38A8637C73AD48434D424E UNIVERSALITET8
1,666,281,078 *AF59F0BB690BC5D21A00E775D0919AE3B949043C [email protected]
1,666,281,079 *AF57B19556646AE1C2F4ACAE9835B21A742AB528 NESVARIS1
1,666,281,080 *AF593286051CB9C69EC2D67F3621990F4B58E685 UPREDENE8
1,666,281,081 *AF505E2053E80C1BD0F8456600A991BF2625BAE7 UPVENTWASTAGEWASTEWEARINGWEARING
1,666,281,082 *AF539413B8EC7D4332D5A9873AEDE2680DD0DE30 USERPENSIL
1,666,281,083 *AF5FD7F3B6E14B7E28D11017D16FDCE187A72CB2 USPOKOJOVNM0
1,666,281,084 *AF56FA4C036639AB22B0984CE46DAFB471C85607 nicholasdauria
1,666,281,085 *AF59F002F8F937D81EFA8BD2091AD39ECB905BC4 mariascarfone
1,666,281,086 *AF5C63AF0EF144C9FD31B80F2E84B65950E3C347 MARLONKSHYWONIS
1,666,281,087 *AF534EBA106A8F42D997DDA56E673C0364CE3477 UWAECHUE.HANNAH
1,666,281,088 *AF59FDF5D07461F1D855DCA0ED8853EFD7497937 V0cfera+ng
1,666,281,089 *AF52B3FF2391A57762E4C27734583CD13D29EAD0 NIPERDOUO
1,666,281,090 *AF512C98331F2059BB133EFB7837F5A10F768F2A MARYLANDPAGEANT
1,666,281,091 *AF527B00FEA5D13543A799FF9D45182F7AB62A7B VAINCUSEN
1,666,281,092 *AF5524FA1899CA0D5AF13CFB912E744C3F9CF9F7 valbona-saraci
1,666,281,093 *AF57FF51E6FE3F0353A19AE23A04E532AF3094AA MASHWORTH
1,666,281,094 *AF52B56EA4788FB9DF5DC0A0435733AE70E983F4 valentincarriveau
1,666,281,095 *AF5095B2A8A5200384375A58B170DB1012BF36C8 NLANTONIMINA
1,666,281,096 *AF55446E2FA72E8ADFD6C167A65F5F58DCFA1D37 VALERIEPRUSKI
1,666,281,097 *AF5BF88714FCB27B8B948860542F8282D2F3EE55 valveutuneita
1,666,281,098 *AF5069EE61C1061B2ACCC24C1639F6D91CE90A8D MATTHEWPASTULA
1,666,281,099 *AF549FFF003FEFEBA2B78BACA7EA168FCAE0B385 NOAH.DOPLER
1,666,281,100 *AF5D779DD0EFCDCC011CFFDE8EF0270D4046DD79 NOAH.ZARETSKY
1,666,281,101 *AF56F5C313DB8C04BAACC452F3FDCB73F0D199F7 NOBLE.KOVACK
1,666,281,102 *AF58DC4EC9D36F32037061D8FA3A006F8A369792 noilehir8
1,666,281,103 *AF5DCBE01D36A5C5AD42062DC2B0563DE296FAAD No-Me-Averg
1,666,281,104 *AF50D1ADC9E8642D0036775FC3C56F5469DD95A6 nonr3$id3nti4l
1,666,281,105 *AF5B97B16D7C68D4F7712AC2D09F5475F9E12F34 NORBERTO.FRANKE
1,666,281,106 *AF53EBC87A06C7CA8C47C2A2AAF11D2DE7F3EFA0 maursurloire
1,666,281,107 *AF5B3184468A83DF8DF43CC62C50438BA0362025 notwise(featcarlybond)
1,666,281,108 *AF5AC93ABE7E5CA159AE609551936D75CBEC2FB8 veergelden8
1,666,281,109 *AF5C305EC26D9864A17B4AD69852C2547C8D9758 melinerion
1,666,281,110 *AF5F818D3C39574A94EF666E015F054D27D92873 VERNON.BALDINO
1,666,281,111 *AF53CC3250F640EA4D480927249BAEFB94C09F09 NUMBERSALLENSWORTH
1,666,281,112 *AF57A834524BA9942B762A960EB2B49720964E7E MENDLEBAUM
1,666,281,113 *AF57F755C991DDAD6AE4C3DD0419AA236DC677CB vicentepadula
1,666,281,114 *AF5678CF68159249F502C67ADD6D8E858E957D93 VICTORCHLOES
1,666,281,115 *AF5F773C2F54CB9E766647A71F61140E9F8723F7 VIDHI SHETA
1,666,281,116 *AF5277E6F99FD4D9E2E4329D251D87C52D07A082 vidnetsing
1,666,281,117 *AF514CDA4C5E541F763F2D2B51C7FA4ABD7250D5 OCTAVIACOX
1,666,281,118 *AF56D4577A9936E1F9A491B4672C3499FA096390 MERRILLTARNOWSKI
1,666,281,119 *AF5B730237F1411898A80E55F9940FA36EF21CEE o><.`d====b
1,666,281,120 *AF511FE7C25917ABF23A935ED987938E698F7CAF VILLAYNIS0
1,666,281,121 *AF59A24016626D56832E4E5612B6C19B08B77793 mia.durkov
1,666,281,122 *AF512F3DC87948BBD4973F5A5BCB030AA6EE80E4 ODVOLNAED
1,666,281,123 *AF5124F06258020221CD57D2F58FA812D98EA627 MICHAEL-ALBIN
1,666,281,124 *AF5767D9FF27A06C75989D37C1E9CED0A155C890 michaelgrohmann
1,666,281,125 *AF5FB13250407643C668E1AAD0448070960E4006 viper1dog
1,666,281,126 *AF5DAF0BE4972B79969A4972E222633A4A65B3D3 VITO.GREENWEIG
1,666,281,127 *AF58E14EEBE8452DCCF7334B8C009341BF202D4A mikelgoubeaux
1,666,281,128 *AF571018794360BE2726B8F619B300DCC1668241 mikemagraw
1,666,281,129 *AF52479974DE3D9A0EAE1EC7BEA6898442E1A1D8 vlakotvorba
1,666,281,130 *AF54F7F231805B01C10A75BE24B50874FDB9C84B VLIEGONGELUKKEN.
1,666,281,131 *AF5452011EF453ED12C84EEAB45AD51854B6EA57 VOCHOVA
1,666,281,132 *AF55044C465DBCA34C9FED29BC1EF4864AB0717F MILFORD.HOFFMASTER
1,666,281,133 *AF589B2A24A3188B12C15B24F4B97F1C3F8FAC15 milo74
1,666,281,134 *AF567034D3BDF9DA46E7537317A84E5A9D648918 [email protected]
1,666,281,135 *AF58A4CA4EBE417E3C9AD0619D2132AFD84F587E OPERAGOE1
1,666,281,136 *AF56A06D03F2B849C60024048F663AC3803864A7 MINHGUTJAHR
1,666,281,137 *AF5A4467F722F27F80D0B31DCA4F860184EB4719 v.roll,drum,rumble,rattle,clatter,patter,clack;
1,666,281,138 *AF57D04D6787870BD5173B836CA67BF81C77DE70 VS150OFEUGENEONEGIN
1,666,281,139 *AF57DF3B7C715D234183C9D3184E576F8ED1EC87 MITCHELGALLEN
1,666,281,140 *AF5FDFD7FF5FD39FB07928AC8813E9C4EBFE864E W4FBYT
1,666,281,141 *AF50BE12CD99CA7DCC189603EEB6152EC6369D1A W4RPROOF
1,666,281,142 *AF5495B5779914B0D5E1E123D8309C10562C5E1D ORGSCANADIANSIRCHERI
1,666,281,143 *AF5C7D3ECBE0EE669522F90D21856E7A44BC1A55 WALTZ IN AFLAT MAJOR, OP 42 "TWOFOURWALTZ"
1,666,281,144 *AF560F5144B1FBFF86003F05D666CD8419DAB82A [email protected]
1,666,281,145 *AF5EB438BA79DD92ED70D1C300879AE633305BB9 [email protected]
1,666,281,146 *AF56C7EA4440F04C111D573F4B4D3F9C11FF5BBD MOITIÉDROITE
1,666,281,147 *AF55CD03168DDC10D966A39B3DF1A373F111C176 MOLLY ATHERTON
1,666,281,148 *AF51A864D52761835546122483DEE9E4A30BDF34 MONOLAURATE
1,666,281,149 *AF519ABD47075C76F1404D88EEC8B610601BA0F2 MONTEMALACARA
1,666,281,150 *AF5BE222492E82F5ADC5DD1161B8BE727C07B62C wapwallopen8
1,666,281,151 *AF5B894606F891B19DAE9A2CA47B10880A34A939 moonsherises
1,666,281,152 *AF590C4F7FE1F5D51B20850CB5E883638FDB5D28 WATERLOVERS
1,666,281,153 *AF5B421ABC26E757780D0CF010E78D8CA6B5A0EB OUTOFACLEARSKY
1,666,281,154 *AF5B15A4EE03F812FFA57787C1222C6DE5908B66 [email protected]
1,666,281,155 *AF5D29506955D4934CE013FB924FD2CB373067AB [email protected]
1,666,281,156 *AF52C3997F48149D50E37A452B5849C81363D3C2 [email protected]`~.`~.>-<
1,666,281,157 *AF580BB0E87CBADC6AC8C74D8CEBE9DDB6082901 [email protected]~0~o)8(
1,666,281,158 *AF59440CE30026324878DCCB9AEB67BADF724B37 [email protected]
1,666,281,159 *AF568D59017E72F8A33505F76AC90248BDAC1A70 MURRAYCERTOSIMO
1,666,281,160 *AF585EE542F64387374F3295A1051145B71D0351 PAINTING-AN-ICEBERG
1,666,281,161 *AF51EB7D178A453007D8DDE8786A783104D44568 MYCOOKIES2008
1,666,281,162 *AF59A5FCF3572041281939DAAA96194CF3D4D9F6 WERFTDEPARTEMENTS
1,666,281,163 *AF5AE745D9A42C4AC9135C58E8B060B8BEFDC4D5 WESKALFAS
1,666,281,164 *AF543F7749D8E0994D27A0D4E62A17F66014D3E2 parasol,.sunshade;.veil.(shade).424;.shield.&c..(defense).717.
1,666,281,165 *AF5813F56852C6CA20E1B3A3008938E69667A0F7 MYOUNG-BAKS
1,666,281,166 *AF5983CC7B79DBED235304970E10B50F069ABA23 parisfrancevacation
1,666,281,167 *AF5798F63A1ECE7F1AE1E550DA0197D3BD0649BB WFY>
1,666,281,168 *AF51E6C088098855FDB8DFFDCCCFC281DEB6D809 PARTHĪ
1,666,281,169 *AF5B84C8FCA11DF8297189F82098630CFD0936CD N[$`
1,666,281,170 *AF50743621C5E7E7B6470E25C0ACB89312DFF369 pasqualecosano
1,666,281,171 *AF5B82859CC3E4B38DFBADE9C0D6D3A184E5A2EA N}5\
1,666,281,172 *AF5FA9B87779B79103DC63E3C1445DBD7E0510A6 PASTRAL.WALTZ
1,666,281,173 *AF5FA88B40ECEDEE42CE870DD19E2FD52FDF519C NADA.A.MI.ALREDEDOR
1,666,281,174 *AF53F2470A3A46BF3A6B24A6B0848DDC7FCD4B0A [email protected]
1,666,281,175 *AF5A863388D7BE1AD8145E3B705EA22FE64FCFBE WHYDON'TYOUCOMEHOMEBLUES
1,666,281,176 *AF59339D2407F3AED0ADE2AD3B5132CAA5015CBE [email protected]
1,666,281,177 *AF52A3D4AD0F2CCE8421C6C6B6F027EA67E663C1 WILBERT.MOCHER
1,666,281,178 *AF5F6B9438338EE5C72AA66D83E894E9B73FA4B5 p==B~~(O_-)
1,666,281,179 *AF57182FB39803A9C93667D1B8037EBB9987E088 NATASHA BENHAM
1,666,281,180 *AF5A5DD7A8922F16E071EBF8B0B80BC35EAB5D32 p####d.~0.~o.(00)
1,666,281,181 *AF52637C5B38F4A1DB9EFDFE69289A31A0B00B67 NATHANIELTAKARA
1,666,281,182 *AF51A54706D11B0CE2DFE43958CE1DF2CDA6CC8F NATIPADAS
1,666,281,183 *AF5DA9ADBBA20DE7EA2AD0B106AC6D6638628A2C [email protected]
1,666,281,184 *AF50912A037C558B7C078166738A6B88455288D3 WILLIAMSBYRLEY
1,666,281,185 *AF50A76F3F7DC56F919A666BE1043F0524CC5D4F NB*X
1,666,281,186 *AF566765373B47ACEBEFBCEDE3F6B59DB571011C willnealon
1,666,281,187 *AF54A0A4904AAB060DF56E0012CFCCAD22E8ABFA ndl*
1,666,281,188 *AF5EBB2FA84BEF00011D223602C268D17E2BC669 NEAS DE OCEAN
1,666,281,189 *AF521854FA04CAACF91E089B3E743418BD3BCEA5 WILSONDALPE
1,666,281,190 *AF58C6EE911FC0FDD311E6773B97C1FAA3C9F7EA [email protected]
1,666,281,191 *AF52360BB520DF3870157CDAA1FF3B3BF0890185 NED.RAGGS
1,666,281,192 *AF59F16F371A398830E0C635BA8A4A1BDC8E1D84 NEDSPAINHOWER
1,666,281,193 *AF5D557BAF4F841AC0DD7FC7271425CCA136F15B NELSONPECHAL
1,666,281,194 *AF509B01C70F0ACEA8D2F7FDD58A238947049391 NEMYRTNE7
1,666,281,195 *AF5407DA6F8B86E4F9B4404DB7BA67A81BF72A86 Neptune-Records
1,666,281,196 *AF555C92F45D47F5801E18BD21CDE696286BA4DF WILWOHLED
1,666,281,197 *AF5E20408AE9BA2B8D524400E27789B72E1B0694 PES7ALOZZIANISM
1,666,281,198 *AF5BEF0C864BE9C2278E4FF847976D049BBF5772 PESTRACK
1,666,281,199 *AF5A1CEB1F09C250567CF5294DC2A9C052625934 newstape
1,666,281,200 *AF562A0319BB4151FA41727FCF4BC768AF65B028 NICHMEINTACH
1,666,281,201 *AF57DE12098D6D986F8461A103805C7F7B4D1A5D NISHHAADATVAM
1,666,281,202 *AF5FFA4F65232AA86C4807BC3C63125D5C1C28D5 PINJAURENSIS
1,666,281,203 *AF5CF452A3A87683CF721390FB6468ECFCBB25E2 noelmagallon
1,666,281,204 *AF52E8973384390171C76174A9BFFABD0BB682A3 WWW.FLL.VT.EDURUSSIA
1,666,281,205 *AF5D638D30E0EF3C1307B45062C0FE9CB9BA4937 WWWHANDBELLCOUK
1,666,281,206 *AF57DC79FD2FAFF2497A32601AB75C4EBA687E8A WWW.ILOVEJEFFHARDY.COM
1,666,281,207 *AF5E2193BE6990ACDD477F9D5628834F77D66ECD wx3
1,666,281,208 *AF5307125D3B264C9FEF962AC85EE2AB3492F4ED NORDIANAISHAK
1,666,281,209 *AF5448007833BE823F7D3833D863D71FF82BF50A )X(.~`<8
1,666,281,210 *AF535DF0904771250B32F54C35C40BD83A88424B NORRIS.YOUNT
1,666,281,211 *AF545F9483F371563E6661F6BDB3A1DC890A427F :P O~ O~D###P
1,666,281,212 *AF52A10675E7E274A4820F973690AE7AA535E28C notcube
1,666,281,213 *AF5AE2FF8E78754A3748C77BE5CFADF12C179890 PORT1!3$T
1,666,281,214 *AF5125EB3D45AB36B61B6D47C405A6D341D481E4 PotpourriNr339
1,666,281,215 *AF5C468F0CA3E01ECF73F56E96D536D24A51D3FA @[email protected]
1,666,281,216 *AF5F4968D35A11FEAE724A2248A997A52FDCF8D0 XFILESTRIXIED
1,666,281,217 *AF5841A3890E1354452D35247A244880697EB2C3 [email protected]
1,666,281,218 *AF524254DEE80BEF635E99D0241A204FDC4ED363 p######p`~(o_-)
1,666,281,219 *AF5C720B9AC50AC21D94F1845A2273544222F83E NUS BEAT
1,666,281,220 *AF50783D240E64BE27183EB8B8E23211385ED118 OANA-B
1,666,281,221 *AF5912D1819DB4C9BD8B7AC124E6DAF94897E93F XY%R
1,666,281,222 *AF50F8A8BAD1F979E29D940FC0F322484762360F YAIRALVARADO
1,666,281,223 *AF5283F2B9814AEAE9C1D5879CD7B7A4C8F5EE1B ODREĐENIJU
1,666,281,224 *AF55238F83A36C60E5C4FB6872C2B656BF71A842 offersi
1,666,281,225 *AF50C31AA700A8B9D32EECE1F93F59B269D11EC5 [email protected]
1,666,281,226 *AF5C0E5EF14722C60C64AE11E1FB10AD7AE7D374 YFFATASSYLA
1,666,281,227 *AF53D045F3BAF9414BCADC190F8EA0D296471857 PS3UDO L3
1,666,281,228 *AF5B518A9AEF82A5E519E9FAABB3E46FB1CB8C1A [email protected]
1,666,281,229 *AF5C3FF2F54AA43C4259CDFEB15554B0213B46DF ON THE RECORD
1,666,281,230 *AF5025E6EAA6AD0AD96155E383365D0225031D03 purveies3
1,666,281,231 *AF5E1A84DF0347ABDF3EFC0E2DFBD4337AD42106 PZ{H
1,666,281,232 *AF5F3A081964CE3795EA3C0385338D04C90F6C1A q======D-~0splat
1,666,281,233 *AF5EC76982E03041B3DC09158365EE7FE9B0EA79 qkm-llnsozg
1,666,281,234 *AF5A08EBE5DE0E6C94518C365DE401963DE8F186 q*li
1,666,281,235 *AF502017EBAED731CFAD1736BF2CBEBE3EADD808 ORISPAA
1,666,281,236 *AF5954F8CE105ED8ED4BB4F991F649F54E11FD6A oswaldostichter
1,666,281,237 *AF525582612244F48965F7F7299A20D24869F118 yumaikoed
1,666,281,238 *AF52AE256E28643C089A3451BAC97DFD35167FA5 rachaelsugden
1,666,281,239 *AF501FEC48C0086514330610531824703E1B481D OV3RTAXAT
1,666,281,240 *AF55B2724DB2473B971C3D69AF58B4373E083918 Z150879
1,666,281,241 *AF56FA90AC478849DDE4E0E807C5FD4D6F17767A [email protected]
1,666,281,242 *AF5F8C223B8B6CAF5C6283DEEE1D0C52039F315C RAFIYEH
1,666,281,243 *AF58ED32928BDCA57951977A2BB4B51BEB3162A4 ZABIERU
1,666,281,244 *AF56B79ED15AFA3A0574ADAE749EE4210FEA3D99 zackaryhanly
1,666,281,245 *AF50E4ACD97EB6E4BC44FFD3B82B26A7126385D5 RAJI-DEVARAJAN
1,666,281,246 *AF5C5C49B4AF8BD8766127B34F24404568064D02 ZACKVASTINE
1,666,281,247 *AF5E743E739FEF1B551BA649B41A147B47CD5F8F ramialahmad
1,666,281,248 *AF50E3B7AAE551204305421975A88732C8A6E692 raoul1660
1,666,281,249 *AF5C31366C81437F5312EE7ED3B6EEB19A369CB0 RASHISINGLA
1,666,281,250 *AF5ADB31959F95EB91E7877FCD33FF1894104F49 ZEIRRET5
1,666,281,251 *AF5075D64953FE11DFEC475EB27B4940CDC8469D paddelsts
1,666,281,252 *AF5D981737705FAF62F41504D2941718F1C680C5 r.dig.o.springa
1,666,281,253 *AF5D7BAA8C301BA618A5FB1B63F5D1745EC4A417 PAMPAMSL
1,666,281,254 *AF5E221BB56FB54322500998F8FD591E2D0666B5 [email protected]
1,666,281,255 *AF54EB9D53017D8EBB307F30E5C49DEF774FE30B REBELLIONSORGWWW
1,666,281,256 *AF52A482A87B8C34F2AEF0C7CEA432CC4803F9FF REBERBELADEN
1,666,281,257 *AF5ED981582563B96902DD2952CE0D09457CAE4C ZHENNI.CHEN
1,666,281,258 *AF54529DB943484673DB509E3A7A4041DDE693D2 ZHONGGUOLIZARD3
1,666,281,259 *AF555AB9392A8CDA979F4EAD1E83BF7D880C5084 REDEPLACEMENT6
1,666,281,260 *AF55DA87524FA685B06A961CF250F877E317CAC2 PARLEANN
1,666,281,261 *AF55F8CF3C08E259A5907D88D875E2682B450A81 reecudni8
1,666,281,262 *AF5F7A63441095E659D2B484DD1640F5EEFBB0BB REGGIE.SAHLBERG
1,666,281,263 *AF5117EDD4910253FD0D4EE6F7DF43F7B574CE94 reginaldknell
1,666,281,264 *AF5825EF4560E9412CB4CA30A84A7ED3DB562D34 reinaldohelle
1,666,281,265 *AF54A28A6D2B7DBA1ACCF66B941FA84F46B69804 RENALDOHAMPSON
1,666,281,266 *AF57E2B6BCB92D799C061FFC1EF3B72409F1F8F6 ren.blev.till.h
1,666,281,267 *AF52850DAE0C4C5812F56382E1EE729E900D13B3 RERE-GAMAL
1,666,281,268 *AF5C850ECC03459FD7BC7D8EC4AE2519D4328E6B RESPECTCS
1,666,281,269 *AF505212C06888D2C1A45B7CF931CF4F3FEEAE3C REUBENMANDA
1,666,281,270 *AF598E53A1DEA3087A016A5EE31A5CE345526568 P===B`~`~;)
1,666,281,271 *AF54A21506F517103A89035AFC65D72E40341F37 REVOCADA9
1,666,281,272 *AF5E68E8354345DEBD778661EBDC731C8B59684A ZXCVBVICTORY8
1,666,281,273 *AF5838C0015FB53D2F6D57EE8E1506180619B4A3 PEDRO.ALDERFER
1,666,281,274 *AF5F92BC0BC625E5A881FE63A075B2C0C236733C PEDROPLEASE
1,666,281,275 *AF5A88C8AF3F481ADF182FE0BF7D8715C090B29A RICKIEROMM
1,666,281,276 *AF5747B6CDD5DF5008C5D214D9E5E0E934724A60 rickystilley
1,666,281,277 *AF5CCEDFAD0480735DFB827F24A11C9B220125EA ricoehret
1,666,281,278 *AF55C3F27DC99122FD9D9BB43BF4D36D36F12B41 бодздзоле
1,666,281,279 *AF5AD0F2524961AF889F29571BAD7FF4E6FFFD1F RJOSPEIO
1,666,281,280 *AF52D45D618966B3A0DD73D92788D4C42CD597D2 декларати
1,666,281,281 *AF51AAA6A52CF26CEF817C706BC07FCE51D9DFC0 PIGFESTS
1,666,281,282 *AF54F1E4F5569868274715C9D56EE96B18E2A2C1 PILLORED1234
1,666,281,283 *AF566B3DE32CD181C0D7A4F5899B9C55D6314143 ROBITIES9
1,666,281,284 *AF53BFE02C18B229B2CAE204CC5084A818ED4346 robtrone
1,666,281,285 *AF57EE7B9FD3124E0624D4DE287B72CE32C36E7D ROCCO.BALDACCHINO
1,666,281,286 *AF5685369724DA15EAAED08E373BBF7EDE51DAA2 ROCCO.SCHULTZE
1,666,281,287 *AF5BA50EF545F65AF0528993F8426E67EC48E5CF НЕРОЗПИС
1,666,281,288 *AF5FB53C3283FF4DCDEF7A7F003ACF22FD411EF4 ноўбл
1,666,281,289 *AF575D8C08C6DD4A17CC34410B802AA20BF9F44F RODERICKMASS
1,666,281,290 *AF51AD992ADF28053A00ACBAF8BA529904A2C9D6 P{{LAELLEEN"
1,666,281,291 *AF5407FE7BB158C3E88B94BD4ECE3F7BA96108FF plhttomenoy
1,666,281,292 *AF5D22BCA0527A6E9EDBB01A3B011B1319C25BF8 PLUS-DE-PLACE-POUR-LES-R
1,666,281,293 *AF5277A7F83D06982CBB19E196D3E987A3C40896 p(]n
1,666,281,294 *AF5298BC66EDDCB6600C18909828173C6CB6C976 rolandtobias
1,666,281,295 *AF5FCCCA8CF1267554968C5DB639D4FF04908A66 podcasts8
1,666,281,296 *AF55771904B20AF22E103999F0D40C6C07ED3E87 ROMEPOORS
1,666,281,297 *AF5910F910847D56995EEFB6DB7A24C0339CC36E PORTERSCARLETT
1,666,281,298 *AF551573C211B61AA7CD757EF54C377762DBC585 rt-des-auf-(Instrumental)
1,666,281,299 *AF51C39482B76CC2DFBED1A34BF8C12301A1781A r (the crying of the women in the slaughter) (air)
1,666,281,300 *AF580C8C29207CB5882E1701B76A45243E3D36B0 RUDY.SATHER
1,666,281,301 *AF5BD39E6A0E2D3F3A5B9491AA60A2621BFB5DAE [email protected]
1,666,281,302 *AF50CF1A788CBCF7E950D741F08F141F780D0F4D PRECISANDO!
1,666,281,303 *AF5FC953C782F733F905C070D9E0337A446B0749 RYANXXXED
1,666,281,304 *AF5414C9A74B59331283825857BA96ABEE076CDB RYCYNUSIE
1,666,281,305 *AF5E20BFBF88C073A03F9E561DD95F827FE8306A RYKNINGERS8
1,666,281,306 *AF5C0B26FDE4740A3998E019A1E8F3C4A6206019 SA
1,666,281,307 *AF56F810244849B7C47A7ACBAAC07CD3BBB5252A [email protected]
1,666,281,308 *AF5F3F0C0D65AC071CD254F1CAA12BA2C7A43DE7 samme
1,666,281,309 *AF5D81A16465B1DA99BF30BB47B23AC74638FC6F SANDAUCE7
1,666,281,310 *AF5BB15986ABF2C3DEE2A6A1D22F32E840821F8B PRZYSTOPOWAĆ
1,666,281,311 *AF5EF8580ADB8CEC85B324E467FD66C6894EC8CB psycho.butterfly.-nightmare.mix-
1,666,281,312 *AF59B127982EE6EA1FF7D840A416B69E77EC3BC8 SANTOS.LEVENSON
1,666,281,313 *AF51CC373A80B1140C915E4D84D570155BB3730D SASICASI
1,666,281,314 *AF5CBE561A1DF73790ED61A096B76482477D98BD [email protected]
1,666,281,315 *AF5EEC495F6E813BE31741F9C05E1169E009ADE8 PYYDETTESS
1,666,281,316 *AF5EE6566B7E029D1102410CF9AD0F31FEA362C3 [email protected]
1,666,281,317 *AF5775180C5C48C21B2D94C4050A672F5DDB2B66 SCOELIEN
1,666,281,318 *AF56B38F543DF3C03B866C78D7BC5878A4B7EA93 Q===P-`SPLAT!!
1,666,281,319 *AF5E65907D221675E5F7E5569D84D813D68F3AFA QUASI-REMARKABLE
1,666,281,320 *AF57213DD7E7E77313831814835128DB55A940A5 R3C4T3I
1,666,281,321 *AF5B9E35C6F3FF335CAFAFF7870B106C25E35195 RABENTA8
1,666,281,322 *AF5A1B3093366B6A1D5AE7FEC5C1B9A0DD5D41A1 RANDELL.EDUARDO
1,666,281,323 *AF50DFC5E2DE8965A95FD36F9A315433E80C20E7 RANDOLPH.FILGO
1,666,281,324 *AF58862EE6E5CEA53581AE045AA70DCCAC44FCF9 SENANDASJAGENSTUNDMEDDEJ
1,666,281,325 *AF5E28497E0C6C2CB99467263FDD6B2237D7C033 RANIAADEEB
1,666,281,326 *AF511B5A8C5F084E66B88F859EDFAA40EC0CF5BB :-sequence-#7
1,666,281,327 *AF523D67363A76443969CD76E577A9E6DA0D7C47 [email protected]
1,666,281,328 *AF52F2A592D83CB2C3466ED85FF4FE6A9224A54E redbrick
1,666,281,329 *AF593826BCC31826EF62E52356DC18CA2D171803 REGIG1
1,666,281,330 *AF5E5D818AD69D5360072BE23C94EA311EDB3186 REMUIEZSED
1,666,281,331 *AF5E4DEE53E96F8FE00584F0109E2C618CFB8E5B SHANEANDRADE
1,666,281,332 *AF51B6A1B35E9A7C89B6386E31F588423E99DBC3 RETOURBILJETTEN9
1,666,281,333 *AF58AE09D29F7FEB621C36920C8BD83E23AF8700 REYBUDESA
1,666,281,334 *AF55D801D1E8B491C79654C8F91A65DAED1AD264 REYDELIZA VILLANUEVA
1,666,281,335 *AF5A6E193A2AAF871346AEDC1D0461935BAB6530 REYESDIRIENZO
1,666,281,336 *AF560EC9124FE95E09D04943D26AE60C42E36539 rickamarante
1,666,281,337 *AF5F2612D19AD0C645400AB36601C6B554F5AFB1 RICK.COLLEY
1,666,281,338 *AF53A909E9A04677D50F9B8B769C516ADB18A101 rickyasher
1,666,281,339 *AF50221CB31C55DE83A0BF711544B52D6B8AF0AB RIOT LEAGUE
1,666,281,340 *AF59614ACD5E883492A0DA154F30E5703668DF54 sidman.
1,666,281,341 *AF561CF46A203F65B1628A9827970407CC6821C5 simonbradfield
1,666,281,342 *AF5387AD0F099CE3A682D629A3AEE3F91D37BCD7 robotsoldier(resurrectionrescue)
1,666,281,343 *AF570EFC87CC5F7CFBB243ADDD29B8305F8BB45C RODRICKTWITCHELL
1,666,281,344 *AF580B5C45A119CB2DFBE9D5C5DE09946EDCE02F skimtb
1,666,281,345 *AF57831D4791CACDDEAA0AF66ED8E245A7E3D17B rolandoanon
1,666,281,346 *AF5B3AA5A1624EF5D36131D4D179359EC7041F2D ROLANDO.HARDEY
1,666,281,347 *AF519AB7A3E2DA644D6318C9E7A934CE71ECDCBA 0246jordan23
1,666,281,348 *AF5C3FCFF09B61D8C0456FFBDE8C3B84F4FA0B85 043JAX
1,666,281,349 *AF5DA9B2D7586DE70DEB1D79F074C0114701E78F rosscofran
1,666,281,350 *AF5462155C18FAFA89B9184E9F9DC4E1380CF8A5 ROTPMEER0
1,666,281,351 *AF5D48D7E557282A2E33575115AFAC299F0C04B5 [email protected]
1,666,281,352 *AF565553595BBC691A52533D3FA57BB1C749CA9B RRUTTUNG5
1,666,281,353 *AF5F6DF65E5258FB36E4F220C1720E2E148C8021 RSHKA9WN0CSC
1,666,281,354 *AF57CBD108788CAA2CD8BFF3592B2E6089CA7BE1 [email protected]
1,666,281,355 *AF5AAFD12327DB24DFB58F7D2642BF53D83F40C9 rudolffiglioli
1,666,281,356 *AF5BB6AD9327F0FF16FC4B9DB392D9AA432C5587 (_0)~`(==8
1,666,281,357 *AF5A9EDF795C4801C2DE4A7B18CEF346E2509038 rufuspackers
1,666,281,358 *AF556C2E284FA9073DF34641DF263450C68B3CC4 RUPERT.HIGNIGHT
1,666,281,359 *AF54AD760C5094F82A611866B57241E63DB855D4 09311156
1,666,281,360 *AF5EC89DDBCAD705A72D588D8D11087522363701 [email protected]
1,666,281,361 *AF5040EC78B58B6E72DE182C907849752AE303C8 SA
1,666,281,362 *AF5B75721AEC596E7B7DA9D15C050C8A30F5E570 1084287 kaikki.tutkimukset.ovat.nopeita.ja.kivuttomia..
1,666,281,363 *AF5755CA9DA7FE79CEE87629FEEB36D75B9C3ABE 10.DOGURABILECEGI
1,666,281,364 *AF508C0DBE74D2C532DD64D5EC5D4FB0344880B2 SAL.GROCHOW
1,666,281,365 *AF501FBE7501CB1094EB548589A805E772AF70A7 sonnybeneke
1,666,281,366 *AF5AE04EA018A4F24AD9B85A6C21A1CFCF9CCDF0 SALVATORE.BRODEN
1,666,281,367 *AF5AFA1F88E6D601E0C9AECD7E8A3D3018AC63B2 SALVEKRUKKE6
1,666,281,368 *AF5D05E296CBA5C981084388ECAC3B21EF515B67 [email protected]
1,666,281,369 *AF570DFB142E876C6E3BF71C24BDADB1A11011BE SAM.IOPA
1,666,281,370 *AF55D73C29233DAD7A2015A7BB4620671F2F7A6D SOYLUHS
1,666,281,371 *AF54EB10E6A8D81437D14353271EC7A62143E65B SAMMENSTILLET7
1,666,281,372 *AF5F4B5C582A7B3D865BD61852733C0BC19E4C0C SAMOHTERAWTEN
1,666,281,373 *AF56713DF2134898B97E4CBBF5076585D925DFA8 sam-witwicky
1,666,281,374 *AF568B7AFF3066CD42186EB0D8D5BB29248C380A SANG.GILLIAN
1,666,281,375 *AF5A742A3FEA70970D7305C856F2528E30312A2E SANGRIA
1,666,281,376 *AF5E269616BFB4B9E5E2D2494D8BCE8ECF943C94 13september1268
1,666,281,377 *AF5FE580DD11715F0ED4CD4233C1CDE4DF02F0B2 SPEW FORTH BLASPHEMY
1,666,281,378 *AF5FAE9302D157AF948E00D4395009679B32CC70 15CRYOGENIC
1,666,281,379 *AF5096812F511F1D45B79AE87CC200C63BCDCA7F SAUERKRAUTING2
1,666,281,380 *AF523852F658AF4FD277023B895A129BEFF70914 splat!!-o~<--b
1,666,281,381 *AF542284EA0EC493649F5C76211D6E3EE6CCCC6D 18-04-1041
1,666,281,382 *AF5C30827E9925177C5C3F88E7FA3CD33C49AD30 18-10-1584
1,666,281,383 *AF5A0C9D4A412BAD003BCD0FF03B12486D45264C 1989147 EEROKIVINIEMI(1993):IITALINTAMARIA.
1,666,281,384 *AF5947F9F02D44B07F43307D304CF976379AF532 1993DMB
1,666,281,385 *AF5074A6FCFDB909F86E570B11B1F21B07AD3971 sregarvr
1,666,281,386 *AF5C3F138796BEF44FE6576CC707052BB64C288D 1BARSCHELWORTE
1,666,281,387 *AF5748B42E6A9CBEF568031C6C06345674E78727 SSENILLAED
1,666,281,388 *AF50B2CE86C04ED4F080098021F3BC0C157746C0 SSRTNHCN
1,666,281,389 *AF5F2165A52734628E6DA5CED70620F709B5D6C9 stargatehappy1
1,666,281,390 *AF5E2E4EB2F49D24B7EF65F7DC04FE78F965CD41 1fahrzeugingenieur
1,666,281,391 *AF577AD94B1761EF0150B45CCDDB5835D2B187BB SENTERIEZ
1,666,281,392 *AF56A95DD8F56D2E311683D3AA21E1A51591751D STERNBERGH0
1,666,281,393 *AF57F972018F91A6653F0BA511E16ADFF768D64C SERVICIO»
1,666,281,394 *AF53C865200D07E63C9A8760C1F290ADA9D1F880 1-hommage-welle
1,666,281,395 *AF5E8B14B5C5B0C044749557D0DAEA1CE1302EC7 setheinwalter
1,666,281,396 *AF5523F93173A004E9D4D8C08D64FA0496CE437F STEVEOHM
1,666,281,397 *AF5D09214D8C0AFE915D776BBF7E3D86E963FB1E SF.TAN
1,666,281,398 *AF5203E2DDD05702D94755E2A402E1D597AB66EA [email protected]
1,666,281,399 *AF5D1B61648F8EEAF8D57401EEB59F597B58B99F STOUDMIRE7
1,666,281,400 *AF5D06EC6C4A2D024D01BB5AF7944998A7ED3D17 SHANNONFARTHING
1,666,281,401 *AF59E13E54704B6E31CD753430E1DACDAB4FB431 stsidnub
1,666,281,402 *AF52EB2200071AEE396F5FA2EA0B8D50B372D22F 1 MORAALIDOGMIEN
1,666,281,403 *AF5EA55D3C4D311DB1901ABF5FFE9BF6997EF5D1 SHERWOOD.ZARING
1,666,281,404 *AF5BD0CFFFDD9873157CCFD029BD8644F1A34139 sheryl-omeara
1,666,281,405 *AF574A812BA1EB924E8E3740F15DEF2956C3D857 SHESHHAIH9
1,666,281,406 *AF5A717CE56665C7526206F0923977736D5C19B1 1NICHTEIN
1,666,281,407 *AF5A064EF0487B3613F75FE8A82B0191E93F3F7D SHIRLEYBEAVER3
1,666,281,408 *AF54BDB2DCEAF8C63C60657B15AFEBAED8A853F7 1 NOW-GAUDY
1,666,281,409 *AF5439590F8FBDF3F301B910E1C6958651F23253 1.opiskelijakollegojen
1,666,281,410 *AF5A24E9D753DA75F5443482DE1675596B8833DD 1-OVATSUUNNITTELUARVIOINTIEN
1,666,281,411 *AF5355EEE25C64D3627F8C7ECF894595CE6ABDE2 sufflates
1,666,281,412 *AF566577B5D762692265492EA860F29509C4A1DD 1 PALKKATY
1,666,281,413 *AF54522CCCF37CCD737B7AA584471977B2496175 sukekleininstrumental
1,666,281,414 *AF50E23D7F377E147B59376B0FAF9E70FB23C5CB sichhcis2
1,666,281,415 *AF53EC72E8A1F27456CE9B45E6BA42076C4E1620 sinawe.mandelas
1,666,281,416 *AF5A5E70A41E413572B1DE9960CDAE402BBC44EA SINUSPAULIANU7
1,666,281,417 *AF598D35CCE76A263C92FDA2005C61534587BA8E SIZEPRETTIED
1,666,281,418 *AF53781763B41D69C43DF1DD3AA67DEA2650BDB2 1.polonezkoye
1,666,281,419 *AF5CB603F4FF6F212804A4D2497D0E380E04DF3C SYDNEYEISIMINGER
1,666,281,420 *AF5A3E1B40BE267028DB8B9C6DA690AC3CB52B20 1.RUOKATUNNILLAKIN
1,666,281,421 *AF5F738C9FEADF43BEAC6C5FE45EE7BF2E387CDE 1-sechs-mann-betriebe
1,666,281,422 *AF5F7A6AFAC74CFCCA6D2D4751A6490DA9E88AC5 1.SEKOITINYKSIKK
1,666,281,423 *AF5E0B0943925466FE798D24FDFC777F33BD2157 1.seurantamahdollisuuksia
1,666,281,424 *AF5734E44C40D7B446F75DE6D1264E707F079E05 1-shafland
1,666,281,425 *AF5D514A260AAE921C695316AB68A524EC75C5B7 1SSF1234
1,666,281,426 *AF524FE9977E888E4D66873A045DB9AE2A930AAD slewejnoocar
1,666,281,427 *AF5D68D2B5F64F888E6AB0EC8BBFE9A731F64D9E TAKEMEHOME(FEAT.JOHNNYCASH)
1,666,281,428 *AF520773FB48957CD27D078D3DC264DF54125596 smaclin6
1,666,281,429 *AF5C045D1B02475A9794D5D2DEE2071F14E1A21D talibov
1,666,281,430 *AF54AF95F008C79559BE6783CD4F8554B76B7408 Snow-Gull
1,666,281,431 *AF5AD79B6A31FF44BA543FC03D12559592BB1B3D 1 YKSIL
1,666,281,432 *AF585D9635B3C36044703A354698E866CEA70CD6 SNRMPSRPRCPTTNPRBLMPRLT
1,666,281,433 *AF50CCABF5A754997D3BBB466CB48D98A9EC3AC2 SNUBBISHLY
1,666,281,434 *AF5121D9FFF6D51BADABAFB6AA8CF9DA5D9D6E40 somalipiratescaptureshipwith
1,666,281,435 *AF57A6355072EB1FADC0E61E4EA71727AF9C70CF TARATUTABSW5
1,666,281,436 *AF59F02647337E7B22678E7FDF629B1D237529F7 2124534 KOKOLUOKATMUSTAVALKOISETJAPAPERIV
1,666,281,437 *AF5416D644AC3A3B3900C08411D0BC813111F783 22maggi
1,666,281,438 *AF581B0DAE244440C74FB9DE4C08577AA45CAC96 SPARTINI9
1,666,281,439 *AF5B747A9223D42D871DE2EB2E287E727E55B341 TEODOROCALDORON
1,666,281,440 *AF583F50439BEB75DF4CF1104F7B414C88E94DCE TEQUILALOONEYS
1,666,281,441 *AF57D0A138181A9B4EBCCD4ED0DCA8766104092A SPENCER.UEKI
1,666,281,442 *AF5548AEA3C144F240762652297139FE81AD9C4E 2607357 PASI-NURMINEN-JA-HASEKKI-.
1,666,281,443 *AF5B39738A0E82F9A150BDC6CA3960BFCF0D8CD9 SPINNINGTHEWEBORG
1,666,281,444 *AF51CA342D427966DB073147CF1ED07DD715C7E7 [email protected]#8
1,666,281,445 *AF586F04347E937C6EEB3163A9C858982C4D6D39 splat!o~ o~qp
1,666,281,446 *AF5F60EAE2D970838AFA45B60890361D91CA417E SPROVESTI2
1,666,281,447 *AF5056A3FFB29AE20ED233301E7C5B6F63DB99EE 2FACTORYSHIP
1,666,281,448 *AF5FC2D4E796057F0123128668F6330FE38CEC5D TheHits/TheBSides(disc1:TheHits1)
1,666,281,449 *AF51CC671901B93AB138939F720852669D14D593 2.fIrlamasIyla
1,666,281,450 *AF5B5733154037ABCB11631CC96CC02CC9C4EB07 ssengnisuac
1,666,281,451 *AF50A09F7EF68C82A0A4410FA3EE8FF507694907 SSRHPSHP
1,666,281,452 *AF564BEF5C4A439342C6FF9F9E2D36BF79C76A10 [email protected]
1,666,281,453 *AF50C7AB676334E92F4DFF48890726A658DFAB1E THEROBERTS30
1,666,281,454 *AF522DA4E7A64A18C3D5EED6602AB3054E7C3290 2.portreleriyle
1,666,281,455 *AF5A0DC9B1C584CC4CD44B482D266BE0C90F7453 2preventively
1,666,281,456 *AF595F25854E0E831B4BD8AF28BE5BC0D6012AE4 STATUTORYSTAE1CHAH0TAO2RIY0
1,666,281,457 *AF5E243A317E0BFFC396083268F3650A893C4646 THE STORY OF THE GHOST: COMPLETE STUDIO OUTTAKES (DISC 2)
1,666,281,458 *AF50F2B1FA3F7002D0A27BE1374C41C73C63B256 THOMASCOLLE
1,666,281,459 *AF5C9E29FE1E919D3A302608D25E4A84767A67B1 30APRIL1620
1,666,281,460 *AF559A583B3FADDF931C7245756249A71E87F925 THURMAN.GORIUS
1,666,281,461 *AF5E3BAB00F1384EB61C05CCFD73D9F8E14FC8F4 314763 BE FOREWARNED : WE DON'T COME CHEAP .
1,666,281,462 *AF5C1BB7C936EF99521DB1FCF31DDC5359954268 straatslijpers2
1,666,281,463 *AF5580041A25AB18C977FF26508C2C95647A910C STRAVENOU5
1,666,281,464 *AF518464FED7AEC9BABA220887CD2D741F24B6AD timmymcdoniel
1,666,281,465 *AF53519A702D6D0F162EC4FBE504C4AFA5FCC2D6 TIM.TULLOCH
1,666,281,466 *AF5E5B04B29780D9D6ED617A0DDF1B8980A413CA 3BAHNHALTESTELLEN
1,666,281,467 *AF515DF8E56350855186F289292CC14ED8509DD7 stützpunktwachen
1,666,281,468 *AF5757FFC250879CC9FAF47222886F401773CDB4 SUBMURIATES2
1,666,281,469 *AF5435FAA9755057854EF4D46DFECB1A7EC3C604 TNSAC4
1,666,281,470 *AF59A9492548F6B8A799DB8DC1A43CFD7A276EB7 [email protected]
1,666,281,471 *AF51E30CBA6762E40E1A54A34D77C3DB158C32A7 [email protected]
1,666,281,472 *AF505F705B03E4D22B2CE5A67428D7D8FC3EFC5E TOMMIE.RODAL
1,666,281,473 *AF5C9E9AC8553BABA6E092FDA4583DB58383B789 SUPERCOUNTRY
1,666,281,474 *AF58D2B02C028DC65D782BF0C9F276F306178A51 SUPERMAK8
1,666,281,475 *AF59F7199C2A16A53F05C86161769E4961CCDA1E TONEYBOSTROM
1,666,281,476 *AF575AB606E1858224CDC1A9C5E294FA2AC9D8A6 [email protected] ~o ~o (0-0)
1,666,281,477 *AF56DC64C7CB847863E2BDF8A8BC0302FB044F18 SURGRIVA-3-0
1,666,281,478 *AF5F5C008D0D52DE599BF732DEF105C2D38BD411 TORY.ALPAUGH
1,666,281,479 *AF55FCA04F36F7C15105EA2E7C5586B2B4DBD9BD SVMI
1,666,281,480 *AF528A118A4D935548B144E657719362EEB75C80 SWIMMINGJOSH3
1,666,281,481 *AF509CEA1158DF3B16A1FD71F724D9C39CA34F85 SWITCHBLADENING
1,666,281,482 *AF5E89CD989FD8610F21A8AC41AFA1B45F2EC92C 3 westare
1,666,281,483 *AF5EFCA53743967E8EEE2BDBEE852B1C7252855E TOTENSIESIE
1,666,281,484 *AF5D35A42B099F6BB353AD1D125162670CEEBDDC TRABALHADORAS
1,666,281,485 *AF59F0AA6BDDF5039DEA42EC6CE17B1B791EAA3E TRAJAN GIOVANNI
1,666,281,486 *AF5BDA0ECB6FD597A577C58C76F6F147C6442028 tabuh-tabuhan:iinocturne
1,666,281,487 *AF5E2322052A7961E9431CB7A3A214AD49044D8C TAITUELTVT
1,666,281,488 *AF52F4691D678B531CBCCBDC20F2B3A8B87074A9 TREASUREHAWK
1,666,281,489 *AF5533D250F301F0B9C671A642E6C54FF5A5E983 TREDEILGEGRETNU
1,666,281,490 *AF5E6F87EB0BAFE362E4562FB74875E6351C2AAC 4ENERGIEMODERATORINNEN
1,666,281,491 *AF51C3678B6990486E5C17840E23D3B9B39ACD4F TREVOR.GOSS
1,666,281,492 *AF561A31E073A7CEC15A79FFBD04644F9D657E01 tamrewolf
1,666,281,493 *AF583B9A6EE26EB75E5C718B5F4D25115794662B TANTMAN7
1,666,281,494 *AF542811BC3CA16A8BEA6965CDC4A5817469EA68 TRIMERNEUTRONING
1,666,281,495 *AF5AD143054FBF0E1E497757D6982C2C939B500A TRINALAMBE
1,666,281,496 *AF5A3B804DE384C18AF5E1ECF9FFA584656EA0BD tripill7
1,666,281,497 *AF5829398550552D61363014E21E3CA9B2A87FFA tseissag7
1,666,281,498 *AF5406F284852E07D3FA226686FFDBECF615B320 Tavşan.dağa.küsmüş,.dağın.haberi.olmamış.
1,666,281,499 *AF53252501C2F84D17386B31604A934525FE6C79 TSJIRKOING
1,666,281,500 *AF5F664712A411A7983D58F46E7B2186954D1F87 TBONAN
1,666,281,501 *AF503732219599234D32A0681CFAC96315C49DFB TDKRLQW32
1,666,281,502 *AF52ED3B5A384501DC5490194E1C456D1243D110 4SCRAMBLY
1,666,281,503 *AF596BB6171E8D257CDC039C626A7F750EB2969F tw"u
1,666,281,504 *AF5CAF2A1CB7A4659D738ECA897452B7BB536C90 4 webliittym
1,666,281,505 *AF5D9FEFD1F24E4B717553038156E7069C0B2740 4WOORMES
1,666,281,506 *AF5E6655B62EF5E46A38A31C810185DD5D598ACF TYPENGENEHMIGUNG
1,666,281,507 *AF5F928C973AE92E67DE2754B6A56149F0F93184 52945 NUORTEN-HARRASTEURHEILUN-LIS
1,666,281,508 *AF5EE5081C0152C7F3CB44D8F74DBB2D958CC874 TEREBICACID3
1,666,281,509 *AF546BF47595074B7F08D041C499E2191A7A63FE UEBERSAET1
1,666,281,510 *AF5925766A715E8B3DCDB98A8664B15C2DBCC720 TERUGBETAALDEN6
1,666,281,511 *AF5F715E4F4905A0CBDE835444B823CB1156C598 un1nhab1tab1e
1,666,281,512 *AF559304DF3EC8928F5E83727A8FB3C754177285 unawkwardly7
1,666,281,513 *AF54B601669F44554189F625608B5177EF3858BA UNF1BB1NG
1,666,281,514 *AF515D164129E1F489E469DDE705921DDD0D5778 UNN
1,666,281,515 *AF5AADF13119085721CE33D60A00ECB7CCE675D8 5TEMPDIMBBSW
1,666,281,516 *AF5D8C9BDF0D03902A5B2BBAE187BCD13DBC67CB 5thatenergy
1,666,281,517 *AF5FA9B77930A8929D3E5562E26B8EB7B54641F1 UPLOADS9
1,666,281,518 *AF55D79CCA02C484F6EE43F2595EDF1FA5649DDD THEDURWARD
1,666,281,519 *AF5E6D27852D80F68C2B76C0EB4BE3B8BA76E5AE THE.LIFE.&.TIMES.OF.A.MODERN.DAY.COAT-TAIL.RIDER
1,666,281,520 *AF5C3D2B9BA9F67ED85A892CFEE6E64F8EA2C93F THEME-FROM-STARSKY-AND-HUTCH
1,666,281,521 *AF53A694C84F6FBCF99336FCCD2DBEBCCC081F1F theotavis
1,666,281,522 *AF54AFEF621970D4C82A74BE2D8EFE5002A78ADD UTORBSW1
1,666,281,523 *AF50C0DC5D6F1DD95E1D084D65D880286B8AEBE6 UTVECKLINGSARBETETSING
1,666,281,524 *AF5F0F7870561799B4B2D5929208EB2E2F165FEC thevalidationcheck<p>
1,666,281,525 *AF52A6EBD1D8B49389340D3B1099118CB63C529C [email protected]
1,666,281,526 *AF5083B1BB8AFD4A8673054EEADA9F5DB701272B v05y8538084t0217xd30v1
1,666,281,527 *AF545525716D87C4530A01428013EACB3FF8820B THZ63B6
1,666,281,528 *AF5C76B815F8DA2A28F864F4F00CD49C08004CA6 [email protected]
1,666,281,529 *AF5D5035C2AFE98A642DF9CF90330965DAC76B20 tickell.35.0
1,666,281,530 *AF5728E30D8A9A454FE2ADAFD94EEF3BE8C7A312 tidak-inna
1,666,281,531 *AF59DE0081FF009B1796EB8497A5A1BB4E47808F vallorie6
1,666,281,532 *AF52EA14DFB238CE38C2484BAC7B49221FD28E5C VALZANAYED
1,666,281,533 *AF58FA3A9DDE0158E0CC370D80D87714FDAC7BEC vanessa.baliton.hamid
1,666,281,534 *AF50F9B1362D1F2FD523AA84001F2CCE822E4404 VANYACHUGH
1,666,281,535 *AF522ADBD8B461E62003518EF0A643069D877EA3 VENNEX
1,666,281,536 *AF544D99D11F11C2A7690712FD1A00145B207899 6MACULESQUE
1,666,281,537 *AF5E81AB39A2D659B4690E19E135F7195FB73F14 6MENSTRUOSITY
1,666,281,538 *AF5622263FAB6A913935BECD18AF96978C2C2602 TNEIASSAPED
1,666,281,539 *AF558EDA652B3411573153E4B9DFD2897794814A 6-PURTSCHERT
1,666,281,540 *AF5E5271EEFBC42F455DE032086ADAE4D7984861 アナログvhfは
1,666,281,541 *AF554B0D8DB8F46D0F31C54A3D2FE82804668750 TOMAVANT
1,666,281,542 *AF5759D769E057EE9A1428199C836A4923DDA6DD VICTOR.FAIRES
1,666,281,543 *AF5EB7769A8B413FED65772276A0F31A7DB1DAF5 victoria.maggio
1,666,281,544 *AF58EA42303E7D78844E6F46A9E3F2303F2AABA0 tomgolebiewski
1,666,281,545 *AF5F957DC7F751E87A767EB09C6526E6543B1679 TOM,-HOW-CAN-YOU-HAVE-THE-BLUES?
1,666,281,546 *AF5A3B41597FDC444E3299A84DAD36C2FD963D5E TOMMIETEDDER
1,666,281,547 *AF5D0C45F613038C70C2B25A0634B80C9C0DBA10 tom.pinnell
1,666,281,548 *AF595E425B71104CB8F63869F5438E8A3032C2E7 VIKAS SAHORE
1,666,281,549 *AF593D471A24EE9DBFB0D2F8A44E429493DF5E61 76374 t
1,666,281,550 *AF5A7DB2C0A8672ABDCBF1E5C782437D784C3746 7ANESTHETICALLIES
1,666,281,551 *AF5ED08CBC02A41D3868D596EA61F9086E857F7F 7BASEBALLROBERT
1,666,281,552 *AF5133A4725BD70724C1985E34A33BBB51AD1104 vincekurtzer
1,666,281,553 *AF549058684271E56B728B2726405DE2E26BE017 [email protected]
1,666,281,554 *AF537EF4C9041817D9E0D008D5F219C6871E4734 7BSWMIMOBSW
1,666,281,555 *AF599418468DE85A57FABBBCD77516562764D66E [email protected]*r
1,666,281,556 *AF5F1A0B5F2AB3F7B5A3F45D755BB2148B8880A7 TRANSVASÂT
1,666,281,557 *AF5930F98BDBD41D5D421A7BE29482F443D3EA13 7GRAYWQSB
1,666,281,558 *AF538631F99CF0C7FC631AF6815824817E97FD10 VLF0710
1,666,281,559 *AF5721E3F7765A85EC8AC116EC8751A21666B5DA VO040000100003ENG
1,666,281,560 *AF53A640208B273F38AA0F13A781839501C3ABBE VS150OFEUGENEONEGIN
1,666,281,561 *AF54BFD21227C41C1E8CF1F0D6E088B75FED09CF [email protected]
1,666,281,562 *AF5BDF1029F978489DF26B3726E899461868C8F0 TRISTAN.ASUNCION
1,666,281,563 *AF52C138F14B65ADBE0AABF88E271E0996EBD5B8 tsecheuyiu
1,666,281,564 *AF58C8D992377545F275745CB774E98FAC402781 VYYSJUOKSIJING
1,666,281,565 *AF56ABA682B04A6728BC0CE1051FD25729084DFA W4K3DIRG
1,666,281,566 *AF528A7E6E9ABB9279BFD9DA457887B2BFD7156F TŪNE
1,666,281,567 *AF54E089EADDA78DD53C74995EA4688F0E99056C wan$c0+3d
1,666,281,568 *AF5F7A54E5FD3CBE28EDBF478C3C575D453024DC [email protected]
1,666,281,569 *AF5E59F75795EA8A2F9CBCA6D7949E5377B4ED56 [email protected]
1,666,281,570 *AF59B55E7C7688F6D83E96582ACEF3F2F9E45C01 WARD.BLAZEK
1,666,281,571 *AF5195E139F78A0EF43E8AA7FE227DAC504A06C8 8ANKOMSTMELDIN
1,666,281,572 *AF51B60B4A889621C016659749CAC680CDB90FB9 [email protected]
1,666,281,573 *AF5DDB15CFA1FB09245FF3A87E8A2F324C49A40D tylerlincoln
1,666,281,574 *AF5E1D17C045D24603850D29FBB32FB55F4ACFAF warinrin
1,666,281,575 *AF5549C8000A6EDFD622416C795CACD6759F67CB 8CASCADEINSANE
1,666,281,576 *AF563A7DB7F6D65AF2090ADA650358E785F93913 WASSETTE4
1,666,281,577 *AF520EEAC3503919B989BC50B6E9376AAF6A7768 8HWNDLISTBOXBSW
1,666,281,578 *AF56E0960F4B275CC689431E6423B68A760564E9 ulyssesarcenal
1,666,281,579 *AF56ABDC6CEC777A0A6AF15B609C7FFF5184AE5B 8KONDOLR
1,666,281,580 *AF5F2D8DA0F4EB8C7FC3159DEEB71415BB5D3C4C [email protected]
1,666,281,581 *AF53C315766D0371E40292309F4251C91737528A UNDERTRYKKELE
1,666,281,582 *AF5186B02FEDC232511C6511C1350508FE68CACF 8OVATEWAT
1,666,281,583 *AF59CED05D010C96BAC01EFA0C92B67DAE72BCAF [email protected]
1,666,281,584 *AF585F72DE9BDBBF09082C65FD25E6257B5A9360 8PLATEWAYS
1,666,281,585 *AF566B869914A26D94ABE87201359AF4B44AC503 wevingwoo
1,666,281,586 *AF58C54E6669F5FB0553D386E35D842CC2E0A35D WHITNEY D FRANKLIN
1,666,281,587 *AF54539A0CA88A5C2A4D75F5ECE0D255C2AC0BEE 8TIMESHARERS
1,666,281,588 *AF5733E7A5AA77088FC330A5C24427E9AAA89731 [email protected]
1,666,281,589 *AF53CCD8AFC695F30986DEB0159D164286345769 USKRATI5
1,666,281,590 *AF5173D17B727513B358C393F11830941AB51001 910080 maC-Cok-hIzlI-baSladI-.
1,666,281,591 *AF56A898113DF2934AB108D4677BFD74EC79829C VAGGELIS AGAPITOS
1,666,281,592 *AF59A54392AEA0EE2897C89494F0EDD511718A0A 96423 auchrainermeifertkamvonderisar.
1,666,281,593 *AF58C099451B1441A21D075F55C3A50F12145302 979693 kti tai kti:n henkil
1,666,281,594 *AF5A0502B7DE2BE43FD7507EBAA1F74F7314F46D WILLIAM-TRINCADO
1,666,281,595 *AF5039DCC10384FA097556AA540DCF118BF59BC2 WilliDeutschmann:Tupperparty
1,666,281,596 *AF53D2CCDF612EF5F5768C36D39D2B4FEF1EFEF0 99RNDZ3M3N7
1,666,281,597 *AF5FCEBD2590A6CD40A5F956DF100411E99844B0 9ASSAULTBOAT
1,666,281,598 *AF5F592F0E4B65EDF1DC6CE8665A038220D3586A WILTON.MORENO
1,666,281,599 *AF5C6C2A31655DBBCC32929F8DF91E3AEA716599 WINNIEFAITH
1,666,281,600 *AF5E59B0830568717FDD0211C6F47E067C061D13 9CELLISTEEN
1,666,281,601 *AF540B1219C2936B5B6AC15DD4F749F09E6A2B34 9CHRISSYSYDNEY
1,666,281,602 *AF5AAAB65D79F73C3D2445B5AD02F3A912F3FD92 9chrysochloris
1,666,281,603 *AF5EBE2038F243FE754327488810AD94F5535CCE 9EARSH1F7
1,666,281,604 *AF59F73BFA1EEE7C1BB10E86E079A2971C47E178 woman-is-the-nigger-of-the-world
1,666,281,605 *AF55FA5708BF7A72B83342E6CF1FB98DA7285BC2 WONG.CHECH.YEAN
1,666,281,606 *AF58F209F05F0A60A572CA32757DA77B7B12DB1A WOUTERTREURNICHT
1,666,281,607 *AF5C03D9111FF95EC2F5AAD5E7F81CDE951859B9 verfeindet
1,666,281,608 *AF5B81F63739F2A54E3261AF63FD39D1772A7BDB [email protected]
1,666,281,609 *AF50E2C9657936B4DA7BCFE91A0895D0803BC305 Verticalo-visitor-mix
1,666,281,610 *AF5C02E8CC4B54EFDD6F677756C8D6E1C12B9BB0 9.miehell
1,666,281,611 *AF5190EB28D8E6BCBBA1DC2CC5CB14E75A0AA6D5 VICTORIACHELSEA1
1,666,281,612 *AF57A635BA6E7EC0F6912E40BC95D5C140D892F5 9PAUCITIED
1,666,281,613 *AF5B6A6247B608611C80F82988F45DB39363ADE5 wwwe-solutionsunlimitedcom
1,666,281,614 *AF532802BB6D57FAE36CEFA7C1505C6246CAB508 WWWLASVEGASSANDSCOM
1,666,281,615 *AF5FF81AD29263416F4A225A80438C727D680735 9RESORBIO
1,666,281,616 *AF51FBE23459E773F283928C018AD7C8224169BD WWWPRAHA1929CZPRAH
1,666,281,617 *AF5682F36454EEAB0461824E1AFC6B2D17F78FDF VIKTOR.LORINCZ
1,666,281,618 *AF508021974A24C2D0F94D5B25C83E4574120448 wwwtasselsshoescom
1,666,281,619 *AF5FA67FB5A51FFB66CF4D618EB75653235ADDD0 9SARDAGNOLO
1,666,281,620 *AF5C4AC299824F19978B40ADA69E70C0A5B3CF3D villov
1,666,281,621 *AF50A2E4432810907CAC81F73859A179E82B5DBE X,3[
1,666,281,622 *AF5C8ED3D53E6614FC9264A17BEE8AB21A7CEBAE xavier-baiza
1,666,281,623 *AF591A9B1937AA536728E640DD3D1B4836D26431 XEIDILLYSM
1,666,281,624 *AF5B3DC3B3FD494EFB4F61886AFA2061D7CF82B5 [email protected]
1,666,281,625 *AF57E8483264003CAC8674CACC8EF7C4BC16877D [email protected]
1,666,281,626 *AF5116A31E320B5F5E9174CB81572CC20CE1BF2A XIEGUHU
1,666,281,627 *AF533290CE273C88036262315D212DF3F0FFF724 virgiliodangel
1,666,281,628 *AF5F8251C3A9BA18175E65B0545D4D12F4B46EAA VIWEMNIKI
1,666,281,629 *AF5551F73A7BD1CC728D3552AE04D1DABCBB64DD VIZENTAL1
1,666,281,630 *AF58CEC68DD4A00204111122A695388D5CF95DB4 XTREAMHEART0987
1,666,281,631 *AF57D0A490DD6427D792AF6842E8DE4205056B4C vollzugsoberbehörde
1,666,281,632 *AF56D4D1C4B09729F72586CB4B1888D1C7869D62 [email protected]
1,666,281,633 *AF5F0A73CBEC5B0A7A3A22AA012E3A8B1D3E8660 VR"H
1,666,281,634 *AF5660B7915C79AD1B1945788F663F9B7A92BF6C A29KC
1,666,281,635 *AF592569236CC991E84E45115F3C75E6B44B3CFB [email protected]
1,666,281,636 *AF536901510C494AFFC711DFAF711ED469E83621 a3n=&
1,666,281,637 *AF51CC881DF556C0289C93E925E73E486F5B3BE9 YANIKADEMANUELE
1,666,281,638 *AF5FEF51A72178AA2562805E215DFF60BACAF6BA [email protected]AJIA.COM
1,666,281,639 *AF5C297ED796AB56FCA236AAF26CD2727A9C9426 walkersobeck
1,666,281,640 *AF5B40DE0138FAC0E98E8A5E2AA5A0480FA11036 YARDA9E5
1,666,281,641 *AF5D5D175A078E99C3505C880F093E5530CE33EE YDUJYEKNOM
1,666,281,642 *AF59EBB0490C0CF0B902CCA6595E4FFAE1B1CE7B YELLOWCARDINAL
1,666,281,643 *AF59EE2D4ED390F93E2DE4AAC5BDA918C92D94D2 WENDELLREGEL
1,666,281,644 *AF5919C4B3D35D80952936F73B5A92247AEFC818 WENDY.RAHMING.CARTWRIGHT
1,666,281,645 *AF534CEF04BF3D77A23E934FDEB396BE87F92520 a.Andaluza.(Alegr
1,666,281,646 *AF58C6FCA45F0021C7AD0C6D1C78D045F0E1AF7D AANSMEED7
1,666,281,647 *AF56CF163869BD049AFB9AC57807E76E79253B45 wenush.kumara
1,666,281,648 *AF53DE7CD7F6404D69D3A9CCBD7A20AE5A5AC00C aatetovereill8
1,666,281,649 *AF59D426E4EADD6BE3948CD64D3F5D74C88FC7D6 YUSFIAN.GUNAWAN
1,666,281,650 *AF54E978DC23277592EC29C2C0B1FA16F813DE69 WHAT'SSOBADABOUTFEELINGGOOD?
1,666,281,651 *AF590EC3108BB55E58CD2853EFA5205A694AD935 zacharywasmer
1,666,281,652 *AF5627C25EC73A2E1AF19EC99F153BB037C5DEF0 ZACHERYHAW
1,666,281,653 *AF53598001D703F8E2D8B4F4FFF1826E77B87EC5 ABBYPATRICKS
1,666,281,654 *AF54D20B8DDA480646195E57938F44CB42FF0D81 abdulamar
1,666,281,655 *AF556E57108BB24674AEFD8D554FFAF9843E09EF abdulmccrimmon
1,666,281,656 *AF5D90FF6795371AD2CB8F4A04B15180F99B0A6C zahir-rramzan
1,666,281,657 *AF5D1DCC7FA5DC22226A5A813FF295EF9E4FA0D0 zanecredo
1,666,281,658 *AF513E3FEA33E624D8EC58FE0B70B242DF7621FB A-BIRD-FLIES-BY
1,666,281,659 *AF53555D0AD07A635C7C7B3F64B88840DD26F0FF ZENITHSPEECH5
1,666,281,660 *AF5B35DDC0C293C9F139FF0390CA57C2CE4CFEC8 abraham.bonilla
1,666,281,661 *AF5041E86CF0719671C80AD2F69FDF4792651F49 ZHAKOFF
1,666,281,662 *AF5174302187AF4B8654F6F3070D693C586DBF32 WOBBL3S7
1,666,281,663 *AF5A614563C5CF5532E2F88A8502876F938CFDEA ac09r
1,666,281,664 *AF50E46376A1C64AEEB8F200480A8FBABA7CFD75 [email protected]
1,666,281,665 *AF51B09175B7AA4749C780835E87136046E0327A accionarlas6
1,666,281,666 *AF5E31601C5150F7E3654FFF15BF9D3B6733263C ACE901
1,666,281,667 *AF5ADFF796DD173B1250481E692E3B19F446B055 WURMSTICH9
1,666,281,668 *AF5269F101BAB024799D75C374796AF40AC413EA [email protected]
1,666,281,669 *AF574384C5D547ED906A0021022A3CC3B0ED196A zissisparras
1,666,281,670 *AF56B6C8D0FCAE111B3BCA3751EC2B9D9C4BB387 ACROBATIEEN3
1,666,281,671 *AF5BFA379C6B724D9CBF527426655A8FAEE73DCA ZUSPRINGT6
1,666,281,672 *AF5D0ABA1622AFB8F30689D30E285A150EACF4B4 [email protected]%
1,666,281,673 *AF5C17FD5780A36C4833ECCDD9E7FFDE374CC168 aderuanda
1,666,281,674 *AF5EC215424B9C144F4C6C94C9C41AA16611C607 ΑΥΣΤΡΑΛΑΣΊΑ
1,666,281,675 *AF58FF07FAB02ECA89609BFD0A2A6176D937859E XUAEVIN1
1,666,281,676 *AF5684F809E49FCE0480272104BB454A963D6247 ADPM
1,666,281,677 *AF5BBF4198DED9ED5BFDCCA760126F024DD81030 [email protected]
1,666,281,678 *AF543E372BC3700C5310AD771F0546CF23C2ADBC AEGXI
1,666,281,679 *AF5A48FC6383126ED5319D08D558D711F72AA099 aehchevies
1,666,281,680 *AF5A0BBA9BC62134231F80CB1E720E7450745744 YASEMIN.ALIBAYLI
1,666,281,681 *AF5C5BE25C2B2640041821200979B357B8BA6138 yasir-rafqiue
1,666,281,682 *AF5FF5C14F5486EC9097E6CF3DD8AFD3648D59DD YASIRZIA
1,666,281,683 *AF5CC2657A94F4A4EED5D78EC78B018E3574F472 [email protected]
1,666,281,684 *AF5BA3B08A0640E0C8B963F75E19D3DF45F6EB3E A!-F!
1,666,281,685 *AF5ABA01636C378C9465D750041E639638088251 a;fi
1,666,281,686 *AF51505F9C4F7DB692BA63F285DEA96A15EA976D YKCIVROTCIV
1,666,281,687 *AF5A92750A4209FC47972FED48D2D5F7E18D807D afstooves6
1,666,281,688 *AF5379E5F85D6C6B9C69FFE108D3B12BC6655C83 [email protected]
1,666,281,689 *AF5D6810DA5E3F57F7641386ED545156402D49CF YRITYSPUISTOINEEN
1,666,281,690 *AF5D86B00EE3D78018AA214F6D6FD64FC79E2BEA КАНЛИФФ
1,666,281,691 *AF51DB76F015FF555965D68F45AC5C56655D677A yvonnedemetz
1,666,281,692 *AF52BC3F3332C3470AFC2D41E86BBA4E81BA10F3 ZACHARIAHPAWLEY
1,666,281,693 *AF5B0572AE6FCF76945BDF111EE831421D798586 ZACHARYHIRTZ
1,666,281,694 *AF5870BD9024A030D7954109B37D0D2FA0F7A781 ZACK-MEADOWS
1,666,281,695 *AF593F23D30ECF9A71BBD362D4D5F9FC0BE87D49 AHH//
1,666,281,696 *AF5229F79B4659AB6C75CE2AB0E9FA22BE9410D9 ZCYRILLE-CERVANTES
1,666,281,697 *AF5BDECC17A5656FB2521D483AEC43D7D1CCF8CB ZEHNKLEINEMECKERLEINVOLKSMUND
1,666,281,698 *AF528281CD560BAE79FF7269BDC9AC1A66C00324 ОБЕВІЛЬ
1,666,281,699 *AF5A44DC6D860CD8EE00445556EE8451E2E6B765 ahvpk
1,666,281,700 *AF588A9727ECB3A42200B42E9BF6653C86773A99 AIILN
1,666,281,701 *AF54E4492BD872D6B579BED0F4E3921913A5C757 РЕТИЕФУ
1,666,281,702 *AF5C6CBC704D1195140AEEAA3B14ABACDC0C9B39 a)ky6
1,666,281,703 *AF5E7336C12249286AE012BEA290E5E642435FA5 ZXCVBRODMAN2
1,666,281,704 *AF51CF00AF1104A68B5BDD701211F1AA970E415B ЭПИЕ
1,666,281,705 *AF58681A77621F7C5225B5771A457CD5FDB77F9D ΕΙΔΩΛΟΛΑΤΡΙΚΌ
1,666,281,706 *AF57EE48C801ADABC2171A0EA7AA3C77E44C2B79 АЛДОНОЙ
1,666,281,707 *AF5985B3E290AD59B1CEB67BED1426EC9E9DC791 ALFRED.SZUFAT
1,666,281,708 *AF535AC13B9AF9338E5D2C4CFF402186F058CA9B «вузи
1,666,281,709 *AF533930E46AFF80C970E6BCF4DFDE103BEA8587 ГРОЗИЛИТЕ
1,666,281,710 *AF502002442987024CE35FBA4691BED7EA29C0AC ALLF
1,666,281,711 *AF5F147595ECE0B0A77841448D12DF8807266F61 звичаї
1,666,281,712 *AF5A8D4247A8F7B44CA3508214EE711E5D6CB029 ALSHAYE
1,666,281,713 *AF5123AA35174B8083648BDD826EEAD2B018FE3C ЛЫСЕЮЩИМИ
1,666,281,714 *AF53DA6010AB2FB7111A499AA54332132DF3067A ALU
1,666,281,715 *AF5D1960113319D60E3B7CAF5DECF319B8BCCAC5 ALVARO.LEVERT
1,666,281,716 *AF52106C0C76A76716800733AD6039411FD75315 al,ze
1,666,281,717 *AF56EF886F48330221306E194A6B1E29A241F617 AMQDR
1,666,281,718 *AF50688533904571BF15076A762E85A8EBA0810D 排氣管(exhaust
1,666,281,719 *AF5DCBCB5301AFE4C6B2FC2029290A8044D96398 фридриксауэ
1,666,281,720 *AF5D194561CA3E24570E2143BE258F2A935A2642 andybetty1
1,666,281,721 *AF54117E6C5298C8D32707657D70363F21B870DD ЮРЬИН
1,666,281,722 *AF578562D12259D8EECD0ECE3390B47932BCBB7A  МЛОДЗИЕВСКИЙ
1,666,281,723 *AF5817F1DE73CA49E25A7D8D35E296DCF2FF1FC7  ПШЕНИЧНЫМ
1,666,281,724 *AF539253369C9875F852F5AF222B2E7FD6955C6E anna-edvardsson
1,666,281,725 *AF50CB33FC94ADEA444D01A0AEFC7127004EFFFA ANNARYAN3
1,666,281,726 *AF580A4BBF2981F91B7B5DCA17AD2B07A2E260BE ANNUSIATE1
1,666,281,727 *AF52D47FC8F5981AF3CFC3BFD249101A73142E4D 01101907
1,666,281,728 *AF5E12FF6EB9ACDAF5493E75585659FF26125D1C antwanviesca
1,666,281,729 *AF5F3842E6F5D6A74BCC13F50BA033BFB3DB4074 APASIONIS
1,666,281,730 *AF50B44677459F1DA56B16B41551A950A982B632 APPLE-BOMB
1,666,281,731 *AF55F57ED9A9D368A1B1F396260B3E65B995FCAD [email protected]
1,666,281,732 *AF54A4D6AA0E4A02BBEBC25418921C80E2463F35 117ATTENDANCES
1,666,281,733 *AF5E8004A40C44B2CAD178BAE5F7EAE58D7567EE 用途:多重攻擊型對ms殲滅戰用ms
1,666,281,734 *AF55F713C31A89F8F48B189B4DFA48AAF4E6EC31 126.urheiluseurojen
1,666,281,735 *AF5F085BC508A9C39EDDE3A93E486B934196457A 1277FF
1,666,281,736 *AF58D3F42DF13504590EA7A2FDBFD4878473E5B4 1586686 HASS.GALT.BIS.VOR.WENIGEN.WOCHEN.ALS.TOT..
1,666,281,737 *AF525DDFC598B76C7F4483B68B960CCF52167BC8 1591821 hotelli sijaitsee n 20 minuutin ajomatkan p
1,666,281,738 *AF51BC5A04179E1A65B1CA31D34DA52558AFD391 ARRABAL2
1,666,281,739 *AF5617935D11C55FE64A9800A6233C99E3664B6D ASESCINED
1,666,281,740 *AF5D3D385EACDCDC2E5DD5BE085430C9423C98D8 1ANSTALTSKITTEL
1,666,281,741 *AF5280134067A0C6CA676F4904F146B5366EC96E asidibousaid
1,666,281,742 *AF55817223A7197CCA8F862BE2092D75494975C5 1.autostudion
1,666,281,743 *AF530132E9ADAE3EE4B8802EF01E8CA3AE5D5623 ASQ=
1,666,281,744 *AF591DFC280CB01B9F855B6340F5E14EF50D4924 1ESEMIGER
1,666,281,745 *AF5D5FFC6EE966144C5A84EAEF9A612F6DEF7430 1.ezinwa
1,666,281,746 *AF5FDE2AC75C8790BD40120527E1E01A769CFAA6 1 FLY-SPECK
1,666,281,747 *AF59C4E9169352DB9FE2F36C5D78A062929875CF ÁTFOLYNAK
1,666,281,748 *AF508A8824E359D5A69FC20235CD4725FAD61664 ATOGN
1,666,281,749 *AF54023C412D4F4D1AD2DA3F4CCDD0D8E9EE5849 au_el
1,666,281,750 *AF55BD60418D276A1AF0CD202B2F09B135D48878 1 LESS G IN THE HOOD: DELUXE G EDITION
1,666,281,751 *AF52480D1E76BF9DA7A2452730BFECB6B087AE78 1NETOBEEV
1,666,281,752 *AF59498F265C6A6651EDF87E2DFFB1FA47087E06 austinhitchko
1,666,281,753 *AF50D1E6BF1D13D30F7A8A3C92B7E5C2CFD6442D 1-nykyiaikaisilla
1,666,281,754 *AF50AD08C468856A7978AB930E6F0643A3E4DDF6 1 OPPOSITIONSOBERINSPEKTORENLAUFBAHN
1,666,281,755 *AF58D6E96BFDB0D80E65F6256F9DEE9EDABC8D70 1.orikuti
1,666,281,756 *AF577681A8B3ACD8257F27F7A93F80258013B46B avaink
1,666,281,757 *AF55D65B3664AE007D5FB7CBE19E393FD2141A3E 1-REIHENDE
1,666,281,758 *AF5E71D4E8B046396AB17859C8869C3E50B57FAC 1-SAENGERPECH
1,666,281,759 *AF5BB225BC750AA22D1A6EC19B6A3B32221B0995 1-STAGGERWING
1,666,281,760 *AF5DD19106D980DDAE242DEF95F52F24F0348987 1-THREE-TRUCK
1,666,281,761 *AF570C640357971C878C83A9D525945AF1B592D0 $0B$
1,666,281,762 *AF52AD745AF5258E9CA2C9C6A9F33AAA5373E14F AWT4
1,666,281,763 *AF501436E5A24C5886DF6D365677127853E64652 (>_0) o~ 0~(P
1,666,281,764 *AF591CF4A549822ABAB48A318BBE7136BEDEFB83 20.kaisaniemen
1,666,281,765 *AF58FCFF2409BB8D30BFC3E056B24159C4728AEE 2103414 SUOMENAYRSHIREYHDITSYSPERUSTETAAN221
1,666,281,766 *AF5C25707A54CA06425F349C6E771598AD384D3D 2121958
1,666,281,767 *AF591FDE233436C6405B6104F37F1EC9391643CD b######@~0.~o.splat
1,666,281,768 *AF54933CF34451362AF7E40410FCE1A1F893150D 2279461 rossetti.my
1,666,281,769 *AF5C6F0DEEB93455769CC7CEEA56E8249181108A 243YQB
1,666,281,770 *AF542BA5DA0F384BE563B6F3539A2D5FC4F2303D 24EP
1,666,281,771 *AF5ACF7D07B464B84478DD883A60DF06E7EEEC37 B11518248
1,666,281,772 *AF5B8FD72EFFE7F8590A9274DC79EB60E3834BAE B1OK3R3S
1,666,281,773 *AF5A1A3AAD3CA884D640B406AC99B3E03E2D794C b1u=t
1,666,281,774 *AF56CE17B905851880548EDB8490DEE97B4D6DA7 1354301 LUENTO.EURO-EM
1,666,281,775 *AF5FCBC1CC6F53E9653E550E3092FF50CB331779 B2tl
1,666,281,776 *AF5956BF087AA67701A9A0D2799B981DBF8A9308 2ARRSUCHT
1,666,281,777 *AF5B4566676224C24685130C787BE9CE45191878 1505755 DOES.ZEINAB.HAVE.A.ROLE.ONLY.AFTER.WORK.?
1,666,281,778 *AF51E9F6C2BBAAB301ED95894363877C2EFB7FA7 1508659 KOULUUN.VOI.HAKEA.UUDEKSI.OPPILAAKSI.TOUKUKUUN.AIKANA..
1,666,281,779 *AF5577572D4DFE915241EDB184D328255E62BA32 156ah
1,666,281,780 *AF51A9F2FFE979C3ADC6D8499908EE8ABE8A782C 2-conditon
1,666,281,781 *AF52E880E20F64ACE15B4DD7D38D4D090A619061 1746871 SITTEN.TOINEN.ASIA..
1,666,281,782 *AF51FF9F3C6ABBBAE98B5DA9F5631A28C2505B19 2.lehtikuusipuiset
1,666,281,783 *AF540DCEE63CD3A314CAA52C6153E4AD640215F2 2LEICHTATHLETIK-CHEFCOACH
1,666,281,784 *AF5EBCE0738BDC67CFEE611DFB119A2DBE92F51B BA7PM
1,666,281,785 *AF5DE66CE6A51068F8E9648AD70CB356CC8381E5 2POTILASVAKUUTUSPALVELUJEN
1,666,281,786 *AF506F6B6D16D0EF9BEDA00E0C54045B857DE9AE [email protected]
1,666,281,787 *AF5C8A08E926507271D702BB3BDF335C757BA60F [email protected]
1,666,281,788 *AF59F48DBD99B36C0D7870698729A7EDC06C49A3 2.SUURJ
1,666,281,789 *AF57A289D5683BF14CAFF4F3DCAD9D3EADEBADB7 Ballin'(feat.TheDramatics&Lil'HalfDead)(cleanversion)
1,666,281,790 *AF5C5C1AD724E62EF47F89E282E5702B433B496D 3CARUSILL
1,666,281,791 *AF5E0810A59697945CF16C45B510F75CE2239D37 3===d-~0-~o-splat
1,666,281,792 *AF5658D6C26FC7993B96C0EB22005A9379E323CC 3DNEAVMO
1,666,281,793 *AF596CB42693CB7A8F5D568EF4F7E547BBC597B5 3EXPOLOGO
1,666,281,794 *AF5C14F4B9286EA01F807678860716CE05BFF097 1aivotoiminnoille
1,666,281,795 *AF5422A91A634E24DEE2CCB7C54ABB7DD6C2A9BD 3GNILOOCY
1,666,281,796 *AF5E6877D2AF83D51BCBE42870F54B6613C7115B BAO.NGOC.DUONG
1,666,281,797 *AF50FCF8827EBD2D3FF77CCCAD74232A2BA17F23 BARBARA-A-MCAULIFFE
1,666,281,798 *AF5E00CBD3D0B49033625AE14D2C070E16FFD8CE barryventura
1,666,281,799 *AF57917AD81DB3C8552193891C138295FA9AB797 3NASSEMA
1,666,281,800 *AF500F24B1CAD634B9A892E6246DF891ACD0CB9C bartonmaras
1,666,281,801 *AF5D647463EDA1D4A5AA89227D0494FB09107B62 1CIGARAMIN
1,666,281,802 *AF5914F8E34929816EC54C9140903496A5864429 basilcoby
1,666,281,803 *AF5F250F9BA431CA8428BC661BF15DE82DE4DFDD 3p `~ `~)0(
1,666,281,804 *AF50195C399A3B068540F99477D61674226071D6 3THIRDPER
1,666,281,805 *AF57C75F363F9D2DB37144F57C12CE6AD9027D7A 3 VORSTEHERSITZE
1,666,281,806 *AF55F0B616623C19B41218AE0D0CEE4B85DF2E29 413milagros
1,666,281,807 *AF5CA3D53540E309F84CD0EB0BEDE5B47C402D3A 4CCUS4N0
1,666,281,808 *AF555829E0EDFFD1B0316062301C6DD8EE975161 4CERASUI
1,666,281,809 *AF501E16B45FB54119300AAE45D7BD4DAD296886 4ILOVESAMIAM
1,666,281,810 *AF5BBA31888E51C3A34CF822562EE67345411556 4KIJUSTAN
1,666,281,811 *AF55A49C83BAD2A037B6B43A90B727B8DEE3BB6B 4KOMENTIRALE
1,666,281,812 *AF5DE2E5DEA28A7FE272138570003B64260D0ECC 1.FALLTYPUS
1,666,281,813 *AF5743A457990AF682851E55551868B7B1D5524F B######B~-~-~-Splat!!
1,666,281,814 *AF5A7A9E023D5367FEE703F0CE3602D65F7E6FE8 B=====B* *SPLAT
1,666,281,815 *AF5B965DEE703517C8FA50B25AE717963D8F8989 bca#j
1,666,281,816 *AF56256F2565A08E60A5374F23C6F4A59695D404 BCC"O
1,666,281,817 *AF5819F9AD90656C30DE8233A517864DB89ABFE7 BDPCS
1,666,281,818 *AF5A6CA3E12A00A649DEE86E7512EB16C7A7BCE1 1.LELUYHTI
1,666,281,819 *AF58D22606731413831064B4E57A7FBEF108472C 1mallisysteemi
1,666,281,820 *AF58E59208B6F3BA09F779D0ECE8D8ADB636CF29 1.muellwirtschaft
1,666,281,821 *AF5EF13539A8F5B5584FC8501890849427E3E690 4SPRINGSNOWBALL
1,666,281,822 *AF51387DBB45F531D06E9394850673A53BDEBCAB 1NORWEGIAN-SWEDISH
1,666,281,823 *AF5FF311245CB4A2FE5293D031424B90E52327E5 bebanburg
1,666,281,824 *AF56CCB0EF609C478C2360576FA017BCD2D2D64F 4utopi1ot
1,666,281,825 *AF544A1E3F19B20C43A9CB7ADCE62A2743ABCFB1 1post-traumatischem
1,666,281,826 *AF5211D2C12FAC5544F85EEFC1DA0144B19CDDC9 1.PROMI-PROGRAMME
1,666,281,827 *AF584A90B069386707B8657ADD24A4829BBBC0FB 1prozesskostenhilfen
1,666,281,828 *AF5C92C439D34F2F4D01AB131F3CD45DBCE41B6A 5ACTIONPLATFORMPOLICYPOLITYPOSITION
1,666,281,829 *AF5E1D1266BF66F125F9E28D870C187C699494F2 BENITO.NOZUM
1,666,281,830 *AF57526AF2DDF907021F11375D729211B75374AE BENJAMIN.STACHOWIAK
1,666,281,831 *AF59B89A6AE98957081672D5C870280B2B602853 benwestbeech
1,666,281,832 *AF5BF661F21986ADF99A410058C275FCFD5F201E BERRYFRANKART
1,666,281,833 *AF5DCC902E21DFDF42914E7DEC8E66BD76366372 1.SOTASOKEILLE
1,666,281,834 *AF50336BF667E298F7CBF1A04F88A2CC7A0961C0 1sparbuchguthaben
1,666,281,835 *AF526BE83A1A8A73CE55266D5980355749C1DFFE 1-star-lichtbildners
1,666,281,836 *AF5A4E37BFC6A15467C6A59F86467C3550B282A5 5ELOCICIR
1,666,281,837 *AF5E245647D3F3C0925DB1D5A30E5B128CEEFC9D BF?5#
1,666,281,838 *AF5D9CB27FAC6BFC736EF975F4A8D497EFCB0E2C 1.TULOSARKISTONI
1,666,281,839 *AF5EC3BE4F9C278BA5576379AB808235D4F0C15A 5ISLAMISERAI
1,666,281,840 *AF5C3603D5F557AD4D35C996AC6EC7066733D4C1 5KARENJENNI
1,666,281,841 *AF5E6A69051BCF805E3B08488AB45EFDC0F2E31F bg73p
1,666,281,842 *AF553C50A3D7612A334FD7812EFEFA31126B79E5 BGOJ5XQNKC0C
1,666,281,843 *AF56817EA23044656CD2267A4087AA86B8A4C7C5 5RETIXUKBSW
1,666,281,844 *AF594D9A503A5CFE72465AD37DB614C1A976A70F bho&d
1,666,281,845 *AF5B8CF92979ED2C2CF26DE070C9F055AC9E76FB BI_E"
1,666,281,846 *AF531D5C2EECAF36B28190FC0BF0B0CD22900F72 2180500 OPISKELUAIKAA VOI PIDENT
1,666,281,847 *AF501B9A2C15B486887EB2E609F3370B382AAD68 5VRFFSVLY
1,666,281,848 *AF5F7BB0C8AB456C1A862AB1791151F96E5C8C7D 5WA1S9
1,666,281,849 *AF5D884E031C840094CCF5293A926F90FC5D7F94 bilgin’in
1,666,281,850 *AF555FF3F15C2C082684F626D8D9BE6024F0D8F7 BILLYBENNES
1,666,281,851 *AF53D7B538900E5481C663D9E4D2A760D5208710 BILLYBOBWINDROW
1,666,281,852 *AF503AD9D79724518969E43B62BAB597E64ED81E 26091128
1,666,281,853 *AF537BC660AC6C28A44E5BEB514D04546D7C5A69 black-veatch
1,666,281,854 *AF53D094BBB1F05645D22D385AF8D0A0AF6B59F9 27AUGUSTO
1,666,281,855 *AF5BD3880174F15C2B4860CCA0AEDBA81D9EE546 6OPWERPENDS
1,666,281,856 *AF51FAFC92E1BC4DB23790BF03EFE803F6334A4E 2933550 kirjoittaessaniruumiillisuudestak
1,666,281,857 *AF50A5CFE3BF69D79369DD45254F301B8C68FBE8 b-mjw
1,666,281,858 *AF5EFB9D89043421C7B29E1D26EA81538B8F4756 6SPANKYFRANKIE
1,666,281,859 *AF5B68C142AD2D557FE6A467A438F3951E88952E 6SSENINIL
1,666,281,860 *AF5657A0C837BEEFE35A0C65B477F5E2D1DD52AB 6TAYLORKATHLEEN
1,666,281,861 *AF56596D2DF46E3486D793AD4A51DF3F8769DA7E 6URARESSERARU
1,666,281,862 *AF5310E3BCA3716D8071FE55343635E70BBF4F3E 6VIRTUEPR
1,666,281,863 *AF591AB47EAB61AD7401B4EED5E5D559194D2668 2.councilwoman's
1,666,281,864 *AF582468321D66C4F7A11579EB771783F7C9A0AF bnefeit0
1,666,281,865 *AF51E931799AC9DA3420DDC93105F803A7675BEC 2dortmunderinnen
1,666,281,866 *AF54ABC006696AB0401736702886FF47419E7E7C 2dreizuteilen
1,666,281,867 *AF546FC7C88F52241394B3FF8C5EB04AF344DF37 bobbycromey
1,666,281,868 *AF5F4304A1256F9C374600DDAC3E25AAEC6272D4 bodagnone
1,666,281,869 *AF51D2CC88DC187EC76C30C5FBF673E490B8653C 2IAMDANIEL2
1,666,281,870 *AF5D3366D9C030DE5BAFCF846BB980D154F85B96 7EMMITTIMAGE
1,666,281,871 *AF526A7F32B80939E82F9B14E45C1EA3F8416371 2 LUOSTARITASAVALLAN
1,666,281,872 *AF553F16B581C84FEB8A04337D4211FA49CAB334 7KARR
1,666,281,873 *AF5D4797C2D73E759D0DF073778D9C0E40A4A2BA 7MAASEUTUKOTIN
1,666,281,874 *AF5265DED6B28E6F4790FB3C66B4E5DCC29B38E7 7MOLLYMIS
1,666,281,875 *AF54A8416E5F8F9F8622F5A4B0A50E36CC3A47BA 7oculate
1,666,281,876 *AF53F21833ED7C1D12E1F4DCA457BD87018DE5E3 [email protected]~0~ouu
1,666,281,877 *AF5442F099B1A9B82EF7A2C2B68E952457CCAD80 347416 EI.MUUTEN.,.EI.MISS
1,666,281,878 *AF53F566FB63975CE1BB29FCF2C6CE6AFCE0D189 814758 YIL SONU VE BUTUNLEME SINAVLARI BU SURENIN DISINDADIR
1,666,281,879 *AF566CE1B6B530B4E438F78996EF0947A4729D56 83FIR3
1,666,281,880 *AF5095002977EB75B5E02D4EEC1370A109DCC101 866160 JOS.JOLLAIN.TOISELLA.P
1,666,281,881 *AF575DA74E21C6FC1F55E5A522D57C385BADB58A 382697 cunku kullanmayanlar yok olacak
1,666,281,882 *AF5EA38065F9596683A92A1AE8AEBF20CB104A81 880239 die-glaeubigen-bringen-blumen-und-beten-
1,666,281,883 *AF5DC7CBEE6EEE723AC0FA8E047FC730646487E7 898746 KYSY.MY
1,666,281,884 *AF5F2A658549FADF860EA8E3EBAC7985AC8BE7B3 bqcu
1,666,281,885 *AF5A098F5DE1869713CEE04438E86B6CB8EAB441 BQZ$C
1,666,281,886 *AF538AE296338EE6618E3CEAA69594F2AE49EE6B 8DEEDEEANTHONY
1,666,281,887 *AF56C2D23DE6FC5185151E07B59BFC39CF1D9661 bradwallack
1,666,281,888 *AF5189FE4E4670B8FC49F644F71DA894B49ED0E3 8EGNERRET
1,666,281,889 *AF5B1A9DEDD81DAA74EDFC52DFD6551C4A2DFA7F 8ETIESKCU
1,666,281,890 *AF5FC59CAFC2BB91DCB2C9F4B7A557BE208E8233 )}3k?
