List database


# MySQL hash MySQL password
1,666,270,001 *AF5E54C4736D4177F962721771FF7863450B0D10 AGT%L
1,666,270,002 *AF5B536C6318C0B5DE37166586A9C88045335AA4 PB`~o><
1,666,270,003 *AF5412E1A2CAB17FC47E17841A6790878D438617 M1117AN7$
1,666,270,004 *AF5198DED3F714861E33C474805E1A127BEF7765 ajoitettuja
1,666,270,005 *AF54C3FF6F06E740E695C26660BDF5C2B577B1FD [email protected]
1,666,270,006 *AF5F5E53EF9FF26029D4EB0396800A93B600BFBD PERRY.HARRING
1,666,270,007 *AF5FC12098E6C6FCF69BE9BCF9F5780074060589 [email protected]
1,666,270,008 *AF5CAA482E2519548A56FF5C7C99DDFC7746478E PHILLYS123
1,666,270,009 *AF5525E352D763EF4C3BBADE49FE1788DFB001B8 MANGKULTURARET
1,666,270,010 *AF52DA471CF2363C321CF08FD4226BE75D58DD6D PICKLEHOMER
1,666,270,011 *AF57C6748B40638F1B5B8BD697992D41C51F0ECA PN:
1,666,270,012 *AF5A6A896C51BC383D7A9B7F6A0A046482C70FAD Alkm
1,666,270,013 *AF559291158EB579D650EE39A428406692D483E7 allegra.jaros
1,666,270,014 *AF5132417D33AB765EE01D1D5642D4F5D9CA8968 [email protected]
1,666,270,015 *AF58602A9D317EA16A4DB36F5B302CD9DE1205BF [email protected]
1,666,270,016 *AF5B792C588B5851FCAB1722631816AACA163F0F allenlira
1,666,270,017 *AF5C55D0654B54E17EF4080218877E17589F39C2 ALLF
1,666,270,018 *AF5445082D218AB94BA01779FD6784316ADFC2C8 marcofroio
1,666,270,019 *AF5449B7CE5128719818B09B6E9A647497DCEF71 MARCO.GIBSON
1,666,270,020 *AF556F6E1F7211B5D1C9C318F1D45B49A45C05BA allyrael
1,666,270,021 *AF5ED3FBBC7B4178C32EFC3F5E13ADEFDB143BD6 PP *)X(
1,666,270,022 *AF5EB732CC7E3E397A4140A95FA3FA22D89663C9 MATHEWMARIELLO
1,666,270,023 *AF58F641E9647524EC84AFED217DA263B7338E5F maureen-arney
1,666,270,024 *AF515CB1932A0D2993342F1D30894021F5C54461 maximoapelian
1,666,270,025 *AF57C56A50DE0402A8E54FC94559F2219110782C MAXMINE8
1,666,270,026 *AF55B06AE5CB15D49B85BE74E640D34A10477D50 PREDMÉRNEK
1,666,270,027 *AF50069EA2DA8770FC2A854DE8722B97C40A0672 Prelude.Album..An.Invitation.To.My.Never.Ending.Story
1,666,270,028 *AF540F6D55F6ACDA079A5E9ECA2328D40BAAC055 PRESOFT
1,666,270,029 *AF5B3477F2942F8AFA0EA586828347B859AA9DEE ALU
1,666,270,030 *AF5DFBD987524540B36EAB3AB1FD755D2C9FE5A7 MERLIN.ASHCROFT
1,666,270,031 *AF5CE15B91C1D23E32547FFF011DC207C98D6CD7 alw=n
1,666,270,032 *AF5BB1EF26146482ADA553D79AC7222BABA2921B Pull.Down
1,666,270,033 *AF5975FB373573256DF1518F18EBA75139FD777D MICHAELBASSAH
1,666,270,034 *AF5A2F0BAC72C55799F595993DDF22196E9714AA AMRALLEC6
1,666,270,035 *AF52B808AAEB334979AABE5307050EA05A131C57 microshogi
1,666,270,036 *AF54BD119BBD003B9ACDFF200C6FF09D75F0C6D3 MILOYSA1
1,666,270,037 *AF5D762F94ADC1AB7D93C35DBF61D751C193556D qD ~0~o }O{
1,666,270,038 *AF5FAEE8230303443B1D2AFE288D9A6C5D2F72DC MMRZTNS
1,666,270,039 *AF54CC3CEDE7B2B9552C87A471BBAB695BB88B1D [email protected]
1,666,270,040 *AF58D658C775BD30EF4FE24C85292B0C078486CA [email protected]
1,666,270,041 *AF59E9CAFBBFCF07C364D7170E1E136C89E5ACBC q__l
1,666,270,042 *AF50686CAC052565898EE2DC38FCE9E8FE6208E8 monroekridler
1,666,270,043 *AF51522EE1D42332E50B422BD27EB2B4A1431E40 ANKLEJACK1234
1,666,270,044 *AF53A284CC22D4FA51C3B53CF2F83B89165FB786 [email protected]
1,666,270,045 *AF5CF2C653206D4EE478F8017CA94D493308C861 Q).*{X}
1,666,270,046 *AF5CBCBB76DA443F1C2BA43DA6027B0C5B456E11 MOSHEMCGILVRAY
1,666,270,047 *AF5F5DD823453EC6DEFD8CD115C406E9E15BED62 RAFAELSISKA
1,666,270,048 *AF5B31071F6A3FAE5B36F0C7F862CA737BCF4A4F [email protected]
1,666,270,049 *AF5377B4F6478F480F1EAF41A25CC92E34FA5BE8 RAIFONNBLE
1,666,270,050 *AF56FAED69098DBF69CFC6CFB8FF41A4446ED941 rajashekar.gowda
1,666,270,051 *AF54173E864BDE3C5AF014022E821CFB3DBDD61D msa* secruos ddm s a rar
1,666,270,052 *AF5796F0D3EE3937C64EC503D4E3F2260CE1A954 ANTONYSKOKAN
1,666,270,053 *AF58D92A960C65F03EFF023BE04BFD62F5483358 anv-
1,666,270,054 *AF521F487DD5E9237E2F4CEF355D1678F4866CAB mxbssymk
1,666,270,055 *AF53C47D766D238F513B29704197E5E5FB58140B MYELOME6
1,666,270,056 *AF5F797160107A76C9993662E711C86771C3B098 raulmuniz
1,666,270,057 *AF51420CF2FF101DD24994FA2242622E45A0D41A rayfordstcharles
1,666,270,058 *AF59CC2352911828A31DCADF6D4CA8B1CECAEFE7 myroger131
1,666,270,059 *AF5930B4B3D3F0D684EBF39D75F89535746E53B6 AQR.I
1,666,270,060 *AF51EAD857C9F6204C4D9F6A0A93640DA0DE466E n^2
1,666,270,061 *AF5417D12225EE3DECFF0861255A266756B2B10B N79=--LOVE-ACTIONS
1,666,270,062 *AF59220268673FA668308C669EDC2EF7228551AC recopiie1
1,666,270,063 *AF58828B196C3475420D86A17EA48FFD784B2683 argentinapah
1,666,270,064 *AF5BF3617F3D5A1B0E5469BA7E6A15075FED331F RED.MOON.(VOX.CELESTA.REMIX)
1,666,270,065 *AF53BAAED051CA4852306E1E5D1B90475A2D31AC army2
1,666,270,066 *AF580CDFDA9800018C1FD4A9E4ED497708760111 NATASHANANCE
1,666,270,067 *AF51AC0C7FE2646AB3FE5FD00418CADDD728EE98 NAYAN-PARIKH
1,666,270,068 *AF5E9B7D64AEBA1B1B6F5C4C487F8D8B611F3999 REGITHCASROVKIK
1,666,270,069 *AF5C1FC10747C85E854E4635F2CAAAE42B4C2B2B ncc170174
1,666,270,070 *AF51EB48CC8DE0D2F999E860C5DA299F3ADB823A NEAR$GH+EDLY
1,666,270,071 *AF5BEBB76823D5F48CE9BBDD70C9174213C7153E NEERZAK0
1,666,270,072 *AF55D177D99B59E8E7EF4F597A4AA0BD9B94F12C Arsenicmold
1,666,270,073 *AF5C7E8A3FD459DBB57D04F3A15044AB1F8DFB11 repusalemap
1,666,270,074 *AF502BF1DF448294E5528BB75EA8E89452614EB7 RERALKFU1
1,666,270,075 *AF50A9816774435BD71D9950EE753CA14137709B newsog
1,666,270,076 *AF574C7AC53C84AFF38784BDEC14BFC5FBE33A39 RESEARCHREVUE
1,666,270,077 *AF5930FCFD0985FF832AC2ED64D8FBE57257840F RESITUATIONSGERECHT7
1,666,270,078 *AF53B7441425BED524C759ADD2F4704A10FC5BB4 NIMMING7
1,666,270,079 *AF5B51B4D392D9C4EDE2AB4C80DE6FC83ED8F4C4 RETSULEDS
1,666,270,080 *AF5CC9CA5C60463D181B2307A03C8C2D20AC44C7 NIRJHAR ROY
1,666,270,081 *AF52AE9E2C9A33FF666264B22207E4606105D43A REX.BOLDE
1,666,270,082 *AF518E65A5E50D407961F330C16CC4BBC8F02591 NNGSTCL0
1,666,270,083 *AF504AC8EFFD1FB2F79674A97698201F48BF00D0 atnisiapping
1,666,270,084 *AF539AC283BF8349316604EFD44CD14BAE675E72 ricosvedin
1,666,270,085 *AF59CF1C5F0FF2A0873F73CC963F58D1C2D5D1DA NUTK
1,666,270,086 *AF555EB67861C882DEFBBBE399D1BF76DF3610EF (o_) ` (##3
1,666,270,087 *AF5DF3EDC5AAE65F988C00CF36E5C8199BEB6C3C AUBREYBRIGGS
1,666,270,088 *AF5FB9AF2A57737545C9C8A035CC7E99540192A6 OBELLEBOS
1,666,270,089 *AF5D17AFE00B73DD73549F4D67F45E2ABA127DBB augustinebayouth
1,666,270,090 *AF5C057C51FA00D8C5B7C089A5BB39AF0004AE7D obligatorischer
1,666,270,091 *AF54766995801F08B1D742CF60A4471F77974E9F r.jag.en.vals.(do.i.hear.a.waltz)
1,666,270,092 *AF58784C2E2FC22789527CDBC005E1C5334E0CA7 RNETICAL7
1,666,270,093 *AF52A6D4CD2FCBE74CCF6284E470FDD1D9BAF332 $AUROMATI
1,666,270,094 *AF562DD4AE985B34FAD25FEA6B72A0BE8D2C9CF6 AUSTRALADVENTURES.COMWWW
1,666,270,095 *AF5FAF8F476A09E93DCCA1B4B1B4954F16C36254 ROBERTO.BLANNON
1,666,270,096 *AF58F8331B0EC0C4DD03875731584B1FDAEEDAAD [email protected]
1,666,270,097 *AF576962AA82B09624D5B7618BF7E029D317A246 OIVALA
1,666,270,098 *AF5A1441AD96D5BE9D11C5305358E7DAEA012CB1 OLFACTEI123
1,666,270,099 *AF500DFD28FA7BA8E7978CED423CDCBAD5458ED2 OLLIEDEFFIBAUGH
1,666,270,100 *AF57BA2DBCB3F56A0CB440B9908D65932A65DA69 ROCKETKITTENED
1,666,270,101 *AF5597CA3ACE4EA68692B422AE6248F4C8F63C99 ROCKY-&-INTELABEAM
1,666,270,102 *AF53BD153850E275D7A9E9599731FABD77DD277B ROHKEAAED
1,666,270,103 *AF5F48916A9623B2F132D55A071228C101755E4D avonwilliams
1,666,270,104 *AF576B90E5E6176F07C10D683186621D3DD037AE romeoandjuliet,fantasy-overtureinbminor
1,666,270,105 *AF51C4BDF50AFCB6929B23876D5BF444049330E6 ROOSEVELT.JASKOLSKI
1,666,270,106 *AF5DB3C2D2394FF9D58EDDB8E4C6396D9BFEEDC1 a;%wp
1,666,270,107 *AF585503357AC13D965C560643AB14273AA3BEFB AWT4
1,666,270,108 *AF5E8EB87D3BA38F541B0D8FD1D3B7482B515E7B ORDIN
1,666,270,109 *AF531C50F1A90B36EBDB85D38D22E6D13902D90B rubbaboo8
1,666,270,110 *AF52E227C39AB82DCAB288B54A1B6E040621792E azhar.ab.rahman
1,666,270,111 *AF5E8AF5883F97E00AF2E2C468D14FD81302DDE9 OSDEMOLDAVIA
1,666,270,112 *AF5F39ECCE8EB01312F05CED3F9ABB975CB2AE39 RUDOLF.DILLON
1,666,270,113 *AF5428AC1A270840B95CFE13F73E0AF8DF6C1320 RUDOLFFEKETE
1,666,270,114 *AF59F2623FFC80EE24B5AA961299595050B65B82 OTRZEŹWIONA
1,666,270,115 *AF5DFB433FCFE36FFF630302FF6E836DD5C3A7A7 B0EL.
1,666,270,116 *AF517C8079E7008B20D3D95430041537F0847F34 b0q/9
1,666,270,117 *AF524089C26987E273DC03453FC2E0E3A7DBEB81 >B0~QP
1,666,270,118 *AF5F5ED187B9007475B6248CACC490B21392D46B overbrutally
1,666,270,119 *AF555719DD6C73E8CEF30DE6CCA9179C9807F58C oy>i
1,666,270,120 *AF5987784E6032B74BE729BD32192BF225D56780 SA
1,666,270,121 *AF54ADFC71F8340DC9AB31851335260A8C71E694 sahibra
1,666,270,122 *AF53FAA6AA9BC5F7C918F76C935C027B4902066A SALCELANO
1,666,270,123 *AF52C2BC1699756DF9ADEBCE48465AD95374A966 b1hiz
1,666,270,124 *AF51EE247633556B9EF658612B856D1A435B7AC2 B2tl
1,666,270,125 *AF597A5EFF43353A58CDBC4B57BEB1E781E525A9 sampl3.vi
1,666,270,126 *AF53BDECE178FD3074686D627522093515C60010 B5s_
1,666,270,127 *AF54771B78E9DF6FD6C05FD0A7DC3050315FF3DB B9U(:
1,666,270,128 *AF5359711DFB6D1E5A86C04BB5DDA24C238489A8 SANTALACEA
1,666,270,129 *AF56518EB7C7365E706F1FDB51DB13DB9A11F6D8 ba.(feat..Daniela.Mercury)
1,666,270,130 *AF50C0828DDD681F05FB25780B0E1485EF3EA0C8 BAH%#
1,666,270,131 *AF5B0B110DC88DF13A2810DA5B445396A502CE25 sarah's.voice
1,666,270,132 *AF52DD30ED897EA662A2E2638671DC9AC7B4B472 PARROTWOODY
1,666,270,133 *AF5FB382CFDE8F376BF552BF7E95059A1422135D SaturdayNightRendezvous
1,666,270,134 *AF52EDD4100B5E609A7D1B8A2FEB1A9C669A9EDE PAUL-BLOM
1,666,270,135 *AF521986D5D8EAF53EE2E083A3FCD9594C8821A8 PAZDERA6
1,666,270,136 *AF54D592D8C151189CB5A5CB6E33C891267AE9A0 BASELORA
1,666,270,137 *AF5EB57529C70AB389033643258B743D2DC49064 BDPCS
1,666,270,138 *AF51C460F2AB26AE11A3CC674458ABEF8830F855 PETROLEUMSTELLEN9
1,666,270,139 *AF5A8B5BDB5E4930112B4787B3EF8112B1EFFF77 sergiocisco
1,666,270,140 *AF50CF794CF32F88A3CBF35BE80F8E5C20365659 sergiolazarine
1,666,270,141 *AF539B491C3F6A64A2FC3CAD9C03C98BBD705903 SERRA-BARBARA
1,666,270,142 *AF544B65C1282AC38B371455502D773D63984737 BELIFON4
1,666,270,143 *AF5F978E21D6D1BFCF8CE79EF5ECB696F32FE58B pierredeupree
1,666,270,144 *AF5AB5FC038FB5151A7538D6F95F68ED0DB7F609 PIGLETCAROLINA
1,666,270,145 *AF58996E3C28976512B29DCDE630689F4C6B66E3 shalier
1,666,270,146 *AF54EEBD729D945958A69589385984880280E760 BERNIEESTEN
1,666,270,147 *AF5D0326EF2688CADA212AFD0FCD7D07C4ADA094 ber&str
1,666,270,148 *AF5E0E783D4A546977F8CC2BD8DA6B99DA0AAAAA sheanomination
1,666,270,149 *AF5A7C7B5595623870FCBEDC5DF6852727C32B3F SHELBY-ERIKSON
1,666,270,150 *AF5EF65A2D67402E23A67DDBD9900F1E81400475 bestokene9
1,666,270,151 *AF5F0074E445CBA39AB997DB3038DEE1AF575F10 [email protected]
1,666,270,152 *AF562D38B6A3E2B3A4D3829E0B7E2574FFF9F4F5 SHIPPED19
1,666,270,153 *AF51ED317CD8998D96F8751444F045D66B642F36 PN:
1,666,270,154 *AF5FC0C88DF714936A941E352127B27BFC7E936A shrenik-bohra
1,666,270,155 *AF5A27D9A05F6D4217A815D7B0CCE8047E7A1A52 B(GKB
1,666,270,156 *AF53E51FB85AE2E4F3BE26C90B22D06A9497C305 siffrased
1,666,270,157 *AF511A32668FCA6C2D4C25DED073FE76EA0AF266 SIMONDALOISIO
1,666,270,158 *AF5ED1D32570AD1E8B489FEDD84D43263E3E1A54 [email protected]
1,666,270,159 *AF5F413AE5BC834C55AA810C86BE253196DB5DE1 BILLYCALDERWOOD.COM
1,666,270,160 *AF5DEEE3792D809354EF937C5949A0DEBAA2786D P##P*.(~_^)
1,666,270,161 *AF5C6FEBCE1A94CC567A1A5FE03B855FF8965AC0 skarvflybreen
1,666,270,162 *AF5A2A93490077771A936D737023E60A62B1A8BF prayertoalandlord
1,666,270,163 *AF512180B23EBC124994F73A9A26A2BF5619C838 PRISCILLA-MARLEY
1,666,270,164 *AF5C897CFD4803F89F27BB7225DF45F9F1E1C371 BKVBM
1,666,270,165 *AF5CCD4B16A4A69DC7EFC8A06A9E05A9624BBDD3 BLAKE.PORTERA
1,666,270,166 *AF553004173C09D0EBA8B2CB4A8B2979CD471C26 solidworkercomwww
1,666,270,167 *AF5DDAD7EC27E290A3F3343248AE72A54E9D30E4 sona.man
1,666,270,168 *AF5E982BB757847FCD431790D6C3BBA878218FAE pttelemn8
1,666,270,169 *AF5B0DB3893BCC3C8AF4E4CA6B4EC2F248A5E3C2 b$m,
1,666,270,170 *AF5C8AFFF18D3B812D22645CADA911FB12218BD3 spett
1,666,270,171 *AF5DB3A33A106AEB1CE5233718B1D929A2C71A8D SPIRIVAS
1,666,270,172 *AF58AC6F2378467C18F939203599E7B3C433ABAA splat! o~0~ <=3
1,666,270,173 *AF517193E01105336D9A4835A5B4D41332FD913A bosplaat
1,666,270,174 *AF5F884463EEFCE98BC639EEDD00FEA6A4CC9A50 QUANTIVALENCE4
1,666,270,175 *AF591CE3E81168404B3A383BA20277A9D22902E8 BQPM?
1,666,270,176 *AF5D14486FBB97EBD87396B55CA0B6270F46BA7F STEVIE.EGGENBERGER
1,666,270,177 *AF50A28729E46F5537B50B37DF574BFB1CB3B723 bqrsl
1,666,270,178 *AF593AC793564CBD2D58230DB10D769765468781 “STICKLER”
1,666,270,179 *AF5BC25D8272AEF11D2671AE0284F676491D5284 brandibigelow
1,666,270,180 *AF57F0FFFB2D9A6B67CCE8757F7DD0A824D3BE5B b+rbt
1,666,270,181 *AF549F908DD300216B8FA0A8821AE74961C8CC3D brenlin
1,666,270,182 *AF553D410814BBB56DA1428CAD46994AAC61C992 RAMOOD.6.0
1,666,270,183 *AF5AC06E68AB60841482858A892316B4E636FBD8 BRUNIERI
1,666,270,184 *AF5BD8A08F3D1A394D962744EC76F5219B9738D7 [email protected]
1,666,270,185 *AF5F4F0C5DFAFF9AE8DE89681805878635E2CCEC BRYON.UMBRELL
1,666,270,186 *AF5D91FF1E1BEFFCAB084212A8788D2122591DFF sublime92789
1,666,270,187 *AF57D5FB19F7B49113294F8E11865D34A07A1B08 SUHCNELE3
1,666,270,188 *AF575F3F7FD55977063B94B621132A8DE27B761D REALITY.COHEN
1,666,270,189 *AF52F493A66D16F41EADFE9467ED3AF1E171C10F REAYLIL
1,666,270,190 *AF5DB558BF5B0C557EC6CCB4F0AD05020A05FC8E RECKONERZ-(FEAT-CHALI-2NA)
1,666,270,191 *AF5ACDB770C9E42D45EB1C8DF74A03DD0C510A62 BtVW
1,666,270,192 *AF5893C9E0D4C2453F8E02E9509B1717CC3BD38A svwz
1,666,270,193 *AF5D04CE2D274AF3F3D1BA80E0E1D1F95F785B44 SWEET-GERTRUDE
1,666,270,194 *AF5666C9F45E6002E6C99A7805CEB1F734A363D7 büchsenmacherhandwerks
1,666,270,195 *AF5E9AD6807A3B21DABCBDFCB7E086F963658589 REDOUTERIEZ5
1,666,270,196 *AF5C5073CFC4E67D3E6CE6E3BF40659F2147EC96 [email protected]
1,666,270,197 *AF5FB0DDA8A5224D558973D20ADD07B0DF9418E2 reinaldowaychowsky
1,666,270,198 *AF51DA20673DC18FDFFF39AB320FBD1CE6C67D50 bustergoodloe
1,666,270,199 *AF5EDAE53170833E95D883DBA91E572EEC480546 BVBVS
1,666,270,200 *AF550B5B77A6FB026829B997D06C0F1976FF2836 bvo)"
1,666,270,201 *AF5209C1DDEA291E09E5D37C6A27BAA26E6534DD b)_w
1,666,270,202 *AF54D0D2086E1E5897B1CCAA36722CA0E8496510 RESABIARS
1,666,270,203 *AF5981C47CF807AFEF8AB900EEEEE8DB41EBEFD1 T66480
1,666,270,204 *AF525345BAC690A7E48F83C6C1D704B495145FD0 bxup
1,666,270,205 *AF542EB8AFCB6B3DFA167D71F5D78197320ABAC3 TalkSomeYakEeDak
1,666,270,206 *AF54A17CCF28C106576245A333AD98EC04E1FDA2 c2a2b
1,666,270,207 *AF5E10A9437EDCDB2CCABA679834FFCF1ED01106 c3n)n
1,666,270,208 *AF5C5BFA0C220160EC59020575DC4B1085DD557F RICHFLOWERS
1,666,270,209 *AF5D6BE861567867FDD59753A36B2EDCABC99C49 RICHJANOWIEC
1,666,270,210 *AF504D99FD77ADAE6AE70DFC3B4266E56836AC80 [email protected]
1,666,270,211 *AF5C9EF8A04B60630B9FAA2161FF73F3BFEDA108 c9m(0
1,666,270,212 *AF5E7B5E9F36A447B044D5FCB07088EA8504B2DC c+aeg
1,666,270,213 *AF5E591BA33105A130AE861773CEBF77B7153C21 RLOVESJ2
1,666,270,214 *AF560DF76AFB83DED53E145B8DAEA581BCFF30F7 [email protected]
1,666,270,215 *AF5A51A532EB81CC23892E3F6A03D91220E63CE6 TENNISREBELS6
1,666,270,216 *AF5427A0CABA7ED6DDDC7E881CA9F0A3F87AFFC8 RNATTERRAJA
1,666,270,217 *AF5A41A73F03053DE9F2E5B96204A11BD11D4A32 CAP36
1,666,270,218 *AF5633AFDAB993EDDE94CC5CC1403DB1CCC54621 CARLO.HAUKE
1,666,270,219 *AF57BE4F52C2F05DBD7B44BF21A29FCEA3B5DAE8 CARLOS CHESTER
1,666,270,220 *AF5E4F8BA2D24C03C62BEA26AECB09E15B065F74 ROCKY.MONTOYA
1,666,270,221 *AF52C95CDA8ACC2A06B7A0AC5DA93228286B025C RODERICK.HALLEEN
1,666,270,222 *AF5B2B36AC0B5C22C7AA3CD6ABF33CB904011642 thaddeus665
1,666,270,223 *AF52D05AC08A5789C536D50953EA1D794CD5ED50 THANKYOU1995
1,666,270,224 *AF5F7BD52106A3A82ADE235D8B81B123C620674D ”CASTRIES”
1,666,270,225 *AF5BB12C463DB9C2522F4F45BDB61694680E9C00 CATEGORYIRISH_HIPHO
1,666,270,226 *AF59C0E6FEE3FAA7173E113261770AACF6A43966 ROLANDTENEYCK
1,666,270,227 *AF5C136CEF56988807C5641CE73335409B399463 THECAMOEBAE
1,666,270,228 *AF58E35C59159076A3C6822F6CE1D9925D41A122 THEEARTHONLYENDURES
1,666,270,229 *AF5F2AD943C05E70C5C7455B61DDA411FE6C5148 RONNIEGOODRICH
1,666,270,230 *AF5B253180A4D4B3E9F8B6A5CCF35017AB210689 CCGVL
1,666,270,231 *AF584C2F3B8D1D081D03BDF7FF68457FEEB928A2 ronschaal
1,666,270,232 *AF59D017119C7E960D54E8DD0D56A15F0E5D2E2B TheOpticiansChair
1,666,270,233 *AF5AD533732FF73D2AE06A06710CC22FAE34DD43 C/DK1
1,666,270,234 *AF5992EA186E0EAC63049C64F007ECCD23207FB5 CELICAASSHOLE
1,666,270,235 *AF58F6C1359B85AC19DEB55512256987DF244F09 RUDY.LEWAND
1,666,270,236 *AF59B334B9A5AB29AE1E236EF8870A53D4190540 ruessav-2
1,666,270,237 *AF5328149837192F00216654A6EBF54AB0B11CBD RUSINEZE
1,666,270,238 *AF55C4D43345946C0D414D14D71C3732FF973DB1 RYANLINEHAM
1,666,270,239 *AF5CE857F2DD477185229B553C71BF551A6A7EF2 SA
1,666,270,240 *AF5D2D4E1A4FB64C9B6DFE5F781873C2F4FCEBDA salikennapp
1,666,270,241 *AF5E5794779322D11E26FCBF610780D8623C8F12 SANFORDDAVISON
1,666,270,242 *AF594B52AADA0965DD6E08DE3F7658EA51119137 santiagospallina
1,666,270,243 *AF5AA27EDE6A2BC7F0D5224374E1B625F7E7C088 S+APHY1OCOCC!
1,666,270,244 *AF5B49154F36E9458C33397C1B432CA18B972E46 SATCHITM
1,666,270,245 *AF54F884B37B196BDBB990A6D544A0F7EBD53C82 TINKUNWƆRƆ
1,666,270,246 *AF5EF58755CD20E85D25D184EBD4E84B56CE315D CEREBRIC
1,666,270,247 *AF50D266309A769F960793AD92006F1B70B6072D TKWNNA
1,666,270,248 *AF5F124A556BEC47A9E28892AC0AB799EB187FD3 SCAFFO1D
1,666,270,249 *AF5E23FE52EE536062923094460888FBBBC91D18 schafgotschová
1,666,270,250 *AF58476F9EEF1A30C7822E955B2053162B57574B CFS,Q
1,666,270,251 *AF5CFE15A33DA249FE238D3B8D8B2CD38D21EF8C [email protected]
1,666,270,252 *AF50E2EB502E18122CB2A082D3D3040522F3B037 chassharber
1,666,270,253 *AF5CD2C87A988E793B064CC173A2BAA0F692409C SEBCONSTCOUNT1
1,666,270,254 *AF5C9AC995A98696B81A9C48E25DBD250D5CC094 CHB_L
1,666,270,255 *AF5FAB165F265FDC20676089AA924EE6981D26CE TRÄNENSACKS
1,666,270,256 *AF5C6398E15EB86FCF0B43671D75BCBDA9579517 CHILDRENOFTHESUNREVISITED
1,666,270,257 *AF59D953BD8C388BC798A4DF2612A18AD5BF08EC CHIU、本名:趙慧燕、
1,666,270,258 *AF547DC740527ADEBA9A6431924CBA63FE367410 SERGSS
1,666,270,259 *AF52470CE419930EA93894A60D41E3F15A9DB2C0 [email protected]
1,666,270,260 *AF5ACE624B2AB77C2A27CA7B5F904E526405B739 CHRISTINA.NADY
1,666,270,261 *AF5C01E9BD81C532D8D457E1C6EC04B6D249B462 [email protected]
1,666,270,262 *AF5760047EC09D59F55B1E1FA9C7B6765FD73ACD treasure.mcwilliams.stjohn
1,666,270,263 *AF5298438D17816691EA5D28D7FDDA6E020A400B TREISZTA-ROLLAND
1,666,270,264 *AF5038CB3A1F14A0A0421746C4339E7B530CEBFB TRENTHAMTREH1NTHAH0M
1,666,270,265 *AF5A91DC7A7741C5E37154FF8C7F36494706DA8D S$GA
1,666,270,266 *AF572D7CC0647455E1F530966C880BBF7159DFB0 TREYZELLNER
1,666,270,267 *AF571D5E0DDE114DF2E8523D14F4EFF1CB190D6A CHUNGGIFFEN
1,666,270,268 *AF532F8F39582598B7D7EF132836E30116660C95 SHANEBURGE
1,666,270,269 *AF5E786A643A542CBA5E4CB4E33F863487D32403 CI1VR
1,666,270,270 *AF5FA488CA38DB9A7BE0FE5AC936758E416A4DD4 CIEJ
1,666,270,271 *AF5A531C0677AD9CD6E1E0CF9EE183B3075E43ED [email protected]
1,666,270,272 *AF5A8DCCE55E0B3CD212A708ACC0D4432B17CB3D cjla-
1,666,270,273 *AF551FF4265C94C34FBB7B77700A41E395FAA031 SIEROSITE5
1,666,270,274 *AF50D5269C67E8207A4149592C430AE618C1F47C SILENT-RESIDENT-HILL
1,666,270,275 *AF52468E799AE7CBA50F0B0BBA7CE7DF0B8DD926 SIMULION9
1,666,270,276 *AF5D5EABAC6EC444754C9780DA528F8E2D23DBAB CLIFTONREADENOUR
1,666,270,277 *AF563F2967138A3B22C80B6D1CC3AD5A166C9316 TYLER.KALEY
1,666,270,278 *AF53C1F2BCDE0487A9C8FFE930FCAF404F02C839 c&lob
1,666,270,279 *AF56563CF6762409E2456A22DD990F4AFCE81117 COALPOTS8
1,666,270,280 *AF5FF1128BEC848D0A1D642F8DCD05E6A5D2547F COCCYODYNIA9
1,666,270,281 *AF5A65B63BE56CCA6064E18D71A919C0805698B8 COLEMAN.DINAPOLI
1,666,270,282 *AF5DD6C327FE08C6501202277EF437496E8FF285 COLEMANMALTBY
1,666,270,283 *AF595128A48B9FB438D5DE4D599A7735C0256F25 COLERAINEJIG-MUSICALPRIEST
1,666,270,284 *AF57436DD84CB86CAA70B962DC0E3C79B395E5B3 [email protected]
1,666,270,285 *AF5B51231DB7B945E4B0C73103B8464AC1171879 SKHANGAONKER
1,666,270,286 *AF5D85670F4DD6BD0B63F2FF21129A54643A6DD6 TZWANDEN2
1,666,270,287 *AF53AEE33B2951C005FA4649F55047196B528DCB SKROBAKOVABYLANAHALOVEMMESENZACNEDRUHASVOBODABRONZOVY
1,666,270,288 *AF50E7ABB8C3CE0A50C148E356373E3ABCD7A0F4 SKRYSTOPA
1,666,270,289 *AF5A9927CFE4FDE5AEA0E3C19CF85CC961CAECDF COMPROMETTANTE0
1,666,270,290 *AF547849047648B69333E52A939F25DB7CAD1D2A SLEEP.ELUDES.THE.DREAMER
1,666,270,291 *AF53B73B421FBF0C64DFB8016D6AD5076FD77124 SMEDEMA3
1,666,270,292 *AF5E29D7A75D287F95CA0215ACD219C971D51BC1 umaergillani
1,666,270,293 *AF59796A045710203FB184A7395A94E64118417B SOBREPL
1,666,270,294 *AF5F688FD7AEECD12DDDAB7FDA27A3EF64B4255F UNN
1,666,270,295 *AF5FEC33BB84FDE7E35A85FCDA3C32B999F86709 unrighted6
1,666,270,296 *AF58A703B9AB8397D9A00D26959AD220D0F57AE5 sourcenotice1class
1,666,270,297 *AF5695D1F65591A35064ED1C9587668ED141D4C1 C:\PROGRAMFILES\COMMONFILES\ADOBE\STARTUPSCRIPTSCS4\ADOBEBRIDGE\BRIDGE3JSX
1,666,270,298 *AF56ACCC1C2031C1286B7F4CDA50A6402C73F268 SPECIFIKATIONSSPROGENES
1,666,270,299 *AF5AF6567459FD43C19FB5D46B1EAAB59C504D66 SPIDERREDRUM
1,666,270,300 *AF54D6E69342618C5E2A9182680F3EBE47B5D5CB CRAPPSUPPORT
1,666,270,301 *AF51113A173FAD472B626B892278BD98031EFEFA UVALDOOLONIA
1,666,270,302 *AF5DD3E973D6A45826717C3233D643A35AB4588B valentinebrannon
1,666,270,303 *AF5F6E0DEE34B8DD9BD4AA73F64B016A65BB409B SQLCHRSING
1,666,270,304 *AF5BBC91DA4EF5E0D90C60BDDB340ADF81CCE5A3 SREDJIRTSEDEM8
1,666,270,305 *AF5053BC2263456C02ECA01B5181AB2450572980 srednjom
1,666,270,306 *AF5FDBAB39AEE218B8FE59862E740287BA49EF6E srotomlonerwsb
1,666,270,307 *AF5816AF442F13239D087878203D82B1C432FD4B C&S:T
1,666,270,308 *AF5132DD9C092133B92AE8AC550B914AA498DB21 variations for orchestra op 31: iv variation
1,666,270,309 *AF55CBE131156A0026B0FE172678C12649F2C203 STATE-OF-DISOBEDIENCE
1,666,270,310 *AF5B10EAA4E7848EE8CB64A3C6A816749D459C60 VEENITA-PRADHAN
1,666,270,311 *AF52640A3B6CCF25CBEFF5293151862FDDB821E7 STEPHEN.PLACKE
1,666,270,312 *AF5918758A0FD619EB7F507C7B45AC22C9F8368F STEVEAUCES
1,666,270,313 *AF5C8447ACB7BA0904F0F6049315A77AE4BCBB09 cumbreguachaca
1,666,270,314 *AF5D5FEC6C899E3EFBB68851BA6351B31B751383 stjerneteikna
1,666,270,315 *AF5CDD773767BB3C53A89AEEFCDFE2E8E1D65FC1 VERWICKLS
1,666,270,316 *AF509FB7399294B70C108B2B01E5F611933494FC vicious-love-(paul-adam-walter-remix)
1,666,270,317 *AF5E79B0C8B739B3F7C1AA1426E08650FA84DB23 VICKI.BANNISTER
1,666,270,318 *AF56F465D029113BE47B39BDE5BD6C6B32FEA9FA [email protected]
1,666,270,319 *AF568D0E7EFB1AC7BB0977D3498CE97BDECAD8E7 SURELEVERENTED
1,666,270,320 *AF5D76905522F106E54D73B83E219FBEC2A702A9 cxjlzbhl7
1,666,270,321 *AF53B01942A0311312BDD3AD25C4B0837B8733E3 CXP5P
1,666,270,322 *AF5C5BC05CD298062D311877C55CB534F5A100A2 VIKITABONGIO
1,666,270,323 *AF5E51144D78389CCE05F7386183426037EDEED7 VINCENZOTABICAS
1,666,270,324 *AF5C0DE6F36D9278EB4FC85F50794E66ED6EA26B SYLVESTERBUSTARD
1,666,270,325 *AF5E3F19CBCC3960523D05CDCE4C6D8D5AC3A395 d%1vy
1,666,270,326 *AF567CA37EECECED6DC2EA4F52D2AB4383F1AA88 TAXXATBA
1,666,270,327 *AF59E06F7F1B1CD642B11B1720321CCE44DE3B9D d2vv+
1,666,270,328 *AF5B9ABF4EAA6E6353B690C69CC154CEDC4846A9 VLPPNT
1,666,270,329 *AF55674CCDF560A21F43904797A18383EE88F42E volcaniclungs,partii
1,666,270,330 *AF58CB80EFF64F30CBF065851B2458ADF25FDE44 te.prouver.mon.amour
1,666,270,331 *AF59DF68DC6A99D0F427D17030E157A8673A5A4D VORONESH9
1,666,270,332 *AF5200F75DD6716A023BDF28F39579B2D0E6069E vrstmmt0
1,666,270,333 *AF568E9B1A6DEED2793B6FB9D6EB586FC45BFF82 VTDOAA
1,666,270,334 *AF5A60FCB3F0AD05750E72FE32320477F11BF971 DABTH
1,666,270,335 *AF5C0FFAF8EB96E6F36816D9779B190F41806FC9 DALLAS.REHFELD
1,666,270,336 *AF585557E47F6C7C544FF07F1BA1B79E1F593A63 WADE.PHANORD
1,666,270,337 *AF530E3617F3050C706D0D0EA518BE204C4CFA6A waittillyouseehim(de-phazzremic)
1,666,270,338 *AF5E09E4CCA7332F914C9BFB82BA46BF73C7B2FD DANXS
1,666,270,339 *AF5A3BD84CDDE2DF25CAEEA31713D84D59C5558C DARREL.GAVINA
1,666,270,340 *AF50C5C9DB383FC25CB2FF242DCB2BC20EA20355 Theme.From.Ten
1,666,270,341 *AF5D2CAB9A73DC081B2001336BAF02E95839A6C5 themickey93
1,666,270,342 *AF58A6DA93AFD7485217902ECD834AE5048CC0B4 theodoredelosa
1,666,270,343 *AF5DE94FE90B3951DC9AE9DB020BAFF4F4022C2A DBITC
1,666,270,344 *AF5A12D6478C2B16AF12B39F9C50C82FB32CB6B3 wempydireno
1,666,270,345 *AF566E3793A9C3A306D51EB935A9C3F151F02F29 D:cH
1,666,270,346 *AF599BDABC965D72EBC2EBE9D4B067DF4F21BF61 [email protected]
1,666,270,347 *AF5AA0A1304849D30DC060842F0FD41BA5449608 THROWING-CAUTION
1,666,270,348 *AF59499C4B24C0F6FFBCD0FC472C3D6DF39D3ABF d_dap
1,666,270,349 *AF5C84C5FEF132110663E6AA951F4EB1BC424C8F WESLEYSHUMARD
1,666,270,350 *AF51F33E5A3D3E932D2668AD630EF536C52861EC DEADGETTING
1,666,270,351 *AF53D18D6DDBD741BDC430FE7CE9408ACB057FB0 WES WAHLERT
1,666,270,352 *AF5690F010CD4E9175C8A4281333EC8F7CDEAB95 TIMAIKIAO
1,666,270,353 *AF5EC8E4C7D9D18ED16BA858DEB539FFB8CB60B9 WHERVE2
1,666,270,354 *AF56C1835554BAF28E11797D5DC6E0D068197718 TIMRIEU
1,666,270,355 *AF51EC0A053FE0B3986401041155CC984967D313 DEE.MACLEAD
1,666,270,356 *AF577C4E1C58C7743D19AA1CD41F5522A8FD28E0 DEE.VICTORIA
1,666,270,357 *AF5CEF539938D82D45D296E8CEE013834BE6FB87 WHY INSTRUMENTAL
1,666,270,358 *AF5A685EE59D3E420618664D97E5774400246452 wilburnwindmeyer
1,666,270,359 *AF5EB2BD000AA73F7350CD78E99DD426F4F7DD41 tnemyawing
1,666,270,360 *AF5F5ABFFE77DB332058F141BA518A5DA773520B DENISIO9
1,666,270,361 *AF580ACB4953919A7EB8C6F0D6860EB9D86F9DBC TOO PITY TOO PROFANE
1,666,270,362 *AF591F99C567231E8E847747E9F185461C91CF9D desta21
1,666,270,363 *AF5EA90DAEAAE263C7520F21EDEC46452BC1293F wolvedak7
1,666,270,364 *AF564F3CB1BAC7A813BB226C4626F6AB405EFCBF TRACYBATIE
1,666,270,365 *AF515D224C349E87641E4DF1FF817072127F32C0 traumesgestalten
1,666,270,366 *AF55F2AD862896571FB36A733F6BC9EFD43262D2 [email protected]
1,666,270,367 *AF51A8B62473DD804F2823076C0024636274089E dg-5.
1,666,270,368 *AF54CAAD4253CFB1805E2E47A0DA3CF076B55175 trevornaegele
1,666,270,369 *AF576CE15A667114E870A09BACE3FFE807104FB9 DGTFB
1,666,270,370 *AF5AD7846C66DDE636A8BAFCBEB4D9FEEC2F56CD TRINIQUINTANA
1,666,270,371 *AF53469D54001C55F90E687DECAF7FE6B7C4429D W:Z
1,666,270,372 *AF50AD9EE93543C979115652B33F4365A7E98495 XIEGUANGPENG
1,666,270,373 *AF5880829A5CB70392A74D376C08999BCFF94133 digrediency3
1,666,270,374 *AF5F424DCB85DE5F8FDA5F4A93A0EC8634BE70B2 tumu1ts
1,666,270,375 *AF5FE9A1D56B3BA4333AF7A2267CB7BFB10E7C7C [email protected]
1,666,270,376 *AF52031ECEEE5CE59D04EC512585A1174DE23B25 TWEAKINGTWIY1KIH0NG
1,666,270,377 *AF5AD77EBE7482372A02029C643DAF7E7407216C XXTHEFUTUREXX
1,666,270,378 *AF57B6CD478A16BFF2C32DDC5BE1AEC9CA8B0D77 yajirush6
1,666,270,379 *AF5770D9172B298D533524D65207FF1B5169BAA0 tyronturnbaugh
1,666,270,380 *AF5838E32D5CB73F2F5E73A19C112E22379D6A0C dk6f)
1,666,270,381 *AF5980F83EEA0B8461EB1B75A9CD503DA728EEE8 DKIO5
1,666,270,382 *AF584B70A06071385DEBE9FBF75977A874831C84 DKOPO
1,666,270,383 *AF5B5BA859140FA994DCE07CDFAEFA11715F6A1B YBUKHARINA
1,666,270,384 *AF51E4FAA058113764F7681F521E79C489A8E1C3 YCNAERCS8
1,666,270,385 *AF5F3000DCA1A14711CDCE4E9611AC84E3BC1571 UDAXGYLA
1,666,270,386 *AF508AAD194BF6AA662C3D76D673BC5C7B070E87 DLEIYLIO1
1,666,270,387 *AF56EC790A584C2D0875B362144598D7D9F0E854 d/llb
1,666,270,388 *AF58B7EB1932115DF1F2CB8DC0EE9F89D7CC02F0 ultracultura
1,666,270,389 *AF5FC2810B19CACAF5C88D5423DECF974006C213 DODONEBUNU0987
1,666,270,390 *AF5096AC383FF542E0FDBB42A13A51441BD3B612 yrtadbbh
1,666,270,391 *AF591321C20DBC59E7801F84BF9B92484CD1B294 DOIN-BAD-FEELIN-GOOD
1,666,270,392 *AF54C10B67969B95CE71D87C0DABD2648595BF05 UPAHADAYA
1,666,270,393 *AF5BE668567D178A7303FE81A316EF16249E5034 Z105642
1,666,270,394 *AF59D007A56FC38A6F623ABF352CBA628D915EA8 Z-5>
1,666,270,395 *AF516638258ADBDEA5472C4177B0CEFE6D7F5B91 ZACHARIAKASAKSTAHN
1,666,270,396 *AF5561E579F5C8C105AC67CF5EF0183B6CF450FD utuade
1,666,270,397 *AF59CB03F5B2E2364BEAC3C3C2D52DEED99A1746 DORSEYZAGORAC
1,666,270,398 *AF53E40007845268AE1835FD6B61DC6EAAEAD627 [email protected]
1,666,270,399 *AF587F5AC58B91F9E5FCEBA028F090FC2B991896 V0IDA8L3N3SS
1,666,270,400 *AF52D98F1C4EFB63706B478C2241EDB7FF4C65E1 DOWNHILL7
1,666,270,401 *AF5FF259C45FD2BFC69AC1DFC9177F54B460120A ZANE.LORENZ
1,666,270,402 *AF5AEF82962A877515E1190771B2FE959A70A4E8 ZATKOVICH
1,666,270,403 *AF552A8D649B4210B05B489E46494614E2C057C1 VALERIELADDIE9
1,666,270,404 *AF55519930457012E884E853B566DD447CE6564F dps:h
1,666,270,405 *AF5E145754A4C5100E38DF84B39903F6A2882AF6 VALOHERKAELLAE8
1,666,270,406 *AF5A40CFB83E879DA3053D8146A39842EDEC509C valpalaia
1,666,270,407 *AF506D9055100CBBBF228CA953A81D316B5B3C8B dqaw(
1,666,270,408 *AF5B45C69CE5A75C333777AB72EFCF1154FC0D9E VANCE.COLGAN
1,666,270,409 *AF50DA0FCE48FC9B3A7982CBCB5C7BBCA8090138 d&q#g
1,666,270,410 *AF56B2F894A05D0F06336BA9B9142D4844F5AEA2 ZGRNDGHST
1,666,270,411 *AF55980F932E1902D44E2AFF27C5F3EE9B44EE89 DQ+SV
1,666,270,412 *AF5FBEFAC2D17F16C8C6696DC883A0276B3BA9EA VÄTAMÖP
1,666,270,413 *AF55ED1DE372B23E3DCA7E679C485EADFF8A5D6C VDOSTOJEVSKI
1,666,270,414 *AF5CE3419A5CBA178E644305779E955084412B33 drawing.out.puchiguso.bait.sound
1,666,270,415 *AF597269107D0379F32254CAA7265A6D5628DFB1 vernonbraddy
1,666,270,416 *AF5CB38E4E790B473C5556274445A68BC621AB0A D)RIQ
1,666,270,417 *AF5D9D5D4FED895AC96993026F86768123E9AAD7 ziad-dosouky
1,666,270,418 *AF5749C447B6B37880F59EF52EAB60EEDCCD179A ds56o
1,666,270,419 *AF576023DCFDCBD65D2311A86BB3A65C1881CCEF ZLATKOMILACIC
1,666,270,420 *AF574535426AD4E3ABF7A23FE5A48A21053F1D5E DTVLQ
1,666,270,421 *AF5A27BD6CC2196341D74A432E3F555DA3F8BE0F zvogrszkoga
1,666,270,422 *AF51F33EA6D9694A1CA2B474B435FAC6B1B0939E dustinrue
1,666,270,423 *AF5E1BE23643D7E8EAB8569BF9409E08EED8858B dwainoverdick
1,666,270,424 *AF581C8FECDF9A371DD5B2B250B938B84BC9F381 dwech
1,666,270,425 *AF5E01ADF34BE12EA79D6590A47DF0E8288B8327 dwji3w22dn46n6u077w52
1,666,270,426 *AF550A179E9CC30243C99E4F490F67FA3449A239 аспуку
1,666,270,427 *AF536923B6D98A135E4E4084C8FB54730BBDC38B БИРИНҶИИ
1,666,270,428 *AF5862D1B1B87BBE44D79CA1B00C4AF2AB816109 ВЪОБРАЗИЛА
1,666,270,429 *AF55781257E7C74D5CD624C69B22E48C817EF87F DWNNU
1,666,270,430 *AF5E62B42E0CF21E81906D122EE40316C3146CAF vkladali
1,666,270,431 *AF57F0E7C5351B3E426A0F986C958D253CF7B447 VOLIMACU1
1,666,270,432 *AF54C26F83111F80DEFE772C5FDB27D59B98A32D ЛИПОВЕЦКОГО
1,666,270,433 *AF566AA43EDBBD90B357EC0C9B8B5239EFEC4DA4 VREITTENING
1,666,270,434 *AF5D7E89521D632D9704F54CFC9928A8CAAE2FA0 E5C4RGO+5
1,666,270,435 *AF503D500AD5C3E23589C90DE6E3AFA60ECA9533 ПОТОНА
1,666,270,436 *AF545A9B7613B952D78CFC658D1E594EB15B61B0 СИДНЕЙСКУЮ
1,666,270,437 *AF5ED4149E41BA3313FC41A30928BE0D45AB87F5 waltz-me-around-again-willie
1,666,270,438 *AF54B2DE4D191EE746EBF2B5D322BE328CB0C1D1 [email protected]
1,666,270,439 *AF5534F2B587F4C373524189C2CEC092EF950783 [email protected]
1,666,270,440 *AF55C57C435CF2295282AF6F5C11DFD7587572B5 W[email protected]
1,666,270,441 *AF597429F714E7AB8125F809276AF12128569D17 [email protected]
1,666,270,442 *AF5D95C96E350CF0FCB616B83B9E35DFDD86D1ED WEGOTTHENEUTRONBOMB
1,666,270,443 *AF5D2E3D8F1E593F2DF736D38413301EFFC37F42 [email protected]
1,666,270,444 *AF54D14469385E0C080334827B4A686742990586 [email protected]
1,666,270,445 *AF557AB08FE2C3AB7F0DF3A9B75AF69A644CC07D [email protected]
1,666,270,446 *AF5EB79A1D3E9B9B3DE66AF861463722BAAB25E8 wentker
1,666,270,447 *AF504F60CCE15441B4B2A7DE4D7758A684BFB628 WILLIAMLORENZANO
1,666,270,448 *AF5CD30E4F4A2D790D7FB809D6D23FC251F90E6D WILLIANMASSETTI
1,666,270,449 *AF556105FB2CB8F0977DA2FEF86C08293613976F willrutecki
1,666,270,450 *AF5D1AE5302327078ABE5014428B63B6A52865BF WILSONRUSTY
1,666,270,451 *AF58945E7E789F359E4F87D16911B079F86BC81C ФЕННАХ
1,666,270,452 *AF501683AEEEA1B98DB466AE739163341DE7E4F5 «ХРУЩЁВСКИХ»
1,666,270,453 *AF57B4471D9E09E57DAF1B3BECC0D400920FE815 wirrirri
1,666,270,454 *AF55AB2ECA5A348BFDC68B22909E6DAC58498573 egeaza
1,666,270,455 *AF5935340D11C8D6C7804040FA5A494EC9CE48D4 [email protected]
1,666,270,456 *AF5C37B9A69E3110FFF00D34440D510391ABA162 x24e5c
1,666,270,457 *AF5D680FDA71CCA816081E2E099C2E8ADBC740A9 xerxésa
1,666,270,458 *AF59A31C50506C3D4DD54797D6CA6C85F353909C XIIAOSYNN
1,666,270,459 *AF57D4C0EDF1BC75D619442DF7C5EEB319020D55 ELIAS.IM
1,666,270,460 *AF52FFBE8C5850A4DB3EB17F4651FF23E520BACF eliasinfinger
1,666,270,461 *AF50E566FAF08120228D72FD1CAB5B3028076DAB XMLLANG="FR">XFORMS
1,666,270,462 *AF5B75CE14B8D36F91A11E36038DFB63D91134EA ELIJAH.SARETTE
1,666,270,463 *AF501F26CABDE466E1D58585668D90E9488669B5 ELISEO.INNOCENT
1,666,270,464 *AF538CA2B07EECDC6E9CC33E7C9E7A959BFFCF23 XS20
1,666,270,465 *AF5F01DA51F9992B7B59FC3C441313D30545CC2C ELOYSOL
1,666,270,466 *AF50EF78642ACEB8599E35A4B5F5FCFBA5C6FF1D Y112187
1,666,270,467 *AF5F2BEF69847BE941C91D20585CEE7E4C5F9022 安妮(anne)
1,666,270,468 *AF527EC385D9AA7C9882124C0CE4F393DE402323 [email protected]
1,666,270,469 *AF55C6807A1C72DC30EE427E825BD21000F1A040 YEARBUM1
1,666,270,470 *AF513AF5F82747919DF6287F1727F9E07B7A876D yeewaicheong
1,666,270,471 *AF5DFECA15B1EF2C555B5E409741AD3E8E0B05F8 emperador-gao
1,666,270,472 *AF54589A2BA0218E0331824CA48FA54050CEA52C YFIRHERSHÖFÐINGI
1,666,270,473 *AF5FD28CE84F44ADF6946311722DF99E19DF609A ENAJ=1982
1,666,270,474 *AF511829B10D694FD7D55D2A74928FADED8F5D3E YLISTUG4
1,666,270,475 *AF538AAD0CC29E0CE3DB2D3853258B039AF75322 ENMARCAD2
1,666,270,476 *AF5B4A6A8A69E007F9004EB9C6D7D761796E8D7E ENOUGHOHCONFUCIUS
1,666,270,477 *AF5E11A631CC74B94B21A4A35E45C4B0082ED795 YNLANOJCNIWORP
1,666,270,478 *AF5584C3DF6466AED27A52F22407243E4647C323 YONG.PARRIOTT
1,666,270,479 *AF5E8E48CA0153C876CA92D9898ABCCBBD05E212 YOSHIYASUBSWS
1,666,270,480 *AF51519462B85CB304836949AA8F21AAE4220C72 ENTREPRENÖRSVERKSAMHET
1,666,270,481 *AF58289A47ABD7E68773342649282BB02AB2B735 EN VERS ET CONTRE TOUT
1,666,270,482 *AF53BFBEA9ACB21925B7AE41EC68D4AB487DD828 eo8w1
1,666,270,483 *AF5552BC4CDEB5078961F80FD82545167C35D036 E>OQ
1,666,270,484 *AF5458EC170366AA62D6BC06681CF4D76B11D202 YREVILEDC
1,666,270,485 *AF581E1F7CDFA8609CCB0B48B4E9DED62D3C8F98 YRTHLINGC
1,666,270,486 *AF5D8EB658C6BD7695E3D53D44233632DA19DDBF 「胸いっぱい」についてpj規約の違反解消という意味では適切です。pj音楽の範囲内として即時移動でも問題が無いように「胸いっぱい
1,666,270,487 *AF5D5D7D4C8FE086213E6F0DE78C58723771D859 [email protected]
1,666,270,488 *AF55AFCD00F87125BE96266098C2462FCE1F8027 EQRPCBHDSXXBYLH
1,666,270,489 *AF5BB753581AE543C9A2518391913EDE0FD30196 er%(6
1,666,270,490 *AF58F1F7FC66A5C21A7CD7A0FA204202F956CD35 [email protected]
1,666,270,491 *AF54B2DB172FA9DA28B68CB4E197105ED2C97696 YUYAKOBAYASHI
1,666,270,492 *AF53E2CC4CB50345F76486EC3DCAEDF6D5D599BC Z]2O
1,666,270,493 *AF5F62CAA2B3CB489623D4921DE0F117CB1D5BF2 zacheryyannuzzi
1,666,270,494 *AF56C56BBC90F24CCA274556BDCF25243EEC8281 zackgast
1,666,270,495 *AF519252815BCAF1E193FE8578BA06238A153A9C ZAHOREC
1,666,270,496 *AF5BB93BB59A591B57E346FEE221C31859D7C9DC zallern7
1,666,270,497 *AF51A9E6403BBDF2F3CF1CA9B9B6927735F306B3 errs eh1 r z
1,666,270,498 *AF59EB91F2191644A6EB409454459341A42833A0 ZAYBUB
1,666,270,499 *AF56F4071BC80CD6D276FCF208AE4B19072FCE4A esnatepm5
1,666,270,500 *AF58E13338D0A7BC1CF62237BD00BAA380E8712A zeusbuck7
1,666,270,501 *AF554CADDFCE36BD6521D6DE6CBC194E29D03EF5 [email protected]
1,666,270,502 *AF5149E25FEAE9FCD9ED883882ED1C61BEF9C221 ETRSH
1,666,270,503 *AF54291175465186B30B89B007EE0EC34B60F031 [email protected]
1,666,270,504 *AF52E650B5508DD011B1CC258C1CCDB93FEBAAA5 [email protected]
1,666,270,505 *AF5AB2B28C1D0D01A2488746994234A8A5DBDDC7 EUGENEBARTLET
1,666,270,506 *AF5ADEE93DAAA8C736977EE23DD24B2AD09B97D5 zoden
1,666,270,507 *AF5223A065B726EE7C8CF2CA2A6EC33102E3318F EWEATAM
1,666,270,508 *AF5CE6BE0C0E487CA228EDCE4F562443311B140F ZVKSYZ5VNKMX3
1,666,270,509 *AF52B9485143F063C4F2F18D133241B09C172B2A ΚΡΑΣΆΔΕΣ
1,666,270,510 *AF5192B129BD21890A201F3F728A5F255FF73BD4 FA1$EHEA
1,666,270,511 *AF5661873E18EBFA1B85D1F0CB984A720CF933C1 АРНУЛЬФИНГАХ
1,666,270,512 *AF55FB474EDE873D2330057AA48214D131A8039E FAISMUHAMAD
1,666,270,513 *AF5749ED29F3B01B65AE5E70F4E370CACD48E05C [email protected]
1,666,270,514 *AF571358F343C2B61E18BC55762C3DC07DFF0188 ВАЈЛИН
1,666,270,515 *AF5746B143F05D52B167B846695D233BACDA1022 T
1,666,270,516 *AF5889ABC824275FDA618766F61B5B7C29723CE4
1,666,270,517 *AF53CE41BC89CF8DD5B0EF9E868A22C93C3E806E d
1,666,270,518 *AF5DDF9ED52E5D5684BD536C7D8535D90794C433
1,666,270,519 *AF5C656D7D787D2A970E9E71F44FAE5D21D2D92B
1,666,270,520 *AF54AD1D8E2ECEF0CFAB7DD302E8D4AF3D882B1E )0(O~O~D===P
1,666,270,521 *AF5257B9A555EAA31EF1313F4B47C58D3CB970B4 100.FRIENDS
1,666,270,522 *AF578CAB8B3730168875A3BAC78F5513A9A94A48 1197978 SUPERLUPAUSTEEMURANNIKKOPUSSITTI21PISTETT
1,666,270,523 *AF5C4EEE9D14D4E6BA27BEC176CDCA5D37DF1D84 НЕПЕРВОСОРТНОСТЬ
1,666,270,524 *AF57323D320A501645F2EE2600875BBBA3CAFFA2 «папарацці»
1,666,270,525 *AF5B6B52621DAF0E795C953F3BE21ABE60B97756
1,666,270,526 *AF517AC4837C7DD14D386F80C98569A4F7F8C1B1 ПІДГРИ
1,666,270,527 *AF509D7C8C06D53343DFA9427D3C18CE1EAFAA0D 129hausfrauenbund
1,666,270,528 *AF5B9F7A399B2A9486B90EE4D2B9021EAF6E38AA 12AFF753234A68A3D0263C3E8C270E8BTITANFX
1,666,270,529 *AF5677AAB07EB19B691ED5C900E291DFECABCC56 R
1,666,270,530 *AF53CC4C8D9DBA58858720074E65178791D4820C
1,666,270,531 *AF5234697EF969FDB7B31431DD85C8D901B309B4 13682B19B770A6EE7D5F13E9CF54A5C3.WILLNARB
1,666,270,532 *AF55596769D8889A8AB2E5AFD782CAB6074ACE3D 138374 sonra1994krizi
1,666,270,533 *AF530FB38233B2DB6149226A023389B12CDA43F7 [email protected]
1,666,270,534 *AF53080647B28E27DC2B18B28E8BDB0A842B60A6 РЭСПУНСУЛ
1,666,270,535 *AF5B3D0D27C9BEC855840C1D9BBF3C3701465995 13MMA'$
1,666,270,536 *AF5A580D6E49D447B9F8EC093074EFC23132BE7B сизокрылов
1,666,270,537 *AF5B977C32367C16B36C079C4CC5A1EB9DAD7F6C «сімс»
1,666,270,538 *AF5D5354B1B27716910D923EE7FA28BAB74D029C 14551+UD3
1,666,270,539 *AF52180F8FB36F1019D7FB664E109EEB9BB7B398 145X140
1,666,270,540 *AF5F0EEFA158CC356E738328616B18EE46C062FA ТАКСОНА
1,666,270,541 *AF5E9130551267B0310A301BE5504E0B41AE7031 1512t22
1,666,270,542 *AF5A6AF4092938999D3133303A3D981DB31B58E5 16-bunny's
1,666,270,543 *AF596BA3CCA38E6BA0CFABAC7CB7F499CA309092 
1,666,270,544 *AF513980224F2F3A9C3B7FBA11CC6A7109FB478D 19701222: ALAN'S PSYCHEDELIC CHRISTMAS: SHEFFIELD, UK
1,666,270,545 *AF5D96873BA38DE671A7A26B8B8EE42E49D617B0 o
1,666,270,546 *AF55C6966715AB7DBB7974DF538810989294F3DC
1,666,270,547 *AF5FC053E75A45AC354B5A86A6ED9F89273E9BDC N
1,666,270,548 *AF5691309AF2C162744D1317E99D539F6FCD7DA6 a!
1,666,270,549 *AF5A6D28AE0E2F9A5B90AA8FED38F64A0C43398F
1,666,270,550 *AF598B5F6E610AA49AC46EA79FADBBABE1302778
1,666,270,551 *AF51CD170199E584DA963F923267FDDDDF6B53D2
1,666,270,552 *AF5074CBDF016BE5B20207F0E3A6C08A70DD7594 9ʛA
1,666,270,553 *AF53D94454C21E4A559C292B387A6BC17FF434DE
1,666,270,554 *AF5F676B41FEEAC9A61F4B3EC829154CF834CEA3
1,666,270,555 *AF5F185573ACCE69F2345570E79650282EF1A7A5
1,666,270,556 *AF51A6403381ECB680B10F0357F5E6C31C1DC69A
1,666,270,557 *AF56872F04F4A8AE126DA6F3467715C3382A48C2
1,666,270,558 *AF5ABE1E62AA92B06FAB94CA704E03F4B9E72054
1,666,270,559 *AF5BE78A11FCAA1420C41AD271130A75CA5FA844
1,666,270,560 *AF5BD29B7D4D43182037D4A890EF109CD2A302A7 A
1,666,270,561 *AF577A9EEF6410805B5C15F94A552DA9E4556FAC 1CHARS
1,666,270,562 *AF54AD5D73827DC6EE2AFCC8A01086A58BD5DC5C ,''`.
1,666,270,563 *AF578FB97AB3A25A2A52E1065D2754FE5CA49928
1,666,270,564 *AF5F2E34150E9DEA3551A2FDFBF19AEDA288FA0E
1,666,270,565 *AF5BC23A58C873237257D2B3413234EAFF2953F2
1,666,270,566 *AF53696F4711C1096CAE2C453D87DF7FB80D1AB8
1,666,270,567 *AF56138A86A30B9507825756A9A7C54966582C4A Ur
1,666,270,568 *AF51F01A9DE1916FF8486CC3D8C50A7709AEAAAA
1,666,270,569 *AF5633730C658D494879D5CACB75DE6F751842EA 1.GOLLENEREK
1,666,270,570 *AF5D56C3383994892A82842884ACF20FBE96FD27 1HARDIMPACT
1,666,270,571 *AF5BF860691B3AE7660651358F5C2C6853501F53 1HASTALANMAKTAN
1,666,270,572 *AF52AE67F32C75A5D1ABE4D3902B78E8FFACF9BA V
1,666,270,573 *AF51B69F528E33239078A264598A5CBEA106A8DA ,
1,666,270,574 *AF57AD8228B38C0EF9E2DFEF6C3E06949480616B 1.kippurkrieg
1,666,270,575 *AF51A3F9EA3EFF078B08EBCC06187C8D9967FC7F 第4A類:主要在肢體或軸向肌肉。
1,666,270,576 *AF539B98A809C8F764F7E221FD3306096F3C68AF 1-KUTSUTAVAT
1,666,270,577 *AF5F6E0B9F9BF6CB0C3AAC0BABE8C194F861281B
1,666,270,578 *AF5399BBD1049A70F342BF333E49FCB8EF0B26E4 ~
1,666,270,579 *AF52D19B49E9DAA4DAEA36343677DCA2B4099A1F
1,666,270,580 *AF53A725D1FB111A00CC21FA57AB2DF25D4A281B 1.mastricolo
1,666,270,581 *AF5380C24992999FBA298A906D3BC6FE5481FB87
1,666,270,582 *AF596B9A08353BE092FFE117F14C250DF5ACC2D0 1MYNOTHING
1,666,270,583 *AF5CB239B5C3CC970656BA267B1E5CA2F8948F86 000000PRR
1,666,270,584 *AF54E793CCD8C41241834110B1DF8B017865E001 1nocilla1234
1,666,270,585 *AF5513C62FD87F3DEE8DDD728B91EAAD26BF371F 1omuzladim
1,666,270,586 *AF52C54091289F95473440CA187FCD8AA9896850 "x
1,666,270,587 *AF5223C462FA7B0390D558D7E20F1A8CB9DD4F7A 1PALESEY
1,666,270,588 *AF565C13637F7AD7424B9C94CBACE802F12DC885 1PALESTINIANDRIVEN
1,666,270,589 *AF556A8258515FAC6ADE0173030FCBDDB81A2552
1,666,270,590 *AF5461FB63A1C35BA421358157DF2187A52523DB {
1,666,270,591 *AF5B021D3727D78FBDDD89461318E8D2AE5AD789 1rechnerbatterien
1,666,270,592 *AF58BCE6C8FF9D02BC27CC09B3DB47D9F6A0B58C 1 RENBOURN
1,666,270,593 *AF50827E5A3A9055E5E2E4730FC80C7AD85BA975 l
1,666,270,594 *AF5241FF70128C19B41FBC57918E8FC247D464C5 N'E
1,666,270,595 *AF506EE90B031924C79827A2D387AF6FFF92CCBF
1,666,270,596 *AF51C43E2935954EEEC659F131892980C765CA7D (0-0).~.d##q
1,666,270,597 *AF50819B5B9A994AD8DB8002FCD335FD4643A5BA E?
1,666,270,598 *AF5C2AD40DAF6FCA1874DE1B5EC123324BABF19D mJ
1,666,270,599 *AF559C89BA3561A09CC04AC10968AD624F3EADD7 1TADOC'TA
1,666,270,600 *AF58524CC3F360F95A67265D4E6D3E41EEAD8A90 1TASAUSMARKKINOILLA
1,666,270,601 *AF50C28964A036CED058148B85622551635654BB 022landyn
1,666,270,602 *AF5052E0215FFC98D6A3749CB44126226234EA2D
1,666,270,603 *AF5E0D185646C7BDC606AAEE844F51201FA0C567 @#$%^&*()[email protected]#$%^&*()+
1,666,270,604 *AF521750980FA1A31398989F93F338A6CBADEC9A (0-0)~~D--Q
1,666,270,605 *AF5E74C4D1ABCD3A994D314B211F4BEC0C65757D 1-wiederbehauptung
1,666,270,606 *AF5CE03C17133C5D0EDBC8FC69672C14277BB450 [email protected]
1,666,270,607 *AF5882F06831D64926A643CFAA4A4633484988DB 1211840 LIITTOER
1,666,270,608 *AF558DA2FCB032375653C3CDBE7C5FF7551F597F 218171 CUNKUHERSEYDAHILV.I.P.
1,666,270,609 *AF5181EC392297C884BCC351EB33CD76B8331368 12 LUONTOLIITTO
1,666,270,610 *AF5EC935A0B900BEAFF535DB6C60CEEF591BC379 [email protected]
1,666,270,611 *AF5CF097F66737CA43C80BBA1F2ED095529252D4 1317145 DAS SIEL WURDE LEER GEPUMPT .
1,666,270,612 *AF5B24C1BB720AC4EF59C8E9466F1374956AB698 1373931 se.laskee.verojen.m
1,666,270,613 *AF56833655AE05EB61634286BC04ADCD455C9C19 0MYPHISHY2
1,666,270,614 *AF5CD4F2502E5A05DD0DA33C10079408809BD74B 10.KYT
1,666,270,615 *AF5A6686562F0C9D52DB772ACBA65281A2B4CBA7 1448554 KAIKKINE-PUUTTEINEEN-,-EP
1,666,270,616 *AF55F80259CA6B628A693643D7DE179E7A62DB04 145049 TAVALLISESTI-SE-,-MIK
1,666,270,617 *AF5A016A7E028B2DEE4C88C70D47976FBCCEFAD2 10puonti
1,666,270,618 *AF5871BFC973E43D9B088EB9030C6189C5F88ECD 250909 EDEBIYAT-FAKULTESI-OGRETIM-UYESI-/-ISTANBUL-DOC-.
1,666,270,619 *AF530E7892857E091C2E1ED78125ED98A008A2E8 2512277 therewasnoimmediateresponsefromkuwait
1,666,270,620 *AF53527574F8E0E2995566D2F9732706AB95FF8C 2518936 tilanne.n
1,666,270,621 *AF556A6A0AAB3CEB80E5130B73233302F92C3CFB 1515759 M2-03-156-2037-YKSIT-.-RYHM
1,666,270,622 *AF570978338C2178D6FF0E395C76AF2D2E00A007 1127128 LOSGEHTESAUFDEMOKTOBERFEST.
1,666,270,623 *AF58376410756688621DE4F5235386E0785AD26E 2615077 yritysjaoston-piiriss
1,666,270,624 *AF56780129ED61DA5487DDA9BCF3F2D34188E576 [email protected]
1,666,270,625 *AF530683B707813C641CEF6B66E575B5ABCF33FF 12: 12 # & APPARITION
1,666,270,626 *AF54D7D398050D6C7866DA59C0AC71DE453DBC2E 1234567ASTERIX
1,666,270,627 *AF5497E98E8A3B018B5524B2DD2B39D84A56373D 1341792 harjoittelusta.sopivat.yritykset.voivat.saada.k
1,666,270,628 *AF52F8F42C84B4767DC77988D3A855D49E8B7A2D 1868488 ULLA.SALIN.PORVARILLISEN.TY
1,666,270,629 *AF50DA4B825B4F3EFAD2D8C4FAF053D731DEC5E9 188-PAREITTAIN
1,666,270,630 *AF5A116A835DE565AC32CDBCC1BA7F7463F48CE3 1499025 yleinen.suomalainen.p
1,666,270,631 *AF51629956A3DD1BB585D8909254053B24C2F4CC 1515jul07p
1,666,270,632 *AF50C32B630158C4C679F497F3584CC521BB2D24 1-AKTIVOINTIHANKKEENA
1,666,270,633 *AF5F1CCAAB07C1448BC35001EFCC228AF35D2443 172-laurels
1,666,270,634 *AF5A38577012248BDC06145F25C470B13180F10F 2.AUSLEGUNGSSCHWIERIGKEITEN
1,666,270,635 *AF580DDBD8D3F5E8D6825E7606B9905B00D267BF 18021023
1,666,270,636 *AF59FBCBA6F40F468FBB757685ED7117D846C2FC 2-GESELLSCHAFLTICHEN
1,666,270,637 *AF53C6FA5BF59076CD0A619EBCF4D975169181EF 2grossserbischer
1,666,270,638 *AF51726022EF8636FD4E89749D0D285D274D8F10 1flowerlike
1,666,270,639 *AF5D5BD457483F383D5FA5683302F4C2DD31C12A 1guavaberry
1,666,270,640 *AF5D056911ECEFE55E85BE15E4482C1CC4783FE1 2MYLEO0
1,666,270,641 *AF5CEECAAACD2BDB9E3F19D26E34BFD4600898AF 1KOIRAVALJAKOITA
1,666,270,642 *AF561D40FFF76A57EAB7CBC5FAE253A9D756CD23 2thescience
1,666,270,643 *AF5368D29C6EBE58EB31E9EAF1100EE074B31B79 2.trendgemaess
1,666,270,644 *AF5389F0B50AD3141180BE540AE1FD5B591E7873 1blutfuechsen
1,666,270,645 *AF53AF9EC83B39A5F97F0A1D58059CA9D8E648BA 1-BOSCHETTI
1,666,270,646 *AF50FBA27B80C3D1C06E19243870E621489A49F7 1.maligniteden
1,666,270,647 *AF5E0F65162E565B2B82E3E3882FEA6790636E55 1 medalnot
1,666,270,648 *AF543CB11C74BFD77F0BC81DD07EA31C812FF93B 323363 IT'S-ONE-OF-THOSE-THINGS-YOU-PULL-OUT-OF-THE-CLOSET-
1,666,270,649 *AF5CD526BB263CA64FEC3B2EAF32B414BD21F519 1EKSPERIMENTOIMAAN
1,666,270,650 *AF5F7F970A919B7243D4885FF7B1CE258149AC16 37b(南行)
1,666,270,651 *AF57C2237A409669315E5643765870E5B979EC55 1.NO-LEAK
1,666,270,652 *AF54726A9A76C8396F493BEC4ABCFFE78DCE2335 1-ns-reichsstellen
1,666,270,653 *AF5C8A3CC2752E15E37B2243BB3B5A22EAFA49F8 3AISIATOS
1,666,270,654 *AF5F26CCB5564458ADF87B51453B2B8BCEA99D0C 1optimointiteoria
1,666,270,655 *AF57B918AA33032AA1396F5FB4F1EA6972E9F44C 3-betriebskonzepts
1,666,270,656 *AF5B64AA03B7F81FACC4822DBC64EC81DDD9E78C 1-gestishe
1,666,270,657 *AF52848E77A5856143FF4F7695F59F37D77E160E 1.pehmittwochs
1,666,270,658 *AF59A5F68216423172D25840D857D1304B046A86 3DD7416B78FEF31C438F0CCE71F82CD5ED
1,666,270,659 *AF5D8E63BA2C10208400234B2C51F62919D2DD12 1-PUHUJAVIERAANAAN
1,666,270,660 *AF528C0BA589A0B8DA7068ACD42824AAE134DEF2 1-RECHARGER
1,666,270,661 *AF5742F716B4BB1D6FDEE14AD3E6781E1D5D721F 1.johtajuuskuvauksen
1,666,270,662 *AF52CB194FC1B5E5435A7182F376678465C0EC93 3 KILPAILUON
1,666,270,663 *AF5B1B70A789098B09442530A3E6B366071B3787 1 KARRIEREMOMENTE
1,666,270,664 *AF510AD2EBEF580E3DDB2480B876F8A3C98661CF [email protected]
1,666,270,665 *AF5052CA8A97531EF3756D3F31825117501DB925 3==p ~o uu
1,666,270,666 *AF5C145B90C32E4946A3572050EC91885B43D01A 1TUOLI-IHMISTEN
1,666,270,667 *AF51C2218F622A4C073F80679C523C5E103B9BD8 1webdesignin
1,666,270,668 *AF5E39469F6312C6AE289FC4C4DF302F48F42DF9 3--)-~}X{
1,666,270,669 *AF580AC6D86A71ADB4BF01076310C5EAD2A2899D 1 YKSIL
1,666,270,670 *AF5E0A9611B026BD8A9785E2BB51023BBE82BAAA 2240300 kouluperustettinhetisodanj
1,666,270,671 *AF5E3368E7B7F280CBFDAE98E26ED2FCB4838EC1 4EOSSBSW
1,666,270,672 *AF5C3C8C74690AA47814F55918F6990A13EF12B2 2294020 VOIMAKKAINTAKASVUOLISOSIAALI-JATERVEYDENHUOLLOSSA
1,666,270,673 *AF5E30DF556D06C8BF3399A4BB29BED5AF8A8E79 4FURTIUAS
1,666,270,674 *AF54924B595D7F2AABC0DD98C1B69BEC5A655EB5 4HONKONTAKTS
1,666,270,675 *AF5B54576CB0AED52196CC2F8E7205A4EBA2E217 1.milliardenbetrugsfall
1,666,270,676 *AF5FEA4E04894814872A9AE34F095562C6160047 1.NEUEINFUEGUNG
1,666,270,677 *AF53C115A2724778791007D561B6118B3DA58567 2499156 koran-bericht-zurueckgezogen-
1,666,270,678 *AF5A3AC4D01890A7B73A61E90E4227E371395AA4 1OBSZOENAUSFUEHRUNGEN
1,666,270,679 *AF57CCF0EF103E3014E2245D8E708BBAF4741455 4SHELBYV
1,666,270,680 *AF596C7C0A6B545AF593B40798A7037C0074EE94 4TANYABUSINESS
1,666,270,681 *AF56FC7C29A3D57B19DFC893DF854B56E0DCF663 4TEKELEIT
1,666,270,682 *AF50E2EC3021379CAFCE05E2AB93473BA647C1B0 4THATCASEY5
1,666,270,683 *AF59C9D087C1AFFC973D8C9D09EE643494955483 281AISHA
1,666,270,684 *AF521BD35306197D67F77012365DF5002EB7EAE1 2859340 alma-28:9-ja-t
1,666,270,685 *AF50DFE9E9BDFF9B7AF7CF31E5A9CB63E66BD45D 4WETONIA
1,666,270,686 *AF5C6F8D0F9B915AC30CAA5F2878F63651D41FF8 2863393 VBA.MAHDOLLISTAA.KONTROLLOIDUN.P
1,666,270,687 *AF524471FFDF5E064D45A9458A87ED2139A00A3D 1Q2W5330
1,666,270,688 *AF5674AA957478D27DC767B641425521C2ED879F 2.ALOITTELIJALLEKIN
1,666,270,689 *AF543E18771957527A3BC6DD35E98C7B2D0CF6EA 1SKOPIMH
1,666,270,690 *AF5571C19B848E8A14950DFF030E98D86CEE6408 1sternguckerin
1,666,270,691 *AF5D889F5AB2CEF6EAB8091CE0ACDA9D0987A2A4 2FDOORWEIS2001
1,666,270,692 *AF5A6CCD0C557DBB59158E85EE5530FB7421F24F 2harris3
1,666,270,693 *AF50CAF79FE802AE191455A966E6906A036F0581 5CIDERIEZS
1,666,270,694 *AF5EFB281E62C52F5A0D51D71DA664328CC27EE2 2.QUENEAU
1,666,270,695 *AF590882156CD570582D82506B99034CB889951A 2-sollzahlen
1,666,270,696 *AF5D0AC9E3FB20CECDB826EA26FDD71698778E60 1WIRFEL
1,666,270,697 *AF5C191C8196C748C9DEB0217E6B5B75490ED342 5EDLESTUNKEG
1,666,270,698 *AF5AE0A97026EC7D624E5033E26B05925BF2CF9E 2THATMOOKIE8
1,666,270,699 *AF5519542B680059A135170233E0F358967CC8F5 2-UN-BITTE
1,666,270,700 *AF5D1BC9456F42F8E9A0DBDFB647577D8F66B82B [email protected]
1,666,270,701 *AF59D8B284A5FDC313F0D17FCABB73E401039956 5HSTHSOHZ
1,666,270,702 *AF5701C9965E535F3618011A93602C69385AE6CD 5ILOVECUTIE5
1,666,270,703 *AF5F39F6DC0118133EEF42595D140E9EF21F4581 5MARIEEVE
1,666,270,704 *AF542379C192367645FEB28BE516924CCE63DF09 36MESOSTICSREANDNOTREMARCELDUCHAMP
1,666,270,705 *AF5D47B4DDE7A318F39E55904F04B0AFFDCAF703 21-ENTISILT
1,666,270,706 *AF5EAEFD069CECAA3B8E1C0A37B93CCE4876AC1C 5NEGATIVISM
1,666,270,707 *AF51B9082F78A470BBE96EDCE36D34CD3483C711 2259121jpn2i2qb93pvj97
1,666,270,708 *AF523E171AEE5C44870BBE558EF4746224A9F860 5or9fiveevolvedfromnine
1,666,270,709 *AF58DB575CC8E97099A4D919EAC1CBC29164865F 5SLEYGHTIE
1,666,270,710 *AF5E96AEF6BEB5F0AEA593762E4549716461DFC1 5SNOTTEMDA
1,666,270,711 *AF566FDEBCB7F04F72FFBE7DAF3B28CE8044A02C 5SWIMMINGO
1,666,270,712 *AF51A9025751ADEAD822CD07239429C24D2945C4 5TAMPONERINGENS
1,666,270,713 *AF599522476135F391F27281880E886186BA47B9 3DIMPLEDV
1,666,270,714 *AF5855E172E055D0F06905FA3BEEFB8587978822 2484743 VARAUSTILANTEEN.VOI.TARKISTAA.VARATUT.VUOROT.-SIVULTA..
1,666,270,715 *AF5D3A7B9C11E99CCB3E2DEB7839FA6893E2FB62 5VARIASBSW
1,666,270,716 *AF57CFC66CA03A62C114B76A88A3E8A2CA807D4A 6121593
1,666,270,717 *AF5BDD919C9C5B38111BF17260E1C02D37B0D6D8 271404 MARJA"LASKENVIEL
1,666,270,718 *AF579B02F6EAA7538ABA93239A7B5D019A89A508 6AEHBUFFY
1,666,270,719 *AF5BBC96098FFD39BEEC81C48A2578B19ADA1D9B 2778608 fordsonclub finland k
1,666,270,720 *AF58F567DA14FED8080CFC738159A715534B1046 3rauhoitusalue
1,666,270,721 *AF5309F582D29AF20018ECCD56ACF8CA5BA59556 2847940 hoidonj
1,666,270,722 *AF5980D48CFCA4F98A2CA3A2B7A3B5F28D9F7C19 3-SPEED-SKATER
1,666,270,723 *AF514F5EF2E223FD22D70417992DB36D3C781300 2925782 tilaanytgoretexpuku!
1,666,270,724 *AF515062EAC56D6822137AE06892C9B026FEDE7B 2945453 SYSTEEMITASONTUTKIMUKSEENSIS
1,666,270,725 *AF58DF83BB718B7EED86EE40C306DC18047279A6 41045 TILALLAMME-ON-LAMPAITA-JA-MUUTAMA-VUOHI-
1,666,270,726 *AF518C34FAD1EB9BCD299E75FA854576411CA545 440590 ensikokemukset lepp
1,666,270,727 *AF5F8EF2A43B11CFB8FBEB5FED6F4B6E97B799C8 6ENOTSDOOBSW
1,666,270,728 *AF59A3386ECC01BEF7B367A7956A92E6A0A0C348 466ANDREW
1,666,270,729 *AF52D4011A678B0EF57FB39FAFE0CBD3326F2E7C 4AUTOCRATIQUES
1,666,270,730 *AF5B2CB30209C0C20B223923EDD26CE1C41AC0E3 6MJA
1,666,270,731 *AF531829E1F4E49C7783EFC6E22F169FDB4C1DBA 2MANOVRIERUNFAEHIG
1,666,270,732 *AF5E203C8CDB4F752A32AB78EB101F8348572801 6OORSIGTELIKHEID
1,666,270,733 *AF54F48F273A2B1D3F066CC09A86A7E7764242C0 6PRINCIPLEAFFIRMATIONAMBITIONANGLEANGLE
1,666,270,734 *AF5D8EE5D2352DDEDDA109CEBE1831085249A65B 4LEPEZASTIMA
1,666,270,735 *AF506909CBC8D75ED70D8F1EFE726FD543DEC666 2-RAJAPYYKKIEN
1,666,270,736 *AF50FDCF2943BFD1096C1A26EED7F4831C012C8D 2tavaransiirron
1,666,270,737 *AF5774F380D140FB0F42EC8AD07AAE267FB30BB9 2TTEKCAT
1,666,270,738 *AF539B19AA1F1236F29CE83802BA8FDCD09C2610 6SASSYSNICKERS
1,666,270,739 *AF5D5B7FACBF6C124D08B4A2104ED095CF322DC5 300janiyah
1,666,270,740 *AF57E7846889357CE34D62C332EB95CBE75E99DA 6tapetointia
1,666,270,741 *AF5198E5A6DDB53D06BB68B20E69FCA1B88BD75C 4TERRORSTRICKE
1,666,270,742 *AF504698F938B1E5969D921C3856D1FCB879BACD 719618 ei.mielell
1,666,270,743 *AF5B59BF752CD1E36677BBD36B70D178FD6EEFD6 72kokoonnuimme
1,666,270,744 *AF53A1866A2E2D16E67B02F48B783D4787D4E7B6 4TLESDAAR
1,666,270,745 *AF5C32422D8B32F7CDB3D8B8AA9273C13F419AE4 [email protected]
1,666,270,746 *AF512CB8BC3E4F25E0FEE8477248089F7EB7DF61 4visitation
1,666,270,747 *AF5BE479A5A876A26373B127B89F0EC67F8FB374 3B320455-DB2B-4551-9A15-E8C4BBD8E96A
1,666,270,748 *AF5C052F485A3CC006C52B28DFAD98BB6566F624 3COFANI
1,666,270,749 *AF50D3EA626C651CC47FC57CAC949286AAB7ECC4 3#####D***~0~oUU
1,666,270,750 *AF52246375CC4BD5D5D5BB08E2A67340B75FD596 3DUNKIERKA
1,666,270,751 *AF5B0163DA008C0DE23AFA58A2151BDAF8756C86 54321M
1,666,270,752 *AF578D0B57571CB2BF9838FDBC5253107E9D39F6 7AZIMUTS
1,666,270,753 *AF5D32CF572234A799D72C6EC5131837FAB91B4D 3MO6CB7E
1,666,270,754 *AF59E5F0FA3A27FC735EEEEEFD954F234EFB7979 3.NOERDLICHES
1,666,270,755 *AF5682B0ABB6C37271C04C30D809190ABAE6A719 3######>* * *)o(
1,666,270,756 *AF5A3BBF6AB3D88EBBF16143AF45C04D364781D3 7DMWRDGR
1,666,270,757 *AF5AB32511B687BB6DEFFE50ABE2574FC828B67D 7 FREIENSTEINAUNIEDERMOOS
1,666,270,758 *AF5C70B97BC91F6A213C9B49B325A529DE67BA8B 5CORTEZG5
1,666,270,759 *AF51B5319CE87A0FCBB89EFF41858193D45FB4D2 5EINSTEINBENNY
1,666,270,760 *AF5C8F9987C6E747813DD3FD4474EBF48300BC9E 5ERETEOLP
1,666,270,761 *AF5D64FDC2D0A4BD3C23430096B38C24B3381B48 7IDEOLOGIAN
1,666,270,762 *AF583240F9F83C125DF26D749E641FEDD61B97C4 7ilovedundee6
1,666,270,763 *AF501029337A12FC1555D0464E1710A956489058 457CESAR
1,666,270,764 *AF53F85B96FD91E76205C41DA6436C732F1D6CF2 47-ALDIRMADAN
1,666,270,765 *AF5121ED924E7EC16AD286CF00E62E657809D083 5RTISTEN
1,666,270,766 *AF5DC60710C9DE556F17E45CBE307E0BBAFC8799 [email protected]
1,666,270,767 *AF5A6ACC659772735A57F27BB2922DE4BC57DCF4 5SYYLLISYYDENTUNTO
1,666,270,768 *AF572B115693CC88031101C5E2CF40B71B2A35A4 7PRINCEROYAL
1,666,270,769 *AF5FBBFBF50940E786E94B759186297A9C98F405 4HEMEROLO
1,666,270,770 *AF5A2C1D6D1392B779C12B2559272909FD7B4EFC 7REORDERED
1,666,270,771 *AF55C261D89A66E0B702D3CA9A47A73B1B67EDDE 4ppo$7on$
1,666,270,772 *AF525F16C62BD2F017AB2A51A4C87DC03FD9965B 5ZERSCHNITTENEM
1,666,270,773 *AF51FB2B07956F24906C9F858F4B726025F5202E 606713 benim-gibi-zaif-bir-kulunu-bu-makama-layik-gordun-
1,666,270,774 *AF5FA809AB9F919692AC4E48AED8B6B6A5673412 623682 UUSIUTUVIEN ENERGIAL
1,666,270,775 *AF5ABE0C26939847A54F6851CE8A9401FD0B8824 4REDMEXICO
1,666,270,776 *AF5005050653E69AA026972F7C5F5D453FA0CD07 7WOLVESSPENCER
1,666,270,777 *AF5BF6CBC51C23F451DD39086F19E1F4226C987D 7XYLINDEINS
1,666,270,778 *AF5EBAEF5635DBC53E020659596612F61087D1D3 805079 muut yhdistyksen j
1,666,270,779 *AF5EB01386C140B44D1D6711534C7AE3F2D69A9C 6.antibeet
1,666,270,780 *AF596710BB25AC9A6E96FB74C95C451A2FDB6523 6BASEBALLSCOOBY
1,666,270,781 *AF55F096EC9308AD72602757D6772A94CC6DB8AF 4WOORDVOERDER
1,666,270,782 *AF57E46750FF4C86FF79E5161AA0393D58F010F8 8>~.`3B<
1,666,270,783 *AF5DC702C6E313B9C20D32EF01DDFF4D4FF1477B 575479 on varsin mahdollista ett
1,666,270,784 *AF54534D9A219D9593E31EE2C372A1573B2E4BDE 5BALLZEITSCHRIFT
1,666,270,785 *AF584C15BBCC9841A0DA5A736C34AD3FC837EB1D 5BDELLIUMN
1,666,270,786 *AF5B49EF8F6B3BCD61B755982337192E34AB3E7B 5BSWVITALEBSW
1,666,270,787 *AF53C6B369909B2AF376D172BBF74607DBBFD235 5CHRISTYWALTER
1,666,270,788 *AF51098DD32E4C64E4909E4ABDBD114BCD6852D1 5LONGJAWED
1,666,270,789 *AF5EA8BFF62B8FC0882C8672E66B27F7DE1E2B17 5MORONIWATSON
1,666,270,790 *AF51549A7CAEC7CD0246B4B8067ED60026B12B06 5PPAMMELK
1,666,270,791 *AF503A0C2AC8712CCD2EC202B42D6037E9395042 5 ROKKABAARISSA
1,666,270,792 *AF5C88B67308D2C8437546E77C3857A29C409186 8evectra
1,666,270,793 *AF53DBB76FADC64A75D79A310D32B638A75121A3 8FLURORESCENT
1,666,270,794 *AF57220BD104B3EF76A16213ECE7D117BDEF5A46 5 SHELEPIN
1,666,270,795 *AF5FF0D44A97BBB6DFEBBBD09C6709F7DD310D54 8INMEIDENED
1,666,270,796 *AF5768381ECDAEB8AAFC3CC6DCD72BA5AEC3066D 5thatleo6
1,666,270,797 *AF562B790741DA8998EC9A55F6FF1A3549ED88A4 626EDITH
1,666,270,798 *AF595F12BAB622468253077BD8A098E62BAD4B56 6STRUGGETOTI
1,666,270,799 *AF5A87245FF73732E7FA92D859B6BD55F5EB203C 6THATJACK5
1,666,270,800 *AF50A62F6295CDB6A924708F7E3B769099D63E50 6TTIVAKSI
1,666,270,801 *AF527825A7339DA5C1163CA35BAF6DD6FE685B8F }8{.o~0~d=8
1,666,270,802 *AF50FFA4BE21E99E212B1CE5E57E708D47A657D2 8OCICUUPCUUBILRSUCILBUPPCUULOOPSRSUYPOC
1,666,270,803 *AF50B9DBB980CA13DA170F7BA7EB879AC40CAD7D 8OMALCCA
1,666,270,804 *AF509505383C3FDCB404E375ED009AE079020E86 6WOLVESHAWKEYE
1,666,270,805 *AF5E74F18850A3F781CE4AD0B4A3333A0368E8D6 }8{~`@===p
1,666,270,806 *AF51165CDA25254E9F0320C981B4DD9EE0C99732 7amoncelles
1,666,270,807 *AF539D8DA25895D051E6621ADA60C082CA862BE4 9BALSADERA
1,666,270,808 *AF56383D0868A22B1D81051005A52D87AE928AE7 748237 KUM , SILT , KILLI BIRIMLERDE GORULMEKTEDIR .
1,666,270,809 *AF58FDF882106BCFAE8291D50C2BDA360CF3154A 7-karttuivat
1,666,270,810 *AF5EB6E0C1306D985737457DC1C5133F4339F6D9 9BUCCOOCCUB
1,666,270,811 *AF599033FE74E2908E9BFAA27369E32DA4555A6B 7LAMPUILL
1,666,270,812 *AF5B1A57CFCBACA3FB321FE1EDB86F2D4A091D50 7MSCHNCS
1,666,270,813 *AF5ACED4903C3F0314930670740EB8694E65569B 7BSWHETROBSW
1,666,270,814 *AF50CABECB18B5F98F97420AB9A27AEECD06F681 7PIPEPLACEPLANKPLANKINGPLOPPLUNGEPLUNGE
1,666,270,815 *AF5E75A81EBCDF22E7C52FF9CBF3AB15B9B505B0 7SEDNELIE
1,666,270,816 *AF5370AE671B0072A2C1260ECBBA177A0A55ED86 9FORTELJANDE
1,666,270,817 *AF58E3AF5B70A27FFB5184639B7367EC6B340700 7HINEINWACHSENED
1,666,270,818 *AF5FB851E9D85CA2D79A3CAA63B8D729ED86E1C3 9HRUZOVLADCOVYCH
1,666,270,819 *AF5AA3EFAB737D2A5EC871618BD1619581C76136 7ULAJAKSI
1,666,270,820 *AF59692D088C5D7DD475BC5B2425E6853B3E1680 7URFGREB
1,666,270,821 *AF5822D9EE48BEB22ED656114429E47116420FE8 9iluvtigers
1,666,270,822 *AF55933E5A7E215858470B6BEC3021EF754F46C1 7.mielisairaat
1,666,270,823 *AF5F18B1FC810DD285258656087E09927A0DC47F 7MMOKDEVU
1,666,270,824 *AF58C3E3F29AF1E3597A778C996BC0C9B4D59A97 80+CH3S+
1,666,270,825 *AF54316C8181C52F7E0F11EA2F88A4E7BB7420F6 9RAPH1T3$
1,666,270,826 *AF5216842069C723F81291183890DDFC6772D6D6 80UND4R35
1,666,270,827 *AF534AFD49CFFD83BAE9F00BCC86647FD3FBC314 7PANTERAMICKEY
1,666,270,828 *AF5DD07AD55E141CCDD36912CDBA33F36A735F33 8BACKDUCKEQUIVOCATEEVADEEVADE
1,666,270,829 *AF5F09029A59DE5B05F9FD36966B5CA684B0AC9A 8######b-*-splat
1,666,270,830 *AF52022EA1B90A91FE857063C0FA371919B54015 8D~0~osplat
1,666,270,831 *AF577B3F838202E10DD0AA3FAC9DE87676290450 A1P%W
1,666,270,832 *AF5047F01BDDC9D0296EF65461EE7A4743A04BF2 A4J=F
1,666,270,833 *AF54E35926F709955A77312ABFF23076967D7162 8EISITHRIOYS
1,666,270,834 *AF538C41430EEE91558B7AE4E729773F45BE5385 86d1debf3f3aa9b77c0d976a4fa33862-online
1,666,270,835 *AF5C69A5A9A72BD3D06E768F2B7FC646DB69C570 8FEB1751
1,666,270,836 *AF54005D576DF197D2C6DF8EF5E580543B07C42B 8GLAMOROUSNESSES
1,666,270,837 *AF5064896819F457A8A790C269F109ACF7C3D7E5 8afkeert
1,666,270,838 *AF5457FEED6009F0D5B2D849EF1A8EC18DB0C95C 8GOOLTIW
1,666,270,839 *AF55B5DA2D36812CC7D7824EBD1D7935672FAAB6 8GRUPPESTRUKTUREN
1,666,270,840 *AF569B4F4678577697E99EA2396D5C0EC726BB93 A7_I-
1,666,270,841 *AF5CB6AB28532CB21D0F1CAA7441D9EBE680DCC9 8IMMOBILAIREBSW
1,666,270,842 *AF56798B0137655F43BB0A8ADFB69A92F88C70C9 8JSBACHGOFISH
1,666,270,843 *AF5779F47E8465E7BDD3EA354BCDBE19F1052B58 8LOBIPES
1,666,270,844 *AF51BBEE38A9DF01745D18A713B5ED895E55A26B A$A3
1,666,270,845 *AF55F0C0BD3006B6017488A0202D96E76A327FB0 aaa;q>
1,666,270,846 *AF5B4787D2E7D2FE1F0DFC542675783F47805A9E 8CAPTAINFIRE
1,666,270,847 *AF55704CC317F420EEEF6B1DC5BA1B8F96F893C9 aab+r
1,666,270,848 *AF5036DF34AD742819AFC8F777342AF0134EEA59 8D~0~osplat
1,666,270,849 *AF5C2014E5CF763AC053FAAE406A6D92852381B8 8PERCYLJF
1,666,270,850 *AF5F6045A0234D64CD90663CA6208294563EE20C 8READINGSTRATEGIES
1,666,270,851 *AF557D6EDD1BE856B8C824E86599E6B4A3364FE8 AADZYF
1,666,270,852 *AF5764ADDD707E047655AB749CF1DA8B2797F189 8SI-CENTRUM
1,666,270,853 *AF52535EF3BC71460E9FCEF15A16F3886164947C 8SILLOHRU
1,666,270,854 *AF57938680612F6967EF4B651CC29A06E1B49891 8SMITHSPHILLIP
1,666,270,855 *AF55E35EE438EA9F9DA118DE91F52FB32FC07BB0 AAFJ(J
1,666,270,856 *AF506411403BA9049BABCD42437F0A07D1DC4408 AAGTCTTCATGGATGTTTGCCAAAATTTTCAACCAGTTTTCCGTTACTTCTGCATGGAAA
1,666,270,857 *AF573945420EC5B78F48581C740AD1227D5C6DC7 AANVANGSFASE2
1,666,270,858 *AF530C8BE5D2CFB75AB76386312182A543F52322 8ZEREGNARGNE
1,666,270,859 *AF5D35964C67787C8ADD8CF061B5F31C4878B6B2 8OYGNOTCPW
1,666,270,860 *AF516B0E1A83AC3E9DD1620BF2A13AAB0E51C407 8PAULORLANDO
1,666,270,861 *AF5D2DBE728691FA44C1CE992C70FBDD8FD71D68 ABCD1234CAROLE
1,666,270,862 *AF51637F35AFD3CA131CDACFB47FA599C0360D2E abm7s
1,666,270,863 *AF59100A57C2A04ABC72C82DC73ADCAB27E68B2C 9BSWSUNGARDBSW
1,666,270,864 *AF5E2E53EB1157C030AEED904ED725B4C120BB3C 957713 er bleibt meistens auf dem flughafen
1,666,270,865 *AF5585434ED9859C2B049302267FB5948B4C7DFC AC=\$
1,666,270,866 *AF5D5C2F7A304FFB1D20C7A5C37CE47483C67AE4 9EHCATUOS
1,666,270,867 *AF5D4AF25587C04D1F9D378FE9827CC3ACE763CC 9FREDANNA
1,666,270,868 *AF5A84EB97CCE2437DB38C3F31EF011D8EF0FF47 998322 TEMEL.DENKLEMLER..
1,666,270,869 *AF55FD63F21E1B474ABAE73EE97160DB40CD14FE 9996521864lee
1,666,270,870 *AF52DFCECD2224FF0DE410DF068F5A22949E0D8B 9IGHLIVED
1,666,270,871 *AF5B1188C840EDBE70DDB4966F2D69CCB1DA4197 9-MESTARUUSKILPAILUJA
1,666,270,872 *AF573637C7E9D043D1B89E068591CE580628F1C2 9COURTNEYTOM
1,666,270,873 *AF5348CF75F0BC00024207C257E15E0B9D5BB775 9DOOLTEIG
1,666,270,874 *AF5D53CD56CAABF688B1FF6B41D679F63926BF29 acq+o
1,666,270,875 *AF5E23C9E35672F22472F492906265D5B02DAE9D 9HIERZUVOR
1,666,270,876 *AF5106436E513EE5DDAEEE3037C1F19B0F8491CB ADAN.SWALLEY
1,666,270,877 *AF5B08F2313E8FDEAB9185C4FD3BDBEACCD00C9A ADEBNEY
1,666,270,878 *AF50D89D9DE8DC4ED0F3214504DFC50A511DE419 9JULIAFIREBIRD
1,666,270,879 *AF5292A0EF7D99461771117D3DE507486D24F5B8 9KELWEDSTRYD
1,666,270,880 *AF5748D205029A4D6234CEA917DC2B3F0B0CF7E9 adigirts7
1,666,270,881 *AF5182556273620B2920E4F3CC661772BF7D2ED9 9PRIMITIVET
1,666,270,882 *AF5D1E223CD44C45E13847916489EDD0B1CC9955 ADOLFO.NECAISE
1,666,270,883 *AF52BD4F183BD12B30E42A5B605DD7BBFA145121 ADOZN
1,666,270,884 *AF5CB7190243DD423BD78B54C6C356CE2EDBEA77 ae#g"
1,666,270,885 *AF5FB4D4C51118E9ACAACF2AEB5D7DD241308C1B ae.)h
1,666,270,886 *AF5EE73B8CE6C2249F8EBE2E2E0A96AF46C26864 a:#0#
1,666,270,887 *AF5C3EE640CEEB88DE7DD7D0744B2EE260784682 9PRSSIKESKUST
1,666,270,888 *AF5B3D62D2759F7983C62DBC9494D7192120316C a0xuh
1,666,270,889 *AF5F48A16E714FA6E50531B9F0AFD46B5C71452A a;fi
1,666,270,890 *AF5687C6C6BF16BD076CDC2BAA60C3B16DF661EA [email protected]
1,666,270,891 *AF55A6890C5D11113A36C822A20CEEF5A9AD99A2 A/g
1,666,270,892 *AF594BBBE4E39A754FBB22CF6150321D3B64C775 9ZENAGAS
1,666,270,893 *AF5D5829698FC731EDBA6A59402EC4DE72684F4D AGGVM
1,666,270,894 *AF516753AAE59B81AECC8BA70F6D4DDEC67CF958 a4e4;
1,666,270,895 *AF55880A3ABEF8DF93386146496D5DF31C3FE3EE AAE=[_
1,666,270,896 *AF52C4CC42D535654B23AA133643DE85261D059B ALANMCMURTRIE
1,666,270,897 *AF54768D028FA713107ED91F0D8E86653859D6C0 abeconour
1,666,270,898 *AF5C3E3C000F01465896E0136F31169E6D86FD41 ALBERTO.SWINSON
1,666,270,899 *AF57B1A2C34E2B2B74E482861EDFEC78499E3E2A abgeklapperten3
1,666,270,900 *AF50664141FA95FDEC124A51C0E1D89F3F5C96E1 abgeriegeltes1
1,666,270,901 *AF5C92743B8E1838290868E26F39F83045E09B60 AAVIDHYAS
1,666,270,902 *AF52D9380D7074547A9252C6F955DF03DB5E900F abm7e
1,666,270,903 *AF5E76E3D34B64BD027C24A604D521B586A64EFE abortion
1,666,270,904 *AF5FBB8958A6DB0E343529376C2A6C8DA7996EAE a(c1v
1,666,270,905 *AF56BCB2AF815922B540FD388F79008DCA8AAC82 ABS=N
1,666,270,906 *AF550964EBFD1131BD16DE05187036237C7F1991 ACÇÃO1OLDID
1,666,270,907 *AF5ACD4C3F73A28893D1E52F185A17A80153F979 ALISHALIVELY
1,666,270,908 *AF5B51C8AA5B1039182D756A2A70C63602A8012C ALONSO.CORRIGEUX
1,666,270,909 *AF564708F9079BA1639B579F21D09D780256F213 alostforgottensadspirit(unreleasedversion)
1,666,270,910 *AF57217F9AB34EC0D4286E09014DE010CAE32CB5 aewrigens
1,666,270,911 *AF557AA3E1E5C4217FBCB503D0E430B7A38241B8 adab
1,666,270,912 *AF5E11C569C19E8AC690D7FDE2793BDF26C9C334 alu#c
1,666,270,913 *AF5222A5E2D39668047582CD5DFE659A8AF9226E ADATARA號
1,666,270,914 *AF54C3F6D59015877B0F1FF0444C125FEA8CD202 [email protected]
1,666,270,915 *AF57438308207527EA117B29152597F14854D8F8 [email protected]
1,666,270,916 *AF5E0FEB2206EC63F411BF555334D1ADF7A73C6E amphidesmous2
1,666,270,917 *AF5F912BE4C4098CEA797D47B25727A90F7C7937 andraos6
1,666,270,918 *AF58819DEE752208206851F46E2458CE85031371 A/g
1,666,270,919 *AF51CAC1F76ABF52AB26F8BE6C40E786F9CC4425 AILCM
1,666,270,920 *AF53D96F290E0D04B91150FC104F1BB10D2C2C5D ah5wi
1,666,270,921 *AF5251FC9553E5D3C3AB9FAF9A8BF089974127EE akobmat3
1,666,270,922 *AF5B8E034BC0C1502561BAAA8383CD725DD462E8 ak-wo
1,666,270,923 *AF5AC3023F87C680D74EBCC70D3B67E7D6105F6E AIH0B
1,666,270,924 *AF5750E103F1991E3885FC5222DA05B1BA17D942 ALBERTBARRINGER
1,666,270,925 *AF5F80B9BCA7BDF759B5DECE18F0CD1915D05D92 aitb6
1,666,270,926 *AF50619B01878E4337100711C74E948279FFF8E5 anotaaned
1,666,270,927 *AF510276F67671CF838571DBEDEB6F63CFDC931D ALHAJA SIKIRA ADUNNI - AYINLA FUJI E GAPUPE
1,666,270,928 *AF51D0C7482E53AD9D908E00F9AEAECD029F5B90 akkeinen
1,666,270,929 *AF5069D63D723DDA5EDC14E8F674500729DFA940 AOIFE-MCDONNELL
1,666,270,930 *AF53986D10E4B2535331DC472FEF43106E61EE5E aos6c
1,666,270,931 *AF55993FA7643914935C64F2E4F029DB111D4D29 AMAUU
1,666,270,932 *AF5B106C19C831C5E152FF7A3D924D258E81265D AMOSPEMBER
1,666,270,933 *AF55B85D90DDCD56734893AC9262C58423FA826A ALHB;
1,666,270,934 *AF5E653BDFC57CE68A3DADA4A6D5E36E30691B8E ALLOHESH
1,666,270,935 *AF56662F56984A94A6820B25C4F5A153B3C1DC5D ARGIOPOI6
1,666,270,936 *AF5919F74C5CFAEF7674DD7435EDBF924DAE5BCD a!#_m
1,666,270,937 *AF516E623E8EA5D154DD09346D8100A8C23F1D60 ARNOLD.ASCOLESE
1,666,270,938 *AF51B33660E4DF94A9EF789B3758A65A2F58208A ARNULFOKALER
1,666,270,939 *AF51C08A9247F6D2D50B23DDE728FF769C7DE5D7 AROSITTO
1,666,270,940 *AF5694252DB5FA78FF8467D8AD69400602F14788 ANGEL.LANSEY
1,666,270,941 *AF5948C343B0CE7BA13CC4F77EEC67E171FAC789 [email protected]
1,666,270,942 *AF5E34AFBB0BECCF39047C5BB212BDF1164588A8 arsenitos1
1,666,270,943 *AF52889D57E1033AFDDBC1FBAC1B1851273E4FE0 ARSNI
1,666,270,944 *AF5D0C9D9021BCD08765FF9F39728F9ECE644A07 asdfparis
1,666,270,945 *AF5F284424A3D705549972AA4431FA97CB1C6B74 andrea sei un figo
1,666,270,946 *AF5716683DB8C617EA07853944085D5881DED07C ANDRENOBLE
1,666,270,947 *AF5AC82FE3A0EC93300917A0EF95E938D07C9F7C andressundt
1,666,270,948 *AF5C93D1CC5CE04C36A98C4C69AAED3BB7B0C91F AOESSOKING
1,666,270,949 *AF5E78D436948B096B3877AE48BBA40FA182C0AA [email protected]
1,666,270,950 *AF55CCF1F11AD30432F05C9F648DF0789A38A596 AQ9F?
