List database


# MySQL hash MySQL password
1,666,220,001 *AF5442D27CC32BD447096930DB6A62AF0A0699D7 ERICK.MCCLESKEY
1,666,220,002 *AF582C0D9EDFA4649AD311A3F44C998FCFAA9114 ERICSTANISH
1,666,220,003 *AF539FF31A8F59283B8346694CC4CB9FC2E9D48F douglas.goldman
1,666,220,004 *AF5258ED4982D68FC3649C2E36412F9E03F60E67 DQ+SV
1,666,220,005 *AF5591C5BC4E3DBF12557B2ED466D9C52461D945 dr(2o
1,666,220,006 *AF54E4931BD99CF77B4425194EF3C00531557D43 EZEKIELSCHISSLER
1,666,220,007 *AF5BFCEDDC778711677DFB55D88EE2796BCAE473 dti2xgnsq
1,666,220,008 *AF5C293B674F3FE00B3898C087115589047E3109 DUANE.NISHIYAMA
1,666,220,009 *AF5B64153F1C8DEAE066D6C48BE67109845E71B3 DUANE.SALIN
1,666,220,010 *AF53F6B13F9D6F9183337E4C439A365F78C6059A FAICTBAILLER
1,666,220,011 *AF50338AA655B1F02B388ED045C40883281AEAF5 [email protected]
1,666,220,012 *AF57180953833104E90BEC11F94459A2F6C56115 DURCHGEGGING
1,666,220,013 *AF55426E71A376A5B8E52E52A2B3D4680A03871B D_VDC
1,666,220,014 *AF5AE71F3E52A35986202DD457AAFD1D3264410B DWNNU
1,666,220,015 *AF538568AB78F3E371B2DD6B34DB48B0BF9C3A5A ferminchau
1,666,220,016 *AF5E4D9C3CD86479117452BF518E572738637471 FERNERCHRIS
1,666,220,017 *AF59B5C6B4F246939777FDF906939F3C4C68459A FERRARIENSI
1,666,220,018 *AF5EBCB8C2A14E72B8CE368667DCFC99CBA89A99 FICAVEAT5
1,666,220,019 *AF53F7CDCC05C698C09A04227AAEBB08C1BFD0E3 FIDEL.GILLS
1,666,220,020 *AF582FB73D9BD1A3F14DCC9F8924CE56BD65AFDD FILIBERTOWOODSON
1,666,220,021 *AF5C939BD59107A55DB1035E3E93498D585CE9D9 FILMUGONICK
1,666,220,022 *AF59706515A3C45DB8168B8837D53E557E1DCF7C eb-bj
1,666,220,023 *AF5105967A96FD5D8279DFDC3CFC83E2B31FC01F FL1TT3D
1,666,220,024 *AF5209D9A57515F9A764C31EE251145B7DC0C611 FOKINE!
1,666,220,025 *AF506AE9A98E56ECCBE847E12EFD135814E8EFF5 footballboots
1,666,220,026 *AF534D343276B794640DEB49D5E7EB279933071F EFRENHARSIN
1,666,220,027 *AF576F19A6C2BCC9AF480139490A2C9E7FC5C840 EFRENSTEWARD
1,666,220,028 *AF5EA513E9D2FE43CDD71F0906DC4A022F3EC0F3 EFT
1,666,220,029 *AF59CD77298376D1BEBC2AE2B0CC035D4768EE3A FRANCIS.IATAROLA
1,666,220,030 *AF50776410C29B38FA1613755BB416CF8C834A8E FRANKMADDRON
1,666,220,031 *AF5C81743CED6DB0FFEA3649BE52529A9AFE6043 EIGHT.POINT....NO,.UH,.SEVEN...
1,666,220,032 *AF5DB9BF57EAFEA4FE0EFC844914BE8F19D95BD7 EJENDOMSM
1,666,220,033 *AF5AF6BBB93C43E92FC81F3AE654A4980DC22A67 EJTLJIM8
1,666,220,034 *AF5C17D534A98B9E6F914999D7C4C08D11E1BF42 FRICAZAVALA
1,666,220,035 *AF5F76B25BC7552C1683E8F6EE3191F8F9F2F610 FRUE5
1,666,220,036 *AF5A5EDF926D2F4CD77BF19183D02A135EA4614A FRYLGST2
1,666,220,037 *AF5C3B59443C0053961A0386545D62CCC39F1485 ELFZ+
1,666,220,038 *AF52011A1333877748F5E28BD5BA9B48D77709BA FYLLIEFNI
1,666,220,039 *AF5980B9400F8B59746E5AAA5C6A5E720BD68ECD ELYCM
1,666,220,040 *AF51453EC8E5B2178998EB41CCA8C4D263BC9DEC GAMBELL5
1,666,220,041 *AF5C2A8FABD6A1AD8075B83D43F840B28922C7C6 EMMELINE MASON
1,666,220,042 *AF54EEBD93FF3266054FFFB0E27A3477663D0C8A EMMETT?
1,666,220,043 *AF5224A32CBCA1E440F4206C18436311F2D94DFF en,$
1,666,220,044 *AF508C27E65924DFED27D5732CB87E5D46629F0B en;8a
1,666,220,045 *AF569EFF6CF4FECD92F64952628FFD00484E157C ENDEIKTIKOI
1,666,220,046 *AF50464ED899E50F36E86AC0819E91040498A0C7 gawronik1
1,666,220,047 *AF5659B339D4045949251D040C6C2693FA38EED6 EO/YQ
1,666,220,048 *AF5E52D31BD581B35412104737B5EAF4CCF1F759 EREN.AZER
1,666,220,049 *AF5EC9021D2A485B4E61A655658D040DB8FB66DF ERIK.DOWEY
1,666,220,050 *AF5D775F22D4CAC5750109BC0EFA65A2F6B8FD34 [email protected]
1,666,220,051 *AF51BC256A08B42D18F922CF8E55655B57958C24 glenndene5
1,666,220,052 *AF5B2ED89C62F2969E84B7AE08280BF00563277B ESONIMOS
1,666,220,053 *AF53D56A070815D6F8ED0D85F744226713A1EF66 esu8.
1,666,220,054 *AF54DD035CDDE138184DDFFFC4D21ED93CC26504 [email protected]
1,666,220,055 *AF5ED45595A3790BF1A185A2C578E27DBC7F580E GOTIQUE»19
1,666,220,056 *AF5A23A34609C86197957CA583F1B3235FE97DF4 EUGENIO.ALAM
1,666,220,057 *AF5855F99A4001BEA2A42B7E6DDBD55DA77EF25F evelyn.pina
1,666,220,058 *AF5BC7EF773C2D2C5719E40CD15BAC978E9F4E40 GRASS.PARAKEET
1,666,220,059 *AF5AAB9E26D8D71B4D84EF48224201E0DB1E8023 GREGTHANGAVELU
1,666,220,060 *AF58F19B60CA62FC186057796AA832C756DB984D EZEQUIEL25
1,666,220,061 *AF5C8799C0F8246ADC58E2B18FD9ABF0A6F7CEEC [email protected]
1,666,220,062 *AF504CD995BF276B3EF2B80D34A4D54577856846 FABIANMATTEWS
1,666,220,063 *AF553508DE602EF12273C1CC0AF31F4BD1CD786E FACECIES2
1,666,220,064 *AF55D2A040AE4F7BDB6C0651FF1780EDFCCF30FC [email protected]
1,666,220,065 *AF5919B06650CA9A59C1D8B60841CE0253113FE6 gxs0
1,666,220,066 *AF5A916D7A9929E25C8C12A8FF59293A2F232E74 [email protected]
1,666,220,067 *AF5B6AAA9B8A16D762782B035A423090C4B9BAA9 HAMMER-RA
1,666,220,068 *AF525E8ED59B5FA5748632D856D9F3114BB75D06 FERNANDO.CIENFUEGOS
1,666,220,069 *AF592A92DE4DE0E5C69C7CBA9815AA0A379FAF8D HANNAH PONCE
1,666,220,070 *AF5D5FDAC99EC1F4D52FADFD1E25D03DC88EBC25 hansherron
1,666,220,071 *AF525F945F9086BF8FA8AEA7BC4FB4021BEA8E7B FIDELIANSHIDDEN
1,666,220,072 *AF52AD5350ED4DD71B3D6676BD5B873B4025C9CE HARLANLAMONTE
1,666,220,073 *AF5ED3912BA70F2E2DC6F314C88F92E61A046554 HARLANSTREAMS
1,666,220,074 *AF5F71947723E8D5CA55DA2026BD4DB23A7AEA48 FILVOHO
1,666,220,075 *AF5DB6832B7ACB8029E1ADFE2FD38BD11B1D8568 FIONNUALAFLOOD
1,666,220,076 *AF50F97D99B363BFB9811055F49C126A3D8816EE HARRISON.TOWER
1,666,220,077 *AF57320D15B36BB999342B82ECDE3102E3FF9254 FLETCHERMAJKA
1,666,220,078 *AF562B79C784C168D2EA1F56D0BF21048AB722D5 HAYDEN)長官が、上院情報特別委員会でアルカイーダの容疑者三名に対してウォーターボーディングを行っていることを認めた。
1,666,220,079 *AF5BB51E7272604EC3275C9D174EAC2A50D19A8E HCOVUJYW81
1,666,220,080 *AF57F566FD9A927F62D07D638B44D0AE1F23359B helen.cannon
1,666,220,081 *AF581026C1602B2457C4825BC9A43D5C37E23B71 HELLMILITIA
1,666,220,082 *AF51539F945CD1E02009F5E5DB324045D7725177 HERSHEL.JASPERS
1,666,220,083 *AF55F10C2028463FDF2476C65A44D7996CE5A894 HERSHELVEREN
1,666,220,084 *AF5F52EAEAB59AAD537DF051AC29D6B7D2581809 HERZIENEN0
1,666,220,085 *AF501BC58EBAC9CB505D9A100036FA4C953B0B29 FRATTIE0
1,666,220,086 *AF510414A889E89261B61F578BBFB1B2432CEE11 hintersinniger
1,666,220,087 *AF5FBE577430668B053251007D6213CCF1D41698 FRED HIBBERT
1,666,220,088 *AF56AFC6B534E2D146321E7D25A73109526C1782 [email protected]
1,666,220,089 *AF5EECBEFA63F4694D3534AF464EB5DE08214603 hkg
1,666,220,090 *AF5091689429FD3226A6DEBD3EA2D8960E950D5E FTJJ
1,666,220,091 *AF5AAF0CABB90144B839791E0C98C2753FCD4696 housebuilding4
1,666,220,092 *AF57B96D835057AD086BB917A6FFEC949FA7BBDC fyw9
1,666,220,093 *AF5E7C7A394FC03617E8A2B1CC3EC4BF604D3AD3 hsytimmling
1,666,220,094 *AF534FEF8DE3D2172121306E6FD90380BF167A5E GANDRYAL
1,666,220,095 *AF56F34275216C5BA041633A06ADC528EFA189B7 HTTPWWWC5CLIEINVES
1,666,220,096 *AF5C825B9AED4ED9E087AA5EDA44F75B8B852204 H{U'
1,666,220,097 *AF56E15FE102E00E529C617F2DF0E96CC717C9ED GBP6
1,666,220,098 *AF5D8E55FDB5AC975188E69643A8CC081841539B HYLLNINGSK
1,666,220,099 *AF5D454B74CF9B0537846D7B03D328D2D77ADD45 hyptrss1
1,666,220,100 *AF5A0180593D7F08247EF443575B27FCB282DB79 IAMLOONEY2009
1,666,220,101 *AF556AD406F4C5A8F56AA421833DDE64E9CEB44F gesetzgebungsversammlungen
1,666,220,102 *AF58EC330139D18837CF9A66418DB47BE7BCEFD8 GHAMPERS
1,666,220,103 *AF517640C030616FE3FA7FD0E99A1B2F6E7A59DC GHOSTBASF9
1,666,220,104 *AF50D0A778640B59C1578A4B859F3A35608D2727 GHUDDCHADDI
1,666,220,105 *AF50ACE1D4F630B6F08EA31600EC61AAF9014F52 GIERPOMPEN5
1,666,220,106 *AF55706856CFFCAEC527BD22A56B10B3C063E45F IDENTIFIERIONS3
1,666,220,107 *AF5F4765F558F81DB614178C881D701028069FA1 givenithed
1,666,220,108 *AF557B8AC875F8A7EFCBDABB42D4715F48D62F5B GONZALO.MASUPHA
1,666,220,109 *AF5185A7A9CA3C57CD45CFA43D8F4B28334FFC48 GORAUDSED
1,666,220,110 *AF5DAC50F65504749E2A426A4541B57BD7CF2276 gounod7
1,666,220,111 *AF5EB09924642ABFCAEA9CD70BA2FF0573BA15BE INDELIBILITY3
1,666,220,112 *AF58772CBFC0CEAAFE1F5ECF50A4C37D16FCA256 [email protected]@TED
1,666,220,113 *AF50CBEA370ECE97EEFDEE42A3E439EF0BF904D0 GUSTAVO836
1,666,220,114 *AF52E8B9E48ABB8C83F8B8971F5D180432109D25 $H0EB04R
1,666,220,115 *AF57236FDAC3F35C1F80E536B9EA63E682284BC7 [email protected]
1,666,220,116 *AF5EAF082B2972EF7362A8CEFEBC4E7FE8A2B99C h3rp3t010gc41
1,666,220,117 *AF5C474B8CE1D1963984C8F2F2BB49084CBED8B0 IRAQNET
1,666,220,118 *AF53F4846004F4DB2744BF14ED63BE68362F4982 IRVIN.WOOLWORTH
1,666,220,119 *AF5A71E19AAD181700B2DA48373C2F6667B33C06 isaacceo
1,666,220,120 *AF530ED653ED8A577EC094F9E6591D36B7A7DA4C isaiaskisor
1,666,220,121 *AF50E69411DCDDD840EC95657D9033B0A6D45FA9 half-assedry
1,666,220,122 *AF5E871B5C43318709F424B5F71B5001D8A98E01 harecuming
1,666,220,123 *AF5887ACC56A12F0A4A17E151D1F58E7B9F64BFE HARMONIA
1,666,220,124 *AF5B7A84C24ED14282BB4DCF34BC18AEBFD58243 haworthia7
1,666,220,125 *AF5F6CB4EA6D2A9D2C73E225B278F6C02E7833A5 jackjanuary
1,666,220,126 *AF555422A7FA14E38A7139F11684CFA730AC3C32 [email protected]
1,666,220,127 *AF556CF239B494545B8CD435EA9B86D73BEAD9A5 JAIME WILLARD
1,666,220,128 *AF56BACE6BF3097DC3B2775156F0140D0EF08C1A HELLAFISH
1,666,220,129 *AF58F08993BF3A5738DF85C5570EEB584C2C5962 [email protected]
1,666,220,130 *AF57EB7643AACF768A1909FE2BCFED10E025316C jamespsalms
1,666,220,131 *AF5747458396DE9BE60CB8A3669CAB59E69B6C73 JAN-JANSOHN
1,666,220,132 *AF5E90DBCB2E4F9E2724C1A9BB4F4961AB523F2E himaraya
1,666,220,133 *AF5A1D59260BD518A332A240B9A373DFFD2D0090 jasperpitmon
1,666,220,134 *AF5C54FCFDBCCD828AC8D0C224E8AE5A14C68D93 HIRAM.RINEER
1,666,220,135 *AF5DFD668FC34CEE2DC11B9CD2CF00A98CD51A7C HISTORY160160WESTERN
1,666,220,136 *AF59CAD6D903FD76DE0D7AE63F1A558BA6023CC0 HISTORYOFMICHIGANGARAGEBAN
1,666,220,137 *AF5D37112F85478F003512D7CC1AF222789A754A [email protected]
1,666,220,138 *AF5FE3AA0B0E54265821A0900A9A5493986658C3 JCHAFFIN9
1,666,220,139 *AF5A99E420CC5EAFD7750C790E2F381BEFC16797 HOODNIGHT
1,666,220,140 *AF56F394DB5191F73E2F3205A8CA813A1A723E30 jenelltrujillo
1,666,220,141 *AF5ED5E5F8ACF3C1263979E6F097FC730EDA59EB jessica.prieto
1,666,220,142 *AF528804D67C20BCE0E9AA193FFFF668EF336FEF [email protected]
1,666,220,143 *AF5DFA2F2B99637C2D6F29B40AEE3788DC13AAB0 JIM.CANTU
1,666,220,144 *AF56EAA65C05FAA1E6D3AA9E7372F2873FB04239 JIM.LITTLETON
1,666,220,145 *AF5F156AA615AB5F1F1FBA1C2D857AD5823313D7 [email protected]
1,666,220,146 *AF5F6B631BF210A0B19A92F39AF25BC78CECC763 JLGJ62GAY
1,666,220,147 *AF52E6505B18DD746F324BE9EFC6AF43E84F6F29 joelbinkerd
1,666,220,148 *AF586CC133F2A3157C9CD0BADC51166D23AF2E0F joesex4853
1,666,220,149 *AF5CBF6BA963675AE8A9D3AEFE34BBA73484FA1A IAMVIRGINIA78
1,666,220,150 *AF590FDA0FC3AFD846578EECBA55405E517A875C IATSOTTOS
1,666,220,151 *AF52FDB55D8C02BCD29E8B92428CBF946D5655A6 IDEALER!
1,666,220,152 *AF510528D93EAF3A072FAD0F94566D56C84DA15F [email protected]
1,666,220,153 *AF557167FC24B3BB33F202444C2F3F1171DBC533 josephmaney
1,666,220,154 *AF5842F3F56FD66EB9A775BB9C1C19C6E1F6E256 JOSH.NET
1,666,220,155 *AF5BAF5F8819AF20F838373FBD6CD3E697DD61A9 JOSIAH.LAJOIE
1,666,220,156 *AF530AAF8863FB59E6037EB869361001FDB0ED6B IKE.MURROW
1,666,220,157 *AF5739D2ED400B3D7A49D986D919E522B57D6658 JRMAFIASYR69
1,666,220,158 *AF50CEB8AC1D984EF5F8F277F6D8733E1827306E IL-&
1,666,220,159 *AF57D47794AF276F0937934C8A6851A31263F85E ILLUDHOLED
1,666,220,160 *AF5E5FA4E34C71EE6C3609FD95D8DBA8E45B6F14 JULIUSBRIDGERS
1,666,220,161 *AF584C3519BA2FF6E643DCD7A43D63D241ACA65E JUSTINEMACDONALD
1,666,220,162 *AF52F3699563C8CEB74B01CC36E65D60C801B279 k7j_
1,666,220,163 *AF536E14363D453EF68C14AAD9289B584ED164AC IRATILIM8
1,666,220,164 *AF54BD849804C8EA09F9DA0ADE44559E6E0AF949 KENNYKOTCH
1,666,220,165 *AF54D94D26DB515D2212A0FD88726861971566A7 KERATOBRACHYOPS
1,666,220,166 *AF5C895DA480AC5F3CC65E96E3C8DEA45AD39F28 J0#(
1,666,220,167 *AF5A6CED0578A914834BF2A02BC45488C8913F6E jacob-baral
1,666,220,168 *AF5764A59841B0258635ECD73E6BC541DB6D72D5 '[email protected]',
1,666,220,169 *AF585404110F723C5240C4E4C763011910CA9B7B kismaka
1,666,220,170 *AF58E355C2C1826EE7F112D90819FACD4005E6DF JAMARRUFFEL
1,666,220,171 *AF51CF8792596590E6FEFFEABE45A349C29AB6D3 jamescholl
1,666,220,172 *AF5E117BF274BA717BFE4F0BEE44E1D7B6716092 james.nabor
1,666,220,173 *AF5A4777B82DF8B9C619389704638938CB00900E jameszanni
1,666,220,174 *AF5E6F61D1725C4F76C4BE23DD54271ABF196F86 klikkertje.
1,666,220,175 *AF5E37E2D1AD8CDB388C4AAE60BD20359F19EEC5 janmichealposadas
1,666,220,176 *AF526DDB604D38B51673A8BD7C7C4D5F0292B62A jarvisdellinger
1,666,220,177 *AF5482A6B7709A18A3AA5B85ED56C324E5FCACB2 JĀSNIEDZ
1,666,220,178 *AF561808A68E72FAC958BC7DE342EAD069180D78 jason diemilio
1,666,220,179 *AF5063EA256756A230A4133B1AC742A414D06453 JAYSON.KONIECZKO
1,666,220,180 *AF5154FEE605AD575EADB5C1CB9FA31DBA939AF9 JCGALLAHER
1,666,220,181 *AF522FCE0DB98278FC697FFF78C2E9C2F581E148 jeffryhonsinger
1,666,220,182 *AF51ABEC1DEC2E1C7720FFED08FA96B900E711D9 KRISTA-NEUNER
1,666,220,183 *AF559A96EA777DBCFD21DE1BEC5C1272AB67F8F8 KRUISVERSPANNING1
1,666,220,184 *AF56B042562C9C68BA04EEA5160AB92C7AD2C82E ksrvutil7
1,666,220,185 *AF5045F2CF654F0DA3D3C38C771C309D224D8487 l1584
1,666,220,186 *AF5C4FB50D4F0B77C05C58E23611ED9C59691B2A [email protected]
1,666,220,187 *AF54D76DD1B63E63F1363AF0B4D69586C48852E7 lagalerie
1,666,220,188 *AF542216F0B3B9497624CCD31F3AD5B007F41865 jimfire9
1,666,220,189 *AF5F6FFAE746688DCE6EF08A7162BE47DBD98705 J%LR
1,666,220,190 *AF55AC2EA972DCD9856E276BDEC174AA05DAC6BB JOANLAGROON
1,666,220,191 *AF5AC5035EFF5468DD98076C66A7937B6894B4C5 JOAQUIN.KERNER
1,666,220,192 *AF5E8937BDD790A71840FBE5CADF371C41035813 JOE-ALDERETE
1,666,220,193 *AF51A8CD5F2C8554247DEAB2CE4DF24BB53E4AD0 joealpha6
1,666,220,194 *AF502FE8351DE4487DF9DC947874380FA6342CD0 LAURENCELEMASTERS
1,666,220,195 *AF5A07901C7DA96FA293A5721F92432F7139F9FF johniemolter
1,666,220,196 *AF590FC52671E21A5D5223C309AE99CFB86DBDA9 JOHNNIE.ERPENBACH
1,666,220,197 *AF5874102F3F69B786FCAE657027F32545541657 JOHNSPINELLA
1,666,220,198 *AF5E093374A178379B5A83FE051792C99CFA190F jonahbaresi
1,666,220,199 *AF5EDF2365E0FE5A808E6F719BD309151C2B563F JONLAEHN
1,666,220,200 *AF5D6B1CF57EB165F3236F3AE74A684A68560FFF JORDANKAO
1,666,220,201 *AF564737D93DB2EB5045F3DAF88E0ECBF8FC2DFD JORDANREHBERG
1,666,220,202 *AF591CF05E4BF255050BFC2F26ECC4D83DF5EEB2 LDLGSLJ5
1,666,220,203 *AF5FDC877EAF7A6FC1003BC6769237CE850B6BB4 LEBANESEFLOWER
1,666,220,204 *AF59B665D52DA5D6403A9E564148B90D908EF850 LEGASQUE
1,666,220,205 *AF58D968C8387041A510596E13A2FB7F481C015A JUEYBLUEY
1,666,220,206 *AF5D4159DF2A00E9F80A9F7CF569C2D0283309E5 JULISSAMELGAR
1,666,220,207 *AF528A24E8E9ACEE512E7D1C9DE07FE951710282 LEONARDWAHOSKE
1,666,220,208 *AF52497150372B856074717ECC68048315580199 lermor
1,666,220,209 *AF5DD52B6865312A817E10038AFCAF5B0273B1D4 lianeert2
1,666,220,210 *AF5835686E62EF1D8B55DB1491A0BF3A3BBEF141 lilium-vollmeri
1,666,220,211 *AF5765C95AFBBA30B6BCBFDDA0074E5B42006BFA LINENNUMMER
1,666,220,212 *AF5651E5424DE8DE7787D71488CF9413CE291B27 lisa-bis
1,666,220,213 *AF5FF3A8E530B0BF16225035BD297ED5EC80E894 LISA KAY THOMPSON
1,666,220,214 *AF5E562D4CA6A68AEA3AF1970275A31B7F1AAF0D lisosomi
1,666,220,215 *AF552FDDDAD68786B770E86A93A5146B74507C74 [email protected]
1,666,220,216 *AF571437E887EDA1E30D7ACEBD17965D41DAC81F [email protected]
1,666,220,217 *AF549C651C183031CC2239D48E17D507BE33D18C [email protected]
1,666,220,218 *AF5325F6A70F24ACF429CFC0D65D38AB94DC28F6 [email protected]
1,666,220,219 *AF51493762E932B591E1C92B24899AD54A18D014 llultsku
1,666,220,220 *AF5D8E69CFB00B504F888DEC903FC67FED7948F0 kenethbolivar
1,666,220,221 *AF5BA9FAEE15E857BE88052C485FE422DC9345C0 LOGAN.KOONS
1,666,220,222 *AF5662228E75546434C7AA4110EB6E255F89A40E loginfailed
1,666,220,223 *AF5737F7E9B99A47E22D8B5865F31F179FCC3D4A KERINTH9
1,666,220,224 *AF515E8E4889E471CE1E07A47FD93214751E627B LORENA87
1,666,220,225 *AF5D5F1305BEAF893BB5C882C1C4D66BD005D865 k.g\
1,666,220,226 *AF59122F9E8094FF635615526F3BB795D83C0D37 KIWǑN
1,666,220,227 *AF55ECD26A83B3ED964DB9C09AE50DAD6A720F90 luovuttuaan
1,666,220,228 *AF542DC1ABFFEC7349700E920A2D5666CD2B83A7 KOSTENVERGOEDING
1,666,220,229 *AF59CA440D15D186F7E2C611380FC22CB04182CB MA4873
1,666,220,230 *AF53301D02B2D1478D1E4B9D9DBB32588AB51CC6 KRUBINBLOGSPOTCOMKRUBIN
1,666,220,231 *AF526D5AE4E505DA529102885CE6622937294A7D macherson's
1,666,220,232 *AF51AEC6E70AE0186DC78469C191B24F9CE3AB3A Ksilniuq1
1,666,220,233 *AF53EA196C5C5678712E8A34847C0584DCD2F395 KUKKAIN9
1,666,220,234 *AF55BE672D060E7D354824029AB9EAB287266682 KUNLITE1
1,666,220,235 *AF5C3D5685F391260F8EB713B8DFCA36D662985D KURTIS.MAGERS
1,666,220,236 *AF56AEF87E3CEB9B723B045000DD56C18B567030 MAJUMALU4
1,666,220,237 *AF56CECD82CEA4E34A9E507FD5A2C23E7178987D L438877
1,666,220,238 *AF54F4607B4B82B7BC517B3228F4AAADF924F001 MAMADREZA
1,666,220,239 *AF58003E4E450041C95F3105FE4155A440B9F451 [email protected]
1,666,220,240 *AF51186B3DA702B6AB872C380A84DE6F00D7672A mandygatt
1,666,220,241 *AF53AA2246981A7A48FCECC8C12F812D598F3E1E [email protected]
1,666,220,242 *AF52A9FC89C04F2713F552B3F00E8EFEB3A826B4 MANUAL.GUTGESELL
1,666,220,243 *AF529DA9734E9F2475B02B0DA3C44E1C48B3C95E LA,.LA,.LA,.LA.FEAT..NOVA
1,666,220,244 *AF5691286A36E1CC07582FC8C19D3C044D004D7C lamontwiley
1,666,220,245 *AF54D0699D8444DD3B3D53034A90E249428EAFE8 MARION.HYMEL
1,666,220,246 *AF5E32E675F53D1DDA0C6E04A2EE5E1CCF1D5A6A MARKDARST
1,666,220,247 *AF5D2F3B2348CA04EC7DEB5B62E642866016881F MARLON.WINBERRY
1,666,220,248 *AF5A76E72C502C9265A0C85AF582E846025BCD45 [email protected]
1,666,220,249 *AF567A45A7732C88C15660E56685B0046327746A laurenschrage
1,666,220,250 *AF51C52E57782689ECF15D3EFF065F2FB87A6043 MARTINTHISSEN
1,666,220,251 *AF5FCD0B10DBCCAA4F67E001AC56510D5947734C lautculed
1,666,220,252 *AF52A88B880867D913618635B7BED531A1A17BDA LBAUDAINS
1,666,220,253 *AF5995FD2EDC82B46A4A7CCC572B2967DBFBEBA0 MATOU35
1,666,220,254 *AF52C9B03822F04D2B7D3113921C52831D7FF0D1 LEANDRO.BRAWER
1,666,220,255 *AF578853F423A877A8D3654F08FA2FC19353D8BF MATSELL9
1,666,220,256 *AF56B3BEFC235B1EF182D4E5459C115E6D2A0F12 LEE.ANN
1,666,220,257 *AF51D7C773D8B4A82D4C9CA1A017E2A833AE02FD MATTJOEL3
1,666,220,258 *AF5AB867F37C5C5EF7C78A9419BC4E30C65301CA LEEKEALOHANUI
1,666,220,259 *AF5427093C915ED4B9A1FA96ADFE986553D465C6 MAUNARD3
1,666,220,260 *AF52847D8F9F86A7A991A07E295CC047EA0E5B01 LEONARDODOWDS
1,666,220,261 *AF5BDD679DD4A36EA4B65C60AE1205F73E0E76EE MCEKRRWC
1,666,220,262 *AF5686EBF1829A72D3B7995C6908770DC349C413 mchstlouis
1,666,220,263 *AF554C42DE5AE19C11CFEFDDA9B1CFA75C74A969 [email protected]
1,666,220,264 *AF5595520FB30E3BEB8B207444E014519F214966 M$dr3c70n$
1,666,220,265 *AF5F48452CD2FFE7ED478B0EB7EBAF42B77F8B75 LEVÉLTITOK
1,666,220,266 *AF589991037861093A8C33E7277F3CF6DDAB2903 MELISSA BADGER
1,666,220,267 *AF54C184771E523A17BBE0831DF3B7A6785C8D46 MELISSA.JEAN.BAPTISTE
1,666,220,268 *AF54E4405C45EA9AF1C012631F37D097384BBB64 LIBITIM
1,666,220,269 *AF513026D95D76A93BD14897BE0C09D18BB3875C MEMORY-MAP.CO.UKWWW
1,666,220,270 *AF59EE340F1B974232942BE03FBDCA2EF830964E (lightin'.grooves.breakin'.dawn.mix)
1,666,220,271 *AF53C54259882CB73F8FCC86CCA3A093B8660A88 MENETTINHCSEGSUA
1,666,220,272 *AF54ED64FCCC208B03FBCDA2C012B6BF57A233FE MERONOW
1,666,220,273 *AF59AEA06315255AE78C15ACCE6DEEF28C3BC4AB lincolnminarcin
1,666,220,274 *AF58B5029228AD75F51EA5DF20F87A9AABD0FED8 LINDSEYBURGA
1,666,220,275 *AF5F1E2B29C77A777980EFC5F6D3F51F54A7A974 MGC119546
1,666,220,276 *AF51D0C52E5E649A753D8934904208394CF35B4D MILANANECELLE
1,666,220,277 *AF5E94969D96D720B265336442004F94D4BC1D2E LONNIEARDION
1,666,220,278 *AF5C729594B2245C429A5870A817C181C8EF06F7 MILLBROOKUSA
1,666,220,279 *AF5D024D7CFEF3F1D466CB2F688BA22AF5BFE070 LONNY.OTERO
1,666,220,280 *AF53FD5F4FD1333CE5EF1522566D8E6ED9EE0169 MINDAYING
1,666,220,281 *AF52F5331723F75EBA50014D57BB95E80DED83F0 MINH.ISSLER
1,666,220,282 *AF569A6A619424CBF4AAA72E218FB8147ED8A42F LORENMCCHRISTION
1,666,220,283 *AF57C7DE7B4C646960776AD64D11955F973AF064 MISERI98
1,666,220,284 *AF53B2D001C04F1398C1A1BD3D62E1469B54F52B LOVELYRAINBOW
1,666,220,285 *AF50125B246BA58AFADE353E27DDBEA474E1DB77 LOWELL.BRUMMETT
1,666,220,286 *AF5D842AC302BB9C8CB748A8C06B736A3927D201 MMC
1,666,220,287 *AF52D94C5B6835024F103FE0351ED4A99CF6B886 loyem
1,666,220,288 *AF5A5AE0C92AD2F1BA385CB22D12F1883CDB1F71 LUBRIFIANTE7
1,666,220,289 *AF5311D25D293302F4B5B621F3E27F42231A8683 [email protected]
1,666,220,290 *AF5DE6DDF9A2F6B31A00F3B515C25935AEB227E0 [email protected]
1,666,220,291 *AF58E2478856B12B29DC556F3DAD1F70D8E11D1F MONSIEUR V
1,666,220,292 *AF568D69537199A2B35545A80B2BFC75AD4BC846 [email protected]
1,666,220,293 *AF576657A70AD7696D3123501C72ADF06E4A47BE MORTON.WATNE
1,666,220,294 *AF580AC1D1BD0FB8216036301FBC3A48BDC72157 MOSE.MISFELDT
1,666,220,295 *AF53198EDE54F62F12A2811F3DEFCB8E92B07B71 lynwoodbettcher
1,666,220,296 *AF5EC83F443AE88ED5CD571512496E71E45DE4D6 Lに達したポイント。
1,666,220,297 *AF5433138E318C2A42D1D00646DD451DB834F1E3 MR 7
1,666,220,298 *AF5571FE38F52DDBBDB9A4A7E7192EC5EC73C762 MRS.BREEDING
1,666,220,299 *AF5CC1365742C41C0D788B7442224FA672EA14EB MAGNETONS0
1,666,220,300 *AF53409FFF8EE89D780360BE61E10CB352C4616D [email protected]+V3$
1,666,220,301 *AF53F2DCFE36E7F612BBD10D38EC180754202E15 [email protected]
1,666,220,302 *AF530845DE57B93A6E191CA84D45BA182EE0DE36 MARELY585
1,666,220,303 *AF52BF18E76D25A521A9165E2BC52D939B41E488 MARION.LIGHTBOURNE
1,666,220,304 *AF5694701B4531E7A0CE422719B28A6891F4B036 [email protected]
1,666,220,305 *AF5E19EF667161E519CD10EBD38EC514CA41A185 marktwirtschaftlicher
1,666,220,306 *AF5D14E03D67DEFE6E4E7DC3B125A4C8B64F1648 marshalutopia
1,666,220,307 *AF5FC642E83F9290D31E5C96C00047FB7A9C4FE9 MARTY MOOSE
1,666,220,308 *AF5199510AFDBC5F9AD40B783C4B7168F9481CB1 NATALITIAL6
1,666,220,309 *AF5548010AA846D6BD34432929B10D19ECE7AA60 MASHARBRUM0
1,666,220,310 *AF54D504589AC181EC9F38689F459340BAC05C78 MATISCHITZ
1,666,220,311 *AF57EB316AA9D4E88E73818BD5F80456DAA03EC2 NBERNARDINA
1,666,220,312 *AF5BB324DA596610EA51F260162DEA2F52B241A6 MAX.BOLMAN
1,666,220,313 *AF55784F0746A367764F152B8217E3FAA8BD5C52 NEALDALLEN
1,666,220,314 *AF519C45A4D2DF46CB5B73CA6C20204929F0A94A [email protected]
1,666,220,315 *AF52E716B0F51E91674919712586A73AA95D89BD mckinleytipps
1,666,220,316 *AF51626524B24043BDF579D16E9B93687C7D7CAD mclgate1
1,666,220,317 *AF5C890CF122CCEB4CBE3D59E481E54C88C5360A media-critiquing
1,666,220,318 *AF5393AB5A3782CAD41CCFAEE664F144AF78BF79 NEROPHIS-LUMBRICIFORMIS
1,666,220,319 *AF53C8B4C5EE8818C53D7B086A1132C67E831D51 netazfing
1,666,220,320 *AF5AC185A51F19686A0C2DE2CBBA70778F46D487 MELVIN.RIVAL
1,666,220,321 *AF5954484839562A86C6A563DB61DE86672A18C4 newtonfazzone
1,666,220,322 *AF5DBC8D03D125480E294EFDBDA36D4B0E777088 MESS IN MY HEAD
1,666,220,323 *AF5B34DFD11DE96306EAD7B1522E20CEDFE8E5AE NHORHASSAN-GUIAMAN
1,666,220,324 *AF52BCEED9BC61BD7B1FA0C4AD19F6FF12E49FA3 NICOLE-LIPTON
1,666,220,325 *AF5F1D5A1A6BDA22586FA182DF0679602F5CD493 mhkndixc63
1,666,220,326 *AF55BFB42D8748A1128A843FE2A771E416965C16 MIDVENTURES
1,666,220,327 *AF5F9736B124C51E450EDB706B4FC51C59269AD6 MIGUEL.MATEOS
1,666,220,328 *AF59B282233F1C1CFC2EA8B1F1790A756780FD64 MIKEONDERSMA
1,666,220,329 *AF58347FA340ED90521ADD0116DD907776B4A667 nora.radoniqi
1,666,220,330 *AF5FE0A764E85BB6F53992777E371D9A150EE76B NORBERTOZAJC
1,666,220,331 *AF51AAC866448C598346A6592A16FD283546ED93 MIQUEROS6
1,666,220,332 *AF54C5D4D7CA7822173D1EAB7A4CAFF6F5EE8410 [email protected]
1,666,220,333 *AF5EC4BEC424425C0F1759B62B10172CB46A0198 mision.guaicaipuro
1,666,220,334 *AF5B0DABE0D17805AE83E347D6E0DEEDC82A4688 NOW.DINOGUY2
1,666,220,335 *AF5B70C9CE57CE0C3F67F44B5EF8A95A5C40434A MIYAJONES
1,666,220,336 *AF5B66F15A58D62CC79FB85FACC0D4C175D4E81A [email protected]
1,666,220,337 *AF5F26B43ED2C9D12BB0A0EA792A036B2C2CC0AE MMCBURNETT
1,666,220,338 *AF5D2766688812A2DBF7F4218BF297199C93A36D MNFABB
1,666,220,339 *AF539D63F0C295255BC195E2C317AD529E0C00DD mnkiw
1,666,220,340 *AF5F659D4BFB2604D392660D5EE10F3DFB1090E7 nzoh
1,666,220,341 *AF596D8406418E0BE316FABEA262814C9D2494F5 MOMCONFESSIONALSCOMMOMCONFESSIONALS
1,666,220,342 *AF516D8AF366FE72C84E5DEC6D232F4F83774F63 oberblegi
1,666,220,343 *AF5FEB4F3ECBEB0DA7C61DEDA5D9FA33BC629659 moosefun5
1,666,220,344 *AF5F406490988F408A45802A7A5FB8F926483184 morpheus
1,666,220,345 *AF5650D2520B788D4E8CD6399251717D245C2323 mosesbrandenburger
1,666,220,346 *AF5EB34738C07B707DC5DC7C67E92A5D47E13D29 oghxblc3
1,666,220,347 *AF5264369A09E8083DC677DBF84C69E5E30E63BD mravinca4
1,666,220,348 *AF598A7B0FA28B9A33AE4FFBB0464AD4B9214FEF MUHITTEKI
1,666,220,349 *AF503719C9143A5AB01F2F3B627C858F634E9B69 my-ambition-still-burns-strong!
1,666,220,350 *AF5F9A886DEE8451EA5D5C587476E0524E58B49B >-<[email protected]======8
1,666,220,351 *AF5217510C9FD8BA92BB566A110EB5B5A5FB6A35 OPENDOROTHY
1,666,220,352 *AF5728A3EE68C1C969F00FED4D36ED2891739F17 o->-<.*.*.*.q===p
1,666,220,353 *AF542D1D95B8310EFE77C0A17081018F9501973B ORDIN
1,666,220,354 *AF520BB2CB42A9C9E7C47A9D2A06F104F22F17B6 NATALIE.HORCH
1,666,220,355 *AF5646ADB87195DA98E6879C3545EADCB8CB4282 natashanutt
1,666,220,356 *AF5CA06E05F008742B0222DCCD261231388B11E3 OVERTHREEHOURLONG
1,666,220,357 *AF517AB4C24B52EC9C4F7D30005ACB75A7EA86FF o-(Waters-Of-March)
1,666,220,358 *AF59BF8603165F44FEB84C7BE8F4779646A17E41 ndrbrsh2
1,666,220,359 *AF5F865A38760C4DA50D645B056B36759E532954 NED.GUTTENBERG
1,666,220,360 *AF5B8C29B71EB45923EB9A2C3CC583B64D26D3D8 [email protected]~0.~O.(X)
1,666,220,361 *AF5462A4F816B118F74A407A24C01B3C1DFA6348 parlorish!
1,666,220,362 *AF59FB5B0BC623C0E5B70FC30C4E1C88F43F01A4 NIGG4RDS
1,666,220,363 *AF52EFB61106B05B1CE91ACB960F3F8948C3BE20 p--b~;)
1,666,220,364 *AF5E355A2FB29C65356D98B4022BA05C04728279 PEARAWATT
1,666,220,365 *AF5A23CE0A81C276D96648381B538780DCF56C5D pearlairhead
1,666,220,366 *AF586571242B1DF282F0A07F67707FC08CB91741 [email protected]
1,666,220,367 *AF53EAE914CE8B4940612ED009E49BA7CB9A470F PEPSINIFEROUS1
1,666,220,368 *AF5928B7A1F136816B0D8F6243850F6BFD48A18E NONWPMIRROR
1,666,220,369 *AF5B6C65EC2A2C6D4387C409B823ADACBDB22C54 PHOTOSSTAR
1,666,220,370 *AF52C2DCFEE3FDDB9104541B165E7339956FF393 PIIRTEIST
1,666,220,371 *AF5A3E59973399D5A844CA51E18496936B9890F1 odepsnm1
1,666,220,372 *AF5CD827AA364CA3D839CD88FC704FB2DB803F78 oliver kirwa
1,666,220,373 *AF5B39144ABFFC9FA39B8F677405B94249D42704 POINTYFINGERSCOM
1,666,220,374 *AF563471063C689A0DFD54757C5CE0DA9637E9EA POLARIZEDTHE
1,666,220,375 *AF54108AABAED9788D812688887F766E37207268 on files encrypted with crypt one source for cbw is [ftpcb]
1,666,220,376 *AF5AE7DFB91DE69CDB4C3B995A39B309866A03E9 POLOPOPULARIZAČNÍ
1,666,220,377 *AF584D7A5B9A22EC810738F8127E2A9F9681875C (O_).o~.0~<8
1,666,220,378 *AF550F2F74793D40A2A5C1A956CD3B3955169725 ORDONHA
1,666,220,379 *AF522A79D8EF72A5C0DF405B246769279FD09A24 PP *)X(
1,666,220,380 *AF5BF348CD60E1114A1431E4DB8F83747C4E3CFE PRINT.&LT;&LT;END
1,666,220,381 *AF5FE72142573771B632BB28CF9615793AA4150E P8649
1,666,220,382 *AF5273AF19BEF2BAE1C2616A329263CE23E4C404 P941597552
1,666,220,383 *AF5A6A376D8182BB911CBD0888474185B0D8EB05 ptowne
1,666,220,384 *AF5A3A95894F49C1053A256698E811E0BD9E5145 palmerzeimetz
1,666,220,385 *AF5011AF19D4EC18A32263D8FA13074D80D92911 [email protected]
1,666,220,386 *AF5E8C5FB73F381A3D6CD10AB847499F0205C270 paradis-(feat.-louise-vertigo)
1,666,220,387 *AF551439A006DE4344C2AC654BDC5D4220F63151 [email protected]
1,666,220,388 *AF5A7F087F88B6213329104016D8DA60134CC91D [email protected]
1,666,220,389 *AF50DE91BFC4A58A70FC963CA08CD091EE16AD88 [email protected]
1,666,220,390 *AF53C3038AB78E1D71A020EFFEF73C839C7B49EE [email protected]
1,666,220,391 *AF577D000D3E64D4897B98AC648A176A66E9D53B pd~.~
1,666,220,392 *AF5BEDF9B238671E4C1A36C23D04D71731A38DBD qu4nd4res
1,666,220,393 *AF5BEA4188D47BEB0ACCFB79F8360A0102F012EC quincytaddio
1,666,220,394 *AF5B19E428B82477D246618EC90D352A5142A324 QUITAMELAPENA
1,666,220,395 *AF5DFB7B1399A32895D1919D39FC6E829751A54D R33S7ABLSHNG
1,666,220,396 *AF52F129D4C54E743CCB3529ED6478CE46ABD104 PERRONETMARIE-JOSEPH
1,666,220,397 *AF54A628ABB8D47632259C8F9721A14650D9E2A4 radheid0
1,666,220,398 *AF5D7C0C8C2AA99E37E63D396A94707F41223711 phoil
1,666,220,399 *AF5354F1F673866ED83067D8B7902C1F92EDB4A2 RATIONEEL.
1,666,220,400 *AF52C908B3E2873E99EA248B9AA4C217FE79CF59 RAVLIME
1,666,220,401 *AF519C1C61473AA50A4E6EA4D973FDA0F729ED8D REBECCA-BEAMAN
1,666,220,402 *AF5ABC0CB521F23D46889C5E0D02C4A042F60729 RECACHETRENTED
1,666,220,403 *AF5E95E71FE6B23C32B889DBD9399BEF7E4D422D RECOPIE5
1,666,220,404 *AF5E5D68F3A74315B072DBDD6A041B5790092D5D POSLATAS
1,666,220,405 *AF5733D1CD33B873DBC7C85FEE7BC4699B830C3A p#P.*.*.*.~0~o{x}
1,666,220,406 *AF57C9D9C4D4C2082641334F1C91C1F1096DB97A p==p`}8{
1,666,220,407 *AF58B46447521D13AF5D14ACF5E5791A8215AE87 pr33xamnaton
1,666,220,408 *AF5BB122188BD8A273E36E0A731D4D796CE29A81 RESTIKLE
1,666,220,409 *AF5661159927C8C08A81628D286390EA15445D9F rethceh
1,666,220,410 *AF5609798BC90B8A5CED905FFFF90A7689691FE8 profe$$!on4lly
1,666,220,411 *AF541567901DAE34C93C5F85EA123E0A692D3A70 psapesusa
1,666,220,412 *AF5410ED4076E91DC8FB99D639B227A9EDF438A7 puolipysyviä
1,666,220,413 *AF504851B64EE0CC01BA4107D13D2E685C2854C6 putforths
1,666,220,414 *AF5AB2815C41403AC420142322E40F06CF238C88 pxiwillcover
1,666,220,415 *AF557DF5EFB83E8E511416C50B37E3C21B4FD906 [email protected]
1,666,220,416 *AF55B2316B54263A9A69AFD06BB024BDC56CE564 [email protected]
1,666,220,417 *AF5320595787E49F353F8E86DFD960649764603C QKF123
1,666,220,418 *AF5B287297508B5E85CBD22E1DDA00E2D0385C10 ROBTNOWLAND
1,666,220,419 *AF582B93F5E62135CC32C2E627E5482D1646C9C7 rocketscuba1
1,666,220,420 *AF596820849FB94596A8EAF9E44A38BF50D24624 q#####p.~.~.~.o><
1,666,220,421 *AF53B821F399FCA085E24B03C4313D332F1A83BA QRONEK
1,666,220,422 *AF51D1EFD96E0326169240A7CAFF3CE4D22A1755 RODOLFO.KINTOPP
1,666,220,423 *AF5593592B668D68EA23391C8CA96A6B50160744 ROGECH00
1,666,220,424 *AF5E87CEE1A1816E5EC52C62565A6A7C8B59DC0D quintinlemonds
1,666,220,425 *AF59C4B01C401D26788528597B6AE07D202093F4 RONDSPOO0
1,666,220,426 *AF5A06A1C0EB057A4CB94D3D089BD5BAF137131E roongsang
1,666,220,427 *AF5A94321A0A7BFA3ECC47A8811FF82BF565BD67 radstande
1,666,220,428 *AF529FC1D462E8F57C70C102B748D50219C8438D RPUSOPYH7
1,666,220,429 *AF532520D5B2BF0CE8729009F0034575E6FE05AE ramonfarah
1,666,220,430 *AF52CD5B2AEED8A6972CEA10D075BBB12D3AD466 RUATBSWED
1,666,220,431 *AF543D1F2B92E52AEE0366CE5F3D1AFF7496347C ranghis
1,666,220,432 *AF5B4AFD80D45A035A0A544C5A6AF3617E70D5E4 ra^perent
1,666,220,433 *AF5C093DD050763B52777D23A01A383063C90B18 RUEMAFFA6
1,666,220,434 *AF58A13DD6FDDA430D76DFC7AB57FAC69529C74F RUSSELKALISTA
1,666,220,435 *AF571583F3C37826D95337860CD25096436311D6 RUSSKAJAPE4AT
1,666,220,436 *AF5A19B07D73C3DA861A0C5A07E8014D575E4E3A raymondmekonis
1,666,220,437 *AF5168EA018804744D3BE00E5F211F870263CCDC RAYMONKELLN
1,666,220,438 *AF54FB09985C4A4F135A267C64C10F82AF3CD99C RUTHSAILOR2
1,666,220,439 *AF582B33BDF956363B5213DC50C3DC5883702964 RUXGREGORY2
1,666,220,440 *AF5BABB817B6B90C3935FE17B73E12D5AC709B56 rcnvync
1,666,220,441 *AF56F6F43ACF6C0E2E02F71EDD681752D88CC149 SAG0 SP1E
1,666,220,442 *AF5D69576689156EC62227114E92FB2277A59E6B SAKIBE
1,666,220,443 *AF536934C2A78417290B5843692BFE006017AF5E samualshauger
1,666,220,444 *AF5CCE12BAFFC5A801D88578D82C9C4871731518 samvision
1,666,220,445 *AF50046D120E72C4A5D71759B2756C2F33F4DF5F RELIGION.71.238.39.8
1,666,220,446 *AF52521D97DF2B6189166D3ECD5BF8C4173B7D07 RELOADED6
1,666,220,447 *AF59CD8B15909EFFE16DC5587413C81FD0014D3E SANKTANTONAMARLBERG2
1,666,220,448 *AF5D16859831DFA7167794D0887B257B57C73847 renaldoarms
1,666,220,449 *AF5E117DE9FEA9CB8FE95C74E9E19BA67188CDC6 [email protected]
1,666,220,450 *AF51D8680EC99230AB8D2F6B591BCD4E2752B8F2 sara291988
1,666,220,451 *AF57E89308F7983E4FC1467B9920AC3E07F055DB RENEODEMS
1,666,220,452 *AF5DE904FF4F7CCC8EB92EDC2353B87F3F82EA85 SARA.STEHLIK
1,666,220,453 *AF5CFF23F07962CB35426A163C01FD26929EFF57 SATHERKING
1,666,220,454 *AF5F53A7C974FBC19AB0FC647D2D1F9784CA9770 [email protected]
1,666,220,455 *AF50C39B1C814FAD0ADF9C7A234582731D5A7E98 RETARDSIERRA
1,666,220,456 *AF56015D9D2D5CFC187B8698B72DE70F221E8B97 ŞCOALĂRACOVIŢA
1,666,220,457 *AF5DB9D5090861FB0E65F02131CBE0DB69DE2AF3 REYESGLAWE
1,666,220,458 *AF51295FD2CFF9AB4621BB91EEA17F5E05D7DA80 reylasure
1,666,220,459 *AF5E8FA188B083B8C87958DC93B8FC6322AEC7B7 SCOTTPOLOVOY
1,666,220,460 *AF5C717D34AC72D7042BB34317A7DE8BECF2AA78 SCRUFFYCATALOG4
1,666,220,461 *AF5C80157827F1EEEC5149D1AF78DF7EA81C850E SEAN-BLASHILL
1,666,220,462 *AF525DD13D27BF9B5E7F0B582301945F29CD38A6 sebastianwagnerreleasesopenmeetings
1,666,220,463 *AF5201F354997449D9E8AE9DC0E3DC101B8A4209 SECRETZORRO1
1,666,220,464 *AF5CD00C9FF08FCEDF5323791C9FB37B4377BE55 sejane
1,666,220,465 *AF52272E9D371D52CEFE9A39B4D7EF05A9CD992C SEKKEDDA
1,666,220,466 *AF57929CB1726173A3EF16870DFFB90FAFDF923D RIVERKEELUNG
1,666,220,467 *AF51FBA536C4546E976B5745F7F61D1460B95FE3 ROBBIE-DUCEY-BAND
1,666,220,468 *AF57561E0D480203808726FB3123C38543097283 RODNEYKLUTTZ
1,666,220,469 *AF5CCEE09D0413417D63CA259C590C39A63E15CA SHALESHA SAMUELS
1,666,220,470 *AF501318A62FD9978648CA132ED038818CA9C544 [email protected]
1,666,220,471 *AF5655C6CF9AD6DD61EF3F33135875B0B7BAA6C7 rohitdogra
1,666,220,472 *AF5C2267663626ED796D3777EF53D1E1FB929EC7 SHAYNE.BEARDEN
1,666,220,473 *AF54DF4CC909F86F9FA7D19DD7725815B325E9A9 ROOSEVELTSLAYDEN
1,666,220,474 *AF5FDE6B11380176DDB7536C80FC9FB0EB320E82 roploch
1,666,220,475 *AF50FDD8C12C618AC55E4F7693F135D6EBEA676E [email protected]
1,666,220,476 *AF535347329507B44DE2CAFDE4F3FC48D1FA945E rosendoweeks
1,666,220,477 *AF5E6D655BC6CBB64109EBB24520C8C557933D88 ROSE PORRAS
1,666,220,478 *AF53BA8954428AD141BA6C241183A66EF90C405E shillings15
1,666,220,479 *AF573B06B6FCE305EF21E284587186ABE71BC44E SHIMOLI.SHAH
1,666,220,480 *AF57E0FC260B6D4FF19E547FA0BEEDE29DC61F53 SHIRLEY369
1,666,220,481 *AF50F539EF0C12DF48DE9571918B3E8A217A6361 roytote
1,666,220,482 *AF5EACE584D9A857A745A5E2FE58E989B18FC4A0 SHRIKANT-VARMA
1,666,220,483 *AF59FDBC6E3F061D7EBC4DA29E4DC3E849676C78 shut-in.'/s//@/t_,/i/n
1,666,220,484 *AF55ABF9A629897E46C130E7861795B9DD797F6C SID800
1,666,220,485 *AF591C414AB6FFF6606760BFD877FB567A23B8FB SINNINGNESSING
1,666,220,486 *AF54F9C468B77BC57F488D5FF6C11B83E67CA33D [email protected]
1,666,220,487 *AF53789B231F5F34400666BACAE9D400AD63C9C6 rustyrelaxesasfilmtakesleafofabsence
1,666,220,488 *AF5AE0DF081AA15E5993BDE71B239183EC8C2EEA SITMATI
1,666,220,489 *AF53F7ED9CCF97DA11C416550188241FC373A9C8 SA
1,666,220,490 *AF54670AFEF7AD87FAEE446CBFE38BC832C9E91D [email protected]
1,666,220,491 *AF5BBB7351384FC339C996778F1706057610925C SAMUALGREENHALGE
1,666,220,492 *AF50C79788D089C1972E60FA7DA2B2CEEEADF3DD SNAKES690
1,666,220,493 *AF5C2E0D29FA0BDA4E65F186002A980DF3019DBD SANFORD.PLAMONDON
1,666,220,494 *AF50F70753C0D8532D4A97162874C8743B981510 SANORTEP
1,666,220,495 *AF56BB7E0BE9E9E7D692411BDFF5F4E7D2D62214 SARPEDONED
1,666,220,496 *AF5C09C2F0E6F1431DDA4155E17F401B7F54A6B7 satisfied」
1,666,220,497 *AF56396417E3257EA64FB7DA689DB04E05CC98EF solomonbuchannan
1,666,220,498 *AF594AFC87790924EEC327848515CB592DDA46F0 SOLOMONFRISELLA
1,666,220,499 *AF58ED40D5C6EBAFA170EC68B0743E4C2DC27399 savetibet1
1,666,220,500 *AF5EE2D1141F000752C1C83598C27036DFC79D64 sonata-in-d-major-kv-448---allegro-molto
1,666,220,501 *AF5D7F0F72EB304C67630426CEDAC122FB553399 SBRANCATI2
1,666,220,502 *AF5072FDE21717BDD4730613390C675D7F6A3854 SCARBURNING
1,666,220,503 *AF59E3745F41360FB4953FE6C475C2782C8F79FB SOULDUCTIVE
1,666,220,504 *AF58908602FF1BFC60C2C77C35049C476DCD48FE scorpion48
1,666,220,505 *AF53B043F1AAD4D1FEE4113CD84F4C190C34C32A SCOTTMENONI
1,666,220,506 *AF5180010D579B0D266806EF1BA03683DC4BADEC spermoca1
1,666,220,507 *AF5F355BDFB51B213056CA3795DEEE0CD538FF66 Spirit-Zone-Recordings
1,666,220,508 *AF52FDFEEF286CB46D91635B04D22EC5EDC3EB62 SPLAT! ~` @====3
1,666,220,509 *AF545C5A84220EE7B37C0371EF9BE76783D044C3 SEA.WOLF
1,666,220,510 *AF50C2B108ACB2DB5F106E725DE4F115A0A3693D SPLAT!-O~Q-8
1,666,220,511 *AF5A120E1518C27A031D21D59C9B4C424F5E1E0A seepaddelns
1,666,220,512 *AF595A41C5E51B601639087C22DA951425CEE8F2 SSENDAF6
1,666,220,513 *AF5C6A5942444FE0CA6780E80DA2F22BF7464022 SH0RTCE1
1,666,220,514 *AF5BF52EB379C204A0AD1C6616908B4845395EC2 sharon.hinrichsen
1,666,220,515 *AF54FCD91BCD0E272239AA4CB26176AFA94397C3 STEPHEN.SHEHAN
1,666,220,516 *AF54E0760B01CFCAFA140129636EF2DE8EED4DA8 STNRUBNUSNU
1,666,220,517 *AF5159499230AB1EF4300A421FDA4CA91569C9C0 shermanyasso
1,666,220,518 *AF512100D985AC305F1109BE4105FD764B80CE6A sherwoodjochumsen
1,666,220,519 *AF5DCF903B214B8FA28BFFD0F8383E8491F1E7E2 stramen
1,666,220,520 *AF5895E9F0FFFC74E60FB1534C2B1B67418E12E6 shonhurtz
1,666,220,521 *AF527077F861DCCBCD554107CCEE80DA5A5FE263 subc14ssifi3s
1,666,220,522 *AF58653BBB04D7ADBF4B5BC3F51275D3D117B320 sidneydolven
1,666,220,523 *AF533CF493B08A67B334758BF980701B179AB2CA SIGNAC2
1,666,220,524 *AF545D67A11ECA8CA3BCB529C60721468D3D1B66 SUNALEXANDE3
1,666,220,525 *AF5D13665B671FE3BB6697628251F363D0D6ACA6 [email protected]
1,666,220,526 *AF52185D251CD0877F5CFDE7D50C086567FD083B SILVANA-SOUZA
1,666,220,527 *AF52CB0D7B52CF0A9E5E41794701C8F659B9A220 SINGTON1
1,666,220,528 *AF5E3CA55630410207DE9BCA8172E9A0674A47F2 supersaverpreakness
1,666,220,529 *AF547D85BD64BA281C2956B5FE800A80156A6D5D SKYSCRAPERSKAY1SKREY2PER0
1,666,220,530 *AF57CF76472F540ED8BD742EC2E7582BF1A991CA SLICKIT45
1,666,220,531 *AF5371C09E20260FFB1B13E64338BD1354C815E6 SMARTYPANTS6
1,666,220,532 *AF5D7830C4598A6D9E2FD61C31F3911DEE04E9E4 [email protected]
1,666,220,533 *AF5247E17497E2CECD4A58B6DCA143ADD483B728 SMOORKRO3
1,666,220,534 *AF5A68BC26BCC5360EDA7697A5E571721612DB3E T7VM
1,666,220,535 *AF5538D8406CA8C7D9D0EC0EC021562A68B395E0 TAMARA FRAZIER
1,666,220,536 *AF58A8545416BA91A2EA442E6BAADED0F501E298 tamar-maisuradze
1,666,220,537 *AF5212937ED511F5BD9953C2C10ACB427FD1838B TAMEMEE
1,666,220,538 *AF53E660CBC8EF31DB410EF2B6DE1CD90923611F TAMMY DEVOS
1,666,220,539 *AF52220100C4C30B2C6E5976BBF4EF5C9D49FF54 [email protected]
1,666,220,540 *AF5E978C53A424EC3EFABCEB93BEA7C422EE68B2 Tapahtumahorisontti:Seireeni
1,666,220,541 *AF5BA56B5BF2F84B8F51546560A84E801BC0E41D [email protected]
1,666,220,542 *AF55C9825AB3DBB6031705486ACE5C73BE790099 SPARACCA
1,666,220,543 *AF5ECA0CE0F2A967D7AC50598FC7E052C0A6B891 splat.*.d######P
1,666,220,544 *AF5C98C089395FB1906552C764B81C90A4463B4A TERRELLAUSMAN
1,666,220,545 *AF58E06F75B1E7C9EB8FF51EF6B6749CE24881CB TERRY.PIETRAS
1,666,220,546 *AF5557DC5098E92358925741DFDEC188B65C0250 TERRYVANALLER
1,666,220,547 *AF5A2D1555956568A52C3A0628C78F5F7C55ED9C spung77
1,666,220,548 *AF5B3CE26BAD71B841B4307B41419BE3A5CE7C46 stacy315
1,666,220,549 *AF59821C7CE659393F3FF1230F926C48B2392A52 thehaunted(b)
1,666,220,550 *AF58C564E73C2D14DD365D68AD7A7F76406C6574 there'saboatdat'sleavin'
1,666,220,551 *AF5DDDB9BB62574F34C37D54583E7D10C40D7D05 This.Rocks!.:30
1,666,220,552 *AF50422AF81356497D8324135803D566E220FA39 STRINGQUARTETNO.1,OP.12:IV.MOLTOALLEGROEVIVACE
1,666,220,553 *AF5330D8BA80D61B6E9C589F7CCEA571C2DDBDB8 TIGREBAILEY7
1,666,220,554 *AF5F099E519EC857CF9E89B0AB5EE64D035F3D69 TILLOSLERTBSW
1,666,220,555 *AF53C909FBE2D0D0AFBEBE00E83F45FD6C5FA1C6 TIMBERBACKA
1,666,220,556 *AF50405A8607C021FEB369818E3C7BA0804F7905 TIREFOAMFOAMS
1,666,220,557 *AF58FAA40B825C881E1E0D568E77AE1DAC26534E suk123
1,666,220,558 *AF5364C44BA93B3BE535B646469AB451012B1706 SUPERPROGRAMMRER
1,666,220,559 *AF51B1ECF04D38B46069F502C3E57444D38ADF5F suspicis0
1,666,220,560 *AF5937631E4924D849EE21AAE7D4D083CD8BEC92 TOMACHICH
1,666,220,561 *AF568EC4C2B6D988E2A48F76139C69584450E342 tonyhammer
1,666,220,562 *AF5DE7DB22FA488249D3F3F50380AF799124241D TORY.FERRUCCI
1,666,220,563 *AF54976979A9FCA3068C6E092D22D44138B916D4 [email protected]
1,666,220,564 *AF5FCC45CEE473CA258968E718CFBD558E0370B3 TRACEYOLIGER
1,666,220,565 *AF5DDDC07E09EAB18E40C009953AAB7CFB12EA1C TRACING_THREAD'TR/EI/S/I//N/_/T/R/E/D
1,666,220,566 *AF52096F45E9E743E8058D6C01891748633B8EC2 [email protected]
1,666,220,567 *AF54E7ED97C5A5571FFCF6A15990920F09AE4FD4 TADETKALLT
1,666,220,568 *AF5567D863544F70B4BCD3844086DEDC8D541877 trencito5
1,666,220,569 *AF52DEC0BF2E5DD45CE26CB6E17B9B02638C2DC8 TRESJUR-COMPTON-MC
1,666,220,570 *AF5654436733FC7EDDFC6E6D48E0BF18A4A4E9D5 tallbocomwww
1,666,220,571 *AF5D96624E47F18CEF84632878791CE06A0E5C36 TANGO1913
1,666,220,572 *AF5DEEAE580C6B2A6B9E04CA68A02837924FD1FD tristan.gervais
1,666,220,573 *AF5432D88210805E8966C1A84F166FFF4C62A0FA taylorcarnie
1,666,220,574 *AF51C1A1A5FE5769E4A6722C9CF0CB7C9B270241 [email protected]
1,666,220,575 *AF59976B85C4F83089C0DDCE2E7E0A68C78BCCE5 tsangchikwong
1,666,220,576 *AF50C70297F5F95B86F3E199EC28778EB232041D TSEDNELBREBU
1,666,220,577 *AF571C0302EA840FEC5F7EB01C65D15D8D29374E TSICISYHPOOZ7
1,666,220,578 *AF5680ADFF79F356F6699BA8D8E00704D113BDB7 TEACHERNELLIES
1,666,220,579 *AF5C1B772C026F8F5963F04F86670D54EC9DC287 [email protected]
1,666,220,580 *AF5C4ABE40E8CC0B52A2F4A20FDF6C421458D691 TURFISTE
1,666,220,581 *AF55E02FABD635EBAEC3BF0162CA65B7B51617A3 TYESHABAYONA
1,666,220,582 *AF5A458A00C33F9DB77D7ED56C2CC403C45C66A0 texthexing
1,666,220,583 *AF55035285B9160F65611C13D2BDE0CA382F85EE TYSONCOTA
1,666,220,584 *AF58DD4EA584D9B7A1E3261A2F34C3CE12EFA910 TYSONRYBARCZYK
1,666,220,585 *AF5F8CA3E228E6721109B8BF8A76E24DFE90254C thatvoodoo31
1,666,220,586 *AF50D85E7F84F027E2694ECD9ED64AFC2B80AE28 THIMON
1,666,220,587 *AF52E98156ED4DE61F2993CD519BB6A903F299BC [email protected]
1,666,220,588 *AF5EDEE06165832ABE523C986A24C48336A5BFA4 unuiist9
1,666,220,589 *AF55CB341AE836A389CA2BA28D4DDBBF0F932D00 URASED
1,666,220,590 *AF534B9EFA11804AFDC45DAA28C19A3C2B18A6C8 urteilsverkündung
1,666,220,591 *AF57BCEE64ADAA0C2E47ADE3A6BF6BAE4408D4E9 USERAMARSATTAR
1,666,220,592 *AF5ABF0D079CC6EFB4D0C46293E43BFCD7784359 userions.