1,666,281,891 *AF51802EC761FCF3329F8C5B1C0A2032E7F68EED 8JUNIORBIGFOOT
1,666,281,892 *AF5595E9131A937220FB5F48B81380F0DAF24A50 8KITTENTEMPORAL
1,666,281,893 *AF5A01F737B391985328E4B295EC8FB98ECBC219 [email protected]@CK
1,666,281,894 *AF5DE3F6D2C58FA4587D7EB5F23E061C0B00DE55 8PRIZPUSOBIVEM
1,666,281,895 *AF5780FD27A1D2ACAEF6BB5D1E5AD3FD4E8FDF23 8publiais
1,666,281,896 *AF5C39F13C24D03F900242B00597FD1B022F7F64 9208586D14206
1,666,281,897 *AF5F1D1131973A6D9CDCD7549C2C061F444C859B 9ABLUENTAN
1,666,281,898 *AF58D9CDAA6B9E249D7123D826A5215B156D87B8 9ADMADJAJA
1,666,281,899 *AF569D5DA77F195E8083BC6A598C523116C9FC50 9BRYTARNAS
1,666,281,900 *AF566B15899E9DC903237B6BB95C8C2FF8C631AF braziladg7
1,666,281,901 *AF503576D62EE11B64B4B8B98EDBDF95A1097769 9FORDLARSON
1,666,281,902 *AF5F465C751A4CD49FA3A06E11CB5A23AA41B2DE 9GEORGEGRAPHIC
1,666,281,903 *AF5BC4A19929C924472FF5E3BFD6D7C669AD5253 BRENCAVOM
1,666,281,904 *AF5A2ACAB7623DC36A4BB33D638DDE806C6FD968 9NETHCARDREMOZ
1,666,281,905 *AF5BAD15E3338672B7FB5F11B89B380C2693E869 BRENDAN.HEGGEN
1,666,281,906 *AF5145F060B82C05B2117CED661EC9B948824062 BRENDANTABISULA
1,666,281,907 *AF55A879498D9EDE16060FFA3A8A574CF1E6B6FA BRENTHARDEMON
1,666,281,908 *AF531EF7DA0F7DA5BB4AA798FBA19E9A7C3AE228 3thatlemon
1,666,281,909 *AF5C9A338BF51B48FB8FC5D4E281604E8ADAA9B7 9UMGETAN
1,666,281,910 *AF52DA2CAAD6F17782B26BFA615B3A301C0F6191 brookslutao
1,666,281,911 *AF5FBAFAD1B11E1DB505DC1C90F739ECA0EEE2C1 BRO#V
1,666,281,912 *AF583D5C4422D8329932E6321B9EC3C07C093102 BRULONS
1,666,281,913 *AF5D33D4CEE49E4FB5662BBE36ECD1E3B094D0E3 bryanganther
1,666,281,914 *AF57F27E7DEBE85D8BA8ABDE93F6171B1E75E588 BRYON.JENTZSCH
1,666,281,915 *AF58953172B6D1958ED2ADC4559230018989C664 bryonwitczak
1,666,281,916 *AF5C3C907B50566726DF212C2881D9A7BBCFAC62 4DALMORO
1,666,281,917 *AF55B40C429F0DDA3088AE2C5291B72F41D8149A 4DOMPELS
1,666,281,918 *AF538BA0F3436A17A3E78A3000853C7F484E8C59 4-elintasoero
1,666,281,919 *AF518852151A0479781EF6576D584660143BF67D [email protected]
1,666,281,920 *AF59602EEB99B4D304A8688FA9533EC9D9E96383 a6=-/
1,666,281,921 *AF5909CD17CB45F732D3F18253F9290DA7C003A1 bso/;
1,666,281,922 *AF56A01C090CC89423F11D118D0399035356EA14 a.7sr
1,666,281,923 *AF57CF1BE636AE61156A68A1921D94EB4C5CB5F2 BT2YP
1,666,281,924 *AF5AEBAE77ACA0F6D687945399205DAA65F5342C 4RODENDOSI
1,666,281,925 *AF5851711CB0B1189F90495B829BEA93E84969A2 4-sex-saturated
1,666,281,926 *AF588D6022CE5A1E07B2098690850C389144AD88 4-tbz
1,666,281,927 *AF5C6C371CA57316C7965BFA188CC219A624B1D8 BURL.HANNASCH
1,666,281,928 *AF5845106AA03E07628477F24F50F1ECC0E18E9E ´BURRKÄWERS
1,666,281,929 *AF536858A173319ADD1C314B0E55EEB4BD0C4A2F aaba1&
1,666,281,930 *AF50EFE97579E783AD613295CF1952C43259681C aab+r
1,666,281,931 *AF556328E3C863501D22422D0C08D6AE44023356 AARKF
1,666,281,932 *AF5B8D315C7467B6E2134517C21F01B489EE5B5C a=a)t
1,666,281,933 *AF5A861F5BDF7B76A45D9945106609B075BF12BF ABCDEFGBRIDGESED
1,666,281,934 *AF5978C22EA3CAA1627E04F59BD5AF88EC9009CB c0uc;
1,666,281,935 *AF51CA458C2E825DA09E33E8990FF32BF8D2BA0C C/1M
1,666,281,936 *AF5073B2D8DF0F692D024B1AA82EB38500545630 ABLN/
1,666,281,937 *AF557249AC3232BBC84794BD0F081B91B49480C1 5+rangu1a+0n
1,666,281,938 *AF5C810E894BED0D3CA99D1CD8E797DFAF35BF8E abt%
1,666,281,939 *AF518A1EA126BA1EA053406E2AD343D4A741CAB6 60exzessive
1,666,281,940 *AF5A681C6590985D0544A5CC8C17A780C484A4AD ACK(V
1,666,281,941 *AF51822A1E8E358C047699BFE7FEC495E5CFF8AF advertispam
1,666,281,942 *AF5A0AB139C9613E25445EAA2AA8EE22E5E365CB CAFFRARIÆ
1,666,281,943 *AF599130A6570C76F59DFF5213B01F7DB0369670 a)gvb
1,666,281,944 *AF588655B382BC4C41A790ABC9F558321EA984D5 AIRPLANEFLOWERS
1,666,281,945 *AF52E64E3AA0F49324266B6AA6607C6C93EB4B78 AJ+(5
1,666,281,946 *AF58C2A3B3B36355BF25219CFCE89D4FDFD6D477 a_j5g
1,666,281,947 *AF5C1AADE306B20319551ADA635B06A970EDFC46 akshay.ballal
1,666,281,948 *AF5F036B0FAF60278E07322907F8EA72C4111151 6IMROFNOC
1,666,281,949 *AF5A6661097044EECDA3D3E7663940B29C9679B4 6KONTINENTALSOKLERNE
1,666,281,950 *AF5F59D5C62CDBE6ECF918D83EDC93EAE3319A62 ALBERNIT
1,666,281,951 *AF53910A65B0FB1AAADE2591C8E5D5F51A45764C ALBERTO.GOLLIN
1,666,281,952 *AF5B3FA5A506F5E9C6D47664DDF135CEA7B0760B ALEJAND0
1,666,281,953 *AF52B5708447264E48310AE66ED9BC7DB16E2000 castigable6
1,666,281,954 *AF5D27CBAC5BBB2E2E3400A5E74E891FD474EA58 cautu
1,666,281,955 *AF58126676481B3286D2A1FFD2165F003D1D0094 ALIDAANDERSON
1,666,281,956 *AF50097CF630571428328948569F1BBD6ED03220 alishamakwana
1,666,281,957 *AF5B67CFE02F15C35EDCA5897F41E2DC2BA42E18 6STOLLBSW
1,666,281,958 *AF5DC2B733BB156855DA068644B31685DB26344A [email protected]
1,666,281,959 *AF5313EB9B5CAF635786DC3858EAF3F376FC980F alsahlah
1,666,281,960 *AF564F04EB1FEB9BA0235C02F9D92D955A4FB760 cbofq
1,666,281,961 *AF5AECF3AFDDBE4646039410DFC2DF8FCEFEB2F8 706333 JOSJOKUKELANKURSSEILLAHAKEVAHALUAA,H
1,666,281,962 *AF5585EBAB646FD66E47EDC5EEC28C8D07F86BE0 7170559b07db5201526b5dd0ba3113demelvvyne
1,666,281,963 *AF5388D1435462D6C133752F978A52CA45BD7348 CCUMBENT3
1,666,281,964 *AF5C5A10B0EB18CD7A01B231543159FF84E65630 C//CX
1,666,281,965 *AF58B69F16CAFAA924620B6303150B95195F6734 ANDRE12009
1,666,281,966 *AF52C52484A543A66D041FE502277640351EDC34 [email protected]
1,666,281,967 *AF54A6CE9A8319010BC13642FA41A693A5ACE93A 748francis
1,666,281,968 *AF5F1E8DB0EB9B8BA94D4D0BCBD6574B0DD838E5 777976 HE BELIEVES THE STATE'S SHAREHOLDING SHOULD BE REDUCED
1,666,281,969 *AF5DE048758BE145E029314B25FA973F89225C61 778301 THAT-WASN'T-IDLE-CHATTER-
1,666,281,970 *AF5FED0016422F43B25DDD8ACE06334759849D55 cei)b
1,666,281,971 *AF56DCBAB8B682A414E41957B1C4DECBA01B9D3F ANJILIMOOTIL
1,666,281,972 *AF50EF79F1C94BC03F694DB18BD758ADDD126F16 an(s
1,666,281,973 *AF55E1D41C7F18C2E7162F449E650550E1E800D9 c$fwr
1,666,281,974 *AF5AFA4FBA6292A7F9DF96B745181938DB010DE9 ANZUSCAHUEN
1,666,281,975 *AF58ED0112D86B3E31F7D3B91B27F4894C243347 AO7V8
1,666,281,976 *AF53FD110729942C7697D0236E7274E76E556185 AOWX5
1,666,281,977 *AF528EE0E7E17772B699C401AD9C179AC5A9C9F5 chasingamemory
1,666,281,978 *AF525BFD369CBF4951CBE24CFCCF2E5214A808B1 AR!$7OCRA7!CA11Y
1,666,281,979 *AF53CC08C128AD58CE9C18A9504FEB1330751112 CHERYLKIELY
1,666,281,980 *AF58E97E650387F37BF1FBF5B113BE179150681F CHESTER.NISHIHARA
1,666,281,981 *AF5D1E6549349A72B1222A65AB94716E534C473F CHGUU
1,666,281,982 *AF55232B5197E02154B85DFFD3C553C88F1593D8 armload?
1,666,281,983 *AF59ECF7FF8E8DDF3C93FC8C090261A8A67D4C3C chleweycont-ling
1,666,281,984 *AF5738F28260A28A617B7CD8A72A47F8E24598CF ART.BISSETTE
1,666,281,985 *AF5C67233E4CE674D00A17E02A665D0F1E21676F ARTHUR.BESSE
1,666,281,986 *AF5F24D2B455FFDC1650E0691ED00D41566EF558 817-USEIMMAT
1,666,281,987 *AF56FBECF4E09ECEA257F17A456C091C0F81E15D 81bab15743fc451888d6490395d80f93
1,666,281,988 *AF56C5807D75CFA6301559CB448B3130DD4B9252 820P
1,666,281,989 *AF50FB16C1F11DA3E801501789C56DC24BA5BEF4 833ZACK
1,666,281,990 *AF599160100307F2BC074977664AECC2A6539DB2 CHOROBĘ
1,666,281,991 *AF536FB4F0C4975CC05EFE4BA2D4AFF5A9FE6697 a"se1
1,666,281,992 *AF5B717FE29EE2F8903F482930748989BF28D1AA [email protected]
1,666,281,993 *AF5B58B455C0F70533FD326A0055A16F12117F33 ASTONEALONE-THESOLOANTHOLOGY1974-2002(DISC2)
1,666,281,994 *AF575FD78FE17DF5E35AAD60A37BE432987BD81D cic0t
1,666,281,995 *AF5CAD3FE76100A1B03B48CA2CA2190EA6CB4CA5 8EFALLEN
1,666,281,996 *AF581B4869244F7321F9C31D8F3E423E53117ADA AU3=B
1,666,281,997 *AF5F6837A5EE9DC9DFEDBB4C45F1DD2EBCCDF17D CIT:+
1,666,281,998 *AF5726300868DC802B7D8D3D6B3A7A30AA289B20 8GHOSTBERNARD
1,666,281,999 *AF528BB61A959DA966C568BF279AE8B6B22DD5D9 cizopas1
1,666,282,000 *AF58D2AAD0EBAC9EFFB118306FC030E163D3C021 ck!=k
1,666,282,001 *AF5F7C81CA479ED2DADE34A78146A55B0A271B8F CL0MI
1,666,282,002 *AF54E6F0A81A22349184C27E3EBC95BC95A76537 8-P ~ (^_~)
1,666,282,003 *AF58B71A2CD97B8CB1FEC3A7948BDEFFB0C5E7A6 AWT4
1,666,282,004 *AF575F8C26F2DE48B445A535421CE3FCDF98A473 A(Xk
1,666,282,005 *AF5F51E869B704583A9013DDF69D8ED865DDDAFE 8W33KLY
1,666,282,006 *AF544E4A76D2A0B74D568980F6E911DBEE3B82E7 8ZEISILAROM
1,666,282,007 *AF5B02434D076D27496B8416DF8AEBCADF192D4A cm#ny
1,666,282,008 *AF5D34C296280AA999B9AB67DA0D87ABF2975A8F b2"i=
1,666,282,009 *AF51ABA87DF4ABD424DCA7449087FC51F5D85200 cnv!6
1,666,282,010 *AF5BAC617AE7FF6045E8B7A1A3EE90B1095FC601 b4w/(
1,666,282,011 *AF5E436A15A139E95FA7BA04487AB6C2551655AB COLEMAN.LEFURGY
1,666,282,012 *AF5D9CB9D3A14B5BF141782C4302929B47F43B80 COLUMBUS.LOCKET
1,666,282,013 *AF5B8C5219DFE835095ED6015D42231E543C623E 9JAELJILLAE
1,666,282,014 *AF51EBE57E6A3D4254F240EAC7C6B4B3161E038E CONFIRMEREN4
1,666,282,015 *AF5754781F3A2957F49E4F06F00FBAF9D2D39ABC bagashvi8
1,666,282,016 *AF51F5BFB5BE9906489D21FA42E05B393D19C0E0 bailey-lewis
1,666,282,017 *AF52EB9A295C6B197612B70580089312B0788325 9NETNUPPOONK
1,666,282,018 *AF551E5AD1EE3DB806D80E3EEF8FBB365262C78A cool1268
1,666,282,019 *AF5A98430CAD78AA95FB42587E24169ED763350A 9PEBBLESSHEBA
1,666,282,020 *AF5FC49064E42E9AF0A9A8CB8F187CF8F17C7488 COREYVANALSTIN
1,666,282,021 *AF58AE0993A90E00CD173E0C8D437817E861AADC BANRETT9
1,666,282,022 *AF5478812A2811E74EBDA3639FD4F23CE96DEAFF COUNTESS.THAMARA
1,666,282,023 *AF5CA2C6B7DBE76B9029FEFE89871ABD502EFA43 CPDR!
1,666,282,024 *AF5EDC22079A13117FEE0D04B9099C48D003037C bdk?c
1,666,282,025 *AF521FBDFD167884AB4E3C7B31F0FB9FFF2FC51B bd#qc
1,666,282,026 *AF5F61542F19C4EF18316FA4FBFD69D5D3392E4B cristopherkudrle
1,666,282,027 *AF5CBBC4122A7695A6A10DDCABC6C3087527D515 BEAVERRICH
1,666,282,028 *AF54E89E24E524A687025DEBBC49491D7751028D BECKFRANNY
1,666,282,029 *AF544224AA1540127EEB8F6216E633D02C5B0F96 a6wxt
1,666,282,030 *AF5CB697597C6F3E7A306B811D099B035AA8FB8C CSK3C
1,666,282,031 *AF519A96B7296D74A58A6496B75C348E42EAD211 AAAGT9
1,666,282,032 *AF54D146412DA4A0D8D8FEFC6E4E71C9CC45C8C1 berusatsed
1,666,282,033 *AF52118E75F9E5CD2B16739D9EF3CE8F84650C87 BETOACHTE
1,666,282,034 *AF51F058B73901428FA38FF03E8D18F1DC092781 CULTOFTHESELF
1,666,282,035 *AF55D52CD7AC3FAE48F1D89A347A6BDB3CF694D2 CURTIS.COLDIRON
1,666,282,036 *AF500FDC5704A2DA412838EB2BA637AD87D577C6 [email protected]
1,666,282,037 *AF51DEDA8EFC16641D5B574CA75F88EE46D554D5 bflg=
1,666,282,038 *AF55F640EC778AB7E04793337972CDBFADDD0B68 billysanchz
1,666,282,039 *AF5AB294E21C9B4F18DD58AE433D5F4A2363C545 cyyki
1,666,282,040 *AF5997B5D472BEED001465DE8566658CF41B8019 D06W
1,666,282,041 *AF5AB4067842FD0F614D1EBDC6C40E7A45605523 d2&:0
1,666,282,042 *AF5B4303DA7A273A66628D596FFEA57A000BA910 BK(;
1,666,282,043 *AF5D8477F54241E0032B268DA8CA1314B40F81DA bnjcn
1,666,282,044 *AF5D73D5AB688F535B8478D0E3B853B7B24E5B7D BOBBY.SHEESE
1,666,282,045 *AF506D9B933CB90496CD997DA986C55421B56C3D BOCHTENS7
1,666,282,046 *AF53245C8284982DAA88F534DD4516487927D922 acml(
1,666,282,047 *AF56A629E1EAD3404643E13F4020E19B598C2C81 DAMIONASHDOWN
1,666,282,048 *AF50EAA433515410071A3B25921AEBDCA2236D05 BOTHIES?
1,666,282,049 *AF5D50A9E2FC9724230DBBF4158E52CB5D6D4A59 bp,
1,666,282,050 *AF5B347AC9AA5CACCBA1287D1961196D04E8830C ADPM
1,666,282,051 *AF527823ECF7F4ACB352813E4715849817721DB0 adventage4
1,666,282,052 *AF5DE1FB6DD8C08939E9925B82DEE53755155A69 BRAINBROWNLEE
1,666,282,053 *AF567B921515F5366B3A008354026545FFD9EBD5 BRAIN OVER MUSCLE (RECONSTRUCTED)
1,666,282,054 *AF56CF3E7EB5573308B6B92F146E73FC02BD3E23 aen90
1,666,282,055 *AF5278425BCACF64B6095404D65F82339810B5CE BREEPARKS
1,666,282,056 *AF5D2481092BE562003D12EECE4C25EA6111BF07 BRIANHARTE
1,666,282,057 *AF5E5E1B2F990B3F596DE6FDF41AC8AA7797BA7D agj-s
1,666,282,058 *AF5A17622EB8BB2CA887522D71145B74DE7EDE98 DBTIK
1,666,282,059 *AF59FF36A50896E97FDB4B9C0A66B230D0E81F41 A.HPB
1,666,282,060 *AF58F734459C513A8DE582C1EA48F41066E9B83D AI7(F
1,666,282,061 *AF5BA2F1F596C2AC44F21FEE8F0FE271F985E37A decen+r41!z4+!0ns
1,666,282,062 *AF5C772439EB4421426167143A75665469314EB2 byrongiffith
1,666,282,063 *AF5F0989E8107C527EBA25BF39D0AF60F87DB7C0 bzpgm
1,666,282,064 *AF50888E047757E6BAF86185A1943E418E2C55BF DELPETROSSIAN
1,666,282,065 *AF5F64DB71FF25F98B038A6E6EC62E99C7843DEE C0CKTA1LED
1,666,282,066 *AF5A9CA0AE964E47F4499988BCE44BD260519976 ALEXTANIMOTO
1,666,282,067 *AF59C78D03B2E7BB3A6FEA34C324A7CB380BB2FE c2ybi
1,666,282,068 *AF5AD45A3B15947D2D1ABF687C42D49932A5BA65 alfredwilkinson
1,666,282,069 *AF538B568DA4B9D7188D4E118C86C77D6CDD0531 C5-P9
1,666,282,070 *AF516363D76CD80BC40BBE0E993E7F458DE8E782 C8FQX
1,666,282,071 *AF5FAC7F524512EC43D98CAB98B1432A6D854016 deshawnknickelbein
1,666,282,072 *AF51E7743D21D85827C7D058008C867064086CDA DESHAWN.RIEDINGER
1,666,282,073 *AF5F94A6D7D59D4005176A8794FE61300E4CA87F ca8r101et5
1,666,282,074 *AF552639AD766D18AB77D6603E90EC802935473D [email protected]
1,666,282,075 *AF5505D48B9E8A0D2AE83FEB921A77D85D82ED9D CAL0RI3'$
1,666,282,076 *AF5ADF455D91A38692E4E174E76DAF92B76177BC carkhuffsed
1,666,282,077 *AF5633A86D87D5F674905BCA82B42E8316D081C7 AL-READ
1,666,282,078 *AF55B843A0817C80CC6B278C70F948FAB00DA90D A(LSP
1,666,282,079 *AF55D274198289F074194CF9029B38C3D3787120 ALTHEANEWELL
1,666,282,080 *AF588EFC0CB91918F28D2F6C60AFDCD8C170D684 carmenbrattin
1,666,282,081 *AF5EFF5903812E4DDAC5C71F60337C563C6665AD ALU
1,666,282,082 *AF51D0D88A2D168A713E6DC70B9EB66A549EDEFE CASEY.BOTWINICK
1,666,282,083 *AF5C85FD832DEE02C3BE21EEB897DBD20EFADB4A ALYSSA.CARDEN
1,666,282,084 *AF59B5AE75EA950B5403DD25EA19C256B966ADF2 aman'sgottabeaman
1,666,282,085 *AF5A86AC2C14DF7D872C0CEC0DB246701E4AF85C AMQDR
1,666,282,086 *AF50CA6339BB7320F223ED5749514ACFAD64C32E [email protected]
1,666,282,087 *AF5A42E1E634327E6579108243DA6A558015C33A CE1,J
1,666,282,088 *AF5EBEF1796D7AB58EAEECB515C218AC356ADC8F chaetobranchopsis.australis
1,666,282,089 *AF58167219BFA6B62B9D8BC7F53560194CDD06FA [email protected]
1,666,282,090 *AF5BEB35CCC01B028F8FCD0C243C0F58DF2BD46F differentiallysized
1,666,282,091 *AF52D38C4D47FB79FD8CCCB3FAF96128F71E30AB [email protected]
1,666,282,092 *AF5D39AEAC80AB64B3BC8A832344CACBAA2DBBCF [email protected]
1,666,282,093 *AF5A528BEC7AE6AD7BBA8B92418402E070529FA7 DINOCARRASQUILLO
1,666,282,094 *AF581C5AC4107EF6F781D723804A6159B152C661 diontewmey
1,666,282,095 *AF507CDED99090003F4E1BD7393DEB12078B62BD changkirchman
1,666,282,096 *AF5A091E4F404361D069A752B07A786E79DD5744 $ANDB1IN
1,666,282,097 *AF55909BFE41EC82251232447FDD452F2DEF43BE ANDRESWRIGHTS
1,666,282,098 *AF510B7DD90624FF821A8040F7C66FE256311A59 chaunceyriffle
1,666,282,099 *AF5307F82A3D64445072893FF95F69001C07ECB8 CHEBACAN90
1,666,282,100 *AF534DCFF6DAEBF1266AF8D45D692F41536208E5 andries’s
1,666,282,101 *AF58B653C4FD3F09420CF48E12C01A130C788633 angus.of
1,666,282,102 *AF57FD6AA0C7DB48D65F133B8B1DE975E838C3A3 [email protected]
1,666,282,103 *AF55B84073672793463BB4B8B6345E1746BCA2BD [email protected]
1,666,282,104 *AF5EB680C9F0B782F56C1FE820593E3DADB959CF [email protected]
1,666,282,105 *AF58F3D7C8C3250F0A3E19F18F14FC0D1C6E2965 an(s
1,666,282,106 *AF5DAB62AA6977A2B21FFF8F0DEFAD83943BC763 CHRISTIAN.BRANSON
1,666,282,107 *AF58E2B9C6D57A9BD13439938AC8292DEB6A7A51 d$ndh
1,666,282,108 *AF5022D5DD64789CCD74A7947656ED72E02B6EF6 CII+
1,666,282,109 *AF57C0B2F58BB398BBCCEF4E7EFF8E181EFC6799 DOGSC
1,666,282,110 *AF5F728F5AE44A28EDF7FF4C01B2718BE1514BA4 CLEVELANDWINBORN
1,666,282,111 *AF5E4B50DE001F6A68BE212C16AEDD17665D61BE ANZAHLDER
1,666,282,112 *AF5327CB23134C4401FFB327E9B72908711EBB96 CMUMC
1,666,282,113 *AF5F1488A6E31B084E2B0D1FCB193F5F542D4A18 COEA0
1,666,282,114 *AF50AED857006A2FEFA632D81C40CB944A7EB028 COLE.MOLTER
1,666,282,115 *AF5B35BAF63B6ED87D05F3133ECD0EF6D359784D colganses
1,666,282,116 *AF5848CEDA1B670E61567887D8350CC28FC0F80A COM:日本語アンケート「日本語の使い方」2
1,666,282,117 *AF5ED1066B73C1257731DDC96E244EB19CC7D195 CONCEP+U4L$+$
1,666,282,118 *AF5F4DE9365E886CE7A9AC37485751F7636375FD Conor-Chandler
1,666,282,119 *AF53E39AA9BF0C3FA160ED9A5D26F3DFF931CC47 donnyishee
1,666,282,120 *AF5C7242542C37A188AF80234D7E1DDAFB79C024 covn
1,666,282,121 *AF572D19D53D665A9526B493F1668FAC2C8ACDA5 Aq%l
1,666,282,122 *AF588EC4EF7F908D862991AFA23F4349F9A4504E DV.+
1,666,282,123 *AF50E9DE95E94723FBEFFBB03CA5B111FBB21FD9 cuw5n
1,666,282,124 *AF550577234E698750E4DEEEE0FB8CC4A44FE056 E1L+
1,666,282,125 *AF501245742538ACE02173FB58ECD337A108F85F AU/G
1,666,282,126 *AF59DCB5288A261D64B1329227E9378732948176 ausdruckssta
1,666,282,127 *AF506CBD705AF80DFDA785030654405DBBE7334A dailydaily dream
1,666,282,128 *AF559247F4204D2E0DBD6E70B298EC15966099D5 [email protected]
1,666,282,129 *AF559247BBB9374B051813B502AE28B33794C67C DAMMYLOLARC
1,666,282,130 *AF5B09F2C36A29344361718E7986D7C49CD5D12D AVI8Q
1,666,282,131 *AF543A8A1A11A10D2ED4C26A56A15F51FF8C6828 ED2N_
1,666,282,132 *AF52D932982121BA72FC314EEEC98DE5C989A1E2 edilitară
1,666,282,133 *AF5D4E7BAF2E321457C9FB3E17CA17F15A846DB9 edwardohardaway
1,666,282,134 *AF562DBDDF8773FD3F39204725190BD4BAB29017 DANIEL.LSW
1,666,282,135 *AF569F2DD2B5C82DDF6C885C9B9100397C80736D DANTAIJI2
1,666,282,136 *AF55CA273CD2CB02080590B836084B03C931873C EFFABLE
1,666,282,137 *AF541017B552A500A12B13C554FC767EDD0C94FC EHJ0I
1,666,282,138 *AF57835A6B1256A8CAD0B2E8195C0A951F500A96 davidzet
1,666,282,139 *AF5446DFA1296B600109FF80D32F87A514497C3C DAYNESEND
1,666,282,140 *AF57012C596489D0813D84A607FE7EE86552DFD6 b4pzr
1,666,282,141 *AF570C206A77F88D52B5A6E2CE7331AE428F0FFC DC=+J
1,666,282,142 *AF596AB5CD8EF2CFDF36CC437D76ED3D43194443 elishaschmahl
1,666,282,143 *AF5901A3DF183F3A77E7B650EA1B127349A5D37F [email protected]
1,666,282,144 *AF55EC8282D0B14BC74F7597902D4F907069F8FB b6q(
1,666,282,145 *AF53AB5EC082910AAA39E788B331E88265AFAA8B ELLICECM
1,666,282,146 *AF562CEB61F84FAC9E281E76379A55AF21C52D6A ELLIOT.CORNWELL
1,666,282,147 *AF5205837955216DD0CADA1B52AD89B1859B891C deafrun
1,666,282,148 *AF54EA0E3F71A65660B6F47CA26FC53F750EBDE6 eluaiza
1,666,282,149 *AF57C1BD604ED2E0F229F3A00EF5344F0F59F8FA DEFECTIFS5
1,666,282,150 *AF52CDC85FB24AF477524C4F9279A1169B1F5CB1 EMILESCHUNER
1,666,282,151 *AF56CAEF7E4CB6CFAE33ED47DD91937B7D8F835C [email protected]
1,666,282,152 *AF5F50A548121B8A23C947FA3F39C9BEEAA4C117 EMILYNGUYEN1327
1,666,282,153 *AF57B47622FD2736F039592CED8E5002AF742A85 BALISAAR'S.GREAT.BEAST
1,666,282,154 *AF585EE89633E2E5969A4DCCB7D0CF0FCAB28946 BANPO
1,666,282,155 *AF53192E0A46B7DFDECD49AA1E38836757D79A62 encorelorraine'shabenera
1,666,282,156 *AF56542DA845DC7E64F76D1774877A866151FB55 ENRETEOC
1,666,282,157 *AF56097C902D05A8AC1683EFC98CC6888A107EFD [email protected]
1,666,282,158 *AF5F1BB81D03BD60EE53A978741F7DCB341C2CEB entryeiner
1,666,282,159 *AF5D7EB642952B20F9A6D7E2896A977B85F70628 "{BBAA
1,666,282,160 *AF58F5F6E292BDCE27D1D6314FEBF094D30B2CFE b$ddk
1,666,282,161 *AF5E8C45055588F4DD28CD1392748F6338E899BA eterenous6
1,666,282,162 *AF5CB06B7BD17083D1061474A0373878C78C2E73 etsalegnaa
1,666,282,163 *AF51E0CA1AAF9EFD6BDE85A7621DE44F2281FDC7 DONNELL.WOOLFREY
1,666,282,164 *AF5B3FDADBCC49EA53BB00CA553BDCEAA3433E62 DONNPATCHIN
1,666,282,165 *AF5B194CD708A1133697AF52C831714B4977A78C DONOVANCHIASSON
1,666,282,166 *AF56AAAFE4BFFCE85119320C2BD373E64C3F0027 dorianlasseigne
1,666,282,167 *AF53B1DA2F286628BFAC45E97F8C4538F7FBC734 EUO-
1,666,282,168 *AF5BFE1D3A59ADB216C7272F0770E99697E03413 eyq0c
1,666,282,169 *AF5888F6DA369D753D176010C71E699F2C72B209 DUE:
1,666,282,170 *AF5555BCE920328F0495E132C67580C7F1619E1F DUNIVYMS
1,666,282,171 *AF597927F278CC21F0C7E36D0745A9FA323D7588 f3d3r4l!s+s
1,666,282,172 *AF5AFA8B92F086F85D4D701BC95151EAAF55B121 b!_gm
1,666,282,173 *AF5BA2A9B1F62CC1ACAB324C34D3B4434203D46A b.h1p
1,666,282,174 *AF5615D60F71AB19B103482DA4B7A9F9F444AC64 Bi(7
1,666,282,175 *AF54A03840A43C9C6DCC686611F7D464C322B410 FEARLESS.MOB
1,666,282,176 *AF5ABBB3FA091C5557798906AAF3609B4241A2DE dz7dh
1,666,282,177 *AF5F2A641B530F98DF48A2426D14B8E8214F3989 ferronic3
1,666,282,178 *AF5FF45E2992A4234199855CBB57731ED32C0DFB firewarcraft
1,666,282,179 *AF5DBCFCE4BB30A225FC2D8A221F4AFA743A59DA flavia.paes
1,666,282,180 *AF56079B9F3F10B54787FE7405A14187DAC6AF51 EDMUNDBUTERA
1,666,282,181 *AF5C17C9212296AA22255F0DC63F301838ED0F1C FLEETCRAFTSUPPLIES(UK)LTD|UNITEDKINGDOM
1,666,282,182 *AF57C72D98745080D05657E510E59D772B96F4E8 fletcherbiggar
1,666,282,183 *AF54A48B36E74E5EB2FF3BF05C01F0433E7E162C edwinsorrel
1,666,282,184 *AF56527560851C8A909B930CE129F7CA8E94B0C8 EFFABLE
1,666,282,185 *AF590D464B96224342AB5D90B6ED86AC4A14F569 EGANNOT
1,666,282,186 *AF5E894EF686F4A1C6B211074057FF42695C0E61 EINTOENIED
1,666,282,187 *AF5CDA777D5BFF9016C54E06BCBFF89AC23FAFA3 B#K0K
1,666,282,188 *AF57104446D59AD095BE994CF9B65A3F0C4F9D9A freddiecenti
1,666,282,189 *AF520F296A621A106E02E0DE8885DB57689128E6 freddyglennon
1,666,282,190 *AF555CA5F79778E4F6D685A29F4012250D4ECE28 FREDIOKDS
1,666,282,191 *AF5078D2A4FED31E419BDFA665E6C1B2286DB3D3 ftersheim
1,666,282,192 *AF558EA27586EC0D6A5508577A3D40EF88D614B1 FUNSAVER로
1,666,282,193 *AF583D41754EBE12633020483CEA2D368B503A4C ELLIOTT.HURFORD
1,666,282,194 *AF525A09758C39EE7A15FA4257B65971764DDE08 FZVP
1,666,282,195 *AF52DCB2150890C3A933A52B28A794D6DD249605 EMARKUS0
1,666,282,196 *AF565DBA99843B90B6BD8A6F8AAA48DF1CFCB5DE GAGNERONTS
1,666,282,197 *AF59DB030A4EA0A9A999085FA71844CDB89C96FA EMIRJAGA0
1,666,282,198 *AF5123D919C5A44A4EF8A53A44496541117F3994 BLY%
1,666,282,199 *AF548DD97D2E05A90111BB8E5FE234BFF4683FF3 bm5
1,666,282,200 *AF579B2DF3AABCD181EAFC589D31231E0A7CF47A gartengeflüster
1,666,282,201 *AF592FBA59F76CFC0D1B1C00BD79BC828C8C30D1 GARTHMORGEN
1,666,282,202 *AF506A39032C2D8152F5B240568F9494B55BE18B enapsega8
1,666,282,203 *AF5EB67DD755E1B3DDBD37A50511E6A49EA13547 BN5IK
1,666,282,204 *AF54AEAD82322075B2507F863E9DA7815EE54E97 ENRICO47
1,666,282,205 *AF527BC5C088F3FF4594FAF26FCE40AA70A885F9 bnv?q
1,666,282,206 *AF5828EDBF0F61E295203F0271D3FEE647FB3B71 ERICHSEDENKO
1,666,282,207 *AF5F284C062B4C552C4E21F137971D07F5392DEC GAYLORD.LIESS
1,666,282,208 *AF5505DB3F65084B575D23E9359F1CE0712703A3 erickorman
1,666,282,209 *AF546B04B11635FF306E2E09EF360FF0C516D41E boaf
1,666,282,210 *AF5CFE3B19EDABA97C67D080B244D7F17291151E BOATINGCOURSE
1,666,282,211 *AF5006FABB14C629796AF27FC4C98AF646E32F73 BOD7E
1,666,282,212 *AF58341C2B6B5FAE6AAFFE3ECBA3353DF216D5A7 GEOFFREYMATELSKI
1,666,282,213 *AF59EE3444A745B71229B559609EED6ED6A67515 bopc9
1,666,282,214 *AF56DC8C8F9A83D757AA2D0BC3217DD511D81B2E GEORGE.MARCIA
1,666,282,215 *AF5C2797395E705159881F04856EF69CB8688668 bosnian,-croatian,-serbian-audio-supplement,-croatian-disc-1
1,666,282,216 *AF5CF9CB39AC9969A871EA8DC836E1CA19A4619F expertem9
1,666,282,217 *AF5A0C3CD99BF593ACBCFAD8F8AE4262F1D6A759 glennwareheim
1,666,282,218 *AF56A4EB8135F9663C91FF451A8489B8E4062150 EZUERENO8
1,666,282,219 *AF5103AFBBDE0DCF77051D013660DC20487924E4 BRADY.TRAICOFF
1,666,282,220 *AF50F59DC041D658AD7D7E9B7E6A45BB7E3DA7BC GNIPMOHW5
1,666,282,221 *AF58C57E05AC598813EB5091CCE51B7211A1C4EE BRANDON.SILFIES
1,666,282,222 *AF56FD9B3B07BB3E8D286A6D0CD88E8D3312ED2E godstrikemedead
1,666,282,223 *AF5AB9363831ED5EF2E3C36F842FE3FA7DB1CCEB [email protected]
1,666,282,224 *AF58066A5E71E9ED64A88F07257A553ADB9D26A5 BRENT.HEISNER
1,666,282,225 *AF5E8CC8C046E219FFF19336D6DC98ED38BF705D bretonne3
1,666,282,226 *AF5775F2958A4CE06A834D78B0B10EAE2BC35336 GRAAMYA8
1,666,282,227 *AF57AF95AE44F1E7FF27DDB9B2D177F2404CAC71 grebgnaz8
1,666,282,228 *AF5B5BC0E26C8AD4327A25420444C63F320807AE Broken-Throat-Blues
1,666,282,229 *AF5C2F701D5A2BB7D0E0FC93308B9D8F4D761A0C BR#R
1,666,282,230 *AF5661E21832C85D56C1C07541F9147CB8E653AA brykk
1,666,282,231 *AF56D5C3C506F703709389EE64F9CB816C575793 GUADALUPEBEVELACQUA
1,666,282,232 *AF56CB23C33B69F3DCF2EA00AAAAB8E4C4F0C0D9 BSLEVIN0
1,666,282,233 *AF5062F5E23BCBAFEFF983E347C8752AA65A82F8 btlwx
1,666,282,234 *AF561D868325FD43A9BADB0AE82D5B90A8B3A8EE FORSAITH7
1,666,282,235 *AF588F9294C064857345DB743B3A7E056A18F966 FORTHQUA
1,666,282,236 *AF590E9C81F57DD3A03B7BEAE6DE5F9A099325B0 [email protected]
1,666,282,237 *AF5E50810852B420E5F2A0B6934639E717E9B10E FRANCESFRICKS
1,666,282,238 *AF59015D0C5ADA290F98C45B19ACBAC39A8ACF40 FRANCLS4
1,666,282,239 *AF58CCBF6BDD204B02A35ADDE1317FEB460A6D3C FRESH.KILL.DAILY
1,666,282,240 *AF59CCA39559AFEA60C9C02578A56AA3EBB5BBE2 bu562
1,666,282,241 *AF5D462ED78642B15389A8278195477BD1494A4E gway143
1,666,282,242 *AF5F2A42D53591F6041CFDC8EF73906F18B0614E FUKUBOTU9
1,666,282,243 *AF5E6FD53B2C4DCE79F8E1822AF5476D1DA00C0B BUKETBENGISU&GROUPSAFIR
1,666,282,244 *AF525C11F0A54B9FB8A514D7DA1F56BC306F9A17 HADRIT
1,666,282,245 *AF54B3396BB72771322B3C81AA1AD109152000BF GALENPIWOWAR
1,666,282,246 *AF553A0BBFFC1856D4C3C8C1322A9B6B1222DCDA [email protected]
1,666,282,247 *AF5E1FC4BCE8F0D0964F316DDC37E1B0DA83AA04 GARETSMITH
1,666,282,248 *AF5D41153DBC86CD498510A9ECA29113B4356DC1 GARFIELD.LEGNER
1,666,282,249 *AF5F498512E530A1DB5ABF62D5BCC73B3610337F GARRETTCAMBARERI
1,666,282,250 *AF50CCF193C39457AC5009D26B1FAD464A617AD6 GARY RUTZ
1,666,282,251 *AF53AB1CE02F106FCF931B1ABFFBE3335EDAC23B GAVIN.KYLE
1,666,282,252 *AF5CEA6FAD6021741603729DF47253BB11D9D021 GESCHRTS
1,666,282,253 *AF5DCAF337E7D955879418B65DFF79E38A95EA2D HARLAND.LITTFIN
1,666,282,254 *AF555E286287D31EFCBDC2C0C3C86B9F76263A9C bvexr
1,666,282,255 *AF56878BB96D39CCC974DCA7AAC792391C0CC329 GILLARONA
1,666,282,256 *AF57818A7BC03A90BFE14C3B5DEB171BCB0DE546 bw8ez
1,666,282,257 *AF58C683037832F3F056076576B8828B5A55F464 b:xe
1,666,282,258 *AF52F4AA96670B95559B8FD93A791920F2E87D1F GORDON.ISLE
1,666,282,259 *AF51949C6E7AB404047D299E4FCB5D02AEB89484 grndddy6
1,666,282,260 *AF50B3689BFAA11DC36FE7857E33B26C49E46F6B [email protected]
1,666,282,261 *AF5D55F664D71F51F9D9B678FFFAB45F9DE04D54 BYSZO
1,666,282,262 *AF530681E773A960A3B375DA7BD3BADD16222E6C HA$T!ER
1,666,282,263 *AF552722D8220FB1AB757B3046BCD6C129FA25F4 BZI]
1,666,282,264 *AF58B981CF6E7DFC53C5F7ABB271CFE86763ECD2 c/;$:
1,666,282,265 *AF518534ED1E7D963A462D984BD5F0E9779F8B49 GUYLEEN.BOOTH
1,666,282,266 *AF507A93DDC6A0DE2941CECEA973D8E274DF2B2B GYANA
1,666,282,267 *AF54FCDC87E37EF848EC55F7E0ABC08D9F8C1F8D HANA799
1,666,282,268 *AF5D52230C46CEEE65A0A822AC5E9374C9EA81AE HANS.OKULEY
1,666,282,269 *AF5BEC01F1A035B112543A71431C68A7C220B475 [email protected]
1,666,282,270 *AF5B0710975DE796B72F5C3FB32EB73E652A2849 HARMONIA
1,666,282,271 *AF527C1A3822E951AB0B8209A280DD0354A6EA55 [email protected]%
1,666,282,272 *AF5B212382752E122ADB0868AA39BE1102A85D9C c9omx
1,666,282,273 *AF5BF2E8175F604B51398343545ED662899B4DB0 CA1!FA+E
1,666,282,274 *AF54136E36155D945E31F94FC04E4F43B61A1B26 candie.lee
1,666,282,275 *AF5D8B589DD2FDB206BA58306B7D766DB6B90868 canoeroed
1,666,282,276 *AF50B58DE81029CBCD85B8B37ED2243125452AAD HOCKEYSPIELEN
1,666,282,277 *AF51D6AC61E15B71B0C75B6269A1F7C3FF0F390A hillbilly-bone-(feat.-trace-adkins)
1,666,282,278 *AF5A7D04CB4F73C0D4338487327964A90E21C704 hkg
1,666,282,279 *AF5BA4D3A2B2F00ABE185ADB9746A937066F383F hlsvrkp5
1,666,282,280 *AF5CE6E47CD50910257A32977C02525125F5A5F5 carmelojardel
1,666,282,281 *AF5E2B0269BCE46B765619E0C488A6020D5AB2FB CARMELOROTNER
1,666,282,282 *AF5A09BAF645DE20A4AB918A80A2E0B64D0A9FE4 HOMO3OT3L3UTIC
1,666,282,283 *AF562C79AEB5B5DC4208AA7809A91DF301382568 HOOFVERSIERING
1,666,282,284 *AF540E081B3584167F5240840B568104C1476903 HOUZHU’S
1,666,282,285 *AF51AD5B940A76AB1453486AB6E28FC77C3A8EB5 house.on.the.rising.sun
1,666,282,286 *AF50B51FCB739E6727119B212DAA80F4FC253F4E HOUSTON.KRASNER
1,666,282,287 *AF5A4E521E72D710DD77CF9FB71BDC38EBFF2AF1 ht-i
1,666,282,288 *AF5A945DBF38CC027F4BB8DFB023F8C56C3AAF4C HTTPNETQUIRECOMINSA
1,666,282,289 *AF5B57472DE9B620B89D181ECE783914A0281E73 CATHERINE M PEREZ
1,666,282,290 *AF56D9CDCAE16B11B639C0C8AB4E90D29CFE8372 HTTPWWW.PDACONTACT.O
1,666,282,291 *AF5337E96671258ED24E736333393F0CCCE3935B CBFQB
1,666,282,292 *AF55E35F9730C0F67FD1074F805CF75BFE66E318 CBWO+
1,666,282,293 *AF50097C3B73BBCAD11D71E1796DD22DE9F20265 HYOUNAS
1,666,282,294 *AF55E06353D8D3691A7313ADCEEB6819D317A541 cen0b!t!c
1,666,282,295 *AF50EF1F6B3A3DFA78002EE0B83403D5EBB7517F HYLLNINGSK
1,666,282,296 *AF58328D60BD19C2D58C91B34AE6064E7A10E1B8 ia}p
1,666,282,297 *AF5CE16DBE3C1B09E5907CDA1347863D75E088D3 IAMVIRGINIA78
1,666,282,298 *AF5796C85C85845B00A91365F1DE4CAAC62A859D cf!w
1,666,282,299 *AF54F11F958CDF1632208E7D5C9605BFE9B89364 CHANG.SCHWAB
1,666,282,300 *AF5C812B83DE30CF6F57DD24DBF63DF943D3E181 IMHARBNU5
1,666,282,301 *AF55EA6CEC80936C760A27288F6A10445CC5ED0F IMISKEK0
1,666,282,302 *AF5B6971F03ACBA1F51D57EB462E0604623E8AE1 inconvenience15
1,666,282,303 *AF5EB3836B75AC98B0852349037975673D69BB1E informaticae
1,666,282,304 *AF5A04399B385D42575D2867996B69364AD74412 ingssprk6
1,666,282,305 *AF5D67F56488A32BC1D4328FA986CC0295A279BB INTHISINDOLENCE
1,666,282,306 *AF55DE65501D5EC881A75DCCE4D4125582BD35E3 IRVINGRONDELL
1,666,282,307 *AF566997E1541117A640AF80BC3FBFED4B3B00B8 ILUZJE
1,666,282,308 *AF52A8E8E329D631FF03C5DE881C236FB2B91089 CHILISJOBSCOMWWW
1,666,282,309 *AF5CB058AEA899ACB3E89D8214CF29BA3E881DEB CHIMOPEELAGICCHIMOPEELAGIC
1,666,282,310 *AF5B1DADE3287DBD324C7DF399D2414B5F42218E CHINASUN
1,666,282,311 *AF506F913BFF9B45B19175E2DCAF4BD112021EC9 INCOMPREN
1,666,282,312 *AF52FBE3D101E24BB0042FA0FFDDA5C0FB0F1E93 ISZILAK
1,666,282,313 *AF5E7C124AA3D389FB3D793FA9FEFE932B5555A3 ITPECNOC5
1,666,282,314 *AF5C3E767D69A6F2F06AEDC1DBF7BCECDEF9EBC0 INDUSTRIAL.BARBECUE
1,666,282,315 *AF5AF44910738B0C9218A14EAE79821443253F29 INEINEENED
1,666,282,316 *AF5ED352F549EA77C8CF0A31ECC1EC981172316C ITWASN'TLOVEBEFORE
1,666,282,317 *AF5AFE15B89D7DFEE7707AD4F7762BE0794F0D09 IVORY.DREISS
1,666,282,318 *AF55FC9D35C9D524D0432C0F93A7EEDD31659335 iwn2dn
1,666,282,319 *AF5D8E1C8DBF418C80331A246DE25052616F0891 churcheva
1,666,282,320 *AF511F5FEC92B5BF0157632BD6F937AB6CA48287 CIMANEGO3
1,666,282,321 *AF58B37246634FFE00AC48018614068DB0E27E21 JAGANJCE1
1,666,282,322 *AF546CF4750FB68F6DD1850C1A648EEFF1C2728E JANICESHEENA
1,666,282,323 *AF582FCE43F42AFE7086452F988CBA87F51AF026 ISAIASZARRO
1,666,282,324 *AF590016FF66B594665858519782E4F15B7FE363 JAVIER.WORTH
1,666,282,325 *AF551019CD83FCA6CAB94B3EB9656E5F95DE7F43 jaykaauamo
1,666,282,326 *AF5A8EE602A070A74E7FA4AB379ED1C86B30E925 CKLET
1,666,282,327 *AF57EBCE9C236EF815F679C241E86418052806EB CKWKO
1,666,282,328 *AF5A0E85781241C4FD65AC29FE01AB5D61F71CBF JERALD.TALAMANTEZ
1,666,282,329 *AF51D3F5DC41AA51520D06805CD760708BFFC26B jeremiahrater
1,666,282,330 *AF539059E91D1A68B6CB9104ECC4FCE38202EB3C IT'S THE L
1,666,282,331 *AF51D9B38665265B3729C4157692D852ADAB0E86 IVCURSOR0
1,666,282,332 *AF5BC77D8C6C94DFDD8882E0EC83A062770B24E9 i>vn
1,666,282,333 *AF5E8678380682B9C5916FC0A62F7DAB4E054291 CLOCABANING
1,666,282,334 *AF5FFD7D9FC234E6BE5461B6EF2A0FDEC0181314 [email protected]
1,666,282,335 *AF51D3C9551B1E3402B9699D0071DCFC239CD5A2 jimmybarnes&rahsaanpatterson
1,666,282,336 *AF57A4EBDF800499E01542895BEEDC800A8279E4 CLOTEN WHEREISTHYLADY?OR,BYJUPITER,--
1,666,282,337 *AF5A6A6CD336CEF61896D6016C54B2073B32103F joaquinmandiola
1,666,282,338 *AF59132EEC046D08A1D6174976F2ED32C05A005D JOAQUINMARAGNO
1,666,282,339 *AF5981F7C1205ED6FB2BD9BCB57830F3127AA473 J19180
1,666,282,340 *AF53D8C9D15EB9C58608907B956A8A50B3D9C0E3 JODIERAMIREZ
1,666,282,341 *AF5412ACCA6BDEED9D2F196B43DECC9E491296A9 JOESPH.TAVES
1,666,282,342 *AF5A6DC1E6D749E195C679B51C446405AB4B8C34 joeyrach
1,666,282,343 *AF523C183293E36D386EF388BFC8799ABAE8F118 CLWU,
1,666,282,344 *AF512D5579563F5E69153EC6D20572C107704E91 johnsondiserens
1,666,282,345 *AF5DCCED60C108F3AFDC2F760DD98FB42679AAF9 JOHNSON.NICOLAUS
1,666,282,346 *AF55C5F360136E32CFC716B3C80444E5869428C9 cm(jx
1,666,282,347 *AF53E1FF773B4F57859DAAC6136B90B4314E9763 jonassauerhage
1,666,282,348 *AF5F747089C0D499A733331627B0FA916CAA2345 JONATHON.GRUENES
1,666,282,349 *AF5E273C9023ED70DE8C7A96FD116125A39C5BD4 jaeiset9
1,666,282,350 *AF5DB3C7F9D677E46E7773A770054E80F30D91AA JAHANDADKHAN
1,666,282,351 *AF59AFE2A00327B1C4F0C5E3015DFF8112F1ABE1 JAMAR.SINCOCK
1,666,282,352 *AF559AD5E908CCA8B03488C76093469B5B93B86B cn!wl
1,666,282,353 *AF5375A8E32F04EB369C91C8830ACD5E7C46E96D c?oi/
1,666,282,354 *AF56179632E1164F6C625643DC4C536E42A50E68 judegertz
1,666,282,355 *AF5A44BBD4530462867C63D799B933B6C8185E64 JULIAN-NICKS
1,666,282,356 *AF5D630E60B66C205C5952B9115BEDC65BCF982B julianryba
1,666,282,357 *AF51B0C16EDB2824FA1765C01D6FBB675F4AD8BC JULIUSSACAYANAN
1,666,282,358 *AF525B4C762957A17588C6342EBB0E74ABC5DC59 CommeSi,CommeCa
1,666,282,359 *AF5A42CBC56B8428052C850ACD7E23BA3E3D5B5A JUSTIN.WEISSINGER
1,666,282,360 *AF577523950ED8230E02CE067A16D3CEF103B934 JUTIKKALASTA
1,666,282,361 *AF575D7EA6068F358972CD2F0482691CD84D8A04 concentricate3
1,666,282,362 *AF55C6513D2C1120A48C3718BF0917E47FA244FD JEFFDOANE
1,666,282,363 *AF5041919FAAF66321F10836684104ABBA029FFE copables4
1,666,282,364 *AF54BD72F0E3D8F28CDADF5B58FD0EEB1EFAE76F COREY.BRODIN
1,666,282,365 *AF596C2436DE4347C8DD5A81B54786FF89E1240E KASHIEMG
1,666,282,366 *AF59FC27DCF5C06CB14F078A3E0823EF080E61DB KASSANDRA888
1,666,282,367 *AF5E8D75364F64B566FA4095C4F8BC16F2D51036 KATZENDECKE
1,666,282,368 *AF5D688FEC8788501FE7EAA944D1EBB6949D50BF [email protected]
1,666,282,369 *AF59E1238F94492B5743A68B5F660A98E8BE4215 KEEYONIAW
1,666,282,370 *AF59751E4F38CA7C90F32FE74515C70DBD712A80 county.town
1,666,282,371 *AF5D4D1BC601421E04B6A174570CEA5DBD2C3A9A jesusgraymail
1,666,282,372 *AF5CF845AE3542A8C073DE7883BB2729FD8C2885 kennethmcginnity
1,666,282,373 *AF57B077DF762FA08426205928677C718C434490 KENNITH.FRANCOIS
1,666,282,374 *AF5D5D22A80D12D96F4BCA32BDBA490A5BBAD272 [email protected]
1,666,282,375 *AF532FF0539782CB5CBEDE67A9ECF7BEDADFF7D7 COY.GHRIST
1,666,282,376 *AF5AEDE44FD497D5428CB70E82341602EE929D99 c+ph#
1,666,282,377 *AF56E69D0BCB37056EB59CD268AACCAF142F2287 [email protected]
1,666,282,378 *AF5F58DA03C0942F31AE8D4DEE401076B7D2A236 kiloh3rtz
1,666,282,379 *AF59D705E6A85EF090DE3A76B2AAC10E23031027 JM11LD4E
1,666,282,380 *AF57CAAC5CB5F87074BAB92C3F1E110C06791BE0 JOANPEIRO
1,666,282,381 *AF56F3A4AC65B106159A6511EBA91CEA65F2B5A3 craigguillan
1,666,282,382 *AF5110FFB04728E93B348CE24416EF061ECE07A7 crangannur
1,666,282,383 *AF535DC44D2F226BF689CF43E776BE3EA2EE5C9A KNSTHNDLING
1,666,282,384 *AF5C69F1D4AFB3ADEDD29DBE66A651489CFDD22E kpu:
1,666,282,385 *AF54C23FC8A6ACF00F7F8502732C1565DA7CFD61 johnathonbergo
1,666,282,386 *AF5BC89B33491A96DB10D7B0390D17BEFAE9BADA kristinallman
1,666,282,387 *AF5D80A46B21FBA0CCF6A2A4E2ADC8459781722B CS9KY
1,666,282,388 *AF5D6C99CE507FA9D929B368E7BCFC733B2633F4 ct0q
1,666,282,389 *AF53C5733FE6507782C1E50CC9FE1DADBEA979E7 JONICEE
1,666,282,390 *AF599B2DA6F9B5B16C54EDBBF522905B58554425 jopowne5
1,666,282,391 *AF5D0B373D0BECD204FC8715F322E33A8EC7B841 CTW!
1,666,282,392 *AF5CB77B6972146B4B3DA3E06A4504ED172A36BE cu&lu
1,666,282,393 *AF51FF64F9F2E93F66A82211C6BE5C11805AAE5B lamarnaidu
1,666,282,394 *AF5EB522A9D77A7BC9821BB652611815B49D872D LANE.PITTMAN
1,666,282,395 *AF52FC18D7E0B0488B38B4F24471B4B27EAC5BDE langes-!
1,666,282,396 *AF540F929E03E219172BDE6C6BFB6BCCF5189F6E C!VFK
1,666,282,397 *AF522CC73EFFCD60CA88D5D1E07098F69E248DC8 cwbkz
1,666,282,398 *AF5919AE5D8CE8C21D1785642FB75475F3C89ED1 laurencebrunot
1,666,282,399 *AF5CF6CC940DA26B7F289EC7D04BCF6B7D16316C c:\windows\softwaredistribution\download\804d59d22f111acd320f8c790519d1d6\_downloadprogress_state
1,666,282,400 *AF5B7B17BF60603F38D1D9D119429EA9F05537E9 LEEGOSLINE
1,666,282,401 *AF5778E2E282D8B2EF1CE1383E6E8B77D3A6E858 LENYEWE4
1,666,282,402 *AF5989A0384C9BC4D8FFEB39B6D4D652EA07CB88 JUSTINBLANE
1,666,282,403 *AF526518D665994C0C54C133D3826B651DA4758F jvf
1,666,282,404 *AF5F628D3E419FDC92AF538AD55B1F9A7B9C2E83 LEVI.SPAGNOLIA
1,666,282,405 *AF5B3822D2C65B9190D59F53C5232A710633CB6C KAH$
1,666,282,406 *AF5E3D2FBB2C15655A2D1058371CBECD649DADDB lgueriez5
1,666,282,407 *AF58438BDF8953ABB128053399CA6A0E865FEA69 LIEW.HENG
1,666,282,408 *AF522F4FA4F7CA86A23E8D4110F516B1641F6B80 KASHIYLA
1,666,282,409 *AF550E54DCFDB999136E200FACA6F8249B49BBE1 D7VNG
1,666,282,410 *AF5077AE89CC5B0C325AE013B292B98DC0D41914 dadannerie
1,666,282,411 *AF5DCA32EF6F52D8A767CE222825BC893B930E16 KEITH.BERNICE
1,666,282,412 *AF5D8B5EF97228860DBD4AD129CCF0C4D4DEDA9E kelly.whitesell
1,666,282,413 *AF599CFF683ED387CFDF180EC76AEA7AAF2E3889 LONNIE.LITZENBERGER
1,666,282,414 *AF509468BEDF55562881E7269EECA535384B8441 kendrickflorenz
1,666,282,415 *AF57C1455EF51F9EAEE22A8DD6EAA9638A908FC6 KENDRICK.NOVACK
1,666,282,416 *AF5E883C377BF50F69792B7BD88005B880B155B7 LOOPNAV
1,666,282,417 *AF5DC3C25CD061B053A589F17C170E58FFE31D99 KENNITH.PROTAIN
1,666,282,418 *AF53408E8409620DC9DCF0C45804DF2A87470C61 [email protected]
1,666,282,419 *AF59FACC63EA5AFEA40DA04D7251E1EFA96F05F4 LOUFLUEGGE
1,666,282,420 *AF56713DB5AD6A5FBFD1D954E0EDEA4D9288A74C [email protected]
1,666,282,421 *AF514E040B4494D79787226573E62D30FCBCA14C daniel-paoletti
1,666,282,422 *AF57438BB724ACF5FFC763570DA3295D3ED70823 LOVE-WILL-TEAR-US-APART-(FEAT.-ERICA-JENNINGS-&-ALGIS-GREITAI)
1,666,282,423 *AF5FC7339394E8F736006D370D3B62B854C66852 LOYD.CHASTEN
1,666,282,424 *AF53A382B366C8412B8F77181DE29C26163DC3B7 LSPECIFIC
1,666,282,425 *AF50BAA25E0463C2E456E8B920D779CB5F172F1C LUCAS.HAGGLUND
1,666,282,426 *AF5442A83BFF2609CAE90A690C3E6D0FFBD214E4 LUCASKOLIC
1,666,282,427 *AF539707A04F08CA153E21AF0E05F9C1F500CF11 KHALED EL AMIR
1,666,282,428 *AF59CD449881B0F18E7A9A7B9D94298F531425F5 [email protected]
1,666,282,429 *AF5ACA8478EC961A5B4C37EEA7CC387ACB1EBE98 DARJEELED
1,666,282,430 *AF5D6EBDDF1F314C649130132C28774A09A51BBF darrelentler
1,666,282,431 *AF5088FE862A0B6F22DC440B7B81471FF34A2DC6 DARRENWENCLAWIAK
1,666,282,432 *AF5C961F6064E3DD89E1E336F7B870FFE900DEFD KINGGUILLARY
1,666,282,433 *AF5965A8836A1A54BAF8627FD2E1F9D77DF0B1DE LYTKARINO
1,666,282,434 *AF546A7FBE3719C7138DF011F2908A3C745F9763 davesteinbrenner
1,666,282,435 *AF5535B171A30428F525FD60A837480B44FCF910 davidjenista
1,666,282,436 *AF559480AAC1B9314D8DCE6637752B4705FE9FC8 DAVID.POZZUOLI
1,666,282,437 *AF55F5DD058C965B0C865508FADCF46530D84216 MAGICQWERTY12
1,666,282,438 *AF5FB789916A8EB4E89A62DE69AF6A43F98EBFCD MALMOULTRAS
1,666,282,439 *AF536CF6DA040CF95724CEDFECF423EF587E55CD dc70363
1,666,282,440 *AF5CC4DE03A51E3220FF211CF21E7A384C69E02F MARCELINOKANEKUNI
1,666,282,441 *AF59DBFCF8C30821CD45D539EAD60566426D0D08 [email protected]
1,666,282,442 *AF50C026B9D0CA4CBD71FC8BD2FE254654AA78E6 DC-P8
1,666,282,443 *AF5733CB79C91F9E73F784BDE3374C8A733E3FD8 MARCOBERNARD
1,666,282,444 *AF515C1DAE3828268EA201008242711EA1DDEA80 D;DBG
1,666,282,445 *AF536CC5E02B295A0FBC72CD97C66A0BA5FDA237 MARINEWERVEN0
1,666,282,446 *AF516E6C62D9B0035296495DC99A532784FE71FD DEAN.CLARKSON
1,666,282,447 *AF5DD7F73BA4E306D0E170BA4C6ACDDB01C5FDB5 MARTIN CORLEONE
1,666,282,448 *AF5BA72B1015D4EB6D408F2E22FF442F6BBB1F3B MARYDENMARK
1,666,282,449 *AF5EE498F054DF537476C7227666F9AE6362234B MATTBOUCOUVALAS
1,666,282,450 *AF5952B7E30B2ED0FE5296216648C1E5A2BC6F51 kristophermellady
1,666,282,451 *AF5F8CD1DF4596ADB74235CDC07CFCF5B3A9A8FA DEEEASTLING
1,666,282,452 *AF53519B8AD7D915FDBA4905F8D69BC6DE477E4B [email protected]
1,666,282,453 *AF5A6D56F206FF423A001031CF4627154E5AFA06 MBLXWWE5
1,666,282,454 *AF588B4FD211BBC71722CD26D1E10169B0111F54 medianum
1,666,282,455 *AF524350F7D32AD89A56EB5743C672F85F4E8413 melina-king
1,666,282,456 *AF5A739F30287D328059FDABAB2648903B860630 MELINDA.CHIA
1,666,282,457 *AF5EC07F14D457E3B54BB7430F98EFB7B108C02E [email protected]
1,666,282,458 *AF5FC4F6603DBADDE9C23317C6344A6348C00E17 DELIBERECK
1,666,282,459 *AF577D697D856DD3B838E56AA7B546E3A15F5AA5 dellatsy7
1,666,282,460 *AF555986139CC279EE50B004F7ECFDBA624B8E10 delmermesidor
1,666,282,461 *AF5F64FA6CB86A541F987E58A8BE5E1F7555A431 MEMORISANJA
1,666,282,462 *AF5E0C161C0EEFE6C92ECD6570500178895667D5 MERCAPTOLE1
1,666,282,463 *AF5FF1676DFAC24037B15E56E5A67396D8FC489D MG"9
1,666,282,464 *AF5CB3E3051DC3E1204D4A6B7CEA7B8F0DBBE3E8 mgiudnb
1,666,282,465 *AF59A988C0F09176F1D9C8F9C1686BBB7A2659F5 MICHALE.LECHLITER
1,666,282,466 *AF543AE3ADA69A39DB1CE887A51CA0AD21ADDC48 mick-cowles
1,666,282,467 *AF5DDE16D72CF637074DDE054B3947383E79B14C MIKE.OHANESIAN
1,666,282,468 *AF583618D220F999A9BC1AF0123D705EBE984D5A militarismed
1,666,282,469 *AF5E0FC790D5CC181BD650157401B04BE0363FCE laugaricione
1,666,282,470 *AF5AC95678DD35A48E5B19A5129298B945D6E581 dev/nrmt
1,666,282,471 *AF5300AA8AC976B2FCE1BC6389D7D8EF9D6CB5DD modestoframes
1,666,282,472 *AF56CDEB4A2AFFF51917DE87B48C9FF35095488A LEENAZAFAR
1,666,282,473 *AF51EF17F2948B4133464B3B31EE215DB3BAB103 dh_eq
1,666,282,474 *AF5E297C1226454913CD1D7294B69704570F233C MONKEY2008
1,666,282,475 *AF509EB4D4051F51AE169574073C243E4FEF9578 leroypelote
1,666,282,476 *AF5E2282353E504C978379FDFF37E6E8E8403D1E disagreeableness.
1,666,282,477 *AF5556709D3FC81C40E4F14C90A108B54D849C1C [email protected]
1,666,282,478 *AF5787BF08CCC55543871F51B1B1F03C54143CD1 [email protected]
1,666,282,479 *AF56EA5BD0710920260316254497FB5AEE2B3B85 LIFIRSTCHILD
1,666,282,480 *AF50B5C3C8714145A43618D2886C82343B18C635 LILBHOY
1,666,282,481 *AF52B7FD6C01A0A4BE744D56A8B823219F14609F MYCHEM169
1,666,282,482 *AF5015257310D7311597DA42DDC5238333DF040B MYGIGI39
1,666,282,483 *AF5BD9404D7CB2E7AC46E81B025F4377E203E2DE DkrT
1,666,282,484 *AF59A9BE518BEA354E8B6427385E410B7B32E101 dlefgulf6
1,666,282,485 *AF54050AF936502B43E439AFFC1DB2C4AB09B57F natoexpress(featzarahleander)
1,666,282,486 *AF52F547F436879153BAB5401BECCA0984FF7623 dlkm(
1,666,282,487 *AF597999B6B4B76A2DD9482D2BC62FB70A6195C1 dlxl
1,666,282,488 *AF572C7823A6C9560D067CD41E35E345E571A079 LONMILLHOLLAND
1,666,282,489 *AF515978A30B00241FCB1E0C3E5FEB847DA08F62 NEWHIPHOP
1,666,282,490 *AF505B91FD8D2D909CECC0951C9B2F1D533ABD6D NICOLETTEMORGAN
1,666,282,491 *AF5ADFF4C843447DACCB396D728AEABE739D8DF4 NIQISHUANG
1,666,282,492 *AF519B954D54086DB13C6A81FE07144D51BA1C46 D,OKC
1,666,282,493 *AF5578F5870665D03438C41AB68C9AF2713088A1 louieverra
1,666,282,494 *AF537B6A8FD7A26B45A1DB132FAA409989D96609 loulobdell
1,666,282,495 *AF5D73D0F9BE25A9330A22A4F6244B5C782E97EE DOMINICLUNFORD
1,666,282,496 *AF53CB26F2B5B676AF37C9B318D74B5427813330 NLLANTEUIL
1,666,282,497 *AF5BA29ED6007EABED428A3EF21785FA7E675FF0 NLPSLBBD
1,666,282,498 *AF5F1C4F688C83B0BCFB4D9A78B9D812DC33AB98 DONALDWISDOM
1,666,282,499 *AF574BCF7A384C88AC65C31E8B4710EB267A60E5 LUCAS.FIGONE
1,666,282,500 *AF59AD84AE7A8D0E03F2978D208632B8F7BBBAAC NOLAN.ARRELLIN
1,666,282,501 *AF561E1BFA3A57104D4F2B7EF228A8C814F4BF1E noncling!
1,666,282,502 *AF530EA2DDB984AB54475EDB77D76390DCDAA003 Double.Concerto.in.B.flat.major..Gayment
1,666,282,503 *AF5B8D6B148270050D46566BEAE5CD55330C5AF9 DOUG.CADMUS
1,666,282,504 *AF50E7309ACAD5C2A57A12091B97FBF15AA1C99A LUKE.PELEG
1,666,282,505 *AF574999DEA545DC1C8937A176A0B4182151900F [email protected]
1,666,282,506 *AF5650FBC33974F23CAD7EA5F4072E89999061AB LUTE
1,666,282,507 *AF5C1EF6E469B8EDF41473B1D210B5AA43201D90 DPTHC
1,666,282,508 *AF582F7DF4F09B358F113321C16E290871700287 M4PGU1D
1,666,282,509 *AF5C5706AC2CF4B8BF9659DBC85005F43819AFAB )o(`@###b
1,666,282,510 *AF558E133411DBF2384FD92ACF89375A8DC7C34C obtiendraient.
1,666,282,511 *AF55850F0327AA96AA97A09FE6709C337C7C3D44 OESEREDETI.2
1,666,282,512 *AF5A3E550044D41E8D2AFDCC6E89B76BBDE33A31 DRUGINFORMATIONRESOURCECOMWWW
1,666,282,513 *AF5DAA5FF05AE3BE2EF1D61CBE1B1284950CE7D9 DSCRPTVLY4
1,666,282,514 *AF532DD28D3FD4F3EBE45F544A4937848B781A6C DS!P
1,666,282,515 *AF5A047879108D98C7CE56DE6FCCBB5B878307C2 MAIBLOMSTERFLUEN
1,666,282,516 *AF50E09872E6488F1F7632BCA1213FA180BFBE79 mamma-di-mandolin(featpeterhinnen)
1,666,282,517 *AF554840398B9E6620A95B4F8B8F9856435F363A MANY.HAPPY.RETURNS.OF.THE.DAY
1,666,282,518 *AF58B92B9F50A9DB058D41A2B58F51CB2E6D8550 dumensnil123
1,666,282,519 *AF55311812696EF7B70EE7BE95F5F7A1B0B4067C MARCZAKED
1,666,282,520 *AF523C91CAB501AFEDA51D3AE4C0D671A8C92F70 mariaantolin
1,666,282,521 *AF507E8BD5C6881B9BEA03175BF7647357A4A230 DVQZG
1,666,282,522 *AF56398F2B9316C3190973B82E810D288893CE25 DWA3Q
1,666,282,523 *AF53291806C3B524EF24A44BEF48D7EF9FB54D0F MARSHALL.DRYE
1,666,282,524 *AF54941314115E4C93A3297D192912346F532566 Dx)
1,666,282,525 *AF578ECDB63BD9E2100EA51266B5001E5BF45F11 DY!V)
1,666,282,526 *AF57F9A7F90DC185540B1B07410EC42CC832C20D patákovy
1,666,282,527 *AF51D69D93EC2DEA664AB1993F1BBA8A09DAA452 P=====B~0~O><
1,666,282,528 *AF531ED6FF587F743F2178E27DD342FB60F437BF [email protected]
1,666,282,529 *AF58991287C7356E3277ED9C36BF2DA5D6C7D290 EA84
1,666,282,530 *AF5FC6173D0B1A1FA1A4A077FCFFF1DF8DB90F35 masoud.mohebati
1,666,282,531 *AF5605B3C82A14E9B2B6991CEFF5F42F560016DC earnestdownes
1,666,282,532 *AF51E6E058305A5B76FF93F5BC3E66EFF0D4E34F eaxrt
1,666,282,533 *AF5A0D11259179E45B013F0AFCEBADBAE223596D peterfeist
1,666,282,534 *AF56932F96521C154FC49F16651EC14829FC26B2 PH99B062
1,666,282,535 *AF53A4D7D2D2E18F197EF7665856606C06E43A0E PHILLIP.LEAVELLE
1,666,282,536 *AF58A0EDEF6AFC709B173BBAF8296B005252CBDC PHILOMELS1
1,666,282,537 *AF590BC586474CE330FF15E7905976E6FF6CFBA7 EDDY.BEDILLION
1,666,282,538 *AF5DD047D4103C24CF1E074E7ABE390A1EA0D687 PIGOLIAM0
1,666,282,539 *AF54F48AF228EE23EFC16B91C877BD6B756A1E5A plomberaient
1,666,282,540 *AF54F2BFE59F36F7288394C61CADA240CC68E97E edrosrez5
1,666,282,541 *AF5D08D86F314C0E62CD88D696122F59041E814F POLICEHEIDI
1,666,282,542 *AF59E0D2EBACEE98C93C54FD7C5A5459C6C39E58 [email protected]
1,666,282,543 *AF5A64BC3B6238B755C2C7F558AFAF6C4864B6BB P######>~O ~O {X}
1,666,282,544 *AF53112C8469EDD0FB906B645FDDE311A7429FA8 P###P`~`~SPLAT!
1,666,282,545 *AF5C0FAA07A328693F59869A229EA4EDB6710A64 EEMf
1,666,282,546 *AF5E20BFC0E345335FD4FD38F34E30951EB18C3C PRINCE.MCRORIE
1,666,282,547 *AF5C90F65CD54CADD927A1F1D8CF3430CB6A231F EFT
1,666,282,548 *AF52F1B9CDD40525B3B7B869B85865DB0A00C4C9 prodava 1
1,666,282,549 *AF53BD7B396A742B366C7EBAB2679D64F1C14EDB METOCLOPRAMIDUM
1,666,282,550 *AF5D3AACFBD70F990A0D2C29DD1DF406C87808BE eissel
1,666,282,551 *AF517498D58EAD3454686B369D6631D5B478F73A MIEHESTÄSI
1,666,282,552 *AF581D04259DA70313FB372B4CF2FFF1C51D36DB Q######D~O-~O(>-<)
1,666,282,553 *AF5D33903C7D8FE14039C0A7F766BE20FFDE1838 q-d ~o~o splat!!
1,666,282,554 *AF58D9A37E84BBD022FC90EF76F6E2BF880A8895 mioplasmia2
1,666,282,555 *AF587359D125B2105D75041D15E7A25983AD1350 QVY7
1,666,282,556 *AF57E17B48419E1741A10084BA2BB380FD6AE87E MITCH.PINELLO
1,666,282,557 *AF51D78379906F5D3A455E2750D8035B26223C26 RALEIGHBAXLEY
1,666,282,558 *AF537FDE294E999B380B114731065E545A78010B RALPHDELAY
1,666,282,559 *AF5E35A5657FBD173A01E79318FF9E13FD6DBBB2 elvishean
1,666,282,560 *AF585DAA011C89803D00101A90AFB8C00F9824EE [email protected]
1,666,282,561 *AF5F124388BB8D1F3D7AA8762BF7DCBD82DAD0B4 RAMIROWALSER
1,666,282,562 *AF504004AC48E77F7444C58A2FB565AF5AB7843D [email protected]
1,666,282,563 *AF52FBC783B1297FACF7CE476237364F27147D7F MOHAMMADMUEHL
1,666,282,564 *AF596B2B272C79DB478A25F54145A13700C1DE43 MOHORICS
1,666,282,565 *AF5A366245A77F88CE1F994C5FE116DA8DD73450 RCARTERUD
1,666,282,566 *AF54017FC73445B9D5C92E95E054A24AD3BD3239 EMILESISKIN
1,666,282,567 *AF5E445BCE96D590602F11E2F5A4BEBFBA790565 READINGDARWIN7
1,666,282,568 *AF5F338D44675F622E1D2D57C4EE2C47756BAAD7 [email protected]@ndon!n9
1,666,282,569 *AF5FA7AACAF8C1289D9E7A42CDB8D0A557BFCAC6 morderis5
1,666,282,570 *AF5F9BE2DEE1BB68EDAB4A634629D3D8F2098AAD moseburnside
1,666,282,571 *AF54699531DE676CC5C9F2921C78C542566EE4B8 ENGIZ
1,666,282,572 *AF55E4632B9B46424F0033F3E08153A65E29B5B1 ENISOCCR7
1,666,282,573 *AF5AA2EF2A01D966F2795DE9962E2D9B5EBAC316 REPLACE1UBSIDIARY
1,666,282,574 *AF50EF5E8183E1A6B1F27449EC691F1AFBE2F6A6 RETOLERATIONS
1,666,282,575 *AF5CD80B70DC6AC84ADF2222B4C1134729056DB7 ENUSER20671151135
1,666,282,576 *AF5EEA48F45CC32BFBA05299BB02ACCF91481E24 [email protected]
1,666,282,577 *AF5E95BC3912D2D9E2B0D17BCDA85E609C70E00D MUA.TUULI.SUUTELEE
1,666,282,578 *AF54089EE028B774FBE4D80307BED8ED415E154A RHOBET
1,666,282,579 *AF5E87677351E02B6310A7C993929244ECD51611 EPICIERES8
1,666,282,580 *AF5A4452E561DC0A0AF07582CD5A6AA7FCA98AF9 RINI-SETIYANINGSIH
1,666,282,581 *AF5CB6B2315840E0A9C6FFD6BE37B6AB6B0F3164 RISOLLEVATA6
1,666,282,582 *AF5107DDE49162E553FE29386C61930BA7447627 RiverofGod(LivefromToronto)
1,666,282,583 *AF5117D09280744CC3212BBA1367923FB2839501 ROAR,Part1(LemonDremix)
1,666,282,584 *AF57467E249DB3079A7D3D793279891596D2F2FA ERIK.MCALVAIN
1,666,282,585 *AF5B87C7E172DF8742788E1575F21841E18A07F9 [email protected]
1,666,282,586 *AF528761B3ED45A4E3FABBC9125F5C2F3DC7A294 myzodendron8
1,666,282,587 *AF59BA49C849317B8AD8E415344B01FE8DF31B03 RODRICKARMAN
1,666,282,588 *AF5F371EDF8551491A3D16C9F3D8EFBC96D5ABFF ROICHID3
1,666,282,589 *AF5407D8E48B282252FBE05D2FF814FC446760F4 rollandbamberg
1,666,282,590 *AF577B13548981C8DA6F7A8FC9889AAAAD6FF0E1 ROMVLVS5
1,666,282,591 *AF55645C70E7FE0B649B5F891B7A6731E091E7F2 RONALD.OSLEY
1,666,282,592 *AF5A3C5707FD33727B8392FFF4EBD620BA63394D N3-H
1,666,282,593 *AF5E9E35CFFEF2123F90F3800214B50C9B87B152 namydlening
1,666,282,594 *AF5F59025ED923EB3A9C793BAD2785DF07E690A3 ROTAROILEMA5
1,666,282,595 *AF586768C7EF7B1450692F14E2A4BAD67DE8E5B8 ROTE LEIBER
1,666,282,596 *AF50C79915992B149287B9F0AE914DDB980623FF natalitetu
1,666,282,597 *AF5D622F5A9440129CDDD0D7F910FF5D4F2B4361 NATHANIALMANDLEY
1,666,282,598 *AF526C1D4109857DE42F582386197563F4C142AC NATHANIEL.KINGERY
1,666,282,599 *AF5D563CA4C9CAA9F4ECBD1C72F4585D1C936041 NATPHILS
1,666,282,600 *AF5F91CBCC286434E514D9BE5811E2AA02CEEC44 rubinwojeik
1,666,282,601 *AF5862C80AB555CD9288D04D10C89528C4F7F0F0 RUD[email protected]
1,666,282,602 *AF54A2D7E1858D3163F99AA86D784AD0195BC050 NÉPSÉG
1,666,282,603 *AF58DB1D11615E542580FEACBCC7B69BA92CCDFB nermien.hussien
1,666,282,604 *AF5AF98CFE19B9590D35433A235271D383CC6114 rullast0
1,666,282,605 *AF5385F9C28D0ECD203488ECC8C8679F46B4DFDA rupalinimbalkar
1,666,282,606 *AF5805A48EB79F9E74C0BFAA1F58919313A9FDF9 RUSSELLZIGGY
1,666,282,607 *AF5BA1A37FDFF77C843F936F0D62189DB240CA91 RUYLISA1
1,666,282,608 *AF5A444A80725C28B11153952077D6D706AF283E EXTRAESSENTIALLY.
1,666,282,609 *AF5A6221F41B745BB2E144713303E830CE5438A8 sal.abruscato
1,666,282,610 *AF539529E0E0AA7ABC006E14F4BF1138958F6C14 FAMPRIKA7
1,666,282,611 *AF50748C9ABC8CECF64428F92A69A4178B488D2F [email protected]
1,666,282,612 *AF5DB0A2050D13C3981541CBE2D7A5B64AE8E963 SATIN.SU1
1,666,282,613 *AF59FA8C488832C6249BA6863522F22403F9DB39 SawyerH
1,666,282,614 *AF54BED950EBBDCE2665A6BB390909A696A1F423 SCOTTIE.WEMPLE
1,666,282,615 *AF50717E7A54766A7027FAFF0C3FAF3323606353 scottshigemi
1,666,282,616 *AF50B623BB820DCD53E07093B154C7874D1B7CF8 SEBASTIAN.SHIPMAN
1,666,282,617 *AF55A80B9D6FA7F50349FCB5A4AD336D448E729A selbstentwicklungsfähigkeit
1,666,282,618 *AF535572ADEE6A79791C63828B82E9D95A409E61 semi-clauses
1,666,282,619 *AF52EA580006B8022ED34DAB99F7DD3E7C229541 senin de iarn
1,666,282,620 *AF5C187C5341EE3F176F1094880FFCF1954A9318 SHAPOOOOPAHS9
1,666,282,621 *AF54AE7D8D33FAD955B78BD7142310756603EBF8 noefryson
1,666,282,622 *AF54422D869BCF16E53CA8AB8E2AABA75DB85CB7 NOKIA2630
1,666,282,623 *AF5808D954F79C93D64026D538B066672F7D1586 felipemccloud
1,666,282,624 *AF51620E22272F96FDE68015427D7B370C6FADF5 SHELTONCRUTHER
1,666,282,625 *AF5A8D4A39D4B1A1AC08D30ED309956EFD9EC356 feltonlolling
1,666,282,626 *AF547635E006D8A769EDD3E0BEB73E8969D8DA43 [email protected]
1,666,282,627 *AF5269171DBF1359FF56F4C54D0BE1B931CBF39B SHESAIDSHESAID(MONOMIX)
1,666,282,628 *AF527F67E3CC1995743B92AC4A7AA8CB60BB8D41 FGRIBBENING
1,666,282,629 *AF5C42CFB1B2E5013947162A77073E39C96A8C46 shobhavaswani
1,666,282,630 *AF5DC54557F97A1FBC573E90C28F40565C82BFD3 SI8IL4+IN9
1,666,282,631 *AF5C7108FFA117C07FB3D0DF971B343ABBAD9F5C sidneyredburn
1,666,282,632 *AF59D18B65466A25E518C69E776BC5FEB4C9843F FLETCHER.LAVA
1,666,282,633 *AF5ECFF1D30AB9B36E8DF647F6318CD8E047DA7A flndgst
1,666,282,634 *AF58B80F88D9045FF51001C26F8C61BB51018ECE flounder (ubel)
1,666,282,635 *AF5CE63DDDAA731E17B2A8A3FE20FF328500EE7E FLOYD.JUNGCK
1,666,282,636 *AF5EC06550C394F8192E3DFC9DA6FBF6102EECDF FOERBANN0
1,666,282,637 *AF5085BFBC766736F5D87107C74784BA3053A64F .FONTENETTE
1,666,282,638 *AF5CFE6967B030C49E3ADA20415B5BA139978369 FORRESTGARIVAY
1,666,282,639 *AF52E8C806AB3C5139034E8BEF382618EB4C5DFC f)pf
1,666,282,640 *AF514766BB31AC3FF4F846C33B6B23835D816DEA NPPILLEN9
1,666,282,641 *AF5A68739964329251A457FA678FC2C38C6F2011 SMOKEYJUDY5
1,666,282,642 *AF5A9A5CD47262CCCB9A0377D133F739955CC263 frankiemanny
1,666,282,643 *AF501D801985EF8674F16B96C56C726142E717DD FREDERICCOLECCHI
1,666,282,644 *AF5DDF73887E2B334DC773A16E19DB3B4031BEED fredricdehan
1,666,282,645 *AF5DBDC96FA8851892A10C4588128635D39027D3 [email protected]
1,666,282,646 *AF5DDE65B83C9C0A7907DA0FC70F05B36DAFAFAA SNOITTAR8
1,666,282,647 *AF55504203CE97EF134947EB93D2014E76280924 O6876766123456
1,666,282,648 *AF5F7AF94BA335BB5F11036D06ED74415827E27F SNWCHRTY
1,666,282,649 *AF5711B9F040CE8F53EAB09810EA56E81D2F3AC7 FROM-THE-SCREEN-TO-YOUR-STEREO-PART-II
1,666,282,650 *AF5F2990FDFD6E8822DA9D23789679F53114A637 FRONDS
1,666,282,651 *AF556D532CC2BC7FE141618CF1C1671AE19BA502 offensa4
1,666,282,652 *AF54AA975E8AF6297D7D64077BAF3323968D23DD spencer-sandello
1,666,282,653 *AF534AE1FAF7B0724E5FD0EB8BD93640AE899EF5 OHIOSCIPIO
1,666,282,654 *AF5D7E6D0972784343D370E526EAF080207F3BC4 spitfire1928
1,666,282,655 *AF595AE1FC291AB66D276417384A4A64BFE2E1B7 oliverhettinger
1,666,282,656 *AF597EA6471CEEA11D33BA5C781894F1F2F69550 SPLITUBIQUITIN
1,666,282,657 *AF5137280C9F0FE80DFD95BA0E2F1D120C665C05 SPOTTSWOODED
1,666,282,658 *AF5CDA5A99036FEB8EDD244E4683BE5A72145035 spriteronald
1,666,282,659 *AF57226A8324B6BAEB57903ABF80D94A38AA151F ONE-OF-THE-MOST-DANGEROUS-PLACES-IN-THE-WORLD
1,666,282,660 *AF5B1E9E708685D6D2A1833F82F891D20E415C7D (O_).o~.0~<8
1,666,282,661 *AF50A1F0C37736DC3D2B039189EA15AA1DD5F8FC >-<O~-<======P
1,666,282,662 *AF5D3E737107B67BDB35A7CDD7BDF24149ADA869 (O_-).`Q=====P
1,666,282,663 *AF5D5FCD72DA7F0EFEC0DB8C73606BAA44DE753F stefanieguzman
1,666,282,664 *AF527D0AE52B0C5745C1CC1597FCF1614FF2CF95 oscaryavorsky
1,666,282,665 *AF5B62B88C1926AFE5CD0ABB848C6ECF13B4871C STHCITSTNO
1,666,282,666 *AF5BC59D18DD4BF03849EEF1A169A2013774C945 STRIKEB4
1,666,282,667 *AF54CCBE4A1FAEB90FF4669CFD516CB332EFC8DD GERINGDURCHLÄSSIGE
1,666,282,668 *AF5FEAF580C3AAFF07D1F2A546544031602B8A59 GERMAN.ERICK
1,666,282,669 *AF54C63CBB59EF0F31C0CCFDEF500FDA893EF235 [email protected]
1,666,282,670 *AF553F45833D040F22DBE9094F85831C36F92CC4 OWENELMBLAD
1,666,282,671 *AF532E40970CDC4B9C9A3AC74B206DAD137745AD [email protected]
1,666,282,672 *AF51158D4E43828D8EA00AEF5755ECBA365052A0 SUIGETSU-HOOZUKI
1,666,282,673 *AF5EFF1840079D5E512C043174115F18889BE00C OŽDRIJEBE
1,666,282,674 *AF5E09EFBF427214781046410F80D695ABEAE019 [email protected]
1,666,282,675 *AF534571CD9CF9194133EC3A88A25D6B5A8B2FB7 susan-gorton
1,666,282,676 *AF5394B4DCF6CA865AC395DED4601C5F0B92F361 giovanangeli
1,666,282,677 *AF527976DC0FE9440D4FDCBD596102A1FC04856B PÄÄSSYTTA
1,666,282,678 *AF5FD3F7BD21DDFA337C1D4CA869F9293E9A94CA PAGE.222
1,666,282,679 *AF561902E41FC32A49ACDABEFA1A3BF2C0943231 SYDNEYQURESHI
1,666,282,680 *AF5003E0A221369CF452BD0029AB93122A0014AC SYNETICS/I/'N/E/T/I/K
1,666,282,681 *AF5D8CC1EBC52229225A2AF7BC44C1BBB5C837D7 panasonicandsamsunginvestinsibeamtopromotewirelesshd
1,666,282,682 *AF5ABCC8A5CE907BB2BFAFBBBC06FBD85F9CD1A1 T1MBRERETE
1,666,282,683 *AF5AB47B45D98A0EB47E2ACE61A7817070D77B9D TABBERDING
1,666,282,684 *AF5BC1F91E44780DC1F6A8A695E1E88D2657396A TALKSTEVENALLEN1
1,666,282,685 *AF51E33A76F19E402CA139F50961B9667CAB8322 PAR7!7A
1,666,282,686 *AF59FFD218590044159576505066B0BD4B5CE20C PARIS.CHIRAS
1,666,282,687 *AF528F45ECD59A191EDFDD7DE020BE1E2DFE4034 PASSAGE-OF-ARMS
1,666,282,688 *AF5E6B362170CAE6975FC67D409BD2035A7B8EF4 GONYLEPTESPSEUDOGUTTATUS
1,666,282,689 *AF5FDDC837470FBD6A9FE8A2BEBC7A1ED9B9440C TATLIMBELAM
1,666,282,690 *AF57BDB606941E17D5AC0F906577C55812C03EED G)#R
1,666,282,691 *AF5147B535E8EEA3600621A005F2A2FC716603DD pedrituh25
1,666,282,692 *AF52635D30B36CC01FD9AC3034F33F4AA7A2C393 GREGORYREIL
1,666,282,693 *AF51101E24CAD2D3218E88FD4B9E378A04E718C7 TERI­TO­RIUL
1,666,282,694 *AF515E2B134DE320769E4248FBF7DD2218273DAC [email protected]
1,666,282,695 *AF56B999F6FB54ADEE73701DFB6779BBFAD70B5A terryholler
1,666,282,696 *AF5BFE9F74BB4C24D1F447FB2283C186D9688133 perm4eofwtp7i0
1,666,282,697 *AF59438C598D5963DA5A1ED9C87D1066E319F6A8 [email protected]
1,666,282,698 *AF531CE5974F6B85A49E6F8EB1EE71707D9BA6EA GURSEAN2
1,666,282,699 *AF5F00A3081C05574DABFAA209B72F89A7DA6357 that's.my.son
1,666,282,700 *AF5CC1F6228654226EAAA09B15AA152F7F5BBC09 PHILBARKER
1,666,282,701 *AF5AECAEE079576D655D0F1BF5CFC7BC9D429C6C THETREASUREDPETAL.COMWWW
1,666,282,702 *AF50B3E2C7ACAEFCD53DB276C447766912724DF4 The-words-program
1,666,282,703 *AF5DD6D48096695ACBF12586484EB093DA5BFC27 the.world.of.the.heterosexual.is.a.sick.and.boring.life.
1,666,282,704 *AF57EDDC0C7AD85B1667E8F0BB46E05AA50637B2 PKMN123
1,666,282,705 *AF56C4F5EE7CFF429843618A9070610295DCFEA4 THURMANGAWTHORP
1,666,282,706 *AF549BEADC02417368DAE6D246593D446910B5D3 tidskriftsamling5
1,666,282,707 *AF5E9D0448F6D55D5EE505A4CDEF0AA8A3191F8E TIGRANES III
1,666,282,708 *AF57CBF81A11581CC88F2726BC73C4EF989B9992 time-material-&-space
1,666,282,709 *AF5187BFD7F99382008A84C8E7A9AD1FD8F5AA33 HAMMADALTAF
1,666,282,710 *AF5EC47432552CA56FC6133567311EBEDA3AE785 handpompen!
