List database


# MySQL hash MySQL password
1,666,230,001 *AF5A6EB69E4D1E6B0B83C6FDE4ECE1D0DA27DF4E JOSIAH.DAY
1,666,230,002 *AF586B99B7CEB7A43ABFFBEF6C4C88E606BFBF86 [email protected]
1,666,230,003 *AF537ED3006F1B607E7409794E2D809C82A10B1B kabanskiy
1,666,230,004 *AF586387A00CD0361D2DB62EF84DC8C962CBD852 KANEIN
1,666,230,005 *AF5A414BF076FC98833C23ECCEA4A51790034A1B karsyn272
1,666,230,006 *AF589222CD2C35C438054D1F4DD6051565FC6E6D keep.me.hangin'.on.(short.cut).(feat..sandra)
1,666,230,007 *AF5E57E43A0A2EE91A5D77AAC48E93B591393DE2 KIETHMILDON
1,666,230,008 *AF550C14C412B3862D5AD42158E6D0726125607D KIRBYMCIWRAITH
1,666,230,009 *AF597CA25E0436E66BF03DED043C7EFC9EC08444 «kirchgängerinnen
1,666,230,010 *AF5045FBD57F1103144BE175E3BCF0E96EF2CECA KLUBBSANGER
1,666,230,011 *AF565D91BDBAD6AA5E359AFFACB4B79962448398 KREDIETWAARDIG
1,666,230,012 *AF5651AD70D3CB00DA40E5CDBE6E20EB0DDB6911 kristopherschuhmann
1,666,230,013 *AF5DF92E7364F58F4CE1C4E9AFBE42E8698FD4A6 KRSWOOD
1,666,230,014 *AF59A95CEF0EA394BD86C9EB594D0E862E083ABE KRUISVUUR4
1,666,230,015 *AF5ACD466F612CE3CD8C5744400E3B49DAD2569C KYLE.PAINO
1,666,230,016 *AF5CB953BBB1DE322F3EAE1F6C05145BF294E0BB KZSC
1,666,230,017 *AF5F218F5FCB693976A06A3681570E0EF39DCB09 latrilled
1,666,230,018 *AF523688930625FD266FCB170D3E27532BA04FC6 lavernehatheway
1,666,230,019 *AF5E1673D0C4222F2E336F818F366EA7298973ED lavernetortoriello
1,666,230,020 *AF5FA5A1D44C89F99B5D505E28EB4D56738B1462 leiflangner
1,666,230,021 *AF56F2AB8E952E1FDADE8766BB2E652D9497E15B LESAASEL
1,666,230,022 *AF5A9581EDB266319A1D7DDDBDCBE9427F51FAF1 LH.MATTHEWBECKETT.COM
1,666,230,023 *AF524297CED02809FD484E4627017C5A435C5A35 LI-CHIFA
1,666,230,024 *AF5EDE241AA5DBEB2D97053488178D2998B8B349 LIJNSLAGERS9
1,666,230,025 *AF57FC3A856B181E293410D4354C0DFF3456EA9E LILYS
1,666,230,026 *AF5D92BEFA080520D4E8DDCE6A2A45D8630CB8D1 LINO.SOLOMAN
1,666,230,027 *AF5B21968A52C7E4067E4EE13E9A37A49DC540A0 [email protected]
1,666,230,028 *AF52046B995556705A8613F785A424F867E35A19 LIVE.AT.THE.BAKERY,.OAKLAND.-.6-30-06
1,666,230,029 *AF5708954A58F52A68387C4E5507E4D5DF472D3E logicaltopgun
1,666,230,030 *AF51FFB7F91DBEB193AB41A0EAEBE19DE4223C8C lorenbraham
1,666,230,031 *AF53C24BB0EB915ABC1AFF74D057ADB7A37B4451 [email protected]
1,666,230,032 *AF5B4DDAB1D274E3A40385C0E30967920959231F LUCHTKOKER.
1,666,230,033 *AF5C5DAD88D91852010E0A35D3C6302962B85841 ŁYSINIE
1,666,230,034 *AF56E03389A16C4E44AB790D2C7F51650C2C4347 [email protected]
1,666,230,035 *AF50362A7A3779340C23E826A3D94A268083ADD7 M3MORI4RLH4
1,666,230,036 *AF58D18C9996F56B3C3A2BCAFB33D3ADC4ED981E M9221282
1,666,230,037 *AF5BA6D32C5B011DE9696DE17946DDD3097BEECA machtspreuken0
1,666,230,038 *AF50A14DE5821B7CF385F49145FBF40988DD9170 MAJOR.MASTERSON
1,666,230,039 *AF5CD68F113EFBEC9E3BB9CBDE87B688FDE085E0 MALINDA.TATE
1,666,230,040 *AF597E3442D9DEC5BA2A0050A90FA2D9CA514921 MANDY-MCCARTHY
1,666,230,041 *AF588D2FAE08DD76B2B4340D1DE58B616D8071BD MAPRTERP
1,666,230,042 *AF5DF2E3FCFC64EA8C10E0E1EEF9F8069BF6816D MARCELLUS.ATTLES
1,666,230,043 *AF57267425DA6598D9F6E540728394A9D8EDA974 margaret-testerman
1,666,230,044 *AF5015BFAAF9E768587DFCD7B9D4ADBDAFB07C01 margaritocockreham
1,666,230,045 *AF5795F45BF00910F662F6538C4EFA3AD8080E10 mariah-wagar
1,666,230,046 *AF5A3573A381115464D4D7794B12010B979176A6 MARIANGELES-MARTINEZ
1,666,230,047 *AF5137EE83B3EEED39836372DFC870612393C2A2 MARIHUANA GETS ME HIGH
1,666,230,048 *AF504D48C4C6DAE433DA70F790D6556CAD231A67 MARTINLUTHERCHURCH
1,666,230,049 *AF59E80A0F91F13C367E6116DC1F12821B538402 MARYJOYCECARINO
1,666,230,050 *AF523C9855003C692A59F0E7F84825F1FD56C3B0 MASECZKĄ
1,666,230,051 *AF538B77546AFD871BEEABB45E9D48D29F762430 MENOMON2
1,666,230,052 *AF576FBFC4147349269FA64E5CD6980C0A5E04FE „meschin“
1,666,230,053 *AF5BA6232721F7C11143BB9BAD24A3D8F828E16A MIKEKASS
1,666,230,054 *AF55A865B2F9FE0759B911591D4DF5ABE9D247CB milfred5
1,666,230,055 *AF54E8480EBF438528C4BA529AD02296B5308D33 MISDUDE6
1,666,230,056 *AF5747F9AE3860405ADFA007424496E2446A893C mizel--m-ay1-z-ah0-l
1,666,230,057 *AF5E4A98E2410ED9BEFD64AA5EFF2897B0220044 [email protected]@l
1,666,230,058 *AF513C5929399F7633F85B51F36A4EE4FC15ECE8 MLIUAA
1,666,230,059 *AF5369C28713DFABA905B8B6B1AAC763AC51E5B3 [email protected]
1,666,230,060 *AF596719D2F220074300534CB459A0DCFCED0CBF MORE-REVEALING
1,666,230,061 *AF587F6B4DE7017C41D7E3061CDD3572927CD6CA mosesorme
1,666,230,062 *AF55CEF64C5EFBDF27A6A6ED2F8CB7DF7F6E84D4 [email protected]
1,666,230,063 *AF5DB76C1B3CC74624787727B70DB53CFBF5F69F MUSIK: W
1,666,230,064 *AF5A7A90AB812246FACE6F10744020705EBE88A2 mysore4
1,666,230,065 *AF593162BA323C93CF0EF5350E978022D98A7B62 NADINE-LEONARD
1,666,230,066 *AF5E2B1A6B71D5855099B08E6D6B000B85BAFF34 NAYEBKHEL
1,666,230,067 *AF52C4C3439CFFEF5EBAD10FB29BC9C416BA29CA N-DE-LEGITIMOS-USUARIOS-Y-TENEDORES-DE-ARMAS-DE-LA-REPUBLICA-ARGENTINA
1,666,230,068 *AF55AB5A1AA2981A24E4BA249322D8AFBC7871F5 NED.KLIMA
1,666,230,069 *AF50BC3A0E89AEA929D84C217087DB66139670BF NESSMEI
1,666,230,070 *AF57ADEE37016C6BCAAE1D21EFB60B7A4726AD97 [email protected]
1,666,230,071 *AF5568BC3DBAA508F02D0334C81CCF820F377FCB nevetsfa8
1,666,230,072 *AF53F4777A33086F743599B76128E90DDBDCF93F NICK.BEEDELL
1,666,230,073 *AF56F43A25B1FC886289D984F026C5605D8D10A7 NICOLASCATALINE
1,666,230,074 *AF5A0AFED7664646ACA03087273133A2E23E56CF NINABURNETT
1,666,230,075 *AF5535C27E77E74A82D73D65C6980F5D38E27360 NONCONDUCTION4
1,666,230,076 *AF569B4C675BB7A687878FBBF2471E8820542137 NORBERTORIEGER
1,666,230,077 *AF5C690CEBABF9009A0CE5B0374A76DAB89AD532 NORIKO→
1,666,230,078 *AF53659A3B63631A7563175475887A5D25DD866E norman'sfanfare(30secondversion)
1,666,230,079 *AF5586DD596B800EB29732ACBF78C1B6E69742D2 npgpmsc
1,666,230,080 *AF52BFBBEE7BF47C12504D0D61A2203A609F2659 OBALAIO
1,666,230,081 *AF5EAC073B05C760929AEBA47EC917BA96B7B746 omarbanderas
1,666,230,082 *AF58F2D6E244D633829101482B4AB03E4E078399 o'mulready
1,666,230,083 *AF596A0864A94A1D8D14485FB653970B208C0E2E OŠATEK
1,666,230,084 *AF59C43A89DC989A5D2A162280ADA0DDBB76D9CB oscarabbenante
1,666,230,085 *AF50F93BE3CCAC40E72A54D2D40D34BE45D1D7CA OYIKIENI
1,666,230,086 *AF5C8FBB7946FBB47B2DF1FF897815378A3DB29B oy*j
1,666,230,087 *AF581300EA3A1B4646F8D3EA43BF79FECFA54357 [email protected]
1,666,230,088 *AF5188EEE01DC6F11253BD3DE78F52C38A18BDCB PANCHEZ5
1,666,230,089 *AF59E77CC8974BB0545374892B822F8C3E5653F2 PARQUE-NACIONAL-DE-AIGUESTORTES-I-ESTANY-DE-SANT-MAURICI
1,666,230,090 *AF5079DD0F346724E87718207B968C4392668973 PATRICK.BOUDREAU
1,666,230,091 *AF56A9DA2589BCC771067302E3F035E4DE37173E patti&thebluebelleslabelle
1,666,230,092 *AF5BC315CCC0EB28AF5A904C76283FEC8D77D85F paul-draper
1,666,230,093 *AF580A9401D42C6EF71F2C56562E5E7E9F5D2650 P####B*-*-*>-<
1,666,230,094 *AF5643314256B5BE5A9AF60F6F8DB225CBE16D86 PD*(0_<)
1,666,230,095 *AF51F9B376111FBC3048A743F72B82B86D3127C0 PHIL.KULLMANN
1,666,230,096 *AF507A36B659EA4CDFB50076126CAFC0B8E2A738 plateauhimalaya
1,666,230,097 *AF537F2CBEAA7D66F5533460A74063E049DBFE80 <P>NETWORK:.PROVIDES.THE.PHYSICAL.ROUTING.INFORMATION
1,666,230,098 *AF50167652A8CCCF5777305CCC925267EC954358 portprotection
1,666,230,099 *AF563D28FEC76BD399F1F3F6AF16C79D9080A24E PRICEOFMERCY
1,666,230,100 *AF51C20DE1744DC8B3757D73B53F32043544619E prostheticcunt
1,666,230,101 *AF5D6A418B787B0463FB603CC709F3DD90A4C026 PU5E
1,666,230,102 *AF5383F17FB3ABD79CA315EFE6994890F60AB7CE Q#####).~0.}O{
1,666,230,103 *AF5B84EADCBFAEA79DF7C7C87F01498EA7EB10A2 [email protected]~`}8{
1,666,230,104 *AF59D2238080CEFD703934E2555DDD8E7F4585EE quiero ser un delincuente
1,666,230,105 *AF5568FC59B85D957CE5D8C1983185F3E55554C7 r080zbhgbkxt2gm
1,666,230,106 *AF5D97E04143944950EAE8A59713CF39013F3126 RANDALLDUTT
1,666,230,107 *AF5C1D4BE8546913B0CB22610A9012852368295E RANDY.BAINS
1,666,230,108 *AF51A6449F3341B3B086778AD104888054AAC3D0 RATCHASUDA
1,666,230,109 *AF5794D1C7B6866771B8386FAF4B74B8E6C1CA81 RAYMONDMEARA
1,666,230,110 *AF5E1030FB6B812C6F7EBF8DEFE1CFAD405936ED REANGELASTETED
1,666,230,111 *AF5941D39FB984BD0FF2B96F7E565FD66D1EFA08 REBARBOUILLERIEZ
1,666,230,112 *AF5B9C84E9C4E33EDB53A4E40E7ADF630C6F97F1 reclama+0ns
1,666,230,113 *AF5723BDA45572FBAF95F4625AB814755596D5A2 RENE.BELFANTI
1,666,230,114 *AF50F53A2D3816BF77C0939596B4D6F4D03EDD93 RENZDOMEP
1,666,230,115 *AF5D60E3BF4D47FB308B21E4FEF71AF4EE197B3F RESTORESUNDELETES
1,666,230,116 *AF5D631A233A56C5DCC994119CCD4C6F209BD500 restudied8
1,666,230,117 *AF5BF7FCF170C80E95592D3A56F73FCF4BEE8632 RETSEEMEGRUBWSB
1,666,230,118 *AF53AA2D6E41983040BE9EBF3BD82E1AC01210EB rich.satterfield
1,666,230,119 *AF5C4938223DF77A53601D2A1E583EB88A9BA872 RICOFAY
1,666,230,120 *AF574C1565C527899026150283853613FECCDF05 RJBZAA
1,666,230,121 *AF5314579DDD4805E2B6D3B030527F0ADA8CFC26 [email protected]
1,666,230,122 *AF538139D6601078AD147B3C5751C62560E64595 ROB.KRZESINSKI
1,666,230,123 *AF51D67D37E8DCAF5C61510401BB6772A84DBB85 ROLAND-KROELL
1,666,230,124 *AF589DF11946C64FCC5A0785C6B4D2DF3E59B578 RONALDHARPOLD
1,666,230,125 *AF582F6F2141470C04DE7F5FC399D84F4E4A8285 RONNY.MCCARTAN
1,666,230,126 *AF5EBD8D2598D644E22C7B411E4F4BFCE97C3427 ROTAX-OWNERCOMWWW
1,666,230,127 *AF53916AC3E9ACAE6A547B712FB9CA7EEDE6E6F5 ROTTENRIVER
1,666,230,128 *AF5A2750EA00B8977CF892E67326279439C1E24B RUDY.MCMURREY
1,666,230,129 *AF541E4CCB584E397FD2A362DE6E72E9055B35A7 RUSSEL.MCCONNICO
1,666,230,130 *AF5741DB5CA8EBE556A1E377B47E44939BC3BDEF RUSSRONSINI
1,666,230,131 *AF555F8077F1A454ACD8245215649FC74499EDF9 RUTH BARRETT & BELLA SAER
1,666,230,132 *AF5437313392F106FC8D13792FFBFC17FA5EEC4B RUXEENAM
1,666,230,133 *AF5220A5C3DA40B03F9FB26FF2E491478605CBCB ryan1
1,666,230,134 *AF57F5ED9A6728E41C08C55EB78CE8D9F261EAE0 salebeid
1,666,230,135 *AF5F1D8D5407A3E17D321978646CD412E41D1DA5 SAMMY.LOSITO
1,666,230,136 *AF5C99E7435EFBFC3D4C6FAD2EFF501F28272FE2 SAMUALSOWER
1,666,230,137 *AF5D3C9223786007DE735F39BD154227F2625C6B SAMUEL.LIST
1,666,230,138 *AF55B844E4E274754885B8F8B1D5F36C9CF0B7B9 SAPRAYOJANAH1
1,666,230,139 *AF578C853E321A9227316259C100A67A4107B46A SARAH.HULME
1,666,230,140 *AF5AB79EA00FDE4278789B8B9756619A2174BFD0 satiasutherland
1,666,230,141 *AF5CB4D0787CDEDCAAEB844BCA95EBDDBEDC4ECE [email protected]
1,666,230,142 *AF5A33831FD002E21DDFEFA8C288DF063A4C9C77 SCHURKENBENDE0
1,666,230,143 *AF5F8333B1D3DF492963F6D54C4FE9912B679294 S.DES.TR
1,666,230,144 *AF567C72D74D2F741FCCE4D95B16A1C319BE737C SEIFIMMU7
1,666,230,145 *AF5036A73D0B7028970AF12BC68007C23A2A446E SELLABLE
1,666,230,146 *AF5B7E72AA4264B018839EBD28F2EA97DD2791AD SEREKNEA1
1,666,230,147 *AF517A49F81E76B84D09C0CC21AF0CCF7B349035 SESAREFSNARTLYSOTPERTSORDYHID
1,666,230,148 *AF5E36E5C8218622E9444029794AF20ACD10A0EC sexy561
1,666,230,149 *AF54A67C6C36B6AA266E46244D30DC0AF05AEF30 SHAWKER
1,666,230,150 *AF5A617D3992A10B8451B5041D99862B602D9A87 [email protected]
1,666,230,151 *AF5BED208FBE87E1BBADB2F8A45EE5F3C83D9C23 SHUBHANGI-YADAV
1,666,230,152 *AF58F493A3B8748BCCD7DDE121A5399F9C6BCB60 [email protected]
1,666,230,153 *AF5743EB746D75A15A0F2150C47830EEA969D151 «sicilian
1,666,230,154 *AF5E692D1DCF0FC96A80B1A64C07BA48F040B951 sieci
1,666,230,155 *AF5DB02871D1D113AD3DE418B0E9F9DD91B6A544 SINMORTIGANTO
1,666,230,156 *AF5EF2407C868F798E25564094B99CA2C8F24722 SJUAYB
1,666,230,157 *AF574AD5D3A56675EC2169BA7BCD60EE66E58CA5 SKULK(SWEEPREMIX)
1,666,230,158 *AF5C06259A9FAE7CE521601CEE6E6961FBD9247D SOGGYBISCUITGAME
1,666,230,159 *AF52EED46DA8088D739425B929B93CD980E8E8CA [email protected]
1,666,230,160 *AF5421D9EC10ED5CDA90BEF13EA3DB8C7F4A4C87 [email protected]
1,666,230,161 *AF5FC51AFA180B5539EB915DDB479EF4001DD62A [email protected]
1,666,230,162 *AF53D21A456D31003C02C7BEDDC322B72AD02861 SPALLANZANI'S
1,666,230,163 *AF53FB535F8A09EBE463F765D16E655258727EF1 SPLOIT~.D##B
1,666,230,164 *AF5CD1ACFF05645D2685DADB3207527B41404424 SPOOKYTOOTHCOUK
1,666,230,165 *AF5EE935A4FDA59B90B5B4B8981910D32118B5F9 s×rumpus
1,666,230,166 *AF55099091A747B0700F658CBEBFE71CA82353A3 ssisessa
1,666,230,167 *AF5D95A189EB762EF2C082848CC38602F58493F3 STEPHANMCMAHEN
1,666,230,168 *AF5223F6FF1D54D857CA60231B0D818FAA7AC0BA STEPHEN.MCKEAGUE
1,666,230,169 *AF522D6C45ED7C1AD192FBC84AF6F209B2A13A23 stevenaltmiller
1,666,230,170 *AF56B12204B9B123909BF3CC744A1C80852D2809 steven.butts
1,666,230,171 *AF5486A273E6318440D2136EFCFE9A9F343F5245 STONYEYE5
1,666,230,172 *AF503F1A46FB08F96F3C80D1530CBCBEF0A67887 SUEHCRING
1,666,230,173 *AF5EC9413023AF982079DC9B53396D6E110E1028 SUETHOMPSON
1,666,230,174 *AF53EBEFD296E61B764BCD136F6F066E010B35E0 SURFMENSED
1,666,230,175 *AF557964BE0E4982F27F0C1FE3E1418685CB8830 szarota
1,666,230,176 *AF5D9C569CBA340FE307ABCC780249EFADC96C13 talk823613091
1,666,230,177 *AF56397F4EB9F8A913B0087002A564EA0B0BCC83 TANGSUXUN
1,666,230,178 *AF59FECCB04910677B82DDA27FA1BAC16CBCF40B [email protected]
1,666,230,179 *AF516B0C27990828967720631F5D3B36B377CD94 TARASTIU
1,666,230,180 *AF581323A49721296BC5BBEB965700C06F2DCF10 TARHEELS:HOOTERS
1,666,230,181 *AF50ACD9FCBA894CE480B35957F1BE3FAE76E206 TAROZZI9
1,666,230,182 *AF50F0B3221EB71550333114727B724CC5E0282F TCHIHATCHEFF
1,666,230,183 *AF5894778B5E07D9FD1E94980D57DB385C1D9D7B technodanceparty(disc1)
1,666,230,184 *AF58D0478F969F146E7158F17049520B4438344F TH3OR!Z3S
1,666,230,185 *AF5E4499041AC7C58FBC396B681ABD29232E4207 the.fallen.stars
1,666,230,186 *AF5823CDA943A50F225EA3DB05B6E735D9D8A6A9 THEMANHENDRIX
1,666,230,187 *AF588A9F52C578FD550B98ECAE2E3A79D2768653 thyrsiform2
1,666,230,188 *AF5CD18C5F9EB4E95C5D503409623599BEE0494F TIMON Prithee, no more
1,666,230,189 *AF505ADC3883169494842FA73FF18BD4470FB289 TJ-DICE
1,666,230,190 *AF5821FFC609D439911081D17836BF78494DDA0E TMSXBMZNQW0
1,666,230,191 *AF56109B45B025FAFAEF55A9E91FF7ED429F5127 TOERISMESES
1,666,230,192 *AF55134F98B8F23F6CDD99CCCB2AEB1ACCCE8453 TOGORTSO8
1,666,230,193 *AF5CCB6E95C42923D64C85E002DA8E01F3E0DC21 TOSCA: ACTE III PRESTO! SU, MARIO! ANDIAM!
1,666,230,194 *AF52C75EAC3FFC502285C12629F4BB9581B07604 TREIBHAUSPOTENZIALEN
1,666,230,195 *AF568FC2496EAE95F432103480A11574A7DF36A8 TRIGGER-MCGEE
1,666,230,196 *AF58A37A55FC37B9F049F208E0587D70125F087E tsetepmoc
1,666,230,197 *AF5FAF268E37475B60BE43A51C8734C1C6D4514B TUNICAES5
1,666,230,198 *AF589A2E8F79E4265E1772CB03034D22E96B0582 TUOMASKANERVA
1,666,230,199 *AF59035DAF7265CDE6FFD390F65B32C8E7A8C1E8 tylundy
1,666,230,200 *AF5BDAD1088CF0FE5555964400F4A340BCF35CED tylz
1,666,230,201 *AF5F82FE5BFD405756579F24C77C6940BBF24061 TYSONGIESBRECHT
1,666,230,202 *AF559245D89654DFA6D4A3A7757BF5A45B06A0C6 U42093
1,666,230,203 *AF5813C5457C3B36E8D58E0FA96AF7946D7AF3D1 [u\aaa
1,666,230,204 *AF5922631A321FCB925E03A9BA6A79544DD0189E uithalend7
1,666,230,205 *AF5B229E698FC77EC34FD591E22BAAF29E521231 [email protected]
1,666,230,206 *AF54A4191EAED0194A1244E5AA761057E6FC44CC UNWOKEDIUKO
1,666,230,207 *AF5F03E6F1F751F7F8D9334BE848B57872BEDE28 USERMALIIES-X3
1,666,230,208 *AF5C21D48046A1EFC6BB2EF1B96914366414A994 USTJUGU
1,666,230,209 *AF5A80D2076B2121D628FFBC930D3792DEAB1A23 UWAY.FAIRUZ
1,666,230,210 *AF5C02B4725BCA67E23DB2BF665B405D47CCE59E uzdrmaste
1,666,230,211 *AF5D22332BD4D12EE0221FF2AA435AC0BE711EA7 VARNALHS0
1,666,230,212 *AF59893806B00DF3C0858492BF3E164BD41BADA3 vedlekic
1,666,230,213 *AF53EB74F5F6DC6F22CEADBAD20E91F24BAFF29F verndanley
1,666,230,214 *AF5555D9650825BAEB1C35D156933423895C0633 «vianoce» —
1,666,230,215 *AF5DB797BD65E2B5252F10EDF161C5282AE72C48 vicente.cielo
1,666,230,216 *AF50854AE5FF9281B8DE2C3DA00F1CD76B993BFE VICTOR.DANIEL.LIMA
1,666,230,217 *AF594769C1562FCDC0145FC5FE1BB1FD01FDF75D VICTOR.RUDNEY
1,666,230,218 *AF5868317D9A297E14514433D6040F5AFC960E0E vinod.jain.vinod.jain
1,666,230,219 *AF5F8DA31049A6B5CD52EC2EACC8247AE5D148AF VISIBI1IT
1,666,230,220 *AF5B1C1EB968F2EAFD03479BB41C670349CC42F6 VIVIR ASI ES MORIR DE AMOR
1,666,230,221 *AF53D18B87BE1CE5456FF4FA6E94405151F0B981 VOCHTIGH6
1,666,230,222 *AF56E6486A067BD9E22D3D0E09413C388458EA81 W|$0
1,666,230,223 *AF583FCEA1A3AD7BE4992C12C8781373F9DA6416 W3LLT0N3D
1,666,230,224 *AF5B0C4C9683B5CFEE851DF5FC325C5396D8C827 [email protected]
1,666,230,225 *AF575438BC48E7286C1AA8078C199158D6E8DBCA [email protected]
1,666,230,226 *AF55EC10A7CA8A64006DA485B0E28B9CE6293CFB WATCHIN' (MOTIVO HILECTRO REMIX)
1,666,230,227 *AF5FCE5499EBE10273CD8FEFAB9973957B20A474 WAYLONEWELIKE
1,666,230,228 *AF5659F2AC2081047212663EF94AFDE3AE800F1B WAYNE.THONE
1,666,230,229 *AF5A5BF1433C8C9206B5FFEE25283A0012AC2351 webbie,-foxx-&-big-head
1,666,230,230 *AF5D4EAC01FEFD2DB813EC9312E10A8CCB8990FB Weightdown
1,666,230,231 *AF5AAB97BC1BFDA67CFBE2B2985A9B4431DFEC7E wendelltaal
1,666,230,232 *AF5D80A4DB7D5255CFBF09093053310067DC6C95 wëßßeling
1,666,230,233 *AF5561E44C05672B03F6BD649A1CBC0F70F5ECA7 we've.got.it.all
1,666,230,234 *AF5D7156142496CF5E2E256282ED7E3FCD0CB615 wilfredbrevik
1,666,230,235 *AF53D32AFF3513B818527D4FC8434EA91A872FBA william.c.hammond
1,666,230,236 *AF5C424B9800857B2C78DC924B5CFDA7B9DC219E WILLIETRIPLIN
1,666,230,237 *AF51817B7B9146CF9CC5D4BFB17E8484D99A1477 WONG-KWEI-MING
1,666,230,238 *AF527A32E55F4DE881E3F21B3CB7503340070CD8 WR#\
1,666,230,239 *AF59E26356A83D1B7D5F9717EEF583A436C5A37E [email protected]
1,666,230,240 *AF5BA90701F0E23725F693343B5DBBA1E182A6E6 WWWLITTLEWRETCHESCOM
1,666,230,241 *AF5193868308C915CA36E08D7CD412937441BA79 xandi-pike
1,666,230,242 *AF5B8FA2BC006D2C794A7A20A8508AD30E064EA3 [email protected]
1,666,230,243 *AF55AC7984EB44D233917AD87CC201C21CA40DE9 }X{[email protected]=3
1,666,230,244 *AF503463B78AF187B1AE7A4A17564A851BC29137 [email protected]
1,666,230,245 *AF56CC1D2E3D0EC6B72D004C976EBF09FA8F06A2 Yeh.Come.T'be
1,666,230,246 *AF5A88907980EF68CE682676C50090314C888DE6 YEMENI!
1,666,230,247 *AF518EEE7EF4EFDE12F9D1FE43689442CB91F1D7 [email protected]
1,666,230,248 *AF5CAFCFDE8F4793B9019A3C953DB08F1A66BAED [email protected]
1,666,230,249 *AF54B0AC167599CA9E93F24AFC52C95B15AA4C2F YNVI
1,666,230,250 *AF50F5BC26BB620B7C814424CE4FA1805F72348B YOLANDI.CAMPS
1,666,230,251 *AF57558F11050706E2C044C4F21A27A1B5DDC666 you're-a-hypocrite
1,666,230,252 *AF58E9CCB7D5F0C03515E1ADB2C2A58A482CBA52 YouShouldBeMurdered
1,666,230,253 *AF57AFC17AB51D12BF4E3288A37FC5E168E4E771 [email protected]
1,666,230,254 *AF55EB7598DCD7825E1FD2BAAC78EDDABB7D5A08 [email protected]
1,666,230,255 *AF5E87045BBD16BC89708D599C71F18E15DD24D9 Z>1
1,666,230,256 *AF5FE47FD346DE4FFDC2036985C5890E3399BD2F ZACHARIAH.GOVE
1,666,230,257 *AF53275B533F0113CE61BF9969B0C3BA9EE9EC14 ZACHDIMEGLIO
1,666,230,258 *AF5E5EBE9595BCD4392C676C90DC6317CFAC2E14 [email protected]
1,666,230,259 *AF593FAFBBBB6D23FCC9185D65B11583F494F45B zlatica-milosevic
1,666,230,260 *AF5266E3C6806638AB25C11321EE94856C58E20E ZQ9OVDDBG7GK3X
1,666,230,261 *AF5266C1D2392C7F8AF79D97652DFCA3B0B57193 ВИЛО
1,666,230,262 *AF5506619D7799FF02F33D5DC4D674DC9B421701 ОБУХІВКОЮ
1,666,230,263 *AF5513F495CFF3041CFA2D235C7F46E2321E2AE4 сереховичівська
1,666,230,264 *AF5C81494303595DC4C3EC8F0FA8AB16CF78A9EB ՔԱՅՔԱՅԵԼՈՒ
1,666,230,265 *AF57C5864E2C2E4642AB767E2B8766CFEBF1C2A9  ПРОВАТОРОВ
1,666,230,266 *AF5F8D78C59D6A659F2D34B3E87DC70068926FA1 ホテル棟。254M。58階
1,666,230,267 *AF5EABDEA6B4EF075A7E423BB8675FA932100C98 資料により細い日付に相違があります。また届出、帳簿上の日付と実情に差異のある場合がありますが、JRの資料に合わせました。
1,666,230,268 *AF5AEBF3D8CB043FC1313DC16378A25F9D3DCD08 0DQB
1,666,230,269 *AF56EDB426B064467C921FE04DE84D7A98CE1A0D 0iluvmarley
1,666,230,270 *AF582B098A3A25204280980EE8C454F7B345709F 1145383 aufdemwegzumkonzertploetzlichdiekaterstimmung.
1,666,230,271 *AF5724EB1C9E0E5949679738D95EF88CAD4E2C73 13953038x
1,666,230,272 *AF5DA42EBBC2BEC8FD6AA2C0518D6AADE969A9E8 1471988 ITSE-EN-OTTIKONETTA-L
1,666,230,273 *AF5DA0D3A72657AD8E50EBED814BE227D0941E75 15A401C7-380D-3D13-A306-A0E35E176CFA
1,666,230,274 *AF5DE856C846DE543FABD676DCE2062A7A0CBCB9 179 TAIWANIN
1,666,230,275 *AF53633EE50D92277D4DDE0FD489A6CECA6D713D 1932812 tammenterhonopastuskeskuksessaesitell
1,666,230,276 *AF55E52304FF6F4CECCF65E2486979CAF2249892 1AX!TY
1,666,230,277 *AF57AF2495921A718C9998985D0E26DAD8A59482 1 BASF-PRAESENTATION
1,666,230,278 *AF53893DA90D42BB6ECC5FADF0F9E855BF09B4A8 1bumar-warynski
1,666,230,279 *AF5930B2CF63952AA0893318E045958F2FA70014 1CONTRESIGNEE
1,666,230,280 *AF5988E9BBD37509503B329C3BA68B406793B64F 1.ensiapuhuoneessa
1,666,230,281 *AF5CF8E720FC55CC848AEEC41A37BE05AADD958B 1esrtuettu
1,666,230,282 *AF5FA99A9DD8D3C1F80767F61327A560254FB116 1.EUROG
1,666,230,283 *AF5B0EB2CFE34C364F5B92CE27A66128615DC883 1fluchttraeume
1,666,230,284 *AF5CB3C42A6803AAB831288F1F525AC9EF6B4119 1HEPCAT
1,666,230,285 *AF519E1F9FA4BF140F56D0D997EB2AF555009130 1JEANNECLAYTON
1,666,230,286 *AF5BD94D612C1BECB945B38DEB07ABBC07CE0E69 1.lamaprojektin
1,666,230,287 *AF5E1A85C0C5C218FAC76E0507A03383586E0489 1.LATVA-ALUEILLE
1,666,230,288 *AF58823BEDEE4ABF4E8ABBD3D0599CA3A2891340 1.maatuneena
1,666,230,289 *AF53F19F6D081E2674F7A269B98B0E9D91BB6B41 1 MC-PISTEIDEN
1,666,230,290 *AF5B4DB731B041850764B3C0004766A61B61EC4E 1mediumtolongrange
1,666,230,291 *AF55B6539998651865EF047CA07F61A66F425AEE 1.murad'cIIm
1,666,230,292 *AF517145292DB9E523472C09E1453883661DAE8E 1netzschwefel
1,666,230,293 *AF53074FEFFD2577B41A73A8FD45472478CBED6D 1raumgebundenen
1,666,230,294 *AF5711F6BCA41FF78276BC00A551C2918984C45D 1SAHA-AIHION
1,666,230,295 *AF50A0126F97CF792EF49AB850B07A11E5E6BCE9 1 SHOWMANGEHABES
1,666,230,296 *AF5FA71B192A03D3BB2F430C9228E6B5A9DA3128 1.sondershausen-elf
1,666,230,297 *AF5A233741A183DCC2886D7D73D0874784533248 1 STRATEGIE-THEMA
1,666,230,298 *AF535E787C5C4999BE252C9CAA5789AB58A2E450 1 telecastermallit
1,666,230,299 *AF50221799CA7BD0321C7489CE46E0996D1F45FD 1 TINKERED-GENERAL
1,666,230,300 *AF546012E9D48CD2F0C7AE1F3A64495371C8C6ED 1 YKSIL
1,666,230,301 *AF54CDB77B1501621A3A0BFF26542B1D11B6B270 22961 ONNETTOMUUDESSA MENEHTYNYT MIES OLI SYNTYNYT VUONNA -77
1,666,230,302 *AF55DA6AA81C8955308A96C47BAD501734C103F7 2475QAZ
1,666,230,303 *AF52B9E1D4E3C8AF32828B58BCBC1E2441947727 249-UNWRITTEN
1,666,230,304 *AF53842E6EF3141806AD070F031C3C4C0ECC5C43 257004 kirkkoharjussaky
1,666,230,305 *AF5BE261D05C4EB31044DB602939053CDFDEA9FD 291171 THE-GOING-RATE-WAS-$19-
1,666,230,306 *AF528DC5B43A92BECACAB4982789F073ABB2C4E0 2995641 TEXAS-OFFICIALS-WERE-PLEASED-WITH-THE-OUTCOME-.
1,666,230,307 *AF5571CE4DAAE39C6AA1DD7F1DC8298B7C0DA968 2AKTIVITELERIDIR
1,666,230,308 *AF506DC9AE72ADE6811812AD3CBFCDBA3A4E4948 2FIVE-FOOTERS
1,666,230,309 *AF594B7C0EAD5F08443E8C72F4D833C731A7CA9A 2GIROCOLLI
1,666,230,310 *AF599E7BFE6F120B78773F693CB9DA00374E86B3 2 IR-LINIE
1,666,230,311 *AF55852896368484CE86988A768458AB2C70354E 2REILLYB
1,666,230,312 *AF55A4867B1EDB411716E677B826B31E9AF27847 2.RINDERMASTBETRIEB
1,666,230,313 *AF5C958A0593561C85C75FB81135C5F958CA9252 2-strategems
1,666,230,314 *AF5C90E601A6DB54B1147CFEF38D3FBBED988B03 2THEAMOUR8
1,666,230,315 *AF5E387DC040E71F8B187720C3F8A151BE5298E3 399ANAHI
1,666,230,316 *AF59B46D84785973A6BC00A5C3FBA537F407A4A8 3P * * * ~0~oSplat
1,666,230,317 *AF5B12AA207CCEBD8142E97964B2DE04BCA0B1BC 484carmelo
1,666,230,318 *AF57FCFED7A5B0C3E31E2B469A3AFB9EF5ABE2B5 49-MAKSUILLA
1,666,230,319 *AF5201DE9EA20E8E447C9DD004B44467CF7D94A2 4JOHNSONFARMING
1,666,230,320 *AF56659A0819D072C0819D7709A29DDFE8442E72 4MYWINTER7
1,666,230,321 *AF585D93459A4D0BCF8AA802E3D5C2DD6D457E5F 4NICOLEGENESIS
1,666,230,322 *AF56BEFDC160D3779AB5606324AD9E0315F1C255 4NTR0P03D3
1,666,230,323 *AF53C8A897491B1738423D21CFD2DED4B0AEEDD9 4REHCAJSEG
1,666,230,324 *AF56E6DBB036C37EEF17E23A7FF0251F541B7A40 4TAVERNIERIS
1,666,230,325 *AF5C6DF780617EF582A224A311DDDA3B707E1DEB 4UGURASTI
1,666,230,326 *AF5CA3E4127A5EC896BB1D0EF3F88BCF9D34384F 535CC)発表。
1,666,230,327 *AF537BAA74A07D3BBDF6587FED02B4E572A97B71 5BSWSAFIEBSW
1,666,230,328 *AF5643C503292F5C118DA54DFAA464C8DF623BC1 5COMPUTERABC
1,666,230,329 *AF5B2BAB0101D627ABB857C6155561586EC535DF 5DIABOLICAS
1,666,230,330 *AF5855E2FDCB0C4D9AAD0298E016D277DEA798B9 5ILUVCRUSADER4
1,666,230,331 *AF53ECB7A882B1AD1A994788F2ADF02CC4BA3FD2 5NIKIMELANIE
1,666,230,332 *AF54308FD9F321A59081EF2E92F8FC77CB5B4050 5pharyngoplegy
1,666,230,333 *AF53067410BAD1C788292488FC9E345145F7EDBE 5TEJEMANEJE
1,666,230,334 *AF54E25E6FB3E24646C85A96131EBF8CCF502B96 5TRAVELWARNER
1,666,230,335 *AF51579C2F7710EDA9BEC76978FCAFDB52CAF1D5 646207 ASKERIYENIN GURES TAKIMINDA COK IYI DERECELER ALMISTI
1,666,230,336 *AF568DAA7B9A1E22BB45C03370CE2CCC82B14A1B 6BSWABSCHMIERT
1,666,230,337 *AF5A23D8BA607BC2E0F294483EBAD85FA29BFA00 6CICALATO
1,666,230,338 *AF5CD8DFE84B2C9EFFCB89B98AB1DC1A8692EBC2 6CONTINENTS
1,666,230,339 *AF537D9717799A685923EBA7471148F7859B2BEE 6TRAININGARIEL
1,666,230,340 *AF5F3BC9562A2887BD9F7736C0561F3B1FA0EF14 6WATSONWICKED
1,666,230,341 *AF58708A8680F28E93CDFE515E4687E48967C527 707955 liitoksen.tiiveyden.kannalta.on.t
1,666,230,342 *AF5B9AE6DE6FE7AE83DB812B24AA309E707DFF57 754482 usein.varsin.v
1,666,230,343 *AF58DC4D3E5498BFB6F660713146BF820FBF247E 759HAYLEY
1,666,230,344 *AF50AAACBCE27010A6BEC4E54C923D31FEB58C5A 7AF5430E192259D0DBE2DE9CAFE1FA32ID3F3NS3
1,666,230,345 *AF58E36FD775FA76DB4D4E5E028935B05EDD6652 7HIKKOMO
1,666,230,346 *AF552C9541FEB99DAD4FDF18CDC923FE7BEE89D5 7NEUVOSTOLIITTOLAISTANSSIJAT
1,666,230,347 *AF54734EAA8E2D44B8DC2BA4F658E5C17DAF78F0 7ODGONETNE
1,666,230,348 *AF56E73B4662822136FBC46C9F5164DF7A6D4390 7SHIONING
1,666,230,349 *AF583B51E7B57BF51D6A4BD047E3565412AC40A3 8:--8---#---&---acceptably
1,666,230,350 *AF514CA35E2D356B1CEE4F802865C6A84AF9F74C 8##B * * * ~0~osplat
1,666,230,351 *AF584A6BD05CC37F7BFCE3DA84064A8E882670C6 8HJEMBYGD
1,666,230,352 *AF50CF4C053780882170D789CA94DCE96927B720 8INARGUAB
1,666,230,353 *AF5F48ECE1A461ABF75806CF0CD9E6823BDBCE0C 8NARCISSISMES
1,666,230,354 *AF59D750A5D9E9551F009E610840387728AC28AC )8(O~.0~.D#Q
1,666,230,355 *AF59B894F11532690E02B480475668B52F4BD493 8SATTAGYDIANS
1,666,230,356 *AF5B614963AD48020DFE6C1EEFB403B2E8997F26 8slommack
1,666,230,357 *AF5CC4F04B9D1F55A4E72298D05D6091A97534FD 8WANDERSMA
1,666,230,358 *AF567F83670BE20DAA9F9CF5FF9B50EA28F6ED10 9881090301sss
1,666,230,359 *AF5474E101325C590A7848ECB52EF7D341410646 9AMANGERBSW
1,666,230,360 *AF57B28D7E1DE5BDAE81244E63EE7139E4DA7E44 9CURTISAPRIL
1,666,230,361 *AF556BB663460DDBC8A4944EECCB0D4BF414F3EA 9FOOLWILDCAT
1,666,230,362 *AF5BCE6A47196C5BA7EE2236BE2A624155310F0E 9FRIDAYGOLDIE
1,666,230,363 *AF5BE52B3A2E831C0CFD0DB465F3C386B5A58EE7 9GROVERMARINE
1,666,230,364 *AF5BDD2A89BF8E94D9E10D4DE5B47E4FBD97FB42 9SPECIALHACKER
1,666,230,365 *AF5B6091519365EB57A25CF14BA0D93108209D9C 9TETNOHCS
1,666,230,366 *AF5F42137DFCC43A164977650A7BA951B74856D2 a0r5m
1,666,230,367 *AF5BFCD838C7945E8AC80BBCB9B364D217C51002 a0s=1
1,666,230,368 *AF5B2B6E05BD80D94F1DD8BB963FD78957987577 a5(6;
1,666,230,369 *AF51EF41BD2ABD646B3810531EB149A65FE4382D a69)n
1,666,230,370 *AF5A9AE50F313EBDDEE7A342D8FC6E08599D4F6D AAA{F~
1,666,230,371 *AF564025DC446CEA94404BF98548DF5FEF15C50E AACD\M
1,666,230,372 *AF58C623BC21FF51B824D4A3AFB50A8F64008C61 AA!Z:
1,666,230,373 *AF55CFAD5BE0FAEFFE09FE9EC755EB8B7467F2DC a-ei
1,666,230,374 *AF5DC87A99686E141D07E714EB5C774AEF6A5856 [email protected]
1,666,230,375 *AF568A068FE4D6A3F294D10B2E4C0E0856331B8C afcmm
1,666,230,376 *AF57A4346406AFF7AAA9076DB1AC38F498A49A34 ai-ju
1,666,230,377 *AF5D26C93402A9C63A20879CA2454AF838EF6559 aldrig4
1,666,230,378 *AF5B390E4F1F1F12D385B6320D77E58F4806DB81 ALEXDRENNER
1,666,230,379 *AF5917E4901DF99E0DBA65569554C2A9B07276EE ALFREDO CONCHA
1,666,230,380 *AF550446E1691991D1AED0D2769EDB62FAC762DE alhnj
1,666,230,381 *AF57CED3C077CEE982368B4BC0E8B4DEE9742CB5 ALLAVUHU9
1,666,230,382 *AF5B73E8070E33F8699E9AE65207FF03CA26E75F ALLCDS
1,666,230,383 *AF5E3D4B8921C26E08231F12140B746DCEA8FC67 [email protected]
1,666,230,384 *AF509320F873E165B0217C71268923F46F402510 ALONSO.HOFFARTH
1,666,230,385 *AF53E83425D603196A94A18E122C585DD5662797 ALTAMISAS6
1,666,230,386 *AF52D9AAAD87B9ACF9B11563FDABBCB74C754DEF ALVARO.GONDA
1,666,230,387 *AF57C4D49C5CB610B3FF4CEFDB32C8DA4FF33FAF A,M7K
1,666,230,388 *AF5D6744F9D5458A6127C6219D7A2DE4B3419E22 ANDRE.JUAREZ
1,666,230,389 *AF56A3EE5E926F85D1871B8202E6AD2AFEA3F83E angiographic!
1,666,230,390 *AF5167796A78845BCA5BE086B05C86624CB92493 ansonu
1,666,230,391 *AF5CDA4233ABDFA998B43BFBFA1CA10CF86FC7B4 antwanriskin
1,666,230,392 *AF5EC7A9AB67AE4B0C4DDF5299D63E3E4F7340CD A&O.E
1,666,230,393 *AF58569B5C3F24FDE2AD86FEFF3FA8D53F322666 a/.q(
1,666,230,394 *AF5B1EFEFAC4BDC3D7A5D84AC6F95F481A1BFB0C ARDENHUPF
1,666,230,395 *AF59ECF4BFD4DF0C690436D47AEF3C1CCAE34FD2 [email protected]
1,666,230,396 *AF5979E33C13B30887AA5B1EC317F7A1AE18270A ariyapuram
1,666,230,397 *AF53D7AC873BC1C5B3A938971FB0973B77626149 ARMANDBOZELL
1,666,230,398 *AF5239D58F746DAE726191B30D37D6C5186628A2 ARMANDGAZZILLO
1,666,230,399 *AF53FD95993832BD58E8D566E84BC47D80E7D887 ARRON.COSMO
1,666,230,400 *AF5C4CE0569524D0227D5949E76A415C1340A1AC arthurkarro
1,666,230,401 *AF5C8B8F642FD6518BEC4A20FF1370793B1D9A5F [email protected]
1,666,230,402 *AF53F41D41E7A3FDDF22B25B9A51CCD5685575C5 ASAVORER3
1,666,230,403 *AF57E61414B6FD0C889B179578A9621AFFE27B40 assorabr0
1,666,230,404 *AF5106C4C6179924E625C46842357D8635C29FB9 A-SURFEIT-OF-HONEY-BY-RUSSELL-LYNES
1,666,230,405 *AF58E5327CF3D58C5E17EFDA760CA8BF71179417 AUFDERALMDAGIBT'SKAS
1,666,230,406 *AF5CF5DBCC0AD9FADDF1574AE81F379FB2A916AE av42m
1,666,230,407 *AF5D9FC291638506F880EEDEFD457C311D586048 AVRAMALEXANDRU
1,666,230,408 *AF52DBDE3B38D030B976E390FEC3F75A9A680BC7 barnstar-free
1,666,230,409 *AF5601E33A584C91596EC182964E8563282DDCA3 bbd0j
1,666,230,410 *AF5DEB0E603AFB989762AF07E3F7988FB49066C6 BENSONDELIVER
1,666,230,411 *AF5B3E6C2E3754A55AF18B641524CFC80BE9C538 BERNIE.TASSON
1,666,230,412 *AF59532D9AB06EC8C27D9F0A923FD2EB72622EB9 BERRY.KEENE
1,666,230,413 *AF5B1ACDC67076D3E127932FA972911BD2924A3C [email protected]
1,666,230,414 *AF5D237B39344F0C2EB52DE19F1A12E433984C7E BG2JY
1,666,230,415 *AF59EDADD3D9A19EEAF8F331FEC85013E84838A7 bg6ut
1,666,230,416 *AF587020DF46DD608B4BF04460921BB2745AEDC4 BHPS#
1,666,230,417 *AF5505C32292A7184F3A1921DD4CC48ACC415AD7 biou?
1,666,230,418 *AF5573FBCED835310358B1116D601C43D1210D66 B:O9
1,666,230,419 *AF5D147D422DC1CF826914D2A38C8F513EBD6DB9 BRAD-RULEY
1,666,230,420 *AF596BF668A5049A741066A7C9897D2E3E716633 BRADYWEEDMAN
1,666,230,421 *AF5AE03A88E66DDDB5BAEA14CC35622AFD56E621 BRANDON.DUSI
1,666,230,422 *AF56326CB7D0FB5AF122039922C726CB04149D5F break,.your.gaskins.fall.
1,666,230,423 *AF5334F38970C30C07F1D6135975C6E4B8A49CB2 briley480
1,666,230,424 *AF560B0AE952B2BB04CD0511E41CB6771C6E05D8 BRUMMINGS
1,666,230,425 *AF5DD785E8C1FC46292D983EA14D6449294CA226 [email protected]
1,666,230,426 *AF55D0F057D642454D805FE700E93F22DDCEE025 B/SQF
1,666,230,427 *AF5E7D4C4FF9C8297D6BDAAC4070DD9DA78415DC BUMBLER
1,666,230,428 *AF5938F650FC0124FE973C1EAFC08B51EEDFD694 burnedclean
1,666,230,429 *AF5A206B73662D0E019225A926D964EB4CBA1A9D BwwE
1,666,230,430 *AF5EFDDC72A88EB319D7B4F0D401C8F36FCF055D c139c2c70ed13d319f5826bd2a0800ee
1,666,230,431 *AF5C809EFFB90BC18AB0DB34A3B18155815DEE53 c37olo9!3$
1,666,230,432 *AF5705FE5F7E280BE7BA6D3CB6809534836AFAB0 c6pd!
1,666,230,433 *AF5F20597A499193176A299453A227319359F50B [email protected]
1,666,230,434 *AF5CE9A5E8F72D4D4199398ABA3F4A7047951EE3 [email protected]
1,666,230,435 *AF5F8CF678A5E5E21F8FB4F994D65F0C4AB7F72F CARROLLMOODIE
1,666,230,436 *AF5A8AA76A21245300E841BC0AC2073E0DCD5214 CARSONSARAS
1,666,230,437 *AF54DB6D9AB286D173643B69F5D7CAB6EB385E87 cartersowden
1,666,230,438 *AF5AF5A621F1CF36B80D68E70437D9FE32BF5E6F cascade_method-k/&/s'k/eI/d_'m/E//T//@/d
1,666,230,439 *AF5DBD2A182343CB1373FCDC51EE5431A4EB6566 cb)"h
1,666,230,440 *AF5F9ACFF0E14777FC1654EB1F79D6F551A32FB3 ccw28
1,666,230,441 *AF5441724D366F5D54002C999E1D80DEFFF6EF51 CFAA;
1,666,230,442 *AF5F0E9D407E447FE12A6F6E9D16BA41C0E68EE0 CG9,M
1,666,230,443 *AF5B997D83878AFD77B0A84AB55064DB08AD759E CHELSEABLUE123
1,666,230,444 *AF5E9AA236B81F86C2520872D346E2576B859742 [email protected]
1,666,230,445 *AF51B5FF6D6DB1E66B671048EE3CE2F0AF4101CC [email protected]
1,666,230,446 *AF5F2CD1C34F12A4F44DD4463543283705BDE811 [email protected]
1,666,230,447 *AF5597E09A475CDAD95CA2652078F5E72F989201 [email protected]
1,666,230,448 *AF5D80DDA7AB9D64F2E2230DE4C66249D790DBAC chereshovica
1,666,230,449 *AF548E1D0A693FC4DDDA5D6E33E6CA2250BF0D5A CHET.MOATES
1,666,230,450 *AF5197B6F836411675037868B0A4F64A8DABA574 chỉgiới
1,666,230,451 *AF5956D0CEECCA6EC4ADB01FBE394B6A6F9454B9 CHINDURZA15
1,666,230,452 *AF5E017C5A2C342FDBC6660B5D4CF6597FD618CE CHLOE-LAW
1,666,230,453 *AF5540DA3F4D4AC7AED011C357149639E324E0B2 CHOPPRA
1,666,230,454 *AF546A26B2D564135B6833F66F386641974C7CFF christiagateway
1,666,230,455 *AF574C5E06852C44AFCB2C8FB1DFA8F5301B2321 chris.vidal
1,666,230,456 *AF5F56EBE1E171ECF9B34604CA4D04C6871A2C36 CLAUDGIBEAU
1,666,230,457 *AF5DAC1A209AF67FB58EE331BD745A43B1AC5C14 claudiobrumbelow
1,666,230,458 *AF53CF4D22254109931AC27F0F135243E9C28487 clbnw
1,666,230,459 *AF5AD5E0A519F7D8C1EEDB4D6F10B6F07865833C CME#9
1,666,230,460 *AF52C4CC16CF311C544AACF113E29E63FAE32137 CNE,
1,666,230,461 *AF5BA3030A7CA8620648BEFA13023C9C887D6874 cnk.a
1,666,230,462 *AF56671BD740BF8F2742332566862EAEBBFA5816 COLLEENSHERIFF
1,666,230,463 *AF5125D85D382122E0DF8DED3B6F8735AF5DF8CE columbuskring
1,666,230,464 *AF5473B1995455B24B8511B25631825B42A1A52F concedat
1,666,230,465 *AF54837B1FCA6D5AFC4970A929E64F7B082DD9DC COR81CULATE
1,666,230,466 *AF5C02A43B7ECCF1A7C609B5F20F4B8DE1D858BE CORNELL.CALLINS
1,666,230,467 *AF5676009AAE0D364A4764346C2B08CF16021C02 CORTEZPRINZ
1,666,230,468 *AF51BEC3BDC9459B14DD54DF0F44071CA6413BC3 covn
1,666,230,469 *AF54AE8D0222C548BFAC3ADA4D007428D0A04669 CPL官方网站
1,666,230,470 *AF5D7442028AE5AEF5EDD87894DC99FABDF68170 C:\PROGRAM.FILES\ADOBE\ADOBE.DEVICE.CENTRAL.CS4\REGLOC\KO_KR\COUNTRIES.ZDCT
1,666,230,471 *AF5C9D600551A41472D7A706ACFDFBDA5934B85D cq7/3
1,666,230,472 *AF5BCAA980E24ADFF89D94E6A5157DCF7E12B1C6 CQM7K
1,666,230,473 *AF5D76CF1A10DDFDDEE5DE48D718A9CE1823449C CRVFW
1,666,230,474 *AF53EBDD388BF12C4ADF08C4E8FA2E98C89A78A8 CUNEATOR9
1,666,230,475 *AF5B06BBF852371E71399E74FF0504471744C499 CVI-STARBUCKS
1,666,230,476 *AF521F494401D26CCEED3BB17D1148DDA626ADCD CYRIL.CARMONA
1,666,230,477 *AF5C63A11AA385DB35264BC967CEC47DAA259121 c/zkq
1,666,230,478 *AF54A3FBF696AB96C5065813198FAA66295657B9 dampflokaktivitäten
1,666,230,479 *AF51409A5244C2EC302A4E4481F28850D616D5EB Danger.Seeker
1,666,230,480 *AF58A6C3EABC4FA8F517A93E41DB979272A83DF3 DANGETTY
1,666,230,481 *AF53C60012A539567868400ADC32752302811618 DARIN.BOLFA
1,666,230,482 *AF5D0EE0EE9A18C1232CD17B087C39FC21E5DD39 dariusnives
1,666,230,483 *AF50988466DCB0725E04B0989202BFDF13F0E02C darwinclisham
1,666,230,484 *AF5DE981A00D49B0837CF10956680184E666662E DAVE.EIDSCHUN
1,666,230,485 *AF5EC5522BDF79FDBF81A01138D4D0273DB5B52E davin063
1,666,230,486 *AF5381C34130CF0A4631FDFCEFB42364F62C6911 DEANBARBIE
1,666,230,487 *AF5EB6367D941481491F57DEA109B42E413DB17A DELBERT.GUTHRIDGE
1,666,230,488 *AF568B429B833414DDB39B06405640DC3BCC12A7 DEMIARMOR
1,666,230,489 *AF5535DCF823107D9903D7462F5269CB998D1EFB DEONLEUBNER
1,666,230,490 *AF5933C9969B1CCC4B32C9B4099F57B983586EA6 DESILICONIZE8
1,666,230,491 *AF570B9BB6DD079F527099D41E2916C8CD7B3355 dfdu_
1,666,230,492 *AF5956E7D128F2018EE487BB3DC6791848E7345F DISPARAITRE2
1,666,230,493 *AF51F99BA588F4180331744EE425EEFE35DF5953 diz%k
1,666,230,494 *AF51AA88083AA7F726459989880CDEB5FED766C6 DOSTAVENI4
1,666,230,495 *AF59D6F20ABE2D1E06AE0151B941277F1A78028D doxda
1,666,230,496 *AF599B289A54D38A8FDA325522E5C917ACAAE17A Dp:v
1,666,230,497 *AF57B1C472E9197A9DD27E2A3F69F5F515E91C77 DREWBANECKER
1,666,230,498 *AF5E7DD2FA4ED3D13FAEE0BC5040D34EBF482863 drxmqughing
1,666,230,499 *AF5E67BABB5F28D85F7BD598889FA193D2729837 dstilfelle
1,666,230,500 *AF5CF8ABA4BF9F8FA4AA8144D680B11905D9DC75 duz.4
1,666,230,501 *AF5A56D7F650E190848F8A234598D31D9A09AB0E d"-v&
1,666,230,502 *AF5703A236810302962F8F8107328FC76885316F dzee
1,666,230,503 *AF5100E96F8175536D5B335D668A7D6F93579014 E6ADAC76AC
1,666,230,504 *AF51BCB08164BCD94E7001DFFCF9C4BC75C92CC5 EACKM
1,666,230,505 *AF588519278A6331236939F3D800FAF581B1CA5E EDMUNDO.GRIGOREAS
1,666,230,506 *AF50F049A1BC0155D7BD240726218AA38CD30500 EDWIN.LUCEK
1,666,230,507 *AF5B71C6039FF1F6DE54E2BA753C4A241F0F3B17 EESILAUSING
1,666,230,508 *AF59D1572121C4AE105A90DC54F27F5827178E6A eg_bd
1,666,230,509 *AF5264CDEF2D63CA343BE8739C15491A5B47374E ekt=t
1,666,230,510 *AF53DFB3AF74A34D3C258DEE0E4F01813D105D83 ELIZABETHZANE
1,666,230,511 *AF5CBF59D9BFB9F5C28EF19CFB7467A51D2289DB elq:f
1,666,230,512 *AF59FBE85B08785E18A24351E892CF687A416499 ELVISDRALLE
1,666,230,513 *AF5C891B7CD0A0D7F1369A454F416AB2D9846A96 ELZENVEIVERPLATZ
1,666,230,514 *AF5F148CAACC30A8E9C6F3EA30D07DAF3FF18BD7 EMILY.COLLAR
1,666,230,515 *AF5D6305E4CEB0FC003B339F8688E4FA216731C6 eminem`
1,666,230,516 *AF5B4B67C7EF4E01DA921CAF5808BCFCA5493F10 EMOTTURBBING
1,666,230,517 *AF5BBE5AB072A3B2EF528F7DAECD90C84C6394FE en20318966227
1,666,230,518 *AF5C05AE9B866FC3DD5BF5F3E33ED2A1ACD953F7 en2121816233
1,666,230,519 *AF500E5A372D2471F1379E2CCBEFEAB7CE23A239 ENTRA7
1,666,230,520 *AF51E1474D2ABB7A520C75FEA4CFC072C5D64C3A ep%g+
1,666,230,521 *AF509421C657AF8621ACEE20CEB46009DC091263 ERICH.ZIEBERT
1,666,230,522 *AF5C506C2DB243FEAF374CCF88590738F24E9D62 ERNESTPIROSO
1,666,230,523 *AF518A4297281E131D5E621A08BCB5782DEF9CFF erocna
1,666,230,524 *AF56AB0D47392FFE02FB947E6B09DD0D9DD1FE30 esadikiking
1,666,230,525 *AF59443946B180B745113DA125113B7F42392B44 espiery6
1,666,230,526 *AF5EDAF7B1B57929FECA3BD36BD8C9B3D076832E etc62
1,666,230,527 *AF5ED7E306B256366C52C915D529814162AA0978 EXP4+4+E$
1,666,230,528 *AF5051B1D48B28713F27394C857CE512CEC9EC08 Fantasien,Op.116:CapriccioinGminor:Allegropassionato
1,666,230,529 *AF58595AE81A1A24DFC7C3F30CD94120A8FD9FEC FARRYBSW1
1,666,230,530 *AF597B997CD473386391BA53A32606CDE437983D feathermouth1
1,666,230,531 *AF5A8E1E6588A6DC08CF8E28010C982F187CD9B9 fern-reid
1,666,230,532 *AF5FCE013D0D1EE3BE090614EBFCD32D6D22E970 FFILEBSW
1,666,230,533 *AF5ECE1D9DFEB149D05B5F8D627AAEC64F63FAD3 [email protected]
1,666,230,534 *AF59F9AE35C27AA5E12540ECBD83B2830F3C620B f"gf
1,666,230,535 *AF55E5819DBB1B16507F5FF4998CF995A2062168 FOR EVIL NEWS RIDES POST, WHILE GOOD NEWS BAITS.
1,666,230,536 *AF56A357E41A2ACB0AD2B1DBB181DD36636ECA18 FORMABITED
1,666,230,537 *AF5F07DB83D7AFF882FCC35DD678F14167E9853A FRANCIS.CANTILLO
1,666,230,538 *AF55111ADA1EA62E06D4A15CCA9C748BDE1EBE11 FREDERICKCMURPHYGRAVE
1,666,230,539 *AF51CBF21BDFA94C21B3C130DDDF4026FDF263B9 from-memory-(matrix-remix)
1,666,230,540 *AF53F469A335B301393B078838CA4F3B79B54F90 ft$.
1,666,230,541 *AF57CF5A1A279A9F59092D94141DF5FA01FB4A31 FZVP
1,666,230,542 *AF50F7D3E00CD15E43FAAA127EDA6381AE0F9E75 GANIĄC
1,666,230,543 *AF5F54B9F101D26937F2E3582D58C720CE2CC5ED garyhoey&donavonfrankenreiter
1,666,230,544 *AF5586202187E92DC18AC3946A2CCB34B2FAB52A gavinrowton
1,666,230,545 *AF54AF189A38E6DBC418EFE7F163058C4CA8B5F3 GAZACLOSUREDEFINEDHEB
1,666,230,546 *AF5D9CF9C309EA126B9448982CF9A933E92975CB geluidsgoeroe
1,666,230,547 *AF5B45F9E66A6B7CB0B04CA4A519532F0F71C109 gewinnmi2
1,666,230,548 *AF55E6F0CBA192417E8D89E1A2F1455C3C41FACB glenda.morin
1,666,230,549 *AF5734B833CF851B0A9050F8826E52A76F76B48D GOLF
1,666,230,550 *AF5809841095A808F67345C69DF8EB141712598F GREGORIO.LALONE
1,666,230,551 *AF561154489465A1B29138D5CF84E2374744FF91 GSQUARED EP
1,666,230,552 *AF575B2D47393C815D15868B1A9D8824674540B0 GUEST43803
1,666,230,553 *AF50D3B4EF14924825F453C63B0C246BA00183D3 GUINEAPIGS
1,666,230,554 *AF5DD04DA99B0945284700148085D3C9C0D0FD24 GVVL
1,666,230,555 *AF54D83B15E9EAF4153E8332320B296F24FBB0E6 H3M47O1O91S7
1,666,230,556 *AF5A5BF320B3F39423590AAA00A857A44AF05FBF hangin'tree
1,666,230,557 *AF5DE80D54E5407A96C1E16B386158BEDC1BD6FE HARRISON.MONTILLA
1,666,230,558 *AF5E1C0FAE433155BE69000EA9D9783F15CA31A9 HattieLittles
1,666,230,559 *AF596AA5F26F5ABE4F03912DCCF6F0DA8192FBB1 HBEARDED6
1,666,230,560 *AF5BE3ABF1FE4122CB0CFD197C660101E89D9FE6 HBOLAJI
1,666,230,561 *AF58B346511394484B7F91A5D84B501FD0FFFFA8 HCQWEHDT42
1,666,230,562 *AF59276B1E65B41773621F1F709D2AAADE293E6E HEATHEARING
1,666,230,563 *AF5D19C55E42963A756AE832A82E97B7F6FB5659 HEAVENISFREETONIGHT
1,666,230,564 *AF51B39652FAFF8A92425E9AC9592DE9D50DC707 heydariyehzadeh
1,666,230,565 *AF5D9484C5B55DD053587B113F319B3E71C3526B HIDEYRUS
1,666,230,566 *AF5E1AE3964896DC873F707F5131D4050B9E58F8 HORACIOFROESCHLE
1,666,230,567 *AF51E9B1F0C4A28A19B7985A2AA8823779B80538 horsied2
1,666,230,568 *AF5A128E4794B2A04F3F6E3DA00B1BCBA857B55F HR(C
1,666,230,569 *AF541FD41D57C753F5DD984D2C59821400DEAB79 HTTPGROUPSMSNCOMIL
1,666,230,570 *AF55A567156476561DC35614CBA07D1F9883AE57 HUAIIAUH
1,666,230,571 *AF550204F93DC2C88F116711AA8529A01E1456C1 HUDSON.'H/@/DS/@/N
1,666,230,572 *AF576A38D73BE986374932ED7FA8A2E4E5CF3A24 HUEY.ARROYANO
1,666,230,573 *AF52CF8DF4E405646A58A142E397A5E6B3B38828 HUGHGISCOMBE
1,666,230,574 *AF5B05D9D92816EB14A9D9AAC24349D2016DA4AB HUGHKILLIANY
1,666,230,575 *AF54613E7CFD69885EAED526A8D9DF3293B32499 HUGOHYSQUIERDO
1,666,230,576 *AF53C302D2A6552B5A824C917F95B2E051313F37 HUHOHAOTE7
1,666,230,577 *AF56F2AE614D871D6DBAFB522584AC2F03BF6AF0 HYP3RPLAG1AR1SM
1,666,230,578 *AF5417DE2DBA12EEEDD8FEE52BAE11593749EB35 HZ45A2
1,666,230,579 *AF5FF657BB18E786D172FF1671BD7EF96AC09E76 iacn98
1,666,230,580 *AF506E370FA53FE189FC8DC7A76C6BD92AA1BA18 iloveskate49
1,666,230,581 *AF5828E8974026B418F103C6522199DE39414E45 IMAGEJETBLUE
1,666,230,582 *AF5391174BB84149745EB09916E8018E3FDE5815 INAMNAQVI
1,666,230,583 *AF5A84BB246FA1621B38387D9971A5A32C37F581 [email protected]
1,666,230,584 *AF524DDBFCC2CE9EAB38524FBF9DF8C863A68DD6 INFOBOXANIMANGAESPECIALDETV
1,666,230,585 *AF5D32F7B3499612CF46965CCEBF0FB1379B2952 INSTRUMENTSHURDY-GUR
1,666,230,586 *AF58494820D61119038A85E70347AE2584E9AD29 INWAARTS
1,666,230,587 *AF5CD1C866C785171069E8129F0778D1A9937E0A IRDCAGES7
1,666,230,588 *AF57268C13DC156DB2E168C403AC507D44F2448C isannatha'ncairdeasmarachumare
1,666,230,589 *AF5749A14DC17E77FFF87FF5FB02C64CB6A936ED ismique4
1,666,230,590 *AF5D81AB5AD1E1D911330F65A492F662890C532A IWASMADEFORLOVE
1,666,230,591 *AF5F588F4B10F23A301FFC0D5D07470C11BF9079 jadensun
1,666,230,592 *AF5169EF06221EAA52EDC063F9C21AEDC507C706 jamesarmeli
1,666,230,593 *AF56CB5B87072DB943149E595C08434329F54323 JAMESDACK
1,666,230,594 *AF5FC37915EFBD68D107905EEA3EBBA8E253F4AB JERRYBARCENAS
1,666,230,595 *AF54D9515EE3A091E9943AC50C0D5B5F4D93AE79 JJ2F0TVGVSF4HGXJA
1,666,230,596 *AF58D2745767DFAC02849C6575E6F8FD0BDEACE7 JOAN.EASTMAN
1,666,230,597 *AF518E95E2AEB6B4AC257841AF1D054254BFF57D JORDONCLEMMENTS
1,666,230,598 *AF5E042C7A066FB8F3C55BD4054CC7D78AE34EF6 JOSEF.SCHNORBUS
1,666,230,599 *AF59B7DD12BDC9FF8900FB0D41E11451CB951164 JOSEPHETUK
1,666,230,600 *AF586DE12AEDAA1317F62D88FBFBD96BB897665F josephine.nunes
1,666,230,601 *AF51FE90FAE2D818E40651E38F12AE77B1E88414 JOSHZIMMEREBNER
1,666,230,602 *AF5D0445556618FF28C51C6C93A00384EA6F06F1 JUDITH-ABODE
1,666,230,603 *AF50376AAC13133AEB63D93204D8F2D4EC3DA2B1 JULES.CULPEPPER
1,666,230,604 *AF56080C3F6CFE3DC18C3D7ED1BEC8E26179DCE6 [email protected]
1,666,230,605 *AF51C00496105B414721C00A8ECF71FB3F3F2EB8 katiecapel
1,666,230,606 *AF5DFCF06260056393073E7FD4FCB729EA10F043 keeley
1,666,230,607 *AF5625107DF96D246240662FF487E9883B6D61B8 KEMIJOKI5
1,666,230,608 *AF5F616C90E2AE3BDA690A9AA0276E9DA3045EF1 KENNETHSCRIVNER
1,666,230,609 *AF5605D2A5E8B61120A077FDEF5894021761DCE1 kensellers
1,666,230,610 *AF5B2F4E810C014C2A80E3EFB19FC98ACA1549D3 KEVIN.MCNOLTY
1,666,230,611 *AF58E762C3E7F9E7B29E0F2D9C78115CF0EDC3E8 KHARAOSTA’S
1,666,230,612 *AF5530815C795F6310F16642EF6CF42CA9BD9ED1 kjempest2
1,666,230,613 *AF564BEADC0336AB7E703ADFFACF41BB63BA333B KRISTOFER.DASHEM
1,666,230,614 *AF5E36921C7D1F36DD1662992A030E89DEC53201 kurtestrado
1,666,230,615 *AF5E4B3D0A659FAE382F515CDAE8F38F6FA17435 [email protected]
1,666,230,616 *AF531A0EE79175DA816CEAFE5BB9C3616E666875 laboratoire2
1,666,230,617 *AF5FDF4366F09AE3AFD65E618C736CEEBCDBE4D5 lämplein
1,666,230,618 *AF542B65F9669050237E1651F82062BA4BA88C7B LENGERKE9
1,666,230,619 *AF5D39E936711F556A3E3C6E7CF274A34E83D250 LIEDERAUS"DESKNABENWUNDERHORN":REVELGE
1,666,230,620 *AF5367FF6424F8402279317A5A1C78E246B33B89 [email protected]
1,666,230,621 *AF5BC11AE95E7B13CEC0F13FEF3F9188AB71DC0E lizajansevanvuuren
1,666,230,622 *AF562CA334FA13E72AAF271B93C3C1D8EAEC85AE LKERMITGLIEDERLIST
1,666,230,623 *AF50FB7FD38E96DE952351B8D9E33AC194CED157 LOL1888
1,666,230,624 *AF54FCD30D4E4E8C14452290F8E49524246CA8B7 LOREN.MAFFITT
1,666,230,625 *AF50CA04AB5D8E78E88F6B8933FA193843593691 LORISLUT
1,666,230,626 *AF5F689EAD7E8A9AD0DAF0BFDF30AB84C655862E LPDKCREW
1,666,230,627 *AF52340094FFB6A46419665E3EDCDEE22CC41090 LYNWOOD.SOOD
1,666,230,628 *AF5C8588DEEE17DF1FB1A02A15CD7B6BCB6809A1 M1E
1,666,230,629 *AF52D1E6EA769F5740066078F1A2C558149CDD49 MAEGDENDAL
1,666,230,630 *AF5C675DA398CA743BA17CAFAC1980232B22DFF7 MANINFIREBBS
1,666,230,631 *AF58516A2DB63B580E7BD1A3DD2D3FC5B8B7842D MARLINVERRY
1,666,230,632 *AF566BAE4EDEA08832379B9295B2E9A6652C1550 MATTHEW.CURRELL
1,666,230,633 *AF5FCB28201113ECFDC0BB1541BC48B0D6477E47 maurerbunde
1,666,230,634 *AF5229603318FB41546205DCBAECB9414E8FD1E5 May30,1998
1,666,230,635 *AF5550AE59BDBA5A844AEDA016799842A1EB9292 MCCARTHY-M/@/'K/A/R/T//I/
1,666,230,636 *AF5731EFB36B9B74015FBE7B98C4492513FB643B MCQUITA5
1,666,230,637 *AF56D27F69CED340D5F092E9170202663EBEA6ED MERESAMNEWALIKHIDKIMEIN
1,666,230,638 *AF5DF4936CB53C317DA46E774045CB5936C98172 messiah:-part-ii,-no-35-chorus-"the-lord-gave-the-word"
1,666,230,639 *AF57407B83B9E9010952DC81BE1592C77FAD52C5 METAPECTIC.
1,666,230,640 *AF5310D3FC847A868CA50C979C5C5A3B6CD08132 MICHAL.RAWLINSON
1,666,230,641 *AF5D4F8045F81BB11DD54AC1EF97D0A1BAEFE3CA michealantronica
1,666,230,642 *AF501A8AD587EC15514D3C4F53704A3E323681BC MICKEY.REICHENBACH
1,666,230,643 *AF59FEE1447A1C5A01E686CE6BAB952A04442048 midd1epe
1,666,230,644 *AF5644C5E366E15FD46711AC05F387EA17AE8C6A minhtamulis
1,666,230,645 *AF527879ACD48308375AE7E3B803A4ACBA4004FD miosotis.vazquez
1,666,230,646 *AF5DA7C89B8261C666600DB12C4483BD3AA2D452 MITCHELSANTIAGO
1,666,230,647 *AF508F10411224F510C55658FEA6721B9ED8A64C mizugutis
1,666,230,648 *AF56F532A9C480D0699670822031BDD78F2F80E4 morpheus
1,666,230,649 *AF5BF82C4954CE9AA87BD0476893B37248CD84C0 MOSHE-MIZRACHI
1,666,230,650 *AF563AF823C95A1740CC65FB01A1AC2E710E846B MOSHE.PEDULLA
1,666,230,651 *AF5945BBE0F355C660883915DAFB36ADAF0A3EED MU1TINERVATE
1,666,230,652 *AF5BC4F3326DCD291E6328A4FC6007CD9A517CB2 MUKHTARODIN
1,666,230,653 *AF52F0936B42A2F188C28F51CB159AF081D15FCC MY HEART BECKONS YOU
1,666,230,654 *AF5ADB26B4F7E29E51B59FC2033B7C10A6BE8EFD NAISSABLES
1,666,230,655 *AF536D901A5B14FDB66AC980084EC698BA4C94D5 NDHotshots
1,666,230,656 *AF587528B46C453B1E81AFDFA10944D6845EE76B nd-philippine-international-motor-shows-first-day-august
1,666,230,657 *AF50033D448ED7BC0B7310455C52D1CFAC0168A9 NELSON.BONEY
1,666,230,658 *AF58BB5A8FDD537E125A1F2E59A0B9BD54536991 NESVARIS1
1,666,230,659 *AF5E4476EF9E94143B1F12B19F708038A4BA84BA NEUROTEST
1,666,230,660 *AF530BBE5821881D5F61789CDBD5FEA7C6A71F9F NFOHL
1,666,230,661 *AF583A850BFD855E631880F851AD7C4E06A4A31D NICHOLASMUGG
1,666,230,662 *AF57687C504B94F4BAB851854BB5902E123F58C2 Nichtsvonalledem(tutmirleid)(NixDeLaTristesseremix)
1,666,230,663 *AF54C42ADB113AF5376BD6C05C5815F254B85E4B NICKY.WAYNICK
1,666,230,664 *AF582406A6A727313BA929E18ABB63FA825B43DD nigritlan
1,666,230,665 *AF5E987B55E7BE45B0EDAF788C6D1D849C42989F No.-3-Do-minore-/-Grave
1,666,230,666 *AF5B45C3929D10A20B5782211F639C47D2DF25F1 NORBERTOHALDERMAN
1,666,230,667 *AF571CBA2DDBCA181B33FE21DF15498024AE5B6D OBJAVENE
1,666,230,668 *AF59C7EF973923A52F35D8CDADC84EC0D4FF2275 OCTAVIOPAYSINGER
1,666,230,669 *AF59BC9BDFC6FEC2C8E30E8C7094A77D2F7E56C9 O->-< ~ D######3
1,666,230,670 *AF50D073EE390B1E6672C8A128F2453C980CF6F7 OEZLOVAJA
1,666,230,671 *AF5E41A0621584C9517873DEFC24A53878FBFD45 OGAMBRAH
1,666,230,672 *AF522A8AD04CC0F5195ECE15440A2979A0FDA553 OIMPLEMENTAH
1,666,230,673 *AF5B9A9B9B2B76943A21ADF2C3913F7CD4F021BA OLIVERSUPPLICE
1,666,230,674 *AF5C41760C1BC4B0EEE5CC775AC6E889BB027B55 OLLIEDISANDRO
1,666,230,675 *AF57F8E33ED360775F8F11242729C2476A701C9C onvergetelijkst
1,666,230,676 *AF5AA32A633C372DEF314299647A15CB44B5D7BF ovidiu.pavel
1,666,230,677 *AF58984BCAC21896D8FAF794D262D90A1D266344 OWEN.DEDOMINICIS
1,666,230,678 *AF5F433132D2876FFB21475D445F9B7A9E2AF7C1 P=====)~0~o{x}
1,666,230,679 *AF57F0EEB38AE459ECD8DBC65FD21CD50A554615 P’ARSADAN
1,666,230,680 *AF58EA8CCA429E832524F84ED226409767D15F17 pasiliksumanim(slow)(duetassus'jam)
1,666,230,681 *AF5CE52F15B6E1A4352EB1D7375205DDFC47AAC0 PAULA ARCHIE
1,666,230,682 *AF577D87B9D1B71B249B4FD5A6A600B5B6EDC7B9 pegahpasha
1,666,230,683 *AF53B528E6B4CA7AF3206971AB50F7EB008CA9F1 PETER.CHRISTIAN.HANSEN
1,666,230,684 *AF50E4E3F8DD32AFCC853343F0B98B953ACDB23E [email protected]
1,666,230,685 *AF56ED1194672BD85C8CE099680C9C6319028C4A PLISSI3Z
1,666,230,686 *AF511025A6CD416BFA13B2E41D0DF2C934EF9D84 <P>NetworkingResponsibilities
1,666,230,687 *AF5329AF8D2A653C346E78BFA53498DB123A98AE p###>`~-`~-o->-<
1,666,230,688 *AF56A41547F4EE37D022B9069F4FDC5CA5E3463B PODALICSES
1,666,230,689 *AF59338E4C23C2445B30E45DF93851D9E43AAE5F polanicki”
1,666,230,690 *AF5CB07931EF2B6FE592ECB90E8A02E756C950C7 pop-song-'89-(live)
1,666,230,691 *AF55E9A1FFA5A078DD7623859DF82A71EE925C95 PRELUDE.IN.E.MINOR.BWV.941.(FIVE.PRELUDES)
1,666,230,692 *AF5DF415CD24341412D80F7F34E001C56929864E PROFILELIBXT
1,666,230,693 *AF5CE460C084319BF5F3BC5497E02EBFD7B0ECA2 [email protected]
1,666,230,694 *AF5011475C4C277B3B67ECBC226F186FFB671E75 [email protected]
1,666,230,695 *AF5BB913CBE9DEBE2FDE4B4B7EF73CA314C85FB2 [email protected]
1,666,230,696 *AF5D55E6E35DDE702C78C98C646E12686584463F QUINTINDETILLION
1,666,230,697 *AF5207802B6F24F124DA961B036BAEB493996AEC RAMIZINASUTION
1,666,230,698 *AF539025F059E1B819537FC5A2F4BE864538D3E0 randallharrald
1,666,230,699 *AF54968B9E1FF65AD4D4CA63AF5A175E469D6EED RANDALL.SUB
1,666,230,700 *AF5B7753F28424E376B7528FFEB26E3CAA11181D RAYMOND.GADAPEE
1,666,230,701 *AF58AA64C812E8BBBF17F8A5F652372E1C62239F RE1OCA+ON5
1,666,230,702 *AF51D88E4B4CFF06BC48F52FCC40347FB605204E RECITATIS2
1,666,230,703 *AF5F01AD925A76BC06CA75A100977E799508363C REDDEVIL4YOU
1,666,230,704 *AF5B1055A664B7B8EEE0DDCE1BB8FDF7388B4619 REETNEMUCODED
1,666,230,705 *AF5AD5536B003CAFEBD2DBA35603B940FC24EE2D REGATOM5
1,666,230,706 *AF5CB35B9F1F26CC2661C5750A8CDC42EDBB67FF REGISTRIRANJIM6
1,666,230,707 *AF52F6817F3BCF11E9FC1F3AD9FBC5066A1D4F30 reiszalb
1,666,230,708 *AF5AC9C33ABCC9E3BAE3EF2345C1B0F7F088BC2A renatovictor
1,666,230,709 *AF5986C3AB7AF5A9555B91DB81334DE11347FD9D RGRAGSON
1,666,230,710 *AF56D75F559A9494739781FCEEB8BFD3A933905D RHEUMASOL0
1,666,230,711 *AF5FF91673632B1A7F6C9BBE2AD892E9F182076A rickey-price
1,666,230,712 *AF59DDD54B29D06E95CA288A4B98812B637A57D8 RICKIE.LOWENSTEIN
1,666,230,713 *AF588EC03AF46D2DDC5B03E520C6BB0025EFDCB8 RIGOBERTO.TAMBE
1,666,230,714 *AF59E8C85EE096A1DA5CDACE00669B3B6F9D8B4F rileybaudler
1,666,230,715 *AF59BAAC89711A1B27FF35C60AB159BD89874B80 RMBOTEDY3
1,666,230,716 *AF5745E222DC8E0EC1ECAE4D2E522EDF5B1E0B3A RMEILA
1,666,230,717 *AF543B657EBC368C2CBC34AAFF03646AEDD13996 robecka2
1,666,230,718 *AF5061757C41477049B3284EA693892195D82317 ROGERTHANAS
1,666,230,719 *AF5D7AE7CDDDDBC96E42A4C87562A2CEB7C1D177 ROGO370
1,666,230,720 *AF5A839130829772D07B5DF74BE9E42A333B8945 roolaid
1,666,230,721 *AF521663E9AFECF92EC6F4C44B446D1BEE1A6932 ROYCE.LUECKENBACH
1,666,230,722 *AF5695C4ACFD02BD866005B8DC2B89CBE86CAF97 ROZUANDING
1,666,230,723 *AF5FC2D8AF559ED47F9AF34DE3DF138BF9D8B993 [email protected]
1,666,230,724 *AF5650D1178530087EFF3055BF7EB780A6F1D48B RUMBLINGLY
1,666,230,725 *AF56BBF26D954BD5E44F9BDB5D47F56DAEDDDB2B RUYLENA9
1,666,230,726 *AF5205F797CF5AF5B79634252525E815FF256B41 [email protected][email protected]
1,666,230,727 *AF546F0EB7A2B3B9CE5764CFF181B6612BCA43F2 saintnomlabret
1,666,230,728 *AF519C5EC3713082332815D4D7E7AAE63E5DBE80 SALVATORECEJKA
1,666,230,729 *AF59B3C08D05A57514ABB33E57F486591A6A5989 sameergaonkar
1,666,230,730 *AF52FF6B817447728AEA2A3E715C198F5D58568B scene:-cinderella-arrives-/-in-the-palace
1,666,230,731 *AF5123869DCCBEF39ED746496B59733ABDDBB06C scottyrajala
1,666,230,732 *AF598BE447601FB96222B8D3256E2A48827E7BFD SE400.PPPOE3966.SA.
1,666,230,733 *AF5E49045E95C2808BF0E3B515CE0C8DC6AF4E94 SEANRUFE
1,666,230,734 *AF5A519CD4EC970DCF1518C29444704E3B149E48 SEKLAHCSING
1,666,230,735 *AF56E666959F2839F8E370C2DBC261C2B3F241E8 SELFINTECRIT
1,666,230,736 *AF553895B5B591C6D75D0F0B7AC0D9941410A2A8 SEZILODIED
1,666,230,737 *AF55583BC3275F089DB2A6154BD58F2CDF0DEFDB sheldoncunniff
1,666,230,738 *AF55787598FA5920B9484FB6282A2AFCC910C427 [email protected]
1,666,230,739 *AF57C7417EA28D1973E63BA278F84434477D7D3D [email protected]
1,666,230,740 *AF5EA2CA6A871934111C616ED325F40BB9675103 SHOTGUN-LADY
1,666,230,741 *AF59ABF9365A6072EA97313BA949396D4207EECC should-not-exceed-one-year.
1,666,230,742 *AF57DAAB6B8770B81FDB2E0A9CF7234CCFC050E0 siperlendi
1,666,230,743 *AF57F036F6060DE645B966913C4846E95C1362E0 SIWNNOB0
1,666,230,744 *AF54FC96510D6EB7F387D629E3D6EAB765DE5342 SLOANE864
1,666,230,745 *AF51AE58A4A49065D21CDDA5640F427E16115FEB „spektraldarstellung“
1,666,230,746 *AF580465CA58BB3E00B302D04FC85D857AD381ED splat 0~ @p
1,666,230,747 *AF5D22C4086C23A4674DBE711DCF230062BC182D [email protected]
1,666,230,748 *AF52EF5507814709B73C1E495540142DF351201A SRCHEVRU
1,666,230,749 *AF547F93CCBC8C04E85525349385607AAACEE19C SREIDANA?
1,666,230,750 *AF5334F9D92C1938D18231D864F2659C4394F676 srvcsgrclsdvrss,s|spn
1,666,230,751 *AF5FD639CC5B14F8DAAB3B631586EA33655760E4 ssenH
1,666,230,752 *AF573B5DA1FDDC096DD951830BC7A8BBAC60EB6A stephenmigl
1,666,230,753 *AF5C9B41FF426833C264EE00DBC583069194043B steuerungsaufgabe!
1,666,230,754 *AF5A2A7013187A39DA5CB9B58A71F9D90D37671E STEVIE.JOY
1,666,230,755 *AF5F8ACF20C89ACC7B5A943564C3F643F7D3D734 STILLINGIA1
1,666,230,756 *AF59AB8A7F7C7FA6A944198735873EFE2232055A SUGOROKU3
1,666,230,757 *AF5E8222DA7D610B5C19C1504F8C17783FECDD94 [email protected]
1,666,230,758 *AF556BE135CA1C9B4FFD0678BA1B9043DDA894F0 SUSMITR
1,666,230,759 *AF5A7183D946851FBE04379EBC7E0A6CCDC1B908 SWIMMERALLISON9
1,666,230,760 *AF52072781EA778F87C5320DDAFC767D3160B9E6 Szamait-1
1,666,230,761 *AF5608FEA7FB4C156DF9BDB87A3E5451152D4773 TANYACALLE
1,666,230,762 *AF51959B3BAFBEB2CAE3D7DBB3363AA766F37061 TASHAGOPHER3
1,666,230,763 *AF5D8788C00C33BB363800EA63DC007210DDFB19 TAVERNA.:30
1,666,230,764 *AF57EC7B7B9043AEA8CC293A7F3A61FE023BC889 THATCHICAGO94
1,666,230,765 *AF531A31DD91F33C77B08347BA88E078BC6EF3A2 THATPANDA75
1,666,230,766 *AF5497765AACF63898641A3326F1D8A7C3A4B745 THEOLOGASTRICS8
1,666,230,767 *AF57C959172CC99F4D9269B63120D236593B13A3 THOUGHTENS3
1,666,230,768 *AF589C1F3D27261AE63E00EF794EEC6EE0476681 tiberging
1,666,230,769 *AF52D2613D31FFBA093644A23142DB7F0108903C TIIT-REIN
1,666,230,770 *AF524084320ED5DD83594908A32351D335D429D0 TODAYIMPALA9
1,666,230,771 *AF54200AA9A5CDF271C200ACC6FE6409F3277AF9 todd-bramer
1,666,230,772 *AF5A6AD3BB1870C4D76721FFB228DAB609E60C24 TOKILLAKING(PANDIQUEMIX)
1,666,230,773 *AF5C8B2F8914B1D9167EE27EFA17B08A493AA6CC tomashysong
1,666,230,774 *AF5223C15925D5CF5DF484F2C903116574FC560A TOMMI-SALMINEN
1,666,230,775 *AF5D4FF570DAD3E2B50713985835634BA2514B2A [email protected]
1,666,230,776 *AF544E7BF5CB68495209FDEBEDD24B03F242F983 TOTONARAN5
1,666,230,777 *AF52B2657F00546EFCB9940D7A1E6E7D26A4ABC5 TOUTES MES JOURN
1,666,230,778 *AF5D64E488DA78FF4CDEC15732096204F1AA614D traessicaodom
1,666,230,779 *AF510CBAB88A6A5E5EFE78E63CA7D510C77232CB trent-vanderaa
1,666,230,780 *AF58A8D06678457D04102FED39A809C2DDECBC44 TRIGGERHAPPYDONKEYS
1,666,230,781 *AF54EF65036BC3CA01691D2206AC7F892DA8F902 TRISTAN HONU ALVAREZ
1,666,230,782 *AF57FAEE5131A256050A970F2252898A9CB0E6AF TROMBINA9
1,666,230,783 *AF5B3A120D942E6F9EF3BF5E19FBF37D1DD118D1 trumanaleksey
1,666,230,784 *AF51D912E5CC1EC7E5CCFD560AD993C19DBBE399 [email protected]
1,666,230,785 *AF55CAEEEC70A1BAA2E10A9B962B1B8FC592E372 tyesha.malone
1,666,230,786 *AF516B821E1534AA294947BD262CB3E339CD28F6 TYLER.OSHIRO
1,666,230,787 *AF56C3A5A4C056B37BF08651F0D9876CAE6BE24B U-BEIJA-FLOR
1,666,230,788 *AF5DDE64B8F7F2AD11C96994B10634C47082A6BF underdeveloped2
1,666,230,789 *AF50947B29294F4B417A4EB4C90030605E5886A7 UNN
1,666,230,790 *AF5B66769718176778FEFA9D720F799E3D73EB23 ussyonzkidz
1,666,230,791 *AF500E0246FB62F59219D2858AB96E14844152D5 vanessa.petiteville
1,666,230,792 *AF50CD2A411229509B5D7A73FE8EF54949E43480 VARVEDDEVRAVING
1,666,230,793 *AF5EFBDDAAEE44CD77EA455AD18D920D9C319A64 VERKROMT1
1,666,230,794 *AF53EF1042F6F23AD8553D6BD9CA45D175D75532 verschmilzt1
1,666,230,795 *AF5DDFA85AE11728A4D02D1042EB12A681FBC391 villageoflyons
1,666,230,796 *AF54167831458C24A09D2A56A11BE6ED5E1C627B VINDICASTE7
1,666,230,797 *AF5431ED908A1571F1F5152E3C9595684B024D49 VISLŪS
1,666,230,798 *AF5440EA78F97566E8B61F23FBA4D1AB9AC06CD5 vitoselbe
1,666,230,799 *AF5203BD8AA67128121D335C1D8E72B8D5595038 VIVIR ASI ES MORIR DE AMOR
1,666,230,800 *AF599A9EFB8778F56ED1C1FC76746FA2C953D9AD VOLCANICDUB
1,666,230,801 *AF5324E33BD69DE05326DFEA8ADEFA2EAD9F4B39 VRBASKACINCO
1,666,230,802 *AF5C26F3A71420A73B5C939F3F9D2D3AEA9B672E V/]Y
1,666,230,803 *AF5ACDBA2F8513CCA91F5C6FE4F24565E99F6CD0 WALZBETON
1,666,230,804 *AF531CFD61C2118EDE2A7531308A355BD406DDF5 WEINGERFINISHES
1,666,230,805 *AF51B6C8416E70EB325E1D99FDA0FE8F338FE744 WENGGAUNAMIACO
1,666,230,806 *AF56A9D0457468B5FD9C12A5AC2AB1AB071E30D4 [email protected]
1,666,230,807 *AF551DFA2E7BAA81CF69EF325C52B3EB40B7DE9E [email protected]
1,666,230,808 *AF5BBC24A8CDB0377534A2E872E9B756BE0D545A WE'VE-GOT-TO-LIVE-SOME-LIFE
1,666,230,809 *AF564128537910A0835E01ADFCDE5D4646104AD0 WGGROUPSREMOVEFROMSELF
1,666,230,810 *AF57E1DF7E1CB2EEF6504AB5A4E297BCFB97C03D wildeth-tan
1,666,230,811 *AF52913BF27441ED60730AD62CE66B63C40C7764 WILSON.LOVAGLIO
1,666,230,812 *AF555493E7F196D921D23D25B485B84528B788B1 WINNIE DEMENTIA JAMES
1,666,230,813 *AF589EA70506AE58741264EEEE1D7938DBFB1137 WSBFASUE
1,666,230,814 *AF56E950D03B2135536BFDEEA38FACFB3B6F1C94 WWW.ACHIEVEMENT-PRODUCTS.COM
1,666,230,815 *AF5BEC18EC3EBB31ABBC257B2155B7D6072ED386 WYCOMBEAIRPARK
1,666,230,816 *AF5BD99905C32F93A10A2314F766E5B6057532EC XBMNHXI9
1,666,230,817 *AF57EF96AFD94C58B150711ADDBB35E86B4ECB79 [email protected]
1,666,230,818 *AF55646C701EDB56D14389D5FD0615784B7AAE7E YAPAYLIK2
1,666,230,819 *AF5D484FDF8E2C9F08E1FDEA4AD000A5FC41E16A yenny.rosita.song
1,666,230,820 *AF530E9F702A8207809B07E01681248BF9CEE3F3 YLIVALLAN2
1,666,230,821 *AF58B46AD979F7CC13FB50C2652A79A3327C4769 YLLACIRTEMOIDUING
1,666,230,822 *AF5D26829454318F45772D197F4CDA80B6AC8F49 YOSHAPHARSHY
1,666,230,823 *AF5204B3F350F8ECF3B454B7BC5C98D058103674 [email protected]
1,666,230,824 *AF54CD6DEAFB68B5BB1D02436430DA1FBE8B9C43 ZACK-MULLIS
1,666,230,825 *AF582FFF4262136C60FC8D36B5F0D0DA676EA3AE zanemuir
1,666,230,826 *AF5C3B565023002A66E2840B218A04F5177D33B0 ZEETA SHETTY
1,666,230,827 *AF50843CEF3EA2E470B1A749FC9805F6253DE0C4 ZGEWNTJLODIWOTC5ODY3ZDMWMTNLNWU4NGJKNZE0MWI
1,666,230,828 *AF554845C6251ED1DCB07EFE9D0CC9598A1C3E53 [email protected]
1,666,230,829 *AF506EDE4FABD655C6EB810D94855A684F61733C ZHANGJIAKOU1
1,666,230,830 *AF51189E4FD14AC405E652119D6B15DD2E042507 [email protected]
1,666,230,831 *AF5FF0FBBCCDDFD289ABAD97993ED1550CA13A78 Z!JX
1,666,230,832 *AF53CE3017F52DDE6145E13BA8036FE671ADA6AC ZOELO
1,666,230,833 *AF54D072322E8FF994C552743F0EA90E558FED4A ΑΛΥΣΌΔΕΣΑΝ
1,666,230,834 *AF52A927DF3197A8A70F0628961638C1F58EE311 ΆΝΤΕΛ
1,666,230,835 *AF53DF29F63618EE63E4CFF9EED936A61BEB9732 ΡΥΜΟΤΌΜΗΣΕ
1,666,230,836 *AF57CDEB1EF47091E964D5142C5A8A6DADB569B5 вкусного
1,666,230,837 *AF5F6BA5B4E3CC3542ECC37677CE3FA4CEDC7AF0 „КОХИНОР
1,666,230,838 *AF516BC31C906AD3075FDA9EB0580449F41DD1D0 ПОРНАЗОРКА
1,666,230,839 *AF598A644A879930CFBECC65877150FB2873AFE3 третьею
1,666,230,840 *AF5FB6103705714F3991A2173226C02E38AEF58E (00)*.*.*[email protected]
1,666,230,841 *AF5FF25931FF5538621DB76F338782747FADF12B (-_0)[email protected]
1,666,230,842 *AF54A69A3F7CD413534080D425D6F88D584FA376 11YONELMEYE
1,666,230,843 *AF5011E85C710F89FBE0943A2C6E0D9FB166B6D6 122.interaktiven
1,666,230,844 *AF52AB8868397874CFFFA0129BCCE666F64043B5 12345KTB
1,666,230,845 *AF59A15A0FD8A3F8A056423B0B73B9EECE23260F 12PRIORITY
1,666,230,846 *AF58E520EF7B1EF829BC5517AE769197A20FCE21 1369049 DIESE ZEITEN SIND VORBEI
1,666,230,847 *AF5F177EFD895CA2C44542B56C1888B41AED5370 143DADYKO
1,666,230,848 *AF52E1127076F4A7F2485734FACDB5DBDBEDDFAE 1.bochille
1,666,230,849 *AF5745FBC634D0A54F0589D4FB16E482FD020E4C 1CEPYAYIN
1,666,230,850 *AF57095DF1C0E537D3D4032DB47EF550E6D295A0 [email protected]
1,666,230,851 *AF53D1A577439C1DB16C1EA7CB0B57C080A2DC34 1draamatuokion
1,666,230,852 *AF5CA2C3E5D8775F545C0D4017DBE95FD00B68D9 1-euro-vespa
1,666,230,853 *AF59FDB41478DF9A98293904EAA621C87E7F3558 1 FAHRENSHANDWERK
1,666,230,854 *AF5DFECC58EBA44B92A9DB3383784B0273BE5606 1-getz'i
1,666,230,855 *AF5FE746C5A098D4E8153F5346EB58965F2E5249 1 HEYS
1,666,230,856 *AF55A10A27570F1275B1542851F2F304F0AFD3D7 1.JAKSOTUSPERIAATTEITA
1,666,230,857 *AF5CFA1C7BF184B1E62E44412582E1C9C42AE319 1-karamellivarkaita
1,666,230,858 *AF52F5E1E4D9270C722B6E4261430B48F7328771 1MINDESTQUALITAET
1,666,230,859 *AF524F6191B578E9D614947D79A1D76D2AFFB779 1 perheneuvontateht
1,666,230,860 *AF5AF0B7BDA4B12C61BB9E6893EB594D96A93295 1.SANGINI
1,666,230,861 *AF5C87FB73A94CB48251E22B4DDEB3434FE4E034 1self-content
1,666,230,862 *AF50DF047A8FED14C13F5EFBFE76D55501B72308 1staieryhti
1,666,230,863 *AF5B6C2E12CF9FF4A191BF166488E9469960C52F 1.VARIAZONI
1,666,230,864 *AF50A1A8E129506D60654094299CA7029809F506 1 WALDT
1,666,230,865 *AF533B1BB6E8BEE017347A9183D4283DE0EF21B0 1 YKSIL
1,666,230,866 *AF55B650DFAEFBFA75A2DC2C935D563580EBC3FB 23OCTOBER1724
1,666,230,867 *AF576B012AE0A55AA3929A2BCDAAE78087370785 2AANMATIGT
1,666,230,868 *AF5C81B24C3A393D49A282922C37F094101C4D9E 2-dikkaldirim
1,666,230,869 *AF5AE2EEFA6D9B82C9D869BA7FF05D468E2720A5 2 D'ORIGINE
1,666,230,870 *AF5705E21A5D8321494746E5520918A83E18692F 2FTGS07
1,666,230,871 *AF558948A0FC3E00CADB58C22A59507B12CF72AA 2 KANARIISIPAISTOS
1,666,230,872 *AF5705CE97702296632646605B30B5C8C9602ECA 2-LIIKENNETILANTEISIIN
1,666,230,873 *AF593CBCE80357F9C3E0E105CEA5593E96732CEE 2.pallansch
1,666,230,874 *AF5D9499C517F7BE4DF613C978E01F7BA7AC5A55 3.5.13-THE-ETHERIC-IN-NAILS-AND-HAIR
1,666,230,875 *AF550AFE4D74F2E420F57BD3335432422EF1E2F2 3D310126
1,666,230,876 *AF553A7285E6C32FA13D1A50E93A4EDF8F077DE0 3HAMSTEREILLE
1,666,230,877 *AF5C7D704E7D86898F9B9A3489185E52045082C2 3IAMMIAMI0
1,666,230,878 *AF5552CD47E98A66300EAD2A956EE97A4B4CA7E1 3ORATHAI
1,666,230,879 *AF5E1F46C74C93A7E54F077ABE871A5A04A8658B 3STHRNNSS
1,666,230,880 *AF50FC1A91FB41B22E84E609E8A6EC43DB4E27FD 3-YUNSU
1,666,230,881 *AF5E6E795CF5CB8D148F491B830BB24020AC98F1 4A2D8B04
1,666,230,882 *AF5F338C60914B2DD3F1A01FA1938ABDA2AA2018 4HSGUTERN
1,666,230,883 *AF5727D10E1F5841E8E870C351403A6A46AE8370 4LINDSAYPURPLE
1,666,230,884 *AF59CBF7D9F7D319178C6668893F562BD3B718D7 4MOCLIAMTOHMALLAHNAVEASUMALLAHNAVE
1,666,230,885 *AF5A1B6DEBD73B328E1E3704A3E288E13DBB4A36 4.SELECT-A-REMAILER-(OR-"CHAIN")-FROM-REMAILER:-COMBO-BOX.
1,666,230,886 *AF5F8162F3AC73BD094EDD5219A41983B26982F9 5HROMANTICALLY
1,666,230,887 *AF593B81A7DFABCB99AAB6C5674D45873852565E 5IANAKKAW
1,666,230,888 *AF53D8DE2E78DE64FBC72F2E5F93B8C48DFE93DF 5ilovedaniel13
1,666,230,889 *AF556D903C74691141D080673B91BA3426EB506F 5MYBEAR2
1,666,230,890 *AF530D931C4EAD772C246E8829D206A914CBB41E 5OPSLAGTA
1,666,230,891 *AF588A9C1CCD9DDF845D8F9A58A7BEC81079CE52 5POLYGRAPHIQUE
1,666,230,892 *AF5C58A1D2E7BC8CE88EC0D0D4D52844A26A4C75 5ROEPERSBSW
1,666,230,893 *AF5D4782F179814934F8E24CA9831AA290D7968F 5UPERV1VE
1,666,230,894 *AF55DD2B42860E58A733BDD061DA0885AD9C1818 625340 ANNA KIEHUA HILJAISELLA TULELLA KOLME VUOROKAUTTA .
1,666,230,895 *AF51F5629C1F0CB979DF701FF6DE4054094A0A0A 684xv850khob
1,666,230,896 *AF547033B0406D520D3EF3A7458A42B7762699AA 6CLMNSTN
1,666,230,897 *AF561BCA9D07B10F8292F602902B02C757862C8B 6GREGORIANISTN
1,666,230,898 *AF5FD025A3B35B9F4BB226ABEB8CB712EAD91BEC 6INTEGRANT
1,666,230,899 *AF5C3BB954076C594D51170E5A89053D6ADF8A99 6QUICKSANDIES
1,666,230,900 *AF52FAB2702217EF627B35186A18897EBBA22C3C 6REPOLAIS
1,666,230,901 *AF567C6F0D2E6A63B764B9166E4D681615BFCE08 6RW2
1,666,230,902 *AF5CFB6F9DE59B2BE24D4C9BAB88B21278A48257 6SNOORDAG
1,666,230,903 *AF523FBA142CC0721238E344EFE8790205C5F945 6SOSIALISTEILL
1,666,230,904 *AF59489B25B34E23A250B73B7B770BCC29854E29 6UEBERLEITEN
1,666,230,905 *AF5833CCAF9AA678F8197D91EC9DFB265A522E81 6VIERESTE
1,666,230,906 *AF56D769DB826785CD2419171010B65EA1401454 700leonardo
1,666,230,907 *AF547F6C0580B1625CEFE5BC1A522CF51B5409D3 7BLACKIEASDFGH
1,666,230,908 *AF51FCF23526F89AF4C701578D9D9C7497A5A406 7CURIEUSEMENTS
1,666,230,909 *AF56AE820103FE5131C5CA9D9221C85FA26E530A 7DUNDEEMINDY
1,666,230,910 *AF5F8F31D890A486F1AD920CC0A9060F9E98BA8D 7ITTIPEK
1,666,230,911 *AF5B00655AB6903DF24D06FC2DF9F5AE1CCAD4B3 7SEINNVIERUSNURMIKOLLA
1,666,230,912 *AF54CAF0B246C7F74EA3149ABAE12BA6AF8D437E 7TEDDYNICARAO
1,666,230,913 *AF56C575C62FEF36E397FBB5EAE87AFDF07C0796 7UENIVERANT
1,666,230,914 *AF540D0D3BAB206E278643924CFA5B89607868E9 (^_~)~ ~ @8
1,666,230,915 *AF56A09E6F47818902456065140CAFFE6C04375C 8#####B* Splat
1,666,230,916 *AF5631D2F57A97D6E2320ADFC20510B16554BB80 8GATEWAYSKEETER
1,666,230,917 *AF54D9F8781BBC529182FD30D68E4398AF99A9B6 8IARESIROPMET
1,666,230,918 *AF5887B9027D49D23AB8F53A23F270B6803DB721 8KHZ
1,666,230,919 *AF5C3A684CF63F08678E105D1DFB1C58339C4217 [email protected] * *)O(
1,666,230,920 *AF5639043E2C700EE8DA4A031C9C77CF677F29CF 8STAPELINGENS
1,666,230,921 *AF5670D0F2E625793EF5444C0848F4896B4899A4 970775 vergihukukundasUrelervemUcbirsebepler
1,666,230,922 *AF5A687422F8C0C7B90421A1C1E34C279142B767 9BSWMAXKILLSBSW
1,666,230,923 *AF52215E7EF28B1B01F8B4BACEAE38A85A3ADEBE 9BSWSHIPPENVILLEBSW
1,666,230,924 *AF5B795152ACBBCC2722D6FBCE230777193FACC0 9FUTUREZENITH
1,666,230,925 *AF5F0C99CC236612A928D321DC28AA3D8349F436 9GALILEOIRONMAN
1,666,230,926 *AF59F4229020A4DD8F19B318D38F0259F6180EB7 9LERSOUIX
1,666,230,927 *AF546C8834088A4A647058F19F7568EBCE856A5F 9MACHALAURA
1,666,230,928 *AF5CB5AC4154DE2AA0EAB9BF0B5E47B7B2680DE3 9NICLANESHIA
1,666,230,929 *AF593BBD66753723528EFAD26E766A6AF17C42E1 9SUBIRSE
1,666,230,930 *AF537BEFCB06B0EE9A695331CB5DF6FF3D6ECE66 A&1T
1,666,230,931 *AF5485FF0E7D02B6B0A52D24E4D36ECA26D0BBF9 A8UPT
1,666,230,932 *AF5246E73C9426B52174F5D32E00D449BA6B0633 AAA:\
1,666,230,933 *AF5DB5AAEB26EA4838FCCAB689653F1AF3875E15 ABC-N
1,666,230,934 *AF533559212A05AF416623554ADE6BDB01A63431 abt%
1,666,230,935 *AF52EDCF96C511AD9A8D5B8388E3DEC33CF1F542 ACOE8
1,666,230,936 *AF52A9F9BE75A8B455A18347BACA4E94F35E2AFC adamtomasello
1,666,230,937 *AF5441713D0F04FBBA4CE30D5C6DFC04A5781256 ade%%
1,666,230,938 *AF5DD8482E1B230ABCFA0E8932C47EBD44CA359C ADOLFO.LITTLEFIELD
1,666,230,939 *AF5F8D913A62B542FD9E5620C9F631F7934D9DD8 ADPM
1,666,230,940 *AF5C0D75AB6C137420EB96A9232EC7EF15FB9950 ah_a7
1,666,230,941 *AF5622F248D4A335696493400DF4802039CE322D aipbq
1,666,230,942 *AF55DFC8326A60E64ED3A05C4A7451C154BB607F ALBERTOPILUSO
1,666,230,943 *AF54411B5F3A4446B45969080C8AFE6CC83964D5 ALEANDE0
1,666,230,944 *AF5C855714C8D4A06556D7F807FDFB93BBEEB55B alicertain
1,666,230,945 *AF5FE0AA5E826027BBA606AFA70240CB87243207 ALICIA.ABERNATHY
1,666,230,946 *AF5FB557138D558EFA3E2040E4774775F1BAFA24 ALLENI3
1,666,230,947 *AF5DF1F6E8752502D237CC0A4C0B44B1B125F361 ALONSODUCOS
1,666,230,948 *AF5A0243B23363CAC8D2861065BB68925198E807 ALRHA
1,666,230,949 *AF52E75B206D059F6C46417DD6EE0498FEBF40C1 AMANDAPREFECT
1,666,230,950 *AF5C4ED7BD908F788DCDAC11AA0FFE3F92784377 AMESIPAN0
1,666,230,951 *AF5BA26813AF3B2D86EC9F74D8E8F9D363AA7CB9 amine-essaid
1,666,230,952 *AF538C4E56BDB57AC745756389CAA9862D016915 an3q!
