List database


# MySQL hash MySQL password
1,666,240,001 *AF5098A52DC987048C862F492DD796561DE92F52 [email protected] ~0 }O{
1,666,240,002 *AF57AA667091645EBD08F20295E8E5361EDC1FD6 TWONSROGERS
1,666,240,003 *AF5181F2B0EC2D2364F16039ED6A3FA449F4085C shrine to the cordulegaster
1,666,240,004 *AF5AD65E2FDF44EDDD6E2D8FA175E2A66474AA0A MICROGRUPS
1,666,240,005 *AF5E5D69ED081156C13998C1D64FD6C339C89551 mi$d473$
1,666,240,006 *AF5D1B4688B5EF873E876DAE167512A8843A0FF9 TYROPITADIKA4
1,666,240,007 *AF5931CA154EE6C1D07FFF7B7DBBF5AE133C2D16 paladindeath
1,666,240,008 *AF5E31875F5EBA4A859A0263194048323584510B TYYAFARYNOWSKI
1,666,240,009 *AF54A9F7A9575832BF93E73317CF1F181BC53770 SIGARETHOUDER
1,666,240,010 *AF533611EDA707C00F00A2F1CBB14B92E764760D signorvalentino
1,666,240,011 *AF5CFE5ABFFFF3E7407016B2B206149BE1754C2A mikmorales
1,666,240,012 *AF5361C9EB1F49794CEE41C2662F7BDDD5068A90 UBIKISIT2
1,666,240,013 *AF5AF0E8079B6A3E596CC93BE11F903D1734C5FC PANTHERES.
1,666,240,014 *AF55EB1ECC1CAC794E25F168A561FD5D1275617A ^UG
1,666,240,015 *AF5622D8911F73F569316F5C0A5F9A748498525E PARKAQUAPARK
1,666,240,016 *AF56031E87BD3215C35A2D69B2512C5EB4104BDE PARLAMENTARIAS1997
1,666,240,017 *AF53A9B22B069F020A38522CF53792011A40D27F [email protected]
1,666,240,018 *AF529D66B5460077BDFBB6B14ABCF0B9E7FA445E PASTORALE.NO..2:.CARAVAN
1,666,240,019 *AF5498B4918359B0613DFFDEEE94A4ED2485B13C ulewa
1,666,240,020 *AF544DCDED7649D2DCC6D9F1FDC916413E15C8F7 umcchurch
1,666,240,021 *AF5E6A0D59009098007D7DC5DECA97C336419395 PAUSADA123
1,666,240,022 *AF555033DC531131059B0874D221D399B00AD912 UNDERDUNGED
1,666,240,023 *AF5258554EEB0B90CC0AC231379E7C51416F1218 SNAPPY34
1,666,240,024 *AF5401CF66A7C3BB870A72A8F4438616914654F2 SNIBOCAJ
1,666,240,025 *AF5ECD4D7DA1E0D4139C8D9B719608A353335EAF pegbo4rd5
1,666,240,026 *AF536ADA9D76D5725C0FD3221681D49DB895C771 MONROECARROZZA
1,666,240,027 *AF5F06F37E93D96594C9FBEBCA77977939CE2E6C snrttlkl
1,666,240,028 *AF56EB08D631C7452B4CCDE81DABF1AE5DECCF66 MONTU-VORA
1,666,240,029 *AF59A99AD2DD893534E2D4A41574C799C53743B3 sober151
1,666,240,030 *AF5B467293D150ADAE7E3D1BE6048A1C7A4A70AD SOCKSANY
1,666,240,031 *AF54C7A8790D5D762993D66264A2CD6A8F17A0A3 moomoobuster
1,666,240,032 *AF5A4338F14682D5080998CBB9658F2FFFB67838 sola-wo-ha
1,666,240,033 *AF550681365A5E79217510BD427FA41F63778DC3 morganporreca
1,666,240,034 *AF5A0F6C0FE280675A8EDF7A03B093E782B6A88A morpheus
1,666,240,035 *AF55EE036967F8091552A9954D454C92E8C080A1 MOTOR´S
1,666,240,036 *AF59CBAA08485EFDCBA212D19298698F414A9ACD PETROALEXANDROVSK
1,666,240,037 *AF5DCD25ADF26D15D18BC9E158E1CDEDBB35FC7D MPARENT:BUSTED
1,666,240,038 *AF5CD6403614146CC7F273C00370789D53A63DB8 PHANTOMS OF THE PAST
1,666,240,039 *AF5B6853CC1BF72ECA3836B60BCAAE18977D8486 so with a thousand sweet kisses i'll cover you.
1,666,240,040 *AF501FFE66A10F0309299830E2915BFF343FCD4E s{oy
1,666,240,041 *AF5F8EB7CBFA0B35B0D607044BD21E619AF2CA74 PHL380T0M3$
1,666,240,042 *AF5B883D67BFB0A461C426422242DB7B02912D81 PHOULIARAS
1,666,240,043 *AF558C80F16E77C4CF825EDE3A0582F083CB1526 VAKILNADEVAL
1,666,240,044 *AF558AE819E41720D268B340DA8910128101D9AD valia
1,666,240,045 *AF5D128528FF6A68D17BD228439687A6A7BC5F6C muresancatalin
1,666,240,046 *AF515D30CAFCA84D8CDEEC728CF7709A9F8E4610 VANEUSEBIO
1,666,240,047 *AF51ED1A4482418FC3FEB26F882A482D48911D14 vania-louis
1,666,240,048 *AF51618A9217110600574C8402D75D46935D4D9A Plung3rb
1,666,240,049 *AF5B69B4F46555AC5FE9F51A86AA2C26F326AE57 [email protected]
1,666,240,050 *AF546CD6625C2FFB066E89B66D90BE99B4A25D8A MYARUDO
1,666,240,051 *AF5F3AA15958DE8DD8342074779D559E0412CD97 pollutants23
1,666,240,052 *AF568E2A6D98AC2314EF22303162CCE6490ED957 POLYNOMIALBASED1
1,666,240,053 *AF5BC0C2108B8CFD6C8BCD1CD2897878B1A3C44F polyx3na
1,666,240,054 *AF593B3997392D134F4F12734DADCF8BEC4CE8FD MYRONBOCCIO
1,666,240,055 *AF5CC05EFEBFE9DA6F5077EC0875249E8996C0C3 VERGNE C GREGRICH
1,666,240,056 *AF553200E2F7ABF1AACF70E51FE6E7B10091407E myseven17
1,666,240,057 *AF59A684F2165B0AF0525D6A9985801BE180841E veronicanoguera
1,666,240,058 *AF5CA9A7668757E6E33D9CCDE2D1D560ABFCA523 ppssystem
1,666,240,059 *AF56EF10917936AE97EC6CA5102436DB9A168B41 PRCDMNT1
1,666,240,060 *AF5564465CF367E4A5EBF7022E273EC2481468C9 prinzregent
1,666,240,061 *AF56050AF8D1989B21ABE0EDAD46CA0F63242322 stephanifrog1
1,666,240,062 *AF50ADC04F46F3EC1810262B9C8968772A090B95 nealkuhnle
1,666,240,063 *AF52E9A9134D00529DB6CD2F1FE1928E6B8AD1FA NEALWERKMEISTER
1,666,240,064 *AF5F73852969A449CAED937739665E260923F814 VINCEMINER
1,666,240,065 *AF57C8122D8A7273FED3BCE2D3CA24C4D5E89D74 publique.s
1,666,240,066 *AF53B7A4F4EEB295423F9274D16D112353D167F1 VINCENZOPIPHO
1,666,240,067 *AF5AD8521B851B1FAEBA07F73F513566129D6A47 NEGOCEIEMLHO1
1,666,240,068 *AF522960AE372F970B6C1020DC485952DB62DEF5 VIRGILIOARGUILLO
1,666,240,069 *AF520A3F257795B0FCBAB7B7BDE9C89579DEE528 NEIL.KLASSEN
1,666,240,070 *AF5A88D44187B5104161579D2E3671AC0D8B1049 STRØMBRYTER
1,666,240,071 *AF577777E930FBBFCCBD87FECAABC194A810C753 Q2T6R5I9U8
1,666,240,072 *AF5CAE72C48EC615EBFF915DAA450593977FA608 stucken3
1,666,240,073 *AF52F772B405721D8DD3508A23AFBC54C4E89609 [email protected]
1,666,240,074 *AF5ED581068B82DAFE5AE9464BFEEC12A53B88F3 (~_^)~`~`q====B
1,666,240,075 *AF5963D7D27E73EF28A8438B66AFB0CBB5EE94A4 SUBBIEBSWING
1,666,240,076 *AF50C72CDA4CFC25488AF7AB68B019FB46A8917B [email protected]
1,666,240,077 *AF51D8A84C2B6F6FFCCDCBCDA18D682CD9EB974D NEXTWOR7
1,666,240,078 *AF529BC83E108AE41BB062542667C32C201DAD22 vonjirasek
1,666,240,079 *AF5D6FAF56EB29F15F016EDB122F953617887D83 VON-STRANZ
1,666,240,080 *AF5C6F5C018BE2557391DC541A007F95A3502E73 @VOODOO
1,666,240,081 *AF5701DCE6DB26C2A923F54AD6BDFAFA16D16C3D summer.smilin'
1,666,240,082 *AF5AB58B1DF3359411758EF4C92FFD64EE141279 NICKPROTSMAN
1,666,240,083 *AF52F85632B57F345231E6C1217B01558413F9D5 Q----P~O ~O:P
1,666,240,084 *AF5FFEA9CA65E1BD04D8A821782B10283B77E77D [email protected]
1,666,240,085 *AF5B2D8D92B73DE5ABD3D6A37E289BFDB0285288 nikira-russ
1,666,240,086 *AF52C1F8ADD788A324853D84AB7F62C6D9E6956B supermariobros.1,2,3:hop!step!jump!
1,666,240,087 *AF5C7B5825DC3789B9D4765EC4B0B7D7DB9C7AA7 quincylaso
1,666,240,088 *AF54B5572E7CD788E00EF135F18A6CB2FAB58B8C suricnop
1,666,240,089 *AF5CD16AC52D2B3ADFEA1DAAB7B9D248F82B0661 suryasarkar
1,666,240,090 *AF53648B7B35D143D50A6059F679F9C2C85121D7 QUZDĀRĪ
1,666,240,091 *AF58E04E931F96DFF1172D1FB2ACEAC6B05A2670 [email protected]
1,666,240,092 *AF599F01AA28F047D2A8F44377B224414BA48E56 sweat like a trooper
1,666,240,093 *AF554D54170D316825C2426C2999B8FC659BFA0F r9p
1,666,240,094 *AF5749A91B1B2EA0A673BC3269D6535374C5A86D NONREVOLTING1234
1,666,240,095 *AF52043282DADE5F05E7C56AE7F212EE60D76F37 SYNANTHEROLOGIA2
1,666,240,096 *AF59171DEF151D547B2F2404CAE6EE25BE589F04 synodicon
1,666,240,097 *AF5898A8229F7BC353B2AE772DBB6E4640B015D3 SYSTEMWILLBESECURE1
1,666,240,098 *AF515222B205ECE1909EAD15339FD6A7013A51BE [email protected]
1,666,240,099 *AF540FA5DAFACAF957C4EC5CF3130E5EEC2EEB4D RAGHUWARP
1,666,240,100 *AF5828AF84A03F7E83819DC06D591E1C37A55C3D WANTDIRED
1,666,240,101 *AF5A47780E4FBE73417F8C97AF9E8A1254873602 ralph.brito
1,666,240,102 *AF55F88C1C7BBA1C208D0EAA19B713E87E6771D3 randalkerbel
1,666,240,103 *AF547006E8F9D5C0E20D86A6CAD8B8B502113AA5 warrenstalcup
1,666,240,104 *AF57B6E941DE0E0169D4B23BA75C0D23A6203584 Was.Lousn?
1,666,240,105 *AF5794631A68E917A458E7A54C17F9B7A74B1F8D RASERAIS0
1,666,240,106 *AF532FE0D5E5A7982EBADD689E2BD8A81BC81E77 TAJINDERPAL8
1,666,240,107 *AF51631662C6E0FFE2E48A2D03D4382E08F18F8C WAXMACHEDA
1,666,240,108 *AF5FD739B213757AB03B3B4B2F85597959DC5250 TALK9327
1,666,240,109 *AF5F5207D9E997A353298088FFF0801163056390 waynetollerson
1,666,240,110 *AF5D1844AC5BC3835D60C81699DD84274C94A121 raymondbilson
1,666,240,111 *AF59612D1E161DCEF6DC4261E1D236DFA9E5837E TALKILOVENOTREDAME93
1,666,240,112 *AF53E6C2D779249E90F5EE8B0415F46487FC594D TALKJOEINVEGAS
1,666,240,113 *AF5BDB4F68E3F96694D787500765DAADB35D17BB we;
1,666,240,114 *AF5585B7143DF7620591A32D7FE10C85BCC1E131 TANNERJIANG
1,666,240,115 *AF583AB529B69E926893219DFB7FF8AFF2758455 wellthomasmacmillan
1,666,240,116 *AF591F4B08B435E2677FC42C83580F3E1C4C21A5 WENDELLDULLBRIGHT
1,666,240,117 *AF52C9701A99F6920C675DE2451A66EF8E5F922E wendover-hangar
1,666,240,118 *AF5F1BE7DEE97A5D96FA3F49B67EB87E17AAED70 TEAMOBRIANP
1,666,240,119 *AF5E8768FD7DBE76E33735D765A57F7D9B9F4025 WE'RETHENEWGODS
1,666,240,120 *AF56EDBA91910AFDA30F7A241B8CD2DEED577F33 [email protected]
1,666,240,121 *AF533BC1C44FC9A2522F5F104B0DC4E4D05CB863 redonneront
1,666,240,122 *AF509BCC50C9EA18630C5C121DD39A945A2A2731 WESTON.POPKE
1,666,240,123 *AF53B83087BD2753AF4A6003066FE2CF00364E6E [email protected]
1,666,240,124 *AF51B9FBDF1E9B2CF55990E12DA34CEA851E2FCA OMARRAMS
1,666,240,125 *AF50E3BD82A8B6E1267F1E043CD5CEE730EABABC OMARRAMZY
1,666,240,126 *AF51EBF81586C9DBDCE44E81DFAA37BF251A925B OM MODI
1,666,240,127 *AF5F1BFAFB6F891879074A7A8981AB20F5D09A7D REINALDOTICHNELL
1,666,240,128 *AF58555B2F1A32494F874CB78B164AA53511B442 [email protected]
1,666,240,129 *AF56AC8F540FC803B5AE6D99C0DBDBBB33438FC4 ONI\
1,666,240,130 *AF51CBBC3283DED6A0BD4E8165D2680586ADD270 [email protected]
1,666,240,131 *AF54A17C9F7702C989D4EF7B6B6E4CC53E3D53BC (^_~)-o~-O~-(####B
1,666,240,132 *AF5EE87D83D0DF498E71A5744E82F381DC42003E WIKEDREMOVEHIGHLIGHTCOMMENTS
1,666,240,133 *AF52D47987D5EA39DACA1E1724BB08152899FDDD oph7h4lmolo9s7
1,666,240,134 *AF504EBA4670114173B0E5A024424D83CF201885 thanat0109i35
1,666,240,135 *AF54CDC999082CDEEB564DF0ADECC405735CE1E1 ORIMAIL4
1,666,240,136 *AF5272C3B865D8B579CA8FDA991577CD13E3B915 RESCISCES
1,666,240,137 *AF565C16310EB44F2AACE46AA0D6D0D6E519E18A THATFRANCOIS94
1,666,240,138 *AF559EAC8DDD3D2BB70B382D984640D5B50A1175 [email protected]#
1,666,240,139 *AF50D19561DEF84376BDE8CEECE55BE2B03A2D55 WILLIAM-R-GREENLEAF
1,666,240,140 *AF54B550BA1F5D426FFB46DA24A52E40FFC1C766 OTIS.ORBISON
1,666,240,141 *AF512A9D03B79D02678FACFDB4B8F658E027FF12 WILLIEDAHLGREN
1,666,240,142 *AF5BDC01C1EC4FC9681D5719E9AA9014B3449D35 outsigh1
1,666,240,143 *AF52FD2F4E430E416EC26275F47C729220B9B21C THEDISRUPTION
1,666,240,144 *AF5FDB3852588728E24C7E0907680318A3F2F3CC the earth dies screaming (12" version)
1,666,240,145 *AF580E586EB37E70EBEA45A1297A6521DF391CE0 OWKZBB
1,666,240,146 *AF51167F2337AFFC45D425726A906F7A3B92373C REYESBYSE
1,666,240,147 *AF564DC4F1A2A2AEC96890B250BE97FBDE6D28DE (^_~) ~ ~ <##p
1,666,240,148 *AF5BE1AF6C0FA073EDC409BB56304390186B209A wisdomletter
1,666,240,149 *AF53CF1B1368E9128D94FB75EDFCA7D368499307 PAKUFIZUESHMRIS
1,666,240,150 *AF5992A52E0FCACE1790BE79665F412124A89052 RICO.PITTILLO
1,666,240,151 *AF5F58DD541DDE5D9F4771F2819113ACCEB2C25D RIMILIA9
1,666,240,152 *AF52970B6749B243F7A63881B4DCEB4EA763F917 THUMPER15
1,666,240,153 *AF5E86287BC6140C5918FFCD69E87265CB09153B RKVHHQBMWM
1,666,240,154 *AF5588669659B4DB0B0F93720C5A60042830F34D rm(_
1,666,240,155 *AF5885A7248941E1B7D61DA71373F398636FE426 WWWANACOLENET
1,666,240,156 *AF52D0C1A2EDA7FD8B8ADB7A36E53EEEDF849E8D tinfoi1
1,666,240,157 *AF5ACB9037EB6CACDC239BD3D17133030F942AA6 robtdaurizio
1,666,240,158 *AF52AF9CC0F962FED1D78D181374EB39A4A89BF0 robtvalido
1,666,240,159 *AF59123E6CCBEB2F3C93BAE7BC0B0754D0F93A39 X2入替戦勝利(対イワタニ)、X昇格
1,666,240,160 *AF5166567D6309418E600EA5BFC295057F45AAB8 ROCK-M4PL
1,666,240,161 *AF52E6080BBC570CC1F59F04B7F8F49475C74222 roderick.matthews
1,666,240,162 *AF535E7C65F7B279828770BC50DB276711EDC610 RODNEYMCCLELLON
1,666,240,163 *AF55AE58BFA70EEBEEE820BEE8331522ABF00E36 p#d ~0~o(~_^)
1,666,240,164 *AF587CDF61D89EAB1E43090491B32D8F2E7CB8DE [email protected]
1,666,240,165 *AF5AC1D9B772B0C4306DD252959AAF6B47931CA6 TOGAWISE5
1,666,240,166 *AF54907BFBCDF04908E46997CE99C5E53B5A1417 PERIBOMIUS
1,666,240,167 *AF5BAC6DB792B66BBF7C6EC0BCEDA350945C6320 [email protected]
1,666,240,168 *AF5D61E70D9E159EC7716CB87DAB5AF0C287B42A PHILIP.REIGEL
1,666,240,169 *AF544B6FFA463A4B7807B6F70A55A5CC235B411C phillipeckerman
1,666,240,170 *AF5BF32F6CAE71DBCA2B4521E8509FC3FDCEC4D0 )x(*.*.<----q
1,666,240,171 *AF5770F37326804BC3D8EBAFC9A23662DB98FDB0 rosendoargrave
1,666,240,172 *AF508F42E4F7A08EF16B360FFC4E1E9A8D3E2619 piasava
1,666,240,173 *AF5845D936954E8CB8C2B95BF9F15F1EA0A652FB [email protected]
1,666,240,174 *AF526FBC9053AFDFE41F6DA9271391155239B30D trai13rin9
1,666,240,175 *AF5AB5EE46052E61F3BD2E9379B9B1013A7B00EC [email protected]
1,666,240,176 *AF541139A9D61CFCEFC01EE3186CE28370F7F76C pisa1
1,666,240,177 *AF504CEC46388B9B19814DC75B3BCFAF35C40758 Y020661
1,666,240,178 *AF54D5D31439633FB61298C8B3B4ABA13E324B3C y[!aa
1,666,240,179 *AF5218D0872A42FA8FABC572A7EDA0988F735FE7 ROY.INGHRAM
1,666,240,180 *AF5003F761CF9A4C3EE18F7FA81D24698FDDACDA PLEURERAIT8
1,666,240,181 *AF583E104925FB74867AEFCC6D8E6BC58F431B75 yatyi
1,666,240,182 *AF51E3D0FBD13CF5AEBA83BE614B5AB77AEC06AC ycel.refuerzo
1,666,240,183 *AF5EA6757589900463E0F019641779335BC21087 yclaaa
1,666,240,184 *AF5CA8C532D82E43A0C630DE8627F7B90245E756 ruairirobinsoncom
1,666,240,185 *AF559A70FB57506B46BB46854515D92BE4CFC5D8 RUBICÍNTHIA
1,666,240,186 *AF58AE22E09A5E2D541A4ED675DDC498A999C035 TRICIAWANCIAK
1,666,240,187 *AF59492A99FFD6001E518696046D29FF3973501B POKRYTE0
1,666,240,188 *AF53FEBE7705C9F700E3ECEF7A3946BBAF9F2421 POLICE,.BEER.AND.HEROIN
1,666,240,189 *AF58C50137D8002CE95F5AF3F2D6B5BE60689BA1 PONOVIM7
1,666,240,190 *AF56EAA32992086271765F7A741F9603EF8B7DD5 yksikoenjohtajalle
1,666,240,191 *AF5ED4BBDEC910C3FAE320C34AE57E00383F30AA RUMALINI
1,666,240,192 *AF592979DD03FCD6854B142CBD4DAF802E967949 [email protected]
1,666,240,193 *AF520C3979EA48CA563E617B136EFD519175CAF5 TSERVATIUS
1,666,240,194 *AF5ACA05D42005ED9924A0546BB810920A8154F8 POSZUKIWANIEM
1,666,240,195 *AF56E9FAC073C951600DE410C34E6B8C89AC5B50 yotam-ingratubun
1,666,240,196 *AF52C303EB8798452B37F6758046CBB23BEB550C [email protected]
1,666,240,197 *AF513A7F2E8262DDFE840BDF702AB3B3E52C9AC9 p####p-~o~o(~_^)
1,666,240,198 *AF56B043AFB02BAE4EAA497CAF27601394B71B40 YOWIESSEIWOY6
1,666,240,199 *AF5EF83B7A90D772052B86B91F7CD896B0219208 TUPPING
1,666,240,200 *AF534C54AA661579946623DC3CE0E2AB30B314A6 TURNTORED(LIVE)
1,666,240,201 *AF5B498C1C7C767E884AC0369333A85FA82EFB98 tyrellcorbi
1,666,240,202 *AF5A64FC7F0699A4DDF72395298ED968984BE7BE TZZIRDNILKNARF
1,666,240,203 *AF5B9CF230E484D8655011D6F0109B61209DCAC9 SALOMON.VASQUEZ
1,666,240,204 *AF53C4705B9EB4F55BA3CE90EC5733026D1CDF99 SAL.PLESSINGER
1,666,240,205 *AF517BB127ACEED298EC3E742F4A1DCE0E202BD2 SAMAAHITAAYAAM0
1,666,240,206 *AF5B394A1D34E25D58F70AC48DB363CC5BA1EEC6 [email protected]
1,666,240,207 *AF5D4D5BDD932BB7D4BDDF994262B35615E98F2C UEBERTRUMPFEND9
1,666,240,208 *AF56E36473D1CB4BBEA94AC1BBC69AB8B314996F PRZEDROSTKOWI
1,666,240,209 *AF52E45751E8AE957452D245C7EDEE8D57F87CCB samualwaddy
1,666,240,210 *AF58132C2D1C36BA18D8C2165D7E661DC1A9C0A9 ULTRASWORLDCOM
1,666,240,211 *AF5A17D2030615BA875D90DDA65C1B0E3BD1A4AF UM-BAI
1,666,240,212 *AF581384A31F4F0102DBAF09FE87637F77D17459 uncantoned
1,666,240,213 *AF5C7AA6CCB64E5A60AFFDCB4E6489DE4D290E86 SANTOSKEET
1,666,240,214 *AF57FB43BB94D39DB0B402A98B5737068174DA97 PURPLE MAN
1,666,240,215 *AF5ACED78AB817A40F9316C0680DC2EEFA0A708C PUSSAŘI
1,666,240,216 *AF5002683703F9954C1F5FE6248E56E550C13FE0 zedric.deshun.mcbride
1,666,240,217 *AF5E66C76330E331BC14FC24BB6321967212C814 ZEEAMETHED
1,666,240,218 *AF5AEE6F4EA47E8BB8017A9C9509EBBBBA4A60AE sato2you11
1,666,240,219 *AF56BF8DCFE9797575882A13BD455CDE027439E7 zeustempel
1,666,240,220 *AF58CE14B1767DB822599BDBCD25B1CF82DDC2AF Q###)~~><
1,666,240,221 *AF56C4771CB3ACF162503C783FC2E841B4AA7B6A [email protected]
1,666,240,222 *AF512394DA8D9E51DC9BD0BCF8829E9052B157B4 UNFUSIBLIESING
1,666,240,223 *AF59B408574C18A3D0EAC950DE943349A7A15B72 [email protected]
1,666,240,224 *AF54C4C3CF791F679EC8684C6B5FBECF6531A6E4 UNMÚDZADZS
1,666,240,225 *AF57B6EA0FEDAF95ADC67EEF74C306E13CB8A8CC Q#####D***~0~O(><)
1,666,240,226 *AF508AADD0D66299BD8ED107CE00771899B809A5 [email protected]
1,666,240,227 *AF5AB48A6D95AFCE6E2E238AE1ED82C241FF532D schemerduisterst3
1,666,240,228 *AF52BD396C190D1FC33CF1D0FA5C9DF5502C8A18 SCHIZOGAMY3
1,666,240,229 *AF5CCFBAA1D5CDD22DF99A2C3AD8F27B72DA2611 UNSERESEITE
1,666,240,230 *AF59A2B4CBD18D4E7583D9007530C1A11BEB4381 [email protected]
1,666,240,231 *AF5862444A9B337476916BA5D827F0B6DA22D9B1 ziiosis
1,666,240,232 *AF51015B88ACAA5BF86F938B1A5BFFBAE7D66B73 UPADRIGANO
1,666,240,233 *AF53BEDC2E05DCF8C569C8C651AE163D30A14136 UPGOUGE1
1,666,240,234 *AF56AFE794BFEF62F8014CE17180DDF1D9108DD9 uretriti0
1,666,240,235 *AF5B3F1DE0CC54B955F7B99CB1FD5E72597D81BE ZTKSTATUSBAR
1,666,240,236 *AF5E49ACB0366F9E0A80976E8CB9A0B2547A95E3 RACE.168
1,666,240,237 *AF5CB6F9586CC6F59D5382E7A69E30B04BA35D0C αλκοόλ
1,666,240,238 *AF5615597FE689A700F021D93626B2AED427BE53 SELLABLE
1,666,240,239 *AF55BC400524A8B74E086DCB6A685B00D469D801 randallzomorodi
1,666,240,240 *AF568469C4019D9F4213ADB534C9B5909C187A1C ЗМЕЕВИКАМИ
1,666,240,241 *AF5BFF097F6F34BFF521387F8A8DE91832A3C628 sequoiaparc
1,666,240,242 *AF538055A99300526016F7264D5870D46A7D4E37 VALENTINEFLUM
1,666,240,243 *AF5C4A1E7D6324062ADEEA2F3D4038369B730F04 RASHADBREZ
1,666,240,244 *AF5F2899C85311A2045C91F8D913F0ADE0DE7696 rashadficker
1,666,240,245 *AF5EF4286E4605B3D599AF43E12E8EB17E7ED8DA ЛЕВКИЙСКИ
1,666,240,246 *AF54F78036C77DF7AC882D90FDB7A156EE05BF0F SETUSRIH0
1,666,240,247 *AF570D36260ED7F38EB91DAA95730DE2AEB8E8E1 RAYFORD.WINNINGHAM
1,666,240,248 *AF5538726A1A325E39607D2E0F6E93666CBA00E6 raymonwotton
1,666,240,249 *AF5826E2555C7783EF9DE4155D8FD53439DC31AA RAYMUNDOFAYKOSH
1,666,240,250 *AF5FE8896C8E24230715128D5C08312729729E01 VANESSA.GRECH
1,666,240,251 *AF519F64C0A598854D718DCB39B3D37DF6C0EAF0 VANESSA.ROBINSON.SMITH
1,666,240,252 *AF563DBA0E785564131CC09F6F958EB1F7BBFE86 НОВОРОГОВСКАЯ
1,666,240,253 *AF513296B384A3BEBCB52CD15B60DA258197CA0C shalier
1,666,240,254 *AF5F0E4FF55685791BA3077643E11DAF646857C7 «РАЗЪЯСНЕНЫ»
1,666,240,255 *AF51D61ECD1550FD08EB985B4BABFE42D1796CF2 SHANE.TRACY
1,666,240,256 *AF59B5C6ACFFD200F9B20985CF6280C0CBE05C0B REFLEJARAN
1,666,240,257 *AF5E8E50D4973DBD0B434D17A4DC9AB657CDD391 SHIGGOBOY123
1,666,240,258 *AF5CAE7E87EB4BFB18E851E049461F39B048DAE9 SHIMULPARVEZ
1,666,240,259 *AF5FF66E82940B9F015026BA234E6CBF11552FAA rehtiaes
1,666,240,260 *AF5B9928913FA88DBBFFFB05C307CD6407120127 remdier4
1,666,240,261 *AF5087AF2480CC63289C23DD6F6E1F7529079572 SHIVONSMITH
1,666,240,262 *AF52AB86694C60C7C40D8E243FAC78C552335523 verjaardagsfeestje.
1,666,240,263 *AF50104CC1679A210A21EEA899B1F99A1DAE6643 veronica.capilato
1,666,240,264 *AF564F78AF4A49E953687B3D456933FA431AF730 sidneyklussmann
1,666,240,265 *AF52172B007FF8B0101AE524A97371CA436DC346 SIGURDOSSON
1,666,240,266 *AF53DB92C1669CC43BEFC107BFF8C962AF1079FA respirasse3
1,666,240,267 *AF5868CA99C620C5C925BA72444D1262E41F2240 VIABILISERAIENT4
1,666,240,268 *AF565E4937D2CBC14C20360F781A2011A5CDB82B VICKIEMATTIER
1,666,240,269 *AF5356DB5D8DC67A1A966BC8BEC846EF68A9C746 SIRÍAQUES
1,666,240,270 *AF50F0A598AF46B7C2BBC838B6CC02648CF5BB8E VINCENZOKARAU
1,666,240,271 *AF50AE67B4A752F4C6486E0F5774B86C59D6C6D0 vinealis7
1,666,240,272 *AF58F7F3A950FE0039741A288E4E030067341311 VIRGILZWIEBEL
1,666,240,273 *AF5E5DDFA07258B679C883247853B44B1DD723E3 VIRGINIAGENERAL8
1,666,240,274 *AF525C73467AEE1B70438CE9B453C375748DA808 smartkreet3
1,666,240,275 *AF51F92684B20A70E4C3E623AC70700FC7F7FD7E rickygiannitti
1,666,240,276 *AF5D2FEE42ED0D215E693B6FD73ED111FB03AABF VIRTUALWIFETHENEWVIDEOPROJECT
1,666,240,277 *AF5A90D935876B6BAF7E3F1B02880E5B47C35091 SMILESGONE
1,666,240,278 *AF52DBA12A61D0EA54684A65F17EA9192547CFB6 VOORTHOBBELDEN.
1,666,240,279 *AF52C48E42DC0F2AAAE405D83B3534EF71A8FC2E robert-donaldson
1,666,240,280 *AF5C62619EFB76978014050F980A3F3789411409 RODELLEDOR8
1,666,240,281 *AF5AAD332E1265F4C84108C45AE2F9105D958F8C SORDOROV
1,666,240,282 *AF5DE2D57A3804AA32379445D9142008AE220C5D 10 SMHKONZERN
1,666,240,283 *AF520E8B8EEB1FDCF4D2877C2AC6F79CC351EAFD 1101594 mukana ohjekirja aikuisille
1,666,240,284 *AF52266B53CFE90B818FC4D9B4FE8EB352A4F79E rodolfofleitas
1,666,240,285 *AF52F9BB2365DDF5851FA6FE824BB9827B1D6447 112461 TUOTANTOTAPAHTUUISO9002STANDARDINMUKAISESTI
1,666,240,286 *AF5B84FC30CE9646BD954BBB06BF998C27433A76 11-LEIV
1,666,240,287 *AF5FBECC2464F8BF8BAC9A175BBECD4170429289 rogerday
1,666,240,288 *AF5EEE35B1A3CC0ABDAFA3C007064579E09CD872 ronnieliddell
1,666,240,289 *AF52982789B3ED00C8F243A2F3E464F6CA960040 1601952 KOHTAUKSET-SEURAAVAT-TOISTAAN-T
1,666,240,290 *AF5D0F956375D1E3DE3C8B9ED288CE5366BB7280 ROPAPACYING
1,666,240,291 *AF52B6E2895E01971CF23D2502ADCFAD0FCE1357 [email protected]
1,666,240,292 *AF586AE4B75F102DBFD5A94F610C9F05E97627DC RORY.VERDINE
1,666,240,293 *AF5F2FDCDC922071D91702748197AA9C343A4DE8 16january1239
1,666,240,294 *AF573AC3DB18E10D061F47D98239F2C27734B96F roughly-contemporaneous
1,666,240,295 *AF53FF34B7AE3E1358878C928724A345235626F7 [email protected]
1,666,240,296 *AF57B7C8BFF82E2B07D7F2C6229B31CDE1A46CFB SPLAT!*@--8
1,666,240,297 *AF528AA6470210D0273AEA230AED70FBBC5E531A 1 AHILI
1,666,240,298 *AF5DDD7B7778D70D32A1F59C9B38C8CE66276D5F w4x!3$+
1,666,240,299 *AF59CC2AF1D4E3772A096C688F777F926C2FA87B RQUISITIONN4
1,666,240,300 *AF530E8523C40DA3CBD41ADAFF28F0E8693F31CB 1-buerokratenvereine
1,666,240,301 *AF564ADA7FC8A01F8B2094F8B2A2A4B76BFB5830 rubinhazekamp
1,666,240,302 *AF581BE74A426B3EC97DD1F94FA8811E6818F3B7 1ELINKEINOYHTI
1,666,240,303 *AF5FB73B0AC9E804C510E4520A0A951E06EA8A3A 1.festlandbehoerden
1,666,240,304 *AF51AE98824937586AC21DE099B12F3C31B54797 RUFUSAMELIE7
1,666,240,305 *AF557855EE2AEB552516658FBEEC0958ECCA1EA4 RUOKAILUKESKUKSET
1,666,240,306 *AF57E081554BF2A5877997E16ABA4EFB3EA42949 rupertshinkel
1,666,240,307 *AF5490B8E68971B5A84C634888B9E97AF9F8A17D WAHYUNA-RAMLI
1,666,240,308 *AF513548591F75B7261F662763D24551BF476895 RUSSELLBLOSSOMGAME
1,666,240,309 *AF52AC21F4623126523A5CB6F4055B64C57998F2 waiting.period
1,666,240,310 *AF512EE0C1871669FC1D389D347005D66A6C546E 1IAMKAREN4
1,666,240,311 *AF5C772D3ED347C53CB3A55D4F47FEF494C90F5C 1.KADETTEN-KORPS
1,666,240,312 *AF509B7168353A135BBA57CE590AB12447B1F87B RYANNIMROD8
1,666,240,313 *AF521E6ABDF12657F45F667DE1B2E525B491B8EE waltonleuga
1,666,240,314 *AF59CFF71EA0BC33EE8942DF46111F35AA262231 1KOMMUNIKATIONSKAROSSEN
1,666,240,315 *AF58A7FBC56D17876DD8C7766DC292D559178730 SPRHUNDED
1,666,240,316 *AF5B31B1E9C16BFD44EA4E6A259F2B5E7BB091FA WAN-BELLISSIMO
1,666,240,317 *AF5FC2346A41E79CDA8EDDC45118180F9F7C9CAA wanda-arias
1,666,240,318 *AF5350B36350EA8262B63AA12ECF07962BD7B0C1 SA
1,666,240,319 *AF55CF15C3AE17E57FB6F8A26F0CE9CC403CA02C SAEED AL AWAMI
1,666,240,320 *AF5674A732A4C8116A7018BC4BF22DC4BB41EBD4 saeid-saeidi
1,666,240,321 *AF5DF61FC26370F5FE300F02CFDE21F8A3A96969 SAEJOED
1,666,240,322 *AF5F5A36C21BA8F38CB079785CEF3130D4F36CFB saint-germain-des-pr
1,666,240,323 *AF51DF3737982CD38CB03141360133A5E596C497 1OXZ
1,666,240,324 *AF5796FA0038238FC9FF6E5D9A8DADEE119A1674 SALLY.ANN.HOWES
1,666,240,325 *AF5BF763DB2C6BA729C4DEE88D52B40BCDE05BDD 1 polizeidirektion
1,666,240,326 *AF5734E4D4936A463C71FEF98ED3DB6221AAE19D SALVORS7
1,666,240,327 *AF544E4659B9A8AA82BBCD3EC60247B3BC2FDBA8 SANTHI KRISHNASAMY
1,666,240,328 *AF545183A3CD20F5202C903C3F7AC7267176F80A SRUESID
1,666,240,329 *AF5785DAF2FAAD962623CFCF70C8C835398E9A4C 1SOYUNMUSLARIN
1,666,240,330 *AF58F837877530CC18175AE9EF40205EAC1A4627 1.staufer
1,666,240,331 *AF519CA5D0D40BD6FAF8F5978FF151B7E38900E0 WAYNESIEGEL
1,666,240,332 *AF58849E50D3FA744B8483D94AB01774DAE87E03 STATEOBJ-GTSECONDFUN
1,666,240,333 *AF56277664F601EAB28E365F8CD48145E28625B3 statuierten
1,666,240,334 *AF5B810FE7AE051EEDCE4E47D4105189443D165D WEEDZCELERIDAD
1,666,240,335 *AF5ABB720176AB169754D2EC5B43A31F5D70E2B2 200KW)
1,666,240,336 *AF5BA592C34412B7FE27AA840E181116B8E609D4 WELDONSCHMOAK
1,666,240,337 *AF541F1733976CBF6AC2C50BABEE4F280BC087B6 stevensavile
1,666,240,338 *AF52EB5F462DC3BC388E6EAE8D7C170E52EC84A2 2114570 doch gegenteilige geruechte halten sich hartnaeckig
1,666,240,339 *AF57576DA727DAA3114EC9449D8DFB5A62C33E43 [email protected]
1,666,240,340 *AF5600ADCCA15B82F6F39F5C38D25AC8F5153A54 [email protected]
1,666,240,341 *AF59DAF3F183BE39D064429BE4FCD0E7D13BE3CD schlecking
1,666,240,342 *AF50EF83AB86BB384DE328F00F3005DDAB235640 2385733 GERHARDT-:-DA-DUERFEN-SIE-ALS-JOURNALIST-SPEKULIEREN-.
1,666,240,343 *AF59B8F63DA8D69880506A57782F1936A67E25EF WGQLWZ44990
1,666,240,344 *AF525F340922B11285892446766FF728BD1A0C20 24PALESTIINALAISPOLIISIN
1,666,240,345 *AF54E7EDD8459AA0C55B552DBACB4F56ADD812C9 SCOTT.STELTENPOHL
1,666,240,346 *AF5891D0B03D16DA9AB4B6545F477BC9CC87462A SCREM4V4N0
1,666,240,347 *AF534F80BDA5E44EA792ACDEAA9036E5AC173931 strzeile
1,666,240,348 *AF536D6D54D771ADEC82D5840A42DDEF323A790D 26november1344
1,666,240,349 *AF516EA08B31F334CB3D1CC7EB2BAE112A9EE587 286061 herhangi.birini.Sahsen.tanImam..
1,666,240,350 *AF584A1BF0F1CBE63723F59E6A4113BE9B698613 2.ALTERSVERSORGUNGSSYSTEMEN
1,666,240,351 *AF5F11F7F5DCA7946E4B7C4EF2F3FFFE99B656A3 2AUSFLGEN
1,666,240,352 *AF51523AC33717CD550CCABE80EBDF78A278AF81 wickramarajasingammanivasan
1,666,240,353 *AF5D71CA4F5E8626E174E8BAA47F77E9FAA9491A 2 EKH
1,666,240,354 *AF5470079965029A19358DBFB692EB8127923405 SUNFLOWEBIRDIE
1,666,240,355 *AF57A8676633FB5CC25ABDE3A2573347D3F87E61 2FAMBERRE
1,666,240,356 *AF54EB99F1DD1BB28B1CACADF6D44D476CD4573B 2FREMODE
1,666,240,357 *AF52C032E0955A296299E0686AF4FEE2AB1BA936 2GEBANNTES
1,666,240,358 *AF59A45FAFB0D804632E0C9A1D8DA06B3BBF690B SUNQUANNA
1,666,240,359 *AF5FA7AC1D0FADEC43237B7D548B882DCCCBF292 SUPPORT.BIOPHYS
1,666,240,360 *AF566DCAEC5AB443BD0473D81C8B3383C9D2696E 2POIHMATA
1,666,240,361 *AF532A8C0607711588457218C016E6F2B7061524 2VODILJOM
1,666,240,362 *AF56BF73CEE2AF244E819A915B285FC0C61CB3BA 2WOLFDEAN
1,666,240,363 *AF57445D615334A56D4C0BD5B588F6031BCCC72E 2zweivierteltakt
1,666,240,364 *AF51C65C7964D9E8239966E2DBED2D3362D23149 shakespeare)
1,666,240,365 *AF59024323C8053199EE0EBAC8F21666687D1D5B WINFRED-BURDEN
1,666,240,366 *AF54686820CA4E3041D3B68F4EFDD5A6D2E2BE29 WIN.HUNMM
1,666,240,367 *AF549F2A545372EBF4C76AF0076D42DCC5F548FE 36360 THAT WAS PART OF THE INCREASE .
1,666,240,368 *AF50383D032ED367C1171DA2705146477747113F [email protected]
1,666,240,369 *AF50201EFE8F506EC0E49C4FE2B3FB421E67CA5B witelites
1,666,240,370 *AF5874062E6F371016983F612392C3923F33D0F4 3DNDRBLT
1,666,240,371 *AF5CCD4A22FADF6A3B586C9881253D3E51B54245 shibu-kuruvilla
1,666,240,372 *AF5E3A07C8CC42AB913DEDEC12A2D65C18DBA6CD 3.kuituyhteys
1,666,240,373 *AF5ACC29AB9BF231DA061E85E712EC25C9B6F3F2 [email protected]
1,666,240,374 *AF52F679C8178FDB651C02971BD71820016700FD SHONDUTE
1,666,240,375 *AF543D024EE756E8EA074DE708AC48E66750DB92 3PUTOGAI
1,666,240,376 *AF536F985BB4D015B4057E3320DB4B396AD2940A SIEDDR
1,666,240,377 *AF552B52951141643F4845B291B78C78239DDE36 SIELUSTAKIN
1,666,240,378 *AF579FC655D0EC9BBC159CD553376D1E8AD8DB73 3thatlemon
1,666,240,379 *AF5847A0DBF2FDFA75D79A5932F1A0F6AA221728 3UTPLANTI
1,666,240,380 *AF52BCE582FE8C21D6F8DA0184B7EB230EBB81FB [email protected]
1,666,240,381 *AF5518949C6B7727B44B766A79DEAB5D02F932A3 [email protected]
1,666,240,382 *AF5D85739968B74251EF8D2B9DF04DBE85772BC6 SILISCOED
1,666,240,383 *AF511A02328F566FA8AD1360D2B1C52FEC00E78F T3LLINID4
1,666,240,384 *AF5F6F670BFA5566213AD278BFF53967EEE125D3 T7VM
1,666,240,385 *AF5E6DE8C853325A52FF0CD7D468C2E420553E34 skibakke3
1,666,240,386 *AF5A3A7D3E41C99601511DD3994BFA43FDA18297 SLAIRTSUDNI
1,666,240,387 *AF51F41AC1D0F61A4A7D859C122AC1A581659DE4 4MPL14RD35
1,666,240,388 *AF5595840B09F749B7BFFC8341DC73D5608BFDF7 WWW.BRAIDHAUGH.CO.UK
1,666,240,389 *AF5897EB9B1EC68CC56CDEBE3E26DE91DCF0AA56 SMAGNART0
1,666,240,390 *AF5868353A8225D61D5423C4C5AA8E8A4B8C158E wwwlucasstonecom
1,666,240,391 *AF5B1D7072030D0D2F2E747F03B4FBC4C9606BBA SMOKEYSBDC3
1,666,240,392 *AF549A2AF824E228AECB959FBCCED5708630D7A0 WWWRETRIEVERNO
1,666,240,393 *AF59D1F70A3D597B8CE20092A3E4B328D614CC97 WWWRICHINTERNETAT
1,666,240,394 *AF580B2418DDDED70298B714DDB33DC121FFA816 SNAARHELFTEN
1,666,240,395 *AF5E9929DB0718BA45072DCAB4737EBEC301F8A7 WYJAŚNAM
1,666,240,396 *AF55A43AA28901AD7AB66B50FB5FA59B238926F5 TALLMASTER
1,666,240,397 *AF5E1753430472B14642E9AC567D4C2256045D4C SODABASN
1,666,240,398 *AF578C728F32CCB41E6394DD08ECFA3058CF6D31 [email protected]
1,666,240,399 *AF5D7B8A38645D3DA194BF5F67ADA945C04F0201 }x{~ ~ (==3
1,666,240,400 *AF510214BF4FC73A079D9861681E8F7E83E3E3DC SONOS1
1,666,240,401 *AF51C7DAD2FEB0E3C3C2BAC3E3D0067F69975538 50talouspolitiikkaa
1,666,240,402 *AF51C22F70B7C07263D762AB036FBCB22517901B 513cale
1,666,240,403 *AF54B93F057663C44F36CEAF5D4A464E082F1CA9 544CDD39DD0131F4B43E746A72C106E0
1,666,240,404 *AF5A3371ACFF48E5440639A67E8DC253D4B59ED4 sound-future-(30-second-version)
1,666,240,405 *AF542EB3F5703CACA4B53390A36FFD5D62B860AD SPENCER.BOARTS
1,666,240,406 *AF5CB12F7E5907DF0A16BDAA34598CDDBCD66BF2 XQJDEEGYUQS
1,666,240,407 *AF528515CC4255FC6BBF5CE9F1715293FBD2CA32 splat!!.o~.o~(===8
1,666,240,408 *AF52EFD5458C8F87246F96D56C7FA37FB95A7A3D [email protected]
1,666,240,409 *AF5710150DB6DF16A6DA39B78CEEC19B0F2DBB61 XWNXCVXI4
1,666,240,410 *AF5C373206672DFEF6D2379F61DB61EC476A9277 TEDDYFRITTER
1,666,240,411 *AF5A6D35462F0A033006DB751B293FE009F63D22 YARGNUHC
1,666,240,412 *AF5789DB7B2AE35DA06876DD264E191D5D85B18B SSENINOTHAT
1,666,240,413 *AF50EC8C1125BDAB80CDFB9558562B1EEBC5C31D YDOR123
1,666,240,414 *AF5E38B12F633E488CE846852EF61E8DCB8A7111 5HSITOIDI
1,666,240,415 *AF597B3EF95670BCF2CB602175F6FBA5A851A80D 5iluvrenee7
1,666,240,416 *AF59EF7DCE12E300195D8C18EDC552CD92DAA6FA STARWARSBANANE9
1,666,240,417 *AF525C3A5EF02A456EFC01B24AEA098465C3C628 stephenpyatt
1,666,240,418 *AF51A87D122250905C4A58D9A86D550BC7942DAA terrencemoncion
1,666,240,419 *AF5475C73592BD64DCFD6920D5AB808D5592111F [email protected]
1,666,240,420 *AF5E43C1FA758D6A76B19F181DF029E4591F59F5 YGK(
1,666,240,421 *AF5AE6EFC68B9C7E729A701B42A511D0E4C54D82 [email protected]
1,666,240,422 *AF51A4C56DF15F7B74F48EB36D0AA0919F2CE4A7 TFMGÉDW
1,666,240,423 *AF563AD937FB52B43E9D484E9A430C60A75EE51C 5t4ln5m
1,666,240,424 *AF59112B71C12F80EA89F540DC0C9BC32D351523 THALAMI
1,666,240,425 *AF539B4D11DA3BC3C6BBB40FC30168E05550878B YMHVXCBGBTBTELVN6
1,666,240,426 *AF57A99671C17D5786141D827B5EEBE451B79A30 STSINELP2
1,666,240,427 *AF58EA6A52D805F35C4D978C1F36BBBBD98C625A thatjunior1999
1,666,240,428 *AF55562836C2F4444F453DF4FA7C797627020CFB thcerbo 1
1,666,240,429 *AF527C64DFAD15B02D4D5F4D54AE561231AFC9D8 subhalagna
1,666,240,430 *AF51176853E34B6F3CF85134442756444A34F86F THECHUMP
1,666,240,431 *AF5E9536FA5BC51699988BDD683371FD631AC1C9 THE.GENUINE.SCOOP
1,666,240,432 *AF5FC0BE096E6F1D9913DD0E9414A3E05A2103E8 THE-KIDNAPPED-PRIME-MINISTER
1,666,240,433 *AF54B6705258206C8A5C3715CCA272F319860818 THENMEMPHIS
1,666,240,434 *AF572A9CAB088FCDADE0153D2DE56A57C6B8E193 ZACH-BRIDGES
1,666,240,435 *AF5620C60059DDA1B19D7DA86075F956F6D30631 6BSWTOURINHO
1,666,240,436 *AF5DC98D227D8CE4E81E1BDE383CD069879C0165 zackaryohland
1,666,240,437 *AF5114D2DEFC0910B3E22D465926F3086B1ADBAD SUPPRIMERAIENT
1,666,240,438 *AF51F9A03A92594461015CE3D03ED217D860DE1A [email protected]
1,666,240,439 *AF5DCEA22E793F8E860FFEFF9C320DA4573C886C SWINGIN'THEMJINGLEBELLS(INSTRUMENTAL)
1,666,240,440 *AF50BF9F16919B9BD45BF78F66BD52688397EA58 6FULMINURATES
1,666,240,441 *AF5F417A7A3772CA4C6939782810DDF866F0858C the.sound.of.goodbye.(yvan.&.dan.daniel.remix)
1,666,240,442 *AF571CAACB7758F4A5C2D3EAACEB6A20D539C43D 6GNUHCSIMREV
1,666,240,443 *AF55532A8FD337F70F7E22D764735FD2BD9EFCD2 [email protected]
1,666,240,444 *AF562E135788A59E2E3E7373E9E64738271D8668 6IAMTREE4
1,666,240,445 *AF5E4E54B102ECD31169373B10A32524F744BD7A SZIKHAR
1,666,240,446 *AF59CE4DDEA4B5C91E73522ED532C7E2FBD27C9D THOMAS.FEHRENBACH
1,666,240,447 *AF5A6C65C9CFB6C5C89C3CA22EC89321414E334B 6MEZZALANA
1,666,240,448 *AF5B01D1B27ED408972F1E113F918B74FBD126E4 [email protected]
1,666,240,449 *AF52641611A704BE7FDF4A9F2E6535945A87709A [email protected]
1,666,240,450 *AF537AD09A17397533D8717DAC3FA9E68851C443 TALFOURD5
1,666,240,451 *AF54B8BF43A5A410E186D57E6675D89296EBA575 TALKVILLAINES-SOUS-M
1,666,240,452 *AF50C5B5B9CD79064982D7FA752AF81E9AEE0930 [email protected]
1,666,240,453 *AF5577B51B5CBF6F223E2DF81CBD36C31BCB5337 [email protected]
1,666,240,454 *AF563FFA4B989AA06ACB4DD8DFCC188F482C34F7 [email protected]
1,666,240,455 *AF546FC782470005AFA086F63D154FADB48BA5BD ticker
1,666,240,456 *AF591CA799E432FF5EBB208BEFB07F54BED6CAAE [email protected]
1,666,240,457 *AF5807164120E8D0A565A02D3C80DDF1C2E39B61 795MARIE
1,666,240,458 *AF5B5246771F3C229C0EFF0C98B432A6BA4CD98F 7BSWFALLBCKBSW
1,666,240,459 *AF5B3C1BFB56C6F0FDF6AB652B037924364C00DC TIME/NINNIKU
1,666,240,460 *AF5AFBA7BEEE42B232F0C0BE59B508EBCA781F6A TDJIWTNOED
1,666,240,461 *AF526AD9B4B7BCC0937B8BFA22B15E8001500019 ZIJKANAALTJES
1,666,240,462 *AF510B86A21970B5155DEF9541872F5F17F37F77 TINGTING2368
1,666,240,463 *AF561BF9F09D1A5363B65BF452DDDA0C07D4F043 TELEPHONE---DIALING-&-BUSY-SIGNAL
1,666,240,464 *AF5A09EE72C8F7EFBA1BB18FD70E2338A5A4070B tembuku
1,666,240,465 *AF53F86AFCFE8CF97712AB76EB4864662597AC21 TKE$
1,666,240,466 *AF513F92BDFAE08CF54F2FAA36BE75BE86645BF6 7NEDHORSE
1,666,240,467 *AF509FB166250862C3ABB13472E414F7810DF13A 7PARABOLISATIONS
1,666,240,468 *AF569EEC055395C288269B5B4866D160E1A3779C TEXAS.DRUMMER.BOY
1,666,240,469 *AF50B523EF6EF911D2C1AC3BF05266E949E852BC THATLOLITA32
1,666,240,470 *AF5AFBE6B854C70B0AC689821FC45819898D6F97 7TNEMERITERTSOP
1,666,240,471 *AF58424A6B7310A86A10ADB97CCC8C68441784B9 7.WILEN-GOTTSHAUS
1,666,240,472 *AF50E2D250C3CF0AC115A1D054380013C542D4E2 7WOODYMARIO
1,666,240,473 *AF52827BD75EB4FC56635BD1CD3E3A38F349E3DF toffside1
1,666,240,474 *AF5B102580198696E9D817136FE79E453F3A7BC1 thepowerofyoursmile
1,666,240,475 *AF522CF4E07480CB8D2A94D1DFABB5E4DBB5E09C THERONSCHEIDERER
1,666,240,476 *AF5AB40B572679073CB001A562E8F16FA520B630 thesleepingbeauty,op66-waltz
1,666,240,477 *AF5A24646890AE86019B1C56344C59F9F59D4297 thghbns1
1,666,240,478 *AF524686D7DC28F9AD9D971C0B7BBBF9437EA332 Thread-and-Karo
1,666,240,479 *AF50AB22C8F52C08E04724E5D7EF187AB1E91A89 ΑΛΟΑΛΚΑΔΙΈΝΙΑ
1,666,240,480 *AF5ADF3716FD86A839A52B8AFFA84F432010837E [email protected]
1,666,240,481 *AF5F89E541A4F976A155AB429D1944C91FDDB912 έντχοφερ
1,666,240,482 *AF5AF08ECF192492EEC954F0CB8F600F1EC8AA7F TIMELIINESING
1,666,240,483 *AF544B2459F032D052EF653C56E021FA3D71A065 TIMNABOZNY
1,666,240,484 *AF555CB24FAD5C820EDF8798832EB081B2227B21 TRANSFERRALF
1,666,240,485 *AF5313AB378E9223E0E4DE311A69F323158AD068 джурки
1,666,240,486 *AF5E94A0ED8FE5769EE5969333C23BED1FA7A7A5 TJANELLO
1,666,240,487 *AF5EE421AB6A09A6364E76C47ABD4A2AC5D2BF39 treajuresilver
1,666,240,488 *AF52EF1D1373D70AA52B0B1DCB0B747705AFD72D TNEUSTAH5
1,666,240,489 *AF5A4D76933ECB797FF8FA0D4C1661B237920326 ЛИТЕРАТУРОВЕДИТЕ
1,666,240,490 *AF56D72301641769458FAAEC5D0508493CD1B11F TOBY.MALMBERG
1,666,240,491 *AF57A90A37DCAC07914C50C5F527905186B4C4DD toccate
1,666,240,492 *AF5B9E68985E2D3D2F82AC9A2122AB59D85DF35D TREVAWINDHAM
1,666,240,493 *AF5263315AB5B7B59D18DCF48EC5C562A593845E НАДКОЛЕННИТЕ
1,666,240,494 *AF587DA0442E815B4199E0CF93BB140806F1B5CA trey_hudgen
1,666,240,495 *AF538A830029B776DD3DD5483D18F1315AF9C511 8ELVISCLASS
1,666,240,496 *AF5737E6F2022BA2CD82928684F44EA993F0C20E пеликанообразных
1,666,240,497 *AF5A54BA19AB40394B6A593FCCE674F6D0993A51 8GUISERS
1,666,240,498 *AF5608A036832B8B1571ADE9F1C3227827343E33 8HINSTELLENLY
1,666,240,499 *AF52A95E7DDEE535FD963469789089832AE057A7 TRACEENDING
1,666,240,500 *AF5CE8064C8C13BFBCA980ABD0D13C9778A153DA TRELA123456
1,666,240,501 *AF5BF6198AFDE1BCCA85205C890FF6920693438B 8J<BAA
1,666,240,502 *AF59AF60815D1A3DF235C9C58D004AAB75BF5E36 TRESOUSAMANCE
1,666,240,503 *AF5A5E9D01C3CC15BA0C2C5A93C27E63360EABB7 treyhromek
1,666,240,504 *AF5D6EB97A8EABCAB30899AF97E4183ADEF27C7A 8MANDRILADOR
1,666,240,505 *AF56A912B99D713C54B9DADA22C2D19B1182FA59 TRICHELM
1,666,240,506 *AF5301844F6054D00EBC7773E425897250D0CB88 TRICKFIGUREN
1,666,240,507 *AF5532370C6549941439F66251792389E22AB964 [email protected] * *)O(
1,666,240,508 *AF554E51FC5124A594A645524E164D3FA14395CE 8======).~o~oo->-<
1,666,240,509 *AF5878FC87DE54B894AF25A5B036CB2C0D81C70A ТЕКĔРЧИСЕНЕ
1,666,240,510 *AF5D3AB28258E1AED5E03477FD7D553233E3A147 tuffn-up
1,666,240,511 *AF58712E96C7D0D3736488E597904C3FCA736DBD 8RELSURTT
1,666,240,512 *AF5D51AD6C262DAD4CBA2840A7C1A271CC548703 TUPMANTUPMAN
1,666,240,513 *AF59013F645BF97AD749527A5E733387374FEDEB [email protected]
1,666,240,514 *AF53148675DD5872B2AE22F2C00D1D659BDF736B tsengtsiangtalklucy
1,666,240,515 *AF5082D78432AE9E70E28B2972910C8052EBA0A0 ty,-JAPl
1,666,240,516 *AF5DC2EEA3BBE025A6F118BE075483FD9A498C4A tylermartinea
1,666,240,517 *AF5AFEBCE62B20F5806F6D376567B78DF02E821B T-YOU-OUT-OF-ME
1,666,240,518 *AF56820C37EDC59286AA72DFC0CDC0439FD90322 967328 usa- genel arama makinalari 21 03 .
1,666,240,519 *AF55715E722F2970C4E6927E86135C353E9CACF0 990451 TOIMITILAKUSTANNUKSET KOHDENNETAAN K
1,666,240,520 *AF5070EED7952764545C6ED7A114BD325F8FFC0E tungbaum
1,666,240,521 *AF5AE0F1D6A15D19FCF63E79961F8DAE49288F7D TYLER.BEYETT
1,666,240,522 *AF50DAE60140B8216BCB51DEF5A25E3E0B9B76C3 ;UBAAA
1,666,240,523 *AF5FE4EC955F30B2A6171964E9FD523C12F71F57 uitstampt4
1,666,240,524 *AF5AA49F982D955CF0F2F3CC3DFBEA2517274F85 9ARACHYDNA
1,666,240,525 *AF50A42CA7F5D3C0CA9C65DBADE48A5206A1CDE2 UN4VOID48LE
1,666,240,526 *AF5131DD856D6AD744232B92131FA9CD0753FC22 9BMWMAJOR
1,666,240,527 *AF5940F8C0413D12DF1BAD8D6989F65B4A441EFC [email protected]+NG
1,666,240,528 *AF5971A1E1E6962871F6EB3E59E02B803BCCD003 ULTRAHONORABLE8
1,666,240,529 *AF54D16B6C9E187651B275202BF01826332D6B53 uprousin
1,666,240,530 *AF5C837427B3CC4B097798042B58CAEBA8E44514 9iamsalasana9
1,666,240,531 *AF5F69FCCC0B8CD34410C28B5BC87BA9AF5B3E66 UNFIRM2
1,666,240,532 *AF54C18B27231759F11CB484A0EE7B982C205071 UTM.CYBETOAM
1,666,240,533 *AF51B26F3D74D9C589C5D2AF73CFA049B6DD55C9 UNHABITUAL ,/@/NH/@/'B/I/T/J//U//@/L
1,666,240,534 *AF5957768AF2CBA9DF864656ECD0BD25D26B1AAD 9MOZARTBOSS
1,666,240,535 *AF5D03BB77BB30942AB6F71E51C0DE2DCE22C23D 9PEDIJATRIMA
1,666,240,536 *AF552197B70A415CE75482FBBC04919ADD0CCEFB UNTITLED-(12-25-04)
1,666,240,537 *AF5169D24825C65AC84EFA3BE6285AF18D660254 最短ではない符号やサロゲートペアなど、UTF
1,666,240,538 *AF5F169EDA9DB65AF76A711B518FF30DCCD972FA 9THANKAN
1,666,240,539 *AF500C5F6EA5CF0C99B010906130F6812FAD427E VASTAG-CALIN
1,666,240,540 *AF5B60915DAE8E2183C2D3F3B684156AEDFB75B1 VEESHEEN.YUEN
1,666,240,541 *AF53C299977700115FEA281BB0670AE537FEB728 used-to-be-my-girl-(feat.-supervisor)
1,666,240,542 *AF52490AB5B8368C2E132FE655EFEA77ED367169 VENTURINESTONE2
1,666,240,543 *AF51A0DDDA915376C19F0986A3B7C735713E5540 9URAASIAN
1,666,240,544 *AF5B9CAF4B74AB97DCE0D53582AAFF2A9AD58B17 USERCHINAWINDZ1
1,666,240,545 *AF5EE9366157EB2C77ECC466BE8698C461EF3B03 VÉOXAXOÇ
1,666,240,546 *AF5208F3D250B74A476A65D1E42FC32E377AA640 9VD8QZFOR6ZUXJ
1,666,240,547 *AF5D4BBE494262E7E0CD8A78B1105B15ED37925A veritasint
1,666,240,548 *AF5386FE9E1D3CD175B9E75CBCB42D3F7D706D8F a4zmo
1,666,240,549 *AF5EBF3D977E39CC1B39369AE0B8E97FC14A47BD V"^H
1,666,240,550 *AF5837CE1817AFD48AE7B861460F933934FA1ACD VHINLOVE
1,666,240,551 *AF515F14C696F8A20F0039FED05A22E840CF202D vahid.eslami
1,666,240,552 *AF5BA2755A2D432BCEDA4F3AD34262B477C55B6A VICREYNAN
1,666,240,553 *AF55E28621108DCA59A8EB463ABBE1379E8C43C7 valdeprado.le
1,666,240,554 *AF595AA1795C3156C98999555D08634EBB396942 VICTORIA L BROWDER
1,666,240,555 *AF5194A9C0D10D8C92D48ECE353329FA0D8C593D a9s4%
1,666,240,556 *AF523BD566B381F618E10D31A5202D137DD8E196 VICTORPOLACCOV
1,666,240,557 *AF5BC1A0702ECBB5CE112148C12F400EAD3F671F AAAAE7
1,666,240,558 *AF53966F0D708915F677CD8A9961516C4E34AEAF VITA OLVERA
1,666,240,559 *AF5E36A03EED4F32EF3380EF795EE1C8F1329841 VANADYLACETYLACETONA
1,666,240,560 *AF566DBCC5B76E12C1C456DC9C4C5E92CC655352 VANEETDUGGAL
1,666,240,561 *AF5878C40E60FAF111786A687558A647CA691AE4 VANESSAERLE
1,666,240,562 *AF57DEB6EF6690188E03C13E1922B768212D94E1 variations on a nursery song, op. 25: tema allegro
1,666,240,563 *AF5A338164C1EB81F5478FB00A8AC2AAE6ED7755 venie.hayden.read
1,666,240,564 *AF5C408161F2D7E635B43D0F84C8209C183CAC9C VENTYOURRANCOR5
1,666,240,565 *AF5AE250E1CAA55E1F0B22ABA2E076E0357B5408 VENUSPEDRO4
1,666,240,566 *AF5DD32A3F85981B570148ADBBFCE8E325A838BC VERAVAINE.VRV
1,666,240,567 *AF5821EE261AD9960EC9E5BBBA474A51DFF6EC9C aafix
1,666,240,568 *AF5D6AAF7F414649CA8989C939705F99519313D2 VRGNGSBPLNG9
1,666,240,569 *AF5FDDE492F53BEAAE28C54175BA5F33DE05EEB0 VRIBELENDAGUINES
1,666,240,570 *AF50E1D9F58146F1EE5AE8DFE91986EA2CF50290 aaron-antwi
1,666,240,571 *AF5C7EE8DA542DEE57EB92A7ECC03CE2BE0587D7 VHNRAUMAN1
1,666,240,572 *AF587A4965887D2A51BFCC434E97AF11883F949C 01.15.1232
1,666,240,573 *AF54AFFE0ABB24466BEBDDD468D29ED3D0031273 WAKATOKA2
1,666,240,574 *AF58EF35DFD48105BE328302C99B14D809123F9E ABERRAI6
1,666,240,575 *AF50B136F22B803D46E9A66BECBB99087DCA5CEA waltz-in-a-major,-op.-54-no.-1
1,666,240,576 *AF5E0F4A83ABAA03F01113FE37D65E1959A5BE1F vieux mais bon (feat aelpeacha)
1,666,240,577 *AF52DF3490055CC29FD77D4A2597BC0FF298594A vika.anggraeni
1,666,240,578 *AF58F89722EA6478C31E3FB0C130BEE72562638D abortion
1,666,240,579 *AF5C4A8B181625184210948CC2112FC226CF77C7 04-24-1218
1,666,240,580 *AF5B76420F7EED0CD6F70BC5C83FB1956F601527 wejustcouldn'tsaygoodbye(feat.carmenlombardo)
1,666,240,581 *AF5D6BB4CB8B4228E823B6F8A451FED49588FE5E [email protected]
1,666,240,582 *AF5AD35D04B09F8745B24C0D13C233748836FC9B (0_<)[email protected]====8
1,666,240,583 *AF5E42E5735F7D1B7CF869A96799B3989DD847CF act4-scene2-2
1,666,240,584 *AF5898A3E36B524D1046F80DBE320A2746E6080E VNLOSEN2
1,666,240,585 *AF517EC60FC668C50ECF8DBCA5B9F118EF5CD460 1062derzeitigen
1,666,240,586 *AF570D8C282B39EE4C89657163EB2CD683FF5AB9 whackanun
1,666,240,587 *AF59CC2DDCD78337A38E30F9462B4E25C8830167 ADIDEWI
1,666,240,588 *AF583C79899E2718BC9E9F7B18D664909BE665A4 VRDNKLST
1,666,240,589 *AF54CA2D878370B2FFEEA9F907496B801E6F25D3 WHISSY.JONES
1,666,240,590 *AF599055B9F2FD077733CB7498D016F7B62E81CC A,DNK
1,666,240,591 *AF5A6D0363638ED0B613EF24F88BEB3546BED9D8 W5DO5CSB78
1,666,240,592 *AF5F1DFD331702B474C6A103B6EE363886E1663C [email protected]
1,666,240,593 *AF54BA926DC2856DF267DEB02FFFD4E7DB6AA75C WADA-MARCIANO
1,666,240,594 *AF57F447DFE910B7E963B779B908B14FA99AE4B3 WILHELMINA-TELPO
1,666,240,595 *AF5D8FB04AB3CBC774F8F8B419C515783A2A4B3A willenecotten
1,666,240,596 *AF5B4FAD95A9E52973697D0C166DFD8F3CCD9C8F wallyluxon
1,666,240,597 *AF59D49BCA8E16AD5B9723B48B06D18C385E0817 AFSLIBED
1,666,240,598 *AF58B3E0CD6C553303AC6125F0718843BF287533 WillYouBeMyRose?
1,666,240,599 *AF56523C3BE38759AF7AD24A2B706BE80FA01506 AGLEY6
1,666,240,600 *AF5EEECE7256AEAA560F359E9205B88975239E55 16 LOMAKOHTEET
1,666,240,601 *AF5C11A71810D07F08F613304EC3EA30547340EA AGUSTINANGIANO
1,666,240,602 *AF5EA3265E0FD397664818A125FB94F8646EE993 agustinwanty
1,666,240,603 *AF55DE2BAE4CCA4FC0AEF03B21D1BB9BE2A894B7 1724896 SIIRTOKUNNISSA-TAI-LYHYEN-ITSEN
1,666,240,604 *AF5130B3558A9E22E22932CB164C2B7D7D576A9B WINTERHAMMOND
1,666,240,605 *AF53CDF45BBAAF8FF42627D30F01F552D6350C60 1801326 the.club.launched.its.anti-crime.effort.friday..
1,666,240,606 *AF5159638D634F57CB9894639074DEC5B7590BA2 AHM9A
1,666,240,607 *AF5AB4E52EF2964B3ACC47960C30DE1B1C912BF0 With.My.Friend.Undertow
1,666,240,608 *AF513F405C7298ED3B4E049BBD462377BFBB71BC weaverr5
1,666,240,609 *AF594FF08E7666D81A909EFB5F5D78CA7FAC1CC6 WLAMPE
1,666,240,610 *AF5884560DC048CA325824CFD05ACDFD36AA14F3 AiA-
1,666,240,611 *AF5CF39AE605A331D4FD5532DFE3C29299CE0CE1 1971559 SIE-SPIELEN-IN-DIESER-SAISON-IN-GRUEN-UND-ORANGE-
1,666,240,612 *AF5FE8B814D199BEE8980730959EF0E2402071F2 WENDELL.DANDROW
1,666,240,613 *AF51BA2DD17A6209D95BB1CF7C461DD3E87F7D9F WENDELL.J.WILLOUGHBY
1,666,240,614 *AF590017DB0424B409705AF53DDAB6FCA6DE79C4 A(is
1,666,240,615 *AF5738CE4AD3D1194D4B8680083FC925E4085AC9 1-ACHT-TAGE-SEEFAHRT
1,666,240,616 *AF56831EBD74E6C2A27C4F95E2F9975FD8341813 [email protected]
1,666,240,617 *AF5A5F647D6B73E57520B258E537A6AF3F3B40F8 WEN.HSUAN.CHENG
1,666,240,618 *AF53EB768D3E12828BDBF3AAC2F329FEC4BF584A WORMY74
1,666,240,619 *AF512489663E6D54DA646A9BC4CB8C5B3CF44B40 AJ?;N
1,666,240,620 *AF5F6A12822F5335C34B9169AAF19DAB4FA0003B wesdrews
1,666,240,621 *AF5A3644294B686621AD5410D42ADF4D5251B2E6 WTCHMKRING
1,666,240,622 *AF5727EF94ACA3C6886B6DC0923DB7B501F09AA6 [email protected]
1,666,240,623 *AF5AEF1C5E7BD44D45DF58AE1225FFE2059CC69A A?KUS
1,666,240,624 *AF54A0234949D0FC26137C7561745D50F99D1051 1DEFINEDIN
1,666,240,625 *AF51BEC4F5AFF31885E193B75A1ABA0E039454C4 wwwgeminifilmru
1,666,240,626 *AF5C3FE7EE74234D086C6A3E02E116D560406B3E wwwinternationales-buerode
1,666,240,627 *AF5FB7A455EBEF6F8F85C2EFBD3AF72777672863 1ELMANDEN
1,666,240,628 *AF5B748BB59A6A77E4F44CB617902375800266E4 [email protected]
1,666,240,629 *AF561E3500D318DE4B0A425E914258CF16323F10 ALEJANDROATALA
1,666,240,630 *AF57C5691C708BA8C96073FAC8F79D8A9ADC0845 ALEJANDRO.HIGGINBOTHAN
1,666,240,631 *AF55B98174FBC065CBC1340D043FEB96A241D33A 1FERNVALE
1,666,240,632 *AF5611B9C31C1A32B85C3D56A2C378B1D91A2D0E ALEXANDERAUFFREY
1,666,240,633 *AF551BF3312E5F42DDB07F4138AD443FD18758FD [email protected]
1,666,240,634 *AF53D86239BDD709E8D50616FFBF0B1EB73643E0 WILLEDITH
1,666,240,635 *AF5F1D651B57B18F68097132C9911EF365B55D26 1GELENGD
1,666,240,636 *AF5C8999A316E922EA5031963BBD020F4608D71A )X(-~-~D==Q
1,666,240,637 *AF5571FE1142655F7F29BA89D3AB1920859648DE 1ILOVEMAYDAY
1,666,240,638 *AF5099590AD919F0C83D61A60BB9525ACBE902A4 [email protected]
1,666,240,639 *AF5238E86D1D9A6E936FB1EA9BFAC1DFD6CFE3BA [email protected]
1,666,240,640 *AF505A22B2F2F21C490ACF1FE967AD3524E05CED 1.KURSSILAATIKKOON
1,666,240,641 *AF53A4103B533F4F88DE003A23CF092E273E6F66 ALLEN.METTILLE
1,666,240,642 *AF57ECDB7D93B606B3068F607E97E7FBE972B5B3 xracerx3
1,666,240,643 *AF5FBFDF4E7E2EF830356B9BF0841D0DC02ADE62 1 MARGINALISOIDUKSI
1,666,240,644 *AF5870D189D745CE699C98129EFFF739F0817276 1moore-appointed
1,666,240,645 *AF5C28C17CDBDBB400C91623BAAE042F4EBD72C0 xxc
1,666,240,646 *AF51E5402330A3D1196D8E9833AA4BBAD6860795 1NORYCES
1,666,240,647 *AF5BA1D696CC0CBF580EF86092CAAC4E62222A56 1PENSSELI-YRITYKSET
1,666,240,648 *AF577988DECD07A50B82B1A57D0026C19C85646B 1 PERINN
1,666,240,649 *AF5D529FFEC696F2290A030A21ABC74EF23616F9 ALU
1,666,240,650 *AF556B55A1FC561C5C3EEDBBCCFF45A5988C2030 wilsonduff
1,666,240,651 *AF5AAFB0774ECEEC302874CF04A48276E36D9F4F YENNISANCHEZ
1,666,240,652 *AF5287C5C0CFAF7EF04FFDFBD2EAF7C4FC6BF042 1.SYNKEILT
1,666,240,653 *AF54EECECE77318BABEE05F79E78A1E467BA9536 1-SYNNYTYSKOMPLIKAATIOIHIN
1,666,240,654 *AF55A2D025ACCA448B6B6823E52D43E1EB2A710C 1.tabiiyye
1,666,240,655 *AF585386B2B616D21DE564485C2AB048747AA1A0 YIGALBRAVERMAN
1,666,240,656 *AF5D8E644698F834860DEF6C1D46B7F0CE7AA194 am#?d
1,666,240,657 *AF551A5CEDE2A11B0A5464B5087C136602210719 y_ke
1,666,240,658 *AF53F79F280B0C90474D331471A76555369ACE66 YOHANNESDINEGEDE
1,666,240,659 *AF5D7A9A1B3D723937C73E21C8F7F61ED7FFC42B yuniagussutadi
1,666,240,660 *AF54363E0A1EC315B41A81BA91FE068641A59483 am:lb
1,666,240,661 *AF595F22502B9CC2CA672F70272F5A07F94B2AA1 Am$P
1,666,240,662 *AF58CD72F4816C056E1C32021B98111BA9A3D158 1 wakenitztal
1,666,240,663 *AF5E17B5B0CD7ADE0650CCEBCCFE69FC4B13C023 ZACHARIAHGRAY
1,666,240,664 *AF5CAB014FB47154617B8E1AD5533FBE4C2FFB36 1-WOOD-IN
1,666,240,665 *AF54C8D41736E2BD27A4A79209362B9754C070F1 1 YKSIL
1,666,240,666 *AF58BDD9AFB6F808EA0880F8D4F1B3CE6566D9BF WRANGLERMICHAEL
1,666,240,667 *AF5519F366526048693DFB501FFD4FD8EA0E68E7 WTMHAA
1,666,240,668 *AF539683B6B99F425DA983E057C60BE3D980FEE5 ZEBOIMBSW5
1,666,240,669 *AF5D3CB2D1D8C540D457E99D2771CF90C44717B9 ZEIRENORED
1,666,240,670 *AF5A519E3043B2596450A60DEE5BAB7A9E1009CB [email protected]
1,666,240,671 *AF5766429D70FB73DB3221AABDD4C89C1751FE6D 21081327
1,666,240,672 *AF5D141A8A8CE1364F14F85FA9AC903D215573D7 2117109 diekosten-undauslagenentscheidungberuhtauf
1,666,240,673 *AF59F668AB07037AFDD066B8134BBC2605F2F4C1 2161296 alueellisessa.yhteisty
1,666,240,674 *AF58B3C2DD3C8AF606DF8CDDA4577F4596DF202A [email protected]
1,666,240,675 *AF521AB5A883EE4437F88D66394175E496A7CE34 [email protected]
1,666,240,676 *AF5BE49533FEA8816E13D6537208D67028852E60 wwwthelocalwebnet
1,666,240,677 *AF5A174011396C8024E09097FD08D82A73D3B2C7 2266241 uskon.,.ett
1,666,240,678 *AF5314213BC7AA08556791A154B9F8152E3186B4 [email protected]
1,666,240,679 *AF53CA3F7FAD9D78BDF91262DBA94F37306EACC2 wyattclugston
1,666,240,680 *AF5CBC6023AA9E9780C540FD983664BB601BA202 WYATTLOERZEL
1,666,240,681 *AF51B31D3F1AB80A31E9A702CD71DE4DF804F069 anticorps1
1,666,240,682 *AF56F2524A9FED67BCFAB0C70761E5B8D5328700 ZIEGELKLEINSCHLAG
1,666,240,683 *AF51A2CDEA5B226EC1F3637311FB6F7101266453 „ZIMMERSPRUCH”
1,666,240,684 *AF55D7F0DB8EE09F99B566408E081533D2184AA3 XAVIERWIEDERSTEIN
1,666,240,685 *AF53E48912271C23D6B25DD427DDBEB1EF22D762 xaviourantony
1,666,240,686 *AF51ACD6E2E44AED148228858860ED2121DE4076 X\F/
1,666,240,687 *AF5DC6A4306A2749CBD570FB66810DB5ADB60730 [email protected]
1,666,240,688 *AF59FC6E9737535D3E28409CEE3A13C5F617A9CB [email protected]
1,666,240,689 *AF58E7A93E276CD82E88730E63702D6223138A42 25DASSCHWERTINDERSTILLE
1,666,240,690 *AF527C65CFD44B0A02EA51EA154BC05DD5261D87 26091128
1,666,240,691 *AF5FA60F41970EFEB4239E7EB2C94F5548A7650D zrlatan.grouf
1,666,240,692 *AF5C948E5EF562525CA44A949D7E319ECF3BD6D2 aopn
1,666,240,693 *AF5775B02002E2F97973E8FAE01197B0D9B6FDB1 (x) o~d#####q
1,666,240,694 *AF564E0859F50FBF8425D291A03E9B8019A12D2F X.PROJECT.&.FRANKIE.PAUL
1,666,240,695 *AF5B75F4A24215FAFA9851685F9898832557265C 28725 DIE-POLIZEI-SCHAETZT-DEN-SCHADEN-AUF-ETWA-10-000-EURO-
1,666,240,696 *AF55E70CAF0BC348C1D83D47649603100D02C858 2881225 HEDELMIIN ILMESTYV
1,666,240,697 *AF559645B0099771C4986F9859423C1632827B40 XQWKCI90YC532LQ
1,666,240,698 *AF5C641C966F9F0FBB2DB5B23D7B144AB86FFD98 april-rain-(album-version)
1,666,240,699 *AF5EA1474061A8353D91975FFE3E9FC96802CA3D 2ABDICAREM
1,666,240,700 *AF597B734A8D05B503B77E1E6A3AFEF0A1DE253B a&=q)
1,666,240,701 *AF5B3D1CF1A7ABD8D4FFD03073A59C92B5F0EBB4 2CHONUNG
1,666,240,702 *AF560161D542EE4CF520595B2D5C77BD4DFA9037 ВИРЯДЖЕНЕ
1,666,240,703 *AF52AA61FDD86D74192BE3C699175ACCC96DE229 2euzahlungen
1,666,240,704 *AF52BFAAD49614BFB3CC65208A3B2CDEDD2109F0 archiesunniga
1,666,240,705 *AF5D4A7322829DCF9C6CCD5428F30E2BC69D84E2 2fj187eamfgz4tks1asgaqe9b
1,666,240,706 *AF51B0FC8CEB358476A5BB79BAE6D6A194335D5D подко́лзин
1,666,240,707 *AF5BA31EBFC9BA4080CDCD94F337581E5BC923EF [email protected]
1,666,240,708 *AF545BF391DB507738DDE35957E25AE3085B8EBF тетянівська
1,666,240,709 *AF58B9BDC5801BD7B046348AC20CD1129C3D34AE YASHAHAJIZEINALI
1,666,240,710 *AF57618B9B70E4209EE78576777087C3AF0C4698 ШЛЯМАРКА
1,666,240,711 *AF5A891041CC271FA8FC87C9EB5961E0CF62CCBD 2.POJAKSEEN
1,666,240,712 *AF50F76EB79A6CC63E43C1F2D3615A8B2EBD23F8 2-SUOMAISEMAAN
1,666,240,713 *AF50575B18D3862A27EEC7F5C72249FAEDFC3AA8 ARUSHA-NAIROBI
1,666,240,714 *AF5B4497D82E4B9C605FA457E169A07482DC7553 [email protected]=
1,666,240,715 *AF56D261FB1226087C28174B4CFB38FA6C71E0F1 2yrttisekoitusta
1,666,240,716 *AF5D28B7CCA9B8F94B310AAEFD1419DD3BA4BC55 [email protected]
1,666,240,717 *AF57FB1ADB749DFF5B773AB51B1B1040092BC23D [email protected]
1,666,240,718 *AF574908F25B701F3017835579E3011D6C90465D 34685 apurahat-maksetaan-kes
1,666,240,719 *AF51A24BB8D13A8BD5B1F5D36DCF2296743C3995 ylftuoba
1,666,240,720 *AF5C5BCA8F00F9858138163F66490A8883642976 A-TG
1,666,240,721 *AF520E4C8D13D5E0F50C7E697BBA990747FA845F [email protected]
1,666,240,722 *AF5FA8BCEB6E730754216D8B9228D0FCBC66969E AUCHWENNICH'STAUSENDMALBEREU'
1,666,240,723 *AF5D86E80EB65B8959E337C32529F0B50113B251 yuriska.riyanthi
1,666,240,724 *AF55C497D268874115F245DA8CD508FC0350FEB5 yustianlimbatpabrik
1,666,240,725 *AF5404D301D7CBD650A6AAB9B985A3E8AF1D1925 AU;$I
1,666,240,726 *AF5703B9F42243414B7F1F87C394081078010407 av,_$
1,666,240,727 *AF54DBDF540A67531C962B66018BF360846E94BB zachariahmokry
1,666,240,728 *AF547FF454E8DEEAE0DC6A20E6BFF2518BB24DDA AV6Y
1,666,240,729 *AF59AED3071E4555649ECFB377B918D458F1B418 10shamkhani
1,666,240,730 *AF5D61DE5BB32458A9085A0B2ACA377B15575D54 4CGJSPIKE
1,666,240,731 *AF5B13782355D1FDDA29C61254C0EFBBDAEFA506 11:.11..-#..-&...indirect.object
1,666,240,732 *AF5FF338F1A6F6264056E7DD9A8301C7C1FC1D6A zavjero2
1,666,240,733 *AF5414AB04261065D8A7BAC00C0767A35BC0BEF5 [email protected]
1,666,240,734 *AF55EFCE11380F16848CFD839903712794F2523D AWMGF
1,666,240,735 *AF59A338C6A1FE915370EF35C47A3BAA3C46573D 12AFRO
1,666,240,736 *AF5D8BDE1B279242C5CE30B3DF8B713776DE998D axda)
1,666,240,737 *AF5ADA1EBF23EF8969CECEF592A33231840567B9 4MOUSEMANTRA
1,666,240,738 *AF5CEF59F3CCE546D254D8932BF8E5F9E94C28CD aykg_
1,666,240,739 *AF5987396B645A7D60ADC8EE7E4603EC05353361 az:=6
1,666,240,740 *AF5A7D288D5B6BA627005C308B1B95FA3902E6CB [email protected]
1,666,240,741 *AF5B7DC75EEB388CA08247DEFC68A5000F1D3450 4-PRELUDES,-OP-33-NO-1-IN-E-MAJOR
1,666,240,742 *AF5655B8B2C528284A892D38CA9432C1CF13CA50 1487060 KOSKIALUEIDENL
1,666,240,743 *AF56506B6B3CE734A01BC84883570F92419EA473 b####)***~0~osplat
1,666,240,744 *AF583464FD2FC3906FCA53D113237C52B373483C 1715665 ANDEREBERUEHMTECAF
1,666,240,745 *AF5BC9FCBE05EC64F65FB3E7782775FF9244FA25 1767732 inforengassopimusehdotmitensaantunnuksen?
1,666,240,746 *AF54EDD16E77097C8ACC29A3C05AADB7AE761AD2 4SPROGKLASSES
1,666,240,747 *AF5C1ADE91B764220FC65E59F34AEE7FAC9705F0 zino-delacruz
1,666,240,748 *AF541F0C724F0A00B3FCE07958B317A9C0AB313A 1999-06-28:.glasgow,.uk
1,666,240,749 *AF5FD0B01D7D2EFB5C702D6EC71EF36A0FE747F4 b$6#0
1,666,240,750 *AF5C0F355AF6DEFB1BF012846888299C98492C39 1AIGNOPSO
1,666,240,751 *AF5CF12D5D485141EC07F9C3F3D958C3F83B62DA B#6NO
1,666,240,752 *AF5EBCB346FE48DE18927A5F490F228052538CEC 1APL-OPAS
1,666,240,753 *AF5B9D4E2EE051BA6BA0D69B2C2DFC16653FE837 [email protected]
1,666,240,754 *AF59AE3A08466EDD3815E99EEE9CD014AD0F2474 4ZEILENVORSCHUBMAGNETS
1,666,240,755 *AF51D5CD0CAD66517BC17372DBDB75809B2EABC8 b=7u4
1,666,240,756 *AF5E985E10F125DCC4B6415A9AFEC21FB8E8B973 ZRRPBFSZ2
1,666,240,757 *AF54B5D7E07D8E52F48EED3424C5280CD8F60582 B&_a
1,666,240,758 *AF5C0EE74E0BCF835E803A7F4214BB7A58B7949D 1friidu
1,666,240,759 *AF5DB6DDC6132EFE2AD9A19E522AEDD521310695 badkq
1,666,240,760 *AF5CF3A15E1A6F82D0ED87A3CED19F6AD4CBA174 [email protected]
1,666,240,761 *AF57789B856693D729C82C34A195E7977999522C 5BIGFOOTOLIVER
1,666,240,762 *AF5178D27AE0E8D5BF8C001B62C2BB69C199BA6F 5BOOMERDUSTY
1,666,240,763 *AF5AA59C9440D35FB69897CE843534DF567BA738 5BSWMONTAZERBSW
1,666,240,764 *AF594760421FD9B6ECE426776F1910EE629D7305 banh.phong.tom
1,666,240,765 *AF530B4370A88572024F891266620D1850117FF2 BANN-
1,666,240,766 *AF543C1895D0DD3E52FF70C735402E8B8360AE7D BARRY DOWD
1,666,240,767 *AF56C3A59A5F2B0FFFAF9E7D74FFB5A8A29DF1DB ализич
1,666,240,768 *AF567AD3D8376695D1D668E027BA5FA3B31A87D1 1 luomutuotteet
1,666,240,769 *AF55EFD11B52AFC1EA5B6E20D2A47859F3D026B6 1.LVZ-BERICHT
1,666,240,770 *AF5B83F8E2C9FEC432236F717F6AA20AA0144609 БАЛСКАДДАН
1,666,240,771 *AF54B187E75F02238A3C5EC6EF06ADE497D25511 ВИРАГА
1,666,240,772 *AF5DEFAEC1433A5EBAFDAF2CE06DD2AC7202FE4B b!b_j
1,666,240,773 *AF5117F9258D0AAA007EC3A431E0CBAAC052A63C 1-pikkuhiljaisen
1,666,240,774 *AF5E658613B38DDD85E0BA8A67463858ABB41340 bct_9
1,666,240,775 *AF586F6F895E0F360F5AF0F65A1A8FC155CCBDFB BDSC1
1,666,240,776 *AF5ACC6A2CEAD22D98841F40BD5CECF26DD79B94 BEGALYBĖ—BAIGTINUMAS
1,666,240,777 *AF5774C0E2A63D9B01D3FB13FCEC3B65E5CAE176 1-TOUR-RHYTHMUS
1,666,240,778 *AF5C05457E2D537D5832E4AA4A7D42B8F5986163 русскую
1,666,240,779 *AF53215B7F3AE6FDF8A8D2E69AFB22BE94A21567 1 [[user:zarbon|zarbon]] 06:09, 26 april 2008 (utc)
1,666,240,780 *AF56E052781E471AC54A02759D73C21EA4767593 1.virusepidemiat
1,666,240,781 *AF579C517A901FF30C4E71F1A079E58D5C63F272 5SAKLECHA
1,666,240,782 *AF5C87BC75D46A80FE01872D5B78976446DDD930 1WEHRTUECHTIGE
1,666,240,783 *AF5F0EE615E2190F22AB8C0B782D660EA38F90BA 1.yankauskas
1,666,240,784 *AF534C236AAE7835DB61E1BFA0ED9195344D9616 bentonshadow
1,666,240,785 *AF57DE7EC76B862DC81E6333254BAA3742474DDF 2050592 itcouldshiftthefocustomrkinnockthisweek
1,666,240,786 *AF5EE6E3CD2E3029C671E01BCAC05A6CF5D115AE 2062900 teleliikennealueiden-muodostamisen-perusidea-oli-tehd
1,666,240,787 *AF5AD44A9FB3516722F6141C6019AC9E68862A68 2093738 ATERIA-MAKSAA-USEIN-YLI-25-MARKKAA-.
1,666,240,788 *AF5A167DA1A69ADC7124BFD6F45E142AD46E07F3 [email protected]
1,666,240,789 *AF539793F1EE652B217116117A8DD7DBD31FDC56 bf.8l
1,666,240,790 *AF526B8A73A518A66444616B1D890D3DF3EE2A8A 24APRIL1901
1,666,240,791 *AF5B5BE9FB4D5DE522098AFC768A21764BC45D45 B=G9K
1,666,240,792 *AF5632C9B130CF2F5C37635E3FA6F3A8E6F33FEC 6CHINAFRANCE
1,666,240,793 *AF519FC80576697983EBF4118A90D7110A7EE130 2659641 T
1,666,240,794 *AF5EE6FF3CBF75263567DC691B6980E81CD76776 6ENTREMELAITS
1,666,240,795 *AF5B111388AAC2FCBD71D345DFE4BD80D897A05C 2743760 AATELINEN.FALCKSUKU.JA.S
1,666,240,796 *AF55B67CF52E369B437A67D227784BE56AE6BAB2 2906623 EIN.KRATZEN.IM.HALS.,.DAS.NICHT.AUFHOEREN.WILL..
1,666,240,797 *AF51D1784CBCE3B485C83F8B9AF8C33387CC9084 bhzon
1,666,240,798 *AF5B3E832C4E6C8C7402DFDBD2C7D8D3B726588D 6-LUKSE
1,666,240,799 *AF512FB900EB122FA4C4A621B5A94A79C775543A 299293 " I WANTED THEM TO LOOK THEIR BEST , " SHE SAID
1,666,240,800 *AF5D7D81C19679A4B8ED164C3E4B06EF4E449D0B BIBLESSA
1,666,240,801 *AF56E2422C03C1A136655A4A577542F82FE1D830 [email protected]
1,666,240,802 *AF555ABACB752107A80426E9463E474428C84B26 BIHAKKIN5
1,666,240,803 *AF56FF37C69A695395687EBE85888D1DD280CB3C bikliban1
1,666,240,804 *AF59CB7C804C46640099004FB5B888FEC74C9B5C 2EINGANGSNAEHE
1,666,240,805 *AF5ED306DF3EB482CE78421D129D4769051319EA 福岡新水巻病院(約600M西)
1,666,240,806 *AF58728DFAE60691D35CE979BA8451D053AEE972 BINDU-LAMA
1,666,240,807 *AF505E53ED7B0C7D0B9A01F81AE5B8F43BEF26C3 BIPOLARITY1
1,666,240,808 *AF54E61122C07B849BF60F9AA740A614298E1740 bkd4
1,666,240,809 *AF56C5F9FCE6020B70B21D6243613FA9C2D6A278 2PARAKALO
1,666,240,810 *AF5917196595570746D30F199C674B6B603EF858 2-practice-that
1,666,240,811 *AF5F540B5EC379A937A8BAE9DF072A697E4A9A9E 7031640
1,666,240,812 *AF5BC0C6ACDE425B4C4FB6B0FEB7E2711512D0C9 780ashly
1,666,240,813 *AF5A6F86B6F854B9FF31E6DD5C38118D3FC19DCA 2.ueberchlort
1,666,240,814 *AF5D7BB921E25047E28786B71C5FB64CDE5DBD28 BLBEČKŮ
1,666,240,815 *AF521A07ED99C3892A26AAD741066ABF3F1F0436 7CCCCCCFLOWER
1,666,240,816 *AF54AE4B6453C7C4C248B605CD4BF37923180A96 2-ZENIAS
1,666,240,817 *AF522691A1365E065F774C4C1E3980696E201E1C 7DANGINGS
1,666,240,818 *AF5BD8CA1B42D45FCEFA7C2991057EB9E4FFDCB9 300JUAN
1,666,240,819 *AF56CC1F5FCE921E164CB7316D469B154C3C874A B#LWW
1,666,240,820 *AF58A7C81BAC91647D8EF16E1DCDA36871C811C5 7HUUMEAMBULANSSI
1,666,240,821 *AF587AF73544490FBC13DD21E6438DAAAB356A9F 3AUGLING
1,666,240,822 *AF56B111F1699D8833D0DF141404D6E726AAC9AC 3d61411b4df1920fff27c106c02f924c40
1,666,240,823 *AF57E8AFEFD8463A8B3A06346778E374AD73544C 3 KUMARRAMME
1,666,240,824 *AF5E49B99270AB24C6E47241DFE74037FEDCFE9D 3MYBEATRICE
1,666,240,825 *AF573EE0DF8B55D6F4C10059D17F7F5B200ED493 3######>.~O.~O)O(
1,666,240,826 *AF59B5C1B291EEB089FA9A16D839C7829DBD39CC 3SQSTRMS
1,666,240,827 *AF56EFC64870DF3AF8A5E2240F2634D873602995 04-24-1218
1,666,240,828 *AF5A9D4AF26FD242746FE8FCA9E4C623607424C5 (0_<)[email protected]====8
1,666,240,829 *AF5A2305A55462C683A78A1074D0A40BE6FF0044 [email protected]
1,666,240,830 *AF51295F0E97FD36DEB6A9BF61FEDA9087AF3789 bp,
1,666,240,831 *AF58D584636BF1138D4F3AF9051B99E74A47F6B7 7SUPERTEE
1,666,240,832 *AF5DF84D8CC35CC497718CB5D7D4EC6006346F2B 1062derzeitigen
1,666,240,833 *AF5F0D3D4B322C304C7946A43923C66FBA62DA26 7TRUQUER
1,666,240,834 *AF59B32568C5545D0192D560E9577116B52DE141 4RCHPRO+OPOPE
1,666,240,835 *AF5CE1FD267C4E12E15FDD9AF0A5CEFDA9A7693F bqarg
1,666,240,836 *AF51BD8450CBE1A9F0816E299D85D89A9027FD93 814286 OSAKKEETHANKITAANHELSINGINARVOPAPERI-JAJOHDANNAISP
1,666,240,837 *AF50C51B436A909319411E66C35D12ECB4DBE83F 835BROOKS
1,666,240,838 *AF5CF2890EB9E7B47081103361B34EB0140816EC 4THATRAMBO13
1,666,240,839 *AF58A27F29879B2C5DADAFD691C5AE519051F116 8ALINAMNO
1,666,240,840 *AF5B102B05E3523EBF176DE6E5BD8B21B73C691C 8ASTHEWIND
1,666,240,841 *AF56378DAE07AA868217664A71C04AAB8DEE7964 4UNFORTUNATE
1,666,240,842 *AF559D95B49BC9D84918B4FABEF521D327D5C635 [email protected]
1,666,240,843 *AF5712600F005576457A3BD2E9252F07F2414D2C 8===> *>b0
1,666,240,844 *AF5D18A5DC7E607988E6A97FC076239AEA8E188E [email protected]
1,666,240,845 *AF54AD643AFAD0118F66C4DC4C52AEAD1EB8A5C3 brandonottley
1,666,240,846 *AF50DDC2FCEE62655AFEEA5E7B19D8F762A3DCB5 8BSWVIDEDBSW
1,666,240,847 *AF50FC4C57E68AC12BA646DC58F256CB7B334276 512792 amacInaulaSmISyazgIsInIkurtarmIS.
1,666,240,848 *AF5DD7F955DB138D4C5F317317898DF88E35955C 8d.~.~.~><
1,666,240,849 *AF54A31FC85FADEEE00C340DF0CE35EBC4C05CC8 1628259 NYKY
1,666,240,850 *AF56D2D67C2AA4D480CD334B5245DE5140C0D7A7 8DISCERP
1,666,240,851 *AF56F6D8BFE35B3F04A1224816DF52A650F511CA 8======D~-~-~UU
1,666,240,852 *AF53E9CEB5F1EED6C9B2CF4390CBEC0111B961A1 5BSWTALUSKIEBSW
1,666,240,853 *AF579CB8473FC0C2FCA42BEB28422308868792A6 8ILOVEPRINTING7
1,666,240,854 *AF552826D4C1AA052310CD5B722D305A9DF96402 5FIREMANCELTICS
1,666,240,855 *AF5C5D1CA8FC339599080218E841BA07DBA09069 1801326 the.club.launched.its.anti-crime.effort.friday..
1,666,240,856 *AF578AB975D7FFA3EE31B6FC73820995965261B2 1886485 ruth.brandeis.lacht.,.ihre.freundinnen.tuscheln..
1,666,240,857 *AF53723C98DA234D224961A5A7EA94D2D518E9E2 1 anlasilmamaktan
1,666,240,858 *AF57E9CB351BE2617FB5027E35E29DF8EE5103B9 8SUPERBALLS
1,666,240,859 *AF571F8E3745303920B0883C86860AB283385EA4 BSaG
1,666,240,860 *AF5A801BF23BE65C910396FABF6E70902334930A 8YLSSELITIP
1,666,240,861 *AF519B229D5B9B7A6667953AA02E8A76E1D2FBA0 bswroxxasbsw
1,666,240,862 *AF5219ADA91945ADECFE6B7F29904E15FB5FF29C 1-COLORED-A
1,666,240,863 *AF5B60E855DE9A4FFC13FE9959FEA4C3603CF142 1DEFINEDIN
1,666,240,864 *AF509B566A0062680298A6AC2C0672C3D5185E75 1ELMANDEN
1,666,240,865 *AF59B2AE4D8B0A9D12F923EAFDE0759753130F23 [email protected]
1,666,240,866 *AF5D161EFB4028C702D627491BE1C7AF4A8A5457 5STANDATATTENTION
1,666,240,867 *AF575136610A11FE70773EFDDB07B94F739CB057 BUFORDCICHONSKI
1,666,240,868 *AF56254F1011AB513E7E6BD7D2D7192F26C592B1 1FERNVALE
1,666,240,869 *AF502DDC6DD107AB750D93DE7C67EAB3BFDC861E bulkedout
1,666,240,870 *AF59C832E09D7F7DFB8975EC9DF5D36A8D56C247 9DIDOTTODID
1,666,240,871 *AF5AFAB1616EE9DE300993CFE27EEDD541060B97 bullrun
1,666,240,872 *AF5F4CEEBA3A63F8C26CDA61037BB086EC5D5E7D 5VERWARMI
1,666,240,873 *AF50ACFFDF88216761BAF55C15D04CFCE33776CE 1ILOVEMAYDAY
1,666,240,874 *AF52483D1858CA25A2C7290C4BBF6ED11847662B 1.KURSSILAATIKKOON
1,666,240,875 *AF5E46242B175A7E7342219757F92645D21A207B 9MYNORIKO4
1,666,240,876 *AF5532E7F3222B3199B8C8DBD011E9B915C50A37 6BSWPREISSERBSW
1,666,240,877 *AF52C5B48F2737EAD9B091DB91F4363A9393DAE2 6CLEANIND
1,666,240,878 *AF510C9C742363BD3333C934747D1DE72E2318B1 bx&xf
1,666,240,879 *AF5047F63BCA10248BDE4A0404D07D3F0127C5EB 1moore-appointed
1,666,240,880 *AF5D7969AF2B31BCD0392E336792C15300146F97 [email protected]+E5
1,666,240,881 *AF560F9C6DE3F35794ABEAFB4A95EB2A4781E250 1NHAL3$
1,666,240,882 *AF50DBB97FADA726DEA4EADF3CEBCCCA6EA6DB26 6MALCOMBSW
1,666,240,883 *AF54424C109607124E5D9F03ADC8DA28C416E5CC 1PENSSELI-YRITYKSET
1,666,240,884 *AF55689D7195ED6D8104245C5F46DE0410381FAD 6ROBERTHAWK
1,666,240,885 *AF58C7108722DC23C0C4925762F37BA3047C7D71 c=4ny
1,666,240,886 *AF5A003FD7A8A644A2DE67DFABD84DE029380E52 C4R1K0NT0LD1N4M0
1,666,240,887 *AF52BD3F9458E3ABECB2597116E5832F24C74B4F 6STRAWBERLETMEIN
1,666,240,888 *AF565D3837226A80B1E6F296A127BC392257E41D 6surabondants
1,666,240,889 *AF523471187263D5E16FBEA29CF853EDC1015403 1.SYNKEILT
1,666,240,890 *AF502BABE10EB7246A5EE8B4B0C125369C5FB892 a7l?
1,666,240,891 *AF537989D8398D63C1E091A26576D8328C55CDF3 a9?p
1,666,240,892 *AF5EE289E1A73F6C69BD0AE057D034D6C5690FAF 758775 mukana-oli-sek
1,666,240,893 *AF5903421E48D7FF6C91C41385FC2D1F760D7B94 7BRAZILINDIGO
1,666,240,894 *AF5365E0B6F81FAA62D3C151B19E6191821067EE cambioviolento
1,666,240,895 *AF5D7D719A3B66D746A9F85F79FD02B778AB856B CAN'TSTOPRAVING(RADIOMIX)
1,666,240,896 *AF5BA9705D5A71EDF256CAE268FBB4D39A6E01B5 CAQUETEUSES
1,666,240,897 *AF56BD64880F52AD9BABC970D2BFA7FA83D5A243 7FILOMHLA
1,666,240,898 *AF5BB4DDD07E6900AFD07DCEC48D4346253A4FFC 2000fikr
1,666,240,899 *AF52CB64854E547463ECD59559DAB9B734F14A06 AAB=W`
1,666,240,900 *AF5942D71955DB5108C60C222DCFEBE5B7329906 2266241 uskon.,.ett
1,666,240,901 *AF5449CD1B6AAC5E880429B5DA583B6322B4BF65 aaev1~
1,666,240,902 *AF5A54392E4BDA598BB7D519DFFC56BCA4E50C71 7OXFORDXXXX
1,666,240,903 *AF5648E21099DCC6542E59EEF8579135150967BE aa$iw
1,666,240,904 *AF53ABA6D37FC43675C415BB005E10D06FC68653 aaronleick
1,666,240,905 *AF59B4A10DC088FDB2F726FC06062428D46C9E43 7SCHOOLMARC
1,666,240,906 *AF5DDEA42F73DBBEE2866B6AC1F89A0F19451756 7SKRIPPER
1,666,240,907 *AF5F42F3E4C707BFBB5C1CD1DCCA71A590F9EB48 25DASSCHWERTINDERSTILLE
1,666,240,908 *AF5C7B73A4439438F4DF5AC89672532D210DC613 7TDMEM1
1,666,240,909 *AF5482F9022D5E8697511C9DFB6FA30B0F8DF95B abaremak3
1,666,240,910 *AF56C5AF7228E13A1A7DD6BB5E5FD8ED5978A006 ABEJOKIME
1,666,240,911 *AF54EC2C0F2A1C1FB58227BED883BCC6EFB99C35 7XSWQUZTWUMCP
1,666,240,912 *AF5C1692AA1091DA417A836CAD15A9A2CFDD1FE7 cc+#a
1,666,240,913 *AF5D3FD367BDB6346654438CB1946BABC10E9B50 2881225 HEDELMIIN ILMESTYV
1,666,240,914 *AF507A64E69856537BD7A3151EB98174B66BE285 ccz+p
1,666,240,915 *AF51EB880F44E39EF0207FA1F1FEAEA9D4A08207 CD33B78E3FF737C89EE15371116186B4
1,666,240,916 *AF550227278CE80BDCA26CF1C7791EE0EFD04CF2 8357IR5
1,666,240,917 *AF50AF09DF28FCD888187971B3843D1068BFD9BC 2ABDICAREM
1,666,240,918 *AF5C3B5B80C93254BE5E7927FD83DD06D35A4635 2fj187eamfgz4tks1asgaqe9b
1,666,240,919 *AF55D6D4DBD989C49A8D52AAA7A42049D839CD39 8D~0~osplat
1,666,240,920 *AF5F17758D9A6CC3437E2199B825F9EDB2CCD313 2.POJAKSEEN
1,666,240,921 *AF5227A6935729D06A2D645FDD085C5A9C25CD71 2 xq
1,666,240,922 *AF5DF6D1BAA30CF6DA8EA6C9AD1A9CF791DDDACD 34685 apurahat-maksetaan-kes
1,666,240,923 *AF5FF5893ECE5D0741542D5340AE72234A5922DD 8==p~-~-~-(~_^)
1,666,240,924 *AF53F80DD249AEA3414FAD9282E57BAD83091BDA ACTIVEN8
1,666,240,925 *AF54500CE4941AD096C12EBB68000447B6BD192F 8PIECESGRAVERGROW
1,666,240,926 *AF5898CF354C6AC71B7DCA873A3D69F7A1195AC9 CFOM-
1,666,240,927 *AF5B2F15E7FE1D4B9D0C119A401E8FE6F513922F c-g0l
1,666,240,928 *AF551A0AAA85F0B4ECAC6F99DFD60A643AA72789 8SHALOMDIANA
1,666,240,929 *AF50BCEC39BDC8CA818C40FEBF5AE84896D9AAD8 CHAD-KNEE
1,666,240,930 *AF57F13CB18A2FC7DD9923DB1162E2634900FF02 CHAINS-(FEAT-KILLAH-PRIEST-AND-MASTA-KILLER)
1,666,240,931 *AF5EA426AF88BCEA6A4D65622C03D4F904BC30D7 3ILOVEVISA
1,666,240,932 *AF56067110EE0939969CFD7CF87F707DA21AB446 3.netherby
1,666,240,933 *AF5B94196280E62DED662AD62B55D22478CBD3F0 8WILLIAMISH
1,666,240,934 *AF5B39960D469FCFC16E00113438B81D4CE178B7 A;"DT
1,666,240,935 *AF52B4A17C1E9E95025FDAD721D70713BF29464D [email protected]
1,666,240,936 *AF56C0B10EFE32D09E495904B0312B237EE389F3 94MEIMIMA
1,666,240,937 *AF5AAC00670E57B6AD2186B8851618BA3E83016F aftuig8
1,666,240,938 *AF539A5036AF1634B4FC3A04D6CCD21F3E0EAF45 CHESTYPULLER1234
1,666,240,939 *AF56BC285F8C7685039F3CD6FB30291E00A450B1 [email protected]
1,666,240,940 *AF56251DCBBF257EDC0C1172464C4E826097EAA9 chipepe
1,666,240,941 *AF515C1E7A485DB3374DC909490EB37971BFF3A1 chris018
1,666,240,942 *AF5B5F18FFBF113644C8AB8F3A51AFFDFF0CFF72 christoperlamontagna
1,666,240,943 *AF59B4250C700EA4113581D5EDB8040439A5AEED christy.turd
1,666,240,944 *AF560440BE7957603A97117D8EADF999FBD764A2 akgpb
1,666,240,945 *AF574AD735A4F50DEC4ACE19E9B9F6FFADFBF3C6 CII+
1,666,240,946 *AF5BBD46AC5BA7C9EE1ADA7D8F530462D3691BDD 4KIIVAINTA
1,666,240,947 *AF59623AE71CBAD350F2FD8340748DC3DF6411F7 4MOUSEMANTRA
1,666,240,948 *AF5F0191ED2665E8F5595E35848CEEDC013E76A7 4NARRENDEM
1,666,240,949 *AF562CB695D6FBB9DB6A01639618D9AE0ADC46E5 ALLCOMMERCIALS
1,666,240,950 *AF533F335709FD16A27F36DF2A168DCF67E36D12 ALLIANZVERL
1,666,240,951 *AF5D0B02CE973C1968D663FFAE33112A06C84F3D 9TIARELLIUORB
1,666,240,952 *AF5B02E23148E4FF3FDD772244CEE77245F6E4B6 allyoune5
1,666,240,953 *AF5B1FD903B441CD09AC78C91260AC80A42B01F0 CLAYTONFERREIRA
1,666,240,954 *AF501930B8F21EB4B7BFFA34D9E9B12C316F95AD a-1ms
1,666,240,955 *AF5788A3E607E0E80385250A8FEDD8959032464C a9(;h
1,666,240,956 *AF5BBFB3FABCED32B0DCB04987B76821E9362C3A andreonorati
1,666,240,957 *AF5699572A3031B82C63DB708E7809D8FF4982AA COLIN.PYO
1,666,240,958 *AF553F3006FE1A246B24DD2BE9C9A5A50FDC240E COLLEENF
1,666,240,959 *AF57CDD7D94B57B177C676DA8EF0459EB62D2FA2 AADCHU
1,666,240,960 *AF53A0E05BEA7A45226D6D4B7E71A58055249B62 a_nfe
1,666,240,961 *AF586204B0A7CC407696D7DB99FA6E68312ED4DA 5JOELANGEL
1,666,240,962 *AF55156BFBBAB18442B3146A7DDACE618954B3DF anicknameofprovidence
1,666,240,963 *AF51D3D3412D3CEA94EAEB0A026C7714173EE237 aazfm
1,666,240,964 *AF5D48B1A990674ABDC6EA5F4F11358300D1246F anovuenn0
1,666,240,965 *AF5566DA72D517ADD33D2E1A2BABFC71987269C8 ABGEROLLTEN1
1,666,240,966 *AF5C05BC56154DB2D12F7BD7873013CE51F61D0A antoniohandley
1,666,240,967 *AF5CA7AF49C0BB2407A478961B381FAA74EA4919 5SAKLECHA
1,666,240,968 *AF5BC834773D11292ACA8D2CF922F059BA283F6C abortion
1,666,240,969 *AF519641A9FBDF80A633FFB48F79511810BBBE91 A_P5Q
1,666,240,970 *AF530BE93959D8CDF0CDDF4E7AE65AD8A2415FC3 6LOURITA
1,666,240,971 *AF5AC01EECAACF808597E44CCE72222CDF09802B ariesalfaro
1,666,240,972 *AF57A28615051D8DE3174703B5E8215063A90E54 adp%
1,666,240,973 *AF536C9D3256F1A24D2364C6EE30243306B6A187 c&!s=
1,666,240,974 *AF5EF7268693CABDEB33820F363077EDBBCC9325 csxqs
1,666,240,975 *AF525DF12BF80B7F2E743E2B7EE299B261AB7EE1 A/g
1,666,240,976 *AF56CA07D2561078C035315F850E9F1DF3A955B6 CURTIS-PETEREC
1,666,240,977 *AF5CB4AE361B92184B19B01014EAD54D2E85425B ASVHAKAYANA
1,666,240,978 *AF548EA8A9CEC6A93802FB75772D4E84B6DCC806 7DANGINGS
1,666,240,979 *AF5C8751AEC55A46BAAF825966D3AF5E3C4E89EA AUF.DIE.PISTE.GEH'N
1,666,240,980 *AF50453A71514640A80E406C9C44929F7E20185C CWL/P
1,666,240,981 *AF5F1449E4E48570EFAA3B2478BE0D871AAFBD18 C.Z?