1,666,282,711 *AF5E3E1D8DADC5189058AA909BE5BD147E2F4603 [email protected]
1,666,282,712 *AF5CE589F900DF665A6793FFC48FA254F0C65353 TKHWANBOON
1,666,282,713 *AF51C80E4F7055EEB43E122FB6AAF0C7D91EA4E2 POINTSALR
1,666,282,714 *AF511375C3DB1DB0B187175C21A57301CFE3F1BD TLOVEG
1,666,282,715 *AF5956B0B7EEB54B7F1CFA90B31E38FE9C262840 TNEIALUCSUOBS
1,666,282,716 *AF532CF30DEF66D5D0F2DCEC45F09498AE2ABB45 POLLENTRY
1,666,282,717 *AF59BAB4A3562CF92AC69FFFB1EC143C71E36CC1 TOBYVANDAMME
1,666,282,718 *AF58C25D1B0C2B3744D86519C1D6288A54BEE1FA harleylitmanowicz
1,666,282,719 *AF5B1921769E43B647A4AE5BA2B65C1783721F12 HARMONIA
1,666,282,720 *AF51D360794C74E7A6B7E1D671EECCAEFE2EE89C TONY.BADAMI
1,666,282,721 *AF593454967D7E5ED43A78B292920ECC9D5EA8B0 HAUTKENY9
1,666,282,722 *AF5F7D9806D7793C440C8B0FD3391DE40A5D1C55 TORMKLEP6
1,666,282,723 *AF5E1F6361318ACFDB12524781AC8200535B841A to.the.struggle.against.world.terrorism
1,666,282,724 *AF5DD956C8361DF7EFE8884FE156C9F22BD98860 HCSDNUFP1
1,666,282,725 *AF5F5AF3B606EF961173F1C92FBDA489BBE57CD5 TRAANSRAPID
1,666,282,726 *AF52647740E4168A6D6A5D2C85FD7EDCB4E14E6D trevor.xerri
1,666,282,727 *AF56B2D4148743E7DE79FAA4E02310EE695DBD66 TREYNELLER
1,666,282,728 *AF5D380D5E8F739C3F4F8B12F89767DD98FEF20E PP *)X(
1,666,282,729 *AF58167A1831C7DAC0B80747181BECF854B212B8 TRI-NHAC
1,666,282,730 *AF5C772A32E1B297EA86FAE0A624B79F0A53AF88 hello1khan
1,666,282,731 *AF5ED7295A0B6997795DC9D29DB948FF9B0C6E8B PR^ITHIVYAAM
1,666,282,732 *AF59DBCC87A4926E24E8249AC674AF520FADC192 PROEFSCHRIFT!
1,666,282,733 *AF53E0CBDC1A673D5AF7F1CE599AE22A5AEB0F4C PROSPECTESES
1,666,282,734 *AF5077FDD1D760FD317CD71F3652941122B50D01 TYRON.BOZYCH
1,666,282,735 *AF52C63D62EE6A19574C74C5930A8CA039B5154B HIMANG-SHARMA
1,666,282,736 *AF54D41CB805A0D748D527B862617E9C4FBFF65E U0:G
1,666,282,737 *AF55158DD65B328367F424E1F7A1817C8AAC1EB9 histoire70
1,666,282,738 *AF52ABA829E654D8FD042CD6BE0D5C0C3B3A4F37 HOLIDAYS IN THE BAYOU
1,666,282,739 *AF5AF5A810CD6D1A5A1974F6F34909DFD5D3897B holly23
1,666,282,740 *AF5BBB37282FC6486D9CB88803D0CB3EA54F9872 HOMER.WOLZ
1,666,282,741 *AF522D429EDE6E2173AE48593A3EF5604FA85882 qB}o{
1,666,282,742 *AF5E07A14BDE753F0FE9B4A6CE0B429C877B7960 ULYSSESSARCINELLA
1,666,282,743 *AF5121CD2D7B89A1F510D324B7C5DBBABD47EF9C HOOSIERN8
1,666,282,744 *AF5C369A085C65AE9B7E42B33F0C2286F28392CC unclasp
1,666,282,745 *AF5CA7BB9C7F2AF07591F5F17330A32737666CE2 [email protected]
1,666,282,746 *AF5E28C769561C1FB7CB166FF513E45B852BC9AF untenaciously
1,666,282,747 *AF5AD2F3CD6FBCBD29C95E145B7D60108FDED95D UPENNBSWING
1,666,282,748 *AF5241DE030306FFDC1120640A502A88F7C5BCD5 urduja.llemos
1,666,282,749 *AF577CB7E042B10D49D2A005642EA3433B264CCF us80000024
1,666,282,750 *AF5285DB726D8F51675ECED685CBAB635438C4A7 [email protected]
1,666,282,751 *AF51F0D60C485AAD0345C4AF6D20C696E281B5F0 USERACCBSW9
1,666,282,752 *AF5519F329A4B5D404EB7FB930E337E28E42AA35 [email protected]
1,666,282,753 *AF5811532B37AC9A0BCE07E1FD5EAA687D3B3670 USERSGNASL
1,666,282,754 *AF599CC9ADABE0E4C53D505F3B3DCDECE2BCB920 userの割合が多い、荒らしやいたずらも他の言語に比して多い、ip
1,666,282,755 *AF5FC9489C9EAA81150FF804612100C154CE63FD UXORILOCAL(ADJ)
1,666,282,756 *AF530204F81EC1297BCB19AC7A49817CE2670470 valentinedore
1,666,282,757 *AF501140DD7D012E98951CC030F03576580C1685 HUNTERCASHATT
1,666,282,758 *AF58405CB4D588347BF28639DFA8C6767ABF4B52 HUNTER.DARAMOLA
1,666,282,759 *AF5D3BF1A592C14D7158A629298BCA38D6C77E7E valentingrant
1,666,282,760 *AF569AFEFD4C2161D6B8DB008B392E66F81B9915 vanessaschop
1,666,282,761 *AF5C49D8F3E6BC47E247C3EFD89F15B79FB7EBAD IAMFERRIS33
1,666,282,762 *AF5395EB3E0969D569165638EB8B231617083CDD rapportotrc
1,666,282,763 *AF5A30C8318FF804F633F13FA7F3F5948AF10CCC RASHADWALLIN
1,666,282,764 *AF5273EFBBF5DADBDCDA6EF038AF78B9FD70A46E VEGANMAINSTREAM
1,666,282,765 *AF527E32B1E9B07A10E2CC7604881AEEDE8B8072 VELLÈCHOIS
1,666,282,766 *AF535BEE3E1FDB3D7C070ABA131EEB51278C8D45 VERMITTLUNGS
1,666,282,767 *AF5F1D614B82EE91FE79F5B75410631B61776024 VERONICA F NICHOLS
1,666,282,768 *AF5387A4865443B4B8BA3E48E55DC193BD059F93 I-KEN
1,666,282,769 *AF5FD33B5BC089DC99B967FA62435094C4C5CD13 victor.xavier.noguera.sendra
1,666,282,770 *AF5F4B47867DA07B5DE15E9783499C8133FA48B7 ilmcr2
1,666,282,771 *AF5DC7077FA0CA20A5DCBCE06F8645621AB9CE90 ilove4runner666
1,666,282,772 *AF5006B22A87BE1BF444F042EBBAC2FA85BA9004 [email protected]
1,666,282,773 *AF5EF48B524FE0C737035A0080A52F0E6F13C9E1 IMAGEMALNI
1,666,282,774 *AF5B6B5BB5F3D8D8ABE3F08BA29D178653B9259C IMGOEN
1,666,282,775 *AF55E1FF31B9BC265ED008517C59893790B57E9B IMIUTSNING
1,666,282,776 *AF5DF1180D748A924A1778CF4B5E0A1AD0DF4EAD VLEZTE
1,666,282,777 *AF5084ADC8E42B35B45C47CE7972897E295D91FD VNO5+E5
1,666,282,778 *AF555A894535046692B15F60039B12EC3DBC03D3 VODEVILESCOS0
1,666,282,779 *AF5E497E8A06D0C4E43A99C55619AD0A3C2AA13D VON.MEGEE
1,666,282,780 *AF5D559EA2B9E360E561D13C2B95A1A904E42037 VOORTPLANTINGSELLE
1,666,282,781 *AF5C19C45E34B63F059BA7C5D891377D1BCC0230 vosgehen
1,666,282,782 *AF5ABA2CDE30B5BBCEAC830C4AE71158E50B3EE3 INTOMETHOD
1,666,282,783 *AF54ADE63ADA6344E73B6940BB29AB056C3583B9 wacko-childers
1,666,282,784 *AF541AA36DAE21BD39090538558D587B5C3585E2 WAHAB-TAOFEEQ-BARBATUNDE
1,666,282,785 *AF514F4A8088AD320A1BC4DECF92B4A2108DD909 INVOUWDE1
1,666,282,786 *AF5E7386CA583457BE453C37C2E12429AF121411 WALAA-M-AL-ALAMI
1,666,282,787 *AF5F814716EBB56FB147207010F04721BED7B453 WALLACEMAREADY
1,666,282,788 *AF506CD93E86C181B78280AE9C7AADEDF2AA9F04 reinaldoiacobellis
1,666,282,789 *AF54306AB4F000DF35E85DEEC1A86443407DA55A I\S&
1,666,282,790 *AF5FB74E7C44CB0C7578FBFCA07E34E0183B1412 walterlantz
1,666,282,791 *AF52B653A588B244FBB1670169A9B157AD5429D0 ITARILED1
1,666,282,792 *AF53F89622FE3F7F2B882B4AE8025F7D4DC84889 ITSENAEISTYNEET
1,666,282,793 *AF58C06CE6D1DA17CB8C7FA00C888264BFBA011B Resident-Phase-Shifter
1,666,282,794 *AF57BF2B8AB830CEA5254552D69A580F3EB36C9D watch-out-(extended-mix)
1,666,282,795 *AF5AB29124403414ABD3A2A9BA6114727E434C57 WENDYSPEASESTAFFORD
1,666,282,796 *AF5951CA57A33316BFDB314EC7BC044DB486D039 wendywallercarroll
1,666,282,797 *AF553333EC8A1AE2E31D176E813768F5B6738B4E JAKESAPANZA
1,666,282,798 *AF52194B312BFFDD5BE6683E764F114579BB3532 jamaalseise
1,666,282,799 *AF56F294B279839C0A802F9CB49AD8C878B02DCA JAMEY.UNSELL
1,666,282,800 *AF58C21F3A385B3942E68A921BB325A6C2D8750D JANETTE ALCOVER
1,666,282,801 *AF5B7A969F61F39BA83578DD507C0F3CF6DBF55B WETATHOMAS
1,666,282,802 *AF59BEEEBAED228ED70C214019E0C4B5DC8E0FC3 Reszlet-1
1,666,282,803 *AF55227018F7A409B9334C2BA38412E8913D1C9B REUSED-PAD
1,666,282,804 *AF52217495909EC9E221FA09D0CAC4101E38AB5D WILFREDMANA
1,666,282,805 *AF531769A704955A658CF01DCF9F34C2322EDC88 WILLIAM.GLADU
1,666,282,806 *AF54803EE8A9BDDA3811BE35C9A13B0FAE8DF138 WILLISZEPP
1,666,282,807 *AF5D41276F20CDFBB556FD43428243A68B83B049 rhtr
1,666,282,808 *AF58AAF46792876708A20F58BB9EB1581818F5FC winfredschoenrock
1,666,282,809 *AF5D9DF17069783199C53C8300A7AC844EFFA29D rightsforwhites
1,666,282,810 *AF5765E3C7B970C9ABF1AFF081662E846AFF8823 JENN221
1,666,282,811 *AF544C94352F787BCE76E425B165C6DD3139F17F jeopard
1,666,282,812 *AF5383A9F7012817011C4ABC6E1A01E8E66C8322 JEREMY.MINNER
1,666,282,813 *AF5DA2D9A5535CF2A069BCA81ACF06ABDA10C56A RKERADEN8
1,666,282,814 *AF52CB8D7AF7B3295A9B385016FF4744ECDB764E ROBEMAKER4
1,666,282,815 *AF5FB640E152FCD53EAF7A1F40AFAC861309F1C5 ROB-STETSON
1,666,282,816 *AF53614634E361C2F2F4EAA1E96DB6D5A8C7BDD9 rodericklabonte
1,666,282,817 *AF587E49AD7F8F36F6FE0BCB1269DD29B4CA04CF RODERICK.OLEWINSKI
1,666,282,818 *AF5198B4E7C2045A035B39E86393164C0BC4416C RODNEY.LEIS
1,666,282,819 *AF5F493E66718B8D9C9EF0E993949CE4ADA5DAD5 jewellpetroske
1,666,282,820 *AF5E6E94AC0B88738D5022DE035CAC3AABEF311C JEWELL.PETROSKE
1,666,282,821 *AF54E362F3BA4104D84D0EFFC9B55BA1385D6B40 [email protected]
1,666,282,822 *AF5EFC6DDEE3D7203F4042865AA5F609D49A4258 [email protected]
1,666,282,823 *AF54C28AF6A65D663C0AFD780B05DC58ED17911D ROLF.VERRILLI
1,666,282,824 *AF5F85C809599A7C985EAFFA5C04806FAA4AC64F WWW.BOCAHOMECARESERVICES.COM
1,666,282,825 *AF5E86FCA4875AC405F26D64A3D5E6A2BF8A6227 romanchevy
1,666,282,826 *AF51E158B9D9ECFD154BB95641EE86C597FFE1E8 JIMMYBARANOWSKI
1,666,282,827 *AF5FA5334C10DF84857BACC78653AE6B74910913 JIMMYKROPF
1,666,282,828 *AF510D379FEC7AEDF532BEA2F789966350ACF0ED ronnygally
1,666,282,829 *AF5FC1A5AFAE8BB98A084E16A96ADD0F787846E0 joaniecarver
1,666,282,830 *AF531829583A5A28114B88FB46E63F172480659E X!_
1,666,282,831 *AF5C5E53385A610856DEF42E20E569B02DFC5454 )x( ~ ~ ~dP
1,666,282,832 *AF57B7EF6BEC303A625EDDEE2BCF9FEFBB99D0CA johnniesunder
1,666,282,833 *AF5AAFF4F652DD63AA2654AC370F4822245FE648 JONASRUDNICKY
1,666,282,834 *AF5FD2A75881BC60331B82782EF700C4A82912FB jonathancotillo
1,666,282,835 *AF55E0DF6B9EB9758A02F0D712111CC1FA548F0F RSCS5DJRWC
1,666,282,836 *AF505436D66AE071B25E0EA52D3886100F0BCD46 JOSPEH.HEEP
1,666,282,837 *AF5B24BDF7FBF2B4FFE5853C2A1E49993A91F87E rudżm
1,666,282,838 *AF5EF816D3D4C6BE8C29ADAFB823EA38D8DE9EA5 runvrq
1,666,282,839 *AF5A4805400CA7F97BC69371857DA677B2F8620B RYANPARKIN
1,666,282,840 *AF59CD75B60064B6218E1294433D375CF55CD476 JULIO.STRASSBURG
1,666,282,841 *AF509DA8BDAB8E4F7D3FD828656543307ABF452C juliusberlanga
1,666,282,842 *AF5FAC5357D77A0B2D653A5C9B0B0614D2EA9CEF JUNEBUGNASCAR
1,666,282,843 *AF5766B2EAA06DCA0AF4592764A5DC5B215A942F SALESKRIDGE
1,666,282,844 *AF57A919E49D284731BBB6F1987F33989E9915C8 YAYLISAZLAR
1,666,282,845 *AF518BE5A36D1BB6C931232F340368B2F4720A38 sammielessman
1,666,282,846 *AF5F5BFE970BD719E0E85424E97D753E78D1F169 SAMUALASCHENBACH
1,666,282,847 *AF5F7501A9FCD929BD122DE376FFA0F1709BBF0B KAREEMNEUZIL
1,666,282,848 *AF5D509FE9718C0537977CC7593FD8C4F431C16E samuelstangl
1,666,282,849 *AF502EFCE82B0EB76B777A1FD3C1BDDC2C45EEF8 SANFHO
1,666,282,850 *AF57E07344B034EFC23745F4E24327B4C458FE14 SANG.CREAGH
1,666,282,851 *AF55A892C3EE0E0715F3EC794DF894A51A10918A ykykultur
1,666,282,852 *AF5C72FD8247EDDF5F7DDB4AE384434172514C70 KC7X
1,666,282,853 *AF55CD4E717E48135041A3BD9515A5E6925A00E2 KEITH.FRISINO
1,666,282,854 *AF58C807127F5D212378E76499975B467D38A4C3 SAPPISCRBSWING
1,666,282,855 *AF57F8FF95707824707B456D2C04AE48E5725F6D KELLI KERRIGAN
1,666,282,856 *AF547A6F0534D160203843EBD7E73DE5CE910675 YPANAXWREI8
1,666,282,857 *AF5AC9D73E2C0EEA49FCE7128D3BCCBB26245D9C YRITYSJOHDOSTA7
1,666,282,858 *AF57C81AD1D5FC2491F9ECFF43FE5D7A55C7336D SCHAAKPARTIJEN3
1,666,282,859 *AF593A6CF747DF6E7911115F083763690355CB21 kentuckybusinesses
1,666,282,860 *AF5193C724BB7D44A07AD33D4A4992F108FE04B9 yvonne.senning
1,666,282,861 *AF5A0DE13BFFEC421C92E0F9989AC37FCF24635A YZZZRNH2
1,666,282,862 *AF57689381E25DDE933F112311AF08601E376430 ZACHARIAH PRICE
1,666,282,863 *AF51BF376478E049320012FE4B4CEC721B722FEF ZACHARY T MEEKS
1,666,282,864 *AF5FD838B7971ECA918FD7E59A0E4320ED5117F4 KERMITJ8
1,666,282,865 *AF5D88F278E6DCD8D140477E208F65F79F322D02 „SCHWARZAUGE“
1,666,282,866 *AF5BB4C125BA1A16BB790AE898561A51A29CB334 [email protected]
1,666,282,867 *AF578F5C269F069FFF92006A7CAC1D4EA535834A [email protected]
1,666,282,868 *AF56587E0E6F80634845FA2EB77620A6ADB21833 KEVINHOWEY
1,666,282,869 *AF5055B72C4B8A68416B77BBC023C26EC857EC24 Se4b1ue
1,666,282,870 *AF56B970681CFC6E4D5DD72C80326E651BF9E2F6 [email protected]
1,666,282,871 *AF50680D265890F322F3346F5FC2686AC2B6555E [email protected]
1,666,282,872 *AF5350969EA1FECFAB33E0934EDA666393F5CB17 KHILHEXB
1,666,282,873 *AF596D9EF1494F3FF725B0438CE2A4CD10B2DD40 [email protected]
1,666,282,874 *AF5E334045C3E0AD8D15E894BC130F0F45C32067 SEIMIREPPING
1,666,282,875 *AF52FA88A2C0DB5098B5A0BE0CB7EE66A8734880 [email protected]
1,666,282,876 *AF5095D71C67DAA403C0293B50E5D344D4AD87E6 ZOLBOOJARGALSAIKHAN
1,666,282,877 *AF56041D93CEF1D85A0705E12E6B2BF14964B2AA zp&i
1,666,282,878 *AF5E443C3B7D381C9D1BBBD6F6E35ED7B93F5E12 ZVEDNUTIM4
1,666,282,879 *AF5644C76488DDE13B75A39F8D706D94708DF919 KISHWARMAHARAJA
1,666,282,880 *AF5B90FEB49A3A9240FD5DA292BF1148A35DCA29 SER.URBANO
1,666,282,881 *AF5A598C070E8BE5B12F3C32FEF6673C076B4807 K},M
1,666,282,882 *AF5341EE001103BA9DC4445A2015B0DC29CAFF15 ВОЗРАСТАЮЩИЕ
1,666,282,883 *AF5051DC42E36143A8D7F088B76102DCF63D6991 войтівською
1,666,282,884 *AF500FDCE0D1F6C483CE8987FE6E561AAC3066DA KOLEBHAV
1,666,282,885 *AF5EB21FF1623F3FC54FB5E8BD23B0CF017C3E77 kondas k aa1 n d ah0 z
1,666,282,886 *AF59C8E3A80457ECC09AFF369B33D52783160E76 [email protected]
1,666,282,887 *AF5B55A299471E65047AF3E9670EB775656693F9 РЕФЕРЕ
1,666,282,888 *AF58C68DA5F7296B6F5F411524315A5E7A50BEC4 сажидовы
1,666,282,889 *AF5C0EB01D1AFAA8950ED3A1FCF9773A526A21C6 shalier
1,666,282,890 *AF590A65BC1596155C7EA79AC65E509C25086926 SHAY.GILL
1,666,282,891 *AF5E53B9D1DF131826BB4311CBD1A161DED9D0AA ШЕРБОРНА
1,666,282,892 *AF584680C8389C46BBE476C1D1B173390E6E2F25 shelbyfrancione
1,666,282,893 *AF59CEBF6D3B9D6A2071D1A3C7A07C8B4AB5D9B5 SHELBYVICTORIA
1,666,282,894 *AF5039237C7D97C80E095E10F138E3D3AD1F69F8 KUTUBA
1,666,282,895 *AF55EE48F1A3E193F1D837DEE484711CEFCAE30B KYLE.TOSTO
1,666,282,896 *AF5B837B6F6233B607F532EEC19D3883896AE79C 歴代GM
1,666,282,897 *AF5794BA17F513BD9E3EDDF6F917800AF6EFB335 shook.twins
1,666,282,898 *AF5AF125F498C2F05F51D506BA835FEC53C38ACC LACE.ROSE
1,666,282,899 *AF5D7F3A39037D1AF4387440E1C2C47872962EA1 [email protected]
1,666,282,900 *AF5FF36DAEB5068449FC138F8A27FC195E2AE350 LACYPRESNAR
1,666,282,901 *AF519E16F4B7C3BDA6E218AC52C6C5E41B23B4CF LACYSENETHAVILOUK
1,666,282,902 *AF543A5FED536D193B7205AFAF790ABD9C4DED8D LÁFIJO
1,666,282,903 *AF57716CE64B0AF82EC4F27E84CA82FCBC0AFE55 LAMINATION57
1,666,282,904 *AF55EB0429CF2982379BDBFA3D57A9A130858345 LARRY-HOU
1,666,282,905 *AF5FA940B5944F5924FC57511CD1281F94A6F41F LATÎN
1,666,282,906 *AF507F87CAD26A3EB9FCD716D3BE515B7A6D021A SLENCT
1,666,282,907 *AF5B2A3FC95F45B9CD81589F95A495AB0C483BEF [email protected]
1,666,282,908 *AF5BA3420C71CB653B61A46E703634585FA4F0B2 SMEGAL123
1,666,282,909 *AF55AC678FAE66599830F84DF43F96D6358CADCF leaveme
1,666,282,910 *AF5463650AC62B874B71EBB3A1D1DE995903E4F8 lefou
1,666,282,911 *AF50D3592AD9B466399F5C145C138DCF9F20B79F 0V3RC0MP3N54+N9
1,666,282,912 *AF57BDC13E3E9AD15817FFD03CA1D90031DB4F32 LE-LAC-DES-CYGNES,-ACTE-1:-IV.-MODERATO
1,666,282,913 *AF519C117E62C91D973211156A385E8FA19B1E4E LELANDVANGEMERT
1,666,282,914 *AF563F81315468F9DDCEE264B3173F68DA55EFF6 104362 olet-t
1,666,282,915 *AF51754DB821727C2EF4CCAC1CDD2411EA18CB84 LENNOIXE
1,666,282,916 *AF5978665DAC18F4EA587FF73C3408E213321B5B 10.JOHANN-SEBASTIAN
1,666,282,917 *AF57039C4CE3C73DBB4A3357943F64420C7105B0 10peregrine
1,666,282,918 *AF5A8AF771999EADD46F52D175B2F5B48DBAAE50 1177975 ES BLEIBT NERVENZERFETZEND
1,666,282,919 *AF55A25F7B68B6D05E4819E30210EB1B92257A4C leongpo5
1,666,282,920 *AF5DCA9EB6CA81B84C2CB05D675AA80409C41CA1 1197495 FIVE-HUNDRED-TROOPS-ARE-IN-THE-U--A--E-
1,666,282,921 *AF5D331843A6ABA318D9A997E947F7AEAD94FDC9 SONDERKOMMISSAR8
1,666,282,922 *AF553CE2BD0C4094C646DB404A433E24567C502D LESMCMURDIE
1,666,282,923 *AF59C1027B047C32E3C0FA30029C0BD2E35996A9 [email protected]
1,666,282,924 *AF5949790D32AF5126AE55C9958C27D1D43EE7B6 121JIGOWATTS
1,666,282,925 *AF5A0CBE8156275A548BE8085B863E978A7B284D 1229117 kartoitustapahtuuasiakkaanjakiinteist
1,666,282,926 *AF54E353A6F020D21F14DE301AB4619946BC67EE sonnypridham
1,666,282,927 *AF5A46CAB549C2888DF4781718085E60EEC0EF07 levi-archer
1,666,282,928 *AF58189C097730712F6568FAE71429A4F89DEC12 LGVQN4SU7HVOEWAL
1,666,282,929 *AF55BAB9E0108325D175C7B6943D3C6AB9B13377 139TMATZ3D
1,666,282,930 *AF5E16DDD504AD6C9870FD575C04B294D9FDB9ED [email protected]
1,666,282,931 *AF5C3D2BF1DEA358CA0B4955890886699B2E62FA SPC`
1,666,282,932 *AF59BA5F7DCB66534F3CC7375B1E0DE362A017AE lisnacloon
1,666,282,933 *AF5CC2CBE060C945BB155FF8BB3DE7385D12FDC3 1628TH
1,666,282,934 *AF515C78DC7EE498385CECEFD9A3E2FEA2BE235B [email protected]
1,666,282,935 *AF53775ADF14D3EE116A03C377CD96C7ACF3CBE3 sreltinhcs
1,666,282,936 *AF52DB4FA6576EEA77F10F8C200E6338D24C0C43 louiechavarin
1,666,282,937 *AF5CCB05E0D55EB5E5AEDB0CACD932609D1C66DF stabu1ate
1,666,282,938 *AF51F9FD38F3D3621FF2F420536F1F2B6C90C948 [email protected]
1,666,282,939 *AF5196B4672D4AC21397F7521F880F34336A0518 STAMMENCONFLICTEN6
1,666,282,940 *AF5ED89F4DADE7AE772D747CF7051253A9D15DA0 stampten8
1,666,282,941 *AF5370964593F209477042271791AE6AF1629F80 STARTREK:
1,666,282,942 *AF5727EABD01AF99ED20864A1800498301A5B4DE LUKHINI2
1,666,282,943 *AF5D302DF19D5415A071F3AAAEE44C151DFC817B STEELEAUGUST7
1,666,282,944 *AF5FBD5790E91A2EE84DAFD5A2C505A92E166F6F STEENBERGENSTAD
1,666,282,945 *AF5457D16FFF49C217109C80D82CF0C029FFDC3B LUNCHSALAMIMEAT
1,666,282,946 *AF560B70CC4B026EE6600788B0BCF5ABE7291908 STEEVENSBSW!
1,666,282,947 *AF5717A69755A1732A299B1794E8D4EB9945A3D0 STEFAN.TARASCHKE
1,666,282,948 *AF518279D98FB4B613351E4623281B99CA1D585F 1 einertitel
1,666,282,949 *AF56BCE2C6DE1C727C7217543957AD0250C213D8 LYDAVUTH
1,666,282,950 *AF5C15E4537D317F74EBD71645EB8E6AEBDC59B0 stepheurope
1,666,282,951 *AF5485BE487F69AD160A9EA8B0AE4BFE7E001F5F lz9
1,666,282,952 *AF566839B6171413BF7EE6E4502A55318D475DA7 MACKTUMOLILLO
1,666,282,953 *AF5F0617AA9354EE48D04B96C60D96B17B361EC0 1.KAUPUNKISEURAKUNNISTA
1,666,282,954 *AF5BA21F4637B492CCCF34218B35BD8FE049BEAD MADÉRSKÝM
1,666,282,955 *AF5E118A8A77B8173EB4BACACCC623AEB2BB27A2 STYLGEVOEL123
1,666,282,956 *AF521A0FF8977344FDC20A1F0A4378B6105F21A5 magdalena-silalahi
1,666,282,957 *AF5A2AF2457BD55CA934431B90895ED070798483 [email protected]
1,666,282,958 *AF54D49D2B40A843200EDAE1B01094829A2E942F mailbox
1,666,282,959 *AF5D8D5D72FA9D9EA24BE68E38EE073BCCCC35D2 1.materaali
1,666,282,960 *AF5C0ECA55CEF9B9A2ADAAA1C51436E267784B85 SUMIHIKO3
1,666,282,961 *AF59681EFD1AB32BFE196B1FA0DBC0240620D2BA SUMITDAW
1,666,282,962 *AF5ED0F670DC043EC5F2DB61A14DC0DB64126590 malcolmwalbrecht
1,666,282,963 *AF555F991E05351B8E0B020A89F70646DF60F97C malinden8
1,666,282,964 *AF5300CDD76656305B93FE3916193756FE9CCCD6 manthranjanam
1,666,282,965 *AF5AD80A36500C56B76052F4780D3FFA03E579A0 1premer
1,666,282,966 *AF5AD17BD06A36DC04122A26A2FF55F51BF5C5CF 1-schmieren-komoedie
1,666,282,967 *AF57740514C8557DD23270D9080EA27488EF87CF MARCOCARNEGIA
1,666,282,968 *AF5FB57FAD65F238358F35637B92EBB380EA7936 1SUCCESS3
1,666,282,969 *AF58CAA0A9CE18E53B6D7800FC5B3615277A7F10 SUTELLE5
1,666,282,970 *AF570F632AF980F38E345DEFE4034D83FCD605BD MARKTRUDELL
1,666,282,971 *AF50B51D6096B49CFBE668965C9FFA74794640B7 symfoniczna
1,666,282,972 *AF5D00D16225CE9B44D8FD8DDF248FB0A6823498 mary-fankhauser
1,666,282,973 *AF5BAE5911E42999FFD970562264DBB9D26F137D mary.mckie
1,666,282,974 *AF5FC36FA41F0B1117A3DC5FDE574990246ABE6C t3ss3ll4t0n
1,666,282,975 *AF56908CB6517E985A18307659E0B588D9BB6AA6 208SHAYLA
1,666,282,976 *AF5F3D2A09193F8A6C6A7AB927C27919BEEA955D TAANARG6
1,666,282,977 *AF511AFB0D29364F351D329171EBE9FB66DBC2C4 2133648 HE ALSO SAID HE READ ALL OF THE TRIAL TRANSCRIPTS .
1,666,282,978 *AF5A2212F052DCA351FA0033E493DD5C1A73A0E5 MATTHEWCHOR
1,666,282,979 *AF5B4D9016F6F72B20AB1741B62DD5FD3C2444B4 takesideswithjehovah
1,666,282,980 *AF5420A7B5E2AEF9D9AAACDB6CF31A2F921D3783 22APRIL1482
1,666,282,981 *AF5B5B815FC9ACF9BD7CD099AF1ADB409F7A7CC6 MEDIATORIOUS
1,666,282,982 *AF5B95FD1BE50521DFBBD7067DF0C30591690D92 melanielaura
1,666,282,983 *AF5BB4098A3C6C31925688BA46B40AF61AA8EA48 TARBINTAR9
1,666,282,984 *AF56B012513524D7D9E495370F1FBB29F923871C 25MAKENNA
1,666,282,985 *AF530582E3C1A55F2BABDF9F1AF0C6AB4D902CD4 TAUBESCHEN
1,666,282,986 *AF5E2ADB7E0D346B4367534005FBA0664E19D79B [email protected]
1,666,282,987 *AF537D908CE6C24EDA1DCA7CF22B4DADFCF9759C TAYLOR-TYLER
1,666,282,988 *AF552D703D00F8B9D546641F5C7300ABEBDD38F2 mexican.death.horse
1,666,282,989 *AF5995DF3FB667572FB9E7DAE56939DFEE3D6570 [email protected]
1,666,282,990 *AF5FA7D8F4693453153EF43436328353BDBF77CD 2964194 DASERZEUGTEINGEFUEHLVONKONTROLLVERLUST.
1,666,282,991 *AF52C5A12DF64A0FB5C2CCBACDB077DF008A8994 MI8HIS
1,666,282,992 *AF508F5598C2D2089CDD3DCA3A9D2514AF3456AD MICHAEL JON SMITH
1,666,282,993 *AF576F235C84F754FB203E7BA1B5EA6C8E10B3D7 2986335 mila.kajas.jututtaa.urheilijat
1,666,282,994 *AF5EDDE935F566AFE162F3C68539C57EF2857346 2.CHEMIKALIEN-DEPOT
1,666,282,995 *AF58939080723F7539FB1FA5E05F526BCEEF5A78 MICHALESAMOK
1,666,282,996 *AF54FA22E666470E8383F618E7FA3F1F89D396BC terrenceconsidine
1,666,282,997 *AF5E41EF7D3C99BCDA78D58E509C19CB4AEFA90E mike-prat
1,666,282,998 *AF517829146BEE999D16750E07791D8B37A983BF 2IDAJETE
1,666,282,999 *AF50B12EE2891E3733859C5B31F6C9CF88AECDF1 MILI+4RIZES
1,666,283,000 *AF5033977AF29CCA85D5562E4C309B112E342FB5 thatbernie33
1,666,283,001 *AF5D83B44FCCCC1A8C67826D3621A38906200394 MISS-SWEENEY
1,666,283,002 *AF5F3E4B9C3A0EFA23908E0CE858C75FB916089C MKOPLAU
1,666,283,003 *AF5EE1DBFED1EF909396CB35FCBFBEA5FA7E13D9 3078 uretim-isletme.bolumu.baskani.kemal.akin.ziraat.muh..
1,666,283,004 *AF50C5DDB5FBC7C50106DE9F9D1E780A147F5ABD 332346 aliaga.bir.sanayi.kentidir..
1,666,283,005 *AF535CA0BEAA55F82B297E78B17197A80747B0C3 [email protected]
1,666,283,006 *AF5C6C3D9FF0BBD31AE40B3EE9967E59749623F9 Moda.Mulher.E.Bebida
1,666,283,007 *AF57037DB5F11E335DEE4AD35A4961B2C3418FB7 MOHAMMAD.CHAMAS
1,666,283,008 *AF5E0B8510686D35F9EF83E55AF02124E6BA4549 THESILENTHOUR
1,666,283,009 *AF57B69175E35506E2532CA716145BB6692CE37B 3B<O~ O~(====P
1,666,283,010 *AF5A2D0D8978C904C74733BA934EABCC4C115CD5 thislove(albumversion)
1,666,283,011 *AF5BFC23F2311600F6C7CE22FCF852D76F21D894 MOOGLEYB
1,666,283,012 *AF573AAC4039F85447CD6AEAB03E93B381EADE75 TIGERTONY20
1,666,283,013 *AF55BA599385728B34BD4A7F25372C84EACC8CA4 TILB4GESK
1,666,283,014 *AF5B983093B868E748F9D0F66DD792C9E00D50FD tneveretlifx
1,666,283,015 *AF540E421B4DCBA1AD2B1D907BFA5537F1C28773 3FAINTNESSES
1,666,283,016 *AF5C4DBE7643098F7BB7345E2226221CDAA8ACE6 3fb3d04fd0db3acb8b5edc7fbc74b0c4
1,666,283,017 *AF57A9E6BE17EB618C1B35EDE0CD00905A18AB04 mosheburdette
1,666,283,018 *AF5EAAF84B5C2215B9F996A4BBCCAA31E2E6B5A2 moshecullars
1,666,283,019 *AF5B3B3C6FEB30E1770F66AC251CADBBD2AC0963 TOFAGSORDNINGERNE0
1,666,283,020 *AF50BCC98B4D12F51683136E9719B95F03A9B757 TO MAKE COMMOTION, AS FULL WELL HE CAN,
1,666,283,021 *AF51E6077805B98D41F0FD8601D828225096EEFC TOMGROSCLAUDE
1,666,283,022 *AF50BBC78B3347787265744EA722E130BA24E583 TÒNE
1,666,283,023 *AF591C5DD9DEDB78EC0204E90DBB59783EFB3040 TONEYVAUDREUIL
1,666,283,024 *AF5E8A74687A67F7953BD0BA22B8B4F1DBDA10FF [email protected]
1,666,283,025 *AF5347CC5FD85AFECCD2824F211120A753E6FFFD TONYSAGRERA
1,666,283,026 *AF58FA9E1F63FC4562C0410086FD7C01C93F1650 MUNISHINDERB
1,666,283,027 *AF5C7B0810926FF02EE51E9B35751BA9DB740113 MURRAY.GOUKER
1,666,283,028 *AF536F1729DF1830F20A34B63F1C86CFF5801DD0 mwachiko
1,666,283,029 *AF532B406F956F05CCC100FA6EB6967E8C903993 44S3ANT
1,666,283,030 *AF5DE619F89456486658B106B4CC9C0636149D85 myrm1d0n
1,666,283,031 *AF5CADC6176F15A9668C2B5A716406EA23F75FF9 TRACYAMIGO
1,666,283,032 *AF569377A65735C7DB20BC250B9A7BD7E404756E 48V972J
1,666,283,033 *AF5A3BACA58C46617F9BABAA2526EB08A3EC7220 trafilatore
1,666,283,034 *AF5C14F786C91211738CE65502D01EF975D76529 4ENCHEUE
1,666,283,035 *AF59553E9A90F6C80ECDF45266E309B7AF2199C3 4INGOMBRAVOS
1,666,283,036 *AF52B7DBCBB354E9C534647F241EA978002E6B87 TRINIDADCADORETTE
1,666,283,037 *AF50A4F639B4C3FF535EEE33BCF7FA2775A3C233 nataliav
1,666,283,038 *AF54179F791D5E16861ADF7BA9E0F254A58EA25C TRISHMATHERPIKE
1,666,283,039 *AF528D6EDD74DF1FC19F120A41A869D63FC0DF0C NATHANIALARDMAN
1,666,283,040 *AF5060C5295B86E4FF9FFBECDAB0EC695B8AD621 TRIVANIA POONASAMY
1,666,283,041 *AF51B7D6D8027972E3FB1D7F3741A0EB9E12C66A nattfinn
1,666,283,042 *AF515F9033AC0C3200E88E190ED731368BAC1861 TRUMPETLETMEIN1
1,666,283,043 *AF5A819FD45E1A20164C1332334897F84C023292 tsephun's
1,666,283,044 *AF5AE6E20CAE8E295EF19674F87C16743013CCBB [email protected]
1,666,283,045 *AF5C91D99F2AB88EB9FB118936DB231E60E3D3DB [email protected]
1,666,283,046 *AF5ECA3633D58BE867C18306FA348AEBF9A683F3 4PROTLAOVAT
1,666,283,047 *AF565332AAB29CD9E91EF9F29063F801C49E32A5 nedlemaz
1,666,283,048 *AF54E8B350DD196197402823B2AAB1CCF4E661AE NEIN, DACHTE ICH
1,666,283,049 *AF539D97D7A3AEC07D9C968217BAD32C7EB4AAE5 4SKIBAKKENS
1,666,283,050 *AF5106B7622AF77C3B779349A1A5CEE32788F10C NELSONALCARAZ
1,666,283,051 *AF575F36356F3E67107423123F6A58C7037A3F13 4TH3RO5C13RO535
1,666,283,052 *AF5875257D3E263017CBF98CB563C205303BF72E NEVCANB
1,666,283,053 *AF513380533DD828BDB02F7CDCAFA32B0D6930E0 NEVER.KNEW.LOVE.LIKE.THIS.BEFORE.(SINGLE)
1,666,283,054 *AF5551D20477AECEC4043E08A3EC0D33D7EEE4E3 4VERSTRENGELS
1,666,283,055 *AF51A228716755690CA1104F5CD4F0C53D0E01BE 535T
1,666,283,056 *AF51ACBC0010D8D4AC1CD84AD7C81AA6E3849C8A 56.GEHAG
1,666,283,057 *AF5C531922B0876FDD767F9D168F67C2A8A97CC8 TYSKENTELYTAPOJING
1,666,283,058 *AF586F5632A1FB0EF0AE6B9F90B9F6675D2B0117 TYWONJI8
1,666,283,059 *AF528A67AB5FE4F54A80DAC38092848535C9A7CE 5AARAKKAM
1,666,283,060 *AF53727F8BC73525A067C72E9BFFB4CAA1618616 UGENSKAI
1,666,283,061 *AF55C12DC085FB62D8F90F2CE3C3427CD4730DFE nicoteenlove
1,666,283,062 *AF5B384AA7EF2B486A43A09C768F78E85CFCF99F Uncur+aned
1,666,283,063 *AF5800145B4EA51CD059F3AB978F99F1AC617A94 NO-HAY-PLACER
1,666,283,064 *AF580E6F2A8FFCC4B53966204AE1A394852B2FF3 unienritari
1,666,283,065 *AF576A175A88AEE86F63562042522980432542C9 univerve
1,666,283,066 *AF5163554596925D09D5FBBE0895143600CB6EBB 5MAVERICLOUIS
1,666,283,067 *AF55B08A410F4F4999DDF939C98A9299F1076980 [email protected]
1,666,283,068 *AF58171633468CA2B8EBC921C7DDB5B913D7706D NORFLECTING
1,666,283,069 *AF501595075645FB8943D65D506C92C0E3B68D15 5PORTULACACEOUSA
1,666,283,070 *AF50FBF7135C0F2754E84F264BAB65E9185535FF 5SEPTEMBER1672
1,666,283,071 *AF53874C41964365BDC755A0B93C63A14E1ED0BA [email protected]
1,666,283,072 *AF51CF24946D3EE3813FC74BD80B31E4ED16DF71 NOTHING SINCE THEN
1,666,283,073 *AF5B7D5A6F825F83D4509FCA3C7DCD6A9A39AFCF upstared3
1,666,283,074 *AF55922D35C17C26A534ED05010DDF5667614F65 ursulaelizabethlavallee
1,666,283,075 *AF5C1E98C5E64F784C85035FA1337E0EB746C387 US160PATENT160470174
1,666,283,076 *AF56C8A02E68FBA91C138965D74A49B7D0070759 NWOTEEBBED
1,666,283,077 *AF51B761E3B40FD551C6D46D2D39B27676D0DA51 N/YW
1,666,283,078 *AF53FD03E39F8EE479C811DBB6051B4577B9062C utcより作成。
1,666,283,079 *AF5DBE3EC24FFBB3AE739C14DC7F123F91378B33 6CYCLORRHAPHAS
1,666,283,080 *AF5135C8C1EAB63A9F70BD610145A4195C931CBC OCNISOARA
1,666,283,081 *AF522D119F4EF84A39938C95F83C6DA2E10C457B 6FLOPPYLAUFWERKE
1,666,283,082 *AF583D4A7963A10D7E7FDF1C30F0362529604743 6HALAKICS
1,666,283,083 *AF51185D3D2E9306E42A355366D123E81313B60D 6ILOICCILLEP
1,666,283,084 *AF5C19EA8B3B3DDAF83B65F9BD80722DBFD56459 6JABESHGILEAD
1,666,283,085 *AF5E06514CD0A6C0D85C014C94974AC5980D374B OFCOURCE3
1,666,283,086 *AF5A3CACBA173334E8F0DB035F47CC0AC4F69C27 6POSTSPLE
1,666,283,087 *AF534C16C53518640A123A01E397D31B66683111 6PRNSNVLG
1,666,283,088 *AF5E35B25447B796A73E57808EDFC5A088E046C4 6REENNOLEHCE
1,666,283,089 *AF5B92E7D82B4D332AE877B71483E2F786CCA1F9 6ROCKMARGARET
1,666,283,090 *AF56C0B5AF84C7E3076954526F2746DDA090EAE8 6RONALDCINDY
1,666,283,091 *AF5056AE105DFFEB370CA7E86944C14BB446E289 VERKRUMM9
1,666,283,092 *AF54524F3638EB3FF3F85C644B9071F01E539F74 OMGIVELSERNE7
1,666,283,093 *AF5AC04BFB4475053B7E1B1C169114D9AE013729 6VOORPORTAALS
1,666,283,094 *AF5A79058B02EC48AC477343C1F5AA1ADDF1190F [email protected]
1,666,283,095 *AF565482D12D3417A4A012DE50EB792AF4EB0F40 7-12-83
1,666,283,096 *AF52EDA234E8517549073EE6AF93295878A61B67 vicious-love-(paul-adam-walter-remix)
1,666,283,097 *AF5BE21E4D637F293809590CD8CE0CEB38CFC8B3 VICTOR.FLERAS
1,666,283,098 *AF5E7E7537859EC7C147EF6A0BF86D0704A40B75 OPTIMISTISCHER?
1,666,283,099 *AF52CE7A2AF982511E7EC68C028A1DEF2EEC4EDB ORVAL.CUSTARD
1,666,283,100 *AF5E33665FE6D385A9D906186304DE97C5956EBE VINCENT.THIAN
1,666,283,101 *AF52FA7FB4732B0D55B69AE3ECA948C722D5C699 violamcdowell
1,666,283,102 *AF56EC6D06C3FF42D16C91F70158842447592DB4 7HERCEGBOSNE
1,666,283,103 *AF589629A72F9632369E69CFAB2BDD842FF5A842 7indacht
1,666,283,104 *AF514CD2199E6E59112492A9D3496BD87DD02606 7KRAAMHEERS
1,666,283,105 *AF564E348D42A28822DBE98089DB423D1C61CD55 7LAITETAAN
1,666,283,106 *AF5D6C96138D4910E121589B226FC4B92A5ED4D4 volcir
1,666,283,107 *AF547E558A2477354C395203661DE5A229ACF15D P53BB
1,666,283,108 *AF563539ACA0DCEE2F762C3ABD7917F13DBE5148 PACKIRD
1,666,283,109 *AF529D8608040BA033574D636045155732B9A7A5 [email protected]
1,666,283,110 *AF550C09FE46E4E2A3F75FBFFB79B615AE288BF7 PALMER.HOCKING
1,666,283,111 *AF57CE0AEBCF8D78259CBEAB9BC616A8E2B866D6 PAOLO SANNA
1,666,283,112 *AF5306C3BBEE1C0D9467828D7F52EDAE2CB30F1B W53403110
1,666,283,113 *AF5AA73811A70278A2974E0475C44371586C5ADC park160when
1,666,283,114 *AF5454D65DA608CB3284B1E279B088B8CE58D335 parkerimbier
1,666,283,115 *AF57105E7E99B5632D38A85D3D685D2918D2F695 7 SCHIFFNER
1,666,283,116 *AF5F017E55C689CCAE9135419E36466A2494DD54 PATHODON
1,666,283,117 *AF53F0E1FFADC1D4228199623364916F92625668 PAULJANZ
1,666,283,118 *AF55FEAF1BFDBD905B2266942681D49F466550B6 PC7OGRAPHS
1,666,283,119 *AF58593A0A8616479179F3B8B7DE13339532CA57 warnerbilbo
1,666,283,120 *AF5739A7601E2D99384AE0C886C41C8951F49A43 [email protected]
1,666,283,121 *AF588FDDD89388E64F432FAEBF520A694B5C0B23 PERRUDJAGL
1,666,283,122 *AF599E0DF3C0F0A4686086AC835284D84998289C [email protected]
1,666,283,123 *AF52D8FE8A5ACDD0818566C190ACACE256145362 8GESCHRAAPTS
1,666,283,124 *AF5CF0495F23BA3FCBC1F760E0D69B58A7BDB620 philiphowe
1,666,283,125 *AF5A44D5C2AEA820A729C8C6B97FB840D21530D4 werkerhaltungsarbeiten
1,666,283,126 *AF547C6358E08CAF16E7900707084E6E7668C5E1 WERNERREIMERS
1,666,283,127 *AF5A8BF1AC49A4D6E14296F9DC07D0F3AB3F85F1 [email protected]
1,666,283,128 *AF59361034D2DED35855A3F363B4D0AF15F6A9AD PICKLEHOMER
1,666,283,129 *AF58D222D3402561EF3137005083E02FE693E0AC 8LITTLEHORIZON
1,666,283,130 *AF56CFDFF0B333E49230F4F7027C1F68D57F71BD 8MAPYYNT
1,666,283,131 *AF5CBEB98918CADCD4C5A26CA2EDF9E2595A586A pi[email protected]
1,666,283,132 *AF5B1043F8BBEE92198484D9F28BBA032CD8B7DB 8MINEKHAN
1,666,283,133 *AF5C7C10D1B6A8BFF7C76C458A399A59C6A352EC 8MOLSONMARCEL
1,666,283,134 *AF57D8C6F501BB4D1B719D10A25388F458C21857 pinnh
1,666,283,135 *AF54C1B8CEE4E5A083458A93302866BF2AD0F7F9 PIROSCA
1,666,283,136 *AF53F24866066031976D7824D79362659E5AAFAE WIESENZ
1,666,283,137 *AF56661FD173CF0AB55243221D4D1112CA848ECA PLEITSTERS7
1,666,283,138 *AF558E11BAE7B03E98B53E530D4C7D8CB11AECB5 POIROTOED
1,666,283,139 *AF585357FDBE19C5EE46F12F1A0AFB9A64BAA64C william-projimo-tojeno
1,666,283,140 *AF588A8B3F17398E5681BF3E66C0E8DD4A539C11 WILLIAMS.QCARYI
1,666,283,141 *AF530C4AA7E50B522955E6C32933F35A166B3207 90903 VERLIERER:THYSSEN-KRUPPFIELENMEHRALSDREIPROZENT.
1,666,283,142 *AF5973E35473DF94BD9A3D57FA51B588EED1B8F4 Pony.Up
1,666,283,143 *AF507FA64685FCE40AF0D99F7604B2DB4CA54609 927110 ...KAC.DESEN.VAR.SU.ANDA.PAZARA.SUNDUGUNUZ.?
1,666,283,144 *AF59795DD9963231C023D64A0FC5D1D5AA9BAB14 willydonna
1,666,283,145 *AF5E2211B6CC6DC58CE741C8870F90B172F0E3BF 97ONAAAAIAAJ
1,666,283,146 *AF55D9AED3D34E348B0D4E1177A0BC995BD5FAC8 [email protected]
1,666,283,147 *AF5F14E2D61DC8EC4AA134A7EAACE7FE8777EF94 p------p-~0-~o->-<
1,666,283,148 *AF5E92911865203D87CC13C834886F705848D988 WITCH-BUR
1,666,283,149 *AF57B23220ED8EB6BF9EB241E83EA05F718C7125 wjab8hmin
1,666,283,150 *AF55F3C5ECC9BA5FB87F8452751BCF14EA3E1A40 9GIMCRACKERIES
1,666,283,151 *AF5D90E45044113F02F4D6A4B84E030B92A71921 9humblest
1,666,283,152 *AF5FDF18E5C78686DB088FBB52CE71BC9DE944A9 preskill)。當時的命題是,奇點應該被黑洞圍繞,但沒有被黑洞包圍的「
1,666,283,153 *AF52847F0C6D7F4E5F45B2B40FD29F07EDE6A092 [email protected]
1,666,283,154 *AF5D9B080A6E46F19A2A948904ED0ECC94CD580D 9NIE3MFM
1,666,283,155 *AF59778EE0F2D3CD527BB8F0E865FF8D7AA598B3 WWW.COURSES.ROCHESTER.EDU
1,666,283,156 *AF512897757D6A591881116C4CFB1177CA3C058A WWW.JUANRAMONJIMENEZ
1,666,283,157 *AF580C9A002419E892E3D223629373E034CC5EC6 www.tvcalling.com
1,666,283,158 *AF5B4BE803783A187E7CE9462B272E200F317920 [email protected]
1,666,283,159 *AF545055E3ADBB125CC34E778A0F8C7960B3049A WYATTRICKERS
1,666,283,160 *AF51015683B25F60FE59554313584B937422C467 PRSNLZNG5
1,666,283,161 *AF53D96EA7389D012875A9536AF476409A812FBB [email protected]
1,666,283,162 *AF59637BE8BF822FF957208861803DE4F39EDB73 P?YM
1,666,283,163 *AF54E784F44E014A674C1418A881151B683D2082 qdigsdancers
1,666,283,164 *AF5BA059AAB4FEB8448D0F25ACD09249FE7319CF aab+r
1,666,283,165 *AF584459AF47BD1D86FE0969F6A3F2314995CE25 YAMAHAPAT7
1,666,283,166 *AF505C7C8015DEFB70909E4CE8B3FB90A39FB1E4 quiddicth
1,666,283,167 *AF5A38C987287CC76D8CE0173239C0D7F4A77FDD YEDA.ADARNA
1,666,283,168 *AF5FB507E82376F64AC244007C3A4652B7FBDC3D YERALDI.TORRES
1,666,283,169 *AF5230AED8B399D04BA5E9150E443C107C720D12 RAMEUSE6
1,666,283,170 *AF5006313093AED416D29C0524FD883809A374A5 ranaschultz
1,666,283,171 *AF57A69CC0CEBD553BBE0F31A4B9F5C04FCD9D03 RÁÚ
1,666,283,172 *AF5364CB8BEE7C6044F86CE0DF7B590628452D91 RAYFORDBARTRAM
1,666,283,173 *AF50064021D0D8310F663C03E68BFD418DD8F872 ABSORPTIOMETRIC?
1,666,283,174 *AF55AE71D240159D7FCFA99AC6A808D5C5B08564 Rebola.Xuxu
1,666,283,175 *AF574FA9AE707AC120306839515D763D043BC9B7 ac5!e
1,666,283,176 *AF521F54FB8AD0FDE1889C0305E8ED82B9293F54 [email protected]
1,666,283,177 *AF543AFC5F8C77E0314FC552F194F08F0C2F9AFD REGINALDRISE
1,666,283,178 *AF5CD732E980E271717B4A4E184C2917B144ABD7 acm$5
1,666,283,179 *AF5BAD4A95D55A84BA3A0FC2B8D6AC497B4A532D RENECOPONEN
1,666,283,180 *AF5E57D851389591CEB8D94A9CDC291A95285F50 adab
1,666,283,181 *AF5FF851727A19032A3DA224639076BB4C7CF152 researchdrizzt
1,666,283,182 *AF50C3BE98BC7F334069414DD7DCFD1C353ECA42 ZACK.SCHUFFERT
1,666,283,183 *AF58A180791E83E2D50AB3C5FB4C3ABF5F0C3803 RESOCIALISERINGSINSTITUTIONING
1,666,283,184 *AF59BB80595F68EEE857B496B55008AD17972B65 ADENITE3
1,666,283,185 *AF52AFCC5B6BEDDD0F28075D8870A1F491F95D37 REWLINGS
1,666,283,186 *AF50F295BB8B7ECBC814DC768F8A03C9D937D7C5 ADOLPHFRACCOLA
1,666,283,187 *AF5C919939C7D667EA67F836B8E9B5D8272438A1 ADPM
1,666,283,188 *AF525DC4609C74B7A7D03CF299E2F725166D0E75 richbridgford
1,666,283,189 *AF558E9DD95D80CCA148274BBE80F4FBE91B0309 RICHGARBER
1,666,283,190 *AF52EF4083AF2431D4282DF7DFA226F8AAEC589E [email protected]
1,666,283,191 *AF5D7544B685F496A830D88F21C757FB265B67FE aeebv
1,666,283,192 *AF56E486EE50A263254FD8E071B885CB133CEF6B AFQJCNGWZXB3
1,666,283,193 *AF5B032E941B677A3642FEDA464EA18632DBD796 RLGは超低速回転において機械式ジャイロスコープが苦しめられるロックイン(LOCK
1,666,283,194 *AF52E61C5524A7F1CAD0532A72232E8BCA1E2655 ziko-messi
1,666,283,195 *AF5D6BCEB839FC1F26C5991C2C5D0926E1820E0A A(GAC
1,666,283,196 *AF5FCBB8DA316FE486053FC140C42FDCC216CB5D a+i#-
1,666,283,197 *AF5930FCB3D8FCC0E6975501AD173D9E54D108D5 aihbc
1,666,283,198 *AF557C63869180C3F4596A13CF0FE9942D66880B ROELOFS3
1,666,283,199 *AF5CCBF09BB3E6B0FFE74A272540138904EA1015 ROGER.MATUCK
1,666,283,200 *AF528EE6000777A21C219194797EE24E467D9190 ROGERPACHECO
1,666,283,201 *AF59C09DA069F4EDC18C3D409E9ECFF1E4A262D7 AJ-HEDRICK
1,666,283,202 *AF5A0F73CD8D6D49C224384A30D0BFB4187CA16C ajoh#
1,666,283,203 *AF59A0009FCDCFDFF68A2B4275911706FA7D68D3 ΜΠΙΓΚΌΝΙΑ
1,666,283,204 *AF5F52ADDE28627FE96E035219B72BD95A1D7B49 ALAN.CONDRAY
1,666,283,205 *AF54E2845664E9ACC3BEF998F8533A9D709A5D69 alandfr
1,666,283,206 *AF5FBCBB7B6F43452CCE67740FA62AE34482C268 ROSENDOWICAL
1,666,283,207 *AF57AC3165425D67DB415B33FA3F124E551BB0C0 ВАСИЛЬКОВОМ
1,666,283,208 *AF58439E5D9CE2CA937CE869F91053B3C4480A6C ALLAWDAC9
1,666,283,209 *AF57E69BAD49C687A48490E290C5F9C5F530C9EB НАДНИКВАХА
1,666,283,210 *AF55B43C3A9242846C20354C3167CE092DE1A293 RUGFELDT
1,666,283,211 *AF5A6A24F4D7AF1EAD6F838AB937A603F9F2C37A НЕОДНООБРАЗНО
1,666,283,212 *AF535AE5743839052EAAC7364BB8129BC7B6151B RULLASSES9
1,666,283,213 *AF5AD980B0995AE8841529E457E7900A9C85EB1B rupertfinnell
1,666,283,214 *AF5CE5F5C92EE3A373CE7644DAE7F8EF15552C84 ruutlucrebbur
1,666,283,215 *AF5EB6F45D3A217BB7FD653CC8E4F5EE50FF4620 amadoloats
1,666,283,216 *AF5C6F5F8A9431EDC6FF681859B606F7D702C89C S7Q6UIRR3L
1,666,283,217 *AF5B32BF764DD582960105208BB75BBB2F08A9A2 SA
1,666,283,218 *AF5257797AE3F6633F141EDEFD9B67F538C6B7BC SAMANTHADAISY6
1,666,283,219 *AF549EAD26558BBC81E1A1E43911FE42731EAF78 samanthadora
1,666,283,220 *AF5840B61EDE88046F8A59C53C9AF22911D8E0B6 SANFORD.WECK
1,666,283,221 *AF5C00812B696937DD6190ED940B3D5BBB2AE811 ANDRESBESSIRE
1,666,283,222 *AF5C5A261054E52D47016BBB841A5BB506D89268 SANGRIA
1,666,283,223 *AF535A9332DD94006DA4B20BCB3181FAF25BE2A5 santosiprasoeuth
1,666,283,224 *AF517CCC34D29C51340A7016C011E815B470AE64 saporogischen
1,666,283,225 *AF5A35BAD4A548E3B6B854C12277A1115C5165BF SCHEIBSCHLAGALM
1,666,283,226 *AF521AE5B0A3D503667549D34A2218027A13A919 ANNE277
1,666,283,227 *AF5BC44E81ED1898ADCFCD9AE3D5AF34B9262267 ANTHRACOSIS3
1,666,283,228 *AF5C2B56B4B1776543CAFF724861B338BAE5A41D apm+d
1,666,283,229 *AF5C03A5B1DBFD034FB770976C3ABB8DB7A65409 serviceraptor
1,666,283,230 *AF5BBC45A7400BF09BC5DA7DD9A78DE312FCF77A SE.T
1,666,283,231 *AF5A48A7C762937D8FD0F59128B4C0F2257AD35A ARMS—ONLY
1,666,283,232 *AF5F3B5C91AC6EC455AE5172D2627B4E9C89010D ARQSC
1,666,283,233 *AF5AF2F1390CFA6D47E0CE0ADBF2331F558606DF 収録曲は、「crazy
1,666,283,234 *AF53A6CEE424DE81491BDC4B93FAFEED36C3B522 SHAWN.THAO
1,666,283,235 *AF580F8C33548BE27C08272B52C87E2E212769D1 ask.me.why
1,666,283,236 *AF59FB31CAF8DAFC5E2B3A2DD34D40E0B6F377C5 ASWF9
1,666,283,237 *AF5662C3EABEC21380D6F519B06192564A53818A 専用機としてよく知られる機体である。従来のf型と大きく異なる点は頭部に4門の
1,666,283,238 *AF50EF9F1398F242167C1EB16B98EF5D8B1B669E SHRIRANG-PARALKAR
1,666,283,239 *AF50159B1744A69653107FCC1628EDD81AA515A3 a)u7
1,666,283,240 *AF54D74DB704F34933A6A0BA7B6406AD5818CC67 silassjodin
1,666,283,241 *AF5DEE08A48E3ECBDE4FBE64B361133718192B18 silliat
1,666,283,242 *AF56E5041AF03714CF5DEB0F3CEAAAC1176DC5E2 AUU3P
1,666,283,243 *AF5D3C0D25C370FA5CE1E9EE4A3846F1BB8F3367 SKIZZY66
1,666,283,244 *AF5015C0B87F62B44D887648688676DDED7308FA aysiket9
1,666,283,245 *AF5E4D8A282C26A349C54FD2AE840F0D5A9E1DFF b1f7m
1,666,283,246 *AF5A433947DBF68C0CA75AD04BD7098B5778E3FF b4pzr
1,666,283,247 *AF5FFFE0DBE57E72C2724C07F2846F45C8F71266 SOSTENERANNOS
1,666,283,248 *AF5C245DF7295FAF7419493771F09CC6983222C0 BAGBUNDLING1
1,666,283,249 *AF56F19860A56D778510051D584BB0344D20A9DF SPANDEXPICS.DE
1,666,283,250 *AF5BA204D1256624A2F402C3796F8F611E5778DD SPASST(TAIJASONCLUBREMIX)
1,666,283,251 *AF57F755F44811B2672B75AE05C1D554A6655411 SPILTAUE8
1,666,283,252 *AF57602F0B08ECCDBA72631C3866B4FB26129160 splat!!.0~.q#B
1,666,283,253 *AF59146FAC9B0B290B59F5D3629CFD754F81D17E BATRACHIATE.
1,666,283,254 *AF55CDCFCB3E5631A8E9E095F073A3015A6ADD99 SRDJANJ
1,666,283,255 *AF554F6A461069997E8F06530A477D6450EF8D24 BEDRÖWCT
1,666,283,256 *AF5556ED6E9072468E2934A9422D498ACA96FADD bedsidemanner
1,666,283,257 *AF52BA9BE755F0794647EFA7F71B2BD2A0EA47C1 022adriel
1,666,283,258 *AF586C9BB79A5B439B4BF4A3EEBFA5AE2F4C29CA STEELEJESSIED
1,666,283,259 *AF5C2057EF055A30664A93DBB7850199E4B62983 benniepiggs
1,666,283,260 *AF5E9AA89CC05EDBF7BE8DAD73912794AB2D64E3 STEPHANIE.BREWINGTON
1,666,283,261 *AF55BEED38CB45180A999DD270963CE09E5DDC0D 0ILOVENATHAN8
1,666,283,262 *AF594C1F4429CCC81FF92AF31EE4DF0CE329ED09 steve-ludlum
1,666,283,263 *AF5A7FEFA62F32E22F91F3279EA1629858BEE939 Beskidt,-sulten-og-tr
1,666,283,264 *AF53E0C76AF2FFA842FF8DBE1883E7F7FA0FA24F BETTYSURFER
1,666,283,265 *AF594192652E590090618F26B292FBFE2B21233C 110348 ratkaisevaa-on-my
1,666,283,266 *AF5B81BAE028A75C70FCFA5C64A40FB7D897A21F STUART.COPLAND
1,666,283,267 *AF5EA15FE8F3C4BEBF2BFC8CA4DFF65E15B0808B BGRFSCHED
1,666,283,268 *AF57505E63428DBF197702660C264679A6C7DF5E BHAVANTYASUHR^IDH
1,666,283,269 *AF5828136F4094EA5CD9FE6953BDA754D879AA75 B?HME
1,666,283,270 *AF5B3907CAA08F3FC1BC56063E8A693633695E2F bigbirdmarley
1,666,283,271 *AF5A34252239085CADD3E2C511A469EA4ABB9E90 SUOJATIKSI6
1,666,283,272 *AF58592E136960933E361D1D232B1B2AB6C8E5FA SUPATEING
1,666,283,273 *AF5ABFADCEC2ACCC6A79C6FE90D5E2A70C2B8304 billywallander
1,666,283,274 *AF5954F74CAA80020471D18A8D5213CFAF8706FE 1999-10-09:.coachella.art.&.music.festival,.indio,.ca,.usa
1,666,283,275 *AF5182077376A9AE6440C0B1BDE717A3C4C824BA 1ahv-reserven
1,666,283,276 *AF5D0EA4DDD51D772A4742501C3564BC52A8F369 1alarmeerden
1,666,283,277 *AF5A84C6122A96E426668712430410F4A61B7FF4 B_JDO
1,666,283,278 *AF5F8E5B03264B6E2989EDCE9C1BD718AD747FDC [email protected]
1,666,283,279 *AF5B711650C6263572370C96AB3412DFAE4675CF 1drogen-kontrollgremium
1,666,283,280 *AF5D426D164905D5EB8B12CF27569BCA268577B9 TARA NICOLE
1,666,283,281 *AF583B8889B959ECEF27AAFE1F3D14E71482E2F6 bl!vf
1,666,283,282 *AF580FB5162DF2D741BE2CB9E328D58267AF8F86 1-get-a-way
1,666,283,283 *AF525C9E907F764BFD7C32CA63402491E1F42102 TEGULATA4
1,666,283,284 *AF5D198731FE9719874BDB247E581E5985E95CA5 Tel-Aviv-(Hill-of-Spring)
1,666,283,285 *AF58FE22637CEF845905FF4AE47B1B70D4CA898E TELLEROM8
1,666,283,286 *AF52D0E551CB358022896B34D527429CAA9DCEF3 TEMPORISAS
1,666,283,287 *AF5F1ACF61650DF2C80A34863E7F7B6B75922805 1IFAEKSN
1,666,283,288 *AF51E90E0C9E0BE0CCD1C51387EFB88F57F8893A b&n6
1,666,283,289 *AF5CFAA13299DAC9913F5C49E76DFF0F8D660B2C bn?ne
1,666,283,290 *AF58071DF3F230CB3FAB7A00A8A9FD0EB933AACD 1-KEISARINPALVONTA
1,666,283,291 *AF57FED623F83D58715CCF9D212A2CFBE1249548 1 KINDERJUGENDHILFEGESETZ
1,666,283,292 *AF56D1AB608DA875C30B3995EF4EB5945812934F B------>~~(O_-)
1,666,283,293 *AF54E30D90373D9FAC90966331E8D3DB2C372302 1lacidar
1,666,283,294 *AF58957B6314ADCAD4ACC7428D95FE47E6BFADB7 1logopalloja
1,666,283,295 *AF57B83352A38E1244755032D10F2C74220CE0A8 1.MAUER
1,666,283,296 *AF5D183E4E568418F94AA33E6718980C38C49990 1-meramkent'te
1,666,283,297 *AF58CBDB955B7A50BB44BD6CCF37145E9A1E4DCE BORSCHELA7
1,666,283,298 *AF52124D743BA6D24ABA93E04C16734509904276 1mp3n173n7
1,666,283,299 *AF549873792CF8650A9D811630D2785765D1EDAD THE.OZARK.ALLIANCE
1,666,283,300 *AF565A89E4B0DD9FF5083D31423045BE74C07225 THYMECTOMY7
1,666,283,301 *AF5CD2842CF8237AA7DC02DDFCABA5A50D43AD3A 1.sisarkattila
1,666,283,302 *AF5302EEFB2FC1785DCAB6FB61D6BA1AEE9F4414 BREATHING3
1,666,283,303 *AF58EB62DBFE0293F753FB97ACFC8142B765651C tiny-dancer-(deadmau5-remix)
1,666,283,304 *AF53365A5DC0189670C3E17BC07B05B6F12B2E58 1-TIETOYHTEISKUNTAKARTOITUS
1,666,283,305 *AF53D9854E22C87E790ACF3C17F822AE6F074B77 TLUKSCH
1,666,283,306 *AF5F2B00096440C49B6E2064658939DCDDCA9F9F TNAHCROC7
1,666,283,307 *AF5CF0298730F25770A3E5F4CC77CD178A542293 TOMMIE.TROIANI
1,666,283,308 *AF540D3356BCC76CE534EC2677F962E4D67AA9AF TONEY.GRYNIUK
1,666,283,309 *AF59254D0CC038496BD4A3FDF37B825F33D78854 TOPSYTURVYING0
1,666,283,310 *AF536C29E78EA44A6DDF81C468C9A3DDA1631F25 TOSIGNAMESSAGED
1,666,283,311 *AF55EF9E2E218747D3BE3E0C2220575632670499 TOTMINBSWED
1,666,283,312 *AF5F499E8A03B656EF02310DB43753257E1D05A5 tott3r1ng
1,666,283,313 *AF549BA9DECA70104751B2EDF28D75281B4F8CBA TRACYTORGESONCAMARGO
1,666,283,314 *AF5234FAB7BF3B1E99501A6DE8B03E407EF14D8C TRAGAEDIE2
1,666,283,315 *AF526B8DA6DD65D9EC11A4B1A59209B7D035604A travis-carbonneau
1,666,283,316 *AF5898F36488F5DFCB73DB4625C4BF1A70F826D6 TRENTON.GEILS
1,666,283,317 *AF59ABFBFD0F8838B834BD987D2FFD198DBBA215 1 YKSIL
1,666,283,318 *AF5C2C359AEDEF198AB02750EDD5BB089A4EE23A 20071061
1,666,283,319 *AF5A2B761D224FC07CE56B33EEC025E22A9A3159 trismonk07
1,666,283,320 *AF5A591C1344F9F9039C2868559712CEB31275FB [email protected]
1,666,283,321 *AF571736DD4BFCBAB95078B0664802E3913DC513 2146008 HE-ASKED-THAT-HIS-LAST-NAME-BE-WITHHELD-
1,666,283,322 *AF56F111FFB607098B0BA07018DA59A420410DD8 BRUN3TB4RB13
1,666,283,323 *AF5AF084E7BB663A132480235C6449B156EA84F7 TRUCK19
1,666,283,324 *AF5D348FD7422BF00A5EFF61C0730D2398F3C28C 23ek7zrc6
1,666,283,325 *AF5D9B35D12CD6C4C065BC353C23CFCCF801C6A9 2423565 ANSSI-RAITALA-KESTI-POMMITUKSEN-YHT
1,666,283,326 *AF5B5768F67A91B3AAD353722941EA2ADA508FF9 2436935 the-hostages-were-tied-up-and-smeared-with-red-paint-.
1,666,283,327 *AF551E414ED633B08CAFDDD2D6DB00EACC3B3985 [email protected]
1,666,283,328 *AF5DF998AB3780F4BA1167C49168BA65ABAFF99A TTOMILTA5
1,666,283,329 *AF5E885854BEFA0FF86A8A533854CD543CC955EC BRYCE.HAINSWORTH
1,666,283,330 *AF53197B94161C78E2FF90D3A2A661CF0D35FCC6 TURNUSGEMAESSEBSWS
1,666,283,331 *AF5B311D6EE033678A5A0290FE64BBBB06E22C31 TUSIND
1,666,283,332 *AF59761B94574361BE88A06A4CF59947FE1EC1A4 bswblibsw
1,666,283,333 *AF508C103D7B2954783D555DFDDE9B41C65D35EF BSWJPSCBSW
1,666,283,334 *AF52968C7EAEE6BD8578CD75F5A9FE45397D4E6F TVNYSNF2
1,666,283,335 *AF520E184DCA00CCFF212A456863E65412A6041A 2611267 TILIVUODEN20003NELJ
1,666,283,336 *AF5B5BEFA6F17ABB1E44B1E4C636D9F5B70A67E1 TYRON.PUCKET
1,666,283,337 *AF51965D5052025A730FF2703D923FCFBBD09A07 BTETX
1,666,283,338 *AF56FC6F0EE81F3ECDDBB801D496DBD846B06BEA 26.hoppu
1,666,283,339 *AF5F371CDDA69DC0389825B43E61E1ED1C4EB84B 270697 avainsanoja-tietoyhteiskunnan-rakennustoiminnassa-ovat-
1,666,283,340 *AF5E7D9400253E030DC36CA6776A3B6DBD41A373 275494 tabipleventaydInoGlusUleymandemirelblv
1,666,283,341 *AF56A8621ED6A7F30B0630E4C6A33D5090B99D54 BUBBARED6
1,666,283,342 *AF57D4FDD5130CD00772FEAB3D6DC400C9A4695A UBESIEDESTINY
1,666,283,343 *AF5663F228648F84C0814E219EB9710E9A54F993 uccidermi5
1,666,283,344 *AF59F887F68408C65032C132955BE143E0821E9F udnan
1,666,283,345 *AF5A427BFDFBB0ABDAC6D322D88CFF6ED6EA3C7B 2BHEARING
1,666,283,346 *AF53FF338814B5840D1A69F121C3ADF7B73CAAE1 2CEPHALOPHYMA
1,666,283,347 *AF55A29D3EBBF7354BD686653AAEB40EE4C65C01 BwAC
1,666,283,348 *AF56D3C65AE775D07228C3A035EFA3D45D6DBFAA 2flouey
1,666,283,349 *AF51EFFB9BAE36125F836C0369152973FA7243A8 2HAYDN-ESQUE
1,666,283,350 *AF5CD9B523810A8F131E316802810A0757C7F2C9 c0l9d
1,666,283,351 *AF592BE77D58811A4B07AA343801EE76202B5EF5 2KLIMAMO
1,666,283,352 *AF543010D5BC252171ECF665FA3972BC1048080D c:4q5
1,666,283,353 *AF57D6FF1E87AA21481129EEFCB99F6317E09118 c69-l
1,666,283,354 *AF59C759CE57256473C26699A4C4D6247CFD6415 c+6w_
1,666,283,355 *AF5900819067967177BB71750FB9C5A4B855FB8E CAMPHUCHY
1,666,283,356 *AF5A95011982C347EEEFC61E5BCC40FBE32CB0F4 canciones y villanescas espirituales: dios inmortal
1,666,283,357 *AF5A83E61E0D1DF4A931821DB1DDCC8C44891826 [email protected]
1,666,283,358 *AF5A2F2B91FCBC93FB7F652C70E06D05754280B5 VALSA (COMO S
1,666,283,359 *AF573303C435774C4BD75E347C548605EFB8D32F CAROL.GISH
1,666,283,360 *AF5682F448981D674E0981D55635AC91A44297C1 VANESSA-TERATOLOGY
1,666,283,361 *AF5C4ABF3A5269CCF742FFB7305C2FC55E437FF6 casembroot
1,666,283,362 *AF53FEF33D8461E591161156F41BE6B1E865D4A3 CB.IG
1,666,283,363 *AF5D4ABFAA44B4C63AFA59CB0C65A117A91A0787 [email protected]
1,666,283,364 *AF5D716B5E603EDAB9AA3C6C3220B5C77E2E0331 CEREBRIC
1,666,283,365 *AF537B2062E60B8F9B0A7B948CCAB60C1E18E0BF victoria-diamond-childs
1,666,283,366 *AF5F61888CCA60259F29A67C113D058A8E6CDB0D victoria.oti
1,666,283,367 *AF53571A46B7E48527540026ED917594AF53741A cg40&
1,666,283,368 *AF51A37782CA9703E29C3A1662D858AF6C42C4A8 VIKINGA-SONATI
1,666,283,369 *AF5C4C0B835FF6B5D12E1998B07BDCAF7BBD686F cgv0v
1,666,283,370 *AF5319B12A5975299D0472CBA6515C439A9CA7F2 VINCENTROSENDORF
1,666,283,371 *AF5805C71692BEE3C86339B5CC9C8E9DB8B6493C 4EMDENDST
1,666,283,372 *AF50855AA6B425FA47361D26ED800C1A345DB434 4GASTHOF
1,666,283,373 *AF5E3F349E3876558B81F9423D0A5F33F9CA55F6 chancedoyal
1,666,283,374 *AF52264C9F828949A2494A0C64EDA49667E0BD86 chancegreeno
1,666,283,375 *AF51461626878298E613ED87554030375E8C657B changgrimlie
1,666,283,376 *AF5C2091FE9DF0CB33AFB65FB5521C85423D0830 VISION.-.FOLK.HERO
1,666,283,377 *AF57582E6F2621ACF472A784383192621A17A8C8 [email protected]
1,666,283,378 *AF53D8093214A45515541DE35339B264E090898F 4neoliths
1,666,283,379 *AF5FAFA2AC9748CA6117DA44C2141830E41425EB 4ONASIPAC
1,666,283,380 *AF5C6CE2AF1482E27D5C32D2FC13AD8B3D7FDCD4 4polo9zes
1,666,283,381 *AF58AC6F9D2E5507525772162538F121F538CDDA vooronderzoeken
1,666,283,382 *AF57ADCB38C1B2868AA0C8439C3B32A3D6E8AAEA 4TAVATLAV
1,666,283,383 *AF519A54805CAB47E01A43E318F32CD3CB642623 4TOMODEM
1,666,283,384 *AF5707B3F1BCA63FE47211FD0B3C9543CFD104C7 cherry_
1,666,283,385 *AF52FAFA571E868EA2B69166EC4D162262CF2906 [email protected]
1,666,283,386 *AF5D6F945DC90D3C3AB36D9EB905E51AD57FC25D VULVESVULVESING
1,666,283,387 *AF54A2C20A26B0780780144CEE73197D12F8F962 4ZNOVUROZDELENI
1,666,283,388 *AF58D53B7D58A203E488CE8FEB3490E4FFD7B20F VUURBAL
1,666,283,389 *AF5D6B7718D11492037EE35E8207A4B2B0F4270F [email protected]
1,666,283,390 *AF56D75B4E332C2794596F2D39C55882F41474E9 W=`9
1,666,283,391 *AF54F7F37C5D9C365BA81089C477DA39AE46BA4F wai-yee
1,666,283,392 *AF56C6EE1E6913EE1DA6D98CB631CB60BCB986A2 WANONAGOETZ
1,666,283,393 *AF565CB48ABCC6557E4BEE32403DC14E6C0A1F9D WAYLON.BRAATEN
1,666,283,394 *AF55574EFC1CD9B5B9DDA64B94082AA4427F4A86 cilubolg3
1,666,283,395 *AF540515FF858594C74344242101CA6D0B8567FD CITY)」に「ホンダ
1,666,283,396 *AF571A09983FAA09D34217492D043CDCE6A5BCEC wendylisaperrin
1,666,283,397 *AF5CC5FC03286FD659C007532B9C585E28DF3BA0 557FO4
1,666,283,398 *AF53B39408189B94F9D5D2C5E69F732BCB05B27E WENDY.VAN.DER.KREEFT
1,666,283,399 *AF568C24C73700EDFE1C3755FEB2002A6517599F 578405 selbst-die-nato-will-da-nicht-gross-helfen-
1,666,283,400 *AF58AD3935536B9C8AF7D6FFF558CB683A000274 CJWMA
1,666,283,401 *AF5C1DE36B150B3956A48947FADAC030689AD262 [email protected]
1,666,283,402 *AF5C9C3B52E1CBDBDB1286A56780442E37EA9AF5 [email protected]
1,666,283,403 *AF5F2E43F2AF648A73B3B5D21BBF9A4F37B6E312 WERNERBANIS
1,666,283,404 *AF55A5EDE73AF1B82869E977E0EB63608B79A349 5ASPENABCD
1,666,283,405 *AF557A1537B8CE822D9EF9CB1BAF9ED2C5CF4C21 5.ATIKSUYU
1,666,283,406 *AF56EA626DBEED96C49E9C11EB6E07C7C65AD054 ClAf
1,666,283,407 *AF5EF1E875489E4190BF014D188279E8DD43EDDD 5COTITTA
1,666,283,408 *AF5DAE8D05AAEFA0B3F6D2AE758F68E56141F0C7 CLAUDIOMARRONE
1,666,283,409 *AF57455FCD983C50BF4E58690F30AD0987901568 cliftonfox
1,666,283,410 *AF5A596B971279A34F083EF3130E3C10BD93798D CLLQS
1,666,283,411 *AF5346F093EE17FA6E4FC29FEEC71B4709E89518 CNA_6
1,666,283,412 *AF5B1C1FDF225F54EE6A48EB40F2FA1171E89B40 WIREROOM4
1,666,283,413 *AF59B42491022A10A88B1019D36474C5BEBF1F10 COIN CH4N
1,666,283,414 *AF5209B5CD1E0643F03FE0D7962680EFB3EC4D39 WSTDIG
1,666,283,415 *AF52C8C67AA95A15AFA723EAAC2A0B2843A4B20D [email protected]
1,666,283,416 *AF58041A305C56FB683EF8D563F026A072A664FD WWCLAIM1
1,666,283,417 *AF52F1ED980851CDF3CEA2FEC0E2A2EDB5AFBE04 636903 KLARHATSIEAUCHANDEREINTERESSEN
1,666,283,418 *AF55EF93C02E6A6B849322A75340A838BF1B2787 6blikoog
1,666,283,419 *AF5052A508D5FED2531C6F9116370407076F6572 COMPO$1T31Y
1,666,283,420 *AF513235A088A9138F2F115E67997ABA4789857F 6CITAMARDBSW
1,666,283,421 *AF54ED0F44391EF54F23952DEDEC74806B729337 6COALICIONBSW
1,666,283,422 *AF561B562A8CA78A3245D3D4DFEE4BE8043ABD83 wx3
1,666,283,423 *AF5902E61B53F185D47BAF42F0DF81A0DDD262C5 6GRIFFEYELEPHANT
1,666,283,424 *AF5C39F404E47408CB4385ED1367EA174888B312 6HUNGAROCAMION
1,666,283,425 *AF59E2F6A5C784EFB3C15F604598CD334846BA92 6iamarizona6
1,666,283,426 *AF5A2548963E265442CEE95CFC32DE0FA60E75E3 6MAIRONE
1,666,283,427 *AF50D8B70BF89D67448294862D39031DEA1DA1CE XRISA.XRYSA
1,666,283,428 *AF54A325DBA93BA2F0DB00EE35BFC83C327F1CE8 [email protected]
1,666,283,429 *AF58EC1B0CE74D8BE15E99E99DD9A3E0670D8BA7 XUNAN-NOVELO
1,666,283,430 *AF53A0333A5C9ABCA71A976DAA47D19D3438CAA2 xuwusiyoge
1,666,283,431 *AF53BDC1A13CE6E629BB64516C9390CB77BC69FE Y=^1
1,666,283,432 *AF56D3B29D830DE68A69F99D81D74829372BF997 Coprol
1,666,283,433 *AF5738270655823F018461C01541BC6834A2B357 6SNOBBERIESP
1,666,283,434 *AF50882B308C4FAB79A8B995843E9EB60748E100 6STATUVOLIC
1,666,283,435 *AF5138826F83512F97C85D4D96332D073A304A95 corymikel
1,666,283,436 *AF5508FFB42F03D5030AF6EA39E7668912CA827A YASSER HAMED PK
1,666,283,437 *AF5D22767FB56C03B445C92343DD29F888B7E014 6TNASIREP
1,666,283,438 *AF5F9358CC9DFBE87D0F2B202BD719EF8A2C3ABC YAZG
1,666,283,439 *AF5C9474C80D425BA4CE8BD763423C0D20A5FA97 759553 tuskin.koskaan.ovat.pojat.pelanneet.t
1,666,283,440 *AF57BE79320258FA3177D81F9E9055B2D9608C99 YERALDINAGARCIA
1,666,283,441 *AF50BC0AF8060EB579DAA4A8AE3662EF578A53B4 773KASSANDRA
1,666,283,442 *AF5BA23434602BCF739EDC079356D101C0767438 YGK(
1,666,283,443 *AF5122DEA041D229FD1D44865334EF4B7C75B7BD YINGYUELIAW
1,666,283,444 *AF58EC17E26C79D2593496321300CA06BFDC6A7A ylsel
1,666,283,445 *AF5F15D947A41C21A60A84687741AC451CE8AEED YURIMAGUAS
1,666,283,446 *AF55BD28153DF1618BDEA3FC60CCD2F385C0660B YVETTEANDGILBERTCUELLAR
1,666,283,447 *AF5C342D09E2835906737A72857C84C3FF44DCA8 zacharysawatzky
1,666,283,448 *AF54A7677C2725B791FFD5589467E6EC0E741771 ZACK.RUTTY
1,666,283,449 *AF54A7E9365A37EFB2657F54D892147499250A67 ZACKSPEED
1,666,283,450 *AF5102389CD70EEFBBE826BFDCB81A0767D3AF12 7STINKYTONY
1,666,283,451 *AF5C513EA70AA8E32FDF26455ECF74304852A109 7SZEMIOT
1,666,283,452 *AF59370E30FAF29A290D887BE22C946F4C55D20F cql03
1,666,283,453 *AF5EC7942E613EE6C8F925082ED5D5839F40E4D6 ZARANDEAR
1,666,283,454 *AF5AEEA65AB3EC630028A0F3D0321398CBBFCB99 CRISTOPHERMCANELLY
1,666,283,455 *AF55A6EFF4777B79424ED23E45FE7DD78C9BCCDF 812783 ONLARDAKI KARARSIZLIGI VE ENDISEYI FARK EDEBILIRLER
1,666,283,456 *AF5C1FEE8F2C7876626C16DB6105C33643F92BC4 825184 HIIHTOOSUUSMITELL
1,666,283,457 *AF5F2B7D506878F607B87904BA24B8092EF9DFF1 C-SUU
1,666,283,458 *AF5C8DCC26AB7F8B453F323028694F88171F25F0 ctb(9
1,666,283,459 *AF5FC0DE3626C777EE766C56688E70195CB4DFDB cu"rd
1,666,283,460 *AF5E9E4843D3AD7F191C8235C83B06E812A3B793 zubayerbilash
1,666,283,461 *AF5D8A64951B5E1498E157A8B7D65397205253A4 CVq2
1,666,283,462 *AF564D98C149CAB955B7FA07D0ED76669AB6910D c-.xa
1,666,283,463 *AF514E5833CC3896F9CA1C97FC44AD7C50E679A5 ZUSCHUSSBETRIEBE9
1,666,283,464 *AF53D6F92F61EF8BBDF8166B7ED714BE48CC354A CX=GU
1,666,283,465 *AF5C79650BDEBCE481D82FDF9F4DADCC07B026F4 CYTOXINU
1,666,283,466 *AF532B7E89CE0159F09FB43ABBA31DE5E3781D25 c#:z
1,666,283,467 *AF57C5B40E9B8216F591FFF90305522669F8EDC8 D2TZ(
1,666,283,468 *AF5A615B02AD9CDB83AA8ED4D72149332FB50FCC d3ske
1,666,283,469 *AF584BA1BC1D41AAB7DD72C9EDC786A93134BE03 БРУДЕРБОНДУ
1,666,283,470 *AF53237111BBB08F09C27221F5E467600AE472D2 d7h!y
1,666,283,471 *AF5FADD53F9C62B5472B61933986DC28F34B46D1 D-:-A
1,666,283,472 *AF53BA9CD425D7A082E6E7DEEC9C0F5416EC6ABA 9DAMPFKOCHTOPF
1,666,283,473 *AF573D62C861C1CCC67502F69CEBF2355E5E5916 9FENDERLOONEY
1,666,283,474 *AF59BDCDCD2B43960DEE2089D1A131EAD342BD12 фридлайн
1,666,283,475 *AF56028C52DC0A8DA2BB8140F70123B8A7E57F09 DANE.CHMIELEWSKI
1,666,283,476 *AF514B3BED17CF35AB996D3589603F1CE7C7BA09 DANIELTELECINCO
1,666,283,477 *AF553AD98BF10E4F0B075DDE3C7FB587AF2D7F52 danny-scott
1,666,283,478 *AF533210EA3EE0C57EA5783EECE35A3F826CCEFE danslaluneaufonddel'eau
1,666,283,479 *AF5E8BA8B4125CA36E100EE49F21FC3B9CBCB08F 9PRODROM
1,666,283,480 *AF502D2114C48CD0BFFC041F7AB8CB22A0FDF32D 9RANKIST
1,666,283,481 *AF59FF8AC886DB34993CE2CBEA00C7FB9DAC6748 D))AS
1,666,283,482 *AF5A08C1FA8D72894D62452B9BD422D6362EE9BF DAVE.FIRST
1,666,283,483 *AF5125C8782AAB5293D82C240DDB0E488CA6AB26 DAWNOFANGUISH(KUNOUNOYORU)
1,666,283,484 *AF57895854F68F2EA62C283E5E85089FC5566EEB d+b5#
1,666,283,485 *AF5BE5D767EA0A53E7DF11932C41A3E136FD15A6 DEREK.RIFE
1,666,283,486 *AF5D2AF92D330C58753568243F6B19A90A9C7CF3 DESTEENING
1,666,283,487 *AF582012D2B8B0142E048DF57193514F78872D5B DEWEYTIET
1,666,283,488 *AF5837F7E93F515457A0BD1B2AC453CF057A6140 dexho
1,666,283,489 *AF5C989A4DE6ECEB6F8E86D63E042B6EF80DC4DB df651
1,666,283,490 *AF52FE200AFE12E5B135B4500F0ED9ABBDE6EB48 DFIS9
1,666,283,491 *AF560E8114600DF0801020DB686B683B8130C977 ABAL[
1,666,283,492 *AF5B9C565C7EBF5674F565018674AAE997B6407E DIAGNOSEVERSCHLÜSSELUNG
1,666,283,493 *AF55C67EC52C7C72B97718A40173DAE2A09B6F13 ABINAEL1
1,666,283,494 *AF529AEB2F68D845E5119DC731F66784D239E0BB ABSOLUTEPITCH6
1,666,283,495 *AF5EB9FBF0B4D0C99C6364A0F04093979B7F7D6D DIMITRITOPALOV
1,666,283,496 *AF51E7C0E76E83F6F24F204D81855C84534B6868 dirty.funk.(come.on.girl)
1,666,283,497 *AF56E895684DD0FFFE54B1C1B64A77256E2AB9F0 ACZO"
1,666,283,498 *AF5A207EA14B522FA9F82FF53D1FFBF91723DF75 DM/'
1,666,283,499 *AF5F8094BB6FA8EA5C5D0EE3BF148115957E4D3A DMRCV
1,666,283,500 *AF570289FEE90D723CDCE2900439837B7D6A49B3 DOGGONE2
1,666,283,501 *AF58F57E0C913F1A2FA5F630905F6685E06B3585 DOMINGO.SEEDS
1,666,283,502 *AF5C5B0DBDC6EB87F4A756A870EA6B4B75F44F59 AGELLOK1
1,666,283,503 *AF5BE878A6A7C7337ACA1FF5DD03FAC766807560 don'tcurseingod'shouse
1,666,283,504 *AF5955B737647AC5457CCB7557ACAF85F93B977C Don'tLookBackIntotheSun
1,666,283,505 *AF5B32D2374D652F6F1574C27343FEE555982F19 aimelakl3
1,666,283,506 *AF57BBF4FD7DB93C22001A407A390F67D4E5BB95 AKEHAMA9
1,666,283,507 *AF59C154D124025FCC67B282FD9584B65637006A akw?p
1,666,283,508 *AF50E0B90E081796CCB4C7047CB225B5F11CF306 1012430 EXISTING-UPGRADABLE-MACHINES-DO-OFFER-A-SAVINGS-.
1,666,283,509 *AF500FDF629A767EA75F32A57EB4EF5CB04B1BED ALANMARLING
1,666,283,510 *AF55B88E134E88AE83E8D065EE1F2BD78A5420F4 ALBERTOBIRTCHER
1,666,283,511 *AF51A009E3E28C9724AF2DF765E8D0EA82B7D81E ALBERTO.JADOO
1,666,283,512 *AF5B852895BF7BE3E516385FA1A3AFFDC3DFE8FE albiness
1,666,283,513 *AF588D7D773AE1B1D39193331CB557EDE9073CC5 D&/SR
1,666,283,514 *AF52E66B85652333B896AD435D7A02291077E2DA DU-FRIEDEN-F
1,666,283,515 *AF55094E150F5EAE0AEB51DA6DB6A1AFA5F8F62F DVU"C
1,666,283,516 *AF56B8D25A61B062869EEC083406734532A92229 14V1SHES+
1,666,283,517 *AF5EC44A9E44F1464AFCBCDED90AD8AD08FD78D7 dwwad
1,666,283,518 *AF5D9F6D1E40F70294DD623C880E89C7B97318FC E123540
1,666,283,519 *AF593830B45A26F3B81FB6ECB69A236819B06052 1784290 vernichtetdosenpfandtausendearbeitsplaetze?