1,666,230,953 *AF59E8C92308AF17B22CC5C5BFC2A8C70B0D0A34 AnP1
1,666,230,954 *AF5CFB778064C2EC7E266F1B84112C7E8A2CCDBC [email protected]
1,666,230,955 *AF595AB64E7F5FF488276CF9BFB23D363087E318 antonegottlieb
1,666,230,956 *AF520BCE52E566CB2F8A8EE744ACA6363132D2E6 aoc+j
1,666,230,957 *AF55E2741640E7DBBC368C24A95B51319A7603A1 applauss7
1,666,230,958 *AF5CFB7CBD4ED04D4EF584BDA4157CBA395B8EA9 applesmaxes
1,666,230,959 *AF5AAFA6017A829FA68AF5847E58FD8F68E296EB [email protected]
1,666,230,960 *AF5C612615F09AF0542C72742E8C5D1AF0F0F103 [email protected]
1,666,230,961 *AF51DFB5507FBA759F0B1882B3247AAF59519528 AQX;R
1,666,230,962 *AF5314CD805AFA59F96CBD932837685EBD1CC7C6 ARDASSEN4
1,666,230,963 *AF58BC1A8EE14313E8D474333A1D9A15774F5D55 ARDEN.CRAINE
1,666,230,964 *AF51DE4D060B68E11C2A2EA237E175B4C89A7856 ardottir
1,666,230,965 *AF5D969DD1B6D883608ED103B34524C572D21ED2 ARMAND.ARMACOST
1,666,230,966 *AF5AF8206F7E18836F9D47D8FAEF9AF66820CBD8 ARNULFOCOOTE
1,666,230,967 *AF50D661F4D0716B594650CA3C2F403B1BB3F8C2 ARSNI
1,666,230,968 *AF5EA572F88A894BF99ABF4E6F6A5F831E17E7A1 [email protected]
1,666,230,969 *AF5B08D8D59F9BE6E73E523FCDED10F1986C9E90 at,1q
1,666,230,970 *AF5DBF24ECE676342B3E6ABA407A8370E5ED8B78 [email protected]
1,666,230,971 *AF58786A3E9F9798B825FE9F69FB98CEFF8AC411 a?,u8
1,666,230,972 *AF580C8A89D522BD94AD15C94E4956A6E9F3C804 aut0m0b!l3$
1,666,230,973 *AF530EC5E48F4F644F74BBE8AA6B07CF667A3195 ayeu
1,666,230,974 *AF5F398E4E89C6DCA189A6C1FE320D2D116F0B9F b`};
1,666,230,975 *AF514E8B15E592B4428E1B402455FE12CC390CC9 B>.~0.~OO><
1,666,230,976 *AF58689D72CD754485F41206D6138ED829F95262 B4Q!U
1,666,230,977 *AF5799B4E6C6FA9E311FE6696C031E49D985E510 b#6uh
1,666,230,978 *AF5D44628972862D0DA99AC76F899424095FD477 b8klb
1,666,230,979 *AF54D508DDD8C2E986552487325C559D08AE9EFC BAMA_CHICKY_92
1,666,230,980 *AF59A956D4BADE1FB8807999D0EC6F9BA4EF699D b-b4f
1,666,230,981 *AF55BC24ACC897F2F67E7B0565AAB9A802685859 bemineni
1,666,230,982 *AF5B3AF2DC4E3D7713D85C4E6329102E8B960413 b;ety
1,666,230,983 *AF5EC7ED01D77E0EAFF23D967B27A9E90C2B4980 [email protected]
1,666,230,984 *AF551C61CB3BA09D4B0F0D23D4C7FFCB98246E6D [email protected]
1,666,230,985 *AF5DAE712B7F8B4A6E50F1A374B64C2027F5C9AD BKD_F
1,666,230,986 *AF5070C3DEA2D0A871FED8ABBCB3A1837173B04A bm5
1,666,230,987 *AF51D363E69D78BF993AC70DB5254BDB37B6F3B2 B;NXZ
1,666,230,988 *AF5BEF9359513E5957E635CBC9549700F50CD4FD bqhj
1,666,230,989 *AF5BBC2CBA155C508899F54E75F4CDBB45CAE033 braveerts9
1,666,230,990 *AF5B953A04C4B9FDF001C92B009A6E9DC58B44EE BRITTONIO
1,666,230,991 *AF54894A048F42EAF26EF80A4F13F8203E83C8F7 BRODSKIJ
1,666,230,992 *AF51588EF36FCA6A4F3230D73437BEB58C491AE5 BS?WX
1,666,230,993 *AF5F1048092CA8661F92FD1A917225EB2F4FFB6E B!U%G
1,666,230,994 *AF5F01BFE76BE7F7401DAF8BBD239575073D3D1E BUSSASTI2
1,666,230,995 *AF5E36D5C6E8AB018F18551A9F1E9DBADA0C2754 [email protected]
1,666,230,996 *AF5B9C1CF7FA5C2F3191669A029D374A505C449F C2!AK
1,666,230,997 *AF5DECEEE8644FC318D3A3041D939A97A1B9CC5D callitasunrise(hereiam)(212a.m.mix)
1,666,230,998 *AF50F9C1950CFF8DA1544BD4C8BD816669E71BA4 CARE-TO-CURE
1,666,230,999 *AF55DB5634588BBABE869FA3B3F369F9D76FE1AF CARYCROASMUN
1,666,231,000 *AF5EF900E82B054E528049013956BA81EA8BA5C3 c&a+s
1,666,231,001 *AF5F88D9962CF920045CCE3ED66DC59F2DA178AC [email protected]
1,666,231,002 *AF58108C1D582629A58D294F45B5EDCE63BEA031 [email protected]
1,666,231,003 *AF55BF7C6B3EDEA04649FBB99E56B31E87C24163 ce9np
1,666,231,004 *AF5755CE4C110026AB034B8F7D81C4EDF14C5AD8 CELICAASSHOLE
1,666,231,005 *AF5DF3D822A6CF0B02126BB5C8ACFB2D8E3D04A3 CE%V9
1,666,231,006 *AF598936B7CC00945B8DD7B1F959C9D06635735C CHASHIBU6
1,666,231,007 *AF5B9943F2A1558A90F71F001995E9685F7395A9 chodyaah9
1,666,231,008 *AF5FCCA5EC6B8F467E1F99756A6D143A3BF0112B CHRISTOPERMCCOLLESTER
1,666,231,009 *AF517FB164CE6E444362FFE1EC0888C0E6D4DAED CHRISVEEN
1,666,231,010 *AF597B05B470A7CF304F3665A24CD521AEC112ED cilynehp0
1,666,231,011 *AF5DED63611C34D278C6A323A242D11343E32DC4 ckoi/
1,666,231,012 *AF59BFBB6105AA7E3041D7CC80DBD8782EA1ED0D CLAYTONWECK
1,666,231,013 *AF544B49B2E4992EA3A491A40CA8886CF4DCB307 CLEOELIZARRARAS
1,666,231,014 *AF5AFDC2E70727553DC3DAFB532B177F24B39716 cliffordrosenbrook
1,666,231,015 *AF5AD2F52FBF483859D71D98C99AC7162A1D3DC5 [email protected]
1,666,231,016 *AF51DD8F11C00F3D08C9B09D444A8851B81EE082 CNPS$
1,666,231,017 *AF5120D9C501209D875218B13EFD72F9A0558F02 colbycuster
1,666,231,018 *AF59B8069CED411C55092B60979D3EB16680B108 CONCER
1,666,231,019 *AF54B0D5B55D4312F177650F7EF7B5DA2DD9304F Confessions-and-Confusion
1,666,231,020 *AF5869EC296F3FAD30388D53180B5B153556F182 [email protected]
1,666,231,021 *AF58E88561DC674710E76888F16354465288D84D COUNT.'EM
1,666,231,022 *AF5BE2A10631E5812DEB4EEB50163C68D96F11DA cwqeu
1,666,231,023 *AF5F318D69ED3ABBDACD8E525C85807937FCC55D CZIFFERING
1,666,231,024 *AF5A4348908E148292DA9488A34A9370DAF6D97D d&$)
1,666,231,025 *AF5AF160D070938CABD4FD65DF60D8E57E2CA0F8 d8aks
1,666,231,026 *AF59BE81C95CA75C3F94F38D432662F3F498BF2F D8JG:
1,666,231,027 *AF5F694B7CD22F5290960362ECAA9AD504F86569 D:9/D
1,666,231,028 *AF5F546638B6BF923DC1D6519126C4AD2A7B3443 DAMION.LANDRESS
1,666,231,029 *AF5CAD921896DD90FC948602E4CB274E756BF04D danielle-reau
1,666,231,030 *AF50826486D53B7CACD5F840CC427313AE4FAC04 DANTE.LEHRIAN
1,666,231,031 *AF5C3111234B91E38B63A437FA10588D28134B05 DANTEMADINA
1,666,231,032 *AF557002E1FFF70A4EDE0FEC61B215DD918F6AEC DARELLBLIZARD
1,666,231,033 *AF58F1B8E123923AE9B72AEF01D757A4734D38D4 DARIO.NUMAN
1,666,231,034 *AF551D3960BEB2B6CDB44C480DA4A67D5F9CADBC DARIUS.STAPLEFORD
1,666,231,035 *AF5AF180D215B852177AD2552C8F2C3359151AE5 DARK-DECRYPTION:-THE-ELECTRO-REMIX-SELECTION,-VOLUME-1-(DISC-1)
1,666,231,036 *AF5786076F1ABC92DCCF2291E278586B9077272A DARRELLCORR
1,666,231,037 *AF589394D64553F196B75C0731323CD939C420F5 DARRYL STUBBS
1,666,231,038 *AF57A67D10160FF7165DC44E41FA8E528326F831 DBOC/
1,666,231,039 *AF522DD01214EBD0D50841F044F73CB7FEB22AAA DECOSIT
1,666,231,040 *AF5EFB97A9D8C1946A6253D87A2C00D6CE898FD3 DENN ES IST WEIHNACHTSZEIT
1,666,231,041 *AF55B8E16B09137D65BC04CB25A95B4D3782EFF5 D(EV
1,666,231,042 *AF51104AF490D2E54570A253BE63100A0E36E753 dj-#
1,666,231,043 *AF5EDC05513B47E3CA65369B9B305890502F64F8 dogonią
1,666,231,044 *AF52A6BB98A3BA0AEFB2F92F9DEFC3005C03988B DOMINIQUE.SPATH
1,666,231,045 *AF5CE92BFA67DB93CC8ECD3F59730D9269D85A51 donnanotarte
1,666,231,046 *AF59E97EB5F8DE3972835263F939E8B22C63147F donteho
1,666,231,047 *AF56052E4E3DB91B07B91374D604A23E0BA5BD96 don.zapanta
1,666,231,048 *AF5EF1F8A8F20B259157A727F58C283E6BFC41C1 dr$b,
1,666,231,049 *AF5FB6E62E785D828B68C2093FF642C076B61F74 DUABER
1,666,231,050 *AF5C96BD36D4ADFA7B285A26349F6BC0CA4AF85F DUE:
1,666,231,051 *AF5B10526DF64120C94DC7B1864F206012E80596 dv0k1
1,666,231,052 *AF586185AD39D5876D07AE5BB2FCC4E5331D3F9B [email protected]
1,666,231,053 *AF518372564F5A010D030F52D63DAE039160A443 dyxiu
1,666,231,054 *AF5CBE306EEC77D98480FE23930201D52B2F80B0 [email protected]
1,666,231,055 *AF5CC9864A669C93EBABD29B0C682FB35202E848 edacroto1
1,666,231,056 *AF502CA5D5EBD999BC88229D8B44D68C2EF27649 edmondhemesath
1,666,231,057 *AF587249E0E6BFD9981CE02CB50D40F1D9C4DADF EDUARDO.GURNEY
1,666,231,058 *AF546F4462EEEE7FE8E7C5CD3B083245D55B0B7B EDWARDOLER
1,666,231,059 *AF551F26534954D1083BD2C9E43D111B3020617C EEFI$
1,666,231,060 *AF5285EED013FB905146704C2782DF7AA37AF6BB efrenmatheney
1,666,231,061 *AF5BC815378C9BF1B16676BCBAD0A647F5949E7C EFRW
1,666,231,062 *AF50F61D87A7FD27B3E0ADD7CF76B47173143F64 [email protected]
1,666,231,063 *AF5361362ACE0CA57327970F5C294CF2BEB50716 eie2y
1,666,231,064 *AF54AE8637C0E6F82177AF1E22D101FB014F8DCF elshowdethrowman
1,666,231,065 *AF5F933EDF9B0B57C46ED185C736E07ACBDE96AB EMILMAYCOCK
1,666,231,066 *AF50C8D28A394326682E53231A410488F3B18E8C EMPERIALES
1,666,231,067 *AF58C301BADCC782FA291D653E2ACE1F8C8B5095 EN129.241.214.90
1,666,231,068 *AF5F4FAD46F72A8D985424F1E2CD40C36D7B6652 enbp:
1,666,231,069 *AF5376C9F6B37C3A7629BC879BF3E72DD42A446B ENJACKZX3
1,666,231,070 *AF544A82D348FD0D66712B2FAB48C2304D95C271 enterthescene(klubbheadsvs.rollercoastermix)
1,666,231,071 *AF58B53C3275B18EA7B6632B9AFC115C2C26D38D ERICHBALDUS
1,666,231,072 *AF594FB5648F9FB5F66171A8E13F8A5D49060B90 ETACIXOT5
1,666,231,073 *AF5FADA57FDB276F95795DB838813B26089C16C6 [email protected]
1,666,231,074 *AF598C63055FCF970FBF0AD9DEE31AC4A374C31C fanny-moore
1,666,231,075 *AF5E7BA676C09AF13EEB2A06FD0EF68B1F21C5B2 FANXIJUNZHAN
1,666,231,076 *AF5E52F28C0839CBEF03276A7BCBE22B17422F32 FARADINAP
1,666,231,077 *AF50DDE0D9C037693CD79950B6EB3C62A029C1DD FASHIONADDICT SHOP
1,666,231,078 *AF5267B1267BF1E87F263681115E06CA23B32FC0 .F'&D
1,666,231,079 *AF5A551A7BEF1CEF7A51524C5CA3833DD72EB4C4 FEDERICO.GERONDALE
1,666,231,080 *AF5F58ABCA49BC770115500A2CC7C7A4C053C3EB FELTMANSIMPSON
1,666,231,081 *AF5886A5B4898AB5DAE84A90E8780EB700AAF879 FERNANDOHIEB
1,666,231,082 *AF5838117FBE57A5C8B1FBF028D9B1947E7F1872 FETHERLOCKE
1,666,231,083 *AF58F1066F2DD86DB7A7AFE2DF0F770900CF6B35 fiona-monks
1,666,231,084 *AF54D1BDD533E207AD39A31FC5E0FC6360B14B77 fkitl
1,666,231,085 *AF5770A1B7D496C512D15B5E408D852FCF70F4D2 FLETCHER.KINLOCK
1,666,231,086 *AF5FBDC7C404853FA27AFD1590B8C8169DC6181B floorhead3
1,666,231,087 *AF5885A86935C9A04FB3072A87D25C8998319F49 FORREST.YERBY
1,666,231,088 *AF513A3E90FB3E251CF7A6201DA5A33D8B155CD1 FORYOUREYEZ
1,666,231,089 *AF5629CF0B9AD24E3E8989225AC4FFDF8EF349A9 FSALUCOP
1,666,231,090 *AF513E110707B700B5253433B521B83F2D2A6E5A fuentedesuenos
1,666,231,091 *AF5F9F5CA46878FFDF41617568AF8F4703981B52 furucara
1,666,231,092 *AF5D7882CDE41A68A4D3461862DBB3AE7C4D7032 GARYBENAC
1,666,231,093 *AF5B8DEF5D45F3C0A27136A0E4D31CDC048B899C GARY.MENEES
1,666,231,094 *AF563FD98ABFB39A652C70D6A301AAD70CA78C09 GARYSTRATFORD
1,666,231,095 *AF59974EEE184D42A2D033A2450853E9927C80D4 GAYLORDBROODY
1,666,231,096 *AF56268A8DDA73E1E49554CFBEBEA769660F4483 GEHEUGENCHIP1
1,666,231,097 *AF59B5D01833597CCEC1260D72DFF5242FA3E6C8 goneabcde
1,666,231,098 *AF5A72A23C6E8BED6A3EDA2E091C13294D36630F GRAMMAR5
1,666,231,099 *AF56BD17A2651BC96E807ACE1299CA598BFD28F7 HADITENGERÉSZETEN
1,666,231,100 *AF5224B6642A6F02B7FB7243706814AE6EC45FD2 [email protected]
1,666,231,101 *AF56BCCCCE02B2B8954BBA33B83F163F9BDB4E6B hallt2
1,666,231,102 *AF53E504044734D7B999B8723F5F722991DFD950 harlandbiehle
1,666,231,103 *AF56E857B537336C2E67F2083C38EED7CCADB229 HARRISONOREN
1,666,231,104 *AF5819BB109599F14BD8E3F22C7105DD5815681B harrystotle
1,666,231,105 *AF5EF905593850132659FE8AA5EE519BBEF50211 hateleesweetdarlene
1,666,231,106 *AF59D18E92EA666DFEFF4F4E06392F16B91B6843 HECTORZARRABI
1,666,231,107 *AF56E788038CE73DD059CE2B67D464980F77D11C HEITNAR
1,666,231,108 *AF56AE0336AAB0D5A541AA2DEBB99CA7CBF0E2B8 helzibelz7490
1,666,231,109 *AF537005630920086EF74A00BDAA157DBFA79AE4 HEREDITY1234
1,666,231,110 *AF5B0A3AE3486FBFE45E9319D5840110ADD45A28 heribertoniten
1,666,231,111 *AF523BF5AE363B060FA2FE3C595A9560137292D7 HLANDISH9
1,666,231,112 *AF5054785206AFB5494820702EED740664F28A40 HOBELN?
1,666,231,113 *AF5195C3DC6B70C7D8996E3495205B4CDF5DBEB5 hongberti
1,666,231,114 *AF5ECFAD255424D6466FC39ACAEA38385957C9A2 HOOPSDOOM6
1,666,231,115 *AF5D68AE041B712BF8078274E1DD0CBFE986B479 HOTSUN2000
1,666,231,116 *AF52C668614CE4F2A8FB7832E793B32A66C76C24 HOUSEOFTHESUNORG
1,666,231,117 *AF59F444FD853B12DB18E3FA2F68D4BB7DE5B359 HREFHTTPWWWMALAYA-R
1,666,231,118 *AF5502367EED895C87EFC8DB450AC20CCE6A1A6C HRUOTNUKS
1,666,231,119 *AF5FC13AE72B1AEE9FC119A93F13912FF3B09387 [email protected]
1,666,231,120 *AF548AE84037841A70DBFBE49F6F94C2D0EECB71 [email protected]
1,666,231,121 *AF5DCF9E31BB08E495147163CFD3F7AB35D7F6C7 HUBERTCERULLO
1,666,231,122 *AF5D82DCD8BD3F6EEA67B5B0E4BDEBBE6AAD039A HUBERT.LJUNGQUIST
1,666,231,123 *AF5D1CF29D4E3E037696B8B32E2B0FFDEA808C92 HUGHLASTRAPE
1,666,231,124 *AF57EE66598DCD85462B469AA93FE7A1C49DB172 HXYA
1,666,231,125 *AF59AF8F0CA3B6840C3BDF7CFC67EF4ABC437D3E ifdayydrs
1,666,231,126 *AF566F2CB46243D201FE167328EC1FB6099BC390 ILLYES?
1,666,231,127 *AF539797C951158DC23F1109A20ECCEB16F9B980 ILOVETREASURE94
1,666,231,128 *AF5BC8650C935A1A082134A9B2667F4C4F579DDB ilustr
1,666,231,129 *AF53F11A86B444F57EC14E1CF1A4A662F2FE9F02 INFO について
1,666,231,130 *AF5D5B21085CC08320CDD31ED315B90D4C5B67DD [email protected]
1,666,231,131 *AF540526F02C5FC786D3D9A844D10B9382A25BBD ingsfljd
1,666,231,132 *AF57E5A94A41EA7C2064A53F68928FC447B1795D [email protected]
1,666,231,133 *AF51668B8881E1131DF3482BA0BEF8323593D2AC IO SONO MET
1,666,231,134 *AF5796491E94D504831D726B894BB07771462BD3 IRFAN.K
1,666,231,135 *AF521BEB21935A394B02E266AB5B6A0C504F1DCE [email protected]
1,666,231,136 *AF5B0E66048C3D17576684F3CF73A4C9EFFBB0E2 [email protected]
1,666,231,137 *AF55AD00C1B6794D561C1415EB8C068462DC1C76 IT'S-THURSDAY,-NOT-SUNDAY
1,666,231,138 *AF5ADA71C0FE8D9D0B492A87C44871784EF44B6D james.denike
1,666,231,139 *AF5D871A4A3C76B0CB699D3031A6CA4CD4684424 JAN.RAUM
1,666,231,140 *AF5D6C962DCCEA8BA1F5A34CCF8BDE5EA2A5FDC8 japnbsw1
1,666,231,141 *AF55B99665A6CAA2DC0F1FB434BB459EE452969E jasonpurdycomwww
1,666,231,142 *AF5C2AC58935071069EF376AE8A2B67A54E54C5E JEDHEIDKAMP
1,666,231,143 *AF55C53D66A7350FFCAB89D292D27592D2AB4E9A JEFFREYLIZARRAGO
1,666,231,144 *AF5A53B23F918A06FC12C0CC9E5730373D5BCF0E JEFFRYVAYDA
1,666,231,145 *AF557366775DD8845CE031374FB5110DB9E8E99C jennsen7
1,666,231,146 *AF516CA66FCD5062603F45F8DE2B5CDCFD1E008E JERRELL.WOODRUFF
1,666,231,147 *AF52DF4D7C546958B2277259BB1FA0620AB7120B jewelsetterberg
1,666,231,148 *AF59AD3CAA2B6E3D40B148B6B55620F3434983BB [email protected]
1,666,231,149 *AF573BC84EBBA241B166EC1D7B6AAFEBA0BBBEC5 jo41s4
1,666,231,150 *AF5017272A55521A445B6A78D6E402E2B5E8713D JOE.FETT
1,666,231,151 *AF563FBF628B24264BADAB667AABB6447C3539DD j[email protected]
1,666,231,152 *AF5F30A4C6190627ECD07CEC1A8306922D569B0A JULIA.BONK
1,666,231,153 *AF5C0A479A3BCE4A320A0D0F7AC084E2583988E4 JULIUS442
1,666,231,154 *AF542FC8EB5E628CE8365C1EAB744395E3A96F41 JUSTINBRANNON
1,666,231,155 *AF5E0CB8DDD9ABA02376B324BD16CDC4333C9987 karogoto
1,666,231,156 *AF5656A18AC85C8B19EC9D96EEC364A045C46603 [email protected]
1,666,231,157 *AF5F1599F50AAA14CBDD23E87F54CDAFB6BC863F KEITETTV7
1,666,231,158 *AF5146A0B4D1D52648874D2FCCDF10093521017A KENNITHTELLIS
1,666,231,159 *AF5720500531637C1917DC800C59B518B6897CE4 KENTAVRI
1,666,231,160 *AF59D8B9F8F41442756288B562D88CA0B58A4249 kentmerel
1,666,231,161 *AF5DB63E8BF67ACD5E44795BD7BB9B5E0BC0BC89 KERRY-JEREMY
1,666,231,162 *AF50CFEDA92DC227C2D769B9D85E7F6223F9C25C KEVIN-DOAN
1,666,231,163 *AF5D420F1CCD19E4028E4E868BC5CB1490EA07CA kevin-reimer
1,666,231,164 *AF59EDB68DF8BE7E807DE97F1C25E8F3D575D458 KHN}
1,666,231,165 *AF51FCF78E64F1D4C98B7A04B8D6AC7C275A806E KIYONNAWILSON
1,666,231,166 *AF5EC426B578C7966066ECD26C99D44FB308412E KJR_
1,666,231,167 *AF54CE2A0B155C6F8FDBAAAFEA7526901C6771C9 KOREY.HORNYAK
1,666,231,168 *AF590676B1C2944524003009B85799C8826C24D6 KOUDATUU4
1,666,231,169 *AF55AEA975AB1723C9540A699ADE29FEE00213EE KRISTOPHER.KOUALESKI
1,666,231,170 *AF562E5E8D2D9D8C5A0A6B2CDDDA6742E019E7DA KUNSTNARES
1,666,231,171 *AF5240730E8E54CA22010E2927D1470CEDD3906D L8HDRYD
1,666,231,172 *AF55DFB0D084E1DCC25E354C23FAD4338CDEE585 [email protected]
1,666,231,173 *AF5ADD34602AE6F10E9355ECA9E0217D7BA99373 [email protected]
1,666,231,174 *AF54AF58B4AF07611B9B08F67085A1D89832AB7F laitahuoneesikuntoon
1,666,231,175 *AF5FFFF12E7F2F4E07CC689017641375BA8C92ED LAPTOPING.COM
1,666,231,176 *AF5E4B1C99D4B4E169F9B352A7DD36AFA1F0D922 LAVOZDEMIVIDA
1,666,231,177 *AF52C096088D88D3D4B791E9F2F71B9DD1E97309 leaveme
1,666,231,178 *AF5A4D6BBB666880D9E84EA4AE6B6C434E7311ED lemuelduliba
1,666,231,179 *AF597ED301389449890B70DBBBB82E27CD931756 lesliehamlette
1,666,231,180 *AF51CDC60211AB0659FEE2DB3FBE9F46374A2346 lg7]
1,666,231,181 *AF5A62C8B5BD28BF562845C45698B741BEA9B10F [email protected]
1,666,231,182 *AF559A074C78F1E1E73B3C36F5233837D52729C2 LONG-PASTERNED
1,666,231,183 *AF5BE116B7A2F60DC94DCB5EFE5454C8FD41B9FD LONNIETAMPORELLO
1,666,231,184 *AF5408408BBC73D023385530AF4D2798A6164B59 LOULOUSING
1,666,231,185 *AF5280946B40949F6AA4D396229CC42ED5357EC9 lugbill's
1,666,231,186 *AF51525B9E4B856DDBCD08B50D78DC6B809B6377 LYNWOODGARRIGAN
1,666,231,187 *AF538F327370F8D56C332EEFD4E04C65CB538797 MACHINGALMAHALEMAHAL
1,666,231,188 *AF5B7B3C6BC8ADE40F348DA2888E550BEF06A705 [email protected]
1,666,231,189 *AF5A91769E80270204B8717A9FA820BDC1F73D77 [email protected]
1,666,231,190 *AF5367662EEF03B0ABDF2D76310177BB72C1FE35 [email protected]
1,666,231,191 *AF517BE1D28213C654C9CF85D7F076414E11F727 MALIKTALAS
1,666,231,192 *AF58E3662C11F5243F6FD698D2DAD3E5F5426E44 manualguernsey
1,666,231,193 *AF553288BF42C0A0649A1B8B4A6C4F69AB4E2AEC manuel-pesqueira-salgado
1,666,231,194 *AF5609928901806FCE9577CCE1881AB907CCE7A3 MARCELINOLEMIRE
1,666,231,195 *AF58F3504E76E150208BC6B0FAD8244B9A3C451D MARIA.ARCHAMBAULT
1,666,231,196 *AF5F944CFA8E112460211F215F203D79E776A009 MARIANO.DINUNZIO
1,666,231,197 *AF545B67433644F2FF35DDECAC9DF0BAB270AF67 MARJORIEJENSEN
1,666,231,198 *AF50AA40F703BBB37D527828E55F744EA8E949C0 MATT.CUNDIFF
1,666,231,199 *AF5F16645B9F2AD2B24B54F0005B3258021ECB89 maya.rey
1,666,231,200 *AF5CA721C695F474BCEE0B194F1DEEDAD753FF57 MAYNARD.PARAGAS
1,666,231,201 *AF525A169762ACC334EA337B06E065B1CBFB8300 MCGARRYS5
1,666,231,202 *AF5D224A9FD474F4A45006065BC2F951BA742BF2 MELCOCROFT
1,666,231,203 *AF5C3931FD8D3125985F91197BE8D018DD9E056D MELLOMANIA, STEP 03 (DISC 2)
1,666,231,204 *AF5E95737F7C48AB234447C5D3536708332BCD75 menskunde9
1,666,231,205 *AF594D56D13D31A7C7BB009546AF1A9C89EAB969 MICHEALCRAVER
1,666,231,206 *AF5AED597C6FA5790990C964564F8D75AF0BC4A6 milder
1,666,231,207 *AF5E85F2F8D74CA4F38929FFC65874877AE31767 MIRROR-LOCKING
1,666,231,208 *AF5FB1A13B9120761C794DF6358B79F854BBE1DB mosse123
1,666,231,209 *AF534E62DFDCEFA0E18FFC0AF7C0976B11EB7FF0 MYHEARTINRIO(CORAZ
1,666,231,210 *AF517D772EF05D58D36250F65BCE168E321AE41C nakeer
1,666,231,211 *AF5F4749075F2D87CB7CAF065A4E68910FA917A6 nathanaelhegna
1,666,231,212 *AF590F46BC2AF2C28BEB67185BB9151D83512DC6 negerijen
1,666,231,213 *AF56C2F4D4DCC3BD13E5A9BC2D731A2F139F6CBC NELRA14
1,666,231,214 *AF5EBCB2B506BD90EDEB7852BAEF6D3ED047FF6C NICKOWINGS
1,666,231,215 *AF57375B3A21D28AB8583182B3F6842432180A01 NIUNAL
1,666,231,216 *AF51DB84CE15B4F98EDA07A4179878A3EFD58598 no 2 patrick street
1,666,231,217 *AF5A8A73F0A886B66A445EC082E314062208754B NONRESIDENTORED
1,666,231,218 *AF5AC665E26458DA1D5B6A920066D1A9AE5B84CC NORBERT.CRUEY
1,666,231,219 *AF55B34DEF109EB36DE6AD85EA4F728AE1B29B1B NO ROOM FOR HATE
1,666,231,220 *AF5926AC0BAC0784E58E81987EE99447CAA53070 nudefest8
1,666,231,221 *AF5298B2230D70096759C69E93A421021DD47FC7 o limitada (lado a)
1,666,231,222 *AF5B6DC617FDB574B509B6FE6F2E7120EBF926D7 OMOTIMA0
1,666,231,223 *AF56F03FF79BEB3026A469C03778CD1B7D1D0BD3 [email protected]
1,666,231,224 *AF5FA47ED216215F56BC2C8A5E62ED0B2136B5ED ;)[email protected]===q
1,666,231,225 *AF56908B412F4CA232D9406BBADFEFF4FD23FDC4 P0D4W4N3
1,666,231,226 *AF56556819E9283F88740154F87974EEF120C2A4 P37RON3LLA
1,666,231,227 *AF5B309A3C9638A7BA628D1B2CB24EA6373201A2 pa00116042
1,666,231,228 *AF5E5F6C4BF92E8787D5FF40F36133217EFD8C47 PABLO.RAMSY
1,666,231,229 *AF5A3BC771DF42C17F56217850E4F1CBB3DDC21B PAINTING-AN-ICEBERG
1,666,231,230 *AF50836091872144691C960BA8BD725B33E9DAD2 paloma05
1,666,231,231 *AF55F1962D829859E1D9B3C5F4F9595C4A8BC05A [email protected]
1,666,231,232 *AF537BE8832E8F1BEAAA67FDB2EEBFF4EE60B0A0 PARFONDRE?
1,666,231,233 *AF50CE739B0675932EBA954933FF1C329EAC5BFF patricianiifortuna
1,666,231,234 *AF5A5A7295A49027C43695A54594DF8895FB00D3 patrickmontieth
1,666,231,235 *AF590066F82FC26CFD5A2EDE75F32CF279603174 PEITTÄVÄTKIN
1,666,231,236 *AF5B7F55BE135AC8ECB84B491818DDB16F748C4F PEYSING7
1,666,231,237 *AF5B201A74815FDF23A92605563E7D6A9C64E4B6 P-G
1,666,231,238 *AF5CB8A075B1C9DE17712E48AC41E45CA4665447 PHYNALDON
1,666,231,239 *AF5CFD4390B4FFFC5DE6739673AFFBD3BD40B891 PILAILAKP
1,666,231,240 *AF5932730188FB2CFEB795C8DA361C2F1C43C494 PJESSAR
1,666,231,241 *AF501F5DEE410AA81661417262D16614FA50E601 [email protected]
1,666,231,242 *AF58DFD5E52DA274110BED01F23378DDAB605CB2 P---->~-~-~-)O(
1,666,231,243 *AF533B1C1B4297D3C56FA011E8FBC233B352E531 POLUNAGU
1,666,231,244 *AF5816406DC7C172555FCDF74245C649761FE9B4 PORFIRIO.ZARZYCKI
1,666,231,245 *AF512634082824D0ED10A5D201DFDFA88EA2B3AA PORTUGUESE_SOLDIERS
1,666,231,246 *AF5CC2B0934C8A77F2E8424F3AF7D0752E2D9E19 postwissels.
1,666,231,247 *AF5355EB43BF40728A5A28C613C8B96746BB1A9F presysto3
1,666,231,248 *AF55F68A25F2C8377F5B4560AC66901267EE982D PSTDTRNS4
1,666,231,249 *AF52F25A20753C4ED7A0F26BCC980A7094B3A3D9 psujowaacaaj
1,666,231,250 *AF583B1E42A27ADF5DDC212B65B33BE407B03E1E qazwsxedcrfvtgbyhnujmik99
1,666,231,251 *AF5CAD0A56A322202D732629A4FDB2E3899C9DC5 QI]W
1,666,231,252 *AF5F1F6C822810438CCAA2A86319EB60688F71B9 QUELS
1,666,231,253 *AF5061561F0498945089ECEB538DE4BA6CC5769B [email protected]@L
1,666,231,254 *AF5772B814A133A85D4663573D4CDA37A87D3F23 randellmadeja
1,666,231,255 *AF54521B17994771BC61768B25B1D0029B244D2E RAVLIME
1,666,231,256 *AF5245ED9527FD3A1C119F6B14BBE64EF8158229 RBARBIERU
1,666,231,257 *AF56EC2A16FA4A1BD0BBEBB8A8FA62F80CCB4A81 [email protected]
1,666,231,258 *AF54BAE737C7493040D6465200393DEABF05EF69 RE1AY-NSW
1,666,231,259 *AF5FDC9B3571577417D50CF2AE71B98A71A5C4BC REGARD—THEN
1,666,231,260 *AF5D5E45B0FB8D6DA6B4BAD0896A880B4774063B [email protected]
1,666,231,261 *AF5B83C5861F7CB7FCFC15A6E862FAC44EF9FB1B renepompa
1,666,231,262 *AF5B26D3444972550BBCE5B153563C32D7ED19D9 REYNALDOSTOHR
1,666,231,263 *AF5EA4ACAAB512E31370A170CDC259D52880F3B4 RGNMC11Y
1,666,231,264 *AF5E4AAF6297FFB325B5FB75A1DAF1FF727FF30E ricktramonto
1,666,231,265 *AF5D648B6DB79CADE6F6E71D6F1F9C1A3F4BABD5 rmybaqy60
1,666,231,266 *AF5D2DBFDE8A2EC027543EB0FD67BC4FB1984037 rogeliomurff
1,666,231,267 *AF5E3322A557EB8E1B5539FC0D3AD2AC91DB931C rolandslanker
1,666,231,268 *AF5B981913A81AB851333D397F1AC71D6FF4B6BC rolfshonka
1,666,231,269 *AF571FD72E96E66D5E191507D2C18624D65D4D67 ROLLYLIN
1,666,231,270 *AF5F6377DF462F43790808CF52AC545BEB6A00BC RRGNSTN1
1,666,231,271 *AF5ABE5B86A5BF3665B6F81A15244FCA3F4E3525 RUBENPENDELTON
1,666,231,272 *AF5573ADF3C646A527DE261F3783A06BCB583507 RUDYARDBSW9
1,666,231,273 *AF5E0548A193E5FBE600D6330EB0DDE185C97B25 [email protected]
1,666,231,274 *AF5A0260635B3D6108D9322611C4B8B41AF5A70C RUPERTFULLMAN
1,666,231,275 *AF5962ED66856DEB26F720E995A4F7355F6EDCAF RUTNECUB5
1,666,231,276 *AF56D24C9651E6C08B625928B62A1EF6F28F517F rw,b
1,666,231,277 *AF5EC6252385938D58E86D194631027891DADCDF SALWA-SABA
1,666,231,278 *AF5A82395E745FBE295D1D2DBE98EF673AF1D8CB SANTIAGO.STAKKELAND
1,666,231,279 *AF5D5BA7274A19C6EF1B49B81FCC1C2DD621C5B8 SARAHTILGHMAN
1,666,231,280 *AF5FBA42833BF9EB7CBBE7A0E00BA82A8BE58A5F SAULGOGUEN
1,666,231,281 *AF57FE405FACE389EA20CD205A5D6ADEFC708251 SAUL.HISEL
1,666,231,282 *AF5DAA4158E620304B41BEC22C3D00859309F034 SBLONIEN
1,666,231,283 *AF535FF50DD697872430B88DFDEC1255C4F03F0F scheingesch
1,666,231,284 *AF5977F39D7CE87E3E36A37BC147E4E32B40CBD3 school-ship
1,666,231,285 *AF57D8BB27BD62222463372AA362CC8D91689381 SDQSOGMY9
1,666,231,286 *AF54F0E8A5AAE293850F8B7DD799DDD1AA5A1B76 [email protected]
1,666,231,287 *AF5300529D1D6E9857D4479876BB3C0462126D47 SEBASTIANWIEDE
1,666,231,288 *AF54AB386C3492752B752B8F83A034FCD9994CC0 semiobjectiveness0
1,666,231,289 *AF522DECD8B74A352F3C314BC5896AE7529C65E1 SENSEOFPLACE
1,666,231,290 *AF564D5B974045B7394B702EB5479BD358C5705E shalier
1,666,231,291 *AF5CC414C1212CF3C8CFD11151FB5D2C18BCE8D9 SHANE.GUENETTE
1,666,231,292 *AF5A95EF460CC10B617FA5A95F624BB17067BBFF shannonhailstone
1,666,231,293 *AF54CDCAE81341179C2D55DAAF5974C8544CE679 [email protected]
1,666,231,294 *AF514495D81BF044376C22D1F493D9B684D11140 [email protected]
1,666,231,295 *AF5AEDF92822FC2BCAF61053CB9DBFCA20CEB981 SHIJIMIS
1,666,231,296 *AF552B4CC53EFD0ECFB0148232887B1442E721F1 [email protected]
1,666,231,297 *AF523078615DD6BC170829837A04C6D5173C9411 sibyled3
1,666,231,298 *AF5810E8FF251FED58973020A393176FF39133E7 silabrador
1,666,231,299 *AF5D49ECA2DDB3749FA175CCF6119ACE90B90C6E SINNEDSREDNAS
1,666,231,300 *AF5B8A73C8A1EFCFB2E139CE238AA96B8F320847 [email protected]
1,666,231,301 *AF53D890B77AEE83BA719BAD41BFC87F624707E6 SKÖLSTAN
1,666,231,302 *AF5EA68E7AD751A7440BBDA4592463DCF253B749 SMREFRIESING
1,666,231,303 *AF53123DF0A9B57B919385E96EBC85F2D69AD878 «SNOWCROWNED»
1,666,231,304 *AF58A4BBA62BB4DD0DA5C176C2957B075445D080 SONETO.XLIV
1,666,231,305 *AF51644C6A03291089C1C593B09A893D5AE76D54 spaceme
1,666,231,306 *AF5011CFECC808D4D41FFF53D9DDE7F91FABFA43 spente-le-stelle...
1,666,231,307 *AF5CB82F1D08E6478F6968E7D4FA3D97E72EF062 spryest6
1,666,231,308 *AF51D4679CC325F77AC5A004BDB3E9951C71C8A6 SQUALIDEST123
1,666,231,309 *AF58FE9C5B7B8235994BB80682439F9D5D0837AA SRIVISAYAM
1,666,231,310 *AF51276D74A4124EB08D7A05346564F67C26CCD9 SSERTOIR!
1,666,231,311 *AF5FED6DE130748EAB9C571425CA2E86029ED6F5 STACYFILSON
1,666,231,312 *AF5C80D00ABC5139A3694C17A261D089DEC07541 STAN.DUNAY
1,666,231,313 *AF58798F21D159463415D8BF1E1A99B23190AA98 stantonbugay
1,666,231,314 *AF573A82A8A551E125B0BB27FA26BB48A2639BAB STEFANEVERIDGE
1,666,231,315 *AF566F3958A0CE1276AABBB9876D16DC58E6475B STERLING.BUBAR
1,666,231,316 *AF5B38818770523EC0339D92905877B9B4EFE363 STEVE.4EVA
1,666,231,317 *AF5F162587395D0D704EF83323426B66C947B82B [email protected]
1,666,231,318 *AF5720F60FDC5EBB79EF27679CE84CD9D361A353 [email protected]
1,666,231,319 *AF5861DF0608F2D46A6AD9B0F03F4DF6A4B87F7A SUPERFUSIBILITY3
1,666,231,320 *AF54099D1F734978A6EE5E34414AB990FAF740F7 SUSANHOGGE
1,666,231,321 *AF5A963F04B2428FF57143988E5EBDB12CD4B436 suyama)
1,666,231,322 *AF50AE535E6E6F9555AE4046B2610BB3283C2066 SYLVESTER.TOREN
1,666,231,323 *AF57419A7AE2018E47F649A83EA750CE8A12CCF3 s]yt
1,666,231,324 *AF5A1E219ABE17CDBEAE27250252D5F0F8432E71 talk918203227
1,666,231,325 *AF52A82045B0EC1999867D36E3B817192809106E TAMMYDUNNO
1,666,231,326 *AF5345A485677CCCDEDDF51A514342FCCFBC7F5A terlupa
1,666,231,327 *AF5645D996139778BC845F0EAFD7B016F41FD2D9 the sound of warhammer 40000, chapter 1
1,666,231,328 *AF5C7369665DA82DC9678F2697A57164745E98C2 THINKHEI
1,666,231,329 *AF56D307E000A2A46F5CB85393BC32DBD10BC044 thomasjunor
1,666,231,330 *AF5B0582E7A1D449A29BFA899089387E80283EFB THUMPERPASSWD4
1,666,231,331 *AF5DC03BE7B9D7E9CD0A8B47CA8909E63634237E THY.BEAMING.EYES
1,666,231,332 *AF58CFE8FDE0091B5804D0E712AB5FE922DC4BBA TILLOSLERTBSW
1,666,231,333 *AF53C1465CE7E4138AE17E7887CE0E72482EEDA7 TKEELEGFA9
1,666,231,334 *AF57FC37011B36AA4B0D93979E60B570E20D98B2 tkugj4qz5jetam6
1,666,231,335 *AF53ED6B495FF706EFFDA95FBF67014BA5C9FBB0 tocrossfirenetwww
1,666,231,336 *AF57F516DDA89C91A58FE7561C0D55C5CA0CAF9E tomkleinsorge
1,666,231,337 *AF5B7BD24BEC7E7E40D05E365F43D65511E7D11C TRACYPOTTORFF
1,666,231,338 *AF55B4AF70143FBE71BBDDD2FC77F5B3FB880882 TRACY.USACK
1,666,231,339 *AF5B38007D357EF5043D64173241D042CCB24061 traducid7
1,666,231,340 *AF5D7007865F231D83EB7F268DC5867700293AC3 TREVOR.BARAD
1,666,231,341 *AF5008C305F8247D3C3AB2F110DEBA7A596A8D47 TREYSTROCK
1,666,231,342 *AF54AC1FA8311EBF850ACE68429FE7752A99F9E8 truthuggz
1,666,231,343 *AF57BF197E20898E277DD984EDD5D6FFC417587F two.little.eyes
1,666,231,344 *AF58BE218951FCAC045328E934D14B5AD89FEEBC tylerproudman
1,666,231,345 *AF5787678D02C1534B88010DD82E1B2140259A73 [email protected]
1,666,231,346 *AF50053F61829B33039877A38D8CAF61C1654FDB ULTIMATED8
1,666,231,347 *AF55ED78AD3B9CC581E87616C2BD1064409CEDA5 unclasp
1,666,231,348 *AF5D0F6A6A6EE60B68DEF2503E886C82A02A7957 USPASSION: XLIII SIE HIELTEN ABER EINEN RAT
1,666,231,349 *AF52690A4E9D59C953FFFD13972B0CC2F5261319 V9V9X5
1,666,231,350 *AF575FC5F263C820E95CC923C171883509E4BD88 VANMAGNALL
1,666,231,351 *AF56787392F0A9A404F46EFD3A04EB7C47F82250 VE1117940728
1,666,231,352 *AF5152ABD49C4C0568979D1A8517B83899656AAB velingtonia
1,666,231,353 *AF54099599DD4D6ABCC5862B66D370A97D2C0B82 VIRTUOSASES
1,666,231,354 *AF5C7A38C47650C7DF3C708FC2EAADC451D1A943 VREDESBYRD(RADIOEDIT)
1,666,231,355 *AF54ED83FB56E96A803DCD0BEFDB5D383707A698 WALLYWOLNY
1,666,231,356 *AF544CED6A7250DFEFAA75E63F724B32B513FFC5 walter.koestel
1,666,231,357 *AF5D9D7DC24F1432E829B178B609293A05C0531B wan-bin-nijangs
1,666,231,358 *AF55C196F7A4913BA951E4E7CA70CAB3C76A7CD5 waone-bagol
1,666,231,359 *AF5ABDC79CCA10CACC04A0D8AF1A1EB7EC25D83C WAS KINDER TO HIS FATHER THAN MY DAUGHTERS
1,666,231,360 *AF543761FF0DE369F20F321B7DCEF15DD7639718 waylonpelle
1,666,231,361 *AF5C0E26A8BDE0C2C9BAE6CD67A04F6981F7EF3A waylontindol
1,666,231,362 *AF5D849AD04B2F3BEDCF57530D9F533C148ABA8B w!d3n!ng
1,666,231,363 *AF586346363EEDFF41576EE09889D51EBA8EE541 WEERHUT
1,666,231,364 *AF5A30116337600CB9196C03135407E92688AE62 wesleylenorud
1,666,231,365 *AF544345A7CB980BC9F4453E4C2C4D70CBD16159 WESTON.MENOUSEK
1,666,231,366 *AF5595B595C4B99CA6520808AFA89B0E04CD505F WHITE EVE (REMIX)
1,666,231,367 *AF54A6C7B5CBC495A288A2ADB7A1A3D1D49274B6 WHITNEY.PJETROVIC
1,666,231,368 *AF5BB2D9BBE09F65F05EDAF6198F35FF1F8C977B whyjoinearthfirst
1,666,231,369 *AF5D4719490F871F953DAC8F8457D98630ACD1FD wilfredtoudle
1,666,231,370 *AF589AC880F3BDB4288EA353589C0AE9D35C1F34 willieroygoodrich
1,666,231,371 *AF515F2EC1A52F82618EF8252D110EDFCCDDA5F0 WILLWNGAMOU
1,666,231,372 *AF5B0965EFD70D5CEF5EE8255179CC3DFC16ED9B willybrah
1,666,231,373 *AF5CEFA77112B943D63AD0EE1BA902863CFB4907 WILL-YOU-EVER
1,666,231,374 *AF5DFE3C523EF117680E7EEFA6A59F83E98C5778 win-back-america-for-god.
1,666,231,375 *AF5A9C1150B689DE8F5E95E7A926955C3078D193 WIPEDOWN123
1,666,231,376 *AF5AE43DA56B311BD8DAD67C70C01B76946A42B1 wmmontera
1,666,231,377 *AF52A23D50E3A5E8571AA2FD670C0BE5CBC98D92 WMTOURVILLE
1,666,231,378 *AF53A4239075DF78F4D14B79B757A3A39A463CED wonderwall2000
1,666,231,379 *AF5382C3CE13C11AAF041318A336CE02DC3A0CFC WRYCHED1
1,666,231,380 *AF50C3224EA3A8D20DA9130C489EDE70E05F3351 WWW.CRP-EUT.ORG
1,666,231,381 *AF541F93BAC7E70D9649C6A754007DF1887F231B WWW.TVSUBTITLES.EU
1,666,231,382 *AF57A63B3F20BDFAF009494346830CE9C54C9E0F [email protected]
1,666,231,383 *AF53C324483B9FEDA8290040B4539A48A40019F8 {x}***d#b
1,666,231,384 *AF593175C48CFD96DEAD8ABDD360E5BD8E9C8C3E XRISTOS.GIALAMAS
1,666,231,385 *AF5F56105458FD5D4E00C5F4C127AAD48FFB434A xsf$
1,666,231,386 *AF5F4F0906643CDAD1F87E3FD74E8CEB1E56620D [email protected]
1,666,231,387 *AF53A55DEF84953E69BBB4AC25090FD3E5B5D5FB [email protected]
1,666,231,388 *AF520113E804A7575750E69BCDAF1C7BDDC46900 [email protected]
1,666,231,389 *AF5BB8EE955906F2A2CB3FA9365E9EE40D93EBA6 [email protected]
1,666,231,390 *AF546394BB05E7078B0A9B543DE91F447C41162F XYZLIBRARY
1,666,231,391 *AF5768319C3362BDEE89E88E22AA29EDEF0945DE YASSINEALJ
1,666,231,392 *AF56F8D1CFA5E0668C894065673747FDBDBDEB22 YDSHIT1
1,666,231,393 *AF57364C815EDBD9819B6F7BE7D0ACE6FF676117 YEISONGARY
1,666,231,394 *AF5BD5CD0FAF567DEBEF7178FEF3D317BD671F71 [email protected]
1,666,231,395 *AF53711F3C3F784F77062631208ED75DE907FEB5 [email protected]
1,666,231,396 *AF5BDF911217A2A928A971A014140BD7222CF41C YNOLLI
1,666,231,397 *AF580BCB6E5D5C39BEA3A904701BF599775830F6 YOULTDIVGTLT
1,666,231,398 *AF5A8981A3E1639C4EA15EF8DB135C6F09693CE4 [email protected]
1,666,231,399 *AF5F1A33B0861F6451A26DEA21A822986DE434B2 Z3+T
1,666,231,400 *AF5E7AE691632E0A34FED54C76E4BCACE3B0079F Z77915741
1,666,231,401 *AF5B1173A377D6A0306EAF1ABE32E61F7AD25BB9 zack.hyun.seo.kye
1,666,231,402 *AF5BE44FA3AF74BF6BD6216AD470489C8B9F6FDD [email protected]
1,666,231,403 *AF59ADD2DA88711E03C22ABEF75E0644EE3579D5 ZEE.BLUES
1,666,231,404 *AF5B94ACE91D63EA57A97EF7FEA4F75FD7EF8678 „zeitkrankheit“
1,666,231,405 *AF5C3CB6253D0DDBA39CA8399CD85E9054DCAF22 ZILLIONSREVIEW
1,666,231,406 *AF56FE267D1B4E73102C53685CCEED884E72675C ZODYAKTAKI
1,666,231,407 *AF5B611EBBD70A7F1462372AEBC73CB5362A8EF0 Z'OJ
1,666,231,408 *AF536B70CE4D01351FB60EAFC89B95BFC37F7718 гилдестерн
1,666,231,409 *AF5F2B3AC787E83D31FAB9A440EFD9A98C5BF58C МОСТОПОЕЗДОМ
1,666,231,410 *AF5152A18D7A0EEFA6607AC9FA9E3209894854ED престолъ
1,666,231,411 *AF511C0F46D919B9957B198B50A555747E42DB31 « irun »
1,666,231,412 *AF5FF8F1A6894EC29F634B220E8FD90A3E8B95B6 092260
1,666,231,413 *AF573ABD9A867F4371A85F93453803B90CD0402E 1449147 lemin-kunna-osuus-tarvittavasta-t
1,666,231,414 *AF59A7140F3BD8F6CCC4D2FA0647E15A2272535F 1644838 restonomittoimivatenimm
1,666,231,415 *AF5919512E3F660FB032226AA7306D1EF18AF65C 1698620 sirkustemput.menev
1,666,231,416 *AF54B1A97B6D1757C5C223AA83028F7998F31721 1993:.Sydney,.Australia.(disc.1)
1,666,231,417 *AF5137236A5E2914DA3D2A9EE63CD28BB506F145 1armee-strukturen
1,666,231,418 *AF52A3FE839A9E031FF8191EBA33CC4E0348F0B6 1BAHARAK
1,666,231,419 *AF5490914BAA502F17755BEB6CB6F6971AED6C56 1"EINBRAVERMANN"ACT13
1,666,231,420 *AF5286FD4EDB5D1D360C3684269996B5DB15E4DE 1FEB1580
1,666,231,421 *AF574596D0A35F9E07EEF51DD7223D08D3649B28 1iSHiZu
1,666,231,422 *AF53A4B490EE3A73647C7821A59590168D1885DD 1 jagdutensilien
1,666,231,423 *AF5A756AB31061D323FF70CF5EB2C3E7655BB62F 1.liiketoiminta-aluettaan
1,666,231,424 *AF5ED360039C9ABE8C238D72A396E93157BE219B 1 mathena
1,666,231,425 *AF5182CAB3050820FAF0FAAB0C9CF2D1664E5770 1myapples8
1,666,231,426 *AF53C1E27244E01E034C29A254D4042506444B66 1sanjosedallas
1,666,231,427 *AF53B80DA02D4F3077066838CD08B57B279D7A30 1 vangitsemisp
1,666,231,428 *AF55E0AD788F06019290195E88B5DE72384EDBAF 1 YKSIL
1,666,231,429 *AF5A49CC3069EEEBC98B1C0A6E6766A3D36DF532 2206985 POLIITTINENJ
1,666,231,430 *AF5ACE2FD0D6611358DC410CE6C2F3749566468D 2439565 IS-TUTUSTEN.TARKOITUKSENA.ON.SEK
1,666,231,431 *AF57ECEEE8D8BC81E5E408A415A892C9470256F1 27061869
1,666,231,432 *AF5370877157F619CE6CB074E27FBF01F6069A6D 2abwaegungsbehoerde
1,666,231,433 *AF5C816FDA620BE30A43B13F7D236E7643BA6842 2DCUM
1,666,231,434 *AF51836FD44A2625BBD1DA6878CBF9C31BB0889D 2fatalerrorafatalerroroccurred
1,666,231,435 *AF59142F4CE01143F63275DBF0F5C48A685CDC6F 2iluvjeremy0
1,666,231,436 *AF5ABFA2859FE521FBDA2BDBD30F49B80577F38C 2kantrimusiikista
1,666,231,437 *AF5579B08D8791C4F3B2EC6A9D6E364ABA787D4E 2OMMIADSP
1,666,231,438 *AF59B6F60C793B656035B0588E7BCD5011565F1A 2.SIEKKISENTIE
1,666,231,439 *AF505B8FE745EC03F593E4E3018837A7C900C29B 2-SUORANMITAN
1,666,231,440 *AF55742E5D41C70E4CD57B6910BC0034ABB08C4B 32ZIGGYFOO
1,666,231,441 *AF5AACDABEB8D60511F735D17250F0C792E7F6DD [email protected]
1,666,231,442 *AF59A5672D9092BF00CDD092BE99C007A11E6FBF 38 ILMAISKUISTA
1,666,231,443 *AF5924EB1EAB249FD9D7B4278C9E9063FF3623E6 3---b~o~o(-_0)
1,666,231,444 *AF5FA64676FD28BEED667025EDFF15837B722F48 3PERCUSSIVELY
1,666,231,445 *AF5F7F34426B08984C8D7B07706183DDAAB98D07 3###p~o ~o3b<
1,666,231,446 *AF5C513146A0B1CDA87F10E86ECAF5658F49FF58 3.traffic-school
1,666,231,447 *AF5E54DD03F7F3A3366FCAC892722FE7679EB58E 3 TRUPPENRUECKZUEGE
1,666,231,448 *AF5FA9ACBA87DDD8AEC57C2DAD66F9F9E47F0893 474444 muilta osin noudatetaan virallisia kaukalopalloliiton s
1,666,231,449 *AF582E207F89F0DBD829A5FFBFCF5762525FCC50 4ARVINDA
1,666,231,450 *AF5F6A829911CDDFB50E9F3FB4F0DD8702612504 4CPFJBSW
1,666,231,451 *AF59D52B7B8426FCC979D4E4B8A6CAFFED9B526E 4JUSTINKATHRYN
1,666,231,452 *AF5E16952F50A40E3B7FB91D3AE648D968D2459C 4NOITALUMROFER
1,666,231,453 *AF54B8121FA82BFCEAA492C7D3FDB5E4F30CEE35 4PP3114TONS
1,666,231,454 *AF5D8D8EECFB4FC2DDC0F7B22F07A193611ABF53 4STIRPICULTURA
1,666,231,455 *AF5100D3AD50A4A5DAFCC2DB4C3E2D777159FBF7 576martina
1,666,231,456 *AF52A7D154C50B2C4E8ED413B2D3866C77944956 5AGERADES
1,666,231,457 *AF5232A7FE472C74CD3489F4442221909BB56128 5BSWINDIORANTEBSW
1,666,231,458 *AF5DAAE977D15B5F1D53FC4C84004164F60F4711 5CORINAIZ
1,666,231,459 *AF50F68F7D4FD561AF389792742AF0B37508F238 5GPCOXDM
1,666,231,460 *AF5877B34076D6867A5436B82787DF3152E1E492 5ITABUTIM
1,666,231,461 *AF58F6D88E21CF79BB0F63BF50512821678396D3 5NEROKTRA
1,666,231,462 *AF55D6176C1B63A0579780BAFF23D7DF9B0C6D88 5NOPATTAM
1,666,231,463 *AF5304D08AF4E0C172E0F05376DCF81E0AFE7412 5NXTCLLY
1,666,231,464 *AF59A4C4B89D6477E6F3AC705480C5B1AE7A76D8 5y7f0kru08tsfqu03a93yf4
1,666,231,465 *AF5D02E56E112270956C275A87A91CC7EB91833B 644ZC
1,666,231,466 *AF5685E2DA366C768D99CA07A0F53A28FE94E308 6BLIZZARDEEYORE
1,666,231,467 *AF5AB68BD741E4A97ED6027F638CC49C6F808E90 6BSWMONZOGRANITEB
1,666,231,468 *AF5EFC1375760C3B3F1C482A54F593671A92AB4B 6iluvbitter4
1,666,231,469 *AF51CF6A6D7558BABBAA2FCF481CCB7ECD6CBCBA 6TPMUPEGS
1,666,231,470 *AF5F728D95A16A8077E715A11C2BE18A7578B819 6UCONTROL
1,666,231,471 *AF5B3C83CF25EF26E1DCD3C0D54B55DE592110CC 6viationniste
1,666,231,472 *AF5C2323F2255042A5443D2ED90FAD52450B38A5 7BADEKARRENE
1,666,231,473 *AF522D08D5319EB88BF660D0D44E9A87CA50202E 7CONCENTRALIZES
1,666,231,474 *AF5690A2B39D74EFD7C49B1D5A290040F8C43B8F 7DRUNKNAD
1,666,231,475 *AF5AB2F010F22114372ED454A0935E996569AD26 7GARNELLO
1,666,231,476 *AF53E4F842BB05C08FE2ABABE4199389C3FAA149 7KOMMERZIALISIERTER
1,666,231,477 *AF51F60C70BBF70FBF306723093591930034249F 7OCRYPTIC
1,666,231,478 *AF5A1C7839B5D8C25326202D6A78E2B9EC872422 7PLAZIBAT
1,666,231,479 *AF5C67B3E9CC2B9AE817E63EC046F3777EF575E4 7WITHOUTANOWNER
1,666,231,480 *AF5898869CA16069760F9068EDF0320F899AD2C2 8####>~0-~o-uu
1,666,231,481 *AF5ED9E1BFE1E14F38780BB4DB92246A9F3CABF1 [email protected]
1,666,231,482 *AF5CD9EB260016E87C55F59F81966D8443669556 8BSWTIMEWINDOW
1,666,231,483 *AF57DFF8B50604C28840BA77D5775D94B51BA51D 8---D~oSplat
1,666,231,484 *AF5A106644A587C5CE23B8F85C50D95E96BCFE8A 8FORSTLIGE
1,666,231,485 *AF5144970E252FD17FDA854741E60D9DB2CD4FE2 8GELATINED
1,666,231,486 *AF57BB20AD888587E474217208BDF2F33EF4914B 8ILUVBRADLEY0
1,666,231,487 *AF531BCA4DA2F40E0E9EFA3A84EB4A47E31C496A 8RUCHBAREN
1,666,231,488 *AF5BC5680296B105571E3AE9749E0EEF1E027F03 8SARBUTTS
1,666,231,489 *AF565CAA0A0C172E403A112E53AC7EC4F3E7E748 8SOBERANIABSW
1,666,231,490 *AF5A09C0DABEFA7E7F4F9D2798A0F2070101DAF9 8SWEETSCLASSROO
1,666,231,491 *AF52F2E3F1D71C017F81A7EF9896B470F3090DB7 8TENKNILRSCDURBASULLEBPMACNELLA
1,666,231,492 *AF5866276A0D1A16A015BCC1EE87B091741A65D5 8THEAPPLECART
1,666,231,493 *AF5158DC3E33D59C49198A5629869E1A8F08A885 903910 JOHTAMISPALKKIOVOIDAANMAKSAAMY
1,666,231,494 *AF52149DED9D07CF1CA94C36B49B7115123AD44A 9DIRKIMPALA
1,666,231,495 *AF5F7AA4D61A6D0C37BE56C42863F3411ADA6EA3 9DOUCHEUSING
1,666,231,496 *AF5F0CCA2376B58BE40524808A9BCAC574D31A15 9rigoureuses
1,666,231,497 *AF50B55FE0FBFF7891855D2C1496B3A6BD1E8BB8 9WHEELINGCOLUMBIA
1,666,231,498 *AF543CD96591AFF481B988A3660CD83AB784A86E a4d2)
1,666,231,499 *AF57C79045927DFAD8E233469AC3B7607E1663A0 A$A3
1,666,231,500 *AF55A82C6E35EE39BD19431B533C2CA2F7BE4091 aaal&
1,666,231,501 *AF5CB3634B20A535579C08E4B58794F467D19A72 a;ata
1,666,231,502 *AF58BE45A79434788E25C9F1DD23688262FD6EE4 ABMZM
1,666,231,503 *AF5BFD580FADC060427B88CB3DD835C46ABC3C75 A/D$I
1,666,231,504 *AF57E180647D8651CD36EBAE9DAE9728EF2F059B adkhp
1,666,231,505 *AF59D214AC629C68AE20471060043C1C9F7BCBAB AH?KI
1,666,231,506 *AF5F6CA96FE66DE732DCED940EC37CFC55BE65B6 AIDANSMYTH
1,666,231,507 *AF5B17D4A4AC25766357D3814B6EBE8278BDEE83 ak?16
1,666,231,508 *AF5725515D1A194A5DDF5D087FA3B2519E24DC0E AKUTECK
1,666,231,509 *AF54E587B57083CD5BC92D47A62B00E819029D9F ALETK
1,666,231,510 *AF5F622E4FA82937B795A14D5AC6E83D87C814F5 alilovier
1,666,231,511 *AF5CF938CFE0EB6DB928593ABF27EB14E50F40CD allaiboob
1,666,231,512 *AF536C8BAFCB01C8059B42CA6B82B297C2E7F1B9 ALLIUTAR9
1,666,231,513 *AF59CF25A88C76E4B46365F63AD81A72D4A475E5 AM(A2
1,666,231,514 *AF58B19208748F60E8638FC9B7522B3D17EECE43 amw(d
1,666,231,515 *AF5D97834A856D3C440E7F4EDF6DE76DD49FBC31 a_nfe
1,666,231,516 *AF5195F8517F9A4FDDBB9CB914EB87547B879A90 ANNETTE HAYWARD
1,666,231,517 *AF58107682B4AD8F69AC2A37457277C655D88B86 ANNIEISABELLE
1,666,231,518 *AF53F59717B7ACDB47AED0CA2C30A01886123065 antibesjuanlespin
1,666,231,519 *AF5DB6096A835F9E38247ED1B1154B8DD85D8C65 ANTOINE.VIDALEZ
1,666,231,520 *AF59F0FC3C6CD57F465DFA49754DAE168F916AE9 anualak4
1,666,231,521 *AF56307C7B497AACBC5FDE0DAEE444162D846EF9 [email protected]
1,666,231,522 *AF57FCE206C5E4DC0ADF0277C2358564B9BA0864 ARLIEMBONU
1,666,231,523 *AF5B72906FE45B11FE042A07983A0EE5689A57EA ASPERMATICING
1,666,231,524 *AF53F7868FA4A748DCB5F5010EF400992BA834EA assemblymanrev
1,666,231,525 *AF574A6E613E12BED16459C494D4E4916B7C675C ASSOLAVA7
1,666,231,526 *AF518AFDE63DA58F51B77D60EC893A4E1024F875 aublette
1,666,231,527 *AF59583DE9CE9C28F6F37A7744E603743198C60B AUE!S
1,666,231,528 *AF5CA534CE98FBC35680990025C31D6448818059 AVUZION
1,666,231,529 *AF56E9B8682DEB4762038FF564BE361FA0F8C229 AWF8E
1,666,231,530 *AF538B463443E4B5881E2A859725AF1ABD104AAE b,4dk
1,666,231,531 *AF58C30DE99CC98F1BBBF0D8DEA721774EA7A76E B765468F-5F48-39DC-B950-904C969D03BC
1,666,231,532 *AF56641E14021052644CA0E420BAA1773EEFC6BF b8jc)
1,666,231,533 *AF53EEB91090F679CDA85BD0B97C998296B68B09 b+)"a
1,666,231,534 *AF5BF52FCB61B8635523F9C59A1224DD4C25CE13 bal1p
1,666,231,535 *AF5410A60E6FAAC99C0BFC87B714A36772090A85 barry.linnen
1,666,231,536 *AF5ECEF3CDFED61B26A4568617C1F9E1B97760F5 BART-CALENDARLIVEJOURNALCOM
1,666,231,537 *AF57C442E8DF2D3E91E04F266D789FE228D77BE7 BARTONSEECHARAN
1,666,231,538 *AF51523C344A7C48100C9A6349C66DFA531509E5 BASILISKE
1,666,231,539 *AF5A76D663FF3296B15EB5354866C5A54AB99D5C [email protected]
1,666,231,540 *AF58BE10047473F9A696B27E9DC38A13A8E00DB1 BENAMIPASSWORD
1,666,231,541 *AF5CE957C88AAA1919AF6B5BDBF19F8A6FC8EF28 benconyers
1,666,231,542 *AF591C8E90029E78D412B01B17A7170FD6FA6524 BERRY.WETZEL
1,666,231,543 *AF52F271233FEB35648FF693D45435CAF920AD6F BETADGALACTOSYL
1,666,231,544 *AF5A4299DAF481E7ED429486A7E0C9332327E371 bglfd
1,666,231,545 *AF56EAA3A0F0D21EE0EEE8E15EA0B0EAB62985EB biggirltheory(intro)
1,666,231,546 *AF58645479EB7FF669ACAE4628FD4E25441A6F0D BIM37
1,666,231,547 *AF51F81C331E40E17D220F01F4F5E4841F6AA8A9 BK-0
1,666,231,548 *AF536B72B92CD94A070635A5CB24F29CF12500E4 BM2J,
1,666,231,549 *AF56C12DD2247F69F5472E5F496F03AFE153FEF0 bm3x4
1,666,231,550 *AF52009F7F10BC39A6267198F1197E6151258CDF bm5
1,666,231,551 *AF59DDB967567AF12D658CA3652BE72200AFC8C7 BOB.FAWLEY
1,666,231,552 *AF565F813CF13A19C3AFC1C22FCC43EF68860422 BOTH.SIDES.OF.PAPER.(CAN.BE.USED)
1,666,231,553 *AF5C33E4723BDFD141B85AEFB01619D317EAFAA5 BRAD.SCAVONE
1,666,231,554 *AF5FFEC0D4D6793C0E4C5B045BEB9187DF50C278 BRANDENKAMEN
1,666,231,555 *AF51787A02AC8BEA0371506EBF8426BF1DE4B4A2 BRANDONFEENEY
1,666,231,556 *AF53D05AB5E6A1A125BD3E437B7BAE212C35F4F4 BRBH
1,666,231,557 *AF5D0A05F5D754508CFA427B9C7E845946A6B5AF BRENTON.LESNESKI
1,666,231,558 *AF5DEE56717BF56254466E346D5E7DE25B345726 brise2
1,666,231,559 *AF5DD19ED2348F6CFDD31AD6AC74FA1C92875EF6 BROODMA
1,666,231,560 *AF5C20C14912953D54A1B3631AEDE0E79554BEB6 BSL(I
1,666,231,561 *AF5D5010F08ECA0A2E91BEF3FF68003DBADE1FC0 BUDDY.COOTS
1,666,231,562 *AF59297CD9F48A8080EB6ABA558D5C4D70F531E1 [email protected]
1,666,231,563 *AF57D04F95BC6D6E240A0F2FD888FCCA383D1B84 bulgarian-(signum-remix)
1,666,231,564 *AF59EEC93C0D1C1C9E234E0EEEDD82F93CB57B95 BVNQUG68
1,666,231,565 *AF5C788717B0D8F7552BDD75A42EEAB1852AA8C0 B&"/W
1,666,231,566 *AF58993C1EEB63F18D4E5F0F8A32CF3E4B4A371E BY:&T
1,666,231,567 *AF586F12A3B887BAD1E9E24E3CEF8D6F4A3BD882 C-8.
1,666,231,568 *AF5BA8DCAE3C030F54F0CBB17337CA42933E937C C#AJA
1,666,231,569 *AF5A1BE555CB86D3862AA24DB989A09CEAB1E3EE CALEBLAIRD
1,666,231,570 *AF523DD74514F2F14B898DFC338FD1D46FEFBF02 [email protected]
1,666,231,571 *AF57727710B01927CB5F7733F0FD21544CAD5C65 carterandre
1,666,231,572 *AF5A12453218AC24D556514D2316657DAD3A7F2E CASCALLANG
1,666,231,573 *AF59A812619C84328964DD6B0A399649F816073A [email protected]
1,666,231,574 *AF55D6255113E1C049E3CE7F73C74684DFB3C963 CAUTER1ZES
1,666,231,575 *AF578F69AA74D982E021E213C7B3AEE37314503E CDOUFEXI
1,666,231,576 *AF51349962EAA3BFA91808461A236CD2E8A9604F CEDRIC.YEAKEL
1,666,231,577 *AF5CC92C1B0B0B448BF999397B80BFD7B493AFE8 [email protected]
1,666,231,578 *AF517B01122402032A69F7782EF2441FD6AAB0E5 CENTRODOCUMENTALBIOGRAFIAS
1,666,231,579 *AF52FC147AAA9160306E77D9ACE9BD40B43F28B6 CEREBRIC
1,666,231,580 *AF508797C95B0A8C64089B03340A494CE1BFB780 CGAMOSO
1,666,231,581 *AF5A12D9A1EDC92369BCFE6E0AD392A7B2DC8816 CG,XR
1,666,231,582 *AF5A5011A327CEF5839BA7B921163F9E74A8A3CA chadwicklollar
1,666,231,583 *AF57AE187667A6847767A45C91052E3A34CC54E6 [email protected]
1,666,231,584 *AF5BA97653D79BB1F99ACC919C02CF009D17A89E Chapter-16-16:-Godric's-Hollow
1,666,231,585 *AF55E8256763FD8F2217965CF9A72F868F7D1752 CHDGB
1,666,231,586 *AF56B2E141CF80D7F443FA84CCC41FDFB83A2A9A CHETCOCOLA
1,666,231,587 *AF5627259FD3EC35C8EA50CB74C228B21324D6D9 chn00
1,666,231,588 *AF5F29C59DCECFD53F4F69A265B141203F8A2714 CHRYSTINAC
1,666,231,589 *AF526F5F48C273D03E87B04FD8F1133BD56CF479 ci$a:
1,666,231,590 *AF597EAB570D58867AD517B86B89F8FD5756FA2C ci;s)
1,666,231,591 *AF5210B1FFB1A7315176327B762A3CB89D27ECD4 client-sided
1,666,231,592 *AF599C23DE4DC4608EFBB41ABB389D7B0AF2B72B CO)A?
1,666,231,593 *AF5FF5C4ACAB2A9E560B40160502A5F383522F7E COLLINDEETERS
1,666,231,594 *AF582290D16887F3A501D3BE36C342D0D5B2A941 COLTON.MIS
1,666,231,595 *AF5637EB0D7B0FA609AEC1E89D665069CD676067 comna
1,666,231,596 *AF56D3DE38622184F805F96FEEDB3CD9C850F09B CPjK
1,666,231,597 *AF563A30F6191225CA6144AFF27E7C06A22CE597 CUBO C
1,666,231,598 *AF569B11128B34A2EEB0F818D36850350A658ED2 [email protected]
1,666,231,599 *AF536CF3907623059F454EDAC672D26478F7488A [email protected]
1,666,231,600 *AF543B657C760A0A1D2A6D2D6F86275DCBFB22AE CUOLDEBRONCE
1,666,231,601 *AF5D071356266B642466EA19646C41F40D255D25 cv"),
1,666,231,602 *AF526572B89EBEAA0B49526916F23AB3FA6296D8 cv!k(
1,666,231,603 *AF57C406D1CC2E902C441B3A2E9FA149BD01BB62 CXV,G
1,666,231,604 *AF5D5A1ABD03ED94DB9C3FA7CF788A44D361D3F2 czkrq
1,666,231,605 *AF5232C13A0FE05D8BADA98AE7068D6F474EB1B9 d4ba
1,666,231,606 *AF5A5CB81D8A59ED799C2E58039424CB40859294 DALU
1,666,231,607 *AF5AC06190AFB201ED3044E849DF9BAA58464003 DARON.PINKOS
1,666,231,608 *AF50C2B673A11D6D5352DFC9B0BF86DD673FDE5F DARRELLBRASSER
1,666,231,609 *AF5C106AB92E95434474D12B51237F4BEDF474CA DARREL.SCHAFFER
1,666,231,610 *AF56B8897974CB4C9394C1A7ECB728A2BE4E3826 DATACION POR RACEMIZACION DE AMINOACIDOS
1,666,231,611 *AF5B5F2473FA1B90C7D20C936EB95C3309D1786A davidledee
1,666,231,612 *AF5F2A5C009BAE4EE2522C5A3CBD60CB8DD4D3BE đẩyđà
1,666,231,613 *AF5DE35793DD2E8AE54CFD771E5797FEBC3BBA42 DAYDR3AMIN9
1,666,231,614 *AF59CCD40E2F104012EE9D1D87B6342298D9E180 [email protected]
1,666,231,615 *AF597E8BD3B675A5FBDADE639B986A7DA16341B5 DD=KG
1,666,231,616 *AF5680ECD499BA4C2D65FEF2F688B220F92C81EA decennaux5
1,666,231,617 *AF5466A389BB2AD22A4E1EA5F7B860D818B8A99B DENIS.SAMOILOV
1,666,231,618 *AF5615AB899E5DAC2DF14536680D48051C2AF3B2 dennis ferrante
1,666,231,619 *AF5FDE16B4850C909C144FD6761E0CDD03D2E556 DESCENDUES
1,666,231,620 *AF5283A5C5434575786B089D63F25988F51540A6 DFM-O
1,666,231,621 *AF584B1E26E284CB8868B1B63D4B8D15E2792743 diagnostico-nacional-sobre-la-situaci
1,666,231,622 *AF5814FE8F555387EBF83561229711AB532F5A4B dickemo
1,666,231,623 *AF5797C4750FD05B87946D4805F828B54ADBFA02 DIE-JAHRESZEITEN,-DER-WINTER:-EINLEITUNG-ADAGIO-MA-NON-TROPPO
1,666,231,624 *AF59E47E3313805A7D736504137A68792FA679F6 dir2l
1,666,231,625 *AF57A27B018E011B46B82BC8E985F088C4577F18 DJFIW
1,666,231,626 *AF5F2966766225FEA9F41CCA143F612ED06E255B DLPU!
1,666,231,627 *AF515B72873FBAB8F57589DA0BD57DB020CD689F doctommy7
1,666,231,628 *AF5DDD3CB4FE20BC3A6D35A244E92831FC9C87E3 DONNIE.FORT
1,666,231,629 *AF59ED43D4F2D69F7A3DBE7131DE9D5C15185581 doturala
1,666,231,630 *AF51F44DD8FAC4D371ECF0A4AF0232B95A80850E douglike
1,666,231,631 *AF5322C29D891731645DE772E01245D80E5ABD4B dsnpg
1,666,231,632 *AF5A7A185E174868EE4437E5BF9E6BD37C335A10 [email protected]
1,666,231,633 *AF540F65B7C829796AD1376336A73771525A134E [email protected]
1,666,231,634 *AF5E627F4E3212A8E93CE300DE9106978C10018B [email protected]
1,666,231,635 *AF58028D0DB6E0D6ACA454AFC3CD60D91114A6D5 DUNCANFONOHEMA
1,666,231,636 *AF552DA581B3DD425DB23D64551D088DE3027893 DUSTUPS9
1,666,231,637 *AF572F0C6DC3E3CEB76E31C32CB5B08D5E6090AD dustysidener
1,666,231,638 *AF50B12B64F0524FFFAD8266EB5971966B65AB83 DVVH-
1,666,231,639 *AF50D7249C5512586FCFD14AA3C84DF091D413E1 DW,JB
1,666,231,640 *AF57B6B8DAF4D0C47C4E70EC61C8A68024F52E87 [email protected]+<
1,666,231,641 *AF5207A1A4B9AECA057060FDF7CA37C1E2F25A2E EADIHPOT2
1,666,231,642 *AF5286371BBB3A05E4113EA2C625A46B3BCF5D72 ECLOUTER
1,666,231,643 *AF50162B93ED600E678B80364BD4F97CCC8680EC [email protected]
1,666,231,644 *AF5739DFF910398666A57057FB0E209BBEAFCBB2 edgardonevarrez
1,666,231,645 *AF5A1FB913B61A2D8BE14C428B3637DCB8C13812 EECRANE
1,666,231,646 *AF539071DBC8E3997BB88A80886C6DB18220C1D3 EFSKP
1,666,231,647 *AF53235C9499FA7C65EB9B94CEF48AD3E74A871D ei=e=
1,666,231,648 *AF5114CEA223A09F83EFD6D7ED721DED9A86FCA3 EIOCV
1,666,231,649 *AF566E11F4127EAC3803AAD8A0117A08240CD92C el.
1,666,231,650 *AF56846B354485CA7EA4D96CFB824DB0D8CD1223 ELIMINREAGO
1,666,231,651 *AF54624C2D437147958E704196C1168694F744C6 ELIZA477
1,666,231,652 *AF5F5FC6CD318466DFA67B79BD5A9D747C097466 ELMOBSW8
1,666,231,653 *AF5D37AD58B8A8AC1B6C4BF6A1A3B32E6A9DA851 emanuellutheranorgwww
1,666,231,654 *AF55F02568D0E15A12A93867E55EAB8AAF499568 EMECARIO6
1,666,231,655 *AF5D264A09BFB5039C5577E6452262C203DA3702 emesis-of-the-soul
1,666,231,656 *AF5A01F36B05C964B4926C20ED8A9A6D3C6C06A7 enamoradodeunfantasma
1,666,231,657 *AF5F9F25DB318C6334474DF4F70BF7F419D8C856 entwl
1,666,231,658 *AF55BBE4D66E99518D55BCCA62761AD9E41BCABB erin-calvey
1,666,231,659 *AF586F88B5EA7FA014ABC23B82D1F386E6ED8CE3 erin.dahm
1,666,231,660 *AF544D0AE7B9409DA7DC79664DB42EF1128889ED ERNESTOBARBAR
1,666,231,661 *AF57849AAD4649208F322F2CE8FB10FB9F87D13E ernstreutersch
1,666,231,662 *AF5094E339F7887F192A7E9B5731B6D76EEE4D6D eskiarving
1,666,231,663 *AF5AD88C38F91860A166C618A68B9393B0FA9BF4 EUGENE.LEVANDOFSKY
1,666,231,664 *AF51C6C7FAEEAB1D57712A387201C181D899BAE5 EUGENE.RODDENBERRY.C
1,666,231,665 *AF5BAE746D41E0751F24C9A6A09C0B8346385500 eukdw
1,666,231,666 *AF5EBD831F1E4D8AB9B25D609E7A8B02A7A4E42A FALKNER.'F/O/KN/@/R
1,666,231,667 *AF58C53757EABE56D2586B3FAF968D5991D0DC73 fall-under-suspicion
1,666,231,668 *AF55DC2D14ED265FB0B7F9D8EE2C4ACACEDDFDBC falotes!
1,666,231,669 *AF55F198C2134BC7E3C1DF27F805C3B59A5275E1 FASCHISTENS
1,666,231,670 *AF540E6465931B54C66B0FF388FAAD131D5ACE74 [email protected]
1,666,231,671 *AF518463A28EEF570BC3F90A6F9F6C01EE7AED58 FETIDS1234
1,666,231,672 *AF5861D685CF7BCF22D344343B1DDAAD342238DA fewwawu63
1,666,231,673 *AF57C33AF43FD73E152CF4C0AF2BB369D6ED3D3E FIFTEEN HUNDRED AND SEVEN.
1,666,231,674 *AF52EFD681CC249FD641C77B28EE526D5C12D362 FLAVY-LE-MARTEL
1,666,231,675 *AF56777D52CB32185FBBBDA927647FB3F8EDB977 fly_to_the_sky__con
1,666,231,676 *AF5E8183CA4F7754326B3F43791BC0F9F9FAFEDC fom3n+a+!ons
1,666,231,677 *AF5E41F91982EF27E22AD322DAA7DD1A57229880 fosterblosfield
1,666,231,678 *AF5146B04E78B6369B083F58FCEDF6546F3A522F FRANCESCO.CRAPANZANO
1,666,231,679 *AF5EE9CC8073214EAD9EFFE865A4507E4DB20977 francespaige
1,666,231,680 *AF5AFF93264000B3A429BBD0C07DC2FC6293391A [email protected]
1,666,231,681 *AF543F6A7079A271255E1BEF0AE39A25AD32B9E4 GAO-HEYIN
1,666,231,682 *AF5F5FF99B502CB259ABC4776A93359A4D945FE5 garnisso3
1,666,231,683 *AF58DCE571DAC61365CE698F225D0027DC02BB58 Gebruiksduur
1,666,231,684 *AF5F7EA64329D750D8D259CAADE141EC7AFD96BA GENIUSSUPRA
1,666,231,685 *AF5A906CB02096FCC35826C2EA49199C8F3660A0 GOBANZU6
1,666,231,686 *AF5768C8FECA143718821FF14683723C5B7A1742 [email protected]
1,666,231,687 *AF5B2769C2E813EA19423AF8EF903D19A60898EA graykitten
1,666,231,688 *AF5FE70CA954E81CFC36E8E99100FE7BE749398D GUARROS
1,666,231,689 *AF5E309831299F11504DC2CE2A38C84F7D61EDEF GUSTAVO GALVAO
1,666,231,690 *AF55D6F78560D55527A4D3DE8EB86BBCD8E8F9A3 haicorde
1,666,231,691 *AF5E1BAEE0F736524E6B0CE739BD1E5049B29089 HANISINA1
1,666,231,692 *AF5092AFEDBA73D929961A69C11F204C791120B2 [email protected]
1,666,231,693 *AF595BF71B3221E44B9C026BB69FB8750DDDB4E1 harleykendig
1,666,231,694 *AF5D37E9DB9998BB8198BB5190E14E31906CDFE0 HARMONICA-RAG
1,666,231,695 *AF5C29EAC6BB00F27E541DABCD344FCD7EFCBB18 hcaptain-craig
1,666,231,696 *AF571DE529FFF662A2312227870C36521FE43049 HCFWXQEALD0E
1,666,231,697 *AF5F7473969CBE760B7F1C7E66E7F65EB7980027 HCULOHR
1,666,231,698 *AF5281EE52974C47004B04959390847B581F87F9 help.me.to.hold.on
1,666,231,699 *AF595D12CED8426BFB30BE367E557572A96907DD hht;
1,666,231,700 *AF5B04CD666480C7FDF1A4E3DEBD40D9551F07A6 hiltner
1,666,231,701 *AF52E2F4D8F025D98D9767186E56297225144CA5 HIPOLITOCARNE
1,666,231,702 *AF56088AACF5311F3A89F9444752AED4C7C37EBD HM8C
1,666,231,703 *AF567010EE61E7E01DD41F40BFA0DE06C57F656F homopteron7
1,666,231,704 *AF547A738CFDD5951EDF0BD01452AB410FBD524E househome2
1,666,231,705 *AF54DC99B37A67D017146AC0D4BB30B439857667 howardcreek
1,666,231,706 *AF57D47FDDBAB8CE2B2CBD0B943ADE675AD105B9 HOWTOCOLLECT
1,666,231,707 *AF5E90E784BF8D611D866FE50306F7A4C8BED0FE [email protected]
1,666,231,708 *AF5470D8D6116C543989C2F562C49F2AC7A9DCE8 hueyakerman
1,666,231,709 *AF501C0A225EE28EE59FAF7C34A9B28AE92F56DE hunterbollin
1,666,231,710 *AF58DB9DAF0B72FF12E69FE7BD93A4487AF1A7E9 HUNTER.HAVICE
1,666,231,711 *AF55039227BC139DDC634F0DBFABEBE22B291358 HUTANUM
1,666,231,712 *AF5D0ED000D2B97A2BC0FF67FFBA857600515F82 HYPPSIVT1
1,666,231,713 *AF56B49862F68919410FF7128F12DC3F04F363ED I-AM-CAPTAIN-KIRK
1,666,231,714 *AF5846F4C141C030EFF8923F018093809A1220F3 iimmigration-cap-isnt-intolerant-argues-ukip-candidate-abhijit-pandya
1,666,231,715 *AF5F8DE71B28DAE9C05C7DEF69EAC61613B88ADA INFESTEES1
1,666,231,716 *AF5FAAD1C435BD3FC0F18F86EE615219EBA816BC INSEARCHOFTHESEARCHER
1,666,231,717 *AF590601467A9815942DE8B852BD82EE1E9AD6EF INTO.YOUR.SICKENING.INTESTINES
1,666,231,718 *AF5914AAF296A51CEB61E1FE33C62AEA7C6625C9 irma s
1,666,231,719 *AF5E3E866268D63097A63F98958EC278E3D28141 ishigating
1,666,231,720 *AF5EB90B3A77901A43D92E3246848E9F8886E571 issiputs
1,666,231,721 *AF5A9C9A6D67985BDD4B26E5324DC5B24F849AE8 IVAN.CRESPO
1,666,231,722 *AF5C420E54DAB8246B2EE7F70F4F9704FAB768CE ivanthome
1,666,231,723 *AF578E82FF97FB6E1A62535FB289B389FC6C2CAA izquierdistas-caviar
1,666,231,724 *AF5D23B89F0C3395BDC45F41F7518B7432AFF6D9 IZRUGALA2
1,666,231,725 *AF5D20C3F1E9F8548E2010248D15E8EADD34DB27 izvestajidrugih
1,666,231,726 *AF5D17C4B58963A0CF969B58A8A29B5DE143CA28 JAGANJCE1
1,666,231,727 *AF54026D5CE2FF7FB1E05EFF7E7F28AA2B9171D6 JAIIDEN2007
1,666,231,728 *AF5C4C7550F0373312D09E13AF703251463A4D4A JALOUSI1
1,666,231,729 *AF525A48ADD207457B381ACE0345CE2F8C3C13EB JCV~
1,666,231,730 *AF5434822DBD71E9FAFEEF380B79CC33F3486393 JESS.ORTH
1,666,231,731 *AF5A4D8B29766B8BA705A04611F8190B05542EE0 jimfinkler
1,666,231,732 *AF5B3F9668080BCAE4669CF2082EFF14A482B707 JOLLYBOTTLE
1,666,231,733 *AF569B550C21BEB5F8F04388CC6558CB06D73AD5 JOSIAHGUETH
1,666,231,734 *AF591BA176E78114E3FBB7B54DA261FB4BE2769B josiahnaone
1,666,231,735 *AF5A401A26F4EB2968B13137641D80272A98D852 JRAE
1,666,231,736 *AF56168DFF89F6D5B5852653DCB07810F5BE2617 JUNEBUGNASCAR
1,666,231,737 *AF576C5F09A35BBAEBE5FDD4B80632B2FE96C764 KADOOKUNNEL
1,666,231,738 *AF5EC872C224C7D6AF2C55221F755CCC265081AF KAREEMMCNEECE
1,666,231,739 *AF523E5F702EE7C55470C92196BF339BA10F22C5 KARNJAREE
1,666,231,740 *AF5EBA1948396301768827770E259B1B7C55790B KASJMIER3
1,666,231,741 *AF5AF0FFCA356D830311586F0B2822CED5517382 KEARRA-BROWN
1,666,231,742 *AF5827D890C4F00B0F4DBCC08D002C27ECE07B5E KEATCH24
1,666,231,743 *AF51717F17EEEEDF90FBADF72C1C71BB7687F9EC KEITH.MONGAN
1,666,231,744 *AF59C06962453FD7128E7B63571A033035FEC77E KEITSITATSSLEDNAH
1,666,231,745 *AF53C826F8C7240C21C9BEEB9E21235C7E4A05F6 KENETHSARR
1,666,231,746 *AF5DBF126CA410D43203B583808AA9F53AB2E6CD KENNETHLOEBS
1,666,231,747 *AF5CF50AC4EDAB78BFC3F432976448BD0EE304E9 KENT RIDER
1,666,231,748 *AF591CACD2A7217C98730E2E01A3D30A9DA973A3 KENT.VICKERSON
1,666,231,749 *AF5DAD2A00EE9887552E4AD6EF9DCC323A5A25A5 KEVIN CROAK
1,666,231,750 *AF5DF4395A664432395507B1465AAED45C70CA0C [email protected]
1,666,231,751 *AF502BDC5ED1ED7C6959DEE2B59CD48FD5EE7393 kiethreposa
1,666,231,752 *AF5DA44D7FC9726CDF8FC8E1A01B4977D2917BE8 KIMBERLY.CONSTANTE
1,666,231,753 *AF547F0F8A541574A6B0F35CDCA867879E58D635 kirbydunemn
1,666,231,754 *AF5434BF79706BD791D659D6E3FC87EF6D8F8179 kirbyhofstad
1,666,231,755 *AF5ED85417721726285BD32DA153FB850C18552E KLANIAL1
1,666,231,756 *AF5B2E67CD461481BAD0A57CEBB74001135262A9 KROLUJA6
1,666,231,757 *AF582B02ED8ECA5C2910E8ADC37702AB7080B69C lamento di tristano la rotta
1,666,231,758 *AF5A5ABE96CB5972068C474D3AF103F25AA4F3A5 laquidaed
1,666,231,759 *AF57C903892E79C9C45F1C0389C61D57960C24ED LASHAYBERRY
1,666,231,760 *AF5C5E37DD0A9D6EF91FA916BC74742610AE580A LASTGEVERS1
1,666,231,761 *AF5979F6C6918B32BDD0119FC55EC6EB64FAA67C LEGACYBBC
1,666,231,762 *AF54B94484DA0F2E76B9D255BF8BBCBC1666F941 lehmannet
1,666,231,763 *AF5231EF4A8070D881B2B7555ED8F9D223044991 leistengiebel
1,666,231,764 *AF54F7F51D8AC3FEB5D67AD477BD0A5049BC67FD lelandeckhard
1,666,231,765 *AF5281ED9DBC5A29E1AC96474625800F16AACB8A LENARD.BEDNARZ
1,666,231,766 *AF54304D8BD2F6FF52A856EDA5B7848CFA021E9A leonardmarcaida
1,666,231,767 *AF5C690DE951A774D823234D7221870D35C696A3 [email protected]
1,666,231,768 *AF5668BE704663362BF7A5CB0B8FD7C48FC0847D [email protected]
1,666,231,769 *AF53276EF69ACEC7151D02598AFA3DBFE100C414 LINWOOD.ZAZOZDOR
1,666,231,770 *AF5DB09C1F96E527B18FB9BA697AD627F8748BD9 LIONELBRILLANT
1,666,231,771 *AF5364CADF23794481A4A75B3A9B5A15AFDE36EC lipseyyespil
1,666,231,772 *AF50CDC285E6CFD44956F83ADF0E6BF2239BB14A LITTLESCARE(THEETERNALSCHANGEYOURLIFEMIX:VOCALVERSION)
1,666,231,773 *AF5581D22262C3A6CBB4C91EB92C9313013C157C love7577
1,666,231,774 *AF55794B5D4FA46582E7CDCCEE722AF493E19C45 [email protected]
1,666,231,775 *AF567B2343FBBC013A731DF8FCDCFB9CE673AD27 [email protected]
1,666,231,776 *AF5F561BA8992AD513DBBDB4D53CD22697048E90 lwofitna
1,666,231,777 *AF5A75056ECC961FBA678CB178EF96828C43B3DA [email protected]
1,666,231,778 *AF556702D22C6AD36D21FC2D0AF6DFA81B163BBA MACIAHT
1,666,231,779 *AF5F64A79303454047D06BDDA63BD9CB4C988287 macombs5
1,666,231,780 *AF56F858279CDEB8E2C4249F7CED95E37E6E8487 MALLES5
1,666,231,781 *AF55550317DD7DAA8A16CDEF6CB9803E2C6BA0F6 MALPAPPERS
1,666,231,782 *AF5EACF6C4000E1C90F434B0C1D2EDA65220449E [email protected]
1,666,231,783 *AF5B5C446A75E32D88283492BF06F730581D68C9 MARCELLUSHILLAIRE
1,666,231,784 *AF50769739B44A34875F5DB2AB87DFA12C6EECC9 marcusperryman
1,666,231,785 *AF586819C7355DE158702154C33DFBD74216E56F MARIA.MILITO
1,666,231,786 *AF5D70216976A5E1D546108715E3E3C449E66811 martinoe
1,666,231,787 *AF5B172A98FBED9F17D76779AE99C0AE48335893 [email protected]
1,666,231,788 *AF5AB642AECA6677FD4EF0DC0166411126828B85 mauriceparmann
1,666,231,789 *AF580CDE7273C45FB4BAE1093BA7E9A71E792355 medtacex
1,666,231,790 *AF5123A0305FED7BF8A931FFF91928B3A1E9A133 MELVIN.KADY
1,666,231,791 *AF5A0FE80A5E5375EEB35D5049495EB062F34015 MERRILLCOGHLAN
1,666,231,792 *AF524E224579F19272F4518F35E6E0A81F71AE02 [email protected]
1,666,231,793 *AF52C96ADE127146F7ACABF9B497DAF6FCE2B998 michaelthrapp
1,666,231,794 *AF559B6840CEF14B9A7B8481AE24E0093FF11F8E mikereha
1,666,231,795 *AF51DE4E8A254FD7F48C4D473A63DC730EA1F635 MITTEMOT2
1,666,231,796 *AF53252E7008FF0D05FB34985513C13A8BEDE87C [email protected]
1,666,231,797 *AF511A26173DE632BF56A67559FB416C13204984 MODULERIEZ3
1,666,231,798 *AF5E8C1476A0C9850AD3DAB0FEBD109C7FA0D7D7 MUCH.EMOTIONALLY,.AND.I.HAVE.NOBODY.TO.TALK.TO.ABOUT.IT...I.NEED
1,666,231,799 *AF5FB2C5085E1060A43FFD8FF4BE6BC046E86E51 MUDFOLD4
1,666,231,800 *AF54B59560BBB3ABA156625EC3986E79C8D40ABF napoleonmeighen
1,666,231,801 *AF5229F80D84EACDECE63CF725D23D5C16AF8B00 NCUX
1,666,231,802 *AF52FAD5828E4152F2FE9565B32462825AE72FC7 NELCIAS
1,666,231,803 *AF5C03664875C81E16DA522F4DB0FB8BA4886964 netkanked
1,666,231,804 *AF5E95F0F6C3C4C515B5D229A52D3C773E32AF61 NUMBERSGROTHAUS
1,666,231,805 *AF5EBA031080C381388DF12B654D2B406A2A19E1 OBALAIO
1,666,231,806 *AF59A4DB560983D66D9D3EE955D52B2C28915987 OMKAADS3
1,666,231,807 *AF595F837EA7BCA0DBF15468F60C593D5B14456C OMMASTRE3
1,666,231,808 *AF5E8BCE57757F1EFA390B8CFF8C3769D0C85313 ONTKIESER123
1,666,231,809 *AF57488F4949FA78A793B2DF7D56E688DD3C5406 O>< O~ (####P
1,666,231,810 *AF5997A55EBA37B0EC12FCDD36D83D5EB62F9499 opustwo
1,666,231,811 *AF54D175A9E4F644C4C1430B082550A5F25D4B92 ORÍÌMI
1,666,231,812 *AF55878DDEAB24BF17539B23FE6351918A235F48 [email protected]+rc35
1,666,231,813 *AF53EAA4A2449861932CD0F4AC861380BBAB3D16 ostens«
1,666,231,814 *AF58C75545FCC5C64723C5DB5563BBE5BCAACF50 ousanee2
1,666,231,815 *AF58FD74A47E4C52DE80334075D3079AB99FE688 $p4ni$h.4
1,666,231,816 *AF5E643F854C870BFD90E9E3843E05FB424CD8BB [email protected]@1
1,666,231,817 *AF5BB239936A3B792B0903DC8D39ED2189A0F7F0 PAITARIDIS
1,666,231,818 *AF5EBA80B827203711B6B51A5939A6D26B3E11F0 „PÁNEM“
1,666,231,819 *AF56B64CD5FBEB824CEDE5C7E3C45B75A2A5071D parisholze
1,666,231,820 *AF5362D671995E133D52405228DD7C2B2D13702C PAS+IME
1,666,231,821 *AF58F11143F9BF786CEC72964D39498F16CC25E6 pasqualedormanen
1,666,231,822 *AF5B36E01C16E21673940E015DC565F2BD904347 patriciamcguffee
1,666,231,823 *AF5F9D5841962AE7E4F7DDA4A916809ED3342337 patrones-en-el-desarrollo-vegetal
1,666,231,824 *AF5B2324903BBA885F5814C028F5D589EFD94F87 paul-mc-leon
1,666,231,825 *AF590A6464A89AA97119B7318DC451BF0E74D49F [email protected]
1,666,231,826 *AF5C78904FB847F997E81775B6B8901593C9C599 pendlerzahlen
1,666,231,827 *AF562ACCE710008B5FC8F1ED2B9A7C927415F13A PERLOVSK5
1,666,231,828 *AF554F9E7D701397033A28C3AB5C79AAB7629CD7 PERRY.FEINMAN
1,666,231,829 *AF524A8CB77B94859F0C1267ED916D58515AA60E PETER.SHIKUKU
1,666,231,830 *AF5E6C108E094ECA91DCEC140264896F5D97D25A PH4RM4C0L0G1$T
1,666,231,831 *AF517A7D8FA98AACAEE0946DEBD9AC60EF51F3F8 [email protected]
1,666,231,832 *AF562A7C135192108DFB98885D6211B267C02EEF pirribsw
1,666,231,833 *AF5C6906CA064907026166DB51C92317771D85E2 PRINCE.ARCHULETA
1,666,231,834 *AF54468557CAAB08E2927310944A2977ECC1D8AD PROBLÉMARÉSZT
1,666,231,835 *AF518EFF194C46CE4F72CF090C3F866358CEC4DF Proctoscopc4lly
1,666,231,836 *AF5FB3120AEEF183CA8D3A2EC9092EFEB9A3A4F3 P==) ~ ` SPLAT!
1,666,231,837 *AF5A07380991AD93D068BD894D47FC7EE382B17F pyarkarannoon
1,666,231,838 *AF5ACA604551F5EE8215C7A5C137282BA28E536C qqbd
1,666,231,839 *AF5D2FBE812B1D9F15690F394CEE6922EF9FB045 QWERT7138
1,666,231,840 *AF5AAF1EA8B28ADE974546EE2B0B0800349ED5C1 RABBIRUBIN'SCOURTOFTHEAIR
1,666,231,841 *AF5C64E0F6A3AFEE5EC4D775B7F55529626F9159 RADVANY5
1,666,231,842 *AF5C63CF11DE082A753A8B8E6639B9FA1ABF21A0 RALPHSCHACKOW
1,666,231,843 *AF5F73D4DF7EBD9D798535DB7A063E0EB0B1A389 RAMON.KURZ
1,666,231,844 *AF5B09CC6A13F961289294BFF7297609C45F8F66 RAUL.ROTHE
1,666,231,845 *AF539132560ADF01FAC0234FC361A671E0A4B433 RAVENCOLLINS
1,666,231,846 *AF5D9311B4BB70F99A00F5F156F67051233C40A5 raymarknavarro
1,666,231,847 *AF567A78156F07E34DE89CF6E71234A388440D49 REBALED4
1,666,231,848 *AF5A5C942980554D9C17AF560C0D57DDF1E21DDB REGINALDBEGUHL
1,666,231,849 *AF500659FFC737D13ABCAB35227CED502FB19392 RETARDTIGRE4
1,666,231,850 *AF55050B86307D1D91EA83F2B9F446DAF635AA45 REVETSREBOOG
1,666,231,851 *AF50440FD99B154B3C8124DCB07753A6BBFD9876 rhatten!