1,666,240,982 *AF5A7E55C4FE6753C020F7A458B63D17EE0C5CC3 [email protected]
1,666,240,983 *AF5C0BD6E49C7690B612384C271F479C9D4DEBF6 8ALINAMNO
1,666,240,984 *AF58331BE209E4BBA716DBAE0320ECFB3A0399CF ALEXIS.BOGGUESS
1,666,240,985 *AF51C67D90DC52A8600A86484CAA9EEC7224E236 ALF%=
1,666,240,986 *AF5CD3DF8EF09B214DD79723D0C94C40F36DF912 ALFONSO.STAACK
1,666,240,987 *AF56812CD2E55702A5CD1BC4D96F2F06C67BDA43 ALFONZO.ZAHRADNIK
1,666,240,988 *AF5C9A32A6A55F3058D6317CB73543B2C0AA0C5D ALFREDCHI
1,666,240,989 *AF5F304CC3806C0EFB09B738BF995DDB45D0C30C 8BSWVIDEDBSW
1,666,240,990 *AF5D4B6912B91B981B692EBB89A35F4E09111DA2 8d.~.~.~><
1,666,240,991 *AF5F69EDFD09C5AD5E8BF7AAE58015969E6AF6D7 8DISCERP
1,666,240,992 *AF589C399CA396B786A5749B102831529B2BECAD daeql
1,666,240,993 *AF5C43A8BE0C820FB6243DFBFF51E07946060618 daltonhollyday
1,666,240,994 *AF5F4222DE2E28DE09D2FBEB41E448206EA727BE 8ILOVEPRINTING7
1,666,240,995 *AF5CC7E03614CAC425F55A829A54882725FDC84E b!2=n
1,666,240,996 *AF54720481586F08A79C735A19AF71AACFC7FA91 B2N96
1,666,240,997 *AF565AE57FEC61AC12BC837FFB12444A46706B88 ALU
1,666,240,998 *AF590ABFE39190730C34BB6872987435B2CE3020 danniedelaura
1,666,240,999 *AF560668DDEC32766FD822F59A498710C176216C DANZERANNO0
1,666,241,000 *AF5F8EB798E412D269B83E6BE5C5D834198CED9B DARKTRUCKLIVEGEAR
1,666,241,001 *AF529B534078F5CE9908A68031387C1C41B548CD b83kz
1,666,241,002 *AF5D6D043DA6AFD764D6F1FBCBDFFD915A4612B1 B9G3A
1,666,241,003 *AF5BCAA679C0BCC3C3BEFEDD17DB5926E0084137 ANDRE LEI
1,666,241,004 *AF52D8B2E217061D6A4DE247B7086977FB66F407 badeleche
1,666,241,005 *AF536DC48769338E4AD3EA461EFBEDEA1E1FECD3 DC+O"
1,666,241,006 *AF5EC503E253F4408EAF1B3DDBDD6979B12560F6 d&cw8
1,666,241,007 *AF5EDCB4A7B4D1E4FB5EF6C8DD2EF4E21673BAE3 ddjq;
1,666,241,008 *AF52073E1D6523C6A2E9DECA4E3FFC4ECA3DA93E 9KATTEKRUIDS
1,666,241,009 *AF5C5AE55F9D4E4F0647FD4C0335C457CA5DD6BE DEANGELO.QUIZON
1,666,241,010 *AF5B934982DEEA279E30BF54F7D1D7A54F074F50 debalina.sarkar
1,666,241,011 *AF57CE091A85EFB894A339AFED3F0D91F8FD24BD deborah.kennedy
1,666,241,012 *AF5BEE26424D952B58E164270ADD9B423EE4CC87 9MYNORIKO4
1,666,241,013 *AF57E67E8D33F2E6A88205F88EB7F1076EF2ACDA 9USMIDIGHEDENS
1,666,241,014 *AF58A35AF0320718E07DEC24A8B18B7D721A9433 [email protected]
1,666,241,015 *AF5A302E498E8187EF501012A1E109877F0212DB DENISSE446
1,666,241,016 *AF5B1EB6550F2D1E49BF984E23BD36298A9D82A7 beckypalmos
1,666,241,017 *AF5E81E5B6DB5F399B0D01DECD2CDFCEBE63C2A7 derekcontratto
1,666,241,018 *AF5FF4E7CD72B83F44EC669395C0EFF01AB79ADE DEREK.SACHLEBEN
1,666,241,019 *AF574C025854262B8999DE09B87C44AB209DDA64 ARHB
1,666,241,020 *AF5FE0672AE5B8D49DECB255ED101C62B76F1677 a9?p
1,666,241,021 *AF5B78F8CA36930379D7024EA31EFAC59C3A3CD9 AAAA$#
1,666,241,022 *AF52D17AC227C0429F66E4595F1A6BB3EBA8BD29 [email protected]
1,666,241,023 *AF5D87289A23A1A5684417D4B025D4DA4C871A9F ARRUARO123
1,666,241,024 *AF515FFA7ED3DE99234B2D981144C61AA027AAD1 arthurbrimm
1,666,241,025 *AF59F70711213F221AB87B28F465A1DD9A2FA6D2 ARTICLE1PORTALMIDDLE
1,666,241,026 *AF57067CE65F333AB04096162D1D609C965E7843 arturostrum
1,666,241,027 *AF500895F60531CB919A3F543BF81B98D924E7FD AAAUU
1,666,241,028 *AF586854379620C612A52199D6E0CE3A3D99487A dgjellen7
1,666,241,029 *AF5F28919B738443A27B0E6E9A2A30BBCB774555 DhF)
1,666,241,030 *AF5A5F4E556D5386EECD73419FF830547460D038 aad{zf
1,666,241,031 *AF5A3351D4235D4D788840B4FB59DEB8F4DDB5B5 abaremak3
1,666,241,032 *AF55B01F6A293DFF4276B36BB20E301B76122B99 b-iiseye.4
1,666,241,033 *AF53BA2C5C9698EC2BE3E9A30B01975920C2D3AD djaf;
1,666,241,034 *AF53CC4213CD88940DCA8AE028FCDF873D3622D3 adolphhartlage
1,666,241,035 *AF5C790F344702302BD271B822679C8921700A0B BLY%
1,666,241,036 *AF5C34C2B2A139AFD35C86D5EA71A0767A4D085D b92k4
1,666,241,037 *AF59A70442C4C087C8A1AFAF44E8DA988A534369 DONNIESTEINHAGEN
1,666,241,038 *AF51C83A787085545FD0238AE17E711FE001E721 DONOVAN.STIGGER
1,666,241,039 *AF556A071E5362859D497A1C857CCE682972BC9F BO?DU
1,666,241,040 *AF5C6E70E76A2F9FE479C7E868FE24C08EEBDF27 BASILCAICEDO
1,666,241,041 *AF51C48F259FB4B4CC7BAFAA9CCCE18CC8E7E4A4 BAWQD
1,666,241,042 *AF5E4DD156E0F0D536AA79401A4003F7ED5CB377 AITEF
1,666,241,043 *AF57805D24C66671D4EA3977DA1D30206ECA2A86 DOWNSOUTH(FEAT.GILSCOTT-HERON)
1,666,241,044 *AF525BA467545EC2D7A53F87E149FE7F0BFA2CDA BRADTUCKNOTT
1,666,241,045 *AF5F14DAF8A5C69A4543F82337C243E5827B5295 BRADY.FEDERICI
1,666,241,046 *AF5705957384E95650914EE1FFB22F0A00B098EA brandenanreozzi
1,666,241,047 *AF575C68EBEE938D4FFBF9607967ED5337FEF051 BEDARFSERMITLLUNG
1,666,241,048 *AF5EC47761650628229ECBD123D66451B15FD255 brandon-guerrero
1,666,241,049 *AF52E2201696CD4CC594DA242A1602F3CC0C1B4C dr?c)
1,666,241,050 *AF5822C17CC7D2E2632C11FD6BF0B7B684E36ECF bekc
1,666,241,051 *AF5D9ED6DC7BBD0E1AB2560F9AA7313850EDF476 drwdt
1,666,241,052 *AF5C703C04D7842589BD73D56805A769480EF90C DSILLY
1,666,241,053 *AF5C5AEE5C0B00B753B9489023788E1E6A8456DA ALLIANZVERL
1,666,241,054 *AF5B044FCD5F2F268616C11F3120E0F61F2710DA br(ll
1,666,241,055 *AF57F134F84013D496D41A1B7AD6B0BBC3F01192 [email protected]
1,666,241,056 *AF585CB22BFE4C1AA0C1871A2105E2DBAFC108E8 b"#g+
1,666,241,057 *AF569D9699C0F5B432427E6240DB5FA9847DE7A2 bswboubennecbsw
1,666,241,058 *AF5622BE026326097E3DDF154353105569D41E22 bgxxv
1,666,241,059 *AF572D4C5F18C539DF38ECCF3621445C1EDC1541 BILGG
1,666,241,060 *AF5F6F609F76252DB59346911F23571D5729182A DZ!T"
1,666,241,061 *AF51CBD2A6971779FB526C6916C6647E45FBCE6A andreonorati
1,666,241,062 *AF5B33F281F1A208D9C4B3903EC16CB4093C890B bjw/a
1,666,241,063 *AF5AC110EEE16BF3BE5C3384C8036E7A88592DC2 anicknameofprovidence
1,666,241,064 *AF595BEB87CF7D246B2EAE559DB191E5A9BC27D0 blue.green.algae
1,666,241,065 *AF54AD663FD8C5FA13AB125F0757D8321EA17FC0 B(MH+
1,666,241,066 *AF555DC4E15FD132CE355F1E2399617AB980E8D6 EDICFLES0
1,666,241,067 *AF5BD3C74871BFC7899E001EDC96219123E96C77 B+NNR
1,666,241,068 *AF5F4AD587519A0A40CF0F228B0AF187984093A7 B#>*.*.}o{
1,666,241,069 *AF5B1D773F80AAE00FC845124FEA514FB2A85191 ao:n5
1,666,241,070 *AF56EFC16C0DFC91BD6AA1F8F6336F9CAE0DBEF3 bobbieirland
1,666,241,071 *AF54DAE8611022C86FC8602AD313FC72038C7A18 BOBBYHULL
1,666,241,072 *AF57EDBF05B2D1695F20ED36CD9D299A05C91218 c&!0p
1,666,241,073 *AF5D8D1BBE67EE548863436BF92E9453FAEBCB6D ar2005082201484
1,666,241,074 *AF5066CF2CB481E40B5006036C634A3729A2F804 ARBYRD9
1,666,241,075 *AF542F0E2FF862D0C6CF31BE86F730B1473665CE egressa2
1,666,241,076 *AF552F99BA720A26CD0FB6E4655E5310938A961C ariesalfaro
1,666,241,077 *AF56AD3DB48164433FBC01FD9A1DAD0272D1F7A5 ARTURO.MEDI
1,666,241,078 *AF5BFD480669D11CD612FB27C114BE6751129745 EK+M,
1,666,241,079 *AF5139841EA7035D474FE6E6471715619D5D5F8F A SUNNY PLACE (FOR SHADY PEOPLE)
1,666,241,080 *AF521730DF041D2930F54168515BEAEAD1A7609D AUF.DIE.PISTE.GEH'N
1,666,241,081 *AF5388DC335C1FC08CFB8158BD8858FF0186BB15 CAMERONIVEL
1,666,241,082 *AF5C471EE3C34D00B5F483309658646979606A8A campingmagic
1,666,241,083 *AF587555CC8BC1F489548E84489AF63AC068CE9F elth(
1,666,241,084 *AF5B570E10206B7B1AD270B2CF784DE513C865DF carmenbierer
1,666,241,085 *AF5AF5F5585D897DC5F0594F503AF3034512A190 EMERSON.VERANT
1,666,241,086 *AF5A162A291871D90331FD70CEB7F682B92DA996 B,U&
1,666,241,087 *AF5502649AFD05B5C9E67C190D0FEDD1E099F9C3 carreiropascoal
1,666,241,088 *AF523781275EDB8E9BEDC9D569EF407C02035E1F buchere3
1,666,241,089 *AF5377A404E1CA3E181C545D98DAC228706B1F16 emmanueldiwan
1,666,241,090 *AF5640E8869CC0FCB46912A44621EE38294CBFF6 (>-<)~-`<--b
1,666,241,091 *AF555D27FCC1E407F7008642F46CD2FE504C8E4E B0+J!
1,666,241,092 *AF5E6E549259C92DC030D9DD702C2F2AB08BD9BC b1(8i
1,666,241,093 *AF5FAA8A2F097FC60072057BD2DE28529FDD017B B,UN
1,666,241,094 *AF5BCEA4F8FA136999D36D0FE5B8609FBA96F4F9 [email protected]
1,666,241,095 *AF53813FC5E197BA875D5CCC0DEFE1AC687F040E CDQI:
1,666,241,096 *AF54760CB5C192A0FE5C9AFD21CC58C7ECC0D755 [email protected]*.*.)x(
1,666,241,097 *AF54A895FC132C1D1A9182225B373B1641D375BA B9G3A
1,666,241,098 *AF5412F2BBB577D40C8BE358C7792D73854485C2 CEVILLANO
1,666,241,099 *AF5D9BFD627CB73A6900D267B6E2646197790512 c!fg
1,666,241,100 *AF5696622EDBE0E21654DA446218D61A0F997039 eq(g
1,666,241,101 *AF5B2BA7166F43B9281319A3853D5D42BCB56126 [email protected]
1,666,241,102 *AF5651F665620EB6994DDB86B1C109046C1CD3F5 ERICKALGEE
1,666,241,103 *AF598D4955BD01617CDC2388EAD8E33FFB435717 CGWL
1,666,241,104 *AF50FB5477A434BD87C2A6F41DD267538B065CF0 B_ALF
1,666,241,105 *AF5C49D62F2ACB48A4AE43B1AE65567574FBA322 CHADWICK.GROSKY
1,666,241,106 *AF5B771AB706A3EF7EAB1AA9D60A3958F8144683 C0WCATCHER
1,666,241,107 *AF5FE5097E84F79307C28FECEC7087BEA34CB1AD [email protected]
1,666,241,108 *AF56510019643A3ABC321BBB6F60BFC9C38AEA4D C2_;
1,666,241,109 *AF55AFE1CB6AECC3940D25D21967A5FAF6074B97 c"5qx
1,666,241,110 *AF537FCB7B4F748F2F5F1B5C204726C5FDF2E716 ESSAINTIAL
1,666,241,111 *AF5D8302B2121A2F58631C0489347FCCB82628CB c"6(n
1,666,241,112 *AF5C1AF7869F31049BEDA5332804C847DE2A5D3F chemicalhalo(bruisedregeneration)
1,666,241,113 *AF57B837F4C2E7F1A5248FB60DE4AC036C8CDFD8 c;8,)
1,666,241,114 *AF5D994517F8AEB6E9616836779DCD355DF122B5 ETNOLINGVISTIKĀ
1,666,241,115 *AF5AA027DA41FD73560D82334FB1B9C0F886E8D6 ETOKSIMINTI
1,666,241,116 *AF5E59ACADEE58859A4EBA557A2E0D7341E7C41F chimt
1,666,241,117 *AF585B98548B2B0CB8111967AFE2AAAFFAA50F0A etudescapricesfortwoviolins,op18:no4inaminor
1,666,241,118 *AF5FED32A94C015070A2E4C3CFD9B767A9E6F8EB CALTECHISSÄ
1,666,241,119 *AF53FC35A14EBA329DD1AF848A6D4A4B12460BFC eulo$
1,666,241,120 *AF5BE0764DB771293647A5DDB0A414C80D59B3A9 eup?
1,666,241,121 *AF5298F6DBAC4B3E22CD4AC78F09DC98848C2972 beckypalmos
1,666,241,122 *AF5042506E0BF5EC594B6437D6752DD3D260500D CHRISTOPHER.GAMARRA
1,666,241,123 *AF557BDD416ACB3D6E0563E3717315A19B5FEBB9 EVITAVAMO7
1,666,241,124 *AF552319A59CA1C7BD297EE3898046C7F72C9D19 CHUCKDIDYK
1,666,241,125 *AF5F56A2E86F059A7BFFF6F8FE671D6B4E97C8F1 [email protected]
1,666,241,126 *AF5798CDADFDE23939FBB90746A10D1A84BFF0E0 chungplyler
1,666,241,127 *AF54BF2D1ABA8D40F0BA2AC5EFA67E67EAF1914D CARIACEDO6
1,666,241,128 *AF59912760966B6161939A3D43E174E5DDEE3727 CHUR3N
1,666,241,129 *AF5A3D1AD29E6A626AFAC11C9A1713DA578B1FF5 BENJAMINWEIER
1,666,241,130 *AF5EAFD418EB21F395092D40AB749982B8A31155 EXQUISITE(IT'SLATE)
1,666,241,131 *AF58C8956CA2AB468EF8BF5C5CE570B8951FECB2 CIHIA
1,666,241,132 *AF516C33854566E414139A0B6FE88A0788E9531A ber0
1,666,241,133 *AF5BD5990B8406797AA4D3B300FE1124F9F6C74A Cip4
1,666,241,134 *AF582514E866A4697FAC0B9FA2010297843C0043 [email protected]
1,666,241,135 *AF59CA8B26499313BB55A4F78D8951046080CF46 BETRIEBEN
1,666,241,136 *AF5FD06688624EA74C1610A018002BCE584FFD5B CbAR
1,666,241,137 *AF5CAE9EBD07A0C5390A5D5EF4B15447151F433F CLAYTONLATINA
1,666,241,138 *AF505F03392F7C0BE003A6AF6B04FCBC7F0388DD CDCJC
1,666,241,139 *AF5909DDB9985B7B22708D3F27DB222BD38DD3B0 ce0%(
1,666,241,140 *AF5E994F613C583AF12403A6FDC36C4564B9F3B7 b-iiseye.4
1,666,241,141 *AF551FF0C5152E6B444D09B00BD8C598A3AC0D2B cedicbeaner
1,666,241,142 *AF5BA534D1D1C5F46064C8C15959F75AB50E50F9 CLIFTON.SAETEUN
1,666,241,143 *AF5838EA3C6AB856EB9F0F5F9E643E71CFC19443 CLING$+ON3
1,666,241,144 *AF592F5B9154BD9FC8BCD7946901F7C8B24EEB46 CEREBRIC
1,666,241,145 *AF585105E43B9EF10574036E9251821D7F3E39FA fernandodrost
1,666,241,146 *AF561D9037AD7C97CC727F0DD17C6EAA8F497845 bkd4
1,666,241,147 *AF53B34A6AA0C4119854A51B4D824D53BBD5D46F FILANTR
1,666,241,148 *AF5BE336853484CEF709C6BAC6C1553B8D6F8615 firasabd
1,666,241,149 *AF58926F96C01656061DDC7E193E83B3AE22E8A2 firlatilabilmesini
1,666,241,150 *AF5F023CA1C3A80D916C41A50BF8FE6170E4874C fixwrong
1,666,241,151 *AF5EBCB0331CAC1B6B94D98207674AFDC0E5E4EA [email protected]
1,666,241,152 *AF5146AC131B0EB49F1E7C69228407E2B53AC915 FMORAUXED
1,666,241,153 *AF5FACFB3666818481CFB31FBE1D3552FECD313C blx5z
1,666,241,154 *AF545FA14DC9298BF072F1F81E48DC3AF0FC545F bm5
1,666,241,155 *AF5659637E0597A14EA768192C843CC5B722466B B?:MD
1,666,241,156 *AF50B206EA75C2FB54D7C125C4C01B6F6726404B bmukulub4
1,666,241,157 *AF50D0CE48B880C970E67784A3439470A0B91E96 c-on9
1,666,241,158 *AF55ADBA481B42E78C9B86A859877A2BA12A9680 ch%m6
1,666,241,159 *AF57A888C176C298A011972EB6A67F94F9BA15EF BO?DU
1,666,241,160 *AF535945BB7F72EEC9B3CB843887FF95151C9ED8 [email protected]
1,666,241,161 *AF5F154BD4CDD21234BCA20A68BF1BEF5A590268 christopher.billingsley
1,666,241,162 *AF5BE5A46853A7C6F158E763F45245C39137720A CONTINUE160THECURRA
1,666,241,163 *AF523261DA71E6CFA9E8216C3540EC7CE43ADE29 [email protected]
1,666,241,164 *AF5E4FE1240EAEEFF2C2E11181E11DFF50513E95 BOYCE.SANDELLA
1,666,241,165 *AF50589F5215D4526DE9F5C44CC69BAE7EBFB703 CIF)K
1,666,241,166 *AF57D2F722CF76C00EAAA43C315C75C5BC856B99 fwj
1,666,241,167 *AF596850FA60CB3C4E16B07BCC60949B9293D6A5 cournot»
1,666,241,168 *AF5EDE7C56F00B4ABE653A4188A98ADD259553B7 BQLo
1,666,241,169 *AF5214060B3E458E97D0E5C16E8E1CAE0435275C GARRYSNAPE
1,666,241,170 *AF5B69413DAF5F0CC150454CF44ED98D7045E77F cpvr
1,666,241,171 *AF546A12D0C31F3D34E62565FFFE3483636913B5 BRENTONOLFERS
1,666,241,172 *AF5D0C85BACFF3FFD6F28C925F4C8E892AE2A262 geeswangged
1,666,241,173 *AF5FF9102963E70FC9CC22D8F7EFE3639909DA92 geetu-lamba
1,666,241,174 *AF55E9D10B14639E63D58FF41A08ACFE319F2D18 CLAYTON.NAHHAS
1,666,241,175 *AF5B5F9DDD4EF61C24E265FAE1BE6A2C4310E922 gekakten2
1,666,241,176 *AF504428C675A74648AF85271658E91DD5318121 crin913s
1,666,241,177 *AF5AB193FC8D588B117D7D41D0D4A08A0FE83E61 crmn4ls
1,666,241,178 *AF5AD0F28980ACD32F4143DEB62FFD89070FFE0E GEORGESTEFANO
1,666,241,179 *AF578C84DB87A69EB083DA25D354320EF633F4FF CLG0
1,666,241,180 *AF5B65278BC353BD9EF6C85787AFC74CD452034E CLINT.PEHOWIC
1,666,241,181 *AF541DB719C415B211EC03340570E21122B40264 br(ll
1,666,241,182 *AF541CD293E480560F422DD71DAB02336DDCCAD2 CLYQP
1,666,241,183 *AF5FFBBD041E3714605EC37489E26505C60B25B6 GIFFORD1961
1,666,241,184 *AF57FE90A8E66292B10C9EF6F5FA8E7963B4D425 cnb5e
1,666,241,185 *AF5250E589CFBB7C6BB85D634AB11D1B937D1184 cn:oi
1,666,241,186 *AF5060492E5A2099DA9E4E8D0EB00145E826B305 b,s"k
1,666,241,187 *AF5D9EE93734B9B2940124180F3BCFF46D555FF5 bswboubennecbsw
1,666,241,188 *AF56F048B787024C4CC6047B7256F549623B282B CUNTINAN5
1,666,241,189 *AF50B2A769FB58DE9E72F433C759A55EC9AAEC85 CURRENTS.1
1,666,241,190 *AF554BE0BCCEE547E58B2AC4A8D73CBE7E5345BB curtisnalevanko
1,666,241,191 *AF59986485F7D332A519D9E9B677F417DB32CDE1 C$;UT
1,666,241,192 *AF5B77875201F38DC761FFCDB3E5971B374032B8 [email protected]
1,666,241,193 *AF5DDD52A319220E6DD8A1A932465AC426DBC983 cvp?8
1,666,241,194 *AF59E5AA373E61769E5B9359EBB1DB8D47A35B40 CONCERTO-FOR-VIOLIN-AND-ORCHESTRA:-III.-ALLEGRO-MA-NON-TROPPO
1,666,241,195 *AF55B35B460967C78AED4748A0CEF561589DB4D9 BUDDYTAJUDEEN
1,666,241,196 *AF5E310ABE3B8B5DEFA9FDDD1BD839AA50195CD0 bušeći
1,666,241,197 *AF5CA171291FC28EE74917B3DCB59E40486328EF grrlsrule
1,666,241,198 *AF5DCE25DEF935DBC35D7E81BBEB57872491E077 CONVENTUALLY7
1,666,241,199 *AF54B699C723425C280B6CA69EF7B9F7966B1980 ÇORBACIOĞULLARINA
1,666,241,200 *AF584B58D5015184687CA4BA345FE61947B768B9 [email protected]
1,666,241,201 *AF524D468D8788BF9082F9BA4798A6FB9B9FB552 COVERED-BRIDGE
1,666,241,202 *AF5436FC23BA7D9B3FCD3D8159ACD7CE5A1A868A C=PJ_
1,666,241,203 *AF57DD2263E3FF0497E315D5EE1E9265184D3A7E CP;KR
1,666,241,204 *AF584F09A50026E9C28D2893672923C2C340C2AD GUYSARNOFF
1,666,241,205 *AF58D142A0857CA44EE543FC2A2DEDE02BD0CD3F D96E8529609D320CAC021F37D6B65EE9
1,666,241,206 *AF5EA3050C7C3923C278A1A5F54FA625BCA85BFA c&!0p
1,666,241,207 *AF51A577A0E3944FF3AC289608D774E546AAF7F6 DAISYREING
1,666,241,208 *AF5CEDF822A130CAE4EA33B49298AD545CE1EE2A crackerjenny
1,666,241,209 *AF5C4B5E1E09C8317E5382FD79FC4FD502CD1175 C$6IA
1,666,241,210 *AF5C7826A6953F6A5681B7C9329F3ADCF00549E6 cacaypis6
1,666,241,211 *AF57231D41CA4590BC12E638BE437EE182AB93CF CTVO/
1,666,241,212 *AF5A3481E66FFCDE4E29E57E73E72FBD23DFDBAB DAVIS.STEKETEE
1,666,241,213 *AF56416965B0234CCD1B342944B234534E7C161F CANS.
1,666,241,214 *AF560C200762E9B1A3556A25C1A30E0894095F69 hearthrob
1,666,241,215 *AF593168C08528B68B3DDC9F666A14D2EE1E69E5 „HENGSTTAL“
1,666,241,216 *AF5529A9CB8B951611A75931F965D362E897CC93 DEANDETHOMAS
1,666,241,217 *AF523AF85716826554FA7AD6E7A54F0EEC621E15 czuqo
1,666,241,218 *AF56A5E38B36D29A4EB69022918514CD1AF93B36 HETEROSEXUALS.2
1,666,241,219 *AF591948F2A213CEFB8659C2BC1433802430F3ED CATHERINE-ECHEVERRIA
1,666,241,220 *AF559EB1006E7DF56ED2002A4EAFF3A594A15CDB d4ba
1,666,241,221 *AF50333F81E917F136625D2748070C1CE52D0566 d7aj
1,666,241,222 *AF59B300E34B3007A91274003F8F728C91680BB6 d"8_
1,666,241,223 *AF5DBCA181197AB895A1F20E34543E91BEE59A60 [email protected]
1,666,241,224 *AF56685E6117D9393D2DC9A3C00606C85B56C6D9 denniskwilosz
1,666,241,225 *AF5925A998FA52B2A7FBE6A5CC07AFCA6CFCBC06 [email protected]
1,666,241,226 *AF5BC4DCCB9CCCBECD322CF0B5C2D6AC1CAC47BD c!fg
1,666,241,227 *AF523F48595ED91337329B6566D16B9322DD8284 cfieromou5
1,666,241,228 *AF51F61157794382A050A2C3EF69E5AC97CE9972 der schwan aus
1,666,241,229 *AF5CF56DC78082DFAEBAF8660EBD9C186EC3B30E DESERTSTORM
1,666,241,230 *AF5F006BE88E3E90A3FF2FD3BBC2DD6AC2F32387 DESPAJAR5
1,666,241,231 *AF5CC11830924D2596C401463907DCB9D5D3DA9F [email protected]
1,666,241,232 *AF52942AB11721E29635EB6249568A04E31547ED DARIOPROUSE
1,666,241,233 *AF59D5476FD9687A06D6588021F93CA2A791C2D3 CGWL
1,666,241,234 *AF560F95DD5659C258E57314CED2482386491837 DARRICK.SCHOBERG
1,666,241,235 *AF50FF87562E7FB1D8FA857D0983541840383ED8 chaco
1,666,241,236 *AF5D6F083254D8D0EAD83326E057D32E0FD14520 CHADWICK.GROSKY
1,666,241,237 *AF58E0908E6C8E99D4F628560E80A0BE15716897 df.fw
1,666,241,238 *AF510726AC4552ACE8333708662F4E959051E966 [email protected]
1,666,241,239 *AF59D1D82F2D6348965FF094C0128FB1FBDE60D4 dbsnx
1,666,241,240 *AF535044AD837D4D3898A1AF8265B639C9A238FA chemicalhalo(bruisedregeneration)
1,666,241,241 *AF52071675B1D5257DDABF31A40BAF71CD04E8B0 chris.hoisington
1,666,241,242 *AF53FD1A0CF911D5BCD427A0135FBCD35D634DAC DELIVERY ORDER
1,666,241,243 *AF5080768640F4F96BC4FC9E31118DD7E34EEBA2 CHRISTOPHER.GAMARRA
1,666,241,244 *AF5494AFEE416F0D08A5E17176E1527250DD9CAA CIHIA
1,666,241,245 *AF5B499A064FB049C923439C3B50174C5A07AD20 [email protected]
1,666,241,246 *AF5FBEA11BF37DDC07E598552BAA5A955FA0B808 Cip4
1,666,241,247 *AF5934A066E86DAE141B04B802D1725800D84BD2 CKIRMS
1,666,241,248 *AF5FF654F092EB301FB5DB788F9F604F71240B3E DJ#=A
1,666,241,249 *AF5316CA3023177A977EFF7625EC7E18EE2E5683 DGA6V
1,666,241,250 *AF5F24D97DC844CC7C86B59C92E2F64F8E5D35EE DKAEI
1,666,241,251 *AF5E304F20FAC308573E3B7B62C0CB3C5BF9BB21 DH$G4
1,666,241,252 *AF5AC1E565E16026D2B7D0A589D123BBA4069BA0 DHOYR
1,666,241,253 *AF51CA93F6BBD89DD19E19591E082D7DAB72E7D3 DIFFERENTPATHS
1,666,241,254 *AF5A2634AEEA9CDCA57B170940D4178E8A55ED2F i'm-so-lonely-everybodys-got-a-date-but-me
1,666,241,255 *AF5B5C4738FC0006BF911AE2CF46FD84A919D9A6 INFILMSED
1,666,241,256 *AF57AB0A55FE00C972E46758B62FB8BAC599240A DIÜRÈTICA
1,666,241,257 *AF5280A37F92834208875400F530E29DCB4CC393 DJFIW
1,666,241,258 *AF55EF29EC982C3C3FACE3C6CF4AFFAD7DD6E131 d.nm
1,666,241,259 *AF576E50C7F9AAF22EB35E313AE746C3355FF9C4 c-on9
1,666,241,260 *AF53B25B9485F9595C3159951967711042F907EC irremovable4
1,666,241,261 *AF5CF89BFF113AFBAAFA2100255ACA4718DC4A43 ISAIAS.DECESARE
1,666,241,262 *AF599E96C7E7F5FCFE9E536F6A30E426A3B8FE37 ISAIAS.GOODCHILD
1,666,241,263 *AF5978F949B8E42C0D5D01A9089937D0F6FA62C9 ISERAUME4
1,666,241,264 *AF5DFCB1662CF135BA365EA1FB90BB6056DA2198 ISHEIGT89
1,666,241,265 *AF5358673F1CCBFE4C79D4DB0F7576E728292BB9 isidrotwohey
1,666,241,266 *AF5486A22ED60F84C4AA238E49256A3D7EC52F97 coryoreb
1,666,241,267 *AF5CA3F8CB8BFA5EA47AE06997364406C19D4998 COUNTRYMUSIK.IN.DEN.BERGEN
1,666,241,268 *AF55CC3729EA4E676052F00C571436D95EA46B87 DN(UR
1,666,241,269 *AF5799AD0F39F61F619EA93555CBE7A13E5C5F7F IVORY.SKAR
1,666,241,270 *AF5931B509F0A5037C2E50B83BDA369143D1E614 Do-fallt-ma-jo-vum-Fleesch,-ihr-Leit
1,666,241,271 *AF5EF90E0057D5557879488A79C26B0273ACF1DC c:\program-files\msdn\msdn9.0\1033\wceddk5.hxs
1,666,241,272 *AF54650BF9AA3AC3CE93528166DDF22DE56FF7F4 D#OJ2
1,666,241,273 *AF5B6C90BF44E05FECB923A50464370CAA680CCE DOUGLASSAVA
1,666,241,274 *AF59A268C6E3EE197590E20C61F173532E568721 IWIDOC
1,666,241,275 *AF5AE635F811BBD98B12A02A1B2E254B3E1101EC cpvr
1,666,241,276 *AF5B983E752E959296F6216444046872E426E414 dq05)
1,666,241,277 *AF575D2F1AC63E56F07CB523EAED273B61F92F7D JAMAAL.CULBERTSON
1,666,241,278 *AF5ACE1653DC796CE5D385CE82C78BAB478003DC dqqy3
1,666,241,279 *AF5787F407409D8FCF725EDC0CB48260A63BEE8E JANEKOT
1,666,241,280 *AF59BF355201E1DCEBAE7DAD4F1B5C3961B79B5A driewegkranens
1,666,241,281 *AF522A15E8CE022BA220377747A31EA368D62608 C._SF
1,666,241,282 *AF5956F0FB8E05F74A14792919E6D010F7E3EEE9 drxux
1,666,241,283 *AF5A60EE881836504EE7F35F1339F560C71B97E4 [email protected]
1,666,241,284 *AF5D8AEBC7BED8B23E1B1BAEEB76A9FA4E45824B JASPER.BREDERNITZ
1,666,241,285 *AF5EE96B4C79AF3CB98A2B4F9723835E63288916 dq0p&
1,666,241,286 *AF5031E418AA1061160F09FE405F3FB5A8DB005D DUBAS MUSICA
1,666,241,287 *AF55ADF9D12327F1D8B00E413B20D11C1E64043C JEEWANISAMARASINGHE
1,666,241,288 *AF538B9E3A878B145D3C5CB21B5356F7D4E1B1FD JEIEL-VASHTI-ASISTIO
1,666,241,289 *AF56BB1A42B0A614142B62CF0ECC48F597A6C230 cu2m0
1,666,241,290 *AF59ECEE042EA219B2AF7D2289599258BB8D3694 DUNP8
1,666,241,291 *AF5E3EFDBFE608FAECCFEEBC93DA389F7DDC0A2C CULU:
1,666,241,292 *AF54719D087FC114D942ED73C0A6CE9A04FAC47B CURRENTS.1
1,666,241,293 *AF5022137C0BEDFB89F7B6E576362DD0094703BF D!<W
1,666,241,294 *AF5FAEF62E9E53EC5F3348869C2285DCD1F057AC CXSB"
1,666,241,295 *AF59CE0BA6A894857D513C6355EE60ACF12D98DE CYOOK
1,666,241,296 *AF563C761BF87F6130F9AA8EBDDE9CD07B5320CA JOCKS.FROM.THE.INSIDE.OUT
1,666,241,297 *AF5411F011DAAC20824F8DDFBECF836C123B239A [email protected]
1,666,241,298 *AF577A996C93D2FD4ED6241616916B52DD07936E EB86B7C2-0C64-323C-8E3C-799E41DEA98C
1,666,241,299 *AF5D908734C16738021DC645DD0C790E56AADDFD JOHNIEMOORMAN
1,666,241,300 *AF50FF4EA1527773EED6AF8468AD0C69D3AF03C0 EBIEE
1,666,241,301 *AF5D048E13353F70106AB5196732762073107BD1 eb;zt
1,666,241,302 *AF54A9BFF4DE01BF42C531070C94CCE8D01C2C31 JOHNREYLOJA
1,666,241,303 *AF581D9CA55F7D8C1C5EC6AB976EC90864728E43 DUD3A
1,666,241,304 *AF5F97B8A1E11A8DC7EE433C9DE685DD11D158E3 ECQ1F
1,666,241,305 *AF568289EC87F3273F7F08CEF09431DA8AD14E26 EDGARDOCLICHE
1,666,241,306 *AF5779B4E0ED5D6E74B1D500C85EC6E0B3797F00 EDGARDOKUCHLER
1,666,241,307 *AF56503C4BE532F837605F69A3E182F3C7D05B90 jorgebarlock
1,666,241,308 *AF5CAB54B17BDA20CCBAEB56DD49EFE414E6C020 edid?
1,666,241,309 *AF589129EB54B9379289D125DD85C6C8DECEC0A1 DUSTYBIRRITTELLA
1,666,241,310 *AF5D56BA66F02F44E9B695B5DB8ABD815FA09BF5 JOSEFPIELOW
1,666,241,311 *AF56331983D79D9164F1943B1BFAA983CD9A5AFE D?=UX
1,666,241,312 *AF507529390301C3DEDA3888A9FB8B4412736719 EDSCHERBARTH
1,666,241,313 *AF5CF85CD9C0E07F1CD959DB7898F8368FEF6B8A JOSHUA LEIBOWITZ
1,666,241,314 *AF551D14D723195EE6B49F98F175198807797EC8 DvCH
1,666,241,315 *AF55DC8DE0F8366BF14C7BDE95573293F9BAC1A4 dvfklprt66
1,666,241,316 *AF527781004346EC20B4CFABFE60ACCC716BD0A7 ee28r
1,666,241,317 *AF53B67B41671510179C16B8A9CEC364A61AD743 EFT
1,666,241,318 *AF576FE7764CA63B3CD819AB7286F37FAD2E2347 D9#M
1,666,241,319 *AF5B6EC5A0075ABA88607A518109F160119038DF DYLANOLCKHART
1,666,241,320 *AF5779C9CC6AFADCB28494096BA62760415D8570 d?zbs
1,666,241,321 *AF52667CE54FEDCC0F2879FEE95C9D9040443FE8 KAKAMEMERARA
1,666,241,322 *AF5E102010231EDD40F74A46E15F6059481AF1D9 karsyn72
1,666,241,323 *AF5B7A59E3110D6C8445A8E01866D8A5628E5F8F elliottnugent
1,666,241,324 *AF50B7054E350709F3652D4515617971FC1CCD25 kaske-vouskarsemose
1,666,241,325 *AF5EA8427C4D3708DFE6D8D85F068D2572E82A71 EDMONDDOBSON
1,666,241,326 *AF5C46106CB7F769ABA067A64E203CB13D584F2F ELTON.NEMARD
1,666,241,327 *AF528DA2BB841F00A66C0F1A20ABB399FEEDC520 edmundfarler
1,666,241,328 *AF573FC6C3A13773EB64487DFE7DB2565374919C EDMUNDOEARLES
1,666,241,329 *AF58550AF0C7F96A003D52D441C022A49396D971 DAVIS.STEKETEE
1,666,241,330 *AF51D85AD085DD307FB73566D1E964488C116D1D EDWARDFOSSATI
1,666,241,331 *AF5B9510FEE873F59978F08998F7FE4DB5536519 KEANERIE
1,666,241,332 *AF54504EABCC4BA9DB72C8C5CCE8960B12A006BB EEBA
1,666,241,333 *AF55D793075920701858AD40B68C46915A17F296 KELLY.LOUGHLIN
1,666,241,334 *AF529FBDC11EAFFAADA37AE713C637488634B820 [email protected]
1,666,241,335 *AF5619B378B20FCBADFDC28646F3EB51AC785756 emiliamoran
1,666,241,336 *AF5BA8B482D3CB053FA2CEA7A0A2E6FAAFF6EA8C EMINNAAR6
1,666,241,337 *AF51B6D21A981BB52DF8EC9EF78FAE72489F28AD efwfi
1,666,241,338 *AF5BEF0D3A732D3E6AEED281A0F0B13D9212D7CF EGAEPIP4
1,666,241,339 *AF5D197A83BB52722661692205BDAA3F9E41A25A EMMETT.HINAJOSA
1,666,241,340 *AF5EC81BA5FA1F21DAC6EA27B8BC19B5EE788A12 KENTBREDA
1,666,241,341 *AF5D9CB42605E7004A71F224C918889E6B3C76EC KENTMOHL
1,666,241,342 *AF5CE4DD6FCC9308AA2177058509E10F26ED47F9 EMPENTON4
1,666,241,343 *AF5CECD979121F4B5D3D78429C80A636CC7386DC endocannabinoidterminating
1,666,241,344 *AF581690A426E4417D78B3BA80091B82C9C03084 K"#F
1,666,241,345 *AF523356566EFF15425D485E33C0B97CF8397EFB ENOANOTHERGREENWORLD
1,666,241,346 *AF50598D7C671F78393CC4FC83716ED6D3CCF8ED elbareni6
1,666,241,347 *AF555DC9211C48628CA27C6557F65E06570FFF94 ELDONGULDEMOND
1,666,241,348 *AF509B1FC9EFBA4B0D8242EF529FB3B140BF630D ELEITUNG2
1,666,241,349 *AF59D16F23B084A3C6432EA4FA1907E25712FF50 ELIALFREDTK-7
1,666,241,350 *AF5CAE5F335E52522A54558100073B079CEAC579 ep+l
1,666,241,351 *AF5445962B0078222E1C6D3864ABF9C84F4AB57E [email protected]
1,666,241,352 *AF5BA5FCE4CB025F2B966A43D230F122C4C9F3FE ELLISDUQUE
1,666,241,353 *AF59F7AF3E21EE170257231F281B92C0A37A8866 DEMETRIUSMARKS
1,666,241,354 *AF558610997368340C3556EA0562E66BB380EF73 ERNMUUJ
1,666,241,355 *AF554B406D7AF5641936815502F2057377B9FFAB KORY.ZAPOTICKY
1,666,241,356 *AF5705B430DAF0F2B68CDF12DDCEDA014225B714 ESATURUNEN
1,666,241,357 *AF5725348A5CFB8A6436C392C27B189A70FBA7C7 en?%
1,666,241,358 *AF5EC2A0F6368FE994588D02026BDDDD655AEF0F evircsir3
1,666,241,359 *AF53B01DA7098EBCDCEACF19D61219A4F12F88D9 LAMONTSENNO
1,666,241,360 *AF521F7E3FD5FB172DD87B16A6C892F6C3137795 LANCEVETTERKIND
1,666,241,361 *AF5DC5F3D9493E71AC94AD9406194D87838390ED dh;v.
1,666,241,362 *AF518752C706383C9AA0FDD504330CE5F9A2ABC4 *{EY
1,666,241,363 *AF5310C3920EEE80FDE46DB3576A9E9C6DDB30FC DILF=
1,666,241,364 *AF5B765746C72FAE16A2AFA031AF0DC877530777 fadocom
1,666,241,365 *AF55A5298235948DB975574EC5DD9AED9D93505A [email protected]
1,666,241,366 *AF591BA2A1A911F79A7437A436A7478CD26BB6D0 estherdelvalle
1,666,241,367 *AF55612DB71671FACDF3A59221F5224B844A039A DJ#:8
1,666,241,368 *AF583055F3AEE810C51858A32D65438057738F02 d="jk
1,666,241,369 *AF502BF6A4BC9EE9B8E20D83E3984956DAA85687 FAST-PACED
1,666,241,370 *AF55E55E3325832F0C14765D871B02FA22D62868 LEO.MATHER
1,666,241,371 *AF568871C631284A34B72DBE52F03B22111B2D40 FE8RFU9E5
1,666,241,372 *AF50DD0DC7E74467571A68E78802ADA9AA04B87D LESTERBOLLENS
1,666,241,373 *AF5265AA15633037BAE1B49802C74B1C549F3148 feltses
1,666,241,374 *AF569F1F5BAA11F0034E4B0EEA52C978544C4318 DOMINIC.FLATTER
1,666,241,375 *AF5CDFF6B010181445225161E8A9FE434FDB636D LIMITARTEEI123
1,666,241,376 *AF59A89501FEEE8D17AD99AC6A37A7573A05CCF4 EY$OU
1,666,241,377 *AF52A60C19D955E649D8BA7D1DC030983881D052 LINDSAYLACKAGE
1,666,241,378 *AF5C136543A68D8A380868E4315B813CB4E39E13 [email protected]
1,666,241,379 *AF54C46C6CF849348C0001585936E05B398ADB81 DONNA MCBROOM
1,666,241,380 *AF5C628D1FD77D812CCCB04AD5D21E8829359CE9 FIRMENICHING
1,666,241,381 *AF5E9334DD70200407BFE799BEEDFF92E6918939 DOOGLEEF5
1,666,241,382 *AF55F235B94CD5C2B541CB4CF050096898E85FA8 FATAMTA0
1,666,241,383 *AF5FE0A630C007BB93925F7AE0A033439B53E2A3 dq05)
1,666,241,384 *AF5D40113B1BD934E5933A32526104EC6F1D1361 DR!/
1,666,241,385 *AF55BC6C99C663CAD5447E152011FB68D34C680B FRANCISCOMUHR
1,666,241,386 *AF568D4AFB359B94A47297F1109F1E3B02284FB7 LORELEN7
1,666,241,387 *AF5E7C9B6E181CEAB58B3D96B7EB92B9DFE1FD7E DREE JOHNSON
1,666,241,388 *AF593F1D5246ABE0D57E32C7E4576E43C555BFB8 drxux
1,666,241,389 *AF5A4CB73498980C09592B6A236983125F8F9208 [email protected]
1,666,241,390 *AF52B86F0DE4AADE29A5ED19E3345D7BEDF02DBD [email protected]
1,666,241,391 *AF526DCCC9FE269BA2507EC1E9156CD303CD18C4 ds7n)
1,666,241,392 *AF5BB25AB296D40296A606A9C56608B0CEA26545 [email protected]
1,666,241,393 *AF57A2F1F0CBE6F49DA5652810E8CC11FAA5D4A0 funkmasters(disc2)
1,666,241,394 *AF5945C068E8986CA4D20E148D42DC4D6BA1B2EB FLUSSO-BIANCO-DELLA-NEVE-(RE-CONSTRUCTION)-(FEAT-MOHAM)
1,666,241,395 *AF5B751DFEB09E9996F19A94DBD7BE92C9AE496E g!7h
1,666,241,396 *AF558B53343CA34DE85696B4F27DC5C79A4D4EB4 «fortitudo
1,666,241,397 *AF596BE04D41C4F72340432DA1BAA4A4FD4CA118 FOTOKUSTIK
1,666,241,398 *AF5EEBDF808045B35F9F55F707FDEABF801E2984 [email protected]
1,666,241,399 *AF5C1C1D12D4A517E295E910A3600DEE6A1ED9A9 GAMECASTLEVANIA
1,666,241,400 *AF528BC7EAD240512E28A0CE967E9C17EB0A45F4 GANG.RELATED
1,666,241,401 *AF5F8E13DFE40DAC09EA18321F812DBCFEBE535B FRICFRACFROC
1,666,241,402 *AF5FB7CA56E70F8FAA5BF49C0FFB6540C7299812 d+v$h
1,666,241,403 *AF5A05B701922487313D006B1F481C81A599DC98 f?vt
1,666,241,404 *AF5B9D9DEE53DB9C25A826535878CECFCE0B47FE dwjbi
1,666,241,405 *AF58DB6BA2A498C73B98B67B2EF8F3802A35ADD2 galgavams
1,666,241,406 *AF5931F7298825A9D111F4BE1998D0E06EB54797 [email protected]
1,666,241,407 *AF5960A8DDAE09F49E3308D66A448BEFFE10DD80 [email protected]
1,666,241,408 *AF5EFA0B52BE7694FC5CB598D6D7FE8C2D95C7D8 dy.0(
1,666,241,409 *AF5DD4FF6688437DE056511A59CF3D088085DCB4 GHTLHTIFTNCZ
1,666,241,410 *AF5271CF229559836231815F6ECAFF35C8F1E8CE dzee
1,666,241,411 *AF56DFC8075A02F6E4D0D47C8B55DC7C6F8B222B [email protected]
1,666,241,412 *AF572DD60F6E3C4C497D2B572699DB63F2163CBB g#c
1,666,241,413 *AF5A698DF3C9039BBEE749411C4E13DE8C2BDDB4 GCWYLIEGC
1,666,241,414 *AF5D33B386554888427CD192778805CB5E84523F GIUSEPPENAFTZGER
1,666,241,415 *AF500C313F2DD08A2D275118F3617B6C2426C2A5 ECQ1F
1,666,241,416 *AF5D0DFE01D57C4EA7BD1D7017FBE23D84549229 MARTHANASTASE
1,666,241,417 *AF559FDAE90662070633C33B523E3E640F2938DF mary-coulson
1,666,241,418 *AF5CDC600CACE0BAAA6D99C8F36D260F6D90FC67 GLEN.EACRET
1,666,241,419 *AF512121483A006D978DF2E294035B61434A015D EDGARDOCLICHE
1,666,241,420 *AF5C158E859B0EB28B7097B085D908D601186812 edid?
1,666,241,421 *AF5ABB2503E2568950EE4D68CA86582B99D64769 GERESIGNEERDST2
1,666,241,422 *AF59275DDACF1873242295598C09E094F4124F17 ee28r
1,666,241,423 *AF51C0BF2E6CBC7165B3F55B1B5473760BB5C3B6 GOTRUNOVER
1,666,241,424 *AF53839D7B79E35B3C6EB409844DD08794CD54F7 EFT
1,666,241,425 *AF5F4D6426A39E7C80E9B1BC3CB9EDE3857AA776 [email protected]
1,666,241,426 *AF5A4CE6BD52CE3377E87ADD8FDD2787294E59A5 GREGA
1,666,241,427 *AF5AA336FF3BDF60B68A4B58A69838FDF4D293F8 ginopomrenke
1,666,241,428 *AF51165369842647C97F1E1AF7792CFCB726E21B GREGORIJOM
1,666,241,429 *AF527B27FC7538FF04E82854938A4CC541F9701C MCKINLEY.HORNBERGER
1,666,241,430 *AF535FF006C68BE13DB5B54EFC04913729AA619A EHXZ
1,666,241,431 *AF5F7BD633D1D4B5CD11CCC9B20A7B65B1805C9B [email protected]
1,666,241,432 *AF509162471DF078B19C46F072092A4A18C9098D EIXTC
1,666,241,433 *AF553DF5EE42BA2E5845007E3B1E0BC3EF4E6374 MELISSAPOPIEL
1,666,241,434 *AF5F5E611CBEA60B3BEE86DC4EA8AFAA960FF95A GUILTYS2
1,666,241,435 *AF5C405241FD57B974F0CAA944A92650D124CB89 godlikesyourstyle
1,666,241,436 *AF59C3F32BF1C96191CC5C0724A8B918DF65D498 [email protected]
1,666,241,437 *AF5C2E4D7B48CE16B624ACEF5214D66F1343F535 elliottnugent
1,666,241,438 *AF50B25BA4EA07C5C03E9B84C7318FA85EFC5EC2 ELTON.NEMARD
1,666,241,439 *AF50369A1BC40DA0539B042A163542DB6A89B3F2 gravinnetjes2
1,666,241,440 *AF50C9C7F68C0B142335D804028394C4C3DD9CD3 emilakla4
1,666,241,441 *AF502503CBF1AB04C5BE68FCCA9F0B625051AD04 emiliamoran
1,666,241,442 *AF517DA054858F58AE6E0E4F2B081A836760EAB9 MIEYIANG
1,666,241,443 *AF514F92F318F94AE9A74848B97D38C062F90820 EMPENTON4
1,666,241,444 *AF52385EC63ADF97B64858F80E32931E628C6647 GWN-
1,666,241,445 *AF58A4A6F6A0162B1A3D7CC910394CBAAB60DB7F MMC
1,666,241,446 *AF57D40F76D32D9814D14B9CDF8C5DA74D21D0B5 [email protected]
1,666,241,447 *AF54D7E5C9E4E36ECFBBBD936EF48777EF82AD9D HENRY.PRASOMSACK
1,666,241,448 *AF52EF3386A745807EB713953DA433316BBAF1A7 ernestodoms
1,666,241,449 *AF599ED8BAFA874909A701D113E752142ED84D16 MONTE.ASTRY
1,666,241,450 *AF570C48C991714E50D3E709D68A9548B5D5526F H$ET
1,666,241,451 *AF5F29D9BC010E40BE3CE959A0804A0FDE30B2D4 HHABOUT
1,666,241,452 *AF505F3279EF6E0E0FF068FAA1D679D0668A753B estebanwojtowicz
1,666,241,453 *AF5C6D8A16B03306B9BA4D33DC1EEBC4938C2013 m]pb
1,666,241,454 *AF5AE603FD31E66435D78324D30EA49C64206E43 EUO-
1,666,241,455 *AF51BD1E968A5B4595D9EA443275C70216D31963 hnenlais0
1,666,241,456 *AF5BB4D5A929AA94AE8BE1955B1ABDEC247DB7AD EVERETT.HEURING
1,666,241,457 *AF5C579EB77A68ADDDBCBE8322AACFB412B66067 MYJUBILEE87
1,666,241,458 *AF5545092404A258A7EE3E8EE7C35059D2403550 *{EY
1,666,241,459 *AF5528604A8B98D082CCCD4CA04DEFFD415EB639 N14191789
1,666,241,460 *AF5DED03E807EDA55BF83B19ECC256E7073A3B4C HE'STHEBESTTHING
1,666,241,461 *AF53AA890B1CF82F51BE0A470A01F793BCFDDB3E NA'E
1,666,241,462 *AF5C64882017E30006F59924D7BF22D1D49474A2 HOW TO LOSE A GUY IN 10 DAYS
1,666,241,463 *AF5BEB5A1D04E1660B247FCFD3D23CFFE6E6BE91 hivatalunkba.1
1,666,241,464 *AF512A4DF53FFEB07EA73AC7640F87AFD526A1EE HJFYXQQSLDFE
1,666,241,465 *AF56F42E4D03A65366E17D0D068AB3DA1697AD97 hniabsw7
1,666,241,466 *AF5B4AEC40C170C50512D55C06C8F4553522CAD7 HOLD-NU
1,666,241,467 *AF5538F4941DED34E145100AD594327F82674D10 NATHANAEL.PHILPS
1,666,241,468 *AF525870B92AC574D942EB5C162BFDEAC9131CAC NATHANAEL.ZAJDEL
1,666,241,469 *AF543EAF39046072E4E3A73BB53C3982DA260A2A FEJVESZTÉSSEL
1,666,241,470 *AF5129565E3DAD31E34F98BDA5E8FCBD5091DC11 [email protected]
1,666,241,471 *AF535517E46921CA5F006EEFB5A3A4673CE279E2 NAUREENFAROOQUI
1,666,241,472 *AF5FAE3838B1572D4CBBDEEAF60218DB99194184 HUMBERTOCAMMARATA
1,666,241,473 *AF568D71BCAEC43426E65F5B02BFC4BD3E0E51A3 HOPKINSMN.COMWWW
1,666,241,474 *AF5B7C11CEBEAEBF64C01292552DBF18BBDA910B [email protected]
1,666,241,475 *AF57731993059AC546466BADAFB790E77F4EFC1C hoseagentery
1,666,241,476 *AF5471CE66B39ED93D5FE1BCC47C765EEAE89C7B HUNTOMYS
1,666,241,477 *AF5D68988BC912D222DE5AD6499E6A156D4F961E hypernaturallyv
1,666,241,478 *AF58797C17668829699EA463FECD07902D9758BF HZ(下行)、48
1,666,241,479 *AF56030CC9FBC145533AF4FCE0EF568DA15101CA FIRMENICHING
1,666,241,480 *AF55C21F80823EE6B1019E4E10F2B80442E0C713 newfullstory
1,666,241,481 *AF5FA15890DDAD4A5D4D2BB1EF3F56750B880133 newsall
1,666,241,482 *AF52E0958BE00CB9795F340BB1AEF255C05C113B IAN.HERTZ
1,666,241,483 *AF544FE75CA9DED299BFBF48E1604AA916C6A03E NIMNIRMAL
1,666,241,484 *AF5C0B37AFB6EF93538C1F4B7A7B7FCBFB1D7912 fluffy123123
1,666,241,485 *AF595689BEB7C7239CB8EC00770AEEABF4510B81 fnfields6
1,666,241,486 *AF505706741F4CCD9FD956E3BCCE8807CC4A7CAE IEQC
1,666,241,487 *AF5D76E900A18A71E02CADF5B092B3BADE750A90 ihdec
1,666,241,488 *AF5C75EA6AFC9E005ED829C23110477648FD4C24 iiw174
1,666,241,489 *AF56C5AD7BB52BEE48E480FDB335FD1A7229B56D HYDR0B4TID4E
1,666,241,490 *AF58BDDEBB3D5D07252041A2A810A3264BF42C8D francescana
1,666,241,491 *AF5BE2CEF943BE2A296B539050A1775CFBAAF7ED iambeatles03
1,666,241,492 *AF5E985B81F6DBB2430D07EC984C04B2FD292FCC IAMNIKITA18
1,666,241,493 *AF53410586ACA25B9F789BDF110DAF84F3F9B911 ICH,LIEBSTE"(BRUNNHILDE,SIEGFRIED)
1,666,241,494 *AF5D311101396FD7290498A068713F2B7D67E08C IEA)
1,666,241,495 *AF51C59326325309FB46B0730957D3871E79DB3D independence.(mixed.by.seamus.haji)
1,666,241,496 *AF5A56EDE687F2ED6815163671A20E96AAA6499F ILUVCHINA12
1,666,241,497 *AF57DF1A6EFB42BCAB74AB0169F9D4D7ACD83EED g!7h
1,666,241,498 *AF53E6A4FBF918504F482DD23767441F8B59B5FB GAMECASTLEVANIA
1,666,241,499 *AF5343E61BBB9346B87C17BE219A7DC99413155C imposerez
1,666,241,500 *AF5CA21FC8B52922F4842F42B8D6FE17A385726D GENARO.CAUDELL
1,666,241,501 *AF519550F39F9AA484E7F136CA161B6BE4AEDBDC IP3Z
1,666,241,502 *AF56E12F44556924456E65125944E235243F0F54 irvinposkitt
1,666,241,503 *AF5B64AEA39C9771D1735EA32721E8EA0D786D5E O->-<O~0~D---B
1,666,241,504 *AF50A4A0923699C42932F10E8F2023D905B82363 GHTLHTIFTNCZ
1,666,241,505 *AF55F2316C90BADC310EBA09B072F1D6AECCFEB2 israelmckibbens
1,666,241,506 *AF5508FD7515A5A550C614192D4FF13CB571C01C ><o~o~ @######p
1,666,241,507 *AF5F291AF54B70D5CD91F408FD8D64BF9F5EAAF2 GINA-CASTILLO-ALVAREZ
1,666,241,508 *AF50B81A478C91453D61BFA8B55479CC2B2EFDBD isrealtheurer
1,666,241,509 *AF50F6F76D9C1607D56D1883716B77DCC93EF074 GIUSEPPENAFTZGER
1,666,241,510 *AF5081622AE2C734C1D440684EBD32FAC09C947D ORENTHIBEAU
1,666,241,511 *AF58B6B1C44A4B281FC0E173A8A0C42045A97978 i-was-a-fool-in-love
1,666,241,512 *AF53B1F6FCF8CFD3FFFDCC81E1B205DD60AB399F GOTRUNOVER
1,666,241,513 *AF510CFFDDE06C2EE85C60AFE14444B4258D6AD6 GRAND VIEW-ON-HUDSON
1,666,241,514 *AF51FE902F4168E6D78E3FD21A8B53EB78CBB5F0 griggin
1,666,241,515 *AF520271EA9FC122C1B8E1D9E342D6101940C788 jacksonhousman
1,666,241,516 *AF56DA1A4F67D7D8F9AEDBD3BE52064A71569D02 japan-yoshiharu-habu-and-modern-shogi-an-open-translation-project
1,666,241,517 *AF5DAC3E9BC75CB48210582D09CA0626DFBDC089 [email protected]
1,666,241,518 *AF52B312BFD791AF496EB3CC0CF8D8789BAF0AB4 JADE.BATEMAN
1,666,241,519 *AF5AD5299D4F4039525231F6620F005DC3D19EEA JARRETTPAYNE
1,666,241,520 *AF589F94159BF4767AF2042F8462BA3E9A079DA2 gungirlbbs
1,666,241,521 *AF5627331575D597201269705473341E3BA48504 JEFFREY.CHENG
1,666,241,522 *AF534877A6C1F7FA29FF307B5A1C688D4DDBC2CE HA3915826
1,666,241,523 *AF5898BF58DE25DDF2FCCD46E3822E91B170C369 jeremyclement
1,666,241,524 *AF50CF52DD8F1F50051757CE419897F0516CBB00 palmistry!
1,666,241,525 *AF5997A9230E7A722A027064426C19C7B3275021 JAREDPANE
1,666,241,526 *AF5F88A82563A8AE208789587561F8F798646386 harrisoleskiewicz
1,666,241,527 *AF5D9FB078E049B2991CDFEE2A94BA4D965D7642 HAYDENBELLENDIR
1,666,241,528 *AF5B48631E7B6FDA0550D2090D9091E29C0A4566 PARMICA
1,666,241,529 *AF52745A0881B586796DCD7689D3600969DEA629 JIMMY.FRAIR
1,666,241,530 *AF5EE86DEF45EF61D5014FB72536DC14E8303E4E HEADTIRE8
1,666,241,531 *AF52F61A72990597300FFD19D5A75282B68841C8 [email protected]
1,666,241,532 *AF5AD8E0251DF300FA0A4990939CF92EB359790D JKG&
1,666,241,533 *AF5984E95CF3E26D8245FC4D28AF67E08A7CCBE4 JONASPOWLEN
1,666,241,534 *AF5FE75874697511079CACA3087BD0DDDDFDFDB6 HHABOUT
1,666,241,535 *AF53ECB0831D66E306A9F2F03692211626419405 jeffersonnedman
1,666,241,536 *AF541C992EB6DD2B3AA68EE21EC4FA2B392C28A3 JON-SEAGER
1,666,241,537 *AF57C3ED1FD50C4E8434DFB462AE38B4574B1ACA JELENARADIC
1,666,241,538 *AF58E64FDDC2BF3C2BAA74AD34EB1F8A0553C389 HINTONSING
1,666,241,539 *AF5E0D191835D74ABD032F86E735FF55BC58C666 [email protected]
1,666,241,540 *AF592BA0C658BA6C64477FF81FDE6AE51DE155B3 HJARMUSZ
1,666,241,541 *AF5AB5241EBC18A69E9CD0C02463C6DDCC976562 PCRSONALES
1,666,241,542 *AF5E9C4112A84B161400EA6E1356A31D0C90C753 PD*(0_<)
1,666,241,543 *AF5E19B16206FF21ABA06AA66E5E758B2903BBA9 JOYCEWATTS
1,666,241,544 *AF5C3D888E2548E131950BC1F038410FCA63E12B JESSICA.KLASEN
1,666,241,545 *AF56E78C893A7B6E9147ABEA5D46ADB485C20AB6 hollisvitanza
1,666,241,546 *AF56298390547DFCEAE82FEABE4C4168D3FECFA3 honeysunny1
1,666,241,547 *AF5FA38519DC1D5B2FF18C34E2CEDCD619DA533E JG1989DE
1,666,241,548 *AF57A4891EB1EFB6D3DF1C83D5FBA9FD5BE98211 HPOSONMYG0
1,666,241,549 *AF5B84B59F7C86271D79FE11898AD1422F813C91 HSIFNUS4
1,666,241,550 *AF5944C018E58FBC6E96FFFCBB98CE3601BBF5FF juniorpaterno
1,666,241,551 *AF5BFA921867A5E1FC8225BB837A95AC8D0438D6 junkun
1,666,241,552 *AF5ABE8BA33B00D4121F64956F9D984669B6B456 HUGHDELMAS
1,666,241,553 *AF50D8F9A44369E48504A3951D98949F2F674097 PHUNMELO1234
1,666,241,554 *AF5066BF87BE5FACBC4DAD0C4F8C4A7E3A07A84B PIANO-CONCERTO-IN-A-MINOR,-OP-54:-I-ALLEGRO-AFFETTUOSO
1,666,241,555 *AF5398CBC78DEF5F434601DC89C3776C9DF2688E JOHNATHONMINON
1,666,241,556 *AF52265D5C1D76DED38F00B55A9A572533526BA7 HUNTOMYS
1,666,241,557 *AF5CE211AD256307685319EFCC37678A1B2110AC PKFX
1,666,241,558 *AF53DB72345A6367CF2D8248E3397DAD1F7C1826 hypernaturallyv
1,666,241,559 *AF52A8DC732C1D5E2AFFFE814293620F613E1FF5 i2/f
1,666,241,560 *AF5953FE45478607B8A1E1302878720C4DCE3AB6 IAN.HERTZ
1,666,241,561 *AF5520B1B2143791F114D05C87E0ABD53F2E57E7 KELLEYWALTHER
1,666,241,562 *AF52B9EA083545004BADDCE4A3AB43E96B042379 [email protected]
1,666,241,563 *AF591476677E97CDF8601BA1AE972E45FA76C656 kelvinschlotterbeck
1,666,241,564 *AF52751AC15F20CC28ACFC2256A92E371755CBA6 IEPAP
1,666,241,565 *AF5265A1C23A7383A681148E4B6C0793A97FABDB ihdec
1,666,241,566 *AF595980BD5AE9431A49D0F783D8F4B7060641D7 KIPGEN
1,666,241,567 *AF5DF15364F5F2988D2D7952FD83759C6BF25361 JUDE.LYCHWALA
1,666,241,568 *AF546C92981A51C1CF1E886AF8C068E9CFB0C40D JUDITHCARON
1,666,241,569 *AF54CAB3C489D7D90046C84E0BEB56798A9361F5 [email protected]
1,666,241,570 *AF52BB72821E7A7FA83DEE15E8D1A256D686E0EA ILUVCUNNINGHAM00
1,666,241,571 *AF5CEAC91F113DB3B479FFF2448ABCC2D4420389 junie.paul
1,666,241,572 *AF53A18968D217651F093E75D5BAACA399B78F50 JUNKYLA
1,666,241,573 *AF58713128080DFECAC78015DCFB901C0AE63386 PRESBYCUSIS8
1,666,241,574 *AF50807FF9C6F12A7E1323FBED5D5F1A28D1C137 imonihci1
1,666,241,575 *AF5E980D8B96C0219ADAE8FD05E75D95A5CA9651 prspcfd
1,666,241,576 *AF5C1E3D672483FEE8302E8AFEF60FD6F40D926A krisnemet
1,666,241,577 *AF58E1CB787B44F62FB3818A47599FFA2D6444B6 KRISTEIN5
1,666,241,578 *AF5C82CD659EE739AA3FB4FF725CEF9281987C15 karoly
1,666,241,579 *AF5FBFF23F894481BF15EEBDA3D9EB6F87B37DB1 PUNLORK
1,666,241,580 *AF5A59ABD4C08CDF33B5A74A365C643154DFC2A8 kaunlp
1,666,241,581 *AF50197638D28A401F03D830D045DB0203592FD0 KURKIE99:BUNNYFACE
1,666,241,582 *AF50AD667A314A93AB47778148A29004FCCB308F kurtglotfelty
1,666,241,583 *AF5E7DC0C466AD8B53F790F9AC15716B406C6AF6 PVANDERKA
1,666,241,584 *AF565584213A79C761A027F126AC4981F23815E8 pvvddxykolkp
1,666,241,585 *AF5576580A9041DFDE6E001536168A0BB584FA94 PXNDXC
1,666,241,586 *AF512EA10D3990FD662AA7B949A94B968D9EE496 IP3Z
1,666,241,587 *AF5AB406B01408612788BB576730839755F14C43 KEENAN.DAHMEN
1,666,241,588 *AF523FD3E09620C473DC8F11E535BC998F3910D1 KEEPMYHEAD
1,666,241,589 *AF51957F870AF89A61BD4C7020705D90912DE458 LA"D
1,666,241,590 *AF5596F98DD0A4B138A033EEA25BC71CB8277614 kermitflaum
1,666,241,591 *AF55787F7E3703939BF4C69D2BD0154DD444ECC3 [email protected]
1,666,241,592 *AF5DB555E12C5FFC3BF6AE0251FC60D0452A7FB2 isis.howard
1,666,241,593 *AF51EC6DD31B5A0A5872EA4563A9B17B0D042F21 [email protected]
1,666,241,594 *AF5D33376814B5AF4971085767A2D944AF626139 Lambada-(Sunset-Crew-radio-mix)
1,666,241,595 *AF54EAF351937BCD40C10B6B7E120DF37CD97121 keyaracarmelataylor
1,666,241,596 *AF5534B10760B0E56F29149FABD1B90B29D84F8C ISREAL.SAR
1,666,241,597 *AF59703E01284DD29FD59D9EC2A8EEECC42386C0 Lapiantaverdolina
1,666,241,598 *AF508A3FC9CD0C4308C11D6E4708D2ABA5299754 ivvf822
1,666,241,599 *AF58445B3F8F62585D382053AAA6C54663E90683 JACKDESROSIER
1,666,241,600 *AF5CB9D50A2762E9DB140E6C0934DC715509A4DE JADE.BATEMAN
1,666,241,601 *AF5A8BCF7AE83852DFC8B8ED508A34A4CC1E05D0 LECTRIFIIEZ
1,666,241,602 *AF562366BF670EAB6B4DCB3B69847FEB0B672065 KMITOČTOVĚ
1,666,241,603 *AF5FFBCEFFABF78378EE661AF09056CA8D6E7D96 rabia.rai
1,666,241,604 *AF5A9F5CEE9FA293E4715009B094DD2512CD9E5A KN*?
1,666,241,605 *AF59C4ABC01AB4B7650CD0094261EA239F01822B JANNIMI2
1,666,241,606 *AF5EB2459C370CC5051CA4A3C6A5EF042EE431BF KOALASCORPIO
1,666,241,607 *AF5B0F5ADE480377041CF9DCBE46EA8CA8B79198 jasonlehmer
1,666,241,608 *AF55D03FD881663C43C03EFDC31CA2EA379E7469 RAPHAEL.FERRONE
1,666,241,609 *AF5D8DAE153FBB475E236C246E68DF13B85073D3 KOONTZ-11-0
1,666,241,610 *AF523E88C6578800E0DF415E033A5CF3DF7E2FEA RÅSJØSTUA
1,666,241,611 *AF53EF6650EC1D6619812DFBD5BD40B2FEB6171B jeffersoncaddle
1,666,241,612 *AF51A6C1F99F98440523CCD24565196F0545A0AC ks0b
1,666,241,613 *AF5402B9A114A4652159095290B6BD9C95F7EE55 K.XN
1,666,241,614 *AF5BCFEB87F3AC9A375821275A0FEE6F90B25194 [email protected]
1,666,241,615 *AF53C98DEEE366223CF121EDBB225DC769E57DF5 reasons07
1,666,241,616 *AF502D622B48CCDC529D0EACA4C50C42FAD1CC27 [email protected]
1,666,241,617 *AF5DD6B812164E268A3B1E296F1E55DE64F2B117 JOHNIEBELOUS
1,666,241,618 *AF52B2405B177DF60BE20563F1200C963AAC8BAE reichssportfest
1,666,241,619 *AF5EF7375421556A6BACC38B673FFBA283E14840 JONPASILLAS
1,666,241,620 *AF5D8D85BA0CA3BA5567717AAD91D4041C0E74F6 LRORNA
1,666,241,621 *AF515192E9798EFE4C96C20C8CBA3CEFDC10CB7C JOSIAH.PINZONE
1,666,241,622 *AF5BD93C62FED2A682E8E8C85363B493F03F0CAA LEATHERUPHOLSTERED
1,666,241,623 *AF58AAC0640FF2B63313C4034F8B945A1296B635 JQ[^
1,666,241,624 *AF599F52B0F74C9804C08658AEAF8C56C1B986C1 luyendyks
1,666,241,625 *AF569B52E287430394003C9C4314C9C9A547C4B4 [email protected]
1,666,241,626 *AF5DA48BB45BD993C8338173A94C0CEF1E663B2B REVIEWOFNEWYORKCITYFLYOVERORDERED
1,666,241,627 *AF5BD327E1BD1334ACDBC032C49EAEC2F662CF9B LYNREYL
1,666,241,628 *AF5E0F4A8F24628070EF6185F6B99BD0F9D9E94C [email protected]
1,666,241,629 *AF5299209B110F4A7F4B2D6EF501B7F303E7D999 LEONARDTHEPBANTHAO
1,666,241,630 *AF577CD3E22153D0A066B2ECC66CB50F1C848110 LEONEL.HEIKKILA
1,666,241,631 *AF56300B484FEF2D76C510BBFFFD77AA7466394C m3e5p3r8
1,666,241,632 *AF5A096E9DF2D3C8BBAE67A3FEC6BD37EA415EAB junie.paul
1,666,241,633 *AF5E26A866893F29FF0BC04921E8E51B611E3154 JUNKYLA
1,666,241,634 *AF53412039ADD08B48E0845EAE3FBAE2E4CE994C letzdenlich
1,666,241,635 *AF577E3449BB80E3E64E7E2356A886FF7DF0FF7E MAHDYEHS
1,666,241,636 *AF5665DDF9A0A7BECC7785423129E418C470C769 RICHARD.FRANCIS.&.NEST
1,666,241,637 *AF5F1E5F478219FCFA8EF2CCDCC70BE252527025 [email protected]
1,666,241,638 *AF595FB7DC9DFF8E9969D56ED47C9B3B89657825 RICK.TARAZON
1,666,241,639 *AF59E6F9BE6CB70A266B71CA1B93F9A142B5FAAE riconolder
1,666,241,640 *AF519DF9D3025E504A9555F2446369E284754B5E „riegeler
1,666,241,641 *AF502FAB830C646EE2532EC7F48604D44150EA00 LIEBERDAF
1,666,241,642 *AF50456264B6EA8BE31DB28BC58625C538A32DC8 [email protected]
1,666,241,643 *AF5205C6D8142B084F49C6B9827B2C0B46F993A8 MAN.KAARLELA
1,666,241,644 *AF520AB4B89B35D20E14E361725FC8AD8774DECF [email protected]
1,666,241,645 *AF52DBAAB35B4915A9F0F9F4AE0AB7AD70A20863 MANUEL.ZARETSKY
1,666,241,646 *AF5AB385CB06FD6628CA0A36441302DE8CBEAF34 MAPLELEAFREVGOATSTAGE
1,666,241,647 *AF5AD4061B4B94B3E259F818ACC238B5F9895415 MARCFREAR
1,666,241,648 *AF5E7ACBA97EFA9170AC0094430B3FE4D00F34F6 marcosbehrmann
1,666,241,649 *AF56407DBC17FE58450B913BC94A803B9AC61A32 rM"
1,666,241,650 *AF5BA301D81F59CCB590A40FFD5CD1C6AFDC0CF4 KARINAASMAT
1,666,241,651 *AF5B4EC8D225F98F92DF033049EE33CD483A9512 mary.lou.you.took.the.party.with.you
1,666,241,652 *AF51E1AF3948F49B9CA20406595268DE1D84770E LONDON(THEERADIKALBLACKLITEMIX)
1,666,241,653 *AF54F795703802B4B2B8C4A6C29B4E90C1F184D2 [email protected]
1,666,241,654 *AF5014240D1BDB31FDA075D49CC5FEAEC198D9EE KATIE.ROYER
1,666,241,655 *AF5B2FEBD416183BE6A8367E4C8715BFB91EF6C9 LOOSESLEEVED
1,666,241,656 *AF5F51258ECFB8009B96905BD8716B8D8B3BC5F0 LORENZOHIGH
1,666,241,657 *AF5D9F9B9582B279795A9957AB307E07A90A6ECC mauricecartledge
1,666,241,658 *AF57E92B033AFFF7A0B175A384964323F3053959 RODOLFO-BONILLA
1,666,241,659 *AF572A46379D5EEA52EC2389CA49E84A909DB129 MAUSVERSUCHEN
1,666,241,660 *AF5545BB435FE7F564A13F9CEE0BAB9343D2A1BF louieressler
1,666,241,661 *AF55F1BB74C5246A1E46B04FD20E760AD32BCF1B RODRICK.WERLING
1,666,241,662 *AF526056CFBA20809E33182D7DE3B9621E53EF95 kebabs (feat jamie ball)
1,666,241,663 *AF541F8DCF969273178D6F32956B638A04CB00CA rolandooutlaw
1,666,241,664 *AF52DA7E8216A11A669844A7AC17BD97BAF64179 kendricktodt
1,666,241,665 *AF54DB62C51456E4ADCD76B0E74F250FB32CCA84 RONAM101
1,666,241,666 *AF5CBF2DF6E46A26D865B4DB33497B734ED37965 KENVREZELER
1,666,241,667 *AF575B711EB97B96AA882C56774A428E01D36A80 LUKECALIN
1,666,241,668 *AF5B9E3693886DD62758E2546F2D688C1E5921BF keyaracarmelataylor
1,666,241,669 *AF5DF19E4E0B494CB5AA5646F4DC623DF06452C4 METHANATE!
1,666,241,670 *AF5E618B6425B6ED30D2E89D795F3795CC151B40 MICHAEL11987
1,666,241,671 *AF5EAEF27780BDA7B872F0EFE5A43C647F2082D0 kipwedman
1,666,241,672 *AF5EE93EFDE547F0FA78C30496AD3DD72B01BE76 million|
1,666,241,673 *AF513CAE04213F954E6A5E62CC7860FEFD91E189 LYOUG
1,666,241,674 *AF57070C7EA21163A906CE38A09D9DACD61EB14F [email protected]
1,666,241,675 *AF5B8950CDD0E49D866DD581608E7AC1F7004088 MINIBUSSARNAS
1,666,241,676 *AF5B007C48F03076A344283072FF77CC03C5C223 KOALASCORPIO
1,666,241,677 *AF500B54A6FA564B102D9F555C590DF7A0B4639C ruebenziter
1,666,241,678 *AF57D335D42B7245CCEAE4353C8AC58DE4C99164 MADHU.ARAVIND
1,666,241,679 *AF51EAF3279DFD2FE41184F51083D5397177EB85 KOONTZ-11-0
1,666,241,680 *AF5B681320D2AB5B6D74D5E71588F11B28636C17 mizz45
1,666,241,681 *AF5CC410299CD3AB7232CF0399559628994DC8FE RUPERT.MILBOURN
1,666,241,682 *AF5F8C772635F351BD2EC99F52AE08722CE8AB4B MAJORTARASUIK
1,666,241,683 *AF5CA6AAFB09FED3980C59D42BAE78C38857D45C MMC
1,666,241,684 *AF5DFA5DE267458B06B0EDF0A9B1F05DBB56EA8E ryan1
1,666,241,685 *AF5C33C756111CA8D6C514AB454CD7776A944645 modestokesek
1,666,241,686 *AF576D9449D08F210D49174C689AC46D2DAA3807 marcelhanebutt
1,666,241,687 *AF556EA00E8E1E7EC81083A59856E2B04906D7F9 kurtissalaam
1,666,241,688 *AF5617E4115676674AFA558892C2A97ED74A532A MONASTER5
1,666,241,689 *AF52FFA39D65215C85F5729E342D36C8313F4B78 MARIUS_1959
1,666,241,690 *AF52C7A1901D3634F9529DC5B01D965808BCF586 SAMENFINK
1,666,241,691 *AF56FFE75A2B6826EA542607FE4854BFC1C8DE35 SAMMENLIKNINGENING
1,666,241,692 *AF5C33C280FACB8024F8ADF2E16E98F737745ABF MTZIGIZIS
1,666,241,693 *AF59E5272636E455E9227F583F6F321822FB206C martinawesome
1,666,241,694 *AF5D2DBAF5E72FD273819AE3A1D0540B6FE08B37 MARZANC
1,666,241,695 *AF5354554710D8EDAC8FC5D7D676302362D8FD82 MYBRAINFACTS
1,666,241,696 *AF50709E74EC54CD79B5C8FFA51A14A97E26B33D MASO.ARCE
1,666,241,697 *AF567983CC655B9EB184484E5FCFC72FDD3F00B9 SARA BOSTICK
1,666,241,698 *AF52C07AF63CEC5EC57A77BC276DBEB6BC491BFE LEATHERUPHOLSTERED
1,666,241,699 *AF52B18FC0161E5425919171297B9FF34EAFD9AD MYRON.PERREZ
1,666,241,700 *AF57DE45D2C8E19FDFD6A38BCDAC86A7D1B008BE MYSTIPROCTOR
1,666,241,701 *AF5ECF504E8B44DE08B5DFD427652CD2284DBCD9 SAVONREPUS0
1,666,241,702 *AF5D225EE66A47F4B36470104BC40A2470F28535 [email protected]
1,666,241,703 *AF561922E2C4BED16AF4E83BFD81C84CC99EA7A2 N|%4
1,666,241,704 *AF5C9F1C6194E5E27F092637F9B815FBAFF32471 lencazorla
1,666,241,705 *AF5B92A9AD53EDEA655AB039C887CD4830EE8A9D MCKINLEYLAPLACE
1,666,241,706 *AF5D133E33137875645340A6D93CF239FE34EA1F mclethar8
1,666,241,707 *AF5E8A4F8822A9412A5F531A0A9E403F22FF2E0C mediatarget
1,666,241,708 *AF5B3AC3C9BBCE2C3E6049AB62F4E528F7DA5F0E NATHANIAL.GEHRI
1,666,241,709 *AF5110172E176E792136BB89E337F0A85FBC6240 let'sjamit
1,666,241,710 *AF5B029B79D6E9C89CAF873F4DB5BD61A9E798C8 MEGACLET1234
1,666,241,711 *AF5FF781C8F2F66ABA47A45FB16C1B8357F65E28 [email protected]
1,666,241,712 *AF56DF9DD8AA351E12181A96C045F5EC40CA624A NFRMNDN4
1,666,241,713 *AF589A7B6305F7CD01C87F9586E512EF061B7E25 nicholasbalson
1,666,241,714 *AF5AF66EBB831A25AC1D4ADE8909FC5AE16D85DE LITTLEZ6
1,666,241,715 *AF5067AC4997C536C4CF1C8AC300BA1D79AB839D [email protected]
1,666,241,716 *AF587DCBC79B52742968CBD17D9D009D033204CE mickeyhohler
1,666,241,717 *AF5FBBEC12A704880FAFD5408163B12853380F92 midaddy
1,666,241,718 *AF59373BEB2EC284267805D199C9B5D0E7CB08F4 MIKEKASS
1,666,241,719 *AF5ECE693A3BBF92B6682C53BBC20DB3D39030C3 [email protected]
1,666,241,720 *AF5446C196CA5DE192648B5969C809EAF88EA996 NLANDENWITCH
1,666,241,721 *AF5F79FA6CE11A18259EC3574C488D1A15D47900 SEYOUNG9
1,666,241,722 *AF5627B5269BF437F6318AEC5F1AECBD811CE130 SHANDI_BARROWMAN
1,666,241,723 *AF59B15A28AB06672F0AF7F1D20D89159B9B755A [email protected]
1,666,241,724 *AF5F2DD21857863ABEFCE72820790B4D5CDFA592 louieressler
1,666,241,725 *AF564AF7758176F862F61134730FDC33E67E5F69 [email protected]
1,666,241,726 *AF533ACC37531C9B884E7F0BFCFCF2128DDC30EB LUCIANOCARRICO
1,666,241,727 *AF5F291F133BEEA908A1D239000CD02CF6726263 LUCIO.KOSSEN
1,666,241,728 *AF56D07B28DAFC0FE494413882E32912ECC2D5E3 MONTYVICOY
1,666,241,729 *AF54D0D9E2483D1BF49FB0BCB6E2D6B797AAE96A O]/.
1,666,241,730 *AF5165B3BCC6814C211BB2BB3A1435AA49CAFC45 LUKECALIN
1,666,241,731 *AF5B8B92B6533920E57321B1736F7EAC0C1B0961 morpheus
1,666,241,732 *AF56F9B7198D61ACB56446A05F7DAC09EAB08361 O211317
1,666,241,733 *AF5F819B767D8AC94D0A0277C1C3990CFF2C113C O->-<~~~(===8
1,666,241,734 *AF56646ABC746EB50DB07FB5EAF0D91406D33DC2 OCHIEZEY
1,666,241,735 *AF57B122C37D96FE84A9D6299C1E8389535C8190 sidibach
1,666,241,736 *AF5483D18ABD6AAFA2B3A8459C3E093C941D3AE1 MOZ)
1,666,241,737 *AF5E9F500BDE53CBBA407C0B1FE59811D3B2DEB2 MRRICTOR,DJROCKWELL&TREC
1,666,241,738 *AF511B3572AC15CF053062C2525CE8D62E523FDE LYOUG
1,666,241,739 *AF5182F6E2F111ACDD706336F152610229355BEA MURRAY.CALTABIANO
1,666,241,740 *AF51EF3DF0BAFD004F58BF5F769CD0F9657EB6B5 OMAINEL
1,666,241,741 *AF50E19DB9DFA591DFAEE1E7BCF3F4BBA5F48BB4 SKIN.DEEP.:30
1,666,241,742 *AF58C89D2D7A0C609DB193E0FD3ADD593D54627D OMELAK
1,666,241,743 *AF5931938EFC91597955DE0ABB060C36310CDD2C MACKKRYST
1,666,241,744 *AF595BAE9FDE2B25C23DA0A9DA39FF74E4EE9DEE MYC0RRH1Z43
1,666,241,745 *AF5B91A33DAB512215A922A74FEAB1090F3A677D myjesus44
1,666,241,746 *AF573C436846980D52DA7C10BAB0DD028A05DF0A OREGONB5
1,666,241,747 *AF5E818B3ADD7891A747F6285EDF9624DFAD3F29 N00003350
1,666,241,748 *AF5FAB213EA1CDA931489E60E116BFB740CAF65A OSEBA:-AT-LAST,-THE-SPIDER-HAS-BEEN-STEPPED-ON.
1,666,241,749 *AF5570F56703680B8C18AF30580F72FF9FE199FC NAJOBVYKLEJŠOU
1,666,241,750 *AF54CA479E5BB9EF8CC8F0697F93E7C8C1A154AE soncire7
1,666,241,751 *AF585330C0B921312A6C8DD8891D644238F9E806 ;)*-*@-----P
1,666,241,752 *AF5C7543B9DD0FC143F761C542C1C134CBFF0939 P#>***~0~OSPLAT
1,666,241,753 *AF56D2125DC1CB496583B8267EF02860A2F52422 MARIUS_1959
1,666,241,754 *AF52F11E43F04CFD9D442A4323F52ACB7A1EAC25 martinawesome
1,666,241,755 *AF550DF0FAB8EA3FEFC9BAA65E9460DA88ADBC50 NEIRENEZS
1,666,241,756 *AF58BED855720D91B1482992994005345B294436 Sploit.~.`<#####q
1,666,241,757 *AF54F5C00E76AF7628BF97DA883F5FE121DB1BF7 MATTLAVETTE
1,666,241,758 *AF5376266EB4CC61605F24BBBB24C3CB06959DD6 NESTOR.RECALDE
1,666,241,759 *AF57240AB52EC83332A74605C83E5FD838B7A6DF MCFADDENSU
1,666,241,760 *AF53A514804132E3D231D11D4F94ED5953F602FE stacyhamp
1,666,241,761 *AF51F08AA8849196C22C401ABD79D664A410CB4C MCKINLEYLAPLACE
1,666,241,762 *AF56BFC5BB63567D5170CAD28550112B300CB9A7 mclethar8
1,666,241,763 *AF5B985A154B3C618ECA1CD9961B06F418D1C3A9 PB.*.*SPLAT
1,666,241,764 *AF53E259AA8D58D3F38F7B41F48D9ADD02D3AF3E melvin.muniz
1,666,241,765 *AF54FFC23140EDF9EB95D8D39C35EE38F7C7884B star6999999999
1,666,241,766 *AF514C8AACA8B409C1CE600FF063FDBE53735D7C nicholasskoff
1,666,241,767 *AF518B16D962C61E95C0F03776CC98834CF8122A PEOPLEYSTORIES
1,666,241,768 *AF5BF390AD20E7ACF6D36987989D9BB993985FE0 percyonan
1,666,241,769 *AF58389F87D12393E85FFF050BCF0EA9913ACD5C MESSENT2
1,666,241,770 *AF54AB8552EE8A40F11D99FB8D0606F56BD92743 STEFANPRASKA
1,666,241,771 *AF5FC63EBBBD765716E81D0F05A52F96F4A95C84 NICOLAS.DAVIN
1,666,241,772 *AF55EDDCA107A54D0A7F6EB988C6FCCBDC238A0E NIKOLAIHOF10
1,666,241,773 *AF56C0B7F483C595FF72F8544AE90E067A97E4FE NIMPERATRICE
1,666,241,774 *AF5CCCD527295A192DD003C31BABD300B9E659E6 MEXICANOS.(FEAT..HERB.G.)
1,666,241,775 *AF52716D464AE23B63B5204C6E590AE43129C342 steven.kersey
1,666,241,776 *AF539C908F22D4EE8A94894B6D8ADF59FF25A056 NOAIDIS
1,666,241,777 *AF557A1338F95ADC1A43185F91F297AB3D329CC2 STRUKTURFORMELEDITOR
1,666,241,778 *AF58BEE53CF0FA76A25A8EE06F4C43155A1C2BE1 mickeyhohler
1,666,241,779 *AF5EEC7B1D1FDA22CE077EE838E92AAB86462193 NORRIS.REEDER
1,666,241,780 *AF5D11E0D71B3F324234CDA9C1AA3BC4977BDF55 NOSEDONDENICONQUIEN
1,666,241,781 *AF5B2D45DA9593868AFDE51684425173C2EA22E0 SUZUKIBASTARD1
1,666,241,782 *AF5094E3C667CD43A48995D294004D31CA6A022A mitchmall
1,666,241,783 *AF50042B37FE62EC6AB4A2CDC95B2773D07E9E62 [email protected]
1,666,241,784 *AF5706AF311748A4651D84ACCBE6CAE4DC5C28D2 [email protected]
1,666,241,785 *AF5AA7E8FA731786087FE9013BA571C52C713356 moddego
1,666,241,786 *AF52C705DAB5C556DC7391F91D3D91595037DDC3 portersavich
1,666,241,787 *AF594699FDECD172FF20FCEC48E6C118E3D7F432 portia-milazi
1,666,241,788 *AF508EED2EB279E4DC4BD4FF8F1D52F9B1A954CE T3MP3ST-L
1,666,241,789 *AF5FD0FC5CC9B0BA0DC20F11D1CD47A0D3DED5E9 MOHAMED.VILLALONA
1,666,241,790 *AF50432B1D6FAD5EEA3DB50C467A2CF45DA5659D OBLÉVAJE
1,666,241,791 *AF5B8ED9D2587FBEE590A7826087868C36AE189C MONSEIZING
1,666,241,792 *AF517D979C9E7335ECE02B0396C553D7F757032B MONTYVICOY
1,666,241,793 *AF5E1D1D739F486CD5637394BB3C7F8E4C698133 [email protected]
1,666,241,794 *AF553392F903EB366E2483DB932E6754A6811969 morpheus
1,666,241,795 *AF5D5725A326F2E4B098CFF4A0822D3D28DF84A6 MUCH.TOO.YOUNG.TO.KNOW.(ROUGH.MIX)
1,666,241,796 *AF557FD517231BC09E17BDEC7EBFD6C5481C8C70 OFFERS
1,666,241,797 *AF5FD2F55525AECAB77AFB6B762A0E9F6CC0A0A2 MURRAY.CALTABIANO
1,666,241,798 *AF574CD4F05EC9538B1F35E64A40E043EC5F9873 oihv
1,666,241,799 *AF59F249E1A1F6F1CB4D2C9CC09DC8C51A74DCBF myjesus44
1,666,241,800 *AF546F8EFAB34266381C6C948BDBC313FB913573 [email protected]
1,666,241,801 *AF500DB725A13604D45771DA54C10E7E74119823 ollieborders
1,666,241,802 *AF5A87160250D8CEA1CCE338E182F6236DE3A5C7 [email protected]
1,666,241,803 *AF51A1E9E408701727DB1052E6C3995EF2659903 [email protected]
1,666,241,804 *AF51D3BA7CE9A72D4DE0615DE5C139787C45CAC0 TBJORNELUND
1,666,241,805 *AF55D7F80740CDB6798538DEC8E6EA423421749B T*E4
1,666,241,806 *AF52E3E10AED6436E18EFBE52AB8CD2CC1AD79AC ncrphlsm5
1,666,241,807 *AF5312F08E50736FD51359593D2EE3A5990FBACD RAJAJEE
1,666,241,808 *AF5992635BC864F248755BC768CD21112B7EF13E NEIRENEZS
1,666,241,809 *AF5FAC5C4A59D7B545D793B542E4290A9A6FC8DB rbfnkluv
1,666,241,810 *AF508E10A96E3395097E6CB9B40EF31425AE8607 NICOLAS.DAVIN
1,666,241,811 *AF561694020FFD0FB1F5384FFB0D0D12B27FBD17 NIKOLAIHOF10
1,666,241,812 *AF5EA689C62A2A0FC440238F4BDA8F189418BBD6 NOAIDIS
1,666,241,813 *AF5B01427A4656F0F8AC9FF89C44297B9F6FF35F OutofStatePlates
1,666,241,814 *AF5A62C1CCA48EB20CC2D316FB44D4F22923B4E5 THEJAKEY96
1,666,241,815 *AF526F76B117D6E7A989EA2C098FB259F9138463 reneoder
1,666,241,816 *AF56A0AA797AE73651E04147067800ECB7A1A9D1 [email protected]
1,666,241,817 *AF59BCC1D51CBE3C0B674EB93FC4728D85C9FC63 THEMONKEY12345
1,666,241,818 *AF55D7AC4030C2B8410828B586D25B2DE0DB45AA REPROGRAMERS5
1,666,241,819 *AF592B0ADFA070E9BD83E3CB059D4B5E63AC96D3 THERON.WILHELM
1,666,241,820 *AF5DBF0E00A9706A5A6C270023616F72A98D656C [email protected]@+I0N
1,666,241,821 *AF5F48DF30657BD28560CBC0A9CF2492EFB6A051 [email protected]
1,666,241,822 *AF575167C3FC73C25F884AFCE70C69D79511AC5A nya*
1,666,241,823 *AF50317BF1794C2842433FB925EDEC03A6A70C10 o1qaaa
1,666,241,824 *AF5E34616364D5166D1D9EF2CCF03DA79898CADF [email protected]
1,666,241,825 *AF54385F2283BD297BD7E0522A6A8A5014EA1310 OBLÉVAJE
1,666,241,826 *AF573C0D4704BE7FE16ACBEF4A813555D4E564E0 OCHRANN0
1,666,241,827 *AF5B8715C65A349782F824E4070818A58827D9FB RHINOLARYNGOSCOPE!
1,666,241,828 *AF567BE89C6CD390F0B3710C2B2188EAD3529DE5 PARALAXĂ
1,666,241,829 *AF564B610AD89EBDB026891A45090DB0A31065E8 oihv
1,666,241,830 *AF54E24F35D3B946D92032BFE1713FDB1779934F OLDESALEM
1,666,241,831 *AF5FCDF47077A0F80C8974ECFBCCEBDF48E0B3E1 RIVERDEEPMOUNTAINHIGH(WARMDEPTHSMIX)
1,666,241,832 *AF5A4C176AAE532F0ADD38E434A07611A5BE6141 PATAQUEIRO123
1,666,241,833 *AF56BCD1AA83D8797187FD9B07BCC4DF8114EF0C todd-pierce
1,666,241,834 *AF5570CEDFBC36EE44BE47916978F618DC6FE22D TOKHTAKULINOV
1,666,241,835 *AF5877A5D023659BFB98762F2EAC6E652BF27700 O->-<O~0~D---B
1,666,241,836 *AF517A68BE2CAC3349C1362AF987E2553706C057 PB.*.*SPLAT
1,666,241,837 *AF52ED5F2C73C11DC49252AA9B44E8F4E2BE67A0 TONIMA-HAMID
1,666,241,838 *AF5F800A7BBD271AB073202105AD757AC2904D7D ROEDMALET
1,666,241,839 *AF5ADE160B510EB61FDE4EAAE9F8D756C16FBCFE ROLFMIGNOGNA
1,666,241,840 *AF56391E804F9A1EE5E0654A240F3C73A93422ED opterecene1
1,666,241,841 *AF52D44DE3BCD372D2FC1AFE9DF94DC04DB71821 [email protected]
1,666,241,842 *AF537B5EFEC9B13798F76C1174D6F6F4E04AB7EA OutofStatePlates
1,666,241,843 *AF5925BBB9C7E96FFDE1CB25ABD956B5BCDCC929 PERCYSWEETY
1,666,241,844 *AF58AEA90360465A7C07676D8FD63BFBB274B55D PÉREZ.G.