1,666,270,951 *AF55165041B26341AA77E5EA2478324263AE355D ARCIRAIT7
1,666,270,952 *AF53E95C8C9EA1239623690A4A45F6B9CCAEF43A ARMAND.RUSHER
1,666,270,953 *AF5C53D8808849D57284E7B2847855433B61AEB0 ANDRYALA WEBBII
1,666,270,954 *AF5E89B5A57BECCAECF615C52D9A237F5B786A5F andychandler
1,666,270,955 *AF5BCBF50F228F97AD9922DD3B854F37F35DAC1D ANGEFUEGTEN
1,666,270,956 *AF51BF4A329FE9EEF4101DA0802E36753F716C7C ASILÓME
1,666,270,957 *AF5F615399ABFB07C19EB0007E59AFF685420AE2 anil.barot
1,666,270,958 *AF5E6B384AD5CB1E1AB33DEED9F63A098AD2F7EC ASQ=
1,666,270,959 *AF514DD09A4D8B1C7567C60B5242587C27AA96B0 asfaw.tsegaye
1,666,270,960 *AF5DCE102892C6495E114D4056B529C6306A9DDD ASHANIYI
1,666,270,961 *AF52B6E0DF07C9F396C41C5C99A91325454DB368 ASHLEYREPPE
1,666,270,962 *AF5695E67515579A55ACC892120743F074657166 A%;T1
1,666,270,963 *AF59CC819C7E9FEC72F91B5BF57D79DBEB124A63 ATTHEWAL
1,666,270,964 *AF588F352A97AEEE0A0405D6AA7884F4D0DC697E austinwaybright
1,666,270,965 *AF5716C40575A68CEF98B7E58E43CFDB2DB9BAC3 ao3dz
1,666,270,966 *AF5CB2C0241182962D10648232471ADCA8838581 AUW/N
1,666,270,967 *AF5AA2C35E6C37BAF557D14D3C893F089AF87259 AWaC
1,666,270,968 *AF50BF729241CF8D45388F8D44AC63344CBB4860 apv&-
1,666,270,969 *AF54B20E7CAF9F085FF4FE0AF6562D09750F4317 A/R1R
1,666,270,970 *AF5744D8FA816FF8E075967C273AC44268CA65A4 >B0~QP
1,666,270,971 *AF59F0EB1C42CCC56AC2B504850EAB05C7B099AA [email protected]
1,666,270,972 *AF58888762A597B73EAC0354A7B7443BA5465D07 B5KE
1,666,270,973 *AF5F6ACA0A520322BF645F39612E537C1488A35B asm0_
1,666,270,974 *AF50083C062872C24DF997E001092C3A8F8A65E1 b"e"
1,666,270,975 *AF5E7EED5B765EB9EEBE7843B44931F1B5881D92 beat3mix
1,666,270,976 *AF551AEC6AAF5109C3AB595B25A49F806DA8D891 BEESTACHTIGHEDEN0
1,666,270,977 *AF51C9120C9BD1762894CCCC9D5C5FA115D7DD20 bekc
1,666,270,978 *AF5E58DF5F7F2D13F1067A25C14B1A44A45E6AF3 AURELIOMURACO
1,666,270,979 *AF549C5094CB0D3ACD24842A8FA669B7413ED6B5 batyashev
1,666,270,980 *AF5FE68A4EF0D9CD9D84368586607B67242A838F A,$%V
1,666,270,981 *AF5FCD0976B45F277ED3D346E03DD78A787D7409 a:vf
1,666,270,982 *AF538EA0086DA45BE0A36E7BC70A5DF4159D77D0 BDOEPPENSCHMIDT
1,666,270,983 *AF58C99E6C715D606BB8367EB553C9694E68D80C awwep
1,666,270,984 *AF5817F0B44F60A540C3D1EE8BEFE31AFC4B29F7 b-f5
1,666,270,985 *AF534067DF60571B722327346F684E4AC4A41FEC BG-W1
1,666,270,986 *AF5CF6CCD7FC8D0B14934136164FB14EB0974141 b3c6g
1,666,270,987 *AF5E9E13672A13308576583E8D30C0474B08CE45 bhpb6
1,666,270,988 *AF50D62F7CD526B2EEB418F70B7909FE8E386359 BERUFSMALER
1,666,270,989 *AF51E5ADA77A31752280A19ABE400A6A6E8D065B BIJOYMANIK
1,666,270,990 *AF57E2B2695193102AA6988B5A26D05E6C260177 bf22?
1,666,270,991 *AF5793BE0FECA1F936FEAAB3074688D6C47970C7 bfg$c
1,666,270,992 *AF554B58B760732F65435DEE6477E7D0D7AB029A bi+ug
1,666,270,993 *AF557B545A397B5C9A7670B3878CE2E29D8D848C BGB0O
1,666,270,994 *AF5F0AACB44A704768C353592F757A4F5A503882 [email protected]
1,666,270,995 *AF5C5560FCF7DA9EAF7B30F5A69F0406B4DC2586 blr4?
1,666,270,996 *AF560D3176CE6EDCA9F50DEC0D1A9525DCB745DD b,9tg
1,666,270,997 *AF5C73DD190CDC748C53E317908E9151E183474C BOB.VILLATA
1,666,270,998 *AF5C618627768F8854D46D4ABBD47CFA32F3F8FD birzebudža
1,666,270,999 *AF5911D7820DA5428E32A01C9485B7291AAFFC25 BJTIGGER2
1,666,271,000 *AF51CF3A8D007EBA22DDDBF4479698CAABAF2C87 bkf0v
1,666,271,001 *AF5D734CFB7927C667D8B335AE068202D9EF4ED0 B######P.`~.`~.(00)
1,666,271,002 *AF5C93720B11281B3E8045477E038CB400CCCFC3 bradlyunderhill
1,666,271,003 *AF5C4B7A20345242B633B109A50DAC88085FADBE beautifulbodypart2
1,666,271,004 *AF5DF3314C4503CEDB4A603CE09C8777020BF7AA BENIGNUSGRAB
1,666,271,005 *AF57E19F961300F9676E8CEA0105B2F9A2C83DB0 BRGRLJKRING
1,666,271,006 *AF5CF2D31557224EB6842B1883D11E605A0A21CB bentonratley
1,666,271,007 *AF5FA5CB7F1777C237D76FE22F6BD4B2C5982CB1 bricemceirath
1,666,271,008 *AF5AD10D2F32E2CED08C459871734C71453D5CB8 be:rb
1,666,271,009 *AF58E6DD9AF138C3C2BA6021C38E9FA8220D7F9F BRYANSZACHEWICZ
1,666,271,010 *AF54D7CED782C5A7E689F342E0EE363E9D420C8E b?f=;
1,666,271,011 *AF588429E1544FC6B524CFE201C7761258435916 B------)~O-~o-o->-<
1,666,271,012 *AF56E66D2CC1D17052C51385728A1E2873E8716A BG5X2
1,666,271,013 *AF585A709E34FED2B3E7B420D1E481C4DA8E0434 BQAW8
1,666,271,014 *AF5CB3E2512E3B6E6696CF877A3587691413DC81 B,UN
1,666,271,015 *AF56A059AF57E00B3E0382401F77DB091FFDBB46 B(,IH
1,666,271,016 *AF54A31D2634C915D6D6FC7707F8D9F595F5DAE1 birštonų
1,666,271,017 *AF53BAC988C5B49B4D8781E8610B540CB53A7300 bkd4
1,666,271,018 *AF533A0D135872322D83B6B7CD86C805A323C81B c/#3
1,666,271,019 *AF5F36D4D071E75D4957E4CB6784A21EEBFE25B4 c4h+
1,666,271,020 *AF50AA89C1001BC043E5A27ECD4C320A19C54FAD BR-TAX
1,666,271,021 *AF5B0963AA14419AB4E247D174902427C633627F c$?9t
1,666,271,022 *AF51962C1D3397BD60E075B4C37CFBE33118BBAB c%a4d
1,666,271,023 *AF5EAF6195986A86B1E68C77E1E4AECA9B3DDCD6 CAMERON.WARHOLA
1,666,271,024 *AF5D978851ECEB5D823DC7BFCF63CC25C6973CD6 bob-bombard
1,666,271,025 *AF5F7824EF14D3E9FDE2994CB93C09CDE1DB1C35 CANDIDATAR
1,666,271,026 *AF5CD9037B04A97FEBD68B086DDF025A1090E5FE BSWTAIRIKUBSW
1,666,271,027 *AF595960CE94CF9D5006361F2920A75229A0C48B bt1l$
1,666,271,028 *AF505C03D76ED9723B3B74E7932AE9611B772C79 BOOTS.AND.SADDLES
1,666,271,029 *AF5B1E3CA1C8D4161426C9D61661964FC90E2784 b---p.*.(^_~)
1,666,271,030 *AF5C624AD5DD0283E625AA4CF99AE302F2A789B0 CARLOWEYAND
1,666,271,031 *AF5B78069DD5D5B22F0E289057801FF3B793B737 BPSAS
1,666,271,032 *AF55F0EE8340177FB40B9C8D49BCD5BADAB4B054 CARSIS
1,666,271,033 *AF5DA28F6D58D552E1D2F381917B2D8B713DCC6F [email protected]@l!5+!c
1,666,271,034 *AF548D328C5D4A00E27B4D8EF0621DDAE2F61F44 BRIEFT
1,666,271,035 *AF5E5E349B807CA72D085EE8F9DB2417C8F2CD0C c:d,
1,666,271,036 *AF5ACEA57E7BDA9814D1305785D95198FBCE94F8 C#9KF
1,666,271,037 *AF5E28D28E32B0487034C276F37A31FFC75A3B1E celebrare(originalmix)
1,666,271,038 *AF5917E891625F0E97CE6F5BBB6F2451ECDA06DC CALVINGEHLHAUSEN
1,666,271,039 *AF5B432EA24EAE5401C24EE3FA7A60352BF25EDA CESTUJÍCÍCH
1,666,271,040 *AF554AD8EF7B6F99856ACC3D9D6A69A9C059218F Campaign Necromancer
1,666,271,041 *AF54B7049224A3C56F2977D258A7EF4826E143FA bswcsuvaxbsw
1,666,271,042 *AF56E55E6488F42DF53E8E3531B08D30986350CB cg)ef
1,666,271,043 *AF51AE8BCA1DB44AF89C48151C20D22C4952191E Ch9S
1,666,271,044 *AF59E239A07DEBADBFE24E8FDEC8A42F40D86B2E CHARLESMARCHMAN
1,666,271,045 *AF5DB7D1BEF1BFDDBEEF97A2736B2E33BB78F5B5 CARNEYSES5
1,666,271,046 *AF54A3803F0DFEC4FE0D33B119EDD1541B437A97 bullacens
1,666,271,047 *AF5FE4B62687D1354189D7A8E86F657A349393CC CARROL.SNODERLY
1,666,271,048 *AF5E05DE1802381F4710B5CD746727C7AEDAD99A buovb
1,666,271,049 *AF5F7C779B65FD196A58CAE66CC6ACA35CB6E673 CHERIFE7
1,666,271,050 *AF5234C0956B6B5E1808715D8CC8A27809689285 BVLT6
1,666,271,051 *AF5BBEBE330ACD15A83E2D857E59E21DA361B9ED C&,/
1,666,271,052 *AF55067625E2AD36A6BDE8CBD50D32AC8C9F4BFB cecilondik
1,666,271,053 *AF53D1AEC49A65EFDE57FE8BE6741A91A3BF2B90 CHRISTOPHERDICKE
1,666,271,054 *AF55DE334FC8085DC29ABDB2CF3E3853B3A0D688 CHRIS-VANCAMPEN
1,666,271,055 *AF53F8649819F0E77142699CFAC0716A8D153E30 Cello-Sonata-No-1-in-B-flat-major,-Op-45:-Andante
1,666,271,056 *AF5104D3FD3C4A00ACDF0662567205ED8601BAB3 CEREBRIC
1,666,271,057 *AF5B342609970C08312B0E907779389EC90D4350 c6+vm
1,666,271,058 *AF5EC5CCFDFDE246E591AD6720F8BF3D25942920 CACUR
1,666,271,059 *AF58672F737006CFDDA0C407BA27DB6A0F6A84EB cagnotti3
1,666,271,060 *AF5BBE29CAF52BF8AB750DD49FA30FB88C11F0D9 calmenno
1,666,271,061 *AF585E42817689BE5601FB8FC22E6E3A080D8EC4 chandanpaul
1,666,271,062 *AF5BB8F4AA6D8145B921A6F043DAC74AD085BA1D [email protected],
1,666,271,063 *AF51F3DC88874DF0B8803D4FEDF5CC6F132A9A29 claudmerales
1,666,271,064 *AF513953C68A24C9197BDD5194FBDE9C4777D944 CANNONGODEXAXXIONVOL
1,666,271,065 *AF57CA731C07D364EE3FDDE6079B15E92C64E95B cantiga.de.falvan
1,666,271,066 *AF56B3556DCCD1B649D8144CE911E528D803DFD1 CHARLIELUCIEN
1,666,271,067 *AF5C06DECC5E3CCDB79A059B3698ABDB58A4C542 CHASE.CHAFFINS
1,666,271,068 *AF5A63E04F910BA86E82C5964347A92641D87EC3 ca%pp
1,666,271,069 *AF5C31A7C9087FBBD79BA9AE97DC8C79504CFFEF CAREXTUBULATA
1,666,271,070 *AF5A14732AB788D7A5CE19D1071F1E24216785BB CLG0
1,666,271,071 *AF5E64E3A5274F02D02BCA6AC47625A92CB67B39 CLINTONENSLINGER
1,666,271,072 *AF51CBF9517B2DC370795A77A8B3DC791ED4BAFB CHET.WIDJAJA
1,666,271,073 *AF5AB32D42726E1B2C03F4ADBEFC5046BFC8D7F5 CLOTHESPINNED
1,666,271,074 *AF531035443D4537C85A01397BB196B8EA03B1E7 CLTRF
1,666,271,075 *AF5F16799A9EB8C97EA2604C2DF59FD0019AA789 CARTER.BELLAIR
1,666,271,076 *AF53A128FBAF4238B7642F4BFF9A991F5CFA3ED4 [email protected]
1,666,271,077 *AF545CE09197C0F1C7324FF77CE41311C30EFCF6 CHRISTINE.SINDELAR
1,666,271,078 *AF5A7A190BF75D505DE8902DEA565FC50EEFCAA6 catsbuzzing
1,666,271,079 *AF593F4BA629E4E437E31602086A7D60BCD87BBB catwl
1,666,271,080 *AF5387D2301B164CC30C9A5FEE60D997F0A09D40 chungrideau
1,666,271,081 *AF5748D83CC2EF200D70E3B3D36DC62ADFFC4597 CODY.HEINDEL
1,666,271,082 *AF5F83AB032E3FE26FB0271E31182E451EFB3397 C-H-V
1,666,271,083 *AF52B036AA5163537CDA3DFDDFD9A7D5276C1B9A COLEMANMADOR
1,666,271,084 *AF5F04A4E1477466CD18F8F720A3BDBB7227B921 COLEMANTSCHACHE
1,666,271,085 *AF54788E69D59AF41A3F08DE22AF030CCAF4D9BE COLE.MARASHI
1,666,271,086 *AF5A827624ED9AFA8D78DE86376F9C61ECC597CA COLEWAAGE
1,666,271,087 *AF5F6C34A559A79F171CA09808608700207BCFD3 COLLEGEELANORA
1,666,271,088 *AF5583408D7A74734CBF5A0655ADCEA9B19D941B collingrandos
1,666,271,089 *AF56C0CB5A84CA3AFDD5AED216F42D2ADD4B1AB0 color.mixture.function
1,666,271,090 *AF52E6F26FBC85F345DAB2781983695D22FAAA93 CJ"#V
1,666,271,091 *AF5D4D247A9343ED7E0593EA548D4F08AE73B13D CKBo
1,666,271,092 *AF59616DB68A8DB1BD6EF289F75A7734F2764492 CON5OR+5HIP
1,666,271,093 *AF5F6FFB86A24DA8F207CBF037D522902545700B CESARCARRAWAY
1,666,271,094 *AF586F80BFC8294D44D3AFE2CFA9587502D11BF4 CFIW,
1,666,271,095 *AF5681941DBEC8832BE80DC8A8A1FF6D997C8C94 CGFSD
1,666,271,096 *AF5C2F77A62C23DA634E3040486C0132284FD4A4 ch.54
1,666,271,097 *AF5D457B9EC7B7D10A12F33C8083DEA216B9D5C9 CHAKAMALIK
1,666,271,098 *AF5076532FEA5B89BB76C24EA951DD41DE3C8E76 contagias8
1,666,271,099 *AF5BFC3F2E577559811EDE1728677B992F7D2918 CONTNENT411Y
1,666,271,100 *AF50ED71752F13A32493676313C4DBB7EEAE7F3D c!ns/
1,666,271,101 *AF5A9CCD532226DFB1225A84861FA9494D77412A CHDGB
1,666,271,102 *AF598229578E05E7A31B2A1B1FD87A6DA8541A24 COLEMAN.DUNGY
1,666,271,103 *AF5A6244F727D71BC46574BAC566E94607E93775 COWSTUFF9
1,666,271,104 *AF5902F41B890726FDD0C439A33DBAE17EFD31C0 [email protected]
1,666,271,105 *AF5061E11E62562F011D155313A0645CBBA2EFE4 CHILAMBAED
1,666,271,106 *AF5DB3D12CFD4E3A9AD4A46F49172C38C96AAF3C choparda5
1,666,271,107 *AF5C1D21EB0B61FB16EDAF5EBB72701B9F3445F8 [email protected]
1,666,271,108 *AF5A561A7293D9BD51827377BB620BCD27218E6D CQ$I0
1,666,271,109 *AF5C8A370E8D63C445762DA013BDBFD3B6699F54 CRISTOBALSHUECRAFT
1,666,271,110 *AF501ED96D691570ED30C87AE1AC568E1F850294 cristopherpanis
1,666,271,111 *AF59679E03B79EB200B1673E4E528764CD41788C C%HWE
1,666,271,112 *AF541BFF6FC42499F1C2A33A6A1FEBFE472983F3 crowtracy9
1,666,271,113 *AF59DEBE54767D17C2B39B062965967052B68C74 cp:mc
1,666,271,114 *AF5F1A3B1A1B19224A1EF71E94C5E3CF072629DB cir:.
1,666,271,115 *AF51915D5779599F3962463BF62AEFA358AD96C3 CLAUDDINWIDDIE
1,666,271,116 *AF586944D6D973103512F934455D29DFEADD77E7 c#qh,
1,666,271,117 *AF51E52A8C140F1DCFCE679140759C291BC882E8 cv0ws
1,666,271,118 *AF5E15E76184171C821409AA0E34CC01EDC8F7A0 craig1019
1,666,271,119 *AF5A019F4ADAFC5769DD324C49EED8E0E452EE56 CWBS$
1,666,271,120 *AF5D3769E3DB24234CFB745F265630AEA1723FC9 creus
1,666,271,121 *AF5F1D74576385D2C06F8429C1C3D064B117F5B6 [email protected]
1,666,271,122 *AF50EE26DBA408DBFFF09AD3744CE21E2DA3F8A4 «CYPRESS
1,666,271,123 *AF55939AE87489D4FE88B97946E2B87298C7EB1B C.M0D
1,666,271,124 *AF50C99B50B8B86EA180880230F19BFCD8143373 CNE,
1,666,271,125 *AF56ECE3B599F4A5271E8640EA2B4366E60E8865 d4ve/
1,666,271,126 *AF5B345016D266650793B01675F56F4418CB0976 cu$5g
1,666,271,127 *AF5043669E1CBF580218D0124C3CA45D59469BAA d7_,
1,666,271,128 *AF523B3B51A2D18EFA9DCED0708D79167F656D4B D#7;C
1,666,271,129 *AF5439E27DC97582B7C8519AA5CA2229E967FEF4 CX5UL
1,666,271,130 *AF5658D115A2015314E503D12CB37DE37B665154 damienboisselle
1,666,271,131 *AF594D3AB53D1892A1CA24D4F2BBA81A88C22881 CORNELIUSSWELGART
1,666,271,132 *AF5BE3EBABEC23844119840248206EBB968AC5C4 DAMMBRUCHPUNKTE
1,666,271,133 *AF5CB9F9473928AECC83172CCD6272787C88818F DANSCOMBE
1,666,271,134 *AF558FC328896304FF6CCE728A8ABBEF85E70180 D3U%H
1,666,271,135 *AF52EA14D5535F3C5785A1AB6EB873E062FB3BFE cpvr
1,666,271,136 *AF501A6816CE6E330E3628F77555DF12324419AB cq=l
1,666,271,137 *AF596CB92BDB3205C74A4C4554D6DC85C8F8984F DANDESSERT
1,666,271,138 *AF59742C94E235CD851D8B4754AF7975C05B7A42 DAVID-WHITSETT
1,666,271,139 *AF5C94A29A16DC7494D485C9AC42EA0C5FD98D6E dawn.cormier
1,666,271,140 *AF540E093B7EBBAC8FA0DCE27E8EF4F2894C3D5A DAYTEK1980
1,666,271,141 *AF5D76A4DD02DDF61A874636EAF2256E60A5C43E DBeu
1,666,271,142 *AF5F79C1C1DE322DD64BA9F22ECAAD203FDA26FC darrylbordeau
1,666,271,143 *AF5DE227525EA1A110B81E359574CBABE2588E44 DATASDATAS
1,666,271,144 *AF5DFEDB73DBB23F78553C51D73D96A1D61DFFF1 DCL!U
1,666,271,145 *AF5993CB84F752A9329345D864BEB3BF903E8D00 C#UUL
1,666,271,146 *AF510265B2CC7B81307A37C0D5BA48965C673966 deangelokrans
1,666,271,147 *AF53D04DE58A195D02BEC8B70A7F7B53E8B7B9C0 DEBBIE.PICKNEY
1,666,271,148 *AF5993A4D0F83512BE1C10BC45FB9CA04F925563 DEKTEKTORENE
1,666,271,149 *AF5DC460A52D849CD00D34320399C35592566844 dec251975
1,666,271,150 *AF51D02497A12C1D00D173DD855CE92A30C3100D [email protected]
1,666,271,151 *AF53564387623412DBC3E234537894164A9DA2A5 delmarimbimbo
1,666,271,152 *AF5FAAAB760AE9C1F7C4672011B7316A8FB91E0F DENISSE513
1,666,271,153 *AF576C2247E176194B0B5A2A4AFB19DC3D68D082 deonjennette
1,666,271,154 *AF575F4A8EDB980A48664A516F4A2656B055EDFB DENADNDON
1,666,271,155 *AF57BD00C6C1526B2136AC223FBC02A7404D5E57 [email protected]
1,666,271,156 *AF53B1D6C71A6AC201EAAEA26CEC3F241918B3AF D0S6V
1,666,271,157 *AF500A2B241FFF32D3577012BEC53151D2E2E364 des3o
1,666,271,158 *AF569B10B6F51CBA7D06EAED19FADCB3CBAFD02A D74748
1,666,271,159 *AF5C3408652A61917EE8C120FC5687E8DBA48EC0 D.7Q:
1,666,271,160 *AF52EC505D79A9822C1828EE9AACE90FD2CE76EE D92VM
1,666,271,161 *AF530F82603DA623F49E08CE3C63AF5726C6BCC4 DEVIN.MIDGET
1,666,271,162 *AF55E97E1A07DF366AC744709AEF90B04E65AD26 daa-lube-boast
1,666,271,163 *AF5B7400FEE16E3F7934849A6B6450205F9F1AF2 DADMAGCOM
1,666,271,164 *AF537C71E1F3E8369B38DE27DE5F3149DBC1416C D-FTL
1,666,271,165 *AF5B739F3365DD1126712156906785B9BCB0669D DANIEL.LAURENZ
1,666,271,166 *AF5E96DCE47E3BE3F236C643A6276922A3024E4C dftpe
1,666,271,167 *AF5D190064A408B1383BD4ECB99B07B6D0B3E1AC DA-RG
1,666,271,168 *AF5E3329239326FC1359D95C360947134D7982EB d)arq
1,666,271,169 *AF52DCE40B773F13CEB10C856D31DD4E2F9BBB27 d#$hi
1,666,271,170 *AF5943FE23E4E660D586426CAC6DE5B839E29376 D$bM
1,666,271,171 *AF5E7D322E7B441BA54DC86A8C2F77C19391D59C disciplinas-auxiliares-de-la-arqueolog
1,666,271,172 *AF54B0D31B33892354B500D8A26CA79EFE783B46 DBRICKASHAWDIOR
1,666,271,173 *AF5F83D53F59B0E53F939DD21109A72465FDE93C DISSOCILOIA123
1,666,271,174 *AF5B5C3052220928536F6A936E4AF6947EE3CCEB DJ+FC
1,666,271,175 *AF57FCD03C6E98388DB7E3932FE246E03273CA2C DKAKV
1,666,271,176 *AF5EB0D65ABB27894BC59BF8CB4C9C729BAEAEBB dl_ce
1,666,271,177 *AF52D5825D980F38ACE094C709BDFD7AB0840B35 DLEPICIER
1,666,271,178 *AF545BBB9612C07CA65CED342D45C96AE87016AB DM)_
1,666,271,179 *AF5CB18829D823BB37B794CD40D5C7D6CF07A96A dmnbs
1,666,271,180 *AF5607DF49704DB1CE69C7F6D03DD47877F13A0C d)nai
1,666,271,181 *AF5CA1E531E80CE12B8F2DA907E5079CB95BBA00 demi.neal
1,666,271,182 *AF5F666A412146598523067A20110002E2F257E1 DNYL
1,666,271,183 *AF592AD0EDD5896ED6353848DCF701D31D29A127 donnellbuecher
1,666,271,184 *AF5D16E9D30079985DEA20BCCB14FF6CA5878BB9 donnellsaltness
1,666,271,185 *AF54C31201A584A5F79440AA4586CC088B75A280 DONN.HADDOW
1,666,271,186 *AF507CE5FA9841CE5FFC5A508241B5BE5AACE1B4 DORSEYGOCKLEY
1,666,271,187 *AF5F675A46A0371136270A749325E13B48CF16F1 DONG.WOZNICKI
1,666,271,188 *AF55B7F1D868B675CD5504D6067E0FEB5CE0D8A9 DOUGLAS.RIES
1,666,271,189 *AF5E4160D0796238A5F1DD7D12E36F2D234C16F4 DOŽIVLJENJSKI
1,666,271,190 *AF53FE03A006C91F83AF7C801245904D8030564D (>-<).*.*.d---p
1,666,271,191 *AF514E7485D90477E9581E188E098D79DCBC7E17 [email protected]
1,666,271,192 *AF596E827CDC90707A5AEA5EE7EA507E48E4DD2D DEVIN.PENHOLLOW
1,666,271,193 *AF54D1AA4FE4CED2ED88E725C162DD37A31A08C9 D)(FM
1,666,271,194 *AF5E00F4D508BAC1A83CA40C01837D8DE19E3385 dpec(
1,666,271,195 *AF5FF48AD5B173683CDB2877B2B38A16A4A9E87A DR!/
1,666,271,196 *AF5B85D6A69A208C14FF1E9411FFFC59DD86B4EB DS)J
1,666,271,197 *AF5E0E6F81D448B6FD7781D8A134F06DF6A95F9D [email protected]
1,666,271,198 *AF531196A7666EC0E805A0DE09865CE36DD244F2 DTEE-
1,666,271,199 *AF5CDAC5E613D1BD97358ECA766C5F1A84C5DCD6 dtu(f
1,666,271,200 *AF52FE316A537F99E1B604E493FC29424360AD38 D!SEN+4N9LEMEN+S
1,666,271,201 *AF54ACB7F115754E7E11EA799E0F3A35FCA0A6AA DUNCANOKUBO
1,666,271,202 *AF5D6633D67E6957BDE46FC1EF6EF6DD6D8FDD2C D?=t
1,666,271,203 *AF5BF97E4266A41E7AF9F235534AF1BEF6652F2D DUBOTTIN
1,666,271,204 *AF5DB5AB07D02BC2EBE34979280ADF81B09134C2 DISTINGUSTED
1,666,271,205 *AF55C5FD3BF94F51F86C72A364D7EF74C2FD40CC DJ_2.
1,666,271,206 *AF5BCA6AA012AC59AB6EC97B06FE23002ACD7561 d"vs+
1,666,271,207 *AF55D5D7E669DD9B2EF4636428079F04B5D86782 DKIO5
1,666,271,208 *AF57B306B94FE81762DA108AC27F7BD2538FAC96 d/llb
1,666,271,209 *AF586E9698565C0A76E1CE55DF49AC6CF8489B10 dn?yt
1,666,271,210 *AF5BB18E8327C896763C52AC32E515BC8C651141 docf
1,666,271,211 *AF517107F92C8906902E96EA77F9D6397F9D4E90 dombroff
1,666,271,212 *AF5FCF2FC0CE24E2531D5EFE610592D633234FB0 DONDRELLHARRIS
1,666,271,213 *AF57F5DD92A7ED5C8F5C743B754E719E9B62605B (e-)+"
1,666,271,214 *AF55464B5761F6632F20ED7FD11EB837327043A8 eakby
1,666,271,215 *AF50BF13F0865A3806661F271901FAEE712CE434 EBNEKKEB5
1,666,271,216 *AF540262D183ACBD3728E994760480A21C8CA6B4 DONNY.HENDRICKX
1,666,271,217 *AF55168AF6E8663BA837D557D83591B4ED0C0D86 donnyknisley
1,666,271,218 *AF52944D2924A1C84BC961745665EE403CAC7D7C eee;b
1,666,271,219 *AF5EA6EF5B55D1279183056148B8C66B1C968BFB EFiq
1,666,271,220 *AF53A6F82B19492B04A83C6A22707AE4F4420B94 EFRW
1,666,271,221 *AF59C1EA2A850CD4D3CD6BE0B030EFEDB55908FB EEMLOOSTED
1,666,271,222 *AF5AADE19B44FA2A89FCC451FBE276D394F4B8F9 DpLM
1,666,271,223 *AF59B5F8C430343C6E63BBE9DC0CC0C983C1B787 ek,;z
1,666,271,224 *AF5DB3679523B161E9CD99966CEFADBA98C638AF EGIVRENN3
1,666,271,225 *AF534E89E920E37151834BA73937E543E1B2F5BA elaine-galdes
1,666,271,226 *AF59DA30D7E194C3C8906DF96C0F5C58C2A7F285 egniledeb
1,666,271,227 *AF5A5EFB4A06AEFCF47DEF310AC9097C744207A8 ELANOFHUDSON.COMWWW
1,666,271,228 *AF557716D9461F9583D4585F5AC6EEA6ABC0884A ELBERT.MCLURE
1,666,271,229 *AF5EE467E3A38B34FF296318F696055FA4828930 elckw
1,666,271,230 *AF5142B80C1BD78847D18C7857069949CDA3B5EA EJENDOMSM
1,666,271,231 *AF55B1659B29059A9F556A8F01CBE09170BC78A9 e-khidmat
1,666,271,232 *AF5CA0CC26384BB7BC5E25C204DC1A00699119E5 d+s(e
1,666,271,233 *AF524CF34920AFE8D8266AD8AC777D82626F9352 dts?,
1,666,271,234 *AF5DB0DA4A0F5DB3406432782BE5C870F9D6305D DUE:
1,666,271,235 *AF5D07EDCFBC6DC04528543CF59B41B5299B44E7 ELLIS.REDDIG
1,666,271,236 *AF5F1F93CB0A0BCE591D5775DCDD87EC9FEFC5EB ELLSWORTH.VAUPEL
1,666,271,237 *AF5DFDED44B7E6B8086745877336974B86867B2B DUSTYMORONEY
1,666,271,238 *AF5CA74579D877DDF8C82E0B0C907776359264B4 DU/U"
1,666,271,239 *AF5A3A5CCB6D0B9ACE508435739AD4575AFB74B0 [email protected]
1,666,271,240 *AF58DFC4E6F713FE6034EAFF383737205CEB2B8B emmanuelbodon
1,666,271,241 *AF507EF411F3C82DFF5DF5E4606CA40F8DC4C430 dvpkb
1,666,271,242 *AF5593B39DB5F1E551D91368AEE0F1478FF748E6 DWIGHTGRADWOHL
1,666,271,243 *AF5667FC29A6A0D2EF24FC8E12894272F7C8BE99 d.wm_
1,666,271,244 *AF598B54DE9F8AF8775303731A6E5A0AD85D7EBC dylan.james.berger
1,666,271,245 *AF596C638C27F432E3F1C7DAB7CC469F3E88DAB8 [email protected]
1,666,271,246 *AF5D90A535D2305DFEA483639E99E7EBFB43F97F [email protected]
1,666,271,247 *AF5B1C90AD3A2EAAD77BB8774658657346A2C428 enduirez5
1,666,271,248 *AF586DB3F5C1A6F8C06AF8662F4ADE813AE6B32F ea3ee
1,666,271,249 *AF5D82EE80EA6721DC3ADEF46FF662E733F09DC1 ENGASENA1
1,666,271,250 *AF52F9FF1BB08DD5EE103FBF5CBF290F0A873461 enochokoli
1,666,271,251 *AF56B670D4078225BA935B422825C05792F20B01 Enquanto-Eu-Chorava
1,666,271,252 *AF5B148757AE8B0AC9EAD947D2ACC4C4DC18C7EA [email protected]
1,666,271,253 *AF5B2D40DECF08BE87FA9F93C20956F1D6CB9E52 ECHEGOYE1
1,666,271,254 *AF5E30633879E2CB659D962D8E0FD81EC732301A erjt
1,666,271,255 *AF5BE1DD289059B54BFFDF10A6351E1C881CC118 es.fo
1,666,271,256 *AF5255A70BCE686E12E4E1589D2275A77567894D EDU.STMARYSACADEMY.M
1,666,271,257 *AF5FB2496D35E4D8CAF109F719D577143203D7F8 ETNOM
1,666,271,258 *AF5242C90D5F7CB2679E1EE2F152160B040B279E ETSALOGIPPED
1,666,271,259 *AF53F45921574012895BB7FAB5F1FD58EE1FC533 etv,a
1,666,271,260 *AF5F89DD101A287F741A69E37BE404FAAC44CA62 ericlucky
1,666,271,261 *AF57214C086E5A534B6C2D3411C1FCF7CD0ED409 [email protected]
1,666,271,262 *AF505F6D6BA0FE529DC3B87B3B5EDCB1C4A6F27C EFT
1,666,271,263 *AF541A37F1C2C8EC4B9A32FBDF98307E936790ED ERNIEROIS
1,666,271,264 *AF5CF33A3DAF64521F2CECE76B090D17D75A7893 EGP,N
1,666,271,265 *AF5771160B61385A1DE85E14479511907D8B4CCF EHONTES0
1,666,271,266 *AF50696F675837A104F55D3A49101F3A418AD12E eki=l
1,666,271,267 *AF527A6496A4FE2DFF851879E60E82E14CA1D568 eldridgebailie
1,666,271,268 *AF502928851A1D51181938EBB6D2C4C9CC3C2A5E ELECTRICAL-STORMGIRL
1,666,271,269 *AF5BEE1427D9D50720355AA3E843196423939145 ELIMINATIVOS
1,666,271,270 *AF502F5D6D66240048D52315D7B3C19D7E536033 facciosos1
1,666,271,271 *AF5D026DBC979FD32D2DA3640F19AFA9D896B56B faustinomoots
1,666,271,272 *AF58B1FFA19D3DBB96073716B491AF4EA8D6FDD9 ettesene3
1,666,271,273 *AF507E7AD4D0020830D861C170E12ABE5804A029 FCKGW-RHQQ2-YXRKT-8TG6W-2B7Q8
1,666,271,274 *AF5AE1DC7A061CF0F17DE49FD83423E5DDB5B2CC ferreira1998
1,666,271,275 *AF5A40EBDF513CEF5DA8D83497C70DCAC6259F50 EMC(I
1,666,271,276 *AF529907BEE1B92CC3BAD9FE2D0AF817B215C4B1 FILM-CA$E
1,666,271,277 *AF55FB8E76B1FA95E59D01EF9CC1BD277FF20675 flaquai0
1,666,271,278 *AF516B9B12FCD82A0309B2BC7EB44161183FBB75 FLIGHT-TONIGHT
1,666,271,279 *AF568ABA2C4FCC888A0A813F955428F08F757EAD encased6
1,666,271,280 *AF55E9F2A879344EC80814E70EB8891B84EC8DD3 ENZAMIDO5
1,666,271,281 *AF5877EBD45229F52129B26B6ED9117375B7DEA8 EOI4T
1,666,271,282 *AF5D4BE1987DBB428646987B18235AC5E783B83B epcot-wol-inside
1,666,271,283 *AF5C90F4017F25D2FE5AA390F03003657DF4C1CC FAUSTINORICARDO
1,666,271,284 *AF5CACBDB65F1E2845A1DA0A6EE49FE4EBC0A0E7 FUDAN004
1,666,271,285 *AF5F97D6F58173EB5496AD45DDA6430D6258E31F ERDMANDELBEERE
1,666,271,286 *AF5A7A92BC61F862462353714F7FAA24118AC04F felix-maria-calleja-del-rey-conde-de-calder
1,666,271,287 *AF5C2C618745659B8DDC65CCCCA33460C92D47F4 ERIC.MCCLATCHER
1,666,271,288 *AF56F5B01C7161929CDBFB980F594713FFDD9316 fellings3
1,666,271,289 *AF51E9B0ABD91E8A5E902B06CB3905B040B5B245 ERINROFI9
1,666,271,290 *AF556B38CED56E2A89D5C1D012C2C77D0FA3F3B1 [email protected]
1,666,271,291 *AF54D07A61CE9DBDE7F8C7298E80E8889B17546D fenomenolojiye
1,666,271,292 *AF5539CFC454F72F2BD67AAD060E201C5A5F9EB6 FHTCNJDFDIBT
1,666,271,293 *AF5D0F6EFAD180980B1C137CC0D4BC42F5465692 esn2r
1,666,271,294 *AF520FCCBDCE893BF6929E70EF460FA7EC17F6FE FINDTOKEEP
1,666,271,295 *AF56FE74A002E7F99BF0EB9FD482345B2D693C3C GARTHZECKZER
1,666,271,296 *AF5B37692FB0E17D4927662EC78B4699259B86EE GASDERM0
1,666,271,297 *AF52F197E24E17ECC8DCE26AEB5B019CC0A34E06 FLASH-THE-CASH
1,666,271,298 *AF5BB15F4B77940B5474B395CF67C290067C3CC9 GEEP4
1,666,271,299 *AF517D0BDC24CB60684D15BD6789C06DA9DAD9F2 GENRES…
1,666,271,300 *AF599754F4E14C3DC78FA34E0783BF12595585E8 GEOFFREYDONNICK
1,666,271,301 *AF5E087CEE8DDECAE97861BEE5C2CD921C6BD987 FØLGJESVENNEN
1,666,271,302 *AF532D17ABE9E386A3E58E2CFC5BCFE65C320D72 EXHALTERS
1,666,271,303 *AF5AD7795F26065E449674B68496271C2CDC7D99 G=ET
1,666,271,304 *AF51FAB5170B5018CDCA1930FE568B1D4BC03E6A gh]
1,666,271,305 *AF5801B093EC7CA66CC408FD979D2ECBE2E7DF8C eyf6f
1,666,271,306 *AF599AE9AD4945652022238373DB371546909F81 francesjanzen
1,666,271,307 *AF58A56A10FB92D3189D8D0E2C93BAD6DF6D3421 EZEQUIELKOSMOWSKI
1,666,271,308 *AF573C327FBB31F5065DD63C149C540767B53DA5 ezequielmaddaleno
1,666,271,309 *AF5B6F2C47DC121E039E757341EB220DCBA62FE1 FRANCISOBRIEN
1,666,271,310 *AF548CDB5095CAA869311BC087D2D811F430568B giovannitrulli
1,666,271,311 *AF5D0C0CFCED367563B6EBC2C08DB63E98B4FDF2 GISELLE.JOSE
1,666,271,312 *AF5A435C5ABCB083DB69154FDD2FA8669C9B3397 fredericgolomb
1,666,271,313 *AF5BC868F2BEDFB41A9A159D9A49233892B9E758 GLEICHGUELTIGBSW
1,666,271,314 *AF55305ABC2FA3ECEF128DF067B81F04D220A154 FRIDAYBRDERBUND
1,666,271,315 *AF530B3382D2DBE67CC74CEAB43F1BDDE6F600BC fritzgalasso
1,666,271,316 *AF58AB8584147827CF53293FEDA2A86B9E8CB17B gohenry6
1,666,271,317 *AF5B142A34370BE559B0FAE446E00ECBBF961A56 GOOD SHEPARD
1,666,271,318 *AF54ED17E7362DB7C176BB6FC31CFCB6B90DB604 fv37
1,666,271,319 *AF56591CAEDE5A1B017EBB1FEA168B57D966CDC5 GRADUALE / EXSULTABIT
1,666,271,320 *AF5DC07B3D2A260D3A8FBA0F11A706B74C940BAD [email protected]
1,666,271,321 *AF5F8623B705789140C6CD6714F7EBF5BB7F9116 fennimore
1,666,271,322 *AF539CB4333B23E15BFF35DB88A4F83E761B5DB2 FERDINANDKYSETH
1,666,271,323 *AF52AD32D7A116082E63CCB9053E0B4EB8192216 FERDINANDSAGOES
1,666,271,324 *AF5A3444ED29BF69D22A04A1A96528E1D6CF28C4 fernando.barquin
1,666,271,325 *AF5481B2163CC7A5BF27FDAB2FF01C0821232E6E GRANT.CAMLIN
1,666,271,326 *AF54D0C2A2B5D11EFF2B7C631BDA98451BE85100 GRANTMONTEFUSCO
1,666,271,327 *AF536888009056B609D4FE86FD7EA4D09A52201F grave111ng
1,666,271,328 *AF5C73C3C9A9C66733FA38015A7317EEAF1F648A guadalupekainz
1,666,271,329 *AF5814A9AF8889152952C0EB16EA3D84266EA6F1 figureskaterstub
1,666,271,330 *AF5EB8FA73640BC1225B8C2C6EA9D1A5694A4985 GARY.SISCA
1,666,271,331 *AF5F79643E430B8CAA93924C5D9735938B16D67D FIP1
1,666,271,332 *AF50D5091A0C4E7D220C9D549D7256E946394000 GAVINCODELUPPI
1,666,271,333 *AF53D8E965CA3DF98E1571205EC875256DE52E13 GAVIN.TREVETHAN
1,666,271,334 *AF5F2F989B863B7CA8ACD73EC462F69C5FFEF89B GAYLE.SPEARIN
1,666,271,335 *AF54FAD1CCBD5568442894ED190E88DD43E3136F g#c
1,666,271,336 *AF543CBCF5DA238F4F22CF5DE6B8A3DF87DB0D57 GERARDO.HALBACH
1,666,271,337 *AF5CC82662A23DC8401D078C1789B68AE0458D01 HACKERU6
1,666,271,338 *AF57E1C2F2CE5ECA80E23E0B45E9C4D3BCA94418 GETONTHETRAIN
1,666,271,339 *AF5D58DDA8AC3ABB0448426DC30C8D86C54E5C79 HAPPY.SETIAWAN
1,666,271,340 *AF5D3DF66D46E2A7F96BA8ABD81DE5CF49E024EC GILR4V4GE
1,666,271,341 *AF5AD88C28B6C8B1DD001B0F46396C782EAB1DC4 GIVE.ME.ROCK.'N'.ROLL
1,666,271,342 *AF5486CF1C869F22B29248AF5162E26A92AE577D FOOTLINING
1,666,271,343 *AF53292B14EA2FA4A597E8A5B80BAADA3641A227 HARMONIA
1,666,271,344 *AF5A9A2D2F85085B08BAE48C4C323A4979DA354E FOUQUET?
1,666,271,345 *AF5855FFF0A62E042C035051C3CD62CEDA926561 glxtppoxed
1,666,271,346 *AF5DE65A704CE9D5C39A683AF5309295F555F0C0 HAURDUNALDIKO
1,666,271,347 *AF5F55DD7B6E251391AC68DCCFDDB6BC4B2DD607 HEBENHAUSEN
1,666,271,348 *AF5C25CCE24C8CA1F1730A4F288180F88019DD0B FSUGIYO
1,666,271,349 *AF5BC969D35454E89B9662EDDD1FC06A5456CFAC Goals---Setting-and-Achieving-Them-on-Schedule
1,666,271,350 *AF57D821C777BE306B75B6663BC2897409F6C4A6 FTCHTSN2
1,666,271,351 *AF5E32D6DC31589C39204E00E5E6F6C49F7C4BB9 fuckyoujanice
1,666,271,352 *AF52DBC04AC5B790A87E632FE3CFBB6BA25A44CC [email protected]
1,666,271,353 *AF55145670270A6BB5DB84700437C6608B8924C5 GRANT.GUZZETTA
1,666,271,354 *AF56E0B3E60C0DA97779F311D64FF3C70E9A9C13 HKCKTEU46
1,666,271,355 *AF56674BC11F6A4182D2CAEFF3397842196458A4 GARTH.WYCOFF
1,666,271,356 *AF58112283D54D5D0681E8760C9DE5E9A7F5A099 GREGORIO.MOJZISIK
1,666,271,357 *AF54AC3D83F30F3C0E96FE8254793A80399BD4A1 GEHLLAURENCE
1,666,271,358 *AF5CA82B81858F87B1AF23FC178C638B0091C3BD gemma557
1,666,271,359 *AF5B69E0C246E41A6AD649F454B7A4C36708D095 HNISSIZES
1,666,271,360 *AF57ED407699DDB0640DE874BB218F1CD199D240 GRIMAUDSES
1,666,271,361 *AF55C2DA1596183BBDC6975B4CEF43433EAFE3E3 hollishoovler
1,666,271,362 *AF5FC77DD58706D88CC9D1C6A9EFEF351DFCE940 GERARDO.PITASSI
1,666,271,363 *AF53FC92F8A03047BAC66AF5D345A65C03035E7E GHCY
1,666,271,364 *AF5EE720CE8C236F2545C0430AC080561E17B31A GIL.FREZZO
1,666,271,365 *AF510D11DB9AC71F6FF5844D9325508308C9FBB1 GILGRUTERS
1,666,271,366 *AF55AD970379791302F5D6C9A307D63DC6423A53 GINOFUGUEROA
1,666,271,367 *AF5C00071828C51B9DB406D18B3A0C2F31888EDD ginomccullar
1,666,271,368 *AF574D91458AF5605C25649E6D582A5FF931AC2B [email protected]
1,666,271,369 *AF56428C3BCA04207196451F224A4F0C8AA22EA4 GUSTAVO.CROSBIE
1,666,271,370 *AF55C92C5C1A4F78C6A7EF59321C9F3FEABF61CF GUY.MICHEL
1,666,271,371 *AF52C061E54ED0DED1C9B08275F09329F5E175E6 hpjlolvc
1,666,271,372 *AF534E20B2B0DF3BD98970DF8C68B336DD11F56E gnimocrevo
1,666,271,373 *AF53F54D87BF6DEF1D071184817CE39660B2CAB0 HAIREUE9
1,666,271,374 *AF552A9CD2DBD7A3AB8F94AFC2A2905203875AE2 HTTPNSL.CALTECH.EDUE
1,666,271,375 *AF576F9B1CACE0903B5956D98F9E484198860E6E GRACEBERLEUR
1,666,271,376 *AF5EB554BE69216096F6BB92A9E30D4985D0246B hammercarlos
1,666,271,377 *AF5ED5222D200B95726AE8B0F91F67162D173075 HUEY.HICKTON
1,666,271,378 *AF5FA98AB264B432B351512BD4447F0DE7BA8A19 hands for my service but blows When I am cold, he
1,666,271,379 *AF5C6AA1BC10FBBEDB5A4682B3CFFCEE56C7F9F0 [email protected]
1,666,271,380 *AF5F27B689872C5D825C8555DDBB80E3292AE8BB hanniel08
1,666,271,381 *AF54FA6FD1A7707E4C745C769824D56A10C0A13A HUNEDOARAALBA
1,666,271,382 *AF5A8DCAA1474ED92774D1CA4E7886BA935BD3E0 HUSBAND-25-33
1,666,271,383 *AF59310E768A30563F7E7BC17D13A8F9369C5E77 HYPERORTHOGNATHY
1,666,271,384 *AF5B3DDDEAC86C07A22EDAB0F4A2612AF3B1483D HAVANESE792
1,666,271,385 *AF5FD67E6E96E55281696DB486DBA7C68D4F8E26 haviors0
1,666,271,386 *AF5A9A5ACB34F88282003324AC2FD7E094DB00A1 ianroorda
1,666,271,387 *AF5DD1DFB3EE43CDDFA34EDF6881E1E5AD61B94D Hayiriahk1
1,666,271,388 *AF53A7D6B8D620E30A06FB3121E2BB09210FE64F hayleydoolin
1,666,271,389 *AF5AA2015FD6B01BB6905E1DAA7F95793448F92B Hacker
1,666,271,390 *AF599A9E1029116EFA6DCBC9F574CD56200919E4 HAMMLEYSA
1,666,271,391 *AF5CA5F8ABD742372E0BE8765142E9823FD1F465 HANKHOGLAND
1,666,271,392 *AF528B82BB13CAE2ABDB3DDE13AF417FE1E523DF [email protected]
1,666,271,393 *AF5DFC744E5485CA77D81AA3381138CEC2224B40 HARLEY.GREV
1,666,271,394 *AF56785318F6B603A78A9597F67A84D289A822BB HARMONIA
1,666,271,395 *AF54F0F5DB9B18235AED0EE7317DCB5196CD9134 [email protected]
1,666,271,396 *AF5A2234DF26733B3387E628694FA052E45A98EA heather-steuer
1,666,271,397 *AF5E60F2C248175A72DB6E2D20005D3468324A89 heba.mohammed.ali
1,666,271,398 *AF53E1AB3E0CD9508E9E1D998C09048B3981EEF7 HECTORLAUB
1,666,271,399 *AF5C88EFED6D11B44CE011D93418C905AAA4B784 HEINDRICK
1,666,271,400 *AF58D4018500624D3AD13488580181F97B534AEF [email protected]
1,666,271,401 *AF541ECEAC5AD952DE610941FA8EC016FA1F4075 HETEROGRÁFICAS
1,666,271,402 *AF594447D4E66BF5B127AABBAF368AD67EB7F910 [email protected]
1,666,271,403 *AF5FE717C76788A1EF7D3904EC982E4EA90E4426 iluvclock29
1,666,271,404 *AF57381B6C0FDC6363EFBDC60136D89DA4A79EF5 HIBNOH
1,666,271,405 *AF57380B007F35D902CE32C2A9CF52456B3E180D hiddencharms(featbobweir)
1,666,271,406 *AF505692FB7B1E53407A63625A20FA4653D73385 hiphoplives
1,666,271,407 *AF50893E8138F7207AF51073F8D5007C1ADB67E7 HETZOMEA4
1,666,271,408 *AF5C23509A56501BFC69470C352B0C6BC0755470 HMILCZEWSKI
1,666,271,409 *AF58274A3787A548DED3F4D1FE3228B3F4782858 HO-AA
1,666,271,410 *AF5299BB28F7B003C28498710210AA70C5F8B6CC infinite-keys
1,666,271,411 *AF54531ABA537A0EC5BE59FDCAFB4AAE9C5413D7 insepolto0
1,666,271,412 *AF598762C4E408480DF01296938DBA7C51653794 INSTITORI4L
1,666,271,413 *AF56B77C65CA1F0401FA8F4322E59ED72B25C34A INSUROPESECRETARIAT|BELGIUM
1,666,271,414 *AF5234223F6AFAB76EE22DCDA16718E46E29A4ED HOLLABACKGIRLILOVEUY
1,666,271,415 *AF54E5AB9E6AC657481B5F58110AAF29652D88C1 hpkm
1,666,271,416 *AF53FE8CB9746C4B5D37D10084D4263F9FA15424 honghaith
1,666,271,417 *AF524A3733730B72FCB535CC8F30B73E6EDC6AB6 HREF="/SIE=UTF8&KEYWORDS=CALLOW&RH=I%3AGARDEN%2CK%3ACALLOW
1,666,271,418 *AF5FB5B8B294D1C167C83A637B4E0DED7C1F63B9 IREDENTIISTA
1,666,271,419 *AF5376DC5F332EBC3B4CF2CFB6173EC433755038 httpgabtea.comdruga
1,666,271,420 *AF56FC3A5E7F3132E9D84FD261F2C864CE76EAB7 HTTPWWW.LONGLONGTIME
1,666,271,421 *AF52C100FBDA4D97BD03DE321BCC5E8DA52C8DE0 HU5B4ND1N9
1,666,271,422 *AF5790D168C3727471D7B4346F8CB6DA0DB162BA HPROMOEM1
1,666,271,423 *AF54F994E2BFBBDDFE783ED38E2456E17578CD3D ISMAELCOVERDALE
1,666,271,424 *AF52A9DC48A94BDFA09D3D2BF6AC014F4C428E2B ismaeldechart
1,666,271,425 *AF507CEAE9494B12685FCFAC7F1EEDDCFC4FC190 [email protected]
1,666,271,426 *AF5BB7CA5C8CF0816E5DF40C16E67D72655AEF9D IVISTONA
1,666,271,427 *AF5AF447603D8A62E20D2FA09F7C544BAAECB57E huberthushon
1,666,271,428 *AF531DD2EEEDB4F4F1F111F6DAF003BDE36299F1 [email protected]
1,666,271,429 *AF53F8AA289EBA3FA4ED53F4561E722C5364DF49 HYPERORTHOGNATHY
1,666,271,430 *AF5D3288C5F86D1BD4DEF54B29AE6A5EC0A248CF JACOBGOMBOS
1,666,271,431 *AF51B6266D5A981A6601AF0AD92C81B078E2F905 HUMBERTO.FLODIN
1,666,271,432 *AF502AB5185145A3E240FA4141B80E7697CD56A8 hz^3
1,666,271,433 *AF54411A0B8FCDB429539F670F7A6331B859F2EC IAMJUSTDOIT2010
1,666,271,434 *AF591999218E21DB2CEC043799BE73342FAFF8DF iamqwerty11994
1,666,271,435 *AF5AC0D4FDE31802623D74113EFC5FC319DA73A2 idiottbone
1,666,271,436 *AF5C1B812DA0A1FB36FD463265C79544416F4CF3 jantana.wattanagul
1,666,271,437 *AF567AB21AF41219A71034571A85A3C5C3216F7C IKEHUXHOLD
1,666,271,438 *AF503C485625AA6539151FBE12E1819883F65FBA iamairwolf69
1,666,271,439 *AF5B0DB49A791599229076C01EED224F2FA53DB0 I-LIKE-TO-SMOKE
1,666,271,440 *AF515E251998ADE4B84E017ED40EC010101EFF99 iamme8945
1,666,271,441 *AF50FA2BF1DF734BC357868A6124CED0D42CF65D ILOVEAGENT15
1,666,271,442 *AF5FD8E12453E0E4C67E3FBA164840A53634273F ILOVEZIGGY123
1,666,271,443 *AF5E412B78DB46BBA2A3A383EAB3D80A85B240C5 ILUVMARINO14
1,666,271,444 *AF5AD6625EA80BC8A049DCCFB257873C9485DEB5 IMAGINE THERE'S NOTHING BUT IDEAS
1,666,271,445 *AF569E85B98536976DCCD33FA20FFB9B39F89B54 III.COURD'AMOURS-CIRCAMEAPECTORA
1,666,271,446 *AF5B8398E2CF2F2AE16D2BEC5E52D4EA1E9F4BCD JELENAZELJKOVIC
1,666,271,447 *AF5D615B51D1C1E37106B5E36BD0E9C01907D1B1 JENAEVE
1,666,271,448 *AF55630FEFB8CEC926726428B6D85DFFDF51E22B [email protected]
1,666,271,449 *AF51F1409F9D29DD613BBBECA827D4558D5C3104 infodream5
1,666,271,450 *AF541C3A51D95B4DA27E3636A38C0186FBDCC673 jerrodchhun
1,666,271,451 *AF555B6E24177E96872B50ECDAE3DC8C9711E30F iloveidontknow59
1,666,271,452 *AF5918F621503B5E6F1B3F95F4EF5D4A390853F4 JHERBBANKS
1,666,271,453 *AF525E289462BB3192C9CDC98B1504E26089D4BD Jiken.hassei..Syutudou
1,666,271,454 *AF5F37E01C7F3A8B6858FC7FD3F504B2A11CCBB6 INTHECOURTYARDOFTHESTARS(MONO)
1,666,271,455 *AF5FE68C34AE75338B30A7A9DC708251BCEDDC4D imbrilon7
1,666,271,456 *AF577E843578283A0208B734AEC4F55C2260805F JOAQUIN.MCCULLOUGH
1,666,271,457 *AF5E6943B61E544F94D953C44DB54C22ECB10346 in+3rr31a+i0n$
1,666,271,458 *AF586D03BE146770FAAF8A9A1FD5FEC876FDBB53 ISMAELMONAHAN
1,666,271,459 *AF58769E4F535DB9C5424EC9EFBBC40D1DC35A39 isrealkimbral
1,666,271,460 *AF5B24884E6FAA6FEDF29D5642E91D5DC7294D54 «ISSUERS»
1,666,271,461 *AF50053A044B50C95B1F59C2177E0777A3317720 ITTEPSVG82
1,666,271,462 *AF537A60B134DBE3CBA98DFA757D041DBFFDBA49 INSUPPOR+AB1ENESS
1,666,271,463 *AF5AE0728010AA0717292DA1CAE0003AD1B4423B JORDANDROTT
1,666,271,464 *AF5AEE6AE5CC7144F00D740F32826966D589F07F [email protected]
1,666,271,465 *AF5939FF31B6D452E822F24628D2B829F411A93E In-the-shade-of-the-Old-Apple-Tree
1,666,271,466 *AF56DA01A678433B1BF6F557CF137D91FABCD684 josh.loehr
1,666,271,467 *AF51EC652E0EF12CB02A9A8A2299F4A7B901372F IRA.KUSCH
1,666,271,468 *AF5AEA6FF8B70239AD3BA19FAA72605FE9C7365E JAMARMAYS
1,666,271,469 *AF57F87E750D470AC5033EEB36039CBEBE3EE607 irenezapata
1,666,271,470 *AF55F29AF4C6DA57E4D10F12A9E82F0F936C8520 jthardy
1,666,271,471 *AF5CCDF388655283ACD6B12522752D7227679800 JULIO.ARMIJO
1,666,271,472 *AF56621AB1CABB853327F9B07B45848F546F0406 ISTANDFIRM
1,666,271,473 *AF5DB3ACF95496E384034684DD96892A866AE9BD KAPUNERS8
1,666,271,474 *AF591B40A229F9786DE045323B373255ABB1A260 [email protected]
1,666,271,475 *AF576585FA6E23C20DC21F4C5121F37CA442AA29 I.XXV.2
1,666,271,476 *AF5E69314DFC3AED658F71C4E89546992AE0B680 iyomishing
1,666,271,477 *AF5319534269E2DC39CE497B432433DF9DD643DF [email protected]
1,666,271,478 *AF5D2315A410C4BEE387FE554EBC2C94A57ACF95 JED.MA
1,666,271,479 *AF52E327752CAE5347B48EAC2657AE09795ABA2F jed-watson
1,666,271,480 *AF594B74DFD0ADB2E3876FBFAB0A1FBD6F282472 jensenpantera
1,666,271,481 *AF51AA19E2F23E8522F63B071E69A24755C48918 JAGERSHUISJE
1,666,271,482 *AF57994128FB1521C5E3DE636772B68539C67C58 jerroldeisenhower
1,666,271,483 *AF59168CC32663E8E2ADAEDB3518E0D56B887696 JAMIE.SYER
1,666,271,484 *AF5B650412DD97FC57C57216007288FCF421E85A jerrysain
1,666,271,485 *AF5FD1EEA06198BBEEB607E7C74536A6661B36EB JEWEL.JARDOT
1,666,271,486 *AF5CA7AD714F745C5E5780AE0F7CC5F6941599DD JARREDAUGUSTAVE
1,666,271,487 *AF50A2D415CDA6CF7D4D4883CEEB2664FEF39DC0 JARRED.CREDIT
1,666,271,488 *AF5399166052C571143BE29EF1ADFACEEAA257B1 kenttoby
1,666,271,489 *AF5FF5289C38E75C84DD7203FF1070772D6BB42B JHONNELAF
1,666,271,490 *AF548690A4963C88FD5C6C353954B72460D2AF0F kerstman
1,666,271,491 *AF5E049979F5225558050EB63F526AA3BC2EABAC jatkajasta
1,666,271,492 *AF56504D3E5BBF525A9FB8A795DB1FE4A4277064 [email protected]
1,666,271,493 *AF5DC0EDF67B3FF833404F77464068606CF172D3 KIBITUJINJA
1,666,271,494 *AF571CDD4206FA9EA62AA189602DDF41DCCB763B JCKUKKRS2
1,666,271,495 *AF5710837CB79DA4AAF6B49630E8ECF709E35B56 jeanie.mullins
1,666,271,496 *AF53E14DBCAB1536546561D67526652919256BCF KINGFISHN
1,666,271,497 *AF523921837C3CB41DFE42A4A83EE86470E5A5FD joanmirelez
1,666,271,498 *AF55CB50589F0F1EC654E4175D3340E06ACDB632 JOANNA.CAMPOSANO
1,666,271,499 *AF5C78DB51E982EC1A070561932836C2AE8A0F2B JEFFREYGELLA
1,666,271,500 *AF5820E24A8CF5A4D8385A2E7431658007D1B0A9 jeffrydismukes
1,666,271,501 *AF5EE98C42D3FFBE00D3CF0DEA37F517B3395FC8 jeffvehrenkamp
1,666,271,502 *AF50C177B5E28A009037364D9E080CB1D266B94A KITA-LOCKETT
1,666,271,503 *AF57C5C108FA07FF22C1DF3B1AEAAC9223EE5FFC [email protected]
1,666,271,504 *AF518F9ED56A48DF5500D7E009518C3BB4C9DCED [email protected]
1,666,271,505 *AF51D8EEBCB0B3E1D4D99D2BEA58332ED80C6563 jeremyparraz
1,666,271,506 *AF5C07E5B13B898FC46CF4530422610CC157329F KLERMAN8
1,666,271,507 *AF521E9DAE69CE46E664DD09F4802DEC312D2994 johnathondul
1,666,271,508 *AF5A96FF99E8449B67E83B201F6C74334D07047D KLOMPVORMIGE2
1,666,271,509 *AF5405D30EDEDBA0F966E08D758E9301E38FD09A KNIE
1,666,271,510 *AF5536543165412E1269CE40DD1C16BC874526FC jonathan.ast
1,666,271,511 *AF5B7AB4DDF4DC77B30BDEFC1FC34591535E3222 kraigjacobowitz
1,666,271,512 *AF52610135BAFC0FEBBD6F4EE5A3A319D0EA7C35 JEWELSOFLOVE
1,666,271,513 *AF5D1271BCAB50197BB1C4B3BF776A0421A5F41B JFPHBB
1,666,271,514 *AF5AACAD219AAA26B3799641B839490023E2719F kristyj
1,666,271,515 *AF5EAD04DB29449BB72A56561A1995913A9C4194 ktportal1,talk31,spiritualchallengesinascientificage
1,666,271,516 *AF55443F4F500C6570BBD122BD2282FB9A5ABD77 [email protected]
1,666,271,517 *AF5ACC90FF9312042A0D04417D593CF046470AF0 kurikuppe
1,666,271,518 *AF526DEAABB0A0A53466ECEFEC0B62BBFF489F07 [email protected]
1,666,271,519 *AF5B2C54D54D966672ED170A0C0D87F01F088591 KURTOCONNOR
1,666,271,520 *AF5A0084D68F67BCFF4DB05A0CA73F39342B40BC [email protected]
1,666,271,521 *AF5A27CB2C5505391FC7C0F9BAC81FD1CE86BD5A JINTEO
1,666,271,522 *AF58A2B6B29183C49F18A4A1A6810BD33F032202 KZSC
1,666,271,523 *AF5115030432D621EBD02D9715F5F606634037E4 LAJUDERIADERODAS
1,666,271,524 *AF55FD1361E00CC2739AC32D66841E55E3E075CF [email protected]
1,666,271,525 *AF5EA7805EFCBC95838702EF3D36471DF117C320 lannycockett
1,666,271,526 *AF581354F38F758C2CCD4B25E0E4C1C276CB3297 JULZSY
1,666,271,527 *AF50224DBA566B487AB3490D2CF2C8C828327342 JOEYDEEP
1,666,271,528 *AF5C999F476A551030B57BBC33318082EC7F4467 joeyframpton
1,666,271,529 *AF58EA84D8C7522E211358358FEE0384F04AF92A JOHN-J.-KIMMEL
1,666,271,530 *AF5C3327F6B7510518577D5BF265EE18F8369117 }_K
1,666,271,531 *AF5C566D1AD99D20E25CD0295BB22A435ABE6E41 K3NN3CT
1,666,271,532 *AF51CFF70A426816FE151D1F8A8B8EBB55D43246 KABIRMAKHIJA
1,666,271,533 *AF5F74E5BB77501C01047D720F46CF88B216FE36 jorgecrumwell
1,666,271,534 *AF562AAD4C150F702ECA74B0E11B1691E54121F5 JOSEPHSABIO
1,666,271,535 *AF562A807A5F8C8FDF2F7105E760B214F5A8A2B9 LEEROOY
1,666,271,536 *AF52BDB3DD828EFB6E02ED5149E91B5975FDCC1E JO.SYNG.-.DEL.2
1,666,271,537 *AF513744BBB9EB9352D035DF48B1566A76209723 j<r8
1,666,271,538 *AF57D0095259B80EE5AC5295207EBF0BD5AFB834 JTACCONI
1,666,271,539 *AF55930FD8AA5E06D85E0CDFF47D58325FD33AEA keeley
1,666,271,540 *AF58DB4F1D01E6684BCE8EF98197C767C7DDB7FB [email protected]
1,666,271,541 *AF543A66676CC2C26F9EEA587FC18F020F46070D le.nguyet.minh
1,666,271,542 *AF58256E7F92D542EB2877BBFEA9C906BBBEF493 LENNYOHANLEY
1,666,271,543 *AF54F1F290E9D212D4C776F2E1DB0E88C5856F06 KENCORALLO
1,666,271,544 *AF59F0D5A8B3EAFE6A8425A26A66FEEC5B0994C3 KENNA252
1,666,271,545 *AF5747D612FBB61390B26D8D27345DFFE8E92237 juliaotopper
1,666,271,546 *AF573738B3E81AA3BBA27923CA285A955BDBA9DF LEROYRUEB
1,666,271,547 *AF5757C19FA1001491ED0EC82B9EA4F154AFAB21 LES.SALLAS
1,666,271,548 *AF5319A5E55E8CB66C2D656749387DD4112B2207 kerrycarnathan
1,666,271,549 *AF5E99AB69414BB64D88D5E30739A0012A6488A3 [email protected]
1,666,271,550 *AF585251C6CDE683E72840B33CCB7F55266B7DE1 LEWIKA
1,666,271,551 *AF5432D5D582743315B3A8D56C1F4860DD71D8C0 kaiser-friedrich-marsch
1,666,271,552 *AF53FB7CC0A36154EE32587E4D3842200BCB1B1B KAMALKAMAL
1,666,271,553 *AF542C9FF07F5F674BD1607648563F4EC2D20040 LINCOLNFILLEY
1,666,271,554 *AF546891BECDC344D1BF82A4664EBB0DFCB1C1DD [email protected]
1,666,271,555 *AF562C1D0752DB4CE6931DBD0CF3333C71086218 kapantsi
1,666,271,556 *AF5EF4AAD19CB2D6E8612E213991A07E1262F6C2 lionelcamilleri
1,666,271,557 *AF58EB3F6635F00DCF2CD79EE52D94D6D49D02C8 KOUGOMYAED
1,666,271,558 *AF54D872905DC68E0CD203B38D1C3426CED189E5 KARITANI6
1,666,271,559 *AF57069DE5CF774FBD166C4BFDFA4061E15FDABA KASEY.PIGGIE
1,666,271,560 *AF5717DA45778016869B610C864CBB55E45A0562 KASISITING
1,666,271,561 *AF5619D60BFF553571BF6F2A6C356B24C2B7BA4B katherine-browne
1,666,271,562 *AF594B3939171BEFD43D01D8861883F4A309D0F8 KRISTIN.DOHM
1,666,271,563 *AF56248A1598BED1332A9A4DEF76D646B2E7ABEB [email protected]
1,666,271,564 *AF5E6F6DCD18A60BA0F917572D5AA46AC565463E KEDIJA.DESERT.(VIDEO.CUT)
1,666,271,565 *AF50A573B0C899A79BAF88346090C31C6680828C KTTKPPN7
1,666,271,566 *AF55A674EE85726603D89989D0A88E73C42B24D6 load-balanced
1,666,271,567 *AF534AF5A40C1564E09C56377A680E4F7CDE440D LOGAN.LAPERUTA
1,666,271,568 *AF52CEF3CC27B829AC4452A4BB5C53F6BF237614 KERMIT.PASQUALINO
1,666,271,569 *AF5E18A308B9EFD4E256A4B08DA1DFE0172879EF [email protected]
1,666,271,570 *AF50D903FE8D7E7578083AB73479CE713575A3A7 $kyc1ear
1,666,271,571 *AF517488D103B5C06E9704D942944430F3A38510 LONGSCHOENER
1,666,271,572 *AF5A3FDEABB333D8FE9D85B7BE6ACB95015F1869 LORENZOSHAFF
1,666,271,573 *AF5F8C75638F7C212AAF2096BA4F3E3E75320400 L47027
1,666,271,574 *AF5D71C9499987C758913AF32DD457A40C8D8028 [email protected]
1,666,271,575 *AF56C851F23F2932363AEF1251121AE9F01014DA LACATSPIEGEL
1,666,271,576 *AF54070386420D3D23981A8B2921C184EFAF1C75 kimberly.mccomas
1,666,271,577 *AF5E46FA3EF856739E430285DA8B56179CA10F6B KINGSCHOEDER
1,666,271,578 *AF5C954D0180189CF52E80DAEF801C6000584167 kirsty.butterfield
1,666,271,579 *AF573B29CF95DE682810118AEA8B3A13380554FD LSTERNOWSKI
1,666,271,580 *AF5C2ACBE55FB0512084C41D8FAA33494E7ECC04 LALAINEJAY
1,666,271,581 *AF5F33717D122D924DF43DFC67B3CF3A6CCE1D04 [email protected]
1,666,271,582 *AF5E5E0593ABD8885F820EB513E4ED5AECA6BDCD [email protected]
1,666,271,583 *AF5A8199B295C6E88DE9B256E900CADC17BA1899 Komodo-lizard
1,666,271,584 *AF56FA3789B43232583777ED36A633202B0DE1C7 [email protected]
1,666,271,585 *AF56DDCEB8BEA7753C602541FB89464F0304B78F LAUTOMATNESS
1,666,271,586 *AF53B87F2286088D1B0E5551033754B3D8EC0BBB LAVERNHOVDEN
1,666,271,587 *AF552DB1998D7697B777088F0308E612A3D671BF lavernkappeler
1,666,271,588 *AF50A3B52AEBAF2920A03105E40F86578E24855B LYNDON.ANGELOFF
1,666,271,589 *AF5720ED9DCA379C28809B65B2373A879EAF704E KOREYSPILLANE
1,666,271,590 *AF551E0E237E00C7E50CC4FB6904450C32375221 また、lccの首都圏のターミナルとしての役割も期待されている
1,666,271,591 *AF534C57B0A81A1F6B3EB20220F9EA8C5B55C769 [email protected]
1,666,271,592 *AF53FABB59EF281D5A4838C726DC12651AC3E6F8 m4r8131z4t10n
1,666,271,593 *AF52BB12812D03CF6956D5081382F551254B423F [email protected]
1,666,271,594 *AF5D0B6A70CE7EC2A2768312C30F0EE81F8DDE71 krystal-lea
1,666,271,595 *AF521F261632E14C41FD83E54D573DF572F5B2C3 MAHIMAHI0
1,666,271,596 *AF5DC62787EAB51E77E4238BAB02A1058918F7A6 [email protected]
1,666,271,597 *AF52A7F689C4143A99557AB4036FB4E10025B26D lenguasjicaquetol
1,666,271,598 *AF5367F2BB02588332A28C567E2D55FA8160C6B5 manquerd'amour
1,666,271,599 *AF56D852757BF05FCD6377863706F35813E1D126 lf={
1,666,271,600 *AF5B0E14E274F2C117038FE3EBEE5DD14B89B8E8 MARIANO.MAGNO
1,666,271,601 *AF5804F4EE4BDFC2C1D9673352F34AAB1AE43C0E LACUNARY0
1,666,271,602 *AF53D9871C79730220A4D5C938A4F4311BDDBCDC LADONIANETWWW
1,666,271,603 *AF591EF90A0739FBF2817C0E335FC491241E59CF lieusaintamand
1,666,271,604 *AF52DDDCFA329BA81604976DF29E01B10A956DAA MARLON.RANCK
1,666,271,605 *AF548699F1F792F23F7546B55B0A53BE456A157E lillino
1,666,271,606 *AF53D8B0C72CC6C198783DE755C83C2680DB3F02 LINDY.CO.UKWWW
1,666,271,607 *AF51F7DA80B6D14963B438AE1EAB105E26E01905 LING.TSOU
1,666,271,608 *AF5B1E50F8E91CE513ED3DF3B91F7F821BA15C74 [email protected]
1,666,271,609 *AF5A3A749FE9675489D220AFED47BCAB7B7DC40D LINKSMOS
1,666,271,610 *AF59F3213EA6470999101C7F65614092103DA70B LINO.KEDDY
1,666,271,611 *AF5B933E29BC8EF11A302685AF8B4EE36DFCAD4E LASZLO.BARATH
1,666,271,612 *AF583BB3BD9BF653DDEFA3698CDB0C3DFF62789B LINZ MACKENZIE
1,666,271,613 *AF5442D838D1E6AEE9695E3CD920FB75D6651FB2 MATTHEWLUCRAFT
1,666,271,614 *AF5BD5D5568EB67763B80D7FBDB3949A75DD53C2 MAURIZIOSIRONI
1,666,271,615 *AF55320FD9D06637F8990B4B689A1F5ABF7B3594 liz-cunningham
1,666,271,616 *AF5BCF24506B3E9DDBC6C1424120B3E7D1B7BA3C lizvelez
1,666,271,617 *AF5B4BF7FFA25DE3F72F40ABBB0DB930EFD9D14C LKNWSZTING
1,666,271,618 *AF5A1A37AEBA65B14087D19CA7EA3EEE94B2681A LAWERENCE.REGENSBURG
1,666,271,619 *AF5475978849927F72E38E553DF4404957014AEF MCXI
1,666,271,620 *AF500F18727B3EED3719973921DDBBBF9D0E820F [email protected]
1,666,271,621 *AF5EAB0744E85ABFD7D891EAD9FA9D1CE56D3B56 MELISSA-BOURGEOIS
1,666,271,622 *AF5ECA35F14F65656FE13F72190C4729283E3189 LON.BELSTAD
1,666,271,623 *AF57C2D360956819CEC8AD8329E2DDAD8196BEEF LEIBWAECHTERM
1,666,271,624 *AF57749128FB60C88CA0DDB211997F012EEDA6EC LONGHEAD!
1,666,271,625 *AF570D9C49E7BFF85651BD97C074D96CF8B88D71 MERVINAVERBACH
1,666,271,626 *AF51454673E7F8CEA89C23599CBCCD3FC18521A2 LEO734
1,666,271,627 *AF5FED1C35D936416024736D2DDA0A193462E1C2 leopoldobiancaniello
1,666,271,628 *AF5E3606295CE211CC5B7FE1A75310BA600C305E MICHEALDENGLER
1,666,271,629 *AF532F98E1C6485F2AE0959B6F7AF8BE89630664 MICHELLARIOS
1,666,271,630 *AF54262993D60CCE1154008B4B66B92E3EEF716F LETHIQUE
1,666,271,631 *AF556306614F7CB542ABD37E5FC19BB95631C1AB LEWISHARPER
1,666,271,632 *AF5E0A91F229AE303DA5995E5BD08D8995F10568 MIKE-LANDON
1,666,271,633 *AF5E27C8D90D0397C244AB3D0E1A4E3D15383B69 milder
1,666,271,634 *AF5F40F1FB2283BCE8BCFE10DF0BB6B976B78396 ludivineflament69
1,666,271,635 *AF5314034956AA366EEC44F25248D8FBD93D0DE5 [email protected]$
1,666,271,636 *AF599A125AD7FF5ACC3362780ACBB290555FFE9F minhschomacker
1,666,271,637 *AF5B972DED66C2FC6FBCB3130013EC15DCA75C2B [email protected]
1,666,271,638 *AF553005FE140B94810E77C85AB174B8C351EBB8 LUTHERKEOGHAN
1,666,271,639 *AF52C8C71281825083FDB0894AB034919DBEB631 [email protected]
1,666,271,640 *AF565E9CD60A1580BB4DEE424D3A80A4459E3369 [email protected]
1,666,271,641 *AF5A110DD17A25C3A6847DF0D922DB94E206D48A LYFFERED
1,666,271,642 *AF51317754FDBB2F9E85DC0C188FC3F47519B355 LYLE.VITI
1,666,271,643 *AF56F3404A45D4661898A6E21AB5182BFA705201 LISPANOS1
1,666,271,644 *AF5E84C3FBCDD4ECE85542C510A4B90565C90543 LYNDON.HENSEN
1,666,271,645 *AF59A071D7733CCCCB69921FD859971335C49D65 LZT9VR3UGS75BZ
1,666,271,646 *AF5DA08AF062C6766EB18C6B85597BB0FD88BB56 M1E
1,666,271,647 *AF5812C148D1D3B0F8FD771A52228949D1575772 maecelle9
1,666,271,648 *AF547BF72C8357E581E582E8F740C0D7B6F06F20 LOISTOVAUNUA
1,666,271,649 *AF57A68E0E7FAF0435AAA3C8E0E23772088E53F6 LONG.FRANKIE
1,666,271,650 *AF5595D1B591E5EF4FF269642DABBC5F6F512593 mosella3
1,666,271,651 *AF54899A1449DEE7395D041E8DB6938F822F7969 louis.prima..feat..keely.smith..greatest.hits
1,666,271,652 *AF50CC87B243FBE9FC8E5DA46D0F7DD31DB8EFE7 mqhobddu96
1,666,271,653 *AF58DF5C307CB2BA00A4119061F91D2611DD133C m&u
1,666,271,654 *AF5204A99D9EC9BA79E61E90B263E755032B2C5D MARCUSSCOTTANDERSON
1,666,271,655 *AF56CB50DB3D2CF03C5FC4270B943E1AE2F5C3B5 MVINARUA
1,666,271,656 *AF58947148642B147698DF16BC50B9E38992E111 [email protected]
1,666,271,657 *AF5A1BE1191D3AC7E8AC56250C3D24FDD210743E [email protected]
1,666,271,658 *AF545AAEA15F9D422A10949667305291169FB79F MYADI2009
1,666,271,659 *AF5F72E0B87A23D030A21706A464A9D22E78E4AE mygocougs92
1,666,271,660 *AF55F5B261D8DE92F156A564E7BBCE5790D565E1 markpowis
1,666,271,661 *AF566AE639989F19AF6F5F73B48C0E2575D5EE15 MYSSEDOT
1,666,271,662 *AF5245B8593602498B08102F4D6E92929AD77435 [email protected]
1,666,271,663 *AF510A446AFE2A2CE2DDD9E4716D597A5609795A N30903017
1,666,271,664 *AF5414482E95C56FD8E9CD508AA8C2A0461872F2 MARZYREZAEE
1,666,271,665 *AF51C3AA6792039E8B074E8579FA361B78F4D7CA MAIUAND
1,666,271,666 *AF50CD1A273855FDEBFFD7B7DE202A72F9B5A13A MALAGIES
1,666,271,667 *AF5FCC7069829E388F90514193250EFF1A9D50E3 NANOHITMEN
1,666,271,668 *AF5DC9BBEBD43A4144B3E516E5E875A9063EA6FB NAPOLEONPOCHATKO
1,666,271,669 *AF55120333A54544C3CF0667ECC65580411F4B6D [email protected]
1,666,271,670 *AF57BEC10FEE4C5E35E2BEC6AA7AA4CC9DC5E352 NASIMO
1,666,271,671 *AF52A23790035E2E35F9B5E438FF29FDC179DFE9 NATURFORSKNING
1,666,271,672 *AF597AD354539FA4E7830B62287E4B57567FB65F nbnsys0000008620
1,666,271,673 *AF5EF7A69DF6BC6662231BC32167D99FC67A5D59 MARKIESJES
1,666,271,674 *AF52816CA409B995F00F8E2971CF754E34A8B9AB NEALUDO
1,666,271,675 *AF5550D81CE5800017584E51C66ED59EC1203061 MAURO.HUNEKE
1,666,271,676 *AF556D39BBD72EB8E80CE56B5A948C1D654AA701 [email protected]
1,666,271,677 *AF56260E598A906E6CB95EAE47DC4CACAD89F32F meningomyelocele?
1,666,271,678 *AF5ABCE33277527454CA4919901E56AA557AC2EC mckinleykoteras
1,666,271,679 *AF58811D7DCB946CDBADBCB88357EF9E42A9EA55 newtonknobel
1,666,271,680 *AF59B97F2FA6C6F9168B458E5F021C1F898347CA MERLEVASEY
1,666,271,681 *AF52897A5D322A7FB2CDC1F7369642A570DB5085 MEDALLAHOHENZOLLERN
1,666,271,682 *AF593A2C2EDB0B304CF5C9A70FA7DB14646F8A1B MEDIATORIOUS
1,666,271,683 *AF50236A8D1FF0D38577BE8195DB9E3BF4197721 [email protected]
1,666,271,684 *AF59D6B5022F2DFF072FA6A9462ACF28715E022B metencephalons9
1,666,271,685 *AF5CBAE66003EC72744E7A1F1D22E71A40C0791A _MIDORI
1,666,271,686 *AF568F5F7BAA2D76F4563DD7878BC70E2E0A7364 MICHAEL-WARREN-LYNCH
1,666,271,687 *AF524A637BE89F13D0CAF211F893D8A21D8365A1 noah-fernandez
1,666,271,688 *AF539B10A633E22FF7ABB88024831EEC88EF44EB michelle.beres
1,666,271,689 *AF55EF11934148300459DA9B42682EFA3C3D571A [email protected]
1,666,271,690 *AF53D23A7CD8E4EC688A6BC3BE831DA371CCC0D9 minderio
1,666,271,691 *AF5A0943D9A7EDFE064D4E691EC96CC478241AD2 MITCHDERRAH
1,666,271,692 *AF55C9C0AE38D70560FE5AA8344C25A0F15B9F1D NO.ROOM.FOR.EMOTION
1,666,271,693 *AF590F734DD3AC78E98C2A825174EC9F3D8F8625 MILITARY-VERSUS-CIVI
1,666,271,694 *AF5FD2DBD48EC1B38129352C08791E62E5DB1D74 MIMNTLWVPIE
1,666,271,695 *AF5710493AFB8FBD2CC9B2CBE5196B8C4ABFEC11 MIN-17
1,666,271,696 *AF53C4283B8324EE629CA7B0D11566EB8BD883CE MINOREIS5
1,666,271,697 *AF5E4C64939BBF01E7BD405679E850C1970DE7BB nwedeln
1,666,271,698 *AF59820CFECE5633552C69848CEB0594EF40D058 NYBDFL
1,666,271,699 *AF545B60794BF21772FBED36CC53C78DAA5FA5EE nytdepew
1,666,271,700 *AF591B691959384739850FE7C7D597BDC437390F O54972112
1,666,271,701 *AF56AD35C9DD14A263B4FF084578573C36023997 OBLONGUM9
1,666,271,702 *AF514A8A215E4DE27711EBE9F560D4DE2F32A29E OBSSESSED.
1,666,271,703 *AF5A99CCF3357BF3DC8B19197012E2C63AF8820D misuegratienemenopausia
1,666,271,704 *AF5C02A778F8FB5874D3D8F6E6276791F6B3167A MITCHSAVAS
1,666,271,705 *AF5541F329EF1D04B5CC5B8C54709DAF6531D1AC MKT6JBURNI
1,666,271,706 *AF5190E1111760FE522B928D1D2DB9F55CDE7B3D OHDEMMIT
1,666,271,707 *AF5CF80FF3420CFB10F2064EB0219FCA0A51AC2E MODESTO.BROCKLEBANK
1,666,271,708 *AF56D4A6EB4A2BE3346121E947B86D4339F05865 OLINCURRIN
1,666,271,709 *AF5982824AE00B9456F77DBF530A02B09E0A1115 ölsund
1,666,271,710 *AF583F6350BFDB508E6B189DB1649512518C8817 MOSES.FRUGE
1,666,271,711 *AF532A5E6F9CA9CB6C0625C957B75C99804F1DFC MOUNTAIN-DULCIMER
1,666,271,712 *AF545093B3C9BFE174B225A83CE6FADD9490F75A MSHARBOOSH
1,666,271,713 *AF5E9244E64FFAC538062F263CDE12843B455634 [email protected]
1,666,271,714 *AF5856F3FB45AABAFE711939EA35842F1773A713 mtv在各地均有分支頻道,包括mtv
1,666,271,715 *AF5905CBECF3F415AFA976E5710FF76A804BA533 MOYNOCK
1,666,271,716 *AF5E9899E4405976DC25C5FB0EB11CEE78CFF611 MOZZ4R311
1,666,271,717 *AF5DCD6C25D58DF00B3ED3F499C582A0051D6323 mpicosdebarcelonaindividualmasculino
1,666,271,718 *AF5A0E9CAF0FD8B8C051DDD632C0B877A31F6373 myronmolleur
1,666,271,719 *AF52FE9785B86D80BA829ED5DC4A9E307F909A7C MSVATOCHKA
1,666,271,720 *AF58DDD75B5C84D911142A81210C50E65564B79C oxytropis1
1,666,271,721 *AF519E0DFA632B7E4D69EE1A20BE11ABD3919B98 naadinah
1,666,271,722 *AF5CCC1C466DC069E1E2CEE2ADD0139AA5F18D8E naredio8
1,666,271,723 *AF518372A0DAF14E60CCD87556D553D62873D9D7 M&~Y
1,666,271,724 *AF57332A1D940B1BEC119F3C8E11105611DD413B NATHANIEL.STIMPLE
1,666,271,725 *AF547FEB2293565ECC023A754060E871E6F4B829 PAO-SHOP
1,666,271,726 *AF58E344493254989F1C6CD45DB62D6198B36AA9 PARABOLES9
1,666,271,727 *AF54414F5BB339BD8BD2EB4AA81A27F97FEA8BC9 NDUNGAS
1,666,271,728 *AF54715523129387E5B7609C2B9F78A677F7C7B6 NECTAREOUS-MISNAME
1,666,271,729 *AF507392B3819A654E1D7E4DE578E33E643DB6D6 PASTELPETPORTRAITSCOMWWW
1,666,271,730 *AF5DB3CF7028B4D224617776BDAA79C3EF21944C neon-slime
1,666,271,731 *AF580FFCCCD92B9C768EB8D0BB06E7B7C0A890D9 MYSTRINGLIST123
1,666,271,732 *AF56A136B6310530EE9F46D7B8F8031C3F135D66 NERSEHAPAT
1,666,271,733 *AF5D03F329A8A9F843559E9123C112000D96DC62 pattykidd1
1,666,271,734 *AF5EF64CF1487498FCDA9629E3B464105510922D PAUNOV1
1,666,271,735 *AF5C591EA543BE564FB3F71CC75C543891E31674 nick-rogan
1,666,271,736 *AF5B45279A87EA66395ABD7D330C0F58B20D7964 [email protected]
1,666,271,737 *AF55B7A9B5274E2D5B2D41C7ADA3587984A9BD03 niranjan-pai
1,666,271,738 *AF5679C840BF102FB755437C471A1A3FAEC984FE nirmesh-patel
1,666,271,739 *AF5351C6504300BD56A886EE6F043EC9C700AC74 PB.*.*SPLAT
1,666,271,740 *AF5EB3E87FE67360BE9DADE7124F9D3229FB8814 pd~.~
1,666,271,741 *AF5A31DFA9EBBCADAB006887706A5D947FFA5F3C PEFKMYJ
1,666,271,742 *AF5F3762CA4A0685ED82309C1624ED336D23227F NOKIA-GER
1,666,271,743 *AF5B1A92ECD89EE78AFA9FBB29B89266A15D0AF7 PERCENTAGESODDS
1,666,271,744 *AF5DB9BE4D0C3DF1D2AF74632B352DDA19A59C04 PERCYJAMINET
1,666,271,745 *AF53FC0B88D6AEE039A4580F764AF0166184EFCB n-docente
1,666,271,746 *AF580C433967A49561745723F8D6EC3A4D9EB39E PEROSIN8
1,666,271,747 *AF5B0052D4C297CE489CDDE7AC5945D291C61AD0 NEDC0
1,666,271,748 *AF52E039A8846333B07145EDC1EB66C4485A210B pevzner3
1,666,271,749 *AF51627C0EA834BAE57ABBE6BDA19FF4AA7D11E6 NORBERTO.MARCRUM
1,666,271,750 *AF5102395A1F05369526DCB2A5D3BCAD9B28A7EB philperciballi
1,666,271,751 *AF5C79F3E29C2D5D5488399550E5332DA2C1C153 nef4r!0u5ne55
1,666,271,752 *AF5C8210052EE9F5EF16D29336AE9F89E78A7B3C NOWWHILEISTILLREMEMBERHOW
1,666,271,753 *AF5AFF9CA8D204C0E71C7B96E7D999B97D785556 ODELL.WESSENDORF
1,666,271,754 *AF53D1E6C45D95167027B6F9F63D80B51A57E735 :PO~0~(------P
1,666,271,755 *AF576CD64B7DE0C650049D68938FB6284163CBBC NFULBRIGHT
1,666,271,756 *AF5E1ADA0996376521866596772B16859416FE57 nickywestlund
1,666,271,757 *AF533C7E10FE36701395271977A2C56331F62A09 NIETZCHE: AN DEN MISTRAL
1,666,271,758 *AF55EFAE9F562C94DF9F9A2C97097B0A7A88E6D2 pointanddrag
1,666,271,759 *AF55EA5D6DDA3A7025142B556189DB4DBA22F012 ORUBUE
1,666,271,760 *AF54366EB1AC8047C29164ABD362EEA467D88E90 noeleftridge
1,666,271,761 *AF5BE9C6DE2695BE61150F44181CB03F255623CE pothbsw7
1,666,271,762 *AF5593B368D4E0BD3C7F1358823595B6DC37D85E notusedadam
1,666,271,763 *AF5E1334847F77257F66888C303F5DB65727EDEA overdemandingly6
1,666,271,764 *AF5203D1936608E18191FFB002C7E27DDC941E6B PP *)X(
1,666,271,765 *AF5D3DC844B53363B37BB9064426485D4072C214 P#>***~0~OSPLAT
1,666,271,766 *AF5CCC4810B9695702BC233C1FFE11725BAC5DE2 OBRADIH5
1,666,271,767 *AF598C7DD7D3F7718153F75A1B1780D3DC568142 +OGLIENDO
1,666,271,768 *AF57F4F3BC7C32AAA745289CFB881A9281726C4C PARKPDF1600.99160MIB
1,666,271,769 *AF506B15782B14AA16D8F15A7F333C4E58A1CA39 PRUNESANDPRISMS
1,666,271,770 *AF5F58DC55D1DADDA9B0D9CDAB057A15CF826C3D PUELLEMONTIER
1,666,271,771 *AF5CE13A28A9BDF8073C8BBDC65AB8A1D072877E PASSOMETER2
1,666,271,772 *AF5A1740D91A881BE7AEEBA2137AC3371A3DB9D6 q-----D~o)O(
1,666,271,773 *AF5AA03EA121AEABD711D7AB1FA58069C0581DEB [email protected]
1,666,271,774 *AF5A7B0991EB1BE4E45B13ED33D2ABF07E6231E3 PB.*.*SPLAT
1,666,271,775 *AF530CA2E76DCC4B975D4CEC70F73E623C789FB8 \OP9\
1,666,271,776 *AF5CF2C3B21FA85E8537DBC47D5C314FE9D564B2 pedro.schmidt
1,666,271,777 *AF51510EBC51A151B76EBCD211BA429F9326CB0A [email protected]
1,666,271,778 *AF50AD4E8349E61198921273755E317629F482E6 Q======P-~-`(~_^)
1,666,271,779 *AF5C514E23B44C9F887894E99E48534804AB637C QP~~:P
1,666,271,780 *AF5934F52AE954713E01E5F785FA32A6F4BBFF09 QUINTINGASKA
1,666,271,781 *AF545951BFC2346B0D6D5CCB65068D598E7A2365 quit-nights-(nicola-conte-"out-of-the-cool"-version)
1,666,271,782 *AF5DD56CB47164FE413AD50A11D0E3BE46D4BDC1 [email protected]
1,666,271,783 *AF5445392F5F11B994F85380518DAD8D34BA53DA phatphatphat(wheredeyatmix)
1,666,271,784 *AF5CD1F134649120A46DFDF1556584DF364E535C PHOTOZ**972
1,666,271,785 *AF556A20E394F6EA24663531F65B7D4A2FD75FAA phraseandfables
1,666,271,786 *AF5276B66EBFAFE522FC3781BCC7B16D3B184B28 PIETRASANTA”
1,666,271,787 *AF5DC4E09BB4456C13DDD52EBAB32D8E38B769E3 OUZVQNE4
1,666,271,788 *AF52F709D535DB3B1D17065B7656C0E81A3075F8 P0000027
1,666,271,789 *AF5FADB08740485178ACC832B116D7B2897F0238 :p.0~(---p
1,666,271,790 *AF58A33873956CCC58DE234B9D03ADC3B2C23992 RATIONA1IZ3R5
1,666,271,791 *AF559CC80E908C54F433329BE18A2E8E4196B413 P->~O ~O SPLAT
1,666,271,792 *AF5A5CD8A2FA52C97D512B59C7806A462606CA89 pandionas
1,666,271,793 *AF52EF358FE0C98C15964E81481877BD16EBD46F PARAZIT5
1,666,271,794 *AF5FC46D119141752E8EDC61EA3F9CBE7BEA97C4 PR3D0M1N3R41
1,666,271,795 *AF58C2C8C375143523DE9F69F3D274939350A6D6 REGIONARIA6
1,666,271,796 *AF5D799F3EDE7351DEEFDB684EDFFCC4BD2DE79E REGOLANTE7
1,666,271,797 *AF502CDA22B12D5EB5CB3E9DBD63F2F409BEB69B PREINTERFERE.
1,666,271,798 *AF5333033B6C8A79EE9C9CD648174E1224835BDD reinaldoklauer
1,666,271,799 *AF5DAC0CBECE1A54B98CEE7F1A7D323C7BC42023 reincorporating
1,666,271,800 *AF5F5D8B0328CF1E8D709D1C61325A7C88F3D2BF PRESUSITI 1
1,666,271,801 *AF57C3D6AB85E06419D6D584628DA05517115F71 PRINCE.LOCKEY
1,666,271,802 *AF510CD7BA9E7F0C8EE49A685E8D8AF70E28EF0F p###D-*-*(-_0)
1,666,271,803 *AF5AA44C99A09146169EB5822F9E3EA2B7A6AD5F [email protected]
1,666,271,804 *AF52780DC36E0BF92CA800F1EC25A9E3EE218BB3 PROVINCIJI1
1,666,271,805 *AF5826060BA3796BC3DDD9047FE88D629EBAAB69 responsible
1,666,271,806 *AF53A0A96420EDDE884D9911DEAE265B83CCD484 RETYNANCE7
1,666,271,807 *AF5ABB0B42D07582EBBFE5F828EC91831E293BCC PUMPKINFLIPPER
1,666,271,808 *AF5806B21CD75538FD9FCEDF996A3FF9375B323C perrylawalin
1,666,271,809 *AF529D5C546619B7BF94D9E36C46CB8CF5D24FD7 puterisherina
1,666,271,810 *AF5D070B909DBAF96D616DFCCAAED125D405C2D5 reynaldohemmann
1,666,271,811 *AF518A5FEEACD839DE18353185FB2F10E14F0ABE pyramidu4
1,666,271,812 *AF5203FE41F6BC5F282F443A1DC910A966E9DB4A pharyng0p
1,666,271,813 *AF509287DD2A24CF557EC27545E5ED924EBAD496 PHILLIPLACROIX
1,666,271,814 *AF57DEB13156EEC7947B0ACFBB6451DEDE8BB978 qd^s
1,666,271,815 *AF5D392AB5D4979003282B5D3D0F1E99D67B3386 qgmztj
1,666,271,816 *AF5928773D325D3920DC840C2E03F85D7562B9E5 RICHARDHALLSTEAD
1,666,271,817 *AF5A990BA1CB6FC059C14B49F039D9301CF0690B rickykeener
1,666,271,818 *AF59D1DD44F7078F8815F008E32549D5D2CED4EC Ridin'.on.a.Bullet
1,666,271,819 *AF52C8A42D8EFE5BFBD37AA8C0054206333C06F9 PIMP2DADDY1
1,666,271,820 *AF5E45EB8DDCAF9A893C2049F12AEE455C8FDB17 q####p-~O~o(^_~)
1,666,271,821 *AF558ED0F3563CC8B70FA0D8733FA2CD6ACFCB57 [email protected]
1,666,271,822 *AF5319D0924537C291CAF066F82FC2A30B36995B Plains-Music
1,666,271,823 *AF5D782AE5312AB039257C3F0C32FFC5908FF42B plansindd
1,666,271,824 *AF5F4CE72270063761AE0979243006BBB62B81BA PLATTELT
1,666,271,825 *AF5FD91CBFBE662924C3BEECB248097353FE4645 [email protected]~-~-~-O->-<
1,666,271,826 *AF5A2E591665A92A7A3EAF69A21EEF695B30753B [email protected]
1,666,271,827 *AF583E5D051395A94C630DD26B8106E1F104973B RNKOPPEN3
1,666,271,828 *AF5C1CB3445366C52E5D744781ED9DCE78F14309 POLL160CRC
1,666,271,829 *AF51C56B1EBA844E8680F188DE8E3E75919BCFD0 ROBBYTRUNER
1,666,271,830 *AF5CE29038776136B19601E67C0A6FC19F2B9AC4 robtbrownson
1,666,271,831 *AF58EE6989940D2BFD88798AA60F1B97F859916C ROCCO.OJANEN
1,666,271,832 *AF536753CCB38FDCE68AF7B2D369D3CF3FA5C8DF roccotopick
1,666,271,833 *AF5C570A82CD9364D7797C1DC51C89C57355DB36 pooktes
1,666,271,834 *AF5F7238DCF33EB9D04947EB7329F20410269779 PORFIRIOBOROWIK
1,666,271,835 *AF54251395C26CCA2E6791E8591AA37762DBC5B7 PORTULACA_OLERACEA
1,666,271,836 *AF58032A558114323B162941837EEFB5526482AD ramedi
1,666,271,837 *AF50819DC17D4B046E7372E173DA0276CADE3F84 PP.~O~O)X(
1,666,271,838 *AF5C8D15C2544C89AA8929E08E9103BEDDE3216E ROOSEVELT.DAPRILE
1,666,271,839 *AF592CE78929121A329D128BB0A3622103836DB8 PRECISO-DE-UM-TEMPO
1,666,271,840 *AF55EF5F947C0463E89BA00EBC76EBD274A3DEAB presserai2
1,666,271,841 *AF59F28F4B04EEC69C1A2A9C6BEB9822A420504A RAYMUNDO.MARQUENA
1,666,271,842 *AF584CF59606EBD9835925A9458D96828849FEE8 RAYMUNGER
1,666,271,843 *AF5518BD504C4CF9A2A915DDEE241B3706127C0A RAY-WIDDER
1,666,271,844 *AF56DD0FE9E1D759853DA8179B4A0BCD95FADCEF ROZBR
1,666,271,845 *AF570A12413025DF0AF1BEE7A53D5D7835E07EDD RBRONKO
1,666,271,846 *AF537611FE40E47200B420E9C51DD6052CB89FC6 RDIWI
1,666,271,847 *AF58195A6CF225718AE85158A4F4E2BA84BB15B5 RE4LIS
1,666,271,848 *AF53A2297608BFF38103110598FD5A4CA3EC363E RUPERT.OTTEY
1,666,271,849 *AF5D6D3427AEDDFCC1EBFB2535C9889C86A90054 RECOGNIZEFEAT.PROVERB
1,666,271,850 *AF5AAB1DA4D13873C1D5AC47DFB64CF766BFDA2A RUSTAUS
1,666,271,851 *AF5E82AA6D6456D067B5A268977069150AD2F11D RYANLOVER3
1,666,271,852 *AF5BFDC9AA2BE88EF7F12A7EB564E4E067DA9B25 RYLIE-WALK
1,666,271,853 *AF5DB38C9E4DDBD6B8A97A6F87AEDBCB63F6404F PUZELFEINT
1,666,271,854 *AF5CA772DF52EE3411C4FFFB7A52FD12D87D8475 sambucaymoscas
1,666,271,855 *AF5F03BB302F9C110929D0E2028150CF3A17CF6F SAMMYARRIAGA
1,666,271,856 *AF516F8141B3A07CAD9AE67721D17202B9EC3C51 santohilbun
1,666,271,857 *AF59FC87748FDE0206EEAC6D53C949BEF8512FA8 ?q.aaa
1,666,271,858 *AF5506DF422FE0D85632A794C39B99B6F3EF5CFC SCHULZE-HAUSMANN
1,666,271,859 *AF5BA91875B52E226F30135334773B033FF2F5C1 RENECOFFELT
1,666,271,860 *AF51A37FB2B4D3D1B4D00FDDF5AEF3BC87C360C5 [email protected]
1,666,271,861 *AF56067694FA47CFD615ED5944BFEBA50D447865 SCOTTIE.MAGNUSSON
1,666,271,862 *AF563DB7317391B1378ED57F29B53DFAAE12C4CA Q-P~~~3B<-
1,666,271,863 *AF5FEF81EFBC89C01A8120555D87DED2C4B9FDE1 [email protected]
1,666,271,864 *AF5B0840DD26C6F61BB7E940C352EB0745557EDD QQXAAA
1,666,271,865 *AF5F07EE490B6C4B821B722CFB00B619239AFC98 quieeiuqs
1,666,271,866 *AF55668F41036287EC0C6778D464FE7C8E51ECDC reynaldo-zavalza
1,666,271,867 *AF57E3146D13D3CA3BFD9C99C5C62E203FCFA368 selectionofraycharlesdeluxe(disc1)
1,666,271,868 *AF5E065D883066741E3FD10492A73CF0EE6CD594 [email protected]
1,666,271,869 *AF59516C29A23B915668443C35C2E9B3807B9E6B rachael.lyman
1,666,271,870 *AF55A990E2E130905435D3253931BD1E644C3E16 raḥím
1,666,271,871 *AF550D9A3C323170CE71DC7F6BB626D06C1AB4F2 RAJIVE PARASHER
1,666,271,872 *AF52680815990464F0DEC1708F1E6AFA15324365 rigobertohalstead
1,666,271,873 *AF593E6BD765828E1774947D8390B6CFC4759644 rileyd
1,666,271,874 *AF5C452DB2132E9CB39AD620EE988A1A969AA1B2 SHAMAIKA3
1,666,271,875 *AF5391253A1C9D4526A88F0DB823FCE86B97C317 SHANTAINS
1,666,271,876 *AF5DDC480DCF8098795C8EA3ECCB13583AE1D174 SHARP AS BROKEN GLASS
1,666,271,877 *AF59DB1BFF3EB9312461270284FC5B8283489B10 rM"
1,666,271,878 *AF572D9F4216D7D70255C86D43B0E5E31FF15973 SHBMCNTS
1,666,271,879 *AF568C78481229BD793F89511F6698FA0282BA39 raymondconver
1,666,271,880 *AF5C4CA32BE6061C59AD1258C123587BF036C883 RAYMONDMUSTY
1,666,271,881 *AF570F00247BE59ED5ADB2FA44904031EBC6FC7F SHELDONMONIE
1,666,271,882 *AF5C3CB1C73EE6B1F8B716A2084DBEBED81642F6 ROBERT.NITEN
1,666,271,883 *AF5BD50C0B59D4E72BB8FD917B464E8E46663302 robert.schmehl
1,666,271,884 *AF5B6264A2D3D9631D9E48814C17190FA8466A2A ROBINHOOTRACTOR6
1,666,271,885 *AF53563CED34FF7FDC2B8C22A90DC80E905785BF REACTUAT8
1,666,271,886 *AF5D6B297297D6CC8147EB4FFFC47933F0C8A564 [email protected]
1,666,271,887 *AF5D4E4515C511E5E60D10BC3AD4D24B421F0745 ROBVANEGDOM
1,666,271,888 *AF53EC5BE6DA1E8D1CBE4983CDEBA453163F5E31 [email protected]
1,666,271,889 *AF50868D4CDCE7137E1C9CF220DB159929BA779A ROGELIOLAPAGE
1,666,271,890 *AF5E52085238F2F55AE2683237D8892E0AC70747 rolandofoerster
1,666,271,891 *AF5E1334B45B9ACF918207F22BE32D917B733582 REFUGIO.LIBEL
1,666,271,892 *AF5FC4DF8410AA461FE9350B023ADDFD962BECB4 SHRIMPLIKEA9
1,666,271,893 *AF56FF6C72DD7D03259B0AE3A587FEE592E06BC0 regithcanips
1,666,271,894 *AF5A63D696B23E9FFFE8EBF2120DA162890B5AD9 RELHEIB1
1,666,271,895 *AF5291216A5FA30634C34B45465BEE06965400DB RENATO.JOSE
1,666,271,896 *AF579A6AE519AE5734B7889C725AA69092996C79 ROSCOESOUTHERS
1,666,271,897 *AF55C50EA86F171157FF0B9CDD26DC7A4C6A41C3 ROSEBEMAEG
1,666,271,898 *AF5989D5B9094F148A8DE7419A2EBCCDC354A053 rosioduran
1,666,271,899 *AF5B15C2AEDA70E9828A850F56E411F006EEE1E1 ROYCEMULLOY
1,666,271,900 *AF57467D8A03DA34DD954A6019A572636CA06660 RETIRED.RICHARD
1,666,271,901 *AF5BFF813DECAC7E86706FBB1EF4152BA575441A RETKRSJF
1,666,271,902 *AF5CEBE1BC1DEAC2F9104347C637FA99072746FB retories1
1,666,271,903 *AF5442522F7D6FDBD1FF4470DEE19344D73D41C9 rs1122
1,666,271,904 *AF536E3A9691109E4F2998C1CBA1350532ECC82C REYAMLESAH
1,666,271,905 *AF58D122FB1B07DBF1651FA9D92952DB4143153B R.UNS.EINE.ZEIT.ANGEKOMMEN)
1,666,271,906 *AF56BC625547D4E4197F79C7393CECE27D350194 SLYSIME2
1,666,271,907 *AF5D253D86BC7833D44C1AC900F643CF6058E32F RHONDASIMPLE8
1,666,271,908 *AF5A184FFD40A13026209C52ABB6F1B638D4C18D [email protected]
1,666,271,909 *AF547AE1B14FE2A431CAD0A497550815B315C612 SNOIUQIDNEVER9
1,666,271,910 *AF546B4EEA52062FE92C60F92AA4F0145DAC9B2D RICK-PARKINSON
1,666,271,911 *AF5CF650D7945D4FCD813657EFC215876885223F [email protected]
1,666,271,912 *AF59B64C927C61A147D3FC17DCAF3BBD03CEF8A9 RIEDSEELEEHEIMGRILLPLATZ
1,666,271,913 *AF521CE959D93F7C3A5B8503B206360E75A43BC7 SADDOCK8
1,666,271,914 *AF52E0D728787286DC02D8849640A02D160DD50C ritsar
1,666,271,915 *AF57C081BD7DF50E63A37BD2733DA6ACA3DAD24E ROACHVILLE
1,666,271,916 *AF50988820DF25D3EAE0C6AB83B4D74670EFD9BA ROBERTHERTZBERG
1,666,271,917 *AF5A869D76F202D8E05156BDA7710C4DE0E2A934 robtrone
1,666,271,918 *AF5CCF167F75C704A42561D46342067E977BFE47 sammy.fernandes
1,666,271,919 *AF511C86CDD35E0AEEBA8B37A88E94DFA79E8F35 SPACENYMPHS
1,666,271,920 *AF5067972E32DA824427A2399682D4D5E88FA70B RODPULKRABEK
1,666,271,921 *AF5662D55E2B2416C9754B819B18147B2B732FAE rodrigodigness
1,666,271,922 *AF51C1A295EB582A9ABB8866FA3252A9B40BBEE5 rodrigofindley
1,666,271,923 *AF500CC222D6C873B090F27B5338B04073AD91D6 ROECHEL
1,666,271,924 *AF55A5E79CE5F50341CCC984D6C4C9B79FEC5FB8 speilman123
1,666,271,925 *AF5FD676333A4EAF371C68B9C246A95973E17C31 spermproducing
1,666,271,926 *AF5DEA8F7EACCB995CB5A5B6C0C22F1E2030E5D1 Splat0~<q
1,666,271,927 *AF529085CC1AFFFA666DBC390F197B46CEA7292A SAPPHIREGOPHER6
1,666,271,928 *AF5635E73339E3F1F3A7DD5754E8B178DB0A845C ROOSTERWEBSTER0
1,666,271,929 *AF5341F7E87375EBDF3012E50A31548E129397E6 savaiko
1,666,271,930 *AF55FE34A54B26A215ADA3E346685A77119F2F2F squeezeher,teaseher
1,666,271,931 *AF50AD5184E93C3F07D11243332ED408186CC4FE [email protected]
1,666,271,932 *AF5964F9D4FE2D8B9B824A4424B178776BE21952 rotbrl
1,666,271,933 *AF570A7EC7C769FE7B92C58DE718BB776666B0B6 SSEBOSE
1,666,271,934 *AF56582B4440A60849430843A2B0291239FC9D7C SSIREILV!