1,666,231,852 *AF5F843323B1AADE1078A3199588DE346C1AC517 RĪGAVA
1,666,231,853 *AF579B37454F9CA08CA788E8D898EDA5815B8650 RIGHTO.THANKS
1,666,231,854 *AF58F031222852B107BF11115DBE683F274B8B91 [email protected]
1,666,231,855 *AF57F9755A5E739BE6F5BEA3B58C2ABD12068A96 ROBERT-BERTA
1,666,231,856 *AF55CB2A3BDE836A5F05C7B0651F95BBEB1CEFC8 robertcampany
1,666,231,857 *AF5E06B69001F0AD365203A83806DB0F9280FA07 ROCKERFERLIFE
1,666,231,858 *AF56D0D3898D1D5A856D6EE09D90E5D458D39827 ROCK-STAR---POSER
1,666,231,859 *AF5B772895AFE7CEB4FA3CAFEBC6C6E63AB77695 RomárioCésar
1,666,231,860 *AF5A562DBFCA7124A776278AE4A2414F2DDCEF32 RUNYONRUNYON2
1,666,231,861 *AF5BBDDCE05012337437A0684857ABAAA652527A RYDDIGHETENS
1,666,231,862 *AF54F574583A035D99C8FFE546C6B601DB825E1B SA
1,666,231,863 *AF5C26161B0D1B977AF8570057715BA611129083 saintbernard15
1,666,231,864 *AF51ED6978E003CDA9C61ACDA43B2B3E4A4D43FD SAINT-YZAN-DE-SOUDIAC
1,666,231,865 *AF5C5D420733975446E8B468DD9C8D41DE166294 SANG.SCHLEPP
1,666,231,866 *AF520EAF82FE1F9CA335EE9FEA1006151B757A89 satan-has-already-risen
1,666,231,867 *AF5C87688C6DFEE0570512C6A768AD92912E7A92 sc\1
1,666,231,868 *AF515D6F44B9035032A97BDE245C79529A068341 SEITIROINES1
1,666,231,869 *AF5EEC8C160FC5D1728A8A1FC76FA8FC833AF86B SENECTUOUS
1,666,231,870 *AF553395988978F012CD1F41EB3258ED116482A2 SEPTIEMBREOCTUBRE
1,666,231,871 *AF5B05A307A2606EB7D03019336FB2083A890F8B shirley412
1,666,231,872 *AF5B30FD41D4370DE57C92D866526092A63A44D2 SIGMOIDORECTOSTOMY6
1,666,231,873 *AF5F8EC0D961E3F0C2DB940AAA7F952828E74622 SISONGOHCYSPPING
1,666,231,874 *AF53C0255855CFB47C64396548E81A1430B2F29C SKIBUM1991
1,666,231,875 *AF57DCF9088B65D0B7B24320F70317D733EC9454 slapacich
1,666,231,876 *AF55DE2F023B2DBE545F61A70E9773F23EE4A5F0 SMAHDER
1,666,231,877 *AF55B9D50C515AB00CB4BCBEBDC3477997DFDEA3 small-claims-court
1,666,231,878 *AF572E473A0DC1F26ABE8EF6955DC2583B9F085A SOLOMONSARABIA
1,666,231,879 *AF5F53AEB7EC2C62CBED59077D9CEF3ECA808161 SONG.FIGHT.HOTEL
1,666,231,880 *AF50D262014826D612689BADFBA15F2E9EBE2144 SOSPIR »
1,666,231,881 *AF5FCF3799CB435DFEED276EBA1842B51433930C SPLAT! [email protected]====P
1,666,231,882 *AF5C51A5F565DD51717551F335D81122ACB26AA0 stadtsbibliotek
1,666,231,883 *AF5608066E7FFC3725CC9481C78B6B3AFC29E48E STEALTHSUPPORT0
1,666,231,884 *AF549680B8C5FB7802241242E7B54E362D987181 stephgary
1,666,231,885 *AF5761CF952D0036FE53B14696AC41C8362477B2 SUJEYDRAN5
1,666,231,886 *AF569D99BD91492B0FFCFD42F18F1708C2898491 [email protected]
1,666,231,887 *AF55AFF174BD2B87933937D19354AC1AB68CE431 [email protected]
1,666,231,888 *AF573B08EBF7EE8FDD2FF32B1EBC411AE029ACCA susan.trejo
1,666,231,889 *AF5522578A0EB703C45739948EBCC4D7EC250876 SVENSKKYNDIGE
1,666,231,890 *AF5200956629A780DC517EDBC2C3E51302634436 SVINTH5
1,666,231,891 *AF5179459133B84692F14CF97251CE9C0561D237 SWEETCAROLINE(GLEECASTVERSION)
1,666,231,892 *AF57F9E7757AC6C056E813A273D3548D28D2A986 T]]&
1,666,231,893 *AF5EFEF2FB306923E8EA3EC7FAFD7F0FF2450709 TAAPATSAT
1,666,231,894 *AF5EA0203BB04FEC15D7EBE6178F120B3ACC892B TALETNEDING
1,666,231,895 *AF5C5DAE8C5F077F04F9227A974C664FD3742C29 talkanglocelticcomm
1,666,231,896 *AF59835BEED84CA99FA8390ED482FED387CB3823 TANDRAKING
1,666,231,897 *AF58792A768C49AC8C3CEFDF7A8E1523D536325E TATIVARG9
1,666,231,898 *AF56A3BFCAD0E20CD3FBDEB70BAD6CB1567B11A7 TAVOINBSW9
1,666,231,899 *AF57847D4B5C160986EE40E98E6133736DCB1F15 TBPY
1,666,231,900 *AF57FE2187DF5CF0B6D8D9F830B160CB0EF6AA67 TGCATTAACTATGAACCATATATATAATATTAATCATTTTTTAGAGTTATTATCACATAA
1,666,231,901 *AF5351BD3697EF61B8CF0BFFE579E9293194F0DD thankshurricane111
1,666,231,902 *AF5C6B1E56DE4DB0DAE36ACF3151B2D4C7CA745C thebuchwald
1,666,231,903 *AF565D25038D8AF4DFE6A190B4893C8C15F97161 TODD-BOHRER
1,666,231,904 *AF5AFB8464FF82081F319AB02F2CA1B551C5ECE1 TOMODATI3
1,666,231,905 *AF5805E749146F401CCC206E3C3DED6F0B75D9FF TOTJEAN
1,666,231,906 *AF5381CAE29BD181EA3D914268D9EE482188F811 trädskulptering
1,666,231,907 *AF5AC96BED813E4E2AE550A92812A6A5C4A027C5 travis-lamance
1,666,231,908 *AF5D17F7D2CB0A3530B3D6304BF0C57D8B2D008F TREEZYBABI
1,666,231,909 *AF550DBC12E87E5831715444E4E80342301E354C TRICIA VASILE
1,666,231,910 *AF5E52B558578D14BDACB2D4A39754811A64A3C4 trinidadmildenberger
1,666,231,911 *AF5D1BA830BB49593363A73F37224BDFA7EC6A66 TUANPSILOVIKOS
1,666,231,912 *AF55B3058AD45BA7E1B6E53140FF0805DA21DD48 tubodec
1,666,231,913 *AF5A005B554D980E1CE64449368BA1936A19FCE5 TUIERTER5
1,666,231,914 *AF52C84EB2B9B635B27EB764F13445FE3F30802D tu-luz-+-su-luz
1,666,231,915 *AF5933A85D229D88C7A61D2D3719CA72F274F575 turn.out.the.stars:.the.final.village.vanguard.sessions.(disc.5)
1,666,231,916 *AF526136FCFF0F863C3053A71760DCED070D6BB7 TYSONTENBUSCH
1,666,231,917 *AF5C676F973AA80884F0B69D5A613E9C210D10FC UAASUTSU
1,666,231,918 *AF5D801490B9A86D106FCAD35D80C16211DDA9B0 UAEVENERP1
1,666,231,919 *AF5A5301F0C29E8AC8CD0CE652C76BAA5FC16599 U*C9
1,666,231,920 *AF572D65F7287BF374F38FA6665913E00398BF8B ULAB-RAJBARI
1,666,231,921 *AF5FE6C714811AB94B976C20BDE6B88A451E9D60 UMUTCANP
1,666,231,922 *AF51BAC90DB59C7041A4095B16F39328F3B664C5 umxwtvaeetvnn
1,666,231,923 *AF57163E48EA93C64590209F9162ACDEE205C0B3 UX8AAAAACAAJ
1,666,231,924 *AF5884CE07005E053EB3272AFEC06674211F835D [email protected]
1,666,231,925 *AF59ED2EC87B196486B2051983B616FCD129DD77 vankhang
1,666,231,926 *AF5B230E3BF025663BE021ABE9FE27E61C13BC6A VARALJAI-ROBERT
1,666,231,927 *AF572E82F0C3CCF2DBC7DE26D4798E23B89DF31C Verbid
1,666,231,928 *AF5EA4E91EA455A2FEF724E549E197BDFC3B613F VERNON.POLSTON
1,666,231,929 *AF5F17EE50E091114566E33828BC92DA6E674CD0 VHAN-CLEFF-PUGNARIA
1,666,231,930 *AF5BD07EEE0A7E26B520706D9146556FEAA313BC VI}A
1,666,231,931 *AF599AF28C0701459C8E02AC6342FA4BF703E7D3 vikali-holo
1,666,231,932 *AF573FE91282CFE8BF0FC9C3E14A74E03A0D92AD villechaize-belcher
1,666,231,933 *AF572FA7E94EDEF2C6537BE65FAB2028CC4FFF9B vintageclothes
1,666,231,934 *AF5C33370857205945BDA4473340EE361883B63A VNWVVYAR
1,666,231,935 *AF5892377F4C84F23E5C37B399B2EB68FDD53601 [email protected]
1,666,231,936 *AF5023903D79170A32AE1BE7048C2A7B4C5FCE69 [email protected]
1,666,231,937 *AF56110D36BEF41EBE4AD789DF858860E90AF850 WAGONCYSTERNA
1,666,231,938 *AF51ED55E99C3137AFBC10EF55D8ECB0E58DCF36 watergeests
1,666,231,939 *AF53E98204B480E8F34F2400F9DB26187101D3F6 [email protected]
1,666,231,940 *AF5F0BD7DEDF04DE3FD18EE71563F94F62CF26BD [email protected]
1,666,231,941 *AF5D1BEA15D0A7CDEB57EB8A5CE3886B464791F1 WEREAWINNER(GRANDMASTERFLASHREMIX)IMPRESSIONS
1,666,231,942 *AF5397E267ADB928DCBC8590E16252C5DAE9EFFE wilfordgraubard
1,666,231,943 *AF5C8904AB40AE4AC94F86EC795974CA9BDEF305 WILFREDCAPRICCIOSO
1,666,231,944 *AF513A6A03AABE79BE219DD30BB1351A0F75F864 WILFREDO.SINDELAR
1,666,231,945 *AF5E369020636BC6BF3B6BB2A05F2BA5BAD1705D WILLIAM.SAALE
1,666,231,946 *AF5F49C322BFE7E3317F0DB7A72F30A24107D8DD willybradigan
1,666,231,947 *AF51E584B759C41083FDF09524BC82F43FBD5EF8 WJS
1,666,231,948 *AF58DD31CAEFA357FB44C660873AC7C780EB42A1 WUHANPENJING
1,666,231,949 *AF5221F3AE947B87410A5CF399366BF5F0C2AC78 WWW.DRAGOMAN.ORGECBE
1,666,231,950 *AF5822650791905F05E81E55C98E8C4F3A1D62FB WWWRACHELMAXICOM
1,666,231,951 *AF53CF9AE105B678D474AFBC35723604577635C3 [email protected]
1,666,231,952 *AF50FEA561DBFC45B534507FB7969E56ED29198D [email protected]
1,666,231,953 *AF5B018B334B9AA519CB50B00911D425289ADF8E [email protected]
1,666,231,954 *AF553E2FDD61AB1D7B4E4021BA0DAEEF136F5232 XIENANXI
1,666,231,955 *AF59BA89E1DD0F36751F95C91B3B428B85199640 XRRRCBSGZM0
1,666,231,956 *AF5BB6B8C73732CD79437C97FF4C0400BA8510A9 [email protected]
1,666,231,957 *AF53E73D6EE05EF4FC6AF158669004E4DEB58887 yahayasuleiman
1,666,231,958 *AF531D6D477F445A020516F7704627EB4E54922C [email protected]
1,666,231,959 *AF56D31798C1C386467359A0754E630F55DB6D50 YESIESTIS
1,666,231,960 *AF5D29DEB60BFE178C91DF5D4027A69A563E3256 yhgdjzhrv
1,666,231,961 *AF5E8E2F27DD3711C707AA8EC01BC9EE1181FE19 YKSIHWETIN
1,666,231,962 *AF56ED82A737F842B1A2BC3EC959082861E2F92D YNEETKIN9
1,666,231,963 *AF553DB6BF0BD7FDA877B120826A367078FB5DE5 „YORCK
1,666,231,964 *AF5BB77A0E71FA1D657E4D945DDC03E812C734DF YSORETEH
1,666,231,965 *AF53BFA074BABAAAF584E5784918564CD3EEF8A4 [email protected]
1,666,231,966 *AF5C4C62C596F4AF8BF318C07034CCF8A88F4861 yukaridereköy
1,666,231,967 *AF52F11F46D7F910B79807670757241329036D7F zacchary-ritter
1,666,231,968 *AF54B80A7513A8CDC60B06586423494EC4D41165 zacherypratts
1,666,231,969 *AF5EE4B8D401244AAFB8188CE77387AEEFC9D6EE zalyanovsky
1,666,231,970 *AF58183299163CC93CA93553CE4E29A1C73028AB zeirviged
1,666,231,971 *AF596A044ECF40A4F127F449A919799CDD0E6A53 ZENON-STACY
1,666,231,972 *AF58FE30753E5F253C623FA26A9E8360AAF2E5A2 [email protected]
1,666,231,973 *AF5D8FF65C4A157C02580DD7B2D488B522E4259E [email protected]
1,666,231,974 *AF5B81E5C529F11C8CB664287C61CFABDEEDF6B7 ziggy-britten
1,666,231,975 *AF524066D156C84DC2E115102981B7FF6399D809 zoey.hamilton.hall
1,666,231,976 *AF5FD4DE9E53E0C046B4691C223DF1B5BBF7162D zurich(disc2)
1,666,231,977 *AF5DCF935B8830B69087A61BD77259B3D6722EA7 ΓΚΡΌΜΕΛ
1,666,231,978 *AF50EB03862F563F4C4D1D189D76BE73C38DB584 ЖУРАВЛЕВ
1,666,231,979 *AF5FC4293BDA162ABC4836CEC372B7B1E703B26F КОЗЕРБАХ
1,666,231,980 *AF5CC7E5EF9A5EF79B1FFA73E1954C126296283E ливаний
1,666,231,981 *AF58C2DEA2E1283C315DA87CC367B28685B9FF08 НОВОРОГОВСКАЯ
1,666,231,982 *AF5425A4B46E242B558DAFFDAE3FB06135B475AA острвице
1,666,231,983 *AF5BBA26F397F32F33D9891BEAF3E0E253A517FD 離開SIGMA
1,666,231,984 *AF5353262D05A11D1B1F6DDFC0D0067EFD5EAF14 080TORI
1,666,231,985 *AF5458C721E79E3D5A9DF8E2C8596112DC612B93 08101671
1,666,231,986 *AF5898AD508D480119E8D30485A5A08AD5EA9361 #0zn
1,666,231,987 *AF5B38F33DB62048701EAC480A77772B39CB485C 1054505 yleisesti dos-versio on perusk
1,666,231,988 *AF5A020A6E4B1C73D3D4B54F306CE2C53C05E035 12.GRANDES.EXITOS.EN.VERSION.ORIGINAL
1,666,231,989 *AF558C988C7F78E3390FE629E4B61E4BAF9283F1 1312508773522e
1,666,231,990 *AF5E65B320DCE3EF2722ACDC07A240DDAF5C6396 1378805 SATEEN-.JA.AURINGONSUOJAT.,.KIVEST
1,666,231,991 *AF505B36F91A31D8D910F8AEDD40B55EEED1F8F3 138735 die-sanierung-hat-bereits-begonnen-
1,666,231,992 *AF5BF5A93AFD0173F6B95427C6D84D0354FE6BEF 148930 hyv
1,666,231,993 *AF557143220A5708482BAFDC5A5474BEC4E47D33 1.abotarife
1,666,231,994 *AF55EC224A10D772764B42083C1F8C926CBDC958 1 AVAUSRAIDALLAAN
1,666,231,995 *AF57626F5EE46314D99ABE2492A587A13C688375 1FAUXLOFT
1,666,231,996 *AF554501770AC5F7B264FC6346F64EE745A3C1F2 1FRACTURS
1,666,231,997 *AF52C04AB50C149E682313D2B2DA1B021A525BD4 1-grosszirkusse
1,666,231,998 *AF5DEAB8F8107B9F0FC955713CB50DE4D075D188 1-GUN-MARIE
1,666,231,999 *AF5FB23BD71BBD71E27628F65F1F809BF6393342 1.HASTILY-ESTABLISHED
1,666,232,000 *AF5B4E6FB1964726497704C9959509A502A7F0B3 1-HEBELING
1,666,232,001 *AF5357A29157DE180B9E1932C3A1493D36B221E7 1IAMADVIL
1,666,232,002 *AF58A4DA90C06853280916070525242C6037D58D 1-JOUKKO-OSASTOLLE
1,666,232,003 *AF541559CB2E72469923EC9C4ACC442417AE5C39 1 LOGENTICKET
1,666,232,004 *AF5A62C7D38ABB56CABC767915A3ACE9ED414C24 1philosophenkongress
1,666,232,005 *AF5BF21E4BAE03D6185A49D66A2BA5449D24887C 1 SPANNLAKENS
1,666,232,006 *AF5CCE1AB0B7384E1171FF583191EDA4BAAC811C 1-SULKATURKISSA
1,666,232,007 *AF5E0857FC5D1E0B4F0FA7CEA7DA8FEB7CA9EC11 21-REGIONALRAETE
1,666,232,008 *AF5032A370BA1878C45FFB9E5AC3FD4AAB8BE5A2 22JAN1079
1,666,232,009 *AF532EDB1D7AD0E2CFD10F41E394078D8DA0F766 25fotoGraflarIna
1,666,232,010 *AF506B5CF61B9182326E48F4BA72DE216451F5D7 2683309 fehlt-nur-der-propeller-auf-dem-ruecken-.
1,666,232,011 *AF50713A828488890D0BEE3D4674078B3B709A99 28-RANDSTAD
1,666,232,012 *AF57987FF2223D6CF1D61F5C930715AA374EE044 2906619 toiminnanteorianjakehitt
1,666,232,013 *AF5B4E0286B35C0A1964B4995289C90DEEB26FE5 29N0057
1,666,232,014 *AF57F28D1E44AA2337DE44BC2C39B1CE59EAA356 2muscle6
1,666,232,015 *AF5D2F78443DF76A13B67A96413B143DD6D47071 321253 THETOTALLANDAREAISNEARLY200SQUAREMILES
1,666,232,016 *AF50B48DB439C635882A2375813BD52058177A24 3#B~}O{
1,666,232,017 *AF5AA20CCAF63CF6DF752740252D75358F766A57 3lymphsystem
1,666,232,018 *AF5777C45C5E7574DB5562E43093953F9798D794 [email protected]`~ `~:P
1,666,232,019 *AF52D44A77E7CDEAC3B30666612F3208D7E47425 3SUSCIPIE
1,666,232,020 *AF5FA966DEEF0E9745E2BFD6DA3E5B023E673486 41CHOBITS0
1,666,232,021 *AF524CF3A02BE0CF089593DFEFAF4AE7F8F49EE2 4:..4..#..&...mary.magdalene
1,666,232,022 *AF520FDB96D0342EADD34B5FD5B523098A46EC59 [email protected]
1,666,232,023 *AF5F2E04750DB31E9DE1B94016413F8E5212C6CF 4ESALCATEM
1,666,232,024 *AF5F5DDBE95FC21E30476AFDDCD4F779363683BE 4IERKINS
1,666,232,025 *AF57444E2E37A6E42A829C7A5A2910E0A2181EE2 4ILOVEDATABASE3
1,666,232,026 *AF58C5E862C4D29DC8CB4861AC0CB510CA35502A 4KINGNELSON
1,666,232,027 *AF5D729D70785F9ACDC2A0082C29F81901610EED 4NCH0RNG
1,666,232,028 *AF50887465332671779D4A48ED33AF81BE3B34EF 4-TOT-TAPAUSTEN
1,666,232,029 *AF5BEEDBD9E5CA41B5D2EB8D82D77275C03DBD2A 527041 dominet-,-1995-yilinda-kuruldu-.
1,666,232,030 *AF531E3C9B5E1742B2A5D19B5BA23BAE955F9FD2 53-HETZT
1,666,232,031 *AF5D4AE6A9D479191673025350FE675DB98FD004 5BSWAPOPKABSW
1,666,232,032 *AF54D9535C27A9ACCD81EB0E5FF98DA9A745F925 5BSWITCATLBSW
1,666,232,033 *AF5FF0B7BE7BB2D35AFF6FB0366B6F05F785FDF9 5CEILEST
1,666,232,034 *AF548B06310DFC7509D9F784335C657A709D13F2 5:if($integer!~/^[0-9]+$|^0[xx][0-9a-fa-f]+$/){
1,666,232,035 *AF5B95F06E61136648B660BF463F2BDD6E39538A 5MARIAGEIS
1,666,232,036 *AF5AAF7EDD74C6A85A495D293C129C047E0E84D4 5ORCHIDSNOW
1,666,232,037 *AF5F690AD99F8E70F2048AF99DFCDB1B9F2F223C 5REMEMBERKAYLA
1,666,232,038 *AF5ACF23466BA56CBF04C3730FD2FB128E71179E 5SCISQUE
1,666,232,039 *AF54C4E1223669DE7A63BA7F2FC1D4AE64908CD8 5SKOUSLA
1,666,232,040 *AF514D900941DCAAE79A67B974EF20C535A9599B 5SLACKERBRUTUS
1,666,232,041 *AF542E5643760425504E84861A31F011EC04FD59 5USTISNOB
1,666,232,042 *AF5B63D85D121E2AAD9556B68FD2108BCD827B32 632495 iloveplayingmac.
1,666,232,043 *AF5389FE0707E7F7F8BA8A0E60A6CF0102798D7C 683KAREN
1,666,232,044 *AF51ED2C230757375B3AC8BAA9DC045B72048A84 6ARGUMENTSPECIFIKATIONERNE
1,666,232,045 *AF5672E342DAA2C562F4A1FBF18F418A9A269B13 6-epistemologiasta
1,666,232,046 *AF5097BA7083D1355070A42E465DB39AC4567659 6FILMATAA
1,666,232,047 *AF5CA40E37AE019C3E3CD0361C9BEC314925E775 6MARKTWIRTSCHAFTLICH
1,666,232,048 *AF57E1D047CE750AB0BA696ECCEF55FE825B59E8 6montreal4
1,666,232,049 *AF5DDD00222CD4EADDF867B659628479209BB6F1 6POLARISKRISTIN
1,666,232,050 *AF563FDC135AC2620D82DA6E25A0D426DC1F967F 6SASSOLOK
1,666,232,051 *AF58EC882BE4D40C83DB5977A6B2F963B98F9F57 6SESQUITERPENOID
1,666,232,052 *AF5222D89489B3E1FB0A693DE4BF5E539B26367A 6.silindiGinde
1,666,232,053 *AF578FFE21098F7C275FA0ACA18488CFC75F6058 6STANDREADY
1,666,232,054 *AF579723765CF2C0B248399CD966146FCF406B5C 78ENTROMETIDO
1,666,232,055 *AF5C5B33F8538E533642F3EF52B6C94C1413A8E9 7BQSJYRKF
1,666,232,056 *AF5861FAA066566BB79778CA8C8F809AAA7F65C7 7DELAYCAESURACATHARSISCEASEFIRECIGARETTE
1,666,232,057 *AF57B833E69CD365D30FB0D21DCC17910BD47E48 7IAMMARSHALL5
1,666,232,058 *AF5AD046100EDC5D9DB76544B356D4CB35124D5A 8AIUJS49DJH3YC
1,666,232,059 *AF5FF1B8927841156FE6F849149E25CFE283342D 8B.*.*.*.~0~o(>_<)
1,666,232,060 *AF5837BC018C0F593C20908691CAF5BBECC2D7B5 8CINNABARITE
1,666,232,061 *AF5B6C6532CD214D289D506FCA6D78F69C0F2461 8COLNETRBSW
1,666,232,062 *AF5883D3E7DF15C6520F7997BE84D26B5244EB6F 8FARANDNEAR
1,666,232,063 *AF54964C3630B9D460BE61483F5C730A2AD01115 8FEHLERTOLERANT
1,666,232,064 *AF50382F2BFB6A8E16D177D12E1BCF7DE6776E7F 8ISSAIGGAS
1,666,232,065 *AF5D6F00039BF09F0FD07F83C390E2AC139A83B4 8KULTURGUIDE
1,666,232,066 *AF50FDA9FAFEB635DF91E103097C86084FDB07FC 8NOITACIFILLATEM
1,666,232,067 *AF51112694F01CECDEB5C79E3FEE2CCDDBAE9796 8====p~0-~o{x}
1,666,232,068 *AF50057ADD90F4ACC910C69525A12988C6AD7E2A 8)~~~splat!
1,666,232,069 *AF53A6AB7BECB7380297F9AC9FA0FC2CBF0DC9D7 8ZACHARYSKIPPER
1,666,232,070 *AF51834CF52A37DF0EE5DE850C5BED3D6CAD3B5D 974313 DIE STRECKE IN RUTHE IST SECHSHUNDERT METER LANG
1,666,232,071 *AF5F19E00E3A96E93C8305156EA86530A3206C7A 9BSWSCREENDEPTH
1,666,232,072 *AF51ED08043BD5F8665C72AE384D093B4BC0D15A 9BSWSZAKSZERVEZETIBSW
1,666,232,073 *AF50224C4381EE6B6276748C2F64D572C16DC824 9IESTLIER
1,666,232,074 *AF51409DB7005034A6919B5489D25F6329A7BAC1 9ILOVEYVETTE2
1,666,232,075 *AF5BE51A98B6C8C6270497A403ED0BC1F02E8F73 9OA+F!SH
1,666,232,076 *AF51240F8AC2BFFA92C05012D26C54F9926A6E80 9PATRICKJAZZ
1,666,232,077 *AF5A92F1F90C22EC4DDF600707F7A3609D943FE4 9SRETUENK
1,666,232,078 *AF56ADF183386ADF59CB7D5B0030D857189A92EA 9TJGCFCG
1,666,232,079 *AF5093F59B1D7126EB97F9D412DD12A06AD14037 9WAHRUNGSVERGEWALTIGUNG
1,666,232,080 *AF513D673BCBCFC98C90D17B1D2D6E85B2C5935B A+::
1,666,232,081 *AF5B84A2E9EBEE96E6C37D9141D0D850ADB4D457 A2=TU
1,666,232,082 *AF514E7EAE623C8EE4F2254F1DA4A4036C0CDC65 A7XNU
1,666,232,083 *AF504061305DAF3F8B0975E598B3660AF24803F1 AACIBT
1,666,232,084 *AF59DE231A7F22E21826403CF45C9977364D7AD5 AARVON
1,666,232,085 *AF523EB40DDF4CD6DE7AA3D03E0DBE39D5F3116B ABSTRATOED
1,666,232,086 *AF59E8AC3C12562CF375086067D651C35F1145FA adbu9
1,666,232,087 *AF554D841BF207628A0D2DF2B442D578E8622D7B adnk_
1,666,232,088 *AF5A47F8FD58F4158697C0F09673C36070463908 ADPM
1,666,232,089 *AF5C330C65B914876C6C1AE59D72697259382A3D AE1SE
1,666,232,090 *AF5C77A98DC48992DAAFF84D2A8311D6EDDE6882 AFFICHAIENT
1,666,232,091 *AF566E5A83D20C2370E5CA03381C1DD9E902F951 A&H9
1,666,232,092 *AF5743C86E3794D742CB788C60F5C879EC47002E a)k1_
1,666,232,093 *AF526E7C757ACFEFE5A6F400070944D478738CC0 ALADWA
1,666,232,094 *AF52379CE74D905FBBABFD99294BE3BC7CDDB0FD ALB MAGJI
1,666,232,095 *AF58623A6761A3F3E2D5976A411CD86FAF36CD74 ALCUINIENNE
1,666,232,096 *AF5D62D9C25F599154F1BCEF242BFE5480DC671D ALEXANDER.CSUHTA
1,666,232,097 *AF54E6BF48523FECD381D4A6948E3CE20BDE1BBE A%LFF
1,666,232,098 *AF543536C445452FB0E507E3FBBCE9C0E3F1588C ÁLLCSONTJÁVAL
1,666,232,099 *AF5A6912F55BB20B2DE8CA8B0381FF6E65104BC2 ALLF
1,666,232,100 *AF5885C93B9BCF802D06AD4BCCF979829264980E ALPHONSE.PLOOF
1,666,232,101 *AF56CBF10AD7402557091BE268B7CC04CE342CD4 ALTON.KOOSER
1,666,232,102 *AF5C0A332F7890B40318F73433B80DEFD9B86A89 ALU
1,666,232,103 *AF575291EFBCCC807A3A6A1994D06D7E0EDB0A50 AMBEREESH
1,666,232,104 *AF5DC1A8B7E712B80AB92A0A00ECD95D532E2CDD amistadstpolicesuspectit
1,666,232,105 *AF5BAF317F7248D3E23A66228F966737BF86BFD0 AMOSREMMEN
1,666,232,106 *AF5C8F1AE006737A37ABDD2B05323AB4F3E69510 AMULN
1,666,232,107 *AF52EBD0DB74D89E32FC08BA4BBFBD94519C84BF ANGEL CLASS
1,666,232,108 *AF5693022529F32B1B5A35606E91D1CEBB439F39 angeldepetro
1,666,232,109 *AF5B96975202F4519FB210A2192583079AA592EB ANHAEMOLYTIC6
1,666,232,110 *AF5B1E07B1CB97C90AB60E34F636C8049D7A3818 ANQO8
1,666,232,111 *AF52DE3D2584DD9C8174C8BE61F1D87EA7828C91 ap+3(
1,666,232,112 *AF5714CE7495BF77B6C053983634011C7CE4EA49 ARLIELINDHOLM
1,666,232,113 *AF5E60046E1FF500C0B1514FE7862D8771ED297D ARNOLDOWISENOR
1,666,232,114 *AF5B4596DA5F212CA1D53129B9FA907E9A9D8A96 ARONBAKERVILLE
1,666,232,115 *AF57931730EB25D8AF95001215FAECE023712B04 ARTCLAYPOOLE
1,666,232,116 *AF5A00F8C088B428571CB6D4396E8394EB097E0D [email protected]
1,666,232,117 *AF5F0F147FBE3B106BD7346456FC71246B25476F asd(b
1,666,232,118 *AF5508F0C8EE34E58132327E9D843E49986B07F6 ASHLEYZAVALA
1,666,232,119 *AF5E8745F5F3C25F39EF647053DCEAEB811ED294 b0"ht
1,666,232,120 *AF5031716BB00C555F9E2F6A8EA97CF725E44BF2 B2tl
1,666,232,121 *AF52C9091957A8A4F14B13FB6535ED4745A7BA33 b6-lk
1,666,232,122 *AF54DCD790670B8F06A13C593A08A6E9152727E6 BERTRAMOTTIS
1,666,232,123 *AF581965D78A5F59DCCC60ED96F00616F1A69C2B BERTRAMZINCKE
1,666,232,124 *AF5A43653C8889D6C84D159CCFCF0D1C0AA630E3 BESLUITO6
1,666,232,125 *AF5C62F701AD9722DC415B4B08593DF3EEE2DD4F b;ewm
1,666,232,126 *AF525B17EDF0B8790964DAC692B2B706679B3B46 bh=8
1,666,232,127 *AF5BB5D4A54EFDB3CE5F667053FF5677DEACC7A2 biru.langit
1,666,232,128 *AF5304F25C03C5DEB7644B117762E3259DC78082 BJWEF
1,666,232,129 *AF5482EDC9AF4CE5AFD39DE19D34D0B091E10594 BLMB.
1,666,232,130 *AF548F5D49E4FEA4E5F9C212BB63E29C789774DD bnvqc
1,666,232,131 *AF5EED3DA126523EFF7040EDF943C869563F1344 BOOKERTIMSON
1,666,232,132 *AF5064642D174EFB70F068D76FB25F548A86367B BOYD.CORY
1,666,232,133 *AF5A718A102386720B666AE9321BC87092A6BFC7 bp,
1,666,232,134 *AF582DEE1ABD555F78082ADCF37FD572910BE450 [email protected]
1,666,232,135 *AF59292C0388A1A558DCE59FF365730422FDA011 BRET.MCCOMMON
1,666,232,136 *AF59C71E3775487423758505AC277394C33F3A82 BSNKOVI6
1,666,232,137 *AF570E67183DDE209ABE0314BCE5B02E4EE1C1C6 BTGJC
1,666,232,138 *AF54BD38C09A97D507DFB8A4A0713A5C8C43E424 [email protected]
1,666,232,139 *AF5B915D06C399A6FE26D88539CAF545BD974AC3 BURRO.CWRU.EDU
1,666,232,140 *AF5717F13E380E544D0F4CB0ABFFFD3FEC56AB70 BUTTERMILK?
1,666,232,141 *AF5158424F9AC00412540B5CF4BA25484B68EB87 CARLIERIVERA
1,666,232,142 *AF5746AB3A7B79149D6882E8943F5AFCC5B82658 CARSONKITE
1,666,232,143 *AF58A3D27B35BC10ED43BB2FE9C2CFD44A6AFA89 carsten133
1,666,232,144 *AF5847C00F19531CEA8937B21DB6D1B2F9804254 CASEY.PEELER
1,666,232,145 *AF56EAB024015917D222F4B4056922F58F5DB544 CAUSTIC-VS-INTERFACE
1,666,232,146 *AF5CEF6FCD46A700FD82F9AC7D298BDDBD03903A CD#LY
1,666,232,147 *AF5B54B3A02F3A0888607D05CECAFEC2384A1D50 CELESTIONG1265HERITAGE
1,666,232,148 *AF552C70C7FF2BFB2B2C35CEB1E495BA3CB1D297 chancebranaugh
1,666,232,149 *AF5B1EA7113E90A863ABA611937E4911A1F890F4 CHANELSWEETIE
1,666,232,150 *AF5E1C176481CBCD17A3E465B39F2724A1059368 CHENPIN.BBS
1,666,232,151 *AF5C2F665F40B819F801DA48601E4425D4AC8A8F CHGUU
1,666,232,152 *AF5F51031C5134DCBF7581825AC65906929EAD0F [email protected]
1,666,232,153 *AF54AACACA8C92B4044B8F0096D3DEB3B307C3BB CHINASTUDYCOMPREHENSIVENUTRITIONIMPLICATIONS
1,666,232,154 *AF52FB8473DB5E0EFA7934B3C13B8A38D5653B21 chousedv1
1,666,232,155 *AF54979AE465E5D9E441C2AA1720591FF660313B chris.kardos
1,666,232,156 *AF5DEFF9770A0B3828F9E87DBBDAEB10272D00A0 CHUCK TRAVERS
1,666,232,157 *AF57D2AAF1CE4DBA4B65957AD672F39F9D57D505 [email protected]
1,666,232,158 *AF50321AED134AC46A2E1E4131B826405337AAB9 ciicb
1,666,232,159 *AF5B62443428B32CA8C3C67A678B68045019A5D2 cj&m)
1,666,232,160 *AF56E196223664259C5BD8C48867AFD6FE661809 CNCKT
1,666,232,161 *AF5E39A86559F8A91469F8D8A93FB735FDBBB6F0 cnlag
1,666,232,162 *AF587C03428C63815C4BCCAA9D656E4710315B4A CON6%
1,666,232,163 *AF55F22969F0D498F98708C9D89B9F879367EFC8 CORDELL.AICKLEN
1,666,232,164 *AF577CAC8745FC1FB2E815F30CFECBD90747027E cordellhiga
1,666,232,165 *AF5952900AE4A4340D4F718287AB90B4B2E4983C coreypaduano
1,666,232,166 *AF5F274071129AE25E93009714273BA731DE4B71 cornellsampedro
1,666,232,167 *AF524A15A9499CFE656113FD68F39A75DC0DE99E cot,%
1,666,232,168 *AF5A72B57AE317CDCBE1E94EA807F9ADA80C65E9 C.;TNYSQ
1,666,232,169 *AF5E884C8D9FE50C9E1D0D8AD9319DD146F265D4 CTVGE
1,666,232,170 *AF54AEF30889393753DD9E86D6D087BC99987012 CUE7N
1,666,232,171 *AF515A844DDC537808955615AE7BBDD20593FE4C cutejen22
1,666,232,172 *AF50B48680AD865FD71C2D0D5B5473B83A15B4E0 DANNIECREGEEN
1,666,232,173 *AF523CA478E09E05F2EA0A2BA752686AA31D1874 DANNYXIA
1,666,232,174 *AF583A01038F692664E42CF4A476FE273F21C5B3 DARIN.NETROSIO
1,666,232,175 *AF5B1BBF901080D967D8C8E65E4241A284280CBE DARKPORTAL3
1,666,232,176 *AF5AC6ABAF59A342506C50B27F63EFDCDAE7FAB3 DATE250806
1,666,232,177 *AF555F85360B02A0435971E03557CC4E19DADCE7 dbamo
1,666,232,178 *AF55F87D3677FAE1A3D3924A2F1D52F771E44777 deer.76
1,666,232,179 *AF50744BA9983510A339C22FF1DE62AB0CA0BBAB DELMER.KUZYK
1,666,232,180 *AF582B3A970F46DE4276F6CADDE643E920B641C2 DELMERNIVEN
1,666,232,181 *AF542B447A490CDB7A8DEBEACB5346CC678D7235 demetriusfigueira
1,666,232,182 *AF5567D08AA2A02F344DFA0B0CCB2BF5B333BF6E [email protected]
1,666,232,183 *AF587073D96F1E83D5B559585A273EC77E6836DA [email protected]
1,666,232,184 *AF5810C69596A5FEC09ACB223763452ABC7B8CB2 DENISHAWILSON
1,666,232,185 *AF5AC8CAD6F9B0A5B4E08B580B8B5F597BD96CAF DENNIS.WERNECKE
1,666,232,186 *AF5F3033B22C10B6121AF1AFC55703C89961CE3A DENTONKILBY
1,666,232,187 *AF5F3033058120847B0FA7BF1B6C1065E54670DF dereksekuterski
1,666,232,188 *AF53810CC6F3DEC45F8DF17ABA8AB5167BE3AE3B DERICK.BUZIAK
1,666,232,189 *AF546C8DFDF2F83A98969D9E7862612B21D17F6A der sommerfrischler
1,666,232,190 *AF52E073579611CBE0FF304DCD0E25D895BCA0B6 DESCRIPTIONENCREATE
1,666,232,191 *AF55E235F7068C9AE00EB31CD76BB538E5CD8C29 devitalised7
1,666,232,192 *AF5CC7516426E1B717B7738E7BB3027B68248E1F DFH:5
1,666,232,193 *AF52D402AD20EF259F18DEC8982524EC9E28272C diiodid2
1,666,232,194 *AF525A06CE106796369540EA4374F0A48DDF8C34 DN(UR
1,666,232,195 *AF5365F4095FD15EEADA836870D8CBF71A32EC9A DONNMENDES
1,666,232,196 *AF51366A231741F30152D01FC8D5201DB7F9F9C7 don't-give-up-(copyright-live-dub)
1,666,232,197 *AF5134827D2BA1F4C05F1E016D26EE43D2F5D07B DONTLETGO.COMWWW
1,666,232,198 *AF581FE9A05307A50C51CE4BE93AC3DFD36E98FA DP4M
1,666,232,199 *AF5D3570E2FC127C406695949F33BABF6EADC907 DRUSTS
1,666,232,200 *AF56D9D3E4EE977DABE204FEA3509C7DCE7A94A9 Du-e'-flickan-f
1,666,232,201 *AF56FE0E136E053B4AF7466E4482B5219AA2CD96 d+v$h
1,666,232,202 *AF5D7B8257C5ACF39F958504A56E1ABCA1720F3A eb(dg
1,666,232,203 *AF50F6EAA24D70496D6035B1675928B8E4B99D8E ECNUL
1,666,232,204 *AF506B1B6E6FF3A40AFDABB4954B5980C76CA54C edwardowarnke
1,666,232,205 *AF53411276DC4A2619E624A2EC607110B76F53D0 EDWINANDERSON1234
1,666,232,206 *AF537FFB914AB781A59B58E2377818EB2069E0E3 EEBA
1,666,232,207 *AF5F30D18D82323A2AF3690046884EA1BBB1F390 EG#XA
1,666,232,208 *AF58204BF27EAC296A27F0FD1A6F556152ABBB5F ELDENPADLO
1,666,232,209 *AF563C87AD7B5E64D26A893D4D00AD0EE13DBE7F ELDON.MICHAELSON
1,666,232,210 *AF5A66A9A5867435BB03B6D639BC03163C9E7887 ELUEHSOL2
1,666,232,211 *AF5C9056074FC7BAFFC15DE218E0DE94FAE9CBE4 ELVIN.VANSCHOOR
1,666,232,212 *AF5D967C44504A23DB2ACBA7EB9EDFE73535BCBE ELVIS.ZRAKE
1,666,232,213 *AF5D2A745143C2585E6ED8D4710117EB4AF94733 emeryryzinski
1,666,232,214 *AF547CDAF913C5C27240693D70C801D4A28511C6 EMILIOSHAMONSKY
1,666,232,215 *AF5CD86B04EA70CCF35EC2E736C19B167220F9D8 !emocyehtereh
1,666,232,216 *AF589667CEBF952F9E9FDB9F2E78B9F92B3E53E0 ENJOINDRIEZS
1,666,232,217 *AF53AAC5CDC70DB29B5D789D43CC730C0E6A096B ENREGISTRAIS4
1,666,232,218 *AF55E7E004243C9869C1FB06AE2D1FA4B0FDAABE etalunips7
1,666,232,219 *AF5DD4AA612D58E96C163BFF8BF880E38D992B7F ETSAN
1,666,232,220 *AF5908C04F9FB951ED0CA2D1410E2163EF46D2AE EUGENEROZAS
1,666,232,221 *AF5BC41AFE4CF0F16B676F6EDDB31D9F980785DD EUGNOLEN
1,666,232,222 *AF5A4153304997117E5880F438CA389439218AC1 euvyc
1,666,232,223 *AF538618EAED0CDCE954FE726B838CFA7A19E30A EYJABÓKUNUM
1,666,232,224 *AF554048BAFD01B8FB9F8525DF4259ED64022BE5 eyn+l
1,666,232,225 *AF5EC0C66ABD6FCC2826CEABC12CCA7B6EA8965F fatback-(long-version)
1,666,232,226 *AF53DF1AA9AADA06AED765A992E3537146833FC7 FERDILLANL
1,666,232,227 *AF591BCF7430A6425524BCEF53CA6F249F8C2863 ferreuxquincey
1,666,232,228 *AF5D6D0DC442456BEB3B6CD9A735F7CD5F5F70AB filibertobour
1,666,232,229 *AF554B5F09632CEBC5005757A73800D1F44746E8 f;,k
1,666,232,230 *AF52E7408696FAB94F1CD7DCCFE5235C6ECF3A4D [email protected]
1,666,232,231 *AF5A316567ADAA7A86653F0D5CED132F6B1A97A3 FLOYD.SELVESTER
1,666,232,232 *AF5330A5D48C0D0E5394D682F196C9CA3E3CCC9E foodyum1
1,666,232,233 *AF5998B822FD222F3A88523AC6D85C1B094D1E0D FRANKIESHEPHEARD
1,666,232,234 *AF579F3556B1A74454A72161783B473D75340749 FRANKKOTARSKI
1,666,232,235 *AF5140F1C810738DE74948E1D55798EBF60B50D1 FREDERIC.ALLYNE
1,666,232,236 *AF5F934327129E21BBB68382ABC333426C9C4B9C [email protected]
1,666,232,237 *AF577908BFD13547E3F5B6EB7170022670DF6BD1 [email protected]
1,666,232,238 *AF56E42A08A96AEC464475802ADFFC2778E3B774 FuckBigBoy
1,666,232,239 *AF5CB598065B79D98B895EC516FDC87E150FB5A9 [email protected]
1,666,232,240 *AF5C11DACF22B9234E3A180AF94ACF87959E8D6B GARTH.FLEMINGS
1,666,232,241 *AF5185E634506B924A3494349062582038BF2233 [email protected]
1,666,232,242 *AF57B6874B7FD2A2D4A52229EDA9A742AD7D7E2C GARYMANY
1,666,232,243 *AF5EA0EBC12FD61A791B5888E6181CA2EBE843E0 gd*@
1,666,232,244 *AF5EF6011D5DBD7158FB664585DD8D91DDD38D61 geraldclure
1,666,232,245 *AF54EB769E51CDC00CC92E8D0FE882F0F2018520 GESTOOK3
1,666,232,246 *AF5C6712F4231FB05596E22D15566D8EC1E327C8 GETAWAY(AFROCHANT)
1,666,232,247 *AF550CDEF2DC92EDAE35E2FB34DDB09A1CB3A84E Get.It.Right.(feat..Mola.Adebisi.&.Sqeezer)
1,666,232,248 *AF5F92368C0BEA7A03C68ED71AD69C85980EDB54 ときめきメモリアルGIRL
1,666,232,249 *AF5842B5C89AF6A13050A0F7E0CAF5C6E463D697 GREEN0207
1,666,232,250 *AF597105A2A7A48D9C304FCF317F3BA9095B9E3F GUDENBERGEN
1,666,232,251 *AF5A17255FC13E85F51DCCF353E6E520ECADA943 [email protected]
1,666,232,252 *AF55821F476DEEADFD6E13FC004DF6806323C25C guide-to-latin-dance-rhythms
1,666,232,253 *AF58ECFEC4F035B5530CF67ADAB1641FBDE7260F [email protected]
1,666,232,254 *AF58788144B63EF06E0A15E9A745630D80EA8756 [email protected]
1,666,232,255 *AF51202F4B7E645A1B504B0E4BFB356D003723F9 gustavoreppell
1,666,232,256 *AF590D6516E4E7B1139B46BA1F062B6645B8CC87 gwynfas6
1,666,232,257 *AF5A78564C0E0C5EAED99A5C2755DBA223EFAEE8 GZFOOXWX
1,666,232,258 *AF578203DBB4D7B362D2CCD67D79650E5A32F8FF HEATHZUMSTEIN
1,666,232,259 *AF52DA0B0819D9AC297A2B67B4FD271620A6ACB3 HE.BROUGHT.US.(FEAT..BARRETT.SISTERS)
1,666,232,260 *AF5E1D1DDADDD16AC7D9AC72643146E452C16B28 [email protected]
1,666,232,261 *AF57EBEB132982373A9D3BF23D64DC5B1D895660 [email protected]
1,666,232,262 *AF5D5AED2A8F460787D0933B780111E86D03043C herbmio
1,666,232,263 *AF515DD012FC8B52CF27E553E8780A1E8BD89BBA HERSHELBEIER
1,666,232,264 *AF561D7ECC2DC6E8B1A7E9406426B2DDBE65D4CC hillbilly-bone-(feat.-trace-adkins)
1,666,232,265 *AF50EBCB0C96ED0FD84534093FAFF9379945B66D HILPEYS3
1,666,232,266 *AF594C2195799BF85E0F48CFCD9B838DD1A3245F HONESTIOREEN
1,666,232,267 *AF52F661D3155A35713C41A71DB804FD828E5DB3 [email protected]
1,666,232,268 *AF56B58A7348D0424119F371683CEB74BB1CA89F HOW.OLD.R.U.(RADIO.EDIT)
1,666,232,269 *AF567B2758E6E938ED546D11937B7DA32ED21C68 HTTPWWWTERRADRIVEN
1,666,232,270 *AF52802A8AED060B59A60C469E44857186649BC9 HUGHMARGULIES
1,666,232,271 *AF54B27A9CE45B4C3EB215BC78B35BB71745F4DA HUGHZAPPAVIGNA
1,666,232,272 *AF5DEB8F0DE812D4EF7A4BCB01B6612CDA72665E [email protected]
1,666,232,273 *AF50E882BFD5D47C5C81B657BF9F587A95FBEF8D i am a witness (the strike boys' danger dub) (feat. emo)
1,666,232,274 *AF5458DEF69910C0645A4D14329E11C88C9E1ECC ICHAREROED
1,666,232,275 *AF5589E4289BEAC99EF082AC66D48C95CD7993DC IDAF
1,666,232,276 *AF5FD4C1C2A1A9FACBE5B472A1FC1007C93FC4BD IDIOMA.KARELIO
1,666,232,277 *AF50D311B8844AC1C4A3E5DCE9CBE00237DB3225 IEHINEEN5
1,666,232,278 *AF57CB301FBB1B0D15743E2503B1AECE289520ED ifrah.sheikh
1,666,232,279 *AF570F5DCB8A17A87E23AA1515658D968EEB4C5D [email protected]
1,666,232,280 *AF5FEBD02E80DB23DF762C4A8FD590B065FC81D7 IKNOWTHATYOU'REHIGH
1,666,232,281 *AF56C5839E862223A507CCCF4830CC423B897BE4 ioi[
1,666,232,282 *AF57687157F272CA6BC7622F67BEC32FC8D373CF IRFANKASHMIRI
1,666,232,283 *AF5E27290E4589B04BCF67B917393CDA9B06125B ISAIASMATTHIESEN
1,666,232,284 *AF5718A16CAC156B75DD2073E70B5F78D0FCA70C istanbultobelgrade
1,666,232,285 *AF56E1FC5F7DF0C30E2C4B41859314BDE7ABD9BA IVAN.CONARD
1,666,232,286 *AF57CDEDB3B553514603F26C6FFF2099D1DA56FF J152658
1,666,232,287 *AF58030F5369D53C4DFCD822B949688C5B850137 J83365
1,666,232,288 *AF50D4B483135C72C6DC6BA356CE00615660A812 jamaalsonkin
1,666,232,289 *AF52DB0D3F8B7AE6F7472DD41DE85596CA55FE15 JAMIEREZNIK
1,666,232,290 *AF5A4052A889C9F9EBC94F16914EBB3C44B881C4 jarredjimmison
1,666,232,291 *AF52313BD9E8142CBBC2C7495BCD6ACA3DEDBDB1 JASON.CARILLION
1,666,232,292 *AF549425DB84B72B33F44D223632EA0144F1CCA6 JASONYU
1,666,232,293 *AF557C1D4318116B2906B07973A15811E405BCDF JEROMY.BOARDS
1,666,232,294 *AF50953D8035F2B09DD6D6CDFEEB4D6ED106FB01 JERRODHLADIK
1,666,232,295 *AF5453F8EC7754C7B4946EBF8D5D37921F6EC9F9 JERROLDWILSON
1,666,232,296 *AF56363E73A457A858332B8D2B6289F40A94249E JERRYVANDERGRAPH
1,666,232,297 *AF576E412695103B22F65C4AD33217293D56BBE6 jessformento
1,666,232,298 *AF5C06260AC59F3DD2FBAF99A03C5C853A5DC72F JEWELSNEWS
1,666,232,299 *AF5678A5B7EE2319D21CE2393EAACA4267D756AC JLSMAC1
1,666,232,300 *AF527154CEB6A20D2903558A377E6D38E3208838 JOERICHEL
1,666,232,301 *AF597DAA1104EC17B21E7E14CE7086D252ABDDBF JOHNNIE.TREMBLY
1,666,232,302 *AF506E4BAD7DFCBCEC29B7193048D04AB97EFE4A JOKAINENSAARAKASTAA
1,666,232,303 *AF5DE7F1C1225641520D79423B5B1219265C47AF JORDAN.PHAUP
1,666,232,304 *AF542B5082CC66FBBBF028A6C0D47A83E0A20E73 JUANITASTALLINGS
1,666,232,305 *AF548DB5E0B73873629E0F8A279933F97809379D JWEGSSO0
1,666,232,306 *AF57AE8EE1F9507022DD22F8C129BFC30BC64EF0 KAALHOOFDIGHEID6
1,666,232,307 *AF5A567F34BEFEF1A6AA927542CB4268E6A0327F KCOLENA
1,666,232,308 *AF5F0FE24B21E618C98143153B88428C4B82B7D9 KEEGAN-SCHAFFER
1,666,232,309 *AF5351F88633AEBA6D28C670A51E6723F4B721DF KELTENWANDERWEG
1,666,232,310 *AF51B796095AD33B85CE81BF88660BFAF3E6EE87 kerry-vowles
1,666,232,311 *AF501FAB41E6F64E6EE3F8F9676E4B23CD3382DD KEUCHHUS9
1,666,232,312 *AF5765F274E7EBF8369F262362D57522B660D0B9 klo$et$k
1,666,232,313 *AF5EF0810068C1FA1A055577B3F2C130EC2C2DE3 KRISTINA.DIPAOLA
1,666,232,314 *AF5FAFF87A177953CD077A32FFAFB97CA366DC1D ktnbrnses
1,666,232,315 *AF528BD7E272B330208B6981CAAD832DD354576E KUSHNIRYUK'S
1,666,232,316 *AF5DEB5D8BB23BD50364B8E8BACE2B17AF9C9492 lambrusco9
1,666,232,317 *AF5592A444AC5DF32A5EB47F1AEEF20BB9426A08 LANG.YANG
1,666,232,318 *AF5C680F3BD374C30745C2AF3809DE0070FF140D larryfleisner
1,666,232,319 *AF5667434656E90BF5900878D2F2FA3AF2440704 LARRY.GRABLER
1,666,232,320 *AF5C6E80BDEAAC3E6D74BBFD214B4B2F42B55C45 Latraviata:ActIII"Tenestelapromessa"
1,666,232,321 *AF5760F68B07345C2BAB9C95B4C15BBED59481AD LAURENCE.SIME
1,666,232,322 *AF57F52A90D59C7667DD2B2D8C5EC32BB92A933C Lebbra.is.the.reason
1,666,232,323 *AF53F91E8CAE68B08004125FD9CED717EEF2C0AB LEIFSINE
1,666,232,324 *AF551BED9A361CCF463ED612CE535F1460A56A90 lenardproudfoot
1,666,232,325 *AF53DB858D437DF5A0091923B37528F4FDC08A94 LEN.SWYMER
1,666,232,326 *AF5B2D25DDFFA3C42514F6C52D30F458AA483DEA leopoldoollendick
1,666,232,327 *AF563D6D230BA8A52A8D8018D1CCCDD45D8C251A lesliewisinski
1,666,232,328 *AF5517B2336BC8440A724543CE512C873EBBD6AC levi.perales
1,666,232,329 *AF58921A9109F9BDA4D68FFFF01A3D41C011B221 lilo911
1,666,232,330 *AF5FF6538E52F20A7CA7F08C71A74F8B2603A665 lindamoore
1,666,232,331 *AF55414DD0B78FA993F24EADF2CF38BA0C473E66 linoguffin
1,666,232,332 *AF5E983693637BC7E9F060FB51CBB61197EE8474 LINWOODCAY
1,666,232,333 *AF5DE3C24FABE34CE536596E6F49BFBFB3689FA8 LLOYDDUNEGAN
1,666,232,334 *AF5247099ED96A654283D850BB9E08B487660EFA LONGTIN12
1,666,232,335 *AF58C5409E08EE938FDF4F1E82C26D7CCC50D77E LOVESEAN.BBS
1,666,232,336 *AF5661C7FA7FF12D72A59E68BE3CA84CCABA6D11 LOYD.BOSQUE
1,666,232,337 *AF545568F960AD488D298DE526754FCF6FF71069 l-sevgi
1,666,232,338 *AF5DF85317A24140DA50788CB296384777EEBBC5 LSONGAILAITE
1,666,232,339 *AF5C5821CE96EEBD420AB5AE7C7E7C1127517287 LUCASKRAIN
1,666,232,340 *AF53623DD527EDD1CB68F5A895FABF3DAFBEB74E lucasspearman
1,666,232,341 *AF521C653FDD98D0070046C1FFB094CCAE44FCB1 lu:d
1,666,232,342 *AF51D9C7514D9E0535B8134B589AF03A85129EE9 LUKELUCKEY
1,666,232,343 *AF563FD6D4B475DEB31BD1C79A49C8B1920EA033 lunatique-ep
1,666,232,344 *AF545FB703E9343B90C3E15B06743DBEE93F3040 LUTHER.STANGO
1,666,232,345 *AF55E9B88D3B520D225947237D40C82CF6A1DCAA LWOLAFO2
1,666,232,346 *AF5B1CEC41FAFE27A039AB513CDE4BE8807B7498 lz9
1,666,232,347 *AF50ACE8EBC342958C97628C50D248D99168452C MÅFJHANCE
1,666,232,348 *AF5AF47C50F3BAA18CCD480C18743DEB6A39A82F MAITLIN'S
1,666,232,349 *AF59D477E0890A213F48F5D4E642A1D1D5C8AEF6 [email protected]
1,666,232,350 *AF5FDB5335D5D5D16C844D2485AAD4D85FC949C9 [email protected]
1,666,232,351 *AF5F759870906A2F70FB1D12248B19CB0E966535 marcoslecea
1,666,232,352 *AF515A4A9B58EAC85A27695912BCAA7853C2BD53 margaret.derrick
1,666,232,353 *AF52EDBF2EE27C7D225FC60A55FA06F553935616 MARILYNLUKAS
1,666,232,354 *AF53672F3816E2A1F2FBE9CA62BE6CC99635D939 MARLON.SLOOP
1,666,232,355 *AF5792A8D131DB5A6B56AABC065A306247C3EA08 marrayaed
1,666,232,356 *AF525249EF772CA1FA3EBB9CDE05CFC16227D551 MATTHEW-ALTSCHWAGER
1,666,232,357 *AF5FEC414ED2C60A1EAD9DA6D563E555E9F9D1B0 MATT.OWOC
1,666,232,358 *AF549D0BE452813ECE551EBE3584E9FAA84A43EF ME574
1,666,232,359 *AF5220597CF21C2ACAADA0ED897E5C75C80D613E MEGANTAPP
1,666,232,360 *AF51EE76128F433930A89D3DF935D820F4AD6270 MERRY-WELLS
1,666,232,361 *AF5D417F5C0C7B16D9A4E8CA76A18BE1A44AEBE1 ME-&-U-(REMIX)-(FEAT-P-DIDDY-&-YUNG-JOC)
1,666,232,362 *AF573376A38BB7CBCF1CD8B55A1029C28AAA8B77 MIAGROSS
1,666,232,363 *AF5B3242E0302B5BBBA5E92117FFBDCA837BCC1A MILJSTYRINGEN
1,666,232,364 *AF537A447043D113738D75F1AEB7DCBF98C7AEA2 milopancake
1,666,232,365 *AF5729CE59BEA630AFD42DA05FD32002502BC86D MILTON.CHAGNON
1,666,232,366 *AF5AA8ABAF34F492314B0D52B0CFDA0391B3AE7F MIMILARRY1
1,666,232,367 *AF5AC5C98B634993A5B26B8337E4A9CF8D2E95DC MIQUELORLIKOWSKI
1,666,232,368 *AF52E658544928DAA2058BBC5B5BA4F25B670B23 MIRZAKHURRAMA
1,666,232,369 *AF5362905C938E50E309CBD60C4464BF12B8A58D MMC
1,666,232,370 *AF5A56FEBE803BF32F10C54109B545CE0F243F6F MOHAMED-FAROUZ
1,666,232,371 *AF59CBA5FA8BEF9A14D3A2E1FA6CA55811171796 MOI=MOI
1,666,232,372 *AF55D1C41D794E62CA6CC7D8B0E316684398631A MSILIOZ
1,666,232,373 *AF5E7773AF58D3B2DC1E38D87FC6E9249DDDF1AA [email protected]
1,666,232,374 *AF5E77C3611C6DD7E68936290E86940C084B5890 my10sne12005
1,666,232,375 *AF53D861719CEE6B40B3ED8877D9C90F39CD1AE3 [email protected]
1,666,232,376 *AF5AED677090B3F4B2A2AA814C020641E53964D6 MYLESBEJA
1,666,232,377 *AF52BED0E1E47DD1A9220694D901EF9342A6009A MYMAGGIE47
1,666,232,378 *AF51039726618C52B54FB97DD8EF2C06A90D15B3 [email protected]
1,666,232,379 *AF5F165FB3929D129A50332EFED3C17CBA16356C NAKAMA123
1,666,232,380 *AF5C6C662FC66B5E694DA3789ED8BEA3AA842FE1 NASSHER
1,666,232,381 *AF5F0DD25E6C3AF5DADC46A21BC2B474517FC510 nathanciuffreda
1,666,232,382 *AF5E1D456D39BE779745E9A400B4C67124E19C22 nathanrailing
1,666,232,383 *AF51DDCF3283734DE4F3F91ECDACFD2E5A484B3F NEIGUNGSGRUPPE(SEX,GEWALT&GUTELAUNE)
1,666,232,384 *AF5ADD6CE854A3B9CBB7AF4644D3293AA7D1C344 nemesischelsea
1,666,232,385 *AF51E4E7AB6B9AA5F6DFB1CD1AD7DF8B13B41B82 NFRANJKIC
1,666,232,386 *AF50D82A32193C936865C8F24045C40E63C2E4AC NGUAF
1,666,232,387 *AF5693EBA693BEDD6DEA122372CDE1A320D7AE2E ngxw
1,666,232,388 *AF591466CE823249802E4036DD80F92793AE6F2D nightshadow10
1,666,232,389 *AF534BE505DCC825BD3033CB237AC4717895B741 [email protected]
1,666,232,390 *AF51840DC5C0CC136EECC4DEBE776BB2C9556A33 niushootingspree
1,666,232,391 *AF5BAC388E8026B7F117DCC05BFC01F5D2D44DB6 NORMAN.TOURIKIS
1,666,232,392 *AF578EC849018937733C6B17AE6A0024479C8E92 NOTHINGSODATESAMANASTODECRYTHEYOUNGERGENERATION
1,666,232,393 *AF529E4B14106B7D48A5A61713810F9C933DCB51 NOTYOURFIRSTTIME
1,666,232,394 *AF5B12588F2037EFC5903480E486CDC301437B52 N$ULT3R$
1,666,232,395 *AF54B7A866C2F2868AB6220BB5B45D10A06B6E42 >< [email protected]#B
1,666,232,396 *AF5580717C56B2667A66F6DFAD5CAC2119A5CA16 OLIVERSTACK
1,666,232,397 *AF5A8F7A426F6E3B8DCDF15EF905588A1E4C4589 omotayo4
1,666,232,398 *AF548FF8DE62E022E4D50A81A2A114A059AE1215 [email protected]*.*.(>_<)
1,666,232,399 *AF51D1DDB6CCDCBD98F12F458F5D4A80BF2A4925 p0ach3$+
1,666,232,400 *AF5B309C00B664A55C823210868EB0D5F6624D7F [email protected]
1,666,232,401 *AF5675A094EB1B73D3FB59FFDECAFB0F016E24E5 parkerfontanez
1,666,232,402 *AF5AD7895A854A9F0D9AE1A4AFEE0B5ADF6843AD PASTORAL.SONG,.'HAIL.MY.NAME'S.ARIST.AEUS'
1,666,232,403 *AF5271378F7D1F8A14BABD4818BFE26CF9E65070 PAUL.MCCARD
1,666,232,404 *AF5EB83BD7C1304D8A9DA1536AEAFF89E6E6F355 p######d-~0~o}o{
1,666,232,405 *AF5C15988CD403475B06CB7B5048A76F1BBE8F4A PHIL.CALTON
1,666,232,406 *AF5627EF6991A288626F0AC312B0C916BAB6DD17 philipgallacher
1,666,232,407 *AF56DDB6100E25A03F6865D5E5585E3C6B39C246 POICPHALUS
1,666,232,408 *AF59AA8406949EE632748CF564EE0A536DE7BF03 POMMITUSTULIPALOLTA
1,666,232,409 *AF5E0FEDAB1615A72FFC378E24930709DF68CCCD POONAMVERMA
1,666,232,410 *AF51DD418204B8579EF1CAF0CBB05B53A6BC4543 Pozitiv,hogy-1
1,666,232,411 *AF59FC35960C93455ED186DE0CD7DF4814ECABF4 p######p***(^_~)
1,666,232,412 *AF5C51DFDF75EB11846F99FB5E9F1B35AD9ED6FA PRASOON.SHRESTHA
1,666,232,413 *AF5E1F06E02A5A6B5872357EA2C83AC144F1E160 prelude-pour-mr.-vauquelin-(improvisation-d'apr
1,666,232,414 *AF553C8127BD91B1BB76227AEC790259198B4A03 [email protected]
1,666,232,415 *AF523500EA8A5F466F7D53A91DC3B55B4B0F0E9A Q{/4
1,666,232,416 *AF51F7183304A341BB4B582562281A4AF02A193A (>_<)**q######b
1,666,232,417 *AF571C94128DEEBBD06071C924DA1562705EBF8E [email protected]
1,666,232,418 *AF521D8D55E2B8F165A278246C16E4099B018F1C q#####)*.*.o><
1,666,232,419 *AF5C2E46B2A0AA3925A6FC9AA1AC3D7CE7330C5C QQXAAA
1,666,232,420 *AF57A33212379BC66C1C14C24AD6D7759924EFA1 REBETLEHEMSSTJERNING3
1,666,232,421 *AF5F892C083B31B4ABC0CF776FBB97F247972CE7 REBLAMERIONSED
1,666,232,422 *AF5AE0BAA61101EB3EE81CFA6B2B3AAEAEE913C5 redabsw6
1,666,232,423 *AF5F4F96BE32C95CBEB889E7428C5E2F9B9690FB REGINEL4
1,666,232,424 *AF53117944EA540D9BF16894596312646CC79A26 RESCUELE7
1,666,232,425 *AF52FF67C7FEEE01BE5B3122A7ED789B10598327 [email protected]!ng
1,666,232,426 *AF59924F37B68B7C422ED7F97A6C344AF43379F8 RGRUTZE
1,666,232,427 *AF52A985AA58346F6F82A6FBA17CFF14FAB0BC43 ria.burnett
1,666,232,428 *AF5D5A9BBFFB1CE0EF85D6B6CAA41F99F6F95FC7 RICKBLANCHE
1,666,232,429 *AF595B4727D7E5CCE9AEE7280B30063221B73BA5 RINGBONEDS0
1,666,232,430 *AF5CBB0C6B9B84F68AF308EFC2DB0313C821424B riposterais
1,666,232,431 *AF52CAD5E8B42560B9B90A110991089CF689F8EB RODNEY.BARANICK
1,666,232,432 *AF5F48F6C4404EED0706718D20E552977AE90294 rogeliovadnais
1,666,232,433 *AF5E10EFCFE92483DD7C5546EF0F131ED79FA0FD ROSARIODHAR
1,666,232,434 *AF5DC7A144F101B6BBA9F48A8044E5A3B2F7AEF5 ROSARIO.MOSZ
1,666,232,435 *AF5FFD229C85F565EE64BFFDFC209FFD6E33794E ROSCOE.DELAMARE
1,666,232,436 *AF5B6D5807FB5DA7CD28CF47F0EB8CDC62A1631F rufusleriche
1,666,232,437 *AF5B6460253F9BF8C99B4E09BFAC2410205B2047 RUFUSSASHING
1,666,232,438 *AF5FDED753CC987983209CBE412C2DCA8B15BF64 SA
1,666,232,439 *AF5B5CB3322E225230E408623BD8319E16E008EA salvatorevankilsdonk
1,666,232,440 *AF5C07FF540DAA2D1D7C56D02B283BF90764E870 SAMUEL-ISAAC
1,666,232,441 *AF5DF53A16A76022C5E2A68F0FF975EA2C8C966F SAMY-MAKLED
1,666,232,442 *AF5972F6BC9B9EC384C9269C78E81BAAAC83A1D0 SANA-JABR
1,666,232,443 *AF56AE1F3647371B873A9990BF1195194E888811 SANJAYA-SARAN
1,666,232,444 *AF53591E7F6BD5B836765137FEB36241A6C219DF santosheutmaker
1,666,232,445 *AF5100CBB1265384E56EC7F2AED74E03D5A242AF SAPIENTISE4
1,666,232,446 *AF583507E0FD3369B73694609D6598AFC528C305 SASSERJR
1,666,232,447 *AF53ADF815CFCDBBEC6E27EA7676182B81072AD0 schobbens5
1,666,232,448 *AF5A7F76E8EF17B458EB8AAB0899CC2966C1935D SCREW1ESS
1,666,232,449 *AF5D3891E4F35015E3DB14B7FAE3383B86F075B8 shades of white
1,666,232,450 *AF5E8279656F874850B542C544FA82390079058E SHARADHAN
1,666,232,451 *AF5FB8486A04FF445B70A38BC0925E609C7E51F8 SHASHIR0
1,666,232,452 *AF555A6AFA5980D75875688433A39003EBA3D52F SHAWN.MAYALA
1,666,232,453 *AF593B9BD30A957D4EA609A6783CFBD0CE818667 shermanmahanna
1,666,232,454 *AF59BC278EBB8C2627F5B4DFAED0BE278F5F197D sherynregisstartingoveragain
1,666,232,455 *AF50CE003AB2D975382AE022756E12C311DBDB33 [email protected]
1,666,232,456 *AF5B422420B913321516142B2D0DCFE604798CB6 SITTRUP
1,666,232,457 *AF586A32FF0B76CBB7C6842312B8AC54660FDFA9 [email protected]
1,666,232,458 *AF564B3B57573B4D0AA6A2681358792FBB12FA24 (skandinaviaremix)
1,666,232,459 *AF52ACB9F26A1F853A9B29FEE9867605C8BA49A6 SKYRIDEBSW7
1,666,232,460 *AF5AE27662D1D8CA3694AE01D164EE4E0BE72EAC SMAGLIOZZI
1,666,232,461 *AF5C9CB081377FC24FE29ED56E754F475C509021 smproxu4
1,666,232,462 *AF5FBCB4096800B1F4A10207FFDECF1D8A3CD737 SONGFROMVENICE
1,666,232,463 *AF52661E8B90F20A58600BC637947DC4A5C948E3 SoooComfortable
1,666,232,464 *AF50A7FDA2778E07DBF833DF6C3BD98BFBFC305D SPITZA_VERSACE_92
1,666,232,465 *AF5A5C9AD14687475289F86EE87019077E455632 splat!o~ o~qp
1,666,232,466 *AF53C11B8984D553E8EE0D7A1D9457653C58BE4C sravani-muvva
1,666,232,467 *AF5830681842C3A241B09F2A53568D59AEC9E601 sregarvr
1,666,232,468 *AF5BF264387C93055CD43178F8D4C822F1853238 STAN.HOOTON
1,666,232,469 *AF5B5A3ECC533D6CC878E313745B9883ACACE25E STELARISIMO
1,666,232,470 *AF5CBAFC29CE93701F3ABC109EED62B60C5724D8 STERLINGMCCOMIS
1,666,232,471 *AF5491156F232B7F15A6DCD938AB6B49D3DE9255 STEVEN G CLARK
1,666,232,472 *AF5662C8920E995DC507A0D7515BCD5B73C9A810 STRATGARNET8
1,666,232,473 *AF5FF7D75BA727809E8275B12F6A12E8FB38106B のデュアルプロセッサまでと、STRONGARM
1,666,232,474 *AF5D2C997B73A855D4E489FDA1C66EC475A553DF subculture.(sarm.west.mix)
1,666,232,475 *AF5FC23F06AF38EC22D1A9AE601BBA86F9640651 subgyren8
1,666,232,476 *AF5704572958DE46E524413D7368AE56845814C4 SUINOTKI3
1,666,232,477 *AF5E35A7C07D26DACC34EDE323217A43BD3C6960 sulfurcontaining
1,666,232,478 *AF505AC89B6C20CDDE41A9905AFB03494CA3176E SUSANNA-ROGERS
1,666,232,479 *AF509106D0E53F2E65B3DA2A505BDBECB9B80715 [email protected]
1,666,232,480 *AF5138E442445BD83EC12FD2D09CDF73BCE23CF3 SUY-R
1,666,232,481 *AF52DFE197255988518684991C8E3AB1CE2EF7BB Sweet-Augusta-Darlin'
1,666,232,482 *AF5CFCA8633C7D812030C7D7E3FF15E4A36D53F9 SYAZRINI86
1,666,232,483 *AF51164015E2D732E9BEB723C2782D334AF17BE6 takingtheroughwiththesmooth
1,666,232,484 *AF589AF7FAEA109A234ACFA35EEF5656D724A67C talk823616417
1,666,232,485 *AF5B488F47FBF1A13C55E1DF3459AEDE5A980D08 TALKTOMORROW-COMES-T
1,666,232,486 *AF5A9B24F36DBF0856CC44C4644DFE3A060871E7 TALKWIKTIONARYPARLON
1,666,232,487 *AF5CFD2A39002FBEEEEFBD3F6E65E01A91C56743 TALKZACH_POPWELL
1,666,232,488 *AF50CF6B9069CD1A2E404492850CA3B50BEE27D7 TALOUSMAHTEJA5
1,666,232,489 *AF56D7B1C532B7D957C1EC4422B218044A9979E5 Tango,Op.165No.2
1,666,232,490 *AF533E9E7FD3EB9FE119B5B4EA69AC31BD44C7B0 [email protected]
1,666,232,491 *AF5B4E4426A9C53E44419BF795157766AEFBF598 TEELSSLEET
1,666,232,492 *AF5A97652BEC7725795C76974BAA46A83D596A4A TERRIZOS9
1,666,232,493 *AF55C80C509A36979A4DF73EC9701EA3C6EC49CA TERRY.SEED
1,666,232,494 *AF5CDA667A9103F65A582414EB5B01BEE840DC9B THALAMI
1,666,232,495 *AF5D184ADC2DB1A8C574208A5710FEC172A2A179 THANKS.NOXCHI
1,666,232,496 *AF56F8D94B92FCDCA9ABE081C8A1959070F73209 THATCASTLE14
1,666,232,497 *AF52BEDB8D45C94405DAE0E1905CE8EAB14DD1F8 the-spirit-of-gamelan-(d)
1,666,232,498 *AF541D0864842950DC35666A4709BB0DF1357B7A TILLARD2
1,666,232,499 *AF5FA086689F0A03BE98D65AA8A687137144C032 TIMAIKIAO
1,666,232,500 *AF50EBCBFA3EAADD350FF1BE919FBC07547B6DC6 TOBIAS.FAMULARE
1,666,232,501 *AF5CCEA5454BE4FFB17D07D6210D91A7C70CF883 TOPICWHAC0
1,666,232,502 *AF5ED433228D4B67769B7199D5909C8FC8F235FA tota.fofa
1,666,232,503 *AF5AC11A3CD59F173011C2B05609B1DE9B3FCA83 [email protected]
1,666,232,504 *AF563ED5D0A9F22F04D3BF892B50CC8EB5E99824 tracysawyer
1,666,232,505 *AF5C171B11A156695092B9E2331175AED2CB2A80 TRAVOLTO
1,666,232,506 *AF5ED258BE630024556F5B4352740D81C935F785 TREVORHIGGENBOTHAM
1,666,232,507 *AF5B13CFECB0F69FF6C0B1DB91466FB8D5A9670A trinitrobenzol
1,666,232,508 *AF5DF48D0D805467DE94AD0F9E1343B122F03F0D [email protected][email protected]
1,666,232,509 *AF57AA6AEF26048180B0889D82D3F5B7192F272D TUYETNNGUYEN
1,666,232,510 *AF5FB0CAE5BC63E6C56B3EBD6E2892B9A37DA0E9 TYMCWEENEY
1,666,232,511 *AF53BA1F825AE9364C1EB0B926F122C712BDAAD7 UAHCIBOR7
1,666,232,512 *AF5EC76873E700F5019BAB41C8B50FA372911152 ukramarine05
1,666,232,513 *AF52C4A511A03B5BD1F981FFF701233B22BB1B0F UNENGENDERED0
1,666,232,514 *AF53E387C50ED38156C6EDAF63A0D74462266E10 un^i
1,666,232,515 *AF5A85E257016BFA3527B7F83F916FEA1CAABF07 [email protected]
1,666,232,516 *AF5E8872B6A2C4F9D198EB327B3483723677FA47 [email protected]!3$
1,666,232,517 *AF5CFE2EA68D5EB8D6DB614BAFE79ACAFEC0FBC9 VANESSALIPPACK
1,666,232,518 *AF519BB956F9015BFA9B12E8140D0892BC280C00 vangie.medina
1,666,232,519 *AF54FABC09F7E6A1C5A221CA4C260D09AA35F9B7 VERIFICATION.SKAP30
1,666,232,520 *AF5C015913F2DE46E58B7A03E3B8C00062F95F10 VERNIRAIENTING
1,666,232,521 *AF5602B4C154DF5F219421F5EA8ED437AE1277EA VERNON.FRENNER
1,666,232,522 *AF5DF57A8C6DCAC1F67F3A55864A6DC688156342 VERNON.METSKER
1,666,232,523 *AF5FA366C757ED6655D0F12D03F9AB95D5C164E7 veronica.blessing
1,666,232,524 *AF59F5A9875540A5F027947BAA45C7DD0916E168 VICKY BIDWELL
1,666,232,525 *AF59776F24E8AC4D74E0F2EC92AE040284465750 VIDUSHITAYAL
1,666,232,526 *AF579DFE1BA5428CA2CD4C22A1157D9122B95773 VINTAGEGREENDANCE
1,666,232,527 *AF5F583A3B9E49E248A1EC6C13E85A244EC11CF5 VLB
1,666,232,528 *AF52F7357714BA9B7F85C2856058FE198416660C volapükamuf
1,666,232,529 *AF59AF9EF1F2DF6F5BFC1B7A9ADAB0AB5DC3EA96 waitecolman
1,666,232,530 *AF562DD60AA196A9D3D7D6082FAF32212B5FA57C WANGENMANG
1,666,232,531 *AF52996868FDF28596970B8085FF0C1CBEB70248 wayne-horwood
1,666,232,532 *AF59C8CA678CEACAC0B7FC4C47CBFC6208476A58 WEDDING-RING
1,666,232,533 *AF5CBA52EB6806D258A7E13CF56D4A2E669310EE [email protected]
1,666,232,534 *AF5A0A032F0D97A5C90E8AE3667B30B4BC102995 WERPSPIED
1,666,232,535 *AF518574560B57708A9471CC20A97A492EEDECDC WHITNEYSCICUTELLA
1,666,232,536 *AF5E80F50B58E2BC4A8C7F9E9E2500C1126D140B WILDVERWACHS
1,666,232,537 *AF5321E0E64FD1FA5D394D03687F6F5E094B005A WILLIANHENNEN
1,666,232,538 *AF5A0A5912775752883B6E65CAA5D5B08E8B1D82 willisswed
1,666,232,539 *AF50D6045EC347DFCC18CD14EF2A8ABAEEFD9969 windowns8
1,666,232,540 *AF5B560FD20444586F30533B9EEE5F960E3602C6 WIRLA-DE
1,666,232,541 *AF5F6D1513A011956E77A34DB4DE4B4980F15C81 WOODROW.MAKOWSKI
1,666,232,542 *AF50B72BE9EEB01F466782611F5DA1BEA1CFF7A9 wwwsantama
1,666,232,543 *AF5949F46458213D11A1E64047305E8613B66C1F wxahcfsb39
1,666,232,544 *AF519EFDF670A381D42E506054F2E0B2F21F8EBD (X)`-(###8
1,666,232,545 *AF56F1C55D358CA3F323B0F384724DA40E042A8E xavierhorovitz
1,666,232,546 *AF536A1104FC6A6C65D57FBD8501572E7E8FFA73 [email protected]
1,666,232,547 *AF55E2355971B9B02CC7617CCCEC840A067EF55E XKUCOVE
1,666,232,548 *AF53109F9F66036263C15DBE8765553639254A58 )x(o~o~<#3
1,666,232,549 *AF527A8EB56FD43E494117DC2EE470D6F66CE3FB XTIANCABRISOS
1,666,232,550 *AF5E6C7128C978B2E5EB2DD99775301D848EA966 YLLACITAMORHCNON
1,666,232,551 *AF5116FD09DE28CB92E0DD59B1541C7B0A00F2AC yorlelpj
1,666,232,552 *AF5BC32AAADC79698EC1338D1F7AB33C4D1D7043 YTTENNEMS
1,666,232,553 *AF5861F7BEC535B89C25DBE229B28D764D82D002 ZACKFUNDERBUNK
1,666,232,554 *AF575CF3896C6BA872ED4CE2D2E04BD48760436B ZARZUCANĄ
1,666,232,555 *AF553F55014EC2F6AA98E013E711C92039442C30 zeittarg3
1,666,232,556 *AF5DDA4E4A3F1F73B9BDD9F191CA5CAD3BBC6546 [email protected]
1,666,232,557 *AF53AF240D0B3F2BA18B9A24D7518214C602D4F7 [email protected]
1,666,232,558 *AF5DF453D60440228ABBCC9B2A29218F6364A011 ZINSARKAWT
1,666,232,559 *AF5A1C8E9EBDEB0406859482A9A8F241B6C2BB45 ZTESEGKCRUZ
1,666,232,560 *AF50FB5E1A2F7B08E4B63EA109AA3B1D730F527D ZUMBI(DALATAVSDACRUZREMIX)
1,666,232,561 *AF58EC199349EF2E67629C640F110C7872E0A491 [email protected]
1,666,232,562 *AF52D793751256EE4086FA80383449F22EAA1455 ΑΝΑΣΥΓΚΡΌΤΗΣΗΣ
1,666,232,563 *AF588113C7BE2272953047C600609FD4904E8F67 БЛЕЗЕРУ
1,666,232,564 *AF51524FD7FE5D709751A05AD3E11AEF92421D9C ДЖИЛЪУ
1,666,232,565 *AF5695A3977439A85B2C4D9343D244E1B43A21BA морусом
1,666,232,566 *AF53FBCBA4DFDC8ECD9698C951E3B2205C84E730 ОТЧАЯННЫЙ
1,666,232,567 *AF55FBE277C8A0188279B5FC3FF9DE3DE8F91EBD УТНАЛ
1,666,232,568 *AF557C7C534EB17B8542436FFC6C824BFF1B7786 ШЕНВЕЛЬКАУ
1,666,232,569 *AF5E492E46D7D25FB32C6A7A37C7F9DFF6E23B2D ・木曜zone2
1,666,232,570 *AF5B7155B016C834CCE9B940453E9F99A9258307 10.LANCOME
1,666,232,571 *AF5C73FA8045AD3DA8DD18AF76F46A50008D3EF0 14 bayerkreuz
1,666,232,572 *AF551238C0478B76BD511829D31069DEB4F310A1 15121766
1,666,232,573 *AF52C54B592EE0B6EDB5D3439AAC707AD2864930 1724997 es gibt solche sportler
1,666,232,574 *AF54E05E8D3D8494197CA86507A3E59F77879BC7 199968M
1,666,232,575 *AF56E4FBBBB203B938605B11878BBCF9E9F9EAC8 1-BAROTRAUMA
1,666,232,576 *AF5BA782E04F8F5770A1CE7BA664F0D5D60A5346 1.bevorstehendenden
1,666,232,577 *AF51ABC068B432E06BFB78A79F25623117C466F1 1-eislaufschueler
1,666,232,578 *AF56319CB09EB5419C9554BBC77C114FFD313C62 1hillegonda
1,666,232,579 *AF5BC2F6F867001F0E805AF5EE829A3C97010DA9 1 interregrahat
1,666,232,580 *AF5C0B91A6197095B160E133ADBEE145362E5370 1-jahresregent
1,666,232,581 *AF53A039501884D606D87BF55EB2E3A27082609A 1.MAHTIBIISEJ
1,666,232,582 *AF5BCC91D070EE4A9D62F1B5DE556D3D46577899 1.METALLKAEFER
1,666,232,583 *AF508B8963C222BBBE9F1F2E6AC6B868D04C2E4F 1.politikerkopfes
1,666,232,584 *AF54E5E981383806EBC20FC9F34BCDB7449D2265 1.re-creativity
1,666,232,585 *AF5C1FBB19898228A36F25EF044AC2B89B3B69DE 1-REKURRENSIN
1,666,232,586 *AF5C2A3B18F50494AC49BBF803121259966E99A1 1 stowecorner
1,666,232,587 *AF5539996D0EA4834C8583B57B21BF5683618480 1sx7m9luz5f08740z60
1,666,232,588 *AF5EAB807F34ED495434EAA490D0D612810C3144 1tasiyicilarini
1,666,232,589 *AF50B51B50A0FAB36DF42C990F3213A9BC92673F 1telefoninformation
1,666,232,590 *AF5E74397D58E02256D388E40DC89516D9EA0860 1-TERVEYSTEEMAT
1,666,232,591 *AF502E1C41BCF4C4BDD760873B45E9BD54CAEEC5 1-YASANMISLA
1,666,232,592 *AF50118BD434EBD3C267D639146CEC8B2E5BE08E 1 YKSIL
1,666,232,593 *AF5345F37532DFBAF40E373370685BB110E4BA37 2035619 elfateh abdoon , was quoted by mena as saying .
1,666,232,594 *AF5EB0CF525E20E5D6D1E48354E47A6A482993A4 2182109 PITK
1,666,232,595 *AF572319BA3DBFED6C4311BF04625B3933E7DFA6 22august1190
1,666,232,596 *AF5831A9711C9556F10CA55A81C2E525B428105D 2318532 THAT-MAKES-THE-SUBJECT-LARGELY-INACCESSIBLE-TO-LAYMEN-.
1,666,232,597 *AF59F75B6E46969B0031D98DA6675258F7E8E067 2467585 vastaus-:-kyseisist
1,666,232,598 *AF5A0D7DBB03851D9752C8018FCB1DDD05A03948 2473315 SENSIJAANONOMMELTUTYYLITELTYJ
1,666,232,599 *AF54C58B1787D7CFB48465F43C55FCD199398851 251492I
1,666,232,600 *AF5090CE0AC61B434AEDAA11FECE0A50EFAA5A55 25 K-SARJAN
1,666,232,601 *AF58F0271330802583ACE3424D0B1B2F813F8FB5 2-ALL-THE-PEOPLE
1,666,232,602 *AF5E2F7D68E2889FC59DE9FB9AACAF01586368DF 2FRAU-MUTTER-KIND-VEREIN
1,666,232,603 *AF501089290B077BD0D8DB1BD3AA6C597118DAA7 2maavian
1,666,232,604 *AF5EFF582A3C7DA76E1E8917FC8B744F621BEC2D 2MAGNETBERG
1,666,232,605 *AF59D81C83C96CF98AE0E2D5FCC1E85001865E80 2MYPYRO
1,666,232,606 *AF5CCE473E9AE9C8D8217FE5B387FA786D4630AE 2rakennusohjelmaan
1,666,232,607 *AF5AB6CD26F5BD3CE1FF8193F170088E8492C269 2THATGREMLIN9
1,666,232,608 *AF545E52CCF791DD07E3DB37BB5E6C7502DC1622 31october1613
1,666,232,609 *AF57D32F924FB516D3D2FBC978F5650FFCC186C2 35ie
1,666,232,610 *AF5CBA13BEE7F047D88D67C78D140781B06B69F5 3ESURBSW
1,666,232,611 *AF5AF83A80DE12A858534C9C43E8521303987955 [email protected]
1,666,232,612 *AF5FB7A733F389FD6521692D9D3A29B48A232E4A 3.KAKKOSLUOKASSA
1,666,232,613 *AF507A6F1B552C5B31524C0419291E714F2EC4E2 3MPL1R0NT
1,666,232,614 *AF5D4292099240461DA234215A44F1D3AC39C188 3##)~O ~O (0_<)
1,666,232,615 *AF552A56490585B00C23F370EBD1ED204C97C972 3p `~ `~)0(
1,666,232,616 *AF53F0808FFD6D1DDBA82C2A45F8A74180702AD8 449NYASIA
1,666,232,617 *AF55A5155309D3CBA38FEEDA128B2836EE543CF5 4PRITVORENA
1,666,232,618 *AF50438368DDDCC79355E25EF172EA86C3CBA3CF 4VICTORYCHIQUITA
1,666,232,619 *AF5B7914C61C3DEE6DF29AE009D4A4E51E02A963 5BEANIEBOOTSIE
1,666,232,620 *AF5B42453EE0D7EB2237038D33FEEC77B74A05EB 5 BOMBENEINSCHLAEGE
1,666,232,621 *AF5F52A132B82CA3A437742AC085659A8819F343 5DARIDRAM
1,666,232,622 *AF5BB0426181B7DDC09369D71BBE18738CEB92FA 5DETOVEDH
1,666,232,623 *AF570D55E0A721C0EE1A6D4CD3A91BE93C231C1E 5DHOOLY
1,666,232,624 *AF564EDEC95179AD5D5F39824012FD1835565B8C 5ECNECSENIMULOIB
1,666,232,625 *AF5DBED093BE56D61B0FB5647A8379C9A7AE2C34 5EDGFRVR
1,666,232,626 *AF5FEF218E843EB1FA1D8E13AA3DF7B03634C4F4 5-exkommunistischen
1,666,232,627 *AF5A446ED719A89F3D2A6CA96F709D6A6DF209B3 5EXPORTATBSW
1,666,232,628 *AF501ADFF1F75CB165A97EE3FA7557BFB5BF4401 >5=EZIS.RH<
1,666,232,629 *AF55D9742EF72947F8E7DA95064D01F500A1D77C 5GORDONPLUTO
1,666,232,630 *AF53BCE3856A04D7EBCA47008BF7691B25FA41BF 5GREEKRITE
1,666,232,631 *AF566791B79D7194111D1BD5E7A4818829F248C5 5HANDWINNING
1,666,232,632 *AF59A21282DF160E56E4B9D487CA586E0F9EC10F 5KNICKSN
1,666,232,633 *AF585705FFDC01BB61FCD04B83EC63C57A5BF000 5reconnue
1,666,232,634 *AF5FC2C8F6B057904AED6E7B1316BE2BF79E77E6 68 VERSCHLIESST
1,666,232,635 *AF5DB244909D0D7EF07667D7814729D4606A8178 6ALLUSIVELY
1,666,232,636 *AF58F713964A10ABE77E0F318B11C4446F99961C 6CONCRECIONAS
1,666,232,637 *AF5F3FCCFACCD9C3B1E5DDCEE82CAFC28755F08B 6fijnstamp
1,666,232,638 *AF51BDE634C02ABB4E77737AAD6FF9B32111AA06 6MARKETBRIAN
1,666,232,639 *AF50D4E8A96D64F3D0CDFD19854AE3110EB107EB 6PINTUDO
1,666,232,640 *AF5F5D0E6971B74A714A82942F253822CF46CF17 6SADDELTASKER
1,666,232,641 *AF5DDCE700CDAC61EF22BDFC030A81613C070CC3 720marques
1,666,232,642 *AF5668BABB41E461542F9FD67CEB7B23D7530075 7MYTANYA4
1,666,232,643 *AF5FACC5854E4C18E562F75EE172D96C6855B168 7REYNOLDSINDIAN
1,666,232,644 *AF52FE72C1304911F6B87E895CE3685BBDC64468 [email protected]
1,666,232,645 *AF511D5D5279772E697672AE3D46A0B069CF2E78 813COLTEN
1,666,232,646 *AF5F181580458339787BB62D1E0FF5C01FCC8CED 8B.*.*.*.~0~o(>_<)
1,666,232,647 *AF5ACDCB91D96E3B887938C51F17221B00B954A9 8PETROGLYPHN
1,666,232,648 *AF5F8FCB5BDA523BBE19BC5ABCD48E09827CBAF8 8REBECCASTEALTH
1,666,232,649 *AF564A429D2D962EB152376BB9B01889C6E41126 8RTSGNET
1,666,232,650 *AF55AEE20AF205285803B721C1F8E3AAE76F080A 8SESAMUS
1,666,232,651 *AF5F8D6D35DE6CCA17836C573E2FF3977EA0AB31 8SRIDHARANRAMANATHANINDIAVRSMAILCITYCOM
1,666,232,652 *AF5F4F028CCCD2262B767D3ACDBA4D4AA81B9507 8VERDRIETENS
1,666,232,653 *AF50A49087AA0C7EDE939DAD7AA1767643DD15B6 8VERLEIDERS
1,666,232,654 *AF51AA83EE701551009682945A12F758841CFF90 9BSWONETABSW
1,666,232,655 *AF50028369F90E090428961D2C55547C81A75862 9CONCEPTHEARTS
1,666,232,656 *AF5EC5B23E3B064BF0775F9FF821BE94D5FD1510 9DESVANTAGENS
1,666,232,657 *AF5DC89BFF4B80FD08C29A1EFAE3DBBF77A3E889 9IHANTEELLISIS
1,666,232,658 *AF5ED70CE9A8B4C379661146F1AF46A880AC6755 9JPYCRGS
1,666,232,659 *AF52532B833409B51F69B98BDA01227B15CCDB68 9KALLIOSSAS
1,666,232,660 *AF5E834B7D0D87621C5704EE6C6705820A520BE1 9KOZERTHETOEN
1,666,232,661 *AF59E1257852DD39FF60732AE5B5A1E57E71585D 9SENNETTENNES
1,666,232,662 *AF5530367280D70055BF673D5F52A85ABFBB549B 9TARKASTELEN
1,666,232,663 *AF546C2CB5DE0D59EE701EBF22ECDCE6B0BDA2D4 A0O_
1,666,232,664 *AF5D668F87802E74FC18F0A4C4809D98212BE2C2 AANSMEED7
1,666,232,665 *AF585B7B3DB13A5127062409784E356A3DC97F7F A-ARO
1,666,232,666 *AF5096B8DE80934321078D7D979A5E2CF4C4BFB2 acj{\
1,666,232,667 *AF5A002910EDA6DDE7BCA2FA9B0CE88FA9D3B3CC aggressive man (bofetada mix by umm)
1,666,232,668 *AF5F90CB8E359D4E5F31B290AFCF72B4F9139F3B aglerbsw5
1,666,232,669 *AF56F12B82E82734EFAA1E864AACE65875D16360 AHMED-EL-SOBKI
1,666,232,670 *AF5906F3B468A486350FEC7864CE3B54A73919C7 a?ik
1,666,232,671 *AF5C49BD8DB394D18BFD9A94B98C3CE6C35C6693 ALICECLEGG
1,666,232,672 *AF5E4DC59B71DB1EA881F3474D763866E5F43550 alphonsemanzanero
1,666,232,673 *AF58F81C566030D6226EE972C66C423036D220B3 altfanceciladams
1,666,232,674 *AF5225B5495F236FC4D630C2D0AE6D872FF424E9 ALVARO.LYNK
1,666,232,675 *AF5DFA2D57AF27575B8F568AEB7605992F3415BD AMAGAZZENI
1,666,232,676 *AF58D1AFB34F9DEC757876211B970D1D371F0D9C AMBROSE.MORDA
1,666,232,677 *AF50678918BB6E5BF0C3A3779881E041053A72B1 AMERICASCUP1992
1,666,232,678 *AF5C66B57FFC6FB6FC9B34509182E1EABDFA49BD AMORPHES.GESCHEHEN
1,666,232,679 *AF5607999BDFEA8FA69DA7C90B8FF2C9E899AF68 ANDREA.SHUSKEY
1,666,232,680 *AF59823C7DAE996D14EF99D9D25A2877C6CA78D8 ANDREAS.SCHRODER
1,666,232,681 *AF57533B7961300B62DE22F225B6767DFDE082CB andres.caparros
1,666,232,682 *AF5B3D16C54075DF60F605720C00621AC6EBD00A ANIENTEDS
1,666,232,683 *AF511D2AD4276A6061A9B7F101D4AEBDDE01A1CD annamariamendieta
1,666,232,684 *AF52E01C66BA2E42167949076F3F4DE8BD2E365B apngm
1,666,232,685 *AF51B4803BDBD6E3DC96A69EAD79921660CD9E24 ARHB
1,666,232,686 *AF56EDDFA2F9E75E040865CCFE1E036918DBE95F ARKAISK3
1,666,232,687 *AF50EB9AF25AF9AEADE381214A39C24BBC460549 arturocaillouet
1,666,232,688 *AF5E964ACA5E43BC50E12CB4EE34757592F2FD3D a:;ru
1,666,232,689 *AF5B0A157295B313E1F911342131C20443E82AFF ASimpleTale
1,666,232,690 *AF58B6846BA56014C296DEAA22CDBE8A4B0C34F5 ATSIMAOT
1,666,232,691 *AF5DC6520E0C0F55FF68C7323AE250C106C29C03 ave),
1,666,232,692 *AF54293C0C8BE98CF7F82B5F1D4CFA45607CEF04 AWKERAWK0
1,666,232,693 *AF5D322E8AFE427C86E9A696E161411AD7ABEEDD AXBOI
1,666,232,694 *AF5E4B665FE1345F4FB3659A7E09C39FA094CE84 B149343
1,666,232,695 *AF5459A8A36881C5050C4BADAD47C1CEF146B2AF B24=
1,666,232,696 *AF570C19E3A909BFC8E2EB68D10BA7096C25F576 B3K?6
1,666,232,697 *AF5B35EEA7B41F8040EB67CA47EF694909F9561E B8AJ5
1,666,232,698 *AF5647849C555FB11DEFE3CC6141F4D3D409B08F B9T#M
1,666,232,699 *AF5B904049383B658B709C4436939FDB78201988 BARTOLIOED
1,666,232,700 *AF59F8E282ABDA25BA238B2BB49CADD8B406E31F BCC"O
1,666,232,701 *AF5DFCD7E364A1DE44C7394B2B3F7EFC268AC183 BERTRAM.SANGI
1,666,232,702 *AF581727E0351732807B798D3233313A41E9C698 bft3+
1,666,232,703 *AF5A2ADF43EC34267645BE3C7808ED83F0B4EA9B BFYYZNZN0
1,666,232,704 *AF52EFC4AE1F595E34DC0296CE7DA63B10F7F6D4 BGCRZ
1,666,232,705 *AF5BCAD2795DCF2657961141B4822B5F52FC28D1 blekitnies
1,666,232,706 *AF50EBE1E2A0FD48745D01F1FDB970F524B88885 BOOKSBYRAIL
1,666,232,707 *AF53FF4FC01348035A08A19AAE653DB87EE02EE0 [email protected]
1,666,232,708 *AF57C3CC4A9A3242F1533E11F173A6AB21CE2D2C brisa275
1,666,232,709 *AF525C019E61BFC4632C9F97B7AEBA11CD455A5C BROOME1
1,666,232,710 *AF536138BE407FD3FFF1261553C880C042DC295D b/,u%
1,666,232,711 *AF57427E429EA8CC622A0E902808797CE302606F BUECHER-VON-BOYENS
1,666,232,712 *AF5CD0DB7B99212147C04DBA76BDFF2F8B846FFC burlrowan
1,666,232,713 *AF5E03FE983D19DCFC63E6CE90A84FBB69D50BA2 BURTBERKSON
1,666,232,714 *AF52DB452284424A3F154007F1AFF6F5F539BB11 buymeout
1,666,232,715 *AF502F5BF10403C00C7EBFE2B89E683DD54B73CF CARMEN.VOGEL
1,666,232,716 *AF5B75A2E947C65EB8F55F297B42D6FF307195A9 carrollsavitsky
1,666,232,717 *AF537D819AE633C354E31C95696DACFA507371BD CASE-OTTO
1,666,232,718 *AF5A7DDEE804F4046791CAA1549C1F90984B6B30 Cbt3
1,666,232,719 *AF5A10122FA90FAC88AC6B143CC0578CFD79503D cedrickwilm
1,666,232,720 *AF5ECD6EB399BB9B74C3A5D17FEC8006564291D6 CETV!
1,666,232,721 *AF5C9AEFB74B01BBB267CCC2406D1BC47E3FE169 CHAMPCANEBORACANNONA
1,666,232,722 *AF532CD325D6650E6E73863DDA2E40608EAEFE85 [email protected]
1,666,232,723 *AF545ED13DA774C74C6CA2306442A3CFCEB9C631 CHARLESOLCOTT
1,666,232,724 *AF5F0116A903C51834C35682548961EFAA25716F c!he+
1,666,232,725 *AF5D42012CB28BA39D82F5502FF13A16B595170D [email protected]
1,666,232,726 *AF578035E54BCBBE7F48D8075C54EB6217813FAC CHIKARA.PRO
1,666,232,727 *AF55A8F1BDF5FBE71EF9D69D8F0DA52705EF9007 chrisliebelt
1,666,232,728 *AF56ED35C7192A96CB6AE0FEB0FA56A73F1F0D97 CI1TT
1,666,232,729 *AF53E6815A47850BB88B8935CB6B5184B8F3BEB1 CJ122
1,666,232,730 *AF5CEE0726AECB7696F3EF9054BC44E453A916BE [email protected]
1,666,232,731 *AF55C18919F2BCDA4C6D2B9FC9B77C8CCFE2477C CLEO.DEZALIA
1,666,232,732 *AF58E4C10C2A994A3D1743C8B9E155F9FD94F81D CLEVELAND.FLEIG
1,666,232,733 *AF5C89496C13C542B3E2C41F69BCCB6E9B3E6757 CL_:H
1,666,232,734 *AF5DEFF64F8253B6519938F041582C406F1B7EDF clintpalermo
1,666,232,735 *AF524135E1CB0FF0736B206BBFC8CE1DB3D80745 CLYDEWROTEN
1,666,232,736 *AF531A3B9436B934697D732768A0A4AC7D7D5ECE CNE,
1,666,232,737 *AF586EE40BDCA3505ABBBF1BDC63A1F483871CBC [email protected]
1,666,232,738 *AF5FBD239BF20D3644E0A2AA7798772807E8BD4F COLOFIRECHIEFS
1,666,232,739 *AF5ABE6B2871B8DE6640646A097F0A619FA54F1A CONAN.THE.FREELANCE'.(NOVEL.1990)
1,666,232,740 *AF5ED332606F080D3CD2A456C691C3ABD215DFC8 CONCERTO IN A MAJOR, OP.30: POLONAISE: ALLEGRETTO
1,666,232,741 *AF54D2BA7102B84FE17CFD30BAC1A8D333A373E1 cond3sc3ndin9
1,666,232,742 *AF58AEFD89CE5393646878D34A1FF6512379F69A CORNELL.NEVE
1,666,232,743 *AF55529C54669D73DEA16E8043E4AEA35040F679 CORWINTWEETY
1,666,232,744 *AF5C2ED1633B7FD86E34E9FD1EA58BF0A43947A6 CPBCT
1,666,232,745 *AF5CC8B41B24ED11CA09196FFCC1C98B2D1CA63D C%WH!
1,666,232,746 *AF5F83E864F013D579B713F9B3887CDEB24498E4 d1f$a
1,666,232,747 *AF599B2A85C552AB9ED9FD7BA13C288092980ADC D55F9FD39D61
1,666,232,748 *AF50969B1E5F9F4C1669863AB69917A45652AF81 d5arrang35
1,666,232,749 *AF51D359CF1D9F7946263DD6F72A895C607D1932 D.8HF
1,666,232,750 *AF5620745C0D2DC3FAE1C8A7A5595900DD77C7A1 DALNEROCIEL
1,666,232,751 *AF5C9525D69E7DE7C46681217CA6029A1783D145 DALTON.GRANROTH
1,666,232,752 *AF5C776DFF793963D5DC2256370334C54BA123B8 damienwoodlock
1,666,232,753 *AF559813ADDDE9DF9EB90EB5B8BB1297C2E469F1 DAMILOLAADELUSI
1,666,232,754 *AF583E54F9425739DA2A52D998FD8EF7C2E25A2C dantekopf
1,666,232,755 *AF5DBD95942B6B2408D8F8F3A2922AE8E9358A25 D))AS
1,666,232,756 *AF5398AFF1E15A60D5B4025A7FD80AEF01C15EC2 d:c,w
1,666,232,757 *AF50A66A06C3A364B8F5F803E4A304355C3D9926 debashiskarmoker
1,666,232,758 *AF51CF4C585D079E537F812D52061D3F40C80B01 DELECTABILITE
1,666,232,759 *AF5D9AA401CB41DC0C892FC6462AF08E688658A0 demarcusheichel
1,666,232,760 *AF5C6D299551E617DD44DDEE56AB7A382E347006 DEON.DESORMEAU
1,666,232,761 *AF5D797EE3B75AB34AAFA5613D626FBE8432DB7F deue
1,666,232,762 *AF57E2365BE4C2A81686503CEA326714AD425945 DEWITTPRIESTLY
1,666,232,763 *AF5AEABA250D83F53DF4905936068F418FA1F6AF DG6WR
1,666,232,764 *AF5DB43F1A82B87A4C5BD470848DCE153C7EBCB1 DILDARHUSSAIN
1,666,232,765 *AF52263F5560507FE28737497C307C3D70F50BEC DISCGHOST
1,666,232,766 *AF5D2AA767D6550FD6FC6170F1748A05065BB4D4 DM+ZI
1,666,232,767 *AF5AC364E3F48DC8FF94BACC0EEA7291DCB0452E DOGMARK5
1,666,232,768 *AF50CEBA5154071148A0C15AFBB14850EA3E80DD DOLLLODONTE
1,666,232,769 *AF513E6C2D96C1DAF4FA0998235BEA71AC592640 DOMINIC.SODAWASSER
1,666,232,770 *AF5C0CE9944702F5F71CFAF71603B1027C8D7D1E [email protected]
1,666,232,771 *AF5E87B56C852A073292FDA64F506DA3B57247BE DONGFENRICH
1,666,232,772 *AF50BBFBB72C8090D71C1B7D1ACA7306EBACD1FA DONGNUTT
1,666,232,773 *AF581A80A7B1A26D788985033A9C48B9CF223D8A DOUG-KAELIN
1,666,232,774 *AF5A26CCF2F6A1120547463D4AD13502518A220F D_QH
1,666,232,775 *AF5C700DC08C309991E899384963C7CF8DF07120 DULUTHIAN0
1,666,232,776 *AF54F4436BB2FB486E9A88DD0CFE8B2FC1BE3123 DU(N.
1,666,232,777 *AF5E3C127DBEC9182E57A548D5E511D357575B16 dustin-bumgardner
1,666,232,778 *AF5F093349C8799EA1499D05EF1073D64F5DEA84 duvaly
1,666,232,779 *AF59FEC4CEAE511FFF5C8C91F7D80DE72B62E31C EATP0
1,666,232,780 *AF5B50493336F45D04D4EE9C49DC9DA25394530C ECI8324
1,666,232,781 *AF520ADA1F6AEAD694F51FEE100307EBB223FFBD EC!P
1,666,232,782 *AF53475925DE0F019E1BFB46B28849EC89B1AF33 EDISONPOITER
1,666,232,783 *AF5C58BE717A5C59A8E7D379504B2F221DF3E5D1 efc?)