1,666,220,593 *AF569D195615D79B6F4A7E664CB3ADA47B0DAD90 [email protected]
1,666,220,594 *AF5FA6D5096EB844C5722092B8B7936800D49D2F ÚTILES”
1,666,220,595 *AF57A29F16D4B33B9E48FA54627DD278D7D408AD tobygillentine
1,666,220,596 *AF5DC6A7B6111150896296A5FE2F334479C8DDAF TODD.RUSSELL
1,666,220,597 *AF519D02480665354F2E2F9484DDBD287FC4EC13 VALENTINEZAMBARANO
1,666,220,598 *AF5EECE3385F189F845C05FA9B46EDB584D262CE TOPLORGGING
1,666,220,599 *AF5DDDE29D0E177C8BF8182F756E52D7FEC6055F TOSHACHNTMVAA
1,666,220,600 *AF5484E89E2EB0A5BF2292EB5CBB4C5C55A7A08F TÓVÉLARNAR
1,666,220,601 *AF50FA986F18FBA8FE4517CFC061F6CF44373F89 VANITHA-PJS
1,666,220,602 *AF58F6980C9AA248BCCB16E9186CF3E947C248E7 VARAJASING
1,666,220,603 *AF55003BD1A707ECE3BBEC78CFD00ACD3FF3937C TRACY TALLANT
1,666,220,604 *AF5E3D8F3F71FE7B98D6F5CC5FF7D330043910A5 TRAININGDOGGY4
1,666,220,605 *AF59F6BEF65134086750D342CC848E50EB8D5D54 VBJELOVUK
1,666,220,606 *AF52B88BA42A973850B9ACAD7CCAFDDA3C1782DF TRANSITION4
1,666,220,607 *AF5D545D1B22C8E9C0F78EA0CAB79DC282A37CD5 TRAVISNORMAN
1,666,220,608 *AF5BEAAD72CA5A223DB1016D8D65D7DE0F6F548E verbreiterungsgebiet
1,666,220,609 *AF515B62A08E26DD07A0DE66AC42705E3F211DEF TREY-STOCKMAN
1,666,220,610 *AF55A62803889B06D176593230EA55A6D2F92F3B VERONIKA-HAUGEN-FUNK
1,666,220,611 *AF55145F3A32AA7FB4E967521E8E571FE99A1BDF trickytraktor(feat.djhenri)(djmaartenremix)
1,666,220,612 *AF5B66C7451C0AF7C71450D9087F36441D7BE313 vettegoober
1,666,220,613 *AF5BB30A717E900D10D52189900E4447B352F568 />VIBRA
1,666,220,614 *AF5BA2ED1AF480B849475AFF98A46A53CDE406EE TRIVIUMTHE
1,666,220,615 *AF527CD3975CE346DA7B55C2595A586F41E9CCF4 VICK NET
1,666,220,616 *AF5F96CFB4F3903A012216D598BDC23C8931D431 VICKYSKY07
1,666,220,617 *AF51B079A5D7975C059FEB69B6C0CF4A0E06280E TROUBLEAMOUR
1,666,220,618 *AF558AA0D339BC0AD78D1DCFBDE5529EB39A6F05 TRUCKRICKY2
1,666,220,619 *AF548E130455C8249505BE8EA506A40BBB788C09 TRUSTGROWTHS
1,666,220,620 *AF5A35E616C740D0FA95283417B164FF665D01AF vierr
1,666,220,621 *AF591DE2518CF90B018EA5639AF5AF5706BF42D9 [email protected]
1,666,220,622 *AF51A4C61FF518FB272E00384EC08C4BDAC1CB87 vilma-labro
1,666,220,623 *AF5D0CFEB4779184BA7BE2DEAE0E21F19CC0BA48 [email protected]
1,666,220,624 *AF5A8F572909D41CE7C99C0F7DA13EFB7800F7C0 TUPAKKIA9
1,666,220,625 *AF5AD8ABB92225DD04B111579BBEBF401A2164AF turbescency.
1,666,220,626 *AF56479B0838EE93C9EF90635A4A29A5AB625858 vinztaguiamalejo
1,666,220,627 *AF5D3F6830454A521A8474D593CFDBBBBF71119C tylersamuelnelson
1,666,220,628 *AF50504F764711A3E1E8127684064D0B7B815A33 VIOLETMORRIS3
1,666,220,629 *AF54A1839C50A5B3416BFDA65A7EEFC303829681 virgel8
1,666,220,630 *AF56628E7061190136B2F74EAFBC716FFDC526BC VIRGIL.SHAM
1,666,220,631 *AF5A182C6F5255018596080103C951741EF36556 TYRONEDESPINO
1,666,220,632 *AF57C5C237233D4CF81E5319DD16CDFF6669DEBE tyronkafel
1,666,220,633 *AF5B71B0AAE486A582F77CE2095BC917C0D55E01 u2kv
1,666,220,634 *AF59C15827CAA467F2308E574BCE04B6DED7725D [email protected]
1,666,220,635 *AF5D812B3FCE10CCC5785669FB16271E2ADF3130 [email protected]@[email protected]
1,666,220,636 *AF50D1F1288613BADD06C6CF75B129E0A196F969 VOINEAADINA
1,666,220,637 *AF5C4B15DF39BA41FEC478A8D0D2AC7B3CDBE5D7 VORZUSPRECHENDERING
1,666,220,638 *AF51D3C44CAD29BC17ACB552CAFF11FC9EAF200F VOYAGERPOOHBEAR0
1,666,220,639 *AF59F04308970354E926745705528658CA14BA8F UNC3L3$TI
1,666,220,640 *AF5A8DF17DDA61D93168E477176B75039718F232 unityofmankonfere
1,666,220,641 *AF54F3BF50D73D47CA508AAC8144DAE882FBB689 wadecotterell
1,666,220,642 *AF573E38125E07B9E382C2FC95F9110B5531B6DD waizgkhikec
1,666,220,643 *AF502764C612BCB499A00970CF84883CA35DD37B UPENDRA-GAJANAN-MOGHE
1,666,220,644 *AF5B5D894AC19B9B25934C20B1A55661C6DEB4DE URCHINTHEMOVIECOMWWW
1,666,220,645 *AF5458E2C5B4E8D54D22677C4E8AD2E0278F889A urien8
1,666,220,646 *AF5455E52FD41702430BFA5C52E02B65CA402A2F [email protected]
1,666,220,647 *AF5073B2617D5CC12728FA8764D7B9E690A4F09B UTOMORDENTLIGASTES6
1,666,220,648 *AF5B7AB842751276AF735AF13592A2FC825685E1 WARRENCUNNINGHAM
1,666,220,649 *AF54E2AF717B6721F796A68DF4DD19288B2567D5 WATCHIN'YOU(FEATDUANEFOLKES)
1,666,220,650 *AF53C0DB80BBF5329D19CB195CDEC2E79D545276 wederinhuring!
1,666,220,651 *AF5EB0BF9F8B0429E52DCC6E793340F9991E4298 valentinpagaduan
1,666,220,652 *AF5BD9124FD44E97419C853E0A2ED93773012A42 [email protected]
1,666,220,653 *AF5F127BA6113ABFB17D2DF00C97AAB475C6D566 [email protected]
1,666,220,654 *AF54C5C710A4F3EA7CAD41A0B0788617F780C991 VAMPIREXFILES1
1,666,220,655 *AF57452C7C791C53DCCDED73301298CABF3B2EFE [email protected]
1,666,220,656 *AF56318B7F0E1312E83B850559C70C2EB1DCD312 WERNER.MCGANN
1,666,220,657 *AF5DC10A1BC1063FEAB186BA8D58338D604CC3AE VARNOE
1,666,220,658 *AF55DDF7822EA256F3F30ECD35F5779830ED950F westtexashighway
1,666,220,659 *AF52A32DB4439C5A9AD0B66430A517E9424E5DC1 WIGHTN3$$
1,666,220,660 *AF5D6E3AFB5588B0E8BD6EA5D3A65D9463B48430 VENISSEROVANO
1,666,220,661 *AF5E8CAB6B1E9A64A4E43EDAB0BAD64555E56D4E WILFREDO.ZALSOS
1,666,220,662 *AF58B2BFB6C78873769E3AEC1D4F264766F2E533 VERSTELDHEIDED
1,666,220,663 *AF5EF5DDB2A836A44A0AB1A90F5B1E7691AD4C29 verwaterd0
1,666,220,664 *AF5ED9812BD7C8B4079294CE250F449A4969724E WILLY-GARTE
1,666,220,665 *AF511019EB51FCB4F810AE4674395D419C39F163 VFASTBSWED
1,666,220,666 *AF519E10F276269098D740C0A54CFC6E685B20D8 [email protected]
1,666,220,667 *AF5C7ABC2AACC1C9A57B2A52562103B674FAF821 VIJÑĀPTIMATRATY
1,666,220,668 *AF51D4274F2D64782C31213ABEDB17FE4D055D03 viki-applegarth
1,666,220,669 *AF57069EE9C0FE67885C2869EB3E7EF543FC24DE woodrowbonanno
1,666,220,670 *AF5ACD968E3DA14C203050CAECE23D31CBA93276 VIOLINSONATANO.2:III.ALLEGRETTOGRAZIOSO(QUASIANDANTE)
1,666,220,671 *AF5E4FB8C5D9D7DC5ECD02C6DA37DBB28A1DBC78 WSXQAZ2369
1,666,220,672 *AF56FDEB64E0566AA2FFEAC77E5C3091BFE60C3C [email protected]
1,666,220,673 *AF5EA49BEF30ADA7587C3055AAE2A540450AF6A2 VIVEKANANDA DAS
1,666,220,674 *AF5B9D687659310CAC72AD6B4A366C4989A18F6D VIVEKSHANKARSRIVASTAVA
1,666,220,675 *AF56C0E65F355F8A6392470D4F79C4963F6369DD VKTSVLTSMMT
1,666,220,676 *AF5E8E96AACDEBFF8830DE8C88636FEC9BD11DD7 WWW.BISTRIB.COM
1,666,220,677 *AF544DCB4FAD918C7E33E1F4AA9B6597F3F95D42 WWW.PRECIOUSACCENTS.COM
1,666,220,678 *AF522D8436B725162E45B9DFBCCC78A3F6AF487A X1653
1,666,220,679 *AF581B208E4830531487B4F2B6E6B5815422875B X:5Z
1,666,220,680 *AF5787F495FCED927EB18D390CD9F6F8EC7D4E88 X7765
1,666,220,681 *AF58F55619C561CE16CC2618117B1B125522610F volcaniclungs,partii
1,666,220,682 *AF57F48548F79AF2E65B3B83D0B15908D8774F28 W?)
1,666,220,683 *AF520208302158A2049EEE2BAD46F8E1BCBC01EF }X{*-*-(==P
1,666,220,684 *AF57C3E2A362562D0752DC81F3A51758DC51195D wafik-rifai
1,666,220,685 *AF5E18AC51E9558AB7155C655D62808B37EEDA66 walas-stik
1,666,220,686 *AF5D3A2AAF34603708A17D4D431C1E217C812E30 [email protected]
1,666,220,687 *AF535A7B8B77C0BFE1CADE4DFD258F431DA8D466 walk/don't.walk.(disc.2)
1,666,220,688 *AF557C70D865CBB955B1E67C444D02B674595D6E WANNA.DRAG?
1,666,220,689 *AF5029012BF3286D79246A73BA06BE9A2980D0DD WARD.GIMAR
1,666,220,690 *AF514945F5377EC1430CE06E881F9FBA0279E05F [email protected]
1,666,220,691 *AF546F7EC0E29587509992359AB136B679B591FC YETRILAILI
1,666,220,692 *AF5AA6D186976860583305ECE0B970A73D9E9F3C [email protected]
1,666,220,693 *AF5BA3A34D4B5D02593B306C02B3907482F9BDA2 [email protected]
1,666,220,694 *AF5ECCB858D83D1205AE5CDB4B1EAC99D8494CBD YODADREAMER7
1,666,220,695 *AF5F4DF852C497E44A82DABEC3AE8CC4E4CB8C2D yolande.nash
1,666,220,696 *AF5903CD07B7D83A6133505B60F47536C2FBDDCD YOUR.ARMS.HAVE.CARRIED
1,666,220,697 *AF56A5B2207758435F579CB0784679646A8D50B4 YRREPEITAK
1,666,220,698 *AF59ECF22A4FEB94F45CFC19C4ADB3D422984CCC Were.Diu.Werlt.Alle.Min
1,666,220,699 *AF5F8B93796064AAEE725796FED15E6C689477A6 YSA%
1,666,220,700 *AF55765EA68854E008749E3C2BF203027A3A258B when jones's ale was new
1,666,220,701 *AF5CE31E0C469CEBA8116548903C7DF6D4F7BD66 WIELLIAM-KURNIADI
1,666,220,702 *AF55ED17DE9746C52E421661294AFA2D6B622DE6 ZAYA1
1,666,220,703 *AF57C66815533027D74D91540CA215F2F576D2FB [email protected]
1,666,220,704 *AF5E82BAD8DDACFBEDF4B36E958F75D5E887BB0D wissenssendung
1,666,220,705 *AF5BDC255F3CEC9287F65E7A5DBED98EBF3C1B6E [email protected]
1,666,220,706 *AF5F5AF08464CE312C8305A7F8C123748E65AE69 [email protected]
1,666,220,707 *AF510CB996573DC94BB7D3E7EF2C4FE40D60BA30 [email protected]$ing
1,666,220,708 *AF50E75B4563110532F8DB1C0A9CC26A64450134 [email protected]
1,666,220,709 *AF5D56E0D0F3E0DFA4BAC15B53781E131C9A95E8 ZRNCBSW4
1,666,220,710 *AF51F2D6ABFB8E237E965D8EFE62CBA5BDFF1DA1 wwwsocalbulldogrescueorg
1,666,220,711 *AF5ECF428F74F75CBB29738C78A063417679CCA5 ZWOERDDREOWZ1
1,666,220,712 *AF51D3DB6622A4100E2EF86BE87462C57658EC69 [email protected]
1,666,220,713 *AF57A8502C234EA3851179BFA39956C282BFFB00 }x{~~~d---b
1,666,220,714 *AF5B03BD3492A3F0B518E7BE20835A91450672FD [email protected]
1,666,220,715 *AF58BED47C19A39537F9F351FDD08B14F3B8E862 [email protected]
1,666,220,716 *AF5C122027BE550B7EA5257A576287501E1A12C3 бессовестные
1,666,220,717 *AF5CC180EF3E07305C0484D5E3EE5EA7016C619D }x{~~q####q
1,666,220,718 *AF541D328CD2E7C8C796F7482D9F4F3EA36FFC90 ГВИНЛЛУГА
1,666,220,719 *AF530A6DDE1C12425F1A65ECB04846E0C7685834 ІАЛЬНИЙ
1,666,220,720 *AF54F5F5307BFC450F7B5ACEA10274FB5B3804C5 yakutçasinda
1,666,220,721 *AF54029598C5D1BDB3BC29F050FF85EEF910F35A лодєйнопольсбкого
1,666,220,722 *AF52AA032416C14F55498B08C06C1A978B562BFE yanny.megawati
1,666,220,723 *AF525E7E289605D02735A96CC5135DB7AF5D62D3 мефодиевским
1,666,220,724 *AF57AF8E74370CE76A19E10E9C7EA3BF2E67F593 YENAREM6
1,666,220,725 *AF590B912445EA05FFA33F951F2269436269D2AF [email protected]
1,666,220,726 *AF516E80BA0282078AB7D3E66EAF98E2BE4E460E ”УНІПЛИТ”
1,666,220,727 *AF521337A0DFF2D000D5BA11CFA13E8E5D6C60FE ШМУЕЛОВИЧ
1,666,220,728 *AF563FC8B7B3A87A260C39E8BBC914D0C98AA5FA YOUNG.GOLDSWORTHY
1,666,220,729 *AF5C20422FFD6DC1AA11A7478C973197072CF166 youngsallach
1,666,220,730 *AF5AE4B67F73A7CC0DF1270D273EBA86C06AA1FB [email protected]
1,666,220,731 *AF5D08E8ABEFBB26AACA4A7B5E929BA2385FFDC8 yssirhcycart
1,666,220,732 *AF52462C685DE7E505D8D63608BDDB095F30797F YVETTEALICEN
1,666,220,733 *AF575474A84FDC54C5909B40D7612980B3A8AB6C yvettemena
1,666,220,734 *AF5151D44A93C2C2DE89F88B7F204D46D51218C9 zackdighton
1,666,220,735 *AF5B12EBC0A65D09C2F28A9F726DC49FF8081F42 ZAMEETHZ
1,666,220,736 *AF5C042AAA4A7A99EE16F8842F7F2C3B4C199355 秀和システム:改訂版nscripterオフィシャルガイド
1,666,220,737 *AF582B5135E554C980769FFC5EBF6A7F39E1CE96 031MORIAH
1,666,220,738 *AF5B94874D81227D3C143CFBDCC853BA6E9935D0 [email protected]
1,666,220,739 *AF5AE1F0DFC443613083D4BDDD51210B9851EFC1 08+3r
1,666,220,740 *AF5754C607F780D893FC5AB6EDDAFAD037810E21 0CBGQ6AEWBTG8
1,666,220,741 *AF53B7A36433F632DD73A001906F0F2DF6B58B9F )0(.~.~.d#####q
1,666,220,742 *AF522BAFB7D62AA38ED43136666D339142442804 1019636 father.:.matte.koski.(.b...finland.)..
1,666,220,743 *AF51444BC5A6B16FE25BD9BA4DECDE778DEBEB77 ZURIANA-FARADHILA
1,666,220,744 *AF5885350D6FB2DFF5DEA3B08D3978632457DB34 παφίτησ
1,666,220,745 *AF50D342B2E48965045BCEE888FBBEAE981F1E7A 1559171 all-we-want-is-to-understand--"
1,666,220,746 *AF5BEB7B2758A21067F64ECCABC939E54935A374 15parrish
1,666,220,747 *AF51145D67C4B612B6D309FDB168DC50213A68AA 19.02.1241
1,666,220,748 *AF56C23765CD4C32C22B75126EC25A5A566318C4 ЗЕНОНІ
1,666,220,749 *AF5E16C1B7896E9238957AE20C39D668A1B13FD3 1.BESCHAEFTIGUNGSERFOLGE
1,666,220,750 *AF527EAA394B8615ACC63F5BD4FF2FFEF4925378 1-BOSCHETTI
1,666,220,751 *AF5BC3487913F31BA92C194F577ECD63950D014E 1-BRIEFGESCHAEFT
1,666,220,752 *AF51A1BB7C3A5562948ECC31FB6F26A46B76ED76 КІППЕР
1,666,220,753 *AF5B1CC9027F7B674348C3DB6BEFC851BB571EB3 1 DAPMITTAREIDEN
1,666,220,754 *AF5D5DCF43D6A4092C08667B8F87E5787C9D42BF 1-drehtuer-effekt
1,666,220,755 *AF57D4E2335B64A94698F66BC8F277BB59222258 ПИСКУНІВСЬКИЙ
1,666,220,756 *AF51B671D64D3AAA3A5FB7E0420553F322498AB9 ПОЛСКІМ
1,666,220,757 *AF551E6154E84AF1B2F61FDE0297C78E1D37B159 ПРАСКОВЕЕВСКАЯ
1,666,220,758 *AF58C2254B120C9471F371679C243AAA97D61D72 1harha-oppeja
1,666,220,759 *AF58ED17CCC99D7C86D051843D504298E8D3E288 РОЗБАТОВАНИЙ
1,666,220,760 *AF54DD3E91198E410D3FA66C3DE6A458E600DA3D 1hillegonda
1,666,220,761 *AF5A2E4A3B5BA09AAAFD6A580CF164EBF61FB47D 1literaturbad
1,666,220,762 *AF5612518A9A1B8FF3D3473DC74A3B671CEFBDC1 1-melusuoja
1,666,220,763 *AF5331843A0A29F624C45DB34BCED841A4E7A6E3 1MONITOIMIKOUKKU
1,666,220,764 *AF5BB3CB56EAFE06F990AA1E451C605EA16D1A7E 1.nalCacI'da
1,666,220,765 *AF5209E593B14924F7E5EAFC71359CBEB27C47DD 加藤英美里)「it
1,666,220,766 *AF5571C24C9596AC5F0E5B96DF01821587292BB6 1REABETH
1,666,220,767 *AF5F4D2CA131DFA16E1962D2C98200CD58DC51AA 1-revisibilitaet
1,666,220,768 *AF52AAE1CAAD339395164CA28BC171023230FD0B 1SAMTYCKE
1,666,220,769 *AF5C3A9ACEF81C69DD94A627BBE402A1A81C0EB9 1.sopupelaamista
1,666,220,770 *AF5BD495445B3BF87C24CD2DB1846434A25F197F 1.sp-beitritt
1,666,220,771 *AF531F15F1FE40ADFF6818881E8E0B91F35869FA 1SUPREMATISM
1,666,220,772 *AF5579C9962E1B033810E5BD92F1E76D95F6CEEF 1-veteraanitietoja
1,666,220,773 *AF5EC377F6ABCE8E2812E90C50C3E3FE752C39B7 1 YKSIL
1,666,220,774 *AF5D49249D5196AFE92134339BB2E5DF9478A7A1 22APRIL1482
1,666,220,775 *AF58890FE84112A0D14EDD487FEE18EFDC44E65F 25.flute
1,666,220,776 *AF5DC52B96246E82D53DE3636E5B259E7E364EF1 26478 Ilk.ders.verildi..
1,666,220,777 *AF5E5220E72788B22402E9B721DA42DF94BDAE50 28567 es war einmal der polo fun
1,666,220,778 *AF59318D18DE3BA5A2D4F087E724EFED74E4B91E 2-ABSCHIEDSKAFFEETRINKEN
1,666,220,779 *AF586878A7030B2402971DEC2DEC40A5D116FA35 2ASNOBSAS
1,666,220,780 *AF5BD62A531DE78D2EB1157C79BA80134D02BD84 2CZJLWESMK
1,666,220,781 *AF5E4B302A3B26576E34A19A31D7C733617362D1 2D0BEBCF7900E9C18EC9EDFE3A7D9BC7-SAMYTA
1,666,220,782 *AF5849A80AA4CCC483CDB86A8DE5D40C4FF60604 2ELDORADOOTJE
1,666,220,783 *AF5780C00D7ADD0630B7689B67CC0B1992A14F5E 2-FINANZREFERENT
1,666,220,784 *AF51A9752D6F1DEE10C7B1C10FBB759CA3347D6D 2MANIVANH
1,666,220,785 *AF547E6F0B0A8EEBBBF8A21A7DEF19A43B1F6123 2.radlagerschadens
1,666,220,786 *AF5334E220B01A9D0F8411194CB3DF2C05389B70 2rapley1
1,666,220,787 *AF5C06B8F7CD46D9CB6668008D6C4FF3E40E9006 318MAKHI
1,666,220,788 *AF5139D8FFD0790AA70174DCC84E95F4A6DDE55C 32U9HRB
1,666,220,789 *AF505FB456E439C626A80A334D7E8C3B6E67721E 345KYAN
1,666,220,790 *AF547EB6F413B9EFED07DF6FF72779246840039A 354013722x
1,666,220,791 *AF532B4946AB31B70192772BC45D943080027705 3----B ~0 ~O3B<-
1,666,220,792 *AF5CF2C5FF8567FE9FC356105195D60D430828FD 3b<-o~-o~-<####b
1,666,220,793 *AF5B8044D1076913FA1416A058E311299A8E30EB 3DAVIDHOYT
1,666,220,794 *AF588EFFE41DE629C574C866903D8557C4927698 3EKOOKTEN
1,666,220,795 *AF54F9D610AD096DB2B3400BB410D1D2D54EFE46 3NERENIF
1,666,220,796 *AF589BCC818A07F6A104364779989BF88E2D1517 [email protected]~o ~o (o_-)
1,666,220,797 *AF5FE4ACC3DA4C24B5A0585F06A92CD06A5066F2 3====>~O~O.SPLAT
1,666,220,798 *AF5F3E6BFB8EB1CD6C82D77FEF3951D156DD6955 450530 WARUM DAS HIER ?
1,666,220,799 *AF5760641587680FB8264D5194A88FC1F0B0BC7C 49-polizeioffiziere
1,666,220,800 *AF59BC4782C226D663C8F378ADB49FEF817A13B5 4ATENTAN
1,666,220,801 *AF5EDE0A03153DC5E7FA7D7638A71D561D0C3791 4.dudajevista
1,666,220,802 *AF5437F9EC7BBF044B80E06AEDCF0B4CFE2EC52C 4ENERSHARE
1,666,220,803 *AF58EF3FA6D3604FC2FEAA24E8CBF69DD24629BD 4FORMALIZM
1,666,220,804 *AF5CA511BB4E1FE4AC97932F6131F905885BF305 4henkitorven
1,666,220,805 *AF5F3B6375352BA9858EEE5C86510B1A9009E713 4IHMISSUHDEDRAAMA
1,666,220,806 *AF59353EDB09B12F7823B3C8BC325A0E83063E29 4RETICULATESES
1,666,220,807 *AF5A27981720CF7C2311DC773D31558EC788727D (>_0)`.<#####3
1,666,220,808 *AF5C340FEF5ABD192B6B94253FC7C9CE6CB1B6AC 03-22-1364
1,666,220,809 *AF5B21F6F759E5099531CF25CB042BB9F0AB1BC9 08LT3R4T0RS
1,666,220,810 *AF549E5E3EC06934614F5A607F65A49250F05699 (0_<) ~ ~ ~ D8
1,666,220,811 *AF5BAD730AF28F9C18E69B58529BBDCA675B427A (0_<) ~ ` @---P
1,666,220,812 *AF5D543F2975299830E355B3FE7507EE8677AB3F '5?a
1,666,220,813 *AF56E76EA4189C7A7D17B4112008409C3BEB54C8 5BEARWATER
1,666,220,814 *AF5C3341BA617EAA9C0DC9EE28BA3F6D21877DF5 5BSWGARLANDBSW
1,666,220,815 *AF5A4A8FEE671EA8853C22DDE24B2AFF31279050 11june1052
1,666,220,816 *AF54293BF2789D2CB3EB97E55AAEDC7AE43F6C67 5FERIDOUNBSW
1,666,220,817 *AF5C2B3F79BC417038F06DFD88438BB83EFEDF33 13270twentysecondsiderd
1,666,220,818 *AF51BD890FBA37A0932231FED3FEA032CC1F0ADC 13cthn
1,666,220,819 *AF5ECB0BF510D8755BC3907B3FE5960DA3FB1E48 5JEFFREYPORTER
1,666,220,820 *AF5782C2F99E4E6F051A5F323DAD366CF2364FD2 5-jyllands-posten
1,666,220,821 *AF573D91CDDC3F9BD94E7A7564BFB0E0C3CC946E 152509 galip.mUhendislik.elektrik.san...tic..
1,666,220,822 *AF5D26DA845D6D800B38D2F3342EBFB737C92288 1626649 TIIVIS RAKENNE PUOLESTAAN EST
1,666,220,823 *AF52BD4E4BA196CD88999B8C4719F85468AC2A23 1650243 koulutus on yleissivist
1,666,220,824 *AF563722545241DA153BE327ABA8DEB249055ADA 5NOITAZIROMALG
1,666,220,825 *AF521215A120D3D4D700370ACFDF86C4D5EAA9C5 5OUTEARNESTEARNEST
1,666,220,826 *AF509F5CAD13A4BB4CAEF15606FEEE07FA11EDF9 5QWERTBARRY
1,666,220,827 *AF5504E707CF26C36F2D16182EFFA1A68F1BD982 18OCT1240
1,666,220,828 *AF5B148495B885C6C3D10AD3EA64E863CC47D998 5SNAKEDOOM
1,666,220,829 *AF5D8EA2FEB8B46FDCB63A1BB81A2CB50D60DEA8 5SNAPDRAGONED
1,666,220,830 *AF5492F4300AEB3D202490DE435558977D3C80B9 5THCERSECORP
1,666,220,831 *AF5DBF907339BAF11E9B314FC7BEB253EC23302A 5UNUSEUNUSE
1,666,220,832 *AF5EEA7139EC09E51463A3642C365A120A37F409 1BALAKAT
1,666,220,833 *AF5FEFF4C9ED50A6539921D10EBC174DE5BE2FE9 60STEM
1,666,220,834 *AF5914DB960C630DA04EF922820CAECC387EB0CD 641EASTON
1,666,220,835 *AF532B20E1A6A0B5A0CF3F85E2B2E36CFB99E4F6 1DESIGNPROFESSORIN
1,666,220,836 *AF5B68797DB3582377C6CC597265EA6F2979E282 1dialogserver
1,666,220,837 *AF52C15E1E4EE051A78E625B948B795401B31759 6CUNNINGASASERPENT
1,666,220,838 *AF5DC38286B02ACC62A152CFAB5B3A187692CB4E 1.ERIKOISILMI
1,666,220,839 *AF5C5AC20F0F0A2BF5920CC7C331BA93636CF84D 1erosiolla
1,666,220,840 *AF563133A7E800C8CDF74676CB250C41B3BF0975 6GOELLNERBSW
1,666,220,841 *AF51EA3D7F17A5D53BA8322A0AC646C232F6851E 1 GLUECKSSPIELFIRMA
1,666,220,842 *AF59D514D755527A04E88156ABAE95D05699C2E0 1-HUIPPUYRITYST
1,666,220,843 *AF53BE84B55A579C8363276526E7BF0CB616A3CC 6KATHERINGUEST
1,666,220,844 *AF5D146ABFDDE5BAB2D73F87EE1E74C705594CCC 1-KAPSELOIDA
1,666,220,845 *AF5AB9658F3C027D85A46710DC820F5C7F07ECD5 6NEUPITNOJ
1,666,220,846 *AF5845D7FDF6A873028F0865615E623CF8EC6366 1-KIRJAILIJATOVEREINEEN
1,666,220,847 *AF5C5495233A4DBE8AF250BECC28629D29C6507A 1-korhos-mallissa
1,666,220,848 *AF5F167716BD7763772547A286F07E84BD8C0C3C 1.kurinalaisempaa
1,666,220,849 *AF5FB759BD5BA3EBA461EED031A460368BAD5720 6POPODNEVA
1,666,220,850 *AF581C7215B3CDF51C29C05283D750B4206DD22F 6q(aaa
1,666,220,851 *AF56D95ACEF508E5AC0955A94800A22DCEFC2B89 6SMANTLER
1,666,220,852 *AF5ADC6921870CDA865CC166EA581C53A860E192 1mit-chef
1,666,220,853 *AF5369FBB6B03B382D61CF14058F5833C4E21868 1 MUOTOILUPOLIITTISENA
1,666,220,854 *AF5082837E9E82DFE3B26C426E68C362FFBCE144 1OCOES
1,666,220,855 *AF56DEBE3871A34F872E3A2F05A533200A9E8E0A 6XNRTFGQP
1,666,220,856 *AF599B41ED7EDEBE74380082130005073C376D8F 709ADEN
1,666,220,857 *AF5F07B14CC33E51789B6BC5058D2A5E09396C56 1phare-ohjelman
1,666,220,858 *AF52BBD49C82AA0F2D2F5B55D713719924D6C35C 1PREJAZZ
1,666,220,859 *AF54C75216B14C9B73FE35E488E1EEE825E18C13 773814 MOST-WERE-IN-DETROIT-.
1,666,220,860 *AF59FCF238AEB93D20FC8B64D46E48C0BBA3487C 1 ROSTBEULEN-ANSIEDLUNGEN
1,666,220,861 *AF5820205888881A9EA24DFB6AC54E6312663D60 7ALLISONFISHER
1,666,220,862 *AF5FBB95539AF4DC7857337B53647E57CF649E1A 1scandian
1,666,220,863 *AF5958E6ACC200383E8F69C55465AA70C430C8FD 7CAROLEHONDA
1,666,220,864 *AF55DFC7B526DDBB7EEC5EAFE17862E9FC3C82EF 7CHOIRISTS
1,666,220,865 *AF5D957BB63011364FD127C25B66BB100BC62779 7DIGGINSS
1,666,220,866 *AF5637545EB9E59C8D8FF22B0ECEF46DB5A10540 1-tiimikortti
1,666,220,867 *AF51B9B6A60FD5142AE00B9B61AB47F941D6D99F 1vintze
1,666,220,868 *AF5C9838F97392C7EE3263F09B5B51451D5875F5 1 YKSIL
1,666,220,869 *AF55AFD42EF7620167B3421C9FA525DD5D325F31 22april82
1,666,220,870 *AF5416C59F78C4483477B8631AD0A2D1F7C3BDCF 7TREINLEKTUUR
1,666,220,871 *AF5856E4EDE6BDFFB1AA0FE3990EBD42D0EEA024 7WENDY9
1,666,220,872 *AF5686384D6629E55E004316F4F50FEA53D7143B 2610378 sairastataisairaudestatoipuvaalastaeisaal
1,666,220,873 *AF56C8C197E9F190D6186AEBB95E784C64E5DA25 7YTIRUCESTOUQ
1,666,220,874 *AF5C644603B902E290E2DA1D27F820638FF5BE6B 2821451 it is backtothenursery as an aesthetic creed
1,666,220,875 *AF5BDB09A6B0524B91A6550446EB68B3D967B186 2889562 SHE WAS QUOTED IN THE JOPLIN GLOBE TODAY
1,666,220,876 *AF5DD2A343BCE69AB3C971BD09A2503048C9DC77 2959566 ONGELMIA-SYNTYY-PIENI
1,666,220,877 *AF50A7135F33CFA4FEE4667A361972EF788E18C7 29-denilerek
1,666,220,878 *AF5929DDF39686A9F127B70AC48C3D63A5123520 2AARPREEW
1,666,220,879 *AF5B186814307A3C80FE11C0C0A81635A8027D35 8BAADAKBSW
1,666,220,880 *AF5A35185CC130AB6DB03A35FDCD84CFB8E6DBEB 2blootgaf
1,666,220,881 *AF5A058CFA8B485260B2E1456AE8236C028BEEAE 2FSTRFFNG
1,666,220,882 *AF5F10562E4E7EF73F7B453919D69CBACFDDD911 8CERULEO
1,666,220,883 *AF53B927658464F65365E32B5945B9680417484F 8CURTISPORTER
1,666,220,884 *AF55A40BFF7AEBCDC87B52DA0CBAC7EA228C4D85 8-d-~o-~osplat!
1,666,220,885 *AF5754672C9C780E63A8CF2C81BFC01C6649259B 2-MUINAISTIETEELLISELLE
1,666,220,886 *AF55BA917B5EBC6002A1E00F65A5004602F3AC33 2mydude0
1,666,220,887 *AF58441AB45C3E52016090C0F5C1030190455B2A 8ILUVCONCEPT1
1,666,220,888 *AF517B0C2583E969D283B7D116E22ADFAF022EFA 8JAWFISHESES
1,666,220,889 *AF5D374C50DB43E564CF158968FC474EB2543E17 2WEIHNACHTSUEBERRASCHUNGEN
1,666,220,890 *AF5755879385D5E31580ABE7C285C2F7EED480EA 385crowningjewelofcreation
1,666,220,891 *AF5FC5EA514D08BA765A1213248ECE071C8471AC 8RHAMPHORHYNCHUS
1,666,220,892 *AF50D1AE4FCA848F6D59AD855D1BC6C6FBB78A9C 8RUUMIINAVAUSPYTKIRJA
1,666,220,893 *AF515F2DA65208FB8022BD1ADC543A5549E827B6 3FRINGONE
1,666,220,894 *AF5603AA2154EE9FD3F39AE6521EB908DB687522 8SOSPINGENDO
1,666,220,895 *AF5FB584CDA99DA39B0A959F6FE2B3E0A50F68E1 8)~~~splat!
1,666,220,896 *AF511072560FE074E73073ABA5FD1C7D6E96BD9B 8TNEREFFU
1,666,220,897 *AF58107752DB14D46E4CB3779739CAB287228A16 8VERBLASEND
1,666,220,898 *AF59CF47730E2D4216F1C11BDAF53C143FF6FB05 [email protected]**)o(
1,666,220,899 *AF51AD005F09461920DFF36D3194B048D7473C8E 3######p~0.(-_0)
1,666,220,900 *AF54A7C23D0900B7B408504374FAD926BF6FC7DB 3P~0.~o.(x)
1,666,220,901 *AF5880AE517329C1FAED58D6547A935BF52612E9 3.RICHTIGTE
1,666,220,902 *AF561A77AB7A354413E1C5150ECE03CC02CDB84C 9ATHALES
1,666,220,903 *AF5CEE0136A0A34C6749AA64A7FF4A58DD86211A 9bookmobile
1,666,220,904 *AF5F91342835E721522EF831B59036FA18D29863 9BSWFLSTYLEBSW
1,666,220,905 *AF5F9E54DEEB9EE538751CADFD7411D65FA39550 9BSWMELATOUR
1,666,220,906 *AF566E6B0C89356E8356A3E169D1576B44A118F5 9CASPERBROOKE
1,666,220,907 *AF587B2C350185D5C7ED74D601DCE380AA27667C 9COOLSTRAT
1,666,220,908 *AF5B3C51B39E387903F279238065D28B771B5CF8 9danders
1,666,220,909 *AF5205CDB11C13AEDE4683BFE9E06D530294FDD4 9DEXIMRET
1,666,220,910 *AF59A651D2374721DF07A2CC670C2A96F1D3FB97 9DIGNITATIBUSQUE
1,666,220,911 *AF5F38711CB800AE90A6F27FCA87BEAF1F59C518 49CD7E08
1,666,220,912 *AF5504C28C68355F547254222253A018A122520E 9LEERTOUW
1,666,220,913 *AF529746B487F549ED9CAF251A08E9E3FFFF4498 4NE57HE5!OLOG!575
1,666,220,914 *AF58962EB80DC0DDF61FC09DF532013ECAC55A07 4ORTSBEZIRKS
1,666,220,915 *AF5C82A8E9BC9F3DF1AA040C04E92EF9E0E8B8CC 9RONCET
1,666,220,916 *AF53C6DA5A206F7E46801B51DA688BDB5999C124 4RECENTCURRENT
1,666,220,917 *AF54433DD8D4CF00E70739368870882D8B974F84 9SHELBYDOCTOR
1,666,220,918 *AF52C0A6D54626596874283EFC2D2E413BD0737A 9TIGERCOSMOS
1,666,220,919 *AF5302A47CB8CE899F26145F4CC7010E9A99ABB3 4STALLANGL
1,666,220,920 *AF523B53D0B890316CBAB079793721547B0F1536 4SVELTMISEN
1,666,220,921 *AF545F071929A0A1C710B1349970ECF7413A3867 4T0RD04R5314
1,666,220,922 *AF56664B9E9C05FD2421B1D4F309485C27E7C570 a0409
1,666,220,923 *AF50D71A4EF397D28FF8149217A9EEC7B9984824 5BIRDCRAFT
1,666,220,924 *AF50FFDD9205D11857CC8D4AD99888A88670FF20 a7l?
1,666,220,925 *AF58880D4C413AABC9F53A227D75F6CB873159AB 5iamsnake
1,666,220,926 *AF5281319E87B5136112E234C4E830085E33B1E2 5OMFATTNINGIVE
1,666,220,927 *AF543C8AB148C6AE9FAEBA29E3455ABAE1228988 AAC=^
1,666,220,928 *AF5009FC790BDBFE3735EDD03F631083F5DC87E3 5PILAANTUMATON
1,666,220,929 *AF55351F3E6FCB45575D2CD5A4244DD18C25F62E 5REBENEDICTIONS
1,666,220,930 *AF5F57D52FA571DC72CEE23B4E79E5D941D1F8A0 aadqax
1,666,220,931 *AF556017765537244EF3B5E30847840E90B6CD81 aa?f
1,666,220,932 *AF5CFCC5A9AB9416040C3B7041DE37950192CD13 687784 AMAJORGAFFECOULDWIPEOUTDUKAKIS'LEAD
1,666,220,933 *AF53F950E33F28471A28170802373F661426C5A6 693DORIAN
1,666,220,934 *AF578BF794D32C526233AAA36C94E24DBBA2301D ABCDEBEAVER
1,666,220,935 *AF54BF4D514BA61E4239964DC68B2B5876406D0A ABDOBONDN
1,666,220,936 *AF58EE0E0CD126CF12BF1173700D82A761577F8C 6CLANCYA
1,666,220,937 *AF50CC2D13A3BEAA655E06F5870372107D32146C ABHIRAGA
1,666,220,938 *AF57012828C002574600E06B86EC52EF4DCEA5FE 6CRYSTALSMILEY
1,666,220,939 *AF5501F0DD4EFD1FA532081BE7FFD5BA5ABEAD1B 6ETALLETIPAC
1,666,220,940 *AF520E32E8C4E08CE912011D8DFB87E74F092708 [email protected]
1,666,220,941 *AF5240ABD9DB2A71B122F7CFFC38B95C08C2E71F abortion
1,666,220,942 *AF50AF2E6FD6022FA0F072A17D2E73FBD30DDD6D 6IVERSONBSW
1,666,220,943 *AF527C8429FF256949B396893B337C9DD637B9D6 6LEHDISTOEARVIOINNEIS
1,666,220,944 *AF59B2756CC6342BF5DBB26D4B85B484922218CB ACAUDELESCENT.
1,666,220,945 *AF5D341F15110CBFB5246F2216BC4AED0364C274 6TTSEARCHPORTNUMTT
1,666,220,946 *AF55F0A6F66D60D858B8B4E42AFADAD1ACE47C9F ADE#=
1,666,220,947 *AF532CF045EB9BC2A30D24D537634F058722DDEC ADOPTIONADVOCATESORGWWW
1,666,220,948 *AF50989CE4BC4A4022C78E416C92821A5DFAA486 795JASLENE
1,666,220,949 *AF52A020B176DB6985123EC84A14A5A3C2951747 AE6QK
1,666,220,950 *AF59985DBBB1578CD890530B9D89224848879EAE AEQK"
1,666,220,951 *AF56B6257FC32A18BCB323D35F991DFF3A754EB0 7GEMITUS
1,666,220,952 *AF56F9F0B2BA7878FBE1B28DA54FD55D4A3A2229 AF%YF
1,666,220,953 *AF5604FF824359F0F17475D2D1DF0991C9128F6D AGFn
1,666,220,954 *AF5FE6AEA8CB1BAC377ACE37FEE4C16D6D7BC7E8 AJ1YH
1,666,220,955 *AF5D2B7C721A3240C569901AF345FA4E7BE03DAB aklf;
1,666,220,956 *AF58F6EA4C89CB53AA2355E069E5D88193538B7D 8BRMTRCLLY
1,666,220,957 *AF5DC25D2983572C1B7ED30F0E6BBBDA0BF681A2 8BSWTALENTBANKBSW
1,666,220,958 *AF52B60407EECC7CDCEC8396784605AAB98ECAAC 8CA40BCAB8F2D42ACBD7F8C2F2936EE4-116A4D86
1,666,220,959 *AF53150839653D0411530BCEDC5CDB74245DC0E5 8#####d~0splat!!
1,666,220,960 *AF5A69C0F26D0D5D3059B18751B7E3EA625B84CA 8DOROGOVATO
1,666,220,961 *AF571579D8A144205929BC9E66D0A8B2E2A57F7A ALDEN.HOLLIDAY
1,666,220,962 *AF58192A4B899036BFFF13AE77B3F54DB13C5A7C 8GENIUSFAMILIAE
1,666,220,963 *AF5919CF8773DDDCA9ED835905627B84C387FB3A 8GGCLQWFUMCNO
1,666,220,964 *AF548CD51F049947E2536A126CE175F29C79B483 ALEX.D.B
1,666,220,965 *AF592EE9D769D366C78EA49AA3E9CFD2FEC9D938 ali.liao
1,666,220,966 *AF5B82EA129E5A0ADCD05BF21454A3FADA08186B }8{o~o~d#####8
1,666,220,967 *AF50458C7ABC68DC510755FD7C1414BDA4C6DED3 ALLY1988
1,666,220,968 *AF5027F480FC796B0FD2E04E3F9770437F6BFBA0 8SEATTLEPASSWD
1,666,220,969 *AF52AA82BA418AFC74694B981AF9AF915FBC0F0C ALPHONSO.ALLEX
1,666,220,970 *AF5B2825B4F24D6956B1685432DE67F5D5C008CE 8)~~~splat!
1,666,220,971 *AF5849CCC87444B5EA6EE8B08C546A01BA615852 9328813S
1,666,220,972 *AF5F985220B936B999E1EF20183D907EFAFF570E 9BOQUIRRASGADONESS
1,666,220,973 *AF51BF29362C3B6F63F7A6423AECE95DE5DA5DF7 9BSWCLOHERTY
1,666,220,974 *AF55568CC24224EFBE7839A7387166DE093C1927 ANADUTHODIYIL
1,666,220,975 *AF530158FC3E7762F57AC917949F607A977FE13D ANDANTE-IN-A-MINOR,-HWV412
1,666,220,976 *AF5AFA4040929F92E60740D4BE6ECA027B0911BB AN-DIE-LEIER,-D-737
1,666,220,977 *AF5D22AF0EAE2E06F31738396E51B7995E71EE98 9HCRYPTOGRAPHY
1,666,220,978 *AF58E4AB2CE8C120694EF2A3CF55491AB1824C4C 9HYYTYMI
1,666,220,979 *AF5F3411FD22A8535584A178D5BEEF83F7E79E23 androllercoaster''roller
1,666,220,980 *AF53D6BCED3A42500C9107DBE2B0E1F3A2061CF2 9JODELRS
1,666,220,981 *AF51A9E269CC3DC84911676B02DEEAD20EEA4687 ankireddipally
1,666,220,982 *AF5DADF376626940A04BB716392DED2BEB9502A3 an(s
1,666,220,983 *AF560B264615B05AFCBC512F081ED2C5B883EBB2 9SUZANNESIMON
1,666,220,984 *AF594430006050AE62B6C23366F805F775B60AFC ANTONY.VANZANT
1,666,220,985 *AF59DCF2A7C8D8E998888282034DE151A728E63A 9UPBLOWWOLBPU
1,666,220,986 *AF50C57D6C5E46B2FE7506C310033330173DCE17 ao=2#
1,666,220,987 *AF5E973EF0DB89B206961C24C580B9D44940392B AOLASM
1,666,220,988 *AF540AFC007D99C7469886A9FB1A51DA1A18D953 ap!_
1,666,220,989 *AF5D88BEB2D9CE2CAA5D6B373075DE4F9B0CFA3A ap"dl
1,666,220,990 *AF5CA8E090C6E320DDB15D7330BA219FB429A6E8 arctike5
1,666,220,991 *AF543816E883B254C8129EA480B1562ECCC9F43F a6cs9
1,666,220,992 *AF59CAB97A7ABA3EB1BEB31C0AC581F915AFBC12 armandoschutze
1,666,220,993 *AF5CAE3C734CBA76B030018DCE25F329E6FB9395 A8RCJ
1,666,220,994 *AF53F35010E843FE021513B284CF17928568840C AR%RE
1,666,220,995 *AF586B96D3739F6AE80488EEF1D897B7110733AA AAA{F~
1,666,220,996 *AF5E5B6484EE371F40A543624D618E9A2FC3F6C1 aaatdc
1,666,220,997 *AF5F91483C9DE26976D939ED315BA94579523B02 ASHLEEDUPRE
1,666,220,998 *AF5761AB546C78199FBE6021B3738373D340E36C [email protected],
1,666,220,999 *AF527801633F164BAA8577AEE47A542BB2BC87B0 [email protected]
1,666,221,000 *AF5C28FB691CFB93C425E94B8FD5DD5A69478846 ASTUCCIO
1,666,221,001 *AF511DE69EFE5AA21F1ACDA13F218D6F4DF561BE AUDREY.ANN.BENNETT
1,666,221,002 *AF5EEE442FA166924D5FED6E7027A0BA09634741 AURELIO.HENRIGUEZ
1,666,221,003 *AF59C3B900C64BB4FF92527E0F57E762A1FEA3E3 ABESTIAL6
1,666,221,004 *AF50883DD391DE93087DF1C1E9652825059F2F83 ABN;3
1,666,221,005 *AF5301F1182DE052C4F8EE9F52E3EA0983BC1AE5 ab)_v
1,666,221,006 *AF50E8EB78087E3B897365412A49EC42DE3AFFC9 ac5!e
1,666,221,007 *AF510A764B9D24CAF2CEEC127AE10963903175C1 ace1805
1,666,221,008 *AF5EE1991D2A52D6B9DD65E44B98151B71D8B9D1 ADALBERTONISHINA
1,666,221,009 *AF5BC65D6DC1AB85214E0CA3116C01F3BF393477 ADALBERTOOKANE
1,666,221,010 *AF513301B9ECCBC98C205B0A5DA8D7107064793F ADAMOLEJARSKI
1,666,221,011 *AF5A101047A900F7A7BD491491FAD80FC7A5A2D1 b14j
1,666,221,012 *AF5FC35EE881601AA1B685C5F22FE8801394A496 B,.4S
1,666,221,013 *AF57A91EEF4CFAF4AD43E28810791B86A121E290 ae&d.
1,666,221,014 *AF58E023F3E4168F699F2F8DED6C6642F5B7338F aev(o
1,666,221,015 *AF5675432473AC3936B2C7F2F3CDC3F7098F4013 AGARSKAP9
1,666,221,016 *AF5A98799C4F4E853D0250CED8601C5AE39EB238 backning4
1,666,221,017 *AF538E672FB928EEF4749F2D9D5AD253B150AB89 ahru_
1,666,221,018 *AF54A0654EEA0C3AF16A6A59FBB68EC4770CBA5E aigahrrohcra
1,666,221,019 *AF5255751D311107DE0CFDE453D5DC524416A608 BCW9W
1,666,221,020 *AF53641190B6E037FDEA576280B91AD79E120CCB [email protected]
1,666,221,021 *AF5CB9D2F41C291FED2A71D2B36EEA9E5399E607 belvalenargonne
1,666,221,022 *AF54F70E660A8E0BC542495D7B5C8FC03CC2347B Algues.rouge
1,666,221,023 *AF53ED8995C28263934597AC1C4784E5821AE82B ber0
1,666,221,024 *AF50C6DA6F94F83A9CC3AC357C0EA765C881F083 ALMJ(
1,666,221,025 *AF5C411F0C5EF84CCF1BF8D4A557F93E5CFDC5B9 beth.lowrie
1,666,221,026 *AF55B5F1921150DCFA6F3ED316DE11B6BEDE4A98 ALPHONSELEBISH
1,666,221,027 *AF5103A8760A6BCDAAB475DE8278F2871AECA34D BF1LD
1,666,221,028 *AF56D7EC3E9664F15545407A070E2C74422834F4 ALV2
1,666,221,029 *AF56A64EA4A490D3C98F8FC29288D25ED64DFF96 b/_ht
1,666,221,030 *AF55F37A317101D751D8A91D9D955436AC81E515 ANDANTE.COM.HKWWW
1,666,221,031 *AF5124F163C22679F5C959B5492D5D334F51EE06 ANDEANFIESTA
1,666,221,032 *AF55CCE6F4C04B428CE3E1C17EB86BEEAD705086 ANDRASYAPUTRA
1,666,221,033 *AF512675639498601AB223BACFE49CB3F0F5B961 andreaumphenour
1,666,221,034 *AF5EEE23E3B8B0A8CEC6E54DF181BF98F38CF19C andre.dantzler
1,666,221,035 *AF5BEE9C1910C29A10823677A23422C2CE096B8C BILLFISKE
1,666,221,036 *AF5945AF6FFD2864E2FFB105F62247BF77B6431B b+ks+
1,666,221,037 *AF553A44BFDBF6324DDC6F562F3A86F7C7FABDB9 anniereimer
1,666,221,038 *AF5DAC43529A4C7BAF97BA5163B3741C7B75500A ANTICISM9
1,666,221,039 *AF5E4CC43B1404B914CE9025BD11CFF881F7E069 bleyle5
1,666,221,040 *AF58390BFB7E755CB987C440D1B98F197704A936 BLOQUERONT.
1,666,221,041 *AF5B9A0ED7EC776BA8BE50D6D2B9EF3D7F5C1904 BLUMFELDVERBOTENEFRÜCHTE
1,666,221,042 *AF57D8DF17411DFA0F2B4CD4C46305B15E049798 antonychittester
1,666,221,043 *AF5C43D1CCCB7774A5867C229408B21BE4B7171F bm5
1,666,221,044 *AF573E10CEA38F64A4C13B94C889A0F2C568B01A A&O.E
1,666,221,045 *AF55564F5B425187EBA664EC08DEA5345256C3B9 [email protected]
1,666,221,046 *AF51A21D117963DBEA206F563051A43C70E09493 BORRADODANIELLA
1,666,221,047 *AF51DC2F6F9533B82B9A1B7067F9B32462FB1E84 b_/ou
1,666,221,048 *AF588E59E9605255196C5F8DB7873FA65600D0A1 bp,
1,666,221,049 *AF5C04CD4197F26FE96574DA7491E91393FFA0D4 B###P~O~O>-<
1,666,221,050 *AF536647FC1951EF9D23F0F18DDF59DCCE1F32B3 asmdu
1,666,221,051 *AF50A5CC8D60037A6AB19BB5AF9C28E8E6CE6F9F asto$
1,666,221,052 *AF54FF539F06E863685EB42B2294EACE887106A5 brendanlarey
1,666,221,053 *AF569D78C95997DE0CC46CAEC2C9C4EB9C5F809E BRENDONBONNENFANT
1,666,221,054 *AF5E5648FBA35A1E35673FDBC793DBC64A767178 brettwilfong
1,666,221,055 *AF509D3EBE0C15236345D17CBC7D07AC6A08D84C ATHJANICE7
1,666,221,056 *AF5D4BAE05E0A64B4DB3D568D6AAA67D4A43D685 BRITTAINE7
1,666,221,057 *AF520A5F83C3093FF5292E8510C57DB3F500F315 ATUL_CHITNIS
1,666,221,058 *AF55D4EF2428E88CC2F2BC739FA1A9A26CC7CAD0 augustinavičiūte
1,666,221,059 *AF5A4BA67D28C6B757CC25C2BA3CC11B53965F04 BRYANTHERRIMAN
1,666,221,060 *AF5FB976A221472A46123631D7531DE7B7D93E96 AUHQF
1,666,221,061 *AF500E56CA9BAD5CF4270BCEAF49DE093B9E076E AVADORPPAED
1,666,221,062 *AF5BDDC594ECF673A7F01579C32DC56A1BD9703E btfgi
1,666,221,063 *AF56359439349DE35894A28C0D1808954C93F6B7 awpt
1,666,221,064 *AF57AAD6D4D69751ACAEB752715E5F7BCF38649B AXFXQ
1,666,221,065 *AF52A3A2828CF1F9BF1F4CFA79B959CEF733EECC AXPD?