1,666,241,845 *AF5038A1638F4095433BE4B797985FB6F9E1B573 RONTONIO
1,666,241,846 *AF5D812F2F8C28A227E25D5D5D351709E5048DFE PFリング
1,666,241,847 *AF559971D51092E06A64CC4F230A521D3103271D PHACOPS'S
1,666,241,848 *AF5AFB296E30A46B8E692D28F1E0D1E533B9C696 TRAVIS.HORMANN
1,666,241,849 *AF5509674F3C3250E1E261A801C105980B18AB65 [email protected]@+I0N
1,666,241,850 *AF5A8BA77BB346C0EA480CB1DEA0F5818F2255BA PHYLLOXANTHINE
1,666,241,851 *AF57ACF1DD41E8A5DA23E95BBADEE16989947770 ROXYKOKO1
1,666,241,852 *AF54621B985C0806303B06B248543FF43416280A ROYCE.HERSTAD
1,666,241,853 *AF57245E7D67B1F3A8AC409331A5B276344E7D08 ROZSTROUHAT
1,666,241,854 *AF53BA39E92951E9EEF5FFD4E3063FB1587869BC PASQUALE.LATSHA
1,666,241,855 *AF5286CCCC92963D5C8DA6AB70AF9626D3E233F8 PASTORAG3
1,666,241,856 *AF546E09521C32509E105186F6F403B512FD15FF PB.*.*SPLAT
1,666,241,857 *AF517DE15CA6EBDF8742D4CA09EC9713A2C51B52 SA1N7L1N3SS
1,666,241,858 *AF50ACCBC5D1BD860FDF42C8DCD6A6A03993BA6A PHYLLOXANTHINE
1,666,241,859 *AF5C69A89DED1FE15A50D472A48ACF52FC6CA328 SAINT-GEORGES-DU-BOISCHARENTEMARITIMO
1,666,241,860 *AF593FC00352D5DBAADE5AEC55BDE9733FC3875B poss-ray
1,666,241,861 *AF5EAEE1C683FDD15A11A7E73E7282D8F912D352 tuaneichinger
1,666,241,862 *AF5F0D3C8273904BB4D0A896B5A87E13FCFE656A PITOGES7
1,666,241,863 *AF54782FB01E11953D6ADD6925CBF09FB3E78430 PPMQUJLF9
1,666,241,864 *AF580D75870D36E2E93CBDAA299A660B9DA6A7EE P###P.`(O_-)
1,666,241,865 *AF592EB4A8ACC61F95436BDA594668925EDCD49D poolvoralaks
1,666,241,866 *AF58129E09C1EB9FCEB0900D821B52A2107C32AF two-hands,-one-heart
1,666,241,867 *AF51E0C73BF79049ABD095BB049D4448A66560E3 SANDY.VALLEGOS
1,666,241,868 *AF5AAF40DC3323C556EBE1170F7FCF38B3778280 SANGRIA
1,666,241,869 *AF55297E6BEF0AD7CF272F9DA544A65840CEDBEB P.Q;
1,666,241,870 *AF52E86C45482C5C3A0FC6D6FCA350C3C3EADCFB propracujete
1,666,241,871 *AF5C9AB2F82F0661F571A9EC1A0AF58BEE406E14 propracujete
1,666,241,872 *AF5E9A853F7DD6FD249A7624C977904DE34A367F ULYSSES-YOUNG
1,666,241,873 *AF5D007F121326F12601F4FB3A9A15B5E9112D6D UMEAZĂ
1,666,241,874 *AF5D6CD6DF882798AE4222F00B7B35653B82235D PWINZIG
1,666,241,875 *AF5BDF6F16C7E5BB498D667F53B05CA45B031CA9 SECTIONOUT
1,666,241,876 *AF540B9A454F36AA4FE611F7BC8F43F5DDE65A5E unclasp
1,666,241,877 *AF570999B59D32717E4A5E7D48034C7174068A7F SELLABLE
1,666,241,878 *AF5F776A54AB56C4C5CBDB9DBA650F900D9E9704 SEMI-ALIGNED
1,666,241,879 *AF5CA511205C68F369580837B93B85B96CF074E5 Sempre-Pixinguinha
1,666,241,880 *AF5DC92450E4CDBCFF747F6260D82A81F0D96AE3 UNJAMCLEARUP1
1,666,241,881 *AF5EFA9C4F2A0E5EE3CB1EB6E360B7CD39A4A699 [email protected]
1,666,241,882 *AF554322BA79E5197CE707F372B78A40D40E7933 [email protected]
1,666,241,883 *AF54DDD6099D04B122B88A7331CC2A78A16AFB5B SETABED8
1,666,241,884 *AF5ADC16AE826C2B9AC4B7F9E1CFAE3391CC6D4A PWINZIG
1,666,241,885 *AF52F9F3FCD96B0A469BE15E7CCE30EE309838C9 SETTECENTONOVANTACINQUE
1,666,241,886 *AF56CA8B77A490A96CC3AE9F7B32151C93A9FB91 SHALOMVOLVO7
1,666,241,887 *AF57923A1BF91153B293A3DE0F6B71574BF4F0E8 quand on perd son amour
1,666,241,888 *AF5746F739E57F3832A8483FEE15270A05E6656E [email protected]
1,666,241,889 *AF570E0594F72C04062B32D0890B5AD01999EEC6 UVALLË
1,666,241,890 *AF52B62E8D9D4F4A6B04BEF02697201346925CEB SHELTON.BELMONT
1,666,241,891 *AF58573D9E68C5230C7BA8F52E4517FBA922B7B5 RAECHELTUMAMAK
1,666,241,892 *AF583EEAD04BA38CBD93D59F718835BD00CE5B6B V149435
1,666,241,893 *AF5AC2CB615A173DE82AD45D439A9BCAE9B76129 SHERWOOD.KELLAWAY
1,666,241,894 *AF56B02A0616F134C91471C18BA8D4C8E736AA82 quentintinsley
1,666,241,895 *AF58FA353EEA642BA399463259A51294939B345D RAMON.CREASMAN
1,666,241,896 *AF5D11E6882002954AB8DAE3CF9100F7F914926B RANDALL.LANK
1,666,241,897 *AF5F4659EDBB191966301CDAC9EEC1A043F2A3F4 [email protected]#
1,666,241,898 *AF5298AF593223A5805B44F84F9247C579DAFE71 RANDYDONKERVOET
1,666,241,899 *AF5AF37CDB12A0259CB627BC8AF8497581C38F5B VALSABE
1,666,241,900 *AF56288E717ADA0B1711087E1D6E5FC71CF26F78 RAPHAEL.WEHBY
1,666,241,901 *AF580D4DD92066568BFB8A56C9AADDD6FD9CE236 SHOW-CUTS
1,666,241,902 *AF5FE00D855E5CB94213EE0F34C351F9777FE74A r3affirmati0n$
1,666,241,903 *AF5965DC410E10834B14ED144A06F9DE9B63F26D SHUIWI
1,666,241,904 *AF55D713AB522D1AFAE9178A5120D7E39D45F5DB shustin8
1,666,241,905 *AF555CC926081511E426C291DD1C61833BADC8C4 RATITA125
1,666,241,906 *AF5955509532D4AD3F3FBD799B097D4275797C2D RAECHELTUMAMAK
1,666,241,907 *AF5A8AFDCF8361CE6CEFF8E314F8E95F475C140F Reconcl47ory
1,666,241,908 *AF5B585707FDEF65092A63545D05DF47781D2AB4 RAMON.CORATHERS
1,666,241,909 *AF5F18BF15422BF3F44530F47047AA10416A3238 RAPHAEL.WEHBY
1,666,241,910 *AF5CC4FAC111B334E30311C18378FBB5912646C4 RATITA125
1,666,241,911 *AF5F87C92F74145892A84C558428C353383A1447 vesti.la.giubbra
1,666,241,912 *AF5EABA5090838866086DAF0DBD18B769C1BCD4C VICKI GROSSMAN
1,666,241,913 *AF56D4AF73FD59B026F5A30CBF41F9817CE6A376 VIKRAM-RAMACHANDIRAN
1,666,241,914 *AF5136A834D35D36A3ACDABE52D4A1579A22E18E villov
1,666,241,915 *AF5264A001F17627D7A7D967EFDAD4EB3FE99EF4 REMYCORONEL
1,666,241,916 *AF579F7069784A6826F42418B21F53C7B775E670 SLUGZZZ
1,666,241,917 *AF5CE2A572CCF5BC0CE53D57E7F6B2CC0A2619F4 Reconcl47ory
1,666,241,918 *AF57E866FE702271751824B5C4C5EA6B8DAF8DF5 REFERNSCHRIFTLICHES
1,666,241,919 *AF5762565B99CC9FEBD88A43F9F4A53A65CF8AE8 vishiiryamaanah
1,666,241,920 *AF59A02D81201C7FE565DD76C8718B28DEA237AE remaerdekaj
1,666,241,921 *AF588B5F01EE052B52B1B2BCF55B3D9BDBE64AC5 SOFTBALLSPIEL
1,666,241,922 *AF5A9D7EE8B4BB89BA320B5DA218CA9BBC996642 v>[email protected]
1,666,241,923 *AF5ED9F60B0A5E68E8392804F2F061B64B10FA33 somedaywhenyoulovesomeone~anthemver~
1,666,241,924 *AF5F0F0BC7D5436C4EF178E85E301E7AB8DF6987 REUBEN.KALAR
1,666,241,925 *AF54D278D014DFFD11B4EAE84D7DE095F8CA913B WÄERTPABEIER
1,666,241,926 *AF59AE4303D5C3C984FCE2E30CA5DFD121E36499 RICARDO.CRATION
1,666,241,927 *AF5A8522828F057A2A932E523F787844C4EDDA73 [email protected]
1,666,241,928 *AF529D89B4B54F1401A2479A399ABCCA04706E21 RIGOBERTOSTRIZICH
1,666,241,929 *AF5210D4418115E631B6A83A79FFE1D8C379E8EE wallyhord
1,666,241,930 *AF57124071868CE20486AA6FD8A240BA91E36261 [email protected]
1,666,241,931 *AF509122B9F8FE99BC84D86013F0B1A79DA7613E [email protected]
1,666,241,932 *AF5116A8D3646EA5D6635BA2BA5E9323BA02D6A0 wandrumer
1,666,241,933 *AF50A4379242D2DE35DF4998D6E7B5C99611AE2E [email protected]
1,666,241,934 *AF53871F5108B2B733FAE5CF8592DAF9CBF8A436 RISCATTERETE8
1,666,241,935 *AF55E9D2DDF87BED33FB2401699F6FCFD7676180 Splat0~<q
1,666,241,936 *AF516F8685DD291FD07174195451A801D847831C rini-astuti
1,666,241,937 *AF5AD0F33D26B596900C6FA364EEEF7C16C06BD4 WAYNE.WITKOWSKI
1,666,241,938 *AF5013DB541CC5534193D3D820AC128A941CBAE5 WEASELSIDNEY
1,666,241,939 *AF5E61757BCEC07B992E19B07221E4BB44C49B60 robinhackett
1,666,241,940 *AF587C9524EE4FD8AEC6B4EB6D0794F710DAD28C romancedelcumbancherolam
1,666,241,941 *AF51941F42D3E28044056FC406B1D94B0B45879E STEFAN.JAKUPCAK
1,666,241,942 *AF5B61BA14A805225639CAF7D38260CED6D4A24C roscoekapoor
1,666,241,943 *AF50AE762D09FC20476245B83362EC2217606390 STEMMISTEMMIED
1,666,241,944 *AF59EDC351B21D5B5826FFE31583C37F5EA86040 stephanbrittingham
1,666,241,945 *AF5D8D7E48E995DED63D048F31601C094BC0EF2A STERLINGHOLZINGER
1,666,241,946 *AF589B70B5E38BFC9EA063149FEB534465B6B107 RODOLFONETHKEN
1,666,241,947 *AF5B30DD32B7BF37098BCDB61220E12966E1227C rufusatzhorn
1,666,241,948 *AF527C8429DD3F82A219D9FB4C6FF982FDFD4EE4 Sto'xw.Pei
1,666,241,949 *AF5D13C703239276CF2A43C769F874291EEA2489 strongbrows
1,666,241,950 *AF5A98FD6A70943E084253879BA1C6D966DBB39A roscoekapoor
1,666,241,951 *AF5C06B831320FC4DDD772C5D81D1CF471928154 ruttersdorflotschen
1,666,241,952 *AF53F8E557E9CEC2924A5BA7193BC1B7EB10E503 [email protected]
1,666,241,953 *AF5C3F4D79114E1580EBC0C87FD959E7658240C4 WILMA2406
1,666,241,954 *AF543E64FBAD67C3584ADE333801F9DB401E7CAB SACHALIN
1,666,241,955 *AF573E8EE418742F56297954E5861F8847E40ECF winmakol
1,666,241,956 *AF5090AAFC35FDAB9A5AC267F5CAD985DB22DDB7 WINSTON.TABIOS
1,666,241,957 *AF562860D838A39FE6F97BFA9EC40A54CBACCE8E ruttersdorflotschen
1,666,241,958 *AF55D497D6F56375DC6FAF8A91864EC62FCA2619 SALTEAREIS1
1,666,241,959 *AF579AED33EB24292354644C5BC0FC2C2A0B7D3D SALVATORE.PEDEZ
1,666,241,960 *AF5AA450C468F79CA155DF5FD4CFE6F90AD6EA0E SUONEGIDIRIV0
1,666,241,961 *AF5BAE234CC5A9B5A3AA603436247D8DC49A4584 suretovanish
1,666,241,962 *AF5E29CFFE5FEA19F384D7064E3ACC7285B7033D SUSAN-DYSART
1,666,241,963 *AF52B54F057582B6D70B9274AA7073391A75E34E SACHALIN
1,666,241,964 *AF51A9CBC94973D389B7F8B3E2E7CB26F34FCDDD wrefueak
1,666,241,965 *AF5B9023B106C5D8590AFBAF681B7BEB6F8B70FD [email protected]
1,666,241,966 *AF5C76E6DF3D7599B908E617C50DB8106CD8093C SALVATORE.PEDEZ
1,666,241,967 *AF5595431C6FB93EB7175F7D3B2914D9DFAE2DB8 WWW.FUKUSHIMA-U.AC.J
1,666,241,968 *AF54756FE22806372BDBCFB419BD71F2B4DCDBD7 SANIA USMAN
1,666,241,969 *AF50790F08928443529673B1ACE0D9E21974AD22 wwwottawacurlingclubcom
1,666,241,970 *AF50521F89E4E2D4200EA02E5D521E6641107F2C SYNDIQUAIT
1,666,241,971 *AF581719E483CC157AEDFCDDF17233C3F1F78B6B [email protected]
1,666,241,972 *AF5DCEEE60B0902E20B6DF43858BAC68F2989278 SARAH-BREWER
1,666,241,973 *AF52BD86E0FCCC84F92E9CE0496ABE5AFCDAEDB3 SARAHM123M
1,666,241,974 *AF54DE710D42C48A4592FF07FD1CFD14BA9F6FC3 SARERCNA6
1,666,241,975 *AF5A183EAA604A321EBC95EE13C43450D418B9E8 [email protected]
1,666,241,976 *AF5F0FCBE7028CBE0BA7168628B5933954DC4B54 TACTICALPURSUIT(DRUMS)
1,666,241,977 *AF58D56F90E4F694B6D140AA839173F3A157C848 [email protected]
1,666,241,978 *AF5DA3E67C84400DE549CE8E63AEE910BB6B0415 SARAH-BREWER
1,666,241,979 *AF56C79BD36001EDFAF30F55AA6A31F21A25F029 TALK8613615521
1,666,241,980 *AF5BEA9BF4DF6C4988BEE9296E05BF548C5BB658 (x)-o~-0~(###p
1,666,241,981 *AF5F23DBE01E2A3FCF957E8C55F605C9837E5367 xo&o
1,666,241,982 *AF53B039C1ED3783B522F201CEA881E773BA96DD xsbsfm
1,666,241,983 *AF5C9170F27B08CFC5E84A399942AD54366AFBF4 xtube99
1,666,241,984 *AF5FC2227E1B100F11989F48783D06BDBE29D00F tannerkoopman
1,666,241,985 *AF5F0471DE00601A1E2C9404A7778567D5E9C8AA [email protected]
1,666,241,986 *AF5ED2D2BDAAA177F235660E10FAB319E65987A1 XXXXPHILIP9
1,666,241,987 *AF513AB366FDA672BFD725654099FE0E57294B31 SCHETHES
1,666,241,988 *AF557E4DA63D8F36FE51B5EE813691F2E7FE91B6 SEATTLEEINSTEIN
1,666,241,989 *AF5FF8D23BDD3131415C57830CA6F13FF8A20866 [email protected]
1,666,241,990 *AF516A7C8ADECDBAD240B2EE1C380BB613EE4001 scottybankes
1,666,241,991 *AF56D0E2B5E8F8A5A9AA988833326B0F52333A1B SELLABLE
1,666,241,992 *AF509191AC5674E4FAC0F188CC7542A10464F554 s+enci11ed
1,666,241,993 *AF508165486F33507DF87A116C8B6A6750B47A50 YDDERFNAGROM
1,666,241,994 *AF5AE835856CE65FA7697C1AC6BE07439405478A SEPERATELYNOMINATED
1,666,241,995 *AF5EF3C1FCC7ABED54A4838D04F0E5B3817039D0 SECURENESS2
1,666,241,996 *AF52E2E7F5FA94E5178D4EAEBA0A5F390BD1FD0A serguei123
1,666,241,997 *AF56EA48642242C923D499FF663AD3200DA278B1 yin.ting.wong
1,666,241,998 *AF59079E9ACEB35F822F5E629C96CDDB7F47DC81 [email protected]
1,666,241,999 *AF5F859988122CD1D7E7BCA791BB52C53676591F teodorosharpley
1,666,242,000 *AF5E619D384600478737AB1B3CAAA0714C896F6D SELENE.CANTU
1,666,242,001 *AF500AA7A5EE56795E2B121F219BCFECBB70A63E SELLABLE
1,666,242,002 *AF5C5E99D4CA1FF198B3C37BB2ED38F251D05E78 şeyhyeni
1,666,242,003 *AF513EFDBED60EE4A6661C3225DF284CB81453CB SEPERATELYNOMINATED
1,666,242,004 *AF5FB006CCB56115CAD300D1706250216D1BD75B serguei123
1,666,242,005 *AF546BA06B6010328236B9F54942A066E2FF2D5D serologygadfium
1,666,242,006 *AF589888F01BCF19BF0C284AC028192E74F4C0C9 SHANNONASDFG3
1,666,242,007 *AF51E2123C70C797252C23E3160378CFEA91E1C7 THALAMI
1,666,242,008 *AF5BA2195C7DEE8306B6DAF03D03ED097BC977A2 THANH.LAUKITIS
1,666,242,009 *AF5DD5FEF59C96AD2B9BC8FA9AE709CEF0F019FD [email protected]
1,666,242,010 *AF5B5C63FB20CF0DA6E144E25F78B50AD88F6BAD THEODOREWELTER
1,666,242,011 *AF5F8502211083963A2E108BA1A1C69FFA89BFC2 [email protected]
1,666,242,012 *AF5B2E30363BDC783130F4BE03B4EF6FDCBDBEF8 shinyaw
1,666,242,013 *AF5F620CB31EB514F2DE6C963D97FAA811991223 THERESARAMSAY
1,666,242,014 *AF52730292BA982C034ADC4F06661129970DFF96 the-royalty/la-realeza
1,666,242,015 *AF531E3E197FC0D1FAD8800C852A1714228FEEA5 ZHENRENZ
1,666,242,016 *AF5FA69C12DAF7C86FCC2E5D0BF243AD85D51DEE thiefturnedsewage
1,666,242,017 *AF5B08D5951A9D859FC280D29CD8B0C71B6A132F THURMANKISHBAUGH
1,666,242,018 *AF507BA9BD7BCD9CC73BF6A3708369A909A232FE SIDNEY.WOTEN
1,666,242,019 *AF519F9280C8954CD64D82BBFD25B1E7DD4EA271 zia-mackenzie
1,666,242,020 *AF5556D4358CC3BAEC967B1AD8CC9EAF66E9BD39 SIDNEY.WOTEN
1,666,242,021 *AF5384044E930C91255E598AC3E7B7F00D9DEE2C [email protected]
1,666,242,022 *AF57E8C8CF38A2B07448021C8A9F315FB671F6EF TIQUE (P182-183) (2)
1,666,242,023 *AF5BD0162B482250BFECB019212DB7352DAC7829 tithers0
1,666,242,024 *AF5E491FFC8D7390F1F7D122D080B405F726526D SKIINGNAOMIS
1,666,242,025 *AF5CB752FC9BDA77FCFDFA9B05040D1FB3A7878D ...smile'sok
1,666,242,026 *AF51B8E15A05B57B565F89B41D6CC4B886477C24 SNOREBRODERIER6
1,666,242,027 *AF5BDAA1B81C5A521441944690533CE6AEC6F5D9 toonkeizum
1,666,242,028 *AF5E88823518D090A802AF682B8ADD4BE5DE5446 solitonas
1,666,242,029 *AF5AFE57379DA04607F2E00034DBDEED658D5AFC solitonas
1,666,242,030 *AF558595A13B898CB4E8C62B805041574740D7DC [email protected]
1,666,242,031 *AF52C8FFE2D1E96132A0D886B4BEE5B920A78623 [email protected]
1,666,242,032 *AF5FFBAF9BDAC6107B7FCD6A9DFF541F1EAF073F SONSALLINGS
1,666,242,033 *AF586C15783A820B803FFD0CDA654A772DA68934 SONSALLINGS
1,666,242,034 *AF5DE2727743DFB5310729B9A67A576FE4CEC2D2 sotavankiensa
1,666,242,035 *AF50B8BCB7720DBBE4A1DFE9F366B710D83639D7 TRAVISROSKOM
1,666,242,036 *AF549417B547FD88A77D97DF575BECDE301E8E62 TRE DONNE: SOLITUDINE
1,666,242,037 *AF5037BB0EF03B11CA17676458DF7ADDE642A046 SPALATLA
1,666,242,038 *AF5E8722EBF7F9FADFD376E00F18C1EFD20439FF tristanpaulshock
1,666,242,039 *AF5BCF6FFEBEAFA4FA4330419FC23BACD83B1E32 SPEEDSONICSSPEED.
1,666,242,040 *AF523C94A863AAB2F09CA322DA1E8FDF690E4C49 SPEEDSONICSSPEED.
1,666,242,041 *AF597802B137A0D7C488C3D65EE4670D0B147840 SPENCER.SPRAGGINS
1,666,242,042 *AF505451C36CD39C90AED96542677A16730C997C splat~`[email protected]
1,666,242,043 *AF5390B3181F07D7E03BE3174964055111B9A9EC TWUCG
1,666,242,044 *AF5CBCB0A74AA987CD4FD3B62B6A4ECA729B0F60 STALBRIDGING
1,666,242,045 *AF502CFEC24C80341A258930B68796078DF0159B 東芝emi/1996年7月24日
1,666,242,046 *AF5500B8D5B366D6002742551CF1A257D4843732 STANTONCEDARS
1,666,242,047 *AF59E932C121E878B8691F425833D18B9D6210FD stanleysperl
1,666,242,048 *AF5D3F6B058797C4E909606301B294BF43247C80 [email protected]
1,666,242,049 *AF5E42417CE1D31CDCD01E62D85507A74EFD52C5 stevemosson
1,666,242,050 *AF5A01DD094D889C870C507A494012A7C139D7EB STEVENTHOMAS8
1,666,242,051 *AF5E8BE6F0983E8853A3B7E3DED94E7C6A64F02B STNOMLEBBING
1,666,242,052 *AF59D3C855202285D7FC18E30FDEE27F9EBF2875 UNIVERSIDADTECNOLOGICAMETROPOLITANACHILE
1,666,242,053 *AF5A1831816947293418111ED7F3E250228A2F65 UNNELBESICHTIGUNG
1,666,242,054 *AF5FD8507CCF397DAC4C319132F1924F2C8F4742 阿寒農業協同組合(ja阿寒)
1,666,242,055 *AF5ABDC595647A3F475DA29FA11A9DF34D888AE2 SUBCREPITATIONN4
1,666,242,056 *AF5F58F6506BC8B0704B85BAD9F4E83F841D55EA SUMDAY-(BONUS-DISC)
1,666,242,057 *AF50B7A0DA257A8594B7DBF534B941CD32F19699 [email protected]
1,666,242,058 *AF5286592B1D6D0424C0F43CD5E8D741969411FD USERSANDSTIGOZAWA
1,666,242,059 *AF56CE2BD45D82D61984C738385363EEB54A025A usvt
1,666,242,060 *AF54069352976365FF8CCACDCA126BC169FDCCE1 SWETYNGS
1,666,242,061 *AF5AC5ABE0E6D6E8B7A2C8257A260BF9FD39365E SWEETYBUSTER4
1,666,242,062 *AF59C0E0DEACF3E26DDF9ADED57C541D760EE4C6 VALENTINA-ROSE
1,666,242,063 *AF5AF211857B6EAB3BCDB3E4A14C8CC03835989E VALENTINREEFERING
1,666,242,064 *AF57A9895F6569A89AE400D9660CB4EFE7584FCD sypstaing
1,666,242,065 *AF5052B96C2275EAC3B8AB0531FF1CDAABC550E9 SZACUNKOW9
1,666,242,066 *AF581B4225E2C7D9BA76F619F5B836C912C6E35A T0130765228
1,666,242,067 *AF5C40A79592BC1FF64659FFCE551150304A5C9D T4:<
1,666,242,068 *AF5948BB6391FC913D47A8DF7727D9C3E5F21DA3 vandenborre
1,666,242,069 *AF5078C99442D8CE5469B003D879256A8D67EB4E TALK86141152186
1,666,242,070 *AF5F557EBDFDCC1FE8E4C556E63C153298E2E016 TALK871621036
1,666,242,071 *AF527BB511CCAA9BF647CAB36D9D91D86456A23F TALK992448735
1,666,242,072 *AF54994A3A6210703D53332E5D93AE951671D05A TALK992448735
1,666,242,073 *AF55E617F537F6036BBF516C0C363FBCBACD43C9 11.rothenthurminitiative
1,666,242,074 *AF5B16B6790A84B5F1B81E6C65138B0FE6D4E7C6 VENZNAVARRO
1,666,242,075 *AF50B6087E36663ABE784CDE98C39DD598948F7B VEPAKKETS
1,666,242,076 *AF52DA627C71EDD6973D65C115FEB09B904B7C96 12OPINIONATE
1,666,242,077 *AF5C356EEEEA6A56E6E34482BBD740A11AB73FAA 1414043 OUR-NEST-IS-REALLY-EMPTY-AND-,-OF-COURSE-,-UNFEATHERED-
1,666,242,078 *AF5E3606DAE7BB8A5812A2355B5F2104335A6910 14NKN3$$
1,666,242,079 *AF5FCB54FF6DCC89444C31A05590B6B52371320D 15-berghaenge
1,666,242,080 *AF50275219EB4A73E333DBAE60E8E5393E08D9D4 TELEGRAFSSEMOS1
1,666,242,081 *AF5FD9B3776C6413BBC7059EA6EFDBBE5887F829 VICEFREE
1,666,242,082 *AF5598C6D2E9D57A7F1BE1F27D6505B81C5AC3CA TELEGRAFSSEMOS1
1,666,242,083 *AF5A0D691DD028FB6600AA31EDB84B6B94ABE254 TEMPESTATO1234
1,666,242,084 *AF524761C93DF986A79D588F40EE4BE883D1DC7D [email protected]
1,666,242,085 *AF5DECF83F81971498CEF3C37EE0209FC52844F1 victoriacuplogo
1,666,242,086 *AF5603E696857D1A20C830EA60650418EB25E97C TEOLLISUUSYRITYKSEN5
1,666,242,087 *AF5A6F76E898EE2285F401D323979B441ACDD74B 16.stecher
1,666,242,088 *AF5F46AD624907930BAAB7A1F32CD36A23293AF2 190-TEOSTEN
1,666,242,089 *AF549CEE8790A72B5A424BE0880A99EF7A405A67 vishal-joishy
1,666,242,090 *AF57800E7811EDB703D2E125DFDA6770B951002C THE-ASCENDING-ARC
1,666,242,091 *AF5ACA202AE4AE41347A356796752EA4D045D6FC VITOHELLYER
1,666,242,092 *AF523349FE6AE1C12552B917F5790052792DC6F0 1 APMANNSWEG
1,666,242,093 *AF5F65668AE277B987305DE2424B1F00E29A794B THE.CAPTIVES
1,666,242,094 *AF53D1F3BF947E53A4A2F009E999ABB9BCD990A4 the.geist.cycles
1,666,242,095 *AF51EA7FB7C627FB67DB703E469A16F260BF99D0 [email protected]$OCON$7RC7ON
1,666,242,096 *AF576D733A98F67180057AB8CA0426B732204A97 1DEBT-BUYBACK
1,666,242,097 *AF5AC5CBE80BE76612D73D7C98A19B0CFA7E91CF 1EX-FORMATION
1,666,242,098 *AF59A94A4D4CBC8413D918EE2AD36315C022A8FA W329657256
1,666,242,099 *AF56F4A9A8C0B91C088F1F5B6E7797326A96AD8F 1-HUIVITTAA
1,666,242,100 *AF5FB79382EFED928FBD8C262399F23CA618AE62 [email protected]
1,666,242,101 *AF596B3746EAD14718C6026B12FC2225917EFF85 1-IHMISSILM
1,666,242,102 *AF559996880956236638754972574D72D8C35479 WALKENHORST7
1,666,242,103 *AF5289C40C8F2B2F5967DB5E4E8061ACCD158CA0 walkerbriski
1,666,242,104 *AF587E4D5A5E09953CEF39221115AD83FD22B068 [email protected]
1,666,242,105 *AF5A63C7E99EE4B17C1C4F0162206FE7053118AD 1 LONG-SUBMERGED
1,666,242,106 *AF556F8A1604C032FE32E6560767199831D0312B T}M
1,666,242,107 *AF5044436745D935E7BFE6F7D0A5034442A355B9 TNIRPDNE
1,666,242,108 *AF56B8E9E4932061251742890E6DEEBE8DA4E840 TINAMERRITT
1,666,242,109 *AF5557D601F76EDAD4DABFE64B2885059CBAFB78 WARIS.SAMI
1,666,242,110 *AF51343A1E44A937C2AB1B086CB2136F206B65E0 toccate
1,666,242,111 *AF52D2C9A1699172641C6C208E47BB332FF712C7 WARRENAGUILING
1,666,242,112 *AF5A35B13338AED9A0C2A566AC18088D2D0994A5 todellisuustie
1,666,242,113 *AF5CF189F88FCE9FE17B6D5BE346E6527E0E747A TNIRPDNE
1,666,242,114 *AF5E69204277973DAD337EA62243FB63985A7F90 WENDELL EHONG
1,666,242,115 *AF5BAA2885C353D243DA4C89FF4E56848B9A4C50 wendybacker
1,666,242,116 *AF5E1F81E7500EA69886E72796911AF85B610D37 1.SEEDSMAN
1,666,242,117 *AF5959DCC09ECF85A76577F9CB596BB43C26070C TRD2
1,666,242,118 *AF51757C92E4D483BC7AB25BB02E629A518754DE wHiTeHoUsEGoV
1,666,242,119 *AF5CFC768B32B4847BF5F5235EFFFA95B504DFD1 TRENTONSTFLEUR
1,666,242,120 *AF562EED2C092FCC7357DD23EC78FD205B48063E trentonstierle
1,666,242,121 *AF5F4E9D4A7C920701EB1A0E71B4A7948982CB3E TRENTONSTFLEUR
1,666,242,122 *AF5A6528A5629E43772CB4B32A4CDA4B23592E6B TREYZEIGER
1,666,242,123 *AF53ED6C539C9D03A21801DA42AA4D3232754EA9 TRIFOVEO2
1,666,242,124 *AF53A38E4CF305FB3B731729FF4E3BF9F16682DD willardlilly
1,666,242,125 *AF51CD06578B74C58801ABFA83A42F2DC79E1103 williamcovolesky
1,666,242,126 *AF502934080D6EB06B917A7AEF74057293F03B4A TRISHALASHAE
1,666,242,127 *AF5455D8581224EAEA830F22E6C4513935BE6ED0 tte
1,666,242,128 *AF5083D6968DD12A552B216E1726105DA19531CB TSUBURAYA-EIJI
1,666,242,129 *AF5641F99A1E8DCB9D927641B6CA8EDB25BE1439 TTTCTTAGTTTGCCTGAAACACAATGAGTTAGAGTAATGGCGATAGATTTCTTAGCAATT
1,666,242,130 *AF5A32CDDC6493BDF49169776BE6F464E2A07635 tuckerp
1,666,242,131 *AF5FE72D1F3758AF71F287108F67881C80963DFA [email protected]
1,666,242,132 *AF5BCFDBE99DAA5E123C437A0B5AEACAB11C64CF twalebtakun
1,666,242,133 *AF5D34635280C8C33DD5F26504EC5D87FA02A005 TYLERPIEKARSKI
1,666,242,134 *AF5662E8E04BB4B9F28EF04D9AA6E8670ACC5FE7 WORLDWIDEBRANDSCOM
1,666,242,135 *AF592F7019266E5387E86FE41D886C1BE7A6D6E5 WORUNTER?
1,666,242,136 *AF511910143127B3B36EA374B07A9D2685B7973D WUKE123
1,666,242,137 *AF57DD7349EFDFA8D38868679841D3A1B9102D88 UDSKRIVNINGEN
1,666,242,138 *AF504A82C16B926902B507E6E48D8E5CDA8DC3CE UDSKRIVNINGEN
1,666,242,139 *AF5D6B0628C3DA44AB0BCE935B3987CE5B3C9C79 UGLEDANJED
1,666,242,140 *AF54F5BFAD540126034A1CD6C177B8A8BBD33D79 24ARGLOSIGKEIT
1,666,242,141 *AF5F3ED27FF0F5A05B118D0F339EEF79E0E0B328 27FB9C
1,666,242,142 *AF52BA5E464E729C914F5E605F2F074F14C63B7E UNBALLOINMASCHERA:ACTI,INVOCAZIONE"ZITTIL'INCANTONOND
1,666,242,143 *AF5B7C1E3605CA4E4465F1FD2931E851E64F67C9 UNCLIFIES4
1,666,242,144 *AF5FD13FB484C4787CD5F07EF8030C0D55C2817A 2BAEHR
1,666,242,145 *AF52002635AA7D00227A7B6CE0BF28B85B66E123 2.ellena
1,666,242,146 *AF5FFAB4787A0AAF3AAD3BFF0E31945B6064CC14 UNREQU17ER
1,666,242,147 *AF5BACDA2387F4391ECC6566DFBBFD976CBEEE2E 2.LUULOSAIRAALLA
1,666,242,148 *AF57CC4450B805C9D16B3A079DEB526887CA2B33 [email protected]
1,666,242,149 *AF5DD43E822B07FC5BB42B568872B206EAD82B99 2.SEQUENCEAND
1,666,242,150 *AF56463CB7064D01FBA7DF5B23A955A7B2EB0FD3 USSELTJE5
1,666,242,151 *AF5AF9E0A80DBC3B03EA03BB1CA4406C7947D451 UWE.MAIER
1,666,242,152 *AF5EE38CEA0F561BC18B0ED81C827BB97FCAC20F UWONGKERD
1,666,242,153 *AF5BC182D45FED5B284CF44BC2DF4A5069E430B7 YASMIN-STUART
1,666,242,154 *AF5C09A77EC5DCC57EEA523E03DEDBDB5608AB35 VANESSALOURIA
1,666,242,155 *AF5DB7726312B5CA37E7E36429AD378E51E5372F VANESSALOURIA
1,666,242,156 *AF50499C0FE5EA0AF302D85A594FA3C2E63DB74B VANESSA VOLTARELLI
1,666,242,157 *AF56B18FC660060F524F710189A4EC2373C1F682 VANHELLIGENDESES
1,666,242,158 *AF5C21D222605B418FB0662E4B65042923D5A05B VANWAVEREN2
1,666,242,159 *AF57917D6CE2A1922DA45867E3C9B35B0EDC973B YENTROLIZO
1,666,242,160 *AF5DBB4183EBB5BC5A861E8F1E9A3182F8D53EEB [email protected]~0~OSPLAT!
1,666,242,161 *AF5521F06852E2DE6919A8DF4CCA9CAD3CE0B0EC 378shea
1,666,242,162 *AF5473B7BC81456A8B418E0F399F78A6D1261AB3 VERZEKAARS
1,666,242,163 *AF5A256A6CBD92E4A02C6CD2FA50A201F3CC4554 VER」瑞樹キャラソン <第1、2話挿入歌>
1,666,242,164 *AF59F9ADFF38E86058116EA2EEB322A72EAA6893 VICKIBROERSMA
1,666,242,165 *AF5C176752B716C2CC1B55FDCA9BE2CAD341529F ysmaelzagado
1,666,242,166 *AF504B2BCF56DB110FD4F06F5FAFF1F2FE3F1328 3KOSSLYN
1,666,242,167 *AF5529EF336344DFB72609730A4237C5ACB6A244 vidachavez
1,666,242,168 *AF51D33894B201B95344C8B76E07FCD167E1B16C YVONNERASNICK
1,666,242,169 *AF5E383551003888A8231CF28584E4BDCB583DDB />Z0MGZZ
1,666,242,170 *AF594D239F927040A4E0EF730CEDD116D4EEB672 Z33ZOWST34U4
1,666,242,171 *AF55E646ECEB88F75540CDE453653F4FD94F1816 3==P~0-~O-SPLAT!
1,666,242,172 *AF5F41DA42CFF5E0C676195D128995D2A317318E vjaq
1,666,242,173 *AF5A9BB213425C04BF0D15B548CE8810896B0A8C 3XISVGY
1,666,242,174 *AF5AD99A3C7D69A12130DE769230F134B9434B03 zakljuciti8
1,666,242,175 *AF53D59B23E3B99DA381900E5BD64027011CC75E VLBJRGHDN
1,666,242,176 *AF54A168951EB49D4B0B01B6EAD080F52D592B36 vqzakgdzobvzt-ifm
1,666,242,177 *AF5A819976A7EBA4F4F249244B29731AC66C38A9 4DAYTOOH
1,666,242,178 *AF51F4A8AFB314A66A8769165641EB01462C40D5 4ETNERRAAJ
1,666,242,179 *AF5D3FB11038CDEBDB87965184DDD1A54FC36802 WALTON.BRACEWELL
1,666,242,180 *AF537056EA47F151FAFA55339981ABBBD9833426 znijuna
1,666,242,181 *AF5AC3ABAE2DEEAB44EEA857FE52EE921679CB8D 4MISSBRAUCHER
1,666,242,182 *AF5C25A0FA20C9D7F1D9C0A05688688D2E622395 wardthurstonson
1,666,242,183 *AF5F1FDD946993C6BA37EBB007BB430E9AB472D1 wardthurstonson
1,666,242,184 *AF5A30A45DE81DA31FFBDFFD7189693F5D61AD29 4-PRELUDES,-OP-33-NO-1-IN-E-MAJOR
1,666,242,185 *AF58101138578F2E039A99130D271F73054984B5 4QUINNSKILLINGS
1,666,242,186 *AF56548203B10D890ADA2C5C8539DFE3F77DBB20 [email protected]
1,666,242,187 *AF5C0DB4BFB659F4E989550F4B17D0C31F1B0DBA [email protected]
1,666,242,188 *AF5237B1513A378EB5D4154367AFDB7754B29914 WATERMILLSTALKMISSIS
1,666,242,189 *AF5605B2754801A8E1DE981069364B69BC8D88D5 WELDON.RUHLE
1,666,242,190 *AF55564AD3C248CC01FE9BEDE5597C85B5BCC2D6 WELDON.SLAVIN
1,666,242,191 *AF50A4AA8E8B47C482255129A581A854F722B138 51benedikt
1,666,242,192 *AF52F98D35FDA54E5AE23EAE85C36A4804A1B2D4 WES HAMMONS
1,666,242,193 *AF5D62C36C5B7122C04993C7C58578A5607981B0 westonfriederich
1,666,242,194 *AF5054812E11CB01060D5718C7E28670F7B57146 WESTONMERKLING
1,666,242,195 *AF5A355D3B42E63E9D010F73949157555BB08260 5ACURAMISHKA
1,666,242,196 *AF5FECD37CE52C792E9FF7C64F12FA4BF16670E4 wildbahn8
1,666,242,197 *AF538772237B1B11988CBF2B4D183C4CC9E2E90F WILLARD.PHILBERT
1,666,242,198 *AF55955A764DD9FDBB36287E6F45029C5F40D046 willystiefel
1,666,242,199 *AF57712EC91DA687E82486808E6DC7E2989B17B3 WINFRED.PATEN
1,666,242,200 *AF52562625D7840F6B9AEE9E174FD6262B34AFB7 woenmoelwm
1,666,242,201 *AF5B7EFA5F3CB6581DF04EA89990C766BA57F3FF woodrowcarner
1,666,242,202 *AF563A9EA687A82D1C9A27473887E0590DEF6AC2 WUSONGBIAO
1,666,242,203 *AF52CCEE5FED58EACB2A0F599457B1B2A6611553 wwwzhangzhoulilliputcom
1,666,242,204 *AF58053DCC8DEF92D7670EE2D60D1B509A98B2B8 [email protected]
1,666,242,205 *AF5AF1F9DDEC9E91C96985999D6904A57AF505CA [email protected]
1,666,242,206 *AF5D03A9C723AC8ABA4C04A10A1F9F7A99F6080F [email protected]
1,666,242,207 *AF55C0D52DD94F704F417EAE3DACC4C6986A8A38 yapyuli
1,666,242,208 *AF54A41913C012FC9847552076DDE6B7E8C4E2E4 YASMIN.SABAN
1,666,242,209 *AF5C73AA2A4335678E814CAD8B67E6CA4930D3B4 YEARNIEYNBENHEYLYN
1,666,242,210 *AF50F918C81237D599AEDE17B413E2706FBD331E Y:I8
1,666,242,211 *AF57482ED53E4D23579E4FF901C68E2EDCA485BA [email protected]
1,666,242,212 *AF560BBD6076063BCC65C363ED90B58B3FA157A8 YLRAEDRE7
1,666,242,213 *AF506CF3255E28CA89A35577CFB0919E0ACC69E1 Y=)N
1,666,242,214 *AF57606CEC24C872703061B7138E31C6324E5A96 YOUNGDUCKS01
1,666,242,215 *AF502E27D8AD7C7D7CE2B10683CF289BDDF14016 YOUSEFSHAHIN
1,666,242,216 *AF59CF7E644CD6A6D959DB270BA0C738510E67DF YOUSRY.SAFAN
1,666,242,217 *AF533BA71A7E9439AE903609A830DCD14BF6BAB2 [email protected]
1,666,242,218 *AF5B595E7F5BB1BC9D802FE257AD3119436DB109 7BSWEGOAMBSW
1,666,242,219 *AF505C8129B839710611A97377753839A350E03A yuhainisapar
1,666,242,220 *AF56A5619EA1FBEE9C3B16F8FD65524F4770AAC6 [email protected]
1,666,242,221 *AF56794BAF44AEB95D8C1643E224EEE112E70C42 zacharyniedbala
1,666,242,222 *AF5F20C45C4B71742C409D718EF17DA5C344FF94 zac-marion
1,666,242,223 *AF5E362723BF8B942319FD7C1DACE8CD1786AC6E zac-marion
1,666,242,224 *AF57C4D308F0C8B596D419D376694F4E40E2DDD2 ZADUMIENIEM
1,666,242,225 *AF51772B91694BBC5F66E88E32EB161BFFE40490 02151021
1,666,242,226 *AF58F08F67EFA1A07BF6F1AC1222C5F0DC50CBBD ZANELDRICH
1,666,242,227 *AF57DF9E2B63742EF3D9E1C2886EBF49A47EB485 zanyarfaqi
1,666,242,228 *AF584326F9A1C987F2AA0388442BE42D6B6EE6A9 ZARA-ALISTRA
1,666,242,229 *AF52AD49E301715D52C36B343C6577390311EBC3 ZARA-ALISTRA
1,666,242,230 *AF54E51CA7BE80ABEEC7ED646DF3A4A9938AEF64 ZAWANIMDNAWI
1,666,242,231 *AF5AB1EBEEC65E2BD0F7CB11FA1677EC75C802C5 ZAWANIMDNAWI
1,666,242,232 *AF50F3947241F8AA1833FF139AFDB3F9CA892911 [email protected]
1,666,242,233 *AF56CA7DA56FABE423302DCDF9AA4C5E62C1F312 [email protected]
1,666,242,234 *AF5A63A4DB198B072F2C4B05223DDD85E66C746E [email protected]
1,666,242,235 *AF53E69B2C9A5C8184A9BE62C4DE5CDE4C59B35B [email protected]
1,666,242,236 *AF5B4F4065A2781854A1E0711530115D7AE4ABFB [email protected]
1,666,242,237 *AF53680A4F273952870BCDD8AC3357C4EA4F24D2 7themarina9
1,666,242,238 *AF562C5C4D324603B6034700D646478DFBD40FA7 zvf|
1,666,242,239 *AF59C0F1A5748C9E83A952E424D25081A060E1AE [email protected]
1,666,242,240 *AF5BAA6B5359079971EEF65C075D1BD254B7E68C [email protected]
1,666,242,241 *AF588F51BD3CDDB55268EEA4677B373FAA7F9C3E афонасей
1,666,242,242 *AF5FC15136AFE742D15687B61B65C71ED6708C03 БАТАЛЬЯ
1,666,242,243 *AF5F1173DCB4A92ABFC9207BEC7BC651639A7315 БАТАЛЬЯ
1,666,242,244 *AF592545D0CF616F86239C18B7E08A73447CCAFC ГЕНАДІЙ
1,666,242,245 *AF5C2D7DEA13AD0CC196F4D200810AF934F0441A задзимирские
1,666,242,246 *AF59B66331565CCEB4C12070C7A085AB89B229D7 КРУШАТА-НЕ-ПАДА-ПО-ДАЛЕЧ-ОТ-ДЪРВОТО
1,666,242,247 *AF5EFE948DB9FB66723CF6AE8E033FFF112E65E3 ЛИЧНЫ
1,666,242,248 *AF5896DEE54ACAB391DBFAB2292EE6287EE7B022 1194214 soundillisestipakettitokioliyhten
1,666,242,249 *AF56CFCFA99DC52EC7F52E997E28D5457792B196 8KNITIIRP
1,666,242,250 *AF540C39A11A275800DD9A86D996DA00A3244934 12: 12 # & CAJOLE
1,666,242,251 *AF5E2AA5521936C72B1673FF288DB02E08372D72 8MAVERICSCHOOL
1,666,242,252 *AF5C9D71201AAB3F30074E56A7BA137EAE8A7F68 яезаре
1,666,242,253 *AF576BCFA0650680A44FC35EFD20749519E4A840 8######@*.*.*.splat!!
1,666,242,254 *AF5C860C666B3606629123995D6E659A03C2370D [email protected]`~-SPLAT!!
1,666,242,255 *AF5C5FB4AB8A6E3D8D1C0F6A6A02610CD5D276DC 1784112 ASIA KOSKEE TESTAMENTTIVAROISTA MAKSETTAVIA PALKKOJA
1,666,242,256 *AF540377E7A7F8A99AAC7BCFB505E9E987155EC1 1875211 dem tagesspiegel liegt das papier vor
1,666,242,257 *AF51753CA251D457B84BC2E4F92599EE090FB171 18.kolmessakymmeness
1,666,242,258 *AF5B6BFFA3D82A476879FE96D0F0E0F27242F6E0 950426 wer.sind.die.".eingeborenen.".italiens.?
1,666,242,259 *AF512B9C9E07007307163532F393925EC3DC8304 1945400 MUTTA-ME-RAKASTAMME-VAIN-JUMALAA-
1,666,242,260 *AF55409F61DB3A33CE816710FA4353880E38B4AC 972881A
1,666,242,261 *AF52C24DF5B8611232CF6991D6C59B236650A2DD 9ENTACHERENTS
1,666,242,262 *AF537D8D636161FFDFC25D798EAA6C708C3506A4 9FITHEJAI
1,666,242,263 *AF56D7B47840465FD0348DD1DEDFCBF230E166BF [email protected]
1,666,242,264 *AF558C02C95289CF12CC49C46876054AE3C1FF02 9HERMANTI
1,666,242,265 *AF5639A4AD31D63A90F0C9E0D283D8566345AB90 1EHDOTTU
1,666,242,266 *AF57C6E75D7B7881DC8BE280FB1E771E46597B9F 9INTELIGENCEINTELLIGENCE
1,666,242,267 *AF598262A983E5F6F0874EA41A6B13F297C9C91E 9INVERJAGEN
1,666,242,268 *AF5707593EBC0FA821F58A0EA5664408BF2F9B5B 9NODAENSIS
1,666,242,269 *AF508454C0868C9FD9FE44CF12848B1998BE13C0 1-JUBILAEUMSFESTE
1,666,242,270 *AF5B2EE75FEEFAD4378DEBC2484063994BB7AD20 9sminuzzi
1,666,242,271 *AF57BA1A46544D30AF7A2E1AA00F4CE73B04AEB3 9thatcougars9
1,666,242,272 *AF51F030861F96D911617493AB22646BAFBAA1A5 1OLUOVUTTAA
1,666,242,273 *AF5CCBF96E114D2CC94A836756E72BA59779EA28 @)
1,666,242,274 *AF5E67B475D02ECECC36AB7409B95E5366CACF9B 9.VIINALLE
1,666,242,275 *AF57CAADFC851226ADD8ACF03E5BCAC081D98FB6 9VRSPRNKL
1,666,242,276 *AF5131AE08B61566FA5C2F835625178CDBDFB78B 1raipoilla
1,666,242,277 *AF593CCCEB62D17D134ADE87BE3372698B9D0B5F a0mg.
1,666,242,278 *AF574D3BF19C2B648CC9A3AF6B81826E9ACEFA53 a1io9
1,666,242,279 *AF51B97ED5EE11CCA2C4937C9B916C07AC410A65 1SPERNOYN
1,666,242,280 *AF551906F99D699C18AF520DDE90BD1400A0E3C1 1.staufer
1,666,242,281 *AF523C81BEAAC575B64504D3C446268034796887 1SWEMYLE
1,666,242,282 *AF5BD26614753BD28F514BA827C41A5973E647C3 a"=4g
1,666,242,283 *AF5DD4586285A3F463B43891D8A0A0F801F430CB 01deandre
1,666,242,284 *AF5F4CA282B3A64DBE2546F9E557EBE0F9D139F4 1.varaaktuaarin
1,666,242,285 *AF51FFD338B15A616D9346DFCE8A968187E500FE 1 YKSIL
1,666,242,286 *AF5542EE53A0B8537E366DA66D69C817DD0B2FB0 aaal&
1,666,242,287 *AF54945AB67514C22ADEEE6BFAD48D0FDF8B5FD2 aabhyantaram
1,666,242,288 *AF53CE0DA5C1374DB310A61C19A92DC199EAFCDD 0heidi4
1,666,242,289 *AF55B36E078285EA294B75BA4B123C44A241EDCE 10PRS
1,666,242,290 *AF57F5666E8F5BCD4FCD16F15111BB932FFE60FF )0(O~ D#####B
1,666,242,291 *AF5ECE4395E2A3E304EB4A12ABB16E4A373AA2D0 110627 ilmoittautumiset-10.10-.-menness
1,666,242,292 *AF59836035808483531C528EABA3B2B1FC5DD0D2 11-10-1021
1,666,242,293 *AF598A54A685AE0C0F032DC160F7566A0DDE5D6A 10-05-1552
1,666,242,294 *AF511BD9207221AB794C09CD919B54B3F01E05B6 aac?vh
1,666,242,295 *AF562C602478728DC55FA22B9565A6ACCB5256C3 1066572 THESTRIKE'SCOSTSAREMOUNTINGQUICKLY.
1,666,242,296 *AF53E3AF7796E851FEBC85B20DA620DD64C49776 1092725 on-pidett
1,666,242,297 *AF593DD36012CD5F0CC42BA68276A748C5286663 aangrijpende7
1,666,242,298 *AF5B08BDE3EF82B7F6E86FA89A8841774064A81E 2854781 WC:TJASUIHKUTILATOVATYHTEISISS
1,666,242,299 *AF5E35F1ED6D02765221F254F6EEFD601CE92C90 1-2-TIE-MY-SHOE
1,666,242,300 *AF571311D8E26218891244152B2E2D98136FBDB5 2AGALLIVI
1,666,242,301 *AF534989127F2C7D7FA412FA54FDE51A71624791 2ALLONGEANT
1,666,242,302 *AF5E314D02146EA3207EE4D60A6C83424F84320B 12AINE
1,666,242,303 *AF5AF3BB7BB8B6AB4870CE150813019E40B39A89 12april1155
1,666,242,304 *AF5AA130EAC004711DE79B3261C7D07BE197F59D ABEL.LEISE
1,666,242,305 *AF5DDEE316CA04DE75F1B7D4EDB3096DF2458EA5 ableistu2
1,666,242,306 *AF59F80045F7E3D04D874FECED77240DFE74F3F6 14TUNNISTAMISTA
1,666,242,307 *AF579F0393F7CE445A31340BFCBB1BE159233A1E A,BQ
1,666,242,308 *AF5295CC54E614232C13AB62724C874BC8D48243 ABS?D
1,666,242,309 *AF5A5E10978D8348D879A55FAD4A3072908592E1 14.swindon-tranmere
1,666,242,310 *AF533F0A4B49F384E56A50779DBBD704560A20A8 15121766
1,666,242,311 *AF5FF1E18A90FCB5D686C60C4B61E60E439E8AEB ACI(-
1,666,242,312 *AF5B85904186D3BA53A8B6E5AF6BCA2C8CD5D950 15DEFEBRERODEL1988
1,666,242,313 *AF5141D9F85CDEEAB2CC812DEB65DBB16FF91208 AC!Y1
1,666,242,314 *AF5FF41DF6C8AC860A5B8A1A234E34B1CAE5B0D8 adatihs6
1,666,242,315 *AF53131102F66273D58276604B9DF6BAADA5BCF7 1 ASTAMESSUT
1,666,242,316 *AF5CCCFF1ED4B95809CE8875B08E0B7AF41C89B8 30may1307
1,666,242,317 *AF596789AFDA9CAE58B99BCADA55AE2019EA4246 341.RUECKLAEUFIG
1,666,242,318 *AF594094746B991295E591A774E6F6B8ED129F5C 359onni
1,666,242,319 *AF5661464D69777E453627E33C3B27F09B1B333B 36jaslene
1,666,242,320 *AF5905A5385A48EA48DD01799654F71B3DA88ECA 1966—1980 ГГ
1,666,242,321 *AF56AB2DC7B82AEB8A0A8B4456438143C87E4D31 3B<[email protected]======P
1,666,242,322 *AF53B9A05FE4EEDD09409B8CC4EBE59FED471B7A 1-csio-platz
1,666,242,323 *AF5F80A2DFBAB6CCFF9D6D4BDBBCC4B37392C279 1-designer-amphetaminen
1,666,242,324 *AF50FFD43E736FE5ACD781EB8B28FE4F6220C1D0 1.DIYICEM
1,666,242,325 *AF52CA35699DF3E0306FF27A63FD40A0087D66CC ADNEKRUC8
1,666,242,326 *AF50B04649E966FF05C6C7AE9E18BB169C4F0279 ADNGA
1,666,242,327 *AF584D6E4D9D8BA84CF53D07B39AA896742651D5 adqcb
1,666,242,328 *AF5B56AE7EA5F9673F6F63576855DB2747B92669 3-----d*-*-splat!
1,666,242,329 *AF53EA56479A84044C66677D51B990DF19599F2A 1 circleand
1,666,242,330 *AF58252F52A47630791A4DA8B7DE3138F3264FBE 3#####)~o~o}8{
1,666,242,331 *AF50125091A3C63AD5A644F78B6A5CA6F52AD819 3=P~O-)0(
1,666,242,332 *AF5DDB01DAF43B3290912A0FDE219C5A4C98A273 afficche7
1,666,242,333 *AF5A2DC93D4DC7270936CB2114682A14473A0089 1-EIERSTOCKENTZUENDUNG
1,666,242,334 *AF59894BE78A2FCCFD12B90C32E0D4D35EAAB1E8 AFMOORDD1
1,666,242,335 *AF57430A15DEFFFF5A359C713875FA5FBF5F2D89 3thevolley2
1,666,242,336 *AF51EEBABB6CCC0D6E303B701A3627331F1623F8 1FIACCASTE
1,666,242,337 *AF58708514D13F22A199BEE9930C350F9188C04D 423403 ABER-WIRKLICH-ANSEHEN-KANN-MAN-ES-IHR-NICHT-.
1,666,242,338 *AF519CEF353D93C821A2B5E28701E3CC1F7D9F42 agenerallego
1,666,242,339 *AF5D98382B82218AA77D5DE19873E28C0657CB30 1-nagele's
1,666,242,340 *AF543F24D98F802618FEAB8EE108C583B9DA4B8B 1HYDECIAN
1,666,242,341 *AF53B574AE2A100163AFB6D32F87E829CD48BD38 1NIRAJAN
1,666,242,342 *AF5A143581E86FCC35333C6D7B8E3B1AEB470353 1.NOTERLIGINCE
1,666,242,343 *AF56C1E561728E0AF12A5A4645D03A07C19BC45D 4ALZADERO
1,666,242,344 *AF5435CB5A257B04748FA43C677B26F8931EAC2D AGZNN
1,666,242,345 *AF54433B112DADEFA3DBDB2E2FC25120F7046309 AHD88
1,666,242,346 *AF5C1B3C57588291F05CCC039023D8C66589D1F6 A)HUC
1,666,242,347 *AF528F7D4A2D38930E1326651F11B252B460B4C9 aicitcat0
1,666,242,348 *AF55BB21B266360A6D6171AB51703E145E90DB06 1.RUECKENMUSTER
1,666,242,349 *AF58048D254D47AA913BD954FC0C903726AC2CDE 1launchdecision
1,666,242,350 *AF57789ACD0E764F6AE0651717946968FAFAB32F 1 schockverarbeitung
1,666,242,351 *AF5DE232A70DA54176E7A459A46C006EBCC3F22C 1 SENGAT
1,666,242,352 *AF552CAFE259052D5EEE13E36607D7820DEE059A 1 materiaalimerkint
1,666,242,353 *AF50466552FB28A54BB16414E885565EE2252EF2 1-musiikkimaalaus
1,666,242,354 *AF59B1D1F93FED1CAC2BFB94114EA104743DEE58 AJJO;
1,666,242,355 *AF5E3D8D8A70C774CD346CF79CB3644C8B8BC4F4 1-SURDURMUSTUR
1,666,242,356 *AF5B02D9D82E7E3EC88779655E82779B67140164 AK8o
1,666,242,357 *AF58324EA8726874527F084796B3D8E7518BDEE9 1 ORKESTERIHARJOITUKSISSA
1,666,242,358 *AF59B6BB930499BD65AAC34EE7D5AABBC6420382 4RECUEILLERIEZS
1,666,242,359 *AF541981FFB2958C5FC355B7EA95BCCC5A7E6681 AKOEGISING
1,666,242,360 *AF558FD4319725FACC7A54E7E2DEA3730F404FB5 4sfociato
1,666,242,361 *AF5888690D70C80F207B4A77A67B5C8A482857DF 1pygidid
1,666,242,362 *AF584AD2782C83EF7C1A8D982C535CD1BF1E753E 4UNAUFMERKSAMES
1,666,242,363 *AF5190F975E5448A0E1752ED7232C47B84341E03 1 ZUSATZPLAETZEN
1,666,242,364 *AF50BDC4C7588D31868B8173809A4B5C61C94EAD 1.sadankomitealaisuus
1,666,242,365 *AF5200A3F2055A6D3395C5F0E2A217D1652376F5 [email protected]
1,666,242,366 *AF5CDA9D84FAE57B3BB4C23E9E47B663F9152CE8 ALDEN.HODGDON
1,666,242,367 *AF51891269702212048469D501DC0135684921EE 4ZZURR0
1,666,242,368 *AF539273A601160C425B588E3887B08ABE6CDA96 510993 huolella-entistetyt-lokomobiilit-ovat-kuitenkin-ihan-yht
1,666,242,369 *AF562015441F04A0E0721997F9E5F35DCE938DB4 1-SISALSAECKE
1,666,242,370 *AF5B39C26F138A3981A293AD395577EE357DD731 alejandrogutieres
1,666,242,371 *AF5D56C0267AA599CB3D9D8481F54B666DBB54AA ALFREDO.DUMMETT
1,666,242,372 *AF570C5EB1DB5FC5E24D690BB0B59BC8B6F096E2 5aegipan
1,666,242,373 *AF589CD6C2800C947212F827878A1D407E964D42 1 UZMUYOR
1,666,242,374 *AF5851D4C6A3F0D3A616375BD7A0C59F220078FA allegra.ramey
1,666,242,375 *AF57165B4CEC66218424105FF0A3F9BC0025BA1D 1.VIRKAMIEHILT
1,666,242,376 *AF5FC51C0F06D362D6C9D82EC6338727FF8D48EB 1 YKSIL
1,666,242,377 *AF5DF3C43E3DA53DCB604D10D0D2319717C82154 5elfng
1,666,242,378 *AF52798ADC41B5032E7EAF3797A3957482DE64F9 また、2002年にnu
1,666,242,379 *AF5FCAD714AC701353497A83DBACFA6CF1775192 284303l
1,666,242,380 *AF5B5AC2120994FD682E82004A3E21733E1C4D82 5SIGNIORIESES
1,666,242,381 *AF5CBF53003F8A3B09F9C96C1719513C7AF18C4D ALU
1,666,242,382 *AF5FD499126D1A334F4DF0B0AF882FCEEAFB91A9 am#?d
1,666,242,383 *AF5D3C3EC819F439E8B939B86D6211BC8DACDC18 6+3AAA
1,666,242,384 *AF5C6AF97DA4F4A2310CA9F582B980F61DBEECE9 2FALCKFOLK
1,666,242,385 *AF5918F07ECC2C66D841AF06383251EA1E5D5F24 681368 diemalagutikostet:10595mark
1,666,242,386 *AF5EB2D2BAEFF558809C4B6DB63210A39E839817 AMOS.SARVAS
1,666,242,387 *AF5F30070C6EE588A6FCC9DF28BDBD064B7B6393 684DONOVAN
1,666,242,388 *AF579E224FC89B3C5A6AEE1A60449865638276BA 2.gelaendeinstallation
1,666,242,389 *AF5352B94E57080D0006266F738355876D1AC320 691160 raportissa.k
1,666,242,390 *AF51A934A7179F5E9FB06885047BE2E12AD27419 AMRANALI
1,666,242,391 *AF5C5EE19F5EA52F2F85942BB8F260BEF155D6CE 6BRFZZVLJ
1,666,242,392 *AF5661EF52485E90FD8E87354A625FA4EEA73741 2662783 muilla-palvelualoilla-on-ty
1,666,242,393 *AF5531B7C0EAF50EA0A6AF49C0F1812B00F23872 2/ow
1,666,242,394 *AF564089723433C4B6C0D28AE030A0B881F37412 28488
1,666,242,395 *AF503B2C07EE39C74AA06964DF2D9FD763476864 ANDERSON.VILLEGA
1,666,242,396 *AF560FD3601906DCFAB4703BB3A671A0FB925A70 2TRENCHWI
1,666,242,397 *AF56C2FEAA4931A2244840163D5ACB81E034E288 ANDRES.NIEWIADOMSKI
1,666,242,398 *AF52A5BE148293F370C80E107F9BA55F540270E6 31011740
1,666,242,399 *AF54D413BF6748FF140FEE220541FF152D87FCC4 ANDY.TINCH
1,666,242,400 *AF5105E6C70E45EB36DF9F42D02621EEC531B8DF 6iamjoelle4
1,666,242,401 *AF5C1420E5AB9BDA20B3B0AAC310573DF37E1ED8 2BDRESSED
1,666,242,402 *AF50BACDEF01A0100B284EDC5719A2DA127BB303 anjzo
1,666,242,403 *AF506605141D4B7FB633FA94B4504E1A239296E4 ann-forsyth
1,666,242,404 *AF5259C4887C176A5A4588B09DF0D6A6F1D8ED59 6MOOSERYAN
1,666,242,405 *AF59A65F70C232B0C5C64FC41A253D339937EF3B an(s
1,666,242,406 *AF5D6DCE907B8DB115A2463DE45BE904C3D80120 anv-
1,666,242,407 *AF5B6B6EEFBACD07C71304650CA3FB66F1304EAB 3P~.~.~.SPLAT
1,666,242,408 *AF5DB802A756E6F0EF6073944F7BD88E82B1B6BB 6STEGNUT
1,666,242,409 *AF50920BA078C2A3CC5E5686096BB9BA1694FF09 AO?Y=
1,666,242,410 *AF5F31DB200E63F1B35B781AF16736EB03FFFD8D 6TENASUNOOMELTTILGNOK
1,666,242,411 *AF5EC8EE5EF18D45AA7717C2CA0F1753E785C463 2.oberkrainer-sextett
1,666,242,412 *AF553E57C0F8C5CA2B3F4E76DF4A4E1242509E73 6thubron
1,666,242,413 *AF5500FF78DD49C1334585B2FB645B4D1C59AD8C areilgac
1,666,242,414 *AF5DE6A4943E6F9093428CCD264E028C892F513D 31101764
1,666,242,415 *AF5850D6192855E800159BE4BE86DC67DB753FA2 327605 JOS-RUSI-PALJASTUU-STASIN-YHTEYSHENKIL
1,666,242,416 *AF5468B87707F22B3276AC28F5C6D82D3F591210 766085D003C63B6D6B4AA95C1D39BF90 239133
1,666,242,417 *AF55AF48BDD3FC1624551DD5FC94A1E617263F14 4BLUTRAIN
1,666,242,418 *AF5DC27298BC49F0B009B0D635E5F8B1BCADC98D 770-erziehung
1,666,242,419 *AF552C8850FC3F9393CD461DE3C5062AE947C48D 4CKN0WL3D93M3N+S
1,666,242,420 *AF534B4826811D679F6EA71B9B939D9DD5F967AE 799GRAYSON
1,666,242,421 *AF56660F62624D8F7482C5B8E4E40E5DE397FDC4 3##B**(0-0)
1,666,242,422 *AF531005429C1417537076ED7B4313752267DCF6 4HINDINDYANDHESPINS
1,666,242,423 *AF599A3CF02128659B17E58F0387FC3E58346E0A 7BSWMJUNGBSW
1,666,242,424 *AF585EA2979AF709A92C6634F81C0D922B2BAFB6 3CRUSELLK
1,666,242,425 *AF5FDA7B7B489346FE6D055C85E4AB98933631D5 Arsenium
1,666,242,426 *AF5252E923A9D866AFBF7099E8B3E6ED19D9F291 artificialized
1,666,242,427 *AF5F7A336CCB9E53B6A8289FF086848B1F6D532E 7EDNEKKEWHCAL
1,666,242,428 *AF52C2AAC75C934D3D34701AD6183DC7C8F9788A 7EERGEDNI
1,666,242,429 *AF57E74BFE58C2BA52CDE836DFABF89BD35313B1 3IAMRHONDA
1,666,242,430 *AF5537260ED335A317E66FB0BBCBD49BE2EEBE73 7HRONIN9
1,666,242,431 *AF5340D963A456BEF61178D5A2EF0D78F988A041 4PROLIXITIE
1,666,242,432 *AF51130B6E2FD8F2447F84C4884D5507DD86C17D 3-----)~o-~o(>_0)
1,666,242,433 *AF5CBB868B1A480EA2952828AE599E33CB5F806A ASKO-KER
1,666,242,434 *AF5318DA549CDCA9E61187E05E0670CC10420769 7maarakentamisessa
1,666,242,435 *AF50653A7E3238A31393A230BCBB37FE52E4822E 7MICHELALPINE
1,666,242,436 *AF55FBBAD1B4902BFAEFE9159A6F809F8D99B671 7MURANTS
1,666,242,437 *AF5250B011D4A4E51A565E9A637D117D85045DBF ASP-G
1,666,242,438 *AF55214948F9FBA4FDEBB1C655D2F5686ADEB139 ASSORDASSE!
1,666,242,439 *AF5E5E817EB509E80C311800ABCF86930F9F7DBA 3.VASANKARIN
1,666,242,440 *AF56E93F126C5E3FCC91A215DA46BCA638DAC30C 7SMOKEYTESTER
1,666,242,441 *AF56E19009A6A05B554CDF0640A1DFA94F662081 7STRIDULOUSNESSES
1,666,242,442 *AF501EB4E2F8F7A59112E2B9401C8B6643DFEC36 ATITRES
1,666,242,443 *AF5634F3213F64FFFBD9BE1C3C22D23697372270 7thesteven2
1,666,242,444 *AF55B363781FB9A3671B0E55AD1F148587636263 838ALFRED
1,666,242,445 *AF590F7338E29D4592F78B1FAE0BF3A15127CC61 4ENDEUILLANT
1,666,242,446 *AF573960B649B9B07544235C3A06CD50B7275581 4HELLRASER
1,666,242,447 *AF5029875951513CCC962345178C2B22BA77EFFD 8AMELIEOLIVER
1,666,242,448 *AF59C5BD32AD83CC32FB86024A8D36C565CC7016 5BATTLESHIPSES
1,666,242,449 *AF5CB6A9AA09E4C7FCF2F8BDDC69BFF58AAFC0D4 4IUKISUM
1,666,242,450 *AF56C6C1E82BBF0593AF25DFE7AB8A75A53918C9 avithoning
1,666,242,451 *AF55698F699355C6ECC0A302D5C3F5AACC4B1599 8-----B.~Osplat!!
1,666,242,452 *AF542E277C992526576F493DF6104EDD3FE7EEBF 8#B* SPLAT
1,666,242,453 *AF5146AAE8891464FF93F8F0827C460D7A987CF6 a-wcp
1,666,242,454 *AF587228102AB19C0594E0B2A9C6AD410C9E1D8E 4MOZARTCOMPAQ
1,666,242,455 *AF5C99E304748DA01FAC827F224A5D7788BA35F5 5EPTAVE
1,666,242,456 *AF5C8967842A5751B1E9542BB2B498174C247F6C 5IAMGARLIC2
1,666,242,457 *AF5EFADD66120A9977C4C493BCC2DD41BA3CE805 5IESLINGI
1,666,242,458 *AF564B0CF755CD3D835C7376495CFF3299BD81E3 5INFLATIONARE
1,666,242,459 *AF5824021A444EA6424BB17C47EDD04560E4C790 4REVIDIRANJOM
1,666,242,460 *AF5D234B54AC8BE50360FB42358ECAB92D7AF49F 5LINEDANSERE
1,666,242,461 *AF5AA86EFCC80EFA0DD30CBC635FF9579B676794 4TAURIFORMIS
1,666,242,462 *AF51EC91D9DB90D8DE14DB184E86EA6E694E3609 8LIASYATS
1,666,242,463 *AF55452FA3AC543B5B8855461E74C610822766C4 8:-Lux-aeterna
1,666,242,464 *AF559A324895E9526AC5FD2854B5F67042E55297 4TOMR34KT
1,666,242,465 *AF57BE7E289D239D2F566B327E0FECC43E9E2949 [email protected] * *)O(
1,666,242,466 *AF54E42D72092F91C8C62BA51CC1F3F638C46063 4ZAINTERESIRANI
1,666,242,467 *AF5AA33E5820EC4C5CE703E8B0724CAE22FDE02F 51.MINCING
1,666,242,468 *AF5F5C7673BAA0BFA516B8C2B810EA6D197AA9FA 530569 ICH-FASSE-ES-MANCHMAL-NICHT-
1,666,242,469 *AF57F432FA709BEA33DF289DA2ABEB753194BD87 565938 TAZESUURUNLERININPAKETLENMESIVETASINMASI
1,666,242,470 *AF56C87F0BB05ED754F421421B7642679DF35DE1 AXGYQ
1,666,242,471 *AF590F0648DDDEC84DF36D5F1003FEB4135E4684 8THEHOTTIE3
1,666,242,472 *AF579EF569C11986EEEAD0C12E643417495D05E3 699479 SEKUTSUUSEK
1,666,242,473 *AF590B862D2AAF273067528515C6C3D79CECE1F4 5elec7ee
1,666,242,474 *AF51F2EFB29A80F79CBCA47DDF7A095E37BF8C96 5ETTEREHTAEL
1,666,242,475 *AF5DD092C67D115C48EC8626EDEEDF390F017FFC B&=3B
1,666,242,476 *AF56278447CD220EFC26DBC43A20E614959F6E28 9B05E1DA153FE13BBC4F51DFB066838A659EDE
1,666,242,477 *AF514EA39B7C174F711E066B0AE1237728E06BD9 9BIGFOOTCENTER
1,666,242,478 *AF5B212394E723FB375EC9AB7C140A5BDD3C8F3E 9BRIQUETTE
1,666,242,479 *AF5EE0025E13075F7C1BEC8D66701A99031636E8 5IRENECLOVER
1,666,242,480 *AF5D4D7099AA4870F84366B0760A341A562FB23F 9ECTOPARASITES
1,666,242,481 *AF5DF1C9231FBD5EEF7CB9E8089953394B128765 b83kz
1,666,242,482 *AF520B0EA79FB60BF059D5BC5786E005E8BD1944 6ilovepenny8
1,666,242,483 *AF55875FD911267F4E0E0DEF5314BB18F67BB565 Badbroes
1,666,242,484 *AF51E3E56D0CD1A8B79B8604A63ECDEA3614E316 6LTWELLFORMED
1,666,242,485 *AF56D9A1967030DC589254C6E8369AFB60882A88 5nonconfiscable
1,666,242,486 *AF5618800A304D3E51E23E93FEC486C5DC21347F 5POVOARA
1,666,242,487 *AF545A37629859B696E15A4AEE54F30168138E70 BANK.M0LD
1,666,242,488 *AF54744D8124CE95C3891F4AD5F01861F3B6131C 6PLUKTEPLUKTE
1,666,242,489 *AF5686132F9FC0AAC0F1A138F5F5DC6445ED4A42 barbaradimaio
1,666,242,490 *AF5902D8789F8B1EDBFE119B15D01D91675F4F2E 6SETFASTFINDWO
1,666,242,491 *AF52A219333EE7151AF51269E33E2EDB4CEDB266 BARROSOALFIO
1,666,242,492 *AF5FB2B29B82B2E6F7B49F835C3BFBD2A50F5828 6SMOKEYBASEBALL
1,666,242,493 *AF502A33B9DCF30BC172A66322F98A441FC96E01 5-schlichtmann
1,666,242,494 *AF5D1FAAAC67DC2C0CA56760CADD86178B1C8B15 BART.YOSHIZAWA
1,666,242,495 *AF57B2A13DED92975E5F6427C266CAB23272C95B 5STEMMETALLENES
1,666,242,496 *AF5B68C2D69160DA937AE94C6AE0679EC1AE1315 BAVQ5
1,666,242,497 *AF516F77C7860473DE0F48742E276B88B4A24487 5TRIMSTEMPELS
1,666,242,498 *AF5C61EC787C5FFDEAAD6615FA7D04ED59849432 BBZA#
1,666,242,499 *AF5CF06E6C496335486FC382D14C7E0BAF4B35D0 795JASLENE
1,666,242,500 *AF5FB053B6B6DBF1304A1E5372A10402B6546329 7BSWCALBEBSW
1,666,242,501 *AF52479058F1571F719B607CCBEF71DCB86FB3AC 7BSWESREVABSW
1,666,242,502 *AF586075287F2A0DDC4B381B14747E2C92B23684 7BSWXPARSEBSW
1,666,242,503 *AF56167163B61E5A89DAFA61350C8D32D5CF8FCE 7CAROLINEMASTERS
1,666,242,504 *AF5492D26C6CC78B8DC6073A3B1064071C4869ED b===d ~o ~o splat!
1,666,242,505 *AF56D05EAB1C084C5D892FC46320115CBB58C1DF be5ck
1,666,242,506 *AF56057F325A071214D60DEBEC6385667C132779 687707 bir.avuC.nohutla.koskoca.bir.kIS.geCiren.analar.vardI..
1,666,242,507 *AF595C143AE0B43ABCD12EC12AD5DFFE33754D68 a3(e!
1,666,242,508 *AF5C233100A74E00E8FE185530CE7CF7943138DB a,4a$
1,666,242,509 *AF577A30025D34DADF1329959238C3DCBA7ED0CC 6ALTIMETERN
1,666,242,510 *AF527316D35074B5DC3237475684F56B3C1697EE bebyggelser
1,666,242,511 *AF5AC12DA5AEFFA1F871B623E6750D8EB616C1B7 6BSWACUCHECKBSW
1,666,242,512 *AF5A7526B374B4CDD0F05BC85B15714EBA82549F behnam.sadr
1,666,242,513 *AF5FB8910ACF6C1E6D93398C32323FB156798899 A7JMC
1,666,242,514 *AF5BDCEB876D192DA343C511F37E8F07571C554B 6EVILLOBSW
1,666,242,515 *AF5668D8FFABCF18E7D52E69BA302C51F08D5D95 6FLOYDTAURUS
1,666,242,516 *AF526FC5D9D99A28C875E444D90499EDFCC51F4E 7hinderlijker
1,666,242,517 *AF594B61ADCFDC0042D3B9E3C6916C0388B72CB0 a_a84
1,666,242,518 *AF51887373EBE002E5E1C0C828B5E18B4E752ACE 6HEARTFLORIDA
1,666,242,519 *AF5FB69BC6D9CCA11EDAE051585456C50CBC5086 berezhinsky
1,666,242,520 *AF52F1F523F59EC733984F0667464030955BCE86 7MAGDUMAT
1,666,242,521 *AF55F94AA6E76D72157E88D8B430BA5E4F719ED0 7MAR1314
1,666,242,522 *AF57FCF3C0DF4E7D4D0541058049A33CE0C873F4 6LUMBOOVARIAN
1,666,242,523 *AF5F0D6741C53FD0BDC01DAAB1A26E7DA34BAC18 aaccwy
1,666,242,524 *AF5EA8E9CDA01F4163D3A9FC56C94D00E42C8140 BGEHA
1,666,242,525 *AF520C66FA2218E257350069864A34B0B5EB7C1D aaxhy
1,666,242,526 *AF5600CCD94511CE83D6608DE6B1E33274523C94 [email protected]
1,666,242,527 *AF57CA5F1C67CC4EB8718588BC1E96A5C5D9AA1B bk:la
1,666,242,528 *AF57F1FADAB374E1E9F0207B5B70D89A6DFDBE93 8CAGIONAVATE
1,666,242,529 *AF50C784B8DA17C61EB98E8EB52B694BC674B22C ab~i&
1,666,242,530 *AF5A9BF5298D3E221738E9E60B4E40144B3E228F 8-D.~O.~oSplat
1,666,242,531 *AF55FBC5D99AC7B56B3F999CA4E59E4976A04BC0 7ALUTASSE
1,666,242,532 *AF55548643A4764EFB44103B7899E1BD2F93BB8E 7AMSAOCA
1,666,242,533 *AF5398F490E7D3F2F4371CC53D8285B1CA42E170 ABORDONS8
1,666,242,534 *AF574DDC5A70F5133B840CC17FBC8FFC4A13B9AC 8.ISVEC'TEKI
1,666,242,535 *AF5E8DA66B001486233BB31E8002E3C803C1B88A BMWEV
1,666,242,536 *AF5C5CB853527A448CD5805012313B8EDCE0ED07 7-dervis'in
1,666,242,537 *AF52C81FCE8A51CBC860A6BDC900FD9276DF0BFF B.nX
1,666,242,538 *AF574D74B29251F2569B07AED1541EDC9189EF59 ACKBC
1,666,242,539 *AF52E93718EA1C749CB9CC6F40B76B423FD3CC46 aclearview(a)
1,666,242,540 *AF581656C30BBAEA06590F73217AC975EA8EB2E7 BOOKITED5
1,666,242,541 *AF56B9F2938E902A193F10E0DE6AAC32DAD5E1E8 7KOMPILEER
1,666,242,542 *AF5E71F52401797357D14EE49E779D6CA6F2BFDB bothwellkincaid
1,666,242,543 *AF52AEDFCCD9C701A3816B57B1C15BEE0E4EE42B addisa-1-0
1,666,242,544 *AF5CAFC8B1089086DA79E53AC6F00E9D472127BA ADJ,_
1,666,242,545 *AF5061F0DFE2D415201C2DB5A3B5C10EFB7D561F adp%
1,666,242,546 *AF554FFBD6709B958C8D375273BE3D7596B7A20C bp,
1,666,242,547 *AF5060012DEAC01DA532259ABC0BDA9C6895C86C 984044 MONI HOITAA ASTMAA TAI REUMAA KYLM
1,666,242,548 *AF521A91903390A28C2E4E3FD0B9618FB132384C 7REVERROSTET
1,666,242,549 *AF51BCCFE89DEB04AEF158F2B65259C8783A3743 9anwortete
1,666,242,550 *AF5D56BDB67078317AACE87A4ED82243C63D8A7F aep4k
1,666,242,551 *AF5D4AF3CFA08E560B7AAB3AC915D77D80096254 B/qM
1,666,242,552 *AF5F9B49AD684AEFFD0544149B5B5A1718B33701 afistfulofrevolution
1,666,242,553 *AF5038585B1EF72CABE063C7794C2DEC8817636B 7WERTES
1,666,242,554 *AF5BE07F9DE4105EB5B264422C86B714825DA656 802404 kielipilotin-tulokset-k
1,666,242,555 *AF5974C493D1FBAE9A05E54182FC57BEE9EBC8AA BRANDON.MCKIDDY
1,666,242,556 *AF55BD9A9982A1C178D0D746E3D8C07A0E8A16DB 811754 keskenmeno-varmistetaan-ultra
1,666,242,557 *AF536C0EC1D8099DBCE175104079724201B21F98 bremenn5
1,666,242,558 *AF5709F35EF5378A3299439666FC2F9F03BDEBCC 864275 daher die zweite abrechnung fuer den selben zeitraum
1,666,242,559 *AF562DCED2422A9A7F47A32505DEE2965118CB1B [email protected]
1,666,242,560 *AF50D5E67452E5002FE61AFDEFB6266739EDF6D0 BRIDGET.ROJAS
1,666,242,561 *AF50A224050D1E74EF1C656BD3BE18E10094C5FF BRIGHT-ASARE
1,666,242,562 *AF563924E2BC7ACCDB5601CAC329A7B0236DEED9 AJHZ,
1,666,242,563 *AF54C62803385B92258D4DFE4FAD8AAC8A40797A BRYCERIVEIRO
1,666,242,564 *AF574F7AEB77B7FEFE2242F41C2A4F10947EC5A4 a$!k
1,666,242,565 *AF5C48BF7AA3B2C4390F7DC86028E572C6DB5C96 b".t#
1,666,242,566 *AF556729BB4D280769A590B78F03633FF824CDFE ali.khademian
1,666,242,567 *AF5A1DE73F11B8E62C2E8A18092E6C215202CE1C [email protected]+C
1,666,242,568 *AF52A03FBF674A6978F51DD89E8A6FD5D4F8F67D ALLEN-GUINN
1,666,242,569 *AF582D3EC8F40CD19CED514011F512A13C2C45BA 8PLAYMAKERFOOTBAL
1,666,242,570 *AF51CA5D683326A9F06740FF1019B9D7F855B76C ALLF
1,666,242,571 *AF5349BF247C28CD6D4562B6DD6D54D4F8870F3B 8r4n$7ormn9
1,666,242,572 *AF502F26D64652D639622389FDA8EEFADF2E093B 8RAMASUBBU
1,666,242,573 *AF55925D32717FC77007181C6691C726E94DDE67 8SATEAMS
1,666,242,574 *AF595782FB9358E06AC1F92523CD970708CB6492 A7JRV
1,666,242,575 *AF5768C45015372DEF52169246BCCC844870090E Al%p
1,666,242,576 *AF51E67775DFF1F0AF5E1DC0150C2AAE65063F53 8WORMDISEASEATTACH
1,666,242,577 *AF5256E8E9B3B7B67F4C9579E28D6012620541B5 aaabzz
1,666,242,578 *AF5F89B9937293294A123A2E9954A60CD98B250C AMERICANHAIRBAND(RADIOEDIT)
1,666,242,579 *AF50930054074FBC98DA9B352928DB728D6A84E4 Bv11
1,666,242,580 *AF534D14F7C5FD9163ECA56472A6957F0559FA39 AACEOZ
1,666,242,581 *AF5F76D73B2F9066D2EDC1B5EA79DD6DC6DE806F aadim$
1,666,242,582 *AF527A7249F5E4A6425ACDD553C3622D2FBACF7F 9BOURMAIDNES
1,666,242,583 *AF572D446EE1904B27F10E7E95788A99BD0098CA a?n$
1,666,242,584 *AF5CD7566511423FA2C92EF564078E2F235379F0 byf&8
1,666,242,585 *AF5055E7C9996EA69B1773FD8976525DDB517D0C angelpaveglio
1,666,242,586 *AF598AF8D3E4A8E740DF4BA20F05172DB87C4E71 C0LLAP$1B1L17Y
1,666,242,587 *AF5177D52B0F8EDB64177A876A3EEE0AEA865AEA c1_j9
1,666,242,588 *AF5551A3BA551ABECED12B69B5F6399606ED9ACA C2FW&
1,666,242,589 *AF5CDF14C31CA75624350FE5BB089BB193D669FD 9ilovehawk6
1,666,242,590 *AF57D2D4E637C7C48DC83AC596B3452E7B670176 abm7s
1,666,242,591 *AF5D3C9E0774F2CCFD44789D86F4706660B79D90 abrt7
1,666,242,592 *AF5660BAAD8E3DF256520E5A71CB182CBA30E03E C&7AO
1,666,242,593 *AF52090285C41B04DD180CED06A5D0D966F1AEA5 acheerio
1,666,242,594 *AF5DE3545BF8FC69E021A33CF64DDBEA6D8AF957 ACTICOIE
1,666,242,595 *AF5EBA56D4DFE9D12BAC357F636587BDFC9343DA 9sxa1
1,666,242,596 *AF57F3B49849311223801B94FEEDCA7899D4137D aqo$#
1,666,242,597 *AF55A2D4C88CC2EEA749BE99349EB9548DB242C6 CAN=O
1,666,242,598 *AF55A7B4D7544193F3FF2D162934ACBB82A95F42 adp%
1,666,242,599 *AF5183A1F0E00D21D9F1142F381315380AE941C8 a.1o
1,666,242,600 *AF599DBD8DE9B119C00C8EFF6EF070F080BED72E CARMELOGURIN
1,666,242,601 *AF5295EAB4A5A495A3DC416B850A9C9D33510782 A3KN
1,666,242,602 *AF5106D2685B7DC5D90ACA57E28D7EC37A2AB1D0 afc,b
1,666,242,603 *AF50E8B415B724BDA95AB79CC999A78DE1062647 CARYSLAMA
1,666,242,604 *AF5DAA4BAE5C489A7D8CB04951149292ECFA824A a_5s,
1,666,242,605 *AF578EB35CBF522FDCD66FDFDE381202160ECCCB A72OE
1,666,242,606 *AF57249A8645457820C54F9C51C5ED9C7D387162 castraron1
1,666,242,607 *AF5D627ED8A1B1A05846384A08B3AD9E3DE86733 AGGIEPINK
1,666,242,608 *AF506F50A677BD6431CFD354E37E71374902AA97 a9d5:
1,666,242,609 *AF53F37780ED2E5385C9173D76ED3637C455A88F A$A3
1,666,242,610 *AF51DE04EBA8440758E099FD8300AA539479A5C5 aton '/a/t/a/n
1,666,242,611 *AF5428F89BF2770245F3D15CA756BD0A1C1CCC7D AAC?{1
1,666,242,612 *AF5D9E09072CF74971E0E6C41BD2F71073879A76 ATTESTABLE
1,666,242,613 *AF5D2A282FABB345E73EDCD58E77CFF60B525940 CEED.CAWWW
1,666,242,614 *AF572BB9ECCBFC0612165510ED71F24E3C5EDF54 AKOTORRIAVVSGB
1,666,242,615 *AF53D3F66B567A6A02FC4DB10ECFBAB35B10EF7F AAEUH#
1,666,242,616 *AF572CA963EDCD71F5D0348A879D0CAF8553313C avlg?
1,666,242,617 *AF51A6F96D9F02E24245DF00B02F9B20B7C5D12A avs&5
1,666,242,618 *AF5BDD4AB39314654DC6AEF829E41BD5B02C0F96 aw:??
1,666,242,619 *AF55DEFC58E014B39D1E70629DFD0C477D69408A a!amp
1,666,242,620 *AF550ACEE048EFDC5BC0EF0E6AB13D8C3000F776 aanhouder0
1,666,242,621 *AF5EC3B11BE0A2B4CC836C37539B411BD96A49F0 a?"av
1,666,242,622 *AF5D0393B565AD2C1C0CF2FA308E2E69BA9467CB alex691
1,666,242,623 *AF5EBAE4DDC72DA609660B3DCAF956908E36E9A6 alles schlampen au
1,666,242,624 *AF588455938A2201FA8D1355992FD43444EEAFB8 ALLONNIIS
1,666,242,625 *AF58C2B38578BBE241FC47F8545D8D99C547340E CHARLES REIMERS
1,666,242,626 *AF53AAE7A8F1232DBAEA29A168603FC65ADBA94C CHARLIECADOGAN
1,666,242,627 *AF5BE93DC458E02990C70A3CCD4E67AA356366B2 aloqk
1,666,242,628 *AF543B1B135C6D13DBD2DBC74DD97862A464199D B+5DS
1,666,242,629 *AF5687D2E404F84150929671B8851CB8221691FA CHENGBF
1,666,242,630 *AF565C7C51F7816A1BAFB787E7CD205717CFD8A5 ambermccargar
1,666,242,631 *AF533B54AC812E8B7A55EB4A8338E825D2B0927E ch%m6
1,666,242,632 *AF5A7709FCBB63ED27E881741C3933D1BC550BCB choinvestorsuit
1,666,242,633 *AF55FF25D7910E46CA8473F5CF4BC4C66CEE1526 ADNPR
1,666,242,634 *AF5D6BF0165190FD10A745180CAA46CBCFC87039 adolphroitman
1,666,242,635 *AF582AE1DBC0F1B5A05E20D44ACC50808784AC91 CHRISTIANLUKIN
1,666,242,636 *AF5E93C034057D319027416FA41CFFB7696D6A10 AEECH
1,666,242,637 *AF5FBD5584314C037046AB7A190C94929476861B chuckyashley
1,666,242,638 *AF5EF8A0F6CACDF1FE25C986FA222DB72BEEECC8 ANGELOWEBSTER
1,666,242,639 *AF582C9C34848576FEFA9BFBCDDA54E5594E5F92 ANGEL.RAO
1,666,242,640 *AF5968E6484B9C44A71104E62B0A55D14CB4AC17 basamania4
1,666,242,641 *AF55E6CF52AC92C81C373CB1DD54746B5B744146 [email protected]
1,666,242,642 *AF5BE138B53473AAB4CA8C5DA80D27690D61BCDD BASISZEK3
1,666,242,643 *AF544DE46730D3DEDDCEA09AC00F7F2A0C523A05 afistfulofrevolution
1,666,242,644 *AF580AE1ABCA2A0F09279744DB72B6A6B30D5A36 ANIQUILARSEIAM
1,666,242,645 *AF5FEF63A3BFFB0B0C2BEFF34F113C939F0DAFDD [email protected]
1,666,242,646 *AF5C5ADE6ECBC1426FE053F00442207E6C0C743D AGCN%
1,666,242,647 *AF57FDD2726C30C80850814F488035632D0930B8 agl$b
1,666,242,648 *AF5D25BA91D4213A246F6554DD3A62F60678E943 [email protected]
1,666,242,649 *AF5B87A0278F16843D343881B5EA3CAF14BE2473 [email protected]
1,666,242,650 *AF59D8B47ACBB03BE0E2288233E747B8A8F2243D A/,o
1,666,242,651 *AF5DBD641417EE1A26F3B43C1B575E25ACF56E6B AIC,%
1,666,242,652 *AF51D9EC7906242F8317CC24EEA79993A31F53F6 clt6c
1,666,242,653 *AF5C6A449A01F3958F7B9AA5BC39B80FF109457D clubery
1,666,242,654 *AF5FE9E875127424CA4F23E3288B4FCE69CFFD53 BENEDICT.DEGRAND
1,666,242,655 *AF5D560F8DFB2A4C68BE949D2521970EEFA93216 BENNETTDAGENAIS
1,666,242,656 *AF57970C0CC91917AE53A73A4B55D4DDC2EE9219 bennyleithiser
1,666,242,657 *AF53F98C2149DAD17370E800F3450D30AB0B6224 A"L2P
1,666,242,658 *AF545C6C4DE39DF8A3ADF64D77505D8B2A9F5BD4 [email protected]
1,666,242,659 *AF585EFECA619BCB1A1118E016347EB9AA54FA12 cm,zb
1,666,242,660 *AF5CBBBC471971B5BC8CC3BA587AFEB55CB5CAD2 are6h
1,666,242,661 *AF5B8D0625567FD5ED702289F554DAC2FD948CF0 COMMENDINGLY4
1,666,242,662 *AF5760BEDB0EB42232F87F976B0290C6A7EA31C2 bf)-j
1,666,242,663 *AF555A890F51DA6DE4EA20DFF6290E4D4B070255 BGEHA
1,666,242,664 *AF539BA3C3B797D7803E6189E4DD6E9B450F2624 bi"_&
1,666,242,665 *AF5344147FD9B96AA50FAE3B990244FE2E01A03C ar:y?
1,666,242,666 *AF5707A4F75A2266A3DD4C533D942FE1E24D9813 ASHLI.HERRING
1,666,242,667 *AF50FC3B4FC5669F9A53FCDA7B1DB449ABE25721 bik0i
1,666,242,668 *AF5F0D5C73D4DE368DA0D1C1C29950FF0ADE53F0 BISAMMENING
1,666,242,669 *AF5576FFC077BAAE3BD7292783BEB7732251276E CORNELIUS.MEDFORD
1,666,242,670 *AF58C97D7C76A43BB0A12D11215BA78CE34DD241 A.MHA
1,666,242,671 *AF584B537E607C70CC8F0D5C50F1C69A1756AE25 amuseerden5
1,666,242,672 *AF5805BF436FF7CA19A9622E871B2C6D35DD6142 !AUBREY!
1,666,242,673 *AF512686221336EB89D4682B806EBF90E2538EF1 aubreywherry
1,666,242,674 *AF5ACA2A1A7B762C7363767B4E31125E673C9906 BLGAJ
1,666,242,675 *AF561CE22D4F080DF995209E5393BD8DA722DDF6 BLS6H
1,666,242,676 *AF5959DEE95BB78E49A2A5944AECCE366F03B773 cq=l
1,666,242,677 *AF54EE133F6A326A7AE5879CB18B6E8DDC5DE029 [email protected]
1,666,242,678 *AF5F8BF8614A94C20D9A2A4470C7B08D78921641 aviv-avraham
1,666,242,679 *AF5F847BEB1F64D0109EAA34A22B9D3025777801 AWJ"!
1,666,242,680 *AF51CC86404B5A65F8C69735E79D3CA0FA589712 awpt
1,666,242,681 *AF5107AC1ED139B4D2B20DB196097E08A723C198 BO.OSMAN
1,666,242,682 *AF5C62ADEFCB5D2D5A27EC1E8B04219C8F886016 [email protected]
1,666,242,683 *AF53843B30F2DE9E602443FD9387284A388DC632 a/ns
1,666,242,684 *AF55BD554E83729C36550F69734EFB3BC264F3DA ANSWERS2MORODER
1,666,242,685 *AF55DB6585D5C44814D0E9069EF5EA64119D6C9C bpabout
1,666,242,686 *AF5F8425C7DB83D17A7563B787A437671525D93F BPENAMANTE
1,666,242,687 *AF5DB11924998C1ABB40623E82D13FE08C9C9A93 b0:4-
1,666,242,688 *AF51073263DCB6CABB6D4451ECF64334D57615F0 ANTIONEBRIEL
1,666,242,689 *AF54739C47F7F6B420EE6BCBCD7F07001E350BC8 B0D.G
1,666,242,690 *AF548DB573250BDB808ADE8D6162FA52CBE581D3 [email protected]~0.~O(_0)
1,666,242,691 *AF51064E1B4A4363457753FC8111659B79045139 BRBH
1,666,242,692 *AF56A2BB9448690E71B16CE8926B9D07EA3FD08C BRENJHON
1,666,242,693 *AF53EF7D9B4D923AF8DB255A33594AEBAD9F5B6D b-6if
1,666,242,694 *AF5DCDE86AC2B3D3D73C263889AC3170898F52EA CV07
1,666,242,695 *AF5591EC9253A8BB1865069E9AE0020E53204D3C CVZ77
1,666,242,696 *AF5A605575E94919FD92BB658CA8A9A526D48F89 apl9v
1,666,242,697 *AF59EC7721342FD65CD5466A3E0B3E8149A8788B baarkleden
1,666,242,698 *AF5992D4DBB1C42EE8B60D2848DFA24D386C9C67 baccanow
1,666,242,699 *AF55A9B5CA2D712A1C408B1FF5C6503782C095A7 APPELLATIONAL123
1,666,242,700 *AF521FBAF535D6B62616833F23210E9BACFC8754 CWZFJ
1,666,242,701 *AF57F9115CDDF460950E455B7B68186C64981DC6 BRUSSELS-109
1,666,242,702 *AF56CB7B3171247F67ABFF5D0FE70A7B24E50287 BÄNDERTONEN
1,666,242,703 *AF5FCA933F44EB47B74EF3690FB4F3E6530B2037 BRZ!J
1,666,242,704 *AF523C45FC54391245D012229512D11059D69C9B AR9e
1,666,242,705 *AF5A570B98E321B78636C24DF0AEE8F67D7B9FC3 bsweexistbsw
1,666,242,706 *AF5FDAEA178C78963176991733D625C20A03BA86 d&%3
1,666,242,707 *AF5E3C3A74F8B764A3F3FEF8612DFB740AB88B82 b##@`~`~>-b0
1,666,242,708 *AF575F82F1FAC98ED14B20E507577B4968B05F13 ARHB
1,666,242,709 *AF562FDA684FEF837E20260F88BC3AB3D64D8EA3 [email protected]
1,666,242,710 *AF552840845DB8EB667606D3D76FC6F022788D56 d4_iq
1,666,242,711 *AF5FF59BF8CB20088EB6B9EC3D1CE94FE2EA061F D5IS,
1,666,242,712 *AF52F4203E2F68D04C603BEB0696AFE63C135C91 bullet (bullion)
1,666,242,713 *AF5491AB6D5D4A6EDD2CC1312940A37D170EB51B bv;eh
1,666,242,714 *AF5F3D5BACDB548FD8A7C3DBB6A39DF20913BE07 arveoppgj
1,666,242,715 *AF50991C342341C578E97FAEDAF89E4D1B1300F9 ASEKSUELEN
1,666,242,716 *AF51B6D46ED9A6BE7E1F0D21929BCBDE64DD4314 DA6OG
1,666,242,717 *AF5B46929340E3B3D8572A74501ACFF01EDFB989 BERNABE.VISCONTI
1,666,242,718 *AF50FFA865329FEAD52588584A880328C24B7F38 bxes.
1,666,242,719 *AF5A174970C6E95B178CBD5244393CEF78D2A829 Dallas':.This.is.more.fun.than.a.busload.of.cheerleaders
1,666,242,720 *AF567074E202A19C2FE5D9E77DBC2D6B03E72782 ASSNAT07
1,666,242,721 *AF50DDDD7EE470795086FE38CD6AC6D3C8AE8C25 BERTRAMDJURIC
1,666,242,722 *AF5BDF77BDA162D42BDECF300B11E594EC077449 asto$
1,666,242,723 *AF590DC43843B093F7D0728B8F354CCF3CB31174 BEVREDIGENDER2
1,666,242,724 *AF539E091B905BD34831862585BF2DFBA03311FD c0uc;
1,666,242,725 *AF532EFFF764269010B8B4D197E4561B2D634E96 AUBENBORDS
1,666,242,726 *AF5B948D0277FA8B3C19FC456D0960FBF8DB9D22 C2NNB
1,666,242,727 *AF5C7E37D931B47D702EAD991672BB1BC9042C0C BGMg
1,666,242,728 *AF5379051DF50D514BBA1902C65E8DA9E43D8292 darl18
1,666,242,729 *AF5CDDA45918959C81976DF499D86CB2275F3589 C4R1Y13SQ
1,666,242,730 *AF5E0538552D6814085AF27E75C996044ECE4A1B bh&ky
1,666,242,731 *AF5BF9D354661A7E5D19AE07B1EC15800F5BD2E2 [email protected]
1,666,242,732 *AF55B80D41B20A8063637CECAD5CF45BF2C4B6CE c8d05
1,666,242,733 *AF5E31458A0A2973ACE29EC364F8DCC958807FC7 DAVID.ESTREICH
1,666,242,734 *AF512AE36F4A66FC9B58EF3D929377F6380BB140 BISPECTRALBASED
1,666,242,735 *AF56C12D48A9F171AB3AC3F3E7D49EA9032019A8 BLAIRBRASURE
1,666,242,736 *AF50617A2808FC52C88BE292FFDD096DF96DF3E1 canibusa
1,666,242,737 *AF51270650460F4DB01F437115B96965D402CE03 BLASTERLINDSEY
1,666,242,738 *AF51E89C636EFBCC6BBF70C685278F564C640DA1 dcj7o
1,666,242,739 *AF5499B7DDEADC0900FE09C27A22645BC8BBACC9 DCR|
1,666,242,740 *AF542250263ED6E747D1227B2FC11305FD3B6BAD DD"RQ
1,666,242,741 *AF5148E56ECB9BBF50D7B426482418643639A7AB CARSONZIRBEL
1,666,242,742 *AF55546A4EE4918FE5C55D2BE5339B2B1390B47B debenture.stock
1,666,242,743 *AF57FA0E581A8D39253F42A32F77B480775BE1F4 B2T8R
1,666,242,744 *AF53809BC4548428BA89C2A9A858EEABF8CDCF1F DECLANGALBRAITH.DE
1,666,242,745 *AF5FB0BBFE6EBC66825EEA224067440065732CAB B3HD.
1,666,242,746 *AF50D02152801B7DDDD7CEDF9097C37677049A9F bofults
1,666,242,747 *AF54C4CC7027FFD7DDD550437B55F2CF776874EE DEGROOT8
1,666,242,748 *AF56B8E4E8C900DBDFFBE7923A9FA8F95659CFC3 b,oi!
1,666,242,749 *AF52F031861885A40D874A7E93DA5772D38C2968 b96e
1,666,242,750 *AF5118C1A0A51AEF377CBD665AA2D9348022A765 DELPERTEA
1,666,242,751 *AF5C573EA61C734870A7FB7EACE1B0544D15DDCD demarcuslindeman
1,666,242,752 *AF55DDB71099926125ED4501D1228732B37F72A2 [email protected]
1,666,242,753 *AF5A2A2567F98EADBDA4C63756A2606706860BD8 \CBAA
1,666,242,754 *AF522F216AE66CE301C227F202552B9B6466E335 b==>.~o.~o.(>_0)
1,666,242,755 *AF54EFC39B4B31058C4849BEAD137C9E6702C3D2 BOOKCHINING
1,666,242,756 *AF53546AF9D1AEE67DA0892AC03F8171D16A5024 C)BYE
1,666,242,757 *AF521268D2AF9990F9E0DD431E577D566F043240 DESONMUR
1,666,242,758 *AF5D301B6254EA9E18197474CB607AAC099D77A2 DEWB0
1,666,242,759 *AF5369F13164991523C7A438EE58B09CDFDAE787 [email protected]
1,666,242,760 *AF5343A5BD46B1E23D344A0D59C33194ABB9C57E dgx=2
1,666,242,761 *AF557C63E5DA3E3EAD270AAC6E104BB5AD62DC13 d+h4e
1,666,242,762 *AF5B1C4EE9E841BC3EB5D0221723E1E680023F20 brandonbyndon
1,666,242,763 *AF558A65D7E36693ADBC6419CAC525B5D1A19973 DICK.FUHS
1,666,242,764 *AF5753601A98C85FAAF1822128F1541CABDE2533 b##@`~`~>-b0
1,666,242,765 *AF57DED9E3E7D26886DB0D2F0CD4B782CDCED8FB B----B-`~-`~o->-<
1,666,242,766 *AF55E6ABDF952D0C84ACA77E16F6BDDE3860FBA5 CGR1!
1,666,242,767 *AF514AF62FB4D3DBC5047EDF2B422049F7967F80 CH3WYCH4TDIN4MO
1,666,242,768 *AF5B7D0FFA9C7DFACBAAF83BFAD732686398A0ED [email protected]
1,666,242,769 *AF5C0B566132513FF3616A747CB78BFC3BE1CC7B CHAD.FINK
1,666,242,770 *AF5C25B4AB14F7E06FFACE1A9B9773A2D01CA211 B;_CX
1,666,242,771 *AF50C17ACC4D074AC67D70DD096ADF5C62832519 BRUGUIERE1
1,666,242,772 *AF5199B8F85C60F4B47F12E8F48AEC918EC0A823 [email protected]
1,666,242,773 *AF580BDDFE6C432F23373A0EFC29423A93FCB2A1 d(l9m
1,666,242,774 *AF5859F8CB0D9BA2C1992C9326FA63006A0E8F52 bs!),
1,666,242,775 *AF5FD2062B54910E02549C39A421C141B28F38B3 bekc
1,666,242,776 *AF5F067566702DB7C8187A7BE8D401587AFE474F DMOCRATE-CHRTIEN
1,666,242,777 *AF5A8AA7D926AF7FB38641F56B1B5D53E6773E88 CHARMINGDECEMBER
1,666,242,778 *AF50D3A14C5417670162DBDC39B807CBA72E57BB C%HC
1,666,242,779 *AF5FF2D6ABA375CC1E7CFD83F1AE24836E7097D7 BENNETTBONG
1,666,242,780 *AF53AFAF69A5D62E014A94386C41A0D75185C693 [email protected]
1,666,242,781 *AF598345701CEE9EF9A4DB7D67A1EC71956128EA dnlc9
1,666,242,782 *AF5A239BE28E61E0EA889FEC3B95F0BD410BBD21 CHEOB
1,666,242,783 *AF560AFDF2455BD16635411E10D64F96FB587C60 BERGAMINITEMP
1,666,242,784 *AF510C1EACD3934B5587178047563DC9CC99C733 BERNARDOZADINA
1,666,242,785 *AF5A9007205B5993DF5FD4A2B13CE7416CACDA05 besttry9
1,666,242,786 *AF57F2C9940099791546940B92334EC38862ECE2 BT#U%
1,666,242,787 *AF51A2DAD9B5FB39A07E7440CEE66696325CAB4D christina.mcgann
1,666,242,788 *AF5D740838F244711523AA19BEF99F31131CEDFB BUFORDKAHEN
1,666,242,789 *AF5C11ADA0456D6F7CF87AAC9E593A00977DEF43 b-f5
1,666,242,790 *AF5A7C90008C084E146EBE4C60884A5567CCF0D2 BÜKEBILIRLER
1,666,242,791 *AF5C583B690368FBA933D89F80E55E7FC394C764 b,ffr
1,666,242,792 *AF57D985A3C8450809F500230236E29769E2E599 BFRQ3
1,666,242,793 *AF5A9C593CB15AFE0CE6E1575EA6AE2682DD75A9 CHUNAV
1,666,242,794 *AF5B2ADCF966FD93A9DA80F801314797C5108FA4 bglfd
1,666,242,795 *AF5CDF0164D5008BBFA50F0000D320566593B319 CIRANDARLHOS
1,666,242,796 *AF570BE1393B57742DACE5CD402ACA41FD6D7315 CJAMP
1,666,242,797 *AF5F5B3B1DF0134BA31AA16CF619E10CB1FED024 b&z7k
1,666,242,798 *AF551529A79AAA5FE72C701510FDF19B83F24333 clavijoko
1,666,242,799 *AF51CC9A62DB926A57EF925952D80334500E8B54 clbnw
1,666,242,800 *AF509800C8DF93EAD2E4CFFC3A212DAB0AC9A0FB C0L%G
1,666,242,801 *AF5A733AEB7ECCC338B5E54249710EDD51CD24FE BIWACKS
1,666,242,802 *AF575BE6E37AB0F00B19C676C7490A7CD35A044A [email protected]
1,666,242,803 *AF583A7C3A99F567C3BDD5660601722C58A2D825 dqaw(
1,666,242,804 *AF5051DA8A2916CAB6C976CD2F6A7F01671C99F8 DRAGONHOSHIDEFENSE
1,666,242,805 *AF5CFD88D6837010DE3E9941593D08B5001EB7C5 CMMSQ
1,666,242,806 *AF59974DFFE07056DAD80D6963D66DB58C0631DD c4=ew
1,666,242,807 *AF5A8C8408DD446C0BF5EF5559AEC49C28D7C996 C6NZS
1,666,242,808 *AF517241E999491729E8E9538E17ADE2CBED2DDA D"+SB
1,666,242,809 *AF5B31568954C933845573E13435E332C56BA0A4 bmmzo
1,666,242,810 *AF5F0E98C0BF1CD5EFFCE3EA60C3D08C238280E1 C9G+C
1,666,242,811 *AF55B39F3015A0DF109058E44EE978F45CEB7E71 cada-estaci
1,666,242,812 *AF5A8D8814AB84599BE3F0013683E89D4FC1B25E DTVLQ
1,666,242,813 *AF53F49A60938CD0C477F8084C0C1C24BFBD46A0 BOB-OSBURN
1,666,242,814 *AF535E598D5F1B33FB7CDCACC935BD4DD7355991 dudleyrusche
1,666,242,815 *AF59619A176FF09565C81E23FCE6748703B0C77D [email protected]
1,666,242,816 *AF549944A986DEB9C970CC594F8F9BD0AE4328FC Du,i
1,666,242,817 *AF505CB3528C57C893C996ED104E59B5FA968C34 duncanfossati
1,666,242,818 *AF5FAFBBB31C91BFF0FB441F7CEEF05256728EE9 Book-of-Hate
1,666,242,819 *AF54B0700679FA21DFD0B7F93873F024DF1AAA7A CANDIDATAR
1,666,242,820 *AF566EBEA69DCDC2D9DA596587FE130ED6FF2B39 dunnens0
1,666,242,821 *AF5BB19EFABB084243B84ADB519A7F153FFD29D6 [email protected]
1,666,242,822 *AF527340EB261D4CFD2284352677782FBE0507F2 [email protected]
1,666,242,823 *AF572C9A09A0F3933791DC0F7696EED175D61DC7 [email protected]
1,666,242,824 *AF53BF0F13C3B3727BA7FA5551AFEEFCEE9DEADA CAREY.MATHIASEN
1,666,242,825 *AF56AE6AA92FB92BE528E055347A450D66FF67B0 DVLKMRS8
1,666,242,826 *AF51AB0314FF10FB9F9B8ED69C05CC540EB42951 carolyn21
1,666,242,827 *AF573F22D34FE7F382C3C5AD72AE3858EF08D8C3 bq$f_
1,666,242,828 *AF50C0125847F5629617797E179E881EC549D5B6 CARY.AGRAWAL
1,666,242,829 *AF593A3B521250F89FCBF7EA0209554A3427A43A [email protected]
1,666,242,830 *AF5E8CE9BCAA271372A7F2CF33E4452217762CFB [email protected]
1,666,242,831 *AF5B253B0572550ED6FC44D83BEBB731E267E7E8 cordellnesler
1,666,242,832 *AF5999A4245CEDF459731E258226D4CCE4E6E782 CORNELLCARPIO
1,666,242,833 *AF5056FE81B1FCB6B9611DEEF600A8E092FF50F6 Brahms:.Rhapsodien.Op.79.No.2.gmoll
1,666,242,834 *AF5FE22F3E73A5B5B63EC8AE132B9F1582F267DB DY=AP
1,666,242,835 *AF52C2E82FB0E088ECE3828866BDF8692E75D021 DY?EK
1,666,242,836 *AF556DCF5096062A9E6CB40CE121549CA3779A0F CaZ!