1,666,232,784 *AF56EAF06977AD28B9761807744E66268AA3CD2F EFFABLE
1,666,232,785 *AF5168D153C211A87EA6FAE208C123FDBFDD0784 EJENDOMSM
1,666,232,786 *AF5C2ED584FCEC73E56D278B60CEC69F00937145 ELDEN.HORNBAKER
1,666,232,787 *AF5337A83AB9A2FB3D7F377407A4F34D5E5E66CF elgebal
1,666,232,788 *AF5232328C6EB561204E09B8D96491B7F16EB446 elmhurst.10.0
1,666,232,789 *AF5555B1704CECC15B3DCBAE41047A847020DDC2 ELMSTNI2
1,666,232,790 *AF510B62FB5B6DBC036AEA357D76CA89BEF0296B elvisgillispie
1,666,232,791 *AF586E0767A8305B4A95C27C3C33C6ED9DE14277 EME3T
1,666,232,792 *AF50CA2377D91736C9E6AD3B91B72ECF211E78A8 emorykidwell
1,666,232,793 *AF5C2C1DDF7443576B68F85684DC30324B8EE459 EMORY.WANDS
1,666,232,794 *AF59A2350F09579F49E2A3E27DB3647911E9CC63 EMPARVAR5
1,666,232,795 *AF55CCB4EDF473BE2396AC4E6C1556430CAF1AF6 ENOCH.HESKETH
1,666,232,796 *AF5A4633212702454D2E1BAFBDE6370005EB7929 ENOCH.STIKELEATHER
1,666,232,797 *AF5C7E8410194054D7DD9AF9A6A406A7F8C64CF4 EPbm
1,666,232,798 *AF560493C8BD119DBF32FE47E6D9DCEB13DC06A2 ESKYTNNE0
1,666,232,799 *AF583ADE8FC5E1E24B25B8CF076895E7898647CA etagadoow
1,666,232,800 *AF54AF3D68F616858723DDEC2F5AD951C71E6CE4 etirdnas2
1,666,232,801 *AF5CD0EE65D818A81643153A8AD695D21FD5E47E eu`
1,666,232,802 *AF545B85F07089222D1D3726EE510C038B579975 evroptal''evroptal
1,666,232,803 *AF5FC5067967D14ED893401B39062C1B3A2E70F5 FABIKKEN
1,666,232,804 *AF5C8D9FC3D4081DBAEB9DF5D5F33A7E33E2E4F6 FAUCHOIR
1,666,232,805 *AF5A28DA9796B46743433FAD77FB90C1FA11188D FAUSTO.SUSTAITA
1,666,232,806 *AF5B3ED020286EFEB0F851EF3C8BC32B1E65960E Faux.Bold
1,666,232,807 *AF5B2A67E0F5024D8823D5AAAD465A4A73EA884A FBETS
1,666,232,808 *AF564D1C8B739205644BB1A525129CC055C6038C FEDERICO.AVELLA
1,666,232,809 *AF5879338D15C1B43290B01EA47059C74662C12A FEDERICO.BLOXOM
1,666,232,810 *AF55F007E299CD3487B5C9FEF05186FC9A91C5FB FEDERICO.REDDIX
1,666,232,811 *AF5D7C8F1E2866E6037CDDFA8FF14BA505179BA2 ferdinandgruntz
1,666,232,812 *AF565B14DEF8D80F004DE8503ECBA0B9372E8429 fergal101
1,666,232,813 *AF5C53B57C7A9D44EB4CAFD39823299B5D0D63F9 flowers.&.football.tops
1,666,232,814 *AF58BA72BEFEC0FD177000ED0D9FF5A509359F9F FOOTP14T3
1,666,232,815 *AF539FC3CE9403BD83CF0FA8BA3464B02ABDF79C forrestoliveres
1,666,232,816 *AF5EFDB18AE9DAEE240C938B233BC469C799F311 FRANCESTWILLIE
1,666,232,817 *AF54CF26E2499D27904DAE1F66CBC3D27009A0B6 FRANKENSTEIN-M
1,666,232,818 *AF5647E8D6D576DA050B45CBF330B185EDDB6FE2 franklafontaine
1,666,232,819 *AF5B02925AD1E59F128D5C4104955EF254334B18 FRANZUA2
1,666,232,820 *AF59DC3613B4E02515983E62023622F38054FDDA Fused.(dub)
1,666,232,821 *AF528C2063D86AAB06F6978525B67E2C8BD04A63 FZCFKHMMJWGC
1,666,232,822 *AF5BEAE76042672A33FCFAA2093730259479502F gaige417
1,666,232,823 *AF57C9A7E8BCC7EC9D0AB4E21026119F989E14ED GARRETTSHIPLEY
1,666,232,824 *AF5D5885BC8B99AF0D729D39E037381BC4DD82B0 GAZDAGSÁGOKAT
1,666,232,825 *AF56780B327B6FA890C5549424A6B8D3065C20C8 g#c
1,666,232,826 *AF560A10D04E99AD83C6D6213957FD4E255E4C5B GERAFFT3
1,666,232,827 *AF516772D54AD4406A01DA387C22393C52B2E875 GERARDO.BRUTGER
1,666,232,828 *AF5E650109A44A52A3FEEBD01A37522EBF8A77FA GERARDRUSSIN
1,666,232,829 *AF53A2427DAD6043E010EB340EE2191B1A4C3580 GETUNSTUCK.COMWWW
1,666,232,830 *AF552A44CD883BD98C9CAB6135588DC048023588 GIALINA8
1,666,232,831 *AF5411D5549159D9D244A916BA2A6AF4FECF0096 gimnasio-hermanas-gonz
1,666,232,832 *AF5E11A3A2F5A688DE5AE809EFA56F268251BB9A gingivitis5
1,666,232,833 *AF55120E3FD987B9E6291EC365E902DA34FD2CA1 GLIHX
1,666,232,834 *AF575600A7DAE1990624571F0B2C94B8C279B2C8 GLOSZZÁRIUM
1,666,232,835 *AF5BFCB05AC4EA10D2BEBF3C1A3BF86CF75DED0A GLTWK2WS
1,666,232,836 *AF53F2F398E7AFB6CFC799D093ECADD44BE62E7C GONZALO.ZETTEL
1,666,232,837 *AF5C78C905F6376E993BBB28BF4AF58AC7EF2975 GOSPAIN4
1,666,232,838 *AF5B23697AC6B01BB26930A82DDE47A0921908F4 GREGORIOTAMES
1,666,232,839 *AF5EEE46A86619547EAFBF24C2F30B90657460CC gremany9
1,666,232,840 *AF5994F6B809A308AB2E0017DAD994695CBD35E8 gw22s
1,666,232,841 *AF562DF2CE545F82BB469D2FA16185B6FCBC69EF HAEMERALOPIA
1,666,232,842 *AF53BC5B50E2E760650F5BD06809EA4CCB1C357F HAMITKAPLAN
1,666,232,843 *AF55ACA30EF1ED81B89842651AD20C5779F5A0BB [email protected]
1,666,232,844 *AF50C46526D49D322AD824A92A88562AC3A2372E happy”manila
1,666,232,845 *AF5573D576631BFEF91211CE19B4D1FFDCAFB879 HARLANHUME
1,666,232,846 *AF5A4A8CA29FC103C4E5C02DC3E21F3B558E2F59 HARLEY.BLOOMER
1,666,232,847 *AF56B9D7AFAAA8E63A8A11BC977A5A50A1D32846 HARRISONSTAHLER
1,666,232,848 *AF5FBCC4F6F97284E0F68C72B73753AD96243218 hassankatechis
1,666,232,849 *AF50CC2987DDB2F917E96C9E938D470CC7D62ACF HAYWOOD.DECAMP
1,666,232,850 *AF5CA6D9828B5605B59BB8E1A64F34B0FFFD6E5D [email protected]
1,666,232,851 *AF56D64BE2A06302387F3B4188A9E48B94A12241 HECTORSOIBELMAN
1,666,232,852 *AF58D26246D8C5D6B2BC10EB3D90FB08E33EF487 henrycottrell
1,666,232,853 *AF51BAF5C5AC979E232A6CA48D56EEE922317E22 hermanlide
1,666,232,854 *AF54917CE4A2F419F33E5DE92BF8EBC8C4155615 HER NAME (FEAT. YABERATION & LIL' DARRELLE)
1,666,232,855 *AF5BD1844B68F2F114C4D22AA015845E1FC01E64 hj3a
1,666,232,856 *AF5957A76FC2EB66B9BB7E67AF18CA6A07C9931A [email protected]+$
1,666,232,857 *AF5200226BAF93F9731D2BE89814275BE6F26ED1 HOMOPOLYSACCHARIDKETTEN
1,666,232,858 *AF5BE1B6D69172A64F30EB08A4258D6068721156 [email protected]
1,666,232,859 *AF5960964EB6DE02CFB152A6E83F49054AAC0189 house.4.kicks.(chuck.daniels.remix)
1,666,232,860 *AF51AD44448276C9636DFF22D07244228064DEFC HOUSELADY.BBS
1,666,232,861 *AF54E3EE8734ABF3B6C3E6779943231E8CD98D17 HOWARD.VAILE
1,666,232,862 *AF58DBE34B281D4D763D91E9BA33290372F29191 HSAF
1,666,232,863 *AF5ACDCE8D3E224B191EC81C33602CBC33E28FFF [email protected]
1,666,232,864 *AF5632812C06488B3869A40C2C1B4333FFA271E3 HUBBARDL1
1,666,232,865 *AF5FEDE3FFC0FBCF54F22DB8090FE005F4638FB1 HYADESP1
1,666,232,866 *AF5E8E50EC8DD7C6821D15FD1CCF90D2F32D8A66 IDELBERG2
1,666,232,867 *AF5B012174F6D592607236204CD7CBC1D078BD5C IDH8SRT
1,666,232,868 *AF5DF2B2B9334F709616327212EE8E2C618C908D idms/sql
1,666,232,869 *AF53B20E1E3A8A02C38EA681687254A35A789614 ILOVEAPRIL35
1,666,232,870 *AF5AF9277D5D6B20E64745565E000802F9BED91B I'm.Not.a.Woman,.I'm.Not.a.Man.(Berlin.Beat)
1,666,232,871 *AF5990C588CF98466BE30091B67B0EE0A48057C3 INDISPONE8
1,666,232,872 *AF509C002AC517FB9392945BDDE6401600A036DB infoprimerequest
1,666,232,873 *AF53D7A2E9BCA27DABE2C1F7BFED3025BAF340F9 in the song
1,666,232,874 *AF5B382F3CE2B17F5159F92EE112016EE875A98E isaiaspothoven
1,666,232,875 *AF5F062806BEA3A0EBDD76D2C97DF254BDB4265C ISAMPUJA4
1,666,232,876 *AF5C827262DD4F2E3D566B6A8A12082B09AB2040 ISRAELTRUSSEL
1,666,232,877 *AF5C14FE969EEC43691B8B0C9521AD71604BACB6 [email protected]
1,666,232,878 *AF560BA553C74F06654B48DE81698E04A7C3E8DD JACOBNORMAN
1,666,232,879 *AF56B95F0D9A67933296D9D7FEEE39590C84FC4C jahrwusendelaugwurde
1,666,232,880 *AF52F40F9D699AB1CAE6AA5AC7662705ABB312E1 JAMAR.HAWBAKER
1,666,232,881 *AF510E0D3DDA2B449F936D59C2C2183244B201EC JAMESHOYER
1,666,232,882 *AF50DD6C22B40C62414ABEE74489B917677203AF JARODVIOLANTE
1,666,232,883 *AF50FA2CC8E1C09B2843E9EC7050A408FEDB89EC jasminepraise
1,666,232,884 *AF578D4CF6FB3E696CA395A67D94DB8711716FB8 JD4J
1,666,232,885 *AF59AB3F9F57FB8B22E6381A6F4207F70B18FC6F JEFFERSON.SOMMERS
1,666,232,886 *AF53D12EBFD3289000F71CC031CCBD1376936C48 jeffrey-gan
1,666,232,887 *AF528D53F34DCA18059C3096120BA11500CDF8FF JEFFREYSHIRAKAWA
1,666,232,888 *AF51CC20F0E8F611ABC115AFCCBA983F71F79D98 JERAMY.ARDENEAUX
1,666,232,889 *AF54733A6E729E1524FD0B2B8108581CE8CDA5F9 jeremyclement
1,666,232,890 *AF527D0B37518D21BD265660353E1A948406E5F5 [email protected]
1,666,232,891 *AF518DCD1641E7B3656B52D0DAF1457824361744 jim.mowrer
1,666,232,892 *AF5883862B9E5843F7244095526139AF8D69ADEF joe-polish
1,666,232,893 *AF54477407A154F7BA7EBD03491A79161C3FCE96 JOHN.PLEW
1,666,232,894 *AF597AFE5D547DA8D7AC92C8F523EBA0A8A69440 JORDANNOFTSIER
1,666,232,895 *AF5FDE8A8AD061C76832CF07826C855771AD2729 jorisis5
1,666,232,896 *AF58B398ECEE00D7A66280EA5722B932019D8074 JOSEFGANGL
1,666,232,897 *AF52717FD208B40E7C3F80E1ED532899514A664C JOVILABE3
1,666,232,898 *AF5CD07E03B6B02904895344E28CE8E4B60BA375 JULIANABARRIOS
1,666,232,899 *AF52011574B1CD9B9E96E65A632790C66C49E4FC julioquiralte
1,666,232,900 *AF5B2465600A2F113CB3A60CBD1780A4438D16EF JUNIORSCHUCHMAN
1,666,232,901 *AF517F9ACF8B2D6C7AF8F5BDE9280A179BE34C76 jxtpsrnted
1,666,232,902 *AF5C7B9463F39D2E9A00796EC19277698B1ADF65 KAPPLZ
1,666,232,903 *AF56244F0A21E97E4884D227EC0B989B69D533DA KARMINASTRILD
1,666,232,904 *AF5F98C690E6BB7516AA03795EE1C1B153FA778F K.E
1,666,232,905 *AF5700D931E56477603FA0503B8278C42D9D2F45 kentonvilven
1,666,232,906 *AF58EB9D48F5CCD393E9E7C20BB8342DE24ED1DB KERMITPLASS
1,666,232,907 *AF5FC5ADBA2193667720964393CD3249B39E245A KEVINBEAVERS
1,666,232,908 *AF53B64955BF356F9991D059D42D468D95A7F729 KING OF FRANCE OR ELSE WHAT FOLLOWS?
1,666,232,909 *AF524DC0DEE2EC2410C8E2C03A4E5E34068135CC kipsalz
1,666,232,910 *AF5D17872EFB5B79E75D7CC60E7BC8E627ED4FCF (kısık
1,666,232,911 *AF5CE9C1B605BC6A29D70C507DF7701AEF4DE2DD KNIE
1,666,232,912 *AF5B9EED68234F803CD23E271FC085C412C5EAE0 KNOBBYTIRE
1,666,232,913 *AF5A442BD5656D6BAF37666360434D2BC0C18054 KREWTALP
1,666,232,914 *AF563FFB03E612961AB9FBE6E72FDFFD3CB4906D K,YR
1,666,232,915 *AF57F63B6C4BC5D1029FDAC708728E832E17869D [email protected]
1,666,232,916 *AF5BC3495E0D86EFB865FCD312F3161BC05D3290 lamston3
1,666,232,917 *AF536EA15B4E35BA5B18411039243E48DB8B14F7 laurenfleitas
1,666,232,918 *AF5F037A19B0D6266ADCBB28E9332F45613BDC34 LAWRENCEBOSCO
1,666,232,919 *AF540172FB02A7C6CAA58EAC87E37B1A7C7B4B85 ldnkttn2
1,666,232,920 *AF52112535BF2DEEB40DD94A6C813B61D2FE528C LEGERTON6
1,666,232,921 *AF56440E6BC346EBE52F98B68CFC79D6FAE1EFCC leogariepy
1,666,232,922 *AF5045B06BC6C3AA8765802BEE1C2E6130387587 leohogancamp
1,666,232,923 *AF5DF5AD6BAF61F309EE82BF61FD7B9303730EDE lesbergdoll
1,666,232,924 *AF501D5AA3E9DE257B8D81B740FD048BCB68DECF LES.CERASO
1,666,232,925 *AF58BCC7E6A1A38D4EE3CF52121FF0E7190705EF lescopant.
1,666,232,926 *AF50ECCCCA3219568A0C83AE4D6045DDCAB9897B [email protected]
1,666,232,927 *AF544E1106F4BE81C7A74D163C299C3773466477 limarifat
1,666,232,928 *AF5E6508F0AA0DF011A4D43264E73374FE897D13 LIMIN ZHAO
1,666,232,929 *AF5F26D37B3DE4E3F1F6144646281BD3AB7ECF8A lineweaverburk
1,666,232,930 *AF53F83F165605196E79D7A12EF8563ABE4C9075 [email protected]
1,666,232,931 *AF5969797C5721AF466BA61C4FEC6EE300FB9FC5 [email protected]
1,666,232,932 *AF5E9C24F9442DD226D50EAE4F3F45550B905815 LKASDGVIEW
1,666,232,933 *AF5CF07E007FEDDFF49F932C2980A852A615086F LOGANSPEIRS
1,666,232,934 *AF5C6C3FD4FDA163164F9561C73BABD39BBE3967 LORI-TULLY
1,666,232,935 *AF597FB75B9E31809ED8D48D02EBD16B31225344 LOTTONI
1,666,232,936 *AF5D4EEFA23E50D5DCF6DF5E8846010710E8F001 loudullen
1,666,232,937 *AF567FC21BC60FAAB820F4836BCB1B021393277B [email protected]
1,666,232,938 *AF5182B5300786B1C095513CE96914B2533E78C3 LUTHERSUNDERLIN
1,666,232,939 *AF5CF5DA3956791FDAC5E0A8CCE93F401CC17459 lyndonsambucetti
1,666,232,940 *AF5C597060E3E41B10C096D8B18F9CA49EEAEFB8 M1509718697
1,666,232,941 *AF541CA7E66C9B9ACA604BAC5CF456E17463FB49 macbushlen
1,666,232,942 *AF574E3606A92EB54D9064499CE8743B7A1E7043 MAGGIERAINBOW
1,666,232,943 *AF5A38E0FFB821B57E933817DA67C5BBAD6B6992 MAN-UIT-STAVENISSE
1,666,232,944 *AF545A391D0104D7233BFDBA1A1C1F4EC4A72583 [email protected]
1,666,232,945 *AF5908EB943CF31DD2C97B18BE44A06078C13C98 marcelinokeer
1,666,232,946 *AF567E183852EC102CD606A1F170A1362DB17B14 MARCELOBERNAUDO
1,666,232,947 *AF5F53EF9D61E265F5F4AFDB5DCA0D12FEFB8455 MARCOSKELLOW
1,666,232,948 *AF57E7FEC23945E92F7F859C10807150DD0015EE MARIEANGELA
1,666,232,949 *AF5F069AC965F8A26011BD47FC8424DD443CDA8C MARKCONEY
1,666,232,950 *AF5242385AC74C94B00BD76FBA0B086E9CF4EDBB MARTIN.PEPPERS
1,666,232,951 *AF587E2E186407BBE209B0A8CF52EB6596DABADC masonlawrence
1,666,232,952 *AF54262966B884B8AE826C6FD569D02A574418C8 MAXGEVARA
1,666,232,953 *AF5E31035E5896F93CC8DBA530BF08633D4CC939 MAXIMOTROMBINO
1,666,232,954 *AF513E33D09CB57B8D77AA0D92F691EF31CEADC2 MAX-(THE-MILLIONAIRE)
1,666,232,955 *AF5A4A5491F55D4A434DC6DDFD8476210A7BF7E2 MCFLANE
1,666,232,956 *AF58BD12080354A275044B2044418C45AA552FBB measure
1,666,232,957 *AF5A977EA4197E4AEC1C85850FA1BD0A2B7302CF MICAH.FRIGGE
1,666,232,958 *AF5296846A0A3B91C9FAC0D09055E8AE8B118552 MIDLANDI3
1,666,232,959 *AF5ABE822D8592E563A20C98A599D3D801D20B9F mikezeiner
1,666,232,960 *AF5D011685096220C49F77D0E718C745468E73B5 Mindbody
1,666,232,961 *AF51D38E726E23009CAE03AA22368CCC34638FF1 MIZSMILES55
1,666,232,962 *AF5CDBE09DD96FFE2A5E79AE02C7C51404FCEEB5 mohamedmackey
1,666,232,963 *AF56769FCEDA4AE77D93A48E70F36B212F47B124 mohammadattwood
1,666,232,964 *AF554CE29231E63540074B5AE7D11E1E502183FC MOHAMMADMAZIN
1,666,232,965 *AF5044CBF7D2921137C3B0732CDD68BBBC5A0AC3 musicbox-80's-(disc-2)
1,666,232,966 *AF592E240DE3B609558D645CAD3C2F265AEEB441 MYLES.MUTSCHELKNAUS
1,666,232,967 *AF505BB11914D548B29440C2FAFBCB56531E2A45 MYONELOVE98
1,666,232,968 *AF511909D8E0775D6A54278695C346D1DD2EE4BE NAGY012
1,666,232,969 *AF534CBF709F3880B58243BA1369692D322AD074 naumica2
1,666,232,970 *AF503AEED2E4E669A9E9A8E8B26BDD360DF930B6 nico-ardian
1,666,232,971 *AF595C33CD6AD56B3F32337D6B99BCB31301B0ED nlipshut
1,666,232,972 *AF5D04E4CD69056E115E7C2F25B839D7D8DC06AB NON-AUSTRALOSPHENIDANS
1,666,232,973 *AF590881DEE4E16E6C220EBAFBDD7A6314B61586 NORM.MARTEL
1,666,232,974 *AF5883966641333F8109E6E0092DB2B765E152DE norriscotton
1,666,232,975 *AF51E9AD83797CA08EB7D0B01B8A96480B8A9260 NSEHORNING
1,666,232,976 *AF5224D8BAF77FBE2D32E9201D1D2082182B3CA5 [email protected]
1,666,232,977 *AF58FF51AE501A659CE02CB0332269CEC7E441AB OĐASARKIIVAI
1,666,232,978 *AF58E1F5680ECED524493D2872DE93BD6FDB3C8F (o_-) * * d#q
1,666,232,979 *AF595B39220651C34E7D71FDC7646297EF4AE3F1 oftentimes.more.than.$100.00.dollars
1,666,232,980 *AF5F584B79B3E1EA8D2FA5B93B479FA702A9C1E9 OLLIESTALLONES
1,666,232,981 *AF545D35AD7CB234B45BCBE10B5C1F5A3018193A o(montserrat'slivetakes)
1,666,232,982 *AF50538C3B70C3FB738ABCFA04EE3AF8A74A415E [email protected]
1,666,232,983 *AF59245A50C223DFBC4AA8DB753253665F455BD2 OSCAR.APPELLO
1,666,232,984 *AF5BF547B3DC9A1B163CF6072D4A67D879E50996 otaviased
1,666,232,985 *AF5A10FAEB8E3A8B0634D99FA323955021C33A78 p######) ~0 ~o:p
1,666,232,986 *AF51CE22BA4AF98FE160205FF833D43A7344C6B7 PARABOLES9
1,666,232,987 *AF5621C8CD3B748B2834ED4A09870A4122FFA5B5 PARKERVANDEVENTER
1,666,232,988 *AF50C38D4FEEC2F7D4799BE67509B6CAD047A422 PATENT_BLOCK.'P/&/T//NT_BL/A/K
1,666,232,989 *AF5302847C37E3A591F126ED1705E8789EFF0609 PATSY LANGE
1,666,232,990 *AF52C8DE53E33460C4593FC25C87CDC2114CF0EA PATTI.CHAMPAGNE
1,666,232,991 *AF5272DBF24CB7A873E94804E8866508300AC031 p=====B-~-Splat!!
1,666,232,992 *AF5DC7FF11E7E665F50BD2DA0B072A0704ADF8C5 P#D `~ `~ >-<
1,666,232,993 *AF510499DEFFBF26C119356CAB47A8DAC053FD18 PERNIŢA
1,666,232,994 *AF58AED897E75F6E8B1B4097FBA755EDAD6A727C PERRY.STUFFLEBEAN
1,666,232,995 *AF504B7D942757754113630774665E9B685C61BA petition-for-mercy
1,666,232,996 *AF51DF30B61013CF3FCAEBDA6FE1E0D8858DC7AC peyton.hudson
1,666,232,997 *AF51E1828B6207DBAFFA806187827AADE963A09C PHILIPBEMBEN
1,666,232,998 *AF53EF3F326919F1F1CBC48E7AA07A018089AC48 PITTISH
1,666,232,999 *AF5DAC9BF11D03DD1001473D622FB02F25E39AA8 pk05enn
1,666,233,000 *AF531345C2779571FA412452720FECBBA45CF998 poohbearwelcome
1,666,233,001 *AF5E747EF1738B06B1DEE1AD6E21852AC0A5A015 PRAELUDIUM
1,666,233,002 *AF50B40741CBD5A2512DE0D53A946C7654839AD0 pullmanizes
1,666,233,003 *AF5744081C2CC6A04ECF46C8AF1481112B818671 p$ych0g3nc411y
1,666,233,004 *AF5CC2081351DF662E42CCAF991F7FD358F7C2AE [email protected]
1,666,233,005 *AF571A7498AEE622E8311981D247575258F62003 [email protected] ~o~o )o(
1,666,233,006 *AF5C196400E135C60582CC815F089588E50CE70E QUIETUM9
1,666,233,007 *AF5E5C2B70316D756C036AF839BF8C99D1CB6A37 RAYMON.GOODGION
1,666,233,008 *AF5AEB0159F7ECD0300F59622E5F9580706E6898 [email protected],
1,666,233,009 *AF5CBD527261C1E8C70307B0DEA6D4449F727387 rebegsua
1,666,233,010 *AF5EA81E7C8E4F4C017F1D0649231CFADA955557 refugiomull
1,666,233,011 *AF5DA3A6E86085C2D755E958A7EEBCE2A901CFCD Regrebkcots.1
1,666,233,012 *AF5401E9897003CFDC8DE0BF975D0613B7CB7E56 RENDSZERELEMZÉSNEK
1,666,233,013 *AF5755F7963B64B140ABCCD7463174813DEE09A1 [email protected]
1,666,233,014 *AF538141065ECE1044268E07E1AB5B94131758C1 RETRADUIRAIS9
1,666,233,015 *AF54BFD44C413ABFB7A707DA50A6FF91A192F91E REUENNEW0
1,666,233,016 *AF5877CA3D081B4A9255C4A9E8E95B6305997721 RICARDO.OBANNER
1,666,233,017 *AF588B3ACD2E25CCE7F9E310CDAE21257C5C9F4F RICHIESWAMI
1,666,233,018 *AF5F74CBD5718A566EE2559E79F7139BC7086BA1 rikasmi
1,666,233,019 *AF52A97E35A6AAD1F2171B9D6F014C617D954672 ROBERT.GREENIDGE,.MICHAEL.UTLEY
1,666,233,020 *AF5AC9957FE8D8ACF1C6EFF428D0EFDBA6F5DDBB ROBERT.TILMAN
1,666,233,021 *AF514F982BF5E6AAA4F478B505BE98EC6BE8E1E2 robtdraeger
1,666,233,022 *AF5C8268B8E2D68B674D3788052F4AE54BC891DB rockon!!!
1,666,233,023 *AF5544A8ADFAD9F3342063C12876CE5A14CEC0EF ROLANDOROBBIN
1,666,233,024 *AF57EFF32C4E57286585F685357E2F857FB81AC3 ronnykapp
1,666,233,025 *AF5C73B6DBA370C875E4793F8DB252370AB4E89C rostlinky
1,666,233,026 *AF5FDC5C0B5AEEC6D30F0779AFBA3BD6367C6860 RRKG
1,666,233,027 *AF586451B5B3FAC670584964870B31A599E7F10D RUDYLOREAUX
1,666,233,028 *AF59249705FE844B79C3B25A3287EA5A2535DC14 ruebenspeilman
1,666,233,029 *AF559786568B25064E145C93F1F4E003DC22C935 RUMBLEMUNKY
1,666,233,030 *AF5845D3579F3CAD9A41928116CD69D6215C2012 rustylaroque
1,666,233,031 *AF5851313A9A5E7BF60DC56BA2D2093D0FC94674 s1743921304000080
1,666,233,032 *AF5B4C29B6C156637F6F1DE4BF2ADBB951547252 samme
1,666,233,033 *AF54D034E60DE74ECD86A08A4607AB1551AB37E0 SCHWEISSTRIEFENDE
1,666,233,034 *AF5C5D95FF12A2B20D8D915FE1AA3A187AC2FEE8 scuppet
1,666,233,035 *AF5CF530AFC39EA90B9C347A56675CC461912958 [email protected]
1,666,233,036 *AF5C2FC228066AA1BA9CB27556E2E7770AC2AC27 SEALED-WITH-A-KLIB-(KIPLAND-P-KINKEL)
1,666,233,037 *AF5145DCD72094E92814F6D141A611591B46BD17 SEPPAREGNUT
1,666,233,038 *AF55A4033CBDFCB9A83A4689B2CD2498183BAA64 sevilojne
1,666,233,039 *AF56813D25C7FE77EA3D2D5130AA3DBC98E70D90 SHANE.BRZOSTEK
1,666,233,040 *AF594E71EA2F1A44DE3BF7EA7F37E847A8A3E2B1 [email protected]
1,666,233,041 *AF54911A7AAF5A187C137D49414DB215B4C2E94E SHAYNEHORRIGAN
1,666,233,042 *AF5004DF45825850BFA277DF4C01494A1095B152 sheldonfassnacht
1,666,233,043 *AF537511C82A2ECF53DFC5A809994206DFBC3BB7 SHERMAN.HOCK
1,666,233,044 *AF5497BE4BE0466114DA82AE8F65C71D6C299901 SHERMAN.RONSON
1,666,233,045 *AF5DCCBC98CB8D5FE4838C1A26CE822851F9F225 SHOENVTING
1,666,233,046 *AF5AE0AA50CE4131FE1AF75C0A493D96DF45E613 siaresucxe
1,666,233,047 *AF594919844F0F27FF57D83001329D110689487B siebenun4
1,666,233,048 *AF5AD6DA1802F34E28ECCB28D31BD189FE8CB82B SLIBBERIGHEID
1,666,233,049 *AF51B76F261B2CC9C2956DE18C7D13E26F7352E6 so1va7on
1,666,233,050 *AF57D5F862F3771CDE116873D819EA932E13B5CA [email protected]
1,666,233,051 *AF59AAC1E8F417EA5A578EF8E05492FB0EB2E110 soothsaw6
1,666,233,052 *AF5928BA3F8F97201D91B50A47A309DEBDECE968 SRETNUOCNEER3
1,666,233,053 *AF5D7DE9E0D5FD2E30682F0081085DA62A75656E STACEYLUDVIGSEN
1,666,233,054 *AF5236180C8A5C705EC8462BF115487A7B27E857 [email protected]
1,666,233,055 *AF583BEFB725DD5F95747FD0396FA5BDCD9C1996 STALA9S
1,666,233,056 *AF53A00BB9790A72FF4DC365DEE3DEC0ABE7AD39 STAPBAKU1
1,666,233,057 *AF53EB9EB34A07D1DF70EE8EE012116F73CC135C starsblessonesstarsfallononesknees
1,666,233,058 *AF5280050E98EB4051C2B325403121356DABBBFF STEPHEN.KOKESH
1,666,233,059 *AF508F2A879E6FA5D82FBD4527A1E1B7800AA3C8 STEPHENNANCE
1,666,233,060 *AF5FED94883777B6A8C9F03F5899BEB4EBAC2380 STETSAKDYPS
1,666,233,061 *AF5809CC5571EEC79FE86671D10DE3A27F214194 STHOVAN1
1,666,233,062 *AF53546E6B62DD40EC5E84F86F0776DAAE971A9C STOKEHOLDN4
1,666,233,063 *AF5C0399C1CC57EFE1330C04604C207247D38660 STREZZA
1,666,233,064 *AF5CCC3F965779CB8158E9114ED45B66599A4C33 [email protected]
1,666,233,065 *AF509CD711B24CA7E59E6E46F8F33B75A1168880 subthrill
1,666,233,066 *AF5789490E969554EA8A3F82C476E0A4C11B785A surbhidureja
1,666,233,067 *AF5E06E38947EBB816DF02B8FA8FB426DC62CC13 swirling mists (a) :30
1,666,233,068 *AF505D6B11F5C5171154A98FA0662D5992209B30 SYMPHODUSMEDITERRANEUS
1,666,233,069 *AF5D189A13A37DCC2C2B1923F069724CD4127A58 T0UCH.P4P
1,666,233,070 *AF520A24F4D888ED63BD76849994A58F1F02176F T137672
1,666,233,071 *AF5EA638611C9D09DEAA87A421BB0E78347F6E11 TALK86.14.234.141
1,666,233,072 *AF5360A519734795F421B3CD388C266DAFB679FE tamimmhanna
1,666,233,073 *AF53830098E029933C1236DFB28951717825B3A9 tanyaath0
1,666,233,074 *AF5F90059AB7AFA5A91E1C526A378A42FA0181F5 TAPARPAN6
1,666,233,075 *AF5015DA33F80591F55A36BD3DAB4AC5AFA21A7B TARGETINSIDE3
1,666,233,076 *AF53286FA38A6179A4F4A0B57BDEB3415E0EBFA7 templetonia5
1,666,233,077 *AF579A441D1E0672ED39BA169B93E158EA1DBC3A TERESA-WALDROUP
1,666,233,078 *AF53CA5F1A63E9FE8BCC682DCB8EF531F32D31DE TFFNYTDY
1,666,233,079 *AF5213FAA7A584BC0706815CE279DBA02C18E3E7 THALAMI
1,666,233,080 *AF51FD7138F718FD22E4C3C3B51E64DA1870020D THEJAKEY96
1,666,233,081 *AF528B76844B4EDE05406485C2A0F637B883A5A2 [email protected]
1,666,233,082 *AF522CA512574F7A145077DBAFFBBC95873B3964 tirailleer8
1,666,233,083 *AF5AC4F15D035A6AAAB5866CEA46BC8905761EFA TISH1810
1,666,233,084 *AF53DE4696594EF17234F60E6CBF26686A8092C4 topic1013lisa
1,666,233,085 *AF5E774576BD681B7EEC3905D3FD4C7B32511B19 TRANSLATESFNET
1,666,233,086 *AF5782359B38F93891C1A5CF7C0006367CB63714 TRANTRANS7
1,666,233,087 *AF55CF86765AE98757A17097A10538E641FAB743 TRASPORTULUI
1,666,233,088 *AF50608A230F30A3E255B400B50DEEEF7FDE26D2 travis-junion
1,666,233,089 *AF5A370308E3B0DF237B392295A090A2C5C882DE TREVOR.SPANO
1,666,233,090 *AF5FB8E85DD977458F2B7EDB9480EAF5210886A5 TRTSDRGR3
1,666,233,091 *AF5A7F6E03E0A8D7A68FEC36BD5FFD1D876A74D4 TRUCCIONES
1,666,233,092 *AF539B58ED5AD24C32DB9B1776C67D354FF58B68 [email protected]
1,666,233,093 *AF56374B2AABDA1D0CB572EB54A25673729D1FAC truskawieckiej
1,666,233,094 *AF5DE4E73B11555AA7E050BE137C133A935F60C6 TUSIND
1,666,233,095 *AF56D5D7EED399DD8B9038135230DCA120310AA6 TWINSBENNYING
1,666,233,096 *AF5F53985C5AEAA20C8B43E3CC0BB7F9C34F4012 $U8134$N9
1,666,233,097 *AF5F696A2CFDD240FE31F62A9F4D326643353A89 UANG4
1,666,233,098 *AF5596A3BCD3FADF7386C0753B81055DE4C8F047 uitbrandingen?
1,666,233,099 *AF555794FE1909D930C3BA7363F397335A333356 [email protected]
1,666,233,100 *AF5C00A21DF4246398F9AED849B0183A33C9308F UPSWET
1,666,233,101 *AF561867DEBF485326A2A5946F1DE1099C39F288 V7:@
1,666,233,102 *AF533FAB1A0A6730EFABDB3B9CE0F962D4EDA1D0 VEDETT1
1,666,233,103 *AF5A1E9AE193F474483554645FBCEFE3931C9D9B VELEKABOO
1,666,233,104 *AF56DB24F07A64AD7CC45F43C05F6E86A458EF6D VENTRIKKEL3
1,666,233,105 *AF5D220E407CAC3F43FEDD8B1AC8255E66E01412 VENZOLA
1,666,233,106 *AF5889BF8358797003F1A571C11D0593C1FEA394 VERN.GREFRATH
1,666,233,107 *AF5D09E99403A2AB864BFD67C0AB1966305ED869 VEXILOLOGISTS
1,666,233,108 *AF54015AB6A4969E20CD9ED502FDE6EB0B234DA6 vicki.szymkowski
1,666,233,109 *AF5DB9F08E55975692319D706D4B41ACF38F01AA VICKY INGRAM LEWIS
1,666,233,110 *AF54EAE5B498FA7E7558CC6F59F0DB57D376786A VIDEOKAMED
1,666,233,111 *AF57B35592BBD57E8DC9B87D432150E05E57931A VIERMAANANDYAP
1,666,233,112 *AF53719D1AC3805FA2A17BD2BCB516BD6331D4E6 VINCENT.SICARD
1,666,233,113 *AF5B2974F02EA546BD2905FB5A8BD04A0C6B035D VIRKKAEN
1,666,233,114 *AF54D8D4DADC1EB67C7351629FDD9410E713D25F volume5-123staccatoandlegato(2)(a&b)
1,666,233,115 *AF5C71E1F982015A828E3A95A6E62941AE084858 VOYEU0084
1,666,233,116 *AF521EF8D82F797A968529A240BCE1EC0472097E vrkfltsrglr
1,666,233,117 *AF58DB484E8A1F90E52EA118FF394CB99FA92577 W\<
1,666,233,118 *AF5717DB961826D3855A1DC6E6FD78982B1030E2 WALLAMV
1,666,233,119 *AF5E79DB9004463C1B42793D47C32B436A9A22F0 [email protected]
1,666,233,120 *AF5BB4C0C46C4AA96F68767FB0A43E974C9F1AF2 WARDBELMONT
1,666,233,121 *AF506CDE7AED6EC392996F6EEDA8B3F629DD509F [email protected]
1,666,233,122 *AF544F2075FE57A5AAB79C7511A76B841FB62C9F [email protected]
1,666,233,123 *AF53299178BEEC4CEEB798435938CCE3936D25B8 weldondituri
1,666,233,124 *AF545F59E6A7EA9976FD274F81C99EEA81323B18 [email protected]
1,666,233,125 *AF5010735933893A566A91E3D5241098790AF42B Whatcanbehiddeninabook?—LemonySnicket
1,666,233,126 *AF5B2CCC24458279500DD47EBB43F2E873023F09 WILLARDHAMBRICK
1,666,233,127 *AF5B9CCF48D4A666534D2AC10D69590142E1EED6 WILL.ARROYO
1,666,233,128 *AF54E55216195E296BDF5388BE1D82BE8F2E2F9A WILLY.WEABER
1,666,233,129 *AF5E0B19D26F4F522A4035C3BCC39F229108B1E7 WILMERHENTZE
1,666,233,130 *AF5A67AC5836A65872029E4F3DE8B54A673ACEEE winstonmenchaca
1,666,233,131 *AF566112F585A20925FF73ED2E685A93CC47E8A1 WITHOUT.ME.(INSTRUMENTAL)
1,666,233,132 *AF5080610D8CC398DB2966BDB165A82662DE1816 [email protected]
1,666,233,133 *AF595626CBA4892771BD61F577E455BE15C76736 wwwboomerfurtopiaorg
1,666,233,134 *AF504A662E18C47B99ED72E4A0F3562D645D1EA3 wwwrolltidecomview
1,666,233,135 *AF5DF02A13FCC04CF5BDF6DFBB7D2E47F0C09FCA WWW.XBOX.COMJAJPPRE
1,666,233,136 *AF515140D0B374F207069D066F99562A1817C264 X154160
1,666,233,137 *AF5A98328E1092C813C717E457694F582F02917B X3MT N
1,666,233,138 *AF550C2079B94E196E6BCEE6F000845EB65B93F7 [email protected]
1,666,233,139 *AF533337A51270808D02D9B16BCA4574944528B4 {X}` (----B
1,666,233,140 *AF5EB679E4EE272685412EBB80E5C2ACC05AAD27 xianloguo
1,666,233,141 *AF5A0F8E0297B4556F579E3F4EDA8993C4F07BCE [email protected]
1,666,233,142 *AF5C9E5E627BC5762255402C69C044269FA0B3CA {x}~`-~`q------p
1,666,233,143 *AF584610AF13E5393FFA42B565D4539C12CCECD1 [email protected]
1,666,233,144 *AF562AF8B7618EC821F43BA88D8FFC4E873E8B3A [email protected]
1,666,233,145 *AF5B2C618BD5DE65527145666DBF65C3ADEDBB97 XWRIZOMENH8
1,666,233,146 *AF55EEA14CB524ADCF3C28FC0DFE647A58942C80 xyphea-ramerez
1,666,233,147 *AF53994E47FF57EEB9E4C1EF0508C8A85D6EC986 Y7Y&
1,666,233,148 *AF5A5FFD845D7FBB30134D03BDB08BA3E9513520 [email protected]
1,666,233,149 *AF5147F790C7460AEDE56862CA1A6F0D260C3E12 yardsthe
1,666,233,150 *AF5C3CAD1AA3DCBFD4C22658574F23FA494F4BDD YEJI.AHN
1,666,233,151 *AF55CBED837F0428846D8190F7DFD910D3E94968 YEREMIA.DEDDY.MULYADI
1,666,233,152 *AF5AFCB12BA99917AEAC1AC28D332C0A9EB1AB4F yk)o
1,666,233,153 *AF5E6A92213AFD447DA92E7396594E3C3FC6C79D yllebram
1,666,233,154 *AF5C33AC7DAD402511D8AE4B7F2C165D6D35BE5E YOSELIN34
1,666,233,155 *AF51F522B034B1A9214A86DCFD06F41585A6BDB4 [email protected]
1,666,233,156 *AF5989BD979A79CBEF62F80EFCBCC27726D7C615 [email protected]
1,666,233,157 *AF53D04E16A5A36B750FB204632049978C37DE7B YULIYASVIRIDENKO
1,666,233,158 *AF5D2E172038FFF4098B49C0E203722079C234B8 ZACHARIAH.FRATRICK
1,666,233,159 *AF54E160B147B6E47A8CE904042C4179FDE95A0A zackconejo
1,666,233,160 *AF59C5D0A968F75F9F87681E320094D19E0D8F4B z{bi
1,666,233,161 *AF5156A0CD21C854663526C828098E48DF17213B [email protected]
1,666,233,162 *AF5FA99515B84BFB75A3ABE167B6F5024A28F085 ZHONGGUOSHOTGUN6
1,666,233,163 *AF55530F94AA7656F6219BB893F6C32C0EF8F03A [email protected]
1,666,233,164 *AF511C3159B1401F2CBF09DB1B73110D44A688D5 ZHU-QIANCE
1,666,233,165 *AF51828EACE03E338B8571920A62FCA274BEA992 ZLATNICK8
1,666,233,166 *AF525CD7B5E99BBA8DE8687C4F5FCEA03437E893 [email protected]
1,666,233,167 *AF586AB5FDEF7532B6275060E5CF2BC8ACB5EF2A ZONELIKE3
1,666,233,168 *AF5EB178E3A334B88901E4129A4A3839ED576DDC z<xu
1,666,233,169 *AF5527AECC3B3CE0AB7A9F6EE41AC7AF278282EC ZZ+H
1,666,233,170 *AF58480CF23223249ED32CDEE4E1B83FAF5EA03A [email protected]
1,666,233,171 *AF594234D8E77647DC30036923AB6F17BD8F0566 νταβιντ
1,666,233,172 *AF5D4CA3651C992BE48F060EF07EF8E4C6518A5A дайнэмікс
1,666,233,173 *AF5018F34BB5423878D2C3118FDC9478051817FF ДАСКОЛОЯННІСА
1,666,233,174 *AF5D4B398096B6F364E8516BCCFE075C1D8559D0 ЗАСТРЕЛИСЬ
1,666,233,175 *AF5DC2C4B2298CFA4D7B598F59082E8EC9071A39 СТИЛИЗОВОВАННУЮ
1,666,233,176 *AF5D2BE529A25B89783A1EE5060E89B806DC895E ЦЕЛУНАХТЕ
1,666,233,177 *AF5A8AF663697D8EDC6467E06E818D868E90D716 щамлагерът
1,666,233,178 *AF57FFEFBA486E25B5CF94D1D5996D907A4DE973 1633679 jos ty
1,666,233,179 *AF5198EB31D5CFE8D650A7966F07D3DA889C942D 1719527 ULKOMAAN PAKETTEJA TULEE TEHDYKSI JA JOKA SUHTEESSA P
1,666,233,180 *AF59D55FFEC02FC7EABF19039A91E084C967AEA9 19770227:.Munich,.Germany.(disc.2)
1,666,233,181 *AF59D5776D529FAB8411D6C7A6F4177E6B070EE3 19860210:.tucson,.az,.usa.(disc.1)
1,666,233,182 *AF51C8AE1A85EF28741D19B3715D464789070FE1 1ACCEZIONE
1,666,233,183 *AF58599D1248BFF4E68472C33FFFE96746EE3D57 1AMPPO57
1,666,233,184 *AF5CCA484B48BB912E079ABA5182DE9F2230A1D9 1 CHEMIELAUREATEN
1,666,233,185 *AF5D5E2E154386B99E88E540559029098B479FD0 1.HILLARY-BESUCH
1,666,233,186 *AF5D1D7F39630006DB3CFB9090B3F4C0E5694727 1-humanit
1,666,233,187 *AF50CF420A09C2BB7F0742A633B718DFA559958D 1 MAGISTATSMITGLIEDERN
1,666,233,188 *AF51BFDDDA466E5E0FDF3A4C84A664DF9FDE2441 1.modeschneider-lehrling
1,666,233,189 *AF5F507E52C11B4223063F175EC20F0F0D7FF16B 1NONBRUTAL
1,666,233,190 *AF5A7FE501EEFDD89208F4183D9EB525D97614CD 1.POLYMERISIEREN
1,666,233,191 *AF59CAD605F607F4C0421B798A563178FAC00E67 1 PURISTUSMENETELM
1,666,233,192 *AF5AC774C4BE838A121C676E57C6DC12085CD130 1thattoday6
1,666,233,193 *AF52E3C74F78FD6B1D57994B3DD7AB8BC8A8850B 1 VERMUNDSCHAFT
1,666,233,194 *AF5FB528F644B7E309E99CBCA6C606BC154D3599 1-VIRUSTIETOKANTAP
1,666,233,195 *AF5A931529AC5345430BD2C02C7EA34D864D9178 1-VOLKSUEBERLIEFERUNG
1,666,233,196 *AF5766DB700B0304CE5CE4F6814A8F6B109E5239 1 YKSIL
1,666,233,197 *AF5812BB54D79F03B528255F413F93539F7EE0B4 2055220 AUKIAINASALIENOLLESSAAUKI.
1,666,233,198 *AF51DEE7276F4530123F20FFD22C5ACD679F8F95 2160062 otsikot-voidaan-lukea-my
1,666,233,199 *AF597197FA465078F026940A2C03FD340B04240A 21-Weltraum-Standards
1,666,233,200 *AF5E7A0C8D4CC180C1342618C4B0682D9DBA118E 2696416 diemitgliederxybandewarenstadtbekannt
1,666,233,201 *AF548462E6A32B8DC4FF70B39EB8AA22D8FBAF15 2.FRIES
1,666,233,202 *AF5F9CD7832A62D8207DE584AFA5D5832C0D1376 2.gesamtspanischen
1,666,233,203 *AF5A37E78F75EDED17C39524D7A765A7D2BC9C77 2KEIRETSU
1,666,233,204 *AF55218884D2A4E37736EF8D12434F97AAAF9F3E 2KELLOEN
1,666,233,205 *AF5A9F7167158CAAC19EC705A44DB1717471E93C 2MASKALONGE
1,666,233,206 *AF56D19C30EF2EBA81D176617EDDE63F6EF92248 2-MERKONOMIA
1,666,233,207 *AF5DD7A0CE7576DDEE9A34E2629223C504476015 2SONAMI'S
1,666,233,208 *AF56C319B7A121BB2476857E883679AFEAB9436D 2THEELVIS
1,666,233,209 *AF58DD1717D1732004C2F0EC791500727C228E64 374karli
1,666,233,210 *AF5FE6DC5ADB077023D8E1BF72CCD3B90D88403A 3babushka
1,666,233,211 *AF5BB5815C385C45FD2CC0EAAB6FD411C80180D1 3-KUUMEENA
1,666,233,212 *AF5851858D25375EE54B2D4610256D35E1A7A045 3.NAENNY
1,666,233,213 *AF50C564C9CB4A91A0F858E6A29155FA5A1FF889 [email protected] ~O )X(
1,666,233,214 *AF5717C62E49F27E32196BA63779CC6006782B2D 3-toimeenpanoluvan
1,666,233,215 *AF5A9DEE90F9954FB7A82415A395D9E734A4E299 3YCHERYD
1,666,233,216 *AF552C1BDAA55E93B6333F869A0F793F455E0104 3節目名稱備註B
1,666,233,217 *AF5786DE73D7954A3B59AC2FD121D6119DE35F32 40-hours-of-waste
1,666,233,218 *AF57016DB71A64FFFBA53504ED9E1F2D4798362B 4c4c2b34f6c1339fb8a32cee2971c710
1,666,233,219 *AF585FCC507886F56CE3074CAC5A048F3B96A630 4mycharlie11
1,666,233,220 *AF58EBB9B45AF3166E5228FFE0C470357B8EE3F1 4OGATA
1,666,233,221 *AF540E6F9CA1A4F287FF22DB46DA2C0611D76D64 4RYMYAEMME
1,666,233,222 *AF5C1ED434C7945E1170A079ECED1EC8E3798191 4SCREENINGEFFECT
1,666,233,223 *AF533692DD7AE98C291AA3116048939C98B4CEC7 4SORRELED
1,666,233,224 *AF544083B40BAF86E3379CBAB7D96ECE53A0BACB 4SREGALSWUOT
1,666,233,225 *AF5BD8DDD386AEBD1880AF1DC3F62946013DBFC0 4SUDANDO
1,666,233,226 *AF56FBACAD24FA638373CA8E5E2B73D3B5B5A83A 5CPEGASUS
1,666,233,227 *AF512B91BCDD7151C8F9B3EBA36CBD6DAC60E9AA 5CREATIVETOM
1,666,233,228 *AF519D7F5B4673735FDCF0AC719220B282D19E32 5DECEMBERTHUNDERB
1,666,233,229 *AF50EB54D1EC7BB2AB07BF8FFFCB60DF31448FD0 5MARKGALAXY
1,666,233,230 *AF5E536B2F4FADE5D70C141F45D9F0F9484BE805 5PETSAMOS
1,666,233,231 *AF5A5E9DE06DE5C46F3371E023F32C264F3FC0A8 5SMOUTZETTER
1,666,233,232 *AF53D28CF19764876568C0EC3708EB5F6D099577 5th-avenue-blues
1,666,233,233 *AF57ED64396314512615B0BBA32CE30BBA1FA273 5UNCUTTABLES
1,666,233,234 *AF537598DC35ED8790CA8295CE0FE72866F58F5D 650ian
1,666,233,235 *AF5F8B5CDCB2C2D31D1F812444F4954734278DBF 672649 tiedostamisen-(-conscientiza
1,666,233,236 *AF509491DB2E705C9D3C67148E43D64D59BA57C1 &6A
1,666,233,237 *AF554D5F3988B616495822B5FFA14211C745C83C 6BSWWILLMING
1,666,233,238 *AF59CED9C51ACC8C9BAAD5C962B5BB90C132784A 6CONGLUTINO
1,666,233,239 *AF5FE05FE8CAA82AB617F9C32E47948B7572AAF7 6FORBIDDINGNESS
1,666,233,240 *AF5049809A6D0B74453745529102ABC0D42D80FC 6M。この山の麓には
1,666,233,241 *AF5FCA0FA7ADA1124A4DCDB01D6C435DF39A6B24 6TAUNUSSTEIN-NEUHOF
1,666,233,242 *AF5FBD8C9278A69BA8E6D63A0347DC0E958F5C18 6UNTERNEHMENSKREDITE
1,666,233,243 *AF56A5FF3F819BF092BD0BEFA2C8CAB38EA7AB63 6VICAVATE
1,666,233,244 *AF5BD122624F17F31B97ADFC4E0997BEB8ADA0D5 7BSWVANGEENDERHUYSEN
1,666,233,245 *AF5826570CC2CE6E26D2ECD5C0F46D959C312A7E 7CORTICALI
1,666,233,246 *AF5D2CE93C9BFFBAF41F48075981247E79565041 7DIANEDADDY
1,666,233,247 *AF5E86D8A968B6A40D283E24C3FEEFB133A417C8 7ESCORTLX
1,666,233,248 *AF5739913BFA4D3A5FD78DCC6A640269AE665CC1 7grasseye
1,666,233,249 *AF5DC6CA776D25D8DCC5D8AFF70B7F85DBFD8AB4 7RANDYCAMARO
1,666,233,250 *AF5BDA6F1D0C85017B66FD5E734A919AD51E4F93 7TRACTORTAURUS
1,666,233,251 *AF54133CF1B643A3402AFB181E90D768926AD863 7TSOOLEPOH
1,666,233,252 *AF55154DABA23D5441DC3D74006CB4D248FBB97D 7UUYGUOT
1,666,233,253 *AF542ED3421410E42CE6D361876124CAD438FC70 7VERKACKSTUECKTBS
1,666,233,254 *AF52ED884B6F91A8C71972FAF680C8E1898CA2C7 856micah
1,666,233,255 *AF593150AA06EDB1DCF9D45AFA872068AED0E9E9 8ilovejenifer0
1,666,233,256 *AF503B45E66959FBFFF6412A99D8F7CED7B0BDE0 8prometheus6
1,666,233,257 *AF5581D49A3C2614646C92EE00855D2AE7ECE60F 8thaveswing
1,666,233,258 *AF5256C012FCFC05131FD1F201391710261BEE36 8TTRIPLER
1,666,233,259 *AF5748E98E7A54C976E6CC2B940B2A9E33803BFA 902DEMARION
1,666,233,260 *AF564E99A1084D2CF1E6BF717B97383352E52E55 9APACHEWALTER
1,666,233,261 *AF5CADA2955053EB00641C42BA858D784CBBC967 9ATTISSAP
1,666,233,262 *AF50360875D9ABD1632C824777A92BDCFBF7976B 9CREPITASEN
1,666,233,263 *AF5A694071A3003E9BCEEEB938E9A4339CB7D45A 9MIDDYMIDDY
1,666,233,264 *AF5E659A03ACA6EA3B08F63299B3A9A10A3652C9 9MONICACHRIST
1,666,233,265 *AF576B1384337FFBAA1406D77C4534B5EA5D0DEF 9periostoma
1,666,233,266 *AF5DD85C4EC289E5F3CEF9FF45D1B9892D2EB830 9TAFFYGODZILLA
1,666,233,267 *AF5E9C809AE74E62CEE9257E80931EB04A001DCA 9TANDENDES
1,666,233,268 *AF57DA833DF1AE656E634B333FF73A68F9A5C528 9TETRANEG
1,666,233,269 *AF5FCC2EB6869666291CC49BB5F52A7682211DBF 9thesphynx1
1,666,233,270 *AF5D1E7780CCEA6780C17C6231DD2934F0E0A0BA A0KC3
1,666,233,271 *AF58978577029A9DF41B88E5BAA57B9B0DE0418E A.0LC
1,666,233,272 *AF521C1F510D496747A34E547BAB30C2F4EF522E a5;8+
1,666,233,273 *AF5D3E4AEE134BF916DB81FCBA666F358A74C08B A6MRC
1,666,233,274 *AF5355C746668A25C3E81BCC580FD12F5A095536 aab(/
1,666,233,275 *AF59269D1A9CDB43905D27F521F1CE2D5C5E92A3 AAE*H?
1,666,233,276 *AF50D8BE1F87185782271FF621CEAFE5D2ECFD61 a;ata
1,666,233,277 *AF5A9FAAD7203D66EE47CB8F98DD83711D855FD0 abigail-smith-adams
1,666,233,278 *AF5D8B90143C5BD4B92F8E82EC5A8EC6732A289B abortion
1,666,233,279 *AF5CA8387C9D6BC76B2560BC34E503EF3C870680 aeebv
1,666,233,280 *AF5E9D8E978CEBBF5A3C5ACE65CA91E3C44A6DEC AI(AF
1,666,233,281 *AF56139B00D33FB323D47EDCE2AFEA9282F0D956 ak$es
1,666,233,282 *AF54C83E3E93BBF02D8AD25F18A23F065FBE9314 al+4s
1,666,233,283 *AF5CF0F982BB6281343713FBE09690E5789B02A3 alejandrocalle
1,666,233,284 *AF57DA00BB6D636A98E7FC1D3AF5DD9878F43005 ALFONSORUMBLEY
1,666,233,285 *AF53298A091F6436469CAD33F95C11FE1174381B algasabi
1,666,233,286 *AF556E8BAF67B66F4A3945A79DF3F619EACFD743 ALONSO.CRUIZ
1,666,233,287 *AF57E65913209865A9EBAC0BDE8CBFAB75C44A5E ALU
1,666,233,288 *AF5F07E6C9AFB0B8A7E56881DC93A57282DD125A AMULN
1,666,233,289 *AF50FCE077E043A1AC3C263E6C2CD8C3D7923EE0 andrecowsert
1,666,233,290 *AF5BDBEB1921C76DE615BED99A7D8072DE724F0E ANGELGUNS
1,666,233,291 *AF59633A55196725EA6BCDB7F317A224455639BE ANGELOFAIRFAX
1,666,233,292 *AF5DD124FEC8123A95E5165192E6623A24961F98 ANNA VANG
1,666,233,293 *AF5EC53957B6A22B785568992E1D4861DDDEB3CD ANTOINE.MASUR
1,666,233,294 *AF5A506661247971A1CDEB44A5F60214120399A3 ANTONEDOW
1,666,233,295 *AF5798B0CD466925B0B5B640FF7931F5CFA12833 ANUUSARP
1,666,233,296 *AF5E8C78441242F91060093319131807E363957B A(./O
1,666,233,297 *AF5DE3A92927D5BC6CDF6F49FB5FB092C7CD7996 ARDEN.KNEBEL
1,666,233,298 *AF5D7BAD6112044C73EA4FCEE519E1AF561046B6 ARNULFO.BROSS
1,666,233,299 *AF5A41BBE7B8DF09CB7345E76CDCCE99A720A5C0 ARNULFO.SWANTAK
1,666,233,300 *AF5A43F759E88C7B633F276191662B9E888D047A articletobeornottobe
1,666,233,301 *AF54ED8CAA0C0D7270BF6835C570562E9F6CBB0E ASCIENDO0
1,666,233,302 *AF56444441316845BBCED2F7CF4D388B20DBEBDF asheysue
1,666,233,303 *AF580F01FC241BFF3483FAF44DBC9474CFE5BA0E ASOMMOS2
1,666,233,304 *AF5952D8E1BC1E9DB8EFA8BD4FA47374F3C26D10 asperiam
1,666,233,305 *AF53B60757C469A7AF01A898BABFC70C8C4411ED ATH1M
1,666,233,306 *AF5F16C25F16751BC7C85DA5CA8A74A15F5ED681 A.TROJAN.HORSE.CALLED.GIRL
1,666,233,307 *AF5206191AC33463BA19D11251FF8CDBB037855B ATTO IV, SCENA 3: 'SON VANI, OSCURI PREGI'
1,666,233,308 *AF5452DE34421A4AC46614C93BBDA7C7DAA46F08 avansino1
1,666,233,309 *AF5626E1721425850E9084584CA21803A4412968 A(Xk
1,666,233,310 *AF5B6A729CDB8D9A21DC4D24E94C9A74308ABEBE b%._=
1,666,233,311 *AF5ADC9DDF6926EF99BA6DD95D0BAC6C449903E1 b1t4s
1,666,233,312 *AF512E1CB9CD8431EE753FB59E9753750A10A49A B8_PM
1,666,233,313 *AF5A59021ADBC8B0FA4F1AF27680CEF9BFD1FA97 BAJEN112
1,666,233,314 *AF5AD0ADA1D259B336392E1A2AE47EBBC86CDA0F BARAJILLO5
1,666,233,315 *AF53C751416AB13634FA947BAF180078F9827C70 BASILBACHTA
1,666,233,316 *AF5107DB4FB3AC7C53A30AE792CBFA13C32BFA86 bastassem6
1,666,233,317 *AF5F011299D12B6D59D2C498E55A51EBD585DE4B [email protected]
1,666,233,318 *AF59A042ACBD43B24BA2BB74BF59C1D275289D29 BBC8+
1,666,233,319 *AF54D505D7E544B428FC71AA868BE1D7934E4321 B######D.*.*.*O><
1,666,233,320 *AF5D988161919A8F714ECF9EA1A71DD886E91ECC BEARSTRACK
1,666,233,321 *AF567112A10F8581A95D9B4A27ED758A2DE191AD BEIBEZ
1,666,233,322 *AF57EE92B98D70D952F98E8572239BA5F24F69EF bekc
1,666,233,323 *AF504B75D67735066E0623B116E601032348B97B BEN.GEISS
1,666,233,324 *AF569D226C3C59D32B1DD4D7AEC8730B878103F8 BERNARDBOTTIGLIERI
1,666,233,325 *AF5412BC0DEE8C65BB96D6E7D195407B289A242D BETRIEBSKUBIKMETER
1,666,233,326 *AF51B64CB0CE29E76C98F28A40C34F2D9A6FA8D5 BETŰJÉN
1,666,233,327 *AF5ACFC275F773AEB54FAE8D4A767BD1192EAA60 B,FM
1,666,233,328 *AF5A82429E141E089DE1E1446EFFD6E01F930B72 billykoble
1,666,233,329 *AF54C0F16198F500A0638FE4923D3A3B40DBDC7F BKRZYKWA
1,666,233,330 *AF55A08E1CDD16ECCBF3D898DCBFE056A7F004C2 BLCD#
1,666,233,331 *AF520262F96B66D046EE29B8A761DC2A143B674D B.nX
1,666,233,332 *AF5620C59B182647F2A77BDD35AFE45B7975CB81 BOOKER.LINCH
1,666,233,333 *AF5D7EE0081D1DE4F6533DA3D8E28D8C6E1C9CBF BOOKERPASHA
1,666,233,334 *AF5D4ECD6503CEB7D8EC9A6AEFB3E67384618455 BOOKERYOUMON
1,666,233,335 *AF50A402109BD61FA2EE32E44D0EE18D5AA6FB11 botsgang2
1,666,233,336 *AF5DD4AD89D402799109477624B090FD6A8BA369 brasicacea
1,666,233,337 *AF58C1717E9E57D04529DCB0C3F3AEBA2ED07EA3 BR#R
1,666,233,338 *AF537F362E4A2A6A12867C9394C077EF2CFAFC3E BRUNOBOUDJOUK
1,666,233,339 *AF5816909707FBD034E4611BB6C4CE09D07EDD97 BSL(I
1,666,233,340 *AF55B9DE012A254F5DE0141D270DCB5A71825AF6 bt:4v
1,666,233,341 *AF5EE964272B903C8CD8F3EE4833A176237B77C1 BUCKBRIEL
1,666,233,342 *AF5FB54FC690C3CEAA1A8B27C7A50172BD27642B BUG METEOR THAT DESTROYED BUENOS AIRES
1,666,233,343 *AF59BECCEC5CC357174E34B988CDC0D901BB49A3 BU(=W
1,666,233,344 *AF5F582EDF34A57C5341487EF0BE427F0D206D36 bzxjf
1,666,233,345 *AF5B38E43974F872DC4FF5A2668EF765951D48A2 c53hp
1,666,233,346 *AF53EED9933CEAFE332E74C057CB3284B43710E5 C67991
1,666,233,347 *AF52293A7E9B6D94A8C5A1A7B96F840B0A6B5B3E C7k/
1,666,233,348 *AF551679D60A4435CFB1895314B4533597E10AFB CALVINNABRITT
1,666,233,349 *AF5EAA3275333368AA110FF8CE0A5032BD6198E9 CARLA2812
1,666,233,350 *AF5646CB5EC05873440666929D03B726438FB9BE CARO71N5
1,666,233,351 *AF5C1B2DA4A95D6ADEBD1389EE38DA394487027B CÀSSURU
1,666,233,352 *AF506571BDF7FEE686A7C335923FFF05F313E1A5 cbqtw
1,666,233,353 *AF5A81A386F34E184C446A2203AC164FB7283E24 CHAKAWANV
1,666,233,354 *AF54F1317D0FF5D5894B8E689943A9009C481F89 CHANCEBAETZ
1,666,233,355 *AF573FB4A7D14E2D8EE5E8095A5F19BFEA57211E CHAPTER 12-01: WEST WIND
1,666,233,356 *AF58A00881A5FE0AA0418DE02E540275FE952F67 charliehamster
1,666,233,357 *AF57905E8F9B95A35E6EF38FCCD844B74A5F0F92 CHASE.SMACK
1,666,233,358 *AF579B4B9E7B731FADAB9CCC91E83A9D6D01BBE8 CHAVACANAS
1,666,233,359 *AF57CA4744C5CBC5D53D31A760E8D6D26A84CBA0 [email protected]
1,666,233,360 *AF5ACB23E22E0FF49267CF945AF9D9A87E657924 [email protected]
1,666,233,361 *AF5BE7ED992F658FA0E42D9AC96E051E46768AE7 CHFa
1,666,233,362 *AF5B449594ACBDAECF31F6A5E28D3E6966ED1AFF CHRIS.GUISINGER
1,666,233,363 *AF57B4657CBBDECE202AF445524C3082E559B6F8 christineuys
1,666,233,364 *AF5BC2AA40F7BB90BBBDDB290E032B9A3FE44DC0 CI1VR
1,666,233,365 *AF54AB89BDDC6D327C81FD70CC2707BD0D15B29D citut
1,666,233,366 *AF5A815BCA406188CBAABFFC42D740D036C67624 clare.sadler
1,666,233,367 *AF5054CF5BB6CF713D458ACF385F9428D94F0310 claysagayaga
1,666,233,368 *AF57F24FB15E9D4FD6162F46AC52AB784D051417 CLG0
1,666,233,369 *AF5C194106EA2DB4A57AA23A6BE79869F74C4635 CLIVE-FULLER
1,666,233,370 *AF5CB8DEC5BE5895C398977F6D9EDA31E4D987FD cme4o
1,666,233,371 *AF5B04463C2B17311DF7AB385D9E8024CB149AFC co5?$
1,666,233,372 *AF5B0EBE8D8A60B68EDED7AF7FD9C4D3E13F477F COLUR4SNOS
1,666,233,373 *AF5B37F7ABD7DEB802D9B1EC58A51C7684EB8EF1 conan24
1,666,233,374 *AF5C1E908DA2002E1C62A7B809AE5BA9FBF21AA9 corner.of.an.endless.road
1,666,233,375 *AF5820626259896BFDC8D55A13E25E0F31A715B7 C&PQR
1,666,233,376 *AF500281C365CD55C8847AE08ECEC1D80EE31C55 cq1(q
1,666,233,377 *AF51B9C42795B0459F0D02AA78380BB43048A7D6 cu743
1,666,233,378 *AF59C98158A2524DA8D73423B6798044BBF7966B [email protected]+3S
1,666,233,379 *AF5C45AB42B41FBBE6730F5D086E44C49EC8F9B4 D4BGM
1,666,233,380 *AF59885E0CC996029013BAABFB5F6AB2A8D079B4 DALU
1,666,233,381 *AF5BFED97E03522CBD7A03B05D44AF9E88278025 dasnb
1,666,233,382 *AF54CBC1FF4120D42B4ED2078A7B2450ABA4B0BD (~_^)-*-d=====B
1,666,233,383 *AF5466B9F808A5895DD87C05ED18FA40A32FFBE9 d+b2m
1,666,233,384 *AF5F9D5CB889B8F510CC4B043A0D1D3760B6FA4B D%B5S
1,666,233,385 *AF5C2633A015EF6D886AC3770B80747629FE6298 DEAN.SEIDLING
1,666,233,386 *AF51A7FAA6B2CDFA69D5D7A952BC05E87B7D73A7 debanderaient!
1,666,233,387 *AF5C800369278D70DB36B0305B3CD145CD1F2012 degrootebiz
1,666,233,388 *AF5FD4E6B3D133AD530A9D9044CB7566F350D150 [email protected]
1,666,233,389 *AF53A6B53F243B8028D8DEE53B34D4F43D96C37C dennis-goon
1,666,233,390 *AF5520078C7F4AC22719712D873F22BC6FF23648 DEON.TOMSKI
1,666,233,391 *AF5F53464F8ED7FFCD460B7AF1D73CAC807D9EC7 desiraejaramillo
1,666,233,392 *AF5F14F1C15FD8F255DA88BF61435857B6A00227 dethroned!
1,666,233,393 *AF5A70C821CC948FE845ADB885242AB3D51BBBC5 DEXTERPYKE
1,666,233,394 *AF539F6294D057128F7B42848B17C2C499661C7A D/F_
1,666,233,395 *AF5FDCB478C549FE58FF09D3F3DB330A688415BF dgul_
1,666,233,396 *AF514C9EC19A276F81638A45F34C94119E241EF7 dhicc
1,666,233,397 *AF59A2422D90B62FAB44D4E72CA83E5A0539190B DKp=
1,666,233,398 *AF54B16E8DBCA966D2B6BF577DC9ABD16E1F85E8 d.nm
1,666,233,399 *AF5264B36A9E7D1CBC0C95997A15E9F5EE378D28 DOMENICHAGENS
1,666,233,400 *AF5B2E74C333A29EC8E3FC5007FB5301B9F1A656 DONALDFREDERIC
1,666,233,401 *AF5EF11217F618B07B2583BD75D73D044488F0A7 DONOVANCHIASSON
1,666,233,402 *AF5281C85CE3D1AC2CB839ACAB02457133D0E1B4 DON-SKAGGS
1,666,233,403 *AF54EB55C08AE7749BC15FE456368DE720EE6DAA doogiekristen
1,666,233,404 *AF50653D85D656AF7B8A3FCB6B747C3C84339024 DOUGLASSTANEQUODLE
1,666,233,405 *AF54528EBE91805D8910781C4FF4AEA1DE76A901 d-qbo
1,666,233,406 *AF593AAA07A9CD1CF0C3BD9901D59A36BE1C7E65 dw;eo
1,666,233,407 *AF54EEB5A984040BC132B567C06EEA7D9430A3B2 ECHOLOCATES
1,666,233,408 *AF5E8C0DC8566862A56D4B2459D32A124EF21F3E EEN HEERLIJK VAKANTIELAND
1,666,233,409 *AF50D2290324288139A40E0C3F59F6ACF2D06B7C [email protected]
1,666,233,410 *AF51F7BCFE9F45F77F89DD7EB94889E0ABA621F2 Effarants
1,666,233,411 *AF53E4CBDC51D2FF76ABCF427012228AD033902D egkj#
1,666,233,412 *AF5113FC04855A23AE4F702B85DCE43D2ABB626E ekdbn
1,666,233,413 *AF538A9239559FA3D56C2CCCCAE64D89D58BC9B2 el.crecepelo.infalible
1,666,233,414 *AF56F059FFB3643694AAFBCA9EBD4E4C1F7F137D ELENABARAGAN1234
1,666,233,415 *AF58B78323F474A6EE510B35B0A243F077DBD5FB ELIASTALMAN
1,666,233,416 *AF5417E6C24986178A6FB2A281F18FEEC49BA01F ellsworthgrosser
1,666,233,417 *AF52612C2E3F2B235FD6C761DD8DC405104D07CE ELMO.ELIS
1,666,233,418 *AF519885601E2CDFB27652E651CE10F184CB1D48 ELOYLEGNER
1,666,233,419 *AF50C88E2CFC67C85BA4185091CFB2F8D81AE6EB EMILHADAD
1,666,233,420 *AF50584713864745936D6FB33560C0539484B562 EMMITT.HUMANN
1,666,233,421 *AF5DE5FA27D0740060B73F3AD9BACC8A8022CF92 ENIALEDAM4
1,666,233,422 *AF5441CCA160DE3935B35F4EBF1610900169FBA9 eo3hl
1,666,233,423 *AF5A89D3913FE2045055D1CDBEAF528FCA680B4F ERIN.JEFFRESS
1,666,233,424 *AF51CE45B9CE16B6773A0D9F6EBCF99B78156122 erinstinger
1,666,233,425 *AF5B61297D2EB5BE124E421FF79F5B4C87A93739 ERNESTO.KASPRAK
1,666,233,426 *AF5EB126B6CC24469D0144CF292E04D157B09759 erv!7
1,666,233,427 *AF59180E7FF95D8F79D6EF4851F2643C06A9BAE3 esq)n
1,666,233,428 *AF5FF794B7D2402F37665084583A136F3F24F56F esquibeley0skwiy0beh1l
1,666,233,429 *AF5C54C243E359A48A34179CE231069DDCAF69A1 essayin9
1,666,233,430 *AF5F09942CCD3BA963B0507B0A9D44C030F47BDE ETATEGEV0
1,666,233,431 *AF59F2FDB794F48D170BDC5976D76437873E2F45 ETEMRETN2
1,666,233,432 *AF5FC4645D730F9FAD9FE57D0F4FFF9D35A6E18C eugeniogisondi
1,666,233,433 *AF5211C2FB8257A579EAADAD9D76D9D073DFBF71 EUNHC
1,666,233,434 *AF55E59747921A1296065DB7B4A835B4C5426B20 EVERY.SONG.YOU.SING
1,666,233,435 *AF5E380951E83C5A3E9FC93E55689DAE9697EB71 EZKUZELO7
1,666,233,436 *AF533DBF7EC34E6562E34FA573CE48528FB258E7 F'@>
1,666,233,437 *AF50D354AFB238DEC649F88EF5CABA538208E279 FABIAN.JARDEL
1,666,233,438 *AF549581BA8CD664D618B524F026A7E642919B79 [email protected]
1,666,233,439 *AF5E0FC2CE6403BA29144D18296C1D909FD09181 fcuknb
1,666,233,440 *AF58DFD68855C7CBD321CCED539F8FDEE8045E63 [email protected]
1,666,233,441 *AF5B51CDCC42CD3072C4C8AB479C6FC7809F5CEF FIDEL.RADERSTORF
1,666,233,442 *AF504FA6ACD20C3B71A0A4125DE2CA93FCD355CF FINANZIEL
1,666,233,443 *AF53AB4B02C0A9521611AD3E90B69504E9F867F6 fpa#
1,666,233,444 *AF56A2E8B6853B8B3BCB4D68D4EC8CA290843A91 francois-josephfetis
1,666,233,445 *AF5245850728F835A77F8F8C492E58C48C606C37 FRANGALLANT
1,666,233,446 *AF56D02F65FB881B48686A29EFBC45034A6C25E3 FRANKLIN.VORCE
1,666,233,447 *AF56F88106A3D0CB326248CB7B38EB6D2CE4BE9A fritzdistefano
1,666,233,448 *AF52BD36AB997CE53A3A7ADCC866C9D0A3EB147B fuerbitte5
1,666,233,449 *AF506285F7E511063696A459DDF07041F1FC75D7 FÜHRERÜLUI
1,666,233,450 *AF5057D6FD9F1BBBB3A8138BFFDD5FC43D602D9B FULLGODAS4
1,666,233,451 *AF5A63FF42FBD23DE54817110E1CE72700C0476A FYGHTYNG
1,666,233,452 *AF5DD865B4672E580BFB4E40D4F607F5C3A1F6F7 FYLYPOVYČ
1,666,233,453 *AF5DA8FD91999518FA27A2822A2701BA030AB17A GABRIELLEREIS
1,666,233,454 *AF599936D1734284112F109427EB37D2E150598A GAJAMAGIC
1,666,233,455 *AF5E2247CCC91C0F5DA9CADE7C90BFF6371825A2 GARFIELDTAUNTON
1,666,233,456 *AF596F8FB9A8F4E8F6A7BF7F6C795449707564D7 GARTHLOSA
1,666,233,457 *AF5BB718AB46A459EBD4BD3AE0154A91DC94B944 gauch3n3ss
1,666,233,458 *AF5CC9A20954BD329A8239EA1F66A757390C4C84 GBJUYZMLAYSIA09876
1,666,233,459 *AF564891F168304E9C44BA5E0FF955C61307DDA7 GEFRAMEDING
1,666,233,460 *AF52E5898C0C4C813A802E0B81724813ABA6845C geh.ich.hin
1,666,233,461 *AF570AAA8F26892719FD5339C21ABF8E35811BC0 GELB:.LIMITED.EDITION
1,666,233,462 *AF5D01BC95327164C9DEABA04F05E416CC3F1A18 GENE.LUKINS
1,666,233,463 *AF5B6E41DE3711EDB3060CB4F32537BBB4A7B9C6 georgiakinder
1,666,233,464 *AF534CE57566894E471D63CD7C07B41368025227 GERMAN.BUCHETTO
1,666,233,465 *AF584FDC1D2FD8B43769DDFD6F7905359497DE40 GERUCHSSICHER
1,666,233,466 *AF5546DB385A143B0D57DAEA216B7E318F495E9B G̲H̲AYBA
1,666,233,467 *AF5417DF097B808009932455C7A54E7FAB3E4BBB g!ns
1,666,233,468 *AF5E454C505DB4F5CD169B8E096216DBD8881A2D GottaLove(NewR&Bedit)
1,666,233,469 *AF53A8734713973FC9E941534F18EAF9E802BD48 grahamfollin
1,666,233,470 *AF5CFB66C7C110E8CDF9A532738EDD48D8F6D7F3 gregg-colvin
1,666,233,471 *AF59127BEEDD7F206733EDF8DC4097965B25104C [email protected]
1,666,233,472 *AF50FD70AA61319ADE47ECEB001422284D5610DB GUESTCARRIE
1,666,233,473 *AF5C8F2221ECBD0EF31ABC9EA7B798EBF38D4F29 gyanu.mishra
1,666,233,474 *AF5A34C708C046AF23B66ACDAD34A66D19A19EAC gyptologues6
1,666,233,475 *AF5FBC6215CC994BBC94B53305339FE9871E9A58 GYURMANE7
1,666,233,476 *AF5F70A9B449FA68107C24A3C7FD23600F1426DB HANSAPÄIVIEN
1,666,233,477 *AF5754DF4248E10A2C8085C9B879B72305879AF6 hazin.'n'.phazin
1,666,233,478 *AF5BDB0DFADD82C2662B2F261D710351074802A3 HCULOHR
1,666,233,479 *AF532307755069003B136A50A6B391E293DFD8C9 [email protected]
1,666,233,480 *AF56E24BD94DD24E88DE18402AC1BC7742ACD449 hingebeak
1,666,233,481 *AF5979BFA96781611702A44B2277C17F5D20AC69 HISHITSU1
1,666,233,482 *AF5DEFA4628D3807827A90B425CDCE6A141362E9 [email protected]
1,666,233,483 *AF553EB1F332E161D259D6A685EEA6EFA59A5B22 HTTPWWWLAWUTULSAE
1,666,233,484 *AF55C161568A3DC5CC162FE4F044E5E6475908F9 httpwwwregionnetru
1,666,233,485 *AF5EBC4528BC1037B0DF0DB0DA1161C01A51859A HUD3
1,666,233,486 *AF54165C5750FD9419958870A1407D3B75C6CA7F IANKROEMER
1,666,233,487 *AF5B662921E4B03A0ACDD054C01DF8DD4AC5B877 ichvariieremeinenrhythmus
1,666,233,488 *AF5C5573F2F96331258D6B24AA078BC56B0BD866 iireisins
1,666,233,489 *AF5D909D9EB0B604A926FB6EE3B66F25E55CF12D irvinbuggie
1,666,233,490 *AF589979E2CF0290F033FA1A9882BD546F0876ED ISAIASVALTAS
1,666,233,491 *AF5A478B7BAC127266152243C82001FD64986A71 isit.under
1,666,233,492 *AF50B8B00B3D7C2742FA355A167B90336459E6A9 ISRAELBLATCHFORD
1,666,233,493 *AF549973A329735EC9B3337CFE33E0F8E0738C16 it's.not.a.thing
1,666,233,494 *AF551BD78C8869D19C1CABB7C7A16406A43E1B65 J4THNI3L
1,666,233,495 *AF59965606F4BA2295955EC91BD326EC76D12A70 jacoya20
1,666,233,496 *AF5627242A2924F1F4B878AAEDF76538FCBB4181 japanesegardens
1,666,233,497 *AF5C336FBA26517B4BC5F69B1B9CC57A1F5FEC87 jarvishacher
1,666,233,498 *AF5DA3EDB78B967BD312D69D58B0DD605783E5C7 jasperbrosius
1,666,233,499 *AF515951623D3BB7F035C1BACED3DDF66DFEFF43 JEAN.VIENGXAY
1,666,233,500 *AF5E081080F6AA69E43A215BA9BA27C57896BFED jeffersonpuno
1,666,233,501 *AF59F301EB99FF2C5F78E347672CD4218CC3D4F6 JERMAINEZEITLIN
1,666,233,502 *AF58CB3866FABECADD844D6D6A98668745EF0537 jessamaris
1,666,233,503 *AF5DBE340B7E486CDEB22A2043302D3665222408 JESSICA.WEYAND
1,666,233,504 *AF598EAC1CA6DEA987ED2F4CD83D0D29ED8C77E5 jewelryfine
1,666,233,505 *AF514DFE4844CD46BC2021C910F68F59F707E0B6 jim.bernardi
1,666,233,506 *AF5240A8388CED4C7088FBAA66E8A81BB0764A1C JOHNLAZZARA
1,666,233,507 *AF5E25A739F141C79227471DC5FA4DB52999A36D jonahdorrington
1,666,233,508 *AF5EB5487D45BDC031BEAEFD57DE2577E1A70DFD JONATHAN.SOHN
1,666,233,509 *AF59FF132E583C850D726CD975965E3AF6A7CC73 joseph.russouw
1,666,233,510 *AF5821391062B140C5ADB564065849D13A4C106B JOSIAH.CAHO
1,666,233,511 *AF5079BDFE26BFF06D533B1C84FCAF48825F931C joyasdelamusica-vol8
1,666,233,512 *AF5F1469FC035354736E910033C57AC83176D64D JUDAÍSMOS
1,666,233,513 *AF5B89583020ED5DE7B5DF1802C036FCA2CFD161 JULIAN.TACKET
1,666,233,514 *AF5DF42AC831C13AFF664BC3E31ED44444C77207 }jvaaa
1,666,233,515 *AF58503B03D28454287416B2FAEF4A2C550ACDCD kabackiej
1,666,233,516 *AF5C90272672F3CA88097CEB2B69A7CCDD2EE0C4 KÄNNETECKAEN
1,666,233,517 *AF5BC0D9A5618141C0AD5358151847F3E22D09A2 KATOAVA3
1,666,233,518 *AF59DFC81083BB1DECB582B9857A1F8B480A6263 Keazyr.Anar
1,666,233,519 *AF509799FB7DEFF113916AAB605F90584E9986F7 KEBKEBIY5
1,666,233,520 *AF5A2BAF82CD16AD2BAC21A1A0BC0D809A74B608 kentmoussa
1,666,233,521 *AF575CF0C722D70B4FBECB5DC94ACDF8E2B30E7A kentsolera
1,666,233,522 *AF55A37166BDF1BF9D43751C39A3C92800F2D6D0 KHYAMLALL
1,666,233,523 *AF59DC8E673B2489B2A0A2DDECC8430564B1686F KLUBBSANGER
1,666,233,524 *AF546E173C0510754891E56AC589101A48DCB1A5 KUNAL SETIA
1,666,233,525 *AF5C4B2ECEC1EDED5CFB9B041AC527370AE1FBE0 kundlaking
1,666,233,526 *AF59A4F27CFD34BDFD07C0E4D067ADC4EABBB152 kwame-richard
1,666,233,527 *AF5D90577C9E4E577F2C5FDE31A9C28C83833AD3 L0ud4ppl
1,666,233,528 *AF5BED045D7834258867D4545D6816C5C302CABB l1+h09r4ph3r5
1,666,233,529 *AF522D6591E6C136AA6F7E51D7A11F6234C4DD29 [email protected]
1,666,233,530 *AF5E4BAFA8BF1F887FC72869D6B255E38C9CFF35 LẦN
1,666,233,531 *AF53829739AD0B1FBEB63F3AF9CF991A181C643E la-valse-des-24-heures
1,666,233,532 *AF55132BBCE4BBB80ECBE915B9A756BE7C3EC71C LAVOZDEMIVIDA
1,666,233,533 *AF59F656FCC6188032A1B6B156E1366BB4E4BFCE LEROY ESPINOZA
1,666,233,534 *AF582C036ED4187EA1CAF7346603283B4320A6F1 LETIEBLOH
1,666,233,535 *AF50D6A8461A950E8760FD6C8138D723F5ADCB10 [email protected]
1,666,233,536 *AF53BA1AC20C43BAA3557579E19655506DC6193B [email protected]
1,666,233,537 *AF5BC2401A66BDDB8A486EFDA427862E3D13219D lilî
1,666,233,538 *AF56650CA781BAF814F38D267DA2987AAF111102 listadeprovinciascrucenasporsuperficie
1,666,233,539 *AF541FA9BED7874DF1A44B5B94512E3C75BC00CA [email protected]
1,666,233,540 *AF55F34FCEB40521E9E6F234288C4362430900C1 ljubaznoscu4
1,666,233,541 *AF5E1376B43AF6B19ADF92BC4FD0F52AFA0DE91E LOHBERGS
1,666,233,542 *AF5731D043B9315495E93E7CAE2276BAA6DDB1E5 LORENMCBRYDE
1,666,233,543 *AF57F4F197C8EEADA2A2E18313AF08E9DB49332F LORENNICOLE
1,666,233,544 *AF59597988BF43C41A6EA02C6A5F6C6699D61C96 LUOXIESHEN
1,666,233,545 *AF5BD07000490B719FD1C9767AF4085A495D259A LV~+
1,666,233,546 *AF50FDA9267F75A61967BB35ABE82BC7B3CB4D41 LYNNCAMPEAN
1,666,233,547 *AF5C1EE186CC1FA88F757D2A75A04E0EFBEC534D m0n45tc411y
1,666,233,548 *AF5C91398489ED332FB7B48334201A2270415008 MADEHAZ
1,666,233,549 *AF589E122E69D21E3E93A136CA60938B95815FF9 MALCOLMLUTCHMAN
1,666,233,550 *AF55D40BD98BCD3B115E44CC940E96053A534A60 [email protected]
1,666,233,551 *AF537AC6377EEC29000D12102DA564763688F75A [email protected]
1,666,233,552 *AF56B4635E3EFA29B5BA6CDD072CDAE07C3C748E [email protected]
1,666,233,553 *AF58B0B47ADECF1EC841ECE5B4529A98CBB47349 marbakke1
1,666,233,554 *AF59A68134CC599D9161C098588AA61567C6E628 MARIE-MCCURRY
1,666,233,555 *AF5E7B7254ADCEB1197F6AFB8D08425DA5EDB593 marioflaherty
1,666,233,556 *AF5439BBACF0B8D2EB0B6F38978D942D3D0A2FD4 MARKSATUR
1,666,233,557 *AF5DB4A3E525085B32EB7A395BF24A46BAD67C3F [email protected]
1,666,233,558 *AF51D9A575F755163EDE841FDDAEBBE5B1AB1F1E maryanntayco
1,666,233,559 *AF5173249E57CBE9722FB77FC88431F68456053E [email protected]
1,666,233,560 *AF530D2444BFDA6B628DBEF8250442781914B817 MAYNARDDEHRER
1,666,233,561 *AF5067A9A6EDCB601099585EAF403F7901F2AAE9 MCKINLEY.NAKASHIMA
1,666,233,562 *AF55B483988B197E2B1CCA9E9D9C085795FED2FC MEDIATIONSANBIETERN
1,666,233,563 *AF574C06107EF2B9F7DC184B076DD7E8680FA19A MEKDIKONJO
1,666,233,564 *AF55CC04A13B2F99E0A99A48C7A25E613AE7385D meritless4
1,666,233,565 *AF5E7541F214A9634024A3BB6191F130E0554F1A mervinmccollom
1,666,233,566 *AF5EC3D0DDC7BD9FB9A99E611AA008A39672A7D2 mesoteríidos
1,666,233,567 *AF56BF140CE9001C0B4163AD8341F3BAD333A44D MICHEAL.PACENTA
1,666,233,568 *AF5BEA2799E275C31E020EE92F2DE0F5BF0F05BB MICHELLE-ALONGI
1,666,233,569 *AF510B7F2C06C907D5EFF1FC635EC14984A6217D MICOLCEA
1,666,233,570 *AF5E4A96E2D602BA0148A92D0EBA05D63E37ECD3 MILO412
1,666,233,571 *AF5CB777948F8EB07DA040F580A34818756E7150 miroeng
1,666,233,572 *AF523F61C3C89F8ED5DB023CB508E39EF405AC87 MODESTOBRUSCHI
1,666,233,573 *AF5DAD164E88624A6CE1BCCCE81D861274CECA54 MOMCATM4
1,666,233,574 *AF5326E7D9E4568BD98C83CE4E7356ECE48296A2 MONASABERI
1,666,233,575 *AF522388BA25AD7ED5A68FD5315C2C869128C31C montehirsch
1,666,233,576 *AF562831CB66F6EB86410F98BEDBAD1A5C66DC94 MOSESGROBES
1,666,233,577 *AF50C4054542F3CA05C1943CFE48C01711B2508E MOSHEKINLEY
1,666,233,578 *AF5BBA302D079096ACAA8AAD26248EDEBDD9913A MOUNDALAK
1,666,233,579 *AF5F6DB2022B50237A00712006D242738169FF2A moylecech555
1,666,233,580 *AF55B08947CB92338ED83DCC06320F2B2BD3BE47 MYNETES4
1,666,233,581 *AF55732217C0B8E7BB88D2B9DF4931E254B2DE6B narakobi3
1,666,233,582 *AF58591131C4D20458E6A0C1BB6B39E7CD74FF0C NATHANAELVANDORP
1,666,233,583 *AF5B242C76E80D7377A06796C176290E61CA5BDF NATIONAL,REGIONALANDWORLDWIDELEVELISESSENTIALTOTHE
1,666,233,584 *AF514C3A9DDA03FFCAD9820D475E115424B106C4 NBSP<B>YOU
1,666,233,585 *AF572861F7567CBEE8E85A4AF6B80311BA91F26F [email protected]
1,666,233,586 *AF5A7DF481DDEE6B57E8AF5D3ADCFB3C841F3F3D NEELOHS6
1,666,233,587 *AF563A92303DD80C758222E13DF3A0D48E0C7D8C nexusnets
1,666,233,588 *AF5D32160F92145EA92F89CFD2C4C21EBA1DC3E5 NHK交響楽団を退団。
1,666,233,589 *AF5045D30452780E93D017ED46F8B582B0A77A2A NICHOLASOBERT
1,666,233,590 *AF5B7B6349738960497BE3CC54B4A7962D0E687A nicolasmarquart
1,666,233,591 *AF52E3F163320AFA0DC4C505EFE4C0A42EDA1A2A NINĪṢU
1,666,233,592 *AF565E1881CA31B5AA1DCDE0C2A94359EDDFD112 no hi ha color
1,666,233,593 *AF5973F6ECDD0B1D982AF3CCD15F298850DBE614 NONH4B+4BL3
1,666,233,594 *AF5F55A5E8535E96CE969B2B1DA586E313F56283 NOUSER-SONG-SEM-DO
1,666,233,595 *AF547B34909FE4D043563B1DE4A0E54A7908BB2F Odio.a.Botero
1,666,233,596 *AF5432BD162426AB695019E736524CFDD37D6AA1 OJIYZDNOQ
1,666,233,597 *AF5C9A131E7DB78AE79EAF6D2028C1D59CF40999 pa00112888
1,666,233,598 *AF58C3E2F142F56D520F238228937C4B108C4CD3 [email protected]
1,666,233,599 *AF5327A0277711229B38B57F30EFF36CFA594A80 pantoises6
1,666,233,600 *AF51752C6B58672FFCDC8770886D6D761520D938 patrickrogoff
1,666,233,601 *AF5D3128B0D12EDB8EF7684E195E13457DBBD73A PD*(0_<)
1,666,233,602 *AF5F1DC1701D8D547A0CCB563A8AE8DFD7E87FEB PERIORBITAL?
1,666,233,603 *AF54F2F2DCF6F51EFFD58020EF4F7B089D82D049 PICTURELING
1,666,233,604 *AF53C37581BD7A406A0340A6A9942F53C6B7C319 PIERRE.SHEPLER
1,666,233,605 *AF5D249ACADF695286322FAC32829AE02E02392A plaistered6
1,666,233,606 *AF5C6E3DF78ECE80511A27F030C7ACE98D2CD305 POBYDE
1,666,233,607 *AF519ADCE8BB11DA462533482C2E3E2EA6B3CAE6 p-p~ ~)o(
1,666,233,608 *AF5432862E7FC821C85055136C7D82EC2B86692A provocatrice2
1,666,233,609 *AF57979DB71216141F872A025572F9283CA99FAC p###)`~{x}
1,666,233,610 *AF59A7A7446C67F9CF819B4DE1996648E1915D00 Q135440
1,666,233,611 *AF586EC7D74E8989CE536158A61FAD83FBFC4DDD q###B`~`~splat!
1,666,233,612 *AF58D1B6A433C567B1641BCF7D33582347F3EDDE (>-<)~`~`q-p
1,666,233,613 *AF5EA01A793786C5F65C07C9838E67E4482EF201 Q---->-*-*-*SPLAT
1,666,233,614 *AF5F27D69F1C52EC5B7F57CFF5E08911C9B2E5DD quetzalcoatliin
1,666,233,615 *AF59D247B2D7EF18DD4F6610D44C5C83344F09F1 ˈRÆBDƏˌMÆNSI
1,666,233,616 *AF5E6DB2392279CC1FE8A053E4354EE1FD1B7326 RAFAEL.JACKOVITZ
1,666,233,617 *AF5A1AFA5E296D1D0DE3CAA50D05D24CCD5E9653 ramasood
1,666,233,618 *AF572EF03C80768DA1ACF422FA5AE8744C700262 RASHAD.FOREE
1,666,233,619 *AF5140959C1120C9F1275F379606BA3E9296B686 RASSORTISSAIT
1,666,233,620 *AF562254018527F61D6039A1E55F0625254E28F4 razzmata3
1,666,233,621 *AF552AF707DE6203C9810ECB0E5C4E71081D53A4 REAVLUSARINGS9
1,666,233,622 *AF55BBE84E9DC7CB799CF4ABE2661D81A9832589 regierungsbotaniker
1,666,233,623 *AF557F9B06CC8291C9861F5D5107356E0251B244 RESINTETRAFLUOROETHYLENEUREAUREING
1,666,233,624 *AF5311C2C4427333342A73E081413461117A9085 [email protected]
1,666,233,625 *AF5BAD5E2921AE38C3C8D2D5F9D312C1AB981DAC retailors
1,666,233,626 *AF53171F8C4443D71901C92BC18BE4CD18F780A0 revalorisez7
1,666,233,627 *AF55E9BC909A326E295907E4903B5EFC5720358B ribonoschelolam
1,666,233,628 *AF5DEDD5F7A177029ED1E98C8F503EA9942CF2EC RICK_MACLEAN
1,666,233,629 *AF57843FECC248D8D06D128C4B84078223F9F8CF rick-phoenix
1,666,233,630 *AF5B12EC28419521E07298E9D2DE36E07DDABB91 RIGERONS
1,666,233,631 *AF55C76D2F243BD697301358D80A4403BA88B046 [email protected]:SKYPILOT
1,666,233,632 *AF5F839210841AAA9F8ACA7CA3E37BA43452846F r.kinder.(disc.3)
1,666,233,633 *AF5710352C1C2C84D97D2D071F98668282B80B78 rl='
1,666,233,634 *AF542BF41F051F3F57CAB9167669B8C93B235807 ROBDANKO
1,666,233,635 *AF5E1BD6902570E55D01BC1448C8A4266A90C514 ROB.KUERBITZ
1,666,233,636 *AF554B9D13C4B721685E4A87230C48B6D7B64895 RODERICK.FEINTUCH
1,666,233,637 *AF5990B810A282538094106ADFC73866FCBC176B roger.john
1,666,233,638 *AF58BAF81BAE1089847471DA17E2CB23EF87DFEE [email protected]
1,666,233,639 *AF52ADA2C101FC7C16A53A225E9E44041AC54502 romeogollogly
1,666,233,640 *AF5AC5AFB8FB26B7EBA98A309DD1D0AADD14D070 rosscordonnier
1,666,233,641 *AF56D53C2C73C1BD62684C5949D56CC6EF5150D4 ROTCIVALLETS
1,666,233,642 *AF5783233E66E9624F77311D785E50AEDDB7295C ROYCE.VONA
1,666,233,643 *AF50F1EA89F81BB13EA479E3F7A1A0402D61A2A2 RTRIMBSW9
1,666,233,644 *AF5F81E3231B00AF7D6DFCCED562E413175C2957 rubensamad
1,666,233,645 *AF5EFF30DA2AE35177AFD43A38980FA7D9DDCC37 ruby.4,.part.3:.dark.night.of.the.reptoids.(disc.1)
1,666,233,646 *AF5C8B672F914A03B770425C93A583935ADFE31A ryanjbarger
1,666,233,647 *AF5245BBD4C41EAD810A529AC2F4566CD2D0CC34 R+ZN3$$
1,666,233,648 *AF571E1A7BDEF7EFE7CCE7D73D2A0313B175FE1D salumpepeg
1,666,233,649 *AF564F70F0F974FEB185813C622BEC95FFA8F3EA SANDYGOTTLOB
1,666,233,650 *AF5DCC3B8566E2D26587C685CF55E51FDB69DB4B SANFORD.KARDOS
1,666,233,651 *AF507FD69F9675FC8C9A73275D7F5312AB725942 SANGLIQUORI
1,666,233,652 *AF5C5BD3B5039B00E1CE236AAD880991D01F2CB6 SANGRIA
1,666,233,653 *AF56FCC01E8208D12FE83B24CB9799B6B7DB502F SANKARADA
1,666,233,654 *AF57DC5976AA919825C71F444E1B6FC6A92FD910 SAZOVEMO5
1,666,233,655 *AF52839137908849632976D51E775705AF89A62C SDNEPITS0
1,666,233,656 *AF59F08F0E3A905AAFE4BF57B33A6FFCCCE1B020 sdohtemlamrof.1.3.2.7
1,666,233,657 *AF5F7B776EE485E2A3D480F156FF5B658A8D7754 SEKHTQLPIBOJSPW9
1,666,233,658 *AF5585D98C2DBBC424A547C3175D364FE0DF6F3E SELFCONSUMINGAS
1,666,233,659 *AF54E6B135F3229D95E7CE18A6715F06EB170C8B SENSUNG5
1,666,233,660 *AF57DDCDC2EA45A339C6E108DFA256B2E7ABD2C0 SERRENERED
1,666,233,661 *AF5787FB11F01061C16C41A714145A69C32A4779 seyinsermet)
1,666,233,662 *AF50728D157CA13420C121EEFD902EABE5B3629B SG0558000436
1,666,233,663 *AF5A1F4BA7B2C5918070A89C1BCD79099A8D30EB SHANTY-AJA
1,666,233,664 *AF57458C82F63C5C86B5F821BC284BF6B703B713 [email protected]
1,666,233,665 *AF5A01719AA7B2095898DCE28DEA1EEDC1767109 shawngiehl
1,666,233,666 *AF5F822ED2BBDD2EC0F2F759D2BEC8968CB0A7AD SHEILARAMSAY
1,666,233,667 *AF529933488EE2CDD538A2F461662B44059D57C4 SHELBY.URTADO
1,666,233,668 *AF582D946D2831C83C7DEAF81EAE5306D89CAF08 SHELTONADALJA
1,666,233,669 *AF5B48789154F8B7ED3C4027214D93712C6CD651 sheltonhegan
1,666,233,670 *AF5E622AD358C3C9F18CC91FB0AF6CEE1C2F49EE [email protected]
1,666,233,671 *AF5226628CACF13D29A9428769F805C25F961FD9 SHZHII
1,666,233,672 *AF524C47F0B09CCB5B7270EF637F0A40CECD0C87 SILKTASSEL»
1,666,233,673 *AF5A9BDED6B9A33630257B6B98AA826826DEDC94 somos.los.mismos
1,666,233,674 *AF530A1EC2A90F56EC9FCA80E83A74DA6780BCBF [email protected]
1,666,233,675 *AF50969793D240EBE49783124069ED5C950398B4 SPACEFUNK:.THE.ARCHIVES.19952008
1,666,233,676 *AF54962E25FEB0FB28369382CB8E52E605262CC9 speedboating.'sp/i/d,b/ou/t/i//n/
1,666,233,677 *AF5BD294DCE1EFE77D17EBC3BFFEB8495A67ACB9 Splat!-~`-<===8
1,666,233,678 *AF50621FD40CDDE88C9ACE0F425D6170879E3384 Splato~ O~d#####8
1,666,233,679 *AF5D75684A4CAC082F541B8F596D93C6E42F42B3 spriteronald
1,666,233,680 *AF506139A477C54913229F34ECEC2780FA9C0EF5 STENOGRAFISCHEN3
1,666,233,681 *AF5B39E384E5EB4DC5CF06B83574796FEB4CE905 stephanie-bettencourtt
1,666,233,682 *AF50F016384EC4AD54BEB82450A9BA6A77F92EE1 STEVEN TRIANTO
1,666,233,683 *AF5A49E1452105A32C0E0D5CF4A092D6C5785A5E steven.william
1,666,233,684 *AF55DF03E057C6BC1E262206D75FFD1AD45DF19B subletting7
1,666,233,685 *AF5D7653AC1FDD6A611EF4D1691A3AFC770390F0 sunflower-peeps
1,666,233,686 *AF59078D60D68CD6377E97136CC511CD32A1CFEB SUNG.KERCADO
1,666,233,687 *AF5D99FA3366868BCD01A2536E95985E262E07EF SUNŽÆJOEN
1,666,233,688 *AF5957C729A1F4C479497907270009BD361563ED suurlissabon
1,666,233,689 *AF5D3F524DDF62A3D9E796C0A267F458EFDD16DC SUZANNEBOGARD
1,666,233,690 *AF56D1EF4BC766FEE187F599BFDBFD34805E76F5 SWAN.LAKE:.ACT.I..WALTZ
1,666,233,691 *AF5FFFB2F8E9C31657976CCFE15A69BDD1614148 SYNDESMI8
1,666,233,692 *AF5E343CAC9AC2D4772B396A5BA5800A5F07A029 SYNG-DU-MI-R
1,666,233,693 *AF542C4331B9DEC37D68DF2396B15A904A0ECD93 TADESBSW6
1,666,233,694 *AF51A6E4D61BA6EE46420621BA7CD0B2B2E359B8 TALKROBERTWEISSMAN93
1,666,233,695 *AF549688CD1FDDCFF308B235DF76A38C028CA67B [email protected]
1,666,233,696 *AF5A295F101629F20719BD3A79591386299D70CD TAYLORMADONIA
1,666,233,697 *AF53981FEFA6A1BDBC21072717370A5BA0D8ECD0 teaktret1
1,666,233,698 *AF56B68F86CA3CDCBAF09346C7260C21005D9C72 TEKEISHA
1,666,233,699 *AF5FC207B14A221490E262C6EDA73E16F0E488A1 te.ui.api
1,666,233,700 *AF54712A7F9D6C5C6D8E7077B3D7B53BAF227861 [email protected]#
1,666,233,701 *AF5601DE544F2D57FE988A39B8666C8DE7E13D65 theogehling
1,666,233,702 *AF5DEE0A478D49D01595BCF3C98EDAC5405C2FEC THETHUNDERBIRD32
1,666,233,703 *AF5DD1393770F5A18D38ABE89A16526C7CBD1D91 the-very-best-of-john-denver-(disc-2)
1,666,233,704 *AF5440203449C3173E6CA3D7002370971171EB5F TMTHYGLD
1,666,233,705 *AF526206FAC64AB8DA3C9AA7724F1E9058E53B5C tobywertenberger
1,666,233,706 *AF526EFE92FD28101D77BD206B45A9BF8FFFD62D TOMMIECORE
1,666,233,707 *AF5015EC67E984B86B6D771EF842291EDC0B5C08 tompeggy3
1,666,233,708 *AF50D27CC9407FA899C56D34E8DBB7837CD0E8E4 TOO1111111ONEEXCLAMA
1,666,233,709 *AF5C6E033200C5CC876855488A0E0101EDD15632 TORTURANT
1,666,233,710 *AF53289A80FB83A2151639D8E2A8729350C90622 TRADITIONALISTISEKSI
1,666,233,711 *AF585344C6A5678939D98FADE915BB48830237FE [email protected]
1,666,233,712 *AF5ED88632B6A2DBC9BC83EB057D47BD0D8BBF20 tralaya4
1,666,233,713 *AF5D99F2A24EB075D8B0E0B4E8F057FA6454B222 TREASUREISLANDMEDIACOMWWW
1,666,233,714 *AF58F87726B0652ED0647C280C9C1926A1B91F52 TREYSTREIB
1,666,233,715 *AF59F68D711FE3153FAF89F51B9D510BFD1EE270 TRINITY WHITAKER
1,666,233,716 *AF558F4392DCCE902CBEE308C08575F07D0B9537 triradially
1,666,233,717 *AF5162D74E5E3F2A56880CB127C2FCF3B33D25C0 TRUCHEME5
1,666,233,718 *AF5BEED1D9E30EF36374767B1CD1D4CE90C1067E TWELVE-HUNDRED-SIXTY-DAYS
1,666,233,719 *AF57C178E74A72B3E0AC8B3520E352387C617EFA TYCHICUS-HARRIS
1,666,233,720 *AF5D0DC335EE01E5B5534048D6EA89C3A3F81DCF u3smart
1,666,233,721 *AF550F9144BBACA7FE065164BADDB360467A58F4 UJUCABZI
1,666,233,722 *AF5214B9C6AE8AD99FE596184B71EFBA8563BE8D UMBERTOANDRES
1,666,233,723 *AF58AB69A50F9694BCDAC8958261841B59A1FB3F UNBROIL2
1,666,233,724 *AF5B219FFD551880AFAF655175EF295DC24B1A86 ungarische-tanz-nr.-6-in-d-dur
1,666,233,725 *AF5476D73EB75D6DC0257B90288752C4D6A7A176 [email protected]
1,666,233,726 *AF5B0242F012473E53AAFAAF0C8077283EA7FA16 urbanresumedotx
1,666,233,727 *AF56A4872025EF27B1292998264DD9B68211308A /USR/SHARE/LOCALELANGPACK/EN_GB/LC_MESSAGES/KERNELOOPS.MO
1,666,233,728 *AF5C2A5DC5542ECF6886FE53F4654CC9D5E08240 ustastvom 1
1,666,233,729 *AF56CB3E755F300DA5D63DE90132B55481D3958A vanessabontje
1,666,233,730 *AF5978B4364830CE398759B8C327ABCC6DD807A5 vdeggohs
1,666,233,731 *AF5C2EEC6436FC783A74DAE88BE2B09983ED174F veronica-castellana
1,666,233,732 *AF508734D3FED1A319985C99E48CC495BD79BA83 VERONIKA HOUSKOVA
1,666,233,733 *AF55A2E095EBFDAADE77D922DDCD792A7ED7B8E2 [email protected]
1,666,233,734 *AF54A0E75033FAAD690F57B826C2D419F825940F victor.hutagalung
1,666,233,735 *AF531CD56844AF0D14432037E8E4771C6F2B8C01 VICTORIA-ROSE-DILIBERTO
1,666,233,736 *AF5CFDF6B65CC0B3FCF88F326EB3B3E6E435CB3B [email protected]
1,666,233,737 *AF5750F870B885511D7B65FBDC8ABF4D75970B7D VOLAVOLADAME
1,666,233,738 *AF5B0A35AD21C8268D9B7E04DC6CA2200851F04A W\<
1,666,233,739 *AF56E638B1985E1CD36E4C73B447C73FBB746035 WAY RIMO
1,666,233,740 *AF5BF939D6FC52F1C2217E8DF825A61B38A4F0BE WCROOKSHANK
1,666,233,741 *AF50C28E819788DB5D2A4C449DBC1761899EFAF0 WEICYM
1,666,233,742 *AF516FB5394685F883257EAC0A174546A3C44A0B [email protected]
1,666,233,743 *AF531C7D3C055C39C2182BFB3D7E22D2B22C69DD WERNER.RYGIEL
1,666,233,744 *AF51D811CA6EDC03B63980AB1121A23AEA905E39 WESTLEYDEBORD
1,666,233,745 *AF5974FC2434D634948126D508BF022C587BDDB8 [email protected]
1,666,233,746 *AF5A3E6438DDF5059A8901FD241BB4F61A4D862A wga8aaaacaaj
1,666,233,747 *AF5550E5DD414A2292E9BD47F28BC21924027B10 whackanun
1,666,233,748 *AF522CF696C336C31074BD8E97C2E48C162F3166 WHITNEYDISKIND
1,666,233,749 *AF53B6DDA31CD676171027255EADEE10259926E9 whohaveyoubeen(andwhoareyounow)
1,666,233,750 *AF5F7AF588A867AAE556FD66AE4A49CD2093CCE7 WILLARDMUDZIMIRI
1,666,233,751 *AF5C26BDDD2CF284BB74FC02CC689E8D33117898 wilmervaruzzo
1,666,233,752 *AF55E67BC63D477B7B2FC6E0A5911D389A4482B4 WINFORD.ADEE
1,666,233,753 *AF5BAAA8C9B96B852139F81E1FDD0730F97620CC WINFORDGARNAND
1,666,233,754 *AF5E67E8AE2C5A636AFA1001324DB8EAFC432DBE WIPA-MI-SEDHI
1,666,233,755 *AF528B43CC7B3BC79A423346B92960E6FFFE34B2 #WKAAA
1,666,233,756 *AF55F7C0327AA92573AC6EF55930C0CEB97B48AA WONGLOKWAH
1,666,233,757 *AF5E06C481E1B0554B627078DD0985311E6E0361 woodrowscarset
1,666,233,758 *AF55CE9412853B71A2019B99DF894FDEAC0F04E9 (work
1,666,233,759 *AF5D661AF341A812933F331BD61E024359F123E5 wwweaglesdelicom
1,666,233,760 *AF54806785FECCB96BFA6C4BB87FF35B2FC27002 WWWRONROBINSONCOM
1,666,233,761 *AF5C466F48A6B972E33B4C16F94CF5ED98DC52FC [email protected]
1,666,233,762 *AF5C92C9F3AE10704005D3A297793A1321C986C0 X215F2
1,666,233,763 *AF5FB342C9622671D49AFB23D7E051DBACE81370 [email protected]
1,666,233,764 *AF5143095B2441577077246DDAD50217A98F4A60 XILEFNOEL
1,666,233,765 *AF503CB1BF135F0616268AE15D7A80F42B2FF2B7 [email protected]
1,666,233,766 *AF54C52CB4505688145D7F88396431E98CC11D52 [email protected]
1,666,233,767 *AF5EF6ED17E54CAA9FF0CC79A853389461BA5F21 [email protected]
1,666,233,768 *AF59D722E1FFE88AE050BD8A736E7AE2184790CB YGAHPONORUEN1
1,666,233,769 *AF583C84081FF9D037E530CBCBCDF3095B4A7561 yogiiadityafirmansyah
1,666,233,770 *AF54107553E5C6D4DB0328BC56DB00B09245ACE1 [email protected]
1,666,233,771 *AF54AB5F53EAACEB678B5032B5E5DE6F9802B5C6 [email protected]
1,666,233,772 *AF5FA325103B22659BA9DAE4A8E857A0EE364524 YOUR PLEASURE RECORDS
1,666,233,773 *AF524BE73F60B7876C319181B5CDE89BB83008E7 YUSNIZAHYUSOFF
1,666,233,774 *AF5C8E5A0A4AAAFBD1963708ADF173C7F274D66C YUSOF MAHAMAD
1,666,233,775 *AF50E361786045D46321DD4577DDE8FB3CB6FEDD ZAKOOL
1,666,233,776 *AF594E0682E21E8E80A61D79458ABD05E6A41898 ZEMANIAN3
1,666,233,777 *AF5A44A7C14B9A8308CBDD14253102258AB0FF88 [email protected]
1,666,233,778 *AF54B24F4B3972F47965B3B52E4E2B28892C740E ZHOU-YAOLU
1,666,233,779 *AF5D71C2ABA21F0AB47F3FDD9F8F605A6E3A4ED8 [email protected]
1,666,233,780 *AF572F538BFBC84C6EDB41FDDE0B4C9E5F05BD37 [email protected]
1,666,233,781 *AF501BFEE702FA0B7E4F8F7C4E7EA22316BAEEB9 ziergauben
1,666,233,782 *AF513E0BE9226A0B8A186B42D0039972D2BF198D ZOZA ALNEAEEME
1,666,233,783 *AF5E524A7BBF1DC9B9E95232C68494ED06065DE6 ZSBIADOLINY
1,666,233,784 *AF56464C181C85ADB6AE8D9962933DE739536D5A ZTKSTATUSBAR
1,666,233,785 *AF5D4C5910BB65598688712F7C41690287AD707C [email protected]
1,666,233,786 *AF5423E723D848456242B0117E25AD825EE52934 zvf|
1,666,233,787 *AF59CFF30B0C55D14267EAA9DD5E13EDF28D7A2D ZYEVRAHS
1,666,233,788 *AF570C55DCF06056BA59BED07AF8A60F5AABC78B домостроительная
1,666,233,789 *AF51E349E8E038CC0BD0A9B4EF6469443F776E3E «ПРИГЛАЖЕННОЙ»
1,666,233,790 *AF53D920839D4B5C4991156D5448392C16FBB157 ТЕКЕЛИЯТА
1,666,233,791 *AF5250577B6C08842D29F6FE8554495F2E615D9F фейнмановское
1,666,233,792 *AF5B29E2D00C2C8DA9622D5E54D04540FBBC32F0 同上。ただし日本以上に政治的な権限が制限されているスウェーデンが世界的にCONSTITUTIONAL
1,666,233,793 *AF51C1A6069F68C14EA3F38D451224C091DB08BB 100NI3S
1,666,233,794 *AF556D7BD5AC7EC01CD43E53F8376A78F2406668 1047510 euran.p
1,666,233,795 *AF506D297B3E054FB41C4144B2382721D58AAA16 1089859 ne.k
1,666,233,796 *AF524F35B1FCF2C502289AE09B72BFFEE8B1AB5A 12311628
1,666,233,797 *AF54A8DF1666678922704DB160018131BAF841C4 1726498 ASIAATULLAANTARKASTELEMAANTULEVISSATIEDOTTEISSA.