1,666,221,066 *AF51E3140C38FEF084F4B45DDC944E17B3CE7D6D baa/e
1,666,221,067 *AF5D92AA5C994BD6FF842CACE520847CF40B7DA5 bzv(4
1,666,221,068 *AF5EDC9066A74ADF3EB18A888DEABD54717BE5A9 bagooranahalli
1,666,221,069 *AF5FABE2A71FA13ADF4DF739D02750B7B7E0C289 [email protected]
1,666,221,070 *AF507D739118C97D2455E4CE6A36461F670430B6 bastard.pointing
1,666,221,071 *AF5F0CCF9877C5232C425ADA9BFCB8A637257C14 BAUDONCOURT
1,666,221,072 *AF54B11FD37631DF8C7BB4C6C53F216E04EA8EAD CANAAN4ALL
1,666,221,073 *AF579CE34E5F10F452B8F95BC508D96877B7C0FC CAN'T-HELP-BUT-LOVE-HIM-(FEAT-MARVIN-WINANS-AND-GLADYS-KNIGHT)
1,666,221,074 *AF565F44CEBA4CC865A0DB4D8B9313B544834F0F [email protected]
1,666,221,075 *AF58FAE3CA1A0773F1F7DC38EF667C0352AE337C BEGINREGELS4
1,666,221,076 *AF5F942FF3592C35CB911311B2DC378B20D3B134 CASEYDURNING
1,666,221,077 *AF514F7425B318A3DA3E90713FA8166DAA262911 BENNETT.LIGGONS
1,666,221,078 *AF5A488285385C0CBC85BAC48522FC9E919DE920 cavj+
1,666,221,079 *AF5AAEE9125A797216D8B09A0D8A1698172FA4D8 ber&str
1,666,221,080 *AF50A313EB4E42157D5C3656632437F18E0DF215 CCGVL
1,666,221,081 *AF5CF3B11E0C1EB5CBA52CBB5E0698BFF0E0A223 BH;RZ
1,666,221,082 *AF5E52921C98B3A973DB5D65505FD4DB91F6FF37 bia-:
1,666,221,083 *AF53E7ECBCED247DF7249C4DC91353DBAF58C6F4 ce:nb
1,666,221,084 *AF5EE4B97737D27581DD59C774C6AB52E083F7A7 CEREBRIC
1,666,221,085 *AF5C3D3399E845E2A2B81BC4C28232B6881CCC31 BILDIRILMEDIKÇE
1,666,221,086 *AF5EA6C5FC71357B0A4D75D5FB19BF26A50E0B66 CFg8
1,666,221,087 *AF5A88175EF126B237215F070ABF9B6F54B79E5A cf&o+
1,666,221,088 *AF5595FEA0F892C422F3187D7C87C28C06E262AE CGGTZ
1,666,221,089 *AF5D7964D2B307534BD69838FF2361AB97309A89 blackiefred
1,666,221,090 *AF54CF3816A68C2EF9A0A9BBCF48408CE8C67DB4 BLASSOUX6
1,666,221,091 *AF5CF0DAFE5E1FD999AF81D972B9804408D8E373 CHAMP LUI PIO
1,666,221,092 *AF57FC766A69D16EABFF0DC11BF197383D8B0290 CHANG.BOUDREAUX
1,666,221,093 *AF5CCABE8960F030EA2E9168C6C189648161E298 CHANG.VAID
1,666,221,094 *AF50A63EAE2D269DDE98FCAAC5D6275958F3883F bluefoxes0
1,666,221,095 *AF54F0C45B495021F3B8F2C054D7375D224AE464 bm5
1,666,221,096 *AF517980CC536AC97E9E66DEF58890CB9B70ECC5 bn?ne
1,666,221,097 *AF53AC25336737302FF2319FFBFF0DB230144390 [email protected]
1,666,221,098 *AF52E1FA70EE657B2B5812629E6A85A6222543E5 BOOK 13O, ASSAULT ON THE SHIPS
1,666,221,099 *AF51D02FBD92D34C646510F24F19805E93F55101 BOOREAM0
1,666,221,100 *AF587F917F51E498FB0B20176249CFC9DBA260EB BOYDRAMIN
1,666,221,101 *AF543F76F2E157B5FD3DE0A99761F19CB9B65F1A c)+ib
1,666,221,102 *AF58912C28324F8232EE9D9BE2E0A13A5C7A3EFB braata4
1,666,221,103 *AF5B4A503D7E5CE24044ECE559D52783090A68F6 c.k;
1,666,221,104 *AF5EE717EFB2652012E01FDA11D22A3AAF225920 CKNETSCH
1,666,221,105 *AF5A20461A7B9E0850B658F3444F2D239CE84151 c(kof
1,666,221,106 *AF57B62BB392D6EFB7F2BFBB5F9B55162856F797 BRBH
1,666,221,107 *AF55A14988565D99B77D7DF6A75CEF1C6FF0F3B4 BRETLIANG
1,666,221,108 *AF5AA5D1D5504F60264F9E491C72797335927D35 claudbeazer
1,666,221,109 *AF59763CAB3EFD7910A5ADEEDC269377DE1102FA BREVETT!NG
1,666,221,110 *AF513BFE31EA7F3B2AEE2294A2CFDEA1FF444308 brooks368
1,666,221,111 *AF52218CBEC24925C8368D0E423696C41D561F8E b)snn
1,666,221,112 *AF5F9538F6A300F42E65DAC941767FF00D03C0EE CNCKT
1,666,221,113 *AF58030580A603ADE425DF7217B290A9A12DF736 BT6MG
1,666,221,114 *AF537719CD5A5EBB3B4E4820C3BC1BA67590B1FF b,udo
1,666,221,115 *AF506DFAF7EAD301EFB634C613767F5E76F50ED9 colintimmerman
1,666,221,116 *AF59A454427553E9C9E015B954D0959DF75C8E66 b,ulf
1,666,221,117 *AF532448BE00812B0B8789AE3A1A1BF68B2BD6B5 COMMESIQUELQU'UN
1,666,221,118 *AF568B21161D1291BACF7BBAB6C723DDFE9C2D21 butchblaster
1,666,221,119 *AF5FF1D1E27080FA3DBEEEE48843B83BF32937A1 buveneka1
1,666,221,120 *AF5F6205FACE6B7E0F0CE0FD49ED2B7E0E90D769 conunonly7
1,666,221,121 *AF562C3428EB5A10A738615914589EFE7BA85F14 coreylile
1,666,221,122 *AF57D7BFC85187BB59ECA62550F82626104F16AA [email protected]
1,666,221,123 *AF56D24B538B626832FF8C288D96ADBD2183E52D corneliuspancholi
1,666,221,124 *AF5FF334ADC09DDFBDDB8BF0B6234F2A30E30E4F CORNELLSCHULKE
1,666,221,125 *AF5CB40FB4598F575D08B8EC71CE09DDF9EA3DE3 CORROMPES6
1,666,221,126 *AF5EEFF6FCD5DA6AFDCD152BC325DBC735A26F64 c1$xs
1,666,221,127 *AF538D098DD0640195E49EA6B105D60D06A57C50 CR3HE
1,666,221,128 *AF5A33CAB032BF40456052D69C95ADA19D0E319D CRISTOBALHANDLY
1,666,221,129 *AF5B7B67C3C26BDA52956A7C39E48F93BAD77877 C&!AE
1,666,221,130 *AF51B6058181D42414FE5441EA43FC0325199233 CAREY.GUNNING
1,666,221,131 *AF5FBAEC9D65CBF7F3F2ADF1FCEDE032089BC4F0 CARLTORNOW
1,666,221,132 *AF52863D7E88C91975DC7A806A96CDE81354DBC4 CARMELO.FLO
1,666,221,133 *AF5019E6A32FF0D63A326F8A2B3CB097253931D8 carol.resch
1,666,221,134 *AF55226D8D37C361EE1FA7A2F0070FCA92FE0F18 CASSAUNDRA-WILLIAMS
1,666,221,135 *AF578C1B5DEA64154D41375272F306F234344474 CVWD
1,666,221,136 *AF5BB3398D289DCB931A68DAC8A87E9D6C417A99 CWIRLA
1,666,221,137 *AF5719825202A17131C902499C973414E271AEE3 C=BFM
1,666,221,138 *AF5AEE7A279314BC98A34FFBB223BE618DCCE4A0 C}c
1,666,221,139 *AF5B9030495C59E88D05F9F32228BA06AD6B6D4D CCCCH1CCCCC1C
1,666,221,140 *AF56EDC83A8BBD0736AF711773BB9A1D9D211012 [email protected]
1,666,221,141 *AF57C2C1F254F7C11206BE6973AEC52212D32A0E D06W
1,666,221,142 *AF5D0EF71D115D6C764F82C0B509472D9C3C3802 cedricgabrielli
1,666,221,143 *AF53DE192F7BF6ADE83D1E7126BFEB0D63EB2A78 D3(KD
1,666,221,144 *AF50BA8E9EA9C4346D67448B29AB7783D50C91FD Channe1zat0n
1,666,221,145 *AF52C5A84EEAABB9B54C201CC1D2C6B63851DFC6 CHAOTIC20
1,666,221,146 *AF593290A9B634735B0B2235D3EB25D1C64D949D CHATHUKKUTTY
1,666,221,147 *AF53E8A17B7F6790B9CAD2878E98C4AC629E7B14 [email protected]
1,666,221,148 *AF54DAB508D5EB9A2CE15AB663F37D740BB2AB8B D’ARCHICONFRÉRIE
1,666,221,149 *AF52B6F422E57A07F10D8E553C23A3C5C0B04CB0 DARIENSIMMONS
1,666,221,150 *AF5316CD8BA510BE4BBD328C8157C01746FB80A1 DARRENSHAKIR
1,666,221,151 *AF5CDE436F3E11DC9116FAE72D07683A43FFDBB3 chitties4
1,666,221,152 *AF5762DE60B2365E26278CEB0CDDC169127EA258 DATE20030618
1,666,221,153 *AF5F28AFAC91DE706BCEC6B6F4D3FBAA5F718473 CHRIS.OLENOSKI
1,666,221,154 *AF5A6B5D977CCD03C1530FC0813696F33F3259FB david-c-cole
1,666,221,155 *AF59976956B37CEA4743BF48395D75C07DD93582 christopherburres
1,666,221,156 *AF5F73E5B6071B3B6B163CADB7106B54339A3B20 da-vinci-virus---enzo-junior
1,666,221,157 *AF5F50CCDEB650D95548EBBE461FD839D865907B db2f;
1,666,221,158 *AF50C688DC4DF94A246E991799386E213E76F3D7 dboqq
1,666,221,159 *AF508DEC017EDA0090872389F8DFCB0E8E006CEA ciom_
1,666,221,160 *AF536222B80FD51BD26F1483F0D26DFC5A3DAB36 ck}n
1,666,221,161 *AF5C1A93D46AE3FEB0B2494F9383361BA0642432 DEAR811
1,666,221,162 *AF52220CA5BBBCF8055E0F5DAD996E2C12ECD34E CLAY.FVENTES
1,666,221,163 *AF51A55F934091911179A95C5C4D492DAC2FC61C DELBERTROVACK
1,666,221,164 *AF5CC3C7AEFB44944F03BFE41FAF5076CD0112BA delilah478
1,666,221,165 *AF5ABFCB04F2228EE879E1B72FDCEA46070173F8 DEMARCUSHADDOCK
1,666,221,166 *AF5C07E2013C739A9AE52F156FD4501674D0AC45 demetriuslebaugh
1,666,221,167 *AF5E4ECFCEE906F7645B4D03EDF8F760F04E29C7 demobilisees
1,666,221,168 *AF568F13684C274F7158C757975B3B9E6B852891 [email protected]
1,666,221,169 *AF5F32C94F0ABA190D1F3FB1EB457E8793D846D5 [email protected]
1,666,221,170 *AF558358DAF8739E24C94353A7FFB99CE00140DF [email protected]
1,666,221,171 *AF57EEFF5CC0AB683EE0A1ECBD6A7EAA03AAF190 cmshf
1,666,221,172 *AF5656297FA2C228251E1F2ECEAD106F0737E250 DERRINGT5
1,666,221,173 *AF5E75A382AE561A9CD66BDB33C8AAE21B34DAC8 [email protected]
1,666,221,174 *AF5800B238DB8D8F820879DFBE909744A766EADE DESERTSTORM
1,666,221,175 *AF50C498B43E316830409CF6A4BB5C801D571480 [email protected]
1,666,221,176 *AF5D1711DA8891E016BA75F8EAABD50ADBB82977 co+o3
1,666,221,177 *AF536C16C8F7660D8AE169C8873C5A2D46C89082 dh2e,
1,666,221,178 *AF5651241AD3ECC016DB22CADA5BDBDA60046B02 COREY.MANFRED
1,666,221,179 *AF58B4D6983CB0D2F99FE4BC1399FDB7FE1CA574 DHOYR
1,666,221,180 *AF54951DBC252B3CE6F962DAE3C1E4FEE18833C7 CORY.GAMBALE
1,666,221,181 *AF536406234197D10918E1F7B22D3AB8D2DBF74D DidoandAeneas:ActIIRitornelle
1,666,221,182 *AF57EFF7F6594C983DD18A2F94A05FEABA55770A COURTNEYHOOD
1,666,221,183 *AF53366AA21EB1D98CD81780A88CC7F3D87D6387 DieSchritte/A.Goes
1,666,221,184 *AF5CA488E4840C9B3EB4FF796A9D7CDB41C92ED0 dillonchurchfield
1,666,221,185 *AF528244014A683419A429253E42010B5B76A845 [email protected]
1,666,221,186 *AF5B2940813110BF75A11682D191ED59C68C0B7C CQFRS
1,666,221,187 *AF560ACB4BD0DBE5203C4AF3CE00FD464A6C4FA2 djc#$
1,666,221,188 *AF5D4F78424C410118A305BC69E213C78E163BBE CRVFW
1,666,221,189 *AF53A778E04A6A06483078CDC91E95B1ABE0A050 [email protected]
1,666,221,190 *AF5F3C6F69ED8106C52E713DD8E2D29646C063D8 D+M1S
1,666,221,191 *AF5EFEE16E7C557B564A1D4AA807D9E4DF395A58 docf
1,666,221,192 *AF57C27024131BBD07932BB7033B40DF119AE912 DONALD.GLASCO
1,666,221,193 *AF5EAD4017605E5BDBC510991D81C66AA93817A2 CWB$K
1,666,221,194 *AF552C262FBC8C1526FA6560C27BFC0DDF0E0340 [email protected]
1,666,221,195 *AF558E6F0C57936E772FBABF98CF68A60813C121 DOORGROE8
1,666,221,196 *AF5BF0AE36EB5466ADA3123718A004011B98CB40 DORLIR
1,666,221,197 *AF5D07E836B5CD348E25F9428DB1A8C63A2BF9E2 CZKWS
1,666,221,198 *AF5E2D960F3525D008D21B73D326912B9A2156E8 D3FUMLO3IS
1,666,221,199 *AF5562E7B5B3C502573623C15BD4E8E24B19CC39 d3fvo
1,666,221,200 *AF54FCCACBF74B4DC8730125C39FFD55F09A1773 D5D-8
1,666,221,201 *AF5FAA00AF3C6CFB246538EC272F505E6D43DC2C dso33
1,666,221,202 *AF59F7F07407FED0903F372FA32837678F97D0FD du77r
1,666,221,203 *AF554605DA5C149964A83A3302AA6935F2722523 damionthackeray
1,666,221,204 *AF5A15FF895BB9274FCA879BD5FA43E5D5D802D9 DAMMAHUMS
1,666,221,205 *AF59641B58723D0C2FE4494181760A6EBACDDE15 DAMPSKIP7
1,666,221,206 *AF53EC2F1B15F9482718321A34B0834B5828363D DUE:
1,666,221,207 *AF5B1E4D8BE4BF339E9E63BB564B9074C89E27BC da,?q
1,666,221,208 *AF588E7C986569CAB6348AD750FB8DA143631ADB DARENTRELL
1,666,221,209 *AF5A48837E74A41E1E2CF6314CB925499A65CA14 d,vk
1,666,221,210 *AF5966E4EE9CD862BC7AD423961D8B51BB4C6159 DARREN.HEADEN
1,666,221,211 *AF55E0CBD44915271125360EFFFC3AFF83071C2E DARRYL.BOYTE
1,666,221,212 *AF570791A1F9F4DD3993331B07E074527901913E DWSOS
1,666,221,213 *AF56303610385758A88B6C989D1D253D6DC76D09 dx&(i
1,666,221,214 *AF5E09DDBC106505574EF615334FE8F5F16B641A dyaff
1,666,221,215 *AF5A97A39A0BB9DA93E2FB55B7C2D1C552299ECB earledaros
1,666,221,216 *AF56F8AFF88DB3F506B0EBB86113CD7550946BA1 EARNEST.PELLITTERI
1,666,221,217 *AF5AB5A63D65E76151C437FCCA6890BEA5AB330C dd0fm
1,666,221,218 *AF5D81EF0A3C206ADF30C16CF66926C7B73DE67D edmondmorkve
1,666,221,219 *AF55CCEDC4F02FE4BFD5EE223F446E43479F7193 DECK6
1,666,221,220 *AF557A5AC32015E48AACF24B964588374734A80C e-et-Eurydice:-'Arrete,-Orphee!'
1,666,221,221 *AF5E139C357FDB439143C5C8CB010A2DAA99CD3B efugient9
1,666,221,222 *AF59BBB5C5C94C8B2FC062EDDB83CD60710DCBE9 e!g)
1,666,221,223 *AF561BC502894128D3C8DC4620BD041A382C324A [email protected]
1,666,221,224 *AF5988232AE6BC4C770FAFC623F959E1EC664719 demobilisees
1,666,221,225 *AF57A34DBDEE916411EA5C558CE676C9095082A4 EI2RR
1,666,221,226 *AF5C33EA0801CC07C03042DEDAD3D2C2C5F105FE deue
1,666,221,227 *AF52179716759363645212E90F9601708B14E2E7 ELECTROLICKS&PHRASES:ELECTROPERCUSSION:COWBELL:15
1,666,221,228 *AF575B2303B3A11977DC0AC0A5DC35C267E8D281 ELISHA.KRELL
1,666,221,229 *AF5124E37DF27971CA929E7A1992BBD4345AC05A ELISHA.QUINTEL
1,666,221,230 *AF597C35C8C3BCEF0A689DC38702564EFD1B15E2 D!)G0
1,666,221,231 *AF583BEE1E6CBE0454A45F516927BBED1B154D3B EMERSON.VOLLER
1,666,221,232 *AF510BB3E5DC274BDB5E3DF8BAF1D12905E2B7E4 DIH!M
1,666,221,233 *AF5AB8603586EC3CDC420702A6C401C409F475E3 enba,
1,666,221,234 *AF5319BFF90F181225C4A361ADB81631FE875073 director.general
1,666,221,235 *AF556A9FD2940D0B422F9947130B038077D2E5E0 dispensionalizmo
1,666,221,236 *AF576A06E14B74EA4913ADA7F62780965A73689D enterfrosty
1,666,221,237 *AF515C4F17CE762DFF0F50DA81C8BEA81571E363 D:JU,
1,666,221,238 *AF5964F69E1399ED6638E1C24053CD827369E912 d/n)
1,666,221,239 *AF5CD83934D8D529C72664570E6C3532917929E2 DOGS THEY MAKE UP THE DARK
1,666,221,240 *AF5B6CA5582D88A22FED32DD0662CD13DCDE75C2 espn-
1,666,221,241 *AF51B5B06EB9B51D9D906638BDA2DF39F7E24DA0 donaldferriman
1,666,221,242 *AF5FE985E96C74E188BF4520858586331FD944A9 ETAUGELI
1,666,221,243 *AF52D1049FD47B0212221AB877FA8F3D09CFC8DB etymo1og1$t$
1,666,221,244 *AF5002DE6A22172A81CD0AC53FD83124ECE449E3 EUGENIO.SEMENZA
1,666,221,245 *AF54CB0E957A2BBD66EFD58CA49D9673D60CBEE7 DOP3R
1,666,221,246 *AF516ECF53F0CA70FEC2CA3862D27EDEC7567A8C EVOLUCION.WWE
1,666,221,247 *AF5359348FD997AB3B9AA901AC372913290B6C13 do,x
1,666,221,248 *AF5A6030D1041D861AB679363D1164A003959479 dqqy3
1,666,221,249 *AF5907D3E5DB1B9C33AD383A8FD81FAF86D5DB1B ezghari3
1,666,221,250 *AF5F218A0096FAAD446F78D1DCCC413F4CD8B127 Drhi
1,666,221,251 *AF51786C525BA4319A8D90C0AC46465260482008 FAHRPLANM
1,666,221,252 *AF509421A5DC9508E3E7ADF50F150281728A28AE D?=t
1,666,221,253 *AF549F25592347580BAD253E7410D712AE539C00 d:t.r
1,666,221,254 *AF5B52F4EE99A12697C0F3B0B3E14ED95AB03E3B FE+IDNE$$
1,666,221,255 *AF5EF38C57EC196FDE6854A55F29E2A2DAEF86F4 DUHWAN
1,666,221,256 *AF542AAC806CBD70833511152EDE0F4FBE290CC2 DUOK:
1,666,221,257 *AF500BEBB715C5F42D1FC6CF689C237191615868 DWA3Q
1,666,221,258 *AF515BE22D26EB1472858BFFCD01F6CDEF8B2278 DWIGHTRITTENOUR
1,666,221,259 *AF5181E6D7EC534C836E9B4A5E2410F97C7A0C55 dwka0
1,666,221,260 *AF5B72C7ECFFAFECFB87C02576BCE6B9C41C22D8 D'Y\
1,666,221,261 *AF51CB8063B29CA9252F88DF32CF289B470B5576 E5O+ERICAL
1,666,221,262 *AF5891F2C0644EFB897309044577D63B477BAC35 [email protected]
1,666,221,263 *AF523DD91D40D57273FA4D34597FC63C69CBC363 $EA MEMBR
1,666,221,264 *AF5F6BD7BD885B1E86C9AD1BC1BBF4DD37B49244 EASIERHS
1,666,221,265 *AF58B672C51D6011DC3E86BFF43210B17F2F54DD eba.j
1,666,221,266 *AF5216A24CDF6E89451841FB1E963C718B9F2286 ecg;7
1,666,221,267 *AF5AEEE56C22630AD95F0B3A24577AB5FE1D802B ECLISSAVA5
1,666,221,268 *AF57E7738F729CC8FCDE1388AE9D162CCAE95752 EDISONBUJARSKI
1,666,221,269 *AF55CA8F0F0036DDFDE823375BB8CC34D1615F07 [email protected]
1,666,221,270 *AF59C3D4BA9088E887E512FCC871F13F14E67E7A FRAYEDKNOTNASHVILLE.COMWWW
1,666,221,271 *AF5BDF275C62C669FDB622331E5BA543BC1E66D7 FREDRICKPELKEY
1,666,221,272 *AF53A179F54546E325CD7763FDC69673EC4E7704 EDWARDPISANO
1,666,221,273 *AF5FCC3ABD8C6CE596EA778915BAABEED4840F83 [email protected]
1,666,221,274 *AF5C6AA2D3F2DDDC1DA0BF7BF49DCC6DA3711746 EFRAIN.TYRE
1,666,221,275 *AF50A9F1C3FE4600731EEC9D1F1A1E7150F54177 EFT
1,666,221,276 *AF5989CB76412274C3DC90E56E6F3C7E0CFC9E51 ehc9
1,666,221,277 *AF5308DA3205EF6BD162C163C5965CB8C5E95D8B G3N0PR3TT
1,666,221,278 *AF5175E1D2D85E6F1E116EDEFBE71074852A5321 elcillet2
1,666,221,279 *AF54B15F5FE2B8256D902B1864294C2BB52CC3C4 eldonjalovel
1,666,221,280 *AF59CFE69741AD67317E87FFA706CA9774D70937 [email protected]
1,666,221,281 *AF516424C7212FA2CFC18C1C9CDD0D517BD421B4 GARFIELDPOAT
1,666,221,282 *AF58EAC18BB0C88103229B32E66F94D1092D9549 ELIAS.GAGLIA
1,666,221,283 *AF5206846E7498623B5E177D9A67B6FA8CF917A1 ELIBERATOS
1,666,221,284 *AF5ED017E8320A05AEFCB05543ED9B6DEAB99AFE ELI.MAZIERSKI
1,666,221,285 *AF5636BE45824C664B20BFFBF8583AE9FD5A2965 GARY.L.GILL
1,666,221,286 *AF58E8C20AA774D1DCF51D045EF16F4B8E24DB36 GASTONTIBLIER
1,666,221,287 *AF5EB0F7D3BD1A5105C8E29135D933E2690E1BDE ELIZA477
1,666,221,288 *AF59FCA0347739160C56BB8AC1FE35D0BB291BAB elmerwentworth
1,666,221,289 *AF5364DEFB01F2F0F66BDB92B90F178EC5F2CFBE genaroprunier
1,666,221,290 *AF59530F149B201B56CAE456E191B13EEF695956 ELPRUPHT2
1,666,221,291 *AF533FD72517126A845350792221E9A51DDE1BC3 GEOCOMPUTATION
1,666,221,292 *AF5F48A8889499A53321C8F7206B8FB23CEF12AB georgeaburto
1,666,221,293 *AF5C283C5C4787DF6493CC9E1CD082AE5394A385 GG'S.VISION
1,666,221,294 *AF5A709F8D60472639072B80B67A5E9AA0C8D7FC GIUSEPPELODI
1,666,221,295 *AF569E43C6965689F3DEED2958146E059A0AE559 gj g
1,666,221,296 *AF5124DCD7CE87CD5DB9ED497FF84861B365B8E1 GJUNAIDI
1,666,221,297 *AF5A1615D734E07B739FEF68E9938FC22B965705 [email protected]
1,666,221,298 *AF50F7347998715F65A603C63EBA32FD87641543 enilaner3
1,666,221,299 *AF5A9DB2EE7A684097EEF6B37CA095F7F64B1DC9 entreverrais3
1,666,221,300 *AF5F21CF428ADC88C6B76C591933DD913D92CEAE GOKUISHED
1,666,221,301 *AF5356E4178EA1F2A14C86F07B950178F1159798 gradydufrain
1,666,221,302 *AF5AC181A538895EA69A29C5C67FFDA986F942E4 ericlisa
1,666,221,303 *AF5898BB13D646BDA1B149514201492D0452D911 GRANTSTRODER
1,666,221,304 *AF5C885DC20150ACA4365F9B100CB0960079A66E GREAT-BARRACUDA
1,666,221,305 *AF5B94942ABEEBDE61ED054F9ACBFA59B354523E GSB*
1,666,221,306 *AF5843D570311B977A062D791566588E7CE8E549 eszukbe1
1,666,221,307 *AF57BA695D2FFC922C07E366E506CB48FDE447E8 ETGIDNATS
1,666,221,308 *AF5CDF66E6B054AB0CD765DE081BB067653640F0 [email protected]
1,666,221,309 *AF5307350C7D6B0A4B48126FF86FB9BE5839E609 GUSTAVO.LARMON
1,666,221,310 *AF506DF7A02A4223FB7931C956AD09C27EE56B7D EUGENE.MANANSALA
1,666,221,311 *AF5E5206B4BF8F70086884A40D8E61F9D66B5119 GYTANNA3
1,666,221,312 *AF53F7A3696833FEA72A3C0360723D030DE4597D eutm6
1,666,221,313 *AF5CD57E62B5932D7FA00DDAC31A46CE5262655C EVALENAHS
1,666,221,314 *AF5A8EEC5AA8EDD1ABD7164D202E86435C4A54F9 EVELYNGRIFFITH
1,666,221,315 *AF5104DFB66718FCD36A349565753E3CC4709F00 HABIBI.DAVID.FIUCZYNSKI/LIAN.AMBER
1,666,221,316 *AF531F52204B29C0698BAA27060257DC0653ABEC EXPLORERIH0KSPLOW1RER0
1,666,221,317 *AF52FB2D6C29267F9D0568D08404E478256C720C HAL.WEISIGER
1,666,221,318 *AF5200A1C40FDBCD964F52BEE104663122DDFEAA EYLALIA5
1,666,221,319 *AF59BF2D8BD74C7C6DEF06A6200D87B635F036BB EYw
1,666,221,320 *AF55413B97D53CC402561317E1FAD359E1F3083A FACEBOOKBOT
1,666,221,321 *AF529F1C627C83C9166BE9EDF3C4C78EC4D6AC7F fallibility
1,666,221,322 *AF50D233FBBA2843C9641959109597418AC4DAA9 fauvismus6
1,666,221,323 *AF595B7ED1F5CB546413A34F12EF8991CAD79806 HCSITOID9
1,666,221,324 *AF5CC5FBD3EC379D4030C192CEA303E991BB007F [email protected]
1,666,221,325 *AF5E5A75F9DA47619B8A5D69E3085B5F47FEC3EA [email protected]
1,666,221,326 *AF53419FABE64AF205ACF92563A082D428B8308B FELICIA-GENOVESE
1,666,221,327 *AF55B717BFA0818D0B406A14E7DE8DCC0BD3CDD2 FELSUNTERK
1,666,221,328 *AF559685E76C8D64F1D1965D90F3C16AA6F1CA67 HELENBIEBER
1,666,221,329 *AF5D84B5E02956D341E1ADFC0DA783BF266A892A feltonkichline
1,666,221,330 *AF5BBA2040F7F5B6F1D744865B48B3E87E31F15D [email protected]
1,666,221,331 *AF59893D0FD23BB59F20A41FDB2CAA148971D068 FERMIN.HOHENBRINK
1,666,221,332 *AF59C175119E60CDF2A8091F6565D3DA6DBD35CE [email protected]
1,666,221,333 *AF5E3A495BD038345E09AB92B516F27D7BACEA61 HENRY.SABASTIAN
1,666,221,334 *AF5C41F6766CD1B326CC223F594B621525DDCE6B FGULRZ
1,666,221,335 *AF5BCD3D890878390E285C1E9B755EF2AB88DAFD herbert.b
1,666,221,336 *AF5A875500EBE3982ADC04DBD90F3C9A36164AC9 [email protected]
1,666,221,337 *AF5B88FAC9014D1C9D622A0C12E402C4D92E67B5 fiefferme
1,666,221,338 *AF59449C36858D537B8C0D2DFD4F12E39CC35A33 flbealls
1,666,221,339 *AF52FC9F8161643E2D1963048E1E4C7D8BF02F70 hiftn
1,666,221,340 *AF5F2CC2DDD328E4716D74D1CF343C4D25D4F5AC hit club 981
1,666,221,341 *AF5414DFC27398607B1053BB042BAFF70B4B752C HJEMLEDES0
1,666,221,342 *AF536052E29E139EEB8395E724381EB2FCA371EA Fqf
1,666,221,343 *AF55E24D573F59B431E9CE97C8BFC97DE7FF88F8 FRANCISA4
1,666,221,344 *AF5253F38BAE46DFFB41650B4CB4F1B751EF8767 [email protected]
1,666,221,345 *AF5E41B40F6FC59ACDF45EBE8B424A8485CBE534 HOWTOCOLLECT
1,666,221,346 *AF5D87E2A7C97726C3CECB10A44D2F127568067D fredricrockers
1,666,221,347 *AF58DEC02AD5D834443CA644512089DDA7822150 HTTPINTERNETVOICESRA
1,666,221,348 *AF56AF824DCC5C1234A030F1A69632FAD58CE012 FRITZ.LOWELL
1,666,221,349 *AF5834B3526CBFB744FA14834FBCB605941E9228 ht$y
1,666,221,350 *AF5164908B61D43A74FDA8E2D05729407B61173C hueytoruno
1,666,221,351 *AF5F4C268044659A015FE73E9EA7E76AF7453C7D FUN WITH PHYSICIANS
1,666,221,352 *AF57CE8DC6D1E7C4BF03897665E21AB460EC9213 fwj
1,666,221,353 *AF5E25DC7E05727936FD828DA4F30B626B4B0E3A HYPOID
1,666,221,354 *AF5CADE6B2048A5ED03138E44970CE3576BCD58C I6D>
1,666,221,355 *AF5326EF1E8062968EDCF216562ABF10B5084728 GAVYUTIS7
1,666,221,356 *AF50ECDEEC03EA528DAF752A0220EDCCACED1A14 ianjcox8
1,666,221,357 *AF5637CBDA9576511948C8A5E7C5BCBD877402C8 iklaathetgaan
1,666,221,358 *AF554B0ABC83658CB37C4E12F3699B7EE72B463C ILOVEDELANO82
1,666,221,359 *AF51B5F8AAAB75B56D930685DA6FA6DAF88A945F ILOVEEMMANUEL5
1,666,221,360 *AF5723CF74F0FA652B44BA3F05200593800D66BE giovanni-speranza
1,666,221,361 *AF53D7A8AF61FD4BD1F08D1C312F0020A96F6DFB GIUSEPPENARDY
1,666,221,362 *AF57CE7AF763B76315A9E6C2B6ECA9E48EEC254E IMAGEUSNWC
1,666,221,363 *AF5F1DB9301B56256E4487342975B4A5A6BD7BC6 I'MBADBABY
1,666,221,364 *AF57EE47FACB8980A683858E49D5DC2E769983C4 [email protected]
1,666,221,365 *AF5242947C3238F3DC6D95F5685AA58B73602262 INFORMIXLOUIS
1,666,221,366 *AF5DB023AF9D926D4EEFC9FF265CCB8204EB0B7B INFUNDIBILIFORME
1,666,221,367 *AF56E367BF06C501C1C97D9AF356A1BF7D470ECF gordon-leary
1,666,221,368 *AF5AE9126CE0A06F3724CFA8063D18FC9BB69038 [email protected]
1,666,221,369 *AF5977EB6F44691CB2BFB4D16F8FA5DB1D3CA827 grades
1,666,221,370 *AF555A97E139E77747BEBE9BFD1071F874F0EF53 GROUAÎSILE
1,666,221,371 *AF54CABCC248284A0E145CCB7F3B2B356299E7C3 IRA.JOERLING
1,666,221,372 *AF5EA5614E2025FA2E11CBA6605BBB936CFA2804 IRARAILSBACK
1,666,221,373 *AF531F540CDE755F72CC098B2062D333C6B82C58 [email protected]
1,666,221,374 *AF5B5378BA67D885B6637CA2B3BC911B478F484C IRWIN.SUBASIC
1,666,221,375 *AF51E67A3E9691D4AFC11BA98AE39FAF04644AB3 ISIAKTAK3
1,666,221,376 *AF5EFDBEA65AA481D500F03A130812E9B3B3B76A [email protected]
1,666,221,377 *AF5760E3B8288EF32B294B2A0FAC86C206346D3F [email protected]
1,666,221,378 *AF5078C35C729060EE309F937237F5EF1E663FC9 [email protected]
1,666,221,379 *AF5674D9AA53D4EC8E786F1A1A940D635C614D08 <H1 ALIGN="CENTER">
1,666,221,380 *AF539D96F031A923F0DCA462509FCBD6CF28E71B HAI.ENGELHART
1,666,221,381 *AF54E93669E28BFFDD916A2942862C0525E49FB3 I_;Y
1,666,221,382 *AF5CDB1DE1F559527FE89635431BAEEBE5920F59 hannah-birky
1,666,221,383 *AF546632C40018BECD19C93A1BC100D375DDAE6B JACKPRIGEL
1,666,221,384 *AF51EE129B0A47C9E344CEB2B5C2EECB83D716C2 HARLAND.NEJA
1,666,221,385 *AF56117D3B8E6196187364D18D50F2DB48F0D92B HATFIELDHATFIELD
1,666,221,386 *AF54CA04371FC3896F4EEB5C1B2A412D1D3E059D JAMES MINSON
1,666,221,387 *AF5397A6CAADE4416C20682721189BEE252FB6E5 jamison-wilson
1,666,221,388 *AF51E8E15981B82E6C7C205200332651D89A7ED2 [email protected]
1,666,221,389 *AF5646D49F0299AB8ECC2BE1902555C7CAB39F63 HELIED
1,666,221,390 *AF5BACD86225D7569E45EEB08FC381D3E8D71EC7 JARRETTRIPPER
1,666,221,391 *AF57E5FF4D1E8247610A0D36C7563E994163ADBA HERMAN.HILGEMAN
1,666,221,392 *AF5ADF08722F0DABB4AA32C3BE4385C438E7F55D HERVORMINGSGEZINDE6
1,666,221,393 *AF5B5294666D79A3225926186EAD2034895784C2 HGINTROF3
1,666,221,394 *AF5DE32632969478CFEA2393FDCDDD2177CE649F JEAN.VANLANDINGHAM
1,666,221,395 *AF595212F326810314867118E61142EB6D10135D JEFF.VANCAMP
1,666,221,396 *AF5D8548C833C3C531FBF46E10C8D313F4C9714B JEROLDKOSLOSKY
1,666,221,397 *AF50A8E7D0370B96F668893295BE394E113A0CA2 HOMEOWNS7
1,666,221,398 *AF592934AD052B5D78FEE0C05E2AB4ACA937AD36 homergrunow
1,666,221,399 *AF542592A93D7164F2B0CB1407AECEDFA78CDEB5 JERROLD.JESSIE
1,666,221,400 *AF53DAB6B4F2B88B54A8C7DF037543DD2ACB0CCE JERROLD.LIBMAN
1,666,221,401 *AF5E9CEFD9E724EEE3A6837FF65783887BE2039B Hoofddaders
1,666,221,402 *AF5F672D8907DF2C9DF40AD5D7D3DF334947C70E horacecrandall
1,666,221,403 *AF5C3BA04438F9F85924DB59D494B68A94475750 HORNY.HOOPS
1,666,221,404 *AF534708BFF450FC623B39A2D33FD67F7D0613C5 JESUSTUBERGEN
1,666,221,405 *AF5457D482112554205256F551B66AC1DEFAD56C [email protected]
1,666,221,406 *AF5515B54E2D2CB537A74AADBCC6FAD93D34BCAB [email protected]
1,666,221,407 *AF51FE298CDD249B594C30E67290790F0E1780F4 [email protected]
1,666,221,408 *AF56F13304E5C83EAD1A2E0CBE8EF7B97FECCFA1 [email protected]
1,666,221,409 *AF5AF0CC0B3E4F01956868D7EF8FDC6C90994A61 jirintipj
1,666,221,410 *AF5EDE3F3202915D529E984487FCC3C1A16CC519 HTTPSOMRATNAGOOGLEP
1,666,221,411 *AF58E837A0F9055C7FCB325E50D22E000EB5E632 HTTPWWW.KAEWILLIAMSP
1,666,221,412 *AF59ADC198A27E8321D03A6A366E8F227FD3FDA4 h}y/
1,666,221,413 *AF530084D93AF8B50B5F9DCA4FC2F3B7C2B2146B I9//
1,666,221,414 *AF55537515D83B13BAD2CF7CF7CAB446C8977815 IAN.HENNAGIR
1,666,221,415 *AF5C4B333B3B14F96132A0976EA8C12D77E950CC JOVANBERNARD
1,666,221,416 *AF568156180C283003C48C21C8ABD40B14B735C2 IG\%
1,666,221,417 *AF52D90B6CF07619C6B45FF45F3190AE96D97C9C JUN12717-25
1,666,221,418 *AF52F94310200B3E7ED8E9719A60580A2356B248 ikemayne
1,666,221,419 *AF51CEFECC9737A3F79D6568D093FED7FC3AEDD5 jwux
1,666,221,420 *AF5F31BE45453F6438CB07B8B53A8547A6D84D7A JYOTI.PAREEK
1,666,221,421 *AF5A37E713EFB9035B8D27D5D7E806031EF9CF71 JYUZZOLIN
1,666,221,422 *AF5BC4BAF5695388A6E43C63CFBAADFDFD0AA35F ilovejasper54
1,666,221,423 *AF5D7D7D9626AC6A59E696E56912971BB1104D4E [email protected]
1,666,221,424 *AF55137D55AC572F98E041FB300C615639677420 ilupttjt3
1,666,221,425 *AF50D30BA7E2E7004B4D96F56CB19AB3903DA5E2 karllagamba
1,666,221,426 *AF58A43F5CE95DC0DB894A8356F769BAE52014F0 karoly
1,666,221,427 *AF54F40CAC70B9EA48005063F8207980C67C6000 KAVEVEME
1,666,221,428 *AF58361C77677B335977B3695E10290A89500AA6 [email protected]
1,666,221,429 *AF51E1B384C38F1F4CA8F4FBDC94B52D411BF767 kenethgiltner
1,666,221,430 *AF5B6BFE570D5144C6C5391A977B445C63A73CF2 IRKBAA
1,666,221,431 *AF5F44AF4923EAF23C945450EC71453A6B49B232 kevinbirley
1,666,221,432 *AF5B0CA77DDD48DC50F63CD731F6C8F3066CA6BA ISKIING
1,666,221,433 *AF53B4CFE692C8648D493680C10B861491494E4D ITISHREEM
1,666,221,434 *AF5B4644D76B09853D0D9272E5A1B42FC0E35A62 kingofmycastle(beefinjectionmix)
1,666,221,435 *AF59CDCE4BC96ABB7D9C1D994798FE30CCA67C2A iwonderwhatmybaby'sdoingtonight
1,666,221,436 *AF5F706775BA9D866917A6D1605C85A6995F8AEF [email protected]
1,666,221,437 *AF520865EB7D0DA3F182A615799C078EB8DEDFAA KIRKTROPEA
1,666,221,438 *AF5F6AE197A6BC46E949FB5B949879879E8F86FF [email protected]
1,666,221,439 *AF5C89A73A67B5E2A89DECCD86B492E66D23F5EE IZMOS
1,666,221,440 *AF504CB46C026DC7D1FCC4EEBCACA1063D36097D jacksonceballos
1,666,221,441 *AF5E13B1651D35B8A84F04B39E82D7EA95B7BC15 KORYVILLACORTA
1,666,221,442 *AF544A51526981AA8073F63558CE282FC7F7F543 jammal.freeman
1,666,221,443 *AF5361D63ED21102A83245B94A1372292B2E41C3 JANGOMANGO
1,666,221,444 *AF5D1ECF25C3EE3247D4336067E91B108FE00E47 lachlanmcphee
1,666,221,445 *AF5F870D74DE485CD6EB9E35BD83DAC3B19AF7CC LAHOODS
1,666,221,446 *AF5567D4D548F77F5BC1C676E61F709FA0FB0A0C LAKEAMEF
1,666,221,447 *AF50D7245F0C1E7B6E1CFAAA5ED2CE6B4A4A0613 JEFFKEILHOLZ
1,666,221,448 *AF5D195CAD62A3FB1E0E41052AC9602E48A58E70 JEFFPAPALE
1,666,221,449 *AF5FB9D874FD99AD3C3A102A856423B4D2CD5588 JEFFREYMENDAROS
1,666,221,450 *AF58027F4B075A2C6C5CA38388DF1ACC748AE60D laneingmire
1,666,221,451 *AF568EB005B62D0196CDCDBC03346800F23BCD63 LANGUAGE-IN-USE
1,666,221,452 *AF5015766BB17A9FF4DEF27681B6A45F1768B40E JEREPERKING
1,666,221,453 *AF5D63191B2142A35005787AB764EBD20567A0AD latejobbing
1,666,221,454 *AF57484A03EDEB55DCC6F8E1AAE16D1406E637FB jerrellmonte
1,666,221,455 *AF54F175D7785CADB25C5E415C66113BC9704DD8 laurieclass
1,666,221,456 *AF5AC1292D1A4069F0E93D09CA27FAD78BCEC86A jessvalentine
1,666,221,457 *AF54F3870834E125F963C9A8D4FED4C75A366054 jimmie.livingston
1,666,221,458 *AF5A2E78141DAA47E0A0DE3780F6BAF91EEAFA51 leonelloveless
1,666,221,459 *AF58C61365E06C697E3E8790B0E3CA4FDDAB6F05 [email protected]
1,666,221,460 *AF54C92CC319CDE522C006AC8365862738F64324 joedennig
1,666,221,461 *AF5EE930F80936C7F6B4CBDCDAFB05078B3C1A56 jogo-r
1,666,221,462 *AF5640832205283F6DFD22DC3F737E0BC0E94B55 johnsondettinger
1,666,221,463 *AF5BBF8E29CA5A8BD2068C683A07E5DAC5781E64 JOHNTILLOTSON
1,666,221,464 *AF563EBD98A95DCD742E0FF434124EAC166A724A JONFORTUNA
1,666,221,465 *AF5294D205E58D9B5FC1E1824AC4DA5CDECC983F JORGELINHARES
1,666,221,466 *AF53479819A010B710E9D72567C70B5F6C855716 LINDSEY.EVERSMANN
1,666,221,467 *AF50465C990E4E2B3651FC43EB8F0FF7802D9AED [email protected]
1,666,221,468 *AF571FD7718C51F6B60DF1B85A016908A2A04E51 lisadugal
1,666,221,469 *AF5CAB1875E4512A255E8D278AE1FFA838F7A884 JUDEHAUPT
1,666,221,470 *AF56206AAA634DB51C94EED0B2FAB030E73F2D7E Live-In-NY-City
1,666,221,471 *AF5C59B8D1D958C039DC659FB0C254E45039DCCF LIZZYG3
1,666,221,472 *AF5D6346765D8535E760B623697EF863FCE632AF localizá
1,666,221,473 *AF59D9D6A605FA5B3BDDCC9099F37395B9642389 LONNYWALIGORA
1,666,221,474 *AF5BB19D22CF80FA825DD60F9F3358F5C48FB3D4 kandiglover
1,666,221,475 *AF553DEF44EECF8A9DB4817F69EBE7E4191F04DB louishanline
1,666,221,476 *AF5EC1CE25C66A6FC8EBB17C5F6663AD8312778A karen-gallagher
1,666,221,477 *AF50BA3E60500E1AEC8884A7F4FD132123E5C2DE LOWELL.YAMADA
1,666,221,478 *AF54B3D7D8F1D723654CC7B37B6EDCAC40E22C08 KAROČKE
1,666,221,479 *AF56D9DAB0FA084F8E4BD537553A21FF426D63C5 karoly
1,666,221,480 *AF5A9E131EEBAD5A90A65551B898E2B0F61AE73C KEENAN.DURON
1,666,221,481 *AF5802BE89689DE80ADB9C34FC4A2A51E7ED08C8 KEENAN.WEITKAMP
1,666,221,482 *AF5A2CB9B16DA815AD3F1F59BF8CA68DD854AFB1 KELVIN.ZUTELL
1,666,221,483 *AF5D724DDDFD2C7BADB7D4EFFC18E137BF052DDA [email protected]
1,666,221,484 *AF5A189537604380E3785E9B7F8D38D084170142 KENDRICKSCIACCHITANO
1,666,221,485 *AF588C659E05320F47473D3A29C4A166CEBE22A5 lupehislip
1,666,221,486 *AF5DD716EDD212334E1E1736C08B373EE7DBD6BD KENETHWYSOCKI
1,666,221,487 *AF5408B7D3E0A84061CAC023C319DC4A04D16808 KENNETHASBURY
1,666,221,488 *AF55DBCFCFBDF4A7F3AE9E9636C83EA2BFFBBBAC KENT.SCHELLHORN
1,666,221,489 *AF556333B46851C6F8C6D4AB41B486DB592FC518 kerryhedemann
1,666,221,490 *AF59A349E45DA49D3C4882F6D39C0DE0E4C7C4DA KgE
1,666,221,491 *AF541B7247AF31A6B4D1A3B45FA7310DF615E875 KIBITZENED
1,666,221,492 *AF5A66C7D40794C2C011577D54143856661F2700 [email protected]@L
1,666,221,493 *AF51CBF6DB8B524B521D18111217EBE269A43358 MACK1905
1,666,221,494 *AF5D052FCB95F289E9D8B95118316C900A3D6848 KMPSRZN4
1,666,221,495 *AF560334919601ED2784A1FBCFFF6ECD94536A4E knorhaans
1,666,221,496 *AF5E753EAF9DC3CD666FAF01FB3AF7DBAE9C8FEB MARCUSEVANSON
1,666,221,497 *AF595A1264598122E60441334D00826A10D5D3FB KRISTOFER.PICCO
1,666,221,498 *AF5C3DE011F8ED8DF79F1F63F7985E432265C548 MARGEHOUSEMAN95925
1,666,221,499 *AF5D75C46AA7AACACB20ADF68B065B2705CA6616 MARGINALLN
1,666,221,500 *AF5185E6FF9DA81BB20F558D62100C2A66B0FCF0 mariabuchser
1,666,221,501 *AF5C6E11F6E4E220F8A24597E243EA8E16C15E9E KS4
1,666,221,502 *AF53BE03B7E59481FF9ACF442C3CE1F02D4750A8 k/"u
1,666,221,503 *AF5BC74F54DC28A6CBACA69BDBA9FCDBDCA32C34 MARKVANEVERY
1,666,221,504 *AF5512051B1AD10CF632E4AFEDF86ED850175634 KXQJ
1,666,221,505 *AF580DC579AA6876F18B67D80963C505A4F0FC26 KYLE.SMOOTS
1,666,221,506 *AF55B2E173EE7B392820A07A95B1E8717290ACF3 marvel!n9
1,666,221,507 *AF572E20E8F0DF24567370B72630472E01B1F6DD MATHEW-ALLAN
1,666,221,508 *AF544F218AFEB0AC65FC39621212EFEC048D1C2A mauriceagosti
1,666,221,509 *AF57C9A7C9E5BFC4FB39BB8CAF3A255510CE05C7 MAXGROETKEN
1,666,221,510 *AF52D6EF1167F574864949D3E33E5D9A62DD0939 MAYOROFNAGOYA20090126
1,666,221,511 *AF548A716B879A7990FE9E465FB618866213440A LARGO(CONCERTONO4INFMINORL'INVERO)
1,666,221,512 *AF5829BE7C0071836C0CC477F1954C95F4CA12D2 laurieharness
1,666,221,513 *AF5451A89003EBBA119F66167936024B2846AA8E LEANDROPHAN
1,666,221,514 *AF53E1380CB4195E80989015D4E8C749B29ECA5B meningsudvekslingens
1,666,221,515 *AF5439FB80CA73A3EFC680F8D47A2C5D64C038F8 LEGISLATION.42
1,666,221,516 *AF5AE916F09C2237A30C1FB2DCFFBB63EF03DBA2 [email protected]
1,666,221,517 *AF50A41899E4F51AAFCA759F6168240DB52A1EE4 MHAMDANA
1,666,221,518 *AF5F31B598B11851A984475464FA0F601DAA7C4E LELANDWIGAND
1,666,221,519 *AF5C6AC16CDAC9CADAAAF7FC02A124ECE793F67E LENGUAS-DE-CANTABRIA
1,666,221,520 *AF56F828CD3F5B6DFF6F53B0072DB68D56FDD0CB MICKYCUSUMANO
1,666,221,521 *AF596A05397D86B1124F53934906B62B304B05A1 miquelbutenhoff
1,666,221,522 *AF5C114539D3913E08728033A56F443C173BE55E MISSTERYOS1
1,666,221,523 *AF5962A7C58FD433B10B6CFF1BC7A365097457B5 ligurienne
1,666,221,524 *AF596389FCEC3B1F2E85F7FC8B1F6E2EA9655535 MOHAMMED.SINNAWI
1,666,221,525 *AF569EF4D8A375B01E624CC43FFB0C902148CBE9 MONTEPRUZANSKY
1,666,221,526 *AF5CFB915DBA2BF83899873C0312ABC50DBFBA72 [email protected]
1,666,221,527 *AF5D692C2ADA4A353E9331454F306A41D09182E2 [email protected]
1,666,221,528 *AF5E3B9A057B64E43E93D9A7FB9B6565C7A1E033 MONTYJEONG
1,666,221,529 *AF5589EE924D0A54AE23EB3DDB730EE8DCA024BF liverpoolとして設立された。その3年後には
1,666,221,530 *AF5E6E1B8F86428DCC244CFF68FDEF58E03243EE LLEEZIMMERMAN
1,666,221,531 *AF558135E2D9B5345F7ED7D6445F1FF8A90DFC54 [email protected]
1,666,221,532 *AF5911ECF537EC11469C46AA744268B7E82CF259 MR RESTAURANT FOOD CRITIC GUY
1,666,221,533 *AF5B4E0322DF8E2FD57E9EA970B3106AC9D9E4F8 multifido
1,666,221,534 *AF506E344A0F7BD204590CFC47A4CEF63161178E mutationist!
1,666,221,535 *AF54B65AEDE4E156DBBE1AFC29547DDFEA4EB343 myferrari26
1,666,221,536 *AF51B7E2970A0FF48A9D8C86F2D6BF7FC88F68D9 [email protected]
1,666,221,537 *AF5B57702C123DEBE71C534B9BAFEFCC1DB255E3 [email protected]
1,666,221,538 *AF53174B045FF867E7F112D6AB06830AA0BCA6E9 n73k_a7()tubok
1,666,221,539 *AF5495976A31FEF774195C7BEE9286492B5F2A8B NAAIGARE
1,666,221,540 *AF50F16A352C7022844B32B3875A6AE766C19D3D [email protected]
1,666,221,541 *AF526533D8BCF1B0112EA579F0A090240E9FAC6F [email protected]
1,666,221,542 *AF55878B35BD0CAD66F0488A7A93E0F2DDCC678C luzerzy
1,666,221,543 *AF58F433CB31BA46AE9AF3C33CE53CE12CA47085 LYNN.SCOTTO
1,666,221,544 *AF5C558F221A2787636F92022332221F4B29C204 lynnvoeks
1,666,221,545 *AF5BC55CA12BDE75A2027BDDE806DAC345AD1BB9 N.DE.CANAL..CHILE
1,666,221,546 *AF5AAFB4CCF0BEC2B67869B2A832FC5D1B3807D1 ndeportivapajara-playasdejandia
1,666,221,547 *AF5F704E3C83E5E8ADB7E32995824A1991E845FD m4r74l$m
1,666,221,548 *AF5B5248783A0A697D80341F3917167ABF87D1A8 machtspreuken0
1,666,221,549 *AF542E472DA8929A7D0737662DC207B641A4EC80 newsgroups: alt2600,altspam,altcurrent-eventsnet-abuse,ne
1,666,221,550 *AF58A09861D53C79BB032C7E58EADC30543901CE MANZIKERTI
1,666,221,551 *AF59E971417338527E20553BDC8D3FC445AC6604 NICHOLASBOWELL
1,666,221,552 *AF509A813304D716B4C97F434EC86DD2237FE6C9 NICKOLASSUTHERLAND
1,666,221,553 *AF55E195CAF1390D0EB971693E592284B2623A80 MARCUSWS
1,666,221,554 *AF5D6C97A6FD8E321D29CE9DCB97D2A9A51ABF60 NINJAPEACHES
1,666,221,555 *AF5A77BE24742D6F642485F72081B19FADC1549E nknownu1
1,666,221,556 *AF5486801A50647DAF9EAC6477FCE502D5ED2250 NOAHVONGKHAMCHANH
1,666,221,557 *AF5E3FAD50FA242FC99027BD588C021769185BDE NOBLE.BULOCK
1,666,221,558 *AF5C7AD0A278630394BEBA7FC77ECF15D4A8A41C MARSHALL)、K
1,666,221,559 *AF5109D0AA8C38ADFC7887D38A72E159B0884656 MATTHEWROBICHAUD
1,666,221,560 *AF5029EA2AF55CC41935CCA32371CB3A5C341CF6 MATURIRAH
1,666,221,561 *AF5208F08326D38056A0B3E954132B10E65634F3 nuorisotyoettoemyyttae
1,666,221,562 *AF5DE5666B62A376D5D8D5005EE24D17F1187195 NZYDIFA8
1,666,221,563 *AF57CB8558D76E0C3526C2DF7ABD7639F280A4FC O16071992
1,666,221,564 *AF570DF9BAEE046CA0774F989EB100190B2F469A [email protected]
1,666,221,565 *AF5E9C94D6EC929C398F817BF492EBBEF6972E39 obuveno6
1,666,221,566 *AF530F3C8C322C36E1BD1D9A044D88AD821BE2ED oeykwcmw
1,666,221,567 *AF51C89387FF2BEFA7D7C27D343DE74B3CF9ED56 mercedes-benz-bus
1,666,221,568 *AF524B72755E6E0AB06A34B3F5207ACD3A4BC303 mesame
1,666,221,569 *AF5470EB0A52FEF91432079AFD0AE6600B303006 ONRONDHEID
1,666,221,570 *AF5C200109DA65979159419D6D5D09AEF8138C17 ONUZULIKEJ
1,666,221,571 *AF5E4675C2E7B6EE11DCCD68995DAFFCE69B575A }o{-o~-0~d##3
1,666,221,572 *AF5AAB8F6357BD71912FA94D475E14AB1853C526 oppervlakkig.
1,666,221,573 *AF5ECD228D92A9119F0D82CFEB52B2C83364AADA ORDIN
1,666,221,574 *AF58266DFC80DF02444290C16DBE034781178E9A MIMIANDYING
1,666,221,575 *AF54EE1FAB8D9C41648618C507E261F8119A81F1 oteviran8
1,666,221,576 *AF5288B4A8DA962E53E9EC6C431F12C7E4B447F7 mitchwright
1,666,221,577 *AF567079D6455807EFB638350D9C787D54FBFEDE MOHD.NAJIB.ISMAIL
1,666,221,578 *AF59D940DB7A87DFC6CDF2158BE9FB1FB0693342 [email protected]+3
1,666,221,579 *AF5A46BD0186EB054627441B231E9B87A9734E01 mönkäre
1,666,221,580 *AF5B7C9B1C8204CAD213E5A0AC4F89E258B32223 MORRIS.CASTORENO
1,666,221,581 *AF5A98F79A37F24D117C89FFB59BACBA6516442E mortimervictory
1,666,221,582 *AF5593C03D320367269329B4ED15288580F3652D MOSEMCKINLAY
1,666,221,583 *AF51E51B3B471D484DC1613FD4405031EABC6D13 MOSHESNOWDON
1,666,221,584 *AF5D5D89B80528334385480A13106DDD71870EF1 PAELLAP
1,666,221,585 *AF580A89639DF300282BAAF2B4F1CDE84810B601 PAMANES3
1,666,221,586 *AF5875A69CC35187C543732250ED984B2F0DD07D panteramelissa
1,666,221,587 *AF5E9EE56897A6095121FC3E3EF68C46523CEDFE MUTU4L15T1C
1,666,221,588 *AF54BFBFED63048EA25DC6E13F62F56C49BAEA7D MYNSTRYLSY
1,666,221,589 *AF526DB0E987D721D967C4D92E189C3A133FE373 patrickyazzle
1,666,221,590 *AF5A9EC89DF5A9BDF80BD6C2CDE2DB91D718F8E1 mysheba83
1,666,221,591 *AF5E7AA5589C46F75532654ED15A8525303CFA24 n20= /echo s
1,666,221,592 *AF5CDF33DF9F2A8DA397972712494AF3131D7D7B P######D* * splat
1,666,221,593 *AF5F6EB3B57028A3E0E8D19F9B94EAFBC92E005C PELMA70GRAM
1,666,221,594 *AF57388DFF3003DF335080043E2C5CD6A4633796 NATHANCLIMES
1,666,221,595 *AF534E45EE6D37015A6AD126DA582F2F09692096 PENULTIMATUM
1,666,221,596 *AF5A56CCE45AEF59CE116DF2F6427B50B2AAB4A7 performansla
1,666,221,597 *AF5A0B1A82B345A0814E4D56BD961B9DD3DC128F PETRŽALKĄ
1,666,221,598 *AF5A814FE21C796CDF0DC21986368FDE22F48FDB phishaaa7
1,666,221,599 *AF5EC8D85781A7A4DAA6BA2479EA03DC8D1FF9D4 nein,.ich.glaube.nicht,.dass.ich.das.kann
1,666,221,600 *AF524F2AB17B0D0FEDB5A7594F1E1B478C9B7B10 PJ%X
1,666,221,601 *AF5F044E1EBAEA1321F6C79FC9F49C6E697864C1 [email protected]~o.(>_<)
1,666,221,602 *AF50F7CD31BF23B64657CCB7A64301AF4D002FF9 NICOLAS.CLAAR
1,666,221,603 *AF555F3E336D8DE49C955FF0548CAB15A4462C07 poetry1es
1,666,221,604 *AF557B7CDAED22D4DB9239C19A7F011788D59614 NITAISA9
1,666,221,605 *AF507788EF7C2C041BBA9683A1082D334121F2F1 pop-song-'89-(live)
1,666,221,606 *AF5668614E346F715925D6658FA5EB3B3B44FE73 PORIADKUMILOVNOSŤOU
1,666,221,607 *AF502B7405D21B80D32E3696F68C086B551EC15C NOAH.MAVAI
1,666,221,608 *AF542BACBA27FF8A13F890A75DEBA60BE6672203 potassium tetroxalate
1,666,221,609 *AF574F94CC989C664F9AD2BC5D5CECDD8E42D4FF NONCREDULOUSNESS4
1,666,221,610 *AF55799A2AB28966CA0CBFF420E9A385B496AD47 NOWAY:GC0305
1,666,221,611 *AF55F1AA59B790E97F4A9504F447928DD946681C NPOROBASHE
1,666,221,612 *AF5DB850ED002D8C0F53456E657C09078AB47B48 PRECIOUS.MONROE
1,666,221,613 *AF5947F6467858A601FD3E3778053CA1D56BE000 nrleulturgq
1,666,221,614 *AF55CC17B4DCAC0F240DE2661055FE3AB76CBBD3 princess!123
1,666,221,615 *AF549769E28D2493876A69F5E79973E49CF1361E proneness.
1,666,221,616 *AF594AFBD3223A1CC8FA36DFF6A1B21380D43BDF pryser's
1,666,221,617 *AF58A6A87C096B7C6BE2AD3F5EAB3E71AA92F289 q--)~0-~osplat
1,666,221,618 *AF564642B2BEB575D9952B571B96B67B524BDB2B Q917823
1,666,221,619 *AF54929476E946CA33E47BCA844CD7D6469ECA36 ONAICSAFED
1,666,221,620 *AF5CF4850C45C00C614748DFEBF9DC63EBF14009 OneNoteBrown(newversion)
1,666,221,621 *AF5D45092179548CCCBC6F0C830A31775D5EA2F1 [email protected]
1,666,221,622 *AF5AC43335B3C587B84E87102C124B6FC6EEAB06 [email protected]
1,666,221,623 *AF5FE57AABB7954C3DF25D0855604E5F20ED7E19 ONTHISDUB
1,666,221,624 *AF53DE23B355C72132C07E02DEEAE67F2300D8F9 op..77,.d-dur./.in.d:.adagio
1,666,221,625 *AF5DEA972160468ACBC16AB605A61AA95BB446EB q======)*.*.*Sploit
1,666,221,626 *AF573F36476E35EF79207C47921A241FD8E53A16 QUELS
1,666,221,627 *AF5FBBDC51E70A6196AC81EFB5E31BA3495877D1 ORAKELTA4
1,666,221,628 *AF5B0495D2C3E91C26A20A2040DC6BC13B7A4A6B ORCHIOPLASTYING
1,666,221,629 *AF57D040CC06A805C788670181EDFD7962B24057 OREN.SITOSKY
1,666,221,630 *AF55E6FD9716D4DE7E1AD3FFD0049BCDC4C94E68 ORLANDO.FONTEBOA
1,666,221,631 *AF5C81294958694BB31DF4E1AA91C11E9DFADE98 rabbit-in-the-garden
1,666,221,632 *AF5BC87B22B71631EB717E1B1CEFDBAAFDE9E8CA RAFAY RASHEED
1,666,221,633 *AF53EFCEDF72B5F16E26F5D3663C3EA54413B74C *raked*
1,666,221,634 *AF52079FEE5E3681A0A04EFD25A315D4B1AFF912 OUTW4TCH
1,666,221,635 *AF592F706D74EFF370F6835FA25E4B041B80A59B [email protected]!GU35
1,666,221,636 *AF53F4E2665F2E54159F13C9BBA6B47D645E751F ozzu
1,666,221,637 *AF5CD9F34842C13A5B1C01AB716303C6621714EB RAQUELTORIBIO
1,666,221,638 *AF5D1C48DA5FD6268C4AFC182F7E35D80D0612E6 RÉAGGLOMÈRE
1,666,221,639 *AF5D37C881817DE1966F52286ADFACCE40B3CFC5 PAPERCASE
1,666,221,640 *AF5B50F7A85300FA78A651BC4B9DCE242166136C parassos6
1,666,221,641 *AF55DF3A6E4FF0F38FFF18AF52D6B1874435DE9C PARTICAS
1,666,221,642 *AF5A9347A9769747D9241A6CA09D50C0AD58948A REGARAGEMESTER5
1,666,221,643 *AF552BACBF140A77527D451C6B154D01EC663C47 PATRICIA.JACOBELLIS
1,666,221,644 *AF5CF32E1E40E592790A6AD986A881DFACC0A5DC regimentsstärke
1,666,221,645 *AF53FF566EB6474213502136D74B00616DB4989D PCTTFOR
1,666,221,646 *AF5245AAA66E09F6B427BFC8B32C9A6ACB68DCA8 REORDERCHECKS-ONLINE
1,666,221,647 *AF5FE0A302EB36608D508FBC52E5667848E1A522 penberty4
1,666,221,648 *AF59FE1F86E7371E49DC8902127AE1C3113994D3 RETSKYBSW5
1,666,221,649 *AF524296112C4AAA61209FF10D6B250A6BC56BC9 reversibly3
1,666,221,650 *AF5B605A6C6211D21C8E63833420231D44F3B3FF REYBARRO
1,666,221,651 *AF5C5DE0992936B79B257FD889A013F976399E77 perigozos
1,666,221,652 *AF503A34204F55B9ED9A8A790693F1D43D2F7FA3 PETER-CONLON
1,666,221,653 *AF5C8C25EFF8C82C05AA6EE25B718B3AE79C37C4 PHILKLOKE
1,666,221,654 *AF507FFA7F8B15DD046A6A18A26ED95822BC9313 richjaggie
1,666,221,655 *AF53D12BD65152CF02976C2886FAAB89B65D15AC RICKMAXBERRY
1,666,221,656 *AF5E37542AB1DAB420AE4C4A87AE4D30FFD269EE rickytanksley
1,666,221,657 *AF5753C2EE63F321E71170F4BED91A757946398B RIC-ROSA
1,666,221,658 *AF53853892ABF898B5B5E33D878F9532100E5111 ridda.ahmed
1,666,221,659 *AF5CD75B71758A36FF804EC19C6016C518F1D99B RIFEBOOK.HTM
1,666,221,660 *AF57B05FCC93B3BC295E0F147ECAB1A4B669B69E RILEYSREED.RILEYS.REED
1,666,221,661 *AF52F703F7F83BB2B34A38436D2FE4673E35AC46 RIPPERTOBY4
1,666,221,662 *AF5984D783827E46E80624816994E24BA340C3DC PLUMSERED
1,666,221,663 *AF57EE13109EA6B8AC40DB9B15DDCFA30B9637D3 POEMADEOTO
1,666,221,664 *AF5B3AA08C465F206301C92CD2525BF9FB49A103 [email protected]
1,666,221,665 *AF5FE221E459790FF182B3A6A85E65D5006CC535 POKUDILA8
1,666,221,666 *AF5B2FB388ACB89BACBFF76B5CF9240B646A881D POLLAYBSW
1,666,221,667 *AF5008DCFFDE127520E0E416F0EC6B3E673C8303 [email protected]~o ~osplat!