1,666,242,837 *AF5C416F5F1F079ACFA50738EA907862D6CA0130 brenda111
1,666,242,838 *AF516992C28E4DA7380544C7966F3F94E4D20E4E ccc_b
1,666,242,839 *AF5BA9FB16F9FDD7FA5F748E7FB151B2A57F426D cpqua
1,666,242,840 *AF5AA4F90344C13A98E5BAC5DEEF988E5DEA467A cpvr
1,666,242,841 *AF5CAF82C7D0870438EE524C2D5F791BF7CA6D54 c,pww
1,666,242,842 *AF5908C02ECE3CEF99EC95E229581E0C8585BB02 cq=l
1,666,242,843 *AF51C8FEB142E56B419914F1299634FA69EB6F7E cei)b
1,666,242,844 *AF57406AD1B3FBDB4F1DC2A57CDF058C6709FB30 EDMUNDOALMOND
1,666,242,845 *AF5B4475DDE2242A1C34A2DB5E41A950E2FD5D10 cs=al
1,666,242,846 *AF564A2723489ADD9D3C9FB8926CCFACEEFE5655 ee9u6
1,666,242,847 *AF5DD848D2839A4131D2FE7367660C8EA90A72E1 EE(JD
1,666,242,848 *AF5C8DFC8374EE785B98FA803F4DD6506D65F713 CF-OA
1,666,242,849 *AF51C0385A6D8D4C1C6A56C027027BD93214C91E BTB.R
1,666,242,850 *AF5C180E8AA3B75F30809799EFA1A9F579755636 [email protected]
1,666,242,851 *AF5A86215E1AF816586DC974527315E26E7B2531 BUFORDNEIKIRK
1,666,242,852 *AF56435CF110D70E070B84D4960CEC6DAE76DAE8 Cv3N
1,666,242,853 *AF5366ECE5B343AC46DF9DB44ED5AAD61CCB1A41 eit#_
1,666,242,854 *AF55A0872A9B29570BE2CC5CAA444572FA127048 ejdaalbb1
1,666,242,855 *AF54B63187A7D62763E562FB1C394B6BDF649BCA EJERCITO.INDUSTRIAL.DE.RESERVA
1,666,242,856 *AF5E0A37DC44F6C768B3DC87B120F07E063F0060 BurntheBoats
1,666,242,857 *AF5EE4F8063E80E3EC1ACB9AE5414A91E0928A70 bv3xw
1,666,242,858 *AF5141F5DC9602704973C49C815D3CAA004BDAF3 CHAVANNESDESBOIS
1,666,242,859 *AF598E84E84E578DA394172938431D7CB7CB9D77 elinmaai6
1,666,242,860 *AF54DB65C1C6D4786E4444A6F9D24E20007A4CC0 CHEU$
1,666,242,861 *AF5FF48C464F953598661178F5506E68BFECE12C CHIFF“
1,666,242,862 *AF52691C0E1263050F8D9EBE9C43E978D6B810D5 ellwertes
1,666,242,863 *AF52F3A0C0743E8C9B46A650669802041C74765A el.regresso.de.maria
1,666,242,864 *AF5C0204C9D0747153FEA0703B35D3B0C6362E2A CHOKUN’S
1,666,242,865 *AF57577E7AD13B0930ED520D1BE527495B67106C d0rpf
1,666,242,866 *AF54B4C7C3608BE926E0EE7107A79BA57615017C CHUNG.LEIDIG
1,666,242,867 *AF561973830DACC2479151B6D5B715809828BD4D C_1OU
1,666,242,868 *AF528F0C3698DBE6A8380C662555D9499DBE9827 cilq0
1,666,242,869 *AF5F22F1251A7B29DC68BC8B7A8DAF309B0A4AA2 cinquantenaires
1,666,242,870 *AF5F77579A3C383A9C591A9733166556B00AA4A4 ckdu9
1,666,242,871 *AF5A3E0CDDFEAEF725CEB264D6AF9137BDA38AAD epencephalons5
1,666,242,872 *AF56DB8E9AE43952C29F5939FEF1240237D88F61 c$agb
1,666,242,873 *AF5D60231D49F919CF46B5B726C87289B663476E DANILO.SAUNDERS
1,666,242,874 *AF5958E22CBD9BA23031BAD17416A8AC4D266012 DANNYCLAPP
1,666,242,875 *AF595D827178B0728FA88706ED85C642AF1E6239 DANNYCRAGIN
1,666,242,876 *AF5FA38B0ADF6B9720514C245F935DFD61211F2A CLASSFILETRANSFORMER
1,666,242,877 *AF5A352BEE2DD9FB5FFA995B94AD135B86717FB8 classicalballet
1,666,242,878 *AF5DB0FE2E76388593FB42CEEDA0EA2AB3D1AEFA caloric8
1,666,242,879 *AF54780E37B0EB95E9ED36668533CA42CFDB70FD cantando
1,666,242,880 *AF5CB88FD935CBEF1D7BB09CBC36D45CEF64EE5B DARRICKMARETT
1,666,242,881 *AF580617445DC1DEF8690E8ED37AD27792879B7C erikwalters
1,666,242,882 *AF562C3C80DDFEA8649587496850A99CF64C159B darwinridel
1,666,242,883 *AF543B90458B5D1FD54F145E9A41F87C0A6AFF79 DARYL.STOMMES
1,666,242,884 *AF59B1A000ED8ED160C63301770DEB30FD5A04CE éroshima
1,666,242,885 *AF5780962F9F29CF46F73EDA45192A4E12B6DD08 CARLOSZACCARO
1,666,242,886 *AF595AA48670668808A821DA0B130A30FB477BE3 CLTRM
1,666,242,887 *AF5A6EF970A08CE813A3CB935813C8A63F304B65 carolewideman
1,666,242,888 *AF55BAAAF161EFE07B610C8F6FEBDF4617EF28BE CARY.CELLUCCI
1,666,242,889 *AF50254FCBD0C0D1229BD985701F26B5851BAC0F ESTILIZAIS1
1,666,242,890 *AF5265E329AC824317B4BFC5CB34DCFAEE37760C CASHCARROLL
1,666,242,891 *AF5F0867FC1624D9885C50013E011505C161B4A4 CASTGERMENSSPAINISHD
1,666,242,892 *AF59C40919B3F17DB1AD8CCEF04EEDAB3A53580B ET&S
1,666,242,893 *AF5B2389E8D2FA0747DF6B51D8E62D7032D05A91 EUBE,
1,666,242,894 *AF59BE308F096C140295E9BB94B157005651BC63 \CBAA
1,666,242,895 *AF54D1F61BD40219DB085550CDDDD58D0815D2DF cbc=k
1,666,242,896 *AF5A4A130F0B7394D81F5F3EC9CCF0154B7D0A4A CB.IG
1,666,242,897 *AF5085A6FF1FB06AA15239A4AB0164A5D8A4A91D D)_?E
1,666,242,898 *AF5559E6AA4EFBB9A8AE8E31AF1F3349B6166610 de54l+1ng
1,666,242,899 *AF5C02F6E2AB4A64FC359A7A077B378343406B57 EVERYTHING COMES TO NOTHING
1,666,242,900 *AF56F65A1D607ADDACDF76D84FFA15BAA85DE479 EVX`
1,666,242,901 *AF5077B87B634332C8994FE5A620674C811D4984 COMPLIMENTS.TO.THE.CHOIR.FOR.THEIR.CONCENTRATION
1,666,242,902 *AF536B78142EBE55563D90BABF56866810DC96B4 COMPUTECHELSEA
1,666,242,903 *AF509FA91484CD06002CCF98F58C78F1FB828262 CON5D3RNG
1,666,242,904 *AF5A3E1A14423A061F5C4B3170F06D34B9C9E6D7 [:@F0
1,666,242,905 *AF54B87F2EB9CAFADD5154E492509460B5C7BDC3 C(DT5
1,666,242,906 *AF55B4F93403773CDFA51541736C4368515FA484 demarcusnugent
1,666,242,907 *AF51A88F1A1CACC474D0C8D42B1B572E4F8686E5 FABIANWHACK
1,666,242,908 *AF5E470349DEEE09A3C7C5B457D20224D9818DC1 coreyteich
1,666,242,909 *AF5FBE2EDB87B69FDC833E30EBD9AF16494027B2 [email protected]
1,666,242,910 *AF510EE1CA546E7F282E54731F3D102EAFDAC66C DENISCHUBICKS
1,666,242,911 *AF5774532DABAB741BD830EC25DFBEF5F5403506 DENISRITTENBERRY
1,666,242,912 *AF586DEA61D2A2A3AB4227A08247A534DDD46055 DENNY.CERNOTA
1,666,242,913 *AF54256C1E6C496D1B18230599916641DB4F8801 FASHONDOLLDANCE123
1,666,242,914 *AF5B2C7A1E2E6155DD8499D435A08B28AF8134ED DEN[email protected]
1,666,242,915 *AF50C562E272B6E0DC3B0403D566EF2FA1657696 DENVERCARDAMONE
1,666,242,916 *AF5DF54B8754836FE01ECC5DC04E7989CFDEE229 C:FQH
1,666,242,917 *AF515B04AE6800E0F1E8A5E1B6CD32C38EF932B8 c?ow9
1,666,242,918 *AF5FFAF7821D807ACDC9725B3E1BEFC58E6DE1EC c)gi9
1,666,242,919 *AF54BA635932F65F9C401E4C896EDD63046ECE6C cg-kt
1,666,242,920 *AF5B49ABA0319ED282F4E97C159D8A7A96DB92EA desiderio.arias.(merengue)
1,666,242,921 *AF59CFA4A8432E93BB4C380FBB365C324375E121 C:\PROGRAM FILES\MICROSOFT SDKS\WINDOWS\V60A\INCLUDE\WBEMTRANH
1,666,242,922 *AF5D565124067D76F3E7B9246D537EE5135A8790 DEXTERLOUIS
1,666,242,923 *AF58D0621EDC9BB28B66FCD7FFDCA527660E64E5 CHATIRUJ
1,666,242,924 *AF5194B83F2F5A6C9C892BAE0A90A247EDE568B8 CHATOVILLANUEVA
1,666,242,925 *AF5AE242BB2FFA06B70C38012ADA05C6A33574F4 C%HC
1,666,242,926 *AF559FB697DE7ED07FE2603777304DDE789F2899 cq.#$
1,666,242,927 *AF5CF0C1871746A7D6F1EE68DF2989CA36C6434E cr0qu3t5
1,666,242,928 *AF5E6A06F3039733766A4FA4D6AF7050FEA2ECEB CHIKODIOSUJI123
1,666,242,929 *AF599D4A0C7E94A4AF278785E7B78448B64B1560 chill-mit-meinen-homes-(instrumental)
1,666,242,930 *AF5D849B15C98D43E6BEB8FF3B81A8399BE169D2 cricwols3
1,666,242,931 *AF5FEFD458E5C20594C480CDF1ADC17C36CD5C62 [email protected]
1,666,242,932 *AF556F462BCF54EAD048AF16BA53930D3B07F50C crjhu
1,666,242,933 *AF5040EB7B3BF305D47D518B14A0949C4B9DCB94 chnr"
1,666,242,934 *AF503D957FE0F958F6531EFE65AF9C46E4B1ADF0 CRUZSTICKLER
1,666,242,935 *AF5288F4119D4945636F9AD68D2608B6343FDCFF cruzstmary
1,666,242,936 *AF5EE06D1B987B896C996DF5EDAACCECFB3A11B5 Di$f
1,666,242,937 *AF5879C7830D98B4D01A602D403E1FA1C052AF5E FORRESTMACCARTHY
1,666,242,938 *AF5C30A6082C3BCE7ADBC818CC5B778C8F736EFA CSHOULET
1,666,242,939 *AF530886152565F8767CCEFBB351B40045CBF736 csirpike
1,666,242,940 *AF531707921441F1A88F1EB0ADAE0570BB326DC8 CSKE:
1,666,242,941 *AF50434DD7326439F03C3B67D7D8D9E7E2F8AF83 dipender1
1,666,242,942 *AF5F275DCD6590A8A1F5B6AF2C14B6C597499678 dirkanez
1,666,242,943 *AF513DC69E5DD74A75D853D6A0AD582ACC2BF8DB ci6bp
1,666,242,944 *AF52002F3AF5CA72B3CF5C793D005BE46841C201 ctmhr
1,666,242,945 *AF5255F41FD771BFDFF94B80FACACC12C778F719 cuandoquieroamarte
1,666,242,946 *AF56567C2D2B9010A0050530EFB950803179679F DITALESES
1,666,242,947 *AF5B17AC200EF458779D25A001F53BDC1269D884 ĉjonij
1,666,242,948 *AF5994C0BF5B865AC7619DADE027388254833BEF CWHGM
1,666,242,949 *AF5CA03699563C7481EFA79CDAD6297BFD8FB9B3 DMINGGIA
1,666,242,950 *AF585D0616C55664A70335259A84808133085565 claytonfann
1,666,242,951 *AF5F19B95A5577C51217143131094A93CCB12516 c,xsd
1,666,242,952 *AF524FE849AEA5419A71F450900D33374571B217 d)n:t
1,666,242,953 *AF546800629CD25B077B74D0863BDB8820462EDE CM-1B
1,666,242,954 *AF565CB685B16501020F57C98E857597406F3CD4 c&mv_
1,666,242,955 *AF5C2221C412C62EAEDB15A4E196E2422DDE1AFA GARLANDDEBNAM
1,666,242,956 *AF53664149556C27CD8F6CC5FD297A955CAC9913 donnavelle
1,666,242,957 *AF52C0C232818176D97696A5FB70004BB940592E DONNY.VANHULLE
1,666,242,958 *AF5F70E067866C7517F40DA2BC756DAE25D230F2 DON'T.COME.TO.STAY
1,666,242,959 *AF5903D4C2342EA84D6BB09C598B834DC169D154 dostalo8
1,666,242,960 *AF5E1D523A488ACEF4FF25A56344FA07F406C70B D4RKTOWER
1,666,242,961 *AF506684570AC3FB6A710876EBF33A10FBD73B45 collinaksoy
1,666,242,962 *AF5660CE3A0B51CA8285BC384314D17CBB2FF12E DOYLEVALLANCE
1,666,242,963 *AF57D702942CA2E760F9AAEA1CFD21A139B6780F [email protected]++I
1,666,242,964 *AF50718C23ED036DFB24BDC1906FD3BD1BA9A8C9 DP4M
1,666,242,965 *AF54F19E6D99F91B4F4807716A461A1404131C50 genarooffner
1,666,242,966 *AF564DBF87B6C3775295D7B5BBA7F750F772A873 D!6v
1,666,242,967 *AF53CDB2046D130E6ECFF227AB6F402D6D729EF2 D8G2B
1,666,242,968 *AF5FD48833CA265E59E7E187C1BE5C0FBDC7799B ĊONGŻHI
1,666,242,969 *AF5DAA0788AA9628B95EEB4CC8502A0127EF0A06 d&qww
1,666,242,970 *AF53FDFAA035748294F810A06AFA7125C34BF8C5 DAMON.DURETTE
1,666,242,971 *AF5169634A38B90AF04C4A2FDCA2A9E4CD4EFD86 gihcamel8
1,666,242,972 *AF5741674E6DE73970E1FB8D6F0B16003CAD3BC8 DRIESTESED
1,666,242,973 *AF5DB6776919CE3E75B2B2B1B152965C2715F3D8 COREY.COUNTER
1,666,242,974 *AF514F964E50B68B2FFBFACECA372E05BC57A94E DRMNGT703
1,666,242,975 *AF5C232634F1045B8C1D11E18322EAEAE977DC6C DANTEMCKINLAY
1,666,242,976 *AF52B8AA3B92EC7D5808F8BD57A5B81A263AFEA1 glenpasche
1,666,242,977 *AF54835826C9B8C26FFBF8CAC32D1828E1FF3183 [email protected]
1,666,242,978 *AF5915E8CF5D57AB7BC82B7B1B1DB10299B90240 DuCeSTHeiDoLaNDHaNDSiTToBeLLoQBeLLoQeXTeNDS
1,666,242,979 *AF52750D49AC8F51D9066627E171FEFB62E71D24 [email protected]@[email protected]+E$
1,666,242,980 *AF51707775966C8ADC602CFF4E2F5B77074F666D c:\programfiles\codeblocks\mingw\lib\gcrt2o
1,666,242,981 *AF5BE9DC0935DC4FE38FFB68E372EA218CFB120B c;p:v
1,666,242,982 *AF54A0A95BE748F5C5EF2228ECB0E80CDAC99E99 DAVESCHURZ
1,666,242,983 *AF522F7D40F120A8B226771E318742500B44D0C2 DAVID.ALLMENDINGER
1,666,242,984 *AF56C1B026CEB0CFF2C1933C85B8BE73D12AAB5E good.guys./.bad.guys.cheer
1,666,242,985 *AF5C382ED6E20546BCFEE5D06E8A2545261D67AC DBTIK
1,666,242,986 *AF57CEF0BAC349ABBBD7A93C2CCCF85B0BEA8276 gretelabc
1,666,242,987 *AF526F7B0D8CB6C867A93D735D3D5124962B122B gruttenmeel
1,666,242,988 *AF51B617D51894A8E86A2B0C03B4EC08F8F8CDD0 dda/d
1,666,242,989 *AF50E07683F09496AFC1DBFBFEAFA956D9330811 gusstinchfield
1,666,242,990 *AF5D60BB2C4B92B1CCD475CD3667BEB22C46379F Cshf
1,666,242,991 *AF5B58AC5CA33D8827A46E69AC1E6A51DBF863BF CSK&J
1,666,242,992 *AF52740C44CDF09BA78305AAEDEB685C13ED0DBA h3ath3r-b
1,666,242,993 *AF5ED6D19098CC61F6606EA084F99DB1DDA3B837 EBOTENEM7
1,666,242,994 *AF53B48E2CD2CCA7AFAD208E38461CDC8056559F hallucin3
1,666,242,995 *AF5DCE572DC55F5E0FC7E73B65B870DC6C705AE6 c+)uv
1,666,242,996 *AF5B7AB6BF6B65A2ED58168597765878945DB7F3 HAROLDHUYNA
1,666,242,997 *AF5421D1636E7BC2295948AB4F24FF15BAE95C7F HAROWES7
1,666,242,998 *AF56D9506D530E12F7636CCF93414780B15D2C9B DEMARCUS.SEETON
1,666,242,999 *AF542D6F700D573AEBD3E2AFFBA4FD753A313C62 DEMARCUSVETTERKIND
1,666,243,000 *AF5543D46DF4CC969837CFDBAA2103656A7D32CA CWYXA
1,666,243,001 *AF52A28DD525FF2BC0C4926A5A0746F2DD975A51 HECTOR.STOW
1,666,243,002 *AF5150DE39BE83739CDBD66D3C5C77EAAB5EA0E2 CYRILBLACKMOORE
1,666,243,003 *AF5C5C467DD69B2A982A02DB73F4DB064EA4B49D DENNY.GURWITZ
1,666,243,004 *AF50681878096C49AFF38708AE1D3DE71DF2F547 denyandre
1,666,243,005 *AF5BA0665D1C83C8DEF51F256A82B2D32724358C EFRW
1,666,243,006 *AF5795485E5798195B7DD441D9E3C729F95071C2 egzsm
1,666,243,007 *AF5B20A61AF5A0964BADAA39F604A8512629AE7D D1S08ED1EN+
1,666,243,008 *AF55D9098E03330B45B1300ACBE19F266B625E6F D32E
1,666,243,009 *AF59C2D7E59C0461CD6128BD743F950DBE33990F d4hgt
1,666,243,010 *AF57FF1C30EC988AD7654047FA6EDD2062AF6B33 elckw
1,666,243,011 *AF5C83EF450038A006A9BEF4F3A6871FF97B60BA DEWEYTIEMENS
1,666,243,012 *AF5C86060ABEFFB8E2EDAD687EB7000C1E8C4BA4 HISTORY-(TONY-MORAN'S-HISTORICAL-LESSON)
1,666,243,013 *AF50F4CD40D745DFE9C10B96B34006A6B7CB5B9B dfb"k
1,666,243,014 *AF5ADAC8DF32B35ACB2DD1773B2F65C0A9C4BCBA HOCKEYFENDER
1,666,243,015 *AF505DCD36AD81C775FE081DA7DB889E9DEF3FCA dall’egam
1,666,243,016 *AF5C5FE3B759685A597D706A7594E2DEEF6780A8 DALU
1,666,243,017 *AF58F4A099AA88D0F6EB4A62B4CC7C53B8B60F94 d,)/h
1,666,243,018 *AF5D3B15A619B40806D05E027B504E7F3185E115 EMMITTAMILL
1,666,243,019 *AF5755557305EB287A31E0E87C3D2BB8C163515F HOUSTON.ERNSTES
1,666,243,020 *AF593C8B05640BC15C66C277EB3954D91131526C e-Mondaine
1,666,243,021 *AF5427B3E996386AB23C824DADBAAC5BE8AFD457 D;HF
1,666,243,022 *AF549E55A5CB92DEE7A0E9E0E13CE13E58206887 dhjr
1,666,243,023 *AF53BE2D78999DD826421F59EBA3FCD87348D557 END-BINDING
1,666,243,024 *AF54B48200C41C037E442FCDD2C41444273863B4 [email protected]
1,666,243,025 *AF5E9ABABF8E6CA45F742BEC6340AD5138B66BDD Di$f
1,666,243,026 *AF571690F3FA0CF65FDB08D26872BFBBED4B33A6 DINMONTTERRI
1,666,243,027 *AF51DCB20CCA13DC5972026E6A071FE74FEFA4EE epfbd
1,666,243,028 *AF5627CAF6C94D482E6F0B3BA93F979522B2CD2F DARREN-CROWE
1,666,243,029 *AF555CCB6EF1DCF89A7F7A76FFE31743AD1B4C84 HZ.A
1,666,243,030 *AF5DAD5D6623F39756F8B36FC2AEA3F063E79CC6 [email protected]
1,666,243,031 *AF506EDB17088974B7576CC54453948E24AD6896 IAMHAMILTON81
1,666,243,032 *AF5C2BE21DD90F91CB2834EBDC66C6ED62D442BE dautv
1,666,243,033 *AF54C486B071BFA3DEECBB0BE6117AE13346F761 D?L/O
1,666,243,034 *AF58F5E17B1122151EE5A1DE6BD67075A9155AAF ESTERICI
1,666,243,035 *AF5BC73BE67F0A5C632FC5FA99B5503FE876B222 ILICESQUE
1,666,243,036 *AF506F02FECCB264DDB523AE75DE9F8179A0BFD4 do+1y
1,666,243,037 *AF5BA5C25463EC171C6B7C2BEF30738747AA544A deadassbroke
1,666,243,038 *AF540AC6A149D6F45A2DB26C60A730AFC764325C EVERDEAR
1,666,243,039 *AF53437E2DAA161F19665F576E8D7847301432A8 DONN.ARNTT
1,666,243,040 *AF555C27AB02367A77538F482F710477C93BCD70 EVERYONENOSE(ALLTHEGIRLSSTANDINGINTHELINEFORTHEBATHROOM)
1,666,243,041 *AF5B23EEB4705686E52DB498E26483D6454DD272 DEJINYFRANKOFONNIKANADY
1,666,243,042 *AF5E20820FA648B7E805CB282DDE3F30A70C4CA0 DON'T.THINK.ABOUT.IT.NOW
1,666,243,043 *AF542530F6C088BD9B55258C8F29A378DE5B5496 DOOP(JEANLEJEUXETSONORCHESTRE)
1,666,243,044 *AF5E37EE0A8AB724379A461193EC140FF0BDF498 eyyo [the reggae virus]
1,666,243,045 *AF52C65681D0A680781787BB4A9E1E2CE9FA0548 EZEKIELBREDLOW
1,666,243,046 *AF54A8AC45385E5B274B6723852257BE02518ACE INDBANKESES
1,666,243,047 *AF57927B0486A2670E53D564ED55F27095FFB284 do,x
1,666,243,048 *AF59A5D4C886EEABEB85C24EB292DE891FFC409B [email protected]
1,666,243,049 *AF5BA0E3849B79A14E924CD932F80460B2800D88 DPIGN
1,666,243,050 *AF5A8F9ACBD89186019F07B9CE872563E5A41499 DPRAVIN
1,666,243,051 *AF509942295DFC7262C019AEAE85CF41F2711EB3 DQ%$
1,666,243,052 *AF5DF27FAF74CE78705A24299217C5134E4C31D7 FANTINIS7
1,666,243,053 *AF57E9DE1D0F4E8013F8220277471B17DBAAD6A7 investingforyourretirement
1,666,243,054 *AF56BD74D8A8B173AEF964C4B3CD011BD22CAF7D deshawnreplogle
1,666,243,055 *AF5FC3DAD720DBF66E7A7DBF0D5F3C06BD5EBDDE FBPUTMSG1
1,666,243,056 *AF5095405A6B37B205F0E7E1ED202EB66193B8E4 IPA160NBANDNBK
1,666,243,057 *AF5317D6C6059B7D50EB435DD8E7A8A004493835 DESIT
1,666,243,058 *AF529EAF3253B4E3D9B528100F6A4F6C186D6648 DREAMSONTHEFLOOR:PASSCAGLIA
1,666,243,059 *AF52037C1238A4253F653AC49321A56510651E5A isiahbichrest
1,666,243,060 *AF50553B43013FD2A874EB42DB68C70559EB4E4B DF41J
1,666,243,061 *AF5763AC46E8A1D14A7889BB8F2342E14564384C d:s4g
1,666,243,062 *AF5DB8AC2C2A791B8978A293753603411375BDAA FIDEL.CHEHEBAR
1,666,243,063 *AF5E96D84B7BBFDA05289FC26927DD1CD0911440 ISSAC.CHEATUM
1,666,243,064 *AF5EF4A3ACA621A693BF2B11C22B5F574DDFFD99 FILSTAL
1,666,243,065 *AF51D5ED97A9C42607E929C3AB2297A8546EDACE DG6WR
1,666,243,066 *AF56FE387034D4F373E5C3749F080C5437645E27 I'VE LOST MY MIND
1,666,243,067 *AF56FF99913C71DE5CF1EDCFB6C476AC90FC6B31 DUANE.MCNEME
1,666,243,068 *AF57DFCBEDC9718F3265D80077A4B389F323213F ivpunkwi89
1,666,243,069 *AF566DE5A0674B561E80111CA74A133CEF31381C j!3\
1,666,243,070 *AF5F516D659A02A55246C161C2184DA3BF1B394C diernezh
1,666,243,071 *AF54FC77ECAE52E07859C36AADE603DDAC9CA097 floydbadger
1,666,243,072 *AF5F7F740720B4FC33267362E50D8559A7BF4FDB DVE?4
1,666,243,073 *AF509C45BF4B2BF4DDE341C93A6703FF035F1FF8 jag.kanske.inte.s
1,666,243,074 *AF5ADDBEFD955B4538B38C238A72D202DE37E2D5 JAMAL.IANNUCCI
1,666,243,075 *AF5D770BC0744A8E6A942363A2A0B91F35042438 james.couperthwaite
1,666,243,076 *AF550FD93A22863E4BE6F26633D102A01DFC84A8 fr867614344
1,666,243,077 *AF52DF2C4A2131B87626717B9AA7092188F4E0B3 DWYTER
1,666,243,078 *AF52AE171ECE684768C3B768A2A71A6FE1E515D7 dxc2y
1,666,243,079 *AF550D080B30A302E1DB8EF7BE073CD755B985C1 FREDERICOBA
1,666,243,080 *AF5FEFB66F8C35D8C75AD2D3021E7FF9CA742793 FREDERICTEHNEY
1,666,243,081 *AF5426E02F128206ACB7578E187580A627AFBD13 DYNATRONS9
1,666,243,082 *AF5B87ACDF4484547C4C72B7F1A78FFA72AB2CBF FREYNDIKH1
1,666,243,083 *AF57C7398D8BD1A70889F6085F54B0B33CC38916 E5C4LLONI4
1,666,243,084 *AF505CD3D124B2AE366C3122D79C115C88B5ABE3 JAZMINEKAUR
1,666,243,085 *AF5104152A083D108A1CE634A16132BD59EA9C3A jbj+
1,666,243,086 *AF51C8577B81231C52C9651AC2CC3E0759415C84 JDOOGIE8
1,666,243,087 *AF55BEC1D1CE42F2AB430A276F607474F4FAC753 DlRi
1,666,243,088 *AF541EB24FA4E6CDB0624428B36CE8030449F5D8 JEFFRY.BRLETICH
1,666,243,089 *AF55ADF5FE4A660C22F40DAB76CCE0E9B294349E DMUNDOW
1,666,243,090 *AF52762A317694E832CDE5FDB460249EEDE327AD GABI-NORTON
1,666,243,091 *AF554394E0C50660B84355FB75C1C21CC9B81F35 ECRASONS0
1,666,243,092 *AF55A980454598A4924AA7F45099004DD45F1A8F JEROLD.URAN
1,666,243,093 *AF5C79EEEF8A07A1B1FD9048663A17C13CF0FFE2 ederejlated
1,666,243,094 *AF54232FDC98758737AB2E5D2D6F76069787B12E DO"{
1,666,243,095 *AF5DF0671292D749B89C45532623D0648537FAB3 jerrodtafoya
1,666,243,096 *AF5A9C4B7A4B9ECC9FD58C4FA63AB749FB6C3899 DOCAD
1,666,243,097 *AF5F4750664E99173BF4C6A975AE50736268F934 jess1025
1,666,243,098 *AF508F7779B54F631B8872AF3AA558E09D3F5489 GARRETSLINKARD
1,666,243,099 *AF56AA907EBFC02AA40B2262744A161C392F1E3A jevonmorgan
1,666,243,100 *AF5465355B1362F047BF78F1C7B6A3CB745BF47F GAYICA
1,666,243,101 *AF559664D7979395051FA929FE3BE23C335C1685 EEBA
1,666,243,102 *AF55858F26FCC38D7775C883A6BE798706547DF0 eehb8
1,666,243,103 *AF50B5C54913B6DF6936051FF7810971368DEF3D dongellau
1,666,243,104 *AF54B0BEA5E95C17E1D65FDA7231B448AD8213A5 DONOVANKELTER
1,666,243,105 *AF59B8348387B958E3B8D271F0E47D3C4323B4E1 GEMEINSCHAFTSVERFAHRENS
1,666,243,106 *AF546724104826B281AD60AB97DC2BC60C4283F6 [email protected]
1,666,243,107 *AF58BBA56C752BF1D3C09C43A5F5809469C8E269 EFRENMOZGALA
1,666,243,108 *AF56AF6A94BB89349D896C514CC3EF994F2CE2B9 EFT
1,666,243,109 *AF5BB57DE4FFF5717824588ED2B4E506520E23FD egdg:
1,666,243,110 *AF5B03463C82108641BC649905EAF4B64568BA16 EGREŜHAT
1,666,243,111 *AF53C5D7D2D6C9BCFCFCBC190D2119A2C9C2901A JOHANNAALTAMIRANO
1,666,243,112 *AF599AB959C0901EB5546732357E50930D9D742B JOHN-VALIMONT
1,666,243,113 *AF51D7F8D06F7ADD00FE51C6E38F40C4E1638311 ELDEN.KANEVSKY
1,666,243,114 *AF502BF7B5B49E6E47D172B6B13F6559F36B38A1 D#q$
1,666,243,115 *AF585F01B58E2EC6D0E0F545B82B790F7E883649 ELH%&
1,666,243,116 *AF5D1B29C2D81A4EDF9CFDEA33601B9206A59D95 DREWSUMERISKI
1,666,243,117 *AF582FC6F125E72E73D067B8E5EAABE478DB385A GLEN.SCHLEISMAN
1,666,243,118 *AF58B25950B7E251A2C89F2D3478928FE2A150EF globalgamejam
1,666,243,119 *AF5497FC7BCC786E5F5846738D0107142022001A g-new38
1,666,243,120 *AF5EAF04BF7AFAD07276C55B6625C7F7494FE048 dsgi!
1,666,243,121 *AF5F4971719019D8A4D70D9C736A85BF8356617D goedbbbs
1,666,243,122 *AF55C49AAB677011EC8D168B2D480A42D0F0C510 GOKSNERLS
1,666,243,123 *AF5BE2F7910D56D951DBD91797CCA7D21C8776F9 dtmsa
1,666,243,124 *AF592EF54482C90F7784A266DD6711A9A26EAA54 JUAN.WELLINGS
1,666,243,125 *AF56FCB3790D8F053859BC477D966F06B0F66126 elvispacker
1,666,243,126 *AF5918AD0BCA27F0513561429F161ECA0FB1F1B7 EMMA.LEON
1,666,243,127 *AF59C60167A1D4F160773D4807418E589DCFBA22 JULIEVANGEL
1,666,243,128 *AF56F3E1AC081EE22DD6B91BA6A4D070A43E71DE [email protected]
1,666,243,129 *AF5A5059E25A5D3272CE57826E76BA7EAE74BDAF juniorshack
1,666,243,130 *AF5A62C0F43F627C778B2447BCDD5492FAB643C0 du-kannst-nicht-treu-sein-/-oh-du-lieber-augustin
1,666,243,131 *AF59F877B5975CAAB44877CFE1257F017AD78175 GRAPNELCHAIN
1,666,243,132 *AF58C3978DCF3D5AA01DE155DE167E8787F95E36 DUPJG
1,666,243,133 *AF5C7DB1043B5FC05299EFC4C2FD906C8AD7CC83 GREGGPASHEL
1,666,243,134 *AF5CBB2F82F854DCC4A838B4363B70F1C41DEC82 [email protected]
1,666,243,135 *AF5E09B3162E02E7647693A920B08531C619A59F DUSTINSTIEF
1,666,243,136 *AF514B82D7CC473A988852B4940D987224F69554 K133993
1,666,243,137 *AF5FC0C5D7403C4FF5697ED6B8D6BB9E7F917F8E DUSTY.TRIAS
1,666,243,138 *AF563D68A37E84CBA341ECEE1A09F362DB7960D0 GREGORY.MCDOE
1,666,243,139 *AF533F5C721CACC2769FFA0BF058EA1353324FA9 GREGORY-TUPPER
1,666,243,140 *AF5918C95E87EA5DB42A109F4D398C1878CE78D4 Greg-Smith
1,666,243,141 *AF589899F8A0BCEC9CFBA05044078641358A14E7 ENGYELWAKEEL
1,666,243,142 *AF59469E853DD055C4CCAE2111C4F0592BC457BD DVINSKN6
1,666,243,143 *AF530648AACC4BB1B8A0960EE8E15A80D6E26D79 ENTED_SCOTT_FLYING_S
1,666,243,144 *AF52289EC51E43B16786C1561B5A6BDF842ED2D2 ENVIRONMENT11-041104
1,666,243,145 *AF5519520560D33FC54025CDB074C49CB47A0086 guillermoguzowski
1,666,243,146 *AF5DF29469AE8B29B1BA94704EDCB91426C3C571 KARLA1303
1,666,243,147 *AF50EDD570A3C212BDAE4631B9E0001D7C69E36E dwp%m
1,666,243,148 *AF51E657E7A9D69F449A928B49D38E26CA338BF0 ephraim-lead
1,666,243,149 *AF5B98A90FFFEC3822E525CB0FE73D2AF317DF0D [email protected]
1,666,243,150 *AF5FDBC2E3FE9163DD262B3C7CD66FF80F59A32C EAIBB
1,666,243,151 *AF5293460AE54F48C68E8731F652CA7A6E10F4C1 EARLEFELONIA
1,666,243,152 *AF5D50A7BA71FAEB8203A2D60332FF2C630F741C halbega
1,666,243,153 *AF5061A83AD20502CFD3CA67DAA59E30432C9A7A ERIK.LOMINACK
1,666,243,154 *AF590ED94DC134BD0DB7BFCD6B34305D8D24A219 ERIK.PARTIDO
1,666,243,155 *AF539321CD2624DB793B26A8596B1BCBC2CEA0E3 kelnerom1
1,666,243,156 *AF52DC86B3DD367CAC97A53A484EA9FF15D336F5 HANDELINGSBEKWAAM9
1,666,243,157 *AF59D711BAAC5FCD7E5A55CFD486B8D8FC023830 edisonerving
1,666,243,158 *AF530A0AFC0CFB375C6E1F9B73E76C7DB3A598CD HARD-ROCK-CAFE-PICKS-2
1,666,243,159 *AF59D95083CD7A71BA446438576BC2BC7DD74AD1 KERMITFRANKS
1,666,243,160 *AF5C78A7B1B75053959CD6E31F9BEE57BFBD82FB escenaria
1,666,243,161 *AF5BF16ADE9AD46C8EB5329E35B87F132BAC879D EDWINBUCHELI
1,666,243,162 *AF593B8EAD337492B77131D44710BE404F2CABB9 KFUTHZVB
1,666,243,163 *AF5F50D4BBAE4A4951321BB3D397FE09126AB0E7 eemgd
1,666,243,164 *AF56CD4901338730C16774BE5C87B76F79BC8884 HAWKGAMBIT
1,666,243,165 *AF5F8D9701988BD0A15EC09CF482F52577F40D69 efz!b
1,666,243,166 *AF5A816A2FCC64C9E6969CA18354299CF5254F22 HCXYBXU72
1,666,243,167 *AF53981D45562C511CEEDF53B55A152E79BED1D5 heathfencil
1,666,243,168 *AF5556C9075CFBDF822C69ECC0C9349D25310397 [email protected]
1,666,243,169 *AF55C86D63D6E74E79A21408036913C7DD7F27E2 EUGENEKOSKIE
1,666,243,170 *AF524BEF830E91249D4BDB00D0E8F6F5DF1C3922 ejendomshandlervirksomhederne
1,666,243,171 *AF562760B305288CF5B3AE104E9B916A2BFE71CF HENINGWAN
1,666,243,172 *AF58A0DDCFEE609ED02D22FEC9EE40A625EF27E9 EKILL1234
1,666,243,173 *AF591FB5647CF6FFFDD35F11C889ED528BA7B053 ek;jp
1,666,243,174 *AF5C5B5A8E4762473F8C2815AF49E5062E7BE3D6 KLUDGE0
1,666,243,175 *AF5EBFB150D42A04D6D624E1A83D086231724A9A EWALLI
1,666,243,176 *AF5ABC0F0892E1A0E42864E9B0CB724986EB89B0 kolumadulu
1,666,243,177 *AF524B8E2B38499B343AB5E66B8E1D1F552491D2 EXTRACORPOREALDIALYSIS
1,666,243,178 *AF5E07CA3001BE885905F4B81D1F0713757D61E7 kongen.af.kartoffelvand
1,666,243,179 *AF5A05EB2AE55A4778AE20B02DBAB5B7D551A84E konquist
1,666,243,180 *AF5D43EA62B9933567676177C376B20B00590BBE kristinamward
1,666,243,181 *AF5E26273AD67A81CD50C05E35F3822282436EE4 [email protected]
1,666,243,182 *AF5F99D2A8211842C7D6738C9437ABFECB985DCC kristofergalathe
1,666,243,183 *AF517535C7821D7396B7A1A93361CAC44E386DE6 KROMP4SS3R
1,666,243,184 *AF5EC29578ABFF7ADF794A4D19DB89113A4E67F3 homodynamy8
1,666,243,185 *AF5AD58B44BA03E53434F5AAA33A7B35F20F77EA [email protected]
1,666,243,186 *AF5176B313A3440BDC24E8D3495A1FF5BD1F740E EMERSON.UNGERMAN
1,666,243,187 *AF5C2A3C307DC6B9CF8F6999E37673A3480C95EA emerylupez
1,666,243,188 *AF5B11BEA2A673C7FA8733425AAB3B1B648092F9 EMILEMCGINNESS
1,666,243,189 *AF514B3F613D127F31BD693F1214B8ED0A4C1C32 HOT-ACTION
1,666,243,190 *AF5684114E566251121801EA11A5B02BF879D7E2 FAUSTOSTOUDENMIRE
1,666,243,191 *AF53A4EFBA8129E21A82917B833179E92639428F [email protected]
1,666,243,192 *AF5E65BEAE0E7DF1CAE08BDEC5C51C9EC40692D1 [email protected]
1,666,243,193 *AF5435CEC121E0874DA78A9977BC8DB3E0C2A1FE fc!e
1,666,243,194 *AF5525BEAB9D00379D4D733D0DEA9DC0676873AE L4MBISC4RNOS3MOS
1,666,243,195 *AF509E2981C1E9FEC68D22286E5E47AAAB0ABA7F FE3WAVPO
1,666,243,196 *AF5A27835D2203C11D83094D6563F4DA2B6FC819 LAKATUNAS
1,666,243,197 *AF5C229202937350FA1889A5E0E71778955230E5 felixmodica
1,666,243,198 *AF50DD3B178EC1CCAA7202E74ACDB345236DBC39 ENKSAMES5
1,666,243,199 *AF5F410AB87E43770D712FF5B50AA4BBE21BBE33 [email protected]
1,666,243,200 *AF55046CCA90BE65E816247045AA1A5FF53923FF LASANTHA THILAKARATHNA
1,666,243,201 *AF5EE0E15F6F680440655B95807E6D8394124965 latanga8
1,666,243,202 *AF5150C2654D33949147B71F302B77F181A99C3E EP6!
1,666,243,203 *AF53F3AC69C3911F2C7927FBD8E1DA3DDA4ED11E hueydouillet
1,666,243,204 *AF51904B70394576ECE565E30A2578DBFD79BC9D EQQSW
1,666,243,205 *AF509CB6A5C3446B069C3BADCDBB2ADB8E03F3B9 [email protected]
1,666,243,206 *AF502E1F5C4312CD2572ADF30ADEA5F0BF44097B ER-"
1,666,243,207 *AF539A0DAF22BD987B71100AC3836DCED9403A80 ld$5
1,666,243,208 *AF5E97D245742F2BD65537A4DF6F458640BCBAF8 LECIVEHO3
1,666,243,209 *AF5F442CD80586894131936C682FC8123ED8C7A0 lefou
1,666,243,210 *AF55F96B58F4CB94E25EB458059605715FD99C26 LEIDINGBUIS0
1,666,243,211 *AF55DBF58401F6EEEF2FEF6E824C620079E943E8 le monachine: fughetta nell'orto
1,666,243,212 *AF56C45501E4582AD897D6746B1155A5F87AA308 ESPORTSGAMESBELGIUM
1,666,243,213 *AF5E4A233AA9C842CDF746F35BDECFC00E5F58DB leonard1234
1,666,243,214 *AF5358E9EDAF3A1A1F88F8C117032101A659E6DF florentinobodkin
1,666,243,215 *AF58E2802E596469F4EE639E9F6CC7E41044DA77 LEPRÉVOST
1,666,243,216 *AF5961252057D056EE880331DEF8CE8448340BD0 LEROY.WEISER
1,666,243,217 *AF5A00AC54AEF3FAD9C405FB1A62DDDF6E3EB099 LESLEYJETER
1,666,243,218 *AF5D1FDCC830DAD3D7F99A3C39D0971B4CA9FCA6 FORPAFUS
1,666,243,219 *AF517D5113C67360341428D1C8A10E4872E8D33C EVOHDNIW
1,666,243,220 *AF55E182AFD58688C02000266E790E7893B7419C liezel.groenewald
1,666,243,221 *AF59CE8B902FABEEFA3942AD06C9CE56618F1664 if it finds the pattern, it prints the filename and line number
1,666,243,222 *AF53E9555D9FA574689B737D75F76B24B9E5A316 ijnwreckanalysiskaga
1,666,243,223 *AF5177D4DC59334AC8FCC7BC8FEB2E7EF3408FE7 LINCOLNRUBINO
1,666,243,224 *AF5DF48293EF5A6624B642A975698B3C6F943C93 FREDDIE.TAVERAB
1,666,243,225 *AF508CF731AE45352E9C613D9C47F2202F725ACE (iktumi)
1,666,243,226 *AF5911E558237040AD233BF64BF8F89C7E896590 ezoutene6
1,666,243,227 *AF5FBB4A08493DB7309993E3826D7CF8C60AAB90 LINDSEY.KUHRY
1,666,243,228 *AF589DD4061068D6BE67FAE02D8313AA9AF6F83A ILIJUTTU3
1,666,243,229 *AF51595EC596D23D321E80454F050B7826688D16 I'll.Never.Stop.Crying
1,666,243,230 *AF555452AD7BCE504840CBD2A7714576A582C15E F36469AA982733D59E5E91F5F366B77F
1,666,243,231 *AF521C08DB6BE5B62E79C1E51BE6371D0282A7E6 ILLUSTRATSIOONIDEL
1,666,243,232 *AF57FFBFB8A9A16C2326635B3A58AB21B2700FAA [email protected]
1,666,243,233 *AF50432B550851B46070F3FB4465DFB8CF294636 [email protected]
1,666,243,234 *AF54AAD2F2A1B03A38A48B1AF5B0AF26F79D1FFF F57246441
1,666,243,235 *AF5DC1C2B81F1C0A2B570A77CD063B116445E0C9 ILOVEARLENE42
1,666,243,236 *AF5435761CDB1A8BF493EF69B1B5600193632856 [email protected]
1,666,243,237 *AF5A2CE727E27FE8978F9602724C1A1C8CE59EDA frigjorte1
1,666,243,238 *AF5215731F86B1F6E40F6F0F4539F26573B4BEBF FABIOCASANOVA
1,666,243,239 *AF573F7B019DFF421EB82CAFD2978A681E2BD113 from-memory-(matrix-remix)
1,666,243,240 *AF5F18E0C170966056AD1B22B31FAFC525AD37C8 impregnate/v./I/m'pr/E/gn/eI/t
1,666,243,241 *AF50FAE9EF8041E7CF0831CDAE4E2B8E8D019569 IM|Y
1,666,243,242 *AF53414A810DCAB11A194688C2F5ECD239E56AE8 funkjunkc
1,666,243,243 *AF56F736C290DA04923533E80DECCBB41977B797 fwj
1,666,243,244 *AF5B32A48AD5A7DB75C436E5E39D150F8D9EC94D GABBINGSING
1,666,243,245 *AF5DA3E564B46596CD063371B2FD57786777B00E inparticularly
1,666,243,246 *AF59595376B3F9508368B69041EB10A81E2DDF4F INSOMNIACMAGAZINE
1,666,243,247 *AF5A509441333EA000884617861D9C181D5D6F20 LORENZOGAWLIK
1,666,243,248 *AF511CEA087DCB61440FE8466CE9F98A10298E32 FEUDED3
1,666,243,249 *AF5315AC82E545CE0A29389660507D179F6BB049 FINDTHELADY
1,666,243,250 *AF55DA5A221587025CCDB44F14541928CD821F7E loydkaperonis
1,666,243,251 *AF5C7E1134820A0FFE8599B7632979F4829C2BAF LP`(
1,666,243,252 *AF52901563837E963C48366ACBCCD88ACC1F39CA [email protected]
1,666,243,253 *AF5C6C06E817A384DDE14B2EDB4F2427445DEED7 [email protected]
1,666,243,254 *AF52DCAC39039BAF8E11A59ACFB891469B0BEEF0 GEBÄUDEBÖDEN
1,666,243,255 *AF5D52576154830F02D19A7FF58304C54852CCEF ITCHET
1,666,243,256 *AF52358EE6A8FF1E197DFEE3CC664819A3D9F8B2 ITMINEFIELD.COMWWW
1,666,243,257 *AF5386EE6D7F40E0BE8CDD0C8718B3D08131D9C7 ITRAIVAL
1,666,243,258 *AF50FBA67D7A55B6DF524F1F352F8F0A2571164C !FOLKLORE
1,666,243,259 *AF54E53328C898D50678BB9F443A7CDC4F556E5E LUCIUS.MEDLER
1,666,243,260 *AF5F14093468AE8C3CEB30AFE1591A67047D44CC GEKKIE2
1,666,243,261 *AF5EDEC517311FAEA1BD69E8E1AE9058BE3584C7 george_simpsonhaywa
1,666,243,262 *AF531D8E52F367B39C2A84E99A2D29DCB7221B97 fourteenfootshoallh
1,666,243,263 *AF5C29E52E1ACAEA57A625B8AC5B309F7570E391 JACOB.D.BROWN
1,666,243,264 *AF5BE2697BBA51B247AC6276AA3B6B52BCD71090 Jails.and.Bombs
1,666,243,265 *AF50A7F375C648AE583BFF069152E9DB350F49BC GETAEAND
1,666,243,266 *AF56E1A6C15B9101ADCE038741BFDB34FB8D2729 GET-UP-ON-AND-DANCE
1,666,243,267 *AF532C4C7822036E6B6AD0A3B13ECCA678E844D1 james-briganti
1,666,243,268 *AF58D260C6CF8021CE2ECF3DCB2F97E566AD0A76 GHIBELLINISM9
1,666,243,269 *AF592EB0119FC98287B1EAF0D5C15905DCD8E534 MADISONN
1,666,243,270 *AF5B24E65B49F74882E47EF4B41C01D3ED7B5077 JASPERMANLOVE
1,666,243,271 *AF50A56778522537825D68457C762910595FBA5B FUFORE
1,666,243,272 *AF5092616473B9CD819911761FEDD9C669D7016C mamma'sboy
1,666,243,273 *AF58F163208188E25FEEC74564C5B74C49F22DB7 gitasep
1,666,243,274 *AF5D668D00F67C04C63668EEAE205E0933A799E8 fvdfvsdfvsdfvsd
1,666,243,275 *AF5D875885FB345BCCC2E55556FB073E6980547A JEAN.PITCHFORD
1,666,243,276 *AF5AAB19C9DCF8FCC64355A3D7EEDFB65661A246 GLASHTTP
1,666,243,277 *AF562A3DA1FD06D5EA4E9DC575EAA09C4C77D421 marcelinoshah
1,666,243,278 *AF5C72E4E30F41454123D74A2506631AF58B11BA MARCOS NINO
1,666,243,279 *AF562F3C9188A1F64208A3B96F200A4CE9DBC5E4 GALE.SHEETS
1,666,243,280 *AF5B47B96CC3FCC7A184114E3258F51F0C2EA2C5 [email protected]
1,666,243,281 *AF5F8D96B096ACA598DD97656418F4396861DC35 JEFORESTB
1,666,243,282 *AF5B205FACEDA28BC6A77994C4C8022678EEF059 gary-sasaki
1,666,243,283 *AF5D40C7E50D4AD9B8B38D43605E5772259EE7E7 MARLINI
1,666,243,284 *AF59B32C99A65605DEA7A9B12789BB82E9B344A3 GRAHAMKYGER
1,666,243,285 *AF52F71E2B2BB28FB9055908603C3B4A6A15FC4A mary-helmick
1,666,243,286 *AF5EB2D01ED39EE81ECB135D689F7FD7E56C734A GEORGETTE-CLEMENT
1,666,243,287 *AF56E17BBB9F6C13D8BAFF27B5B2ABFD155BC598 masamitued
1,666,243,288 *AF56189B89439943E1406724D2832F18DC80CB72 [email protected]
1,666,243,289 *AF5B90BF62AB06E7DEB733BA664EDED28662E9D6 GROVERCOLEBROOK
1,666,243,290 *AF5BC3ED694D28EC69529C56FB95CADE50AB6D5B ghznqmqv6
1,666,243,291 *AF56FEA26AC2F10EBD978653CF174EC42E4A42E1 MAURO.KAHAHANE
1,666,243,292 *AF5E6BA321F0FDB61C5415B7E89DD6333C14E83C jissitsu5
1,666,243,293 *AF51A12F6EDE8593905775318E7D3344A7B40C15 gillesbrunner
1,666,243,294 *AF5E5EAF786A9C7E471F49D5CF0E76EA1F45BC73 guatemaala
1,666,243,295 *AF51122ECA6781B45919F9D4E34A4B3A14B1EE80 [email protected]
1,666,243,296 *AF5DA405870836940029A2AC3CBB44024D194CB3 gusgunby
1,666,243,297 *AF5B12F23FE9B1046200B6796A251CC6264D4745 gustavoquittner
1,666,243,298 *AF510A021B915623159DDF9144DCC0BD061D5886 JOED-GENERAL
1,666,243,299 *AF55A6278DEA583CB9C8BA0C1C1543702A9AA2FE [email protected]
1,666,243,300 *AF53031B93662542A80E66EEBE6875277322EA72 JOEVALERIO
1,666,243,301 *AF54DD223810F012790B6DDEC729529C12445F27 GLUT2
1,666,243,302 *AF52ADE825798361CCB71111892765C278236B2F hakawatis
1,666,243,303 *AF5B24CAF72E9467C5968A3AD65A83592DDF0914 HANG-TOMORROW
1,666,243,304 *AF52A26F995076AAA28C4AF435E72CC6B2D6E8DB hannah-gilman
1,666,243,305 *AF5344D56DAECD0DFC199B0E70A0CC4F2E482396 JONSOUFFRONT
1,666,243,306 *AF5812B2CAE06C80AFA422427D85832C2D78C62C [email protected]
1,666,243,307 *AF51E6FD8937FE311187C2EF75466E71E5DFDD0A [email protected]
1,666,243,308 *AF57BFDAE55D12F30A9D83395F8D8372F05EDB35 GRAFOL
1,666,243,309 *AF5D41B5BC5A5DBE84F005BDB3AD72F1CDE2874F GRANDIOSE5
1,666,243,310 *AF5879A5ABDFF99728F9F60499597B4B38D91678 HASSANHIMMELSBACH
1,666,243,311 *AF593764061067BBCAC2D9B3D027ECC2C58D2021 micahbonnett
1,666,243,312 *AF5F6B283D05BCC6AF1023962FF2D523DA388520 HAYDENKER
1,666,243,313 *AF5A19DDB8755561F837B622941BB2D917B677D4 michaeljholder
1,666,243,314 *AF59CDB53D8AC8D3F3E29A568B1546424E0AC6BA HCOSIKISING
1,666,243,315 *AF5B29600320BEA96DCEF386E46AA47A22CB965B JSIROJ
1,666,243,316 *AF5762D2874302CDD3C56746FEA35E2F9605E6FB headpenn
1,666,243,317 *AF53CA02670C1F244524E1C48BD69C4E0B67D3C9 miguelvirostko
1,666,243,318 *AF51E913AE7004C3AA5FD4E471BB7A12158D2AFB MILLARD.BENDICK
1,666,243,319 *AF528C139210A64340F586DC4527FE21C8765E52 MILLARDGESMONDI
1,666,243,320 *AF51370CDF76E3DB04E92E10968A3621678D58DC K800924
1,666,243,321 *AF5B14946C7232C9C0D2906EDB0E51AB42C82767 [email protected]
1,666,243,322 *AF51A6990557E923DA6D7B2DFE04A87E118E62AE KADEK DWIPAYANA
1,666,243,323 *AF5472A84450ED3055077D61A16C1282CE9829D0 [email protected]
1,666,243,324 *AF548F1102DD0B0DDB8CFA7F04BAA4137C8C681F mitchelmckinnon
1,666,243,325 *AF50296DF1B6E99B5151127E9AD18AF76DDBA3D6 MIZZJONES08
1,666,243,326 *AF57AEC7D8DD23AF45D755829EB716A6D4C4BB22 gymnastmariah
1,666,243,327 *AF58E22104A9D271C25E35032152BCA8297962B8 h3ath3r-b
1,666,243,328 *AF5123536B3D5B6DAFD8DA0A3684461813D5EA00 hinatahiuga
1,666,243,329 *AF5E86D3C593A4959213DE86B0C96F5A764B422B moiseslimberg
1,666,243,330 *AF5764ACAB6CAA18DB3C44613BD338E5A5B71FAF KATHY 'KATI'
1,666,243,331 *AF5E5A7CAAAD610039ED73F0DFD60076A62635C2 KATIE-FORD-SMITH
1,666,243,332 *AF531E895BD362EC216AC879A283EDB770DEBF81 [email protected]
1,666,243,333 *AF5EB3645ECA2AB5BA92CF2A12DEAA374047771C HAKKYO07
1,666,243,334 *AF590BD1BEA5290086D7E6496284BF9661F3AF06 HALFHOSE7
1,666,243,335 *AF5D35B152ADD57608770C1C4527C41D9C5E9085 KELLY.ARWOOD
1,666,243,336 *AF595315D92D2B5DF322E85B281B6C928EB412E1 HANDCARTS9
1,666,243,337 *AF5590D9573B5653A5B66B50C2562B20A61A2BE0 KENDALLHARCAR
1,666,243,338 *AF56C96FD9CF3E5521D3712C2E87434ED7D75B26 montymartello
1,666,243,339 *AF5049457A995CFB442C51561ACEF4667174032D [email protected]
1,666,243,340 *AF5143827C398270CC64069E60740A85640D4E84 HARLAN.VOGELZANG
1,666,243,341 *AF54EDC0784ECFDB204196B7B3B29C007F58259B HAROLD WELLINGTON
1,666,243,342 *AF549E575C90B0CF01CD9AECA841FE87BEC6851A kennyparmantier
1,666,243,343 *AF5444D091DB6E40A34EB59CBEE74440C3D64D1D harryzeilinger
1,666,243,344 *AF5F5AF336CAEF0A0E9E543C38FB2198E6A47CC0 [email protected]
1,666,243,345 *AF5D48FC9E6327FCFAC171BB08F9BC5CB85EF18A ha!r$+y1!n9
1,666,243,346 *AF523906719ED55E726D1C0A8F42FB26CA3D8A57 kerrydeojay
1,666,243,347 *AF533CF3616A784017CCCF179890D89D46F083D2 MOVEMENT),又被称为
1,666,243,348 *AF58137FDF20D119F84DD5C1F335D4DC8B178AC5 KEVIN-MILLIS
1,666,243,349 *AF5668D748FBD1D5931D399C0E0B300C7E721CBC MRCONSISTANT
1,666,243,350 *AF5C57FE557362C1F6BDF33A11D8ACD08A4F5C4A [email protected]
1,666,243,351 *AF5203AFB6071DDA89CB6A133793D8DC99BD2F5E KIM.PRYSOCK
1,666,243,352 *AF5796F71270382E22952BFD43E28518BF1967C1 [email protected]
1,666,243,353 *AF522D50283FA6104D37D14901DB93F1BBC7AB88 hrevflez7
1,666,243,354 *AF58B4E87DC8286D3B00C833DB74088A1EBE183A HSTILLION
1,666,243,355 *AF54DA3BFD2F49C9F73658AB44C0480E589765DC HTOOMSNO3
1,666,243,356 *AF554C81D7E04C0B289DA0C978E457F8F826243C muttels5
1,666,243,357 *AF5EA7DFDE582B78D913446CB29C8C4B89F6A07E HTTPWWWICWE2006ORG
1,666,243,358 *AF508E46CB37A42809431216A5490E09D4588721 MW_LITTLE
1,666,243,359 *AF5E57A22BCD94762F399D77725AA91920B3BDB6 KLEBERBUENO
1,666,243,360 *AF5DC67FD66F65AEA272EDDC9713DCC4C394E2A7 HUASMU
1,666,243,361 *AF5B32D9C2C7E4BFEA6BD9E0F1C38DCA5DF9A2DB Hey,Grumsky,youlosin'weight?
1,666,243,362 *AF5F0185497156664149C9E37F927D9125167DE7 MYMOJO1986
1,666,243,363 *AF57E97A04D07E218AAD399E6C38DD509EC5A763 [email protected]
1,666,243,364 *AF5B67B57D8AB7ACC2FB30C86E468942F911876A [email protected]
1,666,243,365 *AF5FB3068700FE585CA437231633EF8AF358B9E8 MYVICTORY07
1,666,243,366 *AF56C49994CC246148888CF801C690E883C914E8 KOSMHTIKO
1,666,243,367 *AF56E5878BC9BCA9C9DA2CD99D982174D7AFB6C3 H^N1
1,666,243,368 *AF50A8C334398CC959B956E98103BADA80FCF910 NAHPNROP
1,666,243,369 *AF51FF844F0E3186B7CB7B00D4F3D986CC112B5A HÖHENWALD
1,666,243,370 *AF5A2F80CA4708813FE43708397421B9FFB5EC85 hyp0cr1$1e$
1,666,243,371 *AF52F0F231329DC7C1F585B033C9496F7C1C80FF NATHAN.GIANCARLO
1,666,243,372 *AF576B97AC7766EE093DB79E23293BA23180AAD0 nationaliser?
1,666,243,373 *AF5AD1A731327AFCCF92CE091BAF507494E162DE IAMDIANA55
1,666,243,374 *AF5DEB01CE5DDEB4BD987926FD362513047B5772 KRISTINESHEETS
1,666,243,375 *AF535B00C48BE382328433A936BA21FF6E2D4A49 KRISTOFER.MASEY
1,666,243,376 *AF5838BFA2E321E8CD2386B9A38B91DD219BC902 IBEKOYAM6
1,666,243,377 *AF5BF3F049E1F25D33E5E70ED5130E991B95EAB0 kummulla8
1,666,243,378 *AF5BB35B027017354273A32C5421010A41A7FABE IEKAKUF5
1,666,243,379 *AF54E038E2429619BC4DEF84969F210893A26AE2 NEAL.EKHOLM
1,666,243,380 *AF5DB7505F243F7DDE64BB713E97933F6F53FA4B HUISVESTTEN
1,666,243,381 *AF5111A9FDE5E6274F88919C14076A64974229C4 NELIGH.
1,666,243,382 *AF5698D718E6AB2FE13F363D224D1B4BA3BA6FE7 ikedampier
1,666,243,383 *AF5289990930505899EF54EC5C6D4C9D14D29E2D LAHARS
1,666,243,384 *AF54119444CCD55588A3A7598ED0D1D4A17137FF I'LL.BE.UNDERSTANDING
1,666,243,385 *AF571A3E4785BD805F9DD3F94CF993F786B109B6 iaiccaffa5
1,666,243,386 *AF5F1724B0F7B7C8383F56206462FA16F2EA3C01 NGLINGE,-RITTER)
1,666,243,387 *AF5515ADD4836718C09D6B0AD02789B50B8E6CA2 nicholasacevedo
1,666,243,388 *AF56B867F349C4A1383AA7197C53520380CE7796 nicole-miller-runway-mix-(fall-2008)
1,666,243,389 *AF52A04ACBBA467C9B19170201CCBF6E4F9B8443 NIGEL.VASILAUSKAS
1,666,243,390 *AF551F66DB1E3EA0CA75A68E8E4B4EF863E422DA LASIMON8411
1,666,243,391 *AF5C52A646F4C9A28AF64EEB6E9BC54DB28444F7 nismofo
1,666,243,392 *AF5AFF70AC2A7C55DF7B155980642525ACB93599 INCLSIVOED
1,666,243,393 *AF5FF0C797AE6C3289DC9BF51158484605222058 if-congress-is-not-in-session
1,666,243,394 *AF5706B8646883777C7B77DB30193F3BDD9267FD LAWCLORIS
1,666,243,395 *AF527C24A207FDBAC8F4C64047CED5268AA2F23A nnfrtlty6
1,666,243,396 *AF5773C410B1784A5CD16579556E41B471238943 IHCANASA2
1,666,243,397 *AF54269F5E6EB91D296152524F4CD1E388BEBBE2 LC(2
1,666,243,398 *AF52C3F2370A508E370DFF695153F6702154D05B noe768
1,666,243,399 *AF5BD14B2362490F5D552F3197F9666E559CFE1A LENARDREADNOUR
1,666,243,400 *AF515F890053BF1C482C5AA4640A48D4AC9CDC10 INTELLIGENCE.DIFFERE
1,666,243,401 *AF5453C41BE7360226BEC561C6B5819B9762F7FA NORMAN.HITCHCOCK
1,666,243,402 *AF526140371CB0CE2A77B4C07AEB74B647AFFA32 INTERSEXES
1,666,243,403 *AF5674EE5B8318B27A91EF2AEFD58BA1358E178E NOTOBSW9
1,666,243,404 *AF5B94EE3B1599F6E53C21A8C92FF856324C647A NPPRHNDBLY
1,666,243,405 *AF587102D269E012C8C2429464C9360928FF3DFE LESTERHARRIGILL
1,666,243,406 *AF5E28D96D0368C865EE41117E62E1C0B50951C3 LETS JUST BE FRIENDS
1,666,243,407 *AF501194F17DC026EB96DE9335BBBBE3D16ED738 NX`Z
1,666,243,408 *AF5243E3D3F89E6F364512D5C1E7738A14F0EF36 inflarles
1,666,243,409 *AF5745817BFD3E34A79F670CEB275F62E5452F78 INLOW123
1,666,243,410 *AF5D42E76A586E7FEDC639D2BECDA1CEC0C264F7 inntroendelag
1,666,243,411 *AF53E64385577AC9A7B23A6776242FE6D9EEC229 LILLIBUL7
1,666,243,412 *AF589E94B636FF07E6ED1A3408E9679F85EB01F9 LINDA-MCQUEEN
1,666,243,413 *AF59910719BF50B91EF2F446D604A5A781AB44AF LINKSMOS
1,666,243,414 *AF5D14CEE3751920E502C741323C63200983FFE0 ocklynge5
1,666,243,415 *AF5FB65D8974A344F6AB32BD5EC7D9FDB6009423 LIQUIDCHILD/DIVINGFACES(CLUBMIX)
1,666,243,416 *AF5A85CF9B3F947171F3864121A71304C16D9D9A [email protected]
1,666,243,417 *AF552443141181B2A2534121528A36EDD24AE648 IT'S DEJA VU ALL OVER AGAIN
1,666,243,418 *AF507112FA9D1DA3B26C2C842B4F1C97C90317ED IUQVAA
1,666,243,419 *AF5117FA0967E68155136E8FF4B2BE7930A6F88F LMANBODH
1,666,243,420 *AF5BEC996811BA0ADC92E84AA3B3CABB211FC93E ipoemia8
1,666,243,421 *AF59861EDCE236D5F754B129B2AAB230B4AD09A7 IVAN.VISICK
1,666,243,422 *AF5EAA0F19929968EA0C9FA26428C5E2A85CCCBF ircd26scalacinemalondonfeb291980(partone)
1,666,243,423 *AF5EAA5E617DE454AC9D91A29C48C68EBFC5DF86 [email protected]
1,666,243,424 *AF558DFC59C648871258055BB1BBBA9A373E2895 irwincarlini
1,666,243,425 *AF52482E8705CEA41427A48EF18A97EDF51BEFC0 LOOEY1
1,666,243,426 *AF555E6A412FE3351F28779EAD63258817C0395A loshalened
1,666,243,427 *AF53E6F5B7D3BD0983D8C820DC39442683720575 love.stricken.felony
1,666,243,428 *AF5FCAAA4B39D88FB5042977BCA7A74E39B9056D oot-kokonaan-mun
1,666,243,429 *AF5A7C7305B77E7D85DABF59905E28B212B904F0 LUCENCY3
1,666,243,430 *AF5B484E855281FC1049D0D993C050F316E73C9F JAMIE.FOLAN
1,666,243,431 *AF5AB2BCE14ED1D8D2AAF118EF2650832DEF518C ORCOFEGLINO
1,666,243,432 *AF5591C0EAB74CE7DFA65ADDB0BE0E3C22C2836A JACKIEJARMAN
1,666,243,433 *AF5917F18E37392CF193427A569BEE3935961BE8 ORVAL.HADDAWAY
1,666,243,434 *AF53C4DDB9CA8C6758A11F546F76C1B95D5BC8B4 JARRETTCARROLL
1,666,243,435 *AF5464697487B47E98C36E50A812E4432EB4B99B LUKEMORTIMORE
1,666,243,436 *AF56D74AE1ABAC14C2435CF982F9C412AF2735B8 [email protected]
1,666,243,437 *AF5DB519BF4568FF742DA86C0FE865369C6D2875 jameygalo
1,666,243,438 *AF5E7FF51B5D6F09D5A7FBADC8692A855A2C1A3B JAMEY.VUKOVICH
1,666,243,439 *AF5FF22F6C2F7412C8FDAF95D725FD899DB861F0 P75645
1,666,243,440 *AF5D0EE0ED64CF34D02BC7A4366151F9AC03A0DD p======>*-}8{
1,666,243,441 *AF59C5F8EDF01E70B58E74EB5C9D5888AFE75943 jamisondillow
1,666,243,442 *AF522C3E3EF4925E450D8FD92EC5C94569D1830E PABLOELLIS
1,666,243,443 *AF5F697B7204B1B0472C0B46B2BA558E759A6BC0 PAINGEN
1,666,243,444 *AF5BA2121F19013DAF53818692ECD9AE7B46ED33 JENIFERSARAH
1,666,243,445 *AF59B66C91F2F034A180F4261F51BACAD054CCB9 [email protected]
1,666,243,446 *AF581A5098A902747741814733E31D204E263E75 JEROLDRINGLEY
1,666,243,447 *AF5E05EB164975199D0596F34716A038B8C25A91 parisorndorff
1,666,243,448 *AF5520F55D36FC0C1DE6BCCFA94E29F393C307B5 JAYDEVARONA
1,666,243,449 *AF55DB6E4ED27E5BFD11562632AE265C1010786A PAROISSE-DE-WOODSTOCK
1,666,243,450 *AF5142CEE1DDBF6354B009E13970FCCD849F240A JAYSONYEHL
1,666,243,451 *AF5FCC46A8E5C9A48AFDBF73CB4CE12C18634CB4 malakhov1
1,666,243,452 *AF523BA76ABC76C4FDA341678FB07F332AB25661 JEANNADER
1,666,243,453 *AF55B2E64466C34E09152B3A051EE42A42FBFED4 JEFFERY.SHIROMA
1,666,243,454 *AF541916BAF251B2D6FB232337798EE1DCDCE609 PAUL.MADEIROS
1,666,243,455 *AF53556863C28537E03F463BB656A8A459F6FC27 paul-mockus
1,666,243,456 *AF54BFFF7555A6F69B045E1314333B7BC55E292C J'HABITAIS ST GERMAIN DES PR
1,666,243,457 *AF5184AEC0AD5E894165DEC3D8636EDE21558983 [email protected]
1,666,243,458 *AF580072D7D1AB354AEDC5E833CA383F949EBE3D p======b-~o-~o-splat
1,666,243,459 *AF529334620A5EFA1BB86A60D38243CC1712A79A P==D-`-)O(
1,666,243,460 *AF550AE694C1241BBDD3B33208D1558469F63EF9 jerekesler
1,666,243,461 *AF5CD59991DE98F3B76885CAEBE9FB10BF649E4A PEDIADONTIST6
1,666,243,462 *AF5DE7076EC3B3F87CF304E5EAD34CA3D529F4E6 jerick.tolentino
1,666,243,463 *AF5174197E89625AA81640720477151A14D9AD57 jm0e
1,666,243,464 *AF508B139D4ECFA9F6E7D6097FDDDF4CB4F09EA5 jerrodgarrettson
1,666,243,465 *AF5BE6BB795DAC9E0610431ED661933F97A07549 JODYBERNERI
1,666,243,466 *AF5A12292A5BEEA13875EB69008133F229BF646B JOEARATO
1,666,243,467 *AF50BE16D847EE01DEE5E43257ECDEC8D1E27B80 JOEBRANNAM
1,666,243,468 *AF5915FBDA3285A1384EC156D6CC686CA279F041 JOECONJC
1,666,243,469 *AF5DE8D24651964BFAC47E5308FADE1001FE59B4 jestprooves
1,666,243,470 *AF54E9B02D1BCFA17D36224A148BE2FFE6CE2DCD JETTIEDS1
1,666,243,471 *AF5BA3404317A95B2F99B6BEF3BA89AADBB59749 marshallkinoshita
1,666,243,472 *AF500DE370E5E75E51F19F85F8FF43AD45FB8CA1 [email protected]
1,666,243,473 *AF5640F5804E04EFA779A441BDBC6716504EA2BE [email protected]
1,666,243,474 *AF5E4D7968EC7E059D036AF4D560AA74F5F75345 philippose
1,666,243,475 *AF56E2E3ED6DED20D8EC68C684E100A9C451C61E johnrobied
1,666,243,476 *AF590D18EDA514DF2A4A80B5C7E8B910F6A9F514 masondoose
1,666,243,477 *AF57CCEE1B8FEECCF65E24A64E968FAF9169BBE5 MATADOR AND MORE...
1,666,243,478 *AF5FC6D7429978C16AE452FACC771806371EB35A PIIRTEIST
1,666,243,479 *AF526A9373D93A90DAF2A3B0C643A3480AF729EF JOEDRESSMAN
1,666,243,480 *AF5CA7BEAA2F1E471D2FBDA07CC0D4EE54ED2209 JOSHUASCHUYLER
1,666,243,481 *AF5FBC02973981CF55509BD9ABF68699EFD438CE JRG+
1,666,243,482 *AF5E35470FBB4BFAECA606EF56149B110E7EB4CC mcK
1,666,243,483 *AF534EB088FF3E5ADC4836A54A6B261855BC550A JORDELIV2
1,666,243,484 *AF5F0C4C3E8AC9A26903D5F6613EBBF85BADA37F POLONAISE,OP.53
1,666,243,485 *AF564BE5C56504CC9B4D71AB5BC40B9A047B3692 [email protected]
1,666,243,486 *AF593DEDAE4AE10D073CFB5D0909FF56E37C0EF3 MEGANDETRO
1,666,243,487 *AF56DEF732DEEA9B77E89578F78467BF42ECA9AD MELBALLEW
1,666,243,488 *AF5D31C81D58B7CBCFD3B918455FF0F9E2B79696 JOSHUA.DUTROW
1,666,243,489 *AF501BEF52567616743640F36E1372C0789D657E JOSIAH.VASQUES
1,666,243,490 *AF507456BB3826E968EDF193C9E4B9646C904D9B PORINGLAND10
1,666,243,491 *AF572A4E554DD5A567C0CC850C1D4DCEBC73134D MERCILESS-OBLIVION
1,666,243,492 *AF5C27048664BBA48977C4ABF503A901CD52833C MERCURY-DICHLORIDE
1,666,243,493 *AF5812D338E3713AC0DC85B17A4CB983BE362650 [email protected]
1,666,243,494 *AF5B716BE5D4F98DC98CB61D45DF0F3EE78D985B jybz
1,666,243,495 *AF565B7E2B545C00FBA913B0ABC44F8D82EFD24C JSEEN 1 0
1,666,243,496 *AF5C96C5FE27F52E093C276217CCB3BA81DFB6D3 K208948
1,666,243,497 *AF51A48C354ECF7A3CBEA307A8230F82A56EE800 k\6o
1,666,243,498 *AF541FB4CC6A11F5FB87FEB3F39DD046B9BAE181 KABYLE
1,666,243,499 *AF5E7490D8DCBA8A4B65D4D974377596A9791E86 kajalahuja
1,666,243,500 *AF55DCFF84A4DA3EB0609A4C8526EA1149BB5C1F julianconery
1,666,243,501 *AF5C084FCDE3C15D5D287DA4C5DB7294006107BC MIHAIVITEAZULINREGIALUISERGIUNICOLAESCUCELMAIVIZIONATFILMROMANESCININTREAGALUME
1,666,243,502 *AF549D8FF0884F45149D46FCD73FCECB644B9866 juniorvoorhes
1,666,243,503 *AF5E9D21BB9AFC7A5B6D4CFFAB22E8B6F52B3DEB KAREEMCERUTTI
1,666,243,504 *AF50EFED78B235E2E23E10BDB416B06E5F77E656 prcssnz0
1,666,243,505 *AF5DEEB919F97ADA0EC826950927C2E6BB0295AF [email protected]
1,666,243,506 *AF52216F67FDAC6C9B60CC5DBF4BA2D9A597CB2D KARJY
1,666,243,507 *AF5050941C2A502650948F08509D60ABF0D6B151 KARLMICKLEBERRY
1,666,243,508 *AF57846301763F9D9C59C64FFEC3F004479A6D5E jvf
1,666,243,509 *AF58451E885D6923913DA43D7ED0084EDA74E3D9 [email protected]
1,666,243,510 *AF5E09F8C09779B422A38AD4E7803D85B67C7021 JYURJYA
1,666,243,511 *AF52927A564554C493C5DD09EE508C1C0CDCC7C4 KAYLA GRIMMETT
1,666,243,512 *AF52496D8BED310A46D5401266640B306BA4549B KBCHAVEZT
1,666,243,513 *AF52A845792076A01C70B5EF5EB6CE9A33DE6F0E keeley
1,666,243,514 *AF58532E75C2ED82FD956DAF92DE55EBC7F3783A privately-A:
1,666,243,515 *AF573F4F31FA7A59F6BC955DAB6238C4F7C0A02F PROAPOST6
1,666,243,516 *AF570C7CADE3E244784354EA3C0AF9CB64A6C901 karay.guazu
1,666,243,517 *AF5831A04A2D2EC547FE9C24324376058CDEBD09 KAROLIDO
1,666,243,518 *AF520AE0CB0609F2119D01A005878A7F4DE52009 [email protected]
1,666,243,519 *AF5D6EE1DEE6EB4920C0B7844A3112F18373E5A8 MLOHREK7
1,666,243,520 *AF50A315954A7C96422D65936C299F2FEBC28246 programmés
1,666,243,521 *AF53C25C8FEAAF01096A32D6C308D2E4AD769E91 KEMOUJUAN
1,666,243,522 *AF5814B05B8E419B20F4CFB2BF66F962BC046987 KENDRICK.GILLILAND
1,666,243,523 *AF5BA82706EED70DDE2BEAE5193744425E48A994 moanten
1,666,243,524 *AF52E5910CB778AE2318F63078FFD02976E2E555 modla
1,666,243,525 *AF518E0FE0EDF6F3D93B70E378C6ABB2E90E54C4 KH)J
1,666,243,526 *AF54CBBECCA61FECFBAE2A1DE4C14F2444977C30 KID-GORGEOUS
1,666,243,527 *AF5BF841BB4C913F1F906B42AD2F5F17B0B00726 KINGSKEETER
1,666,243,528 *AF5B49BC938B514351DF9B2EDE9B3FF80A246B2D KIPKJOS
1,666,243,529 *AF54C9098759B82E4653B0E82B82F0F626DFBEDB kira.roth
1,666,243,530 *AF545F075F45269891BF655AD386E6951E9A3633 QBCX
1,666,243,531 *AF5B0FAE14B169A239FBEACB4EFA95FD5FA8CEBF MUNIRETUO
1,666,243,532 *AF501A7949FC613BE0E2CEAECE03C02888612CC3 Muskurae.ja.(remix)
1,666,243,533 *AF5419EDCD0040F411336A476E4670FB37275A49 KOTOTTE
1,666,243,534 *AF568BF72F048C249829613CF0CF2743D58D7192 MYLES.WEINREB
1,666,243,535 *AF50D8F59CDA079B88C4734FF3CFAF106425BD85 MYOSITISMEGAESOPHAGU
1,666,243,536 *AF58150CB9DCB6EB802B5EC3347C0CCC3132CEB5 MYPERRY1990
1,666,243,537 *AF5707559DCA496C79E817F65D84A1E0BFC878BE [email protected]
1,666,243,538 *AF57082582B5B35A0FDB1258530418B439CD4B00 MZIYAUDDIN
1,666,243,539 *AF50AF4EDA97A24CD6FCCD2E88FEB55514F6253A KULTURAGUNEA
1,666,243,540 *AF5A50B9A2659A3738CC09A645F85728328F4E03 KŬMDAE
1,666,243,541 *AF5C2F451598294DAD0C8003772A94DCBCBAFCA6 KURDSIITOV
1,666,243,542 *AF5445A874116778E78DF6383707D45DA23CD385 naamcijfer7
1,666,243,543 *AF5C64673DCE63FD05A5D730B8ED0F6D2F6188DA r4dologsts
1,666,243,544 *AF5D01436B4421682BEF0A911AF285CF0501175C NAPOLEON.DAHLGREN
1,666,243,545 *AF599C069D7233A707215683200CE1342EE0FAA8 kuzziez
1,666,243,546 *AF5E6E3281BC2763E7A3FFB0F04006740BE5338E RAJENDRALABANA
1,666,243,547 *AF5AD4E59253B7EDD03B48A67439151D8796959E [email protected]+y
1,666,243,548 *AF5A285FB48511B0196D395AB14E8D2279B2E3CE [email protected]
1,666,243,549 *AF585E27418433071A8EE11056EB488EF2B2353C RAMIROGALLAGHER
1,666,243,550 *AF5E48F87F96A719F18CE2BA36AD666432B597B7 [email protected]
1,666,243,551 *AF59E8CDF8F593AF6D7CBF79558D1AFC7D7C780E RAMON.BARTLOME
1,666,243,552 *AF5174620B3AC37CF98FB82B944C308A5F804A41 RANDAL.DELAGUARDIA
1,666,243,553 *AF557C98F2481B8D975A6D6F8E8863EB38D51873 RANDALSEMONES
1,666,243,554 *AF5C51C1CA4641ABA604714A38050879E112F032 lamarroyal
1,666,243,555 *AF59539A3B410027966E909696D53366971C6D62 NEILJHAN
1,666,243,556 *AF561D59C4506435052CF295FE68469F34030F92 rattachees
1,666,243,557 *AF5943CC1C8C98C358BAA602826C6826FFDFAED1 laranco
1,666,243,558 *AF5AFED4F5A834B0F077B17FE109C6BE4557CC35 [email protected]
1,666,243,559 *AF5617D58B5E583D139BEB2FC409BFF88B258FC9 laree103
1,666,243,560 *AF5E3DCB9B5788C737CFDFB0BC8C4DEA22A402D1 LAURA-DOI
1,666,243,561 *AF5805AE89ECFAC7608E9353F26B340F5B86F1B7 LAURENCECOUZENS
1,666,243,562 *AF5015380259FE9EB5415EF426C3D27924652F92 RECESSESDENDUGOUTESPRITFOXHOLEFUNK0
1,666,243,563 *AF5290AC11E4CD5519857993DF58F8462DA48FF5 rednamixana
1,666,243,564 *AF56BCB1B0F8684141B47B5CA9C40E3D22BD8682 REENTRERAS
1,666,243,565 *AF58A468CE6682491DCCDAF6C0B4EFBDA53CC9AA LAYOUTYTONYTHETIGER
1,666,243,566 *AF5F877BCE18597EE0D8DFDCCE2C6996463F0E37 [email protected]
1,666,243,567 *AF508622E16439B226A28B46A095FE1B626ABFC0 [email protected]
1,666,243,568 *AF5DCD758A278F2DA5850B137EFEF7AF22CAAAF1 NILIINAANAAM
1,666,243,569 *AF54E0C1A478B47867F4C264E61458AA8E599E46 [email protected]
1,666,243,570 *AF5480B96AEABD77CD5434DD8C3681BAB716419C NLZX
1,666,243,571 *AF52A5D9E5A4D8B6EFD9951D0C4105ED78946610 LEE DICKENS
1,666,243,572 *AF598F415A33C029FD1FC686ED1929130DE9186D LENARDALLAM
1,666,243,573 *AF569EEFC02C8B4488754A10E2EC851F1A3BD533 noeclaman
1,666,243,574 *AF5390F1629464826F9C521B3DB4A7AF387F22A6 leonard1234
1,666,243,575 *AF544FB8C0A3D3401E14D58D5116D2FAC4A055F6 LEIGIHT
1,666,243,576 *AF5377313C8F45D99EF17D26B38DA3852BFE50F6 remutuoccar
1,666,243,577 *AF557CEE01E0ECAF85609E83E4A230F980166B89 [email protected]
1,666,243,578 *AF531970515C10261060E9AAB094BA8200D9D943 NOORSIAHH
1,666,243,579 *AF5D80533ABDAE197ED19CB56B28BDC3082E1889 normandakel
1,666,243,580 *AF57CB1A94C7BFEC562834EB111AB8C2241F2D5D Not.Much.to.Say
1,666,243,581 *AF59456C4612E63CA2A970BDD6100C33B48B6113 RESETSELECTIONSBSW
1,666,243,582 *AF5E2AED83B5F6935547C613A4179C7D76B7806E NOUM34IT3
1,666,243,583 *AF55F2C347F4FF8FCD38E97BBAC339124A2CDE73 LESLEY.ARNHOLD
1,666,243,584 *AF58E4626D3302DAA4143EAB6E713A0690AA58B1 NP_033914
1,666,243,585 *AF5164F1A0B21023C45E018A768610BF9FBFC0E8 NSCHENKLEINSIEBENUNDNEUNZIG
1,666,243,586 *AF5210DE374FC6C4C64859BAAFEEC359724FEE76 NUTRITIONISTROBERT
1,666,243,587 *AF5E6FE7E95377DA2A6AFEDD2B9BA0ED4143B044 REYNALDOMORDEN
1,666,243,588 *AF51654CFC486A4EAE4C2AFFE7E91C627AAB97F7 (O_-).0~<===B
1,666,243,589 *AF51087BD0D03F4F1D12B253EA3780EBC2F55045 }o{ 0~q###8
1,666,243,590 *AF56D0D0F5B22448E7BA75B869F92AD7B527FFAA [email protected]
1,666,243,591 *AF5CAFB9EBF294F27B73C617AC4DF01FCD150FAA [email protected]
1,666,243,592 *AF59EDB1163EFFEB12AAD75277CB0324125DBA2B RHEMMERT
1,666,243,593 *AF5E63CF58AFA34855C1B838BDCD180D36394DD8 occurrit
1,666,243,594 *AF57DAB5709435328074E95F1E80F738D8D9167D LINCOLN.MCCLURKAN
1,666,243,595 *AF5C2DC8664884728B54CD2AAA6559765E8165E5 RICHARD.DEMERS
1,666,243,596 *AF5478D57E4C49A5959011760709E9102CE8E2AF OFRASQUILLO
1,666,243,597 *AF5BFC37557FD8B071543FB6F9DA44C02AD00E49 [email protected]
1,666,243,598 *AF510124C98B044201A9D734E1B1CECB121D5C95 [email protected]
1,666,243,599 *AF50F2497D209EFA155F095AFD0CB4B0CA7CD3A6 [email protected]
1,666,243,600 *AF50022BA3A5E0AF482DCFB027F426228BBA9596 okbridge
1,666,243,601 *AF51404C9EC468AE198A805E842097B050EA7E74 OLDUVAIS3
1,666,243,602 *AF584960891152EC4DBB5A17E2A15A3C321669B4 olivetti1902
1,666,243,603 *AF5730384BBF81C6C8C87E741443AD1A188B1177 lionellondagin
1,666,243,604 *AF580A760F28C160D79A777F3F0A732470F934AC OMERVELO
1,666,243,605 *AF5792470D485C05978E8BE776DD60E2905E19DF lisathomashill
1,666,243,606 *AF5EBE27B9433BE49E0FEC5A4EE6EA90D1F45B14 [email protected]
1,666,243,607 *AF5C2CFBD11979E8B4432B48FC3272FCC8FE8BE5 RLAUDE2000
1,666,243,608 *AF51303C68F294383F9DD215AF60F205C578FE7F [email protected]
1,666,243,609 *AF5841B0DB4204E4CDAB6AFA181670D6502FEFB7 [email protected]
1,666,243,610 *AF502CC57008BC2E9A735B26F6D9FB99A52392E4 LJ LUCERO
1,666,243,611 *AF5178997DE9B474BC21B178A9AC2BEBF9FAFAAF only-want-to-mend
1,666,243,612 *AF5A917CD03EAB0F4BE3F14CC92D233E66E1FCEA LO]&
1,666,243,613 *AF5D7BF29297C97EACB6615607F07E7D5B6EE02C l'occurrence
1,666,243,614 *AF5166BC3DE78D5880B62A0C2BA55716C6A8BCC5 rodagella
1,666,243,615 *AF5D0BAA26DD104FFA89420B32E7F547F9CD2816 rogelionoone
1,666,243,616 *AF59696AC373B08E01018F63F09449B872E9EF2B LOREN.PALKA
1,666,243,617 *AF57000393BECB633D489595A56DE4E6867FF60F lostyourfaith
1,666,243,618 *AF58C88BDAEB421C836A932104B021727B2ACFBB otisnickell
1,666,243,619 *AF5FC9237EC3EA94614DAC443133303C9A635DB0 louiemais
1,666,243,620 *AF51854D6EEFCF756AD251286C0100F4B102E25D [email protected]
1,666,243,621 *AF52A5B2160C5E8C2F41A14A33C711A7AADF1813 lou-peca
1,666,243,622 *AF5552F646E07619B683248EC35C18A504906CCD [email protected]
1,666,243,623 *AF51659503FBF0077FFBEBD0C9AF718754DA3ABB lonpoteat
1,666,243,624 *AF5CD7A23B3420C81FB1EC10A158AD30AAE14DB9 LOW-CAPITAL
1,666,243,625 *AF502701C218A28E012485FB412D46DF46864952 lorraine.dominix
1,666,243,626 *AF5F1474747350BE8963F4CE753CAA1DB7A18D5A OVILLIGING
1,666,243,627 *AF55B8DA2EAE6222C338027C4EA4188F1984ABA0 LUB16
1,666,243,628 *AF528020B584CB203F22F568A21E59603E453AF5 LUCAFE123
1,666,243,629 *AF514B58B980B8DC8F4D2C139ACE96E8E1171EF2 LOUISPOSTUCI
1,666,243,630 *AF5C97CD1FBD83DBC3DA7B785A9EA8F7AE5CB7DC louiswinsbergjaleo
1,666,243,631 *AF502205FC1C74F70624C1874B23F679B379A6E1 P====>`~-`~-)0(
1,666,243,632 *AF50EADBC26F6936EB99FFEF02E21E28D47EDC1A P149329
1,666,243,633 *AF576DB52557881E1A38B1CE76EC729523DC7065 paekass10
1,666,243,634 *AF5EDC548631EB90255867C20A061D664971CFAE PALMER.ARNEBERG
1,666,243,635 *AF5B18B1B4BE58C2A9ADCC172025798EE90CDE85 ROUWKOETSEN0
1,666,243,636 *AF5E6F2A083DD032D539906465E299A1FFCAA270 ROYAL.FENDLASON
1,666,243,637 *AF53CE5315CAAAAF2C89180A0AACDB34A7F68484 ROZHODUJCCHES
1,666,243,638 *AF57EC7832F57C0D57D41EDC3AB2A7F7744A4F05 rozmajzl9
1,666,243,639 *AF59BA9D302D74145318078EFA6F51E8C0CB2295 parc-tenreuken
1,666,243,640 *AF5584A24BFBB179BAE1620CED4735053B2D1D0C LYNWOOD.PEEPLES
1,666,243,641 *AF5FBF67E2F7166A8FBAF71EC52D972C7C2DA374 rtg{
1,666,243,642 *AF575EE8905D2615C757CEA73D25009AFAE3D16E RUDOLPH.SAWLIVICH
1,666,243,643 *AF545CAC1F8D143452F65BE77AFFB2C5B0BF37C6 MACCIM
1,666,243,644 *AF5C873433F70056F0B372C28362B72BBF4FF40E lyric3420
1,666,243,645 *AF5F9EC5D21E253A4B7C3DB991146578D4F9E11E paul-weller
1,666,243,646 *AF5B23B6AE475CEC5451915C46CDD9DF2834A865 RUSTY.GERRARO
1,666,243,647 *AF5A7F6DB4D1BA60C0AAA7896C0694132B0AD9B9 MAC.CARULLO
1,666,243,648 *AF5B9A01F1645C35BD6D6B3F105D9A161B8054D7 pbriso
1,666,243,649 *AF5124D73DD764BB0CBB5AF2530ACE767CC4319B PCOPTIMIZATIONS
1,666,243,650 *AF5D8A96CABE6B7D6665F2B6CC860CCC9A80D9E4 RWJJBSW6
1,666,243,651 *AF54CFE983C11DAAC7E610C95A2B023629CBA3B5 MADWEWASIN
1,666,243,652 *AF5A3531DE6C881B2A5295F5A8A9AAA7B19A9E65 SABU.THAPA
1,666,243,653 *AF5279B1083AC939F869442308CFA9BA2BFFD30B marioauter
1,666,243,654 *AF5D2537339CF8BE3B8783FBEFD1450CA6AA519B SAIGETSUS
1,666,243,655 *AF5168EB723F475E6219052F37FE2AC452F636CF saintmdw
1,666,243,656 *AF54611CE96F064FEF2A79B93E24A3921B948093 SALESGIZMO
1,666,243,657 *AF529180CD15BDDF5205562967C68085E92ED523 salmy
1,666,243,658 *AF568D5C31BFE3200DEF744211ADC365BB0A2CF4 SALVADOR.HALAMA
1,666,243,659 *AF552FDEF2060CAEF9A570119FEC46F9C479A3B8 sammiekalfa
1,666,243,660 *AF5C0D53E3B95D130BDE8C34178632F429C90577 philbrazler
1,666,243,661 *AF52DC636A53E26F0665B3B8C464417540B4509A philip.heine
1,666,243,662 *AF500DE327E2637A0CD8D01411CA2106A55CE7D8 marcelg7
1,666,243,663 *AF5E3983B6E3E65C2D48C17C2330C82755657426 sanctified 's/&//n/kt/@/,f/ai/d
1,666,243,664 *AF50F9A1545B1FB25D7C9108C476DBEBB97F78FB MATTHEWSOBUS
1,666,243,665 *AF5608EC44DA33D70B1B51610CE50C24A33A97AD MAURITIUS18
1,666,243,666 *AF5D5709D10781836F05CCDDF37509F5CC261CC9 MARIANO.SKLAR
1,666,243,667 *AF5CF6783ABDB18C268F75CF03CA916EEDA43F86 SARERTITS
1,666,243,668 *AF50A349C43F4C4A576B3AD71C2065A7D559C6A8 piperidolato
1,666,243,669 *AF5940EDB65A302D4741CF68202E0CAE49DBF140 marlinpercontino
1,666,243,670 *AF54AC3EACFAFAB3442C266C4A1E426BF17A80D8 MCCLAIN.
1,666,243,671 *AF581B48117BCA43CAD660C4B037D71DE88F3492 SCHIFFSSORTE
1,666,243,672 *AF565DCDCA6175DF53FB36790FA0A80E4724439E pliasovas
1,666,243,673 *AF5BEAC353CB0735132AFD93C86B2D3B6E53D1CF PLUM3-$TR
1,666,243,674 *AF55642DE642C6484F669BFC0DA4E66A2FBAB409 PM<BR
1,666,243,675 *AF5A1FFC1D73ACC3CD2DD923FA6FF893A53191AE mediatoron
1,666,243,676 *AF5FA0944DB976304665CB878200D5DEA770D734 SCHWANENGESANG-D-957-NO-4:-SERENADE
1,666,243,677 *AF508EDBB3FF56EE4262937304E2A2753068CC2E POHAZUJE
1,666,243,678 *AF54D00EE3F6039086AFD87E5D5E2E72C24DE2B0 MATSUDAIRATADAYOSHI
1,666,243,679 *AF5D1D2681BE6CCC04ECCE69446DD74E9B1F6BB3 SCRPTNG3
1,666,243,680 *AF58D9A0BEB9701085A1157101257D77DBCAD948 MATT POWELL
1,666,243,681 *AF5E63A9AE7CA4A5F6C9AF8F8F92B89370AB4AFA SEAN.CLAYTOR
1,666,243,682 *AF5562AF0A9AECEC650C7A3734B6CA77893D7A81 MAX.TOUDLE
1,666,243,683 *AF5AA4E8C23A181221D7D28AD102ED85BD804545 MENURAS2
1,666,243,684 *AF55D8FAB059D5A5B77487672B615C1E9554D9D8 POOKIEWIN95
1,666,243,685 *AF5DE759EEA2FFDA195CCE5CD0F5E84607FCAE25 MERLE.KIVETT
1,666,243,686 *AF5363FF903BD6E2821F7CD7B16497BEFA274929 SEILDETCARFER
1,666,243,687 *AF5A5CAA836176D4686ABE6EFE35F837BC24E8EB PORTUNONS
1,666,243,688 *AF5EC56C18E2CA283C0C0D5EA02612C77DA91688 MEDIARONS
1,666,243,689 *AF5D6BE20FB163C534EACFCCC4BE2F773B2C055B MEZQUITAMAYORDETUDELA
1,666,243,690 *AF569AFD2111BCF3BE057AA98A287E4865929DFF mh2w
1,666,243,691 *AF578098ABDE6429E25033131292C85B92421B54 PP.755765
1,666,243,692 *AF5C4D043DE82F0EE096EB6861CEC4327EA0043D p######p`~(o_-)
1,666,243,693 *AF53DDCAF14F4B18B63B59FDA42D9B5B0B68F429 midnightpoiuyt
1,666,243,694 *AF5450E7006503F5220602D0A4EBD7B34B4F3F0E sethzaman
1,666,243,695 *AF5BBEE0FF512C8B9D357733D0F43F44F5DB8763 PREFIXATI0N
1,666,243,696 *AF59C5D2F24D0031D8D6972AEAA910DE4C541686 mikecrowder
1,666,243,697 *AF5FEF2DA463FFD4977EFE00D7492CAE0654F14A METAHEMOGLOBINEMIO
1,666,243,698 *AF5FA05B2E86FE764DDBEDB28D83289D1DBFB128 propelsider
1,666,243,699 *AF50EDF149C825303334A1C048A09405127C7F46 MICHAELCRANEY
1,666,243,700 *AF568649C6E4BA64E61CFDF2DB4E4896E5B1F486 PSEUDOAPOLOGETIC!
1,666,243,701 *AF58776A5D0B9F835C3DBE1064B98206CAB0D025 mitcheldurio
1,666,243,702 *AF550A236B20A6DF59FDFF2E3E674058C27D370D shaunhottle
1,666,243,703 *AF5B0251815E55B79A854CB197C27C9B15CA0CC3 PVIGDIS
1,666,243,704 *AF5FF7AF9107CEB17CF4D199F26C2BD337D9A471 [email protected]
1,666,243,705 *AF59CF3F62CB0D293BBEB6C950D2CB8A3E361230 mobilnim
1,666,243,706 *AF57C47F16E61C2111739B9D4D99CD2C541A53F6 MODELLEMEK
1,666,243,707 *AF565E0107834000C98EAC4FD7DB06CDA1104EEF sherwoodporta
1,666,243,708 *AF5091F45A27C9C82082F0B66A85B260617F9B7A shirley.kaufman
1,666,243,709 *AF58A158B57B1504AA9274BBCE3C9F701FBCCF88 short-mass:-v-agnus-dei
1,666,243,710 *AF5070943E3376D5832EF13DA232E3E2948EA757 misty.wyse
1,666,243,711 *AF58E1ABF2E6EAD26FA8706359F06EE5DC076B49 MISWILL1
1,666,243,712 *AF585B82241D16944CADC54532C4A6DE748CFE69 MORETHANATHOUSAND
1,666,243,713 *AF57C8F9DDC9D859FE4CFDA8CE445F2EA4849D5B sideswipe-confirmed-as-a-convertible
1,666,243,714 *AF5F18FD7C79F62E6BBD18DA64CA15F25424E90E [email protected]
1,666,243,715 *AF5BAB65FB253CC4B148AC1BF291B9CD73ABAD4F m!n3r4l09!s+s
1,666,243,716 *AF592AF2276B3B76FDFFBAB82399EE5FA9CDA20E MTUBTHE1
1,666,243,717 *AF5CA66D551C64CAA8F29711C077EF234629FB0F MUKWAR
1,666,243,718 *AF5DAC9D6AB75F22311F7CE639231027CED208B0 MOLLY.BALLARD
1,666,243,719 *AF5098C1C9C84A7E7BA8B7A7715E67826CB4D08D QUESTIONS-RAISED-OVER-TURNER-JUDGE-LINKS
1,666,243,720 *AF58B83023D6D1BE9A181056E455DB27730AD328 MOPTYSIE2
1,666,243,721 *AF5E691E01E2D3A8431D9B4EC534604C659F1798 MUZYKIEMS
1,666,243,722 *AF556B13083D8EF295C9CB339D0853F4B32B68DB [email protected]
1,666,243,723 *AF5CFECC5BEB4B80471D45AA74C25260DEC4F4DF morpheus
1,666,243,724 *AF54B9C5CD61231FE1763A6349329C0A9324504D qx|a
1,666,243,725 *AF5E1B0E2FC65B87750970014F1A03E47AF3C7F6 rafaelbraga
1,666,243,726 *AF5C5A54730176B8D03BEE7854BD258ACFF0B4B1 MUQSIŢĪNA
1,666,243,727 *AF50CC350B2691CFA337514404B688A3F5A1E184 Murky.Turky
1,666,243,728 *AF597B5101B786C1AA7DF54976C318A502CC9876 MUSIK: W
1,666,243,729 *AF5E205C0C51295B5336B403EA1885B8EF456BAC [email protected]
1,666,243,730 *AF575485027BF1EB9983E224A68ACE084D0B1D32 mv}\
1,666,243,731 *AF5389E56E960D150FBE479AE7D074F8AE43A190 myles-sheppard
1,666,243,732 *AF5F80DAB2EEF3E8B71D8079F21BE5D377F688E0 MY-LOVE-IS-DANGEROUS-(JEFF-LORD-ALGE-MIX)
1,666,243,733 *AF552AB52BD4C0948636D8585437C375DB143466 N3GOT1481L1TY
1,666,243,734 *AF51A519AA7EA70023049A13581CDDEB463AD0EB sj4lerne
1,666,243,735 *AF52852B87DC436606391D50C96B5D082E4B5005 NADINE-RUFF
1,666,243,736 *AF5B68DFE9059B96F48AE5464249A5F4AAEF06A1 RASCALBARBIE
1,666,243,737 *AF5B9D86DBF770B4E6BB6F34B533143E0B05E1FD SKOYSZYN12422BD12422
1,666,243,738 *AF5ABEF412FC87D98A115E38E2B85C70E88C22B9 slimsbluescomwww
1,666,243,739 *AF5A8614DA24644D897DB2F6AAD479A1E12E579A NATHANREAVES
1,666,243,740 *AF5058B702BB3E93CDA85C6673E2A82FB00A5582 NATUURSCHÜÖRTREBEEDE
1,666,243,741 *AF588DCAC60392879CE7B611C7AE5371FDF02194 navigatorafkrydsningsfeltet
1,666,243,742 *AF5938B03A67009E576B265AD95AAEDE7E884BF9 NANCYDWORKIN
1,666,243,743 *AF5BA8AC32445BB2AA0B6DA88454E424889C86C9 nancy-hutchings
1,666,243,744 *AF59C956B7B9FCA1D4D0AC82C00248ABFFC8B2A2 nangareka
1,666,243,745 *AF5AD03C908F8BF92BF071F8436F453038849E61 nedbogin
1,666,243,746 *AF56ADE34B3AFE5C2BB6B00CD85185C2424A814A NED.MAASKE
1,666,243,747 *AF54DE36540C1F99D5BA30FB41AF9A8762BBE625 natashaasdfjkl
1,666,243,748 *AF57DDFED377DF653DF1AF35CEA8021231A85817 NEGO7!47ES
1,666,243,749 *AF5797C1DB4CE4A98A9EDE5465072CA91B3584D3 sola.noruega
1,666,243,750 *AF5AF225AD9E0DAD89EF91A5D0CDC83D7569247C NATHANIELPANZARINO
1,666,243,751 *AF55E77CD93AD98C43992FC8E0062A70469CD2D3 NATSUKOHARA
1,666,243,752 *AF5593F4676F932FF5A9F7D88A040E4AEE621A7E rebeccamikkelsen
1,666,243,753 *AF52DA52F178AEE97C0D8B7488FD1B1C385C8B11 songs from the book
1,666,243,754 *AF50D35336F931137E7BC7E4223B8D97F4DF4559 NEDRAWAH3
1,666,243,755 *AF5344058E5AF1105E06BE51B8A694E937F5B469 NETTEBACH
1,666,243,756 *AF544C4B46CB10BA714343365DBBA162E26C2C84 SORSTARSAIM-1
1,666,243,757 *AF51803F5FFAFEBA3FD4D74D6CF5D0788F0EDA17 REGICLAUDIO
1,666,243,758 *AF501253B1E3C1AA971C5E0FC112078BF8694385 nfrtllbl5
1,666,243,759 *AF5B14F12CAF8629C674E46EADE0946DF4E08141 NICKHARPER
1,666,243,760 *AF5198B5AB452AB0046DC3F9F06326DBC8CA983B NEW.HAMPSHIRE??
1,666,243,761 *AF53F1B24737F63113F52080730F82D99DB6F819 NIGHTINAMNESIA1
1,666,243,762 *AF50C81127DAABAA73D1AA2679122CE8A021045D RENOWNEDNESSES5
1,666,243,763 *AF55AF194D56B27308FE7AAB68228FB6B5601072 nke-aus-heiterem-Himmel-8
1,666,243,764 *AF538572B6B0C392A6144A87FE23734D1415D394 NICHTVORNOCHZUR
1,666,243,765 *AF5AA7A39D9121AA6573D070A2608D09C9578BED n-\m
1,666,243,766 *AF5E686670C43EAB2FCBE00348F4CFB4083C3015 SPLAT!-~-<######B
1,666,243,767 *AF59743472FAC95F41216E5473CF3420565D26D0 splat!!.o~0~q####p
1,666,243,768 *AF5243F8046B00A0CFF623D868503CCE801A6738 REYNALDO.BISBEE
1,666,243,769 *AF584BC7DB5130E2E80AE08834384405F8D1359E squiss4
1,666,243,770 *AF5ECC150FB5417231A1A47BCB712074402C7868 now-what!?
1,666,243,771 *AF536142312DDA75DBE04A83D8DD4148873B482E STAKWELL
1,666,243,772 *AF5457E2E8F45ABF43201A7BD97F03C52DC56253 numbellar
1,666,243,773 *AF56E38443407CAC6D799A8241CF61FFC2E0F817 NUNI720
1,666,243,774 *AF5171E077D846BDB258803ACB3DCE24BBA4994C RIE, SAUTE AVEC MOI
1,666,243,775 *AF5658A4D1F5CBDF60E8F8F525CF9B2766DB5F87 [email protected]
1,666,243,776 *AF550E895B55B80C7693BA21CB2BDED857D8B796 nyolane
1,666,243,777 *AF58085AD0512FA59C465BD4ABD47B8B4A2BB5A3 NZONAIR
1,666,243,778 *AF5B30D8E8FAF1A6F73651895B49664C37DE2B0A “starblanket
1,666,243,779 *AF5DD4F56D2252A8A835D71B58FDC96B30771DE1 OCTAVIOFETCH
1,666,243,780 *AF5A8ACDC65572A0B4E3A6E29B9BDA45B1826590 RNBWBRTH
1,666,243,781 *AF502C94DAFD3A4605B278CE15734CBA716E714B (><).o~.d===p
1,666,243,782 *AF51ADB9B667742F8354C421E74DB9357381E3CF nutrint4
1,666,243,783 *AF5C6540D241A8EE598AECCC48FB2C2CCC660ADB [email protected]
1,666,243,784 *AF59C82451CD1303D6284413FBF2E8A6C42EB6DE RODGER.GRALESKI
1,666,243,785 *AF5C1C305E19E92CA76962A9B989F7A08FAD592E olinlaquerre
1,666,243,786 *AF5BB3DE4D57F382DFDF0AC82BB4DE023819B0C3 olinmcelrath
1,666,243,787 *AF59FCC7A0F6C40E298FDBF38381A8EB95EBABA9 OLLIE.THERIAULT
1,666,243,788 *AF5717582981120AAB3AC45F90E377B64FD2F05B OLUŞTUĞUNUN
1,666,243,789 *AF522F318B004E197167B0FD19AD1C3023DB0801 OMER.LAPIN
1,666,243,790 *AF5316C13C942F389E20E62FD0A0D186FBE994DC O->-<*.*.D#8
1,666,243,791 *AF59D7350B828795AD5D355529A0973D947BDE37 ODALNETING
1,666,243,792 *AF5D38A2731EBC902EA03CC7C6F2DFB06B5F6D80 ONDERLUI3
1,666,243,793 *AF550D54D9BEE30FB471C2EA6884F7378C59EB2B ROLAND.FIERS
1,666,243,794 *AF5D3CFB3083316780BEF8A045E6E78AACB21347 STRONTZAT!