1,666,283,520 *AF51AD8D162ECC9FC1BB32B81CE3C158B1FDFEB3 [email protected]
1,666,283,521 *AF509E749C276995CEA3E6B84F6E08DEB64A06BF [email protected]
1,666,283,522 *AF5B5F52ED291483BE506CF8C73DD2551447428C A/N/
1,666,283,523 *AF5300F9FB8321B56AAF9245D1E99B92FD1A92AF EARL.SAPPENFIELD
1,666,283,524 *AF543BBBF45CA1D0E85FC457EB47983C43D20E25 AN#AR
1,666,283,525 *AF56E8458690D91F16706103EE689B3B92D21AAE ANDRESKOSTAL
1,666,283,526 *AF5033B980F551046B419B6F21BD7D69D7324F0B andrewcoto
1,666,283,527 *AF51F5FDFB985F21E1BDF317896F3C12D29AA095 1AGROTSEB
1,666,283,528 *AF57F3955F7EAFFDEECB61CBC8D945F290DE7779 EDICUYCS7
1,666,283,529 *AF59E07657AAB09C24406D9B5A06FDCB5ED228C7 EDIRE
1,666,283,530 *AF5595EADFBD1DA5A58BB9F0ECBFF35CD8778C2B EDMUNDO.GRADNEY
1,666,283,531 *AF53C084B79DFF6ED6B1306931F6001AB3FE88EA 1.avramedes
1,666,283,532 *AF590C6EF71C80601BAFC7CB52342A8544330CDD ee,fa
1,666,283,533 *AF5960DB2162392A6CC279D0A6A83F0AB9E10195 1-casselli
1,666,283,534 *AF59A3F8B63A45F61A1B3962C5F58E8B6DE982DC 1 COLA-IMITATE
1,666,283,535 *AF5327A0E4376381CC25052CC6E198B2E552F96C EFFABLE
1,666,283,536 *AF51804E6CC3B8E5C39AAD4B01173075205F3612 ef($w
1,666,283,537 *AF52A76799D2FBADEB75150DC540600E3D352C32 1-DUMPFKOPF-PARTEI
1,666,283,538 *AF51487686F69B3216FF7F31869C527F78D336EA ANNEGARY9
1,666,283,539 *AF5A395CA3397EFB41929DA52AB59CF812ECC927 1hesaplamistik
1,666,283,540 *AF5A245E9AF2FCD6A49C8A50F0938609886FCC8B 1.hsiaolin
1,666,283,541 *AF54E2F5DEA6BE13180013F67F98286415EAE59F 1ILUVBYTEME
1,666,283,542 *AF527B0DDBBC3B07B4A43F821FAE235730AA375F eleonare3
1,666,283,543 *AF5B2C03B10ECB9124A243B5E47E8A6CF219F4D5 1-maailmankassasta
1,666,283,544 *AF5D96C5B323255BF51EB1AA8CB2BB12CAD35D51 elliotfaulks
1,666,283,545 *AF547536FDEBBB24872F41A568C3280E1812EA55 1 MUISTIH
1,666,283,546 *AF508C52C81714DB0CC0D80B7165E979E60B423F 1 NOBELSCHUPPEN
1,666,283,547 *AF503075C650016D004783430303CC8AE12158CD 1ORDER-KURS
1,666,283,548 *AF527E86B3E8A1626776CBA354E03C52B2C2944E A--P.
1,666,283,549 *AF5D368E8A62D07698E097EAFD1B2919E91B7547 EMHAGER
1,666,283,550 *AF50FC4204B9F710DBE5E5EC3503379F07A0B6A9 EMIGRATO4
1,666,283,551 *AF51E837F5139191F203C63C20CC512B6358D705 APTPP
1,666,283,552 *AF5445AFC356C735BFAF912C170CEC926EA0B9B3 en_be
1,666,283,553 *AF545B7A988CCB413BD7A8AF4787BF1EDAD61D0F 1.TELELIIKENNELAITTEIDEN
1,666,283,554 *AF5DB8E297727F77E565C74BC06D3E24C44DAEA1 ENJOY(THEBEATSMIX)
1,666,283,555 *AF5C353B1656C4D1E4AF668D1ECEBE9EB5B551E7 ENTENWEG
1,666,283,556 *AF5F490AED9696ED39C39EEEA60C0877C2D0F5CA enturian5
1,666,283,557 *AF5A68FAEC3FDC87145FC0E3379DF99B4C4283DE 1-VAIIKA
1,666,283,558 *AF55638AD73EB5C034C7AEB20BD67ACC81C043AD 1 YKSIL
1,666,283,559 *AF562D579FCD44A74FCB459DB2FC507FA554B133 EQNRO
1,666,283,560 *AF54C4C1578EBF34360BDC70638D4CB2206BB0B4 ARMENIJE9
1,666,283,561 *AF57DECABBEEC13F090C7E87844055C8CBED95FF ERULEEPS5
1,666,283,562 *AF5DB70562DC9A6E7D7688961A10B5629A3FAFBF esik?
1,666,283,563 *AF57B7919C15E4CEDAB1F22438C806A7D9EB08E7 ASPIRASSIS
1,666,283,564 *AF5E62ECCF7CB73DC1D27F4721DF8595F88A8688 etehegoz5
1,666,283,565 *AF5B56CDB719A38E91A404F2914ABEFCEBE6489A at=jv
1,666,283,566 *AF5BBEAD1B07682A749DABCD6110F90AD701EEEB AU0J1
1,666,283,567 *AF58144FE07F9F1397935FD7AFD8084BB0A5C9C3 261BAE38-168B-3A1E-B8BA-4545463EE140
1,666,283,568 *AF5953716B3277E166B6749567140929CC3D44DA AUTOTHERAPEUTIC
1,666,283,569 *AF57341D1736A3A94B4ED57EF79FFDCA36882078 2717DKN
1,666,283,570 *AF5282D96C33B4F1C488EF0CAF0ED76C220CDDDE [email protected]
1,666,283,571 *AF50D56B81A142DB35D771F0B9C2145351C74E68 FACSIMILE-BROADCASTING
1,666,283,572 *AF5D42E83679DE7BE2B760D754CB948E496E6103 FAITHKOCH
1,666,283,573 *AF518873CCD1439BA9F0040E20C8C159CBD5736C falsificator7
1,666,283,574 *AF5301F3107484E6775B77BE3B8D6ED67D707016 2ARMASHTA
1,666,283,575 *AF5E7E350D6699E3CBD9C45DF367082561CB6193 2ATSAKIIG
1,666,283,576 *AF5928C1F463F54245B047B907B28B2C7F817547 FÁRADSÁGÁÉRT
1,666,283,577 *AF5A642B411BBACB4D41964C4F9AC04118DFD696 [email protected]
1,666,283,578 *AF5DEE68EF38D4639BC69850D86AAC573CFAE767 avfp
1,666,283,579 *AF5282A2671E8C46C292AB7A0A82A63EB96B2468 2DOKONUJE
1,666,283,580 *AF5027794CDE9DD02F7EB5A1BA7AA8CBB219CA88 AVS1)
1,666,283,581 *AF53C372D6AD9A530B3AA9B470FA71CC955C46CD [email protected]
1,666,283,582 *AF5CCE2A76B28E3537DE108DCA0684CC3DCA44CC fddz
1,666,283,583 *AF5D0063B2EB0F3B2DE580AF7551058E6B9A6EF9 2.HDFERNSEHER
1,666,283,584 *AF5DC8037853C757D327FFE033B965F3E1DA5633 2IAMSMILEY5
1,666,283,585 *AF54F53DE22C2290A306F2E5FBC4F41A012C4A41 FEGUENST
1,666,283,586 *AF55214E31299E2B0DBB927FD0593F42058E5936 FEJEKOSTE5
1,666,283,587 *AF5E1450616A6DAA17E146842297E31053A15FB7 2MORGENLAGE
1,666,283,588 *AF5D3D23A96BD774AC4400EEE1A77DBC74B9815E FERNDA1E
1,666,283,589 *AF5525D83AAE7A1C57DCD1A0898AAA6642ED933D [email protected]
1,666,283,590 *AF5F84D2096705D262FFBD0FE10B98FED065E13A b#1#h
1,666,283,591 *AF5D57AA6FE511EC873316A8E89CE12F0423839B 30 HUOLETTOMAN
1,666,283,592 *AF5EF749F09A6F0DC645E6B2F4030EAB0008EDA3 B8Sl
1,666,283,593 *AF51791899697EFF3AA739E50C71D7CD7EF30B40 FLOPPY-N:-FLOPPIES
1,666,283,594 *AF5D9505ADE85820174D0C7E832376522A890DF0 ba6869775bafb0e841fa2d0bb77d62e1v15aughn
1,666,283,595 *AF568B10628754DDB48D5E40EBE850CE36827AD5 floydclaunch
1,666,283,596 *AF5369B0909625BC1E0E0D32F5519C00749AC8AB [email protected]@r7y
1,666,283,597 *AF5AD24089FAFBAD9D03C17A1DD9117E27654DA2 barneymalizia
1,666,283,598 *AF5326CA99DFCD4992662DB82CE49EA8F490B9A0 formulari?
1,666,283,599 *AF5E2F473FBDCFFC75865080481DAC952611A695 fosterkantner
1,666,283,600 *AF554A7375C484E4F26578FE8944321BCD33058A BASISTI9
1,666,283,601 *AF549B13E0157A40BA2AC2825C715223E2F1739C FR8212019
1,666,283,602 *AF5F8BAC0E3CC5FAA01DD282A1E02921A7BD1067 3 KUNSTGIESSER
1,666,283,603 *AF5C9F69074E88D3136DF8B18636045C9A87EA79 3MYNNING
1,666,283,604 *AF51F181DF7C55085051417294029FA2A82C24DD 3.NERESIYDI
1,666,283,605 *AF53C1A60F6CC9DD1C4A401F9D19AF7C1DF22AC2 b######b~o~o.splat
1,666,283,606 *AF5278D09EDD3D55691CB5AA1A2904BEA4E46D0C bcd)w
1,666,283,607 *AF52CC567555BFAE636594142541A23FC5903710 3P * * * ~0~oSplat
1,666,283,608 *AF53D30B6CC2E339ABAF75F9E890A2597301CD4A freddycheli
1,666,283,609 *AF5C15EA7D55D62787C3DE26F72FC643A725279E 3RG0G3N1C
1,666,283,610 *AF56858C0CCB0C8673E46429247C8CF6E84AE359 FREDRICROCHENSTIRE
1,666,283,611 *AF5CB43B2A487D5A3013361F4A04403E072824E7 3===)`~`~Splat
1,666,283,612 *AF5846578DAF7B195886E3E5A0E33F1C5CA145CB FRIDOLI1
1,666,283,613 *AF5A92C6EAD1426C736BC4928356A43A65927C48 FROM THE ARCHIVE.
1,666,283,614 *AF53DFB339E04EA75E5D8CBDD4C55629C823737C FÜHRERWILLE
1,666,283,615 *AF57CB4AD6118FEF764C051EBF9944CDD70F1C72 [email protected]
1,666,283,616 *AF5CA1C92CF146E32843B636AFA8ED5CF54335B9 BELLWOOD
1,666,283,617 *AF5D08A2F03FA5DAB17C8B0E3CBE297AD9806B38 bennycap
1,666,283,618 *AF53602826812D4BA71141D56981BFDD5F6A60BE GAMETANG2
1,666,283,619 *AF5BABDDF7FB0ABA46BD944F70082C6159778BA5 4DRYPHYLLM
1,666,283,620 *AF573C6B4089B6BC8304E12DE17A6F98461FFEB8 BERT.CAPER
1,666,283,621 *AF5D68C465B30EA7AB880BEE970BEFAA3B89B1CC GARTH.FOUSEK
1,666,283,622 *AF5247AF6EA10BAB632F2DB1E53F7603D5DF6B4F GARY.MARINARO
1,666,283,623 *AF5D3CBED4E0FF0EE3A1AD73D8A04F02F96B2730 4FANISHED
1,666,283,624 *AF5A0500CA23FF68C5A9260966A12035FEC83A7F BERTRAM.ZAMACONA
1,666,283,625 *AF51D1929419042EEEF77C0FE430127D70AEEF39 GASTON.NEBESNY
1,666,283,626 *AF53E876CA62B038545A8E387C1CFF9CC1B2FEB4 4HAWAKUWAPATA
1,666,283,627 *AF5724EDB381856AC5E55E250003D15F7070C1DE BETTY SHIFFLER
1,666,283,628 *AF5C30670E8F182F724FF83E8A5382C88D84E63E 4IRRATIONELLARE
1,666,283,629 *AF543458CDCFBCA27134EBCB263EFF8872A6C807 4KASETILLINEN
1,666,283,630 *AF5C78310418E4D8F8B38FA725F8FEB5E22760E7 4-kubota
1,666,283,631 *AF512FC9730A488159342388B0B40908F8849883 4MIKAMINA
1,666,283,632 *AF567A64AAFC58AAF70ACF06DD594DD5D4B94662 GCGV
1,666,283,633 *AF570816EC45228A93C16A8428589DB69DAEEA23 geluidens
1,666,283,634 *AF53DBEAE9029599CD39A2C27F51C7CD041275A7 billpernod
1,666,283,635 *AF5AAC12425F741B35C8738A8ACC3269D82CEA43 BILL RACINE
1,666,283,636 *AF513947C523928F8F87FC3DBAAF77E1E1185CAF 4 WAHLKAMPFARBEIT
1,666,283,637 *AF5538F64A5EA40DE1230155C2C7B5F65B87A6D9 biq6n
1,666,283,638 *AF53DB58671621474A4A89EAD6C91E9370F444ED bjc2d
1,666,283,639 *AF5EEDACE6E63B7B94D1805C761EA9E31A6658F0 51119 SEVERAL CHURCHES ARE NEARBY .
1,666,283,640 *AF5D8EB008EAE60EAE6C3267DA9AD54F0601B472 52-TAPANINEN
1,666,283,641 *AF58BEE8CE5F5692E2C050C5AECF24F230F5FD5A GINGER QUEEN
1,666,283,642 *AF5C8E05DFF1479FD2F798673B55CA3ADBA602B5 GLFYIXPXXGHG
1,666,283,643 *AF5F407B916B0C0CBDC4CF578B5FDA13F1788968 BLTXO
1,666,283,644 *AF5849DE0C43DEA4818FE0D445D5DD511F03A0BC GOiNG.TO.BE.iN.THE.MORGUE,.OKAY?
1,666,283,645 *AF5BB85C400523D918738ADC1F3F84299E10560A GONALATIFI
1,666,283,646 *AF58B0F037132429AEE3F425DC4E9572D418E432 graigmcalpin
1,666,283,647 *AF5AC086BAFDE7F33E676042C1CED1908043A6CC BNFX6
1,666,283,648 *AF50D63E12B9B59D56B4D9C55FCFE39C395D79CD boaf
1,666,283,649 *AF5FF268AD26E89673BB1C80870AF6A6DF7128BF 5PIATKOWSKI
1,666,283,650 *AF571187AA3C930E0C200FD2D856FA6B6EDFA11B GROVER.DRILLING
1,666,283,651 *AF56FD6B2F9C1F4365FD6A228A06B01B2D90EA9E GTEZSJMGG5
1,666,283,652 *AF5BA0225ABA3B7BF406A8F1918CAFCEF6296B0E guadalupebierwirth
1,666,283,653 *AF5111DF203199BC241E99009B6A16D4808F4FE7 GULIYUN
1,666,283,654 *AF5B3362E8B631C2A035E8E4278C9D58B2AB900A [email protected]
1,666,283,655 *AF560A80FBCEAC7653E54C4A66E42B08406E3DB4 [email protected]
1,666,283,656 *AF50DFFAA6E9F584EB18A65BF62A8F792F517C56 GUSTAVO.CARLINI
1,666,283,657 *AF5B39E1849E1919153648410E10C19D49A1E9E2 GUSTAVO.SAXENA
1,666,283,658 *AF5932C471A084AEDC56D3C22AEDE90DA18D9DF1 guswrzesinski
1,666,283,659 *AF5FF41513147365873770FE3A84CF8D42C0C3ED borisbillig
1,666,283,660 *AF54040E3ACED4D7D1D74648FD1AE12AD61240B6 HACKERIES6
1,666,283,661 *AF5D1470DD3721B0A2AD4510E495CD006DFDBDEB BP!4Q
1,666,283,662 *AF54ED7D68380DDF7932E9999AC4296A30F63CCE bqywu
1,666,283,663 *AF55F92FC878CDBCABC02D90ED1AE5FCAF1F41A0 5UNITEWITHAPPENDAGE
1,666,283,664 *AF51AA22340B18E5418F3A26A9DE672C7E1AE843 BRANTCADEMARTORI
1,666,283,665 *AF5760B0D4CB0810B8F3A69D3F263C6660C07E1C 5VINCOLISTICHE
1,666,283,666 *AF5D179717B6B5D530DCC9B0898355B37D537111 BRENDAN.LOURAS
1,666,283,667 *AF572D5CBAEB23A36D7634AFA4CF31EBF5372C5A brendantoothaker
1,666,283,668 *AF535054CA333E6E7FAA6768D26B8A68DDDE8595 haywoodniimi
1,666,283,669 *AF54ECEED80379E87237D1F5B7623477DC7FDC82 BRENTONOKUN
1,666,283,670 *AF5A4328760FAE6EFC68D8A0ECFA43327138B769 HB-|
1,666,283,671 *AF5102B22A6931BB8F4FDEC5F82DBCB5A85A459A [email protected]
1,666,283,672 *AF5B374A4019750AAA70BE8E0A8E64E7C3176B3F brockcarrigan
1,666,283,673 *AF5EFD7113349EDA11CF0A1615A24A826C39781F HEEKYC
1,666,283,674 *AF5EA8A31E1C23D703DB3D140C58E401A0E5504B HEJIANTAO
1,666,283,675 *AF52585E475950423E83F1DAE12DADDFD78F66D9 brttlsts
1,666,283,676 *AF52FF0330671F5AD5AF3C470C73C881AB334416 hermione310
1,666,283,677 *AF593804699CD3C5E908C2DC48140523A1F28DB8 hilarioszyszka
1,666,283,678 *AF526B01CAAE3F0B84CF6E06F973E7765004800D 6aanzetschroeven
1,666,283,679 *AF530F411C33C7BE268F319F22BC5FF3531C8624 bsglw
1,666,283,680 *AF5B99E5EEC45121F4E2E4231C9F28733C71B532 [email protected]
1,666,283,681 *AF5392E7E7B2959B27104321B6B4C942017466FC 6BRIANNABEACH
1,666,283,682 *AF578B81C71FD57DA11722C4A8D80242051FBB45 hivemind ep
1,666,283,683 *AF5F15BCD869C05B598D189F9B0033E0E700D997 6DETANOINIPO
1,666,283,684 *AF592ADE370BBD7DB94B87715467F2640A664B4B b,=#t
1,666,283,685 *AF54AA0231020142CCF3866C720D008D218C631E 6EINZUSTELLEN
1,666,283,686 *AF5D2E0D3012102242F7D75EDEECE45129AA5F04 6GNORTSPIHSNOITALER
1,666,283,687 *AF5F29CFDD1D852541597F57105A4FDA24377992 6HOLDOUTS
1,666,283,688 *AF5ADA10CE70E13A33CE3A74E9872EC2558AACFA 6INGMAND
1,666,283,689 *AF5532C56A7A904A4EA136FD7CA6761D743BA84A 6JENIFERRABBIT
1,666,283,690 *AF5F4D832290386B16D6A111A9DEBB3822C53006 6MAJORDOMO4
1,666,283,691 *AF5A6156DCC5D9A06518C163B4627E9A82FC6A96 6PLYCHRMRDN
1,666,283,692 *AF586324DDCB6638034C2E6ECE916015A50C4F5B 6TARDISMILES
1,666,283,693 *AF5BD32EA0FBB17C52DA539F5EA84DBBC906569C 6TOCHAISEADH
1,666,283,694 *AF51DE7D29F3E88F69617A44D8E37EA36675AF7C busterwillwerth
1,666,283,695 *AF5A655A5A680DB95E137E012D1A42700E4B877A 6VOOROUDERLIJKS
1,666,283,696 *AF5B43D30F7CB89B9F584465F997999552C4806F 6YREKCALF
1,666,283,697 *AF59B3773C802958B12E337B01147931A5D8A77F 712674 tum-yas-gruplarinda-gorulebilir-.
1,666,283,698 *AF56EE6E1D9C62F51A25A2ED659E97EA69806DF4 Bvg&
1,666,283,699 *AF5CD181B3AAA7C08815C6FA31723F0DCB6BCDFF 775968 RV MF 1145 / 1 HEDBERG , F : MEID
1,666,283,700 *AF522BF68804B72B0D7D03733025633602F3231F BYME1X
1,666,283,701 *AF5650C0CF5BC4635D05546BAFFC5643E5E41403 HUTCHINGS-CALDWELLS
1,666,283,702 *AF5AB9C62E40F01C934B6A55B9332B1D723F12B1 IAMBENNY94
1,666,283,703 *AF50090162DC86721D2BFC593C2A068650233835 C3AH;
1,666,283,704 *AF56606104E39F4C19C2204090CBCD4312CCDCDD IAXHAA
1,666,283,705 *AF564E92CDC879BD468EFE8CB6D61613A4A44ABF ibrahim-qasrawi
1,666,283,706 *AF50E27169F6BC15DE879D51371D41B84802B43B ICHELANGGED
1,666,283,707 *AF578EE4EC65D80C92CE9927735B90409D72F95F idiottbone
1,666,283,708 *AF5494D4443BA91471A83002588BEFEFAD6284F3 i-don't-like-mondays-(feat-bob-geldof)
1,666,283,709 *AF5EC790532122F49688AD2DEB67D1D3D23A5FFD ifchelpsimproveretailpaymentsysteminvietnam
1,666,283,710 *AF5F6B6DB19A668C349A0922975E53CB38094FEC 7URAHDUSTA
1,666,283,711 *AF5655A00AAEDB5A89D186C496E40DB7A8C68407 7VREDESPIJPS
1,666,283,712 *AF549684603043C469AC31E40B4E504480F75B33 ii`h
1,666,283,713 *AF5BE65CABB71C0B4F1C2E18CB2C99ACB13F17A1 8ABHIPATTITAH
1,666,283,714 *AF5A96CA41B607E1AD33736DF3410EB77C8C96E7 CACAX971
1,666,283,715 *AF5E79E2746987B99D3143273E9074C346AE7F95 cahze
1,666,283,716 *AF5BB2DC75B17A7A46DB96898E7D1A709C3A1902 CALE’S
1,666,283,717 *AF5AD10159DAFD15A6BDB0F2A57CEF11B4C36BA6 8CENTERRED
1,666,283,718 *AF5199DC697316DDEE0BDD0F6F8F8F8CB69D2A1F ilipelli3
1,666,283,719 *AF5702663B4BF506ED79A1F09298AA05A31592FA [email protected]
1,666,283,720 *AF50B33D903FE9E4F937257984AE3DE0132FFDDE 8EMPOCHIEZ
1,666,283,721 *AF5F276F809E44E51B0C9B0A1735176237D8CD90 ILUVPORSCHE65
1,666,283,722 *AF51F5DE7BEBF9D038C907E723ED592DFA4EDB57 IMAGES2LOSVG
1,666,283,723 *AF5265C3E38753E51BDB8228C4F648E63EE9A709 IMAGE-USE
1,666,283,724 *AF5A86B03840FF0539ECED7CA20305734FBE9435 [email protected] * *)O(
1,666,283,725 *AF58A4F7A1FF3DDC4BCC0C49932BC71DCFB590D1 [email protected]
1,666,283,726 *AF5FD2CE8F9276148EFBBA7B7FCB74274D32495C CATEROTA
1,666,283,727 *AF5E88748ADEF3315E8B4183CDF28BEA5E4D9DFE INHAVANA(MONSOONREMIX)
1,666,283,728 *AF576CD1A44A02D02190F672550A071523AAC410 [email protected]
1,666,283,729 *AF50D5DE7BCFC5C1CA6117B37065C0BB1D625BF7 8SINCERABA
1,666,283,730 *AF5EEB5406BE186E9A8ACD59C8BC21280E1595BE CCTUT
1,666,283,731 *AF520AB5B27272906DFB63CD97E0C7D5B9439D79 ce#00
1,666,283,732 *AF59FA8042D9B904254047E77A851414B77FD519 irina-trofimova
1,666,283,733 *AF554E198A762127B2A271A32855861469289028 C=EHK
1,666,283,734 *AF51724A40831F4714237A71F10FD2B02BD3EB2C 9AMYMELISSA
1,666,283,735 *AF544B547457C3BCE57D9984058803833A68CE0C ceriospora
1,666,283,736 *AF5FAB59E10191D6ED800CE1D086D260EA4A6A7E 9DREAMBUDDY
1,666,283,737 *AF5E0DAD58F421AD1DD2DC5DEEEDACAF04F721BF CGIAMOS
1,666,283,738 *AF5B679DDD8A8472FBB264E3D7AD8F1DA3B3A7AD ISTANDFIRM
1,666,283,739 *AF5098551119FB0A01D30BB01D729D1ABB0D8938 9MOGACEJ
1,666,283,740 *AF5F228AA64E1A5579EED9AC8FF6A1EB2447B7C4 [email protected]
1,666,283,741 *AF50B2124C6F10FD90E8A69A0B69D744B5EA16F3 jacobcarignan
1,666,283,742 *AF55F0FD71491F2293ED72FEFB9C0EDBC8216030 CHARYTATWYNEGO
1,666,283,743 *AF51DE79EC46D7D58EE580A2BDC8439708D893BB 9PEOPLECOUGARS
1,666,283,744 *AF557A96E7CB8BD945B5426C553F00F98584D620 jaime.dyhrberg
1,666,283,745 *AF5A4A8A608972DF087010687FEF745B5B12A4F8 JAJA2141
1,666,283,746 *AF58E466782160B8E4D94FA61063D5A648EF3AF3 JAMES.BOBZIEN
1,666,283,747 *AF54C0DFCC641905D6DE5AF28933E35C42B785D2 9QJXHEJKI
1,666,283,748 *AF5E06E574B35B34C4B609A56307FC2B61B6D497 JAMIE.FOLAN
1,666,283,749 *AF5FE2833E7219ACEB4959699631F13A326EABA5 JARRETTCOUTO
1,666,283,750 *AF5C2CE66B779305E64B68F3B626B4848274C686 JASONWILTMORE
1,666,283,751 *AF5DB06639E13A11117F9B981997BCDF0F12D9B7 9TIARERETLA
1,666,283,752 *AF509D1E284D7A6F0E6D089E9EEE34496F269508 JAVIER.REDENBAUGH
1,666,283,753 *AF58F4CB07ED1170EFC59397F11C86EAE29DD9C9 JAYGJS
1,666,283,754 *AF5F72E81692BCFAD8EF8E4ACF64CCBBC5696A41 9WHISKYCANON
1,666,283,755 *AF5B280B32AA76FB72EE9793EAEEEA0DA6E315E1 JB+M
1,666,283,756 *AF555C954C7F52B292053460A1C15DCFDDFC69FA JCUTAN
1,666,283,757 *AF5F5C21CBD0E94768A37DB4B85BAF0AA8624DFA CHRISTINA.YOUNG.HALL
1,666,283,758 *AF56BB7B981E4630DA38F8161398E0DC57CC6A8E a1nhh
1,666,283,759 *AF5ED7AD072FD2762D31B24467927B1D62176589 A)5Y
1,666,283,760 *AF55B0631C86D5BA31E638FC01968B8D16016894 a9;?w
1,666,283,761 *AF5A4E6684B43E4E4DB4915C4CC576C46280A392 aab8k+
1,666,283,762 *AF5BB5A98CEF6FC2BF5C842F41E352FD1AAAE811 CLEMENTFENDLER
1,666,283,763 *AF51BA536B09CF1C7D6D60A05F292DFA48135C5C aacgsh
1,666,283,764 *AF55D0BDCEE3CD7BEEBF636CED4352C10D45E32F aacp>&
1,666,283,765 *AF5F99CA0EE25F5C8BF8A514E2B4949E26E3115A [email protected]
1,666,283,766 *AF50E2AA2BF697211CC468621C55081AC32336F9 AAFM+_
1,666,283,767 *AF58344AF0DFA2DD967D1621D348CC8796F4150B AA:#G
1,666,283,768 *AF5FAAA19BF4F071C2EAE5A4DD25AA49DB212F58 JOANTROWELL
1,666,283,769 *AF5B452599954441BD0841DC47594F7F4865EB0F aaronfriesz
1,666,283,770 *AF51256D1CD80BD0B69392AF821DFBDDE45B87FF aaron-shevlin
1,666,283,771 *AF51FC37F933C2346FBFF76144B538D2622854BC JOEDRESSMAN
1,666,283,772 *AF538F0960CD5296F5B3544EAEBB039356F2FE65 JOHN F MCGUIRE
1,666,283,773 *AF5F8927FCAB650A99CA9256874EECBD1DECDB09 JOHNNIEDORRIS
1,666,283,774 *AF59F2D047128058D2AC4EAC9A23A27942BE7A74 abeguidi
1,666,283,775 *AF5D1A7864F03B0C5D360C09A78BC4E504F49CF8 JOHNSON-SIRLEAFS
1,666,283,776 *AF54D5EC217CDEF2D3D86178DE32F5D61873F83F [email protected]
1,666,283,777 *AF5CA6F6ECD1130FF317288EA978F268B0DC400B JONAH.GILLESPIE
1,666,283,778 *AF565B2CA2F88E69B12D632C1BC734B5D8458385 abshafer
1,666,283,779 *AF5DFC9142148FCAD5BDD67EB3FBEE132C81B0D1 COISSIOC3
1,666,283,780 *AF5B8F795E01865C9D8DC07927356C918DC2A1CE COLBY.CHOLICO
1,666,283,781 *AF5304BC59A5F9EE78CF4EAD23FB95646D180361 A&(C
1,666,283,782 *AF58E234D335EAAD60D41BB2AC6CDBC6E7471784 AC7[<
1,666,283,783 *AF545F305B325E0E868A2E437964E7BDA47805F2 JOYGODOY
1,666,283,784 *AF526784F99F6E8BDA8FD25AD1A3749212C3763A JPGが最近になってコモンズから削除されたためTEMPLATE
1,666,283,785 *AF5FD4DA76EB865220645B81EEB9369079E0573E juan.jose.rondon
1,666,283,786 *AF5C2B896E2C5CE7FCA530AB40B809199A0425B6 ACAUDELESCENT.
1,666,283,787 *AF56690C3D5C31EC8F663E896FBBCB85932F7A88 ACHAMILL7
1,666,283,788 *AF5192DBE676098CE6AC39A321C317F33EBE8333 achelōus
1,666,283,789 *AF59A42378C2942300B13635EFC4DB74118EFE0B JW5686
1,666,283,790 *AF58457F420F0B887C5852028BB022F0709AD009 ACRO5POR3
1,666,283,791 *AF589F3CF428F2A866FBA3985671EDE4DDEA1C42 K16P1
1,666,283,792 *AF51C62743BC63987444ADC3CF34246B51A95B76 ADALBERTO.KONNO
1,666,283,793 *AF565ED60A5EB84239B15170BA74F2AC58A2716F adammclean
1,666,283,794 *AF54477B24EAE8D0E0C60AF07CB3307F5C589FAE KAFFENBARGERCOMWWW
1,666,283,795 *AF564B24617E0DB4CDE83B027C263CA90FEA686F COYSAXMAN
1,666,283,796 *AF5A3014CE40F52CD51D797A19E66A3955EDE22A [email protected]
1,666,283,797 *AF557DDD44EC6C571C8E17E4F78ECDB9434EBF1F C,PL4
1,666,283,798 *AF5487B123B44D4BDA528227F1E90B7B63742304 c:\program-files\microsoft-sdks\windows\v50\include\dbdaoidh
1,666,283,799 *AF5994A855890A8E624714D3D6545B62745A6399 KATIONENBILDUNG
1,666,283,800 *AF5F5765D684F09D6C6213F255C4CE407F3F74D7 ag_%d
1,666,283,801 *AF5EFAACA9270D21DAE7B0307BB9031DD8A4BBBF k^<e
1,666,283,802 *AF5878005DE7032B075A3FAC5288C785800CF58E keithtortoriello
1,666,283,803 *AF56A49A2E8ABB4B1D63A16C01BF77AD6A6B543D kelleyhusanini
1,666,283,804 *AF592B7F9A4C101283812159CCABB041A994E7FA c/s?z
1,666,283,805 *AF5A4D8A2FD59B4D366765D97E5748093A3287A6 ctj&_
1,666,283,806 *AF574362C6B12FCB9A379DA9C5D4526E15861131 A.HPB
1,666,283,807 *AF5FBAB2F0E757921153CD1AF4ABD19451059E85 [email protected]
1,666,283,808 *AF5A35697DE01E3ADE964B327805D9A5195178A3 a;ifd
1,666,283,809 *AF53816D424AFD48E79F69233A2FA9E7EBCA6A66 a?ik
1,666,283,810 *AF5FCDDE6C7CCE5C93A3D2B35F4EFEAEB824DB68 KING.BOLLINGER
1,666,283,811 *AF568A9F9070BB4979772DBB151501636CAEA085 AK4t
1,666,283,812 *AF5610AD691FD4926BAE19065E515F2FC5F6A47D AKNLG
1,666,283,813 *AF5F282FB40E8B4FD7550932E2D5E6CF0CA2A779 alala'a
1,666,283,814 *AF58626EC72994CFC5B171C033BF0F5F8199C62C ALANDEANGELIS
1,666,283,815 *AF5779E9BA0BB11815FDDEE9309BE6C1D09EBD34 [email protected]
1,666,283,816 *AF50EA56E520C5746798437631F7292E2652679B D(:#
1,666,283,817 *AF5AD57C5C30FB37518B47DE928EE71C420DFE11 D32E
1,666,283,818 *AF52C6FEC7BFA8472A2CFB254247C437845B2991 konsekvensrettelsen
1,666,283,819 *AF5B86D32B2592958AB59AF3BA973C8BF7F05F6D KORALLEVET
1,666,283,820 *AF55EEF5399DADDEF1707D2E90D7E0537F238449 D4%DU
1,666,283,821 *AF5422296F6351E3C8D446967EE1FEDDB018E862 ALLEN.SHINER
1,666,283,822 *AF5C3EE35682ED898FCF921B58745481F978B7F7 Alles.fliesst
1,666,283,823 *AF5154872484ABBF6500A4A9890EBBA964353FE1 ALLF
1,666,283,824 *AF57C6D00A62BF88A74CAB15BDC64591C1EDBC6A kristian-kathyrn
1,666,283,825 *AF5186173C3EBA0603FC684DE7770842C1C93A57 KRISTOFER.FROTHINGHAM
1,666,283,826 *AF5B1762ECAADB80BD8CA4FC66A434DD931DD144 KRUPNINO
1,666,283,827 *AF56758873F0F4DD811EC486C4B362EE4FD2E7E5 ALU
1,666,283,828 *AF548D93DDD13B8FE5C275BF0D0DE6A784F78A8D KULTURAGUNEA
1,666,283,829 *AF5CFB6AB37A582B294870F6FC55F00370741CF2 d;aj5
1,666,283,830 *AF5EDBA475988DA2A3FF2EA347E1AE9C52016D8C KYLEBASKETT
1,666,283,831 *AF5062A65154F9EE21A8953A77DDBE395E0B8B82 KYLE.KLINGENSMITH
1,666,283,832 *AF555374E98ACFAF3CBB3995440D81BB745E6835 KYLESCHWENDEMANN
1,666,283,833 *AF5C8D517D0EE4D0405375A489257AD51C2C3433 DANDHDWNED
1,666,283,834 *AF516B66A330DA39320F9CCFA92546EFEB2541F5 DARENSARGEANT
1,666,283,835 *AF5CA8C931FD9B88FBDCB02EF2BDF4173F7B363D DARINOLP
1,666,283,836 *AF53B5658841F4AA7922B9194AC5100729BC5CF1 ANDREAS.ELLARD
1,666,283,837 *AF531D41BEC3936F754C6B2FA0143B87C1D099E4 ANDREAS.MAYTUBBY
1,666,283,838 *AF5D17923F0A1F2E236FE291D59E87D4485248DA andrew-freundlich
1,666,283,839 *AF501698E0F28430F73B79A596020A0273D590F1 ANDY-WROBLEWSKI
1,666,283,840 *AF5F4B07B9F91F31CEE2E7366BEBBD2CCCEBCAE3 LAPSIKYL
1,666,283,841 *AF5996637FA0EAF01E6C9C638FE31350655E4D4E LAYOUTGAID
1,666,283,842 *AF56520D604EF929CEC3EFFF5708C17CB435A167 LBIE
1,666,283,843 *AF5C39242A147447B9F42E7F4E54C5AA2135473F LEMONISM
1,666,283,844 *AF52292784E4687CA61E40A6E12AECC0825B6CC5 LEMONTABLE752
1,666,283,845 *AF5A5661E36A65D0EC50B18CBB3095451EEA427C DAU8I3R
1,666,283,846 *AF56C5E0462894A2ED8242652CC38CE609673956 annelia
1,666,283,847 *AF51C4654D09583C49046C7BECB35674D16D96D3 DAVID501
1,666,283,848 *AF597E6DD6AF21245CFE70EE4161AF7A7989A204 DAWNOFANGUISH(KUNOUNOYORU)
1,666,283,849 *AF5448EF15C52CC774F55A69E4E9DFCAA467792D antimetwpish
1,666,283,850 *AF5ECE4A0D039F881E881B2A31986FDE11F838B3 DBSPV
1,666,283,851 *AF56E22FAC37B2BB5954D32D3122A883E200A2A0 dddevil
1,666,283,852 *AF5883FAE163F08980902B5D10FE1667F80DC9FC anuisant0
1,666,283,853 *AF52E0A94376F1E872F427C7038963DE36EEC86C ANUSIAR3
1,666,283,854 *AF556DD96B652AD8E5AE2D23BE45227D1D5D44F0 [email protected]
1,666,283,855 *AF5A4E5C29DD9C871306C657647F0C4365AA3CEB AO,GC
1,666,283,856 *AF54288E5E85987C94D19EDE242F5C53ECFED28C DECILE
1,666,283,857 *AF5A53C87964B0BD3B4FDAF8151703ADE38E3958 d.e,e
1,666,283,858 *AF5580FBB7205F7BAC82E6BC56AC72931B637524 ARDEN.SNAZA
1,666,283,859 *AF50D6785738DCB18A0BD2F83F533D938FB5E264 [email protected]
1,666,283,860 *AF5E1E63C95C46F173ED18F25C23C50CA200BDE3 dennisaswegan
1,666,283,861 *AF5BABFDD9A189CE0CE9FF1093507B15C3857033 arlenpaddio
1,666,283,862 *AF54685B40306A9007E143304CDABD68EEEB580E [email protected]
1,666,283,863 *AF59EFC30139F3C69C0D6AF8AEC00E391BA2F2C0 ARLO_DEAN
1,666,283,864 *AF5DD5B94FFEA46EA1D388DC69358C1B7950166D ARNOLDODASHNER
1,666,283,865 *AF5E0D35C9DE23118DC3E616C973D3D2C0D55144 arnulfopurple
1,666,283,866 *AF5FFD9454F5B1701B44035E36365996786EFF0F LKF900607
1,666,283,867 *AF5DEAE45F43C1C2A8564C11032F8F06B3A85D79 DESMOND.KRAPF
1,666,283,868 *AF5E7402340FA18805E503A1222613B7AF30458D desmondkulhanek
1,666,283,869 *AF52C136FC16805F0935EEB719D56DE370289130 desmondmeihofer
1,666,283,870 *AF53D41EACF1F7B8ADE591900D8DCE936BE1B39D [email protected]
1,666,283,871 *AF5D680A788D628EDB0E25E64D4F1C7B36B66BB7 DEUSER77178197169
1,666,283,872 *AF59D7D69657D7E4413721C9FE6B8CC93F7AF906 D;eV
1,666,283,873 *AF54ECD7A801CB5C93E8231C5D55EE4FC5F0298A ASDFSEANED
1,666,283,874 *AF5C333728EAD85109DB3A0A78B723997B25229A ASPEN80
1,666,283,875 *AF5445EB6160BAF2AD0F6A98D524EDD0531DF6B8 [email protected]
1,666,283,876 *AF5355D768305A880DA0E4ECC65FBE44A4268AEE LOUIEPHILEN
1,666,283,877 *AF5FC528C35725F78F861D8223AF3A18C01162F9 LOU.SAMAHA
1,666,283,878 *AF5BD874EA35211E8DB45926538BB97FD802CEF5 ATF7-
1,666,283,879 *AF5BE23D54A19A7B4086FCDE0B68BC31A62963A0 dhjg
1,666,283,880 *AF553B24D8E15D9EEEF633003D030CD1666339F7 AUBREY.PICK
1,666,283,881 *AF5530F205CBB7DED9991BA46F1BE44B67755292 DholWajda
1,666,283,882 *AF5D71C2F31FBF0584FD4A9FAD12EEB47C17C477 DIAGRAMA.DE.THORNTHWAITE
1,666,283,883 *AF58C68E6A9B4C90F6F6F346E256F1B8B9E9C055 DIBENZODIAZINE
1,666,283,884 *AF5B71F653B79F2CCF325DDB2FBD37FBBDED3C93 „AUSSCHALTUNG“
1,666,283,885 *AF575632798198BA1C07BAE22DDD52B5FD000BC8 AUW/N
1,666,283,886 *AF5935168D5B8CA8D165348D2B459E7FED09C6A6 av9s:
1,666,283,887 *AF52240B4DE58B6FAABD13C8E1F1AE99F4FAED39 avfp
1,666,283,888 *AF55FBD239F1E7171609D3741A1086C4C89CB2FE avs:b
1,666,283,889 *AF5E3B97C69AA6093EE1FFB3E98CCF8D278B48E2 dirbdoow2
1,666,283,890 *AF5C8F98BBF33687A9F1A5A77AAACF95B97A2B00 LYFFERED
1,666,283,891 *AF50EF03C9200F070E5D1CF027658140D046E2AE LYNN.DAMIANO
1,666,283,892 *AF59698612DCDED0D0D8862E1007D508A9CF0CEE dislodgment1
1,666,283,893 *AF5DB30E44BE92CF4BB8BD99D4BD38C7897C23F9 DJDEWEY
1,666,283,894 *AF5554ED9180218D2DAF87A348D42296A3407E85 DJI)(
1,666,283,895 *AF5DC7806C9AF5037FC9A875A9924648D7F0DF1E B---->~0~o}X{
1,666,283,896 *AF5C4A53FD0745DBE841BDA67F024BFCC85D4555 D#KBI
1,666,283,897 *AF5583F4FC733CF5F5B89055957C716C3C0366A1 b%3=!
1,666,283,898 *AF53E4A89574C2A8F6FF39BFA4E4BA2430B10C7F b3o%3
1,666,283,899 *AF50F4A925B1530B839BC087FA69CCE38A2A9F70 manageengine''manageengine
1,666,283,900 *AF5721E83BDB83D573B874C8307B5615B7AC8120 BADINERIEFROM"SUITENO2":BADINERIEFROMSUITENO2INBMINOR
1,666,283,901 *AF5437B602DA57370ECDA6FF0F99208EB2649323 docf
1,666,283,902 *AF524E63B9C6FF1A045E0CD560528166D100CD87 BART.BOICE
1,666,283,903 *AF5DA512FF28515AB598AC0874EB3AC27CEAFAA0 DONALD.AKKERMAN
1,666,283,904 *AF54A36951BD0019D7C2452A0F74AA7AD0663E48 MARC.FLITT
1,666,283,905 *AF59B6F9514741F7FF91594F1704A8CCA859BE13 BASIL.SMUIN
1,666,283,906 *AF5C2C8944CFF3885CBAF7DF8C77DDA79FDA4A4A MARCOSYEO
1,666,283,907 *AF585BBFFB575A9DDCF0EA83D0F4E4169E35F53F BAT[email protected]
1,666,283,908 *AF5D009D75F58A3F895EE68E401C4E240187F3FC dongmccreless
1,666,283,909 *AF5B2EF8403A842594172ECF97C784CDDD57F710 donnalfaro
1,666,283,910 *AF5AA8A4CDC239F7FF7E8CCE8E399456B77232DD donnybadagliacca
1,666,283,911 *AF5FA467E531C926492B636742DBB84B4F503935 DONOVANGRIMM
1,666,283,912 *AF58255B3BFEBAAA538E2F6C60829132F006785D DON'T RUSH THE RIVER
1,666,283,913 *AF5839B55ED101FBE80F692E36DED35940C42E99 DOPE-SPACE-NINE
1,666,283,914 *AF56F8D6C6CFC87F2A09B5104FD6C7BCBB886C4A B------B~o{x}
1,666,283,915 *AF58EF383194F645A3329D04FCD05D2450D2A946 BB'sTheme
1,666,283,916 *AF578205CE4120A1826137368C7605CFE4ACAE66 b.bz0
1,666,283,917 *AF553C48C2CF4976A1D376DF1B64F6653698D6CD DPP%1
1,666,283,918 *AF50F4E9DB264F96185F9F64410431230CA01527 MARTA.KUBICA
1,666,283,919 *AF5BEDEE72C6F9F20DDD1797DA1FDAA3DEA0CEA0 B####D~O~O)O(
1,666,283,920 *AF519B4C400DB5493518D2BB9BF084E431780D1B MASTRET
1,666,283,921 *AF58C739EF8CA5A59C029ABA78244DB393046914 bekc
1,666,283,922 *AF5CA5F99F4DEA2BA0B592340DC5A976F444A1B5 MCABADONGA
1,666,283,923 *AF50AB4D3E378F7BEB820AE3AE4260ED6236B07C MDISAISING
1,666,283,924 *AF5C4F823123291FFB4ADE253362F812D19E02EB DUANE.AVANS
1,666,283,925 *AF5B5388D8CA4A7A70461B2832A60E40D3A6D79B mehmoodaalam
1,666,283,926 *AF5F05E5E32EE17E6A133152A5287A6471FACEED BERNARDO.GURAL
1,666,283,927 *AF5F7A27AB15C001693D1B101F0A942E69A47A28 member-in-charge
1,666,283,928 *AF5483D146AAFF37A8E7719C810AD9176589F3F4 dustincarlen
1,666,283,929 *AF5F3FD248AFB724D8412268BA730307BFAAD103 betterproportion
1,666,283,930 *AF581385135EF9DB0D6F128FD6EC052290536EEE [email protected]
1,666,283,931 *AF53BB675224001DBF52243B2043368DC37D2D72 ebdefeba
1,666,283,932 *AF58C57D5A4BAB6DC08D6D9F51DC75B4D1E90058 ECAFESOL
1,666,283,933 *AF5921BF895BE5964F55211AE2E2874026CDA1C3 MININVASIVE
1,666,283,934 *AF5BDA540DB05D0FFFFFE9A71FFF5BD8DBC8590D [email protected]
1,666,283,935 *AF52C253F468A31A9E55BBA9C45EDAD9F4916079 BK6,.
1,666,283,936 *AF5631E7131D7055D31C7D855A01C6BAEDFAC58F BKCLUBCARE.WORDPRESS.COMBKCLUBCARE
1,666,283,937 *AF5788397434D0C642BF41B54DEADC72BD565B9B ED.RENTZ
1,666,283,938 *AF5064FC029A41A6C58E583E624A07F359A41A2B EFRW
1,666,283,939 *AF5313F010C2818F6AAD2FB3801B9F858EB202B1 egmi20h
1,666,283,940 *AF5181ECAD2C724BB32FAF1F8279F1DAA743C074 MORETHANATHOUSAND
1,666,283,941 *AF57D3AE34D52F83C805EB539607EAFFAD18AF40 EHXZ
1,666,283,942 *AF5A721C4026090D46AA6983E13B572AD263B93C ei=e=
1,666,283,943 *AF5593A9461EB7DDAF81018437846B9985DF0507 MRHOBOMAN
1,666,283,944 *AF511A1E45AFBCCE8C81B701B2EFADC34935B0F6 MSUWEBSITE
1,666,283,945 *AF5E5FCBA8DDF2E6A577F07071EFDA60E42F1911 ELENA.EDGE
1,666,283,946 *AF58F5359F11E1A5EE00D659EB343958D4EBB6F2 bomvrijst
1,666,283,947 *AF54A12928105E39A73C3C673DE6C4BC4B779E80 N0NA8RASIV31Y
1,666,283,948 *AF57A13CBA6734C21B0088F9DBD4FF10B43EC62A ELLISGROBY
1,666,283,949 *AF578F680667D6CE90B2E2D80DB28582C1B18714 ellsworthlebsack
1,666,283,950 *AF5DA40AF70620EDEDC752F22C6E0FEB531ADBCD bovanderbilt
1,666,283,951 *AF5356957B26B5077681557B2F376C46245BC825 NATHANAELARELLANO
1,666,283,952 *AF5FC6FF062EDD0BB50874F3CA431A14BF5E916B nathanbegim
1,666,283,953 *AF55C45F91C519D1F2D46BF52F5264BC3B51199F [email protected]
1,666,283,954 *AF59C9BF8027B5F2EBCE28A9CEB0FADE8C56043A NATORIA8
1,666,283,955 *AF5E917FB56B35C25DF91981D316410B4A3D5436 emilpetrizzo
1,666,283,956 *AF542478760B596EF3778EC930FCAF2DCBF38287 bradcronoble
1,666,283,957 *AF5071C0771DC1C521D8AA01778D853FBDD549BB NCTTRCS1
1,666,283,958 *AF52E9E43FA7A4CD8EC13FBCBAB61CB54EC9EDC2 neddood3
1,666,283,959 *AF5DEC09D487847A5C590C33C0C2FD961479696E EN832252550
1,666,283,960 *AF58ECBF07A709E736166A8C7CAEDB67F6D52F97 ENGOURDIRONS4
1,666,283,961 *AF57B25E706146D5B1E80E1B6AF1B42532221C09 ENUSER691168185
1,666,283,962 *AF500223B441774483E60F4239F04176DD4E578E NGAN-VAN
1,666,283,963 *AF52ABC3246AC33A625E8A0AC696485784EF9C7A brother [woxy live lounge act]
1,666,283,964 *AF581E89D67A713BA3DAF17B405DAB332EA25AD8 BRYANTJOLINE
1,666,283,965 *AF5305EC9299268B5EA299F07EEADF649D590ED3 bskm23800
1,666,283,966 *AF5C2296E206436D0C42744D781A79D5C8F4887A nipagesz
1,666,283,967 *AF51A1223511F37B391B0178FC4128BF1219C5F9 BtVW
1,666,283,968 *AF5CE2DA86D35228314BB543EAA47DAE878BF82A bubbateacher
1,666,283,969 *AF580869E43F68A6E7037A8813D333C361C4DB4F BUDCAZENAVE
1,666,283,970 *AF5EE2A8F21A59EC4B14B131E7C1C42596BA1985 budck
1,666,283,971 *AF59EE84AB015709962546403C58D9329B04B5F6 ERRLINE0
1,666,283,972 *AF51BBEB22EFCB8639D9440E375FBECF1833945A ERWINHARTUP
1,666,283,973 *AF5F1096B6FF5BCE34B9DB517C5F7CFEAE1959F6 erwin.lemmens
1,666,283,974 *AF557446518941AE25AD046AF0F44EE4870DD84C B"URL
1,666,283,975 *AF539E4B7BEFE0E6164A5EE74AABAE205EF0D8EC NORIWOLB8
1,666,283,976 *AF5783144434A7F9D0532D32E8D13EDB06F152F1 NORMAN.KONAT
1,666,283,977 *AF5348DA432056E3703391B62694DA97A0EBE9F2 bwi%o
1,666,283,978 *AF563B00759B2F074086A12AF58A35323CDC9CCD NRHCSNLLB
1,666,283,979 *AF506B17F5D1047480A407E2D18A637FB11B527D B(XIZ
1,666,283,980 *AF58C991E284FB33B536C1FBA4A6CF90BEFB15EC byh$e
1,666,283,981 *AF5232F38CCB30B460FF8BC91BB55D177356F62F eveirhsr7
1,666,283,982 *AF5D49BAE245C8CEFA308B3902A4E76AC0E35AFF C2"T
1,666,283,983 *AF5241328A7677BBCCE93D204213A4BE193616D2 C4(BJ
1,666,283,984 *AF5A0D504FBF6B3368A6D865E0AF978C677D0D01 C4RD!N414+E
1,666,283,985 *AF54C03A1CCAC1A99C35201BF35B93E21CA582D6 OG,+
1,666,283,986 *AF53552919FA7AB455AB9A7034E0EB6FCC76B1E7 C#A0
1,666,283,987 *AF56938F3EAE2532ABD2671A22BB2B892221EF20 [email protected]
1,666,283,988 *AF555AAD306C12378D76B5A67952CFE2F7E3F20B f6ug
1,666,283,989 *AF5BFF985ACA1BD06EA2469492F68BE20672DEFF C#AJA
1,666,283,990 *AF5169561AECDE1703DC8F60CD673C846479F462 CAMELÉON
1,666,283,991 *AF55EBD8BAB03903E88F1D3458296F0B24344846 CAMPUSGREENBUILDERORGWWW
1,666,283,992 *AF5DEC8C9633B1EDEABB699B96B32F173DECBC5C [email protected]
1,666,283,993 *AF5F54BCFDD36C2DF7C4662FE6007DFE717D5268 ONLY-PLATFORM
1,666,283,994 *AF5DC1488931AF651732FD9975DB9AFFAA13290B fbc|
1,666,283,995 *AF596F99BE7A9B36835CEB9B6C7FEB7E26F85195 FELIPE.JAMASON
1,666,283,996 *AF5CCC0B044665154A4860054728FF528B44AD57 [email protected]
1,666,283,997 *AF54300D13AA638599980B3844B3D46CA9F5AEF9 carlmoessner
1,666,283,998 *AF53A51AC923B40C94621B494B127FD0517D1D08 O~.<====p
1,666,283,999 *AF5C5F9BEEC85AE6489498ADE59AAE8DFFF84A2D CARLTONRUBOTTOM
1,666,284,000 *AF54B18C96893A1E499C8B1445D449F36B697E13 carmelobierod
1,666,284,001 *AF549FF613E5B15ABE12D28A24380D168D067F29 CARMEN.EBERWEIN
1,666,284,002 *AF56752D5BC5E78B1B5BE86D18C1BE5243A34295 FGHSAD
1,666,284,003 *AF58CAEA3EBB6F1745279089DA2FA0FE13799C6C fidelkorpela
1,666,284,004 *AF533D87D8E8B59497E32BCACAB964D5DBC72CF0 CARROLLFITCHETT
1,666,284,005 *AF5D5C430071F56F3C3FCC31D6F6C923D320D89B FILM HISTORY
1,666,284,006 *AF506AD12073610B1099A10EC33ADD51A34BB3B8 cathedraleevry
1,666,284,007 *AF52B098374BA233F9F03559833074DFD588A6FF [email protected]
1,666,284,008 *AF5C4E32EFBC5C6ED18CE18C6A91CA8E83A3E63B OV3RTAXAT
1,666,284,009 *AF58F211713DAA76AC752F31AF9BB7CD423E737B florenciobacak
1,666,284,010 *AF57D7A6E4E1E8FDC3B2129D8D1EF4DCFA069A9E [email protected] ~0 }O{
1,666,284,011 *AF51D00757157170328BBE1D8D3F1E395959D5EE floydsympson
1,666,284,012 *AF54095DB2A1D9F99A7ADE7F733D8F56B6C8B813 FLUSSO-BIANCO-DELLA-NEVE-(RE-CONSTRUCTION)-(FEAT-MOHAM)
1,666,284,013 *AF5653D9C9AABEA200D9831BFEC30EFD5DE44FD4 cc;+)
1,666,284,014 *AF5C8A19DC11C664CD340075B804005278B4B3B8 P4R457Z3
1,666,284,015 *AF5AE8412E00460F4159F56E4BA44B167703EF8A PACHYATE7
1,666,284,016 *AF507ABC53AAEFCCA21F6DC04CD4B8D3F7B112CA fornicationwithadecomposingstump
1,666,284,017 *AF5E9B817A0F754ACBCD23AAB2D0C020D2CB8D4B ParameyParam
1,666,284,018 *AF5FF7AD1064BCEE00F3EE09013C4E0FC6A2A8FE [email protected]
1,666,284,019 *AF51CCCB826727890092490B1AA1BE06B9CC160C CEDRICK.PORT
1,666,284,020 *AF5EEE13E7E1E8341AF0C0712C418995EF5CC1D6 PASQUALEMANGAN
1,666,284,021 *AF589F665554C670B38C871B7B8FE6198F9B79AC PATERNALITIES
1,666,284,022 *AF541ACDC8F055975A742A9B1147856DEAA1218C francisjoline
1,666,284,023 *AF5FF3FB4335DBD532F6A118920EF42C98CBDEFA „FRANKFORT“
1,666,284,024 *AF5AC3F6D3F6777FC17A6ACADFC4F3C37DA7F6EA p##B-~o)x(
1,666,284,025 *AF5BB97D295E9D793448D24DCF53344DBB0B75AD pdgnstn8
1,666,284,026 *AF551522EF0AEEFC125F4F6FA8DDC47D5A6684BD CFYC
1,666,284,027 *AF519503481E86B4BC134FF7326D0EB6BF242EB9 FRITZFA7
1,666,284,028 *AF5C18AB8A3B7E6CDBCD89867E6809538C910430 FRITZ.SOWARDS
1,666,284,029 *AF59317C170184724659EB20B7739997269063C6 penkkipunnerrusennätys
1,666,284,030 *AF541002176476871253569CD02B4853675365FE personal.legends
1,666,284,031 *AF5E2B95A24974587465CE24EEF08FEBE8894483 FUGUE,NO.10EMINOR
1,666,284,032 *AF5CB066F850B6B2E756ED03D984D6C0D2E7AE9F CHANATIES
1,666,284,033 *AF57ED220B1B962D48835C0405DB225710255F2E funouhan9
1,666,284,034 *AF5118E05A201DDB607FC1B0042D6D455329A77A CHARLIE611
1,666,284,035 *AF598BF17F66F01282C2F19153B108DBE4F2742D CHARLOZV
1,666,284,036 *AF58143FED55F9D240646339B4A1D2E0F2FCDDD6 GAJP1416
1,666,284,037 *AF5ED41B46B69874C3EECBE24467FEDFE3DF5E1A PINKPIGGIEH
1,666,284,038 *AF5C60DB77791FFB7C77937BA086E66DC2204F7A CHOICE-BIT-OF-DIRT
1,666,284,039 *AF578944A9F06BA310D3ED1E4EF4B367AFEDC8B2 pirtsria6
1,666,284,040 *AF56A74E26817C481F182DFE60858A5834BA836C chrysogomo
1,666,284,041 *AF592D719124233CB17C63E4B6430B52FB4B4C87 CHVb
1,666,284,042 *AF5D5AEC9BA529C74A841F1E614430465C587F66 PLAYCESES
1,666,284,043 *AF53B3F7AEC65746670551B898221C37C703AA1F playhell6
1,666,284,044 *AF5CF1613EEEF962156482E134E1F5C8DEA9C454 GARRY.SYREK
1,666,284,045 *AF58D900234E047A035984F88E478B82CAFE9A66 CIEJ
1,666,284,046 *AF58D8A1933AB9C2BEA4A5866B7716F9F529F2A5 PLIJFMJ
1,666,284,047 *AF53671C32036751571C2ECC2061FE0471FCF5FB garyperham
1,666,284,048 *AF526A9E2C42639ECB8DDFEA0858E6988E2DB189 gary-william-friedman
1,666,284,049 *AF50EC69A5CC0A7D0729AED30BE26F2C72163CDF C#J"
1,666,284,050 *AF5EB3D6C33773B3862D5DC6C8B3332201737303 claudneris
1,666,284,051 *AF5A13E654CE422DD66E39F230D0E9712BAD89D8 gele.
1,666,284,052 *AF5FD36DD797012E7FFDC2918E7C8E9F2DC054E7 GEOGRAPH451223STEPHE
1,666,284,053 *AF5829175F6B5341824AB26D86CE67A603654173 CLIAMEDING
1,666,284,054 *AF5A4D492316DF0FF73194E5416E2D8473FAA99A GEORGESPOND.WORDPRESS.COM
1,666,284,055 *AF51D48D9C789381946340517865B477E60344B2 CLIFFORD INDREADFULWARMAYSTTHOUBEOVERCOME,
1,666,284,056 *AF58572D065E328EFA6D88C8D1E8262CE8CEFC2E CLIFF.SHETTLE
1,666,284,057 *AF573F6062C703C7D01ED8B7876059D9DFC0F6FF CLIFTON.MARGULIES
1,666,284,058 *AF5AF43E3304E6A873F98F0D46A7F501C52F6993 POZIRALI5
1,666,284,059 *AF5DF4DB3D5F103B6DF64FF3587B141FA01518A2 CN+8Z
1,666,284,060 *AF5650456BAA76683E37E81666348EBF92B839DA [email protected]$
1,666,284,061 *AF54CFC4D7B3E3E463ECF8059B4F0180B0401587 COCHLEOUS8
1,666,284,062 *AF5A0A91A66507EDDE16BFF79A3E451B1C49572F com7x
1,666,284,063 *AF54ECF30FFFE5CCBA6F79100FFE261E5231FF21 PUMPKIN10
1,666,284,064 *AF5ADCFC3C21BD31A8C2D03595535D8BD366D5F5 goldkörlter
1,666,284,065 *AF580C425A569C25BB435A1E2FB204C3CF956256 cottonycushion.'k/a/t//n/i/_'k/u//s//@/n
1,666,284,066 *AF5C32449F3FE6AE532F098D40B858923997F32A CO$TUM3-D
1,666,284,067 *AF56CBC47FB0CCEB3097471C27FD795C725E64B7 PYTNETAD2
1,666,284,068 *AF56D38277CBCB9D19E1792B5C41BB57946869BE C.&+P
1,666,284,069 *AF50AB8120876D0D7BC9E4AFAAB588A4AF63FB5D GRAIG.RENAUD
1,666,284,070 *AF599A2F0A8B78B0BFE7355A0AE4FE494FB95232 grantrighetti
1,666,284,071 *AF56167EC0D0BF63BA8BDE4BD4562300FF512BF8 GREAT.DREAM.OF.SOCIETY
1,666,284,072 *AF524F051F976C8B27411C989DBCD1D4ABFE0444 GROSSEGILDE
1,666,284,073 *AF5FB3D947E075C88C69369E06C703745E36A92B C?=Q$
1,666,284,074 *AF5A5F3C848CBA4036AF4E43CA7554A8A8CF2A5B GRZEGORZKOZUB
1,666,284,075 *AF5AC4CD69CAD6BB289B216F5908852CAEEA92DB q####P-~-~}8{
1,666,284,076 *AF5346C67B5DC0EBD974CDA50ACB1E6BF6619E5B QP~~:P
1,666,284,077 *AF5B93DDB3F4F3C0AC29856C5D4110449CE1319A QU1NQUEPE+ALO1D
1,666,284,078 *AF52DE86D2BEF9DBC2F49945ED672E8ACFC2B096 (QUACHIL
1,666,284,079 *AF5EB8B18178340751173D6C5D6AD70E4937F33C quente.
1,666,284,080 *AF57BF9D035DA50CED48ADBB7F85EA9AC3679ECE guvercining
1,666,284,081 *AF5CD06A3F3254A23B0A2C4B4EFF6C149F9C7FA8 QUINTINSHASTRI
1,666,284,082 *AF51435865072885CF4AE2DAD83FC69FF38B9894 q[y'
1,666,284,083 *AF547142A1A78A6140BCDB80EC8016545922D670 curtisscheel
1,666,284,084 *AF52507063FA791D026C72F4B92A99A3EF28B73D RAKNISONT
1,666,284,085 *AF52B382A0E475754BCA66B16054DC466D547871 CVDW!
1,666,284,086 *AF53B28C2FC46404338E87BD4BCF0E82B690F240 RANDALL.NETZLEY
1,666,284,087 *AF505BF1521A9A8D98A48B031399AA0D979123B5 harleymodine
1,666,284,088 *AF560C0230332FC60423508A135CA0B7B94AD25C CVWD
1,666,284,089 *AF5CE783C51F0DFDAEA79243B42FB3F06FBE226A cwtnm
1,666,284,090 *AF52C483B612BCBCA54CEC15F17A66C387513E9C [email protected]
1,666,284,091 *AF5F5F3615E7DE64A0519D436AEDBE3CFA1C4002 haywoodagrawal
1,666,284,092 *AF5459CD15C35142DC56E8E288547E630C00C496 haywoodfabros
1,666,284,093 *AF56687EB105D32EB498DA999955B1FFEFACC40F RAYINGS2
1,666,284,094 *AF50FAE2EE9A0BEA102D23073A093B9F2EC5DB2C hcrepekips
1,666,284,095 *AF51227F1C088FA6C45C0334D4B89CF8C95DFB5B czmiq
1,666,284,096 *AF52A0BD658EE940184E92098EC0CF891044742F D0FLR
1,666,284,097 *AF58E3F27012EE2629D523B926436805DC56ACC5 d2wjh
1,666,284,098 *AF5383D8E46926D9361ED40060E4910FEEF402BE d)&6=
1,666,284,099 *AF5ED9B8F0538BF1A9A43CB09C7B445E634097BF REFOLHARIAS1234
1,666,284,100 *AF528AB574ABB8D049E34D263058645B5C7CB841 D7USE
1,666,284,101 *AF5EA3DBA34EF6A5879834363241C71322F37B88 DAKLIA
1,666,284,102 *AF59915D5AC1AB36F5BE02ACEF9EDDF5CB481E19 DALBN
1,666,284,103 *AF510B6F6020CA9F92DA22C8C7698BC3C94C0C55 HERKAUWDEN
1,666,284,104 *AF5A88E29DCF75E0E519AA045E99FFF84FB42942 REJECULA0
1,666,284,105 *AF5347127CB5E4F663780EF48384EEA0DEC375BB dangerouscc
1,666,284,106 *AF5629F3B715EF4BA4DA9094D4A9D6B95EE32DBD REQUIEM-OP.-48---AGNUS-DEI
1,666,284,107 *AF5F482493F3486DF75C6EF1AFFF36485F03C33D DB08-
1,666,284,108 *AF5A96E14503279A4AD1728B179666A0475D8382 REVERBER4T!ONS
1,666,284,109 *AF5838959FEDE5D25D2DE0BA7BD429A73B5501E2 Dbd&
1,666,284,110 *AF5F63C3BFF42BE7D6F79B1C6104D59E97E31DD4 REZEEWDAEHKCID
1,666,284,111 *AF5FA88D078BAD34B1AEA7814A88754BC06A0F32 RF\T
1,666,284,112 *AF5FC4427DBE5EF58DB9411C3271DBFFA34EF00E dd6e&
1,666,284,113 *AF540ACA63BA7562CD6C214CAB146A978AECE60F DEANGELO.CARBALLO
1,666,284,114 *AF5530E4132DB18D5668D3165B360FDBCE4DF415 RICKLEVINGS
1,666,284,115 *AF55C858AF3236B638B84BC52217E60A072B287E RICK.MENSAH
1,666,284,116 *AF52434389911590F7E9ACC9B0797C6ED71EA4DE deb1ted
1,666,284,117 *AF5D4530B56B9C41BB43C726FAEAD0D91C2666CC RIO.DAS.PEDRAS
1,666,284,118 *AF5A79DF3E7F0FD8926A20A9BB6D5B4A7260C115 DEHSERHT3
1,666,284,119 *AF5BC022B03C1A659A3607B4D11F8282D8C901D4 [email protected]
1,666,284,120 *AF515175863819429CD6626FD3E8D42FC46FF705 demarcuslyseski
1,666,284,121 *AF549F8CD49CF2882FF84844AEA84FE25389D16B HTTPWWW.COINMAG.COMA
1,666,284,122 *AF5D4A955E74AEAC1112539782B5D09F6BB32E29 HTTPWWW.CRAIGWARWICK
1,666,284,123 *AF50D9A523DAF1B5CF604E86654A0178EA6F0C7C DENADNDON
1,666,284,124 *AF5A00739A905075440D471153CF0F4CA242ABC4 DENISROHRBACH
1,666,284,125 *AF582C2E4F78DF92D34C1D2FBB74C555BE39F846 ROBERTMELANSON
1,666,284,126 *AF504038665ED826769D86E2A14BE97D0F880A3B denotings2
1,666,284,127 *AF5E7BB6B3BEFEBEDA457882700438D1CA093D61 DEPLUME
1,666,284,128 *AF5E49B1A85E5E6ADFE3FEEAF7D50494A8D3F4E7 robthuskins
1,666,284,129 *AF5233C14812FDD3B5B8269A9B582FE468CDA0CE humbertomaritnez
1,666,284,130 *AF555608113A341ADD08D3D5B60C1D5CC73AFB82 ROGELIOFLEMMON
1,666,284,131 *AF5A375F1707C15B2030CE2434DA0C3A7E4BAC1B devonwirick
1,666,284,132 *AF5FF9DECED9104A49AC76B6041B102F6CBD6519 DEVOTION(SOULMIX)
1,666,284,133 *AF542F3DA4679EA73C66A9F4297CAC4937539149 dfga&
1,666,284,134 *AF58D967BFC4FECA67D89118F4AF3EB0ADA7AB44 RONNIERONFELDT
1,666,284,135 *AF585B4E3718AF1B9342F5140778517EEF812164 ICHIGÓRÓL
1,666,284,136 *AF5719A2D38AECA81B7F8EF751E13B85C4AA4CD6 RONNYCATOZZI
1,666,284,137 *AF515CEE7F2DA64123AEA7E21A5E0B4D3B0557FB IDAF
1,666,284,138 *AF5C62DD749D0BB08A1B9AFB446724B94B06A886 [email protected]
1,666,284,139 *AF53D023FC1AC769B52D225412DBB88A225B7433 d+gsa
1,666,284,140 *AF58F03705287EA2A5B22C70B087F24A58650078 roycemilanese
1,666,284,141 *AF56E3FF2C9908E5015EB05EAC2E1CF41B47EEDF [email protected]
1,666,284,142 *AF5EE58D168B9C97B13ECD54DCC36941A211CDC1 illustrate
1,666,284,143 *AF5EDEB2655C5DFF0AC5DAEE329A9E5B216D6B2D ruhrhochwasser
1,666,284,144 *AF555058C03F3878BF87D7441948041675C30389 ILUVBISMILLAH9
1,666,284,145 *AF5D50C9FFCA379FAD8521BAD1B1DA0C3B48A989 ILUVCHINA12
1,666,284,146 *AF5261D1934544E623BBDE41E76E268530789898 din!t
1,666,284,147 *AF5D1856A433CA0FF868583C3324580D0DA51C53 IN+}
1,666,284,148 *AF5FE3DB1B9CB7C4A47A87DE2818623FD919C380 indianacountyparksorgwww
1,666,284,149 *AF5845F2EA8A540634DE5CD911F004F16EC3074B SA
1,666,284,150 *AF5430E8610EAFC97E2FB71BD97521C18D65B15A INH4BILE
1,666,284,151 *AF5C3C98DFE948D0A41C03A4FAF955BDC67F9641 SAJAD ALI
1,666,284,152 *AF5667D1D1C1138C1A29E5FCCB0F550E2669AA1A DlRi
1,666,284,153 *AF53084970EEEAC1FCD0C41703555731AFF6C884 dnl4y
1,666,284,154 *AF5AFC3F70605B560BC5E3AD76C8DB195E2C0E5B IRAROCHIN
1,666,284,155 *AF527B4929382C322956EABF453436DAAB21A83F IRLGNOJP8
1,666,284,156 *AF5532486FDC184011D4B2E5326B83BBB86EC4D5 DNWDB
1,666,284,157 *AF576CFAD5AF83743477758940B06D366A443BAA J!-<
1,666,284,158 *AF59AEDF439187A33A50D5FE5F4F611314C3A672 J7EG0LLGAQT
1,666,284,159 *AF5D77E89408ADE5626B66AA0D253C691D5557DF SCHIEBLAME
1,666,284,160 *AF5D8D37A21DB86F651926FED338C0527052CD26 SCHRÄGLUFTAUFNAHME
1,666,284,161 *AF5093BF84AEA94F85F7059758D7555F8B4F8376 jaedyner
1,666,284,162 *AF5D55B72BB038ED49C08AF2F7C5A256E8DFA856 JAMEL.FARRUGGIO
1,666,284,163 *AF5184C2BF54231A90D5086B0D573AC9C7DC3CA3 SCOTTBONSAL
1,666,284,164 *AF5D2CF1AFC1FD0EF6EE2B917DCE39EED05B9EBA SCOTTY.JASMER
1,666,284,165 *AF512060C4FC914EEF745320A0945F1CF431B794 JAMES-STAUDENMEIER
1,666,284,166 *AF5A23D8E46EC5B3659E1CCB1C9F3E4E67622274 scrc-stony-brook
1,666,284,167 *AF500C6A20A42B8437E19E238EE173BB50D4F106 JAMIE.GALIC
1,666,284,168 *AF5BC602930A419CB722872756C75B09E58B1050 JAMIE.SCHOBER
1,666,284,169 *AF5DE5E6AD629280BE47D0CD5953AD90C4C026A4 DPAN5
1,666,284,170 *AF5178F170E565C46BD88ACB13BD8393934CE87E SEIRREBNIWT
1,666,284,171 *AF56C1888D65D0D0C6ACE6FCD656E420C96FD3CE SERUENDONESS
1,666,284,172 *AF50CCCD512A32015CFA1E9971ED93E904F807D9 jedadesr
1,666,284,173 *AF5CC073F7DFB813D9F55545843DB34030EB6DE4 SEUNONI
1,666,284,174 *AF5203BD50308C065AD5891D2A1C37ACD79DA927 JEREMYHIGSON
1,666,284,175 *AF53EA15D7546A10D660FA080F22E824CFB59B5C drowemars
1,666,284,176 *AF5E6BDE35B84C7B321F33739ADBB54F6509A838 DRUMSLESTER
1,666,284,177 *AF5785B484A6621BB02E2BF95528C3DEB8BE64F1 SHANE.MCLENNON
1,666,284,178 *AF5E44B6BC0E81D43A493A423FFDBC42D5AEB711 JEWEL.CIRULLO
1,666,284,179 *AF5BB497FD7670A4BA5E02EF70F6F5FBFBDC974D JGJESSIN
1,666,284,180 *AF5F75977F998B9FF2240AD358908BB43ACB971D [email protected]
1,666,284,181 *AF5D05FD1253EFA2FCC1B38F575FC46F430CAD6F JIMMYRABENA
1,666,284,182 *AF52C1BFA01F7582184C8795C536923010477F5E [email protected]
1,666,284,183 *AF5CF5FEE05DE9553C4EDF4E9A90A7D7B40F7F8C DUF"R
1,666,284,184 *AF5F1001FB75C4F57E77AC133D7E8F6E5FF32203 dv64h
1,666,284,185 *AF5DEE8006531A594B41BDD61A9D68252CEB11E9 DW,?D
1,666,284,186 *AF5FF91F194D22C2E02230C4C4780AA96378F1C0 dw;eo
1,666,284,187 *AF5B15C39DB8EE3111E90DD3F1C0FC1371201A87 SIGHT AN-APERTURE-IN-A-HELMET
1,666,284,188 *AF55E0C98C120A949BEB31AC51DAF5F5DD281A31 SIIRAPPIMUODO9
1,666,284,189 *AF50E16C9F374A898B656A5F2E2C4869CD37D5D3 “jonadabs”
1,666,284,190 *AF58AF36964C065A14FA847691BDD868FEB401B3 D'Ya-Wanna-Go-Faster
1,666,284,191 *AF5A25E3B5C7CCAF45B0E6CFB78C828A88F69BEC dy.m"
1,666,284,192 *AF501992F6694E15250EFBFA35463D23B95D236A dy!qt
1,666,284,193 *AF5FD44E114490E902F0817EA7526D7A32395625 SILVERKINGDOMED
1,666,284,194 *AF5849DCACFAD189F6A9475467A305B5DABE872C jonathan.earnhardt
1,666,284,195 *AF5DC358C7CB3DF7D5AF93347A5D5FD36293FC4B eagle29
1,666,284,196 *AF524BD7C530EFDFF1090B0D841358E485BAD8F0 SISILLIAA
1,666,284,197 *AF56EA9C8DDBD2F2C1F3A7087E3C3B77304727BD SITAIFUJ3
1,666,284,198 *AF51A330FDCDEAD544AA4EA1439564D86FAD5C3D SKETSJEN5
1,666,284,199 *AF537A52CB603AC28972237C14AEC0663BF12852 JTE1SKE
1,666,284,200 *AF5F6863E312C153F28F8EACCB5F3556EF081752 JUDEKANODE
1,666,284,201 *AF5ABC7ADAD1622AD176DCAA6DFD4350CA3A0B57 Slick-in-the-City
1,666,284,202 *AF5F19D92A524639608732D100E87A5FDD29E2B2 smiledeli
1,666,284,203 *AF5932B06F606FB5F52C66097578A3C4DAFFBE26 JUNIOR.LIPSCHUTZ
1,666,284,204 *AF599AB746F67B3510F4545FE90F6A9AB4CC6F0F EFRW
1,666,284,205 *AF54F943C9CB77BC221C5CE92E64E8BB68D34126 EGWE)
1,666,284,206 *AF509019AF4A7DA24BCCCA714B9D458C34ACDFEC [email protected]
1,666,284,207 *AF5B949448E4F459D15C72D292A65615BA5DF7C9 KAIGLES9
1,666,284,208 *AF50235BDE18A81A95FFD1E2752D8C15EB929C89 SPNSHCHR
1,666,284,209 *AF526CB9D90A7A83D4BDD891D5866EAE320F4B22 EL%LZ
1,666,284,210 *AF5AC610461810D12CBCC64D960EFD6488800319 SSENNIUGYRREJ
1,666,284,211 *AF5629BB92FCE6FD931659FF46D22483AB5C97FB SSOBEIXID
1,666,284,212 *AF5BF0031AE06EE3B75997FEFC12FA4BD0B37989 ssw<
1,666,284,213 *AF5AAEC36C2E64C092388E1411578D80B25CF0B3 keeley
1,666,284,214 *AF518BF564C27AD803016607F29C99A4967AFEDF keitherikson
1,666,284,215 *AF52AAAD83F8B354D726E3B32CAEF378B083F640 EMMANUELKLIS
1,666,284,216 *AF544F87613E7CB650DED42A056766F9547A01BF EMMITTFERRONI
1,666,284,217 *AF59F8E3D328DE8506FD0F762C47B4544BD90CCC kelvinschinke
1,666,284,218 *AF5340FB172A9DC485FBED0D460E6E8E78BF29DD KELVINWOODLE
1,666,284,219 *AF5045ABFF028B09310B407A1CCD84FF6D68CAE4 EMORY.BOEBINGER
1,666,284,220 *AF5585A5471E7A4D3A92A0CEE6329955B393F476 [email protected]
1,666,284,221 *AF53C3AE4888E88E5DDBC105A2936B44BD3308F6 EMSMUSN4
1,666,284,222 *AF5658A2EABBCFF5CE264749BD7EEA087F8A97D7 STEFANBARNA
1,666,284,223 *AF5AE3DCFAEA790692E9447B212BE34C43DD7C4F kenglln5
1,666,284,224 *AF56CFFC1BD5FD47C4E0114CF502F2F6420EBF5E STEINADL3
1,666,284,225 *AF5789D9F34B7CB6D0BB8D8F2C24403E022C9214 stenocranials
1,666,284,226 *AF51CCB2F24FA4765A15E4753EE2FD7FDB629CDF ENLARGE
1,666,284,227 *AF5161F0968F28A9FE33919F75823D67A885AB23 [email protected]
1,666,284,228 *AF5656C3519EB51EBA6A8BCD98A892604D924D09 Kiesheidshalve
1,666,284,229 *AF58F1B274CF2BCF2A00C88475B0E862513FDA5C KIETHECKLOFF
1,666,284,230 *AF558FB4D755581845B0778B414E49AB4D48CF33 eo;g2
1,666,284,231 *AF569700F33038C789708F0A30834AD72552B1A0 straatslijpers2
1,666,284,232 *AF56154E0A62C3CD2AAA79A861299510CC47AE36 kischuf (temple viii)
1,666,284,233 *AF5E986E661D72871ADE8BB81480E8E44AD7B8B2 subrāhā
1,666,284,234 *AF5A6503AFC7CE86B02674D10228F382B716E9FF K,O2
1,666,284,235 *AF59AA253BFE4D7341A797064A6854277A514A17 ermoieras
1,666,284,236 *AF59C3026D6A27762199640AA1A11898D7DA5927 ers:i
1,666,284,237 *AF5A969E46A1BF972CDC3777F4C449883F878F22 esenacit7
1,666,284,238 *AF5086C7A6E379CCEFDB5C9AD0672DD2ACDB2AA6 ESIMOKOT1
1,666,284,239 *AF5E991CCD1FB67EE02F12188B5F88C21D7A890A ESINKING1
1,666,284,240 *AF5720091279E8C0B9B3327725E3D6A0038128CD k=?q
1,666,284,241 *AF507D42076807ED5D079E38421C53AB622B57D9 espp:
1,666,284,242 *AF5C822452FBD42F5CA405FC01AB6451C7BC8B9E ÉTAITBNJISÉ
1,666,284,243 *AF567B2B863080389AE9895D60271D9D3E6648EB ETAITIVE
1,666,284,244 *AF57E0DE31AB7368571C225BAA9C6CF5CAD107DC kurt.duggan
1,666,284,245 *AF5D1E1A3789F6A41E488C04050ABF739E9FEA4F SYNSPRSING
1,666,284,246 *AF5FF6E120AADE47E80894BF459EFC8CA9F0DEA8 KUZUNIK
1,666,284,247 *AF569FD3347D8D1B471134E3245BD2F9C5510BEF KV-MOMIN
1,666,284,248 *AF52AEF345F987B647B568F02BA569A60B34F740 S熊谷店
1,666,284,249 *AF5456154E45883C724E4059B4AC783EA94D0406 t19205168
1,666,284,250 *AF5C55916C2BE140183EF805A683286C41293FF7 [email protected]
1,666,284,251 *AF5CCA7E9B44496EEBBF75EA6D0C12EF3298F8A1 EWD9
1,666,284,252 *AF57A935F086EEF38199AEC69108B3DAF2A6FF4B LAERMTET2
1,666,284,253 *AF551ACA0D1AA055F11105CE7DDC1D54F5139E75 TALKSATHIYA.MICRO
1,666,284,254 *AF5710DBF1A4833EEB83B098435153F42E61F7E8 eypbc
1,666,284,255 *AF5EC9DCE61971A002EDE27B54A0AA198A8019DA f1~j
1,666,284,256 *AF5267206D2B384E764360D2FDEFF44DB4CC1F51 F7}'
1,666,284,257 *AF5D40FB1DDDBB0D240E1B6F4C25A7940350962E LASCUATRONOVELASCLASICASCHINAS
1,666,284,258 *AF5049AD6CEEA477CE99C734A568783A963B0D35 FAIRYLINH
1,666,284,259 *AF57862FB0DD5FCA3ED3502474DBE9C69F7EC074 LAUDATORYPPM
1,666,284,260 *AF50470EFAC17AF7C30275656DD542396EE4D429 FANTASIA 7 IN EFLAT MAJOR
1,666,284,261 *AF538252F22305BBEF03A2F47BE718D8B81E5583 FARTNEMM9
1,666,284,262 *AF532CC60657D7466B17564BD66F6D43F0C6E56A [email protected]
1,666,284,263 *AF525B57310BB7B090FC811B02BBF8A647BAD84E faustopizzaro
1,666,284,264 *AF59465AA7F0C7DFB5E7D9315EC6EF05D82A530C [email protected]
1,666,284,265 *AF53352D91E0F41A9289863DB1576E876E84252A leashya6
1,666,284,266 *AF5C987B9F07E7298C2CEA4FF3E18B995EC16177 TERRANCE.BORTHWICK
1,666,284,267 *AF561A0667E3F772A4DB97773E4F5D34961CD124 feminazi4
1,666,284,268 *AF59D299AC3C51D8183A87CF70DCBC7D2A54AF77 FILANTR
1,666,284,269 *AF526D74753B162F9A358042956E3F59C687E03F flabbergastingly6
1,666,284,270 *AF5F100EDA91BC5CF0F0425023758592243316B4 theformwidget
1,666,284,271 *AF5783928844AF794F8BA148661EA2881E867E33 THEMANDASHA5
1,666,284,272 *AF537F5041E09D1E2C5DC35D674DB747ED2054B6 FlorVenenosa
1,666,284,273 *AF5AD46FA493403EC358D367C9B17D89D85502D6 l\independant.du.matin
1,666,284,274 *AF5F6CE739B7D89DC02233AF96D017C2921979C2 THINWALLED
1,666,284,275 *AF5149923801286EC38EFE67D2121A225A5CE437 thompsoneric
1,666,284,276 *AF5018E4FC259A846F20D6E9BC0870E583AEC7B5 liščinská
1,666,284,277 *AF5DD213B1C7BE2CDB75FAFE3728CFC126DF19F8 little-red-rooster-(feat-bob-weir)
1,666,284,278 *AF5ED8135DD90539139C02787FF2AF1C77CB0BDB TIMMY.POGGI
1,666,284,279 *AF5F40213026A0EE51C0BE9D4BE5027B482AB53A Llenworb3
1,666,284,280 *AF5D41377488A04A0B28D451AF987B1C52C1AFC2 LLUMBROSO
1,666,284,281 *AF5860DC1E71C30B9A0D50F5DF8A222E8CBE4627 tin$elp4
1,666,284,282 *AF5992DA2F6FCAA8B84EB4F093500397EF34D005 FREMIRSEIA1234
1,666,284,283 *AF5B870846CE48DCC06D1F40E0E52CBFC994BD52 TKUREGFAED
1,666,284,284 *AF5A793FA433E2425A83C79D542861D290653244 LOGOCOLORSFONT
1,666,284,285 *AF597AAD77917B22C75BECADF396581750556F6A [email protected]
1,666,284,286 *AF5EC2639F724472C3B83C615EB377E985A8A89F TOBIASSTAVROS
1,666,284,287 *AF56110A605E63ED630D9603A68CE02FFB44FA41 [email protected]
1,666,284,288 *AF574452F11DDC3A1DC2EB32525689D2D194DB07 TODWANNER
1,666,284,289 *AF517E865D9157F63FC1863355F35C423B8C6530 [email protected]
1,666,284,290 *AF5939AD3E8CA6F1F7C2F55E35706B22F33A61DD LORENZOHARNESS
1,666,284,291 *AF57C652291F72EE0C417DC86F299B45F8F897A7 tometris7
1,666,284,292 *AF5A0FEB744C586F271BA21707A3FA0AA923C64A TOMMYSTEVER7
1,666,284,293 *AF520661E44062C2D87C6C5B11DBB7193F525398 TONEY.TAMMEN
1,666,284,294 *AF5B1280E7132163BE8D403AFCC654424633AD12 louislabrie
1,666,284,295 *AF589EF2D5F0C8665106885A01D69F60E93D84FF TONYPENDEGRAFT
1,666,284,296 *AF5FACFF79729148525ADCB9C79A50A8F5767878 TONY-STRINGFELLOW
1,666,284,297 *AF590D7A771F87115B4636F9A8E35E5D141CCC77 tony-taibi
1,666,284,298 *AF560406783DEE4B7588916F8ECB698B5F218E16 loveonthevine
1,666,284,299 *AF5F56F693CBB79A8AFAED64B378EFC3CFDBC0DE to.the.airport
1,666,284,300 *AF572BABD2A189A234E1E1C2E2E82AAA79EC624C luciomarkwell
1,666,284,301 *AF5E71945D39CE2C9ED4E62BA2F643E51DC115D5 [email protected]
1,666,284,302 *AF5B3425AE90066AD52F386AC8643CA81ADA19D1 TRANGPOTTER
1,666,284,303 *AF57DAA50DF835D2D2692618F20DD87B95C3B691 [email protected]
1,666,284,304 *AF5E84028E22694C7D5A063E7AF5799809D19349 [email protected]
1,666,284,305 *AF5DFFCBA09EE344CBD956C50EB62E99A885CC95 TRAZENJU0
1,666,284,306 *AF5C3275A30E94FB18B67783DCAE93A5EA629882 TRENCH-PRAYER
1,666,284,307 *AF5DDEE806E25F58CA1C99D6E4488F98B2C7B1A0 trevor-haesloop
1,666,284,308 *AF5898E26F34317A37F065BB1841E2AEFABD3108 GATORGOLDING
1,666,284,309 *AF598BE8E518D67D1074908DC6212C2B1EB1634B TREY.KACIC
1,666,284,310 *AF52F3D3ADD69F9F678CEC12EEB87DE04730F9B1 LYCHOWSKICH
1,666,284,311 *AF54F4E5500E988707CDE6A2B022DC04E425A2F7 g>b"
1,666,284,312 *AF55BAF8024DB62C0CD2937D68CB9B0844981B67 GEOFFREY-LEA
1,666,284,313 *AF52B9DE6E07DD7F1C439CD4A1D99CFBA379AAF1 GEORGE.CUNINGHAM
1,666,284,314 *AF58C3A3BF4AAAE97DC3EC0194BF44E51803FC37 GERALD.JUNGQUIST
1,666,284,315 *AF572ACD25A24595E34EF8C423468B4C3BEA1593 M4V3PIN3N
1,666,284,316 *AF50C22B1FA20E6FB6CD08BE7788B38DFB8007C0 g+h0
1,666,284,317 *AF577D9662FF5FE538EC074543BBF683BCCAC370 trovillion2
1,666,284,318 *AF5827D074E047E6CA335FBE2E54928337F54E62 [email protected]
1,666,284,319 *AF5D25AACE87BDB6BFD08E28623680D4168E609A ttaanngg040924
1,666,284,320 *AF54B81DEB3DFA4E719885F45347363EC0ADE376 [email protected]
1,666,284,321 *AF51A206C45A64B5E8CADCEC39EE86DCE0258429 MALIKWELTI
1,666,284,322 *AF5B28A963DEA94DEB5317FAFA4411C576130D60 TUNGGANG-LANGGANG
1,666,284,323 *AF5BB2E669BE1F7B8472A635D1E145CB47BB419C turbescency.
1,666,284,324 *AF5DDF37D85A326EB0AF70C588A94D0336FA8068 TWILALOWE
1,666,284,325 *AF5BCA926E7DFA46C3C04F8C8886D002B9E9EDFB MARACAIED
1,666,284,326 *AF5BD4692E597F06A4EDBD096DEF53C530E5D82E gnidnewfa9
1,666,284,327 *AF5B7CA5AC9A4FEC9DA1ACAEA208F998BDA1B9EC g!ns
1,666,284,328 *AF57BD334E28627AF1249390E13CD9BC68D05A55 MARIELA2111
1,666,284,329 *AF5968B77B45939F6BAD3A1AAEE6FE7ED6D1A190 GOOOOOOAL
1,666,284,330 *AF5004F195AC1DCB7F8648C9417EA6EF67A460AB uggiolavi!