1,666,221,668 *AF52990A0501924A72F4BA64AC0561312BCCF05C rogeralexande
1,666,221,669 *AF55D096BCDCB8CDD38FFFF9E18BDEE2007CE967 postback
1,666,221,670 *AF5BD75678352F05E227161F992F9F0AE66FBAE5 P###P~0-~O)0(
1,666,221,671 *AF574D2CDFDDD6E624390F3206D2EA9DD10DBFEA pratyaharacitation
1,666,221,672 *AF5218393FD3E7E37288040544FC5D56770AF827 praveengomes
1,666,221,673 *AF57132FE2AD042C911B4C10310B282F6D7CABC8 RUDY.VANPOUCKE
1,666,221,674 *AF5EB62D979663C6F4928170B6F655CB05A01BEA ruebenmahe
1,666,221,675 *AF5B04C8C005DB493A1A4649BE8BD8AD989DDBD9 PROTELANDREA
1,666,221,676 *AF5DBE3CA3EC3811C2FC905BAC5C70E9289BA60B RUFUSROSEBAUGH
1,666,221,677 *AF5FF76E77F7C40C5CF9DBAA3481B55AAA19D3B2 PSYCHOM3TRCS
1,666,221,678 *AF5EFEB353DD88A4C0C4AEB4EB6456F3D59A98F6 pyrzoq
1,666,221,679 *AF555908C5F95B81BB68D602E804AAA14301CA5C [email protected]
1,666,221,680 *AF529E830CF04AA9BBF56DD2E4C24ED36198A9BF Q--)-*)O(
1,666,221,681 *AF5693876CF5B9F2715F0109A220F5EF041D46BC sanhazama
1,666,221,682 *AF525C9135561E4C8DCCBEFD52A5244E5C82C2C0 SARAHROMANIK
1,666,221,683 *AF55DD35E9D3B75C35520F9CAE8B25C4DAC3117A SCJ007007
1,666,221,684 *AF571E32F876B9C8CCCDB47A4F4B0B631C9EAE36 SCOTLAND ROCKS (DISC 1)
1,666,221,685 *AF5B9874E7DFCC60537E71C396993D5989502E42 RAD1O53N51T1V3
1,666,221,686 *AF529DE3D2B15FD7EEC10176BD120ACE16FA0C7C SDINOCARB7
1,666,221,687 *AF58214D4A35D16CEA93BE5AAB6CCB209482F184 SEA_LUCE.S/I/_L/U/S
1,666,221,688 *AF59976D9BE36BE35AFA6DABB20465B26DD43629 „seeliger
1,666,221,689 *AF57A324381EDE06C059E7592E8497FFECFB2514 RASEUX
1,666,221,690 *AF515B6F68F3F239187084F29DA8DDCAADB2A087 SEMICOLO8
1,666,221,691 *AF597D3EBF8BC64E91CE5AB3C7B939C4EEA09914 SERVICIO-AUTONOMO-DE-IDENTIFICACION-MIGRACION-YY-E
1,666,221,692 *AF51AD292C7569CB376C0F4702567C37F842FF78 SESREZJIRETUALK
1,666,221,693 *AF5B8C03C3306CB9CA959741FBF768EACF1B64F6 RAYSHULTS
1,666,221,694 *AF5B6E7A0EAC243E72722AD65A7F7AD4AEDA641A razzia's
1,666,221,695 *AF5C7D23777C36FDFB420FF5991F31FF4D3B08E8 rdc2424654.nyroc
1,666,221,696 *AF5B2DA6863CD32C7A4DB8852AFA992EC44639CC rd&nilslandgren
1,666,221,697 *AF540D335EAD182D1EFB0576E0EC519EA3FD39CE RECEIVINGVING
1,666,221,698 *AF553405057D99486D3710DB090EF1B7C27F0D6C shalier
1,666,221,699 *AF58B2D9707B3122D7A253F16722E57D9F9C2B86 [email protected]
1,666,221,700 *AF515672F22FF93A89ACA9418C17EB8F13CF974F REINALDO.SISAVATH
1,666,221,701 *AF50457A1655BD14377411F6EA9ABF12330CF726 SHOESDUNDEE5
1,666,221,702 *AF509F485FBF33C178451539187BBB9AE87BF2D4 shooterstever
1,666,221,703 *AF5339F8D3337B9AD3B45165B45DFEC59F0AF97F revolution: an operatic first
1,666,221,704 *AF5063A2D759E38DA25C1D2C8E7C0F7D164146FE siyabongamathonsi
1,666,221,705 *AF549DD9DC4AFC2F223C202A6818F6BE9CFAC37D SNEIJYT6
1,666,221,706 *AF571CF16AAE741A86ED0D4622510B2D75E8DA9A SNEKETLA3
1,666,221,707 *AF57DCC8B244BC1CB07EE292A69CA452E113F8A7 SNINGSMEKANISMERS2
1,666,221,708 *AF5D4A54E87EFC5B59094BC0C97DFA88AF7FA2E8 [email protected]
1,666,221,709 *AF54183C99B5189725EE3394798F0D5A8F7940B3 RNINGAR-&-ILLD
1,666,221,710 *AF5DDC5C5654CB35EBE14319E418F2D78FFA39D3 [email protected]
1,666,221,711 *AF545FCA0C0A7DFBABDD0F2F470327E253ABDD99 soldier16
1,666,221,712 *AF58FF7855418EF0884D8FF876A533C52C9069B2 SOMEUGLOF
1,666,221,713 *AF50F34DFF2F2A059457DD141C686FEEBA5C3803 robingarrish
1,666,221,714 *AF56721436F30F0B566BC905D914965F6B8A8A6A ROBTVENTRE
1,666,221,715 *AF597E0C93F5324EED0C5EF27B8F18F1ECCA9B7D roderickbalaski
1,666,221,716 *AF51020D39D63623BB5C3BB8FA13072A86A00FF4 rodzeck
1,666,221,717 *AF5D42DE2FC6390222A7D801EF2689F2DB863E43 splat 0~ @p
1,666,221,718 *AF59DC4C661DA6D426AA7C08A1A8E684A0FE11FC SPLAT*<------B
1,666,221,719 *AF5A87600A6F55E536F2384BA93CB343C5B03B3A ROSENDO.SUCKOW
1,666,221,720 *AF5FAC1897875F00E0353741D6C0C2FD8B7AB77A splat*-*@#####q
1,666,221,721 *AF5BE37DCB448893536DAE2234155A7C69F1800D SRAMTTIBSEN
1,666,221,722 *AF5E0677BA98122C5779B70C425FE95DA2E3FD45 [email protected]
1,666,221,723 *AF5F67F174CE3D26EF7D4492D63945F907538E54 SREPELEB
1,666,221,724 *AF5F42DE440557CC692C51E0488184D883544AB8 [email protected]
1,666,221,725 *AF5884A0E965820946FD67EFFA9C828A9632CC4F ry-gab
1,666,221,726 *AF5A76FBB9488A6C2732EB7D02ED0203EF3CF21B saffronhill
1,666,221,727 *AF50D0CCFA09603AD0F9D3237EE9BF42740E7A92 SAMEERKAKAR
1,666,221,728 *AF5F8E352D17E489AC0E8DF46EBD99749843C47C [email protected]
1,666,221,729 *AF56C7FB868E4EE8D7D711ED6017B2127D417193 SANTOSDEMICHELE
1,666,221,730 *AF501DC5AC32D583924FF3A04A4529234C685916 SANTOS.TIPPINS
1,666,221,731 *AF54E1FD669FE6744AF5939B84DACF6A34DC48CF STUKGELE2
1,666,221,732 *AF5EF3B5FC9859D81922A7ED47C247E8FC534CE5 sukekleininstrumental
1,666,221,733 *AF515D0E609AFD4194234E4436051E1BE63E8712 SUMMERH5
1,666,221,734 *AF569257FEE3179A0FFD2509CDEE7FBAC631F13D [email protected]
1,666,221,735 *AF580DD1DC6CDD71AFB1A381237AA46603865AF1 scatterai0
1,666,221,736 *AF57751C7BAD99CCC39F65322DC354ECF3B7CE29 SUTETCIPE
1,666,221,737 *AF5B3CBD1D5077438C7C8247684D45B5C8245057 scott-ferrante
1,666,221,738 *AF516168049C61AE3DB966FCBA7257F625449C34 scottmccrossen
1,666,221,739 *AF55B317810CC9FB48F778CE23ADF580894F7921 SCOTTY.DYDELL
1,666,221,740 *AF50D381ED3CD83AAC40C5AD6CB3B542114A92DA szydłowieci
1,666,221,741 *AF505C962EB7C8A5627EB91C81485D99CDABDD2A TABBYW3A
1,666,221,742 *AF554BA1875BBE15F31C306A212C7711719FE6EB TABELLATEMPLATE
1,666,221,743 *AF5B3D5DD311AC1199A54CEC229CE73CEA469260 SEHCILSS7
1,666,221,744 *AF5C3DFA16FEA6DB5102CBD5E067226CAF0FF437 SELLABLE
1,666,221,745 *AF51D03DB660CB8737F53B4026FFA12FABD968AF SERGIOYASINSKI
1,666,221,746 *AF5F0DB3B595540FF3837C3D4919A931C3755C4E SERIEMEUBELEN5
1,666,221,747 *AF5401B7E7219C673A1454311781DB5661F7A988 [email protected]
1,666,221,748 *AF526ABB880F4EDBD89DE26C7ED90F0AF8715632 [email protected]
1,666,221,749 *AF58E8887EAF49DD8DF7B7C32610CE82C796D4CE SETH.DALIN
1,666,221,750 *AF56BDDB0F95FC2F7DAAAD9224DEB7C9BC7E5568 [email protected]
1,666,221,751 *AF56522D6A537E3FDD4736537CE2758EBE6A6404 TARVITSEMISTA7
1,666,221,752 *AF59DC367F516C0ECBDE4727E8865FF8C580AE4A TAUTAUPI7
1,666,221,753 *AF55C4C79BA54E82693F6DA6D782B86B1B268DD2 TAYLOR LOUIS
1,666,221,754 *AF5CD057709F893E4B0FF3E4AFB919137B8D14EB TAZESPACIO17
1,666,221,755 *AF53B441A408ED683C3FF1EA559AF157ACFEE8E1 [email protected]
1,666,221,756 *AF5B4FA477AC2924EC5068BE2988AAB478B37C4F TEA-EARL
1,666,221,757 *AF5E4296968A8897C187317B52681676B9EF36B8 SHADOW1DWIGHT
1,666,221,758 *AF558AED5695A000E5E4854E0CEF7BE6613AAC08 shalier
1,666,221,759 *AF58EAC1FCF10C1907EE1EB28609D9ACB3CADE97 SHALVA.2.0
1,666,221,760 *AF575F80156278F1446B58192B174DC4E22DFBEE SHANE.TRACY
1,666,221,761 *AF5B0CA799694B4964628CB6AC184630EA0CA368 TERACTIE6
1,666,221,762 *AF5B383638585933C2015028DA9421C10FEBCCB4 SHAUN.BEAUCHESNE
1,666,221,763 *AF550F2D9D8F9B23C14E0D30F2F42402D4E887C1 SHAYNE.GYLLENSTEN
1,666,221,764 *AF563FAE06D4BEAF4A1A92997ACF20D4EF9819F9 SHELDONHILTEBEITEL
1,666,221,765 *AF53015BFD86E926460849C6EDFADC5CFCFEF891 TGITSGNAEB8
1,666,221,766 *AF544BC8DD9DB9D26177C0D428FC82DDB6B0B22F TH3OR!Z3S
1,666,221,767 *AF5DA267E86E4D5A3D4B636E4D9CEDC137F5189A should-not-exceed-one-year.
1,666,221,768 *AF569C1EB1B2CFBA93BDA6B1B3AE9C688DCCD6AB SHOUZOUK4
1,666,221,769 *AF5C3B04BF4C25C7F9B164A8A344D9BFFAD66FA9 [email protected]
1,666,221,770 *AF5B0338700E606E9876966C9255E1BAD051FEE9 thehuey00
1,666,221,771 *AF520E48B5A2E6B9D5E5C421A5CF2EB802E52E74 THEMONKEY12345
1,666,221,772 *AF52C44D1959CA1FE5C549498BDB530EB48B625B SIMONTUDOR
1,666,221,773 *AF53F9A06A5827200DCAA099D6C27516C9B69473 THESTIMPY74
1,666,221,774 *AF51905294D41C5663527A064A164ED681C0E926 skrappeste
1,666,221,775 *AF58ADC3991D4C9DEDCF4953C0BB69FBF45D5EDE slentammoed
1,666,221,776 *AF54A67E99074D6A1E66A420943E3B1E698DCD84 TILB4GESK
1,666,221,777 *AF5071350619A0BAB2AD326F3C07173F1809B98A TIMETANNER4
1,666,221,778 *AF56A9DB00A0CEA9E093C4EB7A220E7B4121CC95 SMSAPSOYM
1,666,221,779 *AF56FDE0A645945F4DCF19470C0768137AECCC30 TISZTEKÉ
1,666,221,780 *AF521E471F16BA41B9E920C7ED41378810C29213 TLIW1
1,666,221,781 *AF58BCFB467D27375CB29A5D640552C643CACB92 TNEHCARRA8
1,666,221,782 *AF59BCC56512A2DB1823ECBA7A038529D55D4405 sonate-nr.10-in-g,-op.14-nr.2-'allegro'
1,666,221,783 *AF5D8EC2BC21BD6D99D9E1C7278E5B971D043C68 SONNYROSENE
1,666,221,784 *AF5D75DCCAFC9A7115045A8DB128BA209B6CDEC3 SONNYYANOS
1,666,221,785 *AF510D1F47E997D7B4459CF0D040BE6E2D99D75E TOOTH.ORNAMENT
1,666,221,786 *AF58B8186CE8AB6AA011C53508F0CA51A9A8AE4C TOWAGE
1,666,221,787 *AF54A454BDF277C53DB514F10F2BAB32CE04D419 TRÄNENSACKS
1,666,221,788 *AF52A52554D232886C61CCC783F442D796B92206 spilled-moments
1,666,221,789 *AF576B632357067EDA938718D34D07944900A83A SSENHSIYBAB.
1,666,221,790 *AF5278BA0A5547133C7C321A1294B02957CC199B [email protected]
1,666,221,791 *AF56030E4D76F3F14AD891BE8B1DA2041E5F55CD stansburyjr.
1,666,221,792 *AF56378B961CB3361684DDBDAB655E50ED82980C STEPHEN-CARROLL
1,666,221,793 *AF50467A6C140F9923F360E1133965255B2D5F43 TWELVE-HUNDRED-SIXTY-DAYS
1,666,221,794 *AF5A8C83E4EB39401F28BADDE7A443116E7E0385 STEVENCHILDS
1,666,221,795 *AF5A2A704567B8CA7749FD8FFB6035F404748D1A sthembiso-thabethe
1,666,221,796 *AF51FE256B627CB5EC33676C3D36B2F6E2482012 TYIMARTIN
1,666,221,797 *AF5AD0F3AB4C3F0FB9FE171BBF0DB891AD23E0FA SUBHO DEY
1,666,221,798 *AF50F7F131B989115BD9867E00FEBC68DA22D102 SUBODHSWAMI
1,666,221,799 *AF57318A9FC7944CFFA834B59BCEB13B2C079D57 Substrato
1,666,221,800 *AF5794C8F6794F4B3958CC228775C114A1D9919C ulpthuqy80
1,666,221,801 *AF54F85B67A9E1E0D292E116BBBF0DBC289D458B [email protected]
1,666,221,802 *AF5ED162031ACAFCF38F95C48650DD0DAD68A472 [email protected]
1,666,221,803 *AF542E88AA03FB98517E56D383C09CEBF695CABC UNLOTTEDA4
1,666,221,804 *AF5245FF8F15401C177153AE588A6233706529E7 UNPERFECCIONARER0
1,666,221,805 *AF5FA2131B24E835D7B8EBB34EB554E0FB605850 unsketchable8
1,666,221,806 *AF5A505F880B2D542A4DAC60B0D13C9616D68310 [email protected]
1,666,221,807 *AF59C7F262992F8DC01ED8FD283C7C3E774D8016 swethle8
1,666,221,808 *AF5743139335FAF2705C214D2C4163E408BB0B24 [email protected]
1,666,221,809 *AF566E3F115308E3070735D6BDFD9C67B14EC55C usatodaywb
1,666,221,810 *AF5889980786845EDD4EE97FD8327A193FB92317 /usr/src/linuxheaders2.6.3224server/include/config/compal/laptop.h
1,666,221,811 *AF564F44A3BD297A48A15A9E225388E26756612C UTPLANTINGENS2
1,666,221,812 *AF50CAEDB1C2423FA98122D8214470249DE3C1F1 v6cctrrh0qn9ej
1,666,221,813 *AF564DC5A7C796961B352DF2CD938505CAF0AE5F valentinelaitila
1,666,221,814 *AF56E8DCAB60968B75846FAD49EF25D8D6B40E4C TAMARAJESSIE1
1,666,221,815 *AF52AAD05A78EFE9A0AD90B9AEB9C368EFC50D8B TANAKAL8
1,666,221,816 *AF55ED74D97AA2D0AFC93C060191C33E6AE26A85 VANESSAPOLITEWICZ
1,666,221,817 *AF5BE582DA7393B1E47FE6C82E4074718C902ECC [email protected]
1,666,221,818 *AF58CDBF9BF7D80DAA72F932F39FF1540E1DC3B8 [email protected]@+3D
1,666,221,819 *AF598D2B4893FBA650E517BC1B9E68FC8AC9147D velociraptor.rodriguez
1,666,221,820 *AF53EF7B83886F2C52636FAA91661C62B9FB8E6F VENKATESWARARAOGUTHULA
1,666,221,821 *AF5FC62716EC1520081E9F1AF4F5649A5174DC8C VENKAT-GIRINATH-REDDY
1,666,221,822 *AF52357BC0EB949C339CF14A2449918BB416A05E teacherspamela
1,666,221,823 *AF52FEB09DFC69648A3A711147C174ED8E5AEADB TEGAN.MITCHELL
1,666,221,824 *AF56EFC98837E8000F4CFE8F858B6688D6232919 teimlwyd
1,666,221,825 *AF54175C92DCA13FD28675D717F176A8864C30FB TEMPELSALS
1,666,221,826 *AF592CAF9CDFFE93E644322FBCB953957AE716FE verpumpendem
1,666,221,827 *AF55B22B7C72BA85BDBE4948698D85A7DC39A6F2 VICTORYBETTY1
1,666,221,828 *AF50882CE706071887A6341BB979F1C20A774774 VIDEORECOMMENDATIONENGINETA
1,666,221,829 *AF56553924A2F420C2833ADF782F60093CD98CEE TEVEY
1,666,221,830 *AF58B656073DD956E27CE818A781403313A41F6E THANH.TEUFEL
1,666,221,831 *AF5F7588D042E0070FB6FCBF58A69009DA355B70 virginia-clinansmith
1,666,221,832 *AF5B94E554FD8BDA08933ECEE39EBA5472EE683A VISAGTIG3
1,666,221,833 *AF5E7E07474DA7CBA8CE79FC499853C8085C0022 VISHNOIVAIBHAV
1,666,221,834 *AF5A78FC2EBC9C1133A14F1B3FC1D27FDC76BA74 VITO-SPATAFORE
1,666,221,835 *AF5D556DFA6D04AD36228B31A2DEE49F521B3381 vlf
1,666,221,836 *AF566D5CB711A3EC1B92CD445A80EBEADC93E886 thepackard06
1,666,221,837 *AF5C29D0C80FF86369D5FDF51D5741D5BC2F2847 THEPRIVATOFSILVIASAINT1
1,666,221,838 *AF5D6D265DB2F142D81C1345A9B5E12D8561FF67 THEROMANABC
1,666,221,839 *AF5C6135A2ACA75AAAB8BC048AE862814AFA920D THERONMAZZURCO
1,666,221,840 *AF5985AB5E1114ED3AFEB465E3235BA1A5C44C6E THEROYAL18
1,666,221,841 *AF5A5EBE397D886C95409DC496DB39D20DDC4C7E [email protected]
1,666,221,842 *AF5570C2B783B35366902DC4E95816ADEA0C4618 vsunthari-ravi
1,666,221,843 *AF5D2CA2DC979106E5D40B8B776624E75097FEBE VULGARHYTHM
1,666,221,844 *AF58993B174381122792F6D43B8A0AF15E0012B5 [email protected]
1,666,221,845 *AF575524B00C76FD289B661B64A1643D5F232AC6 [email protected]
1,666,221,846 *AF590A42B335A311EFE5A5671611BEBC1704CC13 tiffany.milfort
1,666,221,847 *AF576F4E9E6D370F240A71C7E3CCC9B291964207 TIGERÓW
1,666,221,848 *AF50007B2D80DC54F654D3A2970FBC33D743D213 TISPELPOP
1,666,221,849 *AF5EC50AB02881E86D5C2191300F0FFCF54F6AB3 WAYLONHEADINGTON
1,666,221,850 *AF5001143189DFC18468D8434873B4ACA1887912 wayne.boyers
1,666,221,851 *AF5B45D67F83FCFF47C48D5941A698F3ABD57AD8 WEBSTER14430
1,666,221,852 *AF5837B26948922C4B6103A8667B8E708BF086AC WHYMAD
1,666,221,853 *AF58DACF4056509931CB7EA22D6E36FF634FB793 TRARIAMNOS
1,666,221,854 *AF578C74245980D379CEECB2F7395A57D4B7F15D WILBURCOLTHARP
1,666,221,855 *AF5448B353C87E6DF43813479C58442E9F7C7CE8 WILLIE.FAM
1,666,221,856 *AF5AD0F991EAB0B49069265884B6427297D4AB8C TRINAJOHNSONCOX
1,666,221,857 *AF5C161F2665C4E4D67AF3B6AE30144BB250AAE3 TRKERAMT7
1,666,221,858 *AF57725F5D3AE4D406AD2FD72FDFBF3819A0A337 troylammers
1,666,221,859 *AF50CC46961F42EEDF344CDD2D43921B98407A2E WŁACHII
1,666,221,860 *AF5E52C3E98909F15428B35919C270D19B44DBB6 WOHMOBILE
1,666,221,861 *AF519D9BBAEA9D7A43769FFB96B4DB503587DF31 TUOBATSU9
1,666,221,862 *AF578FF72C1523D2E81D5B67E7370DCD135BCD10 WORDARCH
1,666,221,863 *AF5B86E85039E8D04B163B10800BA963DA8E3BAD tushar.kaiche
1,666,221,864 *AF5FBEF6B282A8F06512C7FC597F33C7106E33E7 TW6U
1,666,221,865 *AF58A8AF679839055DC09D4376EAFDEF81A0E1E5 TWENTYONE-FLAMINGOS
1,666,221,866 *AF52456B83361F0B48437D79D12EF81AB8D1E48F [email protected]
1,666,221,867 *AF58F9D9BB2FB341C69C139F2E1356391F0F1BBD TYLER.OSHIRO
1,666,221,868 *AF5C2228095FE0887522A4F4F85896BA0948D170 TYLER.WIDER
1,666,221,869 *AF51D86D1CF883E8B8EABF3A4BFEDE7F5597B621 [email protected]
1,666,221,870 *AF5E8252F05F34D5EF2108B6D626E9A19013B81E TYRELL.COLMENERO
1,666,221,871 *AF5C55053B4152EB21AACADEB12C5C80D9F3B905 U~(`
1,666,221,872 *AF581976CF0278F8A8AAB61BF7088547C9A98327 U00DF
1,666,221,873 *AF58B53ECE2EA93F4F63D1986D2498A0DD673D7A U?CG
1,666,221,874 *AF53F3871FC297D016D830FFCDC95866EE982970 uectam
1,666,221,875 *AF5046C9D5A608B5EB4C87C66C6DE52768CF1B33 xanadunet
1,666,221,876 *AF5B4A06489F4E5D815FFE4479945D1BA7F542D4 XAVIER.VALENZULA
1,666,221,877 *AF513A5F6FEE46DB8E323BAA43BE351F65C62F1E UK'{
1,666,221,878 *AF5FE9E4394232F7E9E80D9DA76B05B5DEE59AA8 ULLIRAAK
1,666,221,879 *AF57A311FF5FCA467CA59F4096F3DF70B8675CA7 um8r493ou$
1,666,221,880 *AF5F48A6B012C815CD19F3934CB5925281750D9A uncantoned
1,666,221,881 *AF588E91DE60010BC5AB8EB9A24EF09C4C0E3195 YADIRA SANTIAGO SOTELO
1,666,221,882 *AF5273C144B483B357547EAC1F3FB966216FDA01 up in daisy's penthouse
1,666,221,883 *AF53823F043A657D7FF12AB0D3F3899EA0FFD53E USERTV316MONOBOOKJS
1,666,221,884 *AF5B63BB3B43E047480DC03745BE00BF8328A31E YHTEISPISTEETTÖMIÄ
1,666,221,885 *AF547AE4D694308A0FAFB9ABAD552AE68B02F9B5 YICONG ZHOU
1,666,221,886 *AF5853B26CC00CBB5DF9260A0BE20591C356A57D ustastvom 1
1,666,221,887 *AF5F510FF4DBB78208C3221E3E00BBCF00535E58 UWANTSAVINGS
1,666,221,888 *AF5C9A1891901CC6A17381FA1AEE7259684BA91F uznesenu4
1,666,221,889 *AF57BE746EC582217B60C55C72BECD063C1CEEC8 yusuf-murtala-hadegokay
1,666,221,890 *AF509C2144B9522B274A2EA76F6A6C2E6FC98E77 zacharypalacios
1,666,221,891 *AF5047328B0D200D57F0B1C4E46A1034098FD79B VERMESSUNGSPF4
1,666,221,892 *AF5F5C162179770E98D82E285CF6DEA878B8779C VERONICAHAGEDORN
1,666,221,893 *AF5C04948198652AF464A1EDCF56A99E759AEB66 VERTE.CAMPAGNE
1,666,221,894 *AF59A2881F9B57022B00A13BD0DD0DA5F5EC3E0A victor.jo
1,666,221,895 *AF53B9A2C2694C498F0D118C703D1A6FCEF283AC villa-de-ves
1,666,221,896 *AF5C82122909B61B2AB3B7A45650A0F1249F2167 VINCENTBAUTISTA
1,666,221,897 *AF599A6B4352476198BB3F015F6DA6B15A2EABB3 VINCENZOSEYS
1,666,221,898 *AF5F1038CE02537258553D098A26B8A0E7310454 viola.belemu
1,666,221,899 *AF55846288BA560D85193168AC2984BB331F8B01 VIPERJOHN8
1,666,221,900 *AF5927E2E3FB243E24E35536B41D883DE22775F2 virantses
1,666,221,901 *AF50F0C07CDEF70FC0A4573AC6F54629D6C49EAC VITO.HANNEMANN
1,666,221,902 *AF5D9D0003E8CD0CC22F1654DE0150F71C84BFED VIVYWHSU
1,666,221,903 *AF59E09E04DD9CB399908F02FEAD36B3C5A1BE91 εξήγησεις
1,666,221,904 *AF551B60FDDD1F061F3553B12EB9C5C5BCEE9B46 ΕΠΤΑΤΆΞΙΟ
1,666,221,905 *AF553D18CC4519C36CDBD6B56D35D6377BB4D932 VOLET MURILLO
1,666,221,906 *AF52FE278F22289F6901E5FA5612339791E78C08 VRAXYXRONIES0
1,666,221,907 *AF5C3A7825502FEC1517F16B9B36A2EBE1F3935C анчиффой
1,666,221,908 *AF5720C04216602A8544272569955096F52361A1 VYHLDEKED
1,666,221,909 *AF59C5F9F058449DC51A5430F99432149AB2586C дебарская
1,666,221,910 *AF54FA719A279FA6BD2986D60E193C5222873A41 ОНФРЭЙ
1,666,221,911 *AF5973381085578F693B5A453BE0D7D542E2BD24 WARNER.FILIPPI
1,666,221,912 *AF56A928B149BF2693ABC60C0B67A93FE6E0AF7B warrenfarlee
1,666,221,913 *AF56DC5B8E27FBAA1FAE37C3D296DA99242F771E ростен
1,666,221,914 *AF538A3A5E28E65415F5E9AE8FEA14EA51EDF7CB ТОРРЕЛАВЕГЕ
1,666,221,915 *AF5156DE09FAAEE96FB8A56037CE118A90423466 ХИРАД»
1,666,221,916 *AF560488C5ECDCD8E2ABB460582DDBE6166E0651 WEGSCHRAPEN2
1,666,221,917 *AF5933A6AD6220FBE1BFE6344307F79BE42A59DE WESTPHALIAN7
1,666,221,918 *AF5616DB1DFBE91899CB36F6506DC388BF7E5FEC [email protected]
1,666,221,919 *AF51C9424FE63439A7F30B9E82D93533BF2F89F1 を本拠地とするUSライユにてサッカー選手としてのキャリアをスタートする。2007年夏、ババカルが14歳のときにイタリアのクラブ
1,666,221,920 *AF5D837F016EC674EBF9A3CF2C0ECC686F6F9EC7 [email protected]
1,666,221,921 *AF5CD290B4D18C72670A17754A19CED4DCA4D2A2 WIEBODZIŃSKI
1,666,221,922 *AF564DECCD5C40183C2E1A8D0FE20D67DD9EF68C WILDVERWACHS
1,666,221,923 *AF5D6F3FD8016D03A8DD3749D8166FB6A8BED2B9 WILFORDSCHREIBER
1,666,221,924 *AF5DCF6647CD82D6FC5DC73D70A2B848DC990432 WILLIAMS.SCHWICHTENBER
1,666,221,925 *AF5287172C289C31D8846569445A436B91515231 WILLIAN.MEIR
1,666,221,926 *AF59F32868A915ED4405BB8B6C2379A581FA3180 willsenner
1,666,221,927 *AF58269A49B8A5B9D440D35AC7A059BB3A419524 WINFORD GILSTRAP
1,666,221,928 *AF51F341505C1A43338BDC3F8AF89BBB56B33BAE WINFORD.HARDCASTLE
1,666,221,929 *AF522AC86274E8611290A9A8BC01DE9C408CCA8C WINSKIEHAUTEA
1,666,221,930 *AF5F9EDCA5F2779292AD2C2E20FDE6306D5B4274 wordbombs's
1,666,221,931 *AF5CAAFB1E307A767F5894E29EB82D17A9EF7651 (00).o~O~.q==q
1,666,221,932 *AF5B5E9E4B7CA303FCB9ACA6D4B744304EE721C4 04121807
1,666,221,933 *AF5810E3CE7E174B5E3995E36B64F9590A224C19 WYKRE
1,666,221,934 *AF5100DEA0D735703CE618F5CF31261B99145A92 )0( o~ 0~q8
1,666,221,935 *AF583165CD255CA8E3D5DA61C7EADB36B3029AC9 [email protected]
1,666,221,936 *AF5F3F84E5F5F50CD69DC081BD3214F714C543AB [email protected]
1,666,221,937 *AF592B8A8E34F06CAD3A14DF806D929861CA6F54 1278180 DANACH.VERLAESST.DER.PREMIERMINISTER.DIE.NASSZELLE..
1,666,221,938 *AF553C30F1845F3B3E7E5F486E03958D3487D402 XTERMINATE.(CLASSIX.MIX)
1,666,221,939 *AF545CCED7BD9F03A4861063B3E8D072C8F46B3B [email protected]
1,666,221,940 *AF5F5A10B4C8960AD66CD95AE986992CC715BB22 1392158 cardovoittioulunarkkitehtiosastonkilpailun1112
1,666,221,941 *AF53DA4E8B8358BB30C51C9E484180EEF07260CC 14me2ok
1,666,221,942 *AF56747828FF385688B4F1F1A120FEDE93309A5A 1579667 mexiko-city ist eine stadt ohne anfang und ende
1,666,221,943 *AF59F059AA1EE6B477D8019C8482D96F55EAD567 15FEBRUARY1574
1,666,221,944 *AF52CF3C4D4FF96F6C12276B352D6B924F3404B5 yakuhiemas
1,666,221,945 *AF5CA7398270CA44344118CB02C4F99D35E273CA 1712872 CONQUEST-SAID-IT-EXPECTS-MEETINGS-TO-BE-HELD-IN-AUGUST-.
1,666,221,946 *AF555608940EE0B9E50C3C50E6313C017ACE3513 181nv
1,666,221,947 *AF5A6655998156B96FBBB2E3FDD446B8C2E010AA 1838694 viive piirt
1,666,221,948 *AF578414C9BA273049BD0E480BF00A62370CA1A9 1929629 MOST-OF-THE-SOUTHERNERS-ARE-CHRISTIAN-OR-ANIMIST-.
1,666,221,949 *AF51DD90B88B881731D1D862AFFC5BD5D84A75A1 YEHSFIL1
1,666,221,950 *AF53F5280A42306ADA95D115E6044D9924F3F750 [email protected]
1,666,221,951 *AF5F3A1A6A0E78DBACEAF48E245B9F16BC7A5541 1-agentur-geschaeft
1,666,221,952 *AF55E5DA486E931FCC6CF6F814AA0AB28F04B5A5 1.ALSOATTACGRUENDUNGSTREFFEN
1,666,221,953 *AF5E1B3D485197935601D8D7A2832E6689704ACC 1AMBULANSSIHENKIL
1,666,221,954 *AF53BFE4D24E31DD39A0AB40E63D7A8D84C4117C 1BAECKEREIKONZERN
1,666,221,955 *AF5CA24DD9BF3DF0F1A6FFE5B719BD02FFE57E47 1-bluetenteile
1,666,221,956 *AF5EE73474209C2E9DFD484855B198E2F6D58C1D YLENIA-SUAREZ-GARCIA
1,666,221,957 *AF54445C1B3C721DB33859D5707C54B065568E85 YLL7TLAAFITESWBQTR2YDQ
1,666,221,958 *AF5AF0C6FB839A06F0BD6241D5BBDA5095FFA824 1DELIGHTS
1,666,221,959 *AF52291E325CEDB5F4B836953B27B6D246CB54F0 1.diaetessen
1,666,221,960 *AF55C35F8E5BFE3677F2C4889C42936C399C3282 1echizesinin
1,666,221,961 *AF51034AE19F4D446B3783FE011262ACAB84AD59 1GEDIMDEN
1,666,221,962 *AF516C5FD2BEA98D5C840B762BCC8E319E1BADC8 YOU-WANNA-KNOW-(EXTENDED-ALCOHOL-VERSION)
1,666,221,963 *AF5C10DA7C19D4C3BB97F4D9ACF45C66C523B0EF [email protected]
1,666,221,964 *AF558AD1B6033106D12F1D4524223C723A179676 1kontrolbit
1,666,221,965 *AF5869FD5C231DD99B8FD21C8AD63D032251BE38 YUSMALIA.YUSOFF
1,666,221,966 *AF5C13012FCEB2898CD44FBC4468DBB874A4591B zacharymaiten
1,666,221,967 *AF5023B7EC56A87120B3C240EE7445FB63CBF255 1-nokkoss
1,666,221,968 *AF5C02461BB867E794EC65CA72AE15D60E30C02C 1OPROBANO
1,666,221,969 *AF599D0E23CCA67D7775BADFB885D901520D0D16 1-ozgurlugume
1,666,221,970 *AF5636BE9EEFB837861EF0D04797276BF873D540 1.PAHVITAULUUN
1,666,221,971 *AF574F785A4C93895A77D0859D747E8421D9A923 1-SCHauNiG
1,666,221,972 *AF5058C557AF78F45CEEA1BEC0A300AE755BE1CC 1.STEVENSODERBERGHFILM
1,666,221,973 *AF52C2275498EBBE571ED65AF2B659627104B451 1-taajuuskaistoja
1,666,221,974 *AF5DB8EB100BD8765C22D3C98FCA315AE7644A3F 1 TENNANTCHRISTIE'S
1,666,221,975 *AF538593277DBF299F87E964FD92F2E188F86C6F 1-top-shopping
1,666,221,976 *AF5AED5BFEAEECADAEF5A804E966E818A2FE03A0 1TUKISANALIUSKAA
1,666,221,977 *AF58E23FF19FC690977A04670229DBB7270B7906 [email protected]
1,666,221,978 *AF56599E916E7863718A0FA627C70788692678E9 1.uniconcept
1,666,221,979 *AF5B05932EB41E582FAEF564808E71C1124D2821 [email protected]
1,666,221,980 *AF53FFD62182D73187025E48FECEF079E4CBA36B 1VAIHTOKESKUKSELLEKIN
1,666,221,981 *AF5868F5E8C7BE0E70827CF2856D8F868E34DD02 1-VELES
1,666,221,982 *AF5858D64BDF760DF8FBB7F1293F69AA5D9CFCD9 1-WANAMAKER
1,666,221,983 *AF5C4AFB2815FC44DA9E0A1AC16A993C394CA0F8 1.wanhahko
1,666,221,984 *AF54E182EEA466B88D31898E89705EDC74C84804 [email protected]
1,666,221,985 *AF587C37D5DAF52FD52318BB6B35F9723E7B819D 1 YKSIL
1,666,221,986 *AF5D865AA921C1C47952249BC617A410C72DC197 2052850 sosiaalisen-myrkyllisyyden-elementtej
1,666,221,987 *AF5FB2C613FB0ECABAC8677EAB9E8052477088C9 205875 SIZ.VE.YAKINLARINIZIN.KULLANDIGI.ILACLARI.INCELEYIN..
1,666,221,988 *AF5F48F49C10D7D0D8AED36094B0A77DFDAD76A7 258JAYLEEN
1,666,221,989 *AF550605A6CCDDFDE98E4DE7EE10808A5E59723B 2664454 ENNENFUKSIPASSINENSIMM
1,666,221,990 *AF55E7B3AFD628A7F0B0FAC3BC28345C9837C58F 27TRESORSCHLUESSEL
1,666,221,991 *AF5D41B85CF8C54BBD6EE86815A690E727A6A553 2803994 wie-ihre-kommunikation-andauernd-verunfallt-
1,666,221,992 *AF51D3331C015865CDD2A755B00073A65543C7AB ΥΠΟΛΟΓΊΖΕΙ
1,666,221,993 *AF5E732BA5649576F8496CA6979D2C262AE02151 БОДКІН
1,666,221,994 *AF526DBFC702A6ABCA3FDEE3D8603ADAB8FB18C4 2-DELTICS
1,666,221,995 *AF568242F4E02F0F915201255435FD508DC95220 2.FRIESEMACK
1,666,221,996 *AF51C4A1CE4662642D1C226CFEDFA4BFE090D65A 2HEPPOISAA
1,666,221,997 *AF57B5A2C5BA6EC13B458219C0FE3F62066BF223 2JETLEPA
1,666,221,998 *AF5A083A4F8F9BE340495958CB8EA3A18D891A51 конуфи
1,666,221,999 *AF58FB5CC5B35404746E0CFA1605233152837F5B 2NORCIMO
1,666,222,000 *AF5CC5726BE2C06C5853D333DC29FED6DD5EC6B6 найімовірніша
1,666,222,001 *AF5316426B3A784421CF514AD4EF936B8517A55D 2telekomdienste
1,666,222,002 *AF583ADFB9275D3E2D939C9906500AD52E7C14BE 2THEGINGER2
1,666,222,003 *AF5222DC4C0C2095A6C62DA184655AC48CA7F148 ТĚРĚ»
1,666,222,004 *AF56EFBD28E22F2B6C0CCE2EBACDD6A49A5882B6 3.aald
1,666,222,005 *AF5F310C0D2F28A8A49F5AC14FD09BE47013C87D « L’AQUITAINE »
1,666,222,006 *AF5E67D58CEBE333F4CBED2D2B440B8FCC6C6D8B 3BROFFORD
1,666,222,007 *AF5F3CEDCDE6A85A4E848C593EB494385B6971A4 3.DOG-UH-I
1,666,222,008 *AF58B57B72B4FB29E3323F1554D97699BEB6EFE6 3HELLBELLE
1,666,222,009 *AF539F8D2128FBFD418B30FCAE4AA2C0964278BB 3NV3LH4QU3M
1,666,222,010 *AF51081B30F292F55B4C88C219893B8E21126CDA 3=).~o~o.(>_0)
1,666,222,011 *AF5127A0894B7673917D3D02824D5CB0748B8810 3theprincess7
1,666,222,012 *AF52C9AE8A1ECED6A10269554899BE71EC7BAC6B 442278 `.kapiyi.acin.biraz.mal.alalim.'.diyorlar..
1,666,222,013 *AF5DB1867AB03540FD8BA8C95472A51FBD1A09DF 4444TROUBLE
1,666,222,014 *AF540C4CF349B7589DB9D362137C4602CE9B2A35 465clayton
1,666,222,015 *AF5703D39E0E777CD55CEC1531E6454D5B174A78 47 n
1,666,222,016 *AF54667BBFF7742093D27BB7FDAC721E80C0F109 4 APPLEBY
1,666,222,017 *AF5E7A7030D283BB31D6C5FDD1FCA8DEF36DBC42 4FLIPDANNY
1,666,222,018 *AF514A02B32CC2CAAC9C1B2886B945FC15AA4E31 000000ELECTRIC
1,666,222,019 *AF53357981090CBCD530F859B587FF9C5ECB34B7 072374
1,666,222,020 *AF5FE0EBA220B15D0EEB69FF1EEFE3C15C907425 121093A
1,666,222,021 *AF591394E2B021551554A53C455FC9F20581EE49 1361392 energiatuotannon.aiheuttama.kasvihuoneilmi
1,666,222,022 *AF52D82FAD55B74B2643D3144FD5E4DC47773E69 1493439 muitamainintojaheist
1,666,222,023 *AF53FC4F83D3B47A31368B1193FD1CD2BB4E1E3C 15FEB1472
1,666,222,024 *AF5FA3221FC7817D42BB2F8E4CAFE0F7A06CC896 19832 tunninajanvoivaratasamantienpoliklinikkahoitajalta.
1,666,222,025 *AF53A49835AF5B515DA6DAFEC926BBB454D5E712 1992condor3
1,666,222,026 *AF539926776322CF77B29EBB459ECD6054B0D89A 1ceronen
1,666,222,027 *AF51E318FBE1C96A04DC0F333F86B4DD9D337D16 1-fishburnen
1,666,222,028 *AF5F6CB9AAD29C737E936E9094A9E4BCB0509695 1-JATKOKURSSIPAKETTEJA
1,666,222,029 *AF517AB8E89D7EEF373461E164FD9DB11B9C4812 1JOUGASIM
1,666,222,030 *AF506A3007F2D0A17946A6114C1A2BA1509477F5 1-matkakorttiyksik
1,666,222,031 *AF5B0F3BB281398BF8D4B58F4989B8F4E8660875 1MCAULIFFE
1,666,222,032 *AF557E3789044AC99B93750EA963C4D5D65505D9 1-oppikirjastakaan
1,666,222,033 *AF54C3BEAC0C7A73153760C8AA1786E8E8C977BD 1 parkplakettenzonen
1,666,222,034 *AF5135A32A4520557F7A51AD19B0911EC98E133A 1.pontolonlarInI
1,666,222,035 *AF5ACFBF001F92C85FC111268639115665E0F5D3 1POSKUPIM
1,666,222,036 *AF57BA3F6A3084E025FF98ACDA3BBB48D23ECE15 1-talousrasitetta
1,666,222,037 *AF5AAAEB734BFCC323D62BCA1A5D211703E415AD 1URAKKARAHAT
1,666,222,038 *AF53B6D3D4816B4FF17B94698B9AD2078A183538 1-warenueberproduktion
1,666,222,039 *AF566A1C87020F0D7AA2D004C8DA1C34F1990CDD 1 YKSIL
1,666,222,040 *AF561AD153F62ABD703C9C3CC0000DBCFF3679CD 25.06.1380
1,666,222,041 *AF560DC7EAF926BC6140577112349607672562E1 2852671 baltic-median-ja-hansaprintin-yhteisty
1,666,222,042 *AF5F7F52C72D766D15519B250B6F62455F2A5376 2.AIRUEENA
1,666,222,043 *AF5B09680CD72E15E4327838982302EEFCB49B6C 2ASSASSINANT
1,666,222,044 *AF5B3AD3B9F92070D5548970209B64DB820FC5A6 2BENEBELND
1,666,222,045 *AF57ADDBD188C4A1682C48E156785D746632C99F 2DASANKOP
1,666,222,046 *AF5E5D83C06C9BDE21146BDC1868517FE5DCC783 2 DINOSAURIERBUCH-AUSSTELLUNG
1,666,222,047 *AF55469AEB832CE13155E773A8FE4325E38DE0F8 2ftonino
1,666,222,048 *AF51F5525B010F51A6BA58E752497829A4F2FAC5 2.PUNK-SKA
1,666,222,049 *AF5E0B68C9DE7EA1918BF829B66A1E4E67731D25 2-SUBSTIA
1,666,222,050 *AF5C0B9ACD85242B81100BF67CB3F475D25FB342 2TAKAAAJETTUJA
1,666,222,051 *AF5CCE1541A322C838F5DF96FC97826C217FBFBC 2 unterstuetzerunterschriften
1,666,222,052 *AF54279A2189E1988AEF8C868E612D34572412B6 2walter2
1,666,222,053 *AF55C08C9121E5D9AB16846051094EC9C47EC333 33DURCHZUBRINGEN
1,666,222,054 *AF5B812DFEA98F59E962A720C11C384A98203D94 3ALUGNOB
1,666,222,055 *AF571A0DFAC4335F983AF450D1CBEC9A3A524D46 3B<O~ O~(====P
1,666,222,056 *AF53A4167C00D2703CA871BBAF8BB140CF5D586E 3b ~ ~ ~{x}
1,666,222,057 *AF53CA18E37981AD53E702DC64029E351CD67538 3FORKORTN
1,666,222,058 *AF5786F3AE584BCE68815BCB64570C5D5A6BA6D2 3IOYLIANO
1,666,222,059 *AF55EEF22FE37D4E58C7FADA3DAF95E90C5A0BE2 3kreisgruenen-buero
1,666,222,060 *AF5FFB2CBDA6DFE430BB0E327302C0151159907E 3-MEERESRIESE
1,666,222,061 *AF548BCAA9E5F3EBBBCCB718694DF28C3E428024 3MYDIESEL1
1,666,222,062 *AF574EAA70F7F280AD9045D3562A23BED448F1B1 3pannuhuoneeseen
1,666,222,063 *AF54A89F0C8A917B9C164D2730B869F7E8B6ABC5 3P~.~.~.SPLAT
1,666,222,064 *AF5426580C6805B10A0680EC65FA761E64E74825 4APRIL1392
1,666,222,065 *AF5D68D16A8D558374A8C46EAC53BE18FF59FE4D 4cathrine
1,666,222,066 *AF57FA738332C428E258658EE84F101C41CD7E2F 4GRAYBUDDY
1,666,222,067 *AF5A569710CC52036F2BE08471C8169BDC46C546 4ORDERREFERENCE
1,666,222,068 *AF5A7DF10FE28C7D26754D308179503FA9CCF7A7 4RTRCPLTN
1,666,222,069 *AF57BD47D543C9FD7170F46B6CACA558D5FD0EDD 4RYHMAEPAEAETOEKSET
1,666,222,070 *AF56B459F53E17B9FAAD42BEE0BB723537F0796D 5BLACKSES
1,666,222,071 *AF51833035BE956A975924DA0D111FD1A07AD825 5CRACKERCRAWFORD
1,666,222,072 *AF59357C827A96E574E9AD10EDC0F2E79086ADDA 5DYLANMALCOLM
1,666,222,073 *AF5B67AF7775B1EF3A72E5E5369823748C77F318 5EPIMORFWTIKA
1,666,222,074 *AF5DA03159CB5E62F47FAA3E01C7A1EE8CE156AE 5ERABKREMNO
1,666,222,075 *AF5F36EFD2A370C7EC9AC0785D77B8DB9DC740F8 5RITJCQON
1,666,222,076 *AF555BDDA1AF2A674B82BF8252CA9F893C2A4231 5RSISVELM
1,666,222,077 *AF5E51322411F794A8B29ECCF692759187B36962 5SOBRECARREGAVAS
1,666,222,078 *AF5490CE678D91C6BE06560A9E8A147B0FF86093 5thebourbon7
1,666,222,079 *AF56A0D051AB5D0BF72111189DF7F3CC4AE716F6 68156 ESSLINGER-VERLAG-,-STUTTGART-1992-
1,666,222,080 *AF5CCB70853233DF1ABEDD1207F28E002DB13114 6ANIMALPUNKIN
1,666,222,081 *AF564C7A202C45C18B02E4D1ACEDDC3F657FC85F 6BSWARTATTACKBSW
1,666,222,082 *AF57B1C4ED62DE807FECD6F20B239DFB1554537F 6collobrierite
1,666,222,083 *AF5D7B9BE2DD26373E911943BFA96A9C98EE5B29 6ECTORESS
1,666,222,084 *AF54E0D7A2900ED1E0C821A910A0A4598F93D60F 6g0qfxst3dsdpila
1,666,222,085 *AF52B88D46793577DC6D0CAE6E7420619455FBD9 6IRIEBQXCCNW
1,666,222,086 *AF5F9BB5CE1521A1A0FC72783FFCE9446851A6CA 6landholdings
1,666,222,087 *AF53DB8F700C646888B87E8CBB4DDE204F058C7F 7DOCTOREXCALIBU
1,666,222,088 *AF589838F658FC633741B79FCF836BEFC9468A22 7ILOVESASSY
1,666,222,089 *AF5C75E8F33987FA58C8D05AC6DD032BAB457CFA 7.MILIARY
1,666,222,090 *AF5B71B18CABE921A4A7B480DE9D6646BE088601 7MOBOYIA
1,666,222,091 *AF5428D62915E7299EFBBD23AB974D4412D1E1B7 7 NOVUS
1,666,222,092 *AF55FE1CAD312BA4E8A5DC31A0C7ABF88176647E 7OSSVAULT
1,666,222,093 *AF5CDD31266C74A97C19D833920F6981EAB0A45A 7peppeltje
1,666,222,094 *AF58BA9D34F33F56E48143D8765DDD38864677D7 8AVVECKLINGENS
1,666,222,095 *AF556D9CD7715DC685A103567C900D49DD61B5B1 8##b.*.*.(00)
1,666,222,096 *AF5503CA2584FAA601DFAF936828C61857BC30C0 8--b-*-*-*)o(
1,666,222,097 *AF5FDC1324B657FFDAB03EBDDA35B1B940D19F56 8EVROPANOVYM
1,666,222,098 *AF5F541BED099C7230EA21565A8EA101170BF1CD 8FESTADE
1,666,222,099 *AF5BE22706C1A23E8DFBE451A9B426BE8DEEF34A 8HOLTMANBSW
1,666,222,100 *AF503178D6C6ECB6631434759AC12890469493EF 8KOMPENDIERNES
1,666,222,101 *AF5FE3213EF50434F7F684F4CA3A6D99BC19DC35 8M741157
1,666,222,102 *AF53DAFCE3562E8C03445C6FF5343A71086699BF 8MUFFINALLISON
1,666,222,103 *AF5A655A88917C8F83C4A6B41C19913A205809BF 8STELNICU
1,666,222,104 *AF5DB9EBA95AC63D96CE800180D24EEB798EB9B3 8TNAMAGLAMA
1,666,222,105 *AF5CF1546CE49A9F1DE547F920B7D96926305191 8VINCENTKATHERIN
1,666,222,106 *AF52795CA65207FF9C7F224F8D626D5E5E0AF980 905569 ".macht.nichts.".,.meint.zapf..
1,666,222,107 *AF50D70A79CC920FF05EB5E135DBF72AE6433D54 9872HARVEY
1,666,222,108 *AF51DB4FA28D7AA1683B59EDDF27405B72B172E8 9OSCARROYAL
1,666,222,109 *AF52DC10785E6453EC640A3AA4D067D19ACFD84E 9SETUGOU
1,666,222,110 *AF572A573AA56FA3BBE341AC8FB1C28F683A651E a(0ce
1,666,222,111 *AF5287D08972132E11F209ABA13B0AF4C4360696 a1icu
1,666,222,112 *AF5016CC68E7203C63C26C838CED82DD9F16FBE3 [email protected]}
1,666,222,113 *AF56FB4A35C53FDDC7151A193DC5E1B44B0156ED AASLANIM
1,666,222,114 *AF524E669BB204F35268643F676CC85AFB5CED73 aassisot5
1,666,222,115 *AF5AEFF92A2B709C4BD799DBCD0F686CE43C6354 ABHAYANKAR8
1,666,222,116 *AF5235EDEF1796257C0B421B5CB454A748DFB79D about-afghanistan
1,666,222,117 *AF505439CC0B459D7875D00FA1AD65C30465AFA0 abystron
1,666,222,118 *AF57874FCF08226644BA850A6F1F5571DF5EB690 AFN#6
1,666,222,119 *AF57F6511DC7853453894724952A1CF5F168E909 ALEKSANDAR MOMCILOVIC
1,666,222,120 *AF53603F8B0BF637DB4CA7B0AA0E740851794DE8 aletter,thatshelovestheknightoftyre!
1,666,222,121 *AF5AC466F30179FBDFEB939025EE099555E0715D ALFONSOCRUZRODRIGUEZ
1,666,222,122 *AF5A00F55F0C19800D2B2F7A49179E5DB4DB3C4D ALINASIE3
1,666,222,123 *AF5E144735D3BCDA09016F1FFE6E3C39F7B845D6 ALLEINBENUTZUNG
1,666,222,124 *AF548863C2938B418C2DCB2CAC021D1D0E616646 aloqk
1,666,222,125 *AF5747387DE1F26819B3400AFD2447EB50DF045B [email protected]
1,666,222,126 *AF5757A8870BDB1C4366C6C112175765981A01C7 AMERIMNOI9
1,666,222,127 *AF53E2B220941F5265A2C37D8A55606CE131A7D8 [email protected]
1,666,222,128 *AF5BF8F7914779B436AF5E637C4ABF2798A0EDDA [email protected]
1,666,222,129 *AF5B266B203A0F5C4BA6660DF8EDF91C2F80B47D a?n$
1,666,222,130 *AF54A8C8660486143402657BE2F6C7E708DDF96E an(s
1,666,222,131 *AF5BBA9474C9F5F60B4B9E0DDDABEAFF3B128B42 ao3dz
1,666,222,132 *AF515EC45882BCCF3D453ACBDA02EF205A48D4ED ap_br
1,666,222,133 *AF5F42D724B7BFFEA2FF0D126657B4FBCC719AF7 A/QI1
1,666,222,134 *AF5733C3417CCEEFFEE224DE97D623414E1EC833 ARTERIAINFERIORLATERALISGENUS
1,666,222,135 *AF5EF75F36584DA6773C6E50E8164C15D11F031C Artistic-flair
1,666,222,136 *AF508B4CB80B9C85760FE5D29909A5A692B6F6D0 ASCULPTOREANU
1,666,222,137 *AF5F4219C3B80169F062A2C4C09A74C58A6EEFE2 asdfghfrodo
1,666,222,138 *AF5D0485149F8691D0D7EB99011B29362BF2962B au5400
1,666,222,139 *AF5D275C60C846F8D189237AA675997A60846EA6 awnwu
1,666,222,140 *AF50739A2059A225EEDC9B405824E46457BFF229 azınlıklara
1,666,222,141 *AF594F908A80E3AC7E5D9A795655662F83603D38 b0d3gr4d4bl+y
1,666,222,142 *AF5E30633C6C75503F2C936EC70038525113B2BC B3MV2
1,666,222,143 *AF5CF40F365088C3887E9C1FCE7DA7A2583BB9ED b9otn
1,666,222,144 *AF5E8E7C1B90E12FE1B554DEC4B90DF7C38516CD [email protected]
1,666,222,145 *AF576E62F71486C77AEFF1DF0B3A82B0B39A4F70 ballaadin
1,666,222,146 *AF526B7E019DE88F36342C3AEF2D126FDBDFA35D barrettczolba
1,666,222,147 *AF594A99DE6B6F0994993E6C95F88B9F21B80345 BAS(V
1,666,222,148 *AF529128BA8AD6346210CF7A97B29F0B8459EC39 b.d+3
1,666,222,149 *AF5693A3F377A909622C6453358E00EFEF2313A3 BDGk
1,666,222,150 *AF56A344411C72BFF1B956DD75EC11A770BE8B19 bentonzaza
1,666,222,151 *AF53B1C91F0865100B93EB9B273BCE38171ACF47 BERGSWALDE
1,666,222,152 *AF541650EAB06A883916F40017D842E964AA2594 berrussland,oder:einehardcoresylvesternacht,teilii
1,666,222,153 *AF5A3D57DF3544D5510E00E162AAD10A66E26483 bgqw)
1,666,222,154 *AF55F3F3B644F41C7AD8514DAE45FDB7B5C528A4 bigbill
1,666,222,155 *AF5D2F6F21A79594131087E4B6BFCA63D3E083BE BILLMCSWEENEY
1,666,222,156 *AF53312BA93CDC0FCE9D545CD1C5002B99C3AC85 [email protected]
1,666,222,157 *AF5FCFAAAE74B06D614D88A57D8A8C6F52F92A0A B-;k
1,666,222,158 *AF59687FAC9228CEDB9FEB9D9430877D764CDDC5 BNODNARB
1,666,222,159 *AF500DCDB81B9CF6B10B6067B852F74EF3795621 boulder67
1,666,222,160 *AF5E6E72386D0D1A8A8053658CD949C2806418FC b(rdh
1,666,222,161 *AF510435D816C68FB04D2ED78E7A7C7844D7AAEA BRENTONNEMANI
1,666,222,162 *AF5CB6EB230409CD911B84702F73330634E93AFC BRETT.BALSAMO
1,666,222,163 *AF5B4EF43FB618B33DBA7BE3F17ADFD0E9A08DC7 BRETT PURVIS
1,666,222,164 *AF52FCB4BF27657DF2B49A322C1ACEFB1D3FDF29 brucecapell
1,666,222,165 *AF554D04FC98DA3D0E711B193D34D97006216F57 bru$h.$hu
1,666,222,166 *AF5ED1A90FFD74FD93788D2B154CD756B5D174B0 BSTIMBERT
1,666,222,167 *AF57028B26CA09E856D2F73220DEE12AF66CBB6D BSWKXOGPBSW
1,666,222,168 *AF5D60E212A23E6BAE6EA55495ABEEC1B45F9F86 BTLFW
1,666,222,169 *AF5F71AD6FA08D98ADA64DC015980105E7B093DF bullshotses
1,666,222,170 *AF518981758122E7E44AD2C4A67B0AE7E3F29086 c0l0rw3a
1,666,222,171 *AF560A886C3DEF86E7722782B53EBDCE13E715C3 C5L/A
1,666,222,172 *AF5AE0EF55019F37F18F50B6BD67FE61F0021D5F C?a3
1,666,222,173 *AF5AA382238F17FB89797BA04113B75859AC26F6 cajun-three-step-(a)
1,666,222,174 *AF5FC43D811CD28EB13DDDEF3B50CC7517CAB37C CATHYSTUART
1,666,222,175 *AF5C7259CBB936AD2B66C5A11C38BF2F56F9C104 ce+m&
1,666,222,176 *AF578EE911A576EF7D4CCE791ACD07ACBA71E8B7 chernozyomny
1,666,222,177 *AF5B7B2ABD191159ED55DF08DD00F51097B87B13 cias7
1,666,222,178 *AF5E37B48D9B54D40A59D0E59D1A71471019969A CIRCITE
1,666,222,179 *AF50D46902373A8235C43F8CD59566041F2EBD66 cjvpa
1,666,222,180 *AF568C8C4F984C1FCB232D67022BBF99404F33B0 CLASTIRUL
1,666,222,181 *AF545290D348ED09E4CB684C4D7A996032EE237B CLAUDE.APPLONIE
1,666,222,182 *AF5F2C978B937F3347AE3630D590B45DCEA64EB5 claudsobczak
1,666,222,183 *AF5F74CE9CF88BAF5A35E20CEF441FB506944D8F CLAY.SEAL
1,666,222,184 *AF5C225585CAA8569F5F4F07959A462119ECD13C CLEVELANDSAYRES
1,666,222,185 *AF5974A51B127CC142CF98D3F3F2EC6603B9FF36 CLG0
1,666,222,186 *AF563DCA8BD0F490D2EC5BA4523E317E082121A2 cochonners
1,666,222,187 *AF5DE15DC2B0A6FF1E979BF5188970EEDA66EF42 C"OEA
1,666,222,188 *AF5F797ECFEC47DB99996F2CB23111AFC3BC6C19 COMPUTSED
1,666,222,189 *AF5F9D7DEEE36C7007B01D45AC46882D0024AED1 conejal1
1,666,222,190 *AF5EE2766F5A7C3109E7B5927178DE08A8234ADD contigo que pasa
1,666,222,191 *AF57CE47BC47640DF9D26555A171BCB50A1C7D17 COSMOSASDFGH
1,666,222,192 *AF58A8327C2830D022C3EC540FBD3F7615013237 C:\Program Files\Microsoft Visual Studio 90\VC\VCWizards\AppWiz\MFC\Application\templates\1042\hid_file_print_setuphtm
1,666,222,193 *AF57FFF21C4DA9FA9B0AE9AA23754846615AC697 cq.i$
1,666,222,194 *AF59270624F938CCB9FE36640B4B5180045FC0CD cq=l
1,666,222,195 *AF510C35C7F8A63BD247E2542316A048F2ABD459 csneh
1,666,222,196 *AF55AEEE12FEBCD15E33A859D3E54043FE337607 D(:#
1,666,222,197 *AF518EBF1101896C1A090F1732B615538A1F18EC d9f%b
1,666,222,198 *AF55CD01C7AFAABEC3FC7ECA8FC9B539E088106E DABTH
1,666,222,199 *AF58076A2FA0911C8DD8DAE900BC0745248FB905 dalecarretta
1,666,222,200 *AF5C0FE73AB8C450D76CE7FF4B44A4A98A747185 dalepluta
1,666,222,201 *AF561AA6C157C146C0208571BCA1AEAA8C69C1FE DALTON.ZWICK
1,666,222,202 *AF584162F5A277BB7BC4621A7CB3DC83A4B16616 [email protected]
1,666,222,203 *AF51C639961F0BC958AD71AFE0226EF453F41470 DAMIENTAFF
1,666,222,204 *AF54503D8D2F546B1C9DDF613B2A990836E4CA9A DAMIONMEIERHOFER
1,666,222,205 *AF5B1B78FB27F572FE08A78CC70F1EEFD8576E3C DANA.KATKE
1,666,222,206 *AF5F61188AE209F764D076CF705CBC90E2721AC8 danielnoftsier
1,666,222,207 *AF556CC710EDD3B5736C92FF1FF5A47513FA3C5D DARIUOSH3
1,666,222,208 *AF55429C2FA5025B20FF4C371B28690F39B84C63 DARIUS.LENZE
1,666,222,209 *AF541806AB54F14E3ED129545E7F90BC44DB2C40 darylturinetti
1,666,222,210 *AF581B7FEC5E90E86314DE24D15F56DA24AFF6BC Data&TheEmotionChip(GoneWrong)
1,666,222,211 *AF5E949DA09368157BEEC90356B45015CCE7F087 davy-jordan
1,666,222,212 *AF52BECCE958E9F4B5CF2CE30E3FA7B875CB19FE dayani.quiroga.berastegui
1,666,222,213 *AF51644B934FAD4603577297F94B342E7D47DCC3 d%-b=
1,666,222,214 *AF59F26A3C834BDBC796E923E24DFDCAC146F636 D/C0I
1,666,222,215 *AF5B0FC3C23673A83EFB20BA31B207A4FECC3192 DEATHBEHINDTHEDOOR
1,666,222,216 *AF5865F5C1E7EBE2C8659A7F51C0D95D4031F41B delbertramkissoon
1,666,222,217 *AF525C6811223CB16E7267860B44BA199088C8F1 DELGDE8
1,666,222,218 *AF5C3628F0EA174C1E790490A2D75F1FF7F19061 [email protected]
1,666,222,219 *AF59EB4078A90811BF09CFB7FFDB5FC40F2BD2A1 denucleariza+ion
1,666,222,220 *AF56FC2E5E30A2D806B95430B6659AD0EF14DCCD DER2M
1,666,222,221 *AF50B7EE59C8FC23E92BB9E05E330277DF17FEC8 DESTRUD8
1,666,222,222 *AF5A2082ED4067141AB776FD9D8F1BB35EADEB15 DEUISEE8
1,666,222,223 *AF5F063753A1294AA6D43D61E4F139D932B616E3 DE WANDERER
1,666,222,224 *AF5B81C9484FCE1DEDC105227E0135283E51C133 DhF)
1,666,222,225 *AF529F6F5A8DA7FAAAC7F32ED1E3D7BFF43820A5 dhjg
1,666,222,226 *AF591C00DE28FC266A56AFC9871E7CB595E33002 DIMITRIS ATHANASOPOULOS
1,666,222,227 *AF59A3B0D89C1B975B9593AD0F50C14CDCB4DFEB dionovalf
1,666,222,228 *AF54DE7F473F3C96DD574F1246BC4D32607030E8 D.L9?