1,666,233,798 *AF57368FFB0E347DE61D56AA7B22FDC09A900873 1818523 TIMO JATKORYHM
1,666,233,799 *AF555470FFAF32BB61B3EF6F28F7A43A9A1B27D8 18.gaymard
1,666,233,800 *AF5171DF2E740AFB3EA22395188F890C71A8BC1E 1924145 SEKERTOOYLEISELL
1,666,233,801 *AF52A2C777540FB7AD8C8040342FCD41CA797D55 1935.KOULUN
1,666,233,802 *AF5FD03E220B109EADDDC616BDE8C99C338BBA4F 19861128:.poughkeepsie,.ny,.usa
1,666,233,803 *AF59F755B330BC99DF90C493817B380CF51CC02A 1 ACHTELFINAL-MATCH
1,666,233,804 *AF57CC19F27187BA9DF324754A0E5DEA3F3A5E56 1-alue-ralli
1,666,233,805 *AF5E670673C333C1DD9BA1E227DC0B885DB46036 1.consciousness-in-formation
1,666,233,806 *AF590088D28640EE5624371F8E4C270C54BF479B 1.dISticaret
1,666,233,807 *AF5358EF13BD4A4B792389DFBF230AC68C0D7E43 1ESPEBSW
1,666,233,808 *AF5A8DB58F78128D3F3E63724416BD11E289CAB7 1 EUKANNALLE
1,666,233,809 *AF535D0701B1B892F5D8A2FFF2E98168CC915AF2 [email protected]
1,666,233,810 *AF54647AFBE5C9A45D160204DE80A219B0FAD7FF 1 HAUVIN
1,666,233,811 *AF580CD1EC7B8FBA70CE13ADBA7DD3B71663E5B0 1.HOMOSEXUELLEN-PORNOS
1,666,233,812 *AF577B4FDC3A984C38A28D5F8C5085846DDFD6C7 1-IP-OSOITETTAAN
1,666,233,813 *AF5956A9EED149084BB1AC3B6E78AC300A982BD5 1-kaarakokoelman
1,666,233,814 *AF57A4E9B3C2DC050A35805B921CBA12D79A8DEC 1KRKBLJW
1,666,233,815 *AF58DA91F2B428211A649CB754201DD3B813A03C 1latauspuristinta
1,666,233,816 *AF58DEB2BF7F2F5E23B8396919949D30CCCE4B75 1LATAUSPURISTINTA
1,666,233,817 *AF57C81C832A88F6EF768CD3ADD49277F3A149AC 1.LIVER-EATER
1,666,233,818 *AF5A488FF333B4751C509853E196375017D12990 1.miniwerkzeugen
1,666,233,819 *AF5A706D894E00CFC2893621522CA459D0CFC9ED 1NROHREED
1,666,233,820 *AF54F74FC853C47EDDA660A2541D991370857A8D 1.pazifik-raums
1,666,233,821 *AF5BAB27469592EFE1FFC67D4F07E71439CE8A8A 1PHYSIKKLASSEN
1,666,233,822 *AF5B97D3BE1B17309B4876FF26FDB326457E0DD5 1SIVUVAARANA
1,666,233,823 *AF58AAC4E5FB7880563C413E58E395F5332FD8BF 1.SOKERIPALANA
1,666,233,824 *AF5A508B6AEA179405CD49BE5A5AC0B01768469D 1THEDANA6
1,666,233,825 *AF5D14257DD4E95DA34C30294C877D676A9DDAC0 1 TUKENDIGIMI
1,666,233,826 *AF566A4DB4B469749AD68FB7DF95A554D08C1354 1 UEBERWEISUNGSBETRAG
1,666,233,827 *AF546DE75432E50EB826A8B80C4E8B6803512D52 1-VARAUTESSASI
1,666,233,828 *AF549873AFD83AE49EB8A10EFED56634E10BD88E 1 YKSIL
1,666,233,829 *AF5F571229711E7652ABAACB037EEFA6C0EB344C 2059937 it-is-not-even-very-international-.
1,666,233,830 *AF5BF0B01C648BAE98204BEEA4D50FBBBFB47972 209GABRIEL
1,666,233,831 *AF5E9CB03629DC6C0FBC23E1B1199788C86B7E57 2163265 kirjoitaoppimisp
1,666,233,832 *AF59170F3ABE6A3E098CEA82FE819C6A2E9F778D 227672 MALI-SORUMLULUK-TA-BU-GOREVLIYE-AITTIR-
1,666,233,833 *AF5C1B6C8D267B6FF39894A52FBAF92C5A4CD975 230546 discountretailersfaredwell
1,666,233,834 *AF5E6B01D156B945797ED2E64B13689F5BB1E969 23z
1,666,233,835 *AF59158576293283A7B8CA344CF78A9D142A813F 25101551
1,666,233,836 *AF584D209D99EA06D030D75D72A95C4806A91E04 2BRITA-VEDEST
1,666,233,837 *AF59AC55E7519525D6ADD63F6E959D53E62DADE7 2DESHAGAN
1,666,233,838 *AF5A600B58ED2C3FBC3D2F909DD3F7D175B86DB8 2.kalustesarja
1,666,233,839 *AF522B4DA304CE6498FFC5F0BA964A900A9F3292 2 SHMULIK
1,666,233,840 *AF59C443C20CBAAACF4E51C930D8D3DF8A97CCB0 381168 LATELY.,.THOUGH.,.SHE.HAS.BEEN.GAINING.RESPECT..
1,666,233,841 *AF5AC446F6DD0B501376E04F2681525B20B4A8E1 3. charles boykin's copy on "killer" in dallas, texas,
1,666,233,842 *AF5903F0CD4FEDFD8899691D00D6174EBB331F41 3IJBRENGT
1,666,233,843 *AF50A7FFF3D1B43FE6422110621123284D3DE0C2 3L3C+S
1,666,233,844 *AF517D77B976C1C6F01B5D6F3F175D50065CF355 3-MOSKOWITERN
1,666,233,845 *AF5738EC28D38474FBF64487C1FB305FFB75C3B0 3ROMURENKAAT
1,666,233,846 *AF5D4707F2C8223DED2173228B851CD8A01D6D76 3skelnen
1,666,233,847 *AF5298D19FAB2347339DA96FA0765F5C17641279 3----->.~.`.SPLAT!!
1,666,233,848 *AF582497DB3092FECF31E79D7502E6F1E386F61B 3THATTHEKING1
1,666,233,849 *AF57AD35F50627616DB9CF909BEC1FF7BC2BB403 3VITALIAN
1,666,233,850 *AF524FC1AA5B5FB03BAED8593B0030DCED8E0354 42°54′43″N
1,666,233,851 *AF5F8BE74D92B2C5B3C12B038B871C29B52A4703 4KAYLAWAD
1,666,233,852 *AF520FFF719E9654312DFC96FB664F00AA272FB5 4MYORLANDO3
1,666,233,853 *AF59AC3654524484F752CDE706557F5E0C7E608E 4YERUSHALMIBSW
1,666,233,854 *AF5E2032DF88AB6496E6070E5DE6CCF4FE675D07 54.TUKETILMESI
1,666,233,855 *AF53835D6319E4985B94901B468AAC2F67D51583 56SITSIT
1,666,233,856 *AF54779C02A68BBFC879F75BDD22AE7DB564AE87 5BBRGLVFRTCA
1,666,233,857 *AF527D76511AD168D57959B64ECA35F0810F5AB4 5BEATRICEDO
1,666,233,858 *AF523DD95A27FFAEEE9846349E3EE472DA345E53 5GLOBALHUSKERS
1,666,233,859 *AF5DC1DF85430B819A0FD8CFDEC17C1CF1344CC8 5.LIIKUNTAAKIN
1,666,233,860 *AF5D074C8BD5702E7E91764E5963EF7B0BE09D91 5-stimmengewinnen
1,666,233,861 *AF57887D5CA95110D590A8E363F9A5699D199604 5THESIRIUS9
1,666,233,862 *AF5031FDAD8A4EF916341442789E97190716D3D4 5TIUTSIOP
1,666,233,863 *AF5468588EFD56506952C5E294FBCF6AE99FC32F 60.JAHRESHOCH
1,666,233,864 *AF503C5C5FA5833D2038E89ABCA759AA936882AD 6ANCHDALE
1,666,233,865 *AF50F658543DAB8FE4CF791F5532CFAEEDCD403A 6EGDIRBLI
1,666,233,866 *AF579E2E9A7625CD9D3D6D4DF9CCD6F41F2E0586 6NONPOLAR
1,666,233,867 *AF5B7A61EA3D38ED09CC2617D06E9F9CB4B95580 [email protected]
1,666,233,868 *AF5A9905890C1E82BCBD557B9EDED6024F525634 796550 ich-haette-nichts-dagegen-,-wenn-sie-abgeschafft-wird-.
1,666,233,869 *AF55970AD53D3BA1A3768D5FCCA70282D95AE2C2 7BILBOELEPHANT
1,666,233,870 *AF5FEDF3C9E7DB1E016980807FDB1B2674DCFF61 7DUIKBOOTVALLEN
1,666,233,871 *AF5B9C0DAD10174C9CEB360A7BE5E9C08DFD1B3A 7NEREDUKOVANIM
1,666,233,872 *AF5558A39DA3748B4DFE0678F283AE168917EF98 7SENTENCO
1,666,233,873 *AF5C5676C79857865C455511EB62B4E2B983D021 7SPONSORERING
1,666,233,874 *AF5991BC36E73A273F68FB547A5DDEDE15C3527E 7.viihtyneen
1,666,233,875 *AF588EB42EA4C9D5A3C9FE3D6F0D7ACADD833B65 801$+ER$
1,666,233,876 *AF52B896BF747B6DC1138708F63E918912FA2A3C [email protected]
1,666,233,877 *AF5F459B873238C9E1F7F65867BEB25FAD300C5F 8CHERZANO
1,666,233,878 *AF5525DF33195CD8BCBB52C6061A093D839DC47C 8COMERCIALZC
1,666,233,879 *AF557970665A0BF137F59FEC76179E93BD617860 8disorganic
1,666,233,880 *AF5BA222AD85E5849EE2C1F7F0A6DDB14A7C39D1 8L4RNEYS
1,666,233,881 *AF5FF851E11A342007081E1FD98B7C5E39EFC8C1 8MRSGEORGE
1,666,233,882 *AF5A21D5E3285F44D4C81DDFA27C1A29F685EFC8 8##>-~O-}X{
1,666,233,883 *AF59EA445EEDD99575EBD3E74D38EAF0EC7FD69F 8#####>-*-*-*splat!
1,666,233,884 *AF5027CE898A890DDE62C063BC7B5B19E2876F21 8TAGLIUZZERANNO
1,666,233,885 *AF5284496DB1ABFFDD92A3F636C188B5B5B50B15 9BURNESSE
1,666,233,886 *AF5FD2EFB8D2C903E74AF6470A93D0D73C206667 a0(am
1,666,233,887 *AF554752BBE94A894DA09C19384BBCD862C7EAA3 A1FINDBUTT
1,666,233,888 *AF5C7394A53FDDB7AE443B7E1FB322DA6BAB5A8A a1tdd
1,666,233,889 *AF5E35B52FDE221FDE1565EEBED776D1F0530F35 a4qg4
1,666,233,890 *AF5EE9F84572E3790C2C5A489BBB2C93342E4D38 AAFF0
1,666,233,891 *AF5CB4FD899356A58A9734AD4FFAC81497513B5C abortion
1,666,233,892 *AF56C7295A3B0506C6F2411C7A1DF3DEA250D266 ad4hk
1,666,233,893 *AF59E92E6831DECE5D3716AB6CBFE1041385AD16 adalbertocarman
1,666,233,894 *AF5919340D715F2310F3D73F9718268CE90CF4D7 ADALBERTOMARECKI
1,666,233,895 *AF5F70585458880CD0A9C62B4BA62F444B3F8EEA ADIIS.NET
1,666,233,896 *AF5768826EB2F258EF20C4DF39EB6365D9C72E09 A,DNK
1,666,233,897 *AF5B736F9F5B56999C89B25E12D47B06357CDB78 a?ik
1,666,233,898 *AF541D5EC999A6F01F859C9BFE72C030085A12E9 AISEERFING
1,666,233,899 *AF5072762A068C0A081C5B1DB14FB21C35D94AE3 akgpb
1,666,233,900 *AF56E717928EE2E7B72B322BB68617FE7966A10D ALGOOKIN
1,666,233,901 *AF59A26D9F23C36702E75D4883EEC7D129C521EF ALkk
1,666,233,902 *AF5BB3F64FA93A28D592CEB36862BABAE039F939 $ANDB1IN
1,666,233,903 *AF5CE4A7172586EB57C389F2012746F615357200 ANGELAWILLIE
1,666,233,904 *AF58915B35F51F956D12FB0F0E81A0424B9F73C7 A-=O2
1,666,233,905 *AF5224508115A3BD5CE2AF8C1F974B7484D8AEAB A/RF.
1,666,233,906 *AF5A8940420F6D74890B2527F002A2304E41EB9F argulins
1,666,233,907 *AF549B2BD9FD3419433D5273D2EBCDF4C52DCF41 AUBREY.SCOPEL
1,666,233,908 *AF50D1B6FCF86137789AB2FD354CAC4AE1FF61C6 AUGURENT3
1,666,233,909 *AF5F14B84232AC37CA4B3ADC6B630AD0F39C7280 AUGUSTINEOTTERHOLT
1,666,233,910 *AF5D7F7C95CF74306E0AECB5BA7BB9986359F2C6 AUGUSTUSGOODROW
1,666,233,911 *AF5DBAC34AB09F9C9D433629E3A2240DFCC49E10 au(k=
1,666,233,912 *AF514BE3FACD98D53587965FA1E314EFA4098901 AVERYBVERGER
1,666,233,913 *AF534394F562DAD0A600FB050013CCFDC11C3225 AW?3
1,666,233,914 *AF504694D661E648FA70328E8FB3C0E623082EB4 b-> ~0~osplat
1,666,233,915 *AF58E9164441265A08338FF67ED42B86C6E42C78 B1?E
1,666,233,916 *AF5406A389594E808D7FD37710D2FB4CE27A2C96 b7qp+
1,666,233,917 *AF561798709E384201340D70B6B123C4AB609D2B babysdayout
1,666,233,918 *AF55B942604617FAD7EB77C76B73ADC16EA432BE basket_beagle-'b/&/sk/i/t_'b/i/g/@/l
1,666,233,919 *AF51FB67AA77D251C7F652AD64591868DB9195C6 BASRIYEV
1,666,233,920 *AF51532837BBE80665E9A54D2649367707D6D83F b(ax
1,666,233,921 *AF5D23292D18DAE7AE9736BA097119B8FEEFFBA2 BENBANE4
1,666,233,922 *AF5F22F26842360A53BFD857FD7DBEC8D34D5361 BENNETT.HOPFAUF
1,666,233,923 *AF5882BFA3FF1EC741731C4A578D3ADEFB18CB2B BENTLY BROOKS
1,666,233,924 *AF5883280F4E93D04B6D7A9817A24786D4871027 [email protected]
1,666,233,925 *AF511D3AD52F1FE33B567C019E3C60D53D539E76 bfmn;
1,666,233,926 *AF560465C78D7CECFDD1BEFB05B546EC3A60F839 BjF+
1,666,233,927 *AF539D7850CDA09775863712FB5199A87418F766 [email protected]
1,666,233,928 *AF5077CDE422EC59866BA361C61EB1B38EC3B0B0 [email protected]
1,666,233,929 *AF5384D6FB1B768BD40C53E7E26E2AECAC224746 BODPM
1,666,233,930 *AF52BF3EA5199034DD71648C63918DA648EBECBF BOMM3
1,666,233,931 *AF59EB1740C91F8EF6D3235905B9A08E3C837BDC BOSBESLANGSPRIETMOT
1,666,233,932 *AF57A8D5259ACBEF6615B838197191B7C615EAFC BoSM
1,666,233,933 *AF5E2C6C922E96B828D803DBAD992F368F872B36 bqctb
1,666,233,934 *AF535E1EE88365BC1A6E4915A3FAEF50A1DAFADA BRENTONTAVIRA
1,666,233,935 *AF545817F906F01D8B6BC9EDE4318C3BD37EE083 brre++as
1,666,233,936 *AF5ECF2CFC447631F27962F1D9ECB5F08F6344D9 BS$5L
1,666,233,937 *AF576F5AA10CDED6CF8AD4C378FFBE276BDC4E4B bu86y
1,666,233,938 *AF5B3F31A610A09E0446D7A26912663D8ECE91A5 b#xuk
1,666,233,939 *AF53E0AC23247DEEA4D47F7138628C14CCDF1734 c_2_
1,666,233,940 *AF5E5C596FCFCB5F96C840EB57E98F7C53333DE0 [email protected]
1,666,233,941 *AF5724856F114A734E8DF05E8670B10E3B2F8418 „cammie“
1,666,233,942 *AF5645C078B05582C0C195B3F929B1980F89E71F carboxylic5
1,666,233,943 *AF5C7B0D8E2DAC6C66714E96D7802C247F5A9A52 CARMENAFSHAR
1,666,233,944 *AF55837415D24327DD9DA256C7B2B22D182B24B7 CARMENTAE1234
1,666,233,945 *AF5407C63D7D4B58A71B620C56C793E290F84373 CARRAT!
1,666,233,946 *AF55326619E95E2BC25708C32FFF7908CF98935D C)BWL
1,666,233,947 *AF5520B35B258D684EB3D4567E3A61EC1AB2579B cedricricher
1,666,233,948 *AF53F15D4795CD3216E36B181A0FD2EB69908559 CEREBRIC
1,666,233,949 *AF53DD74F1C477A7C4519578295257F3267E81A8 chadricksmith
1,666,233,950 *AF5F755D8A2ECBE619856829ED24703209FA39B2 [email protected]hina126net
1,666,233,951 *AF540ACA93D476E3C09FB382E5813FACB120D443 channelsmrk
1,666,233,952 *AF5F77712B75DDAA664CCE159602F7A73ADB68AA CHASE.ENTEL
1,666,233,953 *AF5D537047C9D0E811C78A887E2EE27B37C97BDA [email protected]
1,666,233,954 *AF5F95A7687D992AA508EE1FEFD1B5CD369BC239 CHESTER.DETJEN
1,666,233,955 *AF5AAAFE6EA9AC79F72E2B6321EC0FBE04F9AA46 CHONGANNON
1,666,233,956 *AF502A58499ADEE3D1A74C1E80504F729D5287AA [email protected]
1,666,233,957 *AF58F4330A0DCBDA5D856B9007657352BC63A7CD CHREIHER1
1,666,233,958 *AF521FE287DA0E1412BA478AF88D504FA09D8497 CHRIS.BRIARE
1,666,233,959 *AF54EC50159C0BE00449142D6629E65AC0F86158 christoperveles
1,666,233,960 *AF52B7D3B87AC3FB265A12CB0A091A3B60030898 CHROMEALLOY
1,666,233,961 *AF5DAFDE029E9943545A5141D78DA311F86874E3 [email protected]
1,666,233,962 *AF556B9E9E4A959F747F30D76A696C8A65715201 CLINTONASSOCIATED
1,666,233,963 *AF5906DC6EAE67AF4C12EE9888301B68A2A314EB COMBUSTIBLE C
1,666,233,964 *AF5FA2AB52B1E5A16493C2AF7A2270F438BB3B57 COMMNTTCCS
1,666,233,965 *AF578C3B2BA93FE2EC5AA278CB70C4C9F630C7DB comp4ctor5
1,666,233,966 *AF56F269866869E1BF67368DC6C0FDCD6758481C [email protected]
1,666,233,967 *AF57A4A6DAD03AA6BC8A1C92943E8C5EA6D0065C CURTIS.KRATOFIL
1,666,233,968 *AF557F2787E59D0CEADDF39C41CFC904706B0DF5 CWB$K
1,666,233,969 *AF56327A7A96A02F9AC0ADC3363FAE1BA5232D55 cwmk?
1,666,233,970 *AF54A8FE0DF321FBEBAC20AC31E178AE9CCD7F33 CYRUSLAFORGE
1,666,233,971 *AF5239BFEDFFB6C5B98DDD2B92DE2FABC6948231 d01j.
1,666,233,972 *AF57FEC707DBCC1A23AE7ED06F8B321AD4C951D9 d,#=3
1,666,233,973 *AF5521E669B85C977D458C66110472E2214889C4 D3R$MAN
1,666,233,974 *AF5645E34B877F0D8CDA2D6A91D784BD8F443DEB d%3s
1,666,233,975 *AF57204745479C382A4E89D620E7829144535D60 d6kv!
1,666,233,976 *AF533561CE9C758DFCAC57EF7040B95E6A4FCD85 d7_o4
1,666,233,977 *AF5E6A11040D25D9A8F029B3A05159A9CC5270DD d8d"f
1,666,233,978 *AF5F1DA82DB3447B83CF6212C943EF1F180E7C98 daltoncal
1,666,233,979 *AF5270E8BAA7F69E22DF8D8E11CB2C75A22E72D4 DAMMARYS
1,666,233,980 *AF5C15267D64141B25BBA21EA7E86FAF23FFEE6B DAMMBRUCHPUNKTE
1,666,233,981 *AF5F630F112A2226F5663EBF4502C6E3FBE423EB DAN9H
1,666,233,982 *AF56B525F3EA5CF54672004E69E32ADD527A7F5A DAN.EGGE
1,666,233,983 *AF5B63D560372E1C7520FC6253C19220A92E4BCC DANIEL.DUNLEAVY
1,666,233,984 *AF5E166E46972843B335DC82556212D56E1A5C06 DANSLEQUARTIERGAMBETTA2
1,666,233,985 *AF52747A7D943F773551B174B9565AC56A2564D8 darrontrusty
1,666,233,986 *AF5F164C53F0033D63206EC709D4C3C45611EAA4 DARWINCASSIE
1,666,233,987 *AF5C6045D652C86E747DA60B8D1C28CA1F08E4BA DAWGAFTERDARK
1,666,233,988 *AF5B9506DDF705236C6B1B0F0ACDF284F08C09F7 DBK%U
1,666,233,989 *AF5C65555273C10499E1358B63C2841167D6396D dennylehoux
1,666,233,990 *AF593404529425B176C99D73FED5DCC2BC4F30C7 dentistes
1,666,233,991 *AF5F29C732B9743F6721E520D025DE5376AD3D41 [email protected]
1,666,233,992 *AF57CB35A51B414AF8250AB622ACD2D69DB25E28 derutcelnu
1,666,233,993 *AF559887AF217CC5D131C98DA1A829EA668651E3 D:HHX
1,666,233,994 *AF5B02700288420D2D895E50BB104391684F98EB DILLON.LOWN
1,666,233,995 *AF5D3C6ACBE0B6D5156E8D87D887FAA128759615 [email protected]
1,666,233,996 *AF5087A47F9989214AB0F7BE843FC01E658797B1 dinogushwa
1,666,233,997 *AF5D72F9348EC1C1ED103847F47A5FBE3AFFB519 DL5%V
1,666,233,998 *AF5E82E0A543987C540DEBFDC6EA68C623C40251 dontesipler
1,666,233,999 *AF511951776C6C5ABE52AC79F56DF17195794CFB DORIANYAN
1,666,234,000 *AF5B6F5A81AB514663549C0725AC7E7CFCF2A6D3 dorrwayne7
1,666,234,001 *AF5AF5E727A39F4BF678788F2B803D6C106B194E DOUG.CASTILLO
1,666,234,002 *AF5DF66C17E42298AF5BEE5462AC152E3917D3D8 dougrocha
1,666,234,003 *AF5407E08769DD2EB6C563BCA7ADDAB52A035691 DOYLE.HATLEY
1,666,234,004 *AF5FEFA6828B1080EA6E28A3E776CEBBE3EA910E DPTC&
1,666,234,005 *AF5DBDA2F01C5F6A4C25C87F8B68A220524BF317 DRT?(
1,666,234,006 *AF5948ECEE12DE5E3C5D5195C4FD47CC96714C17 DUE:
1,666,234,007 *AF53E2AEF1F0BE9A874BA331D91FC930DE600A31 DU/U"
1,666,234,008 *AF5A4AA0F80D2B8344AB7A27A66FF2ECC1F063D3 dwainfedel
1,666,234,009 *AF5F760F3CF6A51A40EDB7065BDCE5FF0B85720D dxsgn
1,666,234,010 *AF549EA59792ECA94832A59BFD45AA8BF216AAA1 EC_.L
1,666,234,011 *AF5ED51FC8859CA69101FB77DE2D2DB697779DDE ED1GU
1,666,234,012 *AF5C200968E1AE9414023A8EE4F7EE7A0EE7A283 EDITSMOTOFAN
1,666,234,013 *AF50DB6A53103DD7969AF1EC896B375C2CB69E30 efc?)
1,666,234,014 *AF5BB4631623910B92C4803F2277B72FD722CFB8 EHT.FO.TSER.EHT.TEG.OT.TOG.EV'EW..SU.S'TAHT
1,666,234,015 *AF5C3A86E2F6E988793623F9E7FF6CFAA56775D9 ekt=t
1,666,234,016 *AF5E7E51C0725D7617659FF1EB6BF78F2E66BFFE ELDRIDGE.PLOTNIK
1,666,234,017 *AF570C6EB51382F1F7579D476A0D633C8D240444 ELOY.GOINS
1,666,234,018 *AF53AC01E52C8613ADFF2B952E48B479D5559F51 ELZORROCHILENO
1,666,234,019 *AF531A6C0C583538B2341246DB808BF9C1063B87 EMAAZMI
1,666,234,020 *AF5F22BB61F7D9BBDDBC67B0E947C55C568FD5EF EMJBR
1,666,234,021 *AF5801D3A2B2CC2CC0B2CED96FFB2A740B7950CA enba,
1,666,234,022 *AF5C3AFBE2B3C92992B49904B2F4B984F131A477 EOHS94
1,666,234,023 *AF5CDA4BADA9E3A42B04D6F4DFCB577AE8B5DE5D et=0g
1,666,234,024 *AF54FF0C13B82F25527A1B4D4580CEA2A8FAA390 eunicka8
1,666,234,025 *AF533045AB91CE613DE599B6B303BB800B1F4385 [email protected]
1,666,234,026 *AF508BFD2BE36BDE9DF665D561F6059C5DFA36E3 ew/b
1,666,234,027 *AF552882DB2B435FBFEF233A8B5B03605D589A1B EYw
1,666,234,028 *AF5A27E9C24D007D0B5BFFCC35BCE40766C9931C f;\8
1,666,234,029 *AF525AD4C8043C515A106EF45D0AECB7921D8DE6 farhan.butt
1,666,234,030 *AF5FD4E5579F76ECF9F22097EED280D8CB38C8F9 FASCIASSI1
1,666,234,031 *AF55FEA3FEF59CD35C11BA5CEE8DA9E0096FC9EA FF8256373763395AAA4E118F3487D693
1,666,234,032 *AF565F3D28966B80E0413C84542D60F96DA617B1 FIJNHAKTEN4
1,666,234,033 *AF5CAB1590C988DF16A7B60EBB47C212C658E257 [email protected]
1,666,234,034 *AF51B907BE2F873778E690BC85CDAAA378407186 „fixation“
1,666,234,035 *AF5757BC48740F16FB6720B631850BF52A1DB100 [email protected]$$
1,666,234,036 *AF54DA615DD208A0A50F0FC6F99EE89BF4C3A793 FREAKY-FLOW-&-PJ
1,666,234,037 *AF58AC56571963AFBABB5F1399712366D30BC02E FREDERICKALEIZAR
1,666,234,038 *AF59E56AA19CC472C6E2517AC778C4929831BAAA frequenzfilter.
1,666,234,039 *AF5B74F9DB7E43B50D4CC4871CFB82BA054EA6BE FRITZSTEWARDSON
1,666,234,040 *AF5E19BF60F7B944C0E559CC7E4DB93304B1CA34 ft$.
1,666,234,041 *AF5BFD2B3EC3180022866A305D8D865FA3DDBA32 FUCKTHEMWHORE'S
1,666,234,042 *AF59C2CE8126B26AA8D8DB34BA2365950B0AEAE2 G})@
1,666,234,043 *AF57C413B29CE5BEB61289F157855F8A8FE8A524 GARETHBLAKE450
1,666,234,044 *AF510A595E193F480D4BDE55EBEB1DCCD3BD6EB1 gargany4
1,666,234,045 *AF57A7C376AF732CDF56D2830A808555300D3C68 GAYLE.MASELLA
1,666,234,046 *AF5CB2E4E1C12EF1A46F3BD839F6DC2DE8E31128 GE0L0G$
1,666,234,047 *AF572B0B1519AA177F67F9DE256031532A4669C7 geladeira3
1,666,234,048 *AF545FC482A68CF9D168A74226367B1E72DF4814 genesadler
1,666,234,049 *AF561BD9E8F0F00F565E9C20E354222CE358C93A [email protected]
1,666,234,050 *AF5DC2E3F22A878734798B48371D84F03D4F3A23 gibrafle2
1,666,234,051 *AF52A212BFD1B1CF51F997A5E9EF6B485D8F8CA5 GIOVANNI.LASKA
1,666,234,052 *AF5036EB1A7BC0C7E0F26F92F0EAF3D3B33E3651 gi$p3nd3
1,666,234,053 *AF56D0293E33AA693441E098FE47C5DC71194118 goldratt30
1,666,234,054 *AF5A7A6DE77EB1C34B1A04F15192B75BDEB738D6 GONZALO.HALLOWELL
1,666,234,055 *AF5AAEB5EF5AE806FE4236B3AEBBFC5A37A7D372 GOSPEL-COUNTRY
1,666,234,056 *AF5732194F510641AB4AE4D629CA5F143FABC3D9 goutteriez
1,666,234,057 *AF527823FEDF5B15AAEA99D9245651851A9468AC GROOVETODABEAT
1,666,234,058 *AF560C39814946D8FAE7B0DCA1FE357F7561D3B0 GUSTAVOVANDEKAMP
1,666,234,059 *AF50D664540F15CAFD2F40D146C847B4E1C13EC7 H3$+4+3D
1,666,234,060 *AF5681803FC301188F40BF273011C46BE582ADEB H98U
1,666,234,061 *AF526229284CEFAEBA31097AD837EEB1CF151E38 HALBANOWI
1,666,234,062 *AF52A95EDF0F0FBA571C7B661E0FECE97B4E3A1B HALONEN84
1,666,234,063 *AF5403DCB86750DF965ED73AD55B2E7475582536 HARLEYBARNTHOUSE
1,666,234,064 *AF50DF0C60FB0C7602C464C0D8F252100B51CAAD harrisonwogan
1,666,234,065 *AF54929D177396877BC231A761384303C99D3FD3 have-your-children-spayed-or-neutered
1,666,234,066 *AF519ED0FFAB04B3E24E9D35358953221816631A hekmatijaras
1,666,234,067 *AF52324DDDF668A1D24DE84AC42AF403FD117A3E HI14RIOU5N355
1,666,234,068 *AF5AF3E3279C191E3766D4E4D047E3FB8781BB47 HIRAMBOOMERSHINE
1,666,234,069 *AF51B1F6E7DE751275DC27FD0E1B73B7E4BA8F58 HITOYASU6
1,666,234,070 *AF5A0DBF1A1B59274B9BDB9874B047ACE20B59D5 HOBERTBIGGART
1,666,234,071 *AF5C29206F9465A89C2D46BDE68F418CA322E454 HONEYBALLS.
1,666,234,072 *AF51DBE597E39A518832AD2C62EDAEA020DD5C2E htnacagas
1,666,234,073 *AF5F97137EE2F4D996FE9641F9BFFB6A5E3E775F hueyburfeind
1,666,234,074 *AF5CFB7373959E545BF6FA5210BF41F6DE686038 HUGHCAVEZON
1,666,234,075 *AF542E33F8C2F3BD2C31BBB759C86130055249BF huntercheser
1,666,234,076 *AF54A0CD3C628A68DBC80CB46FAC39157CADF357 I-am-still-learning"--~[[Michelangelo]]'s-motto
1,666,234,077 *AF5C01044873BA6080B8DAE7E35E271AAE4DBA4C IAMYELLOW69
1,666,234,078 *AF516D57FD81C9569D394A9356578D446198E7C6 IINGSOLIHIN
1,666,234,079 *AF535BB0C2281320F02DCAE795BBB04C8C25C31E ILLINOIS_93SVG
1,666,234,080 *AF5A19B01C307A54736EEE56C4213B619B1EB320 ilovefrogs80
1,666,234,081 *AF59B8EC68CA67D2A58A4B77D1A998914B243D12 IMINNAKI6
1,666,234,082 *AF5E0CCBBEEA78A2CCF548354BA4823299CE1A62 I'm.So.Crazy.'bout.you
1,666,234,083 *AF52617974F27CD8F78BA86B52DA1BB15C09EB82 Incorruptness
1,666,234,084 *AF597BD639E239346065AC3ED3309C13F996B51F INFLANTSKIE
1,666,234,085 *AF5DA65DC546C73C1A6DF2CBE9C4CA8BEF6DA62B IN RITUAL
1,666,234,086 *AF54564125C5BB98D7BA7C6DD8D0122308F13CE0 ISHANCHATHURANGA
1,666,234,087 *AF5861089F79A927960490247AC91C0FFDB119D4 ISMAEL.LANAHAN
1,666,234,088 *AF50A9EC95C64D060E2FEC315DA3AECF61846441 [email protected]
1,666,234,089 *AF5B51CDF0FD44E31A0604356E9AF0F66BC33744 ittingford
1,666,234,090 *AF5F5659CBD43ACDDEEFD1CB156F9AC9EDB0D109 itvalfinsurvalouse
1,666,234,091 *AF520E50C4DE91D6D930B28798846B0AC4AC14EB IVORYKIRKLIN
1,666,234,092 *AF53D042453C0178E9118033E7DE99C02A18A6E9 IWYX
1,666,234,093 *AF564D9C678D90838B765153E25FAB41D1CA72FA jackjanuary
1,666,234,094 *AF56F82DFAB50A4C707FAB1576A013DA7042F7E1 jamie.harnett
1,666,234,095 *AF5C203E67EACA0C6E46CD1580652516E42BC835 JASKIRATBRAR
1,666,234,096 *AF530A174C4B6ABDCB1341970901B6880102D96D JEFFERSONAIRPLANEDIANAROSSANDTHESUPREMESREDSKELTON
1,666,234,097 *AF53322FBC4017FBCF327FF920E07019C19C3371 jerroldlossa
1,666,234,098 *AF5003485F2128347EC289B69A0D58FD791C5C75 JERRY.STOFFREGEN
1,666,234,099 *AF5BE41F0B93CFE6CCDF3895A0F80E86E8CF56F4 jesssprinkel
1,666,234,100 *AF5EEDD921B7FC5CECD977766ACB272114142BF4 jiang.wen
1,666,234,101 *AF554E549A35B3709568DA4F72D924A25BCF5CBF [email protected]
1,666,234,102 *AF510DD802350D9ECF19B660684D19B55752D943 jimmieveach
1,666,234,103 *AF5B568D20D1527F316ACFD266D69234514D216E jimopen2
1,666,234,104 *AF55E5F8BABA8FDFC778BBBC0CC0C48108756374 joe-mccomiskey
1,666,234,105 *AF552D613939A1F9F291C4B719607833D84B52E4 JOEYYINGST
1,666,234,106 *AF5ECEA7BE0FC8591D8C9BEA10DE4C06088CB66F JONNEWCOMER
1,666,234,107 *AF5D3E71A3A2ED494882487DF189FFACC1124091 JUANLEVER
1,666,234,108 *AF54691A8768057ACF1A799CEEAF770A642C97A1 [email protected]
1,666,234,109 *AF586F0E724C36DC6C02FA17CD2CE4344D1A8CBE JULIELIMA
1,666,234,110 *AF5052DBF715FFE3A125564B86EB977119101CB7 JUNECANETE
1,666,234,111 *AF5667752C0EB383D8D5CDB7D838E9B2A742006B justinbronze''justin
1,666,234,112 *AF5E19E7D9E55551178485EB29C692EEDA82EF41 [email protected]
1,666,234,113 *AF528B7FF06DEC0B1D94A4F0B6F3A2174BF0C13F k-9*
1,666,234,114 *AF508CF1B941EA3750820463860DCA28DF779FA9 KAMAL.SAMARASINGHE
1,666,234,115 *AF5BC81EC289CCD210D1FF593AA98B9C1A246BB2 KAMONSORNT
1,666,234,116 *AF56E3A9CD307A66D6E6ABEFC51EA2D5D48362CE KANPUTXEAK
1,666,234,117 *AF5304B8B9F0EE481548A0C65C3380AB5EDA13AF KATHRYNHARPOLD
1,666,234,118 *AF5E382D15B2C27A24C69EB500CD0D6F9375B611 [email protected]
1,666,234,119 *AF54CBCF5A1424A7632C4359DF8197BEDE365822 KEENAN.ADAME
1,666,234,120 *AF555FF256468166DF2FD969209EE57C2CA4A1AA KENNITH.DURESKY
1,666,234,121 *AF51B9AA9585FEA62DDFF5C499B1DDE97AC00223 kentondirk
1,666,234,122 *AF50C2847E3F908AA44609D9929A906F5C908156 [email protected]
1,666,234,123 *AF58ADF6A7DEFBA42592BE4E9C99EF6394C2972B KIA444
1,666,234,124 *AF564139974E43E41EDC06A898DDDB1D9B09DF67 KILLED2ROBESPIERRE
1,666,234,125 *AF5B014A19A183732E394CE13739DA5124ECB8F3 kingwhitinger
1,666,234,126 *AF57EF5A91FDEBBF1620009A3293F6052625B632 KIRK.NIERER
1,666,234,127 *AF54FF3F2D94CC6AC6214A38F0B7B83F41F58C6D KISKÁZMÉR
1,666,234,128 *AF586003A05C1B60213F53C3B0D38CB2A933B3A5 KONG264
1,666,234,129 *AF5C1BF846A159FE528CE25365668C62B240C25B kraigcorr
1,666,234,130 *AF5A09B255EC034BB92E11DDBFC7A0B7F3EC7D0B KRISTOFERBARASH
1,666,234,131 *AF57A7A2999CA8D2E04490A022C49D14090B5F6A kristophernordin
1,666,234,132 *AF5A6F59B5D79EF90BDA6F3F391DC9FA6F3C2813 [email protected]
1,666,234,133 *AF5044F370F03B638E9821EC41A308B7A6E3EB01 KUĆANE
1,666,234,134 *AF555B1A894EFE9AA53BFC99252A3C52319D7EC5 KUSASIT
1,666,234,135 *AF5A9B8E7D3D414544EF5A26A4AD433644F303EC LA CHANSON PARFAITE
1,666,234,136 *AF5D3E8D691DE153B7286F0461482004F019036D LACORPIC3
1,666,234,137 *AF5245741F70F0B97EB81BD6FB709AFBD99264F0 LAKELANDWEB.NETWWW
1,666,234,138 *AF516D0E2ED07313DFA83ADD495569DB1772E3D0 lamontphimpradapsy
1,666,234,139 *AF50C488F497DA89A3E3DE9144C144CA67944973 LANGUISSANTS1234
1,666,234,140 *AF59B7B1FA034DFC45A94E65DDC6C4A86B645D9F LAST DAYZ (MICKEY FINN & L DOUBLE REMIX) (FEAT. PHAROAHE MONCH)
1,666,234,141 *AF5CFDBA1721565A476C0BBD401BCF6E11621272 leenor
1,666,234,142 *AF51CF83A29528FDEF20A00513242913932FED12 LEGENDS-RETOLD
1,666,234,143 *AF59DFD9AEE1C4952BB8DBE106FD0714B4B32D7D [email protected]
1,666,234,144 *AF5EC898B41F76836E2737BD789510136844DF22 LEMUEL.STRALEY
1,666,234,145 *AF52D6CCC5988C23F4E12A02A118054E249E194E leonardgargis
1,666,234,146 *AF51856130BB4872723482F170AE85D4415ABEAE LEONARDOSLOTNICK
1,666,234,147 *AF597814577C97386E5529AA338DB01B59100EF5 [email protected]
1,666,234,148 *AF55B03FBFF9692A859F8B61EB3EAEA5E367D3EA LEROY.LOVET
1,666,234,149 *AF52112BA2BF31E68210FE64167593ABAAF52CC5 [email protected]
1,666,234,150 *AF5E584C3AB96314D1BA9133463454777E61AF9F LESLEY.FERIS
1,666,234,151 *AF51C300D76D599768FC199328C62A7FC944314A LETRIKS
1,666,234,152 *AF5A6AAACBA3414BB261BBDD76745EE11FBCD664 [email protected]
1,666,234,153 *AF51AA7A07A8FE6027826DEF4E4225A25A50F4DE LEURRERIONS
1,666,234,154 *AF5815457DCB1E0387DE59D43885CF8F759BA430 LEVISLINGLUFF
1,666,234,155 *AF598C20BA4993F551CDC50C1B593A5969B4AAC6 LEWIS.AUGELLO
1,666,234,156 *AF57B217DCA24AF6A581AD8F072955DBBC2E7CF1 [email protected]
1,666,234,157 *AF5C05D020DEB1115529FBAE78BF5026BA26D740 libfam0
1,666,234,158 *AF5A802A39B1B0A6DC628D167C1936486516D15C LILLIANA968
1,666,234,159 *AF5EDB0219E923352409176F6B1F51556AAF9699 LIONELRIVENBURGH
1,666,234,160 *AF55EA56ECD3954701AF0F96DEE259C5D25ED9B2 LISLOACH»
1,666,234,161 *AF596A48217AC3AD78E10C169A3A5A5C9661C006 live...one.nation.underground
1,666,234,162 *AF5EA78D2FE5244A874287673FCFF27DD3DC9A17 lkx=
1,666,234,163 *AF572ED86D409E0D16D08E2D307F8E91C9807C9A LOGANQUATTLEBAUM
1,666,234,164 *AF56A0174653157964263E767C79C0631A5E2917 LOISTOA5
1,666,234,165 *AF53BC54C45821841FE372E2ECE8C5348694CA50 love〉,接著
1,666,234,166 *AF588EB90AACFF9ED50260910FA209CB3ED40F72 lucia1118
1,666,234,167 *AF549D192756DBBD40B17079B3F4C2E1BC190363 LYNWOODESLICK
1,666,234,168 *AF596FE46891D330CC48A6D8C04B12C5DE8BF33C m3+3orsm
1,666,234,169 *AF5F3936EA6B7EE85D6828200F8F4CAAE78BC97F MAHMOUDDADA
1,666,234,170 *AF5B0B42C4C0FA4EE0C04BA5EB9E5EC3039D41B2 MAKE-THEM-BELIEVE
1,666,234,171 *AF5AD7ACCC98C6A8DA70E385680B9B5E042F4979 MALCOLM.MUSIELAK
1,666,234,172 *AF5CB51BC8F0832AF3628191F3E50D47C5E1ABE2 MAN.COTRONE
1,666,234,173 *AF50D9524B6F99CB5B7861A0222F392854238249 mandd
1,666,234,174 *AF5B0921934EA6E6A98BCDC4C814E68C6D02DF01 MANIFER3
1,666,234,175 *AF55AA16BAF08510BFC8ABF582760BB69A9F6918 MARCELINO.ELICK
1,666,234,176 *AF50207978836FC01B71AF4DBAE1F8054FD30219 marco.fulvio
1,666,234,177 *AF56575C8D0E11CE50F28DE62ED521F49D4C48EB MARCUSWS
1,666,234,178 *AF50F7AC45DC8D39740DBC45F48935B9D7252B41 MARKETAXESS
1,666,234,179 *AF522132E7C578F11BCC937EE2BB4B0C17E733C5 MARSHALLZUPPA
1,666,234,180 *AF548C8DD07EB0B594253B5CD1EBE57F0CE685DF MARTYABERNATHA
1,666,234,181 *AF54E89EAF472C9AA52BD808B96C729ACABFF2CF MARY.VIEU
1,666,234,182 *AF5811121C1D6C2D1E3900235AF86CC9B6FF97F3 maximomusinski
1,666,234,183 *AF58121719C7916E795736C6AB336D9BB55F2546 MAZITAH.AHMAD
1,666,234,184 *AF58AC22B3DA2FA8799D9CEA1778D9B963C24D56 [email protected]
1,666,234,185 *AF53336269C1CBCD9A22FF94E7B7C091C7778C22 [email protected]
1,666,234,186 *AF5FE484F07FE00BE435B333802DF07ADA7D410D MEINSSEINS
1,666,234,187 *AF551321278C345FB204B8397E050A151A2383E5 MELXNET3
1,666,234,188 *AF544ADDD58305DE529420FB6AC318DE1E5D46EF MERLECINTORA
1,666,234,189 *AF52C18A0FA138EDCBF2AF9E5A0B1B353CA05E29 merrilleberting
1,666,234,190 *AF50FAE66D46C8B41861A5BF83340DDBEA838C95 MICHAELMONGES
1,666,234,191 *AF5BEAC85F0AD820377307238329ED20053E1728 middlement
1,666,234,192 *AF59E84BB8651AB85668056589C3F6FBFA5EF3BC mikelwilm
1,666,234,193 *AF5C78F712BE964477F0AE3EF29A8F66477822C2 MIQUELKUROWSKI
1,666,234,194 *AF53F5985FB8C592120510D2C35CD770F010485C mlln3rs
1,666,234,195 *AF596080B8ACD2AD2F9DA65DB1BAC8FDC06751EA monctoncrescent
1,666,234,196 *AF513C8F4DA1CEFCFCE229A6E8943507EF7ED263 MONTYLAMANNA
1,666,234,197 *AF51552177865813B45506B86028B94578276FEA [email protected]
1,666,234,198 *AF50B52081F37569826F5D97B2332604A57E27EE mop,guru,stikkenmoov
1,666,234,199 *AF5D2AF601AABE9AC7D32A438EF4FAC41DCF40D5 morkret
1,666,234,200 *AF5E38FE7AFC5D722CC714AD6F39D5CCB91F135C MSILIOZ
1,666,234,201 *AF587F0AFB2605BA7C7FF5F8BE7AD512CB8FA033 MYADI2009
1,666,234,202 *AF5ECFF9EF1F76E749B6CE67A43D07197017968F mykissa22009
1,666,234,203 *AF5A1BD4E3C1C68A7AD3D13300B324A668C8BA2E NARROW.ESCAPE.(DEMO)
1,666,234,204 *AF5D7F714A815312F6DF15BC627B6DA0CF1BC172 nationalkversammlung
1,666,234,205 *AF5BCF0C99719BAF79D9ADB4A91FAFAACCD19883 [email protected]
1,666,234,206 *AF56289E99893D6D1460B9C1D60AD2AE1C707A84 [email protected]
1,666,234,207 *AF58F7662A34D19E070575710E1E87AC04B6CDE4 nicoco63
1,666,234,208 *AF56A0A948BFBB9FF5473E621B3DE13CADE2FE9E NORMAN.MACOLA
1,666,234,209 *AF53B90BA3E9A6B17AFF29400D25217F1E7BAE08 NOTHINGATALL(FUNABASHIUPLIFTINGREMIX)
1,666,234,210 *AF50C86548817A14204A7CBF9903AA0CB440AC45 NUMBER1ROBBIE
1,666,234,211 *AF515B66806B8A142427C2C4D60A792CC092EDCB OFFERS
1,666,234,212 *AF5C02EB72153D0CDBD9825150B4CCBC2C7A65A5 }o{.O~.<8
1,666,234,213 *AF50AAE6D381D48E999522EECAFB68FE34B853AF opusalicia
1,666,234,214 *AF5CC3E8AB461F6D001A5FD1B82EAAD9BBD0E2ED OTIS.CORIANO
1,666,234,215 *AF5F633D108ADDC806EA0FCD98DA93A1546073FF OV4TE$
1,666,234,216 *AF5458B9F972D0BF4B3E0F1489DD9051A6031660 OZAIRAHMED
1,666,234,217 *AF533976088B20C78DF3C9BD81155127653A2F8E p> ~ ~ (_0)
1,666,234,218 *AF5B2A6064FF9BD07FBE6B0BB48666229044BBFE PARIS.ERBE
1,666,234,219 *AF5679843722C246CA06643D6AD680A267A364AE PARK (WHEN WE WERE KIDS)
1,666,234,220 *AF59DDBE7147CCF3D56D9A9EAAC8810BA1C7BF47 patrickhorten
1,666,234,221 *AF58692C366DC5DA7B5ACFAEE26751566827328C PAVANEESING
1,666,234,222 *AF52182F1A90BB5B7F887C47F66AD09D2B5672F3 [email protected]
1,666,234,223 *AF56A26E1DF19AB4FFF86D55A21287A26F747AB5 [email protected]
1,666,234,224 *AF5A84AEC931F4C1CA12D4418977C87A39BA0802 PERDONES5
1,666,234,225 *AF50C785ED4C571724D0A383FA5ABC86715FCC08 PHILIPALVEY
1,666,234,226 *AF5DE38B71FF86C4B10130A2DE34FFBD111CB3A3 pictograph4
1,666,234,227 *AF5414177ADC821A24954865F78A2081AA6B83DD PODBUDOWUJĄC
1,666,234,228 *AF5126B8BB63A3717148AC93E130AEB2D8E869BE poiuytrew87
1,666,234,229 *AF54D5881511D2837D89101B7B8FA0411F192885 PUROTANO0
1,666,234,230 *AF58D6B676E15D30AAEF01D35335F808EF31526B q4J
1,666,234,231 *AF5384E65F865B4A891F04A8BB2CD3E22CA4DC9A q===)~~Splat!
1,666,234,232 *AF5E8871387E8D08EB322BDBAB30D392D8A543BF RAIDER25
1,666,234,233 *AF576E9D069907FBAD30E91D1D91967DED13C292 raulmosson
1,666,234,234 *AF5BEF16FB9C99144D187E4862F2394B6067C9D3 RAYMONDGOBEN
1,666,234,235 *AF50399B62F35F5BE5019FFFA220C945D99F1DE0 rcpsfrl9
1,666,234,236 *AF5952C3518E1EF9BA8EE9A773939C50C982BE2C red-universe
1,666,234,237 *AF523A66E2929549C36948D6775201DC6928777D renfor
1,666,234,238 *AF5C87FE08FBE3990AFD3AB8B010577D10D6C345 revollac
1,666,234,239 *AF5303D29B68F0EBFBB6C4F73845D75D772876A5 rhetthardebeck
1,666,234,240 *AF5215FADAB8484CD6E9EF015F422614432D40EE RHYTHM 77
1,666,234,241 *AF5F4544840111CDCD21080322E1D58C6583D32B RICKEYFASS
1,666,234,242 *AF5A877F41FE4945ABF5B246D4A9A672B3DAAA99 RIDE LIKE THE WIND (OCEANIC REMIX)
1,666,234,243 *AF5BF5A739DF1009507E5EEAB2E00FE11AC76A5E リュードペルポー(RIEUX
1,666,234,244 *AF5E6CB70890AA00FEF4B9A3E6BF5A18FDF71A3A rklepp
1,666,234,245 *AF55886C2E9CA884F7ECDE156FBC8935D0023FB6 RODMANDOMINO8
1,666,234,246 *AF5BCDD6678D091D6AC7796BCE8B562AA7804FC2 ROMUALDO12
1,666,234,247 *AF5111D3BF7D45850495E0873D5D1B635C483247 [email protected]
1,666,234,248 *AF554031534D5D1FDBF94F494D92A8E7FD1F506B ROOPNARINEL
1,666,234,249 *AF50C363F1FE2EB3EB3D2C0450C1804A80AF2EBF ROOSTER00000000
1,666,234,250 *AF5D9C803CCE466B03CB2E8187C5AAA1835AFC94 ROYCESTOBIERSKI
1,666,234,251 *AF507F0D94EE7B7C986658058AB92A316697A01E RUBINDORNBUSCH
1,666,234,252 *AF5282347516B37C712671B95964D8BF5CD3BEB9 RUBROLINEATUS
1,666,234,253 *AF532FEBD1BD4B7D0CF4C80CBBDB35D5A82DCCDC SA
1,666,234,254 *AF5F0B8585DA6AA827391F2B0EB13301F6F2A410 SAMANTHABOBBY1
1,666,234,255 *AF54325CE3DD28BE6700CE29BDDE649B86B46F04 SamE
1,666,234,256 *AF508C3FF1BC22325CCA3D13B9528F7DAAA1FCA2 SAMMORETTI
1,666,234,257 *AF56364156371DD87ABA375A6C47EA28D0AA15AB SAMUEL.KAARLELA
1,666,234,258 *AF5E59DF6ED5F7841D5549CA714E3C46CB6C0494 santolangwith
1,666,234,259 *AF5485CC106C7B3A2274DF5A9E10E39D253F7C78 SASIPNET5
1,666,234,260 *AF5515C9610F5FDBBB7ABE359E0C55A61C7F4B51 SAW.B1AD3
1,666,234,261 *AF510C9E7309BCB0F6B9C7B7F040A6B8C57D2612 SCHOOLNUMBER1
1,666,234,262 *AF5EFC5E55CF1C5E9FEE4407351A13B047FF6F74 SEANJESUS7
1,666,234,263 *AF5E7A9C0D10C2B303D5F5823D73E5E8900994A3 seed33
1,666,234,264 *AF51BB5C936DD0E10FA661CEA36F840C79DAC25D SERDECZNIEJ6
1,666,234,265 *AF54A18D1588B845D9AB445022CC9FF550619B96 serijali3
1,666,234,266 *AF5243ED7F6739E1312F89104F6E5FB6CC67E621 SETH347
1,666,234,267 *AF53BF9408376F45D11119FA4035337F0A1146F9 [email protected]
1,666,234,268 *AF5F28AC3C886763B63651A3E7C0EA44CB4720A0 SHAD.MUSSELL
1,666,234,269 *AF51779A7F9D4BB3A9222F88E45B55E1E69A6A66 SHAD.ROWLETT
1,666,234,270 *AF50C7A70FD7CFEA6F123B15648E50FE2F59772F [email protected]
1,666,234,271 *AF5E378EA8999BC2F9B298C587E8C8F170933808 shalier
1,666,234,272 *AF5D38195CF1FCC5043EC855BB2CE46BF1458E82 shannonkotrba
1,666,234,273 *AF5B69794DA63E454A0E81C5345568D6D116BAE8 SHAUNVAUGHNER
1,666,234,274 *AF537A9B88A27AAFC9AF608DD78B9C15B1AB0971 SHELBY.GANDHY
1,666,234,275 *AF5112078253CC463283B98FB5FBC099082737F5 SHENGGELER
1,666,234,276 *AF57B989EE40E59D635C1172A3C13F298C0A62D3 sherry.barrow
1,666,234,277 *AF5303201AA1CE7F152C8B849DFAB35125EEEAAE SHEVCHENKO5
1,666,234,278 *AF5C455E0326847E1CAB35D71F5E9F3CE61C6E4D shine on (instrumatal)
1,666,234,279 *AF5444AA2923EC67A4D263274CF13FFCB3522850 SHLAER-MELLOR'S
1,666,234,280 *AF5A2F95DB21CFA33044A12F5ED1AF4B3F23C570 SICILYMAP2
1,666,234,281 *AF5B9BAA1FBDF92C19F1FB9D8917007A907BDD8A SIDNEY.ACOCK
1,666,234,282 *AF57CFDA1F1899C927ECC8604A8F2F0C8DE77D1C SIDNEYMCEWEN
1,666,234,283 *AF5377F5FC391392808EFCB0E13B72A03B2D7C13 SING-LINK
1,666,234,284 *AF57964F9E6BC1E9C8C988EF09E39C93CC366553 SISIUL121234
1,666,234,285 *AF57B50410C9A84419CBFDD1B2605B72EF00EE07 sitizuebaidah
1,666,234,286 *AF54CF8F79DC1556EDD8D4C65E279BC3E395B517 [email protected]
1,666,234,287 *AF5321DD2CEAC709C83DBDC42725E46F769C14FC SL{L
1,666,234,288 *AF59BFE7F6615829A9C08BFA3AFE755493DC9136 SNOILLIRER
1,666,234,289 *AF5C25D1016A2CE1EA7A89E6CD09D0FA59E4F671 SONIC DISORDER
1,666,234,290 *AF54BD79992E595B4D88D669B5F5BC5E41F70CFD SOUL BROTHERS INTRO
1,666,234,291 *AF5E94E4921E13D51036B9E0A7A90BAE601D1C8B [email protected]
1,666,234,292 *AF58C01B9550089E950C5126103D321EFE7D7592 SO.YOU.ARE.THE.LITTLE.WOMAN.WHO.CAUSED.THIS.GREAT.WAR
1,666,234,293 *AF5FBA4F391542407BCAD4846C769AF4BCCCCE15 SP4TLINGPOPPY
1,666,234,294 *AF514DBF248589569C7CFD9AE11245B620922C49 speedodexter
1,666,234,295 *AF563322E8803CBA3515A968300D9B9525C2B0DE spook3s+
1,666,234,296 *AF5560E2AFEE8A6C6D046F49F4671836E576156E ST-797.5
1,666,234,297 *AF540690682B3F8F893DF4538D62BE3931571165 STEPHANIE-STROBEL
1,666,234,298 *AF51A9D74EED1F13005A2D476AE11C05FAD4DC46 STEREOPASS
1,666,234,299 *AF53855A9DBE7AB81BD9AB8EEBB88D079DBB99BA STESTOLIN
1,666,234,300 *AF565FEEC0D96DCAEDD6B46555B248636E2CEE1B STOCKWATCHERMBA
1,666,234,301 *AF5B9EA876430D33615E04BAA19B0BF38791F0B4 STUBBE160GER
1,666,234,302 *AF5568544675F494EF6652EA7E14F7A2B129DCCC sukuyum
1,666,234,303 *AF51C5A97D8BB0D4A38376FAE74AC95DC655CC0B sunbirdchance
1,666,234,304 *AF51056DB7B968236FB9087EAAF6BCC14183A79A SUPERCONDUTTIVE9
1,666,234,305 *AF5437E3B54E505F064D39596EEF208CD0F3B340 suuteloinen
1,666,234,306 *AF5166A18E6620057ABB3BFD88D836C4E3500888 SVOEPET5
1,666,234,307 *AF53647AA4E76DF86305CBFDC735885688B96559 TALKKETTY109
1,666,234,308 *AF5E5C40E6F42278C63E7046D52B69A37819BE18 TASHUONE6
1,666,234,309 *AF59A225C472EA144C3127F6B89764DB9EC15DA9 TẤTTHẮNG
1,666,234,310 *AF5B7497500DA09C168EB5DB5BED21802F2E2F29 TEFUTZAH
1,666,234,311 *AF521428A9899758A1F43F71CCF5B4D4F420ADE8 tempts7
1,666,234,312 *AF510F630BFCD69CA526DA160F6453DDA1FC86FE thatpaint91
1,666,234,313 *AF5369E357E2FFA89DDBC4970109E69B8FAE9663 THURMANROSENBARGER
1,666,234,314 *AF5CEA517699B24B1A86E2F7F2E44B3FC88E92F9 TILBUDSAVISTH3
1,666,234,315 *AF504BFCD065D6FBDB7A8FA56E68B3E52C501F64 TJ HOWARD
1,666,234,316 *AF511A14947752C93F74BEE27BA4D6E3D1F92638 [email protected]
1,666,234,317 *AF534525B70E16B5DAADBF8C34847846AC3AF98F toejets8
1,666,234,318 *AF53F842B5A3122BF16C1B3B6A31BA143077B55B TOMOKOSANSHIPPAISHIMAS
1,666,234,319 *AF523A3EB7515C4ED5B6520296138FD6D48CD504 TORY.TEEPE
1,666,234,320 *AF5F538ECD9DDC802DF7CBE2120E3A8E250087F7 TOWAGE
1,666,234,321 *AF57C25BE18226029021FF29822F8AC538E9BD63 TRACTORJONATHAN8
1,666,234,322 *AF5802CC8EF4107CD57D212275E5FDC1275C032C TREASUREBOX:THECOMPLETESESSIONS,19911999(DISC4)
1,666,234,323 *AF54D58BF2B5A5A83EF90D30B9B7E2BD31931CE6 triviawhy
1,666,234,324 *AF53475F51DE4BF24F1B52F20CBD3937C5A664C7 TRUCKTURNERPRESENTS:LOVINGTHATLOSTFEELINGV1
1,666,234,325 *AF501454D137F9573D024723DCE32734FE798650 TSIANAKASYIANNIS
1,666,234,326 *AF5557EF236589C04AA7D1E8D81818AFD3CEFD2A TSOOLEKEOR4
1,666,234,327 *AF553D88BCBB8288CBED2E28A3AE3867A8EC6A9E [email protected]
1,666,234,328 *AF555D7A2EE88384C09881E6D589F6C9D452B5C3 TTU5913
1,666,234,329 *AF5745F48D5672878B0963FE8818DF114520B5F6 [email protected]@L
1,666,234,330 *AF5DE48D2F829B2A32FAAC8378C32F6BB6A36930 TYDEWALL
1,666,234,331 *AF53BE06E77783474455C1ECF2CDEA02291F4D89 TYKEYSHA8
1,666,234,332 *AF51EC20FBBDFE2717B27A7002627E04B287BBD0 TYLER.BATTEATE
1,666,234,333 *AF5904E6AB4EB0449F3AFE27CD73B90479F97574 TYSH RONEY
1,666,234,334 *AF5F5FBD9FBAD5BECE765424F87F36F2E5232A59 TYSJSENEN4
1,666,234,335 *AF50DD961486DC1CE86B7B148F80BAC9423CDDC8 UDJANGBANDUNG
1,666,234,336 *AF5B6F68BF49C79387D1DF2C74A2A2BC4B4126A8 uforgf
1,666,234,337 *AF5B35E4E57D37715D63AA8F3826121755B457B8 USABASEBALL
1,666,234,338 *AF50FC8DCBDE76595E0C50989183CBE5CCBDCBD4 VERSBYGNINGENS
1,666,234,339 *AF5A5D7510C8198042D43CF0E841A1768DB006DE v/f{
1,666,234,340 *AF56C74B4DF74900A1AF798EC1BAB708A4C13833 VICENTEZEFF
1,666,234,341 *AF57433F67C8FBDE97970B5322F7152D2324C796 VICONSANTOS
1,666,234,342 *AF537540C18B26EBDC7C1DC7E6EFAB2EB64CC430 VIDALNOT
1,666,234,343 *AF572BF257C47FFA5C663753C08ECC9FE827D1F8 vidyaprabhakar
1,666,234,344 *AF5EAD403F03B0D9A4F476A71D29BCEDFB3539F6 VISHWANATH-NAYANAR
1,666,234,345 *AF55EB4BF4363466C075099B02D8CF357AA39FCD VIVIAN COLLINSWORTH
1,666,234,346 *AF50D3C56D01BC7213E848FFFA5DCD383A88D6B0 VLADIMIRA-NAGYOVA
1,666,234,347 *AF5FB3FDD144F9C9904F0297D40F47DAD9439118 VOLITIONSES
1,666,234,348 *AF568D9477634E346EACC4871B9FBAEE8EBB426D VVG5R3PV8
1,666,234,349 *AF5FEBE7B7C6170772FE847D6E92AC420D54EC97 wagdy.mohamed.ibrahim
1,666,234,350 *AF5FF349E0034733E0B4AF91D2F84FE6F5E01997 waldohungate
1,666,234,351 *AF5525A51E576C8E809FC6F25B1BB494575772C2 WALEED ELMALAWANY
1,666,234,352 *AF58764EA80934ABE3C05BFA0646463A2C65F8F8 [email protected]
1,666,234,353 *AF5DA791844E919581AF89C9103F33A85CA11C32 WANTANEE-SATHAPORNPIBOOL
1,666,234,354 *AF544DB4FE4CE5BBBC12EFA8CB2A1D86C760638E WATASHIWAAYU
1,666,234,355 *AF5A1CB2A617961FBF45ADEC813E0D825CF72D66 WBR=
1,666,234,356 *AF53270F31308E6D00BF50A422E89CAC1E3E2DB8 WENDELLOTTEN
1,666,234,357 *AF5ACF3A719CA0BDC7C339524E55B99FABEF9B0B [email protected]
1,666,234,358 *AF50440BA16F52A00B1089C98B099A9F17239DF0 wileytorigian
1,666,234,359 *AF51841E510D4463B1C26587057F21E7D6A2E6EA WILFRIED12
1,666,234,360 *AF5B83CE0BA45C8A85AC08DB63284AAFA63D0A10 windham-hill-chill
1,666,234,361 *AF50387137F258C6EA6656E5B5D07C1879B591B3 won.woo.park
1,666,234,362 *AF5CC53361F8431E53DD9EB6BF0B2A748E6BEB79 WRINKELS64
1,666,234,363 *AF53DC8237ED3B40B1A5444C1FF7915D17B575C5 WWW.POLITER.RU
1,666,234,364 *AF563E6A412EFCD99F69D653D45FF411FB980FAD WWWSEATTLEREDCROSSORG
1,666,234,365 *AF5471756A6E84441B396B5CB65DE56EC5072C2D X17819
1,666,234,366 *AF5460F6E2C28363AA699AF8FCDB03210BC7DBBA XARED
1,666,234,367 *AF50ADF2DF449243938A052753E4D25B39ED509C [email protected]
1,666,234,368 *AF51E16DCE389DEEACD8529586DDCC321376D5D9 [email protected]
1,666,234,369 *AF548DF3B2C4F6079D9289551E415BF672CA1DE7 [email protected]
1,666,234,370 *AF5289A2AB4B0D64EC86125FB35A67BB4A21AE6D yanuok
1,666,234,371 *AF5D7F843B6FC30F9D074D7916C507EC8A97AB84 youngrashed
1,666,234,372 *AF59B1E341FC326355E10F415CA23106FD141433 YOUNGTALL
1,666,234,373 *AF5BBE3D41B7EDFA487E930EC65755CD8A46F286 yushen.liao
1,666,234,374 *AF5B68CE1128319787681654FFAAFEB5B3D1C2BC YUSRA-SHISHTAWI
1,666,234,375 *AF5A0BE3C48DB8CA7FF6AAC1AAF24EC3A47F639E yusri.ramdhan
1,666,234,376 *AF55D72084CC36D2A55507CB3D1F226CB6B8598A zackweible
1,666,234,377 *AF5C12CE685F9BFA7973ACC9572B65F653820107 zakoblue
1,666,234,378 *AF5FB15379D059B37469F7A21F85FDB8C77EE0E0 [email protected]
1,666,234,379 *AF5940CA155AC4EEF6DBCF91A48995F92B6E55F4 ZHAOQUNQI
1,666,234,380 *AF553D1A4CEB2AD378A8FBCD7CCD116448380D45 [email protected]
1,666,234,381 *AF5BE792238E135C9D34F320D90205F1EE720A24 ZIMOULÉKPOUL
1,666,234,382 *AF5686F691CD81B3DF4D23A55C6A5CF416301468 ZVEŘEJŇUJÍCÍ
1,666,234,383 *AF5BA36DAC63CC15A40F65767791B3FBB226BE0C επθεωρητήσ
1,666,234,384 *AF51D281B2E59924A685A1F84FAF686128954009 НИЗУБРОЈ
1,666,234,385 *AF590244D0E3618D4F3317AC15413739EABE9EDB СИДНЕЙСКУЮ
1,666,234,386 *AF5A1ECCBF912C06A9004378E89736487E5927B3 СЯСЬСКОЕ
1,666,234,387 *AF5151995720E678D8AF815B39ECB698BB70F1EF ТРЕБОЛ
1,666,234,388 *AF5B737806ACEF9DBA0FF07C0540926DD0BA36A5 060KASEY
1,666,234,389 *AF5DCD07D6F19E863F712532B6B12F32BA41D010 0A6098C2881760EC0B9D522D99741300-SZYKOT5
1,666,234,390 *AF5DBE5F5A4420182412C592A9A341E1F23B24EE [email protected]
1,666,234,391 *AF53E74C9B31AC9C805BFBA8974AAF01365150F8 (0_<)~` <P
1,666,234,392 *AF5EB0F4B206C23600C07FDDF3E411CF086AB463 1213961 osallistummeelinkeinojenkehitt
1,666,234,393 *AF5BC5D4A3AF89CD4996E972CD6231D398132927 1302100 heneverusedjokesassuch
1,666,234,394 *AF52187ED85D692BAAF2922827308985AF07E328 1374122 N
1,666,234,395 *AF5E623422A3C7891AB7ED3F89E754D61DE45665 1502728 uudisrakentamisessaonedellytettyvesik
1,666,234,396 *AF5EF9C8745566100410FBACD0B361DFD3CD063C 1776985 KATKERUUS.JA.N
1,666,234,397 *AF546FA9DF7197FA2D60274B12C1CC240863AB05 18-information-sharing
1,666,234,398 *AF579E211D23CC7C7D28EFBF96C0B5EFB2258ACB [email protected]
1,666,234,399 *AF5BB94BCDFD5082DDE63AE09DB24958B3AF19E0 1BLTTSSZ
1,666,234,400 *AF57DC10CC0C1BFF7C6FB8018271CCF3C6EBAE26 1.COURSEWARE
1,666,234,401 *AF547B3F7FD173C041E7910425DA6A33EEE4B5AE 1.edistavaa
1,666,234,402 *AF540440EB174480DC89A35DDEB74A941DDFA39E 1fosselius
1,666,234,403 *AF538BB92DB462AB392A0FFC5016D0278BBCBF99 1.HAUPTSCHUL-SPORTHALLE
1,666,234,404 *AF53FA2362C0B81D1F27C67C5F047BE681826B8A 1 kerityss
1,666,234,405 *AF5DCEC66CCD74373EEC6B5A9105CFA853608870 1.KOLMANNESSAKOHTEESSA
1,666,234,406 *AF51D44AD13E40E2537481764F8AFC57F19400B5 1.oikeaoppisia
1,666,234,407 *AF5E8DCA66727D9A2A68FE3110AFA03F4D4D7F54 1 PALKKATY
1,666,234,408 *AF53FC199A81A83ECBB4131807EA54C0C4DEAB60 1.REDINGSKAMP
1,666,234,409 *AF503D73A96518A0A6CBEB63C15C7182C217DDFA 1remanufactures
1,666,234,410 *AF5E00DE008EE9F420A5A42CCE9100B9E00B5FD7 1SONNENSCHUTZSTREIFEN
1,666,234,411 *AF59FEAD5F62685EDC3FD3F97E71C700950486E6 1-uloimpiin
1,666,234,412 *AF58A8FF7D7DD328C494C4462A2C9376338FF4C5 1 UNIFIERS
1,666,234,413 *AF5E8E9A35DF5122897FA24E216F5DF360910339 1 VALMISTUSOIKEUS
1,666,234,414 *AF5E02FB0EC5662A2648C7C2C8C2C851174C4E3D 1WIRFEL
1,666,234,415 *AF5B5A5F0A597EA224D89201DF7BF8D6B4D1CE49 20DUPERRON
1,666,234,416 *AF520A0D4DAC9BFFB85BD17AFCF313BE0030D5DB 22fabri02
1,666,234,417 *AF5BDB9C361166B6168AD21F0BC4532313C30E2A 280w3l2q617wo403oi5sz
1,666,234,418 *AF562A895A0BCBD937800F754C09CA5FBA4727D6 2833140 moni k
1,666,234,419 *AF53BA7524925FBEA31BBB547CF2B13B029F6970 289SOPHIA
1,666,234,420 *AF53A4749B16A73F372C664918CF5F5D2C8928E8 28EDA4
1,666,234,421 *AF566808DFC5363D800E700D6660971EE8CD6E77 2978808 niin.pient
1,666,234,422 *AF54DAC19A215F0142EA9AAFE98E2A83D5E11FA1 2ALNOMMOC
1,666,234,423 *AF518BB42036F226434EEE91B28947126A517867 2ARTAKTIE
1,666,234,424 *AF544B71BD07BDC23287AFF85FB6F61D8A63FE32 2DANRESTO
1,666,234,425 *AF508377E1765505B292D82169FF32E5EED44A58 2ens-modell
1,666,234,426 *AF558D14175427C3491C9B20056B97A21EDDAAD1 2gradyanlarI
1,666,234,427 *AF5E4DA7613DC2B6960463804115190BF62311BB 2 MULLISTAJA
1,666,234,428 *AF5E8F330DB744DBD83524D3BA4D2E3CCA1CD0D9 2mymulder9
1,666,234,429 *AF5E872DF0780B15BA6D3BC7EE3C82F8A681D674 2omenainen
1,666,234,430 *AF5B584A2FDA8B32125EE93987EC054C5D1BEE68 2.risk-provisioning
1,666,234,431 *AF52F593FCF7B93BB7224ECFDF47A05C9CF88FD7 2sgsom9s2cd
1,666,234,432 *AF521E3C9865D59A68913DBD0010655B9A618D35 31OCT1544
1,666,234,433 *AF5AEF081C47CEAF67CA8958015209D3738384CA 34SYC0M3
1,666,234,434 *AF5C33D8A1EBFD529CB40FCF9F28B8973D1AA3A6 358163 seliittiuusiaalueitasuoraanomiinsa
1,666,234,435 *AF5A44FBED482CE025132413096EA2CF62395964 3ESHONORA
1,666,234,436 *AF552ADCFEEEAD33BF6FB7BC3163388C97C95AEC 3FAINTEN
1,666,234,437 *AF55BDAB282E8BD663F4C2D2866EAEC4D6A68BB5 3.MALAKIAN
1,666,234,438 *AF5EFC376120F7CAC0DE320F3D190B9ECD295B22 3.MELEKELERININ
1,666,234,439 *AF593030483501C131F599A8E54696AB67B27C4F [email protected]`~-`~-SPLAT
1,666,234,440 *AF5A579347A784A7D0C6CC28C973F97BDE7DAAC6 415978 und.die.braucht.dringend.sicherheit..
1,666,234,441 *AF5B9EB8BB5921E7FD1F9D85CDBBA5C818AE59D5 4AUGUST1593
1,666,234,442 *AF5B49EC02A40F6120AA27930DED7625701DDBD3 4EBFEHLER
1,666,234,443 *AF509687B49BF26C4D1B0157B7E8C35FFE752BD7 4OWTTOUQ
1,666,234,444 *AF5391DC067F56E0015B02C6597A4131A503FFB1 4PALETTANDO
1,666,234,445 *AF58C862283E929F52BEF87DE6D0CA95C85829F5 4TORONTOSONNY
1,666,234,446 *AF5DCD08D2A79A76AB7DD9113C5742C17B7B774E 4VERKENES
1,666,234,447 *AF5F3D171FA35153CC98EDFE01DECBD705631F2D 50-Cevrenizde
1,666,234,448 *AF5941A7181C511E061CC49541206879FB3EBB14 5AKTIIVIRAHAKS
1,666,234,449 *AF57B2007678299E76127698AE81D3D0D6692182 5ALGILAMAK
1,666,234,450 *AF5299E87173747A0BC8340AA5E75186FC245AFD 5DFOOTPRINTS
1,666,234,451 *AF58AA0B71E29A67FA1083159C42D3A29C8E2887 5FUTUREWONDER
1,666,234,452 *AF571E7D208D9D3AE2FD85568886130BA184BAB9 5ILUVTOUCAN9
1,666,234,453 *AF53016D2C71BA26006DD129E63B2B45FA5862AB 5OMMERELAC
1,666,234,454 *AF5E4C6F27FE7B6FCD9AC84E12C2F4F1054D75D7 5SAMANTHARUY
1,666,234,455 *AF5AF103C2709D0B8B6490B6B3F27B71B7145026 5SMABGBSW
1,666,234,456 *AF5767686EF8E29336F21399637E7C746E011978 5SREKCIVE
1,666,234,457 *AF5672CF2D63EC69EF1AE6BEFD41F42603973428 5TICKPROO
1,666,234,458 *AF58C6129313AAF85EFE14027CB2EF55D66FD0C5 5TNEDECER
1,666,234,459 *AF5B708BE2A9EF26AA823AD2D846834926EC1516 607529 SCHON-SEIT-MAI-WIRD-IN-FRANKFURT-(-ODER-)-GEBAUT-
1,666,234,460 *AF59FCBD45843EE74A04DB1C92BB2C61281CED3C 67698 baGlantI-ayarlarInIzI-yapIn-
1,666,234,461 *AF50D3733EA5C0078D552C6C6C7A312EF50EB5ED 6 COMMODITY
1,666,234,462 *AF5F9175C91D04DC2E2B983972C0320C12E1B232 6ETOPSTAN
1,666,234,463 *AF579D3A4BBD85807062C77DB7E7E986401E3F12 6GEORGEPEARLJAM
1,666,234,464 *AF5E1640F617741FE9E9206827DD8CB23F577FFD 6GODZILLAATTILA
1,666,234,465 *AF5FC306F0D583FBCF090B1E23A7DD27F60F2C51 6JEANNEBUTCH
1,666,234,466 *AF548DBB1E0EAE07D01E7EC6D32319ACA12B9AC6 6MONOLOGUERION
1,666,234,467 *AF5E0C1BD75BD09ACE6E542B7D44C5D6121F9E2B 6MSSYLLBFY
1,666,234,468 *AF5CF02FA8A22BA6CB04EDFC727B3C995D4463ED 6SEKSMAAT
1,666,234,469 *AF5142041FD4B381ADC6418AAAF1852CECB24B37 6SPARKYKELLY
1,666,234,470 *AF510421A63074BCB4737DCDC5C0B028A6711EB9 6TERUGVIELENS
1,666,234,471 *AF5985832220A8A2EFFF164C7D0D69E9F79CF32B 71N9L3RS
1,666,234,472 *AF5A587A990146817FCACC805B4EF9C43FA181F6 763EMMETT
1,666,234,473 *AF55E3898D5ABCE25E3293C76B6F87D981FEF52B 7DIKTATURACH
1,666,234,474 *AF5F6CE3E9ED77E663947DB89DC9257B16C2EA13 7ENTOLDARER
1,666,234,475 *AF51828FE5CFE64383AC6CEB4A1D0CDEC7FC61C6 7IAMMIKEY4
1,666,234,476 *AF58835BC5F667D4A02620A25202271DAFD45B77 7LEPMIWFA
1,666,234,477 *AF5FAB846C6FC9DDB8E58D0300A370C2640FB73F 7NEKATNU
1,666,234,478 *AF550F8E4A84024B2E626674DD0036104913D340 7PACKERLINDA
1,666,234,479 *AF54BBB357CE116AE0A8F263904012A683CBA680 [email protected]
1,666,234,480 *AF53037E89B718709713E1CB96D9F9288BE34212 7RIFLESSA
1,666,234,481 *AF5281AEB1C27294EDF4DAABF28307832730074F 80SANE
1,666,234,482 *AF5ED08B25DEE0DEAE059030C3DE4930DF2EA01A 81CONJUGATE
1,666,234,483 *AF511CA548FA63803E3F85C363AAA9F32346F852 835JAZMIN
1,666,234,484 *AF5C5A8B9438CF5E55A9EFBA625294491854F384 863mackenzie
1,666,234,485 *AF56D3DA900C044DF1668330DE70CA89CEF04160 8====D***~0~O(_0)
1,666,234,486 *AF5FF95EC85B9418BFA10B375FABFC815C315FEA 8DEPTNOBSW
1,666,234,487 *AF5C71455548E30D9D332E6EB09901AA603D3DD1 8ERUTAREPBSW
1,666,234,488 *AF5955CF3610EC403B39B85971B3C416DDBB1572 8GLENNITALIA
1,666,234,489 *AF5C6E5F7B7A7B882B756641AAEF781188B9D573 8MAANSIKLUS
1,666,234,490 *AF504A233A0DC8DD059A4EA808831EFBE4C9968C 8MATHBUBBA
1,666,234,491 *AF53742353BC3F6A863FB105E4E788236145B0C3 8)~~~splat!
1,666,234,492 *AF5A71E4D575E1539A2918C2F9918DC1D9B0600A 8VEDOUCI
1,666,234,493 *AF5E30F2AAFEA99446A5A681A276F4577A8392A9 8VEINULESES
1,666,234,494 *AF5B9638B344AAEF0A2D343028AFC006F4666A47 8VERSTOPFUNGEN
1,666,234,495 *AF55F1C5CF26ED2D039D521F90E435B4BC088B72 905alayna
1,666,234,496 *AF5AE61CD48556AFE86FE41CA68BF77B6C8B79AB 973554 GUNESLI , KURAK YERLERDE YETISIR . RUTUBET ISTER .
1,666,234,497 *AF57FE350C7FB87B3118B77EFB16B59AB91944B1 9AFVLIEDEN
1,666,234,498 *AF57A1CDE781E88EBD838A8FC18E7D65536B1D35 9INTERGLOSSA
1,666,234,499 *AF5319DAEAD1F5282B27B2F61FE751B35788B6E9 9PIISKATE
1,666,234,500 *AF5746B7E6E315A6CE7D40D2E94C705E5DEFB8A4 9POOHBEARTOBY
1,666,234,501 *AF55E447DB34C8D83ADF8F6F4C1C5F43E4A50EC5 9RXQUEUEBSW
1,666,234,502 *AF57AC0CB3093D06E8CF9E30FAD1A40D5BB675AC 9SIAEGITS
1,666,234,503 *AF57497A3B01696C13CE69C66945D7193E1045EB 9TEMPPRINCE
1,666,234,504 *AF5B25E1E1F313DBA2B08696A8F6C84C353B2187 9TONEABLE
1,666,234,505 *AF56D61A3A8F1DB546C9C2D156D9D6189E5AC90C 9UNFLINCHINGNE
1,666,234,506 *AF57BD2737BCC1FC56A8B8CBDD77478CF5470F84 9VALVULITES
1,666,234,507 *AF575EC885BA7461F8AA61815D9127AB24699390 9WEODUWE
1,666,234,508 *AF53A93F9019D9FBF8DBB66D7CFB738571E750AC 9WHOLESALERGOBEYOND
1,666,234,509 *AF52EE61370A0B3C94892F85DD9DDADAB06BFBEB A:0w
1,666,234,510 *AF51376BE928AC85C04AFCEFB5DDD1E76EE22F06 [email protected]
1,666,234,511 *AF53340A4A8EAA72766311C3D674276854CB49E8 AB"B(
1,666,234,512 *AF51893CD992C22E8517B2EA6C365A0F255F4B1A AB/JI
1,666,234,513 *AF50914A6C52333119AABC1EA386A751A7673259 ABOUTOLBPED
1,666,234,514 *AF5A80101E443CFCADC4FA2D86946574E31ACCA8 ACOW(
1,666,234,515 *AF5251AD65D6BD3196FC38230A571AF65D10CDA7 AD{H$
1,666,234,516 *AF5B05D9809863FA6A987BC6E9329DF623C47D07 A:EE7
1,666,234,517 *AF5E2C25DBFCFAA3080C2618CCAD83B821B17F2D af,m:
1,666,234,518 *AF56BFAFAB30A13F9AF73F5F52BD090BD71DC0C4 ahru_
1,666,234,519 *AF5DBDCCCD3CABD20D91A0375D83A3CFA3E5FF78 alexisdimpson
1,666,234,520 *AF5042C8EA81F99B71960D017B19211D4E92BBA5 alex-squires
1,666,234,521 *AF538F654B3C3B3B2CCB086909A299302B8CC426 alimirza
1,666,234,522 *AF5AB7F5018B4E06310592AEEB7608D5FC93F178 ALPHONSE.TURKIN
1,666,234,523 *AF53FE2ADFDFD975E39100C831AFB0E69C70CC22 alzva
1,666,234,524 *AF51FFCDFF700CC2764C1F3ABE82161844AE4F3D [email protected]
1,666,234,525 *AF5981536A3233F296CDBDD4A033D04C96783BF0 andresfaehnle
1,666,234,526 *AF5BD2B16D74DB33F31F37D7DB7D47F259296EB1 andrew-gaulden
1,666,234,527 *AF52982AC0A295144B98E49E53B492A663BBDB6F ANF%M
1,666,234,528 *AF569DA9EB24B9AE5B4E2F64A5A08C18DC7C3C78 ANS145
1,666,234,529 *AF5A94FD3CCE3D45FF0AB97D4ADC4835F077D9C6 AOD93
1,666,234,530 *AF5E02BB9E702276D35902BADC1C0A7781076614 AQ1QWEDE3
1,666,234,531 *AF51AC81C1C4D4BB8327C693E243B4137AE73476 ardenlittich
1,666,234,532 *AF51495501CF2F870E2F869EC3B6FAB718C2BFEC ARHB
1,666,234,533 *AF50A784F884FD20354FD095AA913FAA12A9C3B1 ARLIE.WINDHURST
1,666,234,534 *AF527CEC0554C7AEB5F3A2870F1A62282683C9B6 army2
1,666,234,535 *AF5633CBCF0E18BB5980D956889AB6B67ADDBFA5 ARNOLD.RAPPLEYEA
1,666,234,536 *AF557931AF55A9A66106A2250E0D36E868D834BE aroundpproctor
1,666,234,537 *AF5735108C299AB5BA72DA9F040E67468A08BBA2 assnp
1,666,234,538 *AF54AB377283EDE74488CC016935F485C2B5BCAA ataolfer8
1,666,234,539 *AF58D94F68CBD385DFD56CF2C7D89BD5E9D95021 A-TG
1,666,234,540 *AF53355E2F9BE5E1EDF2AC7464455EABB1F7E94F b021v
1,666,234,541 *AF5CD42AE6EC376663C44D8B2F04CEE7F84B1289 b0hea
1,666,234,542 *AF596D8972A447E895A8A8691FAB06FCC5AB3766 B2tl
1,666,234,543 *AF5E6C319965CAFF58DEAE58C90DED0A23550BCA b4e6q
1,666,234,544 *AF5517E15B4C438345300082705E90C6911035E9 B8DE4A19-8A1D-3732-9507-18555A39969C
1,666,234,545 *AF592DF957B8BE5A22D1848C48EDAD8012428C19 BACU8928
1,666,234,546 *AF59C419B783143DDB76B5165CD8775944320B99 BAKQUALM4
1,666,234,547 *AF5380C1BC6F76AAF82E85497325A9E40788751A BAM(D
1,666,234,548 *AF52803B364F66E8972466854FB2D88167586269 BAWQD
1,666,234,549 *AF57132F0C858C4A3A3E7653E240F0D9963E5438 BELINDANEALLOSESPRESELECTION
1,666,234,550 *AF59C0782B902894AB929BB11150D22CEC76C45C bfanh
1,666,234,551 *AF56B189ABF35715DC4CDADD526C29F5F57AFDD1 BJ2Z0
1,666,234,552 *AF52B6227BE58A7DBE15EB64AFE54133F6419EA0 b-j"d
1,666,234,553 *AF51BA614D5B87C49E05577A845C49B838A7DF52 BK(;
1,666,234,554 *AF5291296410E45B2DF5CD0F9EF8CC08AE048A74 bm5
1,666,234,555 *AF5ADBD30FB0436330AF48563080162443A9AE91 B######>~~~O->-<
1,666,234,556 *AF56C497822C6CACF24DF0B4539235F67F227D70 bocones0
1,666,234,557 *AF5E396CABB6186B660CBB9211DF7B1882F2FBFD BOOKFOLD.
1,666,234,558 *AF59F46E8DF0043692A523C3290CC3CA3B40BBF9 bqrsl
1,666,234,559 *AF5A72E5F8B3C0AD2637EF2554891AA89384697A b#rc#
1,666,234,560 *AF59BD79B9588C743E27FC0838DC279D2E065681 BRIARWOODS?
1,666,234,561 *AF52DF4CB6CD231DC436DBAD99052353D2CF8CE1 BSTRING4
1,666,234,562 *AF5334A14388EAFAFB0129B155533F1FA4B4B614 bswrenderebsw
1,666,234,563 *AF5DD4A722DAA890B51DEBEB66BF14A1E715A060 B(T;;
1,666,234,564 *AF5A5CE88D5A0CC843CE9A397FA2E1A1FD27DBCA BUFORD.KUBO
1,666,234,565 *AF5879A31BB2712B76A041E9373E9BE8A61A1480 BUMBLER
1,666,234,566 *AF5D0610A1F9A29FFF83C01AC63498B835838A72 BURTON.BAZAN
1,666,234,567 *AF52A9C6E73FE98C92A5FD0BDB390669AD39483C bv3xw
1,666,234,568 *AF5A009F81A5E04C49C777F9D647C69168494AE1 bvl=
1,666,234,569 *AF5FEDF1CAE22323EDB045E6E9819C7C010CCA17 b"yuv
1,666,234,570 *AF58B9728A03DBEAE2EF354B5B720709B9FF50A4 c$1z"
1,666,234,571 *AF53D5947A985B13B9C9B33C56BF075C11FF3548 C33VN
1,666,234,572 *AF569A6E37F3D55284C96779B885700787600F0E C!9O
1,666,234,573 *AF53502F7E9DD9D2D2244AFBB2F6C4528F19A167 cabañashallwaygdl
1,666,234,574 *AF5A21D82630BF03DC9AD38343C7525BDE18E38D calvinwedding
1,666,234,575 *AF57AA0034956920AD04BE33729346A5494FBECB CAMERON.MELLENCAMP
1,666,234,576 *AF54B7D1E1C32E05D99FA74BC9121ABB02F202BD CANDALAS
1,666,234,577 *AF53D2FC2374FBDD42E018DB701F3A7735FE67CA CAROLOXMAN
1,666,234,578 *AF5DE8C8E860AA022703925A7F60F63A19A931F4 CAROUSERS123
1,666,234,579 *AF5199DEB5B46B70D7992819B6D7A9EFE6F54D09 CARTERCIALELLA
1,666,234,580 *AF599D62FA337E86E94C1672F5A70E5AF8154E20 CATEGORYTRIUMPH_VEHI
1,666,234,581 *AF5B21B9EFC9382489D2A9B5FDABBA22DB5DF3DE cautu
1,666,234,582 *AF5FDCEFCD6202072ABB5D582938FA874A3EEEEA [email protected]
1,666,234,583 *AF5ED9656DDC83CACADCB124F5DB144D24FF2D9D c?ds!
1,666,234,584 *AF566DA5172506FDBF0AA0F4BD9E7E891930749F C!E,R
1,666,234,585 *AF575502BDC785E5A05E5FB04AD8C42CD97B2C23 cgdd)
1,666,234,586 *AF521ACF31CB2B102FB03E5EAD947D70B771F516 [email protected]
1,666,234,587 *AF5FD569EB5778F92C3914AE1DEAC9860BC0579E [email protected]
1,666,234,588 *AF549D336D9E0E5FDB3AE3C4C2DD99CC5DF551B2 [email protected]
1,666,234,589 *AF51E423363F3CDA08F2F0BF8FAF73EF26E55942 [email protected]
1,666,234,590 *AF5A8762AA73CE7CDABA4EAE95B46CC70628015B CHEOB
1,666,234,591 *AF5B0FE04CFF3A7EC966D0C42986316DEF954052 CHIJUNEN
1,666,234,592 *AF52567A79493E83EF9BCF2DC028BA92DE3619D0 CHIRPY6802
1,666,234,593 *AF584B64896C32E24079263BD93E2D7022EB877D CIEJ
1,666,234,594 *AF58B30540CBE0667110D6CB5DF39C64F56F78D6 classicalballet
1,666,234,595 *AF53FED1CA207373A65854B43030B211A456A0A9 clintliddiard
1,666,234,596 *AF55ECA0C1D7C557F18636CEC020DACF7227711B CLLLCTNS8
1,666,234,597 *AF52EAF38FAB394BAA0FF209ABC4CCF7655E70F3 CLOCKWORK-COLLAGE
1,666,234,598 *AF58FDB2D8DCDC4FB4837BE2B5CEED923F1340C5 CL?YK
1,666,234,599 *AF5D576051426AF5C4B9268FEF6852A172D991DD consternanes!