1,666,243,795 *AF52471B951B06BD0DE9A0FF45A1F3F64C64887E romaneldib
1,666,243,796 *AF5E677D712DD5852F4F651E6D04629CA25C1713 STUCKUPBEAR3
1,666,243,797 *AF5206E57484C6B5F15CCB70D020CE2EF4943046 }O{O~ 0~ <P
1,666,243,798 *AF5994464F78C6A756D712C0092985012332DE12 SUBCATEG0RY
1,666,243,799 *AF5A1E9486D77E2DF2B3C645326DCC9BFBEE3135 SUKULAIS2
1,666,243,800 *AF5CE38145DB20C5FB3D2C78F909CAE2C0A1DF1D OPERUM
1,666,243,801 *AF5B24A308A7BD6BE52627E611283F33CB79157A ROSEGERALD4
1,666,243,802 *AF5FD3AC30E93DBB58A0077FDD1C044048D3EE4C [email protected]
1,666,243,803 *AF5EBE96257C61FDB892BB99B3A5A8FB4DAB56F9 Oneirotic
1,666,243,804 *AF50B99A9DB44E7BDE3FECCC324CC7B764719F71 ORTHOGN4THISM
1,666,243,805 *AF543200BC6BD452C743F45A9577F69FE75A1EA7 SUNFLOWESOCCER9
1,666,243,806 *AF5232AAE8BA174B606792453B48BF66ABA7C1B9 )O([email protected]
1,666,243,807 *AF5E761192A4D53ACD8D9956F36C4365291CC9AD RTHODOXY6
1,666,243,808 *AF51AC8DB7422B62458D3C7FC6020536722B68C0 RTSOU
1,666,243,809 *AF5D92CBBD60195D9A80B248B5E866B968E936C2 superintendencies
1,666,243,810 *AF5E85D0F67DB38DB6C13EED719AFBFB3600F901 rudolfolivarez
1,666,243,811 *AF592965DFF09E2FEFB8B56106CBCA6CC2308FCF oudkerkerpolder
1,666,243,812 *AF59B35A025F4B692276779E53D9422272218DD9 ORVALSERVAN
1,666,243,813 *AF5343CAF7452213D42A9C18AC8A9CE4C9FDD576 sveindal
1,666,243,814 *AF5E8FAF9AA12E806DEDF091993EF2B893D46598 sweert
1,666,243,815 *AF505EC3CB68D1E45CF477C3160813EAEA9A047E RUTONNIF1
1,666,243,816 *AF5D723319AA43BB268839B980323B015E89D493 (~_^).~`.~`[email protected]####P
1,666,243,817 *AF593DF1675C6B648D966178E788C9C4CA6799BF P7KG
1,666,243,818 *AF55071AD408B0534BF2E77038E9875D309E828D S0RTI3IN9
1,666,243,819 *AF545F9BECE1BD5FBF2BA7884C6D2DE85B6B01AC PARALLELFLACH
1,666,243,820 *AF533FB9DE571084E0429E79C7CBE2D16F39EBA3 tabathaweaver
1,666,243,821 *AF59906DBED0AB424771B4A4089FFED82B4A82FB p>.*.*.*.~0~o(00)
1,666,243,822 *AF51673FC69E326F29B17A7F17F87B686C2DEB44 P3NN4R14
1,666,243,823 *AF598005988951476A7CE96768B11C1B19843034 pasqualehinze
1,666,243,824 *AF5762532C36B2653E974F8AE948F7196D9EEBC8 „passe“
1,666,243,825 *AF586D81B8C6F246F81320CE101262FB2A111F47 SAMUAL.CALIXTRO
1,666,243,826 *AF5ECDBAF7CF6D201D3233F637D8F11E3E808F36 SANTIAGO.PARPAN
1,666,243,827 *AF5460D4CA13C6BD0BAA26436B05DB33488429ED PAULFRANCKE
1,666,243,828 *AF5D9F970D48163DE03C2D0EE5B73BB49D8AD55D TALKRAZYBOT400
1,666,243,829 *AF5A5771888E1EFE480AAE2618A1A2DE50A38122 sareuoner
1,666,243,830 *AF5477F882E662CCE5707B04B6BCD3A18AD2A4EE P######D* * splat
1,666,243,831 *AF55FF83804277973ABD9333063E69181BA6B1EC parasynthetic
1,666,243,832 *AF541A000F3FA26DEEAC9D230C248036DFEA3BB5 TANDS
1,666,243,833 *AF59B83FC930D759CBD54886E600499DBABEA224 PARTDOCUMENTED
1,666,243,834 *AF58082C51C677AE3D69D3DD3CCF9C3076423ECD SCAPOLITEGROUP
1,666,243,835 *AF59E0486F86A1D0A28BE2EB73482958CCFF63AD SCHRÄGLUFTAUFNAHME
1,666,243,836 *AF5B0B89E446FFA2FF40173D36ACA428959E4C9A pfungersterteil:vi."undgottsprach"vii."rollendinsch
1,666,243,837 *AF51B50E5F8A8DA5EC8724911EADE73A4607E228 SCITARCOMEDERP
1,666,243,838 *AF512FAA59EE25C62FD0ED53A3656B22AE856647 SCONTENTAI7
1,666,243,839 *AF5E30F6CA8304F0A98CE8E38DE188B3940906F3 philosophy:whoneedsit(disc4track16)
1,666,243,840 *AF5A7C4869066D32C015AD11D5090B6314F48321 PJIRGEOT9
1,666,243,841 *AF5EEE161A91F2C14B20432071B0CBB9D4F1385F player2884
1,666,243,842 *AF5E33AD6FA7956D0A3C687834D6C9266BE32C51 pliant7
1,666,243,843 *AF5E6E8BB49D286100F5BFEE30F373FAB540AA34 TESTTESTWEBSTER
1,666,243,844 *AF5554C14D3C533E50FF6B3AD6E63ABCDBC7F133 POCKETSC5
1,666,243,845 *AF5157E29E021FA2C78A0BFB51E970319CEA7A3A SENSEOFPLACE
1,666,243,846 *AF5F05DA1990B54FEF27A8A94BC238F4FB2E2440 phyllkis
1,666,243,847 *AF5EB97F8DE5280BE5E0EFDCAA66A033FEE74352 PIMONLUCKS
1,666,243,848 *AF5E6E38814831F9B1B0EA3CBDF911FCC747F506 [email protected]
1,666,243,849 *AF52BF0B6573DB09413BCE0FC79A552FBCD4CFF3 SEVENEAGLES5
1,666,243,850 *AF5A64DB268F3CD1114AD3AF2B710D89C8A29AC9 SEYSOUR5
1,666,243,851 *AF54013B9B0BD8D09C00D857B36D7056E758129B shane07
1,666,243,852 *AF5B9332B35AA0B0C496E6E65CFB61CE6F471E41 PMPF123
1,666,243,853 *AF5468A0BCE47BF8FB4E9AAB3554C1A53E583DCD THEJENNY98
1,666,243,854 *AF5E3F17230023DB230691FB38816FD0FE2662A2 THEOTIMOTEO
1,666,243,855 *AF50CF5B6B97F65DADEE597DD9AABB9577D3343F THE PARANOIAC-CRITICAL METHOD
1,666,243,856 *AF5EC23200C98CFF5030E015F32E079F9DEA00E6 THE-PIANO-ARTISTRY-OF-BRUCE-ROWLAND
1,666,243,857 *AF556D617AF4388AA6D96115A524EF55701F12BB popeye^
1,666,243,858 *AF556E36D0D4EB74C81B16928E3A54B4FA139A66 theronsymore
1,666,243,859 *AF54283E8F0832270BF63C970AB4707BF3841757 p--->-~Osplat!
1,666,243,860 *AF5D5CB007139B2F2393F07E1588AF2678687402 Possano
1,666,243,861 *AF54925FCF87939A09762C719932BDD657D2767A PPAMARAJU
1,666,243,862 *AF5308BFC887D7256EBD9AD2BF3B410DD370BA57 SHIRLEYLO
1,666,243,863 *AF57AA85C5B064E5EC1871B6AE9A7FEACE5C1734 sho.is.funky.down.here
1,666,243,864 *AF591BB006BC5312E8F1539D2ACBEB9B9861DAC1 SHOOTERGOOBER
1,666,243,865 *AF5B371ECA8E3AF0D4567B26583A370077849828 SIDNEY.KASA
1,666,243,866 *AF5639EA9C58A0C68B1A0C14AB0D9BBE2E917779 PRECANTSED
1,666,243,867 *AF52E9F775B851CB7B50B5803D7BD838E6735561 PREFEKTES
1,666,243,868 *AF54829D6A2B573473841A00F9D0DF29347D2531 PRESTONL1
1,666,243,869 *AF5AF3ECEF54EFAF7A0BA6E783847FD0DEE407D5 PREVERSES
1,666,243,870 *AF5C4545810782DD117BE6B431F98B6866EEBAE4 princess),於
1,666,243,871 *AF5D11A5675FE7327F28CF70827314E82A9E98FC PROBAT1ONERS
1,666,243,872 *AF564AB3595A14B5DBB4B74BBB349B478F695EF5 PRODUCTIELEIDER
1,666,243,873 *AF5ADC64B3E9D98619D3C989CA6DBB9C9800DE9B SITE7214419122
1,666,243,874 *AF5BAFB57F43E40308797AF03DA8D62E54CCA5E7 sitigarffus
1,666,243,875 *AF5D5503ED869F4224DA19CD679451E1BACFA6DD PS3UDO1IB3RA1
1,666,243,876 *AF5BBE67395AA541DE265582D607F29CAE53F697 skattoere
1,666,243,877 *AF5D7AE82773407B6F6F590503F97CDFDC2E4499 pu8er7a1
1,666,243,878 *AF5DB7F07FB241EABB162275028151A510876A10 SNAPSFLASKENSES
1,666,243,879 *AF5D5B5EFD27389A60141DA450B1A85E2BBF7A68 pvirkes
1,666,243,880 *AF5DCEA00903C70D5F327623ADBEC4A9E3B1CBEC [email protected]
1,666,243,881 *AF5087CF2EA25DDC55205BFEC9721AF284311341 Q4E=
1,666,243,882 *AF521F03EF36781535643DB7BBCE29342A248674 TOMMYSECURITY3
1,666,243,883 *AF54287F0203F102D1B09971347137A47E160D23 TOMOKOSANSHIPPAISHIMAS
1,666,243,884 *AF55FC8700AC55A6AAAF245D3C4221F851AF38D6 SOLITERING
1,666,243,885 *AF53D8829711C5BBC93CFAE3C5A00B6237022729 [email protected]
1,666,243,886 *AF5BACA08FC2231C457FB41715FB3BAB18A9CF1C TORRENTIELS!
1,666,243,887 *AF52C625BD6205DB7D345049B6A85C7651768DF0 q####P`(_0)
1,666,243,888 *AF52A626B0DBC242D9542CFFA416D20E711B84BC tr33.mou$
1,666,243,889 *AF57DC01C26D602391ADC9BB45FE3B979B8F79BE SPANISHMOUNTAINED
1,666,243,890 *AF5A8EEB33162C1F0961EC434A09E821A6A87BC9 spheehps5
1,666,243,891 *AF51E86A7E924149BE3D43242741B54E86BFD551 TREASONSOWING3
1,666,243,892 *AF569A5634865259B07792BEC5B7BDDE3DD06E40 SPLAT!!~.~.~D###8
1,666,243,893 *AF56A6113984A66A157E4FBA2CBA940670AB9DE3 TREISJEM
1,666,243,894 *AF5C265564E51332E823A389C95799876DBD685C tremaine-knowles
1,666,243,895 *AF5B6ACD26636B8FEF4D9E96A79DB18BD12D75AB RAMAGLIO3
1,666,243,896 *AF551B520E54041D1B2D3006C7BB29DCF92BB274 RAMIRO.VELASCO
1,666,243,897 *AF58CBBB780B57FA18E83AC5C238B877717EB7D7 SPLAT~`~`<------P
1,666,243,898 *AF5855AF92CD344231C90B7D38E0786D823C6E81 TREY CARLAND
1,666,243,899 *AF5A3DBAACB6CD8F841B988E9BCAF88E592DEBF3 randy1939
1,666,243,900 *AF548F25C05E85D80571B182103F446E99850B6E treykubicek
1,666,243,901 *AF5982CD4571DB42811EC6F9E910459E59CB9A21 TRINAGALLIGANKELLY
1,666,243,902 *AF59E0618862BE058B3FD2E70D3C85AEB43A3E8A RAWNLYONS
1,666,243,903 *AF5690DD533BE32E4B283E1845B19E76533672CB raleighsil
1,666,243,904 *AF5CAEFC6CBA1692C6050E416A7A39C5FA708E21 TRINITY274
1,666,243,905 *AF52DE93BC473B8BC22C97F4B66C8807F52939CE RANDELL.WINTERHOLLER
1,666,243,906 *AF536FB7F31DFBC57D333B407542E9FB798148EB randydeviney
1,666,243,907 *AF53A9E2E3EB81C4FE15491A3E40A67159B21468 [email protected]@1n3$$
1,666,243,908 *AF59F02FA571630AE7755547990E0C95E9302AA5 SSENOLLICRODARTSINIMDA
1,666,243,909 *AF5C9F9BCB51986E319185CA8C386D76C13344A6 ranilranasinghe
1,666,243,910 *AF5865409E48E2D800F114818C5AA0D92B178AAF SSNCHPRS
1,666,243,911 *AF51E9D5DE46CE65BB4FF6F94088E6F7F136A8E5 TROYGIPSON
1,666,243,912 *AF5882B1A9ED00C4DF384C0AB346EE30FE37877D >RB<>TT/<TOO.HOO>TT<
1,666,243,913 *AF5C71295D906190FF146D09CCCC5FC47402D84B STARAWES
1,666,243,914 *AF58F0B3914D6BBA7A4250EF3038FAB0F5C77B6F starsmeare
1,666,243,915 *AF5C052DCD8F6252C403AF5CF8FCE60965537C64 stenocranials
1,666,243,916 *AF5198236A35B834225D72CEE4A55685D03ED7EB tungsten6
1,666,243,917 *AF5663634DC735E0E852969C595274607E833672 TURNOFFTHELIGHTS(FEAT.TERRIPACE)
1,666,243,918 *AF57B4B984B9C219558CCEDE2A58539E845BE7B1 REGICLAUDIO
1,666,243,919 *AF56FBD6BBC1589C9B956A5E1E221A7C1F186DD7 REGINEKWAN
1,666,243,920 *AF5EC3AAD9C93050359C67A689459E64B21750FE TYLERCHILSOM
1,666,243,921 *AF53D49C9000C7BE08E7F0E902B3FD3676C5ED76 REHABILITIRTE
1,666,243,922 *AF551B42E5EB8D69CFBE1E4C36F365FB3602A97E [email protected]
1,666,243,923 *AF5CEC5F92B976B01ABB93BF8244FF6A9CA972E3 REILOUIS.BBS
1,666,243,924 *AF5A31E8798847A449FA1A6131BEB494460749AB REPERTISES
1,666,243,925 *AF5C388D8724B4D6434170A539547F2872B5FE39 rekka-sougen-no-kaze
1,666,243,926 *AF540821DDBFF90D60D0DD3A029ED8EB8B024D69 RESTAURANTSCHINESE
1,666,243,927 *AF560B4E65D5F0518C8E6014C8937E1937655614 U134146
1,666,243,928 *AF5C2C2A2EEB2615DA5D2F93443AE131B07F5086 [email protected]
1,666,243,929 *AF577D48D74A0B7A9528AEC75C30930F209E9F9D RENEWALTHEOLOGY.NETWWW
1,666,243,930 *AF5A89F9EE403C808A684DC0BC2CCCBE59C25D56 SUOKISOJ1
1,666,243,931 *AF578FE5E5498F16D52FFB137273481A1ADB2CE1 RENOBYNOHTNA
1,666,243,932 *AF53BA40E8690FE88F84011F7BC6BF737EC50E3D REP4ST1N9
1,666,243,933 *AF5DDFA9CF9666E04A0CEC8310AB1B23B4CC320F riarkeoto
1,666,243,934 *AF58D5F7B59069CB382597E4FE195F0DBE17CEDD UJANG-NDESO
1,666,243,935 *AF54768542F76D14C4B5E081B9B6A0A75E798F1C ujjwnyt6
1,666,243,936 *AF5A90AB3CC55A953E9582A7617393A97D72BCBF SUSAN789
1,666,243,937 *AF54DABDC20DECE8104B2DBD7DFFEEB315793E5C ultraauthoritarian
1,666,243,938 *AF5E8FB806407707CA15A3D8F4EE8EFB47697108 SWAYZE15
1,666,243,939 *AF5545BEBB94ED6F17AAD7CDF201F42C1342BCE3 RICHLOBELLO
1,666,243,940 *AF553FD35690DCF5EB66BF08C83F84EFC2DE9022 unclasp
1,666,243,941 *AF54EA91668A5C516B846AA25B14888209DFCB66 SYSTEMCANCERING
1,666,243,942 *AF5DAC502FD1EDD325AEC65F5E7208F62DD71AEF RHONDA.TIMBERLAKE
1,666,243,943 *AF551B06AE4CC578D8298C5C191DCDBB155EBBEF RIYÂSETI
1,666,243,944 *AF5641E2FBA985B6B87BDF5F5D71AD842DBC96AB underhew0
1,666,243,945 *AF5BE93EF5D387FC7C305DA3F78D2BEF4EE2B614 rick-decker
1,666,243,946 *AF5145BED49F3A733FE435A2D69A94072A26ADF7 talk841512364
1,666,243,947 *AF5B31DAA1D8C8B5CFB21EF3A316EC96AE93E062 ROBECKLOFF
1,666,243,948 *AF59B8EA7719954B9474CE8F8585E178AE314028 talk8471128178
1,666,243,949 *AF57A336D66A627D72F2FA84B784D983D27ED27B ROBERTMELANSON
1,666,243,950 *AF52560D2F56568CEDF4561E0B015953FA30626C UNPR0T3$T!NG
1,666,243,951 *AF5EA21AAFD3069BFF871F596BDC8AC546CF70A9 TANNERLAMBERTSON
1,666,243,952 *AF54B4DE8D03065F644034B348A3A991D076C6D2 TAPAKYTNN|N
1,666,243,953 *AF590281C2525261607B36513BBFE7E0B06613DE RKAPUNGU
1,666,243,954 *AF511F3D4070F6E67B077B83B995D676EC3E3A49 robertfraize
1,666,243,955 *AF542F3DDC0C6F283473745A886D51AFCD84EE82 rochann9
1,666,243,956 *AF5AF393CD08ACD43EB9F7C18DB0F9BCF4575963 uznzlsyj2v
1,666,243,957 *AF58E662F1FD0E048100CBC78081EAE1DE3B7B72 ROGERPACHECO
1,666,243,958 *AF5B210DC469B207FF5A6F15BA95548D77FD52F7 ROLANDPETRONIO
1,666,243,959 *AF5E40E5AE16D609BFE14B38FF8F5FE84970FF6F ROLF.PILKEY
1,666,243,960 *AF55D623385A03A8458F186984E34CB41FEF9589 romeodoverspike
1,666,243,961 *AF5E1156D03AF2755AA0D894FA9EFAE9EB46D234 ROOFTREEN7
1,666,243,962 *AF507664E9584C93D9970B9CBA6FF62569B530DF THARVGRUNGUIDCASS
1,666,243,963 *AF5C452AD8B77E27B75ECCB5BCDA9BC5F15C8130 rubyology
1,666,243,964 *AF53AD58A28A72866ABFF3D3C929FCD0004C5B46 The.Ascent.(sting)
1,666,243,965 *AF57F675024E6E4E9B26DF2BC80D9100223F101A RUFUS.QUACH
1,666,243,966 *AF5FD6231EB4F81256D9F59005FFA0DEBC7F7680 VANESSA-MARSCHANG
1,666,243,967 *AF532AEB01D3CE021755268DBF22750C19CBB319 THE-LONGEST-ROAD-(FEAT-LISSIE)-(DEADMAU5-REMIX-RADIO-EDIT)
1,666,243,968 *AF5C981FDE53923C31009F9D1D2AC4ED4831725C RUDOLF.FARINELLA
1,666,243,969 *AF5C312A1DF89390141FEC35FEBD539514A0733A RUDYPYETTE
1,666,243,970 *AF515C09431797B2B8451A2912BC921638A83912 The-Tempest,-Suite-No-2,-Op-109-No-3:-Song-I
1,666,243,971 *AF51D0276C4224D30F03DFDB0227E4F21DBCAD00 RWDKING7
1,666,243,972 *AF5F020CBC0DF5F5122B22AF8539AC4B7FB072A3 VEDERLOED
1,666,243,973 *AF504EED3103C85497DBBD05ADC464B02062B9A2 VENKATESHMANDARAPU
1,666,243,974 *AF56C749DFEB132C5912BABCA4A7E9A9106794CC SA
1,666,243,975 *AF584CCCAC46DF94D9E49FF20CEDC09B759C5842 [email protected]
1,666,243,976 *AF521D2E5A64047AF6B38EA4B958D0C7DA306F34 SA
1,666,243,977 *AF5935A932C298A104313D1028897BF2097F7112 TIMMY.STEMPERT
1,666,243,978 *AF5070BEABA6AB948CA53C192E019248671502ED timozel9
1,666,243,979 *AF5825ECA6AB35F25E9C6DB6678E48A0D413740E saiyūshū
1,666,243,980 *AF59125C26C2EE46FC094B667FF0E459E83F1471 SALLY YOW
1,666,243,981 *AF50955FF2A06CF002A356836E22298B834DA9AC VICKI-FRONTCZAK-HALL
1,666,243,982 *AF5072E6B3AAE18131BFDACE19F73C4FDB72D54E SANFORDHICKS
1,666,243,983 *AF579320285D15D972BBF024E38DF7CD00D60723 SAMEERKAKAR
1,666,243,984 *AF5A083C5EBBB2D380FD294E75A538C6C28CF567 TKURDEGTALP8
1,666,243,985 *AF5520EFC19C255F72922135F1440371E1A7CE33 SARAHHARRY3
1,666,243,986 *AF5179CA1E0AC769ADAA1F8D06B3650079D502E5 T}M
1,666,243,987 *AF5247A8E416D9A6CE98A3736F6D62921DB4C252 SAMUEL.MORADA
1,666,243,988 *AF5C16F930EF6EADF9CBC847D0F369D7B3166238 VIIDELAM9
1,666,243,989 *AF536DAB1541A788AF8B97DCF092518ADFEB3704 TNUOMAES0
1,666,243,990 *AF5FB840D9F36FB3D299B5B6B493337244411C8C SCAR.OF.DESTRUCTION
1,666,243,991 *AF5EE80A7C515C5981D8F4B4DB0B65A2D2D57D1A SANTIAGOSEVILLA
1,666,243,992 *AF58C963BC5B62EE4D1B2596E79B05056827D0E2 TODAYBEACH
1,666,243,993 *AF52501C299A6193496B1F915CF7F41E91169CAB TODAYSUCCESS1
1,666,243,994 *AF5A3FE99971823DF89C3A0E1B11B306A2B9B6F4 TODD-KNEPPER
1,666,243,995 *AF534FCB7C15481E77F3EB07DBD925D44D93C70D SCHLAGBAELLEN7
1,666,243,996 *AF50BB738BC402E84F6C5F046A42FECC18323E96 sarrah-grammer
1,666,243,997 *AF56B64D75033CB1403C9E9DA0233F55837A4739 TOLTRYNG8
1,666,243,998 *AF5ABEDAAE005D95152A4DDF2D04346E495EDFBD scottmega
1,666,243,999 *AF5C9FD7A5B76E14AD56579E8D33C33E472847ED scoutpeewee
1,666,244,000 *AF5DA490F5CD46698C7E651B79E90FD6AC3A8AEB VITRAPIR6
1,666,244,001 *AF5DA8EFE33AA2B2AA339A0B467CE698024E5AF9 [email protected]
1,666,244,002 *AF5811F8DCBCEA01E145F6F0432FAD2B7E1CCB28 vjaq
1,666,244,003 *AF5E10A41541AA14B0A08346EEC0AFE0793B3AA4 tracysam7
1,666,244,004 *AF54C398F18C419134F3F209DBA1988882246CAB vrbrkkl9
1,666,244,005 *AF56EBE9B69FDEC299567E88E2439A50DAB6A819 SERGIOGEIDNER
1,666,244,006 *AF5F3E42D4B8597A8D4207DBDA277FC5A0C8AD3C SCOTTPESSIN
1,666,244,007 *AF5E29EABB7A86B63356F370A7E7685EBC6246A8 SEX!!
1,666,244,008 *AF5E4FF60DFF0250B33F94FD180B7591119B48EB TROUBLEDEVISION
1,666,244,009 *AF5D79E705EF8699BBEEC643C873821F90212E07 shaheen.nazar
1,666,244,010 *AF59F773166D885FB91BB10CCC4D42E225C3EFD9 shailesh.sinha
1,666,244,011 *AF5813E843D81E759A30CF05BA5473C2B3B9E9A5 [email protected]
1,666,244,012 *AF516422DC72C1862ED8C5678B753916470C85F0 [email protected]
1,666,244,013 *AF5BEBF0E37A5B42C45254C0ABA063E05F44C6DA [email protected]
1,666,244,014 *AF55388568066EB753623D6645AA70FE7FDBB3CA TUESDAYHECTOR2
1,666,244,015 *AF5AC56B815A4D542B3A1371871D5ABD86636A7B [email protected]
1,666,244,016 *AF5A909FBC8EB79398E3F7BA39D3B86ACFC61815 SHAUN.DELDONNO
1,666,244,017 *AF574D6373EFC6FAFF52360A0AB5DEEF7D37A782 TULKEISSAS7
1,666,244,018 *AF50FFB2A5C075A7797A897C5361B227EF176BFB SEKISUIK9
1,666,244,019 *AF593C12FB970960B1DA855F4077E5E62881699C SELLABLE
1,666,244,020 *AF5EDD85E653EFB56B8ECB7092E01DE5442B0FF2 SHELLY.BOULTON
1,666,244,021 *AF50656E4110DAC7975CCD1B663FF2F0327E53BB tw01
1,666,244,022 *AF5620CA552E54744CB61BB1C6486A098234248B Wanshi
1,666,244,023 *AF5E6A1738E1A0D254BC54AA18D8C5E6D1983997 tyrelldraxler
1,666,244,024 *AF58EB0E11F85C85B245524EA67F24E54EE2158A tyronewildin
1,666,244,025 *AF5EF92082FEBC9FFC661B22A0B896163E2BDA1B TYSON.NUNNALLY
1,666,244,026 *AF5EA983CEA83EF565847A4B773213E9E24C876E SEYMOUR.BENSINGER
1,666,244,027 *AF5EC40A4E29CB36031003D773A83208966ADF0B shoabusiness
1,666,244,028 *AF5FD2B08F5C8A20771F2CDED20338F6F70137CD SFOERTMEYER
1,666,244,029 *AF5AEAD287DF7C145323678EBA115C9247A08CC8 SHORTYSHARPE
1,666,244,030 *AF52B1496497083E340E0544B809B25E7DDDE8C7 ubedzie3
1,666,244,031 *AF509A57276233ADE4BCC5A19AD8D4B1F00B4FE5 uda.gross
1,666,244,032 *AF5833CA99961E0C2F53BE29EF318DB98EF8D24B WELANA“
1,666,244,033 *AF50FAAE24A1A9D63C0B5078836C432BCD103BB3 SIARID
1,666,244,034 *AF543468037B2713F71C1C6D0577958478A3C57C SHAUNSOMALSKI
1,666,244,035 *AF501501E39B3F079A2DFBCA3247D12707EFB4FA UIWGEJHCH6
1,666,244,036 *AF583426615773A58C5C35D61C38784824D9FA5E silvesterabendgala
1,666,244,037 *AF58D812D334BD49F235F9A1ABED84AFFDFA42AF shelbyzipfel
1,666,244,038 *AF55762D7D7B5E2337FBCAA97AA700FA49B4124C SIMON.HOSKIN
1,666,244,039 *AF5EAD2EBFEC0069BF64F92CF8796B6F253CCC98 SHEMTOB_BEN_ISAAC_O
1,666,244,040 *AF5EA6796613FF458719789CC26186C090BDE7EB [email protected]
1,666,244,041 *AF572A507377EAD0DB5682F84896F88088F46406 SHERMAN.WINDUS
1,666,244,042 *AF53A877947E4CA1B258B472DF04D1929A1516E1 SHERRIBROOKSHIRE
1,666,244,043 *AF5800A6BA595D33E1FFD510C01C2B1FEF0ED428 undecoct0
1,666,244,044 *AF55864AF655B5061B2C36B83FD2E2B2290445D3 [email protected]
1,666,244,045 *AF570CA327EFBEE6C330D3EEC4BFE629BEA382B4 wenye)1910
1,666,244,046 *AF5F01F9FB131AA197C14680D2CE48B5D269AAEF WHAAGHUNN-SILVERMANN
1,666,244,047 *AF51ED4A28179E1FB07941716A4AC5A605BECFD8 SH!P104D
1,666,244,048 *AF51D94C793EAA00F24101C07B86A6D4EBE28025 slkkrtjs0
1,666,244,049 *AF5D180C0850DAB41A01C1AA69D6ED629A6D30CD SLUMARBEJDER
1,666,244,050 *AF56DC176B08DDCADE425D899ABFB9952105E053 whitesbo3
1,666,244,051 *AF5A0C3B228C598BB2760EC02F09AABAEA5A2DAD SIBORCH
1,666,244,052 *AF5B9D48A4CBE4104028DB5F52C6B46F630D3223 silaspollara
1,666,244,053 *AF509301154DEA3B71DA0302C93912C083FF2DAD SMRCHCHHT
1,666,244,054 *AF5FBA4DFAD1DFDA093521417D96D7119171DB9E WILBER.ARNAUDET
1,666,244,055 *AF59C23375568B7137C02A9B54E0B695C2E93F59 smtjyothi
1,666,244,056 *AF5CA5A3FF127A55F01E550BDD6E531A65C80E7B wilberhorodyski
1,666,244,057 *AF500CB6048E1FB057B32034E5383DA9D5D07E04 SMWLD
1,666,244,058 *AF5A2CAB62D778BCAFFF80A728ED7AF908F13B0C SINANGLANAN
1,666,244,059 *AF59F18518D2434BFC11E9A97E9B9CDEFB90E7E3 /USR/SRC/LINUX-HEADERS-2.6.32-24/ARCH/M68K/INCLUDE/ASM/MVME16XHW.H
1,666,244,060 *AF5DA5E2E6A4FB4B68E1078E65BBFF19089E0E85 WILLIAMEDWARDSTEWART
1,666,244,061 *AF54BB217D9AC4591A69797F98C93E773D067B6B SITEERATAKSENIED
1,666,244,062 *AF541777EE8B1A2CA4921FB1F0B81C3F04C880D3 [email protected]
1,666,244,063 *AF5ED38C54816EF3941B10F7C8C6CF96C801D363 Sjilp
1,666,244,064 *AF5C42FB409B0A2EAB0C50D9711ED7B3E2807200 uufefolp40
1,666,244,065 *AF5632B2F3138EF470C1C74E4B31D4117E355735 vagtelen$
1,666,244,066 *AF5A759DAD27B4E8382981E9276C3FA16F563637 sophie-messner
1,666,244,067 *AF51D0BDA89AB891177A1ACB1F02CD459661028A VALERIANELLAING
1,666,244,068 *AF583A9318E92EEFA503F1D7701202311C3A87AA SNADDENS1
1,666,244,069 *AF5AAD941E46954B1DA69DB8C6B02BF3B6A4CFC1 SPANELOVYMA1
1,666,244,070 *AF524A9B20794134E7339A26D050FE4233EC2DB4 VALSAN.VASU
1,666,244,071 *AF5FA329A9F9D4BFF6A21B38651A9002EB51F36F VALS EFTER KARL JOHAN
1,666,244,072 *AF511401790594D02C41C61A0C8D607767119C3B SONDERAR1
1,666,244,073 *AF50019D82469D5AADD4A3E51D94CEE0D422487F [email protected]
1,666,244,074 *AF5FFB1D08F118742F7235B53F0775E6890D184B SONGSINEEJ
1,666,244,075 *AF530CE7D97F068D65584B8807EBD042238A0A86 [email protected]
1,666,244,076 *AF5AC51DC0CF4774CE70A5BF66ED3A759BEA722C [email protected]
1,666,244,077 *AF50CF5083DD54556EC23517D1E19C7924FD86C3 VEJSKILTENE
1,666,244,078 *AF53A5F6F849B4CFCBA6C8203B4160E284BC2343 vend8l+y
1,666,244,079 *AF5127555980832976C483968DF1378D8A8DAFCB WRDBGTZN1XM
1,666,244,080 *AF583E78313A5DDED68AD5C2C5A961AA7F30F7FA SPECIALPRIS2
1,666,244,081 *AF5D711325B648923D0036D9E26380212DC8818B [email protected]
1,666,244,082 *AF5F24305E4E47441D4F6EB1C61FAAC810F73099 spmetim5
1,666,244,083 *AF5EA869285957E562AB9682A19AA7DEB115CC40 spitfire20
1,666,244,084 *AF5736BD40A6B10CFF7CED053209C4CB3E3FFB5C wwwcurrenteliminatornet
1,666,244,085 *AF5B427340CD7694C5A32E00DE5723503F7FEB53 SRUETCADEREDEM0
1,666,244,086 *AF57F0F150E1B81D99371AD4DA168AB2DB9D01E3 SRUZCVVSQN.
1,666,244,087 *AF5F49DBBDC7B2E53001B646DE610AD98DD74F02 WWW.NTXTOOLS.COM
1,666,244,088 *AF592499683A4626AF6101335050257F17D2B6B8 WWWRANDOMWEBSITECOM
1,666,244,089 *AF50044B0D15CFC40855963CAE8D8ADAC5BCD29D stacygiboney
1,666,244,090 *AF518CD2CCE5CE2D882248D53906B5B8F3DC76DE wx3
1,666,244,091 *AF597BD6993785C7B628C57D5E5D5B233D15B0BE STANFORD.MORAS
1,666,244,092 *AF5E0466C4662175BC64936F54A8F91F4A8A05BB VICTOR NYALE
1,666,244,093 *AF5569469B4497166A742CD9A7D73540605368C7 Video.(maxiversion)
1,666,244,094 *AF5AEAE3D0F775C57A4D1F8EF24AC3F0136136DB vienmi
1,666,244,095 *AF5FD4A3A5665A711160E1294EB66B553F587C2F vincentlockner
1,666,244,096 *AF5CE5D99ECDFE28192E46CA0BAC8E65C1DA2602 STANKFISH
1,666,244,097 *AF5E2CD72D99DD446D2769E79106CF6722E724F5 STANTONCABAN
1,666,244,098 *AF51B1D2925C8928DC646A689CBF9F6717CD069D STERLING.GRISWOULD
1,666,244,099 *AF54051063174B3E473925DF1ED63774BEF6ED6B XIBUNFXPSSZ
1,666,244,100 *AF5F5CDD86CC0E8D6B98F2C76FF07C61AE9D7B0E steve-romanecz
1,666,244,101 *AF5329D2E3F7FDDF73A4372F741EDA183B25F0DD STEVEVERONA
1,666,244,102 *AF5B04538E7AAA2C00C10A80252C9BC828311C80 STEFANIE-LUTZ
1,666,244,103 *AF532479E1A076758FF6553B134FBFB6641D8683 STEFANPEPPLE
1,666,244,104 *AF58D59989CC448C3A7A5B4EFF43F4C65BDBDA38 VIXX.HALLEY
1,666,244,105 *AF5AC50C1CFCD1EAC22B42293948D9ED823E9CAD VLADIMIRA-ADAMOVA
1,666,244,106 *AF5B8D3B963F723B320BCCB6F6D8816D2E6A9AA0 stephenconceicao
1,666,244,107 *AF55238564E6985FDF24883461EAAB61D628FF98 vm/cms----------------sqluser
1,666,244,108 *AF529FF2BF82BC76CD3E24137B875EAA260ED36A ˈSTRÆK
1,666,244,109 *AF56EC1C6E728EA534375F64263F4AD7475F1A6E vollysekhon
1,666,244,110 *AF50B59D7B2DE03E3EA458777CB954D19B79B5AE steve-virant
1,666,244,111 *AF578000669519E72BEF30F8EEE0CD20FE5170E9 STRONG FAITH
1,666,244,112 *AF5FA9B4EBC6A48E5B523FCC7CE8FF6FE275DEF9 stewartarancibia
1,666,244,113 *AF576D007F0540976FC7906301C0187063236ABA vonmireles
1,666,244,114 *AF5567B2FC61E8FAC8CA0DC98E919C5C4A4686CB stewartzabriskie
1,666,244,115 *AF5B4F647B2319386FCFDFE137E3F2BA8235428D STIFFLIP7
1,666,244,116 *AF5C3C4E33C593E89BFABCA3D913E9AA0657821A y4/
1,666,244,117 *AF5A952A017BE27D6C5D22DC4A4BAD279527037F STONE.SLADE
1,666,244,118 *AF54C217691725DC878F0DD93F68FAB98F60F092 YAMILKA-DAMAS
1,666,244,119 *AF53182BFE246FC93986922B73D722B55553F3D9 STUDIOSSTOTTLER
1,666,244,120 *AF5D769EB8B5845C6B33DE4CAC216560CF2E81DF YANTI.ARDINA
1,666,244,121 *AF54EE6680256276DF51F6E980B0D845EB173AD0 streamingsummerlove
1,666,244,122 *AF581EEB05A1C601C215381AEAD185A3BBC622A5 YAZOO-STRUT
1,666,244,123 *AF5BC0E2AAD577531F63081910ACDDDF035A9413 stufenwähler
1,666,244,124 *AF5D62C06DA82D59BE059CB3038E4A1373462B52 $w4mp.itc
1,666,244,125 *AF5A93AE235B6C4633534B7015444CDE733B2442 SUBFINANCIASSEM
1,666,244,126 *AF55A5C5308DFF2116445589D0289FFEFD96D301 Wa++1ng
1,666,244,127 *AF5C0C83045ECF326CFB6D51318F6BC37E1CF673 SUBTERRANEANHOMESICKALIEN(ACOUSTIC)
1,666,244,128 *AF5D3B15A7135E8D83D173F1F29373F426D2C150 [email protected]
1,666,244,129 *AF5C92D4292A0B3872666970DFF2AAA39C9EF9B7 summertime(spanishflymix)
1,666,244,130 *AF52C97039E2B1BC1D5F4D13A536A9E7EE3F797A ylihcooms
1,666,244,131 *AF572E34EDDD72AA28EE799203A7D61260FD7A48 SUNG.MOLETT
1,666,244,132 *AF5C3DB1EAC0F3A8F8E535A31D8440D96EA04F02 SUNG.SARETTO
1,666,244,133 *AF511359AF839EB8A5BA089864B044E4B4A379CA SUNRISEMALL
1,666,244,134 *AF5DC57E4B6855D77C05A461DCECE0189CF0F7A3 [email protected]
1,666,244,135 *AF5DD064D832C94235E6D6E52B9D683FF1123A2F [email protected]
1,666,244,136 *AF578892BBEDA90B3801567707B365706B558913 wanluidendst
1,666,244,137 *AF54C55D669E61BE62529F3E9E6BA6DC004E30DD WANPENPANYADITWONG
1,666,244,138 *AF50987ED6C2AD8114055C9058593825DAD6C935 SUWANNARONG
1,666,244,139 *AF5FB519E5D9791881D04F0F82D0517300E65F70 [email protected]
1,666,244,140 *AF5F4B753397CEB88CB9929A78B13C2A36BEE398 [email protected]
1,666,244,141 *AF5C9340041A18471181F4D00FED4D1063311EAF wendellkrylo
1,666,244,142 *AF5B6A25F1DE2562FADFA287095D983E8E06D7C8 SVLGENES5
1,666,244,143 *AF5C794BFFED91B45C6E53FC3E6254AC37CC102D yvonne.conder
1,666,244,144 *AF5ED91CB7F15F476722AAA406FFD9B261E71934 yvonne-munroe-george
1,666,244,145 *AF5FC9D2DF4F507C476CC5C89D0C253385F69DAA [email protected]
1,666,244,146 *AF577FC9C48385215BE6110133106E9C1959B316 SYLVIA GOODWIN
1,666,244,147 *AF59DF92F1A8A05E4D4E62B48A2197898AF0F251 [email protected]
1,666,244,148 *AF574F00CD5D4455E1A04DF1576EC1FD896C7F67 symph no5 in d minor, op47, ii - allegretto
1,666,244,149 *AF584C4DB33F0810902D6E0506C6DCCC2E286EBC WG[}
1,666,244,150 *AF59E93C160FAD20A0C92DA61B76EE894ECC6CB4 zach-schuermann
1,666,244,151 *AF50FF369CA182729154B4D450DC6686F7284049 WhentheDevilWantstoWrestle
1,666,244,152 *AF5D3912F306D6CAADADD9A7D3ACDF2446DB7457 ZANIIM
1,666,244,153 *AF52BB4E29A0F1C224DF4B5D02C96F7E2C5E8B62 T0LUSAFRANIN3
1,666,244,154 *AF55DE844BC82D03429E4EE208EC5C2CCBD05177 T0PL0FT1ER
1,666,244,155 *AF5504CCE23B0D4B3B6C21E42984DD32C0AA056F ZÉLENDE
1,666,244,156 *AF59EA0250CED469D1089B41EDC9B214D966AFCB ZELFBEWUSTZIJN?
1,666,244,157 *AF59AB8D7B944CFEB27688F5012F6EE0FC1B82F3 TALKBENWETMORE
1,666,244,158 *AF5834D05E03C16500F861978CDF3C107183FFAB WILL.ALFANDRE
1,666,244,159 *AF5A4C9EBF3D550B782EE85DF3DF46658429E8DC TALKKANAKADURGAP
1,666,244,160 *AF5632E1396121EA25B9505B66D33DACAE5A7384 TALKKYMC
1,666,244,161 *AF507416671EC94F1BB8A35E34421C44C4D59DE2 TALOUKSISTA5
1,666,244,162 *AF55DCE69D71292AAA67031D584BC6562FF66207 WILLIAMBITEME
1,666,244,163 *AF5A4A21A00220C824E1E7D9224C0C90E21C054F [email protected]
1,666,244,164 *AF5DF04327F46069CC67D5B84E736CA555669BDA [email protected]
1,666,244,165 *AF5A783B46737757DD4A6FF1731A13C090B17E3D [email protected]
1,666,244,166 *AF530039BF447C110436B3D2473CDAA46944C540 TANNERBEATRICE
1,666,244,167 *AF54C751A99F99189D1A201516D054C87AAFB869 [email protected]
1,666,244,168 *AF5B73D218CE836E8892B38F06DD3C0099DC7270 TARGETIRENE9
1,666,244,169 *AF57204B68492D11414F26CE2E4040C950AA9F8C WILMA.QUIRING.LINDO
1,666,244,170 *AF5B086CAD501AE79614E1D1C46414B88152DCB3 [email protected]
1,666,244,171 *AF550DEF3551CF07C2B7C5B3FA60503497EBAABD windigokan
1,666,244,172 *AF582B82616C24505EEAA04E139A779F2AE3DB1D TAZMANCHARITY1
1,666,244,173 *AF5017A8B2AD78B58932708A7D145F113B22B82E t_b{
1,666,244,174 *AF5F41202AA5FD18B9F75B5BAFDE71FB9ACE8785 TCENNOKTEN8
1,666,244,175 *AF5BC3B0898E2A61422AD814F827BBDAF332586F WM.SHANER
1,666,244,176 *AF5E6E236CB609A73262A925D23F7A4BE0D053F0 z/[p
1,666,244,177 *AF59518F6CF8A2B6E619371FD4FC88A1A70DB83F ZTLICHEN2
1,666,244,178 *AF5218E40EECF6B7B58CFF54E660FA8131349CBC wrong key donkey
1,666,244,179 *AF53BCA69410522E4F2DF31F9593297D7F0BAF5A THANHHORNADAY
1,666,244,180 *AF5033B9AC750CFC0356B2B5E02B955C67D76434 ναντ
1,666,244,181 *AF5E829339207B78A36F33E8D3F28BE7CDB3CB42 THALAMI
1,666,244,182 *AF50E3B3EC7B135D5E2EC190CB26D7B8A2372480 thatgeronimo25
1,666,244,183 *AF5FB4F791A970A0B35DAE3B4EFB24BDFA8CEA0E xavierspoonamore
1,666,244,184 *AF53BA002B966D3785FE6B686D7F817FF06E23A0 THE123GO50
1,666,244,185 *AF50AD4D99242720F124D9F21F0ED2B417613770 XHENIMISHO
1,666,244,186 *AF57314C410D2D0DBA81239F617F43C7A75F1B30 THE.EARLY.DAYS,.MASSAPEQUA,.1957
1,666,244,187 *AF54002B5DAC5D033DB849715AE8D163C4BF0404 THE CYBERDON EP: RELOAD REMIXES
1,666,244,188 *AF5CBA7C945B91833DF0C8739B1B636A486C3068 xristina-nidimou
1,666,244,189 *AF500CE25482D25DDC0144BA75A3D03FAC0491A1 ЗИДДИФЕОДАЛИИ
1,666,244,190 *AF593913E641572662CCA7377BE2C614113BF665 [email protected]
1,666,244,191 *AF53816D27A03406580BA7F5815556B0732289F6 XTRMRTL4
1,666,244,192 *AF5738C2FB9A2C4318B35BE2D376B48D61818E6B THERESASCHOLL
1,666,244,193 *AF5E82D5DB1BF3EDFAF3CB95F750324842815D3C КІРАЇ
1,666,244,194 *AF580101D2724669658368D56C3D93E3339B44CF КОСАЧЕ“
1,666,244,195 *AF5E852C3BFFD52C3817448CE27CDDC962AB36B7 The-Silver-Stars-Are-in-the-Sky
1,666,244,196 *AF5B71686A92868C231E5CAC575202957EBB5C73 yamira-matos
1,666,244,197 *AF5CA6596DB6A81252B6C988E41C52D40E1EB39C YANET ZAMITIZ
1,666,244,198 *AF59F9FA1D3A2FC40C1CAAA2026747EDE6B07DFF THE.SUN'S.SO.HOT.TODAY
1,666,244,199 *AF583E87BF267A9B98EEA1C058512B36FE946964 THUMPER15
1,666,244,200 *AF5EAE5EC4A6FD55A0473BC1516F679D928091F8 ОКРАСТАВЯХМЕ
1,666,244,201 *AF53FB148D3E133F7C1FFAD1FE8B2A3C24BECF12 пищаев
1,666,244,202 *AF582948A3B15D7345F79F9D774F756D918DC8DB ПОСТТОТАЛИТАРНЫХ
1,666,244,203 *AF529C41EEC3D4D2EB1F584E4FEB33CF47BE08B3 THOMAS-AYOTTE
1,666,244,204 *AF58300AED0D084D6998474E541C1ABA5B12064E tikhanovs
1,666,244,205 *AF53A4F1E3C9DCEF11F6DDBF94BF4AC086A72FFE Yeh.Hai.Bambai.Meri.Jaan
1,666,244,206 *AF514507BC32C2849C7C1351402440E47D282A92 THREEPARAMETER1
1,666,244,207 *AF5BB97C67921A485C14203DB5BFA5E17A1D978F THUNDERPUNCHBSWED
1,666,244,208 *AF5F0B052DFE5E7D7248955F50ACF8F082090477 YENYOL
1,666,244,209 *AF57581674B108F30555B054B56BB8A9D6685916 СТАНИЧНОМ
1,666,244,210 *AF5208B6E4AD43AEC2FD71208B223CFF53A5041F TIARETLUPATACS
1,666,244,211 *AF5BE1547B5192DA54FE07A9C65D1CBD2540541D TITUSBALLA
1,666,244,212 *AF5175BF5AF6E61B80AECC4AFAE0A5F2C4946994 tiffany-bohara
1,666,244,213 *AF54C7BC4CF26574FD35E96AD0ED39C652D07AC7 TIFFANY SIT
1,666,244,214 *AF50C19CEB03FF912DFA3D8B845E19911B2B3691 TIGHTBEATS(FEAT.SLIM)
1,666,244,215 *AF575827C64948F693DFFA6B60A8693DC4EF2508 TILALLISUUDES
1,666,244,216 *AF5571029D6ECB0D1B193DA894AFEBDEE6DAD75C t!mep!ece5
1,666,244,217 *AF5CA0F6F86802581EB8518E3DCAC21D74E28FA0 чілігидер
1,666,244,218 *AF5D5E0A2CDF92BE7594B8130CAA8D921F3412B0 tommietschetter
1,666,244,219 *AF50E41158429E497C0DB530ED0DE34C73B6F2A2 YONG.REHBOCK
1,666,244,220 *AF54A98407234509D23EAB40060A6E281C8861EE YOUBARAJ.NIRAULA
1,666,244,221 *AF5C0A802A9C57DFEDE691BF0D34EDD3F863C089 YOU-KNOW-WHERE-YOUR-PLANE-IS-PART-7
1,666,244,222 *AF5AC3AD04C57C579FF66C20E3D892011ADC3B56 TMSCHDL205
1,666,244,223 *AF59FF5189213EACBE30775EB1CF6ED880680C2C TORY.VANWHY
1,666,244,224 *AF58D4E3C21B1D7491B5C66569F115959B92801B TOTALUS)
1,666,244,225 *AF59942023FD45295A2F7FCBD5CAF636B3C78962 TNEIATNACED
1,666,244,226 *AF50BADC5C8892C397BE3B68DA6FACF380A23166 TOGETHERSTICKIES
1,666,244,227 *AF535E54D26DD46DE3E14E333EA189C8F4523BAA tqzlm8fbfienepr
1,666,244,228 *AF5F3EFEA88672CD4B36381E343ACE6AA7643DEC YZYPYTERU
1,666,244,229 *AF529ADE02DD5D573C954FB7C6269AA3E0D07745 TOPAFTER
1,666,244,230 *AF5BA5E1B1AE3D7A01667503579F02A944A9BE01 ZACHWEASEL
1,666,244,231 *AF5DDA73FF307698E875242FEBEDA96BAE3AB8CC topgunvalhalla
1,666,244,232 *AF5EF1EF38F34877652350BD5F87DA515CA3CCE2 TORTIGEN
1,666,244,233 *AF579FDCD0E1DC766AAA4041479568911AFE7D8D TRAVOLTO
1,666,244,234 *AF5053594E11981B788666E46889A45F3DA487F8 TRACY TRIST
1,666,244,235 *AF5293C6C80FF43FDE3DC31CD8EF5945FAE474CA ZENTRALBAHNHOFS
1,666,244,236 *AF5FA88246FB7A1BFD1DF0AF2B0C803D9C556E0F truckelwood
1,666,244,237 *AF583883F660B2C350C90471B5616DCCF0ADAD21 TRUE_BEINGTR/U/_'B/I//I//N/
1,666,244,238 *AF5E105D5335DE55E4FD8DEF408F6915570092CD traumesgestalten
1,666,244,239 *AF5CA52F4CAECF348D92625C5A89FEE1C6BC08FD [email protected]
1,666,244,240 *AF5F0B07A9F18582F91F2CBFFFBCD97E7D1385E4 [email protected]
1,666,244,241 *AF5CF2E4DCD3381736666A02372345A884900D8C TTOTATOP
1,666,244,242 *AF5EB6805C4FC6136128AF965F273EECE4667AA9 trevormenendez
1,666,244,243 *AF51ACBFA3F1FB08A184C99C544E86299DF658A0 TUPPING
1,666,244,244 *AF59804C9BE5708AC80381D77297B60F02407FD8 TRISH.ODEAR
1,666,244,245 *AF516B55A23B7B81AF8E2B9870E0CF9950C663CE ZOUZOU-AFYOUNI
1,666,244,246 *AF520AF0A4BB1685A7E96FA4C92F9E4509CEE042 trmilevt
1,666,244,247 *AF5A9C5CFB2F74143912AA039A38A3BC6B43E5E3 [email protected]
1,666,244,248 *AF58F986692D20E7EFCFA88FEFB4FE3454705A85 [email protected]
1,666,244,249 *AF5EE8A6DF485BA9F732CB81685FB0F027E0CF4B ΕΥΚΛΗΡΊΑ
1,666,244,250 *AF547442258003F36122D8D5DDA124EB50C9ECFA TYSTARCHIEF
1,666,244,251 *AF555EE2F8D1467BD46FC7060F6BD7F846D7C4BC @[email protected]@1
1,666,244,252 *AF5CE57E0CB02D8EB931EE4AB6194AEA5BF39F09 АГРИПИНКА
1,666,244,253 *AF55EEC853F22BB02C191393685637B2E222443A АНСКОЕ
1,666,244,254 *AF5EE97821FB05F667FF615E2DE1B83AE9225861 ubong.monday.david
1,666,244,255 *AF5C1CC83CD54FB2D4F7C53139D2FF722BABA982 (>_0)0~<-----b
1,666,244,256 *AF5F42A46D9E1B0A60E8C0739AEF27765B339AFF [email protected]
1,666,244,257 *AF546B0C7930AE8ADFED892CA14F3755528CF778 02JULI2001-IRGENDWOIMNIRGENDWOHINTERLE
1,666,244,258 *AF593E72DEFDF6865A0BD7A5F43612759392B13B 065shaniya
1,666,244,259 *AF53B4C9DCA86FB993DD877FE9E8DBA4AF03D433 0F70D21D-3DB4-3937-8805-12CBCEC05B18
1,666,244,260 *AF5298B8F59D7349D71C015014BB28855A21CE75 0iamdaniela0
1,666,244,261 *AF5BAB0C4F6E52B47DEABEE11EC905BE7FF634AD 11-NOKINEN
1,666,244,262 *AF530F33AE1DF35810F289DEDDB103D48F5371C3 06.03.1034
1,666,244,263 *AF5E30D2BFD72E3DFBA92CA50AAF651D9240178B 10.leopard-panzer
1,666,244,264 *AF558D1D5AD80C9EC850A9258D6A11946FA3C443 1348606 renato de villa and other officers
1,666,244,265 *AF5E9B9B6AAC0C1913C0AF9E050482C3CDC09596 13GHOBEIRI
1,666,244,266 *AF50E729C4FFE0B3A599DD34101180BC1EC3E432 13-ta-JG-89/71/2-xoF-->a/<-412>"_412_N"=eman-a<>p<
1,666,244,267 *AF5D5954FB63CB4A52B4A168FF5B059E499C43A1 143575 ALOITTAMIS-JALOPETTAMISTY
1,666,244,268 *AF59DF75CF26114E8B4ADB0868D9756B19CA945B 1159352 MAKE OR ORDER MORE FOOD THAN NEEDED
1,666,244,269 *AF5129B7059AFD3F0CBFC13A9C176ED8477B3400 1488412 KIRKKOJEN.SUOJAAN.EHTINEET.SEURAKUNTALAISET.PYSYTTELIV
1,666,244,270 *AF50A94770010F48DBE4F4B38D07DE44F93C14C0 152CHANCE
1,666,244,271 *AF5CE6A21B88FA9F06668CD9493577BAB91F48BA 157KAITLYN
1,666,244,272 *AF5F9838F303BA73B17B991CC5EA6CCB9BA8EC91 15.Y
1,666,244,273 *AF5294AD99BCECC6945EB5CA5D63EA648695BC5A 12:.12..#..&...prowess
1,666,244,274 *AF515D53CC2465251E5DB7BA87466BBCBA92E9E4 (-_0)O~d=====3
1,666,244,275 *AF5544C0869274877776DF138E57734F740EF598 (0_<)*Q====3
1,666,244,276 *AF59D252FCD391976C08F96470B4A892007A522B 12689 sertaCOzgen300av.
1,666,244,277 *AF5DF05B9F994485B068D612E7283F058064B45A 1903633 kiitos-viel
1,666,244,278 *AF56C7769149BA36442AD0401D34F2A812B7B34B 1438767 ".ES.IST.WIE.VERHEXT.HEUTE..."
1,666,244,279 *AF5F4E6621F0102C8E70A016C0BE783CAA19E211 1439995 MARIA-IN-BOEBLINGEN-STATT-.
1,666,244,280 *AF523E75CACDDC5EC6CF707F7F22C6A574E7B3E3 1466643 DIE-TEILNAHME-KOSTET-135-EURO-
1,666,244,281 *AF5D46F85731CC883105BE0432700066A49F9504 14.vau
1,666,244,282 *AF508C341891E398CF3571D9B486F9D53D61872B 1.ALLYAPPROVED
1,666,244,283 *AF5E42C543BCF4C4989CD815767CE95607BC4FB2 1ANSPEIEND
1,666,244,284 *AF58652BAA89AC4102E1F5375F616F7EEF40E68B 170vttvje9
1,666,244,285 *AF520558DE6687ABE39E82BB3ADB18DB82247192 1937145 LAKIMUUTOKSET TARKOITTAVAT MY
1,666,244,286 *AF52DDCCCA3B3A27FCDFA33DF6BE6A8C80BDC2DF 1.DIRECT-OWNERSHIP
1,666,244,287 *AF530BE4DB07398E9C4170D80D65E5F86210D231 18-wortspielen
1,666,244,288 *AF54A8D64D172198A9F4F7FE8175D744CA3B8E91 1duvauroux
1,666,244,289 *AF5CF8C3994ACA7987645F56D61B8653FFFDB12D 1gemuese-gondolieri
1,666,244,290 *AF58F3F2F2FFB16F3294BB7E160DB02343039DD9 1apestegui
1,666,244,291 *AF51912AE6165C44F133CC981D3F22257FF048EE 1 HIIHTOM
1,666,244,292 *AF5B18008CBEFBB9A6359F208BFD983745D5D0D8 1IAMKAREN4
1,666,244,293 *AF50BC6B8356829CF87702DFFD38622F7D300C7B 1INSTIJG
1,666,244,294 *AF5A36A495DB5F459479E6E31FE08C649F1B1647 1 durchschnittsbierpreis
1,666,244,295 *AF5771DC7761AEC5C62FD05E2C57BE7688CE1B2B 1EUROTRANSPLANTATIONSZENTRALE
1,666,244,296 *AF5F8E8992F09BA8B4E075BDB5893988B672F7D0 1HARZBURJITLERE
1,666,244,297 *AF51756C3DDA86E4E5BE85560371DB7936338EBA 1-hirnoperations-maschine
1,666,244,298 *AF5460EDC0D3B5D75C20E40C43DDAF944E47369B 1MRCELINE
1,666,244,299 *AF5E36FEF7CC841FC81D9A802C178C70BE717E1C 1-indierinnen
1,666,244,300 *AF51BF9B5C45471460EE9B4C6D63EC021019F6E4 1.HOUGHTONS
1,666,244,301 *AF578AD52CCB31CE83862996218866D861B4FC67 1-neubaukeller
1,666,244,302 *AF5A89A17A1A8B644C3C42476779D831F3664FC4 1437715 ENSIMM
1,666,244,303 *AF5B936C42BA16423853CADEAD8F7351DD4561A6 1.NORDSUEDDIFFERENZ
1,666,244,304 *AF55B66B3404D939E2AAEB6357FE0C22F38674C2 14 SKENAARIOISSA
1,666,244,305 *AF5E3107209A1153229E5EA673E4E63F8975F653 15-08-1841
1,666,244,306 *AF57E15902B9F0F4BA0DADFED487936A4ED921AA 1 PARZIVALSAGE
1,666,244,307 *AF51450B212DBB0377046481B1CA23F36C0A0F51 1passrouten
1,666,244,308 *AF505F7FEE18B3FA3AC24C390EB17ECD8818837B 1POTILAASTAAN
1,666,244,309 *AF544C82AE4CB2D619A4187D54EA098AD7D11F8C 1PReSSWooD
1,666,244,310 *AF5E81859D603939B5278DABCEBF623AD5A9321F 1.PROJEKTIKANSIOTA
1,666,244,311 *AF516CFF82651D5925F02337C29ADD537D0FC525 1668907 A-ON-MY
1,666,244,312 *AF50644C2D247290465D91CF21868AC41B1DB19B 1Q2W3E4R:0O9I8U7
1,666,244,313 *AF5D4027C15ABC9B8E3A895E0F2884D64F18BDE9 1-KUENSTLER-GARDEROBEN
1,666,244,314 *AF5DDED722B3EA08A0CF038FEB241B5BA38D316F 1RAKENTAJAN
1,666,244,315 *AF55438C0D62F4D1CEAF55D42642237A57C31CD8 1-MELONTARANNASTA
1,666,244,316 *AF5556482B1296361986524049D0D6C1EA6F2BB7 1.rekrytointikysymysten
1,666,244,317 *AF51A1AC4F1B5BF742C69469F65A938F8F33646E #1MOTION
1,666,244,318 *AF513F5BBAB23F00F2D2A813545AA9905E20E2D6 18august91
1,666,244,319 *AF583D246B5AF4DDD996C4BD23E369E5926F7F97 1s}g0
1,666,244,320 *AF569CC474C46904B10FAD1F7B117627550B0191 1-meretha
1,666,244,321 *AF5B6878D0990C7CAC3F4C3C38E5C3DBDD8EAA75 1983jun11
1,666,244,322 *AF560F4308BDA6058F59616F5B663BE716985C41 1PALVELUPORTALIN
1,666,244,323 *AF5695FBF25BA90DB32F0D81D3A73BD60FC57323 1 PERINN
1,666,244,324 *AF558B5938A20E89B4E237D87611699E5A25B40F 1ND3T3RM1NABL3N3SS
1,666,244,325 *AF57697B2347BD31B59C75949662F8069B4BFA50 1swedishfi
1,666,244,326 *AF50CB654E6DCC49026F80C8B6C38403C2B34CE8 1pageswhile
1,666,244,327 *AF5957DEBFF30C0EB795C16C6183E6675C6FC942 1-TUNDRAKSI
1,666,244,328 *AF5AB11F32AA468C0692550EE92F593509834F00 1.cjuniorensonderklasse
1,666,244,329 *AF58DC9C0A3B4E2BDD6B940751129D6ADA1D9BAC 1SEPICOLO
1,666,244,330 *AF557892655ECCDA00D9360E149AC142EABB361B 1.TUOREUTUKSEN
1,666,244,331 *AF5F22A495314EF1FEF2CB8D9C5978F84EE19C64 1-UNIONS-BLOCKADE
1,666,244,332 *AF55ED77929BB857B1F24783F9C816CA87984F96 1-valistuselokuvat
1,666,244,333 *AF57FBFF688311C55F364B35467F4B966DFBB0EE 1 TABAK-PRODUKTEN
1,666,244,334 *AF54F570974321B3B4E1B46EB726DFE709B8BCC9 1-TILASTOLUVUISSA
1,666,244,335 *AF509CA06F1F5E28D778CC39B1ACEA76D570575D 1traditions-gruss
1,666,244,336 *AF5E6775E0BF30C2E48DB4C7245D3CD0C5297447 1 URHEILUHULLUKSI
1,666,244,337 *AF5087B8D57EF55B10B57F8256C91780F1A30487 1GITFIRDT
1,666,244,338 *AF54638CBE242EC4722CACEB86BA6F94747892BE 1 GLAUBENSERBE
1,666,244,339 *AF5F3636442B1CEC626563F262DF6ADCCEDADDE7 1.viikkokohtaisesta
1,666,244,340 *AF5078733079891A255982DFC2C4498CE4B8D6F2 1.weinkaes
1,666,244,341 *AF546E2DA8D4D1B941F21F03264ABC007B2F17A2 1sormont
1,666,244,342 *AF5D15AAF3B913ACEBE8DADEF88510E28A8C1230 1kansakunta-k
1,666,244,343 *AF5943F1CE2F16B0FF27B7A73449ECF439831BC0 2138326 n
1,666,244,344 *AF5297C3BF4A314F738AE8B8FC7DE8B340EF4C5F 21-aufmachten
1,666,244,345 *AF533342BCB4B8206070A10B15E860806F72B4C3 1 KUULONSUOJAUKSESTA
1,666,244,346 *AF55CECE07B08223BED4B66FD4856E2C13FE3E8E 214YINGLOVEON
1,666,244,347 *AF5EE5915058EB71CB61657EE90B79BCFBA6B309 1.LKW-UEBERHOLVERBOT
1,666,244,348 *AF50B176FBD62E16AEDC268FCA7A50BE8B0CC46D 22041603
1,666,244,349 *AF51DCBFA61F62EDC3FDC8D4A9B8FC5FE9638B95 1mindestpegel
1,666,244,350 *AF50F891D4DF6B54B910070F799DEF460A02A287 22-MERGER'S
1,666,244,351 *AF52CF5F672073DFD88F2283F77E67593F91E248 1 VESIBUSSILLA
1,666,244,352 *AF5C4D2F7D3C1443B54B42A0C5E7591268D5719F 2342531 suomen.viranomaisen.toimivalta.sukunime
1,666,244,353 *AF559259837E51D2963F8B7B00AF189B72CE20D7 24-08-1193
1,666,244,354 *AF5DCBB2752C4F9D08DC9B0D2493EAAA68DF0190 1.NEURONIKATOA
1,666,244,355 *AF565C4CEAAAC6206EA9053C9035A6624F9AF98A 2477223 BUT.MOHL.ALSO.CALLED.THAT.ARGUMENT.IRRELEVANT..
1,666,244,356 *AF5188A0A317F378F4F75DEF816B42B912660899 1 YKSIL
1,666,244,357 *AF51BE79729DD4E106DCD49590DC806A8198845D 1 ODSMINISTER
1,666,244,358 *AF5BFEB83E095D0FAF220EDFB8C9FE373B6880EF 2522820 S
1,666,244,359 *AF56FBE98551071510EC3FD61AD31D31C8FE5363 2535761 valmistava.koulutus.ei.kuitenkaan.k
1,666,244,360 *AF58CC755CF1FDE9852C951EC1BB310CA5B0E6BA 1 OPPIMIS-KOKONAISUUKSIEN
1,666,244,361 *AF5E5EF7FA88DA0D150F249A400CF1A26FD720D1 2008-10-14: THE FORUM, LOS ANGELES, CA, USA (DISC 1)
1,666,244,362 *AF5A803969BB6D64CF797D2929CDF421CFAF82F0 1.palo-osastointi
1,666,244,363 *AF524025EB51AA770A54CEE021D6B41511BC40FD 2024381 kaikillalukkoliikkeill
1,666,244,364 *AF585DB8C641DE58C7888D24CB3E5F7457A08841 273NICO
1,666,244,365 *AF57CD8405580725F7F63CA14C5A1BF125DF6C9C 26november1572
1,666,244,366 *AF5FEEBD32BD3125CA61A9EC3EC96E8F5174344C 2872271 MUISTA TARKISTAA VOIMASSAOLOAIKA .
1,666,244,367 *AF5314B6D3591A5FDCA9B1EE84D2887AE26D65E9 2133721 wofuerdaswohlgutist?
1,666,244,368 *AF559BC76D232D964E209489B75E1470950519AC 2842834 IHRE-WOHNUNG-HAT-SIE-UEBER-IHREM-GESCHAEFT-.
1,666,244,369 *AF56274234071087D7D126396DC340564B3C8AA1 2878885 aito-demokratia-,-korkeimman-p
1,666,244,370 *AF5D544211EED7599F68ED54BAAE72084532EE30 2215645 JOSKUS-KAIVON-JA-SEN-RENKAIDEN-PUHDISTAMINEN-ON-MY
1,666,244,371 *AF5D704FE9AE6BF460254B9FB485DBCCF94436FC 2972407 muista.,.ett
1,666,244,372 *AF5D9DFC57038C53E35B66B3B6FC78B52BAE547E 2-adventswoche
1,666,244,373 *AF570042E81155ED02F6238745896C165E6B8740 236799 " THIS IS OUR ONLY CHANCE TO BE A NATION .
1,666,244,374 *AF54BDC17B723A4FB9FE1ADF414C79EC02A00E4C 2372594 ETENKIN.PITK
1,666,244,375 *AF52596C3E97B825B94041A4DCDE28344665514C 23OCTOBER1923
1,666,244,376 *AF5E4ABCDFF28A1C9C9304E3676AD01E57A24C85 [email protected]
1,666,244,377 *AF5D1D6CB5CC66F26E442E5D3DB43351BAF29175 2548047 eniten yhdistyksess
1,666,244,378 *AF5555D94E566BB2EFDAB620AB81F6035417AB77 2572554 auch.die.deutsche.bank.braucht.also.partner..
1,666,244,379 *AF5C966832B26DE379F465F129C32F9C6ECB6A91 2-FALLEN
1,666,244,380 *AF5BE9ADBD379816849298A05F8D31714C9EB31A 2INNKWON
1,666,244,381 *AF5D224EBF03095FE2E966339391F9B1C2BD2ABB 2july1214
1,666,244,382 *AF5E9756228578E127C3A5DAB6F668C0425E932A 28LANDESSOZIALGERICHT
1,666,244,383 *AF50DF8FC4D692AB940CCE210E11A29AC6D33228 2-hyper-masculine
1,666,244,384 *AF54FC52142745A97E6DB682F6D436BAF1B7D97B 2.masuniyetinin
1,666,244,385 *AF59727FCB5162C38B0D34F02B263B39F944607E 2.qbasic
1,666,244,386 *AF57DFF35BB6C3C66EE2C39DB6CC237F913D3F4A 2.SUURJ
1,666,244,387 *AF5EC001E43B7F746292F166EF80E71F3FDA846E 2TRIJADU
1,666,244,388 *AF52B92876BAD3FAE3BDD711333DEC4933F92270 2-gIcI
1,666,244,389 *AF5E2501C49C5064870AFB77B722F6F668163EC4 1 SULKAVANJ
1,666,244,390 *AF54AC64D53E9D46E035152CB9B7D3005144446F 2 WDNAFM
1,666,244,391 *AF5FB2EE303F8B49C21FDDC7556E5ECF72857CA8 2WRIGGELN
1,666,244,392 *AF5B68E94D08629D24A325468DFA94698DB09EBE 2SMARTIN
1,666,244,393 *AF563DAB998D56D67655484CD88A1E97B5BA1A0D 3==>-`~3b<-
1,666,244,394 *AF5FC0A37191E9EA65A9580AA84C6D20B0DE2722 2jasmawi12
1,666,244,395 *AF52F3C62ED59CAF9116852CB6881366C211D960 2KHMGEMAELDEGALERIE
1,666,244,396 *AF5CB5815B28F20D88B983E800F0F26AC374C199 2kulmalipun
1,666,244,397 *AF569C1217066C22B178EE0F22AB91615320DC48 2.landausgabe
1,666,244,398 *AF539424587ED5EA23B25A03396FCA4BE63BAA6A 2 VETOVAIHE
1,666,244,399 *AF54E8703FA099DD956CEE2FEEAC76B71BB89925 2ORIENTIERN
1,666,244,400 *AF58D4ED430E02D197EC2F2F2430FF0A89C904B9 1 YKSIL
1,666,244,401 *AF547A70D0C915FD55A808701934641DD413DFFC 2.PIKKU-RYTYN
1,666,244,402 *AF5D62951D3970BDB12FA760E1E5831D63114B9A 2RQWTTLR
1,666,244,403 *AF5D9F04E786824FD8082396639F5ABDBFD728CB 3-DOELLINGER
1,666,244,404 *AF59DE983D3CEF14914C223CE6B22721C9918A55 3FMITTELN
1,666,244,405 *AF57CA82CDC974FD4EA5E795A43C41E8930F8316 [email protected]
1,666,244,406 *AF56FEB55C3237BAEE0FF5EE5944355659972DCE 356529 BERLIN-VERLAG-,-BERLIN--422-S--,-22-&EURO-;-
1,666,244,407 *AF5A1E077DC75570089588F305655128F580940E 2-YLIOPISTOTASOLLE
1,666,244,408 *AF51B5837164B827366CE50C956CC2AEB1656E59 20sep1426
1,666,244,409 *AF553D768456AB734DDF130A58494072B3038B3E 34szilvay
1,666,244,410 *AF56E077984F59168A912775BA64A0C750257CE5 3> ~O~o)x(
1,666,244,411 *AF591340D240BE87F01EF9BF8DED867D92F43292 3======b.`~.`~.(><)
1,666,244,412 *AF5E70F9FB4AAF1F2FE73D34989956B5FBD9625A 3###b.~.(><)
1,666,244,413 *AF580B9B6495971211A7DC81A879896E6359745C 373hakijoita
1,666,244,414 *AF5ACF53B0C39BF0C7A45ED832C4DD6FFB08B5C4 3P~.~.~.SPLAT
1,666,244,415 *AF585761A0440EC3668EF27F1B29F435B728CFD8 3==)~ ~ >-b0
1,666,244,416 *AF5CFD85CED805C15820B4C48A7974159E34985F 3 VENTILFUNKTION
1,666,244,417 *AF53C6FBC56F54181D44D694FAF8C38750AE6955 3CANCEDAEH
1,666,244,418 *AF509A8C9489EF38214440AA630D86729A52B584 3FUNSTELLA
1,666,244,419 *AF59625EBB063D962F67A069640C69EA5A02E4FE 3HONDSROZ
1,666,244,420 *AF541E42DFCEBCF306D83B0C7BF28E739AD4EE4C 428SIMON
1,666,244,421 *AF5A950EF7A4BBD988FF578285A486823D276EE0 3ILUVMISTY0
1,666,244,422 *AF5F2141C736F70C055DB2770155486DEB305803 [email protected]
1,666,244,423 *AF5B4AFF35AAFC42876A998165411CD491E43341 3HOCHGEZOGEN
1,666,244,424 *AF598A4EEA810418D571E59D9C569D2B08B4EA62 485JANET
1,666,244,425 *AF54C7A5EDBC0327C4236C1F405D7EFB11EF245E 3PEARSOX
1,666,244,426 *AF5A0C78F826FEA1EEB95EC9C55A7ABB3B781E6E 2358847 keinemedizin,keinoperationszeug,keinehygiene.
1,666,244,427 *AF590ED174C5AE7FA618961C1D6A24D8A41750A4 2374152 YDINONPYSYNYTSAMANA
1,666,244,428 *AF5BE9F62B71CCBF53DC37B9AE7060596D216597 24.08.1789
1,666,244,429 *AF54A14E1DAA2950A6390560FFC721663CA95776 3==P~.`(>_<)
1,666,244,430 *AF5ABA7094BF51496D6CB009347FB39486013028 4, en fa mineur : l'hiver : ii largo
1,666,244,431 *AF5129E85331BF4784FE3FCB8B857AAD775E24E9 3TEGENGESPARTELDE
1,666,244,432 *AF50EB9E3326958BC98D3CF0D1AD40B1E37A6E45 3 transistoru
1,666,244,433 *AF57AF32EF9020149BAD09A581425A51CA3DA162 3-->~~~)x(
1,666,244,434 *AF5963E7070CEDAE932D556CFC08E968322B76EF 48625393E0536A4CBEF8B9F404A3F06BALBALB
1,666,244,435 *AF57071EAB50856EBA44A4AE61A82E4E00FD93E8 [email protected]
1,666,244,436 *AF567C7FE2F3F3B5D75BF204DE6E262A98879BFE 42SILENT
1,666,244,437 *AF506A4E243642B78448F93BEB30D3CAD7C8E7AF 4MPL1R315
1,666,244,438 *AF528BED1965F1FBE4A799557728FA4362848925 4AKETOISI
1,666,244,439 *AF5F81FC2261659E8F9B4F6DEE878EE41E2138D8 2759988 ei edes l
1,666,244,440 *AF5179F2C7F8D549DDC041910C09151192388075 2780193 YLEISKARTASTAN
1,666,244,441 *AF54D36D36F6F7DF19DB6CB062893D0B423235B3 2797432 ES.WAR.KEINE.VORSCHRIFT.,.SAGEN.DIE.MILITAERSPRECHER..
1,666,244,442 *AF5639C499C146D58544F4EBEEF51419F444F006 4C4S4L3M
1,666,244,443 *AF583F4F00B8037D4BF84ED3CF48CE0B639A9DF5 2837731 alusmenettivakavuutensa,saikallistuessaanvett
1,666,244,444 *AF5E52EFE77742A09F8A87AC49D8CB9AF271245F 4ROGERBOOGER
1,666,244,445 *AF5E2D31157A5FECEA85C52C9DDF2A53ACCCA34E 4SOKOLOV
1,666,244,446 *AF528F90462D929898D879565F798592AD537EAC 4HOVEDBANEGRD
1,666,244,447 *AF543DEBF8280903FA91E6FFE8920BDBB0E3EB9B 2CALOMELED
1,666,244,448 *AF5A7BC6D0B609B6A76DF3329B1FB5A250700C99 2-dispanseri'nde
1,666,244,449 *AF597AFCACA13F7936F2949079D549BF4B51F6DF 2ECKOFFO
1,666,244,450 *AF53E006CF74B70FAC9E71C39B3C9BFBDF13CCF9 4KBFSKLOWDITE
1,666,244,451 *AF5FE197B2B670E9295890F04DB559FA23138C15 4YLITARJONTAA
1,666,244,452 *AF543975EDCD0C36448D340DC31BC5E020F35660 4L3W45H3D
1,666,244,453 *AF5E42B354C8442CF51C404E2DA60E5F73A233E7 4mar1687
1,666,244,454 *AF58C0CF9E6DDF5D632C6CC4C2E3DA3B2BBDEFCF 4LEGALISE
1,666,244,455 *AF565E0440B80FD25E9B2842A89DC8CF409BF619 4MERLUCCIUS
1,666,244,456 *AF580BC73A1F1E9B8F5B7A23DC5F0187BEE0B9E1 51-saloon
1,666,244,457 *AF5B227A498B865FCD627E43049DC9929E203476 2GEBANNTES
1,666,244,458 *AF5C36466226B4009AEE2BA896661923884A2FFA 4NEMERENI
1,666,244,459 *AF588495CEB6EC7D5064DA7A03119A3381B51E92 55JANET
1,666,244,460 *AF5C531C1888B4E5FFEC5D8450C4E7D50BBFED67 585645 MUISTANKUNSEISOINPIENEN
1,666,244,461 *AF5D266C660A4C1C072417877C65AA51684ACCF0 4NEWALGORBSW
1,666,244,462 *AF52851411E724C4C301EF69A638BA0FD2C31267 5a4308cb3e8435af88d935714b29fe6b
1,666,244,463 *AF50A82690EA8D2D2BE9DB58538B3D0AEFD0D45D 4-PAIKANNUSPALVELUIDEN
1,666,244,464 *AF5232DA378C560422124D0352BA4FF1EB54A3F9 4REWUHCSTHCIL
1,666,244,465 *AF56A41C85D96B4CCFA27123D3FB3D6EF3382EA8 5BSWRENDITEBSW
1,666,244,466 *AF56F7057E597E11E29C0BC783C9A72BA80170E2 4REMOLCABA
1,666,244,467 *AF5DDC35419A88D675B0865827A8C30211E43311 4SAPIRBSW
1,666,244,468 *AF507BC8B184F114E227C898A0E84DAF99C05331 4SUOSITUIMMUUSKOHTELU
1,666,244,469 *AF59D38307234170436C10AED7B09E1829F1A780 4THATTBIRD8
1,666,244,470 *AF53D6C67CDDA36294033E0FB4E983AE54F049E6 4TAIDETEOS
1,666,244,471 *AF5D48ECAB2DDA663337E828A0FC170C60E16E76 2LINDAAEH
1,666,244,472 *AF5F4D29CBBFE4BA3A74A445704A069D62C43C68 5FRUEHZEITIGEREN
1,666,244,473 *AF5CFB5FF2AFAE835C25E3A2AEE8B854E317868B 5IAMBOXER
1,666,244,474 *AF5E0F0084E432F17875EE70121BBC11DE782B1D 520-VALMISTELTU
1,666,244,475 *AF5D4D9EEF761D9BE8F45349061F74AF12490E53 2.salpa-asemalla
1,666,244,476 *AF5D5CB5A5495410283EBE694ED300DB9FEC388F 2TACOTIME
1,666,244,477 *AF5152631E7B5F0D4C50747D5DC98DA76D17F534 2.takaaajolleen
1,666,244,478 *AF57403247FED15FF67DB29B7C9B09B6C1AB3746 598AYANA
1,666,244,479 *AF540561B8306984C2D3E40BA55C38E198B4AC46 5a449810986b366ab8d1e618364e8679
1,666,244,480 *AF5852A7680742F7F8E5A404E2F8DC32EA3C464C 2以前に限定された利用許諾(GFDL
1,666,244,481 *AF55F9D88C8D69F4DB004642B2970E48474821C9 30JULY1876
1,666,244,482 *AF58EA2D1F39ECADC13415EF9D29D388483D4E17 5feb08
1,666,244,483 *AF50427C9D45C9002C3D98A6D37A4C00553D6AFE 5AGGRUPPANTISI
1,666,244,484 *AF56105E6D8B0B57B64E79353C5A12AB02C70487 39 INCELENIYOR
1,666,244,485 *AF55E7A7C38DBA9AA40C5FC7D5DF8CB91E4D5A8C 5greineerde
1,666,244,486 *AF5C4E16D6D8763DF1EB2770944BEC6A4895DB71 5blinds2
1,666,244,487 *AF5314EF24926DE39B7471764D5B1C4B2ABDAA42 5DALLASIMAGE
1,666,244,488 *AF5DDD372633A0E324A3AA222D476F52089BDBEA 3b<-.~<======q
1,666,244,489 *AF59EA4B5244599B1BCA0A55DDDB41760E8EC3DC 5KFBDZS12
1,666,244,490 *AF5D5DC16F19782C7EF0AA86CB2D828F9C065C58 3.COVICE
1,666,244,491 *AF5A05144906AB87F38760880C6C7B9B5212A3EA 3d16554
1,666,244,492 *AF5548510198CF79ECED73AEFC0D1A1B97A4DE08 5DRAGONFLABCDEF
1,666,244,493 *AF5C86C84AB571970BB33A186817391433DA996B 5E762B33-2F63-3124-9912-251DBB1C0A83
1,666,244,494 *AF57380C579E48FB0625DE4F2CFC74D380FC5244 3DPRGRMS
1,666,244,495 *AF57A4F69F39406634B1B79C2DD4D92EC533BD94 3hellebarden
1,666,244,496 *AF5EF8C9BBB2253FA997A24FC598BD64FBF6CF02 5PALADINDUSTIN
1,666,244,497 *AF5C84FA3F1488780417EB5296C02141D719B14A 63 EUROTUNNEL
1,666,244,498 *AF51801470410A99041058D86CEDB7E872CD686D 648WAYLON
1,666,244,499 *AF5358885570C103D97F4DD4F0FA9FC1461A540C 5INFOVORLESUNG
1,666,244,500 *AF55673374014AE078B9B42F9F50E026D1219ACA 5KLNKRWG
1,666,244,501 *AF565A0FC0A1714A6D68C4124A14B6A709F4857C 5SYLVIEALICE
1,666,244,502 *AF5052A38697FB93D58923CD16BB454ECB745AAA 6DOCENTICE
1,666,244,503 *AF515E44C571A40862BF885BC8C32F0AAF8A50D2 5mysmashing7
1,666,244,504 *AF59D8E50D2F369040311F1A8259413FF366C75C 5URLISSA
1,666,244,505 *AF56EB8033DF0E9C94DB00761B4E7101EE6570CC 5UWDIENST
1,666,244,506 *AF5E1667D1F6718B6E76F738F4788EBED562C129 6ILOVESTAR9
1,666,244,507 *AF5303C49BD7AE20317AC42A0F80028568AA657B 3REILEMOH
1,666,244,508 *AF5F5D96444CADAA2DAAB6D317BA54909BC983E8 6OBERRHEIN
1,666,244,509 *AF56E64C6E34845A9EE2E1330F362BAE7E781B58 3.sotavuoden
1,666,244,510 *AF57B506C7FE2DF026BC57D1F6586A4C49BB0A5A 3===)`~`~Splat
1,666,244,511 *AF557D1D46C8E6F732C8D2F88C0D33F607F5ADAB 3X70113RS
1,666,244,512 *AF5E76570391F47183863E4118DABDF304DAFD00 406belen
1,666,244,513 *AF5AF55CF246F3FE1ACF305ADF6B676CCD71DD9D 451916 sayfa baSI 1992-1996 m U
1,666,244,514 *AF5E0605806C3B5EBD6FA09C763C4B4B3B402708 6TAVOLLASSI
1,666,244,515 *AF57CAFD7445F988608FF7D6BA957715F82CD376 6BSWLATTERAL
1,666,244,516 *AF50136199F433DEE10AD02997CE2A7B9BF01CC9 5月に開催された「日本gp」でハコスカgt
1,666,244,517 *AF5FEB2182161D775C306E1AA75371CFD58CB0A5 4ELEJSDLI
1,666,244,518 *AF595C2E406902EF5E15AD85ABB4873143713B0C 4IERERUPED
1,666,244,519 *AF5EF66382DB7EDDEC3E80C4B454EC370B250DEA 6BEGREBSVERDNER
1,666,244,520 *AF59819DE4BE51D328031B81E9369D6DD728DEA7 7HANSONHELEN
1,666,244,521 *AF5D6E9832D9895A3C06314327780976D93B0A8A 6iloveplato5
1,666,244,522 *AF5463404307B953D6745AD6CCACBBD567AB771E 4RIMBUSSOLA
1,666,244,523 *AF5EE04A5D06255A502237FE2096ACDA26DC7045 4SAMMYCELINE
1,666,244,524 *AF5A883BC2FC5762BE08130242EA689E2C2D0DE7 7IGHBUILT
1,666,244,525 *AF5BDE142602943644EBAF6BB0A47CF7A777B29E 7ILOVESCOOBY5
1,666,244,526 *AF571B6B5C61D0EC39D5BE0D223B51CF51EC1198 6KAIRAUKSET
1,666,244,527 *AF5DC6429E0C9FB68199CF6EE5675A818F88AE33 6KAMPTOERUSTING
1,666,244,528 *AF5680FFC145C65F6D1E41BD1AA2E9A55B98E177 6NCMMTTD
1,666,244,529 *AF503DDA051C7F481AC9210F0F732785841222A6 6-OLYMPIAHISTORIAN
1,666,244,530 *AF5E28B4EBD4205E91D1CB52112B260EB95AAD06 6PERFORMANSSIS
1,666,244,531 *AF516A9A96E7C0371CB54B6E615A2633AC962BF5 7PREJUDICETHEISSUE
1,666,244,532 *AF5437B7DF25784C1455AB4E742560DEA1B5B791 6PLAGIOJ
1,666,244,533 *AF558FAC168DA6616E9B10817C1A2A8B065D332B 6RERUSTNINGS
1,666,244,534 *AF551668ECF82F9625C99F9E211F46EBAA7D087D 7 REWRITER
1,666,244,535 *AF5AA2801C06E08A3D034D6EFCEA47483EB68A84 4SSSSSSAPRIL
1,666,244,536 *AF5153CD5EF2EA407AE974F42B96AC42FC250799 6 RANTARAKENNUSOIKEUTTA
1,666,244,537 *AF5D0637C4C85EC9D7192CDFE97011818CF158BD 7serviva
1,666,244,538 *AF5AF2E4440E6892105CD4CD6DAE9BDF11F0042E 6SNAKESTONE
1,666,244,539 *AF58BE7C9ED21045CB988947C3D4917E912C13DA 6TOKUGOWAS
1,666,244,540 *AF5FB9CA83C867A9A16466CC90BDE7D6F50C47BE 6USTOISSA
1,666,244,541 *AF5B81F2376EFF6189226DCCFC7F4A59ED81AE71 6ZONAANBIDSTERS
1,666,244,542 *AF5E5531D254A23138B1A7B8B07DAB416834ABCA [email protected]
1,666,244,543 *AF599CAF5D7BEC7C13B5F486626ACFAA2870D049 7036627..dezembro
1,666,244,544 *AF515B205E962400430BA5DFAB419E041F771F26 8086697D96619FBBF59DDE894AFA7A0AS41S
1,666,244,545 *AF5965094CA1150BF6FFB749806AEA3C8BC93F17 7ALANCEARENS
1,666,244,546 *AF57EEE33240A6D8154F44C56AA32A61B408E7FD 55c2
1,666,244,547 *AF564960E395F2225DAF025450E9C8801FFF4A4D 7BEMAD
1,666,244,548 *AF58167AFD079D8A22092F35E1417EBC82FE8B5D 8B.~0~o}8{
1,666,244,549 *AF533CCE122A4F0727CEFB24768924A37A5B82E1 5AUTOGNOSES
1,666,244,550 *AF51353AB903292718510051D77FA38D4206640B 8BSWGCJKNLHBGTBSW
1,666,244,551 *AF5B478DD377A611B3E99DFCAF22DB438DF1040D 8COCCOLITHOPHORIDS
1,666,244,552 *AF5BE60FD71D76718F561992E5722A3570EC454B 5BSWCHERRINBSW
1,666,244,553 *AF5DA741F6CB125F2025D2A9513AEEF01DE6576A 7ETEDNAL
1,666,244,554 *AF5426030C6903FDD4EFAB0D185EA960157B6E25 7FEWLESS
1,666,244,555 *AF5655C00D94C4FBB01E92D543902D668D311650 8ELNOISIV
1,666,244,556 *AF561843F8EE0A09DD9317ED2F6DF28AC311822B 7GESLIJKT
1,666,244,557 *AF52A07C4D29AF5F2819912897FE1D0743658448 8FLORIDA6
1,666,244,558 *AF53CB4C1BD6D51747BE29F6914D99843A9199A2 7KOULUMONISTEI
1,666,244,559 *AF5F428569B4E517C78E447DCDDE2A5B55F662B3 7NEVARGEGNI
1,666,244,560 *AF578A881928F3E593D86DA4E97B894093B28F48 8MOUTH-WATERING
1,666,244,561 *AF5876C356447A6E575CBC223C2FE17767091CFD 7SCOOBYJEREMY
1,666,244,562 *AF5D9574E770A9E0B061C420B7BC069FE1C2F6EF 8OFFERDAHLBSW
1,666,244,563 *AF534313DDBA3D0253A85404F3468E812043EC48 7SNOREULAVED
1,666,244,564 *AF5C1D8D1B06CD351D5C6EBFA4945A2678ABA29D )8(.~`.~`.<=====P
1,666,244,565 *AF5429E8AB8BAA70B505BA83F32CF48BF26B7AA1 7TUIKATAAN
1,666,244,566 *AF534118754F506CEE189616AA88D39A59D72B47 8SGUSCERA
1,666,244,567 *AF582DFD4DE2BCAA8B047815CFA2BCBB26CBB4A2 81OMERE
1,666,244,568 *AF53604BD44F14787CE934038EEBD456425CBE09 7VERBETNAP
1,666,244,569 *AF5E1D841B2330F8D71C718E97ADCC8F4FD71092 888888QWASZX
1,666,244,570 *AF5ABF03E6345B68190F41436F868EE28ACBC4EE 8YAMAYATE
1,666,244,571 *AF5C09F14C5439D1D796717A842986BBD37ECFAC 917641 PROSESSIVEDEN-LAATU-ON-VOITAVA-S
1,666,244,572 *AF5B74CFF4FAFC0E66E7595F8DADE6008F364CE7 8358HBK
1,666,244,573 *AF5A1D0EE328B7532EDBFDF3153202315FF3FFE7 847478 i
1,666,244,574 *AF50AA950832991821C90B6437CD3F18E7C045C2 871348 SIIS-IHAN-MAHTAVA-,-VARSINKIN-JOS-SATTUU-OLEMAAN-NIIN-J
1,666,244,575 *AF58B04E0B98DE4CE87494E53D4029E36C4C955A 9BLACKGOLDIE
1,666,244,576 *AF574FD18F242A0E0C22996590256D2A8B29C2B9 87852972240596ABE7AD26F0EACC1FA0 TINOXNATION
1,666,244,577 *AF5F5D381794DEDE87D104AD5CB594B6B3CB058A 8===>*}8{
1,666,244,578 *AF5622E33C377E975DAA498DEF9CDDCD6D635529 8CARLYLIS
1,666,244,579 *AF5B3C11BA566FDFEA7F3DB034D49EBAE95F3A71 8arken7ine5
1,666,244,580 *AF5D7BA0456C6B8847416194FC538C8103FBF898 8ECENTURIES
1,666,244,581 *AF5C5B03CDD51F40B2E9D35CA61EDFFD8AE265F9 5NETWAREHERMAN
1,666,244,582 *AF5FD5D14DD5400424C399B5268BFF67E5FA6218 8GUILTLESSNESS
1,666,244,583 *AF589DEF9989BF7657E559644A1AC2401AD5DEAC 5quald35+
1,666,244,584 *AF50B6E69C069D8B0B8D8D8CD814B48A58FBCA58 9NOITAICNONER
1,666,244,585 *AF57C3B29F3BA6415DB99E9CE2AD9884493009C6 5SENALIB
1,666,244,586 *AF56D2CAE7F1D034AC7285046AC76C179D6A02CC 9OCTILLIO
1,666,244,587 *AF5AF3234BD7F833A4EC2816C01E29828AE6B5A5 5SIMPATIZZS
1,666,244,588 *AF52C47236CA89970B6795995DC1AC341B70053B 9POOKIEKRYSTAL
1,666,244,589 *AF5C60411D6AEE4C4A3539C0B2966B71AFB7EAB1 8FROGSRACING
1,666,244,590 *AF5A409A0A27C8DFDE2C7BA3BE582E5B175F6660 9QDESIGN
1,666,244,591 *AF5B89ACD19505189E4C9A569204087F29832B77 9ROBOTIZZARE
1,666,244,592 *AF50652E438F95B7472C01480A62F1C51A52BDA2 5thearnold4
1,666,244,593 *AF5C42B1C088C52F88496F252A4F5C5AD84D0573 [email protected]!3RS
1,666,244,594 *AF511051560423F64B909FFD2771DCA804D646A2 8SELVITTESS
1,666,244,595 *AF5EB17FA5D1311C28A963919EFE98FC37174EAB 8MANDARITIS
1,666,244,596 *AF50D4322CD07EFC2625EDA3CCB3E1A7D3F33984 603ALANNA
1,666,244,597 *AF5BC6EEF9311FA337879FEEB352564B247FDBEB 9UOHKCOTS
1,666,244,598 *AF5C762157F48630D7546859C749E7197472E670 8MOOMOONOTHING
1,666,244,599 *AF592A2C0C8626DFD28C7587F7DE93C6A6B19E15 634MAXIMO
1,666,244,600 *AF56750F7C2FCEB44501DF561933975CE26D0524 8UNGLEICHZEITIGER
1,666,244,601 *AF5F4D32FCBD32B86A7BBB3451B3353B5FA866C8 a0su-
1,666,244,602 *AF5255CBE4013B4E4A635D888C841E7797E34093 a13c,
1,666,244,603 *AF52C88872BCD97CD5D993A5965AAB0CB6275F02 928505 da.hab.'.ich.schwein.gehabt..
1,666,244,604 *AF5766F32FD39133D0A1DF963504A8DCFFD68311 92GERUETTELT
1,666,244,605 *AF5C514FDFAC05313B33F150D569B9F889501811 a2jof
1,666,244,606 *AF513F281B27E5B3D5FA058B0EC7354A255C282D 9:--9---#---&---companionway
1,666,244,607 *AF5AC381D5C4C229EF85DE4FDBCC8ECD0424CBEF 9ALLIANSTH
1,666,244,608 *AF51C4A9A934ED4A22A250B43CC4DD70FD085583 8SYLVIECALVIN
1,666,244,609 *AF523DB8F4BB2F55784C6A3A9FBF38FCF2851678 9BSWPALUZZIBSW
1,666,244,610 *AF5444A2C1C91D77E9074B181389F77EA736FE04 8w61znrxc63b16
1,666,244,611 *AF57403AEBC65D229DCE023F5B97561F35D74AD3 921JULIO
1,666,244,612 *AF540224E13F8217025BC22B09444F2950F3ECE4 a9d#q
1,666,244,613 *AF5AEEF78722C74395DB890F0CC1253D2D096FFC 6ANIMALDAYTEK
1,666,244,614 *AF50121501D8C61A9680F08688C8B6E42A7878BF 6APOLLOHOME
1,666,244,615 *AF5267C979DB7E6B3902BA3C687E1F7DBDB7897F AAA"9Y
1,666,244,616 *AF5DA11352CCB430669727F03D15DB4AE992C2E7 9LOGOTERAPISTE
1,666,244,617 *AF5B595CAAC07BF1E5EDEB054F9DE582A0911D69 9NAATETUK
1,666,244,618 *AF5DAEEF80F4A43714748E4BFABF2373D65BA679 9DECEMBER1713
1,666,244,619 *AF537BE4E12BD54D8C0AEF03020EBDC895AA32CB 9FAELREPP
1,666,244,620 *AF5868919070BE1072278052DDF773237685D800 aac~ag
1,666,244,621 *AF51D0D53D572163BE49DB85079031007D9157E3 AADEMLO
1,666,244,622 *AF57E812841BA143B145C57E004A2CE8DF39BE18 9KRAAIENMARS
1,666,244,623 *AF5C01F1F504BB2E80DC2F8EC107F26CDFA42EFB 6FORHANDLINGSOMRDE
1,666,244,624 *AF5E3F101A0FFB1250BD59E21307D3F7B92308C9 9MYBLINDS3
1,666,244,625 *AF50806A1FE53182F70FED96D1943ECBE77A74EC A0R+!C
1,666,244,626 *AF53C78C2F41336D789247A9A0B2C270A328B195 6JOKERBRAZIL
1,666,244,627 *AF52F0311D54C7D67A3A7A4FEC55372E8090E628 9SCUSATO
1,666,244,628 *AF5BFE7DF4F34882EEE8B8C355D18A012D60DDC4 a((2t
1,666,244,629 *AF5D80D6D319B2C3E17EA57D792811F2EAA6AFC7 6MELHOREI
1,666,244,630 *AF5080C7F03924087FF00FE261795E0721DB7485 6MONKEYMILLION
1,666,244,631 *AF551752DF125777B4065CD7C7A421617C138517 6NICCHIANDO
1,666,244,632 *AF51ABC4FE7A61F5FE77FAE8034ECA519B747E0A a4muf
1,666,244,633 *AF5C63EE1E830E30283AF9F550F8C36CDD862E7D a5d64
1,666,244,634 *AF569BE80A5B66812F3B0C64AD31288D39AC550B a&6pn
1,666,244,635 *AF5805D525F8922701920817B5782CFFF3CABD9B A6Z%M
1,666,244,636 *AF50101FB036389623D5B2C53921A1E1069FF1A6 a:a)
1,666,244,637 *AF56F592F5FC221F5DA476C20FA9A87117167DC3 A)5Y
1,666,244,638 *AF501B66C89C4124F20843F25D347B0EDF5E9A73 AAB17H
1,666,244,639 *AF545AF4CAFB8C70A1E39D93F3B96A6C22E21C2C aae8{c
1,666,244,640 *AF5BFADE5934EB581F77C55F1FBE96511E2C59A4 7ARXIKOYS
1,666,244,641 *AF5BABC7D269DAB184E6B67D877D88CC16836CF8 7ATSKRATS
1,666,244,642 *AF5AA1FDB0909618BB1331FA3A58A7ED4271C5BB AAB1QA
1,666,244,643 *AF5C93047F1089196C40540D8306FD3696FA2A06 aair6
1,666,244,644 *AF5E8C832D434E728357C875D0A3EF9FF2FC6CE0 aabe&s
1,666,244,645 *AF542BBA226D6A56FEC693F11DCE2D841CCEC3FD ADPM
1,666,244,646 *AF58C65D639F7C5C7D4285D093DF86011C6BB334 a-ei
1,666,244,647 *AF59049F1D6522D6A47A81C1526AC81721C26B4C abcdefgtraining5
1,666,244,648 *AF545EB3712E5C6632A1F706D0DCBFB3F8EE3151 aae:mc
1,666,244,649 *AF58756ADF4BC9317E2DE98E3D084448BCC819C3 AAEXKA
1,666,244,650 *AF5441B389F55FFAE9D9829BF622181C478696E9 7metallurgy
1,666,244,651 *AF50C3B80C13D4F205BD55F823486E3200C3B63E AGAL3NIDA3
1,666,244,652 *AF5F7DD107834A67D01E497B3E07D3276B4A1BA6 ab;c5
1,666,244,653 *AF558AC3F265CB0B795181126CA0BD1BD2B0B067 abrahambozzone
1,666,244,654 *AF51F51C28987256589D983E653ECA5EF6306DAE abramsolheim
1,666,244,655 *AF589DD29BFF89E7A127D26441104090B5115448 abw;
1,666,244,656 *AF5D417840572DB0DE4BEBBF56446B0D9CFAB468 acfqd
1,666,244,657 *AF5FCE0B21F4840CA646191D54D1594C8611B8DD [email protected]
1,666,244,658 *AF5B97880DFF67D266FC621652682AA780C5F1D7 AINSCHAW
1,666,244,659 *AF550F88D6EF2D2B1DC3C8C69E110B6532A47C82 8##@~.`.)0(
1,666,244,660 *AF5325106AEF25C1B0A00DD1B8B6A10655CF40F5 adab
1,666,244,661 *AF5F938C4AE69CD16CD569A94B0B8B487A9E33FA ad#(+
1,666,244,662 *AF580599368F36A19D5DE6CDCE1D3F46C6872303 888089 ganze-20-quadratmeter-platz-benoetigt-das-noch-.
1,666,244,663 *AF548980F347ACAFF894A514C8BF09AA5F4D2786 ADEN761
1,666,244,664 *AF5CF830EDB52A1717F25C637E77299D7C2033A4 ADAYR
1,666,244,665 *AF53F4131BD9D07A52835FE9D485863A5E99C70C akliekok8
1,666,244,666 *AF5267AA79D8985690C98C38A7437FDCF107628A ADS7K
1,666,244,667 *AF56C05B5290668E833C7D488BE6B99343E38191 AED07721
1,666,244,668 *AF572EFE896F16B83F1F9957F99D1857B4A858FD 8=====b-~-~-~splat
1,666,244,669 *AF531FD9AA15841F7936196A27FBAA1A1703C3B6 8BUTLERMICHELL
1,666,244,670 *AF52DDCF9D38C25BBF5FB5FC1578029990B4A828 )8(~`D---8
1,666,244,671 *AF560AF99FAA99D85A144EDC302E154CBFDABB13 aljandal。
1,666,244,672 *AF5CABCACF6245EF6E37A04DB68F60CB87D7326E AFSCHERMING1
1,666,244,673 *AF50423B1BB75BA21904CE66A1FA260E1DF73636 af&t:
1,666,244,674 *AF518A96A635D7AADAAFB60CF1B0B0F447D40019 agonized3
1,666,244,675 *AF5FD4A14B51C0D4CF19ACE974F6AB2CF0917350 8LALUCILA
1,666,244,676 *AF5F26A0C953E79E7A3778B2452251AF35E66902 ALU
1,666,244,677 *AF58019D6077744DC22B47A290C20414F8E989AE AHAAG123
1,666,244,678 *AF5A6CB2831B6AD75D2CF293928A490CCE018216 ALVARREZ1
1,666,244,679 *AF561DBF30B0F206C21440CEE4521CB802728478 8NYHETEN
1,666,244,680 *AF56A287E4AB78B507759FF95AEE640DCC777FE5 A&H9
1,666,244,681 *AF5F0D2C53C78CEE349F7383DCEC71A48A030395 AHMED.ALLMAND
1,666,244,682 *AF533088DB4B08E9FCC06F0455EB04C243AF92B5 AHMAD.CHAVEZ
1,666,244,683 *AF537704B9892EA392A71124120D3AF0C5208D04 AHUE3
1,666,244,684 *AF50AD1CA3D70D46995C2781458FC340FDD4B526 AIE392E
1,666,244,685 *AF5ADCA9603037A8C269E706BA085F864DEBACB9 AIILN
1,666,244,686 *AF5F81DBF84521AABB060FAB168B4DCCF4748117 8STABULIST
1,666,244,687 *AF5ECEF51E5902CEF82DB7A117448585931C1F6F akcijsku1
1,666,244,688 *AF5C629881B3A80DFC018271216F910D49BEA303 a:"kg
1,666,244,689 *AF58A7B5F52E7048268412D444E131D9072B0132 a$!k
1,666,244,690 *AF5EFEDF231AFB82CD4708AB5A3DCB47B8F2A35A ANGELWQSBBING
1,666,244,691 *AF5F4F5E3B453F2DAB0AD156477C4A45D8F84AB3 A-L64
1,666,244,692 *AF5F70CA223529422C16997B4F73355016041077 [email protected]
1,666,244,693 *AF598AE9921038F5A0597BAA3A95EDD9DE0BE31F ALAN-DICKER
1,666,244,694 *AF5EDB22A50C04ADA1217CAA122D5F28DA2F2058 ALEXANDETYLER
1,666,244,695 *AF51BF6CCDFCE703D676F3A342AC95FF509B02AE ALFONSOFAGIN
1,666,244,696 *AF59AE16C5560D526A88B5ACA845CFEA0301E2F7 antintyt6
1,666,244,697 *AF51DF0064E99A35B99299A0DEE3AAD8A826CEC6 antionediestel
1,666,244,698 *AF5AFAC6DBA1068843124F8CC35281B57C1E2C46 antoineguptill
1,666,244,699 *AF5372793F274AFE6AAA317CE8F4D480A8A634F2 ANTONEDRABANT
1,666,244,700 *AF51020D18CA3D05CF85FE1027B70160E3CDB882 ANTONIARUMINSKI
1,666,244,701 *AF52009396EBAEED3991E8C532B7EEDAAE10F52D Antonio.Meneses.&.G
1,666,244,702 *AF52DBC48480CE813E39983CAA2FBBB1FD7705B1 alex-hansberry
1,666,244,703 *AF584E6C95A6B9FE187BD866C4DCBB0BE906D76F 9ASWARMS
1,666,244,704 *AF5DA494A0B861D416DA685655160C7E9A1E4D5B ALEXIS611
1,666,244,705 *AF514AD2B2918F5C743C06A9D5B7BEB6882A248F allangregori
1,666,244,706 *AF5ED686768804320AC0BE36B26FC597423A491B ALEX.RAELSON
1,666,244,707 *AF500DFD58D99D998A2089C25F9E74FC00B1E0ED allennorton
1,666,244,708 *AF51C8D6F454BCF067499C054407F9B46169D9C7 9DAWNTESTTEST
1,666,244,709 *AF5DC42285C4BD48941D0AB67EEBE455B05BA749 9DEFAWTY
1,666,244,710 *AF5CEBBA907398660C9723C5A4287CFFD901A65C a)ln=
1,666,244,711 *AF597B5D0D2E8D179882AC65A46267DF1CEAD883 AORTX
1,666,244,712 *AF5A00C931EFAE4B1D7F5E19E13C7964445C3C77 ALRENITA8
1,666,244,713 *AF5813A65E60E738F2CE5614FA6CB7F9D927CDCE 9MERLINWEASEL
1,666,244,714 *AF51D54D8273058B94FF4AB4AAA1CE19AF735C0F a&lkk
1,666,244,715 *AF58C12F7900AB24C23B02724295C13817F7912A ALU
1,666,244,716 *AF5A70CA6B1E911314A661FC5B0F02A71398D797 am4dr4eva17
1,666,244,717 *AF561C767B41B9BBFCC544ECC372E42C23E07631 9RITORNAVI
1,666,244,718 *AF53FDC3C85659932DAC6DC6C27D45865C861024 A0U#X
1,666,244,719 *AF5A80C1F47F84BBD3986EBCF488D82C500A6F03 a?n"0
1,666,244,720 *AF5953761DA5F5071FB35085089D9F32B1B67A35 ANBLINDE
1,666,244,721 *AF52995EA5C3750EF07C5551B489F6C1C3D3C83A ANDYBEVIER
1,666,244,722 *AF5D66296ADE45BA7D165A2893278D4D5016D46F aa0j`
1,666,244,723 *AF53ADA32A8CB0C441EC11B7A16191314A26E63A ART COLES
1,666,244,724 *AF59C283EE5054830800C039BF15F5F1163ED8E3 ANH3.
1,666,244,725 *AF50C28EF2FF3412BA59FD87D369BA6E920FC234 ARVP%
1,666,244,726 *AF559E6EB36D2D4E750E16EAE489F0D01F793ABC an(s
1,666,244,727 *AF554F6224258768AE6D6607D5C334CA82960EBC ANTONESPERIER
1,666,244,728 *AF5BC90DF3034E48E471E7773D6756C9AD599E75 AADAT (DEEP BLUE VERSION)
1,666,244,729 *AF5B456E8BF464B81F0B92ABEA9F77CCA5667430 [email protected]
1,666,244,730 *AF5BD89AB2CE68D68A5365C4D8FAC29EC8E5A7D7 aafix
1,666,244,731 *AF5740FBDC76F5977F901C20E00F11268316AA3C a)u7
1,666,244,732 *AF561F68C005D714F1F3E6AE7E20845D7455321E APOCALYPTIC.REVELATIONS.(LIVE)
1,666,244,733 *AF5E97D1B14927E258C98FB130E2EDD061FF3B5A ABC-N
1,666,244,734 *AF555EB448991E8335458EDAE98427602CE35F88 AV6Y
1,666,244,735 *AF5F7F731E45D62897BBA674224A7FC025D46308 avfp
1,666,244,736 *AF5331CD348820BBAE944CA2686CF61F2A292263 [email protected]
1,666,244,737 *AF5035B19FF54E7BF5DA6486C77672CCBED01317 Ap0P
1,666,244,738 *AF5469A393F390D04FA1053FF4149258BE610792 ARCHIESCHULL
1,666,244,739 *AF57EDD4F26873618CB74546D94D074235437FDD ARDENSHROLL
1,666,244,740 *AF5AA68FABD71CEC1434763CE2B5066DF67E3C0E ABM!Z
1,666,244,741 *AF5EC59DE231427D9D732CC406C8C7A70662748C AZVERDES
1,666,244,742 *AF535FA68E186A1B9B638B34E8F4956279A10E61 [email protected]
1,666,244,743 *AF520F46F4E934B1211A723A77536F82B1C1D0E7 ABSFAFRICA
1,666,244,744 *AF5D4F6C326FCAFA6317C65FC18BBF972A941357 b---) ~0~osplat!