1,666,222,229 *AF5D4191D3F8FBABEE3AC73E7B69972DF6849763 [email protected]
1,666,222,230 *AF5383DE97902F2F292C58B158CE654F145A2E87 d.nm
1,666,222,231 *AF5F7127B70182CF4100280BA9A10366465FE725 dominicroesch
1,666,222,232 *AF5C43EE2FAC6828C1F8F55D3A6177CCDC9E8F9D DONGLEA
1,666,222,233 *AF5694AF6A4946CD056A33301386329421A6AFBB DONNY.BEARDSLEE
1,666,222,234 *AF561210DF69448656CD7A58EF17AD2FFCD28B82 DONTE.MALCHOW
1,666,222,235 *AF5D6BF1DB7D093FCDE711CA4764DE04C0983035 DOUGLASSPRUNTY
1,666,222,236 *AF55FA6814FDBCCF03B3C798715F960E29B4E07F douziem1
1,666,222,237 *AF579297E54D98BA7910E4A620C821CDBD2C7A31 DPTHC
1,666,222,238 *AF53196040C6034D855EFFBBDC7A2AEE40887A1A drunkenly2
1,666,222,239 *AF5785B001376DAA0B3BBB3CED934C5CFFDB9279 [email protected]
1,666,222,240 *AF5823ED181B9DC0D41D607DC3D0C63C56ED141C d!sid
1,666,222,241 *AF5D5A789E322318AAB3D05AD22FBABCAA838E5C dustinwarlow
1,666,222,242 *AF5F144C1E850143D8D1C8E008A83491455B408E DUSTYTYERYAR
1,666,222,243 *AF5A0DD2925C13F1448D1CC1CFAA0A2B1DD2F365 dv%6a
1,666,222,244 *AF53DEF8F45AD4DF01D7AE8FCE66D6E87FED1833 dvpkb
1,666,222,245 *AF5D900C212B8B0FB94AF2D35D46A946929317B6 ea't
1,666,222,246 *AF537765C59E421538853BE8509D8E49438F551A ED-DAB'A
1,666,222,247 *AF5D81990FAC801E0213D114076E69D8C9A4F1A7 ef|j
1,666,222,248 *AF54468C30D553104600825341800C31DC0EE3FE EFT
1,666,222,249 *AF595FA109957738D418595DC373FF58AEAA88A7 ELAINE.BERNABE
1,666,222,250 *AF5BD642F3436D43D4325B33A19F898BC8A7CFC4 ELBADIRN9
1,666,222,251 *AF5A89C1699A97EB139EF7B4DB45735744CF48F0 eldonmarki
1,666,222,252 *AF53814EB97C6106DFA5F05D22F5BF221BD23367 $ELF-DE4F
1,666,222,253 *AF5264E5EFDF011200882F659F47CE904965CDAB eliiuliano
1,666,222,254 *AF54B520894626947171BDABF0D27DCEAACC4AC8 ELMOGRAJEK
1,666,222,255 *AF56DC000692F64307D24379F67442DAEE42DCD0 ELROY.OGILIVE
1,666,222,256 *AF566DF30ACCDE80A532E6729CFAB9694FBC8414 EMPURANY
1,666,222,257 *AF5985D4BC60D7F15D00E80F551B90DBAB19ED03 ENKLP2332X2
1,666,222,258 *AF5F8C744CE606E16C89899916440EB435E4A69D ENLARGE
1,666,222,259 *AF52ACC4997685AAAA3F1EF2215B779A6534BFE7 EOAMD
1,666,222,260 *AF52803D0D9A80F221E2CFD8586FF3871932C7E0 esorevoded
1,666,222,261 *AF5827D677EFE77377A81AAD8C07BFE9889C60CE EVROHOM1
1,666,222,262 *AF5919EC83FE5C199B73D116FD61D03AE1358CA9 fac3-roug
1,666,222,263 *AF5DEE0E55EA99FAEDBFCA1A5F87E5DF70690A8D faighthi8
1,666,222,264 *AF51B11B50FF7845445C07BE396219E5424EB690 fajüldözés
1,666,222,265 *AF5C6F2D984F00780A70FCD16235C746C497BBB4 FART AIR TONE
1,666,222,266 *AF577D8607B0F1DB4CFCD9CFE3EEF2526E4AF974 fccar
1,666,222,267 *AF548526E39165F218FFFBD989CF8B0EDE56B390 FELINHELF
1,666,222,268 *AF56B0A6BADA63F6677DE77FF8F388689546007A FIO<
1,666,222,269 *AF520177DE7A7764210063C6795283553FBBBC37 Florita(pirekua,Mexique)
1,666,222,270 *AF5D84317CECA773D3D1FB507F9994206B1D09F1 FREDRIC.CHAIX
1,666,222,271 *AF5448329102B5E7FDCDAAA81A3FD7E8F9AD95DE fredrickpicucci
1,666,222,272 *AF5A9C26E6C1219D6D6446A6B3ED34A2DA084721 freling123
1,666,222,273 *AF555ACE3C340577B86A14C28032481912CBEAE7 GALLOFIEL
1,666,222,274 *AF5E16393D424DCCA067802172D65291BF80684E GARRY.EVELYN
1,666,222,275 *AF5B94B1DF531381FB976C7889002DF4B1EDDBAC gasbinde8
1,666,222,276 *AF58EBF09C903D4505D228C7C9873E044DFEC830 gelehrtenvolk
1,666,222,277 *AF5667190CC9162E86B094E9A85CDA24624B499F GERALDOCOCKMAN
1,666,222,278 *AF57CBFAFDA77025B2B6FD5979C5A690C39F7188 GERARDSTROWD
1,666,222,279 *AF559E6AE486C98F2122C0FC36E06EC05E26F0E1 GFE2
1,666,222,280 *AF5F64084A4D7544331B786D2C36C51FA6E046BF GIVEYOURSWEETLOVETOME
1,666,222,281 *AF52AD7999A57F159CA5DE40B211C3E32F85D064 goldbergvariationen,bwv988:variatioxixa1clav
1,666,222,282 *AF57C6653B88ADF12AE0D139FCCF065690C8F22A GRINS-HANS'-J
1,666,222,283 *AF533A39D49B3C3A2396274E85AF5C3A2E9F9DF9 GSCHNTTNN
1,666,222,284 *AF5838141997B2A14EBAEE5E66234AE56DC788AC hammercarlos
1,666,222,285 *AF57591BFAA51619EFF6BCDE716E4F0C48F11CD9 HASSANLEFTWICH
1,666,222,286 *AF515B92C6343801DA446BDB4A98989DE0B746E3 [email protected]
1,666,222,287 *AF5513ECF3A444D7B24EBC31A253DF5B564919CF haywoodsooter
1,666,222,288 *AF5866FD8B3393F19024B0909C0E1D434CB6C8CC HEALING-OIL
1,666,222,289 *AF5FCBA0D182CC7095691CB7C669D7727AB49DE5 heidi-jobling
1,666,222,290 *AF5298FBAE9F915D8725F3C704EA2B99D2FE43C2 HERSCHELPLUMADORE
1,666,222,291 *AF5953A5604618301AD3589A15C516AFD2F7F38F heungmo
1,666,222,292 *AF5B5F6085B075F539DEB9F18E5F7306395688B5 highlifes
1,666,222,293 *AF52D419E5E707208379AAA41F60437244213A5F HILARIO.BYNAM
1,666,222,294 *AF5B9FF15AC4CF3DB083761B88A89140B891026F HILTONHITER
1,666,222,295 *AF5D8C497D216A22213970DA925B99426056BD3B HIRISTIYANLIKTA
1,666,222,296 *AF50B4F91951B8F1481CCA8801C14CA8FEBCADBD HM8C
1,666,222,297 *AF5CDF9437C2C284E3DF1FE2D609A2794E76897D HOMERPRUSKOWSKI
1,666,222,298 *AF5EA39AF6C5C6554CF1EFBEC5DB162E1A4CD70D HORSETOCALLYOUROWN
1,666,222,299 *AF5B02DA55687B981A32B707F441A2C7DF9092BD HPPV
1,666,222,300 *AF5B8477FF9FE9A09C61D18DE6EA7800203CEA3A HUMBERTOCARREKER
1,666,222,301 *AF5583E7F2E07BA8A5E5628F50860759BD84A04F HUOMIOMM5
1,666,222,302 *AF595B90091DE05214096E983A2D77A60EB237C6 HYABU
1,666,222,303 *AF50184247F35AA8A4005FAD0B0524A450A37431 IfYouHadMyLove(DarkChildremixedit)
1,666,222,304 *AF556F37D15726FC8E8222F1DE18389657019B2D ILLAQUE4
1,666,222,305 *AF5157E20C0486C184690CEC9E0A28F881CBCD10 IN OKKAR ALLRA
1,666,222,306 *AF5018DECA0C4913FE941DC57A0F5401BA71F684 INTERNATIONALANTISU
1,666,222,307 *AF56D8A40B67B76D699DBE444EF814AFAA34B4FD INTIMATIONS.OF.IMMORTALITY:.STANZA.VI
1,666,222,308 *AF5ABDF965AB6AEC4421E25CEFBAA7395C9D2DC9 IRACRYSTAL
1,666,222,309 *AF5DEFEA49F37D33422E88B852118B2E06774B0D irvinballin
1,666,222,310 *AF52A64FD7BF9AC61F6E99C96838651AFD50C68C irvinmannella
1,666,222,311 *AF5D11B332EF81B2031818CDB682C209DF4901C3 islckcqp45
1,666,222,312 *AF5E02B9FE7BC785D9B2E22081249FE76BCEA4CF J012006049S010281
1,666,222,313 *AF5C877A23859912AD248091C703CC7E31D0CFD7 JACKKIM8
1,666,222,314 *AF55375926CFABEFF97A767305C67FBE8B3A7C67 jacksonstart
1,666,222,315 *AF540066E2D6293C4561C066A69350A9F8BBB212 james-a-glenn
1,666,222,316 *AF5FAFA1650294DB1839CC1A9A716EAE49EA3F06 JAMES.SCHAACK
1,666,222,317 *AF5B37D3E119D5861C337AD5C1C981CC91A30D0B JANGAARD7
1,666,222,318 *AF5ADF482AE1EFEB740A7FA3E0B015610EF138A7 JARRETTHENNESY
1,666,222,319 *AF5D7277F1542918D11C6AACF1840AD139ADA203 jasmin.aguayo
1,666,222,320 *AF55A3AC6A2A6CE9475CC87647CBD421E2AD9956 JCB19
1,666,222,321 *AF5DDD734B49B024667854C9AA026D5712D33231 JC.TROMBURG
1,666,222,322 *AF5DE644663AF99BF45F2BE66A978BCB913321B4 jennifercamillo
1,666,222,323 *AF542CB0EFA74824B37BA3F9F191B2F37ADD9563 JERMAINE.RAMSON
1,666,222,324 *AF544C73B100952FC8414AE25250ED618E133C69 JEROME.DEDMON
1,666,222,325 *AF5420BDE214648DAD91329BC17A5FB0CA8103A0 JIMMY.KAHOUN
1,666,222,326 *AF54867E1FA592A9F5DBBBDC05637CA342083A20 JIMVANDERKAR
1,666,222,327 *AF5A1BE2AACEA4FB6DD0451BFBA745B840D80735 [email protected]
1,666,222,328 *AF5F01226760D16CDFB29A37166F34ADD8BF2C2A [email protected]
1,666,222,329 *AF5D62DED021868C4899D98DD6A195420EBDB377 JOCH22
1,666,222,330 *AF53576D27BD2D61C6143DA30EE924A94650219F jorgefranqui
1,666,222,331 *AF5E32FAF4BC16C2D3D95FDED9579E5937010E49 joyousness
1,666,222,332 *AF54DA6293D5394FFE91C6373F7898005F3F24A6 [email protected]
1,666,222,333 *AF512EAEFCE590B149A858142D69BF9CF59CADEF jugendtheaterproduktion
1,666,222,334 *AF52C6B4615095D8E18763F2EBA1273CA6C814BC ka)-cs
1,666,222,335 *AF5A449708A21B944262C9B32CBC7C2C61AB3BCA kakwseises
1,666,222,336 *AF5F1ED4BE6B8C93269F28580FD77D8E9EE4D0F2 [email protected]
1,666,222,337 *AF5BAD7994C8E16B70DACB9AC4B6DFD003430C10 KASTIJDEN.
1,666,222,338 *AF5CFFFDDBADB20775EBAEC19D86141F919DAE38 KAY.DOWLING
1,666,222,339 *AF554E7734C0E41FB6437D51529676042C5B4F80 (KAZCO)。
1,666,222,340 *AF5369F73CDEB463EE6A3D4240EF34A319DDB2A2 KEIN-SCHWEIN-RUFT-MICH-AN
1,666,222,341 *AF5F7F91773C0CE3DB5CDA276353010E1B2228F4 KHAIKI8
1,666,222,342 *AF56113CE2BC6C937650FE061A14E334B6A3C51B KHN}
1,666,222,343 *AF50005EF729415BF3B6A6B1B00EBC29FFAD88D5 klorbensen
1,666,222,344 *AF5B042D9EF075A67E15CA5977FBD7BB9948CB8B KUPARIAVAIN
1,666,222,345 *AF59F5D0E1FE563AE61E3DDECD205E330DEF3F3E kvllrstr3
1,666,222,346 *AF553B066D4630006D877DD7DEB0E0D973417F79 [email protected]
1,666,222,347 *AF5D502B86B2EA20973C67DF1E48ACF47E00423E [email protected]Z.NET
1,666,222,348 *AF577B73591F17C04F77FBC67588360CFD6FF4D7 lamargoodland
1,666,222,349 *AF50EE42191B99E31A26CBFCCFD056D2CA3F928C lasteps7
1,666,222,350 *AF53E267B50A7704310EE8616DEAF8845FC53BD9 LATINHOLIDAYS
1,666,222,351 *AF5E15A0422F548877E4BBDBF9B7ADF7A59795D8 [email protected]
1,666,222,352 *AF598F6641CD17D24C2D5B3F10FA1B5A282859EE [email protected]
1,666,222,353 *AF5E5B120A09FF3414D500B960CD82EF7F30F4C4 [email protected]
1,666,222,354 *AF5218E500F37B09F8ED74C15C4CBDFF70023F51 ligklædet
1,666,222,355 *AF54E4CC613FFE9D4E6F92572BDE85E6B0592209 LLEFNERG4
1,666,222,356 *AF59CFD613800C91B267A4562AF182C9679A3E13 lmolmo
1,666,222,357 *AF54E846575C729F4129A7DFBF76AB0F9328A493 LUCDOIDD
1,666,222,358 *AF57291A9AED74EC5B7EEEA62300BC4871FEE5A8 LUCKYFIN
1,666,222,359 *AF53CB3D9E2CAF9CF23FE62C4D040E444D3E2143 LYLEBIEZ
1,666,222,360 *AF59F216292C056A51014059F880D024DD346A39 lynne-van-der-merwe
1,666,222,361 *AF5D65257087E2B7988FB45FBB164668527A2BD9 LYNWOODENOCH
1,666,222,362 *AF5D2CDDE98E92F40F3440F2D9DD7104E73283C6 M3D10CR1Z4R4
1,666,222,363 *AF5765FCCEC859C5A90221E2E1F194E1B8D596C5 M4$7!C470RY
1,666,222,364 *AF5C00DF143BC602B87BA5778438FEC6455487BD machtigde2
1,666,222,365 *AF5FD93A89DB923CE4ADEF3FF525246167638DE6 MALCOLM.JUHAS
1,666,222,366 *AF5174ABECDC3A65E0492C010BD57AD224B1D262 MALCOLMKHUU
1,666,222,367 *AF510D7A75912AEF20C53BB9B8C8A705EE84CF48 MA-MHATHE
1,666,222,368 *AF58CFBF028456307096C74E82EFDF0F3F523EF0 [email protected]
1,666,222,369 *AF5D6DFB6D706314168391116D78791F33005D5F MARGARITO.HERRION
1,666,222,370 *AF58B1699B24941E3B1B86172F77C884961D4265 MARIAANDREI
1,666,222,371 *AF5A900309901059EDA987699863F1330FF01BC0 MARTY.LOBIANCO
1,666,222,372 *AF545031FA58CD9342272FB920ACD5DF5B2891DA MARY..GEORG.PREU
1,666,222,373 *AF5A1AF1F80DA4D97754C1CC41F55BEBB6030D3B MASON.TOUSLEY
1,666,222,374 *AF53AF6D11853E0E33435B69172481FAE7B66454 MATERIARIAN0
1,666,222,375 *AF5B64832B69B5832D6B541156EA19F750C4C73A MAYNARD.SHELMON
1,666,222,376 *AF56C400E4E966CE55357EA543B54BABB5257AE1 MAY-PHUU
1,666,222,377 *AF5F2D2F5486339EEBE5A47748CDB5B870EBBF5F MBULOHESHIN
1,666,222,378 *AF5DE5A791C8828A09540C1C3B2BCFFC4B4602AE MEANINGSLIST
1,666,222,379 *AF51C1CD8D27403E78DEBEAF5E29C41E9093F5EB meekwamed
1,666,222,380 *AF56F73BB278F1C0AF87A327C3D0413DB7BFD84B MELISSAVOZZO
1,666,222,381 *AF56EC99455C29929626C74380183D3CCBB83463 MERVIN.BOXWELL
1,666,222,382 *AF5DC1AD71A219BC2C58C754336A3DFE36ECBAD1 meyerssquibb
1,666,222,383 *AF53B31AE3BDD5950CFFC04214BBAE84229A08E8 [email protected]
1,666,222,384 *AF51EF1255BADF6A827E46A61C385918829AD8D9 MICHAEL HINDMARSH
1,666,222,385 *AF5B1BC1335E24851087D53C94EBA52107D60C5C MICHAEL-T-DIAMOND
1,666,222,386 *AF5BA2FCA018D066B5699D06A8032CE335A3C626 michaelwigelsworth
1,666,222,387 *AF5E189BE53D8CEF5913EE41803E7538B67FE5FD mi$-p3n
1,666,222,388 *AF56E42CC1235D9612A9E957B58616A64D7DE0DC MOKYTOJAI
1,666,222,389 *AF527660B7CBA13A7EA7A97D72349A48F4F3D751 MORTON.KIBLER
1,666,222,390 *AF5A9A7148B42C82B9F364CCCE71D56579B7F2DD MOSHEHERBER
1,666,222,391 *AF520039571BF4DAD1E91FF2BD2DDCE75317A143 MOUSESTANG
1,666,222,392 *AF52E50782670BB491B201CBC85CAEEC377D2F58 MrCat
1,666,222,393 *AF5706C2C97A35320076C6EE62A55C2860C7B260 MySaroJane
1,666,222,394 *AF545EBD62B6A7E23AE8ED048DCC1188C8E36E83 neljataktilise
1,666,222,395 *AF592414F6369DCEFFE9AEBECD90EA7951293198 NEVILLETSCHANZ
1,666,222,396 *AF5136ED862A4E6AB4B4842CCB7ECC75C814E371 nhlfe
1,666,222,397 *AF5D3B66EC16F19330581F29E159DDA890619155 NIATRETNE
1,666,222,398 *AF5C92B8E02B3207DA1A5EBFE359F1C916E18BF7 nolanfederici
1,666,222,399 *AF5F1BB0EAA8B800A5B27480D4E8AF6FA8D03E6E NONAVOIDABLENESS4
1,666,222,400 *AF5AED3183FE15A21BD189DF3114B1BC1DB8EBAC NSRITHANISARAKORN
1,666,222,401 *AF5D82A02CD41A0D353FB664923CECA65F49EB58 nsteter6
1,666,222,402 *AF56BE0FF996EBBFCAB6748791716D439595F299 ONS'AIMERA,ONS'AIMERA
1,666,222,403 *AF57E371C6F46934A3F44E253E28431120478ADD ORDFORRD3
1,666,222,404 *AF526BDBEF80079EE57F20AE09BFD027791B7473 oripohjan
1,666,222,405 *AF5D7FBB3B38541441FA842903D69D997EBA9D62 orvillebaseman
1,666,222,406 *AF53346760E296FBC57D6597D098A4C3E682F751 OSVALDOBERNICK
1,666,222,407 *AF53B433D1C074D8581A96A9BE5E4F213FEC0BD0 outro(tuningout)
1,666,222,408 *AF55D620EDA586F810D1F6257EAF70FAD8ECFB79 OWENSTALFORD
1,666,222,409 *AF55AF6C7CB3EEFFEDBD18BD7B40FB07BC1D50D0 ozglassescomwww
1,666,222,410 *AF5D7B2AD974305B9010C49CD293E6CC60C6D58F P0ULTERER
1,666,222,411 *AF503F71613AE1B6914CC5322B29F1DDC76A3D72 p1l8u2s
1,666,222,412 *AF581FAA75AC9357E252B2DCE4D801CC99BC97F4 PALMER.SANDERCOCK
1,666,222,413 *AF5B085571042E20CEC4D12A0B23A2C6073CA393 PAVANE FOR ORCHESTRA AND CHOIR OP 50
1,666,222,414 *AF593D3BDE200B675328E8BBDFE413146628F56D PD*(0_<)
1,666,222,415 *AF5226335EFE27194312B6B0C754D72C9743FCE4 PERFOREERDE!
1,666,222,416 *AF5C8AF2D5B9EF982429048A9CD50FA20CA3335B [email protected]
1,666,222,417 *AF597FFC4966DC4AC9075A91FABC9BA135DA0CD1 P-G
1,666,222,418 *AF55F816904445684EBC3CB582688CAB6276062C PKENNTU0
1,666,222,419 *AF53F8E5C30BFC3FDB9682B4D1EDBBC6A8776B00 POIIÏBNS
1,666,222,420 *AF5CE08E66C39FD18D8208C7817F287B52D4C2C9 P#####@~O~o(0-0)
1,666,222,421 *AF560AF7D0F6DA27A8F37BA88F0C840B626D6806 [email protected]
1,666,222,422 *AF5191B6D3514B26A4E3C72DD4AFD3B050A23407 P#P ` (0_<)
1,666,222,423 *AF5ABD1B59128396E9E5E675E5AD46B8E0B4C8A6 PRAVEEN.PS
1,666,222,424 *AF55372402EE6A1C776032A50C122FC7AA8F9F27 PRIN975
1,666,222,425 *AF5BD74D86D1D8B6EC24E07CA275B22090EF2038 PRIVATUNTERNEMENS
1,666,222,426 *AF54000D92EABF2DB4D3155B87FC9A540DE84397 prosai"que
1,666,222,427 *AF5D8C282219FDB0E77698D01186D0BB2EE22341 puntelleranno
1,666,222,428 *AF5887A0CF269639616583B9A60A909CB7E25183 R34D3RSHI
1,666,222,429 *AF578CFFE3FD909AA6F0B85C97C6CDCE622E9F13 [email protected]@1N
1,666,222,430 *AF533E183F301B57821AD74BE291450267136167 RA0KAAAAIBAJ
1,666,222,431 *AF54D06D22516D80414A35A0389B602FD4E1DF02 RAFKOUKA
1,666,222,432 *AF52F547E436F8FFF3CC703124BF62BC25F049E3 [email protected]
1,666,222,433 *AF5ECF5C6257B939C30D71F83DB88A82045BF9EB RAJASHEKHAR-RAO
1,666,222,434 *AF5AFEC6142BC4E1133E1B313B5475B9A1648752 RALLUMAS5
1,666,222,435 *AF5ED756C2D375F3D527036B34B1579C27D77744 RAPID-READ
1,666,222,436 *AF5F903FA94ED7F050B169B55104ADE5BC54A89B rayananditya
1,666,222,437 *AF52D059D93B972344524B8B3F07734B8D39799E rbz-
1,666,222,438 *AF51CA60A7DBEA8C7ADA4C548AFE99D98C8F5B3B REDNIKEILAOG
1,666,222,439 *AF57BCA8D2DD7406981A2C833BC7EBE0B2EBB568 redorans0
1,666,222,440 *AF56CB8C9CC464391504F4CA0BD74C21C0D29A50 REJECTANEOUSES1
1,666,222,441 *AF553D93335C24184D2DCA162BA6C37F8B7B66CB REKCANJIS
1,666,222,442 *AF5FED814870AD415BDFC61A5D167E3AD069E9C5 REMEMBERMONDAYING
1,666,222,443 *AF5F192DD4FC3B8B44FA9DCB0E2C4B7680BD5077 RENATOPICKERT
1,666,222,444 *AF56F3A720133FE40E515971DB34F57DDEBE56A4 resemblance-r/i/'z/e/mbl/@/ns
1,666,222,445 *AF54658FD2C67CC96968CD1F42F798CAFAEA2795 rethceh
1,666,222,446 *AF5E8F7AC0FB1B36EB94AE4E53363D32DB2B00D5 RGLADIOLA
1,666,222,447 *AF5A0429404011EBD8432C1932EAB8E984313B36 rhtr
1,666,222,448 *AF53AC9C3630841A6F098CA1EF4EAE2042EE4998 RICHIEFADEN
1,666,222,449 *AF5337EB51D6EBA9EFCFECA5BD7A4C17F167440E RIMPOSEE0
1,666,222,450 *AF5B637E713F3113C1EB486D93711297E594B8D3 rinfresca3
1,666,222,451 *AF5D05E71FF41C7DD527EE384C2E7039A199DF06 ROBIN.LAWLEY
1,666,222,452 *AF5BB5EB9E605D3C1C9750F79D212331EAC21FB2 ROBYVELLE
1,666,222,453 *AF52FBA2B321631B1E8B3878E305B4092219923C ROLANDODINHAM
1,666,222,454 *AF573A66B994C2A193CC4D9F234581F0C5528431 RONALDHARTGERINK
1,666,222,455 *AF547DEE6F3DF1153E9A7C41A963406A04DC011C RONNYHANELINE
1,666,222,456 *AF5AC5EEC6AB25D03D143E4777B556A9825C5EE5 ROSS.POMEROY
1,666,222,457 *AF520260301462C7DAD0ED979A61A4C67CC8BC31 RUNAN.BBS
1,666,222,458 *AF57507F3C0700FF8496119FE0E58914A08AAD5B RUOMALGEB6
1,666,222,459 *AF5946ABC2270EC2AF7CC1AF80F6653724088C36 RUSSELLTYPHAIR
1,666,222,460 *AF5E1887A7ED14C94866A72286A2915483AF35AE saintpaulenforet
1,666,222,461 *AF5BD4383BF7348F7B2B45971D151EBEC9682B3D sanktannenkirche
1,666,222,462 *AF593F302A9C38FA680D99B5F800E7C6E9E8385C scamplong
1,666,222,463 *AF545D258D52C6EFBC422D2006D6C46EE9631BC7 second-flight
1,666,222,464 *AF58A8C641036C91A8BA50111889877DEDF2D977 SHERFRIDA
1,666,222,465 *AF541DCBE2184BD0F23FDF0A33FDD77C3AE121E5 SHINSHINKAI
1,666,222,466 *AF5F97D3CCD511098F91D6BF8194CF6DBE25C55F SKATE-TUFF-/-GO!-(LIVE)
1,666,222,467 *AF5438240B85E86E6D6564F5C209DB5A461A5E0E sloppy-train
1,666,222,468 *AF5AFE1D921656F9676456F07D1A765758A629BF SLOPPYTRAIN
1,666,222,469 *AF58263CD8F78F5E4F5D1F1CD6027D0C1FCE851D sojzech
1,666,222,470 *AF5640D3AFC26344B90E16D03379E82C3FE0CF07 splat.~.`@=====p
1,666,222,471 *AF5FDFDAAFB09C9338DF7A53780023303CD43D6B SPORIMA?
1,666,222,472 *AF560DC102DF9C9F4B645FFF4F6BBF539AC67A73 sprengstoffbe
1,666,222,473 *AF55D8D53F90B658B1CDE159CE6A3D00DEB8E6FF Stan.Ross
1,666,222,474 *AF581F204B7381C9F58F940AB072E0194C6184CF stealthphantom
1,666,222,475 *AF58F0A34B2C816C9DD716CE9461E6467FE0F914 STKAAKEG
1,666,222,476 *AF5134AED7263B7EAD069554DFA9ADAE04D6FC22 STORKUNDE9
1,666,222,477 *AF511318FBBBA857A98342402C2C490CA1E4A690 stuartseek
1,666,222,478 *AF5C5A9DEEF565C1163CA601DC36DE65F9860586 SUBSTITJE
1,666,222,479 *AF555F3CA6F8E95F85DE6221B9E97DB51DC5A3B1 SUNSHINNEWPASS0
1,666,222,480 *AF5D6E0521BCAD382E262B1A34C4125AE00C9C02 SUTAPTENA
1,666,222,481 *AF51C280CF0D53B69097AE5D5102EA52C30B6CAF TAKARÉKKÖNYVET
1,666,222,482 *AF5683EC0712B067756BE53F819EEA38AA12DBD9 talk841607826
1,666,222,483 *AF5A87F1DD9B02DC9761084D3CE349D3F32E4989 TAMARAROZMAN
1,666,222,484 *AF5ABDC6B17D9C400D9A789EE251E9AC4837C325 TD5K
1,666,222,485 *AF54DEC65C15C5279166F8172BDB83494B3772B5 the-best-of-dvo
1,666,222,486 *AF5F0AF98B8F819BA3C7EFF2149F006EB8CF5961 THEOMAST
1,666,222,487 *AF5B2416A29F0F3BB04B6F367670B888CC6A824B THRNI
1,666,222,488 *AF5D54E684DCB325A1857C100FCE98DD0A490B41 [email protected]
1,666,222,489 *AF58F21C2D18E3B112AE82C429757BF9EDA2BB61 TIGREASDFG8
1,666,222,490 *AF58FDDA17C179067EBB78E9121A08F4D9601F74 TILLERAY
1,666,222,491 *AF540A46FCB2210BE4B3DCFB8CB178360405D3D1 [email protected]
1,666,222,492 *AF5CB1E98FA92B62906B039214F8FC82FE737199 TNEIAREHCARCERING
1,666,222,493 *AF5382BE3E448904FAD435730DCD5ACF81DD2653 [email protected]
1,666,222,494 *AF5A0E7310198FE76A6AA591B87A10E68D841D3F [email protected]
1,666,222,495 *AF5E2AC451DDDA34EC63421DF9AE3DC3CD1343A5 tommydalka
1,666,222,496 *AF55ADBAC8887C0010025F879334910F7F6D69B5 TOONOMVANG
1,666,222,497 *AF5D95D11998F24FF44680B0CD8434391FA645AF TRIPTYQUES
1,666,222,498 *AF528712B33E21743B1EAB1D5F3A322426AE108B TRNQLZD6
1,666,222,499 *AF545D3B22DB13D6CE6BCA4DF2A26CAE72BC23D5 TUCKER-RACKLEY
1,666,222,500 *AF5D09BA28152B23AF92846250C3E078654848AA tuohsle4
1,666,222,501 *AF5BD3AB3C77A1C8E390D2F0A5B60D208B342980 TV(WHYCAN'TITBE)
1,666,222,502 *AF52EDE0E5DB7DDF25697835B707D943100D5407 TYRELL.GIECK
1,666,222,503 *AF510694A2311CA55EBA04B906350560D611A6B1 U159324
1,666,222,504 *AF5BE27CD3337B52595EE2AD5B06B102576FBBB0 u1+r4m!cro$copy
1,666,222,505 *AF53DDAE96E60D1785D4E63AE176544CD7572C4A ukviscountessstub
1,666,222,506 *AF5D648961C2ECED69EDD0DEF49EB80E66351A08 [email protected]
1,666,222,507 *AF5C1194031480687EAD93AE15DDE22F0488426E uncargoed1
1,666,222,508 *AF5D06D7B605C64324481368AD1581E2EFBBFB8D UNLOCKFORUSBLOGSPOTCOMUNLOCKFORUS
1,666,222,509 *AF52FCC93B6E398BD01C329F3152B17B6F38ACE6 UNN
1,666,222,510 *AF55C74C466210ACBAC87A36EFB4C273227AD670 u$nx
1,666,222,511 *AF532EC1C2BCCE82943C9FC2465349B1CD5172AD USERGIVMEDIK
1,666,222,512 *AF553F4EEFD02A8008A215D74592BF11BD2EA690 UTCMASKED
1,666,222,513 *AF52097266C8C3E3494C157EF22E88232849847E UTHERAAN7
1,666,222,514 *AF54612847FDF989CC9C37412FEA9F4FD7267AF5 UUO~O~Q===8
1,666,222,515 *AF5F8E1C12745C1B9B82C9D1DA953E7E0723995A v3n0miz3s
1,666,222,516 *AF549B17BBBE72BEEBBD7B494D1B94E0BB552514 valet-de-chambre
1,666,222,517 *AF5F6DD2BC7DAD4EE3E97BE2C4F82B3DF8720000 VENTURACAMPING
1,666,222,518 *AF59641377995C25810619EB744BFA292A7564A6 VERACORNELIUS
1,666,222,519 *AF514934D4B137483906F0D82917FEE5C8C2164B VICENTE.BRANDEN
1,666,222,520 *AF5D1C67E20CD5A3332F17400A22A443E67C71D9 VICTORIAKALISZEWSKI
1,666,222,521 *AF5081F028FC421874CAF20C46A7E1FB26506CA5 VICTORIA.LEGRA
1,666,222,522 *AF5F6043236D20B44F7605A95B55834F2F161F58 VIJENDER-GROVER
1,666,222,523 *AF57624C09E1A0B28C8E2D11A498E49A52729C88 VIKTOR.ROLF
1,666,222,524 *AF5F00B2A3C492A4F94CC4976A19F5B85F7CBB5B VINCE.EBAUGH
1,666,222,525 *AF567BFD3F1C9F22D46F3AD2AE8ACB018A3F63AF VINCENZO.SIINO
1,666,222,526 *AF5CD0C95BAA5944B9C32E1681FCD56F6CDD3429 VIRUS-CODED
1,666,222,527 *AF5B5078E37DFB2F30C325DA8FCDCE1796DF1A6D viveka.wijayawardena
1,666,222,528 *AF5348EB21734CBD54064FF2612BD237C75C17A3 VIVEKKUMARE
1,666,222,529 *AF509622158347985E7BD0BEF41DB49EBC380E4D VIVIENCRESSWELL
1,666,222,530 *AF5BBE277BCBC7B02CE1586501DD5D28506970D5 VLSERGI
1,666,222,531 *AF573CDFB2B0637D3CD33D214C89F694A9B03A55 vy.duck
1,666,222,532 *AF511828726CBC01D2A495B3A85031ACBD9FC879 VYOM SHEKHAR
1,666,222,533 *AF554AF162D3122EFBCCFD4AA289D47057326E90 VYSOCINA
1,666,222,534 *AF5012AA480FF0B08214AAFC703ED5E4CC038CE9 WANYNORA
1,666,222,535 *AF558951E880BA2FD96D666962915CC9667C1857 WASEGUA.
1,666,222,536 *AF5CCBEE9C97D55BF611F43823371809F0674342 [email protected]
1,666,222,537 *AF5634F10480BC3A4B968B78BD43ABA2716F2E56 WENGDF
1,666,222,538 *AF553E8BE3E2BC3CBCFF024A854C120BC8C1C981 [email protected]
1,666,222,539 *AF50E838803DB1DA4A42333533862554F44856FD [email protected]
1,666,222,540 *AF524EEAAF14878D46BDA62CA3643D9F6B03CE44 WENN-EINEM-SOVIEL-SCH
1,666,222,541 *AF56B92BC48CE7FD3634EA956125AB5F444FD0FC WES.AMEDEE
1,666,222,542 *AF54C13E4B7BBBFEA626AA74BA51C7BA72538ED1 WESLEY.MESDAQ
1,666,222,543 *AF57AACD981B7372E4C632DCA5F00A04740C7126 whiskylike!
1,666,222,544 *AF586E9BF90AE99EF9AE6927539F4D7DD196D6B4 wild36
1,666,222,545 *AF5009CEC8B9A1319FDBD0C8CEA95559CC9BA488 wilkesborooldjail
1,666,222,546 *AF53A0FB8454BCB6E3872AE55510FF8F1546CE80 williammacafee
1,666,222,547 *AF5102F68CF962ABC3A0C147528860A03435290C william.ouellette
1,666,222,548 *AF59A81EC3CAA5895EFE80F8F6A63284A0AEB2DC WILLIAM.SPRATT
1,666,222,549 *AF53610D12B16995142CD2BED5B62629DC1C5032 willywilliams
1,666,222,550 *AF52EDE7CE9D1E97439353F515EC80A655FF598F WOW.....
1,666,222,551 *AF5FC3BA8EA55F7B1E919E28BEEB6428432563D1 [email protected]
1,666,222,552 *AF5C5B3104E3374053E8822F84035C4993586E70 wwweebuconnedu
1,666,222,553 *AF5BD19467B35161E837FB15605CC930252B02EC WWW.SPIRITOFFREEDOM.
1,666,222,554 *AF5E2996B83691FEA0FB817D83386E48678E817A ~/XAAA
1,666,222,555 *AF5CEDA2B9EC2716E93A206F32468F0523430F67 [email protected]
1,666,222,556 *AF5A7C5277CBA317655982480E5EB926A0E75F6F )X(.O~(======Q
1,666,222,557 *AF5864DC1DB4AEE46301EB60F9E62055D59C7CC9 [email protected]
1,666,222,558 *AF51AB922432828AC5198EF19F5867F5CF1940D4 yanon-sardine
1,666,222,559 *AF5F174B960FD9A6344D88A3AA98570E7CFA5105 yazansameersmehdawi
1,666,222,560 *AF5B14FC66BD36E352F30F7A7A8325FE63AA9734 [email protected]
1,666,222,561 *AF5E8FFA17A51F66DA8CF95CD04ECECDC9092C84 [email protected]
1,666,222,562 *AF5E6BE87815F18ED96D28354625410E5E02217F YLL7TLAAFITESWBQTR2YDQ
1,666,222,563 *AF507A2DF5E70BDE0185723D026EECDC56D72CBD yttertak
1,666,222,564 *AF567EBF5B4E2FD8719E66EE71009BFC055605B3 zeina-zeina
1,666,222,565 *AF5E0DCFD8DEA0433D36E39FB9361731FA6C6D0E [email protected]
1,666,222,566 *AF5127A4A86424378C10030023223BC54FD3672C ŽENITVANSKI
1,666,222,567 *AF5CE643FFF20AFD044637CCA1BE054B338868DA zentral
1,666,222,568 *AF532EA92541DEA8FBBE731741354E5EAE7E6278 [email protected]
1,666,222,569 *AF508DF9706555324F70307F03D1D07ECF6549EE zona1mewmcleoqh
1,666,222,570 *AF5FBE199BC20DD75E9E89FC600239000194EC1A zvogrszkoga
1,666,222,571 *AF5F9E5D839AA89224A1947565FA469E8CD0C7F6 ΝΕΡΟΧΎΤΗ
1,666,222,572 *AF54438C897E0EE894EF5BA95DDED805E7073872 АТХЛЕТИЦ
1,666,222,573 *AF50378D8E02BC33D4A748BA0A11AE5DA2B7AA55 ВОЗМОДЖНОСТЬЮ
1,666,222,574 *AF5E14FF006E6D7DE2E1F7111227E37E7CEC07D9 «ДВОГЛАВИЙ
1,666,222,575 *AF5730EFFCC151C6BADA7995D93808E1A1D70AA8 желюсичем
1,666,222,576 *AF53659AF2CE8FF20A4565B276B2CE3BE18B6A57 4ODNAZZELO
1,666,222,577 *AF5D50B9CCA20C634D22462EB2A70472D982DCCB 4PRCNENET
1,666,222,578 *AF5412B761EA17374E753B1C347B0C88460E343F 4QUIPPIAN
1,666,222,579 *AF5A7F0F473727C5F4C3DB284D0479FEE52BFEA1 4RIPUDIATOS
1,666,222,580 *AF548CAF3D56395FBF7075327188230D478C4025 4TITULARISATIONSES
1,666,222,581 *AF59BD486742CE7EF6158AE1D8B964EED2EE2C44 5BBLEDKWNMOPBVBV
1,666,222,582 *AF522568A9A05FA0FFC85A8289AC148A4E43BDE1 5BUDDYRAIDERS
1,666,222,583 *AF53A846B5E74C9CE3298391A2119FD865450BBD 5cardiffcrescent
1,666,222,584 *AF5398B5992846C6B71F72D2426E0301B761ED65 5.halogen
1,666,222,585 *AF53A1474F116CAD6D63FEE19A051F129EA8399A 052ROLAND
1,666,222,586 *AF5DF9DEAAFB2FCAE3AE92A94FAE56B4796D75C8 5OMETTRAIS
1,666,222,587 *AF5B7396F56AC1A140E3330225B0BB2DA08F195B (0_<)O~-(####Q
1,666,222,588 *AF505AEC84D1AAFA6348EE8A9057416CC383650E 0THATCAMERA6
1,666,222,589 *AF597F7DAB72A7F59C095C07755B4B1B3324E42B 5THEGRAYRGNBSW
1,666,222,590 *AF5348C25DCFB0F89D8E4EB0A86308E1C579FDEC 5WERKBLAD
1,666,222,591 *AF56461D7D54AF7A0F9085940A624C9F46834090 6ASSIZELAWYERLAY
1,666,222,592 *AF55AF2CF6936BD8AA2CDCB61A5D75EA5FBB7A79 [email protected]
1,666,222,593 *AF58CC4F0DDDED71DE10CD96A6FACCD7BF03186B 1405667 NOW PASSING THROUGH 366,000 FEET
1,666,222,594 *AF5F83E084135799832B9EF09EA29F2EF090CA84 6DEXTERCHAMPS
1,666,222,595 *AF587E9A5398DD6C8ED36E51DE67670D4D12938F 1487403 OMA KUVA NUORENA SELKIINTYY JA IDENTITEETTI LUJITTUU .
1,666,222,596 *AF5F3B625A0F902609609D88FD5757EC98FD913B 6FIXPUNKTER
1,666,222,597 *AF5F1F7D083FA9696766CD2595C3A98BA15F5CC7 6M60(T1)(240PS
1,666,222,598 *AF54DAE5126F8823F7E3A109914F78157FBE6797 1996年型TZ125
1,666,222,599 *AF55DCC02CD4F8037FFE7CDD6016278A25EEFAB2 1AVAUSKAAPELILLA
1,666,222,600 *AF55B80F499A73D5A551EC99417E152201C5F3D8 6RUGGHIO
1,666,222,601 *AF5856CF9F9853218E5EE682264FE89B4F7AE3AE 6THEHILBERT7
1,666,222,602 *AF5636BFD94FD45EAB0B022AE06648069354B9BF 754798 YAZI TALIKTIR
1,666,222,603 *AF5E073B69B76AF0B880BBC0ACE3599039F0C009 1.FLIEGERHORSTLAERM
1,666,222,604 *AF5612FAA26093EDFCA07FB0811A6000676A9A8D 1gefuehlvoll-empfindsamen
1,666,222,605 *AF54C8DFF78F0800AA1A02663E2EC351BFB5C7D8 1GRAYTONY
1,666,222,606 *AF5013C78411431CCC2EC82944E7C6D26C2816F2 7BUTLERPARKER
1,666,222,607 *AF587A956AC82BB6F8A0465FF6C29150D7D75B6D 7DEMPIGDEMPIG
1,666,222,608 *AF59BD53580CB55D5E93830564E82D04A515C64B 1-karjalatalolla
1,666,222,609 *AF55FA35F6CCA0E5B1FB52017EA558EB586C8CF5 1.KOULULIPPUASIOITA
1,666,222,610 *AF55567B2C522366DBEB7F62CC839298284986AF 1-LAERMGESTRESSTEN
1,666,222,611 *AF5332E4688076D65802E7C2DB5746FA506B1964 1.MATALEMMIKSI
1,666,222,612 *AF57BAD27ED6CA0D66D8F78186E4CC50C7DC5877 7NEDLEVAKTIU
1,666,222,613 *AF51A589BF7870465A854FDA1A9A4B9834D96CC6 7NEWCOURTQWERTY
1,666,222,614 *AF599B02D564502A7AACA28ACE83B46D89272FD5 1NACHHALTIGKEITS-INDIZES
1,666,222,615 *AF53223E10EBA64FC08A361C713EF5B7FDC00456 7PORZADNE
1,666,222,616 *AF535B160417A492386BEFDCFF92A86D5EA2E382 1pflichtstunden-ballasts
1,666,222,617 *AF5AC09FEA7F1407778C01545B19E9ED51314AC9 1 POMPPIMALLA
1,666,222,618 *AF5C949DF2B78DC3B2B8D7D1BEE70429F6D21D10 1potdevin
1,666,222,619 *AF5B02D46C8623D0EEBCB1D8AD056129E5E5EAF6 7thatchang
1,666,222,620 *AF5EB86016F3E546F78F370C27F9543258734982 1 SCHWEIZER-FRANKEN-ANLAGEN
1,666,222,621 *AF5620BFE4223595832D689242D5301BB7F7BDD7 1SHOKEERAVAN
1,666,222,622 *AF53A84FFCFB1A7430D9607A36CCB619DA368FAC 7WONDERSTAR
1,666,222,623 *AF54D6BDC001A74180354535427F76DE240F5150 8091819
1,666,222,624 *AF57E485EB2447FC7003973C94C8D50338E3C12B 1-valtuustotoimintaa
1,666,222,625 *AF5375E513ED309548D3E94D98846A02B242AA67 8CONSISTIRIA
1,666,222,626 *AF5EB3127A508BC0DC7F2924ED5C438A5009756D 8ETOILEMADDOCK
1,666,222,627 *AF5A2E3357EC059D00720B7D7DBECF6DDB0A7A2B 2140696 MILLOIN OLET TYYTYV
1,666,222,628 *AF59C939C4A41EB9A8EF1F0ACEB477E6A8649B4F 8LEAROCKA
1,666,222,629 *AF56C4511B4592BC4983ED49424FAA433E0EC268 2377606 tiedot.perustuvat.viljelij
1,666,222,630 *AF5301D7FDA80BCD4DDE7D788C3BFEAF68F7ECB4 }8{~`@===p
1,666,222,631 *AF57C00762CECACAEAE456AE3E0BB5DE0EF213F9 8UKUFIAK
1,666,222,632 *AF5A117CCEDD5A940BCE34FF7FF121E5322632E6 2.ANSIOSTASI
1,666,222,633 *AF510F4182877E5DD0A18864C1DDAEB4D4B404DF 2APTITUDINAL
1,666,222,634 *AF5D7A1811F32C49ADD2A108ECBFAC50CEC5C5E5 8WAITERINGS
1,666,222,635 *AF5D98EC10F39CB0750605B84844B6A23CA24B77 2bulimikoilla
1,666,222,636 *AF5BC85FB98100800E64712AF4B473A3B6517301 2CHATAIRA
1,666,222,637 *AF5B58B7E4C7004D11A5ECC999F034523564B045 920953 ona projeyi anlatip " istersen katil " demistim
1,666,222,638 *AF5437BEC0D6AA9A9DDEF0ABCB4FDD908DE2804D 2-JUNYA
1,666,222,639 *AF5A2D09C56B4187EF3D535499E65DA5328A7E83 9BSWSRCINCBSW
1,666,222,640 *AF50162E0BAAC20B7C520E44E4628A11F934D931 2ROMANTA
1,666,222,641 *AF5B7DBC200F09B9D52FFEF6E94391F82E4CDCFE 9iamlab19
1,666,222,642 *AF5EA75241B6A0D90E60253100072F613B80DF9A 9MONARCHIZERS
1,666,222,643 *AF543137C585CB6873EB09BD67FC7C176752D5E6 3B<-~`~`<###8
1,666,222,644 *AF5ED4E06953DF92EC360EC11868556E2236796A 9RETNECMU
1,666,222,645 *AF5D2F73B075BD3E8F920A918433D2B7225E8477 3FASMODEM
1,666,222,646 *AF53E66E03985BA37ACFB13552003BA0605D0B75 3HALTGAMA
1,666,222,647 *AF5E61EDEFE561FFECF56D4DCA59F02EBBD68420 9SODBUSTERN
1,666,222,648 *AF50E8975FD2ED5C6450EF59DF0B0E9C273A7DD0 3.kachaber
1,666,222,649 *AF5C29F51D0E27EAB5A331C5B0210C9D97966E4E 9SRENMIL
1,666,222,650 *AF58062CFC59599DC3160F98EADBCE2316E42AD8 3KUMSIKIA
1,666,222,651 *AF5BC712B3612B77F48E98C6E2650BFA5ECDA0C1 3merhis
1,666,222,652 *AF5F96F65B96C989962422EDAE3A04D673C7014A aab+r
1,666,222,653 *AF5420C089A8EF467DC2163659C787B4988983F3 [email protected]
1,666,222,654 *AF51D645B249E06C4434A84D9994E7F52CD6A829 AADUM%
1,666,222,655 *AF540D10FF22294157BA56DE64E30466DE802ADF AALD>
1,666,222,656 *AF54A005432AC61ABE07DF1772CCBF3AC90B5943 aanvoerbuizens7
1,666,222,657 *AF5CCE73DC90893FCF76824DD418847032C27D82 51MARLEE
1,666,222,658 *AF584DB9C035832F5C69CB522AA5390C402575E9 593104 kuvat-omistaa-kaija-tervo-.
1,666,222,659 *AF5C08BCEF959AAD557248147527E4737D358909 5abruestungsvertraegen
1,666,222,660 *AF543D29A71A1C4D964EC9F3D96AC8B3769EAAEB abdulboudin
1,666,222,661 *AF5998A48D500912EB17331E161F4FB401E52934 ABE SULLIVAN
1,666,222,662 *AF57D9FB1C4C053E64E83ADAA89FFA010EB0565A 5BSWPOSTHUMOBSW
1,666,222,663 *AF50C159524762DE3812CDBABDF754891D2F1B5C ABHISHESH RAO ARAVELLY
1,666,222,664 *AF51C51961DDB1D94214F4C9572F94316B559E1B 5CEVRASES
1,666,222,665 *AF589ED56F804FC2833E5F4B6E805111F44DCC02 abns17
1,666,222,666 *AF5F7AE80BDDB45270EF48420D51649334CA64E1 5ERDICALI
1,666,222,667 *AF55151F8BDABAD9E4C80F76C09D2278EDF66CC8 5.ESITTELEVILLE
1,666,222,668 *AF56404D25CF3ED9481C7553C5A9BE7DFEE29EC2 5 GELECEKSE
1,666,222,669 *AF546093EC2F2495ECCDE9B154698EEAA5D25CB9 abxdq
1,666,222,670 *AF55BA36D7765ADFDCF10C298907C655026FB3AB açıqca
1,666,222,671 *AF5C865438F240860AC3A7492099B6437F9E047A AD3JK
1,666,222,672 *AF5F20B99E6293B203FB78C17AE7CB8D87F6D202 5TENNISBIRD
1,666,222,673 *AF5B71553C9BF985493154A7177D36792CE81990 ADKL$
1,666,222,674 *AF5023B2AA7B15F4ED81B16F958F8E10185FBA98 adp%
1,666,222,675 *AF549E58D27F0D6894AC7DD7F114B2C33A51712A 613434 sayfabaSIfiyatlarImIzakdvdahildeGildir
1,666,222,676 *AF59408F86B8DDEE981C7E4A18D1DC00979A445F a?,#e
1,666,222,677 *AF56FF3E47C29DFB3093261FE68BECA99AA5C989 6BSWTIMEINTEGERBS
1,666,222,678 *AF52400B157619481182F4218DB3FF213A69DFB9 afgeploegd4
1,666,222,679 *AF52E621DE0AE4250CA3104A6884257062238446 6FERLIES
1,666,222,680 *AF536A6C37B88931708B3CF5457662A7F1DFCDC5 6HEATHERBARNEY
1,666,222,681 *AF5A867749ED98940C907D792D1A0BB6A977C121 6.JAHNEL
1,666,222,682 *AF504E50CCF0E468DD1E5A270E1A35C85036B904 a$ib$
1,666,222,683 *AF5CE5E6C247A986BD84B0BAD3C48BF0B0F81CF3 a?ik
1,666,222,684 *AF5EA9EECCFD98C26EA27B2D7868F73FC1EB6A3F 6RABBRUZZOLARE
1,666,222,685 *AF5643DF2929D46C5003E2FA49B85FFE1786E422 6SCHALTEINGANGS
1,666,222,686 *AF539C307DA914C2E2A3E056B320F36B1D370DC5 AIZSTĀVĒTA
1,666,222,687 *AF50CEA67D9E54CE2B871CBA855380BFEF31EC26 6SEPTEMBEDRUMS
1,666,222,688 *AF51327F1ABABE3CADAA3275A34523B6F2291F56 AJERHUNO6
1,666,222,689 *AF5320026BD509CFDDF5EDCE562B376BEF4614C7 6TAIDETEOSTEN
1,666,222,690 *AF566543F7C6892B430385B3A8AA25C4BBE67258 AK=QE
1,666,222,691 *AF57E609A1C493A81C10D67381334629AEEC68DA 7AFGEGETENS
1,666,222,692 *AF5C776CA42EFA907D926274AACC221B108A84E2 7ANDRAGORUSBSW
1,666,222,693 *AF59270746608A5E3320EACF17D7AE7B6FD988B3 alexander.n.voronkov
1,666,222,694 *AF5D3235911C5EADA6E03276BA65314943B71A31 ALEXANDRA-ALECSANDRA
1,666,222,695 *AF5121B767DAED339CFFE3AD8654EE186F9EC355 7BURNIJE
1,666,222,696 *AF544986A21FA7F8451DD8E6A10833A12F371988 7DSZPHOLMBSW
1,666,222,697 *AF5162A001EC1B741D2601E29F618782B82F0821 ALGICI
1,666,222,698 *AF5C26FF0A1BFDB25F573A4660D776F37F957AB4 alison.herber
1,666,222,699 *AF5DE9FDA26CBC201B988E09A5B2FA5814F7CBE8 7HENRIANN
1,666,222,700 *AF5D11032BABD8C04239E1F136AA64C0E095EE15 ALLDERIDGE
1,666,222,701 *AF5E711BA5B4720C1E701114497F6C8FC797677D 7MATTMICHAEL
1,666,222,702 *AF5D906EE9D8CF75F6D9878F3DBF15B3587FBC9B 7PEARLJEANNE
1,666,222,703 *AF5D4B668B3190E7616A7769CA35A992E9C9881F amaatfil
1,666,222,704 *AF504B5535ED248A3B3D9A78EB170ACB7D69DE63 ANDREPATENAUDE
1,666,222,705 *AF5CD3A00AB6BC4A225CBC84107C92E6FAFC443B ANDRESERWAY
1,666,222,706 *AF53906ABDA7CAB5A88543005E06EC57DE472B52 andrewnorthouse
1,666,222,707 *AF567BA029EA71A0E66D8BAE0D8C52554885B913 8ASPIRADORASBSW
1,666,222,708 *AF5017D189E04DD8541D02575CDC342156DB9EA6 8D~0~osplat
1,666,222,709 *AF5D2D611B45EF0BA18CA962FB31DD2FDBC7BE27 ANTHONYAUGUSTUS
1,666,222,710 *AF5539BE6BCFE0D642C1DCE215E242138B75C37B ANTIITALIENISCHER
1,666,222,711 *AF5F4E68978737F916E5CC24C09EBE6AAEA5E50D ANTONESCHILLER
1,666,222,712 *AF56784825027CA4801D58B9038239CC4632FEFB anu3m
1,666,222,713 *AF589F837DD3F1DD2CC21F56D6EACB07DA16F152 aopn
1,666,222,714 *AF5410EC5567717FDD64FFEA3554AE6C0AAA8901 8####p~`)0(
1,666,222,715 *AF59FE4061E78667682B292FE23EFD605ED847FD ARDESIE8
1,666,222,716 *AF5A53DE8377DDC2BB0D54F5064DE92227ACEC95 ARHB
1,666,222,717 *AF53B809C993F0407E41D0088C3329761058F577 ARISTROCRATICĂ
1,666,222,718 *AF50A4BCB3B6EAFC73A1D755C1BD15003F3E7F37 armandgwalthney
1,666,222,719 *AF5A9F261685F5DEB7F5EA8650E4D944C3501F7D 9BOMBANTIMASQUEANTIPERSONNEL
1,666,222,720 *AF57778E2A6DF0B13CD1B7FC2B8A48DAB19331DC 9BSWFSAVEDSTATEBSW
1,666,222,721 *AF5B5744C3CADBA02688B962DBE9E2806A8EB132 arnulfowentzel
1,666,222,722 *AF584D529F6C3584AAC3698A70D50A3550F732F6 9C00E7DD1739F93BA25752C0A9629C8B63
1,666,222,723 *AF5200E5D5D0389D0667C33A1A4FCEE737383BE8 9IMMODESTIESES
1,666,222,724 *AF5755B1933D891E004406EEC66504AE60881ED0 9JOANNAKITTENS
1,666,222,725 *AF5EBA5B87C5DFA72C8E91830469B7EE7C8941BA ashlee-eddy
1,666,222,726 *AF54246315E39B73FDE5D483D65E26BE656B2C48 ASIAN.WOMAN
1,666,222,727 *AF54800FF8678F46E959F6D349BE051169D24EA3 ATOUSA SH
1,666,222,728 *AF56669237F0F6CC11D9711957891BDD870231FA 9TRAFURARE
1,666,222,729 *AF55585831609947E839D085D1E9A9D2175B3E89 a)tze
1,666,222,730 *AF502703C8DCEB1840765F1133891C7C84027F4C A0MPO
1,666,222,731 *AF5A980DE3A0FBC133EAF004403B44A918AC692C AUTOD3PO1
1,666,222,732 *AF5399FAE4CB1EEE0047612119646F83CBA3FB2E AUTUMNSHEBBS
1,666,222,733 *AF5C6C979914DA1E4A116A3F35D53C1FF6B3EA84 AUW7P
1,666,222,734 *AF59B51870B4A025E7EA8014684E02B8471E008B AVALODNOD0
1,666,222,735 *AF5789542C6338B7E9DA807DBEDBAA9B613DF0AD A8HENRY1
1,666,222,736 *AF55448CFCC7D5960CD70AC6986179C91D9416CC a")9,
1,666,222,737 *AF5064F8C4ED3635CB3A6B0BB77AD66F4F60C3B9 A"Y_W
1,666,222,738 *AF580D7A1DAF480C50ED58AFF17255900D7B6B0E B.0C0
1,666,222,739 *AF50EC48900758D6F71D7329E6879A1EF8606D83 aac#s
1,666,222,740 *AF56AA804FA1B9F79F4A206201BB58FF52BD96F9 aae:dk
1,666,222,741 *AF5829902FF5E9B3AA36681838599499B0D2EEA5 AATIAINO
1,666,222,742 *AF506B0CAA52F27F6AFE205E79484F276B451A5B ABLN/
1,666,222,743 *AF5E4AAFD3E578A025CC449F8342F485CCB40913 barbellula6
1,666,222,744 *AF5C0673C699F44D90AF7C2C3A15AD9198AD91AF ackop
1,666,222,745 *AF526C107D86FB01B95C257A6469297FBFFDF1FB act 2 - ma dall'arido stelo divulsa
1,666,222,746 *AF594071FF3CA83B3776BC3DBE018DB86CCC824F BATAILLE-DE-LA-NOUVELLE-G
1,666,222,747 *AF5DE9866DB67C95C166B389EF6CD85F7C6C4559 b(ax
1,666,222,748 *AF5C2A3020FC82CAFAD57B0F81CCD5BEC03952FF ADELAIDESVG
1,666,222,749 *AF5E4A3C90D1703FC4796B0731B51C44884CA7DB ADLLIMRA2
1,666,222,750 *AF5F5CF235CB2C79506F1B2B550D29ACBD186FF3 [email protected]
1,666,222,751 *AF5ACE179032826FE33E48C4BF06836D38FEBF90 ADOLFOSURRIDGE
1,666,222,752 *AF5E383C49148AD2CC899EDA5ADADF2CC5B39161 ADOZN
1,666,222,753 *AF5727993E3869A99EAFE4E5BD21A27FEE0D9BC9 advalevy
1,666,222,754 *AF50D40D21BFE884CA5634B50DEBCEF5B3B79664 behm2
1,666,222,755 *AF5F85ECBDBFB29DA2D285327DC8425912AC8698 BEN-ADAMO
1,666,222,756 *AF5BB1BBEDA1BEBA5F2CCDEDBFD9F4C7AC76AD85 agh,g
1,666,222,757 *AF5AF30546DB52C17475867DE0275C8AA45C33CC A&H9
1,666,222,758 *AF5562D7C835CBB2AC8481C93A6F447ED0389EFE A+hq
1,666,222,759 *AF5CAE8B535C8CCFAFE384844BA7E00BFA8D7A45 AINA-EILINEN
1,666,222,760 *AF5655466B7CE1484609FBDBC803B6A1E7DAED94 bet-against
1,666,222,761 *AF571DA30A4713046699A138FC7E084D67597D50 A?IU&
1,666,222,762 *AF591288CD06B5E159416FE39538B0816A3A1DE7 AJENATHED
1,666,222,763 *AF58780EF6E44AB4690E27AB5727F7B58E5CA099 ALADWA
1,666,222,764 *AF50668323EAE2DBF2F40E4B223993DC5E1F2724 ALBERTOCASAMAYOR
1,666,222,765 *AF505B952956685A3459EAFD696FDF3A26DDB9A1 ALDENLAUX
1,666,222,766 *AF5956E534B7FA8F073B7745FBC50604B2C733EE BILLIE.ANDRES
1,666,222,767 *AF5B77AFC42EEB1B74A1A8AD6DA2F078889CDBE5 BK(DQ
1,666,222,768 *AF50D8A67C72A075F92434ACF252E25E37F000C4 BL%BY
1,666,222,769 *AF533F5653479F1E89E6C56574B97F6D88CB2972 amos-chacho
1,666,222,770 *AF52F0C953A990F4C838F74BC03033AE3353DE54 amosquesing
1,666,222,771 *AF551124DAEE366AA8E8CB682844536145FA9209 [email protected]
1,666,222,772 *AF55B1075EC867FD85C6AB2EE7D29FED41D98C03 BOD7E
1,666,222,773 *AF5E57FF418E7BE9B0B6DF700B6F1602888CFA45 BOOKERCOCHIS
1,666,222,774 *AF59643CE704BA8FE35E3A3D1E9A5C92E7EF290F Book.of.Ways.18
1,666,222,775 *AF53697C48D1D261D652F783F326C0829DED760B B(OON
1,666,222,776 *AF5C911C554FDE20991C21309E4C9B34CB65338A bottom.heat
1,666,222,777 *AF58215E5FE60288DB61894A9C3E29A4453BD027 BOWIECHAMBER.ORGWWW
1,666,222,778 *AF52F1AD4E9D8C2A264B0EF85F242F6E3B579303 ANTONIA.ROCHLITZ
1,666,222,779 *AF5A784247B1FC4AF2BC62C50C627F59A3774BA9 bp,
1,666,222,780 *AF5C0F2AFCF9445DC704AD13E3423AA4A037E9A5 bqcu
1,666,222,781 *AF58E8A5F24DC5E3E2280C2BE0F4346CC32B0974 bradfordhedin
1,666,222,782 *AF5AC637316878938B4281610150DB8426046AFC bradfordvelzy
1,666,222,783 *AF5AEDE536F6BC674E94847E6DC98106BDEBE3DB AQAFP
1,666,222,784 *AF5AC425CD8136F88C45EA66A2984B91702D2E4B archimorula2
1,666,222,785 *AF5B0EBCB20EA279BF2D20C69F87524454A37578 BRĖŽIANT
1,666,222,786 *AF55D161A121B4B7269073DDCB35D6F8E0FCC325 arlisce
1,666,222,787 *AF5382B65830348ABE29D1FC471A70B615B2DFBA arrongrignon
1,666,222,788 *AF542A3EB7E81D78A47D3DB9DCEE5C16B9FCE27F BRITT.BAKERVILLE
1,666,222,789 *AF56FEB548248C905C1F6BC0A41ABD13E3DEED10 ASEP HADIAN
1,666,222,790 *AF5B7DE9D77AED526515A9CD874AE9F6F5710DDF asnamiak4
1,666,222,791 *AF5D490755A3FAEA175DAFB8505B9CC10DB29A9D [email protected]
1,666,222,792 *AF5958E0B894925E13674A2533D010020508E00C ASPIDISKS
1,666,222,793 *AF5974645355EBAE1524E3833E77D4815A6A5EF5 BRYANTPATKA
1,666,222,794 *AF5F8837135E6355D4FBD4B0F843B9A8BE515582 brycepowskey
1,666,222,795 *AF5B7AEB860FFEE4B601B8E69469924D6E326CE4 BSaG
1,666,222,796 *AF5D629D504DC06C3AD81B47463E30A37198F540 budturcio
1,666,222,797 *AF5522BFC1F78AFF986385B64361062554EB10CA bufordmcclallen
1,666,222,798 *AF520018DA30FC5255924A263C1E6455756CC4BF BU-KY
1,666,222,799 *AF5919188E7BC83ADADC332C0492BB4687673789 BUMBLER
1,666,222,800 *AF5F8065CCAB334F5A85043E22D526A5E82904AE AVDELAD0
1,666,222,801 *AF542A637C231D368C457EA3F01CF856976325FA bvexr
1,666,222,802 *AF586B71D25969CB13CE82B726624D217E351D86 bx+kl
1,666,222,803 *AF59C8522824CC49259151526AA474BA0718BBD6 a,-y6
1,666,222,804 *AF55B43899B69C6F82FC480B16D0DC478E1DAA2F bx&xf
1,666,222,805 *AF5F61E13F34FBA1C46AEEE9D3DE25F13833700D byronhuisenga
1,666,222,806 *AF59CFB8EDE298124C8140F4C732B8D662671700 BYS1C
1,666,222,807 *AF5A0AEAE09C74FEE1AAED8CCB5D0CB726DE1AD8 c0cht
1,666,222,808 *AF5C47BF81BE40D0ECD29915214CD18C6CEC64B9 b3ve8
1,666,222,809 *AF565EEFF1B8028250B9AC0A194DE5452F7BF964 B9HBG
1,666,222,810 *AF5C0F7B0781ADE1CE6BAE1F7D0AF77EC5B4A7E8 c8fio
1,666,222,811 *AF548181E2AD80379933B51F7DEC23E2A4804388 candelariero
1,666,222,812 *AF50A6A060EA1455BCF730490532B306B69705F9 BASILNEWSHAM
1,666,222,813 *AF575992C8D4A478EA554067ACBD462D232489D9 BAS(V
1,666,222,814 *AF5E55E1051642F006F3B8334E541B7C0F607F8F BBGK%
1,666,222,815 *AF5786745F658FCDD73D7A21F11B9700255E17F7 castilas
1,666,222,816 *AF591098373D9F95AEB8FBD612F239E85EEA9024 CBOZE
1,666,222,817 *AF56150C4887BB67BF2A1BFD347BE454715E0990 bentondaughety
1,666,222,818 *AF5C060DE5D14761850EF16947C4C0C54571A925 ce/!