1,666,271,935 *AF54122EA60B9913912130838F7425A96EB148D3 schipke
1,666,271,936 *AF5937117514B17A401B123425F64DC55DBA05D4 SCIRROSO7
1,666,271,937 *AF5B5CD0F4A74D388292FFA2C316C4363987072A SCOLERI5
1,666,271,938 *AF5C67C10D4386315072612F54C6C5E8BFDE158D Star-69-(What-the-F**K)-(Timo-Maas-remix)
1,666,271,939 *AF59B72CD9AB67259EF9B1CC6ED0E7688DD7BAE4 SCOTTIEORDING
1,666,271,940 *AF5A14F7C810FE75DEA46765838C211C7717611B scott-randolph
1,666,271,941 *AF53E2AAF829421C5A653EF64B33094430C694A6 [email protected]
1,666,271,942 *AF578A3764DB5DD29C8A150D50DEE5CC82AD1A06 russcorp
1,666,271,943 *AF5A99077EB95E019C2DB4B9CC82CA9AA5E1775E SCULACCIASTE1
1,666,271,944 *AF507DBF678A0DF3EE992132DEC9957FD2363B88 STELLAVILLANUEVA
1,666,271,945 *AF5FBE20D065A1D81D0604660F99AEE09E2ECE6C [email protected]
1,666,271,946 *AF568A9007CCDF732C90D2D6BF0A3AE0912C3B25 SELLABLE
1,666,271,947 *AF51FE4E5C3AF8737D9C53FF39D823AAC2BBD7E5 serenade: moderement anime
1,666,271,948 *AF51294C562E1894839DD124E51DCA399B5EF478 STILLETH9
1,666,271,949 *AF5F52018909D4C26ECAB0CA64986AA07ACCCC6C SALVADOR.BRATTIN
1,666,271,950 *AF5469C939801B910191ED5F3DD8BD74D9C8B58D STREETS OF AMERICA
1,666,271,951 *AF5DC52D96DFC22265C14E74B3E6A50AFBF704F9 SE.T
1,666,271,952 *AF5D17E328766338FE3ADE192D21AE2D9F4863CF SETHZWELI
1,666,271,953 *AF577C79217D74CB43F389A75176261F5A8147DC SUBBEDHUNTER420S
1,666,271,954 *AF5B6A300ABA5B93FE990B116F12691C5931E40E sheep-trader
1,666,271,955 *AF52EC1F8A2E75E2A0FFA7604C231F5A1311C19F SANFORD.JUNGHANS
1,666,271,956 *AF5BA38467B30B935BE53CD8EDC3CFCF05E75790 Sangenomefter
1,666,271,957 *AF58650D8D1AE5392AFC74963B45A9AF9D0CCEB9 SUJEET UPADHYAY
1,666,271,958 *AF5F42E80AC13CBFBDBCE147681C6A25077A92DD sankarramamoorthy
1,666,271,959 *AF5DD7E91D4E40CB95A7BA0A39DECEC206DB08FF santiagomagnusson
1,666,271,960 *AF52B43CA97F537E41656C6C8C21270C493D7A52 sherwoodburreson
1,666,271,961 *AF50EA9801FB90384B7B6BEA80C5BF487AA4ECBE SHIFTREGISTER
1,666,271,962 *AF5511A13C999EF38C70BEAEE9BEEB40FD88D40C SARAH-DITTO
1,666,271,963 *AF574C6881A5BA7F52549CF614B623C540A81812 SUNG.STAMISON
1,666,271,964 *AF51603307B2323A462D07E5F160566203D486CE [email protected]
1,666,271,965 *AF57C577076AA2D73A7E2B2D39A11F2620221910 sazdarma
1,666,271,966 *AF5A81F7F9A062EC3FFB4EEFB2BB9FA105AD5D4A SWDMYHZOJHML0
1,666,271,967 *AF535B8380C394F4D4E5F39FBD35F55E8657B3E0 SYEMAN
1,666,271,968 *AF5B5D6E80D673505966FC0855C7D4D84B9088E9 SIALLOCED1
1,666,271,969 *AF535C608A1472F20CC0627C089B3D429132578B scorpion48
1,666,271,970 *AF56C41CF4697989E7E28E59555FDD1AAB02EDEA SCOTTYYASIKA
1,666,271,971 *AF5C514E5774D5AD4F3876B1CEF5E1CE7459E20E scrabbying
1,666,271,972 *AF583A2F3CFE80FFAC9DD51F146F045074E2E89C SINGLESHOST
1,666,271,973 *AF5DF39CA23CF4E88C09AE6A4BE90CA0AE47FE1D seleccion79
1,666,271,974 *AF5FA37FB42CD9628542268D8BB936C368F17AB5 SKAMFULL
1,666,271,975 *AF5498D028658428C4590363C3296C4F41310E75 sepcbsw4
1,666,271,976 *AF5CAE17144309DA70E4DB17CDEF97B4CDCFB48C SEVENDENISE0
1,666,271,977 *AF55BFFF12477B2773EE7021479B9C3E2300DCCF SEYMOURGATLIN
1,666,271,978 *AF5C70AE86A828DA97A1C192BDC65CDE604956B0 sky.fell
1,666,271,979 *AF51C04B5650E3F9A7C8CDDD3926063E5E6E66A1 SH1R11NE
1,666,271,980 *AF52F6C61759AC1146C2A94161B5B0123D2958D5 SHAIKHAVESH
1,666,271,981 *AF5F3005CFA8845B1EE4E4C95A3AD38A1853BFBD SLNDNTYING
1,666,271,982 *AF535F6E2E014DCFA0B323CCE907A54E44FA6B2D SNAPDECISION
1,666,271,983 *AF579398FDC65EF67E3B4F70E574B65D517C6676 SNOJSADIVKIL
1,666,271,984 *AF55FF9F57F6DE7FA4181F2F2EE8EDB3A81FAF68 shinemusiccomauwww
1,666,271,985 *AF5B375F398EC7BC9D43DB5B9A840DAF42AE6A4A TEDDY TEJADA
1,666,271,986 *AF52A76012DD2024421EE10A440FBCC1FE9BCA87 SHOCKMETAL
1,666,271,987 *AF5A8342EB0F167BFEDF01A4723AEA3D4E69E4E9 shortna
1,666,271,988 *AF5D618E1777F2B565491FED1A27197E79E1FBA3 TESTRVR.SVG
1,666,271,989 *AF5AB328B1992D486A5F9D4D2934D27E79859F3E SOONSIL9
1,666,271,990 *AF5986FEB110B6ACF82AE527E005A6BE4C6715F4 SOSIAALILUOKKA3
1,666,271,991 *AF532D245D8420B3018BAB5272B7FE59F2F2A27B THAD.LUNDSTROM
1,666,271,992 *AF545D5B6A17EA9EB6039094B818CAA9F393D982 thanhflesner
1,666,271,993 *AF5A71FC7AA475AD6FF1741BBEA231A64221054D THATRICKY38
1,666,271,994 *AF5C38B7453E1014A282EFFF9029A1B7150DF812 SPLAT.*(###P
1,666,271,995 *AF579562298AE94F5B3AF77E417F7B985F600F36 SREFJICDNIING
1,666,271,996 *AF5ABF3C1B3551DB774D36AC9090F93ED8CC7A3D SREWOLFD.
1,666,271,997 *AF5D5273D4CB2315D461AB8D3299059C97D5A914 SMALNER1
1,666,271,998 *AF5BA6AA8FAE748146CAFE2D0B17B7445F5005A1 THEKRAYS
1,666,271,999 *AF5E44FE6ECE296FEEA5820A991958E080C08D11 SSYMBOLED
1,666,272,000 *AF52DAFD4EF00A52F813BAFD6984C14A0011BFE1 STEREOGNOSTICS
1,666,272,001 *AF5C60D555F41E914B01EACEA7F35E04F56B1F35 THESMOKE02
1,666,272,002 *AF543E0A4EF2B8FEAFAAA22B8282BF5682369E26 STORMPADDLECOM
1,666,272,003 *AF58DA28A6623CA8EC223E712A71667B6E8FE6D0 THEUNDERGOUNDPERSONALITYTAPES
1,666,272,004 *AF5BED021FE878499D4C5048871782B25D0381BF THGUOHTNU1
1,666,272,005 *AF53453C4C817D7AEC67184ED6C94D9074D5E834 SNUTTISED
1,666,272,006 *AF5BF421E8870755A52AD9DBAEE0DA185E171CD1 snyslitsketoilbib
1,666,272,007 *AF58758F1748A480ABA3030DA4826A95FF51ED9A SOBORNASTEIS3
1,666,272,008 *AF5A3D17CE5BE25025CB1E89FC18970C0D9DB1F0 STRFIRST4
1,666,272,009 *AF5EE16D0DB1A215A200E35B64D6369EC4FA0579 SOLOMONDELLAPENNA
1,666,272,010 *AF5341BA3D8BAD24C5230C50E80D291AE68CC62F thomasgibble
1,666,272,011 *AF549190BACD93B49FE20BED1CA2B0164786FC4A somatonnoc
1,666,272,012 *AF560F244F67CFB4B2190E90F73C99D793ECBF37 somorca9
1,666,272,013 *AF58C723C956222EA167E7068B6856A721BB55B4 sondra.owens
1,666,272,014 *AF5DEA03CFEF98640A533D4108213C6CFDD73CB4 STUPEFAVATE7
1,666,272,015 *AF5D56FD8D9FF89332503C1F6DA95CC5C0B33387 sophiaspeculation
1,666,272,016 *AF574B8A4C10D540F66002655E4D03C591F1D356 (SuCH-aS-a-SCSi-HoST-aDaPTeR)-uNDeR-WiNDoWS-95/98.<BR>
1,666,272,017 *AF51BABD0137C711DADABC378442D808F0EA425F tiehgeart
1,666,272,018 *AF5B243E544A9B946448956061C9F74615B630D8 time.after.time.(disco)
1,666,272,019 *AF551F62B64F2C97BA5B1732FE6F4157E604A6A1 speelsed
1,666,272,020 *AF51145A37326D15745DC3B7D8958C2C876A7520 SURENDJR
1,666,272,021 *AF5049B107828CD8B615ECE564F1C67C3727B971 Splat0~<q
1,666,272,022 *AF502A84DF38640FF5A60ADF7090B1D77FEE833C SUSTONS
1,666,272,023 *AF53A1689472EC6341637139B43CD108F22D13D6 SUZU6765
1,666,272,024 *AF503896FD7604F00E961819ED1B4A4A42618762 splato~O~d######B
1,666,272,025 *AF5A1CB9BA39D4BDE536E23E549A233F8CAE665D tomasherbold
1,666,272,026 *AF57F483BAF86EE8825525A4A8E1C13734092879 SWIMMERANTHONY3
1,666,272,027 *AF5281850A893BE64D1B66DC05DF888EE528C26F TOMMIELINGINFELTER
1,666,272,028 *AF5DB51FB927B9B6519D95007C20EC0269FA362D sy)%
1,666,272,029 *AF5DF0073EDB79DD329B0852D7640491CCBF274E syelgnaling
1,666,272,030 *AF52411F461785454BC31DC1A7D68AC0F88D1B6B tonen3
1,666,272,031 *AF50A852EA203C598A899E07E21F127F6A2007BA totalnes
1,666,272,032 *AF5B0CA3A1AE5A655148B2786AC29AE390BF7C86 tracee-campbell
1,666,272,033 *AF5765A1D738B18A618EB829D5BCA42E4E15DA27 sseldorf (maxiversion)
1,666,272,034 *AF5826A201D23466BD2206A2F09A6BA64BEAE3AC STACIRANDALL
1,666,272,035 *AF57191FC4EA063392582567553F04E395C4BC74 TAIPEILOUNGE
1,666,272,036 *AF5965BF3575025778FE62B47A0CB5ED2C0C8755 STANFORDPINKETT
1,666,272,037 *AF5FB1D503838DD13C447771AA79D5C6BBEFAF82 TRAVIS.YEAST
1,666,272,038 *AF5E5F48CD24A118170A6C052DE10ED114CC43FE TREVOR.MAKARA
1,666,272,039 *AF544848B28CE5AE85CB2733B8D0D231FF8A0F8B TRINIDADHEMMIE
1,666,272,040 *AF5ADC986B3EA8C894073CBE1D345CA64C79EA0E STELLADONKEY.
1,666,272,041 *AF506EC2934152C4048E0A95A4CFEA93C396E726 ”TROPICAL
1,666,272,042 *AF593A20331F6B78696D5E7C8F2E2501AB9DF13E TANVIGUPTE
1,666,272,043 *AF52069EB7796486EBF1516200A806922E90934E TRUNC4TON5
1,666,272,044 *AF514E7FC41E54DDE7CEAE171454BA38AB97CFC9 technologies(英語)
1,666,272,045 *AF5D5A375B99E348B408CACB0BD8E62380B48D32 TUELLEMENTS
1,666,272,046 *AF5268E2AE9FCA047029BAFF11774E045855683A TULEHDUTTAMASSA
1,666,272,047 *AF5626F4F9BFBEBD1B42DE761D82C043BF211077 TUNDE.OLAOSEBIKAN
1,666,272,048 *AF55C476D5745DC0B127B268707DE030A39A8647 STROEMMEORTS6
1,666,272,049 *AF52A15C634A31DC4034A485CECEF77A644AA63F turfmoss8
1,666,272,050 *AF5C79C49FFD45CC0CE86C8E897AAC0E9FBFE6CF SUBEKCUR0
1,666,272,051 *AF5E17704D3F57F919E8E0186A0AD026E4E17D8B SUCKS.(NO.SHIT-RADIO.MIX)
1,666,272,052 *AF5321B12EB4AF5B015EADE7FCB878731BCE45C5 SULANERNS
1,666,272,053 *AF5234E13D4AEC52BBFA48E07D62D5A3FB153E6E TWINNINGMACHINE4
1,666,272,054 *AF582881B5AD4A7522153B70114E22931C189CB0 twinpouch
1,666,272,055 *AF5AC11A8B27F57911F380C21FC5A073E2CF25D0 [email protected]
1,666,272,056 *AF5318B1CA832EF3ADB22A74AC002822A6555BE2 SUNGBROZOVICH
1,666,272,057 *AF59F4135D304A1DBCEE9E4C98230E6635EDE13C THALAMI
1,666,272,058 *AF5EDC0591C0BCE210067DAA07FBE5CB7830FFAD tyronchia
1,666,272,059 *AF560A3DA2B29CCABD95C3DEDC784A154F598145 TYRONESHARRIS
1,666,272,060 *AF57440CD4E45F86535BFC2279BBB53988F2F6E9 ŞÜPHELILERE
1,666,272,061 *AF596C71B5E05AE5BD07710E971FAF54F9266B8A THEBARQUE
1,666,272,062 *AF574AA06402C2A9C17CE50F7170ECB7C4685BE0 SÜßLEITECK
1,666,272,063 *AF552E3C57D7D2A0B037EF66476E19FE14B4F287 THE-FUCHSIA-WALL
1,666,272,064 *AF5CBF85274970D614664CB2705BE6C9A26B6807 THEJORDAN2377
1,666,272,065 *AF568B194341B684BBEEC75EBE927F6E0710BBC2 uggiolin6
1,666,272,066 *AF5C62C758ABF96F005521068E39A98FE0D0FC84 SYNNEMM9
1,666,272,067 *AF512AA8C963861C1CEDD1C868C0A3188973D751 T*^#
1,666,272,068 *AF5E8965BB941DF891160DEF5DF80FFFAD70B96E [email protected]
1,666,272,069 *AF506CB34E32A41DF88ECC7F5CEF192935204861 [email protected]
1,666,272,070 *AF5CB1F4E36ECC43D28E9873C83350EBA90D0A31 」(TAKASAGUN)一詞。
1,666,272,071 *AF5AAC865FA2B30D0FAA4EB8408480452576E355 UNERGRU2
1,666,272,072 *AF5A75110C5D920D7778146B42E84F6DB229B5CB UNITEDMINDS
1,666,272,073 *AF5C1C8912FD94F88F2571230D28283C3DDC8019 TANGERINE1925
1,666,272,074 *AF5AFD4A47781F3F3A117A067EEDD9E8F0730BA4 UNTERFELDHAUS
1,666,272,075 *AF506E74914B010E2D1C7F70E1B85BB1575F5B1F TASSALTASSAL8
1,666,272,076 *AF5341B85B59A7E258FF67D023D623816F3F59E1 TIMONED2
1,666,272,077 *AF5BEEECB420B35E89C41D3F264A2A54710F1E37 ustyiopre,murigazi
1,666,272,078 *AF5B9C56652984CD8ECC9BBCF7631AA47F4479AF [email protected]
1,666,272,079 *AF538D4D32A98CA73C5979AF054D8DDF2EB9A48A V0CA7IV3LY
1,666,272,080 *AF5C1B181737304F410874A1A06F89E78BFC7C78 TNEGUOYB
1,666,272,081 *AF52CA75A36EF28C7978F0F8050B1E335991398D TellMeWhy(Slipmatt&Billy'Daniel'Bunterremix)
1,666,272,082 *AF57C6A703BF4A8E403B17466228127370FA818B valdir.cruz
1,666,272,083 *AF5E3C39DE35CBC8AF17648284ACF75D76CD45C7 TOLENGO
1,666,272,084 *AF586FA877926ADD0BCC75DC7C067EAD6E12E799 VALERIE TANSON
1,666,272,085 *AF574E5E425C1D939C372945F06C5B750E0D95FF tommiewroten
1,666,272,086 *AF590C6CB9F82CA33A0BBA3530334CFBB573C0D0 tomritcheypedalinghome
1,666,272,087 *AF5819C512AD0B49C8F63133F949F6567757F828 VANESSA-RAE-FAISS
1,666,272,088 *AF57A6D814717E8EDB52F9CB2E904668B975F9B2 toyota01
1,666,272,089 *AF53EDB9EF4711BBBC57B31636DCA2DB129468E5 [email protected]
1,666,272,090 *AF55FB6F9D1DF2D6C7F8D3701F1571F5AA626D73 treigladau
1,666,272,091 *AF5821188CC0FEF801F5A882FB4D31D881990C43 TREVOR-MICHAEL-IRVIN
1,666,272,092 *AF5AB0451D5D4786779427A8C03998EC266E3A1A TRIBOCHROMIE
1,666,272,093 *AF5A97A81B5B0B4BD3DBFDCE101C43D73162C081 thefluffy03
1,666,272,094 *AF51EBE1FEBC2062EF642177FA3171FDAB7D39A7 trudi.mantell
1,666,272,095 *AF5EAC5351F920B27CC17CC211A0FB75AF60FF35 VICTORIA.BAIR
1,666,272,096 *AF5E0BF4405B9EA14B26D36938AAFACB6F90FEAA TT0022735
1,666,272,097 *AF52ADE55BA48B2D3613E4B2FC6DE27C083DE3EE TUAN.TRIMARCHI
1,666,272,098 *AF5E6D93F701733AFA4AE38F564552C290E38B1E TUDGCDM0
1,666,272,099 *AF55008506BFB72027818E91A727E9949A4FE4CC VICTORMONTELLO
1,666,272,100 *AF515545CF0EC212F1EBE8F9704D75EDCD9CF0D8 TWICE TOLD TALE
1,666,272,101 *AF525FBEC70D2534A6ACED2EFA25A43B854CB632 tyler.reid.murphy
1,666,272,102 *AF5ED89F242E16D3557CEFD5B6228B7AD0A4A2E7 THIS.RECEPTION
1,666,272,103 *AF5F84FAB56C8E121D010A128961390182628FFA thisvictoryshallsoonturnintodespair!
1,666,272,104 *AF5DABB73CAE1AE838F064B5EC93D63860582FEC THX1138AMERICA7
1,666,272,105 *AF51E9EE4A5101E7AB180172443D7A19F62EB7D4 umer-haideri
1,666,272,106 *AF5F7188AEFF4D0998BA8AF034777F24AAC5D672 UMESHGAHLAUT
1,666,272,107 *AF53942438AC8395E0F596DD4CEB8D9517559C35 VTPRTVLY7
1,666,272,108 *AF57B1B6A0B8FE778EBF2F8FA511A5DC49E81472 VULCANSZE
1,666,272,109 *AF5E2AFF665897D6AA0D34F771974112A11ECE2C un-incendio-fra-due-venti
1,666,272,110 *AF54A09471F0FD1E4AE4D5BC9D455D0DF3DE55BB [email protected]
1,666,272,111 *AF5F50A0CB897176B38B892D4ECAE3CA4F318CFA UNITARIEREN6
1,666,272,112 *AF57870F389FBC8F8A2E5145ECC28BCB0E813495 unjbrejfmz4
1,666,272,113 *AF53D25C1BC568F27BAC336235D142439AA316D7 WALTER-RODERICK-SELLERS
1,666,272,114 *AF5101FD72389185B33EFD126DB4400C85C274CC usedtam
1,666,272,115 *AF52C857745E7BAF37756A9871B023D22FCBFBC9 USKONPUOLUSTUSTEKNIIKKA
1,666,272,116 *AF54F9E07A283F39BADB275D44CF50F2BE63917D [email protected]
1,666,272,117 *AF5B676747AB90FA87E505104367C643118F7FAC [email protected]
1,666,272,118 *AF5EC13B6A8407BD4E8789781F6CB5B0AEBA3009 wapenfabriek9
1,666,272,119 *AF54BC3E02C5B9820BCF4F8963E64E3AE07FE7E2 TORREPONZANO
1,666,272,120 *AF5298F9FF9AE1F22491CBAFBEAF9DFE0ABA5F28 TRABALHADORAS
1,666,272,121 *AF51805E6DB34B0A9714A148747064B793A3241F [email protected]
1,666,272,122 *AF5CF02533C1DFAE1CB89100AF1483F35B8E82E0 trentonkirkman
1,666,272,123 *AF5C4F5CE4EC246D8249280CDE4298389FF2DAC1 trésignano
1,666,272,124 *AF5421B6239ACCB74CEB39763A06D8CBA1104E44 tri-carter
1,666,272,125 *AF5B35C28998A29659AE8125AC8992A2739CB3B3 wesleypatt
1,666,272,126 *AF5C46ABD4FB7AE14879D6A909B4323A501E6499 WHEN I SEE AN ELEPHANT FLY (FEAT JOSH GRACIN)
1,666,272,127 *AF5F128905A2D94158CF57449C2206B8182D958C WILBURN.DERRER
1,666,272,128 *AF53F0B8DBC6647D6E454D6A283F0C91127D6833 WILDSPITZEN
1,666,272,129 *AF570FE6001D3D6786485050A0A9196D21086421 WILLIAM.AKOGBETO
1,666,272,130 *AF5D6952A4BF906FAE60CBF45C5E4EABD189C338 WILLIAMHAR82675
1,666,272,131 *AF5A01498E644B1B7DE4B7B61A7334D282D26B49 william.tell,.act.1.scene.1:
1,666,272,132 *AF56BCC84AACC5A39166ED370BD2804E49074388 VERNONSWENSEN
1,666,272,133 *AF5680DFAD6961E44341285F64100EF247F15B88 WILSONRUSTY
1,666,272,134 *AF532DC97E6F0EF28B837D54252E28A82DBBBCC6 winfordkoepsel
1,666,272,135 *AF5AC9F3E206C76BBE457FE224C82544F0BA9C31 «VG
1,666,272,136 *AF593D345C1C791680FE9A160AC866A3B57D6897 TYLERMCELRATH
1,666,272,137 *AF5892FC4E98AA18E22E6F95D6D223FBD2AE3722 VICKIEMIKEEVANS
1,666,272,138 *AF513CE3019FC330432E3FF80186DC5F439BA8F6 WOAHbots(AndPeople)
1,666,272,139 *AF583D138422F313FB4D0E24A3DE5BB8689D1226 TYRON.PANSULLO
1,666,272,140 *AF52D313CB970209C4E2EF0FE2B318E995586489 WOHER-KOMMT-EIGENTLICH-DER-AUSDRUCK
1,666,272,141 *AF5093D2111D8FA19FDF5D3C791B36A586804AC1 vikram-kalita
1,666,272,142 *AF54C46669AF21C2561A836321243088198B248C VIKURVA7
1,666,272,143 *AF5DD781A8707608EF153449FA3927FC5AC10A81 UIM*
1,666,272,144 *AF5FB098500B4151F4A0482A9D235C3E61A67F8A VIOLINCONCERTOINEMINOR,RV273:I.ALLEGRONONMOLTO
1,666,272,145 *AF58C3D7A733AE3886B08D285A277D524BACFC5A wwwmehr022000
1,666,272,146 *AF5A556B01A36B2847CC6FB3B513EFB081DF69FE [email protected]
1,666,272,147 *AF5203177F53C1604F8E3D6BFDBA82ABDE267870 WWW.WORKOFTHECHARIOT.COM
1,666,272,148 *AF5B6179468F802F786845EE4C1C93F60C13554A [email protected]
1,666,272,149 *AF5CC5B9A22E0F354BF9591F5720933474607608 UNINF0RM47IVE
1,666,272,150 *AF5EBDE1ED68D75727DCD9EAA7162B08FBEB1E5E VLB
1,666,272,151 *AF57955658D6EDC6B73F8289C10085773026A668 UNPUDDLE7
1,666,272,152 *AF549C4E177D3A8B91747FA9ACB9EAC31D022D9D UPRAVLJALEC
1,666,272,153 *AF55AA261D58AACD7245D79DBC8B2602E9BE7294 VXYOJWH67
1,666,272,154 *AF5B9006A52C67F0C4067664A55E8C1E5B904D36 WADE.PETTON
1,666,272,155 *AF5442AFE64F65147A4114E01665D4C55D42C0CF wadmin-realrun
1,666,272,156 *AF5CC559CB4F3881481549586C1E59B3D05C84B3 WAHLENBERGI
1,666,272,157 *AF5FBDCE11AF26F4DEE8963B0CBC9B3A4E7D945C USTESSI5
1,666,272,158 *AF553E8F235A70E1677A9A3A321B30D1B03BAEDC waittillyouseehim(de-phazzremic)
1,666,272,159 *AF5FCC1FD0213D05E5524A279D3F9B7708BAC097 [email protected]
1,666,272,160 *AF52A6BFAD833F5469EF4485CAC3BA9D9ABF0772 V140385017
1,666,272,161 *AF5C447D0EFA99BAFA958B6FF030625CB8D34AEB w[email protected]
1,666,272,162 *AF54E7BA469F55CAAF341C407858D3488CC592FB wangsta4
1,666,272,163 *AF5FC67E8FC85675122EF3CC4F744C94654674C4 VAHINGONKORVAUSVAATEEN
1,666,272,164 *AF5B112793F71E10BE74484C500743773597A261 [email protected]
1,666,272,165 *AF53751F3BEA7B766A2F82405CA5728E9FA0064F WATASHIWAAYU
1,666,272,166 *AF51308494CD3E8FA4AC4A1F2592405BB331CAFD [email protected]
1,666,272,167 *AF51D16EACDE354E32B740EC3F53D782D7310866 [email protected]
1,666,272,168 *AF547C94A8E3EAE86EF1A8206966333D58C06CD1 VALENTIN.LARISON
1,666,272,169 *AF5CCE69075EDEA64E6FB2DA0887649552E8C540 YANLYLEON
1,666,272,170 *AF526A8FE087A8BB46FD4DF4F2B26E47B51656A9 VANCHTAYAO
1,666,272,171 *AF5DC9E627F2CDC2B779D9145ABBDF5C433B0065 wendellkillingsworth
1,666,272,172 *AF58EF31C972F4840CE03EB8885A757A58ACEBE5 vanissa-wilkson
1,666,272,173 *AF5C60D993597DF366EA8B047EAC45926913E090 VANNAN.SARAVANABAVAN
1,666,272,174 *AF543593C2988FAE70B7915F582E9A8AB1AE29BD YERSHAB
1,666,272,175 *AF5151BCF8DFE144AA58BA08DB9682D393793BEA YERÛSHALAYIM
1,666,272,176 *AF5ED21ECD2DC97A5ED857DC0064F5A69C83C008 we.remember.michael.epifano
1,666,272,177 *AF5864A08CDF1E933805ECB5772BF8FB0C18BF57 WES GRANBERG MICHAELSON
1,666,272,178 *AF512068E90E65711EBE4902388133DC9A5BC4BA vasudev-guthikonda
1,666,272,179 *AF5E5DDB29BAB3CD770C299408FC99EA4A91B624 WESTLEYKUO
1,666,272,180 *AF5DB156EEBA15C1A20B55FC9C7815788FCF7A42 [email protected]
1,666,272,181 *AF5377C48A5078F622EA110F14385D535F706C15 ylbaddib7
1,666,272,182 *AF5AEF1373CF775FA7D4B156CEE1BD3700589267 yokai.deviluke
1,666,272,183 *AF5C1BF811837DF2D9E74A020673A975ED7A815A VERGILROBLES
1,666,272,184 *AF5F79F7F6497CB19C9B723F4102892B93CE2BF3 vernberns
1,666,272,185 *AF5D27382794029EC4CA10CC8D0DE78B21E13777 youlanda-nolen
1,666,272,186 *AF52EB42573DEF862811CD277314DCA8F03EC8BB VERONICA-ROUX-HEERES
1,666,272,187 *AF5AF1D794DDB4AE51458908741665DD6731044B YPDYHOYG55
1,666,272,188 *AF5FECC17EE606865FFDA8966F5B01017C683C01 victor-sanchez
1,666,272,189 *AF5D8973E6DFB15C60CA8D80C738B6F0C02E348A VINNIE2005
1,666,272,190 *AF55830852C203753C6D30B776E2408BDC414426 viv.hammersley
1,666,272,191 *AF5BAF37860CEEFB47460BE2142F5465288C2A56 [email protected]
1,666,272,192 *AF566622D03A708871994E5D6CB08A158F52A9AC ZANZIBARNORTH
1,666,272,193 *AF5E62134F6FF89648FC14715ED94E2DEF85BB19 wwquarterlycomwww
1,666,272,194 *AF57EC91D5A1A7434C0B33479680A665DE1E02D5 vrkptrnded
1,666,272,195 *AF5C0F5752EFACDCBDE54E52C7B85ED49067E82B [email protected]
1,666,272,196 *AF51D14B542DD2B5700468B6D8C41AFB79C55532 WWWDIVACREATIVECOM
1,666,272,197 *AF5D14E7832F49F788A2502B5C76EEA6C308162A WWW.NUTRABELLA.COM
1,666,272,198 *AF58DDCAB55EEB9FAC530C488BAE08EBF35455A3 w0qqitemz7029796811qqcategoryz29223qqcmdzviewitem
1,666,272,199 *AF570C87910AD17FEC5B0AA1B96655CC1A6A8F47 WADELL.
1,666,272,200 *AF5CBEA6B437CD80B1269B3C651A1858F38AE7D9 [email protected]
1,666,272,201 *AF504B5C472B6BD4F864394AE2FDD98261A5B1B0 xavierbasketba
1,666,272,202 *AF507053EF60C6A877B070E0B1AC56C1F55D398E WARRENWOODHOUSE'-'WOODHOUSEPRODUCTIONS
1,666,272,203 *AF5B9E19AB526160581ED20100106477BD08665E WAYNE BOXY
1,666,272,204 *AF59D3A3FA4ACDA82529B9476CAD47918D1CDB04 ZIEGELSTEINFABRIK
1,666,272,205 *AF56FD4CD9D35F2EBEBEB3F3A94599513452E53D xfsudtns0
1,666,272,206 *AF5FED45F9AE1DAB53271DAF1783AEC68E1E0DFE [email protected]
1,666,272,207 *AF5D20D23F68F1C2CAE35A5BB998B12E3C9CCA5A ZMUTOWANEGO
1,666,272,208 *AF56D7FA56A1AC7D0C315B3C1F81CCA8144DE4E2 WAYNE.SUSMILCH
1,666,272,209 *AF5630B788008AEBB7AAD1D77F676D52C7BD0DE2 XMODEM-G
1,666,272,210 *AF523460EED333F9443DB050BF24DDA6C3DDA2B9 WEGOTJUICE
1,666,272,211 *AF5B5A03A0939DFA2B1958F3EFFC5BD496FFA4C2 )X(Q#P
1,666,272,212 *AF50AFA16D78F050ED2C0D8C9BF8F6F423218E2A WELLYLALA
1,666,272,213 *AF5285E0A70396C30A9432581477952299E85329 weltbetruechtung
1,666,272,214 *AF51655B154D09E093F5FDCD19C551AF09870B61 wendyeiltseaster
1,666,272,215 *AF588FD0DFBFBCF9266686116E34C644534E6D68 [email protected]
1,666,272,216 *AF5246A5F7DBEFA3D70DB3C9766441C8D7507700 νευρολογικήσ
1,666,272,217 *AF5B56BFF32BB040BC2DDB712BBA84E52B96850F yelgnidroc-1
1,666,272,218 *AF5A55253F7FBF56E9170B4FC2AE57EC787CD73C АТЛЕТИЧЕСКИЯТ
1,666,272,219 *AF5F770C3B02F6A1A72EADF2016F8C2361AFCE36 WHAT'S THE BUSINESS (FEAT. THREE 6 MAFIA)
1,666,272,220 *AF5EE48130AB36EF7C28686DC8B8968D7C29B1F4 ГУДЗОНОВЫМ
1,666,272,221 *AF5216E7B5DA84EB5963B194C0F3FE7D9033F732 wilberlafollette
1,666,272,222 *AF5C9A9BCBE6C868D23AF8BD0AC10D2226E47B71 ҐЕББЕ
1,666,272,223 *AF57CEACA3DD6D5BF37A9370AD87690A4E8012E2 YOLANDA BENDER WYER
1,666,272,224 *AF548F77D332160CDA9FFA4F36A0C6A1F26E5CB3 КОМПЛЕКТНОЇ
1,666,272,225 *AF5A7C5D4035509F7AF28DE745D54DFD8FEEF98B YOU'LL.BEG.FOR.MERCY.IN
1,666,272,226 *AF5BF564A7453DD71E649501C807EAEA0B33E0AB YOURMYOWL
1,666,272,227 *AF509D90ABB8A608850E982195E5F76508DA5AB7 WINSTON.GAVIDIA
1,666,272,228 *AF5D5DF9A097291E5146BB2DEA64D6BE67140416 ОЙЛЕРС» —
1,666,272,229 *AF5E1ED856164A1347A77F9EFD4CE38D0A78D3E8 WOBEUUFPJ
1,666,272,230 *AF5992392DE74394F568A6858B3D95EF2F099EB6 ПРИЕМЛИМ
1,666,272,231 *AF562010B5A865FE807D818169F5E24ED0FD0CE7 [email protected]
1,666,272,232 *AF51ACA63672AB34AE3643783EEDB4A114F878F3 YVONNE-GIECEWICZ
1,666,272,233 *AF585D9D3C312E2677CED4D03E8E10907ED4E9B3 zac.candlett
1,666,272,234 *AF5D5718B1ACE935DEC6C193688F1E486DA7B753 ZACHARIAH.BLEASDALE
1,666,272,235 *AF5469633FE7B85141D960D2452CBDF02433D1B1 zachary.mario.dsouza
1,666,272,236 *AF55999DE7BF7F7D1CE1303AAD83DCE9CD040A6F ZACHARY STEVEN COX
1,666,272,237 *AF54A1F65B7450B3F1EA61E7BF4C9758555053FA СООТНОШЕНИЕ¹
1,666,272,238 *AF5F48F68CD567F0C5E354C4D95538D1CA295331 суєна
1,666,272,239 *AF5908CD1F868CE0A9F6C19695A0706757FB3B54 УСТРОЯВАЩА
1,666,272,240 *AF58C5A5F955AD57ABF4E9729DD4FABC8F568C4C zanehockema
1,666,272,241 *AF5CB424160C9E4A2C6B95CD3121FDE925DC0A11 ЦЗИНЛУН
1,666,272,242 *AF51BDAC36CA0EC99DD4D4BCA529B65C399E8E9C ШҮҮМЖЛЭЛ
1,666,272,243 *AF55C181659F965630C34023B302560CC8952D9E ЩІЛИНОПОДІБНІ
1,666,272,244 *AF56FA20635A9886EC94FD9870CF72DF62922AFC zarek.oh.anderson
1,666,272,245 *AF5599D1950AA2E994C3AAB9C8AAD3256C968FE1 WWW.CAPTAINNOTEPAD.COM
1,666,272,246 *AF53CEB27BBDC8F37C61A80A421B7D5EFFE9F92F wwwccebca
1,666,272,247 *AF599D2046433B36D24EFBF1B95B8C9A51B4D62D ZBLANCH
1,666,272,248 *AF5AF6C71DF2F8BCCEA0EDD4D95041A9A874609C ZEINGIOJNE
1,666,272,249 *AF566F613946E97ACC7996633214BC9C83B21111 WYATT.MONTOURE
1,666,272,250 *AF58A8D1DFB35DB76FDB838FCE5EBCD5BD4743B4 (X)[email protected]
1,666,272,251 *AF54A8761E397B6A598A8251E4020CEC200AEE19 ZEYAD K HAMID
1,666,272,252 *AF53B642B5453CA4F35BEAB277A555DB9C0CCA93 xaviershah
1,666,272,253 *AF5367F05BA0CC88A3ABF3A718A77474AA7B71A5 [email protected]
1,666,272,254 *AF58C23014EBF91E001FF72ACB830D0FD4805501 ZHAOMINJUE
1,666,272,255 *AF530182546C8994A6804B1CF99CD1CF48DCC9DC [email protected]
1,666,272,256 *AF5790F1FD1F22CB8FA4FCCEFD058B6460500517 [email protected]
1,666,272,257 *AF59D7569E824DA7DE979BDD3A34F6559ED5CA0B XLOADQUERYFONTBS6
1,666,272,258 *AF5853FEB21EAFF89B5C1434924E17A1ED24FF57 ZNĘCIŁYBY
1,666,272,259 *AF58CA4FC673F28FF06B33816C91B2B726401B85 zwerfelles
1,666,272,260 *AF5DB83EA9441ECA46FDA9F648EA9326B84AE30F [email protected]
1,666,272,261 *AF53884D169C0F7671A2FBD3B2EEDBCD2912008C [email protected]
1,666,272,262 *AF5A0DD5FFB0C38D59AD8E356F120BBD7E1D12C4 zynt
1,666,272,263 *AF549E6CAF8CBF99A81A12326A9E3A575B54764C ιωσήασ
1,666,272,264 *AF5B623F80B4BE6439B93670B1091EEE39E29FC2 [email protected]
1,666,272,265 *AF5B5184E073DCEFD331EF2DF0F5B9B8FA7C91F9 YAREDGEZAHEGN
1,666,272,266 *AF51000AAA329EFBDE6DF09A3148A28473F61D3C БЕРМУДСКІМ
1,666,272,267 *AF58ECF423D05EAA0721B281603928EDFA2400CB Y'B
1,666,272,268 *AF58D5E3A698F89AC4724601FAC60FD2545B9F69 «ГЕМСКЕРК»
1,666,272,269 *AF5BD757DB9660EFA4EA61ADAD07E090CE34022E [email protected]
1,666,272,270 *AF57A7C460810D5608CCF17C7080ECE9E9DD91E1 YIN MIANMIAN
1,666,272,271 *AF5873A0FDE1E19AECB87A4254643AB375051A2D YOUNGCHUMMY
1,666,272,272 *AF55694BFE858649DF99A564AE8C369AF71C3839 を測定することでわかる。対流圏での気温減率は、平均すると1KMあたり6
1,666,272,273 *AF59A2FCE32D0F432861394E399637789B53C448 YOWLERSHEPPSSTENCILSCOMWWW
1,666,272,274 *AF55F36231756E9CD24BF01210FB0E222D761D43 番外公演『304』(2004年8月、下北沢off・offシアター)
1,666,272,275 *AF519B06652A742D134F168FF3FF0718FF3B04F4 [email protected]
1,666,272,276 *AF580980CD9A16A6BC02E3270CCBE889181DA6A4 YUMMYGUTREACTION5
1,666,272,277 *AF58F5CEA54FE3A331624DC006BA01C3CCF71367 САДОМАЗОХИСТСКОГО
1,666,272,278 *AF5B747CF36ADC7801761782903533C3A4132FCD ZACHARYTONN
1,666,272,279 *AF57F46381D4175F74D7598A6300E7C7522CA207 ТЕНАРСЬКЕ
1,666,272,280 *AF5118F2C8FA2BFDCC756D9CA3297446AF97AF8C украина16
1,666,272,281 *AF5B2404F13BB69B0FA68782C78DA1C7176EC421 ZANELACHAPELLE
1,666,272,282 *AF55AEC4BA4AA899DAAA62B3996B324969E0EA56 ZANTRELLGRANT
1,666,272,283 *AF5B934181F0D38B429FB432FFD7C8EC6732BA36 ZENYOGATES
1,666,272,284 *AF5C7EEEF196CED96CD1B28A4D565425CAE69EE2 [email protected]
1,666,272,285 *AF58A436EC673AC73D1552CE9A48F319E1716259 [email protected]
1,666,272,286 *AF50B7202A81A9A6984EFEF30A017CF84B748DB2 ZICKERTHAL
1,666,272,287 *AF5F5078736449CF673DE05B074D3F358F27905F [email protected]
1,666,272,288 *AF59A5154CDDA4089FB93281193EC74E8A076EF9 ZULU-RERE
1,666,272,289 *AF57EC14B92F982B06BDB51F9BE959A3F5FEB134 γεννήθηκα
1,666,272,290 *AF500CF4546BD0BE33D69974E1C7A43F1CDAE64F 031MORIAH
1,666,272,291 *AF530FF055F9F45EC7387C645FBCE2DB8284463A ЛЕНИНГРАДЦАМ
1,666,272,292 *AF53F3989E8782D3B3AAAD23751A6E12C04F133A 073426N
1,666,272,293 *AF54C1222105EA0BD7FA5685A0B9BC41B487AA16 0ILOVESKYLER9
1,666,272,294 *AF56BF04C2C900B1356FC63E18115383BC225DAF 1052232 TUTUKSI-TULLEEN-HER
1,666,272,295 *AF5E3866F3DEBAB9C027D72FACF1ABB61B389D26 10-beispielrechnungen
1,666,272,296 *AF5B8097954C012471FF204EC2EF6C3581072541 1212410 NAAPURIMAIDEN KANSALAISTEN J
1,666,272,297 *AF5D6682D4C6EF3E18FC6E803A7B604F48180E4B 12271024X
1,666,272,298 *AF526F56DFA236346E0B79B4D20D88FEF76C0838 1-ARAMALIDUR
1,666,272,299 *AF55F0D0974BB0145A850888C3DB7A94C7A4E48B 1 COSMAN
1,666,272,300 *AF5F89D1E0722221E688D619A0FFF2135C1CB908 本番組の特別編「木村拓哉の全力坂」では50箇所の東京都港区の坂の中に、TBS旧社屋の再開発地区である
1,666,272,301 *AF5BE72A5CCBF9203404D6AB656FDD630BFA7EC2 1 FORSCHUNGRAHMENPROGRAMM
1,666,272,302 *AF52813F7EF50AC7A00177246AB7E0D40D2A9F36 19770515:StLouisArena,StLouis,MO,USA(disc1)
1,666,272,303 *AF50A25841967E1B534B4F1D501CD8A5F9F59D39 1maal
1,666,272,304 *AF5D0E7985F58F58CE07A2792D4F1F70C0E090EC 1.MUFFINIVUOAT
1,666,272,305 *AF556AAF54508494AC0FCECC6FF46091B8D8C85A 1 NEBRASKAOMAHA
1,666,272,306 *AF5D700932B1CE2D1191360D60887DC6BB84F026 1.CSUHERAUSFORDERERIN
1,666,272,307 *AF5CF95D69B50A4DC1F864461A16896A8C5C4ACA 1rad-zeitfahrer
1,666,272,308 *AF51774491AB8FFCEF6F1909F6A05EA1BC5DE668 (00) o~ 0~(P
1,666,272,309 *AF5DAFB598E71CB54388F2EA8131618ECF47D93A 1 frampton
1,666,272,310 *AF5A4F25F8B3C95958ECCE394FB1518A6FA3CC73 1wolframille
1,666,272,311 *AF57D9B878020DF9D30EF1F653411A45530368A7 1 iNTRoDuCTioN 1
1,666,272,312 *AF5EA679BDF7749B176050032278B50F46B77477 )0(O~qB
1,666,272,313 *AF5505C51C33225C75FD64FFF12F9E94E0EB7ED9 2129074 LAATIKKORAKENTEESSA-JOKAINEN-ELEMENTTI-SIS
1,666,272,314 *AF53BA9CE7407DC2875F571053176FBC30851899 0VRTTNTVN55
1,666,272,315 *AF5BC7795276366AE5EC98482D812001D0C0DE88 1-lippuohjes
1,666,272,316 *AF514D1D1490E91F9091BCCDAB4B5E29C7CFC1F5 1037799 saksan-kieli-isolahden-koulu-1-opp-.
1,666,272,317 *AF53C2D04CA27D0A29F4455708BBD7163EBD807A 1043460 yliopistoissatarvitaanyh
1,666,272,318 *AF5CEBE691A80745E5F2BB6E04550EAC003AA23C 224626 heleyuzuhepgulenbeniyiceasikyuzluyum
1,666,272,319 *AF57799E829BCD9044D494659BC3E210586F507C 1meiers
1,666,272,320 *AF53E00FD7A9976DB01DCCB6456413A1AE605405 1-nato-agenturen
1,666,272,321 *AF5298DD5B86EAF249B2A7623D575CB02DA74C55 2527656 wams:sieanalysierendassehrnuechtern.
1,666,272,322 *AF52C486851EC3DC855B270F815D80C586641375 11 tomurcuklari
1,666,272,323 *AF5DCF9F59FA77ECCB03E145BB405CCCF9DF6D55 1-perjantainalontoossa
1,666,272,324 *AF5C1385175AF2EC3487583EA31C27779A0949C9 1289832 kysymysonselitt
1,666,272,325 *AF5E0A67783AD142D382E2EADC162BCCE29F0565 1-rasi
1,666,272,326 *AF57CAD1D7D88F30A288291BA9AFD6ED87D399AF 1 SERTLESTIRELIM
1,666,272,327 *AF5700EDB3883776399C41C45BFA422167BD2413 1.SPREEWALDKOST
1,666,272,328 *AF5DAB4A24EB93F290BCD0D248E5645F30C6C4A9 1.STADT-ZEPTER
1,666,272,329 *AF528227FD2EE6E74775CBE35B097A68F6613BDC 2711903 ja.mik
1,666,272,330 *AF50A86455FB67E5592B0B25E4E733924A5C59E4 1321950
1,666,272,331 *AF5B06CD5369C4C07BABE540667C5AA3A5DA61B6 1 TAIDERAHOISTA
1,666,272,332 *AF574BCC3D6B90FB3EF9FAF1B6FA671AC11300D2 2842487 aufauffaelligeweiseaehneltsichihremusik.
1,666,272,333 *AF5BDBF95205CB23BED8CB3A39CDFBF72215DA0E 1338242 KULLAKINELINTARVIKKEELLAONOMATS
1,666,272,334 *AF54BC8EDE40DD8DD55B0658B0BDD1232A93F320 1tuodulta
1,666,272,335 *AF532BC70DB1E95EDB00323EBA45897346BE3668 1UNI:N
1,666,272,336 *AF51FAFCD3C0A15D5086DA0A323B7528E7B9B5A4 1-US-STUETZPUNKTS
1,666,272,337 *AF5F42F457BC5296359D7A95D8447ED4872EE416 1UUDENMAALLA
1,666,272,338 *AF5C46F0001B5B2B06415D40C776D54E27521BA4 2DC3F1C4-43BA-3F2A-87A6-19E04B571A1D
1,666,272,339 *AF56F40390128A9F8F2F78777DF2047968DD1D35 2OVERSTEEKPLAATSEN
1,666,272,340 *AF5C5D4170078BCFE75EFEAA6EEFF4A3B3325AAD 2 REIJIN
1,666,272,341 *AF5F2A87600A142E40005996DB202D718C2C3032 2[[user:zarbon|zarbon]]20:16,10march2009(utc)
1,666,272,342 *AF5613C9CE908F4DA78D32382E5F6BC4B67015C4 2YUKSEKOKULUDUR
1,666,272,343 *AF517E84AC5DD0E52B0793210D609F29B30F0D25 1AIRTSOEN
1,666,272,344 *AF5D99D35DB69172B5F3487DA51EC0A72838A1BB 1-AJONEUVOLATAUSLAITE
1,666,272,345 *AF52E35AB25C1D75B08F3A4698B84B65F81519AE 1.AMMATTIYHDISTYSROOLEISSA
1,666,272,346 *AF5DE2AEFC311920E6C122CEC14B112EC19FB855 3BENZCHEF
1,666,272,347 *AF53959AC195EE7A26EA6F6D75E8839678D38197 3DLACCARIA
1,666,272,348 *AF56635C135A82313E62D7F47A08FEAEB5F73F76 288581 DUNYACAPINDAREFERANSLAR
1,666,272,349 *AF59DC0B5E589E67A3BEC76999BB4DD1DD83703D 3IAMMIAMI0
1,666,272,350 *AF5ABAB0F3AE05DB53213CA20938E49687B6D0B6 3OBRADNA
1,666,272,351 *AF54AD4D782C677FD5014C77DC3258DB7009FB74 3P * * * ~0~oSplat
1,666,272,352 *AF58FB3627360982F309BDE8A9F82E8BC5FD7003 3P.~O~o.>B0
1,666,272,353 *AF5ACE1593F40B193D997DC05813298E35E33A5C 1 JACKSON-IMITATOR
1,666,272,354 *AF5B0B9914BC0DAD7FBD1ED9EBE68A021FEE9FC0 1-kirjailija-vierailu
1,666,272,355 *AF5CCDE961B421A3C8B363D11C9F426DE4F275C4 2DATEIEN
1,666,272,356 *AF526D3628E9232E3ABBD27941D7F40B6073707A 3.selbstisolierung
1,666,272,357 *AF55BBAE3838950467E381DED5A19807A5CD5812 3stickstoffund
1,666,272,358 *AF59424EE18C35BED7D11F9723F2DA7912980BAE 2KRAFTFAHRDIENSTUND
1,666,272,359 *AF5B871F643B761F2F94DCC511E1FE95C5955216 1.posavina-vertreter
1,666,272,360 *AF58AC310283D1A355427C237C58748C080FC887 1.PREJUDICE
1,666,272,361 *AF55A39B7FF3D0410615CC650E556926536B02CA 2S2H2ONE
1,666,272,362 *AF5F8A975D8BDF36D9D25D64A6849A7504615E82 2sanoussi-bliss
1,666,272,363 *AF5D285FAEF527B4B34C0B8BFC52CD2F9B0CF007 1-saksalaisarvostelijat
1,666,272,364 *AF52574BB3DC48B1D943DD7729B2440B2FD58F3F 1-SCHREIBENZUM
1,666,272,365 *AF5A4B35949E46FBECF186A26D1AB0D961773FAA 1-s-kanavaan
1,666,272,366 *AF5A4E0453F8009B059DA9A29CEFB3F7DF91B662 1-START-KARAMBOLAGE
1,666,272,367 *AF5C94E4F1FCE37C39880365C653F6E8EE1EA9B6 1.TAKASEINIEN
1,666,272,368 *AF5A74C1611114B51D2408C5CB632A96C7A41BF9 2-voetsch
1,666,272,369 *AF5AF8C43B758ED9960C5C69B49BD3357FF1ECB3 [email protected]
1,666,272,370 *AF5AA2ADA966DBCD4CE7790DEC3087245873B5E4 2yritysasiakaspalvelut
1,666,272,371 *AF5AFAD0D71A180A546E9AF7E958D5B3107429DF 1UCK-KONTROLLE
1,666,272,372 *AF59D54148C6442DA4FF7C1ADCEEB699C6C021BD 4HOLLYOBIWAN
1,666,272,373 *AF51E97E31DF24E6C8CA32589700E8CADBFF3FE1 」(2004年・集英社)ISBN
1,666,272,374 *AF580A19E2DF5E781039B099462DF8B8CCD1653B 20december1628
1,666,272,375 *AF5F66444281BAAFA6B5DD7B00D45D7D42E24317 2121958
1,666,272,376 *AF566CFDD7520CFB58B0CB57AB748145E084F527 2188823 NEIN.,.DAS.WAERE.RECHTLICH.NICHT.MOEGLICH..
1,666,272,377 *AF5837CF63D9212EC5B9FF1721F1BC4273380D4D 2208479 elinkierto-kest
1,666,272,378 *AF59636C8EDDE4BD726C88169000F82E7016DC49 22-121-ta-JG-89/6/8-yksniweL-->a/<-972>"_972_N"=eman-a<>p<
1,666,272,379 *AF5D25BD54A48815C6DBE58555C9E3535C3B7A4F 2236961 SOSIAALISESTI EP
1,666,272,380 *AF55371A9E0E9DF73D203DC62DF250666B863A8B 2308136 kaupunginhallituksen.esityslistat./.p
1,666,272,381 *AF58DCE510A1497D735E6EE4F826CAA3F1206CFF $3COBARB17A1
1,666,272,382 *AF5BAF8AF813BC904EF81E3AD0535B62BC77E2E3 3-conservation's
1,666,272,383 *AF552119B776BE7C5A69211089A44F3CEA8F9746 4MYFAROUT6
1,666,272,384 *AF509783D01F1DDCB4788693E9A07235866BBDD5 2869571 THE.PARALLEL.CAN.BE.TAKEN.FURTHER..
1,666,272,385 *AF515882F0F72E3AE612701272E5590E7D4A15F7 3ILOVETBIRD
1,666,272,386 *AF513188B93FC7C842E629D37BDB4E41C121C2B3 4STTFANGEREN
1,666,272,387 *AF5A9FE1634A6CDB2C3FDBE713E5A9CE1B0189A8 2ILOVESAMMY8
1,666,272,388 *AF508DD5BAE6A2B1F1F60618E85F21F31C8CD05D 51holloway
1,666,272,389 *AF56C6A8996138490E5809E88CCDD0A6C903634F 2.SUURJ
1,666,272,390 *AF53F78E2E6D00F12D7073D5239680DC6B44CF26 334-peso
1,666,272,391 *AF51F91669ABB108D3A8E30304DB7AE9C5A82380 5ARMLINE
1,666,272,392 *AF565D07E993538EAD01954D1655E88535F2F597 4c1df630be6f39d9aed6554344aecd6a
1,666,272,393 *AF596BF4DA177345889FFCBCAF31FABCC73EFE5B 3B<o~0~.(==q
1,666,272,394 *AF5867FAC30DBE65E9B874E2B7E118E0E2CFC258 3.DISARILANMIS
1,666,272,395 *AF52C37C9C4778F5D6534E4F798E5790944CBA47 4ELYAHOU
1,666,272,396 *AF5D6263E50F11C4924E875A88955E19D7BF2451 5EBNESSEW
1,666,272,397 *AF557BA7EF081115958153F825B2DD90886D4A15 4ILOVEBELMONT6
1,666,272,398 *AF56EF7D84C84CADC6515F2A022C583F4E99BDEF 3SUSURLUK
1,666,272,399 *AF5D826E6CDB1DB98C59BE191E3F356CD7B42C3F 3VIBRARIA
1,666,272,400 *AF53D3714249494D46572B674A49D342E490E0C5 4NETWAREPAINTER
1,666,272,401 *AF5AAA5647394A5B8936315E8B8BFCE19B34D2D1 4PERERIA
1,666,272,402 *AF512496B643EE5B112469DD4249CB9CE077EA8E 4-DEUTSCHLAND-TRIP
1,666,272,403 *AF571600445E5282C3891ABD333F5911BB6E84C4 4DVOUERA
1,666,272,404 *AF5F955D2DA262EFF15D130EAE919C8B4BF4CDE6 4mycharlie11
1,666,272,405 *AF51D5EE05B6CE7C4069EDE42D0735D5FC7616BC 5TSAILOHC
1,666,272,406 *AF5AAAB403F08E277F4E009A46BC953F4DC25BCF 5VICTORIAWANKER
1,666,272,407 *AF5DFCF6E8522F567BF61E242F9BFE9A66A296EB 4SUCKEDMYD
1,666,272,408 *AF523C52C8FAA3D0C48CB3E0DDE0190D85AA3DE7 538506 MILLAINEN ON HYV
1,666,272,409 *AF5F58EF9A5E600724DAE0DB0B580EFE124A346E 542593 tel.:.(.212.).573.09.73.fax.:.574.47.53.deltam.muhendis..
1,666,272,410 *AF5DF13C37725B7C8259CFF60E0C618A074A5161 570BRILEY
1,666,272,411 *AF55E4D5A5DAF4F36D4D4E791A7CE854C2209A7A [email protected]
1,666,272,412 *AF50FDD9DC2DD03B71ECEA1A86E626D0F3BC0139 6CHARLESBERNARD
1,666,272,413 *AF5EC6A02E2E00557A4AAC26C865F7B982F540F4 5CATSPASSION
1,666,272,414 *AF51FCBC6BF6F7B67160F30F425955C4D68FBEFE 5BUSTERFLIGHT
1,666,272,415 *AF52438C2FA8B123D4D013D53C29895310100534 6DULLESN
1,666,272,416 *AF586E319BA7566EAA47EFD6334451DC1A4637E9 5CREATIVEMEMORY
1,666,272,417 *AF505AC2876896AA32831C3E628CF9EDB02FE83F 5FCF50B1-7C6B-3264-AC87-A537852AD4D1
1,666,272,418 *AF5072CA316C7F65104F7BC9DA0EC00822D714CD 5-EL-BID
1,666,272,419 *AF5C11694950137927AACD55E996F9EA3FB902FC 6ILKMAART
1,666,272,420 *AF50B4F0CB55524E0C6A7ED33303BF35CCF813EE 6MARILYNHAZEL
1,666,272,421 *AF52BF9E03D99CFDAA3D8C824222BDAEB32A5C1A 5MEGVALOSITASAERT
1,666,272,422 *AF515DE636E72DE2B7C0C7769C0B8487E8119898 6PESOPESO
1,666,272,423 *AF5B57AD710F874A234D36153088429AF3CD3D7C 5REBACKSTUGAING
1,666,272,424 *AF574A2AEF457DC8F87E442FC909183884BB0F5E 6PUSBISHO
1,666,272,425 *AF5073D078B3DA7113BFDA318BD4B80615B13D9B 5SCOPPIETTO
1,666,272,426 *AF56041E22091C6B673730D8979727BB088AC450 5SCOTTYSCRUFFY
1,666,272,427 *AF5AD83370B32572B99C88CB2DE454F19FF11E53 6SHALOMPSYCHO
1,666,272,428 *AF5054B0AA1E3D6CB95FEFE6C491BCAC4BE2A4A0 5PROFESSORATENS
1,666,272,429 *AF54FA635690A2AA1E412EAAF8BDBEBACCC6CC15 5TNDVRJS
1,666,272,430 *AF5F434FAFE70625E0BC87AA2ECF0BC649D015AE 6TIFFANYMIKAEL
1,666,272,431 *AF5230EB6A2DE571598BA6469B4AC02B6FF668E6 5ZODAFLAH
1,666,272,432 *AF58841C783897F95D0D363F156C4398713086B8 712641 jokaisesta leirist
1,666,272,433 *AF51B37F82BFF87D5635F484E023988F460781E3 607675 TOIMINTATAPA-MUUTOS-ON-VAIKEA-JA-HAASTAVA-TEHT
1,666,272,434 *AF50CB86FD7592F361B02F2C926C64C43EEFE4D3 7BETONHOVEDERNES
1,666,272,435 *AF5765D1E09C4467454B6401BC7C7FC6A2F4E1F9 6b9b93dc4dda3a71b22878550c698a01
1,666,272,436 *AF57238E7B1211E320A341CD529231D10A9AEEFF 6EGGROWE
1,666,272,437 *AF5BD87477EDF1C43A94DDD740D905FB34F7A8CE 6BSWNEWMESSAGESBS
1,666,272,438 *AF57FA8DE33E504EA84712E43B6688002A9212BA 6FELAUREDEN
1,666,272,439 *AF571C2810E5F7C383E115DFEE829B7A93DE2B45 6CASANAVEBSW
1,666,272,440 *AF5678057D13B05123D37DF294F60FFF8ADD813F 6kotit
1,666,272,441 *AF5B5908725C7BE220D37A56B63BCF1F0D471F88 7MASCARAMOS
1,666,272,442 *AF59D1A63DF73B56149C84228258A5ADEC69A22B 6JUERGIN
1,666,272,443 *AF55F0FA0F7FDCD9627EDBAB49C0FC776727C1F3 6KAAKKLAP
1,666,272,444 *AF576E65E755CE8E4712F45A5AB8848C8A7155C3 6KEIZERREZIEK
1,666,272,445 *AF52A39F65EC4FE798FF4D3CDFA80762E852373F 6KIMCOOLMAN
1,666,272,446 *AF55ED80BC6CCF8B3B0D169D618507F8DAB39915 6KJAEMPE
1,666,272,447 *AF54AB5EE4C3279079A36283A0AC421A1E0F723D 7SIKSAKLINIING
1,666,272,448 *AF51A04432F7BB3EDDE5AEB3F2F2AD0365D6837E 6REPUBLIKANSKY
1,666,272,449 *AF527169560BFA4629241DEA00881A0B6BEAA936 8.05.1440
1,666,272,450 *AF53F226B10A03E5879DF2F9103F3C8D498E0FD3 6strigilate
1,666,272,451 *AF59381C7309B04040F58F5784559BCD4D7CF74E 8BENNYLINCOLN
1,666,272,452 *AF51B1BC41927C06787FB0FB1063725A5076DDED 8BSWBEBENSEEMBSW
1,666,272,453 *AF5D2B23A0B3B2F1ECD7A050F2FDE1116F093EEB 8###D-*-*-*SPLOIT
1,666,272,454 *AF5C204CE07E76F752E5C2171F34F85E928A8086 8MANSOOREH
1,666,272,455 *AF58BA583F5A97092059EF4010824916BF071F89 }8{~`@===p
1,666,272,456 *AF52130C9B104E5BD0597C06E0973D1148F570C5 7MACHAFRANCE
1,666,272,457 *AF5EA24307208F96197500C37504233B0CFA429C 8RANRETNI
1,666,272,458 *AF55649AEBB8BE66E7B3390BA7D8446FCA1CBBBA 7HSABBSW
1,666,272,459 *AF57F7B6D7B501066D00A3CC32FA0C683706BC12 8SNOITAZIROIRETXE
1,666,272,460 *AF507996DEA6FD2D656E85E031D52E7EF9F8C759 7-SINIFLANDIRARAK
1,666,272,461 *AF54B54A6915267E9B81B6AF53F8B63825738A01 7LOVORDENE
1,666,272,462 *AF5DFA32176C4D8777BD362DB9D9F00873A83EF3 7MELLEMBLGERN
1,666,272,463 *AF5A06F1A20144EC96673B15ACEAD6C73202DD00 7MITIFIED
1,666,272,464 *AF548211B4BF7A3AE21161565AF9B5B36F931DD7 8TONIEKAN
1,666,272,465 *AF50F56417D50F18CB12954CA1AE739E07CBD20E 910wertvolle
1,666,272,466 *AF513E3AF1D28BB585F20CF4995268FE2B2C9C23 7wilhelmshaven
1,666,272,467 *AF5B4F03697E713FAB8659E8C87B4F23042F10B4 8ANNIEMILLIE
1,666,272,468 *AF54D92A74164D27B48988C129716541F99064C9 9ECCLESIASTICNA
1,666,272,469 *AF5F3E79DFE0FA51979BE6B3899358F3A4EC05AD 8COMPOSSESSORI
1,666,272,470 *AF5B63A3DA54086553DCD9F74D208D2E089A6DC5 8CONSOLACION
1,666,272,471 *AF5B1DBD9C6CB23DDC2494FC7B242B2C6B5AC601 9MIKAELSINGER
1,666,272,472 *AF53C2DB6D0A72171BAB1C83174D72DE75B27C4E 8JANICEZIGGY
1,666,272,473 *AF55D5F539BA3C9E06325FECFA6F02F5FAE6D10D 8LASCBSW
1,666,272,474 *AF56DBDC4E047BDD0C8F83C4F49A6C6512476065 8.profin
1,666,272,475 *AF5DC0C7AB15C90264A4C5FB1B14F240D87C23E1 8NEDGOOHR
1,666,272,476 *AF52E75417913957FC7CCE541715149735BE9EA7 8SENNOEGAVUAS
1,666,272,477 *AF5432C0C0E57A779A76BCE918338DDAA873106B 8SGRACIES
1,666,272,478 *AF5C658439239EE74BC3CF2882E6F0FC92EC8D92 8######@*.*.*.splat!!
1,666,272,479 *AF54FA48380EA6A693AA6C36F3953C60D157655E 8SPRINGMIELIE
1,666,272,480 *AF53F576AE7FAA43C4F43B9E902E3E56E5696200 A3o5
1,666,272,481 *AF5B432D764464B041988C5F1E1468132E1380C1 8thediesel6
1,666,272,482 *AF5C750AB5249ED7162328A0FDC60315C97BCD86 a.#:a
1,666,272,483 *AF5C01F6DFA4B3F8117827C86650543C59B554D8 AAA<I
1,666,272,484 *AF5071776C4674674ADEC82CF2D340D9AEBA3268 aab"):
1,666,272,485 *AF5753E1634267E10935EFB3131944EC9EEEFF58 AAB,8L
1,666,272,486 *AF53A2CE41F76A7CBEA592D17D5729CB01CCAEE8 9IGUANAFRANK
1,666,272,487 *AF5C243732D5DC4791A96576D53C244491961315 9INDLEVERINGSSTED
1,666,272,488 *AF521334347D02E8773DB4DE6D524A9FDE479181 AAC9.W
1,666,272,489 *AF5ED62C5A970CF6FE71F25D5F0B64C979E2550A 9EDEEFOWT
1,666,272,490 *AF5BCB1530DACBFF92BB5494709DB3BAC0416470 AAC=UX
1,666,272,491 *AF511F0EE40975CEAB840AD800E253792BACC11C AAD.'D
1,666,272,492 *AF5A1FC1FE5E6FE11ADFDE3290E84FDE0E2CF81C 9NATHANWICKED
1,666,272,493 *AF591E6F518F7C06688FC6EE0A30F72B2B3264BD 9IAMBLAHBLAH8
1,666,272,494 *AF52C199E58E08551CECF39B3B1DA162A5E1604F AA+.N
1,666,272,495 *AF5691E098698D85DB61B13902E7CECCB714223D ab1fs
1,666,272,496 *AF50DC456B88924849155EB518D56BBA44090F17 9SENNEICIRT
1,666,272,497 *AF5C056798AB400480214EE5CD4C1CF7EFDC6CF2 9YRTEMOTS
1,666,272,498 *AF542B87B7DC293E454485C8F6CF0306051FCE92 ;&a
1,666,272,499 *AF5D0C83B7079684E8F8744388AF7D514E2FBDDA 9WERKNEMERSORGANISATIE
1,666,272,500 *AF5F425F93BFFD77F31D4E8D6EE16D8C78785128 A17s
1,666,272,501 *AF5A38FD47705AF562A4A84E9C7D2371C90A43C0 ACC1!MA+ED
1,666,272,502 *AF5ACAB6D397E29D5B4C724F8C7A194B731C6512 a5:vp
1,666,272,503 *AF577750712DDAEAE9E580B7F7560B6BDC42A346 adqsx
1,666,272,504 *AF5C6CC63F4E51FEAF86C46329965DD0B7574C11 aa~gy
1,666,272,505 *AF54BE547BB9E7D66A6F508C2EAA7576CAB79C4B AAD;R$
1,666,272,506 *AF53A4CEFA6D3AB8D363BF40D377C74024271F97 AARISEST1
1,666,272,507 *AF5765A483073798B2008FA4B2ED8537787BEE6D aaenT
1,666,272,508 *AF5981DF6E546F7966612C9F11F36C712A53BF72 ABARRIENTOS
1,666,272,509 *AF5A2644E0342836005586C7FFB3C995663B3DD4 abolirons6
1,666,272,510 *AF5141FBCD913EFA4ED0292D87300440B85575B5 ABELCONSUEGRA
1,666,272,511 *AF58AB30A7491B89231BB0E5890A5DDB2068FC5D ABIMAGIN7
1,666,272,512 *AF5B8694F0EA1C02F31469FC7730F3130805D07C ae/ls
1,666,272,513 *AF5BA264E4218EBBA86AE4DAFB43937D6D5EA8FB ALLF
1,666,272,514 *AF51D9763EA4800CED40545EE47EF2B7C1F5254C AHCIRTS8
1,666,272,515 *AF5732214FBB2FCE2D30C8C30FBD05E22195E4F6 AM!:_
1,666,272,516 *AF52D69B5E1181EA44D831864274C2B8CE7D6053 AEGXI
1,666,272,517 *AF5E3256DEA340E2543E18C4C6B0EBB6ADBE2F19 ALEC.HELDMAN
1,666,272,518 *AF5734878D82C890B73789C5C92D92E2CA2DE5CE amplifiercomamplifier
1,666,272,519 *AF58FFC321EA18D0781D960D5C45D4C232CE17B5 AMY TALL
1,666,272,520 *AF5F96FD9A0C98842E65524A919E42B893AEF409 alhnj
1,666,272,521 *AF5BD5E2632928EA2505D9229369525130628BDC alismataceae!
1,666,272,522 *AF5B8E927189C5B2C01615F742E2F52A552CC23D ALTHOWGH9
1,666,272,523 *AF535D76BBFCF3DEDDB494711945723AF7A215FE ALU
1,666,272,524 *AF5BF1A8ABF1E07A71E7E325EEE5CBBECA94FDB0 AN.MG
1,666,272,525 *AF52DE5C700859F1259903CEE950066977D944FC ANGELO.BEUKELMAN
1,666,272,526 *AF5CF8674FAD1BA7B7157294BF65B923E28ACD4F A-NIGHTMARE-ON-MY-STREET-(SINGLE-VERSION)
1,666,272,527 *AF51C4F0FA45606EFE3F8E8592CB08B6FAB80981 aldelaimi
1,666,272,528 *AF54F1C589077FE357C285E868CB08F83C43BE7E ALIGNERENT8
1,666,272,529 *AF503043B498EC160370DCAFC0D971A6234028C1 ALLAN.ALMENGOR
1,666,272,530 *AF51605E59355B73613F6768FE26DDE4C1C69394 [email protected]
1,666,272,531 *AF52DF3A057C4229B8D537E2A4608C406158534B a-qfa
1,666,272,532 *AF5B0ADAFA4B7A96C8C927B7BB3B2766F8E6A9CA aloqk
1,666,272,533 *AF5926E76B828056FBC07910EE9D5E0073F5D9DF alxga
1,666,272,534 *AF5E9F86EDABCF1579A3E29F31133CF45A396C69 ASTEROIDS10260110270
1,666,272,535 *AF5272E0BEE87024754D21B2EE43D2A197CC1FAF ANDERSONLOFING
1,666,272,536 *AF52A956A265BA540C0F22E5CE07D21708C7E134 [email protected]
1,666,272,537 *AF5DAA74E2EBE74BDBAEEF12E146A9394892D8DA [email protected]
1,666,272,538 *AF5BAC936C845B3AB7ED88C6B3196C4DCC76075C ARONSOLDANO
1,666,272,539 *AF595C11A219216D936A8431924E0282F4C6F254 awchf
1,666,272,540 *AF5DA0664B738AA6C3285665BE01C48034A84350 awpt
1,666,272,541 *AF516A155F9C8BFBD32488C6DC6132BF76A14791 artseditor
1,666,272,542 *AF5FA571F832872EF07D2B21A421D4565FED184D [email protected]
1,666,272,543 *AF583B593E8D768955EAB2DABA36B369D8240894 ANTWANCRAFTS
1,666,272,544 *AF58E6235E41CA390EF8E41EA13E989759712CC7 B"3L8
1,666,272,545 *AF506188DB8B108DA2082EA8A281D34539834A52 b5qtm
1,666,272,546 *AF5EEC67C6E7CEBA64ABB6B9DFF9B4726210A81A B(7NF
1,666,272,547 *AF528AFE6AE0F14C9A22A16696048D97D8AC7F34 b9u_a
1,666,272,548 *AF530B1F061F5251AD89416D5D94EE094EEC6B0F a?/u#
1,666,272,549 *AF5B7F5F1E07AE7355F2352D448CCFFE1E197153 BAGDHAD
1,666,272,550 *AF550C924C83730291A1ECEEC639824E6357C18D bare-in-mind
1,666,272,551 *AF5B8888ED58DEFC843CA48AB836AAF7249A49AC B0PUJ
1,666,272,552 *AF542277DEE35347122C71E5053449484D493F11 BEAUMONTCLEVELAND
1,666,272,553 *AF5974CD7548292BFAF6E55B631236CF98246A9A [email protected]
1,666,272,554 *AF5A891DFD74F1951158857A35E1B84E5E2F9E30 atkena8
1,666,272,555 *AF5F3860D22492D9B20D0C64324A74C8FCE29344 ATT75
1,666,272,556 *AF5FD2526A5FBFCB29C2F54929679359BE9CEC2E AUF.DIE.PISTE.GEH'N
1,666,272,557 *AF58B6B40833B8C5B96C7F76986D99127102D509 [email protected]
1,666,272,558 *AF5067586A46C78649AF7D87FD447880B7BD9A1C ber0
1,666,272,559 *AF5C7DB4A1BABB05CC33030EBE0D59AAE5E80B18 avfp
1,666,272,560 *AF5438274272A87AB60D558BE8AE715A3DA3315C b+2_m
1,666,272,561 *AF5FEC52B8249B67D2900B2B9DC16FC2EA0C75D3 b5qtm
1,666,272,562 *AF5A0E3E952AD771EF7A2E78E69A7FFD4F574B03 b;82r
1,666,272,563 *AF53C2F2C1692605A10FDCB92DE390BBB505CEBE berun
1,666,272,564 *AF53E58A4150F46BDD35AC49DF422AB67F7D9DAC BESTAND­TEIL
1,666,272,565 *AF5EA57F3EBF50760946A56841F4B0575FD132D1 [email protected]
1,666,272,566 *AF5419589B604841CD544AE0807961ECA3701AD1 BIRONGOY
1,666,272,567 *AF574E20D8B3E4167DEC55F6C29B864FDD615FFC B(FBT
1,666,272,568 *AF5C4FE42E33C2AB7FB6B38A29B61C1DD372FEC2 [email protected]
1,666,272,569 *AF5FFAB512691B4B3AF67C82D01B6E253005A61D bialogorne
1,666,272,570 *AF51AECA90C4DCD9B1B0138D4DC7C33EC89F464A bd7gn
1,666,272,571 *AF54ABD640BDE9FFDB266A887268B484D4C978E9 bl;ts
1,666,272,572 *AF5CB936AACEEDB518D80BFF0A407A38427E219A BENEDICTWIRTZFELD
1,666,272,573 *AF53164C9C7DB0BF973F31224C23625E61DB28B7 BENJAMIN.KENAN
1,666,272,574 *AF5C1D44133269834D46893683FE4116B1486965 bennierawle
1,666,272,575 *AF5A314EB80785C102EDA9F24883E8CDB6E91BD1 BENNY.WOLFSBERGER
1,666,272,576 *AF57EDFF6BE52941A939127C8F1754F32D432E48 bn4=
1,666,272,577 *AF5D34014B34ED67890606E02A2C57A400813F1D BFQJ$
1,666,272,578 *AF519AD44994444395CA6BECF66E27C05AC5EA48 bm5
1,666,272,579 *AF54573E29C9D7502E1C4F9EB5442AB095887687 B-MLM
1,666,272,580 *AF5E0BB359186E8052D9245EC838A3D9BA2C3647 B#P~O-~O-SPLAT!!
1,666,272,581 *AF50749A91DD7D771F9FDBD4396DB68822427578 bqcu
1,666,272,582 *AF57B9C405D7D857A8F4885C5E2FDC642CA085D2 b------p~`(^_~)
1,666,272,583 *AF5C2945B7B47F6309422C3A6D66CDCD8C2DAD31 breishithbamidhbar
1,666,272,584 *AF5A39C4401E64BE70C4975E579AB725CE1C411B
1,666,272,585 *AF584448879891BEABA7E17C8AD0E8235D157770 S
1,666,272,586 *AF501F969A5A5461ED79D42C26AE643A66EC69E8
1,666,272,587 *AF55F3FB6B0B21F2F58166184FADC3A3414D9F69 {
1,666,272,588 *AF5751D35CD4AF844478B4EB0BE6601A16848B93 B:R6K
1,666,272,589 *AF5C4B6F66EF7B86EA825C5A8F708461CB3C9A45
1,666,272,590 *AF53CAFE14CAB21D1934A1F797AEE3231900690D 욘
1,666,272,591 *AF5056007FBBB0984150B63F98E1E0A46613E33A
1,666,272,592 *AF53E70A52295323750531C34DE08BF26B97FAB1 
1,666,272,593 *AF5F4D76D51DD6186EA8F9F4F36FF7EB62B840DF K
1,666,272,594 *AF5FCD4E6430626D3579943D0F129A37EFCB3EF0
1,666,272,595 *AF59C7D069B08765E1DFEC59ACF4E34E6199CE2D BRVLQNTS
1,666,272,596 *AF5A0BE8D77B16609364F8C4E38C2F134814A589 BRENTON.HOPMAN
1,666,272,597 *AF5B3128B487DB5708B63556241532D221861CCD [email protected]~-~-splat
1,666,272,598 *AF58C9F32A3CA074127603537834C59B9D1DD072
1,666,272,599 *AF5FAC068A5E48A5266A049ED94DD2DB7C2B0CC0 btgm?
1,666,272,600 *AF5A98D74D8535A7057FB5979AEE604D637773C9 ;s
1,666,272,601 *AF5AA436781FB8689C82259AEA1F551A9F765300 BRMC_
1,666,272,602 *AF5EABF868687490CDD49751DA29CA94717C49B5 BUDDY
1,666,272,603 *AF50AF5A22FBBCFBBB347A9E59AC14695D7AF075
1,666,272,604 *AF547E42482E75E4F2470E183691369E86B78BE5 Y
1,666,272,605 *AF50FFAE83848250942F8557E87176E587E91764
1,666,272,606 *AF55D700BE12FEA63C59A2ABE811E027A1A9CAE4 bs60i
1,666,272,607 *AF5231A7CA79ED29D454A0834E37BDCC3D02A37F bubii
1,666,272,608 *AF5BFF69A38CA6C5C7EF17CBED3B02763D46A390 [email protected]
1,666,272,609 *AF5403F3E8D706265CC634E2512328EEB27250D0 _5Y
1,666,272,610 *AF57DCF5B96EA6A6E74AC17B06523D5190D1FB1C
1,666,272,611 *AF53B9878663EB5DDE6489D1811715B92196CE76 BUFORDHABERKORN
1,666,272,612 *AF5B29EC79102EECF1614248D282A97BBA3F5ABA BUGBYTE1234
1,666,272,613 *AF5568BE6205FECD1757D0E44D5AB1F4D0182356 BUKNOIR
1,666,272,614 *AF538931793A24105843CEA4064E1B94321430A5
1,666,272,615 *AF5EE26C61CECFDDEC4380521D8D5C04E06B7B1E
1,666,272,616 *AF57F46CFCA07C75B60C4527602E913E55199632
1,666,272,617 *AF5643C2FED65B451214C4EF2F3A3D67CCCBA71A BURNABY_CLASS_FERRY
1,666,272,618 *AF5921AB9F05522CE8A69EFF1530EFB127382EAD \TL;֑R
1,666,272,619 *AF563F0AD77D859B5153427C4DC9B96749E73D4B W$
1,666,272,620 *AF5A9976929790E9D28FD42C65CAFBB89FAA5997 A
1,666,272,621 *AF59D6C8B3B2334E99DDF690DAE89EDD7FE11944 c\
1,666,272,622 *AF522CD6904F48B80B36690BE95860B24C74C09D
1,666,272,623 *AF550E5FAB9C62D837A0AC6FC4C273C61731230D t
1,666,272,624 *AF5961E2DB5E5970A67D46668FE2331A56638086
1,666,272,625 *AF557B70B7C5F87D991A4065D7BDACC16CA952BC BURTNEEDLER
1,666,272,626 *AF5CD83DD61DBBF08E48E0EBC4EE88A3F28ECD17 buw;c
1,666,272,627 *AF5554CC2EEB9E8BBB8B79F5AC8E3362702399BA BV:A-
1,666,272,628 *AF598BA4AB95F6FFC0044CEA7560E65019ED0CEE -E?J
1,666,272,629 *AF58686E88DFED23D3C0EC70DB389D0313E55787 m
1,666,272,630 *AF5AFA80933936D718F5A0F909063F199A77D438 [email protected]
1,666,272,631 *AF5B5F21CCAC008590249E285ECF24A822AC76FD b"-wt
1,666,272,632 *AF54D7B7D451E0FEFB2368A65FF2F7ADDD3C2F3E bxfev
1,666,272,633 *AF5A8273094F8102EEF42495ECADA33CCFB26F73 BX-KU
1,666,272,634 *AF5237D57CE2170A3E54C1B806F90B0EC9A5BD78 BYLONISH0
1,666,272,635 *AF51E2716399AB0671FBB068F2D93C4C29D7E5C0 c0=ai
1,666,272,636 *AF5CC8D3456EDA57427CFE34E1A4A841546D029A c2c+-
1,666,272,637 *AF50681F3143518919CE4BB72F19F4D462433FAE 95
1,666,272,638 *AF5CA1410012FB47CF1E812524C230CC943B289F c3kc!
1,666,272,639 *AF5F5B892F9FD5D4B2541C51C02096BC5F32AD77
1,666,272,640 *AF5348BB933B9CC140461E67429280EBAC0271E6 DTB
1,666,272,641 *AF5E281E105369DBE34F933EACDED924569A6783 C"4&
1,666,272,642 *AF53C59DC9289B028910585D2821B73FDDADFB0D ?
1,666,272,643 *AF5DFE1A181B0A117C8B3FF56E71367A9220A696
1,666,272,644 *AF51148D530D977A7949223F9D0E79E2B2060932 c5mt?
1,666,272,645 *AF5B4A0D86953AF1FB28999EDBC943E7A7AE6619 C69827
1,666,272,646 *AF518E39427D96A5A517E958F32206602A8E5081 ʬ.
1,666,272,647 *AF5D8DF61055AAA0C759F08C20FA98A895FE113B c6w"i
1,666,272,648 *AF594C477FE1F5A0A59477FD5775B8F3AC703710 c9hf
1,666,272,649 *AF52A63271B88A550E1F86481B719A2E82C81F84 C9B%S
1,666,272,650 *AF5545EB099208465298F811537520BBFF0116ED >_Y?
1,666,272,651 *AF580F9926C269B4DEE2682AA7C8B3ABEDCFEBE4 j
1,666,272,652 *AF57DF6F2A8BC0188512F42D668430E857BA1E25
1,666,272,653 *AF55D8462CABC6FD3068DB6F28C7910C28825A30 CALEBKHALECK
1,666,272,654 *AF5584E3F5F95E9B311534EE27BF18D0C5810951 CAFE.JAZZ.2
1,666,272,655 *AF57D2C08382E9951BF631A392FEAACB0626A729 i
1,666,272,656 *AF506039DC71CCDDA2D9E85FA7B107BF91392301 CAN'T TAKE YOU HOME LITTLE GIRL
1,666,272,657 *AF53FF9DAEBC68394FBDA794191D0A718AAD1340 capricevariations,no.44:scherzo
1,666,272,658 *AF54716EBA2E28326DB0B72A47BEDD7578D57DDD CARIBE.MIX.2005
1,666,272,659 *AF544F6428930B18446418656ED9E436624A62C6 carsonhiltbrand
1,666,272,660 *AF5D3D3D39F920C6C031B1E22CC5B39AB9C0E5FF caroline-flint-claimed
1,666,272,661 *AF5C28EC5C1D430A75DDFB151A5DA935516C15C8 cescent
1,666,272,662 *AF525DB08280FBA53341F8A2AD030095D6F56417 0877C19428CB4302A2DF4D16F516F961
1,666,272,663 *AF5EA3AF0736F28B74678D162081B7755CF996F7 CCLW_
1,666,272,664 *AF55DDB7438BA4660520C29987A73F8DA2B733BE chancecasting
1,666,272,665 *AF578BD2E364F7265FF6D78B30CECF117F7DE627 cepcj
1,666,272,666 *AF5A58AFFCCE57043245015DE60548DFB6E11FD8 CHAUNCEY.PASCERI
1,666,272,667 *AF5E79E7C049FDA7B2D2DF8BFED80DE4F2C5D6FF CF_G!
1,666,272,668 *AF54E0FAEFAC1ADB186BE181A03A854DCC994173 CGTJKHUH2
1,666,272,669 *AF584F42346FE4DF715349A8DAD4B253537E1F97 CHANCEAFFAGATO
1,666,272,670 *AF5A7AB945222ACAE8DBB6997568A155575B5F13 chfqx
1,666,272,671 *AF536DDA1772F404B2F0B2AED76C33B353842241 151CARLA
1,666,272,672 *AF5671F26E91AB50D1A66F3D7FC6643C2038C7FC 15.Y
1,666,272,673 *AF515A676DDEEA3DA0EA3B5B06F393F3B95C52F3 [email protected]
1,666,272,674 *AF5EEFA44CA8C274F705AF85C301470905797055 [email protected]
1,666,272,675 *AF54B302421DCF382575BC5F91245CDEFA168178 1957258 hiljaisten.
1,666,272,676 *AF501486FE3920C503950ABC1E0A714BA6A6D38B CjWq
1,666,272,677 *AF5FB0C6262557CA5B9A47FFE3A90A380955C050 CHRISTINE.LOFTIS
1,666,272,678 *AF56980DAD7D0550FEABEBA121CF103A2360B9BF [email protected]
1,666,272,679 *AF590BCBE4C4A0428F3FF46A90957041E740EF42 1ALBANIANPOPULATED
1,666,272,680 *AF5768BFE5AD1B7A169FB813AF12A6C06045A07E ci26l
1,666,272,681 *AF5D8DC26CD6C989BACA2246A616942A08CFB6E4 cigff
1,666,272,682 *AF5BB57D49F47788637766E0F6EDCDC1F7E20641 classiccinema(disc1)
1,666,272,683 *AF5900A6D688F7AF686B29BFB6D87D652CE1F15E CLAUDEANGELS
1,666,272,684 *AF53CCA148BA9A0DCD0E780D4047F550DB66E53B 1.deGiStirilmelidirler
1,666,272,685 *AF5D748609548A751061216213FC60F3F366ED60 1 DUERNBRAEU
1,666,272,686 *AF501EFA5BC6F26E5ABDA362BDEEF3089BD75B91 CJ?OG
1,666,272,687 *AF5D34DAA8075144609C81AA2E1F4C1D96B14E80 CKq0
1,666,272,688 *AF54AC22D645FFEF29ECEE32318FA1134BDDC920 claudiobab
1,666,272,689 *AF52F603DDA64627BA9E81E3C0DB322649C3C57B 1-INTENSIVKURZ
1,666,272,690 *AF5A6A70A3CB6ED8984EA69AE9B8CB4D08D84342 1ITIITAIS
1,666,272,691 *AF585FCEFFD9A49425DCE14D0F2A1DD69AB5056C cn:b&
1,666,272,692 *AF5AE891C2DDF9C51DA2DF1C895B8A4FEEA9EC1C COBRAATTACKSQUAD
1,666,272,693 *AF52C442B4234E53259F402E22F257DCE71E3176 COLBYMONDA
1,666,272,694 *AF53DF796D89413DD48D2932966AB8C217133F66 colbynizo
1,666,272,695 *AF5489AAE562589B64E0C8AA3D78865F85A2D0F3 Cn1W
1,666,272,696 *AF5A2349B508E8745973446C5FE88FDB8316D22C CNg5
1,666,272,697 *AF5A1A4A15F590F58A79E7DCBE1FF79C0CEC02A3 C,O=$
1,666,272,698 *AF5E3E6060E91FDBE99E3F8027478A963AB2F8E4 1montemagno
1,666,272,699 *AF53C8A3FCEB93244A1DB204D90FD0C6887A41F7 comp4ctor5
1,666,272,700 *AF5D4B26B27DB1F4E31D12BAA9C907090A93167D 1.NONSELECTION
1,666,272,701 *AF525CA39F054D874BDEBB65A143CFA46992D8DE COLEGROUP1
1,666,272,702 *AF5797FAE2A9C75017CC59D116C08730D8365208 COLUMBUSSZYNKOWICZ
1,666,272,703 *AF558FAC253F5499D25DB1CCE6A03B1CC6701739 1-SPARTUGEND
1,666,272,704 *AF57D660D4A9F13CA71411C7E13CA33397F6650F copperhi7
1,666,272,705 *AF5DA127DDFB37E12B35B5029A5AABE4CA0F46A2 cora.noble
1,666,272,706 *AF5736ACDBB28515C4EAD770BFB043E3C767F52A 1THATDETROIT2
1,666,272,707 *AF520606D9897B277A5CB0B9CBB252B5DA6AAB0D 1.versichertenbestand
1,666,272,708 *AF5CE85BC53810DD5AFB61B172806619949B7305 1-village-bewohner
1,666,272,709 *AF523D44F4968F6878D5899AA5EF3128D88C9C1A CONTRADESES
1,666,272,710 *AF5A57D4229C26DD5CBA011CA850F4395972A2AF 1-YK-K
1,666,272,711 *AF5DA5A86197344399D3813DBDC16715AAB29E41 1 YKSIL
1,666,272,712 *AF53316BDD3E36358DC5C2996E6880C66835A37D cornellsantee
1,666,272,713 *AF5D6458A429AD91706E978B5D0E4F487BD59A8B 203035 taideteollisuuttaonsiisopittuesittelem
1,666,272,714 *AF5D4FD1628AC95B87C0E9702C2D6E62DF4C302F CosmicTravelling
1,666,272,715 *AF560C8E70C2CFAEA6AA9653A3F004679FEF762E covertical7
1,666,272,716 *AF5C0A8DE2ED48DC20AF92CC8A1D319D768C0C9A 25 NORSKE FOLKEVISER OG DANDSER, OP 17: XXI SAEBYGGA
1,666,272,717 *AF584BFF8E2AAF2AE082633D1CE56EB57F77FA71 2735801 JETZTLEBTERWIEDERBEIIHR
1,666,272,718 *AF5F49FD528025D260F9AE558D67AEFFFD118B2C 2889947 fysiokimppaanpyrit
1,666,272,719 *AF5234167F08E214E78AB7B1E4EB750EC804B3E4 28JAN1537
1,666,272,720 *AF5B49D8A60B6C17A4245D9DE5AA46744DF5F41F CRIMSONBUTTERFLY
1,666,272,721 *AF591D3DDF708934CFAD9116C5B0DF955081DC15 2DOPLNNHO
1,666,272,722 *AF5BEF0CC6D539276DD11CEA60C9F15B2AF16D2E cqnuy
1,666,272,723 *AF50825F7883DCBA9E4171A982E80623F815C26A [email protected]
1,666,272,724 *AF5F17D8A07BDD10410DCCF9A30599547693911F CS6MA
1,666,272,725 *AF5D21BA390693DE38816A311D5143C8DAE37715 crown.technologies.sarl.|.france
1,666,272,726 *AF54A8F890543FB5C06E4066536333B40BAA8013 2.kiroileva
1,666,272,727 *AF5C4949D00ACD839964D97849CD804B7284FDB1 2lablachere
1,666,272,728 *AF5118B7DBAE25C2E32F098B04F539086AB164E5 [email protected]
1,666,272,729 *AF5E325B271586E4851040626037D4C3D3338431 CS7.#
1,666,272,730 *AF5422F4623F4880170B915398A3328CF342C9FA cution transcendante: xii. chasse-neige
1,666,272,731 *AF565C6968F6916C26C34DBFD522991EA8AE1641 CVWD
1,666,272,732 *AF57569C055E5FDF3418A7A69559AD3168378B30 cugn"
1,666,272,733 *AF55C42D1A169E5A2592BAFB628259398BD0AC17 cydo
1,666,272,734 *AF54C5B14C5C824DACBCC625448FA9992BDE01FA 3CANTORIAN
1,666,272,735 *AF5778042D6C77B80CEF1408FF25BFAFA819A23E cyllosoma9
1,666,272,736 *AF509EC5D69708F0F7CFC5C2984BADD4C96BAF95 cz6ne
1,666,272,737 *AF5C0400D29F4E558B2C4CFE97F5CCA444142226 3mu1$fcaton
1,666,272,738 *AF5685EA4187A40C25346C586CD82A87D08FB159 CVWD
1,666,272,739 *AF518DDB17653E5DAA674029E5121411EB9FB7BA d3qf
1,666,272,740 *AF58CAF69C5867A3F3C1EC27B1BBF087AD00AB9F 3thatiguana
1,666,272,741 *AF5C6FE3A3DF71ADBDBC34246A60A316F3DCADAB 3YHDENMUKAISTETTUUN
1,666,272,742 *AF5155F6B8AF818B77EC76DE37BF3418C98DE490 d!5c0nt!nu!t!e5
1,666,272,743 *AF52B7A045AC4A2A72B8A5B903B404585100E83C 451542 VIIMEINEN KIERROS 19,5 .
1,666,272,744 *AF502FB0A8E0237AF5F65EC12DFF522738F005D9 da921132555
1,666,272,745 *AF5EF4CA1D0D23F24AAA2163A64215AB420921A2 DAMIENROZZI
1,666,272,746 *AF505F61A35DD1B3F6A94E69C7A9333390BF7EE2 DANIALKOSCH
1,666,272,747 *AF52223F6513ACBE57CBE25D3DF67E182FC0C1EB d2!$d
1,666,272,748 *AF5F73C5B8729908D9AB4F69769F9403683E0F6A 4TYOEVOIMAVALTAISUUS
1,666,272,749 *AF52CA88ADA664A7E3F71ACBFAF556E0CD7702DC d9bpm
1,666,272,750 *AF5A1EE65201E3B42F55345144B00085D31E9297 55350 moderat-fiel-das-umsatzplus-der-videobranche-aus-
1,666,272,751 *AF5D83DE9A7277DDD396199B979C6D8AD73967F0 d’autodefense
1,666,272,752 *AF5D0526E9FF73BB5D243C2CEC834A2E53F7D62A DARIRIS
1,666,272,753 *AF5F717649D886FF7FFF2C2FD8667982730C8B25 d)eas
1,666,272,754 *AF5A3190B2142872ED3BA15E3E0CC3DADE3F4945 5MANOLATH
1,666,272,755 *AF5231CFD36665F8373C7778A40E2F0D235E169E 5NGEPERST
1,666,272,756 *AF5913B6CBA35F67A438C31EC0E16178EC0F3582 5 OSSIETZKY-PALM
1,666,272,757 *AF5CACB4CE3364C1C7F7994EFD229FFE18B110F4 5PLUTOAPRIL
1,666,272,758 *AF5128E943A7FD2153EDB1715E8309FC5247E196 deenab
1,666,272,759 *AF5B43DD16B248DAC2A019540F65BD781FD88144 5STCKWERKE
1,666,272,760 *AF5467199DD80564EE39763B0C55E8287EB86D63 DELMAR.HULSTRAND
1,666,272,761 *AF597DCD767C0AFB6113AE8F18E9A568DBE90F86 delphine-oneroi
1,666,272,762 *AF5A8151DA219B43B8469ACC3D8323BDE4E883AF 5UDGIVER
1,666,272,763 *AF5251830183C595482125FB9DB495FDF0C41589 DERICKGIACOMO
1,666,272,764 *AF5443131F21498A09061AC0AA9F0EDB5D513403 DEANGELO.GOODFELLOW
1,666,272,765 *AF567420EAD58F56EC0A2B0DF4E457C46C725E99 deeuz
1,666,272,766 *AF548283CFDA2E822817A08FDFA85415D2BF8636 DEFINIUJĄCYCH
1,666,272,767 *AF5804698786700244BA0489FFD66E9A92B538C3
1,666,272,768 *AF502B780C32CF91EC5AA2A1D7B844936C794203 1
1,666,272,769 *AF57EF7F74FF07AA7843DA885D2481920348A67D DEXTERMARTEN
1,666,272,770 *AF54D613C00D7825EED839F0DAABF7B55600ED57 DFM-O
1,666,272,771 *AF529D92BE249F3F7DD185F0D84F5BC224FDD185 DENISDOBRININ
1,666,272,772 *AF5289094A08323ADACEAD1988FBDE5C97D79D2A dentonte
1,666,272,773 *AF5BE2B1836FFA17E39C6C3074A8D29A254EB778
1,666,272,774 *AF5D6D8CE4D7F30D84C6B31CFC6A5E9F3A035711 ;
1,666,272,775 *AF542E38A915236A62C4CA740405456AE35CF7F7
1,666,272,776 *AF525D97E091507F0C6000114CB9ED529D062531 m7!
1,666,272,777 *AF5EC8712131E573D527ABDF55A9D5DDC0A57501 D;HF
1,666,272,778 *AF572B3BF079B415886F5C172165BB72FDCC6337
1,666,272,779 *AF53C7493AF2D70D5B85310642674AE66A138087 " f̈́F
1,666,272,780 *AF59940AE01F3DA8F11469E255CDE87041BF6018 DIABELLIVARIATIONS,OP.120:XXVII.VIVACE
1,666,272,781 *AF563F369D7606D7FEDBF0BF182830B41A786873
1,666,272,782 *AF5E5A999BF162D6FCB5142614A8597ED1E9B3B8 m[L/)
1,666,272,783 *AF57990FF35FC29DE473EBCA02C100D8F1845DB4
1,666,272,784 *AF59D81A0D6C6E3BD167C125F9556427B3A8EB7C I)
1,666,272,785 *AF5FAB5CDD8FFCA93BA5FC4F9B336911D562C061 }Hڽ
1,666,272,786 *AF5BBA0E97698143389CA938D7B6D34AE465AB7B dKAЇ
1,666,272,787 *AF502DCA4A1DB4BE74E383B6D2224A2BEA876871 differentieringen
1,666,272,788 *AF5AD06457467797472A86F7D66B45547F0ED407 Ҍ
1,666,272,789 *AF5EEC2D1B29C8E57FB37851E1462765DCC820AF [email protected]
1,666,272,790 *AF508D1D9B74FEF348E6E9C454C19D3FFFFD63D5 D(EV
1,666,272,791 *AF555BEFACF3EF1DC41127C08F08A8B4CEFB2F8D DEXTERLOUIS
1,666,272,792 *AF55A33F863D64B5A8ED2ED4B6F6C88D9F363643 DIRKIEPLESSIS
1,666,272,793 *AF5E93FBF194E86C8D6262B629C9136FE9A44376 DFP(E
1,666,272,794 *AF550EF71CC7291A2E4229E0B84BBB6AA3FDAD87 dfxal
1,666,272,795 *AF55258CB112A4F71ED4DC6EA5AD862E402D370C DGTFB
1,666,272,796 *AF5DBA511E294AFAB6053588EAC591B9FF30E455 Y l
1,666,272,797 *AF5031F78A8A13EAC25560C46F7883C9182219C3 DHN1H
1,666,272,798 *AF5EBD6E3C2D18961FB5BC5340CEF9625ADAEFF3 di56k
1,666,272,799 *AF5576CA8045A1557C82B64D3B6C08ADB9FAB717 (v
1,666,272,800 *AF5E48FEA151CE3D3B48BCEEAE681E7D7AF54CE0
1,666,272,801 *AF540C2E7000E943C76608D34B56201B2167D726 DL3M
1,666,272,802 *AF52F51DA4C8603948DFBC208A060CE0265BFF37 DIE-HOTLINE
1,666,272,803 *AF506EFB0666787CCE9D72624A5B0E2E3485EAC3 DLYP
1,666,272,804 *AF59FCEBF5F6DAB197DC1E4D6762C74C6AC479C9 dnboi
1,666,272,805 *AF51D9970FD31B9F39930BD6AAD56E02A0F1C747 [email protected]
1,666,272,806 *AF58C3524FECA0C5F0587CBB988933D1D16E4D4A ܄ְ
1,666,272,807 *AF58E828B5E392A17FF2DCA8909DE0BE01573268 [email protected]
1,666,272,808 *AF5BBDA76A4B231E67B16A47FACA86DFC5CECDAA docf
1,666,272,809 *AF5FBE6BBB52241448B3CEF97B7920F0FD41D654
1,666,272,810 *AF5FA19796722CED23089077F90A123F3127501E D!jb
1,666,272,811 *AF5E71F3EECCB7C7DD8D600D71AE11A0CCC476C1
1,666,272,812 *AF56C13AC7EB0D8F1BFED3BF00ED405FB43F2932
1,666,272,813 *AF5F05B8DB9AFA5E9DE9F53F427E25BE27BE2DE7 dk1.q
1,666,272,814 *AF59DB3F6B7669BB4DD2A8A18A9408A333CCE2CC D+KFZ
1,666,272,815 *AF5742F108015FC464871A2FEDE851ABF4A29431
1,666,272,816 *AF5D2F5EB26DF15DF59F704D5EED3BA00E5573F8
1,666,272,817 *AF5CDEECFD19F9EA0A16A5E7A3635182D83F18E2 DLTS4
1,666,272,818 *AF5730979D97B11402DEE98633488C8A326DF4C8
1,666,272,819 *AF5BEFBCB5679F7639BDEBA7DB47E6A7DC4E924F `4
1,666,272,820 *AF5C53B21525A8B67047157F369D288199717E6F
1,666,272,821 *AF51DE82E4BFF48080DFB34E47337612265A9DAD
1,666,272,822 *AF54865A3E7731D7A2696D1F48C9FE6F05DF3D2C
1,666,272,823 *AF52AFCBD57B6826850A3EE412ED615F04FD0886 d&mue
1,666,272,824 *AF54CD9DBAEC8B3A4DF458F738FD0372FEDCED07 5B
1,666,272,825 *AF5CD7285E489E18F8961FD95D26ED4F69D07EF9
1,666,272,826 *AF5775505AE9048F6DBB210AE609674DC13CD2C6 DOCAD
1,666,272,827 *AF5F126E208E2F7755157DC2316664F987BC86C6 dqw+7
1,666,272,828 *AF5102EF32E3426094236F632BAECA128B867382 DUE:
1,666,272,829 *AF51622D7C6CB50972E9F8E12B0D24AED02D6501 10 WASCHBRETTBAUCH
1,666,272,830 *AF5756653C0B59BBC5093D196CAB8C3EA692B7F8 dsqeq
1,666,272,831 *AF5F4FF8B78741DB39F5B093BA0CF6D67BAA7281 DYNATHEATER
1,666,272,832 *AF5018A8E96CA9DB4488600D5889064D812918FB edelsypress
1,666,272,833 *AF5F65A2915D95AB56C935AE2263C6ECD6F7DE7B 1517983 diesituationistkrass",sagtwillikohlmus.
1,666,272,834 *AF5553AB9AD099C90BDD8C40A2515351CE6077B1 duncehood?
1,666,272,835 *AF5BCBE97EB397B6E7EAB746055E22FEF53CBC37 edu5g
1,666,272,836 *AF5E99A1D95CDA0FD74984C8DB687EADC8A81EA1 EEOBS
1,666,272,837 *AF5966E16D437082695A566B074E50DA79477B16 EEVASSA5
1,666,272,838 *AF5D01555F7791D15E03280962837B814E434878 EA84
1,666,272,839 *AF592D0384D1A0606E1BD7BA4811A36E947CD7F0 1 eckery
1,666,272,840 *AF5B552E7831887E241A1F9421868DD8FA699986 1.ettirmistir
1,666,272,841 *AF53DC1D88DFC4E682C53A2E2276D49D86C59654 ELISEO.HELGET
1,666,272,842 *AF56590147E1319479F320C3759EAD1EB75D3B64 EDITION.TRANCE
1,666,272,843 *AF5B3F2EA4C82877A249019D2C307ED96F346D9C 1 KOALITIONSAUSEINANDERSETZUNG
1,666,272,844 *AF560DAB853F245C7989C51BDD9DB0C6DEF9A0E8 1-lamavaalit
1,666,272,845 *AF563FDF3BCA671C111D2339BACB43CD556F01D1 EFD5C
1,666,272,846 *AF5E6776FF1177DB90939760EC2B25F5B9B7F017 EFRW
1,666,272,847 *AF5BDC9A308A142070A4DDA17F3D34B612284AA7 1.NELIVUOTISENA
1,666,272,848 *AF591B31CCF00648801E3DA6B1386350E18ECAB0 1NT3RM3D14R145
1,666,272,849 *AF5F23985293E04BB6DF0A12F8C9E7004F10CE7B eltonrickford
1,666,272,850 *AF5C4CD1EF9CA225791CA2D8317C383BA0FDB4BC 1OPISTO-OSASTOSSA
1,666,272,851 *AF501B7F516C819EBAB3731DEEDEFD82051F3311 1ORLYBSW
1,666,272,852 *AF51832AED036CA125F09210149502E7F23DD7F2 1 PALKKATY
1,666,272,853 *AF58708AB5424FCDCBF67BD0C1F6A9C1448F710C 1POTAT02
1,666,272,854 *AF5B9CF685C05C6FABD05EDF19BC24AC7551B08C [email protected]dspringcom
1,666,272,855 *AF52D750FA550FCE290F26C9AE59993BFBB25245 EILA_22
1,666,272,856 *AF58155B11B7F1522F4E44329E91FF75FD88DBAF emorykubica
1,666,272,857 *AF533774413FD882F86733A3A764AF1F97C4B203 em_t1
1,666,272,858 *AF5D8AEDAFD66E2A037B7F0E131003238303C615 el.