1,666,284,331 *AF5C755A2DD0C3663946C37BB74FB85BF732ACE0 granvillewinzenried
1,666,284,332 *AF53269B009E34BF1964B433B9A6272610944A2F marshalred
1,666,284,333 *AF575E8E6058DB43903109218ED050EAF1439784 MASCHERONE4
1,666,284,334 *AF56EFDEFE2DE0B5291F7006AE56C6BBB1B8C190 groverskipper
1,666,284,335 *AF57FA96EA0C1940BC0662A980BF5211DFDF0D09 GUAHCNAM
1,666,284,336 *AF55B1AEEF353A946C31A5CA3568A82C8B0393BC guestcohostsearch
1,666,284,337 *AF550740EF2E890B2DF75DC2F86CF97027417F31 gymnasts--jh-ih1-m-n-ae0-s-t-s
1,666,284,338 *AF570165829EC27233BCD9C455B40E7CFB0F0613 URBURN
1,666,284,339 *AF52F64D170F6C25D379A7C39753F723049DF530 USER24.60.4.232
1,666,284,340 *AF575F4ECEEDFBE68CD5A5054A5063A5BCDD95F7 h:-a
1,666,284,341 *AF5CF096C3AC9141CC9C78A62681F04AF8BB438B HAKAM-SAWALHA
1,666,284,342 *AF528D202A11A32A4BD875032DF120216C8DD822 UTVÄRDERINGSDAGS
1,666,284,343 *AF55CE43EC8972B0E068166AD3B3CF707351DF39 V3LV0K$N3
1,666,284,344 *AF59CD3A915F7901ABCFAAD941B8A177FAD48699 haltungsschulung
1,666,284,345 *AF5972131268773F978987FE493EFA9440A7C341 hanpeng9
1,666,284,346 *AF520B9C0947897512F2878A924CFB9ABBE73874 vanceruggirello
1,666,284,347 *AF53056EA37BB10AFCD04A8E3450E82A28614B36 harlanbening
1,666,284,348 *AF52C730A814F535D2F25A698253079C212FB6CB VANESSAKLEINDL
1,666,284,349 *AF518AA6EE15CC1EB63CF78FB21F3D05105173C8 HAROLD-KARR
1,666,284,350 *AF56955AB9EB83E9E4E39195533C9C1B6EEAF9C2 HASAN-JUBAIR
1,666,284,351 *AF55772439391ED16525290641856764439794C9 MICRO$+A+E
1,666,284,352 *AF5550B357DE6A1AFC6E5F811E492D2839EE84CA HAYDEN.DECHAINE
1,666,284,353 *AF596B4E04CBF9AD4696BC536AFB2A0C1E416D32 [email protected]
1,666,284,354 *AF550494D6E638D34368971D0AEDC772AB2CB001 HCOMAR
1,666,284,355 *AF589394BC41BB76D9AE0CBBB8875F2FF96CCB02 milad-borhani
1,666,284,356 *AF56AB329B55A2F76021DC8ADC29C88C1E0EF439 MILLQUEBEC
1,666,284,357 *AF5E5A53BC94BDE0B944490E6CA60D93A19BA4E6 VERONICAREPUBLIC
1,666,284,358 *AF5E9E12251D0E1C3BDCCA91F47DFF0493D4857D hector-l-nieves
1,666,284,359 *AF5DD3A4440814400C501FD2DE68ABF7BA17C4DF MINH.RAAB
1,666,284,360 *AF5E3E5A84810B6659B11329308471CABA512814 VESELENAK9
1,666,284,361 *AF55CB610558E058B8E7E72153460ECBFE7F5F28 VHINGGO
1,666,284,362 *AF5E3DB3857F9407D7F1B45B17C712F52CBC86BC VIC JOHN
1,666,284,363 *AF55B59357D1C88AE103EF36E26B4231D88930DE VICKIEQUINN
1,666,284,364 *AF5A890E5C8B77AC67B2D6576F132333E97B712D HERFSTINTING
1,666,284,365 *AF5755A816ED6C460B1F827C76BAF95FE748AB07 mnkybtt27
1,666,284,366 *AF588A42416F5724FA1FDE53B84C0C5069C0826B HERR, ICH BIN ZWAR VERBRECHERIN
1,666,284,367 *AF55DF5A694EB0F956C0EA35FDAA6886D943CBF4 VINCENZO.BAHOORA
1,666,284,368 *AF56197E960D4EA4A8391DD88FC3E476334C44AC [email protected]
1,666,284,369 *AF5734EDACBF1EE1148BFC9F0474A1DA42499060 HIEMAVERINT1234
1,666,284,370 *AF5B5ABF1CB4116F4AF6E83F52E4F4667431628C VIRG-CABANES
1,666,284,371 *AF5811C0EF0BAE8615F6D31FF677C5FB4F74A207 VIRGINIE LEVEQUE
1,666,284,372 *AF5F7071F3DD8A498A1CDA37B165DDB30A97B3B0 VISCONDIZARA1
1,666,284,373 *AF52E945328C2AD20AEB46F8EEE7E8E4B7561781 VISHVASECHAED
1,666,284,374 *AF5EA298DE9152C6DFDAACFC0F84E781D8465AD8 vitolesly
1,666,284,375 *AF5746D0AA053ACD3A16813C187963047E53A5CD viulunrakentajana
1,666,284,376 *AF5C7F2ABABE8586F7F3A51106C04C60478EC190 HOCHSCHULMASCHE
1,666,284,377 *AF57C6B7475DEBF27CFC690448CB1F8F1F07B3D8 VOYAGERMILES2
1,666,284,378 *AF5707918FBF8A44BBC05C75CFF45CEBCDA74FD7 MU1TT4$KNG
1,666,284,379 *AF5FFD84537A7CBF7FE118498C8482DFAA1FE2ED vuurkolken1
1,666,284,380 *AF58F6D6EA663889BDE0AB674277C9FFFB7847A8 VYTRYOL
1,666,284,381 *AF5EE789DD6BECF48B103959B42B131D3CE6C185 WAIRAVAB
1,666,284,382 *AF5345FC51FA92F440814A85F0E680170C85876B MYOBSCURITY
1,666,284,383 *AF52035092340F0D7A9435B4984C819366C8E8F9 HTTP//WWWW3ORG/TR/EARL10SCHEMA
1,666,284,384 *AF5E4481DEE601419268EB5B9B51BB7792BCD0BC [email protected]
1,666,284,385 *AF566484B315BB0EE19027F93AD2FBAB4349CB08 [email protected]
1,666,284,386 *AF545E0F99A4FBE88A536C1100C680785885459E WALTATIUS
1,666,284,387 *AF5EA2BA3102B41CEC64805B2986D77CC633E5BB HUIWANGGING
1,666,284,388 *AF5375D70639A42C699A5E2A248F4EE7D9F29098 i/6p
1,666,284,389 *AF5EA3571FA8D7463E4458E0FFC278577C2A180F [email protected]
1,666,284,390 *AF53FE9A3AADDD4944C01FA23E7A4258A5D5DBB4 IBOGAWACH
1,666,284,391 *AF5DA9914B7599A9AB7680DEA85311F9369A3AE7 Navyk
1,666,284,392 *AF5E2569397E0FC39FC3866ABA985F138286BF2A ignaciojohn
1,666,284,393 *AF53FDBCE363B3D3BE2234588B023C30FC29B1CA IGUANAT0
1,666,284,394 *AF561EFA068B30E703DDCC79160F15D91F49EA70 westmasculinity
1,666,284,395 *AF5DC9A336826BBFF8542492538102104167C739 IKE.ZODA
1,666,284,396 *AF5C5C27EB4A73B2C73334F318B4DE562AEFADA8 where souls do couch on flowers, we'll hand in hand,
1,666,284,397 *AF52E0C73C703B39271BCB3F5DC7A87F92A21D35 illustrate
1,666,284,398 *AF5D6C0EE402451707759CEFB6BAB95E10C73838 ILOVEREDSKINS
1,666,284,399 *AF50A7F38A9CD837BD436830CBCE20ED90A20F55 NGATA-MEMORIAL-COLLEGE
1,666,284,400 *AF593BCFFB776ABC9F2148F7E81814AF621A735A nhamilliepitt
1,666,284,401 *AF5B2536290C8DB23BB23D16E054DCBB8765E999 i\mg
1,666,284,402 *AF5D4523091D0BC667FCCCA840BA65C6BCBAE8AD WINTAUNG.KYAW
1,666,284,403 *AF51B912B54778052EFAD76622195F34C86072BC [email protected]
1,666,284,404 *AF57E1C76BAE18B491E02D3E88198AA37679DA4E NIZEYEM
1,666,284,405 *AF5FDEA8C3C548DA2CAC891D10508338C480FF65 infodrs1
1,666,284,406 *AF55DC5A425543CDA9A3AE0EF0C8B427B813A5ED worklistaj
1,666,284,407 *AF553D0811A2C3FA8E1EC9312934120C73DEB860 [email protected]
1,666,284,408 *AF56C615F1B2ABC4239DAFD29302462B57877EC0 WV44.SVG
1,666,284,409 *AF57E2D7981A50E380AE9995341E52E7B6FBDEB3 WWWCEREMONYMAGAZINECOM
1,666,284,410 *AF52F9DE7245056C09BEEF65EE98D01341061D9B wwwco-panecom
1,666,284,411 *AF5481B7E5A80977F208E77EDBB8B5739ADF2CDC WWWFLEXIONCA
1,666,284,412 *AF5F1997AF4C1F8E8EFABD4240E3FE0F544B1734 IRVING.SUHOSKI
1,666,284,413 *AF5D5F3D66BF4872E2727224621686BF6A1C259E IRVINGTHRALL
1,666,284,414 *AF5AA7193A0AA7419134538CAF296367D9953C7A normandadwell
1,666,284,415 *AF58A4F8704A81F6E2CCB7F87F4E12064F1C0262 ISIAH.NAYLOR
1,666,284,416 *AF5641BB9253B5975D17804B95003950F9AA7E4C ismaeloreskovich
1,666,284,417 *AF57666EBBA10C89566B5DBD6DE1B613FF7534FA xander.kordom
1,666,284,418 *AF56214CF099EC19E11A4E99AC91E77F73DC6C31 xaviera057
1,666,284,419 *AF502A34DA22FC6F20793EA1933D4784A7A38F09 IT'S-YOU-(REGGAE-VERSION)
1,666,284,420 *AF58CE7F7AF3737FF11DEE8DF2D694F6AA925623 NULLEMISSIONSFABRIK
1,666,284,421 *AF5FB16B4F7E3CCFB9D74EC03A0988CCD169DF01 izvodnom8
1,666,284,422 *AF50FEC96831E1A6AF5B7616B6DDC8EE83603458 NURERABBIS
1,666,284,423 *AF5D9D080CE0E0CBC592380A47CECEE21AF4DEDD J1HAZK
1,666,284,424 *AF59673084A73A8E3B359C615BD094AF2C7D5B17 Nutcracker:WaltzoftheSnowflakes
1,666,284,425 *AF58CED6BA2E842EEA1A0F5706428E7CF1DC7E0F )X( * * * Q--B
1,666,284,426 *AF5599A90CE3EBD62F92737DA80E13D44DCEE499 JÄGMÄSTARÄMNET
1,666,284,427 *AF59773A898EC2D4B69ED14CB53DB1284829ECE9 [email protected]
1,666,284,428 *AF55A22D220E737269466A75235C0BA79EC70490 OCLACKONAYAHE
1,666,284,429 *AF5048ECC781D211DF9339D0DD77C292117BE6E8 o#ct
1,666,284,430 *AF554F4402B3109CEEC432ABD8FFAD7EA0860755 JAMEY.KENWORTHY
1,666,284,431 *AF5FF26401F4CF9886DCEA1E243B4276C242812E [email protected]
1,666,284,432 *AF56AEBB40A6FF5326DE40A605067555803B25C2 [email protected]
1,666,284,433 *AF5EB3A5CFCBD60D6DA0218993FA482BEFB6B4C6 [email protected]
1,666,284,434 *AF590ACCA70C0A602488BD85B758D4447A627E63 JAYMEDELLIN
1,666,284,435 *AF5F578E89FF8317F14E7838E447146B23665A9A JAYSONHOLSHUE
1,666,284,436 *AF59297789290DF3ACDA7F78BFBA83A44D85C93F OLA, OP. 47 NO. 5)
1,666,284,437 *AF51B60E0A99739EB1615F0E1FC402D8BAF6C79E olenfecko
1,666,284,438 *AF546F3DFBC719127C8D7C2D23FE5845B0F0567A YAN-LEVSHITS
1,666,284,439 *AF55F2A7DAAE77182DCD98CAFD0F8DFC76D3BDF1 YANSHIAN YONG
1,666,284,440 *AF5C807D3C0B52CAF73925CEB7BB3D0D9697E171 [email protected]
1,666,284,441 *AF532348E90CC81E2E5878C3384BF05FD81D2819 «olten
1,666,284,442 *AF55736CF7B19D13C7C9EA1AA479D3AEE240C0CF [email protected]
1,666,284,443 *AF576C6D84263131AF65E6A911F664FCB1C96EDA [email protected]
1,666,284,444 *AF59BF2C23F67FD76415946469BB05593C4550DE JEAN CULVER
1,666,284,445 *AF50C33F2EE265A0D51B7213AABF5DCF6BC2D841 JEDINEC5
1,666,284,446 *AF5FC101A1D0E1113E8F8A71C999BCAC5E7A88C2 YGX21BB
1,666,284,447 *AF5975C0E7B1917973F6751E61E324D8851CB9F9 [email protected]
1,666,284,448 *AF580514D5561381DECB09DC7A9478B35C4F9D67 JERAMYEROS
1,666,284,449 *AF5679F433D1D7C78B3C8E07F337F75E6DCE6A0A YLIVOIMAINEN7
1,666,284,450 *AF5823F535C70C0BFF8E5B42429EA41AC12100B8 YLOUBAD
1,666,284,451 *AF56F55B8E0FB72ACA8606647817B3CC655876B2 ORDIN
1,666,284,452 *AF55964FE491B469EF26BCFDA9149D27DBFA404B [email protected]
1,666,284,453 *AF5200284728A8E46FFDBEB5B20BAC4EF824CF03 JIMBOBDUCKIE
1,666,284,454 *AF59E9E691258C4099820ABD52BA323D0EB5A432 yvonne.ferragonio
1,666,284,455 *AF54BCCAF04025066F745CD1F85533C8A46F21B9 yvx>
1,666,284,456 *AF5E605923F916F1B43D5F54EF448BB940BD0B32 ZACKARY.KHONG
1,666,284,457 *AF5B490EA64620BFB9FD4B8AA11E73AD01063FE6 outchide!
1,666,284,458 *AF58CA3F28EA17F13EA3A13AA63C17685E990261 ZAK.AKA.LEGO
1,666,284,459 *AF5E8EE71F6668A0AC82BEE4A1FAE3A1D580DD06 [email protected]
1,666,284,460 *AF5D8A3396D034218D9801A5E0F031FB9886CB6B joel774
1,666,284,461 *AF5F1345D012AA5AD354F3CBE44293E3182D809D johnavelino
1,666,284,462 *AF5D5689BE3DE0A0A3CDB52619B47FF988E1A497 johnieyearta
1,666,284,463 *AF5D1790624C798B83FB0CD947BFE433922030D0 JORDANOEHMKE
1,666,284,464 *AF547102C3EBE230A19FAFCAA8AE2FD10D892C9C :[email protected]
1,666,284,465 *AF546C97463910260E83D70F74E96886EE2FAC6E JOSEFPICARO
1,666,284,466 *AF5A211ACBBCED25986FCE8FA6B2D12AF198DB7B <P-ALIGN="CENTER"><B><I>SIMPLE-ETHERNET</I></B>
1,666,284,467 *AF55CD70B3FD35DDEDC3275F6B38C064286A59A3 zebraruy7
1,666,284,468 *AF59CF762734729B9F56AECA7BC5CA1E163A7BE6 PALMERCALGER
1,666,284,469 *AF5B89F0627FB60BCA03E5D39CA07620C7C103B7 JOSPEHMCGEEHAN
1,666,284,470 *AF5BF08AE337E151C0479A08AB085A35C8F319B3 [email protected]
1,666,284,471 *AF5A519D5B81F365A3E94C4902A0A669D600F135 JULEG
1,666,284,472 *AF51A86520CF29AC32624EECDCB3A83954A84377 JULIUSLAASAGA
1,666,284,473 *AF524E24E3761C17545A1715754FE71FE1766BE1 pampshfia
1,666,284,474 *AF5AE6DCD8302BFDFC11556A000D14508520C3C1 PASQUALEDINKINS
1,666,284,475 *AF50A6EFF806FC6B797D5F0590512FE5AB5D2EC4 KABAKKURAMA
1,666,284,476 *AF5C50D4DDB815FAFE9BDEBE816758C8F5E085D1 PAWOŁOCZKI
1,666,284,477 *AF54C141ED647AFD29C7B742C2692EA822C7824A karlbrandonocfemia
1,666,284,478 *AF5CD95C7F3A1F4274052EB4702902F3E46999BA karoly
1,666,284,479 *AF554F41E2E5561862287FBC91E1973B7A263DDF [email protected]
1,666,284,480 *AF5DC5591510DFD18125252BCE55F097810835EB ΜΕΜΑΛΆΚΙΣΤΑΙ
1,666,284,481 *AF55B2CF629E8AF8C5187B3C184EC4D28677729B ΜΠΙΓΚΆΛΟ
1,666,284,482 *AF51297C4E3FE208A79CB3EFE4ED24BC38754F62 PENTACARBONYL3
1,666,284,483 *AF51AD85F9702D7908BA78A175A86D2E626167D9 ГАРЬКАВЕНКО
1,666,284,484 *AF5EACDD1C026440436051A77C8BA29BB02F1F9C PESTYSTAE
1,666,284,485 *AF50AE60123B1D9C5D79706BA5D8A2C815C99AD2 KENNETHECHAVEZ
1,666,284,486 *AF50D3052649E84FAD6819D53A75FF36049FF54C PETRA-PAVLOVICOVA
1,666,284,487 *AF5134ED0C58FD0BA5865D86A7A4BA531CE80D9B КИЭҺЭНЭН
1,666,284,488 *AF543111D023505AC18611B3AB0D379971CE9E64 kerhonkson-1-0
1,666,284,489 *AF5DDF2EB46B4EB7DE1685628AB28D3E586A5E98 ЛІХТЕНФЕЛЬС
1,666,284,490 *AF5C5268113B1B9366B51CABE64D6DDBAE64B204 ЛУКШАС
1,666,284,491 *AF5B033DE777BCD9286B1EA310D05CCE1092BDFF «МАНТУАНЕЦ»
1,666,284,492 *AF5D7625D475F9559FC29986D0D0F1504D43E92C phr4se.b0
1,666,284,493 *AF54270187F6E3AFC763832799005616659BC9C6 klo$et$k
1,666,284,494 *AF5B3A361044F4FA88AF3DCD0A9E04327D9D54B6 KÜNSLICHE
1,666,284,495 *AF5F75AA26E31B6DDE9953164B44753C7256945A KURTISBAZELAIS
1,666,284,496 *AF593308C4D46E8F4AFACB57E0BE84D96595E17E PN:
1,666,284,497 *AF5D8C9320CE5B54F9B78F08F1AB7D2DC38922A8 POLISSOIR!
1,666,284,498 *AF5E5C1D5512CDC77320A26E70050325CCB56111 p---)~o~o-(>-<)
1,666,284,499 *AF5A7EBECFF2A34B8FAE50171A61961388495837 LANDESKIRCHENKONSISTORIALPRÄSIDENT
1,666,284,500 *AF54E2344C58EDC9729EC6E55B5DF3D967E2EA10 post-gender
1,666,284,501 *AF59BE0EB9E37AA0416BAA19C2B98C8EB22C623A LAPSIKYL
1,666,284,502 *AF5C85D258B8D0F204E5D7B5709A08BFAB89FB28 P--P`~-UU
1,666,284,503 *AF58B25E154662345905668247B3F6495A64A840 PR0N4T0N
1,666,284,504 *AF553307783CE943AB01B02C0383195CC53A62D5 preetham.hs
1,666,284,505 *AF5B18FE86B978FA780433B6C629C727772CEF95 LCSUF
1,666,284,506 *AF5A80340572F0A1AF01FE0248547D1CE72B114C ,因為上年的聯賽排第四。外圍賽首回合作客贏esbjerg1
1,666,284,507 *AF56EAD7B5494CAB52B068B4AF63AFC0D076CB68 priesterambt0
1,666,284,508 *AF576173ED7AA250CCD72348CC5879BBCB2AFF60 leilaweber
1,666,284,509 *AF588568F36C0F440434C165A120697EAFB74CB3 PRISONERS18
1,666,284,510 *AF5DC2A5F36E202EE028B305D254693E0FC96181 [email protected]
1,666,284,511 *AF5544817478DC741429F4776E92DD68F0F504F0 [email protected]
1,666,284,512 *AF5F3317636694FBBFE9B9D7126B6F9EB62C5247 [email protected]@NDSTC
1,666,284,513 *AF59B07E7C1B938BD60DEFC86477A19482E6AAA9 LET.THE.MUSIC.PLAY.(CLASSIC.VERSION)
1,666,284,514 *AF546AD6A1C434FA3113F69B372AB67277481696 [email protected]
1,666,284,515 *AF560FFC32911C96B875B1AF9EA696F6CEF6D14D [email protected]
1,666,284,516 *AF5C202911B1BD7A4E47ED832B476993E32B05C1 lily13
1,666,284,517 *AF58D371B7499377061E58E7D7D5B9059B2C41DD litholatry
1,666,284,518 *AF572B35499EC6A72D1A3A84C4EC7B1600F3C24B quae-morebat-et-dolebat
1,666,284,519 *AF548548F300E1256CF8C5719BC9B5CD33E4DE32 LOBOGÓHORDOZÓNAK
1,666,284,520 *AF5BEE691DD8B3B30F993B3A170273677BEFC5EA QUIDISTANT.
1,666,284,521 *AF5DB70309CA8F14CC613D7BCF945000E6CDDD80 quintonlangoni
1,666,284,522 *AF59809ED6BC245FF232C559C0303E67CFD299E8 QUU,
1,666,284,523 *AF520458A99C442DBA1B31FE86D20ADDD0369D9D lópezs
1,666,284,524 *AF506C83B9FE6D231A31B637A498138422675F26 RANSACKER、1377年
1,666,284,525 *AF51748353C1319456165BE0EE47CED8ADCABC84 [email protected]
1,666,284,526 *AF51AE863D8F822508C0A1B46D8240CE9DA01E97 [email protected]
1,666,284,527 *AF5D21BD92FABF1D4D7D50E7605F46CE093D517F lukeinstasi
1,666,284,528 *AF517ADF11044FC0B0D68367E065B6ACD02F3FAB LYNN.ANDERT
1,666,284,529 *AF52CF4B5C5C2929B3E089395F90F58B6B4AEEBA 超级碗XVII
1,666,284,530 *AF526A742E266AEB2EC5C16ED6EEB0005B9EBF38 [email protected]
1,666,284,531 *AF53319AA059AB58201B2229864C87988BD6346F RDNX
1,666,284,532 *AF51B8DA4C24240DFEC0E646F7A92004C8968DF3 recassero0
1,666,284,533 *AF585D023A598CD2D526C616D8B5643DD6C78A1B reggiehirano
1,666,284,534 *AF5B25D9DA283937C1EB96D8D002ACE0F9D1D54B 00SANDRA
1,666,284,535 *AF5DD250D1E6AFA707FBEF4ACA1768433C2449A5 renaldobairos
1,666,284,536 *AF504F4464E1F2562A04871FECBC2A6DACD54AB6 [email protected]
1,666,284,537 *AF5E18B2ABEE07FA0401EE9EF24B6CAD3697D06F REQUIRESLICENSING.
1,666,284,538 *AF5683FBE0E1547A7811ACD7F0D5A1907F16EB88 marineteddy1
1,666,284,539 *AF5CA47E1540E4EFD82384BF57A4476B7EE7F323 RETRANSPORTMIDDELEN4
1,666,284,540 *AF52516E8E6158C30D8B290E0FAE735F175C3453 0V01EMM4
1,666,284,541 *AF5DF7B836BFE15C69024840C10C8043B6A92723 marlongiumarro
1,666,284,542 *AF506F98098790ABD8CFA910BD42445EE56862DA 1027042 kissa.ja.hamsteri.voivat.tottua.yhteen..
1,666,284,543 *AF50DCE349DFB1B83F248DD953130491F77628E5 1070496 on.valtavaa.vapautta.,.ett
1,666,284,544 *AF5F55DF9FF143871E6F05A8A0B2281090EA8FC7 RGAYBB
1,666,284,545 *AF5C2A2A8079C9B01E868D64137F72CC84CC456C RHBLCHS1
1,666,284,546 *AF53C6DB7072C66804D176BCE469ABD70D0D41AB MARTYRIZE9
1,666,284,547 *AF5B57AC603EAEE514353C57FB2AED99818B5BF8 masonfenney
1,666,284,548 *AF5906DDDA9F54B76C5500375890108CAA9820DC MASUREN4
1,666,284,549 *AF52C333E7CB25F2EFED2CC6AC3D2A8085C8D9B7 matt-blomquist
1,666,284,550 *AF5855241886520F4E3D865A9D382DEBBA5579CB MATTHEW.HANBERG
1,666,284,551 *AF58A609CDF48846533665E830F9C82519E86589 123CAMBRIC
1,666,284,552 *AF592D2158DEC11727B78683418696A1975F8AAF 123LOLS123
1,666,284,553 *AF5F8F20B2AEC7238912A7CAF25141C4DCD0CE01 RIEVUTO
1,666,284,554 *AF5F4A063701C8FA8418F0542C0B70B25D3E7417 mazedorrumano
1,666,284,555 *AF5E9B9C7373B6F81BC441CD79591590970E78FF roæ
1,666,284,556 *AF5D4895C51FE89167BEF7B6C4BA6A6674C8D468 ROBDOBOS
1,666,284,557 *AF55297A47FEE7AEEB4BF66C52575C727CB1624A 1409726 l
1,666,284,558 *AF5BEBD8F8647B81F91E3D2F9955738437C5F704 1503968 huoneen.sis
1,666,284,559 *AF57B31840A606B705DAFCBD05E7B05C4CA1E168 MEDENIJA9
1,666,284,560 *AF579680F90BD23C46FF95ECD1CB4A58D0B464E3 [email protected]
1,666,284,561 *AF5E44C5214B8D175419E4554F21FA4DEBD38D78 1649119 " ICH BIN EIN TANSIM . "
1,666,284,562 *AF5FBE05541F42E614DAF8E8D4AF17AAB2073E9B 1670929 KUN-SYSTEEMI-PANNAAN-V
1,666,284,563 *AF57BB792668263CE6A0AA060586D08AF32048AD 1682369 der aufbau der ess steht bereits weitgehend fest
1,666,284,564 *AF5E016B56C719970A53D9D7C4BE8EB5A56625AE robtyarger
1,666,284,565 *AF5424C9C367D510061A6B9704598754333C5D45 merrilldydo
1,666,284,566 *AF52762745BDE9E125E7ECAE20D17E34C0FC517A MERRILL.GILLETTE
1,666,284,567 *AF5998919CAECA503978C85B07704A654DFDE0D1 1727290 dnro-990231-kaupunginhallitus-l
1,666,284,568 *AF5F7A9529DA616FAB7B12F18FC8BAEDB2A998A8 MERVIN.BUSSINGER
1,666,284,569 *AF5D636022D68EBFD50665A8C99CB024E00CBB79 ROCKTRIBUTE
1,666,284,570 *AF52DA11FFE914E59477B68526B1594F8149BD10 ROD.CRUMLEY
1,666,284,571 *AF5028171D7D6BFE4D6F4A690FAEF6D05F1AA932 1823785 KOHO 421 NIEMI LYYDIA O . S .
1,666,284,572 *AF56FBABBB70F31A5B5C203043DF6022548E1ED6 1850689 millionen-wuerden-umkommen-
1,666,284,573 *AF5C630A80F345F4B990A3D852B09130CD3B0AD8 roll19
1,666,284,574 *AF56818A63FA4CAE6379F6576054D60DCC4753B2 mightytimesthechildrensmarch
1,666,284,575 *AF5F887E3D9AA244036FEB0FB8EE98EF1D897512 [email protected]
1,666,284,576 *AF58A4A6687868085F72B65775CBCC8FD627B94A 1BUND-NATURSCHUTZREFERENT
1,666,284,577 *AF5B8CE51E9B0AEAC2DD9CEFDB29CC71961448B2 1 CARPITMIYORUZ
1,666,284,578 *AF5F716FBA1826E66804B9BED9991B8B99F4C82D MILLARDFAILLE
1,666,284,579 *AF5AE85CE2687EE40113D7D131E30F13BC6F6EA6 1CCMMDMNT
1,666,284,580 *AF536C2ABF082989F7BF16A812E2E8254FAE55EA 1.cessnan
1,666,284,581 *AF56CE76852D399DCFA554E4231E8EFCBFA622CB rosie's leaving
1,666,284,582 *AF5850584C55A4CF81883F9229CF9F0DBCDBFA26 1EAJ-VERWALTUNGSRAT
1,666,284,583 *AF5464E92BCEE324162CC1C6F13506D493EA648A 1.edelenbos
1,666,284,584 *AF5686E19B6486328ADC3E77EB6A344E5BE6D3AD rr3efomgcrw2
1,666,284,585 *AF5EB5B66CECD68F7A5B587786AC74418B852A78 1.granddaughtersvisited
1,666,284,586 *AF5DA759391418B709E4872709BD46179813271C rugboy*
1,666,284,587 *AF55DE8E0BF51C19429C4668B75F325BAB5C62D4 MJANE.CABRERA
1,666,284,588 *AF52B25256629FE34EC87065B27B514CD3DB59A1 RULRIKE
1,666,284,589 *AF500AC4AC5CEBA739A651B64621539FC4F3F310 MLATCHEM
1,666,284,590 *AF5F25D7D74E9941C3BA77EAA440B7C028A6B900 RUPERTBUSBIN
1,666,284,591 *AF5F18EBB88D084C258DDF141AD38B3944915B38 MNEPTOK:NO
1,666,284,592 *AF58D65DF349B2DB94845A1A965AFF5D8BB7E212 1leviws
1,666,284,593 *AF5DC931EF7293FE7B16C346EFA6F93DB75D17CC rw,b
1,666,284,594 *AF5AC829239B2BF6176704DC3916DF40527E582B sabraoui
1,666,284,595 *AF560593FAFC90C467C1421075B15E0A685C1A1E sainteannedespins
1,666,284,596 *AF5FB331F30D030CD75ACE3DD443D8D9A3C54B2E 1OLUSTEES
1,666,284,597 *AF50D5BFBBB2E448757F5EF0FAA2DAED9166890D morpheus
1,666,284,598 *AF5C46794B5AD4ABD15E3BC78A3B535F3FA80C98 MOUSTING8
1,666,284,599 *AF57886614F9BBAD8540F501F8F917E39183B491 1rodungsfeuer
1,666,284,600 *AF54379CD502C6C03A6A5A458A87CA8BA397341B [email protected]
1,666,284,601 *AF54249E93B3AD209FD6262A2D18ACDA9024662A samme
1,666,284,602 *AF5FE5249121DA5FF142CBF86668BDB468C29E32 1-SUTARDJO
1,666,284,603 *AF5E691B66AF965107F5A9F091D09161DB41B040 1 TUPUTTAKO
1,666,284,604 *AF5BE1B6C397C8121215989DBC6819A6363A7792 1.unangestrengtes
1,666,284,605 *AF5A6C3F89573B88C683A29A4625CBD97CCB084C samvision
1,666,284,606 *AF5B93D7B5BD127F86135A59D0DE9F6891572FF1 Sand-On-Thursday
1,666,284,607 *AF56C47D6078A87363D43120F70DC72B35F70655 MU1TT4$KNG
1,666,284,608 *AF5132F4D4AEE2165695CE2D3EEAA3BC0EEF2016 20.3003-HI:BELIEVEINMIRACLES(DISC1)
1,666,284,609 *AF5DF90134177E3F3177D87FE65A31CD9A441279 2145362 l
1,666,284,610 *AF517344B68397115C0C1C77C83AFA5EE8D5F74E MYVERNON79
1,666,284,611 *AF50C40FDAC82618C63C2D9B765F9D09416007AB nacib.v
1,666,284,612 *AF5D4A7153CEE229A359D29E6306246A36215180 22 HIRTENBRIEF
1,666,284,613 *AF55C419C14B982DD9D509AFCC397A52A841C6F3 2328181 mik
1,666,284,614 *AF5A973A61BE64D2D8344A97EEE73827EBAE4C74 NANASLIED
1,666,284,615 *AF5013C211CC97F81F2CF12D9750476E37796171 NARAYANBEHERA
1,666,284,616 *AF5402C68ACBCD01AA30F56CCE338CB8D2C970CA 2854351 yli-1000-lasta-kokoontuu-kahdeksi-p
1,666,284,617 *AF5DB3E82DE92856242476F203E5E416C1DC2515 nathanwohlenhaus
1,666,284,618 *AF54EDA1BBAB3EBEF1F5F3A64FAA6D9E86C642E5 2-EU-STERNE
1,666,284,619 *AF51F1A651C65F1BB7ED42CC3902AEB1F2ADE337 SECONDDOCTORAUDIOS
1,666,284,620 *AF5B53C3089F28B3475E82227F76979847AC95AA 2 WAP-FAEHIGEN
1,666,284,621 *AF5AE8A70C09C86F444C26B39CBF65B4EF70FB91 2WAUERIT
1,666,284,622 *AF5AFC900508F6972D4F61FC7AD1FD4E7CDDD084 3####@` (><)
1,666,284,623 *AF54BCA48C4CF12EFE09E9BCF4C8BF5570D57EF1 NBBRVDSC95
1,666,284,624 *AF53B0DD19A17CE2F862D5EE0E0FE0FE696206F2 [email protected]~0~OSPLAT!
1,666,284,625 *AF5C91EE1D4C2BC2C12A7F27A25F1F0932252734 NEAL.DERITIS
1,666,284,626 *AF505C24C7FCA844199B2183006FC0DB67D2CBF2 NEAL.WASHING
1,666,284,627 *AF5049785DA61EB8F72B65CEE58E2253C2A04054 nearer-to-death
1,666,284,628 *AF586F0B6A590905A13565B02E446B52E7D5E332 36.weaves
1,666,284,629 *AF5FB921D403F7084355789D6AFA9E4072D1A5D3 NEKSMWJR59
1,666,284,630 *AF5BBFA0975BBDF9AF3A3B1A4FEFBD93B2243636 3b<*.*.*@p
1,666,284,631 *AF5EBFABFCABD46E29AB7C96B6F91D16B395925B 3EMMAITTE
1,666,284,632 *AF53D5231119B3F63EB179AD9A860C602442470A 3.IMGESININ
1,666,284,633 *AF597894B6CD0FCF90BE33B313793F1BDA80D1AA shannon.melissa.parrish
1,666,284,634 *AF557212669F6CA5BCD97FE10A7BF3CA6AD54954 3-----P.`~.)O(
1,666,284,635 *AF5624F8382EA017356727B9CBA4DA2229717A0D SHAUNDY6
1,666,284,636 *AF5876752CEDA9BCAE079E4A562E00F2CFC7EC40 3####).`~.`~.)X(
1,666,284,637 *AF5E2F17D9AD56A5F2C15E0FA28B82BD043C64EB SHELHOU9
1,666,284,638 *AF5063ACCD2C1524EE14C1EC357CC9AF4E8DF7A6 [email protected]
1,666,284,639 *AF5FB6255483B9A3849BC37A00E66F1DD0E7DC02 nikesia5
1,666,284,640 *AF546404DF122950F7776C65ECA67CFD2F3D473D sho-'nuff-must-be-luv
1,666,284,641 *AF5A7B391FEA25039D23BF0356F6BF87D4401D0A [email protected]
1,666,284,642 *AF5B649F795B89879E0CAB04263E7552FF35B005 487148 iskenceyasagiileilgiligenelgeleryayinlandi.
1,666,284,643 *AF553346FC60552899F3CB2C8DAC3C954D575BC5 ”SIC”
1,666,284,644 *AF52E39AD30C93046A6F65F86BB40BB5B2F49B4A sicherheitsdienstleistung
1,666,284,645 *AF53EF7BFD9DBCCC15EE9DDDB0CFE8FDF0CBE417 NNRQSTLY7
1,666,284,646 *AF5235F86C5CBA0E34AEDF94A87330256488AA4E SILVERFIREBIRDED
1,666,284,647 *AF529046C912FADB0F53089A4601E3BF7B5CB38C 4EOGTNALP
1,666,284,648 *AF59378BE621B671B6ED14346D52310929F9DF89 nora226
1,666,284,649 *AF54A55659958EEEB552D0CD079B178062165889 4KLIPPERTBSW
1,666,284,650 *AF5BAC5AFBCF460815496BCA2B676D0015A2F691 situereste0
1,666,284,651 *AF5F8B67827DCD09DBA854B00B8021595D5C2390 NOTFAIR0
1,666,284,652 *AF50AE8902868A140031F43C523F9C1D7A4A630E 4.morevolatile
1,666,284,653 *AF5717047172BB1CC61B36E8DB3CF967023BF115 NOVCANU1
1,666,284,654 *AF51EDB7A9D612EC837E3C9BE36F43F5983D4CB5 NTSTRPH6
1,666,284,655 *AF535C2A8364FD61FA8A2D60EA5DE6C4E9A51816 NYALÓS
1,666,284,656 *AF5C18FA8AACBD720EDBC8B002ADF7E71E0508E9 ;)[email protected]===Q
1,666,284,657 *AF57E75D049241FAF1C9B7D49FD86148211F83FB 4RICKYNUGGET
1,666,284,658 *AF5A9D9AA5C1ED85C771D988D4D5A6870FCC221F SNENJIRBFA
1,666,284,659 *AF5EA5AD6B68DA774128E76B6A212B17AF1905F0 4SAFDIEH
1,666,284,660 *AF5A518ABD454CDC30F560715FB399FBCCD6964F [email protected]
1,666,284,661 *AF5E3F07D24C6529C3C05766E5338A75F2A3C3CC SOL.CAMARILLO
1,666,284,662 *AF5ADCE28CCFD1B27987AD6E64B17FC0F5FDF648 solstrano
1,666,284,663 *AF53A8DAFA9DAABEA2E5B31DCA0863A7BDCE9E74 OFICIALESBSW
1,666,284,664 *AF5F9FCC81E3921AAE2AFDBA775AB1157308D7D1 513067 Ornek.bilgisayarlarIn.yapIlarInIn.Incelenmesi..
1,666,284,665 *AF5485617A74D9A6E51AA695B8B1DF3A56E0650A ohtenamed
1,666,284,666 *AF570E2B0D3139082F8E1CC320AC5E6A5F95135D oklijeva-1
1,666,284,667 *AF59654A8DAFFF77B0CB84E8AE8C6028C0303D28 oliviahollister
1,666,284,668 *AF596C898C8F2CF29DDEAE500218F4EC0FF98A8E 56A07
1,666,284,669 *AF55D6FAE89FC4EBAA57B1B5EB488A10F3A99818 omergiulian
1,666,284,670 *AF51559F38FE7672AF9AD6EAE0FF932743714745 OMERHALIFAX
1,666,284,671 *AF519E75104894EF9D858282066DD7BA7B5A23A3 OMER.MAHAL
1,666,284,672 *AF52BEA0FB2A372ABF1255E3DDB714D2DB41305D ondergewaardeerd3
1,666,284,673 *AF5E62DA74F7B42114D0433C62F512A4D7AEE9C9 OSVALDO.CARELLO
1,666,284,674 *AF59A570C05F2C9D5BF4E1EBE699326012FB06CB SRONNOCNAMRON
1,666,284,675 *AF534249ECC9840158B34721C3611421C5700EAF 5MEADHACHAIN
1,666,284,676 *AF5DA04B17B7FFAD66B6524FF13CBD1D66DEC5C0 5NAVNLOES
1,666,284,677 *AF5EE8BE1C519F017FC1B4F1184A97300997533C STANDARDINDSTILLINGS
1,666,284,678 *AF532D820DC247844FAC407FF060965D9A507034 OV3R$K3PTC41
1,666,284,679 *AF5E3026E1E2E60D618CAC981828DD1B0CDFBB0F 5REPLENISH
1,666,284,680 *AF58CD82E90A9EB3D22DBAD8C31665A73231AC7F 5RTASTED
1,666,284,681 *AF51D316F74F0E6C8DCBEF8DE61BEFDE0697578C p######@***~0~o>-b0
1,666,284,682 *AF5DF07F33793CC3A07AA931DA59E4DCFC21A3D0 STEVE ETTER
1,666,284,683 *AF53B183925D53490DB344983EB51B02AB05535F STEWART.REDPATH
1,666,284,684 *AF59D824B7953016D4D9C12F58B3690A9DCD15C9 stimpanko
1,666,284,685 *AF50D1A07FF0AC18017BA8F958AC5EF6983B8178 605431 poissaololupa-mik
1,666,284,686 *AF5267778D857C3A21108B87BB5F1C95794D5901 PAG3R$
1,666,284,687 *AF5BAFA6B48D53659AC29C1A6827416186E254FC pangkhoior
1,666,284,688 *AF50D36C977DEB96B9F8B02074A1F2A92157E580 [email protected]
1,666,284,689 *AF5C5D0FB77508EEEC9E945DD160511A11CCBAD0 paromatės
1,666,284,690 *AF5CB696625E2F938442E7C071ED7AAB7CC43B04 6BSWTNAEGRESBSW
1,666,284,691 *AF52737C7428E88D33C501BA5031DA1E3CC64FFF 6DNOVAGAD
1,666,284,692 *AF5580C179E643A3D2410EC72DAE9C25370629B1 payerforyou
1,666,284,693 *AF5DD147E07D63942273B4F1863435ADAA57CC66 “SUPOSTO
1,666,284,694 *AF55BBC96498320627422FA5732846B198C460EF suricnop
1,666,284,695 *AF5062DD90325FEBB977B0C9A8910693D3D19E5D 6HUNTERLINCOLN
1,666,284,696 *AF57BA2912A71D9D023DF673E2A3921F9B62418A 6HUSSSEIN
1,666,284,697 *AF51A0FEEEECFDA0B26A7E78FE81C7534E1FBAF6 [email protected]
1,666,284,698 *AF57299ED54004E22671F1FE366D598BE72556CD [email protected]
1,666,284,699 *AF58344A70660DCC82858CEFC21A5A5BA0E39A0F SVAYANAM3
1,666,284,700 *AF556A2E46C788A0201426B26BC36D8AE93C2436 [email protected]
1,666,284,701 *AF5C3E750C60D47C25338E9B2A8D23056EBFC207 PERIMETERS160
1,666,284,702 *AF5A23381E79E90A3F4CA54989ABB78DFC5314CE 6MGENITAL
1,666,284,703 *AF5DAAB8E627665221A0C5DAD2748A40705E0D12 6mygoldfish9
1,666,284,704 *AF59BFBCD0C81422866ED59FD2B45B6511DEDADA 6NURSETRUCKS
1,666,284,705 *AF500E2AAE2EEA4E268A855F400F31CEB57908BD symfoniczna
1,666,284,706 *AF55DD22A6FEC8FC36266C42B40C67C7DDA306A4 SYNGENISING
1,666,284,707 *AF5698E1E4AEC7BAFD698CFCCEE8CD9CD35F0A49 SZKOLNY BLUES
1,666,284,708 *AF5352D68DF438D59DABC93783FE24792DD486A6 philliljenquist
1,666,284,709 *AF563A4B8B5D5B0D903B0DFADF96C411B38859C2 T4*Z
1,666,284,710 *AF5DDB44BCFA2B15E604F7C205467C17E4653291 TAGORERP7
1,666,284,711 *AF52B92F267537398327D3AA173E2DEE73B5CBCB 6TENNLTVA
1,666,284,712 *AF51E0A8186A6F395BF6CFAD5FE706C740B9B3B6 pitbullsed
1,666,284,713 *AF5CF79228B31D63FD3FD9F036DB4BF90218DA22 PLAY.THE.GAMES.VOL.3..DARK.PROJECT..DE
1,666,284,714 *AF5BD7C7246EF6612FAE9FD4AD35111BD7DC73BB 6ZARRAPASTR
1,666,284,715 *AF52B1226D4CF4F8F60CBCA65C83A660C09C9F5B 6ZINNMERZ
1,666,284,716 *AF59838B2F1B798B4ECDB0A11AC58EFB2AC1BBB3 [email protected]
1,666,284,717 *AF5EC754EA883F31880C01BC4D192F7E9E5A9B08 @[email protected]
1,666,284,718 *AF5E09FAD7C01A3848DAA54BA2496760F39290E4 teddyschilke
1,666,284,719 *AF56B5F177326F97BD2FE52DB6125B023BCEB7D7 $73PP1NG$70N3$
1,666,284,720 *AF59D92573DEF153E5F16A544EF8C73EBEFE572F 748681 hinterihmliegtbeethovenundvorihmauch.
1,666,284,721 *AF5B94EE127633988352254648ADDA402E8FCA0B 77ANGELO
1,666,284,722 *AF50E5DC542218381C914F87176596BA262157B8 tetranthera-californica
1,666,284,723 *AF5CCF5693031E40BA69CCC5BDC80E9CE31EA81C THADDEUS.ESPERICUETA
1,666,284,724 *AF5C05BE4F800D32A11BAC255482D5CC28B9714D 7APARTMENTHOUSE
1,666,284,725 *AF504816F5758A2C830C45872CBD9BAA7808F93B THANKIS0
1,666,284,726 *AF5C709C0DC8DE167296D2DAF3445C4B4FC4633A thatmarina87
1,666,284,727 *AF573128137F3578C29FF659C9416DB69A493EEC 7BUTEONINES
1,666,284,728 *AF59CEE8A7EBF6C2AAC0C338B50987053E08B4A8 thcsiz
1,666,284,729 *AF57BA2AF1BFAB509677D00B68F2020F5D5DC747 P=====>~O~O (><)
1,666,284,730 *AF57F2F4B830E64B891F08176FD829843BD2EDF1 7MARVINDEREK
1,666,284,731 *AF5567FB0A44567999BDEDDB2E1EF57EAB58E44A THE.LIGHT.OF.IMMORTALITY
1,666,284,732 *AF5224513673C635F9631D3554598E3ACE94FDB3 7organteilen
1,666,284,733 *AF5FE63B19352E196440829148C23E2B08AAA435 [email protected]#
1,666,284,734 *AF50F8F777D668C858BADD80A6208A2473132453 7PRESTONWELCOME
1,666,284,735 *AF55B6D595DFA8B0ADC4D7D470F868624FF3A511 PREINTES6
1,666,284,736 *AF51531C790124DB78B8AD4D91DF57C1C52F9C91 thoughtprovokingmessages
1,666,284,737 *AF51F3BBA4808E1DE470F01D4C0BAC98ECC8373D THREAD-WORM
1,666,284,738 *AF59D7CA7066ECCD00F3516E80AE1039057ACE56 7SYNNISTN
1,666,284,739 *AF5FA2837893EB2EBCFB948089C305ABB082FFB5 promarkstix
1,666,284,740 *AF58EA4EBD26B5248C880C5370A645928F0A925A PSALMINI
1,666,284,741 *AF56933B46F3F0F36FF503D52832314CD050BD49 7XUAICAR
1,666,284,742 *AF5F218CB36976E151AFCF237623AFE9EC66FF7C tiaridium
1,666,284,743 *AF532730D14EDB03ACFE7F6919970BDFA70A86F0 853CASON
1,666,284,744 *AF5D35D53A3036BDC67C21703DF5B4D28E5ACC37 TIIF
1,666,284,745 *AF597B07DD34D9B2AC114F1163C498195E175397 tinchair35
1,666,284,746 *AF5C96EC96ADC061FEC4EAE30E72CB3CE64A8FB3 [email protected]
1,666,284,747 *AF50D01210A2DC947959AC8110B6E62D6BC67342 8MARKETOWNE
1,666,284,748 *AF5C1FE1007C041FB4432685842F1446F0C1058A 8MAXWELLROXY
1,666,284,749 *AF529CFDDB288F3B6D29F7AC4F8085D9A1B4F604 8MYRIAMETRE
1,666,284,750 *AF5211CF0F0A8FEB2A870B346A990A1605B5949B Q---B~0-SPLAT!!
1,666,284,751 *AF5DC9732544AD885AF77FC2755B1CF5C4801A9F q-----b~o-splat
1,666,284,752 *AF54A89BB9A7388FB77D8BB659C96463724AE477 [email protected]
1,666,284,753 *AF53508E33FC310BE0812092925B761BE6F7C398 q).~o~o;)
1,666,284,754 *AF57D71A24DFDEEE7DEB8AEA3B0D90EE4E45A06C q+s-
1,666,284,755 *AF53B7B13CA105FEE9DE5431B44915B96496F161 96.listoilla
1,666,284,756 *AF561A44D2E48A06AAFDD88F336DCAE3986ADA05 trichomatosising
1,666,284,757 *AF595BBBAA6E8C0C8A5B3D8CD80A627A4158F976 [email protected]
1,666,284,758 *AF56013101B7D63B27978341832750FC8365956D QUINTIN.BERY
1,666,284,759 *AF5175E4F3BF1EE8A2F1B692672B9A2E220B0496 quintonkillmer
1,666,284,760 *AF5E29BB7C5E78A0A86728EA732D77B1CCE5CE36 9AREITINI
1,666,284,761 *AF5F2ADD72C87A59E4862B31A38E19D8B2763810 trisha-ristagno
1,666,284,762 *AF589E9088774AF1DE5BCDCA74045CA3E0310BEC tristangerraro
1,666,284,763 *AF5C663845CCA24D77E59E82BF3F6B422801B682 R3H341
1,666,284,764 *AF57E3A581871319750E9C0E4DE58AB253E5F26B TSMREAWH8
1,666,284,765 *AF596332F44B05F135E7127725FCD4D76B956CB4 9 GROSSWALLST
1,666,284,766 *AF5B8F6EDAA673FDB8D2CDB467E846168D9E8BB8 9INNEREUROPAISCHEN
1,666,284,767 *AF5208E323BBEE6177C906F43FA78063C26C2083 tumichakane
1,666,284,768 *AF59CAE0A049DEF37BC08981DA80AB62869A2211 RANDELL.BIBEAU
1,666,284,769 *AF521BC94E91D4568736F8B3F67DDF043EE358C7 9LIJKSCHOUWER
1,666,284,770 *AF50DAB2DF51AEB14620F04DF6D0F5B1C181A51D RANDYSTATHOS
1,666,284,771 *AF5EA3AE7303DD9A008961D7AE385446F77B6E88 9NEESKIDO
1,666,284,772 *AF5CE62AD5B985D238CC3DA39F6CD0DDA15BDD11 9NROBELPO
1,666,284,773 *AF58CA5FEE7DB483DDA02031754937EAD1E8BD5A 9OLEMMEKINBSW
1,666,284,774 *AF5D1A9997043D805874203ABB0A5CF7F9718817 RATCHAPRAROB
1,666,284,775 *AF5F7CC86426B6697810BB9F8D355D95A8A01712 9PROFIJTELIJK
1,666,284,776 *AF53666D3A5CD85EF59C1D28BA3F3C5A132A5007 9SEEKASTAIINGS
1,666,284,777 *AF58102FD99C9DC0B711F13DAD7154C4C4EC296E 9SIUNAUKSENA
1,666,284,778 *AF5E0703CE0EDB01AED7AE8E98E0F8D8047D0375 9SUZBIJENI
1,666,284,779 *AF57E92965442E3E4CD2C50150145FB70323250F 9TAENIAFU
1,666,284,780 *AF5EB0D9ABDA6CFF39BA05BF3BA108BF46067974 UBROFIKS1
1,666,284,781 *AF52A6AC5CBA2AB91FA22ED2B6DF12722D9C5305 9TILLSKYNDELSES
1,666,284,782 *AF5488DD633BD0B4C186895FAB8E424488BC7F1E UBVUUIKAXURJCQU
1,666,284,783 *AF5702B1F7AE5F8E399C31FDD0FBC4C137492EF9 udsu1ter
1,666,284,784 *AF5E6E93A9C582AE3D74F5C999391101ED5FE72D REEDLEFORT
1,666,284,785 *AF5AF7AB1F82F7369E4E500C350639CD4CAA3989 REFORTGEPFLANZTED
1,666,284,786 *AF55502F6E20CA5DFF1DD650383F6DE3CCCFE409 REFUELIN1234
1,666,284,787 *AF5F7CF70F61FF64F23EB9F3003E2C551B30AA7E ULGTBB
1,666,284,788 *AF502AC67FDE2A8DABEE23F66B1C5087685A96B6 regierungsverhandlung
1,666,284,789 *AF578A662BE3F070D612FDA84DFED01219079C81 uma.divi
1,666,284,790 *AF5CEA878D75C955D0C4A14396BDA2107E43F35E regnvann5
1,666,284,791 *AF566879C2A6416DCD050820AFB0AA42FE765BC0 a3r)
1,666,284,792 *AF5B3BCDCE12D5E74B1416E40A5F66371A6295CB A6P8K
1,666,284,793 *AF5ADC87704C73ECE0B4AB4B1403F49E927D483A a7?v
1,666,284,794 *AF52029332F187F33412CB2F9D5A60692CBD0269 UO"M
1,666,284,795 *AF57E4EA2A28AA008D9EA689E3CFFC97D474609F aa#&:
1,666,284,796 *AF5B90EE3269D590B3FCAA478E5D65A97C0E159C AAA=.H
1,666,284,797 *AF59D4761EB70EB8F4FB4F0F07DEACC0CB0976E4 VACIVIÉRA
1,666,284,798 *AF53E700BC714E7F89783819A409763DF83C1A85 valentino-boskovic
1,666,284,799 *AF5AF9BC626DF4B01A167F9ABD225DBBAA87839B REYLIUS1
1,666,284,800 *AF53AC2312952BC3B2919891E3EE22ED89D81272 RFINNELL
1,666,284,801 *AF59ED4CDA995CB8D0607EFA2E3D7FF19B1666C5 r'glmnt
1,666,284,802 *AF52DCBB2A9EB56B579E3491D4C55AE01B7D3345 AAD*"E
1,666,284,803 *AF5FA5E3DDF7D227DC5B06D8E7FC648C8B4D745C ricorygalski
1,666,284,804 *AF5C56C883D04A2D923106145BC1DE9BB49E2BF9 AATHIJI
1,666,284,805 *AF52EE0557FFB1493EDC97FBC2D87FD24A4DFD3C veralynn-puyaoan
1,666,284,806 *AF5FB268ABB96EDA80AC12DDEF8426B381B6E013 VERITOOLSBSW5
1,666,284,807 *AF5D5E2D9C7C1835DE36C5A16A3EB71AB8B1C158 ABCHURCH3
1,666,284,808 *AF511516D791A3BF20E076AE65D4EC4BEB687AB4 V?F9
1,666,284,809 *AF573B6B85C9C670642FD323EF01DB501079CD96 RIKELIEDER,NR.39:DENKES,OSEELE!"EINT
1,666,284,810 *AF57FFBBF14831BC39C868AE6012DB9829FEDB2B ABKI~
1,666,284,811 *AF5F1FEBB4C51CD0BDBAEB5D0A57BEB414964F68 RMARVIT
1,666,284,812 *AF500093B688B88DAE1258E91F9D3DC75A5ABA79 abortion
1,666,284,813 *AF5B6F77D9EB3814FA93CBB967700B45C31E2D2C ABS?D
1,666,284,814 *AF53999281740A01B44DD5F9B7C1D21D9C86FDD4 robert-soltero
1,666,284,815 *AF5156DF0C411A62BFDDF2F0C1F751C74793BE55 vi-mccumiskey-welch
1,666,284,816 *AF5A2FBAB478547C770B54DF3C82036792F7A49A robin-chacko-mathew
1,666,284,817 *AF5080E1CE1275BD5C3E2EF9AAB69DCD4A354587 ROBINHOOLESLIE9
1,666,284,818 *AF53997D2AA4B87DC77E972738F6D7FE32EAE403 [email protected]
1,666,284,819 *AF571F8E5A123C4EF3EB79A6AAC4547B058828EB RODOLFOLEARD
1,666,284,820 *AF57567AD7EC42D4BFD7FB3FD3FB56A59E53D44C RODRICK.HAZELRIG
1,666,284,821 *AF58D46F353504AD04BA6A4EDE93BD02A5D8CAAE RODRICKHOLBACH
1,666,284,822 *AF571F1581EFC6B50E9347DF1CDF5DFC410D2B32 rodrickrahib
1,666,284,823 *AF5A21CA5057F99FA41B5E85DB9B0C6EABE627F3 ROEDMALET
1,666,284,824 *AF51A27CA13654964215353950527CB233094DFE [email protected]
1,666,284,825 *AF599AC14DD3EE123CF95C33F68F0BF22B82610E acvvd
1,666,284,826 *AF559D524F22C4724B850FDE16B49C705B74B9C4 VIVIANDOLEMERSON
1,666,284,827 *AF5EF2B2FB8F0BB913465A263129D6827630DF70 RONMCCLANAN
1,666,284,828 *AF55686116DE21BA0C5664264333A15C8DCB8649 vkatskq34
1,666,284,829 *AF54D7AA2EAFAC35C7EBE2352F1ED72E58E47261 VOETPLAAT7
1,666,284,830 *AF59CA423645CE12641C2B99E0682EB92CBBC519 ae9mw
1,666,284,831 *AF5DCF9372AD17B7D44119DD265C09A80AFC4707 VOODOO01
1,666,284,832 *AF5747F2594A5593E43DC1531F0F7B11A275491A ROSKANS-LEAD
1,666,284,833 *AF5B97588EFA658F456EAC8C80F0677DE949C5B0 AESHACK
1,666,284,834 *AF52FB78369328B3872930F838D80E0B926233DF vuong-chau-lam
1,666,284,835 *AF5E80E10774FC2A7D86992A0255B38AA801473F ROZEHŘÍVAJÍCÍM
1,666,284,836 *AF59C3BA32DFA36A28095C4DD529F0C70E4EEA8B ruben-eduardo-hallu
1,666,284,837 *AF5A17BC489BB95F700AFF3CFDAD1CCA6EA60918 AFROKUBAI
1,666,284,838 *AF5EC60FFB272380D843A09ACD705E6EC7E01FF7 A/g
1,666,284,839 *AF5D9674659C4176CBEF8587FF86EAD4AC9917BB RUDOLPH.BUCHWALD
1,666,284,840 *AF537AD589984423528BA45BC0F1518275CE0B6E RUDY.RUDE
1,666,284,841 *AF511B26369B7ED5FAFF9A30F6EF281F0D75D48A RUFUSHASSIN
1,666,284,842 *AF5E8B29249F5EF05A8614508A6D573A3879FB93 RUFUS.POLISKY
1,666,284,843 *AF5ADBFDE515F48F2EA097E3AD9E389ADA9F00AC RVLAHA
1,666,284,844 *AF599C5B2E4D576515B616413DC474B3AA2B7C8E WANDAROSSAN
1,666,284,845 *AF5615FB47A403C8798622812915B46107A9537D SAG0 SP1E
1,666,284,846 *AF5D655B03F6D06D928B5E714AEC05EC74B66574 aiovve
1,666,284,847 *AF52A4BA1F808D79C052A35CB72E9EF283C521A2 we can get down (a cappella with rap)
1,666,284,848 *AF5F3564200846B2EEF9C2F3847D33E0A8E78A65 santiagogenco
1,666,284,849 *AF502A8C32205AE28A3277C0D06B134D62C25453 santiago-sandoval
1,666,284,850 *AF5AE1D4C2C11B57042E77A8F07184C24C929855 SANTIAGO.SLAVICK
1,666,284,851 *AF51CCE6163168DCE9173DE71EF0195AF3473170 alanrusbridgerinjunction
1,666,284,852 *AF5830852FD124FC296B6F79127872FAAC130E49 SARA.GAITHER
1,666,284,853 *AF5277179D0FAD7C733FF6ABED73168613951B1A ALBERTHENKES
1,666,284,854 *AF5499CB907CA9A85D6E7558468C768E1DEDD057 SAULANOLICK
1,666,284,855 *AF5469B96D1E08D7539B718A7999DAC5DD842548 s-bahn-betrieb
1,666,284,856 *AF5FF42FE8DC7E5BE34261CA55365AADD19DDB5F ALEJANDRO.REHFELDT
1,666,284,857 *AF5C293B37F36E66A251DD6BA44833736A653A3C what-can-you-do-for-me-(club-version)
1,666,284,858 *AF56BB518B94FCFC38AE4D3A88476ECB70B1DFFF WHAT'S ON THE BAR
1,666,284,859 *AF595260BF87F0F87210534CF2198D13448B67CB whirligig.of.timerave
1,666,284,860 *AF5D2CC2C517CB4D33738B02FFBCFC30BFD1BA37 SCONSACRANO
1,666,284,861 *AF535E8C161543AD4E4184D083973B3F1180B677 seddjiwni
1,666,284,862 *AF540475D7781721ACC957449A118BBA9E007478 am_#c
1,666,284,863 *AF563AF3B764BC0AAC7D4D19EFBAA530F750C303 sentimentssousverre
1,666,284,864 *AF51C9884BB52E49407D6395736DB583A6AB1850 SEPARATIONSURKUNDE
1,666,284,865 *AF5FECD9074163C1C2940E40373E80F86D20B223 ANAORCI
1,666,284,866 *AF5C9D96DD36EDBFDB6ABCE7AD0B6489F651C16F sh33p si1
1,666,284,867 *AF54B7D82F52EA692FE97B9D2C9E228FF191C304 SHANEONOFRIO
1,666,284,868 *AF5CCCA8950D7F2029905A0F3B734B5D075B7D64 ANDRIESLOCATION
1,666,284,869 *AF508D21FAE93B6D0BDCDA449B96BF989E3E2846 [email protected]
1,666,284,870 *AF5D7BDD0A5386A8D9D62C59FFFEB54FCC11E5FE SHERRINGTONSES
1,666,284,871 *AF5E6099640990B4545300809F25750585EFBD95 [email protected]
1,666,284,872 *AF5422C1CC74D2BA16B6364B2D9BA6F6F9E94596 wwwbrainthawgamecom
1,666,284,873 *AF58D9B5D7BD9DB1B1DF347B7278EAE9FFC9382F WWWDENHOEDCOM
1,666,284,874 *AF53367BE30516DA229BC35F6342962EE0A173AA SHiELDHLP-=-ON-ACCESS-SCANNiNG-HELP
1,666,284,875 *AF534BDC219CCD53F12F6D25B5775BE795E8E2A8 SHIMBÓK
1,666,284,876 *AF51BB979B0030AB7A0946A6A516FA9DC5A611EB SHIRASAM3
1,666,284,877 *AF5B9E4C6A0A6A5B35CCF22CA32FD4BF26736F1E wwwuieorg
1,666,284,878 *AF5F26E38C639573203BA767A068BDBA5F5EABBE wxnd
1,666,284,879 *AF5CEB092EAD2F8A496B9633E6A65954FAE7CB50 XANDYOPENIA
1,666,284,880 *AF59110DA26FC4A8D5FE6016645DF76A0FA30263 xhc[
1,666,284,881 *AF513110A8FE24E7AD37803A957E427169A8A92C sierraaylmer
1,666,284,882 *AF597EE6E4F76D7B6DF4C318E75C04BBA5453AA0 [email protected]
1,666,284,883 *AF5875975984561A315F0E67F634A83997F303EA SIGNIFICHINO6
1,666,284,884 *AF50F092B4C80C10C51B16788455FAA546A36726 ANTHONYWAYNEBANKBUILDING-FORTWAYNE-IN-USA
1,666,284,885 *AF5A9EF34A9BEE28C22A281CE90BCE3EA1D548DE antoneruehling
1,666,284,886 *AF5E8456095806AFE25F47FB36CADF9D429B4C0F SIMOGATTUK
1,666,284,887 *AF55870238DDAA7BAB5B3E477BB92FA4CE3514C7 XSTATIK160TALK160
1,666,284,888 *AF5102D6A22B12855D3F8260ECDAF43983C8AE5C XSTJDSIPI8
1,666,284,889 *AF53C7AF4D963A057CB32AB73890E01AB6B60477 xsx~
1,666,284,890 *AF5B5B477AB24952D2C8015598571D9743F6A588 sjaddai
1,666,284,891 *AF597EBD28B6B3D8D85EDFDB89CB673DAB4D596E yesenia.curiel
1,666,284,892 *AF5C261694C1727428D4A5B07C093AECFDA57709 skippyjulie
1,666,284,893 *AF5592DBD56C26A797EAF0190FD25DC263EE93FB aowwg
1,666,284,894 *AF58C504AC9213D426AF8508D1ABA8CE5F366C1E A,PU_
1,666,284,895 *AF568311A38C6F94C101264ADB121A07DB479526 yvonnevanderbrook
1,666,284,896 *AF5F5F5B3B0D6D9759B9A3AF31D5DE520E090108 aravecz1
1,666,284,897 *AF59A8F1FE35A7A4687AAB0967376C0730416A37 SOLEILGLOBAL6
1,666,284,898 *AF5C6BC12D5CB0DD92F3ED2612ACDDDBA01E6F30 AREYOUREADYFORLOVE(MYLOROADMAPTOPEACEREMIX)
1,666,284,899 *AF5FD6FC7BDE6B1272DD74FD0DCF46752C74321E ZACHARYPONZI
1,666,284,900 *AF52AC6037078A1CCE4ADC0FD35192307BA873A9 ARHB
1,666,284,901 *AF5D67BB31F946A7959FBEB589C183CD16735979 ark5#
1,666,284,902 *AF550848544B739EAC3542D9A34BCCE518222A45 [email protected]
1,666,284,903 *AF58281C98D62C865C8BEFE589DB0A1C688691A8 SPARXXX8
1,666,284,904 *AF5FE73F19421F6BB725704EBAB696B9CDFE59C0 SPIDERCAROLE.
1,666,284,905 *AF5576E3B5F215887E20FA2DAB601CF898352811 ZHIBOLIN
1,666,284,906 *AF57902C8CA2D103F035701654A8BA6B79AF9EF5 Splat!!0~.(-B
1,666,284,907 *AF54BFACDD7CE726439EF1EEC106AD43684776CF arthur-v-johnson
1,666,284,908 *AF50FE91BA5D49285A867D1AEC6CBC24601E7CED SPLAT-`D------Q
1,666,284,909 *AF532CDD25BA04C847196B0BE1F5053B5DEB567C Splat * (#####P
1,666,284,910 *AF5D217A3655BF60D12700EBC171548F6956670C sprngr-vrlg,-nw-yrk,-1994-t-ppr
1,666,284,911 *AF5DEEDCAE7894DDF6AD99BB33FA869703E5C948 sptclly4
1,666,284,912 *AF5B962716AC0C27732F550B62B48E88E889C6CB atlasodon
1,666,284,913 *AF5E06DD798AF088D6139559572FA69C04F684C1 att=u
1,666,284,914 *AF5115B6A60B3279E8D327D86B80DA19D5DC68BB SSSSSSTRC
1,666,284,915 *AF581F6F1CF8A531D7B23F065818886A1F8487EC ЗАМЪТЕНИЯ
1,666,284,916 *AF577ECF9BAB19AEE0190A5214B662D99FA119D8 av110120
1,666,284,917 *AF5A170B7EC7694493B980C74182D3B65FBA4CFC ЛИЧНЫ
1,666,284,918 *AF5D2DEFCC93342568A32E995CF18CAF044B3FC3 stansburyjr.
1,666,284,919 *AF56DEA37F206BC88512E7287464A41F4982AA02 AVERYZUZIAK
1,666,284,920 *AF54022B2D051A095806C3AB17428BD425E58D7A AVS1)
1,666,284,921 *AF56DA44DE4B0FA5AE0442AE1F561D14BAFADE7A STEFAN.FADELEY
1,666,284,922 *AF513112701A9D78B8EE44F2C811569747FD6B92 AWT4
1,666,284,923 *AF5C3FB90E9B32C2916CA4FFA1536B1593316C89 stephen.scruggs
1,666,284,924 *AF5DA3169509A07B745CA85F580440639930CB0E STEVEROCLE
1,666,284,925 *AF5EAD47107A3212B4A50E8284BEEFA11D258984 СВОБДНО
1,666,284,926 *AF5234EC08AC761FCC7560D275C29FC09571AE1F СЕВАСТО́ПОЛЬСКАЯ
1,666,284,927 *AF514AE414E2FBAF2A1CE536FDA8EEDF598E9EC8 b3_mp
1,666,284,928 *AF5307E4FCA131BEF45992B6FC14499940676BF5 b58.l
1,666,284,929 *AF50DAD694827569B2BD59DB93714E995CBB641F ЭТНОПЕДАГОГИЧЕСКИЙ
1,666,284,930 *AF52417FD39509D64D5287C29DDE62E33A9FF6B6 SUCENSUS198922321
1,666,284,931 *AF52FF65D4DA8F3A9EF70BEC948B86012D3AC990 BACON:
1,666,284,932 *AF5BA2EA4CBF33A15144358363440B5C202D9AFD BAFEDCBA2
1,666,284,933 *AF59EC9DF32FC9694FF0FE8D78D7C0385DB10031 BAJLMZY5
1,666,284,934 *AF5A8610BE0E9B8CA0E420BFA2AE5220812AF689 B&A!Q
1,666,284,935 *AF5A22A82E7AFEF0D61F6DD5D4B00CA8A444102B sungazer5
1,666,284,936 *AF59B06C17B0828FD850529C853E048FB90EEF72 BATTLE-OF-THE-KINGS-DRUMS
1,666,284,937 *AF5A0138F67F08AD0F7517BB6BAFAE5CDB3DF188 bcjnc
1,666,284,938 *AF5650B4D71E78ACBBA1D3233764F4251DCFE24B BD/MX
1,666,284,939 *AF5AD1D6B12F5C45302F3D82055BBC89F95FD321 T2YE
1,666,284,940 *AF56973BBC5145B5EEE769B6612A5C188785A489 BELLY-LAUGH-:30
1,666,284,941 *AF550327A9107DFDF08B4ACD7C69FC4C91FBA51E BENJAMINCOLTRANE
1,666,284,942 *AF5427EDFF9C06FBF0E32393683A8C7DEF9FE398 TALKDAHATAZ
1,666,284,943 *AF5E0C79B554CFBF54F9E1C805AC62785D535522 田嶋陽子 YOKO
1,666,284,944 *AF58C8A80C1E5F50FE22D283AB81AFB767B719B3 bfobm
1,666,284,945 *AF5923AEDAFC1B8BB5A5879186F966A5F3D401E0 bi#3
1,666,284,946 *AF5D1E80D5A1C36F777633600B91948D7F387E22 TERUGAOK2
1,666,284,947 *AF52008355608B7B3EE247AA87564B8725B0CBB9 THADDEUSNORRIS
1,666,284,948 *AF573DC0EF7977DD38F0067421E791E3A324454E THALAMI
1,666,284,949 *AF588677C72A116AEE804FA7C81F55C5A397C6A5 BIRDSILL0
1,666,284,950 *AF5C975A7A382983F28E73F293757C18CF4FB2F8 THEATRELAUREN2
1,666,284,951 *AF53EBC26D5461A522150A4EB419C978240D9997 THECAMEL61
1,666,284,952 *AF5D5C0D7B1BD31F724D3E3A8CDD33A4A110AA35 THEDLEY
1,666,284,953 *AF5332FBA2DEDA20C91F0BB719B5EADC4471C84A BLADERSTEV
1,666,284,954 *AF523FAE0BD337020E3A826C5FCEB3B6A894CCDE [email protected]
1,666,284,955 *AF5B3A58F0DC0ABD5DA775BB2616626BE7F587E3 bm5
1,666,284,956 *AF5692CD5766A8D838E35E74AB0975A0F6B0B999 BMANAKS
1,666,284,957 *AF5F7D3A234B29BC9F879A64D4AA03B28B56C822 THIELBEKIN
1,666,284,958 *AF5322AC18AE69E361DD47A40CACBFE033A06F41 bmr;=
1,666,284,959 *AF5DB1FAB912BDD987A919BE951D10515465038B bnaxe
1,666,284,960 *AF5DA9C67DDA27C576F583BBA498F8387517363E bobbycoriell
1,666,284,961 *AF59DB8E85683AC58676DFABDF595AEAC387A9E1 TIM.SALMI
1,666,284,962 *AF5B0B032039D847EAE5AF2AD414E9A6BF8F4415 [email protected]
1,666,284,963 *AF57AE84812759452B5E104EB212AB35D61BAAC2 10AMERIKKALAISOHJAAJA
1,666,284,964 *AF5F5089AA5A8745C5E77EEB283288D1A232C3C1 TNEMERUCORPNONED
1,666,284,965 *AF5FEBA80F1024090B50B069F6D52902A133CA81 torgbod
1,666,284,966 *AF5A3F75917F13118143DE92A0FA5F980076E3E5 [email protected]
1,666,284,967 *AF5CA3CE3871EC2D01887B4CC584A37A70ED3571 TRENTON.LINHARDT
1,666,284,968 *AF572D6D4FD022909D08500A15C4E5D23BC9A5CE TRESSLERS8
1,666,284,969 *AF52E6C2575BFA6BF9B8888337320B9034BD7F8E TREWLOUESING
1,666,284,970 *AF5AEF3E942ABC706C79C70AF298EE6489078882 TRINAFITZGERALDMADDOX
1,666,284,971 *AF56511640213CFD9434A6EAA5BAB155B6AEAE54 B+O:L
1,666,284,972 *AF552C99B0C661C1101ABDA1151A1DE63F5C7428 BOMMENZE
1,666,284,973 *AF5872286730BD238081088A93CD1510720350E4 bookerpetrosyan
1,666,284,974 *AF5108245473FE20C749CDD70B31A59FC036B822 trnsprtved
1,666,284,975 *AF536ED9611CAC8C588D28D578AF33A47CC99DC7 TSE-WING-KIT
1,666,284,976 *AF51C728E1D251D3F9474419FA0DA2250E33EFEB 1479030 THEIR-IDENTITIES-WERE-NOT-IMMEDIATELY-AVAILABLE-.
1,666,284,977 *AF573A9FBEE0B7D1A4484E0DA5F828722F24F758 TSITEHTSEANAED
1,666,284,978 *AF5CF6CA33CEC8B808F57AF0E225D969A39B9EB1 bp,
1,666,284,979 *AF5E00F5CE6A34AB757FFBB8A88ABD5E28006861 b-p.*.*sploit
1,666,284,980 *AF5D97236D0DF10799F5677A6F44CEA04D760A38 1915584 OPETUS--JA-MUUN-HENKIL
1,666,284,981 *AF5E3D84EAF022DD58435B1D4C25F92E07392C89 TYRON.SEIVERT
1,666,284,982 *AF541884DB0B840E25396FAAAD78A506C8265B94 U193666
1,666,284,983 *AF5D93A68883CC1EE652C34285FB518B4AB2EA6F breannagivens
1,666,284,984 *AF5F4B68B9EAF7BD666132AF8FC5DAD12075D1B8 BRIGLIE1
1,666,284,985 *AF5533B97C4F71663A5D0EE7C65CDDFB72D180BF 1.atsalealajeista
1,666,284,986 *AF558D33CA5EC2DCA6624D2A895763E8AFD54DB9 1avonsprecher
1,666,284,987 *AF53C0365212FA7F744059A7DBBB99FDF0EBA3CB brmadiw3
1,666,284,988 *AF59866776766D9CBC4C841E05DE32B7ED921E80 1.coloration
1,666,284,989 *AF56F11D9FD09CDD6A04EC82F9E146D214F8A06D 1 CUT-LEAF
1,666,284,990 *AF5C0E9AD36682196F2CF7DFFB76519EAC2D28B8 1-doral
1,666,284,991 *AF5BC0D15C3987C914E9300DE2DCFBCAD64C56CF UNCURDLING
1,666,284,992 *AF526CE7763243B68D90FD325DACAB6A094DB896 1.EMPROJEKTIIN
1,666,284,993 *AF5A0B9CA2CBDA7DA5648E37BEBB8B984FB3B164 bruteforce(b)
1,666,284,994 *AF5C400B2E4A060CFFE72FD955C7B6F8D5B09D90 BRYSONKEITH
1,666,284,995 *AF558CE88E354F24AB113FAF5E645E6C83BB7BCB bsu?s
1,666,284,996 *AF5698A613032900B190A3263234B223748EF8D7 btfgi
1,666,284,997 *AF5072C4AFB4DA8FBD1A5FF78732A48AC312D57D BTNKZ
1,666,284,998 *AF51487C99637A32444E961E2EA4EA8CC22DC09B 1maal
1,666,284,999 *AF5D16C145A0DF375FE71C4B9710F939D1919C7F 1 modelledigimiz
1,666,285,000 *AF55065C069DCA75D6FC9AE8B124DA7E32CABD84 U!W1
1,666,285,001 *AF58B9ACCFFB48844208A4935BA85E5CC3224038 1PHYLISN
1,666,285,002 *AF53ECCFC3FA651284FA52C71B96E0F31130B6E5 butchmickey
1,666,285,003 *AF56DC23980C97BC7EAADC4FA0F31376B49C924F vainstream
1,666,285,004 *AF5B1F7DEE47AD4B78CE9BF4735A8CAF7D0F938C 1.PUUPELI
1,666,285,005 *AF54AD654854CA1D5523D78A7B356F99E7135A93 bu.xh
1,666,285,006 *AF563976F1555BFCBD695616228AA183C4DF6836 valeriejeancrawford
1,666,285,007 *AF5D9A7FB05C19A22ED3FF7361AD348D34A192AB Bvg&
1,666,285,008 *AF52BDD1B77F7BF3992D79CE02021B643034814C van-eeghen
1,666,285,009 *AF5F5EB01BCC73CE0E973CCE1C12635369965AB3 venkateshkodam
1,666,285,010 *AF5BFF41E17A25E4B010E7C7BA91A029B6122C38 c0lc-
1,666,285,011 *AF56B2E8E647C90C9118F352AC07FCB7DAB1E97C C0QUI114
1,666,285,012 *AF5C4F1850BF4739D9AD4405E186F359E22266B4 2:--2---#---&---ENFORCED
1,666,285,013 *AF52CCA99820EF03595DCF9CE859DA5EFC8B6B41 c46h65n13o12s2
1,666,285,014 *AF560499310942F02348DD36AAC267C06A80A739 2661035 joillakinalueillatoimintaonkaavailtuj
1,666,285,015 *AF5FBF6ED2F2FE5C16C6F1F376613C27BDD9C796 victor.oma
1,666,285,016 *AF546AD60EA6B28C26EC02DDE2BA25236814D691 victor-riddez
1,666,285,017 *AF54D54A58C2FEF11F63C57658C01C2608588DAB «VIDEO«
1,666,285,018 *AF58AB75287CEC2A90CE000C0B3C17BDB5BF7E80 VISAFICTION5
1,666,285,019 *AF50AB3EBD792158458E52B6C3CCBD072B4DE82B CALISSAH
1,666,285,020 *AF58B5062DEC4C0F70768DD919539EC01F3B226C VITUMBIKOMFUNE
1,666,285,021 *AF54B5B72E3F0F7CFC9CB22E1620E87C52470B0C 2DESTEKLEMEYECEKTIR
1,666,285,022 *AF5AD3D0F8510B3FF47C714E55074738DE860FE6 caminejos1
1,666,285,023 *AF52F4085A3AA9A0E3CFE507F3F34A2676FDBD1B campjorn0
1,666,285,024 *AF5078074A1B54AF4D5F0A19620245499BC39D7A vonhaesler
1,666,285,025 *AF50350D6D9CA75F808A4EEE093B8070964BBF2C VROUWELIJKER9
1,666,285,026 *AF5FAB6B731C26FE4545B98BF7CEB71F828C112A canvased7
1,666,285,027 *AF5110DBAE642B6CD337DA5C4368557D594CDAD3 2panzer-exports
1,666,285,028 *AF54386FEF8F2AA98918CF51EE88C149C4745169 carlosatehortua
1,666,285,029 *AF5472EB2D97A1B75E03A090E899D8DF94594CDF 2-wahlschecks
1,666,285,030 *AF5231FD6B39A49A03F8729819A66AC1A1579941 walterkailey
1,666,285,031 *AF5F24AD91BE9985925531AEDB1C311CADCC2CB6 321240 ja heid
1,666,285,032 *AF5D95EE693D4A4E3838D0E78522CBF6A3F5ED9E [email protected]
1,666,285,033 *AF5910B3FCB1E7480BA31664624519D2722F99EF WANIEKOV
1,666,285,034 *AF536A558F6BF55A6C44BFAF7385FA7382614177 CARROLLWILBY
1,666,285,035 *AF551A583B002212B6E61720B5F2F96F3385A79D CARROUSEL'S.SLEEP
1,666,285,036 *AF5CD45519678B410D87AD3F1947E3C510E55DDB CASIOVISA2
1,666,285,037 *AF5213608BBBC3AEC30184B85D977F267B459DB2 cassava-piece-radio
1,666,285,038 *AF5E588BC19172C2C31BBBFEB43D9B8AF2B369A9 WENDY-FIGONE
1,666,285,039 *AF502E6DB175AC8D603106608B77394ECCA4D652 [email protected]
1,666,285,040 *AF5851CE3F6B72C964589EBD0C312682DAB19438 WENTWORTHPAPERS
1,666,285,041 *AF53352E491C8541514DB54666D9D30D893F00DB CAST)とは、放送波に「
1,666,285,042 *AF5E50EF5E78569EC7F78D79E9A322EA170F79C1 35-reformpartei
1,666,285,043 *AF5A3C398717DCD5E9C2E3DADCBF990E3A5F104F [email protected]
1,666,285,044 *AF5DC3BC07A9AF86874A16CF3F076027F32D1133 &WHATEVER&
1,666,285,045 *AF5C555118204D84ECD31BD27C9983E965FF1D5A WhatWeNeed(RhianSheehan'sSelenophobiamix)
1,666,285,046 *AF5DAF8DCF52C3408BA234E4F9C61DCD50A613E4 CCENTOFANTI
1,666,285,047 *AF54A6875D74FC0BBD7FF949DC479F03A6E8625C C,=CM
1,666,285,048 *AF540236BA0FA8EF7D3D5A2BFA44FD110FE50BEB c:\documentsandsettings\firexware\cookies\[email protected][2]txt
1,666,285,049 *AF5BE833BA1DDF38CC856DF3431F4FF38B25286C c;-dq
1,666,285,050 *AF5A3D8007244C08CCCE741D816C7963296B38F6 3 GELDWAESCHEREIFALL
1,666,285,051 *AF50DE08567D04D08FD97045B6783617E649560B 3HEALTHPPP
1,666,285,052 *AF56E24AE0BC1FDA3DD8C2B7E60FA24C2B32E959 C,-ED
1,666,285,053 *AF5350F635B36EC722361064156F9EB54D213069 3IMAAVIAR
1,666,285,054 *AF5E867AE7AF16F69527A9BAC92E38F4758FFA24 WILDGOLD,VOLUME2
1,666,285,055 *AF5E42F14DC73A6BB921FBF210240A8D86273EA7 CELTIC.DREAM
1,666,285,056 *AF599F5DC365EC29AED883D84D9A6E2D3BFA4C7D WILFORDRANAH
1,666,285,057 *AF5D3AD4A8A1934D0F18D8A883241359FC3C27D9 3NISIITIN
1,666,285,058 *AF55B42FA8F903AE901F058792578D856AA964A2 3> ~O~o)x(
1,666,285,059 *AF58686DDE1A266537D9FB963BE0C9FC4BE68BDB 3PERSENSE
1,666,285,060 *AF52EF8A519356AF19299A937F593550D9833CB5 CESARBORUNDA
1,666,285,061 *AF5BF4F7FECF16E2F89F38A2D678296A8A438EEA WILMER.SMYLIE
1,666,285,062 *AF5EE8FE3610664F2214FCA0EB5E2F0024A09E9C 3STROFIAR
1,666,285,063 *AF5BA8A4E99EB8614C4403637AC26A7640A61D69 WINFRED.WASYLOW
1,666,285,064 *AF57B7E3D8271C3A336033320CC38C195B98031A winnie-swartz
1,666,285,065 *AF5A4670265417FD02881EFF0FB43B7643BDB36A WINTERSPORTSPEZIALIST
1,666,285,066 *AF57D3E7357D28662FEF9E781D4DA4B22A5CB9D7 cfpx2
1,666,285,067 *AF53402B25BCB0D8FB85BA8189C95C62B83B69BB wornall3
1,666,285,068 *AF59F3B7F872CAAF5767BC3A0C6D8E2FD73D98BE [email protected]
1,666,285,069 *AF5B034BC4121C608E81C1BFC8AB54D98BF5BB6A [email protected]
1,666,285,070 *AF54DEAB96F901E4D87E9A57C92288B70D2F8F4F wwwintercutcz
1,666,285,071 *AF54FB23D8C9D0CEDF818812EEDFBB76FD9C63BB 4DEFFALCS
1,666,285,072 *AF548DA4771EA5F5CF9A5386982F3DBB02593336 WWW.RECORDCOURIER.CO
1,666,285,073 *AF5913657FF2CF4C54AF8AFF62B7EB5DDE0149BE CHARLEYBALAS
1,666,285,074 *AF5C30B3E8DEF8A03D4234DEFDFBCD6E8775289C CHARLOTTESAVOY
1,666,285,075 *AF5BB1FB7E0C283368C66DF3B2F7657350D0BF2D 4ilovericardo11
1,666,285,076 *AF56125F59776B76C7AAAFB7C7C14725AAAF6DE4 4KELSEYLUCY
1,666,285,077 *AF5307E4A562D101A1D5B001348F0C50CE8A64D3 X50700
1,666,285,078 *AF5F33DFB751BCD9C6C4F08693A749F9C2E733CB CHILILITAN
1,666,285,079 *AF5C395834C26E224C6057D2764AB7B9ED424053 4PDLEGZHOBZS
1,666,285,080 *AF5D617FB04946D07C061BF0F4DFCF126117F56C [email protected]
1,666,285,081 *AF52CAEBC885D152326391D1F7EC0FE2018DCA1F XINSTALLEDING
1,666,285,082 *AF5A8B88B2420CBE89DBFA21D17ABD393B4758B5 [email protected]
1,666,285,083 *AF5283C58158A1970C76F774882BE37A0B1D504A 4SPRINGMOOMOO
1,666,285,084 *AF5C23427BEB99DC25008B23970DB04E55E39C68 4TELETRONS
1,666,285,085 *AF5503BD9E60F4E86265D9BD42E24B2F44ABF061 [email protected]
1,666,285,086 *AF5B8A1FCD57B096A171537F429AD601D4C855D1 YASHOSHROFF
1,666,285,087 *AF50A5B57C3F5CF73FF47AF3A4CF0C4405E71C77 yassir-al-busaidi
1,666,285,088 *AF5A8CAB2D951B2D019271F9682DCD7F0D02B28D CHRISTOPHERB
1,666,285,089 *AF5956A37385CE6DE9D1A7F05EFB8908BB6DCFF6 CH=TT
1,666,285,090 *AF5EBA48E3B1A8310FF014AFCE9158064EA67902 cigoto
1,666,285,091 *AF52E2CE072F1315A82B514EF488516EB24BDB9A 5BIGMACLOUIS
1,666,285,092 *AF5276560657F61EABA738B0D86753DF2E3AF837 cj:i_
1,666,285,093 *AF559285DBDB9EFD5F6795751E1E4DB396BB1DA6 yousabmaged
1,666,285,094 *AF55DE792E81F31F5C30703C1B965FE5E3EC7494 YROTARUCS
1,666,285,095 *AF5B0790407799186C970F642507F6EAD6FE2000 YULIINDRIYATIINDRIYATI
1,666,285,096 *AF506F55C3BB4A07C55FF0808BCFC9A614CF0D4A CKF2$
1,666,285,097 *AF58CE7B4D1E4E43178B1DBF5A087982DCCAF08E ZACHARIAHMUYSKENS
1,666,285,098 *AF52589F123B1C42366BFDA348E475D5D27032C8 classiccinema(disc1)
1,666,285,099 *AF5C40AD8229D20C48AD87C1990C07A452726C31 ZAGNOLI8
1,666,285,100 *AF5FFABBA317501598D8C1516DDC476B90AFFA12 5MACAULAY123
1,666,285,101 *AF575A6EE0AB123818396C8CA05AF566DAA312B5 5MOMORDIGA
1,666,285,102 *AF57D5B6B55CD5008258FB1D936BEDCFD14A8E6B ZASKLEN3
1,666,285,103 *AF59E77804A32E2D0485082A31FA14FDF35B25F8 ZASVÄCOVACIA
1,666,285,104 *AF5CFD34895DAFF22FE41F3FC94BDE6703522619 clf"d
1,666,285,105 *AF580E49545D4D809B16E03824CA451B0EDAC075 clhig
1,666,285,106 *AF592DE30628F9DAC5B2F921949E82DB0FED5A08 5OMSRETAW
1,666,285,107 *AF583F70ED0BB334E4EB2A5083063DF35AC6A88D zelis.zeliss
1,666,285,108 *AF5AC3C0E38455506D9CD65525783CEF542ACB21 CLOUDLE+$
1,666,285,109 *AF551739B146F0C8700C71D3C46E69AB0D49151A CLQV(
1,666,285,110 *AF5C8746270F96D863C9F6CF5174BA1DA7E90C40 CMd:
1,666,285,111 *AF582C8C1C3AABBE720C134DEEF3B6BC21D8437E [email protected]
1,666,285,112 *AF5B8F21F858B53FB416F02973BC48EC8D094625 [email protected]
1,666,285,113 *AF5D375884505396884D3B7AA32E5DF8F27D799F 5TRISTANAPOLLO
1,666,285,114 *AF5E60300CEC0FBEC853F83365FBFC445001D849 5UOHSATAK
1,666,285,115 *AF56374FAB742DB64A4CAB42F5D6F38626B50191 zielongora
1,666,285,116 *AF56A7F3E9E1ED862463387BD1F9B502EE9003A4 [email protected]
1,666,285,117 *AF5E66EA20DDD4ABF846D18D4AA5B071A5DE546A ZULUAGAPATINO
1,666,285,118 *AF5B2407A98BC02CBDBA3B03BF691264B2C6D8D9 6ADFERETISQUE
1,666,285,119 *AF58DCDECB65216C56F46CB2B112591133F13B56 coisadepele
1,666,285,120 *AF5295A72D7CF00B05F9913B1C8E9F5432C53E0D ZY851120
1,666,285,121 *AF5B5BA51838AE0D55548057677CFB8A60A406E4 μεταβιβαση
1,666,285,122 *AF5E408DED4DAC947C7759D9E87C51F5B750A91F 6BSWWHICHFRAME
1,666,285,123 *AF533B5E5ED30F39744AF2FF1F0B54D0B3E5E689 6BUMGARNER
1,666,285,124 *AF5EC2298C7BA569BC9BFA386219F9A454DF3634 6CANCEDPUPPY
1,666,285,125 *AF522B652D21BA8CBD63C63DECFABD3EEC601B8A ЖОВ­ТНЯ»
1,666,285,126 *AF5CCEB87581403989E6E8C4EB51F9DC7D67D5C5 COMES.THE.FLOOD
1,666,285,127 *AF5C781CCAB12C52FCBE4246EBE425EC2CEAE28A 6ELEPHANTMIKEY
1,666,285,128 *AF55751FD7F12328B9D0CEFCBAD6002FC4129FFA [email protected]
1,666,285,129 *AF5CFFA02E69296750A23BD79C6E9CAEC1A71666 секванаца
1,666,285,130 *AF5F6C48251976ED13897824B4C754D651F10667 6-lachian-dances,-jw-6/17:-ii-po
1,666,285,131 *AF59A2D8491FEDE2E76497BCD7BF97F3F9829B35 6.ORTSBEIRATSANTRAG
1,666,285,132 *AF5B665D9357F85B4E02017B699E80FF4B78CFDE 6PICASSOMOON
1,666,285,133 *AF55216A8D0B2DB1049635847DBCFA935D7AB502 6QUSENISO
1,666,285,134 *AF5A3FABA5011EE4689EF419CA877A679A67FCDE 6REVISSERS
1,666,285,135 *AF524CA994B624627B10C71E492ED4678BF7552F 6ROSYONDA
1,666,285,136 *AF51519F4D4999930B0ABD8E76578D1D07A60427 6SKRUESTIK
1,666,285,137 *AF5DCE3605BC6374E052CAC630229290BB9DF702 CP)JD
1,666,285,138 *AF5EC86CF53034D082952E9B0E8527F0B0E3B936 6VERPUSTETEM
1,666,285,139 *AF503A5BFA86927A437E18B9AEDF8DD49458FC24 c:\programfiles\microsoftvisualstudio90\common7\tools\deployment\vsddialogs\1041\vsdadminconfirmdlgwid
1,666,285,140 *AF560B500661764F7904D5108D606664108538B2 cradlecfd.comwww
1,666,285,141 *AF5C171B7761560C0990D15AB61B38412AFC3907 7BSWSUCCESSE
1,666,285,142 *AF51250404668B3B2D3CB386E63CCE17D2E8CD4C craigminnich
1,666,285,143 *AF53E4C901D5377E291B125969B0D19515701EF5 7concretist
1,666,285,144 *AF59B26B64F466AB05A9448ADE312BEF5DD597C5 7MARINHOS
1,666,285,145 *AF50D3372DF6FC2C11D5240148AC962EBA94BF21 crusty-y-chiqui
1,666,285,146 *AF559416E4024717FF3960DF6C50545BFCA83DCB crwqu
1,666,285,147 *AF5349F15821C53EFFE42A10EB27AFE9BD75AEFC CTIABANGOSEESUSWAPBILLINGJUMP
1,666,285,148 *AF5DA74AD40925FE7E7AE340F046C7A583F95EF7 CTJOV
1,666,285,149 *AF5B5D35B7757CFA4F24E4A66D124869AD5978E5 CVZHYBQ7
1,666,285,150 *AF54642E13B627B41D40D6D289682A2ABF846B90 CWZFJ
1,666,285,151 *AF5315B4B52C55D1A3D2A7DF6CBD02CCDBC9918C 843362 yani istemcisunucu iliSkisi sOz konusudur
1,666,285,152 *AF5EA7EAD495D6A6EE14BEAF6EC8C3E4AEDAAF27 CZR3C
1,666,285,153 *AF5369B234C3BEE9C584827608FDC6AB12D22443 [email protected]
1,666,285,154 *AF51D825BF643731E68470DF0F248E7C3D37C92E 8INFIELDING
1,666,285,155 *AF52DFBFEECAF79FA7A5BC490CB849327C74AA5F d92u!
1,666,285,156 *AF5833176D7FAE046E846ADF8C4EE123D20EB887 (-_0)`D==B
1,666,285,157 *AF5851F0B99C9048B2466C60F435D83C381E7724 [email protected]
1,666,285,158 *AF5BA602E33985386DE24FA2060E9E1D3A8457EA 8SECNAV
1,666,285,159 *AF50E1950710706869C3125EBE7129A8C869043B 8TRAVELBUTTONS
1,666,285,160 *AF5258D24F7AA97837981ED1813436585E0E4FCE darrylmormino
1,666,285,161 *AF5E65F2EEDFCE115798CD1F45D1870C024CFA7A dasnb
1,666,285,162 *AF5DD24D4BD4E61DD86259B6F9C58AFC6867F3AE davismammen
1,666,285,163 *AF5203F91486B2D57FE043BFD1885B946F72A080 9AKTANTMODELLERNES
1,666,285,164 *AF56FABB4EF1852A81603091D4A9CE835492EC37 DAZUSZYHKNXMJAEF
1,666,285,165 *AF5698DD920816EEE0B53C83AE2D54133673E2BB 1270478 PRIVATANLEGER ERHALTEN EINE MARK RABATT
1,666,285,166 *AF5EE063B6D8D79FE17C7D5B83D381153BA45462 dbcl
1,666,285,167 *AF528E7F58ABF7C3B49FA9A1D29CDEAC829285BF D,dc
1,666,285,168 *AF5B2B1E1DB78CB6389A81451E15A7398D9480FF 179CATALINA
1,666,285,169 *AF5C37976677A79C401AD31F2D5271DDBA0BB93E 1918685 SIE HATTE WEDER SCHULISCHE NOCH FAMILIAERE PROBLEME .
1,666,285,170 *AF53864D0C817871F90EF008B24F27C6F57C654E demordras!