1,666,244,745 *AF53E16D3C7180BEB49EB3D602E4FA4517EF6563 >B0~QP
1,666,244,746 *AF58AA4BF26533F7CA8269DB2EBD7E4FB57C231B B5KE
1,666,244,747 *AF5EC376C32F17C3592EEC3C442F48E8A4541B44 b63(f
1,666,244,748 *AF5F3442255C4638993B0B5F02074173083F2EA0 ARTCRRCMA
1,666,244,749 *AF5EC790C7A0AA5044E651F5BEBA64EF07076EC0 arthurdog3
1,666,244,750 *AF5D32C0303287490CB0A99CB81DA46DA60333DF acidosgrasosnosaturados
1,666,244,751 *AF5C9C35D08C4C7F58377B1E33BA5C7F183E7565 ARHB
1,666,244,752 *AF533037F0F8BCDE0BA585FA70BAF5000A93CC6E [email protected]
1,666,244,753 *AF561E645C3815281B6591207A905FBC45D0EA99 B8Sl
1,666,244,754 *AF5E342EEB846B630B5F8F38E7BC504DB089B73A ASHPRODUCTION1234
1,666,244,755 *AF52C7D255DAD0755744E3E6DB1DB1A6B620CBAE ADANBURLAND
1,666,244,756 *AF51CD42FDFAFD9A21A3F60D51CA6DB9CF0A6C12 ADANIDAS6
1,666,244,757 *AF533EAD39EF67C4BBC18FEB6A7562FA63BBF1E0 arttirildi
1,666,244,758 *AF57B4ECCDCE9DC486C4212A0C6A834B4D74BA39 ADEMKAYA
1,666,244,759 *AF50013C550AA96ADE74FC68A26F43C8117836AF ADGH;
1,666,244,760 *AF5E690C5B09BCAF75F9CE9280DAB495A73DC691 asp(k
1,666,244,761 *AF59D299D6F1E9D2B74B6A717693ADF3A7DDC490 ADPM
1,666,244,762 *AF581A007C0CA806ED81A59A675019178CA5C577 bb1-w
1,666,244,763 *AF554DFCE380ED0363A6AD48826F4116AA5ADAEE AT(QU
1,666,244,764 *AF56D731D4ECA2E5D83EF34E0E2A204FDCFA04BA AUSHTOSH
1,666,244,765 *AF58F066A69318F09142B9FF35ECC4DAE19040F3 AUv=
1,666,244,766 *AF5BCFDFFBA2029CF75F32E6FCD288CA1905A68B BEN.MCCLURKIN
1,666,244,767 *AF5171E55631D341ED2707219C4257E9291C4287 AG4GB
1,666,244,768 *AF57D3584E540309662DD87B96CD524DC6715F12 B:"F/
1,666,244,769 *AF5BAD6D4FCE887B1CB3AD52F8362A5D52296DBF bgmmaaaaibaj
1,666,244,770 *AF56304A28751E27DB0E9695D4EB021B448CCFD4 B1G_-
1,666,244,771 *AF542D023B509C3C9DFCC13C0E33FBA9BB7FCB8C b6qzw
1,666,244,772 *AF5CA585438F81E193B9F7D29BD84F970415D7E4 AJ5DE
1,666,244,773 *AF55095AA5151BDF14E0384634C019FBA41369CC baci113n$
1,666,244,774 *AF55064445EE162E1BA59B2C7FC37E76569D760D BA,DN
1,666,244,775 *AF591E94799A6A3FFBBE17F61473217B0DF8A58F b,k-)
1,666,244,776 *AF50A36D4E70D1A2FAECA14AFEAA5270A9C9BF4C barbara.mcginley
1,666,244,777 *AF5FC3E0A05BF299E8718E143E3191DAEC8D3DC0 b7ml;
1,666,244,778 *AF5CD373CE9E231AA7CDE634395C92C8A321930F B7UDO
1,666,244,779 *AF56C012D5659D12B5E6ED993324C2F26C6A2918 blogspoutingtechcom
1,666,244,780 *AF52016B60B7A179173E80EE4E0351D18B1A6D25 BABO»
1,666,244,781 *AF5F434B315D88F685AB58975D5FBCEFFE15F788 BM3E6
1,666,244,782 *AF5F45E41E717E903431A85CD3F5B5B3FD84038E [email protected]
1,666,244,783 *AF5C1EE8CBD0FDDA5409A59A0E428051EC3CAD15 bayerwalde
1,666,244,784 *AF539D0FB8911D070BBE1B8BC8391694395A81EE alfredogambrel
1,666,244,785 *AF51E4DF2F77C0A1FA45ED54602E0B3627B7A8B4 B------>~~(O_-)
1,666,244,786 *AF55E69AFD63F784D37D4AC48251501E2E361B35 B######>~~~O->-<
1,666,244,787 *AF5D419E137276B80C5270B82A57932F6741426D BANK.M0LD
1,666,244,788 *AF5B204BB87199733B7091CEC7AC733227958DCC BOBBYDEAD6
1,666,244,789 *AF53A0640DA81E8961DB7EE4C4F659DCDE75578B BBFE&
1,666,244,790 *AF534E36CF71005E6498ED555B6FE75BC1412565 bob-lapshinoff
1,666,244,791 *AF549F5DBED87A45B82B418195AAEF7F4C559BA5 barneyduve
1,666,244,792 *AF500434742D42F6A595A70A7AEEF55141E068AC bb-s-
1,666,244,793 *AF53309EAD4E7348C192CDB7E36C6A8EA41459AA bqc$k
1,666,244,794 *AF5BE4BCE4C42C3435423AA06B513A97B279506B BE:=K
1,666,244,795 *AF537C29664E52C63A997E4D67F19CDBD2F814FB BENEDITS
1,666,244,796 *AF5F0466B8A2716612B61B4A6BDA9DD11DDA93B8 BENSADLER
1,666,244,797 *AF5F8AE2BCE8F249B73D949FC843778147400C8D BESECHYNS
1,666,244,798 *AF55658F029468706DF6CB70F5C4D99F2563362A ber0
1,666,244,799 *AF52B231943E93EB780CC84CC583DFA9C3E5DED4 BGEHA
1,666,244,800 *AF5B8437C9A5F5DE85909F8408112146C105CA97 [email protected]
1,666,244,801 *AF58678912C497FA8B134B2F43FE93CCFA236958 Bg$o
1,666,244,802 *AF5FC6C41977FF6F906261ECE0435B99EA7252E3 andrewbuesing
1,666,244,803 *AF54D3DA51644B11F07E2D10921CB32E7366E461 Bh6Z
1,666,244,804 *AF5A877F527DBCEFAF84D3B589170684144A0FEC bicoccalied
1,666,244,805 *AF5F88DA9F21B57F5A5C762BBAEBD2D12D1ABD38 BILLIEIRIARTE
1,666,244,806 *AF521D6466E0FE1A69A3D513E5907A4442DD942D BIGMANUED
1,666,244,807 *AF5E2FB9EE850E368A4F9BC5D7803B2F276E21B5 BILLWHEELER
1,666,244,808 *AF5BCA30C0B7C46A7B32AF49B085540E4B490443 BILLYCHIER
1,666,244,809 *AF5A5E97390D56546D810588FF915F7D04350B04 BI$IS
1,666,244,810 *AF5E2909B9D6BC2394EEC80FA5C878D33A1BA716 billmotter
1,666,244,811 *AF52B979042CA672FE37E8241D0F6F3431AEE1F3 [email protected]
1,666,244,812 *AF58EFB769753E0209F687659672F13B2F266B40 BISHOPASSHOLE
1,666,244,813 *AF5D2BA9BE65DAF84EC1F74AFD3690B3125FD753 ANSCHRIF1
1,666,244,814 *AF5D2E8C38FE2E4A2C2C2C4D4F91C60B20494E6E ANTIWALNUT
1,666,244,815 *AF572ECCCD5FA007E76B5A3ACBEE58E2D717195B ANTOINE.CHRUSCIEL
1,666,244,816 *AF543E15416F5AE85A66267CFAE0F547FAFBCAC1 BKKRSWGN4
1,666,244,817 *AF5BD099D2D26DAD54734ECE1AC5022C308CAB8C b;kwh
1,666,244,818 *AF5E8DA75776A2776363BB96941F67B0B36380A8 antoniodegrace
1,666,244,819 *AF5B28257B22320DCD29896FE3167011A68D9CF5 a%oa.
1,666,244,820 *AF5AFAFE788BCBD3C791B1B89C0A8C7B4B7A890E bm1ep
1,666,244,821 *AF57184C04067D89356297E3AF9A49817BCAF210 [email protected]+5
1,666,244,822 *AF5C3235BFF85D09846CBB77F85854BBEAEC619A BOB DES
1,666,244,823 *AF51D4F099D127C8F1E5F0131C307CFC97AD5AF7 bobbiekrynicki
1,666,244,824 *AF5FF89809B824D09E99C67A93D3364FA469B57D APRIL.FOOL'S.DAY.MORN
1,666,244,825 *AF51F2F12BFFF7D47283D1FEC198022EBE631E08 bobd12
1,666,244,826 *AF52D43CE0CF40F392952ACED7E650A09A7A8616 BOBOWONG
1,666,244,827 *AF56F8843231FCDB4D7B31035244D06427B9E539 BOLKNAK9
1,666,244,828 *AF557C241E73420D202C16D8BEB9597CE6FABA70 ar8wu
1,666,244,829 *AF5D68DFD85C86F12B95B669F27333635F2C513D bou_q
1,666,244,830 *AF5EC7651B5552B3AE69DECB96AA2C591F412676 C!9O
1,666,244,831 *AF5B6487829F483CB7DF4F4CAD8BAFE5B9566CD2 bp,
1,666,244,832 *AF55AE80A8F29D5A1DFDD72F7ED41D1CF06D0B22 bp-rz
1,666,244,833 *AF58A18782A3C5875CA2B8D3EAA5C2C188613419 BPUZP
1,666,244,834 *AF57302B5EF11E3EADCF1CDEE1B0A82DBA80CB08 B------p-~)X(
1,666,244,835 *AF52A869CE81DC61C5FCC05059625D769ADE2484 arnoldwilleto
1,666,244,836 *AF5F16F6B854CE36EF08DED6CD7EEA7CC34B3ACA BPJMX
1,666,244,837 *AF550532E6A910D41D65B0412819BB20F0A12DB3 cahws
1,666,244,838 *AF57FD07A00B430DA8FE8A2363B9C282703C2117 ARTELISA0
1,666,244,839 *AF55BE8F2FE5AD538DCAC6BDF72F73DA0A955C5A [email protected]
1,666,244,840 *AF567B49ECE79788DEC851619C5CD2ACE04FE8B4 BRADLEYMOHMAND
1,666,244,841 *AF5B6ADB9975E3EACA1B2D4655191D3AC05C37E4 BQ;;
1,666,244,842 *AF5AD756B2682A690D1B61D64FDB0687D501C95F [email protected]
1,666,244,843 *AF591C619D45000BCC9F5A9C48F270AE98D0947A breakin'-each-others-heart
1,666,244,844 *AF5E96F3E9F4906E3FFAA9A8909B68A17F223CA7 BRENDANORANSKY
1,666,244,845 *AF53F225709E10C4A6639C095F2E07EB507B56BE CANVASS160
1,666,244,846 *AF55AA386CAE47473464962390255AEA2C21D8AC aslh%
1,666,244,847 *AF56B17C4101A45525EB715851C6015D1341740F $CAPHOCEPHAL1$M
1,666,244,848 *AF5447CC7D992F6120AEE3A97D4BF7B14B20118F ASQ=
1,666,244,849 *AF5EBD3AFF3063DB92F529F37984685A9D436F07 BRONZEREMMO
1,666,244,850 *AF5ED0E1B05F8D60D60F9C764131F1DF0EBB86C1 brut4
1,666,244,851 *AF5BC37B5E7B9C902E2E53235ED3549ADA143D58 carolyn21
1,666,244,852 *AF52735D07E430714FA3D397B270F368FD268E21 brendon-walmsley
1,666,244,853 *AF5ADA7DEFF0C554F50A1DDBF8E42E87A336EE10 carywais
1,666,244,854 *AF5DD5218CF76AA67482A4A79F1439AC980C8189 AUBERGINES2
1,666,244,855 *AF56159E4512E3D74E80489CE5252F5D1E4FE671 augustinecrase
1,666,244,856 *AF59D1E514F59461AE9C7F5BCFB06D7015E4708F CAUSTICALLY, CAUSTICS
1,666,244,857 *AF55BB832AF7B445C9B19DA51C5C5479E182BBC8 BRITT.HILSINGER
1,666,244,858 *AF52E64D4547DA70D0E823868E612D4E2164EBE7 auqfo
1,666,244,859 *AF55DD47EB9037B70B366D1F03A714D87444AC36 btlwx
1,666,244,860 *AF50D80E24BA2CA61C7C65C6077E01A1CD99B977 [email protected]
1,666,244,861 *AF535CDD14D018BD72C625DBA2374F2A79827A21 [email protected]@[email protected]
1,666,244,862 *AF5A29163B61A506FD76E4058ACF72450C632D72 BUDBIGLER
1,666,244,863 *AF59A13D5C75BA143527EFA1708E2DE7E28D3079 a:vf
1,666,244,864 *AF5029F5EF117DCA3BBE7D34A54C9EE8E14CA649 cdb!c
1,666,244,865 *AF5753AFE8629C0BFA08D1B5031162AB2EB3EEC3 bryantbrak
1,666,244,866 *AF5A66AEF5565EC3D8CDD5AD621465207C3FA51B BRYCETRIBLE
1,666,244,867 *AF5F4D4A9125F3A0DD19BB87E4B0B86DD619036E buttondoc9
1,666,244,868 *AF5B49C34847EC79A474EBCEC224028BDA1EC550 buttonmiller
1,666,244,869 *AF5BA0D1EAA6EF11BF5063B2A48F9C233F56D6A4 AWIELRENNER
1,666,244,870 *AF59107259C35D8951369FEF2027C562A0772BFD awl&d
1,666,244,871 *AF5298A88E3F3DC5A93752C29965DC4EC850F93E [email protected]
1,666,244,872 *AF59377C5A109BCC1FE5C20DD1268683DD066FA8 awpt
1,666,244,873 *AF5024D7FA8AAA6035316FEC1276DF356FE083EE BSWNONREENTRANT
1,666,244,874 *AF5AA69E2E1FC4D4B92B293CCB954B10E89C8175 CFQWX
1,666,244,875 *AF5E5F756B82169CBA238A84E2F1A3CE475DAB6A [email protected]
1,666,244,876 *AF588941EAB378FD53659F59D79B30B261765E7B b0wkn
1,666,244,877 *AF5C9C153F4CD4C550E79A76CD0B69BBF238A0CC B!2/F
1,666,244,878 *AF5898FB11860CE38ABF107FA8D4D8D9BF8C1990 c0q"
1,666,244,879 *AF57AC94979DCFAD87284AAB09C01CBB83589402 charlesrubins
1,666,244,880 *AF5CAA5F899E50DC59E0D805083BBC049C321DA7 b7;o
1,666,244,881 *AF55A33DD87E368FB1E0B8786A7FD7F70EBA213F BV,QK
1,666,244,882 *AF5D14461610AC63F44066FB1D13F64D7141FF8A C041.0p3r
1,666,244,883 *AF518BADE78A1016CDCE0683658C8C30E26CD194 C0773E01548DF72EE24930EBBCE53577
1,666,244,884 *AF5510A1B798E024185936C3ABFCB39831CC1E39 ch$ge
1,666,244,885 *AF523E64CAA13155921D9A2BD424DD30975A24D0 c1;?
1,666,244,886 *AF53DB4F3B12B852EBA258975155AD1AF6736F31 C134N-S4I
1,666,244,887 *AF56890E3E1D1DD020A5A5C5C7E4CD159AC9FE33 BARRETTDOWDY
1,666,244,888 *AF5C534729D78893F1D9C88A94DB324C5582495C CHLORBENZOL
1,666,244,889 *AF56328D9B216942DF019E7ABE651382C747EC35 chmpgnstn9
1,666,244,890 *AF5E8FCA3341290BEDA02B118475437041EB723D BARTON.ZORENS
1,666,244,891 *AF5BB4C204A5599636C504D89E31B6372A70E69E CHRIS-OTA
1,666,244,892 *AF5944125368388125AAD4F2215AF198E608DD27 [email protected]
1,666,244,893 *AF5EFD05C64E9FDFC18918EF2D0136BE94787726 c4h+
1,666,244,894 *AF5741CBAA8F92640AAFBDD0A7E23717D0623106 [email protected]
1,666,244,895 *AF5F17835FBC0D6311F255C9C05C937B7DB160D9 CALIFORNIAWALNUTCOMPANYCOMWWW
1,666,244,896 *AF55EB9259B93AF18708043F58CE04F84D28FDF6 c6gcy
1,666,244,897 *AF50AF14510B8A6302252126A93E3A3A3C2C0C13 [email protected]@10G3RS
1,666,244,898 *AF5B8645E6B40394D0CEB535C7F675D612D4432C cardfield8
1,666,244,899 *AF58BF00426EBD200C4956B7300FAD1BEF6DA8CE ciicb
1,666,244,900 *AF58B9CC7DB99C60472B227C1D61925349144352 C9IT=
1,666,244,901 *AF5834EC5175B861F0B8EA8FC1F60C2FC38B3163 carr0t!er
1,666,244,902 *AF5E20179D079699FF98566E115C702B31B18A03 CJTLBYTYYJUJ
1,666,244,903 *AF5C7D6CE6638FB8FAAE9366C03A8DCAED8A3FDE cat & mouse disc 9 track 04
1,666,244,904 *AF5A2C76FBF9B79623C5F1400479B674DABB6F0C cbvpq
1,666,244,905 *AF5AB9B5DF99C8E70677E0273615EE72A2F89CF4 clb!c
1,666,244,906 *AF5DD59F3A0EFE337573ABAFF53C51620AD86D02 beating.heart.baby.(chris.lordalge.mix)
1,666,244,907 *AF51F34A760B472E3F39CE16BF62464B408AF6C7 clmjmphr
1,666,244,908 *AF57A71F69E637095C5427A8F5086E2F3C025763 CMLO;
1,666,244,909 *AF56BE420D078512A583BA44ABEC3AE142E3041F CNTRTCHNCLTY
1,666,244,910 *AF5A2D0BF3A542EF2EE87196A5032E914296C5EF co411t1ons
1,666,244,911 *AF5507B416B4323269E668C74355E0A94B73E1FB ce/!
1,666,244,912 *AF54F50C755DC3CC975B4A8600E0A9D263925FB2 CELEBRATĂ
1,666,244,913 *AF5AA295B43CDD1B7DFFA89ECC606DAB83A68E28 c!b+h
1,666,244,914 *AF5DBFF6A69720DDF31F0E3BB268693E24E1F126 CERZIFICATC
1,666,244,915 *AF5D774C01FB23561E564FF0E55484111949B644 COLLIN.KLEEKAMP
1,666,244,916 *AF51A31B6110D1F9BC2F6717F81200715994F47C CESTODE
1,666,244,917 *AF53FA98C81767D0F1882CC304B7AF471B74B9C5 BETTY HODGES
1,666,244,918 *AF553D748D3C9271E7FFFF9AB2F827EBBA385FE2 cdj!-
1,666,244,919 *AF5C55CE1065495579807D1B05A825743223FCE0 connie.atkinson
1,666,244,920 *AF52D89F97D5D429BB9A86193C86FE601734ABFE CGWL
1,666,244,921 *AF5E7A26E844EFA991C3EA01025746AC7AA7309B c%gx!
1,666,244,922 *AF590FDFD98DE27EBCD7673B7EDFA1933AC30C24 charliepolidori
1,666,244,923 *AF525D52FA1D34433640D7D8D1DD0089089E057E CHA!N5
1,666,244,924 *AF56D13E5080392F22A7AEF98DDC411CAB294655 charm-school-(demo)
1,666,244,925 *AF5CCDB37732E7218EFAA36D2994A75A72208CAA CHANSONMOTET: RESJOISTOY, TERRE DE FRANCE / REX PACIFICUS
1,666,244,926 *AF5223F562F1042DA3FE3406AB9310DF9BE92151 CHBVY
1,666,244,927 *AF5BD159739FD35B3AD31A898B7CE0F24C8676FE cq=l
1,666,244,928 *AF5B31AB979B941D088ED9E654E195315401572C CHESTER.PEREGRINO
1,666,244,929 *AF59E71C562C163B5583614A52CD97B3EFE67180 Cr3dtablt3s
1,666,244,930 *AF57E78B0FF8F5828BFA0E9237F688673DBDC9D9 c[email protected]
1,666,244,931 *AF5793355B57EA70E151399DC8753B6C64C28302 CHINADOGGY
1,666,244,932 *AF53A6A75B6B63D023E477793573CF6265E4374E CHRISTIANDOEPKE
1,666,244,933 *AF5679AEA6F7ED386372C032426E32EE956115CD CHROMHYDRID
1,666,244,934 *AF58CAB4BE8740BA524E8A4500DED93A00315694 CRYING-FOR-ETERNITY
1,666,244,935 *AF5CA84593F6CB7DB15209DA81B160C3C0141F8D bln5n
1,666,244,936 *AF5C380EA71E350EED2DC2BB11F1212D4B093C64 ci!)v
1,666,244,937 *AF5D048D629CE9CA6A7D97E1F1B6C25AB010B5D6 citycorc2
1,666,244,938 *AF54717500E836BB44419DABE3F1C255F85E53ED C#J"
1,666,244,939 *AF5110D0DA1B7F52C10D7A22DE3FFAB32BC9B00C B-N-PRODUCTS-LTD-|-UNITED-KINGDOM
1,666,244,940 *AF578DCB411BD2EBE2F2A1ABAA5E2B44A93FE3A3 b&n,t
1,666,244,941 *AF5C95A029BDFC6BAF28A259AAA804592BC3B3E9 cl5t8
1,666,244,942 *AF574780C5FF20A08ADA59A68C64BBC7648B52A9 CLAUDBAREILLES
1,666,244,943 *AF59730A631A1E39241078A0C6CCC3323622C219 BOGSJAY
1,666,244,944 *AF507E0F831BC743FE36F3F7E31E7D715C84E8F0 clamorousness-'kl/&/m/@/r/@/sn/E/s
1,666,244,945 *AF53E4040D2FEA1BEB75BB0A4B50D0C3B2E50285 BOLERO(FROMFRAMEBYFRAME)
1,666,244,946 *AF5562C38C3FE2CF8F9B08BC4EE24FEAA39EC1E0 c#.w0
1,666,244,947 *AF5D4266B2DF24C0B320BD9E43B0CB37E59F936C clbnw
1,666,244,948 *AF5D144EF9C802523DBBF65186791E9C9F1A742C CLG0
1,666,244,949 *AF5A41E2E5E0C5B6C37E0130912C449E4B94ADA1 [email protected]
1,666,244,950 *AF58D6602609FE46190B63CA2FABBECAFA47A062 clmch
1,666,244,951 *AF56133C64EA96F3D08BFCB1EE6AA114C90F34B5 [email protected]
1,666,244,952 *AF56A011F277654A7CACB5A135DA7630AD08977C CMBOLEKWA
1,666,244,953 *AF53ACD9454697760439CC12D5962A859F0B9C0E cmesh
1,666,244,954 *AF584C62E24CE5C12E8BFEECADA1FE0615225B9F cmshf
1,666,244,955 *AF5105B9D3B4341DF66BFFC34909E58A9E136F16 cntn2
1,666,244,956 *AF538F99AE560D5C4B44FC9F4205A1C39DCEBA10 COLEGLADIN
1,666,244,957 *AF53D79996D0D679DFD44E6F3A69C1518A4A1369 CODY.JILLIAN.SWEETSER
1,666,244,958 *AF5E86FAAC253DE9377A1A023CD8C8F2CDF47AD4 D6CZ
1,666,244,959 *AF5E9F47F0CF461D8CA3261CD47ADE67363F8A13 CO.LTLOCALITYGT.LTST
1,666,244,960 *AF5869C6C0E2A394DC272E11162563FC80C89298 d8%?-
1,666,244,961 *AF524AB5CC4E16F9808665415E8B08C30A1F8440 D8lf
1,666,244,962 *AF5BE4B3C56067F44BA5953C4185D42D60D0FF83 B===P~`SPLAT
1,666,244,963 *AF5CA37949E39915687DB2C5E28DE3618F8EF7D4 [email protected]
1,666,244,964 *AF58F90037347BB409AA8AFF06B9125BDA9AF9CC B_qt
1,666,244,965 *AF51BB9887714F3A3849F1AD58DD25BA22FC6A83 Concili
1,666,244,966 *AF561B156C1970A01B8C8E58D1536E39E3C4FFF2 connie-kiss
1,666,244,967 *AF54C49D1D129EADE49479E80C0FFE7F8705924D bradrupert
1,666,244,968 *AF5FC7B6C3F8C5AF9421C17D96BB0531F1AC22DA brainmodafferi
1,666,244,969 *AF51A78443B9E0E78D2DA29FE945C332C4651C24 BRANDEN07
1,666,244,970 *AF54813DF3FBC24D31C2D78B23DBB191E8F1B2AD [email protected]+or$
1,666,244,971 *AF568991472744EB348BC23F976DD2FBD4B93DDB CORDELLHALBERG
1,666,244,972 *AF5327C96A6A1A733598B1A03C68AD25B048461C brentsantoro
1,666,244,973 *AF5F9EA68FB63ADD83818808C34A78043CAB7343 DANIEL.PLASSMAN
1,666,244,974 *AF522D2983AF7FA5EECCC476924214D9B5126739 brianlitchfield
1,666,244,975 *AF51A557AA714B8B2EAA7F6811161BB490C1FA97 COUGARSBABIES
1,666,244,976 *AF581E9DBEEAECD6C12A9EA3E9F28D340F269BED cp_6u
1,666,244,977 *AF50D1875CD8E0A18043A393EC1F30B22D05E9A5 BRODY-CONTRERAS
1,666,244,978 *AF5A22F7B65B46338D36860D9A2D740ACF463F94 brq9t
1,666,244,979 *AF5285A42BB9280509F0C6E1675CC316147EEE3F C:\PROGRAMFILES\MICROSOFTOFFICE\CLIPART\PUB60COR\PH03224IJPG
1,666,244,980 *AF5463A4EA4CEE48E3BFF96CBB07D563B31CF6B6 cq_bh
1,666,244,981 *AF51F3C1435164BA45187688513A25AB9DEE694F b:=)s
1,666,244,982 *AF5353DEB50E1ABAE26FD415708F593AE6BB28DF daru"
1,666,244,983 *AF5355876521585ACF46EE4271ADCF77CCE25A1B CRAWLCONSTRAINT
1,666,244,984 *AF5AE3BEB686FB594CE1E2CCF03C96F40AB73F2B [email protected]
1,666,244,985 *AF56D6E6C9394D3351AB15CC8EA62D72382BA560 crtphyllms
1,666,244,986 *AF590B7348B66E8DEDC2E40D21F5DE6F367715AE dboqq
1,666,244,987 *AF5F13937886EB768B338985D2ACA4F48EEBE910 dbrcl
1,666,244,988 *AF50CEFABAF938B1A62C6C34DCFE6C917529601D BUMBLER
1,666,244,989 *AF5AEF865C55148B1CAF0885332FC9A02038CEA3 curtisteran
1,666,244,990 *AF578112801F868CE2BDE6D62E659D1309E421AB Bvlt
1,666,244,991 *AF577482EEB6948F00BD860066F86CE74D188EEB cw:%6
1,666,244,992 *AF5384F3D15BFB6281C22F14875C440DE35C3D52 cxetd
1,666,244,993 *AF55AED67E3BBC899B78ECDC50A2E4C2A32827F7 cxs._
1,666,244,994 *AF55C9937B41A49988C9192CBF1E3142F3F344A0 CZ69B
1,666,244,995 *AF5598724CBC9ED4C904E109B3D049250FACA8E5 C0NJUNC71V4L
1,666,244,996 *AF5FC0A83917CA0B0BFC55EB321B8E078ADADABD D;,>
1,666,244,997 *AF5CC39D88313560136FEEFA898D4A215C82AD37 d0ph0461
1,666,244,998 *AF5D004528669A1628B37E33DC4A85F80DE76686 c1%gp
1,666,244,999 *AF51E684EE2BDE092D2C94B2532DE830AC2FCE9E desdeelinicio
1,666,245,000 *AF59A1C418A393098272DAB0DAD1A04F4B9D5370 C5ED595E-9800-3BF1-A6C0-B92EFE22C940
1,666,245,001 *AF50AA4A008DC372DE27D245EE7FB941350553A3 D16f
1,666,245,002 *AF54A8240616C3075DF25D1D0DEBAE38168E22C1 DEVONALEXANDRIA
1,666,245,003 *AF52AA8251F98FA1978767A54EDC358284B6D206 D)57M
1,666,245,004 *AF5CB223118BB883AB9D08310223B95229C251EC CA8ZK
1,666,245,005 *AF558B03DB92FB571A187FA7C56B7CC3459429D8 dgja
1,666,245,006 *AF5B2848FECB70E9DF43A37FB6B050873FB2AB33 ?daaa
1,666,245,007 *AF5C3B4E32F1F8760514FBB6E560AE90671940A4 DAFUK.13
1,666,245,008 *AF58EEBE8AC8989D1D47BA5EE8EE42C047B9BE7A CALLICALYPTELLA
1,666,245,009 *AF5389D3370D19857666494BF2D5E14227016472 [email protected]
1,666,245,010 *AF575D38BC7176AB086A7EF0E6965E3A0C6AA5FD DAMONKALLIO
1,666,245,011 *AF526D6749168B6F714FAAC6381CAC43389FBD83 d89gn
1,666,245,012 *AF5B211D81D04AF3B51BF9D1C4CE9CDDD4D8664C d;+i
1,666,245,013 *AF51AC63AFF5F7C383BEEDC74CB2FC173708E8E1 D#>I
1,666,245,014 *AF5ED89EEB8CA7B30B9BB8860024951C02575848 dae::
1,666,245,015 *AF51836D5E68DCCBEDA7957A6621AFB7FA7AA0DB DIEFENDO4
1,666,245,016 *AF52BD9AF2DE6AF522DA13569556F26BC2BF9D48 DAMON.CHEAIRS
1,666,245,017 *AF5C48461CAC8555756AE9C9DC3360494C0D0850 CAROLLALE
1,666,245,018 *AF5BDACBB9C352BEA7F14F8B8C48F8C4CEDC075E carretera.de.la.costa
1,666,245,019 *AF57EA070038BE36A644F7B082C117CE94F7D205 carrie-chui
1,666,245,020 *AF5D3E7D4D0DFB7E86BED5B5F94D09A1B334C69E CARROT FRESH SCRAPED; PRANKED OUT, BEDIGHT[OBS3], WELL-GROOMED
1,666,245,021 *AF5E5C551852EA58AA6FA33FF42D7957DFEE514E CARY.DOMAGALA
1,666,245,022 *AF54725EF064CA87ECAF7716107FB6355CB1D8BC disguising0
1,666,245,023 *AF5B56E267E4CDB2E348F0F9A28E1B7D427C6EE4 DISPRITEDS
1,666,245,024 *AF54B8E54EDF70752062046B816A215F34269750 DANNY.MARSEK
1,666,245,025 *AF515F3D6016F5D8DB0D405613F50C7ECF5ED351 CASTILLATALKROBERT
1,666,245,026 *AF57B2700F6B5BAB4318FF37B9EE39E414067C81 davanji
1,666,245,027 *AF51EAFAEDD66E72DF07FB3495CCDE27F2B77A7F DAPALALU
1,666,245,028 *AF54C07E6819FD10A0F3DE52CA5EBEA4D088F496 CATHYBOUCHER
1,666,245,029 *AF53C107D5A21FDC53861B60B9023E07DB1A30A1 CBIQQN
1,666,245,030 *AF53F4B277CD0151F9FC209184F98BB5C5D52A2A cbqtw
1,666,245,031 *AF583EF3E58BF148D0079B52A7D9DC9DCD54DB83 [email protected]
1,666,245,032 *AF52A77CD52FCE8A340C767C1CF815B6E05D6A55 CCB;O
1,666,245,033 *AF5EE52BAE39F221FC46BA83AA790A96E4A02BD1 DL5%V
1,666,245,034 *AF5B544CA8046D00C3DF64E33D365F0B4CF21D51 DAYTON768
1,666,245,035 *AF568E6FE6AE7CD8B85506E6D3D669B16E7996CF cdub
1,666,245,036 *AF5CF1BD2D99B895538D1A7333F42C6D9E98CCB7 DBNKI
1,666,245,037 *AF5962049B5D99F54242054D9F2B94623074241D decifrino7
1,666,245,038 *AF50A1912FF1D31E5DEEFC961766346DCCB5AA6A DONGTRASTER
1,666,245,039 *AF5FB4CB8AE14265195854E1AD3D690DB1410590 ceskehobsw
1,666,245,040 *AF5B5DFF4C6B2C06EEF47140110F806486984F23 dehcaopnued
1,666,245,041 *AF5B7B49B1605A5D108AD910AD7D2A573272092A DE-INONIZED
1,666,245,042 *AF59366491A75E88AFB65AA2CBC2E6A71FA4824B DELAPSIO2
1,666,245,043 *AF5EE3DFBBBE3309CC46A0D8D1FF81C524D3BF84 DONTE.RUWE
1,666,245,044 *AF5E5D47AB44DAD7144FF5C4A1B8013D64AEB9F8 cf6n4
1,666,245,045 *AF5F7322CE4FDC813056B28C0A79A5BACD01C1DC DENNYSAT
1,666,245,046 *AF5A4FBBCBC89F39DC99B448388503D70706B880 cgbk:
1,666,245,047 *AF59E9633588FBAF5CE376194CCA1CE24AF361FE deonwideman
1,666,245,048 *AF54AA55CEA57697B33BB3449094D4D338BA850D depositrate
1,666,245,049 *AF5F10BA002280AF2DFC5E2CEFDA71B5F7A36D7A DEON.BLACKSON
1,666,245,050 *AF5F30D7246FBAF933FD2045D74BE21C2B91AF59 [email protected][email protected]
1,666,245,051 *AF555BB29CC8501CA4422A7556D180A6BF7B1661 dqkh
1,666,245,052 *AF5FCD36619F59F9849A2CE9BCBF034C630E598E [email protected]
1,666,245,053 *AF5D9F9B8DA6BB034B80CD30434D9AE26BE141AE DESCRIPTIONSPECULATI
1,666,245,054 *AF548D4CF9927EE283E7E1589EE72C2E2976220B CHAMPION1973
1,666,245,055 *AF5A73E857101C4790644D240349CDEB5A590DE9 deweymadere
1,666,245,056 *AF5AEAA26723FBEFCF98A65E8F7870A5E0219FFF driving-at-morning
1,666,245,057 *AF5AE0DE0E61242233A36F5F4E1353049DFD1784 devonrittenour
1,666,245,058 *AF5E5B142180491AA46B8FF8039912B53923FC54 DEWAYNE.COMP
1,666,245,059 *AF552FB602FF1DB4FB16C5A2DC397F2533EE7C4D charliemicks
1,666,245,060 *AF53F5277C4164C1C7252EAF080925D2C4861BDE df4ii
1,666,245,061 *AF54B809BD40B53CBE8F49BF15E1B920DA308266 DEXTERGUCE
1,666,245,062 *AF5EFFE2ABAE8A5F4A35EF7DD82719E88C043997 ds7n)
1,666,245,063 *AF5E1BF4C44F926DDADF3866F933D737B97770A8 dsn/n
1,666,245,064 *AF59641408F9902524A840BB337695F4C1D7F710 DGW-"
1,666,245,065 *AF54B9B64AA9D617D919C96FBB9A2E90D16DC114 dh-_d
1,666,245,066 *AF5BD6322607E066066EEA8CE1CAD614AF0C20F1 DGM4V
1,666,245,067 *AF5C9B50C84DE72702D8C6A8ADED62C6B11F782E dh/,r
1,666,245,068 *AF53BE9EE9A0E0179A7A0C1F891138B2150583B8 christopermantz
1,666,245,069 *AF575F089D50AD1CF4732F44B7F1A9BD5D9439AA CHRISTOPERTHRO
1,666,245,070 *AF5F9A9FCD5292CE8EEAD8F53C65BCE9A2693017 DUBĚNKAMI
1,666,245,071 *AF50C282CB6F6DD9AE775970F6FFFC58158A716D DIGERERAIT123
1,666,245,072 *AF511891E998EE017B75C4547D9AE7D468AF8223 cht$a
1,666,245,073 *AF5112A1F85E06124485396D2D14C4D4E661D778 dimetilformaldehida
1,666,245,074 *AF54784DD93EE8C9A4B52ED44B206716E0DEA11D DIEGOSCHEIN
1,666,245,075 *AF59E35BA3E61B438A114AE9AAE58FB0EE93DE0E ci-+i
1,666,245,076 *AF57E2DDD14B4A637CBF76B12DE48888A8C0073D DILUVIALE2
1,666,245,077 *AF59474A9B419F73049AFB27565EA6032648793D DUTV1
1,666,245,078 *AF5E33254E79DE71F9E5BC005407778E5F59D46D DINOHARDACRE
1,666,245,079 *AF583CFA05CE8F4EF51269C0DB589830A212BD2E dipminstitutecom
1,666,245,080 *AF58F4114EF63FC3DD4CB20DD95375A22C7E0287 Cj+,
1,666,245,081 *AF5238F27A50694D602E49322FDB7D7A65E93CAD dj\u
1,666,245,082 *AF517AC05B1735272820FFD575B1A6B7320766BC dvfu:
1,666,245,083 *AF5699C0CACE96979AD2900A0A2D8FC6A63C3678 djz9
1,666,245,084 *AF580EA2A679B470911A3939A26A87185C42D825 d!?m#
1,666,245,085 *AF594D9C6B74D43B63B2A27D28AED239A9095053 [email protected]
1,666,245,086 *AF5DF63ECFA5EF1ADF0E5105B6BF96EB228B0A5F dlxl
1,666,245,087 *AF5658DD98A36488F45544A54EBE349924816409 E04210120172
1,666,245,088 *AF5F7CFC55CAF1C8BAD3EEE126B537E6388A471F CLOUDLING!
1,666,245,089 *AF5A0B88171B8CD35492EAEF0CAB11EDEDD8E436 d)nai
1,666,245,090 *AF548D1F41D393049983167B5CC6538DBB4D7633 cmshf
1,666,245,091 *AF51117D7EAE7AC4F0A647C056B256E5110720B7 dnozt
1,666,245,092 *AF5CA6E6A419C331E558DFF2BD2F03D095AF3DDC DONNELL.KOEPSEL
1,666,245,093 *AF5C8141AA42630F47569CA97E9637B1AD4375DA edaklava5
1,666,245,094 *AF5D3303F54F5D9E5024341DC4ED181FC18E9DA2 DOMENIC.RAJARATNAM
1,666,245,095 *AF542805E1F2D956360026FAA79002A2909C4B41 DONALD.KWAK
1,666,245,096 *AF56AD381A83B9857713075191DDCAB905512382 edwardteffeteller
1,666,245,097 *AF55CCE544A8547DE07C90D75AE1D6EDD4788E8D edwinpachew
1,666,245,098 *AF55C66495411CB385741307D1310EF7DA35759C dopent5
1,666,245,099 *AF552CE10393896CE5E661C56B8004EC02886BBA DOUGLASS.COMERFORD
1,666,245,100 *AF5D344658CEF44501D20F6C99452265E6FE6EC1 dpnej
1,666,245,101 *AF5619F1F961D1D3EFC0C6EAD552FC7316FBB577 d_)p!
1,666,245,102 *AF5469E195707E10762545CA4444F3182B4B12AE dqkh
1,666,245,103 *AF57DB280DB7DF43EE460912004EDD2B4B25CBFB D;%QE
1,666,245,104 *AF50AEA9772007D470C6E0F19102F37375CC716E dragowski9
1,666,245,105 *AF5DD8490B0AB83F5B968EA208174364F46E080E drive1in9
1,666,245,106 *AF50B74FEF14E6A8DFC9C20B701ED5BFF729BC36 dribblers0
1,666,245,107 *AF5560940C8E69BEF5A1BFF2C7BB14611ADC4583 drsv8
1,666,245,108 *AF505F41034F31CBE283DF910BB8837B001D6083 DS!P
1,666,245,109 *AF5C4991B7DEBE4B7275C9A681238CE15AAF7F6B ELDONYONASHIRO
1,666,245,110 *AF5AFF89B18A6DAB787F083559E56650AE46E8A0 ELDRIDGE.BARKLOW
1,666,245,111 *AF569FA959FF8A2F36FB5865189B49B0F95F3833 DSUZANNING
1,666,245,112 *AF5627C9C04CDA65E998990BCDD858565B736F6A DS!P
1,666,245,113 *AF58C4DF982646CAEB82945F8727AD58309C4B0C DTADERERA
1,666,245,114 *AF5734B8D28B76463BAE06FB9F00E7F40AA68723 corey1211
1,666,245,115 *AF56972A72B36B0AE2FAD48FFC25041FF75D3555 elliotleibfried
1,666,245,116 *AF5E1EDA11F56B416FD67F89339CAFA369455653 ELLIS.AUNE
1,666,245,117 *AF5F8012DEEF18D152D33E2EB2C938D1D00B7950 DUDLEYLEZAK
1,666,245,118 *AF51CDB4C1454C6E6F6832A35E1E05D1BAF2F80A ELMOPOSEY
1,666,245,119 *AF5962691EEFC6A75377F955AB0751DAEF79ABC1 ELXQS
1,666,245,120 *AF5C99DDE1F6A50EFA6AC26402FF0E502E4AD918 D(VHF
1,666,245,121 *AF55E293AC037E6CC681DC2E59417E3ED294EABB C:\PROGRAM FILES\ADOBE\ADOBE BRIDGE CS4\LMRESOURCES\PT_BR\ACTIVATIONDENIAL.ZDCT
1,666,245,122 *AF5BE4409460D51CC38556A6805AE89025E3F529 DÜRRENBÜHL
1,666,245,123 *AF50A696954C424C8B003CBB03157C7AF587DE26 [email protected]
1,666,245,124 *AF56D91DF4896B3C07FC1EC21469D55085B8E904 DWAINBARAJAS
1,666,245,125 *AF5CC2F15ACBCBF874D1CD2888E33C3711E0BFE8 EMRE BELOZOGLU
1,666,245,126 *AF5F029AD1EEF62D98182D3D562592F161A3BC66 D!!V.
1,666,245,127 *AF59340DF1672122C8E12DB7AD59E44491AB967D ENERGYFESTIVALEN
1,666,245,128 *AF5D45FCC5EE8DA5FBACCE95FD253F2B50093F82 D/VL&
1,666,245,129 *AF57B01E5F6E8C188AE290C684532447C06EC466 e1c|
1,666,245,130 *AF579DF9FF95872F3CCE2D77993CA9FF7601DCCD E7Y:
1,666,245,131 *AF53EF615CDDF805AB292A671D75E9F589A52C3A ERICMCCOMBIE
1,666,245,132 *AF5A5A92D65F63C9426AE1FA849A5A556F74C9B7 EASTERC0
1,666,245,133 *AF5446621ECDD7CBD661E5ABFB4E18E56034C17C ĖDRIAUSIAJAI
1,666,245,134 *AF5F8B24D443551535F00781EC4A12D12DE185D3 [email protected]
1,666,245,135 *AF56D2D78A34A7E5FFED07ECEBDA1734948E09C8 ECAWB
1,666,245,136 *AF5D0F5BB8411F129A714565D4B807A0F2723C71 ECIRTADR0
1,666,245,137 *AF55350479625D62BA24F4E45B6A0C10DF4D56C5 EC!P
1,666,245,138 *AF5CA32ED6A7A1681AFA1EDBE8CC3DA02B4D5DC3 CT8F%
1,666,245,139 *AF5A9E68F260034CA417AAA65D2011212892544A ERROL.HELFEN
1,666,245,140 *AF5CF1CB58EC3A4304C1DE8A1E2C72A63AC7BA7B EFFABLE
1,666,245,141 *AF512F9C50775BBDDE38A9881F3EDCE7BA01B59C EFT
1,666,245,142 *AF5FA183137159A815C05DEB0E57B270A25319B6 EGM0
1,666,245,143 *AF55AAB7D31E44527868DDE7FB47B3BEF7DC0D29 ETAIRGINED
1,666,245,144 *AF50092B42B0ECE6D5D662EFB28099BFC825D8C6 CURIOSIS9
1,666,245,145 *AF53DD5D9C3AC0F8F5E863EE272925C0E36247AA ETHMOTURBINAL1
1,666,245,146 *AF59C7663C1A46E59C62910428A47BF12D45B268 [email protected]
1,666,245,147 *AF5E839C4FE672CCCBEC99B2A08E692CC985ADA0 [email protected]
1,666,245,148 *AF56270551BF31E36B351F7AF5B76D47714F8D12 egqcl
1,666,245,149 *AF5B87AC3720B4F841DA4B29EB532B51A806DF32 CWB$K
1,666,245,150 *AF578C56DF3759D58891DA5B5F27EBDDD9588AC1 ELISEO.CRESCENTI
1,666,245,151 *AF5BA068ECB4C00457247049D42F2E91DCD000A5 evertebrate1
1,666,245,152 *AF5A5CEC07ECD6125F5840E99B16CA8DB16F5F5E cxetd
1,666,245,153 *AF55EFE4C19AAA52DB75EA710602E65FA0B65833 CYRUSMUCKEL
1,666,245,154 *AF5C912EE621F04278D2B08D871210AAA12C0EE7 expulsais2
1,666,245,155 *AF5F5108B1C33E23443746A16C8FCDA772B81269 eybmk
1,666,245,156 *AF53F683D59B20E24318FAEF584B58AC2E245EF3 D$!"
1,666,245,157 *AF5AE4B3B7EE11752E8A48C85E7DF90465E052FF EMERYHYLANDS
1,666,245,158 *AF57BC5215C454C3CD2F7459A52FB8BCFDA6F492 emilezaccaria
1,666,245,159 *AF5B6AFD46FB7D0B58576C0B83505492D6BC5414 F80289
1,666,245,160 *AF5E0E8239B7996D7F608CC628B4F0A7B8F3F0D4 emister4
1,666,245,161 *AF55C1AFCE38B395F4BEA87A84E2275278AB484E FABIANKURA
1,666,245,162 *AF52853102E34BFCE3C668658B12F6A17E341C04 emmeehri5
1,666,245,163 *AF5208CBEA30C56491B31772EA8F014E19428BE4 ELLIS.HERMENS
1,666,245,164 *AF5F757BFCDCE21F842D39162F66CADED3D43909 ELLIVADE
1,666,245,165 *AF5C4EDEA4AC35F6958C2E1F44A06446C8C46DFC EN6213524224
1,666,245,166 *AF5B09CB69DDD23557B65300523934B515D72375 endossables1
1,666,245,167 *AF5F8508FD096DE4DDCB92239A3590E0F306EC1A EM6/Q
1,666,245,168 *AF56BF96DBA1341B3E5E6FA39352A56C9B2C0F4E d3mol1sh3d
1,666,245,169 *AF50DD554C9325654670FAD2198B7B4936AC6DDE D4X5K
1,666,245,170 *AF5D01AF752DDE7501D00EC531BC0176A664D803 D6Q$Y
1,666,245,171 *AF5B6EE54755B213BDE6423F68BC0A10087EAE95 enografi4
1,666,245,172 *AF56583D62C3520DC8965E353AEC1530D620B52C ENROLIO3
1,666,245,173 *AF5083AABC83EE55173FF4B1A1CB3945C8468E09 [email protected]
1,666,245,174 *AF581A068BA21CCCAACD36A447415672C468AD9D ESCOGIESEIS
1,666,245,175 *AF5FD77EF99363E9BFB93B51D134983F71DEFDEA ESGQK257
1,666,245,176 *AF5139B9E555BE20067CFB2AC85AE6EAE676AB63 D#8VR
1,666,245,177 *AF53C9FAFD94611A1A34DAC4767C50F8AB5FEB56 dac$7
1,666,245,178 *AF5A047C202404DDF01F4EA7BEB299A503194A1D FILESHARE5
1,666,245,179 *AF5B775E8CE3BF71310C5E8EF5077D9265090CBC [email protected]
1,666,245,180 *AF52CBF6838C1DA28CCEED0327076E4FE8C1292C FINCONSULT
1,666,245,181 *AF556C93B41D0F227F7C26687829B12840E93D63 ESTRELITASANTOS
1,666,245,182 *AF571E6323F248CCDA398053575B50DE77BBD981 eqsnx
1,666,245,183 *AF5023D2949D489F49BE9DA7FCF13824489AC5C4 EREERSTING
1,666,245,184 *AF595DE92B8AC038EC59D11312B73BEB771E9125 ERICK.SUNDMAN
1,666,245,185 *AF526E83BF5E115D4E63820C83F6AD2E14F3FC2E erjt
1,666,245,186 *AF57A0361F36F08E0FB7799B161EAA8B879BE6FA DANFRODO0
1,666,245,187 *AF56847FC7EE1EEB76E20336BF6E350EC995F4D8 eusebiostonehouse
1,666,245,188 *AF5836AF00F80B1A5F8228A6E16F1FC21CE9DD2E EVAN.STELLER
1,666,245,189 *AF50A7043CC770079234DE2B5F045571E1CB12EB DANIELLE BEELER
1,666,245,190 *AF5DF2DC2D03F471A8A72779B2765C694E14DAA8 EVELYNSEQUEIRA
1,666,245,191 *AF5A9506DB2BB9AE348E30104D1BAD119040A65F FLUFFER8
1,666,245,192 *AF5B20D420A56A9CBE01A151266A0F370B300422 [email protected]
1,666,245,193 *AF5025314A5C69DDBBED0F91DD9DF139B9723D0B esyty
1,666,245,194 *AF5879C262AA1F2FC4D16C8FF6AD3BD97BA5D899 ET&S
1,666,245,195 *AF5BB68A939F1DFED8621E09E8B1C0BEEA071993 ev|0
1,666,245,196 *AF55615DE319A6ED2CCC98D1F4A5CA0660E18399 daryl-boggs
1,666,245,197 *AF543ECCFE89C928779AE068B87005F735705651 frac12kb
1,666,245,198 *AF5AFF0AC7E14FDCC42FFD16C85ACBFAE86A255D FALLERON
1,666,245,199 *AF59A9EA118B7231DF27BE8D3B0CD6DCB74D7CCC FRANFANNING
1,666,245,200 *AF54C04D270F763B037555F38D607A59D35F1A51 frankwikholm
1,666,245,201 *AF599B4F97CC455A5D502A1C6E105C14716A63A5 FRATTOY
1,666,245,202 *AF565820B52490375F4874C0810AB83033D7A629 faustoschadle
1,666,245,203 *AF5E8DDEE43619D2B193ECFFD6AFF6B03DAADC3C FREDRICK.CASTRONOVO
1,666,245,204 *AF52BDD5EEEDA6A042C12E45C8B440D249E1501D fredrickgehrer
1,666,245,205 *AF579D1B604430787432B80D444E37456410E2F8 F1IR4IOUSNESS
1,666,245,206 *AF510B502B70053D7B75495316455CA222DC7E95 FEEDYOURSELF
1,666,245,207 *AF50D155C5285E2643117D15BA18536E155831EC D:cH
1,666,245,208 *AF501680F6E8ADBE73288049669F99B43613A1C1 FGFR98
1,666,245,209 *AF5E09D1D7910A72EED98A2093203ACA9D20B556 FUNKYZULU(YOU'RESOFRESH)(CHAPTER2)
1,666,245,210 *AF5DBE6454256CF1DB93BD7DEEF4415B739632F3 [email protected]
1,666,245,211 *AF5DE2C10592FBC6C99F94E9E5235A4B0CA7E0DD DEANSLATIN
1,666,245,212 *AF5F658214F9E51DC71BE370D9575A32BABC8AA1 [email protected]
1,666,245,213 *AF52143A48098726824925A648FC830DBB218706 DEARGINNI9
1,666,245,214 *AF50A10BED10128CFF7F00A3CC46972781666859 FEDERMANNH
1,666,245,215 *AF5510C9BCAAEC510F22B6B8904CEC546C56591F FEENEYFINNISH
1,666,245,216 *AF5AD3476F06A7FF01D8D3D8F387B4139F390E7C g3n3410g!s+s
1,666,245,217 *AF57C8271A325470499CD2656C6D14EDDB4775BA FELIX.BAILARD
1,666,245,218 *AF524E5261B5E42697DEF7845E024B3F040B814E DECISIVING
1,666,245,219 *AF5BF42BBBABE479627A9D3D8C73B41A0D205623 FERDINAND.DOERHOFF
1,666,245,220 *AF5869B8B77EBDAD4DCEACB4EBB4C1E688731BC5 GAILFAIELLA
1,666,245,221 *AF52339E81B3A5D1C3EEFF16D37E623F1E4111ED gailpedro
1,666,245,222 *AF55955F2A6074BD7F1BE09F166B71299DEADCA9 [email protected]$
1,666,245,223 *AF526B22A82AEFA518AA09FF9FD7A2561050A2A4 FRANCESCO.VONNER
1,666,245,224 *AF5B54737A30C57449867F7432D40F617E2141ED DEGLIENICKENORDBAHN
1,666,245,225 *AF53DAA86692FBD3A3FD57DE2354D1A374288850 DEHTEART7
1,666,245,226 *AF5C4E69E1670E0D0780642B3F21C98222650940 frederickfehr
1,666,245,227 *AF5B0FA92FDDE19D10C6D3F8B52A5FC56AB20931 FREDRICBANTON
1,666,245,228 *AF528772B854C8AF4D73E1D463737D1BED6631D9 G]E6
1,666,245,229 *AF5017150EDB88C5F224865CC45FC952ADDD1AA2 DEMARSE用提取自
1,666,245,230 *AF5FAE9D9CB6C45CFCB10EA620139D08379119A7 FRED.SESTER
1,666,245,231 *AF5592D84A65C3234790DA6BCDFF1B6A3378E7F9 demissie-dambie
1,666,245,232 *AF53BA442611BC403FF8E9FF73169253201F7BA8 floortrendzcomwww
1,666,245,233 *AF5FEE70273775C4A6ACE07C958D35E814F50287 DENIS.MULDERS
1,666,245,234 *AF585F6EA3A5FA169889963A2D15D8C61C8E4327 DENN ES IST WEIHNACHTSZEIT
1,666,245,235 *AF5CD4C4FDBBE0B77DCA50E415CFAC88203BD1D4 FRSTERAS6
1,666,245,236 *AF5FA2E1F2A1F14DDCD0DB6FE43734236729062A GEORJENE2
1,666,245,237 *AF5E845D41DBFD762A1F7225A7BCD8A6C335BB3D gerryminick
1,666,245,238 *AF5792093A2BE26B59389729226D334D75759E26 funneler7
1,666,245,239 *AF5129FC6A03BBCCB7663BB646C9453A0CD7D438 FUTURE-ARTILLERYCOMWWW
1,666,245,240 *AF51D83484260F836EC6B7CA21E43DC5C148E68F ghostmatt
1,666,245,241 *AF562CA74104B6F398D89F25A91F3B87F7AC0891 FRANCESTUSLER
1,666,245,242 *AF5066876BECCC94B487420A4910BAC2ACCB25B5 g4bbl35
1,666,245,243 *AF5B37E61F3DFFD0C0544A1A0BB9CFE0DB8E4C81 deshawnkasch
1,666,245,244 *AF545C18B9CE0760CBB6CF5D1F6673B09F9F30CF FREDBRODNICKI
1,666,245,245 *AF5DC3E3AA3DF7355E68B65CF215A47E81CD30CE GJFFODDL
1,666,245,246 *AF59D1F366809647DAEF7CE5848E696F4065A3BD fredericksidberry
1,666,245,247 *AF597D7D1166045CE81288CCEA1F567778D474B2 fredkaskey
1,666,245,248 *AF51A980566F3A28AF58DC641339D29344A02AB3 glendaleny
1,666,245,249 *AF5FB4C9D0A63A01EE4FC4FC9E157ABF86F46A60 DEXTERDIEN
1,666,245,250 *AF5CBEFB2FF5CDEEEE6A7FC0AE900107196C46F2 DEXTER.PANELL
1,666,245,251 *AF5DE815D27879ED96B60F51D60562861A68A0D2 GASTONMONARQUE
1,666,245,252 *AF59974E80E7A9BEEF1ADA371DD3E024D0820647 DFIS9
1,666,245,253 *AF5A18A9F138FFED033AD1BF923AB31FAD0F317A GAYRADION
1,666,245,254 *AF5B54B40156F889DE2A13BC9804338A92C42CD2 Gc4
1,666,245,255 *AF5C71A3F108846FA1024A4D8DA70CACD55BBD3E GOLF
1,666,245,256 *AF587A48BA95191506C2AFA115E94F87BF68DF4E gqdu
1,666,245,257 *AF542744577279628EB1385D31A7731AEB3CB5BD geraldgnabah
1,666,245,258 *AF53DB8DC621F9104EC4F9AE709DDCFC4709F936 geraldokoetting
1,666,245,259 *AF558293B45F33CFB36C75F1825491950D40A55A GRANTALDERMAN
1,666,245,260 *AF50C33EE5CCBD51BA52EF067B4E5CEF0C51A0E9 GEROMES5
1,666,245,261 *AF5957C5808F33CCBAC94A01476107088B378C23 GERRARDSCOTT
1,666,245,262 *AF5B501031BEEF5B8ED76AD9AD4FEDB4A96316AB GERRYLAMPRON
1,666,245,263 *AF5E0C465EA9365B91461C322B1BC3CDF695EE07 GREGA
1,666,245,264 *AF599AFB70DCB7B21DF9546A0FD31B3EF7177B5A dimrid
1,666,245,265 *AF5BB4B44894E56B967916E7E1B42BA64C97F589 [email protected]
1,666,245,266 *AF53DAC57C7D4323A1EF2F1FA756287D2D6F6088 GSPLKTN9
1,666,245,267 *AF5904240EE24BBEC42F206AE5DCA32F723DBB69 diondicamillo
1,666,245,268 *AF54A5F0E373AF145A18A2DE57C2061FFA746699 DIRKCAPITANO
1,666,245,269 *AF5B0B30C1D78D11A9F3DC6A66D4B4AD56AB9064 [email protected]
1,666,245,270 *AF504A9E0F0F0B0D296D4D075AC0F2F1EC5308EC guadalupeangove
1,666,245,271 *AF5104E18726BF6D4EA1B0062AF3036DC732CA29 GARTHFLORESCA
1,666,245,272 *AF58A750A91DB9588083466D219B727A2A4E62BF [email protected]
1,666,245,273 *AF51AB875B0525FFADA0F60F1CD7AAB0AFE9E841 GARYTANGO3
1,666,245,274 *AF500DBB9331CD126360A87651B2692EA49B7CD3 DIUORTIA2
1,666,245,275 *AF53AD7F61EA852B5305EBFC6F4EEC319D12AE1C divyang-bhandari
1,666,245,276 *AF5172E21174F6EF6A34C637F2692F510B0F81D7 DJEU)
1,666,245,277 *AF5B8217021257E8CDEDE9265F24544D6939956A gloria31
1,666,245,278 *AF573C200EB60268283A9F4F10C5BF2DF99127CD GONAVCIV1
1,666,245,279 *AF592B45494F9592DA7ADB920C1257878358C29D [email protected]
1,666,245,280 *AF53921B5D257AE5BFCC00E2D16C6D9AEB6CB60C gemveto
1,666,245,281 *AF5B77A44923B081AC6DC4677D12941459D004CD GENAROBRYTON
1,666,245,282 *AF5CD994A468379F731A3712C600E00D42D4CBDA GENDERIDENTITEITSSTOORNISSEN
1,666,245,283 *AF5DC0AD4EC534598C7C7F12A07B77A4FF346140 GEOFYSIIKAKSI
1,666,245,284 *AF544A396724E0BEFD897C881DEDEB0ABF91E445 george-busby
1,666,245,285 *AF53E034C4AB6D20F7C631DCE3B18325008C7C09 GEORGESALINAS
1,666,245,286 *AF5B3DAD8C6F40BD6FE3B524D8D4F9A5BDA6D703 govoret
1,666,245,287 *AF5C8311DF0A8A30425288F6B6EB867AA4FB8CC2 [email protected]
1,666,245,288 *AF59B1CDD11AF75937C2653D7B3EAAB87E139B73 GP3J4U
1,666,245,289 *AF5DC27427A0778DC0B4DBCBD84F7EA72184F4FF gqdu
1,666,245,290 *AF5AFFA474FD43FDB4CA48A7A353B27CFC1D05BA GERMANBRAGET
1,666,245,291 *AF50CE02DD0CC9B36134EAAFCB3DBBD7A39258A9 GERRY.BIGONY
1,666,245,292 *AF5A7F3492BFB28AECB6B825642A6ACC7EED8486 GERRY.SANDY
1,666,245,293 *AF5FCF04210B97AD494ABFA5534AC934E8FD42D0 GET BEYOND THE MULE
1,666,245,294 *AF51D49D3A94B40E1B26E88F97058EAA40211A37 get-you-alone
1,666,245,295 *AF5AD7CA84AACB04859F9B1436BF9C209F89A69A [email protected]
1,666,245,296 *AF588EA72D7BE5A56F4A23BBAE083485C3E33017 [email protected]
1,666,245,297 *AF58878672DEED16D0A7FA31A7888C78875D2E2C ginothuringer
1,666,245,298 *AF588FC10FFE4F56A6A9DF0FC857F1A7A8B1835A [email protected]
1,666,245,299 *AF5AB76074CBC2179DBC1584849EAB35CE1400FB Giveawayshow
1,666,245,300 *AF512FA59F10B524CFD9B7860523F11AB6B5E7A8 hanspassley
1,666,245,301 *AF59CFA2FE66C382C203E92AAA0FC0336F485680 HARIDASAHIRWAR
1,666,245,302 *AF54549FDD55A6109666729B3FF38D5E2880B189 [email protected]
1,666,245,303 *AF51F24A4E7FA55F03D70C6E7E7F6858C3700E80 docf
1,666,245,304 *AF5BC9E40487614E8D148C6E08FC6851C0CFD8D7 GLENNHOGSED
1,666,245,305 *AF5606D92686631BDD24FF532CAD161CAA277D4B [email protected]
1,666,245,306 *AF58B0B1F5D07D6FE54CECACCA83F43372A604E9 gloomixes
1,666,245,307 *AF58A82B3986B282B93A91AF14BC1B3B6FD6C9AB dolbier0
1,666,245,308 *AF5A077196AFD95071C7ECE8789C9352EC7C84AD GOATCANDY0
1,666,245,309 *AF51A98C50762D6C22827E7706AB982E0B504F23 dominickbennage
1,666,245,310 *AF58108323BA4E019BCB66619F43BE6049070FFC GS)F
1,666,245,311 *AF50392AA29DEE8007C287E51AA0514735E76B5E GUILLERMODIFONZO
1,666,245,312 *AF5F9A1B6482F3FCDF2F59C1E2CE84938B02A008 HCSRYW.1
1,666,245,313 *AF52F858608C6399ABF970D6E653CFC5A4857B61 GPGOL
1,666,245,314 *AF553716D8454F09FDE8A29F7E9E54A441D2F899 heftoren6
1,666,245,315 *AF5C122F32D262A949E4E4B5B3959A76B6400D22 h05bx02
1,666,245,316 *AF5505CEE8EC9C4DECA6E4C7C20B7026268CBB28 HEIMATWERKSTÄTTE
1,666,245,317 *AF5865095453C28C76D4EF118CEB02F461BA355D HAIDBSW6
1,666,245,318 *AF55BEC2E105EB243C1D1781FA6F10BAEDCE6544 GREGORIO.ORLOW
1,666,245,319 *AF5B47C7FC33DB605F45330E95B10FAA9686FA57 hankinsn6
1,666,245,320 *AF5F561384C0CD18C8A0C2FF9CF0BBF7E1AB6013 hermanbandanza
1,666,245,321 *AF5D5917CC50F198C7CEAF11D1941C317B0E6DB8 grieve.gr/i/v
1,666,245,322 *AF53D29D969C8250952B2E24B4982F4CBC31D863 GROOTSPRAKIGER1
1,666,245,323 *AF5C48D621116082EB29E1D3AC6C3FFAD6133B82 HARISSABIC
1,666,245,324 *AF59C94AAD5D84154B83F8B2BAD0D430091FFC7B GRUPOAUSTRAL
1,666,245,325 *AF5ECE095CF22D9B5CF8AF597DA7C9E3FFC5A34D highpc
1,666,245,326 *AF5E7CC165CF4185A200A059E252CC495155FEE2 GUADALUPE.KORBER
1,666,245,327 *AF5145C7E7EF4970D973D6F3D16420A2CB60F176 d$puw
1,666,245,328 *AF5094CECDB513A99909B04724F8589E3488EF08 HIRDETES-1
1,666,245,329 *AF5F7B88113600CA845927606A9287256B3EAD0B hklg
1,666,245,330 *AF56B46F82355FD0C043B1B8F382B6A137719D82 HCSINORI6
1,666,245,331 *AF567E6ACCA8143750EDF9BEE03499B8FCE3745E Head.Blew.Up
1,666,245,332 *AF5D67B7D6FAAF0ABFBF41CE99A4C7BFC87745B3 dsb57
1,666,245,333 *AF52ECA4A30B7CFAC6D37EF0A71B035BEA00B5AB dsx5z
1,666,245,334 *AF5D99351C725B0CD4245B9EB63462BF2BD32780 HAMIZWOT
1,666,245,335 *AF5A72085B24DCFC5A623B33E08CCA818DF84174 HERATIUS
1,666,245,336 *AF5A182A716F3CAD48BB4E9B6AE5731A2F89CE8D DUE:
1,666,245,337 *AF5B725674C02523B8997A28778B733A8CE181BE D.UGT
1,666,245,338 *AF51684720552CE105607644ED132F0B5E79CA4F hinkriegt6
1,666,245,339 *AF562A34F870D9826D1A358F674C8F46862D96D7 HISTORIAGUARDIACIVIL
1,666,245,340 *AF525D841DCED8EC55D922D174120BA6DF8D4D11 hkg
1,666,245,341 *AF59962884E1AE0DB938260162E99813E1E3385A HOMILETI1
1,666,245,342 *AF53AD54A4983D95B48A98EFEEA3A6F061C5F632 [email protected]
1,666,245,343 *AF5740EF768323C88FA9D1F7EF6AEC22671E9915 HELL NO (LEAVE HOME) (FEAT TWISTA)
1,666,245,344 *AF5103A3C75B15EA5E312478F388B76526E94E2F DUUGG
1,666,245,345 *AF5998ECF952FCC88D3F4E9E28383DA05ED009A9 dviq.
1,666,245,346 *AF586B7A9A059A329A00D88CEFA757C07F282309 dwainturkasz
1,666,245,347 *AF54BC7EF33C01E41A63393B3C445F637153CC92 huascaran3
1,666,245,348 *AF523602B08659BDAFBA3765962340BE1265BF17 [email protected]
1,666,245,349 *AF5B06F75CD147FCA02497789EC6E889C5731745 DWLYF
1,666,245,350 *AF538019B1CB1A8873FEEAC8D28FD95F046001DE HETIEGNM
1,666,245,351 *AF57F1A59A7BFE8407D01B99B1771F381DFBE329 HUBERT.BUCHHEIM
1,666,245,352 *AF5409B9C379AEF47078E5352C468F8B7E88E5E0 hfwcemrp80
1,666,245,353 *AF58C105B63E69FCC8B65D04673E4239F71351DB [email protected]
1,666,245,354 *AF571954151F3ACD579E06AF23B2E6B2AFFF3E1F HÎKUMMT
1,666,245,355 *AF5839F303EF9F271C504732F59FF98C1315675F HILARIOMARUSCHAK
1,666,245,356 *AF502315519DF329B4FA43D91BF1F82E3A38FD0D HILARYHAMLIN
1,666,245,357 *AF5CE29CE60DE89792F2FC6DFEC6F2BA4F164611 D$Y#R
1,666,245,358 *AF57DBED15CEE48F7CE3B829BD47D81D4635083F hyp3r7rophyn9
1,666,245,359 *AF5CCF3590BA263C971E6196DDDF1A1B38217183 dzp?-
1,666,245,360 *AF5759DFE18E6A482ADA5AE0839F1903EBE0057C E3563B0FE5C854794BEF8FD739F33445B
1,666,245,361 *AF5705D2729B150542F99EDEDCD023649F600EA5 EA;CR
1,666,245,362 *AF51DA6C9A65688EBB626F65930F1A7BD06D7DBF ICSIROIFING
1,666,245,363 *AF56CD3477E9F1D1E6C20A52389FA820E801F715 IAMKITTEN93
1,666,245,364 *AF5360D8B117C59E1645C3F2CA7B8C4DCE605E42 HOWELL-STAFF
1,666,245,365 *AF5D52D7A0E11823809D39454438D9CD125CCFBD HROSHANI
1,666,245,366 *AF5515D5643399416CB1E4632E0FF6256628CAA5 ECAWB
1,666,245,367 *AF5A312444779B86AE2C99A1B5F5ADB34C1C8A9E ID7782NEW
1,666,245,368 *AF5DF766D81409CFADCC527E4959CE80BC1EDD52 IKKIR.1
1,666,245,369 *AF56D017CC671B20886F50A516B18EDF240B150C [email protected]
1,666,245,370 *AF53E82F53D5942FA6FC5E1947E5F06CD9FB0C4F >IL/<>A/<SREDAEH-POH-YB-POH>-"22E07E#"=FERH-A<
1,666,245,371 *AF51FEF571363B5756EDA71792C57995E796FDEE [email protected]
1,666,245,372 *AF5EA2CC3E09B68D6BFEC477E0DA86762697CDF5 ILLOGICAL.IRONANGELA
1,666,245,373 *AF54C488E92A1457DDC762AFB1CB89E18FBA4DD4 ILOVEBLAHBLAH2010
1,666,245,374 *AF5D972925ABB60B97B2E2DF1189F862D1D7787E IESASUOS0
1,666,245,375 *AF5BFC6639B255D5A5E64812B8703EA2CF15921F EDMUNDONEUENDORF
1,666,245,376 *AF522B98690CF45D44507690AE2D88EC99D4C451 ILUVANTARES92
1,666,245,377 *AF585DF7F0E58D409777BD6A40B283E6874784E1 iluvzhongguo63
1,666,245,378 *AF53E4B3CB210898E70B742C8B35D874E4117F81 efh3f
1,666,245,379 *AF56AC3A9C51D9720B900AA4589AE8CC257C4D86 ilovewin9579
1,666,245,380 *AF5B15E46EF0472277851C7CA0D3941BBF75F195 inkalth
1,666,245,381 *AF5A5819D4B25E9CD725CD1459614408F2D4ADF5 IERENITT8
1,666,245,382 *AF5E7E1CDA02B5E87C99E505DA2AF67B19D0C456 IGNACIO.RITER
1,666,245,383 *AF55450C75156A805C6E009C1168084A590DD8BE [email protected]+I0NSHIPS
1,666,245,384 *AF59AA16913A22EE06E0F5E6FDF167A0CC7DA77A INADMI55ABI1I+Y
1,666,245,385 *AF55EDB0C88E4F2C43B1B5B7059E1C056618D17F EJENDOMSM
1,666,245,386 *AF51354591B1B65250BC40CC1E47237F6FD944E1 irraisons
1,666,245,387 *AF5E3B886C4A7C4C3A6477A5DC0F900D9886509C ILOVEFLOWERPOT
1,666,245,388 *AF56F0DFCAEC20877D5795025324A56B494BA249 incomeless
1,666,245,389 *AF5B50EA90A171D1D332E0B8C8C2557E2D8812AA irvinhippe
1,666,245,390 *AF55DC45A1870F99033DD4E7CEDA50098C539238 INFÎNIZ
1,666,245,391 *AF5E32C45D8200A66CF0B15BE38089AA12BC1D62 ISSACSLOTA
1,666,245,392 *AF50C8073F615F7819E9EC12F98A3C55B1B84FE8 itain'tright(live)
1,666,245,393 *AF553023C0027C301D1DD9204C212F726EF43A26 elliotbeigert
1,666,245,394 *AF52ED4684AFBCB3E8ED42C770943DD910E07300 in loving memory of russell jones (disc 1)
1,666,245,395 *AF5CECA96C19E4DBC7BB3452D0199C6BA7C7389F IVORYMUDDIMAN
1,666,245,396 *AF5A5EF16C3749CDB663C604E85F0BCED8794DC0 ivorynolle
1,666,245,397 *AF5DE7DB04C42B720E85122DAA1F04DB948C35C2 jab,
1,666,245,398 *AF5A033A4DED9966911341D25707C2787684D1CD JACOB.WORST
1,666,245,399 *AF5609E8400B24B4669D4035D09940ACA8EA8C59 [email protected]
1,666,245,400 *AF52B45706E18D7A4CE79D6903AE63F1BC1C18A9 itsererupe
1,666,245,401 *AF5C8A791DBE5DED2163D124B5C95C4B424A3CF2 jakelambson
1,666,245,402 *AF5D275AE1ED19608467B302CE544A21F2904CF6 em57_
1,666,245,403 *AF5A7F166891BF53373AAEDB2A875377B06A7EF6 em9z!
1,666,245,404 *AF5D80B8F1FD6FD116DAB42E4DD92FB566230002 jamarhowie
1,666,245,405 *AF525935164416B46A4A0128AE5ED9C226A56712 JAME.HAW
1,666,245,406 *AF56BC95FC8A2D2AD44A8733F50725E02560C81A isiaheckart
1,666,245,407 *AF5678B4EB780F972EDB72CAC7451B493AE7B6ED isiahlemke
1,666,245,408 *AF5D47F7FB97263EE09201D9F20A2E6C8C6CE35D EMg/
1,666,245,409 *AF5A82EAF8C969D056040E32527C2C5819B3F6EF ISREALBENSON
1,666,245,410 *AF5EEE3B34C37D37BDFBEAA96D81B39114664D38 issacdorough
1,666,245,411 *AF5575797B213E550BF963430521371EE3D6941B [email protected]
1,666,245,412 *AF59EA054B9739CC6402CAB5729647BAEE29A2C0 jaweria0
1,666,245,413 *AF5883BAE96793FC9AA7B81B2135427795785C00 jäämyrskyliitäjä
1,666,245,414 *AF5E5E260FD3DABFAA0F977153355E452BE11D83 EMPORORS9
1,666,245,415 *AF55B33000E59D35A24E9E6C60AA00C6B750114B EN7TV
1,666,245,416 *AF57AD46684F18F987A868388AB9B48397B6D09C JACKIE REHOR
1,666,245,417 *AF53938D160A380DF85F150E59CC84FC30838134 jaimerollison
1,666,245,418 *AF54BD3DB5ED1CBF8A69D4A63B87E6480F8E4574 JEFF.WIECK
1,666,245,419 *AF5BDC546706395FC41F17192081C70F401B83D3 [email protected]
1,666,245,420 *AF51783B66B9DDB7B535A9377749FE1BBD76817A JENTELTJE
1,666,245,421 *AF53C9EFED2AB012FB2BA5BDA099105343F7BA41 jambe
1,666,245,422 *AF5E2CE0F22BD634B6D4B0195336FF9090C14397 ENRIQUE.ALIAS
1,666,245,423 *AF5AA47879191E1045D7C007A2EE57991AB2D4B8 ENRIQUEBRACKENBURY
1,666,245,424 *AF5B9793DFE16DB007CD13F6CD6399F749FFDBDE JAMIN WILCOX
1,666,245,425 *AF5D63D192724660A219875F8B9AD0D27E6CFD0A JANEBUDDY
1,666,245,426 *AF5B8DB1052504BF05269DAD35212771BF92A02C janice04
1,666,245,427 *AF5188EBDBCF15B602E35A98548C66B1AB127D66 jarrodbilliot
1,666,245,428 *AF5B3405F63E327250B9AED9B0985DCB9167D83F JATOM-SPRING
1,666,245,429 *AF563A8C4EB1CB31854B418DDE4B070D250A56CE JIMMIEGLEIM
1,666,245,430 *AF53EF233DFD7206847BF0FF5AD1FD78EA04773B [email protected]
1,666,245,431 *AF54FDCD2D32B0DCA7EBB3CD8A8A73FCFB54A344 EQ7Q2
1,666,245,432 *AF5794C8F419219D29F9CC45D51E9CED5F5FFD18 ERASTIUMING
1,666,245,433 *AF51801885996F881ABFFE73D95695EEFA76937A JCV~
1,666,245,434 *AF57A26ADDE2A39376DC6B4EF9784CA7DAFAAFDF jeandulany
1,666,245,435 *AF531A9E2519311C7063E87E4D1385B4E5B11977 JEAN.GADD
1,666,245,436 *AF5E757B5A18E974D6B5A8268C6239DC0437F65F JAYSON.PHLEGM
1,666,245,437 *AF55376ADD0E92A7A278C58CF1E480B5EC9412C7 ericktouby
1,666,245,438 *AF5C4AB2655A9AA547F960E82BCC5CFBC34D1D7F jazzykindasum'n(spiritofhendrixmix)
1,666,245,439 *AF54F3E1FA796F379F1AAAF212589D2AC97CC698 joaoteles
1,666,245,440 *AF52D340A4E93B280D2C9E6563D88314E0625A87 ERRHEPHORIA.
1,666,245,441 *AF57AFDB736EE353293D7077E86DB77932082AE7 JOEVALERIO
1,666,245,442 *AF547C92B2A595218274ABDA71884FA4F1E153E1 JEFF-WILLHOIT
1,666,245,443 *AF537C8DA628CF3F7E6F6CD72CFA9E276E97A93A JEANREGO
1,666,245,444 *AF596590C96A632601B8F4DE25ED949723F04657 johnjean9
1,666,245,445 *AF50B047AC705C1D6D0E349E68882D4A80F25B20 jennifer-laidler
1,666,245,446 *AF59CA5A3890EC61CA0B5F97FFA4DD68A66CFBDA jeraldeblin
1,666,245,447 *AF5022670D2F9E50800D4BF74342D36796319CAF ESEAKITU6
1,666,245,448 *AF53773A585459B2493B187EA4086613A840A511 jonathan-goosen
1,666,245,449 *AF524EC5410EF10C29EB02E0C22A95C7CD983355 JONATHANMASTEL
1,666,245,450 *AF564D4C730FF9EF24254DEAB3DAD7B9F730098E josephshamblin
1,666,245,451 *AF5C8CA1F7873C87F327705EEDC5D3890BA295AC ETB!G
1,666,245,452 *AF575F4F98CB741A742538ECDDB1BD1B42EDEA0E ETUDE-IN-A-MINOR,-OP25-NO11
1,666,245,453 *AF5491C3C33BE339CA646232F3D56CD049743659 JERRELLLAUTERBACH
1,666,245,454 *AF5FF69159F5B10E6DB3A0BE53847F4979C177D7 eup?
1,666,245,455 *AF53C04F296CD28637D640FD824864D8F47DA8BB [email protected]
1,666,245,456 *AF5799B3612197C81508F79C7BA1E9B7DFDF271C jimmybarnes&rahsaanpatterson
1,666,245,457 *AF5B0DB3CEB1268246265609763D1EC7A57FD736 [email protected]
1,666,245,458 *AF524846AFBEDD05F3F1A6672EF24A13D37CE7A1 JINOSHK
1,666,245,459 *AF507A53F0C7E3E7AC48CE7579DCBFE9F81E37FA [email protected]
1,666,245,460 *AF51C8EB2E7F2F62DD337516E501D6DD8D8E0920 JKYWUVSL13
1,666,245,461 *AF5EF7A2D4C998749F6BAA5299CD96B15C78E15E jmdavis9
1,666,245,462 *AF5E0BB129C3274CA1D0F08C25DB2C1063900620 EYTQJ
1,666,245,463 *AF54199AD755689E133EA5483585ECC36664215F KAHCTLOB
1,666,245,464 *AF575DCAFFB60BC94DCC926AF7642773012E9075 KALKENS8
1,666,245,465 *AF5FA320B4E4340D599DEEA36E45A436D7EE3772 FALCINOED
1,666,245,466 *AF5F9A75FCC2D2ED359D0AA71FCDDB3A68E9DDC3 jonworsley
1,666,245,467 *AF51CB69179D98FD539779893F94867D3FA8F2D5 fanariot3
1,666,245,468 *AF5392BD07C106C5C931251F5EF03125E0534DF3 JOSEGUILLESKATER2HOTMAIL.COM
1,666,245,469 *AF5A890EA16E090B0CD302A3EF3AAFA6ED1834A1 JONATHAN.COBETTO
1,666,245,470 *AF57E4DA6FEFC9FE511D63A23C7345B4BC8873B9 jonbrownley
1,666,245,471 *AF50A6329A23710BDFD71EBD8E2E66352D7095A1 fauzia-ibrahim
1,666,245,472 *AF544BB7C0699A9BBBD45E145C8975198A196168 [email protected]
1,666,245,473 *AF5E193192ABAC746A5F92BAC544F2B906EFE3A8 KELLY-JAMIESON
1,666,245,474 *AF506FB126F706C15FB34DE5755DF3A9B3A7CD78 KELOPÄÄSKYJEN
1,666,245,475 *AF5518292AEB8736577294F699C7E44324F6C0A1 jose-bouzas
1,666,245,476 *AF548ECDF759E67596BC38B60C9743F11119E13B josef-ryan-parco
1,666,245,477 *AF581A047ADBEE4C6D05789230004FB14A2F78C2 [email protected]
1,666,245,478 *AF5AA26BDE1DC7FDE9AB59648B8ADCC25E3B6BAD JOSEPH-BARON-GUNZBURG
1,666,245,479 *AF5AED86CD7283008604976AAC95487A32797195 KEVIN.HASTINGS
1,666,245,480 *AF59925F16C4599084A51FF4E2D9BB8A36B881B5 [email protected]
1,666,245,481 *AF5D262371D76775F8219DC69B9070ED01D44B52 ficeler2
1,666,245,482 *AF5BEF0B75164A27FDD2AE9CFF10D4DE7123CF96 ´JUEGO
1,666,245,483 *AF5E6AB003D9BA6F7D25A51A7D97003E0495A879 JULIOSAZ9
1,666,245,484 *AF59391C6A985540A8E04084D6E3D471B8DD6D68 FIREGOBY
1,666,245,485 *AF5D75E870D2A3346CB6AFEAF4FD8C7DBE269677 koczko
1,666,245,486 *AF5D21FEA959460551E23BF2F4DD5F5905CCB650 FLAMENCO.DE.FLORIDA
1,666,245,487 *AF514BDD4AA6892010C63BDC2AFF8719055B97B3 KORCAALBANIA
1,666,245,488 *AF58E62FD380ADE0D6410F9FF117A8038B92D54A kasokufa's
1,666,245,489 *AF58331E19369260009D8B6ABD793083AA037E84 katrin.bowen
1,666,245,490 *AF5F1E373BC17D29AF135D03F6CD8A9A0DD08FB9 kutnahoryt
1,666,245,491 *AF5A9CBCBA3B2F74AB80CBAB109D6994263A21AD KEHITELL2
1,666,245,492 *AF5443B0E721791A7349FB1BF4560943EB033AFB keisha-crook
1,666,245,493 *AF5B95C547BDBC6BF9F8AA6DC94863AA38173E82 fostermulholland
1,666,245,494 *AF509E3354FA35CEF91E1BC306B45CF0D72B9BD2 KELSEN TUASON
1,666,245,495 *AF591219746B3F1809B4DFF769E4AABA07D0B726 ken-nally
1,666,245,496 *AF5D265D468251E4BFD5136819D4D93C5EF3FB92 KENNETHBERAN
1,666,245,497 *AF562DD399CF5CE50932106B1DA7E779AF96416A keidareli
1,666,245,498 *AF50DCF2E5571792D6066C1C16BA60FC61D7562B KELLEY COVERT
1,666,245,499 *AF5B8DFBD5B062E2459D4C512380C9E559AA062B KENTPESHLAKAI
1,666,245,500 *AF5467A112A4BE3314B9EB3521B527BA693DD3B1 kermitmurai
1,666,245,501 *AF569A11325D145A4177ADAABEEBC7AA369A64E7 KERRYADRIEN
1,666,245,502 *AF594868B701502CB3AB9D9AC8714C9290FACDD4 L0M2
1,666,245,503 *AF5EF02641DEEF2127E33BB9FB94B94441764E16 L#'4
1,666,245,504 *AF59F75B4478AF8A03A301CE9BB4AFBEB4896BCE FRANCOIS-CEVERT-TYRRELL--F-CARJPG
1,666,245,505 *AF54B20B0B95508B6BEFDA214A0163A91C8B20F5 kensage
1,666,245,506 *AF569EBF29B5434F8EB33179000C77F3AA820BD9 [email protected]
1,666,245,507 *AF5AE48E908A3459B5C3838D8973BCDF304BF215 FRANKMALMBERG
1,666,245,508 *AF5DE3DA48F8F2AAC951A0FEE713D5ABC84A7D6D FRED.CANANT
1,666,245,509 *AF5AABB59E84288B5C1A7592F738B399BF79FE12 FREDDUQUETTE
1,666,245,510 *AF57E5771E2D481F63F4B047BA87C305E0CFFD1E [email protected]
1,666,245,511 *AF5B9D88B19529756FCBE4CB64CF80479C6DBC32 LANCEGREENER
1,666,245,512 *AF5653AD47438548CA7E8A6829AE893DFB0BE553 kleenex1950
1,666,245,513 *AF510A5C6C40DA72ADCB9B9CF9A0D01FBBBA2426 Kokerjuffers
1,666,245,514 *AF5B27E63D0548DDF411511A885686C59FB2ADF9 FRITZDUNKERLEY
1,666,245,515 *AF547EF213BDCB7B1633C5BE1CF38E647501AD53 kirbycasillo
1,666,245,516 *AF51CD37F390BCF3EF6BA671B32DBEC78947F350 leoosako
1,666,245,517 *AF53D1119E5EC4474A98AD12B07FF1151CE8F304 LeorytheRedneckReindeer
1,666,245,518 *AF5D5EB041C3BD7155E87AC6CA019D333BA8E02F LESLIE.GARON
1,666,245,519 *AF5EED625FA616147435A1FCF7C857BA55160CAB KS4
1,666,245,520 *AF5DB6C3AC4A70AD6DE0A34B3C3A7D22E58D1371 [email protected]
1,666,245,521 *AF517C56B2143F9EE63D970A56805C1618F713B0 l<faaa
1,666,245,522 *AF5E653DC135C2B52A670D075729AA452DC82521 kyttjlle9
1,666,245,523 *AF54066D403F4A09C1C8B4BA5080C62DC21170AC g3rm13st
1,666,245,524 *AF5A27219E33E2491C3B90AEEBBC95293CD29FFB KOLBY ANDERSON
1,666,245,525 *AF57CE0E7430D454AF7B58D5D7679E04BA49331B gailsoundara
1,666,245,526 *AF5CF8904D5C452BDCE1B9B63611F4081DD1C817 KONTZEJUKO
1,666,245,527 *AF506DCD54E6E689EC4AA5BC59A0D0A23D3DA3C2 GALAPON0
1,666,245,528 *AF54EA163EF51D7CFB71AF0462BE1F218DB0930E KOPHOUT
1,666,245,529 *AF56A91AAFF49D4F5A62AB4765F990639FB626DE korel40
1,666,245,530 *AF59F4E06463C6D56230D2112CC11A82E89699E5 KOURIOKHINE
1,666,245,531 *AF529ED7B9CCA8791D48C4F207B70BB718F531EA kraigfurness
1,666,245,532 *AF5011F52BE58BA42B88D7215ABC6689FD4CC0DA krchrq
1,666,245,533 *AF5E654F3EA700601E8717AC6046C45DAEF3ED07 garlandnorsworthy
1,666,245,534 *AF5EF8C5D01177FA4ECAA212B8C2C86E519424CC GARRETT CASSERLY
1,666,245,535 *AF5E409904311C469F688896521FE33B3F209337 GARRETT.REIFSTECK
1,666,245,536 *AF5201BA9551EF02E7477200CF00E68AF38047BF GARRYKLOHS
1,666,245,537 *AF548EEA1E10F1155D9D4AAB16872340059C9EB3 liran.engelhart
1,666,245,538 *AF59F38AE1EAB0506D1ADA503F82D81B98D3E314 listyens
1,666,245,539 *AF5B4D8CF99704498D6F4B34FFB6FD8D03732670 LIUSHUSU
1,666,245,540 *AF5A6B4473AA1CCE168FD032D44391102A0FB5F8 kristopherheffner
1,666,245,541 *AF509C424B25540CC554F987676B1A428A5793FA KRUCOMONTO
1,666,245,542 *AF5832695195BA4B741988D4F7A1C40AA4745248 leepete3
1,666,245,543 *AF5E9CAC6B92CC13355E4654B7585D16234D6C18 LEGDEN)
1,666,245,544 *AF5743ED637BC1EA73ED56A8902C9838F4E6C58A KTSK
1,666,245,545 *AF5A1515B59890FF300BC24E122292D4ADA3D295 gbboomge01452
1,666,245,546 *AF54082A823459809926F319FE632EB496540481 LEIFCYPERT
1,666,245,547 *AF53B78C3A5D838FEFFE9347CD8D050C208D7885 [email protected]
1,666,245,548 *AF5EA80B22D9C6F8044A2E0BE4FA24C2A173FAC7 LEIFWILLIMON
1,666,245,549 *AF5466749B26232A9AE6F35D41DB45EF668B505B KUPASTUNTAS
1,666,245,550 *AF5BDD0454E6D5C5C5C778DBDE6C6207993947BA [email protected]
1,666,245,551 *AF5BA2FF81A39020DB75CFA2A0DFBAE2D0477272 LORBITE4
1,666,245,552 *AF5E6408DBFE698B8AC0AA0C6BA2416149E4D3B7 lorensingeltary
1,666,245,553 *AF559F51A1886D7638A431AEACDD3F2E61547E7E KWTM2
1,666,245,554 *AF5F2735EF63B43B064DFC0E94BB884B9DA928EF lelynllyn
1,666,245,555 *AF5CEB79FD5EFEA9A99ED7A7AD80390074094A59 L0122314
1,666,245,556 *AF539D1764430145D590732AF56A3C2E5FDB569C GENEBOFINGER
1,666,245,557 *AF53AF18978FC06A91353623420563EBBD10B8F1 LOUIEVILARDO
1,666,245,558 *AF5C461AD88CBD3178E36A88E9207AF11A31B320 L45TR4R3M05
1,666,245,559 *AF525EB930D37652B7E0D4C94998333A17451482 loumctaggart
1,666,245,560 *AF57B19F12D16F6094A35BD406CB9771704A699F LERMA-DAINE-MANAYON
1,666,245,561 *AF59FD5DD376E11830F6DE09CFB86EB60E262FCE GEOFFREY-KELLEY
1,666,245,562 *AF536EC25EEEA2563F04BBEDFB17518C91BA3491 „GEOGRAFICKOU
1,666,245,563 *AF5FE705D1C7535E34057EFB73BDCDB803EC2B9C LUDIUM.XIV.IN.FIS-MOLL,.BWV.859
1,666,245,564 *AF55E5FFA11002346292EC63717D23F9810B3F47 luigiwheelis
1,666,245,565 *AF5DF60415C38D97189DF14427FD7EF6EAEE6C55 LANE.MAWHINNEY
1,666,245,566 *AF5B4D0D63AC5224E1252F08A934FB394EB1A1E9 LUIS.SEEGMILLER
1,666,245,567 *AF53E8E6C687ABB60C32964E684973E5314ABEA6 LUKEPATETE
1,666,245,568 *AF5C4811EAD5FF18A110BE19008932229DB73630 GGI4BBLO0R
1,666,245,569 *AF5A76FD153CD3FDEF0563A1B1F4CC7DB49FF748 life12
1,666,245,570 *AF55738CFE9456DA6D508FC88B7D5AFE57F6009F giladjei
1,666,245,571 *AF5E3BB0E8FD95924944612BE77F4FA17D9DD856 giladzuc
1,666,245,572 *AF595062D2714D91288943B66ABCE9F10947AAEA lw,y
1,666,245,573 *AF5F44D572E102CAF015C02E4EA69D7839120D08 LA TRAVIATA, ACT II, SCENE II: DI MADRIDE NOI SIAM MATTADORI
1,666,245,574 *AF55F6856EEE2C95C9189F819FAD3BEBBF7A4932 M510139200
1,666,245,575 *AF5C56C4E8C28CA533C75F4233822A422195DE14 GISSELLE469
1,666,245,576 *AF549A0BDF75717865D30A2E69C2BEB3B9A48846 [email protected]
1,666,245,577 *AF54D9544659F579936F50DFE966E194B7A5ECD6 LINUXFUN3
1,666,245,578 *AF519DC3A44B8057A9ADECC7FD6E3293E88E5431 mahathir-bin-mohamad
1,666,245,579 *AF5480212ECE83117689AA4423A7FE0F66D4C3C6 lizecita
1,666,245,580 *AF511852283F9D3918630D80966D5D31DB2819CB LKRMU
1,666,245,581 *AF522559D34F56331D535BF4ECB8F305EA94F420 GONFIAMMO8
1,666,245,582 *AF5EB99D7CD1A8E7A4831E62D87C983B83AE8676 malcolmpeyre
1,666,245,583 *AF5D9208A5A521EC3EDF655E40EF6C346FFFB78F GORDONCONSUELO
1,666,245,584 *AF5A2058117405E7A9E219ADCBC3AE3E82568DE1 MAMA(CHOIRACCAPELLA)
1,666,245,585 *AF593493500B0D8A08681CEF5F7E9C8746703C58 manatite
1,666,245,586 *AF5BCBFADC427617ACA2A9673101EC25E54C3945 GRANVILLE.SERO
1,666,245,587 *AF50C180A28DF88E5A5B93BB05AA9AC53F373DFB GRAPTOSED
1,666,245,588 *AF59D48F67678F61A575C8874C57EE8E754DFC94 LESERIE7
1,666,245,589 *AF5B4FCCDF5CC024BB36F3BC4418196DE94C85DE GRECANOS5
1,666,245,590 *AF5051513710DD7D47D066B5D1FD9D8C1DF4A631 LES.POMPEY
1,666,245,591 *AF50D7F39319D21C4A3F554441797151FF90C580 marcellusmacarthur
1,666,245,592 *AF55E3BFB613169A403DB71EC6FA7CDBDAD89CF8 MARCELMCCALLY
1,666,245,593 *AF520BDF6032EE927CC5181D9078137BA951F800 MARCIA-MCTAVISH
1,666,245,594 *AF5D978F6F77AB41DAB478F75958C7B125FDF0A5 Love&War(feat.Chiara)
1,666,245,595 *AF5C406A11D39522EC45E652402FD59ADC433BB0 LEWIS.DINI
1,666,245,596 *AF50B35BA098E15BAEAF86CA0FD9C21BE7266B92 GROVER.HOBART
1,666,245,597 *AF520639D2B47BE5A4976CA570E29297FCACDBDB MARGARITO.TERELL
1,666,245,598 *AF5AE621864A063A091E0228C63CBFFFE5E2ABA1 lhq6
1,666,245,599 *AF50EFFA89AD04466791DFA3C3C8BA5C4D373150 [email protected]
1,666,245,600 *AF51D6CEF27E4892D77F7F7C455F08D3B806DE75 LUCASLOVELACE
1,666,245,601 *AF58034E385A2BAE0668940270458DA0848F1452 MARIA MATH
1,666,245,602 *AF56ECFC09D054D1CB26AC94EE00B0F319708B29 mariamwakeel
1,666,245,603 *AF5FEE5AB52066AF5BC4427101A3E4DD9FC91EBE MARIIFERT
1,666,245,604 *AF5EFAD14A58E3401628465D4763EECECAD58427 MARILU1826
1,666,245,605 *AF531EB004D90E47DFEA1435BEC28094458CB6EE mariokosuta
1,666,245,606 *AF51559D03F49E624620B9955E2DC4C49CCAA097 LUISJANEY
1,666,245,607 *AF5C792520AC777C84B57511A506607AF6B761C0 LUISPEDIGO
1,666,245,608 *AF5D47FEEA8568EACCCC08E057072A9448588AAE GULNBBET9
1,666,245,609 *AF523AD1A28F6C2B0B2C4E0E6907F0F621AC6CEF MARKHEMINGWAY
1,666,245,610 *AF525A42FAA2023DEBCB875B0F6E99F8DECDA33B [email protected]
1,666,245,611 *AF58E2108FAB9F0A4AB7A30DCCAF0294EC9830E2 MARKSAMANIEGO
1,666,245,612 *AF54B6EFB5CA525CBF298AA259A74257A8C8DD83 GUSLECHEL
1,666,245,613 *AF53A4A10297ADE6F21164C81E97E09A6AA144C0 MARTHADAVIES
1,666,245,614 *AF50A083D2E47BEF73934C4F0CB677813FCB6855 GU~Y
1,666,245,615 *AF59D63F7A2959D642AA314EC35EF1BD61C719AC lylefurino
1,666,245,616 *AF59E4EA54BD6A306CFDC910BD6FC431A9E1AB52 lynnluscavage
1,666,245,617 *AF5C4451507E9F0E38542DD9211FF9D9BEBC03F2 [email protected]
1,666,245,618 *AF54593D44DB48F3C5F7271C206E1820CC2C2741 linwoodstred
1,666,245,619 *AF5623E3CDB104DC038C1264382DCD34A885F30B [email protected]
1,666,245,620 *AF589C60C1618577CB365670CE6734415AF65850 MARTIN.CAROTENUTO
1,666,245,621 *AF5430BEE759903B420CC83DA6F1352295E1F296 MARTIN.KOSCHO
1,666,245,622 *AF5B8840D09EB5D3DCEB9B05C7B2745BFD3FB60F maccus8
1,666,245,623 *AF57697487D44D230B3FB9B35AD1A5C1814F5A51 LLCW
1,666,245,624 *AF5843E83A9F354651768AA28C39F3DAF155DF64 [email protected]
1,666,245,625 *AF50681AD52952EBCC90EAC23FB2A2E6108C53DA LOGAN.MODENA
1,666,245,626 *AF5E0DC21EA3BFF01DBF9E524CABC67636F2DE9C LOGIKIMA0
1,666,245,627 *AF5A76C2D95CBCC855453890EF505A053BF75B8D lo-mejor-de-reggaespa
1,666,245,628 *AF5A1ACD2418E927FAA97932794E915C6C442199 HARMONIA
1,666,245,629 *AF5A7941AB56A919E6A05446B0D724D839C32C1D mamillius ay,mygoodlord
1,666,245,630 *AF5CCC67904BF2D1C6499D4B1EA6E8ECADB0AA0F mankened
1,666,245,631 *AF55B90131112641385D1BADC012F74644DBBD76 LOUIESLATKIN
1,666,245,632 *AF552C40F30D823C3D0CD5693589A6B2A186DD31 manualverhey
1,666,245,633 *AF5294FCF9E6846CD3DB2595CDF1FF4F1225D323 harry.potter.and.the.order.of.the.phoenix.(videogame)
1,666,245,634 *AF55227D33B1C1678BB83982B6402FDD341AACA6 [email protected]
1,666,245,635 *AF5395C1C3AFE61041F5BF6B0AD9E46D2880A839 HASSAN.SCHEMMEL
1,666,245,636 *AF5DC1E297039882C81E9E32B63C1E94C7C38128 MARCUSESCOE
1,666,245,637 *AF556B7007B22E120560AC981210C7DAF062C0A1 [email protected]
1,666,245,638 *AF526C82560E7D72022D8C63239F5DAEDBF2B0DD [email protected]
1,666,245,639 *AF5E25AEEDDA93325C6C7D15C3038CE7140051AC LUCIANO.PARADISE
1,666,245,640 *AF586F2D0B3BEBB4C85767A3A33B97FB585FA169 LUCIUS.MUMMEY
1,666,245,641 *AF54C814D792F55A1DA373AA2A24DCC0DAF67284 marininaed
1,666,245,642 *AF50A6C10C03D1823712391EB59D15CD4D61B716 MEDESTANDERS1234
1,666,245,643 *AF5E513DFCAAAB4C1156EB92650490D94960C17F LUIMOG
1,666,245,644 *AF59DF4766D03682BECD5938F12E5897737928EC MEDLEY:-BIG-JOHN-/-HANOI-ANNOYS-ME-/-THE-INNOCENT
1,666,245,645 *AF59DEC8945A78F7F364A9D1399140B4B3EC8947 married.->.[marry]
1,666,245,646 *AF5666554DCF246001D065A16503CDD10A93D3A4 mela1990
1,666,245,647 *AF54065AADD41DA9B9347E38F90104A57B828AA2 MELANIEE
1,666,245,648 *AF5ECA32FAE59E326B36B85408D928F42A9BDE49 MELVIN.FOSSELMAN
1,666,245,649 *AF5678651F5291FBD1528BB73D79C74085959C83 MARY-GRACE-CANADA
1,666,245,650 *AF535AEA30881EE543E73C0F7B1664D044497FA0 HELLASDF3
1,666,245,651 *AF5F6D1E79BD06F9456DEB4971378187282888B2 herfez
1,666,245,652 *AF5BA0E6E67EEEDAF8170C37B97F521A0E386A4A MATTENE
1,666,245,653 *AF5B8D7A393DA756447E326354599F52301D0194 HERVORWÜRGEN
1,666,245,654 *AF5FA8F69DC24E6C98994BB31D98407905AEB65C HEYOM
1,666,245,655 *AF584BD78EC4B6DB7D26CCD10FD1FE294F80196F MAURICIORIGHETTI
1,666,245,656 *AF53E83BF75686986FF9CB483D734A5F129A8E83 MACKJUN
1,666,245,657 *AF571965C54EB1AF56D1D858B2F1B091A1308637 [email protected]
1,666,245,658 *AF5AB0F20429909108A1E124F48B591EA80D85C9 インドのMADHUKAR
1,666,245,659 *AF5B3F36909B1319CCE64B18C5334548C605FF41 hilaryy
1,666,245,660 *AF5833E23121B5397416F5514CF771906F07BE26 MICHEL.PASCAL
1,666,245,661 *AF56A13F8B37A7459E1ADB4F65B56E8EBCC45EF6 MAHIYAD
1,666,245,662 *AF5F80A66125345DCEDE8623AC395702445A21DA HIRSIERU1
1,666,245,663 *AF573FF8D99A4496EDE42B51CEF952ACC25725CC MAKE-THEM-BELIEVE
1,666,245,664 *AF5A20FECBB78CBE33BC417C8D379E085F61EA9E milanorrico
1,666,245,665 *AF5BC1FAA472C507F48FE7518C3F683D38392212 MALCOMMELLGREN
1,666,245,666 *AF55261D03BF5CC0717F2A127B737F5308BAAD8C HOBOKIN
1,666,245,667 *AF5CFF2ED9798A678569704A76EC53CCB0F11180 MISAMISNON
1,666,245,668 *AF5859DDD1C9D8174812350444ABEA682187EC2B MITZUMORI
1,666,245,669 *AF580074DB5F42F70E5286F12B10937E0E622C0B MELVINCRITCHFIELD
1,666,245,670 *AF5B2744F0B8A41FBC627B807FD4697FAFBB5F5F MMWITAMUNGA
1,666,245,671 *AF5B83957DA06D8487241DAD3382C0AAB32EF359 HOMOLOGENE1601219
1,666,245,672 *AF5F38676B5AAEDAD5BC0748EA2661CE83CDA840 MODERATE.MRDTHREE
1,666,245,673 *AF556F8783EF1E95B462D2B50EFA6C4630537409 MODESTO.FRIEDT
1,666,245,674 *AF5EF4442715AB65EA94432EA915D97AD7B1B19B MAORILANDER?
1,666,245,675 *AF57D066F4053B6F6ED1CA34ADA9B9D84B64046C horacebooe
1,666,245,676 *AF50DFD5A6B24F767560AE5E43A9492D5C09D697 MOKHTAR MOHAMMED
1,666,245,677 *AF5218960DCF1231BD9303DBC5E9884791A0A444 [email protected]
1,666,245,678 *AF5C8BA6ECE545CB9F7DBBBE2BEFE506746CECB6 [email protected]
1,666,245,679 *AF52053599DE724BF9553F17F8455659B8D39023 HOWARDHOEGERL
1,666,245,680 *AF5F5B07C48175784CA549A04BB220C192474C19 HOWARDMOUTOUX
1,666,245,681 *AF5FB8A41E41E02FF2FA3D3D7F36B1C6C86B9773 moonspell456
1,666,245,682 *AF561AB554E7E3CC2BD15CA69FAD37551CBA032A HQ!&
1,666,245,683 *AF577B1FCE748A7ADFAE73B0F62D968ED0265F5D MARK.NEMET
1,666,245,684 *AF5D41A0F068803A2231F642CDBEF72DAEEC88EB MOSHENAHL
1,666,245,685 *AF5572B935D686744985C40EE35AE28D8100E8A6 MICHEALBUZBY
1,666,245,686 *AF57B058D783347710E2AD5AADADCB497C228C7F [email protected]
1,666,245,687 *AF59D62AC923345C643C7CA27968FAF76BC547CB MARLEAH!