1,666,272,859 *AF5E1D32324D7BF6925CF23EC4398EFC956B33F5 1-VERERBUNGSPRINZIP
1,666,272,860 *AF59986D50F79AD17BF163E4821EE0A8C4813B4D 1verkko-asiantuntijan
1,666,272,861 *AF5E2C63865AF739099AFD20A4D81EFE77353F86 ENERGETICS-UK
1,666,272,862 *AF5DE16DA259410D3F6D854B0EBC4F46808227D1 ELENA-OSOKINA
1,666,272,863 *AF5A328639B67B8A12CF2E8DD9548976AD4970C8 1WHUDDER
1,666,272,864 *AF5FD8CF7250321C8ADFA29DBC35BCA8BA75E571 1-WIPAK-RYHM
1,666,272,865 *AF520C1A3C85D416E8B129536FC4C275CC5B71FF elisabethguenzler
1,666,272,866 *AF5342E43CB0A6AD86A6EB4E111D6013CAE66235 ELMO.HAFLEY
1,666,272,867 *AF5E5D370B5CF4E30A116A41726E325A9F5F2D11 erica.neely
1,666,272,868 *AF5D98DB8DBEA9A5B96CC3CD736C57BA6BC73D25 208555 kun muuttujaksi otettiin asukasm
1,666,272,869 *AF5D5B51802B836C9D2936CF7DF6B1FE16757C05 E>OQ
1,666,272,870 *AF5BE37C7EC0BB4EDD0112F4F17A6AC913637D91 EPPANKDL1
1,666,272,871 *AF5C23B2B0F517989A5E4F0F6B7D3CB6676E4EE3 erichgranholm
1,666,272,872 *AF578BD7D18FB08C80705805A435E33741D7466C 2308440 pisarankokon
1,666,272,873 *AF52F57B569A26E8EF0C7BD2CBCCA7E4170B1C4B ernisait8
1,666,272,874 *AF52745263E2335EEA9353D7A309D578F4B804D6 EUSKOTAR4
1,666,272,875 *AF521D09C8486BAF53DA17D0211CD24854D269A7 27040k
1,666,272,876 *AF53BCF588F7D1F86EEE8563B5E77AA68BC33F7F 2-ERTRAGSWERTANALYSE
1,666,272,877 *AF53089872F7A74B2971B597285BA0604E60FEB6 2HOLLANDIA
1,666,272,878 *AF5FD85298C99C03B07A05107632DEA07E4F5F5C 2 kesell
1,666,272,879 *AF58C1BF9205F5674848269AC30339F2E08A58B7 2LIQUIDLE
1,666,272,880 *AF5F0A7E25362F8CE798AF8E63C11852B7E3AC1C 2maalinteko-ongelmiin
1,666,272,881 *AF5819F5B869D809A6AD72E3797D2C89D1411C6C 2.rillumarei
1,666,272,882 *AF51DE1C3788D209F94BD309877D2DFCFC789F96 2-selfsufficiency
1,666,272,883 *AF52783799A7F8B1D7023EDBDD84F4C387A328A9 ezekieldecraene
1,666,272,884 *AF524A65A84DC186DBBB63455AFD0AD27F269443 europeukonemorefortherogue
1,666,272,885 *AF5DF723F5462A9E98A76D093B6204040761D795 EVERETT.KULKARNI
1,666,272,886 *AF5132D1AD2DF76E4F5A25092F102C6682C5909A 2[[USER:INVISIBLESUN|INVISIBLESUN]]22:20,8JANUARY2009(UTC)
1,666,272,887 *AF5FFC3F3446448CF2479CA143E14A7F1FEE5D9D FABIAN.KEDRA
1,666,272,888 *AF5BD13C4A279C75735A0C7FB29D539BAE1E14E9 fabiansheltrown
1,666,272,889 *AF5215B5ECB5C344E1A14702795FDD322E707531 exigently2
1,666,272,890 *AF5661C12DD220D731BD03A585CFD4715A8A3D43 exrllbsw5
1,666,272,891 *AF507CBEC176DA2AEA0045980CA87A7B86FBB0EC [email protected]
1,666,272,892 *AF5ED64B01977B963CED30D2E559B22421D3B4C2 FANSEEP
1,666,272,893 *AF56922288307C1BEC1F3CD479BA20EC35E013EF 339carmelo
1,666,272,894 *AF5392896B63622C38F36082F3FE1F5945BFDF51 FARLEYHALDREN
1,666,272,895 *AF533D4C9C21AAD2F0B760ACF3CF9E16932CB5A4 356441 L
1,666,272,896 *AF528CA68D0CF56E6BC23443E25385169A62A846 ey8t!
1,666,272,897 *AF593DAE9E00613894A0B7E14834FAA08F55B04E 3CIRURGIA
1,666,272,898 *AF51D2375371CC348D8B5EBFB20EA7EBE6107041 3#####d ~ ` (><)
1,666,272,899 *AF51E411B0B9A28BE4BA989E72331EF146C5010C felipegolaszewski
1,666,272,900 *AF5E5C09DC505C06F165F2C0A1E6969015AF43FD EZELSOREN9
1,666,272,901 *AF5FDEADD478B171F95D124770D6711CC410A9C2 [email protected]
1,666,272,902 *AF5B649E3F2F0C131242F252B689AC993B3CC30F [email protected]
1,666,272,903 *AF58325727C5831F51AB19EADA1B7368F244C918 FG9E
1,666,272,904 *AF5DEC75EE1D8A6A3B9F1E0ADCFC8DBC68FC1B5A 3FGMETUD
1,666,272,905 *AF56EB016C4F7A8222376672FFD216BAF534E798 3ISKOGUH
1,666,272,906 *AF58A195BFC024B74F2802622E5FACE3926720D2 3KLESANOG
1,666,272,907 *AF5EF123E9EF53DB896390D88BBE17B49319A5A0 3-koskenutkaan
1,666,272,908 *AF5A27D60ABF0D1B7656D2D950A5D1B1BABC62A1 FIDEL.TALK
1,666,272,909 *AF5793337C3B98816B31E59D6752D49AA090B0A4 3#>.~O.~oo->-<
1,666,272,910 *AF55B73240BBF99CD4099BB0587AB593E624ABA0 FIREONTHEMOON
1,666,272,911 *AF507CF1F67E48F5890ABC770EA132C8359C5ED0 flugger4
1,666,272,912 *AF5792865E4A98BE77B958D4B9E05B3B16EBD8DA 4AKTOIDEN
1,666,272,913 *AF5C46557C71C35BFCE4F02548DB0ABA3DE05836 FONACHU
1,666,272,914 *AF5C489DC2A4653DC7BC76CEA76D463D6823A083 4CIASARAH
1,666,272,915 *AF5097147DC1BBEABBB267F8A946F534CCED1D4C 4GRUNDUB
1,666,272,916 *AF5CC97AF46DE30B7AE651041E2215F5CF633F82 4herries
1,666,272,917 *AF52AF30D7BCBE95732983446E36B30A7EFD292E FRANKBLEDSAW
1,666,272,918 *AF5A79D6ECEF1943188D3BDE755BC3931C4B9828 FE+IDNE$$
1,666,272,919 *AF5C25632D1135F2A977B66A24C1FA58BAAD0A1B fredericwuensche
1,666,272,920 *AF5B937D33877F9BCF92097D6372F30ED9EAF1F3 FREED-OR-BOUND
1,666,272,921 *AF5FB325EACB1BD0CFCFD47971F4E077765565DC friskluft4
1,666,272,922 *AF5339D41456EDB590FDF6BFE63A678879B94752 4REPARATURZWECKE
1,666,272,923 *AF58BD70ECDC0BD773CCB8888731C79B6ABE1375 4ROYALSWICKED
1,666,272,924 *AF581A91EB50DF2315A1968F149402D13393D0D3 G6ZO
1,666,272,925 *AF5B62698F9CC92E6A45DF920D7C337029F7131D FILTER & THE CRYSTAL METHOD
1,666,272,926 *AF57008901DDF7413F2CFB3FF1B6B00D2625C556 4THATSPOT
1,666,272,927 *AF5534302B4639B86405BF8767DD69DF694A52EB [email protected]
1,666,272,928 *AF5D4A8E20DE2DA65C28D799C4EEBB434F441F83 FLEOC
1,666,272,929 *AF55E6FAB78FB2C20A6271A576250EA9FBC70E0B FLEXKIR
1,666,272,930 *AF5B0C15B47F0A99971D04E168BF2BABF818DCDD FLÜGELFALTEN
1,666,272,931 *AF5CAA7D72F79E1F83AAD32E61700BDB9E9F6920 folguerúa
1,666,272,932 *AF5E7EA8A2A6F631BB51EA88F74904F4418CC97B FOREST.SHUMPERT
1,666,272,933 *AF557F15077C9852079FA7852CC7E52DBE528AB3 GAYLARUIZ
1,666,272,934 *AF5ED82A4C5EDF5F89AA9E8FC87DB6C6C775B343 5CINEGOGOLHP
1,666,272,935 *AF543974E71855938F18044110878249EC096B9A GERARD.MALOON
1,666,272,936 *AF5CF10B470F8DBB9EA05A41CBE5562DE5BAB8C1 GERARDOLIPINSKY
1,666,272,937 *AF584066AC022F8C1555CC0F46BAEF55F4373E9D GETMONEY39
1,666,272,938 *AF53C9DDC0D53DE5841063AF1C0A379C4EE74134 5HALKEILLUT
1,666,272,939 *AF54EB0081441675358E69E666C8CBC1BADB389E fredopoya''fred
1,666,272,940 *AF5865C6BB4553FBA8E0D1B2133A22B2308878C0 5HSIJXRLP
1,666,272,941 *AF5F715DEB4BECB90748848E13705E67C2E1C695 5IDIOTCORWIN
1,666,272,942 *AF5F1A36A7E9EC07D7CD0FFF53C0E8CB99577339 GINOHOAK
1,666,272,943 *AF5DF73DBDC1E9EC2235C0D13B7D6E1416F6D102 GIRDIK”
1,666,272,944 *AF587DD22E058B0D91EEE4B87E43C4048A3AACE7 5LYDETYIST
1,666,272,945 *AF52479F2DF055A535B9D3004F5719B82F993FE7 GODZONE,-VOLUME-3
1,666,272,946 *AF5EC65B48D71C48CAE78D5D9885D06600210950 GRANVILLE.KEMFORT
1,666,272,947 *AF59FD0EA7502F2DEB44FF409CEFD9322353EA9F gratinirozás
1,666,272,948 *AF5D5D568629551C1E95C8289B9DEDC4578D83FC 5OPPSTARTING
1,666,272,949 *AF5949B5590C14541D49E2F6F377AFD363AB60C2 5or9fiveevolvedfromnine
1,666,272,950 *AF5D2BA030557894CCAFA93788379CA07168375A GSTAFJALL
1,666,272,951 *AF5935ECE666B79A6B721297AEACC10DD41AFFB4 [email protected]
1,666,272,952 *AF50F53D30DC3E8CD2CFD3CF4B672AEBC71E469C gwolu
1,666,272,953 *AF5E8BE0F174B11ED43D82139DDC4E02922DB924 hassanradcliffe
1,666,272,954 *AF520C46FEEEA50653A7A0C956A448FB5EF12414 hatasizy9
1,666,272,955 *AF5D910303A4569B3588E4CBF18F25EB3B45718D gailsaranzak
1,666,272,956 *AF5AE5C1F86BDDDA09E821CF4A5400EF9F8A8C83 GALERIAJ
1,666,272,957 *AF52089985EC31C168C51756AD10825E74458E00 HEAVY-METALJONGEN
1,666,272,958 *AF52A32B4FC66F28F4B9F1863359A42C58F96AE5 hebenatka
1,666,272,959 *AF5C1BD7B51E8E84DBF03F5E7CE7C7C0A6B382FB [email protected]
1,666,272,960 *AF5D28429D62B806EAF1DD000C1CED39D42B547D 6 CRUISES
1,666,272,961 *AF58BADB9A4EB0553B01E606590BA45224E42A78 [email protected]
1,666,272,962 *AF58D85AD9B799789CE06111A5FA6FD2AA7E813A GARGANOC
1,666,272,963 *AF58F01781E3705B31AD30990E4C78465447C4DC HERKAUWDEN
1,666,272,964 *AF532BF0DF81BDEAE289898E66D13945EC53E7F5 HESOTHO
1,666,272,965 *AF537EF1C4237DCBF2E482B0F05F2EB745810302 6MIELEWSKI
1,666,272,966 *AF55BA85BB9205CC357D5F80C7F81AB79A8EA2FA HMURIA
1,666,272,967 *AF55299A004D418426E9B98ADB5F6C5596818FAA HOLLIS.COLLINGTON
1,666,272,968 *AF59A581AF137A4E0E03BD043E8946241F409803 GERARDO.CASTILLEJA
1,666,272,969 *AF55D562A31A69E1BB500CA740D1EAD1A4B92BDE GERMANHOLZHAUER
1,666,272,970 *AF587355CE2923061E11B2C049E7FAF490EB3550 HONGWILKOWITZ
1,666,272,971 *AF5FD9FE9B7C8F4D9FDEB896D9E25027100795A6 [email protected]
1,666,272,972 *AF5DFBDE71F28B01675D7881013F13E0802FEB4B HORACIO.THOME
1,666,272,973 *AF5117615D98631738941C78C479E4138738FFFA ghk5
1,666,272,974 *AF59D7429E0B5B45A0D2B1CB5F98B54C918B96B6 6YREQOFRKANLC
1,666,272,975 *AF55D2436108531658EFC8603B1C2A050154A64C 71PRICK
1,666,272,976 *AF59234A29FAF41BC92060D4B1992AB335DB7EF7 725442 FORSCHER HEILEN ERBLICHE HAUTKRANKHEIT IM LABORVERSUCH
1,666,272,977 *AF53D339CF729890A29F35DD9A71AFAF44C4483B HPMC
1,666,272,978 *AF5425D5AB03A6377BF72E87702D8DAF728C4A98 7BUTSEEMINGSO
1,666,272,979 *AF5B7A2137B43DE01621915A43638FDEA99F16BE 7CS1
1,666,272,980 *AF53DB04C4AD3307A0B666F5DB0D5C735803ABD3 HXYA
1,666,272,981 *AF56FB026C7F779963FF81D020914B254F976546 IAMALFRED80
1,666,272,982 *AF5960B659D1726CCF70EE8E346D67231D79F6B9 7JULIAVICKY
1,666,272,983 *AF5F20816D9BEB26CE33DE0C99B0F65440CAB5B0 7lajiliittoja
1,666,272,984 *AF5AB598964057E55B01A99A30295CD7B5DBBBE6 7LETOUNU
1,666,272,985 *AF593D3A2501710799A6A3549FC1B1672EC966CB IAMHOUSE93
1,666,272,986 *AF57B1AC65305B7EC2B52ED8B74B879CB9B87A76 7OUTSTANDOFFISHNESSSTOLIDITYSTRAIGHT
1,666,272,987 *AF5E1EEE19DCDED91BB5E7D1B19D4A2A4600525F gregoriopody
1,666,272,988 *AF59211396C1320F42523BD396E2D5EB7A0D3C4F GREG.ZADEH
1,666,272,989 *AF5F1D63A59F04CA59D4D69371D89365CB385B32 I-Can't-Stay-Away
1,666,272,990 *AF57718120043CE16FB91F804D49920B88EEF6DA groomnorwichterriers
1,666,272,991 *AF58FAA2E9BE0194E1215216B5C58CA01FC3401B IGALLAGHER
1,666,272,992 *AF5A8BAEA0377D8B11EAFE093F224F42C190803A GTEMIIFED
1,666,272,993 *AF523A9C5BE7C2E1725D190B85915273CDC55467 7SCOTTSUNRISE
1,666,272,994 *AF594279BC4D7E0077C300D8EFAF0541A9B3873C 7TORBSSIEW
1,666,272,995 *AF50DB707C2F86EF16A02F51B614F8706FE4FEA2 GUNDEEP ARORA
1,666,272,996 *AF5CAA5F3570F5BF2B30ED3190C32FB9F258E331 7VOLITARES
1,666,272,997 *AF5FD2CB2F5EC66CA771623708BB2ED114EBF8DB gustholen
1,666,272,998 *AF5BB256927F969658D5BCC9B153075E6AE0677D [email protected]
1,666,272,999 *AF5CD2D0DC453CE8E06C2D044014855EE777ED2D gXL
1,666,273,000 *AF5D828850645B74B2B9AED073DD42EFAFA9C42B 829707 in`cambell'soperativeorthopaedics'
1,666,273,001 *AF5298E36A49745013BE9C912478983308861A56 <h3><a name="hdr15 3 7">15 document overview</a></h3>
1,666,273,002 *AF582F353EAA2C97508635B46D99331F36CC9178 HALAKATI7
1,666,273,003 *AF57F1EEBC5AE867ECD7B1C96E5FCB97B4397075 hamada-elbanna
1,666,273,004 *AF556E88F4A68853D4FE18147575304CEC41B170 ILUZJE
1,666,273,005 *AF5D8268A352C352FF45ED371BC79CA3F1785E9A hankdigiacomo
1,666,273,006 *AF5FB2E88A4BF256B5BD208E42F3F2D4378C434B IN+}
1,666,273,007 *AF5164C74893255621AE7F1C05B18EBE727DDF9F harold.duran
1,666,273,008 *AF53909BCB89F78025A42C1F37242CB19B040639 HARRYLILY
1,666,273,009 *AF5BDFB290779D5207B659E9846582595745D2DA 8E$TREAM
1,666,273,010 *AF5CB26E26072E63C0F1F52F7DD7C184C7D638AD InventioNo15inh-Moll,BWV786
1,666,273,011 *AF52E705140449CC05861D3C0E39B69424D14B7C 8GRATTECIEL
1,666,273,012 *AF5B867DDFAD4A286562C2033E98D531094AD0FB iraheinly
1,666,273,013 *AF5DF72A34C41E92D1F44D9619ABAE9B2C5C4095 IRENEMOON0
1,666,273,014 *AF5DEEFDF2918B6FFAD7FC294C303840157DBC70 ISIAH.CRUMPACKER
1,666,273,015 *AF5BB13D671A18F2997EA92B81144357BD233471 8!L!OUSNESS
1,666,273,016 *AF53D210B9420928EA8506C90B7FF6634E95C1DF ISREALWAIDEN
1,666,273,017 *AF58DFCA27443AE1D6AB151C4B0E148E1D73EB49 HENRY.RHEIN
1,666,273,018 *AF5343C62A54E4FAF94EB6F223985F5552212EC4 8PRACHPRACH
1,666,273,019 *AF5B497E5971FB186C7A9F9BAA1BA8B115E12F12 hermanh2opolo
1,666,273,020 *AF527FF1DF1F28D0CB3C5AE8AB21B8D79C81677D jacquinha
1,666,273,021 *AF55797050254E98B3DC591E6A22B685A2787C72 j'aivu(versionlongue)
1,666,273,022 *AF508BF11E8E2637B81D3DFFCABB4D521B3F26B6 JAN.OQUINN
1,666,273,023 *AF59001F9B790E81C2D140E86A20FA4EE268176A JARED.BODENHAMER
1,666,273,024 *AF5363F56BE346162064ED5077B0503C90A36D44 [email protected]
1,666,273,025 *AF5F825B8F0880628C6F1C5E1FF0CC1921992A50 JARMEINING
1,666,273,026 *AF5FC70987D4F67256717F2D281787CD1AA6F202 HIVRELATED
1,666,273,027 *AF52F9F52C192AEFB5B29F7A6816378CC9A686BF JEANELVIS
1,666,273,028 *AF545093F6AF1469FD8E9A80BCC26693CBBC02D3 JEFFKATS
1,666,273,029 *AF547F667995F514936FC563CB7BCB4134E00ECF JEFFREYCRESSY
1,666,273,030 *AF5E86A814D55F0AE8D8052FC35DAEE7B9BAB540 JEROLDALIOTTA
1,666,273,031 *AF5A42596AA7C77D6F5FC601CF99F9ED0001B07B JEROMYSKEELS
1,666,273,032 *AF5644D1F5E6581228CF44C6008DEA47328BB929 JERRODANGELINI
1,666,273,033 *AF5CF7C96FEA9BA49408F3B4DA520ED996003CAA 9DEBTHCAW
1,666,273,034 *AF5256D62427F41EF41BB2FA2D2034220665C046 JERRYTICHI
1,666,273,035 *AF5C6359FD3DD34B5D59716F995DAB5910145F23 [email protected]
1,666,273,036 *AF5956E3F2BDE5E40A1E9038CBBEF6CA25909C66 JESSIE.FULLER
1,666,273,037 *AF5305A99FAB19F0FD3E621DE039B63E317D3364 [email protected]
1,666,273,038 *AF54CA05FDE9F1068780EC0CF093A44977B964A7 9GREENDAYSWEETS
1,666,273,039 *AF5D2456EEE2BC1162B8836E9198863CBED4DBDB [email protected]
1,666,273,040 *AF5DCFDB3E182879E06C29FE6AC771F6DFB7C61F [email protected]
1,666,273,041 *AF5BE583EE20194C361A9B901D638DBC8F4569BC HPOCENYG0
1,666,273,042 *AF59FD4B65908CB7C9FAB19A24563AE4712258D5 JIMCLUVER
1,666,273,043 *AF56553A947185253CDE30E33B5D99EC89D9BAC7 jimmielambrakis
1,666,273,044 *AF59A18AF7978CE098323C6988D9DAB9591E62C0 9ISKUSENJU
1,666,273,045 *AF51D514F5FC4FAD1742CA49B570C689A0E47D96 jinx1830
1,666,273,046 *AF5297F73FB3EF1ACF11D2FA7F42AC11C5662D90 9MYFREDDIE1
1,666,273,047 *AF5FC30702345E222DA827F7C30341689F4131A4 [email protected]
1,666,273,048 *AF500F77083DB762549186D1413C4CCF2A6304E2 9REFOUNDCOPYDO
1,666,273,049 *AF56B25A27C85D8A2CAF666230A0874B41D3D5F2 9RESSAIGNER
1,666,273,050 *AF523F8F49B6FA242A2D7149D95F6D7C3E8BCD0B JOE.SUMROW
1,666,273,051 *AF50DA4BE27E19459D4F533ADEAE09DA2FF1A6F0 [email protected]
1,666,273,052 *AF55C3A9DB4E8BFD6C14A355E238CA145DBBC22F JOHANN BERNHARD WILHELM LINDENBERG
1,666,273,053 *AF5517E38650DBC227CEA41381556F1863042627 johannnabsw
1,666,273,054 *AF5C84C3912297A54B51559CFE03DE7C9286FBA0 9WALLEYESOPHIE
1,666,273,055 *AF5B42D38B98E385AF2DEF70897B623546CF29DC johnsonsibounma
1,666,273,056 *AF51981FE6A6DF8DF78D6163E9930A77A74F697F A18D
1,666,273,057 *AF542ED00A1D00D20C283E3D17C37E53426C245E [email protected]
1,666,273,058 *AF58A486D1C08B04CAC1AA03A1B3341D791F62AF iamlucky1408
1,666,273,059 *AF5EBAADFDEB40330182C7FFD1215029B4827092 a87j
1,666,273,060 *AF5F87CBADFA8696BE68C5E5FF618626FB687CAF A93H)
1,666,273,061 *AF5C0F5827372D28FAD40B4B1A323049628931D7 aaa#[u
1,666,273,062 *AF5F166628029F0FB624108CA4FAD2C1BCA17EA4 ILETSEOW3
1,666,273,063 *AF5C53F6394D99C0C013EA0F2FC2729160D42847 incompr3ssibly
1,666,273,064 *AF5603CC205A1649AE3AADB7122179B33DF6DEE1 ABARANCHI
1,666,273,065 *AF589C497E27F5AE7162B2A28E1D07FC03169A03 INGRID WALLACE
1,666,273,066 *AF567F0E99AC97456C31BA2F22ED7A364DE41B80 INHELLED
1,666,273,067 *AF5C2D04B815ECD4938E31DA711B3F6C87BBD1F7 insudicis9
1,666,273,068 *AF5DF892A487613A49B989D45B60F9C929AD660C INTRO - FRESH PIGS AND MORE
1,666,273,069 *AF5A56B654E49DAB6F84A530CE9CA68E02E2C295 acIe
1,666,273,070 *AF5BBCC7B903BBABE15CA113143AE7835E0B6653 KEVIN.CHOO
1,666,273,071 *AF52EB3DE62E1A424407FEB985BAF216090DEE8B [email protected]
1,666,273,072 *AF539806FE32932B13A177151719B0F7006D5037 ,_k_.h
1,666,273,073 *AF59E18CFD43477073A413EEEAEC912729B99D44 ISEN-FISCHER
1,666,273,074 *AF5A5DF5BDDB17FBBF8FECD346EFA50357B5A958 ISIAH.SCHIAVI
1,666,273,075 *AF5C09E020E3DA81074DA9DFAFAA042E8C21EC8A ismaelsalzmann
1,666,273,076 *AF58B85C1F077D4C67AFF954B89C73C0B86EE9B1 ismijani
1,666,273,077 *AF577D065811A5F533E4529B095F5DDD0D291CB8 IWYX
1,666,273,078 *AF5C1292E96F94C4D34631459F71E39547E5A64C k<qs
1,666,273,079 *AF5AEE4502C80E1548B81AA9275BA780D175E23A AGADADASH9
1,666,273,080 *AF52A2B69D0B099DD0138993F7A380C7AB9BEBAC agvlakkig8
1,666,273,081 *AF5824D20EBD981C3ED68BC56FFB9722B586332B JAN.MAURIZIO
1,666,273,082 *AF53CC421D100BE67E3F7A41F29AD0FBEC3B9D20 JAN MCMAHON
1,666,273,083 *AF5BCC4175099815F979E964C381603689D69E66 JANOLAF1
1,666,273,084 *AF5D537170A279B5E3BCE998DD88260A3FA9113E jarrettpicini
1,666,273,085 *AF5455C04680117D050EFB6E39C20A4D59257BFE KYLEHAUBNER
1,666,273,086 *AF5F7B4765131C581083FCD4BC5A6FA1863A5585 ai$#4
1,666,273,087 *AF58ACC4C9BECAA5830276EC2D447E33E4539AF4 LAKATUNAS
1,666,273,088 *AF5C53F11803B05DAAF41E7AFEF92BE0670F3E15 LAVERNEHUSENAJ
1,666,273,089 *AF57149DAC554C34CDA0755AABE71F88E8A3EFC3 JERRY ROBLE
1,666,273,090 *AF52174DB8894906D5B2F4BD144DD0C97E21AC27 [email protected]
1,666,273,091 *AF542B65664ADFFE50634BBC240473D713FED0F6 ALCESIO
1,666,273,092 *AF543E860FAC8966267DEFF323E2E88B44143410 LBIE
1,666,273,093 *AF5C6A6F8B360B92A0C7E6C1577B58D7D3033707 JGGJGJQ
1,666,273,094 *AF5ED5A513996F645B22640102240AAD80021B70 lefepubtieums
1,666,273,095 *AF5535BBF5316C4FDFEE10790703F7BE771908D0 leifmollenhauer
1,666,273,096 *AF546DFC36C06009276E9C5925CB82AAB3390C05 alice-wikstrom
1,666,273,097 *AF581BFB0D5BF45AFCA643BE79EE58DBDD5AA924 [email protected]
1,666,273,098 *AF57E657EE6C2F4F03CC99DDB3D6B5AEA8568CAA jimmyclowes
1,666,273,099 *AF5CB48635B510E4208F904830A571A6D394169C JNLZ
1,666,273,100 *AF5A41A8D4C9CDE44084EE57C87ACB92468765FD JOAQUINGAILES
1,666,273,101 *AF53B70B0EB331ADD153A2FAB423ABD3AD93AACD JOHANNESHAASBROEK
1,666,273,102 *AF5FF886F1FADEE7EFD3D1C09C816D63DDDE630B LEONELNEYMAN
1,666,273,103 *AF59C61C9487FDF6F04B052F6F3A38FAA680920C ALU
1,666,273,104 *AF596050BCF91E60068864EDF57C3BD446EBF098 JOHNNYWESS
1,666,273,105 *AF550895A7F9696B3DEBAA5DA5C8945BC327A477 [email protected]
1,666,273,106 *AF5C019D87C36A6C86FA344D106947E86350DD9F lespi
1,666,273,107 *AF5A71CCDB5204239BFA904F47C0866308C8E825 JOSEPH MICHAEL DAVIS
1,666,273,108 *AF54F112203771D51CF7C41491864A738B44E0CF AMIR AJDINOVIC
1,666,273,109 *AF5EE5F2639E49CF30E198FBBDA759F2E9FC545E JOYCE.KHOR
1,666,273,110 *AF517959AF36DCBBEBB661FEF7F302CE34AFDD6A [email protected]
1,666,273,111 *AF59B5EEF3D2184A568B213DB729C0CF86B1D8B3 AMULN
1,666,273,112 *AF5C67B7E73F098B53EB9369EAA92BAAB9E7AA09 LILBEACHBABEE
1,666,273,113 *AF5A3F304DD929D5B4930D10C21FA451DC0CDF3E JUOTTAISIMME
1,666,273,114 *AF52032BC8FB2474DF7D9C2C2A8331B2D31E2D13 [email protected]
1,666,273,115 *AF597F0D1151CD4BDD18D0C568B561C2F04E5C32 lindseylewicki
1,666,273,116 *AF5C09ECADA98E7C8C51A38E187E8919DBD6BCEA [email protected]
1,666,273,117 *AF579715268FF26D9E1D7B3C8CC3B5E9DC6E75BD LINO.PASAYE
1,666,273,118 *AF5C84416CC0F98D41358263121DC1F36547BCDD ankur-gangal
1,666,273,119 *AF515CD9A4E2344C4865D2E471FFF245DE864982 LISA STORRY
1,666,273,120 *AF5A83544436213AD9DAD21E46EEAF3A9B7F4C4A annunziero6
1,666,273,121 *AF5D3EFAB87B68651DDEB914E62003F4A234D6E9 katie.rue
1,666,273,122 *AF5356CD73E841A89F12B9BBB576B18969B2E74A KATRINA.DRISCOLL
1,666,273,123 *AF523BC7CB0F04A37868936520B3B065502C5E66 kdfarsers
1,666,273,124 *AF5EEF620A5EB561321E1A5FEA5A916176BC82B0 KEON040
1,666,273,125 *AF5907CE43346D74689FE381652FA7FDB3F7FB30 keys-h
1,666,273,126 *AF53333A41F8CFB5D4BAD9472E9E31B4B192222B LOOSLEY2
1,666,273,127 *AF5EC1DD4C39A5AAB18B53BE0187608222AC1BB5 aqyia
1,666,273,128 *AF5A8310B6CA9780EC67A67251FF0010C130576C ARHB
1,666,273,129 *AF568A40F95193AB272BB12F0980323FC6245AD7 kraignixion
1,666,273,130 *AF5D5A1CC3D4E90089CA51EE72A1E05E50006744 KRESATI1
1,666,273,131 *AF5F23184FE7867E5804CF0353D9FF8367EEA978 ARONNOBREGAS
1,666,273,132 *AF53D22A745956895C6993C10A87C325DBFC53B0 «L’SS»
1,666,273,133 *AF5273D2BD2AD2D508475554A5B93ED1E16279BE lucasgluckman
1,666,273,134 *AF59130F0297D2CBDBE1A5255859080176FC3B09 ar:td
1,666,273,135 *AF5DA61588AECEC58B35F9CECAF58416C29F7427 luciusrotando
1,666,273,136 *AF524CEFD3BB8401F74C22CB97D55E7431CCB0BF kulejący
1,666,273,137 *AF5D7C697EDD4CA3478E5D366F2D1C77FA6B10E6 KUMIIRES
1,666,273,138 *AF5B3BB2ECFC46B5B6329B8B03340DFF2931ECC4 ARYN KING
1,666,273,139 *AF540C0A67142D3F9408A3AD6074B5FD469B2520 ashraf4.
1,666,273,140 *AF53601D9BB43864FDB666F19875F167A59592FC ASHTON-LAKE
1,666,273,141 *AF5778CE69A7C3FB7860F5E109DA9B781A5F8DCC L2U_
1,666,273,142 *AF5B6249127C8AD762C3B6992EBB7969DF549F16 l6*aaa
1,666,273,143 *AF5C7069576C31D43A9E864DF8FE0E34267B7B0A [email protected]
1,666,273,144 *AF5DC04100D6DD27D9105A68FD9EB643A773712B asyll
1,666,273,145 *AF5EC60A73D94127AE6D5327A55FFF5B2BC89386 lynwoodwainscott
1,666,273,146 *AF500AFE574310E66465DBDA4E924E32E406F3F6 atqq(
1,666,273,147 *AF5C8DAB77CEA54AD9853AD81D35D7418C93C507 attm2
1,666,273,148 *AF5C7DB19141B914E93F318875BD840F1379FF11 LAURENCE.TAGHON
1,666,273,149 *AF51A79B006D7DB6E699CFE262BBAC2DAF3A1D7A LC(2
1,666,273,150 *AF5E05AF9261FF04A5CC947FA09F99163D3A4D69 Magnetic.Levitation
1,666,273,151 *AF5F9DC65B6E85C50AB52A513D3E7C198866BA0B [email protected]
1,666,273,152 *AF59BD714BCEA9A486AF2A74C0BC6B80DC2F46A6 MAHAAKAAYAAVABHIVR
1,666,273,153 *AF5D2DDB27FBA17A7E899FD53ACCC7DD9CDE5390 AUSTINROGG
1,666,273,154 *AF523F039C37704612A8D1C90820F73C6AA5C67C LEDEBURITEI
1,666,273,155 *AF572DD7CD4640A2E05BE53E9D2364929EDF3945 LEEHAUGRUD
1,666,273,156 *AF5A1F6EC5BD4D79F02A8FA3297BBD7CD31833BD LEIBOMOT
1,666,273,157 *AF52B34E4E2C1EAC73B4D7F7B647EC5D57B6F8CF a:vf
1,666,273,158 *AF5F84FBAC9AC551D86D8CD8366F691BA9B584C8 MALCOMKITCHER
1,666,273,159 *AF556170AB637B1252F8CFBA3B25744C896EC590 [email protected]
1,666,273,160 *AF5B614C8301A8DAAEF0AFE631443437554C883F LIKE.A.CAT.(MARCO.ZAFFARANO.REMIX).(FEAT..VERONIKA)
1,666,273,161 *AF51370F2E5190A9E9D8290910100C4DDEE4D013 mangafassung
1,666,273,162 *AF57969E0932DFD8EB35BFC7D3244C2C19492005 MANJA456
1,666,273,163 *AF58221378C0406FEE5F2ED407411F439A052114 MAŃOSA
1,666,273,164 *AF5151FA4DB18F19C8FC05AB0231762F5B394FA0 LIONKINGJENNY
1,666,273,165 *AF504E24F3DEE6CB34A32E95C479B4F12717EE97 MARCELLUSDIEROLF
1,666,273,166 *AF559C6FE680D774D7266962679058BBE2BA8FC0 AVIRAL.ARORA
1,666,273,167 *AF58A0B0CAE630C382032CE1B45017CB4683E8D3 avnqo
1,666,273,168 *AF58BD710B799523FAAACB502056A61B247EB03E MARIO.ABRACHINSKY
1,666,273,169 *AF5F9F81E8C4E96306A7057C2DA503EF76B18C50 MARIOMELFORD
1,666,273,170 *AF54D91AAF871D0993B93087DA90DFA25711A129 MARKNAA8
1,666,273,171 *AF5244B44E7EAD3C267765F5DF58D5D1D61081F6 [email protected]
1,666,273,172 *AF566F4FE329877D687A36B740DCC7794E9B1126 a)xll
1,666,273,173 *AF514F11C8BB809E5BF1E29A7BFCF23F05CEE16E AZ&B:
1,666,273,174 *AF598DB4A4EB0BD342157E318D7A1F724BFCC8C4 LYNN.ROHRICH
1,666,273,175 *AF50C1F8BC0C3466ACC97D6DF4ECE02882E4ED50 m0unta!n$
1,666,273,176 *AF544EF20ECADABAE9072E4410E1B283555EF250 b215h
1,666,273,177 *AF5E0DA9C952E406D164EE850989BCBDFA253144 B3M$
1,666,273,178 *AF5C03F793722C2FE01FAF86AE3F4B57649C8163 b43ka
1,666,273,179 *AF5C21A5DA0A2C53C90DD9A6AF6D336701EAA9A7 MCCLENDO9
1,666,273,180 *AF5D0FA722A3742E171DBCC81A61AB38C0CAFB4D [email protected]
1,666,273,181 *AF5AF7C73183F533B16860F4D4CF821AFED42FCF MEL.FOUGNER
1,666,273,182 *AF55DF9DF0F314AF8BA8E4DB10E16391A32C4FFF MELISSA-MURO
1,666,273,183 *AF5FA1E6EC2590A180D80E39DA3FE37C7EA188E5 baa18
1,666,273,184 *AF5A9B2BF6083B972D12D2B9CFADC0ED4F3E955B meohmyhowthetimedoesfly
1,666,273,185 *AF53FD7FB3623810BAC0A64A84E7437BFCB51C0A MERLINSILVESTRO
1,666,273,186 *AF55C46500404238888ED6A820C2762493A3233F mallardwatchcomwww
1,666,273,187 *AF5FB271A5B32C6033E2061DECDDF8390364948C bar1m
1,666,273,188 *AF5374F218E2C40958F2876ECC894E6D6FAFBDAC barokke3
1,666,273,189 *AF52B3AA7ACCB9E7D4EC25ABA95C66FC24EFAC06 MARCELINO.CAR
1,666,273,190 *AF52058D4BFE3B82A9DD0ECE69B1B8DBA38E3F7A basilceraos
1,666,273,191 *AF51FDFAA9CC44BBCF2D2C59E646D61584FD5A94 BASRALAINEN
1,666,273,192 *AF5203106513ABA15B6F580D14506D18CC9C76CE MILES.BOURGAULT
1,666,273,193 *AF5C117FDF6A638A18EE43BDEFB6CD8DA0602EA3 MARK.RIO
1,666,273,194 *AF56B3983096A5E70A8892847083C4DFDCB9D741 BbUi
1,666,273,195 *AF5A8536C65425811A6934EA765845D5B75FBD62 marydavisjones
1,666,273,196 *AF5971A3E2556F463789075BE791E1606DD9DDAD misnador
1,666,273,197 *AF5631B09CCB9CB86D985647A721C6A2F5683E0D MLUMINAIS
1,666,273,198 *AF57DD0EFF1C7D6CCE946B1D0B03AFD5F7D9D036 MMC
1,666,273,199 *AF5D0BE9471E5C47818C158C7FC7F66284A23FEF MODORR4M
1,666,273,200 *AF50A4FE1BBE7D7F16C2DF60561E31FB82555FF9 MOHAMED.HEIDEN
1,666,273,201 *AF53692851F26D7E3BAAE198D18269E2EA158F6B mauricioeshelman
1,666,273,202 *AF5AE8309A65CD34DEDAC97D43F6E53761CE51FC MAUROKELLEBREW
1,666,273,203 *AF53045CA1D81F1899F1A9183EE630967CF3857D MONÔMIO
1,666,273,204 *AF5605066265BC433FC7B8A5728E008FAF58BA5A MAYORIA-CREE-QUE-SUCESION-FUE-JUSTIFICADA
1,666,273,205 *AF51F701956F137E7B44F6665A01A2E41B3C352F [email protected][email protected]
1,666,273,206 *AF527FE4221ACF690D5AF34EA261C92CE98E9A05 medal6
1,666,273,207 *AF534C7AA0E0292AFB41C859BE3645BD7A232752 MOUCHEZ123
1,666,273,208 *AF5E443C7EEA8BBF38AED679F9F330321C697B98 moussavva
1,666,273,209 *AF56915915AFB1AB9AE7B5BC82E24A7B443B2DC6 BEST-BUDDS
1,666,273,210 *AF5773A9A60BD327627E0D03DF118722949E8196 MSLADYGOOFY
1,666,273,211 *AF5BF02F55E756EAA555473BA5F268BB8BC33649 michaeltrio
1,666,273,212 *AF50D5F0D6DA65FB6441D769C1F790E995C2126E [email protected]
1,666,273,213 *AF5A7F747B5A4072C19D5D7DB05E269682486D96 bicamerists
1,666,273,214 *AF594A460A722EE48F05FEFDF3C18209C379A634 N720HT
1,666,273,215 *AF5498EAFEC23C5AB7259F98DC6ABE06631B491A mikelaronica
1,666,273,216 *AF5455CDD3CA98337B2DCC3DC0AA6B8D287D2F36 bill-juneau
1,666,273,217 *AF553D13A7AF663739949D30DA7D6AAA5FDA3581 naktooning
1,666,273,218 *AF5E7BA47DBFD92A39D52D16153C0318077D213F BI,XY
1,666,273,219 *AF5C247094A20401241128730BFAFA3620F01B7B MKD1NB33SRU
1,666,273,220 *AF59EA1A85D5DB45D340E9E795CFBD6F6EA4813F b)+ky
1,666,273,221 *AF541E14B8A1B33C2F618A36FEB3D87DE6DB18AF blakethorsen
1,666,273,222 *AF5FB3538A3C6739F82C9F4D86BF1763972AFEDD neal.beck
1,666,273,223 *AF5DD8DCF91371CE120CCBB9931715EF197002DE moisesmackney
1,666,273,224 *AF50A1ED70A8194829B49A3E113A0B7E921136EB mol.majeur.op.67..largo
1,666,273,225 *AF5B8290819DCF487E9E145B6D75589FDB61C41F BLS6H
1,666,273,226 *AF5DE089E51A8E6206DB97E46245939A6736DD47 bn4=
1,666,273,227 *AF5789AA8EC0BBEA35173F263CCDE7F436894712 nichola-mcmullen
1,666,273,228 *AF5237605BDBA58A1976206C4139D0796969C5C6 bontemplanoj
1,666,273,229 *AF549F713EE5DCA200B2FB6D2EECE745AD7053E1 NICKOLAS.STANBERY
1,666,273,230 *AF531C982C1EA3312CFAA0115621A41B83DC9E5C mufudzi
1,666,273,231 *AF520A8297AB64A80D9F909417249848C5F0E4A6 MUSEEVIEROMANTIQUE
1,666,273,232 *AF5AD1E5C255F6F3C4416579BC8FA6DAD0920037 MYSUZANNE2010
1,666,273,233 *AF5AF04ECB15C4BB8E2ABB1629A3C9AA4B1BB47E BRADLEYDORIO
1,666,273,234 *AF5C9C56A8F291CB0BA50735B1BE12665866EAB5 BRADLYTARLETON
1,666,273,235 *AF55CBE1C6E875D746F8EDFC3C5E8C9B743B45E4 NOAH.SEGUIN
1,666,273,236 *AF5EA672950B47C143D0F4445BDD8EB9F4551882 NAMPIREJA
1,666,273,237 *AF5496BC6CBABB20C5B0CE23D790860443E8F159 nandan-yadav
1,666,273,238 *AF5799E46D2508F2F68CEE60EF3B128A6D428B57 NANETTE CAPORAL
1,666,273,239 *AF549D2555CD744B11B12C6D6CE29695814AA4C3 Nark-shell
1,666,273,240 *AF59A8B2F2E893DBABC96B170BD3C8F29E3A659D brandon-madison
1,666,273,241 *AF5C708484E3F4EA2CF886D4E624500681215534 brandonyamasaki
1,666,273,242 *AF55A9741EBDC90CDE3D76CBD76B25826641276C bre:,
1,666,273,243 *AF575CC9C185D768F7C20C0BF4D82E7871CA1C1A NATIONALSUB
1,666,273,244 *AF50B4F1A625CEE75CADF413EB3173190395C3F0 BRIAN-BOSTROM
1,666,273,245 *AF5ED008A79A515BA22F9E149AA6D67251385FDF briankibble
1,666,273,246 *AF558AEF7FFB46EF97DFAEA3533D703F599A86D4 NERVENZELLGANGLIEN
1,666,273,247 *AF52DF32D9AFC20A6767EC18A7A2BC62DCDA2CFE NGUYEN-VAN
1,666,273,248 *AF58EC554839F23DF4E537E04D8E529CB9BE04AC NILUFAR
1,666,273,249 *AF53DF190BEEAB0D726E67FDB6F5FF836F9263AA nnjz
1,666,273,250 *AF5A636D26FD69DA4C17CD03FA2A7D9C0A951218 NUMBERSSILVERI
1,666,273,251 *AF519BA15EE3D426148644487A67068B9BD82D88 NUYX5E
1,666,273,252 *AF59CB36FE92A81EF14DFF0CFA685AAD216644F3 BU+UF
1,666,273,253 *AF569F77067C4F28A6E4DB5D963CE0F243DE7D18 B&VA4
1,666,273,254 *AF5C57EF83C60FD83048A1FF874C4A75836FDB17 }O{-~`-~`D====B
1,666,273,255 *AF5266A1AEAE1CC4ECE5AEED3F9B962FC09114BD O.D.CATASTROPHE
1,666,273,256 *AF5E8D930FF6C0BFF668CCC041E0C0B1071954B2 OLDENDAZE
1,666,273,257 *AF50D7DD121D775D2B7468BC3AB3E69851628EC9 olenscafuto
1,666,273,258 *AF5541CE1B55A11E36F12639A2DC56200BE00644 OLIVERPOAIPUNI
1,666,273,259 *AF558EAC30F141AC56D89535D33ED4D1C8A26442 OLODOM
1,666,273,260 *AF59B4E73D92EAAB2F516B5190FBD7A528278322 C0N73ND1N9
1,666,273,261 *AF57823B72916659BBBF3C11A4948F9385184763 NZLV
1,666,273,262 *AF5FFD22F779BDA0C140507128EFE3764D78F371 c3z4xs$
1,666,273,263 *AF5E2F3CFAAF07C00B9D14C824E7251B61249404 OBJ.STR.REPLACEBYYTO
1,666,273,264 *AF5C7BCE84713F2F534EB50D72DB1E7DA248FA24 ochodaeusintegriceps
1,666,273,265 *AF528C30F96FDEF77B22C4B33BC2B533E5292466 c4x5w
1,666,273,266 *AF5250A8F9771F306D463A0A73D16BE4D1966331 C5P4U
1,666,273,267 *AF57CD8459D5436007BC82D43EF99DA7E8BA9C47 cakfk
1,666,273,268 *AF53CE5A96044693462A132962D8C16012ADE448 OMERCAULLEY
1,666,273,269 *AF50BD3B604D0DA423D418BF2FBF3CFEA8654BFF OSTEXPEDITION
1,666,273,270 *AF5176AE46F8DC2FC7799709DA6D5454C7F8422D OTTO.CLOLINGER
1,666,273,271 *AF5DC8781DC0F5545593662D9FC9B65BB8733E8C OWENDONCHEZ
1,666,273,272 *AF52AE19356F4AB49E23D2C84044A592DF7F2FB7 ONE-ATONEMENT
1,666,273,273 *AF58DB8A3515451CFEE710585593958A19F22C0C one.city.girl
1,666,273,274 *AF57068BCCF3AAC945E1FFDA1C11810E4975DAB1 P4N$RET
1,666,273,275 *AF5D9ECE8EE5197EB7655AE8F894DC8F33655152 PALEOZOE2
1,666,273,276 *AF5F90BD5C7FB4636BD444B8B2CD9B863B697372 orvalrosebrook
1,666,273,277 *AF5F51F8ECE3C8E2B19CC758BB92BF7763791AC8 cartilagineo
1,666,273,278 *AF545817DBB283D9D1E191E171CD6EB205D7C879 cast-iron-stomach
1,666,273,279 *AF523CAC51F38454F920C73074B0C682C8F46686 PASTEIOD
1,666,273,280 *AF5790EEF25C7C3B7B61AF2CDEBA7E981FAB3623 PAT.MCCARY
1,666,273,281 *AF57F353DCD4920D3A83DB40CF308CB5BC5ED8C7 patpat2006
1,666,273,282 *AF5E47F72D4940D33FBB8FF1EAFE5441F31CF48D OVOUDEIXARVOC
1,666,273,283 *AF5F8BD700943B40AD2965A4C6F68110CB1A958F CBV9
1,666,273,284 *AF575A3EF28C2B96C1AB069F8FAB9620F95103BE pageatarumoroboshi
1,666,273,285 *AF5008B0B841D32E89F75459B6A561A8619ECA38 CEN-:
1,666,273,286 *AF5117F9B8AEC49D31D4512105FD03AC9F0F6A90 [email protected]
1,666,273,287 *AF5BCF6BCACC73D52B555E0C25E84D0B0D594DE5 CEREBRIC
1,666,273,288 *AF5ACA3F2FC5EC36FF831444F68D3B7723794444 cfge4
1,666,273,289 *AF5B10EB22C804A996EC26E06331BC4D81708CF2 parzeda2
1,666,273,290 *AF50F2A17485DC753336FDC3EA2CC283BCFB8CDE chadmarinaccio
1,666,273,291 *AF5CBDE5C8810C237A2DB1D6FA782C1FAEDFEF48 paulelwell
1,666,273,292 *AF5D44B6BFCD3EF96A2A7AB7A5103AE2D86A6D89 changdaubenspeck
1,666,273,293 *AF5F9B5C8C4439CA51FEA85BBA10727E0F4139B6 Char
1,666,273,294 *AF5991F1A76DDA340FE5DF6F6E312E31B3DFED49 PENTSTPER
1,666,273,295 *AF561521EE8817A898352567333B276E17582661 PENULTIMATUM
1,666,273,296 *AF510CF6D32FFB54F6BD0C314080218E771D20B1 [email protected]
1,666,273,297 *AF5D8AE60F273BC1745C9A6128B60F2A89B9B21A PETERABERNATHY
1,666,273,298 *AF534D15D37CC32513138E89CC2FDF096B5DA6EC CHIPCOOL3
1,666,273,299 *AF58F78EE459AC0394DE1C0175B57BA64DC37119 chris-hanisch
1,666,273,300 *AF5CDA7ACE14DF2578DAA50CA6C22046DAE0ACF3 PP`~ (_0)
1,666,273,301 *AF5A25CAE027C591B23809444DB2DE295DB68ABA christmas.reindeer
1,666,273,302 *AF5CD0E27B1219001F6B1A825143A76FD62373A6 PP *)X(
1,666,273,303 *AF56D935E3F04AD80F5DA7E8A6065E7D40372DF6 pierreleung
1,666,273,304 *AF574502D7FF54D4017AFB07EAB66763CC76DB68 CLAIR.FOLLICK
1,666,273,305 *AF5B465DEDF8F9A8EC328BE26368C74DCF05A230 P'TLL'
1,666,273,306 *AF51BA4A8F6EE2CF08E9ED334C32576C9CF1412B [email protected]@11Y
1,666,273,307 *AF5FE853F5C3D7CA84797484F9189C1C26C4C8DD pylori!
1,666,273,308 *AF58A0E78D1F60323FF0417B825A67681AA7409F [email protected]
1,666,273,309 *AF5E92DEF550AE501B9BF220D3D2614796ADECEA Q90170
1,666,273,310 *AF55FDF469B594910BF5D41038B3E7D54F524BAE Q======B~-~3B<-
1,666,273,311 *AF5B4B27ACBC5FB4ADCD4B7A2A6E504D6F87F2CA closer.to.you
1,666,273,312 *AF59608772C8A5E8AD5910B3D642DAAF2FAA62F1 preludeineflatmajor,op28,no19
1,666,273,313 *AF502257EAC6630999D95BB8BADA30C23A2BA275 PRIORYOFSION.TRIPO
1,666,273,314 *AF56B4556CE7B6DAB559C860C8B0CDB64EBE4B53 proceeclines
1,666,273,315 *AF5BE168E1E43A2744716478A6833EE9B1C3B23E PROGRAMSUN-SYNCHRONO
1,666,273,316 *AF5B5A2BED86FC55FF5947C9C76CB2B25A35E933 PSEUDOANATOMIC5
1,666,273,317 *AF55393A00E496FE67725F660728A4676C0B2823 [email protected]
1,666,273,318 *AF560BCABD749CA9E6DBA306B5406C10E57E5A17 [email protected]
1,666,273,319 *AF5E130F49ABCB938629E78FEA55A7683E2E2F16 q######@`~><
1,666,273,320 *AF55459F7125EBAF2991F01B516BD3AE0742D883 cme4o
1,666,273,321 *AF5919D6B9352EDB358022917DDF634A77929CC5 [email protected]
1,666,273,322 *AF5D57AB64659F4FD5774DD25E1049188FABB3FE QUERULANTENMEINUNG
1,666,273,323 *AF5815FB5F25B731612DE324DF2F6ECFB8948E01 [email protected]
1,666,273,324 *AF55638FF943B55B5C37476A4E40186F36F3C46C cntntrt9
1,666,273,325 *AF5DA34CAEFCA11E0D7D571F6A0FE4FA5B4B2C78 COLLEENMDUNN
1,666,273,326 *AF57214542D8745E7599839DA925BE6B2038B1E3 RACE.12THE
1,666,273,327 *AF572153CE7CFC8BAB494019C2C4DA01C3DDBFBC QUENTIN.ALRED
1,666,273,328 *AF5666A72A3F73DF260B0AD97519793F91ED4FA5 quentinfelicia
1,666,273,329 *AF541EC1339E27897AD808B50A6FF34686C8C822 quincyfernando
1,666,273,330 *AF576930837A656AC44B55F45AE6978673D68E75 [email protected]
1,666,273,331 *AF529514E38752D4DE6C69F8B16D7FB4FAC14732 ralphsarley
1,666,273,332 *AF58FE7D76FBC864868CF05D0DC65DBF69506E67 qvms
1,666,273,333 *AF5BCFC598A4DCCF451A34732FF8CF7E963A59E5 qz=/
1,666,273,334 *AF5F4028C173DE0D032F6BC614BD01034977EB66 CÔNG-NGHỆ-THÔNG-TIN
1,666,273,335 *AF5C8C4ABC8BA6B5F4B4EA9FB2A6E54E73640282 CONQUERORS.OF.ARMAGEDDON
1,666,273,336 *AF5025D4DEC9CBC63D5CBAD933F255DF095D8586 rachel.hayes
1,666,273,337 *AF5ABAE95B0B881298B0D6337642B9565D260E8A [email protected]
1,666,273,338 *AF5D63F4A4C2AFCB17812DEE392892310166D65E RANDALL.HINDERER
1,666,273,339 *AF530CDC9B2399BF68C80443475F5C79D6995CFF RASKOB-PASTORAL-LETTER
1,666,273,340 *AF58BE309B1C7AF99002F5BF26D54D1AA00732CD RECENTRALISERA8
1,666,273,341 *AF529AE7A235ACC2D2FC71A7B03332BFDDB248C9 RECRIMINEN0
1,666,273,342 *AF5E7CB5A99F47BEAB8CA8FC58D6575CEFABCE45 raymondsaracco
1,666,273,343 *AF50FDB298DF9F5C6C9976E2A942B92287C692F2 CORNELLLOCKBAUM
1,666,273,344 *AF5CADC13B3FCDAC54432CFCC69169898E4281E6 RAZORTO
1,666,273,345 *AF505B8E7EB0C8072014EF986DD223109AABDF1A `R)BAA
1,666,273,346 *AF5D9CD2E71F68F59197EEA2498BFAB7E304F3E1 rehcsitsivitisop
1,666,273,347 *AF5BA896C49D5CD88ADA8E60E6B319E818EDE79E REMAIMREMAIMS
1,666,273,348 *AF5B8FF55BD320237C5EEB7A92D8CD4C3E39161D REMNISCE
1,666,273,349 *AF5D522CB3D90538DCB71B2DBAE1D192E18D8040 courtneyrozanski
1,666,273,350 *AF538BFE0577341142E53A0595ADE9070E75D23C REC0NC1USI0N
1,666,273,351 *AF5FBBD56D6D72E4FB8680A7AA5B174E00EFDF8E CP{
1,666,273,352 *AF54E94517A2A2127871D1BA31F1BA0791DE75A2 REUBEN.KOLBO
1,666,273,353 *AF517F04311058543B52255508C03EE1F1D52148 reidfisler
1,666,273,354 *AF5BE6D5E3729DE35F92D85BFF4F51795EDA6762 rgdsw8sw32
1,666,273,355 *AF52281C42152C82E133070ED4301887549463D1 rhonda.grier
1,666,273,356 *AF5E9C6404148BFA57ACA4FDD2D776C4B7516F22 RIBES504
1,666,273,357 *AF589BC9714F060D5BC98940ED9DEF33AC4D55FF cpvr
1,666,273,358 *AF5136C52D612058E5E6BBF87D81CF906B5B6820 rickey.bills
1,666,273,359 *AF58F687E4440F197E3EEC3CA8396584EE650DF8 ricochacha
1,666,273,360 *AF5C87AC3CBCE359BF106888EFCFCF7AD3088226 rM"
1,666,273,361 *AF59590DF3F69E80296A8B28890558C84628EDE6 respondencies8
1,666,273,362 *AF5B39748FFD8FBF16281C25FAFDE87EF476E49F RODGER.WALLAU
1,666,273,363 *AF55FA1E351D8FB8E4B44D7B3B3FE43A613E7350 RODZAKE
1,666,273,364 *AF540147F67242BB89516EC17C90655ED8C959D1 r'oh
1,666,273,365 *AF5BC6A7732B1AED74BAA7D18B8B5687730441E6 RORYPOLIQUIN
1,666,273,366 *AF55FC99E25C94B9E52425A424AC2E4595B17F07 ROSARIO.HAMIC
1,666,273,367 *AF5240940E86BD95BBF7FFF797DD30932D86B18B ROSENSTEINN
1,666,273,368 *AF58B0F2880A512214D3C3DC79854A976ED89B90 RETNBSW5
1,666,273,369 *AF5579C1A9EFABF40F3D6A9AA41EC5DCA77A69D4 roubaliusa
1,666,273,370 *AF5D6D42DDE288F73CF4917104B37CA47685FAF3 REUNRETES
1,666,273,371 *AF5E094477B01A97DE18F254E48A5C754F1ED844 RRSPCTX4
1,666,273,372 *AF595FA461ACAF79B09578E2A494D374D7CEE5C8 REXLEVERSON
1,666,273,373 *AF52B29E41962FA8590F8DDB01C311F74BE54BE0 [email protected]
1,666,273,374 *AF562EAFF359540541E7BBE6829A7431C788C2B8 rubaiyatafghans990
1,666,273,375 *AF534DAF4930F910D647CB3D6335242DB01B4493 REZUGEWORFEN3
1,666,273,376 *AF5147E1C4EBEEDE7687C86DE8B3306E2AA906AA [email protected]
1,666,273,377 *AF5456132E1FE86B06CC3BF969ADAD1F3B976105 RUKSHAN GAMAGE
1,666,273,378 *AF5EBD81A5F538780CDECB38DC721400C21D7A08 RUSTYSHEBA2
1,666,273,379 *AF5487C1A7EAD22C13387A54DEDBE866541F77A4 ryan-oldham
1,666,273,380 *AF5071A3C0782652D4EE368BC52516B0A22EBB28 S},`
1,666,273,381 *AF5E6871FA99059CFF9F5107D3F5D99B4107A63A S3NSU4LS+
1,666,273,382 *AF5BA604094647AC97CF8086E3FC35E35CCE830A SA
1,666,273,383 *AF5C1394C7C1D45181F40A34C982A16A0CD98805 RIGHTALL8
1,666,273,384 *AF5563A2152354F08DBB38FF77C507820227DE25 cwmtp
1,666,273,385 *AF526F11CF3648D63577831EEBC47F3EEB7C88DC c&y?j
1,666,273,386 *AF54D4B4E0FD2D21629D7B605644BFE193132435 cyrusspielmaker
1,666,273,387 *AF53D34AFB6BF7F4857DA602331A8EEA4BABC7C2 RI<X
1,666,273,388 *AF56D5B467C0D2EA59560678CD515EDDC0D31EC0 SANGABES
1,666,273,389 *AF5E0A3EBC14DDE71FFF6D96B640989EE292B917 SANGBOARDLEY
1,666,273,390 *AF5A8A560C67FA863B416657327B0F5948512AB8 SANGRIA
1,666,273,391 *AF504DA03FDA4F8D48AC19C79BB7E93B5A5B35FA [email protected]
1,666,273,392 *AF5D104D00AC04DAD1A034D1985E04BE94A89848 sargents6
1,666,273,393 *AF57F203832D84262F22673212AA0DEF731AC61D ROBINBIZARRO
1,666,273,394 *AF5EB717F0F1FD94F189D9E0141E1010F92139A6 d&$)
1,666,273,395 *AF510136E12859EC784226F432C5344CAB818A6B SCOTOGRAPHIC1
1,666,273,396 *AF57B622C8CC11DACC6D88CE3437F65288DA636F SELLABLE
1,666,273,397 *AF52DBF03DE535B1B7ABF5E7A92418CDAF9E7D93 SETHWEAVER
1,666,273,398 *AF538FFB438B451CFB4D58D3CC0FA88063FC6060 DALU
1,666,273,399 *AF563E7BA17A46CEA0E3A439CA07BBB7B6D3E146 RONNIE.HEYNEN
1,666,273,400 *AF5695ED67DDAAFDB28E7621223F82E6062FB801 SHADDER0
1,666,273,401 *AF5483732582CCED49BB3A962B3CF985FDA37F8B SHANKEREHSAANLOY
1,666,273,402 *AF5253A6C82F67A3EA1D963DD2563C416561D393 dannyelstner
1,666,273,403 *AF5253B738279C15EA1A50BA3365032D375632C2 darronlapsley
1,666,273,404 *AF5867B9CC17E652D66928187CF89EA5D22323FC SHERWOOD.RABASCA
1,666,273,405 *AF5C277AEB0D0D9719DA1D7F8E30CE099B38CB8C She'sGoneRockin'
1,666,273,406 *AF59D0956E3575721AE37914F8DC227341D3C85C ROWCEPMT1
1,666,273,407 *AF50CA9C915C323F792B1453B660BA8EAA2A1EB3 shonkeeney
1,666,273,408 *AF518E770669E726794358C4549FA4936B3B0966 Shore-Hotel
1,666,273,409 *AF56E62B39127FB2A7F122789D1C33C0E492B98C ROZKUŁACZONY
1,666,273,410 *AF557A59F71564674CD68DCE6A8B58CB53A1EB21 SIELERSES
1,666,273,411 *AF5CDF082CCD07ED7355FD9375A6C66D952FEDC9 DB_PJ
1,666,273,412 *AF5E01F136DFB52441AF3BEA0A6050492D7FF2F0 SITAPARASTI
1,666,273,413 *AF5EE8AE20A5FD6016F4CC6ACD8B4A3AFA2827B8 [email protected]
1,666,273,414 *AF55F29A293944AFF2A8778D23E2CFACC1899491 [email protected]
1,666,273,415 *AF534B4FC870401F4D6965BF9CD7E52388C91855 DCVZO
1,666,273,416 *AF53BE5E47C5900CDD8CF122B00954989E4842ED [email protected]
1,666,273,417 *AF58159954B17FACAD873AC7B167A23090685EED rumpning
1,666,273,418 *AF55A72F046517137E1D205CEA9C4481427EB5ED rus71c471on
1,666,273,419 *AF57ECE81041227397F21958F6EC29265B6D96E7 russsmerkar
1,666,273,420 *AF50DCB420B84D731C84E952C08CDDA2B50AB7BC decaderead
1,666,273,421 *AF5A4C23C6A5CB7DAA1D77D31A59103EE5BE08D5 [email protected]
1,666,273,422 *AF5113486418E8C55398B9BF7E418C4AA0F87288 RYANKEMPEN
1,666,273,423 *AF5CE17F064E30A3633C906A7DD37C36F91738CF [email protected]
1,666,273,424 *AF5D7483A362F61B7EDBFF851A8FB2218FAD19F9 saeed.kashani
1,666,273,425 *AF5371364ADA2E6BFA89065F3365A2D0295C2D2D DEH)H
1,666,273,426 *AF5712B5ABBD49909056257DC8760C4031511D22 DEMJANS
1,666,273,427 *AF598D2899958BA7E5A6E50C2512B55346512BC2 DENNIS.LEPKE
1,666,273,428 *AF5AD0253515539B91FAE56319732DEE382D4481 SOBRE EL NIVEL DEL MAR
1,666,273,429 *AF5F07E6E59337CE89E536D508A53A967E963589 sangmelena
1,666,273,430 *AF573493D46E4BB83094F97DE7CC18EE5337559D DEO,N
1,666,273,431 *AF5DAB1430E1D2357CEF877084705102E022793F SANTAGROOVY3
1,666,273,432 *AF5FF4FE2999F4E9BE060C9597CF58AB559ECCBF DEPLUME
1,666,273,433 *AF55E78BC58A785674F3A913825180182FC2F8A1 de%!s
1,666,273,434 *AF596F5CE73DADD4A1080861822AD4C2158B4544 [email protected]
1,666,273,435 *AF5A0C098D80478A20769F416FE1EEC70DD8F5CF [email protected]
1,666,273,436 *AF54B7090E6D2E6C9B143F95144766837261879E SBLNDSTING
1,666,273,437 *AF5073A616469B7E60F0ED5EFE94618011357E24 soolengtay
1,666,273,438 *AF53C36B323E2B3ACEAB894F7FC47757D85F24DF south india: remixed
1,666,273,439 *AF5D8A8EC5A037EB1FAD03CE769517D979D7D28E [email protected]@LM0NG3R
1,666,273,440 *AF5DB1DE6EE209D37590FAC391E2679475F93CD4 SEANBOXWELL
1,666,273,441 *AF522AD20051FFD129345C9840F23E79AC9F3773 spermproducing
1,666,273,442 *AF5E5AAB7D316B786DBB82076508310E9847FAE0 D(gD
1,666,273,443 *AF5934CB0207E805F846821510559C1398D8B940 DGQNL
1,666,273,444 *AF575492BCF56F8C04BDD380615EC446297AD9C7 DIKERIM
1,666,273,445 *AF5C0FCC206B4F9DBB2403F39D462A1B21575AE5 SQHCIHW!
1,666,273,446 *AF54FEFBB5FDE493ADEAB3E6A287AAF3FF164BE8 setlefr6
1,666,273,447 *AF5C3AAF9FB80C40504648FD73CFBF028BC71152 SHANAKA.KRISHAN
1,666,273,448 *AF57E9777F82E6C7B99A97B45B5B16D817EBCDCF DIVIDECOMBINE
1,666,273,449 *AF5BA4D5D28F0C69270E337B14E1BB75D1F731DF stacy-witt
1,666,273,450 *AF5ED6ECDA96AB7250D4962238C7C89A2174AE05 stadtplanungskonferenz
1,666,273,451 *AF5F94652145852DE40BA9CA2CE8F6761A70F06C SHATASHAHS
1,666,273,452 *AF5B29A1D090317CFACFEBC25C6C69D9347B87CF shayneperet
1,666,273,453 *AF5744ECEAAEE0E755AE58B7EBB676B9D5228EBF STAREAT
1,666,273,454 *AF5C85060286B4F9E5C40AB4AF2DCD918F68B701 SHISENTS0
1,666,273,455 *AF5097AAFB4C2CB48F46D2DD5B86ECC40304C001 stevieborgeson
1,666,273,456 *AF512E9340C474D662E2390C2C1E1E3FF481F2E3 donniesellinger
1,666,273,457 *AF50EE2A6CFEEA443096D21551F70FB3D00AAF22 [email protected]
1,666,273,458 *AF5B5F2821F0EA27F25B4C3E946FE13B61C809B9 sicacalladaxxvii
1,666,273,459 *AF5DAED2CAA29598AB5ABC61205BFCE6A5DC1C58 DONNSTURROCK
1,666,273,460 *AF5E615B03FB861740A55E821F3FB30BE1653E9A DONN.TASTO
1,666,273,461 *AF5503AA1143E32B872A0B862BDADD4F53F373AE STOCKBOX9
1,666,273,462 *AF5678C2A2B784D673E6906BEC4F7CA2AC9CC283 STREEFDE0
1,666,273,463 *AF5C65F460957C1D3B5DE9880E8F66292ACE5BBA STUARTESQUIREL
1,666,273,464 *AF58FB8F940F967F7EE7AC1F4334CC7FBBABE9E0 SIENA0000
1,666,273,465 *AF5E018DE83E16382E2C3E9446E193B17E4B3B75 STURKOW
1,666,273,466 *AF5DB5FEE8996613404217E5EA3210701E1C1737 sikoris
1,666,273,467 *AF5267E53580342588BBED2175B3054F0C08B301 Singt
1,666,273,468 *AF583898019365B39A2F45BD1E5D1B160215BBD6 SUPPRIMERAIENT
1,666,273,469 *AF506598C3B003E921A272F2FC52C012651E90E1 SURNUMES9
1,666,273,470 *AF5B734A5A974D169C5467AF2EC44D0904D37FF1 drv)
1,666,273,471 *AF58EA9B2BA05AF0E88255D699AD2C2F8896BFF8 DSUQ2
1,666,273,472 *AF582DA78FBC60B3E069B723E8BD422FB9316526 DUANEBELARDO
1,666,273,473 *AF505EF1EF46A343556555BEABD108EF14655E4B duende.del.amor
1,666,273,474 *AF551E787B468A954E6E99F24A3A82E5A5D75E77 dugsr
1,666,273,475 *AF5042D9D9135DD9108D4702D578BC2968FEBB69 SOLOMON.SEAMSTER
1,666,273,476 *AF56539BB3D94C139CB617B11B2E4171D408B8CC somebody,-somewhere-(remixes)
1,666,273,477 *AF51E8749C6E6C9E2C8B03B1A374CF25A8CBF69B «SØSTRENES
1,666,273,478 *AF56052EE95FCBE4BDCA59BAB3C55EF98E709905 TALKETUDES
1,666,273,479 *AF5D0DDC3BFC3DB7C1FDD34D329255B7CB55F873 TALKMIKECOXON
1,666,273,480 *AF530A9A0DBD6F684E90CB936691D1BB61A223DD dvdun
1,666,273,481 *AF53245E428081BE72003903A58C64A8EBF7B7B3 $tand-r3$
1,666,273,482 *AF527AF5332DF57F8AA86E5EDC507B7EB2F61709 dw;eo
1,666,273,483 *AF58EA28F6F325F5DF11D2F8F3E1620393155620 TAPE42
1,666,273,484 *AF57B901E1958431A8C058F8739F0B16E0F4F837 STACEYVISION8
1,666,273,485 *AF5199E0FD04E80CDB8DDF49A1A8B14CF9ACC68F TAV1E$VAM
1,666,273,486 *AF587AD0F9A634B02B0B2B26FD498D217D0FC3EE TE179
1,666,273,487 *AF5FB87FDD45EE9AACC997B4F758F12B42812EBB E;&A
1,666,273,488 *AF557C2E4E5744B3B2F06F46AD0B23F822D262C4 TERESA-RENNER
1,666,273,489 *AF5B25F735E5F79B78F70877DACA64FC87EF9A2E teriellenwaller
1,666,273,490 *AF565AC2D581621E78908653C834BA3BE50A684E TERRENCE.PETRAUSKAS
1,666,273,491 *AF586661CA03228A7484E6FCAF985C52D42A608B ECHANGERONT7
1,666,273,492 *AF5D1F6C45414EB5CB2DF15C4FF8ED6E27EE3CA0 TESSALANCASTER
1,666,273,493 *AF5ECB7812B4D8A3AE520895C05F046B9477D8D2 stewardships?
1,666,273,494 *AF58A6469F9FE318D2BCF6A4112F510C27F13641 edlahcsa9
1,666,273,495 *AF5D659F644097880C9AD2D836E0901BAEA97947 EDLEKBERG
1,666,273,496 *AF5BCF03E855A9C6EC35E33F5515D0F165DA2575 STRAFGESETZPARAGRAPHENBSWED
1,666,273,497 *AF5F669E911BBA54314D67CDCE7109E207D386EC EDODEA-ENSEMBLE
1,666,273,498 *AF5C298A11B2D5E302788E43794BFF954B4ED5EB EDO#L
1,666,273,499 *AF54B66D664533AA0F82E41E2F9E36A80D9781C7 STROFTON 1 0
1,666,273,500 *AF52363279B3800BDC4E06761135FB7981F148B4 stroomda7
1,666,273,501 *AF5B835378939A844788F2C64147A4B15871428B THEJULIA57
1,666,273,502 *AF5E02437E664C71EF1D08D9EF7F6FEA9D4929D7 eh2mk
1,666,273,503 *AF5B3AB796DD5CF1BA6E8D8531D538B97EF16E90 [email protected]
1,666,273,504 *AF5441B08814F099FC570762937F8DFAF31D67D8 THEME-FROM-STARSKY-AND-HUTCH
1,666,273,505 *AF597C06DA3650D4AE350749C9B78A3248EEC1BF SULKAVANJ
1,666,273,506 *AF5FC37D9CFAC52915A6CF63D8179C62AE7D704D Three-Steps-to-a-Better-Democracy
1,666,273,507 *AF5433546339BB1F8A0986F3D84292B01240301D ELjp
1,666,273,508 *AF593C734FC261D48AC00CDA6B7DDF2A807CCBDA ELLSWORTH.ANTOLOS
1,666,273,509 *AF52883DA73B87C93CE08F84B7F8C18F71FAEF60 ELLSWORTHCHALUPA
1,666,273,510 *AF5B11FE59D0C563A810B2B8413C3006D7DB2DE6 ELLSWORTHHAZELGROVE
1,666,273,511 *AF5F4E7C0B03C05EAF6B9A099F95C85E32EAD1E0 SUUNNITTELUTOIMISTONING
1,666,273,512 *AF5E88C73BE7FB2694C1B5280058B0C0156D4025 timkenefick
1,666,273,513 *AF50454904C27728C93AB22D42A8C91F25C13238 SVRQBB
1,666,273,514 *AF5C9367E727A8AB6BE42E89E820C45B52616CAB EMANUELCALICUT
1,666,273,515 *AF5C75D1B08FE82613AB3B0281223069D3FA4476 SWXQXQZMADMGGV9
1,666,273,516 *AF5CB3EA5B223ED45533DBED5A9B67BEBFF94ADA timothyroegner
1,666,273,517 *AF5D4CD9A9FDA3D79420E02D48A7A8F895C1A902 [email protected]
1,666,273,518 *AF54FE037355314C1957589D97E2E9A58A2A21EF TIM.SALMI
1,666,273,519 *AF5498222CF57713BEFB6EBB3693157C00ECAF9B TISALUX25452620
1,666,273,520 *AF50E8BF7F9D453D07887606EAD673F1A163E359 SYMPHONY33
1,666,273,521 *AF5F70528682B709727AAA4F270CC6A050E3A050 tomasmay
1,666,273,522 *AF50CD6B08AF6C4B0FCD3C4378FC1550B3F253C8 emilissa9
1,666,273,523 *AF5796D28EAB5BF2C4F59EC5BBFC5C09C629307E [email protected]
1,666,273,524 *AF535BFA9A0ACBAC740C7F4ADEAA689D831A8957 [email protected]
1,666,273,525 *AF598715226591022D77A8A9A79B12E66E1622F0 TOMMY.MARKEVICH
1,666,273,526 *AF58E5F4D54166BF7CBD74B70840E9647A587CD7 TONYSCHLACHTER
1,666,273,527 *AF5B0F6E22D1E087A110BD3DE6AB1C668A49006F Enjoy.the.New.Planet
1,666,273,528 *AF520D0D7FBDABB5E6AAD1C90A148EC797496B61 tracysinglton
1,666,273,529 *AF55F1C6EAA51666ADDD6B581D4F26E500108C24 TALKPARKANTROS
1,666,273,530 *AF5C3876782F1CD68239ABFDBC91EDF4870E3342 ENLARGE
1,666,273,531 *AF50AD7A95B5949F453A792A4ED8138CAAD78535 enriscado2
1,666,273,532 *AF5CAAC509A2A02E7700776E1C6F4623FFCBC5F8 TREAJIRI
1,666,273,533 *AF54A41F8D62B651155E7E6561BBBCE3AE70EB6D [email protected]
1,666,273,534 *AF5CAACE000C74A65AFFF7F330157C171DE7E2CE [email protected]
1,666,273,535 *AF5959D5E097DA99EB4A81E688CE44FCDDCADE8E TRENTON.ROSILES
1,666,273,536 *AF51AC568890B8E986F074532D30098F98A84567 TANNERSVILLE'S
1,666,273,537 *AF5CFEC9C44BFAD98D4CA846B896443E15A144B5 TRINIDAD.HELFER
1,666,273,538 *AF5D9444734D4E160AE270E0C4A8D0B99E79A6E9 eqybv
1,666,273,539 *AF5F921288CFA6C9F1C236DA69F24AC335DD282B ERDMANDELBEERE
1,666,273,540 *AF5D8B6DBCB2F8DB4E604740A85F797D68584758 erinpreskitt
1,666,273,541 *AF519E7EE72D97266C0CCDE3F424242E8C22D9CC erjt
1,666,273,542 *AF51C27AFF77E7070BB15EE9E0A3F1D10C043F4D erniebosen
1,666,273,543 *AF55E9DE50D1BD9243785340608C4E78D462FAE7 TE-(ELLEN)
1,666,273,544 *AF57E4661BFCCB2486A9F903CD3EBFD57EED381A TURO-TANELI
1,666,273,545 *AF5724B66C222DF96A005EEA86C80A89F2619E1E ERRUSF
1,666,273,546 *AF551F200CC994952D58CEDB8C3A0FE772098822 TEODORO.ELIAN
1,666,273,547 *AF50B377D2562822A9035AF5DDF6FAEFEBB236D7 TUTKIMUSMATKOJAS
1,666,273,548 *AF5376814650D5EBA9CB05EA502ED7BF2681AF90 TERENCEELMO
1,666,273,549 *AF5FF775F18400AE6A33DB04B80DBEAE9B56D9E7 TERRANCE.WOLBERT
1,666,273,550 *AF516E2FCDF875556F45DCA8673EEF2B978F7225 TERRENCEGOSVENER
1,666,273,551 *AF5958CD3DF61E5AAD417717E3208C918A3EF30F essentialpiece
1,666,273,552 *AF521993EB9740F6B35643FF50519B33B0421E6F ESUMNER
1,666,273,553 *AF59FB71D3FC4A57EF2F7FF66513D08713BCC1A2 u5[t
1,666,273,554 *AF53581D7CFF46733516B6555319DDC31083CA57 UAEVENERP1
1,666,273,555 *AF5B8FB9FB301245C8CA13561D51F9B5E51C0510 thisispoo
1,666,273,556 *AF5FD44A442DF3195C62C224BD9BC9B1AD78A676 FAHRPLANM
1,666,273,557 *AF5A600000F5F85DD9B3FD4BFF95D0C2042FF5EC THREE-JOLLY-FISHERMEN
1,666,273,558 *AF5499F2071BE71F62E8C8989AD01E0ABA7C0AB8 [email protected]
1,666,273,559 *AF59EA1B79DCF89E85E3E5B160503C87293D465E FAT PLANET: YEAR ONE 0304
1,666,273,560 *AF53025F4CECAC73C8F3CC4299F6FCB79E05CDEE timtutaj
1,666,273,561 *AF56584D1D6BDFDD973A526638191C0EB5743CA0 UQG!
1,666,273,562 *AF5882598C2DA0B4C94940008171CD941CD889CD TLVKJGQXHHIG3
1,666,273,563 *AF58B46E3E90AD1BC9504B048DA38437BE572DEC uskartellbeh
1,666,273,564 *AF51869C41B61E5F395E9B0B3D4B0D5382DA4895 fictionthomas
1,666,273,565 *AF5EE6383FC3E329142FFEE154BC4F5B8F801BD0 filgo
1,666,273,566 *AF5447EDEB1C9794F1462E13359DC9DCFCBF7DF3 fishybacking
1,666,273,567 *AF535D1A29965FDF16DD3557B9982919F8BE0035 FKAPBSWING
1,666,273,568 *AF5DF848FB460B70AA8AE46D506CD19FD1A65CB6 [email protected]
1,666,273,569 *AF5E5E2E06E0B385114ABAF78F72290411B26848 V53:
1,666,273,570 *AF5B387E3F62A048932C5CF20AEF292196C55D92 toonkeizum
1,666,273,571 *AF560E9159289E282333F4336F71734C813CB86C FNETENSTB
1,666,273,572 *AF5C6E061701EE2F0866D1B49BC65FC4B2299FA4 TORFELL0
1,666,273,573 *AF586EC20E6D54529E173CBBC4041C8857729A45 TOWAGE
1,666,273,574 *AF50B85BACDA872F6FB2F2D39B0E0156856AAC99 FOSTERKASE
1,666,273,575 *AF516940292B74D67F4A87B303224BF9F1CFEC82 FOSTER.LEUKHARDT
1,666,273,576 *AF5856CDEF2D00788D61C7AD3D399EB790267EEE VANES.BIGG
1,666,273,577 *AF55D29CA1876E5B6B05161FBAC31CF798D03661 travismashin
1,666,273,578 *AF5E4C52AFD9ECD05C4CA3A2A3CB43543BB37F2D FRANCISCO.CHUPP
1,666,273,579 *AF58F90A3D0E996D07C65B1DD18BCFBAD0367375 FRANCISTAYDUS
1,666,273,580 *AF53D4379EE2999E4CC081DC1F3FE3602710DD7F VARIANPEWA
1,666,273,581 *AF55E31890D51485BCEACA4B11C01C0ED9279E1D franklynburton
1,666,273,582 *AF59134F9853F2BB358C2D2104E9C84E3151C86E varunthdeadman
1,666,273,583 *AF5CF01F95E4AF56B2D5486440BA18E79EEB5ED7 tricky-dave
1,666,273,584 *AF51DB95A5E7BF613401ECB96E02744C5685C9CE VERBYGETREK5
1,666,273,585 *AF532469A8D025A62C1E7A3ADFCADA9B7DBFB4F9 TSCHOENSEE
1,666,273,586 *AF572B251D36C195E8360D1D7C661843734FBE36 VERFORMUNGSZWECKE6
1,666,273,587 *AF50C258DC9598AC675E96C3ECBC12FF990BD25B TSIVTHET8
1,666,273,588 *AF575B1D50A571941158797D229D0CAED84E7754 verleidster4
1,666,273,589 *AF5E82B6561F2207B1CE2EA1BEA6B33C54CF25F0 turbature4
1,666,273,590 *AF5011F67CCAFDEFC0FBBB7729C7514AE0D31691 [email protected]
1,666,273,591 *AF532EC9C5B6DD2B941056A960364B5723769890 VICTOR-HASSINE
1,666,273,592 *AF5C6EEF2C5C4889234DD378B870A2396545A56C TYREE.WERNTZ
1,666,273,593 *AF55639860716BAB8D7E0E67E0DA4E59C974E794 tyrone.isadore
1,666,273,594 *AF536C6780B9A7C6D24E924C55DAB3A0979FE0BD UBIEGAJACY3
1,666,273,595 *AF5260756ED837F502B97024840DBBE08C946806 GAY07
1,666,273,596 *AF5C482F1E4E7E5AD53B6C1EF9D6629AB56DD69E UITBOUWE5
1,666,273,597 *AF5AA54D51FF6E1F5D425534C1B8288E990E039E ULKE.WULAN
1,666,273,598 *AF50EBC3216E540EDDF1E53D37E40818D99E0D21 ULLSPEED2
1,666,273,599 *AF5FD676FA2FF5D5D89213D9DBA9288C11BC6F8D GEORGENOKLEBY
1,666,273,600 *AF56C432A8BE436F178952CE3C8DC552DD275C42 GEORGE.SYNER
1,666,273,601 *AF5736A211AD599F5F714F336657757ABBB9A802 umangshandilya
1,666,273,602 *AF56581743DD1E0EC92401AD10E1985AA6DE1E2D virgilwessinger
1,666,273,603 *AF5410329E660566E0013D1267F125B44ED34E34 GERRYNETZ
1,666,273,604 *AF5085B2D204900222F3ED0EBFDF5603DA5CD264 [email protected]
1,666,273,605 *AF5C6191C05BBFB3593018573C506AA569C4DC26 VIRTUÓZABB
1,666,273,606 *AF58BABBEBC9517DA08D13102BB196DA6B0E0309 GIGSTER5
1,666,273,607 *AF525145AB020B8C87BF52A5B11330A53BFC48E0 visiongalileo
1,666,273,608 *AF514A607FD2F942F8A07D003FDD29A6F97211E4 unfore5eea8le
1,666,273,609 *AF5DC43166106872AAB85EB83CA1A0A90EC9875C gioely
1,666,273,610 *AF5D12B3DA7FF73DB3A857F9AAC0F6AEACD6381C UNMUSICALLY
1,666,273,611 *AF55C8CD225DBF780A40F92D8EB58CC113E271E4 GRABFLÄCHE
1,666,273,612 *AF5BEB8BC7B347CC0D59366195C4A762E39AB87B GRBWRMS9
1,666,273,613 *AF5A991085A983B3A2042DFA4A15A3FA7568EB77 GREGORAS5
1,666,273,614 *AF5F72D251838FD802278C8206056400FBE9195C GRZESZNIEJSZYMI
1,666,273,615 *AF5AB30DADDCEFCF16C0B31A24CBB2EFBF5B44DC GUKGUKK
1,666,273,616 *AF5487C786AEE6BB38E9A51C8F03C49795469DD0 URAN-SYRI
1,666,273,617 *AF5522299F1A23DF803620B31D36FE8B1EEF5E79 [email protected]
1,666,273,618 *AF5B91105E586F710831F6108D0B11FEFCFD65FA URIVIST3
1,666,273,619 *AF57ADACF86F506B9E057D4B5963990F9CE6A441 vritikatoraskar
1,666,273,620 *AF5BE86D15070562B2ECD2A96652B60BAAF1CD5A VAEAERAEMIELISENAE5
1,666,273,621 *AF50383D341D728682AFF26181E0E5D7FFBF24F4 vaksberger
1,666,273,622 *AF5FECB6F195EEE6582825A807CBB20760746987 WANDA-S-MELVIN
1,666,273,623 *AF5BC9F9B88824D634282BB4D225DD9487103B66 [email protected]
1,666,273,624 *AF5165CD1B61C6798F414AA83FB89AE47C1BCB2D [email protected]
1,666,273,625 *AF58E4EC0DAB1DAA35B7CD1FD00A93A3A6ADFCE5 [email protected]
1,666,273,626 *AF5336530F16B7063A8E827069DD838E01FABA5E [email protected]
1,666,273,627 *AF58CEFC570D34F928E335AAA46035EA45A5C03A harvey21620911017
1,666,273,628 *AF5457A6688F840465E48D29921DD5A109B51339 HARVEYRYDELEK
1,666,273,629 *AF5820B9C170F2C59E8DE87AE91C4B682804AC27 HASHILALI
1,666,273,630 *AF540FF14E81771E202BAFAFC0A0424D9C4265D9 HAYWOOD.CONNARD
1,666,273,631 *AF5EFA469FC5C18E1CB25926BA112452F97072F0 waynegerenstein
1,666,273,632 *AF5E9EF99C95FD38099185236421A80BDF6AA746 hd01
1,666,273,633 *AF5B98B9FC00027E5E98768857F54DE6961B6B86 [email protected]
1,666,273,634 *AF56E967FDAB6F860CDDAEC2A6B2DABFCD61C690 heidi.thomann
1,666,273,635 *AF5DA05314BEACA8050F5649A26C24AE34EEB25F HELLENISTLIKE
1,666,273,636 *AF586857E658C7B797F423A6B8217F9474819D9F VELMA LEE JACKSON
1,666,273,637 *AF5BF4FB892838B9675B93137E0D148C82341822 venharsyla
1,666,273,638 *AF58AEA1B889395BDD09B268FAC7E9C685F6C044 HERSHELSONNIER
1,666,273,639 *AF54F564DA24F231D92042D10ACAAFFA344E6958 VERKIKKERDST
1,666,273,640 *AF5C6BDACE75DEFDB7A95A6241D6E0EB6FCEA902 WEECHINAS
1,666,273,641 *AF50A63AE0106201E74203EDD8CB133EF9E2279E veronicagottaletthemgo-coleman
1,666,273,642 *AF5FF093B4D11B4C6CE038C30497F781A8985014 HIRSUTO-RUFOUS
1,666,273,643 *AF5345A63748FF03E7C683EEE8C743D756017D0C WENDELLISLA
1,666,273,644 *AF5B3DAD964794914EEC2668F40C4BB45C0B0CD0 [email protected]
1,666,273,645 *AF517F01D7D931555323A488AC6855BAE17A5BDE [email protected]
1,666,273,646 *AF5C7A4ED9897543A0C419C1878ED5E31604C0E3 HOMERASHMEAD
1,666,273,647 *AF59A5C5D817CD5DD584A968C8F5DAE79E900D3D HORACEREZNICK
1,666,273,648 *AF5BD381CB154A27B3E16879098BB47A3F34CF13 wernerkasuboski
1,666,273,649 *AF587C42C9F5118E490EAA59E1EAEEA3E5B2F7FE hosikovy2
1,666,273,650 *AF515CAB3DFD9B489B78921E5715D61EDA4C26FF VIKKI-CASSIDY
1,666,273,651 *AF5981DD6F2329E12D8FD0F076A950D712528BC0 HOWEVER-YOU-WANT-TO-
1,666,273,652 *AF51DB93EFEF2C45273D06142153D96C19E41F51 HRUMSHA
1,666,273,653 *AF5EA1DC4C0C3FD3DBBC3C4DF27A039645ED103C hsilahw6
1,666,273,654 *AF5026F9B7F3A52C27EAA2C15952D98DEB880406 HUGHNEAT
1,666,273,655 *AF5683C995C4C05B7F478B9DA48D785F29DE464C HULLAH
1,666,273,656 *AF58ABD29FC91501347FC85E1101A4DE8B40B271 I88.
1,666,273,657 *AF5CC00E7E5C91F136634604ECF7A3E1D0E7BBD5 WILBURDEETER
1,666,273,658 *AF58DFC6FAE92765F9CE5C9E0505936893D96DED VITO.KRAUEL
1,666,273,659 *AF5F9721A36C136412AC57DE80F9C5B4AF126A07 VIVIANGGORO
1,666,273,660 *AF5BB7C7A53B12B730FD6EC78069335CA228D604 [email protected]@[email protected]
1,666,273,661 *AF5A19662D1104F227B786741F4E2A9A41EF4CCE ICH.Z
1,666,273,662 *AF5B0AF312234FB8D9F01CB4BF99B4DBB2DBC3A5 IECTASIA8
1,666,273,663 *AF51FCA0E0A33C1E0DCADD0128F818A5E6E12492 VOYAGERONT?
1,666,273,664 *AF56B9E74A4C6C1D86035C8D4E519973E9C67D0F [email protected]@VI
1,666,273,665 *AF5B0B9E3828FCFBFFD01A0730C1B1F1F3D3FBE2 vrettos5
1,666,273,666 *AF5E54BD0F114A76136492A4D99D21F55431FCE8 if it smells like a rain cloud
1,666,273,667 *AF546E87A79D4409EFDA4EF9F54020B903A68FFE iiibowtoyourneighbor
1,666,273,668 *AF5FAF8D1CCFD11E4EA69A9FBF5B73AFD6E86A68 WON'TGETCRAZED
1,666,273,669 *AF5C4B1FFD8BE531724DC75D145D483C3FDDD58C WALWURT5
1,666,273,670 *AF534FBF78F0ACE90380223089A76B98FE6C8944 IL PRIMO LIBRO DE MADRIGALI, S. 2 NO. 11: DEH DIMM'AMOR
1,666,273,671 *AF520D80C43598ACA31C051941CFFF356FCB0B2C wtfmaties48
1,666,273,672 *AF55B5FF463996C8A47F7A4036121C90F9F82BE0 [email protected]
1,666,273,673 *AF50D3A4908B9F78B8D8240D5F7AD030E0E0BAE9 [email protected]
1,666,273,674 *AF59A2FD0076174A516201F10C56F45B5FCDF11B [email protected]
1,666,273,675 *AF54E769146A2E8084A9027FF0831F7E610D47B6 WWW.ACANTHUSRESEARCH.COM
1,666,273,676 *AF5D17C0486E41BB22FCD08B38FF86487E89F6E1 ILUVZIGGY777
1,666,273,677 *AF58D28C0A710F39F63E43544373934D07C730C8 wasanakongnoi
1,666,273,678 *AF575AE9D78DD6DEDEFE3648F3B1B83FB678BF01 wwwwinspiremecom
1,666,273,679 *AF50811890E413989607AEF94AA027C346897030 wwwzoezunigacom
1,666,273,680 *AF5D272228CF4548FB93F7A2D96E8DA376A1713D INDTRYK0
1,666,273,681 *AF5189E62A72B891832CED047526E25E5B2A7173 xd9{
1,666,273,682 *AF554C9239F44E7CA12E02329F4055085CF2A16E INTERMEDIATEDOSE
1,666,273,683 *AF56F48EF5F1FAB2C35E28B0EB67FF9F85B89858 iostegans
1,666,273,684 *AF5B0A70D86CEFBA8C27F510DE60C2C579F56763 [email protected]
1,666,273,685 *AF5C196E743A6110340BC87BDFBAC827D056B88D [email protected]
1,666,273,686 *AF5CDC21F7722FD6EC3292BA26F99C8EDE038752 XW1HOOSS
1,666,273,687 *AF59C9246BFC1FF308DBD47443ACF29965FC6AB1 XXXYENRAB
1,666,273,688 *AF50C403405577033D5A336BE8D5A187EF8C3B79 IRIVALLAND
1,666,273,689 *AF5414753734B0D0598E1129D077E9C0EEE6BDEB IRWINHATRIDGE
1,666,273,690 *AF5F8261DEDA016FD347550FDC2EC1BEA1721C23 ISABELLEDONNAY
1,666,273,691 *AF5E0BDEF9089A81D46295EDACC3AB85269006A7 WHITERUMP?
1,666,273,692 *AF50DFD7ED47FDEF42B3EDAF32FD22BAE1BD2274 isidrotavares
1,666,273,693 *AF5749B8D82A6E99BD3DABF29D66DCB3591FAE83 [email protected]
1,666,273,694 *AF58617056A7EF327F7FCB27DE860675B6C6D89D israelpawlowski
1,666,273,695 *AF55CE494A5669518E263210DB04CBDC84321A84 WHOLENESS IN THE CATHEDRAL OF GOLD
1,666,273,696 *AF56D7559CF2ABFC5AE1128AD07CBB0FBDE275A8 I[V4
1,666,273,697 *AF5AA774C3E6C613E45E16736112B41D73C0672E iwctx
1,666,273,698 *AF53C9A6642D862C784599F9505C95484AD02B75 willjanson
1,666,273,699 *AF5B39876142D250989B841FF81704CB84CB5C05 yom.ma.barn.jao.kah
1,666,273,700 *AF5F2EC7F19C028C847712EC234F83229A2135DE WINFORD.GOPEN
1,666,273,701 *AF54788FF28AF239CFDC1769CBC203C49BAD3D00 WIREROOM4
1,666,273,702 *AF585E375A8064D707A65F01EF4A3D66225EABD2 YUDENIS ORDONEZ
1,666,273,703 *AF5B1A60999BF5386E2A969F0D4D701248A3FC2B JAMIEMPARK
1,666,273,704 *AF50273E689DF18EAC5BA4939F4CE7369E6D14F7 YUSRON-AFRIANTO
1,666,273,705 *AF5A5E5E4A2CF1360328F3262AED09AC2DFD66E6 [email protected]
1,666,273,706 *AF5B8DB535C59DAB9D44D124DBB9FD413ACFCF52 wl%`
1,666,273,707 *AF5F1E2DBAD3ECFD9609A02D17FA8EB8BA68FF5A Z116462
1,666,273,708 *AF5D70CA108C23EA96C987F76C9BEAD341045D63 zackarykemerling
1,666,273,709 *AF5743C6D08686EBEB708D821588C40DEABB7E32 ZACKSHUWAILY
1,666,273,710 *AF521B8F3E0F06576CF3993897AC06505E2CC7EF ZAID-RUDIN
1,666,273,711 *AF5555B31275E7A4712C25A37A28C8475C859670 jaylin332
1,666,273,712 *AF5D66CE25A02B6B3B159E3D84EE7FF933A35E47 ZARENWHITE
1,666,273,713 *AF57EF491700A6F54D45F37EF70A5497F34E1CDD ZAWATHKA
1,666,273,714 *AF53365D3418D90CCC7FD73666F966E5764BAB9D [email protected]
1,666,273,715 *AF5FEE15B002EF8402F8157EA70FC83EA5DBD88A wu\l
1,666,273,716 *AF5B856CA422653D9804CCB61D776A5B3B4D1889 wwwbestbloodymarycom
1,666,273,717 *AF584812007B868C1E81441146D1B55A535A2F83 [email protected]
1,666,273,718 *AF541861B6EEDC118942A06ED8469179D6B95B07 wwwquickmapcommovi
1,666,273,719 *AF51BF98FB83204EB148C5ECCA2F7A2E8B992915 jennybit_07
1,666,273,720 *AF507BB8E881193C4115EE90294FCA9CF3B28C77 jeramymackiewicz
1,666,273,721 *AF51F163FB5947D925138FB77BF30EF549B79772 WWY:
1,666,273,722 *AF5F92E8589AEEBE5142E09C1A75AF99BAA1F421 jeromejesiolowski
1,666,273,723 *AF5CFBA73FA3685F8629CEE1C58BBF599562607E XAVIER.BUENGER
1,666,273,724 *AF54751E853AF8FC1E8EA511677F6ADB2963538A JEWEL.DODD
1,666,273,725 *AF5EF3AF4F3BF2E492CC9EA144AD2A48C38EEAC2 ZURRIRIVE5
1,666,273,726 *AF5B210550510EB5001F8106AB679B7C4363583C ZURÜCKLENKEND
1,666,273,727 *AF51D7A45423D6DF53CF4FC7A0782A194699AB63 ZUTEILENS0
1,666,273,728 *AF574BE95DD93368E2CABD214FA37FAE1BA1E02C xmntnsm
1,666,273,729 *AF594813813C160737F72212340E340247E3CD2C [email protected]
1,666,273,730 *AF5A92BADE0BB85691EADE4EB2F1C387E3BD49E4 xtasy.jones
1,666,273,731 *AF5FED3B230613FA90FC80FDACC89E2716ACCBB1 j=$l
1,666,273,732 *AF50EB3E2F1486865879A1E5C4355601CAAF29FA [email protected]
1,666,273,733 *AF5ECE7DB7FE16D98C3C66451D15F2D9836E569B ΓΡΙΦΕΎΕΙΝ
1,666,273,734 *AF52B410FBF60BCDF7A992DBEB366FC30BC48CFE δειφόμενοσ
1,666,273,735 *AF58AE31303E9A51B208438241E8783CB12D8989 [email protected]
1,666,273,736 *AF5E319AE7AF20D686F547463A704FC94214DFC4 JOAQUINCORDAS
1,666,273,737 *AF548047C66E55AB32530205EB450CF3F05F18B6 JODIEDENTON
1,666,273,738 *AF5E3B464D5DF8D5C13855A2218043CFC4500249 [email protected]
1,666,273,739 *AF5C0BC552B620338ECACA037FD35B600FD4F9A2 Y!"
1,666,273,740 *AF5E41EA02DA161DEDF941EF81AF9BB5AFA90E76 ΠΡΈΣΝΙΑ
1,666,273,741 *AF5F91DFB5EE2ABE97968ED1C3103D6E9D2F5287 [email protected]
1,666,273,742 *AF55A634688D85185B1E6417A3C8DADD7D66451F [email protected]
1,666,273,743 *AF5B6A3524DEBF1F32D5A217566A744DBB1E77C2 [email protected]
1,666,273,744 *AF54188ABE260D3429CF32E4115F54F46E32635D [email protected]
1,666,273,745 *AF560A86E3CD2BA8F89EA6CE93F6BD0E29774F02 JONATHANHUYSER
1,666,273,746 *AF5512D2CFD79956F11AC8097F7CDBFFB8F2C39B yap-tai-hey
1,666,273,747 *AF5A42D649CF6109BDF2C57017F7B7722533BCA3 JONATHONMUSOLF
1,666,273,748 *AF509724DABBFC92B48CE0267C0C5CFF7EB159E5 yasmine-samir-mahmoud
1,666,273,749 *AF50754EFEE363F9F63D187CA1F337D43C3AE608 JORDANSIO
1,666,273,750 *AF5E1F50DCBD61801C7ED0405803BF03CB8886F8 ИНДУКТОРНО
1,666,273,751 *AF501156992A76E81BCC67F0D92477CBB5390B88 yeahyeah(dramirezradioedit)
1,666,273,752 *AF5418E2CEA6529946CA8968FEAB35AF4007F2CB наделяев
1,666,273,753 *AF58FBFC1777327DB19C730E16D6B981C49EEE3E [email protected]
1,666,273,754 *AF57B0185755604C2C1D848FAF780439270D2984 «поселения
1,666,273,755 *AF5031E8B748491F2BA96B81F83212E308E8134F суходембе
1,666,273,756 *AF51E8567E05A6DCB06168AB2BA70B490E898E74 yossiharzahav
1,666,273,757 *AF5B074B9015BA69834B0C146861DED1259A8500 УПАВШЕЙ»
1,666,273,758 *AF5199321A0975AA505503E2A851011DFE3F18AD julieused
1,666,273,759 *AF5F498C27A8120DA0AE67D656D658655CD351CC YOUTIAO-LAO
1,666,273,760 *AF572F14D698D3D33873CC37A3973A253C4B1EFA 《youtube掀全球短片熱
1,666,273,761 *AF58FD4D5166682B68DA81C3F7EE25B72D92252B [email protected]
1,666,273,762 *AF50F438CCBAF982463589CEEE8334EA247A59D2 yui(2006年~)
1,666,273,763 *AF5D302334DFBA3F2D18F9BEE118F10F48F21036 KAMERLING6
1,666,273,764 *AF5DCEB10F63B028066A733A085722F1C9928C16 KAMPSEL
1,666,273,765 *AF52C195EBBDDF3D0A304700FD17291D39987468 kapitel8-3:diequidditchweltmeisterschaft
1,666,273,766 *AF51CF233CFA2FECB993D101026A77E6324D84F2 KATHIHILL
1,666,273,767 *AF5D2C526BDD08833999EE52DF30DF9A5DCF1C7F katolo
1,666,273,768 *AF5EB8299B5E03642A3FC412D5FB37F69A8A4FC2 KCRD0422
1,666,273,769 *AF59AF29E9C10B863472A6B7AEEAEECF6182503D kelton.smith
1,666,273,770 *AF5416D5BC2CC0C6C982DB5A39A5C7246A1112B2 KENETH.CAPORALE
1,666,273,771 *AF545625BDB634FD3E1FF3DBE855C573BA0470B7 [email protected]
1,666,273,772 *AF590C668CF57B7217EB55C56E2DAA2379B1D7A0 KEVINHYDER
1,666,273,773 *AF5732AE175496D6F4AF8D5725017EE1E2290B54 ZWANGSEINLIEFERUNG
1,666,273,774 *AF5E9033EB7A4559C6BFD3B31441B448108BD20B KLARHAGEN
1,666,273,775 *AF5B85EB0D1285E3521C81D343E9E9C0E980CC1B ΒΊΝΒΑΕΝΤ
1,666,273,776 *AF5F081840CE440EB0323A026629095FAE33566C KÖLÜNBSÉG
1,666,273,777 *AF549F597EDF5F997B454456D0C66DC089BF3BB0 АДВАЛОРНИТЕ
1,666,273,778 *AF541DA566260A2CC6EBACE20D270D8E7763B6C3 kruisgewelven0
1,666,273,779 *AF5F82130C4B7F4CB4FCA81950C863D5D460D816 KURT.BEVERLEY
1,666,273,780 *AF5472AEC0EB70693D4D8A49C71CFA97A8F7D370 [email protected]
1,666,273,781 *AF511B581F2BFD8EB86E1F3096F4511B94366835 L.,
1,666,273,782 *AF56678F33BB83A9108DA83A491FBDE471A9D331 МАНХЭТЕНН
1,666,273,783 *AF5BF71DA9720C57655091DD48C4A89F98EE17BF [email protected]
1,666,273,784 *AF55B7BA1843339BA2DED79CF871ACFE263AE0B2 LALANA12
1,666,273,785 *AF5164B6B79089613CDD5568E31F4901B5E6435C [email protected]
1,666,273,786 *AF51CF6CB70CED0C0AEC582CBB797DBE7DFBCD32 LARRY.KHALILI
1,666,273,787 *AF5D7DB3062BACAE6BBCF659D47AF6FFE7990623 LARRY-QUINLAN
1,666,273,788 *AF56311BE31EB32CF3C05F7D8ACD62AB574292ED last-laugh
1,666,273,789 *AF5335F0367BD87475399FA0C1023F129BC60835 latneirooduesp
1,666,273,790 *AF51A0EFFC2C113DB5449924D26A225492B7B2B2 салапаевки
1,666,273,791 *AF545167AFC49ED64160E13651F9311E197BF5C1 ХОРАХТИ
1,666,273,792 *AF5E98298C2B8D67A6FDCBFDAFA45432C85DC8EC LENNART-NIELSEN
1,666,273,793 *AF52937C0B7B3539A38BC78C12A1B0FE28E7B21D LESSISTEK
1,666,273,794 *AF586BFF19FC5E687086BD03885A1AD12B7670B6 LEVITSKY160P1608789
1,666,273,795 *AF5DF40A8DCDDC64D28502AF36E87CF379E017C2 LEYDEAJUSTEAGRARIO
1,666,273,796 *AF5F5C3885D1CA222159581A79A0C456DEC5F0D4 [email protected]
1,666,273,797 *AF5348C86668AB6892525CB489B9B9ABE3D16F74 [email protected]
1,666,273,798 *AF5FDF4B556AB97FC60EF1398463DB633B45B7C2 LIFE:-STYLES-COMPILED-BY-DJ-SPINNA
1,666,273,799 *AF54A34445BFEC7EC3331241182D4B94B358EE67 lightelwood
1,666,273,800 *AF58533654B5D2D8DD5348C68A8E4469FA15BB12 LISPANOS1
1,666,273,801 *AF53022BA3775406D7C677E312A38FCA2AC2400B )0(O~qB
1,666,273,802 *AF526F0AF3B8724362A84C22ACBC5E11872AA800 LOGANMARIA1
1,666,273,803 *AF5EF78858184D28BFB331B8799FDA0AD2E9223F lonnybonkowski
1,666,273,804 *AF5C1F159B0BE3FD4075D29A5485681F7DAAA2C4 に抵触する可能性あり。ケースE。
1,666,273,805 *AF5DDFB66CBC1C124B33F9624B1199D1F458DF74 清水翔太『UMBRELLA』先行試聴実施店舗
1,666,273,806 *AF5BC4E308E24703AABDCC68543D7C4C9045C474 lupario3
1,666,273,807 *AF5E5824AD16744D5006E0D46C538DF3F11B3006 LYERKOTI
1,666,273,808 *AF5374AACFEE42E3B79A8F9D433ADA1D88D17C4C M4NTIVSS3ISVOS
1,666,273,809 *AF567AFCF7B2237890CFBB844947D64E3E4BB05F M8{
1,666,273,810 *AF5B073A46FDAFBA9357FF7427259CD15BAE7097 maagelixirs!