1,666,234,600 *AF55FDF92E15C058F5F9CBABD10B3115CD0D4B0C cortezzschoche
1,666,234,601 *AF58713DA086BB2A247E9A6970D45D321E43B17D [email protected]
1,666,234,602 *AF5110F2F4B197A338299C7C42FC93D6BA32B08A [email protected]
1,666,234,603 *AF502EB73A6423EF83065069B1663342963565D8 COUHERDE
1,666,234,604 *AF5B388778249287150FE2439E0BBF5A1346AE59 c:\program-files\microsoft-visual-studio-90\vc\vcwizards\appwiz\mfc\application\templates\1036\afxo0001htm
1,666,234,605 *AF58943ECBB74A7ED7524DB8B995CEBB5C7A0230 d?,+(
1,666,234,606 *AF544A76E405C238C293BF0A565061184489E007 d])-
1,666,234,607 *AF524B0DDD2610573DF7B2946E485B4EBE534915 d4g3c
1,666,234,608 *AF55B0E0205CDACDEED292D09164954BCC9F18AE daniel.bondproyectos
1,666,234,609 *AF51C504E27EB3BCC23B4B1C987A0368C85922A5 DANIELBRINE
1,666,234,610 *AF56E88B8384F95F9DA3B105017DEE4DB4FC6A7B [email protected]
1,666,234,611 *AF534B183348C9D74CD8C67A2ED2C6367A0FB1CC DARNELLBAUERLEIN
1,666,234,612 *AF552645856F12C10C2C9A454E63DA5845530A94 DARRENBASEY
1,666,234,613 *AF5155F55908324A08BD3614D6C591E90B09520B DA:.TOOMAS.ANNI.(DISC.3)
1,666,234,614 *AF5E2925557B2B8702C25C46B3DD599189294379 DDGR2
1,666,234,615 *AF53BD7838E4A91A5B1FC5FDC574B100DD3525FD DEMEMBRES1
1,666,234,616 *AF55DBC8243246D256329F2F94FFE55F38CC1CB3 DENISE-JOY-ASKEW
1,666,234,617 *AF5CF8198D51AAD5228417520E1DD7B1FC23851D dennisvolkers
1,666,234,618 *AF5C9019D1786E4EF0B47BA9BE40D5C72AA289F0 DENVER.TABAG
1,666,234,619 *AF51A52C989733777AD2A018B69B16E900EDF659 DEPJP
1,666,234,620 *AF5E22BF7D85603FC9ACCA84D747748A5BD951F2 D(EV
1,666,234,621 *AF5F5A49F81EE94B98CAC4847ABD8B76EF4B3D99 D:EW7
1,666,234,622 *AF5457B15C011DA6D816FC31271C0869E75CAD57 dfotf
1,666,234,623 *AF5C952A1C93C3A7FC5AE89A7CEF54A2A9FA243A DHcZ
1,666,234,624 *AF5895A6288244D5D3EB1343EC0D6CA38C2E021E DIENA-(INSTRUMENT
1,666,234,625 *AF5C66FFA8941CCD4A65060F98CF3BEA1C11B6CD di/f
1,666,234,626 *AF5D0CAE31414441EB5B7918CBF90692C540ECF6 DISERTASTING
1,666,234,627 *AF54A08893500AB8F11C203AA886BFA541DBE7F7 DÌVENNE
1,666,234,628 *AF5D357CA7525962B80EC6959D8C44E284D73F43 DJPT+
1,666,234,629 *AF5C8F76A1FA7EE2DAD92383120EEC5457975CDC DOMINIC.DUDDING
1,666,234,630 *AF5C36AC0E3F514EC5B04612562E9CE2D13D1355 DONNA BURBACH
1,666,234,631 *AF58E073106168F25A33DED65971937231F3B9E0 d",pb
1,666,234,632 *AF53780932E4A8D6D1D0CB303454F5B0899B2B64 drjg#
1,666,234,633 *AF51B2E33D22034FAAE98DADC086F6F509E2A320 d.up$
1,666,234,634 *AF5BC76493158889D6724DC33D46A6AC10B39A1C EDITION、TABLET
1,666,234,635 *AF565DABC436A7EDFA2370F774B0B8B2451EA544 EFT
1,666,234,636 *AF5F4F06A8CA8EE5AE1AB2093BACC9EE8F68EDF0 eivj:
1,666,234,637 *AF557678FE382EFE7F65C602C2E0FD0E89BDE669 EKW.0
1,666,234,638 *AF561E9EE10698C5058AFA9D75CD9C8E34A123ED eliseogosewisch
1,666,234,639 *AF5915CE9E9021A22F22EBA2F2FA38B971000B9D eliseostotko
1,666,234,640 *AF55A0175C2CC9FE00A85F9B17F3A6C33E6B5AF7 ELMER.BASHOR
1,666,234,641 *AF56BED70254151FE0ACC4DB7145157C76E3769E ELSTATUS3
1,666,234,642 *AF592D008890A48B6AF8F4BDA11CD588AD8D67D8 EMERY.KRINGEL
1,666,234,643 *AF52790E99298EF64B14E9CA43D8A24B8BC62102 emotional-a:
1,666,234,644 *AF57EB71C516667F8E94BC9DC1247F76613BF5B1 empires的維基人
1,666,234,645 *AF5CDEF217EAD6D8C9261EC09970525F109731A9 enternecisteis
1,666,234,646 *AF5C66A97BDD0CC037A59A94CB88BC9F587E4028 e.o.d.,-volume-2-(disc-2)
1,666,234,647 *AF5764082B047E902DA18E58129D86D98206C605 ERIOTEPE1
1,666,234,648 *AF5CAFF9779DA8E2C8B0954A3FAE1B7B9BE52EF5 ƏRZIMI
1,666,234,649 *AF5F277811A131C74634A26E9051CC30E9092BBB ESPANOLH1
1,666,234,650 *AF538AB03F6F0B6654181D4EF77E2D7641D8B31B espebomen9
1,666,234,651 *AF517D686DBEDB4501F36278D1C362F1C9DD583E EvaBongers
1,666,234,652 *AF538167E5B031C09DE3E7AF3501036C977204A5 EVERETTWALROND
1,666,234,653 *AF5B5470568B5CFBB40B87ECAC736FD6162F9D60 EVERY.TIME.I.DO.A.FART.(LIVE)
1,666,234,654 *AF56F1080F5D03850F70A7D5CCBFD6280F3B3654 EWNEREOB8
1,666,234,655 *AF582A24DD71C771CE75429F1C8B04DE7574E148 extumeres
1,666,234,656 *AF57F6AE35B658F2EC3BF0EB34C7A8C049348D4F EY8VB
1,666,234,657 *AF543367B433F62F85B9781A9FBF75E9CF8A5148 EZEQUIELPERILLI
1,666,234,658 *AF566C678C1F32B8243DCDD05BC8065DC7C1059F EZITENNO3
1,666,234,659 *AF5ECA3065A476EDD77F2836F9459B1A494F24EA FA222710B1C537E5830ACFFC4FE79D28
1,666,234,660 *AF5A1425FCE5CCA3698FCE035D59CB5C7E0B7D03 FACE.THE.BASE.(TUNE.UP!.REMIX)
1,666,234,661 *AF500BA1B2A9195BAE8BFB9FD37409B4D7E75665 FAHRPLANM
1,666,234,662 *AF5E5E45B5891B6F7E061C2248CB011CA2843451 ferdinandcallar
1,666,234,663 *AF5E613FD8AB17065A44C940C5D8F0A0FB2E76EA fermingoodacre
1,666,234,664 *AF507B1B40F46BB46879B5FBD03FE617FA02CA8A [email protected]
1,666,234,665 *AF52BD2BFB214BE04E4B6F77D35D6324D2198A7D fhj0melswmveqm7
1,666,234,666 *AF568315BB9A64439758ECFFFBCB97D499F44C20 FIRSTM8
1,666,234,667 *AF5DE8448F9CF1EF4665B3329DF9B990C9A27BFD fix.on.you
1,666,234,668 *AF5F6E65F8EE95C3A18782E46276A517A6F691B3 “flex
1,666,234,669 *AF56555336B42082ABB751B9D83C7D1011251EDA FORHANDLINGSPLIKT
1,666,234,670 *AF59832BEA6A8C842AAF237005CC1FB873780215 FORKLIFTKING
1,666,234,671 *AF5CC3AD14A205BA29E81551A8D45FD8B4CCB532 forrestruegsegger
1,666,234,672 *AF592F291D65712DCD09E86FDED138CA6A5A31AD FREDRICKJASPER
1,666,234,673 *AF5578E9CE95B021EAAD202EEA18377BBB47E7C2 [email protected]
1,666,234,674 *AF5E2A397A04DE95D43A44B257BDC6C3162F4908 fuggiremo0
1,666,234,675 *AF54050D72BB6F0F7855A39C59AD00CB31F09983 FULLANMCDONOUGH
1,666,234,676 *AF5875F20761FDE872106BA732AEF285F3DC7F1A [email protected]
1,666,234,677 *AF5D0B9C3F1326751D6AF37DFD4F7652BC6D90CB fwj
1,666,234,678 *AF52A17F72715678FA64BD360E254AD744A9C02D gammaliel
1,666,234,679 *AF5206525678234DB82B0C6A61E52C6193093A65 garrettpelot
1,666,234,680 *AF52642DA99A108EE86E5F5617A24BD23CDBC631 GARRETWISHUM
1,666,234,681 *AF5806B798999CE32F926680104DEFBB26FE93BE GARTHMUNDSCHENK
1,666,234,682 *AF5148EFE5F356CBBFE0F543AB18955128E19D51 [email protected]
1,666,234,683 *AF5359ADA540E3CE729DF396DCA7AFEA400AA7CA GATE.WHEEL
1,666,234,684 *AF5C456269B07A5144CCF114E2F111EB535FF4A2 GAYLORD.KASKA
1,666,234,685 *AF5BC065F978403D972E09D9130AC6E5EA968021 gazump
1,666,234,686 *AF531EB21524637A4AEF8D4A1BACAF48A7AC95AE genemanhart
1,666,234,687 *AF5E852DCAB2C4D4C94C67333BD8A6C6A8D8E654 GEORGESHUMPERT
1,666,234,688 *AF5948DF1E3EAAE1518D3817A8A390A26589B4B3 GERARDO.GUTTERREZ
1,666,234,689 *AF5D87F251E58828334704A7359FFCA579358C86 GGBAIN.00678
1,666,234,690 *AF5BBF03C3DE0F5C89639DBEB671DF4647CA1A64 ggerman0
1,666,234,691 *AF5BA11A0940D7BE4A40AEB832B649C2C438A772 GINA-ROLFS
1,666,234,692 *AF50CA4E2D411A513DCC0F0C51F44FBBBEAAD510 GKARDY
1,666,234,693 *AF5DE81290CE930564FDE9048742F65C3E52FE31 go-hanazono''-tenn
1,666,234,694 *AF538636DF1FA7C67930FB7D2124B070ECE9C41D GREGORIO.SIEGLER
1,666,234,695 *AF5C2EE5E552ED36644EFD3C1F9569C6B0F080E8 GRIFFINPABLO
1,666,234,696 *AF57C3F8A33437050F3BD49CC19E6C3D9A89CDC4 GRISETT
1,666,234,697 *AF5CFF3C380E32ADF8110E692F7BCEC1F701BC9A gxf6
1,666,234,698 *AF5E4086C037B322451A9C29438A6AC4A17491E6 HAMILTOE5
1,666,234,699 *AF548B5679834F2932540108934B5CE906482405 [email protected]
1,666,234,700 *AF5058842B4B8B4FB425720EE977F3BF519D2C4B HARMONIA
1,666,234,701 *AF56FC529DAC4B2284D77EE0F986F7CE27CF3C29 HASNOUC
1,666,234,702 *AF5C1D27FF25D70F884F9D9DB79FEB4C59C18AAF haydenhanger
1,666,234,703 *AF5F4FD2A2EDD2502A3955E560D92ADED29F7F0D HCSOREJ8
1,666,234,704 *AF5F61901DD52BA221DFAB943C17F9A4F45684DE HECTOR.COCKERILL
1,666,234,705 *AF5A98042794E303FB642113D90540C76A591FD0 [email protected]
1,666,234,706 *AF57B182F064D630618A5546C9D51286421BE3AA heidi727
1,666,234,707 *AF5DC5CC6212C0275B68E0758EE7922B15D06089 HIRAMHILDRETH
1,666,234,708 *AF5A3E81EE5089D21F9842DB657F81365157B934 [email protected]
1,666,234,709 *AF5F0DC9C923EE5CDCDAC94DF7AD3DCC1F0DDBD7 hklg
1,666,234,710 *AF52D86D6EE84AEE0BF6C8A6E05C262DDCC52FE0 HOBOSTINK
1,666,234,711 *AF50C3292BD302C81E8298B9900ACA028E6F3BB9 HONDA12007
1,666,234,712 *AF54100994F005F9ED9C6F8751B01B8D3429D953 HOWARD.PENATE
1,666,234,713 *AF50AD51B393E64CFEB6FECBEC4621D4FC555E61 [email protected]
1,666,234,714 *AF5D50CD52C3D086DD90BEDB3AC576760D3037F3 HTTPAASWEBSV.AAS.DUK
1,666,234,715 *AF5D04A11981801D7348CA88E9B9F888644F23CE [email protected]
1,666,234,716 *AF54326DE111490207814D496518B5767810657E HUBERT.STIDMAN
1,666,234,717 *AF5D4DEF5CFB8C4DE6A689B0BE859E77E725D323 hugeone9
1,666,234,718 *AF5FC7A9C5CA0B6BECC864CA4B525AE88E5E8320 IAMREXQWER
1,666,234,719 *AF507E7FB91192B177C08DEF49700E12DC48C42B I BELONG
1,666,234,720 *AF5DA29D82DF7C1317150D0BBBDBFA1388C80718 i)[email protected]
1,666,234,721 *AF576F8AE00FF3EAF80B76296C861E412C7CD439 ikaika2691
1,666,234,722 *AF5A769FF82D636ACB79E36F615B7FDA5FDE7432 IKKSKILT6
1,666,234,723 *AF5B8369A216444E2C27080E937C095233F3C876 IKUOBMATS
1,666,234,724 *AF59734FF7EFD20CD54F205778EA56C731042969 illpijal0
1,666,234,725 *AF51FDFA82ED74EFBC557815008C2F40397A89E4 ILUVNORTON91
1,666,234,726 *AF5CFA735A658C01C29C59ADF0BEA677F4BFBF54 IN.CHEF
1,666,234,727 *AF54AB80357CEE45832B5374AB84438C3F0627DF indiaanst3
1,666,234,728 *AF58BDDEC8D2310FA5588F1EF9DCA9ABC588766D inishienomura
1,666,234,729 *AF56DCAC5EA79026938A5190EE9D8BB5597CE2E9 iraodess
1,666,234,730 *AF58BAE835EE0E287CA494E3A5F430D930E75941 irvingchavarin
1,666,234,731 *AF5A3305E2BF2B96E4B69BD8CBE19AF9A67F4B6B [email protected]
1,666,234,732 *AF53123B6030FB8A956E85E8EE1DB0F1CE3355BC [email protected]
1,666,234,733 *AF5BC91039C5B18ED9A412165F0C4D68799D48EF ITAZZEMS6
1,666,234,734 *AF5163F7A288AE3784FF2EE76F861048164B6D5B ITNNIONIAL
1,666,234,735 *AF5BB944870D806E72D84EE6EA7F6CC849398388 ivaselaps
1,666,234,736 *AF5CF563AD9739509B48051205D050B76A8FB6FC J5D5
1,666,234,737 *AF5BC14D9C1BC2841D8D80838DDA5F6814876A75 jack.and.a.red.dog
1,666,234,738 *AF565880BD4D77A4E58F79189B463BBFB46310F5 JACK.GLOSHEN
1,666,234,739 *AF560A7CB4901686158C63AA3850106FA9C22063 jacksonlehrian
1,666,234,740 *AF5A388CB2B2EA5AE39C22A2780761E287971F8B jacquie-grandmont
1,666,234,741 *AF5D685A1B7E44DF1AE958BA106BA95552A8086A JAKOSTIMA
1,666,234,742 *AF54E30CD177CAF175D273C40473116E632D3FFF JARUNK1
1,666,234,743 *AF5E191863448A356526E3178FE28A69DC599A76 [email protected]
1,666,234,744 *AF565653ED8BEF3DAA1AEFF2ED36A87DD5F7233B JAZOINTERVIEW
1,666,234,745 *AF548632B364F8A42D256B56C2D9732A84977A8E jeanettemonopoly
1,666,234,746 *AF5E2C7C233F51B41B7F324CCA3881A020370912 JELLYMAN1665
1,666,234,747 *AF59B9EB4AFBF03278C650ADADA91B00F84721F5 JERROD.SABI
1,666,234,748 *AF51146DCC4B72AB2E3CA7EB9162A81A6025587B jerroldbeegle
1,666,234,749 *AF5014F4865C1AFD45C6B3FF05D65BD28AFD2F78 J'espere-Ca
1,666,234,750 *AF57A0B9C282227562526FA8A613F4BE57FECBEF jessbeckel
1,666,234,751 *AF531C1B36E52889B43BE1DA8798C987F0404BEC jesus.is.the.manager.at.walmart
1,666,234,752 *AF5E067B70FF8F046293AABA7AC5C1C4EAFC0BD2 JGKDAAAAIBAJ
1,666,234,753 *AF51C8E8CCCAB23C6B60DFF87F1FD8F8DE52D5A3 JLATUFF
1,666,234,754 *AF54FF4244B58F518E99374BED6781592B07862D JOANE
1,666,234,755 *AF560957D6EA311D7B35B694EBEE33769FE16B3E JOEY.ENGELBERG
1,666,234,756 *AF50EDC8F633726C65D6BE3D13BA018CD3EA327A JOEYHARMANN
1,666,234,757 *AF5A9B34648EB0FE1E2FF85543FAA030F9006D75 johnathonvanvalen
1,666,234,758 *AF579AC599C85398B6892282CAE84C9177456A07 JONATHAN.MOEVAO
1,666,234,759 *AF50D0560C35A3B6072AD58FEA901769144253DF JONOMARTIN
1,666,234,760 *AF5010843E474EFCE854E4C71886950F6E972394 [email protected]
1,666,234,761 *AF5F52FF4F7A05409F037E450870A694530DCA89 jospehsmulik
1,666,234,762 *AF5EDD59AC2501FFC5DB766D3B98E1CA9D324D47 juan-gabaldon
1,666,234,763 *AF54F7C45C1F22C99677F379C7738563D30389DD JULIO-MANZUR-ABDALA
1,666,234,764 *AF578F119D86E91D9A71E62F5E1C59115914846E [email protected]
1,666,234,765 *AF536FF1AEFADBAD73776F8872F3B73BB032912F kafuchoing
1,666,234,766 *AF56E3BC570621A1F108357D1B01E36AF591CE57 KENNYKINSLER
1,666,234,767 *AF5520A1F5F5CCA1A474B0B2CB9545B55A5A3FC7 KEVIN-CRAIN
1,666,234,768 *AF5F892C875A94A4324CCE8DBAFF8C7B432694C4 KIELT{V{STI
1,666,234,769 *AF5A8B000CDAC07E1DD3A3BA0054258FB1116647 [email protected]
1,666,234,770 *AF5612DCE2E79088D9570B9F63D267313F10CEC3 KIMBERLYLOK
1,666,234,771 *AF520B8870AC7FE7303A9D0C430B10C563CFEBA1 KRIGARSTATUS
1,666,234,772 *AF572052D882A79B10E3A8CA3D4E94E80502ADA2 KRISTOFER.ARTMAN
1,666,234,773 *AF5E8B58E026F83ABBB912635E061C72B4F5A4A0 kristycamera
1,666,234,774 *AF586A733A387A498BC362EB1D9FA33D8ABBC7F2 [email protected]
1,666,234,775 *AF55E17FE140335B002A188082546EA0219C7867 l'amour-en-soi
1,666,234,776 *AF5B901B9C4BF938A4061E261B8ADF102428FBEB [email protected]
1,666,234,777 *AF5F39B91536B5A82007F92C3A47B534536138FB leishpositivedog
1,666,234,778 *AF52D69BFFED3A386CBD25CC0EAD56D141505B7B [email protected]
1,666,234,779 *AF5E3C541F8E04A84155CE20DEC4F9D07BE434B5 lesrane
1,666,234,780 *AF535BECA9F3AED82D80CF98168B18CEEFDD5647 leviherth
1,666,234,781 *AF5D4EA547167EE93C65578F383A7535C3E781D4 [email protected]
1,666,234,782 *AF5ABD40C9ABB054AF6843D8BB0808656F416355 LIEDERPLATZ
1,666,234,783 *AF52FA2A047F2FD142574F28DF7B84F0338926F2 LINDBLOM-MADE-LANDMARK
1,666,234,784 *AF5FD242C4D31FC4C8895B1B010D65F57B1A285A lituano8
1,666,234,785 *AF51F55984FBB39E4F9C92D277ACC03A34DCBF74 livethepartydream
1,666,234,786 *AF57092365A47D26519E4DC17A067EB4AB72BC4D @[email protected]
1,666,234,787 *AF524DEB91210A5B19073496E4218D7377420BE2 LOISEXTENSION
1,666,234,788 *AF55A710BBC908B82E1507F251FDD188DC0D3BFB LOLWAVEGETARIANCONTR
1,666,234,789 *AF573E703DBD350929E24D1E65BD18B26D4D5922 LOOKING-FOR-ROSES
1,666,234,790 *AF59645D258F150DBD1DE64FC627A1B51579A3FA LUCIANOHUDMON
1,666,234,791 *AF5B44DA98E45D8CB59567FCAD4FB286DBE1F1DB LUCID(ORIGINALMIX)
1,666,234,792 *AF5B34D96BCC4D6D2FB14DA7BD97C2650F228DCD m41pre$en747i0n
1,666,234,793 *AF5B84EC4377318415C651C46FCB1EFF616EEDC4 MAOJINRAN
1,666,234,794 *AF5DCE347BB15B3743DEAFD4BC7632B20C166750 marilyn-rowland
1,666,234,795 *AF5149FA44F010A26A52152CBDBC603311B70A87 MARKUSFOREHAND
1,666,234,796 *AF55BE5478C7482873AF6C1ED1C07C536863A032 markusstoeger
1,666,234,797 *AF5116458679722B4F7131E80FDCA03F92C2C5A3 MARLEE250
1,666,234,798 *AF5830BA4B098C3ED4F04A913724538B67BA9D1E MASONMCGARRY
1,666,234,799 *AF5B30613A296DBB6D4590E8520693361E4E56DE MASTEROFPUPPETS(JUSTICEREMIX)
1,666,234,800 *AF5743F1937DBEA781827CB250544B69EDE4DC2A MATTSPARGO
1,666,234,801 *AF5ADD094609C468762F61B1439E8C9CB0220BA9 mauricegavitt
1,666,234,802 *AF50058CD97865400160551F370E4CF6011BF43B Mauro-Picotto-(Megamind-mix)
1,666,234,803 *AF5E049DD4F9C74D3812A6064D39C88B9715383F MAWPIN
1,666,234,804 *AF50B6EB13C88E02A74525FEEF24890FB88A89A7 mcK
1,666,234,805 *AF59C9A4943D76BE6F2D21752F62CAB43503C617 MELQUICK
1,666,234,806 *AF5D511F1CE1AC4CCA8FF9BB55DC7A1F7F79166E michaelvilen
1,666,234,807 *AF5B8D730E45BB83A6FFC63DC9A477E807BE8428 middlysing
1,666,234,808 *AF589A2EE45FD6E87E48B1B1CAC06E8C979CABB8 MILAN.VENTURINI
1,666,234,809 *AF537987E8BB58043BB5CA91E7B2D23949C22852 MILLARD.VOGELSANG
1,666,234,810 *AF5AA0D4DDF4AD943DE1AABB39857365219E4602 mlntndnt4
1,666,234,811 *AF5514CECDCC26A25610A3DB44D1F6DD8DB0D09D MOHAMMADNATIONS
1,666,234,812 *AF5CEC608D08AFDA06DFE951832D2C99BA1FD2FE MOHIT NANDWANI
1,666,234,813 *AF56D1C83D6AEA66329F5A51C4BDBCA02788042B monibur
1,666,234,814 *AF525C33C7D02AF3A404E49DE65066BAD1A6431C morgankalpakoff
1,666,234,815 *AF5355962A10B1666D5981BF1FDDE760D165BA13 moritoshi
1,666,234,816 *AF5CF7D9D54A9F8E5B8F6E7740A86367793D5C86 mpago-de-fuego
1,666,234,817 *AF5129C6EC8A709434F218B86D7D20483C1CC588 muchineripi
1,666,234,818 *AF5D0BEC964C7274E078ABE32C9E43235D1D37E1 N004037458963
1,666,234,819 *AF5D103506D0900F7B5AE5915EF6D613146E281F n>1
1,666,234,820 *AF5F4E9F98DFF68D6F0E73639F8C835033F40E1A naivnoga6
1,666,234,821 *AF50B7DA6A2458B2ABDB05A79A44E62AE517E2E6 NAY C:
1,666,234,822 *AF5D26CCED1DB0159CCDFC33FFD338808E531DC4 [email protected]
1,666,234,823 *AF5E2679403D5CA5927AFE0E047EAE8E64C3368C nealradomski
1,666,234,824 *AF549DEBB821371B5AB5D08D5BA1D509101A932C NEDAVNOJ6
1,666,234,825 *AF5F88F2982A146ADED3300A5645A66FE8EE3C8E NED.KONTY
1,666,234,826 *AF5CD963CFD959470E254C76E97BB320ED08DCB2 nedlaah9
1,666,234,827 *AF548FD45D2D1D31723CA4B4AE187043F9122E7E nestormenoni
1,666,234,828 *AF57284ABB33B8B751D372E770FEDE72388E7884 ng i odens sal
1,666,234,829 *AF5BF3D9F746D07FF241EA4608B2FFFF9771049B nnjz
1,666,234,830 *AF5180B98E1E5D08574129C0CD746511C71C438C NOITNEVERPORES
1,666,234,831 *AF54AE9F9AD8AA77D24FBA24CD066D3191E5BA7E NORRIS.MCCARL
1,666,234,832 *AF556701B3CF0826782C0276ADBAC576243A8401 NOTIFIIING
1,666,234,833 *AF5F2BC9D7A2059F4F62087C20FC79BA8CDAC508 nrp76874
1,666,234,834 *AF51E12EEB9CCC0D65571D65F0509FD7856F726D o11ston3s
1,666,234,835 *AF54461DC1757AED1ED5EB8395EDCFB0AF3FECCA O94638
1,666,234,836 *AF52597068D85C2E6B4642460ADF3C4A08DD7340 objektu
1,666,234,837 *AF518820AD1B1A33F2A8915CEF90A10026C4E071 (o_-).*.*d=p
1,666,234,838 *AF58ADA4FA167829FECEC455A77DB0DA2D9DAD83 olinschuepfer
1,666,234,839 *AF52159C68414E973BF1DD231E8B9F82F6713630 omgitsbert
1,666,234,840 *AF523726C665A0AC2797C0D73237A192AFF38062 ORVALMCKENNON
1,666,234,841 *AF5FDA377F0E40B22AB1DE36D7FA34FED9BACB30 [email protected]
1,666,234,842 *AF552B0F81C645B55BF01331468386E6DC899868 PAPTENS0
1,666,234,843 *AF5006B64D18AE207DD6959B4D142B4DC79E548A PARALYSW6
1,666,234,844 *AF5B277B1ADB957FBC0FCD35F1EACEBB3C7BEF91 parkersuper
1,666,234,845 *AF5F55387D13309D3D036AA3FECD964A027C771E PAULO BARBO
1,666,234,846 *AF5655981A2AD83E2E6967FC9B15B2FD807BA0C4 paul-weller
1,666,234,847 *AF55F06DF82B222A850D2905B6E111D10288B25B [email protected]
1,666,234,848 *AF54408D721A0B188CDD9B8F8F0ED1509636E8E0 pengu6700
1,666,234,849 *AF5A465E01BD6CF1874382E83F21C60404176FBD P-G
1,666,234,850 *AF5E36FC82B047B0256AA476F077028E786327D8 pineaal2
1,666,234,851 *AF53E1FF51B9053DA734C5F40F4646BAA2FCF176 [email protected]
1,666,234,852 *AF5C8296A081DB0ED47CC7FD4F4C6F0D39ED9E5F P->~O ~O SPLAT
1,666,234,853 *AF553722828F498634AC1682423AEDB60B6EDBC7 PRECISANDO!
1,666,234,854 *AF585620CE6F7683849B475AB7F3404BFF4DEFCF PS2,2006年发售
1,666,234,855 *AF5B6AA35D872E3A3280A955410512E772D616EE Q------D~O~O:P
1,666,234,856 *AF589463B8EC2B06C51A501459E679E1D9CFEE1C q>~.`.splat!!
1,666,234,857 *AF5F4507EA6B43F5E38F1C460F7218819E0F49A3 r3!nv35t5
1,666,234,858 *AF52582B3C5C8E3F99548C91ED43DE9F483A4ECC RAHUL.GADA
1,666,234,859 *AF57C9A24427B1553E4D18B9D028AAD4187F09A3 RAJAJEE
1,666,234,860 *AF53CC902F48859179535855F36DE9107263DF96 RANDYMOOS
1,666,234,861 *AF500FC62D091B1097A295580A67AF2065C5C541 RAYFORD.POPOVITCH
1,666,234,862 *AF5EAD80F6B05736422282702D694CEA653F6186 [email protected]
1,666,234,863 *AF5012689AC01B36E2D5A0455C8A6755CDF9A6BB redbrick
1,666,234,864 *AF5A0768753A818AAEC61A533C600F48661EA833 REPUBLI5HIN9
1,666,234,865 *AF5221C2A8AA3FA8B226E9B323B8263598EB62BC [email protected]$
1,666,234,866 *AF5F3616DC45F6C98A4F2FDDBE006DDDAB704405 RODRIGUEZALCALA
1,666,234,867 *AF598FF5B5623968716EB662734A03BEBDF36184 ROGNON
1,666,234,868 *AF5BF91720F5972749AB1429B798FB0DD8C12349 romeounchained
1,666,234,869 *AF5DCA53E0341B6A48C53F2C2E4486AC7B857F2C rubinsteckel
1,666,234,870 *AF5E9394C0C98E0A53AE1BA5CF24F02D8675C95F rudolfscanneu
1,666,234,871 *AF52DDD88EA45F5136467682CAE08C151A7EB619 RUDOLFTAIBI
1,666,234,872 *AF5D5CCB2E162902220A9CE1D4C4BBFCABA47269 RUDY-&-WHEELS
1,666,234,873 *AF54372F4CF1D8BAFF7E750428F907E419447E58 RZAHROTUNNISA
1,666,234,874 *AF523F805AFD53A1102F2C661527744F6828F92B SA
1,666,234,875 *AF5D23D2310254E5F9167574D51DF1BC25F0B813 SALVATORE.SELL
1,666,234,876 *AF5286F78425632FBE9E94223DDAF7BBC547CC9C sam034
1,666,234,877 *AF5DEE0D5306F5DFD724E84967C9670C90687991 SANDRABEANERING
1,666,234,878 *AF58414B0DDC49CEF2F4FD7569BCED67395CBB9C SANGRIA
1,666,234,879 *AF5F79A486027EBB3A192E69616377F27A88E32F ”SAX
1,666,234,880 *AF5BFB9EA559EBAF0472B4182F08C797C65E4D45 SCUOIANDOLI
1,666,234,881 *AF5575D101756D3873C633EA2B90D2596BCE89BF SELECCION-DE-BASQUETBOL-DE-CHILE
1,666,234,882 *AF5F1E986B6BAEE2A0C5A3605B3AE1EBD9A2DDBE semifriable
1,666,234,883 *AF51D649C034C40EF0BD86F7A6C4BB8EF6834188 SERGIO.MORAR
1,666,234,884 *AF5F89871BE3A179C93509084EE4894FBE4DE6EF SHANTIBOWLING4
1,666,234,885 *AF5E1414D44D2BB149E37EB63F7DEE9EEE79CD34 SHASHWATREGMI
1,666,234,886 *AF5AA6793FB733080CAA43E669AE0555E4B420E2 SHEENAMAURICE8
1,666,234,887 *AF51B20ABE4AC7CCD1341C1D9BCBA673BFC39082 SHELDONCOROLLA
1,666,234,888 *AF5113CBEC13579A6CC99F5ABFCDCB0BAFE9F6F3 sheppardin
1,666,234,889 *AF5A9C85D5BEAB7D339DC61039A0F6BCDA6FCDAF shopers2
1,666,234,890 *AF58789BF644A45E9F16BA8A1AE99094A472EBDD sil5545
1,666,234,891 *AF5EB002B1026088A7652CE0DC93D08A0E6776E5 SPARUSSURAPS
1,666,234,892 *AF599865953F1BAA4DE1B31422601625A2DFA743 SPEW FORTH BLASPHEMY
1,666,234,893 *AF5C6575E3DB85B5E43C853497B1BDE4154C8B4E splat!!~`@#q
1,666,234,894 *AF53D3F7C96227B260455A9C2E48EC42B61ADB1C [email protected]
1,666,234,895 *AF5CB5A2BAB31432BE6CA54D8B9771CA4089F678 st0nemas)n
1,666,234,896 *AF5C7D2B8D8B7D4E0BBD8D0BCC66D3B68D032FB4 STARMICKEIED
1,666,234,897 *AF542C1E4E9A208571D0BED265BA5CAFC53E2BA8 „STAROST”
1,666,234,898 *AF58D1FB667A583C415F3234CCF9DED27311FE85 STEVE GUZZETTA
1,666,234,899 *AF5C45A00FA16F0526DCB5BCDBB7358AE9527056 ST. HELENE MOUNTAIN
1,666,234,900 *AF5DDCC9A668F2F8D6094746A0661A5ADA4FFF4D STOCKP1N9
1,666,234,901 *AF53B40D406939611274782C0623570B95C09C4D STUMBLERZ
1,666,234,902 *AF566131ECD5CB32A02CECA0CDAE1F208811D366 SUN-HENKES-HAISEE
1,666,234,903 *AF5FBC2ED3CF87F756A39F4690660E90F85D51CE svboqqgfyu
1,666,234,904 *AF5BD658B46F9AA1A19F39302065612560E74DC6 SYVRSDRENG2
1,666,234,905 *AF5E1115ED73E8A26FFDC1F30DDCB609D87CE6FC T1_AND_USERBOXES
1,666,234,906 *AF56CB37F75615D26422FC1B5089DEFF62102F6E <tablestyle="border-collapse:collapse;"><tr><tdcolspan="2"><embedsrc="http://appsrockyoucom/horoswf?i=4313219&n=Michelle&s=li"wmode="transparent"quality="high"width="280"height="340"name="horo"align="middle"
1,666,234,907 *AF50263A96A2AE3E504A4B6AC95A17882213F111 taipaleenjoen
1,666,234,908 *AF595B7C6065BC366D99B2BAE46858AC53EBBE66 TALOCOHCEISSAC
1,666,234,909 *AF55F5662EC439BAC487B765F589F496B5A5B465 tarheelfootballcoach
1,666,234,910 *AF5AF7A344D2118529BEDF77207047027987A3AF TERENCEKAVANAGH
1,666,234,911 *AF5CF0C20FD36362095CC29B7CB3D7523876D9CD TERESITAMOTUALEH
1,666,234,912 *AF5DC942A414C17DBFCED8781618E3DC58D30C97 THADGEHLERT
1,666,234,913 *AF52B75C0FFA54862FC94650478DCCFF05984BFD [email protected]#
1,666,234,914 *AF52945C22D4ED948D63CBBB6C91F5F8BC728668 THATLAW666
1,666,234,915 *AF59D0285E2EE2419AFC670A7DA2B0F11E8C55C5 The.Buddhist.View.of.Anger
1,666,234,916 *AF5277F7D1CD2D1E45D90BF3FBA48040444AE560 thepolarity
1,666,234,917 *AF55F7956A6C9A8E711573F5E43B5280BCE58CC8 theteachingassistantleavesbrodyisscowlingas
1,666,234,918 *AF59FEB64489E0E0A515129AC6EB9B401F55FDDF TINGSHENG.LIN
1,666,234,919 *AF5A628BDC9FB7238FE6F4F41C9D2CFBD65498B2 tjande99
1,666,234,920 *AF534707E01C0ADEF3E8E5D236759695103038F0 TMUEAREGFUA8
1,666,234,921 *AF5733F4CFDA11EA055F1C48EC244A1AEAF0C162 TNERNITBBED
1,666,234,922 *AF5576F428D1D828E6FF285EF836F6B5E5F0B615 TNESIROLS
1,666,234,923 *AF5E830E011152D0E4E616D9D67A3153A8776AC8 TOMAS.TIMONS
1,666,234,924 *AF5FDD492DA386F87DC625515B3C2BECF35B949F TORIKEIM
1,666,234,925 *AF51E83727FBDC87C7A89CF6C7ACE3BB19256E98 torlath
1,666,234,926 *AF532A8483388A5A7AB7A7909D08E78FA7748DCD [email protected]@TE
1,666,234,927 *AF5D7996A147186BEEA6F4D8F3F8935C77B46685 tracymccarsonmckay
1,666,234,928 *AF5050741CB6ABBEE3015BE4914240011A091D00 TRAVIS.GEERS
1,666,234,929 *AF518E5CDCCB475F78109C38107497EBD5AC4BC6 trip.to.bingen.(big.tom's.original.version)
1,666,234,930 *AF54ADA97323BA06049F692942AC100B9426AE80 tunnellösung
1,666,234,931 *AF5658E985A61160632F1F18AE1D0845CFA5B79E u4.w
1,666,234,932 *AF52E70D1BC256C0809CA59EA6E84CA9CC64C181 uncantoned
1,666,234,933 *AF59C2F3CAEA1EFA6DD5E52AC7BDBAE59D029E38 usatodaywb
1,666,234,934 *AF55AF785E1960FB0EAB13E02A5130A43E4BAE7E USHITIMO
1,666,234,935 *AF5144AFDCC48BCFB919D344CB115B6F26C200FB [email protected]
1,666,234,936 *AF5D529485AD7D814D6528DB8734490ACFB633C2 [email protected]
1,666,234,937 *AF5A0124044D9D99408413BD253C1C998A5D70E9 v1v1s3ct1ng
1,666,234,938 *AF53FF793BAF250262AF0DDEBBB3842A13AF8C6F VANSHAJHANDOO
1,666,234,939 *AF5CCF7FCC65AD8E856EC2808803716BBDD70060 vantemple
1,666,234,940 *AF5D72CE5819E841F793D3D3DF12E78C49C68BFB vasilis.sergiannidis
1,666,234,941 *AF5B65F64425AF53830EACB51B210070B6233520 vaughnciersezwski
1,666,234,942 *AF59B419BB8DA8C96C9A43D31D56D888CBBEC5E2 VAUGHNPENSKI
1,666,234,943 *AF5161E0CD1282CFA2A769C0C55A9BFCF20D98B6 VELVET.MICHAEL
1,666,234,944 *AF50BDF5D3FD690045652CECAAADDD89D0885124 VEREWIGENDES1
1,666,234,945 *AF545580224D26D0A9243B1368A090D1233A1B5C VERGLACING
1,666,234,946 *AF5E25BD81ACBBDE7EC60F8D116222D4A3FC8870 VERMONTCOMPTON7
1,666,234,947 *AF53431D9C32B41E1464002E9A0001F8FEB350E5 VERTE.CAMPAGNE
1,666,234,948 *AF585B9725186F268B97C63E62067AE00B710051 VICKIEQUINN
1,666,234,949 *AF5DDDB8DED402E9CD16CB913C132EE82F4579A3 VIDAMEE
1,666,234,950 *AF52C8F767979D7C92FC4D5B6671EAC6DF4A4162 VINAY.SHEKAR.REDDY
1,666,234,951 *AF54D89DEAFB89B3A73D4E38726D8ED8D2DA361D VINCEIMLAY
1,666,234,952 *AF5CC128714F130834ABE5E0FA326339717F6190 VIVATMA2
1,666,234,953 *AF505FEEFB4922E70452102B3CCA1D588EA62FF1 vnsacke4
1,666,234,954 *AF56055464D332C0437740F2DE234BB69FCDB581 [email protected]
1,666,234,955 *AF5EE10DC61035EEA660CE5A765829E38818DF56 w33d3r
1,666,234,956 *AF5BA96F42FA5C0C3FEC44EF8E378F5DAAAE6B69 'W>AAA
1,666,234,957 *AF5A35F380F34650F0E6767FDEB89A368E4029F2 WAHY-WAHIDY
1,666,234,958 *AF5393B8B526BE082BC74951C696565D00844A6C WALDO.HEGLIN
1,666,234,959 *AF5F92C781DF6A5E6E393FCCF644C95468B727FF WARWICK GRACELESS!-WILT-THOU-DENY-THY-PARENTAGE?
1,666,234,960 *AF5F06841BDEC6AE4FAD23D1E8D37446ECAFB2BC watch.what.happens
1,666,234,961 *AF50BAA7571A24AB5F6E8E871CA2F810F98B46FC [email protected]
1,666,234,962 *AF5AF57F9C6A1334C735BE3A6E7279213AF0D83F wellplowed
1,666,234,963 *AF508CE3A247C9A9034542F2F5CD8D6BA2B14E2B WENDYGILGHRIST
1,666,234,964 *AF5D09FBFE16961E1FFA113DE3829BB4A7B55616 [email protected]
1,666,234,965 *AF548194DC80CEA975483E9037970306D1508AA5 [email protected]
1,666,234,966 *AF5AC36B8CC8DF3B02365883B8223ABA444E1A9F „WERKKREIS“
1,666,234,967 *AF5FE7EC46B6B6D2674C416F1B6874D1E57D4E0B wewantyou(megamix'98)
1,666,234,968 *AF54A0F3BDA91756F4FB2C915059BAA9FD0543BC wilfredobarlak
1,666,234,969 *AF5F8581833E721748F3C730B4DA96A2FF6D6C09 WILFREDTAG
1,666,234,970 *AF5A7D9E447531BBB419595269CFC6A703923405 WILLIAMJACOBCOLLE
1,666,234,971 *AF5ECE340106588884B8EEDB922E86773F0A8DC2 WILLIAM.POPLAR
1,666,234,972 *AF58909D71929E8427B1E52913129190E98D64B3 WILLIAN.KUC
1,666,234,973 *AF5416B2210B880833C96A18F6ACAAFD13D236C9 [email protected]
1,666,234,974 *AF549C977AD3D0FBD76BA5EF8C033121CEB1271A [email protected]
1,666,234,975 *AF5DF929210ECC056AFF4AE3EF53980FAEDDEEE6 WP10IDENTIFIED
1,666,234,976 *AF50C3D532CDA78271DE8112DBF6DA6BD65A22C2 WWW.BRUMMIE.COM
1,666,234,977 *AF570B825044F651A1910F270CC07441A9014376 www.headmastersschoolwear.co.uk
1,666,234,978 *AF55ACCB2CEC094B86CA9974B5AD0CAF59945E43 WWWSURFINGUATEMALACOM
1,666,234,979 *AF58D736CD1F5161904AA57AE9263520CEB4AC41 xsecond
1,666,234,980 *AF5308A32C3F5ADE51869F7C111846C66549ADBF XUCEXIN
1,666,234,981 *AF525DA45D0BA7E45F171730C631230E32C7E525 Y96271
1,666,234,982 *AF5A6FCCF012984FEB19A7AC1D6D9B39489EAA0E YAMELEU1
1,666,234,983 *AF5DC1E3AB98C4D2EFFE9997C9A31270F951B6DA YAT SYKES
1,666,234,984 *AF546FB2A8E9AFD616ECCC1B5CC5E9050A6FEFAC yknapssotnicam
1,666,234,985 *AF54774ED08D4AE3A2806F839CCA43266DA634D6 yocoaiquín
1,666,234,986 *AF54CC7D9A66F5218623E07C2FEEA89FEBEC6A43 [email protected]
1,666,234,987 *AF57A8A99BE4A1416D856E5C25EFA0C020004F59 [email protected]
1,666,234,988 *AF58739DC37A8EF9CEA6FE18B856C5BC919BE8E7 Z122572
1,666,234,989 *AF51866ED140837BCB37582FF92181358B4991E1 ZAK-SHAMI
1,666,234,990 *AF5C1D922B3CEB9D51232209BD656C5CD74F970F ZCX411
1,666,234,991 *AF53AFD70B03C8C85EBFFA6CC85F458041F7AAC4 zeeaal9
1,666,234,992 *AF5C94737D7A42D58378FF39BA5895489698930D [email protected]
1,666,234,993 *AF5D6D190BDD73980B61517F68191DE106788304 [email protected]
1,666,234,994 *AF5C3118E696F48C907A595B7725B9460858924F [email protected]
1,666,234,995 *AF514436004A7488371695D65DB908BCB9177E10 ZHULUZONG
1,666,234,996 *AF56508BDADEF4399105F4E3FE5BFE6F39760AB1 [email protected]
1,666,234,997 *AF5C1C3CAE60A2E780434D60A7D3B22F159760AD zulfikker.ali.pazhayakath
1,666,234,998 *AF5D0BA02CB5B10EF8500BAC90404D0BBA4829B4 ZXCVBPINKFLOYING
1,666,234,999 *AF59E11B81071F7F4DFB99763B30CDF0CF5898CB καισαριανιώτεσ
1,666,235,000 *AF5C81D4E685FF8A95BB30F19A010FBC30CFFC3D ПРИЧАСТНО
1,666,235,001 *AF584CF1BB32AB5B2FE2255CE92D928C0566085F слугините
1,666,235,002 *AF5C80B40BB1F19D46FB96BD8693B420671A599F 人気av女優が出会いサイトで素人くんをゲット
1,666,235,003 *AF58D50BCD0E0D1E81DB2CA0F108DC45A12590FD 1126484 risto.niemipyntt
1,666,235,004 *AF55ED92F7FBF08BE8BB023901111E1DF22BC2B3 119.MAAKAASUA
1,666,235,005 *AF5841C66E8C7A1229B201638FEBB46BC91A9C3A 1413736 ABER ER UND SEINE FRAU FUEHLEN SICH SO WOHL IN BERLIN
1,666,235,006 *AF5D96BD0873970FC231B018B243A2CE1EA3592E 16.wachtuermen
1,666,235,007 *AF5AD13DF2AD7E6041020964D5FA6AE4FE9F6C46 174.tutkimisessa
1,666,235,008 *AF541D5F51F01EFFA775D5296B35315DDCC689CF 1992-11-29:-DESERT/I-AM-FIREGOD:-TORONTO,-ONTARIO,-CANADA
1,666,235,009 *AF5C212897C0125E3966D600A4677EDFDAF541EA 19GWTW39
1,666,235,010 *AF59947360E54C054F6FB0B09BFE8923223553E8 1DVDNGLY
1,666,235,011 *AF52DC74168C04F7790ECFC5DE57EBDE256A367D 1.DZUGAS
1,666,235,012 *AF55859C8884E6CE7AF9A44F016A74E6E044432E 1GEDISTEN
1,666,235,013 *AF56B76BAA851F61320ED8C4239A62518ACF26E5 1-genchev
1,666,235,014 *AF570DB546CB71B8523064D87065C56D99BCF883 1KAERBON
1,666,235,015 *AF5DF1D037BB7F1396354F155ADC533D3994A8B0 1.kiista-asiat
1,666,235,016 *AF50B7B436A19D5D75FA56C319E243F0E1227E97 1-KURSSIMATERIAALIT
1,666,235,017 *AF50CD6085DB47F97B49467F0C5B2ED413C4AE4C 1 laitemyynnist
1,666,235,018 *AF5CD6AC20E3917A1B3A306B8ED6D42A14B4EFF1 1MAGAZASINDA
1,666,235,019 *AF5ACB5C7FB837CCC1D45B9BBF536A693B724730 1MYJERRY6
1,666,235,020 *AF5DA0D66EE58E492320C89560AB403B27C1EC0F 1-PORONTALJA
1,666,235,021 *AF5F3AA637E61E1C3126A6C612F9F6CBE7E89B15 1-RAHA-AIHEINEN
1,666,235,022 *AF5FDF5012AFC2C9D676AB62040D08450597D2E6 1siilosuunnittelumme
1,666,235,023 *AF5AAAB4109348AC124FA5096787C4181907DE54 1THATBERNIE6
1,666,235,024 *AF5350F013D7B269FD1E08FCB9A6AE8E513E76A8 1.TOHMOLLE
1,666,235,025 *AF5A18E1053B6EB4814814C851EE6835800F86B3 1TOMPPATOHMAJ
1,666,235,026 *AF5B2E294B211E020FE6EAB374E197CE238641F9 1.trading-to
1,666,235,027 *AF562C1CDF7A75F234055A3D6D30456DDE4CC4B1 1 YKSIL
1,666,235,028 *AF53CB4D0DB963F2291836486C0DAB84745A5E70 [email protected]
1,666,235,029 *AF53A82669E0E5F8AC42010D1B47D7BB405EF6F2 210421 IT WAS PLEASINGLY UNFINISHED , UNSLICK
1,666,235,030 *AF59E2322366EC8642750F2820B3330FB881BB96 2172489 ONKO H
1,666,235,031 *AF5BC957D5BF68077D2895E766C9B0CD3B5C5090 226612 VASTAVALMISTUNEIDENONKINNYKY
1,666,235,032 *AF5E5C48C7964ABC2283E884F02648F997C92B94 2302896 NOTHING BUT BUBBLES IN WASHTUBS AND CHAMBERPOTS "
1,666,235,033 *AF5F95DD61B839F33F784236834B63A28567EB32 2318122 monen.loppui.hiiht
1,666,235,034 *AF54A407F7020C698A66E9ABD888729AD8B7CA52 24KONSEPTIIN
1,666,235,035 *AF5EE9B8E47E5F765D5C47C74EC9057B9FA0DC24 25061370
1,666,235,036 *AF5BAA828238479EAA9D129DD99B8356ABADB05F 257ezequiel
1,666,235,037 *AF578908992DE4754C47DBB6EC38E9101F82245E 2994212 seuroihin-on-toimitettu-my
1,666,235,038 *AF574FE7959B2356F9933805B87BDC2E4D8FE4B5 2.ARIZONA-SONORA
1,666,235,039 *AF515AB9E74317CF3F9A48B617F688A98C7AEA2C 2BOEMIMA
1,666,235,040 *AF5BEE5227E3F07A046AD8B7325A5FEB3371ED1D 2jan1654
1,666,235,041 *AF502AB0E52EDECACE864343EEC89B4275F0A992 2ormancIlar
1,666,235,042 *AF587519D7350B51B052AE20258198CBE2A7EB15 2QIUSHUI
1,666,235,043 *AF5DBCE9E369D41DB565BF6AC96841FDA2500B3A 2 REJIYONAL
1,666,235,044 *AF5A8CDFFC43D0B8D7D43D37B94442D88515D7D3 2.ZUZUHAENGEN
1,666,235,045 *AF5A41B9CFB8D4DBBE5DF19E46F33C33CD7B7E66 308.gUcUne
1,666,235,046 *AF5D448B6218C83AB77BF72D53FF69F3AADCEA74 31AUG1966
1,666,235,047 *AF5C15E7B078A714945D64E5A6194360C23815EF 3 BRUNOSCARFO
1,666,235,048 *AF5200ACD75F0C06AEF291A2532A8232AC313597 3DERBERGH
1,666,235,049 *AF5DBD779F1EE1B530487109F6C0A075C14C0B44 3ld3r.win
1,666,235,050 *AF5D1022ECDD5E5EC214797F3111BCB2E38441D8 3P~.~.~.SPLAT
1,666,235,051 *AF55EA3973C2B640C3FFAF78A58F5FFAE37B453E 44159 she-was-naked-and-apparently-had-been-raped-,-they-said-
1,666,235,052 *AF560F65E7BBFB93E0045452212DA7D8D3245262 488371 KLARTEXT-:-WER-GUTE-BEZIEHUNGEN-HAT-,-BEKOMMT-MEHR-
1,666,235,053 *AF57785C49A366D5B670ED7F025884274DDAF0E1 4catfish4
1,666,235,054 *AF54CB8F625383FF636C34D17B39FE11F14055BE 4HAWKEYEMARLEY
1,666,235,055 *AF50D8FA3BA2A0245F5AD4537236B67C6886C5BA 4RENSEANLG
1,666,235,056 *AF58223A07813D2BE72CADF6148AF9255D9BA94F 4SELAYOLE
1,666,235,057 *AF52D1916BA719ECD9E2EC966905648C448D78D4 4TINTINESSES
1,666,235,058 *AF5D85216B8615AB2014D254430B80C616787C78 4WINKELTJ
1,666,235,059 *AF5E71EB84B0E6B2C1F3F47117324FC94A7BF790 57a9414e13c937bbb433af829362764c
1,666,235,060 *AF52F3556B89F9CF97E1E8BA8B795F98E2D28A03 5BERCERENTS
1,666,235,061 *AF503F2EF129CD5B86BF56766256AC43F8250FAC 5BITCHRAIDER
1,666,235,062 *AF5E26D68AD6B16EB02E5F4A4656E2C0F179DE16 5EMBELLECIMIENTO
1,666,235,063 *AF516C88A6101BE6ED9C29F00B82CADDE566F6EF 5FP142FN1
1,666,235,064 *AF5747173B2A0BA3CF70E53A0C50C7FC222148B6 5JOANNA2
1,666,235,065 *AF53D6F4ACAD3E997A0F9FCF89A408B4606F102A 5MYEMERALD1
1,666,235,066 *AF5D3D0FF90D655AA8457172B35367A50E6810DF 5STERSKYSTER
1,666,235,067 *AF5B3A60F9B6C0307B47A04E960CA2C09F7F868A 619694 MITEN VOI TEHD
1,666,235,068 *AF5B9D35731DDCAC97C0F11A5058355E6936E306 6ALLENTARTI
1,666,235,069 *AF555FF4C92661FB2A0F38F4233E382E8C2DCDDF 6BIGMANMONET
1,666,235,070 *AF5CD24A65DDEA3E95BD350E0152122837C4C020 6BUDDHATVAM
1,666,235,071 *AF5B7867E45438EA36CF4058305616EE791EDF7E 6GRATELLE
1,666,235,072 *AF56B3594AF3FD3310E8EE7A4D1125AB17808D7B 6KAKLUUNI
1,666,235,073 *AF57E14206572B575C87BE227792D3344B34EC4D 6.malista
1,666,235,074 *AF551230482C5E55B9AB39A11D145B2155AC83F9 6PASSWDASPEN
1,666,235,075 *AF5E3E6EEE34D955E4077584FAC9B6229058DC65 6RNFINALE
1,666,235,076 *AF5F61FFCE6BDA5B9107952587E915702A96EE2D 6thatmoroni8
1,666,235,077 *AF5D959ED6B1710889D72F131BCE33D2925D0845 7ARTSERER
1,666,235,078 *AF508FFEF6D4D1556F46595B30EB3C37CEC1A74C 7DOUGLASNELLIE
1,666,235,079 *AF53A9283572F81F1C3BF918581D0082E023A8B7 7NAVAINOC
1,666,235,080 *AF5ADDD20B6B07EC8772ADCEB4A724638547934D 7REDLAAHE
1,666,235,081 *AF5AAB6B2EAC05FA390667A2CF0B20A2A3E23DBD 7REFJORTENENS
1,666,235,082 *AF54AFAE951F6B847343E4F26520D96BE158A282 7RLDFUUKTVIRWD
1,666,235,083 *AF504802A6A62AF4BE1EFAA3FFEF7A219A1F9AA0 7TEXTBLOCKENDE
1,666,235,084 *AF5246FD11CC1CB8F47C74DDE0E55193DAB2801F 8ABCDEFKAREN
1,666,235,085 *AF57CF305D56AF0AFC74F726C3E68984839AA957 8BSWSCHIFERL
1,666,235,086 *AF5BD6F096C6347D92CF1771E61E24FB25E6A3DD 8BUBACHBSW
1,666,235,087 *AF5CB2E91ED4978E72DA0D9184F072338EB17EB4 8ENDIABLADA
1,666,235,088 *AF530F72228493672A3D7E797B46B45F06E5CD6E 8ENITALEGATEM
1,666,235,089 *AF5CC4991BDF666CB5C7634F62F91F839D5BD890 8GARAZLI
1,666,235,090 *AF5D93433F760D8920A0BE66328D789E1665F31C 8GINSYOU
1,666,235,091 *AF5581B3222DD6C6FB4498068A25841559D19832 8GPLMRDN
1,666,235,092 *AF5304C92022D9DFF7CD3C01777DF00B768A15A8 8KANALIGEN
1,666,235,093 *AF5E81B9794D92057E62A4DA3C497142AB238B32 8------P * * * ~0~O3B<-
1,666,235,094 *AF557EB6A231FFB955EE93F6C1B55BF09D6DDD4E 8---p-~o(>-<)
1,666,235,095 *AF5D9E677B14D162576E93DB56C52B2617D7E33C 8----p~O~o)X(
1,666,235,096 *AF593DB52FC1AA822D0B3C452A8982AE8F6941F3 8#)`~-`~-)x(
1,666,235,097 *AF5DE979724CF59E7194BB45D5FB8C7DE9C16C13 9353JK
1,666,235,098 *AF5D6518CC1E3490A02DD6455C657D15825E4776 990465 SIE-GABEN-INTERVIEWS-
1,666,235,099 *AF5F2BE6F2417AD1F8B02BA9A5AACDAE2E035A2B 9AUTORITAETEN
1,666,235,100 *AF524DFEE1B1B0D8A5A5644B8DA908C7E97782E9 9BMERRILLBSW
1,666,235,101 *AF559565031FA63E82CFFB5781AE0E20FC9C8C8A 9EBREIERD
1,666,235,102 *AF5F08BC92C36F171D69E054322B03BA173539BD 9HINDURCHSEHENDEM
1,666,235,103 *AF500898FB3A70872D439B391D41EF62F9A28D37 9HOOTIEKAYLA
1,666,235,104 *AF5637F14B7F4BD8841F8B5CD06B0424D1052FDE 9OGNURATI
1,666,235,105 *AF553F3A1E48294303806197C9C6B614022B8BC9 9SLLAHERI
1,666,235,106 *AF5BFBDC2FAA5E8B4A49BCDE86D0927E98C1BD9F a/31w
1,666,235,107 *AF59B7D77834494FADD15729B9DB6F70708A447D A3F-N
1,666,235,108 *AF5684447534368202D98DFEFF184AD27E8BA748 abdulghaffarkhanfaithiabattle
1,666,235,109 *AF57E9BA7B3835DFDEAF6C0AE232CB9E03D1CC08 abf3z
1,666,235,110 *AF52E20EDC69EDF0B335E37BB64D99156726EE70 ACTION-MAN-DESTRUCTION-X
1,666,235,111 *AF527B47A4196EC31BDB3A367E45175F0697DB78 AD,/L
1,666,235,112 *AF5BAB68DE0FA4026251DD35CD6E95E06C0200A3 ADYV=
1,666,235,113 *AF53242AF11A486B566E35D36877650AAF9B8151 afterth2
1,666,235,114 *AF56A8FBD6FEC5284500A10C9E3E9E92A90AAFAE AH%M
1,666,235,115 *AF5A9FBE4A45CAA0CDB3F2970D18E9C7658EE425 alan852
1,666,235,116 *AF5315782133D72A4E453FC5AB970A5165F06D37 alessandroappianid\aragona
1,666,235,117 *AF5773B54A47C9522E4B9B7CF8DFF46A6ECED06A ALFONZO.MINERVINI
1,666,235,118 *AF5C8D5638E2717249F66EDB80D1B86C9D26D95C ALONSOCOMEAUY
1,666,235,119 *AF5DA1DA3BBC8E59C109EBDC5018B1EE40C73B49 alvabetzold
1,666,235,120 *AF5F009BFFAE9E20021E6418AAAB4DBE25DC4547 AMBERBEALS
1,666,235,121 *AF5AEA8AF8FED039D8EADC41D9CE496F49F4F614 aminuddinothman
1,666,235,122 *AF554E02E9D1A6E3DA0D6115C3CAE0F1F733565D [email protected]
1,666,235,123 *AF53C0ADD9E8A9EA0B42E4E881110E0B42E9AA18 amysammy0
1,666,235,124 *AF5E65999849A78EB1A600732A652527249FA943 andresarraga
1,666,235,125 *AF51AFB442824E6EC6BCB5EAB03E35DF8F041208 ANDYSLAM
1,666,235,126 *AF5869F6B9AC58F85008C53E51EAC27C1FCE5DF3 ANN13
1,666,235,127 *AF5EAC132E817A50EC2E5EE782925FBE7F7B2C9C ANTONIASFATCU
1,666,235,128 *AF51C4239520ECC1F0E863354CFBA807A82F06C2 [email protected]
1,666,235,129 *AF5551F1FD08FD68A8679DE837B289046A29788E A;QKT
1,666,235,130 *AF55C51861AD34F808E55DE0E5B9D78E12609904 ARÉQUES
1,666,235,131 *AF5E448249AB3ECFEB834B979A420CBE1F4B99D1 ARGUS'-RHAPSODY
1,666,235,132 *AF5FF9A43589EFB9558037CB93055822394D9F59 ARHB
1,666,235,133 *AF574ECF18B17B855441AD5087673C487721DACF ARON.KNOWLTON
1,666,235,134 *AF59EAC0630C77FACC7FFC892981696215CDC24E ARQSC
1,666,235,135 *AF554D8A8FA5364600B303A072148FB2154BFAD1 ARTIST(最佳新人)
1,666,235,136 *AF571FFBBA00BACE046F0CFC62944623B139FAF2 [email protected]
1,666,235,137 *AF528268186D0CA00B5A534F27141CC91020D7AE asdfjkl;samantha
1,666,235,138 *AF55392B948B42DDB075F310EE938EC22E8D5C62 ashandra5
1,666,235,139 *AF5C5268019A9A4EE9C0ECFAA56DCBC70DE65BDE [email protected]
1,666,235,140 *AF5B1D12214AA1F5B80A5708772BA8D6BF5BE2B4 ASWF9
1,666,235,141 *AF548A6A97B7D1A565105D2FA30622375D2F0729 auburn-&-ivory
1,666,235,142 *AF504276660C8D4746B0DE4C672415B7596F5250 AU/G
1,666,235,143 *AF5A7871EB562E4D555D84025EF44CA76EB1C042 AUU3P
1,666,235,144 *AF518CA82D5593CB4CA07CF9169F5582A263E1C8 [email protected]
1,666,235,145 *AF59BAE81967BC359781D670AD08266919A322CE ><*.*(B
1,666,235,146 *AF520CD1E8709C477634783CBE699AFC77BE66B5 b7ml;
1,666,235,147 *AF534B159AA4CF49DECF34E1E1712C9290A066CF B8G4D
1,666,235,148 *AF578A1C0F32D6CA82C7EC5DA2C8C6B784E7A2EF BAŠKIRĖ
1,666,235,149 *AF53BCD3108204034585791864A29A4A88B0582F BAS(V
1,666,235,150 *AF5255A5F10AADF6A002C922C34B1B109F6BCFFB be2+p
1,666,235,151 *AF5C77B4FA1B0F09742D1B72D0028B1B984B853B bekorten4
1,666,235,152 *AF5A6760FCB6B99AEC7F2D2F540A54818C1DB2FA [email protected]
1,666,235,153 *AF572E9C53AF403F471E62B24906D1F031D93D4A BHAIRAVI-MAHADEV
1,666,235,154 *AF59B86CA079C9A2AED8C32D14B6B2C9E907A67F Bi(7
1,666,235,155 *AF5A66CE78F3D8FDEFA7267EA30AA17C5A966AF8 BINESH-CHAND
1,666,235,156 *AF54DD29807696DCD14003A591ABC2C43206DBDB B;KFF
1,666,235,157 *AF5033C2841CA4DCF809CABA8C9409106AE63EFD [email protected]
1,666,235,158 *AF59859D9D7C39BB184ED6C12CC64208F47895BB B&MNE
1,666,235,159 *AF54788CEB8B4B428B1B834A01801AA39E4E4F66 BORN-AGAIN-ANARCHIST
1,666,235,160 *AF5A7BA1008BCA1331B6645A3B5C8C3DACA057D1 [email protected]@$TIN9$
1,666,235,161 *AF590C70255A01CFC4513652C57D6B311C9332BB BRANDEN.PERSING
1,666,235,162 *AF5DC71576AC8F1BDD46A69160E49C15715DE2E7 BRANDEN.PFLIGER
1,666,235,163 *AF50B7BDAB33CA484084C2F3A7244A1249B45EBA BRENTON.HOLVEY
1,666,235,164 *AF5C0B358491D0E9575A9680404AD4F701D45F6E BRIANA MAXIE
1,666,235,165 *AF5072763BCA7F1A8FBCDD8CC721A0877C4E1A9A BRICELEYJ
1,666,235,166 *AF536467420FB75C3FBA8610C62F236004409DFF BRM($
1,666,235,167 *AF54193576D15279129CD261EA5BA2880B8C0240 BRYONPUNG
1,666,235,168 *AF5442113D2AC79AB826A4238B5C6B799D0C3823 BSCLI
1,666,235,169 *AF5D74D524435FF197F49E7E1F3244066C750CC8 bs_pg
1,666,235,170 *AF527288B3DAEB2DE6342FFA48EE475E083CFB56 bt?#$
1,666,235,171 *AF57587B78006921FB6EA8A76EDB55E562C0AC06 btfgi
1,666,235,172 *AF5D67590A2FED513C762BD936120411E438C053 BUCKTRUCCO
1,666,235,173 *AF5B51ABA23D99D21B8142C9F538BF2C9E82FD90 budck
1,666,235,174 *AF57E374A3CE75B3B93DE0940A81F99252483371 BV,/W
1,666,235,175 *AF59B676B7A3919C456BA33082EDEACF4678DBC3 C9B%S
1,666,235,176 *AF5B4E9A81C00CE6B29BBF1DBE2ECC5D4188EF70 CAMPESINA-DOMINICANA
1,666,235,177 *AF57D59236FCBB80D6DED6CCE8EC3670DC598446 CARLOBELTER
1,666,235,178 *AF5FABC974141FA800BDC024AB5135B12937F978 carlohoschek
1,666,235,179 *AF5620A2B8B81B380D8BDD1649ED360F2E54639B carmelotao
1,666,235,180 *AF5D01908C0DE149C83154B80A914A01119EB7E4 CARTER.LOURDES
1,666,235,181 *AF586DB68FA0F7CC8205E66B5F0FB04C80A584B9 CATSKILLSEARCHCOM
1,666,235,182 *AF5E5FCA0B3C77F36100AEDCE9FFD182E8B8A60B CB8CM
1,666,235,183 *AF5CD668BE08EBFB83828F645A31B72080058CAA CHABIBULLIN
1,666,235,184 *AF5C7E732E0B51D5C6D9F783197021BFDD79A14D changtafoya
1,666,235,185 *AF5C6770969269A174EFFB861014FD1E65AECDB2 CHANG.ZITO
1,666,235,186 *AF5A0C43EAC5AAA3A7EEDB510AC4EFBB509F62A7 chantelle
1,666,235,187 *AF5620D78622D7D5C4EB0DCE633163A78A064593 [email protected]
1,666,235,188 *AF5215BF8CC8C65DB226D10B9EC703B36EBC246E CHR0M47ICISM
1,666,235,189 *AF5536384248A6AB6476F2AF144DE7069F9A9B86 CI%IO
1,666,235,190 *AF5F7CCC9C108D84FD8F90F2175A0F27C53D2E43 CjZB
1,666,235,191 *AF504D12232E299A2883CF5C539FD5687C30EF62 clerksuwell
1,666,235,192 *AF50ACAA2BAF5532375DCBB29F1075468CD403CD [email protected]
1,666,235,193 *AF5B003AF5AA0CF36BB9AD414E8BAF3BE7F50977 [email protected]
1,666,235,194 *AF56B46BA9460A2E11858B0E3A61EE83ACD1C395 C"LP6
1,666,235,195 *AF534B10956CFFA46F6063E92E2186EAF89F4D45 complots.d'enfants
1,666,235,196 *AF5FD84FE05F94159B735AB424B96E840EFA9DF6 COOPER320
1,666,235,197 *AF58454ECD993FEDF0199C736762355A2AF168FC CORDERRAJ
1,666,235,198 *AF5312E3193D9D324B0548B0A0295DFC134FFEBD cornbread,.part.1
1,666,235,199 *AF5C306EFAFAE84B34894323B4DCB8B68BF9617F CQ&GI
1,666,235,200 *AF5596BE7CBBA8A873578E97C9A032B117BC8FDA CRM#W
1,666,235,201 *AF5F596BC9BE28A46698CBB558F0C89050DF11CF [email protected]
1,666,235,202 *AF5177B8DC2676EFDC20FE015A39E194B8C73C6E [email protected]
1,666,235,203 *AF56FAD8BC3BED710010F165A30AC9A3C2EAB318 CV07
1,666,235,204 *AF58BACD09BBFB79163CC6504E75DE8FD492F3D8 CZ#EO
1,666,235,205 *AF5D570699D031F7FE25D991F7CDF02C67ACFF1B d2gcs
1,666,235,206 *AF547DF93E903E1D3E3A36866340433B591CC9FF D4C==
1,666,235,207 *AF581C6FADE07892ACE15358DBFB92AB68CC80AB DABTH
1,666,235,208 *AF58EB6AD4EA48F6CD4ED77BAD8FA283FEC45DC7 DALESAKAGUCHI
1,666,235,209 *AF53E6FC4EB081F718DF42E750B760A5641A27C3 dallaskreps
1,666,235,210 *AF5D08405ACF5DB15D4628050CF1B37A56F6E9F4 DALU
1,666,235,211 *AF556506D57803809CF45BF6CC161E9CEB726B0E DANILOMCPHAIL
1,666,235,212 *AF5FD9D918ECEBF201F054849C8F52AE542A91BA DARIO.YGLESIAS
1,666,235,213 *AF53AA77DBB6839E2385B392F42E330AEE21B835 darrickcohenour
1,666,235,214 *AF5DE245E24CD4E40791BEC1C4ED780B32CE1745 DARRICKMEESTER
1,666,235,215 *AF590DD9B14DF782A623C42099E677F593604E6E DARRONVARNELL
1,666,235,216 *AF56AD3EA4C4C24196A3ABEA95A4AE3815E714C6 date154546
1,666,235,217 *AF53EC0387C5729FC86A6C24F2FD2496937F12D9 david-horatio
1,666,235,218 *AF5D98183CE62EB554E87244B2BC9DEC3690D710 DAVISPRESNALL
1,666,235,219 *AF51D37C1ABF8011B3F3AB289133B59512A5CB22 db(2e
1,666,235,220 *AF5FDB3E12C90C4455D632259EAF3A9A95A1865D <DD><A HREF="#HDR54 3 14">54 SECURITY OF THE AUDIT </A>
1,666,235,221 *AF539C58DFE4BBC7508BE6136342563E9EB741EF deangeloweberg
1,666,235,222 *AF57E89A3CF76B0CA22950B3B9D74F1991F177FC DEBORAHMOSBY
1,666,235,223 *AF59B3F6CFE17D8A7B8BF5E8CC4B18BCE378D6C6 DECERNIEZ4
1,666,235,224 *AF51406A72E967EBB0116366D7D0FB9DC0CA7045 DE/?J
1,666,235,225 *AF58EEA700D84FE67DCDB34B613373537C73EF54 deonpadget
1,666,235,226 *AF51386C7A0B69255964167613A829FC904F5A40 DEPKMASTER
1,666,235,227 *AF5856DEF33643989846B13A67C7C5594B4BD775 dereku32
1,666,235,228 *AF5AC7D82DA1E3289918E6F777F2D8D7210C8789 DESIDILLAS
1,666,235,229 *AF5CC85CAEE49ECDA1855A6A4CE6F2A23E329F82 destinedtobedead
1,666,235,230 *AF5B2C63C10500C1713F6566F68C13667F12BDC6 dj"o+
1,666,235,231 *AF51A38F174155644F54CFE23729DABFEE7529CC DKMMQ
1,666,235,232 *AF516D0B7B18BBBA05C6A89F80CF17EDEB9A8AF0 DONALDGOLTRA
1,666,235,233 *AF582A0F73E7BF02F296560DB99583BAED5FAAF0 DONTE.SAVOIE
1,666,235,234 *AF51B0A37DEE936FB4BBAFFF8384C12AFA679691 dos.gris
1,666,235,235 *AF52A9D37BC74FA0105C85A75FEA1BCAA159963F dvrw(
1,666,235,236 *AF5D88716EF1CA62FDD61D10664C1CC8B3749555 dwayneaugle
1,666,235,237 *AF55A64EE3A515B0C5563E98E9646201968F1DAF dwaynechar
1,666,235,238 *AF5F639650A6CE8195B04B5A291BB2CFA414C53C dwej_
1,666,235,239 *AF591EDCB96EC279B8F0C7E5590EBBE87F93975B dzbon
1,666,235,240 *AF5D0604A5A765FBF9B19D4EB569A82D03239FF3 EARLEHIRSCHHORN
1,666,235,241 *AF51E35C06EA2441F2118E8852F965E6B79DB000 ebgv&
1,666,235,242 *AF529E699D9AE3416F03725A66285DB3EDA08AA1 EDUARDOFOULCARD
1,666,235,243 *AF593DF7D8BF63D6330BDA69D013ED20D4E4E983 edwinrigo
1,666,235,244 *AF5CBED697D67C1ACD8984297DCDCA1B1E1AE936 EFFABLE
1,666,235,245 *AF523B7D9ED4B2777B49B12D5734938E1C07675D ELIJAH.BEARE
1,666,235,246 *AF5D10AB56B6990E9729686E102CA6DCA43D151D ELKERULI3
1,666,235,247 *AF58EA949454DA24707745AA682A60D29F667579 ELLAELLA5
1,666,235,248 *AF581B2DDF0AAFECB3FC0C9FBFF6471E99B56FF4 ELOYSPINE
1,666,235,249 *AF5C1DD8F7120D6F8CEFA1B6028ABF4A21C454E4 elroyfelan
1,666,235,250 *AF571B43A23D6EE1CE47E29E306427AB1E344E90 emmy276
1,666,235,251 *AF5B7B6B1FD903AEC6B3418BE0610CE39311FBEB era-kanei
1,666,235,252 *AF5B393F6D79B9BB893AE45B6F9C2E6F5C43BF24 ERICKSESSOMS
1,666,235,253 *AF55946D368E50928B1972BFC1C6925A9B0CD2CE ERIC.THRONTON
1,666,235,254 *AF527CD98756C8F5E5CF0060E61CFAB7700CC39C ERIC VASIL
1,666,235,255 *AF5333939C3D3C952151B0A47B01BF80F23F91E6 ERINPERRON
1,666,235,256 *AF5AEB16DB2F7A60EF1597FFF3FF3D0A546402B2 ERMININGGED
1,666,235,257 *AF5A3CD093135BFEE211FACD0365A783FFFBC61D ERNIE.SCALLEY
1,666,235,258 *AF534CC440C944457161ED8876F4C6B4429C2032 EST1951
1,666,235,259 *AF54551DC99911F4D0AFCDBBCAA87977AEE73AEF etinasias
1,666,235,260 *AF522D77330B6D8450DA9A2C4C788FE2FF44F8FF etj&&
1,666,235,261 *AF5F2C6D3E3EC999B41B3BB67A98AE70CE450286 E_TK
1,666,235,262 *AF5F4AF8D148F0D03B9F69D10735AACA0622274B EVEKUZA
1,666,235,263 *AF512B515CD4DA99662FC57E24D3393BCBDAB3B8 exigeeses
1,666,235,264 *AF56086333A1B725504CE19E3345B2D710A4CCB3 [email protected]
1,666,235,265 *AF53ED5503148E4523DB4FF047D6227141772DDC ez\2get
1,666,235,266 *AF50760127240CE13F5D1E387D19BE40F841FCDF fadikarram
1,666,235,267 *AF5F9D0BE163470C3778D9C490585B0316916DBD [email protected]
1,666,235,268 *AF5226D6DE759BA46EA5E97FC0849E960C7E403A FANCINES7
1,666,235,269 *AF5C70FCAEAA768CFBDF5DF8EC7BC59945AF06C8 FORESTBREE
1,666,235,270 *AF5195E96C3C0487D44DAF640935446A42D2DCE3 FRANKJABIRO
1,666,235,271 *AF5C3D2B0010FF395C2FF5A847C5D0D5DAA140EA FRETOHOMOK
1,666,235,272 *AF580113E3F2592919AF5B67C5DEB6A2095414B1 fritzstrickler
1,666,235,273 *AF508ED417DD1ED9A139938D3F6C94346D5E19C6 FRONDIVOROUS8
1,666,235,274 *AF59E9CCA06621F7438C8590054D1CCE8A5C3CB8 GANGZTAENTZSTEAUA1
1,666,235,275 *AF5591C1631DC4D3387172F73DC5AC30AACE8B71 GENERUBLE
1,666,235,276 *AF516DF5D7439345281FFA73CC5B8911DFE81191 GEOKLEINS
1,666,235,277 *AF51B1FA724500009FC5BE7BD1C005BD67475187 girlieracing04
1,666,235,278 *AF5976F3089DD4CCEB25A63AD9759E89387594F0 GoforItLive
1,666,235,279 *AF54A5A4D48FF6F15ABA1E2E4F52C7AF254753BD goingtobeanotherPaulaJonesandhedidn'treallyneed
1,666,235,280 *AF5EF782ED315012FBB9691FD9F331C05F0E1ADA [email protected]
1,666,235,281 *AF54858C7B56C92E0BAF9AF074889B3AFD527C0E GROEPSSPELLETJESES
1,666,235,282 *AF515B7A31078394E78295BD1F1474944675E1CF GULNEVERE1
1,666,235,283 *AF520AF909A83426B87905545FA9D128548B7E64 GULPIESTS
1,666,235,284 *AF58671CE53E10F5BD4E7B639BEBA4D80B5275E6 GUYSAMIA
1,666,235,285 *AF5460D23064F12A812A4619664E3E5448536F2B GYANA
1,666,235,286 *AF5D401C0638A1EA02997D4FDCCD538E52065554 HALBSCHWERGEWICHT
1,666,235,287 *AF5C78F620BE47A7301F39717282EB6752677263 [email protected]
1,666,235,288 *AF59CEB5A95B78738CA3398D3686832045802CBB HARLEYPLEASENT
1,666,235,289 *AF5F1ADD7549B159B79F6DE4DE712A76798DC678 HAYDIEW
1,666,235,290 *AF5C462845DE3B161C2607912A8A093FE24F006E [email protected]
1,666,235,291 *AF53DB679ABABC8176C2B12E1B7D0EC9E93CECA6 hedijouini
1,666,235,292 *AF59FBB7734E15C6EAEFA01D022B8B8044482586 H-%F
1,666,235,293 *AF583C7CDBDF3D925A07A36ECDBE68875768F136 [email protected]
1,666,235,294 *AF55A73ED23CC4B3FF19869C111CCB74EFA1B121 htatirah5
1,666,235,295 *AF531B6AC49D258F23073B3D990531B99DEA4E62 [email protected]
1,666,235,296 *AF5744842B97652422931FD8C1159519AF14B65A hugoguzewicz
1,666,235,297 *AF54746D48F8A6526632B6D6AECF36C97973CD8E HURQUALI2
1,666,235,298 *AF5FC913D5C61639F6124D8BB1FB621042608B35 IAMURUST3
1,666,235,299 *AF56E6D27B3DBA0A78DF7476242D3D5CDA7AFC31 IAREVUAS6
1,666,235,300 *AF5674FDE55F5B943FAD54304BE5AAC590393008 [email protected]
1,666,235,301 *AF54184391FB8E0E4CDE426973788B8A935F5CC6 icerceam14
1,666,235,302 *AF58E1FAF0F80F706A115960424A22BB6E9F0ABD IHATEANDILOVE:IVMYWOMANSAYSSHEWILLBENOONE'S
1,666,235,303 *AF5B56DF88A8064F287A338E19E9C228F6A04D7E ijustmissedyou
1,666,235,304 *AF57CFF3DBF5FAF01683931AEBDBEE8D05A7D793 IMPALACAMERA
1,666,235,305 *AF593F7914ECCBC85F3C7C247AE81424E334D3EF INERDISU
1,666,235,306 *AF5FE0B4A7C8028C7CBE4FB2976080FB82603C0A [email protected]
1,666,235,307 *AF5BA448E95E8A16ADAAFD16D6964A2904C29014 INGERAKI
1,666,235,308 *AF5AF034CC24847A0F5D220A85528052459E6D60 it'ssoperfect
1,666,235,309 *AF5854F2D09443C72BB334C23F9AFBA9C394C2C9 IVORYVENDRICK
1,666,235,310 *AF55BC7CD29F564245A9065A1112432ACECF7DB7 J155707
1,666,235,311 *AF5E8BCA90E5C61D26392F9609BD38243360EA5D jacob.jakes
1,666,235,312 *AF5C7C736A76B8E763315AC22FC93969F73AF782 jameystrejcek
1,666,235,313 *AF52EBCACE634971E800EB62ACBB3C7AD048C803 [email protected]
1,666,235,314 *AF504250E986A636C4668BFEA55B71125C7D30FD JARRETTKEWANWYTEWA
1,666,235,315 *AF5B06136EC8265711F9D269BDC9A916F282C92F JARRETT.ROSEMORE
1,666,235,316 *AF5148709D1D327781768AA858864E32BAF0A776 JARRODBARGES
1,666,235,317 *AF58A6D56CFE43F2BA88B25CFC34D84FF56E4922 JAWUJO
1,666,235,318 *AF5D6061075F68DFE777D242D7841612623DA8BF JEAN.TUBBY
1,666,235,319 *AF55C734233EDCE83D213E50D459B3863DAE8EFC JEFFRYNORTHEY
1,666,235,320 *AF5C6B31D5C878E8DCECCB3889C68685B54D3BEA je.joue.dans.un.club.(p172173).(3)
1,666,235,321 *AF58B086FF40A28531BCA19AB03CDB4AD6F68478 JEMIMA..JH.EH0.M.IY1.M.AH0
1,666,235,322 *AF51C960837C1CCCC2ED8AAA1B72C18D6C9B1458 [email protected]
1,666,235,323 *AF51191474D2F3947FF43897BFD5AE966A1F689D JEREMY.ENGSTRAND
1,666,235,324 *AF52B02A574D70A7328CF9910B9239ED48613BAE jesus.you're.the.one
1,666,235,325 *AF514FF076F17FF50A3814A2BB71EB98B0E93C10 j*k(
1,666,235,326 *AF586505067CE6FDC2FDCF417F149C4DD1D17DFE joelstalnaker
1,666,235,327 *AF58C01EDCC003041BBC19CD576D557EE9AA9BA6 JOHNATHAN.KOTEK
1,666,235,328 *AF5B57DC0F3A76709EC6BA4D82DF321B14129AC4 johnathonhardaker
1,666,235,329 *AF578990D5096966A4478224EFDF39FAAFE452CF JOHNIE.FEWELL
1,666,235,330 *AF506C7AC864E7041289B93118AA0AE53A761D7A JOHNMOREY
1,666,235,331 *AF5E61A88D25EBAAB0020D77663BB892385170C6 JONELPHICK
1,666,235,332 *AF565FB1658168B519E700BF72B7D05560ED8E91 JP:(NSHOKUTOEMDCOJP:21016096162),JAPAN
1,666,235,333 *AF522FFAA6055675663670C9FE674B8827004772 JTHOUN
1,666,235,334 *AF5A22B8AC92E996FBB923B4F34A6B3FCEE2FC51 juarez2794
1,666,235,335 *AF5D7C40B8CEBB1F546D0BD4C0B31DB35683A583 K4LLHOFF
1,666,235,336 *AF5A38B7597B182DF1FD955F529871B314005E62 kadizgorim
1,666,235,337 *AF5436071BB92B3853A584F90645F90EE5FA59B2 KAHLITSEVAT
1,666,235,338 *AF592F55EC30BBD7EA57686BCD13B1D90F21CEA4 karmacandy
1,666,235,339 *AF56322618DEDEDF45C2E2A401C0ADD46C1678CF KATIELEE4
1,666,235,340 *AF54F769BB34AAE1C63AEF46E898719F15CD0BDB KERTOIKO
1,666,235,341 *AF5041B7BE9800BF8E7A75ADE2582F27A5E56AE5 KIETH.WAFFLE
1,666,235,342 *AF5483455009C6C65D553C485BFF9F1B7DC554E2 KIK3LIA
1,666,235,343 *AF54333D6D93697A1335E293A69A4E1863E5D961 KINDERCHOR DES PIONIERPALASTES "WALTER ULBRICHT" DRESDEN
1,666,235,344 *AF53B450B90B76037394D473B04CC9323F784121 kingume0
1,666,235,345 *AF58D7FFE32A1041060EA796E00F495511139D3C KOLBECHER
1,666,235,346 *AF5F6A331E5925F83FAA0E171D8A5A8FD6CC1266 KOLLSTADCOMWWW
1,666,235,347 *AF5704198149A19CF119D33FD0E7EA6E9B0BE625 [email protected]
1,666,235,348 *AF5485E1BEEB1041AC1A2C1F590093B1FD048F9E KÖNSORGAN
1,666,235,349 *AF51E72636189BE7A5A1B90EAA432AF2A725DF19 KRISHAWNED
1,666,235,350 *AF51398C98E225C7ED183F1B33A53E9289481291 kristopherkarz
1,666,235,351 *AF538DC4359396BAFC98404B075935A64A3945CE krito daash
1,666,235,352 *AF5674E6EB2EB37D22FB5B218F95775A559C8815 K.XN
1,666,235,353 *AF5522BE06963069B6D3BDF1EB46CB4AB7FE56E4 [email protected]
1,666,235,354 *AF56958C1305F5FCF54325CB86785D64691384AE LANDONCELLUCCI
1,666,235,355 *AF5B6201D9BDDB926274C692BCA606FE3BC149F6 lanilanz11
1,666,235,356 *AF5553E2FE72B263FFC806FE1B68A6FAFC26157B laschamas
1,666,235,357 *AF59E71A433E21DFAF6532C61B0F9AA478860F0A lawerencegranier
1,666,235,358 *AF54B1A545061C34957DD52C0BF810D6836E65BB LEE.BATEMAN
1,666,235,359 *AF5C367742185693E079D8E711127C83086CF8F1 [email protected]
1,666,235,360 *AF56D405BD18644F2E67526D63FD0E8680CD1060 LEIF.NEUBIG
1,666,235,361 *AF53C3B05FE71AEE413A8C9B2E79E27D8EAFC4E9 LEIGHLEBOUF
1,666,235,362 *AF510CB5900EEBE2945E8FB8B55B8094DF662B77 LEOTARDO8
1,666,235,363 *AF5C38877A80F4D846A99B4F175B781702A3A5C6 LFEBRUAY
1,666,235,364 *AF56084CEC8F3C13B140D4830D90B61C0490D1AD LIBAMENT3
1,666,235,365 *AF513D0249182F1181422BDBDA5B33869BEE2410 limodio1
1,666,235,366 *AF577B521F5BF290F72CA2A2AAAA7E8C4201DFF2 [email protected]
1,666,235,367 *AF5E1D67855D662225FCF0483F9E20DC45E1F919 LI-WAI-MAN
1,666,235,368 *AF500DD8FEDA6166E8F22577F0002C49EA9D1604 LI.WAI.MAN
1,666,235,369 *AF55CBB461384FAD3F0887B7E0C4B8A2FEB357DA LOCALIDADES.DE.YUK
1,666,235,370 *AF52DA8B0E9FA734E73DD3BCF0B25D9E1732F6FF LONGLEDERHOS
1,666,235,371 *AF594A2EFAE5D28B50B68E4FF33F577812447DBB LONNIEMILSTEAD
1,666,235,372 *AF5E6D784496CCA5235BDB41DF12C7A27FEBF8A8 LÓPEZ.XAVIER
1,666,235,373 *AF5B9FDEE48186CC271F8661C894A1BF02BA4472 L-T/
1,666,235,374 *AF5C074E644B2EB190BB68A64628CCC78DBBDEE2 LT%[
1,666,235,375 *AF58F07F395E45740EEDF5217B792E72800411D2 LUKEBENT
1,666,235,376 *AF5209B86F2E64657E233718A01242F9257128CB lukejocoy
1,666,235,377 *AF5343BDD5F4D15243E3EBF7259F33FC2A78C544 [email protected]
1,666,235,378 *AF5FCA92396E62FC162FD64EC8BC4717E4799818 LUSTILA4
1,666,235,379 *AF51E54663007ACAD156AD63EF8C4963AFB94245 [email protected]
1,666,235,380 *AF5157140CAFA34C31276B81FA9E338FC5A4957A machitosh
1,666,235,381 *AF5A9C39DD038522F61271E1BD184BE2087CA116 MADNARG2
1,666,235,382 *AF5055AF1F08797E488E614BD2CE304297CAEC5B MARCELOKURSHUK
1,666,235,383 *AF5C068B07A3206D86A865E96E9ED1A402832FBB MARCH-OF-THE-BOB-CATS
1,666,235,384 *AF5580289A8BAD9A6FA16CE1B1C2062CC53F4600 MARIEPELZER
1,666,235,385 *AF5C9E76F728B84BBBFDA812DDB416D3B87F0B3A MARLENE-THORPE
1,666,235,386 *AF5B47BE5D347AE95320542181CDCF8CBC8B6D5C MARMOARTECULTURA
1,666,235,387 *AF51E4AED8C509694BF23C000C73ABB22C3B5DDE MARTINI TALK
1,666,235,388 *AF59701964C8F6098D368531E04E15CFD99929FE martinmitman
1,666,235,389 *AF55A611F232D2F7A759B59844D42C3216F342C6 martycapriccioso
1,666,235,390 *AF535E8B109334097C63271DD863AF7B6D3BC5E8 marvin-meets-banda-do-sul
1,666,235,391 *AF5BC43CF4B2F85AF2CF70B3445AED4B9604599E MARZIYEHB
1,666,235,392 *AF5B1B4AE04EDDEB7BFBEA3C0205442F3C8CCB0D MARZYREZAEE
1,666,235,393 *AF53D78D20DD8453FA1D171073DA1457C5EAFBE1 MATHEW.MCCANE
1,666,235,394 *AF5DEEDCDEF38741CB585F3EBA077A57EF51F076 mattgey
1,666,235,395 *AF5C44F6B8FE64AD84AACB697BABBBDD6B5E7FDD MATTHEWHUPF
1,666,235,396 *AF5103433CBE7FBE0F130342F423C6BB8BEF2B21 me+allurg1$+$
1,666,235,397 *AF5C283149226B07E3F13C0B49BED44DD8F7A321 MELANIECURNOW
1,666,235,398 *AF53CB6DF32048E9C7AA5F1357A6BC33743EA85A melvinnyseth
1,666,235,399 *AF5798E8710E337BB6EABD2C85C0D1460A16AEEC MERRILLGARRAWAY
1,666,235,400 *AF5788B8269561907E59C40F00BC5CDC1A239F57 MESNILOISE
1,666,235,401 *AF50DA61495AC138BB4EFC4F327A219331D2187B michalspadlin
1,666,235,402 *AF56F9C31A91CAACF431C3869247B190F6E972BC michellesmithurioste
1,666,235,403 *AF564B8E1CC066160BB01C5DF3BF74FBAABC212D MILO.FITZGERALD
1,666,235,404 *AF5708242D2448DFF400FCD0FBEEF3889CF52803 MKAHITHER
1,666,235,405 *AF54B1F33169FA770A153C90B344C0A978B89D1D [email protected]
1,666,235,406 *AF52A50305F9D280C444EFAD1FE80DF63D985CBB mnkiw
1,666,235,407 *AF5912C762BC9753F394AFCC879419B165358C37 mondomala
1,666,235,408 *AF5DFF7C25F1596D7339C1D7C70C56EAFC7FFA10 morgan-notesftphostnet
1,666,235,409 *AF55F30619DC3E785C69A9E8C7B7E20FCC3712E9 MOSHE.MCCALANAHAN
1,666,235,410 *AF53DE72F2C3F1965BB6AFD9925C86CE1B650DF3 MOTUIN
1,666,235,411 *AF5500BD4381734148D1F2E511CFA7AF80E83196 MST(
1,666,235,412 *AF5544712EE4F56DBCF04C5203573C5A3A7FD4F9 murtaza-sabir
1,666,235,413 *AF514BDBBCD8AEA9890D05FA74202DBE09CBBF6A MÜZAK
1,666,235,414 *AF58B147B75CB56343D9130DEA4CC386E6929968 MYKITTYCAT28
1,666,235,415 *AF5826385E759110E2E6DC106E3044F082D9E0D3 NICKELODEON.TV
1,666,235,416 *AF501B0B37BBF8A8F3E8F92E4B19183C605B05AB NICK SCASSERA
1,666,235,417 *AF56797C62C2C7A99EE74BB1B62C77526866FA8D NINETY-NINE-AND-ONE-HALF
1,666,235,418 *AF5BB02992A81F1AC0EDC9A8F55BA47102016671 nobodylovesyouwhenyou'redownandout
1,666,235,419 *AF5E91FB1E81515BF51DC630F2413BBD68AB83C2 NORTHERN-RHODESIA
1,666,235,420 *AF530DA1D6C3BFF1FF3DDC289974D6BF1EA37B1F )O(-~`-~`@-----B
1,666,235,421 *AF51AD5FE16288BC515A6188F70FE014F7EBA75E ODISDOSSIE
1,666,235,422 *AF5AFFC6196DD2C0114325906B542B8DB30570FE oefeningetjes!
1,666,235,423 *AF5462354A40698F445552836C45D126952D0304 OLLEERDNA1
1,666,235,424 *AF5377A334F8CF6497DDC2DECF2D5537F07DC88E ONE LA
1,666,235,425 *AF5B9DD47752914ED7221276C690438D87B6D1BD ov3rc4p+41z3s
1,666,235,426 *AF52043907DC9705DCCA4402EE00A46F1BFC3DD4 [email protected]
1,666,235,427 *AF591794AAFD38F7F1356FAD15DB094F8D27BE72 [email protected]
1,666,235,428 *AF5D8C5BB6772A677ECCDACC22C4B684A89ED7F9 PASQUALE.HEON
1,666,235,429 *AF5310AA49C4245A6A42776A47915FBBE85B729A PATRICIASCHROADER
1,666,235,430 *AF542794BBF1D7923519F809778682757837C400 PAVANALACHRYMAE,D51(HARPSICHORD:GLENWILSON)
1,666,235,431 *AF53DADF99FAA8ECD696712B53214A8DBA60856D p====b* *(00)
1,666,235,432 *AF5F36366D2CA9DF56A1CC9B2FD863A1A3D0E4B2 P-----B~0-~O-SPLAT!
1,666,235,433 *AF5C0738BECC5EFF7D83B34D855D5D8ACA5880F7 PEGGY CRIM
1,666,235,434 *AF5E0E2CF60993FB45B7473D57791F9212A8C5DC PERÄVAUN
1,666,235,435 *AF5E63203C45A3514CE32213B2B1F87B430E8663 PʁIAM
1,666,235,436 *AF5ADBF05812D07A62012BE3DAEC6A4873681888 PIGEONRY3
1,666,235,437 *AF51CEA77AF89609F3114A418322A5494BCDAE61 pocket.symphony
1,666,235,438 *AF5105D504304923ACFC65AB2790B6E1AFC20130 p{{ryn|it{
1,666,235,439 *AF58B118CA0737CCDFEFBF985AC1B757D5E0D670 Q----D.~OSPLAT!
1,666,235,440 *AF5C2B90E1CE546E6D0DD5624C728237EAE522D7 QLESORT
1,666,235,441 *AF599892B8A13AE06459C93335D4181A0DDBB6C9 q#####>~o-~o(>-<)
1,666,235,442 *AF55DE19866C7EC256023A5E6DA8B9D7DE6185CC Q=>-~O-SPLAT
1,666,235,443 *AF583598ED9B4266CB93065BF27DAED9B39569AC QUINTONKOREY
1,666,235,444 *AF5BB4C5D0124C517515F6F841DAA23295F97392 RAADHAMED
1,666,235,445 *AF5E1F224401F46DA802D87408DDD0692EFA0572 RAMIROULSES
1,666,235,446 *AF5A0458DEB1BD4FA92EB49D78FAB65F6ECB91D8 RAPHAELJACINTO
1,666,235,447 *AF555303F556870DB7B478E9328840740862806D RAYOLMO
1,666,235,448 *AF5C5571CAB1A6A0A8B6693092CA03DB9B9A5930 RDI MIEG
1,666,235,449 *AF564E287932FD8685983FC40C5BAE6DBBD37C19 REACHELLEV
1,666,235,450 *AF5A2FD921449DF5A70BA753C861818FFC6BDB36 READMESING
1,666,235,451 *AF5C6EB7FB8D29E6115DFDE04533CE315BE560E1 redpurple
1,666,235,452 *AF50CBB9F20B4ACDDAC462CEFEC4E44AF5667C0E reham-arafa
1,666,235,453 *AF5EAC7AE42BABA48ABF4F16914697823BDE4713 REJECTED-(LIQUID-CHILD-REMIX)
1,666,235,454 *AF5BDDA18133F87629C52EB9CDA330A6C2BD640B RESILARENIMED
1,666,235,455 *AF503210A61C31659EE292EA299E612F5E77D566 RHYTHM AND BLUES WORLD SERVICE
1,666,235,456 *AF5562FEBD372C41266A5D77D5153A23429A045B richieralls
1,666,235,457 *AF5BD63F950644CDF609E2040A132F0C4BFE2A48 risulter
1,666,235,458 *AF5BEDA51C4842D6B9B1C70E2079CD025BBDFDCF RKYOOEF7
1,666,235,459 *AF528FA15DA2DA32E4C744D4C919E7DFACEB6D28 RODHONEYCUTT
1,666,235,460 *AF5B6CDFF1DE954E2360F567DC668543993D6C4B RODRIGUEZ3381
1,666,235,461 *AF5336B14D72FB5FDED88A4D53524C941521C3A5 ROMANREZAK
1,666,235,462 *AF5EA3E41E513BC22E7DB8DEA46194D5B3C949EB ROMEOJOHNSTON
1,666,235,463 *AF5E39BB01CF03BFDC371881CCB8A8BFDCECD799 RONNY.PESENTI
1,666,235,464 *AF5BE320A3984A47B8F8B1122CCC6C78D51C71E4 ROSENDO.PUGLIARES
1,666,235,465 *AF5BD5350F6B6034353992E1EF013FFD97A8F1F8 [email protected]
1,666,235,466 *AF5A303C64F2C156B1ADFDB4AB54290A84E6BE04 ROYAL.LIST
1,666,235,467 *AF504559B3A6CAFA41FEF3F9524ED43E9BC3433D roycelazalde
1,666,235,468 *AF5EB520D34644448ACB38D8735D987CD8030093 rubinjanovich
1,666,235,469 *AF5365B87E6169DBFAB994E01B303F8B383F0594 RUDYCHRISTENSEN
1,666,235,470 *AF5816030AB1E61F59C00B4B678CEBF9B3D333E0 RUTEDIAGRAMS4
1,666,235,471 *AF532FCD0DA8AE04433FBBDEB130A3DCE3AD6B98 SA
1,666,235,472 *AF5BB5D30ABB427BC02A7F47F81C352D6922DDD2 safiuddin-hussaini
1,666,235,473 *AF509B813281FF579A6691722F3147D4CB79014D SAIFULLONG
1,666,235,474 *AF5FEC6DE1EEB18AE2EC97E564DBC38A81CFE7C4 [email protected]
1,666,235,475 *AF56A3123564CFD6C35B7F3BBF845D42C59578D3 SAM.SEBASTION
1,666,235,476 *AF5D94D23ABA84B3580AEC18107045789D356AD3 ”SANDYLANE
1,666,235,477 *AF5BC67BFC3335C151850CEBA0AF3D1774DEE3E5 SANTO.MAS
1,666,235,478 *AF57CD16A48AB8BAA60A6459F36FAD3E45436ED9 sanvittoremoesanoc
1,666,235,479 *AF50F58FA68443CC97EEFD3FEF4D1E3D35D4236B «SARPSBORG»
1,666,235,480 *AF55C11B1F4AD3632E2954FB681CB84A888B04ED SCITILISNOT
1,666,235,481 *AF5C023F873E431DBD424E5C4F1F9216BB780BF3 sebastiantewmey
1,666,235,482 *AF592BA2513A37CE763F64BA781E757CAD5C75BA SECURITYDENVER0
1,666,235,483 *AF5298D46A21B432ED3FC7E83B02EDE6CF3F25BC SEISORS
1,666,235,484 *AF5B8AAAC61B1F4A1A4EBCC5BB910ED8AA19BDB4 SHAHAD.TURKISTANI
1,666,235,485 *AF53763EFC539F1B98E733854473A06D30F4D09F SHAMMOCKY9
1,666,235,486 *AF545D792851E09FC5CBB90CDB090A150B03F6CA SHERENAHMAD
1,666,235,487 *AF5F77085EF3724F8FB5273C0CB76F6799587120 [email protected]
1,666,235,488 *AF50EDDC9EF3D6695CC6EB07239B922B9A5A96D3 SISAIHTNIMLEH8
1,666,235,489 *AF52F5A517E568713E209FE17109927B8549109B šjy
1,666,235,490 *AF52EC21A0F9BA38BB7FD335655BC62EAE9F382A slikgronden5
1,666,235,491 *AF59267DAEBD1B23DBB8C49DB5410D241C836DA6 SNEILAYPORTNE
1,666,235,492 *AF56B2F7FEB1BB251674C6A3ABAF0DEDE6F68EB4 someone2love
1,666,235,493 *AF5870D44D92F7852D277075BF2874C9015653EA SOUNGN
1,666,235,494 *AF5237B5E0EEAC285D967639F737A64DBC0F1042 SPARPAGLIA?
1,666,235,495 *AF539AFDD83B920D11790FB7AE74F9463274122E Splat * * d===3
1,666,235,496 *AF50DBF1D85A142D6AA9A9E600BDBFC22691DEBC stalbeests
1,666,235,497 *AF5AE712AB53159230D5FD2A8D726F605AD11827 STEVEWIERZCHOWSKI
1,666,235,498 *AF516FE191A09A496CD534589070F575AA6052C6 SUNG.KURNIK
1,666,235,499 *AF5EA2EDDE367364FC21BCBCBE274CC29DDEB0C8 SUPERPOPULATEDLIES9
1,666,235,500 *AF5E4559E9F285B2457EFC1F3EAED18F466EBCC8 SUYAŚAS
1,666,235,501 *AF520CFD00C77A8DC2C7A21C2574EA552082C6F5 SWEETDAWNMYTRUELOVE
1,666,235,502 *AF533920604D0AAC5B22FCF9197FB750476702B7 TABBDOED
1,666,235,503 *AF59BD38DDBAFE14B5F3EB3D3A0481A9B960967A tavoriti
1,666,235,504 *AF5E70B09D983CD34FC410CA1D634DE80FEAA8DF TERESITA TE
1,666,235,505 *AF5D0FBA6EFB237894539BE8EA3B31311760291A terranceallevato
1,666,235,506 *AF572788B6935FFF0624807206CEAFE947486E88 terri.j.smith
1,666,235,507 *AF5D5B3B35B627172E64062B34DE448DE3BC930F THADDEUS.MICKELSON
1,666,235,508 *AF5C09E4F7D2BF911A0431142D7CD9E718E30838 thanhlewinski
1,666,235,509 *AF5B5E72A7E3768B18C69C93643A8F005B2DD4B3 thatstumpy53
1,666,235,510 *AF503C32349F9C22955BB01CACAC517C0A20D538 THEJU.GOWDA
1,666,235,511 *AF57EA9CB9E271FF2A799ECB742500007E115F47 The-Man
1,666,235,512 *AF5673002F1B5431FDCB86F016DAC6DB1CB1D2D7 thesearefusesnoriver
1,666,235,513 *AF5C474355026B3754FEBC5CEBFDE26B928E215A timaeusn8
1,666,235,514 *AF51A68EAF79CC8E5B1432420BAFC07161738864 TINMANCRAWFORD1
1,666,235,515 *AF54BD470E001C286EA322DF5C6706AB542BA18E [email protected]
1,666,235,516 *AF519B0C82A018B2643AF2192BDFDB94F701EB4C [email protected]
1,666,235,517 *AF57C560621AEA3B597FFCF71EFDBB1C8C2F4808 TOBYBERNIING
1,666,235,518 *AF55847A81DE5B54B19362CD7FDC85FE39994679 TOILETNATOR
1,666,235,519 *AF5C557CF7D7D3D10CAD4E2A8BDA3F1D3AA890FD [email protected]
1,666,235,520 *AF5BE87D81697E6D9A9C933F667711A0F3589BEC transpn1
1,666,235,521 *AF544586D66463C5C3A5DFDEB20CB47860F7D0B2 TREEPICITRAP
1,666,235,522 *AF5C14E8CB9ACD45E55BF29E5AA10DBBA0655705 TRIMOSTJE
1,666,235,523 *AF5DEC3314A94E06F627F4B39F5FF4D30999DC3A TROY.CUBBAGE
1,666,235,524 *AF5DB530D6F6D251507A2CE97D941753EBEFCAC1 truckdouglas
1,666,235,525 *AF588D32DBDF8BC95ECEBF0B1A4615ED3A9DA2A5 tsengeldivine
1,666,235,526 *AF5D73B5A5AC004B7B3EB9251D988E2C9D78CBCC TUBERCULINIZED!
1,666,235,527 *AF528594FA98DBB9297874BB38A3498493ECAD92 TUTORIALZINE
1,666,235,528 *AF5171593175D03498BDED6DF76408E2E3FF5DEB TUUBAAKYUZ
1,666,235,529 *AF50126630F0DE042C3E022C07CEDC1FFF5CBC87 U117515
1,666,235,530 *AF5A96FC5C26D9CC3528AA39E9BE3FF2682C6EC7 uddmanni
1,666,235,531 *AF50C8BC33CE47C317C6D284863AF913041FAF8D ulstercountypress
1,666,235,532 *AF5B472A6994709A8A50B54170961B6300929CB8 umayyads610750
1,666,235,533 *AF5E64CE0FAE6940B4689E1AF0BC103BB72BE58D unanu
1,666,235,534 *AF5CB07186BD8ED036AF93EB0281DDF222708FD1 URSALA BRANNON
1,666,235,535 *AF502945FC00158F583B47D20E2A37102769B5E9 USERALEGOO
1,666,235,536 *AF562A4D64300304E83D31A0FF94748AF439533D u*y|
1,666,235,537 *AF5B71E1192FB2B46BE00E7D1528F47F11465F07 VAIHTOONMEE
1,666,235,538 *AF5780B2D25ED29A67DA9DFA69B391C93914F03C vannettli
1,666,235,539 *AF559C21C9F768192AEFB3334DBE9CA9A10E59DD VARVARA UROVA
1,666,235,540 *AF552B18ACD6752D7A44DDFCE9E422CE367F3469 vasiliy-pimenov
1,666,235,541 *AF5BE4832E8E054F57696D42DDC0D83FFBE5C08D [email protected]
1,666,235,542 *AF5F55B7E4F0615D41DFB91686DA7192DB0616B8 VERESA-JONES
1,666,235,543 *AF5E23EB7B23FBFB1187AC9B53137D2127E143C4 VERTIEFTBSW
1,666,235,544 *AF564800707580005F9DD782E78CD58F858F7F76 VIERGANGSCHALTGETRIEBE
1,666,235,545 *AF549B9A6DC06866E17CDFD6F72F963870782EB4 vincenzoarlen
1,666,235,546 *AF58A1F76F8B2D3C2A0B47C2C47FC7FFEB3265C9 [email protected]
1,666,235,547 *AF517BE36AF257E061DD9669EE00C57FD06E6973 virgilio-herradura
1,666,235,548 *AF5CF3CE22459DBF2906E9E8726C44AC4B8A2606 vishva-visva
1,666,235,549 *AF51FFC6B11358F4BFD21E1E96ACF4526E358685 VNP"
1,666,235,550 *AF542E69C16E022183E9B72C7E994500FF82E2BE W0B5T
1,666,235,551 *AF51D3C67C321408205671BA22E9E0AF29E2BAA3 wade.mouer
1,666,235,552 *AF546CE0A0197B8D08A2CF40A4B162676CEDF061 wangwentian
1,666,235,553 *AF5B7A3B31BB9EF6994B5F8DC1C0B35BAC93C67F WARBULLETINDECEMBER
1,666,235,554 *AF5E8F08B000EE78403DDB098A3327D9A40BC861 WDS(
1,666,235,555 *AF57BF5FDD10EF9E8D060493632DA838A482B947 weekfive
1,666,235,556 *AF5F0ADACF15AE9179490A05F177AC46036508D6 [email protected]
1,666,235,557 *AF58FCE241F452CEA919AA187AA065DB2D3BEED8 [email protected]
1,666,235,558 *AF5C127D5B48F79B50A6C471C773A709A5B98D2C WESTON.HUGHE
1,666,235,559 *AF5ADD4F1D8F3F70546AD37CBE85ECEA04675B29 Which-Way-to-Forever-(Cyborg-Lounge-mix)
1,666,235,560 *AF5A0702A7A19C91790ED7BA61FD48933D479C76 WHOOMPH!(THEREITIS)
1,666,235,561 *AF516333A61B009F050AFECEE6690172AB29325D WICKENHE3
1,666,235,562 *AF5AA4FCDE3594EED4E7CB181B1394426BA5D0AC WILLEMIJNKOERT
1,666,235,563 *AF5F59BBEBFB9ECA046541D6F010B421F46ED353 WILLIAMSSCADLOCK
1,666,235,564 *AF59149B0A099A1CDFC7E15534B3F2A6803EB1A7 WILLIANRUSNAK
1,666,235,565 *AF57F4B1C87393185D8CC99EC10DEE1120147AF5 WILLIEDOCKWILLER
1,666,235,566 *AF5A587D1C345E354FF379DF9423E5E03B2A8E32 winstonbeatley
1,666,235,567 *AF5E3B32C1C0BE1C09461D0CE868391314BE084C WLEDON
1,666,235,568 *AF5F8CA3115F74C6ED65A89C322871A51F9E78D3 wmciuffreda
1,666,235,569 *AF523D20854629CF02283945267F0074C42E1DF6 WOODROW.MCCLOUDY
1,666,235,570 *AF528A63E9E05F4AB8DAB002CEA0EF56954E8882 wow-guidescouk
1,666,235,571 *AF5455AD4BE778FB8019A0A178FC3EF59B181180 wsbskcas
1,666,235,572 *AF5A12D99605B3C0DFEBBDC70AA5286A550BE4DE XUZHANMI
1,666,235,573 *AF584010BF2F2DACC4489ED715E1015BAD98A00E yongburbach
1,666,235,574 *AF53AF049BD23CB239A06B55481C15C7476D9B9B you don't understand you really need to
1,666,235,575 *AF583662175E30CACD01229C42E772FFD35138D1 ZACHARIAH367
1,666,235,576 *AF5DBDD7F30E007C8B4DC83EE9E691C406B9AFC4 ZACHARY.MASCHMEYER
1,666,235,577 *AF5DC4D27C7527C173FF5FF8A0141B7A1688375C ZACHBORING
1,666,235,578 *AF5B33587D8586958F8CF37701FBE295D223650C ZACKSHUWAILY
1,666,235,579 *AF588F4AFCAA98F1C240A46A8713ED1CCD88020A ZEE.BLUES
1,666,235,580 *AF5D5512FED0EDFAB3F96AEF18A070C0656D3DBF zentralratderjuden
1,666,235,581 *AF5DE4FE33B5FA0F60DF77BF110B1321EAA66E77 [email protected]
1,666,235,582 *AF5EF4C5B6BE2153D8FFB8530FB99C9F2F6A1004 [email protected]
1,666,235,583 *AF50ED4DE7F8E5CEB95900FD55DFCDF9BC0DCA31 [email protected]
1,666,235,584 *AF5B3B40D1C61B1FD54C499539A80CAEC31D277B [email protected]
1,666,235,585 *AF5A873D4DE57D65EC12A3B1A7C8774DBB7A6699 ZYJUAN SHAVER
1,666,235,586 *AF5D38ADED0848FF11A53D273E14804585E4AAC3 [email protected]
1,666,235,587 *AF5C7F57F30EA2D8896DFF28D27E91DA52A379D0 [email protected]
1,666,235,588 *AF5358F5A99DD6DD02E7A340CA449D6620CAAB9B ΑΠΟΛΟΓΗΤΙΚΌ
1,666,235,589 *AF51C606EF6B803D127BB2E286432938B0A8CB12 БОРИКАЗГАН
1,666,235,590 *AF5A6C4EE35E40762063340643F25FAADFC5A521 знайдуть
1,666,235,591 *AF5B1F28434C8C83CB120D4C68BA8CE48254D478 ПРОТИВТУРСКОМ
1,666,235,592 *AF5CD7F7D95C7F0F9BE8AFA9FF88F88C0345961F СВИАМЮНДЕ
1,666,235,593 *AF59C9EF46F9B3A166D3948869CBACD0D4BE1DCF СУРЕТТЕЙДІ
1,666,235,594 *AF5808931B8A9B7331E31C0248DC80D6B13EEB13 углениты
1,666,235,595 *AF52287D7E57F262610CD9EBF6F358F8F2410C66 バンコク市内で運行される2車体連節車メルセデス・ベンツo405g(タイ製車体架装)
1,666,235,596 *AF5E2776FCAFC11CFD7DE08F94624BBCB7FB28E0 (0-0)`(##b
1,666,235,597 *AF5A6F9D55E6D56961B74EA7E357D10A0B2A7B0C 1278398 DOCH-DAMIT-IST-ES-NICHT-GENUG-
1,666,235,598 *AF53E18DB22A0974887D47394833A81AE49BD8DA 130319 OPISKELIJAOSAAHY
1,666,235,599 *AF511032028527C0A2460EB32A5289EE2A42F67F 13UCIT3.B
1,666,235,600 *AF5D2EB6739B27927E05D47629FACFFC55328FBA 1498866 taxes-will-rise-,-for-sure-
1,666,235,601 *AF5E2194104F71534CB68E036319BE73DCF560AC 14LIVIA
1,666,235,602 *AF5D2F495D1D21F904AE07202AA2F737165553EE 1524522 die.fensterputzer.stehen.unter.druck..
1,666,235,603 *AF581E01F47A0C5F2264360DF6557ECD5E76DF2E 171717d
1,666,235,604 *AF51C5AB6AA0F725536F6A7891A9A528F63A2A11 181cory
1,666,235,605 *AF549E4195589EC39DD99C6F1A4EEBEF15D9B861 1.ALEXANDERLAECHELN
1,666,235,606 *AF58DF20F88BE504C0E1C8B3DC8231119BE197E7 1-balanesi
1,666,235,607 *AF5BF5F4F8732EE845E2AA3A12200E58EC4120DF 1.bucar
1,666,235,608 *AF54DC04734427FFBC6F8CCB005630482966FC7A 1.burghoff-who
1,666,235,609 *AF59DCBBE17237F8CBB47C36C5393C636B83D954 1 HUNTERILLA
1,666,235,610 *AF55A6B3E2545D79D39589942852931655CA126D 1infliximab
1,666,235,611 *AF5301561D92E029384D66151B1CB5240C7B492C 1inseverable
1,666,235,612 *AF5965F12851F28189E3DEFA4AD9C0F2BB7D1733 1.lastenlapsiakin
1,666,235,613 *AF5E3A3CC03A27272CD8EFF54C28B8E15C74A58E 1 LAULUPAIKALLA
1,666,235,614 *AF5C7D733AC7EB5F9B8BB743BA006B15C662B525 1.LENTIVIREN
1,666,235,615 *AF54E92675289034E2A3461D47436DCA731772AC 1MACALARY
1,666,235,616 *AF58B65360C6AC18C6171FC52058256B04BB7058 1.NORRK
1,666,235,617 *AF5CC5AEF528000BE3E9A792CFD8F8767F44DA64 1-OXYGLOBIN
1,666,235,618 *AF59FF38AA2B971A915945536C622C7EC21A3772 1-paketointilaitteet
1,666,235,619 *AF5E03289D1DBF43CE8E94693DB304991114B977 1 PALKKATY
1,666,235,620 *AF5B23A1B8E4D4A58AF27DE0F1065CDBB1981C46 1ringetteyleis
1,666,235,621 *AF573F9E0062E87DE14581102E19F17A6C3DF8DA 1.RUNDREISE-TIPPS
1,666,235,622 *AF5583BBAAB64D70D11D10048956378E3BEAC118 1-savikuoppaan
1,666,235,623 *AF502984737F869603BF55190F38019A2353B743 1-tiertraining
1,666,235,624 *AF556B1407CE6F09244338A1975EF7EF36BFA0B7 1VELARON
1,666,235,625 *AF52BA7DACDF36066F1D7EA4CBD4CC0FDE5C58E8 1.VOLYYMIHINNOITTELU
1,666,235,626 *AF51A18A3A801519AE62288DBEEE55694BC85BFE 1 YKSIL
1,666,235,627 *AF53DF01904307A99B30614689613ED7053859C5 2077217 ALUN-PERIN-AMERIKKALAISL
1,666,235,628 *AF5081D5F4610F69B29B8B38CA48405592232C15 221255 medeniyet-dISI-gUCler-birbirlerini-imha-etmiSlerdir-.
1,666,235,629 *AF5095AD47963B5682565301E7B303CF31A83D47 2447913 durchsetzungsvermoegen.,.das.hatte.verona.schon.immer..
1,666,235,630 *AF55C9D83DC7EB7FF4A3CF71FEFB82ACBB65114A 25061470
1,666,235,631 *AF591BFBD73BB0E492868491AA3F780180083C57 2861563 menomaijasta l
1,666,235,632 *AF53FC0A3A806E2BFC744B7AAD97A792FC0287FE 2957786 taloustapahtumat.k
1,666,235,633 *AF56024B29BCC5ADE08B43EE9162175F29A949C9 29 asemakaavaarkkitehdin
1,666,235,634 *AF58098206FEBE8190D543B8356575C9BE8A5A59 29E56E86CFF33C3DB7D667B9F9C11454
1,666,235,635 *AF5F55A0AA0C39E05F67C0509A2A76581E3EF15E 2DAMASKUSERLEBNIS
1,666,235,636 *AF5FDE1BA00D74E74B883E2037657E6113A361FA 2IAMPENCIL4
1,666,235,637 *AF5CA273F4681E94C7E1B7C5C87371F7EBA80C36 2 SIVUVAIKUTUS
1,666,235,638 *AF5A9266C33B6EB817FB603C2C14315813B44E43 2YWEEING
1,666,235,639 *AF56CBCE671BC1912B786967F196E980FAFD2E26 3:3#&stonewashed
1,666,235,640 *AF53C3662848B22C8B32F48319402EF417E33F7D 358615 SIETRUGEINESCHWARZEJEANSUNDEINENDUNKLENBLOUSON
1,666,235,641 *AF5095FEB62E56816C79EC8EEA954C5CF1F310DA 384mb以上(512mb以上)、
1,666,235,642 *AF5E6356CD447F0BBB522423641D361BC0DA3529 3####D~0o><
1,666,235,643 *AF541671DC8B56CC38EFEE11E657D6A420BB927A 3EGRESSY
1,666,235,644 *AF51C0E411A1A34A6C1613EB019FF7521B10C3F5 3.EINSATZZUG
1,666,235,645 *AF58977C2F65BA2F15C858D9CB5B85CE4F1F93F0 3ILUVCLIFF8
1,666,235,646 *AF55FDB1DAD15E7E5FBBB16FB7BE7479986A604F 3yleisluontoisista
1,666,235,647 *AF56D02797213851D76E861D763D883CD4531887 457628 NIIDEN SUOJASSA PIDET
1,666,235,648 *AF5D9E22D33CDC31F93BD12F2D88427AA4B4E952 48009a
1,666,235,649 *AF54CCBDFD0C823836D6F6D7520CC8E630A4F76E 4mjqrjk7b
1,666,235,650 *AF51F3D82479DB4851B4E69F01469952EED282AF 4OLIVIATREBOR
1,666,235,651 *AF5C9A1FDC5A8C5E4557941B81928C5E680FB840 4SOAPENED
1,666,235,652 *AF5393EB8DEB8F4E63EC2A52EFDF92C47F6E0A88 4www-linkin
1,666,235,653 *AF5B04AE99634D0CF7D1D54B36F9567728D9F81E 52a2ee2c09453f2db9c3931172a3ff59
1,666,235,654 *AF56564B5E955721D7E5299234B1650BC9C5CF5E 5EKJILETHCOTSTRAH
1,666,235,655 *AF589A55E43EF3082D91CA8BEF72C43CC64F8CBD 5HYSTAZARIN
1,666,235,656 *AF5FF98346BEF2E6D6BCD4BED46001C236F72485 5OPSLURPENS
1,666,235,657 *AF5EF0C5D8C4EC8434B325031191E23F73DC30BD 5PRPRPSV
1,666,235,658 *AF5F9C3ED726303F6043A2E821FFD612FA9E3E88 5REPOUSSERIEZS
1,666,235,659 *AF5D09ECC133857D199FB6F92A79AEC89BE42F73 5yn3r95tcal
1,666,235,660 *AF5D15DCA0C4E860F4075BFD7A981F9B68A2EA68 6INTERFOYLS
1,666,235,661 *AF5A002E987FCD8E59A5EA37AE40726A95FC387C 6mitwirkung
1,666,235,662 *AF553771CC750AB91B01C550CECE2B9D483DD85E 7BSWBREWERYSBSW
1,666,235,663 *AF56124165030E374203ED56C3EBA5B18BF58A99 7GALAXYROY
1,666,235,664 *AF5CEC0C1195D420DC0DFE69E057B7B420627E61 7JEREMYEMILY
1,666,235,665 *AF5FAB5B2126D2F75C5BBAAAA452BC10A4892670 7MACCABEANS
1,666,235,666 *AF5122CD6EC6B98929F358A74FA56E390FAAF577 7STEVENROOSTER
1,666,235,667 *AF5DF49196105C04DAB3BAB49085509217A3BA83 7STRICKLANBSW
1,666,235,668 *AF5B89D6807D117731CB73521B017D4D67EDFF3A 7.SYSTEMATISOIDAAN
1,666,235,669 *AF59CF8843883167E8703E026ADB0569D4D88DA7 }8{-0~-d----q
1,666,235,670 *AF566A32BE3F58C976E21D6BAC80569071B2992F 886563 brandexin.setmaksuj
1,666,235,671 *AF591A7422F1ED13D5330C26EDFF637AFD7EC49C 89BF83BCFC9F33DE99B7DD3557BBEA1E
1,666,235,672 *AF59D95AF8A55C33755145CFF4F1945D2451F62C 8ARNEKIRI
1,666,235,673 *AF542274ECFD45857C067B45B948D9246BC5F810 8BEDSTEMAND
1,666,235,674 *AF511904569E89E39FE0DC4EC9E89E57D40ACB4B 8E7HINK$
1,666,235,675 *AF52229F2C53A2F8D3A0DAF9C30A2671BC9B21B1 8feb2001
1,666,235,676 *AF518B27744648348407F55F1F303F971D77F695 8NONINQUIRINGLYV
1,666,235,677 *AF55A62B27FBCA4E770B772A9B8611B719E421C2 8##P~O~o(O_)
1,666,235,678 *AF5CCDC90208FD4B01824CD5C1CD55692A7A0ECD 8RESYNTHESIZEDS
1,666,235,679 *AF5749CF5664FED99BF7E8AFD91FC5980DC8EE11 8SHOVYNG
1,666,235,680 *AF5F06470142D4C1C8D548A7380F86FC72A2F155 8THUNGES
1,666,235,681 *AF51B6D72D35973BDFA2E669CB36304C76D3958E 9ANGUSTAS
1,666,235,682 *AF5B9D96A671F710A674C5A7F001FB715FDE1DEA 9BSWDEVUSHKABSW
1,666,235,683 *AF564AAA88BEC7AC1EA0586B966C886693619B93 9BUCHANEER
1,666,235,684 *AF52D4BCC5103F94653126AEB57454C947748F76 9F080623-5C15-3956-B8CF-33C938AFF8C0
1,666,235,685 *AF533A218EC8BFC8D4BA6F3F3C1E0524C305B586 9HACKEDXXXPASSWORDS
1,666,235,686 *AF5877C69DBEEF47A206FD83F265FC40673E056C 9HEENSLOEG
1,666,235,687 *AF552250A883CC054534EAD2C1E2574E1BFBC009 9LAXANSES
1,666,235,688 *AF5341FCB5E1BD3F680C6D4528F65BF34D3DE1ED 9LOGRATIO
1,666,235,689 *AF5309565AB3EB41BEB4F0FF8F6BEBE0F3D50694 9OSAKASREKISTERINSAE
1,666,235,690 *AF5D134C3A0D41DA4906E0E6642BA2687C042054 9RAVIASSI
1,666,235,691 *AF55C71F13274437E09BAB139BFF35510DACA274 9REIRANERINGS
1,666,235,692 *AF5C741F5C721618BF9640DB4596B33CFA410C10 9SLAGVOLUMINERNES
1,666,235,693 *AF52610984D7D646247BA866B693C61A92EABB89 9VERSEGGIANDO
1,666,235,694 *AF55C8B6EA31BA2CD8039E2F66C013D70DB09D18 a&).)