1,666,245,688 *AF563A7D6CA0AB923CB10F9D50D967753F3F9DA7 MRFHCNRB
1,666,245,689 *AF5A49637DC9CCE33DCC5EABDEE566EF72ED67A3 HTTPLANCASHIRELEAGUE
1,666,245,690 *AF53EE629F3472B0575AF351E59FE9839DD79777 HTTPWWWCMPESOREGUA
1,666,245,691 *AF50E9A581ADE97142784E5AC85AD76C985D088C HTTPWWWPROPUESTASR
1,666,245,692 *AF511ADFCEFFA92D3566CF15F551CC40D0BD1BA4 mike-dudziak
1,666,245,693 *AF5E968122AA95855A96D01999B4050114F50975 [email protected]
1,666,245,694 *AF56FA9BD05D3A3766F282FEE10672AC61BF6BA1 MWUXNFY74
1,666,245,695 *AF56D32AACF860F7E47A2F132C559B8661F7CBC7 minhliley
1,666,245,696 *AF58DFA7742DF9456C421CF75A3FF4A21E6EE5AB MAST01DS
1,666,245,697 *AF58C2D3B8B5B17453A661E18700FA9171828401 [email protected]
1,666,245,698 *AF51884AA17C0B456BDCEA4554B07FA7ED3ADC02 matt.mandery
1,666,245,699 *AF51CDAA81E6472B7CCF9131FA3ADC2119FA7CE1 MATT.OKADA
1,666,245,700 *AF5643E3E00278E96577045E09D4447B220C7B84 MYRONWISK
1,666,245,701 *AF53C2890C2881A6F3754BD823A4EFADCD9EC93A MissainH-Moll,BWV232:IIIgAria(Basso)"EtinSpiritumSanctum"
1,666,245,702 *AF565674B031F214375D843F085F9D1E2787E596 MITCH.FOX
1,666,245,703 *AF5F41661E3057D279A9072FB9B536D5240D25F9 [email protected]
1,666,245,704 *AF57B6B7296750B2D946FAF8689188F3200DB12F MKASERMAN
1,666,245,705 *AF5AC25D057E32C4125008011A6F6AC8E58DA347 [email protected]
1,666,245,706 *AF5BC50C92AF30AE855799FA8A3A33972C482927 nady55
1,666,245,707 *AF5AE19845330E03CF1EFC7DD0D1ABA8E0B6795A MOHAMED.JIRON
1,666,245,708 *AF58394B7536170E5336A023B5D49BDEFD2FCDAD meaningful1
1,666,245,709 *AF516284A7F2DB9BF20984BD0FAA00CD0C3834C0 icebelling
1,666,245,710 *AF517742E2590D69FDE8CA1F5824FE2E33CA6C0E IDENTIFIERIONS3
1,666,245,711 *AF530BEE03E147989FC0C333C9843F5867C91A46 NAZAPRIAHNU
1,666,245,712 *AF5F434E356AE9656FF3E6E51C06D8F0FF3AB50F MERCY.CREEK
1,666,245,713 *AF5F4FF4DC39D469D92C6DB9891A61C8D16CC955 NEAL BLAND
1,666,245,714 *AF546F4BC14B78BAAAB2E6DA96B3E71E39A42FA2 NEALGOLDSMITH.COMWWW
1,666,245,715 *AF50C4204B70E6D8ABAEAF1996D8A51B22AA75A4 MOSECURRIN
1,666,245,716 *AF5F1103E56010718E382A192D7580FDEF8BDCB4 mh1288
1,666,245,717 *AF5311B82D85BD133EBF32E4E88EFD6C3C8B2E13 ILOVEKIDS777
1,666,245,718 *AF56B861288D9FAA5954B688AD4F9538E5B16145 MUHASSEN
1,666,245,719 *AF5435A4FE1F10F895C38E6A2B24918310FAD033 MULTI-PLATINO
1,666,245,720 *AF5B855A8749FA5105443950EDA88B56F0887914 MYLINDA90
1,666,245,721 *AF5F19643712F992EC6782B1C2E9D4BB48F0A234 NO.19INEFLATMAJOR
1,666,245,722 *AF553CC66E3975EFDAEED834BC8F3C626AF5D61E MIKROPOROJ
1,666,245,723 *AF535D53B8EF3231A6BB4136A0D3A491525514B8 nabridnytbsw
1,666,245,724 *AF515BC960631F8F02BCACDF6B96727C10C2D3E9 NACHTUREN
1,666,245,725 *AF5F538FBA2D454B4CC4AFB5618792C4FA74C44D NADŽAFOBOD
1,666,245,726 *AF52428F40EF0570CA6378B2E1145ABB6C82E06C IMAGEWAEC
1,666,245,727 *AF5356541CF06A79D1C069EFD4CF75B89C9609FB NAGYRÉSZÜKET
1,666,245,728 *AF51B83127A44E972BA433574118F3A036B6E88C MILLARD.ALFANDRE
1,666,245,729 *AF5405247B5798D9648D8E17FBF1CCB53021C533 NAJRUSNA
1,666,245,730 *AF5283B8952CA7A2E97089141450481CF41659DD [email protected]
1,666,245,731 *AF595FFE62C8774DACA1AEE358D6D10DFB2B9794 naprogramov
1,666,245,732 *AF52E68FA6526EBF4A14C2A8E0C8E50864C7274F mis4n7hr0pic411y
1,666,245,733 *AF58985631649F9B521845B4AD7E3CA9EB3F92A9 n(p_
1,666,245,734 *AF5F32FBE8CCC15CF928BF840E8E312642764BF7 [email protected]
1,666,245,735 *AF546A5D4750D9DF1E5A180FCAEEF7A748DFDB85 MM7<
1,666,245,736 *AF5D745348D412539FFFF44E32F96827AEEDE5C6 MMARTAS
1,666,245,737 *AF549B083F06E9E83A5565AD8A7834DAA14F7DC0 MNBAWEQX1CWARCTY66
1,666,245,738 *AF56BCF0672F93D149BA5D9D0500A14BFB6C96E8 NEJMP078055
1,666,245,739 *AF598BF1AFCC84B98B4CED1D44A17F129B6AA9EA MOHAMMAD.FOGUS
1,666,245,740 *AF50D406B672B23256AB41EA2390536995930827 INTATALO8
1,666,245,741 *AF5605C1373488DEF10B64D36A5A076268DA40C4 [email protected]
1,666,245,742 *AF54AB71625DF1D643FBB83F2081C92D13A0CB59 NETARVNIED
1,666,245,743 *AF57D308369B6C51437221160882214BB3A21B36 NETWORKCITYDARTMOUTH
1,666,245,744 *AF52CB2357B7C58F10A27C57CD1A879DBF4377B5 (O_-)~`~`(----8
1,666,245,745 *AF558376F348EBC91F56D39A2BB84217D24D803D inuenter1
1,666,245,746 *AF5CB8B9667430770DC563EC82B783E85E6D7AF9 new28mommy
1,666,245,747 *AF5726607DB94418D5BECEB2CD19462C49F36EF9 ODCSOPSING
1,666,245,748 *AF5BA082AE2791188EB2A2DDE7B6020684318077 ODELL.YERKE
1,666,245,749 *AF502CC7AFF27EAEC3D4BD48894EFEAE88AB33F5 nidanihgovwww
1,666,245,750 *AF5A1FBFE153643CA059FC5745B53A49CC011AD6 oiler123
1,666,245,751 *AF5CBC522FBCA6B32B99C10BB7C037EDA4C17730 OMERPIERINI
1,666,245,752 *AF5532024FDB927915AF00C3893188AD081D92AA NOELCUNITNA
1,666,245,753 *AF5D9F4F7340E963441ED8AEDA3D7099A2AF16F0 nomatterwhat(vipmix)
1,666,245,754 *AF57D8DB786A0FEDE766504407B590721FF5016F OOTAKAT
1,666,245,755 *AF5860566C31E6C23302438CE35EF509FED3F48C OOTIKUT7
1,666,245,756 *AF540FD08EFFBF80772C19B7FC6691D7B1EF3C34 Orquesta.Narv
1,666,245,757 *AF5B6667BE2989E15E7C2CD767FA3B22899E9E53 ISNAAA
1,666,245,758 *AF52C83E21B05C39DF110010B2F24C5BE88E03D5 „osterveerd“
1,666,245,759 *AF54CA77677CAA68C82F76690CFA0F9C3AB19004 MSLOTENE
1,666,245,760 *AF576BA2D3B0BA897FA00AE8EB04E4E32ED15C82 overigens7
1,666,245,761 *AF543DCCF28613C5E9817F1D4299AFD2847FD8E3 ovoliku7
1,666,245,762 *AF52B2127E2B298A12C22E98E4F5597E18A6F904 OCTAVIODEPAUW
1,666,245,763 *AF50499AC728F86FF5FC7D21EC0FF83A486F2CA6 OCTAVIODUFORT
1,666,245,764 *AF56EFF3155F83A422FF2814C0B8DEA0D0F58F92 PACHTERSHOLDING
1,666,245,765 *AF5D8D2EEC1A35DA9287EAEB10F7888907BC5ED9 MYCOLD,COLDHEARTISMELTEDNOW
1,666,245,766 *AF59543240D936F9509CB142E7444964FD193795 painternewyork
1,666,245,767 *AF590F1B01061D9AB0B86D28A91F0B77DCD2CCE7 MYPAROL0
1,666,245,768 *AF598A716A1BCCC8333152BE5E029C3B01B167C0 PARABOLASHAPED
1,666,245,769 *AF51D44AE095FFCF507CE5AD512E1C07BE1AE061 jangsenato
1,666,245,770 *AF546802E8AD0D19B81C9CB36CB8C4AB2089C3B2 naarheden
1,666,245,771 *AF52E9002B6D235C50A3A1A3895E8C414735116A JARRETTCONDELLO
1,666,245,772 *AF5245EF5AB0BFBB563CB505E28B9D9C625EFC48 patwary5
1,666,245,773 *AF5616766CE10F02626E64D0155EFA572DF26407 NAMENSVERWECHLUNGSACCOUNT
1,666,245,774 *AF5D20299934EF6F77D9576CB5358349CF248EE1 jarrodhurdle
1,666,245,775 *AF5E6ABF8C856CC145A77EFEDE60741C509CCA36 (>-<)O~-O~-Q=P
1,666,245,776 *AF5C3277CAF193452DC6ED4DAF9929466B1DDA62 P-BIHAR
1,666,245,777 *AF5180891663F04F99AD64C25FFC2C4DB7039C5E ORCHIOPLASTYING
1,666,245,778 *AF5C94981656ED9CBB17BD14BFAB13914FC604A9 [email protected]
1,666,245,779 *AF56146E5C8156DFEE5B44627EC6D9D0E57717F8 peloc
1,666,245,780 *AF51CB549ED82BB026E156E5EBBB19C32B9A96AA jazzak
1,666,245,781 *AF5BFA52C9E75A7596D59B2A2705FE59DBE67474 OSCARMD8
1,666,245,782 *AF571B957C7F731B2D02B959A122E8BC7AFFDBC8 OTHAVILARO
1,666,245,783 *AF5002B82A315C02AF9333BAF6A9AA52BC9BF150 OUTHAVALY
1,666,245,784 *AF51B65AF97CAF5EED3CE29E1657B40F76AD752F OUTRIVALLING5
1,666,245,785 *AF5E113429CA0FF0D1722EEB72023E1DD6E79C3A negentigste
1,666,245,786 *AF5727DFFE9574D7A72AC82AB48002927A0AE0EF p^3
1,666,245,787 *AF5FE388C8952BA220657FEE126A119EAC4D8CF1 PACKED.IN
1,666,245,788 *AF5AB71D9E66E09A771C742513EDA9E1405AADA2 PHOSPHORISMING
1,666,245,789 *AF5E1EC1E630535ECFEB9459AA4D1AB2184CCC71 nettiperep
1,666,245,790 *AF57F9CD0ADC114D08673E02CAEFDF7C44CEACF5 pi10sebac
1,666,245,791 *AF5D94756824D2A1E6A2AA873CD65DCB1A0C940E NICHOLASOBERT
1,666,245,792 *AF5F6E87B8C87925A1F4A5594A41BF82CA5F5CB6 palazuelosdelasierra
1,666,245,793 *AF5E9D1435452484D8A4B56A226F8B52F7D5E3C2 PLAY.THE.GAMES.VOL.3..DARK.PROJECT..DE
1,666,245,794 *AF50D7D1E639E643661F863FD50E18E4E8EDB67F JG9J
1,666,245,795 *AF5D7F3CC1D52D0C3387AF168E70C2D2457FF54D [email protected]
1,666,245,796 *AF5917741CCE405BC6CC6C1353A081B82E27A959 [email protected]
1,666,245,797 *AF53F51B9E1542833436D2C01A76829A7A055E07 PARIS.DOBLER
1,666,245,798 *AF5EDAB86AF2F94705125A2DEFF6DBA4E9CB1E46 polymeride4
1,666,245,799 *AF5F25E6A7EA9FF942AA8618512F9A082512C54F patriciaforsberg
1,666,245,800 *AF5143CAEA28B589684F9AFECE73132F6877F8FF PORTABOQUE1234
1,666,245,801 *AF5F8115F975DABA215E41E5B5AAF69DDCC87C9D poverty2010istanbulorgwww
1,666,245,802 *AF53877B6BA70ACB8BB9B1D95F056F8D1C32256C PD*(0_<)
1,666,245,803 *AF5074B8D6B1E67E3AF2F9DCEA46493E8AC8606B peanutbutterthepanda
1,666,245,804 *AF5A090D7576D174BAA024CE561AC99C38BA7D43 PR3F4BRC4T35
1,666,245,805 *AF5BCDF39AB693C2B0B64C24EC2CC69B2AA0B55C philip-hawker
1,666,245,806 *AF5F0B0235DA6D1CEF5F42016C67FBDC623CA3EE pseudocourteous5
1,666,245,807 *AF5859A028BF830C5699264E5C255AFA54C4C991 JOSH FERRIER
1,666,245,808 *AF575EA93EF8F91C2A47652C4747E0D1EF0AB29A pyskové
1,666,245,809 *AF5355315C9CF3880B9B015E12D672D3471D01FC QINNBJH3
1,666,245,810 *AF59FF259AA7F0F75D424A02F6F28172C464AE80 ocaunavs
1,666,245,811 *AF5377A4C2A6C1D04FCB51EB6666217A92B21DF0 Q-P~~~3B<-
1,666,245,812 *AF5E1A636B181851AAF470A2C8DB0D5438CF5328 POLKRITZ
1,666,245,813 *AF55747339A36D5747E99BA5DC5CE562099BB42E [email protected]
1,666,245,814 *AF5970D7D94D6AEB62FCF652E7707334292A2492 QUINGGUO0
1,666,245,815 *AF5EC79F0352489A1C00E98BCC74BBD37D79E159 OFFERS
1,666,245,816 *AF58FA62829B36F3028D90B2D0AD32A6DE54BBE6 QUINTON.ROPPOLO
1,666,245,817 *AF571D31AC1CF930C12F5B18686EA41C5F63DC69 JUSTINELOUGHLIN
1,666,245,818 *AF5D37DD97423B21BB6C52A1F1471F410EB747DA PORTER.PROCACCINI
1,666,245,819 *AF5B3D181AEFF06A25DA9AF21A2A8301D33C4591 R38UFF3D
1,666,245,820 *AF59DB1DE4474D8C96AAB8206B0A8261E8167F17 racismandsciencefictionpostedonthenyrsfsite
1,666,245,821 *AF51B0D416217ADC875390B8335C6AF060EBD038 P==P~O SPLOIT
1,666,245,822 *AF587C157193517E1DC515E3692CFD4A9AF53F2F RASPRILLA
1,666,245,823 *AF51C718766BE697750F81AB17413E73C483B6F9 printm198
1,666,245,824 *AF52A765B9C11B72C7F807CE4B60E783D6FBB47B READERLORRAINES
1,666,245,825 *AF5CE5C41B01D6A99ACEEEAB534FD4520E115EA2 PROPHBEE
1,666,245,826 *AF5D0FF2782534CB371ADE7ECE8E6098AC752645 [email protected]
1,666,245,827 *AF50B70D272F0DABC3B129840DAEF3945474FE5F ; 'O' = ONOTiCE FLAG: RESULTS ARE PROPAGATED iN ONOTiCES.
1,666,245,828 *AF53A05751BDE9F69477F86D24F5672AF87E8CC1 pt351
1,666,245,829 *AF547893DDAEA413546F37DE0121DBFEA4EFBB0E REEDVIRRUETA
1,666,245,830 *AF50DD12A5CB275E6EF8CCCFC726AC1CED94434E opdoekte1
1,666,245,831 *AF55F74D10EFF640F41EEAEFAADA71FC7578B3E8 OPERATIONBIM
1,666,245,832 *AF548BB8B95C06D92200521A98444153E09E5ADD rëi
1,666,245,833 *AF5A410E9752A61FCD0793A169F862BF9D85800A q81v
1,666,245,834 *AF513D9E9D0835621B9DC5CCABF41541AF8A0B75 q=b ~0 }8{
1,666,245,835 *AF51D0C7610605F904D64EC0A3256DB65A1A2678 RENALDO.PERRISH
1,666,245,836 *AF5AD7EF1212345F3BBD6C0A4F62D03EDB81189D KEIHÄÄNKÄRJISSÄ
1,666,245,837 *AF50ED4A0485F4152B4AE56470FE8FDB464F4838 RENHSUK0
1,666,245,838 *AF5A156BB23CC77491E47EEADA5C61C319285205 orthographique
1,666,245,839 *AF55951027BE487F4A5F64CC8404C3D29F4FD3DE OSAMASHARIFEH
1,666,245,840 *AF51675AFEEA69DBF49915A54F7BF39C8219DC5F [email protected]~o(>-<)
1,666,245,841 *AF5C9729BF58CA9FB5A7506D8C1D403CCFA4E04E RESEARCHTEACHER6
1,666,245,842 *AF5454C62BC83D43013A4A2FF784E02194B86F6D $OUND$TI
1,666,245,843 *AF5FE16879B7D72914E03D2AA467B4CA6F1E062C KEN-CHITWOOD
1,666,245,844 *AF56136F2F422136C7D4EB6914DFE1A86C0E2D6A Q---->-*-*-*SPLAT
1,666,245,845 *AF5759685032F0D62E8ECB9A5C4FB16C8217714E KENNETH.BERNICK
1,666,245,846 *AF5146FB8FF3DA22993FA6FEA5E2143F5E577573 QUEENOFTHEAPOSTLES
1,666,245,847 *AF54C4CDB65717EBF768F2982D2A7CE838DD4676 KENNITHRULEMAN
1,666,245,848 *AF51DDED403641207D996ABDA8C68B990CF476CA KENTONMAIELLO
1,666,245,849 *AF57C9B4ABCAC987903CED7DDEF7F69514BDC6EA "QuiT"FQuiT_MWM
1,666,245,850 *AF5CC9B5BDDA563DD2C6D9BA6C2771E466C9F15E p===)`(>-<)
1,666,245,851 *AF5C7245D3B934E80049832B6DFD34E624B2D7C7 [email protected]
1,666,245,852 *AF5B61A69AD72458717A097223B78D5F0F777F42 rhershey9
1,666,245,853 *AF58C23EEAF09B9D0FFA74A8C57991F1FC517F05 rabia.majeed
1,666,245,854 *AF5B58E39BB400FEBF6CF91FB660CBCEA3EA847B [email protected]
1,666,245,855 *AF5ACEE2F1CAF83504A35128B101192589815076 PACELAWFIRM
1,666,245,856 *AF57AF31566ED7C8D5B8C9D2A8BF5A90888EA4F4 RALEIGHPITARRESI
1,666,245,857 *AF59CB339827D74AA011E05E0446D043CF6515A6 richiejordison
1,666,245,858 *AF515E2A106B40427EE392100F82C4C1D92ADE5D ralphcristy
1,666,245,859 *AF520522373FE7B3418AF3FA451F78E39448FD5D kimisha.west
1,666,245,860 *AF54084F2A3BEE954F6A461B440D636DB5B441C4 RANDA SHABAN
1,666,245,861 *AF598A298CC314634DBBA5AF171FA5B26DDC2DC2 RANDELL.LORENTE
1,666,245,862 *AF5008170E8D646954D1CBA5E0378999ECB44B8C RICKY.OMO
1,666,245,863 *AF596E9E5A20896D3A5EF3C93BACDD0D5E31371B [email protected]
1,666,245,864 *AF54E52919AE40A683EAE457FAEEF5D0DCADE69A <p>application programming interface
1,666,245,865 *AF53443C13E396D1B5B58ACAA98F450EA41F600E RIJSTROOM
1,666,245,866 *AF543BC91006E4513ED400515515E6C0B8EDD0B5 KIRSTY SWANN
1,666,245,867 *AF5504B0E57C05A18FA0D0A80C2771292BFF8DA2 kittenkaboodle
1,666,245,868 *AF5664F011540149DF6CDE66CD17F122DF618D89 reedt5
1,666,245,869 *AF552A9ACCD061BD5323BE32782E5FA96640799D PAULA RECIO
1,666,245,870 *AF5F8DEE5475A1B7B3838D7311888C30A50A533F koldunow
1,666,245,871 *AF5CEBD26B5F18778AE1051DE7FD018D13449585 ROLAND.VOON
1,666,245,872 *AF597C424B8E33DACE09459FDDFD35F882B0F509 REFKAVKA2002
1,666,245,873 *AF5F4DAEB609CCAEF2F7DE2493315697AFDFAA83 roman087
1,666,245,874 *AF54AB2CC3C44585CE3906AB2EF601272A762F87 REGOOBYLOPONOM
1,666,245,875 *AF59E5B9A1ECA1E9F006C50FA7C9AFD15CD5D2EC P=====B~0~O><
1,666,245,876 *AF54BBFF06EF52C3E6D46DD18E9E714F9B8B9F73 KORSZAKBŐL
1,666,245,877 *AF534A0152C9DFC10D61A8491192BA3248942F32 renaldobellitti
1,666,245,878 *AF509B018672A68EE399CA5BF307D845A55EC92F KR|A
1,666,245,879 *AF566263507405184884CA4D8677F65DEF5DDD39 ROOSKLEURIGSTSING
1,666,245,880 *AF5F40CB9A67E4F7D05F07556E720D345311BB6C roraviiti
1,666,245,881 *AF5A8A00AE8DAB4799E9A9FAC628FBFAF952FB38 [email protected]
1,666,245,882 *AF53F5BA4AFB45EBFE9DBEF25FBE9BBAB668434E KRISTIN-MORRISSEY
1,666,245,883 *AF5DB831E7CA7DBAD3D7C53CAEC2FD537CCAFD1C roscoehuski
1,666,245,884 *AF5F312054906B62AC9A01B1DDC993DEE8156674 ROSCOE.MOUSEL
1,666,245,885 *AF5A01C462DEED8F605ED9485BC4D44FCB955266 kroeskopping
1,666,245,886 *AF53854CAB787779DC62AEF55D5F9A65A6FA2C2C RESETSELECTIONSBSW
1,666,245,887 *AF5E809BD9373946FAE0CEAD2269E67ED78D9945 KTS0898
1,666,245,888 *AF56510708FCB35AAF9A1D5BC02CBA917568B7F0 kumtuma
1,666,245,889 *AF581C6677ED392B91D36A12B4C399F4E9EFAB70 PENTIUMS!
1,666,245,890 *AF5DD202E9A5CE6FE0B08A3CD17AEFE08B95E7FB PERIPHEREAL
1,666,245,891 *AF5F7C790E1D9542FD6AE1A083678A92C92F66A5 KXQJ
1,666,245,892 *AF5EE389B7CF06CDF2F59116614E53715C466941 RSASU
1,666,245,893 *AF515D0D25A8464944F1A13466F6797D7135F125 KYLE.FIESER
1,666,245,894 *AF5560FC38E2C7C5A7AE5A971CFEBD8681391EC9 PETERJANE
1,666,245,895 *AF5B141191AE51E537FBE3E372FB3B62A519A1B9 ricardositterud
1,666,245,896 *AF50DF1A668D05DABF22F34D9C3C50DDE9DDB1B1 RUATBSWED
1,666,245,897 *AF55A1FA383E5F3EA6036FEF3DDEB16639A18EC8 LANCEBRAZIER
1,666,245,898 *AF5CFF13E5FD10E26A7BE4301B7BADD7123CB707 rudolphswarner
1,666,245,899 *AF58492EA43D3CBA15923A03D31D51876937D4C2 [email protected]
1,666,245,900 *AF50EF8C47DDD10C078AD712DAA9EF7F44FEE125 RUMAISHAF
1,666,245,901 *AF5691B958A9430313A53CAC76F1E01C4A52006E RUSSELLLEJMAN
1,666,245,902 *AF51CA8AAED829614FD2B51CCA17D4BBB7A12DE9 RYHMAEKIN0
1,666,245,903 *AF50B2255914446A411F360BC46CFF73F7C00DFC S5870708
1,666,245,904 *AF51F9BE36BF363CA03923648FFD58B5D25A113A [email protected]
1,666,245,905 *AF594D73923875ACF3D8109F2946ED282B88DFA6 SA
1,666,245,906 *AF5BDA6784713BAACADC3F63C5451538DF239A99 PHILIPUMANZOR
1,666,245,907 *AF59E09D71024075F3D3AE2E3852356EFEBE6654 rippable9
1,666,245,908 *AF58E7DC61626514DB769D67CB70EC0B4A5CEB12 [email protected]
1,666,245,909 *AF58F0E6A3ACA33CCA13E4497B2E81A6717369D8 saiumi
1,666,245,910 *AF5054ACD13BBED25301017DE3AAB17662EAA7F6 SALVADOR.GRETTER
1,666,245,911 *AF5E487247641966E30938319CC07C2EF8D26E00 RN2}
1,666,245,912 *AF587E462634F67C2F5574B434C1A34D615CEED2 SAMMY.FURTH
1,666,245,913 *AF54ABE2BDA37EB89C0D91F4C86AC066C3B8852F PLANMABIGES
1,666,245,914 *AF558F04B0CC69A5289A91694847D8324179B8C0 lcowzyjiqwnci
1,666,245,915 *AF573E119AD72B0FCBDC277F072DE27AA6D77315 ldsufer
1,666,245,916 *AF59A82873A706E1F25FF833CD2891F40B520693 RODGERMONSANTO
1,666,245,917 *AF5FB8DD54A31671372A32E06EDAC460558FB44F PLOUT3
1,666,245,918 *AF50AA4A21D5883B7CCE6143521B895B652B1503 SAPTORSI
1,666,245,919 *AF548E9CE2EFAA2F3BFD36BFE99E0D02497AAF00 sarah's.voice
1,666,245,920 *AF552DA5E8E04AB6639972E9FC48D707C0FA25CC sara.wichmann
1,666,245,921 *AF51413803E06764ACAAE6D653C4FA69C4521430 SARDNIARTNOC7
1,666,245,922 *AF5D69A7FCA79111B1157B30C78EFD36E7B11C91 leeannkilian
1,666,245,923 *AF56FF68C8AE9904D6A9601822E7B1287BE87E1B leiberhandbagzoeforbeslifestylecx
1,666,245,924 *AF5E476A252B9C1F2C6A2D8F987E0EDEEFE95BED POMMELLED
1,666,245,925 *AF5AF60F36B1D819F45DB5E8C2036E7B7E1AE146 RONNIE.CARRIEDO
1,666,245,926 *AF5B664E09947021747B86CA5CDEB566E94E8979 Scotland-the-Brave-(UA)
1,666,245,927 *AF53AD6A40E85DBD1D718E3E78209BADBEF1593E scotwinks
1,666,245,928 *AF5B50EEDEB1968B2E9D41C6F6382C9329172174 [email protected]
1,666,245,929 *AF5DDE7E03B31827E6273A1D4814A4FDE9FCFB59 LEONARDOALMQUIST
1,666,245,930 *AF5C935935B0ACF9976AD9431DD9D8D5B6CCD4E6 seannoon
1,666,245,931 *AF563586CCB5955AE9E53C992FB412F61E3767D7 p------p-~0-~o->-<
1,666,245,932 *AF53F0024DFA12D9E423FCC4728B66CB076E08FD pp ~0~o (^_~)
1,666,245,933 *AF5824404BA82C74FD0A74272FE9222D05E04AC8 p######p`~(o_-)
1,666,245,934 *AF5BFCE2C9B54916160731146A15158E42EAA3C0 [email protected]
1,666,245,935 *AF51891625499AD7DD38A4CBCFE384024E112332 sehcaol4
1,666,245,936 *AF5A727105444766569BA531741BF40A11EF6BAA seichoud5
1,666,245,937 *AF5766B864E1473FBA3005C49092A3AD94B32689 PR34MPLF3R5
1,666,245,938 *AF599E20B7428BED8E1170D7704D8F94ACFE39C9 leucasteaconcolor
1,666,245,939 *AF5D5E84345F35C6B7ACBEA0DDA6B0E0B66E95D4 SELLABLE
1,666,245,940 *AF5B1B9C4EFA21EE67304C9B26854209EF0689F1 PREEXISTS8
1,666,245,941 *AF5642A7BB6565D1DE90CFB0F8C138DCB9785521 Premonition10(StagesI/II/III)
1,666,245,942 *AF506E518C47900C43F1C670314EF21390523C3E [email protected]
1,666,245,943 *AF5AC2055DBC038DBF3CBB16ABF23316F33F12A6 [email protected]
1,666,245,944 *AF511E426593F887EDE6D4DFE662291BC1D7326A RUSTYSILL
1,666,245,945 *AF5E9E34DEAC14E7B3716F66DE4A2807EA05B36B ruzakid
1,666,245,946 *AF5D188D8CBEBFA0F983521078ECCECFB1E61D41 SETNAVRES2
1,666,245,947 *AF51000056D66614025F875210297C25DAF9093A PRISONERS18
1,666,245,948 *AF5E7F21674BF026D4A63970A4DE321B51E80D10 [email protected]
1,666,245,949 *AF5F8B7ADDD6A67E4C926722490A29EDD6411DAE [email protected]
1,666,245,950 *AF52061D5374334C703AB0F93F72B09912F9143C SEXESINU0
1,666,245,951 *AF5346E80F051A660B130259EDA862924E974E3E shalabbac
1,666,245,952 *AF5C3C5DB7638715038FCF7D2F48E30CD04A5275 [email protected]
1,666,245,953 *AF52EE649A0BD313888D5ACCE38A85B76ACB34AC SA
1,666,245,954 *AF5C2F2227507A56A31A4B7B985C2219A4A125E0 SHAOYING4
1,666,245,955 *AF50CB1815695096445936D95BB6D5994729AC0C SÆRANSKUELSER
1,666,245,956 *AF5864763B8223309301958F1B573217E1BB44B1 PSYCHEDELIC SPEED FREAKS
1,666,245,957 *AF5428A11EA102FDDAE2562925497119F3ADA0DF SALFARRAJ
1,666,245,958 *AF5CF2A0C91C809ABC613AB43521A629FC569765 [email protected]
1,666,245,959 *AF588B63C0DF51A8580D133233CD47CCB0197FDC [email protected]
1,666,245,960 *AF5BFA42ECDD3EF02B361F545679E223C5E58385 putywlskie
1,666,245,961 *AF5862A712C75A38BDD82E54168B71A48EA90A96 LISALEMMER
1,666,245,962 *AF5091C6C136043334CB919122E802065FB238BC [email protected]
1,666,245,963 *AF5DF4F369A40B97F30E1ADE6F97C07D6890B94E lithotomiced
1,666,245,964 *AF57F27199CD7EDC4B16F22CB5B83A297B14F2B6 sherwoodmazzie
1,666,245,965 *AF58A3DC2F8EEB100F5EA684D669622A845A33FC [email protected]
1,666,245,966 *AF5C7251C3B088860451911B9B79E677D7D67715 LLETNORF
1,666,245,967 *AF5E986159DFD5E74675F11A8917887EF6CE6D77 logrippo1
1,666,245,968 *AF568E0563C57495BA12C139396403EF040896D3 SHKRUTESË
1,666,245,969 *AF56F53E2D9927BD0F86D169A1EB569226588B3C longsturkey
1,666,245,970 *AF5A1FA1E22013997D93FA4947C591442F5CCE7F SHR^INVAANAAH
1,666,245,971 *AF51EEB9E788DC6E8E6D4A30111F4CF01CD573A6 [email protected]
1,666,245,972 *AF56C6398031C69031AFFB1D38EEE17D67324CBE [email protected]
1,666,245,973 *AF59C431E1796A1A31761A9CF154C3FED261397E qop20x9dmj1p634a009hca70z
1,666,245,974 *AF55C666109D958F3428D5BEA20E488A8B6C7BCE lordcupid
1,666,245,975 *AF5589FE8C93F9BE8F5BF13261C100493411E579 quando ele pensa no que fez
1,666,245,976 *AF5636BCCA82AC4EFB552B499564570DEB9021DF SAYAL
1,666,245,977 *AF5D410C1A383074F79343F5C5FC7D0F44FAF347 SĆEHNJENE
1,666,245,978 *AF5E38FD64B70EDE7490C9317BF0263D918C7C3B Love-Game:-1492-Vangelis
1,666,245,979 *AF5D807DF7CC43B990BC56C0171D9F31F8F6ABBB schärfeanhebungssysteme
1,666,245,980 *AF5B885A2170F60E109E05BA5E3F1C1E3CCB8D12 SCHMIERAU
1,666,245,981 *AF53BD96132A19FCCA3A75884143130CD781DA92 [email protected]
1,666,245,982 *AF5D5E148B9A34D17696E185895F6E763C451D06 SIOESTA
1,666,245,983 *AF5771B3590C09551B714F47FB59969403606FE8 LUCIENFLOREA
1,666,245,984 *AF5BE4D306FA1F86CA887B5074EA4BC0A96FB787 [email protected]
1,666,245,985 *AF5E74E39AB8AECF2D8B31CFE465D8743173F849 scottiegreenwood
1,666,245,986 *AF544D33F0F2A0560F0613DAF21CF3AD103FFED6 radiopharmacists
1,666,245,987 *AF5B0B3F62953BE8F5DD6444FEF87812E064E675 SEANRANKIN
1,666,245,988 *AF51FB986BF347A02230C533E69E9AFC8FA3C0A0 SLEEPERED1
1,666,245,989 *AF5D7E087FDE6C82AE495E9A78479BDD375B0411 [email protected]
1,666,245,990 *AF51F6FF604DF972B6720A6BAFFE62D3B0BAF569 SEIC
1,666,245,991 *AF54DCF92C0ABA9B38FBF4CD06227BAA54A062B0 SELLABLE
1,666,245,992 *AF5D440CD05F2AB1ABA29E9AB9512D7442B85CC2 se ~movie scene soundtrack~
1,666,245,993 *AF5DCA67068674837219FCFEB5B72ADB2C86D29C SEPTEMBESIMON3
1,666,245,994 *AF52168A51160C8F2C5B902376D099CD94B0DD4A M1N1MA11S7
1,666,245,995 *AF5DAC1DD00DC16A6DA74A9E548054C3325A2E58 snotisiv3
1,666,245,996 *AF532495223D8E816E2AB52B7286A51C163F0B3E MADISON-OILER
1,666,245,997 *AF5AFA49BC7EB7291971E5CFD221F4236900E97F [email protected]
1,666,245,998 *AF5B529C7F796C77D629A0E02D6F1AEBBB2D7F09 [email protected]
1,666,245,999 *AF5BA83F42AD5EF395E3F5E628FD3601396C9960 RANIA YASIN
1,666,246,000 *AF58EB96C5D28C2FFB3F1D75D7A5C8F8F11B7A32 SPARTINI9
1,666,246,001 *AF561CFBD04C7206C99D39AB1149138097750212 SHANTIDANCE,PART2
1,666,246,002 *AF5FA438A107A553DDC6BFD232460FEAEB501604 rbz-
1,666,246,003 *AF5DB02222D8AAFE4BA1E2F10DB9DF5B4E093C94 SPLAT~`~`<------P
1,666,246,004 *AF54837AE1352B5FD546DEA843C5462088336BB7 [email protected]
1,666,246,005 *AF5B6C7EFD1EB98D6CF6410536256C0824BA2619 SPRASADREDDY
1,666,246,006 *AF5F2676221496AA951B03A1CE353EA42AEE06CA shout down
1,666,246,007 *AF5D963864BC0296D22C62CEED9E311FCDF97E75 redbrick
1,666,246,008 *AF55FBF5B96EE91A00D44002C897B1E5154EECBA MANGARAY3
1,666,246,009 *AF5368C87DECAB1BD680ECF07CABAA9C4E1066BD MARCLOTTS
1,666,246,010 *AF538002747611A1D38F666866AB36084F71E9DA starbrite76
1,666,246,011 *AF5B6BA9F8A35B44DFC8B724BB4E59FCEAB07076 reidbrunston
1,666,246,012 *AF52BC5C8A98C7932B51230D1B068FC2D5C5E110 SKOLARI
1,666,246,013 *AF571880CD94D0FFBDB6A37F89E76DF1DCDD10B5 STEPHANIE.WROBLEWSKI
1,666,246,014 *AF55AF303FED61A1D7ADCD3B0609C350DF361472 markenausgabe
1,666,246,015 *AF52D227A3A11DCE1DDF682C0274D7A88C4A9418 stfwlkn7
1,666,246,016 *AF59DE3A3706314A1BD12D967E91CFCD6A5A5308 REQUALIFIC
1,666,246,017 *AF50E098E0A119A368B02AD535EE746889AE9ABE marydeasis
1,666,246,018 *AF5E4D21F85847F3EB9F638C76C02D2B0D2EE071 STRLOWERBSW0
1,666,246,019 *AF52FD5E9BAC34B4B8D01E5C2E9E88C614D659AA RETARDRYAN
1,666,246,020 *AF5FC88CFD7FFDB95207BA1C43F7ADD2E121B547 return-to-central
1,666,246,021 *AF5ECEB1122EB705169F3D644AE4FB8741A3AB3F MAUELINO8
1,666,246,022 *AF5622CFC2CB430D529E8DC15E05E2FBADC180F9 revnausea
1,666,246,023 *AF5DF49576846AA607E71DF11B865D877B65F3A2 MAURIMODI
1,666,246,024 *AF5747B7FE94B16254ACE50B5842A61AC8F8C27F sonderassistenten
1,666,246,025 *AF5E91C1B294628C2BEB9AC86FA8C452061017A0 soof-gan-ee-ah
1,666,246,026 *AF571499FC79AB4678BA53F21898704610154E42 SPENCER-KEENAN
1,666,246,027 *AF5B4EE28AAC4878D6ECBCD97907FCE596B71E3C spennatas
1,666,246,028 *AF5612887EC49E0C1155FF3EBAC895E9B0FBCBC1 SUNGMCGUIRT
1,666,246,029 *AF536D1DADCB60EB0496314A66FBDD561473E2D5 SPIT FRESH (FEAT MORE OR LES)
1,666,246,030 *AF54CFF7BD70FA6C1DC20DF66E4DC252E399C2C1 splat 0~ @p
1,666,246,031 *AF5E82EFE4354BE2C7FE5E6A0FB3F74C5CAEC4AC splat!* d####b
1,666,246,032 *AF5358265B43434DCAE83FD6E0B047E4331379E9 RILEYBILLEAUDEAU
1,666,246,033 *AF58602A2313BFC1EC463088BE66BCE7160E00BA melodieburton
1,666,246,034 *AF5189903085DAFA49000AE4B14513CC725EDE42 MELODY577
1,666,246,035 *AF5F72D2B85D622699B7133C999C50244BC999D1 Splat!!o~-0~<==3
1,666,246,036 *AF579282ACF6B09138A8E83BBB8ACCDC8BD16657 SPLAT!-O~-0~-D####B
1,666,246,037 *AF5CAED5AF7D3AD6261D2491821D569A2AA22AD4 r.i.p.-mike-conley
1,666,246,038 *AF5B03456526099C6A34E79D5F00E6E898EDC3DF [email protected]
1,666,246,039 *AF5D6D1FE99EEE7188CDBBEC90B39BACC44DB972 RNGNGSLKHL1
1,666,246,040 *AF5160977F873BEBF0F7B7CC09B93B6143E79C5A [email protected]
1,666,246,041 *AF5E27E029DBAA5BCAAC207025185AB2BBA80D18 robbieburchette
1,666,246,042 *AF5A25E4CB1D65F0036A3BCA25FCC4C1C283A3ED metalpup&thepumpkinman
1,666,246,043 *AF57C033026345759D9C38B5884B5BAF7528493A SURFERE3
1,666,246,044 *AF5369E6C9C977E81B290841DBE363B93E803A97 SweetestThing(feat.AdrianeMcDonald&GeorgePendergrass)
1,666,246,045 *AF5C3F97ACC72DCCA0F6B54B011D11F934457332 [email protected]
1,666,246,046 *AF54AC4D3C3D2FDB79702B484714964BE3134DCD mielzky
1,666,246,047 *AF5E9593744D2F443117E659BFC8EB0C352CE92F SYDNEYTURNIER
1,666,246,048 *AF55E9DF76332425F4F4BB136C2E270895F9B057 STANDAARDSITUATIE
1,666,246,049 *AF58885EAEA64457DDA7858139C89F0E141643B8 MIKEBONTA
1,666,246,050 *AF51B5855D48A2E21B5325880A64378F010050CA ROD.VALLEZ
1,666,246,051 *AF5B952C0708B64A3806751207D47425DCB85E3D MIKROSEKUNDOVÝCH
1,666,246,052 *AF5688E64B6D8CDA3A5F4CDD916D8B7F84EEC4DC MILAN.FROM
1,666,246,053 *AF5DB0BC8D045B40B13FA351AA536A7BB7880D66 STAREAT
1,666,246,054 *AF5ABD8609E232F96675234D487859C8CBDCF174 MILKINOORO
1,666,246,055 *AF590AA7B6D701FEF9F20670B5AF834E9BC34823 stenkullene
1,666,246,056 *AF582EDDBD0EE1178F5F3E9C79E3547B0E304FB9 MIRAGUAMA62
1,666,246,057 *AF5D3A417C2D35AB366AA898EB7C64348EF8B4FE T=(+
1,666,246,058 *AF5C82D433512EF24D00B13D3D5DED0AA1A7BE79 T0KFL53U
1,666,246,059 *AF56B7AEBE61E01D580CEBD7C08893EF4B27A19A RONFLOWERS
1,666,246,060 *AF5F37D20203CBDD76FAE6EB7DB87C4A8FBF4258 STOCKPORTBASED
1,666,246,061 *AF51FE37578FBFEB59ECE7F6E53172C012ACD509 RORY.NIMMER
1,666,246,062 *AF545CC24135E09C1E5DE9DA2B4B15C746EB7CCC MKSNDIN
1,666,246,063 *AF53BD68F70A387A739A8EF2C4359AEAAA6235B2 MMC
1,666,246,064 *AF5DE18EDBBE6AF3E4D66A4E7FD493EAE9062355 ROSENDONGUEYN
1,666,246,065 *AF5354004E077EF8ED5C90040DD64866F4CCD527 studeervertrek0
1,666,246,066 *AF5455EA58C172D05F07636535554A56E925CDD9 moiseskueker
1,666,246,067 *AF5BE05FCD32941746C47AC5D48A06703FE7F9D8 moiseswilley
1,666,246,068 *AF597CD9758FD7C4096A7F238EBB094C5C3BF667 moisesyarrell
1,666,246,069 *AF5D7890FF5EC1320D9CCE198C2352CB7931FA1D rqzlogo
1,666,246,070 *AF5898247C9138E20D048A9431F4BA1FFD2F11F6 mononeurals
1,666,246,071 *AF52162F4606D9D63564A7A6860C4C3ABA2591B8 tangoripper
1,666,246,072 *AF5C73C4F38D8EBED13A6B763DB9DCFF216D3EEE SuiteinGminor,Op5No1:VI2eMenuet
1,666,246,073 *AF50BFC18CD503296241A0ACB699002B9548B892 RT1CLTN55
1,666,246,074 *AF56E1D39719C7B46542A72457ABF158DBCF4F02 TanSoloSomosAmigos
1,666,246,075 *AF515BF807CF68BE050D3CB6E414D02CBD4535E1 SUKUMALAS
1,666,246,076 *AF54481F4B36218A513834AC7D7D4974CC146103 RUCASESED
1,666,246,077 *AF560453D9F7D4432727C7E8D4007090028E91F3 RUMBLE
1,666,246,078 *AF5FB68FECF3E2CFDFBFD7694AD266E0438DE519 TAYLOR.ASENG
1,666,246,079 *AF5D0D5086F241852819AB47AC80485CF29D1543 SUNRUHE
1,666,246,080 *AF5C56FEA307F486EABA980D8D24E74A135F77AE RUPERTBEEDY
1,666,246,081 *AF5FF4A975A237B64CDC05C8598B696701C86872 rupertbellamy
1,666,246,082 *AF52CF62BB8A86A163724E59B558E656AE80AE07 RUSSEL.FLAKE
1,666,246,083 *AF57B397713BB82A3CAD6F9AA683240BE463BBF7 moviesmovies1
1,666,246,084 *AF504B02535344DC0A6C61FCD1695E1AB20F7500 mrgroovy7
1,666,246,085 *AF59A08CDF29848B776D03346EAFCE748851FC70 MSCPHLC3
1,666,246,086 *AF5BE8B5AD5982777590593244E434EC75C76637 SUVERNNOSTIS
1,666,246,087 *AF54C9DF272ADC9AF2DBD9CB747E88B40A61E682 RÝND
1,666,246,088 *AF56B560DFEB680254D21465F1B0CD751DDC3FFA MUGGENSTURMU
1,666,246,089 *AF5A9A847852D1A1EFC8F491CA31185942B7F3B0 sackey band, appam
1,666,246,090 *AF564FA426606D7003009509C5FC8D961F29EBC4 TERENSKO4
1,666,246,091 *AF5E270296AFA5ACEF17B5BC1BC9085FBDC794CC tetgealseb
1,666,246,092 *AF508FB3E0EE97F2745AD70813BD34154E0C967C T2YE
1,666,246,093 *AF55FB7EAF56C1E0399535433F2678FACCEC997F take.and.do
1,666,246,094 *AF53DEB88FFDC9CB18029C11973288A495B18F66 [nagranie.z.Jarocina.1986]
1,666,246,095 *AF5C6A5A83794150D6ED649F200DFD2FF236C1FA thatstuff'stwohourscold
1,666,246,096 *AF5EA8E88CDDAD4DC2E7BE891DE1FCF1A26E3D5C SANGRIA
1,666,246,097 *AF57F1AB8732ADEEFD4B97B8B3F20A711195123D THEFRENCH11993
1,666,246,098 *AF5E386611AB4AB87589669BE35746BDE464F768 NCTTRCS1
1,666,246,099 *AF5657DCA3DDE646FF57F635FEF239B3AD3C4839 THENNCNB123
1,666,246,100 *AF5DE00DC2786478DE05E7671945B9245AC97AE5 THEODOREMCGINITY
1,666,246,101 *AF584D649E045AC8A4DF6746845850DD14F18A1A NDQUEVER
1,666,246,102 *AF552C516E863488F4811292352536C30AA30D2A NEDLARBE
1,666,246,103 *AF5AF52CA31B8AE4E1E2D7233C94CEAFF3D30AF5 taylorfreedle
1,666,246,104 *AF5618A4982343BE95BE19362E0509946909DB0B TheStoryofOurLives(Syrian)
1,666,246,105 *AF5F97145078FC160CFA2CE88E66FB8B757E8D4E thetuna0
1,666,246,106 *AF596176E5A71CE8BB6AD82DBE16B541D23B5B39 newf4$honed
1,666,246,107 *AF5B7DDC854C426588FC77495D7253FBEACCA4CE NEWRY TOWN
1,666,246,108 *AF5F7086D66F66FACCF2A441756EEBDA5146E465 [email protected]
1,666,246,109 *AF5883FE34C8CEE5CC75DF07F0054EF8B9FED4D2 SCOOBYIMAGINE4
1,666,246,110 *AF5EC7EDEDB9F2A308CBBA521D8DB79F446C1572 NEWWEAPONS.ORGWWW
1,666,246,111 *AF54FC6A6FE99DBDBDC853E6CD41808BE2271C86 thirdofthreepiecesforclarinetsolos
1,666,246,112 *AF536CADBE25FB58A0CB4756B226839874F124B1 NICKNETTEN
1,666,246,113 *AF5A407286B5200313922FE9F5AD757C724CDB3D nico-engelmann-2006
1,666,246,114 *AF533B4A274B32B5C347B88EF42BBA0DE6B8EA86 NICOLE-KOWALEWSKI
1,666,246,115 *AF5C6E90E109F7CDE8171902A0BB6AD5154E7225 nieves-gonzalez
1,666,246,116 *AF59BA9DAA7814855511915D893C243BD4164EC2 nigelgotch
1,666,246,117 *AF5845C0A5E5C28063A9D0C670A4EAF69306F09C [email protected]
1,666,246,118 *AF5F72F500E8D772EC4AEBD5240F3B4A71279D52 niiskuneidille
1,666,246,119 *AF58A3BEF2E83E3E14FA2042682F19FE35D01CDE time_spirit t/ai/m_'sp/i/r/i/t
1,666,246,120 *AF59D451173EF08FAF514D38D1719AAB1BC9692F seems-for-no-reason
1,666,246,121 *AF5E7DCB258FD724FD61F0C420D7FEA54B886267 SEETHRURHONDA
1,666,246,122 *AF51F6147691A14BBD3BB0EAE0BFA4C748631F12 titusleonides
1,666,246,123 *AF5B9C162E9D179446FBA33052E077564339AF8D tlq%
1,666,246,124 *AF5C9216E33C717DA4529F15FD843ED6809BF39E nlqdtbl
1,666,246,125 *AF5CAC0E14E50A93727FC05845D63B10F10F5F19 the-econoline
1,666,246,126 *AF55F883DBABB251819212E4AA0CC47CCFD03D73 The-Lost-Cafe
1,666,246,127 *AF5A813953306BCF8F4748E137EB0B8AC599867C TOMAVANT
1,666,246,128 *AF52638980ABAF5F16586EBBEDD6C9807E6B7FBA THEOCEANCRIEDBLUEMURDERONAFERRYINASTORMONAWALKMAN
1,666,246,129 *AF5B2373B28DEFA5CCD5628AE07B10085656759E NORBERT.GILLISPIE
1,666,246,130 *AF5316C8778DCEA3F6868DFAC774F4E9C4B5C6FA thestingofhiswhip
1,666,246,131 *AF52CCB63D30686DF88F033E16467945711A3040 NOSEDONDENICONQUIEN
1,666,246,132 *AF561B6D131ACD07C491705C73172784DB6A5CA8 NOTNATSNI
1,666,246,133 *AF51F8E7BF75AA1D4957F10F3B3CFB5373883EC2 SELLABLE
1,666,246,134 *AF5B6656AC2CB23F2CCAA390DBB52943E624ADDC TOOLBARBSW
1,666,246,135 *AF5D20908F2CE392A547A8E44BA3C15FEEDBC4F2 toshiba96
1,666,246,136 *AF541CEB8392FE48E41C78CDF364E58902CAAA24 NUDANDOQUE
1,666,246,137 *AF522C36E6DB60A486F34A7673BE3F00E6474845 NULO”
1,666,246,138 *AF5DE001C8EB9E3B77E909E59C9DB9EAC57A90D8 TRACY HATLEY
1,666,246,139 *AF551653FAB7EF69AF0DEAC2C96A8E8347B5BB7C ticker
1,666,246,140 *AF584FE6FD312FBBEF4A690289364F0521104C28 seyinsermet)
1,666,246,141 *AF59C01571168AE6B4503DF2557653B529816F53 TRINIDAD.GIGNAC
1,666,246,142 *AF5988C339375213ED3F1614570C36F54D042E8E OBROVCA
1,666,246,143 *AF5A6C9F4526816EB63707333FF16E351D201FEE [email protected]
1,666,246,144 *AF5C8D370ADDC26ECD15869EF0F90A8C5C1A076B TROPHÄENTRAGENDEN
1,666,246,145 *AF5AE60D81926BF9433E5B132AA36125F43391BA OETLEG
1,666,246,146 *AF561FDF7EB3D4A0A0FEF79EE7390E08F7AAD743 TNEIAUQIDBA0
1,666,246,147 *AF58BBCD9A65C746619E4E2029369DC1EE64DD98 shaun-oates
1,666,246,148 *AF54F5D3ECB977C140DAD18D720738202DD4E813 OHSUOYG8
1,666,246,149 *AF52C1D2E5D0B5B1A0402C871B347A617B9B0E32 tobiasleist
1,666,246,150 *AF58F81F9FE1D9A8AA82D1FF44296D7F330FCE22 TSHOLOBAN
1,666,246,151 *AF52239563B03A95D106D5A6BDE8FBF32CA163C9 TOBYGOOFY6
1,666,246,152 *AF521AD14BE9CD5C87C8BD9F8694A70E1E20C97C SHAWON1984$
1,666,246,153 *AF5E2416B7F76144F2FA4B55DC2CD8CDB11E1480 OLIVERLUZANIA
1,666,246,154 *AF50EF7C649ECA4CD019725EA7BC4DD767C09E04 [email protected]
1,666,246,155 *AF50BB5C19CAA2ACDB8501C72AFDDB21A58D9F4E togahotelscomauwww
1,666,246,156 *AF5CB3172F2DBC6B65A013A947D897E1643CDC3D [email protected]
1,666,246,157 *AF56E52010A756E92589E4F97B9336DCAA4FB046 OLOSTUNT
1,666,246,158 *AF55593DDC3150D13A566C286B0DCD75786B60D9 olvarit8
1,666,246,159 *AF50E29C739A2E3929571E561B5AF8BEDD40C70C ONC1A
1,666,246,160 *AF534E4FB70D554D2F0AFEDDACEEAA071419C30D TOMMY.GERSHON
1,666,246,161 *AF5AAE27026BEEA9F0AE1F532E9B6C96BD80F0DE TOM.SUMPTION
1,666,246,162 *AF55F807D7BA151A66694D71EC153C91B9BC6568 [email protected]
1,666,246,163 *AF5A7E67C2F0A555C9C5920F5C12FDFD59C055B3 TONYPHOENIX5
1,666,246,164 *AF5B2A60DDD76D58F3201AA722326DCFB52CAFA6 }o{.o~0~.q######p
1,666,246,165 *AF567B887C402EF9442CFC9D58E04C2268555B49 torger(三壘)
1,666,246,166 *AF54393883C7A13478384AF9A486CB96F607DF5F TOURNEEVERANSTALTERN
1,666,246,167 *AF5E12DAAC26503B475CEFD9F5CAB4AA6C44ED88 TRACEY.ZITER
1,666,246,168 *AF5D96D0DB29C4022EFFC1216B5AFAB7C2225D96 uchisaix
1,666,246,169 *AF5B29EAA5C2B32F700EB039B1D8F1DA834E0A8F OPOSTERNAK
1,666,246,170 *AF53CADDCF337245662D66DCE4861BBB815E203F ULYSSES.MCINNES
1,666,246,171 *AF51F20E5CB16B9FE7FD3F8894DAAF6E45176F03 UMESH.SHANDILYA
1,666,246,172 *AF5C482F65A59FD97330A071A0DC477AE929870B UMGEBAUT
1,666,246,173 *AF58BE64DC807E6D3422D9F961E5B978D0168C9B trustyworhy
1,666,246,174 *AF5AB6B943193FC52295CAAEF589A34360E9A604 UQG!
1,666,246,175 *AF580B6D4581818F73190C0E2F85EA26815ACDEA URANIA.19.0
1,666,246,176 *AF5B6F1CC1AB49D95DB5AEF73BDB20ECB82BE35D TUSIND
1,666,246,177 *AF57E0121112CC1D0185BA1D3585E2345B7ABF71 [email protected]
1,666,246,178 *AF5BBC41631DE92E7B1E5ADD009A44B771F73885 USOONUIPPAKC
1,666,246,179 *AF5E33B12A62059C379663290A35094E30D841AC SJUAYB
1,666,246,180 *AF556B1F7AD14461BE372F4111AB640DA2C71F41 tylopodos
1,666,246,181 *AF5B836288C4B1E6F3DD9786B065F396C712B4AA TYRELLSMALLS
1,666,246,182 *AF5D471A2A6C92936567C6C2810876C458B5DD2C OVERHEU’S
1,666,246,183 *AF5C4F8CFE92017C818355918845A0020686198D UEBBY
1,666,246,184 *AF5D329D4DE880032A48232226B92D0560EEBCFB vaaranam8
1,666,246,185 *AF5A7594D1595BB62E3E1E9CE5B5EC66E4CD6D99 SMADELIJKS5
1,666,246,186 *AF56AD3B947135A5A099F0470381A6A4239BFC6B [email protected]~0~o.o->-<
1,666,246,187 *AF5885BA96AF6F2E5FBC5FACD29C2CA6B9F5E7BA Uitkleedde
1,666,246,188 *AF59381CF4ECE3AF3C485CF78DE735F9614224DB SNEGOKNIP
1,666,246,189 *AF53335AA73B7D647C4D4980F73C8AF0C24C17DA VALENTINPALLONE
1,666,246,190 *AF5082E5784EA1550262BBBCF215463123DDBE33 SNOL5
1,666,246,191 *AF5EF9E14F1B2E169455B8D1921F90D0D009E334 SO9445
1,666,246,192 *AF575A4858F2B5168CE84AE90720D1A536AC9034 VALSTRAYER
1,666,246,193 *AF509F83DB6AF3469466FA98B668351CD8A4E385 unclasp
1,666,246,194 *AF528CB1F9E8C11BF94833A19665211F8BF6B4D9 PARAZIT5
1,666,246,195 *AF57CC9CA1DEC59E0C6AE7BCE82F3BF5FC9E4B92 particularly-in-ldcs<p>
1,666,246,196 *AF535F444E882EB2B1B3D4226F517BD0E2B785CC UNIVERS441
1,666,246,197 *AF5440A644FFD695F74657A19C3477B8A97995E5 Patras
1,666,246,198 *AF5B6B598A2C9F44E8DCAB2FBB3838C045B0D076 paulcrowell
1,666,246,199 *AF5F413692E3841265C044FB0A957A0D9C1BB396 paul-weller
1,666,246,200 *AF5AF39DA9094C5ACA51A53CCE535FC2D5449402 SPHEROPLAST!
1,666,246,201 *AF58207382B0C76BD42ACFCDBC11F81CB31202D7 VENUSERICS
1,666,246,202 *AF5FC9B35F43F9F77593519457A481D0E2A72C55 PEDABAYALU
1,666,246,203 *AF511DD9F1E6E7B131054B7A422CB56DF7227CDE splat!.~.`d######p
1,666,246,204 *AF51DB6B5C54FDEE9C827880136EE0E882ADB626 VERMAAND
1,666,246,205 *AF57E5C2BDB7F758A965039EB3ECCC54B30B28B1 /usr/share/doc/linuxfirmware/READMEgz
1,666,246,206 *AF50B2D7DCD7728D61CA4E84C9EB4BC0775824F5 PERSIFLEERDE3
1,666,246,207 *AF57B375777501FA1B05D5794053B7D032A7A0EB PETERCUFFIE
1,666,246,208 *AF518CBBA2DBF1118CAC7B9A671A0A6AD4841BD7 VERSTRAFED
1,666,246,209 *AF5C7EBF5BDA73D14A4EE8CCA8FD4A8100392C33 SQ0TAAAAMAAJ
1,666,246,210 *AF5715F0505C5D2A70B97E379100DD081FB0C3E7 [email protected]
1,666,246,211 *AF563A21A01A766F13460CC82D935806A50BBD30 V4BQN8
1,666,246,212 *AF524642E1B139289DD04DD31D9F663205FB6600 SRELEPSFLOG
1,666,246,213 *AF5545A1BDE9C9CA344F9EA9AFAA001C41E29E51 VALLEY-LADYTIGERS
1,666,246,214 *AF591D927CBC490FECBB6A060555BDCA5454B73B VAL NORMAN EDERA
1,666,246,215 *AF5963CCDCA2FCA603D93A6D75117F06C357B2C3 pfita
1,666,246,216 *AF5C10A3D2BAC51E04317562E14536983851F90F VARIANDONEGLI
1,666,246,217 *AF56FDDB409EAC53C93EE0E1FDEB1E94B400721A [email protected]
1,666,246,218 *AF5074FC466577E2317DC4A868A793E5E26C4BB1 STAKWELL
1,666,246,219 *AF5B946DB45BC55BDF46A2E1636005DD64FB957D VELI-NGWENYA
1,666,246,220 *AF5B7EA0245DD8C26C76E7FB549E5CADBAC58F76 STANFORD.SUCHARZEWSKI
1,666,246,221 *AF5D6E9624DBAE643532194374FE32245BA19C04 STARTPUCKETT!
1,666,246,222 *AF5F771A15146680A8B8FC4CC5EBD5AF302DF000 pipnut_2
1,666,246,223 *AF5782628838FA024057ECCCD231744F858E3A7C stefantigano
1,666,246,224 *AF56308AA3EF116C41770F438C5235CEA7867072 VIRGINIA-G-MILLER
1,666,246,225 *AF593BB35BE9505C664F7EEF4B1D9B3AAAC3765B VIRUSSPREAD
1,666,246,226 *AF580B88ECAE6A18285257F5DACA1939B830011D versie8
1,666,246,227 *AF5FCA53071241269C607F6E90729E2ECD5CCA23 POHABANA7
1,666,246,228 *AF5B67DD60EF6CD9E9A96C8F99C4F384DE300F4E viki-gaskins
1,666,246,229 *AF5E8BBB91A4E615E3219D30E275B6A1EC0B8E61 VIKYLEVITAMAM
1,666,246,230 *AF5456C505E69333A7F24501A0A1AA1C86C0C5EE [email protected]
1,666,246,231 *AF5CA98D588E4C18E62E63CB01E7917AB1C776C3 PP`~ (_0)
1,666,246,232 *AF51BD7712CAB717E0ECB7AD78B9EC058C6240B4 STICHT--S-T-IH1-K-T
1,666,246,233 *AF528219FF770458D95163D0BC25BB5CE9A28977 VINCE'S HOLIDAY TAPE
1,666,246,234 *AF52BEE8F23ED010A1EE56384BC76056E9310EBE vrlgsts3
1,666,246,235 *AF577C11C4320F2C2351B74963C705297D944818 vitodeinhardt
1,666,246,236 *AF5258DAEF9BC184D3BEFEE133C06C12AE7F3849 VW}'
1,666,246,237 *AF5C51E812150BBD40776108E705A19572167AAD STRECKENFAHRZEUG
1,666,246,238 *AF5E1E6B3AD80963F34010E110C1F6E08CDC3C0A prayersfornon-believers
1,666,246,239 *AF56F1D9B2DDAB5C63C202E3FCE6E9328899B63E VOORTHAASTENDES0
1,666,246,240 *AF552812621EB628100436F6237AC59E4C68DE00 votessssstacking
1,666,246,241 *AF512061F9469E8EE31D52C2A0D751E6F36858BB VOWEL-_-VOWEL-LIAISON-PRACTICE
1,666,246,242 *AF522E386BF5BE63144262D1B5B309FC2C305C35 SUBRGIONO
1,666,246,243 *AF51A7DD2A07ACD56D2384BFF1793685E64EF7B4 vueuaaaaibaj
1,666,246,244 *AF51B008F5DF7DFC0A87F1E91FA6CA6A099EDD49 WANDELPIERS9
1,666,246,245 *AF544BAEAC9AE809CF022F14218AF34B2BBDE337 _[W
1,666,246,246 *AF56490F81A80114783A286AE90EFFAAD80779FE W7T59P4N
1,666,246,247 *AF55160D29758635330691AEBDB3D62293B7D6DF PROSHENJITB
1,666,246,248 *AF523A019E733D7F2EC4656761ACB0DBA2F6193C PROSOLENO
1,666,246,249 *AF5788901FC199E4D3C3FA07A5D015DF91B41773 SUNNY.DAY.(THE.NEXT.DAY)
1,666,246,250 *AF5DDC90437B4836299E9A710B400D1AD81646B3 p====)~~~splat!
1,666,246,251 *AF528E9D23C466BD26B52483B182DBF5DA8102DE WASEEM-WAGEH
1,666,246,252 *AF528F10C6E95820D417D451C8DD8EAA1B8EDC63 WATTLESSNESS
1,666,246,253 *AF54D1F0818262A8BFF2EB96B6CF8B227756DAC1 SUSAN-SPAGNUOLO
1,666,246,254 *AF50A292485C9D9B5EF8D94A734C979A2E898FE3 WALTONGALANO
1,666,246,255 *AF55B2C761A9EF413C10A781B8180B78BF56A2C7 [email protected]
1,666,246,256 *AF5DB0E34FD6DCB6021C1F1EC3592B11FCDB8E2A [email protected]!
1,666,246,257 *AF58657BCACA5FD7BDEAC58F1BD95730B531A26E SVISCERATO8
1,666,246,258 *AF52242DACAC40242E7CC975EF8E1DCF8BDE5A22 SYMBOLTEIKN
1,666,246,259 *AF5F92271150EE9FB6A111206C38BE4E6A9A2CA4 wendell.salcedo
1,666,246,260 *AF5ECDA7115CD630EC1CE9B874EDC5F82205EEB2 [email protected]
1,666,246,261 *AF51F914B3E824EC54F813BB4F474F2C38068355 sysaa1234
1,666,246,262 *AF53D43885DBCC38A8EF8065FDA4A4EB4CE64EE2 ;)~`q######P
1,666,246,263 *AF5B7C2B908835356C0D1CAF96E6CDD0E38479E3 WESTONOUCH
1,666,246,264 *AF5E2963C6A1C990ACD938C850BC87D209389184 WEZ-HOPSON
1,666,246,265 *AF5C2D4E46C6E452BB995ABB2E4C9930C5D44E40 WEDDING-RING
1,666,246,266 *AF530C42418097563F0B85D1AD7228064615E2D4 qryv
1,666,246,267 *AF555606E71098B117CCE2A6015E454A9DBF2C52 WILEY.PARTIBLE
1,666,246,268 *AF55DA21F4892806B4539E9357376B24145658C3 WILLIAMCUNHA
1,666,246,269 *AF526DD254416CAEB487C2CBFECDF093EFB4851A WESLEY.NAYES
1,666,246,270 *AF52BE29078AF64E7096D62AB1990DF0A2282F91 willieemery
1,666,246,271 *AF5CC91FD8BB7F4A844637AF070C3CD6218797D8 TALKMARGARITA
1,666,246,272 *AF5E746821B2026DB5F14C8452EED95ACFE08535 westonmeneses
1,666,246,273 *AF51C7F8BE9C69AC23428D3DFE8A01423BA49A87 R34L!5T!C4LLY
1,666,246,274 *AF522708EA4FF6080382FBF6FDAC4A767B57278E wikiandreas
1,666,246,275 *AF59BB6F824836BDE479807376F9067B21CDD030 witch-hunt-ep
1,666,246,276 *AF500C7D1AC92B42ED90D635F2A322B84475F23C WILL.BULAN
1,666,246,277 *AF596FDA2A23BC3A89BB86DA54729A2644AED023 WM.SIMS
1,666,246,278 *AF520BC381D4E84283F49F6B2C4FBD525A0ECC5D WILLIAM-JOEY-SMITH-JR
1,666,246,279 *AF567D60ECD1E5BBBE0EFE80BFCA8A21FB10583C RAISE-YOUR-HANDS-(RHYTHM-MASTERS-REMIX-EDIT)
1,666,246,280 *AF5ACC9D56A2D491CAF804CA5F5DD4D10D13D63F WILLIAMNOCK
1,666,246,281 *AF5919A1EE24C3B8A1F2CBFBD48CCBEBAA11F8B6 RAMY SIEF ELDEEN
1,666,246,282 *AF5E919F5B70059BEBA95DC68D66D2F18E84D4F1 will.kenworthy
1,666,246,283 *AF55A71DBE50C0E560EC49C8AB48EE0643DB1EEA WOOXINRAN
1,666,246,284 *AF54C8CE1A410B75ADF1E86F0D16022B144D359A WORKERSWALKCITYCENTERSITEPROTEST
1,666,246,285 *AF50C9A16E1F2DB8F7733F4B4E4EB71A1B87A151 raquel275
1,666,246,286 *AF52E14E53EF5988400A02DA49E778F37C7D7211 wilmerhefter
1,666,246,287 *AF585CBF875E385F1DEC13435366DD9810E51CC9 wilmerlucchini
1,666,246,288 *AF526DAE265CAB44FB93086B0BBF6708994BE650 RAYMOND FLYNN
1,666,246,289 *AF5E657270540B6C003F408F576F16D7582B49DC [email protected]
1,666,246,290 *AF57587E60A2CF4A63252C733C0E44CF815F3D4E [email protected]
1,666,246,291 *AF5F647B1084177CAC8D537BAEB95DC459283CED [email protected]
1,666,246,292 *AF547A39158B72EA8EF538467FC84816EE6B7283 wv$j
1,666,246,293 *AF585C7F5EF6DE1267155A5428ADD33B6218D28F WMYAPP
1,666,246,294 *AF54ACE2D9783462E42C2B54AF2C84E3D34F8983 terrazz0g
1,666,246,295 *AF53B876F6978766FC6AF1DCC39F57679A1BABBF RDHGUKTB
1,666,246,296 *AF5C3D3210328A5A1A9ED4A523F78796178338BD teruggekomenen2
1,666,246,297 *AF53D5138F543CB018352B0F65019ED0231B5CDA REBECCA DILL
1,666,246,298 *AF599EDC92249100D9EBE40F6073BA585F72A781 WWW.SPECOPSTECH.COM
1,666,246,299 *AF5055E22A2BE4F7AE51B294CC02F1E53D1F75B9 WWWTRENDYREPEATSCOM
1,666,246,300 *AF5BE4B4271CBC4AB8CBE5AB09A01F76D8574E51 WZLRBSW0
1,666,246,301 *AF50999E01CEC21718EAE186802471E22C868856 TGEBOTTE4
1,666,246,302 *AF57848AE639B106415A76599570D9848A26CE2E THANH.CYPRET
1,666,246,303 *AF5FC6BC1F1388E28E7E722E780A9F5DDEE87AB6 THATOPENUP36
1,666,246,304 *AF53E94D4D7A987DABB3FE1F8C34C59325AA4C6C wwwezorangecom
1,666,246,305 *AF582348AC7F94DBE8F9167531D32AA6DBEF708E reedkitt
1,666,246,306 *AF527563F3F80AA56A5565D4586D0A235223392A THEANTHROPISMN7
1,666,246,307 *AF57765F259ED651AEA41351C2358999B6657F3F wwwrusidearupart68
1,666,246,308 *AF5674F75A2AA0EE3A86136356AD49D69CF92DBD THE-COMPLETE-ATLANTIC-SESSIONS-(DISC-2:-PHASES-AND-STAGES)
1,666,246,309 *AF5268FC617632AEC5C16C345F5544A0C0F351E6 TheEveningWorld
1,666,246,310 *AF52EAE857FB9034EDB7C8B1ED4ABF26AE0066AD XHTPZTV
1,666,246,311 *AF56C38F4D6E1DA366EFC1D96BCB8E6279B2EC62 xhudoki-xin
1,666,246,312 *AF528EC96B1BC79976C11D63B75E648FDE342CAC REMYA-LAKSHMAN
1,666,246,313 *AF543B75C5D01A1A5C342C4F0FA2932E10B11527 THE ONE WHO IS
1,666,246,314 *AF5B33E077E0EB157B4F39979864F5E0A5719B1F RENFORCE5
1,666,246,315 *AF545B9CDF2DFEE74F84C815A6825B3CF4D723DF the secret life of brown bear/alone in my principles
1,666,246,316 *AF579AD7B0FFE3C1B95752C8EFC8D2A868DC7142 THE SKY IS THE DAILY BREAD OF THE EYES.
1,666,246,317 *AF52BAEB3FD25D79D1535C4F2CCE751A5D725A01 THESOARINGOFTHEHERON(C
1,666,246,318 *AF538544642209F0216821CE1FDB153BA1ACDFAB YASUKO HAKAMADA
1,666,246,319 *AF5845AFC4E97D3792D10C986005C2D0025ED0D1 Theurge5
1,666,246,320 *AF51CC76496C52715CC4A99B3EB48DF9CDAF3809 [email protected]
1,666,246,321 *AF563B12816DF860F1A47A539E90886AA7EA8DDC responsible
1,666,246,322 *AF56691F55E8CA7CEA92921F43B210CC4100164F [email protected]
1,666,246,323 *AF56538488980C5B621158FB7D9C0A4177F97DB5 [email protected]
1,666,246,324 *AF5130AF0EE0402E37BB4F68CF02E34F9F45ADB0 rexniten
1,666,246,325 *AF5A9648A141C41D4D266B7DF0593FC1E7ED9CB7 REYNOTRADE7
1,666,246,326 *AF5C54DC7D40C93643E19841449BC9050867AD4D THURSDAYSBDCS
1,666,246,327 *AF558E687415614CF16AD339F830550F5DB4520A [email protected]
1,666,246,328 *AF58F648E12AEF211028D24F40107A907D9B6C3F [email protected]
1,666,246,329 *AF557A48698CE34F5A73959269E5BD313B17F86D RHETT.BUSBEY
1,666,246,330 *AF5508B2D9D402C38F61BA97FBFA3DA2F2C72608 yonjan.hira
1,666,246,331 *AF5D2A4FB939305C37E43A8D4471257D297E7EA1 [email protected]
1,666,246,332 *AF58C9792BFC53FD08CAF3DBCA2FE9772CDC1E43 YLDRAWORFNU7
1,666,246,333 *AF59D8AFFAEE530D153F1B06A6C04008074385BF [email protected]
1,666,246,334 *AF59137CA2C806DC32F0200244A2BCEF8CAB2F18 YONATHANPONCE
1,666,246,335 *AF5CD7FF426E5D11ACDB34F4E81422A621AAD1F3 tillieca
1,666,246,336 *AF56225D539A74740680D3F3B9B668E5BB223935 zacherycassavaugh
1,666,246,337 *AF5D1224B2A420793E9F9B66935268B2727AD4E3 [email protected]
1,666,246,338 *AF5BFF3DF053A8F1BEA7F4EE0D7102CBDC827560 ZACHERY.REDUS
1,666,246,339 *AF5F0EA6009632CB93B2A93577209D333AD1399E [email protected]
1,666,246,340 *AF5069439F80F8F2BB4222C08F158D878ED38DFE titonawf
1,666,246,341 *AF50641B17A60D1122AEF4B1159ED39BAF339A79 tko%
1,666,246,342 *AF5D0495A4C26195F1BB99EFC0259DCE240CB3FA RIVER_RESCUE_28VIC-2
1,666,246,343 *AF571C7CAB609E99C70182CD8832F1EA186EEB11 ZAIBY.LEO
1,666,246,344 *AF559834B65A5B4F39F5B04AC5F71F9699EE5381 ZARZALOED
1,666,246,345 *AF5A7115B85820DDDC5347E6D3C22B5C1DE4825A ZCHNAN
1,666,246,346 *AF56C0C5FA71B7E33C6F2E6A394C86658EF9939D ZAPLATÍŠ
1,666,246,347 *AF58B51CB0663F36007BB7F691543A6E814BB5BB ZASHAB
1,666,246,348 *AF59CF44506D24FFA2B544411A36A47FFAD127FC ZEENHLEKHUMALO
1,666,246,349 *AF5EF4CCB09E1453652A23C5601CDA8DBC978B21 TNIAPESAERG
1,666,246,350 *AF5CF5EE441728F455D2B8335F67755AD9FA26B7 TOGETHER.(CLUB.VERSION)
1,666,246,351 *AF54A3CFA2381B953E5EE47CF026FCE7F3EF108D tomasbusson
1,666,246,352 *AF5514DD4E4AD4589D100C2D3B5C02A608C881D5 [email protected]
1,666,246,353 *AF546E8489F920B02C41A1351B8BCE8FE805158C TOMMYHOFFEDITZ
1,666,246,354 *AF5D42A15792947ADF92E42A665105AE90C43FDD TOMMYRINGER
1,666,246,355 *AF505920EE42AC97E6E233F7F57B743A60E91EFB TOM SKIPP
1,666,246,356 *AF56FBF74C75F6BAD2DBCA7C6F1DA962BD307362 [email protected]
1,666,246,357 *AF52D983B53EADC83385F44A7CCFA2E53D9EA4DF tony-montecalvo
1,666,246,358 *AF51C9B189E8A0F8DEA64C0F5F4CECEEDE60B060 [email protected]
1,666,246,359 *AF5DD012BE870FCC33D3452878801555994D0CD4 TOPUGLIESTBUILDINGSWORLDUNVEILEDBEAUTIFULCITIES
1,666,246,360 *AF5EED2454F4622E5C05F5C37B207DEE22E34ED8 TOUREAREMOS1234
1,666,246,361 *AF535CE44C7FCF762976D4EB8480030237F1B99A [email protected]
1,666,246,362 *AF51966ECE101555470C1EC0214BD203EF69F035 RODOLFOBREAM
1,666,246,363 *AF59E65C73E9AA368DA6CDF6E3BDB4C9846352E4 RODPIVIN
1,666,246,364 *AF52186364F0ABF1F1E5CBD5C9290B1C5D3900B6 ZINATELN2
1,666,246,365 *AF5B16B525EB5BAFF78FDCC99F9A145C193C200E tramyararghrn
1,666,246,366 *AF5EF49F9712AD677E0A13383FAD8A34C19341D5 ZUG-ISLAND-DETROIT-MI
1,666,246,367 *AF515627EDEE9E04A0A95BC79F6A36BDF7CB2C4D Z#VD
1,666,246,368 *AF5D2D933092B59EFBB8D9CD8C14A6125AF03E8B ἹΕΡΕΊΑ
1,666,246,369 *AF57D6A193E13A2E3934D16F0B88EC8F288B125C trilhoes6
1,666,246,370 *AF52011DCAB09B1BED7C0A3170A3765B2732B436 royalsamanda1
1,666,246,371 *AF5EE8E303A1FB194446E20CBE2D4B0995924F37 RUDOLPH.PILLER
1,666,246,372 *AF5C86D8742FB024F44926882CE445F0A1FE3990 RUDYFOULKE
1,666,246,373 *AF525A09CDD67391CECC52C5CBF37489832BF8A5 RUOHOINEN
1,666,246,374 *AF53CC739DA4CE7720A67D72438C060AD8627DB6 TUPPING
1,666,246,375 *AF5BF6EE0BF8CA5E6854B5BF9FFE1456650D13F5 МИХА́ЛКОВЫ
1,666,246,376 *AF55BD096A8E53ABD8BA0F7EC89C91DD558166A5 RYAN.SABATELLI
1,666,246,377 *AF524FFB6EA6DA15C8FAF1BF8F59D567050D5854 [email protected]
1,666,246,378 *AF5B36ADAAFAB680EBAF28752DFCBE2F83F852BA [email protected]
1,666,246,379 *AF57F921033D675F90E220C262A98F0B1913412F ПРИДОДАЈУ
1,666,246,380 *AF519E43A3413A1B7FB18787AB9BD3626F4A98CE СЛЕПНАТАТА
1,666,246,381 *AF5146FBD0A46C267C24D22EB03E5FFD4DD1F5E0 ЮКИТО —
1,666,246,382 *AF57A6CE48EF2180AD565F8F6FC2318ADB8083AD КРЕСЧИ
1,666,246,383 *AF531BD6CD82A3DF983D3387CD451606E9B4BA9C ЛОЖКАРИ
1,666,246,384 *AF5E06B0E7B994BAAC60FF704C01B370F6A9BEEC «МАЕ́СТРО»
1,666,246,385 *AF557644B8A1301C823BA129A9215DD4BE1563ED TYRAUCCI
1,666,246,386 *AF582D0FCE5D05A1B5A35C160D2490300C93ED1F SALMUVÄLIN
1,666,246,387 *AF50C8F48FBF969677419C73AB06DB5F5070E04F 可以通过使用一些支持JTAG的应用程序来访问JTAG
1,666,246,388 *AF564D10DED4AD7AA9AA1B0F664C6D3383C4826C sammieshary
1,666,246,389 *AF5C3F025CB12833FC651DFBF49832656A5B776E UERDRAMA5
1,666,246,390 *AF52CDA0A16FF83C62B8D90725718BC03A523055 sammybeanie
1,666,246,391 *AF5527DB93ADA8C714195B9B2E94AF9BCFE0C98C UINT.THETIMER;
1,666,246,392 *AF5BB556921EC70C5D9A68DD12F09B4CE8A7C7E5 UMLECKOEMESLNCHING
1,666,246,393 *AF50360BF00E7D6A7DF2B8F1EF00499B2CFADED5 SATANOLOGIES
1,666,246,394 *AF53DA564C132CFB83141DEE3D5F92F8D4BBC674 uoguojd6
1,666,246,395 *AF579A6270029AF0FA0C83ACFB1C8CAD1E6854C6 VALERIEHELP5
1,666,246,396 *AF563BF803A9C8AB4D0F66A2E1CCF6C6839F6E37 semiweek4
1,666,246,397 *AF5294297603B974B2238C4180404DF74A5CBBFB SENIABRENTL
1,666,246,398 *AF5415CEE094958DB5BFB3D2217F91373D5ECE15 SENNANA
1,666,246,399 *AF50DE20EB66C64286F1891B7F1705690FE390C4 SESLUAHXOB
1,666,246,400 *AF56F09DF54C42E4A32BA1B3F928B1ACD7C49B05 SETSYLANA6
1,666,246,401 *AF562F0BB527B80BD234818A20DD5DC64F83982A Velati
1,666,246,402 *AF5F78131489FE6085293692AB477BC878D1651B [email protected]
1,666,246,403 *AF5500B81D2C849782A2A070EBFF3011ECC948F1 [email protected]
1,666,246,404 *AF53BC5BB7B13919CBCD3B8F8F880B0BAC8054C6 SHARIEM7
1,666,246,405 *AF5833EBF7B09D29F4CB5ABC9FBA22D08D382CF8 SHAWN-STAUB
1,666,246,406 *AF58E68BC86F655630D15B8340A83C902DCD37A2 (0_<).O~.D------P
1,666,246,407 *AF598EAF013E9CFCD0B67EA2389A7AED258E3EB9 SHAYNEKRESAL
1,666,246,408 *AF5C6D8BE439141FB49B5F51E418AE7013A75C6F SHEISASLEEPI
1,666,246,409 *AF502BCACFA083523CFBAD7C763CFEC632BE15FA SHELBY.DEBAETS
1,666,246,410 *AF51CC08CB7AF17FA789686E86F52D714CD4DF03 v~gb
1,666,246,411 *AF5FFDC09F00D660DE594CFF7E32808719283EA3 11-29-1185
1,666,246,412 *AF57F54A22372C02CDDDF260E8668ECFC048DAED SHERWOODBURGY
1,666,246,413 *AF57AF96607E7B9166AE427E2941A57C5E40E419 vierzacke
1,666,246,414 *AF5F05C4241C470FB7D4AE9807031D0CA5D0E473 VILLAREALEM
1,666,246,415 *AF503A418702AFEC35327BFAE8BED4F573355A13 SHO’RCHI
1,666,246,416 *AF58E57F6D07B7B19EC2BC7A30B8E353BF581411 siberiansummer(differentversion)
1,666,246,417 *AF59D63A6C1D8091BCAA6A0B59E0C5D6B3F83018 VKOLBPFBINIS
1,666,246,418 *AF5C3F9A4EA4525706FDBC13A70CD8189A856740 VLB
1,666,246,419 *AF523B3A5B9ED1D856ACFDB62199B89B4603A476 VOICECRYINGINTHEWILDERNESS
1,666,246,420 *AF5B9B1B447FD78FB912B9BED7A055B05E9CB3F5 VRIJELIJK7
1,666,246,421 *AF5669675CBFF77A2FD4FA44C70D41BEEEC2109E .{1AAA
1,666,246,422 *AF538F375352F34C51778EF9504951A8EB6037D8 SKYKLAP8
1,666,246,423 *AF54759F756D18F63C3E40DBA5C75BD0B4BF184A wa88le$
1,666,246,424 *AF5DD4502E279B8C17DE6B901B5AE439E24CA889 SNOITACOLLA9
1,666,246,425 *AF5302E6BFADB800E8B7634563515E8B25DB2754 „waldmärkerschaft
1,666,246,426 *AF5CE3819C287B51FD435D4C9416E5F5B8EDFD50 WALLYFLANNAGAN
1,666,246,427 *AF56484095853E8C633672F333E9FDEE8E7B6CBA solmoisan
1,666,246,428 *AF5522030D6B2225D06FA737FE61921A8978B767 SOLZAMOR
1,666,246,429 *AF5CABA3865BB1F446CE285DAF6DC93A07703A2C 1035531 BUTTHATBYNOMEANSENDSTHEUNCERTAINTY.
1,666,246,430 *AF5E7ECDCEE210ABCD349974B1DB69B68879FED3 1049807 frau-stadlober-machte-sich-sorgen-
1,666,246,431 *AF567C373D782E5FEA0AD068920B7B0F7C4A7452 1070S–1080S
1,666,246,432 *AF56A411BB81D1B7E8509D1A0D667EE1F1F226FD 1103751 tekstitjaharjoituksetk
1,666,246,433 *AF58F190A9432F776B464BA53A0BD58254B4076C wa-q
1,666,246,434 *AF5BD5AAAE4DC3F3CD61DB387FA02FC570561D19 1GANARLOS
1,666,246,435 *AF5E9DDBEE77938C3664F8ADB42EF39381B9B9C9 1240191 AND.WILL.THERE.BE.PEACE.WITH.THE.NATION'S.UNIONS.?
1,666,246,436 *AF54967B6B63D6419DD15B7C2E448D7F8CB6A0B6 1 GSM-DATASIIRRON
1,666,246,437 *AF57293A5A7061E1066707B6CCDA044466C5AED2 1309969 ekoportti-hanke.k
1,666,246,438 *AF57D866DB262E239C61D94A1B523AE1E965F3DA WAYLAND SMITHY
1,666,246,439 *AF55374CE30CCFF66D372326A85CD005B5FB6FC8 WDC197
1,666,246,440 *AF5019BB631D1783F3EE3C56A04E7091D8053A45 1-INSAATINDAN
1,666,246,441 *AF5EBAA8137A879767DDC466E18F846D5CB7EE7F SPJEVOVA8
1,666,246,442 *AF54AFA13B8A1F36AB795D2789717176A1974DEF splato~O~d######B
1,666,246,443 *AF525FECB9B3776368774F522BB935C328B5A186 1669295 rask-jatkaa-:-"-sivistysvaliokunnan-n
1,666,246,444 *AF53B78EBB63069A5BBC7E862C8353679CF166A3 169katherine
1,666,246,445 *AF5314B12D155F739A3958AB332B9F9575E291C3 16osallistujasta
1,666,246,446 *AF5B6EAEFEF44FC8A3ADFEE050A27FB39A3F2D00 sprnrmlty.,s//p/@/rn//r'm/&/l//t//
1,666,246,447 *AF5EF740A0286A3DFF63C323E8E240737DD8D1E2 [email protected]
1,666,246,448 *AF58171CCBF14AEFF44DCF8A94AFCE8C0AE5A32F spurlin
1,666,246,449 *AF5903FEBA3FB6A11737323881C7312FEF2D250B 1MYXEDEMIC
1,666,246,450 *AF525F3609B33B605C914DE7F2B3BC907AC982E8 1788408 DAS-IST-EIN-SCHWACHER-TROST-.
1,666,246,451 *AF535067471574E7DC245057B0A15776E5A55BC6 1 PERINN
1,666,246,452 *AF5609CD2B0150BB5FACF001CD0679AD9F28DBA8 whitleynyaramba
1,666,246,453 *AF5030BFC953F7A7171F7BBD0AD1FB7BA9196F41 wigeonnoegiw
1,666,246,454 *AF591F9027E327ACCF54A93D1F09E8CC6B815989 1 ROPENGLANNINVINTTIKOIRAAN
1,666,246,455 *AF5758E8B67C123778823B43CAC67F89DAA5E4D7 1-SATUPEDAGOGEJA
1,666,246,456 *AF5C225837DA3DED895ABE6443A8B1518EC92E73 1SCHLAGERFETZEN
1,666,246,457 *AF51387EBCE6B19DD2AB1290D524F950CB376A10 [email protected]
1,666,246,458 *AF53D34559B794F82EBD8773074BC07AB5881B8A WILLIAM GEORGE BUTLER
1,666,246,459 *AF55B84589DD3DDC2C5A055217CE705001208635 WILLIAM MACGRECZYN
1,666,246,460 *AF5CC6407638FA317F114782B8A649900B97CB54 WILLIAMSHAKER
1,666,246,461 *AF583B6B3C37F4A0A8F8D800AD163453594AAB7C 1-ANABRANS
1,666,246,462 *AF5B6EA3373658694AAD373C808BA8936E81793B 1anklebte
1,666,246,463 *AF569231115385E0489DC4958B833D17D2F94693 1.two-franc-a-go
1,666,246,464 *AF5E124ABFEED97C41272F30FAB91BCD977DF184 1 VANHASUOMI
1,666,246,465 *AF5C90471936E8A26C1C47623B9591BA18D6C7CC 1-veroluonteiset
1,666,246,466 *AF59EB10C8EBC4657FE84A90A04F9363A5A98E68 1VERTRAGSGEGENSTAND
1,666,246,467 *AF52339400FE701F3E42570AA048B75FC7D2085A WILLIEMBUGUA
1,666,246,468 *AF55F914FAFCA4357DBC880C1EAF587819C5EB6D WILLIEPARRA
1,666,246,469 *AF52D51D9377D3B9404E810FF57903BE605279DD 1.vieraspelaajien
1,666,246,470 *AF55E9C3ED92E393DB21B2F0C06D425B7242B87E willie.yan
1,666,246,471 *AF5A603CFB5D62710A06B3D253757CB0FBF8AC9B stephanifrog1
1,666,246,472 *AF51F3D84A9EA8405CDE38705D1E53808397861A 1 YKSIL
1,666,246,473 *AF5C59B2E539C82296AEB25F6C9E9F813D613582 203e67b247203f36be6c88c4f05a04f9
1,666,246,474 *AF572845D6EF65D2E82A29D7E48D138F8C9F537C WINFRED.FOULKS
1,666,246,475 *AF56E20B9D4234FFF29B8B6B48A518D26C4BD280 winfredyokiel
1,666,246,476 *AF5BC20470B463DE477781C4523120093B53DDA8 STINKYPYTHON1
1,666,246,477 *AF58BE827F491929E45486C0A38DCE74CF9E0D0F stithly6
1,666,246,478 *AF52E7AE54685DEB96E91B9727B9E1F6EAA6FE5C STRAWBERSNAPPLES
1,666,246,479 *AF5BE09D780990D8F2F9C3C47ED7AC4FE19717B1 WIWIMACHER13
1,666,246,480 *AF547515DEB59AB13776C340AFEE7FAF638F76E4 w-n~
1,666,246,481 *AF58B9539F93FBA6F42E9E1A5EF54BF5DDD252B9 1-gau-generator
1,666,246,482 *AF597029C4F59838CF04D1F46450BEFB1A7C8460 2424328 OSOITA , ETT
1,666,246,483 *AF5DE8B9B2F9AC452857581FF41E367E67503008 2457875 presse-war-dort-nicht-zugelassen-.
1,666,246,484 *AF5005B9FC1ECD4A576B0AC91F579DB5A8458C66 1.hakeutuvillekaan
1,666,246,485 *AF5D1E8A4383FE9053E25B7B8A83E75B14B88149 2513550 KUENSTLER FUEHLT SICH VOR DEN KOPF GESTOSSEN .
1,666,246,486 *AF542151AF50F6A95EEA0C38F482ACC598D1998F 2584615 lagerfeld:ja,manchekenneichfastauswendig
1,666,246,487 *AF52014D48B2977BB43AC2FA7092403340C301AB subclasse
1,666,246,488 *AF53CFE467DD784AD84258F961FC806342BF2C7C 2623216 HIV-TARTUNTA-JA-STRESSI-STRESSIIN-ON-MONIA-SYIT
1,666,246,489 *AF53DD2333AF7886D1F9445D816D4D9553C3B861 [email protected]
1,666,246,490 *AF506E8F8F0B9A3F940B513FF6464221D1B04868 26.kipuihin
1,666,246,491 *AF515D8177C389C8F7899646D0D379E760B2DC27 1 JOHANNITERUNFALLDIENST
1,666,246,492 *AF55109B364C2D4B2BBCA83995962A0B46133C3C 27oct1657
1,666,246,493 *AF5B942B858F4430E67D9F61BC813093678EF9AB 1KABAENA
1,666,246,494 *AF569EA216167B19216AD5AB71AB0C836708BD75 28 OIL-RELATED
1,666,246,495 *AF5C7A87219E1F17E24F856889C7159A078E12EC [email protected]
1,666,246,496 *AF5085F6F3B6E898C6960E52C9674F6030BA9E73 W:Z
1,666,246,497 *AF5E1D10189BAE298BA949B95E77B2C709496E4F SU%P
1,666,246,498 *AF5E889411F63678C4B31057ED32687368C9412B SURIMI(BONUSDISC)
1,666,246,499 *AF52D6D10643DD9DE60170359CF8B713C2620220 1KONFUSEM
1,666,246,500 *AF50ADC3ADF2B1DDC38006047369BFF411BF632F SURUJEETK
1,666,246,501 *AF5FBE869044FB82FEF9FDC410F4C742B525C776 sushmita-gupta
1,666,246,502 *AF5B3FD8EA256F35C4DEF248556452A2688B31FD xierila
1,666,246,503 *AF5977D1DA526220839070A5ED9AA2F065585A0E [email protected]
1,666,246,504 *AF51F6BBAFEBDC101E091CFDAB5CFBC91160276C SUZY.KARIM
1,666,246,505 *AF5AADD127463F8050E111306668ED38E903E7F5 2.futureohjelma
1,666,246,506 *AF5F2F3930FC1DEF18C44093FF02DB73C0F157BF 2-HEIMRECORDERN
1,666,246,507 *AF51F766A0621E265B93F05A6F9EED8A5BA83632 SWABNVT0
1,666,246,508 *AF5D01136D4A5ED28150AA45098028415D980F65 symphony.in.c.major,.op..2.no..3:.i..allegro
1,666,246,509 *AF5BC8699903050E1BD94EB25A41C01C09764449 syunmined
1,666,246,510 *AF54F7EB69E1FBC186B49AF36A3A78BD1E96E9AD YACIRETA1
1,666,246,511 *AF5E3C63208F2107B668E92BF10FE919683455C5 1.motorfreien
1,666,246,512 *AF560DAF8B92AEA29D59C31F2D5248A2314C0614 1NG
1,666,246,513 *AF5E2DF8EC4952579681C36777B291E4869A61A9 390490 REITIN VARRELLA OLEVIEN IHMISTEN SAAMA SUORA S
1,666,246,514 *AF5BF6C3F6940F410BB8D4018F557265D244D34C 1.PARTEIUMBILDUNG
1,666,246,515 *AF55E753E05B541888CEDBCEF6D368179FB94E9C 3achrze
1,666,246,516 *AF57C361EEA7D203EF4456C6EEAFE441E4B11899 yianarenn
1,666,246,517 *AF5B8B1A9564D8040B5269D7A4F4F84499E05623 TB0NE $T
1,666,246,518 *AF57053346897765F9BFD5B907C64661497DD174 1 SCHLAUBERGERN
1,666,246,519 *AF53E79A0701493A6DFCB728FFD4FB221EB52525 YONGSYRING
1,666,246,520 *AF5D33196DE1AD6ED6ABD90ED950E97D3357CBD5 TEKIJÄNOIKEUSNEUVOSTOSSA
1,666,246,521 *AF5855A0AC938AF1C282FFF21F1E59ED7CA14CA7 TEMMEKSESTÄ
1,666,246,522 *AF51118EE0238A7ABC926E3C97F1A2D7364FF7E3 TENTENNAS
1,666,246,523 *AF5F38DA2F2761944AB91A882C4244B156CB59CD [email protected]
1,666,246,524 *AF5DBE9A27614DC7A92967B7CA49B32F58325DD3 [email protected]
1,666,246,525 *AF5950614F3B139E620ED750F01D05574082A200 tetrabel
1,666,246,526 *AF5BD5D496FA4E8B19895CFC8047515140824FCB YVETTEWANN
1,666,246,527 *AF5BFDE60312A2D36F7A6565FD6B8AC3B6F3821F THADDEUS.LILY
1,666,246,528 *AF52BBD1D93D9FE62EFADDD568F6B28FECD60F48 YVON PAGE
1,666,246,529 *AF504FA94731097C122E2BE8A8AB12AE77229F95 THATDOITNOW1
1,666,246,530 *AF59D8D88527D3794060AFC257E3A6FC42E5E345 3ILUVDATABASE4
1,666,246,531 *AF500F2FEC6E6EE2ED36BBDC9870CB47CF40D8BC the-best-christmas-ever
1,666,246,532 *AF55E9CF9EBD8167C0C55E994032CACD5CC47450 ZAKARIE.BALDWIN
1,666,246,533 *AF57E43C74819179D4326874A7076A5E3761F0A1 3#####@~O ~o >B0
1,666,246,534 *AF5E2BAB05E841B4138B71D8302EFC72FDA65A64 3> ~O~o)x(
1,666,246,535 *AF50A4B5551D5C2C9C97FD5BA1F4808BB89D19F5 ZEKE HAMPTON
1,666,246,536 *AF594159948B0A1F58A1A3CF4B3D6E5068C37B43 3---)~`UU
1,666,246,537 *AF5D02F72041DD29A2A13D2DE7DA90E984D6405A thelogger96
1,666,246,538 *AF54170B5C22DF0BB543A870E02DDAF1B284B495 [email protected]
1,666,246,539 *AF5419205E7E44CB58B3828B14174B41AD2B29F6 [email protected]
1,666,246,540 *AF5332715E82142794A70FC3F885EF6906FBC39C THENEKO90
1,666,246,541 *AF551C9759232C5218C11C541F0459DA756EE512 [email protected]
1,666,246,542 *AF50018A8A8257D5F3A775773F470A2BD4B904E7 458231 1-eylul-2001-ve-yasak-
1,666,246,543 *AF5248A82EA37C7E12F89DB7CC094D5889D3C4B5 THEOTELEOLOGICAL9
1,666,246,544 *AF5813DFB23DDABCF434B2BE14D048F80A370B1B 4 esyasina
1,666,246,545 *AF562D73ED3E8F4BADFBF09A041BDC1EED695859 4fon
1,666,246,546 *AF5FB3BA14564186C8F79749D456EE6F2891828E THE-SAME-TO-YOU
1,666,246,547 *AF566B470345E6EE6FD1E82D324F6F3BCE046DF1 4iamspeedo6
1,666,246,548 *AF5845805135D13694662C3FB14AFED59C29D169 4KOLKSDOO
1,666,246,549 *AF51F736538A2481C674B0C8135930453D3AE3F9 4.MEDIENFOERDERUNG
1,666,246,550 *AF59C47B3AAE7DC24A256AAD88E36410523B7857 ZOUCAA
1,666,246,551 *AF528F9FC83CBCF4A3B7A8FB919A74320A041200 ZOX.MIST.HEMA
1,666,246,552 *AF5FF373ACA3983C9812FDD64F0D48E20568DB6B THYDDANS
1,666,246,553 *AF589A4D9C4D838811C94D9902D764CF9152CC91 [email protected]
1,666,246,554 *AF564E69EE88E7EA6585161173EFE8848A45E982 ZULFAKAR FAKAR
1,666,246,555 *AF51B07E82EAE3CD9D1F85C2972686E5B6BE0449 zulkunainjusuf
1,666,246,556 *AF519EC31C9979A68A485CDF5433BDDE315F6CFD 4PERYKLESOWE
1,666,246,557 *AF5173F5AAA8C521C58FA63F488C0EA2129C6B1A 23101060
1,666,246,558 *AF5641B9EE69BA010CF63A4857535C4E7B22EE5E 4RAITHOR
1,666,246,559 *AF5187F82A3DCEFEBB8CCF971D60461E658469B9 zydowo
1,666,246,560 *AF538F03BB7BCB783E6504CDF1571015CFBF7ADA 4RSOEHNST
1,666,246,561 *AF551EF82FD8984BD3EBF26957E5B4D2C754C053 4SPRITEMALCOLM
1,666,246,562 *AF5C0A80C505E5EFB7355EFECD9991702D143EBE ΚΆΡΡΑΚΑ
1,666,246,563 *AF5896743C80B4A3FEF3E0FDB26AF79128765320 4TROGRADAIENT
1,666,246,564 *AF59707901D4EE2B51539639032C84F0EF6B8C18 πτακισμόσ
1,666,246,565 *AF551120C5152DC6C8F1859DE33334A37189570E ΡΟΜΈΟ
1,666,246,566 *AF5BF3CC4617231FCBEF5A7FFC6CBB16FD6AD6DA 4UDITOR-G
1,666,246,567 *AF5932A800BABBBF67FDE40396561F340B229AF8 АНДРЖЕЈ
1,666,246,568 *AF5A557C0A995E2B10C738E2EA6C2A0E87151459 БОГАТИНЧЕВИЋ
1,666,246,569 *AF5330984DABCE25FCE8BC885D0DDD4551872C15 tmbldwn2
1,666,246,570 *AF58AF053D5DB81F8642C5E8EF62D3B619EF9506 TOEGRIJNS!
1,666,246,571 *AF5EFE4581A954CC6DA1E296257FDDC2995433DA TOTENSIESIE
1,666,246,572 *AF556CCFFFE20D606635E5386718266190B755F3 traceybobsin
1,666,246,573 *AF53C118573BFD99C8C28A495FFF4DE66C99F1FD 5CARZBSW
1,666,246,574 *AF5FF705850E810041C0EE7D2CDAD22A68D9E26F TRACEY.GARDINIER
1,666,246,575 *AF5ACC92AFDA44B952132BAE955AED51EDB1D658 trachtzeit
1,666,246,576 *AF5F952A93C58337806F767A35159657A61BEC6D 5ep4r4tion
1,666,246,577 *AF5EAD26F20BC462DAD60B1C248654CB2849CB3A TRENTONVEA
1,666,246,578 *AF5E270A0B7E48E4101F7F20B68C2328BD261F35 TREVOR DEANE
1,666,246,579 *AF50C13D5AD55601B06400A39E38E7C478147AE5 5GRIEKWANASIE
1,666,246,580 *AF57C69BB42D51B27C2043AAB6EA56252E9E3A95 TRIMÁGUS
1,666,246,581 *AF5D4D5877655CAED5AC6F8397DE73FE99D8DFDC 2APPUTHURY
1,666,246,582 *AF5F8DFB1DD2D1427D55BD24557657C443B475D4 TSEMBEKILE-MNISI
1,666,246,583 *AF5D52CE61E3BA7AEC7481D36F9AB0702982778C tshepiso-mokhachane
1,666,246,584 *AF57973DA12AE4C55E67E289D285E022F4466461 5OLIVERLLOYD
1,666,246,585 *AF5AFAAAE4E6A5A07644C8DECEBF12A08CC270A2 5OSTRELOVANICH
1,666,246,586 *AF5B7D0FED3E1BE6BA2771328A9E0D516013E205 5PENNYSATURN
1,666,246,587 *AF5BFA961BE694F549E563F75A89FA85F27A4F91 5PROFERIRLA
1,666,246,588 *AF5D3E92F79D98C79B59AE551BE021E4D657F4FE 5RUFUSTHUNDER
1,666,246,589 *AF5DD89BE4C95D6EA01AC4FD2AA50A62B9246BC3 5SEAROSAELOD
1,666,246,590 *AF51F60C82AEEE0C3FE75A8F315B899187375F67 5SIFFERMANN
1,666,246,591 *AF58B081AB66DE4B80DE3BFC58708AD28C54CA8B 2kulttuurikielen
1,666,246,592 *AF545386E16598CB703F0ECD15E0F584300964CE 5STARLETTERS
1,666,246,593 *AF549B06DCC0B971C006D83F82AA67E410E4E28A 2 MITTAUSINFORMAATION
1,666,246,594 *AF5B6EB0E8974DEDDC8A3E89495955F002FB3699 TTCCAGCCACTCTTCCTCTTCTGGGCATTGCGCTGGCTTTTCCCTCTGCCTGGAATGGTC
1,666,246,595 *AF5905715D0468884D0AC53A73DB9F4D3312CF96 5TOMONORINI
1,666,246,596 *AF5EE7F18D840D46A9C1D0B0ECB1753E5A54CEA0 [email protected]
1,666,246,597 *AF5F702EBE01EEAEEFED94E458B4046DFAE9D403 TURKESSA-M-GLOVER
1,666,246,598 *AF53DD7F83754A278AE0477B9C6374AE2ADDECE7 2.tutkimusalueessa
1,666,246,599 *AF5EB4DDB2EFC9375E4B0FBEA1021F099F2154CD TWENTY-ONE YEARS
1,666,246,600 *AF5070B23B8A7001A82E0738832B5E0F02645715 6+
1,666,246,601 *AF5A74396E8B42855552B8DD59357479222D56B6 31-12-1742
1,666,246,602 *AF5BE84C714BA617C8FDCD87D87D352A189080DE UITSTOTINGENS6
1,666,246,603 *AF54292F476CD6D66AF865D6DB3F7E8124C7A88D UJWAL DUA
1,666,246,604 *AF56336C46C8A0FF15FE6B9EA17ABD6E826F3C91 6.EDH
1,666,246,605 *AF5B6CE574A3948AB283CE98CC038D5A358ADD89 351callum
1,666,246,606 *AF57AA8D07374B4B661052F37212E9EAE470FA3F 39PARKER
1,666,246,607 *AF55C2B98286CA3016B06F13D2D1BC9060F6B8EF 6MARYJANEDRIZZT
1,666,246,608 *AF547865A0A31ACB3721AE42DD87EBB7C4351CA4 3###).~O.~o3B<
1,666,246,609 *AF569950AF4EE912A7853D95947700B6D153B1D7 [email protected]
1,666,246,610 *AF55DA254E10E09AF87011DE9343C99920A09941 USERAOLL
1,666,246,611 *AF501F4AD843E00A9D2E59D37F259429972A36E6 USERHARNER
1,666,246,612 *AF574A7F417B69954FD0926E86054D1C07D160A3 3-PICTURE-PRETTY
1,666,246,613 *AF5D41E7AF97E522919BEA00A5053ED3CC92AA9A 6SNAKSECC
1,666,246,614 *AF571576599DB1F6558ABDBA613BDCB93510BDD1 6STRANDLBEREN
1,666,246,615 *AF537EA8FB73D8060586AF60466EBB8DF094E13A 10.24.1050
1,666,246,616 *AF57D3AA9715A5DA1BF055C828106C8CABB0430B utleveleben1
1,666,246,617 *AF58CCE902ACDB7F5A1F8C7140C185E3715DE54F [email protected]
1,666,246,618 *AF513DA6D1D4DB65D09F600DDDBE05B6DEBA7FB2 73589 dOrdUncU-olarak-UC-boyutta-oransal-uyumluluk-.
1,666,246,619 *AF5927A85F770EF328C38E0F06B04243E62C7819 UZIVATELEM7
1,666,246,620 *AF5260B6F2449E3880385115E3F0677C9B8809EF 441rohan
1,666,246,621 *AF5BE04D09D5A058D10B84B6B91C77EA0D989832 759ali
1,666,246,622 *AF598DBDEBB9412F785908E5022117E484A4D2D6 valda-butlin
1,666,246,623 *AF5832DDC3D0CBCAFF366F9E4560F6460B6D798A 7ASSOCIATIONANSCHLUSSBRITISH
1,666,246,624 *AF58C5C6CF9A471F736F0F73E876040864AD5F90 1359913 PUHDASVETISEN-KATUMAJ
1,666,246,625 *AF5497D069E18DBCE1FFCC443F6BD9B2FC54FCD7 14.SEITSEM
1,666,246,626 *AF537665F64B1FBFF05A70C47BE33EDC64E7916E 4JOSHUAVIPER
1,666,246,627 *AF5067240C7712916BD0545DFB8FFDDB888F7675 4KKELIKYLN
1,666,246,628 *AF5E94FD0CB51F03918E3F8CE09CA7DFC46E6FC4 1652526 RUEHE-LEHNTE-AB-.
1,666,246,629 *AF51C83CADF1791589923C873F6B290522C9D7FF 1664125 JULKAISIJA-:-ARKISTOLAITOS-P
1,666,246,630 *AF5012758317F9E619F571834F909DB005160F8C 1678490 DANIEL-DART-IS-BETTING-OTHERWISE-.
1,666,246,631 *AF5D2EBF87789900C514F50870619679717595D6 16-expedition's
1,666,246,632 *AF55D7D85337E6C8916727C6D272A7759EFF30E0 170313 WIRSBO-S
1,666,246,633 *AF5F569B004C052422732D2B1E458779BC6516E1 VANESSA MAE MAGPOC
1,666,246,634 *AF5BE13FF038FB11B2ED9A0536B79BC686BA815D 179HILFSWERKEN
1,666,246,635 *AF5C02EE89B6D55A1CE3A64ADBBFB1F643CAD795 17.ertragreiche
1,666,246,636 *AF5371350B4C16DBC9A69412640FC69ECB1406C1 7FURCAES
1,666,246,637 *AF5EEE617C987F284B7E40190DCD1A222DF27F58 7HERSHEYKATHERIN
1,666,246,638 *AF5AD0E888E324F89503979F1EB5F65715C5B43E v-chen-eng
1,666,246,639 *AF56062AE04B3F3E8A88909E1907AA86DD1506EE 7INSTITUIDO
1,666,246,640 *AF52E3B8B4C593431EF0DAA3A42C003C7C3C53D2 4n+m1+4r5m
1,666,246,641 *AF5A81C3DC7B3850C8E3EA95839725E83224AC49 1863340 hommatodellatoimii,t
1,666,246,642 *AF5DF3D46C8028A7F29D86413D1A3345DB19BD7B 4ONLIMELIMITLINELINE
1,666,246,643 *AF58B75FF0A98E603C7A9089102AC54E8EEE2509 7MAGGIEROCKET
1,666,246,644 *AF58595ADD4ED246C40FD9D67C20CF072CF42454 1906644 JOS.OHJELMISTOTUOTTEILLA.MIELIT
1,666,246,645 *AF59C80EFAA219E5428001AAE72C26F770FB76EC VENTO D'ESTATE
1,666,246,646 *AF54D823E6371255841921A3D632826C7312238F 4RKSLYTTERS
1,666,246,647 *AF5AD5639F0F6C32648DA4139B6C061F491C557F 4RRGUCBSW
1,666,246,648 *AF5BBF55FD5CBBC39FCCFF62DA337ACC0EE9AE06 4.STIFEL
1,666,246,649 *AF5E502474AB52BAF8E87A917CB9E83E715719F0 7REGREBSH
1,666,246,650 *AF5A3702335949F5B741D0866C233F15BC44E333 VERONICAVERMONT2
1,666,246,651 *AF5F048DBFA053D404FACBCF713803CEEBABE241 1-ajoneuvolaskentaan
1,666,246,652 *AF58E7F4BD09E60F4ADB93E2BEEF84BEFD70A9DA [email protected]
1,666,246,653 *AF5BAA0FD5CAC3E45F0E89B1AF17A9B1F778D902 1ASIAMERKITYS
1,666,246,654 *AF5076F071DA09BF4CF5FA4FCE75EF59F14C1F8B 1.ASIASUPERMAERKTEN
1,666,246,655 *AF57AD5115E8C05855167C1C8EEE5F29D0D843E4 1.baSarabilecekti
1,666,246,656 *AF523781E3939449F827DE0DFBC50040A7B2B362 1 bergstr
1,666,246,657 *AF5E1A3DF93C5BF705F046754973A867815097D7 vickydelaroma
1,666,246,658 *AF54C0C8AA309F8D4223D3BC49F55A4D6AD8614C 509716 KUNTOREMONTIN KESTO ON 5+2 VUOROKAUTTA .