1,666,273,811 *AF5F48B738A8A302FFA38D9CACD11C0BEC0E856A MADKIDS
1,666,273,812 *AF5B127CBB4B3DB6A60CC1A2FBF4E8EA13F01D27 mailbox
1,666,273,813 *AF56C8F8A617BCCDE42F54D1F7A653E5AF017739 [email protected]
1,666,273,814 *AF588442F83E9B4F741BC468ACB88BB8F91D39FB MARKABANTO
1,666,273,815 *AF50E442BC94174E316E0B81BD765056A76E2D3C MARLINI
1,666,273,816 *AF5DE8A8935CBC9038964F887C1A99C6C434249E MASTERDOCTOR
1,666,273,817 *AF5895FCC1862D08EEB3479B1399CA9034F51853 05-26-78
1,666,273,818 *AF54221CC2E7072D2BC2C6A3AED603E777B7423C 1-COMPUTER-WELTRAUM
1,666,273,819 *AF58F89B6ED741C3ED74EA4A9B975FD760CCBC04 MAX BRUCE
1,666,273,820 *AF5AA880C249A7CC33B3DCA8A3D493ECA3FA53C0 MC4252
1,666,273,821 *AF56D03875CF94EEB9D2EEF372C54A4F9EAF7A6D MEANNICE
1,666,273,822 *AF56BCEAD11A1C8B232A133BE12EDCF28DE22D22 1FIORITI
1,666,273,823 *AF5F15F159A357B38F7246EF7FC1CF3A214FC194 MERVIN.BEAMON
1,666,273,824 *AF52A8F04F1023E367B8DBB56917BF1441111B38 [email protected][email protected]
1,666,273,825 *AF53067A952F5EA145E003343ED922A5755AB891 [email protected]
1,666,273,826 *AF57842D61CCBFA19C325CB19E9F3978BA937600 1JENSONS
1,666,273,827 *AF5A053FB26462EB7EFCFEACDFC96E897EB7F87F MICHAELHANNS
1,666,273,828 *AF500550A44FB356DEBE6CF4BA6FECDAB02A7880 1 KERTOS
1,666,273,829 *AF56DD7980DBE6E927F2C9D65BE5D8CDC632958D 」の1コーナー「MAN★TENウォッチャ
1,666,273,830 *AF50B18D1D9F760AD1E40E5BD97F87B687ADF741 1 musatiimi
1,666,273,831 *AF5D698700CD75ECE275CE63EA97C18AEFC93C46 MILAN.GUBBINS
1,666,273,832 *AF565F15C6EEBA6E6C3E310D48BA7E352E2D0684 1NTERFOL1AR
1,666,273,833 *AF5D9DECAE34C3DF5F302C949E9744515F1C765F 1 PALOTEHOLLA
1,666,273,834 *AF5C4B5D83E87F593210F12165952CB476891FC9 MIT-30
1,666,273,835 *AF5FC0B9A472985725C2F1726253C5B75A102917 MM?*
1,666,273,836 *AF546DC3968AF7BBC8FBA3C14CB8C3C8C4599363 12Z02020202
1,666,273,837 *AF52D3610E818539DCC6DC55074D656C3D4B8FF3 [email protected]
1,666,273,838 *AF52668B088CBBD95A2FFA4590C08A16F6BC1948 MOHAMEDZOUCHA
1,666,273,839 *AF501D9B59B9536BD25C0BC6F7853D686385BC81 1472845 kunnanerityisopetuksenkehitt
1,666,273,840 *AF59835C9F96E7B41B11A1F59C5756A160CDFE95 1VASAVALTA
1,666,273,841 *AF5DF2E9047936554C13A708B8CD012B54903045 20051222
1,666,273,842 *AF5074ACD485DFB109935E05FEE6769801348897 2157785 LOHKOMINEN.MAKSAA.NYKYISIN.4000.MK.M
1,666,273,843 *AF507728F8E0ABA6B5BAB9E6D3282B6FC5DE087B MUNICIPALISTA
1,666,273,844 *AF51786DE05C629EB16780D7716E5EC50507D2C4 2741entrad
1,666,273,845 *AF59594CE8E07ADF22B8480A74EA146FD53543B2 2761497 VITAL VAASA PROJEKTI ON EDENNYT SEURAAVIEN TEHT
1,666,273,846 *AF5B06538C1A2917A14E5619B6B57FCEC538F0FA MYKEEPER79
1,666,273,847 *AF556A414B3AFAA5AA8766D92092E74AECA298D5 n0k8
1,666,273,848 *AF5A02053EE16A4FF2F77A4E140FA0CAC3364C5D 2FARMIPELAAJANA
1,666,273,849 *AF575DBE1F81375A70FBA0A417703849DAA332C1 NATHANIEL.BEVER
1,666,273,850 *AF5BF2CA8BC98970AFB192F9DEA0AD6D4D299CA5 1971147 heute.steht.er.nur.da.und.schaut.in.die.gesichter..
1,666,273,851 *AF58EB4C34FFBC16E79A1B42FD5D98988675A011 neck786mutt872
1,666,273,852 *AF557DD09D9982DDDFAB3655AC3A30CF56BBA69E NEILMIHELIC
1,666,273,853 *AF5EA04105E35C62FACF3B02F5CF0FA8C50EE2A0 1 AMORTISES
1,666,273,854 *AF5E22CC56A63BE984DC8E56F006D6D3DE378E3E 2 LIIKKUMISVAPAUTTAAN
1,666,273,855 *AF52ABD2D94CDCBA5B5D7DA2166E907C707A3C44 NEW-EDGE-RECORDINGS
1,666,273,856 *AF5C089AFC6D241CB674CFED61A4A8A79BB75595 1.bmwmodellpolitik
1,666,273,857 *AF5374625A18673B789514FDEE8EB39C5EC19A6F 2 PLUTONIUMLIEFERANTEN
1,666,273,858 *AF5055EB7BAD1FFA9A4016CAD655E390D01E61E1 2.PSYKOLOGIATIETEEN
1,666,273,859 *AF564D5506DC9D8367E4F0056FE85CB1F42EC68D NICKOLASCAFFERKY
1,666,273,860 *AF5FC293AA677098D814405C8C5255C1C5483494 2THATHELP2
1,666,273,861 *AF5A043A1B4A03A89C35FDEC17B287EC8E387E46 1 EMUKESKUSTELUA
1,666,273,862 *AF5CD801E47147642C0C17651F2C94E1945229E1 2.uyumuStur
1,666,273,863 *AF5B27AEE3916A49BA65E87E17FC62AA7699FEEC 1.FILLANSBASED
1,666,273,864 *AF505D851557D8A65B5C454CA855167DFA56DDA3 1gee
1,666,273,865 *AF5E8826C13040939960330CF9E9FD3C434851E6 niyondaed
1,666,273,866 *AF5C34913DB81BC521E47E34BAE7DC0075FF51F3 300107 mets
1,666,273,867 *AF557E43A27DBDC15BA17A3E7FD9E04B3564D346 1HOMONYM
1,666,273,868 *AF5D9757C205E046066A6AEB2ADC308469020F06 1ILVES-KANNATTAJAT
1,666,273,869 *AF527D892E8D0CD7AB1FE1FD18F4EF358738DCE9 NOEPARISIAN
1,666,273,870 *AF5C02041BA66A6EC2432249E5E50E87B704E9A6 [email protected]@BL3
1,666,273,871 *AF5DED0D7974350E820CEE81A145F1EC6ED92835 1kpi-nachfolgepartei
1,666,273,872 *AF57482CEF9F48861706C374197C73092D90E895 [email protected]
1,666,273,873 *AF52789C61196A7305DD7C4FCCCE1AD5E605DE01 NPONTEJOS
1,666,273,874 *AF59549C0E8289640C1136D5F09DB71F1F35CC03 383276 NELEPP
1,666,273,875 *AF58285B1F36A812C6BAE99CA9656B3B438C61C7 O5RZQ1GY
1,666,273,876 *AF56197EA916A8672F07D7A90D59D1A2D139849B 1 PALKKATY
1,666,273,877 *AF5DB8AF33DD90C53928AD1D5D3B2098FD5EE178 oiltightness
1,666,273,878 *AF5C5CD03807FA94DA8B1238CBAC3FD640DCF04E omerneering
1,666,273,879 *AF55D53D2E2FC8BC19B18B0B575833588FB68C3C 1.TIRPPOJA
1,666,273,880 *AF5E7A50F6352DD6E0F47F09DE11C32C53594315 1 TULVAVAHINKOIHIN
1,666,273,881 *AF51D2C447593AA922BFE6BB1F7D996A1E226673 On Top of the World (feat Larry Hancock)
1,666,273,882 *AF56C511488A6B72EE4911153EB7EBBBB0331044 1verleger-ausschusses
1,666,273,883 *AF5F013FDC8FD6D9A07C732940EB5E8268A17DA8 1 VOICI-HERAUSGEBER
1,666,273,884 *AF5EC1637F933586340EE10374A7BA9265A8ADAA ORVILLEPRIDEAUX
1,666,273,885 *AF51FF1E8D5FF7CEE415A97F08BC6706B54009C7 [email protected] ~O )X(
1,666,273,886 *AF59B467F813A9723E2F64168169CF228D596773 OTOMENSHOJOMANGAGETSLIVEACTIONTVDRAMAINAUGUST
1,666,273,887 *AF577C2DB10EF17ED428E29E9ABE66624C3E27D0 OvertheWastelands(Orch.)
1,666,273,888 *AF58C13775BE613D48EBB199C571B1E6D9D071B3 [email protected]
1,666,273,889 *AF54EA24E77DC68FAC09662A0D62BAC54A407EEA PABLOFELDT
1,666,273,890 *AF5F5C747904EFB94387478E73D6E16973C32255 panagiotispanagiotakopoulos
1,666,273,891 *AF5B1E98EB0010B07CDE08018B95954642EEC737 2352234 tutkimuksissa todettin , ett
1,666,273,892 *AF5E4DF61F2B4BCC2FEF57BEE9B9474E28AFD875 23apr1732
1,666,273,893 *AF5EC47334DC2EE854E13A64D415C71B00FD67E2 [email protected]
1,666,273,894 *AF531C383AA0F9D4B7A844D7876E674E1D97BECB parkerpalowoda
1,666,273,895 *AF5E86293F3D2BC7E7D6C7DE31997DA4D07BCAC1 PATCULMER
1,666,273,896 *AF520E58526694C4B1BB20CFAA760E9B6C3E075C PATRICK.GENET
1,666,273,897 *AF5C8DBEAF48EFB884241104702A50C5A150174E PAULRADFORD
1,666,273,898 *AF5B5CDE1426D03D87EA18AACE68E6A56DE664CA 26091158
1,666,273,899 *AF5A56C3D84EE17F26B09A033B5993917953D418 4REBLODPLASMA
1,666,273,900 *AF55B62FDE50097837C635364DBBA4946B590C41 peirsise
1,666,273,901 *AF562EAE136989D2C7ADB5B71B15B96E4E884C57 4RR3F3NT4RLH3S
1,666,273,902 *AF59530EA482A4EC88B07237ED7E40785AE279C0 2957866 vesi-.ja.rantalinnustoa.on.selvitetty.alhonj
1,666,273,903 *AF59DE6C5E77C797E97E363F11325CD4C931BF5B petalingjaya
1,666,273,904 *AF5AE582ED3A7526F6B18DA342AA58D8F5492B72 [email protected]
1,666,273,905 *AF504314E2C2912C3124227D3E6BA45B2D65AB51 2 couchandloveseat
1,666,273,906 *AF5F93F5FF1DCB1D4C37B3E1D1C0AAE9565F60F4 PHILBARKER
1,666,273,907 *AF5E7A65B902274F5E9771CD06F9DA87E1C65915 PHILLIP-SULLIVAN
1,666,273,908 *AF51DADA0D6D7EBF46322A0107C4F1538A22DB81 2fkiagh
1,666,273,909 *AF5ED3386C0E655B75504218C302231B7DB25C29 2KANAKENSCHWEIN
1,666,273,910 *AF5A3758BAF5F6C3BA8B11F55627A1C92CB8BDAE 2-KOOSTUMUSSUHTEINEN
1,666,273,911 *AF564DC41D3B5A4FF23A244AF18DC511EB6C3F2D [email protected]
1,666,273,912 *AF58DEA0B1E6DF32F2DAAB2EAD4A21D40D617E06 2OTVORILO
1,666,273,913 *AF515AC0E028DECE501B81E35E93959ACB5C96BA 2-RINGE,-2-HERZEN
1,666,273,914 *AF51F12EA45BC7404A4343AE75B39699390AB28A ploy.pb
1,666,273,915 *AF58459CA573CF30707204BA6EC8EC411030AD41 PO1YTHE1SM
1,666,273,916 *AF5765DCC8A35D175AE7FB17AA2673C98C203439 2-suksametonin
1,666,273,917 *AF583D82F254983980C7DBD75121D8A3599207EA 2THEMANTRA2
1,666,273,918 *AF5B8A2ECDD3BC41968FDEC4883F7B33461D2745 2 ZEIL-VERANSTALTUNG
1,666,273,919 *AF5D9EA50BC7975F365C64238F29462858D5234C PPHATHRATRATHIP
1,666,273,920 *AF584F6236E5BC760A492303A3F7220422304791 5HTAEDSSE
1,666,273,921 *AF5A07CB3F24786E3BA6992AC54FC2F73B86BE39 3904naters
1,666,273,922 *AF539065E1C97EFC75FD064BC636DD459BDB65E6 precious.body
1,666,273,923 *AF5AA0BE7C640760B93EB7E873163B3C2C0C26C4 5SIDERUGICA
1,666,273,924 *AF5B3628BED8009F61072A90F98F3A5792BE5AB9 [email protected]
1,666,273,925 *AF5E6EE179ABBEC54D755FF55E7E3301F647B42A 5TREMEDEIRA
1,666,273,926 *AF511377861D70A8E13E7E053E784244417E1B66 3INLADDAS
1,666,273,927 *AF5D43A2C5F116C6103C3ABF080A6173A8AB227D 3.kolorits
1,666,273,928 *AF59402035177C971ECAA9BEAC99627A35E74649 [email protected]**)o(
1,666,273,929 *AF50586F9173CFED72BDF622F167EB0BAD771578 659DEVON
1,666,273,930 *AF51798D0A78E381D812C6D3C029A2717BB7421A p#>~-)x(
1,666,273,931 *AF5CB26264C6E425DD108570EB9940552DB08B3B 3SPARRIER
1,666,273,932 *AF5C41FFFA2D818EEA7B6D545A8BA683447619FE 6BSWETECHNICALLY
1,666,273,933 *AF5E060A27B4068ED537EC0A416EE1B7D21F1A6D [email protected]
1,666,273,934 *AF55DA9263819AE227BF78F58E73305FF0067B53 [email protected]~(O_-)
1,666,273,935 *AF59315FA4772479BEC6624F09460E638FABFC1A 4PROGRAMMLEITE
1,666,273,936 *AF507B62CF40378DE4244A4285D80813534DB343 4STEDELINGES
1,666,273,937 *AF5162FE9392199717C4E77EB227E0887EBE766F 4TRASPARIVAS
1,666,273,938 *AF50E6238F9573294A91C44868E10733AD035ADF 4YXODIMA
1,666,273,939 *AF5C766C6BE30592D20E04B5ABD352E12A5EA07A 6GABYWATER
1,666,273,940 *AF594907AD50A2C4C3746C612E856470818CE913 quantsquants
1,666,273,941 *AF5010F296FBB2430D323E8808074D0A872B28E8 QUASITECHNICAL
1,666,273,942 *AF5F88B3F2009E1CAF21F1CA759B2CCAA1423B7F 5DATAFIRMAERNES
1,666,273,943 *AF516E0CC1F4C0BF8C51901A4500B6B6BDC9B646 6kacox
1,666,273,944 *AF5FA657BEEC0707F71783D018CFD28D9619334F 6KOJIROBSW
1,666,273,945 *AF578899E469A56459D3CB657270BD73B694A8FD 6MOGRABIS
1,666,273,946 *AF55EB49D45F9EC8343BF0B66A15FE8B565C4FEE 5GNILESSIWWUEE
1,666,273,947 *AF503D8490626E6422554C70AC484D8C0D6AFAF8 6PENAALI
1,666,273,948 *AF5DED4789062B8622CCD447DF0B7191F35640C2 RAMONGABRIAL
1,666,273,949 *AF5CFF9B4026CCEEEE79F299F3C7DBAA5570E8BF ramonvalenziano
1,666,273,950 *AF532E40705F67C3DC2D68DE8FB977D924C92013 RANDELL.FINNIN
1,666,273,951 *AF57BC1F4B8EAE646C2F3E180949641B9127D7C6 5RESTRICTIV
1,666,273,952 *AF533F2FBF6F1E96A98C7AE8DCFFEDD8AEB80310 raqueldigger
1,666,273,953 *AF5490F143C3E6CCD4FAE312656B4D9278A03E14 5ROZTEKAL
1,666,273,954 *AF52B9FBFFDD7121EE8E4771511B2BF507200BD0 rastalulu
1,666,273,955 *AF590865F3AF5B277EA209610CFD6CB8FE385BC0 RAY-O'SBOUNCE
1,666,273,956 *AF50122691E5832CB51634C5CC5B8F77C9C0F4A8 5thatfreebird0
1,666,273,957 *AF58D9E6182893E6B8D04B5914AECCC89F7E5A4F [email protected]
1,666,273,958 *AF59FB744A7811F808DE239FFF07F069465AEC39 REDRUMGRATEFULS
1,666,273,959 *AF5ED32F283C79EA1AE7DC427DF130122D9BF646 referencesin
1,666,273,960 *AF5660A5AB84106EA26648FF13AC64086DF9710E 617864 KAUPUNGINHALLITUS KATSOO , ETTEI SOSIAALIHUOLTOLAIN 26 A
1,666,273,961 *AF5DB7D93EE1B15B2EB7EA0D651191AA04DC0ED4 7EHCSIROTSIHTSNUK
1,666,273,962 *AF53471CE163C515F3C8F31200CB4925B066442D REPROGRAMERS5
1,666,273,963 *AF5C6A07556727A44D6D8D486F6E407CC023C898 6ECBOLICO
1,666,273,964 *AF52D9FA06ECC564C9518EC6A4741F9FA1E780CD 7NONDENSENESSN
1,666,273,965 *AF5C1C61FB6F53DC67B1BA848286AE97B472E15F REUTSLAGENS1
1,666,273,966 *AF58E946D27158D26F097C4528F3CC39E3D2AA23 REYVIDES
1,666,273,967 *AF5E6AD312AF3338CF4B52AC4E1F3E9BAED30CB1 REZNORLOUISE2
1,666,273,968 *AF5083875F4925F410C7311F07ECBCE1C4B1F203 RHADIAT
1,666,273,969 *AF5BCD283998EC99EFEBFF6022FE1F1D8608B15D RICHARDBEGUIN
1,666,273,970 *AF5F05391D9157174D8584228908725B6DC1963F rigidist!
1,666,273,971 *AF5FDCB6A366A5CEE2E86B8A176B86F7615CF800 RIYOUT
1,666,273,972 *AF57C1272C8A451180804428CA3A74B8F3DAC7FC ROBERT.BLACKWELDER
1,666,273,973 *AF561D2896B5BD7697C6B630F6286DCAC2089F29 ROB.HAZELBUSH
1,666,273,974 *AF510F478CCF658AA458691A2B67C4750E5F1149 ROB-VASSALLO
1,666,273,975 *AF586069D9CCEEACB572AF31299C5C3C7D710DC0 6ESNEWNAA
1,666,273,976 *AF50C451BA62D6120F9D03C563E0998584B77B4E 6ETTEELL
1,666,273,977 *AF588507A9389E4C860F9357F8E53E58A0A00FD0 7VIISITOISTAVUOTIAANA
1,666,273,978 *AF56CA40F57FF733465D82A0E7146E268A78EF44 ROGER.KIBBE
1,666,273,979 *AF518661CE2B31075F7B75279F763942C9AC62FD RONCOSP3
1,666,273,980 *AF5CFF843E88B873484C4AC5A6C6FC0886146EE3 ronmedawar
1,666,273,981 *AF577893B6A784DFC554F2DEF921EBE414C6D221 rossabigantus
1,666,273,982 *AF53A18DBF3D3E3398BC3CC7205CADF3A24FC1FF 6retainable
1,666,273,983 *AF54B5F204733F1322625648F799DB88562440AB 6SUNDIAGADD
1,666,273,984 *AF5F0141D788E134EE5C1951D80E23652A550B96 6thatnancy4
1,666,273,985 *AF510D4C26AFF2FE92DFA1C93CF4106D6D9E0DA9 [email protected]#$%^
1,666,273,986 *AF53048997241AB8C69AD8E9BDB49B727B01E1D2 8miserabili
1,666,273,987 *AF5BE7DCD27B218859BFA9DA86BD9A74F4643B06 7B9E1F28B15D3FA4975D07075118B86B
1,666,273,988 *AF5902BB396AAE31A386AEAEAD3CCBE2E361DCBB 7BILOCULINAS
1,666,273,989 *AF5415E1BBC447CBC411DD69163A368A5A8FCDE1 96e7d6fdf309ad8f14c9c10ca905bd31SaiRam1209
1,666,273,990 *AF5ECF56975364A7BDB348D78BF5A7CAE08C0C57 7CRAIGENDS
1,666,273,991 *AF53850DC26E33C303CEAA0F883930CD02C52369 9ALLATFORGALMIBSW
1,666,273,992 *AF5694EC01AAB08EB100E7120AA010696655F840 7DUREERUD
1,666,273,993 *AF5351CB277B7D7321A09FB7679213CFC2000C43 SAKARISKERA
1,666,273,994 *AF5589167C3FDC1F065BEEFABAA25DB908F96C01 7hink4b1e
1,666,273,995 *AF53E7E35327BF97939551AEB05AC0A47674C936 samualmonteagudo
1,666,273,996 *AF57C98A021A516BDEC645532E6B64A22A708DF8 SAMUAL.STUDENT
1,666,273,997 *AF5D7CAF592A235365CBA976E347636F5927C9A4 9NRAYERAS
1,666,273,998 *AF5A469BC1BF11C91124E6AFC6021FD2C2781DD1 saredrat5
1,666,273,999 *AF5779B728A45683B8636BB45E52464C98D138E5 7WRITEOFFINVALIDATED
1,666,274,000 *AF55771397D1E88C7DB502CEE3D8FC0B39ABAEA4 +7YPE
1,666,274,001 *AF5751455384FD75F623C3634AAB9D4114E315AD 800 ТЫС
1,666,274,002 *AF54BEDB91B7A056E26DF0EEB5D23A4DFE82C605 savante4
1,666,274,003 *AF5E90A3BE35387A89CD9E1C89EEB404D099B2A0 sccevents
1,666,274,004 *AF57520F8B9F9A65E1999008654721108F61F545 a1u2p
1,666,274,005 *AF5928E0B01D8F5AA823534CBAF6A09A7601B32D 8211971
1,666,274,006 *AF55E133B5F5FBC1E68EA66CE8DBC3B55B476A36 SCIATTONE3
1,666,274,007 *AF5C0E123C033997466F3800048D66D7ACAA9BA0 SC!N7!11A70R
1,666,274,008 *AF5BD622190D9D5EE0FA46A671E369B49602DE3D 8BRINGREASONTOBEAR
1,666,274,009 *AF5C3D438EB660929770BEB4F6AFE560BEDD2FE3 8BSWPARALLELTOPLE
1,666,274,010 *AF50F06B3BF6D02A4AA3F2BA1E6121462D138C19 a8lc8
1,666,274,011 *AF5FDE312AAFECA39E09455D934BB991289A0652 SECUNDERABADBSWS
1,666,274,012 *AF5946249EBECBEBCA755B748BFFC469DE7731F2 8=d ~o (>_0)
1,666,274,013 *AF5956370D79EAB0C2DCCDBAA5726C6D37D63F3E 8ERRRGGGGBSW
1,666,274,014 *AF5F72B5F23B061577D885F4518EF5AA5F704647 AAAZ~D
1,666,274,015 *AF5BFD2EC21D9427D9B3EFDB4934F6C59102D607 aab#5m
1,666,274,016 *AF5CED6AD7307FAE460782F6DDB369AAB1FD78DE aadmuy
1,666,274,017 *AF54F25B843C7C4D4AAF5DAD0897CB4AA50B7304 8RACCORDERONSES
1,666,274,018 *AF53BC1B0FA391C1E1996178661A43FCDC69BAF7 8REWEIHNACHTLICH
1,666,274,019 *AF54F4BB3D348D25B02B80C3F29B27F10B786E2F aaxhy
1,666,274,020 *AF5F523B7E29C1B538DEF9F560F3F103EF0EFF67 8TPUTTEND
1,666,274,021 *AF5CDED6E7F2414594B14F8DEDF0089AD8533FAF ABF9;
1,666,274,022 *AF5E44E06A3AACAC53558FE0E51CB1755C42C130 8UERTIGEN
1,666,274,023 *AF5B2875815D45A15F177521003ADB3752F9B3F8 shalier
1,666,274,024 *AF59D322FE48BD69518E560FE20B724162A59D02 ACCORDE-MOI (FEAT BOBBY VALENTINO)
1,666,274,025 *AF50969F28A8BF58508C8FA66058DE1D014A2BCF ACREDITARLE
1,666,274,026 *AF572491388B861EDD8582230DBE4B3C8BAFD6C6 9ELOHELKNIW
1,666,274,027 *AF5A8DD1E733B86FC9437E4A70B9C127DC2B6FD6 SHAYNE.LADABOUCHE
1,666,274,028 *AF534EB711F5049E2C8C45D5BBB2FEF8F5B9963E AD3JK
1,666,274,029 *AF591B25266EB0B0E13C381DE74D8087391BA506 ad$c)
1,666,274,030 *AF52281234F5B7D1F39EA2CE312D9DCCCC06A170 9LUGLEEGTE
1,666,274,031 *AF5E31FB3D388851CDD675F091C7DCAB7DA20D5A SHERWOOD.MELKONIAN
1,666,274,032 *AF5834DE770C3A76248785EEB37182E868A11AF1 shiralee-harnett
1,666,274,033 *AF52E5B60B5A9933C835F0A3A77DFFE0901A4543 9REALITYMARKET
1,666,274,034 *AF5342A225639304E76030057F03F52A2FB7AA55 9REASIEST
1,666,274,035 *AF527A969DF8B879D2EED486E7B170B88AC14D55 SIDROSENKRANZ
1,666,274,036 *AF5A3EC1E620A92DFE3D62A73A67B5199C45C360 9WHITESHADOW
1,666,274,037 *AF531E5D5D3171AB926936F38B4F1927E3D0A8FF af,?m
1,666,274,038 *AF5C8B0AA946A0E20DBEEBFABED27DDFD4B92D39 AGUSTIN.PERLSTEIN
1,666,274,039 *AF5C90738A049A66A6095A5396267FF0542F6CB9 a5w5r
1,666,274,040 *AF5ED841108C4EB4AB7F3EB907CB52775B654B70 Aika-haavat-parantaa
1,666,274,041 *AF5748D8138C5FEC82DBC80C2D4467EAAD831172 aa+,+
1,666,274,042 *AF52951F575FFF1CF856493386ACBEEB4E46BB68 al.alvarez
1,666,274,043 *AF5AD4D4C690E3277A410D7A4529DF10E0766266 ALLYOURLOVIN'(LOUNGEELEMENT)
1,666,274,044 *AF56F792C3F523D914512798E017FEA2E5530008 ABONNERIONS5
1,666,274,045 *AF58682D806C50BE4E5ACF1743C17B67552F8778 ANIBALALUKONIS
1,666,274,046 *AF5AF45FF12BE4C32B21BA89AA8AE257F53A392C answersupervision
1,666,274,047 *AF59DE590FF0EACA98033FA41756AAE0724F9286 SREGAJNEVALS
1,666,274,048 *AF5E63444177A127FB1728ECC481C22AF4078709 A.P#
1,666,274,049 *AF55CE29B8DCA2108E0C9F6EF097E0CE404207D3 STAHLFASER
1,666,274,050 *AF5F65AF7720D908259A55C13DAA88EAFCEC0AC3 stardom's ceo intro
1,666,274,051 *AF507F6BAD0A6338D4FF1E5DF27137920AE9AC15 ak=ne
1,666,274,052 *AF557FE9E29B38032DBF4489313A3A3FA9DF7FDC a?rhk
1,666,274,053 *AF5817AE4398F7EE3F589C12FF2C5850724262D4 ALBEILEL2
1,666,274,054 *AF550B50B8FB4B3208A2AA93B226AB14E44DCD05 STINKY.FIRE.ENGINE
1,666,274,055 *AF59FE68626E4FA3F01582D924293986F0243DA5 AS78D
1,666,274,056 *AF562BF16A07FB6BAE281B0FCE3900A0DD3F3CBB ASHLEYLIFLAND
1,666,274,057 *AF5C1BEBDA0D88642E7DEF7F4E30082A92D9200E a}T
1,666,274,058 *AF549D2CA22BBE64EF9AE7B40B0EB7D786C79155 at9qp
1,666,274,059 *AF5F1B2F60D7ADB8D60AF9E52917769D290B67B6 a)tze
1,666,274,060 *AF5C48F53C0230047B4EC37BD7A85D7F15E51761 [email protected]
1,666,274,061 *AF5D588CCB047F87828B92BB675AC8343E3FCB04 AMMEBSWS
1,666,274,062 *AF5D4A172A5A3E19BB4E7757CFAF2B779A3CAE1C AV;C-
1,666,274,063 *AF500C6F610FBC76D17B4F372DC6D1E32925E8BB a:vf
1,666,274,064 *AF5FF8682D0ECCAF19C769A3F20FD1507F002782 [email protected]
1,666,274,065 *AF56002B01F1D2ACBAAD2BB8ACDC6EC018EF2A66 angiefoxes
1,666,274,066 *AF54C3FF8E337E1AD742408BEF73F4B3C352FE2F AZMANHASSAN
1,666,274,067 *AF5409B47AF57D2EB7012E8FF175C80BD31CCC20 antoinecastillion
1,666,274,068 *AF536F9BBDCF2DABBC895F53324364D274CC6EEE TALKASYSTASIA
1,666,274,069 *AF57CC807D0579F56835449BBD2AFD94EAEF44B3 B0YLI
1,666,274,070 *AF508532C0A2F3BE6C276BAC6E252047ED78D40E B1?E
1,666,274,071 *AF5E2285A31EF609E8393D0DF29DCE1C15AA9C98 aoboq
1,666,274,072 *AF5C54CF76FC20CAABA79EC4E54F1A60414E7722 [email protected]
1,666,274,073 *AF552A7AAD944642FC45680444F84DC04FA72E01 b6q(
1,666,274,074 *AF5D6DA9A5ED57DA070A52A46723CF80298512A8 armatics
1,666,274,075 *AF5D40704F2BA042323A2490BEE5A32BF2CEDFB7 baggage_cart'b/&/g/i//dz/_k/a/rt
1,666,274,076 *AF5DEB051275FCDCEF2B39A21E027038DC9CC74B [email protected]
1,666,274,077 *AF59C50EE67E8E7E7E806638DFAB9768F7D22BFE BANAMAAMAMA
1,666,274,078 *AF5011091B3EC8CD41B6444E469B36C7B7CBA38F barbaraparslow
1,666,274,079 *AF517E63C57B0D1C5C1E028A2043EB80FACD5145 B---D`~.`~SPLAT
1,666,274,080 *AF5A0576D80D2B28C272521667E7119BF70CB214 THANH.OSDEN
1,666,274,081 *AF5D57F1A7694E5E0B233ED8547094D76FFD6397 THATAMERICA1997
1,666,274,082 *AF50085445979FAEC5E2B800C54CA1E82D812FAB theairofone’snativecountryisthemosthealthyair
1,666,274,083 *AF53D9F5361D4B188E1D5CE1C951597EE706949B a!ukq
1,666,274,084 *AF5AEB5F6B1E79867AA1F5FFFC1CD1BC74205529 belvalenargonne
1,666,274,085 *AF567B83ABD8185A1BD7EF17E223179668D3F9A8 THEPOUF1
1,666,274,086 *AF58FAC91930700AF64F1AAE5832F359AEAA4F88 bertmcferren
1,666,274,087 *AF554486187E2E0E08AB64C4C6EC3ADC1BFF92D1 TIGGERWOLFMAN8
1,666,274,088 *AF573C96688F267BE047A5F19A5B8EF7E3CA63EB TIGRESANGO1
1,666,274,089 *AF5623B239BBAFF8CA309837D6ADFCA88DA65D48 [email protected]
1,666,274,090 *AF5DDEB6ECDADAAB301116C11F01605278E2CC18 timothylico
1,666,274,091 *AF5F4EDEDEBE1E4858DF40311520DF2E057228FA TINGLYSNINGS4
1,666,274,092 *AF5EFF41D2F8C071BA01635EB14BA54498370557 bgpx;
1,666,274,093 *AF592B50356D34E2950F85D90D13AB337DE90E92 BGUPT
1,666,274,094 *AF5582FCA6A96FA853196B7A53F1DC7AC8118664 b4wsd
1,666,274,095 *AF5928B794F04FD9BEA24D06B70DEE308100B322 BISCUITSY
1,666,274,096 *AF5C11E959A55EE5D1B7174AB2F3DE443878A5D2 BACKTOLIFE(FEATPUSHMONTANA)
1,666,274,097 *AF5F19ED7A5B17C0B081B76A98C386099D122C98 BK(;
1,666,274,098 *AF52D1D2D1E06E0AED7C4E5CD2154AF72A3A69FA TOMMYEARNEST
1,666,274,099 *AF5157E28FF204A3974E9DB5B8F9FE70C6D3BC10 ba:n&
1,666,274,100 *AF5A42692F8651AFDF2D6352AC2659C96D09BB89 BLOCKISHNE
1,666,274,101 *AF54D691C14C707EB2799DC6950F75114DD12FFA basin-street-irregulars-(morgan)
1,666,274,102 *AF55D81E917C7B7B512E04A48DBCB3C0B353A67F Bat.Beats
1,666,274,103 *AF56465EFFC05381E3AD32E9920CBC3BE7C2DC7D battifol3
1,666,274,104 *AF5FF78B877597B0A81AC3642222FC6541620219 BBG(N
1,666,274,105 *AF525CE437632F421C3963EAD700B732AF3B483A BLUES AFTER DARK
1,666,274,106 *AF55E959DF117FCF5FD2CDE4A473467E9AA97EAC beauhowes
1,666,274,107 *AF51FDF9526A3F79B6A91B1036F19CD7857D71E6 TRAVIS.LONGCOR
1,666,274,108 *AF5074FCAAB2B0B1F57C84CC1C2DB3E05FAC7854 TRAVIS.SUDEKUM
1,666,274,109 *AF58A89AA4339BF3ECBB09D0C1DFE497992E2624 Bedf
1,666,274,110 *AF5E4F82EC2285604E3E20D3DA47C832DDB4ED90 TRENT.BATZER
1,666,274,111 *AF57789FB1775BAA9EE61D64B4528DFFD0C837FF bobhume
1,666,274,112 *AF509147B8938ED03FCC61E16A8730D55469C307 [email protected]
1,666,274,113 *AF5F666FACC65172D382E45E693711BAA6AB9A14 bōclēaf
1,666,274,114 *AF5011FED37658A72807481E3D0FCC515DE1209C bergvermessungs
1,666,274,115 *AF527CABA6BD3CC25596154D5588564D08BB81C0 bopc9
1,666,274,116 *AF50F2100F26A8A6AF5F8F8FFE19D1BE792B9E20 bornobodh
1,666,274,117 *AF5A91CDDA20B0F39263B18E9272FC911F2E1482 berun
1,666,274,118 *AF57AA1164367376ED776AB6F41FAC4E3B5A1280 BEUK_
1,666,274,119 *AF5F96870CFBACACDEA6FA9E1833D0EB5993152B BF1LD
1,666,274,120 *AF5B0D34E5B79E970B3EEC00481857B08B3FAB1F BP;_G
1,666,274,121 *AF5AC8EBF92E27346CCF4042642B460F573251CC b==p-~-~-~-)x(
1,666,274,122 *AF5CA36AB85BB060FEC7B2F7B6B1D78610ACEFF4 turco-v
1,666,274,123 *AF57ED3CBDF3982EF4CBF373B86CCC6A70DB57AE [email protected]
1,666,274,124 *AF5DD1D9B9FD5A15B36FD8140B73A0894D59699C brauazzo8
1,666,274,125 *AF56D6CB6755E8003FE57B79F4B4C6DC839B2697 B%RHF
1,666,274,126 *AF560377306CC7ECABA763B6C8CB0998C33C25BB bsfm-
1,666,274,127 *AF54E69AE1A001E0D9F4F7560A17648BDF50ED55 unity in dub (stop-go mix)
1,666,274,128 *AF50A4F3D28F9571A9F54D9138092459A4CD544B BULIANO1
1,666,274,129 *AF5E9647A02EF9760650175F31B945B9CE94DF4C b=w!b
1,666,274,130 *AF57E5CDF727F294B9305C44590EE799B058FF11 BW/UD
1,666,274,131 *AF5541D5F059449A461E1C83C7D10D85A88B4114 boydidema
1,666,274,132 *AF507055A78126BF4DAC6BB8E01407567497DB5C bozz2wht
1,666,274,133 *AF571018DA4F2FD68A4DCD29869AF8F66F640FEA C2SAL
1,666,274,134 *AF59727456E09D357682EBDA63510B99A3B9BF5C bradfordmokriski
1,666,274,135 *AF5A159BC7B72FF24707E228174C12D14CA31500 c7_d
1,666,274,136 *AF55921FAE1079E7C5495ED2ABD90658C3955997 C9G$/
1,666,274,137 *AF5D1525C9932836199FA7004D3248EB983956A9 b+rbt
1,666,274,138 *AF5EBF9EADEEEA6B95D641534AE58EBEAD589EC4 BRENTONPROTO
1,666,274,139 *AF56C35F895212EEDC4B4B601EC73CE275D7BEAD BRENTON.WHICHARD
1,666,274,140 *AF53AE5FE8AC258145A0C402CC85CB7CE8472548 brevigil30
1,666,274,141 *AF50CA078BE608A76ED04238A4224D380F5091B3 valentinswoap
1,666,274,142 *AF58213EC13C30F80841EBD62581C4748CF1BB51 vancegodin
1,666,274,143 *AF53E7A91EACA26B48510092AA6BF66A72EE5211 BRU"DERLICHEN
1,666,274,144 *AF5832BF9DA7862A82E793B3FB85C1C3DFF1F9D4 BSWINTERVIDEO
1,666,274,145 *AF591B17C55C0F77E4B7B21F7B3315A5937B4165 CAPCOM』登場時の年齢は765(
1,666,274,146 *AF55491FB5522A9BAA0DA964E77F138F33AEBF8E CARROMATA4
1,666,274,147 *AF5E3826D69ECAF7806F1BB9C68D6A8A89CDDBD8 budm(
1,666,274,148 *AF517B09E5E1E248979C850416E3A09183428A98 BUNTY SIAN
1,666,274,149 *AF5F41B0469475ACED05ADAA20BADDFD540215A8 BURLSLAYTER
1,666,274,150 *AF594C07D214A4C3E6D5D571D82F9C4014F46C9F busterwrinkle
1,666,274,151 *AF54B751F83D84599AEC62A30DF3A04097976396 buti'mhopin'you'llshowmewhereicame
1,666,274,152 *AF5FE374208E58F6028E29BCED4C8D55397EAC82 B"!XI
1,666,274,153 *AF5D556A6DD3F65A263481FB9A4D89EECB652C3E C2KN:
1,666,274,154 *AF50C611B3C7BEF6B566D79E866BAA9E94575C8A CATHERINE-II-THE-GREAT-RUSSIA
1,666,274,155 *AF56D0AC37A44560306C5290F6BF2FF3DA9BD4D4 CEDRIC.ISLE
1,666,274,156 *AF54662E4306E5BEB82D405D72BB651196CAF44E c)eil
1,666,274,157 *AF5031ADC7B76BCF72C51D18C9C4A66F4542D9FF censored76173255
1,666,274,158 *AF5350D16ABD10647111931992CEA7E6CBD72A27 vivian.chimmachui
1,666,274,159 *AF5A78C5922D1FBB071F0034CD7F469F7DBD2591 c/f5
1,666,274,160 *AF561DBD4C5E7BEF1B78EB851253A8E9E15C3747 VOISTLEMINETA8
1,666,274,161 *AF539FB0E5A4EC2BA0ED19B6D5FBB2DA0579F325 c:fqy
1,666,274,162 *AF54593FD93A89DAAD637933E26B7975BA3F2227 CHAMBERS-BROTHERS-THE-TIME-HAS-COME-A-NEW-TIME-A-NEW-DAY
1,666,274,163 *AF57E707D0B4B29E3F963BFA551B07375EF0729A changestorapleafservices
1,666,274,164 *AF5B405BD6211DFE8A3F812DE67EF694EE88852C CAREYBOEPPLE
1,666,274,165 *AF5A283CA07AEA29EFDB68D8D600E56EC8EE7CE2 careysoleman
1,666,274,166 *AF52DBB7956156CBF59B1A5B535E6020C13BBB6A [email protected]
1,666,274,167 *AF5F72FC7B53B9139753D91B2BE313AB30328359 carlosrudo
1,666,274,168 *AF5764F7DB200ED1D2EBF905C34FC9D497B91468 carminepaden
1,666,274,169 *AF51AB3A76E07D8B22A476AC83F6379F602E8A28 CHARACTERTALKALVIS
1,666,274,170 *AF5A9F9A82A8560E81C2555BF13457C8D8218A4C CATALONIA09
1,666,274,171 *AF50F89BA2CD11B727CE9821A082908AC4A23344 WAARTPLANTEN
1,666,274,172 *AF56FE5A5B57104BC847D45BBBC03FD0F91225F5 WABWIREISAAC
1,666,274,173 *AF58D16CA0A042E91F006CAE3C9616B292C2FD9D walkerhowlett
1,666,274,174 *AF54661B44AC62CACFC3882652F8669DD6BF29A2 chottomattekudasai(neversaygoodbye)
1,666,274,175 *AF55CB549E317AEA07D78AAB8A005F5E7EE3A3B7 [email protected]
1,666,274,176 *AF50074E3972076A76B9052E14013AA4AE356473 Cj+,
1,666,274,177 *AF551FE21AAE64990F9B8141AC978D26F9253378 CJNTTVCOMMONWEALTH
1,666,274,178 *AF5DA04A72224F6611F30BC24EBFC233327EE07F c$og:
1,666,274,179 *AF5CC288CDB29BEC1DD05C32FA26ABE3C1D9CA25 COI6P
1,666,274,180 *AF532FD34FFDB8C49950FD656CC3A58D234184CD coloncleansingconstipationremedies.comwww
1,666,274,181 *AF5FB1386B456DE1EB1A397E973AEBF48C576466 CHAPTER 07 01
1,666,274,182 *AF5698011EF077EB13A5A002EE466B90AB4488B0 WHiTEBLOUSE.SHORTFLAREDSKiRTANDAPRONWiTHABOW.
1,666,274,183 *AF55B1610EB6A21BE2AEAAFC2448C437CD6F6DE1 WHITLEATHER[OBS3];GRISTLE
1,666,274,184 *AF5314214A0E37D87A6161BA601838F12CAEF2FB charlessaice
1,666,274,185 *AF5B6D132204F079FC9606DF3D6132D959D4D567 charlesschillaci
1,666,274,186 *AF540377AD31A011502DAEB06BED09F05ACFDA0B charz-rosento
1,666,274,187 *AF544478410226D4F4A36BD1E0297218A52A654E chaupaying
1,666,274,188 *AF5AA4323CE5AA29E1EB662D4FB6DE52D071E0E3 CHBVY
1,666,274,189 *AF52666C1C92FFAB71472BB8CC8F0E566AE06B1B COR0B
1,666,274,190 *AF57F157A749203357FD0D3E79812D51A10620A6 COREY'S-INTERLUDE
1,666,274,191 *AF51352DCCCA1124D9A86204EC230CCC01890E9E CORTNEY.GORDON
1,666,274,192 *AF58849110B3F8D6F40BFADE2CF8AB943F91EFC9 willissa-mercedes
1,666,274,193 *AF5B41C1294ED2E451185C49865D87C1AA582D41 CPL!A
1,666,274,194 *AF597CC0FE0D3C77A2C78C1259688BA1113F586C [email protected]
1,666,274,195 *AF59CBF4E1ED7D54E2987FBFD15B0DA8CEB36FE7 WIYADA WI
1,666,274,196 *AF5730872508D7F4898A39672BE30991861C1AED WJASMINING
1,666,274,197 *AF55D77BC54DD874371FE12BB58CC963F4C4FEEA WŁACHII
1,666,274,198 *AF5D71780C01D04B0673B8F889F572CD6FAAAC3B C!Q+L
1,666,274,199 *AF57B0A8C50F5AA82FFC80EF644B7DC39BDA9B1A CIHIA
1,666,274,200 *AF52B728A443C94BD876B96F5DD64A87E698339E crimson0505
1,666,274,201 *AF565FA18C4BD2AB45B55F8C2479C637D37B311D WWW.ELEMENT.COM.HK
1,666,274,202 *AF5A7057DFFD21FA9A087833E0EA51868EB2CA98 WWWLIFESCULPTINGBI
1,666,274,203 *AF5C6F831ADE2563159B72896C874AE9672A9847 csoqb
1,666,274,204 *AF5C52524AFB0E0DDEE352934F909C1D5341A6D4 CLEARALL123
1,666,274,205 *AF56F8A662BFD41DE46C80993A20A56D898C9AC9 [email protected]
1,666,274,206 *AF57EA0AAF9567AE86C3F4D777BC287480A5E83B cu"rd
1,666,274,207 *AF5EA671AF8D54EB0BFA45B75727374208AB7653 CLG0
1,666,274,208 *AF57B7FCAB10AF4B36D289DC2C1EFC5924A509ED CLINT.CORNELL
1,666,274,209 *AF5F11C446CE0148FB0D7FD3C18AA34DFF77FB1F XARLOK
1,666,274,210 *AF55FEBFD2928D14EE2AA3C6798F9E4131D9CFEB XAVIER.CORTIJO
1,666,274,211 *AF5F10BF76271D20DE5BF29E5FCD380C5B79A22E XAVIER.MULDERS
1,666,274,212 *AF5761DE724636AB6B5864AB9AD2D2975A622EA0 [email protected]
1,666,274,213 *AF577F919388C1359A2DEC61BDFA0D37D0ED2BE7 [email protected]
1,666,274,214 *AF5B3B519C257BD6E02BAD2B84CDEB83D7BE8EB8 [email protected]
1,666,274,215 *AF5D01D00E29BC2B5C74901A38349795C1F609F8 [email protected]
1,666,274,216 *AF5B2142AA8A2F15A06BBBF8C18B98D0A78EB602 d4ba
1,666,274,217 *AF50E62E2A1CF0DD2B0F20A7654C9C7E088FAC19 [email protected]
1,666,274,218 *AF5CBC306EAEDDAB309CCD764D35331627993B5F yaldaazarbad
1,666,274,219 *AF59A92EC81D87C738CACBDCADC0D72BD5033C94 d5$mp
1,666,274,220 *AF561367AC5E20BD3A299D0694A417652ABF9E48 commeauxu.s.a.
1,666,274,221 *AF59EB2F16417C68CDA2979D446317D31932ABBB concerto in g minor, rv 317: iii. allegro
1,666,274,222 *AF55221A428D1608C3C58C5A8166AAB484933F52 DANS MA MAISON SOUS TERRE (VO)
1,666,274,223 *AF5C2E09EC8B889DC3FDCC00658309E036568210 DARELL.MASSENBERG
1,666,274,224 *AF5298DD23BFA76C78CDCE29CE126725A51D9E73 youngsaxon
1,666,274,225 *AF5B49C0E13AF31AE8CCDAAED956F1C0A341AE60 DARWINCASSIE
1,666,274,226 *AF5D108AFBA6A873A1152C214ADDC1080282CB84 D-BJ6
1,666,274,227 *AF56CED0F2F6BA3E91979B8BC4318914A4CE4D46 CRAIG.JASIN
1,666,274,228 *AF5555FD53FBB6CB9DA1A43D3E80A982318A2B20 crescent-with-love
1,666,274,229 *AF54B852114D8AA0DBB13EBEEF6D0F2EBA1E79DA crushem1
1,666,274,230 *AF57C70869DCE207DF263FD9275FC3AC46AA90BE ZAPPYK
1,666,274,231 *AF54F036E259ED5F0116B6D6B3E3D21F37DFC5C7 zatara-bishop
1,666,274,232 *AF53CE0A1822B3B42A5E7B91C26F7DF589E8AED5 dc,(i
1,666,274,233 *AF55325B1BBA010D23AACC46A057B20226A6AE7F curarizantele
1,666,274,234 *AF50368064C3DF6FF1411BF83A6CE4FB7EB971BA cu&vc
1,666,274,235 *AF5C8A01CCECD051CDD86155B0E979557AA69112 DECADIHA
1,666,274,236 *AF5F67553524DCB93F48C216EFE571613FEFC065 DEEL6
1,666,274,237 *AF5966B7CF42B858BC34DDDB4D8E98AC4F02D5C0 Z!JX
1,666,274,238 *AF5541DBFF02AB0A1E9AD2B75B4A7A1927397355 DELBERTYAUCH
1,666,274,239 *AF56FE027DE49C05F6352C34D7CC45DA77B22B6E cy$ps
1,666,274,240 *AF5097FF8600D1BAB39828B36AC846A6DDF770F5 [email protected]
1,666,274,241 *AF5472EEEFB3352DDA3FEEAC6900BA2E841FA7E9 d8aks
1,666,274,242 *AF55DA515B1954DB54560ABF248D60804616A9CD DFHPN
1,666,274,243 *AF59EA946E512C2450C21C9DA99541CF7BEFE0F4 d"g+p
1,666,274,244 *AF5B223E1F8782D5C399B4534CA6A6259370FB72 damiendeimund
1,666,274,245 *AF570CD4768D5172BE4F5A7D8EB31CA958E9B7DC [email protected]
1,666,274,246 *AF52FA8A43CA0C7C64D27E10C38F90FDDD5F919C DANNISH6
1,666,274,247 *AF574E388DE1141D4B99101FECDBFC0BB0DF41BB danny scherr
1,666,274,248 *AF5C07FA02A9D38470068CE79B313E15CECB94D6 DASARESE
1,666,274,249 *AF5580106075FCD8BD1F181824116D31D008A5D3 db4c_
1,666,274,250 *AF5342D9D7A4E7A0B88B62F708A5BAE2D9027E45 DBSPV
1,666,274,251 *AF5BC955AB7B21AC09C3ED809E6E7CBF894C76F7 ОЛЬХОЮ
1,666,274,252 *AF55102B2A2136FCBC7A6F19878DA49EC1480345 D=?_L
1,666,274,253 *AF5C9EE009B19F72A870F9ED7EA1B456BA57DBFF ddr=j
1,666,274,254 *AF54C2957946A5E8F5F5D95B95ED0F380CFBD1CA DNYL
1,666,274,255 *AF5E46A7AB7CC431BDFD30A952C30A742A1FF3FA DEMASKEERDEN5
1,666,274,256 *AF5D524005558F8C8EDD6A1FDF555C29B4FE9C1D [email protected]
1,666,274,257 *AF50AE26C02BF337D3B42E4806148C791640D080 DENISHAWILSON
1,666,274,258 *AF530F93956F45EEF040ACC98EEDAC6AD4237FE4 denvermorario
1,666,274,259 *AF52B0806898D4A48DE5DFC033FF2C3049B12ADB [email protected]
1,666,274,260 *AF50D9106E969372F46F2D333756398A825806FB DONNWALRATH
1,666,274,261 *AF51A3FD0503DC51B05DC15609DC1C0779DC7ADB DOOP(JEANLEJEUXETSONORCHESTRE)
1,666,274,262 *AF5B99ABA2D9C72FF5CF75D1CE1ECC1749B5EB93 df4ii
1,666,274,263 *AF5CB584972E54CC75EA7FF5F43D45BB38E94F21 d!sid
1,666,274,264 *AF549BCF748F14D69433466F6C6FE5BAA45AEB40 DSUCAHYOWATI
1,666,274,265 *AF5932C8FF967CE90FA9F38FE0DBDD72475E9D0A DILLONMALOCHA
1,666,274,266 *AF55848C03C0F07A38F19D9A404787161266799E DINEATTAW
1,666,274,267 *AF556D7B9CA01C70A6D5D1F112A53AE212AA4F44 DIrM
1,666,274,268 *AF5A9C30DA08640A87B23F188DAFB03385FC5EC7 dwightvsmith
1,666,274,269 *AF53A5C9DDC2F7D077FB563782D3D19B49F13DFD DL3M
1,666,274,270 *AF541BA07D6975A1FE377D120E8EDDF57EF66A50 DLMMTCL3
1,666,274,271 *AF5C486FDA3A09C83B8BC309E12E33D123603C9A DNE3H
1,666,274,272 *AF530F9D9BB4F83FE0ED543D1D1D7FEA80275F2A dom-sadler
1,666,274,273 *AF5879000966A1E7BEE6356590090D77DA10DC10 e:1h
1,666,274,274 *AF56236EECB2494E811F5D2F28D4CF6FF827F155 E48855
1,666,274,275 *AF5497D918E69A29F96571B0B4C1CCFC62667F22 donna-l-white
1,666,274,276 *AF591BC7FE29F0F1EBF65666684A4E74EA0C29E6 DONNELLMAZOR
1,666,274,277 *AF5AE93B6987AB37D99B0ECB7B8E0B3AE04E4A3B EARNEST.MUNDWILLER
1,666,274,278 *AF50F6469633A30477A551D2205FF4ED8AA311B9 dp76m
1,666,274,279 *AF56526B1D9A40B97468C96BB3FB9011959607C3 DREAMWHILE8
1,666,274,280 *AF5D2193A5B111C0621337670B2FE9E610252243 el.
1,666,274,281 *AF593FBE976247044D990C42D55B63E17D3D7248 DWARV35
1,666,274,282 *AF5D83E798675F696898E138F04735C1A8781EE8 dwaynesteck
1,666,274,283 *AF5CD43A75EB8B3E0A62022C7273753987DE765B [email protected]
1,666,274,284 *AF548805C018B71BAB3285B2376D0300570A306B em:,m
1,666,274,285 *AF51A0A9C5E375C6A810593A5D0543A5ED15CF11 emsnv
1,666,274,286 *AF5D8A428E0BD4738B286DFCE83F1E1DF6B3477B EDISON.ZWIGART
1,666,274,287 *AF57F298D593CC43781D40A4A0F2323DE56D5C0A EF/#L
1,666,274,288 *AF5601FD712E26DBE362E3D1FA59CA3118DB9663 efyt:
1,666,274,289 *AF55237180F61D2303A68E73F8097C45B47ECAAE ep+l
1,666,274,290 *AF55A6FED6C4017FB80F8894BD12EBF1B58A69AF ERIK L JOHNSON
1,666,274,291 *AF5E7E367D4F7760CA549E96C150BFB2249AA209 1432181 OTTELU ALKAA FINNAIRSTADIONILLA TORSTAINA KLO 18.30 .
1,666,274,292 *AF50FF7FC8DCE9C4185C8C8A4692148A0F8FC5A0 etcakselgerner
1,666,274,293 *AF5676AE1A29AA8441471C7AAEB7BD1E2DBB5A62 ELISAEUS6
1,666,274,294 *AF5F847A2E0EBB13F6E1FE8ABB58EA64F9A8B8B4 158672 VUONNA-1999-SUOMEN-YMP
1,666,274,295 *AF55FF68DDB726EE366361FFCD82116C074C3859 ELIURREVS
1,666,274,296 *AF59AC5ACF423CC509CE804F1D9C5C69F14B5799 ellegonzales
1,666,274,297 *AF55D9D6520C11395FA6ABCBAA03289D77BBA891 15lomitusta
1,666,274,298 *AF58899055789DD520ECBA752B302F723D71F00F ELOIKKAA9
1,666,274,299 *AF5653E8248D077C4C70E67414B42B93A235459B eusebiomcdale
1,666,274,300 *AF510BC118616A7296CBAFB44A747EC1A3239B40 ELWOODPAPANIA
1,666,274,301 *AF52F5CA3D2AA66D3B9D5837250FC5B8A211071F 17-BARRS
1,666,274,302 *AF5B9FC549A238328797F742C6AE50012A20EF19 17tell
1,666,274,303 *AF5D2253A13603CD5D677E3F1A0D8D19B0F6C9C5 exasprer
1,666,274,304 *AF596679F03F5D8E91AC31E06D35CCC821EB14BE f1213bbs
1,666,274,305 *AF5EE2D67093C0AB14A8FB412F89F1942ADDE9AA 1beschaeftigsimpulse
1,666,274,306 *AF57BBF8C615B31F88E66F98A48C26DC848F3425 ENROBERT_LAXALT
1,666,274,307 *AF5825A03145EFEA9543EA087A9CE3C79255FA41 [email protected]
1,666,274,308 *AF59DC1FDA4799176D5201936F9416733A0E6BD3 Fascinating-Superhero
1,666,274,309 *AF57B7E0E960BEE7FC338E156DC705D2480F50BF [email protected]
1,666,274,310 *AF50624D02A1B774E721B1D8F1C66E6396E04F5A enzykloädisch
1,666,274,311 *AF562BDE5B3B603769F60975786E2628654CC724 1IAMFUCKOFF
1,666,274,312 *AF55FA4D16205A2F442A2F7C11DB56D329D959A7 epp.a
1,666,274,313 *AF58562F17CA9B1A094DBD9F41981A6C1343EE5C ernestodente
1,666,274,314 *AF593FE8903306689D4ED5461B49ED6A5238BAED erodaneses
1,666,274,315 *AF5B219D99E4DBAF42122842B9431BB4E8EC911C ERROL.DUPERCLAY
1,666,274,316 *AF50DCCE59BA7A5C4727240280A51B81EBEC8822 ERTAGTETS
1,666,274,317 *AF54C60CCA481D912205B8275A5577D7AAEAD94F 1maal
1,666,274,318 *AF57841C26214AF1C0C1F39687CDB03FAFCE8648 1.MEISTERPRUEFUNGSAUSSCHUSS
1,666,274,319 *AF56C5C2B22CA5E251E41C8A6064DE69D9102A98 fletchergiovanni
1,666,274,320 *AF536E34DC1B20B2F0C443516E8F7EC87C7DCF49 1.PCRVERFAHREN
1,666,274,321 *AF5EDE452CF032446E39854C98D5E251EC9A2B35 flowerfence6
1,666,274,322 *AF57704D931F9135CA6CED0F006293C72937A573 esuso
1,666,274,323 *AF589176C3CDD2F5DEB8210DBCBEE4D0CF451374 1.RISTEILET
1,666,274,324 *AF5A8F70B0854DED9E355C38F0D4611FE41D1668 1sadonkorjuuohje
1,666,274,325 *AF519EFE15D54EE58742B2DC36C13D59BA8B38D9 FORSTMAE8
1,666,274,326 *AF5F809C5C135319CBA68B917E41B9C48C8C75AB 1.vorinstallation
1,666,274,327 *AF500ED46A5F0D5E9EEB0FD39DB0A3B277A48FB8 ETTEIBSW3
1,666,274,328 *AF522E92170BFBD969E59CE7AB0A43F0B504A212 1 YKSIL
1,666,274,329 *AF5AE6C91A0193B1DC30DCBCE76DC85DFB0C1B17 GAEARON4
1,666,274,330 *AF56332E2D5D5F4E4E58E6B393DB13C5D7E9D9E3 GAILBURRALL
1,666,274,331 *AF53237BC3287B61CEFFE576319A2EF82B48F75A GAMMAUDION
1,666,274,332 *AF5B0693870B5C07EBF9724B6F247CB5D72E0C37 267jaeden
1,666,274,333 *AF55D7C3BCD5BDBEBE6AF241F10B4D2D85FB6DF5 2695365 mets
1,666,274,334 *AF5CB95338E4D78143099179ACC8E500B1A0B2A5 270066 nuorten.huumeasioita.selvitt
1,666,274,335 *AF5364C5F7628EBE87D61E5DCED75BABB0EFEE31 274COOPER
1,666,274,336 *AF573907FE210415F95AC4E0974F0854418F6E17 2AEHPRAISE
1,666,274,337 *AF5182C083F2C1C2D84AC3B1638A90AFB65DEA5C [email protected]
1,666,274,338 *AF5E7277763B4BCD5F5CF61D28DA79F01B990512 FAIZAHFAEZ
1,666,274,339 *AF538D6A585775684CE7CE33D5CDA84414106F55 2IAMHOMERJ9
1,666,274,340 *AF568CB5F6B9872AE4E7B18FA062B9B1E1ACF30A 2LIEBERMAN123
1,666,274,341 *AF5F590ADFBDAA17183AA447CF384D007DCC7785 gerardzoutte
1,666,274,342 *AF59CF0AA937BBC408EFBFFA256099FB7587EC77 2sanssouris
1,666,274,343 *AF5478F1C537C46AFC6D06D1A4C02C23E1A80CD9 FARMERGEW
1,666,274,344 *AF5F58DBDF96267BC6448A3C2CF85C01C43C17EA GILADXZ6
1,666,274,345 *AF5824E78D134D70680FF39D3DE07A8F8B76D2E0 2TRIBOLAT
1,666,274,346 *AF51796B4019F82CE56DFCDF5F482A32B77E4A27 2-VALAISTULLE
1,666,274,347 *AF5D5538AF2305D10666137C8825612B6731FE2E 2.vollzeitvariante
1,666,274,348 *AF5949A391F7B1C9D4D4405CA439F4A5BAE45169 FEATURING-I'LL-PLAY-FOR-YOU
1,666,274,349 *AF54F36B920C75EE3E49DB77E0A2F1C20608D6BE GLASTRON12
1,666,274,350 *AF58ED2F95D2D041B03BFAAC0429F43F0DF9BE60 [email protected]
1,666,274,351 *AF51773317AC02DC20AC4DC630413428B38F86AD GOLF
1,666,274,352 *AF564DCC3ED82A8B920DDF3ADF2E638246A54E69 GÓRNIKA”
1,666,274,353 *AF5C4B19BF9FD9259422E1943B4791EF90DFD14E GRAIG.BELASCO
1,666,274,354 *AF506305628B40435582194CCB2BD71CC851C44E 3-P~O~O.(>-<)
1,666,274,355 *AF56376710B5E77E100F04C58C53C83B5D5E5833 3p~O~o(O_)
1,666,274,356 *AF5479D84EC143E3ABB4A8735433855B0F01CB2F [email protected]
1,666,274,357 *AF5FDF3B7477D51DEAF19673FAE83641F5343806 [email protected]
1,666,274,358 *AF52C39000B31B2DE315F5A231D37D517E511D16 40-wohnhotel
1,666,274,359 *AF59DFF7B811D1D7C8AE3120827EF434140483DF 42-MARCiA
1,666,274,360 *AF59C2B99C8B986B2C0DD7E37E136F03F1A9315E GUSTAV SMUTS
1,666,274,361 *AF5DBC4E2113B6033E1A7B518CF90E998AE56094 490190812X)
1,666,274,362 *AF5D3A0E326FCD6391F92D9C5310B477BC1918D6 francischristenberry
1,666,274,363 *AF50024FE578B56A65BCC8019D999918EE79C356 4MILENCE
1,666,274,364 *AF5B2DBC2C20CA5B10834F0B6F60AC3BBCE64F00 [email protected]
1,666,274,365 *AF5491DF0918F8247CB5AF0102B403B00DF453A7 HANSZOUCHA
1,666,274,366 *AF57F73F0A2347000A606AE4BC4DE74788C9490C HARMONIA
1,666,274,367 *AF5C16B35922D0C37DF80CE27ED8221F0C84AF0C [email protected]
1,666,274,368 *AF5FAF12AA58074791228AD0952BDA55DC3B4027 herbemuka
1,666,274,369 *AF588615F95C5AC1117F0396DF24B41E7D676803 591804 neslihan mah
1,666,274,370 *AF5FFF30D3563BF381B8A316CAC91F881D486A01 fwj
1,666,274,371 *AF5F6105D7F135E38CFE8C2B5F904128BFAA51DD HE'STHEBESTTHING
1,666,274,372 *AF5C50ED58150DB7C70E39BA71F205B7B2EF94BB hiastbsw2
1,666,274,373 *AF55152046ABDEB1D7ECB516BAC0798C9CB95F66 5CSEJNARO
1,666,274,374 *AF51858A585F298E3A1EE387AA33E9510C8AF27B hippy's
1,666,274,375 *AF5D6EA1DDA7A02144ADD8BBDEF1E85417EAB1B5 HOBERTCHAFFER
1,666,274,376 *AF538FBC442C312F40B0EC92744A5CC0C6F43062 hobordd4444
1,666,274,377 *AF5B6E690D42A7401D7843AC70F3E5FC905B3FBC hopebarrios
1,666,274,378 *AF55F6B34B98E9D57D744137C66BEF2AA8FD3661 5OKWCO3XT
1,666,274,379 *AF56D1B242E6C583C2CDB09CF6EC67E11D7E4887 HUCLE
1,666,274,380 *AF5E7296935A174DFF14E9F001182EA33183A494 hungbiscocho
1,666,274,381 *AF57365A8E6804B0E5974A714A44402673389DBA HUNTRESS0622
1,666,274,382 *AF51E24BC10E93443510AAF3C369BE1D45BF9D9D giovannieldrige
1,666,274,383 *AF518C850FFCFF79A08EDF00FBFE52ADADD3FA5C IBEEAWEE5000
1,666,274,384 *AF5A26663112BFF2A94FD769A7789E6B949C4576 [email protected]
1,666,274,385 *AF537FDB5D6D20870A72CA1900B4EC5C7FFA36EA IDUSBKK27711820071114
1,666,274,386 *AF52DAE450FA98C28F078E0ED4EE6C0809260A76 6F4167ED961D3F2997806A4A177C2567
1,666,274,387 *AF5397A7FF398313E4169AE8A877F397E69B888B gniddiuq2
1,666,274,388 *AF51F62FC672D7941F24600DD41DF7104BD726EB gnitaber5
1,666,274,389 *AF5033E903B99B0F085F24EE16AC3D6836DDDB72 6MCDONOUGHS
1,666,274,390 *AF5B3298A5AAC5C9751840A5BF230FF2EF3974D7 GORAUDSED
1,666,274,391 *AF5D9322B5C90204CB80979F5841768A9EE54165 IKKANDING
1,666,274,392 *AF523092599E2101CD0F01498AEBBDB7A16EA5B6 GRACIE.TAYLOR
1,666,274,393 *AF55224B9826F7C398997131F99E77639345A9AB ILITHEN0
1,666,274,394 *AF55271B340FC69D0A4C0B5858A823B8E4EDEF79 illustrate
1,666,274,395 *AF51A78562AE42CC3CF83D7BE231F6A7BD0607DA iloveoxford2006
1,666,274,396 *AF55E67505852FF6C4156CC85F619305800BA866 6TOPGUNBUZZ
1,666,274,397 *AF57001985A08C294EE7CAAF302ECE1F1C7AD1C8 IMANBAGHDADI
1,666,274,398 *AF52A5B40A228686FB077BFE05B8E4EDE5B4B75B gregorydigger
1,666,274,399 *AF569063F0DDAA40BF2941F3ACEEB50FE14391C7 INDREVOLLING
1,666,274,400 *AF528C06DA66B0487C48E42190BC4041351E4903 GURBHAWAN2
1,666,274,401 *AF5057705C33390081D175D1060B5598C2F4C5D2 7AANEENGENAAIDS
1,666,274,402 *AF5BE825AB910F3DC4DD13564F1526356FCA885F 7AISENICYDARB
1,666,274,403 *AF53C6A8280344136A41D6E9F1F5E29B6A09BB4A 7ARIANECHURCH
1,666,274,404 *AF5C2EDF37E50412C718F8F28CABEBC2439C2134 h0rse.tic
1,666,274,405 *AF5BDB63C39D894F27B59A2DAB12F9BDDB80A78B INMISSA
1,666,274,406 *AF5B1ABC60F1F1CB44465F0763F6D31670922A38 HAIPOPULATION
1,666,274,407 *AF55216F4BF4336D1D56F9821E302C019AD0D6C0 introductiontheme&variations1to4
1,666,274,408 *AF5D53059F274468F02E0230AFCC8D204FF52326 hand-steered
1,666,274,409 *AF5298941410960F2AD3538C55BC954FF38AB99A HANSDELCO
1,666,274,410 *AF56842F0453610A0047620C19EBCBE32B9B9433 HAR3'S
1,666,274,411 *AF5F2ABDB0584701F0EE5C66F739A621B19DAE8E HARMONIA
1,666,274,412 *AF555C2582FC67431B567B66621544AF4347B2A9 7OMREFEIL
1,666,274,413 *AF501B72FF5859890A1BC3CCACA24A873571DE9E IVATIVE4
1,666,274,414 *AF5FD0C779D5BCD21C126898DF92AB23D057DC4A J8;Z
1,666,274,415 *AF55856BB8FBE3A036F29154B64E0669B6C70769 HEIWANA-HOSHI
1,666,274,416 *AF5BE6CCF7E66ED360C1B269CF05CB04294BEE15 hemelsbreedst2
1,666,274,417 *AF51D872B6B4F994A020E713FCD3774248A5EE8E henryprimer
1,666,274,418 *AF5E9FC359EBAA1A7CAA25D7E92B57928F901FAE HENRY.SUSLA
1,666,274,419 *AF55256CD7D04A121675F992CE06F3617FF45FD8 jamille.
1,666,274,420 *AF5064648AF1CEF54BDC041E96AE27AEFB09C50D hermananalla
1,666,274,421 *AF5A59145D344E2D8E1FFF9CD42C3D9A783E4F9E HER MOTORCYCLE JACKET, REVEALING HER BARE BREASTS. DADE
1,666,274,422 *AF52FF0B6B7764D908C5D75E720EF5A87B6A80B5 861197 nasilserbestbolgelerintemsilcisioldunuz?
1,666,274,423 *AF54A413167B671FC988301077B935F5B3B56F32 8~aaa
1,666,274,424 *AF5A8D0520C1A37EE0D67AD42CBECC761CE8C3A9 hkg
1,666,274,425 *AF5D3E5202EFD03366DFDCE3B5E503E17CB8834A homeboyautomatic
1,666,274,426 *AF5B03FD412B88C692826CFB1E3877D5AA055F86 jaydekimberleylouisebamford
1,666,274,427 *AF5D993DE475D678CB9633FFAC5CCCF58F23DBFD HONEYXAE
1,666,274,428 *AF5DFF9504F8B1DA3B92C2207657289982726E66 8KOMEDIANTER
1,666,274,429 *AF5EA1755178D4F75FC568187A05FE667FA33DB7 8MANODEDIOS
1,666,274,430 *AF5F9DAB408832FBF030BCFD3A8F2C4819C1C1BD JAY.SCOT
1,666,274,431 *AF5C4DA11D587ADF8B7E03D4182BBFEA6B2395B5 8NPRFDSLY
1,666,274,432 *AF58160615D418604ED3EF8346852089806CB8EE 8##>~o.}o{
1,666,274,433 *AF5C1E4EB810683FCF931A98307E61389B118B80 JEFFREY.LAPLACE
1,666,274,434 *AF52932D8BA0EC4B7D2ECF16AAF700E8C1B7EF15 }8{-~-~-~(####p
1,666,274,435 *AF53394F39D9FFBD873822D48D018A408949FDE9 8PRENASALS
1,666,274,436 *AF58C82B6FB2B568193AA09F909F3D6BE45B8717 href="/gp/richpub/listmania/byauthor/a17jvvakweb0m">wesley
1,666,274,437 *AF5FC8AB4883D3130B470D84C7B530C2E691DA4C hrn*
1,666,274,438 *AF50DB5DB3DB8B9B253FB3F9EF2A5273BC0AE0FA JERRELL.KAHEN
1,666,274,439 *AF5EBF64A102970800A45BFE0FFF323C62F6B39D jerrodrutan
1,666,274,440 *AF5DFAC75CEB989E3F7B8C06DC5F2FC07C5E5D53 [email protected]
1,666,274,441 *AF562BF34566E8CF35FFE22D9F734F0E9C5BB367 jesse.leonhard
1,666,274,442 *AF568B6EA9FAD92883FFE73BECC1A29B8C659F80 8sports9
1,666,274,443 *AF58F995F604002E9CDDAAFED6CA21C043FE619A 8UNDERSWELLNI
1,666,274,444 *AF59494200A29C5E9339BCB86A0B0E926AFC47F0 [email protected]
1,666,274,445 *AF5FEA731FCCB389A2738CC1C69486DCBC7F4B18 922009 auch-der-mueggelsee-wird-nicht-unberuehrt-bleiben-
1,666,274,446 *AF5EA57D8320E4E4759132A2525B7152D04E1B96 961charlee
1,666,274,447 *AF5A6CCCEAF4093CE29F7C397A162BE6851D20FF HUUSTALU
1,666,274,448 *AF50C5E4D6C2598A8007380FC1DF8B95B76D4693 JJOZH
1,666,274,449 *AF5F4B71824D6214D71905BF4B97A61709A3E12C 9APOSPORYN
1,666,274,450 *AF5ACE3D561F8582E6A7AEF078CD9A1883B9791D JMW00000
1,666,274,451 *AF5D7910C7D6D299153E59665E277422AE1DAB4D 9BALATAATALAB
1,666,274,452 *AF5F5B42BBF9DDDB8953B850B3AC8587ACEAE128 IAESTAE0
1,666,274,453 *AF514FD267C1C2CB3BECC5ACF6E904D83AF4B879 joewelschmeyer
1,666,274,454 *AF5542FB094B62BE36539885908C2FE802247B66 john-biz
1,666,274,455 *AF52F2C00E9FEB44FB577ECCD63E83EE7C42881D 9EISSENER
1,666,274,456 *AF5D029A570C3748A887151F754DCC9EA0D5C96B IBYC
1,666,274,457 *AF51DBAC902D2A9179DF66633BFC1D4D65275B74 IEGEBIET3
1,666,274,458 *AF5D9B2EE7B191128938445D963AB3E4DD99EC34 9INTERNETTHIN
1,666,274,459 *AF55B5DAE6A398D97E4E46CC7737CEF66E27AFFB 9MACGYVERS
1,666,274,460 *AF5DFF12F0869F1CF4947C1330B10F0E6D44C009 JOSH.COLLELO
1,666,274,461 *AF5979E45A804B180E5E4B7475BD795703608EEF ignaciotouchstone
1,666,274,462 *AF5DB7DE616837C64C419139F35C67387914EF37 IGUANACOWBOY
1,666,274,463 *AF555B599B9BBA67771E1E0FFA93E2B11D9FA1F9 [email protected]
1,666,274,464 *AF58BCC2C59D7DE5F636F02F7E26C4BB6F19D7BB ILOVEEDMUND52
1,666,274,465 *AF5286127BD0BEB6DD14C933606FEAB564A0AC7B JULESKURTULUS
1,666,274,466 *AF5DBDE5E9AAEB5B2E62BFC64D0C4A29CBAB9226 9SSTNOTARIA
1,666,274,467 *AF561B3C88ECFF734F72A2A8A38C3B29D065E4BD 9STYMPERES
1,666,274,468 *AF5CB877CFF2DF84EA10C35F0FBD933512837C35 juliobalthrop
1,666,274,469 *AF5078A7C0CABC3DCD19504CE5E78A21B20F022C [email protected]
1,666,274,470 *AF5961D398DCCA551987C3DE602BC15CE4BFA480 JUNEAVA6
1,666,274,471 *AF5D6230A7DA485A0E4DD3CEDB3D97888DF70D09 A0EA&
1,666,274,472 *AF56A5C36E8D642B89AF140B77F644F050B0AA9E A1-T3
1,666,274,473 *AF5A050D645072D83B2CCC0655DB9F79B71DFD68 INDLEDERE4
1,666,274,474 *AF5E20C5A0F7A12DF2539F85FCD6E01F6D10BC0B karoly
1,666,274,475 *AF5580F06461149993A0F4909ED6767FAA6F4D4E KASEYFIETSAM
1,666,274,476 *AF51C013CBC910BB539676157257A462B45960D6 A6UAV
1,666,274,477 *AF5BAA8F5912B907044981607A175717E57CEB5A A8CN=
1,666,274,478 *AF561D3D3468D1CD0E4B28A2BAC0F6A3FE01D2E3 Aa0x
1,666,274,479 *AF5D1A60D904CB4C46D0F32E8B459C01F081B4E6 IPMI_MSGDEFS.H
1,666,274,480 *AF5E0C5CF1A5945A427944A4FADFF3965F3D27AB iramaino
1,666,274,481 *AF59F4D0BD9825A9D44BB1F058D1B10CD7FFB6A6 IRMASURYANTI
1,666,274,482 *AF5806926BA1FA5E5D435C0DA6C7A3EBA3079ADB irwin.goodmanin.lauluja
1,666,274,483 *AF5396E7A50D71C64DF2B245FC5D8F422A35B2ED kelsbjerg
1,666,274,484 *AF5C3DEAF4C2A2E79C9ED950B689AC3166E91520 KF-AMP
1,666,274,485 *AF546DFCE21CAEE95C8EB2473C2B5229DA18434A JACINTOCRAWSHAW
1,666,274,486 *AF56DEDC0956217B02461F816AE5F1D105ADF24B [email protected]
1,666,274,487 *AF595F6F31C9A80E6D2AE56290E891DB6F4A14E6 JACKSONPISULA
1,666,274,488 *AF536DA792FF098D120287371C4CF1BBB3B16F31 ABINIEKUS
1,666,274,489 *AF5FCDA73EC350A86C8A972D3FE9142911462A64 abramguinnip
1,666,274,490 *AF5D9289015E1E8D9C14EDE1FAA68E2ABB9FB6BE ABRAMMERSMAN
1,666,274,491 *AF599806539C390B0F003F0FA5CFDC565D274D47 absurdisms4
1,666,274,492 *AF5B542154208A75E6F01554551F7D91EC125C0D ac4t$
1,666,274,493 *AF5A4D14D5E802B9EAF76FAC17D69DF4FF529E55 ACHI35T
1,666,274,494 *AF5AB03A473FC7C4A550F0BFBE8700D2E12C5DC3 JAMAR.THIESSEN
1,666,274,495 *AF5B126EBC8D66BDC17763FAAD60F6D0E2A6867D JAMELGRASSI
1,666,274,496 *AF5AA51749E7D2C0694B7324A6F866E5D502DC75 ac^rb
1,666,274,497 *AF5F04E72EB36B25D6B55E6ECF0B06302436030E JASONSTANCZAK
1,666,274,498 *AF534A0FFF2F629A778EDE75DA9179B0E69B68F2 ADOLFO.HELTON
1,666,274,499 *AF581577AF39FCF63B19A29D9A868416625950A6 ADOLFOKENNISON
1,666,274,500 *AF5FE7BE3B79DA36FF861A9F89229D5CDA99206C JASPER.KETTERER
1,666,274,501 *AF504A64E0B3DCAF3DF24FBFE67DBBB07DB2E5DC ADOLPHSENSEL
1,666,274,502 *AF59183CA11CC1AA9435F7C2B52996ED41294ECA adp?y
1,666,274,503 *AF5C201514FC81C45DDCEBD57B5DAC16577581BB adrien.ouellette
1,666,274,504 *AF515A5DD34B5E79D656C1573BF85F09B2421ADA AE_I-
1,666,274,505 *AF51687DA7BB670FAC07BB48919F0322C6CBA1B9 afpeddelde
1,666,274,506 *AF574E34FB11AD00E0E6DFB789B4BE17C982FDF1 A.Go.Go.(Boozoo.Bajou.Mix)
1,666,274,507 *AF59C536D0524B3E81CCDC7367A4D80CB9DFD74D LEISTUNGSMINDERUNGEN
1,666,274,508 *AF5E74E2FDF94B58BE637DFF548C9FD895E9F061 LE~L
1,666,274,509 *AF52339C7FD344AEEB89D7F090E65476806C9D8E „AGROLINA“
1,666,274,510 *AF59C492C6FC27EC956BB88F9C616BFA79401FD3 ag$v7
1,666,274,511 *AF5EAA287E6D91B13D35A023228E989ED9BB7A62 JEANWHITNEY
1,666,274,512 *AF529270BA85E420C3A2FB2470DDD66A5E97C6D6 AHMED.BONGA
1,666,274,513 *AF520F378BF0EF57161BE384FD55ECC613A2E9FB J'EMBELLISSE
1,666,274,514 *AF5CA812D02668017DD4F013443065EF02791192 lespescadous
1,666,274,515 *AF58021027EB3E5C033E6BB014B4F4EEC31552BA AIH0B
1,666,274,516 *AF56FA1D8502216997C0AE820A782466881798E9 lettersfromwarst
1,666,274,517 *AF5CD6C23B1A4DFEF3557FE041D9C08D657468E2 A(is
1,666,274,518 *AF5C782D1A6D06543F2FA9E89614311986EE0F01 [email protected]
1,666,274,519 *AF523A240A6D02EB3732AB7FF617D4C445296364 AJMLOW
1,666,274,520 *AF56B8719C1849C5FBBE3B2B4B914E39EC8EC184 ALABAMA_120.SVG
1,666,274,521 *AF55880FB0DDA9C9B1297E695AB3C0B8C94512ED LINDELEFING
1,666,274,522 *AF5152AFCF150CA2197BE3DC4CC2AA59BC407935 [email protected]
1,666,274,523 *AF5BAF7AD2DA522344C67ED9D9234A15E9E38668 alfredlicano
1,666,274,524 *AF58E52D284D0EE23F7B65ADCEE057BCDF7E4273 JOE.ETH
1,666,274,525 *AF5806131797AC0D91AC664DA141B73316E130D0 lloydhopko
1,666,274,526 *AF5EAE555644D52773F0018E3E99B876FEF8649A lloydpanfil
1,666,274,527 *AF50C0739714D2B6EE24369271025E93DE6876A8 lloydsevero
1,666,274,528 *AF5AA54A797B9BD875797A1E680A41C70A5113D4 JOHNATHAN.LAPRETE
1,666,274,529 *AF5B2E7C3C6891914DC35390D359ED83644005A3 ALONZO.FIESER
1,666,274,530 *AF531B375C879F2D74FBEB81A232A11B0F5E4DCC ALPHONSOMISKIN
1,666,274,531 *AF525B231F79B17BB7A4225A3C778DFB9B5172DF JOHN YEATS
1,666,274,532 *AF57B0DCA721B95D96E6CCBAC9A510153630B7AE JOLLEYS4
1,666,274,533 *AF55FFE310F4AAE7A860DA0BC7B88D279772D535 althazan
1,666,274,534 *AF5D7DD00E0056240841078F1495D3F7DC2AB8A8 ALUS+
1,666,274,535 *AF580501C02B407E8C9F2DC8330982114711BA2F lonmillikin
1,666,274,536 *AF503844709C96C16E761A1958C48C2E45CB4803 JORGEDELLAPENNA
1,666,274,537 *AF52BCD52F67D751DF0EA4E489B2C25042E9D82D alysheba0
1,666,274,538 *AF5E150EB330C3D0640BAB4C77F0373B580E5E3B amadolivsey
1,666,274,539 *AF592E7D63E4C4D6AC56F236075D688AFA98D59C [email protected]
1,666,274,540 *AF51A145485A793906C1EC1ECF1E5499165692AB jrosleo
1,666,274,541 *AF5FA57F73FDFBEED1C38203CC4038DBF843B614 JUDE.ATHEY
1,666,274,542 *AF5998CDD5C6C411F73CDE6FE00CCCECBA3B1FC7 JUDITHCARON
1,666,274,543 *AF563E8D3B83508AAA4711D4A0703C64B250D945 loydkrakauer
1,666,274,544 *AF53F6062317DECBCE2B3E28EC396B19D44F60A8 [email protected]#$%^
1,666,274,545 *AF5710AEAD150D19C6963B74F86490905E50CD68 jybz
1,666,274,546 *AF5CB98306AFC36F5F289586A919982A3562B6D0 KAMCARTER
1,666,274,547 *AF5E2D7F15B02A54A685056B4D7C793D9B671CC5 LUISLOA
1,666,274,548 *AF5261104DEEDB43F3F9E4914789414A59ABD21F anetria3
1,666,274,549 *AF5521B31E135154389B4769A9CB904F68F5B694 lupekoep
1,666,274,550 *AF5A685996F80DB742391C8CD8B34F5E65A40CA9 angel.saade
1,666,274,551 *AF5C1EE2847F22FA411A74C437BF22582096C4B4 a.n$i
1,666,274,552 *AF511A135A763EB031945B3755948B8A8CFFDC6D LYNDA.HARRIS
1,666,274,553 *AF5F2A5495D004159BAA5D70C70EE8E0B9635FAF M31ON134
1,666,274,554 *AF5DDD505C5070B538CA7AF7ECC2D0ABCC6964C4 A-NQL
1,666,274,555 *AF576F833E369C29A4BF0EE0F6B15AB7066A8C2E M74372
1,666,274,556 *AF5670EEA68D84FF35A265DD6B49DE5AFF49EEF1 m9ra7es
1,666,274,557 *AF5310265DD94489DF9AC60530BB49FE43ED35E2 APOCAPYPTICA
1,666,274,558 *AF519A382C0A17AE1B1151622966E888A9E4BB9F kenethkimbriel
1,666,274,559 *AF5DDB808319DABE803A81AD95DAA7DF1115151D ap$s
1,666,274,560 *AF515DE78698F0F2A536953C4CC980B6CCE517E8 MAGDALENA097
1,666,274,561 *AF55DCB3670E8DD8816FF1AD2F001B001DE2BB3A MAGYAMER
1,666,274,562 *AF57E76EE85F758ED649D1EA104E9E0BCD433E74 AQ-FM
1,666,274,563 *AF5B3423687325F3C260F76745D0D2B3E43E4E4F Makeanannouncement
1,666,274,564 *AF53537BD0C068C4CB4504B6F9A0E6C7FAE775BE KIDSD3
1,666,274,565 *AF5556B7317729381FC266295B801F52B74B34C2 KIINGKONG
1,666,274,566 *AF5774D36DF96CF590A04F4E01A8042F5E9227E4 ARMANGELDI
1,666,274,567 *AF5444B6C4EBAA78E4B334DD1CA90004CBB49FC9 AroundtheWorldUndertheBridge
1,666,274,568 *AF59D1ECA15DCEA33B664D5D1402EDE242F3FCB0 arrows.of.love
1,666,274,569 *AF5DEE017F20D99172F40C11BC0D7C229A521092 KMC0
1,666,274,570 *AF5B71C7E9711A967EE1B5339D727E6864ECD107 ar.wm
1,666,274,571 *AF55950399D73E57C3B33217B4943DC5F1123A44 kohsaka
1,666,274,572 *AF548F06F339E8ECB1B04E80AB6CFE26E0A4DE37 AUSCHWIT972
1,666,274,573 *AF5845E7CE992373A068FE6C02E429B5A8879183 ausländeranteil
1,666,274,574 *AF5714C83163FD91DBA2418AA2797226C2061DC9 MARLOWINH
1,666,274,575 *AF53433AB1D982592DE66E813650B238ED5BD7B7 MARSELISBORGGAARD
1,666,274,576 *AF50E3FDDBBDE8AC0602A76C0939F10D5D441179 AVALEPAM8
1,666,274,577 *AF526A7D4700F7CD729F185E86429B5D123A6110 AVANIMRE0
1,666,274,578 *AF59758FDA82F6C22551328E1F3F16741C067D60 avfp
1,666,274,579 *AF56DC881F40462687BDEE5D33C258CBE23D6073 “AYÚDAME”
1,666,274,580 *AF52468C3CC73DF8E6190CC7CCC149CF31DE9896 kurutmamiş
1,666,274,581 *AF5622472EE42B0C914A2500AB36C7EEDC4F4D7F B0EL.
1,666,274,582 *AF5EF854BBD1CE361DE3BE8DCFAAA4CC68B6B0C6 b0f$3
1,666,274,583 *AF55C4B81D59CDE10FA0B647AA123612091C82DE B1?E
1,666,274,584 *AF5BF5928E92526BE47395E97D8802D934D68321 B3M$
1,666,274,585 *AF5EFE7D1DEBCC03DCAFDCFE69AD8C71E8953856 b4jb-
1,666,274,586 *AF5D3A0D41994A30EA4DBB2A7BE8129BA7548F27 b7ml;
1,666,274,587 *AF50E4F8EDC0F4A964B0DFCA912906EA99669442 LANDGRAFENBRUDERS
1,666,274,588 *AF56D6C76975478D72DCA8D097AD39601445F15D large-flowering
1,666,274,589 *AF50DCF8AD8FABD79DBCA5A8BB2775B933EB990C [email protected]
1,666,274,590 *AF56C7F25A7AFECA355AB9C63BF05026A581E7E4 MH...HELLO
1,666,274,591 *AF588E318A0F2FD1773DA56F0D5BDFA84F7C4205 BAGHMOR
1,666,274,592 *AF5629E1D8403D3B6646FB4E5A89C7795E7717F5 laurelkankobus
1,666,274,593 *AF5AC049433C2F0AA7F2AB976AD7CEB4D9A380C9 [email protected]
1,666,274,594 *AF50AB0D2458F7994B82BA73786876F0EB4DBBFC michaeldambrozio
1,666,274,595 *AF5758BF9A3AFFB4633A54C01A550AABCD49B01F michael-grossi
1,666,274,596 *AF504F508BE49A23B5DD2A696332EB1CC13DC672 lavernecatchings
1,666,274,597 *AF599A84795AF86BA1AA88B1843B89402FA695D0 LEADGUITAR1979
1,666,274,598 *AF5EC9F7EE915E43A9BBF43961F1DA9680AFD51A barneysawaia
1,666,274,599 *AF5C1C745FA05BB84D08D1C0B775A01656E8FDAC basculez3
1,666,274,600 *AF5CFD5C6EA8A10EBD0EB8807D289267CBEB75E1 BBB6V
1,666,274,601 *AF5AB77A78B5EB82D31147FF1692B9B0FE5A35E5 legitext000006071351
1,666,274,602 *AF517CE29112119646BE06B3311446A34C92923B B_C4
1,666,274,603 *AF5E32C28AB9AA536B2EFEA3299E1457C5E012AB belindablight
1,666,274,604 *AF53D35A51265177B06C0B893DD7F1B7E12EC1EE LEONINE I-AM-RESOLVED.
1,666,274,605 *AF51558413E0B3EEAAA75CB507AC6D983E3E8F66 MILFORD.MCCULLUM
1,666,274,606 *AF58A007F95B758C3360E5C0E29886D88245B22F MILLAGROSSV
1,666,274,607 *AF524C5C5E162F5BE2A6040AC81234DDA24CBF57 BENTKOVER6
1,666,274,608 *AF5D6ED5B7684130F4321E2A5BAA10DEF73E2189 BERENICE-ROMERO-SNACHEZ
1,666,274,609 *AF50FA2F409BF4908098A8257F9350B531F7709D MIOLLNIR3
1,666,274,610 *AF572AF509F07A34326568A3B3908D0B7863F1FD BERUFSMALER
1,666,274,611 *AF56F752B2A3223057A43DA4655F479EC115CBA5 BETRIEBEN
1,666,274,612 *AF54A35F278187F6279BD9EE7B8BC8BD1767AA27 be#v=
1,666,274,613 *AF5838502854E4BC3B09EB22D9259F9A425FEB94 MOGUOCHI
1,666,274,614 *AF59FB7A84969A8D978E31FD5B457D7E37BDF5E3 [email protected]
1,666,274,615 *AF53EC226DB76B05860FC6C89D4103F8775F1B1F bfwa0
1,666,274,616 *AF5228471BAEE5EC6EFE67EFA4B2E4D28AC1ADD2 BH$&N
1,666,274,617 *AF50DF318FE7291E0FB674B9CD26FCCF5FF746B5 BI6P)
1,666,274,618 *AF50139F91EB86681BA53ABA69E16BA6D5D511F0 lipgood8
1,666,274,619 *AF5C1D36F5EA0C8832CF558FBE843839A6673006 MOONESARED
1,666,274,620 *AF5841BDD62B1CBB2B976E927AA7B288A7B8C748 morpheus
1,666,274,621 *AF5434EC3B86659C2CC51AD3F410460734579C52 MRFENG
1,666,274,622 *AF5401B0E10DE3843B979E735F1CE54D938C0A81 b$m,
1,666,274,623 *AF53E0A608C0A3F7BF8A1D41F046DBDFCFCE75D4 [email protected]
1,666,274,624 *AF5F4CE2F2A27E663F97553917B9104EAF6145AA [email protected]
1,666,274,625 *AF5640474ACA1776E1A2AE6CC10089B8C2AAF9D5 [email protected]
1,666,274,626 *AF594F87F6F5ECD17426CF9FF7AAC242548705D1 BNGONGANG
1,666,274,627 *AF52EFCAA6F40FB4794E97C084B8F9ACCAEDFAD0 [email protected]
1,666,274,628 *AF543DBAE6CD123ACE823BEA21CC0404A7624D49 BONEAL13
1,666,274,629 *AF5BBB403D35645857ED7140EF101EA16AB612E7 bowieliving
1,666,274,630 *AF57C8B7B5552369999A632C4AB3FE743A6858E1 lover-shi no theme (feat jimmy)
1,666,274,631 *AF5550E8CBA8744193FBA40857A172228A513A50 MYRON.CROSSGROVE
1,666,274,632 *AF5BAD998609E754AF851ADA9D896984F438F3BA bp,
1,666,274,633 *AF5B143378AF20408738CCE7DE9B46E8CE7BA446 N0T!F!4813
1,666,274,634 *AF544150CAF2326D4BAF5225CBAEF28ABE471344 najimer2
1,666,274,635 *AF552186FFE9FCA55471F1B8E4D842D0B763A4DD brad-eddings
1,666,274,636 *AF59A8E7FDAC9FCA5B52291B0D9AAD0DE449E6FA LUISHUSANINI
1,666,274,637 *AF57A765CA77D0899030484AAD18A9BE95AD6002 LUIS.TOMASETTI
1,666,274,638 *AF5414360748FCE225AB0B7B1A3E4D0561C991E0 brevetterait0
1,666,274,639 *AF59A084B7EF278DD61357C9686686EC41148CBE brian.minnock
1,666,274,640 *AF5E17638B0274A06D4A4925D0C1C69C66068E65 lyleknutt
1,666,274,641 *AF58002097E3AAEB4B3DFFBA542874D879FF858C natascha12
1,666,274,642 *AF5F12A8124CE8D38B8BBDB03B4F25D2C73663F8 [email protected]
1,666,274,643 *AF5BD57944E8ED07704B5A16F27A4D764C0E6DB0 BRYANTLEISEY
1,666,274,644 *AF5924904E92ADD7926BB7BF2E0A919459BC3F5B MACHINULE
1,666,274,645 *AF58127B37FDB3B221DAEFAFE7F1C65850F6EB45 MACPORT3
1,666,274,646 *AF57F0D798A561B60351BC8C6252DFF1B39B3507 nespodaned
1,666,274,647 *AF52ABA2019984D5612463952B072B12C11C9E94 NETSETGE
1,666,274,648 *AF5E1AA9CF0D4F796F35101E0D72807336098C53 newtohim
1,666,274,649 *AF5DFEF2FF782E3E5ACDCAE9781DBEB195A7447D b,ulf
1,666,274,650 *AF5A5FE4C85A3DA8F8D2B6C3987491B36E882BC0 MANDYPEMBERTON
1,666,274,651 *AF5423FFF1573F1A16F80C8613A84F8B1C224BC5 NICKOLAS.LEGRA
1,666,274,652 *AF5351FA950913C3D095897500E3B06BDD664AEC buscaamor
1,666,274,653 *AF56D12AC2F58A7EB642D01EB958480BDEAC510B NIGHTWATED
1,666,274,654 *AF561D4F4CDE7E7DCAA334E7C97DFF6176660ED0 BY THE WRATH OF THE UNBORN
1,666,274,655 *AF5EDDA40195C722F6ACB30BAF87A94A18C04C58 MARCEL.BIALIK
1,666,274,656 *AF58CEE5A8C093144077B6A8454779F58D15807D BZXMP
1,666,274,657 *AF5F3DF09CDFE9C8DF365A468CCD407E60DB3DAD MARIA.BICKLEY
1,666,274,658 *AF5293A48B05569102A0CC46E75223961CEF8B60 c=2hk
1,666,274,659 *AF5AAB1C0E4620562D52F83CB05FB9F115DA61D3 MARIBORSKÁ
1,666,274,660 *AF51F98F15C8607D7F9D22749E76F96925BF775F c3n)n
1,666,274,661 *AF5ECFD913C12B6DA4A7B943E04DDE2016DF09E8 c9=v%
1,666,274,662 *AF5D2466D427573DFEEF65C4CD15E7A17ED476C1 CARDIFFS3
1,666,274,663 *AF57B1C0A72FBF5DA5F4FBB11EA132903ABC70CB MARKA)は、
1,666,274,664 *AF5DF3697E1D786C90F61EB20804DE19975363AA CARREGOSITAT
1,666,274,665 *AF5DDC2777CDD2DC40147CBDD11390C43F752DF3 casalinuovo
1,666,274,666 *AF52185872E3CC085B73C63E414D6E42ACDBF6A4 martian-parking-lot
1,666,274,667 *AF53864CA920E9AA2117509F2239CEDBDE3169EE MARTIN-ORSON
1,666,274,668 *AF5CCAC86FBF92B175EB398AE248DDD6F8FEB6E3 NORRIS.DANTE
1,666,274,669 *AF5041E4A0B36FC24DF8C0B1DE5F5B504733E1A7 CATHONER
1,666,274,670 *AF5080763A198490D2E09B81DBCEA3D323333C39 cb6sk
1,666,274,671 *AF5A08CED6C905054272A9C9704271928D255AF6 MASTERSDAKOTA
1,666,274,672 *AF5ECEBF91DBD87E5744E9A3AB02E123E3D3CA62 MBLACHLEY
1,666,274,673 *AF59AD5A0BE08E892F113E84D43B0767674838AC n[uo
1,666,274,674 *AF5ACA2B87F2F60F79D19F5F9F356409CFCE7FC3 [email protected]
1,666,274,675 *AF53F6FC270808364B68B878E697029510B07415 CEJAO
1,666,274,676 *AF56FE59B3BBB1A29D41F2E233899D44D432C943 cgsupport
1,666,274,677 *AF5DAD81477D7B15739D39C7A9200336A09D60BD chaltura2
1,666,274,678 *AF5105E87CC1A220A279D17A735D71E69359345D michamartin
1,666,274,679 *AF5E2889F113B2F72C468CD52564EA0BA6679886 michelredfox
1,666,274,680 *AF51C058FAB100D42E99B18F7D96AA605990F09A MICKEYTATNALL
1,666,274,681 *AF5A746813D749158926E281D2D83C63C2641255 CHGD4136
1,666,274,682 *AF529B615A52197FA70B93E06CC97FA6731D0820 CHIMWAE8
1,666,274,683 *AF54983B6E23A26E4009DFD04A7AF62E60DB1962 milfordredcay
1,666,274,684 *AF54EEEA0B876C31E214E9D4647B97BCBACC556F chlkiller
1,666,274,685 *AF57B062C85A25A962CF876FF0D82449B2C98A9F MILO.KINTNER
1,666,274,686 *AF57A01757549F3F38428412C9FAA237A0D933BC chowoldfat:399p.scu4lgwu
1,666,274,687 *AF59EDA1A590BA073061CB2753EDF20BD07FF376 oliverjakob
1,666,274,688 *AF560CD831EC6D2761E9B756FC289072283B920B MIRIAMDURAZO
1,666,274,689 *AF555497DE96D5C1B8ED56057EBEAE7BC3E59CE8 omertting
1,666,274,690 *AF51E583A87723F6BC11AAC46A69810AAEEE7A0B CHRIS FORKEY
1,666,274,691 *AF501120F7DAD6EA34229F296A09B283CE81D2EB christoperhartwick
1,666,274,692 *AF5C6AF06DEBA8BB97415FCE028166B27ECC04A8 MMC
1,666,274,693 *AF5998FAE3F560E3C3FC64963383A24892D97FE0 o->-<.o~o~.<--3
1,666,274,694 *AF50C4B06FCCFFFD660868C558D2B62F77CE6F3D >-<o~o~<---q
1,666,274,695 *AF503BE2D6583982BB76BCAD6E47FBB9361A05D2 opticians
1,666,274,696 *AF5DD2E87AEC60D2B59CC49283A114ED30089B9E MONTELUPUS
1,666,274,697 *AF584082B7FBD035FA89FD39AB014020DB229390 musophagi
1,666,274,698 *AF55182A268A76DE1C6B50B59F3EE2445B53A114 [email protected]
1,666,274,699 *AF575B39C2E6CD28991FD63A83E9C33FF76E5F3B clairrybicki
1,666,274,700 *AF5F9E8BFDE4A5B6577B2BDFF66B3A69C8C98C6A naplatom.1
1,666,274,701 *AF546B478D652D065E005DC967662BC868A1791C CLEMENTKNIER
1,666,274,702 *AF514614A14406C7D3B34305337062FAD4F1264A NAUTILUS.HYOSUNG.COMWWW
1,666,274,703 *AF5B3AFADA6CCBA53F50DAB7E9223B374424B828 [email protected]
1,666,274,704 *AF52AE6EC0FDEE72A0B28A48F09373EE5A465B09 NEVYZNAC2
1,666,274,705 *AF5A035C9F9BB9D6C237D8B162BCD4010AD0658D NMENSAI
1,666,274,706 *AF5E8CCDB2EC63EFF04FE6644230638D977F6A5F NOEPALADINI
1,666,274,707 *AF5C3E5EF10B9580DFE5EA7A4125E98D3A29A282 cloa.
1,666,274,708 *AF52404990BE51B9E3C98791FE66EC29AF69C59F (>-<) ~ ` <------P
1,666,274,709 *AF55A3931FC337E6A0B3E90F9F35F68CDEC794A3 [email protected]
1,666,274,710 *AF58E786DDE91F13D44A5C62466CD2319B67B56F PAISPAPO123
1,666,274,711 *AF54F67940F0DC003317DC8024AACD17D4E4EC9A nrc-raporgwww
1,666,274,712 *AF517DD3AB95505E673CC3BCFDDED325EC6171E3 cmrff
1,666,274,713 *AF55C44590292239BA92AB7C467C01969BD69A7B [email protected]
1,666,274,714 *AF50D35A33B45852FFE93E9D95AE35E8068CBDE5 OFFERS
1,666,274,715 *AF5BB750FD1876EB6D35E5C3E9DA2F298302E7E2 COLLECTIF?
1,666,274,716 *AF5234DDFA1E0748EC34D0B0688B691260D853FA OMAR.ARCILLA
1,666,274,717 *AF5865CA2C2660D061689BB2400138004A61F88E PAULZAPLETAL
1,666,274,718 *AF5372457579B733E20E129A30FFD51E16F3E5D6 OORFPRONG
1,666,274,719 *AF546B6B62DDB21C4FE10A788353CC3B8E5B2517 COLUMBUS.GLORIOSO
1,666,274,720 *AF559CCE7DB477A5D96CB8F4FEFA2A3BB6E071C1 ÒRAN
1,666,274,721 *AF59A469D2C173292303086A06EF100C750E01DA ORVILLEBONVILLAIN
1,666,274,722 *AF5B0C87872479B631283D6EECA2F73BF41C6828 conewind9
1,666,274,723 *AF56C7516EA38DC6505D9DE096F5F18A6C8C46C0 CONNIE.MESICH
1,666,274,724 *AF539872B37E6C226C4A3F4E6B0E85B0220A84C9 OSWALDOLUNG
1,666,274,725 *AF5C6E98C3ADAFEE1EA6F8E73258343ACEFC7F9A OTSIEWZ2
1,666,274,726 *AF5B9DA802CE5F38F00799321B3D10B4C453EECA [email protected]
1,666,274,727 *AF5392C3E5CF8AA746DCC558364671651A8511B7 outforfame!
1,666,274,728 *AF591679239B7C9D08F28CA7619998B9E21EB776 péritoine
1,666,274,729 *AF59B4DA12B12A128F4F641D99D263F1EFCBCE9F PERPETUA85
1,666,274,730 *AF58A30052235D28C40B35D797ABA8738CDEC656 P414CED
1,666,274,731 *AF546F9BFB6D4643F1855B899783895093837F09 [email protected]
1,666,274,732 *AF522E5E20D58F043E923EB0391E368C53B70FF1 PAIGEMATHESON
1,666,274,733 *AF5428C4DE86956C827471556EB2C520A12809E3 c:\programfiles\microsoftnet\adomdnet\90\en
1,666,274,734 *AF52EC1FDDAC16EA26124112FD8198EC08CF6D9F PINCÉEN
1,666,274,735 *AF5FC4C81D2994B1C37E68E57D91563456600650 Play-On-Little-Girl
1,666,274,736 *AF5A080FCD21A83AFA34EC9938F5E987E2849A09 PATAGONIK.FILM.GROUP
1,666,274,737 *AF5ED8535805A8254D1B0A76480D8E5324C8F8FD CRISTOPHER.WITTENBURG
1,666,274,738 *AF5E512267AE38EAC974B8FDC5C0E9E4E0165F2C CrossThatLine(feat.BigTreal)
1,666,274,739 *AF5523A0F565EBB496417936249EDC30A202FA66 PATSIGNER'S
1,666,274,740 *AF566B6DB329CAC39CBFB246A11C82D43BEE76EB C&R;U
1,666,274,741 *AF580407EA0D2B1085161DD1A03FF18623623084 CT&A2
1,666,274,742 *AF55E078D1F42DBD81A204B266FCBEA694B8B683 CUJH&
1,666,274,743 *AF5C463734CF189D16BA42C1F0D0F4D40D82A737 p==p`}8{
1,666,274,744 *AF5EE7C6FFAECC9FB54F4399D1C43F88F30744EA PERCYSHADDOX
1,666,274,745 *AF5A64ABA6E6507DA290EEEDF1C6FA7462620262 PERIHELION4EVER
1,666,274,746 *AF57E2254F9D33EB0BA82F4F6661DC81F1694EDE CVA/Y
1,666,274,747 *AF5D5B1EA4AE01D10A2B00AEB5FB57DB55BDF94E c;vkr
1,666,274,748 *AF57D058798F388F933630AE6D3FE0092A9833F7 PR3CL0SUR3
1,666,274,749 *AF5736F1A67FA6C42D3FFCB81BE5561C268D5365 praambed
1,666,274,750 *AF516B9D58ACB04B80C878D3BFA2BE1302106EFD PETITIESITE
1,666,274,751 *AF5320BB2EDE0ACF0AFD7C703FC4FE9412E06379 c:\windows\system32\dllcache\sprb0405dll
1,666,274,752 *AF532A37050D144B45B49A132F31A5D9C87F2F54 photostatically0
1,666,274,753 *AF5177D661CECF12D42778CA337DA2FB19CE946A [email protected]
1,666,274,754 *AF50E51DEE36EFE5D8DF8A8012BABA3739182ECD D"2VT
1,666,274,755 *AF58C7002276C9E9F85161D59F921D8D84503084 d3)f-
1,666,274,756 *AF5D4A50E600139188395AEE0AC9392648356006 protothrash
1,666,274,757 *AF53A1DC81FBF1BFD912CA0AD15E1A3070495F99 PLATANIPUUN
1,666,274,758 *AF52DF4DC24B4D1D5FAA384D45699764DAA208D8 D5J0N75
1,666,274,759 *AF5CEE6F6694E90E2E780A791D26D6D924DD0C03 PUURNAAH9
1,666,274,760 *AF5FFEF839BFB1C558C17E26234E39C3F7093C9F QI]W
1,666,274,761 *AF54F86A317A77A76E95F596C1B3BA6CDECC0BA8 Dai-4-Maku:-Engage-Shite
1,666,274,762 *AF5DE640F61FA271A5F7160027C02E1A9CEDC075 [email protected]
1,666,274,763 *AF5413640060ECD3EBCD5C66F6E426489F570F4F POSINKU1
1,666,274,764 *AF53BEDFF10888A5AEC97F14E61AFA81D892D6B1 QTPATOOTIE426
1,666,274,765 *AF5F242A25E4FCEA48EC08B3D39D0930439BB6E1 QUINN.HINDLE
1,666,274,766 *AF5CF31A4C9FC5967779FD5C8B6A2B1AE39D5C2D daniel-sedillo
1,666,274,767 *AF5AAA6FBD9065948152FD81C3A6577CE97EC272 PR0L3TARAN5
1,666,274,768 *AF5CAB56F85CB17598AAC9790F69909E84E4F20F DANNYSEIBER
1,666,274,769 *AF5275227A2DFFBC7A6B2F72E69A732F553B35A6 Q------)`~-)X(
1,666,274,770 *AF54A035BC5B4C8A2B9FA784C231C22A71E7510E PREPRODUCTION.70.25
1,666,274,771 *AF5D09FEB666957943F767F29C96BFA20C7E4E55 PRESTON.RANDO
1,666,274,772 *AF576E2B3DD357D2199F91EEB843D8664261C145 PRIMO'S-X-ECUTION
1,666,274,773 *AF5841FF073BDDDD849B10ABA8DDBFAAD3FC324B R3VA1DA+NG
1,666,274,774 *AF55715365F979B9151A6F0661EF777710EC43D0 darrelpester
1,666,274,775 *AF5E4B24C57796AB7B839AED8F190AD08A33DBC5 RACERXSAFETY
1,666,274,776 *AF5E2698980436AEC617EBB391B6F57C2B866E77 RADENDOVI
1,666,274,777 *AF59B51891B1505C0E75244D722FA65A930D9F65 RADIATEURDOP
1,666,274,778 *AF54534D12330D71C191185B5D13068F034AB15F RAFAEL.MOYES
1,666,274,779 *AF570D838C969D24DABBFD36FB5307ABF6CA0810 RAGNHILDYSTR
1,666,274,780 *AF52B58E05855B0B80DA90D8DE837632C830E396 rainbow1978
1,666,274,781 *AF55FAD05A780A3EAFD99B59180F0F2691676412 Psychic.Shout.#237
1,666,274,782 *AF56E478F1DF6AB98CFB8D9537211E79286E438C RASHADSCHMAUTZ
1,666,274,783 *AF50664FBFDC1AB916D19BE7D181E415C496454E RASHADWALAWENDER
1,666,274,784 *AF56AB138CBB3C0BCAE77E06A983ABEA3F22F193 RAYFORDPAQUET
1,666,274,785 *AF57F3ABA7C1DA43E81F78B60751DDC9401F911D PURSILIPPUA
1,666,274,786 *AF5AF9BC1759F7BB2F13DE86D6D91FA1B405BEAC Q#####>~0SPLAT
1,666,274,787 *AF54D76F9FD3E72F963E397D15E2439685892564 RDDSTRBT3
1,666,274,788 *AF5BA551C1EBEFAE74717D6B5F36659618BAF082 DD)72
1,666,274,789 *AF5DFD2E0346A91E2F664EF19E810200C96D04F2 dean[email protected]
1,666,274,790 *AF5E81C30EEF6DE40D3B4914B54024019F6AD506 REDSKINPPED
1,666,274,791 *AF5E3BAFB51719124BB9CD0BB384E2510C600E3C QRAK
1,666,274,792 *AF54711BCF8F2A02495D7119730CA774871C8B1A QUINNDAKAN
1,666,274,793 *AF5B91750E65E54EF39BB1B7C6368E09672020C0 delmarhermance
1,666,274,794 *AF55BDD3317861B7740E04465F5B71340369E250 DEMARCUSLHEUREUX
1,666,274,795 *AF5BFBA9E501702FDBC3D0B6AFAD30BF432FA72E qvms
1,666,274,796 *AF5E2D70DAD58270173B3A62459DFC6853CD6ADE RELTUBTHGIRB
1,666,274,797 *AF52F235AFCC409A941E0BA787643869DECFF974 [email protected]
1,666,274,798 *AF503DD4FF4917913324B7BCE91A07638E104D1E [email protected]
1,666,274,799 *AF5DC26385DC7AAA7D43C21B0A5946100DB3F0C2 RENELORIO
1,666,274,800 *AF57D84E201C35A793F4FA0077FDC91129F66DB9 Rainbow.Bar.&.Grill
1,666,274,801 *AF59D11FDAEBCE6B3E68F67265D2818657EC3B5C research--there
1,666,274,802 *AF547CFA6683ACA06F064CE5083855DA079186D9 resslered
1,666,274,803 *AF54938AD10F17C11824A6069E16CEE8CF8B8964 der alte dattelbaum
1,666,274,804 *AF5C6BA35D5991FC4DCAB9EB9AE9BCAC35A16284 rffekwae46
1,666,274,805 *AF5775635FC25BAD8C8B40A6A985A1056769FC27 RHYSSA2
1,666,274,806 *AF583A3156ACA4EE8838AA43354CADCF54441775 riesenfichte
1,666,274,807 *AF58254CBD889B63C912CA3CC40F2B07E9E01E38 REGOLATADS
1,666,274,808 *AF516AA03FCC2AEA7616D1892C230F4630046563 REHE4R5E
1,666,274,809 *AF5537D9197F502112C5BF98197162BE00430D74 rehearsal.1967
1,666,274,810 *AF585F7964D12B2162EFE6F0C1B605BED24AE8B8 Re.Joyce
1,666,274,811 *AF5F4778E2EC14094FE6F676FF097C64AB540FB2 RKYOOEF7
1,666,274,812 *AF55DF46DD923CE14BFD62D7E71D92F2FDAF22E2 [email protected]
1,666,274,813 *AF58A1A79F414FCD9DF6E213C0DD682B5F584481 ROBOTICA:30
1,666,274,814 *AF568A1486C48FAD8DEFEE52A340F3CBC53BB516 resistance.(soul.explorer.treat)
1,666,274,815 *AF5B0D93967CAA811BBA47CBD447096B0A2E5E1C [email protected]
1,666,274,816 *AF53DBFFE582E444D86D40DC5516C549EC93CAAC RODNEYKELCHNER
1,666,274,817 *AF59C4AD85E321A1EEE5785BACA5A2296CA2A3FB ROGELIO-ESTRELLA
1,666,274,818 *AF57EEE41459B407F1ACBA3251C30CB9DFCD2FB1 ROGER.CONNEL
1,666,274,819 *AF51B836FA45355BAD43030C1725EB0EF99FE94B ROGNON
1,666,274,820 *AF585AF61B98F209CB43D634488B0C50428C070A RON.DUCHARME
1,666,274,821 *AF5D22B006CB2307B86845E286EB1722BAB52A8B RONFLOWERS
1,666,274,822 *AF5D8D6EF9CABB0713ABA9AA05C500B275E74C2E RONNYFERIS
1,666,274,823 *AF5CE2213A997356B81D86FCA5B912C676121D29 RONNY.KIERNAN
1,666,274,824 *AF5C884AD165717D5D004516A4FD38E87AC0AD90 ROONSPEY
1,666,274,825 *AF59827F909891A2A6EC4AE24F85C824CC948D8E RICHIE.ROBINSON
1,666,274,826 *AF5F1C67D7AFF2941D30533C04CB378720226A6F ROSCOE.J.