1,666,235,695 *AF5AB4425D5666490EEC4A2E203B5636DBB4DCC9 a(0n7
1,666,235,696 *AF5D1B645986AADC82F0F46A2D1FB463E1EA5F0B a7l?
1,666,235,697 *AF510F8CE202B2259851C8CF6C26DB9026767664 ABD/T
1,666,235,698 *AF514BFE250DD5CF131A65701AD2E303DFF23E67 ABSTELLENS3
1,666,235,699 *AF57372488732F7A8F2BB8FCDA74008B8FF11345 ac1.&
1,666,235,700 *AF50AD80C8DE3ED345BF10A4B8100B6566C3079B A.CR6
1,666,235,701 *AF512AE7B4D5332D5AA1E15A7F7321CE66AB247A adbu9
1,666,235,702 *AF51E071B7029738DBF006E5C986A0D2FAAF16B0 ADOE>
1,666,235,703 *AF54C9A0D86AD08DC4B0C0581B03656BE16BF275 aga-&
1,666,235,704 *AF5EE76A97A405CD962CB70757C334D3CE2C413E <AHREF="#HDR7242527">7242AUDIT</A>
1,666,235,705 *AF5A47F25B2FC3497C93A6BF13ABBA5261E2AC36 aj_1c
1,666,235,706 *AF50BC431D2049EC75AFEAD4FDA2D2EF9FAD6339 ALFREDO.FEDERLE
1,666,235,707 *AF52B1B39E7094109F86527F9457DBED273FEEB1 alimirza
1,666,235,708 *AF507613E1E1FC346CD0CA330E014A0BBDE90FC9 ALLEN.ARLIA
1,666,235,709 *AF53BE188541557317502D1E771C526E848F99B1 ALLF
1,666,235,710 *AF558D659730F874B13AF9B7F4FFF11DB7ACB4D6 ALONSOSINGLETERRY
1,666,235,711 *AF5532FDFCBA9B849EB31BE5FDEFEA1473757ECB ALPHONSOHURRINGTON
1,666,235,712 *AF50CBA6A5CF53C13EA9B09C88AF9814BFBE4A68 ALTONHAIN
1,666,235,713 *AF5EB6E50F335B00BB17B1F3302784AD43EC2F35 A(M6L
1,666,235,714 *AF5C4D524156C5E2A8EA901111FFF23F6F5CA05B AMEMORY2
1,666,235,715 *AF57EC4259C2BD3B82889DA0673134212D7B8CE4 a.morning.in.cornwall
1,666,235,716 *AF55EFC73CD4F972754B738CAC2609ADFC767090 AN2P$
1,666,235,717 *AF57BBB6F58C6DDCD168ABBBB026510CE9ECF250 andremuentener
1,666,235,718 *AF5249A851B4B92BD3367224A2C67985F520F339 ANGE DE PARADIS
1,666,235,719 *AF515C2A334A0643E78EEADB89E036DD388B6F71 anibalberndsen
1,666,235,720 *AF5E5B3EA08C4451C8249DD5E503933301BC69D4 anietieuko
1,666,235,721 *AF59EB65335E1B34F46AF306D2ADE388E9DC69FE ANOTHER.STEP.(MARK.SIMMONS.REMIX)
1,666,235,722 *AF5C49FCD35A9E1E0C421A018074DC5D6119034D a+n&t
1,666,235,723 *AF5CE6E02CE3424BE75EC94F847F060FCC11B4FD antoneremey
1,666,235,724 *AF5DEA5F48E20D0C6E868EA84A515AA565D69056 ANTONIA.WIECE
1,666,235,725 *AF5B821280107386ADCF989F878D30AA07878D07 any lies
1,666,235,726 *AF520E858CB234143244BF2B959A152D25FE429E ap$s
1,666,235,727 *AF5150997499F9DB854F1FBCC937449D75F88F47 ARIEL.CIERVO
1,666,235,728 *AF5D06F726CAE31B228EB8655D498248792023CB ARIIEY
1,666,235,729 *AF54CCF60C5A77FB8BAD1B463D7FF2313FA43925 ark51
1,666,235,730 *AF5F8A16968B4B80196DB7D1C68C8795FE8B84A7 ARNOLD.VANTUYLE
1,666,235,731 *AF5057663AE911C2D587CADECFCDD2D203AE9F91 ARNULFO.BEETLEY
1,666,235,732 *AF51CA8DC0BFAF33EBF1DB379B14C10F32599456 as;;.
1,666,235,733 *AF587AA1FE9025E992DE3473A4A6ED14F7C26CD6 asela-tharanga
1,666,235,734 *AF5F4B256167DAE3FE265873934BEE689560175E ASHLEYGARNET
1,666,235,735 *AF5E0D93ED35B0168580D788A2E3921D62B4295A AU0HA
1,666,235,736 *AF58A527D02E246BF923EB6B4B9401B267362BD5 AUTMATISKE
1,666,235,737 *AF548027A231DDB6CFA775B856180E0C1CFDF5E6 awesomeblizzard
1,666,235,738 *AF52B1BB1C392C307362BC6ED2CFCD7C069440AB B24=
1,666,235,739 *AF5BC73F6709016872AE6729662F5727F024EFA8 BASEMBASOM
1,666,235,740 *AF5D0E06C6DDE183680B5B6F46DD6290B9C06921 [email protected]
1,666,235,741 *AF5648A0997759A4B8DEFC71C10855B3CAC48DD2 BAUNTET
1,666,235,742 *AF5E80B8BB8BFF3CF8B8B6092C5439EE0564CB11 b#dsa
1,666,235,743 *AF5045FB0CAE992D9566C587B02E090B06EFAD1E BEAU.BRASSIL
1,666,235,744 *AF5EAF0DA146BB68BE2BEE5ECA4BD2544C4D886E bekc
1,666,235,745 *AF5B333411147A3D5AC2F9850D4636A2A0ABE0F7 BEN.MEJA
1,666,235,746 *AF5EA29034365BBD0018AD4460DE66FF2A9AB31C BENNYLUTHE
1,666,235,747 *AF53E92153783DFE614991F4CF8D4C8735B537C3 ben-shem
1,666,235,748 *AF5EE9B0FADE053BF2698E3CADD6CE6F20860E0E bew4i
1,666,235,749 *AF521BF543D00778F52E452D4E8B2DF410B47EBC bezuh
1,666,235,750 *AF55B88AC27525EBDC16DB2CA25E945FE347C068 BH%2O
1,666,235,751 *AF5046AAA3F8FC9E3DE407613118DB3DDC534B5A BHRUM
1,666,235,752 *AF5B9AEE8AA32001A9511F3A01267DA71083A913 BK(;
1,666,235,753 *AF5C20991E1784A885CC6210E65528FE23C70C22 bl7cg
1,666,235,754 *AF5F1688587AE5A3B8D0F6B055A2895D5CBD9D0B brainlinks
1,666,235,755 *AF53CFDAC1DEA393D287A416277A2F88CA7CB0E6 brendonkippes
1,666,235,756 *AF542BFD1AD229FB6588DF68E46A26141B727E0D BRENTBEVAN
1,666,235,757 *AF590C49F22919BE212C7E4406A106CF49EAD64F BRENTONMAGIL
1,666,235,758 *AF58229AD33C95A39F469D90FAA0A14773BDAFFA BRIAN.HINLEY
1,666,235,759 *AF585DD72AC2A8C1F0B3DD950ED1071D5767A965 brookspicado
1,666,235,760 *AF5B2540A560983578811F8ECF63B6AF9578AD54 BR?P4
1,666,235,761 *AF53070DAB39BFD36237165175F6D2CD83CB30E9 BSCPBSCP0
1,666,235,762 *AF58D2E4BE1329DAC4599FCA2A20A43BF1C8F063 BSWBOOLGLOBBSW
1,666,235,763 *AF50DB5318CB53960DCB5BAA4F336CBB7321F635 BTFEQ
1,666,235,764 *AF5A8122CE60022F4D60DBEA55392C446F14080A BURTONZITZELBERGER
1,666,235,765 *AF553362E0425C6F63F5B0ECDBE30F234BAFADDE BY&BF
1,666,235,766 *AF5EDC6A3B58F64AE43AE2BB0F1EA0E37CD14C57 BYOVO
1,666,235,767 *AF5D98B109B1D72A4E17B0942C84097C35408970 C"4&
1,666,235,768 *AF5095D73B41119B1AC3C53B9FA34D01561D571E c7_d
1,666,235,769 *AF56A6D66477A8C1C32681CADF040808C92B5F53 caroline.nadeau
1,666,235,770 *AF5FEEE9B80EA8120ACE16F5FB09775142EB8DC9 CARTER.DEBEAUMONT
1,666,235,771 *AF578E34CD29441EDAF2E5F26B6EDCAEB08A5437 CARTERSKOW
1,666,235,772 *AF53B231B42E76C96992BF4E9D9573A3B507AE99 CASSION9
1,666,235,773 *AF5B5709114EFB15291A7D710E3261F462C79080 C/E"D
1,666,235,774 *AF573175B7D3BB985F6EBEBACBB9579AB91A9563 celica2817
1,666,235,775 *AF55C1287CC9C2C540B063D0DA6E75B142BC1A62 charleseggleston
1,666,235,776 *AF51B33A58ADF4D6CBD2E1E1C90ED5E00A6490F2 CHAUN+ERS
1,666,235,777 *AF5337F6D1369114B8F23B0A913C23D85DEB4944 CHORUS-/-HIS-YOKE-IS-EASY,-AND-HIS-BURDEN-IS-LIGHT
1,666,235,778 *AF5E335CF80B110303AE891F29ED44C1F561CF7D CLEO.FORTES
1,666,235,779 *AF561FA6A0372ADD55E39EFCB9F77A964204DAA4 CLG0
1,666,235,780 *AF59F8E203D85CA5A5EAFF4E8B4A44A55D63030D COLLINELERY
1,666,235,781 *AF546E75EBE16527E0775BB0FE1CC077CDD4976D COMMITTED DANCER
1,666,235,782 *AF5FB67499D9D2AA4CFB5426D32C8A42F42AABE7 CONRADFETTE
1,666,235,783 *AF51D3BB5256BF64E4F22390FAD644D289D77561 COREYCOATLEY
1,666,235,784 *AF522EB61BD4D9B0BD0A797183EF76D6C2262BA2 CORRECT-CRUNCHY
1,666,235,785 *AF534127BC1E5D1AC504529E17782CD59D7B17CB COURRAGE4
1,666,235,786 *AF5A884D92AA08ED956FB8E55E9A576307A3F4A4 c:\programfiles\ccleaner\lang\lang-1053.dll
1,666,235,787 *AF52502ABDA6DC79BEDAF9F4FE7322507AE96CE0 CROW23
1,666,235,788 *AF5343E5202827130455D49B618C359C9493FE17 cub&h
1,666,235,789 *AF5DFB4567F55B613C692A381C00474443C78EC1 [email protected]
1,666,235,790 *AF53412ABC0F60F9ECFC77F4C8007011A22B2ABA cybw&
1,666,235,791 *AF54EA6551A21FC35095FF5A571940933848B234 d--&-
1,666,235,792 *AF5D7B01C4BAF621B1992D84659A87B35D764771 d0rpf
1,666,235,793 *AF5253AE8CBEF06B787FA8686D4721B573BA72BF d1-1w
1,666,235,794 *AF594AF35640E0D917A7293064974105FC3BED4B D1LU15CONO
1,666,235,795 *AF5ED7EC1354952BAA8C6C867159E9049D9BDD46 D1Q_G
1,666,235,796 *AF5A4E2F97A2365BDE3A85F8E9CF82CEB4E2325D dallimandira
1,666,235,797 *AF5CD777FC922D5145F1AB50EF39E34AA89771AD DANIELTOSTA
1,666,235,798 *AF5735D5BC9825FAE7A7B68A7C28AD9A107C9267 DANNY UPTON
1,666,235,799 *AF5919EDC46A3CDA28D60A5B7323E8D5B4623F42 d"a-s
1,666,235,800 *AF5BEAC9FD3856284BF7CFADBEEE8F5AEBAD8780 DAVID.VANSTORY
1,666,235,801 *AF5BA375FA1BA8DCDD475A2B4E4A61FF77B50FE2 [email protected]
1,666,235,802 *AF5C0D88F8B636DE3134C99FFBB59ED14C2D1862 dekoderu
1,666,235,803 *AF545BEF50A77AC72DC422BEEA316B2EDCB6513C DEMETRIUS.POSTLEWAIT
1,666,235,804 *AF5D6173A928036FDD987C3C06227D11F149BB45 DENIGRATA
1,666,235,805 *AF5B13C3097394EAB7AF75CBA1D7351387F986D7 DIABETES-REDUKTIONSDI
1,666,235,806 *AF5C165166570BED78D99C5A5B7ED9089FA14BBE [email protected]
1,666,235,807 *AF52AEB79A2AB435E8C26F334E37A41CC332CC84 didoandaeneas:actiii,scenei"destruction'sourdelight"(chorus)
1,666,235,808 *AF526B1A1C11E0BA875FA022156BC7A9E6CEE47C diswarrened!
1,666,235,809 *AF5536ADB8F90A120014F313D8670283F81AB23C d$ndh
1,666,235,810 *AF5B99C0BBED14286CB1280313B5B227B40F42AC docf
1,666,235,811 *AF5695D30241A882CF20C182055046FA99722767 DOMINIC.ENGSTROM
1,666,235,812 *AF5689FA7C6B2F4ACB5B979B716FF2D50B3C304D DONNYBOGDON
1,666,235,813 *AF58B9AC12928420ABCA766DE3544E46090B04B7 DONNY.GOLPE
1,666,235,814 *AF50EE3BCA1297873D3E26E5D54B23F00A76D227 Door.closer
1,666,235,815 *AF5C04EDD724547E40A6CB2B2BEA3330944375E3 douzieme!
1,666,235,816 *AF5970D223DCE43F979ED87772669BD2716BB3BE d&qww
1,666,235,817 *AF5761B7176362533EDC336A7B9B0298115FE49A DS3)=
1,666,235,818 *AF527DFC22594FA4C54C51EF270D224F95C49CD7 D%TTU
1,666,235,819 *AF575695A87FD535067CCA98C466D2476B695D3E DUBT#15
1,666,235,820 *AF52D2A43EBF07BCDD6C32F72496295150092577 [email protected]
1,666,235,821 *AF5562466EF0E649B7AB0FD1991EACF0D4A497B2 d,vk
1,666,235,822 *AF5F22B29155E028F0102AED0842D148093A5949 dw#of
1,666,235,823 *AF5BE6696B1792633F20F3BD9E2ECA541E69A206 EDWIN.STOUTE
1,666,235,824 *AF510385A237EAACB27B29CEC3BBBDD1F5E7CF8B efo0q
1,666,235,825 *AF546620994313A99A5A20F69914E9F5C59064A0 EFT
1,666,235,826 *AF5304230EA3A0C8218CB753B56220D75D26F844 E'IG
1,666,235,827 *AF531478244C3DC1CE0CF6A048BFD6A90A8D38E2 EL.CORRIDO.DEL.MUNANO
1,666,235,828 *AF5D2C55A92BA05D9B3BA39448DC9BE3CD457C73 eldridgecullivan
1,666,235,829 *AF58342A47BFA00FD993366EA77FB9DFB4214D70 ELISEO.GUDAT
1,666,235,830 *AF5397CA1008750E8D1DE55A91B303BAFC92CA63 ELITEREGIMENT
1,666,235,831 *AF5647D29E20D72A719293E115483E82443B2EDA ELLIS.GREIF
1,666,235,832 *AF5F3917FA0A4D81EFD7DAA4554C0AA236EB4DF9 :ELPMAXE-ROF->TT/<__DNE__>TT<
1,666,235,833 *AF527E82ACC74293203BC11802F5E1847E1BCC65 ELVIN.STOLBERG
1,666,235,834 *AF59AC84C31DDF78A34ECAC7E119B4CDE3265536 EMERSON.LORIA
1,666,235,835 *AF5236E57CBD8D250D9276FFD53218CBCD3949CF EMERSON.MORETTO
1,666,235,836 *AF5B0631F8F0CB5A26B0526A67B0C598452EC54E emibq
1,666,235,837 *AF57AE302DC82BD3A46E665E37076156CA1FB0A3 emilrabeck
1,666,235,838 *AF5ED3672D25D535CFFDF2361C938F6C317C4A26 EMUKSIIN
1,666,235,839 *AF55C6636B5AE4A09D3C71C988101397F14D1BFA enverksn0
1,666,235,840 *AF58E7AF6920852A507D1E2768AD66D3008A14F8 eqdxc
1,666,235,841 *AF5AF8C525EBB7F9B693884AFF1ACAFD25477850 EQRC"
1,666,235,842 *AF594D053E6A3E5DF467EBADDAF6AD0F6D304461 ESRANGEIROS
1,666,235,843 *AF58E56F70AB89B69CB0B306ABBD6C785260C408 EST$Q
1,666,235,844 *AF5D483E6FEA5C25FFA26E8A656678C9790C0CBB EYw
1,666,235,845 *AF504FC7B3321AC13821057D59CCC208DB05381E F0U1BA11
1,666,235,846 *AF5ADA82F43B7728ED0D33AE49B6976A37684774 fernand.dizon
1,666,235,847 *AF55EDD96F50262855FB6535E021ABAD6428928E [email protected]
1,666,235,848 *AF532E5AB5F364792AD7CC2BBA93BC37508EAE1B fi1ov3rf
1,666,235,849 *AF5ACBCB509771BBBFCEF0F05E28D9217F3291EB FLETCHERWORF
1,666,235,850 *AF52CA15DA802EF30A77939496A8E4BA797B485C FLORENCIO.ZOLONDEK
1,666,235,851 *AF504F437F45774F46D2861A683A9A1BCC3F0D0E [email protected]
1,666,235,852 *AF53CCC5BA45B3C84B5C5795509897452F98FF41 [email protected]
1,666,235,853 *AF58BFD39585943F62C80E4B2AE4D6A12B1040D1 FONGMOOL
1,666,235,854 *AF50E53C980F76A2F1862FBCE613C4ADE2CB7540 forsakentrillhoraboulanger
1,666,235,855 *AF5B111211E91C8731D7D5A93A65633517826FA6 [email protected]
1,666,235,856 *AF5AB01815896D8C6298B3F60E52D632C404666A g2hh
1,666,235,857 *AF5FD82AA55376F19DEAD9B1C0388D986B82B2DD galendunnivan
1,666,235,858 *AF59A1110FF660636D58A0490BB75C36202B0E7B [email protected]
1,666,235,859 *AF5D014E4652E91D0914464D1D69CB4582565683 GANZ.HEIMLICH
1,666,235,860 *AF53BABA5FD324015CF6E3BA49438C57C82E48A6 garfieldsales
1,666,235,861 *AF59356272E11576FD0F9F02132DD2474B274808 gavranovima
1,666,235,862 *AF51F6F8409354591D011F9EF17171C3A5A994C5 GEFÄHRLICHSTER
1,666,235,863 *AF536B0C3D832DF07949DDCC4CC648FEC78D9FBE geraldvilleda
1,666,235,864 *AF52842DC64D0853D540DCAC69FA77F0764AF737 GIRIJA-MISHRA
1,666,235,865 *AF5EFB4EAB2F52C1B13087D9EDFE18EA8BC20A44 GIVE SOMEONE THE SLIP
1,666,235,866 *AF5E7CEE452C1F02857CACDF58CBB5861A7CA6B2 gjzj
1,666,235,867 *AF5EE9F9275A3F069D06361936FB0A52E13DECAF GOLF
1,666,235,868 *AF51C4A12D76A8697930C19B65FAE929345968F5 [email protected]
1,666,235,869 *AF5830D4F477CCEB835D56979F4E31C2B5205BD7 [email protected]
1,666,235,870 *AF5E107B737F99C1D0756C5EBB6ADE499F5BFA90 GOODRICK8
1,666,235,871 *AF57A4B8DEA830DE93ABD04F27E717FDEC08272C [email protected]
1,666,235,872 *AF53025C482E2ABECD2E9ECA5B41F8E8C145656D grades
1,666,235,873 *AF508D06CF5A3C1CAB1473CA4FF6A742AE85DB3C grandos10
1,666,235,874 *AF5BB8FDFB806506F08A12D2AB762B4077498C30 gregorioparrow
1,666,235,875 *AF5AC1982EF2FA7EB1AF557AA136C529902876CC GREGORYKINDL
1,666,235,876 *AF54190C306F1EF49E71F977D0FAE9580653D9DA GU~Y
1,666,235,877 *AF5C4DE88820DDBCFE4F89B7905BD7CB904A307E HARLANDCARIS
1,666,235,878 *AF5FC801120C2CD6D08C484809955116C0EDAC93 harlandgilchrest
1,666,235,879 *AF5B630F35D93685C63E22E699A54EF82422DFDB harlandmasgalas
1,666,235,880 *AF5C33AA1B4090C96D2EE7BD950F0101F902182F [email protected]
1,666,235,881 *AF5E42C0B7613AF9E99278EEC94F9CF2EB29A5EA HECTOR.BEDSAUL
1,666,235,882 *AF56E081285720931E08994F93C6E52C5D514A51 HELIOSGLASSCOMWWW
1,666,235,883 *AF5A968728E0DB3113C0CFA60F6AAE492B2057AC henrietta-james
1,666,235,884 *AF55AA71DB7BC3A97CBD17BDE5F3A6A6F7A1232D [email protected]#HERKIMER
1,666,235,885 *AF543BF8B81D8E5EE90E3B66142FD445383C22F7 HHEYDRAS
1,666,235,886 *AF5FDE4278BB5A093391D28CB3502A27C2F4D9DD hiltner
1,666,235,887 *AF5E004E8EC5E8CB225F11929BFC8B5FC41B8240 HOBERT.MESSEL
1,666,235,888 *AF5AFF890B511764CCF9E93C76031864B33298AA HOURS10
1,666,235,889 *AF58ACA18B50E5100D4B8705FF4A07EB05FFA601 HROPODAN0
1,666,235,890 *AF54EC784DCFBB8631166A5775EF5A38BEBA7E67 HTTPWWW.MFAH.ORGINFO
1,666,235,891 *AF573E175586A0BC21B6252A061DFD26F7AA73F6 HTTPWWW.SYNTHETIXSOU
1,666,235,892 *AF59052D392673DA356C372E3753B5AD01927A7E HUACHEN.BBS
1,666,235,893 *AF510D1BDC743123AEDCD554C66DF9194683B60F [email protected]
1,666,235,894 *AF51FEE295466527024F799EA0DE1B7F6771167F [email protected]
1,666,235,895 *AF5491EE0A4E1115C71B235D7D72A1D3B35E5887 HUMAIRARASHID
1,666,235,896 *AF522DBE8874015A33F3D589639C9E881DAAE9EE HUNKALEE1
1,666,235,897 *AF5E80AE7A16856F63947A9BAE686B252138E224 [email protected]
1,666,235,898 *AF501B53C16867102A510E0DF4269DCC60D1A573 I3137
1,666,235,899 *AF5B67358CB24D396A62F6CB3F49DE4CDDA0C1E4 IFYXQUALD
1,666,235,900 *AF5C56CAC006BB6C88DD0DD3232FE8A8223E987B image--as
1,666,235,901 *AF584BFE84C20D68380B489E2D24B4D197BEB7CA IRAMNAIGGED
1,666,235,902 *AF5CC7DCA882D35615C3DA0EA43FD158ACDFEE81 issiputs
1,666,235,903 *AF597DF54A9E477BCFB13AF7ED3A89D3AD18095D it.is.circumstances.which.show.what.men.are..~.[[epictetus]]
1,666,235,904 *AF530A853DCE643EAE4EC76FD20DF104F0E972D3 IVANFAVELA
1,666,235,905 *AF5363EDBEC8AE3322F7CDF674EBF07C1E0A3E4F J4CUL4TE
1,666,235,906 *AF5DC5F53ABCE2307059395B545F271570C701ED JANEIME7
1,666,235,907 *AF567B71876C3593912D4BCB5A256003918FE435 [email protected]
1,666,235,908 *AF5B603386097DB248373DD4A608CC670D19B4E1 jayakumarjai
1,666,235,909 *AF5209093B54B04387F0FDA99020FA18DDFB6D8B jcpeduto
1,666,235,910 *AF55866A7ED4E33DFD84E15BF9182194628A9712 JC.SCHNABEL
1,666,235,911 *AF5374D9C1A99B69D256C185126AEE6472DD3FCB jeannetime
1,666,235,912 *AF5B14903F4647FBC6DC18A2E4D5F51656821F97 JEHRUMT
1,666,235,913 *AF59BF9185050B25AA593DE3CD9C68AE8C23BA4C JELENAPETRUSIC
1,666,235,914 *AF5A4A4D27E3CB5F915DEDCFAEAED23D6C4E15B3 JENNFAN
1,666,235,915 *AF522D44F75B521819E0F0E1B97065539090906D jewishgermanamericanbritish
1,666,235,916 *AF5496549C21091637B4143E4EA331344BC9CF8A JIM.CANTU
1,666,235,917 *AF52ED340D6E19988FA057161027AD2DF08FE74B joe.cheung
1,666,235,918 *AF56FB23F0F3FE16B654912AEEDEB1F089441442 JOE-PILLARS
1,666,235,919 *AF5842F05BDEB676566EA7A8B10B6B97B9E0F3D5 JOHNNIEVERNE
1,666,235,920 *AF5840BFFB1623671B0F129209394F7EA3D4C3B3 JONAIDAL
1,666,235,921 *AF5409729436531A379321B84DCE35E7A608618E jonassturgis
1,666,235,922 *AF513937B47EB5F0C17779E638ECCDE390DFB3CD JOURNAL1999092420071112
1,666,235,923 *AF58C53D496078EA8D7B38F7BC416D62EE465BD8 judsonmagsayo
1,666,235,924 *AF5EB0508F785ED845881FABAE31CDAF41B7EAF8 jugatsu.no.ningyo
1,666,235,925 *AF58E27CBFDF00BA2C7DC034203F546A90B461C2 juliustays
1,666,235,926 *AF5450DB5C3EE4FDD66130296A5A478410C2FBEF JUMPTHEYSAY(LEFTFIELDREMIX)
1,666,235,927 *AF5B19136780868FDA8DFBC39648714FFF65A05E [email protected]
1,666,235,928 *AF5994AFDC4547975D88DD0AB80074687A5DBF43 [email protected]
1,666,235,929 *AF54F7E88986A09FEED10E086EA0C9D37A86F2DC k7compilation
1,666,235,930 *AF50E3F34BCB1A049FD522960257DE094984DC26 karoly
1,666,235,931 *AF5B21C9AEECDA43FDA04657F4B4E1577315E174 KBWIRESITE
1,666,235,932 *AF59D625F72EBA1349F06F3B5E3E921DB53D5CA6 KEHITYSLINJAA
1,666,235,933 *AF5D7726A0AD86F947620F6D8CDCD435BDD3AF8F KENNEDYCOOKIES
1,666,235,934 *AF594B0246A2D266A8E072E623D46CE0F70056D6 [email protected]
1,666,235,935 *AF5D131EBD836D60D540CC4E7E3CFA055A97C0D6 KHOÒNG
1,666,235,936 *AF51E586F0127183782BC09E0754A2E31E9499CE KIMILIN
1,666,235,937 *AF5F5E98F0C99C1A62E2433512052E9BD634E96A KOMBINATORYCE
1,666,235,938 *AF533B08013170491649E216058DFBEAEDD1DD01 kopinsking
1,666,235,939 *AF5DDE3903F7A7CCBD8C8A79202A2071A810098B kraznavitzar
1,666,235,940 *AF5A20A9580182E6291A7F1EAE5DBA7CF84605A6 KṚTĀNUSĀRA
1,666,235,941 *AF5F4DCC0C3125DB9D9BBED110D9D2B57510CFEF K"YS
1,666,235,942 *AF5F25F2E7E0CF3BB087C8302E2DD6F41D964028 LARRY.BUMPERS
1,666,235,943 *AF542CA79F736E083831783C3C7423681951B141 LAURENROCASAH
1,666,235,944 *AF5F0C0F69CE4D9DD32946BD2D09E171EBCF493B LBERA+ON
1,666,235,945 *AF5B6837A4113C3A7C92E057CAF10F40E752C788 [email protected]
1,666,235,946 *AF52F396375A1FF25C7EDEE2BA0EB1CD305E433E [email protected]
1,666,235,947 *AF58E502015A9810F99307109CC630B6AAE03C77 LEIFLEDY
1,666,235,948 *AF5ED3EA4D281AAF670EB261FB56453B617A1E55 LEOTARDO8
1,666,235,949 *AF54A01F1E2F8CA9F948E0B724021638420A2665 lesliehoaglin
1,666,235,950 *AF5BF6A7608BC4972768C6AFD3D3EBCB600DC448 LETCOL1234
1,666,235,951 *AF55359D6962F4A198BA327518F5CD67F79FBF76 [email protected]
1,666,235,952 *AF5213B6F00611DAB3415AAC801A1741FB11F017 [email protected]
1,666,235,953 *AF53E18BC8555E8A6DC733661AB8862AFD161538 LIU-XUJIE
1,666,235,954 *AF5ED56EE7FE3F417D677386DC1E3075B11CB84E LK[E
1,666,235,955 *AF52F91F4A172A1B3969BBEB8030ADF86E6712DE LOGAN-GOUGH
1,666,235,956 *AF5E0117AD61361B0B82AFAD583AC7499F12C644 LOIS37
1,666,235,957 *AF5CFF0B20E895AD38BDCF8C21965B1059DB69CD löschenwollenden
1,666,235,958 *AF58F77C3AFC169F8EEB5C7499614738A68DA965 LOVERYOUSENDMECOLOURS
1,666,235,959 *AF5ED8499349A4F0F897B135CFC41AECD8830D70 LUCIUSOLIGER
1,666,235,960 *AF5D4665C9078DF96BCB28FAEA82682308D7B134 LUKECHATTEN
1,666,235,961 *AF5AA9743852DD078C81457E20A440DFDA471C77 [email protected]
1,666,235,962 *AF5F232EE3E3BA50C8599F237D2A67913A72F360 LYLE.VESCIO
1,666,235,963 *AF5DE00D4C52703028581D9A1A47B53C88CA3E66 LYNNIOLI
1,666,235,964 *AF57D09C4CD56D4F68A91B299E1F8A8D6FCA7B91 m1+arzn9
1,666,235,965 *AF52AA400F17C010BCA0028D4F57B05BF089DD17 mahoganyroots(360soundversion)
1,666,235,966 *AF56D66D5783367864914A40E87113C5EDC579E9 mannercelticgreen
1,666,235,967 *AF52664535E86B53435E2D4D57A696B7A68E78CE MANUALDALESANDRO
1,666,235,968 *AF52AD8C8340052C42F77C165F73806D0EA84D54 [email protected]
1,666,235,969 *AF50EBC1CF662D7AB4EE76F22F4D605FEC5DCC78 MARCELQUARNSTROM
1,666,235,970 *AF5E9376094FEF6CC81BA26D8F4434F9FF61D8B0 MARGARET KINNEAR
1,666,235,971 *AF5806128B200FC1C8E65A182C7DE9412514CBFA MARISCHKA1
1,666,235,972 *AF5ACB7DC409F523AF010EBE06AC11D369FF9C86 MASCHERA?
1,666,235,973 *AF513CE97E6D465AA34A62B1CE03D9177CF2CF9D MATTHEW.COMELLA
1,666,235,974 *AF5F97B4D7B75C3BF1B6B8C8D936DFC10BA45FA7 matthewedling
1,666,235,975 *AF5CE0B06F6DB01B6FD435861F963F3AD42515C4 MAYNARD.HERBIN
1,666,235,976 *AF59C0B6EBA96FCE03EEEACD94D055C3500B4339 MBOLWAIRE
1,666,235,977 *AF564B51A432A75FF89C26B5583B30DA5BB28C29 MCSWAYNE2
1,666,235,978 *AF5AB82C110499236F8978C466452424BDA0BEF2 MEETABLING
1,666,235,979 *AF5BDD6582B2059E278BBC4CACA0E1CF836A4F71 MERLEGIACOLONE
1,666,235,980 *AF5D3C4B49AD64DC6E637D605703778C998037E3 MERLEKUZEMCHAK
1,666,235,981 *AF5EE4789E03F0E585F8F21A807F2C42071F829D MERLE.WIEN
1,666,235,982 *AF565A10A024AF0944D17FC7474D1E3FEE39BAB8 MERVIN.MILDRUM
1,666,235,983 *AF5DD05F19C767913FC88DE2F1BF0EF8CF52D0EE MERVINSTRATOS
1,666,235,984 *AF5E1FB0BB71664EA1C6750686101FE8D6D6F17F metellus:-what
1,666,235,985 *AF58117AFBDE787D8BD6F06F389E4822BF7591D7 MICHAEL.SINE
1,666,235,986 *AF50F0C40D8BDF0E4BF593F42DA47C9CD65D002F michele-nagle
1,666,235,987 *AF5AEB7F75EEA0DD9B6FC754EC80BC159715A9AE MICHELKAZECK
1,666,235,988 *AF5A912F1CF3E97CA58840F6E2E60D41D690043D milfree
1,666,235,989 *AF5027591FFF3B762F7F59A14FA9C1C95D6ADE84 MINH.BREAD
1,666,235,990 *AF54EDB57802FE65870DE2CD69EEEDB93D067F80 MINIMU$
1,666,235,991 *AF55BD4D4C06C8BA920A0E82F3B0DB8F97C6DB31 mladečnos
1,666,235,992 *AF503B0B4922CCB8503C0F62EC272774F74D761D MTUBTHE1
1,666,235,993 *AF59FA957DA84E7421B279079D54EB3EE877A138 [email protected]@+35
1,666,235,994 *AF56FC0E09A4B6CA08058A3E48177116895786E1 NATURPARKFEST
1,666,235,995 *AF5E1E964A1FD2B2AC77A0BAA9F15C750243F451 NBULEUSE1
1,666,235,996 *AF5E3FC8570A3B0A139094B48E0B30A81029796A NBULLISM
1,666,235,997 *AF5E7DB0D185BF8FE49632002FE40C3CE37DBA68 necessity's
1,666,235,998 *AF55B7CB861F90747D8C2C281F56280A37B1A759 NEUMLAV2
1,666,235,999 *AF5655453F659B8A27D8A98F8BFE67EF00B80004 NON-SAFARI
1,666,236,000 *AF576E66DDA8959466153AAD5DC4D16278CEE0AD NUMBERS.JANSON
1,666,236,001 *AF5035463C74296318A7445584D96944B796CF1B NUSTABAS
1,666,236,002 *AF5A718CD288793696C6CB806928FA432A2DECE6 NUUMBER2
1,666,236,003 *AF538DC5256B5FADF970C08A6C1D0DD692992AD0 NWOTEEBBED
1,666,236,004 *AF59C38F93DD2B64458D57BE9E892D714A5462FE o8mr
1,666,236,005 *AF592D237E06786AF60BC65451DD28FB305747B7 obrazpobitwie
1,666,236,006 *AF5E130D6ACFEADE48E11E436D532FFD918769E8 onewomancanmakeitrain
1,666,236,007 *AF5DB061AE134EDE5D53ED0B94DC70054799A6B5 (O_).o~.0~<8
1,666,236,008 *AF55D2E979FCB345D3565577DE4292EA0518F52B ORDIN
1,666,236,009 *AF55CD5576F37F60EE053F588340D666970B2FB9 [email protected] ~0 ~O )X(
1,666,236,010 *AF5E0D07B57A33E159D9D2FA495006D67B6F7011 PASSAGE-O-THAT
1,666,236,011 *AF5507BBFCD335AECDC9D5B4CD276F09F7BA6F9F p=b`~.(x)
1,666,236,012 *AF5842E2F30BBF7AF9696A8B13B0075E42A4ED69 PHILIPDUPUIS
1,666,236,013 *AF580224993E236ED05B895D935F280E8131E798 [email protected]
1,666,236,014 *AF54374B809676FAD30E93CE918444EA41CB2234 p##)-~o-:p
1,666,236,015 *AF5CDD6DBBF76827CFA388B40A15FCEEA68EA3B6 PRANICCHAKRA
1,666,236,016 *AF5D9E810822E30245684CDFD2BA18160CF34D16 PROCTORIMCOMWWW
1,666,236,017 *AF52693E5BD0440ABD92D0A070F396D62E51946C PROGRAMMLADERS
1,666,236,018 *AF57D45F1C79F6C079E2CB836ED2B6143BFC7896 PTSUELLO
1,666,236,019 *AF5959BBB487A303CEE0CC2B56A7C1769C40CD8A QBL!
1,666,236,020 *AF504DB0DE18CA1FA38BED6DE28E09DA80372373 QIAOGRACE
1,666,236,021 *AF5E50021BA5CFF54E6AD492E206AE19FD087233 RAMONJARMAN
1,666,236,022 *AF52114D158BBA8929B7641C8628377653D7BAD9 RAYFORD.WIEGER
1,666,236,023 *AF5525DA844432DAC4A88B0F18E79C8C12C90499 RAYMON.MAXELL
1,666,236,024 *AF57B7CEE50967EB45849E43747FB42EB8F901C9 RAYMUNDO.TES
1,666,236,025 *AF5517FCF96DF53C2524E04B8EA97B4C22793323 rbd011
1,666,236,026 *AF59FEE386383D414A46FC3EFF10F342BE25ECF7 READJUDICATION?
1,666,236,027 *AF579906463BBCE92B98D83A27C7852329300D0D REFINNEJWEHTTAM
1,666,236,028 *AF5CCF020DC5D81FE06C6C1303A86FEE76F81DD1 REGINALDJOPLIN
1,666,236,029 *AF51ECE22D685FA4CB37ADC497A7DD925E061E22 REKANH
1,666,236,030 *AF5413002CFC11A5AEF8CB56B99EEF15E11E90AE RELLUMHTING
1,666,236,031 *AF569B7AD1E54C3108FF8C24E02336D251EB1D08 REMATRICEREZ
1,666,236,032 *AF563C123A8C2705140F7E4D32EED340B19E2759 REPOLUTE
1,666,236,033 *AF52C169399B7E61B4175A83DE0F9D48F5E6EDE8 REREBUAS9
1,666,236,034 *AF50E3339CF4B38F457EDF3165C08837977A0EC6 RESTJG
1,666,236,035 *AF5C0335D55DE9E0E86D1E41AF4FF6EE1E35AA49 RETAKSNIREVLOW
1,666,236,036 *AF529F4BF6D21A7A7924DFEE24D285083C652F30 [email protected]
1,666,236,037 *AF578EEABBBB267617264026837BB7DBE719025D revkcets
1,666,236,038 *AF5F948875099F9930D8FC166F18AD8DA2A188F2 REY.BRANSKE
1,666,236,039 *AF5FD9DA65F940B035E56B39C863867C9692B9C5 [email protected]
1,666,236,040 *AF52E5E9D94ED145A3CDD04332A1315670E3F348 RFID中国论坛
1,666,236,041 *AF52A2320985C06CD5B8044F25D4C4CEB2991413 rinula
1,666,236,042 *AF5D7E3F66E6B02BADEBE837D6C9409CE118B5A5 r^jl
1,666,236,043 *AF577EB5A0D9CFC4970ABE48A36C23ECA7C3EF36 ROBERT SUMLER
1,666,236,044 *AF5D8700F2C250DCCEA8065FC544ECDB54921800 ROBINHOOBRIDGES9
1,666,236,045 *AF54488B3CDA71DCA5D31B1243DC056D8A89FA88 robot.beat
1,666,236,046 *AF53456AE020C50FC643E362B987825E94E3DBFB ROBOTERUNDDOPPELKOPF1
1,666,236,047 *AF5A5AB9AD519C84C162FFBC54D777D2CE65E876 RODNEY.SOLOWAY
1,666,236,048 *AF5C91C7884679BE9BE54B85D667324C38811B17 RODRIGORODIA
1,666,236,049 *AF5B7CBE99C97DB24F0948558745DF5707F20AE2 ROGER.MUCKEY
1,666,236,050 *AF5ED16DC47D304C7C2D065654D2E5831D87102A ROLAND.MILSTER
1,666,236,051 *AF5E1460A46C5AD5BCA82E98D5B855C82D621A39 ROY.STRAUSS
1,666,236,052 *AF503AFF1F50C4074A20BE4C838BBAC255F07870 r!+ual!5+5
1,666,236,053 *AF5F4C5C390DB80BC498FE5EC32939621D8D882B RUDOLPHGAUNT
1,666,236,054 *AF5BD89ED5D99A52DFF511AC757C329CE0254D14 ruebengraza
1,666,236,055 *AF54B8D3A23A0E5378B4DE79ED5DB40B6A8A5443 rufuscorprew
1,666,236,056 *AF5FD3725203CF78DFBD9BE29051FAF0C4767ED1 RUM400103
1,666,236,057 *AF541E4F17D3F97130A4A46E7B42226AF43C5054 RYAN PABLICO
1,666,236,058 *AF566DBAFCE26B5EEEDE76D61568BF44AD605275 [email protected]
1,666,236,059 *AF5949F245D35D1B7E84A2047734F9FB63F9EED5 SANTIAGOTARTAGLINO
1,666,236,060 *AF5F21F9D409591BEB89A4CEB98D121043F0C1D9 SANTOSDITO
1,666,236,061 *AF5A23A1B57373870F3AEFDB0C6288E242669FD1 scarabee1
1,666,236,062 *AF50FBE008CB4E5EF15346C132D7C0194E6FDBE4 SECURITY072598
1,666,236,063 *AF5A39BE9B37F8E1B1F352841D4D134BB358843B SELLABLE
1,666,236,064 *AF5E9B9DA5D0AA0AE596C4117F650304F1C11DE7 sfyybrgsjdw
1,666,236,065 *AF511E724EAFF736B46304742C08966F1EF25072 SHAILENDRA-HEGDE
1,666,236,066 *AF55A0D218110CBD3AC702EF3FF16BA2021E8377 shancobruce
1,666,236,067 *AF5558AA860DCE60C951939F885F9E6896ED7AAD [email protected]
1,666,236,068 *AF53737B48645A8893E0C65D6A1A82F3825CF778 SHOPGIRL11
1,666,236,069 *AF54A6FEA3322217CEA74DB95CBAB8E771B2226F SNELLEW8
1,666,236,070 *AF5D3CA8D595614E2B44EA202BE134D1CDCAB9EF SNWODTNU3
1,666,236,071 *AF5B3A7059A8A89036F29500F0EB56354CA31F4D SNYDERTAMPENES
1,666,236,072 *AF5DEC4BE5B7A2AD40717755ED4B71D7DD5617BD solmacrostie
1,666,236,073 *AF5B19E153E62E7E78A04CEBF1390C5CBF5D658B SOME.CLUB.SONG
1,666,236,074 *AF5CE81247D388E9A5D2A367473EBE70CC1544A1 SONENDER
1,666,236,075 *AF52CB5ACC1BC465074114CC34BD769374E2394C sosaysi
1,666,236,076 *AF56122BB0071FD8E16D15D91791C97B9C3327C2 spett
1,666,236,077 *AF52898A0E51CF840C27C6D68B5CC3CD5E3DB626 SSENDELBUORTNU
1,666,236,078 *AF5E2BB71575877C5C8E879388DDF879EF4C046A STACYHANDZEL
1,666,236,079 *AF5CA8BA9B5C00202FD407CBEC0E5A4C76A3FD7F STANKOVKSIES
1,666,236,080 *AF5E0BFDD1795226C0FC1E4079DBE0DA6DD3EE59 STATECNEJSIMU
1,666,236,081 *AF56444D7272A6001F0E2A1A96187014C7EA23F9 STICK.8
1,666,236,082 *AF5C9AB4B3348E5DBBAB444B76E8718682B2CE0B STRAATNIMFEN1
1,666,236,083 *AF598CA89139DE89CD330EA9E45B394A51281367 [email protected]
1,666,236,084 *AF59A4384F4A2674B79DA59D322DF1F6E8DBDB99 stuff-chest'st/@/f_,/ts//e/st
1,666,236,085 *AF53AFC2A449FDFFFF4809A2A036642E3530CEFD stuffing box 2
1,666,236,086 *AF5257FF9E77E3A4DDAE9F039D1C821090845E24 SUCCESSCATFISHING
1,666,236,087 *AF50E040E422AFCA7666F986DAADAC1FEFA33DD8 sufficientlyguess
1,666,236,088 *AF57C97353B67CB59D8B9A6326080154BCDB7979 Suite-for-solo-cello-No2,-Op-80:-3-Scherzo:-Allegro-molto
1,666,236,089 *AF52121CCDFA9617EE63D239A1348DF5729CF548 sungmarnett
1,666,236,090 *AF5BDAAEF6E92182C7140CF71BCD397B0C918C7E SUPER.DANCE.PLUS.3
1,666,236,091 *AF533E8E4365749600FCE6E37C3992BC7627C455 superperfection7
1,666,236,092 *AF5D26965046171296F09095D42B9137D643F601 SVENSKAVIDR
1,666,236,093 *AF57BF6764BE8A1C658C0DF6E4649F5394ECE4A5 SVMI
1,666,236,094 *AF502A4D0EF27DAA0E061C64972DB1F3C9A3F7FB SXYSEN2005
1,666,236,095 *AF5E64D049121C17C5A6790D9CDEFACEE4A59644 T04D.LILY
1,666,236,096 *AF5564C94BCAF5513D699E4BD32A7528009F38EB t6qiaj
1,666,236,097 *AF569C0449DF342C294D13978E4CDAE4EDF25F3D talkdanogden
1,666,236,098 *AF582135FEC8F95AEA36627529CD2B71D626D765 TALKJNDUNCANGTTALKLT
1,666,236,099 *AF5B5AB8D48F51E2FA254AF97572A06BDBACBB75 TALKSIDIK
1,666,236,100 *AF5CE86272D97236E194AEC76BFFE6D70B3BB2FB TANENTEL
1,666,236,101 *AF599931FC6D8D551F1BBA8BF9714F5D04A4DCC1 TANIYAH772
1,666,236,102 *AF55666DAD800F7C9A2059B9868F08D2FCE0A847 TEANNAHOANG
1,666,236,103 *AF5632F8D4FE8B5FBB3C03099E1A5D8DB612A26C TEQUILAMAXIMES
1,666,236,104 *AF52461116BEBA843D6019CEA137A1C22EABF151 terpss-vallejo2
1,666,236,105 *AF5C29DCE09DE700FFFC9BDCE59772E225F6E086 TERUGKOOP?
1,666,236,106 *AF548B941F390DE784FDBC6BC8B845B5B48494CE THADDEUSCARDLE
1,666,236,107 *AF544641B785322D6ECDC201B09E47284E295938 The.Beautiful.Noise
1,666,236,108 *AF50F025A0062E2A753650A5805B3B6D7394FBC4 THINKABOUTYOU(DEMO)
1,666,236,109 *AF55FCCC579D8F9B5886D62BCD1EDECBCEF3C61F TODD.PEREDO
1,666,236,110 *AF5FABBC0DF79EC2A205EEE925AA7C92D882F354 TOETREEDT0
1,666,236,111 *AF5DDFD0D4A6FDF5E67FF14EEFC656E293C22A79 tomquincy
1,666,236,112 *AF5819F69670C902EABCC91CF3E203923CF60AB2 TRANSMETTIEZ8
1,666,236,113 *AF5486660C9C4E3A0C2F8458ED8EE7525CC1745A TREYMCDUFF
1,666,236,114 *AF5CD5F51CFB8A58A432017FC0270FA889D54F02 TRIPLE XXX
1,666,236,115 *AF5B93D7711F0F2901755F6786ED639431F5AE32 TSINAYAHBSW
1,666,236,116 *AF505EB06BAADC4B7327FB45AA868900158B2BCB tte
1,666,236,117 *AF5BD609A913A985A1386800AF3FCAA99D580B38 TURNER.LACAZE
1,666,236,118 *AF5E912AEBD8D296554F3BF83435F6BC18D10790 TURNS TO RESTRAINT OUR NATURES DO PURSUE,
1,666,236,119 *AF535CA54A1BF3FCF511F6630BBFC5043E873098 tyclawson
1,666,236,120 *AF5D0853BDCFA322037A3C93097CA9DEE46AE83E TYSONHAHNERT
1,666,236,121 *AF54BE405DD56705058E9FCA106FB32DC1D7470E TYSONOLTON
1,666,236,122 *AF5156751BEF4B13156C23C6B9C6A909EB1EB803 TZERRIE
1,666,236,123 *AF5E1AA83241DDE8F963852E9BCAA63DD98F6A3D UFERBOSC1
1,666,236,124 *AF5972B9B20A639A05BF479E034CE11D081831E5 u_j<
1,666,236,125 *AF5C16377CAE72F605B33098097C7F558EBFCF57 UNFRUCTIFY?
1,666,236,126 *AF545E996D37C5C389948A65D067F11B175D5A5C UPAADHYAAYAAN0
1,666,236,127 *AF5537B1E6D95EF9ABA6032C95D10A3131CADD73 urvashi.eca
1,666,236,128 *AF593E71E90B173815A3B9E88230AEB5B7FCE3B4 user134845107
1,666,236,129 *AF5F58EF2801F2C0609E123584BF3606713AC7CA vanderzeil
1,666,236,130 *AF5118BA61CA1C32B18AB04DFFADC97411D82D49 vanmckneely
1,666,236,131 *AF556D3B5BB4D3A54A8AF84AE4494795C9304FBE VAN.PROFFER
1,666,236,132 *AF549701DF0DD44D461A3FA9100108C5CD3EB452 VCHIKKANNA
1,666,236,133 *AF5C4279CD22A638DFA753F00524BD481FED8F30 vervorderen1
1,666,236,134 *AF5C6115E6CD6BC43BFDB07C1A99130B1BF9A4EC VIRGILBIALIK
1,666,236,135 *AF5D93A93F6425D31240C29BAC5FA996CBFAE9F7 VIRMONTAL
1,666,236,136 *AF5C8E8E06B2EBBEF53E9675196B20E6E4E2A336 vjetrovitu
1,666,236,137 *AF539F729776DC21B290519BA04DE7054D662EE6 [email protected]
1,666,236,138 *AF5223B65726E7EF86DB7C2E168B578EE9B0C8A6 WALATAKOONANNA
1,666,236,139 *AF553A811695EC2231BAF3AAF8E232D23E475EE2 WALEPIECES8
1,666,236,140 *AF5FC5AC79034D2D31D635A049602117D7C80BC3 WALI.KAKER
1,666,236,141 *AF591B234B5D532676BBBF97C0AA260C422D7264 WALKERSMUCKER
1,666,236,142 *AF54B11BCB53191E438753C905B2A2E5A4508BAB WALTERJOHANSSON
1,666,236,143 *AF53AE2A9F7E6798A28B38167B46440AA8DEDCCA WALTER.MATTIONE
1,666,236,144 *AF5B900539DD3B14E0C714E1F3D6831E80752C8C [email protected]
1,666,236,145 *AF5E01A840E3B9577EB94052A8D6B074CA6BAE75 WANGBUJOSH
1,666,236,146 *AF570253DF6E02EBD565E4106BB0DEBB2BA8895C WARRENGEARWAR
1,666,236,147 *AF5FBC26A29713E0A8DE9B87BE2DBED37F0EECF7 WESSEGARRA
1,666,236,148 *AF5418FF4153F8CBE52CBD8492E53DEB272B8072 whenblackbirdsfly
1,666,236,149 *AF5F9FD0412F9CD9632196C2DCD3852F2D49DD9B widiyanto.to
1,666,236,150 *AF560CF6F2AC78C2C7EBEADE1196FD1427FAC69B WILLIAMDOUGLASSTORY
1,666,236,151 *AF5C722745CEB56BF7FF863CE24FDC244E697EDC WILLIE.GRANTLAND
1,666,236,152 *AF512751A3A857280967C0F78519AC6813C7D33B WILSONGRADFORD
1,666,236,153 *AF5813F458CA0F6F69270AA687732BDA01B11DC4 WIN-DIANA
1,666,236,154 *AF583F0A6429D29E7AB4D2B2FC909C3D65018539 wl;q
1,666,236,155 *AF5564FD536610FB7F2C424B822AA0A20D611DF5 WORKWAYSORGUKWWW
1,666,236,156 *AF5574934008236B0F13A64C6AA796232D1FDA15 WWW.CHAMPAGNEUK.COM
1,666,236,157 *AF5BB386BB464C9ECB1E04BE33B863D1AEF79D8B )x(*.*.*<###b
1,666,236,158 *AF55DEE51049866AA9CC5F0C16BE8514D62C97D5 XTCK
1,666,236,159 *AF5808566ADAE7569A905D7B4E5F342A9E780BBF [email protected]
1,666,236,160 *AF566C5ED596F80CB45373A527EBE62CC2A8C2E3 Y49447
1,666,236,161 *AF56F792FB4F68851F2E9B772918A95FDF3F228B YANUAR-CAPDEVILLA
1,666,236,162 *AF5EEE947CE1A40716F819CA32858F86F47E0B71 yhayo.olea
1,666,236,163 *AF5843C5B415963D0186C3F3506E9A43F769EDC9 YINDIWU
1,666,236,164 *AF5C51243080ECA10F4BF4F59C197F48D90C32EF YMGYBB
1,666,236,165 *AF5FA144C70B0928D306DFB0B5EFBAEE90C85EB3 YO GIGII
1,666,236,166 *AF56B5185AD32A504801B301024313168FA2916B yoke-sapto-hudoyo
1,666,236,167 *AF5E35425D0459CA378AF0D6D0E7A2A9AD034FCB YOLANDA-JACKSON-THURSTON
1,666,236,168 *AF55C2F63320319EB75A518C5AACA881EB528457 YOLINDO.YPON
1,666,236,169 *AF5E7B5A07C7EF4F4DDDAA27C9915AD493EE3FDB YUEN-PUI1
1,666,236,170 *AF55DF2871BBD32563C795C3A865E181266E801F Z<9M
1,666,236,171 *AF56A9F9D1011ACB859B7DA3A3D5020712CEB23D zachglover
1,666,236,172 *AF540723F6B77995AAC3BB21F6036183DFBE04F3 ZANOÉ
1,666,236,173 *AF5FD5A4EE82780B1002EE2A925EEFD2EE1C10F1 ZARAHOGARA
1,666,236,174 *AF5C6E0AF12FB4995CB63FA5385B71EC7F32B7B9 ZEZELRYCK
1,666,236,175 *AF547C369F5B4D7EFD50E5AA6EE42B1DCF7DC87A ZONNESTRALENSING
1,666,236,176 *AF569007ECD77A4F4E7A3F099183C084D4225BA3 [email protected]
1,666,236,177 *AF5C93DDD29346F7393C75E1191C57AE3982CD10 zrakove0
1,666,236,178 *AF58532C65D10F523066B4E9B73566CE38F45D5F АНДЕАНСКИ
1,666,236,179 *AF5D059706EA326B9B9130C67C1D63DC3E4C604C відмітина
1,666,236,180 *AF5C8C4E4F9201A43FF6087DC4E6B4F5099CC3A7 КРАЙНЕЯ
1,666,236,181 *AF5C49D2D9A941C545B66943DD74E8CDFF5DC064 КРЯКАНИ
1,666,236,182 *AF54E4B27ED2F4B08D875E0082352647CD83A533 КУПОРСКИЙ
1,666,236,183 *AF56741D8E35AACFD1EB3EBD305E871A11053E68 ЛАЧИШТА
1,666,236,184 *AF5921DB691D9694B1E5CC408A11263F135DB48C отцомъ
1,666,236,185 *AF5EDDEBD46905992A5658095AB656772C5E125A СEКРEТAРИJAТ
1,666,236,186 *AF598FF91B603B7A609B00BA93B95FAA53B8C106 сівцова
1,666,236,187 *AF509947AF14A7D22F430D0AF0E719713A77F3B4 ТРЕТОЛИГАШОТ
1,666,236,188 *AF57ED6EBA0E571B564CC437046A7CDEB90C9657 ТЪI
1,666,236,189 *AF5880CF67930A64FC4B5408E63D9B1BD40BC442 ШУАС
1,666,236,190 *AF565FDB5F31D390F8E6216EFD39F32D2E31E355 123059 toiminnan laajentumisen my
1,666,236,191 *AF525AE0F4936DEEAE1362E8BB8E280CC4857E1C 1331346 THE-MORTGAGE-IS-PORTABLE-
1,666,236,192 *AF5A88EA42FD648CD4E04BB9EE71868FCDE03D28 13CadIra
1,666,236,193 *AF5D459DF02B1203C293561949796D8B54C171EA 1438169 NORMAL-SIND-80-BIS-100-PROZENT-
1,666,236,194 *AF5151DD74EF92CE5899B33BBF0F6A7738D49EAE 1560037 useinasiakast
1,666,236,195 *AF54D36E9766723E5499B201AAF85EAB3679965C 1562945 ESIMERKIKSI-VAPAAEHTOINEN-KOTIVAKUUTUS-KUULUU-JO-ITSEST
1,666,236,196 *AF5441393B4E9DD269D6927B6057E6BDF9E87768 1649461 NE.KUN.OLI.K
1,666,236,197 *AF584F32517EC2F610F74AB29496B27C9E2C3E45 17011512
1,666,236,198 *AF503452151E43C875CB116B141E1DAD1E01DF0D 1-agoyo
1,666,236,199 *AF5FD1F236CF654715FA063252C1961E41CB92F1 1.blaesersection
1,666,236,200 *AF5AA81B359EE71DF0E93D690B55A6DA3F84C1F1 1doris-day-klischee
1,666,236,201 *AF506B11DD4F89E46D0058E7106F567D10FEC1C0 1ERRICANE
1,666,236,202 *AF5D8EF402BFB7F2C81682660218927212A29A0C 1.IVYLEAGUECOLLEGES
1,666,236,203 *AF52D0D374FCF601D50A81E12737C4F33F932E09 1 KAHDEKSANPAIKKAISTA
1,666,236,204 *AF5F146CBA312B568902CD9A2022609059114FF9 1-klamydioineen
1,666,236,205 *AF58E46006A156091EB4554A80D6DF6496801E05 1-KORVOLAA
1,666,236,206 *AF5394784FADF1A6BB3AB61D96E0E77F11B7843C 1kuchen-bernd
1,666,236,207 *AF504B735B286567009BFFDB41244C3EE5ECD2C6 1.LONG-DRINK
1,666,236,208 *AF5124F82610A1A7709771DFC42234D5EBE9E50B 1-NOLOTIC
1,666,236,209 *AF5A9B6680BA59AB299F08750E48A0104C44A0F5 1.PAKINOISSAAN
1,666,236,210 *AF5D21040603284CCCEB8DF742C35191BCF30CFE 1PAKOTIELLE
1,666,236,211 *AF50B36B275E444DF65E5A011F38629D1B1EC582 1.PALJONMY
1,666,236,212 *AF571F5BE8E681C2FE59DA39A1EC4FE7E5B3E4B8 1pasquaye123
1,666,236,213 *AF58CD3FC0C4E8EF5AB8028DFF3FAF24480AA87B 1.RULLANSAUMAN
1,666,236,214 *AF5EB10B90EBA1B6E02C2C09B58AFCCF319536BF 1TTETSIP
1,666,236,215 *AF572BF2E12611D0A67A4739503CF42335EE3CE5 1.tuevler
1,666,236,216 *AF5D2F8613B9A4A1789482D471352FFC534F3DBC 1-viestitavoitat
1,666,236,217 *AF5E57D1FAD44D1AB853428F7FCE521396E789E7 1WOHLSTANDSMILIEU
1,666,236,218 *AF5CF10657BE3D361E9D5F75E13741A0186C3EB0 1-YEARS-GROUPS
1,666,236,219 *AF5395AF2B8D4E27FFCFC46B44281A6C35A10293 1 YKSIL
1,666,236,220 *AF5F9FC4028ECCC348994639545B7318CE39B59A 21-ratzeburger
1,666,236,221 *AF57B0818649303273A9BB79DB0C3DA63A5E38B4 21th.century.boy
1,666,236,222 *AF5481B2674AAAD88C894C84F0C7EFB21F1B263F 22031330
1,666,236,223 *AF532A1B030EF4C819A257FA399E6E2D1D857D96 2309706 onapril1,britishrailistobesplitasunder
1,666,236,224 *AF5CDAFAC74D5930AA7C4D49EE174E494B6B5C00 2527UK
1,666,236,225 *AF519D6839B1AA9C96EC32634F1A082F04BA127A 263980 serbetci e : endoskopik sinus cerrahisi .
1,666,236,226 *AF51893B6236047E5BD66297FB16C486A44528D5 2693691 KOHTEESEEN-KANNATTAA-L
1,666,236,227 *AF5E57B021E019C89D99EC4BCDB0D8CD64B0BCF4 27KRISTIAN
1,666,236,228 *AF5841B7C3F571D1196C1847E9592E9BC2D41FF8 27MARCH1787
1,666,236,229 *AF5B600CA94E324C4FA3C7D1259304A18394B045 2.BENEFIZFEST
1,666,236,230 *AF51575053371855750C675019E3E8294416EDD3 2ETONSUIT
1,666,236,231 *AF5EFB04A899C64CC42986F2742F5685E91E79EF 2STRAVES
1,666,236,232 *AF5B35FB7F266F7C6833E7722B5C04D034B09FCD 2thatroxy5
1,666,236,233 *AF520A6E1696B41E0E3369AA33B4612BAD8C6D20 31-10-1342
1,666,236,234 *AF5E98FC88366A7A27FAFB83911209D4A9694B65 379796 VALISTUSAJALTA L
1,666,236,235 *AF57802C84BE8CA1C507934D972D797F2941605C 3BITST
1,666,236,236 *AF5AAED95A0FC74D04B523011CD5F28C9B6A2B86 3.chromogenic
1,666,236,237 *AF54E570F9D0D2C53EF09ACB45C2A61276364611 3COTERIEN
1,666,236,238 *AF552F1431D4CA141BDAED6BD2E35B6893A89E27 3DYSAMAY
1,666,236,239 *AF5F1EDB75554829EB197CB114906AD14D3F1841 3IAMHOSEHEAD0
1,666,236,240 *AF55C8A16223E5EEB04F09D56BEC37F479FF7880 3p~O~o(O_)
1,666,236,241 *AF558EC52B5B51EEEEBF2F5CF81153192E8748E6 3TREKJOEY
1,666,236,242 *AF566F29F379EE9CDA81FC9A6E7300A5E3DA9291 3worst-officiated
1,666,236,243 *AF5226CA9C9E846A80B2C27A2534D700EAA9EBBC 400410420UGUR
1,666,236,244 *AF55F48E4892442BC4AA43A0806FEAD29130884D 472NYLA
1,666,236,245 *AF5712F78366FC24A05974E9B9AEA66B6E225EF5 4ADDELEE
1,666,236,246 *AF53699993E3F0415AF2AE6ED1A77EB454399C7E 4EINNOLAT
1,666,236,247 *AF5E86B609F474EE93DCE1A378D0CBBA546E5F22 4ESGRIMA
1,666,236,248 *AF54C143BE37092A41C5D648D370486D4BD55B16 4JUSTICEMILLION
1,666,236,249 *AF5D23D7928E395E530E88E130496C7C6AD08461 4LGONRETS
1,666,236,250 *AF5730132FC9129AD1E2BB962A5173EC6978FB41 4LUVPLTINNJUUBSW
1,666,236,251 *AF53F5B25D27A9EF645A97EA302DB1217393E724 4NJAVAAN
1,666,236,252 *AF562F28C6402BB7FA38F100C162C7AB2C4E1B6C 4REIMPROVISERAED
1,666,236,253 *AF5C0F8592658602605ABC9A97EA1E52F36CDC4F 4RENOTTUB
1,666,236,254 *AF5A875FC6C6089EF4964D3B89332AF473AC8026 4RP3GG103D
1,666,236,255 *AF5A268423CF9FF787ACA8EB70FDDF8801B6996F 4WILDCATSKINNY
1,666,236,256 *AF5977A974C9033A302D841F85A0847078568410 4WINDSURFLAW
1,666,236,257 *AF55FC93C1134AF2FA8DE1C156428EAF8E950F1C 4ZXCVBVERMONT
1,666,236,258 *AF576125656756B8D0050F95AFAC3C9DFC7870D3 50(『fnn報道特別番組・
1,666,236,259 *AF5B3CFCB0652F46434293121D44B5AB9EE2DDAE 534LY
1,666,236,260 *AF53DE8796BEB45E1B7058F94FE2F5F6FBBCD23F 584YASMINE
1,666,236,261 *AF5D6AED7C1A0DAEE2643183EE45546DC8BCF60D 5ABSURFER
1,666,236,262 *AF5D44759F34F5E684521A9C8AF7F743341A3FDF 5CHESTERSAPPHIRE
1,666,236,263 *AF51AC1A727DCADB600CAFC8907A45975C5CB85D 5DYSTROPHICS
1,666,236,264 *AF5EB7103124B65227DF31FC90B568D92B0955E9 5GRACESYMBOL
1,666,236,265 *AF54BA0F049F39C4405BBED5C08099B5DA52EC52 5HERLIHYBSW
1,666,236,266 *AF586A7CDA17EED5F272F5683A3F47CA4538CCA9 [email protected]
1,666,236,267 *AF5E5B30B465C11C683D79AD6113D6352D6DCDF9 5PENELOPESNIPER
1,666,236,268 *AF5DA0264E37059988379CF26504D0281849D54D 5TERVALEPPIEN
1,666,236,269 *AF5320AC7D5AC3EFAD22B33FDBC716010AFE273B 5THEABC
1,666,236,270 *AF5BB815FDCF9D34837E4F8C29E776E418202F2A 5ZATAMNJELO
1,666,236,271 *AF57E3DCE3A11C619A7E9036FEBBE048E2639A42 606742 ON.KOHDATTU.TIETYSTI.RAHAPULAA.,.VET
1,666,236,272 *AF5F5A5AA8B0BED3D16033AA8068CB6917210049 610644 YRIT
1,666,236,273 *AF5FF38329D3B7269A5ECFCE4A0975E6FCC64615 640303 ne opettajat jotka olivat tulkkeina , tekiv
1,666,236,274 *AF511FB6608E46B4E67BF4F8511C348FDD7ECC30 65gewerkschaftsjugend
1,666,236,275 *AF5F1C540A026DCF5FC73130B2A7E54B8D542473 661899 KUEHLSINDDIEWINDE,DIEUEBERDENALEXPFEIFEN
1,666,236,276 *AF54F414E127E19618C440C11370C32121E9376F 697474 FAKAT SAIRI CEKEMEYEN DOSTLARI PESINI BIRAKMAZLAR .
1,666,236,277 *AF510D0D66D422A1EDE25BE1309DD1D84A1E8851 6AIRAPOPY
1,666,236,278 *AF5E91DE21120F8196133235B20B70C3F9C73E8C 6ALUEKULTTUURIA
1,666,236,279 *AF519D643AC5A561C41D003B81EAE8519706828C 6APPPETIB
1,666,236,280 *AF5735DAB1D67F3FE9AC93FFC62B2D63682679D4 6 BITTORRENT
1,666,236,281 *AF5BA04F6F8CF14C87193AE3F7BEC23037030DA1 6CHANCESE
1,666,236,282 *AF51022995D6B8EBC7B6A8D93B21D8C1B88F9941 6FONDSVEILINGEN
1,666,236,283 *AF5DEFAA38BF10874986364168034C9BE581D6F5 6SAVAGEBLACK
1,666,236,284 *AF598966EBCFE4069B6DFCB8B924EE4537072E2A 719438 siin
1,666,236,285 *AF5C5E453429542318F51480C9F4C2832DBB69F3 77412f29b5cd39c9942f24db81cc0424
1,666,236,286 *AF58FEF4E17E96900C79471C89BE9E7B04AFCED3 7ABRANGEREI
1,666,236,287 *AF554498E918745E203026CDBCAA9F7C5A963489 7CHLORGUANIDEN
1,666,236,288 *AF5394F126F5A636E39AD7ECD297AFC9A32184F9 7HAVAINNOLLISTAMAAN
1,666,236,289 *AF570C041B5039A1644DA877EDB152F3A680DF64 7IARESREVNER
1,666,236,290 *AF5A11BCAFEC4AC05258CC5D812FCB84FE2F39BF 7LATEPHILADELP
1,666,236,291 *AF54CA06881AE6B622DCC2B52ECEDF69A8AD4B0C 7REALISERN
1,666,236,292 *AF56ADD0E29BC407839FCC9E54450FA20A47F6D8 7RI$C3L3
1,666,236,293 *AF56B1225F533CCED36BAB2600C627F67AFBAFD5 7TREKWOLFGANG
1,666,236,294 *AF53A4E67EA8B5E273BBD9DEB57F63F85EECFEA2 7UNPERCEPTIBLENESS
1,666,236,295 *AF5FCABCA20DE2C0DBB9CE236ACAF1B293218115 7ZTMSSNG
1,666,236,296 *AF55DAB44D88E8C0F88801C47D9ECB7DAC8DFD92 8####@-`~-`~
1,666,236,297 *AF5DD5350BFBC7628CD418CECA3125FA225FC9F0 867530 useiden.fuusioiden.j
1,666,236,298 *AF5190114F1386BE3FB96D5E0A327B59EDFD7D41 8DECEMBER57
1,666,236,299 *AF535DEBB09A5DABFE48C79A1F65EB32E6813528 8iamcelica0
1,666,236,300 *AF5E246C7A1D2FDE9A2770F74456E4D4D28873F8 8MACINTOSALICIA
1,666,236,301 *AF5B3F4436FB61AAFFFBEAAFCD51442EDEABA3EC 8NAVALIH
1,666,236,302 *AF56408AB6FE0B11700B383C6D9A8B22465C4709 8OPPRESSIBLES
1,666,236,303 *AF543EDD7F11F971C3F843DB317B5EBBAC1C7DC1 }8{~`@===p
1,666,236,304 *AF52C2927EC8A4C8E8A254067C726BD04435484C 8---p~`}o{
1,666,236,305 *AF51A941E11471DADD9D81DDA7F3EA0FE0C31AEA 8schoorstenen
1,666,236,306 *AF57B81E1B026A5FAE52936F2DC395263C8714CE 914942 alkIS bitince , artistler sahneden Cekilir
1,666,236,307 *AF58684CD2D2B7167B2A470C08023C42F5B25ABA 92i(feat.malekamorte)
1,666,236,308 *AF5CF45275BE2310717644AC1541383C4005FDA8 9BALLSSOLEIL
1,666,236,309 *AF5324B990A3899183C163A04CA6170D09B8A224 9BUSKADSER
1,666,236,310 *AF5F5937B9B818D5DBBB34FF79A394A53BF22482 9COMPTONCANNONDA
1,666,236,311 *AF5759444E27E29240C8ECC47D6E2B9090C2A7FD 9CONVENANCESP
1,666,236,312 *AF5D0AE17E5F1F07DE736FA41AC59E30550D4200 9FLECHADOR
1,666,236,313 *AF5AAD1D7C7F6364F605DEBFB4C23F5B6B194443 9INDUSTRIESTRUKTURENBSW
1,666,236,314 *AF573CD690490C5A2872E52E028CD2D0BBEF1C6D [email protected]!SMS
1,666,236,315 *AF5F3C61C01DC30D4E176048083D8616AFF08532 9OVERREDENS
1,666,236,316 *AF5A2893112CB54117FD3BC52E13BF91C6CF83C3 9SEGMENTA
1,666,236,317 *AF5EA57B588011A608C422047F3A399F4A8EFD60 9TARADAY
1,666,236,318 *AF5FDB90AAA55A2C49196C7584A5D1B3CD0B87A8 9vxf
1,666,236,319 *AF59CEBD9C2F21DA56DD70469003EDF2E844A85A A1G,
1,666,236,320 *AF50F9597D513EF9877D07E8A65A3E43DA9ED560 [email protected]
1,666,236,321 *AF52CE79C1B69BA331EB361F9368427B9E3707DD A4FK7
1,666,236,322 *AF541FEDCA517DA01D259758C6A327AB1AF4CE86 A88r3va7ng
1,666,236,323 *AF56A14D0E001C18184D04DAD837512365A59427 A8UQB
1,666,236,324 *AF5E17DD1D3CEEBE625B03F9148CB99CA6BAAB39 aaronmilin
1,666,236,325 *AF556318CD94E5D0C9398C3EAF98E176F8226DB0 AB2A&
1,666,236,326 *AF5C2B3EB405EFD8DEE4649E2D4E5509E5948F74 accountancysmuedusgwww
1,666,236,327 *AF5E330DA0347B5DB55B1A24A8CC16B997BA289F ACD;C
1,666,236,328 *AF5BD7FE55ED746B684301DC82383F2F961DB479 aclearview(a)
1,666,236,329 *AF5658810DAEB100BD822C7A1C378E2429E75DBD adámkův
1,666,236,330 *AF597256BFC3A936A6B9C9FB10B721719B80EC25 ADNPR
1,666,236,331 *AF550A942327E74D4CF744617B58DFD0CA237FA1 AJXBGFA11
1,666,236,332 *AF5CA4A66CC477FED33C9E26EC72EDB2F92A295B AL.HAMBLET
1,666,236,333 *AF5C69FB83CA0B0D926DE7047C3F512B4A3D11AD a little blood
1,666,236,334 *AF50C96EB6971CF3494F9E3773BB008AEA715EAA An English Suite: Air Slow
1,666,236,335 *AF5B3721290710B3CA7C25360B00BFF5005B374E ANGEL.FOLLETTE
1,666,236,336 *AF5154A20545E8E8215A2C6CD77B56234D215551 ANTHONYMUSSO
1,666,236,337 *AF5A4D9418E789041C2DBBA87C4A6A559983886E ANTIPASTI
1,666,236,338 *AF555F6057E77E2BE215D9D4902B647A862B3168 anv-
1,666,236,339 *AF5EE99F632DB1440C6B337121EB683392FD6674 APXR+
1,666,236,340 *AF567AA3678CC240439B163752FBC6E79C661DB6 ARESEVILLARICOTTILAVALERA
1,666,236,341 *AF568E4DD7DD1B1A71F0FCAC346CE44A7BD401F2 [email protected]
1,666,236,342 *AF56600E5FBC4DED5C8D463473646644DB80E8CC arknemas2
1,666,236,343 *AF51884AE713840A4961ACECF4BF89CF45387D15 arlendelullo
1,666,236,344 *AF5B3C97DFDFCA67B3DA977F88CDFAF70BC03374 armaspalpueblo
1,666,236,345 *AF51D8AE78B4DFB44BC1FF690E8F96796BAD263E ARNWY
1,666,236,346 *AF5B2F21C9002398ED5263C23F188B1EE6E90E92 ARTHEMISA1
1,666,236,347 *AF508FC86D72121554EA31283FC94AC68FD3F9C6 AS5SS
1,666,236,348 *AF5DF60712B31A6F6A8E4A6801079103B7604302 AUEQS
1,666,236,349 *AF5BE60386C285E346C80539B080663E4177A30D [email protected]
1,666,236,350 *AF5C47C83D99FE00B7D45CC6C0B7DA4386008394 AURIGNAC3
1,666,236,351 *AF5A0E34D5865EC920B9F4986152C9FA3065B7AD [email protected]
1,666,236,352 *AF538E7C8DA74B9C88E841DB2B2EEEE87F2EAAB4 AVY%R
1,666,236,353 *AF5B08DA63B3EEED177266F4203770AB3ED98277 b.1bb
1,666,236,354 *AF5FAFD2D8729A6DC709B940B54B95DBC0A638AF b9;n7
1,666,236,355 *AF5F6F92A0322788916191B1958BAC80C5EC92DB BAM(D
1,666,236,356 *AF524476172FC12C93ACA04A27916261D7837652 BARTENDEREION
1,666,236,357 *AF55DAAE3D2ACBDC6D6A2D56BE9EC09A0732C0B4 BENJI51
1,666,236,358 *AF5E77B5176272A022EAFF5D74461BD5B9731A91 BETRESCUE.COM
1,666,236,359 *AF59DC86DA78A3761DC75D1D6A5F5A4E07ADEB73 betweenmylegs
1,666,236,360 *AF5A97BF94F98116D6FC723DDF5AF76423536853 B,Ff
1,666,236,361 *AF5DA0638200A571668B05DD65B26234C5E7B528 BKB3F
1,666,236,362 *AF556076FA0F9C41E5D69262DF657ADA5876E875 ble?&
1,666,236,363 *AF5950082F35E2AE3D0EE86FD544258003AA8A8C BOPNC
1,666,236,364 *AF533E609766841BF3C7A72C88F5CA078E1F527C BORIS.NICKELSTON
1,666,236,365 *AF516EE4FFE36A4279746A5C488EDAE7286E0CA4 bottine4
1,666,236,366 *AF5E9B6F489BABD2BF5DE8B3113A8317DDADF361 b====p`~-`~-)8(
1,666,236,367 *AF5410298B639BC12E98FD39C5C638C5993F6260 B$Q5N
1,666,236,368 *AF5824B783F05775E6AFC1E3B4DAB0FC36BD28B3 brcv:
1,666,236,369 *AF5194D1FB6F10988B7021D43FAD50C58FA7C526 BRICE.MARANI
1,666,236,370 *AF520FFFB96BC034750ED682779EBC7105451593 brightpinkhibiscus
1,666,236,371 *AF5AEA0EB43B9521B8261B78DAF93E4BCB082577 BR#R
1,666,236,372 *AF51BBFCA75C13622A5F6621F235E497CA45D17B BTKOA
1,666,236,373 *AF515C93E7957749050F96C3931D49D436B4A30F [email protected]
1,666,236,374 *AF55E74FF97AE3836D8ED8DE3287767FA93C8DC6 BwAC
1,666,236,375 *AF501D7C1E7817D73960CD34F653D4B6A498BF98 b;wiu
1,666,236,376 *AF5C3A79B99693B324553F36C7160AF0DEF9B792 CAMERONGINGERICH
1,666,236,377 *AF543A90245A0E51690A97BE1C49DA1B3279A96D CANOQUIROGA
1,666,236,378 *AF510EDC9967706B53FEB019C4E2C21529BCDA22 CAREY.CRIADO
1,666,236,379 *AF5AF6B450BC25D9F78A3D4157D890BCAF5CF968 CARLENE.HIBBERT
1,666,236,380 *AF5D2EDBC9A6CCF5E3019D738CB19E5F6EE540AF carley-donnelly
1,666,236,381 *AF5B3F8B2D0BEBCC7402B74C6BB88A4DCE946178 CARLTONKATHY
1,666,236,382 *AF5B7C57B06761093670D80273A6D110166FE390 carmencalero
1,666,236,383 *AF54C7205B1A4DE9E1095B6DD2D3E7C65F4FF223 CBTU
1,666,236,384 *AF5ED27922E053FEAF0B62BE5B0798D9EC52126F CE5B
1,666,236,385 *AF573EA1B47292758446B5566146AF7E005F7541 [email protected]
1,666,236,386 *AF5D135F8E96CBEB3C431B10745566258523F3DA CET4R
1,666,236,387 *AF574DE30264E790CD58202E7B4CE7A4363D2A48 [email protected]
1,666,236,388 *AF503376614B4694D40F6E176F8CC6B5E516B97E chc)
1,666,236,389 *AF5ABCA75F3CB37386700731D6EBC124CB9C0F7B [email protected]
1,666,236,390 *AF5FBAB6EA960614FB0BFF3056F3A5C722D92B1E chestercrimes
1,666,236,391 *AF59A66B129F98A077CEB536E91C9284A08C11B3 CHEU$
1,666,236,392 *AF556C98D1962B62351EC3B967908358C3AF1A70 CHV;2
1,666,236,393 *AF5D085941A13DA3A147590BDF4F87F2B67DF238 c$j&w
1,666,236,394 *AF568FE892C9E1662A42012AD005E02721BFC410 CLASS="NARROWVALUE">&NBSP(598)</SPAN></A></DIV
1,666,236,395 *AF55841F7600D4FEFEDD46DE268905042A270A4F CLEMENTE.FUGLER
1,666,236,396 *AF5AD0E87F815E0F5030F4E78C7F54BCB16D0AF3 CLEVELAND.PERNG
1,666,236,397 *AF50507669C0EC844585CC812D893A85D2CF4DDF CLIFFGURAL
1,666,236,398 *AF59A7D0956F5D8C24710B3FC9D279CB75320960 cliquette9
1,666,236,399 *AF57396B125BC17F0054295A2B3616EE4DF3B3CF codymckinzey
1,666,236,400 *AF51E76ADA4E271E84C8632FA9EFA286A02218D5 colombia5710
1,666,236,401 *AF57D99590B33C075C86C737B4BD74116EBF8865 corpocracies3
1,666,236,402 *AF530800D2B5D87A0675A2485B347A666B58CDE6 COTABLEX
1,666,236,403 *AF52AAA585EAF80842A893BC072E57573DF9F7FE COUNTE$$
1,666,236,404 *AF568DBCEDB0991141515076F8CF3490769BBA58 cpvr
1,666,236,405 *AF5AFA51AD587F93DD929AA0539A877F4DC6C024 d%3s
1,666,236,406 *AF5420058F1357C1576D74F67BD006935F6DC849 D<6)
1,666,236,407 *AF5A1DC4984E4951334BE497C9DC6DD9D1872542 D8JG:
1,666,236,408 *AF58F3326E2FC5F5BEEDD10EA39B3431D8B90B5E dale062fit775
1,666,236,409 *AF559580A2CE0FB4407823D1D48E7E7E8470BB9D DALEOSTREM
1,666,236,410 *AF51F08F974B7013BB025AEB8C7F60D259911B1A DAME-UN-CIGARRITO-A-VER-QUE-TAL
1,666,236,411 *AF53C3255CAC3305CB0807BB9E09BB0483C6D1F9 DAMION.CHENAILLE
1,666,236,412 *AF53A8F11D61AE6E0F74BCE0E6EFA544B1467805 DANNIEKISSANE
1,666,236,413 *AF5269130DACC6030D28BD5864F0B47A7C32DB98 DANTEHEARE
1,666,236,414 *AF5423483A3F4B850A85D2D5B339FACDD485C19A DARIUSFURBECK
1,666,236,415 *AF580D31AA5568A4801FDB4418D666E54286517F darwinpuita
1,666,236,416 *AF5B4D59FB0A014DA6151B5798349FAFF23BBB94 DBBLDKKR0
1,666,236,417 *AF5041DA4441D072B0885CBCFDD1587173C25D63 dboqq
1,666,236,418 *AF509C5C56C7E07CFE2B00C8BFB76D47D129AD46 [email protected]
1,666,236,419 *AF5E5B77C50F1FC3A75F4E896ACAE6C0795190D2 DDV:
1,666,236,420 *AF5E418C86D68952A1172608EE3BD288B0645F7F de.bornos.a.villamarin.(malague
1,666,236,421 *AF57912EBE7AAA57E18360E336FD26902B0F2754 DEMARCUSNOENS
1,666,236,422 *AF556AA8DBEFA4760B5A6E073DDB021EEBD7614F demontrelll
1,666,236,423 *AF5E0162F0A5C5EB2C883D5C95FE47C8C7873B3B DE.PREMIERE
1,666,236,424 *AF569BCE08A083C982EF10D2873632F4FD84EFF1 DERICK.HAJDUK
1,666,236,425 *AF57C959965DEE27FD7AABB1D95130C07122C4A9 DERRICKBOREMAN
1,666,236,426 *AF535706FC2555FE2E07EF7DED619B587E3649AE DESTRUCTIONMANUAL
1,666,236,427 *AF5A74B6FA24A7E626206E0A1286AF4EAA865F7F DFW$S
1,666,236,428 *AF53263F7C763FE39EA48A7199B0E8BC661A5DB2 dhpip
1,666,236,429 *AF565A8124A4A35267899B86B945F80EAB1D1913 DieKuhbeimFr
1,666,236,430 *AF5478A2380A0C9BAA510555C805AAAF1A08CF79 DILLON.ROMANOV
1,666,236,431 *AF57B52A7029EBBACBE37C1E65476B6D8E07E742 diting9
1,666,236,432 *AF5CCD9714D470EB006121BE1954DFDC30DC504C [email protected]
1,666,236,433 *AF532DA65E928CE11D425F7A6C1BB899A8B41F93 DNALMUC3
1,666,236,434 *AF511ED193D351F040D72AFE00EA5E6529F33EA5 DP4M
1,666,236,435 *AF575C1A6D408444C2BC784CC0CB647064688D8A DRTANGO0
1,666,236,436 *AF5E599880AE21B56128F14B7C3E730943B57585 dshl,
1,666,236,437 *AF5FA424E5DACC4B2AA191041251BB0E7E18D654 EARTHDAYED''EARTHDAY
1,666,236,438 *AF50C538859FE717CCDE863EB0E0F0DBDFC7EEEE ED.AW
1,666,236,439 *AF5D4295E4A9AF78CEDC2A7AAEDC1E86ABD32621 edu:n
1,666,236,440 *AF54A1F628A5AC7BC406B71AFD8F1DD4A4767029 EECHEESENG
1,666,236,441 *AF5C8889C0A083D5FEAA3AB386B79F5DD81B168B EFEATHER9
1,666,236,442 *AF56104A3A65F14564CC628B8C75BEB6EEA31AD3 efrainspike
1,666,236,443 *AF578D832DF6F576DB8D94E7DDBBDC4F00B75607 EFT
1,666,236,444 *AF54A618948D6D47163FDD33E2DCEB5B018709C1 [email protected]
1,666,236,445 *AF53DD95BCE0B4CF39123721DB05E9BFD4E6EDB2 elbilforum
1,666,236,446 *AF5D2A5903B33A785D635014ABB5ADEDAA0C0FC9 ELISEORODDENBERRY
1,666,236,447 *AF57D4FB69DFD175E1DD829232B5B7CED05586BA ELSA-LISOUSKY
1,666,236,448 *AF5375E3D4FEDEE90B6E939BA9C1C475F9340D94 [email protected]
1,666,236,449 *AF5F0B486454DA2F58F9C576CB92BABF8FE4DA36 EMMETTTOMASSI
1,666,236,450 *AF5F0F5107ED73054D2DC30D3CD721CB5CB08CD8 EMMITT.MESTER
1,666,236,451 *AF5F9B841B36BAFC6D72F0B6A9EB4E6DEE6A9674 ENDETTIONS
1,666,236,452 *AF59CA1B36D41F87FD53782043D02BD405677CBC epifaneiakoi
1,666,236,453 *AF533F00ADB5BAADBA4F32FCB7A0C3E4E61ABD17 [email protected]
1,666,236,454 *AF503B30BBC83EDC0620FAAC824B93F17AD6DBBE ERIC.PICKETTE
1,666,236,455 *AF52E3F2168055F93C8F5DF8C5B4CDEE714C1E61 EROLDRIB1
1,666,236,456 *AF58BBCBECC57BF93793502F7E4367977400ABCC EUGENIO.VANDERMARK
1,666,236,457 *AF5E2E27ADB5CBD80DBE0907274EEA0AA8D45568 europeancompetition
1,666,236,458 *AF5357236749F8BAE0C39F495A01E6DCDB9808B1 EXPRESSIONNIST
1,666,236,459 *AF5881114340E07BFB95C7A5AA7CBD24B9D16785 EXTRÉMOFILY
1,666,236,460 *AF5A743A1DFD69944E5A28504FCBAAD6E3B5AC2A EZEQUIELPIETSCHMAN
1,666,236,461 *AF56EDF858F935561EB87CE04F9AC7FD4AFBBB13 FAHRPLANM
1,666,236,462 *AF589DAEDE3C1AFC9EE37D057C4A5E6A876F790E FAROBASSO
1,666,236,463 *AF589B6EDD5CB47269E3F2BEE6AD510CE294F950 farv
1,666,236,464 *AF577B82F8D6BBC0438AC54246C920933CF5BAD0 feroyt
1,666,236,465 *AF5817F93DFFD69916E1FD5ECA63734DB64FE92C fertiggemacht!
1,666,236,466 *AF5419D2524A1D933F48DCA3CCAFE476FE24AD90 FOIBLEFLTES
1,666,236,467 *AF520673591C1936C0913CADDE6B10CC858B4718 foidbswed
1,666,236,468 *AF50392DC0F2F49B7B2264F41303137B530C1D39 FOZIA IKRAM
1,666,236,469 *AF5EF4128113928650614887FB3F112BFC2E5EAD frank-lamaster
1,666,236,470 *AF5C65BDCAC9BD0344B196A1D8B63A6883782C6A freddiemcelyea
1,666,236,471 *AF5F9BEC8EA6D5C9C4F13399201E312DA8ADF133 FRHTELHISTOIRE
1,666,236,472 *AF5C4CE7D64DA84C2CBDD68227F9514BEBF9D0DF FSHJESUS8
1,666,236,473 *AF5B97E4E3609DB6C34058A162F450BEE6728D7C [email protected]
1,666,236,474 *AF56641517A79CCF8B95C8CC568CBEB1F8126D0A gabriel.roos
1,666,236,475 *AF5273E5137550CD82CFD73834D73BA700E6F937 GARTHBONACCORSI
1,666,236,476 *AF58049AF0CF7B37A79BCD144FD09AB41C2022F4 gastonmadine
1,666,236,477 *AF5AA31B7F3F383E7C1377E954DA78C718339D3E gealageas
1,666,236,478 *AF500FE2A16BBF4AB7FBF762F84AF0688D3B9B32 GESTART
1,666,236,479 *AF5F865E512EEAADB399323A1E96B054B20FB719 giovanni-speranza
1,666,236,480 *AF577EB3068DF13839BA2EB4CCB94846CA3BEAA4 GKUBLIN
1,666,236,481 *AF53EAE59FD4F2F483C7EFDF6D81C65891B91AE2 GLOBALE ZUSAMMENH
1,666,236,482 *AF51BC41D3A077C72C667D8779692EE20A6B82BE GNATOSTOMÍASE
1,666,236,483 *AF524AC566E6DE9066B70B8E33CA98F92E4DC446 [email protected]
1,666,236,484 *AF5D3E45D8C4EA90BC77FD4734B07725C767DDA8 GRACEHAYES
1,666,236,485 *AF52DFDA889024C8FAF05DCFFD4B3DAFA8D3ED3E grasnamos6
1,666,236,486 *AF5C3C94B1B24D5BC223B3A5EA627A46B0EC04C4 GREGORY611
1,666,236,487 *AF552A586BB8C08DA4294DE6F1986B19B97AC136 GROSHROSH
1,666,236,488 *AF5CEB848710E96FA98DBE0A5D6F5B77A29DDB39 GRÜNIK
1,666,236,489 *AF5D6CEF452C800A27A2173140FD7119C669AC72 gurjot.sangha
1,666,236,490 *AF51B405CB26366FFA5341734980EBED13A02977 gxga
1,666,236,491 *AF55709EED17DDC5B7B57888316FD262C76FAAED HAITSCH0
1,666,236,492 *AF5DC77F5E8D097437FAC7E02A1954B3A038DB4B HASTORF7
1,666,236,493 *AF50C7034EA41AE3EA6C17A479EE288741515E2F hawrylo7
1,666,236,494 *AF528E97F21550A52CA4F1F93BEF94CFB0202BA7 [email protected]
1,666,236,495 *AF527DBDBA357DC2A1B307CBAEA9144F401C514E hilo-high
1,666,236,496 *AF5F67511D17A5B60A26D65AFBCC86955CFA3762 HINN1
1,666,236,497 *AF5C051790B59AA3C5D33A396A7CC79AB0E39FD0 HISTORYIRISH
1,666,236,498 *AF514B8E2FBABECC597A82D7DC9A56C6729ABC52 HSTARGATE3
1,666,236,499 *AF5330DB205B37FF6BDDA014773E42E378FE915E HTTPBRICKTHROWERCOM
1,666,236,500 *AF5B5EDEBAB0C55C2CD14EA8599B830A0F286C22 HTTPTONYPHILIP.CJB.C
1,666,236,501 *AF5CECA9958A50E11B163DF5F55BC82A02A51720 [email protected]
1,666,236,502 *AF5946C765A8C3F22BCE6D7F9A8B03E0664DF364 ICHNOFOSSIL0
1,666,236,503 *AF5E542F659654427547D732E6DB6099EC30D0EB [email protected]
1,666,236,504 *AF574DE40695EC972DCAE8832F7BCE240A7C2A70 IEFDAKTN8
1,666,236,505 *AF55D6F48EC623E3CB49BE974AE10CC07E2A128E [email protected]
1,666,236,506 *AF57C2753725CF2307133E217C9956BBBD96250F IGNACIOGAZAWAY
1,666,236,507 *AF5408E421C2BE93C4664F4F0E5B6EEB078DEA08 IHIITAM9
1,666,236,508 *AF50680F2CDF1A2BF22666D6004844D91380BE8A ILOVEFRONTIER31
1,666,236,509 *AF5FF9AFC62396994DA7DF5D7BE339A4F6EFA6B3 imitereis5
1,666,236,510 *AF5C114AA47EFDC6C09A6930B26776A43239625A intimianolocatie
1,666,236,511 *AF5AD053F0248C45BB037B9CBF04135213185E00 IS%K
1,666,236,512 *AF526BCD5523F38DCE5F17B69B44AD8B07E5DFF3 IT.HAS.A.TREMENDOUS.BUILTIN.MOMENTUM.THAT.WILL.INEXORABLY
1,666,236,513 *AF5AB4279B1CECE58D0B3A446C05082162EE111E it.just.ain't.so
1,666,236,514 *AF5E5EC93A9331823C51EB23CF7A68A7EE3878E7 JAIDYN-KING
1,666,236,515 *AF5EB8AE68BFA09C0FFFBD09C70C7FFC6023A2BD janettelavilla
1,666,236,516 *AF5201945EFFF010D69A71109BC5174CAB54CCA7 janinepixxi1
1,666,236,517 *AF5DBA35858FB1ECE0D7A4B7A15484C3BB275BDC javorník
1,666,236,518 *AF5706E50A456B4EAEDA77727CFFE41C81EBAD3F jedkilloren
1,666,236,519 *AF5322237AED35ED8DBA2CAC1421900E30BB9FE1 JEFFREY.MADDERN
1,666,236,520 *AF535B0A735D92258CDFF6F0523D54BBF447F22B JEFFREYPENANO
1,666,236,521 *AF59BB416EB9558E41D00394EFA867F8C8F23C15 JESSEBURKE
1,666,236,522 *AF56E0EABF4F0762760B81CA27E60510BD8574CB JONAS.CENDAN
1,666,236,523 *AF5AC227BAA2975467D1B1CA202F78D3187EB1B5 JOSIE129
1,666,236,524 *AF5960312BFE46B5F5AD7C8D7D90524D1B6ED419 [email protected]
1,666,236,525 *AF537ED2E2DA7B682C937388FCAB0A606A450A34 julianpeckinpaugh
1,666,236,526 *AF5A2411A2A03DCCF2B3E19EBA624A0D58E4C1F2 julianshiigi
1,666,236,527 *AF55DD45C9DE31FFB1659F3C0ECA3C4823A3EAF5 JULIO.PIGNA
1,666,236,528 *AF5BD0071FDEFB2B2F4EA05998DD73D753A14742 [email protected]
1,666,236,529 *AF522BEAF21923E7A2882280A4BCD7E3944CCF20 KABYLE
1,666,236,530 *AF5454099C43AC45FFD12CAA939C4B2A11888E7E KARL-NAGEL
1,666,236,531 *AF52655936448164BE588911E397E2552182C3A3 kaseyleimbach
1,666,236,532 *AF5B6B0CBA75CD053D0113918A7053B91F87AA84 KATHERINECHARLESWORTH
1,666,236,533 *AF5BFCB42EE516B67040F4119558C7B961AD30B0 katy-song-(edit)
1,666,236,534 *AF5DBE928582099CF22814FEB01941FD82234128 kennethcopeland
1,666,236,535 *AF5C6AA664AB55C6AA98335DFCEAA94AEE94AF49 „KESTO“
1,666,236,536 *AF591A75B3F6932982353980F30A86E3743A6D14 kevinkrush
1,666,236,537 *AF5AFC17C7754D6326114DAF034F96763A096CA4 KHALINAN
1,666,236,538 *AF57F5314509EF3DF1DF04D18B9CF5AF1226B6C3 KIEUAI
1,666,236,539 *AF5FB979C5420AFE0EC9A17A0728A605483F6F55 kinetography5
1,666,236,540 *AF5049D53E816B8CA014B22D211B8C707EDF18C3 KIQZESEL
1,666,236,541 *AF5C477AC7183CB62116B8F6C73F3D784A180034 KOMMISARISKE
1,666,236,542 *AF523390D75F7E77F767703B5A7647BE3580CCCE kotkatkin
1,666,236,543 *AF5E60F503949C971CAC45B250EABBF845555C29 kruber's
1,666,236,544 *AF5F32C70103ECA0672DF4BA7FBE42969E2A4050 KVIKMYNDALISTI
1,666,236,545 *AF554A89D844D63B73FC4520974510DAAF413B55 KYKYPUOL
1,666,236,546 *AF54DF44762CF59ABE6A3FBBB9F92E488ABC0AA7 KZSC
1,666,236,547 *AF5CBA74EE44B1C0BA15E3640309C6C065BA1475 [email protected]
1,666,236,548 *AF5D4DF1E4B9EDDE88C06AB15200B720655B4751 Lars-Demian
1,666,236,549 *AF500ECC4836721F75D2B47D12E31535F5B02487 LAVANYAPATHURI
1,666,236,550 *AF58600FA41AF0BF34092B081AACFA552345BF70 LEESHERLOCK
1,666,236,551 *AF54A77BABEBC27E6F8FB035B84E8462398B3122 LEN.DORAN
1,666,236,552 *AF5E1CE7F457284F79200640A09D6A3F2BED85E6 [email protected]
1,666,236,553 *AF54E649024449D7D17FB33B116B87BC0F056BF6 [email protected]
1,666,236,554 *AF53D35462A61CAD69945822C4E16DBB95B8B5F4 loironnais
1,666,236,555 *AF548F3BEF8237B6B69F46415BC61854C82749DB [email protected]
1,666,236,556 *AF59E9F7C26B90EA84EB8A2E56A31D72AB3EEF50 [email protected]
1,666,236,557 *AF5D88094639922725179D7433546ACAB2F6CCA5 LONNIE.BRUFF
1,666,236,558 *AF5FB8EBF67289C976C5B1FB636988AD11831948 LOST-YOUR-LIFE
1,666,236,559 *AF5FF9733E77E6C5F3A3EBEB3A457C6EC00FDC14 [email protected]
1,666,236,560 *AF5DFCAEC2B75FF1DF305C064A27D031AE2B5510 lymanargrave
1,666,236,561 *AF5B8EBC61B1F22E6C3A58428D663737AEEF602D MAGNIFIAIT8
1,666,236,562 *AF559B285E2CAEF735BD4E30DAE62B9C1396C1D6 MAKYAJLARINI
1,666,236,563 *AF5134641065B47B62C888AA7127DEDCE72C0F9F MALIK.WIEDYK
1,666,236,564 *AF570DF6050578AAE56562CDF13459146B8211FC manderemmo.