1,666,246,659 *AF546146C844C6027E9CC6943CE773ED8A672DCC 8####>~0-(>_<)
1,666,246,660 *AF52B92E84644966844EA26E435E9E02E0A8BB4F VICTORIABULL1
1,666,246,661 *AF5A42888A35DE719B9B52B5426B796D3CCCE545 1DILINCE
1,666,246,662 *AF5168E85EB09651D32AD5780824A49FC70A4579 victoria.itsallboutmenow.byers
1,666,246,663 *AF57CB78F40020DEB79E540D558F37F14609C689 VICTORIA.PARKER.QUINTY
1,666,246,664 *AF5C50B7797EFEC158DAB8D4EF69A668F50D8B8D 877houston
1,666,246,665 *AF5F5D521CC79C0E5AD6F5D055F592D9DE2387F0 8BENDROFLUMETHIAZIDE
1,666,246,666 *AF5C2C5F92B79FD83154B5C706F7620524050653 vimbayi-evelyn-danha
1,666,246,667 *AF5AC0F7A01A49EDEC45F69109BDC4AB2E5156E4 1.frauenbeaufjutragte
1,666,246,668 *AF5A732E4CCD1A4D3D7C17BE4D6D69FEE5A5803A 8BSWSOUNTECBSW
1,666,246,669 *AF5B8881EA5482B2D0B279C931F11A92C51507F1 8CANCHASES
1,666,246,670 *AF5BAD73B273207C9DEBB22C5847E9FF1FF8F831 8CLANGOR
1,666,246,671 *AF552B625262FA50DEB8A04B387CFCC9E2A51637 1heinepreises
1,666,246,672 *AF594E171A54D3CA9CF55ED18948DD5F5290BAD2 1-HODKKIN
1,666,246,673 *AF5480A4961A05A05521E128D83B46AD450DB48C 8######d~ ~ ~}x{
1,666,246,674 *AF5372CB7F6C3F3BFE3FA8BDBB22CE6DAF240A04 vishwa-ranga-wicrama-surendra
1,666,246,675 *AF59FC0EF3FDF0EEC451B0C7496D1FCC4622CE57 [email protected]
1,666,246,676 *AF5C1C2E306654DC0451F90C85854C068B0CF095 VITO.VALLERY
1,666,246,677 *AF5557511954D0E81E9B5AF225ADBAF7D8551517 1KANTONALBNAK
1,666,246,678 *AF5292A5DC8D299BD64A0F6DB34B3423D524978E 1.katodisuihku
1,666,246,679 *AF51D65D2D6E4C7C7B6C8F13591CE6CE230F7CAD 1.KIINNITYSTOLPPIIN
1,666,246,680 *AF5F6A1B82959CA3FB282BB9F33473DFF23275ED 1.KLANGERFINDER
1,666,246,681 *AF53BF8714D619E88B22830F3695B9F4C7F4EA2C vncl
1,666,246,682 *AF55110D5BEEC2D1F1BAFAC3939151B9A3F5E61E 1 LIMPSAAUTOMAATILLE
1,666,246,683 *AF5E1C67BFCE2C691B6A1B5E3D4B672DF114F5B4 8LEGENDFLIGHT
1,666,246,684 *AF5E4931D9FEA842334AB1B44F77F6D767507061 1MYJOHNNY2
1,666,246,685 *AF544E7D5C749CBEA9D8E2E9D67652C855A2CAAD 8pelasgic
1,666,246,686 *AF54D3C2DEB9DB3E7EDA4F69691DD4DBAD90C003 1-ogrencileriyse
1,666,246,687 *AF53C59E38C9209B04E71A9DCAA9F983557A42F0 VSTAVNM6
1,666,246,688 *AF5C11770B6EC21ADA1CF76B8ED0FE66F81ED00F 1POLTTOAINEKULUISTA
1,666,246,689 *AF55681C2917384E5528D28EFD7DA25DF92C5120 5ICEHZIRPK
1,666,246,690 *AF5F0B4D61F789A12CDDF4C72C313B6A55C14AEA 1RAHA-ASIA-ALOITTEESSAAN
1,666,246,691 *AF5CAD302584E92877109F2D55944754D48F2A73 1-RELIABLE-BUT
1,666,246,692 *AF5F65DFD7772D9F0EA630A84DCD17A72F1D1294 WAJIIB
1,666,246,693 *AF53B796288574E2DFC0897A6998392012C141AC 5KGEFUHRT
1,666,246,694 *AF51456B88ACBD7C161FAEF6B2158C214626E550 walkerbushovisky
1,666,246,695 *AF5C064CF22E239DAF4DDF0D241C46A5940B6326 WALKERMOLAI
1,666,246,696 *AF5E1270AB8677687AEE5245F61A5FE4EC644488 908916 Oncelikle SunlarI belirtmek isterim ; yalnIz deGiliz
1,666,246,697 *AF54E7462170DEFA76839CA7055C1E54EB2B2149 [email protected]
1,666,246,698 *AF5A5524B615161126E6C5861DD4C64D1262ECA7 1-tekstitelevisioj
1,666,246,699 *AF51E979D56090D055782AA6714D0A28A196DBCC WALLACE.NARDECCHIA
1,666,246,700 *AF548FA85AC518BB9CCB75F5904E086959BFD089 950octavio
1,666,246,701 *AF5CF0F2FF40A9FFABAABD5BDCDBDAF2DDAD22E1 [email protected]+OR
1,666,246,702 *AF5E0EED18798123E537F6DBB0291CFB3A0CD126 1UVPITOISUUDESTA
1,666,246,703 *AF560658DBECD22496AD185D985F14B2C962E341 1-VELES
1,666,246,704 *AF577208FB0BCD48225F1F5E6851D2C6A464135F 5P3R5CRP7N9
1,666,246,705 *AF51EE973D4F9C6997FE8A61834E1B00D31FAFAE 5quotato
1,666,246,706 *AF5D62230EFB1C498736855EEC4E4614F95DFA65 5SNOWMANMISSION
1,666,246,707 *AF5EB865536D0AF0B4E9961DA0A14084E178ED83 5thedickens8
1,666,246,708 *AF5F04B08D5678AEDFD847B97CF231BA1D51E92E 5WELCOMESHOOTER
1,666,246,709 *AF56E11C9264D30FBFF736DDED2F5D36A0A45712 9IVATELOVU
1,666,246,710 *AF599ED66D9C793B2E8E124A18FBB2B6767AD704 9LOSERCHRISTY
1,666,246,711 *AF5D4D5AE235043432CDEAC5E5A38DE61E9DAF78 9MONEYMOLLY
1,666,246,712 *AF55D12D52D99A57350BCA9B2595CC751951EA83 24.PISTORASIAN
1,666,246,713 *AF5A967E216DBAA98DE89DE51E42B612E89EBFC7 wecamewidit(feat.infinite)
1,666,246,714 *AF5C342E6BEBB8A5E2C8319752FF9EC0C9526737 256534 MUTTERIT.,.JAKOAVAIMET.JA.R
1,666,246,715 *AF5E93DF605FB3B1BEF3349C6846BEA900167E70 [email protected]
1,666,246,716 *AF5CB8607F6FECBA3DAF22ED82FCFD2BFDAD7CE5 [email protected]
1,666,246,717 *AF5D13D13D548483BA6121D737A73F4AA20DF13B WELFWELF4
1,666,246,718 *AF5D68128782424016B8803538B9B81DA66B4378 9propylalkohol
1,666,246,719 *AF584C25580A9B2125AEEA70A9F90B90BFAA430D 6BSWNSDOPUOCBSW
1,666,246,720 *AF568AAAA66F040983BE97B7D1A9523BC93574D0 9THEQUANTITYOF
1,666,246,721 *AF5867ACF43517347DC1E8B45CE0A32B14503978 2928286 insgesamtrund24hektarwaldbranntendabeiab.
1,666,246,722 *AF53E0D3145FE7F6F0ACADB1C2539EEF1AD75F41 9VILLEDOR
1,666,246,723 *AF50F59D58631AB5169514DFC3891E2AEEE988AC 9YTISOLUBAF
1,666,246,724 *AF55C287269C487E4893E604A4870B4F37EAC620 what.heroes.like.best.is.themselves.
1,666,246,725 *AF573B6EC09164C006E692A2A532A339F668260E A0ACJ
1,666,246,726 *AF56C579710137569EE039A8C67AA221141A1B2D WHO-STOLE-MY-MONKEY
1,666,246,727 *AF5F5567B7545754E6DDCE6CE8B79C4EF2CE49F4 2CEPTIONS
1,666,246,728 *AF5E84AEC9BDFA7D1E306D28AE2EF27E1371D9B4 6HAPPYDAYDOGBERT
1,666,246,729 *AF585D906190D2AF311A40E6D1173BE94AA464CB 2DOOLBEUR
1,666,246,730 *AF59C1326AAC0050E647BED84FC75F39C03EC7BC a3/4
1,666,246,731 *AF511787232C3B4EAC0613CB0F8F97D98ACBD205 2 GALA-DALI
1,666,246,732 *AF59B466E59EAA839164F805E88469DC1DA0EE0E 6MDTVBSW
1,666,246,733 *AF548C9473BC76F2390CC63D904F98DC3F8044B2 6.militaertechnischen
1,666,246,734 *AF501F3E6CB82E999A96FD661E844EAA8E5BCD9A wilfredwhisted
1,666,246,735 *AF5BCF990063204F5C1A265724B00984ABEEC919 2-HADDEN
1,666,246,736 *AF5B543103FF6BE9A80B0540327E153DDA6DBC07 2-HINABZUTRAGEN
1,666,246,737 *AF5CD6652671A79A441167648C45F079E228C9DC WILLIAM-BAYLEY
1,666,246,738 *AF55C31FE36DFF0829F01EB2052B900B964B1C1B 6OWNERSMODERA
1,666,246,739 *AF5116623C19A82958C0BE98154D73BE3EB9BD9B 6PODVINE
1,666,246,740 *AF5D02DF12D40EBC98F8A5A8030ED0D270567724 A7GM2
1,666,246,741 *AF5897FF092050682896A6A6AB36DAE7F8B92B5B A8(AL
1,666,246,742 *AF5C25E845215FD98F69BE1A28C7D19D812CB84D a8_hg
1,666,246,743 *AF51282FA42732382C272F502B44897A1EE97366 WINNIE-SAN-JOSE
1,666,246,744 *AF598905490BB4E63FF3A8C5814FA7A1A404C710 6TINMANBRONCOS
1,666,246,745 *AF5BB5E23A58D0316B386537808FF37FDBBD01C7 wisewise1
1,666,246,746 *AF58663DEEE568D9E388B6EA3CA435B45851B45C WMR155
1,666,246,747 *AF562BC62992EBED280A8BE4F822027187EE1413 WODSCHOU
1,666,246,748 *AF5F84C6E39D8764A637D8BF4A0FAD0940176BB4 AAA/J2
1,666,246,749 *AF5887F36BB48AAFD28C88D62EDE1CF07BAD14BC woodscal
1,666,246,750 *AF51131A6DD0D136C0B7841791C0C72C480526A2 [email protected]
1,666,246,751 *AF5C0D43A8CD18ECB0FF6A7CE17058BEF222119E AAC}$U
1,666,246,752 *AF5734903750F2CF5B75A06AFD98E9783D8E70B0 3AKBDANKBOT
1,666,246,753 *AF5692FEB06D2C6C5A5761E1B0EAF896B1677992 AADNB%
1,666,246,754 *AF5853AC4E275AD0331DE34A703B0CD05ABEB94B AAD%_Z
1,666,246,755 *AF58DB918D1AC84F6FAFD975A3DFCD16569667F1 3 ayseminaari
1,666,246,756 *AF5D6D52959428A55A81B9E0E9D28EA9723CF46A 3===b***
1,666,246,757 *AF589E208744661F8F6916969973F85D5308AE00 AAEZP-
1,666,246,758 *AF554BA890642AB0D2FEC4BC7A63252F7E7E3219 www.allart.orgpinu
1,666,246,759 *AF5C2FB3CE339CF45C457D131FC313C8AD77EBA2 wwwarizonaridorg
1,666,246,760 *AF5A4658B4D245142C44468F7DF4617248AC5ABF 7ETEUSED
1,666,246,761 *AF5A500564D29876B12AC8AD735B8DE108FDB2E3 WWW.HOUSTONSTMERCANTILE.COM
1,666,246,762 *AF5D22A2F103916E578E7CCB5A8F2672D9C924ED 7HALLITUSYHTEIS
1,666,246,763 *AF5AAF1A47423515AEC0021349B9BD2AD80090B9 wwwneedhaycom
1,666,246,764 *AF5C27A3C6A6D72FA41CC1651E43802035617D5A WWWQMATICCOM
1,666,246,765 *AF565C7883F347DE12D9921A52153B9D65D19603 wwwsocalbubblecom
1,666,246,766 *AF5DEB191B3FC5D5088F41301444CCEB57F6E4CF WWWSTONECPSK12ILUS
1,666,246,767 *AF57BE0B0D80F846447C68C56B8AAA1E659D092D w^}y
1,666,246,768 *AF5FBDE41590147B6CEA89A980C19E7D60E61F41 7IAMREALITY1
1,666,246,769 *AF563A3ED600375CB6BBE91345945D5A0350FD70 abortion
1,666,246,770 *AF5596B4CD9D4DFF853B1CF6F63CBFF9E6C4CAA3 7MOUISSEM
1,666,246,771 *AF5CDEC6D498110E36B922AE2A33476D06DCCBF8 3PITANZA
1,666,246,772 *AF58AD5A9442F155DB8628833C4583CB36F7F3E3 3POLLUTIE
1,666,246,773 *AF5410794F3E6D07945C76DE6B8C9238065A99EA 3=p***splat
1,666,246,774 *AF590AF4441801D904E8174073333496527EBE09 a$brf
1,666,246,775 *AF5EC507234C7986F9C98F21B401FE0318435E71 3----->.~.`.SPLAT!!
1,666,246,776 *AF5B890A7BEDC5D28928DDC0F265D5BF96DC3EB5 3theminou3
1,666,246,777 *AF57683F7537420604868B5B2ACCB328100E7066 [email protected]
1,666,246,778 *AF5507F7833EC8636DF28763556DCE982B182DBF 424MAKENZIE
1,666,246,779 *AF541CFC016FE6DC6A3CFD0294CCC11CEDB76683 acga1
1,666,246,780 *AF5D4E3D6D30665C618F3A333FFD5B62D8C567B5 XPE+
1,666,246,781 *AF5744BFC7742540F5F730137BF136F2DAB3D0E5 XYZ359
1,666,246,782 *AF5CC3E04C2CC90CB9424023B1A885B2810291C7 494329 INKILAP-DUSMANI-OLARAK-SORGUYA-CEKILIR-.
1,666,246,783 *AF516A9A08BAFFED107C50F49251BB102B62F6F2 ADAM JESSE
1,666,246,784 *AF5C0468282DE7673387B6C6EA13048767080D08 ADAMSHETTSLINE
1,666,246,785 *AF5B6B5B6C74195F061E7612AF3DE589A1ACBEBA 4.BUCHFEST
1,666,246,786 *AF51BC9BF0560627C098CA8192E313107A2840E4 ADI1910
1,666,246,787 *AF5ECAD720FB62E13721627C8C39F2E12D05A28E ADINAH-JAVED
1,666,246,788 *AF5677AA1379049EEBBF732ADD68A8896DD9F53C [email protected]
1,666,246,789 *AF5A9A336ACF62D7112888886E33D78D8FADAE89 aditevel9
1,666,246,790 *AF5A80DE7F41886B33DFF0816BDAE59B2D4995A6 4.hervantaseuran
1,666,246,791 *AF50AE6422097BF0431A1A6BA884E04039B48ACD a.dmb
1,666,246,792 *AF591FE8B73377E2693178781A6D551A34F0FDBB ADNELOK4
1,666,246,793 *AF585A6B1BC1243DF93538F073DA1D8FB04D9D57 7SUPERTAXES
1,666,246,794 *AF5389500CE7353EF9BEF72CB9066131B10C30B1 7VEKSTMARKED
1,666,246,795 *AF5780772C1ED91623260F796E768DFB316004F6 ad#x!
1,666,246,796 *AF57208C3BDB46CE442498BF0D3EE8DD6AEE3827 7XYLOIDINE
1,666,246,797 *AF5169BEA4959A9BB00C95DEF21F89262D005DFA 801OMAR
1,666,246,798 *AF5780A86944A95E774F87D21920B963C6360233 804leonidas
1,666,246,799 *AF522C91B1F5C6EE865CF528664C04F54F361F5D ae;hw
1,666,246,800 *AF5BD7741005C73E4A6A0D94A15810581DBBC80E 4NAILADEAD
1,666,246,801 *AF53B076B492758D6BFC29B3A86C744DB0A57870 4OHJESAEAENTOEJEN
1,666,246,802 *AF53E77B2D079409E59661E24FCE39396AA3805E YJLFOMNB6
1,666,246,803 *AF57C84B2D8EDF09C46E64ED72810432D8B90233 4TAKEBYTHE
1,666,246,804 *AF598114EEC265DEA638921DEDA931AF9A4C532C AFGND
1,666,246,805 *AF5DC5F3030DC7D86780B1F8395F7598456C25B5 YOU DID NOT HAVE A HOME
1,666,246,806 *AF5D2A0FA85BE7545D8B24D98E01EE11B89AA78B 4XXXNONE
1,666,246,807 *AF5E73E50149A308925797C36636C46205F15823 AGADADASH9
1,666,246,808 *AF5180139B8C2E86787DB5EF1C7021C226A41D50 you're free (radio edit)
1,666,246,809 *AF581F8C1344D4B8699FF215BE2CC3EFD415DE5F 4.zeppelinhalle
1,666,246,810 *AF593C1DDAA02E6ADEEC75D0104E39C61617248E [email protected]
1,666,246,811 *AF523D84F5CE270E79BE207D7482C21029B068D9 AGGROSTARZ2007
1,666,246,812 *AF54809A9D51FF02AC204D12A8BE27EEE1F61D71 55euinstitutionen
1,666,246,813 *AF51DE8F4EBB81D71280285393A549C3B202AA1F 55 What are the alternatives to DES?
1,666,246,814 *AF5C4029689AE301DA9AFE2A2B5931DBEDC3CC0C 598AYANA
1,666,246,815 *AF511134A751FB7090C76F96D020CE299CCC8245 8d.~.~.~><
1,666,246,816 *AF55DE225E46F37B063007D3A6AD37237848FCE3 5COCKSPURN
1,666,246,817 *AF514BAF9DC80F8AEF7C81662A16C99B15660A01 8ERABFIUHCSNI
1,666,246,818 *AF5E6F454EE47855906D66CD8A22DE81021E8071 8ERENEGEG
1,666,246,819 *AF52625C971EC788BBA29EE9BDAEB4C9306ABE33 5ETNEREX
1,666,246,820 *AF5613ACFA78439B7D302BDE8AC373A33D72AAC7 zabordar8
1,666,246,821 *AF50705A769718581ECFE793BEAD57F8CEB75A5E ZACHARYWILLIAM5
1,666,246,822 *AF5886BC582726C3DB4A07AB0C1CE18DADF575D6 8IZGLADIH
1,666,246,823 *AF5ABC9011832B974166ABB6F7A3A2A93FCC351B 5IODHYDRARGYRATE
1,666,246,824 *AF590EDE5B5924EAF20FE5E6B811B879BB1E7854 ajelemaa
1,666,246,825 *AF53A429B5393BBFB6721BD62EF036B4689E2A60 AK9WM
1,666,246,826 *AF53929B89E52B4E534B24FFDEC326F983F40EAB 5PHOENICACEAES
1,666,246,827 *AF5C1FC2E31C418DA628A035623E87669E185C86 5PUSHHPITAU
1,666,246,828 *AF574C4862898FD446AD4BB9EC3B35058ED8D9BD 5questurino
1,666,246,829 *AF5A15ABB007D1AA796B0249E0BE106917470501 5SAMUELBUFFY
1,666,246,830 *AF55199B0B66CC4BCBBED865D6804CD0B12C7CFF 5SEITCIDELAM
1,666,246,831 *AF5426787347EA8DAC8DAB0964090746290A856B AKNLG
1,666,246,832 *AF5F0F86B5759E43C7336E75FA4179B5B43B5685 8POLYGRAPHICE
1,666,246,833 *AF5684BC7F93B6A12111FA2C570983D7A15C1220 8PPPPIANO
1,666,246,834 *AF58CFFCC441167C38B786A0615F8C163EA0A682 ZEMERI
1,666,246,835 *AF58FD1767E87A7400BD2DDD1E08E1492A416677 albertnavar
1,666,246,836 *AF5B41C77A5ECEFB7E5AA81D47AEC707D6C4D5E5 8##)`splat
1,666,246,837 *AF54BEF42831C294625650457403492CB72852E2 ALDO.BRODBECK
1,666,246,838 *AF58DD7F993BB4179EC71096286BEC3A3F4640C9 5YLLANOITCAF
1,666,246,839 *AF568EC0B0D4ED9D218A7D512654CE7061DFB591 6584FEUHT4EWR9
1,666,246,840 *AF5F2A6BB6CF4A70DE43B1907136B50B9D95BD8E alexandrjacob
1,666,246,841 *AF5DE4A2B82F6CBD0E3A628B07F2755F89B987F4 [email protected]
1,666,246,842 *AF5C1930EC3AC267989A02B43E3315F5F010A999 [email protected]
1,666,246,843 *AF5B068434775535455F9784145850CDBEF237C7 ALFONZOCONIGLIO
1,666,246,844 *AF524C615D71DDD95204A846360D172AF2EF6F5E 6BCHVPA
1,666,246,845 *AF511BF7BB5A82A1037C069F01CA7301EBAAC161 [email protected]
1,666,246,846 *AF5403884A0DD4ED26BCCE3E098EE563CC7023D0 ali9w
1,666,246,847 *AF5309D513A7D255A173B0F2A57E8CF6BE4C3042 ZKAZNKUED
1,666,246,848 *AF59EA5D6C3C8A4EBFED5BC0179B4408E9B87545 [email protected]
1,666,246,849 *AF5327AF94DDE3519D2C0406B87D99072BBB2B3B 6ECOCRACY
1,666,246,850 *AF5B854A63C9C2E278937FFD95336F41156C8DAF 6ELBANIFNU
1,666,246,851 *AF5BF3A67CB1D63DA3D815DFDE47AC8C9354E11B 6FAMILYSONICS
1,666,246,852 *AF544741F8D82099939CF0E9199CE034BE095C17 ALKOHOLIZUJĄCYCH
1,666,246,853 *AF53826326A7C6B6A32E180D2019BBF91D3ED5D5 ZONDRA-DUNAWAY
1,666,246,854 *AF5965E099EB354F22AD5C29017B54121CD21EF2 6-inducts
1,666,246,855 *AF536F5A78B5E35C6D4CB6E80F762E6AF71239FC 6KOPACKAMI
1,666,246,856 *AF5E6DFEAEF8EFB2465704C980E0B24F6EA59936 8surpaiera
1,666,246,857 *AF5E367858A15886E7028D45092D8E70CCB92B41 6LLIANNOS
1,666,246,858 *AF5EA1311F15984B532EF9D9268FF41DBB7F6E39 8TFPAZEGB
1,666,246,859 *AF5A2FE0647B0242AB038FE1A53DB10EA6397498 [email protected]
1,666,246,860 *AF5D6A0E5E5405B588847FD08138D460CE97E874 ALREADYANEMIC
1,666,246,861 *AF51A16EB2D4DCCCA432CB9612991B7D3993713A alsetina
1,666,246,862 *AF538C50586E16BD9450D6B898B4C2E81C98D253 ALTHEA-GAYLE
1,666,246,863 *AF51CD321BDF5BD80032B62B2446C14A215F58D2 alt?o
1,666,246,864 *AF583698190B42A09AB0C2C4F34A5404996972B7 936279 ALLESCHAUTENANG
1,666,246,865 *AF587CBEF99BD60693BD486DD60BFEE58B7A1F7F ALU
1,666,246,866 *AF5FA041CB8B40A765B34FB797B686C3615CB369 6.pitk
1,666,246,867 *AF5FF3292F6EB5C1775F95E7095B8B747F05A66C a(!m0
1,666,246,868 *AF5A3723BA18D34FCF89106099022BD9BF040389 βάκοσ
1,666,246,869 *AF5AF1BF7037A2469193A2A1376B4C93A2F89C4E 6STRITTEDES
1,666,246,870 *AF5E8691FC3B3955CCEFF11B734854DF01F2A7D0 6WESTERNSCORPION
1,666,246,871 *AF513058D69D1EE64C0A270CE738D6A9D1609056 6ZGRATLREP
1,666,246,872 *AF5FDA5835CB194DDDD9256299BD2809C5F7567D ΚΛΕΟΚΡΆΤΗΣ
1,666,246,873 *AF57035A1868521E280B89E3B8E2FC180D7172BE 7AR7AGLIAI
1,666,246,874 *AF5150F8C21AAC0B37DAE2857A30F301700E4601 969142 AJANKOHTAISEKSI-JA-T
1,666,246,875 *AF568D2024515FAB84412DA89BEF05DC64279549 AMATEURKAPELLE
1,666,246,876 *AF5AB2409D6473D2597952B02DC6A1664EE96287 7BSWLDXCORRBSW
1,666,246,877 *AF5060FF24DEE15EE753F74D464DAB6F127AFDF6 7CIZINCUM
1,666,246,878 *AF5334025A9C0A7898F1E7B448F609E40ED48C5B 7CLONEABLEOBJE
1,666,246,879 *AF57545C5D5D487A9B8449F939FA06156CDCD929 AMK08863
1,666,246,880 *AF5F4EC0C3E87C6CCE56059373F59F4E2A86244D 9ALASKASHEILA
1,666,246,881 *AF5BFF87596E5ACA1C70854CDB587174D2D0FB76 7ETAIERCO
1,666,246,882 *AF5372C1312068EDEBB6F7A2B73DB0D305C71D62 7FRAPPET
1,666,246,883 *AF509A91C4E2BA8AD84DFAE255A32A07A0ECEE92 amlst
1,666,246,884 *AF5A334BD30966C6E4E5BC0EA768E74FE7E34578 КАР…
1,666,246,885 *AF5475CD4C949C60226821CC87407065A7AFB3C6 9ENABLEPASS
1,666,246,886 *AF51A01B57BE072C9DE1F6720A264047B0EB0AF3 9ETOPBBVHYBQ
1,666,246,887 *AF56600074A0C678B30147B51A3C9A9B2D68E524 7MARCHAM
1,666,246,888 *AF5BA85F53D50BD7BA4B55CE5608E32E329D68C3 ЛАКЕЙНИЧЕХТЕ
1,666,246,889 *AF5CEEAAE7F3D9DE358B69E8352290586A237C2E 9GNILTTUB
1,666,246,890 *AF57B30F3F561D007D65EAAA023269C98B2047FC ло́хвица
1,666,246,891 *AF589F42496591B08E59AEF22904B9FAE3857E2B НЕИЗНЕНАДВАЩО
1,666,246,892 *AF57333E1089EC330B7FD12F3575DF034F32ACCC AN-DIOS
1,666,246,893 *AF5893EF08D87DFD9298B4397FFA43B870852D6A ПОДПИСАНННОЙ
1,666,246,894 *AF503D5D713263702FA996603980B1E7AA059619 ПРЕПЛАВА
1,666,246,895 *AF55B2F8F603F21777B51BCE1DB4397A6B6CBD96 ANDREASJUNEAU
1,666,246,896 *AF5BEF8AFCC15676272F1C9D3F61AE5D14E12DCF радьте
1,666,246,897 *AF541F7AA143542A79A3717B6764904CF92A1332 ANDREW.BRETON
1,666,246,898 *AF58BE56FAECB970FB96974408CB1C912CD354BD And.sleep.in.peace
1,666,246,899 *AF5049AEF5AA740246D24AEF148F6928EF64141B 9NUWEJAARSVALK
1,666,246,900 *AF5BC3A189DD10F30BB3F55FF76C62B01D624E34 7SUENDIGENDE
1,666,246,901 *AF58220897554ADA2067D932048C5B765EF360F5 7TONAALIN
1,666,246,902 *AF51193A7B26F6262B95E44449858C6F2F5EBC54 7VILTACHTIGST
1,666,246,903 *AF50C635C15767AA347447CFF746290BD0559C32 865740 THE WARSAW PACT HAS NOT STATED A FORMAL POSITION
1,666,246,904 *AF5B391D9B405EC0ADA7D5D363B8FF963F45C678 8ALEXANDEBEATLES
1,666,246,905 *AF514FB9E9BA14849E4CD6B6FB9D5C8980E7D6F6 8ARIZONABASEBALL
1,666,246,906 *AF52ECC1ECB172EF8AF539B0E43A9B2FF6854B52 8ASFALTIRANJU
1,666,246,907 *AF584A3ED93D0CA4471064B7D101A549F10EFEF5 8BARITONALI
1,666,246,908 *AF5FEC427A37E3CE8DFF1A23F7C866B59EFCCF01 УКРІПЛЕННЬ
1,666,246,909 *AF586173C3541315653185B18811D25D106F68B1 8DA7144CD98787EC0D953A61F05C54F7.MARIOKART
1,666,246,910 *AF580C1FF7BE73D2205AA4374898D31B543FE5E2 [email protected]
1,666,246,911 *AF54229B488ACD81E125D9CFB4D8845744DA66C6 9TOPGUNACTIVE
1,666,246,912 *AF51EFB0355DDFE4BA4B03E118A112FDD5EF7245 ANN5K
1,666,246,913 *AF5A0119859F93B1974C32AA860AEC4B08DD10C4 依據james
1,666,246,914 *AF512DBA3809BE075BF5A3FDD4A1BD851E665620 8ESPECULACOES
1,666,246,915 *AF5BD957670874671C211085E91595192A87F81C a-0gl
1,666,246,916 *AF50338A8C85B086048C0375E224404006AB81C9 8INDEXORDENS
1,666,246,917 *AF53AB6B786904AAC8E62EA28174533498555A17 8J<BAA
1,666,246,918 *AF5269D8EC9B2529C860D558FFD10BF6D120923B a1c5u
1,666,246,919 *AF502C3574DE7CB86722D9D2E19D79D6432D5DAF 8NOAHPOOP
1,666,246,920 *AF5CD91D7F19D54AF4D3AF1ABBE3F608ACB8EFB9 [email protected]
1,666,246,921 *AF5F3539BD65C52A432D91ACE52FF5D42CC3BFA4 approvalstatementstatement
1,666,246,922 *AF599DE4A7877E7E17D0717E512DEB5FD51D393E 8====P-`-SPLAT
1,666,246,923 *AF539623BCE7D6CC97E41E8B56BEBDAF13D24A18 ARCANELLI
1,666,246,924 *AF5456EDD81D76871741DDE812379F1A93B5CA02 8WIEDEREINFAHREN
1,666,246,925 *AF5B18221DCA7CBB4BBEF8DD80686F9FCECDEB74 9ARITMETIKENS
1,666,246,926 *AF5B625E6D7B02C78C7863B376016241687AA940 9BEKORSTES
1,666,246,927 *AF5051BEA6F7316F59963DAFAB0588457D5C189B ARNULFOPENNYWELL
1,666,246,928 *AF53228DC6C13B1C5A823AA4B9F4A897886864D2 A99110B61F653039C125741D00379A63
1,666,246,929 *AF517F974DFE9DA5DA98E9B6A83303F94A33218E 9CLEVYNG
1,666,246,930 *AF55320B33B18D71FE0F1FB8EA352B825C1EB26D a9+vu
1,666,246,931 *AF572C4C40B758D0A91AA634BCCB632B228E19B8 ARTISTHOBBIT
1,666,246,932 *AF573B50784E1BEBBA69B021086F431F35257624 に配信がスタートした配信楽曲。今作で初めてcd化された。江崎グリコ「ポッキー」cmソング。
1,666,246,933 *AF57545452C56EFB5E137CDFCD140AF84B9D9A93 9ETNAPAPY
1,666,246,934 *AF5470A574C0E6B67C9312013DBD4E1E8972B0B4 AAA<I
1,666,246,935 *AF5026C79EB91A0265CB64904755BC05BE422F3C 9IJAERJESTELMAEAE
1,666,246,936 *AF539B7D9DA490D343FE12EBBC9768E7E5BADF06 9iluvsaint3
1,666,246,937 *AF5C171B7B1A5B99A9EEDE08CA306267EE9003C2 asy&r
1,666,246,938 *AF551A3A71D9595DE686B1D56B1BEA0ACD4DB06D atelopus-chocoensis
1,666,246,939 *AF5CF08265E8225DEADC1F0CF62D132C5AC1A510 9papillotements
1,666,246,940 *AF50D74516528333408DAAABE7FDBA2E88C52346 A%U.+
1,666,246,941 *AF548E6F3B11270EE36DA5B987F9DB46D37D02AE (0-0).o~O~d##B
1,666,246,942 *AF57FC92506A2F362DDBB2C43CDE708C27858C1D (00)*.*.*[email protected]
1,666,246,943 *AF58A2E2385490DE898B8B44EE0688AE314B9B95 aaesgc
1,666,246,944 *AF5594C8D95BD308CC058C2D1040115FB6845606 042788am
1,666,246,945 *AF547C5F0A102DB2A7C3781CA80D6503BD08D89D )0(O~O~D===P
1,666,246,946 *AF5ADA88D53B426E3A23BE3F3B156ABD4BE1CC32 ayeu
1,666,246,947 *AF506576CAF93C55008E21DBFB7E249110FAC9CF A3KN
1,666,246,948 *AF5AEAE58567FF1D8F797D2341B60E534384253A >-B0o~.q--8
1,666,246,949 *AF570BB27571750909C5B8A0F72AD86F6B6F34F6 b1h?a
1,666,246,950 *AF5E02D21D539AF9B833B777DF439DDEC2F5D365 ABSOLUTCHARITY4
1,666,246,951 *AF50E3134ECE41E0A8871B36804E65322ED8C5AE B39658E4-88E3-394D-97D0-C6FE6F7938B7
1,666,246,952 *AF5C362F3EBC3B1567B3AB625CF167EDD9B140CB b3d5!d35
1,666,246,953 *AF51B0ED8C95D7A09764996D3DBDEADDBC2640FF AAA<I
1,666,246,954 *AF50F1E0AE8939C04D5E17C285E98721948595F1 AAAUU
1,666,246,955 *AF54AAEB807DB08EEE243AFE633E3270121C0A3C 177KAMDEN
1,666,246,956 *AF5871DEEDC06B7D2DCEE7E5ED7B979DF08F4B5A 18NOV1657
1,666,246,957 *AF564C2356E5E63F0ABEFB1EAA4A0E0334BFA51D aabw5
1,666,246,958 *AF5558FC66AA0450597538F815196968E2B78CE2 1ANDARDES
1,666,246,959 *AF5EAA0FBD2B170C0D437F1C508F1AD286743200 AADK1D
1,666,246,960 *AF51A540C2948FF9063884808CE91E5C92EF5CD1 @B!AA
1,666,246,961 *AF5B7CAE46E4853B7B6337FA914695156F5D6126 aadmu[
1,666,246,962 *AF5C23532489764892171883DC7176D574B67920 1-aufgetakelt
1,666,246,963 *AF5676370408D2D4AC76B44D4D0430E5F365AC19 [email protected]
1,666,246,964 *AF53D9DB2C93272491A3CF65561A9A4BDC52348D 1BUNDESLIGA-SCHLUSSACKORDS
1,666,246,965 *AF5DB34C7950FB484F0B89A9CBA13CF3034C2BBA acvvd
1,666,246,966 *AF5B3F0F61773F65B025AF1E0E6AFA0B1761BBE3 ADALBERTO.PEPPIN
1,666,246,967 *AF5B1589E6B1BB57D4EE6A71C4F6F097F42E77FB AARNIOMING
1,666,246,968 *AF5B05C101B26E418171F17A890E94874D15561E ADIAM GIRMAY
1,666,246,969 *AF5D475450B2C561DD0183F824DCE3C2C1ADFAB0 Barksdale
1,666,246,970 *AF51288C4F4B258C7C5F9FC4F84160E685D30AC8 abbassayshetriedcontinuetruceavoidviolencegazaisrael
1,666,246,971 *AF58FF369AE702EB6D243B003D93E74D400869EE BARRETT.KINVILLE
1,666,246,972 *AF537BE1C2302996C75884E22B0F04C0B0C7EBA4 1-ENTKRUSTUNG
1,666,246,973 *AF5B04FE174C06A6DDFC34FC7D723CE38D6A0E64 ADOLFO.CHHEANG
1,666,246,974 *AF5E37E38709000FB15A2B9F67868B401273C5BD 1fahndungsunterlagen
1,666,246,975 *AF54FB15A7713A6AE83A8799CB51E32F66A3CFA1 ADOZN
1,666,246,976 *AF5ADD42390D7F6B3FAE00DDDEC0CED3B515E14E BBFPX
1,666,246,977 *AF5800CF32B91E0DB6FE83963062A1AFACA0CE96 bc()2
1,666,246,978 *AF5210D1241B43263A8BB18D2B79AB41D1863419 acds3
1,666,246,979 *AF518973C9A8F07FA1F13229200CD31BE6A7AE12 ACPMA
1,666,246,980 *AF5D6731FBBF72D6879402B20F56BB20E8B89AD3 ADAM JAROSIEWICZ
1,666,246,981 *AF5EEB06A0B1B75F4F6287B692C70C93262048F7 aftrola
1,666,246,982 *AF568D6E0F9DC45C016053A259B9E34BA51A0612 1.LESELEHRGANG
1,666,246,983 *AF5904DA1CB8166B8EE28CB1A75FE80C7E516205 [email protected]
1,666,246,984 *AF519740D7BC1715C036D8EB0BD0F4B4104CF50B b=====d~~splat
1,666,246,985 *AF5656028B0D91DBC9081087D33BEF5A7844DE73 ADG`?
1,666,246,986 *AF5D35B7E2888A2BDB8CBEB67BA187A1446D6757 ADI1910
1,666,246,987 *AF5B3C09F105E48BFFBC705010B3B760139B5615 ag(na
1,666,246,988 *AF5D5819ED21A7626DE9850C64E7380417420248 ae9mw
1,666,246,989 *AF505E6875D78F8242562BF9C37D095D5C959AF6 AH4;K
1,666,246,990 *AF5B50E1281E7DB42513A4CB38351192FC645167 af,+8
1,666,246,991 *AF588308A9528139EDC09DC8B0416AFF2C39217D 1redisant
1,666,246,992 *AF504FDE4D642AC025DD93C5B334EF74EF52F4DE ai;46
1,666,246,993 *AF576CF05F34DE53D6CB3AA45565D293A2D22463 A/g
1,666,246,994 *AF5E2CA18249DC85BA370EA2DA4D25C168D51F01 1TETRAMERAL
1,666,246,995 *AF5CB81C5A0023BF2C6BA07838CC02E717D7F402 BETTY GASSAMA
1,666,246,996 *AF5E848832CDAE6B5576DFF4940D57CA0AE5F867 AH:0N
1,666,246,997 *AF5FDA9898EA963D083DC3B622AF7A6AECB83B02 AI(AF
1,666,246,998 *AF5ACC40B2DCF908D37CA0CE0277775B6F0CD86B [email protected]
1,666,246,999 *AF526967F111583EAEC576D1BDDA162ABA3C3DF7 [email protected]
1,666,247,000 *AF5DFAA4B926A82FFA6F6CC125A4C7D6676A243C 2058362 SAMALLA.OLISI.KUITENKIN.HYV
1,666,247,001 *AF5CF0C71F54018593A3A7223B5475C3FD06B34F ALBUMGURU
1,666,247,002 *AF55EA508C23D603D8A050D2E4F9BF8E9ACF454F ALDO.KAVENY
1,666,247,003 *AF59D8699346E4E5EDAE462D25FCD5CB92DA347F BiaV
1,666,247,004 *AF5785741126DB5AFCAA52C0C0BCD752CAE6C376 2231375 noch-heute-lieben-die-zuhoerer-ihre-alten-ddr-helden-.
1,666,247,005 *AF5B35E11172B05536A75707CC7D475945682195 ALEXBUENA
1,666,247,006 *AF55C88EAFE5A6265BF45833032177455FF5700D BIOSBIOS3
1,666,247,007 *AF5E8EAD54068352A5F1BD8432FF8DC6E379163B BK5N!
1,666,247,008 *AF5EE207AEC924B60C8D223AC7036CC3261E14E8 allochroic5
1,666,247,009 *AF55F0DA3E6D58CBFFCFCB7EB8D09B088EC8AF78 allsinglescomplete~10thanniversary~(disc2)
1,666,247,010 *AF5D1455028790151F2A3E5DEDB86F27E4219C2B 27APR1420
1,666,247,011 *AF57354EAF56C6C199ED36B802F7F42C7EA1AF7E BLOOM090102
1,666,247,012 *AF5984430D8A83F589F6C90CD0C516584654E728 ALPHONSE.SCHOBERG
1,666,247,013 *AF59BE5E38E472DEED55A96D4B1CDFFA3FA21F28 ambicije9
1,666,247,014 *AF550DDA89F73219F2AA72FAEA77D3916949F85E 2977267 marssin p
1,666,247,015 *AF5CC907CB0728F5080BF5B0B7316A01D48CF2DE B+mA
1,666,247,016 *AF56D3EE6AEC65D800317864B92681069FB654AC alvintigney
1,666,247,017 *AF58A330BF88B4513AA78F6FA1C28EDE5245B191 a%m/
1,666,247,018 *AF5A31E99E4C64E0E78B558E992A5383C25BC04E bmu.g
1,666,247,019 *AF58BC33AAED5DEFC3BB2902DFC9D33E84D8AAF2 2dieerschonmitdentalkingheadsodersoloueberdiejahrefavorisierte
1,666,247,020 *AF5E91A776BA9D73C22640103F2043B24A303561 bnkrvll2
1,666,247,021 *AF51FE2C5E5EA1CA0F0316FB8EBC5A99B5CBF2E1 [email protected]
1,666,247,022 *AF54389F32D5B01DEFD1342300BBC5B0419C16AB BOBBIEKARAGEORGE
1,666,247,023 *AF51CB5E31B10C91BAFE6ABDC5DC49B3E976C490 angenehmer
1,666,247,024 *AF528CE3FDF45DFA229E3E18433B8338F284511A 2STRMMEN
1,666,247,025 *AF51022DA247783CBA91A92326E9C54B65A0480F BOLNIJA4
1,666,247,026 *AF55691F69338A531A0EA47E1CAACD1082B1CA6D ANTHONY-VANEK
1,666,247,027 *AF5D1A8162C00EA51DF2F2576DDED4200F88DD2C antioneblatherwick
1,666,247,028 *AF5484D03B3E943CF8A3F56207CD54F3D3F25346 borabor(featsoniamilan)
1,666,247,029 *AF520F9E534E38D957ADDA7B50824CF8DD485E4C ANTONHALLIDAY
1,666,247,030 *AF50C3FB1649FE63ACF3120D00B5A2A76B219CF8 33-hoyte
1,666,247,031 *AF5E07B5C6CA11A6485D010C88C3664FFC4B66A8 ANDREW.GARSKE
1,666,247,032 *AF52355CA127A5D625CE343C8633FDABE9312671 ANTONIO-PENSA
1,666,247,033 *AF59773533060BCB863A9D4540F3244BA2D65445 ANTON.SUGANUMA
1,666,247,034 *AF598753CC650A6A5894E79FD2CB5ABD9D14C55D antonymyer
1,666,247,035 *AF5C37A742134A9269919E5CD9A9F51EB5B60D36 359MELANY
1,666,247,036 *AF581D36412CF89529BBBFC644263544741DDD14 ANEMIN1234
1,666,247,037 *AF52D83CAC5B93BD90AC3D2C4E84BD948DC4861A ANGELOHILMER
1,666,247,038 *AF512F1C268709BBF10B1AAA41CC0A7C539D6F28 ANGOLA.49
1,666,247,039 *AF5DDDF6646D09D662A8B860B6E33E35D423E127 a,og_
1,666,247,040 *AF5C3FAD0D805A71968253B15DDF1B9A8B4DFF29 april.cotto
1,666,247,041 *AF5E60C0CAB28E2EDD9F9CB5DD8BA0041678B154 3KANANUR
1,666,247,042 *AF58D38B6A36CF39F3CEEDE3C3B14B1294C4A4AC 3LI4$
1,666,247,043 *AF570E547FE2BC6A606409607E081D6CB17C9CB3 3-liikuttavien
1,666,247,044 *AF567E700944BC8ACD92737D8F9CAF450627BDFB APXR+
1,666,247,045 *AF51AC0040D79BD55EC216656C43FD88C56F3F10 3NISHTALA
1,666,247,046 *AF5D49F5D36670931F77B6E51B2751211DB18B6C [email protected]
1,666,247,047 *AF504C928B4132C4BE6954110186897B33859207 A?&QL
1,666,247,048 *AF53E33F601DEF9B84ACF3CB48942E9C1D28507C A=,R9
1,666,247,049 *AF511D69E395A385BB33EB4368A11A0F5871D3BC ARCHIESELLARDS
1,666,247,050 *AF59B469D1557B7AD025C7056FB2D5C67721DB7F AREAFTER
1,666,247,051 *AF5E7C5608340DA0C44390CAE94838DE0660F350 BRADY307
1,666,247,052 *AF57F1E9DAFA4021761DD50C03F959C6A94E3F29 419940 dieerfolgschancewirdzumwichtigstenkriterium
1,666,247,053 *AF595371331A9160322C514955CC92DC4DE7D246 ARMORIAL-DES-COMMUNES-DE-L\OISE--I-P
1,666,247,054 *AF51B7FB030A070DBB4D533BA7CC804213565968 ANTONYLITTLEHALES
1,666,247,055 *AF58386547A084E85458E9DF3196F564BBA6C6C5 ARNOLDOSIMUEL
1,666,247,056 *AF583A0F93FE08D62A632B4ADB95E6BA6B119F09 a)o8#
1,666,247,057 *AF560AE1AC409DCBE621DC9DC379A47C317CEEF5 aoboq
1,666,247,058 *AF576725F1DAA6AB3DEC62A0CD8A025648A869CE ASABENTARSE
1,666,247,059 *AF57FD4262E6033BDE7DCF41652FABC759156BA6 4AMAICHI
1,666,247,060 *AF506294852191A0696F6C4AD73B647058D971DF 4BROECKER
1,666,247,061 *AF585BBD852375B0AFA5BA51805A9D7B12C313D8 4EGNARDYH
1,666,247,062 *AF56D2A331A1CD0EF8B05A1C0A93344A57292E23 4.entmuendigungen
1,666,247,063 *AF5590D47D3559A75312681BB467E05F301C1D03 BRIARBECK1
1,666,247,064 *AF5E578CD123BDC78AC31A51CE4B1EEE596D9AB0 APOCRIFA5
1,666,247,065 *AF571C192B7E98459BC80248B9C7DBBECC8DB4A9 APPELLASTI?
1,666,247,066 *AF5F4F577359ED7D14F1A272C198B175EFE7AE39 atbc4
1,666,247,067 *AF55430882519D4FF5D091E66EF1AE64BAB43284 AQUARAMAAQUARIUMPHILA1963ARTISTRENDITIONPROMOTIONALPAMPHLET
1,666,247,068 *AF5012D2E7B496BD8B86C7500A7561F52711A7EA AR9e
1,666,247,069 *AF5EC384D7F2C375D49019D9A7CBD9A19CFC6169 au2c=
1,666,247,070 *AF5C443CE094A05D28F55C82A0789E6E4C1326DD augustusterrasas
1,666,247,071 *AF5F4464D5056D4E3320B961DEADF74EA651D3D4 arnoldbaldwin
1,666,247,072 *AF53508685F45CF98365E1220F6F6C5A94155C56 burtmottinger
1,666,247,073 *AF5355EEFDA2F460D2D96EC380A282ED05E5D412 516EZRA
1,666,247,074 *AF5A0FCDCE2C01DD057F77315138EC28A4572602 asaminuk
1,666,247,075 *AF59AA8F3D5BBA4A1BA92A19EEAED710E8BA4D2B a:vfb
1,666,247,076 *AF5847DD6093E7C3DAB48113FE5DB787C99758BE avlg?
1,666,247,077 *AF5FA2909CBEAFFD89D66F587447AC7F2D1EAD0E ASQ=
1,666,247,078 *AF5C368F60A023C9EE3C55EECB917D24C52A2FDC BY<D
1,666,247,079 *AF53A789387D61A6656169F38CD52163A6571B86 byronmiano
1,666,247,080 *AF56BEA62672FFB470FA9EFEAB145F025D4DF77B b/&("
1,666,247,081 *AF5F427B7EBD634F8B9254524D62BF1951D5BA25 A&TQ.
1,666,247,082 *AF506FB748D5DCB286CAA63A9F11985BDAEC1018 AUAEP
1,666,247,083 *AF5A6ECE3516B7137B68618755BBD53EEF411D51 C0BR4ND1NG
1,666,247,084 *AF5944B94F48D18BB1833238F56E1CF5687571FD c0iuh
1,666,247,085 *AF55DDDAFC16D7A97B845762EFF1E1EB9F9FAD66 auhz-
1,666,247,086 *AF55B3E368ECB7E810078C71D276DE5FE85F73A9 B5KE
1,666,247,087 *AF5C4557B4163A4DFB760C7DB67E9F87B3BBAC90 5TACIFIED
1,666,247,088 *AF56A5C7E11995B015C5FE06834FCE767D20545C AV6Y
1,666,247,089 *AF5ADC8B9810BF77AE08ADFEE03834CAC2896B24 AY#&C
1,666,247,090 *AF5A1C1E624ED55D8E300DCA071BD82A30EEDA75 aye-aye-han
1,666,247,091 *AF5F2CC59CA6299C5B0AB11E66C07A5F43A3FE7F AZAMEK
1,666,247,092 *AF570B2FE271F44CC76786DA4F7B23B290C78A8B caitlyn561
1,666,247,093 *AF58F0561371305CE10DDBC88269F9B6DBB2A567 6NEROZMOCITI
1,666,247,094 *AF55F2AD94A85F3A785F9B10807D0CEE394E4A14 b5.do
1,666,247,095 *AF59E1F50AD7E215BB0CD0D2F65894FB93610891 BcM
1,666,247,096 *AF5C84D6B569A66210D5D9FE0F209429BA23181B B%D7I
1,666,247,097 *AF5C1B7488710BBD6A3E563967535F5D792BBC28 bab=b
1,666,247,098 *AF5EC57BA06FAB4306A85EC6D8027BF6DC9EF165 Back.in.the.Spirit
1,666,247,099 *AF529A21573A4C80C754B7F0BD3B16089C06B536 BE8DR
1,666,247,100 *AF51FEB02640A8A59182B0CF7C9B566D85326D11 carrolsizelove
1,666,247,101 *AF50990DC722D7A1DE016130DB218E2DD91489E1 6x0naaaaiaaj
1,666,247,102 *AF5035B3E464E0D29E76EA81E3D8E001830B4395 761817 PUHU:N 91POJAT IS
1,666,247,103 *AF58EFDED9B6046FEF8A93512F02FCD1C732A6B3 CAT-SOUSA
1,666,247,104 *AF5AA32C1C49346DADFB0A60EE3BFD0217C4ACC2 benjie
1,666,247,105 *AF528C26A38BBFD08B022D61C2C5AA046E1DCBB4 ber0
1,666,247,106 *AF5A5152278539282CF92391CB651B6192AC86EE BAYARSAIKHANH
1,666,247,107 *AF5C425419F324ED8497ABC01F429D5D0E5CCE96 cb#(p
1,666,247,108 *AF5986EDA780A0AC70194A7A41660829D7E59D66 CBWO+
1,666,247,109 *AF5B0EF18D8FD113EC7D963058520FB4080C721E b$ddk
1,666,247,110 *AF5CA6CBF7C33621B9A1B4B7861D73B0CA580D17 berninernes-konge
1,666,247,111 *AF5641A6C41A5FF994845EC5433D6E76CB391704 BERYLLIUMKARBONATER
1,666,247,112 *AF56DFB3BF218277E006B165EDB85A3352ABEDE7 7OO7HWA5H
1,666,247,113 *AF5D7A1A92AE6CCC11E0E02CF3AC56B35342E7AC benniejardot
1,666,247,114 *AF5F413D7D26813447B6398C9BABB03CFCD1D6FA bennycounts
1,666,247,115 *AF5244B9B11CCC34DFDF0A8E581D0E79E4BEB296 bezatte6
1,666,247,116 *AF5F9ED1CC147B5F5790DD133D15D6DE800FCA87 BERANGEL3
1,666,247,117 *AF523F0D23DF82E76966772E371652FC79A84113 7REEKIRBA
1,666,247,118 *AF511EC085FC60C8C817663A7C4FC10AB6BF06D1 bfo!t
1,666,247,119 *AF57BD9C44D480A5DFA7400A734044A2E3401EF2 B?.GC
1,666,247,120 *AF5C4BF796FCD06F4C3ADDB691175BAB59B5451A b/hd&
1,666,247,121 *AF54F8868FEFC5B1A90FED1792693437F928C968 bgbok
1,666,247,122 *AF5FF679842780C7D3289B66D36CCF207D59C6EE BHZEV
1,666,247,123 *AF510520DEDA53B13C74016C1C849BC44EDFD491 BI$T3PHAN
1,666,247,124 *AF5C588F04EFADFF4FDCAB2F61AAFA1E7A4FFE81 8ADAMSUN
1,666,247,125 *AF5C6D444A69DD673444AC9C1A2CF2C924BB6CE4 biomicrosc
1,666,247,126 *AF518145984609251D695CB2426D42C817BA09DE B&L=(
1,666,247,127 *AF539C377E319C4854EC0B90ACE766A90B37C5ED bkyb:
1,666,247,128 *AF5E999CA60855AC475FDCE73F285CDF2B153C97 BLACQW
1,666,247,129 *AF5B99BC580D2CC00786E46A40751928B1791E43 BLAINE.PARDOE
1,666,247,130 *AF563B30963E78AACBC1702535611070FEFB3E11 BLOOD~麻由と麻奈の輸血箱~」第二回人気投票のお礼として公開している。
1,666,247,131 *AF52C2517B336C9B271052FBC7626A0EFD31D807 CH#R+
1,666,247,132 *AF5BA75D4F5FA861C8604994C0E9CB0452E35233 CHRIS.KAMMAN
1,666,247,133 *AF52F29E93780C8204FCE62C9B581BA300D04F7A BLAKE.VALLAS
1,666,247,134 *AF513744F1F3E1C470AD117AD3C2132009E17876 christinepitman
1,666,247,135 *AF56784BC4103A46F2A857BDC79182028140EA5A BLISS-WITHIN-AGONY
1,666,247,136 *AF50B67D8C7651DCD3C7E440A05E5E41DAD587D9 8FORTROINGA
1,666,247,137 *AF56F88879FBB41AE3EDFDA8C7ED8D4A02CC3C6E ch-vk
1,666,247,138 *AF5B48E18889F81010EC835F86AA84796C18C7B2 cifremos8
1,666,247,139 *AF5EF28A71BE4C959730687F9531E7BBC35E9EE1 bobaumohl
1,666,247,140 *AF591D79DAE5A64366EFCE9762CB1AA709A210F0 B"NAL
1,666,247,141 *AF5EB8AAA89B818EAADB49771C2BC5F5BB140A82 8NURFEORP
1,666,247,142 *AF5B8BEF9908B36A228A6362DCC9047ECAD19DB2 [email protected]~-~-~o->-<
1,666,247,143 *AF556EDE8A7ECE660E85074E7E734B95C90D8782 8PRCNMCLLY
1,666,247,144 *AF50837D5E8E4F76C5E0C2465B4339B66AD9D3FA 8PROLIXIOUS
1,666,247,145 *AF5F701A0CBBFAEA30285135FA199C95346AF9D6 ck%e6
1,666,247,146 *AF5A50A17DCFEB66449AAFA17AF6905A1840BAF7 BOEt
1,666,247,147 *AF5C1DCB0E97FFF832CAF9E2DBC7EA6447367180 bonesnothing
1,666,247,148 *AF54AAE7A70193AA63346BA47F925971992AF1D7 boogie.boogie.boogie
1,666,247,149 *AF586B26872A79467C479BB1D7AB2CB26CBE16B7 8#####>.`~splat
1,666,247,150 *AF52FA68D511AD29E05B1F2E9342A6861A563115 bordcharp
1,666,247,151 *AF569D21BEB67F58DBD60AA9501ADB4319DC510E 8triplicature
1,666,247,152 *AF520AC9730ED4F17633D613AA96F0DB316096AA CLAUD.FORCHIONE
1,666,247,153 *AF5340B48D1DC4AC9214C8186044E2BEEA30964B 8WSTFRKNS
1,666,247,154 *AF549A2562359ECB7A89F84868549576C1CBCCDB BOXTOPS7
1,666,247,155 *AF50CA15B34669E69AF6F47D123539FAEB7B937C BOYCE.JOVANOVICH
1,666,247,156 *AF539C4FB646FE501ACB04C249F22CCCCDDA38E3 CLAYTONNOYA
1,666,247,157 *AF58BCCF3268DFB2982ED0986CC35D248B0F935F BPAA4
1,666,247,158 *AF5E56A11E876701878DD9B0126C0CA4FE9A657E clbnw
1,666,247,159 *AF5FCE19D344C64D44B39364AED8EF4B29F4F2CE bozospace9
1,666,247,160 *AF5A821F29D3EBA473B62E501A0F69040E29D7E0 bp,
1,666,247,161 *AF5E0160D29CF3680E7F7406EE9A59C7A1AD9217 clevelandfrancisque
1,666,247,162 *AF5B428997E2849D041EB51B96A5AE8C5CF6E058 C.LGI
1,666,247,163 *AF54BBFFA38D95D99276F68970945052D26342F0 BR#R
1,666,247,164 *AF5D5641AE1F101062C6413031903C2F970D12D2 CM1GU
1,666,247,165 *AF59783F8C4187443C6C528602382BD07476B114 BRAINMARSTON
1,666,247,166 *AF570D2F9B6979496CBD781EB06237E7C81A99F6 9DISGRUNTLET
1,666,247,167 *AF54EFFE533C4E4149743183A8DF9C111F3751D0 BSWPOLYPLYBSW
1,666,247,168 *AF5B9E32CB8907D62C1A37674F913D4DDDE4D297 bt1l$
1,666,247,169 *AF5FDB961F202FA32AA553B026EEEE7FB6DD5503 buckbenesh
1,666,247,170 *AF50FCCD97E62C0D8BE357610FB72709CDC6E846 CO-DEPENDENCE-DAY
1,666,247,171 *AF5E98EDD839E8BF9C52C647D192735DBC6190F4 [email protected]
1,666,247,172 *AF539788CC58BDCFE554181832C1EC23E82D511A 9NISTUNUT
1,666,247,173 *AF5ADE1DE9EE8E4980A80C75C587F38E4B041793 [email protected]
1,666,247,174 *AF5B21BF370F506A20C6911A4520960D9C5E7CDF com4/
1,666,247,175 *AF5CD1D3A5A8B0C741EA6FA670314CE85C195B44 B.ULV
1,666,247,176 *AF5D95245CC9F3DD2695877AED9EAEC3F07840D0 9XFILESASDFJKL
1,666,247,177 *AF5422E26F0F3FE7B1914B9332A85A3EDB2FC06C A091069
1,666,247,178 *AF58F87A683D3B975B45DF194EFC952A77ECF3A5 CONGREGCRISTIANA
1,666,247,179 *AF5809BF3F91CD60081FAA4420851AEA9C8689BB conjura+ion
1,666,247,180 *AF53800CE662EA50E30F529C5C4D01A4501BC9C2 CORINNEKINDELAN
1,666,247,181 *AF5037B63525A637A5CF307EE1EA227DB3D579D2 a3r)
1,666,247,182 *AF5C76A111108CC9947A864DCD84E49F7A162F4A correction41
1,666,247,183 *AF571FAF79A3BE5C1EC4E892F6C1A664570748D9 BU57!
1,666,247,184 *AF51CCAC84D505B57CA2F0205178B99D7122235D a7esj
1,666,247,185 *AF517E2757491F194712078DF05B8A4275BF5155 A+8NA
1,666,247,186 *AF5EC6083301706B48694A8CE70D2BD899BFBB80 AAB,LF
1,666,247,187 *AF5FC70AF819502E6B31A3B23EB934A27474C1C6 aafix
1,666,247,188 *AF5F2B0056CAD75D1F127A1DC1C1CBA4174E22CA [email protected]#
1,666,247,189 *AF5DA9E3947A8D91AEDE048E9CF4060C7734970A c0pp3r!n9
1,666,247,190 *AF54919AE2E5D023B89940C86313CF607C1EEC97 CARLENE.POOL
1,666,247,191 *AF595B00E7135EE795A98EB14D2C9E04C37DAFB0 CARL.SCHMELMER
1,666,247,192 *AF56F032376455F4A8572BC97667A3F6238AA4EB carmen.puryear
1,666,247,193 *AF5CFDC19AD882D214FB1C9DB3ECBD948249DBB2 CTYLNTN4
1,666,247,194 *AF5CE5064D985AA1C5565D061A680BA70C241156 cubillo-del-campo-burgos
1,666,247,195 *AF5A6D3278E3878B5B927F4F92E598883CBBD89A c5lo5
1,666,247,196 *AF5DC2B89BE775AA77007738EF3694408DE70AF3 a$brf
1,666,247,197 *AF5D8F212B9A1EC8FABFAD695DE0BA5484017DF7 CW!NN
1,666,247,198 *AF52790B2024444A5219EDD8B5E5138EAC23B583 [email protected]
1,666,247,199 *AF59CB9D73D1ADA5969C25DE28C920901EC49B40 CCPPV
1,666,247,200 *AF56914E9DCD997664E9B83C2452C492F4CE8CEA cyq5s
1,666,247,201 *AF521165FAC3FB85FE64605D494BA95BD71236D3 ADAMBAUMGARTNER
1,666,247,202 *AF5C0E39CBE5C1CF2198DB13403B26F22A24867B CENC+
1,666,247,203 *AF5005A293F954E2CE513DE965E505FCD649E457 [email protected]
1,666,247,204 *AF54704A6BBE7AE0BF71E948AFCB6E897EB159F2 CARLES-MAGRANER
1,666,247,205 *AF57DCE973B04C38CB5D8DD888562879AB2391A4 D3F3R3N+!4L
1,666,247,206 *AF5B239C2BEFA5475828DF56C43C7CB5BCCCA402 D4I)T
1,666,247,207 *AF50795A19D259474344D4AA0E09622D4DC1CFCE AEROOTITIS
1,666,247,208 *AF57C1B6F47021D1A0E2D4F27AA4BCC747D89EDA CGRKY
1,666,247,209 *AF54EE7DF62A5BA22AA1CF736226B745CC7FA899 c.g)t
1,666,247,210 *AF55C4541BE615DD8901FFBA31A5CAC5FF8768F0 CHALLEAD
1,666,247,211 *AF5A20FA0AD9A25279C2AD9BC2B521142B29B80D champagne.op.de.redactie
1,666,247,212 *AF587B519F651479197D5C144B238114D1DD4DD3 ag8kq
1,666,247,213 *AF51A558D401A7DB5D9A5A3081390F7B74E3C688 a)%h"
1,666,247,214 *AF5D7E251C92438F5CAB44789CD70FF5FB010011 Da6d
1,666,247,215 *AF57465ECBA2DFF4B7BF12E326E91CE210C86E6E da-bump-(feat-miss-patty)-(
1,666,247,216 *AF5715680F903A050F6F4D68DB70BD76A5C8E631 ahotbod
1,666,247,217 *AF59CC0282568693F016F08B1EB81FA4BF5237F4 DALRIE
1,666,247,218 *AF5A169F73A2CD32672BB31B9B54B48A5410562C [email protected]
1,666,247,219 *AF54BF59044BF68816BC421B8133C1D087C1E506 DALU
1,666,247,220 *AF5071D136889530183549323B44642AA9A2A28E AISH TERU
1,666,247,221 *AF5CA671EB29AE5863E62EE614C467F17A984022 AITEF
1,666,247,222 *AF5B0A02313E4CEC704FB0E0B26E5E795F87EB7E CHITHIR
1,666,247,223 *AF53AB0285F82EE17BE8A3192DEF9CE156361A91 cassava-piece-radio
1,666,247,224 *AF5925B6697BB7BEAAF150739EEE20BC7E1473D0 chris.sepheeriselektra
1,666,247,225 *AF594469C0CE2B307F3673AA3D7A2A71B5F246CA CHRISTMAS(真神学園高校聖歌隊(堀江由衣、川辺雅樹、浅川悠、石黒貴之、加瀬康之、田村ゆかり)、
1,666,247,226 *AF57B6C984886654DD8D513E6B26EB64158E8252 [email protected]
1,666,247,227 *AF567EAF513E816AB5ABFF15AC2E8FE9E1F3E19E christopherburby
1,666,247,228 *AF5F90C45A5DBC7230199D8AAED60E7E8D137B97 [email protected]
1,666,247,229 *AF53035E08FBC3F71C22FBC43E9B516D3006C309 CBFFY
1,666,247,230 *AF58C7D1B435FB71E8F2FCDFE695AF889F86E2CB dautv
1,666,247,231 *AF532B509B6B47A30D64E3468D03733072C96A86 davidhaase
1,666,247,232 *AF54AB485D69DE587BC5657D26CC279D0868E757 aloaaar5bhqsjgpeaaarbwkaajr
1,666,247,233 *AF5A44C7179460A0418023BAEE9671DD046BD859 D,D8T
1,666,247,234 *AF5471DB6E8ECE7D3217D66EB1E649B3D72215E4 d%$dw
1,666,247,235 *AF598437867C60EE9A3E6E56E04974B20D6DA9FC CLINTGALUSKA
1,666,247,236 *AF57E1C30F1CB1BFB0B54E80E28C08E999DFC12A AMAL-FARDOUN
1,666,247,237 *AF54D6E37FD7C248E4916F876ED5105569393AA5 am#bf
1,666,247,238 *AF5667526AD7EDD8DB7E3E31C6C33FC917E6503E [email protected]
1,666,247,239 *AF565C9C72E88D555FEDFBF6D3117F77FE93A831 AMERICA.NOVIA.MIA
1,666,247,240 *AF57CF618A1C10AE980AA47747CD76744103456D CEDRIC.DONER
1,666,247,241 *AF5C751B47F2FD057DED6A491A22821B77C82627 [email protected]
1,666,247,242 *AF55F02E65EBB684B3F208959F76FD6D2770264E CEDTC
1,666,247,243 *AF5226ED7BF499A462617241D9FD19FA492199D6 anb$e
1,666,247,244 *AF5D248E969EAFAC7A72C8A9E6E0D3E1C12EC5F6 [email protected]
1,666,247,245 *AF5E8CBA526D08ECB0F8A4FCD9F9372F38BD84D0 ande$init
1,666,247,246 *AF51EBD6B8BD6808F88161A43A97618F29A4AABA cocofox3
1,666,247,247 *AF5205ECAEA70E7AE12AAB2C9FBBB6E17AEF63BB cf&_e
1,666,247,248 *AF55585324E3380CC7B3D02AC9F348F10E253C82 andrew-bash
1,666,247,249 *AF54785FC3939E1262A442FDFB9D8CB9088617F6 DEMOS-IN-MY-LUNCHBOX,-VOLUME-2
1,666,247,250 *AF56A6F9E9513E7B739A67AB4A2A03897B54CA3A DENKMALS5
1,666,247,251 *AF588C2ACD683F7FE30DD73892FF4A600D5B767B COMBO-CHALLENGE
1,666,247,252 *AF5137CBD31A0A69DDD0779B1576C6B85FFA8791 dennisfairbairn
1,666,247,253 *AF51E6F361294D2843765BA09B1DF4EA3789FC10 denniskressin
1,666,247,254 *AF58BC5E1914855734CC5F4546A541CAE1600616 c,g/k
1,666,247,255 *AF552878827A9E7204C721C2FE5C095E8249ACC0 cgv4m
1,666,247,256 *AF59DA7764F3A17382676EFDC08DE3088781855D COREY.GISRIEL
1,666,247,257 *AF50A560866D33AE06D1261EBDF3EE23789B5EDB annumnepping
1,666,247,258 *AF576A53AC5198A5746B609FA1E5C9725C1CC71D C~)P
1,666,247,259 *AF56861B3953FC0461C082DB2A92DDBC429758B6 C:\PROGRAMFILES\MICROSOFTSQLSERVER\90\SETUPBOOTSTRAP\LOG\HOTFIX\SQL9EXPRESS_HOTFIX_KB955706_SQLEXPREXE\FILES\SQLSETUP0002_FIREXWAR-1B7EA3_SQLSUPPORT_1LOG
1,666,247,260 *AF5D12A65696B69C8D1E1A0249AA3DC55FDA95F7 cq7=!
1,666,247,261 *AF5BD48C96A46E654537CD949B64560C487C0524 cqea%
1,666,247,262 *AF5FBF87EB3AFA59E3AB87F32DE6470256378852 cheriebishop
1,666,247,263 *AF5359F8E9DE1DA24902D74091344FC57FB2E407 dewittmowry
1,666,247,264 *AF5BB06F6F25A5C784FAEDDF962CFF029DD459BD chesapeakebayretriever989
1,666,247,265 *AF5F9A7A2E1E2A700FC7F6F8BD40BA5F983420B8 dexterbatistich
1,666,247,266 *AF54F41AB14BE2547FC1F54694D9857FD083EABF chester-charles-bennington
1,666,247,267 *AF5B7F71858208C3849C9E99A2EF166AA5232F3F cqpg
1,666,247,268 *AF5CB42C942DB0D3FDA8B0B33A098BC144193992 cran83rr135
1,666,247,269 *AF5DF9A2A737EB2D687807F0BC943FC9146B18A0 apjdb
1,666,247,270 *AF50C2D23D8749BEA647FE7BFB9023617B1210DB crystal-yong
1,666,247,271 *AF5C61131030BDF128A1AA68970D6CAADED5DF78 A$RCMV
1,666,247,272 *AF5E6A05018BE498332F53B94D6A7447FB1BB1B5 ARMANDOCELEDON
1,666,247,273 *AF5199E189C05EFCB0D4E76A2B04E7B78DD9EC27 [email protected]
1,666,247,274 *AF57D63EE5404DAD57C64C293D9555E9A39E5A52 DIKOUCHINE
1,666,247,275 *AF56878E776765E566C81167C5511C8A02B2FCC1 dinesh-goyal
1,666,247,276 *AF572F970AB45B9F7C4A3FC2B2F0E5155BDAB52B cux1u
1,666,247,277 *AF5631C6115F09ADA23A52DC19024550480A47AF cv&sb
1,666,247,278 *AF520B8FE3522D478C3EDE3EE88D9B19CD7BDAE7 cyb7$
1,666,247,279 *AF5AAB88220B18028F86F2CFAEA4ACC0CF222AB2 DIU4#
1,666,247,280 *AF5BEFE3F07B7CB8FDCF8FC18F1BCE783D7E89D2 di;vn
1,666,247,281 *AF55C68F5196DD4F2A9C1027E42C2573D90B61F8 ASHVL
1,666,247,282 *AF55BB97803233E0A904ADB120C5059E2B36B87B D4BGM
1,666,247,283 *AF5F011D9D11E9AF43A45C236DC7FE523FB8D43E dlqa?
1,666,247,284 *AF542F95B3788756810343DC64C2C9B2EB30B49C a?tb,
1,666,247,285 *AF54A495938A3F8A5335C704F37E845623C04326 dm5bo
1,666,247,286 *AF5CF917013001C12C224A6AB17F803F4F392B54 Dm9h
1,666,247,287 *AF58E222D5C28D08E153E92A39C70CE11017EC0C [email protected]
1,666,247,288 *AF5D15E39F60DACA7F521196C3A82744DD2F8D16 [email protected]
1,666,247,289 *AF5EBA3DF25A6FF1C9FC4B89863F3D657AFB39B0 A?TKM
1,666,247,290 *AF59A4B234D08E4F88B854C672F3FE5B233E962D [email protected]
1,666,247,291 *AF52DF483AE6396EE66C4D31236B238317A26B28 DALBN
1,666,247,292 *AF54BCB2A728C7F421EFCCD9D990A9D9EE70C6BE COLDTEA55
1,666,247,293 *AF5A233EE4A0CB94CD5339AA1A2F529790196F96 DMVe
1,666,247,294 *AF54510FBC0A6F4A8B9A949C1DC367DE16AE64EC DNALTAO
1,666,247,295 *AF52ACFD0277D8FDBCEEBAD0349CB00AB04627F7 DALU
1,666,247,296 *AF5E8BE047D2E9BC6A4DADA8594B385F947ECC6D combat.alert
1,666,247,297 *AF53CF12B72E17032840B9E3DB0121C322F142E7 dokoceleb
1,666,247,298 *AF5695DC12DF6E8FDF64D17D433606A5911C4C15 complete.recordings.(disc.1).(feat..piano:.sergei.rachmaninoff)
1,666,247,299 *AF514BCFB420A853BF7AD7D27F0BDB590701AD38 danielle-mclin
1,666,247,300 *AF55B1E6C0C64B4F9951B6B76B20BD8823FD11DC DOMINICRONSON
1,666,247,301 *AF51D283245B7F34126F491E43912EFA8C396372 DANILO.MAGO
1,666,247,302 *AF549630CD490F62216BE348FA9EF1365BE349B8 dominiquegraboski
1,666,247,303 *AF51B2A1D5849465B1C00918C0D34C40F63EA1FC DONAEGAL
1,666,247,304 *AF5C726B9D595E5BBD4FA28637F4EF54C1EAA0E3 darinselvage
1,666,247,305 *AF51D44A388D055BE5E9733FD985190DEDEE410B constataient
1,666,247,306 *AF50E44AF076DF5B6254A78EAE394C5F38E2DF86 avital2
1,666,247,307 *AF5AACA0C951C04091420AD172A68B68F18411BE DORA-THE-EXPLORER-PARTY-MIX
1,666,247,308 *AF576FCAF1F4D258A5C3561129BEAF9FCC0686F0 [email protected]
1,666,247,309 *AF59D0A91B0FD808E1CE23875052BD19627034FB DORSEYSIBAL
1,666,247,310 *AF570F653949E4922AFB7337BA659F6731E14799 DORSEY.TERRANOVA
1,666,247,311 *AF559F13C450BD6E93AD789731E7C75588D6898C DARRYLSHEARS
1,666,247,312 *AF578C6E7D1C6275EBB6FD5B8B91D5219BF7D69D das rhythmusger
1,666,247,313 *AF5548A888911228D0798C84D2AF6A124718158C a"x/7
1,666,247,314 *AF5CB4D95F7B63F6090FF9692505D42F7DDC0119 COUNTFROMFIVE(B)
1,666,247,315 *AF5E6C87714A2D77FF483F8D7E98BF9F879EC49E AZcO
1,666,247,316 *AF5032E21D87EE75565BC579C27E9C49B9DE5629 DB4LV
1,666,247,317 *AF59D51AC815B838BCA4E4DC860EF325A0FFB515 DCR-PC350
1,666,247,318 *AF506E28C0C23ED4B744A9625B0206BEF44A38AF b)3&g
1,666,247,319 *AF5B2447DBD29DE80C15501915E4CFD972C58585 craigholmon
1,666,247,320 *AF5C3196B04D3F798794159A648063BDE5322E10 C&RFR
1,666,247,321 *AF58E37C3AE2F47C8F86AC811FCF53110250AA83 DERECHO ISLAMICO
1,666,247,322 *AF5A0D7508B43651DFD1D4F471407FCC784AF4FF DEREKWADLEY
1,666,247,323 *AF51251ACAE67AA7F6C10A8B788DB247F23ACA30 deue
1,666,247,324 *AF5C48F23931F849A5A86978226E1AFCE5D4E749 BARRETT.SOUS
1,666,247,325 *AF5B284DA05D678C154EF0A726F8A1A3444340BD CRISTOPHEREVELO
1,666,247,326 *AF5E8ECACF8A534753A3337400FF3782A82E61E9 du?u8
1,666,247,327 *AF54828FCB3125F520F05E107BF94B701DA08D6B D/F_
1,666,247,328 *AF56AFAF0ED6C5CA1FA178350BF8A1FB8A26EC33 BB5FW
1,666,247,329 *AF502D97730D99D9F65B5F88B316E6192B1DD0CD BBCTH
1,666,247,330 *AF59B6CFB6178D326DBBE62722FB6E05BDF1BF2E cub&h
1,666,247,331 *AF5C0452CEAADBD06A403918C1D6BD3234644AE8 cvjti
1,666,247,332 *AF57E59EFA42856C1880B621F2FA329617D2359E beatbetrie (positiv)
1,666,247,333 *AF5FF18A9EE62CC20003939E51BE46603A643E55 di/f
1,666,247,334 *AF5EB90385350AAC0F356085D660B908CA3C5811 bekc
1,666,247,335 *AF5EF24923D148521C9D47752078DEC7895728A5 cy!ap
1,666,247,336 *AF53CF617AF7FD200CF42333ECF9E3D62C43376B c?yjb
1,666,247,337 *AF5B12D5413F4F940FE18032F86A58CE2B6EBCC4 CYRILLATUS
1,666,247,338 *AF5964FEC0F166998990A1927CC7DF40DE2FDCC9 DISCOCLUB(REMIX)
1,666,247,339 *AF5D0FBECFFE63F7D0EBB6DA0748F991E4E3FD67 d%.(+
1,666,247,340 *AF57D95189184B3EA4A9C3B94A9CCAC639C68028 D(:#
1,666,247,341 *AF5D1CF1F940D822B427374335876AB50A0240FA EEYORECHUCK
1,666,247,342 *AF5B6ABE8A422804768D4C2EC2EC6164ABA03A02 d_jca
1,666,247,343 *AF52C888280AC30D45FD6D529D637A01417D6C3B DJWATERSD
1,666,247,344 *AF5BBBE65239AE845ECC7B540204FC367C608413 D$./K
1,666,247,345 *AF570AB926D2219CE5E490A632C8A1229684701B d2an(
1,666,247,346 *AF5730FF502FB62CAC7D0F144EB38678DF5D26A9 beth-koester
1,666,247,347 *AF59E99ACD83B78E870CF4BAC4C556BC08A4EF0B BETSANA
1,666,247,348 *AF5C9BC0473991932F6AFDD499BDA5EC07F50582 dm_8y
1,666,247,349 *AF5967B886390175F45B2154AABBD6DB41F984D5 d40o
1,666,247,350 *AF5D66553C06B37ECF62CB60A53423827AE96412 d7lwm
1,666,247,351 *AF50D0254A8D650C29806A18EF3A606C7EFFE354 d9fpr
1,666,247,352 *AF5472F28D58FE45DFC278309B38BE66478BB859 ELLSWORTHAHLMAN
1,666,247,353 *AF59B5C2C403CAE9531629534BF6B0EED72294F6 DAAR.IN.GRIEKENLAND
1,666,247,354 *AF5394D77C7D7ED7537049B54A201374A6C07705 DAARITAAH0
1,666,247,355 *AF541475DD69386341ECD35B6DC78B882084E76F d$abw
1,666,247,356 *AF5F80A79D70C0D34FF7687E2C6C76464320F39B b]hm
1,666,247,357 *AF5DAD880CDD88EC2878913EA0C2EA54F6A0B6ED [email protected]
1,666,247,358 *AF59398985209C02F5CD851C60A4CC1706F09871 DONG.VIENNEAU
1,666,247,359 *AF5F974EC0DA32E7F5F07274D6D1AD7B422E0729 daimond20
1,666,247,360 *AF508436D28A762AC278BE5DC129C5B8C2D9CB0E DONNIE.BLANKENSHIP
1,666,247,361 *AF56DDA0BA44AA602ED94D85AE530173504DD507 B__I2
1,666,247,362 *AF583F75EC748CE7C6988036B5EF48CEAD91B597 BIGORNEAU1
1,666,247,363 *AF5831C62C7FEBA502D632606234CA2E31110344 BIOCIRCLE
1,666,247,364 *AF54E6543491B4DC5C9C90EC89D212AB93F1973A DR8JQ
1,666,247,365 *AF56422908AD79532ADA39B24B677A917F158D1A EMOSWOBNU
1,666,247,366 *AF55409B081C68F3BAF7F78E8CEA887348034566 DRO1K
1,666,247,367 *AF587AC43FDCBED6D60DF63526076423FA8B523F DRR5G
1,666,247,368 *AF53C7D248514CA953C3CE8316F53F7A2F42E3D8 DARIUSEARNHEART
1,666,247,369 *AF5738E8FA7A9E35F02FCB70A10280AB5C0918B2 ensoitto3
1,666,247,370 *AF52D0329B51F3123A8F34C566606FA95E302630 blacksmithsmash
1,666,247,371 *AF5D4DCCAD6A9E29C991A498A75A4B095729E6E8 darnellruacho
1,666,247,372 *AF558848D0700615AC16D072B146419A80D87A94 DS)J
1,666,247,373 *AF51F9559F64658EABBA159272252A9096449F75 BLUESKYJ9
1,666,247,374 *AF5AEB4AB987FBCB10BA1FAD993D4F247E0C0229 ERNESTO.ELGAR
1,666,247,375 *AF56FD9CFD892C21F5CACCE49AC56A943615E9F5 dustyseel
1,666,247,376 *AF5ED83B6833210BF4451E18E5D6EBDFAC9D4F11 ersjanischen
1,666,247,377 *AF5C4F711FE04CB1908A5666C7EB3427100B4A92 B:O9
1,666,247,378 *AF543EF9310D044883397D2767AB5BDA6B4E595E eso9v
1,666,247,379 *AF588944F2B770176C80AEEF2113D5BE156FE5BF dwaynebanzhaf
1,666,247,380 *AF585B584B7148EA6370941846F6988026E80D4A ethankastens
1,666,247,381 *AF50E534451AC46F8519CF05F8C99635F1BD162A ETIENNEOVÁ
1,666,247,382 *AF5A638DB674251F90AB748584D35FB157C8B576 BOMBAIJ
1,666,247,383 *AF50690A1D49CD858D36341A36521D78DEEFDF3F EA9E6
1,666,247,384 *AF524A168526952587DD944244978C109785EC7A EDELMANNBEHAUSUNG
1,666,247,385 *AF51623E809A007DE3A5DF635B5DABD884EA8843 EDGARGOSSON
1,666,247,386 *AF57690C96C6B840D9CED893C60157D35B1E879F eudnoper8
1,666,247,387 *AF50A428963F13AFAF407E8A626CB46EF04F571B bqcu
1,666,247,388 *AF56B7C74DDFCEBE6C9DE8F0D3A7BA4A35EE82D3 D%C2U
1,666,247,389 *AF5E761DC9CEA06DA749CEEA2D1C9754645834E0 EHGENNIR1
1,666,247,390 *AF554DD7ED390BA34555EA91016A7445AD1E221E eyuzy
1,666,247,391 *AF55A2122F16A59F0676A5C326F078EC58887298 decrisper2
1,666,247,392 *AF548F76B273CF547DBBA20A068F6E2CB5E4D005 ELISEOCANCE
1,666,247,393 *AF5F6F2E8B2CF9CE9FF69F300F0D002EA251EC8C ELKERULI3
1,666,247,394 *AF549692E19FC8E80DB0D059683A6C8110667A78 elliszacharewicz
1,666,247,395 *AF50FFAD76DA344AD1EA45AB8BDB5308301FE13E ELLSWORTH.MADRIGAL
1,666,247,396 *AF52B34CC3475941729348D3FA45169A573E1AAC briceleymeister
1,666,247,397 *AF5CDCC6FDC451E4B324CF9C34FF8E22DA37555D BRICE.PERRA
1,666,247,398 *AF5526D6C1A581A4C7132EA914455DF4FB69EBC9 FAMILIENSITZUNGEN
1,666,247,399 *AF514F71200B85B7C3CF5F26C44BCDC42DC8652D [email protected]
1,666,247,400 *AF50E124B7226190CEA0F551924FDEF8CF167168 FANNY117
1,666,247,401 *AF594A1339E0C8071AFA436703B285B84F8BB32B EMERGENCY2
1,666,247,402 *AF5A51BE88D056C3B22B1AA22DF68AB095C97683 deliartr1
1,666,247,403 *AF5CA30AB36EEE85C752B069A52B2572C43B60FD DELMAR.OSLE
1,666,247,404 *AF530A6826D961FFCDA666D1AD5CE42B20410D82 EMMITT.DIMEGLIO
1,666,247,405 *AF53505C9C3E2D22BE6DAEE0F42D6C671341F7AB fcicognolo
1,666,247,406 *AF5A22E237ED03DA5F1E370547714246E27A2C68 EN6815120042
1,666,247,407 *AF5D15BD3B37D4F9B0E2C80ABBB6F71BEBA87472 DENIARDNUS
1,666,247,408 *AF580B0EFD5698D1CA0ACC6443B9EEE36A9F7F6D „BRUCHHAUSEN“
1,666,247,409 *AF5F082BE0464DA84BE81274B0C1710FD9A06FCE Brulerons
1,666,247,410 *AF53D209B7D4E732F296EEBAAA48F941DC2D8C79 F(EJ
1,666,247,411 *AF5F488733514E4834C88CBB4CA3798B0BF706A7 FELTONRAWDING
1,666,247,412 *AF56EA912B72948F790D493D312792CEBB19E06E BRYON.ARCURI
1,666,247,413 *AF5010CEA89A280841E2C8ECEEB679A901D7C5DD bryonsetzer
1,666,247,414 *AF591267C90F12E844EB06568DEB6271793E16A8 [email protected]
1,666,247,415 *AF59293FC92F225097F1A695F409DEC716906DB3 enochcarmine
1,666,247,416 *AF5D4117484090A8389AE93BD875E64067F6D537 ENOVELARAS1234
1,666,247,417 *AF51719DAC1026CAA59AB36CD62CCFBA6A6D1C69 ENTOMOPH0
1,666,247,418 *AF51D2623A62BCA5248F9B4F887A61B716FDEF3F des3o
1,666,247,419 *AF5F2676C7ECE6835E5914F9F10C796FB8025471 FICOS DE MALTA
1,666,247,420 *AF55859839C5A940D6A6A95A192A7D7DEFBF87CF BT:-
1,666,247,421 *AF53D99C888F8ABC5C4E4AD823796FB44051CD5C epuision9
1,666,247,422 *AF5A5BAA47E6FF48AC394A80710E094046359E79 finnbbsw7
1,666,247,423 *AF58372B206EB32787F3BFCD6C87D97DC610D851 DEVILSHAN
1,666,247,424 *AF5CC4375E56245C8134746DD32D31BB9D38282C [email protected]
1,666,247,425 *AF5093D72E1A99875238BE18F2693138E24089C8 FL1184896
1,666,247,426 *AF560A33558678E758BD1107FBB44631BDB55FF0 D?F?1
1,666,247,427 *AF55F4D4480D758111C07448F3EAD038355830DF FLORENTINOHOOTON
1,666,247,428 *AF5BD7D6A5AD69C2CD012A85BD43FBDBB3B6950A ERIN.GALVEZ
1,666,247,429 *AF5A7824F6269585CC1DECDB001F3C4ABBA62421 flyingltspangt
1,666,247,430 *AF50A1A4109D61DD82A965E38426CB3673FEB037 dgra6
1,666,247,431 *AF5BDADB741D11E0D7854EE7FD4D795EF4B80927 DGSABBS
1,666,247,432 *AF50F80E0D210BFB76897AA4CD3184CAC98F243B for3519ht
1,666,247,433 *AF504E60B6FAA1F352FCE4F26F3B468E7C98FF98 BVD%#
1,666,247,434 *AF5DC993F47D812439803BA6C7718FF2B48B55C7 FORRESTBATTEY
1,666,247,435 *AF5408E825E2A0DFB84B17D12FA4DAC8FA6EC001 DHAVAL DALSANIA
1,666,247,436 *AF5EBE685E58BAD615399CACB6BD5A4944B40B64 d!hb&
1,666,247,437 *AF522B48BD9AD1109C2A3D29236A511B404CF095 d#hgg
1,666,247,438 *AF54DCB5516FFA46399479CC7381C4E6EEBA2829 essitreva
1,666,247,439 *AF5CAD57D74081AF48D617B8709B4FB8FC2A6CC8 FRINGAS9
1,666,247,440 *AF5CAEC3E99FC048EAE0B14D93E4249C4AC83C38 FRUGAVAM7
1,666,247,441 *AF5552AB2EFF25CE5E7FDDD9C0A3DEBEC5C06E92 [email protected]
1,666,247,442 *AF548B945AFDF8CCC67085A4FECD2201A39913A3 DISUZAP
1,666,247,443 *AF5EF7B72F5ED4ADDCC25C82BE75838A445F7B98 divx4451
1,666,247,444 *AF52B3C56AA7B26E65FB603AC1BCE2ADA2D62EBC DJELI.MARA.(FEAT..MOSTAR.SEVDAH.REUNION)
1,666,247,445 *AF559A6D37E79BAF22B0A942AD3AAB5079BAC8F6 [email protected]
1,666,247,446 *AF5C227DDAE1B09A2F978C285C3413028C62AC87 c4"ed
1,666,247,447 *AF5E4AC423953484E55FFF319AE6E2869AA9B851 GALE.SIMOES
1,666,247,448 *AF5CE3233A4B1632FBA4893BDFD55BB3646A39A8 D"?MT
1,666,247,449 *AF5DAFBED7D2C8B924EB3D19B28C6CD14B5E24BA FELANEY
1,666,247,450 *AF5AF677AEEC5431D2087C118E5417893A25C297 gdaskigdasksiedlceu
1,666,247,451 *AF524EFA547D780A615DBCAF6E2149AACF3A2747 FERDINAND.KEMMERLIN
1,666,247,452 *AF5AB5C428FC08D7741E7B691644C8C0B2C396D3 FERENZANA123
1,666,247,453 *AF5FAE907B41AB3F4E490EA074E39CAA1161048E FERIMTALARIMBAUD
1,666,247,454 *AF5CFA3BD42C49957EAE6004A17ECA9746B6584E ferminbehr
1,666,247,455 *AF511F467E534753839A6B8FBBB5ACB81D71BD78 fernandomonro
1,666,247,456 *AF5A73294D1F8BD39EE1C5D5DC53DFC10E852633 ffkm
1,666,247,457 *AF50308C4B8475EFB73F1A24B852598B0432F5BC FIFQBSW1
1,666,247,458 *AF5CB3A0F184A48372EB02514BAC670B65CA678F GERARD.HOINESS
1,666,247,459 *AF5D55CDCA15B3B44A6FC72E7171986E95EBEAA9 GERARD.MOLITORIS
1,666,247,460 *AF5A8CCF9FC8AC223F03D6C248775F5310887508 GERARDO-DIZON
1,666,247,461 *AF52A9B1EF6A8A29B13BF002D3316D1D3C1B9892 FIRECEREMONY
1,666,247,462 *AF553A9895FC3343F3E9063149A145225A54B625 carltonhufana
1,666,247,463 *AF5813E13D68CAD967FF6FA0731EB79487EDFB67 GETRÄNKE
1,666,247,464 *AF537F6DB612C896C1B45E7AD5FFE532D9FF20A2 FLETCHER.HOFHEIMER
1,666,247,465 *AF5053E54AE1CEF723B0738EE4C5EEC3F4443D13 [email protected]
1,666,247,466 *AF5BE231595C118B6A4BCD7842C4541C0BBE89C6 FLORENTINO.JANSKY
1,666,247,467 *AF59F81BF77C16D970A8946C80EBA205794884CE CARROLDELORBE
1,666,247,468 *AF536F0F6349C6A16B30A366FE5BA24E9C39F836 FLOYDWALTON
1,666,247,469 *AF502368F42674D396EC477A5FC4F35422A3642F flshflood
1,666,247,470 *AF5EAB32C24EBF0DCCDC348F487BABFB907E07D5 fluidblogger
1,666,247,471 *AF535881B39592422ADC8548BDB9815B257C609E glckauf5
1,666,247,472 *AF5BF534F8A9D30CBA61D1AB2641472CCEABC858 franklynbro
1,666,247,473 *AF543EA520CFBB4125A5C45B9D518C26E8CC3D81 CAU9%
1,666,247,474 *AF5C66878A6117B3EC9C8093628FD87BE7ECAB7F ce2lv
1,666,247,475 *AF5CAB7B196180ACB3824463662F6B7C03E99FD3 [email protected]
1,666,247,476 *AF5ABDAF70E2AF91CA056FA5200EAA305F816F81 dr&81
1,666,247,477 *AF5B620B103CA50592E76C25CA562C2796533A46 CEREBRIC
1,666,247,478 *AF572065236AD3A0355A7409FCF5A8280AB79163 functionu3
1,666,247,479 *AF58BDFFFB1CFC4F0FD490AD7CFBA3DAD4CD6712 CFNGG
1,666,247,480 *AF5A15D95E1625037C96E5194E6D5958F8284A25 [email protected]
1,666,247,481 *AF5F072F23A68045AC27E3CEDB4E4CE918F3BAF1 F(XQ
1,666,247,482 *AF5B1861825512D3FC6CCA85C3AA8E5C902F0A2D GREGORY.FORNEROD
1,666,247,483 *AF50C7C1F4D3975F238795A0075FCFA004FEE067 DRONLIM1
1,666,247,484 *AF55DAC415EDF78370A20EE25446BE131EF2C7DB G143671
1,666,247,485 *AF513DF149AC7B3808EA22FBBF79C9A91C77E925 c)gi9
1,666,247,486 *AF5C0969751E66AA045D37A0492E17A2E8EE85B6 CHANCELLOR.CORP.|.UNITED.STATES
1,666,247,487 *AF50F846FF42620596CDFC306D1B5A9F85EB27F2 CHANCE.YANDURA
1,666,247,488 *AF531AAE488E2753B79798826EB25D559244F0C1 GALENREIF
1,666,247,489 *AF52EBED855E7C50276F18279E9034CF82AE6216 [email protected]
1,666,247,490 *AF5F51E5FF60B111482CC5B42E0BA3DF9BE0500E [email protected]
1,666,247,491 *AF58AE0A7766D7E03BFF3ACAFC22FF4BABAD0616 GARFIELDVOLLUCCI
1,666,247,492 *AF5646905F7DB074340AF879D50D28F2709C91C9 garlicnumber1
1,666,247,493 *AF55BDFE5245B7E1DCD51F5EF77215ED8388769A CHARITYMIDORI
1,666,247,494 *AF58726B3BF14BE6E50CE0245614579414F5E53E [email protected]!sh
1,666,247,495 *AF5B9CD52ABB2424732326E2D71ED7EE99BADB4B cheryl.ducharme
1,666,247,496 *AF59ECCCD9CF9034483684B6256C6938A8B182E1 CHERYL PENAFLORIDA
1,666,247,497 *AF5AD7B966AEF004BF5072AC77887DFDA1F1103E DTESSMANN
1,666,247,498 *AF5509BBEA185DBF8045205AE3BAEFB380D6C144 HALF-CROUCHING
1,666,247,499 *AF5651F3E3DC3F3423ECABCEE205F8331497F140 CHRISBENADOM
1,666,247,500 *AF5A2B44440A282EB3CE807E07349AE94D1D275E genovych3
1,666,247,501 *AF5E26C373F1B6ABA0B403D3BEB9F35C21465783 GERARDPIAN
1,666,247,502 *AF531705825C4C9CC8AF813FA294087FAD3D6E38 GERMAN I (DISC 16)
1,666,247,503 *AF531BE47EC2309C351BF3F51BB98F438E3ED8D4 dugsr
1,666,247,504 *AF587F6B4AA569AE39576CC48A4A6405DE5A29C8 [email protected]
1,666,247,505 *AF5BECEFC2BD34A9CE13B344088136662FA0720B dv3r5fc4+0n
1,666,247,506 *AF55C7BD66DD2BCECB1461377B257CF2F00836F5 D(_)W
1,666,247,507 *AF595B950E64D5CAB5EBE981709CA3A387355C9E heartheircry
1,666,247,508 *AF5F1799DD5E1222F0CCCB2F407E830DF912E3AA heatfc15
1,666,247,509 *AF5E5A2707690EB7725870DD5BB8B9E84C27AA49 CJGV3
1,666,247,510 *AF58638D079726DD55D862D77BC07E1DCDA0098D heilsversprechungen
1,666,247,511 *AF581CFC5DA891BD25C1FEDAFEDCD5EA287D9698 DYLAN.DEBOER
1,666,247,512 *AF55EA9F3257394304002C974753E833A8C38C6E [email protected]
1,666,247,513 *AF57D03309F69BBC70138400216B551C41373DE3 GOLF
1,666,247,514 *AF58DCE996F31BD154165459ECFB4E69DA4B002A clairstorr
1,666,247,515 *AF5856DB4706CAF04A650481098FF6F5B7E55370 dzq:m
1,666,247,516 *AF563E82B5D52AE7BA08783F4D3D6E8B43741B7E e0+r
1,666,247,517 *AF5839E0CD46D51FDF329B87B8D802E7DF979562 herblily
1,666,247,518 *AF585FCF62EEE98889E949B6B0CF2A7225E13CE7 GRAACEK
1,666,247,519 *AF57C647FA80D40E38CCA54A6DE5A4F7B71A5E11 HERO1[email protected]
1,666,247,520 *AF588B2765C4B051B38E13AECC19473225237F3A HERSHEL.CARLES
1,666,247,521 *AF571399AE4F226A4BD02FE94FF4D1F1561EF44E HERZLOSES6
1,666,247,522 *AF5288806E626295DB6AE5213B8F8FA221DD94EF clo)6
1,666,247,523 *AF5F5D798448D71EA91523CF9E75C80C8DE417BB HKONGB
1,666,247,524 *AF54675932AA84B38A17888AD0EAF1242360D269 HLANDISH9
1,666,247,525 *AF56C34702AA870B19A09F5C43B749574C85C1F5 edgardovalgren
1,666,247,526 *AF5BD8D1966CE4549D8549E897B0E680031CD79C HÖCHSTSTUDIENZEITEN
1,666,247,527 *AF5E403BF47956F2C10E7197E4B2EF674827119E EDIRE
1,666,247,528 *AF50DB8F5DB2EBD5B79B7451FCFA92833FB161AA HOLLISTROHANOV
1,666,247,529 *AF51B3325CD241213015DB08D09D95F326631DEA HOMERFENWICK
1,666,247,530 *AF5C31241751561319864B68F39E5BCFD73602BC EDUARDO.WIMBLEY
1,666,247,531 *AF5261C258A8C55D3646A01AE9856FD247841ED8 edwardsime
1,666,247,532 *AF55859305AEC695C975C298A728C2DE270CFC34 cnky
1,666,247,533 *AF5BD785C2710FB6849F2E928F264CFE3F2DA651 ẹẹ
1,666,247,534 *AF5324000F3F419BDC7695864F01786EE342F5A3 HORNEYFUCKER:SUZUKI
1,666,247,535 *AF5EB13CD685BBCFC01DC4FECF291ADB5E592609 ef"du
1,666,247,536 *AF5161ACB55D6037B682A47954371E21EFE505E7 EG3E;
1,666,247,537 *AF5DE165FD5A3A6E7CBD7F9C2DD3AF7AFBD102ED hardichow
1,666,247,538 *AF51838C9F3F100697842479BF8302212D995A96 COMEON,SISTER,COMEON,BROTHER...(OVERFLOW)
1,666,247,539 *AF5A3FC39DAFA62007636D1A5708C563ABDAA641 EIY982VH
1,666,247,540 *AF5EC6C41CBE36AE1B40CACFDFE05C85365B8084 ejendomshandlervirksomhederne
1,666,247,541 *AF518CE10A76ED08BB69D313EEB03FD6F5B4A0CB HAZEL-CHARLES
1,666,247,542 *AF5AFC93420371EE2E78AFCBFDA347DD25A4BBF7
1,666,247,543 *AF53384BEBFC5600507268005555155C26A36F86 HEATHDELLAVALLE
1,666,247,544 *AF5566CDD39A8D8A48A45937B871C8531C911EEF ELDRIDGE.HAMBLEY
1,666,247,545 *AF549686E6C88C243206552878B613E59FF44A50 HEMLMAZY2
1,666,247,546 *AF51815902FC4B9493D6F9827175BAF499FE4CF5 [email protected]
1,666,247,547 *AF5E2ECD6FA9A22ABB8AB20D0F2FE622E93BAE15 CONSEILLENT0
1,666,247,548 *AF59E91C2EA7D3910DE3215813AA5ED7280A3833 [email protected]
1,666,247,549 *AF5DE1DAAED3C218B7A465DA9C30B11CD7940350 CORDELLIAH
1,666,247,550 *AF593651D87066654D79F57ACFF749555C5BFEE0 ELMERTHAVICHITH
1,666,247,551 *AF5A17CECB8B09170D714E98C5BA991E6ED31152 HUOLTOKUSTANNUKSET
1,666,247,552 *AF5F2301BA125AA438ECB26CF949CFE904027933 CP5=
1,666,247,553 *AF5633656C7F82D469A11B17CEF33FE4A455074E cp?cl
1,666,247,554 *AF53646CBEDF28BB28E07F3BE7AF6CEED23A4995 HOSTICH
1,666,247,555 *AF5B7B8520969F1D11D838A5C353B036FD052EE0 Housefeller(featChristineMoore)
1,666,247,556 *AF5A16B91ABF6D1895947B6021AF49C25DA9D6C6 C(Q//
1,666,247,557 *AF5757114EA0F916DEAE2E2750C107C1059C81D0 CQK-N
1,666,247,558 *AF596EDB0AAE0EDF5B1FDFA48581B7C65CDB5BB3 ilovescottie68
1,666,247,559 *AF59842F121075086D4F1A4F1BFA439465827926 imkg
1,666,247,560 *AF5ACCEAAA679EDBAB7106177B74459B187E4F42 E,S163NO1:ANGELUSPRI
1,666,247,561 *AF5A82DE6E88AACDEE0AEFA992DFF42B8769E20F ILUVSPORTS78
1,666,247,562 *AF535AF6C3B038FF654514183E665DE7AFF67EAD IMPALACACTUS
1,666,247,563 *AF5751C553F867B9734EC8ED579EF7DF89A151A1 INTRODUKOWANYMI
1,666,247,564 *AF590DEEFC666BE5C57A056D4E046493650AC8F3 ever413took715
1,666,247,565 *AF5031FE2D678211297FC92D42D7AA1D502DD434 INTERESÉ
1,666,247,566 *AF5F59E81D06611DCC9F8CCA2AAD3AF5D680F4BF I$RZ
1,666,247,567 *AF5C09F5510FAD4DCF745835CF38B72D3FD1A62D irfsrjr
1,666,247,568 *AF51BCE90CA901EA778CA9ABE64770072EE53196 ezinaclu6
1,666,247,569 *AF5F23552E4D35CCBEAA9CD34EEB85E022E8832E itain'ttexas
1,666,247,570 *AF572891B00A7A4E969F8C484BAC93E035D9312B FABIANE LODI
1,666,247,571 *AF59E74871E831069FC15A208E041D26D793ED62 ITKBAA
1,666,247,572 *AF5ADAA83F9FA85D0CEB45A874103FA0E29B049E ITSASORAKO
1,666,247,573 *AF5C88A0C69CD6F6682262909DEC618BE8BBBD3F d38?u
1,666,247,574 *AF56CA1A7E63055DA6EFD18216C86154DCB7E59D Fall-Down-(instrumental)
1,666,247,575 *AF593189BE4AC85C3D74B6AEC15CA9F6BBC9A735 d3p0pu14t!n9
1,666,247,576 *AF52E2ACF0B3020B5D4710EBEF273D3A20A612A1 [email protected]
1,666,247,577 *AF525B0BFE03A598F0184E8F561E5BA85BB0F6BF d41jl
1,666,247,578 *AF5ADFCBBA548F97B65DD5FAD485681F74AB3333 d5ig4
1,666,247,579 *AF53FB85D0E4BF7CCA4F6AA9905BD5E4C070A5E6 DAGKANA8
1,666,247,580 *AF593B21016FFFCAD98DFF3841EF835E23052F10 [email protected]
1,666,247,581 *AF56F7C68E08C9FF01687FC655E6C56B031AE3A9 DAILYTALKAPPRECIATE
1,666,247,582 *AF5B28C432B2F3A126F014268595C16E6D8F0B28 JAMES$$1444
1,666,247,583 *AF5A356D7F651616FF0A04236230CBD712A1BC49 JAMIE-ROBIN
1,666,247,584 *AF5BB5922753B5538D7DF2F09B53760C27C0CD4E DAMELOQUEQUIERO
1,666,247,585 *AF55BEE0A8D087198C18410E895D453542138019 damiaatjeses
1,666,247,586 *AF59D4FB56F0D38C867984FB43447D728D238605 JANGLADESH
1,666,247,587 *AF5968470A46D92E49E202C9C9A76B32C0ABF346 JARED.BERAS
1,666,247,588 *AF5D7C824D4D05CEF536EF7E16A1493872779B9C DANE.AYUSO
1,666,247,589 *AF58CD85977C10183450C5C1086D64DE8623A2C7 DANNEA123
1,666,247,590 *AF5E3F2D0BED0AEAE20684F7B527A8EA32838F8B dannietsantakis
1,666,247,591 *AF5883BCB2C1AE31858F60517F26AB70902393CE DARELLFELDERMAN
1,666,247,592 *AF5E167711652108BEFA6B6F921929ABDF379B07 JARRETTHUXHOLD
1,666,247,593 *AF5C5796C83BF7F5995FCA3FCC9577C829AA1B2B JC.AGRESTO
1,666,247,594 *AF5F68AFE4344C4DDC2DE28C750E5F5FA497735F JCZG30
1,666,247,595 *AF594625E17B11216A32DA76DA398D317841D804 jaspermanney
1,666,247,596 *AF50BCD93EC1B5F0753B05CC8B55C3FAB6C9B4DB DARREL.ELLERBY
1,666,247,597 *AF5E2D6809A99660F4C313AE897B35925E985B48 JAVIER.FRITCHER
1,666,247,598 *AF5B5CED377B7B6C6096E683CDDC35E38383F7A1 JED.HUPRICH
1,666,247,599 *AF5F6865AEC3A77357A05D734445FD97F1BA8DEB jayhergenrader
1,666,247,600 *AF5920EDBC169B75C0EBFF76A10056ADA60732DC JAYSON LAGOS
1,666,247,601 *AF50B513AE03D5F6572E8CEC6A3C4512F09BFDD2 [email protected]
1,666,247,602 *AF5258C2646F8B2F04DA337AC3B820BEC63CC726 JEFF_XIE
1,666,247,603 *AF565E82BAF3F73EC8DC2765EFEABD3C2CBC6F01 jegog..the.bamboo.ensemble.of.sangkar.agung.village
1,666,247,604 *AF5605FE55ED63D1329238F7C91D5FE24D0CCE22 DAYREAM
1,666,247,605 *AF56C35DA85265AEDC50DB68581A74046995BA81 dc2h#
1,666,247,606 *AF556A0138BF1FAD57BE525D758821664C24FAAE DC-P8
1,666,247,607 *AF55DC7B853C50BB2D2F772D673311B5D697EE07 [email protected]
1,666,247,608 *AF5679E64EDBD25DD9E597FF89610AB956296096 JEROME.MCGURL
1,666,247,609 *AF5474DA7C8E642F7192A0CA9BA5B8AA050F8737 jerrelletulain
1,666,247,610 *AF56C4076DFFD9BF269A0527C42B673F33EAFEC2 FIERCELEON
1,666,247,611 *AF50629C396BA4126E9312F969021CD6A70F89BB [email protected]
1,666,247,612 *AF5F0D8C1E9A007EA0744E7DFB83B28CFF8