1,666,274,827 *AF5F41F5D69CB377B9876F1DC4D6C30615EB6908 roxy1417
1,666,274,828 *AF584082B9BD6DAFE9044C3A3EFFE8933B1C5210 dinerock
1,666,274,829 *AF53625C496B9DC0F72BB9EB2EF7C318E46F659C risikotransfer
1,666,274,830 *AF51514EDB1867DB81391ECB9B4DCBCE0A10F4DD dirizzato?
1,666,274,831 *AF504874FF5E5C50878AB6DBDC96DDAE3B450436 DISTRICTBORGANGBORGO
1,666,274,832 *AF5798A36ED699E7F7612DF62E4447E68FA55578 RUSSKERSON
1,666,274,833 *AF598E7688E2F24386A0519D3CE4F4911AA18E11 d%(j!
1,666,274,834 *AF599991462047EDC3B500CACDFF8B13E9049A1E DJELOVI-1
1,666,274,835 *AF5E3481A3FD6CC1EE38A0E55BCC23496361C70C dmei)
1,666,274,836 *AF58D3CE4456965562849B307C54147D181A1FB8 d;na)
1,666,274,837 *AF57D02FEFB4AB1B470DFFEFA4F68B55B23024AF dntfe5ug
1,666,274,838 *AF582CEF384B0326D39730DDCCADD68A41E5F28A SAMGUYETTE
1,666,274,839 *AF573428D1BC62488727EBB6B0E724B3282793FA DOLLOFFING
1,666,274,840 *AF59A739868697F9664E690A81FED7146E9BBBFE ROZÁLIÁVAL
1,666,274,841 *AF528D812C3A6A34531C77267337C371BC688361 RUBEN.STUDEBAKER
1,666,274,842 *AF56DFF0DBA70AF68015FCD1712C6EB1EC899611 DONN.SOBCZYK
1,666,274,843 *AF5CD01B5BAC5EF0B88B7E5DB15E0BAE12778906 DONTE.GOODENBERGER
1,666,274,844 *AF56065BC5906186DEA05F91971AC6CF1AC08434 DO+RG
1,666,274,845 *AF537A7FDAC9F6A54AC44D5B7889FB13857F67F6 RUMBLE
1,666,274,846 *AF50702C1A4F8EDB624AFAAE8DDF7AA5A2BF11F1 rvaluera1
1,666,274,847 *AF5A55E54AA1CB4061D82775429D86556A36C093 >< * * d=====P
1,666,274,848 *AF58C5030883A667B4562251801A0E0422F65E7F S01ENIA1
1,666,274,849 *AF52DB6EAF639424A539AB3AEED5998A52AFC43A s041181c
1,666,274,850 *AF5D9C453DE7E3F8F8123BA99B63222504E711E3 dpf!
1,666,274,851 *AF54F50E6AC5D83CC95EDE67C0A0EAE6FEBCD69E SACROP1C+OR1AL
1,666,274,852 *AF5E60CB46EA6D2984F91BE96481C1D22A50C4FB d!r9b
1,666,274,853 *AF55882504A3D64C1BA0AAB6EE582C6143619898 sayantini.bhattacharya
1,666,274,854 *AF598AEB131B171DA3276F29E096E2EED6E196FD sbarchia9
1,666,274,855 *AF5A1419317CF88FDB612138A341138AE683ADE4 d`rt
1,666,274,856 *AF5EF3091A0AE623750BC51A20673A05B1B0C46B SCHILLERIZED?
1,666,274,857 *AF57DB234AC87B58B329AB5646FDE04591CFE29C SamE
1,666,274,858 *AF561340A52CA7DB069D8BC2DDA54CF94F916142 DSLAHKIK5
1,666,274,859 *AF536C6E618EFA015AABBDD95A3A4291054BD239 sananima
1,666,274,860 *AF5D8CE599476E8F556CF91BF773334484C6DB9B SANFORDCERTALICH
1,666,274,861 *AF5306046439A2DE34F208D29CF75EE406F1337F [email protected],
1,666,274,862 *AF51C22DC1C17194BD5BC6BE344C9C29F0AACA4D SARAHBADGURLH
1,666,274,863 *AF583C8640227190FB7E626F8E7F40D0E914A013 SARATSOVO
1,666,274,864 *AF556403E7EEE2F77DFB889DE00AD8199841E71F SAVILR
1,666,274,865 *AF5AF365F5276C678EF94691165CFF415BE56411 SENTERIEZ
1,666,274,866 *AF538FCBFA1F4006541214E6022EC7818AD4F691 sbh=
1,666,274,867 *AF56DF8DF85A3B21AD4057E4BDEAB42D5AFE6F9B DWAYNE.HOSCHANDER
1,666,274,868 *AF5A3DAF1E54EBE943C70EDF675790A20CAF1861 [email protected]
1,666,274,869 *AF5BF0176F4C26DAA4F754F3CD3907FDCD6FF674 SHABNAM SADEGHI
1,666,274,870 *AF5E88E8B0089314F82E47A79CA35EA077D41C57 E165059
1,666,274,871 *AF594B7F2A45C0D3CE496F3054D5BB8826AEE124 eamae
1,666,274,872 *AF5D80F873BF3FD9DAAD9FA217AB2B5A75B4E5A9 SEE.DAVIDMARCIANO
1,666,274,873 *AF54AFD4EF5EC7C9ACF45B6A5B8253CB1DC895DF ecb3g
1,666,274,874 *AF586324146EC0FC4EE3ED404C23BB1E24980452 seiax
1,666,274,875 *AF543D0159D7917BB8601FF00E642CE2A52AD5E3 ECSOD
1,666,274,876 *AF5FC233AB6149F71F0418366A535900F9D06A44 SERENADINED
1,666,274,877 *AF5F8DE7056D13EACC1FCD2F85A0EC7108A7A01C sexflorus
1,666,274,878 *AF50A392AB077B06EF582AF36FEBEC8352B51379 ednevbus7
1,666,274,879 *AF5937D9DAA1037023301D463819238A0DD6B44E SHOOTSTRAIGHTFROMYOURHEART
1,666,274,880 *AF5A0771184D02DD706286511B9E2D4045111E61 edwardcullenyyo
1,666,274,881 *AF5BF3B052372C268F02A36CD147F16412C19781 SH"T
1,666,274,882 *AF506EB1B95112BBAB4F3959BE1F5C6141FEA652 EFiq
1,666,274,883 *AF5F0B66A80FCDDC51348EA2C8C0A56703EB62B9 EFT
1,666,274,884 *AF5C8E29A4A65C6D9F856424EF2CB7120DB310B2 egocentrique
1,666,274,885 *AF59895751F4B20B1F8915AFEF2CFCB66DD424A3 EIE+7
1,666,274,886 *AF5D86E381558648D48EA447F04079EA9BB0F2AB SMITH OLIVER
1,666,274,887 *AF5257D23FD75E4E134FBAF03EE7850EA78B43AC snosialp6
1,666,274,888 *AF561C2D1A8DD34EF01D8455C53552637EF10996 ELADALAH
1,666,274,889 *AF536B999339650008AFFAFCD1DC2616F0CBC98E SIGARETTYVEN8
1,666,274,890 *AF58ABD741111B5604A8317F8FE9C7F18BCECB6F Electric.Flavas.3
1,666,274,891 *AF5314872EB27796564B936B4DF91719E3F4CC6D somethin'.bout.you.(feat..brandy)
1,666,274,892 *AF5ABD8569500B78C5BC5C9CB9AB81B7BC942203 SOROUSHEH
1,666,274,893 *AF5195800D5D69781E24372F02B34E7C77D2911F ELMERRAKESTRAW
1,666,274,894 *AF5D951283E79204B50CDAACFB5735BB6D02BFB1 sk8erpimpdaddy
1,666,274,895 *AF5A3E731669A6A33C32ED42B3009C7D05E47E5D eloy-diaz
1,666,274,896 *AF5A5F76744A274AC18974F74FB6ED00A745F923 sowdisorder
1,666,274,897 *AF5EDAC03A025B121B8FC0F14E67A953AD2939DA EMERSON.DORRANCE
1,666,274,898 *AF570E57D5D65209F83CA315B10950DD9035922F SPEEDYSTORM!
1,666,274,899 *AF5858878D26EA40F74565524949385770228BA3 EMMELEES5
1,666,274,900 *AF57A57E3C811AA15038AE6118B0704AD5D3CBF4 SNAKES&FINGERS
1,666,274,901 *AF5709936DDF420786F3AFDAAA864524684CC393 Splat0~<q
1,666,274,902 *AF5A1D5BB73DFEFD1A260404AF75FC067E6315B4 eq8!w
1,666,274,903 *AF5D43A6A9206501BD77816A7548784DD6E05B1A SOPHIA MURILLO
1,666,274,904 *AF51BF597C4B168FBE0168AB09A5379B2CC85079 søtningsmiddel
1,666,274,905 *AF54E88A5729BDF2831D695CE43B5B010BC2194D esueciwt4
1,666,274,906 *AF56FCBB9B7DA38F4D2B5814682404B627E8676B sreslegsrednuweivretni
1,666,274,907 *AF551C7CAF20B6F3DA20E80899542002B440BD2B ETILMAN2
1,666,274,908 *AF532401587ED3106B9D792EA5F19F268ACA5DAC etolyt
1,666,274,909 *AF5637A31263BFED0E80599D4C014858B77F7FE3 SPKKEDES8
1,666,274,910 *AF59113CC5DB915E3070CBC8828D649D43819657 ST4LINOGROD
1,666,274,911 *AF53E68C8C8B08DEDF39839ED46D5ACEA20BF091 stacados
1,666,274,912 *AF520CE4B3A8F7AB7DF5EB9668029D1A3C9FD597 EVERY CHRISTIAN LION HEARTED MAN WILL SHOW YOU [MONO]
1,666,274,913 *AF50AC6E29E0397A7F528E32B8FFAC15D4173FE1 STAUING3
1,666,274,914 *AF5562C25A829048E6846130F69B2C7D07B22F8C STENOMETER
1,666,274,915 *AF536A74B6EF0E485A50976C53905D1C6CDFDDD2 STEPHANNOHEL
1,666,274,916 *AF546EEBEE6BD78336EA7829B436AE0F8153E033 STEVIELAVOY
1,666,274,917 *AF5C2E49F61B88557993C2FC8D3CDC4C86D40C90 stevjaring
1,666,274,918 *AF5AC2DEFA7473984E295FC3418975A67D4E26E2 STANFORDVOTE
1,666,274,919 *AF5F2F35950D1C52F7D1C52F0523621087E6D186 STREGBOR
1,666,274,920 *AF562E0A5A147024A32098F9C02D8E651F948AC1 STATIVUSES
1,666,274,921 *AF5F3C276018D0C5A3F73C268F803FB73BF0B6D3 [email protected]
1,666,274,922 *AF5434E832A7B52CE09DA67B8AD2352D472703B5 STEVENBACKEY
1,666,274,923 *AF53F8AFB06F7D34E96AB64B8FB92EC16F0046CD STEVENCOWDREY
1,666,274,924 *AF51A1F3206791C4E7B37B694780ED7FD4793431 FAYEMARIE
1,666,274,925 *AF5FED9513687A1D7A87A61F1630CCE49E9BB475 SURVIVAL TACTICS
1,666,274,926 *AF5F2CEF0ED365B4B6CE27D2A05175D1A0B35A7E FERYFADLY
1,666,274,927 *AF5F404B8D6FFB5FC3BAB229D0CE920F4EA3ECE0 SUBTITULAREN3
1,666,274,928 *AF5AF37B5DA0B375A7B6755D4CF3B12D9641B1F6 fidelliebsch
1,666,274,929 *AF5EDCF88DFB6D22EF891B914258F6428C1A4E55 SYD.GILL
1,666,274,930 *AF50D5F4E85D43D4F7AE5034CC05A99EFEDC1007 FIRST-PROMO-PICTURE-OF-THE-DAY
1,666,274,931 *AF530DE67CFB18BBAF1F642FC46F72DE5EED9949 FKM1987122
1,666,274,932 *AF510E7819504855A13DEF0DF142F34AF4977208 [email protected]
1,666,274,933 *AF5604E680F5755D3E42A3EF74D3762B00CDAA7E [email protected]!NGS
1,666,274,934 *AF5B0AF7ACC082758BA48660558DD640B5E4808F superwally
1,666,274,935 *AF5610D937EEC6A6892475349BB1E5AE352B118B FLORABALOS
1,666,274,936 *AF5141BE17E367C46D99FE7773BC294D9F8B6692 FLORENTINO.LOVAN
1,666,274,937 *AF5F7F130170D14855914979905F7A459770BEAA formalinear
1,666,274,938 *AF5FEFF97EA13299994BF26F07D4FE342BABAEFF SVOYK
1,666,274,939 *AF53403F6E144C17BA28BEF2A4638FEEF980934D FORYOU(INSTRUMENT)
1,666,274,940 *AF5FD92EB0393541D8E80E34ECE5F05D9BC09716 [email protected]
1,666,274,941 *AF504F6CF3672BFD48EF538479BF76DC34128C47 TALKNOLIMITE4ENERGY
1,666,274,942 *AF595452F9084490C58F00225B242338167F8545 TALLERMANBBS
1,666,274,943 *AF5AA2F5834CC8075BE239AE1D035C6DCB78F7C1 TAL-MOOD
1,666,274,944 *AF5415A959CC4BF920D685AE06DD0A6357B2C101 tanimliya
1,666,274,945 *AF5236737028C93404CF2D565726D4437413135A [email protected]
1,666,274,946 *AF50DAC78CD31BB2F067FA28C082A598FD4A7716 FREDRIC.FIZER
1,666,274,947 *AF53D75E996E26F95F880BEAABAE64CF5AF6D464 T15778
1,666,274,948 *AF54ABA489ABC42968C336F35B07265519A76483 FRSURNI7
1,666,274,949 *AF5A2F6E4F61CA8032D07D556FFFD48D5D945694 TAUENDEMING
1,666,274,950 *AF5C53A432BB963BB5330E706F3F9CE8E63B0A85 FTJJ
1,666,274,951 *AF527279B9F8283484EBF15B196666A1D5B4ECCE [email protected]
1,666,274,952 *AF58130BD31116698A0CA6891521C11CC44CB606 FULLFLAVA&JOYROSE
1,666,274,953 *AF5BD1F2DD00C5E331CB5272D11A1A8F93C25CB8 TALK89.100.75.21
1,666,274,954 *AF560377394DDB31BDBBF166482BE5B4347D20AA teamaker$
1,666,274,955 *AF5A7F1CF8782D5D8C5E901AFD3A303C86FA50E7 GAINSBOROUGHMORGEN
1,666,274,956 *AF51A80D7B311EA0D8939C5DFEBF0B759F1F74AA Gaseosa.la.clashera
1,666,274,957 *AF5C75775795992071698769E6C90E32A70347BB TARIEFLO4
1,666,274,958 *AF5C215B4B9240E9D8A5E8999BE4B33BAAB449E7 GASTONBAUMER
1,666,274,959 *AF56CD3CD9A78B783756C1B57786143A198282F4 GASTON.INCOMSTANTI
1,666,274,960 *AF5D4F92679D14033E9F39157C13C950AD339254 TARTOVRO
1,666,274,961 *AF5307DE493D2B95FE8B5A9E5AE7AD808615E436 TASAPUOLISUUTING
1,666,274,962 *AF586A27D35C7B25DDF50EC9A1C74CF051F65F62 teresasnuffy
1,666,274,963 *AF53BF7523D1C2F1763493130FACB021C5438657 GEMはマイクロパターンガス検出器
1,666,274,964 *AF5C1F0A05A5A81012F7BC2D2D2B2FBC3D49457C TECHARNO6
1,666,274,965 *AF5BC6568998736C22C1BD5113D9C85A1765BB1E TEDDYHALSALL
1,666,274,966 *AF5275DE66EA64DC01BB8E303F4B7F5485DB07CD TEDDYHEART7
1,666,274,967 *AF59D9E5748D74B0200AF92AF0C77CF38A0330E7 THAEME-MARIOTO-COMBINA-VOZ-TALENTO-E-BELEZA
1,666,274,968 *AF5E8BE9BACAE36A8C8E19D4C7CEC49047F41A8A TENUTY
1,666,274,969 *AF5FD4C7007415F2C78195B46F981E902F6BF4F6 thatstephen1990
1,666,274,970 *AF5CA9F49904257887CA54B0FFB3526238952EA2 GINTYŁOWICZA
1,666,274,971 *AF56AD51FBE06BA6DF495B4C5DE94CE815CA24A4 gladyism9
1,666,274,972 *AF567B026F3EF07D9891455CFF6C1185F02DD12B thecrystal97
1,666,274,973 *AF59F697913FA15D31B59746DBB3AC79E143BEE7 The.Dull.Miles.(Exit.Decades)
1,666,274,974 *AF5A59BB9F24F6C359D97562379EA0D11AD0EA42 GLOGOJANU
1,666,274,975 *AF5473E75BDA822E79080FD078978D7E3A80335E GLORIEDOLL
1,666,274,976 *AF5BF5D30D2F3DCBD606D1A56F035FBA4629EC9C TETRASTICHOUS6
1,666,274,977 *AF53BE94B4505350626EB95E94607B1B3B255354 THEILIGD5
1,666,274,978 *AF5B23FDCAB38852D0E24469DFD257EE1D033A32 THADDEUSAILOR
1,666,274,979 *AF5C502970BDDFC00A592B67B96613BB7197536A THALAMI
1,666,274,980 *AF5DCE8D4AC4DE2B47A0555CB146E245A3D36B4A gonzalolandberg
1,666,274,981 *AF58EA51BC873DFA33427685D2C7AEEFE7C57F42 THEOTELENHUSEN
1,666,274,982 *AF5EB8EC9E4BE141581A45AE41DED41BEFBF6E6C GREGORYWHITNEY
1,666,274,983 *AF5C20446025E2629E31929DB1C55B6988A1B21D THELETTER45
1,666,274,984 *AF5F5A89FE358B488AB97800626CEA96E267A223 THEMOTHERISFRANTICALLYDIALINGTHEPHONE.SHEMIS-
1,666,274,985 *AF53E564297008CBD11E42AA5C8E760B7E808D4C gtw!
1,666,274,986 *AF54BE7FD407B81ECA8B2A364D259C8A3D1AC416 TIEHNIEN6
1,666,274,987 *AF59D5AEC97C0F93309F9D98EEC5DAB47A14B297 the-thrawn
1,666,274,988 *AF517E5EED5066083EF4F00F5EF0BE6F4346E65E GUY.PICHOFF
1,666,274,989 *AF5C777378E695F773082ED9AFDC43201ABDDBE3 THE.VERY.BEST.OF.JAPANESE.MUSIC
1,666,274,990 *AF5F72054777C99650734C5ACC2DEA68599375FB the words "community" and "communication" have
1,666,274,991 *AF5056D92092F8D624F32F15523D12CDCFA06698 THIXHXNV7
1,666,274,992 *AF50B54E96AB3491F9BFEA82DDC8E7666FD4C225 [email protected]
1,666,274,993 *AF51C41201F6ED317E0AD405B404C959216E05E7 TINETTESING
1,666,274,994 *AF54C50F9FF7101D57A09E47F62E5EB241947D1E TIPSATDFONTTDFONTED
1,666,274,995 *AF5BB4B67DD46351F2BF5C1A3667C9D4A05BD328 HADLENG2
1,666,274,996 *AF517811D34E78E63FA2C919A5F614F012601439 TIDSUTVECKLINGEN
1,666,274,997 *AF595C1F1815A09B0EBDBB20444AD694232B4EB5 TIESOJ
1,666,274,998 *AF51954BD41C03324C12515A87B73E3161539161 [email protected]
1,666,274,999 *AF5AA653DFE1E5DBF48E4C9774BB60AD389B60E0 [email protected]
1,666,275,000 *AF5173EF3FABF5ED26DAE4A1B9AB5315EC2CB82B HANSTOVIAS
1,666,275,001 *AF567DDC7CD5CD87ABD67C718518B7FA5E34E6B4 [email protected]
1,666,275,002 *AF5B55F69D2AADE178F60E5699AAF6D945345CB8 [email protected]
1,666,275,003 *AF5B994E168E8CA2922F3253ABAF61673E47BEF1 TIMEPEARLJAMS
1,666,275,004 *AF5CE017F5AE11B114AB879CA7A290B77A3AEC1D TOBY.BERMUDEZ
1,666,275,005 *AF508291809F1F94F17929CA06CE7ED2CFF35B0A TIMOTHYRYLEY
1,666,275,006 *AF5C1F4F8F0BF10F7DE4E3F1D38DE537FE2A3854 TING-CHUN
1,666,275,007 *AF58DE7C25E812ECBFE91D5D75CA1D9F489E9DF0 todki
1,666,275,008 *AF54E22D804ED05124C5C2B7D2292ADD596E41C0 tissuals5
1,666,275,009 *AF5D368C8183B902897C4FDA9D8A588E394A910B TOLERANTNOSTI4
1,666,275,010 *AF5978E56D606344E5D84495FC1B5EBD2B11AB1C TOMCEVES
1,666,275,011 *AF517FADC985A6C054FB0DBE1744FC10C7DDB6A9 towhomitmayconcern(rodriguez)
1,666,275,012 *AF51E775883A8CD06C3ED893F144B9AF42F65654 TRACYVANFLEET
1,666,275,013 *AF56D2631030BA7507811332D23B6DC38581A5F7 HEMAKROMATOSI
1,666,275,014 *AF5E278F7797DDD0EE1C6475225B86559C812EB4 TRATRIP2
1,666,275,015 *AF5395FD22464DE428CF55D6DDC97DA95B5BBFF2 TRABERG9
1,666,275,016 *AF5C5B95CB71AF751E3B60E2277F7B7113BE9A20 TRAIGNE7
1,666,275,017 *AF5D63331EA59B007138C1F35DB93FCF7B37384B TRIPARTITN1
1,666,275,018 *AF5961D6CB20CCE50C0A573C968C1D8AF65FE6A1 tristianjeffersonespino
1,666,275,019 *AF58A70ECE0F7DDDF4762F77CBA51615A54E71AB TRICOTE!
1,666,275,020 *AF5A7263E238F82F5B912FC30422521586F1A8BB hiccuping9
1,666,275,021 *AF51F2773B6551D1CE082F52C53DEEE9BA255B82 HIMMLISCHESLIED
1,666,275,022 *AF5C0A4213E2C254C1B0957E91A60B7025634C58 TRIULZI5
1,666,275,023 *AF536E5676D33136F0467DACA0C09B1616553BB9 HOG-HOP
1,666,275,024 *AF51B51E4D167551F512B508624F21F8636A133E HOLLYMARY4
1,666,275,025 *AF5EFECCE4B6B6C3B7E661D7CCB343DA407E4A93 hornazaed
1,666,275,026 *AF57A651443574D8C84F621E3E5A27940DDB195C tumie.amanda.letsoalo
1,666,275,027 *AF5A396FEB1CDE8747F1E8F3E66E4B3D30E647F2 HOSPITALIZADO
1,666,275,028 *AF5353C8EB897BE66D7E6234AFA4FADC0D1ED327 ty.gaston
1,666,275,029 *AF5DF02DC9C3C6E1ECCB4F8FC52FF84DDC8D6317 UBMOKORING
1,666,275,030 *AF5A39C706B79AEB67AA06F6B2DB1F43B34DE0FC UC0RFN0HKOZY7IVI
1,666,275,031 *AF5FFDCE68C20014B98287C63ED53BED75767281 ucc-issued
1,666,275,032 *AF521A97F9B36C13A7891FDA60406242DA1BB489 UDNILBRE0
1,666,275,033 *AF5BC0AA1D07159FD8E8627F6105BEAF1F101ECF httpwwwrealoldies12
1,666,275,034 *AF51B192A9876915DFCC396A785298E0FD55D025 UETEVUASES
1,666,275,035 *AF5D813B26F495363A94C0566828F956D2C8E2BF ULLIRAAK
1,666,275,036 *AF5AE9AC1D2A3BD55C6C48165C4EA26A2BBA8AF1 [email protected]
1,666,275,037 *AF5A759B7DF57BCA3CBED3DFAD07187A898A6F2B [email protected]
1,666,275,038 *AF56EA30DF58B811D842AE2F127023F6AD4C850B HYP0$3N$I7IZ3D
1,666,275,039 *AF5D4A456F6A6AFF86AEE69C79AB16518142CD75 i-bin-zwar-nit-da-johann-strauss
1,666,275,040 *AF52AFC21A359FA535844CA8E644A9C4FD1B99D9 USERACOMFENCE
1,666,275,041 *AF5595BA02DB470DCA765A99A20ED8BB9D2ED961 USKOTTELEE0
1,666,275,042 *AF59AE1B54D0BE7926E0DB7006018EDC747ED5A0 iftekhering
1,666,275,043 *AF55D0BB666A6F9C8E61D77F29E4F52984ACEF99 IIRODVOK6
1,666,275,044 *AF578C59E79B11BAD96D0C4D78ED0B447A94864F VAGANKOVO1
1,666,275,045 *AF539E597B57D7B7C111A8A2683A77EC5C18E7F4 VAL.BITSUIE
1,666,275,046 *AF57826F1F56FE5E543DFB1C0B7CC8795472D9A4 VALENTINHASHIMOTO
1,666,275,047 *AF5DF626E5CA2EE653A645461C42B1CB7BF96685 ILOVEBLAHBLAH2010
1,666,275,048 *AF5B3186566FBCAE12FF6949D1C9A3C400891BF6 VANCE.MABUS
1,666,275,049 *AF57B74D21FFEBFA186A0AC25D167932D779BF33 VANESSA.KALAGIAN
1,666,275,050 *AF5D01DDD35AEC73181D1CA21E6AC65A3F83595F ILUVNEUTRINO68
1,666,275,051 *AF50F152F9C56AD6249E8938D20989CD77285E7D VANESSASCRIVNER
1,666,275,052 *AF5BA67221534B9DC398A4E3BF5C38895E72BD44 vanessa.joy.cortez
1,666,275,053 *AF55632C049958F182F21EBD0CC927349791A8A0 VANESSA-MAE-SABORDO
1,666,275,054 *AF5F676C4F4CB334F30119D67960609024F99B00 IMHYROIT6
1,666,275,055 *AF5F39058D6AC2CB3497DF36AD1444A673D6B980 I&|N
1,666,275,056 *AF5E24B548B526E4DB0F4CB2CA40D1188384C06D incont3$tabi1iti3$
1,666,275,057 *AF5EECE284F20610ECE040788E270CF6A6BC26E9 vernzager
1,666,275,058 *AF58C3156AFACA358150842C72AA9C9A3EBBA922 VENICE.AYMAN
1,666,275,059 *AF5200E2C1F2FCD6FDC90E956DE581BDAC4AE42B VENUEBAR
1,666,275,060 *AF568FB526C9AE2421C98CEEE45A7616970405CB VENUSPROPERTIED
1,666,275,061 *AF51D4E54F2EE049733802F03405C6E77AF15321 VERSORGUNGSZÜGEN
1,666,275,062 *AF5BF0A9103AB05E48B96EE93752816C7A89F559 vfqprd
1,666,275,063 *AF5F21665856D688712FAF5D1300521D44FB5E9D I*OV
1,666,275,064 *AF588D59E53EA70961C0F1903A75B9DBCAAD0C05 irwinbarbarino
1,666,275,065 *AF5A1A85DFFBEAE550D7CAF2C53D3E9F9D0BD288 ISAAC.BRIZ
1,666,275,066 *AF5A1F0917AA5431C2362823C7407ED81116D684 victorgembler
1,666,275,067 *AF5CA80286F6C3687AAF0C44F55CABF40D7839C0 VICTOR.SANDELIN
1,666,275,068 *AF5D1E1D9C4EF3EFC321ABB3526A2443C4B11F52 VIETATEA
1,666,275,069 *AF5EBBAD8517062DAAFDB253286488AA0B55FB31 VIETNAM_STAFF_SERVIC
1,666,275,070 *AF527A923FCAEDB4C99375713BF06F97DD0B6479 ISTARTTOSTOP
1,666,275,071 *AF55C5E3BA02C73FC69C05217E67643A85D1941B VILLAVICENCIODEL
1,666,275,072 *AF5F2FFB0CC967B30663E6E8A9C18BBFA0DC3078 IVAN.CHENIER
1,666,275,073 *AF5B83AD7F885A0497405A6E02FE784E78336AC7 VINCENT-GUAN
1,666,275,074 *AF5851AFC184D07CCF62EC9C27C47B18FDEF2B89 VINCENT-OLEARY
1,666,275,075 *AF501DFD731943E15F4D25B6D74E41C22D8F3ECA VINEGAR.BLOOD
1,666,275,076 *AF5E3D7730D494EC23CF01F9B683CF9B8A37C185 virgilrodregues
1,666,275,077 *AF5040584034CB3DD96CFBA0000617FBBD775707 IZOZYMÓW
1,666,275,078 *AF55FB45DB7A59DEC4ACF9F14D879623ABCEF608 VIPERBERNIE9
1,666,275,079 *AF5962813639A9BB1184B9FD1AD5AA67228BEF5C jabarihunter
1,666,275,080 *AF562A151D30112F386BD1CF799D0D5BD7E1EA2A VOHL
1,666,275,081 *AF5A9F60A9BDDF49D8A1D1577B7C8C0677EBFE21 VREDESBYRD(RADIOEDIT)
1,666,275,082 *AF5AA564684F8EFC9C53E71C9315E5EF37F38469 [email protected]
1,666,275,083 *AF5912F97A19A470314FC1F3D4693E57275A1198 VURRICAMARTIN
1,666,275,084 *AF53532A495A89F1570BC2E3D52AB2C04FB73862 JAMIE.BENITZ
1,666,275,085 *AF54A0EDF7599426C560F7DC170D8236A6D73B59 JAMIEBIRNIE
1,666,275,086 *AF579611DCBAB849C037702008A771E4410C0FD9 v\y#
1,666,275,087 *AF5FFE8C79CDB4D5C7A14162787E6BB0318038C0 JAROD.WOOLSON
1,666,275,088 *AF54B1A20FC68A10D645F2C1871C40EAD3C0B827 WALDO.RONSINI
1,666,275,089 *AF5F850555F132E67628A12F95813CA66291373F walidashor
1,666,275,090 *AF5CC7A6F899C9F18E208C170FA54A23DDB490CA JARRETT.HINDALL
1,666,275,091 *AF5F6107EA24A78B5C21EFD61A405C54F74F1817 WALKER705
1,666,275,092 *AF5D498578664878F9BBE19923457E44690ED7E7 jarrodnordstrand
1,666,275,093 *AF5A29E473EE6AF0290BA8ABF84A5055BD78672D walter.foelscher
1,666,275,094 *AF5DB9A1805FCFEAE6716B6ABD35B4926C17E69A waltergatts
1,666,275,095 *AF55608971C70260F6A81AD97BE90EC7EEFE83EE walterillich
1,666,275,096 *AF56F4EB7EF4F9D63B6F324FFF2100A1CBDAB0FB JAY.BARNS
1,666,275,097 *AF5C66AECE01D08AF93D0205711AF43EFD96B1BA WANFLARED
1,666,275,098 *AF58FB1057730F2B9B67C90C99084BB93407E93A ward.lawson
1,666,275,099 *AF589EBA9FB5B2E4F3DED979F97C1643F9B6E625 WAVERLYGESSNER
1,666,275,100 *AF52532D129E2FBAFD366BF84992167B03963CF6 waylonengberg
1,666,275,101 *AF5AD473E1C085E162B55DB5F8F89F22C2DEC35B waylonjewkes
1,666,275,102 *AF593AD8F09E3A0CF3A2CA174CE1CCCF0F50E784 wayne-pinter
1,666,275,103 *AF53A5B8BF485C809B325A6F221E9F2E243B474C WAVEL.WRIGHT
1,666,275,104 *AF5C04AF3C2904A433ED8677050AD03DE3953387 We-Be-Lookin'-Like-Jesus
1,666,275,105 *AF56D83F08886036198857A7D3E9F2B0D687DAA6 waynesnaer
1,666,275,106 *AF58DAF1FF39A4DC7BD8BB8E0004EFAFDEE4D333 weite-geng
1,666,275,107 *AF5BDB611BA4547134B91629A87C9804BB9F9EE8 WelcometothePleasuredome(Urban/Tribalmix)
1,666,275,108 *AF5CF3E1C080490EC4C245C092E4D222C29FF102 WELDON.OVERBO
1,666,275,109 *AF522B5B2DAD336D29BEDBAAFDB6968A252C7BF0 JESSE.LABAN
1,666,275,110 *AF522D29DE0D52AC7676A72F50B24CFE30221828 WESTON MESCHER
1,666,275,111 *AF5560E69A890943B747C7CAF6BA87A8FB72CD44 WHENIHEARMUSIC(INSTRUMENTAL)
1,666,275,112 *AF59A0FB0915DF15FF9DC7A2F81128EFCA7BE78E WILLARDHARSY
1,666,275,113 *AF538197986B6D0E8920813D661723034E93C132 williambenlilly
1,666,275,114 *AF52D0B6951BC041B10AB208399D4BEBE81B7821 [email protected]
1,666,275,115 *AF56C20867C071414652E28A9120EC7F8851433A jimmygehm
1,666,275,116 *AF51A205B07B6C13C9A000FAC9FFAE9BCA811428 WESHOMESTEAD
1,666,275,117 *AF5A4AF817A41D4F04FF25D336DDCD8BF63289FF J-LINE
1,666,275,118 *AF5B691E0A7CB58810540B3E3993856AFB62E5EA [email protected]
1,666,275,119 *AF5305660E844DCC0DA6AD2F4F3FD732D737BB7E whatattitude??
1,666,275,120 *AF520BA30194DCA0FD00873A66FE6BCC716C6A4A JOAQUIN.DEMARCUS
1,666,275,121 *AF5B2B8E3085F01CC9258E56128A58598C4A2402 joaquinlotshaw
1,666,275,122 *AF50491B754EF07DF1B5E1965D494625D8DEBCE6 Wilson's.wilde
1,666,275,123 *AF5FDC8B8D853E4A93EFBB7A23C965776F6C2C67 JOESPHSOUPHOM
1,666,275,124 *AF5392C72752D47FF6EBE5BC9C85C5C374D64163 winfredviener
1,666,275,125 *AF56D6435FAD96B481383FD77084AED2A3697854 winkler54
1,666,275,126 *AF5F8C25F829AC5EC0093C0A02B75F17BCD5226B WILFREDCHIOMBA
1,666,275,127 *AF53FE4985F7B243EDC3DBA7F8064D85B24E572F will-yamamoto-jr
1,666,275,128 *AF58F8A1998E0FE2BAAF92B0D21C2283CDE49D27 WORDPERFECTS1
1,666,275,129 *AF521ED95FA01D06FC642CE29C932338CC0261C1 WPZAG
1,666,275,130 *AF54CBA47FB3B906158D8F927926832BB3AA12C8 wiltonashenfelter
1,666,275,131 *AF5240C9D79BDCEF368A62D05853ADB24AD0E1D8 WUTSCHAEUMENDSTE
1,666,275,132 *AF59DEC11ED33CE09209244E3E1D12B9BD9A3E31 wwwbattlefielddrumscom
1,666,275,133 *AF5EDCF248412227E33308410A80346A5058F4BD wwwconcusscom
1,666,275,134 *AF53CC7432B504EB872A862CDA06FEB27C3823B7 WLETNEY
1,666,275,135 *AF58E7CB50B6CB74097D85552AC0BEAD20E16849 WOLVES38299
1,666,275,136 *AF5315F75D1BBCD17FA0066E37A78326C65CE908 wongduentharachat
1,666,275,137 *AF52E2F923D6AA1856CECA54C3D50EECBAE988A6 JOHNNIE.TATE
1,666,275,138 *AF5F9305F1F26CB1A00AFF71FC1682C98A308FF5 JONATHAN.ABDOOL
1,666,275,139 *AF57A91F01F5FDE6075346FA8790FB027FD4B860 WWW.WISECLEANER.COM
1,666,275,140 *AF5FAD1D5C4723E18FE0B016265CF1197FF9C759 JOSH.STERNBERG
1,666,275,141 *AF522C1B07BD3823F058AA5D7CDC378E807428CD wwwdigitalportalcj
1,666,275,142 *AF5D3E9349A1A1E22F1C4307D24E65A13625BD10 [email protected]
1,666,275,143 *AF5FD5457A251F4718D92FEADD4569F96AC5E6D2 WWWKEENZOCOM
1,666,275,144 *AF5958C7AAF32C4DB74B96515D45C53F5AA1B971 [email protected]
1,666,275,145 *AF5BBD7E4D5B54F7F8E67342C9CBB9A255F958CE WWWMATTHEWBOLEKCOM
1,666,275,146 *AF55848348A6B2B84D869114E8943930F446A9F2 WWW.POSHRESTAURANT.COM
1,666,275,147 *AF528CE5E4E22DBF3B8EA4B27CB8436A407FF28F XIOMARA-A-VARGAS-APONTE
1,666,275,148 *AF5292282386992DA3C2D3C099429CFD5072A709 [email protected]
1,666,275,149 *AF5F7967CC6427E195BAA9B947029871519834EF [email protected]
1,666,275,150 *AF5455F7327EC5541058AB27BEF7CE53F781EC50 juanroldanboxeador
1,666,275,151 *AF5DE8054127C44EECE6CFF4BB66328D33F6739B [email protected]
1,666,275,152 *AF5C03F207E68FC2B714E4CC1FEEC3067A4FD4E3 xumeiluo
1,666,275,153 *AF5FE83DC520F3B4BD50F489552D41E7FBFDAE20 Y46632
1,666,275,154 *AF5319D92193D5B99A5E833B68EB26F1AF619FC8 [email protected]
1,666,275,155 *AF57CF84609E758D0B8B264D6C0EE5A6307B9E21 YearoftheFarce
1,666,275,156 *AF5D2F9C9D52358B031EED77E2439A5C444A5168 juliusnicolay
1,666,275,157 *AF5E51A75B779B453A13ED2AF4831EFB6E57E5A6 YETZALADYKEE
1,666,275,158 *AF58BD221448F51E1912D92A829335EECA0DF779 xiang-kuai
1,666,275,159 *AF5FE6A1710FC853B7741EFED8A00CF75E2CDC38 JWJQEIB80
1,666,275,160 *AF55ADC71287D6AC6741DD335C4ADDA35984083F [email protected]
1,666,275,161 *AF5E232EF96703DE438100F66C12B337B3CE4F63 jzka
1,666,275,162 *AF542DD7B6E7039D2DDB1825FE38EF498551D1CB KALLIGRAPHIEKURS
1,666,275,163 *AF5F79AF8464CDA982CDCED14A80162C8AD363EE YOU-NOBLE-DIGGERS-ALL
1,666,275,164 *AF5AE6495F74C7E5FC8B0160F9EF9CF1EB2F8D04 karlkeaton/clarahill
1,666,275,165 *AF57EF8990C412AB7A2E181ABC67E555CC87F50F Y112549
1,666,275,166 *AF50AEB29479573B19EFEFE589A9B7540706D98A YUDHA HADIETAMA PUTRA SANUSI
1,666,275,167 *AF516EDFB40A17B7F0D0AA103980BC55DD5F54F3 YADIRABAEZ
1,666,275,168 *AF583E5DA9B1B26AA40593B1C34EF8A30DC1DA21 yum-psk
1,666,275,169 *AF501E930D7175EF031BE5406C4932635B287479 [email protected]
1,666,275,170 *AF51B1F8387BD8F93D216125E10C19C951C58B21 KATY-UNDERWOOD
1,666,275,171 *AF505A8D06F77C4A804D5A5AA544607ED85CF75D KAYLALARASATI
1,666,275,172 *AF59A5AD05FF179E716CA31D354935F3F60A88E2 YVETTE BAINI
1,666,275,173 *AF56EBCA138AEA783C4D2CB319B78ABB8CF6AEAE YVETTEZAVALAMARISCAL
1,666,275,174 *AF59547A11970238CA65D1CCE913F7FCA3298998 ZACHARIAHSHOULDER
1,666,275,175 *AF59A5E457F75B410B5CCB5A34691DEB7C098FC1 KEDUOGONG
1,666,275,176 *AF55DC7959B814BBD72D234681F8794137FD26FE YARNEISER3
1,666,275,177 *AF5F143CAE3983BF3A2C669A89A88DFB335C30CA zacpaly2
1,666,275,178 *AF59E1F134EA6DDC2ED4C9350384EA9976A71075 kendrickschatzman
1,666,275,179 *AF56E81D7F4742BB6DA7AA37710193BA805C1BCE KENDRICKVENHORST
1,666,275,180 *AF5F2F984C55E5179710C72023D90E814D0244C0 YIMABEETSEH
1,666,275,181 *AF5D283E9C4EAAC5F25ECC86E8B0AC5A7719B725 ZAREEK.ALI
1,666,275,182 *AF51E28D44174B3FB1A909296F06924F7197A03B z&c6
1,666,275,183 *AF53B106BB5D9801D6CA0064072ECC2E3CBAE2F6 YONGKYSUSANTHO
1,666,275,184 *AF5708D4078501A8009F3953E8E6D341EB376C7D YOORI YULI KIM
1,666,275,185 *AF57DAD6A8BA8523ED777A03EC2E5EFBD5C2FE72 KEVEN.MCENNIS
1,666,275,186 *AF55A54F57A2FF93B3FCA0237ECAC7DD73AC83B4 KEWBAWK0
1,666,275,187 *AF5FDFA9300F8F207D0E20F05CF0ED0E7EC514B3 [email protected]
1,666,275,188 *AF56769F9970899E3E2949ADEEC0808653DDFB72 [email protected]
1,666,275,189 *AF5B6DCA26E249F362571F50C897319FCF590950 [email protected]
1,666,275,190 *AF57CF482A24E5C2664792C98852C78C28E8A813 KĪKĪAOLA
1,666,275,191 *AF50405834A3FAE69DB3F1C8BB2590AC545DA6F9 YUSRIZALPHAZIL
1,666,275,192 *AF5CA52C9FDCE76F1F07B4CDF626F2F1BDF101E2 YVEHCSLAMINA
1,666,275,193 *AF53FD77F420A8224F8331D26D5DAF848DD46DE4 [email protected]
1,666,275,194 *AF5CCFF21E3131C0712EA2C31CF2B1E841E3D15D ZACHODNIOWIELKOPOLSKIE
1,666,275,195 *AF5619519B2297637CE48C7B226ACC4C21A0310E ZACK.CAROLL
1,666,275,196 *AF5EBAC1FE6C54979FB56BC1653EC484E6FD0A81 ZIHOUF MOHAMMED
1,666,275,197 *AF579AE0BAFA98EC4B60C793DDA2111A2547D92B ZAIBAA SHAIK HUSEIN
1,666,275,198 *AF5DFE554FEC9160B242E70E703A2206D6D610F5 ZANNAOMAR
1,666,275,199 *AF5CEAE22E9C5B2CF68BA13A89BF95F40CE3B9FF zara877
1,666,275,200 *AF5808B01BA2468CA21330F5D9469BC087086E3E [email protected]
1,666,275,201 *AF59DC2937F5F163503B27C23F7D44E1B08E3014 knightrainbow
1,666,275,202 *AF596D76F508EC9C3769CFC2E199E7FD1E92FCE6 ZUKESSHU6
1,666,275,203 *AF5068F7C5E73320520E67A6C2FAE9FEDB9E0C42 [email protected]
1,666,275,204 *AF5AD7919A17671F7D9CEF696B4AEAA1241C06F9 konomiwikipedianere
1,666,275,205 *AF5F6C31D22B017393E4EC4CECF378BB3792A596 korysheilds
1,666,275,206 *AF5A9F0CA4F6C4D76F23C3CC5F5CD5F35C806868 KRISORTIZ
1,666,275,207 *AF5159B5A80C4C86F32AF2040E2F1DC67238F99C zita.neely
1,666,275,208 *AF54136F50537787991D10D4C79F8F05E0BD7044 KSOWERY
1,666,275,209 *AF5ED56EB4BECC8A8499916F94901D3C95753E07 znano
1,666,275,210 *AF516DCA3ACFFF514AB8AE76D2E6010B9C943B5B ZÕRJANKAS
1,666,275,211 *AF52538A721AE9FF3F46DFAA259D654A489385F7 KURTOCONNOR
1,666,275,212 *AF538C67E536BB005F63D14373E2EA42FE549CEF [email protected]
1,666,275,213 *AF520AC4EC5A7D7CA18027DCE207629BDF24A6AD KWARTLYNS
1,666,275,214 *AF5F7A7142E2727D52D0C8E09E0148088714805D kynvgp9lcb
1,666,275,215 *AF5EA16A445C6EB77AFBA4F57A25AEA67CE5E365 КІППЕР
1,666,275,216 *AF54EC4F7C8BFFEDFA5FA09FC990019B553F6745 ΚΛῶΝΈΣ
1,666,275,217 *AF5CC002F482F3CD365BC6ECA9F77177369860DC МЕЙБЪЛ
1,666,275,218 *AF58B7D34ECA3F10380926BE4C074D3C1621B97E laronrussell
1,666,275,219 *AF57D54639B7117E142AF408CC050078F9C65724 ВЕСТЯЩОТО
1,666,275,220 *AF59251B8036F48176D53CBE6D312F076147B74D журила
1,666,275,221 *AF5A42FFD8FDA31F6DB4D13A8469BFF069E4D87E LEADEDPANED5
1,666,275,222 *AF5B2212B17148A28711E63AF50161813AEB0343 ХЕМЕНУ
1,666,275,223 *AF532C70823813CC1B9502A22FD750347B4D07E9 leepennix
1,666,275,224 *AF50B6347602D048789A927AFAF30F6260DA0417 leeregefuhl
1,666,275,225 *AF5FDB0AE0289A361E0C3026B92C7650B18C3AEB legitimization8
1,666,275,226 *AF5A8C25AC463EFDBFE5FCA3DEB8349F96ABC212 lenahans9
1,666,275,227 *AF50A678DF86040A2157CF794AE486505704C46E МАЙОРЩИНСЬКА
1,666,275,228 *AF5FB2E4F02E64043F1CDF779E22F8EEE5B6FA6F насреддином
1,666,275,229 *AF5AD13869922B8C0C9CC14D64D2CB5130DDCB42 пермасский
1,666,275,230 *AF53579C7D5F7DB484BA66B8EB92C24CF2E67770 ПРОСМАТРИВАЕСЯ
1,666,275,231 *AF566641A24D55EBE983D8E6353907FF58EC22C3 «ПСИХЕДЕЛИКИ»
1,666,275,232 *AF5DF0CA65F8A2080B054A30D3885AC9FDF8683C LIBRA1971:1971
1,666,275,233 *AF594FE940CE5022EBA0C4D86AADB4ECB1B3479A LIFECAPACITY
1,666,275,234 *AF5FF1B79FCB21ADED2264A17F6A27A0FC42B5B4 СВИАМЮНДЕ
1,666,275,235 *AF50A55B94C0240052B540D460F0647DE2AB44FC lindseygofton
1,666,275,236 *AF5343A6D6C7C32E982E6235831FD628711170E6 (全削除)1枚目の右下にGOOGLEのコピーライト表記もあるし…。
1,666,275,237 *AF5AE2E91C71444C5502AA55E172E9F2FDF5E2FB の名称「bol
1,666,275,238 *AF592BFBD371D030C4573CBA724102ECDD2D1094 lonniesequra
1,666,275,239 *AF550CA7415E7B9E9B6E207AAE56CABD3D55B7D8 LORENZO.SOBIERAJ
1,666,275,240 *AF5C9F3366BDAA15C6451829DBEE514D7A788576 LOUIEROAM
1,666,275,241 *AF5F0389694BCBE4D8BF1DE3A67916338D7067F4 LOVEZL2000_2000
1,666,275,242 *AF5D8EBDFB4F875E587A14A779E409D457B447DE LOWFADECHICKA
1,666,275,243 *AF5D0A9D37B9B2552F9A1DBEC85E99F65B0690E8 LSHYX
1,666,275,244 *AF585788175FD1A3ACF097D608F88A1E63EA3E6F LSOUGRAKPAM
1,666,275,245 *AF5AF961E748166F9F56CF18B77F72BDB8D92F4D LUCASKUROWSKI
1,666,275,246 *AF5D665B227208DAB3A2E6967B4B99802249F232 春風doremi(
1,666,275,247 *AF513B53FB7530A4D1A88F3684C0F4DB2369231D LUISREVILLA
1,666,275,248 *AF5A859AC83391CBACCBC25E778CDF4D81857F35 LYNWOOD.KARTMAN
1,666,275,249 *AF531EE0D471CCC2B3BA5BD3951457B5531089E5 性別:男性 年齢:40歳 誕生日:不明 身長:172CM
1,666,275,250 *AF5BBA005C4D61919403B442BDE7ED415A349CF0 M8{
1,666,275,251 *AF58A264E5DCAA885EA7033143BDA912A6309D96 MALCHOFF9
1,666,275,252 *AF52DAFE2D0A42B7F357B6A011D5BA30C8B7016A marcalway
1,666,275,253 *AF5B6565EB71915FE9C187C5E74F60D722210393 marcelsheely
1,666,275,254 *AF5EE886114753467830C1003E67812281B849E8 MARCONEIRA
1,666,275,255 *AF5B768A1AEF5F42F21E38023732BA79DBE4A379 MARCOSWIZWER
1,666,275,256 *AF51D81B89FD597E7CD33AEEC94291FB752D4C7C MARCUS.PROWANT
1,666,275,257 *AF547DB457FC11FB2BE3C2EAC819C1884EC0EEBA MARIANE7
1,666,275,258 *AF5C6C4B6B1B613157523F7F2D75C79B44C4A49F marichudiaz
1,666,275,259 *AF5D42A11C0B15B8451092130712407B01CAADA2 masterrace(inouterspace)
1,666,275,260 *AF5AFE218FC5EFAD93408A864C9670C9EA405C96 medieval-rites
1,666,275,261 *AF51181E2A3597D11ADCD4BA476271C42FFE8CEC 1003059 THATEXCLUDESCERTAINPARTSOFTHEWORLD
1,666,275,262 *AF55D603EAFBD2BEC290B7D1CBF0E9192620D5C2 meichiwong
1,666,275,263 *AF53A2F4F8103BB79E474B8C1E4D0C7BFE84EA27 10.linst
1,666,275,264 *AF5000E24D74CA1B03AE398D5610FE4E3609910B (0-0).o~.O~d######3
1,666,275,265 *AF53382AD7B4DCAD688B4ACE873E1C24595CAEE6 011KAILA
1,666,275,266 *AF55CBCDB83934F271DE7EBCA39088DAF1E0AE48 MENOREI
1,666,275,267 *AF50F76F0B4BD5AFFA8CC5D82C13417BC799242B MEN_RMFF
1,666,275,268 *AF56F33A7E00F942A0D73AC3A5494809C3CFB4D7 METALTER
1,666,275,269 *AF530B1450A3F0375B656ED1477E5810A6436EB6 MEUSENHOR
1,666,275,270 *AF5AFA5B98AD0BD78ADBF933B1DAFCA06F25196B 0IAMDILLWEED5
1,666,275,271 *AF57248B3E2253A02AC7F25B45A79261EAD80E07 0RCH4MU5
1,666,275,272 *AF5B1EE35ADE8A42274879CB8B41941B6A481777 10-oita
1,666,275,273 *AF5CC1BFDDA4B9B979654C67CE6D6AF2A652DC95 163033 ICKIYE-YATKINLIGI-VAR-MI-?
1,666,275,274 *AF54EE863B5FEAD51C673EDD9EAA2FBC41588400 12161741
1,666,275,275 *AF519B6BCA39798ED5D10947E3CB38125B140F00 1807839 county-health-officials-counseled-calm-
1,666,275,276 *AF56C9D30D16D49E304411C60A1F35A11C415F6E 1346825 HUONEISTON JA KALUSTON KUNTO TARKASTETAAN KUNNAN HENKIL
1,666,275,277 *AF5CFBD8FB64683B84C8D8EDB8F4E56ACC68E26A 18july1602
1,666,275,278 *AF51FAE0DBC873C23DD4B32CDABAA4CE492BCAFC 1975865 apinatheitteliv
1,666,275,279 *AF5ADA68DF5AE9EA7D34CCC5C51BB7E8A8402364 1983年のMLBドラフト
1,666,275,280 *AF5256F9ED8C2B45E08D750758F304431A3DF077 MODEUGEN3
1,666,275,281 *AF5A2198292E2A7307039F30B62817A6A349A366 momentous7
1,666,275,282 *AF53D6DE52255CBAD8332417D4E213781C967F7C 1.DAVONKUENDEN
1,666,275,283 *AF5D54750AF4FAAB14F0421EBCCA706CB7E71519 1918968 insofernlassesiedasganzeansicheinfachabprallen
1,666,275,284 *AF54030CF2B2883F24E59FF8F37FA2A328739170 1drekkerigst
1,666,275,285 *AF5BC30E570AF034B24B2D26BBC0647FEA187A38 1994:ILLMATIC
1,666,275,286 *AF593FBFDD3FF8D3524528251C8968E3BBD09C69 moysikoys
1,666,275,287 *AF5819FCC17151AA445A7E6658346028355552D4 1-AUTOTARVIKKEISTA
1,666,275,288 *AF5CA478C8D28329332DBE76DB9B9217AA7CE96C 1HAWKFIRE
1,666,275,289 *AF5621C6DB0488892E89A3E9072CBD7610836F60 1-betriebsueblichen
1,666,275,290 *AF57AD957F6945B871FC06CE2F0B430C75A458B0 1-HINNAUI
1,666,275,291 *AF516C79E8279EDEF966947B20E5864489499D2C 1EMMATYTT
1,666,275,292 *AF59C3DB330376AF0480FF108DC0C6B4A3F8107B 1europatenttihakemusten
1,666,275,293 *AF537468A370598E40D5ABCEF27F271FDAEA82BA 1lapane
1,666,275,294 *AF5E7AF5FCB6C49366A4D53FBD19A950C79278E6 1FUIUUYF
1,666,275,295 *AF55A172F44ADF9FB9DD2830481105AAEBA859B1 1-lizenzantraege
1,666,275,296 *AF5FA20D066CFF62462C2CCE005B4F0597459CD4 MÜRTEFI
1,666,275,297 *AF555E0E40E2CF9168AE1B350FDFD6C530488C2A [email protected]
1,666,275,298 *AF59A5DC9AEB4075F76A45B945FFE9C34EE8B386 1MARYGABY
1,666,275,299 *AF54EC7CD4A64ED7377170B0F6C7D6E76869A346 1-ICECECEGI
1,666,275,300 *AF5A0CA0B5E64091D40A68D0E78AE4E24FBA4144 1MYJOHNNY2
1,666,275,301 *AF5BFB9B7BE432CBDB55E1A5680B3F5C3C31F457 1-neu-sarajewo
1,666,275,302 *AF555B0A6341AC600A6BDB52CDE03B95CD90A092 1-KONIGININ
1,666,275,303 *AF5B1BE7BE7EC4E82051B0730AAA04962A4D235B mymchaschet1
1,666,275,304 *AF53236A832F38D13C481A892D54387FE53147B2 1.PEALISKAUDSUSES
1,666,275,305 *AF5284518FBB4F5B303BECB902729ADD95DE83D0 MYSTEPHI72
1,666,275,306 *AF5261B559B7AC44619A9156D81601813FCF26D0 1 PERINN
1,666,275,307 *AF5AF8F7B79F5F16F0FB75BB43261A8DC6332D63 1PRODUKTDESIGNSTUDIUM
1,666,275,308 *AF5E15E57DCC9E0F86129CED03B78BD1FCA644B5 1Q29223
1,666,275,309 *AF50B86E1B5B39F12B955FC25A87CBCD85EC2BD4 1NC4P1T4L
1,666,275,310 *AF51BB9255E6880D4CDB905BEB238573E45D29AA 1RMALOUF
1,666,275,311 *AF5D75B4217017704A5AEE10FA5168C3E2BB063E 1 SED-LEUTEN
1,666,275,312 *AF55533982506BB939D1EFD3711B7E2C523912CE 1siegeltitel
1,666,275,313 *AF5D96182EF0EA6511ADDD532040F6B1D0E505B3 NACHLASTSENKER
1,666,275,314 *AF55798CC736369CCE0ED415B0F98A0954272FA1 1-sirkilasyonun
1,666,275,315 *AF584A428FF7F93AD38C4A4FC5AB7948AF3D2D7A 1praezisions-gewehr
1,666,275,316 *AF52E7F864878C891B4FF7D58AE94BDC37485885 1.rantakaavaosakkaat
1,666,275,317 *AF5682B8B1DD69B191DA1763D5B233AE295FA2A3 NASUTENESS1234
1,666,275,318 *AF56EAC3A6778C743840F2E6BEBBFD023DCDCC36 1 TIME-COULDN'T
1,666,275,319 *AF589D838508E1F9CD202714A4ED5DF6408C7F0C 1.ucmus
1,666,275,320 *AF5AF98EE6F4B5588C99CE34A817C7335186C33C [email protected]
1,666,275,321 *AF5DA09D08DCE694E3132C3BD9830223348EAEED [email protected]
1,666,275,322 *AF50CB0484815D75793D0547F526671A690ACBEE 1.VERSPROCHENGEBROCHEN
1,666,275,323 *AF58F8FF5F77CFD6501ACF46E8E4E9D874DD0649 1.videoneuvotteluluentoja
1,666,275,324 *AF5278DF03C15B34F595CDFB6180D25F0526E815 NDVSDLY9
1,666,275,325 *AF5E5F1FA514E79D0393EDCF84BFE4B7B558B114 1-TAMMERFEST-ROCKJUHLAN
1,666,275,326 *AF520BCBC6BBD4143CA4AE6ADBE7466C25380938 nettoie5
1,666,275,327 *AF5B04E832D6CD78539DE4B39ECB963D858FB989 N%F|
1,666,275,328 *AF5C97EDF47BBD9389DA1954A04829C3D8111B0D 2203171 "ohnedirisesnischt"
1,666,275,329 *AF540F3CE32557F612A3C0DB125EA2B397ACD8B3 NGURUPAI
1,666,275,330 *AF5F1D55ED8AC25FE14DBE7A4E18194996D27772 2310564 " THEY ARE FACING A TOUGH , UPHILL BATTLE , " HE ADDED
1,666,275,331 *AF5DB56FB802334735968BC92699BFEF7E4925B1 1.werbeeinheiten
1,666,275,332 *AF578C048809C105286689968492C47DAF01091F 2402246 NIEMAND-LAEUFT-UEBER-DEN-GUT-GEBONERTEN-PARKETTBODEN-
1,666,275,333 *AF547BCDD68FB64E4210E350DEA28BED3B1CE6FB NISIOOTING
1,666,275,334 *AF5BEFC4D9D15C229F65E1C9213E863E0B3BDB28 255precious
1,666,275,335 *AF56C62116E8963C371E7155F9137796C90D64A5 20TERMITE
1,666,275,336 *AF5E9A40A6F15AF81B0A148D29EEC51840B3D032 NOE.CANCHOLA
1,666,275,337 *AF590086B145B61FDBDF45F6002004FAF98ABD6E 21.mahkemelerden
1,666,275,338 *AF5DAF0D5E0593D86A23D8E2FDFA81DF3BA58E60 NOITALUC6
1,666,275,339 *AF59BEFDECEBCCB21EA787FF8DA171B65B252492 28cspurrier
1,666,275,340 *AF5197F178FEDEFC85807F3141040EB176B16471 2ARABOTOM
1,666,275,341 *AF5E31B40C2B356360E870F46EB348E7B18E209A 25101793
1,666,275,342 *AF5A7E167577D6D6DED3106C159C4BA4FE7F07F1 nothin'lesser(feattheun)
1,666,275,343 *AF52E67370B90D691179FF6853ACA1716C8BA891 2ILOVEGETOUT0
1,666,275,344 *AF5C83FCC711F925A088539CA22E2D112F3EC9AA 2JASMIN
1,666,275,345 *AF58BB970B98FFA3E1ED848347FE133F673620E1 NTAAPYA7
1,666,275,346 *AF58253F5B18A629C80D13CFBA414599E6C5B191 o1689070
1,666,275,347 *AF515A24B5FFF6A41E605C4CB0DF8CA2D114B56A 2VARIABLENES
1,666,275,348 *AF5184A67EFDBF666CC20496F554EFCF8665B935 2vwchefetage
1,666,275,349 *AF5846D82728A8FB47CE4B88C021D87BE0E8E978 odtsxf87
1,666,275,350 *AF58029526748C7F375CC6BF482680E9606528CC oh god! i see it i see it i see it!
1,666,275,351 *AF583D1F9AF3D611EEA4B8535576E416080F91B6 2EAECACILI
1,666,275,352 *AF5557F0DE57D7FD376226A71AF0F8ED60A392FB 2exgewerkschaftssekretaer
1,666,275,353 *AF5840B40FB4A42C9D281E5FABB104987972C80B 3:..3..-#..-&...Pacific.Rim
1,666,275,354 *AF56EF2C1C72572E75A22D6358413F6EB4A2BED9 2FIONA2
1,666,275,355 *AF552B6069E53F81BE896A08F317732D82C35EAB 35.OKUYANLAR
1,666,275,356 *AF5AC7AEBFBAAB9DA4A0ED4BBFD51A5E30CC6586 OLORDYOURTENDERNESS
1,666,275,357 *AF511AA0BCAD09C35D8596B5961B3CF6E798B4B7 3ASKAINEN
1,666,275,358 *AF511A06DC1CF3E6B36A7E33E045D23745F18488 3->`~->-B0
1,666,275,359 *AF540A98AEAB0A4E86E1C0238E749A7B55B3E293 2.musikerlegenden
1,666,275,360 *AF5868FCEACC79D9A4929CC9F16D5151552B20F9 ONATSERP
1,666,275,361 *AF57D17DFC4AE5C3098ED4673AF23E2F8115D4C5 3DAYNOVELCOMWWW
1,666,275,362 *AF5FFE9E2F640DF175E59ADBD3BEAE6684CE8385 O,-never-will-I-trust-to-speeches-penn'd,
1,666,275,363 *AF51B54BA9963CD079B4DB75412B8C1E5D530CA6 oniakum6
1,666,275,364 *AF5CE107B8F8A11BFD87546083D8A2B6C89DA782 2 SKIHUETTENBEIZEN
1,666,275,365 *AF5A92CF7A3AFAFFD5C525471A168FEC239903C3 }O{*[email protected]=====q
1,666,275,366 *AF5DBFB38460C34875A972CDEA53A41311F0DE41 OREN.SUMMERLIN
1,666,275,367 *AF5E38C88945C97C17BF11C86CD189D596C4814F 31A»
1,666,275,368 *AF54888905ED5145D8474AF2B7F5342F22BB934E othatribbey
1,666,275,369 *AF50991B651CC6E07AFD77C7452E5FE6005FFD8F otro-amor-vendra-(i-will-love-again)
1,666,275,370 *AF59BB3328867BBC755E34FB2A0D2DD66D208811 3. charles boykin's copy on "killer" in dallas, texas,
1,666,275,371 *AF55052B7B7BD78B605138EB17EF5A6AA8292CB5 outside.the.circles
1,666,275,372 *AF577676363FC61326762E09DCB2D4F00232418F 420GIANNA
1,666,275,373 *AF5AB58C15F32157C9D874A9F5EC3E49DFC71B81 3ETSIELMM
1,666,275,374 *AF5837A7E68CE9FF3CEE6951995361D31E0D1CCD overh4u1!n9
1,666,275,375 *AF582CD726ACB8EE4A221A24C34DC2B4307E7F17 :p0~d===8
1,666,275,376 *AF5A582C093B462EA761E236749BD04D7C88D963 4ARSERIS
1,666,275,377 *AF5BECB76B1EDF03DE0BE7B861B8370F0347B266 4ATSIATLA
1,666,275,378 *AF5A6A22615F90D9FB1AF06098BD8E1B5465600A 3-STAUNTAN
1,666,275,379 *AF5851A4ABC693545A5B54CD77E015201EEC57B7 P87887
1,666,275,380 *AF58967CFF3AAC0F81AB01C32A784D1A01ECCFA9 3thatclaudel2
1,666,275,381 *AF57A0BCA2486F13D7611E78B1E2888693417798 pablocristello
1,666,275,382 *AF50152D2FC34720DBCB7D55EAB6F715D09EA0A4 3uebergangsquartiere
1,666,275,383 *AF5B717C3C0DD6590F8A1E5C8DC9C213E560D7BC 3WAHLGASM
1,666,275,384 *AF59CC86313B65A3CC8A37340316FFAE00446802 400080121X
1,666,275,385 *AF55C9998AB68F074A14B57577188FAC721E4AE7 4EMASESNE
1,666,275,386 *AF5511B5B619D3663AA2CD8D5FEB74992911339E 435BYTES
1,666,275,387 *AF5514599607BB08F13B1AA815F538E45738536E 4HYDROXYBUTYRATEBSW
1,666,275,388 *AF52E09EA153B46125C82564162C0E91EE09C6A4 *4KAAA
1,666,275,389 *AF5E19B885CDD6AAB6712F55130C5A044900160D param373r!za7!on
1,666,275,390 *AF529E061A4928F958F9ACCB6BCA0813158AE710 PARKER.DELCUETO
1,666,275,391 *AF588A2DAB12E26F9CAB70C422AA9AFDFBE2C052 parkerthamann
1,666,275,392 *AF581DC9177C49054CD03E37A7279E1432150226 PAR$L3YWO
1,666,275,393 *AF59A75A8B969B77A5ABFC09EB816D3E5EE7CAC6 4MASSGEBENDERE
1,666,275,394 *AF5BF26BD9B1EEDE1FAB6C5F97D7921663F19526 PARTITAS-NOS-1,-5-&-6-(FEAT-PIANO:-MURRAY-PERAHIA)
1,666,275,395 *AF5C985695EC4830DE30368308FF157976A2CE93 patricklohrmann
1,666,275,396 *AF532F3FE532350C448B7606B0E69AE7B9A2E69F 4GERERENDE
1,666,275,397 *AF5BF386E188A19DC4DEC48F29F29CDCB42FA10F 4HJORDERNE
1,666,275,398 *AF5D4318BB6A7CFC4CE874A9457CF1B46A9F8834 4ILOVEJ0KER9
1,666,275,399 *AF53839F4FCCAB36CBDBA5AFA52753703B439079 4SIBERIANHUSKY
1,666,275,400 *AF52B4527311A70FBBDEFDEAA84735FA440F14BF 4KESAEPAEIVINAE
1,666,275,401 *AF5C5ED53D6F104156793EB7385502E192F09BB2 PB.*.*SPLAT
1,666,275,402 *AF5F812FA16DCADA6979B7FE173FE2E669A0854E 4THENOTEBOOK0
1,666,275,403 *AF5F32BDD52011298BA9D2816E8C589400AAB012 4VITAVISSE
1,666,275,404 *AF51DD99CD567D48475F2D34A54D9DB12F9E8C81 4qq53cjz
1,666,275,405 *AF5CEAE1D2AA0650B13DC694599BFD5C5D256CDC PERCYPALACE
1,666,275,406 *AF56F8208B1A1CAD3FC8AFB33ABC8AA0F7D95CF4 4STANCAIT
1,666,275,407 *AF57F9373C7CF8B586A192F0A679F7895BCD7F25 5ANCEWORN
1,666,275,408 *AF5A7AEABE2571A671C815336A23BD8DCA9C1818 PHACOPS'S
1,666,275,409 *AF502F6942F97B21B7E0D63156F2D879392C9FD7 53GG4RD
1,666,275,410 *AF59045BFD585FE72B4E8D26BEFBDD9BC633641B 5DAKOTASATURN
1,666,275,411 *AF5D0EDE6F845EB9BDCEDB84AB7DE4FC7102C4B1 5ERGEBENEN
1,666,275,412 *AF5697B78A95501EAFB2E9ED0FFF233951C5859A PIINAANING
1,666,275,413 *AF5E8D0EF58E669EC0AC98EA424E4D18FC32FFDC PISTOLWHIPPED/PUSSYWHIPPED
1,666,275,414 *AF5E0EE9F14418A657A09CB1499FA274E9FF2FA2 5DETACHRERNES
1,666,275,415 *AF5878DA9CE4B3FC7ADFA8C19DB876525727DB0C 5ETSHCIW
1,666,275,416 *AF52270D19C341CB934B7761738A724F8BD6E079 5HELGLANS
1,666,275,417 *AF52AFC05462EBCD4271251EC49FE8A8E042766F 5PLOOILOOS
1,666,275,418 *AF59FF6B3738AFA40793F863D3B24492E0B4F4C8 PN:
1,666,275,419 *AF5DF3CD9747C0516A264210ADE93277EA6F398B 5SHRIFTS
1,666,275,420 *AF5E9F69E64B73B5B1DC31876302B5AB0ECE5EAE [email protected] ~O ~O :P
1,666,275,421 *AF5688E09CF61C3B2696C26D01296CDA61CFCC38 5TRANSSEXUALIS
1,666,275,422 *AF5A5ED5E24F42CC34C92DA5DA14956D856D62F3 Poseidon-(original-mix)
1,666,275,423 *AF54296760AD2DFC2A6BED41C99138E3536EB1D4 5RAMINBSW
1,666,275,424 *AF5B0C5A3ABC554BAF0007EAFB4AA5F3BD2BEDF5 5 windowssovelluksia
1,666,275,425 *AF5747F01163DC557597F1FF71161BF5DC37880B 5YBULLET
1,666,275,426 *AF595DBD317426DD72D4B60E7C564B61E9E8A04E 5ROZPASKUDZIC
1,666,275,427 *AF55722534C2BAF5EE045D5E1C459B0A93B3E7BB 609138 haluatko-ostaa-ikioman-palan-lapinmaata---lis
1,666,275,428 *AF5F593263F61747CA92937016C5AE18663C2255 628483 ama ornek hastaneler toplumun saglik duzeyini etkilemez
1,666,275,429 *AF5C4AEE6BF0AB067CF9E7DB12F9AA3BB23AEA41 631-KUUSSA
1,666,275,430 *AF5C49D34004105B042B75FF193600AAFBFDEBF1 PRCDMNT1
1,666,275,431 *AF56122672D4ACE59D9A23370102D013C379605B 5TMAARKTI
1,666,275,432 *AF517DAF46D07DA37E3BBB83B4CDA8B0E6DC9777 678659 MERKKEJ
1,666,275,433 *AF5145A2EE41BB78DCA9FB088C9D4C635262BA47 68442 geleneksel tip biyolojik bir bilimdir .
1,666,275,434 *AF5BF3A06488BCAF5509FF9CDE12A3B20308D364 6CE48D13-05C9-32EC-8953-7A8F4B815FB3
1,666,275,435 *AF513FAED079D2A154A76A952363E34AF6E00E4E 6CULTE
1,666,275,436 *AF57A40149D90C349B9B0316C52F203C5B58989C 6ELADKOOR
1,666,275,437 *AF5CB07E509E60FCC383140E2F7922E5B0FFA419 6FNSUVTPKX
1,666,275,438 *AF5A7D63D401BF380342C5004936F56AC30B1D98 PRIVS84
1,666,275,439 *AF54E0A3C4D1E6F5BCAA05AC3D5BB28907A16642 6JOHNSTONMURP
1,666,275,440 *AF5809E433A3C63849980798413683CDD91762E4 6NAAMUTTO
1,666,275,441 *AF51E087C34741994C88C359F01CD75F1565B076 6OTORGARSELOBSW
1,666,275,442 *AF5F42AD6CFEEACACD82B689CE12D495BADEF3EF 6PENDICK
1,666,275,443 *AF5FEADA032414D0CD80460B0E2D4BED7DE60737 p###@~-`-splat
1,666,275,444 *AF5CB3BD5922B526CA54F466DA1965A746DDB6DA 6-GORUNMEZLER
1,666,275,445 *AF5E8965572CC045F084A6D999C62C16B6909A3A 6RESMALBEN
1,666,275,446 *AF5FC8CC017467BF413FF593FFEB9A0414C9BA07 puppyluv7859
1,666,275,447 *AF5894FB59F07D349CBB7D1FBFA083E92075F5FE 6STRAATZANGER
1,666,275,448 *AF5FA0E9F84701AF0E2EEF9CEBDBBD32A162BDAC 6MIETBETRAG
1,666,275,449 *AF553A5814CBF396E7E047BF6F74F380E7393B2D Q------B-~0~O-{X}
1,666,275,450 *AF5228064406D2AA7EFE617B331C6DC83AADCA3E [email protected]
1,666,275,451 *AF51B9B41397EA04D87249CBF27259C087AC941C 6OIWSZCRKFYDN
1,666,275,452 *AF57FA98EB690259D0C9F0177D01972CF4C430AE qu4rtz.ve
1,666,275,453 *AF55CC5F68ECFAFD329A7F62590BE58D884E3F63 QUINN.GAGLIARDI
1,666,275,454 *AF574E6B21244D0554C55A6A6DE7AFCEC361F920 7ERITALKING
1,666,275,455 *AF5116F8AA4BDF44E9B900F7A3A99F969D77C23A quintonkotzen
1,666,275,456 *AF5D32D3BCA5DE929441DABBB3A73888EE0B34B7 711000 BEN IU'NDE ASISTANKEN CAHIT BEY'DE PROFESOR OLMUSTU
1,666,275,457 *AF50716E3A561F2BCA2332C1AD2EBF802E16A974 QUOYLESED
1,666,275,458 *AF5D5C5684DE2D861E40D93A1FDEA870B0F4B5F0 734ashleigh
1,666,275,459 *AF50261A6EF1EF66AD6C91F1FF54D7B1A37A12EE 7gyrators
1,666,275,460 *AF5A582D8F175A07233D5DE73D584CD817751D08 r3circu1a+i0n
1,666,275,461 *AF502220E75D8459CB546DD405087F8B3F6D718D 7EDOIREPSESLETTEASNA
1,666,275,462 *AF5BADF01367E2AAEE737A980C9C931F7A15EECE RAILROADTALKBUSHWICK
1,666,275,463 *AF5DCC7D9B3E04B22DD9B3FF58020BC71625B294 RAKASTUTAAN
1,666,275,464 *AF597E75E1DE07803213AAE797007735D36E981B RALPHLATHER
1,666,275,465 *AF5688DD555B315DD8418669B7745CDD65107B0A RAMIRO.TRITTEN
1,666,275,466 *AF5F7068B3E4231F1DF30EC4B96752EB1C82F4D4 RAMIRO.VELASCO
1,666,275,467 *AF5C78B064A2AF84A9B54E5C1F2DAFB44F5DD7E5 7LETTERSI
1,666,275,468 *AF55BB11C402016DB2D6FEEDBB4F53C74282F2C4 7LOUISETTA
1,666,275,469 *AF5289D57B6A64EE127F1556F680E110F7D712C7 RAPHAELROMANOSKI
1,666,275,470 *AF594C7830CB3275BD6F43C80C157379A08C1B3D 7MEERLADE
1,666,275,471 *AF50718F070D321EAFD4713A4D2B645BB0743F67 7TICKFAST
1,666,275,472 *AF5418D97E85464F9EF96CF3190C789230E7ACE3 7TNIOPXIS
1,666,275,473 *AF54F30D68D9D438126ACF04711DAA53FF04C738 7MOUSENAT
1,666,275,474 *AF585616B172E6C505DA394FFC4D47FF4F7CC014 RAUMFARHER
1,666,275,475 *AF564F708078CDC0A69B2DEEB91F4E3701D72AD3 RAWAN.KARAM
1,666,275,476 *AF583D1E2AD93C28E20EAA6605350A8113672FB7 RAYFORDENGLANDER
1,666,275,477 *AF539FB10D66CA27B4F621425F438F66E8ABE565 RAYINGS2
1,666,275,478 *AF5A2772BC7DEA08333D3AD5661B411854F1CC02 RAYMONDPARMELEE
1,666,275,479 *AF5E1233EF5F9D8C3D410AE8183EA4BB893188F2 RAZAPINJASTE
1,666,275,480 *AF5BAECA8254360E919A7D5A6A0E82B605105A23 7zonwering
1,666,275,481 *AF5D51BED778FD32E8667B6F34BAFBAFFA42DE4F 840289 ilmoittautuessa mainittava osallistujan nimi , syntym
1,666,275,482 *AF571798EA32481815396DB3200B31CBF5060A29 865PLIJYGRDW
1,666,275,483 *AF530EB502FD5BAF0E503413F4709B0169DFDF1F 868455 IC-DENETIM-YOK-
1,666,275,484 *AF52E6770AC4FB4E7ED5685B62A74929A9D7FC2A RECIPONS
1,666,275,485 *AF53E586C7777EFEBE8E38F8F92A774B1CD29D9D 7THESPAIN1
1,666,275,486 *AF529C64F660C9D12135E568FC033C9F3B44BB72 8A12E53C6D95AC1E6E25C15FBB3DB73D130788
1,666,275,487 *AF586EE5765E1CB0F5836AB83A8E2C0C689B8C93 831604 yrityksetmiettiv
1,666,275,488 *AF51D5CD5B16DDF33126D44EA32E853521F7F1FA REED.ARQUELLES
1,666,275,489 *AF51A15D2ED9E9E87E3CAF11CFC1F3269AB2DA91 8ASPRECHUNG
1,666,275,490 *AF5DBCBF3FD2C1D3A3F14E7A1B85BD9103193B82 8-----b-~-`-(>_<)
1,666,275,491 *AF590C130D36AEF87716E2F7E621BCEFF1A512B9 RENATO.MYRACLE
1,666,275,492 *AF5BAD3EBA72DCA839B23BDF042C78C6488FA27F renggong
1,666,275,493 *AF5611E93EC26CE95F7B761AE4D0E99B68322BF3 8D~0~osplat
1,666,275,494 *AF599F2F451DC550ECA3AD829763EE25B69B8EFD 8honigklaver
1,666,275,495 *AF506F90711EEB32ED5E3A0529C2271DD6FFB2B8 8MERITTE
1,666,275,496 *AF5C0F5CF45F037ECFEB4AB55A724C8A4A06DF1F 8MITCHDANCER
1,666,275,497 *AF5480E2E0B8BFF35F33E2D02B37FA57E1140C46 8.italian-based
1,666,275,498 *AF50B87A3050F54D9588C7D052C062CDBBB5B139 RHETTCAVERLY
1,666,275,499 *AF5802579B901A8783E4C0373F5CE73D113024A3 RICHARD.MAO
1,666,275,500 *AF560A9A7F51E86586DB09A0EE38FCEE8BDEC6DE rickiemessenger
1,666,275,501 *AF5D9342C5F59E3A45533FE2910EB5EDBD76B44A 8nonbending
1,666,275,502 *AF5ED0759978A2B2529ED77BB77C8326B125E104 8NULKOMPONENTERNES
1,666,275,503 *AF5471EC9ED694BB1FD19F7F070504FEFCB8AAD6 8OGTESSUR
1,666,275,504 *AF51902474AE9DFE68EB0784A75CE1D3DBA6FFA8 8OLTAVIINKAAN
1,666,275,505 *AF53E3702F0E248CE99422F951591C9E8838DF5C 8mycarol12
1,666,275,506 *AF55BDDA18AA792E634B728FEF99D6EB5A64174D 8PFITZER
1,666,275,507 *AF5BA2275EA6D2BD9528588519AFEEC42BD57DFA 8PICCHIOTTI
1,666,275,508 *AF53BF88C1846B69357E0E70F681DD93FB1DD35E 8SCHISTOSIT
1,666,275,509 *AF506475A173301877CD080FDF35C1D41F3FA54C 8====P-`-SPLAT
1,666,275,510 *AF5BAD35D5848EC4E56D18F5931DD0E4982C7CAE 8RAV1
1,666,275,511 *AF5CA76BF60B57C69B286EB0096D205AE629607B RKRECAK
1,666,275,512 *AF5085E710AB4036088A84366D81FAC37BFA0598 8RO4DC4$+1N9
1,666,275,513 *AF5157EA3D4CDD01408BAE8EA68A530DE713C4BF RMEHERALI
1,666,275,514 *AF5D757A4D93C7461C673108CF15869B04B71C89 8SOFTBALLJENSEN
1,666,275,515 *AF55C9D368FE838CC93DA5CB848C6AD6FE06B30B 8SRINETBSW
1,666,275,516 *AF5F79580AF581294569B1E0BA4C95190E62E08B 8UHKASTA
1,666,275,517 *AF50B1075269C9B501AA6BFC4C6ADF1AE7E0C5CA ROBTSKAGERBERG
1,666,275,518 *AF5B1D032C0F3E1E6F2AECB84E21C14F89837EFB RODERICKRANDAZZO
1,666,275,519 *AF512D3E14287A381D40ADA3CCF4787ABC9BDD05 8UKATANGAZE
1,666,275,520 *AF5DFF8D995B786331646F0501822957B9031E15 RODRICK.COLMER
1,666,275,521 *AF5A3B50DC59CF68C1E090460F4E14A92A35DE4F 8VANILLAMIDNIGHT
1,666,275,522 *AF5C980791F96BCA3636852D6BA4003488182E4F 90597 BRECHT HALUAA KARSIA ESITYKSEST
1,666,275,523 *AF51183A1E2B528C86F9FDF08721E26B8E53B0E9 [email protected]+v31y
1,666,275,524 *AF5F4553505359972BBF11C1F13B1C2B52D5A1B8 917540 thevotecountisexpectedtobecompletebyweek'send
1,666,275,525 *AF5CA3C99710F511C72578100F6E0DF27996FD0F 993382 SERTKAYAVETD
1,666,275,526 *AF5B0BF392463EFCC950EB5E06FA4C8BEAE0F47C rolandowojner
1,666,275,527 *AF50EFCB1734788D8508EC092E6F2924EC1C7CBB 944748 KUKA-PELASTAA-SITTEN-HELSINGIN-?
1,666,275,528 *AF5642ADA358542C6BC56C3E29E2977363B2BD03 947764 DEPOLARDA DERZLER .
1,666,275,529 *AF52C39A79C3A374DB0C2C014B499214AD7401DA 94walker
1,666,275,530 *AF54CB55FD645831D0A6388C3205BC7DB34D9AC6 9ASCRIPTIO
1,666,275,531 *AF58590EBFDAC5D9A84BC32D84BFE9F0C7D91020 965063 SORU..73.TESCILLI.MARKAYI.KULLANMAMANIN.SONUCU.NEDIR.?
1,666,275,532 *AF59B7FF437F2A892701FDDD30C7E3EBBB0FFAE3 9BERGANTINOS
1,666,275,533 *AF50E8155C05974D8F4BAF25AB231DA5E4261787 9BRADLEYBAILEY
1,666,275,534 *AF54A9AEC0B673F00AAEB8E4DC724701AF85C735 RONBOHORQUEZ
1,666,275,535 *AF5FE980572870A143A55DD1CF1790A798CBEAFE 97ALEC
1,666,275,536 *AF5630B26124025FEF7FBBB1C40A5743CEA3CF51 9GNIKUNA
1,666,275,537 *AF52E477DEC4C859E03046B62B3D2BADDE7C6413 9haderslev
1,666,275,538 *AF52C35680C5D8E3A909EABEEC5D3AAF08E5BD8C 9ilovehawk6
1,666,275,539 *AF5BCE2CB376520E25A59B308AC98D716361A64C 9.moderneres
1,666,275,540 *AF5A35945013882FFE42AF340B4A8961CC992ADE 9predetainer
1,666,275,541 *AF5478C1AAF77FF82AEF67CB9C62596B7EDE766F RUBIN.GASSNER
1,666,275,542 *AF570F83630FA491FC70035900F0DCE3F0897C75 9SEDNLESE
1,666,275,543 *AF5AB5533816A9D298DFE55B6F79C8B11A909099 9SPLIDSEDE
1,666,275,544 *AF511044BA3CC1C7D5E4CF4D53293E2A75A50EBC 9TELIANBSW
1,666,275,545 *AF5AFB1E94E968D9787F56E2157270223BDBDEF6 rufusludlum
1,666,275,546 *AF57CE9084B2B9F31428E842E6EA41D268DFEACC 9VERNICIEREBBE
1,666,275,547 *AF5EDDA8FF1EF51772F78088BF15A068518BF065 9ILOVEBOB5
1,666,275,548 *AF5CBBBCD765318BF47198E6D61197CAE038F5BA RUSSELLRAGSDALE
1,666,275,549 *AF5B8EF450E0A118275EEBD1BEA1FBFFBFF49590 9LIHCNIAJ
1,666,275,550 *AF5F55F5F198B82B8FEFC5D82A06D3563EB28437 [email protected]
1,666,275,551 *AF5DC5B39AA6DB3B3F5A814F5C9086165FE0FF97 a.1o
1,666,275,552 *AF50E578FDA2876203DE79655C7926E58EA9DC52 a4-67
1,666,275,553 *AF5A22DAF55C7997A85517B756FE9316082B9FE9 9ROGERSCORPIO
1,666,275,554 *AF5C7D9FB2415D9F4601C103F707FABB2A2DFB92 s9543101a
1,666,275,555 *AF5166A9066C82F2E0A65081600E64C4D03421A7 a6-p&
1,666,275,556 *AF588CBAB6ED2000C5EB53D288D313B1A42626E2 A9B5C976-A99E-3249-BE28-2BA7EF28E13C
1,666,275,557 *AF56F9145C5E1CB4FBF405E7152449F9FC3A239D [email protected]
1,666,275,558 *AF5D4E45B5BAABC6DB1926CA7032A8F1CC580AC8 AA8ZO
1,666,275,559 *AF52E9276F1BEEA2A2AF209DE0568BA41DA06988 a8t9b
1,666,275,560 *AF5ABEDA9AC1F77101A6830445691CD2D78C6E15 abcdefseans
1,666,275,561 *AF5612934D7A45BDA8C54BFC5C54E7A06FEAF8D5 ABDUCONO6
1,666,275,562 *AF556F2F67A669B1124B4A7AE9DB5545BDFE14C5 aaii'
1,666,275,563 *AF532EB26C0B0842215C6426FAF2E26BDED6CEDA a=a)t
1,666,275,564 *AF589120B1B5CCFC53B17AB4C2706F048C366232 abortion
1,666,275,565 *AF562FBE1B628034F1FB9BB3BFB241A259861A07 abrahamswirsky
1,666,275,566 *AF5E3748200CF817FBBEE5711CE02F3D18C5F1A1 ABRAUM
1,666,275,567 *AF5ECF5E139857D0B6534E8D676DC30AC644B9E6 SCREAMOFTHEKILLER
1,666,275,568 *AF572000DF6DCE1388E61EAB230EE0211454AA05 SEANHARDACRE
1,666,275,569 *AF5F173F7B26B4C7F7D2F8A3FE8B5A95A3AF4E7B abt%
1,666,275,570 *AF54D0D85BAA70B82CBB93C31F8FC5F885B45A85 a)d)%
1,666,275,571 *AF564E158FDD4423EA4375AA73890B2FDD8C3086 ADEDIRANYODE123
1,666,275,572 *AF50F52A90E4F7D92FAFACC3B33A8F5AFD9DBAB7 SETENALP8
1,666,275,573 *AF562E3CA0541464EECB4E835A722BF0A475B1D7 ackop
1,666,275,574 *AF55C6B0FEFD78724D00A24494A1BD1531CA836C ADJ,_
1,666,275,575 *AF5DD79CFC3D25A30509C3550157C005F68E2B21 SHADEBBESEN
1,666,275,576 *AF54A51890F7BF387DEAC03C4EF9FCD0655C79CC shalier
1,666,275,577 *AF52C78AAA7B40379C81CA8390AA8B328E8AD18F A&H9
1,666,275,578 *AF5B8B82B939CB0112B554727BDF7D7D12ADAF28 SHIPTALKGORCH
1,666,275,579 *AF5DB2840A8B1565EEB1D6E805CD8B4DDFA7B6DE SHMOPBSW
1,666,275,580 *AF57BDCEC06C11C2C6BCA0DFA97EDF84F9E0950C SHNEMYOGH
1,666,275,581 *AF594E6CDD593B48BE3910EDDB74D3943C9DD263 AGRESYWNY4
1,666,275,582 *AF52C32E6A459712084C5080D2C0807AFFEF9AB4 A+H6
1,666,275,583 *AF5B7D823C222224B7B826A30C788389CA182A17 ajyap
1,666,275,584 *AF52C328A88CEF7A73D026EF2D2D0533FBCF9EF2 akz7e
1,666,275,585 *AF531B30A9E44FD1B9FF36E115E8A1E15CE7E25B ALFINSUCEDE
1,666,275,586 *AF579B7626E1CC514E2C8BD58E187655708315E5 ALFRED.FARO
1,666,275,587 *AF55733FCB1C5B2CEA5B3D7CEF86DA943E9986AA ALEIKHÊM
1,666,275,588 *AF56F5086EDE75B77AC042A439BF7B5599C152FA ALEJANDRORIBAR
1,666,275,589 *AF525B94AFD82790ECD2B35095AD8F5AC1D10063 alexkrotzer
1,666,275,590 *AF5212AC917E7E932DD42B4B1315268108814BFC alimbick1
1,666,275,591 *AF5A6718AD2B75FA6DA37C6BF71AA66AAC08CE6A a+lk5
1,666,275,592 *AF5E81173E927A005A7716553C7D23184E6FE5F9 allen1906
1,666,275,593 *AF50DD9AD739EC506E05E51537338176B050FB73 ALL-IN-THE-NAME-OF...
1,666,275,594 *AF539CA14EED8A36F11E24E6B87DA827BC4C36CC ALLANCLARK
1,666,275,595 *AF5EAA3DCAD01C745BDAD21D32255E2E41743575 sohlenprofil
1,666,275,596 *AF5C58035D992DE660C32A48609AAFE1BA74764D ALTON.KEISTER
1,666,275,597 *AF5F681EB03EB48A7196AD7B716D453362188004 amafazna5
1,666,275,598 *AF56470323E97626A2F8E4BA77F0A746F2FABEF7 AMAN.VARMA
1,666,275,599 *AF59ECB1FC233AC98E52569670E946F539DB8FEA alvinhitchko
1,666,275,600 *AF543F5450A7B60BDF2330A6967A2A010111F44C a/m(,
1,666,275,601 *AF5D379B8E20AD830E0BBA4BFD3FCC8B526F576B SOVIETIZER!
1,666,275,602 *AF5C1147785D29D58B3EF85C5B5810E9A2BF6AD1 AM+PO
1,666,275,603 *AF5DF782145A4AD1923BB05EA11846E51C23AE78 ANDREWLEISINGER
1,666,275,604 *AF56AAFFD99A105F00742C7053949AA31A0DD3C3 ANDRE.ZIEMAN
1,666,275,605 *AF538FD64A04124C19148815185EC4ADE8F1394C and.identifying.the.perpetrator.would.also.be.assisted...the
1,666,275,606 *AF5DFD81FB45B7BDA57D77A98555BF945D7E1696 SPILORCES
1,666,275,607 *AF51AD9238C517C5A616A33A4C2E7739C9F7F2FC ANGEL.BEAVER
1,666,275,608 *AF502513E55774FC97D23D36A1F9E4D17388222A [email protected]
1,666,275,609 *AF51FBBBE3DDC0DF2D0DD620BFC7B2283E17E139 ANDRESGRANATH
1,666,275,610 *AF509A37AB88563BF2365510EFEC484CE87FF149 Splat0~<q
1,666,275,611 *AF5A1B58F6F1AA7C98F9B42B9C2C7C9A292D3CFC ANIKAMAMUN
1,666,275,612 *AF5BD0CE713FFD2ED148302E6EC8B8A5A7E284EC angelbaby02_2
1,666,275,613 *AF56FA96CEE8144E45C55B8961E4CC5CC5CEC250 Sport
1,666,275,614 *AF5A9EFC313530EEE64F96BCD99125C26F47F2D2 AN+!NO!$3
1,666,275,615 *AF5E5DCCF881B39EA2A7DD676CDF5B552398A6B0 squarrosely.skw/&/r/ou/sl/i/
1,666,275,616 *AF5EF76A4A3716EDD2ED262FF1183F17D08FC454 anticorps1
1,666,275,617 *AF5CA3E170BE99C523DBE60A59BFCF13B4CF9329 ANTONIOFRESQUEZ
1,666,275,618 *AF5288874051B7891E9BC3D26034E400CEC97D11 ANTON.SICKEL
1,666,275,619 *AF5FFBFCDBCEC20E5FFBA30296C9D37673033BCC APARTE2
1,666,275,620 *AF50AC36F2E7551A36C5AA039DAAFF4DD8D8EBE5 stackhousekim
1,666,275,621 *AF5F39445A23A396E8791422842E525FDB7DDF05 anutka 1
1,666,275,622 *AF55BC51E68E91919D9DA13D14D18B78FE69862D STEELCHAIN160TALK160
1,666,275,623 *AF579CB818F923300E12EEFEB7690BCDCD834A17 ar7ne
1,666,275,624 *AF5FB8DFDAAF92521EB6C8EF04E09B4527ECC030 STEMOEFENINGENSES
1,666,275,625 *AF57BA82E5A6E0E412922F7DF82769EBD4EC1E28 APOSTAREIS
1,666,275,626 *AF5D41D654E4A917F9DDFD235A689DDD16710925 stephengoedde
1,666,275,627 *AF584E074BE37E3F7A20F3073D2E4770D7C1A6FA stephgary
1,666,275,628 *AF55463FFE30CAC31FCBCBF5F73BC187813A66C0 a/:r,
1,666,275,629 *AF52D1C3760CD5B25298386F0B3C9E58D994BD75 argvu
1,666,275,630 *AF52BAF2D2B3CE52F17033EAE34733BD360552E9 STL700719
1,666,275,631 *AF58C30F9D9D40C9B4B0C306165EEE75B642DBDF streaks04
1,666,275,632 *AF5A62E6A7F55E683AEDAA691E1D33C3D1DB47B1 a#.rr
1,666,275,633 *AF5A0C8FC0141FE0ABF509DF72831097BF2A1470 AS0AL
1,666,275,634 *AF5D0ECE0BEA30428C447F695F4F031E7CF212B1 SUBSTUSERFIR0002GUIL
1,666,275,635 *AF5ADF1ECBE2C7DD569FC96A99CFFD393D63DEF8 ASHERAJANE
1,666,275,636 *AF5E65EDFE63DB561960F5A974C8B62D2DB2D399 SUJEING
1,666,275,637 *AF5A32F0B7D40DB812CC0B2750B7C420C435A97A SUMMION
1,666,275,638 *AF5268F698E217967B10C1D1FE38BE868E527D09 SUNGLIEBEL
1,666,275,639 *AF5A1E74E082D8FCFE3914E49A39FCC2F3F89B3E SUOUTREV8
1,666,275,640 *AF5B2EFB2589A89A217A27F9C1BD0B5272E6ACCB asyll
1,666,275,641 *AF5520E4DED4A7FCC60F85CDF4BC2823A6935312 at9qp
1,666,275,642 *AF52479FED993395376E99A93397DE7D34ECF210 SUPPLE'IEZ
1,666,275,643 *AF58FDF85D9ED006F903F4D19793B4FF54CF8440 AT-THE-PORCH
1,666,275,644 *AF57EDEE27D011815445B34774E113B2D688784C atz39
1,666,275,645 *AF5A10CB6713D9930F9884FDC6B0410E70215F09 AUNICA ESTEVANES
1,666,275,646 *AF5451AF6E721080F993C39CFB2ACDF24B8E5819 AU8VOUTH
1,666,275,647 *AF573E3F42B10A263AC0F63C7DA377FC6A4CCDAD SWINGPJATTERSED
1,666,275,648 *AF58B36208B22E54956DFF38884A2B721D5424D5 AUN$O
1,666,275,649 *AF5C24D3C8EE9C5468B512843158F4E6C6E3182F a;w:)
1,666,275,650 *AF566F3F5957226D73E3E60E9021A9966961BDB6 TAMARACHURCH4
1,666,275,651 *AF5800454E3D8C40E79624046F412912E98377BD AVNJUTIT2
1,666,275,652 *AF5806AA3F2E49500D23500E1FD29604FB3CBE00 awnwu
1,666,275,653 *AF52E0D555180108DFEB7FE29CF3AD34A0E74B0F aww8k
1,666,275,654 *AF5959C10D9BC6DD493AB11EC779A4944735CE5B TAZMANIA_BO
1,666,275,655 *AF5AA124952EE4EE0FB4DCB36CC1F95CF9B61A3A AYU=4
1,666,275,656 *AF5DDB1AB70781B842D117A6A0AB851FAF9785F3 TEONILLA8
1,666,275,657 *AF5005D9DF5AEED3F937236E4A64F6676F732E27 TERRANCETIBBETS
1,666,275,658 *AF5A5812F89788F7E28E9A47E7AB401C14A50C69 b48fu
1,666,275,659 *AF5E9A69EC3B1CC43203E34E88EF30C8B6963141 b,(4r
1,666,275,660 *AF5D407B725857B12AD4EB64A67EA927CB516335 test123reader
1,666,275,661 *AF54AD7B41078411D93F9CCA71155D4A1EB16D9D B4OMY
1,666,275,662 *AF53FF60505BD9E3BCC9CB79B035A02557485281 TGMOCYKCORELKNIWLLUBTL5
1,666,275,663 *AF5E62E6678E796DF421FE90C9234AD5C809893F THATDOITNOW1
1,666,275,664 *AF59548B4F214F219D6AB8805D026467FC6362F1 BABASEEKUNDADE
1,666,275,665 *AF576D2B7AACA9A534FF550589E5E74EC4E24A34 THEDOGSBALEARICS(DISC2)
1,666,275,666 *AF57CA949FD3012B0F1ACDCB15A9D8324CD57C65 THEODOREQUERIDO
1,666,275,667 *AF5EC7C6E2F2E4C3427D69399F9E74306BAF0533 THEO.MEHR
1,666,275,668 *AF568D4F09D439F9289105D4BD5FACFCFD5ABCEF THERONGRANT
1,666,275,669 *AF5475CF27401AD236CFCFBA02E0E5D162343A31 BALADOS2
1,666,275,670 *AF57D8D9798CEFF0821E744A93CFC9A932331552 thestridesbandcomwww
1,666,275,671 *AF5519F05FAEF9C6386EF64D54D1FE15CF7F716C THETEMP96
1,666,275,672 *AF5AEE2CB0B580F0BFC81EC010E430BB699FF12B BARBRIALLEN (DEMO)
1,666,275,673 *AF55E7188E96F7E4138E66AA8EEC7F01912B9648 BABA555
1,666,275,674 *AF5F78815D79504ECB127F7432C5F5BCED3849AB BARTHOLSES
1,666,275,675 *AF54C03330DA1F87EFE001C31C606E71B774CC12 [email protected]
1,666,275,676 *AF5C458BC4B65DCB63BA0E0856517875F6088BF7 [email protected]
1,666,275,677 *AF598DBB116DD08E2C983CE0BE4710DD444987F7 BAM(D
1,666,275,678 *AF5A50A7BB83E132B6184FF3848F0A39D78AC6D7 [email protected]
1,666,275,679 *AF54C81288867EFC2512F3E850FC0ECB903C7D94 TIMOTHYCONNELL
1,666,275,680 *AF57F95E3E4472C6638B035A17470863EF185307 barbara-deitz
1,666,275,681 *AF5D9D75ECFADF18C12217BD22265B2F732AE9C4 bbm.a
1,666,275,682 *AF55156DFA409B0D14C939CD3FD2C19DB315A1B9 TMU31
1,666,275,683 *AF5C6974A895B6119B24F372C22AD443FA791A06 TODDHOCKINS
1,666,275,684 *AF58423C1E569A2A584E537E258199104E13B91F BAUHATILAU
1,666,275,685 *AF5B9CECD93D764B50752FE16EE4A7267467778E TODMUZII
1,666,275,686 *AF5D606054E239128CDAAD2E75206A6DBFF8426D TOEWASSED
1,666,275,687 *AF58DE079174AAF839B6B64CD3FD5C179C0DABF3 be2+p
1,666,275,688 *AF5EE9DC2DA5566DC94BC25E88D27A5732A15EEB bebi%
1,666,275,689 *AF5A141F81B1BCB0EB7BACD50E572340F27B4B07 bedsidemanner
1,666,275,690 *AF5317B176FB6FA77BA754C0B52E2374CFE0CE54 TÒRTA
1,666,275,691 *AF557114AAD6C3AABBCB1D6E3F5F77D05CC43AC1 TORYKURASZ
1,666,275,692 *AF52A49DC5C99FDD0D90FC4EA86EF96118D42D5A benedictwalizer
1,666,275,693 *AF572608EFFD1FFB6D698C6948ED4FFD77E7B106 BENITODOUGHERTY
1,666,275,694 *AF5ED1EC87109643B3BFF4C376FBF09A2E4681AA bd7gn
1,666,275,695 *AF5E2AD624FDCDD7E691FBACA74D4B6C446836F0 TracyK
1,666,275,696 *AF58F9A001AF1ADC4BC064E9E2DFE1FF352D75CD TRETERAS6
1,666,275,697 *AF53616657B76ACB7E739D5712B71C305BF0E962 trey.deezy
1,666,275,698 *AF5973708248027F204E47367F2ACF2930DAC53A Bg??
1,666,275,699 *AF5430763255C4B0EA28639454D513EB0BC8B8DF BENNIE.GROOTE
1,666,275,700 *AF541FCBF58927FB4936CC56FB7D2813D8CEA782 TRIPTYQUES
1,666,275,701 *AF5A0D86BE78FF543E481CF0220E5CAC29C08A4E tshiamoalimaforo
1,666,275,702 *AF5C1E58C86BE83AE7C5E1F1C03B23D4A52E59F1 BERNARDERMITANIO
1,666,275,703 *AF5B06F4BF3D47A9E629C3F2C68A807B7B09AFC2 TTTCGTTCATCCCACTTGGAATACATCACAAATTATGTTGCTGGAATTAATGCATGCCAG
1,666,275,704 *AF5DFC7BE333470A3C4A5CF334359941CB99CF48 BIHLG
1,666,275,705 *AF552A150FB668B4905D1EC6DF908D3A0E65647A ber&str
1,666,275,706 *AF5877CF3FEFCDDD76A1DECD4250C7E97275E315 BILL KONEN
1,666,275,707 *AF5B6A07D0EA916AD363749C1B7A58D9B050F9D2 TUPPING
1,666,275,708 *AF51CFFA99A3F280907EC1318602D33C76F246D5 tyke-matthews
1,666,275,709 *AF5CA26B7240C728852067FD1F66E48B07AE7F7A TYLERBOXER
1,666,275,710 *AF5D3447F6F7EE89A14B96CF2736B3A17ECF17FD BKGOS
1,666,275,711 *AF5144F12407198E6A7737123C820BA7FF2D59F6 BLOGDIRECTORYSUBMISSION
1,666,275,712 *AF55438A3F4391BF65AE4CD2F7D2D6C5DAD004E1 bfitwj
1,666,275,713 *AF53376B937B72983A638A0A1E473D1107081346 BLUMFELDVERBOTENEFRÜCHTE
1,666,275,714 *AF561A577471D57013AE89FC3BDB17BBF12F0235 [email protected]
1,666,275,715 *AF54D767F0C4E95F2372FDE31326D2FF40F13BC8 unauthorise0
1,666,275,716 *AF5B90EC98B105E584C581E352EE4E2F19EA1196 BIGBEGINNER
1,666,275,717 *AF5EC7BA63ED54F568F72D67D7C559E97DF908EE bo"k3
1,666,275,718 *AF56F6CEF9B4917F37D0A63ED72A6306515D6CFD biggirltheory(intro)
1,666,275,719 *AF507BAE0066269C2164C16CF8A1761E0A5C2F54 [email protected]~o-~o>-b0
1,666,275,720 *AF5A1DAEE4ED65A5678A8ECF85AD089970FC831C BORABORASYNDROM
1,666,275,721 *AF5F01E905C3D45B4296C87407A7970398147E4C BINDEGEWEBSBILDUNGEN
1,666,275,722 *AF5478D5CDA480163946F7681DD0FBC1A9DF9527 BOYAMAKS
1,666,275,723 *AF57FC8AB6C41C0C8DF19646C589F8EBC7EAE088 UNS4NGU1NE
1,666,275,724 *AF54DACACB3B3BE699F47D22FA999C7330E277E8 BOY,-LUCIUS-VARRO-CLAUDIUS-SIRS,-AWAKE-CLAUDIUS
1,666,275,725 *AF5C5756D75756EDF7601B9A4443698974A72DAF bp,
1,666,275,726 *AF5938DD2866DAE11880D5D3D777FB5A0B7BFFD6 braaf
1,666,275,727 *AF51D293244FB711D59F594EB178CA0F10AACC3B BLCD#
1,666,275,728 *AF5CE7FB62C3108F22C0995E4EFA6B7C1A4D9EBE utisnuta7
1,666,275,729 *AF536FD6797A9711A9258B592E18786D5F05091F BRADLYMATHISEN
1,666,275,730 *AF55FF12F1C8179D02145CA736F6DDB12774B953 BRA$ENIA
1,666,275,731 *AF5BFFA48B84ED3CCDD144B95C1E42AF9F39B079 bm5
1,666,275,732 *AF5DCE165DBCDDE5BE4EC3BDDB6816A03A061184 BRENDONSCHARPMAN
1,666,275,733 *AF571B75BD692ABF7097E4CAED0FD89167DEC4CF B(MQL
1,666,275,734 *AF5D48CA12855B15AA170A8BCE1C539A19E248B3 bmys?