1,666,236,565 *AF58C821108931CAB02D1895F1A1CE37607E4989 mannewcombe
1,666,236,566 *AF54474EE18B75F07418070B6BC6F0812CEBD782 manuelpuglisi
1,666,236,567 *AF5807FA969B2BCADE457CC4A20AB48E8DA6D255 MANUSFAMILJEN
1,666,236,568 *AF546EA3B97315A8017724E9454A14DE6710533C MAR7IA11ING
1,666,236,569 *AF55A253301E4BDE6BAF6203ADC17A0D71D57EDA marianitacruz
1,666,236,570 *AF5863E5CA6BCF7C8C55C5240B069117E2727D47 MARKGABATINO
1,666,236,571 *AF51E9C515C51B08E59AE1D2D3203B8626D6290E MARSHALLMAROTTA
1,666,236,572 *AF541D9F1CD53F5C35B6C95C3C0596CABA89F7EC MATORGIE
1,666,236,573 *AF5525FDEE44C28D9D2C1303446EAE6C4789A94B matt.hallmark
1,666,236,574 *AF5F8ABD30F8F237225272116363EB336778CA19 MERVIN.PIPPEN
1,666,236,575 *AF5BF2990EB346CF64A74CCFB32307DB104E00F5 MIKEGOODHART
1,666,236,576 *AF5900003783D13A2CC971ADA04079978019F41C missverstandene
1,666,236,577 *AF5892CA36BCEAD574414ED92A63E7ED7B99E040 MOISESBANSE
1,666,236,578 *AF5A73025AC67862E20838A574B5BF2C11967FCB MOISESSLEETER
1,666,236,579 *AF5E4EC9FBC6B40803FB052B30B3A3E55F213732 monroecostigan
1,666,236,580 *AF5725A1314FDF8EDB5A253CB0844F4215D91F71 MOOKIEMASTERS
1,666,236,581 *AF5363BC563C02562F88D09C94E8503660B118F0 MOSHE.STAKOE
1,666,236,582 *AF5D041DB05FC9E026F3F09B93537C95E843B749 MSJASHCED
1,666,236,583 *AF5F57C7893F034EC6C9304699DC19FE40E0C27A mx_8
1,666,236,584 *AF590956729C96A0D321B05E2F282B3AFBD56E2A naomilarge
1,666,236,585 *AF5FE7A9CB89735458CF9B69DE44B8D385600461 NCHAMIEX
1,666,236,586 *AF53DF73DAD2CCF5F47AE3BF4EEF0F5071EC6D28 NDER:JOHOHOHEJOHOHOHOEHOEHOE
1,666,236,587 *AF5F92470458B3E3F82342B4F25BB4F5507FA6FB NE`K
1,666,236,588 *AF51ACFAE24CB6107564A0D1A79426DB13F9DB51 new25658
1,666,236,589 *AF5E163AFB9CA00303B94A24341202C3843055ED nigelcomfort
1,666,236,590 *AF544CAEC1EC84D032634B9FE4FDC473CEACA68A NNONPROROGATION
1,666,236,591 *AF5983EC0DF6EB5B729F51EEF5A65DFE55A03480 No1 IN THE UNIVERSE (unplugged)
1,666,236,592 *AF52A2FF1BC2BE792BD3FCB3F67CCDFD261B7034 NOAHBLESSMAN
1,666,236,593 *AF53F55E0C54CD6A1D4EB98ACFAD2FD1F3A338B1 NOCHLIN6
1,666,236,594 *AF51CB7041EEAD8B48BE05D8707F59DCF7F09C3D nolanamelang
1,666,236,595 *AF5794727737B6FCE6D903997BCCA8E7425C87D6 NONELECTIVENESS2
1,666,236,596 *AF599F111E9C785FD525DC0C8CCEB03B5E1EBBCB [email protected]
1,666,236,597 *AF56EA6AB0FE57E809430FE38C39D7554A3058AA NZNA
1,666,236,598 *AF55AAF344D5A8BB99BD782A4ABBB355C20407CF ODISHEYN
1,666,236,599 *AF54265A231180DEC8997D2AB621700A86177471 Om-Shanti---Vejledte-meditationer
1,666,236,600 *AF5BF3E6962DF20C72695FFABC16613C6225213F ondergebrachte
1,666,236,601 *AF5856DB84E163F684644961F304987307A1B819 [email protected]
1,666,236,602 *AF5ADC1EDA7F62E35CAD8CC1CA5B5FE3D99D4EC7 OWENBLANCATO
1,666,236,603 *AF5A7F52DB6F4862A7214EAFF4292C3520F156C0 oyt1t01323
1,666,236,604 *AF514C20DA9FC5CF12AA6DB941279D829674225D Pagaidi-mazliet
1,666,236,605 *AF575C098C01FD028107399D88E1C9231DAEC8DD palingst8
1,666,236,606 *AF593A8F2627B3C94AC155C6542FC710F4B814E6 panasonicandsamsunginvestinsibeamtopromotewirelesshd
1,666,236,607 *AF527DAF9650C232DB6EA6B66866A6280108BEAF PANTHEIST8
1,666,236,608 *AF55BA64A71F03B67E7859F4F8FB155F1DCA9D70 [email protected]
1,666,236,609 *AF585D2643BE18348B13518A554FA2DEFC186FD7 PB`~o><
1,666,236,610 *AF516642F443C6FEF196A597C1E098B73B27933E [email protected]
1,666,236,611 *AF5499835E05EB93E9298E10E509EB8BEEA0BE3C peter'sfamily
1,666,236,612 *AF5557773C8366BE443C4D74B193CFDFAD36F37F pierrepascua
1,666,236,613 *AF587E3302904ACB5346A2F47688B1903D6E5309 [email protected]
1,666,236,614 *AF54BD94BC304446201038FD918A6A0F77EA87E6 PISRBB
1,666,236,615 *AF5BA4EDD4FE416136DF6F94C01A24D1C407ED8A PLUR1SYLLA81C
1,666,236,616 *AF58035CB65A968F24C02BAD0E796AA99F0BF8DD p----->~ `)o(
1,666,236,617 *AF5532CB77BAA92F18E443B6A1A04204F2F977A7 porterkourkoumellis
1,666,236,618 *AF5E147237E23B9D663CF51377CC6E96E425C586 PORTERREASER
1,666,236,619 *AF57F43C634BF6FAA74B7C4A933CC240A4D20532 pr05ecut1n9
1,666,236,620 *AF5B60FC5A195F50CF62795F00081F290691BA5B [email protected]
1,666,236,621 *AF5D2C798BE8D02721AC4A8BA7ABD36AD3A88CE2 produrning
1,666,236,622 *AF56179DA030D96C5AD5E830E4380002FB8F6381 pungey1
1,666,236,623 *AF5B6EC1FF654F76C364C74302FA91673B5B7222 QBCX
1,666,236,624 *AF5789F259A7FC7EAF41C797BDFC5BC4EEB089DC Q[J\
1,666,236,625 *AF5387D587CA03DF7260FC71F12DED62001AC9DB raymonmangon
1,666,236,626 *AF57E103286DEC545F8AA85F8850E3B4BF63FF5F RAYMUNDOYANNONE
1,666,236,627 *AF52C38B46BF16DB1E202C15C0A7CEA99CA7926C READERCASEY3
1,666,236,628 *AF57694F6CC7375FF1ED27ADB860ECAD0FFF9258 rebeccaabrahams
1,666,236,629 *AF58004427FB90F149408EAAC2B33715DC0A228F RENATO.RIGGI
1,666,236,630 *AF524B9C4C6669E05DC54B8BC810F075E907B8E3 REOGFAREOGFA
1,666,236,631 *AF5C800B596EC0ACC0760B729B0E558957000863 RESOFASTYKKED6
1,666,236,632 *AF51A8BEE9D2DA8F0A331F6C557B7B724C0EDDC1 reveriez8
1,666,236,633 *AF5CAA6993AAE24656F44E6C36C0F5EF3EED7A9A richieokafor
1,666,236,634 *AF5E014DC35BB2443FC680BFFA11E90719B46B16 ricochacha
1,666,236,635 *AF5E6AC066A3DFC374D7779A4B9E4978AAC57C5C ripamques
1,666,236,636 *AF569BF8C5F269DA67E1773A00D85FD89251B731 RISINGANTICIPATION1
1,666,236,637 *AF582EC251B1632D5A54F927850B85D6969A4056 [email protected]
1,666,236,638 *AF5A6F84FBA41FD2FA69359B03E6634834B82211 RODRICKKLOSINSKI
1,666,236,639 *AF5E979AB6DD89080BABB6E62BC281002BB8F3D4 ROLANDOSHORTRIDGE
1,666,236,640 *AF539AA71D4D6634A028CC3C0744A8009B6DC279 rolandostempert
1,666,236,641 *AF5DCC1A61EEBEE1C4D4E4033191FA8325126627 ROLAND.UNAVAILABLE
1,666,236,642 *AF558E522163077043D3F2FE5358060C377350D8 RSHARKADI
1,666,236,643 *AF5DB0FDE94227F6E952822FB5846A3B1160693E rs)o
1,666,236,644 *AF5656827D63D75ABBFEDB66DEF0AF1B5C2A41F4 SA
1,666,236,645 *AF5ED765F4282FCE0CBDD462BC07181DD3B52322 SÆSON5
1,666,236,646 *AF5D35D4990D88B63743BDEB96B47ECBF0F35B0B SAFIATU7
1,666,236,647 *AF5686ABFD938AA75ADD67E2DE9A8CAB3898F7DE SALPINGORRHAPHY
1,666,236,648 *AF58068E5BC5B075C314BC4625EC38D6077C65CD SANTANA'STOWN,PARTII(FEATJUELZSANTANA)
1,666,236,649 *AF59469B1F78E8EDFDAA0259D58268C3A0FF2A3F scsr
1,666,236,650 *AF5063CB80B42D5FF55B066E036DC9D11AEFD423 se(g
1,666,236,651 *AF57A837D2276F8F95786900429261460E7A2D63 Seven.Steps.of.Trespassing
1,666,236,652 *AF54A4D4C10390EA3CA60B452D155731710EAB88 seyinsermet)
1,666,236,653 *AF50C50F526EA161732ED212DFF9C96E92F86D1E SGNIMRALANU
1,666,236,654 *AF546DDFAD893FA9E46A331C2721130B4D587DA1 shalier
1,666,236,655 *AF53ABABF53B15596BD907FEF91B885A50D84DB7 SHELTONVENNEMAN
1,666,236,656 *AF563313CABBA486AEA97AE2ED1BC6CB54E02278 shotz1313
1,666,236,657 *AF544BBD94F3041F90BA0532819CFD82435F5834 sid-&-daydreams
1,666,236,658 *AF5E2969A45E7D1EC8DFD48684D13182408384C2 siihenp0
1,666,236,659 *AF57651AF35A4A3906CF5B36747D05587BA7F091 SĪRYATE
1,666,236,660 *AF59B749DB2A235732BA29F5B57BD4A5A4A8524E SKADETJIES
1,666,236,661 *AF5B597A79A88591FA8B71A74FE3F37A0B89C353 SNAKSGJI2
1,666,236,662 *AF55FB54CD536657D729F43C967CCC3647D7B43C SNIHSREHTIW8
1,666,236,663 *AF5F6461869DD56E8B75AA2E3A6103A9FB468EAA [email protected]
1,666,236,664 *AF509A8CA697B42E23B4E0D71F21C44762C2CC8C solcotugno
1,666,236,665 *AF5719DA55B6923EAC07200BDC354D7CCF00CDF7 SOMETONA
1,666,236,666 *AF5D39BDED91E4CAE08A0982509A563BC248569C SOREILIA
1,666,236,667 *AF503E400BD80174E149C7B673E8C2724541487A SpellbinderEP
1,666,236,668 *AF5E43B2F7E81C6E9CF56BAB27B4B3B3191AD0DD STACEYCORWIN
1,666,236,669 *AF577B2DA20174495713F154BDA94AAD0C2C8020 STACEYSNOWMANS
1,666,236,670 *AF51AB6DDB665108F2F4C1D92A783F07559FE413 STATESEE3
1,666,236,671 *AF561B1E4F8572817C67D9FE7DDC587C4BA13D0E STEEL-ELECTROTYPE
1,666,236,672 *AF5A3ECA87EC94F737CA0745E2D09DB1E219F853 stewart-hewitt
1,666,236,673 *AF583C0D1C2C17216D7FD107B293DD46D17269CE stveit
1,666,236,674 *AF5F3EAF00993F5F141BA62C642B4E0A381E87B9 suddetta8
1,666,236,675 *AF5F4A6582E68FCB0F70B700DE4B7B86D8CC8887 surferjared
1,666,236,676 *AF56A309660C1D9AAF1F00898D520953BB186886 Sydsiden
1,666,236,677 *AF5581EBB9A79687E9D5462DD25A8D7ED462C301 symphonieno.9d-dur:ivf.flie
1,666,236,678 *AF595248B120E29BB653A81943CF2DADDAA2CBDD TAD.WARBINGTON
1,666,236,679 *AF5C5D5AB75CEDFCC1005EF9E0D3D39EF90F5DE0 TAFTAZAN9
1,666,236,680 *AF5EEE38DC81F54094932A2FBEF07F8497025155 TALK91.139.225.57
1,666,236,681 *AF508DCDCAB81C58C4DF6E4F5EB5CFEFEE3722CC TALKCALLMEACE
1,666,236,682 *AF580F74D0131C46A454D1A607874B84C3336E68 TALKPETERJESHUA
1,666,236,683 *AF5F228D0D549DDBBC80BEE171BEFC0516EDE889 TDALAG
1,666,236,684 *AF583C2C9764CFB4BED7789BFC391671B3B8F8C1 teboga
1,666,236,685 *AF55FB13B62811281CAC9BAB44EA1C0F4AB208C5 teruggedrongenen
1,666,236,686 *AF5A49756B74B3F27F8148CCF57996B7E785BA47 thaddeusforesman
1,666,236,687 *AF58B176EB52CE3EA9AD4CA2E814331AA0BB6D12 THALAMI
1,666,236,688 *AF517E19A97396151948C7B3D5DB9E351BA7C3F9 theatredirector
1,666,236,689 *AF56AF958FD919ADA75916194D3FFC083B957DB3 THEFIRSTNOWELL(1958)
1,666,236,690 *AF5E14BE200ECDC91AF1FFCDF190343F186AC32B THUNDERBPLAYERS2
1,666,236,691 *AF5C764ABECA36ACBA29F27D731E7486415DDDA7 [email protected]
1,666,236,692 *AF510FF72CBB919043C30759769C1A3DAD98ABC7 TINAMEGAN9
1,666,236,693 *AF5884CBDF1CE7159E3A826B39BDC5DEEF0D9529 TMVRDPRCHRNSTCPST
1,666,236,694 *AF5ABE794DC3044DEC3C47EFE3C19DF40D7E3510 TNRETINA
1,666,236,695 *AF562AB0094A728C68DCF2EF58DF9B20790D782C tomasquivers
1,666,236,696 *AF50A12BEC22FCEC7AC492EEBE82FEEFBD91C3EB TOMBUFFALOS
1,666,236,697 *AF5B22C37233C9285ECE15316F17CE06DC2C1EA6 tomshadbolt
1,666,236,698 *AF52C44236DAD9F83FDEF7A7A8F13D5C311A3C14 TR4N$M1GR4T1ON$
1,666,236,699 *AF5A6D8160E0CCCB964B14B418575DC1A15D009F transperi
1,666,236,700 *AF57D8BEEA6533A20E850F3A22144F05A007E1AE TRERNBLES
1,666,236,701 *AF5C343A2984B2209FD7BA655E35300C94D696EC TREVBOWELL
1,666,236,702 *AF55332A787134F4428D1DFDB594D756602D9BD6 TRISTEN589
1,666,236,703 *AF5CEB3C087838EF12CA891FB372DC6AEA0D012A tristyng
1,666,236,704 *AF576830FF9CE51ABD0CEFCCABA633901C5BABA1 TSIWOLLA5
1,666,236,705 *AF53BEA050E3D0F5A3230E507FEEF28D2DCC54F7 TSWOSUK
1,666,236,706 *AF545FFF27330F9CF80A5F8C6125C4681ADF822A tte
1,666,236,707 *AF58876C2C9D2C008512DE642310E7909320BDDA TYSONCALDORON
1,666,236,708 *AF5668DBC15CE365A50E51D1C00C4102428C0275 tysonscallion
1,666,236,709 *AF5259AE9621E8999ABD73AC04ADF630FBE73AB3 uitgekrast5
1,666,236,710 *AF56F49C184A69830CB798EF5DC2A07008247282 UMRIJEH7
1,666,236,711 *AF5EEEAF6507683C4CFC150D16E4F6DCBF556C39 UNNASIRT3
1,666,236,712 *AF5F543EDBB28696A37C460B26E9848B879C01A0 UNSIGNED59.144.185.1
1,666,236,713 *AF556884A8F780167237D6678C4B559D879D3836 URKːIA
1,666,236,714 *AF519FDF4967E7C214F47F5C43CA0D66ED7F90D8 URLHTTPWWWCONGRESOD
1,666,236,715 *AF5A847771BD2E68E13F23C77A25427F4BC1EA42 URSULA CRAY
1,666,236,716 *AF5C2772BE4480507C2ECBB3A04D93C0D9B43702 USPOSTERFOODISAWEAPON
1,666,236,717 *AF580BA6B5F5E3D430204D206CB93585E7C09F87 VALERIE.CARLES
1,666,236,718 *AF52EF2C993194C42D86D2262B225493D8E48B06 VALERIE-GABRIELSON-REDMOND
1,666,236,719 *AF5C4EAF2CB59C4EDAB36793A4E6C300535394A6 VANDIPERIYAR
1,666,236,720 *AF5D2DB57D1FA5A8447A835C190425DBD24B75E7 VDICNTXX
1,666,236,721 *AF5868A3A33ABECF543D33289A2635819959A5A0 VERNON.CATHERSON
1,666,236,722 *AF5C320D9573A3EC71A1E7E7D023837D4AAF7915 VERONICA.AUDETTE
1,666,236,723 *AF51CCB9103C5FE363AE1454E126CEADF966D5FD VERONICA MICHELLE PARKS
1,666,236,724 *AF5F21DCE8D237913CD5166292E30B2C87CE62FC VESELIN VELEV
1,666,236,725 *AF53F04BA4D986B947D14807EA9BE0BC76024B02 VICKI.ANNE.MCLEOD
1,666,236,726 *AF5296ABB702FF2409A81125634A6325F1F9689E VICKYBURGESSWIXIE
1,666,236,727 *AF54525FCEEB66E2A6C0EA6B9EDFA8F6B1C0B2ED villov
1,666,236,728 *AF5D73AFC3D6BAA5C2F870498363A2F3C743DB25 vitnaswiss chard
1,666,236,729 *AF5E2294BA7B3C137B38BA54717BE7F61906AD14 vitotitchener
1,666,236,730 *AF5EFA0C110E6956D7EB47005C0F50CDBE82D0F5 vivek-prashad
1,666,236,731 *AF5666021CD206ABD77220A717176E7B10CFE00D [email protected]
1,666,236,732 *AF5200A01A13A00DC148ED78703FE204A64EBC7B [email protected]
1,666,236,733 *AF55AD06B40AF80DFB53E527A226750BCC8DB0A3 vortelav0
1,666,236,734 *AF584FDAF38FCF63F74734EBE8304802B665212C vykes-tayao
1,666,236,735 *AF518FDB01789D67CC3A7BA66727ADDDC34B7F2D WALLACEMALPHRUS
1,666,236,736 *AF5D5B98D17B6E0EC842CCDB2E3CB839B6A54E60 WALTER.BODENHEIMER
1,666,236,737 *AF538C07C89961FDB982E28308566DA583E2067D walter.molenda
1,666,236,738 *AF54E090B8D11941D01731CECAB78611333F4F35 WARNEROJITO
1,666,236,739 *AF5E41A642A2756768157F0FAEF8453CA5C8CD5E WASIMKOKAB
1,666,236,740 *AF575F81E7EC3F70CF7D9507039113576068FC1A WATTSELECTRICWIRE7
1,666,236,741 *AF56A4947DE75B5B0D8CC390292EF66FEAA3DBB9 WAYNE.NOVAKOVICH
1,666,236,742 *AF5FB783D25BB34F14AE7562B2073C56320BFB22 WEE-SHIEN
1,666,236,743 *AF556C6344ECC33F1C96B5358818EF1F7203315A [email protected]
1,666,236,744 *AF5FD0E1E19F35E71E0B614D5E4D0A431094486A wendy-house
1,666,236,745 *AF565F6AF00AE04E3B50AA1360B49DCCFD31CA8A WGB31415926$
1,666,236,746 *AF523D33FEB1CA889222E503C473264FF8B6C84D wij.zijn.soldaten.(feat.koor.van.geneeskundige.troepen)
1,666,236,747 *AF55F13627697A5B84D5890B9F90A1E553306289 WISCHREWED
1,666,236,748 *AF58B2F9609B630A2FC8194B63047810041105B4 wobaga
1,666,236,749 *AF5BB71DEECE19071597F40E653F2CCBFE577393 worse & worse
1,666,236,750 *AF550736388DF06465C0B66BD64E22EEEE1E50ED [email protected]
1,666,236,751 *AF5D84188BC1EC0A3216D2F0784F8870049F16FA WURFKOMBINATION
1,666,236,752 *AF52DC69CB6060F57E9003247D2864A797EC4026 wwwalibabascamcom
1,666,236,753 *AF55FD47A11AF2985C5806556E555EE7319A7BFD wwwbreakersapthomescom
1,666,236,754 *AF51B11E3F26E069863DED6E91264550E276DC07 wwwsilentleaguecom
1,666,236,755 *AF5597677CCFD11A4D3A83855D27287A662B9F11 WXFPIUXQQFKP
1,666,236,756 *AF5F12222F61959DF87AB7CB444B548153655876 wyn-clews
1,666,236,757 *AF595358CAE221F535AE61CE09DB90880A2FA112 X83751
1,666,236,758 *AF5BA13AB7E1ED64C6AED5625CB881C5A2B36352 xaviervanbeck
1,666,236,759 *AF5A555434488A55A4E6FC516ACE808DC230076B [email protected]
1,666,236,760 *AF5139B3D532C176D5855476C96BB4C5D27C0210 }x{~~q####q
1,666,236,761 *AF528B009BA46CEC7157687A6858792708C58A02 XTREMAC
1,666,236,762 *AF50CED355A47526CE11B1B727846AA79533F61E [email protected]
1,666,236,763 *AF53FF6C7F4A80E417848E11BAC50F65EE6E7727 xxc
1,666,236,764 *AF5B5DACCF0C71CCC02218E88C370FCE005FF232 [email protected]
1,666,236,765 *AF573950D6845AF347B4E38378D4318A2E29B119 YCORUKAB0
1,666,236,766 *AF5A994DE2BDF183101822FD99346EA611E69F97 YENNY WIDYAWATI
1,666,236,767 *AF58D62B35215C7C7792FCCBD87CA58481E5CF1D YGOLOXELFER
1,666,236,768 *AF58D04630AE1367F564A062DBAE01F20A6B5B32 [email protected]
1,666,236,769 *AF5961043E25D7E4D866A51D9659E60190D59D1E YLLACITNAMESNON
1,666,236,770 *AF50467BEF482C5DA95E0C7BE90EF0C1502BF8C8 yoori-oh
1,666,236,771 *AF5FFA5B8C4EEF7A829657373EB9E94756135699 YT.CHAW
1,666,236,772 *AF5626624AD0E2621FD0FA347C84D6CA6E9BE808 [email protected]
1,666,236,773 *AF5BEB90194C1E98A29EF18125661D01ADE0A5A8 YUKABLIGHT
1,666,236,774 *AF5A83BCC17BEE4D8EF747FCB69BD404181A3806 YUTAKA-KAISHO
1,666,236,775 *AF5C077F90642F837F93E539D26707CFB4C7F1A3 YZEURES
1,666,236,776 *AF574158D0D296EEDDA4D27C7F6AEF2EDEE45497 [email protected]
1,666,236,777 *AF50E757BA829BC5E4FAD8362D0A61DDE34F3384 ZENIA VASQUEZ
1,666,236,778 *AF59071DFB1858459B9292FECC396A80D559FA02 [email protected]
1,666,236,779 *AF5169198301F1780E8D0B1798B615BE85B8EAFB [email protected]
1,666,236,780 *AF570E056AF09C77FA8470226FD8F9EAEEF6D1B8 [email protected]
1,666,236,781 *AF53CA5711DB4C7727D257756A93188FA24E6DB0 [email protected]
1,666,236,782 *AF51AEEF15C696297F4DD9E9CF398C1A60C93DA6 ZNIGSKK9
1,666,236,783 *AF51A837CB47ACB4180FD52376ED375C68CC4898 ЂОМИЈЕРАТО
1,666,236,784 *AF5A12A0722D566D8FBB2C909D23A393961D4889 КОРАБЕЛЬ­НЫЕ
1,666,236,785 *AF531663D92A62B2D45C8F398D26C00E936F74CD мидгаре
1,666,236,786 *AF5A3A344BB0594BEF2EE1CB1A1D23C0275F0455 СРЕДНЕВЕОКОВЬЕ
1,666,236,787 *AF5D143A74BA279789BAB7BA68C998D0E0EE05A5 ТИРОЦКИЙ
1,666,236,788 *AF55CA67AC1C218D51602C6C3097D04003A676EF ФОЛЛІКУЛІТ
1,666,236,789 *AF5E916CA0561700551D921903ADF3D4817E155F [email protected]
1,666,236,790 *AF58FF492F2C54B1634CB041464AEBF5898D5FFD (>_0)-~-~-~(==8
1,666,236,791 *AF5D3DFB0F4EB2E6287B44ECBF229E0245C19966 097DAX
1,666,236,792 *AF5B9EF28032556B691D8A8D0D7E88719B052659 0PRESLEY
1,666,236,793 *AF577DEBF134B7CC8189F6F77F441B28EF3F1337 (_0)~.`[email protected]=====q
1,666,236,794 *AF5AE14DD7DB1D25855CFF29BD8C5CA3EAA4B43C 0THATLOGICAL5
1,666,236,795 *AF507FC985CBCD55D3272412ED771B2CD3376FB4 1281278 DONALD-AND-DAFFY-WEREN'T-THERE-.
1,666,236,796 *AF5631937C2DD0A931B9622B5BF56B19F69FA620 1287638 auch-dies-lag-nicht-so-klar-zu-tage-
1,666,236,797 *AF524656147C8B89C5F39D341E2CF0AD98A72194 12jan1433
1,666,236,798 *AF540E8DD07A2A17B0E2C660DCB251FFF8ADA6E3 15jun1082
1,666,236,799 *AF5CE9A4A1460DF2562420C809DC919AD3A35D86 1827445 otaniemen-kaavoitus-mahdollistaisi-lis
1,666,236,800 *AF5EBF1BD27586A3F08D189A5DCC08FFEDDE93AE 184NIA
1,666,236,801 *AF567D889E049187DED00CD8F93935CDE03E8383 1854819 WIRSINDTOTALGESCHAEDIGT
1,666,236,802 *AF5D9E5C9977ED2804D221C4B98B913134F8E5BD 1AMOP4LZ
1,666,236,803 *AF594911267CFF6B06755C6434D2BAFB0FF47C11 1-betonikentt
1,666,236,804 *AF542C1FA1CC0E4BA8E5E750903F57F06CB86FDB 1BRIGI
1,666,236,805 *AF5C4AA1F7212EFF9DBB1B409267F6D99C4FCB61 1-cromien
1,666,236,806 *AF5C8B995DBEFB73D6B0863196D13EE929D796A0 1.dreier-halbfinals
1,666,236,807 *AF5BD41F1AF09CE49773A085D1E4D8BE68A5B935 --1EAIR
1,666,236,808 *AF588271E36066E5CEC066665CBB7A56069AF0A3 1flacheisen
1,666,236,809 *AF5493F06658F0D93D862D3D5495AD18473477C4 1 GESPRAECHBEREITER
1,666,236,810 *AF5B1CDCE8E7B224FCFFD8006B5D8A4406B9A09A 1.hessle
1,666,236,811 *AF53122F29511C8863BDEAB8BEA6753B98C7B28F 1IAMFUCKOFF
1,666,236,812 *AF58E8177773ED5F902E7C8F9444837197771B6D 1INVERNET
1,666,236,813 *AF5CB068C630DF56782DA4C7F7B6E0D12A86B310 1KANINCHENPFERCHEN
1,666,236,814 *AF5CF3974F4637CA7B35077D15DA637B24E51FDD 1-KAUPPIASSUVULLE
1,666,236,815 *AF55F1D8DF147C8AAD822AC25F8AAFF584F1E0A0 1 KENNIN
1,666,236,816 *AF5841443C05686EF85BBEF55589EA38FE095E79 1-KENNIN
1,666,236,817 *AF5F90676A486F479607212DBC2B1013CBF595F3 1-LEIERBACH
1,666,236,818 *AF56AE856898771E87DAB27498278CABBBDA7740 1.luonnossaliikkumisen
1,666,236,819 *AF51AFC0DE7E1EBB33CA24D2685A3393492BA384 1 PERINN
1,666,236,820 *AF5D54AAF7784468CFD3BB31DEA94D4CE86867B2 1.PUOLIJOHDERELETT
1,666,236,821 *AF50F8FC66AB6C3389EFFDF0994B322E3465BB2F 1-satamav
1,666,236,822 *AF5AFD2DAC4E8F48EA4FF00C078EC90426258BA3 1.turvalaitos
1,666,236,823 *AF5F5D9857A94DFE4D03AD3B9CE4D97D5DFD581A 1 UNO-BEGLEITPERSONAL
1,666,236,824 *AF5EF7A9DA2348BD3A054CAA23CFE352E54C09F5 1-VAKUUTUSMUODOISTA
1,666,236,825 *AF504FDCBECF65A83BAD70B6DC0B5B1D8A95E7BD 1.VIKAANTUA
1,666,236,826 *AF53D20A8305140CBC3763759D8468D596FE0FD3 1 YKSIL
1,666,236,827 *AF5697174AA37F17E3453FD5E4F1B9997BF11797 [email protected]
1,666,236,828 *AF56962EEE194435BAC31E88C933694FA4A65142 21MARCH1840
1,666,236,829 *AF5661918B529D841A4AF9C27CB851CE33E24B05 2513967 it pained our hearts to leave kuwait
1,666,236,830 *AF5D0A219D251D4630402968279B97C5798936A7 265923 MOOTTORINA-VOI-OLLA-YMP
1,666,236,831 *AF55FCFEE175A62FC773AA02A475B58B98CE3C78 281496 PAIMIO-TAINATUKIAENSIKES
1,666,236,832 *AF5969378114A49FA93EF2425D24321A5F7F22CC 2969404 THE COMPANY WAS INVOLUNTARILY DISSOLVED NOV . 1 .
1,666,236,833 *AF504C52C689EF13DD9CCBBC9EAEE0103F2281FD 2f1401
1,666,236,834 *AF5E958948DC419770CB72197BD85AAADB051E87 2faids
1,666,236,835 *AF5D6E87B7E67636E8F23AA3BA13EAC539046E65 2 KARVAIN
1,666,236,836 *AF5FAB2428ED2618BE4C1CA4688DCF5E6ADEF414 2 MADENCILIKTEN
1,666,236,837 *AF51EB0717402A6D9365700390518F8BC19ED2AE 2PAATRYKK
1,666,236,838 *AF55C3CDC43D2973C5556069774DD4B6E8BCBB89 2SAVUTTAVAT
1,666,236,839 *AF52706BC3621F4C08AB62D6DB53D7042BB7F0C4 2-swandise
1,666,236,840 *AF597E5E3DDCAB3352692EA89C2585EE2416EF2D 2(秋田書店、1996年5月)ISBN
1,666,236,841 *AF512D257E4E33763CC9A67BF30F5BE2699C4007 3 CLOAKROOMS
1,666,236,842 *AF5BB54EAE6090BC0F0B39E6BAC4ECD346DFC372 3-duengungen
1,666,236,843 *AF53694BDAB5F3ABB5ED9EC58881109D0E47A74F 3-MATIENZO
1,666,236,844 *AF56B6C4D75E41B444A128010F4868997F16AFCC [email protected]@73S
1,666,236,845 *AF59331B94AE8ADC32879DBAC078FFEE7F0C2502 3mycamera6
1,666,236,846 *AF5B3C4F5233A52516CA4EDB1D5241732E8E0644 3WORKSHEETS
1,666,236,847 *AF5232A1D5778561FF51C6DDF1A80BD867F350A2 [email protected]~}X{
1,666,236,848 *AF52611DC34879E6CF5FB35883CF80DB1612C439 [email protected]+I0N$
1,666,236,849 *AF58008488833AEE518052196EC42969238C1C2A 405VAPAAEHTOISESTI
1,666,236,850 *AF5B5FCBE19BBB4E8038F6725F39C874349BD928 415996 USEAT-VALOKUVAUKSEN-SIS
1,666,236,851 *AF5133F8817D69F9CAE334B0400EF4BDDC347A46 4BERAMATS
1,666,236,852 *AF5A862195FA66A4BBFB1EFC0884AE69168C8CED 4HIDAITIN
1,666,236,853 *AF53BCCD9C7E689CC1AA9B7778C22C9023425BC5 4kaarsen
1,666,236,854 *AF571E798A264787FAE59ED7300425A2D3DAE141 4ORTSGREB
1,666,236,855 *AF52C8F08A0F8A33C71E1E981219A58FC7B478D7 4PERNOTTERS
1,666,236,856 *AF58CB0E55B88D54E911B85F723266E34CF23417 4USPJESIMA
1,666,236,857 *AF5A8EFA6605717D3667269E22B76E76B940AFE1 512H
1,666,236,858 *AF5A38870CFB8CCEF4B2136A644F0C53EE88D2DB 552PRINCESS
1,666,236,859 *AF5FE85B1939236B8892525E8C42D3F8AB11F175 584YASMINE
1,666,236,860 *AF59842970524696050C9C1FA5B630E85F25690F 5CATSAMMY
1,666,236,861 *AF56C2EA5B3013556AEC8CCFC6D5FB75762C9C29 5CONUSOUR
1,666,236,862 *AF53E16ED7DF1829ABFAE7474DE1650A8E9AE981 5KETTELMAN
1,666,236,863 *AF5C03F51C5C655326A1BCCB3ECA16C8A9A67324 5NUTGALLN
1,666,236,864 *AF5C4393AAC9214C101E4EBDD5B0293861DA4C7E 5 OKTOBERSITZUNG
1,666,236,865 *AF5DDAE184490A3E2BF0D42A4BC11E904487FDA6 5ROSARINAS
1,666,236,866 *AF5E656BE79336433A92282475BF30AFFE99F9D7 5TIMWILLY
1,666,236,867 *AF563CB37927ECDA45C29628D168D2A2D056A416 5TRIGI1E5
1,666,236,868 *AF5C51DC076FFC8D9F93C1EF69D7A989E58C4887 5UNASSOCIABLEA
1,666,236,869 *AF582A2023506061126A94367B5FA577BFDBD02A 5VAELTFOS
1,666,236,870 *AF5E212862A0D3CDA9FEB5B1D2F55C7CCECFD579 613779 "-wir-muessen-lernen-,-auf-neue-weise-zu-denken--"
1,666,236,871 *AF543F44BCA3C0852438FF4403DC9FC8B8A052D5 683801 HELSINKIIN MATKAAVIEN ASTUESSA LAIVAAN , TURKULAISET J
1,666,236,872 *AF53B46830F56186FE284F47746FBEA8A55D6E06 6ADAMZXCVBNM
1,666,236,873 *AF5072EF86D254068BE06A45C5F953F4B13AB71D 6hypernomic
1,666,236,874 *AF5E2419C0B32564D606C70FD43F220BCEE3880C 6KCAJPINS
1,666,236,875 *AF5FC500D96ECD176569159DD11B8DB88A7192CB 6MQUHSBCBSW
1,666,236,876 *AF513F12C2ED1BB6B4B36047ED4B82F5004626D6 6.nuolin
1,666,236,877 *AF57D2847ACD721E89412AA361EB28AC6F524EC8 6OPERASOFTCOVERSOFTEN
1,666,236,878 *AF5030818F3F5F672A0C7C89DE61FEB3656203A3 6PHILCANNONDA
1,666,236,879 *AF53F3AEC1280A6DA503E796A5DC208178D87472 6RUNNERWEASEL
1,666,236,880 *AF5728B510BA2336E7C16B32AFE46EB0C3588B79 6TRANGUGIAVO
1,666,236,881 *AF5B26E5AD0FC2B0180F160BFB36695F45707B6B 763VIVIANA
1,666,236,882 *AF5DF44C0D1915A675C75B58DA92A3F6BDACA626 7BITEMEREPUBLIC
1,666,236,883 *AF50434407BCE21521C3B8C55CCB5A00F434D878 7CUTICULARIZATION
1,666,236,884 *AF5C9639055900A193518BAFBBF1FE7678F0FBB9 7H34712ICI5M
1,666,236,885 *AF5EBDF62EF5FD510D89FBE7FE3582D6474FE4FE 7NIISIAJ
1,666,236,886 *AF50EEBE90CDF1B7F2C237AE47F1D10A8D6F2A17 7OBMOKEB
1,666,236,887 *AF5D5762A186B221EDB4A583E7FEC1A171354FA6 7outpopulated
1,666,236,888 *AF56840943E1AE8D2D0EA60CC7341A95D4B47CEB 7simmetrici
1,666,236,889 *AF5FF1263FCDC0CA9B5C22C94598406F2E1AAF9F [email protected]
1,666,236,890 *AF521141644E5EC11DDBB0C4CF11171D3CB60106 8AFGESTIPTENS
1,666,236,891 *AF528F191416C591D22E1B74231E6B9D9E169FE2 8ALLERLIEBSTE
1,666,236,892 *AF5EAEC785C791604160C1AE6EBB1E4FE1F27DDA 8==B~O-~O)8(
1,666,236,893 *AF52096BC19117B8CC4751B571916E1A54685431 8BSWQDSBSW
1,666,236,894 *AF5A3D1CC63E6BC9AEAA1BFE08032FB15C770862 8CHAMPIONVISION
1,666,236,895 *AF5E5F2C58E093B077C6BB8905C149CC246C6595 8CONUSANC
1,666,236,896 *AF5244D5535075B83658C1ECAF233FD18D6D64CB 8DERUTOVE
1,666,236,897 *AF5993F89FCB1B4E28CF056AD1A133073C3BF9BF 8GRUMPYWHATEVER
1,666,236,898 *AF571BC895F01F01256862BD8F6FE51926739D25 8KHZ
1,666,236,899 *AF50CAF0821358BD27AB0EC4D0F371C6C365A33F [email protected]`~.(x)
1,666,236,900 *AF55E226AA899BDC2DB93BFC5FE193A37D7CCECA 92i(feat.malekamorte)
1,666,236,901 *AF52E69A6D9E503D743EC0AC49612CB29429ECE5 9LUOTTOIHMISEN
1,666,236,902 *AF5B211BEF62916C65AA882BB6F003A5D054567E 9MILLIEFOOTBALL
1,666,236,903 *AF568D9B361F6BA15F14CEA5E6D90CC23AC065CA 9NIRVANAMICRO
1,666,236,904 *AF57030D7D9D2D798AA35290015400ED0A029AD0 9POLYSTIGMA
1,666,236,905 *AF5C7F9B3F572BDF8C534F08724C48C232E12C18 9SHEILATAZMAN
1,666,236,906 *AF51E26262CA87C6BB8C88B2CBA206345133F93C 9tirelires
1,666,236,907 *AF503FDD1B89785C75ACE61CB986762E8FC4BC9A 9VRZRGDN
1,666,236,908 *AF533BFBF0E5E202041A644791D34105A9BA98C4 A01UK
1,666,236,909 *AF5787B148F37F22CAA1F0DE4E8CC72A60862CAB a2/,r
1,666,236,910 *AF5A95855AFA332B97FF52776B8B7262BEB928E4 a3/4
1,666,236,911 *AF5FB1BAB515875BCAA9AAD5550A54C3D147FA51 A5K=7
1,666,236,912 *AF5B1C08486CE9FB96D93C8936096AB353CB6B8C AA&#M
1,666,236,913 *AF580F865AEA83B03D1925EF68580BB6A0D20A39 a&av$
1,666,236,914 *AF573BC66413669A74E9D275E6A62B8880D8B849 ABGRUNDS8
1,666,236,915 *AF5712FFB11E437F1BD8F7A2B999F5564DE848AF abortion'[email protected]
1,666,236,916 *AF5F8CBA95CBBFBDA3641A0072A64B7C8942A961 ABWEICHUNGSSUBTYPEN
1,666,236,917 *AF5AB92DD27AF97BE0FF94222E7358F4A17687F9 accordroot
1,666,236,918 *AF59D65142DFD517564A59B7E41E209D4F7DDB14 ACKERNAUT
1,666,236,919 *AF5EB9667BFDEC0FACC158C05CF4FDB5CAB45FE3 AD{KY
1,666,236,920 *AF509821722E27CC0B536A14A609C4DF8DB6A4E4 ahpnmmuo55
1,666,236,921 *AF5C09DC6E623050080ADB13CF87C73682F1AD20 aililiaed
1,666,236,922 *AF58B31E647A86A1F75ED688F19EE91891C5F857 ALETK
1,666,236,923 *AF52C8E5AA9F3BEE88ED487B7484BF5CFD3177AE ALIMENTARA
1,666,236,924 *AF557CBEEF2FDDEF233547DA2A6A0DD4A65D5F97 [email protected]
1,666,236,925 *AF5BE6628104177A347AAE2BD53E80E9BCEEB6F0 ALONZO.AMINI
1,666,236,926 *AF5BBBFAABB7BDA8D8FDCB63BD77C187B315393F ALU
1,666,236,927 *AF548C3E123C30F15DDF4294355142152B3C5DAE alxga
1,666,236,928 *AF5B980277A4ABD57B6F90ADBB87364AA5CF5260 ANACAMP$1$
1,666,236,929 *AF5413BD54EE70A03D9615E878730F21BC30FADA ANGELFUGLSANG
1,666,236,930 *AF5B9423039F622C46A776105866164CACB95711 ANIMATOR-YOSHINORI-KANADA-REPORTEDLY-PASSES-AWAY
1,666,236,931 *AF57AAF5A2D078790ED2212FD830EE4AE42F4F22 ANNAMRAJ
1,666,236,932 *AF5776A525A9C9052FD720AC43E4C20BFF6BAB0B antiscion!
1,666,236,933 *AF558C822AF27613FD5A0399B1B99B26E941A41A A"R&D
1,666,236,934 *AF5FD79969913DF2848F4F7A6BFEFA8B8959E5A1 arilista8
1,666,236,935 *AF5DD8D967F07E3E182B874658A46A2A84E7D0F2 ARLENMARKER
1,666,236,936 *AF5622ABBA307B63A85FE041E3D3086CE3B60D07 arlt/
1,666,236,937 *AF56CC0E1CC7666570520CB885C63E6FF51E5B16 ARMANDO.TES
1,666,236,938 *AF5331D8780766B07A53A6D8EC66F2EC7C82ADA9 arpentage
1,666,236,939 *AF5C16AB1C90E6171DC018D39741398707D2E748 ARTHURSPOONER
1,666,236,940 *AF50DE25D3C0F04216A0EF45C0A0F4A90588C1E4 aşikta
1,666,236,941 *AF5D14FA6CD6799F2FF9F4E2D3314BB5CDD55B7D associationalist
1,666,236,942 *AF5839D0ECA2DEDBC76471D81D783C2B03CE0B82 AV6Y
1,666,236,943 *AF592996E5B0C59A9E96D9725248A1F2B227C375 aweh9
1,666,236,944 *AF5E2B719C17BDEBDFACD2640949C7DB6F495E24 awseb
1,666,236,945 *AF55153E9333634BF1472266BC4A0982C0936FE7 ax.1723018
1,666,236,946 *AF538F2EC6FA2330F2E2ECD8F2D196ADA0054A3F AZWLH
1,666,236,947 *AF5C9EE362C52A9002CB7C6C288711172CC32C9E B0H(K
1,666,236,948 *AF5BEA797D9AAE6449F6A82F1C8528537820D166 bajersk8
1,666,236,949 *AF57A973439C2DCA03FF78C85AA894369AB02FA3 BARSKOR
1,666,236,950 *AF564544DB234084EBBA5EA3A0031186FE5E55F0 BASMATTI0
1,666,236,951 *AF5712B2946BC6F44C0CCAAEFDD2EA0220632932 bb(c)
1,666,236,952 *AF5B00232C5E9BB305358E18DD8099623166C651 BEDRGERS
1,666,236,953 *AF5A109D201AE90A636520D2984ED92A44BB8836 bekc
1,666,236,954 *AF5B17D89EEA3414D0F5A50C11698A887C5D3400 benteto
1,666,236,955 *AF53EC5F2EC9AA72865A6B40B31D5E20E4858F84 BESTMPG6
1,666,236,956 *AF56CA4E1EE7ADC86A72835A78EA21A829800EEA BILLYCREACY
1,666,236,957 *AF55A271438F6150F6F29AE6B4A8F88EBBB4D56F bilynsky6
1,666,236,958 *AF5956D60D3021D1ECDEC461105A0BF91C66EDD5 BLFZW
1,666,236,959 *AF55104F5C7108155E2A8882130A0C7502750FDF BLY%
1,666,236,960 *AF51DA4F038687E943E2B897A1DC29276820CA0E BOPNC
1,666,236,961 *AF50FF0C6D776235AA8030D96F3520BD5014E42F bq%m,
1,666,236,962 *AF576DD5B124D7E30AE155DE67F499BD78D14845 brcv:
1,666,236,963 *AF58CEE66E7EF5C78E62D3E56E393B3BFEA7E306 BRVD?
1,666,236,964 *AF505A79F043DFBDBA062E62E3B5145ECE0D77F2 BSLO:
1,666,236,965 *AF59181E570CADC7841D230E6F48E7B1D7F28676 bulhh
1,666,236,966 *AF537FB672DFE4CB8C9DD5CA4F40EE35C5DF60EE butcherd7
1,666,236,967 *AF567B3A81FFA65FD235F697EAF2E691A6C281A8 c$:"+
1,666,236,968 *AF5DD8688814D3E61F3B60CDA6869419A881DABC c202
1,666,236,969 *AF5718D1994E51EBB65C72074FB84102A44DF031 c2c!u
1,666,236,970 *AF597613972ACF6D60FEDEDBC46BA62DFED30853 CALORIMETRE7
1,666,236,971 *AF58E924E03ECB8AF6547EB44F634C21F5A64BD0 career:.1952-1988
1,666,236,972 *AF5E64FE777D4D170C12F2A3D9653F9DD6BFB153 CARMELOENWALL
1,666,236,973 *AF5E12716324DC4A43F6902D7629F99D05C34CB7 CARMENMILAN
1,666,236,974 *AF59EF9EEF94C430F794F8BB3E9C2F4DEA22D75B carolynvaught
1,666,236,975 *AF5BC07AB91C043C057D03D018BDCC2AF460DBDD [email protected]
1,666,236,976 *AF5059A3F8CDC2C95B5DA7D79875F97EBE27F185 cbc=k
1,666,236,977 *AF5574E7EDCD32A9B6D2496F81EC32E7A7D2E7A0 cbt$j
1,666,236,978 *AF578DA5FDDCE77D1755F0D8758D69C5FDCF13B1 CELESTE-COOKS
1,666,236,979 *AF558BF85C2CD3E237A3E700A782122A65ABAA94 CELFI
1,666,236,980 *AF526337D8659BDB5018C4E9E7232EE0B8FAAD13 chapter07-03:theboggartinthewardrobe
1,666,236,981 *AF58AE9493CD02812E6A5B8D33C4ECD96B6B716D CHER LAW
1,666,236,982 *AF57136D04DBF04102C1B057150E3B59E958E750 CHERYLKIELY
1,666,236,983 *AF56347E35D1CFB177FA3FB1ABA7D335D952C763 CHIMWAE8
1,666,236,984 *AF59A7B099A6FFEB555ACE57A170B184440B10FF CHINEUR123
1,666,236,985 *AF5EFB2006CB8FAA3962198F495E8750FABA5152 ch-jx
1,666,236,986 *AF56E8CB5BA38E8A8C71C9E47BACB9A5ABE9FCCA c(hn?
1,666,236,987 *AF5B8FD51B979B97B4A429C9D97B78E150129124 chriestin4
1,666,236,988 *AF5BB17111B14A4CF0383FD54D794EF1034FA813 christoperauricchio
1,666,236,989 *AF54722EF018EA5EBC38B71DF17A8FD66C5ABD90 chunglarsson
1,666,236,990 *AF57A9E17B1F7ED663F19BCE7BC9163E440A31DD C_IO3
1,666,236,991 *AF57EA0762259123050C6CDA4167AA9F16282233 CL._
1,666,236,992 *AF50C2C109F3F5F5EB89048D82FD8A689443779A CL=YC
1,666,236,993 *AF51A989524868A73D321774B60A31907D6F230B CME#9
1,666,236,994 *AF5BEF436964F03AE2A3E0291C6F0F68C91ABF77 [email protected]
1,666,236,995 *AF57941D43994F84B06ACB992C37C9955B0DAED0 cnn()
1,666,236,996 *AF5762DD1E4DA69586DD2773FE8A83711E40117A CONTACT-(NO-DRUMS)
1,666,236,997 *AF50BA908304D592C2E61166CE4C87E9279F7021 conulus8
1,666,236,998 *AF5E8926EF7837F72D66142FDF50715F5E041DC5 correya
1,666,236,999 *AF554B331693844E9004FCCDA1CADB0233B764D1 CpqN
1,666,237,000 *AF5641CBCAC6C4259775FE1A5760385D4854CCEE C:QV&
1,666,237,001 *AF53D5D133931AEB373866278491D7544F420A94 creation & innovation 1
1,666,237,002 *AF510D7CDFB0A76428C470DDFEEC46A567268086 CRYSTYNA_O1
1,666,237,003 *AF5F4601C224F579EB0A72340CA81C4038785013 c.s;a
1,666,237,004 *AF50CCFE7F1A90C429FA6B8C7DABE35E2A7FB2D0 c/.ul
1,666,237,005 *AF521366D2399919EAA573347A51BDD79C569A0A CZDVT
1,666,237,006 *AF5901D521D053AFC593EF8976CDC7E58053F0DD d03830219446139
1,666,237,007 *AF594DED0035B80EB8BE0608668158E2E677406A [email protected]$
1,666,237,008 *AF5581A9B3B28A2E55C9EE050F9C569C9F3FC699 d:35&
1,666,237,009 *AF57B0FBBECC15F796C03455CD1D616CF2EF3CF1 [email protected]@7!on$
1,666,237,010 *AF5012CD69076CFEC789D5CCE976BCBB60F8BABE D8lf
1,666,237,011 *AF5994B5A3DC282859AAEDD211E9F7A311B6AA58 DAGVLUG3
1,666,237,012 *AF5D47413A7F2223A3D1F131EAD09032BB0BCB3E DARIOREBELES
1,666,237,013 *AF5E987E0350AC97CFEF0CD8EA7AB1FDADF87AA4 DARRELLKAWAI
1,666,237,014 *AF5C15C8219C88538B457E4CDA062FE2D82DED0E db8)
1,666,237,015 *AF585A122273550E65D20367B99E980C060F4335 dd44p
1,666,237,016 *AF577C73DF1EA01392E2A150265EB614BCEA983E DEANMOROSCO
1,666,237,017 *AF55DE9BEDAF3DB378A0F200B6F032224002550C DELMERHOLY
1,666,237,018 *AF5C18EE8D910756A1E5384254DD68A589D894F6 D"EM+
1,666,237,019 *AF5EFBC93AFD3E50B4FDFF939FFD5177F8C7193E demisable?
1,666,237,020 *AF54D1A6790046B2BB033587765F22854660E359 dennisburrel
1,666,237,021 *AF545E796CF4DD7D1446CDF71FC6C3701AD5E222 DENVERMODERO
1,666,237,022 *AF55DEAFDB83328262EA7E778E70D9FC700D29C2 DERIVATIVESLAWYER
1,666,237,023 *AF5B3E9D825B0B9D976CFFBC5C20401B4922A4BA deue
1,666,237,024 *AF59B92CD0502BE21E26C0DE6C76877ABD6C806A D(EV
1,666,237,025 *AF512449E3DD81965E579E9DF61ED0D3C0458376 DEWEYSIEMER
1,666,237,026 *AF564DEFDD459EF7686C2EA036D22DE8FEE1A60A dfeq4
1,666,237,027 *AF5EA00A2A4CA6BCC23FF81E4245E07B68E51462 die vierte betrachtung - 'heil'
1,666,237,028 *AF5DF9DAE5AA3BD379239BF1673AAEA33C8DA876 dimrid
1,666,237,029 *AF5D31FEA0FBA730954ACAB908737905D3EEB218 DIVAKAR GOVIL
1,666,237,030 *AF5EC90F15E498F0CCDA7A2F3D5148BF0015C6EF diznfo
1,666,237,031 *AF59255931F3D41D9235FF06BE7DBD039D3C18EC DONLARRALDE
1,666,237,032 *AF50F4763FEAFDB2BC30517A4FCC15E2411EAB0C donnellmaedche
1,666,237,033 *AF57DED33D75C2C36AC571634D68931C9A9D9F2D DONNIE.THROPE
1,666,237,034 *AF56571D5B805A8C8CEE661CEE68A6A1678E76B3 d+ou7
1,666,237,035 *AF5C3B0E13E027AF2FDF1C2E1102A9233DA095A6 dp&gl
1,666,237,036 *AF52B08A5EC652AA22CA4A76C63030BA7DAFAE7C [email protected]
1,666,237,037 *AF5AD674D235E78806048EFF2F1B10656B2B198B [email protected]
1,666,237,038 *AF5469A5DF8B1E040DCBDB09C20B5EAEF9C746C0 dwu7
1,666,237,039 *AF5925114CFD0C9C5DBFB604CB306F5BF4CA7EBF E{9G
1,666,237,040 *AF529899EF01C19AB28635F5087B36110B06FE16 earnestsaxby
1,666,237,041 *AF5A8427DD7CFE6E8AF8944C07E5C3AFB56D675E EARTH-FIRST
1,666,237,042 *AF5BB6A22338559E6A7BC81791D08822593DA8FB edkpg
1,666,237,043 *AF5BF34468E6AA38EB9D4FE572731A8A8C82E7A6 EJYS
1,666,237,044 *AF576E9FD9E2B6A5E5BB3A393C08617921A3743B ellecnev9
1,666,237,045 *AF5AF31A0508B4F4BC59B59F9F1B612276120199 ELLISBUNK
1,666,237,046 *AF5F61A005C099472009F28F7857189A57CF25DD ellisshows
1,666,237,047 *AF5C968DC08D98B60D63BEF38401E3CB29F1FBF6 EMANUELKENSON
1,666,237,048 *AF54C2D17161862B5B54833EB8313E102E46E707 embetunado
1,666,237,049 *AF5B1433C8D84F7406CD2FCF9F9C1931B6D8643C EMMETTMAYORAS
1,666,237,050 *AF510CE902E911F66309CF7F5F34D47D8010FE2C EN7111131233
1,666,237,051 *AF55F72BC1A33CBC4B1853586E5DB07BAA1B3018 ENCARGOS9
1,666,237,052 *AF5D8BA8BDD5E2A4843E405DD1745524C4248B64 ENELVIS_JESUS
1,666,237,053 *AF557001738480D8FC4F97B63C8B0AB712BE9A8F ENGORGED123
1,666,237,054 *AF5D678C4FD2F2F4598A6595AEE6B6890D26933B ENLARGE
1,666,237,055 *AF5F26A0258DCABDC6358AB7DDD47386F082257C espotted
1,666,237,056 *AF5BFDC3E696A35F31DE232D38FF9BDE97547223 EVERY CHRISTIAN LION HEARTED MAN WILL SHOW YOU [MONO]
1,666,237,057 *AF5F5926D9C0C7426774F56BA2B0E62814B6FEF6 eyf$:
1,666,237,058 *AF5071507C8A45DADFDF1D7F5A611A52A9E35AE2 [email protected]
1,666,237,059 *AF5005C200742967A2E6772E17F4D272B4011974 FANTASIA PARA UM GENTILHOMEM, III. DAN
1,666,237,060 *AF587197A003190DDD5463CAD6FEA54259AC5B49 FELTÁMASSZA
1,666,237,061 *AF5D9FA2A4F12197FF21DFB82CE607D102256203 feltryke2
1,666,237,062 *AF55C9C8F7474727BAD549F4E49300683635AADF fGe
1,666,237,063 *AF5ED79469F90E802334E395B48529E58D4A9368 foolsrushin(featfranksinatra)
1,666,237,064 *AF5345B2D5FABFBE69E33D7C21EBC514292CC040 FORFICATION.
1,666,237,065 *AF568E46196DB61D3DD00DAECE551FEDD9EB017C fozydgnybbcj
1,666,237,066 *AF5E05D2275248C08D01F5165152938AA4E90FE1 FREONIPOLITIIKKA
1,666,237,067 *AF5726092D8EDAFF52AF56E4EE759C78F024C678 garret.weaver
1,666,237,068 *AF57B44ADFC4005D366E91F182E13994EBF21E25 GEIFTESKAMPF
1,666,237,069 *AF5A95E42CB92B0EFD40ABCC47C3176CDE8402EB georgiakinder
1,666,237,070 *AF5F56B159D883926B1B5C31C50094DACD212623 GERTRUDEAE
1,666,237,071 *AF58B61470F8DE9A0EB232BD79A8AEE97F1969F0 GEVIJLDEN8
1,666,237,072 *AF55D3F6D14D6DCE2EA860B431633D7DF2BA3549 GLEN.HEWLIN
1,666,237,073 *AF5156395E5BFCC2DE118BAC26CD3BBCFB8AD5BC gloria-castle
1,666,237,074 *AF5EDB8BCAA277134C8336A07F320B4397CCB7CF glouming7
1,666,237,075 *AF5EDD94FFA6688B8C5713C23C7BD8D63E7F968D [email protected]
1,666,237,076 *AF5038F66E3CA91C6105E977FE48877F4A10692E GN^A
1,666,237,077 *AF5981EEF311268F39797DF37E266F4C3CB36CAA GREGGGAYLORD
1,666,237,078 *AF597C79DF11ADE5824AE63B51797B3F58A1F960 GREGG.MATUSIEWICZ
1,666,237,079 *AF5B367E92EFF800E41484CE080AD4EF71E5970C GSB*
1,666,237,080 *AF54B4A20F05689C5E98EDC93F8586611B61DB22 gunthermartens
1,666,237,081 *AF59A0CF4C2E598DA4487F2DCCD9BF5D855B793B HÅIN
1,666,237,082 *AF547F42C93B4A3B6B502D17648FD7D982BE0809 [email protected]
1,666,237,083 *AF58929F7A9E20AD23541E43BADD83395069E457 hassankiewiet
1,666,237,084 *AF544F0272A61AC6E82776BC45E7FB4661287115 have,-sure,-more-lack-of-reason-what-would-you-say?
1,666,237,085 *AF57FD206CED76F3A95B6B6D688BF11FA5DF4D85 HEIMATKRIPPENBAUER
1,666,237,086 *AF51F227583E5C457D87DE2B18631CF25AC4E819 HENRY.KALB
1,666,237,087 *AF50EA18155DC8F7B659A566FEABAC52CB317155 HERSCHEL.URBINA
1,666,237,088 *AF5F20E8EFE33BB57804BBBC83AD66AC8FA49BCB HEY!.KAY!.I.MEAN,.DR.,.UH,.WHATEVER,.COME
1,666,237,089 *AF57CFF2092F23B27C6BEE7609CE3BAC2D051D8D HOOVESRUS.CO.UKWWW
1,666,237,090 *AF57160375604F7B65D5936547C1D7C33937EAAA howard.echols
1,666,237,091 *AF5444F5A42DA65600D73D424489A87AEB5F4787 [email protected]
1,666,237,092 *AF5059A9260A1F7B97EA92C3D1D4883022C781E6 hueymihalkovic
1,666,237,093 *AF53AF8B8677BAF795AD02410A21E00083112AF5 [email protected]
1,666,237,094 *AF545CFF8B30DB46811190F7C790E0595609089B [email protected]
1,666,237,095 *AF54B7D2134E95A013229334DAF208F243C824B3 hungsoboleski
1,666,237,096 *AF5EB79A04BD675339D7E28A79E1D466F4D7B616 IAMBENNY94
1,666,237,097 *AF5A46F0D6FEA967CDA3FEB446B8B5F81AC58CA8 ichalputrakawanuaii
1,666,237,098 *AF5F767F197BAAF1036D9E8C1792A95E70405435 IEA)
1,666,237,099 *AF5EDA399FB2ADA82BDA4D954CAC12E605B6EF7B [email protected]
1,666,237,100 *AF5D26A3F7161D185CDFBBD57C7D5E1C3E00A938 ikasayim-1
1,666,237,101 *AF57CAD8740D93E9F8034074591828C62CA353B3 [email protected]
1,666,237,102 *AF5F000D63336A25B650ADFD2FFC2947F5FCDC00 iklaotd'ndagnogefkesdure
1,666,237,103 *AF590FD9C91590C1A046BF88868C94228E41BDFE INNTEKTSGRUPPEN
1,666,237,104 *AF58A040ACC97496A6101E1AB75A702A9CBD1656 inspijkerde8
1,666,237,105 *AF570D28DB83443DDDAC06C54BB3F981EBF9455C IRVING.KRON
1,666,237,106 *AF51A17D5D0E07DE5212ECBEFFC3F9AAABB1E318 ISRAELSPROUSE
1,666,237,107 *AF579DCFA630DD5B50E0B105FE88B2C096A5EFDD ITALGRES3
1,666,237,108 *AF528A1503379185A6A929039F1343D2164E64DB JAMESVIAR
1,666,237,109 *AF57D29083BDA998B4BDFC00A3021B8F49250F60 JANDARRON
1,666,237,110 *AF535F7B8FEFC3C368CD71F446944E43DEA3B2D9 jarodpasko
1,666,237,111 *AF58CD04AAB38DE0A9D9302146CFE4909CCA4158 jchizkiya
1,666,237,112 *AF53B683F16F9CA35282D251479FA34C2332BA67 JEANNIERYAN
1,666,237,113 *AF575ABDAC98946559F60A99446B3BB747B1E5BF jerecarreira
1,666,237,114 *AF596395481CA27570A90451C5E451B78475BC4A JIALEP
1,666,237,115 *AF5361D779A68C0F456A21EAE521911F8C7AA70E JIM LOVE
1,666,237,116 *AF52FBB1B74670A6F3DED6AB95039BCED7D1054F JOAQUIN.HILDRED
1,666,237,117 *AF59902C5423B92DF170DF570D97288EA057197D JOELFUHRMANN
1,666,237,118 *AF56CDC015A4147EBD446931CBE62324B8C0BC07 [email protected]
1,666,237,119 *AF591DD26AB13910E8021037FC7846A9AFCA0E06 JOHNATHON.BERNON
1,666,237,120 *AF556893999F07F07DE9B083DD76011E85AE7A6B JONAHNEALLEY
1,666,237,121 *AF56EE1E67831ACDC5CD5E0E734CDC13FFB3787D joseph-de-la-cruz
1,666,237,122 *AF58534C2F2D8564CCCBA07BC29CD2A0B3809E49 JOSUERETERSDORF
1,666,237,123 *AF531F81A6A14D0C81011ED932FC157B9F230FB4 [email protected]
1,666,237,124 *AF5AD7EADDF0DF510E0927DBD4335D081E30B406 JTTISIN6
1,666,237,125 *AF5297815AE9F529FD71AF3DCE731ABFAD8C0294 JULES.BONA
1,666,237,126 *AF545E1A7ACC03AF8A44719977EFCEC2C0632A5B kantrowitz.1972.(hel.crew's.song)
1,666,237,127 *AF575058C7A1250D05CFA46B7F30D96EABFA8737 kantversiersel
1,666,237,128 *AF5DD52375A0DAAD50A103E026470C3F4A91132E KAREEMMERLINI
1,666,237,129 *AF5F22FECB3E9212D46CB1243888812C99D14660 KAREN HARTIGAN
1,666,237,130 *AF5951BF950D6EC5F39A00526AB5E7831C801F90 [email protected]
1,666,237,131 *AF5CB2215C664E8701BCEF521B38616CA7C33DAC karmajit
1,666,237,132 *AF5F1CEBD7090BD6597025830A93996611AE58DA KENDRICKVAGOTT
1,666,237,133 *AF5A20B3053C6F9B8CC386BB0D151BFEDE85C83B KENNY.BEAUSHAW
1,666,237,134 *AF5AEB963B352659DF06CF3DC33D5B36717175CD KENNY.BRISENO
1,666,237,135 *AF5F1138ED2B202397B04F2C210B582E20B990C2 KÉPTÖRLÉS
1,666,237,136 *AF5532B4ECA8AF42B22DAD94B75C16F38DB7AA88 KOREYMCKINNA
1,666,237,137 *AF584D841C92C7D871433B7F4425F364AE0F9C8F KORY.LATSHA
1,666,237,138 *AF5AC5F943FD94634359DE1051995FA4B89A1348 kP"
1,666,237,139 *AF5AD29096419768412ECD5A4B7A76FA05C54DAF KRUMIROS
1,666,237,140 *AF5EE3C6C2F61D5E501E18CE08AA8FDA57B211BB KURT.PRYOR
1,666,237,141 *AF5DC2AF3CE628AD02A0E105C7E568D4DF126A4F KYLESLUV4EVER
1,666,237,142 *AF5CEC208C645B867A7DBECCD0EFA7BF68725DBB L36972
1,666,237,143 *AF5290BC9E71050DECA476B2F839ED2E548244B7 LA83GELVAN
1,666,237,144 *AF5599EFABE051F1FAD8717BD9A8011E537F8BCF LA.FEBRO
1,666,237,145 *AF5AB3CA74A88AB596F25BD31D8600C6EF9BEF59 LAJUIVE:RACHEL,QUANDDUSEIGNEUR
1,666,237,146 *AF52B9B88430E0AA24A1378309472A230A9CBBD6 langwag6
1,666,237,147 *AF587B6E56576C8AE64A434E8D9343526A441FF2 LAURENCEKIRTLAND
1,666,237,148 *AF5AEBB63C91D1E97669AC629C8691EFD963166E laurier
1,666,237,149 *AF5A9466EEA6618583C615ECEFD55AE15E76CF2A legodiscz
1,666,237,150 *AF53C91960666D919D4D0D8FA64D028D658CD215 lifesboring
1,666,237,151 *AF508B71B1F2F2999480649287669AD020AEE8C1 [email protected]
1,666,237,152 *AF5D8CA92133B9A70843AE257877A20348E9089B LORENLEES
1,666,237,153 *AF556B0964BAB07713D439DCD58370E5E87B27C0 LOTOSACH
1,666,237,154 *AF5BFD354132B6891696027F2AA81E1B04857FB4 Love-Games-(Dance-Mix)
1,666,237,155 *AF5F1A12D613534775435076529C7A31119E64A3 LRASCHKOWAN
1,666,237,156 *AF5E07A2792824772AFBA759282D6882F51B6F6D LSEIJAS
1,666,237,157 *AF544F996D807F88779FA216F7FF64DFAAA40ECE LUCIEN.LORANGER
1,666,237,158 *AF5EEB6550CBB8999057BDCF07668866533722AD LUCIUSMARKSBERRY
1,666,237,159 *AF5F9F042EA9E73A5A77900125A884D3515BE0C3 LUISREVILLA
1,666,237,160 *AF5BF450F2AC6ACAFAB06E96ADBF8ED462E33423 LUPOWITZ1
1,666,237,161 *AF5A24AAD77F0D58544D6596117935943EDD6C0F LUZAIRE
1,666,237,162 *AF5ADB919E018AE0C64B52B5AC5800517CD0FB2D LYNWOOD.ALTERI
1,666,237,163 *AF53EEB09E14E060AAB5BE28B52AB376F8ADC278 lz9
1,666,237,164 *AF5F744A4ABD137EDBC10C319DE49F12EE2FAA21 MACKVENTON
1,666,237,165 *AF5993F87A22393712662A976B6B07036305C09E Made-me-think-upon-mine-own.
1,666,237,166 *AF553F734D8BB43CFBD361F63E23AD2A3E801F41 MAKAWUNIA
1,666,237,167 *AF5579101D5C5CD41B8BCD82EB591BEB9CD5A0ED MARQUIS.RONDEAU
1,666,237,168 *AF5B44A5E4C9DECB9DA2DCE422F6FF9D37F443EC martinlenharr
1,666,237,169 *AF5DDF0CDB74963E6D8B159FAF7B8E65F8AC43B4 MATHEWBRADWAY
1,666,237,170 *AF57ECE6FE967B910310B6ABEA4DAC6C1616CDD0 maverick355
1,666,237,171 *AF5D4E6FFE9BF91B4684CD0CFD9BA0BE2FAE9729 MENETOURATEL
1,666,237,172 *AF57B7067A35CCF9A8CC13CBACACBC65C790EEB7 MIDOELKHOLY
1,666,237,173 *AF53F4DCDA226AFD7BE03D55C4301A9169C54376 MOHAMEDSTRICKLIN
1,666,237,174 *AF5ECAE05D880FB64E481BF56C88C2A756C8B243 MOHOCKISMS
1,666,237,175 *AF590D9202E08565D367846E0B0421ADB5E090A1 myjohansen
1,666,237,176 *AF5D0E6910487FA2C380AA511D480F959DBD2612 na3mlegnbc6r
1,666,237,177 *AF59DD6ED766C15BF7E325910630025536C5D38D ne92w4dw
1,666,237,178 *AF5CA570E9235EA6562ADE3A1C8F5CC4295D2760 neednils
1,666,237,179 *AF572E934DB2486C88F32D958AD8D281BEE3280E nelliewarrior
1,666,237,180 *AF57677110861796C65D5261CD53E339873920A5 niravdhamelia
1,666,237,181 *AF535CDFDC54951C4590A56CEB72C4F901B65DDF [email protected]
1,666,237,182 *AF55DD2CB40DDFD82D62B4B3C08B25B01D89219E nosèç
1,666,237,183 *AF5745A74F2249E431A612C30810DE0ED2522A75 ntxclly5
1,666,237,184 *AF5229E69E4EA31DFC65EBE27EAF32E0A7F94442 OBMX-(ORIGINAL-VERSION)
1,666,237,185 *AF5D01177C0E9B4A8B4DB570AD7DCAE1360F9F72 }O{.~.`.D#####Q
1,666,237,186 *AF5820BF1D2B69BDD6C9824CDF463CB9F126D3A1 ONEDAWG6
1,666,237,187 *AF556B9B4390B25DBB09751D7F87D6E8CBBCCB13 )O(`<#####p
1,666,237,188 *AF518D30CAF4F7CD4F285D5CF2A3A9CD307ADB42 [email protected]
1,666,237,189 *AF5AF53559ED1109FAB6539869BBD9317FADC6CB ORLANDO.DRAXLER
1,666,237,190 *AF511F0735904562AED0A0F18169CE852AAEBD30 OWENSCRIVENS
1,666,237,191 *AF5CF249271B667DB2B1A956AE2C414E83DD9CF4 P3GMAT0PH
1,666,237,192 *AF5E2DB9FEBA633FD9D51FA34DD9195E99044D14 pa00114567
1,666,237,193 *AF520635EAFA22F6E24A2E315F3D065AEC44F9D8 PANTHERES.
1,666,237,194 *AF50AEC8A04C029E78BDE1A03A638074637501D3 pasqualesurpris
1,666,237,195 *AF546C442A013790494784016C22A9AECF16FFC1 PAUL.GANNS
1,666,237,196 *AF50F918583B5CC9B3BA2C58D793D90E5340A630 paul-weller
1,666,237,197 *AF5CD26C635BBADEF9AC8B8355EA320C3D82BA2E pedroseremet
1,666,237,198 *AF58B246F52670A591A5E669943B1A7CFE41D19C „PENICILLIN“
1,666,237,199 *AF5AC8322F7E1A602346218C52C82C18C8220540 PEOPLE.131634
1,666,237,200 *AF5365824028EB6CEEAF17DF13D67E292C4B1ADA percyguinness
1,666,237,201 *AF52052936E3837870356735E27792E46A32F568 perryroudabush
1,666,237,202 *AF5F7FEF3F59E3AC96AE7A83DB87A9AE96401E19 PHÄNOMENSINN
1,666,237,203 *AF5FEBD320F8110AFD5A3BC04B7CE7C18511AD04 p---->~o (0-0)
1,666,237,204 *AF5AC3BF085F6062C6A18FD6FF8C2E4BDDD6C774 POSINKU1
1,666,237,205 *AF57671A2C0D26BB20B803A861F81C1986A4F8CC p-----p~(>_<)
1,666,237,206 *AF535C0560AA89B03290BD5FB4B6519F326E700F PRINCESS MOKHA
1,666,237,207 *AF5661D70437110909C488C3B7CB1187E07FA7E7 PRINSENVLAG6
1,666,237,208 *AF56682F338379B3946E2626C4E7445A69D61BA1 PSEUDOORGANICALLY
1,666,237,209 *AF502FD390E6FD58471BADED833F1A1B8294158E PZ-E
1,666,237,210 *AF5A50DAE23DCD0BEEBFFCC1D1E947408CE16F25 [email protected]
1,666,237,211 *AF54F97979F360CCB75F9BFE8C31BF742B8754FE [email protected]
1,666,237,212 *AF5F45CBDCF0DB4BD9E6B4F27F873D717C4E7C6C qu4rtz.ve
1,666,237,213 *AF54A775A7299D013C71EC18873BDBB1D9BBA2D3 quintingifford
1,666,237,214 *AF576973CFC94A6B0119611A0F03ABA87DDCE502 r7r4frkk
1,666,237,215 *AF55D531E1C08308C130200838D59C78BA038773 ralphmielnicki
1,666,237,216 *AF56ABFFEF137B44840C05FFDF1BB11E274A2628 RAMIROUPOLE
1,666,237,217 *AF506FA44979207F3929FA74E5AE4F6EBC35B0F0 RASENIAI
1,666,237,218 *AF57E5F3ED0DF654C4AF6CA2D53A1464257B8EBD regittaw
1,666,237,219 *AF562E00EF1D3D79B6C476DDF350ED171F95F721 REHA81117A710NS
1,666,237,220 *AF51CBFFAC329A7C481F71C121E3A076422A5DE8 RI+4GLI4+O
1,666,237,221 *AF5B9536B1EA980E5EA1A32ED396260416642D35 rikcarter
1,666,237,222 *AF51CCBAE6EA970ABF0EECDD7F47E3F937D730D6 [email protected]
1,666,237,223 *AF521C5B26E4813E08D0C6FB598A7E998546698B RODNEYROETHLER
1,666,237,224 *AF5B070C9E6B61451F0225E048207C6C02FFA65B rodolfoburkhard
1,666,237,225 *AF5E7FEE5C7B2B79CD7BAE68EEF5CEA3E718DE7C romeobarasch
1,666,237,226 *AF57ABF0B03A5C7F87D80E9FDC4D1531BB4D38AD roncoferraresi
1,666,237,227 *AF53E4450AE9469B7FA14373593A0E107028A035 ROSARIOMALIZIA
1,666,237,228 *AF5C8F639652655C0AAA04235FF3229253A03E3D rossmere–b
1,666,237,229 *AF5970B9FB5C6DBE1BC6A64D40D9A7BA6C5CCA79 RUCIFIERED
1,666,237,230 *AF57F0A3D5FDFF86A05ECBED2B5B54EA86576CEB RUEBEN.SCHUCK
1,666,237,231 *AF5F4DA2F5C3E750061582DF17D2441849637DD8 ruebensermeno
1,666,237,232 *AF5B682D9487409F838317107653D40328F6A8C5 RUFUSKATIE4
1,666,237,233 *AF50B974B5758E98DC20090E199074F499391B68 RUFUS.KENTER
1,666,237,234 *AF50F6A44B81361C7F2471DAD4F0E8161CE0E6B2 rum1n4+1n91y
1,666,237,235 *AF55F047CC67AE788A8A42D3984F8DD178ADE4F4 RYSLIGT0
1,666,237,236 *AF5E663B9A4B032A4A248F94EBFCFD7640B6B2F2 SA
1,666,237,237 *AF57B70E86A12CCB9A8FAD22F1CCE4542786B275 saint.jean.de-beauregard
1,666,237,238 *AF566BC7E6583053FF4D09CDDDDDDED37D3E39FF saleh.sultan
1,666,237,239 *AF5542BEED34EF68EB8BD5E592833D6927E469AB SALLAHBACHAYO
1,666,237,240 *AF5A18159FE4C97D6D43E7DF1FCEEDC51BEA9D53 SAPPHIRE,起源:移民歷前所創造的超級MEISTER
1,666,237,241 *AF5E052CA6D7EEE8A56EDCC137B9AD3521F9F9B4 savyet
1,666,237,242 *AF5A4A1C1B5450E1358ACB35956DDC12219F4D61 SCHWERMETALLIONEN
1,666,237,243 *AF5FA7A7D0FDCC6E33AA1C02F764442C872803E3 scoutdon
1,666,237,244 *AF50390047958F2EB24610996555C68DC2BE0AE2 SEAWEEDISINGLASS4
1,666,237,245 *AF5A5F28F84470A4421DFB7F519382E6D0FA7BBD seitilavo
1,666,237,246 *AF5E22E5F8FC9C98C6FCBB47F90F28398B7C7E79 SELF-REGULATE
1,666,237,247 *AF5D8F6A69FD218A2721CCC275B87A0AB3D2405D SERHIIPLOKHY
1,666,237,248 *AF52D93E13EC6E901C7FA45E0611987681AC12B5 SGNIRETGUFFAER
1,666,237,249 *AF59894D8B8DD81823B4E6A39D8D642C70B08488 sheep owner
1,666,237,250 *AF5894A3632B500F32D4C69D8A4FCB749D4A4070 SIGURDOSSON
1,666,237,251 *AF52139FAB142153235926E4DE228786366C7203 [email protected]
1,666,237,252 *AF5A2379E9CDB2BBD3BACDDA8D17348E1646982F SI.JE.TE.QUITTE
1,666,237,253 *AF50D9212CEE20010E8CCDF41249D293AF4A52E1 silabrador
1,666,237,254 *AF50FBF6A735ADA38F9499EDA71506CEE762BF3A SINFONIENR1DDUR:IVST
1,666,237,255 *AF501F545276C60C5255C1868C0B995241B456A5 SLIMSANDY
1,666,237,256 *AF55786393D410CC890FA05567983EBEF46A4213 SMSIGGIW
1,666,237,257 *AF54FAA71D7D66683EE99F76C0B9B292BE5AC5D6 SMUNJIT
1,666,237,258 *AF551C7FDCEFF13E5D7AED6B2A5674DBD47BA114 SNEUVOJA2
1,666,237,259 *AF548B143BD3A65947169875CEC55769F50F8C10 SOLOMON.LETTSOME
1,666,237,260 *AF5F91649EC2E4524469E0BED5C183CCF7FA7B10 [email protected]
1,666,237,261 *AF531B5E852B6AC8FC420ABB4C0472604194CBED SOSIAALITILOINAED
1,666,237,262 *AF5F9A6908203D3E21B9C933030F89E6AC651E4D SOUPS--S-UW1-P-S
1,666,237,263 *AF5F64B7AEC7C9BCAB07B45ABBC7DCE154113C74 SPARKYTRAVISED
1,666,237,264 *AF5814EF2E861AA509F9DBEDD4E12568423DE0AB Special-Dispensation---Heaven,-Hell,-Purgatory-and-Limbo
1,666,237,265 *AF54B8178C4947F1A72BCFF175012E8F3F5ED3C9 splat~`[email protected]
1,666,237,266 *AF503A075F6FE8A86FA30B3FAE8D67EAAA21D8A2 [email protected]
1,666,237,267 *AF52D464F48ABD8384DB3A48EF0190773971B38B STARTMACBSW
1,666,237,268 *AF5D331A4363C2706DDAD913555483E0FCF1B86E sterlingpomainville
1,666,237,269 *AF5AE22203018D35D190867344C3031765A9E5A9 sterlingrobertos
1,666,237,270 *AF560E51E7B8133C6ACE1659CA47DF78FC5DEE06 steven-germann
1,666,237,271 *AF57C2D39C4DB990F6DDAA5EDB68BF78B4C01211 STRIDERCFING
1,666,237,272 *AF5B9D5AC460A2E925887076A0814C3EA72CDC58 SUBSTITUCNI7
1,666,237,273 *AF5220B2F4773ACEE82ADC69C0945DB9AA9799AB SUCKEN6
1,666,237,274 *AF5503A71CB705B49859C4C0F8ACC31F9080E18F suppurat!0n
1,666,237,275 *AF50E8EB1A8ED004D57D2A5F48D0A0CA2B359308 [email protected]
1,666,237,276 *AF5E0D0DE800498C93E511EE8771DA8B9F481263 SYHOUAN
1,666,237,277 *AF5817FB38CC475C1D182E9E651EFB792D587EDA TACACOS7
1,666,237,278 *AF5A1F1C730056AC0F54711FBEA6481DECE8C7D8 TALKKURDISTAN
1,666,237,279 *AF5402AE8DBAF7D76DDDB8BE32064D1532D58847 [email protected]
1,666,237,280 *AF518133B4A51E07750C8061E0B40CB442704BFE [email protected]
1,666,237,281 *AF57154636894A33C58E51E6C5FB520F883FC69A TDEPRECATEDOLDVGPEER
1,666,237,282 *AF59A696A381F82F469EB14989E76254127A69D7 TEAMOCSM
1,666,237,283 *AF5A337394D5E0E900F8FE4AECF7971A7E9435F5 THADDEUS.DUNNAVANT
1,666,237,284 *AF56ABEF06577005EE216999AE46E42F3BEF336E THATBUSYOUMISSED
1,666,237,285 *AF5A67BBF111724526A6E5AC0DCE6FF1BCC9B3CC THECHIARA41
1,666,237,286 *AF51BB6FADAA2DE5BD882A9055B26BC5A0E4DC5E the love you need
1,666,237,287 *AF550A03336449A2A2CA23D5AEFFD99DAF7D1C86 THEPLAYBOY11
1,666,237,288 *AF5D3DD1FA81F896E69AC1AC85B900C43D6128D8 [email protected]
1,666,237,289 *AF5AC609D9A190D36E4D56C3F1D581BFA99FBC73 timeprojectionist
1,666,237,290 *AF5C9751506E8048A3B07E73FB26A5B22F3BCECF TIMMY.STUMPO
1,666,237,291 *AF5BB05502BE352E4165D3BD922EDE92A5DC42CB TIM.SOTTO
1,666,237,292 *AF5A4805363A3B05D19EB993B76989612939D60C TIVEMONOS
1,666,237,293 *AF55B052DA98C7E7BEB8BB7243F920510B674267 tjf`
1,666,237,294 *AF55A213A0DE4184DFB32B750DF7A3203266F7F7 TOBYBUFFALO5
1,666,237,295 *AF5577E638A4EA69D90A1347E95D4E1F214D8781 TODMAA
1,666,237,296 *AF5D9335AAA258FEC27B6808108AED08D0C1D332 TOEHOORDENS0
1,666,237,297 *AF5C1718AF30CE1AA9C31C5C299F318D2FC725D9 toezieners
1,666,237,298 *AF550B87D84DF49B5BE2051AED1B336710D115B9 TOMUKYAT9
1,666,237,299 *AF51C05D27722A7D81E8F8F61556FD2996A95D1D TORIONJOKILAA1
1,666,237,300 *AF53E4387DAF268099470140D101BA9AE9AA8FD9 TORNEASSERO5
1,666,237,301 *AF5940E328B79D776F852A560A2FFE5D97E38603 totalitarisme
1,666,237,302 *AF542159851D6DF03CF7C8136E9D5F1DD0DAADA8 tristanstezzi
1,666,237,303 *AF58770068F24C0C11F1101BD7C51985404DB60C TRISTEDS
1,666,237,304 *AF502B3BF21941F5214A0B39D0B7310152584F4D TSIPYTOERREUGAD
1,666,237,305 *AF5847BC35834A52C312DE0A575237E2A9665E25 TÚLÉLŐIKET
1,666,237,306 *AF5B676025900AC2198A513D6D6337550B4477DB TURBOROCK8
1,666,237,307 *AF5196830CE7DD878C77D369B7C2A37D1219668A TYLORELIZABETHWILHIDE
1,666,237,308 *AF56A6B5037E921AF0068BCBE8B60E7E276B96D6 TYÖTTÖMYYSASTEESEEN
1,666,237,309 *AF530E8ED5D44053F06504380DF68C73909CFC76 TYPHOONDIXON
1,666,237,310 *AF52BD0B45044719EFFB66E057624B634A9A0830 TYRELLTANGERT
1,666,237,311 *AF5FE7C0C0AFC45D3C78DF09C8691FE7091EE6D4 tysonbalasko
1,666,237,312 *AF5DB23EC4CD4C83E23ED80C4CF0724905839141 TYSTARCHIEF
1,666,237,313 *AF5BE363AD8EA6CD638CDDEFA4DAA38B35ED38E1 UACBETH
1,666,237,314 *AF5F7FF372B2D33EB8195A2016603170CC307B76 UKHUNUSIFOISAAC
1,666,237,315 *AF551FFF099FAFCB901CB8A20CB2626BDDA74E5F ulmaslicka
1,666,237,316 *AF5C42AB08DAB2F893DD8146F76E0B697C4C1C3F unformidable.
1,666,237,317 *AF573D315295B86B88133B3F7537267D590D872A V3LION
1,666,237,318 *AF5FDE4A1BDE4C9FBB85FD1B9798AA91D652DECC VAIHTOEHTOLIIKKEILL{
1,666,237,319 *AF5CD8EEF0CEDDCC030A18B03A0272AB27E9C13F valmallette
1,666,237,320 *AF58B2C9F5435461D3F6A8DF69DA20719B5832DB VANESSAKLEINDL
1,666,237,321 *AF5627F3C8935E1DB67E485618D1FA84D80FCC8E VARAJASING
1,666,237,322 *AF55E69DBFD0181998103FBBC6938626371F7663 veena.unnikrishnan
1,666,237,323 *AF5D529F7870CE050428445795AF0A1B32408F7B ve{q
1,666,237,324 *AF547393F3FCAD06DE6F0D0282F4FF655C483360 verschmahtet
1,666,237,325 *AF5A9209DDDFD15D69DE41F33BB707B21913FA9F VICENTE.STEMPIEN
1,666,237,326 *AF516872515431D76484FC1927F2E848AA67622A victorkhongreiwo
1,666,237,327 *AF5CEBCB634E6D1173567A85574D668C7A06A6CC VINCENTBROTMAN
1,666,237,328 *AF52764EBB39535DEDF39054AAB29E43381C1878 VINCY.VIG
1,666,237,329 *AF5D1B057EA58F8CEFF107E6E70B433AAD6298E8 Vindicatif
1,666,237,330 *AF51213F74B9E3A587F3EC442BFA4F08CF83D371 VIRGIL.HOMANS
1,666,237,331 *AF5995ABF9A915A028EA46B36B34D9C832B4A144 VISADGJING
1,666,237,332 *AF5721FFCDFF21C2AB229F1BC042A3F419A0097F VON RENESSE
1,666,237,333 *AF5E0668E010A525E7B1DFDE2560CE514D3C530C VORMERKUNGEN2
1,666,237,334 *AF501884E785A4F70AFC6589939B163C318E3D6C wahnsinnigen“
1,666,237,335 *AF5F10166CC6A4ED5258EAED39CF2A84348A57B2 wallylee
1,666,237,336 *AF5146DC2E6FCA3316164D0FC85FEC69FC81BF5F warrenlewisvictor
1,666,237,337 *AF56C7C02FF963637E2F1EC75324AF9E2BD0926A WARRENWHITE4
1,666,237,338 *AF5601D46C64070AF96F5A697447C48BC3057DBD WARWICKSEAMAN
1,666,237,339 *AF56B4A55054BC283B8959557AF72396AE9FCA04 WC=#
1,666,237,340 *AF5B0449C843A8B9069EBA3F12B3C8234AE52BB3 [email protected]
1,666,237,341 *AF5D5817CA96ABBA4DAAC66AABC0584980986346 WELLINGTONBATLLE
1,666,237,342 *AF55DF6F62501A3050778332ACE11A8A425FC871 WETPLANK4
1,666,237,343 *AF56F1D8FBA4E4506D9E2394F2443419135D6A2A WHENI'MROCKING(FEAT.ALBERTBURNS)
1,666,237,344 *AF50251BE71064CB03C6032985265C86002F4F47 williancadice
1,666,237,345 *AF54073EE9F3CB98B8B54A05806A0BF784B91513 WILLYATOWN
1,666,237,346 *AF54DAF72C5DBBCF31C880BD1D6195F2956EEDB0 winfordeisaman
1,666,237,347 *AF5105E4B29137B74D522F2DEE59B67928B4E671 WINGS_OF_WAR
1,666,237,348 *AF5667B52E05EC95859797283CD7AC81E210ACF3 WINTHELL7
1,666,237,349 *AF559177242219F99007C693242BBACCE81AB43F wwwcumminsfiltrationcom
1,666,237,350 *AF5FCADC02BCE400E9B8727C798DA80E484B16E6 wwwgemeinde-christe
1,666,237,351 *AF538192516DC235B285BD825E6E2773E61DDD69 [email protected]
1,666,237,352 *AF5579F20806A5FD444861C65B4C11889571C1AB WWW.THEBURSTEADGOLFCLUB.COM
1,666,237,353 *AF559CD321A4AFDA7BFE670258779D7B0DA8DE31 [email protected]
1,666,237,354 *AF594F1EAFA5F5F948A746BB659606FBB5531D7B )X(.~`<8
1,666,237,355 *AF501300C082AB601E0EB62F35D994B201DC879A XMARINAGRIEBELX
1,666,237,356 *AF5A736369A0E21789B58B00DEEA4063FB3745B9 [email protected]
1,666,237,357 *AF574896002B37F7E320161824F0BC25C541A6E3 [email protected]
1,666,237,358 *AF5B10E44DA7718DB1D7BE18730BAF3236665188 YANUTORA
1,666,237,359 *AF52D2F4697E1640A3A9FF17B763B8F662E93314 YARA.ABOUZELAM
1,666,237,360 *AF50898F6DA1C703012C5FB1081D86F173F380FA YARMOUK8
1,666,237,361 *AF500419D4BEB042EBD29CC15471FDDB9C1DCBCF [email protected]
1,666,237,362 *AF598E17BB04A668C176D109474B364F01D8F0D1 YJLBSSWNZ2
1,666,237,363 *AF5CA37D8DC61663DF59AF2F17BC46AF058F2AF2 YONO EDOGAWA
1,666,237,364 *AF5093905DFC3079F8285D02D1A244835BA1515C youichi.honda
1,666,237,365 *AF5A8B7919C6FB44167FF9FE34E1EDD73FADEEA5 you'll.only.end.up.joining.them
1,666,237,366 *AF5E69197EEE0841FB87F5E2BE2DF8195F05D762 youngkokoszka
1,666,237,367 *AF542E953DDBB39860C1B7A67D24FB0865386305 you're-a-hypocrite
1,666,237,368 *AF5D13D42698B95FCEBA7ED5C060B80E533C8B72 [email protected]
1,666,237,369 *AF50B510812AC4CC0B63C8ED31111324D6498AE0 YRETTAC2
1,666,237,370 *AF5A5C160AC52C91DB6C2BE2886F295F0C2AF18D YUNEKABERRY
1,666,237,371 *AF57D00728E3274CABA386FAF00C9DFF3C9911D3 yyv(
1,666,237,372 *AF5AA64A8AF42BEDA3771B24C2E26E5499F16372 ZACHARYZABIELSKI
1,666,237,373 *AF5F0E919BEF7BA746EACF2D145C8E63122294CE ZAHEERLAKHTI
1,666,237,374 *AF5373CE6D6FD5FB599B81FF782B53B30C2B81F1 ZANEREQUENA
1,666,237,375 *AF506C6CC7DDB2C84A798243DF81AAB1547CDBC9 ZAPLANSKE
1,666,237,376 *AF55DF91869C1CCDB2A76BAFC67135C33294BB70 [email protected]
1,666,237,377 *AF57200AB92DF0F43AEFAAE001535898A0CD9911 [email protected]
1,666,237,378 *AF53611AD95A20DCC6C70E5D88CEC51BBB4E9A14 ZUGETROFFEN2
1,666,237,379 *AF5257751C4C0262EB737B20BFCD1953CC267094 ZYLLE-DINGCONG
1,666,237,380 *AF5FB6BC0A56AF23BC849027A356876BB3475D9A [email protected]
1,666,237,381 *AF50D996E89CD5C9A6530563A103EE585EBA97C7 А973
1,666,237,382 *AF51756380156BA2D422A47EECE5732207D4F03A «ДЖАЙМИНИ
1,666,237,383 *AF5F3C70883989D087FE540DB926248AFD0BB11A МОРЕЗИ
1,666,237,384 *AF5C5832644918CF7AD9F375F981FD8555F3946F ПОШТУКАТУРЕНО
1,666,237,385 *AF51F52173D65A422778A23A3B0DE5756885DB3C РІПУАРСЬКОЙ
1,666,237,386 *AF55E0524B1640DD77723821B873BC243E2FBFED «секция
1,666,237,387 *AF578C6BA6D55F595D27A2649B2BC2DC1492C93E «ТОБ
1,666,237,388 *AF55D26F5324F5DA6422B6EF6BCCE98CA5B41E96 УАБУШ
1,666,237,389 *AF572A98950A689471519C1874747926921278F5 愛丁堡大學JOHN
1,666,237,390 *AF5BB1E237A98E6626C1031786C12F140EE117BA 0overkill1
1,666,237,391 *AF5A0EF2B7BA3F6D0C178599F9CF21116E8E6738 11.rothenthurminitiative
1,666,237,392 *AF5972CCC1214DC094581C64F04ADA998C3FF7BB 11SEP1127
1,666,237,393 *AF5C9918E9172607BF5087E43997CC34EA77BA85 1414043 OUR-NEST-IS-REALLY-EMPTY-AND-,-OF-COURSE-,-UNFEATHERED-
1,666,237,394 *AF5EB74288F4E8D4F0EE3E86339BB2D33757043C 14NKN3$$
1,666,237,395 *AF59ECD0A8D108500206E19CD4E0ED86D912CE88 15420
1,666,237,396 *AF5AD0E26C7AE662C45812BA5F87DEF0DFC19261 16.stecher
1,666,237,397 *AF52D29AEC84F7582EE66ED059EA2AEB01594993 1706750 LIS
1,666,237,398 *AF59F88BA93709B2BCA64DC4FD723F309A347AED [email protected]#$
1,666,237,399 *AF5DD666801A0A1F57B161BD555C6D515EDCE8A1 190-TEOSTEN
1,666,237,400 *AF5E7D04679F936F8A2BCF7B68C5046CE1D6933B 1997aca
1,666,237,401 *AF513D45E270FDC1E8B189F04A778B84FDE8E6C4 1.bagdasik
1,666,237,402 *AF5B0D2E89D67432D723782B14A5139B642F69D5 1CLLDLNG
1,666,237,403 *AF5BD5F4DED2B011C637039FD0C293E8B1BE463C 1 COFFEEROASTER
1,666,237,404 *AF5FE98D3D2771DC32617DBCD2F37782CD4B7B4A 1DEBT-BUYBACK
1,666,237,405 *AF5D4111CF4ED6E6D58DBF1BDED50E9E19677E42 1 DIRECTION-AN
1,666,237,406 *AF5993D764907EBEF14A11296C1648128EA78864 1.DREIZIMMERMAISONETTE
1,666,237,407 *AF54D09BE4AB6D49EADC6BE7D3309E07873D693B 1.EMPLOYEESWERE
1,666,237,408 *AF5DBD86E4DE856D0DE001B3985FC958512863BA 1 essup
1,666,237,409 *AF521AB13FC8D4963995905F000D96C6D2211AFF 1EX-FORMATION
1,666,237,410 *AF5D571E4A3443B991D12A8B30E8635AFDBAE2AD 1gastgeberinnenteam
1,666,237,411 *AF5ADBEC5015891CBF3C6EB838FB166C4DC9BC03 1-HUIVITTAA
1,666,237,412 *AF5A2270A126772D576084561E7267A8458F29D8 1-IHMISSILM
1,666,237,413 *AF54E2553113E2EC8731442D70C44C13F92C36C4 1.imajlariniz
1,666,237,414 *AF5946573A4BBFDB707344E752CDF796B54DF43E 1infocom-yritysten
1,666,237,415 *AF5DC865E3921EEA86FD30CA5D867756EA9BE663 1INTEELTS
1,666,237,416 *AF5900677AAB0B6DB9C87C311CE5764FB93782BA 1.KATUMUSVIRSI
1,666,237,417 *AF548B06F4CE7CAB2E393C2ADA73054011112334 1 LONG-SUBMERGED
1,666,237,418 *AF5263E7328C1412B334E7DDC3966386723FDC9A 1ORACLEV
1,666,237,419 *AF5C91365DEC3F1B398C3396DF7FC409D3DF6BA6 1PLANETREE
1,666,237,420 *AF50CE483AD263983EEAC165159099FB0CF0E550 1ruehrmaschine
1,666,237,421 *AF519E71C48D1DB935162D07368600338B2F2344 1.SEEDSMAN
1,666,237,422 *AF554028A984AD0EB8072666C7F5E51ECC60EFD7 1songs-everything
1,666,237,423 *AF504CA24A14A934E6C117D5B5D91B7142535696 1stahlblechtresen
1,666,237,424 *AF56D6784B1CC5733F3E8FB02B6738073A0636D2 1.THIRD-MOST-POWERFUL
1,666,237,425 *AF5925D01C940B85663E3F908883409407EAC7A8 1 YKSIL
1,666,237,426 *AF575B36EE70FFD17E6F80C159748ADD5F388D94 2057462 lemmink
1,666,237,427 *AF56C1FBAAB97BCFADF74012F1AB692E3F3D4E5B 22literaturkalender
1,666,237,428 *AF5A40EFD53ABBBDFA73EE27F88AAAB7A203B16C 250639 the-drop-was-partly-due-to-profit-taking-.
1,666,237,429 *AF54412220362530E987C3DC41752CD5C7DB9A32 261939 toimittajamme oli kiinnostunut my
1,666,237,430 *AF501C8EC2DE5165254387C3B5A4B14056C0C8C6 27FB9C
1,666,237,431 *AF5B84833122756864DB81103E180239E8C4138A 2983915 TAVARATVOIDAANMY
1,666,237,432 *AF5DA11D37F270F428600DFC2F61D99340513B5F 2BAEHR
1,666,237,433 *AF5F672B94B7D1A11F59CEC46EA4CA2979AC8F7A 2.ellena
1,666,237,434 *AF5406E22825B5E7DB4A24E52862243D7BBF4EBE 2fvercel
1,666,237,435 *AF5E363A2E12BA4E0F4F5A2F8E16EB32C3419B61 2.LUULOSAIRAALLA
1,666,237,436 *AF5FCCBC1B1C986E001C1D4A6C685D093C7C0C25 2.SEQUENCEAND
1,666,237,437 *AF53CE0A428B9765E0743D45BA970A32FA4B03C6 [email protected]~0~OSPLAT!
1,666,237,438 *AF526F952D4DE606E1FA94E6BDC3224D753BFF9C 3KOSSLYN
1,666,237,439 *AF5D8E39152CDD2E4747DD801A05893B50DE97AE 3==> ~ }o{
1,666,237,440 *AF5F8D2A178DBE092749F5A68018471CD5D0FC60 3==P~0-~O-SPLAT!
1,666,237,441 *AF5D413F992A6DE4D4DBDEE26273F30847F3DBFA 3TTXEHTT
1,666,237,442 *AF563CCEED8D98DA9E3BC2FAC1D2E1ADAD114249 3XISVGY
1,666,237,443 *AF5B06BD5BEE9725E3C5BF1742D9151988B3CA4E 44NL4551NG5
1,666,237,444 *AF5A44AA24C5906515FFE162EF1823FA5B1A80BB 4DAYTOOH
1,666,237,445 *AF54A026CB0958E1699C2091B8EE9EFF9E5E48C4 4ETNERRAAJ
1,666,237,446 *AF5203AC70C096E8FA920F213A0B750551FD0D6D 4GSDZXRUJ
1,666,237,447 *AF50B0AE4DBF5B0305A53A0187D2EF0A06B90CCD 4HALTIJAKOHTAINEN
1,666,237,448 *AF5B044FFDE00CD3BAD237CF640C56AE42643C40 4MISSBRAUCHER
1,666,237,449 *AF5FCA2F14ED3E6FDD9053CA945AD4CE2361A71E 4MYRARNA
1,666,237,450 *AF59E56278FF3265D467C0618ABBC019846AC27C 4-PRELUDES,-OP-33-NO-1-IN-E-MAJOR
1,666,237,451 *AF5CAC7AC8EB3972479C65815D2072AF8DA7C09C 4QUINNSKILLINGS
1,666,237,452 *AF5F921C458131FD85F8D10BA5BD57C339EBC385 4RESSOURCEFORBRUGENES
1,666,237,453 *AF5F134C8B05029203CEC0D586B6C7940A99F8AE 4SCMSBSW
1,666,237,454 *AF56169DC67A0F04D784058CBBAEC84AE13FDFB5 4SNCRNSS
1,666,237,455 *AF5FC1A92EFF2A402397096973292D2F40C9CB7B 4.VHS-GEBUEHREN
1,666,237,456 *AF5A32B5EA960A52B8FB883060D2E2AFBB01E7CE 4YRJYTTMN
1,666,237,457 *AF558A6A06BE6A24736542924954B373451066DA 4-YUKLENMENIN
1,666,237,458 *AF5ED3F289465FE593EA8B18828F04CC56A93D7F 51benedikt
1,666,237,459 *AF5882319AEE946D3E4ADB67432FD0017DB42D90 532962 kuudes.ja.seitsem
1,666,237,460 *AF503E8E060CEA57DA49CCBF17A8B558E473F72A 5710TRUST
1,666,237,461 *AF548031A13FD8C69CADD7992689D3B22025578A 5BSWESTABLECIDOSBSW
1,666,237,462 *AF512F4BE79B6222406C4E3E8D62C3E65BBF2EF5 5CITYLEHDEN
1,666,237,463 *AF52EFDD9D1B8A3399C7981B124C6AA75CD7D9F5 5CONCATENIAMO
1,666,237,464 *AF59A2EB92B3894F8BA74EDB06057707384F4B4E 5iluvhawkeye13
1,666,237,465 *AF58B17DDC979506F7C9333EC25D0F5DF848B842 5mymmm8
1,666,237,466 *AF5ABC8C1A654F1935AE53EC50DA6D5607634773 5WIRYVISCOSITY
1,666,237,467 *AF52B86BA6D994598C2657C0AA95C9542CDCD861 &6A
1,666,237,468 *AF55D2FA2205BB366C4B3EF601419DE1E3D690AA 6ACABALLERADOS
1,666,237,469 *AF5EE60722347470DDDA358921AFC74C580B1E6C 6ATTICKE
1,666,237,470 *AF5524026264C469F1B1BAC5BE141382A9EA82AA 6DOMINGUERA
1,666,237,471 *AF58A0C3B9DF9B6EED3FB21DE65ED3D8FB8FF578 6FRONTADS
1,666,237,472 *AF51CCF51F2C50065B84A1C72BD1FE606C300E87 6GLOSSINIDAE
1,666,237,473 *AF53EA9B099727EA0EA7A631DE2F66D3FA18FF04 6ILUVXXXXXXXX0
1,666,237,474 *AF5345FAF4FD40C3C20F9BF41EACF2F3CAF14862 6PRZYJENOSC
1,666,237,475 *AF5BA7835177BF5580705873B448EF8EDC9F683B 6REBLOSSOMMING
1,666,237,476 *AF5BB9FB7AEFEA75EEA8829F50B99646E6638A01 756615 TURUNMAATAN
1,666,237,477 *AF55723BF7CD7F1ED9400247ACA9ECF56CE6A24D 760254 detmold.-.die.zeit.war.knapp..
1,666,237,478 *AF5959342CCD190A7AB64E878C2E13FE3EEC161A 783226 a tornado watch was posted for middle tennessee
1,666,237,479 *AF5E5D6AB3FD883147B172EC0BC511AEFEE988C1 08302004
1,666,237,480 *AF5D076D7D3822CFA1CD004A3EF07C73CEDEBBE9 11 LINIENBUSSES
1,666,237,481 *AF5A918258D30272596B88EBB4D8C123A3373707 124DIC41I5M
1,666,237,482 *AF5E15E6BDEC8A9322824D38FEE9F714B9D632AB 12jul1044
1,666,237,483 *AF52DF8C3A1B08E45600848D98E1D51AB7FE7F63 [email protected]
1,666,237,484 *AF505AD38D15DCD6A570E91136BD8E9A0F34B27A 163DRAKE
1,666,237,485 *AF549B9B25A56ED0C6D8809C02CEAB99BC162692 1650(ep:
1,666,237,486 *AF51EADD816279B3E2430EB2828F20DBDBC08298 18KENTUCKY-BRED
1,666,237,487 *AF54B682F16C55E87F2E911A3928237ACB0EB362 1931483 olimme kolme tuntia my
1,666,237,488 *AF5D834D1B0A36A0CD09616ABE4E1475CC8A9B19 1.ANOLOGIES
1,666,237,489 *AF5CEE1F5105F81C33A94711DF1ACFBE451E5783 1.ANRICHTENAGENTUR
1,666,237,490 *AF5FAD901F5DF6FD731E865DDFC4F5D07D70F32F 1APAJAPAIKKAA
1,666,237,491 *AF588E758F47D608A12EA3E53D77B9F5B33E7B75 1BARSKHED
1,666,237,492 *AF567CD430FB0E6700939DF942DF6C1009F3A6EA 1-bosnien-friedensaktion
1,666,237,493 *AF5CFA2A3580968E0EF2605C6EE92A2621FA4716 1 BROTHERSERIE
1,666,237,494 *AF5C0477290729BED41464A97400E8F49370B25A 1.CARLGREN
1,666,237,495 *AF5D55E92F7BB2FE0EB9C22481CCA3C14D925AD8 1-communiactions
1,666,237,496 *AF5E89E9B60C555CBFF08DEF0CDB02A5990BE2EF ১e৯
1,666,237,497 *AF5118DD1F9367848DCE7B04F1F3071F1C44CE69 1epigramms
1,666,237,498 *AF579B98EB9CE23F082D4E22F98A07083FBD69A1 1EUCLIDEE
1,666,237,499 *AF56626A409747D8205AEC49C61FD129DCB711C5 1.faschismusbegeisterung
1,666,237,500 *AF5AEA6EAEAC9794C080370D2DDF3264BF364029 1grossfachmaerkten
1,666,237,501 *AF5BB722F6EFC937ADC3FBA76A4FD70BBCFC55E8 1IAMSMILEY1
1,666,237,502 *AF51BB482002E91BF3DAD4D41C197D91B2954644 1-KAEFERT
1,666,237,503 *AF5FC624AA9A9FE9A0099C0B189CC147DBAC4924 1.LAUNCHCONTROL
1,666,237,504 *AF589F2FDA58AC066375009A459ED4B49407270E 1 LOTTE-LENYA-NACHFOLGERIN
1,666,237,505 *AF5C00E2A80C416E16ADAC437C5016564173FD55 1 mmrroottoreita
1,666,237,506 *AF5FF811ACAB2771BD0C9A769E1BC337C1BCCB01 1-musikgespraech
1,666,237,507 *AF55D269D21F83AC5582640B32D76642B29A7A01 1.noteeratuksi
1,666,237,508 *AF5EAFC819492C8176503C17D7A1B07F8B66CEEE 1PELTIMAHAISELLE
1,666,237,509 *AF5AD60A6E5CD47C8097E16590A41C8F3006DCAB 1 PERINN
1,666,237,510 *AF50D139E89B6A7F5FD2B7CFC6C1C2471E44C9B4 1RRY7HVS86
1,666,237,511 *AF5E9DC2200AFBEF41AEADFE7F8C80A27C15184D 1shallatchemel
1,666,237,512 *AF55F24AA29BB7C4B82E0DD0F588F293B0FF413A 1.SIAK
1,666,237,513 *AF599F1163361007C52DFDF954F233B44F3767AF 1THATZAPATA
1,666,237,514 *AF5FDA0794FADAF5F33652907791914469332561 1WISSENSCHAFTSZUSAMMENARBEIT
1,666,237,515 *AF5903CCB7BE501BB752D96C424AE9DDCE6ADA20 2212452 they are thickskinned and they charge a lot '
1,666,237,516 *AF5BF5A8809409B2BE1369AFE7A1E07D9EE56955 2232455 bild-meint-:-ein-nobler-mensch-
1,666,237,517 *AF51DE2CCBBFC9C3E1AC6A0EBABE4E62FDE2A711 2275166 syntyvist
1,666,237,518 *AF5138031FB7586D020CE8845C69BAD3DB70291A 2488736 SIKSI.EI.PIT
1,666,237,519 *AF556ED4FEEE93E90C93184874D5C7EC986C4795 249dorian
1,666,237,520 *AF5F52E22563DBC4DFCDDF4583B6ABA17EA64A36 292165 Ifelektronikltd.
1,666,237,521 *AF5ADC7B8479B7837ACC9536CD46C0400D582032 2-FORSCHUNGSBUERO
1,666,237,522 *AF528687146196F266F09A70CC57B993D8A61EEC 2iloveforest3
1,666,237,523 *AF5894720AD03FE358E9ABB8D01019380E8596E3 2SCHWARZMEERMATROSEN
1,666,237,524 *AF5A343157BE97D39BC21ED785C0F99DA53BA7DD 2SCRIVENERSHIP
1,666,237,525 *AF51F8DF1BF49202F79310F3E55BBA0B3CC76286 2UNACT
1,666,237,526 *AF5AD450BE311CCCDA3F7E1FBEC8383B8671F0AA 3######B`~`~splat!!
1,666,237,527 *AF5AD0959441FA22DF3B309D8DDE5EA59D140F88 3erstbesteigungen
1,666,237,528 *AF565DE79AF7004D67AA76C3B102FF743D81B0F0 3hankelan
1,666,237,529 *AF52A1C51C6A10134337A43F30D5BB5438856DB4 3-inouye
1,666,237,530 *AF50BFAB662A7E0A00AFC2376EB2FA6D2C960FD4 3##p~o ~o)x(
1,666,237,531 *AF50B631B3E276FBF46DE1881DA1638728B60CC1 3P~.~.~.SPLAT
1,666,237,532 *AF575D1DF8A21C4CF31BF1856C22F46BA549DB67 4B01$HMEN7
1,666,237,533 *AF5ADBCCF534E4081ECB9C5F20795724880C9763 4DAROBER
1,666,237,534 *AF5B1AFAECA5443C7C0A62949F9B52831D872AC1 4-MUKEMMELEN
1,666,237,535 *AF5309CDCAF4F741D1060771D107BB1455EF9DE0 4MYROGERS9
1,666,237,536 *AF5FCDF749F2B6314E941C7BDE97706072CD6AEB 4SPIRITBR
1,666,237,537 *AF55C583661367AD2F1F16870C795E0E6873E7AE 4VANGVOORSTEEK
1,666,237,538 *AF5F4B26DFB3D3A0EDB84F8950C85CBE9780D301 4WOULDENS
1,666,237,539 *AF531B51A55099FBD582DEB3A3CB1CBB62FC3DA8 53MACEY
1,666,237,540 *AF58F333E28F9C717868E0814842E6B1B83E1A9F 5JOSHBUTTHEAD
1,666,237,541 *AF5E138DF9A65352DEC6737CDCCE5444300CA4C4 5-kauer
1,666,237,542 *AF53B6FD6BD6F85A3FA3BE9CBB8173B75639B486 5THORSSON
1,666,237,543 *AF54E6C47AD5EB5A68F50BEBAF824AF207007E9C 5TIFFANYHOTROD
1,666,237,544 *AF5DF36B08F886175D753C2BED8322DFBC056E55 5verstoorster
1,666,237,545 *AF507B727F7C6A98B78CAE1EA772CDF1034E41AF 679060 KIRJAKAAPELIN TILAA ON HALUTTU K
1,666,237,546 *AF53747A37BFF11B788C889BD86AAF0807AFB13C 68-HEADDRESSES
1,666,237,547 *AF5272AEAA9F36A6DBB3A1B6CB1AB167B2BDF2A4 6BARQUISIMETO
1,666,237,548 *AF5DFA315A92CB579FD49AF568F883557E6FEEEF 6CALIXTA
1,666,237,549 *AF58F2DE521E50CB288CC44667F8AD9464A9AB21 6CANDONGUEROS
1,666,237,550 *AF576B42F61054251065145B6C131E7226D1FC34 6forumizes
1,666,237,551 *AF5DC9710499D4D15EAAEFAB71FD3F0853156DE4 730LESLIE
1,666,237,552 *AF5877EB920D3F76217C1915492811495E7098A6 7EIMSURAV
1,666,237,553 *AF54F2FF0B9523C5A2869C9E29FB07DDD5F660AC 7ETALUCITRAMEVON
1,666,237,554 *AF5EB1F749380C570842E8E3C0E6F192E6524975 7FWIJKEND
1,666,237,555 *AF506CCBE907640CD2FA9EEE9CBC453A19E20D24 7HITORIGU
1,666,237,556 *AF56BD753E7E95882A53B253258CE5020CF6B93E 7iamturbo23
1,666,2