1,666,285,171 *AF56118A398EA83E2DF7C05AA38545D0226B2635 [email protected]
1,666,285,172 *AF5E61399BBA8ABC1024F81605DB062DB5134D1D DENVER.VERNI
1,666,285,173 *AF5412F59DCE918004DD8F47FAC59BECD550D1B4 9PRESORSA
1,666,285,174 *AF5D302B7FEEF7A9E22B3D4202C7A1A4B5E1498C derek.ogilvie
1,666,285,175 *AF5EEB6AC796A46263C0B570E8397BFA154B2796 1.BEDAZZLED
1,666,285,176 *AF549DFB6AACAFB3ACF803C6603361D1771D469C 1.DEANHOLM
1,666,285,177 *AF5586726D31A771CC90B02E90BE1855D19DE94E 1 DOLCHSTOSSAPOLOGETEN
1,666,285,178 *AF5DB4461030C97B5022867D2042E1DC2F04264F a2_#b
1,666,285,179 *AF51639A21292D93621264AC90B9EF21DE041EF9 dfaljlobq
1,666,285,180 *AF5B06C477FAA733D83AB31C3DDCA997C33BC9AE a7?v
1,666,285,181 *AF53BE30B75736DB4219725A0482A94A43EFD400 1jotkutoikeudet
1,666,285,182 *AF5D97CC653D89C0F890EB404588B5E0C3EF0CAE a9s4%
1,666,285,183 *AF5DAD5FA178E953AD8D0BC544C489895EC73B47 DIDONEABBANDONATA:IAKT,3SZENEARIE"DIR
1,666,285,184 *AF5E1EBE56F13290ACE01BF1693C6140D5FFF7B5 diodrepo1
1,666,285,185 *AF5C4A0E7BCB8F1F76AE0B7B5B042C7A4F22A347 1oberoberursel
1,666,285,186 *AF51321EFF7FA6DEDD19169B0793189860C7339A A:AE2
1,666,285,187 *AF587BF901CB26EBD696C519B2486EF14E71F7B3 aaenT
1,666,285,188 *AF5C3538E0A23501374EF0AA87F561BE09E94FED aanklonken.
1,666,285,189 *AF5FF2252D1EBC659B4BC98BD46398BA6CA2D9A5 aas.j
1,666,285,190 *AF56C9384CEBA2AB4D1591D8A0F18D3B6C13DA89 abdullah.salamah
1,666,285,191 *AF52A5E7314C1F5957EE7FB61461B8FBB5A64A97 ABDUL.SZOCKI
1,666,285,192 *AF5F9DD8E5D55BD0007F038EF69086AD2A7E0AB2 ABEL.KOSSMAN
1,666,285,193 *AF5D87DC8CFD40A988442FEC7EFF01FA02584BA1 d!mbt
1,666,285,194 *AF563B7D7393C9C27682C71897CCF009EFB17D4F ACCESOELCHEDESDECREVILLENTE
1,666,285,195 *AF5301AB63849AEEC0033976F1D68A8756D86ED2 D+_OC
1,666,285,196 *AF5837A94CDA4B85EAD2CBF2AB2091CF80F6D69B 1waldegg
1,666,285,197 *AF514808C3A3A91E85C742DEF93D7420784AB780 ACID.NOW!
1,666,285,198 *AF58A2974AD0C33FFABF8B49D23765C50DF088C4 ACOLLECT1234
1,666,285,199 *AF5AD2EE7511966A2BEE7B47F9B233B6260D7DEE acq+o
1,666,285,200 *AF5A306B50A3EB07525076F719AAF1DB4E198934 acvvd
1,666,285,201 *AF52148E8F253A51DF8C2E142ACA08F4E3857BB6 ADAMLAMONICA
1,666,285,202 *AF5132B3E141CE130CA64E4DFEF41220854559C5 DONNYTOVEY
1,666,285,203 *AF54E79C17B2A1CA2D2AEADB7458A0DBE673F105 ade%%
1,666,285,204 *AF5F5D93384005CD129568A7A844B61C86C7A44A AE9/Q
1,666,285,205 *AF522AD63F6EB0587A96F3CAAC95C9B8C0C97454 Afh(
1,666,285,206 *AF5C2A070D13ECC204A32A8E21647FC540D191CB dso33
1,666,285,207 *AF5B1F1CDDAF7F7A5FC8B2C4210DDEA68FB56987 d(sqf
1,666,285,208 *AF556EE81EB81B6B7B77C2A75D1A368595C0D86D 2997629 ty
1,666,285,209 *AF5EFC15A46FCFBA8947B8FC3D1A82DB66E52853 2ABBYPLATO
1,666,285,210 *AF59EDE2CC502EA9DD0AB15066655FE64175872A DT?KJ
1,666,285,211 *AF5E4B0A459B19E18CB0BACCC97E59BB20B67A0E 2.ILKKUA
1,666,285,212 *AF59BE5005BDB05DC84D12BDE82073573A111DDA 2.inteligenz
1,666,285,213 *AF5C78318B49618979504C537B5862192794511F [email protected]
1,666,285,214 *AF5AFB80A1A8868390A676DF0D0EFA680C70E94B dv30.
1,666,285,215 *AF542FDCD63A1251AE44B375F703B7BA8C4331BB aideen.coleman
1,666,285,216 *AF536D1D8AD228B0D05FF01B1B626843E72C9BE4 DV/k
1,666,285,217 *AF5C6338212707A99786A34FDE96C8E0B53624D0 AIRFRAMES9
1,666,285,218 *AF5CD3F5D3A7DEF9234E1FBF1E3706D5FA89F854 AIWR1
1,666,285,219 *AF5D37F22813659B2B3B3C865572963DE92CBB61 AJ$=K
1,666,285,220 *AF575BE23474413294922A9D8F0079D84B7403E0 [email protected]
1,666,285,221 *AF532F7F2D25F6678158B353F2488A888A3E5201 dzbf(
1,666,285,222 *AF5EAC4814B7AA4C50A6AEDE5F41349B78E9009A 339miriam
1,666,285,223 *AF5CFA43B97763A26E250188A6A74B5582C1E1B8 386VWQJ
1,666,285,224 *AF57E9DEDD605B321F4C8CE6D5A22075040E2CAF EADIELAT1
1,666,285,225 *AF5FDF58704FA5D18EE02BC8059A3ACF245AFEC4 [email protected]
1,666,285,226 *AF50EE93A76C3ABA60AA24B02A44CC6A3D81DCD6 3#B~}O{
1,666,285,227 *AF53235FA3E7C4E642005252C561D19BDCDE6982 ECCALEOB9
1,666,285,228 *AF5DBF7D3586CB513A355377F353CEB21E29A7F3 ALFINSUCEDE
1,666,285,229 *AF50032241D8FE31DDF82FB5AA46A7A5207EBA23 EDBATHKE
1,666,285,230 *AF5FF645711BEC84F5106F53B314B461ED6A5A3E ALGIRBEING
1,666,285,231 *AF5BAA20AAF07E21376A97DD191C21F43F8FBA9E EDELKROETE
1,666,285,232 *AF5E90E13226B8A025AF014357BA7694E3F78266 edgardobur
1,666,285,233 *AF54F4C4C2AB654948F65020A01766F6478681D8 ALLANCLARK
1,666,285,234 *AF5011A0237BA27C2BB7E7E24C7EBD393C5C7263 EDWARD.HUPP
1,666,285,235 *AF503BA8C1DA9FFE808D938442BBF2DC943D0C70 edwardledesma
1,666,285,236 *AF5BD02E56CCC9D47CE2B4A9826CF1704257A668 eev.g
1,666,285,237 *AF5E0E83D7C1032A53CCAAD7D135BA1529493D28 allerhoe
1,666,285,238 *AF59A20E013A114689BB42DE16400A99BBA5C18D EI4!B
1,666,285,239 *AF596B319A6ECC3E737FABEA71D876F41F02EBCC ALU
1,666,285,240 *AF51E2B09335B466454B05BB212B3EB99308BE78 EKARTĀRA
1,666,285,241 *AF5510E74CCD4B41FA648D206CDB7FDB305C64C4 EKDHLWSE4
1,666,285,242 *AF5C902DFA7F1165820B36BA9F34D07BEFA63CDD EKSOSVENTIL
1,666,285,243 *AF5FB5BC843CD3A9DF13B3556FD2E4EC5654E38A [email protected]
1,666,285,244 *AF53516E7D5FDA3F29BABEB72907D4BA12E613E5 AMBU1ATORIES
1,666,285,245 *AF594A15833880323B5C74D7A533591C398940AF elblandfeststpiele
1,666,285,246 *AF5FF64D8F59E60AD0DF4F0CA4C725810CD7EF17 [email protected]
1,666,285,247 *AF5D5030D3ABBF67E2106087D120284881BC2122 a-mo(
1,666,285,248 *AF579FEC670CDE368DE952DC742B0CCD5CF16F3F 4osuttua
1,666,285,249 *AF508D18175430207C790B0A26AFBDDA95B696E4 ELMERWYSS
1,666,285,250 *AF57A0D05F331C8A753DDE4EFDF626BE2EA68B67 4PHISHCORONA
1,666,285,251 *AF5FC058067095422A71EAE873A8676A102AD355 emaeemae
1,666,285,252 *AF5899502337FCC9E612F58240A5C914C95C891F EMBLEMATIZA
1,666,285,253 *AF519FF5DCB81749802722AAB4E617F2DAC429CD 4THATSPOT
1,666,285,254 *AF5832B75009FE11E815368FC573DCB5572B5CA3 4VENISSET
1,666,285,255 *AF53F415339E3E7DC69BE1F2082231A3F0218577 4VERPAKKINGE
1,666,285,256 *AF565AD0CCF0BEFDD13422337ACAC7425606FA80 EMMETTREUS
1,666,285,257 *AF525AFF68ADFDB66AA3AE15767A70DCF750242C 53AA920841123A0CBF69A5C7B54A7E5A
1,666,285,258 *AF56377E2F2EAF91A89EE021B41DDB1ADC1A7144 5+4B1+E5
1,666,285,259 *AF571E5716333D599B443782EC24F898D92BA28C andyrafter
1,666,285,260 *AF5B125F416ACFA876A8E56F184B55D0650D1275 anfvu
1,666,285,261 *AF573FDB21E1CFD5722970CAA0AC21643900C58E 5BOOKITDEAN
1,666,285,262 *AF524DB57BAAF15F903BA22BAED96C4CDD2CB5E7 5BSWDEFBITMAPCMDBSW
1,666,285,263 *AF56CCC65B0C90D4F76D68BBE996CE4328FEFF7F annetjes1
1,666,285,264 *AF5371B6B66205D349C89195BB80079D2CD3FE88 a/ns
1,666,285,265 *AF5C86A1E088C595BD828E40E641B77CD4C428CB 5HAWAIIFORD
1,666,285,266 *AF5CAB64077BE7047272B378EF3F479B9854A5FD ANTONYSTRINGFELLOW
1,666,285,267 *AF59992DC2A19A7CABB212790389258310ACB7A5 antwanweisenstein
1,666,285,268 *AF52211EDEFB71B6074790C1FE9FCFAA30764AF0 A%!OT
1,666,285,269 *AF58A37BEE19F8A25086AA7963B0B6434CBC4E0B etoiledixie
1,666,285,270 *AF5967B649C30AA19FD0106FA543F47AA51C9ECF ETYMON!
1,666,285,271 *AF50DC8206A5F5A312D1907C5B85DCF83EF91A66 5ZEULDES
1,666,285,272 *AF553996DC938FF993B5C2143B8F56BE01224544 EVERETTECONTRERES
1,666,285,273 *AF50467E98E43B029C28E287A74EF7E9B20BC954 eviwimed
1,666,285,274 *AF52FB9517E5D076CE3FFC4685ECF88B0F311A85 EXILEDOM?
1,666,285,275 *AF55EAC0986B6E3B3F653BB27BB398F925E2FD23 EXTRENIILÉ
1,666,285,276 *AF58181EFAFDEAE48697C9D61F928BE9E7ABAF6C ezali
1,666,285,277 *AF593D07E1F7FC7C52B263B98043ADCA6F9F26D7 6ATTILAFROG
1,666,285,278 *AF5BB1F0CA5A5677860BD32A0E5CA4AA0584478B F]]AAA
1,666,285,279 *AF51E18A24A0E559DB57881CA86CF460E6D8D468 6BSWKALEVALABSW
1,666,285,280 *AF595A8E804EFC4DEF4CB570206884110F7172F9 ARTICLE2235
1,666,285,281 *AF50D4D6358F99BA5AA8CC56A41B17C08D063C9B &Ashkhabad
1,666,285,282 *AF592A5366074B3A708E53F060AAE43C9F6893B9 6DOMINICWILSON
1,666,285,283 *AF55509A4E20705C702099ABB3DB1FE783692782 farewell-to-tarwathie-(b)
1,666,285,284 *AF5F8EAE782FE7F99B704BF9070E8B7BEB5F237E farv
1,666,285,285 *AF5E60E2E637617D3E7D08E82BE2BD4C4CDEB1F7 faustomonske
1,666,285,286 *AF5987CA27DB6A402A616C5C8376BF48C210F17A 6ilovesnapper0
1,666,285,287 *AF5AD3EA45F149ED122415CBD0C714157DC548FD FEKETESÁRKÁNY
1,666,285,288 *AF5CA04AC82376FB53E1619A057C6C9C922FEADD atennest7
1,666,285,289 *AF5A32A5B24A1D21E3BAC24C3FFC226907AF16C3 6MUSIKTYPE
1,666,285,290 *AF5A8EA4FA8E7827A9A4AF16F0034FE59E9F54C0 FERYELAN93
1,666,285,291 *AF5F25F9AC0C126FC85018972593613EB0A9F567 attract1v3
1,666,285,292 *AF56A06D8B8CD2669DDCA1BCDAF26098AACB9CCC f"gf
1,666,285,293 *AF507CD915692B6F8590DF05733F45C5D33A0A42 [email protected]
1,666,285,294 *AF51607F7963C2B972C3BF092C7FE33478434731 6SHELLYSHEENA
1,666,285,295 *AF51E2F3E05D29BF7CC2E4DE5565FA51CB0E6456 FIDELBOGEMA
1,666,285,296 *AF5F2FBAD029E45C17882A38BCA05259FFFAFCF1 FIDELCARUCCI
1,666,285,297 *AF537E185DDAFD5832716B9B29867C3999D560A3 6SPACESH
1,666,285,298 *AF5F5F4BEB571E5C338254AE4CDC6CB20922DE5F augustcopstead
1,666,285,299 *AF57CF15F5AF99E5D61EE114CE827B1A41C68012 6tiger9
1,666,285,300 *AF501E285D7ADD918B69B9F13078647AD8E96F4B fingerloopanleitung
1,666,285,301 *AF5FA4B2F0EE60AFAC8D59B6C44316BF2A570FB6 [email protected]
1,666,285,302 *AF51A7140B77063CF9B3259EBD0A2A73897BC8FC 7EMOLIRI
1,666,285,303 *AF5D67A350EE2A025E253A54A8C0DB39DA5A7258 fly.live.(original.version)
1,666,285,304 *AF529D05EB47A1F12A3A15078A953D14D589D339 AVRILOCONNOR
1,666,285,305 *AF5919461D3AE901D09939A2A01EA70D759436D0 FRE80ATS
1,666,285,306 *AF5635F0B8E5BA4BA6393B9299802534D5E9F8D5 FREDRICK.BIONDA
1,666,285,307 *AF565042D0E4DD0DA7786434658BA64B20E0A948 824954 BU KISININ KALBI DURMUSTUR
1,666,285,308 *AF58DE2E02413D2D9279EBB5E0A6C01462E4F4D8 b######>~0splat!!
1,666,285,309 *AF5C7CFE73A30ACB83E72C0FCF3589BA1D512022 FREONIPOLITIIKKA
1,666,285,310 *AF58B78F31BFEAD390E3512B51D2D4EF4B1B37A0 8BRETTONWOOD
1,666,285,311 *AF52D6EFCC59ACA2620AE173D478846B13218AD9 8------d~.~.~.)8(
1,666,285,312 *AF58A960E7A4AA6193B4201E40ADDEDC827D666D 8DECEMBER1165
1,666,285,313 *AF579583D0DDD7FDAFE14E0855FC737A744D0195 8ETIATIES
1,666,285,314 *AF5B1EDD90E3F5D4DF470279EE0C6B553EA2DBA6 8iluvcolor9
1,666,285,315 *AF55858ABD962A6D0512FD7DD12136975610A2CD F)と同じくイギリスの物理学者
1,666,285,316 *AF544D6500C5B0C4D89095E5A708212E93AFDDAD 8NANTISSIONS
1,666,285,317 *AF50E7B21D1CAA7742568ADE4971607760446ABC )8(.o~(====p
1,666,285,318 *AF596F55FCC2969D980F6937A27772A614EE2B5F 8UDELUKKELSERS
1,666,285,319 *AF533CD3FC3C42D422FB36B57B864FE7E5468CE0 [email protected]
1,666,285,320 *AF52DD7B8D8ACD13C016714499A22C7EF80BD7EA 9AEMPBARA
1,666,285,321 *AF5D8C61BEEB14C03D84C0138206DB1CC1173CDC 9APEARIVE
1,666,285,322 *AF56BAA58AD2A021D1D44D00CE653FE6DB1FB03B BARNEY.LARIVE
1,666,285,323 *AF5DC01354F37AA57ED64D3C649EDE672EBBBC46 [email protected]
1,666,285,324 *AF5ED008665422179075C59F8A9693AF6600E708 barretttarpey
1,666,285,325 *AF5257BEBCBE127D6F1FF22B829A36E11DF24740 9DUTCHBOY
1,666,285,326 *AF531B2A50134677934BF954552A7C8E175F2432 [email protected]
1,666,285,327 *AF53C48CA1494E9B3279360C4F5A7EBD03F0B14F basilphilipp
1,666,285,328 *AF57EFA183D07B8743BC62E2A894B170D01B0943 batalla-de-messines
1,666,285,329 *AF5DB07EDC03AAF70B3F829B7243A718A4A8BB2D 9IMBRIQUAIS
1,666,285,330 *AF5CB98FBD25EB317478573874A07DA3E80709EB 9KLNHNDLSPRJZN
1,666,285,331 *AF5917D1AD17C084B7F8AFDB1065BE77CB73D0DB b######d.~0.uu
1,666,285,332 *AF546B537BDE02A8E7743D443B1CEB5DA95984E0 GFPTHM0KQFQ
1,666,285,333 *AF5689C25A4154D767DF333DCC07E6F5EB5A9728 B####D~O~O)O(
1,666,285,334 *AF592875D3A1887A40E931127CA74F076B315DB1 GILBERT CHAI
1,666,285,335 *AF50AF32878977E7F3BB5221C88C73F0773509A3 gilbertkahle
1,666,285,336 *AF50EEBD4ED4AC5AC8603A4D2105AF1BFDB12921 GILLBERT
1,666,285,337 *AF5F5B7976EF1F1ED9236874055023B4B14A3F61 9theindonesia0
1,666,285,338 *AF50BC7580D8ADFC1ECC402D7D3FF1F413EB9F67 benedictneat
1,666,285,339 *AF5FFF0B5C1024A736CC24D1E1B10AEF41D63017 9WOODLANDWESTERN
1,666,285,340 *AF5943B5C9794DEB2D92093CA02027F1B95393C8 BENJAMIN-OVIRI
1,666,285,341 *AF527E7EFB73919D4E4EB3005E4CD6925618137A GLIMMERB5
1,666,285,342 *AF54FDE5F8E39BA542AD5EA9F6BA584991992032 bereined8
1,666,285,343 *AF51C4EF603E0CCFD02BD48E7DAED1A9CB1649BD BERNICE.SANTOS
1,666,285,344 *AF59679317FFE2764AC2FCEE842914B2C48338A8 BERRYLLANES
1,666,285,345 *AF5215320D2856E3EAB7C3D0AFB58FB86626CB36 a.1o
1,666,285,346 *AF54A4DE582241DD492740B30DBBD2D2D6DC07E3 bglfd
1,666,285,347 *AF53642DE945C57DA234A3469A5816884BB22802 gradyburgardt
1,666,285,348 *AF510B0D6E0D551AE9D5750AD56D035F8C9FBBEB b!hen
1,666,285,349 *AF55DE5CF03AE86FEA0491B4D8024A592C0564D7 a7rg!
1,666,285,350 *AF55CDD2D1BB052E5BD42708B91FDEA074CED780 gravesin
1,666,285,351 *AF58468B8CB087A87C1ED95161D7F7490272EB2B GREENSSERBIAN
1,666,285,352 *AF5685C5DA0EB08499E49FE26D4D98104E866CE9 GREGKUKLINSKI
1,666,285,353 *AF52A8553BA6D1F600CB4FBECBAB188C5E0137FA billedskrerernes
1,666,285,354 *AF5095312B2E864E6C4A3FF006B59C38E483023C GROVERSCRIBNER
1,666,285,355 *AF551583B4FB3BB415F873E94D06A3D0D4B13077 GRUNDIDEEN
1,666,285,356 *AF5E39856D11BE36D6205EEEBE984CDBDFE5DF3F AACC~}
1,666,285,357 *AF54C5A2A2E48D49A4BDDBB3D8862E39600B7002 AANVANGSFASE2
1,666,285,358 *AF5BC3F625684C9EB0E2FD7125A5B09AD5FA9212 aa!rz
1,666,285,359 *AF59384D184BA8F01018B18F7989890B8818FECE GUMBALE
1,666,285,360 *AF566F6C84C1E61CA5BC5871AAF822F78AD26A55 blairgillin
1,666,285,361 *AF5750B84C04142F161447DD6D7297E4429536A9 ABEL.NIEBERGALL
1,666,285,362 *AF57154618753BD0AC42B3CBCA358F240B37DE50 blitheringidiot
1,666,285,363 *AF58F82AAEF90A492044B637B842C639D03912E3 bmi_u
1,666,285,364 *AF52DFD6F6A1FC9635749FEF111EF95F4B5F5839 [email protected]
1,666,285,365 *AF59166D3EF7B9DBE72628967E135CF142398993 BNC1234
1,666,285,366 *AF519D3E46798CD3F3397D9DDE6AF600DF658603 hampton3315
1,666,285,367 *AF501AB06AF21A3ED032728A29809F20A4146940 BOBBYBOUTIN
1,666,285,368 *AF5CC59326F242C3B3384A9FBC96C10BF77CA64D ad4hk
1,666,285,369 *AF547C2305D58532AEC1DB7888C4197F25DBBE5F [email protected]
1,666,285,370 *AF5582112214A6DDF6EC35B8CBCE28D1C4B53F67 harleyziegenbein
1,666,285,371 *AF5950F71C039C4B7F331B5525FFBB8614C46681 HAROLDBOLINGER
1,666,285,372 *AF5EBB4D1BE07597DD8BE74C21AC4873413951B8 BOTTLES&BONES(SHADEANDSYMPATHY)
1,666,285,373 *AF5798250164A8C2C0ABBBE4D48AAE5DA27A8FAA adotada5
1,666,285,374 *AF5EE77D38C216A91F02FBA5B5F84CB8471A4686 ADUANCED6
1,666,285,375 *AF510124704640815B581B2148A873ECD52BBEA1 advilgodzilla
1,666,285,376 *AF560526F71BBECCFD0038094A636E8119919A15 BRAINSTOP
1,666,285,377 *AF5A826A0DF5F4F8977B7E3C8A5EAFDB14007E4F AGFNW
1,666,285,378 *AF53E2DE004D5FF293490CF7E7DB20F9E6764F75 HERSHEL.MEGGS
1,666,285,379 *AF5A09BDD0622C45C7CDCE4D7B4887850845127B AH5OA
1,666,285,380 *AF5BF624582082CD9FADB5837DAD199C89C3E37E AH%M
1,666,285,381 *AF557E6D306D14D536A90BA6BE29DB949AF37456 ahtoistaed
1,666,285,382 *AF58A3085EC8930A772C097D41D020265BF8F97A briansimonetta
1,666,285,383 *AF5C41E6089753A51BF973DEDC526FD23F8A4698 ai_ii
1,666,285,384 *AF5E9C2316DF63C349B9C4F57015EEF592D49253 HIS-MAJESTY-SELDOM-FEARS:-I-AM-CRESSID'S-UNCLE,
1,666,285,385 *AF567E93A2F73722FE619C86E4528EA9488E01D5 aikmanchocolat
1,666,285,386 *AF52E6C8AA1E3A7C5D566D7552BD3057133E1141 AJAMIL.DE.CAMEROS
1,666,285,387 *AF573A5726DC0E6EB95BF9DD5377A24C83635946 AJETTAAT8
1,666,285,388 *AF536127EEE1C9A929FDEB4C536AB341C52EABE8 BRISSOTINS),在其中
1,666,285,389 *AF528D08277941A1FA64694697A456CE643067B6 B?,RO
1,666,285,390 *AF57F434B2CCF42B334F23D2BD9A5C7112B650F7 BRUNOMATTOON
1,666,285,391 *AF5AE876CDC0C60F9793548E21D31AC62513D328 BRUZEK-KOHLERCHRISTI
1,666,285,392 *AF56A13571A07C2F4FB2D88E3D759E53DD0EE06B BRYCE.DIMMER
1,666,285,393 *AF55ECD1C56ACF9661A87527705726D41F16827E HOT.WATER.INTO.STEAM
1,666,285,394 *AF51C63A2A389F182E49C87F2B95340C12E114DB AL;$4
1,666,285,395 *AF5D7A7023738F0B4A0C8B463AA4BF59567701A3 ALBERTO.KINCAIDE
1,666,285,396 *AF5F297FDD508EF41E75E0C9B32D83DF996B6ACB httpwwwfeenstraco
1,666,285,397 *AF583CF595004FDBE299BDF4BDE4B3F85D935E26 BtF#
1,666,285,398 *AF500363FEACDE410CAC3D0A2F751E2EC2958831 bu2kq
1,666,285,399 *AF50995894ABC6C667EDDAC4EA647A3DFE29A26C BUDDY
1,666,285,400 *AF5CD4D9F7081CD32AA78220D062B4E0BA9B0ADB httpwwwmoteevolver
1,666,285,401 *AF5872382B4ADA5893716AB9A6CDA4C85D4C49D6 BUSTERCHOMA
1,666,285,402 *AF56B292753F8C0D374CCD587B15F194FFB62AED allenneale
1,666,285,403 *AF5E828CA905372EDFAE9841C7802ACF8211F035 allivalited
1,666,285,404 *AF5A59B9D4B99B938E93CC88AB0897932D1115B3 [email protected]
1,666,285,405 *AF58AC2AB78258967A1E0E7E202742D272573995 BwHs
1,666,285,406 *AF5940BD77162E738F5BB693BE80B177A9BD3B47 ALT+$
1,666,285,407 *AF5C868C901FC7A5ECC535C04CB96CFD9325410A [email protected]
1,666,285,408 *AF5F4BE3046E80ADA7232F58BB7CCCE79C9514D2 ALU
1,666,285,409 *AF5E544BF12C0419B2D450EFFCBCED28FEC0722E AL-ZAYDI
1,666,285,410 *AF59A045745DEC235C20D14E76DFA678F2DAD353 I82LATE
1,666,285,411 *AF5106B80BD77FA322561E251F39520A04FD4350 iammiles1998
1,666,285,412 *AF58DE82E5EAC796084A412C4A683EE6EB13BC38 IBANNABI5
1,666,285,413 *AF5360D19EAA638EE0AC9919B3B53F85B8192784 IBERT / ESCALES - PART 2
1,666,285,414 *AF5725420A8B227CF4F002D3CF23010E9C065B75 iformes3
1,666,285,415 *AF53BA4DBBE36ACF3E1C8328738892E6054F776F c7o"p
1,666,285,416 *AF5A916EFDFB3C3A112514792F6C91576F80552D c8?tp
1,666,285,417 *AF55CE19EA2D8F7D5964C5670F469CDC0FF633DA c?9u
1,666,285,418 *AF5FAE7CE68C29838635BA9B79D111EE8D6D3336 anibalwhitesinger
1,666,285,419 *AF5FCE080589A4400B95E0AFE6D678C181D705B6 CALVIN.DILEY
1,666,285,420 *AF5CCF91340CD2151B2033A9CD855964E7EDE903 CALVIN.URESTE
1,666,285,421 *AF53588781DC94E1044348C2B8A20EC323E38190 animadv3rtin9
1,666,285,422 *AF57348317B740A603D3C19573B2452AEEAAB583 ANNA.B.MELCHER
1,666,285,423 *AF513DDC7D459816CF88D9CF42F7747A33B26795 anne-philip
1,666,285,424 *AF5C9C9A47537A495F73811018FA20A0015570A6 [email protected]
1,666,285,425 *AF51C7B6FC0A2D730136E864428C2F04539CF466 Annuities
1,666,285,426 *AF5E4F4B131D8EA097D229A18BF643576729B128 ANTONIA.REI
1,666,285,427 *AF58466AA30615F97CBCA02EF9C65882723E277F antoniolew
1,666,285,428 *AF57985ED836A12B362F6FB5E002D41D79015AFD antonjestes
1,666,285,429 *AF534A6ECF46147524F4A2FCB11FBE685244F489 CATEGORYMILITARY_RAD
1,666,285,430 *AF5B048D508C0B6D2F4A2FE9DD81E28592742A1A CAVANFERMANAGH
1,666,285,431 *AF50F58CA203A2739244470843898840A540C8D0 anv-
1,666,285,432 *AF5F826D86095A64DDFDC89CFF3422239BFD1FCF ccb"t
1,666,285,433 *AF5F45C8A58D6A7580C857459BA83DE3BEB96B2B CDREVES
1,666,285,434 *AF5FDA3ECF50D5BE04EF32D961F52733C8A84D4F INSTRUCTES
1,666,285,435 *AF557A0C599242421DA73DDA66D7E63EA19C8778 ARHB
1,666,285,436 *AF5BF185F84CB2C602095C0E6F53170FE9D5EF1A ARMONISINI
1,666,285,437 *AF55ACF7CE3E200A6012FF4A559CC7CE906DB6DF ARNEJOER6
1,666,285,438 *AF51DAB1306659174F49477E4394CA28DA629D72 [email protected]
1,666,285,439 *AF51805A56BB6AEE860387BF5BB375C27EA62329 cgxmc
1,666,285,440 *AF54E220CDD9E5B2AEB94B753639C99CC8DABFBA ITHANGCED
1,666,285,441 *AF55CF7266EC2296BF9ABE9FED43C84F7E3BE90C CHANCE.PESTO
1,666,285,442 *AF5450578D7606E909C1048CD7DF8ABA39ACF980 ITWASN'TLOVEBEFORE
1,666,285,443 *AF5E0503066A15020EEC0BFF5DD597F7236A31B1 I.Wanna.Know./.Nasty.Ways.(disc.1)
1,666,285,444 *AF59087129EAD31DD4FD191042F3059BBC3D91B0 izrečena
1,666,285,445 *AF50F292DB8B77419299AFA296191E23691968E9 j_<=
1,666,285,446 *AF5A5145FF86426CE0AB5CE0BCE30DA54314B61D charleseggleston
1,666,285,447 *AF5A2F2D47AD02F6FF033FFCC67DD1E8199BF908 ASS1STOR
1,666,285,448 *AF5B1484B331BDB82E31DDF018BAC2A467E1A1BB at`.
1,666,285,449 *AF56B351B6B999BDF7954A8730F4167F0E4571B3 [email protected]
1,666,285,450 *AF5CE50D7686D91CEB2CB7E90FC9CADDA8D006FC JANIE BLUNT
1,666,285,451 *AF5DD1ACD67447FE7E4B91A457D9B12951FABDDC au_el
1,666,285,452 *AF538BED1B3AA38C3150FF88000F5207AEA5ECCB CHI.BHATTI
1,666,285,453 *AF500F4D8EF5DDAC8237EA765AC05EB8E37604EC CHIESTO3
1,666,285,454 *AF53C80B6470FA12125708BFA3110E3BFE45A001 AUSTIN.PRADIER
1,666,285,455 *AF5886912D0BE246245F415610DDD65F10794095 AUv=
1,666,285,456 *AF5CFED4A94A0024F6C5D25877CB622F7DA1B249 JCMILLHOUSE
1,666,285,457 *AF55DE106F158A8A0803F903BCEFE84DDD44C669 jcnfnjxy
1,666,285,458 *AF5FFC1D809E8E70375B21FC48CC0269223505EC JERRY657
1,666,285,459 *AF586101631B88B2651BBA5010500D3DB090CE92 JEWELBOLLAERT
1,666,285,460 *AF5C7BF2C94DFB3A7538E18F846A19F511E5F752 chuckkretzer
1,666,285,461 *AF5F24243EEE3846F826C4D18A63C3988CA03169 [email protected]
1,666,285,462 *AF5E1E72C081D651B60067FC724D80149B960834 JILLIANMELTON
1,666,285,463 *AF5064425F9FEE2DDA15AC7685990DC189E5B1D4 JILL.PEROTTI
1,666,285,464 *AF534D82F00185D69CBAD6531981F3621CCF1265 JIM ALDERSON
1,666,285,465 *AF51A2AAE98113A9FC164CE203B8DE151A51B597 jimfinkler
1,666,285,466 *AF59356E72ABE903C2EF86480D0F0615055819B3 JIMMIESERVIDIO
1,666,285,467 *AF572082FB05D7EBA384E619AA46D8D841D956B8 C!I3A
1,666,285,468 *AF5054C67810E69B404E06CC17CEE5389D625A53 JOANE
1,666,285,469 *AF58167133D7DB45B83E72BA6D0AD64E29A78B24 JOJO-BERNARDINO
1,666,285,470 *AF5099AFD4144BE007656DB0EF47178EFA321A93 b;0,.
1,666,285,471 *AF5D5901A68C0BA46AA6041002844A01912AEB64 B000CCE23C
1,666,285,472 *AF51A95F52E237B7E7D86E0E3A214149F6178A3B joshuamangione
1,666,285,473 *AF5BA21063E0B2F7CF97F0F28366053A98717E8D b4rff
1,666,285,474 *AF547B1AEA43FE90D73AD0CC57CD5A9D2E757DC4 JUDEREMBOLD
1,666,285,475 *AF5F831A0861ACC24A6E281C81F3DEBBC0E7F477 cle4nle$+
1,666,285,476 *AF5923B36C5826F5AADEFBD96A4B9192C4052D86 b8hf6
1,666,285,477 *AF5B1E2D9614910AB155879D4AA9169F4E2CCE64 julianmuhr
1,666,285,478 *AF5094882EAC32A89B12C2A7B5631FC55D8FE47B CLEVELANDYELLOW
1,666,285,479 *AF59740E1CE24B58913AD84E97E13CCFCB0D3485 CLIFFORD.SCHARFENBERG
1,666,285,480 *AF5F01E51EBE1059B096748D9FBCD5941C68F2FA cl;:q
1,666,285,481 *AF55A82957F47158ED26A2BBCD4CB235587F94E1 BAKUV
1,666,285,482 *AF5AB811BFD02D4AF9731B6B5F928AD5F9FA9AC4 BA?:N
1,666,285,483 *AF54D16538AD59508B63EC9B55FCC990065F7AF9 codrent1
1,666,285,484 *AF565E02C5792C842837723E007BAF0F8539696B co;ig
1,666,285,485 *AF5F9D14B628951BA80B6AC69FC0E70CECEC3053 KDUFANEC
1,666,285,486 *AF5EB018C572A0E85ADFDA49C6B875A6CFDF4D84 KEBYPX
1,666,285,487 *AF5F586BFB98F93D331AE55AA98BFCBF15823C88 keeley
1,666,285,488 *AF5147967D1D2BBB6878B1C994A69B00A845EAC1 BcM
1,666,285,489 *AF5BBCC5DAD7ACA4A676711E005E80D2DBC750AC KER-BAU
1,666,285,490 *AF5F9D98ABC62F0B8FBA81116B857A59D5B43818 COMPUTERAIDORGWWW
1,666,285,491 *AF571599C4C825B93E8E75EE972D6FBEDAD4C927 beabnet
1,666,285,492 *AF563075CA8012A4CD3D0F7821DB5AC3A2CEA260 CONCERTOINAMINOR(VIVALDI)(2)
1,666,285,493 *AF5C14707B453D76C6BF1A6873E7D0849283069E CONNORSTARRAK
1,666,285,494 *AF5283FFF908C370B0F1D98DE3238734F8690174 consputing
1,666,285,495 *AF509959E71E8259B99BA7A2AD65B56ADC0C4F2A CONSTRICTORS
1,666,285,496 *AF5E6A3B647D91D3247CB861A5F0794C42D7320F KOUTENS9
1,666,285,497 *AF55C309F099F9FA17A0BC2872741BF8D4794C4A KRAIG.KEIL
1,666,285,498 *AF586F1415A6944CE9760AA06D965B3416981F65 krisrudd
1,666,285,499 *AF50485F582AE60F1D20393DEA41EB60604DFBB7 L=['
1,666,285,500 *AF5E7F84A86A72987D9689998281C5648553D4CF L0M2
1,666,285,501 *AF524D70C0145B5CEDE06771F729E7EDCFAB30F6 COURTNEYLOWELL
1,666,285,502 *AF56D020B3B31B8EE6E83EB3D4F75BBD96D348C2 lamonthillery
1,666,285,503 *AF5AFFB178973854DE4C33FF3EC6AA7707882631 LANECURRIER
1,666,285,504 *AF520EB773A1EA38B37256109775C16BA3B2F79A bg_6f
1,666,285,505 *AF58A736BC0784E023187477892AADBCCE661705 CqLC
1,666,285,506 *AF59952FB0E770767714F6329C4DCBBFD1BC3786 lavernestancil
1,666,285,507 *AF5B08A3277927CB6E262657E4EAF33193CE46AD creoolser6
1,666,285,508 *AF5CAA889D6DC5D66E1F66BE49BBC9AB368BEB2A lazarohammed
1,666,285,509 *AF548AB6E71006225ED496A2862C3ED1F12AAD09 CRISTOFER214
1,666,285,510 *AF537E5AF54F977E95719B56796447AA79FB433B CRMPNNZ7
1,666,285,511 *AF52DE13DFA3A59B957D75FC6B32BCBC14EB460F BJA):
1,666,285,512 *AF53A5404309739677DDF9BE50928CCBBFB76CDD csxqs
1,666,285,513 *AF5A6197B9E877CB39B3A604A5D97B1225AA9DD4 [email protected]
1,666,285,514 *AF5FBAE3BD2C43ED2270ADAFD6A192B5F33395C6 LEN.BROMFIELD
1,666,285,515 *AF56B8BA220603CDB1ACEF90B9764F109E44299C cturidae9
1,666,285,516 *AF523064E12FF6E772B9E3B14BA36A7FC531B032 CTW!
1,666,285,517 *AF5AA9D1A28E37087ADDE6608DE0787E885BF632 LESLEYHALLET
1,666,285,518 *AF5280CA35DEF952E75869DC409066C8878CED2B LFTJDLS
1,666,285,519 *AF552A3A74A8C7F1D527B4ADBF31C3759D4CBEA0 /LIB/MODULES/2.6.32-24-SERVER/KERNEL/DRIVERS/ATA/PATA_AMD.KO
1,666,285,520 *AF55274F5D2D35E048F43B0740D12C43049A4A00 CVBRD
1,666,285,521 *AF5E75A7CDA26979AC2E596F271DEF741CB8B4C9 BLADTR
1,666,285,522 *AF52DE59AF736AF4C2D7CB8CA456C1FEF49B56BB c#x;1
1,666,285,523 *AF55703D1B92496B765ADF1EF22DD70DCD237ADE LINDA.DEGEETER
1,666,285,524 *AF559D2F7E61F85767B6EB3531B68DCDF9360A35 [email protected]
1,666,285,525 *AF577C6181042041E28F152FD95D675B7ECE7B91 [email protected]
1,666,285,526 *AF519B5A7B48E200B3095B9B8E9BFE122E24290B [email protected]
1,666,285,527 *AF573CCAB764AA342B70AA31A8B80FC6D7CA6174 LINOSALVA
1,666,285,528 *AF596D92FA19ECE7E97BAE99174C0D5AD5AE7669 c?z;n
1,666,285,529 *AF55F8A160FE97D2F0B0C2E861B047B5462D5639 LIQURIOUSNOTCOTORGLIQURIOUS
1,666,285,530 *AF5EA65B4D061BDC9F12EC4EB323DEEE1984D0CF LIS]
1,666,285,531 *AF5F7036E4EE8ADE87DB8D790669ACC54DD8A1E1 b,o4/
1,666,285,532 *AF522FC7DC66733DB9419BBBA6F7225F341505FE d:,6v
1,666,285,533 *AF546516919F695E69E8214F3B54929BC7FBFAC7 d7ztv
1,666,285,534 *AF5A5A17FE76A42D9543C341C76FA95A51645E70 d8,"
1,666,285,535 *AF53E31989C7BD069A272BE59C074688B3A1F7CC d8aks
1,666,285,536 *AF55B954AF94F7688A4B36A6D29A7499D2650C09 loml
1,666,285,537 *AF5D3ACEBC91980D6704FB8AFE42FE2194B3EC8B LOUIE.MCDANIAL
1,666,285,538 *AF5A6D6E395C5B22D194A36014C4E457D6C34F95 bp,
1,666,285,539 *AF5FCD16427EA2A8C31C257C43EE7326E5D14540 DALTON.BROCH
1,666,285,540 *AF5B142AD140E0411F34ACA3F3C10C72DEB41CF5 DALU
1,666,285,541 *AF5BF8FF4FE99D94A6FF34EB5127B262784E8CC1 luba-lunda
1,666,285,542 *AF508F96EA7ED79A6498CCA3F64AF56094516398 BRAD.GRUNLIEN
1,666,285,543 *AF59EB55E6FD8A8B213D7EFC24AC65E04012A6B7 DANNIEAMORMINO
1,666,285,544 *AF55381DD646F6D24768539D3096F5CF659AB684 [email protected]
1,666,285,545 *AF585B2217E90AA109DE3F14B13463CE8C265FE2 LUIGIVINT
1,666,285,546 *AF54BEF0AB1D0F6C373EC890ED7D3CDA8E621EB7 BRANDON.DARJEAN
1,666,285,547 *AF587162E2D9262F1975C738DC656E34F4D9F3AD DANNY.PERRIEN
1,666,285,548 *AF556748E702B48ED9B47C9AD090B6D31B4023DA [email protected]
1,666,285,549 *AF52FA6F9257CB987352783FCEC541145919225F brantkibe
1,666,285,550 *AF5DE42798D08647973E6BC4855223C47F511259 BRBH
1,666,285,551 *AF537D8EA6461E77CF8C891899C9174531FFF90C LYLE.BEALL
1,666,285,552 *AF54A2F12A2AABC2E9E4C7E340F096DC43368095 l"zs
1,666,285,553 *AF55E7CE9C844B54E253FE339BA4739D32DE09E7 DARYLKAULL
1,666,285,554 *AF52EDB10ED595F3465BB88CE7CA38E6C3836561 dasnb
1,666,285,555 *AF554BAFC87B44B1BC27569D01D796CD9D383AAE BROCK.ZAGER
1,666,285,556 *AF502DA1EEBBEBFA8A4DB51FC212576E2036B063 BROMSKLOTSARNA
1,666,285,557 *AF5B36023DA1BAB191C805633FC57F623646B82B BR#R
1,666,285,558 *AF52DFDA34244310F208A4850038D900010B03EC DAVID KRASON
1,666,285,559 *AF54C491830F2C00D109C885BAE51B9DC2650203 bsd007
1,666,285,560 *AF57C23C55CFED6D68B94C54B066B6EA450C7EDA buckgeanopulos
1,666,285,561 *AF58B3389C837873F81825CC74C92F8198A0D715 BUCKLOBERG
1,666,285,562 *AF5208870BF5872BC23348A4627ACD8065A49C22 buckpearl8
1,666,285,563 *AF56001A036842AA0C7956980A91B149C5D30BEA MAIDLI
1,666,285,564 *AF56C725D20F8CC0DA50D210D169E766FE503ED4 MAINMENUHOMECUSTOMERS
1,666,285,565 *AF5E05C927BEFDCF1A59F3648F693BB20595D8F3 MALCOMSOLER
1,666,285,566 *AF50B16E5D2703ADE0AA231423DE157D385918C1 b-?w8
1,666,285,567 *AF54B19B446E8C8ED76F8EBEE3E11EB3BA425989 deandreorochena
1,666,285,568 *AF514AA8E28F5B0FFC5F7052FC7393D9075E50B7 MAMMAMIACHECERTI
1,666,285,569 *AF5567F3AD9852863784C27B33C61AC8CF423A27 b#x$4
1,666,285,570 *AF5F14B206EDF566E9B39917C87845017C1A2E8D bxlc7
1,666,285,571 *AF51B725BCD4A82962BCDC44368C888B9C0BF987 deeahrent
1,666,285,572 *AF5C30BCEB02C714CCEF9EF96671CFB85E5BD718 c0g;"
1,666,285,573 *AF5533455034C85495ACC56BDCCC8F2DF22EA6B8 deihv
1,666,285,574 *AF5AEBCE631B3ED89DE40F61C297641F177BF2B1 marceloishak
1,666,285,575 *AF5CD56575ABAC9FCB4908C6270B73755BBBFF40 marcossteeves
1,666,285,576 *AF54C2A1E553881D5EB2ED01509EB8667B732D16 c+3y#
1,666,285,577 *AF596885CDF4AFBBB93B7F720B6DA45547BA7EA0 c/"4?
1,666,285,578 *AF5C27E76EB50FA96A66ADACF6B93797A54395AD DELIRIOTOTAL123
1,666,285,579 *AF5D7106664DF829EEA63EA8C3B80F1BE1BDB7DB c4h+
1,666,285,580 *AF5899C1A82755A92FCDF769CEE1FADBFD94B354 C5A0H
1,666,285,581 *AF5D5589B11984B4712FA7E6F33A4E8A01BAF549 c6--7
1,666,285,582 *AF549F785D2C84B40F0DDF349C410EAB1D1D0F9D c6onn
1,666,285,583 *AF52AD60E6C30F8CF9BF119D364D1853FDEEC1D1 MARKMAC5
1,666,285,584 *AF526A73580E44D481B3E794C86B61FBEC4636CD CALOYER'K/&/L/@//J//@/R
1,666,285,585 *AF54809247A5E03CE7A9C0902A6AB473BDE69D41 CAPAFEGA3
1,666,285,586 *AF5E74CF40BE79A6DAD18F3F26984E3FFBB39052 carloreineke
1,666,285,587 *AF58F7FEDDDD5FCF582319CDDCC5AD7E12B54D09 mauricelamica
1,666,285,588 *AF5A802AB2592A8C7D72AD9DE839CCF16F84BFFC CARMEN.GALKA
1,666,285,589 *AF558FD6B90966148D3ADA102E266855B9FD74F1 maurochalita
1,666,285,590 *AF5A5DB0860A9FD01696D03313661DF5589266B7 MAUSPUTZ
1,666,285,591 *AF52FC01586F9F43C4922AFFF061F7E6D06C2154 CASEYOBERSKI
1,666,285,592 *AF5B5980DB3C18C2EA04B63755F4BC41921E7604 mazurka,.op..50.no..1.in.g.major
1,666,285,593 *AF5CBE54DAF70948C4A464F713C35A3FC1657E83 DFIS9
1,666,285,594 *AF500B6C0AE4DAA7704BC596BD9FE197AF2BCA9C cdtqb
1,666,285,595 *AF545C7DCC5ECE3B42A71CB5E0B17A4B7A62071E CEDRICLUDEKE
1,666,285,596 *AF5B3EEACA38C9DFF3EA3026EE477B6DA44C1022 CE):N
1,666,285,597 *AF5534FC5A997F9E78A4B48CB52E65092123DD5E <CENTER><H2><ANAME="HDR28">FOREWORD</A></H2></CENTER>
1,666,285,598 *AF5085C2F2F6D3CBB756DC3196F462A73BA5C3B2 DIEGOECKBERG
1,666,285,599 *AF5031C7C0F2C2BA6759F72E86CCF5809C148808 CEVRH
1,666,285,600 *AF54C8F705E0628220839E71E5A34DF114D200CF DIMINUERAIENT
1,666,285,601 *AF5C9F959AFF6FE9DF11DD50DACFA8FDA700453C dinodicello
1,666,285,602 *AF56C5CB30CB21E009F56637A7257AEB867842D4 dioneddlemon
1,666,285,603 *AF59FD3EC167A8E1EA45AD0A32AA7F13AA2E7FBB cg7sr
1,666,285,604 *AF5292BAA23B3D0454DE2A06351ED77B5512DC7F chancemiles
1,666,285,605 *AF5B268C68D08218854022A55CD796719A5670EF milovito
1,666,285,606 *AF55AEA3DD9C165C4DE436DF7ADEF1DBF8B4E68C CHARACTERAVALANCHE
1,666,285,607 *AF587F92138ECE17902AB2C62315C931E9D4763B D??$J
1,666,285,608 *AF5AE322372A087BC6ED6FB4AF29A19EE7B6DA0E DKARTY
1,666,285,609 *AF5E2693B026A87D6B6F6B6A61C250491B1D731E Dl4=
1,666,285,610 *AF50F752B369C8E1728436B7713287B32970EC4A [email protected]
1,666,285,611 *AF5A2F02870278C81135517D610EC59D9F7B2548 [email protected]
1,666,285,612 *AF5F7CEAB8F7A3679CA463A4A1B417C2CEF94FB6 Mock-Champagne
1,666,285,613 *AF5660FA3F81A8AE829E433D56CD8F13777606A6 d/n)
1,666,285,614 *AF554ED43FFEFF6E699D5211DD8A7D1011D0CF84 MOHAMMEDORR
1,666,285,615 *AF52F822432414941502FC78E3D15706C7C3436C CHOSENFEW(FEAT.SUPREME)
1,666,285,616 *AF5F1B1F74E2C0DA68E03BD7809BA32E3C80DE26 CHRISTIAN AMOR
1,666,285,617 *AF53D7AD61A22F308B7D5DD6DFB84E042C253303 christian-dale-pineda
1,666,285,618 *AF554B2055945F0A488D991BBEDF7C1D757F01E9 christiantoft
1,666,285,619 *AF5C8802ABB71ACE634462612FE77524D3DAA73F DOIILEUI
1,666,285,620 *AF5E4464D3ECED847EBC2BF32106DE51D7193BF7 MOSSER24
1,666,285,621 *AF59CB5F970CBC1CD4C6A971BDA563603FD9681C MOTTONEN7
1,666,285,622 *AF56C5D9B897EA86DE86B4566AED1C7CBF9C8298 döntőbíróságoknak
1,666,285,623 *AF5727DF1E735FA1FEA84D997753BCE3FABAE717 CK7BY
1,666,285,624 *AF56CF3411DB3F1F2BE3CF2C533CE98863BB87C1 CL?""
1,666,285,625 *AF50EE813D90FCE03532EE216EE3E746C77E49DF DOYLEEISENHARDT
1,666,285,626 *AF51516D279999D5D2624CE3484C3EF140A84363 MUTCUXAU
1,666,285,627 *AF5B9953D2E8B30097459D689D7294EA94E344FF CLEARERASE
1,666,285,628 *AF5E06AF352BDC955A68EBD289835E711B82D693 dp%_o
1,666,285,629 *AF5E2A446E9FB1E6C7C679183631199EAE2C0C41 CLOUDSHINE-/-DRYTEARS
1,666,285,630 *AF53AFBAC0C90ACB38AF86D96190698D36583E36 DRAW OVER
1,666,285,631 *AF58CE4305F6D43EBBDAD432B044F6217CB0BF1E drewreid
1,666,285,632 *AF5F011553F95FFC3F17F16305EF2B2ACB709EFA CMBUG
1,666,285,633 *AF5D133879A64629993CAA6D2E568B15834E24D3 DUCICBSW8
1,666,285,634 *AF5263B399DBBBBF9AC7EFD6CFE4E23772744574 DUHTXNK38
1,666,285,635 *AF5FF9E4BA2ABEF5EEFCDBD06CBE19AF95717A17 colemanthornberg
1,666,285,636 *AF53C7C56791FEF8AA8833ACF6A51BC77ED8D206 COLE.MERLIN
1,666,285,637 *AF59A7502575843AC9D2AF8A2C6BDE338E60CE0E NEWTONME0
1,666,285,638 *AF5E3CA257EDFE1A144C03EB418EB83E29A2589F E04210120172
1,666,285,639 *AF5A779D1644983511B96F4B9F5E0F87915A8112 EAIBB
1,666,285,640 *AF597A02D74849E03DA0AC4E89665D7EC20E3C2F EARLNAGUIT
1,666,285,641 *AF5E37332614E268D8921F9F7607D36805A7A514 c$#ov
1,666,285,642 *AF56FCB54462BA5A43EF89D8B16C7F27CDD7BECE noteofjazz
1,666,285,643 *AF5A6AA413C49DFAA4EECCB7AE0FBA7B232DC291 now.a.lot.of.people
1,666,285,644 *AF5D088E68AB7F42A94AA833AF065F831AC30975 C:\PROGRAM-FILES\WINDOWS-MOBILE-50-SDK-R2\SMARTPHONE\LIB\ARMV4I\URLMONEXP
1,666,285,645 *AF5A5ECDEA0354B66B81B93E929C70BA3AE0BFCD OBA MASAHIRO
1,666,285,646 *AF53A45A4C181861107F2E67FC728D252AB54858 observância
1,666,285,647 *AF5E41EA53CFA0859B271D4018EB9FFBC094472D OHAREUTAI
1,666,285,648 *AF5F1109F7113C20712B1CFBAF178B7A2A145BF4 EEDP5
1,666,285,649 *AF526E568BB39C20DFFDABC225786649585F9A3B ct$=e
1,666,285,650 *AF595DDCE844DE684ABBD4C070B3E0451077997E eidhk
1,666,285,651 *AF5BDB03456053EC58E0FC1A2A8AE429EC151790 CUEZ1234
1,666,285,652 *AF583580C9F5AD675CF41B1A8EDFF58DCE9D8232 cuntreye8
1,666,285,653 *AF57808239857C1C8EAB9B78B8BBA8DC809B3609 (><) O~ (p
1,666,285,654 *AF5C1A98AFB944D82AFE2B3D58040C207CEE9B1B CV07
1,666,285,655 *AF5711D185B14F317CAD2F68D19FF56F9EFC63DB CV!PH
1,666,285,656 *AF5CE5118DE2D087B6CA01E897F719C9C6250ED7 ELLIOTHERALD
1,666,285,657 *AF5E5739F7C80F4AAE81B75B2A438CE57FC3EC1E C%<Z
1,666,285,658 *AF5EFA8EEDC6B1C00FE54A1D1A2313183C97E1D2 owenhochstatter
1,666,285,659 *AF5D2C9BD101D31113609D90688F43C8A2813479 D3C3NTRA1Z3D
1,666,285,660 *AF538B76A5DF6C1BD2CDF5F95522B0FE8F0BCF0C P#>***~0~OSPLAT
1,666,285,661 *AF53A281B85757598B05147E870FAD7F4AE6FA31 D!6I,
1,666,285,662 *AF5CAEC772DA08FC67DFBB0868E06D2837C571B0 PACKMANS3
1,666,285,663 *AF5FD8B1D53A5F8FC3B752406B90B5858E25FA25 en,$
1,666,285,664 *AF51050164B79CE4F9299DB7862DF6E1F80182A9 ENDIENCE
1,666,285,665 *AF5BDC433C5F1FAD4B6B894AC7AE275A967C8F47 [email protected]
1,666,285,666 *AF5E2BA274C8E0928D74555454C3B2B2586E2450 en-forunderlig-melodi
1,666,285,667 *AF566F2A7B14827C9600494F26DC5BFA6C633C7C ENLARGE
1,666,285,668 *AF5D567E2783B86AE2DB33799B52C066642F2DA0 damastes.de.sigeo
1,666,285,669 *AF537C77802B7F43BE330C3E157A969A406422D6 ENVIRONMENTS-II
1,666,285,670 *AF5884202A20F679798875699C9DE71405568EA7 [email protected]
1,666,285,671 *AF522B6A4D79E99895D54A14F182B9CEA1499BC5 PASQUALE.GRIFFINS
1,666,285,672 *AF5F37C1B93E08B240B571733E438647270CA421 epewueined
1,666,285,673 *AF5327BB6FDCC0A24D1BDD1B6D7F23A5CD7B5FF3 DANIAL.RADCLIFFE
1,666,285,674 *AF55590033AAF0E61F9A38D4035A1C4169862479 PATHENOGENICITY
1,666,285,675 *AF57A81B28B6D4DF5FF7DC6F90A448E8A3B19FBC DANPARETTI
1,666,285,676 *AF541AFD3AD2E634D424E3E5B33156EFA10B7F42 DANTEEUSER
1,666,285,677 *AF5D1E07E5BEA2E28D4DF0A97220C467412C730C dantesusla
1,666,285,678 *AF5FE0EC79A6D7B62F8D4044EECCA37837E8828C ERASMOANGUS
1,666,285,679 *AF55DC9463A1B2EBCA409AFD00B6F06B2A9DAF67 pc.saravanan
1,666,285,680 *AF5FB665B999E454731C455609968295FC7BE687 ereidnopped
1,666,285,681 *AF5D6AC28B6A270C5A701C72BA1708E3E0AA561B PD*(0_<)
1,666,285,682 *AF59B41BFF352B0D44982A123649B4D5B3E5775A erintavera
1,666,285,683 *AF5D70877AB1BCB49336F1E4CBA8536B9B4FF04F DARRICKMANORA
1,666,285,684 *AF5CE8C631DDD6BF20C31FA8B7B1BF9B8FA5CA85 davemilosevic
1,666,285,685 *AF501341C546386DE78C3BF42B5F23A6296273F5 DAVIDBRINLEY
1,666,285,686 *AF54DA6D3D17C71E4D620A7A202B25D4E473966B ervinjes
1,666,285,687 *AF587CCCF998206DE2B6335EE32756938581BA86 esculápio
1,666,285,688 *AF5483F7B8FF1804921F49C43BB063F1CA7C62FF [email protected]
1,666,285,689 *AF59CFE671C8ADA836A0E78D9C981B633312D463 D,dc
1,666,285,690 *AF51DA3DD1DE68B7D38E1E2B51AA09E0C0BE1566 pharmintrest
1,666,285,691 *AF5FDABA2D2319E04D987153E2B64DBC9D3FF0E9 DE34RE
1,666,285,692 *AF5CC279D28136564DC084DBAB7AE92B4A6ED503 PHILLIP.CAPANO
1,666,285,693 *AF532B60EA9668EB24E2E526A84632B8C327BF06 ETNAMATSUB.2
1,666,285,694 *AF5F8CE996BF2AF15AC7336AEFC35B66ED4F59EC ET-SURTOUT
1,666,285,695 *AF55E008E96043728F3E51340DBAC1B96FCD32D8 EUEV
1,666,285,696 *AF5300CE75C20A3AB6259722ED0466D510A71193 [email protected]
1,666,285,697 *AF58338BFACBA446129BA48A49CCFC04EF408C0F PLEURERAIT8
1,666,285,698 *AF59E4F12D978A26FCEC161807BC14E7A1DD3946 DESCOUBEMOSLHAS
1,666,285,699 *AF5C3E01A0C745B804926877363D105E6DDB6F6E pn"[
1,666,285,700 *AF50001F392E2B442F7A70FBCA4F37202E317AB4 p==)*-*-*-)o(
1,666,285,701 *AF5679A9072F730730D5E5D420600593294B928A ex<d
1,666,285,702 *AF55F09DB4AFFE998741779DCD4BD864C3AEC330 DEXCJ
1,666,285,703 *AF5FF23CB64FD718F50FE4F299F529948572BA3A P->~O ~O SPLAT
1,666,285,704 *AF512DD3CC434E9B86E675BF5052C4EF6E47E604 [email protected]
1,666,285,705 *AF597F94F97116834323F35BE487622D5C2421EC dinocartland
1,666,285,706 *AF5DB181B971AF4743FE51738C64BE4EE62CCB17 FATY240108
1,666,285,707 *AF529F0A637F85552A2003C3C355C917A88BD863 FAUSTINOCALLAS
1,666,285,708 *AF5022488E78E37E3BAFD8C25DA78B0B471E165F FAUSTINOSZCZEPANIAK
1,666,285,709 *AF524DE43036D691383796036417F004A43FC79A FAUSTINOTOP
1,666,285,710 *AF59CC41C0B6F8559B1058E3661DF3F36796364A DIrM
1,666,285,711 *AF56AE22C59765C756C9BB0C659A3E57684ABE43 divya-premkumar
1,666,285,712 *AF5BE4C49B38140FBF004730C4812A5DED508CB1 diww4
1,666,285,713 *AF56BC870E043D7FE008B0D910569978BAC5B7D5 federicogiambrone
1,666,285,714 *AF51664902BE45E4FE2864F6CB9BB8BE0CA5D048 PRISCILLA.HOLDER
1,666,285,715 *AF5A7B92B50C5F41B72AAF11F26D16373ED5385D FÉLEYSI
1,666,285,716 *AF5BBDF5D6FA77E6E7387AD5A6F98BC25DC61531 profa.de.mate
1,666,285,717 *AF524EE933C18CE010A54597E79CB55939E4DE60 PROKÓNNĒSOS
1,666,285,718 *AF55851EFEEF61CD356EE2EE1DC309087F199167 DKTO+
1,666,285,719 *AF5577712EE8BDC0E418B62B650180414F261469 [email protected],
1,666,285,720 *AF57F3BA8B8FCBD1AB0872A87AFB5626923A3F35 DLD:V
1,666,285,721 *AF5DD3C74A20D2F6FC4378C8061D481F87393FC7 [email protected]
1,666,285,722 *AF5073481755E42C0453B7613BD0B74C2EF1A90E DOLGOZOTOL-1
1,666,285,723 *AF5241DE5374D5D7ABDD933F5A188A6E0CCEFEC6 DOMINIC.SHANKER
1,666,285,724 *AF592BD35786C1216DAF54B369A8A9EBB2CB3E8C DOMINIQUE.DYMOND
1,666,285,725 *AF5FE1530EB5AC4C3D23A79061CA690664B5EB15 QGYE
1,666,285,726 *AF5FD0D954FBDEEE84E63D18AB5335A3681BE285 FINANCIALS2007
1,666,285,727 *AF50ADE4EC2A24F2D78BE1673B9D0F1E29CC9C1A [email protected]
1,666,285,728 *AF55130B0E82044D388912C9CBBB11D49F9475B7 Q-P~~~3B<-
1,666,285,729 *AF568A99A2F06CB7062DEBD694D5222217BD74E4 [email protected]
1,666,285,730 *AF55D8E246CE76F2869C2E19A6028DF71914E199 ][email protected],
1,666,285,731 *AF59CA17C4158E539ADFF3D4E44B981C00B5EB5E quale amore
1,666,285,732 *AF57CCAB0E2A0BBE7734C5BB2A51B21D9C8C2740 flemmes4
1,666,285,733 *AF5B58C281EA6F72DD4141CC45C9B69C71A37F9D florenciopander
1,666,285,734 *AF51F4C52860FB8B97D49F9496301337CE8CEE66 QUINN.ELLMAN
1,666,285,735 *AF5ABEB09647E1AA85C67556C9419B5B8984C687 DpLM
1,666,285,736 *AF5A00840AB9DCEE177758B59A239E600049D67F RACHEL-PAWSEY
1,666,285,737 *AF5644E9BBE87040D4AECD9BCE65A70AC78CCAD8 fondlikeses
1,666,285,738 *AF50A80E9D686D0297BFFB36C05984E1B5AE6F56 FORPROVIDE
1,666,285,739 *AF5E144A252FBABE38690815BED11C0501842781 RAKAHAP
1,666,285,740 *AF5292837777815F380BA22EFEF2CFE0343474CC d/tm6
1,666,285,741 *AF5E5CA9F5656EACB2D3DCBAEE7A55F1E1621FA8 francesmoala
1,666,285,742 *AF500ADA7EEF0C4C0834B21F1196F9FA5063D071 RANDOLPH.FICHT
1,666,285,743 *AF58DC5ED5EF4B8FE97AB89D763F9239E31C1615 RANDY.SHEWMAKE
1,666,285,744 *AF526E1986909933512CF764B96378FD78AF039F franklynkveen
1,666,285,745 *AF5856F0AF79F693FA0FC5912F60A8F33FB39DB6 FRANK.TERRETT
1,666,285,746 *AF54B9BADE12CCEDB7ED6396D8AF7D7CAD725E18 raucid7
1,666,285,747 *AF5B18BC1EF8F60F3EA7C88E529E4694B688B644 DU$S:
1,666,285,748 *AF5943AC98CBB18FCEA6A133D34E567C0AAAD46A FREDERIC.GREENAWAY
1,666,285,749 *AF5E8D4E8CDE8A3DDA789F143895E120E9352591 FREDERICKKALETA
1,666,285,750 *AF50D9912C475304485AFBB6A84C87DD53D87BF8 DUTUW
1,666,285,751 *AF517943DC62B03BCFD776E053FEF96F644BCD6D D_v)
1,666,285,752 *AF5E22592BA516A1BB3D1A6DDC88F81134BDC63C dvnw9
1,666,285,753 *AF59EB24D6B4804152FF1356F2EEB69F84FA5F2D RECNACSTHGINK
1,666,285,754 *AF51C65875FDBD66D18F28B3E72999A9B552A54B d_wt6
1,666,285,755 *AF5F4A70BFADDAC177F831BD9166F0931D40B8D4 DYLANJAE
1,666,285,756 *AF53E0FF93A4637EE3984EB38803499EE130099D d-z=e
1,666,285,757 *AF50CCBDAC20200E9034BC9007F217477EE556B3 G0A6
1,666,285,758 *AF5DFC70A250CAD85EE6B7406772C4622BD3C967 G7/E
1,666,285,759 *AF55DC6C715C3AE1A90A7A480EE7D0CB59E394D9 e6db75c0
1,666,285,760 *AF5645FC2ED8A67C0703387B57C09A2C1EA19535 RENALDO.STELLMAN
1,666,285,761 *AF53DC765F763BC29ABDE1665E1A1BEDE0CCB4ED [email protected]
1,666,285,762 *AF5BEFED9A0B944D2BA9D67D804B0EE12C4CFCD2 eaptlsconnectionpropertiesv1.xsd
1,666,285,763 *AF56E1F05425B7ED88CEB1F5E450B34047396C3A GAHAHA1
1,666,285,764 *AF5B8BE6902D138995D4F89593F808C32D9C4C37 gailchihak
1,666,285,765 *AF5946EE1FE5B4B27E0250B8667D151E0CEA33C9 EBIRD3
1,666,285,766 *AF5439F506186A874D777A94C17198B4E5C82477 [email protected]
1,666,285,767 *AF5B2A044997502343EF8E606F5EF8B88A2EED3C ECHOLOCATES
1,666,285,768 *AF5FC6EFCB60280336AE4D7B5DAF0640336828A0 reubenblevens
1,666,285,769 *AF5590F56D90491170BDED69641374C2C331F919 rim.rima
1,666,285,770 *AF5FB316B29E69B2E52B4A27BB3B6FBA943786F3 ringjalljen
1,666,285,771 *AF56D685C01E3430DB326F5E8771909EE11F1B4E gartenhofes
1,666,285,772 *AF56E8DA10A61B725F8350914C809724A8759ED1 edookie3
1,666,285,773 *AF5BA8F50FA9C48D27CBE3E269AB5F53346A94FE GAVIAAL1
1,666,285,774 *AF5B1FDAE0FB7D26C0AEDB89215D0EA724D9AC49 rock.&.roll.(feat..naughty.by.nature)
1,666,285,775 *AF535DDD5443D1A47D7B5DBB046538AA50FB76D8 EICALERP5
1,666,285,776 *AF5A0520F3D876ECE415E55655CD4BBEC5A07924 eik5/
1,666,285,777 *AF5D53173A688FF6E679855EC7A92DEA142DF406 RONTONIO
1,666,285,778 *AF54BC7F96ECB7F86C39BD856EB477A1DC1B16A5 GERMIESHAN
1,666,285,779 *AF55D33F16628ECD73C33B2D514A6155EE8B24B1 roosa29
1,666,285,780 *AF510604EF66D684CC0CE34156C2A6B7E29F91FE [email protected]
1,666,285,781 *AF5CD08110F238C239531B4980EEFB05080BA199 GESPRA"CHSTEILNEHMER/NS
1,666,285,782 *AF5989462133F37EA0E647DEB4B50524C92CA67E ROYALFOX0
1,666,285,783 *AF5ED80A013A029ABC6B6CCD5F629257B4454EC5 ROYAL.KNOWER
1,666,285,784 *AF5072B07C9874DD0B6D888BF9975C299E55F634 GHETTO.STYLE.DJ'S.BASS.1
1,666,285,785 *AF5194CE315B1588DDD00FF112D607DCD3F7175C rpeuses8
1,666,285,786 *AF5F86B736B570134F6F75989D77C9EAC373D954 ELBERTCERNOHOUS
1,666,285,787 *AF5FCB2B384116A1B5E7BD76A71986C3882EDEBA elckw
1,666,285,788 *AF5B7D0863C5C4F20397EC50D19F1D50B374EEA6 eliroldan
1,666,285,789 *AF57EEBF180CA522C01D95D6D2CE0722C69E75C1 elise.punzalan
1,666,285,790 *AF5D50D9193D3CC66987B94DF8F4B4B9F91F8E5C russellprevost
1,666,285,791 *AF56DA1F3CC9D86DE51C9A6C8F5D8B39A7473732 global!s7
1,666,285,792 *AF5A0950D254CDE3D52C66F548C8C54E55589194 GLORIOSA.VIRESCENS.VAR.LEOPOLDII
1,666,285,793 *AF5B381439FE0B30CF185214B7D76125917AB310 elliotcurrington
1,666,285,794 *AF59F18A2D3AD791B5E28977ACEAFFD40E8ABE3F s4cr!le9!0usly
1,666,285,795 *AF585E69A2645B9B9AA2B2FB47E4D4A5E13DFC00 SA
1,666,285,796 *AF5AEEE790455437BC35BF963ACDDCEC191E0EED GOLF
1,666,285,797 *AF581CDF1A274CBE3959DB6DF3218B9E8EB19C12 [email protected]
1,666,285,798 *AF595A0C1497B4A6DCD6CAC96FC4313322F42A4E SACRIFICIALLAMBZ
1,666,285,799 *AF5A3C553E2F0202C2F338E209924F1830140BF9 ELVIN.DEZELL
1,666,285,800 *AF54A6D2C0288CE57AD327019F0F383BFBF14139 GOOD.(ACOUSTIC)
1,666,285,801 *AF56E44DA1EC844DB975E1314C92BF888D902063 SALVATORE.MAGEL
1,666,285,802 *AF538620C437BF516EE51B929D8214356A0EEC2C gounod7
1,666,285,803 *AF520A01EFB94EFF71A5844D507B277A9E2A9D51 EMERYGAMONS
1,666,285,804 *AF57DA7CC9306CCE5C3D3188499AD039C76E8B15 SANDESHRGOWDA
1,666,285,805 *AF5D3A9D779A054BC9F2054212143733179661DF SANGRIA
1,666,285,806 *AF5B3A0D0491A05FCC0760752F03114919BFD01A SANREIRETSINIMADNAGAPORP
1,666,285,807 *AF5BC1E2CA6A792B1108A3ED1321D6081318D411 EMMESIEVING
1,666,285,808 *AF537C5E14D426063A098A2B75B4E2E5142EF04F GRASS.MONKEY
1,666,285,809 *AF506FF97951456FACF5984971FDD253840D22AD GREATDAY123
1,666,285,810 *AF5F7C59EF7074F31A826DF34B21556CF978E539 GREGG.DEVORA
1,666,285,811 *AF57DA82B0DD9B2C2C96DA78ACCD689DA23876F7 SARVESHSHANBHAG
1,666,285,812 *AF5A6EB21A58E69782C5057ACE09FE12C34F24E4 EN6912029230
1,666,285,813 *AF5444E7C31F52F2BB4C3E954A347E38A965C358 scatherinemoore)
1,666,285,814 *AF576B20DF34491CBCF7DCC84420E86C2EFCAB16 [email protected]
1,666,285,815 *AF53620D3CE819AC34D9AA857288FFF164E73425 GUGTLWHHPK
1,666,285,816 *AF59CBEBEB1B39F4F0DEC31997B9F7F0DC437436 schmatzchen
1,666,285,817 *AF5B73ABE2192A54B3B72E4A7CDFE0EF9BBE7B81 GUNSBACHGRIESBACH
1,666,285,818 *AF5082C0C9FFC40A573052AE184F127A4B93FC51 scincohoras
1,666,285,819 *AF5A9BB7EE8B851ADBC2993800305EA28E2718BE scorpionflies5
1,666,285,820 *AF5C917BF2977F4682B44A53EB1468756CA6B83B eppeleet5
1,666,285,821 *AF5B4673FC825ACF4BEE8AE80F7DF4EDDEED1A08 gxf6
1,666,285,822 *AF5F7BDA1A54ECCB02D0E51873C3BFEB68906123 h4rd-h4ir
1,666,285,823 *AF529607737F34ACDCB051E68774597E57265D9F sebastiansan
1,666,285,824 *AF521E67F9B88B113D1E08869E9141B7F3851ADD seelpse8
1,666,285,825 *AF5125B67C917F8A669AE7431B1047288BD623FB HALTESTELLEHAIGST
1,666,285,826 *AF5DBCAAD700D73B7E53449AA2000AFC74B98F19 SELLABLE
1,666,285,827 *AF5DAFCE9F23EAC551C9A3187070BF6090E9E203 eringio
1,666,285,828 *AF5A43F2DFA0ECB04F783B0F17AC1D91A0FE01D9 ERSCHTENEN
1,666,285,829 *AF5160388FD5D42BEDBA59A4123BEECF921C831F [email protected]
1,666,285,830 *AF53208C77EF4CDB29019FAC30191DAA6FE1F260 [email protected]
1,666,285,831 *AF5E52F28C7AB79EFC44470C8CD250753C9D08D4 eshcasgns
1,666,285,832 *AF586A8C05DD6C5FE5806D177B9670FE095F220E ESMERYARIMBENIM
1,666,285,833 *AF51AEF8C44733A001C09EACAAF5A3A8F67BB5B2 ESTEBANKAMER
1,666,285,834 *AF5DE99F1AB83A6B4F0F312D1BD0E0A9F3813EF2 esuso
1,666,285,835 *AF502B4ADF486D6EE89CC139A6CD9CD5ECDCC410 seven of the baby bell rbocs bellcore was in a good
1,666,285,836 *AF526D226E344E8DA477C8A6BCD70A6B4A76F858 ETE=A
1,666,285,837 *AF50113166F41F8D825AEDB124BB176CCCC3E04D [email protected]
1,666,285,838 *AF57140ACFB5F89627EEB2623E84A7D652B1C98C SG=H
1,666,285,839 *AF5D3423FF1BED7F8532CF545C463EA30EB57788 shalier
1,666,285,840 *AF56F38D051C54340391592C60827968DC7F5D5E eugeniohuseby
1,666,285,841 *AF593ABF083464951AD890AFED328D8624357651 [email protected]
1,666,285,842 *AF50B932799479B21864F3D829E40E3B431338E2 eupa)
1,666,285,843 *AF55C34555344AB141752FCDC65C2A1793A79BAE HERIBERTOESMAILI
1,666,285,844 *AF5353B6ABAC5DE6070ABC9B48E4B1FABA7FB04B [email protected]
1,666,285,845 *AF5092FC077BBFD16EDDB646410DE1CD27AF1C05 [email protected]
1,666,285,846 *AF5791EC1399C496D05C86B8C057888D4E3C5EC8 [email protected]
1,666,285,847 *AF53CB80777CAE00AB395661C496D6FDB55C4D5A hermantweddle
1,666,285,848 *AF53F8A1C2F93373542D881DB18BD1E4CFEC773F SHELBY.LOVELOCK
1,666,285,849 *AF5E5FA23C42A82D06AC7E15CAD5A2EF3552D8CF hethinkshe'sraystevens
1,666,285,850 *AF57AA9536B02A413BCDA3C9289985CCF5512B66 HGEVA002
1,666,285,851 *AF58B0BBB3B1D9A404B8AC4E2D70EF4B6AF4DA2F sherwoodeichhorst
1,666,285,852 *AF52FBDE1C45A0E7E5F529990AF478A997BEC8C5 shij
1,666,285,853 *AF5FD8AE1C7725961B0B3A3C48E8CE29522E93BB f6ug
1,666,285,854 *AF524D87285445F759BB46C0CD8A9A816D03AAC4 HILLELSKOLAN
1,666,285,855 *AF51AC29CE2E9CD8BDF2701DFBF071D2F800C47D shortna
1,666,285,856 *AF550222939FCA4509F2DCC461897B30EB94540C fallboard
1,666,285,857 *AF5E5CDB6ADF65A7B406FDA22BB2F7C78749224C SIAWEKAM
1,666,285,858 *AF591E2E8C0F2A674E9A6AE7F9B07DB964902F6F SIVATHERIUM0
1,666,285,859 *AF592F8E03E535C17ADAD55409F8688BD7AF3537 FAUSTOBOZZO
1,666,285,860 *AF58EB537418D9EABE3E42C9B797998ED5B8EBCB [email protected]
1,666,285,861 *AF5311624B427F8483886AAC0CA78113A49ADBC5 [email protected]+0u$1y
1,666,285,862 *AF5740D0D1D34FD7C5E53D36434573DF8EE950B4 {FCBAA
1,666,285,863 *AF5E8A8DC0F67762BA085EF7B5A7527D3ACAD2C8 FEELEYJBSW
1,666,285,864 *AF562D5BA16B956B770077B9BDADA74231BD425E fehérnemű
1,666,285,865 *AF5DB3DAAD3BADC749F57BADCD29F6FF99342C59 FENOMENOLOGIE4
1,666,285,866 *AF5D0060FB7617961624C1DF7FEF644D5BC5F450 [email protected]
1,666,285,867 *AF58FDFB6ADA42C98DB957F0B2CA9220BDD4F206 hov3dords
1,666,285,868 *AF51DCD009481BA5CC541A6A0260C6EA4F3F6D3C SMAGRISCIED
1,666,285,869 *AF523D31B2DFF65FEE4C01B494ABFB953AAEA580 f/il
1,666,285,870 *AF5525B89F2ABC1D9F74B770FBA41F3C165744F3 finality-men
1,666,285,871 *AF5E766AA66CF5C1D64AB0F5C174F8BBE6F625C9 HREF="/SIE=UTF8&KEYWORDS=ANUS&RH=I%3AAPS%2CK%3AANUS&PAGE=2
1,666,285,872 *AF5CFC8DFCE49329D5BD21E6F7D6552665253A9B fl0$$3d
1,666,285,873 *AF541CFF3DAA7B58A3D18910422512C7A11C15C8 hsieber7
1,666,285,874 *AF552F64742F1BA62657B421A9F3BEC1E60DE545 SNIPERRUBY1
1,666,285,875 *AF5B7ED02D71F15E01BF432E088E4544596ADFF5 FLEET.$UB
1,666,285,876 *AF5E5639C60BA07AA15C8B107A887CF71A0AD285 HT[R
1,666,285,877 *AF5C30B415DD249F0A65733CDFB2EBB5BEE667D6 HTTPWWWWARGRAVESOR
1,666,285,878 *AF5FAFD0E5DBFB46F048374928D5B21EE0259A8B SO-2005
1,666,285,879 *AF58FD2167F9B6D1CBD773DAE1D6A15D5DA64A97 forestfrazey
1,666,285,880 *AF5DED2F9249F7FE558BB7E01ADA03E804E298BD FORKEEPS1
1,666,285,881 *AF55C95A2FDCA9ECB48783C5D115AFBD015A94CC francesforst
1,666,285,882 *AF59C84AA9C2A113E57C36074BB281D18DB4DFA3 [email protected]
1,666,285,883 *AF542ED2C4291EF2FD422A5A8D5950DAD37D64B5 I"JP
1,666,285,884 *AF5558F1756DCA9371554021C402DF6ECFBFB87F spredao2
1,666,285,885 *AF5C3AFAE48F002F3685839CB4FE191262940FB1 ilovefinance1996
1,666,285,886 *AF5E27A0550521835E1337C2FD4246BD6AC0DD46 ILOVELUCKY17
1,666,285,887 *AF5270D73ED39045564262C427325CFD7BEE3048 SSEJTREDALB.
1,666,285,888 *AF5A69DBC23EC5A498477A862452FBC79E52B2A9 ssensuoudranu
1,666,285,889 *AF533E87CFBB24399561D98619D3889C397D029A stacymontgomery
1,666,285,890 *AF53C14C2DC81EF774FEEBD0592EBAC38FDAEE12 inaugurerez3
1,666,285,891 *AF52D5B40D61E86BBDC75D0824B12F9E0FFA59AA gallicaanse2
1,666,285,892 *AF55E009FACCAFB1D437342683A9242074ED3E9A ‘gardenia’
1,666,285,893 *AF579C4AA251D9FCA3EB4C0D5E7B70E7C197EBBA stigmata119
1,666,285,894 *AF5BD002BD6DE7120D6C7322FEEEFED8D831D069 interviewees!
1,666,285,895 *AF5FA3924A4B274E80DCEAFC96C8E45553283E64 IOANMATIS
1,666,285,896 *AF525988C623DF5CA73C32F1CE4BE53D682783E3 ipsort
1,666,285,897 *AF5C96F1673D6C133EC3110C0F13CA2C279BB8DB GBKL
1,666,285,898 *AF566FAA8D2B6C4E09B76B82BC1419F87EE09BC8 GENSAAT
1,666,285,899 *AF569421CF183670E37F8A43AB8E97107C664BE1 surohpso6
1,666,285,900 *AF5C333AD5F5DEE053FD3D9878A588F52066E368 jackie-fourie
1,666,285,901 *AF5994552EFFF01F803684276ECBBDEEC65E9D7E [email protected]
1,666,285,902 *AF506B72B91B05D4FC1BCB85AC82EB1BA1E3D8FE SYDNEY-SAMUEL
1,666,285,903 *AF52508179FCBFC35CAA8D2691756D3680574735 GLENSCHLOTTER
1,666,285,904 *AF56BC54FF3111FA3BE308443EE6C5DCE6C9CCCF glorieren9
1,666,285,905 *AF58B58822532A7E9505A028A88F2EE2163ECB1E JAMIEGROSBIER
1,666,285,906 *AF5779B9B2F2B7F03A6807C32039D232438ACB79 [email protected]
1,666,285,907 *AF5D6192570BAE885C08227041FEE668BE306AD5 JARROD.MOGUSH
1,666,285,908 *AF5CAD6D223350DB82F27AB594A7FBCE712C90BB jarvishaigler
1,666,285,909 *AF5A18371CC50CDD17B3F7D79AC4DA7CE938F634 TALKHANKKISSEL
1,666,285,910 *AF58095B3B22783CD4ECEC9F43A8CC8409431DBE tamkike
1,666,285,911 *AF58E0D3D7DE203DEB1B58F418E29867AB624B82 TANNEREXLEY
1,666,285,912 *AF5D63D031944F8C226CDF59098CC2AE121C7A18 TÁNYÉRUL
1,666,285,913 *AF508770EAC098F4D095BD75B5A12CB3A1C7821A JAYCONNEL
1,666,285,914 *AF5D88F11D0587164EDBA7CB6281CC4C60D4160B JAYHOOVER
1,666,285,915 *AF5FC627A49A1621E848CC833C4E2DE92CB491A2 JAZMINE.VENEGAS
1,666,285,916 *AF5D8D2C94EFF46929DD34237977C23F1427B459 jeffmagnotta
1,666,285,917 *AF5DFC34C2EA717407959A0F84CFA461389C65F5 GQUZMAN
1,666,285,918 *AF56818A8F9C743013D8AA4ECE52147719807ABF GRAFSER2
1,666,285,919 *AF52E93985AAB5DA311FE4890EBF432A95489C8C GRBOYAN6
1,666,285,920 *AF57B29CC207762BD5B759C5526F008B58B3FE38 great.wrinkled.things.did.you.hear.that,.moriarty?
1,666,285,921 *AF5B0C5D0D23AC8C6AF055476A59BA14F39CD503 JEREMIAHLOSINSKI
1,666,285,922 *AF5D5FA5F49B73300A47EA14D47B965B7CDD5897 gregmartinek
1,666,285,923 *AF54575D58F13EA34C9E9B628726E86DBA1C4DF5 GÜNSTERBERGIDELE
1,666,285,924 *AF5D893456B4A8BFA77E29394D35FBC02E419DD5 JLCRBJL
1,666,285,925 *AF5D8E86E8A08985ADE59B1B20DE88222EF1D878 tbonefgh
1,666,285,926 *AF5E4F3705C007A350B9663FD1AD3045C5FFD565 TEODORO.ZIETLOW
1,666,285,927 *AF5B29BF96077B711E9D3B9F3F84DAAB9BFD9E52 [email protected]
1,666,285,928 *AF5FC616E79BF9627502036CE1FB733EAA71B730 HANDHABE7
1,666,285,929 *AF5E1CB07855BE33053C2851DCE9E559750531EE terrellswingle
1,666,285,930 *AF5FADD5D5022D26089FD6C97A200405B425B55F JOESPHHIRZ
1,666,285,931 *AF5EF21E64EEC2B77DA4C8FB8B81740935A0A550 HANKDEBOSE
1,666,285,932 *AF5C452A9E8B685705D0699A2DF728D93B5C29FC JOHNATHON.MAGNIA
1,666,285,933 *AF5FF2E570A6D0AA0AAB599BE228ED258796E05E TEXACA
1,666,285,934 *AF51C8EF0FECBD9EAB78071775C3B5BEC357008F haroldchapman
1,666,285,935 *AF54ACF6F7EA4C8BF98F00B358DB2C76F465E817 THATBASIL2008
1,666,285,936 *AF597CE70106BA201B7B2E4CCAA2C242606AED78 THATSHAZAM1986
1,666,285,937 *AF514942E515D9BC22D661D1F77A10A9C2390728 joshuapagliaro
1,666,285,938 *AF50B3D6C755AB09D14C44287A31F2F3C5E9EFA7 joyasdelamusica-vol8
1,666,285,939 *AF5A0335417E11B0181A9FC3C37FBE1D6F96C05A themario7
1,666,285,940 *AF5A5F022B6C6D722F23E564408A493E7EDB37D5 julesmasey
1,666,285,941 *AF5561AA6BED894622D3FB5A4E0FEFCFA86A1F3A JULIENOP1
1,666,285,942 *AF5DF5449368551961CF57612A1510642900088A juliusmordaunt
1,666,285,943 *AF584A3FB69A2E18E1FF9329F81993560C5DAD90 the-surrey-with-the-fringe-on-top-(feat.-helen-o'connell)
1,666,285,944 *AF5192F11064E8932E865AF40C65BFFEEC9198B9 [email protected]
1,666,285,945 *AF5B66708E1F7EED6DEFCDFFECDC174BF59277FC THOMAS.MONINGTON
1,666,285,946 *AF510BEC08C8496588174FFD137CB141B6F2BB63 jy?i
1,666,285,947 *AF57DA315DB836924FBE55FC6486A0B7024F6EEF K1234567890123
1,666,285,948 *AF555C73419686CF13CB894255641388648BD95A [email protected]
1,666,285,949 *AF573C97E874608B246DAF81209DDD1CC6C1DB59 HERKAUWDEN
1,666,285,950 *AF505C131FB0894C6DF5A4C7849DDB67F98CB242 kanzlistenstelle
1,666,285,951 *AF588D38C938D9018D524EF4CB55803FDA776283 tipillos
1,666,285,952 *AF57E25DB4860DD156AAC0EB64AB38CC904AA667 hilariokirchen
1,666,285,953 *AF575411EF484BBD93F42A4DEBC2C185D05593DC HILLSTALKGEORGE
1,666,285,954 *AF5F139EFD90BB63CA6833E8870BC78CF13893B2 TJATVYC9
1,666,285,955 *AF5920D805CC59AB7310D0DF13DF3C41D654C573 karoly
1,666,285,956 *AF5EF58CC16D6166DB3A293FCEF872DB407C3361 HISTORYOFMICHIGANGARAGEBAN
1,666,285,957 *AF53455BD26B33D734C3E23400834A6838A2C406 tomjamaica
1,666,285,958 *AF5ED67FBC68225259E0DD2903C4E6B1D8AF8104 K.E
1,666,285,959 *AF5939BD25B3EA924BEE2918BBADE6A8745A5492 toryrepetowski
1,666,285,960 *AF5FCB395C8DC98BB7CF72C9C1181C9D407F4ECC TRACY-YOULLNEVAFORGETIT-SULLIVAN
1,666,285,961 *AF561A6D3F250338778156A1C07A06D188FEF27B [email protected]
1,666,285,962 *AF57CC72CC03B148CE99976C4F36BB4DDB49BEA0 traedet8
1,666,285,963 *AF576F24578649762FA3850E5D39CC4FCC987052 KENETHDELENICK
1,666,285,964 *AF5B4A4FABF70560116BC9F33CDAB484B80233B5 KENETHGRADLE
1,666,285,965 *AF53CBAFB65C77C6F79D1A1062B234F963666DCE kennymontesinos
1,666,285,966 *AF5DF24405222D530FA330D5C9B80E75B76DA792 KERSTYNF
1,666,285,967 *AF5189FBAA0B1916DA81021BFDC4EAE54EE536CA HOTAIREXPEDITIONS.COMWWW
1,666,285,968 *AF55949F500B5D574DEA78B4468C7B0C4883F2E9 TREVOR.GHORN
1,666,285,969 *AF584C926E8878865D19C2BADBF1E0508902A974 TREYSOMAYOR
1,666,285,970 *AF5739E5E8924155315FBC50B0D57B1058BC97B0 TRICIA BUCKLEN
1,666,285,971 *AF5B4800F4D5EE60408C24B475A623D67EE4EBD7 HOYTPOLIQUIN
1,666,285,972 *AF5152F670E6C7E6CAD37B993AD023ADB08B19C9 hsadorc3
1,666,285,973 *AF597B9B125A5ADDE430D209C985420A07457139 KIM-UNDERWOOD
1,666,285,974 *AF58D74F4227ACBF338686599886A563FD35DE73 kinesthesia5
1,666,285,975 *AF59FFC2EEB560C1381FA19537E5A6B63E76AB44 kippesoep8
1,666,285,976 *AF5AE7F5A2EA342A75FE95D72A07479E3A5ADAF2 TTOKLOOW5
1,666,285,977 *AF5ED00D570C9C3382321454C3DDCAA331347AB3 koszuli7
1,666,285,978 *AF57E7F9E02AF2D94DBFE3FF8497C6A028AC61FB KRAIGCARRENO
1,666,285,979 *AF516A427B4D00157AED21C5814BBCC1A11A7EE9 KRESSBERG
1,666,285,980 *AF55E311F50B799DF7E41972B0514C84D0803DE4 KRISTENORTEGA
1,666,285,981 *AF5F92387173F5BC1CE3C9888D3C15F72D34FF05 KRIXPATROCINIA
1,666,285,982 *AF59F91C172AC071555B930C825F73C9F0E27499 ibrahim.abdel.hady
1,666,285,983 *AF5BA1DB22CB4319949472DCFD11BBC768958A07 IDIDBBS
1,666,285,984 *AF569A2B3644D70187898986ACCC8B4F537DEC8E [email protected]
1,666,285,985 *AF59E6CB9E24DBB0B0BAA9F18F3E094BA89F7282 ignaciorobidoux
1,666,285,986 *AF52BB5224EFFA532350409FF6C8E1A014E30282 UKNFLAMBAK
1,666,285,987 *AF5328459F8C7F41090CD2809AF4F71D7D5A81CA ULTRASCHALLSENSORSES9
1,666,285,988 *AF5F3A89DFA9EE9D757238753FB33B80098A326C lamb's-polska
1,666,285,989 *AF52F3C4924D66FD442E49D365D9ED452234656B LANCE.THORMAHLEN
1,666,285,990 *AF5AC5F462DCDC9CE552978F7D71A75706796A8E i-know-what-you've-got-up-your-sleeve
1,666,285,991 *AF59B19AFA65EAA59441C0354DFE00D0F2C3E577 la.tasse.de.caf
1,666,285,992 *AF590193581FE55E4F4B954F106EF6D06FC6268C unclasp
1,666,285,993 *AF580F3A55DAFF8B22499421F4C09BA985DF79F3 unproportionally
1,666,285,994 *AF55ADE1A0265F67E113484C0F8B49A4CC21D002 ILUVMADOKA70
1,666,285,995 *AF5FE814D7420B277A065946A844ACA6FE7ABD18 UPONDETERMINED9
1,666,285,996 *AF562393CA920A8E6627EE38FD7906AE8B933F99 UPROSEČAVANJE
1,666,285,997 *AF58CA785884085FF57B1687861CEB6A1E0199AD LEBE-WOHL,-GUTE-REISE
1,666,285,998 *AF5ECB2747AB342110C386EDE848E1F90809F7CE IN-BACKPLANE
1,666,285,999 *AF5FC5E14E2F534B5F727448465C7FF7C7B89A39 LENARD.MATHESON
1,666,286,000 *AF59CE3F1A74E858C565C5D75B19ED7B6910FEBC LESDOLAN
1,666,286,001 *AF51FBAECE269511F2FA670B9BB08365EBE4F543 LEXI-GAVIN
1,666,286,002 *AF56EA32394CAC2949C7FF43F2380BA4ED8F56F3 lfli
1,666,286,003 *AF563098F7AE5BF6289930D8D68EB64D7E6005BB [email protected]
1,666,286,004 *AF5BD15BDF66CEB78F386A3119C333A6BA12AEFE INNOMINEA5(IV)
1,666,286,005 *AF5F7399B8F2B6D9DB0655EF559617783A52CEAC [email protected]
1,666,286,006 *AF5A0818ED2CA4F30D50C4B72533CB470FD3A6E7 LINDAMARTINANDERSON
1,666,286,007 *AF5FBD55CE009CF7DCD6F6E612639D8B4B37C4D3 IOLOGIAS7
1,666,286,008 *AF5BCECD9D3179BB0459018028743E14870F15FD vaudevillians7
1,666,286,009 *AF5F87E092FFC97F7822CBC7473EBC8BB0BA784B IROKAARTING
1,666,286,010 *AF5F223BD7418808CFBE9BB356A6C694FD17B823 ITIATSAL
1,666,286,011 *AF541A6BDD8E071433AC7D3DECEA5FF21968897B [email protected]
1,666,286,012 *AF5FECA053D027FE0017D8A46E15811D2F5BCCD4 VERRUKKELIJKST?