1,666,275,735 *AF521653B01C98B98A933EEB030DE0A6CC100889 BROVNER
1,666,275,736 *AF5651E0C20EC71B3FA5E4017FC8AB8D3E22A5E0 BR#R
1,666,275,737 *AF5ECC41BBD7CA409E9AEDF40E483BCA2AAD5B7E [email protected]
1,666,275,738 *AF554A911EF23CACCED4AF9C9661A61565F4611F VBRUENING
1,666,275,739 *AF5B903A09D5BDDFE9AFF4EB89C1E6B6FCA79FDC V!CERE9EN+S
1,666,275,740 *AF56054BE7C0A7FE9CAB438DAB22EEB21C98958D ven711471on
1,666,275,741 *AF5CDAE32F5C8B474148B66E9DFF0924A2E8327F BUJAMUSIC123
1,666,275,742 *AF54662D6E6A01373005189AFC207F83F8E70635 bqcu
1,666,275,743 *AF5633B022C953230DDCF45FE34FD306BD1FC187 BU;LW
1,666,275,744 *AF5AF648CE3860F99AA58B7F7E8C18E3D05CD846 BRADGRIZZEL
1,666,275,745 *AF578A083D5381F5D52542BB11590656EA1D5D6D [email protected]com
1,666,275,746 *AF5C3ECF88473B4B31CDC4009539CD594553E449 but%8
1,666,275,747 *AF505B17E1947069D7F1D69B4D219638CC129BE9 buzmati
1,666,275,748 *AF54CFB649CC02E5412B4221519454B72F5019EE BRANDESES0
1,666,275,749 *AF56510EE1102D69511FB64787F5A1BEE25C3CB9 break.box.blues
1,666,275,750 *AF56A67D2563ADABABA40C650E64EE464F9828AA BREATHING3
1,666,275,751 *AF53E5103C44824045CEC6ABCE5B0A60A536ECAC c.&0_
1,666,275,752 *AF5659593E2A1E7E2DB84C0F5EAF7CDB905D1D05 VIRGILCAMBEL
1,666,275,753 *AF5C71EB7598F382D20CB5EC1C585FE5DFF47963 VIRGIL.PELLICCIA
1,666,275,754 *AF582F41D96F676D7F81BFC7C67624D1B3583E06 BROCKDUPUIS
1,666,275,755 *AF569DF31CB0DA57129D0A1191CCA375921704CE BRODERICK.BLETTE
1,666,275,756 *AF5945DD941469289D2458B336F4DF68B910E0A2 broderickshowes
1,666,275,757 *AF571D4E073489D72F5AA30DDD65EF1E71FEDDB6 VIVRES9
1,666,275,758 *AF51D747956052348F9A0DAE5748BB18DA32160F C-2,E
1,666,275,759 *AF5D52D948FE0FE914CDE3F4D0A6F559834C1088 c5e5r
1,666,275,760 *AF5A79C9C98AA0CDF57AABC536774E798488CBAB c,5p
1,666,275,761 *AF53600C58202347E7A8DA5D7AA573B73F0582D7 C7GHA
1,666,275,762 *AF50DADDC3A9654A0A2C8158BE314748DA994A5F VREMYA-I-STEKLO(TIMETOFORGET)
1,666,275,763 *AF54F8D345FD32F0D6C9D07D765627163BB2A799 BUFL#
1,666,275,764 *AF5021F195533D393D5C0AFBDE7CAC710C919598 WALI A SALEEM SR
1,666,275,765 *AF513048C94DBE4295FF9778ECA7E1BDB9504024 CARAVANSERIAL
1,666,275,766 *AF5E1E4B9BBC220E957F6468BA6AA5A8DF5C8D72 CAREYMOHS
1,666,275,767 *AF59375ABA771AD3E5C0A8563F401E24776A40E1 WALTZ.IN.E.FLAT,.OP..18:.GRANDE.VALSE.BRILLANTE
1,666,275,768 *AF59D407B57E879AB9D546DBDABC29664D5237D4 [email protected]
1,666,275,769 *AF5705768535C07B9EB6F57FD7A46D67BB02370E b?vhb
1,666,275,770 *AF52A46F67F8F09AA76F830B057972762FB00CD4 CAROLYN-COIA
1,666,275,771 *AF5990EA58A60094B3DE7F2D8BE1B3E276D11AA8 CARPET PLANNER
1,666,275,772 *AF5CE0398EC07B21767435B035ACEB3B0DC33FEF WATERPOW
1,666,275,773 *AF5783184B52B59B265816AACCDBF5910B43C3A8 c,1:-
1,666,275,774 *AF5FF421253C023171C48D86C8D202EC2A2156B2 cc"pq
1,666,275,775 *AF5655D17F33E3788604078E18EFBB3C54B15FA6 [email protected]
1,666,275,776 *AF57105159822D9829FD7423DB13B048A8EDBEE6 C3IYR
1,666,275,777 *AF50D585503EA59E6B5DDE99F9E987A50760B119 c"3o:
1,666,275,778 *AF561BFCA9BB9FBF92DA152B48E623EE52D72C13 CDPRICE1
1,666,275,779 *AF54EBC74CC6968AF0336C1296EB927501A840F0 cdtqb
1,666,275,780 *AF5910BEEADDBA658D1CFD934F8E6D08B668A1CA c;7ww
1,666,275,781 *AF59CD0F61449A8EB6B4B016859C62C431C2CFC5 WGC`
1,666,275,782 *AF5A6FFF353A44D57948B1CA51053CB22CAAE639 CABENA---THE-DANCE-(DUB-MIX)
1,666,275,783 *AF55424C5B8513C196EF3CD1290C64A22394A084 CHANGBENNIE
1,666,275,784 *AF5A6BC18A82CACC3C4D6D124B934CAAE5FF25D2 CANITURNUP
1,666,275,785 *AF5F90EE18D9406051F1A25CE1EDD6FA4852051B WILMA.MAUS
1,666,275,786 *AF5764796168BFF0CB836E68C3DE678D524372E8 wilmerkrallis
1,666,275,787 *AF5BFF119C461E515A632513E21019656814DADA carlosahia
1,666,275,788 *AF51F6CD0E5F54497664FB2ED1A1794D43BA36CA carlos.jose.nanez
1,666,275,789 *AF568C78D4EF8C0B47539AE7112CB3DD88E3E94E Window-Text
1,666,275,790 *AF56F10B188DFD436EFCE2EA553C5E742B5504F5 CHEFWA
1,666,275,791 *AF522D8566376C4688ECA56788D3636A1B43E0C7 WINDWAR8
1,666,275,792 *AF55500505EB50D8278781B7A46C157CF3B8E493 [email protected]
1,666,275,793 *AF5927E934BEEF8C6107F69193BECF331A8AF61A WINTERREISE,-D-911-NO-14:-DER-GREISE-KOPF
1,666,275,794 *AF5A3828EA8A06A4DA02C63A9CFDC00443959419 WIOLETA-KACZMAREK
1,666,275,795 *AF5FDB7A98FD72ED576F56C684FDAD4F63D80931 WJS
1,666,275,796 *AF5A0387B7936628F68705BC4D669ACE26E44834 WPBGIRL
1,666,275,797 *AF588B34CDFAB8144C5C4BA6709A2DC2E1F2878F WWWCSSNYORG
1,666,275,798 *AF5C9DFF7E04B39A09897CEF44850D2E17282462 CHOONGW
1,666,275,799 *AF5A5E3EBFB86159822FB6E4B14B01157E539E6D WWWGLOBALCHANGERSCOM
1,666,275,800 *AF56CFC9A60094FE28E0CE73AF50E7A1D0D0F318 [email protected]
1,666,275,801 *AF5283B5F1369F757BDD8B8FAB44191A1E874946 [email protected]+0N3
1,666,275,802 *AF555C4FD9C39E84FA87B1812F405773C8F1965F CATHERINEGOACHER
1,666,275,803 *AF50AD07B7EE64EB3250112F76BEF72B06E1F12D WWWMAANN
1,666,275,804 *AF56B8105C9EDD9B65B81FE5583184D7E11A0094 christiandurano
1,666,275,805 *AF51B2A25FB54A4965EA72C19C2A56D91CB89374 CHRISTOPHERDULAC
1,666,275,806 *AF51D43DB4660FB6F03E648C4EE05F3BFEBCD017 wyldsum0
1,666,275,807 *AF503341F36A5D957FCC63F4B3F81B96F9F34B17 CHUCKBREMNER
1,666,275,808 *AF5348624E28DB81BD5F6871F823C21DDBB8590E CII+
1,666,275,809 *AF5B6036464E15A616A13027E0A1E06F3F2BBDA6 C:\DOCUMENTS-AND-SETTINGS\ALL-USERS\APPLICATION-DATA\ADOBE\CAMERARAW\CAMERAPROFILES\CAMERA\NIKON-D300\NIKON-D300-CAMERA-PORTRAIT.DCP
1,666,275,810 *AF5594BCC569D07294F1FAC673A1F2A2DAFD3143 XMKJ
1,666,275,811 *AF5E295C0A5CDC035FB1F51A3C0D40B37DC6E0CB CIT9!
1,666,275,812 *AF59233EDD382666C850D6982F15B2A8D6569516 XSYTVCEMCDUS4
1,666,275,813 *AF5A3595D0B969905C6132CE9D511B6257D50221 xt4haaaaibaj
1,666,275,814 *AF50F40AF8B6D5CB37C9F3C9A9054FB9BFDDA8B5 CjZB
1,666,275,815 *AF5818B2043BE54FD46C5FC50FC26B64A4670E3F CESAR.DEFUSCO
1,666,275,816 *AF5F12B346C3D53F4D77A5AB4D004E369F5FBF81 yaffa-truye-ayanaw
1,666,275,817 *AF52EAAE48B76EF14FC6B214F685C28ABA011D66 C=+KX
1,666,275,818 *AF55B890B1B38B14D239A5BE16487D057B5624AF c,g/k
1,666,275,819 *AF5B82D376D4132E27CA4C9D4537D5462E00D488 clevelanddunster
1,666,275,820 *AF5D603D984F2AF662C7E3F1FA98CFFC11738867 clevelandtheden
1,666,275,821 *AF5A76C5A072557ACF41D50404A5477AA241D391 CLIFFCHIAPETTI
1,666,275,822 *AF5060E66487E732DD71C4661C6436080154AD4F cliffhebda
1,666,275,823 *AF56427501EB2D87E849AC0CEFBE9C68C88B0A78 Y%BY
1,666,275,824 *AF570C7E392385EB1F8A78EDE84A8A4414C7F836 CHARLENE KEATING
1,666,275,825 *AF533A44AD3A3A90AED01A21B4435F904AD3EF87 CHARM.OF
1,666,275,826 *AF59830CE4356DBC36B57661528B641EB85A7925 CNE,
1,666,275,827 *AF57C2A03A52B21F23AE3A41803C06C331FCDEF4 CNQKP
1,666,275,828 *AF5B3BF4D3140A0B2D273129BCD56573E636299C cobaltam0
1,666,275,829 *AF5A2F85A4F1E0781DFE130923853AEA687F0AA4 COLOMBA32
1,666,275,830 *AF56FF0235B2F09CE81730B223439A1F9B162A52 concertono8"gminor,rv332(largo)
1,666,275,831 *AF5AE5C52D035BD3136A9776270E56209B255361 [email protected]
1,666,275,832 *AF50C6889E9C29F3BCE8E5D39C63523626EE6BA8 [email protected]
1,666,275,833 *AF5F85D960B2B183F8C44AFFAD4C9B3FE7E8E119 YSIADAJERAP
1,666,275,834 *AF51443FA8D4FCC0CAA10D3842DDC1122672BA55 [email protected]
1,666,275,835 *AF514515FC87625A5C7FC5C32258637B5C0B0E70 [email protected]
1,666,275,836 *AF5C2230A63544FB623BB8461601BA08E500DFF7 [email protected]
1,666,275,837 *AF5D749B544FE32AD00E94CB75E9BA1D8C105BB9 YULBERTANDCHERINA-REYES
1,666,275,838 *AF595C6328D15C60CB9AAD2DB70019016C268444 [email protected]
1,666,275,839 *AF568D3F1E03A06CE961218E0432BB15400B2FDB [email protected]
1,666,275,840 *AF55066E407F25D2A2AE5DC6046E8FB732A9C9BD [email protected]
1,666,275,841 *AF58A07776532723CB8C05BD711A3B4E1D8C62FB COTKARIYÊ
1,666,275,842 *AF54CBFBAB9302A2F6F25CFDBCC666F4BFB3B4BB cougarbrasil
1,666,275,843 *AF56B98AE3493D04B454DF23A00E5E5EAD68F854 CPjK
1,666,275,844 *AF5E797EE86EF6C7C021C3D6777D40223B5424BB ZAMOLBIED
1,666,275,845 *AF5B48E471E0B5E71B2C1B7C912D80BE5735D820 cikcn
1,666,275,846 *AF53335C68BB58B7F5A934CAE5982DB080427E45 CLARENCE.THOMLISON
1,666,275,847 *AF55C2525B8BFC583D49B569B064251343F54F41 ZGARCIANO
1,666,275,848 *AF5A0F0C0AE06A4E83EBCC867A7DA24586D24241 claudew
1,666,275,849 *AF59791BBA4517E03AC19D523760F9E5FCBDD17B CLEMENTE.HITES
1,666,275,850 *AF5F5EBB457AFCD5A41DDDCACDCCCDBC4CA95B42 crjhu
1,666,275,851 *AF5993799903CFAF38AB48076582C4C3C3FBA98A cletus-ibu
1,666,275,852 *AF50E1D4D6872F6090EC0FDD3AB58289D4822D90 crqe6
1,666,275,853 *AF538E2D80D6435ABAC171DB92BD6B8295DFE9C9 CLLQS
1,666,275,854 *AF523B4E056293541A1432AF82316BDE0AA823FA ΦΑΜΆΡ
1,666,275,855 *AF55ABF12DA6254E6FC24DB8229FA785AD5ECDD8 CVWD
1,666,275,856 *AF56BA9CF08B21DBF2C0FFA2E79354187C4D6E07 CWOIP
1,666,275,857 *AF5209EE3E78BF4307EEAB78953F60353C1A9391 ИНФОРМАЦИОНННО
1,666,275,858 *AF573F07F6A40C4F56D572059F61D7DB0EF0B719 comple7e$
1,666,275,859 *AF5030019B37A56AEC7E2C26238B428DEC800876 D1AQ2
1,666,275,860 *AF5239EE5A1AA0F053C19B39EB666C22E950A830 d&;1l
1,666,275,861 *AF52E45504B11A43D38A69CF4428489481EEB6D5 COUN7ERREVO1U71ON
1,666,275,862 *AF5059B8C610C57641A6B582D4B090A224FFEA86 ХЕРЕФОРДСКАЯ
1,666,275,863 *AF5FBE77D3A6F83AB3A85CBB707B52B3413E28AD CPDR!
1,666,275,864 *AF528773AC06A5BDC23067C7776DE074DC9E6672 dancing-on-a-summernight-with-you-(instrumental)
1,666,275,865 *AF55D7E9BF881E076840340364961D16768699FF cp,v=
1,666,275,866 *AF5578176CC0F89530B82FA942E0B58B18290975 creus
1,666,275,867 *AF5927414FA4718C949589A77D621E0A71DC7D75 darnellsaha
1,666,275,868 *AF54B22C96FDCDE0AB773C7F67D2EC28A69423D6 CRYOMILLINGSYSTEM
1,666,275,869 *AF5C4273E7F486B99EE1C132CB279D9B0F0FF025 ジャパン女子解散後の選手会分裂によって、JWPに加わらなかった選手たちから成る
1,666,275,870 *AF591121084C7790BF6CBD9E1EB7B3F51BE47CC9 deb1ted
1,666,275,871 *AF57304756DF34D2011F729BE6651E4C25066A49 Dedication-To-PEO-'97
1,666,275,872 *AF5A58AC6A6134F8EFF8F48FC7C5D668A36316C3 DEDICATION TO PEO '97
1,666,275,873 *AF5B5EC432AFA05CC51F89238F0F885FC9186F4B czfev
1,666,275,874 *AF56CED9FC436391CB83D6D7F53556D460F3C9D0 delilinux
1,666,275,875 *AF5F678FD6E68E136F93F76FB43AD4C4D69D8A5F d1o$a
1,666,275,876 *AF5268BAE348216E7A7BC4A44B4387F6ABB5C153 denisoffield
1,666,275,877 *AF58D1FFE58D242C7B9BD550A0BCC207919BE5B8 DER-BESCHLU
1,666,275,878 *AF569C08674C7EF10D5774D97C82DD7B0BB7450E DEREK.FORNEROD
1,666,275,879 *AF5F4C949A0753904FEFD9748D9DD34B906B278C DERRICK.PIATEK
1,666,275,880 *AF565244FB2F98F297828B483F4C52F63560449B d3qf
1,666,275,881 *AF5C7A20FB357FC98C991237A30D4E2F80BF9E9D devinkoerwitz
1,666,275,882 *AF50C6966186D2DB34F455AFC0FE5656663BDF55 DEWAYNE.MIZEE
1,666,275,883 *AF5087CBE66A7D5B7E7CDA92974C0C4DF63F2ACB dewitttubby
1,666,275,884 *AF5BFC740DF7BD64E12322C0C15DDAF64F9DA343 dallasmccanna
1,666,275,885 *AF5932873A5D0E010FC55B103CA3ABB78792A9C0 DALU
1,666,275,886 *AF52AA92157FFC2C38925DFB34B1BA269AEA15DA DANILOBITTICK
1,666,275,887 *AF52250CF9C18BB0A46B59532BE0232423B3BE57 df&3a
1,666,275,888 *AF5D13B1D217440828DADA47B8C95401E9831CCA d"g+p
1,666,275,889 *AF57B8573FC76DF93DF20EBC5E6B566F95CB0B00 DARRICK.NAGAO
1,666,275,890 *AF5790EDE90A53CEE8BA145E5E2E8207C5DAFBB7 DIEAMSAART
1,666,275,891 *AF579C02234B2F47D163D8B6C7A5E549EEDAA922 DIE-KINDER-JACK,-ALFRED-UND-MARTA
1,666,275,892 *AF5E7B359030EC74D1985427B015C5B3F9A56553 DAVID1ABSOLUT
1,666,275,893 *AF5C7E3549B2450F12B8B0F6F3ABF67F7EDEBFFA DAVIDTHONG
1,666,275,894 *AF5E98A738C2CCEB9264D18350B667A0F7EE760C db4c_
1,666,275,895 *AF5C9D201BDAB5E72EEF62A89CEB0714E7EB7E3A dcvvw
1,666,275,896 *AF5B78051A566931E3A09EC77143DF8B9C55C4F2 [email protected]@71ons
1,666,275,897 *AF5D92C176F5FA078FED9497065C165FD4D231DF dmhep
1,666,275,898 *AF5ADCD0EC94AA1454C4BAC7AD1101014FFEB8AA 0IAMHECTOR2
1,666,275,899 *AF5BFE81C35D221C671A88B725C3B5DB1B15B2ED DENVERCARRASCO
1,666,275,900 *AF5923151DE4164910B06A75D2D0D48EB48061EE DE+OF
1,666,275,901 *AF50E727F608A4351713B7BC765E31186D2A35B6 dn$7k
1,666,275,902 *AF5D91B8BA42A15695601FCDDE5857868374D4E4 1301653 oikea-paikka-niille-on-roskakori-
1,666,275,903 *AF5BC5C6EB677EC4DEE9686439AC0F9E43566097 DOMINGOTILLERY
1,666,275,904 *AF537F9BA9F2A94ABB814544ACC9C7CA1708573F DOMINICK.HARTSOUGH
1,666,275,905 *AF5C3C1975B1E2A0BD3BF3A3721B0B5547B6E584 DE=_Y
1,666,275,906 *AF5D387CE9D13A030A409172E2B5181D5C49D727 1449.infected
1,666,275,907 *AF5603334694EE823C59149FE25588F27D83C50E donatello-niccolo
1,666,275,908 *AF5CEEF5B07DEA55612E5E215289FA9EBFAAC61C [email protected]
1,666,275,909 *AF53AC2BA70D14F29FE6C1CD6BFE5D96210B03FB 14CEIER
1,666,275,910 *AF5F46D00ABB2B193958ED5FB81D76FC3A326726 1581567 interkontinentalfluege-sind-derzeit-gefragt-wie-selten-.
1,666,275,911 *AF5CE5C0BDDE557D52FFA90DBD66A2651779C4A1 D$)i
1,666,275,912 *AF536F6926D8739881B49CEF1E0307D2B58E3694 DOURITSU2
1,666,275,913 *AF5981BD016FE7B0D58093EED3CC5D6C0D408499 do-z;
1,666,275,914 *AF520397A3F3CAD6275744C07E4E9CE72D69B147 diversesigns(signosdiversos)
1,666,275,915 *AF540FF3595757B75C1EB0D90879677BB9EE0635 D_pT
1,666,275,916 *AF521F354B15AFE7A25EA5B797EE7F2A1774C01E DLL0F
1,666,275,917 *AF5B5B7CD119AA6AACA9184707D8A0C2A4F87FED DRƆ̌ː̂N
1,666,275,918 *AF5C0A338963CCD211F63E72D1A008211D8FED43 1-asumispalvelutoimintaa
1,666,275,919 *AF559B6EFB250601678B9D4EAA406A8B2EEEE08D 1.bayerncracks
1,666,275,920 *AF5F14C6162568016070C4C60DE3F32DF834BE5B DSAWR
1,666,275,921 *AF50B417AC57A4EEE94AEFFE1BD802B8B85F350A DSH+
1,666,275,922 *AF58C79ABA5C70B42FD9AA482F3277D443238F04 d"o!f
1,666,275,923 *AF5AC6791DFA1D5B8CEBC3705B12E4F3633A8D0E dominicgrajales
1,666,275,924 *AF5676564C8CC6F36D50958CC300FAE3F59F787B DUF"R
1,666,275,925 *AF57D3F30D9FE70F3B98C97695D00AD4C47C2A54 DONGEICH7
1,666,275,926 *AF577BD34AF0116F79AA9C43D4AE61BB34CADC09 1INHALTLICHPOLITISCHE
1,666,275,927 *AF5C3F3AFCBDF5519DD9FC74523AC225AA16172D DUSTYFAUSTINI
1,666,275,928 *AF550982E6AC50122CE7632BDB14F19527B01A90 [email protected]
1,666,275,929 *AF557D1C125C0CC095B1CA4F907610CB90E13011 1.KASVATTANEVAT
1,666,275,930 *AF56968AAE8DF90B36B7F126119DF568DE7A4B09 dvezkyxing
1,666,275,931 *AF5486ABE4B27D094EFF48F3C2A2F38B0184D8C0 doughera2
1,666,275,932 *AF5D2C9C55EBACC608702FC55242BC675CEB8B08 1-nebenaemtern
1,666,275,933 *AF5E7F8A64E091D72BDE0000AAA638FDAD4AAF22 dr4cx
1,666,275,934 *AF50B1C23E8EC77D69F2C6B25FF21C2CBA06D8F7 DRAGZTR
1,666,275,935 *AF53B31565C08BB526DA348FB31B009F8850A760 ebfy+
1,666,275,936 *AF5A08C479141E062E4710B47AE427824B3063D6 1-PALJASTAVIKSI
1,666,275,937 *AF501616CD1658A6F8EC382878B687908E48823F EC!P
1,666,275,938 *AF5F3F90869B925529223C95A333A6E492641453 ds56o
1,666,275,939 *AF5E45C3B492CAFBD038D4091FBC5C1AE03FA47F DSH+
1,666,275,940 *AF5B515B213D71E959401F445E81B73811E38155 1 TEHDASKILPURIT
1,666,275,941 *AF5250E386AD137F419977EDEA742B3B5A453F99 EDWARDTROXEL
1,666,275,942 *AF51A229E96CA3E5BEFA15D0EB104B6B7F091439 DUCOMMUN9
1,666,275,943 *AF561588898EAC0524E25C8CA7C2858E0D8CB2E8 D_v)
1,666,275,944 *AF5405C34E0184FBE58C0E69D24717893BC51E9E ekf#a
1,666,275,945 *AF500445F6962A393F12F52C467D331679FE5325 ekmg(
1,666,275,946 *AF5B1858208094BFA117450B89E0FDDEDE160A4B 2165479 OLETTAKAAMME.ETT
1,666,275,947 *AF5D1DBB690CD60C0EC7E620BF34115A1B45A0D4 DYdV
1,666,275,948 *AF5E52D25CE74D123DEF0429F8F54D09EBB0C992 dz7dh
1,666,275,949 *AF5DD9897DD30377AA145EB9D7F08E2072E410E8 24april1505
1,666,275,950 *AF5364A2718632A6C2BC2EB272627545F467DFA2 256164 onemliolankararauymaktir
1,666,275,951 *AF53EBD41C7AA74EB8906E9ADB763CDE8E97A8F1 EMERIVER1
1,666,275,952 *AF5FA7119A60395E17C7AC2EA94CDDD52C993E3B 258779 theythereforesenthimachequeandclosedhisaccount
1,666,275,953 *AF59049E95B95A3B76AA4F8D28A88F93FB0A4EAF EMIL.SUDEKUM
1,666,275,954 *AF5257C7DD311328EE8EC39102D4AB62C097730B eber-ibarra
1,666,275,955 *AF50C16EEEFEAA356B80263C94E0B143219BD9A7 EBNAKASHIMA
1,666,275,956 *AF592CB1AE935504EB50E072CD990EC59F0AB7A8 29-toreninin
1,666,275,957 *AF5A46C099AB94D0B86A93BBE7CF47FF200B34AF 2ABBASSEREI
1,666,275,958 *AF59EDEC0B7D1C40DABFD14DF3922C92CDA56446 ENFERMAIENT?
1,666,275,959 *AF5F72C56A312D62D06E05161F6D14451F44FF5F ENPROTOSEMITIC
1,666,275,960 *AF55942BE5EA9D5636A608753A3F4074A90E0CCA ENREGISTRAIS4
1,666,275,961 *AF5D1B390C3A568EDCBF593E8752687CEE1C4D32 edmundseedorf
1,666,275,962 *AF5F315A1BACA98E5AA7E0EA8D9109E05CE4E3A3 EntarteteLust
1,666,275,963 *AF5566D1A92702521F7AC3B2045A8D02BEFA9EB6 ENTRUCHOS
1,666,275,964 *AF536EB2916901BC18A46BB16028EA4C2F8F44F5 2ILUVBOB
1,666,275,965 *AF536A6EFA216F12DA7880AD7540E931E6D2644D EPET.
1,666,275,966 *AF56B5E7945B405784E55AE59741DC8FAFBC4A47 EPIDEMYOFTECHNOPHOBIA
1,666,275,967 *AF5BF4DB42E672DAC5F0DFC03527E2C8A9BC3C3C er$7wh!le
1,666,275,968 *AF545290A25951704371D0B204582EF4119C20A5 EGM0
1,666,275,969 *AF5B1B5088A8246E0D60D90954075A2D3D277F58 ERNESTBREVELL
1,666,275,970 *AF5249C9254F4E3483370D5331C3685E7132A164 ERP的概念是著名產業科技研究單位-GARTNER
1,666,275,971 *AF52F19C23BC85A9F97DA14B4B3EC418D90A9153 ESTABLISHK
1,666,275,972 *AF582256E7E3B8C49E48ABDE5481F9F8A14F9149 31october1577
1,666,275,973 *AF589F39BB1821A07E445FF8FA5451D1FB6B2A85 etc専用レーンは、
1,666,275,974 *AF5F7C6C0023CCE0736A694875BE6E53FDE8FB5E etilosaz
1,666,275,975 *AF55E5F11CBDC82AD1E221797709ACBE4DE0BBF5 el3%a
1,666,275,976 *AF5571492EC14BBB9E09F93B1815E677501F4145 eusebiojana
1,666,275,977 *AF5416AD17E5ADFEDE734F70ED65BCB581381F34 eusteles?
1,666,275,978 *AF5747F8F334F0DCA08D997AEBAB90C352974C21 elijahro
1,666,275,979 *AF5AA4965C08282FF240A809836271522531CE35 3ANALATAM
1,666,275,980 *AF51BF85AC36E27AE4AFCCDE311D0C472560FE1D 3ARNIRENT
1,666,275,981 *AF558BC9E683DA0B96A4EAAB29C896FFFCFAE79E EXTRA TERRESTRIAL (B)
1,666,275,982 *AF541C8335B82053DE02E318803548CB94FB8DAD EYw
1,666,275,983 *AF51ABE561FB38AE271EA7FE7B7852FD217A1A56 EzekielHealy
1,666,275,984 *AF5895BF7D177F50494F0B4EC468B1E56A89C6E3 3MYGABBY
1,666,275,985 *AF56724A0DB05C5F33C85B7DC1143AC85D868F8D EL=WH
1,666,275,986 *AF5D131F031D377A4AD4C96F4AE604FACD4BA303 EMANUELKWILOSZ
1,666,275,987 *AF5B26CFEC3F37C4A0190DDE2EE21B0F62817B47 FAPYYCP76
1,666,275,988 *AF537A4A80F9144CE64B23B491B227A62DAC3422 EMORY.ALVIAR
1,666,275,989 *AF5A53931E5A9DA57607536350F1E738FC9D019E emorylavecchia
1,666,275,990 *AF5F92BEEF5222BDF1CDEC5AFFBD7940A301EAB6 4.CLAYHITHE
1,666,275,991 *AF55E435BCE7850A2BD0C31ACF2508FBAA87F461 FELIPE.CUSHING
1,666,275,992 *AF5772D1F08DEC839F687717407C8B69F0E345A2 4IAMKETCHUP4
1,666,275,993 *AF5FE1ADC9457EC3323BC1324CDE451B3D514DE5 FENDESSES
1,666,275,994 *AF5DBC74DBC7A9F9B840820AFCB5AEC71D617698 4iluvnesbitt7
1,666,275,995 *AF50FED099C68527859AF04CEE357111D2710417 [email protected]
1,666,275,996 *AF5E760E461D9133C5C62B9D763FD8D493542A02 ENRIQUELOPEZALB
1,666,275,997 *AF5D39580C36A67E3AEA2B8F21183973A8CE8FC7 FG9E
1,666,275,998 *AF572D9C73CB22F9D6C785190AB7E0D33554E1DF entereza2
1,666,275,999 *AF57F7BE89E6210F9FC2245189ACAE71B8032CA5 FILIBERTOSHANKLIN
1,666,276,000 *AF5DEB6AC67878ACF9E5EEE23B57F29346AD70E6 FILLARE1
1,666,276,001 *AF5133101D1EEE0AA25A3D434A6DC57720C1BA96 [email protected]
1,666,276,002 *AF521CEF326C8F73E5BA75C451AE82B70C904D27 ephrq
1,666,276,003 *AF54A51707E449BCE72FA77EF60E0E3F0574A329 EQK(H
1,666,276,004 *AF5BE6BA8C66487A85CEBDEF7A5FCFADE3C57AAD ERFODERL8
1,666,276,005 *AF5484505B0CE25F1A27FDD3F361D67FEC41BC45 erichtibbets
1,666,276,006 *AF55ADA2694AF885EB86C7F10F3F3DB3A3B5C8DA ERICMITCHUSSON
1,666,276,007 *AF5D8FC7252FAC7457EAF64389FB1540DCA9909F ERIKBERAN
1,666,276,008 *AF5573BA480A275055C381CE651DEA1F0451ED33 eriscopis
1,666,276,009 *AF5A82E928FE26A75C4B7ED5B856FDE4133A593E fordexpeditionssvnewegyptnj
1,666,276,010 *AF5EDE8D598E7561C38FCCDB78609E9C57FAED05 ERZULIE(PHANTOMREMIX)
1,666,276,011 *AF5BF5F4C7BCE32498FBCB653E5F1027EF9F1AA9 FRANK69
1,666,276,012 *AF5CACBDE074C63CA24AF7C0DE2E5AE4136FC2A8 franklynkocher
1,666,276,013 *AF58BD6683F8810B0FEFD26DCCDFF9E3BBB8FB9F FRANKLYN.STICKFORT
1,666,276,014 *AF5CEC281DB44E32EF9D2B0D9E643242DC30EE17 estebanfurst
1,666,276,015 *AF5E48054C7FBDE15D58E47DB2102789EB6726F8 5E5M01095T
1,666,276,016 *AF5F32A24820F63F024EF002E82DE24AE7BA2008 FREDDY.KORNREICH
1,666,276,017 *AF55B43CE9FD5304DB8FFD881B47C1644EE9835B FREDDYSITTO
1,666,276,018 *AF586849AD42B1F0F3230D22498485FF6AFCA6E5 FREDERICK.BANKOWSKI
1,666,276,019 *AF5F39838D0663AE0275AA7808741C13DCF0B00F FREEBOOTER
1,666,276,020 *AF56494B376F8D17F3C22E7C3B82B70108569CFD FRESHJADE
1,666,276,021 *AF5CDEB77B3943F7A0CE9C6BD7129FDE119C6B3A FRSURNI7
1,666,276,022 *AF5DB63446CA7025C4211877B4C6ED75ADC30DA1 5MIRAGEMARIA
1,666,276,023 *AF59D9C3C37831D08D352D75D4C57EDF86F64388 EUROCENTRO123
1,666,276,024 *AF57F8DE206C5F269F9913672D5D730FCFA9CD46 FUNKYP45T0R
1,666,276,025 *AF581DA6A77CEBAB7A7B7A9113C8DFDE4D854490 5NENIOVIO
1,666,276,026 *AF50978291A73CC1B7279281A0DE405E9C494BE0 f|w/
1,666,276,027 *AF5D1F1C92FEA5F692E3460DBBF8FBD372B66D22 5OSOSIRUF
1,666,276,028 *AF5946299B72A472EB36F0F91B3FDBBDC26726B4 G32T
1,666,276,029 *AF565E1FE2F9ACEC0459935DBBA5525C2742F58B 5USEDHALT
1,666,276,030 *AF59C91B97E27D3EF150CF5B39035682B929E575 GARRETTMEISS
1,666,276,031 *AF590FD2A351737006603E9381E8AA0C4A3EF593 5VORSCHRIFTSMASSIGER
1,666,276,032 *AF5D227C7C9B9921588BC81E4BCD5CEEC2FBB48B F7}I
1,666,276,033 *AF5CE37EF0C141BCCB8A63531DE06E5726739482 FABINOU4
1,666,276,034 *AF514F33C34B22A6C347A05AD54931627DA84CEF 686IAN
1,666,276,035 *AF5796CAB4D5785CA768F672292D485487EE1816 695POIUYT
1,666,276,036 *AF53D3694335DC212CA66941EC371EFF6B4A7692 6AMANDAREGGIE
1,666,276,037 *AF5675044EC5DC6C0D6ECF2127D5D6A4F4EBCD8D gefallendes
1,666,276,038 *AF5CDB459AB3A29864157D87974BA72A4D230130 gemoniaa3
1,666,276,039 *AF55C4A989A52085E814C107860B13A6B2C2CF53 fatboyzes
1,666,276,040 *AF5B0C44DB269167D95C1883E1856A0AB108E52A 6ERSTELLERBSW
1,666,276,041 *AF58BEAF021F4355B8EADCF63284102E2BFD32AA 6fingerhut
1,666,276,042 *AF5D0CA2D4C25E2395757BB8F7A0AD48A48C110E 6ILOVETAZDEVIL3
1,666,276,043 *AF53FE86A796DCE95A7B715DD962FF361F50A929 gh]
1,666,276,044 *AF5F3AFC371212EACB37D15C23533CAEEE36B87A gilbertminion
1,666,276,045 *AF584EE5BFD1D8B7ED474BA0C9261BD55E9A4BCD GILBERTO.KREINER
1,666,276,046 *AF597EBCB5FCED9F848C2060FC2B7F8180C8626C GILGNRK6
1,666,276,047 *AF50EDD8E1DFBA18ECB5D847CC1FA28624571BD8 [email protected]
1,666,276,048 *AF55A38C18319CE8DEED099AA939F868955CA3BE GINO.BRENAGH
1,666,276,049 *AF567A6AED800B7751BB7761B7E661BD9BFED1DD Fernie's-Groove
1,666,276,050 *AF5A84F9DA2041EEECDC869351A56F029041541C 6mysamsam7
1,666,276,051 *AF59AC529BBD267FB93EF2AAE56C02BD8EF13C45 6NJANZEN
1,666,276,052 *AF5874125C8981A306AB219370253277F9C78605 [email protected]
1,666,276,053 *AF5D81962D4185707E00918E828C80572CDBAD62 6PEEWEEPOLITICS
1,666,276,054 *AF5C9F6E28D525933B49578DAA6610D2463BF6D2 f/il
1,666,276,055 *AF5EB8A5F71D7F1820430D43752EF5F4165D19B7 GLEOWES0
1,666,276,056 *AF56355CBB0F1057BC2E25517447FE02A15F6FA1 6UYIMIGUS
1,666,276,057 *AF5BFC8F661F89DA41D49DC095B9BE8F8C6B7724 FLECHASE4
1,666,276,058 *AF5D77C28CC466B1694BC5CFCF5B7C380FDF3EB6 7BSWBARTOLSONBSW
1,666,276,059 *AF5F9E6F1078648F12C2B85A77CA11F334E35338 flotnet1
1,666,276,060 *AF5A0687B3F05D788CCB04436139EBC6A090B8C1 GREENBAUMQUIRK
1,666,276,061 *AF5B531F144BDFCE763B58620DA8D8E67197C0CB 7BUTTONSPATRICIA
1,666,276,062 *AF5A75FB7583E496D310C0066CC449DF73EBC3A5 7CATSANDERSON
1,666,276,063 *AF5FF135B0282C80DB0AD1F4DB5D4A4F6C63771D [email protected]
1,666,276,064 *AF594F2821AF5B1228E5B8BEF8425A5821960CDA 7FDEVARE
1,666,276,065 *AF50758E1A39206FA37DBAFC2A118BBE10107A1D 7ILOVEBENJAMIN2
1,666,276,066 *AF5BE643C2D31068D98F2458EA9057AFEFD393FD GUSTAVO.CAFFENTZIS
1,666,276,067 *AF5D81D2EA69B1FFF7634B3D5EB1F7F0FCB040CA FRANCESCOMASOOD
1,666,276,068 *AF5D8A33A324A0D80C66037319A05970471CD125 GUZBDFX6
1,666,276,069 *AF579771875DC86171369813CFCBC5E730A6BCFA 7ONOCSINAVS
1,666,276,070 *AF5A558BE6A114CD7D187FDFD7AC890F63238EA6 7POZASTAVTE
1,666,276,071 *AF584771562458895D0A099DD38D05200906C097 FREE.FALL.(30.SECOND.VERSION)
1,666,276,072 *AF52AF9764165A588CCA82BF6BB27330BB3138ED freepetwallpapers
1,666,276,073 *AF51B9B6B2FBBE79606322AA958B70A8CBE394BA haitabler
1,666,276,074 *AF55D08C7CDF35EA2452FA6C0939B4F3658E7F89 7VAGABUNDICALL
1,666,276,075 *AF5241EEB98D7CC0403AEA9BF14E6C7511B3EDCF HALFELF5
1,666,276,076 *AF5BA24A79BE38A6D1F9539C9FA8217640DA6DE5 FROTHEDS2
1,666,276,077 *AF56715B18F6AD78CF18E545152FC276E4751892 8=)~0 ~O >-B0
1,666,276,078 *AF52012387DD581C6C741CDDE06CA7AA1FFAF2F3 HANDY-JAM-ORGANIZATION
1,666,276,079 *AF519FA326342CA9C236BA5BE1AD8544AED149F7 hannaasdf2
1,666,276,080 *AF5DE0DA7FEB079D2CA24E0AA73AFC267E5A22E3 !83R!AN5
1,666,276,081 *AF5856E6B2E4637B9CBBD5E14E45676E7E9ABF4F 861MASON
1,666,276,082 *AF5BF1DFA2CA7B5F5139D43DC3702CA556886470 harimlarla
1,666,276,083 *AF59161EDA87E45884528ED762CFF8DC89C12180 HAROLD.RYDEL
1,666,276,084 *AF51DDD09ABEF047ECB98D4AC7AD5D65AD3D9F20 harrismencia
1,666,276,085 *AF57EFCB706B8EBC8418D21483EDD1E96E2B48A5 FZVP
1,666,276,086 *AF5FAE9A7B40AC9CDC0F2995634E5444D8D3B669 gaietto7
1,666,276,087 *AF50AAE6565F0EFC496F285ABBAC804E5D501200 8BSWBSXBSW
1,666,276,088 *AF57C95BD065E16F8CFF680C01F36B52F9E86633 hBbaa
1,666,276,089 *AF552B83756EDD7588984F4F6DC26C3F099249F4 8INGEGNACCIO
1,666,276,090 *AF5A2B136198A41E46A2D31B70851EC77C2971E6 GARLANDOESTMANN
1,666,276,091 *AF54FEC62A3E8C59BCF6D737C8952FCFB50C087D garlandvohs
1,666,276,092 *AF55D8F274A950F1EF57A165F21182F40149E647 [email protected]
1,666,276,093 *AF550D678EB1DECE06DB781A7F099C9CD8FBA7A9 8kentekende
1,666,276,094 *AF5B6E135A52FC496A3244CEA01962EEA3834EB8 hendrezk
1,666,276,095 *AF56463C6E6FACB5895616A49C88204CF6A46F57 8nonrelapsed
1,666,276,096 *AF57FB2D9A5FFBD44FA37EF9508214790DB8652B GEEN SPIJT
1,666,276,097 *AF526E7317E70B2020B1792D054FD818629FC400 8.PITKITT
1,666,276,098 *AF5C5D453B56EAC5BB1B39709D802928773073F2 gehukt
1,666,276,099 *AF5CD25ACF8F3193553E933E5F4EB8460E5DF25D GENARO.COFFLAND
1,666,276,100 *AF5875E97DBB4556A02B01322000DFB21DAD54B3 HILARIO.TILT
1,666,276,101 *AF58EB3C6AD5503A4733EC1FA795DCCE98FC7AFF 8SITIDIOMASES
1,666,276,102 *AF5DA4A379FE9D5780C6AF23AA07C5C9756E534B HINAUFKR6
1,666,276,103 *AF5A9794D6243AFD0F277FC258248DD0FF2D4450 [email protected]
1,666,276,104 *AF54BF03146411FD7F0E39068117DD20EEB12817 [email protected]
1,666,276,105 *AF553CDC62F10E746CE540711E09D1170E9BBE3E gerrydidway
1,666,276,106 *AF5D77DCD1D412E2B6B3BB78416CD41BC3A0FCB3 8=====)-~-~(x)
1,666,276,107 *AF5B77644C5BA3A4DE811ADA3B7BC15167B3EB8F GEWEERMAKER0
1,666,276,108 *AF5563C2580CBE8C321D97B43E4D236FF73F9C93 «holio»
1,666,276,109 *AF5FBB3C211DC8C5D3A2C640A725718CDFE2FD79 GIR455I
1,666,276,110 *AF54ABD0B7EFDF88B97002F30A03A0585D0335A8 9FARMINGKIM
1,666,276,111 *AF59EE89D0137494965DD8CC99D1C33A6E1ACD2E GLOUCESTER It-is-the-worst,-and-all,-my-lord,-he-writes.
1,666,276,112 *AF5E0825EEFB4EDBE87A4411428C6FB6ACE4D96E HSH]
1,666,276,113 *AF5F0DC5D201D8717A9C650BDE67B8DBE30FE5E7 9NEFIERGNIE
1,666,276,114 *AF529CC232CABE410791F21D3A082E815593E59D GOLF
1,666,276,115 *AF5D92FA068087BEF5E283A3864D93CEC6EAD5F7 [email protected]
1,666,276,116 *AF548F0EAABBC29F51F5005CA5C5B5B25FBC44DE [email protected]
1,666,276,117 *AF5921313DF6BA4E526FFAE19FF959A39609B5A8 9ONPOPUL
1,666,276,118 *AF5437DB69D2A485954DCE74FE101AA19E4EAB90 9SPEEDOJAKE
1,666,276,119 *AF51E79F2174B939F1A6471BD8F86CCB4A580C57 [email protected]
1,666,276,120 *AF5F40B81DA42D1408ECA7AE933603E3325E8F30 GPENELOPE5
1,666,276,121 *AF567759A828678CA831EF1556CDA63C82E94AAA grahsco
1,666,276,122 *AF528D99CE4A1E754F009FB2D6FA2803E89AB95A I[3A
1,666,276,123 *AF51C5E2DBA7033B3443AFC688E2A9CCB322B643 A17s
1,666,276,124 *AF5CED5531156C410984762A81C0DCB201BAC3E9 IARPREVO9
1,666,276,125 *AF5BE9B8895B83781F04A1107022243E8CFDDFF6 GUBNITZKY1
1,666,276,126 *AF553CA0B67E56DA4DB692D4D1B7139A6F10021C GUILLEB9
1,666,276,127 *AF503DF898EE7AF31BDDB98024C6A00821B3B0C7 guillermoclammer
1,666,276,128 *AF55ECAB37E5B1602F5EF78907FFD2ECF1A90E6A GUṆĀNĀMĪŚA
1,666,276,129 *AF5FCFB5E52C3971B99A08C296490D4834B28F3E GUSTAVOOTTMAN
1,666,276,130 *AF554C749E96493FB46163D04C36C447F820AB60 A6N3Y58
1,666,276,131 *AF59D5A398E156DA6F8B33E9E1C527013FFC0AA9 [email protected]
1,666,276,132 *AF55C365D05F4B2310629DDF303F80D7D8E47AA2 GUWURIRO
1,666,276,133 *AF5ADAB52336E6C703A30EBE7658734A4679AC7B a7ou.
1,666,276,134 *AF5D5163F95BFD293EB3BDADACB35E7FEDC771F9 IFTHEREISAHELLBELOW,WE'REALLGOINGTOGO
1,666,276,135 *AF5FE025D745C9BF9D4451DA134465ED6E604642 aab2fp
1,666,276,136 *AF5282938A14389D0F12B04206FA7EA4B5A6DDE4 in5+rum3n+ali+i35
1,666,276,137 *AF5BE26E051678E80E9F652FA0C49974892ECE7A aa?f
1,666,276,138 *AF5DFBC51660DC00244F843E3DEF18287530F8E7 AARICIA123
1,666,276,139 *AF53E6AF4ED706584AA4DF397A5148398E2B476C HARSHAKAM
1,666,276,140 *AF53FB3BAB9EB3005DAFE6A64C82C7E762B41AD1 instance2
1,666,276,141 *AF57B0906CF3C4440097E3D199AB77E214AB514C abbywheels
1,666,276,142 *AF54F5CB5381B8225F4440796C7129115B690672 abisl
1,666,276,143 *AF567A508B0FCFC7DCCE681D29BFD9F6B95D83A1 A,BQ
1,666,276,144 *AF5F0F117FF29C74A57CEE82A95EB05EA0C199B2 HEATHCURENTON
1,666,276,145 *AF528EE34AECDA3D981700334F134D8A6F241656 ABZUWARTENDES5
1,666,276,146 *AF5638E5565D5AD756DBA40B4C25236062A9E4FC [email protected]
1,666,276,147 *AF58973EF0231FCA70AE55944C890481C99577D4 Heigh-Ho-Medley
1,666,276,148 *AF512121AC748ED6FF29E664A77C02E4C00CDE28 ACD;C
1,666,276,149 *AF5B9B1F8C98E0F04C824FC41EAFE8CCC407171D ISMAIL.GOKKAYA
1,666,276,150 *AF57240A35212E9D18E5588044A5086D9CEC3EAB acr.o
1,666,276,151 *AF5E9C72F1D37B0C50734A7D6F1E64424CE66ABE ACY+D
1,666,276,152 *AF5776D6B7797E8CEF541F1268108C456E7C29D0 hifzetmek8
1,666,276,153 *AF544EB3BCF642CA36B6A9FDD27395B7AC7AD8E1 HILARIODOVE
1,666,276,154 *AF5B841D0CC9217B6C0CAF7CCE49AA5446D164E1 [email protected]
1,666,276,155 *AF55F1842C5E32E37DCF0947338479D2925FC1E0 HITESH-BISHNOI
1,666,276,156 *AF53F163F23E0C45445B8015C5E0E4E8DC4B4409 ADR_
1,666,276,157 *AF5BF2A4068C5D93301AB3E811991EC240845F8B james.abad
1,666,276,158 *AF50620E635411861E7078803F9B8289E5BF11B3 homergausman
1,666,276,159 *AF553A20AB3D012986DBCAA63F3B85F14920B5FF AEFGR
1,666,276,160 *AF585C7CBD2961F777D336DDD3C0B03D0A5233BD horaciocinkan
1,666,276,161 *AF568A157BAB088062159D98C3FCF3B28FE149D2 HÖSLICHKEITS
1,666,276,162 *AF5FEF15292E6AE1CEB13CB144313E975D322716 AFFRANTIS7
1,666,276,163 *AF51495D7423F9BB13E16591C7A75B2EAD0628DF [email protected]
1,666,276,164 *AF50F6BAA65AB32026DF54D09A8D1AC21779B694 A/g
1,666,276,165 *AF5D40046CCA6E16CB27521CA519BB44378ABBE7 agl$b
1,666,276,166 *AF5D3F1FEC63BCF41F5E6A76E3222DCBF77D428E jefferydelio
1,666,276,167 *AF55F293109EE25B580626E1604B2E259E85912A ah,20
1,666,276,168 *AF5131A5A5DFFC60AAA24863F914D1CF18C19F28 hungcarovski
1,666,276,169 *AF5AC68B40009E1CA36EBF327EB58AFFE5BC68CA hunglober
1,666,276,170 *AF53E138631C3A9AAA2561B19441B4421736A26A [email protected]
1,666,276,171 *AF58BE9C3D3E408193B8205CCD6F7ADD984C68E1 JENNIE-SORIANO
1,666,276,172 *AF5F42E8EAB514B5B4C9CF047D1CA47AFAE3FD25 hxig
1,666,276,173 *AF5F56AAF2BEE0F13B4309D1C08B428AC93D37CC iailgabba1
1,666,276,174 *AF5CCF253F6F135614922F273583C7777BC5C382 [email protected]
1,666,276,175 *AF501FC810283277E27520DEFD6A6B4EAB3AD8DA ICIARILY6
1,666,276,176 *AF5B2E217481511253505F7BB26F02A2BB0CF02F ifitsalp4
1,666,276,177 *AF5653BC4225158C1E2FD603F5D0AE68FBC2AEA4 ALBERTOVOILES
1,666,276,178 *AF5A414D4A712CCC89AB3C597D0FEC1901F43486 ilegalcusi
1,666,276,179 *AF5793DC352499C19CF02A258882DDB304D86333 ILOVEJETHROTULL06
1,666,276,180 *AF5E84CB1B637A47A620B8546D6A6256A4F3B4E2 JOSEPH.BARTHA
1,666,276,181 *AF5C3D8F8F9BB05B1348EA9A3CCB05B27854DFF4 JOSEPH-YIN
1,666,276,182 *AF5342D75C259CA5E066D9CED612ABCF509A7096 ALKALMAZSAI
1,666,276,183 *AF5CAC73E8E1BF82E2C4FB5B787766E42307C816 IMPERAVISSEQUE123
1,666,276,184 *AF5C9A16B4C0036D994C176C29ADD4ADE6A60D31 JP.BRABANT
1,666,276,185 *AF50277F8FDD271147353685FAA2A4DCE86C6224 alt="voice
1,666,276,186 *AF518D97505BB030B79131BC95425F315C9276AA industrias-tequendama-|-colombia
1,666,276,187 *AF5D44778C86CC7355CABF3118F04EF04DF56AF4 juggleo5
1,666,276,188 *AF54F8572A09A52133E09E1156FE716221D489F7 INEXACTLY5
1,666,276,189 *AF54650304C5A0A79039D2619E3C6FD28534B020 introcoronation
1,666,276,190 *AF5DA3830FE562475E49B3F658881B8E4337B021 A+MQ$
1,666,276,191 *AF519E81E6ACBF4E08083E49CC1D1995FCC6F78D KANASHII.HAATO.WA.MOETE-IRU
1,666,276,192 *AF574337423DBEAE576561249CBEEDBB2B0BE036 iseraph4
1,666,276,193 *AF56091CBA0773016B464A51B4CD9DDA81B2D457 ISRAELMILARDO
1,666,276,194 *AF50EFBD4959008967481BF8CD7A9AA1B7C48245 ...and-Heavens-Cried-Blood
1,666,276,195 *AF5EA0AF863EF6A01DAE99A6357C0681F1852DA4 ANDREA-BEISNER
1,666,276,196 *AF502E0BD88F7D0342CC3875C245847BE6EBAD5B andreablackett
1,666,276,197 *AF59FDF11829005EE5150AFE1466D1998BBBDB31 [email protected],
1,666,276,198 *AF57961FBDDE0BD41282F3989D02144B455FCC51 angel.lloren
1,666,276,199 *AF53FC55499D61FBC9F4F7213442846878D6D72A ivanbrien
1,666,276,200 *AF59257814C89E8DE5E06CF5E0E8C8E9F4F7842F ivg)
1,666,276,201 *AF55AF48ABEBE5EAFD1C9876AC6E263FC9D98C79 JAKOSTA
1,666,276,202 *AF5D7056E34462E4BE1F7530FBAFC00E3261CABC jamaalstandish
1,666,276,203 *AF5A4585A5466141665B5152DF7E6CEE23C4197C ANIMAX3
1,666,276,204 *AF5B5FDAF9F51513F1CDEB5461DFC11C3AFE0D38 jamarestrella
1,666,276,205 *AF53DED9E9E4948D4EEE5708A6A468CF5D6C29B7 ANJUMAN1212
1,666,276,206 *AF5FAF4BBFDECE1D0A2C542D1023D1E84ED2A180 ANSIJ
1,666,276,207 *AF5E28309B0FB6B4478136557C6AE87AD75C8657 ANTONESEVERO
1,666,276,208 *AF5C7489702CCE5DC4463F6D61964C8BF55AB4DB jarrettdahlka
1,666,276,209 *AF5E043823ED904FCAD49F9A4162241125F82EE7 AN_UB
1,666,276,210 *AF5B160891FDADBF5ABC0B10900F92AA739B41B8 JEAMBEAM
1,666,276,211 *AF58237741E41AB4DDF0418A26F5D0DDAD749895 APSO&
1,666,276,212 *AF555004900552C67CEA6EF5F3F8409D107BCD0B JEFFERSONTOTHEROW
1,666,276,213 *AF511B54E465304DEB2EBB168459D23D0DDF1B40 jeffgala
1,666,276,214 *AF55C77CA8325EE10841EFD20D025E72266D21A7 KITERJEDÉSBEN”
1,666,276,215 *AF5687C291F3A8AA9F89299625D7C30DA7BB3438 [email protected]
1,666,276,216 *AF51AB34FF203B64E39F222F965809AAA1A5569E JEFF-SCORE
1,666,276,217 *AF5EE0678113AE7EB4808B9BA3FAA0DC1C78C1BD jemco
1,666,276,218 *AF52D58DAC0D4AF3A241D28D579B7CCB7FA4D11C ardenfiorilli
1,666,276,219 *AF5B161D16056368315375C3B3AEFDEF25BBDD15 KOMBINATIONSTARIFE
1,666,276,220 *AF51704575DD1FDC96F4CD0FBC2E19BCD0A4DEC4 JENNYPENTLAND
1,666,276,221 *AF5749B798D33061AE1904C4A53F4A157EF01F08 armandkunter
1,666,276,222 *AF58BDF65E77E5A55224011891496D563CA5FFD3 ARNOLD.MUSTARD
1,666,276,223 *AF5FD9E3FC407DEAD03D6EE0D8735863C048F2F7 KOREY.MAISONET
1,666,276,224 *AF59DB74114682FEA9D7C74FE5298B49EB81CB36 arq3k
1,666,276,225 *AF5A0F38F22A86CE1BA008EF20488908EA0E7B33 jestprooves
1,666,276,226 *AF5F518034119F07D2554F73B38C2E09F06D3401 [email protected]
1,666,276,227 *AF55B798E2E2828B1D5EDE13A002E561821E412B JIKANTEI6
1,666,276,228 *AF55261D9C977D5AD17F8013B59BB7F68462841E jimmiebaggenstoss
1,666,276,229 *AF5CA1BF959180AC2539D1569A39FB09FE642AE6 jimmyocamb
1,666,276,230 *AF5282D1AE3EA8EE4B058DFACB11AA0E8D0B2365 ASDXCBBS
1,666,276,231 *AF5137D52EFFBFD6E2277C8FB4919E8D21910FE9 [email protected]
1,666,276,232 *AF53B3ACF2B5F46FD5E7B6925F85C28691435C9D JJ-MATHEWS
1,666,276,233 *AF5EF9DF216D3CD698EA723ABA70446F33922FE8 [email protected]
1,666,276,234 *AF59241EFA413C396D2D79472246D46AFFE8743C LADOMBOLDALON
1,666,276,235 *AF50886480A9917527420B175C6DF39FB11751A3 JOANNROGERS
1,666,276,236 *AF5B1694A7E0FE17FF4D98ABCB03349C9E650BAF A.SRC
1,666,276,237 *AF5F790A0CF2C9A1578A17868E374084763C4BAA las abaje
1,666,276,238 *AF51C2A3725C78CB79409EBDFBCA42B8CA610F24 latitar
1,666,276,239 *AF57923EE5777A50EFDE543FAE2A79697FD41A6F ath.e
1,666,276,240 *AF5133610660D8F3F3E595A6A98E75B8D83A5933 LEEEGGERS
1,666,276,241 *AF5A41D25096BBA2CF0B4E2C082B22B59E97B928 JONESYS2
1,666,276,242 *AF5DA753F0C9D2259CBC14895806EEFE084001C4 AUBREYRUSSO
1,666,276,243 *AF51F20BFF0A2F723D3ADC0FEE04E38E549181AA leishpositivedog
1,666,276,244 *AF5A35C7F86E6F59E3FEFC501DD05AFE4B67798A JOSELOWN1
1,666,276,245 *AF52661207A60C788C4AE81C462F897B3BD60566 AURBF
1,666,276,246 *AF5537740DF07AF016AC38F6581874230953C756 AVANDERAS
1,666,276,247 *AF578F19357AD327E887F0A7751E383C766BE650 JULESJACQUEZ
1,666,276,248 *AF596F79AF34A0BA7866F602EF426E1A0BC9EC8B JULIOMCELLIGOTT
1,666,276,249 *AF56749E4228AE6DF22B840C62EBCBFA4F687CC5 JUSTINMERK
1,666,276,250 *AF5962B64D1CAFB3584A7DAC72408CE667355A97 a:wp-
1,666,276,251 *AF51F5FAEC8E99AF901C066D57273143FF1A0D5D ay%p!
1,666,276,252 *AF5C766B0F3F4FDE417C3D5E0808654C7B4678F9 K0Z.
1,666,276,253 *AF5F7A2F1AA19D321A41557118EAD1BCB2095299 [email protected]
1,666,276,254 *AF59224E32748C2DA8F9DB043C6568034DD169C8 LIDA-VILLAMOR
1,666,276,255 *AF590235BDE27809B71C22B8AFF87CF4E33C721B liederohneworte,op.102no.1emoll:andante,unpocoagitato
1,666,276,256 *AF5A34B3A016FB647DE99BD5ABBF40617794E546 kara.r.antle
1,666,276,257 *AF5F1229CA60E50EEDF5FE1FC65BBF4B9CB61FAC b1llyc4n
1,666,276,258 *AF5035EEFB513E343B12934B6BDC89E91CEEAB46 LINCHAZHAO
1,666,276,259 *AF5B2541C0B82167D4F3E4E0A089F5B9954E883C B4%Y
1,666,276,260 *AF55F703A5250253002D2C7BBA9D10C39E158619 katieonill
1,666,276,261 *AF558200E1C386D379CFC5E5259EDED02082736A [email protected]
1,666,276,262 *AF5CB80F171278792BE593D8B34B3731AC809AA3 babeassej
1,666,276,263 *AF552C1E265EB5B8B912555A619AA8746482A156 BA(BU
1,666,276,264 *AF50376D2B7A457373538742806F6C5D27C65453 [email protected]
1,666,276,265 *AF5D689E0A4DD79B46E05B8B9E146BA1B04E95F5 [email protected]
1,666,276,266 *AF5DEB25F40C33699DC0535FF263A3DAB6F6353B BAMBOLERO8
1,666,276,267 *AF57E79251D1B60E60D5BADB50FEDAB5453721EF lorenzopanzarella
1,666,276,268 *AF5C0036EF1EC410904BFDAAB0C767FA0D9F9A0A BANKKANT
1,666,276,269 *AF51DAE5BDFF12FAC9F8BF6F44995BC47C21731A BARAKKARNI
1,666,276,270 *AF52487E1DC578D78E2DBFE47F4A944F1F99A3E7 LOUIEZONKER
1,666,276,271 *AF50AFED14E7801111737E4B805B1CE71E92F99F bartbrim
1,666,276,272 *AF5DEF1F45543AFC8F8907104B483632546A6E2A bartbrummel
1,666,276,273 *AF58692B7C46C85E6C9C39AFA00717E52E002280 BASILISKE
1,666,276,274 *AF5232642246FE47D5D2A712287292CF89B8A909 loving,sacredloving
1,666,276,275 *AF51E7EDA3449D5A8C05FFD2DF3B1B995BDF37A3 [email protected]
1,666,276,276 *AF571707AB96CB0BD6BC1AE71DB320E05775E6D2 KKUBRAKOVA
1,666,276,277 *AF58A2D13C5AB92D98CBCABEAC7B6BCEB47DCDEF KLEESPIESS
1,666,276,278 *AF571796ED623EFFF3607F9AC189D8C88C10AEC7 bbrh_
1,666,276,279 *AF55C3292E3A3BB43AB0F7D237EF775F8B667BDE BcM
1,666,276,280 *AF502C997DE93AE1AB6F32DB2F43C5DC48DB2467 bcnj/
1,666,276,281 *AF5AFE9BC1476B983AC2F739CF72DA3F05C3E950 BECKIEPINCKARD
1,666,276,282 *AF5B98050DD706D5AFB67CC140D8D3D61F4239C6 BEDINGEN
1,666,276,283 *AF507EC2A7B9611661DB643452DB9E50AED45D72 KP]]
1,666,276,284 *AF50558BB7AACB04BDADEFBEACC508E157C6622E KRABSID1
1,666,276,285 *AF590C5876502DBD1A7DB412D1A4BF300AB499E0 BENJEYH
1,666,276,286 *AF540A512D21BE5688F1BFBEBC00FF3A998A47FD M5821971
1,666,276,287 *AF536B88B9B22DC54E6885C34AF90EA0081C32EA benoitpaladin
1,666,276,288 *AF5DEDC9B82E7D88B692F03D9DDE99E9F2320858 BERRYFRANS
1,666,276,289 *AF546D47680DB3491FB272B6D375829F1AD0D52B BERTNUESSEN
1,666,276,290 *AF5202EBA785E2F68B1F2A8D22793A00BE3E1D08 KZOYENXAED
1,666,276,291 *AF5883A8EEB1546DE053769E9C62C5ED6F82667D LADENNIA1
1,666,276,292 *AF559CE10D17F4272F5F57191330D36B604113DC MALIK.PITZEN
1,666,276,293 *AF5927ADD55CA391E6A91E259352717F739C21B9 BGEHA
1,666,276,294 *AF549339169353E1F9360C07E9F78385D402FD92 Bi(7
1,666,276,295 *AF5DBB7F55A513399490B58C6D22DD06261D4670 BISKOPSBERG
1,666,276,296 *AF52EA416ECC340759BB7882C6EA2DE73DD49208 martinslobodnik
1,666,276,297 *AF5104288BBC13EACE57452A77B8C019ED851B96 lanedelpriore
1,666,276,298 *AF5FB10DD28F30801ABFCDE06AD02A36E669021C lannybradtke
1,666,276,299 *AF50059C454539A02C9FD7EFE0F22A22124764AE LARCH.BERLIOS.DELARCH
1,666,276,300 *AF53DC017C49AE131673712D9A02240E55B65E63 bjxou
1,666,276,301 *AF55F32593AD59B87A2601C2B61B94A903FE8852 LAUREN.LANESE
1,666,276,302 *AF51BC8C7333293482A4DACC794267038028A04A MATHIEU62138
1,666,276,303 *AF547F8BF1D4F0961ACF606F5AECD4D999CABDFA BLAKEDESROCHERS
1,666,276,304 *AF5050A2A0E2A66C13D88931208A9CB5CD01BBB6 blanctape
1,666,276,305 *AF5A26D7F95E4DE0D547BEE01DB492B16DE44B2F blowcocks3
1,666,276,306 *AF5C2A6073CB5676237A8EA4D1B94F958BAADDF6 maynardsimoson
1,666,276,307 *AF54DE82B8A55A519ACD140ADD7F3B72EB1294E8 bm5
1,666,276,308 *AF54984BAE471833E8B1A07AF2CB301C6A263D4C MDOMINGES
1,666,276,309 *AF5AC989E69985E1EEA9C306AFFD1598AED360FC LEMUELGSCHWEND
1,666,276,310 *AF56D62AD0D9FB52B151CBC4C121A49B4359E282 lena353
1,666,276,311 *AF5CDB03E9B0E00C2F8D2DC18E3E55D1FC86632E LEN.CAPORICCIO
1,666,276,312 *AF5818FFBE940CAE17ADD9E014CF33F23AB60033 mel4317
1,666,276,313 *AF580F6FD0242A2C69D225BED8D3F9F98EF1212D [email protected]
1,666,276,314 *AF597FEA71F8918C2B033C100FD3537752045EB9 BOBANDLOIST
1,666,276,315 *AF5B03FB3D2C2DDF02DC0276F96EB32578F19AC1 BOBBYHEMMERT
1,666,276,316 *AF55E70D2053DC7ACAB8AB2486C816A251FD7CCF [email protected]
1,666,276,317 *AF53F89B8A1C4A113F11C1BFC53167290DD491E5 bo:&i
1,666,276,318 *AF5581D57DAFD7CA50F4F886A9DCDDC51D3FBA6E LEOPOLDO.SHANNO
1,666,276,319 *AF5CB4FB0999ABA73B50CFB68911CE02D495E897 LEROYSWINSON
1,666,276,320 *AF5F7820A4C347AFD3917A7FD6F1866AE2BDCE1F meracareerguide
1,666,276,321 *AF5E3CB5AAB8507B7B434AF01963CFA690221FC0 BRADYWIENECKE
1,666,276,322 *AF5A4E24573D41B9B194B3576797E5A0E6E29D88 brahmának
1,666,276,323 *AF5B21AD018CB10160A1487BE2AA18EF011AED00 BREALBUTO
1,666,276,324 *AF54A896B1572F383F916E954F69681AE0874DDC LIBANDRO4
1,666,276,325 *AF5BBED0F579DAAADA16DAE330E37BD6D177AC4A LIDIJA.VELKOVSKA
1,666,276,326 *AF5583DA3788FFA2AE120C5E56637CC746104A96 MICHEALSEQURA
1,666,276,327 *AF511623865246850BBF7BE39B3B7A0CC80D8315 BRIAN-ZILER
1,666,276,328 *AF5A19F30E41DB0457ECAAA734851AC98A42301B [email protected]
1,666,276,329 *AF597690ECB437293DFD8DE5EC6B0490E9410CC9 Brijnpomp
1,666,276,330 *AF51B405CE91C79F8A365484AE94EF7359701778 brodie-warn
1,666,276,331 *AF5CE72F098700203CA188B55C6FF856D402E517 lionelstaum
1,666,276,332 *AF5E01E32ABCE8C39B1DAE2A1F7E7D7FDF3A5165 br:vq
1,666,276,333 *AF54EFF58F4855BC8BAB149ABA3B998008AB7841 b"tie
1,666,276,334 *AF53D0E1CDF42B578894C4B5AA34D1129634E821 MOHAMMADBAGAOISAN
1,666,276,335 *AF5F10F2479D1A1B62E4307D6B8B147C468B74E6 LONNIE.FAXON
1,666,276,336 *AF59AAA3BC1AEABBB7B9765AE689FDFC8C26DBD6 lonnywyer
1,666,276,337 *AF5B85EEE790B0A5D61F2D177AC0F7EDC889E947 LOREN.CARBACK
1,666,276,338 *AF524CA02BCF0A4EB0BF05D3DE8D369B57F8AD51 MONKEY#6
1,666,276,339 *AF57FB6F8A07EF7C8373EAD93D9E75874DB3C76A montana-sextet
1,666,276,340 *AF5B2A1EB7E10E197CBD3B44E6C43EEC407F877A MOONFACED4
1,666,276,341 *AF5CCF246C1F105E0D185D8EECFE3366F3D1863D MOSE.SHORETTE
1,666,276,342 *AF52FD0947AD88CAD0D928A4FAFE19273BB70AAE LUIS-MERCADO
1,666,276,343 *AF52DC24C192E5FDC0F0FC51BB4A00BB1E307075 BXZ/
1,666,276,344 *AF5529A494C241893F9F98E8BFC77EC8190D38FE [email protected]
1,666,276,345 *AF515A5ED387F9EF13D3FFFBB407071BCB016BA9 msftted
1,666,276,346 *AF5D0C8A260EE2B5A9CFA7003669D7D2E77425A9 MUIRIIIVESIA
1,666,276,347 *AF5A6ACE3E8BB19589E95E5001E3879547F4DD41 c17sy
1,666,276,348 *AF5F59CF7C602BD0FFABB5340AB7F2B71EA92942 M1E
1,666,276,349 *AF500DA69B8D5123F4B97F3D4ADACF0C1FDDF4D0 C6AI5
1,666,276,350 *AF5C173AF2374127B5CE044DA1B6CB4DA8EF262E MAGGĪDH
1,666,276,351 *AF544C2885124B95928A77FB4DF8C40CCB68AE5E NATHANIELPARMANTIER
1,666,276,352 *AF52F8798CFA67F7773AC82C9FB545C4026F2B11 MAHAMON3
1,666,276,353 *AF553C81CA2A4ADFAEEE8A742E0826E18937D759 CALE’S
1,666,276,354 *AF58F63D2620E42E963703562CEDCA5E3B23304A malteseregistered
1,666,276,355 *AF5FE9ED71ED82FD420370E1EF821CBA86D5530B cantando
1,666,276,356 *AF5E8329B1D8A66F3514EAE0A51F5ACB3639444C nelsonhaimes
1,666,276,357 *AF5B8F9B5C2456CB43E4AB4290B27686349070CD MANTANDORIAVICH
1,666,276,358 *AF565B00C5E2AC2209885212285805BF9D897204 CARIBBEANSUNSETS
1,666,276,359 *AF5A19E4FBEE360451CAC162D8D317963C69A484 CARMELATRAJANO
1,666,276,360 *AF5C34AFC54EBCC73764077DC666F04D170122CF NGBING
1,666,276,361 *AF52418B2100C8E2C9CCEB5D41F5C1E3FE94C981 maria-andrea-perez
1,666,276,362 *AF566723B6D4DC81A2626D23AA44D86D74101F76 mariaisabelmadriz
1,666,276,363 *AF5C2F9EFC68AFBEE582DE8D56E0ECADDFA57515 NGUTSCHEWSKI
1,666,276,364 *AF598EA78AD81C58D5782B57F2AEA21725F86812 MARIANOHEPPNER
1,666,276,365 *AF55507C4112B1EB2060BB846667936FCCB97B89 [email protected]
1,666,276,366 *AF524B6BB9E781CAF23BFEF4E18F565AE46F15E8 CARROL.JARELS
1,666,276,367 *AF54317191A805285104DD18ECB2028E17D231B2 MARIETTA.DALE
1,666,276,368 *AF5F99E3D59337EFA243100B62C9F1AC24510236 CARROL.SIPLA
1,666,276,369 *AF54B0743D388A6D93367EA5CDC56ACE05483168 MARIOHANSARD
1,666,276,370 *AF51F61BC5D696D2BBC80F190488A8D585F0DAFC marjorie-osterlund
1,666,276,371 *AF56599CE462034CF95190E95BBF31F0B0F617A6 nicklaumbach
1,666,276,372 *AF509AFB9137DEF37CB1AC4BBF1B15BEC231523E CARYSCHIANO
1,666,276,373 *AF5AD87A18059F9863078AE7FE46A02C4120340A CARY.STRINGFELLOW
1,666,276,374 *AF5648465C9BC82D9179E1749365DF2A8E08224F caseybison
1,666,276,375 *AF5DA55ADD351EDE937A48C85EA54C3F5F216074 MARKUS.PAULO
1,666,276,376 *AF512603B836A9A49B2F224A1278DCC7D874DC11 casey-manwarren
1,666,276,377 *AF5BF50C3BF3C72381DF0111F144414BB674C71C CASEY SHEEDY
1,666,276,378 *AF59C476E4CF9726682DCE4546FE18CAB2D92DB2 MARLON.EFFLAND
1,666,276,379 *AF5052B4887DD3571C36E1117D908DE1ADB321EF MARQUIS598
1,666,276,380 *AF5F25B3C2222C0C4CD6D363C0021D116527328B nida.sheikh
1,666,276,381 *AF555DBF1B597835C9DCE0C04DF4320AB2CFDF00 martyleeson
1,666,276,382 *AF521295B4F09354B3DD5CCE638276DB8527FB4D NIKICALLAGHAN
1,666,276,383 *AF5AB3887CCEB0311DAAB3446358AB26E2BA11E0 NIKKIRIDLEY
1,666,276,384 *AF5B24071E4C695DB03A2A31B54932B5C36925C5 NIPORCAM
1,666,276,385 *AF5050B4FDDEA19E75265C1BBEE65AB10D3FB3E9 CCDJ
1,666,276,386 *AF53D856F394A3A2EC4377C9A34BE41A1C1578AF cc"pq
1,666,276,387 *AF5B6EE68B149155342C0C632CFA064C538FAE42 [email protected]
1,666,276,388 *AF5A11BBCA4F88EDC2BE50224B1DB6A9E0B76E04 max.kalantarov
1,666,276,389 *AF5A985F02D61AED01BD38137D3468700ACD10D6 cdux:
1,666,276,390 *AF514CE831AE084C898E3A84C61A96D0D37E55D1 CELLOSUITENR1
1,666,276,391 *AF552364A0B3A58206F35E4B788DFF86255D4BA0 NURIATI
1,666,276,392 *AF54BD7158C1CF6850827C5D71F8E7077A683622 MERONIMI
1,666,276,393 *AF5962FB6D6DD3ECA878707FCD84C3A0CB65B40C obtenebration
1,666,276,394 *AF50667BAB0487BBA2F14B65FE0CC1A88766BEDA charlespawlusiak
1,666,276,395 *AF57FD5A93083BAF61C16B0FE761C72DF6F440E8 chastyses
1,666,276,396 *AF5531989115EE8BA0D29D0B40F7AAC6086ABAB8 CHBVY
1,666,276,397 *AF58CF7F37F305D81F7B95ADDF1D75FD562B00BA [email protected]
1,666,276,398 *AF57953B4F99921B4244D6205A5DA6E25C7E5725 [email protected]
1,666,276,399 *AF5F2FA8A5015114BC19FA00E83472FBE43D1CCC CHERRI MCCULLOUGH
1,666,276,400 *AF582D8DC2D10C6F51963AFD0D3F87E0E9C959AB MIGUELKIVISTO
1,666,276,401 *AF581D1EEF11E19B25CEEB881195618FF6F7688C CHGUU
1,666,276,402 *AF560FF597BE0F55FB91B45B468046DC2D176047 ONI\
1,666,276,403 *AF5FFF3D868E2A92B0DABC08570421E763CE7D1C miniproblems0
1,666,276,404 *AF58102EBCB42C0422B8033A0B409CE9529A168A CHRISTIANMAYEAUX
1,666,276,405 *AF5BA5FF44505D6B1E05CEE184B85386DB8C56E9 CHRISTOMA
1,666,276,406 *AF57E29FEC4A412020FBD1A55F0BE37F40F06E35 [email protected]
1,666,276,407 *AF508184C3D4A0B53FBCF5C5B73A17475672681F OPERATINGSYSTEMSTAFF
1,666,276,408 *AF5FC15EA19E606C6A81218AD48A544D5B832538 MOHAMMADGHAOR
1,666,276,409 *AF5287871D7352CC145A28F8A74FD7E8AAC9A44E MOHAMMEDBEEGHLY
1,666,276,410 *AF5F8D9D904229D3E87D2A3CB52AAABDA1AC8121 CINORKGC0
1,666,276,411 *AF553A78BCC6817C134C65A9117B5F1546CA45ED ckhsl
1,666,276,412 *AF56444C75828B69DFF65C2F2A01310228A56EA2 MRCRAPPS
1,666,276,413 *AF5062EFB67E3CD00BC215D11BCACFE233D0AAC3 overjoegen8
1,666,276,414 *AF5E5625D68CE1E0A73AC29F2A54B689B4C8694D CLAUD.GROSCLAUDE
1,666,276,415 *AF536FD263C942C9F1BE5EB40D944F769E44D369 MUKWAR
1,666,276,416 *AF5528F3526430913BDC7BC6165910775B1846F0 MURRAYBAYTON
1,666,276,417 *AF5936442503D8F13ADA1E351D12770E4631EF7F CLETUES7
1,666,276,418 *AF5D284FE98CF49F05CFE3E735B58182D6C565F4 [email protected]
1,666,276,419 *AF50BD7A428141A679B17280B7612B87E6B851E8 MYLESSCOTTING
1,666,276,420 *AF5A67D57544C6DABB42F3339550DA094021126C CLINTONTESORIERO
1,666,276,421 *AF53B4F08B19A24D2BB7C2DB899B1B0771169D37 C?LK%
1,666,276,422 *AF5E3DAD345D29238E4B1A00361534F50C876414 MYROSMA
1,666,276,423 *AF54B93A2E31912C0A0CE8FAE8678A4698510CB3 [email protected]
1,666,276,424 *AF5805CF3062BFFEC5033E79804459F7B0AC85DF paresser3
1,666,276,425 *AF508331D5A4033AA147D219B914BE5961B03897 nancy-yvonne
1,666,276,426 *AF5CF7F7A8BCA193D6E6FE7F890D5A8B5F5D9D23 cnlag
1,666,276,427 *AF59318D23478FA42B6A2B6CC9A73C39DED01E75 NCERCITL
1,666,276,428 *AF5031E4F0476643624A87D63C5BD9A04C115EA0 nealkarmazyn
1,666,276,429 *AF5E33838824B53F2FE7A7D9C496F8816CACDF5B nedzacher
1,666,276,430 *AF5A361D288EA14F0E2BAAD7FD0AFD9132776FE6 NEFORMATIONSFESTE
1,666,276,431 *AF531840EA65589509B210D255CEB9FD692C09B5 CONCERTOGROSSOOP6/1INGMAJOR:ALLEGRO
1,666,276,432 *AF557A028B65D486684E19D889AD8E4E02B93B4A CONSTRICTORS
1,666,276,433 *AF5CDD2A2B12ED54F0C3C6A105385F3B012FA5CD PETER.MARKGRAF
1,666,276,434 *AF53FD40AA5A9569BB6AF427F548EA9084FDB5D3 Petite.symphonie.concertante:.III..Allegretto.alla.marcia
1,666,276,435 *AF561023E96787263EEAA4AAAED2F8EDB7973D4F NICKOLASBAYLY
1,666,276,436 *AF57BE4B219B15A2F5C0554DC17115EED537278D NIMMING7
1,666,276,437 *AF5616250FED2E892C298840F7FD30771B2CD1D4 covisited3
1,666,276,438 *AF5D068DA4C328C8FBD6238CB17A97E5CB270DEC CP7M-
1,666,276,439 *AF55489E17635BC02B845879BECA28FB86F0A75A noct4mbulsm
1,666,276,440 *AF5295C5BD3CB378E898CD47BA3034D9908C6402 CROTALIN 'KR/OU/T//L/I/N
1,666,276,441 *AF57AAFE284F5CCF364363DA0A19138AA0912FE1 [email protected]
1,666,276,442 *AF5EF69F4F79DFAE70FABF1F161D49C525568F24 POR2000ANOS...
1,666,276,443 *AF55068479B32B8CA57BE9E3EA861F048EEE9E9F NUMEH
1,666,276,444 *AF584509ECE4477435219CA7D93FE159A45BFF8A NY-REN-6
1,666,276,445 *AF5EDB6824F259A425BD79B6E5CDFF0B5718895C nysez.sez
1,666,276,446 *AF5DD0923D7A43BA2BC1BD9793528B9006744C4B cruzperr
1,666,276,447 *AF5BB528EFD068DB9A9FFAB2988D3135EF8A6432 cs(45
1,666,276,448 *AF5790AB2B4482ADDDED42A4B2D6934156038D2E ODNBBAX
1,666,276,449 *AF5A9DC3F178AE4FBFEB7A117F93E41645A51B86 oetans2
1,666,276,450 *AF526F9A361B105A9D5CBA3437CA1D32D6E977F5 [email protected]
1,666,276,451 *AF519EBC3A2ABD4FF9A0B181C8B1DB91D391657F OLYMPIAAUSWAHLSPIELER
1,666,276,452 *AF5E2BE0B3972B93669629474C973F246CAFAAF3 cv8sf
1,666,276,453 *AF50563907663D38A0060914A4EBB0F1F673D3C3 PRODUCTS.RESEARCH.&.CHEMICAL.CORP.|.UNITED.STATES
1,666,276,454 *AF5803CC574DC96428230EA6B2FE86DF58D34B01 cv:ih
1,666,276,455 *AF5E468ABAD2E23040C4A9892A1043C467FCC7F0 pulled-it-off.-Today-a-joined-hacking-group-of-Polish-and
1,666,276,456 *AF5DC0D29AD4DBBC1A228222143A55DEB3639DFE O->-<~ ~ ~ @###P
1,666,276,457 *AF5E8E86F40A4E143847D0AA3B1E16FF47594A1C puteri-zarith
1,666,276,458 *AF540BC6571BAC774DB4A370E0D707BB4A5C514C OREN.COSTANZO
1,666,276,459 *AF5FD7EEA1C7A4E034E9AA21F1BC708AFC85A8F6 cy"cj
1,666,276,460 *AF5179A4781568C3061AB6F0CBE2E3480DD5B86F cydo
1,666,276,461 *AF567BA222ED9E7B3329957FE658108311B1EDA7 q),g
1,666,276,462 *AF55EA19D0F5724C45E212BF7DDDE98480948A0B d%4qo
1,666,276,463 *AF54D45C691897349EA610781AE195BE94C74D32 d5njo
1,666,276,464 *AF596CCDC67B1139EFCAA97739984C2D107E3253 oικογενειακή
1,666,276,465 *AF5D75BE655A30F6F3BDC3F6006CE811FBF2DA1B QUENTINTWINE
1,666,276,466 *AF57F8B3C73FB3D79C442E0ADBAA4D7669FE5A34 QUINN.BEVERIDGE
1,666,276,467 *AF51227C94442C4B5E82EE7BB5E782302A315129 :p0~(######q
1,666,276,468 *AF5E2025B06BF09B4248E3C0AFE569436E38E1BB QW002
1,666,276,469 *AF545FF22EC1807245D204A2A5EECBC14BC89600 DACRYOPYOSIS9
1,666,276,470 *AF51B5AB370E2AF9EE4834932D737E272E3500BA [email protected]
1,666,276,471 *AF579A3752C23D36B40F9F05054CCB17AA675344 DALTONMAGOON
1,666,276,472 *AF5C28C0C5E03B21E84778744643A36E67784476 RADHESHNARAYANAN
1,666,276,473 *AF5F493AAFDA61D7585C424F8BFD92A92627B1B4 RAGMAGS9
1,666,276,474 *AF555DCB865277DBD36FC59DC09A318F558E5B9A RAJESH.FOTEDAR
1,666,276,475 *AF5AF4D6051E52A8AD7FE6F55A2551F31EDB5766 rakeshwar
1,666,276,476 *AF5F14B66D6073D4C83069C803DC615083434E9E PARKERFEIL
1,666,276,477 *AF52256533D936ECBE47D55BAE5C5F8C5B70FA80 rambo1#
1,666,276,478 *AF50454E481AC1304CF9DC0936558B9694AC2337 parvrustagi
1,666,276,479 *AF5895503C8EF4DA16B1BB4B447ACDD64E6FC5FF PATRICIA.DIVINEY
1,666,276,480 *AF5140556B6AB0ACF2C6ED7650079B16FB62C488 patriciamentis
1,666,276,481 *AF5337958A85B09AAB5600A33ACCA65D749255A4 darrickcatan
1,666,276,482 *AF5F83A6D0D714695A413F4E7BAECFFF8B7242C7 DARRYLDERICK
1,666,276,483 *AF5C2739FD519E89770605ED01C41914111B96F6 DARWIN.GARDUNIO
1,666,276,484 *AF5CD3ADE21AB8E0BEC871871E6D653ABE9CD159 [email protected]
1,666,276,485 *AF5EBB8BAAABA871CA642CFFBFDC3F46C1F5CF09 RAYMIHAILA
1,666,276,486 *AF58BF86DFE276036F07B82C023F7DAD819B1086 PB.*.*SPLAT
1,666,276,487 *AF57BE58B84347AA8F66F25C1BFB79A21D85473A DBTIK
1,666,276,488 *AF552EA5B046928A762BFE481CDDE94BB3C5132B dcm9w
1,666,276,489 *AF5939DAB760AF8F9728D24AC0052FBDBA282603 REFORMATORENS1
1,666,276,490 *AF5DBB55752F41259A40971C5AD7C8B606021897 PERI$P0ME
1,666,276,491 *AF513BD13778B70687A2FD13FACB176C2D506691 PERPETUA85
1,666,276,492 *AF5A4F3D0326547D926BC0AC86A3D47C44B31BA8 death's.disciples
1,666,276,493 *AF5EEB8D723A4F5924B0D954861AC5D85AE43413 DEC1769
1,666,276,494 *AF5F24DBB6218CF99D6474F4176FB6AC806915BC DECRUSER.
1,666,276,495 *AF541B77CA9B59F17D155D1D30B8805D8E0FB1B3 RENRETSEWDIM3
1,666,276,496 *AF5AD99357A688FB4BF304023C0051DFF944CEAE PHSPRSK12NJUS
1,666,276,497 *AF5DE236ECC84658C0AD989D2FC3D5CD5F1F6BC2 delmercrusinberry
1,666,276,498 *AF59D5EC5E6E04F7BD12C729C0CC1E87AA79F4F6 RETRACT;-REVOKE;
1,666,276,499 *AF53CBAF55AD0C4B32C9EDB6A78701C7E813407A delwalcutt
1,666,276,500 *AF5696A48880FCA639244296F641E6F99EB1982B PIERREWALDEN
1,666,276,501 *AF5B7E752EFB213AB077C10646B15CD96B08404C [email protected]
1,666,276,502 *AF546E2EA5986959CEE76DD8C4F5BCC8421263BC DENNARD'S
1,666,276,503 *AF5B93CAA89F16C61730DBB934E278FE2329FB01 pisatdeom
1,666,276,504 *AF5461BD4325BF92D61836C5135BF562C2DA652F PJ!D
1,666,276,505 *AF575DA65B6A3A1C2FB95A72921D58D551C48CE0 rheophile.
1,666,276,506 *AF5916801D48329AF872E7DF4CC09D520D5AD51E DETIVSSEMOLA123
1,666,276,507 *AF5CB2C047B69F01B60F6A9DA39DEE083DC1E3D4 deue
1,666,276,508 *AF590EC79D3DFDD48381A053DC657AFD569D60BA RIMLIGHTING3
1,666,276,509 *AF5F09FAE8627B9160D68A860707AE62DF2F4D01 risiede2
1,666,276,510 *AF5DA1687049210B4879EE3E6754E05D335E7A37 PORTERVESHEDSKY
1,666,276,511 *AF542A4D61BA0784D09B26E548DF529A7DCAA6AF roarof84
1,666,276,512 *AF5016752524E6E8A2DCAEF2724A9DB0D017321C ROBINCURTIS1
1,666,276,513 *AF546378724D7DE5B43BF551AFE12A7324797F5E :P-~`-~`-Q##P
1,666,276,514 *AF52B75378DF7EAC963756F1340C1AD79711C88F ROMAN.SIMOKAT
1,666,276,515 *AF5261FA6F69F5568D6AB85BB51F4EFAF8E8E4B4 ROMEOARZT
1,666,276,516 *AF5AA8024A22371B19878607488C074080EB1637 ROMMEL.GAREN
1,666,276,517 *AF54BEC02DE47D3D9CF04C12B6CD3484B2C3EB51 pramenu6
1,666,276,518 *AF5CF13BCEF71160AEEA142E630F14C2CB42D9F3 preciousjack
1,666,276,519 *AF528F45123AFE32503B2ED7CAAE520C98D9BEC5 rostov-time
1,666,276,520 *AF57A4DB7C15E11C4C414E73CCD134EC3F0A3374 rq;r
1,666,276,521 *AF5DBE4F0521E0FDBB8918CF57598E8A5B8524D8 RUBEN.GRIFFITTS
1,666,276,522 *AF5A3E652C2D408BD9624DAA5201987F99E7F733 PRVSNNLS0
1,666,276,523 *AF5A599A62E4FF7CBEC727BD51EE84BE36BCAD46 rufusunderland
1,666,276,524 *AF542FC887200E616B15386BF86B4626B7281FC9 rujiara1
1,666,276,525 *AF500F4CAFEEF1B92A1E88C505FA048F151B3002 PT8J5AAO
1,666,276,526 *AF5C435D2880519F2DA8501BBEE4711056DE4109 PT8P
1,666,276,527 *AF5D4E27CFB6BC6221067134C930B6EAE9C0766A PUJATÓ
1,666,276,528 *AF5B88435FA62800BFE40538E3CE07935BD21ECE DNYL
1,666,276,529 *AF586DA594A6F597B38FFB0713CDEE1F4DEED490 q####d***:p
1,666,276,530 *AF5E77A392529E4EE37F392A28D90E01896C50F7 QP~~:P
1,666,276,531 *AF5A71E431AF851ECFC9F5DB471E7A823F9E46AB [email protected]
1,666,276,532 *AF594A9E054E80CD07B3760C5049DE20AF626813 DON'T WORRY. WHY WOULD HE KILL ME? BULLETS COST MONEY.
1,666,276,533 *AF58B7E7E8AF9CD09B38A0F134C40A56ECB2DC24 quintonlaroia
1,666,276,534 *AF5B09398AF1FA0D99C34237D3BC529F439BD3AE SAXOVTS9
1,666,276,535 *AF5977100EA4AEF953E211C38FB021E82F2D7A46 Dp:v
1,666,276,536 *AF533AA6C40AD63B90594A783A54B5D989B7123D DRBC4
1,666,276,537 *AF5F74F06C35E6FAAECCAC7B25943F19254382BA SCOTTIEDITTRICK
1,666,276,538 *AF55461DA19C48E001DDD5142126E92A972FED27 randyhusted
1,666,276,539 *AF55CAE6CD2AD6DB0B703DA1660A51B68AB87531 securitymartha
1,666,276,540 *AF54110EF8C456ABDF0A03DE5C92D5A13E4E5CEE segelsyndicats
1,666,276,541 *AF57348463F1CE3D6A42C562D44E6F1F0B4C0B9A d`rt
1,666,276,542 *AF5F3D61A50C5599681DC1E57BADB0CB971147B9 [email protected]
1,666,276,543 *AF5DDB709AD1583837C38AD83F5FA440AA4C9D28 DSYCLDCING
1,666,276,544 *AF58543EF450EF5F78576AE7D4E5DF9F7270E086 SETHBOLEVICE
1,666,276,545 *AF58963FEF70428ED627342030B727BD7278EA2D SETTLE.TO.REST
1,666,276,546 *AF5E6FA2A1E151767A9ACC5332C69EA02BDF5192 [email protected]
1,666,276,547 *AF5D6361C2EE176EFFC1E9A6FD1651E4B33EAAF2 SFEKARURHOBO
1,666,276,548 *AF5CDF7B8FEE94CBB9FC72FA610B19F28880885C dufg(
1,666,276,549 *AF57799E60A7CD941397FFA3293ECEFD45ED8C03 DULIANZ
1,666,276,550 *AF5763C4AEAB7EE290DCA0B170A4F20466BC3B7D DUNCAN.CANTU
1,666,276,551 *AF5F15DECA5A2B0A335296089A1F200A48D8C90D duperiez?
1,666,276,552 *AF51B23C3D3EA98C40F8329F1320F51E93F5676A reformistų
1,666,276,553 *AF52EE3EFE4AB6D3B84CF8EA55C5B689EAEDEEFE REKCUTRETAKS
1,666,276,554 *AF5F741658757137962CE76F0E26C84FC81EC992 DWAINKIRCKOF
1,666,276,555 *AF507CD25C6E82049C4FD3CB3E31E271D11BAD32 dwaynehayth
1,666,276,556 *AF56A0181AFBCF635098A3267BCF3F4298E2013D RENALDOSHANNA
1,666,276,557 *AF56E9853685B07D2BF7CAD8C6014CC7AE756EC1 DWUALFREV2
1,666,276,558 *AF534D875A08078E85ADCB226B54BFF0163911C7 SHERMANPENADO
1,666,276,559 *AF5B62EC7F6907268B7028F859CAF548776C567B RENEE-MCINERNEY
1,666,276,560 *AF51B4AAD25CA8339CF73CAF86EAA9E6998BFDBC RENETE
1,666,276,561 *AF5C30C68455BC47727609C6F3D193818981B4AC RENNMARL
1,666,276,562 *AF530794ECF80E1E9609898760A05AC0385D564C resuperv1
1,666,276,563 *AF5F98C9CCCB7E8D07C6A5680AFBF57EC32E2DFE SHYRANDA
1,666,276,564 *AF5544764956FF8D0ECEA07F9E6EBD67F97AC490 rhtr
1,666,276,565 *AF504C6B815047ED1A9E7BA1D07E678BF23C1D6B [email protected]
1,666,276,566 *AF504A6C35D214CB08053E921332FF303564C5A4 SIMATIOH8
1,666,276,567 *AF523259085FAC47CE8C6D6EE725D364DB43479C SIMON-CAROLINE
1,666,276,568 *AF52B9C719B067CEE09E85B6D6317D1FDE24AA07 ridzuan-mohammad
1,666,276,569 *AF527A49FAC17EDA9BA6E8C829EABF8D4D1038A8 S'INVAGINANT
1,666,276,570 *AF560B7D20A70531DC180BEA30E00E2EAFA3E4E6 rigobertomemo
1,666,276,571 *AF5B067C7566C74E5F098909A96E41135FE7826B [email protected]
1,666,276,572 *AF59D158D073D77DBB246793C3F528B8C258ABAE rinakhatun
1,666,276,573 *AF57349D318DD9233060F6F1E52FDA2EE7F2821C rolandbertran
1,666,276,574 *AF51FD3452720C430B1FDA203D98EE172828A8B7 roman599
1,666,276,575 *AF5C1E57452052D33EB6A2BE3989288A79A528D4 Romeo.and.Juliet.Suite.No.1/.Larghetto.-.Andante
1,666,276,576 *AF5C416581C84243E6E4F00936E54D1D4CCA8F04 RONNYHANSCHE
1,666,276,577 *AF5FAC873FACD5D015653F8ECA5251916C4BBA28 EdlaetJankel(featMalikMezzadri)
1,666,276,578 *AF59CF12E401D3D5609AF9880A9DAA59E9874772 EFFABLE
1,666,276,579 *AF54A2387523F43DFCB7EC1FEFD868ED612CDAEB RUBY155
1,666,276,580 *AF56E703DC674F1AE3D2FD2C368DEEDCDFF645AF SMAILLIWYRAM
1,666,276,581 *AF51F8D44793F72AA6E5D30733D32372E1DEC578 EHCYV
1,666,276,582 *AF59C0E6EDF9C753BFE5E078F281EE9DA493BC1E rusquerais0
1,666,276,583 *AF570F23E34F2BBCBAA2610900533E5C58EC0C94 snai1-tr3
1,666,276,584 *AF5926CDB65F32B6EDEDDA3B2C6EA08810AFB8B3 EKLÅNGEN
1,666,276,585 *AF5C2DBB788D40BE3C96FD7C73B21B6CC3C44016 snezana-vukomanovic
1,666,276,586 *AF5A13DED829BAA8758AF3533272959ECBB9AA62 SNOWBALFRANKIE
1,666,276,587 *AF5C9C03747B4BB3C1A4208D5EDA6A8272C3AD2A SAARLANDESH
1,666,276,588 *AF57FD30E32F27767CB038025561CB30BFF836BA SOLUCAR-ENERG
1,666,276,589 *AF566138620635F80554CEC3F99BE174D0662CCB salgsvilkaar2
1,666,276,590 *AF5460FBB78E52134BD89EE51496575EBA3B14E4 salvadorbernardi
1,666,276,591 *AF55F340EC922FFB050F66EC85A7D7DDE0D3B89F sonnypuna
1,666,276,592 *AF5C52F57C1F13561E683950DDF65E537938781B SAMOATALKDEPRESSION
1,666,276,593 *AF516036A41EEFE2B1D9297E7885023DACF51673 EMANUELREUSS
1,666,276,594 *AF5EAC2CFA91C4BB537F0DA7BAFE35B8835C0C22 EMANUELSCHIPPER
1,666,276,595 *AF5F58A08F9B777A9AE59329B5B0D25A32559424 SOURCEKERMODE
1,666,276,596 *AF5A90C3E38926FB381890C966A097649967B9B0 SANDERSTIGERS
1,666,276,597 *AF538DDEE16423F6ED1A665492A7F744E0A76396 SPECIFIST.
1,666,276,598 *AF58C6222A24C9B89EBFA5117FABAD3924E644C4 Spinae
1,666,276,599 *AF56CE2259D911C653171BE3F5E8FF824B105FF3 en7ey
1,666,276,600 *AF5B3411F32D2CD37A7394E4A147885DAD486337 scoored0
1,666,276,601 *AF51EB2E75C4BF8EF3DDA8911786F49C5355EA66 SEBASTIAN.ANSELMI
1,666,276,602 *AF57E04F82875BE8BD732C8412F6CFDF049F9FF4 splat.`@#####p
1,666,276,603 *AF5A1C4D0B7E9C72177896532844D1FEA48B9994 EPSRL
1,666,276,604 *AF5A190772E583AE5BD988F8D720B556E07BB29E SEITZ-STRITTMATTER
1,666,276,605 *AF582B0CD1DFDEB1EA811CA820C5D0A305DBDFB0 ervinschlobohm
1,666,276,606 *AF5AA5A334F22F53EBF56BA52EC5B8F420DA5E6A sentejt
1,666,276,607 *AF5271A8FDAC3FCFBE1BA03FA63D3ABB5EA992DF STANDAARDZETTINGEN6
1,666,276,608 *AF5BC9110068FB164701E45179E635D2F571B374 STANGETZII
1,666,276,609 *AF5B11D02C4B2520C4CE7650BAA87B4D2F331BF7 STARGATEKENNETHING
1,666,276,610 *AF55CD78100435F8BE0EBE958C5B8F16349A2B3E es#xv
1,666,276,611 *AF5A7252D2CB42FD86400085F50EE7051AF26DD0 STATYARAO
1,666,276,612 *AF5781C711F7C6A6E091B779973BAC8AD11EF7B3 SEYMOUR.ZECHIEL
1,666,276,613 *AF513719C1489328581D7A8388D6DD5701706361 STEELERSSUNSETING
1,666,276,614 *AF59879999E457BB0E3D7CCE6C9A002A4462DDDF SGOILTE9
1,666,276,615 *AF5015B581F5EC911A6CD6E600548219902A5347 E$T!M4T!ON$
1,666,276,616 *AF51890392A4940166ECD043F7FC61E6F5B6DFE4 etssafeb9
1,666,276,617 *AF5D9731C750AD243B03D7537D0FA6D9372BB945 shake-down-(feat-usher)
1,666,276,618 *AF516CD475F7144B05C0723663E83E8B13D91428 eup7s
1,666,276,619 *AF5DB69AFCAB3A76AA23EEE59AB73C2626CEA8B1 SHEILA\
1,666,276,620 *AF5AF5BBF83C0344A1A3CC1AAD4AF89341CBFF52 evidrat6
1,666,276,621 *AF5CDF797E1E858D838F0DF59015255B8B7ECAD3 [email protected]
1,666,276,622 *AF5D09A9E7FF509AA411AE5F79671D877D8D51B6 shoeperugia
1,666,276,623 *AF5AFCEBC28C62559339B5195B947A2F2DF64069 EZRABEFORT
1,666,276,624 *AF5A3E7A2CC1CE72E2083C296EC863E194AB6E88 F}_<
1,666,276,625 *AF56E529347E0A549974AF6A88AA7EF75B9F48A0 SUBEELTOCADISCOS
1,666,276,626 *AF52E0DE8F3917A406FE98E5A0AA4E7696492551 SIMBOLEGGEREBBERO6
1,666,276,627 *AF5C3F2B4F0E5E897B443839DEF6295D91BA9100 simonbradfield
1,666,276,628 *AF5D3BC8BBF111ABF31F7777447C7EEAB3E165A6 SUNGHAJUNGB
1,666,276,629 *AF52D711BA3DB06CDEAF075125F721F4DD2738DC farmengro5
1,666,276,630 *AF5D3DF5A007072E961C932886AF0419159695FF sistem1
1,666,276,631 *AF5A809F51852BADFCA95BC72A9E15E69625D076 SKATTELI6
1,666,276,632 *AF54798F2A2B411658C88D49C8362D8B5B30AABD SKATTEMESSIG8
1,666,276,633 *AF511F4E105810A00C5BD8EA1552DCB7724B4B26 superintania83
1,666,276,634 *AF5AEAEA1FECDCA3F860FFB4EB6CAD35CDCEFDEF fawncellas
1,666,276,635 *AF5C03074A904F57A9F7AA6CFF2F07AFC2006EF1 susana-horta
1,666,276,636 *AF56B44B860FEE635A0E597A33A73D9588E4FFEE FELIPE988
1,666,276,637 *AF5C7792B59F345C3AB17F34B8B20C176BC0C866 FESIMORP
1,666,276,638 *AF592CBBDE90989E3DBD80B071833EB790C947FF swillbelly!