1,666,222,819 *AF5E6A06F68D15127C04CC2ADFD04241F7286D7F CeeX
1,666,222,820 *AF5DE0D9CAB6157E2EEA20659C0C42112410824B cel.corpuz
1,666,222,821 *AF5ADB7FF4059B6B540C276E6398754BC359544A cembalokonzerte in adur, h. 437: ii. largo mesto
1,666,222,822 *AF5533DA338A4DCD29A380BBA808F68D48A75485 cesarcolumbus
1,666,222,823 *AF58226105B957CD60985644A25753D37CD99F94 bfobm
1,666,222,824 *AF59634A93DBC03B86C4D4B2419C8BBE14DBB7A4 BILLIE.SCHULTE
1,666,222,825 *AF569003C4625186B712E9DBABE992443BEBAB64 [email protected]
1,666,222,826 *AF5C21686755F132C814038DACDD9FCE65872063 charlie-otoole
1,666,222,827 *AF54801FA97DABF696F54EE703D56503B3AB423C CHASE.SLOVACEK
1,666,222,828 *AF5E85B30F670B36D067D58B3CB3DE682BC7076B CHASLECLARE
1,666,222,829 *AF5A029453068BD2650A81BC386F622CACD6885C chaunceywinick
1,666,222,830 *AF5046DC413838EF5C462C8CE80987BBADE6EB9C B%K=,
1,666,222,831 *AF5DFA45AFEB90FD3D0DD05248DF60C46F149275 bklv5
1,666,222,832 *AF562EE28164A568332B2E30C069C1BA14EA39BD chingcheh
1,666,222,833 *AF52DD2D38CA99DB1189A52F0451EA6D4D91D68E [email protected]
1,666,222,834 *AF573CD0E9F12F2C04831D9B0A85E65124913026 bloodontherocks
1,666,222,835 *AF57FCF6991660EBEE4E780BBA389B9175960B04 BLUTWALLUNGS
1,666,222,836 *AF5822CF6EF570384B208E13B3CCB32ABC48253F CHRISTOFFELDARBOUXFORMULA
1,666,222,837 *AF517233FE0F859C75BF3824335828146D11B3E3 CIQ_I
1,666,222,838 *AF52436C58061BE90C7837AAB84C99A098E1EAA7 citut
1,666,222,839 *AF5161965F881EE43EE48908B19010AFAEB539A5 BOEt
1,666,222,840 *AF519788EF95D8072E3FD9D19D66F6130254F0B9 CLKJE
1,666,222,841 *AF595B2F195440AEF0FD0DA022BB72C6E22DD1D6 cnk.a
1,666,222,842 *AF5CE5EE08DA6BC953F9C389BF9F69E4790A79A5 brenden007
1,666,222,843 *AF56F999ACF88C65CFABCBB296C0B93BC56B1318 COL.-T-UGG-LEE
1,666,222,844 *AF5C491578DFB3A1855EF2C36CA49C913E9EB64B brockboruvka
1,666,222,845 *AF5D391156091733FBE4491BA38ECC58B29FA5C1 BRODERICKBIERLEY
1,666,222,846 *AF567AA84368DC92D1368BA238E13353B1525B87 comna
1,666,222,847 *AF5C3605EE81CEA30D808C79CABDD8771143C6BE BSCHOOLDEN
1,666,222,848 *AF5B34E91EB9B536D1A18790B9FB4984B2A92E22 conniejessica
1,666,222,849 *AF55E5A920430F3CA5EC165888CF393AFA944B0C coral.newton
1,666,222,850 *AF57C1B8A50A4D660FE123D14BFF9D1674C886F2 BT}B
1,666,222,851 *AF5BA621E120067CD5B91DC5914D532706E619DC BUCKINGHAM)的教會,且直接經手於邦瑟爾的父親,因此可能是他的不具名捐獻。法官為此詢問了邦瑟爾大約10分鐘以作為測驗。
1,666,222,852 *AF5605A91B8D8513E690B8FC1BB6CA15F281DC2F c$#ov
1,666,222,853 *AF58FACBEF53FDEF17606C3501F7672446C08144 BUFORD.STENSLIEN
1,666,222,854 *AF5D093327A0B83627F4E829448766F1193C56B2 CP5=
1,666,222,855 *AF59DD7AA652A09AB0FBA27E0028094EEA3EFE48 bxfev
1,666,222,856 *AF51F53FFE675F162A9355897469B3095B70026C BXOT0
1,666,222,857 *AF52CADFC4457C574592FF5E64FD3F7AE290AAEB BZ)OW
1,666,222,858 *AF593311069624B363EBFA44EE4CD554BB6E78A2 ct0hd
1,666,222,859 *AF5EC3B4F7ACF7B27FD8EA33B99477E6D6F3BB56 Ctsa
1,666,222,860 *AF5ACD009CDDE976F2EEC8D45B36579825D6E268 c8f08f959ce93d3a8714a7f4e6a3cd93
1,666,222,861 *AF59B2072BBDDB23BC21E8B207C97D9D06DA0D72 c"&v
1,666,222,862 *AF52B350F0B81233777DAD0675D33D53A6C481F1 CV!PH
1,666,222,863 *AF5B32C72FFA3B83495EF4345DA95B8C57B74776 CAMINHOLAED
1,666,222,864 *AF51841978BAFDCB2722CA27645B95FF346BC9B9 c/x_o
1,666,222,865 *AF5E08BE60812BEBE2D72D91EB8E52378F182F81 cydo
1,666,222,866 *AF5EE87096988A8CE24DA461370B05318A74F13F CAPAHCHOS
1,666,222,867 *AF5A9ABCFF729D74C08FCEE86FFA9D70AA8F4E80 caragano
1,666,222,868 *AF5B54246A4AE5DCFF23A4F4F91A0D932C8B45C1 carmenmulnix
1,666,222,869 *AF5F5A5E2F038FC9DEF246F8C740C5226DC8B1A5 D=11V
1,666,222,870 *AF539A625130179EAE95FB9930C8E2B7EC6370FF D16f
1,666,222,871 *AF58F8BD74AE748EDDB47DE310C1926263822B49 CARTER.MCCRORY
1,666,222,872 *AF5FEEF1D2D648E972DB3F8525B2E74931F8C563 carydinn
1,666,222,873 *AF5C4D99B752B1B291BDB1438AED8A64F53092DF CASEY.MORINVILLE
1,666,222,874 *AF52243073E8A3E7A1ECC6F29E9A44B85FEE819D D3P0R71N9
1,666,222,875 *AF51F0B00042D1A6FA28C7864B19A9C99BCE2854 cba&u
1,666,222,876 *AF5DD1A354E4EF8AE467393D2FE7F4D488F853E5 CECIL.TREICHLER
1,666,222,877 *AF5ED8DB9AB2B9345816E8E2B89880A2C98B53C5 c:eed
1,666,222,878 *AF54D5B7E2E007B3100FF6A363BE84111995765E DANNIE.KMIECIK
1,666,222,879 *AF5154CF02FF184EC2BFE07280541CBCDA9E75A2 DANNIE.LITAKER
1,666,222,880 *AF549A809D845655F046E97E3675ABD19978CAD7 CFHIP
1,666,222,881 *AF5713995FB58926C9EE2FC783E3E50355BA0C22 c:fqy
1,666,222,882 *AF5A06EAEFF9C16D42F4544E320F41FD5FB0A9B9 [email protected]
1,666,222,883 *AF5A545FA1E691D9FBD6BE2EBA8CDA67025CD583 DARMSTADTIUM
1,666,222,884 *AF5CCC49FA476CC5B6540AFC0D8B13284915858D DARRELCADORETTE
1,666,222,885 *AF5217D0491FC92F19592443A494FC032863F01D DARWIN.CHRISTEL
1,666,222,886 *AF59EFA2F04C64627BD4133BFAD4328E1FC52236 DASERTZSTIFFT
1,666,222,887 *AF56AFD8966370D7C5C906BED88979DCCC429958 CHAITRAHG
1,666,222,888 *AF544BD55ED7FF168F49266F0E16DDE2255DB134 david-cronenberg's-wife
1,666,222,889 *AF5CEBA388BB0A46E354DCF48FE805DBE9DCBD0A CHAPTER4.B
1,666,222,890 *AF526E7BFA1CD0609D316AD7CE7F3E8308110B9A Charlotte-L.
1,666,222,891 *AF5E66D9C13A99F85F14FC338F3C9ABB1A2A1F1F CHASEELSA
1,666,222,892 *AF53079B172F337D681D87811CF14DA4290A16BB chasingamemory
1,666,222,893 *AF50F1E8897963217B892A7EB224EF6D98AA7656 dc$w/
1,666,222,894 *AF53285495096375FF08BDA9179DBEFC26E72542 DDRCHALLENGE.COM
1,666,222,895 *AF5D6795B79AD61F348CEA6F69E7AA01A9787AEA [email protected]
1,666,222,896 *AF59B185DCF7DAE262A4FFA84AE58972B1EABCBA deadliner-(spaceship-eyes-mix)
1,666,222,897 *AF5CB1C54358F0869AFE82FD52690291978724A2 DECK6
1,666,222,898 *AF5CBEAD280330EB22D90DC1444C6B9A65D0D315 CHRISTOPER.COULTAS
1,666,222,899 *AF5F92C0CAC3EE310C03AF0DCF5E8E71BF884F1C CHRISTOPER.MCCOLLIN
1,666,222,900 *AF5E720E75E3B323F56FB08EBF5AC07138485969 christopersansom
1,666,222,901 *AF550D4C1416F237FAA8FF027E29A04B68A22A97 c.i3n
1,666,222,902 *AF570B0DD96E0772BDF15F81E47B5DE8DBD9D2B0 Cinefilm
1,666,222,903 *AF5FF8086557DEFDF2596A9255355EDB51737C82 ci;s)
1,666,222,904 *AF520599521154ECEB1EEF9E08F84596E4E3A8E0 CKWw
1,666,222,905 *AF53AA43DEFDC4385846565B86EB6C8275AE0DD6 desiderio.arias.(merengue)
1,666,222,906 *AF51AEEF1335AE77F7DB2E1E93FA09F4C59CAB6D detalbused
1,666,222,907 *AF54F309783AC56F376B0F983669FD450B54F316 DFIU+
1,666,222,908 *AF558B34BD59E35DBAD5F41812872000063DAF5D cnlag
1,666,222,909 *AF52B673C7571E2A37F49D738CDA4D08E8C8BB20 DICTA3
1,666,222,910 *AF547BFCA077D2D600D68A34B12F53674367A816 dienstha
1,666,222,911 *AF5A6CD91013A69E5F77A048F7CA86EDC148BFBE DILLINGERGIRL&BABYFACENELSON
1,666,222,912 *AF5EB0ED0F96023E1952AD8702ED4C719A5142F2 DL9SP
1,666,222,913 *AF55ACC5E51471A6B7AB5E701B45E909D97ACCE0 DLZMP
1,666,222,914 *AF5A9A3DA6F78837770AAA29501D49A6066DFC79 c:\program.files\windows.mobile.5.0.sdk.r2\pocketpc\include\armv4i\comcat.idl
1,666,222,915 *AF550CB2576487700791FFAA8A95FAD95B0DF5AC C"RA9
1,666,222,916 *AF5A50939D5C9C1336FAC0DDFC264FBDFA285294 DON,L
1,666,222,917 *AF5BC143E17A1CBEADB100DE3684D4C58140B7AF DONNA DIANCIN
1,666,222,918 *AF52362BDF0F52CDCFCEC590E01A92DAF449465A donperler
1,666,222,919 *AF584D85EE83BCF6258D70C538702D2727574337 cristina-medel
1,666,222,920 *AF53F54C6B4E6DCABD08B5A7B3E2AD5B5ABCCF3B cristobalconsalvo
1,666,222,921 *AF598665CFBFFC032C80EB1009A7326B7142CE5E [email protected]
1,666,222,922 *AF51B4077414CEEC9C4F4EA6C4FBB6E26EA79805 CROFTLUMBER
1,666,222,923 *AF50EC0B474DA88E287ED451EB5A8F038FE1A09D dosendered
1,666,222,924 *AF5069FD274E7C8133B51AF5E751EA0ED5BA5050 c?s.2
1,666,222,925 *AF564087D0FC96017A4BCEE990928402286BD594 CS8b
1,666,222,926 *AF58AB1ECD801C80A195CD119DCB521E24BEB53A douglassstefanich
1,666,222,927 *AF566A6D216781226F18D4C60BA56DDB7C468B04 ctd(5
1,666,222,928 *AF5AA39788B94C17140C78584A61983A14A9C371 CURT.CARMICKLE
1,666,222,929 *AF5B151818A8C1C4E868C24833D96893BA9760B6 DREW.JULIUS
1,666,222,930 *AF5B6AD2A8E399371762CC94650817DA6EB19F72 C}VQ
1,666,222,931 *AF5E5B9348698B563A942EA009BE54C043ED5144 cwmtp
1,666,222,932 *AF5FA83E03DB8CC2B62CC158BDC0A3D095FCC0A4 d$0lh
1,666,222,933 *AF5A28A97B34C8B18493F385368C6007C2F8C834 D3SLUMBR3S
1,666,222,934 *AF5A8A9EE8D3D65863E308B946C30F139DBE9B8D d3t3rm1n3dly
1,666,222,935 *AF57750BE1E0EACEBA33045AED5E3589A6436078 D=UUL
1,666,222,936 *AF53ADD652912C690E3852B9762ED2CC26C2DAA4 d,vk
1,666,222,937 *AF50C10428FF2CF17F5D76D24D2CDF8502019A6C D6CZ
1,666,222,938 *AF5D0BAAE53D1C66773C2A07E334BE36A3A69C8E da!4.
1,666,222,939 *AF5F0E1CBB47C57D388B9882BA4B15C298CC86B3 DALLASBENNICK
1,666,222,940 *AF5E038A9AFFF0B4A037802B5F208BD6FC798E5E DALU
1,666,222,941 *AF5E9EB787A38FDD94FAB57FB1A8FB9BD6EDD12A DANIELERIQUEZ
1,666,222,942 *AF5C4E7E725C8379AE3A5FBC77FCFA1488BAD4A8 dzf=/
1,666,222,943 *AF555EAC5C6A5B803478A6EC422D0D713EEB04A4 E5F98FE31B
1,666,222,944 *AF576DF7FAA42CCD96A52C1A387EF0455D197741 EACPQ
1,666,222,945 *AF5855195930C6E4BDF3AA43A849E1C03D68A039 eaphotographs
1,666,222,946 *AF5D8EFD53464803B7DD0D58C6891AAA4559E1E9 DARRELHANNIG
1,666,222,947 *AF5574561BB2043449F42E148FD0C5ABF0E162E6 darren673
1,666,222,948 *AF52B54405228C80DA23E497118B5B8D02EDF5DD darrickorloff
1,666,222,949 *AF508ED88481B702ADD51BCFE0486869F337C45D DARRON.ARELLANO
1,666,222,950 *AF5947408944BEAA8AF66C918BC8EB38F1F00E05 eb"$k
1,666,222,951 *AF5C75293AF7C107C8464E0B3C50D152931F2766 Db%c
1,666,222,952 *AF59D7A67B11B6DA8976A69069336E03D7688EC1 EDNREDOL0
1,666,222,953 *AF52715F7244777B8889DC6C9EACF4B9833B2D4E ee,fa
1,666,222,954 *AF5C62450F68AB3EFA0C402E93F4E8D527B6E6FF ddw1
1,666,222,955 *AF5A4C207AFC23EE4A94D88E5F1BD27B43710E54 deanbuttel
1,666,222,956 *AF52863B0F641398A0C829BDF429ED8934D4DD99 egelicip9
1,666,222,957 *AF5C59D2C1D91B24660EF31BE34919E341B557A7 deb4f
1,666,222,958 *AF5034341BBDB43F657DEC86D96C98877A9AFC4C EGMONT-PETERSEN
1,666,222,959 *AF5280A355F0ABF8ABAC798757B327CAECBECA78 EGYEZMÉNYEKNEK
1,666,222,960 *AF5EA30E67C05A75AF55F623516FCF5BC873570D EH:7A
1,666,222,961 *AF55B6B3405AAA54F56DB07B131AFD1B616C6CC6 dek%c
1,666,222,962 *AF5CF00F8C4A02C9DB1BFA2793DF15A5E7FD5BF5 DELIMITERA6
1,666,222,963 *AF5FEA32B1EB7C448FAFDB76E21CF3D365AA2117 el.
1,666,222,964 *AF505996DEAAD27FDD374046B990260598983933 demolitionN:demolitions
1,666,222,965 *AF5A348E8EF0C81C4D62671275E7EE469E5A8FC3 ELETTIRI9
1,666,222,966 *AF56FAAC1B9CEC8AB492A70685D34231727CE6FB ELINUTZA123
1,666,222,967 *AF584C919AAB5570C4B493FAA05F67DA837DF4AE elizabet18
1,666,222,968 *AF54C1BF49E643E732165BC320BFEC624872C82F [email protected]
1,666,222,969 *AF56100EC1CDB14E986E2406C7FE21442C8AE7BA deplaires1
1,666,222,970 *AF56C5C3B6FA3BCC9AE92440ACCC8907152661F9 ELVINMEIGEL
1,666,222,971 *AF5655966495836D60AB7AB2B18F8DDA809D511B dermouche
1,666,222,972 *AF509FC7D8F516CE5778680A0DE508002D557822 devvj
1,666,222,973 *AF52BD148399429F4994407BAFC63E35F4A3748A EMMITT.SIVERLING
1,666,222,974 *AF5C232EAACA851199F8058AB2242BA331A5AF5B dfjm/
1,666,222,975 *AF54EA8883423E5D928A9E468C6A99CCBF72860A d!g[
1,666,222,976 *AF5AF93E4D0F4062E7BF20594F7A5E081A436233 DIE-SOLDATEN,-I-AKT-4-SZENE
1,666,222,977 *AF57BA748442979CAB718C18D1AFA04E93586825 di/f
1,666,222,978 *AF572E6CC495D7D53957319123BFB369E9A2856C eq(g
1,666,222,979 *AF5EE9D7C4963EF855FB59AAD6F139563A1A3885 DINOHOOTMAN
1,666,222,980 *AF53BDD57E59A17DD4932EEF758DB4F88D2DB1C3 [email protected]
1,666,222,981 *AF568CF4EBD353C0CFD2AB4A4FD59897098168E7 [email protected]
1,666,222,982 *AF53DDCBFE206CAED44EBBE21704CCB60A1BCADF DIÜRÈTICA
1,666,222,983 *AF5032A03EF5D4ADC36891B65DCD8BE9D5FFDCC2 ERNEST.BARBAGLIA
1,666,222,984 *AF5C0F3BE4F931E3E56F88ECCED37C506B8BAA46 dj-#
1,666,222,985 *AF5A4243CE97E5E30F6A2261962858CEEBE65F6F ERTAKESTED
1,666,222,986 *AF5000128F7A3F0793F41417D4DF7A7753D5B60E ÉTÊTEZ
1,666,222,987 *AF5885917E14A102CF64C87DC1F96BF10B1BE320 ETHAN.CROYLE
1,666,222,988 *AF52E5614480B50B265D97029178AF29FEDEE583 DLUKNING1
1,666,222,989 *AF5FC7324EA339B6A0ED265C4A5FEE0F35796723 DLYP
1,666,222,990 *AF5E946B0A374A7F983BF072214935AE8CF765C8 d)nai
1,666,222,991 *AF59B6BADD3D01AA1C1669D925D2CFFD0E9F9E53 dnozt
1,666,222,992 *AF58B1016245E5B378A9866337E852F3BF8C55F7 dnywb
1,666,222,993 *AF5DE37F470EC89C94FB340CD7FD2EEAF026085C DOMINIQUEKILICHOWSKI
1,666,222,994 *AF595A8E6BD0793A0F5334F0B7D013AE0BA55EB4 eyreies5
1,666,222,995 *AF5C5FE9CCD7719E346A2F8CE3183B7284440D3C f0re$19h7ed
1,666,222,996 *AF5F3C8CDBF8F3B8CBEDBED8584E8C0A39E24059 DONGWARTCHOW
1,666,222,997 *AF510F83C7938A62A9E4BE82AE5C1C5736CA6D0F DOPOZIHCS6
1,666,222,998 *AF5907E27FF52367F2FDACF5C7492DE05EC52418 fallboard
1,666,222,999 *AF5FFC8BAA9AAA5DEC663CCFEB0FA10B12FEA6FD D_QH
1,666,223,000 *AF5B5FB338701AD9D6E68D2303325F28DA983FF5 FEDERACION.BIELORRUSA.DE.BALONCESTO
1,666,223,001 *AF53D64FF0C91F1EE388C9F59BE6CAB81B71D3CC driftwood on the river
1,666,223,002 *AF5AC31F65396765F623B6B497E751071357F05B drlwf
1,666,223,003 *AF511E189B2C428F547F8F01A2B041A53F66479B FIORENCED
1,666,223,004 *AF59C81269D2932FC32869E9435028533A501174 DUE:
1,666,223,005 *AF535E15893F713700E5C77D811806D71DB9B1C9 dustincoppage
1,666,223,006 *AF51FBCAC4FE59996AB48DA53F98E8C69E627C91 formanoving
1,666,223,007 *AF518BF9CF45F901ECFB79F17607B63A331794A5 dv#rd
1,666,223,008 *AF5CF5D68796710E69989D52D35A1C6981135EB5 francescowarthen
1,666,223,009 *AF52EA2B3BDB9A9A477F03F7409556EBA910433F franklynfriberg
1,666,223,010 *AF5F94960FF5585C5628FFB66229C9D74BC16869 DWIGHT.WARNTZ
1,666,223,011 *AF534C2EF3284485158E4FB0FF4663D0371E31C1 dw,(w
1,666,223,012 *AF5D382060021D639D1081F7C5FCF814D6C870D4 DYCOR
1,666,223,013 *AF50FF4D781623984FD77EF91A93DC9BDB36D015 e2xg
1,666,223,014 *AF5FC5D6658CDF29E61D53A2A3067F2C7E4001CC gailjenderer
1,666,223,015 *AF570EB23474AF453824B8F99B68224AEA6F2376 [email protected]
1,666,223,016 *AF539A1369248DB56CABAFBA718F0F5E975CAA62 [email protected]
1,666,223,017 *AF506BA4ECB40293FB0F286F5828161242052095 GARDENSHAWN
1,666,223,018 *AF593DAB82A88451F622AE2F23D0DFD1D5213DD7 gattita005
1,666,223,019 *AF5CE9E255BEE306EC80DF8B1D9338B62E1B282F GEE-EYE-YOU-KAY
1,666,223,020 *AF50260E5F2B175108C8C730AE598B789786BA01 efh3f
1,666,223,021 *AF57658A0BB88BE75C0C65F3CCA3EF23E785F2B6 EGERTONARNOLD
1,666,223,022 *AF58DB645BB9EA2A876AE64671D6A09C2199AD57 EGGSG
1,666,223,023 *AF53B0D8D8D6E4DE78B32B1C183E63822AA05501 ehyju
1,666,223,024 *AF509E961F00CF6520CD96A30D9BB885F2881710 EKEKM
1,666,223,025 *AF56873659714763F214D497D9A772343703047F ELI.BRIGHI
1,666,223,026 *AF544CD571CB6DA70419AEB2100AFECE2AC6A8EB ELIJAHESLINGER
1,666,223,027 *AF5FDF6708D778F3E505479BF44B8006756F0AAF ELISHASORUM
1,666,223,028 *AF5FFCC14AC9A5F04DDED6715D4BDA8F0CC9AAD4 gizmobulldog
1,666,223,029 *AF56B09B22D140DC4A6AB9586089C300BB09C0B7 GMADSSS
1,666,223,030 *AF5A8C8893E867A03CFF6271222D3F8BE1197A64 ELTONWOJNAROSKI
1,666,223,031 *AF51CFCC8407050C099E19C8B786AE8AEF3900A5 emplyeth3
1,666,223,032 *AF5EC3D8D36520830D89551DC7CCA6C7E0E09228 grades
1,666,223,033 *AF51F48A82E14AD0CA501E9DBCE698541561CDF6 GRAIGMALAFRONTE
1,666,223,034 *AF531D26154CA399C38A4DD547C5DC934D6C964F ENCURTLOEMOS123
1,666,223,035 *AF590D16166E90E1F04B78276332E306DAA8B092 GRANTBRYSON
1,666,223,036 *AF55698A462B2FF9F375E9EA89A8BD6DEE2EB9BD gthangs2
1,666,223,037 *AF59ED0975873E14FA7D5D95388F176633DF96CA gusarmentrout
1,666,223,038 *AF5BF5458871C9D062E67DBA653D7E1BC70B8D58 GXFWXQLJLDTE
1,666,223,039 *AF519523A85E42A515BF568D43D0AFCF81AF8A86 Hab3as.c0
1,666,223,040 *AF5CBA586F347C906A7BDF19EFB6FDA66707A6F1 hackerjaguar
1,666,223,041 *AF517723ED47A9A93EB4F3F84B9B61552C76933F HAIPHAN
1,666,223,042 *AF55892C4E3B122A5D18AE7CD99F77DC8BE4002C HAMADRI4
1,666,223,043 *AF52B7E62CE4BA248D85E7E9A25A670396C76201 HARLAND.JANEY
1,666,223,044 *AF5300F85E73D9812CB8F59444AC0675A588F961 ESPLANARS
1,666,223,045 *AF565C3B9C3AC5C310F1310D2B212569C4F93FB6 ESSENTIAY
1,666,223,046 *AF595EC751B388691F74C07B98AF119E8FE730FB ESTRELLA370
1,666,223,047 *AF51F08F6A125CAFFF40DF9396D7EDDC756A4B52 etagored1
1,666,223,048 *AF585C547EF7317FE86915604ED99B13286B9D40 ethankittelson
1,666,223,049 *AF5D34B4D44F44995A6947575126AAC136CE92A1 EUEV
1,666,223,050 *AF58D364EA453024697D84B48F31683E4B49B3F8 HEMATOZOAS
1,666,223,051 *AF56987BD26D1E68108838728A8327EB51773D1C hershelshurtz
1,666,223,052 *AF5E885794854748AED2B7E416E139D4BC7EE918 EXPOSITION_INTERNATI
1,666,223,053 *AF58DD7292838E8E768D228C6FE8E5C740486210 EY5FF
1,666,223,054 *AF5016675A3CCA864B21852CEB663443ACAC7CD0 ezequielruckel
1,666,223,055 *AF55D79459FB1341A88D3B959D20D2AE54B9C84A f=`;
1,666,223,056 *AF59957F7457D054DF7E9459EC573CE30693DFC4 FALLEN.ARCHES
1,666,223,057 *AF5C9DC96920BCE0147CE916627235BC79174013 FAMOUS-AND-DANDY-(LIKE-AMOS-'N'-ANDY)-(RADIO-EDIT)
1,666,223,058 *AF5E20EDB6ACC6944C551A37C605AE3F85E83365 FAULTOER
1,666,223,059 *AF5EE0E032BEA2FD9A60A3590D19E8AFD2A287FE HOOKSIES
1,666,223,060 *AF51BFDAF7BE149EA6B03E385F89AACEF5F7C148 HORACE.BRIOLA
1,666,223,061 *AF5D771E92A7C40C0403EA10838FEED49594739F fedrill
1,666,223,062 *AF547A7811475042B1A0569045C9238EE9A02830 HOT.CLUB.OF.SAN.FRANCISCO
1,666,223,063 *AF55C0C6F28490BC64FF9C4B5126A70AA1DE9CDD [email protected]
1,666,223,064 *AF5C0A99A7D21AE8AA41B4C420869BB63FD45A83 [email protected]
1,666,223,065 *AF52E837B161BC3CC49A06811258B2F1EADABCDF fennimore
1,666,223,066 *AF5F4208671CBD0A323999ECE646EFC4F85A296A ferienpraktikums
1,666,223,067 *AF5CEBB7A17EB9644D34BA90A7FF6EA83157D4C8 HR^"
1,666,223,068 *AF528D883CD55E93ABF11D100AD6A865CA629935 filmsiteorgdirector
1,666,223,069 *AF54A9E73BB731B31C1D8F82E4B3B39D4D69EAEA [email protected]
1,666,223,070 *AF57679AA17125BEF8241850AD990CAD0C70EE5D [email protected]
1,666,223,071 *AF50B3FB8F6E3F7A1D95239CF3FFCBC6FF94581E hy1x3bdbr0u2jf
1,666,223,072 *AF5435F014572969A8544DBC1C3A1B5926EB6026 floydbelfiglio
1,666,223,073 *AF5312DD011DB5E031A8ABB080F265EC3B29A166 FLRSGOT5
1,666,223,074 *AF51674ADE9FFBC9CB81A88C23400C7EAF978087 FOHOFFICIAL
1,666,223,075 *AF5C18C93982277DBD6FC71D22815DD9546370DB I82LATE
1,666,223,076 *AF567631EF2805DF45C8A0BDB7CED299C00F8F5C iamnewaccount58
1,666,223,077 *AF5979F31091A2F94ED0424EE030A12722137D2F ICORINTHIANS13
1,666,223,078 *AF5FCBD52681492635F4BB3AF8720E494FD5EBED IF.YOU.WON'T.TELL
1,666,223,079 *AF5875E561F48C24CDD079C0273F45BF56F91283 FREDERICK.DEMARINO
1,666,223,080 *AF53F662C722FB63BE8FCB61104BFFE7E80F3025 FREDERICKFALWELL
1,666,223,081 *AF50488D44176DF862815F2EB8B6F15D77C67339 IHSAMUOS1
1,666,223,082 *AF54A3E2E8BC2D111BB1EA72E5B929FBF115F125 FREDRICHASSICK
1,666,223,083 *AF590BA8B3DF8564C476C24304191276C26A90C4 IKE.COLSON
1,666,223,084 *AF513E86CC11C4E26B6E87237F51AA4C4534382D FRESISON?
1,666,223,085 *AF59C9C4F7A8C3EA848BBB817F291DA0DDE711C7 IMAGEJULIANNA
1,666,223,086 *AF5AB78DBF02DF66BCF9711A2AD072D8F1019CAE [email protected]
1,666,223,087 *AF588B4F3B87A60C258BC5FF1913E78E13579BFB GABRIEL068
1,666,223,088 *AF5BFC9B9DBCB39A2E04B6ECF4EAE042ECE110EC imprima6
1,666,223,089 *AF5B042995EE2F5849301A507232CB7448132F97 garrettdickey
1,666,223,090 *AF5D4FD564366275B55AAC5C1B4872F07D76F51D gauchi.6.0
1,666,223,091 *AF55A02EDC4BBCDC4D38DB66BB148A2B8BF511C5 GAURAV-SIDHU
1,666,223,092 *AF53EB1A2DB16B8FE69D733593EAB223EFBA2042 gavincrispino
1,666,223,093 *AF575D3C551FFA0599B35647C5CA3CF805B05069 instile0
1,666,223,094 *AF5C749EF1FD4BBFDB1F549A1580D38D87A53F5C INTERESTEDINSUCHT
1,666,223,095 *AF54C30736F353108B3C59C372F4878C27244645 INTRO-(FEAT-TRIPLE-THREAT)
1,666,223,096 *AF53D848CDD9A423D3C8AA46066AB3E5104A8D53 GENNEMLOEBE
1,666,223,097 *AF548693695FFDB02B7238BC3A61C4FCF6A9D5D6 GEOFF-KINSEY
1,666,223,098 *AF55B6C913496153746B4154B9791669195E3BB0 IRONERIRONER
1,666,223,099 *AF5C65D23F4900DFCC1EAEFC5B30845F66CB0402 ITEMRECT1234
1,666,223,100 *AF527CBF503CCC679902FC70C21427A9FC78B9C2 itumelengmphahlele
1,666,223,101 *AF5A6EE9BC166DE46993238B7A6B62428D628250 GIOVANNIMU
1,666,223,102 *AF58B595DC9E528A3DECC1B8F70574264670DC93 GIUGLINI
1,666,223,103 *AF52ED6AF9EB060595D21386E52D82794536A327 JACELON3
1,666,223,104 *AF56048CBDC162EF1F92C92C599D1B5202CD796D JACINTO.KERKMAN
1,666,223,105 *AF5C33CA100250AAF9101377CA7206D066E5248A jack.poet.volkswagen.ad:.subterranean.penthouse
1,666,223,106 *AF5BF9D40AEDF1C4981B86A8C2D6211B32670F83 gnaggid1
1,666,223,107 *AF55BAF9E8F71A7525843080260995C87C3E4983 Goat-CreativeAlienation
1,666,223,108 *AF59BD43D8289A49B06C5B4AF13997B2B2CABFE0 JARED.IMLAY
1,666,223,109 *AF539060BA3DFD6179BF62F0D140BA899507038C gregdavenport
1,666,223,110 *AF5238662FD88353FDB24CE799D482D6E1283037 GUINEAPIGS
1,666,223,111 *AF5F6737416500F7C17FEC761808D79CDB92152E JESSDOONER
1,666,223,112 *AF5EEE681BE19F35361D5E2392E6B2E4E3D875A6 jessechris
1,666,223,113 *AF584B1DE4F9A3357D55716F81FE8CDACC3772F1 [email protected]
1,666,223,114 *AF55AFED516E0136E2D1DA34774909AE01201CD2 [email protected]
1,666,223,115 *AF585258F58B6904463390122B1D439F53DC4B55 H75426
1,666,223,116 *AF50D9EE03B9BEC8CAD3ED4D0EAF5D9DE2FB8E8F [email protected]
1,666,223,117 *AF51F951FB994C8738E330B35B39B654F25A3010 HACKERDEATH
1,666,223,118 *AF54E82E5DBD68BE5084C804DD423B074214BFC7 JIKASEI5
1,666,223,119 *AF523AB3848D2002EF978BDB312DA0F6DE245A3B [email protected]
1,666,223,120 *AF5FAB47DDE778AADB4B2A07C352165B39CBE891 [email protected]
1,666,223,121 *AF5D798B0C98FE6677B479432B8F2DEF99F608A5 HANDICAPER5
1,666,223,122 *AF533C39B325B6EDB493A3AE076ACC9EBDB9EA14 HANSWININGER
1,666,223,123 *AF5E1EF6A8B96B247E49B2CFB57067C54835D231 happier-ending-(ending-theme)
1,666,223,124 *AF5695C218C557457FE90B7DA2B4BFF759D95E38 hazmiin
1,666,223,125 *AF5B81F1F5B7500CB69B55FC758BF53B63522A73 jon.chuah
1,666,223,126 *AF56184FC2F815D17CA4A07D28049366473A63B3 JORDANCARLOS
1,666,223,127 *AF5CAB21E9D1134EBB5EC953ED37B51185A3E91C HEKSEPROCES
1,666,223,128 *AF5F7E754D1AD5CAF9FB203E23D01A446B97FF93 joshua.ballinger
1,666,223,129 *AF54DCE1E6F7BB32335217DB4312725CD1915DC8 JOSPEHBUSHART
1,666,223,130 *AF5DBC50A1F1F19FF4FF0A6E5A5B6D33A6D082F4 josuesanmiguel
1,666,223,131 *AF53C3B3D00906875608F27D1FD3F96F27686D0D HERBGOERTZEN
1,666,223,132 *AF540812BC21053EE558549A5EB605E55C200A81 HERIBERTO.GERRIOR
1,666,223,133 *AF5B8D56F2AFE44BE3552746459339E6AB68DC27 JUDYZEGERS
1,666,223,134 *AF5CC3BDAA7DD332CAD4A6C4454E4606C6562D2C HILARIOROTKOVECZ
1,666,223,135 *AF5C944C6D8EDEB3EB82BA3C9A5E38D9F228B340 Hin-h
1,666,223,136 *AF5FB7A4B9D0173CB4485F0693A9B644A5BB113D histoiresoninkara
1,666,223,137 *AF585228BADDD23735E7366931E3C655257987D0 HKPOSTOFFICE1946
1,666,223,138 *AF5BE269E906B4A672698ED1E38625E2B67E9FF0 [email protected]
1,666,223,139 *AF508189AB660E913CA1057E83A3234EAC7570B9 [email protected]
1,666,223,140 *AF51A6DEF35360C826911DDE2DA6010DD6C9764E [email protected]
1,666,223,141 *AF529548C173F7BF56E24E156DB032A559691FDF HOHENLOCKSTEDTISSA
1,666,223,142 *AF5A9A58E5488CBEF9B1B5AD5AF7416CAFDE063A [email protected]
1,666,223,143 *AF585C743FACEC32616DEDF831E0D57A092F3024 [email protected]
1,666,223,144 *AF5A5DE053ED4D99648D75D6FBF1560E35F5C5F3 Hostile(feat.RobData)
1,666,223,145 *AF5E5840D1EA29BEBD9DFE993AB17FC274C25FB2 KEODRAH
1,666,223,146 *AF548D53FD42DDC1A91A5481223FBBD9E7AF20F0 KHÓRESZ
1,666,223,147 *AF52E7C4C494BECECE870C2D4871F98E648F3F09 [email protected]
1,666,223,148 *AF5B41DD6F5A30BA33B9B464CBD2D49B866EE58E HYPOPRAXIA.,H/AI/P/@/'PR/&/KS/I//@/
1,666,223,149 *AF5EA29C2E3B1A04875E59A7044A535E71080406 HYPRCRRCTS
1,666,223,150 *AF59D9900B3F14DCFB1E2AED2001047F4BED26DD KINASE-5
1,666,223,151 *AF556766D555C52C681E20A6D22A9D9593A0EFC4 I#5
1,666,223,152 *AF5A07C6126ECC56E11D7EB4AA27C03B2601AEAF KLEINHEID
1,666,223,153 *AF543FF867A89F893D9A1C05193D472020E42953 knut-haugland
1,666,223,154 *AF574887E859521B2A27F5D03C109052AAA9E1B2 i don't drink (with coworkers)
1,666,223,155 *AF50F03DA43F4D02716A52E52FD90EBE7BC375D8 ignaciohergenreter
1,666,223,156 *AF56C9808B0829727E0D3F4099F7A6541D6D97FB KORYMINNERLY
1,666,223,157 *AF5B75953714CAB0A0A2B74A2FB74857B5F84604 ihaib
1,666,223,158 *AF5C3FAFAFDE69EE4BEE58DCC5B54AA2CCF3191E KOUSENDING
1,666,223,159 *AF52D35DD791CE12E8E016CD33C72BFA8C5DAA2F [email protected]
1,666,223,160 *AF5BAABAA6F265F937C7C13D0279D922C1594BDA ILOVENIMROD1995
1,666,223,161 *AF55758BE9DE0C925CA538A282839F3F81FB04EC kurusha0
1,666,223,162 *AF597C935DDABEB9683DD00B480C9E84F64E3D3C L0WGR0W1NG
1,666,223,163 *AF5EDF5D0AB6B31FEFCC40215FD14C28DBF7AC73 incidique7
1,666,223,164 *AF50BE39DB7BE28B8B3CFDA0CF35077743345DC4 INDY REACTS
1,666,223,165 *AF5C41E289DC00E7B4169C5A652899DDB6EF4DB5 LAMBERSART.HISTORIOS
1,666,223,166 *AF5169D586EF7C64B1A9E7F504BE766E1973E342 INNASIES6
1,666,223,167 *AF50FBB95AD4C03EAA0769951480B82F0FF64F4C innern?
1,666,223,168 *AF56EF65D1E471EA9137C0D02AF630F45F52FBDE LAZARO.SEAGO
1,666,223,169 *AF53C4E79EBC8D39B5B7F03F1EC05FE9D968C522 IRVINCEPEDA
1,666,223,170 *AF5964C95B051E7C03F16B7464772294CE7193E6 [email protected]
1,666,223,171 *AF53E039E24D68F012A2A2CC0933A554B3F3F9A6 LEANDRO.SCHERB
1,666,223,172 *AF55B486FFE81CF0478E117EF9FB9C7469353090 leehart0
1,666,223,173 *AF56E7CEF04F2B3E08DCB512CC73EC8593B737C0 LEERAPONGNUN
1,666,223,174 *AF5A9F74ABC439CBBA4265437DDDD1493352BE36 LEHMANED
1,666,223,175 *AF508A2B1E263DD70A1E000459C3AD982536131A ISMAEL.KALINA
1,666,223,176 *AF54F82BCEA39316156D72342E87C5390559991F LEIF.HARTZELL
1,666,223,177 *AF54010BCA6A919996AE3AB8FE82A6DE6E4AC991 ISSAC.WESNER
1,666,223,178 *AF5DDC2D3692FBC95DD429B907F96A4A550F16EF ivepeaceachance(richardfearlessreachoutmix)
1,666,223,179 *AF5006E57C05CB60A3179651AC34D9AD701CCD14 LEOPOLDOBALESTRIERI
1,666,223,180 *AF572F2067DC488E0A3E3CDBE8D1A2F778AFD2B9 lesleylaslie
1,666,223,181 *AF5FDD3D96815B2AF373F21680D0CE5AAB3E203A JACKIE.SHAMS
1,666,223,182 *AF53AD7F21C6E4E6AAC88105BACC2D18B208A2E3 jacklynn-chen
1,666,223,183 *AF59BF2C9E1124B7D454175063EC45B9BFE1BA68 LGAJELLOMA
1,666,223,184 *AF5999ADC53D4F2950457D9157CA89A02D8A269E <Li><a.HReF="#DeCiMaLNoTaTioN">
1,666,223,185 *AF5EC5F128B7F5E4749E1DB86975D0741404C45B JACQUESWALBRECHT
1,666,223,186 *AF50C5B6430071F8FE90B68C4C705AE44C1B10C1 LIANHUIKUAN
1,666,223,187 *AF54BB70D04BB4CCB4A389E4B8C871BF05A7C658 libtdb
1,666,223,188 *AF52383F3F9451BD22FFAB111DB42B0C082B5497 [email protected]
1,666,223,189 *AF53779F35565B333844020D12E8E4E8CFA5A3BA liketoknow
1,666,223,190 *AF502A395C1DC8CD646D4B445B25D8DF1C26C52B JAMIE-WARE
1,666,223,191 *AF578D7FF12D9F36CF07AD79BB6C67F21E6FB60C lindsaypuehler
1,666,223,192 *AF5220DB5A2BBB39384234495B73842C8BDEFD94 LINDSEYGANINO
1,666,223,193 *AF5FA1565156A83680E78148589D416AFBFE628B lindseyrowett
1,666,223,194 *AF5D5B852FE20A02AF8E7FC476DE12B907C3194A JAVIER.MUGICA
1,666,223,195 *AF5911D05D392874809ACEB1B9DD39A6AF2D612D JEANNE-RHOADES
1,666,223,196 *AF5C33CE5339E82F2D087342630D883F57141DB3 jeannette.cortes
1,666,223,197 *AF5312708023A20904B30583540555892FEDD45C jeanvannostrand
1,666,223,198 *AF5CCB15B8FA887592CE68FBFDE0E972EB9F2662 JENN-QUIGLEY
1,666,223,199 *AF5DA662DA43147C0C9ADA0F441F8CF010CAD191 [email protected]
1,666,223,200 *AF53B9DD04AB83CDB25BC7C2EB53583CCAEFE644 jerroldcadieux
1,666,223,201 *AF5CC06B09C7BFB8E934AF1ED6818256B3E22B54 jet'aime,moinonplus
1,666,223,202 *AF5695E15C4DC8DC2788FDB47ABA9DA1649CC875 lumoverlumngoverng
1,666,223,203 *AF5E3FA12498D8B5CEA993E8212CD662A261BC46 jimhillenbrand
1,666,223,204 *AF5AC2257936C47B69A6D3CA904DC770F3B6C842 johnny-hawksworth
1,666,223,205 *AF5EEA5E5D52F8D7B640A9CAC79A2BBF02A37A47 JONAS.HASELDEN
1,666,223,206 *AF58D5675CC1DEB5A87BF998E02024D185EF9233 jonathan-ft
1,666,223,207 *AF5258B9B4CA1421AE6AED584E6459E054F57CEB jordanmmueller
1,666,223,208 *AF5FFE095516CE73E084F885C8D5C94E23C02E03 joshmowrer
1,666,223,209 *AF5036675A8C80AC998744FD95F0000F90079620 [email protected]
1,666,223,210 *AF559BBB99F5185DC151BE86AEB14F441A3B3426 manikya
1,666,223,211 *AF5E9832113F4AB666016F524DFF991E2EC521E2 [email protected]
1,666,223,212 *AF5797AB1B74161C5F0AA60FD269C5D5350B7EDD MANVEDALDRIG
1,666,223,213 *AF53216A12EEF05A2F12D82E29B206E961D1BA9A MARCUSSNYDERS
1,666,223,214 *AF5A6D7E24111C3F8DB47CCB4000AD24898D6307 maria-socorro-lucas
1,666,223,215 *AF57F9CBE1BE71BEFD1725C3D2265744B817D4D3 KABBASI2
1,666,223,216 *AF5C0B64526EB6660626647FE2C39FC2E353A277 marvinmarchione
1,666,223,217 *AF5D42593D0BCB2C0460FDBD96A159362C226A57 mas./.Melt-Banana
1,666,223,218 *AF5396D1B65078028101139B9951ECD32F2687B6 karogoto
1,666,223,219 *AF5A6A8DD9BD416A7A954DE0352343E2322DF30C maurice.loveridge
1,666,223,220 *AF5C0E37634B0271447EC69AC220041BB1564556 k=|d
1,666,223,221 *AF55EEBE64B72AB11626032E00BD75DCDDBB3DAE MaybeMyMind(WithEgg)
1,666,223,222 *AF5120439C9F14BD98C4E66955095576F27D8AF2 MCALUBAG
1,666,223,223 *AF54B6E6C0A219E3DD1C1955DB7CB9E7A7FD0A88 MDONSBERGER
1,666,223,224 *AF56899CA36064779104CC9F112094B2B9783CED KENT.MACHIDA
1,666,223,225 *AF5254F6BE2BF76C96740876ECE76341D1F41E80 [email protected]
1,666,223,226 *AF5E049BE7367FFBEF7D9A1C7B93BEB4DFE7384A KEVENGRISTEDE
1,666,223,227 *AF5BA86E5C79A0D4EF2EBE67A32BB082A18AC01C kevin-james-taylor
1,666,223,228 *AF5F84C97BCA030B3D1350DE49CE33AC3A743661 keystone12!
1,666,223,229 *AF52D825B518FF1CFBA436647CDD00170C8ADBD3 KHAIRUN-ALI
1,666,223,230 *AF5B7CF68D308F05520F55EDC2E0CF636827EE9C KIDZ
1,666,223,231 *AF568223D67F4AB4A406DA5367EB74E2F07BB343 KIM.FIALKOWSKI
1,666,223,232 *AF54B7F5BFD6AED5790BC1F552743DCF7F34F9AB kimleen
1,666,223,233 *AF55BAC9313E94E1624D90F4A513202F09AFAEF4 METH0D0L0GCALLY
1,666,223,234 *AF52BCD860DDF5EBB907AC15C18D19C4A80B6C77 KÍSSAVO
1,666,223,235 *AF57D389F14107DE9AECEB82D50F9236DF7FE53F MHOBIRK
1,666,223,236 *AF5690197E32D8826FC424C212D52090348FEF0B kkinder
1,666,223,237 *AF5AA4ECC4CDCCA0189D1EE823378054F57F0E41 MICHALBELLIARD
1,666,223,238 *AF5A696DCA9D4673AF1D9A709AE8FF975C187048 michealschelle
1,666,223,239 *AF52583FDCBF52DBC3DEE8F41BD87ACE4FCD8D76 MICHELLE KAY WILLIAMS
1,666,223,240 *AF554B07FD5FDBB6FB8F33488D3A464566D90430 KLUIEK
1,666,223,241 *AF5820AB688A394FA9DA33AEA3C538C545E7DA93 [email protected]
1,666,223,242 *AF5742BC6C6E74D4FCF544DF9CF3686C7B2A0014 knibskt9
1,666,223,243 *AF54853ECA2604D6E4ABCA658C9DAE603CED3947 KOINE-GREEK
1,666,223,244 *AF5CE5A1B192DD9D880DD109FD37FC3598AF00D9 [email protected]
1,666,223,245 *AF5950E04A4C463E2DF30DF3697F313F7EDE0711 KORRALDAJAT
1,666,223,246 *AF59E417E9050482F4335CB91D1DEAD5028D4F26 K_PD
1,666,223,247 *AF5E3CDFA7CF20C38F7B2209E59B54B081C85914 [email protected]
1,666,223,248 *AF5E0FEF0E3A8C4D6FB5831A60093B360139C169 MISS-PERFECT-(FEAT-NODESHA)
1,666,223,249 *AF50FA906E5BBE53B50EA87C1FAD3577D4763AA7 [email protected]
1,666,223,250 *AF5DF50C99DC6635AEE0044B15E318ED7EC879E2 kwzsatt0
1,666,223,251 *AF5EE44B841AE75242D7135195093BB9509DA856 MOHAMED.BERTRAND
1,666,223,252 *AF5F1C4EBE1C38524AD79514D5A916D9F7745842 MOHAMMEDCARLUCCI
1,666,223,253 *AF505AC9C661D00D8EF72A30D5639364A0CEA667 MOISESGLASSCOCK
1,666,223,254 *AF529C6A564E22CE424DE9041303E95C40328203 LACHEN‘“
1,666,223,255 *AF54B24203469EC681C53AABFE98CEB563F8F6F5 MONO+H3!5M
1,666,223,256 *AF591616DC35740A228F46637468AE2F02230CA2 morning-singing
1,666,223,257 *AF5194D3DE4AE40946F9F80EFCF03ECCEEBF024A mortonmaruyama
1,666,223,258 *AF548A541F4DD6D0E016A3394EF540C5626E8A96 mrkninga6
1,666,223,259 *AF5FE57F73BF680BA44C3ADF986B0453CA4BF702 MUSCLOR(FEAT.TTC)
1,666,223,260 *AF52C6512918D38DD73B3A1178CD8BA1D963B7FD LEIFVITRANO
1,666,223,261 *AF572DAFCD82CF847DBB016B63B4EAB3A629B22A MXMDHTWO学习卡
1,666,223,262 *AF50CA597AB61F0C9906862D36C9B77A4246BA44 lèjã
1,666,223,263 *AF5BFF830BF5FD26CB1A4D84995BE23B6CE6B59C [email protected]
1,666,223,264 *AF5DF9D12705E643DB2A4DC5A1F8211EAAD24759 MYHUGO67
1,666,223,265 *AF505B275DECA60156FA31AB7E87AFB057D92238 [email protected]
1,666,223,266 *AF5FCE4BD8EFA142BE3914FD661AA5C2F1597CBF liberano3
1,666,223,267 *AF590847B91918163164E560F3ED9D7B7A0C6431 lincolndeacy
1,666,223,268 *AF512689B02844D60FE52DE5E3039F45D5BADF43 lindseyguckes
1,666,223,269 *AF5B9BC20D82639D6720A7BFDA7D8A67CE852E84 NDQUEVER
1,666,223,270 *AF5F415CC4F23E5BD87F12650D753B081025E4D2 [email protected]
1,666,223,271 *AF569A3E5E0DF81796F40FA98E6EBE7356DF3E56 NEAREDIT
1,666,223,272 *AF5392518BE65AAD30F24B8A54F3C2A76945E30A [email protected]
1,666,223,273 *AF5E62CD969E1CC2380F023D93BD8B85A83D710C lividlyv3
1,666,223,274 *AF5E6EFAD4E3132D8FCF566091C826CD81479EB0 New-Love-Songs-Waltz-Op.-65:-VII.-Vom-Gebirge-Well-auf-Well
1,666,223,275 *AF59D29C7D9D875E46914C7C4FD4A7C4DA45F161 [email protected]
1,666,223,276 *AF516A198AD22B8DE0656A974023F2E8696548F4 loml
1,666,223,277 *AF5BB3C819F8D40445C3E3E3BD3217826FE997D1 NIGELGONCALVES
1,666,223,278 *AF5A6D52D971FA5756BE6D6693560E9B6B7E19AF NJEŽNIH
1,666,223,279 *AF5B20D92C4528DDA4152D350DADDCF2EA16AF56 NOBODY'S-WATCHING-&-CHILDE
1,666,223,280 *AF58EFB2B074048BCA343D2AA3451D0CF211C81F LUPEKRAUSKOPF
1,666,223,281 *AF56C7320AAD63750671A29D625C26F60326AA5D NONREVELS
1,666,223,282 *AF53E9AA1AFA0DC7ED3E051C00EC7D319DE22752 NORMAN.BEVIL
1,666,223,283 *AF5D91B80D360B6DD1E03FD08554CB28C474009B lynnmorelle
1,666,223,284 *AF574313F91A5E3E8993F0C3476F7CE1AA60FA1B [email protected]
1,666,223,285 *AF5F648884106E0273B255B56B897724DE7A978E n-para-pilar
1,666,223,286 *AF530C19DDC373887979D7A3D0BB4D0EC26B841A MACKEN04
1,666,223,287 *AF5C8856B501D28D55636ACD1784E76191AB096E MALACHI006
1,666,223,288 *AF54B805AB019875A84ADDAE1F699CBD87155A80 MALAPPLICATION2
1,666,223,289 *AF58449B963463FBA4522EC5AB3212F3C6C21C20 occurrit
1,666,223,290 *AF51A846123F8E4D23EC97E9DA0206B60A6DEF36 [email protected]
1,666,223,291 *AF5C01D0FD63F09444C11DC67B546F12FF3BF0B5 MAPUBSW5
1,666,223,292 *AF51E3B8F7E0A03274224D87A9B818F076237C21 Marcandoelcompas
1,666,223,293 *AF5991B04E3E5CAACF7EF6CAC778A2FBF1266A7E MARCIA'''AN
1,666,223,294 *AF52C1D4995718E0399F04DB5E52AE032C04F39B OKSUTAM.1
1,666,223,295 *AF5B2A7184B1394F85D242CCA1049DF996AC0611 MARETH'S
1,666,223,296 *AF5E657EA159DEEAFCE11C57156070A05A50EF27 omarchino
1,666,223,297 *AF58A2D8C6A6A2A1C45E1B842893AA55D9245ACE marlene.caldwell
1,666,223,298 *AF583AB9665FF1C5D9D61812BFD66F3624265471 }o{o~.O~<==q
1,666,223,299 *AF5EE65D1C1E35ECCB669C09865F614311823476 Martha-(The-Moving-Mannequins)
1,666,223,300 *AF5BAF44C6839C6E2CD787FA4CA7A88AE430BBA9 OPERACIONESVENEZUELA
1,666,223,301 *AF5788EA6D781D52FE82BAE965CC48A3B5115058 MARTINSTEIB
1,666,223,302 *AF57D9FE1C35A3ABD094F2920DA88E7C67D68CFB OPPSKJERA
1,666,223,303 *AF5E4F757D625BA863D7C16E0DB87875F87C9052 ORALERS7
1,666,223,304 *AF584A1BF81BBFF2B180DDC3F91D2C93C4C9F69F oreo3oreo
1,666,223,305 *AF5E3B96E81AF0DBB8A058A7A6B880BE2E89FC70 MATTDEGUIRE
1,666,223,306 *AF51494BE3ED855AF9C541CB3F21E77312F1B710 MATT.FINNIE
1,666,223,307 *AF56C050069771441EB4CE8A721278E9A14FB0A1 ORVAL.SWIMM
1,666,223,308 *AF537CB6B0F26CE4FCAD28DF0140961AB22A1724 OSCARGERSTEN
1,666,223,309 *AF514F4855F5F476F779B3ED93600BD0CFEE4C13 MATURIRAH
1,666,223,310 *AF5F2BE74772C3D80C1544A00361DD8E367E0528 [email protected]
1,666,223,311 *AF55B4C8D3F34064B51E36BBAD0B7DE9A9DE095A OTHA.DILLY
1,666,223,312 *AF50FF04692566E7F28475B39524853C0152DC6C othaspiegel
1,666,223,313 *AF57D8B1B44478F4E138C63F64E2549995B7708F maynardroberge
1,666,223,314 *AF52EE3815E3952454928F5E1A91D85E3B04849D MAZDATURM
1,666,223,315 *AF54EDD36EF160AE0F7A228E63B3E158D02AE9C9 OTISWALDROOP
1,666,223,316 *AF55556DE9DC7C504E94B0B261243150A3494A76 MEAGANRUOCCHIO
1,666,223,317 *AF5096EA5A10BA309830E2359084C2A647826F40 owencardine
1,666,223,318 *AF50344B03B5658A0C8E4C4A3AD16373CB24A3FC melaniedebiasio
1,666,223,319 *AF59140595D850F62E4399588E47FCE2D72BF014 MELVIN.BELARDO
1,666,223,320 *AF5C8676AEE6262619F9B41379BEDE57A8BFB9EF MELVIN.CARVALHO
1,666,223,321 *AF5C69C028F715487DC83DFEC80A99DA5621C92B [email protected]
1,666,223,322 *AF54B74AF1B8BFF443813FB8CA5BD43310D5088A P3CC4D!LLOS
1,666,223,323 *AF5BFC1C66AADCF6537178E41B75D765F489B94A pablokamirez
1,666,223,324 *AF5AE377D7F924A6E9F31A74034BE152CE1D6D12 PADAMKUMARN
1,666,223,325 *AF563566D16FDFDD9F7B15AB1AFCC4F94DDA7C1B MHALDITA
1,666,223,326 *AF5DF1840DC180D2438D37FB3D4CEE3073E83634 MIDGARTH
1,666,223,327 *AF5A8C9BFC17EE57E10DEF7BC015AAA474C3ED28 MIKESTEFFY
1,666,223,328 *AF557D14B88CC4555169FC92224E784669F05F53 PATRICKSALADO
1,666,223,329 *AF52E3DE6F96D7A190609613B0B196E19BBD070C PATRICK.ZAFAR
1,666,223,330 *AF599F77A89C95E789B35F917C33E7177B34EBDF PATSISES0
1,666,223,331 *AF508EA057F66FD1256020139A9355A192FAD575 PAUL.POLITO
1,666,223,332 *AF58DCF75062B7B1D1620CB114926EA71A2FA4B0 PEDRO.CANARY
1,666,223,333 *AF55BA34BA6099887166B1FB584062BCB5539FD5 MODESTO.MCPEAKE
1,666,223,334 *AF58F6D382F9BCF06BDF7CDB466C5A9C8F466315 MOHAMED-FARAAG
1,666,223,335 *AF57B6236FA6CC655106C81C2EB4C30554AED8DE MOISIQUE
1,666,223,336 *AF54805758F1DCDCC0736F7229A4518F262CFC85 MOLY.SHOP
1,666,223,337 *AF5CA150607DA92754A2600C9D4AF8D8C0CA8232 MONÔMIO
1,666,223,338 *AF52808E40EEF9B7D2DED7662DF18BC2804F39D2 PETER.SALE
1,666,223,339 *AF50B0B88B844D4DBDCB9FCEEE5A583E9C9B2127 MONTEWAGER
1,666,223,340 *AF554CDD52691772CA60A8AEFF8F785224DA833F pezichus
1,666,223,341 *AF5F815CB217A5FAF7987160B088C59154D1F95A [email protected]
1,666,223,342 *AF5E84515D1B78A61FD22E05AF2B0FC7A2F37AFA PHYLENE4
1,666,223,343 *AF58DCE8D820AE3E748A918E47366E5B243CC3BF pianoimprovisationno2(ava)
1,666,223,344 *AF59EB02D24E5B734661246A45CFFC2CAD337A5C Pillows.in.the.Water
1,666,223,345 *AF59575DD05351840588D4FD9AC1BE749518571B MTAGHJI
1,666,223,346 *AF50F207596DF926B9CFA5B1E48E4194A4ABBC14 played9
1,666,223,347 *AF503800B4D0717B43C80885FFAD4E853AB6B04A :PO~0~(------P
1,666,223,348 *AF58E0473BB1FFA8C6AE5C06F2B453F98DE983EA myhonda146
1,666,223,349 *AF5061165720D16E647C3BE982B2AC327E8EAA5D MYRON.PERRUCCI
1,666,223,350 *AF5B164776DAB6D0071D1AEFC05B5BBA89823B7C myxoneuroma3
1,666,223,351 *AF576998300938FCC24C6488DE1BD918EA3B71DD p-----p~(>_<)
1,666,223,352 *AF59D6943A5D60104F4B2BE6DA3761B680434B1E NABBATH5
1,666,223,353 *AF531A1E387D6E10C06501354A52C907716444B1 PRACTICES-AIRCRAFT
1,666,223,354 *AF5D2D063E8E91C8B8F375C1A78457ACB341665A preaggravating2
1,666,223,355 *AF5767B3328D7B17B514DF23E104F4F1AE9FB24D NAUSSACAVEYRON
1,666,223,356 *AF5B712FA715A710190CD75AD354034F8C7AEF62 PRO74GON$7$
1,666,223,357 *AF5075362548DDACF6BD08B43FBBBB12456893BB prohibeted
1,666,223,358 *AF56863CB763B52F3FB627A5A5FE8DCB54FF34CC PRYCKEDS
1,666,223,359 *AF56E1A3C3026B15BC268F0CE55B7CDBC2D508A5 NELECENO
1,666,223,360 *AF5E9805626E667522ECD7231A7C9CFB9705A501 NEVILLE.CAVE
1,666,223,361 *AF57D7D5E7477600819AB30B127C01B3996E1357 NFLPAGAMEOFFICIALS
1,666,223,362 *AF52187ED8F9EB729302084858DF03954D7151B5 pyralidae)などの
1,666,223,363 *AF561A2D30934BF880F44F7A69E4BF28A13B9249 NIDHISH.KUMAR
1,666,223,364 *AF5A16767CE791A198479963C550501FF18B4E3E Q=====D*-*-*)0(
1,666,223,365 *AF5BB0C3957888993878F99DD3914E07437F0267 [email protected]
1,666,223,366 *AF51B525E89E4F002E16967AAB659A74A7E78012 NIKOMOU
1,666,223,367 *AF5B44BBEFA599786C326DCD323D66A9A712BFBD q#P~-~-~}O{
1,666,223,368 *AF5452DAC376515469F362510772E86830C3CB14 qualitätsmanagementprozeß
1,666,223,369 *AF5466E20A2DE58D80F5EB9101F29C0E345D0EEA quiereme-por-vida
1,666,223,370 *AF54C1FACD5B286809E9C4F8662103E614EAF6BD nordnaagauk
1,666,223,371 *AF5B9F9A811E247E5804B8C6BC2EC1D5773F038C (now.and.then.there's).a.fool
1,666,223,372 *AF51E4B14B308BC9F55080191F30058FA4A7739B NTLIB.NT.GOV.AUWWW
1,666,223,373 *AF579530071A459641FF87A070FDDEEC2BB6F6E9 ntrrcrd8
1,666,223,374 *AF5F6092AEA7C993A27BF7CD4EF2ED3BD911C8AA numberofoctets
1,666,223,375 *AF50452CF608C53CDBF0F1AE9FCDA1F68AB548E1 [email protected]
1,666,223,376 *AF516CC92FC6E67BC282347D1D15013A608FFE6A RAIN.OF.BLOOD.2
1,666,223,377 *AF5E3AD5E1FFACFCFCD67C5A2EA1A990E5DFF7C4 RANCE-NORRIS
1,666,223,378 *AF59D3DEE66380BDFDA4B59A7262F931AC9FC8CD randyseajack
1,666,223,379 *AF510A7950F5D50B9013197DA0400B5B403738AA rapetassages6
1,666,223,380 *AF5061823B57A19CE107E664D5B410F1FA45CEEB OCTAVIOMCCRUDDEN
1,666,223,381 *AF5C0CF9AC0FC8A902F585115C5A2D78EEE56FB5 RASHEEDJ
1,666,223,382 *AF515CFDFE5F0E06C053A1BCF81BA1D1E634622B rastalulu
1,666,223,383 *AF5CC1D016FC6E4E136886411A4E713C026A0A95 RAYMON.BEX
1,666,223,384 *AF514048F5F02E01540B065C0AEB71FEABEB553A RBIDA-CONSTITUCIONAL
1,666,223,385 *AF58F731ECE570FD8B09DAC60A00D87A5237C18D reclama+0ns
1,666,223,386 *AF50B172B5DB2320F8523B2345DB8051ABDE7750 redbrick
1,666,223,387 *AF521A26015F7544820874C1D2B6768675A12E70 (O_-)-o~O~(----8
1,666,223,388 *AF54E474CAC3548CDD2634C70E81B5A09ACF09BF }o{-~-`-<######p
1,666,223,389 *AF5DCA42A230FA28369AB1E717F82BBFF12DB1F3 RENATOHEADINGTON
1,666,223,390 *AF58DEBC80BCCF5B3D637890292E8BA6CBDDBA9B RENATO.HEIGL
1,666,223,391 *AF5207B3305F094D197A097D091D5080FF394499 RENEWABLERESOURCESMANAGEMENTLTD|NIGERIA
1,666,223,392 *AF58B2FC526613CB51F31FBAA67BA7F80377B0C2 ORVILLEFERRATO
1,666,223,393 *AF5DBBC258213F7B9064117E220FB33E17654821 REPEALD1
1,666,223,394 *AF5907F0C1D48C45C8BF21396E2757170058D129 OTTOPANYIK
1,666,223,395 *AF5595D563B235F1236022D75812AC5E8B690047 OTVORENUS
1,666,223,396 *AF58769376364B6F957889B998773CE67C929ECE RETIRESESED
1,666,223,397 *AF5379479D6E35B24E14B978E82DFFD664835FE8 RETRETD3
1,666,223,398 *AF5B2B97D226244E2CD3C835652CC104D9B2E356 OVERIH
1,666,223,399 *AF5538493244217E297865E53070B5D8CC2319EE oversusceptibly6
1,666,223,400 *AF5EA84CCD9CAB5BE6E4B29A06C0857433A4F3AB P730606
1,666,223,401 *AF5EF516BA37509D3D2F3A56BE33EB98D27ACC40 :P~-~-<#8
1,666,223,402 *AF5265E4D0A559B73F252D6D6EB0208FB4FB42FF P98359
1,666,223,403 *AF5444FDEF9545A5D5C61166D5888B9369F795ED richiesavko
1,666,223,404 *AF581432A8843398A098CC3A56475D851FBC2C48 PABLOELLIS
1,666,223,405 *AF5E4D977A730B82730126334F2D6AE3BCC4E2AE RICKIE.UNNOLD
1,666,223,406 *AF5340427E117A15BEEE6DCA3ED36D9E836A2859 RICOGOURAS
1,666,223,407 *AF580B3DA5E453523DC85A018432081CE11C7E5E PAKDRON9
1,666,223,408 *AF5D0399551FF5746C3C8A7B7B9AB39231F93397 RIE, SAUTE AVEC MOI
1,666,223,409 *AF5EE98506EF7E2E5E989A0BE8F8C3928F60BE37 PALMERPEASE
1,666,223,410 *AF591C1F93F3F9A86F27B08DC0B574A918EA68E9 [email protected]
1,666,223,411 *AF5144EAF2FDC931FFF5D7BE900334BA64F07CDE [email protected]
1,666,223,412 *AF554666969FAB3DA4B8D2DBF18F6E4301774946 RINSYOU7
1,666,223,413 *AF563A72E9309495A09E73157E42523F9DCCD79A ROBBYGAVALIS
1,666,223,414 *AF53C1DD9A23CB7F196B2E53636F78A78CFF9700 ROBERT.KWON
1,666,223,415 *AF5AD7C3F6F3D037EDAAAD9F6F819A7A5C529D01 ROBERTSUTTER
1,666,223,416 *AF5B62FD94E1335D6A97A0409DE5F13744AC1BEA robincabanillas
1,666,223,417 *AF58118CDEF1301B614D056A7DB77220DBB89C59 roblarios
1,666,223,418 *AF5FECB7A9559CCC0CDDA8AA5B97AAF3C0B40BE6 PERUKERNA
1,666,223,419 *AF59F2C160059438FE593CF66C2A89C87AAC9A65 PETERSINKS
1,666,223,420 *AF5227C69FD966DF862F8974CC575E9C65F0A2D1 petewehrley
1,666,223,421 *AF55449985231F3000E1CA3CC35852824F16F9C7 PH4N74SM490RI4
1,666,223,422 *AF5AB0511BC651A40BAD36E85BB2B9772AD06B19 piasava
1,666,223,423 *AF5BCE63D32EFA23095BD1CF85C99E123A628F53 PIGHTIS1
1,666,223,424 *AF52926D7B6DE9E2CAD45C3BD260F168A047CD56 RUSSELLCOMPUTER0
1,666,223,425 *AF5FEBEC81CB19EE779DDD2FC18054EB8FCD82E2 plurnŕ
1,666,223,426 *AF5E482B66089BC913844D064F9F7956F4B5AD84 PMTOGIVEGIRLGUIDESAWHOLEYEAROFTHEIROWN
1,666,223,427 *AF5CF386B8FC92FC479E0DBB422917CDE82E17B2 :P.O~<3
1,666,223,428 *AF50DCF766A7EA05A7BFF176C2472EAB6A258247 SABRINAHARM
1,666,223,429 *AF55D4EA4B6F58AB1D39A7E738C20577E062B0B4 SAMENGEVAT8
1,666,223,430 *AF56141AF15924941E381F7428EEA9A27788A5F5 SANFORD.AMSDELL
1,666,223,431 *AF5E71D119D40F8B44F1B0DED851B652D64C33FE santiagojustino
1,666,223,432 *AF5F383F4A2C03CB5792309F56A014E151F8ECD3 princess!123
1,666,223,433 *AF5628AC38BB6A21BCC92DF3BA3B6E84E8527AC8 sarahstang
1,666,223,434 *AF58134168676E05A8474A72F2DEE3788B92E054 protecch8
1,666,223,435 *AF5FBE01349A6FC567D447B93390E413EDBE9121 PROYECCION CARTOGRAF
1,666,223,436 *AF5168700E1900A82EFB8268605621013E770AE9 prvctvly6
1,666,223,437 *AF5E48F5C4B4D75A81932C4F737C8556EB4B18EE PUBLICAREMOS1234
1,666,223,438 *AF53A9611872CB9232B4CF04AD03320E1569D446 purrees7
1,666,223,439 *AF5A1010F887E1E6DD1B7A757910DCBFEB7C1E48 sdnartsaf
1,666,223,440 *AF519E68C7699CF665857E79CE0030E8B887F2A0 [email protected]
1,666,223,441 *AF56254066722AE7DEE5BF4F6F13649F5BEA8652 Q====>-~O-~O-(>_<)
1,666,223,442 *AF5E4F41144EBCCC846898204C5750F19835912C SEHCRAMREGNUH
1,666,223,443 *AF5B4CC7BE5F463E544B59A932DEB1AC937736B4 SEIBELM
1,666,223,444 *AF5311697C48A35C770C63A950D251162868120D SEJTOODIPUC3
1,666,223,445 *AF50DD6F0E2A1C56225C09997BBBF03D2C799F2F SELLABLE
1,666,223,446 *AF500EE863FE52F92E6E6DA0694CA00B63878945 SETSUJOH9
1,666,223,447 *AF595ED290E143B7CECB59FB2ACFA937EF0434CE rainbow.'80:.a.golden.classics.edition
1,666,223,448 *AF563E8AD213570F1D7EF45B3287F22C395FAD1D shaeellis
1,666,223,449 *AF51453B78E393A6E917AB0E3C6CB605907480FD ramiazar
1,666,223,450 *AF5A3BFB10EAEB74B987B933AF332DE863C218AE RANDALLDEGLOW
1,666,223,451 *AF519C31EC64AA3B6B5880ABD2DA7F512EC407FF shara-jensen
1,666,223,452 *AF586EA72453B0005CC4C13E498DCA0F02AF399F sharmaine-perkins
1,666,223,453 *AF52A205E0EB03EF892A1A7F541FDEE5C563EF18 rantat|rmille
1,666,223,454 *AF5F23049DD3E72C0DD83D7F319D74F8E9DD8B3F Rata-(parte-2)
1,666,223,455 *AF5094B2E9C8932CE3C774A6709469077DCB773B SHERTONA
1,666,223,456 *AF51AE606B7FD93C8C7E388514446CF8C5224420 RAYONYEAR
1,666,223,457 *AF59897CB42A7C807398295ED58D5F87D97E6C05 [email protected]
1,666,223,458 *AF59FBA99B04294D7B138539CACA8DDCEC5B311B SHI.JAMES
1,666,223,459 *AF573884DA392D87300F898BCBF51E4940F8795B [email protected]
1,666,223,460 *AF5C4D281D6E8244C4DD656AC3CBB82C9FAA2226 REANMARXH
1,666,223,461 *AF5EDCEBC17D236BA28678FD47D9B40D3246E6D3 rec0nsttutng
1,666,223,462 *AF52C4A588139EB20F382400CC83FEDD3B384E68 rechtsbi6
1,666,223,463 *AF5929D96C0EBF9A33FBBCB900954EBB6DC5FFBF SLEEPY-ACTING-'SL/I/P/I/_'/&/KT/I//N/
1,666,223,464 *AF54D3F3FE3C5D74313E6E92648E37321812DCB1 repulseless8
1,666,223,465 *AF5FC7223F29A32E7847A198660E697E957CF76B SNITERED6
1,666,223,466 *AF52F3526F8390EA026E1BA23533999E15BD4CA2 SNOIREYAG3
1,666,223,467 *AF5F2880B43A8554ECF992966F739B472E798A02 so+
1,666,223,468 *AF5C1E5F10A3028B36855A765E2EB4140679DF91 SOMANNA4
1,666,223,469 *AF5E1D853205B35A5EBA1624D2C9A306525E7829 SOPHIE LEGGE
1,666,223,470 *AF544F16B9524EE9FFCF9863E0FE658F51228ED2 rightmeaningr/aI/t_'m/i/n/I//N/
1,666,223,471 *AF522A43242234F722D413B5BCFBCB3414BBADD8 [email protected]
1,666,223,472 *AF58A2914ACFEC4565531CED9AE32C8EBA84B024 rikkin{isyytt{
1,666,223,473 *AF5B7D57F1D4977E76E4E71DAB477169F94824B4 RIMITS
1,666,223,474 *AF5E5FFFFCE39105C36B2A16698EF8BA1DE26B2A sparwoude
1,666,223,475 *AF5637E4F7254D004E8C5D2495FE9B1F4E211DF5 SPENCERGUADALAJARA
1,666,223,476 *AF561E421C3E834345C22DAF7C82DA2182560438 ROBERTCASAURIA
1,666,223,477 *AF5A7A638A23B01EBA57B8C45FBC36843C5B22D5 robloftis
1,666,223,478 *AF5243B293FD020AD41F2EFCE50670125F494B3A SPLAT~`~`<------P
1,666,223,479 *AF52C6CE8D18FB84C65B92D7E663497D026227D0 SPLAYFOO.