1,666,286,013 *AF5ED22C305ABAEC38AA8C39BB420498796B0373 [email protected]
1,666,286,014 *AF55D7E4F87771A88A398D56573A93DEC856EFF4 victerz
1,666,286,015 *AF570C57770D44AE80DD53141E6133B2E6D0E8B0 VIGLIACCHERIE9
1,666,286,016 *AF5726F0E05568BC8B6E8D93A0010DF48E28DEE8 JAMMER87
1,666,286,017 *AF5FB870AD91E444FB06B70249205AB6F61F7E5E luke-hardman
1,666,286,018 *AF592E764C2DF004A613CC4E057417379335E37A [email protected]
1,666,286,019 *AF51542651C811E2FA51DA8B0A72D5EAFA423F06 luopuja5
1,666,286,020 *AF5961B11B50DC0FB51D3B98408578D42FBF881E luvmochabbs
1,666,286,021 *AF52575E00E75242D4143C17850A49504B81FA26 JARODMOLANO
1,666,286,022 *AF59DC31FDF15CAC120E5B14835858BECAA165F2 VINTON.VICKERS
1,666,286,023 *AF5EF725840ADC4FCDB2A1BBF63512B446CB5244 JASON.HASSIAN
1,666,286,024 *AF58C9EFDB064948556B341F30C90CAF6BDB15EA m4$t3r$3
1,666,286,025 *AF5FE4F723164FAC30F858BB08AB04603B6F25A3 maanj{ristyksiss{
1,666,286,026 *AF5D09EF872EAB1A0D5F6F436141AA6445AF08A9 MAHKOTAANTHEM
1,666,286,027 *AF58A55EE0854BF9572C66053E4030716963D24A JEANELVIS
1,666,286,028 *AF5AB33B472644A3A9EAABF4C272B93A58A62B5D JEDHAAGENSEN
1,666,286,029 *AF5B9DCEADA747DD62A27F8EFD0F2ACB15B9AF16 vlf
1,666,286,030 *AF5959FE103856D030628AEDA8017D0B247256D2 JENIFERPOTTER
1,666,286,031 *AF59E93DE465A22367AC6C4204A6632A6AB1A706 [email protected]
1,666,286,032 *AF554B8F684FC60F31EDB388B998ADC089D11ECE VOODOOHAWKEYE
1,666,286,033 *AF5D1C8E079680B0613B0B21C9A05B97B2C05BD0 JEROME185
1,666,286,034 *AF52121A034B44AE43AE10B3000850E985E95324 wachiraphon.sinthavathavorn
1,666,286,035 *AF5F999AD1B383B7114AA854D6CAC8B5C154C04A wachspress
1,666,286,036 *AF5BAB45A0FACB6AC1CF5CBA181F1E5914D9D212 wagggs-belarus
1,666,286,037 *AF5B1C808E6574C161EA00D6925C27C4A49BA1F3 JEWELSNEWS
1,666,286,038 *AF5E79AED5E2579C3102978219F13F393610B030 MARTINDUROCHER
1,666,286,039 *AF5903C4473360806D83D1E96A676D092F1DF0F5 martinoe
1,666,286,040 *AF55F67F5187C957BEE4104E7EC792B238911A12 JIMMY.GLIDEWELL
1,666,286,041 *AF55D9C302468511BD4DB47B4708B4C205577ABE masowkis
1,666,286,042 *AF511D0586DEDA209590B1396EB28D929B390025 MATTICOOPER
1,666,286,043 *AF5CD97874DB7789813268B7626BA7AA892FEEB7 MAX-RAPP
1,666,286,044 *AF55D1B4892939817E5E0ABB01863026DCD5DDE9 JJ|4
1,666,286,045 *AF5B25A11AAA08C53035BBAF10E41F2E2C7D1E83 MBABRAHIM
1,666,286,046 *AF55634003CF03EB3836F0302E3CCCCD9CEF6356 WANDERING.CELL
1,666,286,047 *AF5C543A962ED0F9B1E26DB37105B955DC358202 johnathonchristophel
1,666,286,048 *AF5632D746E104DBE37897A5AFF717BF36A648B2 JOHNCHAIN
1,666,286,049 *AF5C376CA58DD13B4A403C231499EB17020896E6 ME.DISPONGO.AL.OLVIDARTE
1,666,286,050 *AF542977E981A0FD56A4464560AEB420A10C6B65 MEL1COCCA
1,666,286,051 *AF5131D08466ED4D73718B82B49263142C5BDF9E MELLOMANIA, STEP 03 (DISC 2)
1,666,286,052 *AF520AD47B1272D7E466A95E94709D5EF590CA61 joseortegacano
1,666,286,053 *AF5FC8E47DD384690CBDE8D13B97BBDBD141CEFD [email protected]
1,666,286,054 *AF55C67876660E7BDDF7C93004B05EB1910F5EFA joshuamangione
1,666,286,055 *AF5785B6C624B33E8A8656E5AE972BBF9D5A37EB weniwwany
1,666,286,056 *AF50AA1E0F77FA0A3A6AF94B33DBBA497EE31CCA wernerpalek
1,666,286,057 *AF5E2EA3A436CA63AE0A74322852B7766E8B857B MERLE.SOREN
1,666,286,058 *AF5595C40BF48E03B7244361CD131B1E0A9A4FBF MERVIN.FULLEM
1,666,286,059 *AF5111F210D36F5439B7999CFA517DE9BF3CE707 MESKIING5
1,666,286,060 *AF50015767307C56FDBCE12F1BB2FA0FDD9B4DFC judelongerbeam
1,666,286,061 *AF550122B7DD229773772B5A086388BA97763513 WHYDON'TYOUCOMEHOMEBLUES
1,666,286,062 *AF5416D3721B372AEC97D3302691CB1DDF6936F7 micheldecarmine
1,666,286,063 *AF56E7F708F5CF5FA0C9DED13963CD8EF16B1E8E jusformejusforme
1,666,286,064 *AF5CD58C114454F99E251FD5D3EB7E66ED646211 WIDYZA MANGUBAT
1,666,286,065 *AF52DAAA5755405834831219419DA02E017BE988 K0NKYLJ3R
1,666,286,066 *AF5B31B0791E92E180EA3840161982CAD68AA3D1 MIKEYNIELSEN
1,666,286,067 *AF5AFE8A050E9015510A90ABBF3103FF55F8E956 KANANDED7
1,666,286,068 *AF51BF800C06BD8DCE8C6234A7FE6023F30D9236 wilsonhinnenkamp
1,666,286,069 *AF55F3258D4B190110A5406724EE411806942916 WILUJEUNG
1,666,286,070 *AF5A7AA62AED5E7409FBA55D044D0AF36A97E022 KARETSCHILDPADDEN8
1,666,286,071 *AF5B0E90028662A9DC61399435BD117176F2326A WLDVRMDN3
1,666,286,072 *AF55B74EFCA77A8DB6C2AA89F8AA103F961EE524 KENDRICKHARBOUR
1,666,286,073 *AF54BFA0F99AF7D92EE6D2EED77AEE192D02470B wwwpurchaseaddorg
1,666,286,074 *AF5C6126C3047278328B00E88CC862B1F51A2F1D WWW.RUKEYSER.COM
1,666,286,075 *AF54D8036C595A021F341EC23D590B7873BEB008 [email protected]
1,666,286,076 *AF5E84F0880DD8EB72F0B626BFBBCAF405A5CECC KEVEN.SISEMORE
1,666,286,077 *AF58766CA6C2D735363FC725A6E45C231A4EE406 [email protected]
1,666,286,078 *AF5CD2A17F825EC7EEBCCAF831AEB84E89CF3495 KING.SWORDS
1,666,286,079 *AF561F023106C2680039267EB7A02403EC82F547 MRDIDIERSCHUTZ|SWITZERLAND
1,666,286,080 *AF5E9E95AD618F4E583033D77B4A57A8C19F551E kirchenregimentes
1,666,286,081 *AF51E3E6F59B2EA763C32BC7B965A492C334619A KITE92
1,666,286,082 *AF5388086427D6F4951547B54A33ACA7E60DC1B0 klijentas
1,666,286,083 *AF57A03DB9942CF68376DACEE5520400A58BA994 KN-339
1,666,286,084 *AF5034E3ACFFA7C3D511618F52C7167336AE79C2 [email protected]
1,666,286,085 *AF513F6181442BA6A665FFC5F16C327B8EAA1E07 KOFTENS4
1,666,286,086 *AF54B5CCF06B9BE6312C8F591EE69E39EE8947AF KOHLENSTOFFARTIGE
1,666,286,087 *AF56F0ED6D5EC1B82A2CF02E471672ED18939FDE konvektion8
1,666,286,088 *AF5924801E9F50443980573AFB4EC608AF3D2F0D yffaham1
1,666,286,089 *AF52901A16C2052E16C1C8968A496DA6807045B5 MusicalInsignificance
1,666,286,090 *AF5520290A691A2F6510F83957F46DD84D8DD3CE KTSK
1,666,286,091 *AF58503FF9669DEC59725D225D6DC24C3FBC8011 ystrngsing
1,666,286,092 *AF5BB9015B1FB2FFF740F01A703EC5B21AAFCDB8 LabradorRetriever
1,666,286,093 *AF5E87F9215897984413767A49D29DAD336553BE ZABO ZEDUNKOWITZ
1,666,286,094 *AF5DDEEFC949EB8FD99F019523443271A3089081 l’antarctique“
1,666,286,095 *AF5FA61E0C8854C02B460687F9E4E26103763D40 las.tres.ninas
1,666,286,096 *AF5EA2B650FBC01881D44BEA30BAC78C3588F33D LATIN5289
1,666,286,097 *AF5DD7F0A6863900907A7F9DC448A0A1FCF4A00A [email protected]
1,666,286,098 *AF53334F29B5DD0910BAB97FC2B1FF6E15A336F6 ZARA STEVEN
1,666,286,099 *AF56A7BDF49AB5525B7EC30E540E8C605F6C43EC LAURIE FRIESEN
1,666,286,100 *AF543ACC22421AC7DF1F9064641E0DC62714BCCC laurie.tuckman
1,666,286,101 *AF54D5ABF8DCAAA88E0B1D4BA3947D46E9B8ADCC L’AVANTGUARDISME
1,666,286,102 *AF5015128686F93F9CFC0A34A1FCF80BED0B5DE7 MYSUNDAYABC
1,666,286,103 *AF50B5A4F5A373C62D21F0D64A542F66A7901B4D LAZARO.HOAGLUND
1,666,286,104 *AF5FA01A9BB91E1055005498C1F06069B50CC577 [email protected]
1,666,286,105 *AF56A49FA41142AC073632C98DBD7E71036749D2 LDICAY
1,666,286,106 *AF54A4D5C227C0F2FBE4A4D4DE935B4734E49F22 zeusdoc5
1,666,286,107 *AF5B05BF2F428EB6B8F28606A9EB73DE25D3F4C1 ZIIYYN
1,666,286,108 *AF5A2B92A70AD4A6AEE3BDFEC763097EEDEE8065 ZIONLANDER-DELEON
1,666,286,109 *AF5912BC2B63E53E64D33C81CFA7D804C9094822 LENNYMCMAINS
1,666,286,110 *AF51D038E6212A289AC1C4AB44C0046CB5875FB6 LEONARDSTOETZEL
1,666,286,111 *AF5C7ADE6AC134DE14850D95A4F8DDF64B445327 leskol
1,666,286,112 *AF5105801AF3E9FCE9990FD478F52CD1E8C77707 LEWIS.HOLSOMBACK
1,666,286,113 *AF50A5F9D40E1822A609D8F21B48467E6498527F [email protected]
1,666,286,114 *AF5C6EE34D8A7A62FF9499FFE0A5AD9F02A5F29B ZXCVBNMANNE1
1,666,286,115 *AF5EF529699CE4770D7306993A5969A7EE4B97B8 ZYOUYATO0
1,666,286,116 *AF50B3B6B854E97BB57ACD543F85C9E0312E1693 LIMICOLOUS8
1,666,286,117 *AF5A0AAC7273CE62AE1094DCE78C063702A12EEA NEPITKE7
1,666,286,118 *AF5B7AEC35E8BB7C1EF82B53D12D9DE5730CF6FE neprestanu
1,666,286,119 *AF5DC36EEF1F22654FF0243CA854E92D35B63D50 [email protected]
1,666,286,120 *AF5FA824D3B4ADAFABF3681B7C9F92653CDF80F5 [email protected]
1,666,286,121 *AF5435024C0D46C173FBBB264AB6612CCFB71998 NICKOLASAHHEE
1,666,286,122 *AF578420ACBFF9C1517551B57FADE3854BF7A9F4 ГОЛОДИСКЕ
1,666,286,123 *AF5FEDC1EBB5B1A4D108D71937B6E6E352A8B4AF ИЗОНТИНО
1,666,286,124 *AF595182417415A0B57A202B263E9BE23157F9AC КАСТЕЛЛАДЗДЗО
1,666,286,125 *AF5B77AB176676B4E608EE049FC3C76A74A89A49 nnspprtv0
1,666,286,126 *AF5E87BBE60B45AB16BBEA49B09F29D3B3F5C509 LLOURI
1,666,286,127 *AF58AD00B248D4770A81762F5CAF0A1706481895 nonflagrancy2
1,666,286,128 *AF54B426DA5DEB52A673729DA649B77A69A8651D now.and.again
1,666,286,129 *AF594DC1E0C3A104CA7223BE4A80442F6F2C3154 ТЕНАРСЬКЕ
1,666,286,130 *AF5B9A04A9AB16F3ACE6A8FD8EE52E6BA35A5421 ФАМИЛИАРНИЧЕНОТО
1,666,286,131 *AF5514513FABFED4DF4B3413A7EBF5AE20D7C932 LUCIANO.RABERN
1,666,286,132 *AF5B5262200FC311E9D2BA6A6CE32D0C3120D269 LUGAREVUS
1,666,286,133 *AF5D3D0B0D612B7A96C68046045534D43435A5BA OFERGLICK
1,666,286,134 *AF565E60D917364BA3E78AAC363FEE54C38A4E25 OKAN48934722100
1,666,286,135 *AF5E01288FA8243E53835160E638ACCC91625BFF OLHADASED
1,666,286,136 *AF577AD2A55D8A28F65D934ECDF2FC156795DDC9 [email protected]
1,666,286,137 *AF5CE09387ADC19172FFA09B2F08F9DD0F1963D3 LYC4N7HR0P1E$
1,666,286,138 *AF59908335E5C659C4EEFFCECCD6B33CDA8FC7CE ONS-DE-BELLES-MANI
1,666,286,139 *AF5854FB06F83F333EAE116542D193E83994AFE4 )O( o~ 0~q3
1,666,286,140 *AF5CB744B9A9C05112381EFF03A3731FA862990C MACHARROWER
1,666,286,141 *AF57EA74BB5759FF444F2E1B00CF64644D0B518C [email protected]$
1,666,286,142 *AF5C126837B027193735089005DE8B69460B4B28 maidonk2
1,666,286,143 *AF5935E12AAB3BA2AE9029710D3FD13269AF95D5 OSOGNAS
1,666,286,144 *AF5890A690F27ED9C05734013C7980A6510B2BAC manchetten!
1,666,286,145 *AF5148AEECED2575D81479994AC2BC75B2C947C4 MANKÁM
1,666,286,146 *AF5C7947A83DFF91DAD71EA9EC0CE8FC949E52F0 manstave
1,666,286,147 *AF59143D62C847011D8E5FB0209E1FDDADCBEA2B MANUALTHIESSE
1,666,286,148 *AF5166558149A5C63B42A32B6F9DCD38A81BCAAA overdemandingly6
1,666,286,149 *AF5866C51A8897514535E2F1DAEC9FF677D21715 maradesenadoresuruguay
1,666,286,150 *AF589F7CB970D1DC87DFDF856E22031A085B12DD oye.me.guaguanc
1,666,286,151 *AF50378953EC4B72D3C67A464D77E3830BE8801D marcelinokuchenbecker
1,666,286,152 *AF582033796113EA29BA6886E1804C8773496B8D P->.~.~(0_<)
1,666,286,153 *AF550AACDCDC2C0D96BD87A38F63D3F49FCEC284 P=====)***~0~o(~_^)
1,666,286,154 *AF55B2AA91CB28687EED8BC4C22376F9DD0F87E5 [email protected] ~0 }O{
1,666,286,155 *AF599C8F3AC52997D35F4B4B5495CD1245922518 PALATALAGAM
1,666,286,156 *AF5114DAE132F441DBFC9B39B17C001EDAC0B1BE marquisyarbro
1,666,286,157 *AF57AD299D95B7FCE36EC39EC45BD92FF5A1C64A MARSHALLMATES
1,666,286,158 *AF515CE145E48F1A16E6B9F22E21A9ABC1752B51 PARAMITA.DEB
1,666,286,159 *AF5185F6A633E2D3558538BFF174009038A707FE martinbreslin
1,666,286,160 *AF55A3FF11EE00C5F1348AAAA9670AD8996142FC pariswiza
1,666,286,161 *AF545C019F5A2BB7299F29BE037745A756298682 MARVIN.WONGUS
1,666,286,162 *AF54F839E952DECF201EE64895CB333AA2506D92 )経路、pi3k(phosphoinositide
1,666,286,163 *AF5BC3BC5A5AC2858FBBF2883D0223F451A54656 PATHODON
1,666,286,164 *AF562E8E17E60EF64EF26B96248138F0F6365103 patriciawheelen
1,666,286,165 *AF57AA736296CA26328EBFE8CA0C9552488573D6 MATHS137
1,666,286,166 *AF51480384EEFF689BE65B6B9894B6241AE83249 MATTVYHNAL
1,666,286,167 *AF540FF172E762FDF04C7B23069DEDD210D738A3 pbgs
1,666,286,168 *AF50CD452A60F89C96876B3B38BCFAA3D760CE32 MAXWELL.DABNEY
1,666,286,169 *AF52EB8FAB8E70911967B1A8B5CA4931D700FB18 pebbleslacrosse
1,666,286,170 *AF5CFC51597CD0903D868FECF5AF4AE9D7C57765 MCINTYRELAURENTIA
1,666,286,171 *AF5D7008BD9AB973EB8E285363FD12EAC3E34DF0 pelargoys
1,666,286,172 *AF56F9D5F52A8FC1F3ADF4F65B08A04CBD4A1A74 MEADOW975
1,666,286,173 *AF57A41A46492CCB4078C179EC44C526AD0CF057 PETROSYANĚ
1,666,286,174 *AF56092BBF500C40C4C3D61724DC831367DADE70 PETWORTH340
1,666,286,175 *AF59A7B767D32692C05D7B94C7B2622DDFDEFF28 MERESAMNEWALIKHIDKIMEIN
1,666,286,176 *AF52B8EA6FF478AAE6B1184B4A24E7A518A80462 PHILLIPGRILLO
1,666,286,177 *AF506C338258C892BF06F539E6E8B8A5AB7B385C PHILMERCURE
1,666,286,178 *AF5902E0284CD1ECD08E5F0FBEB4652092617B49 phredphranque
1,666,286,179 *AF5372128129E52FD2503868A085FC57D36DB8BD MEYSAM-ZARE
1,666,286,180 *AF5813070F56C1F731F5F9B21B3129C5539EA17E mfinlandonly
1,666,286,181 *AF55E2E7C7EC64A18B35FA138A1E8E6535AA33F1 MICHEALPINNETTE
1,666,286,182 *AF53486C3060C6EAC9FB4A9D274A9016DEDE4452 MICKO_SRBIN
1,666,286,183 *AF5DD628403064F68255B7B2AA994BAE0C0572F6 [email protected]
1,666,286,184 *AF519945EAC7DD188937EA8EC789DB221D8E4626 [email protected]
1,666,286,185 *AF560BAE8CC900AA38DBA56208C5A0C1E912A97B POLEC.ZA.MNA.WYSOKO
1,666,286,186 *AF5DD2B2D16B27BF93755D64F5261F9EC69E6202 p->~o~osploit
1,666,286,187 *AF5E67A78F891E82CF650521A7B11E96C66F58DB [email protected]
1,666,286,188 *AF559D1C01D10B7272D7CDFDA6B426DF09B3CFA5 POS-RELATED
1,666,286,189 *AF5754EFE9B00341384B444F509664DD3DA7D3DF MMSEN
1,666,286,190 *AF54E9EBAF46410E093D5946122CFCDFF072A482 pred0m1n4n+ly
1,666,286,191 *AF534174B73660D1197664994237B54130ACD311 PRERIOS
1,666,286,192 *AF55F015603C6B3770738D2617E8239C0A0F9A0B MOHAMMED.RYSAVY
1,666,286,193 *AF59BCDB7163EE4BAAB703129DE80B461A616BA7 molson13579
1,666,286,194 *AF55370E7C0E5C9230A721954F460DE74611D4E6 Monday.club
1,666,286,195 *AF513374D3B06ACA64697F29AB48AA54FE7DEEBC monomernu
1,666,286,196 *AF549ABE56C4491477FD5B2645F570A32C5297DA progettava.
1,666,286,197 *AF5C62BA51B67D3767884E94231A4388A55FE4CE pseudoblepsia5
1,666,286,198 *AF513880987AD5002B30E99B90A54F2E36167529 1adlandIrmalarI
1,666,286,199 *AF5CB98E1DFDC7E36B75A5880ABE2A28680C17F1 1 AKTIIVIV
1,666,286,200 *AF5A5F51AB292597FAE431AC4A63E50E84D4F70E mundeya-ne-gal-chakli
1,666,286,201 *AF5743C660DD030E3832A308C971D3A054DE396F QCATKOU
1,666,286,202 *AF56BD7F2178EF7A0311F478C9D3A4952B5FB4CE QM8N
1,666,286,203 *AF5BDEDC9FAD8D83AE5E1BC9C0FD7198F9099CE6 N36342
1,666,286,204 *AF54152947DA571BFB85036C51260B9D9AC8A2F6 [email protected]
1,666,286,205 *AF581C0EF958057E60708D105353F18E3EB4501E r30ri3nt3
1,666,286,206 *AF5224FDFAC4D97A3E116244F0A8EE981F67A541 [email protected]
1,666,286,207 *AF5382FE5DA7E41D7C216E80804F01B77F39EE31 R9M0J5FCA
1,666,286,208 *AF542AC980D10CBFC2689FEBF93C103DAC9E9120 1-KOLJONSAARI
1,666,286,209 *AF5CCC7AB772989F78F72E77FC9ACD8983CF717D RAMLUGUN
1,666,286,210 *AF5D1C2BB77C0ADBF611AEEA06D6408764D46D4F RANGALIBAJNA
1,666,286,211 *AF54D317DF909DAE87187B1AEC9C3D5BCC2D35B6 rapid.marui
1,666,286,212 *AF563D226B604338DD98158A83AF9614FD20C1AF 1-ningen
1,666,286,213 *AF5B4B4B43AB80A78EDEF4B1EF540B4E29387094 nealsuvada
1,666,286,214 *AF5F8411443577FF3D64FDCE28BC492D47572E8F 1PARCELL
1,666,286,215 *AF503DF84390C349CB6233FBA8D2400F83EA3EAC 1pistoliamme
1,666,286,216 *AF5072DFAF9523ED5D4AE12E0FE6E6A52B2182FB 1.puvustajista
1,666,286,217 *AF546F2D1DE9A25D0C13F046DFEDE8A33212F8FB nekole-avants
1,666,286,218 *AF59A6A8ADCB26FC2DFEA014CB25A0B9FB77482D 1-rumpurytmi
1,666,286,219 *AF5151C1D4E2C4F0DE7E21B9F0A8035A6C2328B0 raymonbailey
1,666,286,220 *AF5AAF60FCE7A1E71B6C3816A555702022E23FAB 1satoietenkin
1,666,286,221 *AF5B31E661C22B6C4E8FDCBDFA7E9FF2E77BFD06 RAYMONLASTELLA
1,666,286,222 *AF5BF0B23AC7C2EF0448EE7B34ACF2B97BEB577E 1.sfb-stadtradio
1,666,286,223 *AF5F3322E5CB4B0F392161C4A899F16588A921AC NFO1D3RS
1,666,286,224 *AF508F87F104491665C3642ADCED5D31A5594B91 realzado7
1,666,286,225 *AF51E3C2CE12478C36190EBCF670837B2B700031 1THATMOLSON4
1,666,286,226 *AF506CB2D02FE5F5CE8B8DD5668F328B3002D206 2005年:SBS演技大赏
1,666,286,227 *AF5F0D10C726160F68646C9BCA017C439E03E755 20GUIB
1,666,286,228 *AF592EAF020B214AE53741EA9508FDD6A7D3BC41 REGINAHF
1,666,286,229 *AF5C3D26630D65D27DB30F915A7703C359622F83 reinaldolafevre
1,666,286,230 *AF58D4119054423D1391F24D1D63C5339A0E20F0 NKRLG
1,666,286,231 *AF5C47A0FA60D84CBBC970DA0713C7AB066D30B4 [email protected]
1,666,286,232 *AF554FA96E548878BB85065B507B9A1B74A68FB1 NOHA-ZEYAD
1,666,286,233 *AF50001FBD6E7BC3E0A648CFD897DD42B1B94CB4 no-less-than-a-crime-(prelude)
1,666,286,234 *AF5648CA0B977D65501D7B9F4A2D293F5A2EE00C 2-CARTOUCHERIE
1,666,286,235 *AF53FB50FA507F522E452B87E805D174FA960001 restrainor
1,666,286,236 *AF5CE316A9032D08F754F9E3DCDF3C39CF979F79 2IDOLEGGIA
1,666,286,237 *AF5187E27F0656BEB69FE99DDEFA41FD6A0A1368 reyarguijo
1,666,286,238 *AF5D9436D5B2EC5FA4940A244FE2D997F423BA60 NORTHSAL8
1,666,286,239 *AF56A407C5A46BC557DDEE0D30600B408B7611DC 2OCHENSKI
1,666,286,240 *AF5484B604841F5060EBF08020AA3A51337673D9 NOTYOURFIRSTTIME
1,666,286,241 *AF56A5459B728D06D21E803B5E6ED8231B3D5E6B [email protected]
1,666,286,242 *AF595174B72F891C9B37980086FF1D3F77E90B41 RICARDOKENNELL
1,666,286,243 *AF5287270FB5881E8A8C139B19B2B23897C07260 RICHARD.FRANCIS.&.NEST
1,666,286,244 *AF53CF3B556E842E4E9EE444DEBB73F49575488A o5cu14t1ng
1,666,286,245 *AF5F2577BBDEA43AE14906B0D85A2DBAF40EC1A2 RIMKISOEN
1,666,286,246 *AF58428E414974ED2866F6D81726FC428A37528E }o{~`.~`.d=p
1,666,286,247 *AF552A74D964BF3D27DECBA39A1027B655B20337 ROBERTEALEY2
1,666,286,248 *AF503FDCA13F40B0633E54DB5C2676F703C699BE 3FELSOKNI
1,666,286,249 *AF50AA9D9F629471844A95AC39EB6859B0084DBD ROBERTVICARIO
1,666,286,250 *AF55CCE40046C6AE125C6ED34AAF00ED660BD6E2 3GOURISH
1,666,286,251 *AF5540AF139CDA5B7451DD2FBE9F4F89E6C3B510 ROB.MARROW
1,666,286,252 *AF5F456AF7CABD9ABFAD36272C0A9C78E5DB18CF ROCKY.SCHERMER
1,666,286,253 *AF5E94AD3434CDDAF2E80FD7A6AD201D7D5BCC10 RODERICK.UYEDA
1,666,286,254 *AF5D1B4139F30F380254DC9B7793090370A53E79 ongewone7
1,666,286,255 *AF5655FD8ECA5E654FC51BAA53E1E071EC048F85 3P~.~.~.SPLAT
1,666,286,256 *AF50570E30D718FF6562B2E5A03750899BE4158C [email protected]
1,666,286,257 *AF594298E4E704159A56402DB024CBCF9BE57C6F ROMRÊYE
1,666,286,258 *AF534745003BDC43CA664FE05C43813B53E42841 3.ZAMPIERI
1,666,286,259 *AF591B8C36CC0A3AD73149199D074D27D0912A81 rosalie-tiongson
1,666,286,260 *AF5C9960A2E010E0355BA55EA9342F6F4290BD70 rosalynlau
1,666,286,261 *AF56215AB7612D06031534B3C220743686131ADD 4-cassis
1,666,286,262 *AF5811F420C6364C2779BE7341CA0E0FE3DABF2B ROTC16
1,666,286,263 *AF5E640F9C0D7A02C48A94C3353C3F4117FB78EE OV4TE$
1,666,286,264 *AF5C7EC6D3D9748800203EFD323EEAA3B57DE824 rufuseangelina
1,666,286,265 *AF55399CAE5A01114E150F7E819E6B0F65D5618B 4SANTABFI
1,666,286,266 *AF5BBE58CB867770773C11425AAC7197FEE8188B P68V
1,666,286,267 *AF5E59CB4D1A412B4E1D2C637B7E6DC135528EA7 4VASTERASBSW
1,666,286,268 *AF5ABF6824BF8981F3B24034F27F298FD06FCFAD 4WITHTREATUNDERWRITE
1,666,286,269 *AF54AEA04BDB26E5392FABDA2FE180003BC9C390 5411IE5
1,666,286,270 *AF5C01587BA7489F06F737989C7F1093E14B0C74 556404 MUTTA PAIN MIKKO KEKSII HAUSKOJA TEMPAUKSIA .
1,666,286,271 *AF5BCA1C95F3BF26EC999B8E4E382DF403ADC495 557002 denn.wozu.haben.maenner.brustwarzen.?
1,666,286,272 *AF51390301D8BF46E62AA16B8EA4E396D396E18E s5qm
1,666,286,273 *AF59D7646BB96939107A57A538E75679F2091564 PATERNELLE6
1,666,286,274 *AF5BD3F98558E678BBDB663319D213C98B93F6FD [email protected]
1,666,286,275 *AF5B5FEE5A67D75463370AED590C18DE0CA691D0 5DESCONFORMAR
1,666,286,276 *AF5CAD0AB72AA88699FE22DD1F97B8D9567B4D48 SANDRACHUPKA
1,666,286,277 *AF5FE080A41FBDB39E7E8AA66153BA04620AFDF1 sandy-kirby
1,666,286,278 *AF54DFE11618523097124D13F3B911E2E0787B9F sanjapantelic
1,666,286,279 *AF5439A68928967F091539B34FDFA844ECA516F1 SARAHMARTIN-LAW
1,666,286,280 *AF57C0D3D0C1E998F0F83A33B81B2F30477DF7CE PENG0612
1,666,286,281 *AF57AD280D4F320FC61E87600DBEA24488FD0513 Say.I.am.dancing;.if.in.mirth,.report
1,666,286,282 *AF52AA5811BCAF0CD0E6B025623E9818DD51C72F 5NESSINEFARGEB
1,666,286,283 *AF52B206DB3D7F355E12FFE205F52878AB0CD43E SCAPPINGS
1,666,286,284 *AF5E1BC3DE1CDD06B947BF566B2D48A224365BEE 5NOPENNEPON
1,666,286,285 *AF55F61D0E9121856D02727BC09404AF2934C28A 5PAULHENDRIX
1,666,286,286 *AF597CD5D24BAE329B92E482159BAB591719714C 5SNICKERSCOLLEEN
1,666,286,287 *AF5041E128458AE6BC063D8B2C400E239982A643 5th-avenue-blues
1,666,286,288 *AF53FC31E5FBF84F92E54FCD763AD3CB295B4CBF PHLAYERBLOGSPOTCOMPHLAYER
1,666,286,289 *AF5EB9CFC68C6BAA2F61395ECF3D1CC4C1FEE3CB 5uitgeduide
1,666,286,290 *AF58BA09AF3E4870B06425182E05A04FDE6A7785 PIERRE.NALEPA
1,666,286,291 *AF554E14AFDAE17DF470B707D8FA2CFC3A7CBF24 seguiradelante
1,666,286,292 *AF587C507EF587FF42174F2C696C73F058D9EC9F SELFPREPARATIONN
1,666,286,293 *AF5FF8DFF11C276696062874CBF86A8AFAA7A9F8 6COUVAIT
1,666,286,294 *AF5E686DB2015C84AE672F1256CC540BAF6A2D24 6datenkommunikation
1,666,286,295 *AF5D3DA3A2130897E47D4C6725D6E5989323B86F pliions.
1,666,286,296 *AF5C1782F31D1516B49CFB9830E8653AE0AB8662 policefrankie
1,666,286,297 *AF5EC6B509CEE78107D970E2C279F83F42CBB3A5 6-MUESSESEYI
1,666,286,298 *AF5DB49743779C8F44EB7E1DC7BA33461F11C890 seymourcorbisiero
1,666,286,299 *AF52B064CAA320EEA5FB3E8CC3BCB88A314AEC40 seymourcosgrove
1,666,286,300 *AF5B9419B2345F273A4A835B94CB320F55271FAE 6NERHOHRE
1,666,286,301 *AF5B0E73ABDC0B5A4A17727DACC75E1A9C2E0B50 SFERRIS1
1,666,286,302 *AF5E8B4273FCC9D68BB3C8F5D8C76146816D6216 SFZNATE
1,666,286,303 *AF538CBB3ED3000DCBB4A7D9D9FF4B583FC8C6EA PORTER.BECKEM
1,666,286,304 *AF58454FC952F0FAB85D7E4D133550BADBDAB39C 6PLODDINGNESSN
1,666,286,305 *AF5DF0DE69260676D76651D790344BB2DA387A8B pozobala1
1,666,286,306 *AF52250854D01961C94A5D32EFF03B35FC1A002C shalier
1,666,286,307 *AF596BAD9C5C5AF39C6FE38C5293011815EF1D9F PŘETLAČOVANOU
1,666,286,308 *AF5E71E337D80D60DB92919EEE0F36E3DEF5EFAC 6THISEEH
1,666,286,309 *AF583EE3F4BD15325D575A1DBB160508256E6803 SHELBYBONNETT
1,666,286,310 *AF522CFED76ABF4E4964F02B570C700BD5AB9620 6WANDAFUL
1,666,286,311 *AF5B0AE733C989EEBB3B3629C9500E9AF8107F84 709ce00282a8aa920ffa886c2b6b4fc1.kemsabesabe
1,666,286,312 *AF5388FF4774E05F2DAFDA9E6DD9341B25536B33 715497 alueideneurooppaeik
1,666,286,313 *AF5DAC8A6ECC2D79C7EBECD3180E996B3736F89F 722ALIJAH
1,666,286,314 *AF5F372F2F618C9ECA04BEC87ED37F9F464E8716 755413 bu sayede bant geniSliGi verimi maximize edilir
1,666,286,315 *AF5AF5897B1C1BED1306AAC2B4EEB2CFAB9E77CB PROBLEM?-(OWNER'S-REMIX)
1,666,286,316 *AF508718D556E011AEE6FC41FA560FC638F44535 7ALEN7LE55
1,666,286,317 *AF57E6FBDE452F8696326304DB88B21BFC652722 SHIRTTIES
1,666,286,318 *AF5313D637636CE08C6214311008DBDDD2358BB4 7BRUCEOLIVIA
1,666,286,319 *AF591678D1CCD8948F05BAF2AC063DC305D307BF 7BSWZALOKARBSW
1,666,286,320 *AF51917D538909F7F905D52BF113FEE662EBFA8D shrilegging
1,666,286,321 *AF5FD563C0B61E9A15A172C070FCE84675E4CEB5 7HITBATSMAN
1,666,286,322 *AF5823CB4ECBDB156407B589C1C5698A9A99E436 7HSIYADNOM
1,666,286,323 *AF59A578BFBBFF639A306E16222DD3AB1C456B64 [email protected]
1,666,286,324 *AF5D52D2F0863B966F24A8603FFBD5065FCE7225 7kantkussen
1,666,286,325 *AF542408817299710BADA32D6E6BD9FD9FF9E42F sirhenrywood
1,666,286,326 *AF5EAD96BC94017C6D8C4BA102E274935624CD19 [email protected]
1,666,286,327 *AF514BC97DC5992690E10AC7A2EA3E6626D09EDC 7SONNYRONALD
1,666,286,328 *AF5684D01A80A6916D55D48856EEA5FDBA6B139A QINNBJH3
1,666,286,329 *AF53D93D4372AFE23E5071A39D487255A784887D 7thesteven2
1,666,286,330 *AF53464F8FD09368A156706404A385F4C522F401 7WHISTONIAN
1,666,286,331 *AF504381A5FFFE563B242973EE44B52BD1379502 83RING
1,666,286,332 *AF5257606A054D347D00695FC4B337C6BEA2E366 SOBREESTIMÀ
1,666,286,333 *AF56855E67720FBBD9B69A83B0CB047EE89FDA40 SOETERIGE9
1,666,286,334 *AF5D5DBA3D2E52EE1DB0078B9E3939028FA6458D 872LUCY
1,666,286,335 *AF5F4DF55C143B2EAA3048804991F9FA546E808C SOLDIER2CRACKER
1,666,286,336 *AF57A96337083C92D892321C5C7DCF22B14C397A R3D33MA8I1I7Y
1,666,286,337 *AF5F5A14D9396669195FA0FD854B4A7530212FF1 8CEDICPASSION
1,666,286,338 *AF5E0D84F159BDBBCF3EA81C9168B2029E51ECD3 RABATTRAIENTS
1,666,286,339 *AF5F825204F1D63204B9419E141A3CBDDF6B8FCB sonnytauscher
1,666,286,340 *AF5A3ED42A1F2D6664A3AD383D2BC07A0DE8BA3B sophie007007
1,666,286,341 *AF5ED4E6347DB70D23E93086B1A3AEDBA1D30ABA 8FOERBLDDE
1,666,286,342 *AF5D4ABB2812354AE09FF3FE06982C46173CF3C6 SOUL.SURVIVOR.(FEAT..MAC.MAINE)
1,666,286,343 *AF5D26E16F4C37A1C55E656D49646946FC300244 SOUND-PRISONER
1,666,286,344 *AF510E6C7DAF3CBA03DA446C01E31726FB6830B6 SOUSESTIMERONS
1,666,286,345 *AF54A0FACF9477138885A550DBE72402120875EB RAMDANMOKTAR
1,666,286,346 *AF5100CBEF530CE9BAAB7627435A3ED008D28252 8ONCHECKING
1,666,286,347 *AF5136EE57080B068F38392F3A54A8B88BD95E6C 8OPSLEEPTE
1,666,286,348 *AF5B150321D1C7FAC19CD25AF2F3C1C977662832 [email protected]
1,666,286,349 *AF5F2E5256567A54475B2AB59305656771B94757 RASSRNES2
1,666,286,350 *AF5827F45AE95EF62BDA1DF46F264E479FFA70BC 8UNDEADRIVER
1,666,286,351 *AF5597F891F2A4F79B4D9C7D2A181981B938CCF7 splat 0~ @p
1,666,286,352 *AF533A9775541DC45BB7EB0F85074A47FF2BE329 REFUGIO.OXENDINE
1,666,286,353 *AF543B177F11147C7A51A848EBC9DE6BACBCDE28 999859 OHJAUSKOMITEA.K
1,666,286,354 *AF5DCB862E1003185EB104491D3D2A7166D36ACE 9LEDZEPRUSTY
1,666,286,355 *AF5685F7B7E1FAFD9C71BFC3E985ADA44C894D5E STAMBOEKTELERING
1,666,286,356 *AF5E5137E039035EED59190FBB8C6F1C9AF59113 9MUTAZILA
1,666,286,357 *AF5D9D73A81D9879A3E9507A2FBD83D11AC222EF a7zf#
1,666,286,358 *AF5704F91DFFB5C098BF38CD3BA355259D5A2EED RICARDOCARRILO
1,666,286,359 *AF51EDEEC502D320BE1BDE2088D5F56FB6699175 SUB-PAGESIT
1,666,286,360 *AF59B26E142E225D032E1C654A6C8C3959567D10 RICHARD MULLIGAN
1,666,286,361 *AF5384FC4588E3106BAE141E342A66BE46F240CC aab9l}
1,666,286,362 *AF5FFC1AB47579686C71B59D90D02C778760168F AAB>PK
1,666,286,363 *AF5C0309DC59FE6806A84F278E19A79179AD119A SUOROPMI0
1,666,286,364 *AF52C3FDDCDF45B5926AD58F0ADF48C9AD7C0548 ABAPTISTON'S
1,666,286,365 *AF5A47E80ED8C7F28D2F39CA6C232455EBAB1229 ROB.BLASING
1,666,286,366 *AF530C6A318654D7625B18DE59656B094EF1AFC5 ABE.MAYMON
1,666,286,367 *AF5262A8456B69B25847D3AE4DCA51049EC10B27 [email protected]
1,666,286,368 *AF5E40A2C598F80D2031417E51643443C68EBBB9 ROCKY.SENGBUSCH
1,666,286,369 *AF5FAE799FCFDE14D0DB2FEB1ECDBA2F9E844B5E SWORD-KIN-JIKEN
1,666,286,370 *AF5C88201367A30652AFE5785B43D14BCA36CA02 sylvesterschierenbeck
1,666,286,371 *AF57A72E5B5FE7A43E110767428DE07B8AD2E575 RODERICK.CHESTERMAN
1,666,286,372 *AF51C1D2BBBA83487F50F1098993EAB183E004B9 ABRAMWASSERMANN
1,666,286,373 *AF50B3DB7FF1A888348BAE204E04CCDED91FA7E3 SYRIBADENEYRA
1,666,286,374 *AF582ED3A85105BD33F0DD79BC9A6FA4A2E5A5BE SYSILKING7
1,666,286,375 *AF5C48F39EE20D84F7F0AC33F3E7880476227635 rogeliodenzer
1,666,286,376 *AF5EB2995D6342EAE4BC4F0F3F832EDC31CFA558 AB>VL
1,666,286,377 *AF5AADB90C817D3AADCB8952FB0550696F6526FD abw;
1,666,286,378 *AF53A3531EC56E9044E582B0BBB5EB065AEA209B TALK84.123.7.80
1,666,286,379 *AF5986DEB603A489CEF0013935A5BD7DE2652CF5 TALKANGLOPERSIAN
1,666,286,380 *AF58AAD08BBCFDE3AC3D7AC1E1DADB11082E3B31 TALKCARTANUL
1,666,286,381 *AF5B85175A9F8C5F181D39318875410E7AA24D6A TALKFSUNOLES17
1,666,286,382 *AF5C6682DEEADD7E9E30316318099E08468A2E99 rowallaned
1,666,286,383 *AF51BEE37998E92FD1E7C09FDEC55F8A4E3B1003 ROYCEBOWCUTT
1,666,286,384 *AF54221556128F312562700C58BF4BF9775840BC TALKPATRIOT62371
1,666,286,385 *AF55E57762102CCD9AFEF7C60F5F2E5FEC25199B acZR
1,666,286,386 *AF512799985EC78775CD4CEA0B0B01F6ABAA4B50 RUBEN.ROSEBUSH
1,666,286,387 *AF5E81840B071DE62C92D950EC43D899BADC2746 RUBIN.EHMAN
1,666,286,388 *AF51302E7474D8E6535E355AC4BBBC3C4B58FCF3 adesojiolayemi
1,666,286,389 *AF54152B234B69133020192D5F98B3DA3038826F TAPRUSNU7
1,666,286,390 *AF587A69C6F00AE54597E310DDF23FF45623B080 ADOLFO.CARETHERS
1,666,286,391 *AF533AD5B3202140C3A2BC9446F26783FC995AD0 rusinov4
1,666,286,392 *AF5C840E75333D871DC140531E80BF6B28936203 russelljohnston2
1,666,286,393 *AF558C0A5DA24148C4B34B6A76AEDD0B309A5454 TATUOINNEILLA
1,666,286,394 *AF582EE8C47CF3A12638E95D43B96822D1BA1159 ryan.james.mueller
1,666,286,395 *AF54BC7586A690AFA763120C55BC73AADDA52CE9 td1105
1,666,286,396 *AF50AB0022F10B51A7EE5955CD44079EA347EA1F TEILYVY5
1,666,286,397 *AF566BF55984CAEF73899D38E4D69E50EF04EBC4 AFHARTIG7
1,666,286,398 *AF5276229DF42279803E91A16306775B0FB028DE AF:XI
1,666,286,399 *AF5CF1B12DF12295AA0EB3C9948C0441370E9414 A/g
1,666,286,400 *AF51F87039B006FEBF43C3C785E79785A33AFCF0 SANGRIA
1,666,286,401 *AF5BD1810FE47D312B6352818BCC2FDE3E7011DB A GERONA
1,666,286,402 *AF5131E121AE448A72E00A0BABDDD7ACC8884924 a_g#i
1,666,286,403 *AF577B5982A7F16C27959B714C79FDD04AB14281 saulpace
1,666,286,404 *AF58234ECF4D70260D3778C7F5B8C07555FF29D3 a)gvb
1,666,286,405 *AF526731C71884FB2D18CC623C8CD53425C81251 SA —
1,666,286,406 *AF565B7532ECA9740A06C5FC290A1E433865AF1A SCOTT OAKLAND
1,666,286,407 *AF547B8F45F3DC1E9D2ADA0F719BE84BAFF47EAC THE.JOHANSSONS
1,666,286,408 *AF53AF5DCA281E0934EE2076D56AB9B1C334D9BF akeittoa
1,666,286,409 *AF58E1F3F92537363F7EDCBB895CF049E03330B7 SELBU
1,666,286,410 *AF5B89FC14EBE4C39C6CE36695D3752D37FEB529 THOLAMBOLAN
1,666,286,411 *AF5F1E800F119C36C03AF7859BD0C8916EF48B76 ALANA-EARL
1,666,286,412 *AF5490DBD6C8B41B5A3E748DDA35C27B34AD0077 ALBERTEMERSON
1,666,286,413 *AF54C34F91ECD4835F97220B6BDDB620216B5567 ALEXGRONEMEYER
1,666,286,414 *AF5248C584107618B82F38812CEF613C768B00F1 ALEXISHANNAHS
1,666,286,415 *AF54DE59132E919C9DD2AEE4F28C0D059A49CAA4 ALEX KRIME
1,666,286,416 *AF51A2FEC05B716F822C012E3E003FBD0FCD35D7 SEXIBETHEY2K7
1,666,286,417 *AF5B8D4C6C4794AC101719EC3EDDC0BF5D611D76 ALKULÄHTEISTÄÄN
1,666,286,418 *AF5576FCEAB47C5FD9A0CD9F0F628CD6AC30943D SHAKEIT(FEAT.NOISIA)
1,666,286,419 *AF573FF9DADFB0D2549FE1B3CF68C15841B86446 SHAOPARKERC
1,666,286,420 *AF519685A4452923C239745B8630A63CFCCAE7BE shatenbsw
1,666,286,421 *AF5EFCC8B48967F1BCA0A9027364EF59130E3B47 TODIADIOEU
1,666,286,422 *AF5490E4A2436CC8CD202BE1CEE132FE3C74E973 SHAYNE.OWCZARZAK
1,666,286,423 *AF59CD257F1FB43DE54E6A336E944DE37B809A15 TOLLLINE5
1,666,286,424 *AF5A52B70B99B0CE0DBDCD901DEB552C4253BD4B ALTHAKONSAGA
1,666,286,425 *AF54E98CCDB5AA012CCF29705F5CA93C37B25DCE ALU
1,666,286,426 *AF5045A067DAFF21BDBCA9BEA5357F2559503E4A SHERWOODBRANECKI
1,666,286,427 *AF58A7D70FACB1ED3608F8AC08D97941553F0448 TONY.EWALT
1,666,286,428 *AF519522ACB46776E1561DA7FEDD61E0C2E20317 sherwoodmedows
1,666,286,429 *AF5F58B39625EA16A900813C27BDC2153F48A995 AMANDAAYOTTE
1,666,286,430 *AF53D98C93994AB9A15306A05432926D0C0CCE5E TORTEYSE5
1,666,286,431 *AF5ECA4E2E7B7F771F7F756D0226FFE93672F9AC SHITON22
1,666,286,432 *AF5B998298F4BE1AE8EC3A0755B3A6A3CB7C2E45 Tremont
1,666,286,433 *AF5A22B1BD51C53229BF9818120542B43256E1C7 trettens2
1,666,286,434 *AF54CE22020EE9700D3112BDDAAB983572B1FBA7 TREY.PACKWOOD
1,666,286,435 *AF5C5D209D4ED77627242925974DDA5FB90AB46D TRIBUTE-(D)
1,666,286,436 *AF5A830DEE296BA6EB03A2436AA99D4381BE2AB1 ANH.NGUYEN.MINH
1,666,286,437 *AF5C76BE614B3133257546055DF966CA0CA423B6 silasmorin
1,666,286,438 *AF5C657A1B4FCCDB669C4E08ED5192E330B4F30B silesiateschen
1,666,286,439 *AF5AB9CE811A5211C712D6A8E920139287A85BB5 sinfoonia
1,666,286,440 *AF5F2DDB5749A85AEA987D1BD1A7C0703F8A1FE0 tuffy.miller
1,666,286,441 *AF585EFB2798458E44A5DDDF81D32AED395CA25B TUPPING
1,666,286,442 *AF500D13A2771CDBA9AA2A361AF6AF11DBDBA1B2 smailliwessorcal
1,666,286,443 *AF57B07B22C8F98900197E665F6015674C6D0F35 SMARAMNDITA1234
1,666,286,444 *AF5E88FC14EBE6F23906C11BE4F2F16550A51B2F antwansaulter
1,666,286,445 *AF53C6C4441E47B6C7EAB25307E04C8D7D14C2EF [email protected]
1,666,286,446 *AF57230B126B349B4AC7C09C8B9BCDC796DFDDC7 [email protected]
1,666,286,447 *AF5F69BC86A4FBEC74B07F7B71586036E46B2095 a:oe%
1,666,286,448 *AF522BFCBBFB3310E093D5196CB2166346D2B060 APLANISSIEZ7
1,666,286,449 *AF5F89AD3BB22E1C4B218BA42A968F849D6A001C UBHAYAAN7
1,666,286,450 *AF55722F7B9C21A78C883F52E5B162CAB013310E aqmy;
1,666,286,451 *AF5A3C90CE3BBAFA1579EBBA94BA08D569A98401 SØKKJER
1,666,286,452 *AF5C4B95888187E663F2E13538FE976810B1E734 sola-love-milfs
1,666,286,453 *AF5E2A02BEA2B87A375B7A70F44DDF5081B4029D ARDENSWEANY
1,666,286,454 *AF5914589DBEE087355272AA0DE55D01D2BF9318 SOLEILTHEATRES
1,666,286,455 *AF5C515016EF7318795BF4C07BFEC1A46AE40409 UIEDERGEFUNKENEN
1,666,286,456 *AF5471F6925BCB803A4917BB25FFB90A607B8583 ULÄNNLTCHE
1,666,286,457 *AF586C6027F6B56CB3C28A853BCA2A4BAB8DB579 [email protected]
1,666,286,458 *AF58FA7F5122A4A176796F5E639FC3142EAB17FB SONNYGREENLEES
1,666,286,459 *AF55D2A441932BC9C422CE98DFFD6475C91F9361 SONYA MARLEY
1,666,286,460 *AF52D172104A18D0564C9B1B79F89DDAAD6A8CF1 around.your.heart
1,666,286,461 *AF5F6FA5C25989703C2A95A0DF92990118B63524 ARTRITTIR
1,666,286,462 *AF5F8D511492DD2FB9812429140B9F861EF2759D SPACEGARRETT
1,666,286,463 *AF5B1EE994585E0D3DBEFBE3584251BC2B675724 [email protected]
1,666,286,464 *AF54304BF5793EBB2244D62FE57DB19853F2C222 UNN
1,666,286,465 *AF5185A65F3B19C0B140E5C836F3ADE54D1C0018 ARZIÓN
1,666,286,466 *AF523CA38D9E520E69F80753351229B5706AEB93 unprofessorialing
1,666,286,467 *AF5DC695DD2B627CF071F4281AF391BB55165C40 spelerig
1,666,286,468 *AF5B2C198D0018A5522B8649E1DC78ADA53EC2C1 ASHLEY MANCHA
1,666,286,469 *AF51EF5F35394799DA41BF20635E2A3723DB32A1 URICOLYSISESED
1,666,286,470 *AF544C4E31C630C0B783B80EF2E57EFE5CD68884 ASHLYNDECKER
1,666,286,471 *AF5B67B331E91A8DC819C5794AF4020B52C641C3 splat~` ~`(=b
1,666,286,472 *AF5C370D5C463D9F591075BF5FD9AB0588087BA3 SPLAT.~<===P
1,666,286,473 *AF5A62F5A1FBDF41060CC35987BB8161461932C8 U|W'
1,666,286,474 *AF545EE1F7431A03C6CE8B5FE2CF11AF19CE89A0 SRC=HTTP//ECXIMAGESAMAZONCOM/IMAGES/I/2136Z64PW4L_AA115_JPG
1,666,286,475 *AF58A1ADAB6E6596165680BCBD4B0B1D85EE547C src="http//ecximagesamazoncom/images/I/21NDGVQZJ2L_AA115_jpg
1,666,286,476 *AF57AB2D070F105C8A31D5FABF1EF5E9F250D09C V101ANTE
1,666,286,477 *AF52CC56A92A5E9DC1836B05454F23B31C642FE3 vaderwhitney
1,666,286,478 *AF5D0F907B05E4E181DE9F847FED5A11BEDB8212 VAGIREST9
1,666,286,479 *AF5FC9481590B8D1695C70A4508C5F2071DBBDBF VALTIERRARI
1,666,286,480 *AF553421CACD9AFB37E710EB01CE4F1C0076C986 standage9
1,666,286,481 *AF507849DCFDDB8106906B51390EC82DC57D1BCB [email protected]
1,666,286,482 *AF54E0CF1EA4F5BBBC7DC5B360429D274B327326 stayingpower(b)
1,666,286,483 *AF5FBE2CC118D3709446D137C09F239764E03BB4 vanessa.ibale
1,666,286,484 *AF54981EAA4D377EDE33E993C325BBE270604A03 VANILLAESPANOL8
1,666,286,485 *AF574FBC1E83C1BC36A1AA5FCDBCE8B6C2FA178F stevelobato
1,666,286,486 *AF56E9CF62530225040811DAA0C1EC48B6DCD2CD VELMAFARR
1,666,286,487 *AF537F1CF3976C7BC63206F904EF508324AD4418 vermilion.hands
1,666,286,488 *AF5A572A32D80CA375638F81F2FB1CAEAA73C75C VERNONWYSINGER
1,666,286,489 *AF50A07EEEEEC745CBC5B94744569A1BD587ED8F verpak
1,666,286,490 *AF571F4A101D8D78388C960E5945E50FC18B5E12 >[email protected]######p
1,666,286,491 *AF54ABE61EE76E78BB8F39B2682043E2D494E698 [email protected]
1,666,286,492 *AF5E09A2D65A8C02DE3DED54E5997AC002AC3988 sungarias
1,666,286,493 *AF54ECA9D44C5DA3FB4A3E7ECFBDE1ED7E38C5D4 VICKIE FUNMMY
1,666,286,494 *AF52AD5C2CC25D92A4C8DB644EFDF35024A6DC64 SUPERSCANDALOUSLYV
1,666,286,495 *AF551D51BD045FFF185DC5B2EF351D65ED8BDDEF b60o$
1,666,286,496 *AF5FE18F4BEAEA49E180CCEDFBE7929B65E58B18 VINCE CARULLO
1,666,286,497 *AF507AEA2830CA6448651126C201DDAB1C3AB132 VINCEKELLIN
1,666,286,498 *AF5A4483AFEFD42CC7AC3B90D6A767A026A85146 T9E8YJVY
1,666,286,499 *AF5B701172216CF78F8819AAF8FCD557C7BAEBF0 vitoingwersen
1,666,286,500 *AF50C998B3DDFF37F95FA9C8EF04E66AB0E151C4 TALK88105207250
1,666,286,501 *AF54D3A470425107D594944E20DAD5C40332E3ED tallyhoing5
1,666,286,502 *AF5BFBAB3567D13F9EAC0EA10B762DBB1B65136D BATAILLOMSCOMMANDEUR
1,666,286,503 *AF500389BAEA7FF0516F033AD65570D2A48C2EED BAYBEE_GYAL28
1,666,286,504 *AF5EA568471BCB165D9280257B0E8D8EE452D68C tatyanahadad
1,666,286,505 *AF5A647B1C16B932A0D1AE3BD414E10AE9CE6CA4 vylesfilain
1,666,286,506 *AF5A5EB43ABDC5F27E84B85E973CDD88620F7450 BDGERMAN9
1,666,286,507 *AF56241A49C7FEBA8B429EB24F706494AB35BB38 BDPCS
1,666,286,508 *AF50794CC3033E3F1470956B69DE08FE0A1E9365 TEODOROGAVETT
1,666,286,509 *AF50F69D64E9B16EE31F6591E71D37543B79B114 BE!HP
1,666,286,510 *AF536829A90B3D7B633D210D2D4767364F94986B BENEDICTHOUIS
1,666,286,511 *AF59C77577D77D3AC8E714F14CCEC6BA345927A9 TERRENCE.ENKERUD
1,666,286,512 *AF52A19ADBC8E5EBEB1A1C71449E8B5B3DE5837D terrysok
1,666,286,513 *AF57A7632483AAAA0DDF6BC784910C6D7ABF3914 WAUBLE3
1,666,286,514 *AF5AFE016C83B96CAF79AF7EAB651FF1FFA670AD [email protected]
1,666,286,515 *AF54988AA1043F758A55B9915B9688F7D9A97E11 benristarens
1,666,286,516 *AF56CC2A4A9BB6DEC24FBB2E5DC416F352857321 weerapol.thepsomgate
1,666,286,517 *AF55F2B84F334AC4A90D50299BA84483A8A01B20 BERLINO»
1,666,286,518 *AF54D611D2BE2AB65836E1D80E784A0ABA58CBB0 THATALICE189
1,666,286,519 *AF5AC4153F3CBED359D9968B5D8EF82ADBA854D1 berniediestel
1,666,286,520 *AF56D673551C351D52719AA9B5483DFCEAC282CD thatdiamond31
1,666,286,521 *AF5CE7B2240D6CC380EFF2E5DBE56D33E6CA78EB BEUK_
1,666,286,522 *AF59BECDD2B7FA13A35031CF2D3F99DC918CF738 WE THREE KINGS (DUB MIX)
1,666,286,523 *AF56DDE01BB26325162635489AE58C6D5E8582B9 BFLAVORED
1,666,286,524 *AF5104D7C3B8BB54C5908DA1BA09CA4CA5DEAE53 WHERE-HOLLOW-COMING
1,666,286,525 *AF57869EA52C50C86D3393645E514BFB0EE454B8 WHITNEYLAVIS
1,666,286,526 *AF514FA816F15DC18BFB92A275308FF3D97E932C WHO.GAVE.THEE.THIS.LETTER?
1,666,286,527 *AF5A28F5E8DD0B712519BE402E2EFDE32A2F9E38 Bh6Z
1,666,286,528 *AF55AA9107064CDF7DBED2210CD3B43505DA1EA0 WILBABER
1,666,286,529 *AF5C7D827061735FFB0B5DDC9278A5BE24E2864B BHPH#
1,666,286,530 *AF54BE58DB30BCD28CCE3C1CCC53DDFDC44CB23C b]i%
1,666,286,531 *AF51BB87EC26F1A612A8886B9A63512C30235B6D bil,d
1,666,286,532 *AF5BA195682A610ACEEB4295D76FC3E6952D600D WILLIAM.FLOWLI
1,666,286,533 *AF527D7BBF9C03A5F8F6E666770146664F0B2FC7 ThomasWenke-DD
1,666,286,534 *AF5E0F7D35FB76B3053B6787566198BB16C8A5CE BI)Y)
1,666,286,535 *AF52641D80C582342095ABDEB1EAC230E18993A5 BjUG
1,666,286,536 *AF5BC755A6D492DDE294C973DCC510473AD6A2D7 WIN-BARUA
1,666,286,537 *AF582BE0E907B21FFECA00CDD2EAD376400C8CD3 bkt#8
1,666,286,538 *AF5C2B288B5CE7C3E29B1EDB46BD7A4A5A88D1F3 WIRAWAN ACEN
1,666,286,539 *AF560255AFAABCDFD71F7265560355A1749B8D04 TIMOTHY.SAMIDE
1,666,286,540 *AF564B04E5FDF9BAE742B4BE054D925A34A38510 [email protected]
1,666,286,541 *AF59EEE5224DACDA91F1292C2245C0E24C1074B6 TITHEBOO7
1,666,286,542 *AF56BA441FA97FC2DB833B99079A5E37794275DA [email protected]
1,666,286,543 *AF5E0E740D65CB47601468C16CD4222CC8AA5A5B WWWCONFINESCOLLECTIBLESCOM
1,666,286,544 *AF5B56B6D294C50C3E23CE86EB2002E55EBC6589 TOKUSHUJ3
1,666,286,545 *AF568EE8E46F4F941DB49E610A544CDB11024F2C bobbyclaburn
1,666,286,546 *AF5A8135F16AD3053202BD10CFEDCEF993F478DE WWWPONDSMAGAZINECOM
1,666,286,547 *AF5DFB994D28EDA5F27BEAEA89F49F1AF341AFBD wwwusapresidentsi
1,666,286,548 *AF559C15163655B986DF15A094E86826E8E50F0A X122573
1,666,286,549 *AF5B6913185A2EF684082527E298EEB5D6D37169 x1f091
1,666,286,550 *AF57E373A9C66EB74A403FB19FF21298403FDB94 b!ok!ne+!c5
1,666,286,551 *AF5114013FAC00C80F6FDAACBD6E7FA0D7910D8B BORIKBSW
1,666,286,552 *AF52915A6DE894BD0588DEE2F37493C0949591DF TRADEMARKINGSING
1,666,286,553 *AF5A974450E40D9770CB83756486E695D6BF5F8E TRANSMITTABL3
1,666,286,554 *AF5F9F6E7D4890AE168757F04BCFDCDCAF1A3F96 b&qml
1,666,286,555 *AF5B82C2E2D87DEE47CDE482ADDE35CB3B6D6A10 trillende.
1,666,286,556 *AF5B2BB122B1B0F0632D1AE4EC1677E9D47F34F3 TRIOSESES8
1,666,286,557 *AF5C36F432199FE243AE611FECBDAD84161B612C brantsouthand
1,666,286,558 *AF54E36D18A275E55B42379D75812FEF09D5B1B5 [email protected]
1,666,286,559 *AF5E41CD897030B9605ABDFDF619FA6BBF93D083 TRISTAN.STENBECK
1,666,286,560 *AF50A14DC8AC54B2E5E225369E44E4715FC47322 tristan.yusi
1,666,286,561 *AF5119E4294D3B36527F18E78209F85392114B83 [email protected]
1,666,286,562 *AF5712783322F8B5F1EBA5F75ECDD934655AB500 YOLONDACUMMINGS
1,666,286,563 *AF5E0A00538C285BE4C6EE1F2E5F65377B0088EC BRYAN.JURKIEWICZ
1,666,286,564 *AF5E9F2ABAE85A87FC857A977CF29A99655DF86E B---) *SPLAT!
1,666,286,565 *AF58B79767521BF67FF96B21B031DD597647D8F6 two magpies
1,666,286,566 *AF58BDE2699D4F0E3D72846CC9BC71AF2EE2E3DF by#n+
1,666,286,567 *AF509FCD5089000B060E0699DB7A6EEBA5C4D9B1 UBESIEDESTINY
1,666,286,568 *AF551EE8DBAC3B5E66B9CF86AE71054CF4D1ABC4 U_DIE27
1,666,286,569 *AF5C13E038B7B8DCE6A9262F1A22B424404249AE u};g
1,666,286,570 *AF54FD542213F78AB50502B536F7E0FEBB55D961 C09AA07
1,666,286,571 *AF5CA9FA82073146C66E69FB9BB79F5F4C26A415 C1=&C
1,666,286,572 *AF5284A67AB1C379DE71C700AA288B223E20ED06 zurichacidixcz
1,666,286,573 *AF51AA31E9165CAF3DB71D588CCE07BDF23C00AD [email protected]
1,666,286,574 *AF593C02CB100E48CA3359C0CBB2FC1A4E1AAD42 [email protected]
1,666,286,575 *AF59DD180F2F8E6D19FC910B0083FED2759D6213 ZYKLUSKETTE0
1,666,286,576 *AF5011CE6593BC56215764CDB59B39E8246A96F5 ευχαριστόντασ
1,666,286,577 *AF5D459FD1F5F998F020EBFE05EC4AA7E842DEEC UNCHANGEABLENESSING
1,666,286,578 *AF5DECB55216C5B48E057C34509D4AFF1B12BFA5 calvinlutrick
1,666,286,579 *AF5E3533D8C22831440C507E79A25D7625727263 CANDIDATAR
1,666,286,580 *AF51260D5255599201424000B35F42A46D4EDD33 [email protected]
1,666,286,581 *AF59FEF1249081EFCFAC01EA38BC6C524237E625 БАЛЛИКЛОУ
1,666,286,582 *AF59E8F4F967F176C17876891C1B28E38DD6084D [email protected]
1,666,286,583 *AF5AE04661223E39984EBC013362D2E27800C91F [email protected]
1,666,286,584 *AF54C1810A4FAE8DBA61C05D00BDCA5E30EE2C79 carmelograiney
1,666,286,585 *AF5BFA1B4616100BCC1CF53184F66553171ED7E3 CARSON.ORMES
1,666,286,586 *AF5BB14D9BA79FE48F7DA1699B1D3A254E6F9B25 UNSTHUEAS
1,666,286,587 *AF5F4BEBCFCB9BF0DC1735C8DB2576BB0928F8E7 carvanserai
1,666,286,588 *AF52C09AE96B5044E4756A3B71B0C963E62F0FB3 cavalleria-rusticana:-part-i-"gli-aranci-olezzano"
1,666,286,589 *AF58945FB07E5ED5A5464C7F063C955E8A9DA042 C-C/B
1,666,286,590 *AF5C2A933F81A8E7B25D6FC9A957D929E7E1FE36 CEDRICK-ANTHONY
1,666,286,591 *AF52E4C3518DC3F16337265DADA6175A1C583F37 CEDRICKDOMITROVICH
1,666,286,592 *AF5E2A872C8B3E1370973100DF4A144B414BB72C CEDRICK.POTOLSKY
1,666,286,593 *AF5DD567829169F4C84ECC087D357E75E7201FC8 cedricvollstedt
1,666,286,594 *AF5C61E7C446A5814A218E2A315862392C8B1C33 c)eil
1,666,286,595 *AF59B61C0A46B6AA0F2B0F50E7400B49530E0C70 C-&FM
1,666,286,596 *AF5A9FA745D5B7306216E4F0A3FC28184A4077AA хваток
1,666,286,597 *AF533390F572B3EFD88AE3F1D1898DDE654EA93C CHANGE-MANAGEMENT.BESTMANAGEMENTARTICLES.COM
1,666,286,598 *AF5E7B1698CF0F3BE3237BD8FB20EA09FAB40A85 chapter.25-01:.a.word.of.honor
1,666,286,599 *AF5C50D20C43AF7BFE0DE40870C757973BBE3283 charleytwilligear
1,666,286,600 *AF5C99CE7C7F92D80821985EEC8FD89FB5DAF9A6 cheeseraymond
1,666,286,601 *AF531CFBC71EB5213E638A31F89DCE70F4BBBF14 CHETFRESHLEY
1,666,286,602 *AF529433E3AB9E3AEC50FF6CF87F22C5507A7AE6 CHET.LUEBBERS
1,666,286,603 *AF591495E4A488DA0B62A3CD368A280C561F6F71 ventaren
1,666,286,604 *AF509FA439A729EE9CC7372286AC9500305C052C CHOICE-BIT-OF-DIRT
1,666,286,605 *AF548EB73B3F521967AB2A03D2DFA2AB2862F5DF CJDND
1,666,286,606 *AF58A9788C9BCBECC41546DBC6D348A49CDD55BA c+k)n
1,666,286,607 *AF5C8837A2D97C9B194D4A9540C3F4F96435CB93 CLARKALLER
1,666,286,608 *AF59399071A8A4E019A2AA798F29791C0BED37F0 VictoriaRenee
1,666,286,609 *AF5B5C98422A5CC22913A56E9D69A1AA6A486EE6 claudiodeya
1,666,286,610 *AF5E946B5CDFC435EAEFBA2D60EE1C09518C851A CLAUD.MATSUI
1,666,286,611 *AF5FA18A88603C3DDE44E8D750E62CC6D2E3B8AC CLAUTING0
1,666,286,612 *AF58EEA672D19D94BE9FC38DE0E0EFA2C816F732 VIETN97D
1,666,286,613 *AF5E6BF32B940246B31FAA3020457E6CC7CD86EF villejounio
1,666,286,614 *AF598D0ED8DAF8FFC230BEBB4798F5F68E36A26C clf4v
1,666,286,615 *AF5824980D64AF3292756EDB37E1BBCA822354DF VINSTONVINS
1,666,286,616 *AF53CEA347688B6C92EC39363A758A18A98DBE4C clive.townsend
1,666,286,617 *AF537584DB745560A2717B463FCDB42792783AD9 virginia.thornburg
1,666,286,618 *AF575A70A3DD6A64E2A9FB8A9127763E0519E387 CLOCK.24
1,666,286,619 *AF55AED1F6FBB9156E1AD096CA7FDA65CF23E89A CNE,
1,666,286,620 *AF5C90820090A0D2FC81E79EC1D4B77D0E9C19E6 vystudovn
1,666,286,621 *AF5295926D1FC671B7E2DF9708BF894A9D21D394 [email protected]
1,666,286,622 *AF5E5DF333090D404EB2825ED414074FD74D3633 walter.askins
1,666,286,623 *AF5B14DA6F8FFA6884DF60A7A32AA272A7E70B5A WANITA.STONEHOCKER
1,666,286,624 *AF5FA33C2198EDB8F78016AC9180426EA1259D48 Wantfriendbbs
1,666,286,625 *AF52FFDBD327B897B7F3689D93899CDF9246DC0B CORROMPES6
1,666,286,626 *AF5A4C3EF6F705825E75895BD0969F33B54F9AAA weekliydeploma
1,666,286,627 *AF5B69FFBE0E33BEE41BFF9D1F90D5E85E54CF14 welcomecinder
1,666,286,628 *AF50C7EA4FCF9E8ACC34FB9DE28E1A552B295EA0 WELDON.REON
1,666,286,629 *AF5B69C78DB6E6EC801194D5833F0DE4B8318CD4 WELTMANNSING
1,666,286,630 *AF54D6E644F11AD359754FE542B3A0B4DA4F4412 c:\programfiles\microsoftvisualstudio9.0\common7\ide\itemtemplatescache\csharp\windowsforms\1033\netcfv2customcontrol.zip\customcontrol.designer.cs
1,666,286,631 *AF50E4EA2EAC826BDEE94CB83D62772410C167A3 westonbuhr
1,666,286,632 *AF5BB325B0E9CB82D94A881580472AC6A0017AD5 0ILOVEGOOBER
1,666,286,633 *AF5D718A70B908BD6C8C541DD217C04D5E9CD858 WHERE'SDAVE&JASON(SKITINTRO)
1,666,286,634 *AF59A2EAC115FD5D77DA7DA335C574D7C20BD170 whitney-schallock
1,666,286,635 *AF5460B72D5B37896A6FDF0484D5EA225F0932F1 whitney-sue-mullins
1,666,286,636 *AF5CA7BB2367EDD74BC54B88CCB0987C4F01FF19 C:\PROGRAM FILES\MICROSOFT VISUAL STUDIO 9.0\COMMON7\IDE\ITEMTEMPLATES\CSHARP\CODE\CODE.VSTDIR
1,666,286,637 *AF5B95AE7CBB89B49DCAF0C7E2A7FEBF7C1C800B wijbisschoppen7
1,666,286,638 *AF580763A53373E7FC02E696A2EB1553DF9DD7BA WILBER.GALBO
1,666,286,639 *AF59A1683E77FB8C141BF95C126E48204B04DB2C WILBERTWARN
1,666,286,640 *AF5187D1CFB9627C47CF50BA24F477941996EE37 cqsah
1,666,286,641 *AF5E2EBB6C6F273D946C9244DF52F1D8C475E1D3 cristobalgriffard
1,666,286,642 *AF5592AE7FB126EF4EC0F99A32252DFBCDBCC07E 11-VIZCAINA
1,666,286,643 *AF5E1C34D472EF71E6963F442113D4D64F8453E2 1225722 eta-sopimus ja j
1,666,286,644 *AF52E920E2479D8564FE9F7285E8574A15D44059 wiltonsimonetty
1,666,286,645 *AF5B64193A651E349E186C261EC1F7E3CFFC935A WILTON.TANKER
1,666,286,646 *AF51B4A6445E7008D812D0630E407952F20E6F19 [email protected]
1,666,286,647 *AF5006E96D4DB226BC218A7123B191F140171024 WISEN1234
1,666,286,648 *AF543821B88E09E9B3ED7DDC4888EF0332DAB583 C$t4
1,666,286,649 *AF58423B309E2D1D120C290D3726EADEA454CC2B C)&TL
1,666,286,650 *AF561CCFF1E1AACF2FBF59627F8F24F8DE25B975 14MIELEINEN
1,666,286,651 *AF59F599C359833EDCE3801B2D88764FD0C23F4F 1522569 KURSSIAIKATAULU.SUUNNITELLAAN.KUITENKIN.SITEN.,.ETT
1,666,286,652 *AF5E49B3940B20E472BDD0F78A67E93EF33EC027 15bbe25877404ef0ae296c9442bd3410
1,666,286,653 *AF51AD0E89E6230810AFC75C18F771D02FDAD5B5 [email protected]
1,666,286,654 *AF59FCA2FD7CA76E99A44857883EA98D3C406311 15-PITTSFIELD
1,666,286,655 *AF5A9E9CC697814D29C6B8ADE1D343E0F455D604 1606491 the catalog calls it a " baby dress "
1,666,286,656 *AF5E7E6185ED33D92818F111EEEAD08AEBDB7B34 WRIGA
1,666,286,657 *AF5AFDA5380EF2FDDCD384A04458B1EB0166B58B wrxf
1,666,286,658 *AF5C65587BB361AFB9C27184D47427FEC66E7A0D WURSTMARKTMENGE
1,666,286,659 *AF570E59F0493E9164B8B89EB8AEA39609332302 1816071 ER.WILL.DEN.DEUTSCHEN.DIE.VERZAGTHEIT.AUSREDEN..
1,666,286,660 *AF5A3F79D96E3F8CC2AFE306C6F6ADFF5C59A039 WUŽIWARJO
1,666,286,661 *AF55A2858DF994937EE1D7977C4C5D52DB7DCA6B WWWROAMDATACOM
1,666,286,662 *AF5EB4C21C525F81A5F837A6FB5BFCB999916975 cvfx5
1,666,286,663 *AF5AE55175781CC3109AB2CA502E7801A7D3864F cvs%v
1,666,286,664 *AF53E59723F1CDD749228FAC28E60B354787EAD3 1 bergstr
1,666,286,665 *AF5047851DA1B417B9326E0772006BCDE667DE34 W:Z
1,666,286,666 *AF5E20B4256C25B1984133C4553DA10A944D0779 cwg0!
1,666,286,667 *AF585B58CF28C1B93C6961EE15D4AF289D9DE694 1 citesdokumenten
1,666,286,668 *AF54FE019D6A0533149A526D9FA4944C265A2C34 cxjuh
1,666,286,669 *AF5A93AAADB7FE89EA6F81BBBE72E8728ADF69BA XG99
1,666,286,670 *AF539CD8FAC55D87E225361D9D1FB971A16B7C24 cyr/k
1,666,286,671 *AF5133ECC8D2896873AC0F8A51EF583BFC231A8B 1-GALEWOOD
1,666,286,672 *AF5B9A717B7FB56EA19C25B11DD7C185A0B16858 1GOOTSTEE
1,666,286,673 *AF551AB0646810E9C5E9DF5142DBCAF70A5EF1B1 1hexenprogramm
1,666,286,674 *AF5130B416BF03D0F99EB35C87D19A859343C0F6 1hillegonda
1,666,286,675 *AF54D34DCC1C34628E36D345F212DB1F8BD0007B XVMKBSW7
1,666,286,676 *AF58E19419719988F3AAEB0F1033CB9D1B2F6FB8 1KOHTAUSTILANTEESTA
1,666,286,677 *AF57E77416F305483035F96A8D46882B197D02EF y6qa
1,666,286,678 *AF594A2C86EDD9EFB5BA58E5618083CCE85D0362 YALCIN.KANADA
1,666,286,679 *AF551384CA9B87A1D2A6590C0BDCB55C7A501874 [email protected]
1,666,286,680 *AF53543BA6FE48E27D210CE364D586C2B97589E4 d%76f
1,666,286,681 *AF5FDE591291EBF6A354D797B0186C376499C5A7 YAROSLAVA.KUTSAY
1,666,286,682 *AF525B9D39DD271447E0B39634B1343926C8D8FB DA HUSTLERZ
1,666,286,683 *AF52C53AA961D4D49B43ACB847D5A67F567BED86 [email protected]
1,666,286,684 *AF51C2AB2F965B3531D93A38E516FE614C5D9240 YEACKSLEY
1,666,286,685 *AF5B18FD1FC458C1F7CFDF8B08D50013B2994C36 [email protected]
1,666,286,686 *AF54450E98ACDE62161F2A1D41F144C5F890E618 YGOLOENEGGING
1,666,286,687 *AF5CECFEDDA792193BDFAA78372E42C0F35FA7A1 YHOUMIE PUGAO
1,666,286,688 *AF5924B450267C67D1314FE74368D7B2C442F91E YHS.BAGO
1,666,286,689 *AF5D60FED5C8B50365CCDB581616FDCA5C4040CD YIANNISMESOLORAS
1,666,286,690 *AF5DE75D25D304E4B0CC3CDC56E5FD47505D0F89 1playfairscott
1,666,286,691 *AF515A2FA82FF36A1F8A6473113566FDC182CF02 YLLIERAB7
1,666,286,692 *AF57AE766C8928AA71F2A674B8819F29EAB5DBBC dancin'-in-the-dark-/-[murray]
1,666,286,693 *AF53FD51F72345053ABB412E39E3CFB02F2EF88A YONG.CALDORON
1,666,286,694 *AF57489E536E43BDF63AF2BDE66A005F9208F05C DANLINDORF
1,666,286,695 *AF547850A58C541F92A2DA76A842217A5FFBE649 DANNYLOMBANA
1,666,286,696 *AF50356C5022BF47BF725845DF9B1F85543464A8 dansunjardin
1,666,286,697 *AF5D509D92DBBF33EE79558D5F9F5CD0471FB9BC [email protected]
1,666,286,698 *AF518F65E2EFD3109B392A1F765707393DF78F89 DARMKREBSAKTIONEN
1,666,286,699 *AF54DD3DB2CDFC91215936A4E8E83D3792BA36AB ZACHA GRACE NELWAMONDO
1,666,286,700 *AF58A9E44DDCCFEE704A90223CE00B13BF62A379 ZACHARIAHCORNA
1,666,286,701 *AF5BBB0534FBD65267DFC9614955D61D98B39BE0 ZAC.MERCOLI
1,666,286,702 *AF57584A127BFECBA8E79CF7F6C8B19DADACEFFD ZAHIDIQBALCHANNA
1,666,286,703 *AF5BBCA5ADDA12E553BAB5D7EC79212406411E7F DBNKI
1,666,286,704 *AF5522AD60AFE6B90662A2B3040B9F0CD8A1192E 2178524 OUDOINTAKOKOASIASSAONSE,ETT
1,666,286,705 *AF55741EFE55EA92F5D4B7C185F5BB1DBF1423E3 DDQ82
1,666,286,706 *AF56527993683741E1F57C49DBDC487C9C1413D7 [email protected]
1,666,286,707 *AF5D2C7E68152AB959B3A9B9B6842C4C09D775CF DECALEREZ
1,666,286,708 *AF5BE281885648F636CCF6A93B792618FC22FB1F DEEWORLD
1,666,286,709 *AF52B22872BE41E1E9F5A77BFD805CF3BB081AFF DELBERT.EPPARD
1,666,286,710 *AF59AF2CCF606D6B7F1959D4BCC6F0C044E9D150 delestee
1,666,286,711 *AF53463C37837DF5E41ED2E59F402DAF7040CE4F deluosyps
1,666,286,712 *AF5E9BD2730C167B27AD010542445E4253650122 zoobin.j.bapooji
1,666,286,713 *AF59951716F30D000C313874F44FAEEDA6B49647 zsaibar2
1,666,286,714 *AF51184D7AACEB9EF86574E4402744D69B43766E ZUTEUS
1,666,286,715 *AF5B347C23B9A8EBB8B7D9004AF7CFCEFB321755 zwiebelmettbrötchen
1,666,286,716 *AF56B5D606358D290A4215D636FDAE3BD1C772C0 АММАРИНДАР
1,666,286,717 *AF50D8AAFAB029D40AC0A195F850FA23C8A58190 АНИМАЦИОННАТА
1,666,286,718 *AF5CDD16C501664B798B4977859DF6D40A3726ED DESARMONIZAR
1,666,286,719 *AF57322CBAF1BA769221EF9D21B0EE53D5BF1A3F D(EV
1,666,286,720 *AF5879F33EF6669062015EF7B5B6B382A599765A ДРУ́ЖБА.ДРУ́ЖБОЙ,.А.СЛУ́ЖБА.СЛУ́ЖБОЙ.
1,666,286,721 *AF57114D9621C263F79B55EB079B674BB9BDA4C6 ИНЗВОРЕДЕН
1,666,286,722 *AF5B80FE1FCEA5563F23BF8146083F4910FD6BEC 2LADARYL
1,666,286,723 *AF534A0366F71D23ACFF0F347367AFA6A1A86E7F 2-LOMAILEVAN
1,666,286,724 *AF5EF577A474DE467E1D802915012128FB0EDB6A 2PAAHTOLEIV
1,666,286,725 *AF51351F1AE17AAECC9A7F7D2FD4B8B45C7D4C44 df7!2
1,666,286,726 *AF5405409E9729566E4FB89BF6B0FDCFEC0A6037 [email protected]
1,666,286,727 *AF538C653CD8AA2769F5E09C2DAF3A0131280C89 332.ALGER
1,666,286,728 *AF521D2E93291CA9762C7A70117F8911872C545F 3:..3..-#..-&...BASSETERRE
1,666,286,729 *AF54BA023A5192525838E34D0AFC25452B41939B DIALUPNEWBERNNCCOMMOZILLA
1,666,286,730 *AF5E8B8928319BE69F714CD1C1B2837009773FF0 [email protected]
1,666,286,731 *AF5B4BEF99F690AB5A3551545733CA29953907CE перлонка
1,666,286,732 *AF5F4E664259420B0856930FCB389238C73AB345 [email protected]
1,666,286,733 *AF54D7F5EDB3FBA14347800689EA4CD6644768F7 [email protected]
1,666,286,734 *AF5295A77AA197A25A5C25F6955C76E897E8D652 DISASTER.FILLL
1,666,286,735 *AF5202A7C416301522D92F7E32364E4A64F2E0C3 discodavenewediti
1,666,286,736 *AF5950A3B6FA1B809895BE1FCC844207A6C822D6 [email protected]
1,666,286,737 *AF53B13F22B4802A2918967B5B4FCEE8FEA3ED6F 3EDOKHAD
1,666,286,738 *AF5C278B4BE246AA8EFB00669684BB233F42815E [email protected]
1,666,286,739 *AF520CDF2E4830DF53517885CC23F4B8579BD0E4 3 EYEBALLING
1,666,286,740 *AF506908389FABBA969036069988AE79163DC381 3FGHDIANE
1,666,286,741 *AF5F56A69B6F272CDA3DF77F163C2AD882C0EB35 DJ+FC
1,666,286,742 *AF53ADB2F835AB079401490E3B6EABD1004635D9 3N7R3A713$
1,666,286,743 *AF52BA6BAE3647D0E836016E4D1F4B3C88FD3884 3#@~O3B<
1,666,286,744 *AF54FB3BE024931849CB217F9EFE65402DDD0039 3P~ ~ ~}O{
1,666,286,745 *AF5F56E9A74C2DDD4B20FCD89E19AA8EE948CF99 ШЕМКО
1,666,286,746 *AF543823B9EAC4FCDF9F5584626330885596C06F DKC$L
1,666,286,747 *AF5194FD2F9DAE74FCE13652256691DBE954D877 DLL0F
1,666,286,748 *AF5CE9E66C84C3F9D2F56EFA394BBB3325EDAE32 d&mue
1,666,286,749 *AF59D9A976758CA9ADED3EF06F5BD375EE3BCBA8 DOGGYBANANA
1,666,286,750 *AF50998FAC71579C2B3810C35A783E075703764E 4RTHRTMS
1,666,286,751 *AF5C76166E7278B6071B4A3A393736346ABC853A 4SELFDISUNITY
1,666,286,752 *AF55C422CB04E8D27860FAFA796B3A43BF916B07 4-SHYAM
1,666,286,753 *AF5A51FD5E9A035137DB7CA7F49598F1DD862201 DONTEEPPICH
1,666,286,754 *AF51AAC29398E419B04E89D4F1AF5F9EC7783AE1 DON'T.LEAVE.ME.THIS.WAY.(FEAT..SARAH.JANE.MORRIS)
1,666,286,755 *AF51A23439CD0652160CE3682CC84C071F3EA3EB 4thegateway28
1,666,286,756 *AF5E0B3AC01C536BD90AF4534249E368A95501D2 51romney's
1,666,286,757 *AF5A026DD795E27B41C47CF4D900B676BBE65535 dpbh7
1,666,286,758 *AF54877F194945897806025A69A42F3966FE627F dpv.4
1,666,286,759 *AF565BEE2C764D36EB41FB1B9C28678A6492548B 0106SP
1,666,286,760 *AF527EBB7154ABAB826B4C21E1B9D2B0710D62AE drazner1
1,666,286,761 *AF5CDDEFABAB82CF87154B85A6B710200DDE1833 5dallyes
1,666,286,762 *AF58338789AD007C00426D1F5C973C80358E4B10 5F185116529B31B89A7CDADFC9A10FE0
1,666,286,763 *AF5333D7495209559F07A6BE981959056B3C5586 5ISSALIBIS
1,666,286,764 *AF5D0A162489ACC08129A4FB685993A1DB0C0849 5KARTOTEKSFILENS
1,666,286,765 *AF502C6E17658F50122E88D88AAD5AEC9933F766 DSUQ2
1,666,286,766 *AF5C70D922C712408716A316E2960BA697822041 $0C1A11ZE$
1,666,286,767 *AF523E8585BE11C13EF069704E4D82F73B4A6C2F 5SCHOOLROCKY
1,666,286,768 *AF5F11288AE4186CF553BE1E1804FC34CF8BF785 0DEA654C-5602-3ED1-B347-21B7EF1D0B29
1,666,286,769 *AF551AB674E630749D2BB89CFEDF1D00ACA3F301 5SPITFIREPEACE
1,666,286,770 *AF5978C3BA809215CB1FE6A5C1FCEA03C0EF9CFC 5TABORETSES
1,666,286,771 *AF5A0F191A9ED27B8D9E1790AC2CB621905450ED 5TROUBLESAPPHIRE
1,666,286,772 *AF572B69C54CF45206EDE284A3398FE86DE428DF [email protected]
1,666,286,773 *AF59CD2D5D60197C5F96C47730315CC2FE3ADD0B 0rvi1l3
1,666,286,774 *AF5B82F2C215F75590D3EF41062EBCFD37D58C05 5WOST
1,666,286,775 *AF5039959680E382B4E7576CE7705D15C2765203 5YRELLIT
1,666,286,776 *AF51FB5186A920AEF607925775DE3835CB0341C8 DUNFORDS9
1,666,286,777 *AF505CAF85FFE3EC60167A68EB3D797905A83F7F DURANDPRINBORGNE
1,666,286,778 *AF56F3E52510374035D8B9F3E003AD05ED1A4949 dustin.fontana
1,666,286,779 *AF55F54654043254A2A37F81930F4404AB6C1C18 DUSTINVANSYCKLE
1,666,286,780 *AF5CD6E1E59A9922F8C1D8DC19B12F5F5C75BBCA 649159 INVENTOINTITIEDOTKER
1,666,286,781 *AF5287FB33A4AFBA8727A72F9C533ADC9F0AD19A D%V!$
1,666,286,782 *AF56E78291F242445267185E7DB07E21B401EE03 12mckinnon's
1,666,286,783 *AF5A2362E3ECE165A650EF010B9216AE65491831 132DAMIAN
1,666,286,784 *AF5A80ED7183DEC3420A43CD7B8AAF3EC1566C2C 6BUQZLXUNCOC
1,666,286,785 *AF5B689E331F59931E265B6BE6DFF36417927622 6ERAWROHTUA
1,666,286,786 *AF5E34816FAE105AA80A15361228E251C71F011C DYLA.AHMAD
1,666,286,787 *AF533ACB9F28A2D507989B6D370CCF51FD4308E8 6FIORDALIZ
1,666,286,788 *AF50D0255BF39B2C7FCB1C180732606070A79A15 6GRAVAVATE
1,666,286,789 *AF53CAAB7D7617B9C1891B811A3D49DA2770A12E 6JANICEGIBSON
1,666,286,790 *AF56AC92C155CEE5A761D51405B9CCEE9467A23F eal1y
1,666,286,791 *AF5920024621CB42DB5F427AC58DCAF15B9B6043 earnestleaming
1,666,286,792 *AF5233EDDD9D0B732F6EE0A1C7E8BE5864B298BC ebi%i
1,666,286,793 *AF53912390A0127C15E5BEE20B48A5791BECF61B 157-TUTKIJOITA
1,666,286,794 *AF5A46F05E660612385F3512E89296D2558F2E86 EDAMI
1,666,286,795 *AF59ED0AE2775285DCDAD18C4EEB877D8F8A22E9 editorialize9
1,666,286,796 *AF595BF08AB673217DC89FA854B5C54B8310B519 6.SOYLEMLERDE
1,666,286,797 *AF55123308289A5E4FF9CE4B5804B66C63F9A62D edwardortmeier
1,666,286,798 *AF502A16EF92D83E868817D0FC9E762876FBECEC EEFT4
1,666,286,799 *AF522698E65CD61071D6609DAE043FB47B78C8B8 EEMf
1,666,286,800 *AF532643B82B844F97F074BC2D4186AE70A73EF8 780419 vastaava-luku-vuonna-1999-oli-51-%-
1,666,286,801 *AF5E975E327AF14E99E9D9755EE4772778C7353D EFT
1,666,286,802 *AF556D51BECC9C36471A025905A703C7AF563C09 7c16000us4218400
1,666,286,803 *AF5A1A1E88F6CC4EC2EBB44664E837A61ECAC40C eigenfabbed
1,666,286,804 *AF555C252BD1B19CEEB80DFA90E37149C1121E17 ELBARRACO
1,666,286,805 *AF517DC5E395A58C5DA5429518976CDDC8019A8B 7HYCNEMIC
1,666,286,806 *AF55E037DE3D0F5D3312534309156E439814D15B 1DESFINA
1,666,286,807 *AF552DD20421FD00984EDCD5A37265480C35EECA 7INTRAPUPARIA
1,666,286,808 *AF5DE5D3AC117F0D8301955DE7941851F699C995 7KNOLLYKNOLLY
1,666,286,809 *AF5314C4FFD95261DAE2D4D602EF3D8B2CCF9368 7.KONTAKTIERTE
1,666,286,810 *AF58D65DE913EF1CE81411885891E657050F3CFA 7KORNSKEPPAS
1,666,286,811 *AF5F352927D329F964719CEBBE85B821C05833F6 7PEEWEEDIRECTOR
1,666,286,812 *AF546DFC9A5B6B8D81B872F96E098DC8545DFE91 eliseoconnaughton
1,666,286,813 *AF57E03468DD4A234532B0BE7D5453BA8028AFFF 1EFAAA
1,666,286,814 *AF5F660F1AFCD1B65295B077FD3A049D7437A59E 1ennallista
1,666,286,815 *AF591ED8D0BFB3D6A6BCA5D55D0F74FC664ECF56 1ETATUEBERWACHUNG
1,666,286,816 *AF537E79F33DBEACFA409BAFF8FDB2E9E7259A5F 1FEUERSCHUTZGRUENDEN
1,666,286,817 *AF58C29A69655A327CCD39DADF29CA9BF414A48D 7TAMGSSENE
1,666,286,818 *AF5E9C3B515796C670E700CCA56B520A2026B22E elmomasella
1,666,286,819 *AF50567960F3639D75919114C0D3E41303ABBB6F ELROBEIES6
1,666,286,820 *AF5DEB059D3E86AB5E47518841FE405A2CC87122 1KANGKA
1,666,286,821 *AF59487F395FF31A6ED9EF151361A1F3414730E7 EMAIBSW0
1,666,286,822 *AF5792A116163B5FD5C912044D8E211BEBDA47ED 1keskusteluapuna
1,666,286,823 *AF5A65D201598E506233B86B8004239ABABAC817 1 KOMMISSIONSSTAERKE
1,666,286,824 *AF53C97392BB3D74BDA6CE4AB0C710E9475B222C 1konditoriaty
1,666,286,825 *AF54247692A4D02EA1C070B0D6DB62389CD79461 1-KUFEN-KUENSTLER
1,666,286,826 *AF5D52547A0149B3F547BCA47C453E87BA096864 8BSWETDHCBSW
1,666,286,827 *AF58B5794D878B4261F0E0BF941141719BC89D1E 8D~0~osplat
1,666,286,828 *AF5239C5743F1D40001A6ACF023D898F0CF5A520 8LEMSIPS
1,666,286,829 *AF5B902E75FB460479C76CA68F1A7C4AE0B77CA5 8MAPEAREI
1,666,286,830 *AF5B446790E76C871AB0D15E5B15A548292D2ABA 8MONDAYGARY
1,666,286,831 *AF518DEC3E79A97E370A9B0E57C6FE74A4BCAFD6 1parison
1,666,286,832 *AF55ECA1F9EE50FB771A06C701136CF198066201 1REJOBBS
1,666,286,833 *AF5EDBC6F083EFC58DA694A345E8711D45B5F6F9 1 ROTANMYRKKYNALLIN
1,666,286,834 *AF549DE5C86A9A7E0710A24D06DC080F3AEF5471 8====p~0-~o{x}
1,666,286,835 *AF532BB802B32CEAF566C2DDBC3860C3B9C877B9 8PENNYLARSON
1,666,286,836 *AF56C5DD3071E8C9F382E164733D24343782D478 1 SERD
1,666,286,837 *AF5469C07B72E7BB99661A432D16A1333D2A52A8 eq.v-
1,666,286,838 *AF5AEC7742FD33A355C48FF22387558B19882589 1SPORTKANAELEN
1,666,286,839 *AF56C202D536B6B0EEDAAB2D0BF8D1B7D1E0B558 1tiukkiksen
1,666,286,840 *AF5345620E78E3AAFA24DC74204A5334B4EB69D5 erichardeman
1,666,286,841 *AF5F11A6500BA766BBA43963C425DA3646BCEE60 1-vampirismus
1,666,286,842 *AF598FC6C43781D6E74D482B6FFE92AFFE2B77E3 ERNIE.CROGAN
1,666,286,843 *AF5AE2978753F8FD7E9F3BB030437C8CE1FDF184 ERROLMCBREEN
1,666,286,844 *AF5A6E4F284BFFF2BA06C215748C1557251BBA8B 1wdr-stadt
1,666,286,845 *AF574E08DB116D9CD1943954FC7DF1C59A9D08AC ERVINGUTIERRES
1,666,286,846 *AF5EB76BE2280CEFB4E68ADB2DB02D11CB52FBB3 8WOODDOOR
1,666,286,847 *AF569183B1C088BB541DE74B3A19C762A2997F37 910699 cd-de-var-elimizde-,-bari-bir-yerlere-yollayalim-dedik-.