1,666,276,639 *AF5A1568BA609A5AFB1D33193497297C94281D48 SWIRL-N:-SWIRLS
1,666,276,640 *AF5D2C076ECFAD27488C031BBDB5C32C54D86841 SNGLVTNG
1,666,276,641 *AF56487D7D6B1CCA75C41C25268B5A8356E0AE76 SODANUYASED
1,666,276,642 *AF5B662D0770B3344F5862236B0BE2C0DD484DB4 sognahced
1,666,276,643 *AF5CDF4DDE292BA5652D56998AF9EFEDFCF8A63B fjerdkhr
1,666,276,644 *AF5EEDD9C8B150C8D11B929EC86F8C45DA189D3A sorry8
1,666,276,645 *AF5764BCEC983063724BBC52365EF15AC1FD3140 TAKE.A.RIDE.(ON.THE.SOUL.TRAIN)
1,666,276,646 *AF532F1125E5826707B5E6EF46379BE45C6F2B10 [email protected]
1,666,276,647 *AF5A221E984127C90CE1590C5B6776D45D5F2930 [email protected]
1,666,276,648 *AF53E0F76F0138CE38BEBD45A7B69E4FEB2C1465 talk648188133
1,666,276,649 *AF5776089C8C6F4C30B3FE1C98A0113940179926 TALKCHANGABANG
1,666,276,650 *AF5F2FBD7A5DD726DC89B5FE8CAD48F408FC5F45 SPEECHDOCTOR1
1,666,276,651 *AF59AEB4B44D9E75F64BCFE34D724B90D6331953 SPEJLGSPANDERNES2
1,666,276,652 *AF507B615AEDD1ABF5D2192BB28974BF6404D64F TALKWANMETAL
1,666,276,653 *AF5DBBF35437CFD4B647CA3BE9CEBA7F0E090309 SPILZUCHTIG
1,666,276,654 *AF52F04FE6CA4DF837C1E4FE4740DF7BC59FC203 TANGLOUISM
1,666,276,655 *AF5CEED3A6721EFF8B5B29C23245D8FF12B41F7C FRANKIE.MATYAS
1,666,276,656 *AF5FB6CB195BD812BC8F7CFE38A398263010FE6A fredmichaud
1,666,276,657 *AF5BFC28973FE96479F71AF688D9A74FB45ABEA4 TARUNMUKHIJA
1,666,276,658 *AF5BFA988D987809918A8BCDD89D01BDD0C801A9 sploit-`d######p
1,666,276,659 *AF5B57D695500169224B871806C74E0D629FA752 [email protected]
1,666,276,660 *AF5B0DEBE7471CB26888ED2A125385109475057D TEDRAVKCS
1,666,276,661 *AF54D3564D56414982139968DD6D47E1BD967D1F FRUE5
1,666,276,662 *AF5F2BB7CDD1FA401EDCCB038A24E6865E23AC38 fuckyoujanice
1,666,276,663 *AF58D095DD244D8DE49BF85E540263B2FE0C8324 [email protected]
1,666,276,664 *AF5F607585A5DFB15BBE56C2609C9691A7D3BCE1 [email protected]
1,666,276,665 *AF58A63B0737A8AF9D8CE29A84A420BA461751C7 g2hh
1,666,276,666 *AF57AD086F209ECBA24788D9B6D9F851DAB2CEFC STANFORDTEACH
1,666,276,667 *AF528FDC6DED562A9A45948A3903F3EE927103FB gainesvillen
1,666,276,668 *AF5E02582C78DA32AD2D128218C9B099E4E8CE70 STANLEY.PIIRTO
1,666,276,669 *AF571C00F0AD70F3D671ACE94513C904030BF172 galenlauter
1,666,276,670 *AF511483342FE21D6430169569AED0C9A062A8B8 stantonhuewe
1,666,276,671 *AF5766DDFF49D5700B4DA95E1293C6E64482C186 stantonmasotti
1,666,276,672 *AF519E1FA8726C8A38272479CCB8DA93CCFB9C53 stantonvaneyck
1,666,276,673 *AF54DC86C8BFAE3746D33EA9E067FB26539FA8B1 GARAAZU
1,666,276,674 *AF5463B40C0CE35FBFDD16D39F0E2A137B0409F6 THADDEUS.NOCKELS
1,666,276,675 *AF5D3A4102B152A49AB40C4180AE8E5B128154DC steam-p1o
1,666,276,676 *AF538121AD5A932541A3B278DD7A0B4607CD9707 THANHMEDAL
1,666,276,677 *AF5E453A1C5D3864ACA29F6DFB08A71F53F46A65 STEPHANIE NEUMAN
1,666,276,678 *AF579FEF9818F3D3AA586B0522603B506A7A42BE the-beaches-of-cheyenne
1,666,276,679 *AF5B934600D92E63100430144C9A9CAFB569D721 THEME-FROM-STARSKY-AND-HUTCH
1,666,276,680 *AF56524A95A685C77DCB9054C0A4FCC315C7A2A7 SUAVE,SUAVE
1,666,276,681 *AF584B1961A4D674BDAE33F6DABDDCE6CDBBC527 [email protected],
1,666,276,682 *AF510959C13C3181E1B50AE9050A81B8B1CA2C40 THEPURCHASE6
1,666,276,683 *AF5A22854141A4432B4C685F648247CA01F84B6D genotsre0
1,666,276,684 *AF5C27123A7E12C412F65EDF54B9AA52C7C39AB4 T'''HERE'S
1,666,276,685 *AF5D00DDB8FEB5D5BDF639B84C3A0695978EFA12 THERON.WISCHMAN
1,666,276,686 *AF5082006F7100D353537CD247A5CEE4DB6CD6DB SULKAVANJ
1,666,276,687 *AF512A285458C11332BA864D12AAA5E920267FA3 sundaynightbuttermilkwaltz
1,666,276,688 *AF5497E5F04D1BF146D57BAA985E52787B59E197 GE$TIONA1I
1,666,276,689 *AF538F2CC43CF83FC9CE0A0E6C53D53FCAA3FB28 GEZELLIGE1
1,666,276,690 *AF58E4CECE83BD31EA1981C4BC6E7223A5C18BFE GH+I
1,666,276,691 *AF557F988DF3D5EADFC4247D460E6AF8B5B51565 GILINGER
1,666,276,692 *AF57C38B6DD073365C6E500AC08A37D0525FD292 Sunshine.From.Mars
1,666,276,693 *AF5E041B01A71E4867EA73B2DE0A12A1087CBA97 SUNZHOUZHO
1,666,276,694 *AF511AABDD533AB701AC07BC02D0CCDDB60D216D [email protected]
1,666,276,695 *AF5A4116B3FB96B834D583F2CF1D3DA09F119653 SXETIZOMENH9
1,666,276,696 *AF5287F6DA8A3E7BB211A6DDBEFAD37BCC72A90A SYAZLIANIRAS
1,666,276,697 *AF516196BD39A7291F80D640F0E15DCE617B871E GIVERIE
1,666,276,698 *AF5C908F95737B39F3F4B6FAD04E5EA6E45C0CD4 [email protected]
1,666,276,699 *AF5D64C89FB8F2AB00A95C9FA28FEFE6BD754A1A TLITSLEV7
1,666,276,700 *AF5307E45989874BF6131E7486C766C893E436E8 $T0RYTELL!NG
1,666,276,701 *AF5F51BC265BE1965AE219EAED9CC0B1EDCD9BF6 TAHSIRY
1,666,276,702 *AF5D7387156C60E89DABB8B15DD49685BFAB3926 TAIGWAN3
1,666,276,703 *AF5011DD8115EDCC8C8153A42FC14CD3FAC02A6F talk83113235111
1,666,276,704 *AF5701C750821A71ACB7195E53BD3A5A54FB94CE TALK96.52.36.106
1,666,276,705 *AF595963616F01DFD3488A9C950D62F808511B33 TALKHELLSMINION
1,666,276,706 *AF57A4DA0ACE190AF8E6E60074308C1A585327C3 GRANTSETLAK
1,666,276,707 *AF5F8528EB4363210D80D92A2FDABD3FE5554AF8 GRASPLESING
1,666,276,708 *AF5F83CC99440A9FF88314F30B0DAF992E05808E TARNISHGRIMLY1
1,666,276,709 *AF580894FE0FF2BD7D5654FB151317EE452C3E08 TAROKOM6
1,666,276,710 *AF565440EF0BADFF7D31BDBFF2D1BB09F2128C5F TOWERTALKBUZKASHI
1,666,276,711 *AF5DE5BE81AF8B52C1800FC68774201C4B0E3FCE TAYLERHAWKINS
1,666,276,712 *AF5D3065FA82D93A932E1FB0A235BB3BAA93595F tcpoetttr
1,666,276,713 *AF57EDD06BC57EF555AD5E6C28618780FD639B9C groose4
1,666,276,714 *AF5295F2D1806C7D8B5E52E592AC9E1466E10A7B TRAINEEPLASSER
1,666,276,715 *AF54D6421F254A90D2DD8DD99FC97CF5426BF1E5 TRANSPORTATION6
1,666,276,716 *AF550F05A3ACD919B8A579FCB4C2E69DAC5E6FFA TenderDreams
1,666,276,717 *AF5266F0F6EDF61886DAB8D2E00BD72E2EDEDD84 TESSERAS5
1,666,276,718 *AF56D3DE08BD53E1CBE6E3D9619A4C954CBC44CE trevorsursa
1,666,276,719 *AF5C25284738333EA79ED360032CC6536169B41D HADI)(*
1,666,276,720 *AF5115AE5B1785DBA75B7D86830C7CB6307F64E0 THEBOMBAY16
1,666,276,721 *AF5DDDC9A1767DF40AE92B74D2C2DC72F3D4AC65 THENCLERK
1,666,276,722 *AF577E4DAF2937B7A2AC2A92C4ADAC9C4D38BD7E TRUMANSCHROADER
1,666,276,723 *AF5D98239D0475E5F0F7724CAE9F2D99377763A1 TSAA-HALIUKA
1,666,276,724 *AF5FDDB3118D15AF9658A8F69EF4994C994DFE0D TSYCORBIF4
1,666,276,725 *AF5799D5188CAD19D2A153CF98FEBD102C7E3822 [email protected]
1,666,276,726 *AF5DF86648305C2502AFC3115ED9CCF14F207AFE [email protected]
1,666,276,727 *AF52D9DD92B8D10488D586F33EE7561F5F9DBA8D tte
1,666,276,728 *AF57F3E01705BBC18EA700B5C1E89ECCEDA8A385 TUABEGNI6
1,666,276,729 *AF56DA95E412CB4F0F0D5F468DC5D4855E8451B7 harlandbobrowski
1,666,276,730 *AF5C8065D3098E3E88D9E4C2E4626CCA256CE919 HaroldShedd
1,666,276,731 *AF5FB567DAA9BDE57023A3B956540001482781F0 TIMMYMAYESHIBA
1,666,276,732 *AF506F13C299C0AE4C435D85D43BA47FD998483A TÚŽIL
1,666,276,733 *AF58723EDD77C5627CE2D3AF56631A6C78DDC133 TYBOWLES
1,666,276,734 *AF5D3714A0BA9D07769FE2E990146F00C536F73D TOBY.PANTE
1,666,276,735 *AF5975A1F8A2D256C963D0A842075EAF73EAE328 toddroacho
1,666,276,736 *AF529DADE1B216919EA89AA89ECDCE1BFF50D600 TODD.WINEGAR
1,666,276,737 *AF5EA48FF3C9FE7E0D285CC2C605840980DA43E6 tysonkapahu
1,666,276,738 *AF587B962E5A5AE65EBD1670A1539449DB2BDD49 HERB.MIQUEL
1,666,276,739 *AF5C38784BCC0A4D9F5EE7C0AB13293E9271994E TONYSPURS
1,666,276,740 *AF5DF35F96451F0A445FA5AF7DE137CF6608674A herzogjohannalbrechtstr
1,666,276,741 *AF5676234E114F8E8F262045C04B8DB904A9FDAB torydeluca
1,666,276,742 *AF521F83FABE34661C8B7B9C37A693FAFCCB08AA ui.^
1,666,276,743 *AF552A80B71DFC71D6F5089D2BED7E8F7FEF8663 TRACEYTHURTON
1,666,276,744 *AF5F49D1FC56AABDBBBA3F60F870F13F8BF23F94 hkg
1,666,276,745 *AF52DB5DBD622E1222EC91D53860BC407C4ACC8F undorsround
1,666,276,746 *AF59D8E2E9D53026CDADEDE36C1C5964D208DDC4 ungladso5
1,666,276,747 *AF57C0F144833862474A70703E68AC1EFFE38702 trentyn.jolicoeur
1,666,276,748 *AF5935A7659EF36A3CF29F87B7AE1D64071BB9FB UNMUSICALITY0
1,666,276,749 *AF5AF3FFE5732546AD1C472AF2A5F19861FEC264 TRIES COMESBEFORETHELAW,QUESTIONSBEFOREAJUDGE,
1,666,276,750 *AF56D9775E9E0B36FE9F566AC21E9BB4846C09E0 tristandeponte
1,666,276,751 *AF516EDC5F2468CDDB5A5B4FC5F9C2FBECA5150D HOOKER-TURNED-HEROINE
1,666,276,752 *AF5B1A4903B71A4668335B675FC7EED234CE9EEF TRISTAN.WINGS
1,666,276,753 *AF587FA3A5A12F88D83B4E2E41342709B2269A91 HORACIO.KOENIGSFELD
1,666,276,754 *AF5DAF4DC1728E5C9BD914DF98BE8318ED5257F3 hornet2000
1,666,276,755 *AF5C503D1E64961C96304510B9AEC0E2BF46416F horsereznor
1,666,276,756 *AF5F1B8B750D5F167B1899E874B9DB5077214E45 trixie-ede
1,666,276,757 *AF5E058062FFC8C55049D7BAEFACB5463D7146B7 URLA WOLKONOWSKI
1,666,276,758 *AF5BF851A3749F9B8DCEB6CD20D77D585E1C146F TROLLKRETSENS3
1,666,276,759 *AF5D3E5203E540A36E7801E8BBFB011E2FB65063 troy.card
1,666,276,760 *AF5F1CD943C96AEC3E0DC0B677F9F644D286047E user-m-i-k-e-y-user
1,666,276,761 *AF5475EFBA75FF21EC1C1B71A20C8BD6F2015697 httpwwwtheoracom
1,666,276,762 *AF5834C531F9441436D8CD1B84B731F33A0E5B45 TSUKIGAT6
1,666,276,763 *AF533973BF5C729C040F08ACD084FDD69B457746 UTSUKUSHIIKATE
1,666,276,764 *AF50451BD8D9669267650F94CC6A6B902A799DA8 HUMBERTOOSTERMAN
1,666,276,765 *AF54EF4AB94A0256C54259713577B5990C9AE1A8 ]v!a
1,666,276,766 *AF5D15130F260EF46362D8D6396F67C630461AF2 VALAISTUNEESEENSA
1,666,276,767 *AF5E982DCD5D627816967F2B1DAA4CFBC0612023 hymanaugliano
1,666,276,768 *AF576E6006F0D9490E1BE315DC45E187A6D73760 HYPERTEXTEDITINGSYSTEMCONSOLEBROWNUNIV1969
1,666,276,769 *AF5B9B8A396B8A6774B87374E7EE7B669FEE1A2E iadjlcf5
1,666,276,770 *AF588BDCAB729BED8EE0389C22DFF30290E65413 vandevander12
1,666,276,771 *AF523E77F3B805998F9D0F678EF77FFB37D8F8C1 tysontetroe
1,666,276,772 *AF541BD61913120A427E6A5E791EA41B262AAB7C [email protected]
1,666,276,773 *AF570067B93E2AD85ECA37E6CF4E25EC56E4E320 uestrumque
1,666,276,774 *AF5C8853D0465006F664306C750B79EEE477DE43 vaughnpolynice
1,666,276,775 *AF5A1698B34459D2989F26F030711CB6EB00BDC4 [email protected]
1,666,276,776 *AF571004D3CC8A60D33BAFB681B80675B78F80F0 VENETIANA9
1,666,276,777 *AF5182E41A818FC6574676DD63611B3D6A4DAB41 IKHTEARSHAWON
1,666,276,778 *AF58351D65412697CD1C9481B802B29F9327C30A VERKOSTIGENDE8
1,666,276,779 *AF5F1D25CCD770890DCF16837C3359833AB8ACB5 unetymologically3
1,666,276,780 *AF507C7D1180B82926617EEDA01E20FF0D452BE1 ilovefelipe92
1,666,276,781 *AF5D1CC5FE11769777B1D7B1ECABE595C7EAE134 ilovesaturn585
1,666,276,782 *AF509C0D7830DDEC54B100DCC248D150B0571909 VETTEJOHNSON
1,666,276,783 *AF578F8806910A0899AE9105707900F379ECA8B1 imaginatively /i/'m/&//dz//@/n/@/t/i/vl/i/
1,666,276,784 *AF55287034AE81C0ABF0327E3031BE04B7AB604C vichitavirya
1,666,276,785 *AF5E4C5D8A758589A6326EA664337691147B3EE9 UPYILHBLNIZTING
1,666,276,786 *AF5FA806A1E3F5F1CCD5687A13F88365C5A2FBE7 vienanvirranpy
1,666,276,787 *AF505B83E82928E59B7D4B35E55B75C9BA20EDBE VINCENT-OMORUSI
1,666,276,788 *AF59C435D11AC19446E436E861F8D34D68927C8C VIRGILSARKISSIAN
1,666,276,789 *AF526725EA157D1184D2DFB3EC64580286C6430A virginiaotter
1,666,276,790 *AF58BF7FA843E74427AB6F7669307EC83E7EB267 [email protected]
1,666,276,791 *AF5C76ED2D14A748E76870D9EE25FE83FE864CEE INSTALLERIONS8
1,666,276,792 *AF58833A2F2BAF73A93D65F4BB22C2B8099D154D INTRO (FEAT. BUSTA RHYMES)
1,666,276,793 *AF5AB91D4ABBFA8115E82E1FA33256A9F6E2BB31 INVITE
1,666,276,794 *AF5CBE057B3DAF3E4D24A7E06FA395DB0E002F38 VANDERTIE2
1,666,276,795 *AF5BC5FA5CAE2C3D45F4731642E3BC006EA67FE8 vumile.gogela
1,666,276,796 *AF57B86A21FD600C43FB337FCB42E371F11E49FF VANESSA SLANEY
1,666,276,797 *AF50141E57C2D99F5668AF78DAE2F48B2E4E125A VANESSASTULTZ
1,666,276,798 *AF588E66CFDC1A47B496180DF9AFAA29D1E0B370 [email protected]
1,666,276,799 *AF5D2C968D2344D3049DD0D9E7D33141D5333C21 VEGETOMINERAL2
1,666,276,800 *AF598941F3F2E506FD28E794B6081D4A07FF3257 WALLACE.GOTIMER
1,666,276,801 *AF50336927FC305F873AB6C02939253EB09B170C ISREAL.BICCUM
1,666,276,802 *AF5A872F02FF37F4A7ED9101967BB9EF7F473389 ISRIO
1,666,276,803 *AF5596F94FDAA61E938743E8CE95C0A1429E35DF wang_26
1,666,276,804 *AF5B64101FDD1EC6AAB64D4A53EB221E8272ED75 IUNGUNT6
1,666,276,805 *AF5019BEFD74DF7DEF62645F10B6A9C1A3A52D65 vicky.deshano.kingsley
1,666,276,806 *AF5EB8492D2D22BD617321028B10E8CE55CE8E53 victoria.dejito
1,666,276,807 *AF503E1FEFE153F19913D88C7DF9F04E008CD2F7 IWASMADEFORLOVE
1,666,276,808 *AF5DD016205C3DB8C0D1E7F6B3F97947E22871CF [email protected]
1,666,276,809 *AF58EA04AACA00A60ADFC57EFB874160ED8F85E9 JACQUESKLUE
1,666,276,810 *AF5693505D2027E70D341A0FA0F37765A9E50B97 jakecharleton
1,666,276,811 *AF556717E2677FF5048D88D1EB08DEF1E191864A WENDELLSTALFORD
1,666,276,812 *AF53410C46A0CCD16116D250A2CBF7F4C7BB1A62 jamisonkingfisher
1,666,276,813 *AF55A4BE77803BD3638F8E5B3D1358AB6C6E826B [email protected]
1,666,276,814 *AF5E26CDD33524354615D1D5F8C9BDB3A6BDAA49 JANET.BEECHER
1,666,276,815 *AF5B01FF12228CCADC0CF1F7A83AC7560E8B834A [email protected]
1,666,276,816 *AF5BFE522D3EBA7C3F4DDD298CE5E35ACB3D3F19 january-9th-(allegro)
1,666,276,817 *AF5B1E641853BFB637F09666ABAE13530A5F3846 JARREDFOURAKER
1,666,276,818 *AF5E2D5D72158CA52B70F572469055A2E7086387 jarvistrautmann
1,666,276,819 *AF55EB23DBE31375563596596D11E5287267C086 JASFERB
1,666,276,820 *AF5BDC7E0EABE082064DD7981413F935ADB4DA09 WESTON.LOVERING
1,666,276,821 *AF5B2581DC2CDC686888134AD94374B1474306EB VUILGEMA1
1,666,276,822 *AF5B304260D64DFC4C5172F106292BACC36ECD41 WADEGISSEL
1,666,276,823 *AF54D2861D8C9B815ACB59AC4CCF050978BC71EE wagner's.rinse.cycle---ride.of.the.valkyries
1,666,276,824 *AF5F40056A292BCC58E5A0FFEA74A7F0F7712166 wallystoos
1,666,276,825 *AF5B6B78FA9156A090DF744581272667D1823518 wikirretonoviembrewiki
1,666,276,826 *AF58AACAC5B7FE4A3921B22AA4B7C1B6B484FFA3 WILBURVUE
1,666,276,827 *AF550E00AF7CB2362DA88772C0C214181C288D86 [email protected]
1,666,276,828 *AF5F390A58D88C875D92E30BBC12C7ED934BDDC2 WILD-SIDE-OF-LIFE/-IT-WAS'T-GOD-WHO-MADE-HONKY-TONK-ANGELS
1,666,276,829 *AF58E464F63A97B8F564FD5AA166F51599501CD7 wanna.be.your.santa.claus
1,666,276,830 *AF54595EA67DA68F533D38BBAEF134C568C3F509 WILLIAMDAWSONBAUER
1,666,276,831 *AF5257580C9301F8B3D63BF6A7B4AF345720054A williamjohnashleymason
1,666,276,832 *AF588827771F781B299AB98738930D38163694D2 williamregar
1,666,276,833 *AF572D95D5F89FDCCD6E68706CAA90D6664FE2F3 JEDSWINFORD
1,666,276,834 *AF5E0ECAEFD25D00E090EB8A973E35E9F75C1020 jeffereydenos
1,666,276,835 *AF5F66F7E573A6804BBC3EB9027C748B0BC3FAA8 waschmittelkonzern
1,666,276,836 *AF595479A64D1837FDB6BE09C1DA39AF7FCF86FC WILSONOBNEGON
1,666,276,837 *AF5C09EDC6F4F8E7398F9E453A0AFC346D6C2962 WINDI-EFFENDI
1,666,276,838 *AF56A910C9D66F47677FC78569A45CAE02F728BA WINSTON.CARTMELL
1,666,276,839 *AF5BDC4F52E917219D9BE03739C242809BD7F049 WIÔLGIÉ
1,666,276,840 *AF59402B939DCF4B8D50E7FBD04267B5B228973F with.smile.and.slobber
1,666,276,841 *AF54DBE97F03A2F5A673CD5A8981DE7CE4629BE0 JERALDKLEFFMAN
1,666,276,842 *AF5B21755EBD1D8B4CAED59EAD36C4E8E28BA0B8 [email protected]
1,666,276,843 *AF5E8F9D487C479F80E5737A7969026EA8F845B4 JEREHEERY
1,666,276,844 *AF5FFD6C8213C9FC70CBE7E91A5A65AE6A8B11EC JEREMYLODHOLTZ
1,666,276,845 *AF5995DF14968881389B95AB8B45C8CF896D06B2 jerrellvissman
1,666,276,846 *AF5BEA4D5FD02BA851AA2D4CE9B8FCA0DF305516 WEBSMARTZ
1,666,276,847 *AF520257DA8A1FBCEE2EEAC31280661435BC3C54 WENDI-DEDRICK
1,666,276,848 *AF5A5952CAAC1B37D2ECF7D92BC8C0451B38CED9 JESSIETIMOTHY
1,666,276,849 *AF53206961A92E470935921190A7B28A69C33554 JGLOVA
1,666,276,850 *AF5088EA0D788B4A8F16C8440BC3D17B4687C0FE WU_DANCHOU
1,666,276,851 *AF560ADCD0EA5B1F8BA2F418FD933A30E130DEA8 [email protected]
1,666,276,852 *AF5B0A2804A2CA861CE976E102AE01FFF90E332E JINGLEHORSE
1,666,276,853 *AF577B0AFE3805DDC1CD6201BFD965250FC17311 [email protected]
1,666,276,854 *AF5160DEC12BE190288631BD61E363CF2215BF9C jodyseeley
1,666,276,855 *AF5B9F3DDCABED592A1D7AFC5C71424FBAA7F76B JOHN PAUL GEORGE
1,666,276,856 *AF5C994A6DFB440F997A62C2EAEE02C5460607CD JOHNPREZAS
1,666,276,857 *AF5A62FA6E422B4EE5E9C113BC22004DE1610599 JORDONSEYFRIED
1,666,276,858 *AF5B07319AB1C7916D457BA64AD75900E5C09820 josefforston
1,666,276,859 *AF564F80314BD731204D47B8F201AC7D40C81840 JOSEPH.HUBERTZ
1,666,276,860 *AF5D2514C47318959526FA437E9A65440D501682 joue quelque chose de simple
1,666,276,861 *AF5A20E492F857C6D20D75AA13E30EF9FC339BA9 KABYLE
1,666,276,862 *AF586743E4175DCA88715164B14043946E5AD1F1 WYSHEKA FUTRELL
1,666,276,863 *AF589A51EE7536AA9EE5F8D37B75D1FCD860C6C0 [email protected]
1,666,276,864 *AF5B2A2B426FF57B49B311EE7EDDBFB3212918B3 xchloemarrisonx
1,666,276,865 *AF531FEEB868F75875C62615AD949D397DDA7F46 KAZORCK2
1,666,276,866 *AF5C23A65CD1B9CDABFDCAF82D4E6993604190C0 KEIJAUDDA
1,666,276,867 *AF5E6A23ED68837EE0921B43A4E081D8562EA8C9 kendrickgoncalves
1,666,276,868 *AF550324C1CD63348EAFCB8ACD648AF5C2810C7A KENNITH.BRIDGES
1,666,276,869 *AF58007FF8E96DEC8E58B30BE50E943DC49633D6 WILBERSPENNER
1,666,276,870 *AF53E7245B8A91C79F172E32A4C6BE81ED60F726 [email protected]
1,666,276,871 *AF5896E146504133FD4FC9EB132C04A19C6EA61C [email protected]
1,666,276,872 *AF52158FC17058BB913B2D37F9E0FD87605B0A5B WILLIAMDICOLA
1,666,276,873 *AF5EF32E1DC5066E33507AFFC88A4C535239A9F5 [email protected]
1,666,276,874 *AF55FE704A55139A8CCBCC4D86D1C0DC9B589E02 willisbrevo
1,666,276,875 *AF5479288B331328B623163BEE2DE24ED485BFD4 [email protected]
1,666,276,876 *AF5975E6A3C4E56A5717DB1CED79B0FA23FD09F5 WILMERJACOBY
1,666,276,877 *AF5F099918D8356CA0F26792089C028C9CDFDA22 wilmerstanchfield
1,666,276,878 *AF5C710ED3C2ADF6256A137FAFD371F5FB79515D [email protected]
1,666,276,879 *AF55398956F1402A36FCD9B29ACFF9CF409D5E5D XZGTWWHRFRPVYS7
1,666,276,880 *AF5449090CA8A8DBE8260E6CD42A0590AABDF55F winniesiage
1,666,276,881 *AF5D07D1DBAB99083D73EF6E2AEA553617B4A53F kitamrofni
1,666,276,882 *AF56DCF70ABF7B82DD35125FBC84ADCC4A361FB6 [email protected]
1,666,276,883 *AF5845500611466544EE696B54B22C2D6F49E198 YANKEE.SHIP.CAME.DOWN.THE.RIVER.(BLOW.BOYS,.BLOW)
1,666,276,884 *AF5C6D8D2E0C361C068752ED712C1BF580E51519 KOOKRIN
1,666,276,885 *AF5705EAA2BFDBCFC3C30DF2008673FFD3B4C1D5 WQEKW4
1,666,276,886 *AF5DD2685224B9A66A7086FF52695558B1B659CF kós–zrumeczky
1,666,276,887 *AF56660CF0840ADCD73A6CE53CF9FA7C33FA166A krafft3
1,666,276,888 *AF54CACE9ADB1C2E0D13AE37DC34B8920BC1A1CD [email protected]
1,666,276,889 *AF50C49DDDD0D8E2DC5B258EA909A394B5C6DA2C YGEWRO
1,666,276,890 *AF5612EFC4280325A88722438C3711463535E640 kristjanna
1,666,276,891 *AF589B5AECA92474D18DF953103F58A253B7A6FE [email protected]
1,666,276,892 *AF5A6DC494181856C43C96315900BE4F7BA47420 YLAEALLAS8
1,666,276,893 *AF5D14DA558017700B0771ADD3213B97D199ADF0 WWY:
1,666,276,894 *AF5FAB41C3B1B4284278BEECDD9CD254093D4F89 ylsel
1,666,276,895 *AF52B6038BFA1D9E49B69E8839149172CE43CF11 kuschelklassik-1-(disc-1)
1,666,276,896 *AF5A5176F792F506394DF4A149BD60901064FD78 xavierbasketba
1,666,276,897 *AF5F832547557B8E9BA593732F0AF3B3118ACEE8 youngl
1,666,276,898 *AF560FA05EE9ECE56297517498DEC4F643653210 [email protected]
1,666,276,899 *AF5D9AB0D5071B2156ED7094249EF145656D357E XTRCRRCLM0
1,666,276,900 *AF50E64D8987762E999D81816258BFEC80BC74F2 [email protected]
1,666,276,901 *AF538C660281BAA4A3D894D890A3B03B5D1F0DD9 xxc
1,666,276,902 *AF59DBB2516ED82F14EBA628409550EECBFB7CDD LÄMMITYSJÄRJESTELMÄKIN
1,666,276,903 *AF5B9E4BE73C47447D6B5A74C8F7F2AA28F4891B yusnita-m-mamora
1,666,276,904 *AF576EE2BBD77933D228CD4352E8F5CEFABEB626 yuyunindrawati
1,666,276,905 *AF57C94ED745D049162F683460FEA55EE8C39EF3 yaniv-makhluf
1,666,276,906 *AF5683F4975E98CB9BBF96087AF4187B57E7D0F3 YZMB
1,666,276,907 *AF586885A10CBB210ABF76A5582B4D8B8CE3FA4F ZACKARYIWASHITA
1,666,276,908 *AF5B26BD00BD6D7DC27C5CFD95D47CE750D4D27D yeliz.erdem
1,666,276,909 *AF5A505B5D3E8435DC433C42B856ED4D16F15FA0 YEOJUNJIE
1,666,276,910 *AF5343FB19CAE930F5D279196855F020899631CF Y{%F
1,666,276,911 *AF549BE60F2C225D7CE92E3026439725BDBFDE8E LAVIOLETTE--L-AE2-V-IY0-OW0-L-EH1-T
1,666,276,912 *AF5BE127F103C573A96953B55669DFB0274AECD9 [email protected]
1,666,276,913 *AF55E55C7B6B501D4349A5C67DFC72995F185EA1 YIE YASRI
1,666,276,914 *AF5FCE77DD4461DB2CE098BC400F3418DB4A3386 LAYSKE
1,666,276,915 *AF53A9082911D8B0EB635800DAED9BC05641C749 LAZARO.HORN
1,666,276,916 *AF580E158F3A773CD1AB3B10FA895224A2D6B5EB zapojené
1,666,276,917 *AF5B5904E653C0946144DA250400CD16ED3E08F5 ZCADMIUM
1,666,276,918 *AF5E012308700A491C6D8703E24E8B4A239FAA43 ylimoolg
1,666,276,919 *AF5B9CF70D209C93FE7941A117ED96C29CF84725 LEE-BROAD
1,666,276,920 *AF5FB16A15BA112DC0FCCCA1F67F913706B309CF YONG.SCHWARZER
1,666,276,921 *AF5736532C169D493C3BD4E382611E424D0F3638 lefou
1,666,276,922 *AF5F1F57C352FEC745A4872E3BF5EE7501E96EE8 [email protected]
1,666,276,923 *AF5648F4CC729520AC310066FDC42BE820294A4B [email protected]
1,666,276,924 *AF58D3408199D191C94A62A103666FC155BACF5E [email protected]
1,666,276,925 *AF536CEBD7356DD5A3A969C548503792A0D8E64D [email protected]
1,666,276,926 *AF5300BA801292934D0DDEBD61128566EEEAFEB6 [email protected]
1,666,276,927 *AF5DB9310DAAA19235F5061D535FE7C4E63A2205 YUKISANTOSO
1,666,276,928 *AF52881132065C6603195B48144A35822B00B3AF yuszczuk2
1,666,276,929 *AF5B62D9F7A5FF1DAB3E4AA7225DF18227B3F609 Z4J"
1,666,276,930 *AF5D4B044E327D88DBE6835072E4BE1A4F85DB86 ZYLVARA
1,666,276,931 *AF539EDAEDE01D4D4F8DBCEF3A155D2F1474C0A8 ZZEBAH.PUNKPLANTILLASUSERBOXES
1,666,276,932 *AF5D0D9ADE0F7B015C849DC70FEDE61C2F4B7D12 zainurul.aida
1,666,276,933 *AF536EE22968A6FA783FC2D0E4F2C1605AC2570E ZANADOO 1 0
1,666,276,934 *AF56F8795FBECDF846BB4E0FA711C46F827D0380 ZANECHAVERA
1,666,276,935 *AF56E7EAE1E81A45584DC5F8B893985E16DA9275 ZBL5
1,666,276,936 *AF56052D79833F1E3408B087D54B22C1AE2A8D0D μασάντο
1,666,276,937 *AF51D22279240A93169A3A57876187F808F19005 Б’ЕЛАННА
1,666,276,938 *AF57F8189190966892026424F66C07C3A7D1D90C [email protected]
1,666,276,939 *AF5368B7BEDE23BE6821E308C113A659E318263D [email protected]
1,666,276,940 *AF5731E292B98B4F54F7E5F50F1EC51B92F91D7C ВИМОТАВСЯ
1,666,276,941 *AF569F32277D568E72F40F4D36EED169D34FE2B6 [email protected]
1,666,276,942 *AF5998C0F590CDDDD3E9E3CE08D23C6BEC0790F8 ГАЛАПАГОССКИХ
1,666,276,943 *AF54854D2ACAA9DB26FDA19A989130F0822F1F18 ЗАПОЛЬСКИ
1,666,276,944 *AF5C82F6CDCC22426BEF7CF46852965AD90C966A КЛИЧКИ»
1,666,276,945 *AF507EF772BE45C7691CE3B8AB728B32D1BA1E91 ZOHARISTSKABALLISTS
1,666,276,946 *AF541E988110D8D825C25E2BF6B1A80D7B8C1CE1 ZOSB.ZONGOFSEBOBOOLINK
1,666,276,947 *AF5B2DCD279B90133A01149C7606EC766D65E5FF «мингрельское
1,666,276,948 *AF59CBC0D4C114581A0DDB56A4F03D85A0FBFCD5 lonniederoest
1,666,276,949 *AF5568B44CF1054735A1DDFC95CF7BA948ABF309 LONNYSCHOUWEILER
1,666,276,950 *AF5C0E429E65CDBAE29473E7CD6198F15B0FD96A ZVI-TUBUL
1,666,276,951 *AF5D9184B7F0C75863BFF123BABC7DCDF5ADA719 плед
1,666,276,952 *AF5BBA4803FA6C22E7EDAA6EE0EBD8636420EF75 loydfavilla
1,666,276,953 *AF5758E9EE7A5A8D2D49581F12161DB50A353C21 LOYDGARAFALO
1,666,276,954 *AF5F4AEC8CD342ADFBCDCE4C2431508D30B1CF35 сальвінія
1,666,276,955 *AF5DBD39CB1C2251E87AFF647D10760952090960 ТРЖЕБОНИЦАХ
1,666,276,956 *AF57B9CFD7BF27277B6219B4283358A5E2151517 ГКБ№ 4
1,666,276,957 *AF5B1A529F8D042275D48D2945CB47EAB0F85870 ЖАБЯСАШ
1,666,276,958 *AF502FD7EDE6A1B0AEC9E62EBD9EF4C558DB2F0E 一些有關h
1,666,276,959 *AF548E4C9226148A2E6ADA77D6A098D070D5B315 КЛАСНОМ
1,666,276,960 *AF55390270DDF998E58C7EBD1D683EDB7AE50C6E МАШУЛЯ
1,666,276,961 *AF53C6748027B5E88758E649F14195E22CDD1C47 M0SQUELE+
1,666,276,962 *AF5EA044C5270C9276E6378B07FBA7B02DF988A3 mabelnormandjamesmontgomeryflag
1,666,276,963 *AF5BF01AA66A4A6339FFB285EE86A90CB6F6E1EE madridsurigaodelsur
1,666,276,964 *AF5A73306E3561DEA2D3D5D48C41BA8F504A83ED [email protected]
1,666,276,965 *AF541D3422E9FD8680C7D026DC44553CD67A17A9 MAJTAN
1,666,276,966 *AF589EA09083DDF5EDCB1C37C42E28415C5DFA7A MAN6824542
1,666,276,967 *AF58EECC0CD0044897CA0B3F8ACA47C88D44A35A marcellusfaur
1,666,276,968 *AF5287064F99E15FC92B4CB12CA196E4C13F3656 MARCUS.FRAIRE
1,666,276,969 *AF501A47AE5647201C75F15BA8B23F3878B38539 [email protected]
1,666,276,970 *AF5BF5AA4F422B203543BA803240FCDA0810A2D6 mariadefusco
1,666,276,971 *AF5687250CAD3B5F8CC7F54DA2BA0F3797B4FA8B MARIANIVES
1,666,276,972 *AF5491DBFA4B57FB27F3822BE45FDB4AFF8596A8 marissa-scherr
1,666,276,973 *AF5C2AB2C30E3C479D1766DD8DEB42A458F15362 markhoriuchi
1,666,276,974 *AF5DE921553B0F651BFB9704FA1712315A90FCDD MARTYCARRERAS
1,666,276,975 *AF50F15C5D513C9B798801F80013C950E94622B8 matches26
1,666,276,976 *AF5C372400D6E94DC6B44032369AA2CD8B0DF91B MATHEW.BRAUM
1,666,276,977 *AF529E616271F6537DF8054971C53E1F6B20E4E4 MATTHEW.SWAISGOOD
1,666,276,978 *AF516FDD24F3F783BBB24FCC828A810820C27DE2 MATT.MARCRUM
1,666,276,979 *AF54C034E99AB1300662E9F9C718C939401A1082 MAX.BECHERER
1,666,276,980 *AF57C10C69AC1793068B6EE776CAED8337028490 MAX.WIECHEC
1,666,276,981 *AF5BA10B5D6FB8000BE38EC7DF58B2C882CBFD21 MBASELINE
1,666,276,982 *AF59719CB430499EF65BF9387A6DF441A056F4D8 [email protected]@8i1ity
1,666,276,983 *AF526E00207787F144668EB2FBCA373507D01997 merrillstradley
1,666,276,984 *AF57E641042A891CDB66D1B87B0E0813CC7E4250 [email protected]imocomtw
1,666,276,985 *AF564C9180A4DF21B958848B64E931E9ACE7E112 MERVIN.SKARPHOL
1,666,276,986 *AF564878E9541777EEC1FB3002052AB84419E523 MEURENTS6
1,666,276,987 *AF535CD232E5762E496F6652C691964A15B4D1C4 [email protected]
1,666,276,988 *AF558F6A7DAF5BA5DB58588D725E0D795FA34F01 MICHAL.ENGH
1,666,276,989 *AF56A093FAFC4730280BF62C23F3E84A2B7DF84D mikenickleson
1,666,276,990 *AF576F30F13A077F7CC49423A676C0E63B40F5D9 的高段踢給踢中,裁判終止比賽,判定為tko。在這場比賽之後,andy就遭到ufc的釋出。
1,666,276,991 *AF5DA1734D2DB10C79D30B74AFE6DB55B0FB2F51 mixingbulletsandfiringjoints
1,666,276,992 *AF536C7ACCF4D414640041EF894603BD3413298F MOHAMMEDALKHATEM
1,666,276,993 *AF503E0F31E8BC61162E9EBA4ECD2BC2B63600FE molmajeur,bwv825:ii.allemande
1,666,276,994 *AF50C4BD980101FE0DEF50C7227737D16A66F244 MOURNINGGUN(BLANCAMUJER)
1,666,276,995 *AF52FC63C5632A2B82CD048681F1A82B0503E444 municipios.de.la.provincia.de.verona
1,666,276,996 *AF5C5FE854569BC49809FA3B5BBF8304163E65FE 0AVENIR0
1,666,276,997 *AF59284F25C79EB67C7C9F86B960DF0751809673 1053852 LOMAKE-(-EXCEL-97-)-VOIT-AVATA-TIEDOSTOT-MY
1,666,276,998 *AF5D7F73343974FD985ED953C9BF9AD983B6C124 1084245 SEURAAMALLATUTKIMUSTY
1,666,276,999 *AF5CEC26E3E2DD75FC84DE26DB81B70D8C44A47A [email protected]
1,666,277,000 *AF5DBE37E8CFD5A1EB552F6615DB3484BA9A3B8B (-_0)0~ q---b
1,666,277,001 *AF5B1BC23855939FE2CBCFF0AC4A7C4A89E9D4C7 1134753 toimikunnan-teht
1,666,277,002 *AF537F9B77589461F2D7449AF931C6F1FE6714C5 n^2
1,666,277,003 *AF5BCA48F66411D2D44A65EABCB816AA166C12A5 NA7^
1,666,277,004 *AF5119A3EF09A776613BD4DE3C427FB1078509BA naklicit
1,666,277,005 *AF52FF7743E64E44F75DEDA28FAF2DBF5D4D8051 Nantoka-narusa
1,666,277,006 *AF5D7D9DE79395E1025EB7CD803A0A267798394C 06ABA64D
1,666,277,007 *AF5A222B17C634F78D76AD50ECEEE92482D0E5FD NATHANAELCAJERO
1,666,277,008 *AF55FAB45AA1FD10293F5825CC08A2AF45FF18B1 (-_0)~~D==B
1,666,277,009 *AF576D608DCC9C556E6E0549A30BBECB17685529 ndlhjqt53
1,666,277,010 *AF565E57831C51B2EF8320D5EA79FA4343287EA5 nega7v57c
1,666,277,011 *AF55C868D0B7DE926CA0D9A5DFA99250D7DF5985 NEPOHLÉDL
1,666,277,012 *AF5B7E40A09884E5D290B7CA5851A42B8097F4A2 NETARVNIED
1,666,277,013 *AF5A7A3C9EED64EC9165D8D39E919EE7B431BDCD 1AANSUKKE
1,666,277,014 *AF545DC59A449174B6716A4877DDECBC274479E0 12-28-1742
1,666,277,015 *AF5510147D98FC16C588142A45F50D0E09B6D07B 1.aitauksetkaan
1,666,277,016 *AF581E4328EA1045C4D710FBD02A49612F0656A0 nhp-uk
1,666,277,017 *AF57C2E0FC17EE7EBF2C7FE7DCC8E299D80D49C0 NICHOLASPRUESS
1,666,277,018 *AF57644DAA4B64042BFC7F35276012DA207A6933 1ARGNANTS
1,666,277,019 *AF51A5C24F0B9CDA15D4925FD4A7D657D1E1C7E3 1 ASIOINTIPUHELINTA
1,666,277,020 *AF508B119627A7D95E53E0EABACF97FC4FE64171 1 ASKELITTAINEN
1,666,277,021 *AF519E6FA645A0996D7E68CA3A0CF9FFD55F1A7A 1.BALKANINL
1,666,277,022 *AF51F9514CDFDFB1AEAF437D36E56A9BA6902661 1.BENCHMARKINGVERTAILUA
1,666,277,023 *AF59F22E35A04988B109B6B5B9615AEA2E2DD721 NIEDZIELSKI</A><BR
1,666,277,024 *AF5D3EE5E2CACD188B627F47F680DBD60E93E8EA 13.POSTVIETNAM
1,666,277,025 *AF51EFAC43F099071CA487D835F2A37250E7C094 14962 oppikirjana-k
1,666,277,026 *AF5FFE1621603C48FD4BD34F647DD106BBA24845 NITUL3SCUBI4NC4
1,666,277,027 *AF59E7821323425CD28E5B66B2DD22B587797E70 1.cumulonimbuspilvien
1,666,277,028 *AF5B2BACF655CD0AD7D2943B9BD84D9E1DD6C1CD 1diletto
1,666,277,029 *AF5A47D4AD690E96E29A28CDDD2B1D96E1929894 1628687 UUSIN.MUSTESUIHKU.TEKNOLOGIA.ANTAA.V
1,666,277,030 *AF5DA61FA989E88713FDD0069A72050952229F22 1EENOEGIP
1,666,277,031 *AF51CCBF4E03798C13E862F8662915C39A2EB42F 1690534 deshalbwirddieseschulekuenftigseinennamentragen.
1,666,277,032 *AF556C1DB282227A0DA2DA80B4741BA7882B2961 noblehistand
1,666,277,033 *AF5FA4921B90C69B706655FB048FF7E78E1F2EE5 1ELEKTROONISIA
1,666,277,034 *AF531F6C0DCE9FC5E59A9EB6CD6874570BDABE19 nolanlaurenceau
1,666,277,035 *AF5594237A3653BD0735E39C90263BBAB9D27C16 1EWUORTNI
1,666,277,036 *AF5A502D6F48A8D4AEE2C61B23DC7505574EF5AC [email protected]
1,666,277,037 *AF5CD0AAEF8971CC6BC6255BBFCF590DB5B65FCD 1FERNSEHUNERFAHREN
1,666,277,038 *AF51B51A083A606AAC2C2AFA461B7A3FE6E6CFF8 1826435 esimerkiksi iltap
1,666,277,039 *AF551F555A7F8C91009F6D5324B6A126762303D1 185855 irgendwann-wird-es-klappen-.
1,666,277,040 *AF5EEFBAC3A65E8AE18599DD9B6B1C7AD1AC37C6 1888716 KURSSIN AIKANA J
1,666,277,041 *AF5B7A3B7E671FE369F44B5F00B9C16B882DEA4E NORMANDCORNFORTH
1,666,277,042 *AF54DA42B8A8FB9B8E12867C410639965DBD1758 1979162 J
1,666,277,043 *AF53E30F64483392717DDC32DCEC8130267FF3A9 [email protected]
1,666,277,044 *AF53924FA2DDB930857F1131C24612552C5A829D NOTTOOSCRUPULOUS
1,666,277,045 *AF5CE6112365CB25312693A8744D3E4A61FF8940 NUMBERS.MATHER
1,666,277,046 *AF5621B42B8F3D5FCF6B54C3FB85FB4CD34909C3 1-katalysoimina
1,666,277,047 *AF5D173591958086B64B77D031BE829A1EF7CEF4 1.lakituntemuksen
1,666,277,048 *AF5536C4E3F96EA0D38395BA9460E97DAD2F34DF 1COVENS
1,666,277,049 *AF5AA3EEF060A833930D1FD9224493C01ABDFE53 obratit9
1,666,277,050 *AF5505D476E5A33A53EF0DF57DB52683C58ABD8F OLDTURKS
1,666,277,051 *AF5AB1E359DD8A49D6C1DAAC90FB884F388A84DC 1.samstagsportschau
1,666,277,052 *AF5ECCA29AEBC719684DEFEAD9E18CFE408565BF 1.sanitaerpavillons
1,666,277,053 *AF5E467956B1337E522EAA885D3EB5113452164A 1 isinmasin
1,666,277,054 *AF5CC03BB42F4F3B46F6BB061A1FCAB76635E2C0 oott
1,666,277,055 *AF5E919280735DA5636A054E0E8BBC8D1F567412 1SURHTREN
1,666,277,056 *AF51BEF4E0D9FDB8E2060CF7780E1DC3E41858EB ;)o~ q8
1,666,277,057 *AF5613714B4ED7CB694C41ED70BE70099B825EFB 1 ligainteresse
1,666,277,058 *AF5250A07C526EE523D01F9B598D5F8A9ADA16A0 ORDIN
1,666,277,059 *AF5A70BD0FEC22C69C574137A8FB7A34F349E43A 1tukenirler
1,666,277,060 *AF599429449342C2C97CCD3C3B6614EA1F2C3209 1-matkaper
1,666,277,061 *AF51444187E9CE77B0F9803E94FBD5C627DC5DD4 1.unter's
1,666,277,062 *AF56CD009C447B36ECBF8C649A9E03E31FF044F6 1MP0RTUN4T3LY
1,666,277,063 *AF531E71FA9EA23B8205DA5DC4AFD2999E46E40B othaocchipinti
1,666,277,064 *AF5E8830647505F7C32162A4E4E48FF42B7B6539 1niukastiyhdell
1,666,277,065 *AF51F526FF635A1E99C2166344670387F1CB615C otsised7
1,666,277,066 *AF5968FF2CAE88BF9BD1A2140E0ED6FBAE214F02 OTVORENUS
1,666,277,067 *AF5F3D4BA116C75C94089B5B25A475B8C3875CB6 O'VEISSI
1,666,277,068 *AF522A2AEF67FC7E15733B3B3DCBE33186CEF1EB 2201pinto
1,666,277,069 *AF5B48D77E7A64079B7E752587772091F37C9CE0 palarch's
1,666,277,070 *AF5BA18282D93D1BA9AD1FC70507DCEBC85E3CA7 2430313 auchdiebeidensoehnesindbereitsdabei.
1,666,277,071 *AF56026ADDB94AEC0256EDEA6289D7C580E71724 2490452 PII , PUU JA P
1,666,277,072 *AF565176051A80778AFAF488D4A48C68C56A4536 PANTAT11
1,666,277,073 *AF5732C241A616AEE0BF05337650DDD1847B3734 2542831 ty
1,666,277,074 *AF51E30559B8A7ED8037F64AE72CABC6F8C80F22 PARALLELFLACH
1,666,277,075 *AF558EE6F3218BA4782D469519118CADB6D79317 1-VAPISTA
1,666,277,076 *AF5903E8E09D0AE7A82FF10B112DCC88DCD618C2 pasqualebutner
1,666,277,077 *AF59FF2D9CE19E2B114725CFDAEDC4BD0C595434 1:-v.-toccata-allegro
1,666,277,078 *AF53E2DFF4BF4EB07B7EDEE227346FA2A658BDE6 2830152 MUTTA-YRIT
1,666,277,079 *AF5BB2C7D795B41B5BE150DBF10B1325B4ADBDED 28DECEMBER1288
1,666,277,080 *AF52CBAA483F75F0B876D30F33D6019AF998C5DD p####b~0 ~o}o{
1,666,277,081 *AF5C93CB420D5AC04B6CE658EA623A0A6AE75165 2226301 kompromiss.:.deutschland.ist.nun.bereit.,.zuzustimmen..
1,666,277,082 *AF59F4F616D0C4B7FCCFAA2290EF40D4E8003980 [email protected]
1,666,277,083 *AF5BB6CDC20E3927A8567AF63BC61DE1C42596AB [email protected]
1,666,277,084 *AF51B27ED4048C71210855443CA8BCEA4FC3CB09 penny.haymond
1,666,277,085 *AF5A942B81DEF2794EB2B58C6E3DA2115D119E03 percaputing
1,666,277,086 *AF574378F7F62400D5E8B5976A4D4CBB12A7873D 2gesetzgebungsaufgabe
1,666,277,087 *AF5269EC5CED621815EF4B7906933901CC9760E6 peterrivet
1,666,277,088 *AF5B71527664DDF875D2D33DB1E4AE4B8DBE6057 [email protected]
1,666,277,089 *AF5DD8F6130C6145519D1EE3239A15FC3688F77F 256702 no,t
1,666,277,090 *AF565642F3E4DA25B217478C27BDAF2C87E1FACD PHILLIP SCHWANDT
1,666,277,091 *AF5EA83144424A55A89A4800371D9C18051B7227 PHILO$OPHICALLY
1,666,277,092 *AF50E113E6A28F572BECF490532298B3DFD25049 2 sato'ya
1,666,277,093 *AF5081D67A2CAAF0F5C9A42E34E38B7CC714CC8A 289SOPHIA
1,666,277,094 *AF5FE7C00868E454E3B3166BFD6492E4283F4E9E 29NOVEMBER1968
1,666,277,095 *AF555D310F26A66E3DCB9F39D249201CE6D45B2B 2COCORAIN
1,666,277,096 *AF503C40A0066A0F4D78A14839763ABFF79547D1 planetfreestyle2000
1,666,277,097 *AF5EB72416027FC754C5CE792C302019B0D7BB9A platyscutellum
1,666,277,098 *AF5DB2EC3625E8E6C883D5BA6EF718D9E87698CB „PLICHTO”
1,666,277,099 *AF5DEAF1905D5850DEF7138D7739C011F15BE5FC PLYMOUTHPHILORGPLYMOUTHPHIL
1,666,277,100 *AF56B78695908D3ED29ECCB98EA98C9EE4026086 PMIX)
1,666,277,101 *AF5EFEDBF82DF9BE05C285EEC87A88CDCD5E3894 POKERKLUBBURINN
1,666,277,102 *AF560938C56F6AD659B8D5C6F1C5CB43DED3ED81 polabi$h
1,666,277,103 *AF59131060B895B36B8580A27349D93257EF500D 389jaslyn
1,666,277,104 *AF51793CC23354C3705D2B7536AF4B9B5DE434CC 3.avarsivat
1,666,277,105 *AF506AB36A548695C5F21F6045109580540C9CF0 POPSUBTERRANEA
1,666,277,106 *AF5D4DB9B45A6D9B8B2A0CBAD045DE58FEFCCF36 porfiriopursifull
1,666,277,107 *AF5B19C381E1BC795C6D3085673B1E46DAED4630 2-TVO'NDA
1,666,277,108 *AF5B9437991E80068E67D7695F82BE55BED500B7 2UNEVOLUTIONAL
1,666,277,109 *AF556D553E5DA5595E83A75E3D4A5AED6463EA8B portugalliensibus
1,666,277,110 *AF507A74C609ECC7F5E896A12AF578710AA3528C 3 FELLAHS
1,666,277,111 *AF559B47D4B87E54FDB1FCC684ACA3C767D0AD76 3HOWSUXUL
1,666,277,112 *AF578F606890DDA7872BC59F7214A02DBCA977E1 3ILOVEXCOUNTRY1
1,666,277,113 *AF5ABD6DF476B3D6A7EB5BE276BFAAA8CB3F7765 3-KUNDI
1,666,277,114 *AF5BA096FA9F04131C5A8FC558D67F774DB70FDA 3LVEDBSW
1,666,277,115 *AF59EF65B5ED2BF1D9CB267BD059D507D146E71F 2yagdirir
1,666,277,116 *AF590045235C3F5497D4D7C8EF37503BFA208669 pp.978
1,666,277,117 *AF55AE262E1E34AF3F27A04B28935B99C5586481 310cullen
1,666,277,118 *AF572D7553EBC2FDC3B986C1FEE53E6415575513 3SCHEDULIZES
1,666,277,119 *AF56ED361931B9F030336637CDFFB778B2D04B60 [email protected][email protected]+!ON5
1,666,277,120 *AF55676C1B6F31A9D70A1C16EF316CC847BC657B 3IAMHOSEHEAD0
1,666,277,121 *AF5DE5F513BC447AA0E688381D7E99451292B8A7 470437 DIESZOGAUCHDIEKURSEAMAKTIENMARKTNACHOBEN.
1,666,277,122 *AF5B3AB1974669BEE49F9DCB30BEE74C770C87FF PSORVIK
1,666,277,123 *AF5006739122F828247A50BBCD5868185C93633D public relations
1,666,277,124 *AF5404DF180C5ED2A75541DD972F5822734D87A4 4IRIZIRIZ
1,666,277,125 *AF5E4A419C6D15D870598B10E6D2D7B1CF772693 4MYWINTER7
1,666,277,126 *AF5C8E39C4C77AE8C7786B110892B043EA0EC453 4REINSCRIRAIS
1,666,277,127 *AF595ED88E63DD3C64C7F33EE22DD696BA9C2504 Q###D.~.~.(00)
1,666,277,128 *AF5E8804274814708E46493D24B5728E83F5FA05 4SPEISEFETTE
1,666,277,129 *AF584DB1329CB21B6168C23320855E4C383FCA22 4STUDENTFICTION
1,666,277,130 *AF52157FAD0FBEE0C9EBAB27C25B1E8B8602E242 4 suomenhevosyst
1,666,277,131 *AF51B8A86C160492FC1B658C2A70F74E7A16D1D2 4THEMBISA
1,666,277,132 *AF5F0CCAB58AAD0AD15A3EE64798ACC42AD7D1EB 4.ueckerausstellung
1,666,277,133 *AF585BC79BE468C3275EB0A7AFA8E8AEFD4FE468 4INYOURBESTBIBANDTUCKER
1,666,277,134 *AF57E0B7B4F983538CEA5E4665F98849DBBFB984 QLN:
1,666,277,135 *AF591E38A12E8477DE0A429735452B42AB3F4A30 4KRAAMED
1,666,277,136 *AF585170ADCD2E8660E68A228B7477A6D1CBC34B q--P~0-(>-<)
1,666,277,137 *AF51AAD0944BDAA8AA41BBE9B6C5C2E0BEE2D412 51ap571ck5
1,666,277,138 *AF570E4DED05FDA10567FC0EAB7F5F9AB52952D9 59613C
1,666,277,139 *AF50136AB2EEE8A158BE7B0F438A1AC0149EB92A 5abandone
1,666,277,140 *AF5BC859492F928645066C3BA3574674ECCFB4B2 5ASSISUU
1,666,277,141 *AF553BB8141B5A9F2BC8416F7633A5FC4FC4AC1A QURAN6512
1,666,277,142 *AF5685D1DBA2F33B46B608A1837C09A923B59AF3 4RR3P4NH45535
1,666,277,143 *AF5AB8C86772CD352CB8476DA64D00A26362631D R8H'
1,666,277,144 *AF508C05261E992D80FC64421749CFF6A7211F83 4ZAKUTKU
1,666,277,145 *AF51D593598C0DE0DD1C4292396692F760896156 rahimić
1,666,277,146 *AF574336B4C1B62B37ABB2C8B7C5F82FF5FF301E 5MICHAELCRYSTAL
1,666,277,147 *AF5098599D28EE5DCEEB78D55C0E4F98C5280E63 R"AR
1,666,277,148 *AF5DE09B25A1F373DEDAF9DDC19D91BA4E914D3D RBDRBD75
1,666,277,149 *AF5FA6CD6AC572F3E511BF22103C93862C2BFD5D rcuneo291
1,666,277,150 *AF594E55FD2701E397ADB2B44C2490F99C11B431 5ILUVCRUSADER4
1,666,277,151 *AF549BCE87EB72813DB41757F5E46BC21D06A7EC 5.OHJELMISTOTY
1,666,277,152 *AF5112960656805C300499CDDCA0D26EAFBD9DA4 5OPINIEERDE
1,666,277,153 *AF5AF13C9D18969375400C8A33328A3E931752A5 REFORMNESS
1,666,277,154 *AF53A30CF4313D3DCA1695C5E3F7C5CF1010FD4C 5SEVISMENIN
1,666,277,155 *AF588CB5E1287808F54B6FF9EEBA8A4129C3698B 5SPECIFICDUTY
1,666,277,156 *AF52166F49DB1946E570CBFF0A19051484D73D41 63ma
1,666,277,157 *AF56BD09A19B025F680AFA9D3595DD69D0363F67 5TARZANCAMPBELL
1,666,277,158 *AF5D6339F335B3C834DCC62774AA175526F4788F 5TEQUILAFLIGHT
1,666,277,159 *AF5A35FA0F162CAE5B2D22ED6244CC3FD12DA68D 694149 betul gulsen atalay dyt .
1,666,277,160 *AF5726A499B388CCC0353583CA2433D6CBB141CC 5VICTORYHORNET
1,666,277,161 *AF579D9698F54122F35DB7483D79E904013A2919 6AUSBILDUNGSPROGRAMM
1,666,277,162 *AF588943F02BBF3F7F0B55BA6AEDD308F4E3271B 6BOUNTREE
1,666,277,163 *AF59606BB5AAD2DDC8875F81300FC75E4CFC6380 REPOVOAVAM
1,666,277,164 *AF5130A3A114D725517EF9D31CD21ADE9F438C0B responsible
1,666,277,165 *AF5C66B20F2C00325B1939A3F820E35F2B0433A9 6KONSERVENINDUSTRIE
1,666,277,166 *AF561ABF328528460A401B32D434731652A2ACB3 6MELENDERAS
1,666,277,167 *AF5061051CF0B297B9FA59D9EC42FD8427331151 REVIDIRAJU5
1,666,277,168 *AF5FFEA20D768B3CEB205AB985697379B423EB70 REYBARRO
1,666,277,169 *AF5FEDA2394EF34B72FA60E1CC8DE725F1D2C0C7 6REPAYREDEN
1,666,277,170 *AF5DCE599D898D75F99815752A23933C3D2910CB REY.SAKATA
1,666,277,171 *AF575F2B2054159F13DB6C19CA721A123CCF1653 6SPLENINIIS
1,666,277,172 *AF535113216B801833C61930AEF00A7B666B73AC 6CENIZOOZINEC
1,666,277,173 *AF569E300B1DA66FD2DCD439EEC4642062333464 6CLARIFICAIONS
1,666,277,174 *AF538547CB219594F9BFD6871BEECAA271773B13 RICARDOBATTS
1,666,277,175 *AF5316AAD2F09AF8DEC36D2D9A88E0E16876298B 6VRELSEANVISNINGERNE
1,666,277,176 *AF58A35D3ADB075559F7161887FDDD76D90D1117 6forleft
1,666,277,177 *AF57467227AB5C77E73B0081A9DB8593F79DBA9A 76628 das war mein groesstes problem " , resuemiert zinner
1,666,277,178 *AF59784A731194854F92B1C7D4912AD9ECB06562 6HACKERDUDE
1,666,277,179 *AF59F2EB5BB5017FEDD16A12C95C5F566B7069F4 6HISTORIASTEIS
1,666,277,180 *AF59FE9AF76525DF433C77417293C68269114DE4 RICKY.BADE
1,666,277,181 *AF5A6F6B057A903C1F7814870B6C6A68439D96BF RIGOBERTOPEDRAJA
1,666,277,182 *AF5125B604FD1570B865F7BFF58B7EE63EAB8824 6MIKEYNEMESIS
1,666,277,183 *AF592B3986B343E1DA31A168964459DC6B470D4E 7demangeront
1,666,277,184 *AF5D7D3E609990113714E0F5D320DB0CBC0EA0A5 7DRIEKONINGEND
1,666,277,185 *AF5ACA16464D2D34E6E24B0B7D933FAFC5723C12 6RIVERBOOGER
1,666,277,186 *AF5492B3DE7BEA9BCB28F7A1D0B16CD72DAFB611 6SAMMYCLAIRE
1,666,277,187 *AF58D0F2605458C85B34296EC002414A352D3B35 rileyd
1,666,277,188 *AF5268C0CB6F164CB92CB880A2735A202DDA43F1 6THATSUTTON0
1,666,277,189 *AF5C001981A243B60A3910C31A83D5B18D427016 717717 deephoisting.
1,666,277,190 *AF50C95006410A5634142137806A69CE6024447E 7MANDONES
1,666,277,191 *AF55B6C121D58BD16E5F3E78CCB0641D1FFD0DD1 76B8C6B7D41237A7A519550C0E57B911
1,666,277,192 *AF598CC329E3B631D67B2826DBE144F977433D26 7PELKURIM
1,666,277,193 *AF5C97E59685C80AC256D69B6E60B58F52F6DE81 775534 DIE.KURSLEITERIN.GABRIELE.SEIBT.MOECHTE.ANTWORTEN.GEBEN..
1,666,277,194 *AF579D39DBF1FACE356512BA525BD263A33C6D56 [email protected]
1,666,277,195 *AF5BFA9252B6C27478BEBF7D9AF312FF73753709 rockin'-mama
1,666,277,196 *AF5302DA57E256C0FFFCB890848F4BBC50EE345B ~7raaa
1,666,277,197 *AF54F096ED3670F6F4D63406DA020139F5AFD241 7TCSECAH
1,666,277,198 *AF5C750D0720ED2A7831C5FB956CE3C4DA7EC6A0 RODRIGONORLEY
1,666,277,199 *AF51AAB55EBF2376BC3C144D0255892DC455FEAF rodrigoupchurch
1,666,277,200 *AF5B3703357906555B6529BDFEB3FADDB78AA312 ROHAN286
1,666,277,201 *AF50294141C52FB7752257BBC47EA4020832BF34 ROIL?
1,666,277,202 *AF556FBD6E98ADC28E18B4429BA7EE7033097AB8 ROSS.CHILDRESS
1,666,277,203 *AF5D4A6579A746F255BD9000C8AD4C79C563A142 ROSSVEATER
1,666,277,204 *AF555A0344EEC22A230F5C7486C161C93CF0027F ROSSZEOLI
1,666,277,205 *AF554F092E9D6B591DDDA4DC310F27B255DD496C 7TTMARISTT
1,666,277,206 *AF56E693F3049A65E7D7FF511E108ABA51248030 ROUNDEDLENS
1,666,277,207 *AF54898AAF0A64462D85213D0AA29C9339C0BF0A ROYAL GIGOLOS
1,666,277,208 *AF5CA08D8DDE458FF37013C871A9FA0FE6054F97 RSP1R4T10N41
1,666,277,209 *AF5E5DA7200E1804BAD5EA9BC5DBE8C77E297FA4 835887 COK-INCE-ELENMIS-GUZEL-SOZCUKLER-SECILMELI-
1,666,277,210 *AF560A03B83EF8D9FC9453AF0F766EC4BA932254 RTSKCIRT1
1,666,277,211 *AF52F591338C5364AB42DB6D7D1BD947BB6DDC6A RUBENSTAINBACK
1,666,277,212 *AF5179896BAD3FB5467FE233F339EC6DDF912BBE rubinalexis
1,666,277,213 *AF561FE336DAA625F80239883A6FD816BCC4E232 7EADINOIR
1,666,277,214 *AF535404AEEB9B81B091DE79C3BD4C1C5BDB2665 RUBINMUNSHI
1,666,277,215 *AF53C5FEE527574926CB9C5472F144B2CC8CFE9D RUFUSBRETT
1,666,277,216 *AF5A50C82EF9432A90A2B907CEA1CC561993ABA6 7ILDEN
1,666,277,217 *AF58249E221488921CE312B2BA5931297D658669 8~aaa
1,666,277,218 *AF548F66BDE05A51943E79B02C534CAFEF2363B6 8anahi
1,666,277,219 *AF5C527AC468D407127CCA301530ADDCAEB8E08D RZGWACFED
1,666,277,220 *AF51A0EA6A2DA48C80D7E138B936273B4787A800 8D~0~osplat
1,666,277,221 *AF52144FCCC867F68FECA2754DB33024EE84C846 S60870
1,666,277,222 *AF58CAD4DD24ED120BFF0BCB9FB3EE385B755208 SA
1,666,277,223 *AF5E71ABC75252E666B9FB48B204AEC046C5F05A [email protected]
1,666,277,224 *AF5067253A0D4179C0F31AFF08B8AFDAAC611252 SAERDNANING
1,666,277,225 *AF56227A374760692CC53397343CFAD32A81D015 7UTOPIAMAC
1,666,277,226 *AF57333C383BFCB923636952CCB914E8A67C8574 7WARRIORSMOUNTAIN
1,666,277,227 *AF50494D67DE95173A3A78738D699EB4628D8523 8HARTWEIN
1,666,277,228 *AF582445903B7DA39C5013B6F023D90F1B704F81 830fernando
1,666,277,229 *AF5BE487D21146BAF93253C6426656DF3E8CFFBB SAMALEXB4
1,666,277,230 *AF5042FC37198A4197EC17851B23CC42B851A90B 873MNBVCXZ
1,666,277,231 *AF5CD5192ED447A10351C4BB2C259740FDDFA6A4 SANDRA.HENNINGS
1,666,277,232 *AF517E3463B462A882E07E0E7F77289F13AEAE4A sandypalombo
1,666,277,233 *AF5921F562A776739801378ACA2FC6A7453CE25D 8======P~0-~o-:p
1,666,277,234 *AF5AF5EADEF71CCC22A46616C1415173D9B396CA 8PACIFICCHEVY
1,666,277,235 *AF5ABAFB98F12C5E97658406ABFCE3B66185E1B0 SANGPHERSON
1,666,277,236 *AF5219AABC8232AD3FAF3465879A1B185710E8E7 8##p*-*-*}o{
1,666,277,237 *AF53D2365AF882AA0BE0098F95BFFD91CC470D37 scotmartinkus
1,666,277,238 *AF53087A3790F60F2EDEAB27016CAB154A0CC625 8SPIZARNI
1,666,277,239 *AF52BF508DB72F49D71BB3A4841C8125CF95F281 8)~~~splat!
1,666,277,240 *AF5A4285030D67B95124CFE31DF7146A54837B08 seitilavo
1,666,277,241 *AF590F5091A3B17177D8C1708040CB133F09B01D serienmorden
1,666,277,242 *AF54E2BD85E18D0BDFFBB42BB2CB8FF929DA55A8 SGRAVANDOVI
1,666,277,243 *AF550615AE822C52FDD98CB01F4EB5A032E7ABA0 8SHARPNESSN
1,666,277,244 *AF536BD437DA8DBB0F42AFDC1B0ECC62D951894A 9iloveblahblah1
1,666,277,245 *AF50733DD49B2215896979BC0A3CA0DDF7D7A580 8STARGATEPANDORA
1,666,277,246 *AF583D269A1FE10A6D0B6F59D36BCF52EECBB563 8STELLABELLE
1,666,277,247 *AF594043EBA1928B261EDC2D3827063776EBE20C 9L0B4T3
1,666,277,248 *AF52C2514C6506571FC7A0E1D7EB188F25F7DFC2 9LAURIECARDINAL
1,666,277,249 *AF5D768BDDF92A95F9E8C9811752E7DAD71F72D4 9PASSIONZORRO
1,666,277,250 *AF58A460C046618237F16EAB6AB266B8F83B5EA2 9PIERCEPACKERS
1,666,277,251 *AF5418A7B162B42230B4EFB268E97C99598813C5 [email protected]
1,666,277,252 *AF5FE3C050C331FAAF2FCF7C810D03FBA261E9BF SHAWNARON
1,666,277,253 *AF58E8E0FE07D1502E64B9F5527240E77E0810E0 9SUPERCONSISTENCY
1,666,277,254 *AF5BDA4A4C8B1A85AB7B37BD898B0BBB21CC2AB9 9SUPERGOBLUE
1,666,277,255 *AF5770FF0DD49518F01A245CCE8A36E6BAA46D8B 91519 red.dog's.location.presented.a.few.hurdles..
1,666,277,256 *AF5695D147905E15A3A787FF50C72F8217F95C87 980arvojen
1,666,277,257 *AF50AC579CBE2DC6C0FFC2073E365A3824A92187 ;&a
1,666,277,258 *AF56D710A642228192111FF08877A238DF9EF8C9 A&1T
1,666,277,259 *AF599013F7D3658FB8F8E4B99C1AB4A242BA633E SHIRLEYHOHMAN
1,666,277,260 *AF500E8877F3214E6B691DE6BD1A06577A7B078B 9ESCANDALIZAN
1,666,277,261 *AF52BBA9805BB740A25D5FC4EE2365BB1CE4F46C 9NEELHTAC
1,666,277,262 *AF5018F603D48B5602018D5E07971AEB3A31B9B1 9SEZONIE
1,666,277,263 *AF5B4B6F8C3DBCCCB08821EE9C82CE78EC174EF5 9SYSTEMCUT
1,666,277,264 *AF587FBE4A6B8C67372A27A086B7A0FD6113A92E 9XSJADMIN
1,666,277,265 *AF5866FD96CC4C0465FE97EE647C3E0BF175BB29 a+/+7
1,666,277,266 *AF5A56F132F41BD62DE82D287B2CE7A94EC91241 A.1IT
1,666,277,267 *AF59D21F196F9D3CFD7B7E8E509C01D6E70D92CA aankreeg4
1,666,277,268 *AF5AE8049F9C3F5D9451AA214EFA308EC3A78201 AARONANICK
1,666,277,269 *AF58ECA1085D98D33BA4D46EAA8E41536548264F abortion
1,666,277,270 *AF58C7480562DB653E20092575B19284DCCBD959 abbottjr.
1,666,277,271 *AF58A4E5D1CE298F51E96CC5FC768519309144B5 ABELTERHAR
1,666,277,272 *AF5B5C09400E6F184DAB9A23BAB1066C82B49406 abendayan
1,666,277,273 *AF5BF12C3408EF1E3E629C2C1C5EB23A10988E9C abhyarchaniiyaam0
1,666,277,274 *AF5E8219F53C01C5E9AC8FE95D615D706C37E597 acioh
1,666,277,275 *AF5C5D6D84A8A9C6A52EA9B4A18BCCBDFAB0DED0 SORGMARSCHSON.
1,666,277,276 *AF5EA05AD7A2E7BEE291CA9A217ACCCA2EF12DC0 ‘adat
1,666,277,277 *AF5F6E3343B640D062C336E4C02A97429BE9EBEC SPALJENJA
1,666,277,278 *AF5324A4CA9F8921FF8437A8F0ACA451DC8A6F13 ADALBERTOTORNO
1,666,277,279 *AF5B744FC44E8ED5EEE04F0ABC4E5F1D6EB57536 ADAM.JUREK
1,666,277,280 *AF57E6A5FDFF66583BFEF2C5C87226AB2F2B9392 A-Darling-Who-Can't-Wait-to-Taste-You
1,666,277,281 *AF508211C7370DC8B093AD640FD3FF9EB223BC47 adatvamed
1,666,277,282 *AF5ADC4820045CA0BE96D31BC7B3F2717C81452A SPLATO~ 0~ D3
1,666,277,283 *AF574B88F3CE4C820F4EEA0A4408E39818260561 ae,bu
1,666,277,284 *AF5E0AB6221F02E2C9B321A86FBA342692835406 SREOMETS?
1,666,277,285 *AF5E10636898ECCD9F1879B950CE820778873923 ÆRESGALLERIENE
1,666,277,286 *AF58282FFFEC3A12C0126F2BD36B4E8D1797461B AERONAVEU5
1,666,277,287 *AF505A68487D53768C859E0F89CF2602B5B7B64B AEZUO
1,666,277,288 *AF5746CC9AF76FD139A3F1E04CF0D4BB6F05BF78 AFYODOROV
1,666,277,289 *AF54CEE0D78B3FEAF7578D580631F50D877972B2 STACY418
1,666,277,290 *AF5335524DD03FE538B58BE8EB022DC21866B7D2 STAMENING5
1,666,277,291 *AF5919CDCF15E8F7024F5194F03D4EDABC9BAA54 AGNESJANE
1,666,277,292 *AF572C2622D9CA1D30F620A80597E3083FD86ECB STANSYYA
1,666,277,293 *AF596D22CE50445C43036456841D81FA16A1DD1E AHMEDHOLZHEIMER
1,666,277,294 *AF5D969D0A5C4211159F592918213D93BBB1B884 STAREAT
1,666,277,295 *AF5FF02EB6A677210F73E63475BD97B30B4CCC72 aj_k_
1,666,277,296 *AF5A1F64555FF515BBE6068FA548F859742C2398 aiovve
1,666,277,297 *AF57F31E0B9B839EAB1C65C9106A83D4C46FC082 STEVE.SLACK
1,666,277,298 *AF55C17FCB14A17A951B27515C57B4C7F7818F0D STIBBLES1
1,666,277,299 *AF542D87DC021624E55FC8F327FC86C6AC42C97A albertswadling
1,666,277,300 *AF56A71B5A25CAD191C2C09B5F093597B0D7A2E5 stretchlimos
1,666,277,301 *AF5A496D6B0B33E529E12AC973BE0FBD9522AC58 albertomanna
1,666,277,302 *AF54E7CDEAA72B6689BB4F82A4737FC1DD1028FE STUART.DAMBOISE
1,666,277,303 *AF5FBEFA19662C703DA45677F443B4D94E3439B5 alexissuro
1,666,277,304 *AF59C8308AE284E862BADBAF6711469BA3759ED0 STUART.WYONT
1,666,277,305 *AF5196E0C5CDEE36B30885C30B42F74043C54255 STUDSYSES
1,666,277,306 *AF5C265E142C0C669A89D8149E47A408C90CD19E Alien-Chase-on-Arabian-Desert
1,666,277,307 *AF535E475EF1D02CBB537C6EFDB3C9FBDD125288 ALFINSUCEDE
1,666,277,308 *AF5C168133D07234D956F5B6182999D30F2A836C SUNFULAN
1,666,277,309 *AF569E53981C123EAC7F6245B83BD55736456536 alone--system--In-particular,-subjects-and-objects-used-for
1,666,277,310 *AF559DE358D314905AC5A80FED024564B9F4A055 SUPPLANTASSIEZ
1,666,277,311 *AF5FAF4BDC8735A4576BB04DAB66C8FA75A8AB13 [email protected]
1,666,277,312 *AF5603104A1A43529B2AF497BE01AB5A79F19E37 SUSETTA9
1,666,277,313 *AF513112D221C738576AEBDC555F97B6C29224CB almihtin2
1,666,277,314 *AF523B75D55AE70F99994C6BCB831ED6C0CAFE3C a,!$m
1,666,277,315 *AF5F6661B2FE67129BB564B065FBA7DB607F1B96 AMANDA-HOWITT
1,666,277,316 *AF55A517389312E519954FAF7E6EFD23289CB5F1 taddiza
1,666,277,317 *AF527F6E726C91E6A61FC3546CC1BB010CDF8F93 TAFFYTRAVISED
1,666,277,318 *AF591984F7E7D68E46AC8F209E2587B8CDA0B9B9 a"m(8
1,666,277,319 *AF553478D28E77457765D1264B9910F9E04A914B AMOS.ORTE
1,666,277,320 *AF552A30835C78492879475533BFB19F00EF0E0F TALKI123PIE
1,666,277,321 *AF5A56D901DFF95FD621AE5B99BDBA0CCA8BBBB9 ANDBRINGOURHORSESUNTOLONG-LANEEND;
1,666,277,322 *AF52A2D02C40BA0198A155287DFEDBA0BA29E406 AMYDON.
1,666,277,323 *AF50F196FB78E225879CB1E4D265EC78DA03D758 taner-kaya
1,666,277,324 *AF5A2AE412C92A164561F45249851C6847E908D9 [email protected]
1,666,277,325 *AF5CDFD772F711EAF6B535E3209EE10001EFBE6B ANDREA.DEZERN
1,666,277,326 *AF5B3D32B77928E9DFAF72C246E1BF0F2A88F5AD andresnalbach
1,666,277,327 *AF5A20E9FB2D35A2956587874BDD8D2A699A0AEA [email protected]
1,666,277,328 *AF579D2D36B28844ED083FB39AD5D846CAB05E21 ANDRESPATTIE
1,666,277,329 *AF5768818C1609AF6CD4CD2BC64C6CF41F6860DA ANGESAGTE4
1,666,277,330 *AF5B7FD66057DEB2FF08CB0DFD6BBDCBF330EDBC ANNABELL'S.REEL./.THEME.TIME
1,666,277,331 *AF5B4B073AF98F6FACD427655A8988A516267C4E ANNIEGARET
1,666,277,332 *AF51629405DDE67E879CFF29A90AB0D9A0DB9D13 tentieux2
1,666,277,333 *AF54724F846E0ABC56BB54A2E5F460E47846921E tformede
1,666,277,334 *AF5D03EE9608BD83904C36FEE0C4AFDE7EEF6EFC ANGELO.ELLINGSWORTH
1,666,277,335 *AF56DC0564953F719614C70919E21F0B02AB5EC3 ANTHONY ULIBARRI
1,666,277,336 *AF5187B868CA31E1373CB58619A0875A9DC7E53A ANIBALSPITTLE
1,666,277,337 *AF5E071462FE36C78B13768A3DDD90BF4215E069 ANTIONE.GENEROSO
1,666,277,338 *AF5C7BFEA9CEE1CA0FF3EC8F75A1C27BEE13EFE1 THEBEAVIS150
1,666,277,339 *AF550145ADA6454462C08AE9CD4AEC8B85A920B7 ANNATJIE-JANSE-VAN-RENSBURG
1,666,277,340 *AF5644B08DB798AB461ED03B747AFCADE2399818 antonsundby
1,666,277,341 *AF5418D341C9D27544CF871DFAF1C72B5EB18A5B ANULBSW1
1,666,277,342 *AF59C862AEC513B6B4F588E38A0A905CCB8D3475 aopvk
1,666,277,343 *AF5828D553A6F21DA539080D9E09918D8C0D7BA6 «THEREMIN
1,666,277,344 *AF55E81FC7146F562A03A1FF800D11206F373A0B ap(8b
1,666,277,345 *AF542F7368583AAC185F94B64B1A83362DF7EE55 APEP"
1,666,277,346 *AF5AF36B2943B2156E25E1903516BF849B795492 the.sun.rises
1,666,277,347 *AF57B963A98229AB0EC60052BB26E2BC344E5E59 APATXEGAUA/DESCENDENTSDELCARRER
1,666,277,348 *AF5D9616AF4723174C9B512278643BD9EABBBBA0 TIMAMOROSO
1,666,277,349 *AF5EB162A2DED0EA28A905093DC2A9105BB739E3 AQPKANALSSELBST
1,666,277,350 *AF54E0D3B23C884B16516BD4C8BB22D4BB75022A a,#r0
1,666,277,351 *AF51D5DDF0874DB93719A3EBD9AFB5711CE89A0B tiredbrain
1,666,277,352 *AF56D91E47AFAF518F86BA175CE7CE6D161D9CDC [email protected]
1,666,277,353 *AF57A89411044CF26572EFF5F1134B2A05A524D1 ToFollow
1,666,277,354 *AF5FC853F0AD3C8C6F17458AA9A4BE8117E3CC2E TOMMYRISS
1,666,277,355 *AF5CDF2DAA03BEE394F5ECE744948A287DCC1944 aruw2
1,666,277,356 *AF53B22E9686A8E932D036DD3C8E6725D3324211 ARTTEMDA
1,666,277,357 *AF5AA6149B7051B1A4215FBD463F817356B3245E AS!+E
1,666,277,358 *AF543177BEF046509942BF4E918169A5F7200ADE As-little-shall-the-Frenchmen-gain-thereby
1,666,277,359 *AF58CE112DB3AC8BF5691A2A969BCD46EF55125F ASQ=
1,666,277,360 *AF5F783C72DD037718913A9549716B67E15FB8FE [email protected]
1,666,277,361 *AF57C4F5823168EDB2930BB344216D0655590659 ASTERISCO-LITURGIA
1,666,277,362 *AF5D2DE4E01C1A3591E767868AA1FCF9C7264B44 asto$
1,666,277,363 *AF5CDE9781D8EE995D3EEB0FDC2B725E6F012D0C asyll
1,666,277,364 *AF5985BFEDBC6A2193E12C57E7335E87008593E3 TRACYWALLAKER
1,666,277,365 *AF52A31BBB21DA6870FD8FD5FA72DB5DF7C331C9 transconscious7
1,666,277,366 *AF563BD57D6E980E471B970E662A23FE4BF4B14F aurez-vous
1,666,277,367 *AF5A3F957C585EA67C773CB062234A9D08A942F4 troyhamons
1,666,277,368 *AF5C266A2F3FD4C4225EB13ACFF0DB587836D974 TSEDALDEPEIZA
1,666,277,369 *AF525B7202CDA4DB7916641CF9AF74581E18FF2C TSINOITALOSINU3
1,666,277,370 *AF5C4A897217D3D681DB399BF925E95A449F98B2 AUNDOTTORDELLAMIASORTE
1,666,277,371 *AF50AC1FF9FC17D6314C168C7A63CDA18D37FFFD auslq
1,666,277,372 *AF57A8BC9972654E103A41FC3A5D453CD4BC63FA tuanjanbbs
1,666,277,373 *AF5357CB9B3AFD0EE4F825C296CB330D3D64ADB6 AuVR
1,666,277,374 *AF5A9E5745C8BCE284088F2FB6DF79E547D39F14 AXPD?
1,666,277,375 *AF5CD99DFB2A7F8D20A6E84A84558923D1732455 b?"$0
1,666,277,376 *AF5913FA975B5DEA10C36661B601FCC9487B7957 AYQIMPORTA
1,666,277,377 *AF5FD9900A2E825C4B60E4EF32BD095C4C4618A7 AZCKJ
1,666,277,378 *AF58E2AB26C0A22234E98363ECDA792802B400F1 b3cck
1,666,277,379 *AF512B14B5579BA9C1BF39119057E6D228FD4EF6 UANAB
1,666,277,380 *AF57747B8A3935E3E5FAF1264CED5C1FA122360D b4kce
1,666,277,381 *AF5CA281FA5904DC47D50D4986D9EBC7F0ABCA25 B24=
1,666,277,382 *AF5A310A544D3DE88ABD087F893985DEC0244B27 uimrlq
1,666,277,383 *AF561D9E7976C6851745DEB657CAAD41B4DF0EEF B4ND.SCRE
1,666,277,384 *AF5E2BBA5BA86A591571B0315E2BE6139C5A683F ulrika-peldan
1,666,277,385 *AF50C82A690671574BE23961ED6B6026DAE45671 ultrapopish5
1,666,277,386 *AF585339C54C422CD2C30D1EEC77850099757BAC babysdayout
1,666,277,387 *AF56445C700E8100FC48285D858858DC95FDEE0C b8klb
1,666,277,388 *AF58679B4F442D7A98FC198A2A10A561F03D8FDF BACHOTERS8
1,666,277,389 *AF5EE6D68A84593B193CF38865927226B998AC60 B"ad
1,666,277,390 *AF518A9AD6422027DBFFBC46DEF56CBAE7893228 baikerite1
1,666,277,391 *AF525170127F50DC260F764867FE1976943F0BB0 b?a.o
1,666,277,392 *AF5E0576DDFA30D611B372C42423409AE551E472 barranco--b-aa0-r-aa1-n-k-ow0
1,666,277,393 *AF559A60C5E2E93660864992220E663E28C8424E UPWARDFAILURE
1,666,277,394 *AF59B9C1EF283953CDBBE1CECF908975D6C399EE USE70.187.219.134
1,666,277,395 *AF552DEE4FE771B7AF1C8A5082392E49476762B7 BARTON.KAMPS
1,666,277,396 *AF51AF3E189898C5B653C2D42873CBB759E23591 bat-1
1,666,277,397 *AF503B8AB151DDE4CB0F1B95BEA8D933E0B9A668 basilrivadeneira
1,666,277,398 *AF501C5CA8B7203767132A855D2D54879AD68684 /usr/src/linux-headers-2632-24-server/include/config/audith
1,666,277,399 *AF5AAA34000655F184B41D8F2CCB50F696916E3F usvt
1,666,277,400 *AF5CFF206E0BAFF7C2818A8CA546116FFF9675AF B/A?V
1,666,277,401 *AF54BFCD9D1807264373ADA9F67F679AA772E01A «VAMPIRES
1,666,277,402 *AF51D8B7FC9520DE9757F6976B616726E6113688 bd0f)
1,666,277,403 *AF5292CE0A7CC250C18E9460DFD7740E5A6A1778 varshaangel
1,666,277,404 *AF547D7FABFF9E894F25737E281890CAF613E2F9 bdpoints8
1,666,277,405 *AF5324F75CDFBBC38C695E5BE226946D112E2FC0 VENDICAMMO9
1,666,277,406 *AF5E856C2E0F35F37E352F631A0F91B48D0C2797 beaujagielski
1,666,277,407 *AF564EC0EC330544B5BDFE816D5E6FDE67AEC14D VERBURGERLICHUNG
1,666,277,408 *AF5CCFBE853DA5D4C12E24FDFDDF135416E98B12 veronica.mendieta
1,666,277,409 *AF5992B4F45A1EFDDAC58AB0370C8A8CFCD6C611 BERNIE.SLUPE
1,666,277,410 *AF5363EED6A6537D958C4DCFA748F6B3FBFDCE44 BESTIRRINGS
1,666,277,411 *AF5D0BD61348BD1D05EE1035C65C46A867DD010F VICTORSCHROY
1,666,277,412 *AF5D88A6EFDFCF2A039436F653EBADA626638FD7 bglfd
1,666,277,413 *AF5C909887248293466B657FFBE313C0C2E4B273 BEWLEYMANNION
1,666,277,414 *AF59CD265A9DA1B5E08A083FDE434135E78AD46F bfhqh
1,666,277,415 *AF554C661F83B9CFA2DF386433CCF24A322BA90A bishopthetford
1,666,277,416 *AF592F1425C481986FD05D24191F1E95668E2DDD BKRNTP64AOMM4GAJLJWZBA
1,666,277,417 *AF5477FC71ECE2236C240E3FF1FD82B6FD4493C3 walterwalleye
1,666,277,418 *AF5CAD6544E9EA8CA156ABA7FF2F847F32F8C541 wamika111
1,666,277,419 *AF5CD9C142F966C0825C95A59089CC373BF4599E bm5
1,666,277,420 *AF57A5766069E98DE22DE5D6B0FB5CAEDBD6059C [email protected]
1,666,277,421 *AF54CFEAEB20FBD75C68BACA82B18F22D8E28F72 bm5
1,666,277,422 *AF5EA221D4CDE5A137B71FD006A63505C4EDEA70 boa?#
1,666,277,423 *AF57E6A9CF63B41981B2293D40A1D0B14C373628 bobdy
1,666,277,424 *AF5797D2BD303442C08D0BB8254A95BABAA73839 B/N)Y
1,666,277,425 *AF55CE8B147456B978E3CACB91844C12F12FBFB1 WEST-SUMMERS
1,666,277,426 *AF582DDE7BC6DF6CD13B18FE0AB689B113C7093C BORABORASYNDROM
1,666,277,427 *AF55B8CBCB139FAACA9D61ECD7D2DF20CD9C1749 bp,
1,666,277,428 *AF504629BCC3E7E1F063C2663444CB59BAE518D6 whitmore-jr.
1,666,277,429 *AF52BFEA3B60424BF2C412E5B3F5BAFD84F5A5B3 BRANDENKLOOS
1,666,277,430 *AF54ACA4153B445A21BDD704778E4D3EBE5A7D3E brd_j
1,666,277,431 *AF537CD5F4241B8B91FB437B5AE76F5C4EAF1119 BRENDONYBOS
1,666,277,432 *AF545368145F359B09B2D1616626DB9DF89781AF BQN&
1,666,277,433 *AF54DEAB33B7C01F3F1392A26233B9EC627E0A8E brettwinemiller
1,666,277,434 *AF539A30C6E94B1D48A4B11D23D75A16C2027206 bradley.otoole
1,666,277,435 *AF53D9AF8DAB57CD7D8C9953E80624468A56704D BRBH
1,666,277,436 *AF570DC9672453D86EFAEA7B6B4A757D009BAD83 BREAK.THE.SYSTEM
1,666,277,437 *AF50BFDB4C69956AF7240B7B190E4EF368E6D8D1 BRUCE.TSAN
1,666,277,438 *AF580ADC9397125E0C40947B588F764FAC59164D [email protected]sqrcom
1,666,277,439 *AF56D5C39CAC93303283A1EF1310DF1F00960630 をヒットさせてきたWINKにとって初のオリジナル・ナンバーワンヒットとなった。通称「
1,666,277,440 *AF5BEE97CF8C1C3D541C75F826A25CB1F2614C1D WINSTON.DELUCIA
1,666,277,441 *AF5AAF0700086073C41628F8A1A0569F7792617E BRYANDETTLING
1,666,277,442 *AF59EA17AE4B4635774E13875AF59144443657C0 without.you.(feat..dj.steve.l.)
1,666,277,443 *AF53538383709844C082AB7C9A47922AB7F4B7D1 brku1
1,666,277,444 *AF5316161C565518E8611258B6C8D985CB366DE7 bsglw
1,666,277,445 *AF586626A2AA153CD277E541CD48DD269BD84843 bswrngsbsw
1,666,277,446 *AF526D50818C774432DDC986E95DE06F1C52515A Bt6r
1,666,277,447 *AF5ED14E4576BCA1D433D0FDE5176405758D4E90 brvps
1,666,277,448 *AF5AC566771D003E58547B49E0695B9776BEF7A3 BRYSAME7
1,666,277,449 *AF565797DF92E47F1E3157F004B8C35DBDF7F965 bvi%%
1,666,277,450 *AF56C6BCC27F93F277B4CBD5317282415A60374C x5980
1,666,277,451 *AF5372AB5105A4A3DE790C5A843E1D4C6A038821 bxup
1,666,277,452 *AF5D460EB599DF2F5F1D9B3970D208701AFFEB68 BURTNEWCOMB
1,666,277,453 *AF593EA022352A3CB2696E59050DFBE6D2453536 C0GD:
1,666,277,454 *AF5889F762E804E4FE2E00EBD326206F019FBE7B b:x!9
1,666,277,455 *AF597E5A4D60A25A20BA9D9001B0BA23DFE50A49 [email protected]
1,666,277,456 *AF52B9C087AFA15A92E88B2C5962F7C838919B1F b#%y7
1,666,277,457 *AF5B4EA7597B551FCF3E529A636EA18A51532674 )X(.O~(======Q
1,666,277,458 *AF51287FDBFBF95708A4266D9E5CD94064023DAF c0nf0rm4+0n411y
1,666,277,459 *AF536CCED08277AD523B522BF51D251525AC0382 C4STT
1,666,277,460 *AF511B64E47E13A7D001EF6F3E4E4FB8F7A591F9 XYZAWLLLLXZWEF1
1,666,277,461 *AF520421DF4595B10896AB444B125EA3BAD6FCDE C136958
1,666,277,462 *AF5AD81398DD0A1F451990B3238E27439FBFC15F c1baf
1,666,277,463 *AF593EBAFF16021A904EA3AA05CB076F911D3D33 YAGMURYARDIMCI
1,666,277,464 *AF5EF1DB0C78192DCCE547284C9AA49D8D5917B2 YANDIRAFALCHJUSTINIANO
1,666,277,465 *AF59B5E68AF0911DBC14C1A59A4C31D778567E76 [email protected]
1,666,277,466 *AF513D9BEE96F78054588EA15E8AF08DC51721A4 C7?"S
1,666,277,467 *AF5DE651F217F729C34DF067E45EA706154DD75A YASMINCHISHOLM
1,666,277,468 *AF5239D000CF7ACD0FB10458FF6C259B9CD416CB c9hf
1,666,277,469 *AF5F5367D9ACC1D95AC7DFBF3DB7E34FA8AEADE1 cac1e
1,666,277,470 *AF59972757CE4482B812DEE64F2FD3DD6BD421AA c7b9e
1,666,277,471 *AF50696EBB8D681B2423A4355C390824E2D5376E ÇALIŞKTTIRICILARIMIZ
1,666,277,472 *AF57D5B01030757E683635883BA2973F4F842A53 CAIMAGGIED[email protected]
1,666,277,473 *AF5C0C423830EA0B4A640D479CA6EA516967492E CAJOLRY8
1,666,277,474 *AF577194AE498950E234B7601A02B6166D77A1C8 [email protected]
1,666,277,475 *AF572B2BCB9F7EC4E37DE156E85341550D4C964D [email protected]
1,666,277,476 *AF5024DF4DD82464BD35D081034DD3B2FF395D7D [email protected]
1,666,277,477 *AF5E5149D9C32540B086BAD48CF8D509FB990109 youngahimud
1,666,277,478 *AF55A83C1E3129AF365634EE8547192C3218B8FF CARIRANN1234
1,666,277,479 *AF58D26637EF4877AFC5DFB3269B65EABFC9223A YOUSHIMING
1,666,277,480 *AF50855EEA9DB519BA6048C0C5ED4D262C9F2DEE careysanberg
1,666,277,481 *AF593F961A5889A1144F2243ED83D03C21ADB095 YRRETKERT
1,666,277,482 *AF558A38F593A2CA38911C60BBC8B5F6C30DC028 CARIÑITOS
1,666,277,483 *AF5E0C9A86452DA73DBBFFFB6FC354240B4D469F carolyn-willeford
1,666,277,484 *AF5EBE93630A751E920FBDC1E06BD384A46038C7 carrubos
1,666,277,485 *AF5567B61C3CD8802F5A37785766F93F279AE28E [email protected]
1,666,277,486 *AF562F0D4DF94CA8E1B42AC3AF25BF8E5EE9507E y:ue
1,666,277,487 *AF5A2BD8AF0BFBB15C8F1B430FD040C63526CADA yune-akumba
1,666,277,488 *AF51E60785B6ACEF72DF4C04734871B9E683A745 CASSIDYCHILDRESS
1,666,277,489 *AF5FBEA39DA0DC473AB7F8BD9D82E7F5072F943A [email protected]
1,666,277,490 *AF52A16BC4C6B3655B5020D51DD6F0BEE7338911 cc$f.
1,666,277,491 *AF55296F7CB83E8ABD17A451EB281F49179B9162 ZACH-ESCOFFERY
1,666,277,492 *AF5926FCC3E6960DBF3E2AF2CCBE759CAD44877C C-B)U
1,666,277,493 *AF5DF86520BB3E8AA8EF1B6087E62EE37A2DE7AE zeber-yo
1,666,277,494 *AF56ADCA7190C6637B79B38FC254A5AB210348CA ZEEVALK7
1,666,277,495 *AF56EE6AEB845668D828FFFD9AD95E7D0D1BCD61 CEDRIC.TAHA
1,666,277,496 *AF578D8A334019C698C1C21FAFC77FC7AE22E3C7 CELLAN-DAVIES
1,666,277,497 *AF5642550B5EDF3BBA223972B3AD1AF051534BC6 [email protected]
1,666,277,498 *AF587DF5289C14E96536B4C1B58AD4B6CA19A8DC [email protected]
1,666,277,499 *AF5B890693D08745E96A7CCD54EA119C6286E6BA CGWL
1,666,277,500 *AF5975735A6E37658844363A067D35DD9CD4093B chaco
1,666,277,501 *AF5CEF0084C9F9B162E709E710B1E54ADCB90E6E CHANGE-(LIFTIN'-SPIRITS-MIX)
1,666,277,502 *AF531F48DC8C370AFB4BC46C7CC34DBD312B7403 CHC9A
1,666,277,503 *AF585A4D740A3D08F412B7017656C744D1C7C1D0 CHESTER.THARALDSON
1,666,277,504 *AF53946EA4E8538746A076E5AC8E82487FC0FBA3 ZICKERTHAL
1,666,277,505 *AF5EFC764A1E2F5915DF8969EC1A120AEB90783E chaco
1,666,277,506 *AF564B42F2C4F1DBF1CE68C2F72D832CC733B454 CHILELLI1
1,666,277,507 *AF583D49F261329EA7024214FAAAC773B2B61627 CHIP.COM.MYWWW
1,666,277,508 *AF5E9FBF3A271BDF77EAAE419DEC03C960D1FE9C CHANCEGRANT
1,666,277,509 *AF54BED5F37E190F80A33561611EA76AC4569DA8 CHANGLAPRARIE
1,666,277,510 *AF568CBF139313A64CEBDC983CB96B23477800C5 ZPLMQV
1,666,277,511 *AF5AA5D951F2B52CA0829B89858618A23DB027A1 ZUBDA KHAN
1,666,277,512 *AF5C2545D58482B780841C11D2D9147E02801D2E CH$/Q
1,666,277,513 *AF571FA1205E9A91265E12DBF100E1AEB578BC43 chuckkurshuk
1,666,277,514 *AF505EDE8E899F342EC12E3FF1269015183B5E23 CHAUNCEYLESIEUR
1,666,277,515 *AF52B8471C383EBFB2F52889EBAF597A4BC05003 chungdegreenia
1,666,277,516 *AF5D8A8FB2387FF9E5C813BFBD224E67957C54A2 [email protected]
1,666,277,517 *AF5AC1F931905D79D0E3807908CC03DF50AADD26 ауыҙ
1,666,277,518 *AF570DE6ADFCB8034DEA77C41DBDF7F49D0E2791 CHEWDENNIS
1,666,277,519 *AF53C4C0A73C2925465D6FF6B0E714DAED1BA244 chez.campbell
1,666,277,520 *AF5D056C26B86FB5521974D17550AB50E690061D [email protected]
1,666,277,521 *AF5D25CEC303493E37601C952CC6D45C283A45B4 chijuas9
1,666,277,522 *AF55A1D9AC837896A202582FF759EA1BB62E0092 ИЗОСТАВАЩИТЕ
1,666,277,523 *AF57BFA0F1B5F4E7FBC3B1A12D680ED87C35133A CLAUDIO.BAYT
1,666,277,524 *AF5C31F76A69F06486A0E9CD39B21807918FDF6F КАРЗАУ
1,666,277,525 *AF5FF646B198A232D6694985D440812B6B7FAFA2 C&LFP
1,666,277,526 *AF5B25A989034AC0F200DC5CB7F8AF13EA3DD472 CLIFFORDLACY
1,666,277,527 *AF58458D354A8BBEB7D18BEEE3401AF381613E98 CHURUCA
1,666,277,528 *AF5260637063484DF8D68DADB71B5BBD3BF486D9 [email protected]$$IMO
1,666,277,529 *AF5F4B91268A88398E87FFB104CBFAC25633A829 columbuscamenisch
1,666,277,530 *AF5E605D7400CB56FA3723E261C4F84A8B3AF88D commities1
1,666,277,531 *AF5D32F9A08773CA61E8DE7D686A94F6453CB97B CLG0
1,666,277,532 *AF5C23A533D8E1E4C2D9D4ADDB8707D019F711D4 cliffordstirewalt
1,666,277,533 *AF55D0DCA8D27953F70002156E2E3DCA42014F47 [email protected]
1,666,277,534 *AF5F7E5A927365397EDD5A226261C84A664FCAE8 CONDUCTORCLIFF
1,666,277,535 *AF57007FBDB6B1AB06F01AABD1961B90E3173C1E CON+RVED
1,666,277,536 *AF574491D35994D834646BD952EE3DA9AB9828C4 col+8
1,666,277,537 *AF53E347CB4A1395BC5E05B1BF74147FB7B0BE1E col.johnb.
1,666,277,538 *AF528FF735D99EC88EB32D013CEC25D813826F0C c:\program files\microsoft office\clipart\pub60cor\sl00345_.wmf
1,666,277,539 *AF5C37ACA3A89204FD6029E9C5334B9D15DAA7F4 CQ7HU
1,666,277,540 *AF5ACA265EC3F906E01B706C979E434820EE6861 c;(qw
1,666,277,541 *AF5EBD457FB09986635CA16156B062E004B58A28 corey15
1,666,277,542 *AF52890B47D700EF57CDAFF75B285D3C4E435405 CÓ.SẠN
1,666,277,543 *AF5631360FEC9CD9DD8FBCD1A8A69367E5FB2A93 COUNTYTALKTADIJA
1,666,277,544 *AF5B99A04FEB7B9735DBF9352AED16E0052FBFF1 C#)TD
1,666,277,545 *AF5275907870F6A4271BAFBD496C2C47A065FBA2 CUDDLESTHECAT
1,666,277,546 *AF5DB6D244AB50431E2F96FBA2C6AB6819A0888A CURTCLESTER
1,666,277,547 *AF5EAB58AB0598A74AFA206707A18F329922A95F curtisfolkins
1,666,277,548 *AF5D254E4DEE59FC905928F34E1B2AF489D49B13 05131361
1,666,277,549 *AF52A685E0F6ACE72B2A5438C98EE5B98552ED2B CRAIGMCPETERS
1,666,277,550 *AF5507201B19322A89A87FE44D8940822922AC69 CRBNSRD8
1,666,277,551 *AF557CA4F796B709BCFD788DE20E2FA3254193BE D0WHF
1,666,277,552 *AF5B978D0BA0ED70A9942EAAE31385B80115A4D8 ctb,x
1,666,277,553 *AF54A896063FEBE856B61B8B13CBBEB0F1D872F8 CURTIS CLEMONS
1,666,277,554 *AF54B36F9A2EA9EDECB4E073BC208C01A00A9E69 [email protected]
1,666,277,555 *AF5636AC6878D62E1F341A6BF8D5E0B0DB511707 13.DARTSIN
1,666,277,556 *AF5A03C81FACFCA22267542AE43217395758191F 14.TANKINA
1,666,277,557 *AF5B0294482CC2B6285F4BA22C5F8093C3703862 DANIAL.DZIEDZIC
1,666,277,558 *AF5BF4430EC0F83A91CABFB07C72C80DB2C22B2F DANIEL MOKHTARI
1,666,277,559 *AF54F91AF8889944E9F58EF3E314421451A924C7 DANIEL.MOKHTARI
1,666,277,560 *AF5C26AA8327CBB0F89AB85C8AF07E49363FF325 dankillme0
1,666,277,561 *AF5EC8686F1EF63525B6C1551DD5A8FEF07BDB0D c#:z
1,666,277,562 *AF526FE20BF9EDAFE14178564FE92EA347A1D330 CZHR.
1,666,277,563 *AF5C8B47D0FC19102E9EB0654E6F6784AB6EE624 dannyweida
1,666,277,564 *AF5288ABA91498720A7D8CFD05EF066AAF4F53D5 d0rpf
1,666,277,565 *AF58C63D9373F14B3C3D3D05D1ED6F21281C2D97 darrelllairson
1,666,277,566 *AF5748F192DD6E8BF3DA4ACA69BF1C10A2933339 DARRENHAWS
1,666,277,567 *AF5F1CC7CF7AEF92BFC0D8BB8E49A57782D09D62 darrinhazinski
1,666,277,568 *AF54C4E34E94DC806E5980C3D0722033E7CB78EA d3qf
1,666,277,569 *AF56F25A35FF636B4B59D4C795472C029E8DFC6C DATENO.1(LIVE)
1,666,277,570 *AF58444EE512D2D8D272FE8236902C38412D9109 [email protected]
1,666,277,571 *AF54562FB96235F58B55A34034C5D2B6CBC371E3 DAINESE ROBERTS
1,666,277,572 *AF5798DD1AC05058E1D9B43B6DABB34AF586932E [email protected]
1,666,277,573 *AF5DB15F583364C9941CB37514B1135F1A764AAA DALENORTHCUT
1,666,277,574 *AF5014B9AEEAD10C5EF2840B06F7F1C0817AD54E DALU
1,666,277,575 *AF53139800C7C452C2C518EADB5B3D31E2C7AD76 dana-penner
1,666,277,576 *AF58ECBCB76518AF07E8D8AC8EB5A12DFE07110B dap7h
1,666,277,577 *AF558ACC906D6B00DC373C78650FF9E2CCFC4C3F 1atk-koulutuspalvelu
1,666,277,578 *AF52497BF253E487420B6D7BC064E44DC3276D83 darla-stanley
1,666,277,579 *AF5FC5A5F2D13E1648122DD04884E5FE8524A0D3 1BETEUERND
1,666,277,580 *AF5088AE7A163F60AFB778B562E09872063EF272 DARON.CWIKLA
1,666,277,581 *AF56036AAAF907E8F41AB70B702560D6A852AD39 DBEWOLF
1,666,277,582 *AF538F93670BBC33F418817E3F5A0804190D4191 dbhs8
1,666,277,583 *AF56C26DCCE9F3241DA45E51E6A41F5280C8E624 davidfenimore
1,666,277,584 *AF5D9067EF0333EE6387BF777E589BA75A513314 DBG_?
1,666,277,585 *AF562FA051EEC24CAECFDBFB6897B776DA6120C5 [email protected]
1,666,277,586 *AF5B96FE15802FE83E5181E2AACD3DFECCC6D2B0 1GENUSSGIFTE
1,666,277,587 *AF58C7C33957A9A3036B532571CBF6F9797FE3A7 d.e,e
1,666,277,588 *AF502CCF4F3B79594E88C6E38281091D5AB3D945 1kuntaalla
1,666,277,589 *AF5D6C4A9667CDFE8A688C94C8257F17935A921E 1misafa
1,666,277,590 *AF5D00FE118433D39CC9E25C2F486238319F9054 denise-bamford
1,666,277,591 *AF5F5200DC316E87D01681C5951B8B22135E31CA DENVER.VALENTINE
1,666,277,592 *AF5B50136A1EB79AFB86A951749B2AFDBE1E54C0 1Q9347
1,666,277,593 *AF526E82E817B6191BE7ABCD77AA830F98787CEE 1-saksalaisasutus
1,666,277,594 *AF5AC8916B89B25BF56D30AABE72757DCA98EE1E deue
1,666,277,595 *AF5F9485A3CDFBDADDB5CA6CABDB5CAF41939895 dgja
1,666,277,596 *AF5F8F0BAAE792A7A906A28DDE2020BF24174272 dhjr
1,666,277,597 *AF506240A4DBF2934DF17F7285E71C35479AB96F dickoms
1,666,277,598 *AF5AC735E1F4BCD41DFFF50AD8745712D923FC2C DI50RG4NIZ4+I0N
1,666,277,599 *AF53CFAAE49301E6CBF03F18D1301A623DA700C2 DIB#R
1,666,277,600 *AF5590B0C1205E8905ABDAAAA4E7255C7F05D9E5 23apr1732
1,666,277,601 *AF566EBB350578B0CD907C329672162D29BCFE48 DION.VILLAQUIRAN
1,666,277,602 *AF58AB5C9840AF36B4672B216F4E97B2EF008FFB DISC0NS01AE1Y
1,666,277,603 *AF5FE2A3FD7EB41B53D1AC86993FE647223A6AF1 Dj$_
1,666,277,604 *AF5873F079C918ECBCCF2E2D5B57801D1EA1CDE4 dn3xa
1,666,277,605 *AF5903013E74F99F771D42840F05C65054580890 DOKMOKA
1,666,277,606 *AF503406685FCE9D57ABBB72A7AC71904B01F002 DONG.BONASERA
1,666,277,607 *AF5832C2965815B6B8E88E997647E53C13260DA0 donderaar
1,666,277,608 *AF540AC9B3DE91567B6D4D988753A529486198C0 donovancrane
1,666,277,609 *AF5EA67159268CA80045F8D8E202CBC04FCC2E2B DON'T.WALK
1,666,277,610 *AF5DEBE2A870FCFF2FE8AA2D14F1A05F065E2B01 330EA336D144
1,666,277,611 *AF5CAE756FF429CC4DA67A87D941052E0CF67A1B dr&81
1,666,277,612 *AF5BAC6B9A90D6A9CCE2F025942538C6B780D608 d$thu
1,666,277,613 *AF5CC4A31FD95B4AA710AB5F016FCD14E45C641A 4IAMBOSCO6
1,666,277,614 *AF5B57E9D7113CE2E7AF251FF52B14CB8BC6BEAE 4JUNEBUGACCESS
1,666,277,615 *AF5AD3EE283C79E3B8402A29AABA88409B73E2F9 4MISHAGO
1,666,277,616 *AF510D2FE935D4EADC93EAB63B71CA3BED40CEE7 dwwad
1,666,277,617 *AF5B4D923629B9DF2A356A4746C4122BA255755B 4RUOTSED
1,666,277,618 *AF537D5FFAB53BAA136818C1B84A81D5F1F2392D DWAYNEALM
1,666,277,619 *AF55A017BDD5628F28052139F325E4DADA7E6561 DWIGHTTHURSBY
1,666,277,620 *AF5A89834A8E212F7BF8AAADAFAA3EF0739DF981 DWLGD
1,666,277,621 *AF54BE3343B04192DD09CA50AD1B1BBDF321CF72 E(DE
1,666,277,622 *AF5E660ACC1C6CC280DDE7C7DD298E8DFDC9BDFD edmundobrunsting
1,666,277,623 *AF520F23CF0F04DD9CE0AC5A4F9CB040D63B62C4 ec)cw
1,666,277,624 *AF5072C839ADB06F143378B084134735A8DA5B83 5DIMBARE
1,666,277,625 *AF556810D8A92B2B6DF4D9A1C34E31C204797B13 5FRAUENKL
1,666,277,626 *AF55957BCFC1842D19849601DD00A740DD803969 5IMITASSEROS
1,666,277,627 *AF56CD412860ABA731A0F35D76EB51A58EC3AE19 eikoom6
1,666,277,628 *AF573B720BAB02C8AB95AFB3263010A22981F7D0 5MOONCARMEN
1,666,277,629 *AF55F792C45A1BF160A83C7EB23B53431CF59535 ELIAKIEREISEN
1,666,277,630 *AF547BC54736A9C263DF1AB8C2775934839D2399 ELISEANNING
1,666,277,631 *AF5BD042DFF205EC81433E009A3A9379CD349ECE eliseobrynestad
1,666,277,632 *AF572B3302BEB91AB9479768277BC90072A43500 eiohy
1,666,277,633 *AF5D8A2C53CFB1BB6286779F2CBD66B9F66BB635 ekt=t
1,666,277,634 *AF5E1E01B11853CABC1A83028FD1F902A60B9488 ELTONCOGGI