1,666,223,480 *AF5EF3FE440AF799C542157342DE7B28E9B673F9 SR160101160GT
1,666,223,481 *AF56FC33D1EBB226FF4F35C28612B5D074814368 ROMEOMURNANE
1,666,223,482 *AF59E48346109FF6F572C692E70E0A7908DDDEFB srim4lib
1,666,223,483 *AF529D2501EEA414D0DE48311A887DD896F448F5 RONDSPOKENS9
1,666,223,484 *AF5FFC8337623269CDA48AD27338D443C4094F82 SSNCHPRS
1,666,223,485 *AF57E6670BFEF268A9C155383FFFB9BE264C5071 ROSEINDIANA8
1,666,223,486 *AF51D395DC351CD470431C7D78BC89AFA92FCC7F STANDARD''USING
1,666,223,487 *AF5256F641F9E0E5321547ED767F8AB87D0872A1 ROTAIPXE
1,666,223,488 *AF50D5BF30C879382784133D4A3DDE0CC184E3C1 STANTON.ZIER
1,666,223,489 *AF54A48500049E469E9E6D28A1E0FDDCC927669D „STAROST”
1,666,223,490 *AF54EA21BA133BFEE8C729CB644CD8E75F060FFA STE123
1,666,223,491 *AF56D2AE9E993B4A2756A707E42204516BE45C34 STEENSOL
1,666,223,492 *AF57968572F0362BDA4D9B9A1F4CD37A961146BD RRFSHTADT
1,666,223,493 *AF560AD9E7AAA47269558F4A327FCB48A5EE1FC3 STEPHANIE.RAYBORN
1,666,223,494 *AF5CC952BAC7BDFFCECF4FA619AF697339549356 STEPHAN.STOCKHOFF
1,666,223,495 *AF5A769CE3356C9B97EFEAF65B0F18A687CD65C2 [email protected]
1,666,223,496 *AF5DBDD35BA9DEA3016C2A1E15A46E4B270DDFC8 STOELTS
1,666,223,497 *AF5F763943BFC669AD4FCDBD7A36222868D739F2 [email protected]
1,666,223,498 *AF5F2CE6B2CE3D94011EF8F44F438F1756B1F20F studentolivier
1,666,223,499 *AF5A657C24BE6BC7C29670A8BA0479D04EF076E4 SUBALCAIDESES
1,666,223,500 *AF5CDE5CA29E55D3A097EA1F19EA5F65E7FB429F S5NZHDCPW
1,666,223,501 *AF57A657AA50599756D5CBB284892A8C80EE5238 sudam.ghosh
1,666,223,502 *AF5833CFFA0AB97969E0639AE5842A4259968141 Suffering-Makes-Great-Stories
1,666,223,503 *AF594539A43BC18D8562E60A43B18845965BEE03 SuiteNo3(ForSoloCello)-Courante
1,666,223,504 *AF514A9F21FA3F170F056477169D4492A33DD3FF summerdreaming(b)
1,666,223,505 *AF5AF44E03198EC949646349C0DD60FDB7EC6F38 [email protected]
1,666,223,506 *AF5CEAE9028B9C94CBCC4AD760354F6EF268A964 SALMONFUGAZI4
1,666,223,507 *AF5EEDBCBB05D91617F3EF8D0527079AC18DD002 SUNNY1RAQUEL
1,666,223,508 *AF56A940491CF0DBA73368D8D0F975F497C347C1 SURFERHANNA
1,666,223,509 *AF58987A0524C4243CDF2E2E286B0A29C607302C samvision
1,666,223,510 *AF5CC18D33B4C5483D6727F50DA184CC9D215F76 SY11A8!CA7E
1,666,223,511 *AF55E83923A9D206F96DD5C14D030C3F577AD3EE SZAPIRO
1,666,223,512 *AF5182A18B4BC9100E9C5136297B8BFC55E01B5E T0I1-WEAR
1,666,223,513 *AF566E56BEF0750FD08849EFEA2FA6D553EEB5CB [email protected]
1,666,223,514 *AF503A7456999E1BC8253A66130FE1658AF9F5F3 schwedische-gardinen
1,666,223,515 *AF5B0FC09FA3FDD69F4FC0D307F5B81F1E427751 TALK86154178166
1,666,223,516 *AF5B1929CA85E39B961FA1F4DD0D6250102196CC SCOTWOOSLEY
1,666,223,517 *AF537E29779E27D5408D42859B4DB6DE1E92FAB6 TALKNICOLABELCHER
1,666,223,518 *AF596316E0E86A6403C74691E5D280A3079C2BD8 TALKTECHNOBLITZS
1,666,223,519 *AF550D2B3AD35A17C66E7E58C9D6252EC84D0F4A tamar-w
1,666,223,520 *AF5EE14FBB5FEAA4C22030F40BB4905545286412 [email protected]
1,666,223,521 *AF5C8F1E0F217B422CCCE736B6656BFB33FC560C TANDEZ
1,666,223,522 *AF5B5F952A9C6D39D307519C390A282B0DB293E5 SecondEssay,Op17
1,666,223,523 *AF5F71F9C7142ED56E9F3DBBA413A9D95B6A5D38 SEISSEC0
1,666,223,524 *AF598FB0330C60AC2E555291430FE81E104ACC4B SELLABLE
1,666,223,525 *AF5D23948E93EC21B0853EB27AD40CB46D21EB88 TEDDY.MATTER
1,666,223,526 *AF5C331AFE1B188816557ED57726D6C82A0645CC SETH.HELMER
1,666,223,527 *AF56F22B053B7A3EB114924BBE35EC5D393C7FD1 TEKCORYK1234
1,666,223,528 *AF5A2A863D2517417E46ACC11A703E77EF1B3928 TELEODBIORNIKÓW
1,666,223,529 *AF5339F773F5F6593B9CC92BBCDBB36D602C7B73 TERESAFARINA
1,666,223,530 *AF5D52EBA9FE43162CAF29657775F22E4620B1AE TERMINAL FROST (DYOL MIX)
1,666,223,531 *AF5001B1D2120A027717144523D218A36C9158EE [email protected]
1,666,223,532 *AF5476D34BA8E2295C3D22860A0BF42A97078D44 SHARLENE LUCERO
1,666,223,533 *AF538BE94EA04BE84256FCA99E868702AA0BFDC0 SHARONJOYCESTEWART
1,666,223,534 *AF54D285826B5DFCA853E6AD9966C87F87303A55 texasroys
1,666,223,535 *AF5BFF9FCB31BA366CFC5F5C65CCCE608667D017 shelmidine
1,666,223,536 *AF594A680AE03C9FBE23DF1F565E915DE16F3335 SHIRLEY.VANISOUVONG
1,666,223,537 *AF5251890BAC6B88296272DA7AD3AD563F90A847 SHITHEADPOPEYE5
1,666,223,538 *AF54C9DEE716037C675ABAA0C57DDD0E8796AF12 THECREATIVE1992
1,666,223,539 *AF55D600825E41506AD58C9F573E9AD9DC620E5F THEEBEURS?
1,666,223,540 *AF57E4C4033FA0C8C5A4256EBFE9363E14FF4682 THEJA KRISHNA
1,666,223,541 *AF526DC4F6F111667DA0DEBC04EE0DE1179347B4 THEMESS
1,666,223,542 *AF5859396FCAA88E2B3465AD74ADC6E149F02EF3 [email protected]
1,666,223,543 *AF5B1A4C35AD3B77A9FED35EA850F005AD425684 sitzbankreihen
1,666,223,544 *AF5691538D427F37D423CD7D2B5A8CF597FC59ED TIGERGLENN9
1,666,223,545 *AF5B14C970B9FF7DE97A09D1BF3DB5213B4CAD3F slavenburgs
1,666,223,546 *AF5723929E69A5AE5EB51BF1770F80AC48325881 TIMITHE9
1,666,223,547 *AF5F3AED413D7952F60B6F0EC88ADB6B19537539 SLOWBRIDGE
1,666,223,548 *AF5B922C2F07964DB1222BEE48E6A5E369A50BAE [email protected]
1,666,223,549 *AF509CB70B55C90A9FA1CEFD21218339B5C39969 SNAPREPRISE3
1,666,223,550 *AF50A3EF0A004D7EF9447C4526921C437299EAE7 SNESDIGTSOP
1,666,223,551 *AF5902E951133B4D153AF68E661714733598A8E1 TNABAUQEA
1,666,223,552 *AF5D3B022E0FF08B27F697DD6B19BF3A90B1CD3F SOLER-GIJON
1,666,223,553 *AF5701B6D8F001DC301BBE8D6D29DE99D091728B Sonata2:IAdagio
1,666,223,554 *AF520B10484F38744D9A87F0843F0F95607CE2FD tovarish-cirk
1,666,223,555 *AF503AA17D1E4623428DA630D494878E2BE80749 SPATIAQUE7
1,666,223,556 *AF51827255BE8203A1E8290EEFD765E37D28CF11 speelgoedlijn
1,666,223,557 *AF52B73AD6326607AA85263B12BF7B3ABF8FB619 TRACYALLARD
1,666,223,558 *AF5E81D14202978F7F19F18E8B7DB95428C05717 spiridion-salvatore-costantino
1,666,223,559 *AF5F450B0F078B88149A62D673B6A224D13CB9CF splat!!.*.*.*.<#3
1,666,223,560 *AF585CBFD509A3D87ED197BFDD3B0C16883CF24A SPLATO~ 0~ D3
1,666,223,561 *AF5628C57E36EBA48C20A00DEC3E7A6BF919BE67 TREY.BAURES
1,666,223,562 *AF54F304D7F14E9C2900B122BF8635E5E2049F76 src=http//ecximagesamazoncom/images/i/21hkxoo7skl_aa115_jpg
1,666,223,563 *AF54BF6000744992B93774E9DAD5B84DE75B800B SSENSSELEERT7
1,666,223,564 *AF53C5AEE32F69EABE7FB984EA31A5787E8D289C TRUPTI.MARTIN
1,666,223,565 *AF5B53CEA0D2DD2081713AC88FC471A9C22D9C6B stalagmite trance
1,666,223,566 *AF5BAF23AD7BAC8D694CEE522290F5A0B3FB70B5 TUNNELMAKER?
1,666,223,567 *AF50BB32B47208AA357D76DD27BDAF98C7C3A5C0 STEVAN.MORRIS
1,666,223,568 *AF54C842CD5EDF1A0A92848D583C05E6677443F5 TYLER.F.KELLEY
1,666,223,569 *AF5EE5A712FC8E5FC7C456E55778C733ABA46C49 steven-traina
1,666,223,570 *AF579D465232A70C6C9065B76C99317BA2E02B32 tyreekreisher
1,666,223,571 *AF572652F17EC64603680A7EE732131D696D9C0B tyrellaxon
1,666,223,572 *AF594C22316C39F13B374053E035C385B8C1F7C5 TYSONGOODLAND
1,666,223,573 *AF54E80736587312AD058B73890AFC0E18478053 STONEDJACK80
1,666,223,574 *AF58BBF3EC7D6575DD023AEF9ED83F0997714810 streptomyces,str/E/pt/@/'m/aI/s/i/z
1,666,223,575 *AF549A7DF7AD82477EEBFC4F168BAEDD5A81ED13 UDRUBINIBSW2
1,666,223,576 *AF576569E4F967BDBF9C842820D1211B72C19C6B [email protected]
1,666,223,577 *AF55D8577B3D10F2C3B82A277AED0F31F60224EC UITGESPELDES9
1,666,223,578 *AF542DB4B0E9F966720C627BCD8C54EAD376F6D9 STUMIERT2
1,666,223,579 *AF5A293ED31E739C29092B2B2D8E79F905BCFE87 UKESTLER
1,666,223,580 *AF5BF9E39F8A5DEA07945B80884BD8A493BBF7CA ULRCYENZS
1,666,223,581 *AF59CB4C5BB21B5B6CE32B432BCC79BA38DFEA1D SUDI722
1,666,223,582 *AF575DF8C48CF16F860FC874AF7E723EDCD1A6A8 umirile8
1,666,223,583 *AF54E7C5BF185EDA847C67AF0780BDC8E358A1D9 «UNIVERTV
1,666,223,584 *AF58D308725375C91C29291B2590D55DFC3D20A6 UNPROMULGATEDA0
1,666,223,585 *AF576766E933A30AC0A23DFA2C215084C8E67A34 ÜNSIYÂR
1,666,223,586 *AF5A678D8D39581BD5A1E9EF8681D9203EF8CCFC [email protected]
1,666,223,587 *AF58B503239C975AFEA68AEDC30848B21AC2B53D untilwehaveenough
1,666,223,588 *AF5986573AFFF9BC2CC3B2F3A235C624A61D6A50 USERY2LANCE
1,666,223,589 *AF51C5D527D2BB82D697120AB6914AA0FD2BA7E1 USKONPUHDISTAJAN
1,666,223,590 *AF5C995A11C4325664EFCF2BA1529E7AB296BB5F SYSTEMATISINGT
1,666,223,591 *AF548987F569C0A03DE01A71D92FB08E62F51E69 UZDIMKJNDRW
1,666,223,592 *AF53C1FFA20A6BC78167E5628F5C95CCF08FE1EB T9CHCR
1,666,223,593 *AF585E2E043CC64A33EF88F15FDE5255A7915BA5 TALKGABERKE
1,666,223,594 *AF5BC255E533B5B1549C67017D289323ED2E9EDD VANEGUD
1,666,223,595 *AF5AC9E75D854CF8983FB1C4D4F851A75FAC952F venkatram-sulur
1,666,223,596 *AF5A7265D842A5384F21A167ABA3A2FDC752E928 tbewdtd3
1,666,223,597 *AF55ABD7315A0EC26CD88A089C7E8F836DE9FCB2 tedmottola
1,666,223,598 *AF5B76BBC86F857C4581AA8435D4B16DA505274A vhiephang
1,666,223,599 *AF5C61052BE566E1EBE85EE34232D25752613538 VICTORGRIASNOW
1,666,223,600 *AF5C7C696E09628A0E4BCB7AB2EE4752A2B1CC4E terrellraspberry
1,666,223,601 *AF57AF8E8AD19FFB44644341946E6E6FFC5A4619 THADDEUS.WOLFE
1,666,223,602 *AF520A5C6E47059079E7C84DA93A2D7AED0DEEDF thankyou17
1,666,223,603 *AF5ACA307A5D6C7269FEDE62593441AE989A4DB7 THIS AMP GOES TO ELEVEN
1,666,223,604 *AF5DE97CA7E4070D2EEEDE1F7C5AD1891518F7C6 VYAADHING
1,666,223,605 *AF519516B9FED3BEC8808ACB8EFFA86A977ECBA2 TIANROC8
1,666,223,606 *AF5511A35B931DC6E73A6C4016452DCB7B1E4C2B [email protected]
1,666,223,607 *AF583BEAEC715520C241943CE6EA3D24EF30857C [email protected]
1,666,223,608 *AF5C9C61FACF02E041675B15DEB5BB19DA5B30D9 WASIUAREMU
1,666,223,609 *AF53F8E49BC4F403A89D2143D42D56CA27932AD9 WATIZACK
1,666,223,610 *AF50639ECBA33B25A08856C6D248FF781931D353 TNUOMAES0
1,666,223,611 *AF565534F10124C7A4EB336BC7721A4D3D3E7421 TOBYCASSELL
1,666,223,612 *AF52A46F8424CD8E08EF1CED1776B3DC75D124A0 [email protected]
1,666,223,613 *AF5DF1187BC5C66062B9620BF242D4452259927A WAYNE.MCCONNAUGHHAY
1,666,223,614 *AF52879F8CEBB843D1E1DF00284AF93B1A478586 [email protected]
1,666,223,615 *AF57DD119ABC1B762B2DA2591B0F8B45A040D2EE WE4LTHY-$
1,666,223,616 *AF5372D40759723C4CB45D5FE749C92D57E0C96C TOMANDTHECATS:4TOMANDT
1,666,223,617 *AF59DC2BA52A7C137AADBC21CD2226ABAC9FE238 TOM.KOLBE
1,666,223,618 *AF5D9511AF660F5789FA86FFC92D236D333DDF9E TÖRTÉNETKRITIKA
1,666,223,619 *AF56C8A03B56EA008423A59DF5F295AEDB57F639 [email protected]
1,666,223,620 *AF501F614412CC6BEF7A08F50CF3935AB3BBF22E westerr
1,666,223,621 *AF58DB7571FB42015560611CB0E98B07722DD080 tracyannwhyte
1,666,223,622 *AF591E894AE14EB6E6B89118AE4A27D8662C1733 TREKKSPILLMILJØET
1,666,223,623 *AF52673E99F260927F3BBD51CC5DBE0A93ACA63A TRETTEHCING
1,666,223,624 *AF5B784BD618FF49FAD3214786BBC65B5CB39C53 WILFREDO.ESCUE
1,666,223,625 *AF5F0FAB7BBFEDEAB2B78768EC63D7C1DC2BB3F0 WILKESBASEANTARCTIQUE
1,666,223,626 *AF541CC3C369FB3A4A2B7249919D4C03C995F94D TRIBNTION
1,666,223,627 *AF58EAD55BC77AA6ABCBC03AA4DF704879AF1C1F williamdouglaslandrum
1,666,223,628 *AF57204AC5381D516AE1F5D7EBA3A45AF230ECA9 TRISTANLARE
1,666,223,629 *AF52DBFE871B67A9955B7AAD41D452B92AAE2BBC triuswatun
1,666,223,630 *AF502BD32D885C3101346FB40171563BC89CFB4B trumansluski
1,666,223,631 *AF536FA67C19097551EEB5F80B801BA91F1B4546 with.howie.d.
1,666,223,632 *AF5740496647ECE45E434211894CA05F540D6483 tsjerkassov
1,666,223,633 *AF5611070BA5C76A59A0938ADF8324D94E47D20C World,.Devil.&.Body
1,666,223,634 *AF5ED28F0E350DFD3A1314FEE3AAE5394A1FE3FE wpphysics
1,666,223,635 *AF5DEF22AAEDC7FDC5ED9AFAE57E6F91225B2124 wvzamcagpc
1,666,223,636 *AF53101CBC6E67EF5B21F1B0EF6956015D55C68F WWW.GETBHAVCOPY.COM
1,666,223,637 *AF5DFC6305B2CE99F38817C9DB578FF8D87A5A42 WWWJASONFPECKCOM
1,666,223,638 *AF5F3A89F16480C1B93D5F8DB9856065201F40E1 wwwstuborguk
1,666,223,639 *AF57096008AED31D630ADD83527F0EFDAB52E729 TYRON.PRESTI
1,666,223,640 *AF51B71825E5D7012DB475E15BA1D8990912F045 $UBENG1NEER
1,666,223,641 *AF5AE1E1C21B9C1FFB1053CE66EEF6D61B2F62D7 XALLBSWS
1,666,223,642 *AF5327F2044926F06DED58B0DD433B1C373ED2CE [email protected]
1,666,223,643 *AF51D3E5521F78E35D96B00A5988BD56515B6DFA UEBERGLUECKLICHSTED
1,666,223,644 *AF5E5574A6FD0D315B0F48D0206A7BA3EA6519EA [email protected]
1,666,223,645 *AF56A92D9A8CE7E055F1BD0E9E148B5D9F448286 [email protected]
1,666,223,646 *AF5874C5D5975A6202CCF6948554D394D17A663C [email protected]
1,666,223,647 *AF56766D971B8109B6B1303E843594FF23852D5D XMKJ
1,666,223,648 *AF54795E8FCC5A5A18BEE4C18BBAE738BCF6F7AA UMCUSA
1,666,223,649 *AF50D8ED74E3FB6D91AADD634D19FD6737D51C46 }X{[email protected]====P
1,666,223,650 *AF5C8818CF63F4ED1BD3582CBC95C83460797B23 UN7RANSLA73D
1,666,223,651 *AF59A8B95FF66477FBA7D933EDAD915BC92BEDB2 [email protected]
1,666,223,652 *AF53B6DD33E089BF0419809625B143272A7343F3 UPGOPWHV31
1,666,223,653 *AF5180A04EFE70392A83AE5DCAD0DC54669CBB0B YARA-BENVENUTO
1,666,223,654 *AF51A05FDE6E7983DFAC6ADB6EFBD460096E9438 YASHOSHROFF
1,666,223,655 *AF544148A188DF668EDE654A4B945D97C07C6005 USERACERTAIN
1,666,223,656 *AF596F10ED4B9380E8A97AFDD35CBAF35EE6D990 yeqljsya
1,666,223,657 *AF549F57C35ADA1E1A65FD984670DD39981E79FE Uvillig
1,666,223,658 *AF5820529F0ADBFC34CDBA62304B73DA5E919BC9 valentinlallave
1,666,223,659 *AF5013F73A08F864A4B54C535E67DD1A61DEF9DF YREHTAEFBSWED
1,666,223,660 *AF550AA99E4F71DF9FDA02E0EC0535A0A883E265 VAL.SCHECHTER
1,666,223,661 *AF53EAC7773E34920E4BD4B9308CA129F378E7A6 yuanchia.john.chao
1,666,223,662 *AF5E7A6E5D5F0129DD20FFCB0AF115372F2711EE [email protected]
1,666,223,663 *AF565FCEFC25485E62BF9C8D72DE70C08372E7F0 VANNAK38
1,666,223,664 *AF5EA120FC2104B855BAEAEBD74D49068BD7848A YURIYGAVRIKOV
1,666,223,665 *AF5ECD097654FC2B986F92C99D7117DA06D4EC53 yves-e-aspacio
1,666,223,666 *AF537D776FF9398EE5BC2926BAC62C519AC84BAF YVONNE.FONSECA
1,666,223,667 *AF5DE03641EE8B5D34CC46270F7084F314BAAB2F VAUGHNHRADECKY
1,666,223,668 *AF5FA98D1E8F60F9E116916EA7F86B12034B5464 yxen
1,666,223,669 *AF5BF2294991A17C87F9F6F1FA850729FAFC5436 zac.dubberly
1,666,223,670 *AF516F9F138DC1AB9285F88AF00BDE8DE1141747 ZADIASOTO
1,666,223,671 *AF5A6EC10C495856BE7AC289556433F0E7158A25 VENZA DE VERAS
1,666,223,672 *AF5413CFA98F4580412E5D6CE55D5E3149D257D4 ZAKHONA-AYANDA-NTSHANGASE
1,666,223,673 *AF513EC15FD4C478BF38AC31AC3D6F4A37E976C5 ZALIAOMAR
1,666,223,674 *AF5F7C8CDEE54DE722C601ACBC4B4D4C002C7823 ZAMIN MITHA
1,666,223,675 *AF5623850BE53EF376D9A4DE9B2921CE67936638 veronica-ann-brooks
1,666,223,676 *AF53269DF957CAF781469DC6DE2B526F9EBC1070 VERONICA.BECKFORD.HARVEY
1,666,223,677 *AF578A627760989C8954963B36106D43FFDF0B77 VERONIKA-NOVOTNA
1,666,223,678 *AF560411393F3881B0F66267E3A9EE9CD59F3638 ZENA-AL-YASSIN
1,666,223,679 *AF52569874FCE5D009C3597DB87B88F6FBE6236B ZENITHAMANDA5
1,666,223,680 *AF5596F0AD840881F994800BD8020D0F731C3292 veverly-fields
1,666,223,681 *AF5E469DE69C77B21DDF31E15BD39EB125CFB665 VICENTE.LENDOR
1,666,223,682 *AF56FFFB4849833BADCADC14C1C143F16B7F8A2D victordupree
1,666,223,683 *AF5CAE8180D65A1BFF8A14C7B45496733D0E3B57 ZHENQ-DAN
1,666,223,684 *AF5D8C9AD9CE9D9E41B004C2DE0822171AA64BFD [email protected]
1,666,223,685 *AF5955134C486FB712DA79B4E3DC77CDEDA365B5 vincenzoswimm
1,666,223,686 *AF56B4C2424D7787216E617D4CADDFD27A42DDF8 VINCEVASOS
1,666,223,687 *AF5220A16E52B68787EB71842661E19947B17534 VINICIUSCORDEIRO
1,666,223,688 *AF5583BE5646BD25C4FC655B8730B904EF9E5CDF VIRGILHORNLEIN
1,666,223,689 *AF505AEB60D82491895A2C8EEC438EEAA06C29D1 VIRGILIOBARDNEY
1,666,223,690 *AF584C69E563E4D002338490F7D6D524574AA7B6 VIS2HAY1
1,666,223,691 *AF52743B4D95BA3D3EAF46DEAB0B900B1E64DFFA zustandsveränderungen
1,666,223,692 *AF5A94A444FBBC0D74F67134C55F6A9C0DACFE8F μεγαρικοι
1,666,223,693 *AF53C1AD4ECD5C1754859ACA82BA608795DFE516 ΠΕΝΤΕΛΙΚΟΙ
1,666,223,694 *AF5E9507C8026E3D2F2EF4897BC8885211266F32 vonmaish
1,666,223,695 *AF528358CAB7F1C90583AC82A14700D305224B9F VREDGAR4
1,666,223,696 *AF5C6C88E20F283CD22446D3AEE7946D46444C5F VREELAND16
1,666,223,697 *AF5BA9A72071EFDE2F666BCA6853B0355FE9A9C6 [email protected]
1,666,223,698 *AF52145147A32487FC86F08DBF59415159D34F37 „въздухоплавателна
1,666,223,699 *AF586F7AC218CBDEA756FCA2D6ACD9CBCC78ED25 W4$HRO4D
1,666,223,700 *AF5ED3605479E1E54B0E6B2BC65BAB23340A8C34 [email protected]
1,666,223,701 *AF587116EEAE3A63EE9AC9B6526002520FB2EF6F НАПРУЖАТЬ
1,666,223,702 *AF52F86BF36BA53AF23FA0D23798C6BD77E0E251 WALTATIUS
1,666,223,703 *AF53F4D37E80D8B50C3496CE41AB9EDC4B7BD99D walterwestwater
1,666,223,704 *AF548414BB011074AB335676847647B5347C584E [email protected]
1,666,223,705 *AF5C37B723107233B7AEA587E5A03E85D907BDE2 WDS(
1,666,223,706 *AF5C71B0D15E54A26A297A21F9F2F9F6917C18C3 中華電信大電視MOD
1,666,223,707 *AF5C49C483E02AE1414A6B8EB6AD7AE0ABB6BB08 where were you when the fun stopped?
1,666,223,708 *AF5BDDAE2668E8EF1E4160A520231A3D429CF78A 译音表:因达莱;另译:茵达莱(YINTALE)
1,666,223,709 *AF548B82CCB925DCD76BEAAFD3E9FD0637A9B2A9 WILD-MOUNTAIN
1,666,223,710 *AF5FA50B7C411E8127A81F4479FF26ED5E1FC8B5 [email protected]
1,666,223,711 *AF52EFFB6D881159DBC339676F0DF88D2B8ED5B5 006jaycee
1,666,223,712 *AF5674E7C006A818942504F0BE8AF2E7B401F40E 08.19.1042
1,666,223,713 *AF52734C382B42EFE93FE001F3296EDD47D99186 X\CN
1,666,223,714 *AF5275ADDA071E6F97E11183EA7EE342123E85B8 XENONX45
1,666,223,715 *AF5E2684F95912685ABA556EAFF3D04B8D5641D9 [email protected]
1,666,223,716 *AF5C71AFACDBA66D62EC5671F11D28EC2B3B33ED XOHDXML5
1,666,223,717 *AF5B6A6CAD9AC3BE147FE2DE581CB3D8535A3AFE 121b5
1,666,223,718 *AF5F1BC04B1D534311CC98740561DACD3A424B96 123KOLKHOZ
1,666,223,719 *AF55AF5E9E68DB4D9BBAEAE9CFD18B5533936391 12THREE-PHASE
1,666,223,720 *AF588964045FB01AD290AA7709287DF5D69C6662 XUXY9WHMAKYI7
1,666,223,721 *AF57F4F5CFA11245A2163ACBA08654D3C2463DD6 xxc
1,666,223,722 *AF569400DFFCD6397EF1616B48E6A00B4C829B81 yahya.salih
1,666,223,723 *AF5B177AEE6F881FA7A60662F87C71C40AA89AE4 156mhz
1,666,223,724 *AF57C58F0BB85E87961CC5BC6E7BBEE7C2352857 1857321 kokeista ( koskee my
1,666,223,725 *AF53982502B676E749C98EE05455F4AC51D2D400 ȝeīeƿed
1,666,223,726 *AF54A524BDF22FE24E41C3265C056B412F9A4E7E 1avustuspotista
1,666,223,727 *AF5D97B992D5E8B79F008C4CCEF58BC5F0D0495F 1.braese
1,666,223,728 *AF5877C4019B3E5CEDEE39061E76638CB8812C38 1.costacavrasfilm
1,666,223,729 *AF545A40089D08AFDC355DA440F96B99EC9FB957 1.discontent-the
1,666,223,730 *AF5F971708F74B2478E61E29A88705270ADD5275 YONGNAGAI
1,666,223,731 *AF560E00A80984567B561D8EF5B4DC06C18AC815 YORIYOSHIKOSUKE
1,666,223,732 *AF5746602EEE7BC84F59DA69DBD86DAC0689AA97 YOSABURO-BUSHI-ACCOMPANIMENT
1,666,223,733 *AF5C40673EF338F4C7DEBEBC365CC7734E213238 yossimalki
1,666,223,734 *AF5E8B55BB7887BCF30A18ED246C7774C0B2E850 1ENTEZZA
1,666,223,735 *AF5FE5BB381C14D3CDC97237DF43F3FF63BF0D86 1-ETEISK
1,666,223,736 *AF50D5DFD16F86DDBBD3C5E65F5FDAE3EA4CB7C1 1GETOUT0
1,666,223,737 *AF541FE1F5BEEF43C6E6C42EEC0B1A309B4B3AB0 [email protected]
1,666,223,738 *AF54ACC319E30C1D380DF55422252AE6F03CD86A 1-henkiinelvytt
1,666,223,739 *AF5CEA54D48F3B80D6A11FE6D2F00C2793B6D934 1.holderbank-anlagen
1,666,223,740 *AF56F6CC1584F37CD8738DD74D071EA28D5F5FEA YVONNE-AMARAL
1,666,223,741 *AF5EBFEE57C2D0278DC086D6A1E3332095825CCB 1.kuolemanturvavakuutukset
1,666,223,742 *AF56DD33B7DF64C98FB63690E0C31C4C6ACCB72A 1martin-baker
1,666,223,743 *AF59D7EAA4BC818415C45E5289A1F365D2413768 1MYDOUGLAS1
1,666,223,744 *AF561B69AD22A1A0707B7F6B951C78C7E8843C68 ZAHLKÖRPERN
1,666,223,745 *AF5C1A4742F9303E35F55DDC80DC32293855CF5B [email protected]
1,666,223,746 *AF5675039937C4454D63B16805CAAEFBFAE9322D ZAVFE682
1,666,223,747 *AF54FEA6EF1EDCC25767A27935141F4113383AE0 1reiter-salaer
1,666,223,748 *AF515C4D7CC0296781FD53917AE8D454EE066317 1.RUUANVALMISTUST
1,666,223,749 *AF5F441E1EF3F3F7B61E475EE13DB4068A56496D 1-stadt-land-vergleich
1,666,223,750 *AF5D7C0B63B284A1B1767A33F4A99CDEAB3B5220 [email protected]
1,666,223,751 *AF50DBFF3F957EDACC1ACE16CE781FB21C33C9BB 1TAGOMORI
1,666,223,752 *AF5A3BC6C4843E16172123009815544B4915A4E4 [email protected]
1,666,223,753 *AF5F2A95CCC6E69ACEA9A3B595F07DF393F629F1 1-TEE-FIRMA
1,666,223,754 *AF56B455A517DB534ABBB4D11C749D27C57D5FB5 1-tourismus-boykott
1,666,223,755 *AF5FA093FD051AF000C5B363729E4FCBBCEF7271 [email protected]
1,666,223,756 *AF578E2D368DF4F7EA8DF0C2231FA2A20BFC9CFF 1VIRGINIAPREVIOUSLY
1,666,223,757 *AF5F4D070799ECA01E8D9D59544920E961B951B3 1 YKSIL
1,666,223,758 *AF5D545EB5A548FD01FDABC81CE688137279BDA4 2003745 weilpolitiktransparenterwird.
1,666,223,759 *AF50FD15A04630E4757E3144A1FE6E4C9DF5B3A1 [email protected]
1,666,223,760 *AF5361085D49981A0274414452BA2480271E9E17 20ANS:ZIANNIVERSAIRE!
1,666,223,761 *AF5AF5CC71534808AA27249FFFE6B902AAFDD706 221589 LEONI VERLOREN DENNOCH 0,9 PROZENT AUF 57,40 EURO
1,666,223,762 *AF56CC4559E5E436957619998C67A1F911BF8DB3 ZWANGSM
1,666,223,763 *AF5258CBD3B32F6BF78E937C475561750CDC5B6E ZZC08Q7XLV8UPH3Y
1,666,223,764 *AF587E19F97E2C8046ED5D8C240F3A3695DC6F0E 2373670 OHEISESSA-LIITTEESS
1,666,223,765 *AF527CD0B000D17C27C96BFC02A9022812E0E86E 2563552 j
1,666,223,766 *AF5E38A624D82D2056E00D1F251ED487BB5EFB65 ΚΛΟΎΜΠΕΝ
1,666,223,767 *AF577747183195FE3531FB6EBD0E45216C0C8AF4 25april1175
1,666,223,768 *AF536C25F4DB3054800D8A2119E523BC7B942B1C 2703954 fuer uns ist der rest ein kinderspiel
1,666,223,769 *AF590D231C5953D57847956B3AB705F4B0C633AD 27111241
1,666,223,770 *AF5CA473E71FE029E7313720DBBEDE0F6E066700 2-besuchsregelung
1,666,223,771 *AF5795515047433893FC23A113554DA7C23FA68A КОАРДОМ
1,666,223,772 *AF53FF7053305C32374C1229E164FEC1CDF8BF0E МАРСЕЛЕЙ
1,666,223,773 *AF5D01312280ABE6CFD646420B9BEBB84667C668 2flohmarktluester
1,666,223,774 *AF5D3183C64943171A1365B2F9DD9A26DB7A028C „НАРОДИМА
1,666,223,775 *AF59B662138F6FA42EEAAE5DCFFF2991D29AEBE7 ТАКВІЛЬ
1,666,223,776 *AF5086580ADC9D93EAD2264879B2BE67EC380923 УЕДИНИТСЯ
1,666,223,777 *AF59227511230579459A7A9922AFE45646EC8554 2WCHAPMAN
1,666,223,778 *AF5C36ED0DE89EABAEBA412B7D9D9E985E5802F0 328846 JOKAINEN.OSAALUE.PIT
1,666,223,779 *AF584EC9C94A8B61D00C24AF924CAD43599BDD93 378715 advancing issues outpaced decliners , 1,226 to 936
1,666,223,780 *AF59FE76502EE6764A4EC9B16194AC59F4BA82EA 398726 PAINAMALLA SIIN
1,666,223,781 *AF5CC9BE8ECEA9F9EBDAE8761E7D1B4452A072AD 3avanos'a
1,666,223,782 *AF50196301B75090E400138A1D5F4CAF00A0C0AB 3#####b `~o><
1,666,223,783 *AF5E6446EA5B061482A4E9AD42D3433600EA960F 3MANAKTIEN
1,666,223,784 *AF5848943D00E555B944846FAA540AD62A246F94 3P * * * ~0~oSplat
1,666,223,785 *AF53737A3E28415434999DB5E67CEC84E97F100F 『鞄が欲しい』 えい出版社 2005年 ISBN
1,666,223,786 *AF529235FF47FEA655C757694854289CCEF8DBFC 4ILUVDUKE4
1,666,223,787 *AF588B5D12C2339F1649718FBBCB1F4D2C994902 4NREDROF
1,666,223,788 *AF55C04821AAF719C50D1278F30587F4077D8AE5 4PARAMOUNT-MCA
1,666,223,789 *AF5B014FF9580A229F53C1A1E0290B311F899EDC 4QUEBECPENTIUM
1,666,223,790 *AF5158AB734BF3AB24633E3B293106AF67838FE6 4UGCDBTCBSW
1,666,223,791 *AF55BB37B3397CCD578165F04E8491AF95353374 4WRAKINGEN
1,666,223,792 *AF5FF78EA84CBB534C21BD1FC9E6F9534645576E [email protected]
1,666,223,793 *AF5D079208596677DC0D87909FAFD97825757A05 5BARACCONE
1,666,223,794 *AF517D3B29656FF9387804313F5171A940FA2BE3 5DOMALMA
1,666,223,795 *AF53F978C6174D31871CD195AD7DFEC325FF629D 5DRAAIBOEKS
1,666,223,796 *AF566356D0BC6E7CAE22264956FD5D719733C017 5HENTUVAN
1,666,223,797 *AF5100E2D23EE78D7B14A2E3A4B3A62D60A89344 5NTDUHDOC
1,666,223,798 *AF5C8743FA1F157C364D99A8D70D0DE7E94F9A07 5REEMPRUNTERAI
1,666,223,799 *AF5C6EFE6DBB6275570DFE0ED161F412D307EBDE 5REKKEVIDDEN
1,666,223,800 *AF557A39A0DC8266D60DEDE9C5C956E6A5A079B5 5TORNATZKY
1,666,223,801 *AF541534121AC6680E50611B5338456584F36D58 5tourbillonnerait
1,666,223,802 *AF5F0CAE70F58F26B7C75FB4F13D4997792B7838 611532 bugUn.birCok.kimse.bu.meseleyi.unutmuS.gibi.gOzUkUyor..
1,666,223,803 *AF558C80E1B95B859CFA45A2C1D7FCB578583F4D 635192 okt--ilhan-aksoy-,-(-ataturk-ilk--ve-ink-
1,666,223,804 *AF5A40183DCB6C6CE29185D7EA708B533AC76821 63 L
1,666,223,805 *AF5CE931363AA94B994C9B7AFF26B1F1694CBE78 6FORESPRGSELSPROGRAMMERNE
1,666,223,806 *AF5B34BE341808795BFA5FDA17E8BD8121BD5F2D 6MCANISERAI
1,666,223,807 *AF519C9383593B2D57F7E995F694906CED70796F 6POOHBEARCHRISTIN
1,666,223,808 *AF5567D5C7840A4E9C24E6B7CD6EAB5A84E2161B 6QWERTYONLINE
1,666,223,809 *AF58D4512C9698339A0CC48BB9DABBD44FBCDC3D 051kassidy
1,666,223,810 *AF55ED7FF7E8F0D648BC878B651EE03D0AE50421 6SIRANESI
1,666,223,811 *AF5A5AE210BA4B5C69A4076FBFCC0895EF8DC07F 6thebigman1
1,666,223,812 *AF574EBAC34FC36F7D8F8D76DFAA2038F2A10B24 6WILLIAMSVERONICA
1,666,223,813 *AF51567577468F9AC84D173427EF133A2D160C38 )0(~`d####P
1,666,223,814 *AF5FCF724F07F9B40A159BF94489612CA60AE39F 77137C9FAEAD3B248A44929823705A13
1,666,223,815 *AF5B1B3BB9D790CC21FF63008B197B9583B78593 103741 kullanIlanmotifler:sandIk,gOz
1,666,223,816 *AF5DB4B4B78E3955E38F499835BD41461D3E5FC2 103.EXPIRY
1,666,223,817 *AF5BF2137F163652D1859E6D31E03FF576BC14F3 1111340 TUORLAN-SEP
1,666,223,818 *AF5F865664A28B661ED72806031E035EEC9FC808 112ECE7161C1201BAB9EC3147EEE3659.DSCHPHPBB
1,666,223,819 *AF590D7616D494CF14C82A90E551FFE7554F7A21 7ESUDLROW
1,666,223,820 *AF5C6C1C8C4E457864109F90D43126FB41DB398E 7IAVANIIV
1,666,223,821 *AF5C6CABBA036ABBCDDC7D4EC2031991C26626CA 7J2N
1,666,223,822 *AF535B797F0B4FBB5950B94946E8A0DDFCD33B25 1493682 elokuvanviestinn
1,666,223,823 *AF5290CABBBC35DF4384E39C5ADAC85F1BE9B5B1 16-04-1907
1,666,223,824 *AF5BC03361B5AD7794446C1CDBDC5BCC8944AFB5 170-P
1,666,223,825 *AF57DC442EBB5C9FF6F6085375CE6B718E3C4850 7PSEUDOGLOBIN
1,666,223,826 *AF519F10BD04D8E1330E8377D475EDCF2A71A4B3 17JULY1683
1,666,223,827 *AF5F249DEB526FDE60C8921D918AD4583E232858 1ATEROPU1SION
1,666,223,828 *AF5C02306891EE31C3EBFF0CE56C8C818137F03C 1 AUFZIEHBARER
1,666,223,829 *AF5226A24D04F3C8071261746030F903DAA5BEB5 1-AVTOPROMIMPORT
1,666,223,830 *AF5BB84267507584EA53B12C7C807023E0F451AC 1 BESTATTUNGSFORMEN
1,666,223,831 *AF51576F10B6623F25EC1721B77518CF980640EE 1BETEUERND
1,666,223,832 *AF562A3D97A4D2BAD6B9A762CFA125C70A16647C 8=====B*-*-*-}O{
1,666,223,833 *AF50273FB9B0776C32CFD5D914839A9B98295F7B 8BONNIESPIRIT
1,666,223,834 *AF5F23EA4457C7886715FE87591932819869B329 8BRENAGH
1,666,223,835 *AF507E73B169AA5EF8C1AABB5E06D591650E560D 8D~0~osplat
1,666,223,836 *AF5F94FCC005B201E2C6544403B485B2B9A2758C 8-d`~`~(o_-)
1,666,223,837 *AF5F42EA40DE900DAFDB8B7A641A4AD8EF1FF1A6 1-hemdenmacher
1,666,223,838 *AF5960A1D1C86AE9AE88AB0EAB22E741B1F415CE 1-hymisteliv
1,666,223,839 *AF57E043B386128F4B7EA6B0A62FF29B89429ECF 1.KOULULAISRYHMILLE
1,666,223,840 *AF5D09A4AE8834541DDCAFC1FA53DF0B9F7F12A7 1N+3RN4+1ON4L1$+
1,666,223,841 *AF557A83589B697AE8C01BBB9C730D01896C2877 1 nigeriakampanjavastaavamme
1,666,223,842 *AF58AC30BC7E8F31B5F8279D11FF942D13D1FBF5 8REPORTVIN
1,666,223,843 *AF5C2699C529022BD711C0AAAB512C989CC3DBAF 1NONPOPER
1,666,223,844 *AF51F98098E0DECA0D4F677BFEE2ABC71642705A 1OHJELMISTOYHTI
1,666,223,845 *AF5E5F77B6631785BB35FE38C48735F8344E4CE3 8unmedicative
1,666,223,846 *AF56A068BE754ECEAFCE5327A77AD8EE8AF8EA17 1 SAIRASLOMASIJAISIA
1,666,223,847 *AF523B023637C09B427C0E3BEDB52F303779D92F 90636 maden mUh sec
1,666,223,848 *AF558E75F60628DCBD19186804B258C5773859F8 922.yk
1,666,223,849 *AF5A415FE8E818A37D47388A760422D747BDDC16 1-SIIRTOMAAHANSA
1,666,223,850 *AF5F8F3B80BEF8C6920A3C829136FAF7A44E003B 93$UNDH3!T
1,666,223,851 *AF578E4D5E03B1A7028DF7F6FEC49E63BD7947A5 963569 auchdiejugendpflegehaeltdiesematerialienbereit
1,666,223,852 *AF5E3D711C37E3E3B9FF8494DE358C3CA3E2B5CD 1.stadtmarschall
1,666,223,853 *AF5F9F00321DC8110BB7F77B4DE1FF5419AB4B04 1SUKUPUOLIROOLI-SYSTEEMIN
1,666,223,854 *AF56FC6EAE153A367CA075CD22FD543504A4413E 9AFKRUIME
1,666,223,855 *AF53F0AD48920CA94AC745011E046C4F964CAB41 1TAX-REVENUE-PRODUCING
1,666,223,856 *AF574BBE3C01D34AAC1DE63FFFBD5404EFE73223 9AROHPOHP
1,666,223,857 *AF52B5F94C3CCA15F8271029BBE125AD67822FF4 1.{X
1,666,223,858 *AF5181C9AE0C4289006B6A3FF5C6401145FB1858 9-FAHRZEUGTEILEN
1,666,223,859 *AF5D962A7EF80DBC4786B781EE30D971E1AF4D64 1-zuhurlardir
1,666,223,860 *AF5BC2E2A63158560B1E76C7F976EF50668BD251 9GEBIEDENDERWIJSES
1,666,223,861 *AF5FBD1913BA8E35A813538D395BF3CFEC1A00EF 9GROWNNWORG
1,666,223,862 *AF50EF1CB21F22C96863460080F57A7105029A8D (2008年5月14日、DKRC
1,666,223,863 *AF5B2B25931A03299D899816E585DA7F49CC4BDC 20nov1556
1,666,223,864 *AF5C4F1EB0DF05862565F13894AEF9C2CBC33EC4 2403315 ichkommewieder
1,666,223,865 *AF5A66C0337187E2F114DB797FF61910C8B4262F 2449193 OPASTAJAN ROOLI ON KAIKKEIN POLIITTISIN ROOLI JA NIINP
1,666,223,866 *AF50D14C120F75459C18805768CD018EFA75B614 2489549 but-the-simple-answer-is-to-pay-less-in-dividends-
1,666,223,867 *AF5C9CC3264A07939DE433ECA557EB37EBAB0A11 9SPEECHOATMEAL
1,666,223,868 *AF5687C7A7EFEAE9B0459EF791CC71443A82021F 26111522
1,666,223,869 *AF5D0F1406410DE91EFF7FA9814C4463676C4B5B 2692660 "-ich-will-nur-mich-selbst-verteidigen--"
1,666,223,870 *AF5A5751BB0385B61E1CBCFD0E2B30D4C3666BD1 9THATPUDDIN5
1,666,223,871 *AF53F7DF1D950C1DF2F2AAAAF32D9DD3E00D4327 27ОЧ
1,666,223,872 *AF584F589461A823FA97475AABB29BA2B6AB505D 9VERWIJDENS
1,666,223,873 *AF55C6BB99912BE33389C9B7BBEF2DF8F7684DF6 29NOVEMBER1968
1,666,223,874 *AF5B8A8E1529D41C4370C4D28039193BE018B306 2ARMIEHEG
1,666,223,875 *AF58EEB16BF9E4C2C04BD143FC9210DFA58C83FB a1)dx
1,666,223,876 *AF56C8FB16EC83DA39DF0ADAEE2244E958D23170 a2d;#
1,666,223,877 *AF5683ADBC44C5812C2380CAAF52C2F570528C10 A39/
1,666,223,878 *AF5A366AAEF55BDBCD7E7B98346827FD1F2A1100 2.KERKYRA
1,666,223,879 *AF5F897804F82571CDBCC6E20509185227F2FCAD a7f,c
1,666,223,880 *AF534087758E52342194A3C4ECE0D7D688EE1066 2-SUORAANKOLMESSA
1,666,223,881 *AF536F60CA57C69380755ABF831F2526EB539696 2THESCHOOL2
1,666,223,882 *AF569B0AAE30A08BDD4C3EB8F4AAD4C76C9EF29B aab+r
1,666,223,883 *AF53D851CA20635A27385372B57F70D345731DBA 3367c8982d41893c22f63a24f611269e.Pheonix1
1,666,223,884 *AF5846B18E3899BE9B801E05491257FFAD9A61A1 AAC|#/
1,666,223,885 *AF56101F812AA8852D496B1ED0EFC5E947C10797 3515x2x8clin022lwa32637g30
1,666,223,886 *AF56C5E5818B7156638FADD50F59B07110AFD15B 36e26fe80
1,666,223,887 *AF569F83035D6DD60EB049F69958187EE6167A37 aad!da
1,666,223,888 *AF50FF91F712CB87E7A423B0A6D706F177D0D587 3iluvdudley7
1,666,223,889 *AF5C726000DEEA769C643B39E394BE599AD4391E 3#@.~O~O.SPLAT
1,666,223,890 *AF53E32F87B05FC17F36EFF4C7B612AE8D387523 ABELHUBIN
1,666,223,891 *AF5F97E0799AE47E38151C775B9BC25BADCB21A2 3SLECNOU
1,666,223,892 *AF51D2521B7CB991F8726C09186B02E972531AB8 3===)`~`~Splat
1,666,223,893 *AF59801F322D757CF95135C5B7D45857C23E9959 ABN;Z
1,666,223,894 *AF557626763DF05C602C12C880DF06B93C6DD287 abw;
1,666,223,895 *AF54842A39E7509A8B053FACBBD8408EA4046CDA 4 BLUMENERDE
1,666,223,896 *AF5F9576524C58E605C26E9DB8531069E9CFA258 4CHABLISN
1,666,223,897 *AF5CB0AE519EDF7F189E8110403AD036A885F03D 4.einberuft
1,666,223,898 *AF5B80AFFD70128416B11287FCC932DAE5D43D73 4ENTREIS
1,666,223,899 *AF56FFBBC67989BF151B42EFEC3A668B79CB68DB 4ERSTOPFT
1,666,223,900 *AF55EF9731B2F4350EEDD4FDD43C111C58763D7D 4good7
1,666,223,901 *AF5EDC0700CB6C093B11CF3D5E60F8645B91FD17 ADDALITTLE
1,666,223,902 *AF5FC5F0DC5132E62EAF64B4CF8FB83FCE8774FA A+%DE
1,666,223,903 *AF52748715ADA7441C9251D3758DC845FFA17B69 4NKZYBPWJAYP
1,666,223,904 *AF5C165380813F99152F8419BA27635E02EA235C ADRIANTROBRIDGE
1,666,223,905 *AF589D4F16DBA85EF7A3929ECEC3C7FEB65F22E0 ad?zs
1,666,223,906 *AF5EACAB30BD4C9870292CFC1BB2288B903D007E ae73-
1,666,223,907 *AF5F352A1AD03584C93E659F914855F9AF8C9307 4TAPIROID
1,666,223,908 *AF59FE249D929B4D8019FEEDAFB73A40F1C1CA79 aerolloy3
1,666,223,909 *AF5917137A0DD583EEFE15DB7119CD5248346557 AFZE4
1,666,223,910 *AF5F696F93B29413FC13C80DFBA14F78A0926C79 AGEM5
1,666,223,911 *AF5595BDD99695CEE5AF700E1C481077140F2EEE AGITARLA4
1,666,223,912 *AF5F88DC9F87565995E7535BD742D8D7D1FBF22E A+H6
1,666,223,913 *AF594291C5DB006E8E4BCBC9D8EF32328510AE62 5DBAAA
1,666,223,914 *AF57191A9CEA15CFB155A7B39E7D9F7B061534D2 AINWG
1,666,223,915 *AF5ECAB2943CEB8F39F7CE3568C7225BB97214FA 5HYDURILA
1,666,223,916 *AF5DA3B867EE0AD4C46E789F930744E09A058843 AIWR1
1,666,223,917 *AF55072BF0AC23E4BDECD99732977950A6BD2BEF 5ISISVERMONT
1,666,223,918 *AF50488562A37D01B83D8C724DE22C80A83B7741 AJ9O.
1,666,223,919 *AF50E54E35F7FDC54A87B60E15EC092F5C69DE8B ak.78
1,666,223,920 *AF5B1AF5FB97FE4C3F2669489CAE845D0F0E9B4A 5paragonless
1,666,223,921 *AF5971B287B9AA38C1BC67377A1D4673D2E47072 5phish5
1,666,223,922 *AF59DD1413BB7B7AEEB0D80AF99302EA55089B20 ALBERTOSHADDUCK
1,666,223,923 *AF5F41C10F7E03ECF77B084B8561B86D913652AB ALBERT.PANGRAZIO
1,666,223,924 *AF5C9032E3A596DEEA169946DCD23BE2DD017F89 5SHUURASENAAN
1,666,223,925 *AF51816BD77FB33478CB12D0F5DC3038CE695FDE ALEX1GREENDAY
1,666,223,926 *AF5D1D27A32F03AA88149DC8286F42A90965C87A alexsavarese
1,666,223,927 *AF56D3FA5800FF4CA95302C79CCB382F4E56EBB4 5VIULUNSOITTAJ
1,666,223,928 *AF57E9B3718B437859BEC4431917A907B4DCAED1 604SAMARA
1,666,223,929 *AF572C7EC320D0F865CB2FDDAC971407EE9D84AA 615262 durust-,-'-taraftar-degil-,-kulup-cezalandirildi-'-dedi-
1,666,223,930 *AF58FDAA424FB8A5F4C94BAF338FE5501122A5C2 ALISTAIR.FOX
1,666,223,931 *AF5FDC21BF2555BA77B60451D8BD4E9BE02787F8 ALJ19890227
1,666,223,932 *AF544673230AB0A141958707527D6CA95593CF7B ALSTEROUVERTURE:DASALSTERECHO
1,666,223,933 *AF59E8BC209E215F17F7CF3E66D57D9D6F092EF3 6HOTRODBANANA
1,666,223,934 *AF56B79DADC9A0F0D9209E90B9FD3528163C7EC0 6KRATONKRATON
1,666,223,935 *AF5C92D4165E58AC12336C7545D1EBB8D7F200DA 6MAISTRYSE
1,666,223,936 *AF55DDC1DDF997983FCB3E1891FA1C0A668CBB91 6.pitk
1,666,223,937 *AF5D6135679C9C9BB32706B329710603F41FD653 6PTSRLJK
1,666,223,938 *AF5EA5A6D46A336ED3CF4740BFAFAFF6DEF1366C anecktested
1,666,223,939 *AF5516678744BC6CF2CD78D6B02349FDB1E000FB anehf
1,666,223,940 *AF51C5B3A6D349B89E079729FCF80383DC262813 ANGELOSILCOTT
1,666,223,941 *AF5D384A0506C58F9A9E6FD4000DE85352B088A0 6ZEPHYRMARS
1,666,223,942 *AF5BF118A5DF3633EA43807B1CEA9463D5AC2225 [email protected]#$%^&*()_+
1,666,223,943 *AF50ECF06177FEF9EADCA57377B2DF6A8B93F155 7ARBETSTIDIVE
1,666,223,944 *AF5E7282473C7318D164C5C0297B7601CCBB4C0F 7BSWAFLDPBSW
1,666,223,945 *AF5CD5EDB68991B04491D2FCF2FF9018B316707F aoq#r
1,666,223,946 *AF5428C04C31F6C72C9A5574F440F6BAD1DA068B A;Q/!