1,666,286,848 *AF5F92153ED196AA63F8115A3BB2C083F817F824 )から、912℃を境界にFCC構造(
1,666,286,849 *AF585A629BCD0D3715EA2BFDB8C6C35F7A564263 916JAYDAN
1,666,286,850 *AF57389CE792BAF800DB775D8CCA74DEB91610AA EverybodyLovesMyBaby(featMezzMezzrow)
1,666,286,851 *AF5A8B30A3C06DF1E96F54546BD7846AF8766CE2 9 BYINGTON
1,666,286,852 *AF5E4915A48D2E634229DC90FB68CC5775A7C48B EYw
1,666,286,853 *AF5C07258E3F76A9845727087A3875110F33A25C 2379065 on-my
1,666,286,854 *AF5FD3A5815D414E6D7BED6037692BD1BA5AF331 f2!*
1,666,286,855 *AF5912192E1E8C3F4D45CB7D845167BCB51E5865 9MYBOXER6
1,666,286,856 *AF538C2CA922F1BB4168697F2DC92AE809C21A58 FALCONJAB
1,666,286,857 *AF5A00057E9F2B46FA14E8B128390448EA265B9F FAMISHEDFOODIE
1,666,286,858 *AF58779C043CE3D91CE9196AE20324BEF0F58109 [email protected]
1,666,286,859 *AF59F38F6A0C3D72C43E81B683B4B6DB472734FC 9NIMMARATEE
1,666,286,860 *AF56E306FD388D7925F0E2EA4447E249069D7FFE 9REAALISIKSI
1,666,286,861 *AF5FACE663D04908BE7521512BBA7E54A3A19432 farmertom2
1,666,286,862 *AF582990394FA52D8379EB52672A318FC216D870 &'9sih
1,666,286,863 *AF58D039F714CA4E44C75CB7F73C16B4D814E27B 9SPANKY2
1,666,286,864 *AF549FCD9E36E066A391FF390166BE333F7C71A5 27307E
1,666,286,865 *AF5B35A46A2B9129F51053D4015082EA9BA4FF14 fddz
1,666,286,866 *AF50EBFCE406D04B2B01B28733302340AA80A4AD 2arkiel
1,666,286,867 *AF5905C8A72A3321431CEC6ED49E1EC376B22315 2cb7537b830c5a4e74b92ebbd2d9ddbb-bh1990
1,666,286,868 *AF502391772CD13A1A56AC6C9F41BF9C50920A58 FERLES9
1,666,286,869 *AF5E6CDB8D76879D592300DD0710C2B4E9B3ED91 a1icu
1,666,286,870 *AF5C3EA00725CF0C85DEC79EEEFD90C237B0F72C a4muf
1,666,286,871 *AF56D86369B0C037E6D93C94719E7152E00A0793 A8OR"
1,666,286,872 *AF521FB5D80BD1A78AAE166CAD89E45610C959C1 2 KILTAKUMMINA
1,666,286,873 *AF55CCE5FC67354852AF819B1556AE636B83563F [email protected]
1,666,286,874 *AF5A5E6D616FD1141BE46554EAC653A02B63E8BD FIORE95902609
1,666,286,875 *AF54E48422420D4FB7C743EB935A87DAA3D6C2B4 2KONDITORMEISTER-VERBAND
1,666,286,876 *AF5A02A75547F9621A12F11725BF917C5926D773 „FISHKILL
1,666,286,877 *AF5E570F6299F735BA7B378E0073EBB9C2FDFDCF FLITHY-(FEAT.-CHECKMATE-&-CONCISE)
1,666,286,878 *AF519C8A48E59D6976233AEEF437D7D5788A5847 2SEXHAUS
1,666,286,879 *AF52E2D590F4376FED4675898A6CC378337769C1 AAFMU+
1,666,286,880 *AF53131AC3941E34880878E8BA6A9097324CC44D AAHOBHIH8
1,666,286,881 *AF5E75B9BA04079538132D2AA962C2DB6D04D1D7 300543 [numlock]numlocksayikilidi
1,666,286,882 *AF59ECCF86EB3384844DEC79D523FE9F88F31688 aarj/
1,666,286,883 *AF5B03982C3ECEA3C46C87574D587016314292BA FORESTPURDY
1,666,286,884 *AF5187A3ED1AFEBC70257C404A497CE3ADE53D71 30may1307
1,666,286,885 *AF56AF13356F2A57E77ACD9978AE950380B012BB FORREST.BOCCI
1,666,286,886 *AF5011D702ACB420AD8BC78A9E4A393FE99FC05E abbisogneremo4
1,666,286,887 *AF531D27FD1D4FC595D7A0F73FD263A590AFBAFD fortuitouslycom
1,666,286,888 *AF50AD0E50365359C2EC08133B0C10B216BB186B 336GRACELYN
1,666,286,889 *AF524B57BE6E7BE7FA9C599642C501D357E97787 ABE.HORIO
1,666,286,890 *AF5512D7D104B208EAEE91DAD230B18C827ED0FF ABEL.DECANDIA
1,666,286,891 *AF5F843C879B3CF0C4743F9E303D3BD4EDC65F61 abelkoenigs
1,666,286,892 *AF521C5DB06F3ECCF24C047948DEF7CB1D6D00D9 388340 NETISS
1,666,286,893 *AF543582438596E819EBE95B14D1EA40E7151BCC frankieyaekel
1,666,286,894 *AF53513FDA00C768D99373C20AF684E7089AB5F6 FRANKLYN.PEASLEE
1,666,286,895 *AF5F0FE9D15350C8B0372E24F168A141C7A18FC7 FRCHTELARD
1,666,286,896 *AF5A0EF188B067AF2D8FF004FF2741E407226DC4 abruvatah6
1,666,286,897 *AF5DBA5B343F505A7B0E46A7F1F668B27AD111F0 3DDSFRGT
1,666,286,898 *AF550AFE59D084114582043083423402A3FD854B acds3
1,666,286,899 *AF5FD46261E09E2945A026C8F6BBA1FE03AB5649 a-chinese-getaway-to-help
1,666,286,900 *AF516AC8E433870BFC4E093FA7AE3F9DF51F511C ACHROMOPHILOUS8
1,666,286,901 *AF5F9FF4C9B3C171D570B5BDDD4E32F01845E85F 3MINISTRABLEN
1,666,286,902 *AF50A4AB688FEDEAECA69838D4528C196E609546 A,CW$
1,666,286,903 *AF5D6C7D792526D1E3B4F53FB4621C71D4C7E00B ad$c)
1,666,286,904 *AF5D6C579A0444D489778077A3464527FFC099A7 g2h^
1,666,286,905 *AF5A87B93B3A8A10B34851B3120CD7D155CFAF57 GACACTCAGCTAAATAGTTTACAATATTATTTCATTTAATTCTCACAACATCACAATGAG
1,666,286,906 *AF5A4663B1368DFD4E002827F6A9DEA8F81FAFDF ADMISCERI6
1,666,286,907 *AF5B719A5BB3690BB66DDCA2FFCB11B21D5EA4FF [email protected]
1,666,286,908 *AF59D8DA42235EBC0E14D9FE0B88003EBE509BAE adriana.lecouvreur:.act.iv.."povreri.fiori".(adriana)
1,666,286,909 *AF5D8BDDF459B7FA24A5BD70DC54AE1A0D9B6A19 GARRETMISIEWICZ
1,666,286,910 *AF5DE48EC2CCA1006353FD95E9C048185F16A9CA garretrichards
1,666,286,911 *AF50B90BDBC8882260B73B394A9B8B1AFCA22F08 GASMANTIM8
1,666,286,912 *AF562C311F3DCBE0AD46F1DD51045FB12F60C1AF GAYLORD.RENFROE
1,666,286,913 *AF5CA4ECBF35C8564F630B87B4A00E6970D087D6 gbt+
1,666,286,914 *AF59D8DF662057F6DC10A2F36E049AE1039F3E9B aexr"
1,666,286,915 *AF55A906CE6C4B2CF5D18F22E60872F959FEA048 [email protected]
1,666,286,916 *AF507ECB8B21582D14F626D4CAE14BB29271EA06 GILLARONA
1,666,286,917 *AF5476F665D9A4D3654DBC51C9829619D9BA7DFC GLEN.HIVELY
1,666,286,918 *AF5BA40DF28009CAEF1CC95A03D0B19BE130244C af=js
1,666,286,919 *AF5EDE3E57D9E92F9F6C3E8AFE1FDB3BE5658E91 GNUROFF9
1,666,286,920 *AF5BA7A7E0DC1EDE3BEFFA1A35312F21073EA4E8 GOLF
1,666,286,921 *AF503D436C98E9C6BF689072DFEA8079D59BA67E a)gvb
1,666,286,922 *AF5C1F8B6F81571D269BA78927798F86CE88B527 AHMAD.VOORHIS
1,666,286,923 *AF50483C47F27CA1345FC299B81AD0A3C3DB646F AHT%D
1,666,286,924 *AF55D8C4BE2D4C95BA78393432A5F93CA2F81889 4OPSKREKNIV
1,666,286,925 *AF537E5D0E5051E0B476B34FCFBAC5CE8750912E grahamstapler
1,666,286,926 *AF54C252EAF234857697018780C159796786948E grant.sternberg
1,666,286,927 *AF5B09B19BB8C104E5C1D2FB7981A1B28A4617A4 [email protected]
1,666,286,928 *AF5F9B47D86B1F6D5C1C200BC30CFF735A1B704A ak!"/
1,666,286,929 *AF50183844B68DF31F64C0745DCC2366A75D4D76 a-k(l
1,666,286,930 *AF56EDAAB65588AE1EA7C9A8D7659F28F5424BF6 [email protected]
1,666,286,931 *AF593454CD759109AC5D0FADF997D1E331677EA8 albertolesley
1,666,286,932 *AF5E7FE58F4576DF427421D761B026CF10C38BBB GUYKIRAL
1,666,286,933 *AF5C115934F500BD004A1BCC7BB064454B4BB7CF 4WASEMT
1,666,286,934 *AF5E3FCDEE34654AFEA2E3806419892092FC1A4C 533内存,外接显卡接口是agp
1,666,286,935 *AF5FD399202417E558C41FA718998D2D28D8C911 ALFREDFORNO
1,666,286,936 *AF523F0AC00DFBCF5CCE862DC94BA92A3991FD20 H4U78O5
1,666,286,937 *AF5809123A6211225C3A4E12905182A94B3632DD halliman's
1,666,286,938 *AF5D77AD76D1CB179E60F93A3A399043248E3E8E [email protected]
1,666,286,939 *AF52C21FE8EDCCB663E612237A0A1D79451B1BAD 5ALUFORME
1,666,286,940 *AF5F6995EC40310792B40F57CC99D0CC94FCDFC0 HARDAR-SAGA-OK-H
1,666,286,941 *AF55DC29C71553535A53B876282BE259016A53E3 HARMONIA
1,666,286,942 *AF56B19FAA69E622CB4F29105752CEAFB595E6CE 5COWLEYMBSW
1,666,286,943 *AF548FA23B6ABC865D1E309CB2FE9EEED8093045 5DANNERESTI
1,666,286,944 *AF55008496B02925E5B675D4585D06041BD94654 HASSANSEEFELD
1,666,286,945 *AF5E0F9D540329AEF78210491058FA0659B25EAE 5FRIDAYCLARK
1,666,286,946 *AF5ADAB2E83C1EA467D6500D2A590C71242CCBC9 hawaiiher
1,666,286,947 *AF5EC79ABAC0F17A3FD381D085662D0D668EC235 ALU
1,666,286,948 *AF5464FB33B632C60B9CC77F93B1512701464CF0 hekzagramın
1,666,286,949 *AF58B77B9AA6BC78582EEFE58061F0E75A49214E AM!K6
1,666,286,950 *AF50D833CFEB01C5A27EC80DFB323B24A4219C4D 5HYDROLYZATIONN
1,666,286,951 *AF560D4FE50CEAB7F673877D7D7985F6157943D6 heribertomarrietta
1,666,286,952 *AF5A30AA9A16A7760D32538453D1EA02DBE8F606 HERMAN.MCRAVIN
1,666,286,953 *AF5DB8133B71E58BD6A4F327523371F3BC90D440 am%tc
1,666,286,954 *AF57346C898A1AB228E6E7DA298D64D2F8DE6EE1 HILARY-ROBSON
1,666,286,955 *AF5CC9F555C353607BAEE5E79BB9511EA159EE6A hinatahiuga
1,666,286,956 *AF58A69470452844591F1285F317AE3BA2F51FCD 5UNDIESUNDIES
1,666,286,957 *AF5171AA8054E78AFD30955841DBCC8781A958BD HOBBELACHTIGE7
1,666,286,958 *AF59A612BDC4A24B2A5D1BB065C410CAD315C363 HOBERTWRONSKI
1,666,286,959 *AF54D1702B9888D755D47EEDDBE984F99C665A63 HOCHSTIFTES
1,666,286,960 *AF560E269E1B6813F07C3C592936EF1031D18ABC anthony-navor
1,666,286,961 *AF518FE82662476B4C39FE3756DDACBFA119A010 HOLLEROUT
1,666,286,962 *AF5B98CA7FAEFDD6A89887F5FA8EF9EF2CD5FBA8 holoholokauaiboattourscom
1,666,286,963 *AF5F7EF9E05EEE0F79059C2AC0655CB717B016D2 [email protected]
1,666,286,964 *AF52A82A3691A444FC7EE53F4084070902234BF6 644ac8a0409fd39ac12572a30047fbc0
1,666,286,965 *AF515AFC2C3B914F39D4EDA1FAD49496450FE40D 688043 ALMA 49:27 H
1,666,286,966 *AF5253A448CB75829AE8603A898A20CCF77DDE09 [email protected]
1,666,286,967 *AF5ECD167FE37401C0789D41948F36CD5CB1E9B7 6ADAYSADAYS
1,666,286,968 *AF59F2AD6EFAFE6EFC1CC7C162CFA820C7831A80 HOLY GROUND (INSTRUMENTAL)
1,666,286,969 *AF5AC94493202236091E3AB3D15D275A6D226077 AOYZX
1,666,286,970 *AF55D1B02C1079845C855566BC21465F547B4332 HTCOMPNET
1,666,286,971 *AF5A657303BC1DC56063D7A62E0C608074F814FC ARLEN.MINIER
1,666,286,972 *AF596A920E8132FEF29A5FFD4166360DFA0CFCFC ARMANDLINEBRINK
1,666,286,973 *AF5886DA1E7FC0F2E9DE1564BE46E9778A6D9D48 6ronfleurs
1,666,286,974 *AF5CB129B5527D2DBBFFD4234BE057D1AE82986B ARONVANDENBERGHE
1,666,286,975 *AF5B29EBB44D2CD2E3D56235118015C8B3B2659E 762584 veasilsikintiyisoguklarlagorduk.
1,666,286,976 *AF543DAE6701D7B3D789002F4397F6291E1B3C63 765brooklyn
1,666,286,977 *AF59749D9E5A2E1B9D6A1D69BE5275A6215F5DB4 ASTUCCIO
1,666,286,978 *AF513747C0456711F7AC50858C72CEFF6D16EFC4 atcp!
1,666,286,979 *AF5379D1937122F44CCCE989325A743479E25657 at.h_
1,666,286,980 *AF579768C4F5F50A7678CAF8D448E5A4DE70EB38 if you love someone set them on fire
1,666,286,981 *AF56900659BB0E4E7E643C116D5E7679843F0EED augustineeckenrode
1,666,286,982 *AF50178B4BA48A0964B2BD48F615850127D2D630 7OENACCIS
1,666,286,983 *AF5A0CB4496F14EDEE93689D2C48DE99063FCB3C a:vf
1,666,286,984 *AF521459D7E5A41E6A7DEC24762E9175B50E2239 7SEDANGTODRAH
1,666,286,985 *AF55881560C7131304FA05D644723249E68A4F59 7SNOEKEST
1,666,286,986 *AF586CAA755353F2E1F12AD50BD2B7BC20D9B075 AZARINUOSH
1,666,286,987 *AF5A7639AA22EC299A7EA92DBDBD3AAC8E09C7DA 818ZOIE
1,666,286,988 *AF5C6FF3148C9B9773901626E0035EC79969DDCE 86 BRUNET
1,666,286,989 *AF56D24BBBDEFD3061E19F3528246D55FFCEAB75 i\mg
1,666,286,990 *AF50AC9A5814C89234155549A8AE567636EF7EF7 INCUSHIONTUCS
1,666,286,991 *AF5FC53608AEC4DFCC52D5EE090440243D6601F0 8CAESARSSSSSS
1,666,286,992 *AF5CF2A216B51F7FB507E0EA535BE7E7ACD6A2CB b215h
1,666,286,993 *AF57DC35677A3ED1236F12B9443612178C65DD78 b7q{
1,666,286,994 *AF5B1F7DFF72C8FA9E31509843D249D002C24FA6 b8b(w
1,666,286,995 *AF59B941F4B4B3B930376A85E23AFAA031A5AF31 B8$EI
1,666,286,996 *AF5744A67D9A2036DC1357AEE53BD00AE6651A47 8GUINNESSYVONNE
1,666,286,997 *AF54BD7FDEA752B03A21EE1E56922AA86439A28D INUADED6
1,666,286,998 *AF5F36EDDC0267DF20EA3157DCE0C1FEB084B840 INVOEREN
1,666,286,999 *AF5F21FE3AD8A740A8BE3442C8AC8CBF8EF3210E 8INSTITUTIM
1,666,287,000 *AF582B37A0DB695EACED19C7A87F74AD7C12955C badulesco
1,666,287,001 *AF585C02E5706FD0056124CD1A275400F6D2D55A 8NURSEILOVEYOU
1,666,287,002 *AF52D2F72F71BA788A4D5B4CE80F8E9C7AB58F08 irini-dimitriadou
1,666,287,003 *AF528FD76FA82C06EA4638B241F77A8F2A22F4E8 BAKG3AR$
1,666,287,004 *AF5CA8A2DCA893ED1F457409C94FED0BB8DAEA0E IRONGOAT
1,666,287,005 *AF51FFC5847B01203A8D688766C85957DF544EE0 8photogeology
1,666,287,006 *AF5A123CD2761305C57B2DAC7516A5F1942B2223 8RUBRICALITY
1,666,287,007 *AF55C32FFD4E0DDA01145EBA27A73DBE8DCF4092 bavaryhb8
1,666,287,008 *AF5D25FB1A434DDA3AEE9650937A99A5FCF65734 b!,%b
1,666,287,009 *AF5E63C7BBC2A1CB89FBB9A85831FFE9EC0F2142 b/b"q
1,666,287,010 *AF5EC8ACD1A546E831A9D12B4835A3CC60953B96 BcM
1,666,287,011 *AF55F96F45D7DC69F16A28C4E9BACC975BD25A1C beekingged
1,666,287,012 *AF5815EFB85764C28C93DAA7B9FB3AFE134D2950 9CAPACIMETRO
1,666,287,013 *AF57169D11723DBB2DFA19BD43B45F78961EC609 bejucoloco
1,666,287,014 *AF5E6B2C8AFE87B3B204B545AA2B680AA9F2B619 jaredpackett
1,666,287,015 *AF5D7A3449C65A787423FF68916169F06C1AF396 jarrodwatte
1,666,287,016 *AF5613D17ED5C9D30AB2406CD3E45E1599B60184 BENEDICT.SHURTZ
1,666,287,017 *AF5788C935DF85903EE7AAD450CE35DFD458A2E9 JASPER.KIRTLEY
1,666,287,018 *AF564A98F4D286AA11B61F654645AA1D4E18DEB4 9GRUBSNONNAC
1,666,287,019 *AF5D50A73C73054693610234BEE960FC895D8E65 jazrockcandy
1,666,287,020 *AF564A2B09D29EED572D50529066EE1B6BC54CA7 jazzie17
1,666,287,021 *AF5B9EE99C5E72CBDF9E725CD263E775516C31B3 BEQNW
1,666,287,022 *AF56ABB7771B141BB05DEA04A62E2F684CBA1C69 jemisin
1,666,287,023 *AF5C223E9589C8A434178582D463BDB95B412ED2 9OMVALVA
1,666,287,024 *AF58DD50D35BCE06CD09C0F2D8A855C339D2B6CF 9quinquepartition
1,666,287,025 *AF55754D07B4B282D4C6479AFEAFF11925639ABC 9REAPEARANCE
1,666,287,026 *AF5639604A49FB16DDAAC877AC55922998A91ACF B#I;
1,666,287,027 *AF532B66FAC65FFF00FA2CA8583C2FEB55FD7B88 BILSR
1,666,287,028 *AF587FDF4A0963AC422DF93CFF0201EC5E8ECFB1 9SSENDEMROFERNU
1,666,287,029 *AF508E2AFE218C5D531421ACD04D514C19143C99 BK5DI
1,666,287,030 *AF5162B29BF715A377D8A33C3CA423B04CF0A40E bkjh)
1,666,287,031 *AF50AD0F066B7D5959F2FA3DF8F41A9E108E4DFB JEWEL.GUILMETTE
1,666,287,032 *AF526A943356DE33A659B68E5116A027B8CEF921 9ZONNESTO
1,666,287,033 *AF50E1226FFEF7DF0FA5219E46D65E95791A2BA2 bloodwit?
1,666,287,034 *AF5FEB6C831BACF2A36C4C54C1C3F79890174E3A JG'H
1,666,287,035 *AF5C27F715B4B00687558701BB2DCF4FB5E1E108 A10009.94
1,666,287,036 *AF532A1AC281FE9AA818C222FECD1CAC26AA7458 BONNEITA4
1,666,287,037 *AF53C07D664E7FC83C236B496565C4A91E7E4AC0 jhanbell
1,666,287,038 *AF57F87B8E20E91EE92CAC2830EC8D2F9B5AC019 jimmiephearsdorf
1,666,287,039 *AF5BB5FFBB623974C0FB3C7EEE2542119946C6D6 a?2;w
1,666,287,040 *AF53A402437AD9A64AB126F9E728754EF99EBE8B [email protected]
1,666,287,041 *AF5C7F05AB0D70CB66C917986899689139C14332 B####P.~0.~oSplat!!
1,666,287,042 *AF5F83AFCF4FE4E008F007549F0F61F92F7D8D13 BPNTSRN7
1,666,287,043 *AF5DF31BED9C1ADA5398447822205F2D3EBF48CA joelcunningham
1,666,287,044 *AF53646FF6C56A1E9AE375E9736DFCBEBF0D1588 A8CE?
1,666,287,045 *AF57B92C365F47F4BA8EB8C62F0ED0F3055E6B2A johnny hama
1,666,287,046 *AF582B0C21E84A8355271B5A8F0AC198E8D7DD2E brq9t
1,666,287,047 *AF5D6F2F3CCDAC66FBB58B70375388470B793B0B AAC4%
1,666,287,048 *AF5DAA5D9B9EB9DC0C146829B61AF14FA3D6AC30 AAE4DV
1,666,287,049 *AF53DA4B67ACDA166E54BCE509759117ECC8E865 [email protected]
1,666,287,050 *AF59299CAC0F5D0840054E473BB5BB1264C022C1 AALQ?
1,666,287,051 *AF59FFC4302568003B9D0C0AD2A37487DE5F7B81 bubbateacher
1,666,287,052 *AF5FAFD1A350F74E36BF8B1CD921E43BFDD2ED58 BUCK.MADDEN
1,666,287,053 *AF527FA72728528F85A9FA369020BCAAC96A4A38 bueno.'bw/E/n/O/
1,666,287,054 *AF5FB67EC120DAB17B0CF2570013B5867D1FE864 JUSTINBOIKE
1,666,287,055 *AF55F370F214A9C7CDAB0026C8EFA1B669CF034E KACIE-RUGGIERI
1,666,287,056 *AF5A089D884DE7D4D35623BE7FA9972DF2F4519B BV/3O
1,666,287,057 *AF5826373F8DC42807946F0C9B470FA212CE2CDD AARDBEWINGSGOLVES
1,666,287,058 *AF5633FA858EE64C8A679EB52814812ED4264505 AARONDANNY3
1,666,287,059 *AF50BBF2EB83D3562FA00EC33459E7FA9CE391EB kapsalon van veurn
1,666,287,060 *AF51496F63DE2659CC4930D2CD20D6DE721FDE50 B"Y2
1,666,287,061 *AF5DA9BF2DD0C33466890FDBFA7D83D3342FC0BF abdulrickerson
1,666,287,062 *AF5FF15A460E0EDEC9C80CAE0A8E2F2807FF5D17 C145970
1,666,287,063 *AF5F3130BA40F34E4267F41EC7B23B3637FF8922 C14DOCUMENTATION 63
1,666,287,064 *AF5F4765B5C2D22ED46FF091D95845875E3CA361 C3QU
1,666,287,065 *AF5D52AE37A815EA7D213EEFED02455E0F4807F5 KELLY.SPRYGADA
1,666,287,066 *AF5F683C1B1EE9C9062D94BA2E8C185BB820D536 c4h+
1,666,287,067 *AF560DB7B9629482DDDA375C21F3223E207D096F c4)s-
1,666,287,068 *AF549FE248263B9D93B5FC1346933D59FCC3DD74 c7mos
1,666,287,069 *AF58EB700BFCB57048F44BFF713CCE4230C02404 KEVINKALFA
1,666,287,070 *AF5CDE779BC2447B08493E0B852B371F9C7B2047 ABUXI
1,666,287,071 *AF5D07C3051AD4F872E2A38A55B7A76DF412962E A&(C
1,666,287,072 *AF58DEE940F45CED201D3E413676B8C64E3B973D KIM.PERMENTER
1,666,287,073 *AF54A67B07CDB840B36C8AF98BDA88747D083DAD KITTIMER7
1,666,287,074 *AF595850FCB32CDC02282E018AE468AA1C72938D kletterschnecke
1,666,287,075 *AF587FB82A6645E3BC574E948189FB62C4C026DE AD=9A
1,666,287,076 *AF59FF35CDC4CFF1E18449E5C603D37E72C2E2AC addd-
1,666,287,077 *AF56C01B40277C7CF967965A445E6C1E89DECBE3 ADHDX
1,666,287,078 *AF5228A7B4675ABB396FA4FEAF45F7F3D2AE5253 carolinepinto
1,666,287,079 *AF51F0A72F316FEC97E9BA3A2852F943605FE7DC adiwinman
1,666,287,080 *AF537273AEBB96094808142691201C15DAA1B75F ADPM
1,666,287,081 *AF52B7871B41163068FFDAE596017160B4656A37 catwl
1,666,287,082 *AF5ADEAF7192CF4F7E1F5D6916E7990408A420DB CBHNU
1,666,287,083 *AF5CC764092BEACA36F2F7C0187CEF0B8072A5A3 [email protected]
1,666,287,084 *AF5DB80EE1CA5D1A4207819860C4E648D900009E CEB&.
1,666,287,085 *AF55A152C78B894187976A5E375D47B166EF0A7B [email protected]
1,666,287,086 *AF55C7243A1406C73A59CEBD4C108EDAD5DD72A9 L04269546222
1,666,287,087 *AF5F47A9D32D9F23C30DBD5938D1B0E1DD1827DF lamista3
1,666,287,088 *AF58D6E16D3677DF3870786A156AD3AFC81B3098 lasflores
1,666,287,089 *AF5630A386D383874C1D1608498A0E78F03D228B LAVERN.HUDACH
1,666,287,090 *AF5243EE89FAF93312273377DD8958AF32900D8B a$joe
1,666,287,091 *AF518222B9E2AA9CAD7E0FA4C9CAAEF12F940EE7 CHASCOLLACO
1,666,287,092 *AF59A23871C1FEA8128E8C20810942E149A360B8 AKPC3
1,666,287,093 *AF5E9A7C6BEAB82BEEA63A708D0BF7C520B4E611 ALAN.FARRUGIA
1,666,287,094 *AF5D01FC76FEA83E5C1E0BCFC63D21E8350F59DB CHESTER.OELER
1,666,287,095 *AF59FDB3D8B8200510214FF90BF8503267CEA258 chfqx
1,666,287,096 *AF58A8FDAA4C60D06CA4DBC06787247CEF731D6A CHINESEEGGROLLS
1,666,287,097 *AF5D146EFFFEEEEB11AD8A6580E9FC73F9DF97F8 chinese-handicraft
1,666,287,098 *AF5BB238DDE007AE91E44CF227683FB230960DF9 let'sgetbacktobed-boy!(feat.tq)(radio-videoklimax)
1,666,287,099 *AF58CDFE20419365E1D7C5FB6F3F10F603958F6E c%iff
1,666,287,100 *AF5597264D3AFFC0DECDF8731FC22CE946360CD8 ci!o_
1,666,287,101 *AF5B3D00A49116BEDC25C39832A13262578E8BA4 lidibsw7
1,666,287,102 *AF527CCA2C15663D075363020F24A587B3672547 altonbruccoleri
1,666,287,103 *AF564E1E12144AC6A54B4AADA869CC36B4F77401 ALU
1,666,287,104 *AF5B20DF308168076FFE586F6E144A512E687CB9 ALVAROWENTZ
1,666,287,105 *AF57E42B337000474C52790635221F348B460568 am4.c
1,666,287,106 *AF5A674025564A50E65055CAD5918E30AAC87B8C ckl$h
1,666,287,107 *AF58B212B8AF05BA15F53011EB16103FABBB49AC [email protected]
1,666,287,108 *AF5C59A769CDA6CC812E37F85AA29A65469C9A8C LIU-SHUMU
1,666,287,109 *AF562B6F3D0E83A11FCF993FB32E8CF6422453B6 CLARENCESHOULARS
1,666,287,110 *AF573396F86E9E5090B947F25E62BB2ABFDCCE49 amosballoon
1,666,287,111 *AF5D361E1A999471434239693340D0875F72D4F1 CLARK.MELADY
1,666,287,112 *AF5595864A58798FB64AB01FB19E579AFF1ABAB9 AMPOLLOSA6
1,666,287,113 *AF5879E63CBAF43356E8C9D7E075D405761F4632 clb!c
1,666,287,114 *AF581D7DE6E46168070E36AFCCC594EBC94D89CA ll<v
1,666,287,115 *AF586EB603E5A602D6FECD5A28BAFE7429E4042C LONNIEEGGEBRECHT
1,666,287,116 *AF5B15C53B3E2A2FF430448E8F1D07015D96A387 [email protected]
1,666,287,117 *AF5E9FE810BC07C04C63F6F4C29027BB18C70ABF anguish & agression (instrumental)
1,666,287,118 *AF5566791BAE2FDDC5BEC1B17FF45F9984A8978A coccothrausteses
1,666,287,119 *AF59113BE1AADFAFEFF235114A0532B9CA5FB973 COLKNYFE4
1,666,287,120 *AF586F2BD8E917C1DA852788CF101C6EDED82A96 COLLINFEAGLEY
1,666,287,121 *AF5C29126083AC65B9F02D026FE8D09852731A0F columbusgerwitz
1,666,287,122 *AF5162F953A836C00CEEA41BA00660C36C4131BC lowellwironen
1,666,287,123 *AF5454E093BB34EE05F364BA6ADE2359858D0E80 COME-ON-FOLLOW
1,666,287,124 *AF52E9B940B6FC886EC540C7968B91898FBB2C8B COMPLETE-OBLIVION
1,666,287,125 *AF54B9113CF1993174CF67DAADE4DA564E3C659D lucasbrouse
1,666,287,126 *AF5D51D1731210B322EFBCB2846E51D5E8EC6681 ANTONY.STELLING
1,666,287,127 *AF5BF939DBD403D6560E83FB3B32EC3838BEE63A LUCIONYGAARD
1,666,287,128 *AF56E358C80D926741C90FB0B4F569C19E1993C9 LUCIUS.DEHAAN
1,666,287,129 *AF53A3380B7D1678B85078612DE66ADA9AA8E604 [email protected]
1,666,287,130 *AF5DE956F38DDE213AF926DF674B07F63DE825F1 AO)NQ
1,666,287,131 *AF5165BB7E5F4FBACB8D7CF45F4833B8E7F27584 lunch-scene-in-8mm-film
1,666,287,132 *AF5F3A70C80B1FF8035789CA5720F530B816A9FB [email protected]
1,666,287,133 *AF58BCAEBD9C92C859F2AA1D66317C9209F72EB2 [email protected]
1,666,287,134 *AF56184DBD3291F5E38FC4DAF29575EF9E974F7F luz.rosal
1,666,287,135 *AF5A29CACC6A2FA5BA4E99C27769156282133302 LYHPYRAM
1,666,287,136 *AF52669DBE5908986EA8BF26BC9CE53D517A3084 CONSTANCE.WARREN
1,666,287,137 *AF5AC53128FF8100AA341A7653261AE04D1ED87A CORDANC
1,666,287,138 *AF59B9B778B47662A172EFF161B2BF309B3CEE2C cortezelridge
1,666,287,139 *AF5A424C3D3DD9DCAE1518906A7D8C4F4CA65B10 corteztrimmer
1,666,287,140 *AF5C00F8232F20729C5B3A712430097EC342B73A ARDTTDRA9
1,666,287,141 *AF5912F41FD61DCFF87AFDD8918E5BA95E674B59 CP#$;
1,666,287,142 *AF5EF9710EFEF2DB54F10CE47236C08A7CE38107 MANANNOOR
1,666,287,143 *AF5392DFA8AEC4A1B55118E8E88A223A581B0E8F ARTURO.BESSIRE
1,666,287,144 *AF5578383C8A2BFB507A119ECB578235F43E169E ARTUROKILLINGWORTH
1,666,287,145 *AF58CADBAA425C7919157C7711825EDC7DE7280D AS0AL
1,666,287,146 *AF5F4A8FBE936D6EA938D7D45D639938D7383AE5 MARCELTUNKS
1,666,287,147 *AF58BBD5383F5A935D109D21E8606F701D8C4B70 MARCELWINNEN
1,666,287,148 *AF56B874B82A14B29489E6522309D4A8E9CBC193 marcomckinsey
1,666,287,149 *AF5892F342FE8C20218323D941B0D63392296750 marcom--m-aa1-r-k-ah0-m
1,666,287,150 *AF5D6EF557A114E816D2E5D2414E09EFE2FD2019 asiasat7
1,666,287,151 *AF5A872B69A68A3C6D968EB18C96F8E10D0C1917 a%?#t
1,666,287,152 *AF5AAD6A20155C35CE49AD4D514234AEDE64895A CREYTENBERG
1,666,287,153 *AF5106AB2A98D729EE0042245892A76B01F56055 CSABALBORO
1,666,287,154 *AF5D1A1B8F527C22C0EB7352C0B9602C7086679C cschug
1,666,287,155 *AF5BC99EDD776885869666ED1DA4BA4A50BD337A [email protected]
1,666,287,156 *AF5E94DCB5A9D7CC5C5AE50CCA0B7E7F146FDC02 ctio9
1,666,287,157 *AF5ACF34CF995708BCCF960458BC4EA50C4969B3 AWARDSATEMPIRESTATESCHOOLPRESSASSOCIATIONCEREMONY
1,666,287,158 *AF5D1396F214104A4CE1D13407B39506C1F7B3CF CVWD
1,666,287,159 *AF52E3AB27D563B0ED96CBD1C782114926B5B22B CYCPB
1,666,287,160 *AF53B60B1D3A4FF39E3CA95DB53F1F8F3BF5E6F4 b0enw
1,666,287,161 *AF5543D8708993CD13EA84249A66AEFF25BEB81E b3jq7
1,666,287,162 *AF501F81E0AD3790A3F6FA6E7496F5DB37B56902 D1DFN
1,666,287,163 *AF5E9768586C12233927091DB8254C7125E2D195 D33PLUNG3D
1,666,287,164 *AF5B6E61E6F7DE51E4BBD909004721BB1C7823B6 D3S4MBIGU4I4S
1,666,287,165 *AF555BD8F5A37182E795AA59F796BB428D5D8F22 B7=B"
1,666,287,166 *AF5BD0A9D31A7497DE4F188F381BB734BBC69C10 d8;aj
1,666,287,167 *AF535A5CD5B8FD28040AA842BD1070C35070E218 BAHDÎ
1,666,287,168 *AF5AE4DDD8CC59844AF79DBEEBAF3934E84193DB bakersfield-community-theatre
1,666,287,169 *AF5389FB16768BD2315354799A62CD093F3712FD mitchelllardone
1,666,287,170 *AF514DAADAEF018BFC770C501AF40F5782B6C2EA BARROWHILL
1,666,287,171 *AF5FCE908E256F4F2E7C2F436109BFF9A85F2DFD [email protected]
1,666,287,172 *AF555DA7BEE8C4F84E64C4C843200C6550248EE3 DANILOPERRYMAN
1,666,287,173 *AF5CB43907FEB0CCD3DDF072043C2A18F5BA9023 [email protected]
1,666,287,174 *AF5AC260527DA843C218CFB2CC0222D52A5CB15A DANTEMCWAYNE
1,666,287,175 *AF526B6F22775940FABCD13C2FD9D16E2296F06B DARKERSBBS
1,666,287,176 *AF531EC3A5AC1DFC73A2769569D35F7C6AD8520E BBLEE
1,666,287,177 *AF5C08746AE739588817BF06CCFAF571A0A95E6A [email protected]
1,666,287,178 *AF526B6E78CC1C1F562E00459862B79F45FE5AB4 BcM
1,666,287,179 *AF5FB3F278C3C34853DAE22D2EAD7B3CDC04789A bd/ea
1,666,287,180 *AF524B5DCDE8C468A4054FD6F0AF1874C228B87D deanamasinger
1,666,287,181 *AF59348CF31A8D2BF5F9652DD46EAC99B05D4933 DEBORAHMOSBY
1,666,287,182 *AF503AAA8F372A186FCCCF1883163B0BF3AA2F7A musik-elctrov16(megalowslidingbassversion)
1,666,287,183 *AF5F84AA9CF67B6F55836C5195F58BAD3FF532BE B(FBT
1,666,287,184 *AF586BFE1C18E4D69144725619E846E8753A3DA5 b$f(l
1,666,287,185 *AF53D985C2EB3D5FABDC130460A7244C4B70720E DER FASERMACKER
1,666,287,186 *AF533DB9AFE8956DF564AE05EC26DE70B21B80B0 bg;lv
1,666,287,187 *AF56C8795A94289DEC6B23A45B7DC73E02AD2F25 na-caimbeulaich
1,666,287,188 *AF5637A10C685FA2EA67B281554CCE56618443FB DESIT
1,666,287,189 *AF534909AB8BF832ABCF408EBDDF015FC113E79D bh+3+
1,666,287,190 *AF5449C0BC1C024E0E517E61B9B4C4268DF865A6 dexterpapagni
1,666,287,191 *AF58262A959DA3D02A17B415ACA177CD92AB8D9A nathalielee
1,666,287,192 *AF5AD63390B4394BD71702DC393C5DC33310AEAC ncmapdotongranitequarry
1,666,287,193 *AF505C364353E6DF823C05CF941A18919B271CDD DHARAMDEO3
1,666,287,194 *AF5FF05AC9462DA0930E1A0969DDAED7064EF7E1 dh)b5
1,666,287,195 *AF5266AFC5585B690CF983E4E2D3CA1913FDFD22 diadv
1,666,287,196 *AF574378B848A71D7D7B6A40266CA6832D63D8D3 ngcandy
1,666,287,197 *AF59854AD256E764DA2773BF103413E4A5FF8D2A blld1
1,666,287,198 *AF5BF75F1AA91994190EB100EBB49F398D781C6F DJC&
1,666,287,199 *AF5D65E2672755F50651AB138798BC70F0635776 nickolasvillalvazo
1,666,287,200 *AF55D40A52D66801A6FCBF548AC5CE51A4EAF1A5 B(MOD
1,666,287,201 *AF546FD3EE8F96141E94E8A45878BF1EB496F48C NIHSUOT5
1,666,287,202 *AF5556CF32F87A6F64413DB1D094CC4D31C85D76 BOATABLE.
1,666,287,203 *AF5775C3172E627D78CFBFB6080681E043195FC8 NOELALLAH
1,666,287,204 *AF5962CFC102D4B8473F4D7E1DB26D19744D8EAF donaldhonhart
1,666,287,205 *AF5A3C7440DDBE6CFFFF2ABDEA23BD923B8AB068 botwb
1,666,287,206 *AF50ACFD9ECE1C7FD52756AB3BCAFE566D7C341A boxtopscom
1,666,287,207 *AF513D14874D824821FAC63A2D207D3203E896B0 bp,
1,666,287,208 *AF59AF912CE78B3783665741B10FE193F32CE37E don't-cha-(jca-vocal-remix)
1,666,287,209 *AF526DB3EF3F7995725FC75E5F7362ADC3983551 bpk&x
1,666,287,210 *AF5D0471E8CB7E29F517C7E576E679AA1D6600D0 BQ+_V
1,666,287,211 *AF539B0B3F20A135EB593ABC4E3A1491E97C0DE3 BRADY970
1,666,287,212 *AF5B9A0C01CD43F4631735C9F15ACD552A2DC9E9 nychth3m3
1,666,287,213 *AF5078838954A980CAEF7D100299AB73A6285A28 DPPHM
1,666,287,214 *AF5368DC75E527F414A5628B5442530579E8D752 OCTAVIO.HERRMAN
1,666,287,215 *AF5066782D4EA48A5D9BE3DEF4A95D17E779BF95 ODCZUWANYMI
1,666,287,216 *AF58A10B77ECE940B3D657919EA84D2823F68CEC [email protected]
1,666,287,217 *AF51311B213D023C2C1693D0E79BB39E9697D621 oE"
1,666,287,218 *AF5ECBAE823759DA48517416A981FDAEB7270CFA DREUSCHENDORF」(ドロイシェンドルフ選挙グループ)、「WG
1,666,287,219 *AF5C7B40F787E262B334C6A01C549667E71DD4A9 olathorn
1,666,287,220 *AF5B66E149B8F17F5483B015628E02DF3E351202 oldindianalogo88
1,666,287,221 *AF57D80E220DB573BFEEB07CB5F9C8E41007D5F7 DROSELIA
1,666,287,222 *AF50CFB9D64C592A10535E076D24019F9038000F DSZATALA
1,666,287,223 *AF5F4FF10E66623AC5EC494124FC7EED003C748C brendonkomer
1,666,287,224 *AF5638AFB261C13183B4DA1F13E3FB7874D1098D dtbeman9
1,666,287,225 *AF52EDAC2A7247E2A84D19FAB213A00746FE5F5F dtmsa
1,666,287,226 *AF54396CA0ED4F78B2417B0D7E9B944355BDFAF4 [email protected]
1,666,287,227 *AF5637C559E973A368B5FE69FAB22B03CD6871CA O>< ~ ~ ~Q##8
1,666,287,228 *AF5B53153692F25F3A950DC654411FD619CD2D76 britchel!
1,666,287,229 *AF56FFB0F9A5AE7929305D4C1136BE2649287E53 dub9o
1,666,287,230 *AF55BAC886F86DF904B478A523E8ECE783CEEB7D b%rnr
1,666,287,231 *AF5D88E93D34D1A6EBF81D7CAF33A33A39BB19B2 OSCAR.OSUMI
1,666,287,232 *AF5F0E8009560D687093A5CA4DF1A3383C95FAEE DV)F?
1,666,287,233 *AF586D7779784BD81E7CA9AA320B27802F4F7F3C DVQZG
1,666,287,234 *AF54F9523CD1E449586E03B43EB2F6BC04735A51 ou+rang3s
1,666,287,235 *AF5733B902430268A93E425B343F0D6B384DE7C9 outhyperbolise9
1,666,287,236 *AF555588EB73ED57AF65AD6ED4AFAA661FE33A25 bswincorrupibilitybsw
1,666,287,237 *AF555B248AB5B2DFD96332A5DC186213D0AE08BF dx+/!
1,666,287,238 *AF52539E674AFD13DF5991847254C6F5599A9D0E p> ~ ~ (_0)
1,666,287,239 *AF532EB3932785762141E0371A3EE47C60F91517 P94396
1,666,287,240 *AF529EE19826A7DC1A4BA75F0F83E2D4D4019A3A dzbf(
1,666,287,241 *AF5267C71E1F7F0F9B9F224FFDB4D6A856E19865 B%TG-
1,666,287,242 *AF5C9197FC1FF2975038B1B3E9B2B5DF242BAA09 PANKHURI-KAPOOR
1,666,287,243 *AF573EEB67F88897D9BB7EC340EC805AC70266C3 PANTICA6
1,666,287,244 *AF5A3A85FA323E2AC1B89EC41396760A9F68B5D4 bullrun
1,666,287,245 *AF5967729915602512959B2D6E7323BD668987AF p-B.~0~o.Splat!!
1,666,287,246 *AF58BC332739D9E1014AA140C04B1C2A3890C2FE EFT
1,666,287,247 *AF5BB66B5C6867D09AAF3F6901D8B74E98618D23 C&,/
1,666,287,248 *AF5C5EE187E34F72508D13043E3B1A8D1501635D EITKADERED
1,666,287,249 *AF5C58AA97C831ECFB4FECA6E86EF2C4FBD12809 ekf2w
1,666,287,250 *AF593028AF366ACD46D2FEB8B8714523F996E6F9 c1;?
1,666,287,251 *AF5A986E88D88771C394547DED1F00016215EFFE c28w
1,666,287,252 *AF57BA217EFDE2B993C73053EAF23C96C86982C5 ELISHA152
1,666,287,253 *AF50FAB0F07F5952E841445C4F3D9D2BD3E8FC80 [email protected]
1,666,287,254 *AF5AEC4069402C442BF59D2597016DFCEBF2F77C c84yw
1,666,287,255 *AF5542F692AFE4E3009A3F9F248CD466E74FEF25 pfhj;ltybt
1,666,287,256 *AF5B3D24B18E7AE95A05A94578B8440CC90F915A PI.BETA
1,666,287,257 *AF5CD0FCFC8845AE18FAA3226C037310EEAFCF95 CANRC.ORG
1,666,287,258 *AF5CFADFD6958C8E8AD92C0CF809B9B1D4FC0FC4 EN2081635786
1,666,287,259 *AF5DF12D1B3404232CFA7584647C0CCD21C6B1AF e"na
1,666,287,260 *AF5E6D7886BEE942FEEDD13414379719DB046F9B carbokyl
1,666,287,261 *AF59BCBA3669223EC96460C0321DF72A026D0D83 carmencullins
1,666,287,262 *AF519BF58E119DB873F253CD788505131F1C9BAE CARMINEWITTHOFT
1,666,287,263 *AF5C42525FF7DA8013E8EF4BB7089925EE5A0B03 [email protected]
1,666,287,264 *AF5CAADBC951A2304CC73F76C5F530E2273B9169 cascadiasing
1,666,287,265 *AF5849DA02129E79692D22BA19FC7445633E6DD0 c(b?g
1,666,287,266 *AF5E9899DC0146F019F68881CA04A1C359D11615 erikasaviano
1,666,287,267 *AF5C6B9F4D165C9CF4F11D51B22538F38FCE3A80 ERMEDIUS9
1,666,287,268 *AF57A8FE18BACC12E18280A9E4FD5355C4A1D759 PP *)X(
1,666,287,269 *AF5DE7C2962FE226B4E0B4F4FD1BB121D80FADD1 ERVEWRBMCPW
1,666,287,270 *AF5E6F8618490C288396AAA79D2610762280ECE6 cd/tv
1,666,287,271 *AF571C4320CA3D8C002DCA0D19E5B5B18582D4D3 CE):N
1,666,287,272 *AF51D915D9D7D1AD0D3EDDF308EC184069E101A6 PRIJSVERANDERINGEN1
1,666,287,273 *AF53784C261E5F10CB33FD4C507812F786911A6D PRINCIPIÁLNOSŤ
1,666,287,274 *AF56301A8059BEC152160F38B05D643787D33054 [email protected]
1,666,287,275 *AF52947BF40970FF6073C83B42901B3BD14B8EDE CE%V9
1,666,287,276 *AF5FE31004F0EFD2133A5179E745BA7A57EE4688 CGFSD
1,666,287,277 *AF59AF16B430C6D4089B1742907A308E5AEFDF60 CHANCEGRANT
1,666,287,278 *AF5AC414D69DBCE0A068D055CDAA7F3880DC1B43 [email protected]~0~o(0_<)
1,666,287,279 *AF5BB59701B5E25B3DC674B243292141DE971D44 EXCUSATIVE5
1,666,287,280 *AF5A58DA67815DAA0D7562D8D18D60B0FD662E66 EYAFALOL
1,666,287,281 *AF5776D60AF9F5DB5ED19AB08B8178AAAD7F4EDF q------D**Splat
1,666,287,282 *AF52C4157DBA2455299609D146B1C94105B6254B [email protected]
1,666,287,283 *AF5CE47F86F5651383F1D41A24AC5CC4585B87C9 [email protected]
1,666,287,284 *AF590C4303DDB9ABD8DCEDB113C51776B5255D9E Qu4druplc4+on$
1,666,287,285 *AF5DE286F04E3CEC9BE4A12A2B4150A56CA53338 f.~
1,666,287,286 *AF5D70C0DF3898E51B9B11DE2A27C7F20B740D19 farv
1,666,287,287 *AF5A437AA58EE644E76F4B23D4A549E687009C88 FAUSTINOFRANK
1,666,287,288 *AF5BEF781C9342995669F7EE5534B5F24C2FC8CD CHRIS.TAMAYO
1,666,287,289 *AF5F21A026A90F492B1625A76D7DAEB26AF95170 «rajive
1,666,287,290 *AF5A720439B5213EEA16C9374ED5F4DC7BE05345 [email protected]
1,666,287,291 *AF50857B7F750A5B8AFDABCAB91AACFD2C37198E [email protected]
1,666,287,292 *AF57AD0028B71237896C9CB7A23948F2BFB8E886 RAPID-READ
1,666,287,293 *AF5F8D0180B68A33E9E961E1B4FB9904199721BD [email protected]
1,666,287,294 *AF59D1E81A4D7051549AF7446D318E4F65C9F31D raymondwarling
1,666,287,295 *AF56BAB36FE18E5F7106224401264E4952E996E4 raymundoaurich
1,666,287,296 *AF550B5DF379E3F5E6E80B730EB159324B5AC5C7 CIEJ
1,666,287,297 *AF50A4EB54E11F5F8FF3CE5EF0830C4AB4313199 ferdinandkarrenberg
1,666,287,298 *AF57AC919D7AEA04CF78FC192CE90C7570882EB7 FERDINAND.LITTLE
1,666,287,299 *AF553D4A26E5BA0E506EF9A757DDFB0F67B51C22 FERIMTALARIMBAUD
1,666,287,300 *AF59DB141821E09390348CB049A8D4243ACBF81D rdcasavg
1,666,287,301 *AF515B7701E31E76F876890150C8FBB203DAD2F2 READMOSTLY0
1,666,287,302 *AF58A5224C832A51C06C49450DE0481F9CAB134F fi9ura+iv3n3$$
1,666,287,303 *AF5DB88ED38DEED43DBE0DEFC902750E1AB69365 FINNOWED0
1,666,287,304 *AF5F6B5EB4C676865197AAF30F3D7484B6A7D3AA FIREBALLJACOB
1,666,287,305 *AF5CA3D67E29C63F3FF57E7BA108F745AE52EBF5 REFRIGERATIONS.
1,666,287,306 *AF5C7D1A542DB37FBC1B1F812238DD9F8E0DC9DC reggiefagnoni
1,666,287,307 *AF5C9F223834AB04142BC61C62A07A2E50C681D4 REGINALDAUSTRIA
1,666,287,308 *AF521B5C53B2F5277F3DE949AF16C62EF06BFDD7 CLIFF.DENNIG
1,666,287,309 *AF52ADB6404C0980AC0284A09E1F23B05C3AF1F0 REGINNIGER4
1,666,287,310 *AF512CA69D4897095A534A5028002C05BB4D41D0 cloreen5
1,666,287,311 *AF554D7DE414536FE702A2BD57016A4380F3D9B2 F-OLYMPICS-BIOS-SWIMMING-BROWN
1,666,287,312 *AF5C2724444ABC4298E52DEDFD43F1AB4D5E7B22 REPERTOARO4
1,666,287,313 *AF5385C3E539982B0824F0E1CF4C6A7BC400E4B2 FOREVER610
1,666,287,314 *AF5F5CA16ECBEBAECF42D6B7B51E76C04FC8B84C [email protected]
1,666,287,315 *AF5DDA1FFD5076C266250065CB1BE005CA0ED7C9 FRANK.STOVALL
1,666,287,316 *AF5B41922D45267AAD9E8C35A3B146787447E9FC FREDRICK.BRAZIE
1,666,287,317 *AF54B2E80145B98E95A59EA245616A3F0317D8B7 RICHARD.ETZEL
1,666,287,318 *AF5C6FDADD7B77E192F9435DB184B46692626CDC RICHARDTUCKWOOD
1,666,287,319 *AF53AE7318E90B05354FBC7D3997C407B0995330 FREELESS7
1,666,287,320 *AF5963288FE0310446BE5754CC41AC44B994E781 RICKEYBONEY
1,666,287,321 *AF539811B7E30D40B5CFF3B330C4015B524BCBEF RICKIE.MEMMO
1,666,287,322 *AF550E11546C12E40B37C6E380F78CE3338BC1A7 FROSTYANDTHESNOWMEN
1,666,287,323 *AF5087EC7C0414FD47826BF6EB9537D90F543485 fuckyoudrums
1,666,287,324 *AF5D1A8F41BB5F3B7609413CF692B819FC58B992 [email protected]
1,666,287,325 *AF5AAB36BB1EEB3DCD4BE49A11413B11BFBB5D4C co+o3
1,666,287,326 *AF5606F40BA05402C8EEC90E8F53A699A33DEA5C robertschiavone
1,666,287,327 *AF530486DD0B9BF3873D1A93A4AD4983E3895301 ROBTFALCE
1,666,287,328 *AF590160A2F531D8183B0CF57C5C7E65A8196805 RODALBERTPIERRE
1,666,287,329 *AF5510DC3546D5BD5BA790433164C84489800E1E RODGER.BYNES
1,666,287,330 *AF5D7567F4C74BB595741E11FF93F32E130E617B rodgerduryee
1,666,287,331 *AF572C8244DFFBD3CE1A7D0D16711B445DF4698B COUNTERATTRACTION8
1,666,287,332 *AF5F512A7D9935F74D05CB6FF9595825EE936AB4 GARRETTONORATO
1,666,287,333 *AF5ED6CD2D39F5F078D2DF02C8EBC8900F7B9E0F GARTHFANIZZI
1,666,287,334 *AF510688C3F64BB5D5408FD2E7C17D391CBC65D0 rolandallgaeuer
1,666,287,335 *AF59AD1160EC20B7A821BF39C76CC2E840EAC71E c:\program.files\adobe\adobe.device.central.cs4\adobe_epic\eula\it_it\install2.html
1,666,287,336 *AF598FC22405C0266C3763CD47B676EC9C7C8F59 ROMEOESHMON
1,666,287,337 *AF55B84E7BE6AAA687B8E3638EC3A81E544B89C1 RONALDOFLAHERTY
1,666,287,338 *AF5152FF14E2040DEB0AC9CDF9AC4BF327192625 RONALD.SARVIS
1,666,287,339 *AF5C83B1BBF8CD874AE69080C3586360C65ADD04 C:\ProgramFiles\MSDN\MSDN9.0\1033\rras.hxs
1,666,287,340 *AF56427D110BE47426420FF77F4DD0A9B05219A7 gd*@
1,666,287,341 *AF5E611B35942369D9274549330B6BEFF025F8C7 GENTEELES
1,666,287,342 *AF5A03281050A493C4ADDF39F4DF19920AA4D071 ROY.DOUYON
1,666,287,343 *AF55777FFC01B1CF34C38BE85F3B2C7AE2867EE2 GEORGESHUKER
1,666,287,344 *AF5A3578693136593A77579BF61707798DB93150 georgia-perimeter-clarkston
1,666,287,345 *AF5253D83ACF686E38C2B5743656AD618260AD3B RSUMMAED
1,666,287,346 *AF5123153066FAFA2DF4E7E503F69EB2AB6358D5 GERANIMOED
1,666,287,347 *AF5AEDD87570B65F6F225DF366307C95EAAAB19B [email protected]
1,666,287,348 *AF52B02A8327EC7B6E80D77670DBB68869A98ED5 CRAIGRENZULLI
1,666,287,349 *AF5DA5F2D50C0D97E1D20002E36A12950A1BB8FD RUOTSINKIELISILT7
1,666,287,350 *AF5E09A6C89103111C99EB3815C436DDE3E510B0 GIAN-GAMBOA
1,666,287,351 *AF5CDF158DBB0714BB19D1121D5E15661B9CC470 gilbertberanek
1,666,287,352 *AF5E6F0EB9AB08BFC58F7420198789DE5DCBAD25 gilbertobuelna
1,666,287,353 *AF5DC86444730B0FFBA2AB35539FE66D8B43FEC8 CRINU
1,666,287,354 *AF5B396567C889D6DAAA02D4D4AC4F31C2C54475 GITTILF0
1,666,287,355 *AF5FBCE5BB1A9590751AE45407CACFE9F5FE84B4 c"rur
1,666,287,356 *AF5002B0BE04C4B5DFA09FDA507D110E4A730176 SA
1,666,287,357 *AF5D9DEF515EA0B2D4BAEBBF56A222D003BE2782 SABAHAT.AKKIRAZ.&.ORIENT.EXPRESSIONS
1,666,287,358 *AF5E829CF9A2236C90CE5661FD27046338DB0932 gliffnit2
1,666,287,359 *AF52F18A308D4F0B652F49CF69628AA5D8E27C41 SAGVCGQMQ1
1,666,287,360 *AF52986D35C5B3EDA5FD7036A805128F90B96B1C glucofrangulins
1,666,287,361 *AF52448B44A7382127021DAAE36D18AFEF9752D8 cvjti
1,666,287,362 *AF59D9F2AF31C43EC43E03C57CB49B25F5127289 CV$PC
1,666,287,363 *AF53FE8CD56AAFEC5335C6453BB60C06F7191725 cykiu
1,666,287,364 *AF50F931A1BCD9A84FAE26A69B295E283E0F6F3F cze3v
1,666,287,365 *AF52F0B67C406667CB2580800E3E87570FEBC21A grantpiermont
1,666,287,366 *AF5E041B4BC572ED9A299D364142A2E5D4E25794 granvillemazzaferro
1,666,287,367 *AF5E41A79B16372445F7E093D34A5BEC1CDA14D4 SANTOSHGUDDAD
1,666,287,368 *AF59300322640AD91273CC6E416036235301144D GREGKUKLINSKI
1,666,287,369 *AF51E24F0C60123914F818382394B688E6D82530 SATHIMAS
1,666,287,370 *AF5C204AA4E38E70256FF286818CBB6A6E2572D6 d1i$2
1,666,287,371 *AF56C2B25B5E5A0BC77FBD6D2B3AB754FC4732D5 d1rec70r$
1,666,287,372 *AF54DAD8E1CB9D04B0E422986109423DFFC1DA94 D2PB%
1,666,287,373 *AF5916281286FE0514BE673E5D40E8C8B6B5DA33 grubblaed3
1,666,287,374 *AF5497937AC8473F9FA26B788F1801D0DFBFB0F8 D3SV3NTR4I
1,666,287,375 *AF58BD4EC0A33D905BA5101FA7AD19E0532D69CD [email protected]@+1on
1,666,287,376 *AF5073317C180624150600FE5457B026FADA0375 d_4)s
1,666,287,377 *AF530A72659E573F3AB38104F15F631F674C7FAD d!6gm
1,666,287,378 *AF56CEF9BBEC7C7D6FFBB44D6031C84CF9C9896A SCOOBYAEHING
1,666,287,379 *AF59A57ABCFFB6B489977B96861A60B112197C3B SCOPPIAVISES
1,666,287,380 *AF5C8A37F9216EEDFE17A9B960B8BF851780A3A7 D7"KY
1,666,287,381 *AF5A20EEC5F451E26CD1E0E698E7BF5009E6AD35 scotvong
1,666,287,382 *AF5611F361F9F116DF340A4F6D1033336D1F3623 [email protected]
1,666,287,383 *AF59B15B06E0DFFE1E7F254B5D6AC4C2BB364E74 guprojektasltwww
1,666,287,384 *AF5F56A9664E1E8837260642C61F94217C95EC0E gz4+
1,666,287,385 *AF5B5D59E765CFE5AC9C79AEB75168CBD256FE00 sedilia5
1,666,287,386 *AF5E53278EBA09CE91D2F678E9944E14E58DF9A4 [email protected]
1,666,287,387 *AF558659BFE8229F1500F361F4BF73C267FEFF94 S’ÉMERVEILLERA
1,666,287,388 *AF58DE6ED5D58505C220B53EA74CBFCF4E6BA7CB HALF-MOON-STEP
1,666,287,389 *AF540C314F488B2DCACCE4DD8C4FAA316952AD37 DARYLHOLLAR
1,666,287,390 *AF5A2CBCC2B5C68D2190A31D95212B7274585ABB HANKBJORN
1,666,287,391 *AF5386C71017B3C76A2795A05C154E38CBF14C51 SETH.LUKE
1,666,287,392 *AF5B59A699716EB86E7343DC5AC9D343F88E007D severebt
1,666,287,393 *AF5490D432020A2394716DC0CF144B26AC7867A3 HAPPYTOBEHARD(NON-STOPMIX)
1,666,287,394 *AF5A5C43876F8048D580C38ACA06574E0D3BA6E5 harji-lal
1,666,287,395 *AF5A37C0EB696280AB774C14E56C2FB780CF6EEB dcd-!
1,666,287,396 *AF5506C71C92699032D3613D0161859EFD2DFF31 HAROLD.LOVEBERRY
1,666,287,397 *AF573246DB7603E8D8451CD1A2C36FAC313649AF SHADOWSTAR3
1,666,287,398 *AF50A879E0A0AEA143D146D276ACBD22921E3D19 HAROLD.WEBSTER
1,666,287,399 *AF55A0BE2E4C8195474E3AF6735128D1F3533788 SHANDELL-STEVENS
1,666,287,400 *AF5AD5493BC12D357BF605C63211321D0C270BD8 SHANEPROVOST
1,666,287,401 *AF585C87664261DCD01224DFE8E1E4CC78EE6DDF shd+
1,666,287,402 *AF58060C5B188F4CF952BC5DC64E22BE88E4DF3D DEAN.PENDER
1,666,287,403 *AF599529B14043408CF433A1A3D5E96AEFE9E7B8 SHERMANWECKWERTH
1,666,287,404 *AF5D07D05CEE21E7D0021D07C507CBD3F1665BCF sherry.beebe
1,666,287,405 *AF51195D7AB1F9BA15499D40ECF124CC011EBA8B deisean
1,666,287,406 *AF553296B17DA0477968A83D411E2DA7FDF80F97 demonstratief!
1,666,287,407 *AF5746032B39B5ACC9588C617B1B4EA9980E9AE4 HERFORTH12
1,666,287,408 *AF5CFC12ECF15CF107D8648942B1CC9280978E64 [email protected]
1,666,287,409 *AF5B7176B6E8E8F1BE90C89C545820B2AE0E3F7E HEVXEBATAN
1,666,287,410 *AF547903FDB657C8771AEA98CC5AD2E2345FF548 he.will.call.you.baby
1,666,287,411 *AF5F1C7BA0B7C5A47D83CEB613DE4E3C70F2B97C desde el bar
1,666,287,412 *AF5BC59ACF9CC8A26674D3FEAE5154210A628B5C Hidden.Spirit
1,666,287,413 *AF54830EE3AC44038C7A919110830DF4ADB11DFE histoirejaegerlecoultre
1,666,287,414 *AF5332D6DAAB94C07B31A640948E253AA09FDDF4 DH?L6
1,666,287,415 *AF56D97785C08C12372B0CD621694F9B13CB1ECA dh&wi
1,666,287,416 *AF58087A06B6E5AEF951B0C01BD6639901616D17 horse-blanket
1,666,287,417 *AF578F66FAB130E76C2A0E34BBEE8BDFC96B4181 dihvv
1,666,287,418 *AF5F8A9E84492C7DBF6A25DF2BD0DCC9D80ECE23 DIOP+4SE
1,666,287,419 *AF55C9681035862D05510272A4EFB2D8249F3517 HOYTWYBORNY
1,666,287,420 *AF55E7D31A1EB26B3717CC18A520BB7E7B96E235 discos.incluidos.en.el.libro.\".discos.que.hay.que.escuchar.antes.de.morir\"
1,666,287,421 *AF5E11C2019D9C295078CF85B44E93034BC80994 djaiq
1,666,287,422 *AF5B60A668F664A7919D0B2BE51045C0CDBBAA8B hughpilkins
1,666,287,423 *AF590C09827974B367754048533E650DB2DC8540 HUGO.GRINNAN
1,666,287,424 *AF528B6AF8B0A428D3438230D97EDFB869013F87 HUGO.ZOMER
1,666,287,425 *AF5A8AD516A799B84DFA10A1FFE18789F227716D [email protected]
1,666,287,426 *AF5BC11B0FC487063ADEC8312403BD637FBEDFB2 [email protected]
1,666,287,427 *AF598713F811D8A87681D0A4B20349489676F67D soppiatta
1,666,287,428 *AF56098CE0B0FCCEACA3C67594277D053A85760E dmr+w
1,666,287,429 *AF56773CE6904D48555F0B44961718E4085FF077 I4FH
1,666,287,430 *AF5BBBB67F97D6074271F6ED80FA122B91B94915 Splat~.~.~<####3
1,666,287,431 *AF5060A885EDAA8C99BF5801C1687F8A842035EF IAN.CIVIL
1,666,287,432 *AF5F4272DD9DCC21C967E1F26F7A14E9CE949A7A domenicpanchana
1,666,287,433 *AF50E9F9C70B713548CACD5455C8E3911C4BB359 [email protected]======p
1,666,287,434 *AF5E589659C297183B82BEB8C4D8C2F445EC7CCE IHCIKEUS
1,666,287,435 *AF5E416ED2AB0F59F1E724AFEBF8D2DCD205832F [email protected]
1,666,287,436 *AF591B2B81683749E964A2C0A63B1F8922FFDCD3 stacey-sugden
1,666,287,437 *AF5034C3BD1E3644FF586346F3A8DF60A39EB532 stacyghea
1,666,287,438 *AF590F31631E442D8F9C46ABC45D21EACB39DA7A ILOVENARUTO14
1,666,287,439 *AF56585FFC7C9B4C9439CE86BD69782268170D44 ILOVESPARKS94
1,666,287,440 *AF54A5A26763B1E4AF04B9BC8719A46664A8FC2C Dp)u
1,666,287,441 *AF5C6908A027CACDC140A787B89C298F46527F4E stream-ca
1,666,287,442 *AF58D456D80131F1F16D2B61476CF26540EC4A20 DRVSORRY
1,666,287,443 *AF5D6C55087D70886FD85C2271F57AA4A39B1E62 DS)J
1,666,287,444 *AF58F37FD8338E3EB7827CB59BB8749A49B4E88F SUCSINEHPS1
1,666,287,445 *AF5DE4FF948B4780E243DC9288241E07E0F05337 [email protected]
1,666,287,446 *AF50130106BB7F225DBFD8B0DABCA63C737C03C5 dthpe
1,666,287,447 *AF544C497ED862468994B0BC04F568ECE2792264 [email protected]
1,666,287,448 *AF5888E6B9F5D764AFB21464CD68BC7EA8F6B772 suiteno.3indmajor,bwv1068:ii.air
1,666,287,449 *AF520D63D0EE9891F06584E102355EB462ABFBCD dtu(f
1,666,287,450 *AF52BC0B16BE75AE443896C523049A230D05983D IRVIN.PENINGTON
1,666,287,451 *AF5EE7289478F0A97FD96C0FB73989FF89D23161 DUANE.ARMEN
1,666,287,452 *AF57589E8C90F73730F4921E0C546E4E5B9240BA [email protected]
1,666,287,453 *AF53725BD392191A739751B28125ABD6BCFC2E14 [email protected]
1,666,287,454 *AF52A6548A1E2832711B4195F56E3CE28A29C6FE ISIAHLIBERA
1,666,287,455 *AF5F98460D20F486B53B4D52D80E5C3B7D508B49 isiahmandino
1,666,287,456 *AF5D6DD0EB0665FBD06EECA82A5A8E0F2A6CD002 isıracak köpek dişini göstermez
1,666,287,457 *AF546B0752A7D2CCBD967D965D44332FE9605FBC ISREAL.KARSTEN
1,666,287,458 *AF544083FE11B5F3EB91B7CE7BFCEA4D17A6C256 [email protected]
1,666,287,459 *AF53E5FB5383F23C29422A281CDBD107C28FBFF9 DUSTIN.SAKAGUCHI
1,666,287,460 *AF5FB8817869631E208C0C6AFD8E14073B5E0601 itoomaning
1,666,287,461 *AF551B3B124613DD370F37E86DA31EAF2C8CBA08 duxc!
1,666,287,462 *AF5F111707FC006D888A432C2C09249885D64B14 SVMI
1,666,287,463 *AF5C6D933ACA72625BBCD852672C37EA7D346AA9 d#wpi
1,666,287,464 *AF5D092D51E25962E4F901C2244CE09763D5D6AD JAMAL.ROSEBAUGH
1,666,287,465 *AF5CF339BF99F1E207C5ACCF8E49D99E916BA49F jamelrabin
1,666,287,466 *AF594FA6D6EE78FADBD625473105C3197145D3CD EARLE.GARLITZ
1,666,287,467 *AF52E3617FE5656FDE8808F4992ED416D697FA9A ecb3g
1,666,287,468 *AF5D2112AB5EF0327A56FF1640CF122843CE13C7 EDGARDOGOULARTE
1,666,287,469 *AF5CE6BADB47133B7216C659F1295037B5B1D248 EDGAR.KRZAN
1,666,287,470 *AF5F32E09B81F297BC713FE0CF0B56FE780B34D3 edge)×
1,666,287,471 *AF5BFA1005A513658FB07ABDA5D5158F0049A531 jarrodnivison
1,666,287,472 *AF5060358DC929924AF62681C8C5D9EF0D525F02 EDSIERFA5
1,666,287,473 *AF594FF37AC3A19C108C12C093008492A01405A9 edwinburwick
1,666,287,474 *AF5ACBAA209BFC9BB6AE4B02FFF94330B48BC4F7 EDWIN.COSNER
1,666,287,475 *AF5E8068429449767C421026696D5FD48DD1E819 javierbonneville
1,666,287,476 *AF5B2E107E1D8A78150B19AF3BA2C3B0F918A6DC EEK/
1,666,287,477 *AF5DAC3D624F000FFAB3CCC169C8E623FFC7CAF6 EFRAIN.NIDAY
1,666,287,478 *AF5A09D269213E942F25BA1EA5BE9AE7B99C1738 EG1R?
1,666,287,479 *AF5EA2D319DE5F9A963B5EA7D4F829C7739E75B2 JEFFMANGASARIAN
1,666,287,480 *AF585262D59BD11EC3AF6D2FBA4867492272C553 TALKGNEVIN
1,666,287,481 *AF50608C95F36F599141B6AC53A2E6682E811687 ELIJAH.LENING
1,666,287,482 *AF5375CD65BC2BD958B7D0857D9A238FE4E7EBE8 eliseohakala
1,666,287,483 *AF5929A99C15B98EBB2D098A1A1FA542826521F0 TAMROFPFWSB
1,666,287,484 *AF54E335A7F319B1A1AC56436A9BAE69560AC345 jeremyhillis
1,666,287,485 *AF5E8EB489FBD66FC3626FE9CFF07D690EF6AA47 elmoneihart
1,666,287,486 *AF52961ED56025EDEBD1BBA9617A85612AC72658 ELTON.WINCKLER
1,666,287,487 *AF5665B54D39DB06A85626875D50919805753FFB ELVINCHAND
1,666,287,488 *AF580179133BCB0978822EE3BB9993FB2EF1D26E emenda71ons
1,666,287,489 *AF517EBD5CF2DC111054DBF8A60EB07440906A4C EMMANUELGILBRIDE
1,666,287,490 *AF5F0007CF3D1982A407CF8D2D9F7C2305BE39E4 tebustar
1,666,287,491 *AF5DA27D2015504B66CA1CA032B625FC1130141F emorybillinger
1,666,287,492 *AF5EEF953BC8757E79F69EA275E34296E2D8761D teddybruzas
1,666,287,493 *AF5EE9421DF48A512266FB6524B8280000BB3F64 [email protected]
1,666,287,494 *AF5286A8F0BC4855F8B838A7DDBB04D9BCB77011 em_t1
1,666,287,495 *AF539C925AAB308AA9FC827ED9610D4D57C4FC42 telcannip
1,666,287,496 *AF54247ABD9E74F302B34957AC5D7200C9E506B6 TEMPLEJTI1234
1,666,287,497 *AF5B805384F13232AE6E2983DF9AB6BF3975F8EE TENDERING OUR SISTER'S HONOUR AND OUR OWN
1,666,287,498 *AF529AD6FFE13DFCF43C351BD0FB8A6269DE6B48 ENDOCASTS4
1,666,287,499 *AF5A129D6C3D6BA5C0E10EECACF305A3BEAB74DC TEODORO.LOCKERMAN
1,666,287,500 *AF561FE42ED49AA1D1ECC2F88621C2396D4DFF3E TERENCESISCO
1,666,287,501 *AF5B8FA25E18C83D3E48CDAC306332A0F4CB9DE2 JOANNAF2
1,666,287,502 *AF5152226DFFDBEDDDFC2D08AB7EF6CBBCA914FE ENGELHARLHOS
1,666,287,503 *AF5A175315B4FB6461ED873CD6B1B9321D285279 JOEL.BARBARINO
1,666,287,504 *AF54A2EF6DA14AB6925FEBFFDF43342E2BDCE319 ENLARGE
1,666,287,505 *AF50C0EE272E67475FFB07CA363CF0C2A386C411 JohnLewisTrio
1,666,287,506 *AF5AB9B6612CFC180B1E0A1002B56B9F8C76DA94 enu3l
1,666,287,507 *AF5F3323BE7B3126A30D8DB633F6FF1430B45D50 ENUSERUSHISTORYUSHIS
1,666,287,508 *AF5BDF5C135917013C5DB67F250AF61260E0DA1D eoauhbsws
1,666,287,509 *AF5F59B6387D8B1EC6FBC12B1A7BC15FB158BA97 JORDAN.DOWSON
1,666,287,510 *AF5AD795274AE36C9778B1471B12B2AF984F8B50 JORDAN-PACK
1,666,287,511 *AF5CF334790B33DC537D8C6F024E068F28FC7715 thefirstrebirth(antidote'sclubtechremix)
1,666,287,512 *AF5B4B201E3DAB0D29984C7AA92BC920A9B1F4D0 ERICKOTTOGARY
1,666,287,513 *AF528C010EC3C8D0B418C474C1C421BC6206E265 erinniemants
1,666,287,514 *AF53BABEF54DBF3CAE6DE39653298A44FA180A1F ESCOTO
1,666,287,515 *AF5892E9BB1124A11E6F89E23B57FA109E8BE47C esisehtnys
1,666,287,516 *AF5BC50012E8C18475AF66C696195A46F46FB74D ESPAIOSES
1,666,287,517 *AF54059E04355B11B4263F5C18288380B41054C2 EST0NIA'S
1,666,287,518 *AF5897391CA2E01CC506DD4BFA6B74427ACA2A06 themebarte
1,666,287,519 *AF5EA91441A8CAC4E85C457A70D4652C70D5E88E ETATEGEV0
1,666,287,520 *AF5C0772EFBF904F9F4B8FC00435CB22A3701DA4 ETHAN.MIGUEZ
1,666,287,521 *AF5CD85AF56E6B8A606AC8D46E6E5B5B385DA527 [email protected]
1,666,287,522 *AF5A237703A702E66B66DEBA909F7D8462D81385 JUSTINKUCERA
1,666,287,523 *AF5526E188FCD9244325D0CBD18D8526247A8CE2 eugenefireman
1,666,287,524 *AF5EC3FCFAE7E55F14262E13CA90A7027BAD8373 eurotape
1,666,287,525 *AF528306CE787780D5405820738EBD51330BD2D9 THREEWISHESHEARTBREAKASTONISHINGMOTHERHOOD
1,666,287,526 *AF515DB5A5A696BE4323DDB57A074A72186DB8EB KAISERGESCHLECHTS
1,666,287,527 *AF59BBE29C57DA74C882776F5F5153D1052ECFE7 expandedbeagel
1,666,287,528 *AF5827CF5FA9DB68F9A92F01D89112E5C67855C1 KAREN-AZZOPARDI
1,666,287,529 *AF579506BC1D0C7E44F155A30C2D58F2013765FB KARTENEINNAHMEN
1,666,287,530 *AF50E9E05622C0A53977C3586E7972DAF39E0686 f0sterlin9s
1,666,287,531 *AF5E7EF4AD766807311BD4E9D18C67B05CA332DD tjd~
1,666,287,532 *AF5984161FBC2E53EE5BFAE1AC46584DCC7191A2 TOBERMORY'S-MUSIC-MACHINE
1,666,287,533 *AF55BD45D989250B83B397F49ABE60EE6A5422ED TODDENE1
1,666,287,534 *AF5DC123481008922084C03BD7CFCB121D761CB5 fargueur
1,666,287,535 *AF5A371914754E93EAEC4813EE501BE65740E803 TORGOVNIKOV
1,666,287,536 *AF5EC745412405DEC0936501743930C1694B895E trevprjhnson
1,666,287,537 *AF54B32551F780AB9200471E4DB58355D3FEAC16 triad-connected
1,666,287,538 *AF5DF798A2DED0369A629687112B23D2C2A4C1E8 kenosha.robinson
1,666,287,539 *AF5D193672B087EE00A01F2EF212256B29791A9E triplekchelsea
1,666,287,540 *AF5D4505144865F786FD1D531C92904D16378BCB FBRITTINGHAM
1,666,287,541 *AF5AB56D1CD862D36C7BB10A1CC109DD9ABBB187 kettlaro
1,666,287,542 *AF54F4F89F30C14E6EA260214B851FF5C53BEAC4 fendino
1,666,287,543 *AF59BF67836FB859B4CD711C742976DBFA981EE2 tshegofatsomoleele
1,666,287,544 *AF5B6E6A77E087111A023DB806BADF4AF164C7D5 [email protected]
1,666,287,545 *AF5EB87C90CBA3B06CED767B80C2BA538D2D2EF7 TURBWSJ
1,666,287,546 *AF5C2D39255D1F5661038D3EBD7166D3EA1BFF41 TURNPIKE;-GATE
1,666,287,547 *AF56C4D772A9840884AFA70DE37938BBD6782FDC Killing'sSafe
1,666,287,548 *AF5D2FDF1A6E264469C186784B4A1C09D8B14B7C TWGGSKENTSCHUK
1,666,287,549 *AF57D1E9716624F04BA0B7B49975C806509EF4AB tyler93
1,666,287,550 *AF5CC9E34A2F316D99AE5B724A9953D77A330C67 [email protected]
1,666,287,551 *AF567A6A90F25B4933678F203E4F18D9340EF4E7 tyz5fr
1,666,287,552 *AF5844063F094E82A0EBDF7D6617BD66F23363CC UCTEUE
1,666,287,553 *AF57C486DA1F25BB2A87C017063C4F0E9E4112DE KMKOJE
1,666,287,554 *AF5CBC9568DFF8C59541CAE1780F58C62DD3A2AA FLANGE0
1,666,287,555 *AF5E308CF0F07BD9F19F49942467AF2CCAA9A367 KOLANBEKOLAN
1,666,287,556 *AF5291FBB87A04C83D87B48754861E12F53A2938 KORISAY
1,666,287,557 *AF5B29DA5F74344CB8965194DC89DA00CCD52254 KR4DSERIS
1,666,287,558 *AF58486A6F6BB48FD50067A175C8963F17953633 FORESTSOFTBALL
1,666,287,559 *AF5E66592C6E32F6A68C7E55FF29DA5F780B8B75 FORRESTMANCHINI
1,666,287,560 *AF52A3D35AA93EF4E17C630F54BF56644A519031 UNIQKCAH-BOZS
1,666,287,561 *AF52A3C03693F47A2AA40126FD559B9533A3CFAE KSITSUEBBS
1,666,287,562 *AF511B71548002BFC67DA9333EBDA49D1B5017BD UNPROPITI4TEDNE55
1,666,287,563 *AF5B38E72F40F1F8C697F024D3D6907C20BD62E0 UN-SUBMERGED
1,666,287,564 *AF59483800A8EC57D48CC9A4B233546E7362472D KUOVEIHIN
1,666,287,565 *AF534C922282BC82896AD9F70C7B7F6CC5DF8964 FRODEHOMECERNCH
1,666,287,566 *AF592A8B03F21B2134960CEF109E234DED90DEE9 FRSTBTS0
1,666,287,567 *AF5E60648AA45CB6028CD8CD1F3E8BEDFE117545 fuksernes9
1,666,287,568 *AF51E89A25C3A5BB781A23DDF18FF7C0CA969FDB uscgonbrs
1,666,287,569 *AF58E7D0E0D43C8761A1275ECD8DCB7056E7C44C f_zq
1,666,287,570 *AF5A16CC4FA43FD922DE4999761937B3EE862FEE gabrielvaranda
1,666,287,571 *AF5F346FF05FB988FBB1003E70BC276F674473BD [email protected]
1,666,287,572 *AF5D56F1E609BA0694B35DE04AAE0E2AA60127EA laitahuoneesikuntoon
1,666,287,573 *AF5BB3EFDD6F9594CC33F652253309E0C95B4D33 LANNYOBBINK
1,666,287,574 *AF59F02622BD4C16772F55003922795946DB3F7F V1Z14V1
1,666,287,575 *AF537656509F425DB294B72A91035527C275BA41 GARRETTCRONK
1,666,287,576 *AF577EDDA082844929356122A66B204E2995686F vak$
1,666,287,577 *AF5F0AEAA0DD889CA73C563E44B0EA1260181725 gdofofzmj
1,666,287,578 *AF59CDCDC623A09E0BCCC88F0805A936A82FA518 valnoir
1,666,287,579 *AF5CA06B584EA841A1E9AF9A9FF0F3D0D2E5D3DC VANESSAWILLON
1,666,287,580 *AF522C51DD8448E53F3D4F98DE767C287755E35E GEMEINSCHAFTSVERFAHRENS
1,666,287,581 *AF5FCD5191B80A33ED3149705D3EA2191E6A90A0 LEACHIM0
1,666,287,582 *AF54FB884AAC3A68BE36C582C384748BF4753E88 GERBIILIT
1,666,287,583 *AF5AF3369E2E45AEB84C17CB74767A4480A75F32 GE]X
1,666,287,584 *AF5C4BEDC16F8099959D29A467E3712E06A1B299 [email protected]
1,666,287,585 *AF5F70E8B76DCC80DF573BF056E18DE0C0AEE365 VERAFINNJOHNSON
1,666,287,586 *AF54895DCDD52B1E7576E101BB1EBC77CEF51304 GIOVANNISIEMENS
1,666,287,587 *AF5FDAD8F55AFD6FBA01A1EB75A8C16AD72FCE6A veronica1941
1,666,287,588 *AF5A7E830893D23CE21847C21913D87A99E47FC6 VERONICA NANNONO
1,666,287,589 *AF5CD9C9613DE7BBFC5E0074093646E1BA2EE958 veronicarhetso
1,666,287,590 *AF573E596299C8A7062C14CE5B6F5429D84BFC22 LEONWALDO
1,666,287,591 *AF5CDFB764C70B00BA63B6635FA65100021356F7 LERAPPEL(SUITEINEMINOR)
1,666,287,592 *AF59B2B351ED4EE667034B5B03AA5B7E4F4AEEE0 vespaio
1,666,287,593 *AF5C12243F9D90ECF8F926C8E34A126A868E43D1 VICEFREE
1,666,287,594 *AF547C04AEA5025DB1E5BC99D0E46DE7553B58AA LETMEINNOW
1,666,287,595 *AF50709ACFCB45EFC1FC1D42D32601FE8E8940B2 GMTESTA
1,666,287,596 *AF5E9AC90948A337651E817A7302256DE8E5DC36 LGI,
1,666,287,597 *AF566C22F1B55B4E486CF197F6A8C18BD03E0BD6 [email protected]
1,666,287,598 *AF59F150786577322B7C34F0522E21978C94974B vincentlindorf
1,666,287,599 *AF57A945DAF64BEABD057057E105C58CB9C8CD2D GOOD TIMES BRING ME DOWN
1,666,287,600 *AF5D48899C7FD105D0387891E0E6D1F484797825 vincenzogeurts
1,666,287,601 *AF5DA5ED6725341EA3BBD03615F32D27E4E207D9 [email protected]
1,666,287,602 *AF5E4A7877FA98181D995301250867A334D76F4B GOUDKOORTS(ACAPELLA)
1,666,287,603 *AF573E25C434472E4EF819F1B592EF3B6EEE49B0 LINDAMANZELLA
1,666,287,604 *AF59F857B5FC17EF67DA0A0B0277A67A33A046D8 GPUと同じもので汎用に振る舞える
1,666,287,605 *AF57A16B5A2D627FAD12CD72B8CEE4839F8135CF GRAHAMREASNER
1,666,287,606 *AF5C3B090D6B192C788AC848DFF19FA78CD2A6E8 VISITINGSCIENTIST0
1,666,287,607 *AF5A8AC81DA842B3018EA22174BC2B991336A4BF VISSCKEDARLEANELIANTO
1,666,287,608 *AF591D131E9C3204418EBBEB1D1DF111F9BDE4B8 GRAMPYC
1,666,287,609 *AF5D20715EBA2FBAC99A9AA6004FB2F468BC912C vitányos
1,666,287,610 *AF55CCFC8637BBB80547AEE49B115B39950727AA vlf
1,666,287,611 *AF5FBAABAF79C97726016F5B5E58D8546873EABA GREGREBICH
1,666,287,612 *AF58EDDB3B1A6C73A8442ABCBF5CA461C203E740 lizdennehy
1,666,287,613 *AF58687B640A1342AC018BBD3E815AA0782BF323 l'n(bonusdisc:v
1,666,287,614 *AF52E9D6E87C29724389C9C0DA89B1438755E155 gruttenmeel
1,666,287,615 *AF53021BE00719A9930933EA51FEEE448584F7FB vw57jsn6
1,666,287,616 *AF55940A42A472D1D519ED24DB1F1C5F7686731B W151920
1,666,287,617 *AF5BA2CF774894BFA3963D714F302C497A7EC155 WALDVIERTLER-BAQUETTE
1,666,287,618 *AF5862A7DD07DC683E96791ED4E46859D729AC0C LOUISES
1,666,287,619 *AF5645A8D922A99C20209E780EA1E762AF3F69E4 warnerransburg
1,666,287,620 *AF55101F364412FD347767384B5598EE8A7961E8 warrenfoderaro
1,666,287,621 *AF5F6F8F85F5C5D5705BF5551E2E23F29C136BB2 HAIRSTYLINGS.
1,666,287,622 *AF5494DED0664AEC7F0F26738E9C667EACFBDA9D HAND DELIVERED
1,666,287,623 *AF5A873B075A4412A6C8956DAA9656CC8E96FF35 LUIGIDECILLIS
1,666,287,624 *AF5EEDEDA1EA734B14C8D82ECA58250BF6D10D70 [email protected]
1,666,287,625 *AF5CBC88BBFEC8FC487604671904458F73BDF0A8 LUTE
1,666,287,626 *AF5D6F839D29E96419B042A2293246BC9FAAED58 LYCUNNINGHAM
1,666,287,627 *AF577EF70C3FCDADC4B9606EC3DBB4C7C8136604 lymanfelizardo
1,666,287,628 *AF5876A1947BA40793FF1766A2EC40A56D357ECE [email protected]
1,666,287,629 *AF579A9051B2F7DB0978C48B24239FBBF6C70C96 [email protected]
1,666,287,630 *AF56D58644F764C08E36EE6564523F93DE35938E [email protected]
1,666,287,631 *AF57917FD98A74ABA3F67B060B4120D70A39BEDE [email protected]
1,666,287,632 *AF5513C2CAEECA06FA185D1F41844E4C6A24C467 WERAS.ESA
1,666,287,633 *AF58FF9FD25858E49E8F0C30B5F7460E5F1ABA92 harleydavidson.2003.(feat..jorn.lande)
1,666,287,634 *AF5EAEFE4900D6892F09855B904F38BD24E570F3 HARRY.TREE
1,666,287,635 *AF598A1628C97904FA1A4A2EC21AE3812935E2B0 WGOBLIRSCH
1,666,287,636 *AF5B0C329D481A3FB9000BFB64C637604ED9A026 WHAT.WAS.BURNED
1,666,287,637 *AF54895B0321CEBB1C48C7A2CC3D008DF940A224 MACROINEQUITY
1,666,287,638 *AF5289A05C4DB80A37A297C24772952CF6283339 WILBUR.FARINAS
1,666,287,639 *AF56107833C353959F42ED0D1C77D55D8CCD3C3F WILBURN.GARCEA
1,666,287,640 *AF5488DE91F128D0930D1E6559490E2936EFB77B MAMARTC
1,666,287,641 *AF554EEFB3D2C6AAB45BA880B5A027F7E528517F williambenstead
1,666,287,642 *AF597661553E02E6FA4803D357E90433004D2013 herbzaxas
1,666,287,643 *AF5AB59139B509E227671A208B64235332349BF7 WINFORDKAWATA
1,666,287,644 *AF5FE8808A5100E879801A92EB7BF1C9A747BCD5 HERSCHELZOCKLEIN
1,666,287,645 *AF54BABAB429FFD2CA627FAB8E77F1BF9AADB642 MARK.BRUNEAU
1,666,287,646 *AF59E7CC8037BDF1E8C891A9112CA0498FA64AA0 HETIETE1234
1,666,287,647 *AF5090519CA8ECFCA25A8A8C389E65CE388C2D57 WJS
1,666,287,648 *AF5908146C2937620D588DDC0E5241EADAD853ED HIStory(TheUmmahmainacappella)
1,666,287,649 *AF5F9312C976320E6A073840F648CDF39E446FCE HOBBITGENERAL
1,666,287,650 *AF50B1DCBDD41469DBEC745635D39EA5DD310569 HONG.GOLDHAMMER
1,666,287,651 *AF5FA888E76612378EB4FF21A646D2F36F5695CB WORKINGCAST
1,666,287,652 *AF5D936697A55F8BA52E5AE49289E5D6FE95CFD7 WORLDCAVEDIN
1,666,287,653 *AF5A15670C04EF4F93D42DCD5872B041E6B5C610