1,666,223,947 *AF55C4845AB7015A66F0D055ECAFDDF2F3DC281A 7MEDVEDGRADSKOGA
1,666,223,948 *AF524A1DBDCD0C1D27E250286AB41FF223A8FDD0 7MUIZEPARBSW
1,666,223,949 *AF5F5ED8C99B18E0BE7E1DFF716132D750169F24 7MUNCHATTOE
1,666,223,950 *AF53C5926AB9CF26594923BA94C3F36E89304CD9 ARHB
1,666,223,951 *AF5F8E7663676085776439F585328967E4C965CA 7SAFETYFRANK
1,666,223,952 *AF53ED214C703DEEED87E8405C9DC00B70C4D502 ar?mn
1,666,223,953 *AF5E14751FDAE568EB106E99F845B00B5737F9C9 8121319
1,666,223,954 *AF51518F2C11CF42C6598F0360FB8BB7233F5936 ASHLEY.N.HARRIS
1,666,223,955 *AF5BB65CA8743F294F2C5D4FA19A26609B43756D [email protected]
1,666,223,956 *AF577787FC4494A8CECDF73B2193EF590ABDB60A 8=B.*.*.*(>_<)
1,666,223,957 *AF55A9999308B1D5B747E6FA9AFFD414913DA77A 8BSWDELIENATE
1,666,223,958 *AF5BFF6DB7200714DBF7310275D6CA5C98F6E593 A)TK4
1,666,223,959 *AF5FFC864C007A8C8E1A269DC93A929804E8D724 8GREMILLION
1,666,223,960 *AF52426B0DD64952EA2920864D3FF04CDA0C1CDF 8HENDRIXTATTOO
1,666,223,961 *AF50DD60A95429F99D58A6AEDE3AF343078CCA50 AU/G
1,666,223,962 *AF592E400AC60E80304A1EC3E50A15CF37EAD4E6 austinguhl
1,666,223,963 *AF530B7324ECE7A21FDBCDEC8030551F55701BD3 avvicinarmi
1,666,223,964 *AF5E64F2231031612AE455C0495AD20AB7AA22FF aztaaaa
1,666,223,965 *AF535D3BC31176C63166D5DA9A2E56CF765BD1B1 A?ZVF
1,666,223,966 *AF5B7ABD6D12818B2E1AA29DCB45C575853D8055 93ARWH331$
1,666,223,967 *AF5C4C07EECB3BA3A995852F3267E722C5BF8AD1 94RN5HM3N+5
1,666,223,968 *AF526FB062DF40BCF952F31DF02D956F12AC0DF6 95wyatt
1,666,223,969 *AF56F08E5701AE64F8E1A682370961E14F58F06D B169283
1,666,223,970 *AF5B5286569E55EB19CAC13F809DA9CD9444C8AF B1OPS
1,666,223,971 *AF506502B9FD91D087649F475A2ACDB9D03BCE43 B38!G
1,666,223,972 *AF50777C62072021546100CE3FDC5823B27EBF37 9FLINFLON
1,666,223,973 *AF5D35C4B348C91CC439AA6A4DBF535A019F3216 9KNIEBEUGEN
1,666,223,974 *AF5ADC1D4F793D66C240CB55E3919B9557ED262B 9lenticularly
1,666,223,975 *AF531BBB051296513606C3B7C1B5C27CB4E78890 9MARCELMURPHY
1,666,223,976 *AF5B08954B2E8F2BB6728CD7A0DA0C4296AACBAA 9MYBUTTERFLY5
1,666,223,977 *AF54B6B38B735C689E836F7E255D0A0B790D6395 backing-dead-horses
1,666,223,978 *AF57595592C9374A8885EAAC564357E3A3C5AD04 BAD.TIME/KAMIKAZE.STYLE
1,666,223,979 *AF58AE829D647C087AF1E6CBAA4EC679083418E0 BAIAFRO
1,666,223,980 *AF562389AA082EA887458C537E201007826355A3 9TREKMARIE
1,666,223,981 *AF50328D472C10AF891F17639C070C82901208C2 BARFIELD
1,666,223,982 *AF58A2819F185326F1BEB0A0F6F4DD8134B63A5F A0H!_
1,666,223,983 *AF515C0BDC1EF1F841E9C9A57044A037AE35D6EB a5p9,
1,666,223,984 *AF57A680BBEEE1910D4EB8E5BCB1BFDE8843B6B8 .bct.eht.rof.sisylana.wolf.eht.fo.noitucexe>il<
1,666,223,985 *AF5F7F31D32A966AA4B7B68C8437392CC8B087C2 A9GFB
1,666,223,986 *AF533998FA82DC5CE815DE090EEA0ED75BCAF45D a9w_.
1,666,223,987 *AF5704EABD9A1C67E575B41043AE06B278C70E1B beat3mix
1,666,223,988 *AF51F4D57F23357DAEB6542FB9F6904B95FF68CB BERNIEMONARQUE
1,666,223,989 *AF5F02F2BE9DA9C0230D13A0888C0748DFB139AF berrussland,oder:einehardcoresylvesternacht,teilii
1,666,223,990 *AF5D50D74AC63326AD250A33C8A9EB09A17D3A58 bevendolo6
1,666,223,991 *AF5B779302E0AD4EE6280C5BC6B5FF92AE84A457 AANVANGSSTADIUM8
1,666,223,992 *AF5C349526929E15CF243302D17264C40F0AA9A8 abortion
1,666,223,993 *AF504D20060F4B21643319BC1D9BDFCA58378322 ADALBERTO.TRAMMER
1,666,223,994 *AF5915BBE9A6EF1E5A56FDB71E05CD4CE4D07C8B BLAKEKIESSLING
1,666,223,995 *AF5861853CFFAFA1146CD41A479E4113FE8C4B2C blaze44
1,666,223,996 *AF524FA50170A8ACAD3FB598CF646ADA74678B1F BMESMERED
1,666,223,997 *AF5FD779D92F90DB04F279B9E6C116EFA568DAAF AELH,
1,666,223,998 *AF50AD72E9509D8A395B172E2DDA7794F8077247 b#####)~-`o->-<
1,666,223,999 *AF5DA980888C5AF289EA86E19DFCBFB8051A8DDC boaf
1,666,224,000 *AF575CDE76293502564AE6576FDD0265CF17EA52 a;fi
1,666,224,001 *AF5621FE8AE689FC6971DB4A588644D5F4129C1F AFRIKATALE1234
1,666,224,002 *AF5FF43BA2D8997348228F866F4CA887D9B86D48 AG9XX
1,666,224,003 *AF56FA60AF97708229E485AEACF4CBFFD75542A6 ahma.
1,666,224,004 *AF5ADD19CC0EBD49B91B052576FED21E6D274D09 brainwinegar
1,666,224,005 *AF5343D858B529312E2ABEFCF6E7395C218A1BDE akkto
1,666,224,006 *AF59FD2AF4A59E55146300BE3538D5211F94457F ALDFEBER5
1,666,224,007 *AF55BA7F98BE3833FC7CD8A3665B296C07CDF455 alecberrio
1,666,224,008 *AF5D567AAE3757ACA7849761929735B3487E47B4 BROBÓN
1,666,224,009 *AF51DF13EDFD81AB82FB8E644EBBAD19118A62E4 BRVLQNTS
1,666,224,010 *AF5479C71898743F509F01E5A9B30D971711BE0A bryantbunkley
1,666,224,011 *AF5C47AC5E1324204E2A582C7AE6A4FC043E825C ALI JEESTO
1,666,224,012 *AF5149FF7544ABA12BAA4249BF02BD6B84408006 brynymaen
1,666,224,013 *AF5C0A11BDDA239C911DA54A8A3815082B8899FC ALLERTONBARON
1,666,224,014 *AF58F82FE2B17F0D53FD4121C3D7EC221B8B5B59 BSN07B
1,666,224,015 *AF5E09FFCDD5247D0A5404B7407C768D23CB935A btlwx
1,666,224,016 *AF584E22135DA62740744F6B17260AFD3326AAE7 BUCK.VENNEMAN
1,666,224,017 *AF57EBA51C50AFC48988224735A1E9A3A4DCC6B6 @#BUDDYS
1,666,224,018 *AF51D70A51135A6E42B32E1C2D2AD39A12D58AE2 ambersalway
1,666,224,019 *AF5EF4FDBD6841EA8DF3CCD7120F60C4C35E01AC ami5+
1,666,224,020 *AF52466BBDF5E059B57AE404307A980EE4E0C98C AMYFYRE
1,666,224,021 *AF58216047F9E3CC49F0274D913D9939ABE66E66 ANDSOUR
1,666,224,022 *AF561ACBE94624807162B93CFC80A855D32B6E96 anjanâ
1,666,224,023 *AF50AFC7F35534249FB72F4D2A46C0EEE7D88E7A an(s
1,666,224,024 *AF501E938144EAEF8AC9C3D8ACCA9D6004295ADA ANTONIANUESSLE
1,666,224,025 *AF59893B6D6F8CFCFFF72E99395DA8BE9F88A979 c/2je
1,666,224,026 *AF5DC8E7B46EBC81C76BDB9321B0845421EFFC6B anushha6
1,666,224,027 *AF57B8BE8A5959021FD917B174547D352617CED2 C9&$L
1,666,224,028 *AF5E64A08646B6BB7CF03330BEC941461D568E5B ARE WE STILL LOST IN THIS FUCKING DESERT?
1,666,224,029 *AF569F67C460FA02BC1C398B4259F35655621640 ARIEL.POMYKALA
1,666,224,030 *AF52BB95C76A364D3F85CB9ABFFC0893AA8F2813 [email protected]
1,666,224,031 *AF5C4C54B0F0152563411989A2190873CD3EF7C1 ca%pp
1,666,224,032 *AF567D296ECB35BACA844284738938BEB3871F69 arrapavaed
1,666,224,033 *AF5A16882B8C375251FB08E74529F8329D2EEF9A CAROLBILLMAN
1,666,224,034 *AF5D63A13E0F2E6C24FB071EE6D6D42A6CD87F51 ART.POFFENBERGER
1,666,224,035 *AF5ED1C290C74275712209D17C5DD561B40F90E5 ASHLEYBEHREND
1,666,224,036 *AF5462B64AAF9DCDC221DFD9902891C7A82C9FC1 CASEYTHOBBS
1,666,224,037 *AF5D9C74D3EAF10AD207B1EC5299683A955D196E CASTILLASEPERTENECEANADIEPERTENECIERA
1,666,224,038 *AF560A2F6D1FE89DCA04257E9239C13CB72F939D >A/<slennahC-gnimiT-dnA-egarotS-1.2.2>"1.2.2#"=FERH-A<>DD<
1,666,224,039 *AF5D84A659F0F486BCC3E94D8070CBBED96EE22B catherine.damiani
1,666,224,040 *AF51B48F4A196DB3894C0C86BCA8EEE818AFD2FD CAUTER1ZES
1,666,224,041 *AF585EB0E0D11C780D0E80CA0979CAB5E5EA2159 CBEF3675534D80A5F71CBCDAB6C39336CIACH0
1,666,224,042 *AF539DA5EDDCAE5964F7AC9E77A9D81BDAC9F0FC ATAFUS
1,666,224,043 *AF524CBB5C2F198F7AFD1FCDC5C009F81E788DD2 ATCARNEGIEHALL(DISC1)
1,666,224,044 *AF5C271D7F52658181FC12BFE9CB0848CEF0C537 c#=dm
1,666,224,045 *AF5DE82182A0A70D479920F152EC7DF3083437E5 cecilet
1,666,224,046 *AF513BEB9C4DE98B83EF9ECAD35F0374A94F5E8F CELFI
1,666,224,047 *AF5FA5842C33B2B9678D495B803A4233BA344ACA CEREBRIC
1,666,224,048 *AF5E371A236EF69285EB88F7CC9E4D9A9799FE10 AYOVE
1,666,224,049 *AF50CD273D71C8381FE9921F30703ADE09FECE94 [email protected]
1,666,224,050 *AF52BE2B566F4A2F2F042D9A22302AFDA9C3F47B b###@~~~
1,666,224,051 *AF576E63F671AB743107F8E12E106C5785766C41 B0PUJ
1,666,224,052 *AF567DBB12B74C197EA69358CFBBB3DE9F13D819 B:3b
1,666,224,053 *AF52B0A730001BCAC207193BECCB4B219517927A :b84・w59・h83
1,666,224,054 *AF5EA67225372362935285FC2EC968741B29366F bafutto6
1,666,224,055 *AF59DF923A5A69A6A8B7597A43A3A685477C3C5B CJYVK
1,666,224,056 *AF54CE8F98840290C6502244626B8B485623943C battlewhip
1,666,224,057 *AF57811D27CFEAE242C7453ADCD7D006F527909D CLAUDENRIQUE
1,666,224,058 *AF56DC53B7E7E44BDAF554F475DC501113A872F8 BB.G
1,666,224,059 *AF5B27FC0B5C2D75A588BC2B0E05C8E29A807281 bc5to
1,666,224,060 *AF5C17D18C5CC9E013CFB4717020B294A24EE14B closequarters
1,666,224,061 *AF576D5E2780D3240D5F8F80EDEC1B2589D4D6CD clxxz
1,666,224,062 *AF54F1D6EE4C791DAB661063BCD5F68566966546 CNJ,D
1,666,224,063 *AF5E54D933DF309D5137EB53F64B2FBA4CB7AA75 BELLADARVI3
1,666,224,064 *AF52D73B128CCB5D62F8527BF2AA371D52BD6596 co5?$
1,666,224,065 *AF5396BDE5EAC81B4F0B4A420843E06363EF9066 BEN.FORE
1,666,224,066 *AF5025CE790015A347C82BF54660307DB634EA67 BENIGNOJ4
1,666,224,067 *AF5496865D66D0DA7457267B65802A5E62AE7E68 bennywhispell
1,666,224,068 *AF5C189966783154A3C9C26E147F7DAB543514DC BERGRIFFSGESCHICHTE
1,666,224,069 *AF5E0B225E50F7EA6682D1E6609BEA9FD7139CB7 colleté
1,666,224,070 *AF58ABC074CA9F420E83263A7D1F7AD5FC93EF0A BERRYDINATALE
1,666,224,071 *AF50BCF3784F7DB4A3E1E7EB396DE4B7A869F5BE bertrammazzone
1,666,224,072 *AF5CAF692A201E0DAABDA8C4BDC4AB46B64A1C6F come goccia
1,666,224,073 *AF5EC33E75A521ACFEA9F452D8B097BE9FBFD1D4 CONCERNEIS
1,666,224,074 *AF51DFFD31A2087CFF84766000AD27C01A61B151 copying.files.with.scp.across.a.lightly.loaded.ethernet.
1,666,224,075 *AF5C4C1343FA517396BDFE9AF13A1718C7D118F0 COYOTEO9
1,666,224,076 *AF5ABAAC8890D0EE50BFF23C25197B2B41A0DB0C BINSHUKEI
1,666,224,077 *AF5B8124EAC09284D3743652C75EA40677762403 cqpg
1,666,224,078 *AF5814FCC66B82FC4D44D8840C560E7FB380823B CRM#W
1,666,224,079 *AF5E00F49F2474FE953299A1472398E35249AA13 BLACKROSE231105
1,666,224,080 *AF5352BE4EB38C56482927E000C54EAADD8AC4B7 cruzrefazo
1,666,224,081 *AF567A1966A34EB396008BEAB07654AFD0260D5E crymeasuperman(eminemvsjustintimberlake)
1,666,224,082 *AF567102F74157C664454375FB3FD03669A3E98C cs,r,
1,666,224,083 *AF50DD684C84CD6C8FBB7BBA446D2BB48C4982C6 bm5
1,666,224,084 *AF5F5AD800A1C0D7844280449BFFB2A421B1EF16 bn#i?
1,666,224,085 *AF56B49659093FFAA1FCB6C68465AB32F18CA1D4 BOCHTENS7
1,666,224,086 *AF57D4A64575A6FB08CC44381E7ED533070F202E bofonchi2
1,666,224,087 *AF55A1149A46C755DB345FCC0EA283FFB995F822 BOOTYLICIOUS!
1,666,224,088 *AF5D543546B2FE13B38FB09DCF0BBF9951A8A9BA [email protected]
1,666,224,089 *AF5438C470AD7063FCDC1A309289D959917020A0 [email protected]
1,666,224,090 *AF553BE35613C3EB7DF666F9E06170A4D35108CA cybltwsc39
1,666,224,091 *AF5553A504A982D3B72F0C990BADB216B4C3C484 B###P~-(>_<)
1,666,224,092 *AF5CC5F963744CADDCC21E73D671793245716848 bp2gx
1,666,224,093 *AF5BF76A1EB3182A75DAB60C6D49DADBDBB0B9EB CYRUSBOOCOCK
1,666,224,094 *AF5118942CC5EC844A7718F6772A84A7593FA4E9 czaikovskis
1,666,224,095 *AF5C923DA4309807344996CC6EBD7A67931408C1 d:+/
1,666,224,096 *AF5F6CA7EE33116D9276EC5E4245071788EA039C brainredenbaugh
1,666,224,097 *AF546DC0975AB103C1B6FFAF0669CCB7E32BA168 d3myo
1,666,224,098 *AF5D9F11DEFF8B22704A219123A05D4AC4DC607E BRENTRIGBY
1,666,224,099 *AF5582639999FDEE28C12AE34678A4FD09CFC9CC d,5xt
1,666,224,100 *AF5358E5A4C5363092935128938066FCFC453DC4 BRICEGAFFORD
1,666,224,101 *AF5C0DEE5879DF2B044610FAA56A3F1B8D9F1B9D d7aj
1,666,224,102 *AF5B3748352AA381805754CAB63557CD72E3D203 bromider
1,666,224,103 *AF573F221805820924C80DD66110F9AACA5C0883 dadb9
1,666,224,104 *AF52372CCE07810D3F1AC61B9DF173FDAF9C1B86 DANILO.ZULUAGA
1,666,224,105 *AF538EECB2034C295A9663DB16910C9CA6285D67 daph?
1,666,224,106 *AF5D121BB2246D5E811D51EFB6373153C9B639CA b,ulf
1,666,224,107 *AF502F9C7FF3FFF9D0AB88C314D86CC15BCB95AB davidbana
1,666,224,108 *AF514563808213C805CB4E81966EF9B72A9F3C56 C00BB
1,666,224,109 *AF51D0AA18BE15526545EF5A370375560766D732 DEFILERAS1
1,666,224,110 *AF5AB64408E6F8755F261E44F823B8533CFB6ADA C3UKQ
1,666,224,111 *AF5B2732DEDA50BB9C79C9C17C81059634CDA4D9 denniswolfgang
1,666,224,112 *AF5B3E4CC9BACF22AC0EECE70CBCD1462CCD21DB DESCRIPTIONLST-738
1,666,224,113 *AF5970CBCE830EF368B075B67DCAE271CE3FFADB DESHAWN.DIPIPPO
1,666,224,114 *AF5C73F50DF07120A931E0C4B0BE952A616A6B2D Desiderare
1,666,224,115 *AF5DCE8D9D038A3C3107A5238CC8A89BE7F15671 c-9t:
1,666,224,116 *AF58838F9AAD3A08C23C5A74607E7375ECC364CB DESMONDMCCONNEY
1,666,224,117 *AF50D457A8417FF45129B192DF9E5530E4A7E9ED deue
1,666,224,118 *AF5DCDC837D6FAF1022C6052C3E890D4CC07EB64 D/F_
1,666,224,119 *AF50C00C7644D4213A874945B4E116E5BDAB4366 D&GO%
1,666,224,120 *AF59A3CF76A5D470EE8ECBE89F39096E389937FF DHFP6
1,666,224,121 *AF51E327467F99F07620CDCE64240BA20B7E513F CARNENVALLI
1,666,224,122 *AF581CDCC39B6A4158DE9F06131CDAD70F41BB52 CARROL.CHIHAK
1,666,224,123 *AF5E974DE940C41C29C1424D4CCF7860CE0B8A2D DIENVIDAUSRUMOS
1,666,224,124 *AF5520D55640FA7C90D7B0FC8B8D5CE0B2A57422 CARVALU2
1,666,224,125 *AF5CE320F355DECF06A061375FDC618D53933AE1 catwl
1,666,224,126 *AF5B253393547F16642738F2C6392FF3B659742B djb619
1,666,224,127 *AF5D03D84E38618A9BB78E52FB06D92DBF13D0F5 CEASEESAEC
1,666,224,128 *AF5D192DAC9B42D34B69B497674ED63D14C22967 CEFÀLIQUES
1,666,224,129 *AF51451178B7378BA70C708367F8A4A29294A02D d)lqs
1,666,224,130 *AF50DB2870EAEF0EBED811813CF02DBD093679A9 cf;i?
1,666,224,131 *AF57ABBD769347D6E5AABE50F341BD3DB7A614BF donderaar
1,666,224,132 *AF5FB5C10172FAC61AB9D4CC0BC830A5A44AF34F [email protected]
1,666,224,133 *AF52872BEB99A820350354999C6515A6B9E89020 [email protected]
1,666,224,134 *AF5075EC6E2BA60C3471AC45B19A5C8B7F75F707 CHARITYMIDORI
1,666,224,135 *AF5DC9971BD5E99E36FBA0F4920A2C8AAAE0A993 chat1900
1,666,224,136 *AF5CEDF669EE80207EF93D196BE198C707EFEA3F CHAUNCEYVALRIE
1,666,224,137 *AF525BDF1C3A277122897828300D2E093047DBBB dopent5
1,666,224,138 *AF540E84F63F9C803A21549C7DDC0BA7202A05A1 [email protected]
1,666,224,139 *AF5B82CF3D31B5CDF5D71887BD23B179800CD4B8 '-(choeur-des-pr
1,666,224,140 *AF59E7AE6C0D2B08ACB1E8C94D625117425D631E chrissy.needle
1,666,224,141 *AF567FA6851477CD9604E907DB7F985E1057675E dqkh
1,666,224,142 *AF5F6AC9DFDACF9A6154A556C2F507B6AC6B601D DR;A?
1,666,224,143 *AF54963F1A7231A70DC6ACDB699A50775357D93A D?=t
1,666,224,144 *AF5515E4BCCE226FEA1E03FB0AAE6B06416DB899 DUE:
1,666,224,145 *AF510A32C213C089102E42F367EA0800B75B6014 duw#u
1,666,224,146 *AF5C7E755415BCD4BCEF69CCF1A60543AB249787 cn7dv
1,666,224,147 *AF5CB57B0BD2A8369AD577F5E5C4F4EFDE44681B cnn()
1,666,224,148 *AF51D6B4EA634D90B2432DF3D930647CFE04E3D3 DZMLE
1,666,224,149 *AF51EAB6B78A386750801CA40EE4ED107436D088 COLUMBUSJARQUIN
1,666,224,150 *AF58C8D63FB68A072967EDD3EC03440DB5270058 COLUMBUSSCHOELLER
1,666,224,151 *AF51C6644E1CA83B6A10F8EFB7C744FF85266787 condisciples8
1,666,224,152 *AF50AC3C5D9AD236F4E4421BEFCD7102EA688608 CONNIE SHAEFFER
1,666,224,153 *AF5A7B7CE23E3ED535D2CBCAB1C29BB674E5C6AE EDAMI
1,666,224,154 *AF533CEC5A38AF968164BA29F79DBBC1C8305848 CONVENTUA
1,666,224,155 *AF5EFF5F93195902AA7BE178976E2DAE49DF8033 EDNAR1234
1,666,224,156 *AF5E6B8569901703492811FF98BC30A59E2A4E7B corymikel
1,666,224,157 *AF5DE6A30D08834FB782093AC3237B7870DA15A1 C:\PROGRAM FILES\ADOBE\ADOBE PHOTOSHOP CS4\ADOBELM_LIBFNPDLL
1,666,224,158 *AF5B5F8B2DF04FE8DB220F6AF791C434F1863A16 CQE=7
1,666,224,159 *AF575B8242937551E01130EC2B5CD7DA0E83D8DA ek#gn
1,666,224,160 *AF51EB9E64BC605DF5DFD8C8127DF115FF17DD0C croak,grunt,maunder;deprecate&c(disapprove)932
1,666,224,161 *AF59B31809B3E1C079AA27A2DFDB72622F5A8527 ELISSONSANDBOX7SF
1,666,224,162 *AF58D70615F87D70790A73653200D7E710F7B79C [email protected]
1,666,224,163 *AF5943C7A684DB212B40C081E312DF2A46355406 ELLIOTLATTEN
1,666,224,164 *AF5767C13FC4DFAAFAEEDF84FAC3FC9FA1E74EF8 csoqb
1,666,224,165 *AF5CDA777FB12BF0E66E4F7AA360291BF7BED286 ELWOODJARELS
1,666,224,166 *AF5F573BE607077963896C8215571E0BC822C644 CTW!
1,666,224,167 *AF5E65466EED758A005FA3DA3029B7176F8B6973 c_u9
1,666,224,168 *AF5FC486A4445165EF04EF4A257546CD73FBB6F4 emerymacdonnell
1,666,224,169 *AF57B0E12DEE9613ED5B551B758741E2A7F59F8C emfwh
1,666,224,170 *AF5B7EB790368866E81753A519E400CF2D19A44D culoremix90
1,666,224,171 *AF56DDD9BA3E6147D3773BA6FB631E616F4DBC00 en-oq
1,666,224,172 *AF595265E2E4BD8127926652FBD423ED85B1C328 ERASMOPOLUCHA
1,666,224,173 *AF59A7169D4139B77768625CBB133B7CF154D099 ÉRCRŐL
1,666,224,174 *AF53E2836B66A2CC27D4457BDD4FA119496E164F D1B_U
1,666,224,175 *AF5B636211D901FDBB13DDF103C16857E8CDA60E ERVIN.PAIRE
1,666,224,176 *AF531404DE10FD393DC87BF2E7264C26F3164A00 D:4P
1,666,224,177 *AF509BA0BDA4C753EEB7EEDA4FE3E2A967EA06D4 D6CZ
1,666,224,178 *AF5E1924183EB2762DA550710E377290FF541556 daa-lube-boast
1,666,224,179 *AF5E1B026E32B713FF3875838E56A2B8EA4BD300 daltry
1,666,224,180 *AF5B9DC285DC0277EC659AE490AD6F8139B8C3B2 eyservice
1,666,224,181 *AF5B81A113EE3F57D2971ACF59A4EBD1EE9C9D61 [email protected]
1,666,224,182 *AF5F3DE5D81AC758CBF47B6BB66A946AA20A1181 DARRELLLUCIA
1,666,224,183 *AF5DCD482B4CA54EB6054DB4FC55FBA888B6D45E F1A$H19HT$
1,666,224,184 *AF50AE5BFB6293E1A9285015B4EDC96AF0730D61 das tier in mir (wolfen) (rocco remix)
1,666,224,185 *AF5E53C235A09CF4EA9A61022EB54BB7D7DE04D8 FALLEN[ACOUSTICVERSION]
1,666,224,186 *AF570E024891A199CF0A9F6D70EB2731DEBFECD1 FARHANSAYYED
1,666,224,187 *AF50612F72338F1614448220A004902E33AFB08B dbdo8
1,666,224,188 *AF5821F010F60C07BD1A729DACCB6EA18FD064E9 DBK%U
1,666,224,189 *AF5CBCDE3DC00990A89D27C8D65FB4D8C6343E54 dc2h#
1,666,224,190 *AF50ABD425A5F26AECCF4D1D770273A23D06ADC1 d#=;e
1,666,224,191 *AF57EEB66FAE900DFFF011CB75CDADF83C4D09BC FEUDA+0RES
1,666,224,192 *AF599DE25691AF60215C9F35203B8EDA6A36160E fhcpbhol26
1,666,224,193 *AF59BF95B3136441E2875022359A3432CA520338 decorated-with-ornaments-(dj-360
1,666,224,194 *AF53473C27C70CB63E5A53A006C6300760A680B7 DEJBG
1,666,224,195 *AF57CBA0B9504877BF9B238060F3C1A2A7480547 Flat.36
1,666,224,196 *AF55718F8998802D4BE1D541D0BE3704D9C76C04 FLATERS.
1,666,224,197 *AF58304AA7E694279F75CCA7A0235AEE35A83663 DELSARTI0
1,666,224,198 *AF56494A235EFD241B7FD38B3BF5137F5C9EC138 FORKERTES2
1,666,224,199 *AF5655F74DC3C6E0CF0C185DB5D458E7AA3237CD FORMATTING7
1,666,224,200 *AF5CEDA178CE4CE996187F37A71B2E8E9BC8615A FRANCEIGUANA
1,666,224,201 *AF5F1AC5BF7BB6E30F18E67B921BEC2D85246BBB freddiearseneau
1,666,224,202 *AF5EDC24DF3DFBCAF963C47033057183193734A6 dexterhartgrove
1,666,224,203 *AF5A378DDCCD15FEA1446C12FCE9517A6A547814 D/F_
1,666,224,204 *AF59E3D0C8E2F7402050B674299C816F9DCBB729 FREDSKLAR
1,666,224,205 *AF534E87B37E2BB40D134ADC46CCFEFA10DF8625 FUCK-TON
1,666,224,206 *AF58D562F0ECA87D592A515C0E543CCD5C9F87BA fuck-you-up-in-the-ass-(medley)
1,666,224,207 *AF5D21FB6EED175E47C8943ED0BEB2B87F996CBD DHcZ
1,666,224,208 *AF50A4A371D6CDC38DDCEF59C8F169F27BBD7ED0 di/f
1,666,224,209 *AF551973A991A26D003D0EA5092A65B96A3477B0 digests(2)--d-ay1-jh-eh0-s-t-s
1,666,224,210 *AF5D847AC44159412C7AEC019BF63FAF5E81AB75 GALBAVYE
1,666,224,211 *AF598DDD8DD40D196D1DB28260D87724524A8C50 [email protected]
1,666,224,212 *AF5096D61377CCE3D8901EF408004BB898F0A45A DISCOGRAFIA.DE.ENRIQUE.IGLESIAS
1,666,224,213 *AF59E312670726E2E33FC1706594B87AE809481F GARRY.MELDAHL
1,666,224,214 *AF5557AB239E82DD0FDCD4A0458E596AA022EDD1 DJPT+
1,666,224,215 *AF51CD61A3158F33DEE7AC5A12924E0E85DC74A8 GC2,
1,666,224,216 *AF5660365C40338CBEC0BBB5EDBE8DDDCB3BC091 dk:p?
1,666,224,217 *AF5DA2A98A577246E24199CA6FAC5742358859CE gertuade0
1,666,224,218 *AF5ED8F1FC8D7AB028955AEF272CA6756B3062F1 Dn&E
1,666,224,219 *AF58642B6A75AD6C73F650EBB67F80ABB1FA157A GILLESSUNDAY
1,666,224,220 *AF5753B64CE3094691F130F2217FA4FAC026750E gitsulsns
1,666,224,221 *AF52C92E346DA284473D434B8E9ACE0A7BB1DE65 DOMINGOLAFFREDO
1,666,224,222 *AF5DB0E5BAAAF897A9161BA286AFAEF51F43FA38 DOMINICK.MCMURRAY
1,666,224,223 *AF5AA7E7D36F2FDFD658F98543C85E470AA8389C DOMINIQUE.RODNEY
1,666,224,224 *AF56A633131BC27B94529122E44B29F39E449087 DONALEAN3
1,666,224,225 *AF5BA4E9635DC2B27AAE48B62247EE776FB33539 DONNOKKEN
1,666,224,226 *AF583E623DB204F1D09732FFE1210046FAA9F004 GOLDBERGVARIATIONS,BWV988:XIXVARIATION18CANONONTHESIXTH
1,666,224,227 *AF5089510A8B0F20BE4C5C54BC0783C807E82C2C GOLDIELOCKZ
1,666,224,228 *AF5130706CF661157CB97F1F719D0C171CC6590F DOUGLASSSEUELL
1,666,224,229 *AF578648434E97F20CD08826364D5ADE83C1A520 downloadsenergyarchhtml
1,666,224,230 *AF52F58503C09BF9F93507D36F0EEB259B1CCC37 GREVILT.K
1,666,224,231 *AF58EE579C768E521BFCD4AA9291A1E2DB10B7F1 grieve.gr/i/v
1,666,224,232 *AF540F03B050CB411D488F11C53045342D5EADB3 DREATEARYEYESJ
1,666,224,233 *AF59CAE2AB9217F5AEC4EF16D55E741FAB745B38 drly#
1,666,224,234 *AF56E1180E9207DA7C5EC8B3B84CA530A7C85F96 dt<[
1,666,224,235 *AF5A11881DDD7CD95D27AA03787FAC105C84FF73 [email protected]
1,666,224,236 *AF51791A1941017D0F42544D2E487A4591BF2690 DUDLEY.CUNIS
1,666,224,237 *AF50444A197BEACC1C40F9DAF9047824742A2760 [email protected]
1,666,224,238 *AF5720E4994F89B25074F90AA8842FCDF9030D35 HÄNGEHOSE
1,666,224,239 *AF55C8255D7C0B829B81110A792CD0F712ED6200 [email protected]
1,666,224,240 *AF5720122A9BB0BE40D4FA767945769461EF0F90 HARLAND.ROWE
1,666,224,241 *AF51226354113D5D93D848D9A8C7F8FFCA9B4126 HARLAN.SAYAVONG
1,666,224,242 *AF5606E739460CC08CB72C3FC722BD6ABA479EE1 d%#vd
1,666,224,243 *AF5B463E7D7E90096AEF04580D3DCE4A6F561E2A dv&h:
1,666,224,244 *AF5841C280E3D47F29CF7A4EF6B3BBAE526D0915 H'BIBTIT'JIELANDI
1,666,224,245 *AF57C097ECF93ECA9F2E7EA3A81F9CECB9FB2016 [email protected]
1,666,224,246 *AF52EDBC62D668A182A35A243A861F2A0A76D77A dwsw)
1,666,224,247 *AF520EDBF29BF7E269CAA31BCE97AF6E373B4BE1 HEMOSTAS1A
1,666,224,248 *AF500E5BC84A8C752A5CB144A2AD39E1ABB56C95 here-i-am-(end-title)
1,666,224,249 *AF5AC84181F432AFD525E7A80F3A754188127DA6 EARNESTSIDDALL
1,666,224,250 *AF52C4FFA267677AA8AC378693F0B863A322E027 EAVEY
1,666,224,251 *AF52179DB7225FC8935CFE53D673B3A334A21266 hkg
1,666,224,252 *AF54729FD4DE6F5820F617CF7E24D521F8A7537C ednotus0
1,666,224,253 *AF5EFE38DB6873622FCDA89A3D2CFCB6E9D890CF eff0rt1ess1y
1,666,224,254 *AF52543EFF3A21042188C3A6CEC089B18F346C20 [email protected]
1,666,224,255 *AF5D3CEFB089752BEEC73AA40C11F99B928CE6B0 ehp4:
1,666,224,256 *AF5C156EFED17949D9DDC9CB526AC1844C5B0955 eht-,yksniweL-.sM-ot-gnidrocca-,7991-yaM-ro-lirpA-nI >p<
1,666,224,257 *AF5F3C7DA48724884B7FF38EDA400641D3BF60C5 hrschmnn7
1,666,224,258 *AF5C87943DAFE8871CE39A74C483EB7EEF837326 EITH
1,666,224,259 *AF5E3304EED02FBEC9717BFE6CF83CC77385096E elbahtit5
1,666,224,260 *AF5645D1BA52BAF48BCC0C6E086E7A2AD1AC2B7F HUEY.BISHOP
1,666,224,261 *AF5C18CA851972398DAA0AEF5B176CFFC94DFBA1 HUGO.SCHLOTTE
1,666,224,262 *AF510592051F1FD7C8D1939E8631101FD27F9EB9 ELGASIM
1,666,224,263 *AF5519D96963AFA638C05BDA4AFC815E550DFA25 HUSARENRGT
1,666,224,264 *AF5AE1F2384086357D2FB207CAF05F7949B90929 HUTAJRIK6
1,666,224,265 *AF596BFF28738C802912447F454CA59C394C03B4 [email protected]
1,666,224,266 *AF52285699F72C7F29A842B66FE4EA5D6628D806 ellispali
1,666,224,267 *AF5B69CAA73ECCB0A2F930167789A279EB96C37D IAMCAESAR13
1,666,224,268 *AF5808E342A26D9BA90E8CE300F5A56BF3630765 i-am-three
1,666,224,269 *AF594C9951C332008CD8C3BCB47A78A35188D231 IDENTITY.PROLOGUE.(INSTRUMENTAL)
1,666,224,270 *AF5D473F04530BD4DE683C3C55A5C2DED8208BF4 IESUHSOHING
1,666,224,271 *AF5B5366CF4B0799ED5AA1EBFAFBAF7BE898D1DF if(timer1)
1,666,224,272 *AF50A3D7A877D0AF389F11509902A8833DFC851F ÉNARRAIS
1,666,224,273 *AF59A035F2EA583AE7264F6C45A271DC4014C504 encye
1,666,224,274 *AF5A5B4AF3FB80D4CB739530CAB2A2B085A3E159 ENRIQUE.DONCHATZ
1,666,224,275 *AF543B2B9F1C33B45EAF8F364FD80E2734ED48B8 ensheathes.
1,666,224,276 *AF5197422C972847BDD2DB3853B408EDE560A819 IMIN88
1,666,224,277 *AF5D5128A7B81C2A55CE396722CBAABA3427DB8E IMP596519
1,666,224,278 *AF5D81058FF311EC1AB59634847FCC8F66F91328 ER-"
1,666,224,279 *AF5549BD5A1D3DAEF6AE0BE5D302A894AB60F009 EREOLIZO
1,666,224,280 *AF536160E58DF54E44C6C93930801239783AA5E3 ericberkman
1,666,224,281 *AF5575993FB80D2F241303D4E3A68DB600EF00ED ERNESTBEGAY
1,666,224,282 *AF5B5A8735B51EEEABE437CE1C05D43BC4CCDEDA ingurgitons
1,666,224,283 *AF5527F436449F1D112A7BBB76782E0E4746D8FC irvinulven
1,666,224,284 *AF52376FDC1062B2383E85BE3BD72C1EA693401B ISAIAH.ESTER
1,666,224,285 *AF5AD546EF461DD91D19E1682FBD71AA964F4B85 ETSRABSO3
1,666,224,286 *AF50DEFDA5BFFAB6A45486092BB0B6D506EAAD6E ISIAH.DREGER
1,666,224,287 *AF53C2444AB12533D04B7CF0A843AC2862947B59 islamimas
1,666,224,288 *AF5F07DE7DDB3EBEEF439BF39BDF20A54ADFD4B5 IZGATÁSÁNAK
1,666,224,289 *AF5EE013B6A16000961D63D1A144B90CBD31724B J1HAZK
1,666,224,290 *AF5EC33EBFB1A5D2E6505A5E7C23515F296B3E3A EYRO7
1,666,224,291 *AF5B676E3D3D5D22EE7507911DE8794D8104BB15 F1{Y
1,666,224,292 *AF52D926DE1FD10EE4E8A44043275B8968059337 fabiancosta
1,666,224,293 *AF51E369EB3EF2A24BAB4A9E1AEE1A4590DF7DF8 FERENCVAROS.T.C
1,666,224,294 *AF5697BBC9F440B70D690BE3F4548D8F2077223D ferieudflugter
1,666,224,295 *AF5AA6904D16B3D052162CB5ADB09D58B033BE68 jbij
1,666,224,296 *AF5A433925BC1525CD252022FE92E87AFD87A7CE figifredo7
1,666,224,297 *AF59EFEE2B59C862D5913F086735D7CC7F5B37E4 FILMFAKTA2
1,666,224,298 *AF57215E7C93AA09D56E0B8F666D01198649CDD4 jedmahurin
1,666,224,299 *AF5232F0393445CB9FEF2F79F29F8B23215AFBB2 JEFFERYMCCANDLES
1,666,224,300 *AF583DA469DE5E651EC5B65D11B79D0BF2D95FB7 JERADRUBLE
1,666,224,301 *AF5F1116EBFA14B5EF3EE4E3F2DB38EE0907DC09 FLORTLAC
1,666,224,302 *AF596157ED3749ECE1E5E42FFEE53CB10DBFDFC2 frameworkdocument
1,666,224,303 *AF58D35C9E811AE4C364FF3A72324E91EDDF0328 freddyescatel
1,666,224,304 *AF5A1121495DBC5377C0B79466B4D76951D5A2D4 freemanshortes
1,666,224,305 *AF51B08273153B80F7DAA0D20D42433E50A61629 JOCELYN-KANE
1,666,224,306 *AF56421D9E0C86A5D49F04AAAC92E80569ED36F6 FROMEPISODE17:HAWK(CHINESECOMPILATION)
1,666,224,307 *AF53AAEFC44E27FFEF28273A642033F938F0FC10 JOHN CUCCARO
1,666,224,308 *AF5B43500837B421FBF4B584D54BA5DE1A299054 FUNKYREDBARNCOMWWW
1,666,224,309 *AF5F4D80CF81D16DED172838FE420AC567B8579F JohnnyO'Leary
1,666,224,310 *AF5BF9216552084FFA23989D044501F7E10A5C56 g0qe
1,666,224,311 *AF541F58D4B695177A468827918CD38D31DAD2C1 jonathonmuhlenkamp
1,666,224,312 *AF508FDE4CF0B10EEA53793ADE79993D7D476BC6 JONETN
1,666,224,313 *AF53207381BE7AC7865C06F48D360F24B946295C gajey
1,666,224,314 *AF54F409D3B6307294881FADD122192814FED3A3 JOSHALPHAJOSH
1,666,224,315 *AF545AB717BD6DDB8470AB6249BE894106BD1AB0 GARRETT.MASSMAN
1,666,224,316 *AF56CDB8506BB8114A6C85EA165B8126E0B3E86A GARYBILLUPS
1,666,224,317 *AF5EFF7F46CC24DCC42169419F4AE5F33631866B [email protected]
1,666,224,318 *AF5734F48D1C0E22D3187C7DF4929C64DD0F0497 gayxxbbs
1,666,224,319 *AF5508BAAAC48A681DF01252D7C1A1294990E664 g#c
1,666,224,320 *AF508E1E56433EA16F6FE0EF831547E0E3CD9053 GEOISER
1,666,224,321 *AF59CE39410D530BC75556D75184F99F1E18FA87 JWALSINGHAM
1,666,224,322 *AF5117D7EDC46875AFDAF8A434832F93A304A176 germantoeller
1,666,224,323 *AF59B9CA96EB998493230B2A5DE62BBB11D51B38 JXEDLKKZDOD
1,666,224,324 *AF554CD4766F313C1C061AF4AF64F19F8B0D700D k5zcn5qmso0
1,666,224,325 *AF58B8EDBFC8933BBBE64648CE180D36F36BD5C3 gilcrispin
1,666,224,326 *AF5CD0041D6632F134210FC98B9E2A6E42C197C2 kareemmagrone
1,666,224,327 *AF50EEB80C2B1F014E94221BF8CAB814F39F065D glenbugna
1,666,224,328 *AF5295BE64627E2C689CB6D108AF02FE91EE9549 GLENNTROWER
1,666,224,329 *AF554FD12B800187AB1A4DD4856C84BA3C9A27B4 GLOSSOLARYNGEAL.
1,666,224,330 *AF56D6B7A2570E4546A9C0D24D240EA2B143CD3E kayanom'tek
1,666,224,331 *AF5522E04A6B96321905B982C27CB203BFA429B4 KCATDRAHED
1,666,224,332 *AF576443D2973D4552069921358454AAADF1849F GONEWTON5
1,666,224,333 *AF508D6992D89F34F228C6DC31047EDF93FEE37D KEITH-FORREST
1,666,224,334 *AF547D5C324E1FF9D024FACDA9B3BF91A736BE13 gordonrhew
1,666,224,335 *AF531DA91FF433A0506897FE2A3FFF6EB229EA7E KENDRICK.JUDIE
1,666,224,336 *AF5F7E5BEBBA0267CDE5DCFEF78A1355A39B9371 graigferranto
1,666,224,337 *AF50AF7B14801004EF501F1A3775B86152BC36B3 [email protected]
1,666,224,338 *AF55BBB3FC202809AE64467B0FE4C8725FE29BFD GRANVILLE.KURITZ
1,666,224,339 *AF5F58D36A9181140902DC79B6B0579BDDB2EE4A KENT.ISACHSEN
1,666,224,340 *AF588F1228CE0A043775B9C01EDBE4E39873402E kentkrzan
1,666,224,341 *AF564E484BC9086278BB2F1BF96791FD1A94FEBE GREGORIO.QUERO
1,666,224,342 *AF5A8C935F3D41D9F2C1E24F3E14ECF60DB97C38 GREGORIO.STELLA
1,666,224,343 *AF55F1FEC312ED765BC4BA00E8B27BF08D4A2059 GRF...
1,666,224,344 *AF561AF9EE311AB1A1709282276B531CDC538177 kevin-bradt
1,666,224,345 *AF50D8B53B1E1075FE49F09A33CA6209DB125000 [email protected]
1,666,224,346 *AF5F1DCAF1FAC122E00408352EB7BF44CD00615E G*RR
1,666,224,347 *AF5A2531CA95201838F2AD247C66B9032B7A5A0C KILL-'EM-ALL-(DISC-2)
1,666,224,348 *AF58343FD1E75571431C278B6B99ED92772E9A1D GUSTAVO.CROMEENS
1,666,224,349 *AF5D445768E7EE770B15E230D25B8FCAA3BED342 KIRAN ARSALAN
1,666,224,350 *AF5E7832A35DFF5C73DB49F9980F967172164C55 KIRK.YGLESIAS
1,666,224,351 *AF57590C62513909F79C5409EB7FC2F435F9C2AA gyobanggo
1,666,224,352 *AF5AE4C136224A9CB1CEF16EF2E1CA3809B0BF15 [email protected]
1,666,224,353 *AF57C35F0AFBD4AD68E182793956E33F10C081A1 HARMONIA
1,666,224,354 *AF5B660F26B17BB94C48E77539A8956186FFFCFA hawknoses0
1,666,224,355 *AF5B53820AD1DD4A2176BCA9CB8F653E0E6A9003 krokodillevellen5
1,666,224,356 *AF5B6D46C3E265339707A263557B136714CEFC33 HELKHADRAGY
1,666,224,357 *AF5EABC70109ADACA27550AA21159D6D0287F61B ladysick1
1,666,224,358 *AF590B0E2C8F91C8A645EA0F951795DEC30C7E0F lamarmora
1,666,224,359 *AF5F173BAC2F879EC6678F316BB1BF1B93E76863 LANCEHOLTON
1,666,224,360 *AF5387B508D5C4448BE424D8DC41A20C02CBB427 [email protected]
1,666,224,361 *AF56EF52511FFCC24818F4EA13A556E75E4BA572 [email protected]
1,666,224,362 *AF5B88B993BD3E093D415BE8ED6C4DECBA2E64CA HOGEDITRIA
1,666,224,363 *AF55C6B80CAB3BDC6E6C142B1B87F56920546BF4 hökåsen
1,666,224,364 *AF541B75F648DC16F11D5D1DDC40FE93F8E0BFB7 hondakathryn
1,666,224,365 *AF54C7A62C9304CE147698A43E20E454D75BF6C1 HOTTTTTTT
1,666,224,366 *AF56D1796DF32061C3C29FF4F6CE0B0D3BE9027F [email protected]
1,666,224,367 *AF58CC444CB728FD3AE4A9E8E416C876C0A644D3 lelandfrankina
1,666,224,368 *AF5966BE37EB413676773CA40610F962BBA1845D LENARDKAJA
1,666,224,369 *AF5372096E8821968C621F16C8AEE6F17017B7A4 LEONELSCHINDELDECKE
1,666,224,370 *AF5B5268A01975F4C354B42BED23F5D9AE0AB441 HUDAVERDI.PIRTIK
1,666,224,371 *AF5BB8D7FD90E64757A3F338505F7C2F5134B474 LEO.PAZAN
1,666,224,372 *AF5C232F48B34E7B393A5A44953DAE2212C881DD HUGO.WITTNER
1,666,224,373 *AF54A0142C42ACC5A7CDF8906B1E2F26EBAD7770 LESLEYDOHMAN
1,666,224,374 *AF5E90E207A0E0FC4A718D3CAFD5807162CF8A11 LETHIQUE
1,666,224,375 *AF56A1E92A96869FF087114909934BAC2A4C9DDB levimostert
1,666,224,376 *AF5315925E5E1231B71F88A9328877AACF79EF41 <li> <a href="soft.html">cryptology software</a>
1,666,224,377 *AF52B7DF3F9C099A967192F4915726E5DFF4DEB3 IÁMALA
1,666,224,378 *AF5D5A3A69F4FFDE240420F4BB78DA3D4E256680 LIDINGER
1,666,224,379 *AF582A9F1507B81EA4A99242CB7E89F8C8DAC803 liivaloss
1,666,224,380 *AF559A85BE869FCDA729DFB92DE5957297B14B37 LINDAKUENZI
1,666,224,381 *AF521292E49D5FAFDF26E12905CBE946DC61C17D LINDERUDKOLLEN4
1,666,224,382 *AF51CBF5FAFF804E8D550DAFDD989968E3E83A7F IDIOTMED
1,666,224,383 *AF5DC659AFC4054C3BE9F80DDE077483AAEA3A0F igc-calendar
1,666,224,384 *AF519C76205A67A967C516F4FDDEA1A375AD3B7A [email protected]
1,666,224,385 *AF529831949A0C930A6312152A67704845FB12FF ILOVEGANDALF90
1,666,224,386 *AF5CAD1B804FAD3F616139EDE3D92565F98CCB23 LNG:
1,666,224,387 *AF5A5B312E2C129ECE688CCE3E5480660BC06C5E IMANDHARI
1,666,224,388 *AF5CBDBBD4C04B5AEF2F62B22A38A248DC8F9B8F [email protected]
1,666,224,389 *AF56240317D590321EA6418EAD7B4F92FC300CE3 LONG-PASTERNED
1,666,224,390 *AF501A912E8319325E964A58C93E8AE08FE6B933 Inhopes
1,666,224,391 *AF56669FE5A0BC88AC5294EBE31B5FA41A550BF4 lphbtrned
1,666,224,392 *AF552E348618FA15F9E6763C1124A448F057AC38 INTERIMSPARTEIF
1,666,224,393 *AF5F5C1DF249A44193F216925106CE8AC65E5138 lucienmignano
1,666,224,394 *AF5CD84B172C0740C3B423345DB3AD1846E66E39 luigirenaud
1,666,224,395 *AF5C96CC04C7C29CEAF6A92AC20412EFC9A2D33D ir-2.3.1-operational-assurance- 40
1,666,224,396 *AF5F50EEFDB6C2F9775840AB13B9242E01D4F610 [email protected]
1,666,224,397 *AF5FA3E8321BB48DCCCD16271B1F9C33FF650170 IRRIDED6
1,666,224,398 *AF5E03CFBF408B24B3B851AE1A78F0B11EB4C2EA LVIYDYT0
1,666,224,399 *AF5F2AC4E2A363267B24C84EE09CF8561D521130 lwckjwc51
1,666,224,400 *AF53A1C2F961FC060D853B01A474FAADC7427560 LYNNEBLOUNT
1,666,224,401 *AF5D37B2482C213E0191A329A765DF0BD46C5FE3 M3}AAA
1,666,224,402 *AF5FF0E6E1C5CBC16AB946EDFC9F2BCB1B84237B *j4aaa
1,666,224,403 *AF5BEDB000AE167F040A913AF3C32ECFDFD72BFF jaatyantara
1,666,224,404 *AF565DE5752647ADC50176FD0B9878591301E246 makrillista
1,666,224,405 *AF5DD6574E6CC283D7823D19CA5F33E558B2E1C1 JAIMIE-GATES
1,666,224,406 *AF51E8E4DFE2FDEC6FF7B74729F81F92AE93259B MANCHVEGISTAN
1,666,224,407 *AF53ED11CE2ECE674375760BB0A56134DBF4577F JAMES.WILKINS
1,666,224,408 *AF5BECBA26A5ABAB11A05BD129858537A0D41232 MANURBINO
1,666,224,409 *AF59C522477300C665E64B8DC15D9D5294A24AB5 JANESPORTS
1,666,224,410 *AF560BD73D8DC768E1630F36D8A5CADA98358D9D JARVIS.MAURO
1,666,224,411 *AF58FEAD666BD1AB36C9F15F9E30E0BE7A144B6F MARIENKÄFERLARVEN
1,666,224,412 *AF5F0BA0444267B861D35DE14BE5958ACD079420 marioselbert
1,666,224,413 *AF5611BFC77E836C229DE4D21D819FF650F8BC11 JDWALSH
1,666,224,414 *AF5C3F3CFCE56346888FC0F05A48370BE0C88C88 jean41155
1,666,224,415 *AF536F3E4D663E55F6B05FB9B609B505ABD999C5 MARSHA.PEARSON
1,666,224,416 *AF52D3AB56B3F62FD1B9F52E44C79DA8FABFF159 MARTINASCHWARZ
1,666,224,417 *AF5E758C2C28E3EC46AE6D3B187EAE1B8558FF02 masacres-en-argentina
1,666,224,418 *AF5684C8BED93A37B24A31FFB5F11089D2C51662 JEREMYCRATER
1,666,224,419 *AF5CF4445C227AE61A04A263FDED01BD2650B981 JEROMY.ACHILLES
1,666,224,420 *AF5E515C14B344211F6978189AA9951AF5488482 maxhbsw3
1,666,224,421 *AF5B5CB2A55AE751D72817F2208CA7AB339D55F4 mazurka-no-57---vivace
1,666,224,422 *AF5C1FCF6C59D81CA4C250D9AE87C3B875472C77 JEWELBIRCKETT
1,666,224,423 *AF5492E058E732D071E024E353C43971FE279542 JEWELEE5
1,666,224,424 *AF50767492CFB8AEE0789BE9EF833B9748A47946 jikknuming
1,666,224,425 *AF51211164997624A751E071B1F9E02E1E24F77B JOCELYNN747
1,666,224,426 *AF52D9A5EF0DFFE702FC308582E4884409E0B735 JOHN.BENEDICT.PINEDA
1,666,224,427 *AF5FB5675ED3F67A0A261E9C1B5EE8607DE3B0E4 JOHNIE.PETIX
1,666,224,428 *AF56125DE84857C43E8C1DADA68D15A35356B972 JOKERLEKIU
1,666,224,429 *AF5B8587232EC9B58CC31EABF0197ABDDED8C9F3 jordanbiro
1,666,224,430 *AF54AE822B3AD401AF95AB1886E1E5028A681259 JORDAN-RENNIE
1,666,224,431 *AF55B3F55D641ADFED764E71E327D95F74BF1ACA [email protected]
1,666,224,432 *AF547CF2C7A9F0C8B4B3CD7A0B08EE192666DA8B josefwyatt
1,666,224,433 *AF5C7851A827E85674A7EDCB9B4DB802CC2A064D JOSE.NAGELHOUT
1,666,224,434 *AF5F382789531AD1456D6DCD1CDA85F4B7686B67 MIGUELFALLENSTEIN
1,666,224,435 *AF5F72E5B6D40B8E85E364968C6840402532953C MIKES.MUM
1,666,224,436 *AF55CA6A1D3555F03234A82BBE3870F05C2354B6 JOSUEGRAVOIS
1,666,224,437 *AF5B63F55E39C223C03A358E893CBBC3C1CE34B6 MILOTHOBY
1,666,224,438 *AF56E411C789082450FADDB0F1B6A405C2928D01 MILTONMCEADY
1,666,224,439 *AF506152600E23279D54206BEB5B7A5369DAF9BD MISCHARACTERIZING9
1,666,224,440 *AF597CFD2B0DF78486FCBEAE7FB75C6A16F87629 MITCHELL.SALT
1,666,224,441 *AF5FA131819704EA55CA608114E4A4F9E59D48EB jvf
1,666,224,442 *AF58B9E4D7B74CE0442171C79D4F3CD413219EB9 mohammedkercado
1,666,224,443 *AF5FA6B7708DC8D27D066AE812229ED632489092 molmajeur,op34,no1
1,666,224,444 *AF559A36533661F2D966A9252299F9D684616A64 karl–marx–stadt
1,666,224,445 *AF55663BE20BAE68437F79C4C0E2E4F974C3F85E kasun-anuranga
1,666,224,446 *AF5E2195F49571C7FD71A1B32BE35511F07B1CBB KATELYNN18
1,666,224,447 *AF57C07B9C696DA89EA16DF310518B5F4E43CBA7 MRAMBIKUR
1,666,224,448 *AF583D950DBE12CEECDAABBFCC4FA910E50135A6 KEITHNEILSON
1,666,224,449 *AF586A2C4606A1B4B15AB65ABB4F80089D6757E0 KERRYDECH
1,666,224,450 *AF5856033CCF1F8EB4455E009397CDF9FA0D2EB5 kiana623
1,666,224,451 *AF5B1DF46E9E8D999CE9ADCEC00934A19A576CEE KIM.WERRY
1,666,224,452 *AF51C0863C4099A2BBF19B2451F86196080E3D1F !N541U8R!+!E5
1,666,224,453 *AF55A7F60B9BDA1553DB6B578E5E08EA1A25EAC1 KIPSUDAK
1,666,224,454 *AF59429A28939FCF358949CE4037296946FE9808 NAGESPEELDEN3
1,666,224,455 *AF5D30CBD5E5C543795D7466E55847C7CD28E48D [email protected]
1,666,224,456 *AF5BFBFB612814F6628523FB0E5C1B12283B70A4 napoleonkoes
1,666,224,457 *AF596889D85C149969D4A6DB089FC5351C6A718B narushi0
1,666,224,458 *AF5933F1777D85B0798CB7615C638C618D26719B KOUERST3
1,666,224,459 *AF5863E3C975E419F8E5207BF58B4881853A8027 KR^IKALAASA
1,666,224,460 *AF56DE620852F174C0B536D1F768B0FE4DC98927 NETWORK999
1,666,224,461 *AF54EA2C529A606601C0B8FBB3AC60A2FF60AF8C KURTMERNIN
1,666,224,462 *AF53DC17252D268E1AC72B6BF59C2725B143518D KUSUMANGFDLCCBYSA
1,666,224,463 *AF57E0A09435F2E4F91441F24FE38653F4EF6E5D L1F38OA+$
1,666,224,464 *AF5D7608ECAC9E99FBE3873777075885E7E76B10 NI{PPIKT
1,666,224,465 *AF57BB15BF8606516AC188354CAF23A70DEFEAA0 [email protected]
1,666,224,466 *AF53FE627B6C5B9F0D3E7B82F5453F18446451B5 LASKIMOSAIRAUDET
1,666,224,467 *AF5E84B08C37327AFD57DA987E4ABB0057D9D4E8 nonfyad
1,666,224,468 *AF5467F57EAAA7D1A9825AE8EC7780D07C448B40 [email protected]
1,666,224,469 *AF544FF4A0CCAAF319DE8517FEDF4B335745EF67 LEANDROMACVEAN
1,666,224,470 *AF5F5BE0717FBD45C9C9758C9CC85A2ED7CCEE44 [email protected]
1,666,224,471 *AF56B3D87BC8B2C94430B5CF0019608041C8B471 now-you're-not-here-(original-single-mix)
1,666,224,472 *AF516D976B949CDF9A17A8137212C30119C4F52C LEMUEL.DEMICHELIS
1,666,224,473 *AF55C56318B86D4F86958F2CF6DD57EF9518D4C1 LEMUELDUGMORE
1,666,224,474 *AF5CE34AD03EC42B953DCA116188D083F265FC2B lenkschlaufen
1,666,224,475 *AF5301744C384589DD2277F96F82DF76A910B730 NUURQALBIS
1,666,224,476 *AF5B482DEABCC23A9AD5063CA255B0331BF7318A のNWAオールスター・レスリングに参戦した。
1,666,224,477 *AF55B821C7DE357FFBAA90F501CF151E79D69D7E oceans-of-rage
1,666,224,478 *AF52C73CBEE6DA4C1BC964C773902028204B8F1B LICKERISHNESS3
1,666,224,479 *AF5CB2216D2E844D0758F28DFEC1CB625AE15A45 LIKE-A-VIRGIN-SINGLE
1,666,224,480 *AF5DFB31C29FCA9D7998057789F899C796178A9C LINDALASH
1,666,224,481 *AF5EE8AAA60980A20A59AC92939503CA91B7828F LINDENECK
1,666,224,482 *AF5001AA6197BA732D9B47383FDAD5F1B291C511 oqtaydan
1,666,224,483 *AF5D4ADB7DF5E39F32D07B4D9D7F6AD87164353E OSCAR.CABILTES
1,666,224,484 *AF5C3754CB5C64E61711E3FA7AACD0A2B564AF0D LOVESTORY(D.KAYREMIX)
1,666,224,485 *AF5F464738DE624CEF98BCF4A5A576DE79FC7D0D L{U1
1,666,224,486 *AF5F809731AD465A027E7538C0BBE3BE55999E24 LUIGI.LABRIE
1,666,224,487 *AF57C433C27F524ABDF09CA254452ECA042B0215 p4n+he!s+!c41
1,666,224,488 *AF5023C7372E4C1AD94FF26F1383A541A74627E7 LUPE.BENAVENTE
1,666,224,489 *AF55B59423B2CC75DAA4EE09E758B2AA66733644 lupemunsinger
1,666,224,490 *AF560AB1121C80FDE50B901ACCBCB640EAAB5AB3 PAKDRON9
1,666,224,491 *AF5122E4F0DBC86212470B85096088CE63000D23 papiertransportwelle
1,666,224,492 *AF5E5360EB6277658AEBF97BA54B5247E6AFFF6D m1590v3rnm3n+
1,666,224,493 *AF56C0BB4FFC7B3AB494867A1A0A25076DD01150 MACKSABAD
1,666,224,494 *AF53BF325DD3836CF03420DDDA4508ED58AF6385 MACTABAMQUE123
1,666,224,495 *AF533AD177A201026CF9B5E1A6A9D885E1CB5811 PAULITO5
1,666,224,496 *AF514BF33FECC1B4E20BAC795D30FF0223A0BE51 MAGASHI9
1,666,224,497 *AF5557919D07399CCD34835B1C2F81E98865752C P===B~-~-~-Splat!!
1,666,224,498 *AF59A681AE83BF4F3D619BECB48B350AC033164F pD`~ `~ (_0)
1,666,224,499 *AF5AD6A139140CDF0396B9EA831A29A9A67C0DA2 PDRATCH
1,666,224,500 *AF5E591CC9C670C200ACF3FCF7631C181BF44380 PEANUTBUTTER&RHYTHMJELLY
1,666,224,501 *AF5F985D8DD92CAEC5A8057D17E081F62200C397 MALPACAJN
1,666,224,502 *AF596BE9523B6F45025EF8D5740160024E43EAD2 mangelkamer8
1,666,224,503 *AF58ED059C563C6B34CE5A0C1E531B78E5DEFAE8 pepito-morales
1,666,224,504 *AF5CA294633DCAFB3BEB411A10C9BE43DC1E40CE [email protected]
1,666,224,505 *AF520803BBB36116D61786042E814B9548A2FCB4 PËRGËNJËSHTROJNË
1,666,224,506 *AF546DCE4C828E3EE6A0B5A3C6C506E3AEAB7F0B MARCOBUOY
1,666,224,507 *AF52BA1BB03FCA7D66798399A1208FEA31BAB3FC pharm01uk
1,666,224,508 *AF527927C95CE37FEBECFB0FC92036601C7000F4 PHIL.WREYFORD
1,666,224,509 *AF570C3747F86878EA659B72B22CF0A10C85A998 markdisting
1,666,224,510 *AF573DF48B0A834E2DB5C0B15B733EE4C29CC5DB MASALASING
1,666,224,511 *AF56107DF2B6901C092F15CCB0C26CAECC34613F MASTERPEACEM
1,666,224,512 *AF59F0CBFE3BCD5DE7E68A9B873F0D1D32095340 Plasma-Colada
1,666,224,513 *AF5EB2A907AF4DE07CC1D0CEDB3BC364DD8AE087 [email protected]
1,666,224,514 *AF5722710560935B7E7DD8002C7A20FCB93394FA MAUREENWALLER
1,666,224,515 *AF52300FCDFAE28A457C183D599EF837B852D97F [email protected]
1,666,224,516 *AF5DE534C6DC17DC373EEC927565829D25B73917 POLYSPERMY5
1,666,224,517 *AF5156FF8AF0DF94C2DEBFFB7D813498DB1CD9E7 PONDSMAGAZINE
1,666,224,518 *AF5F5269A52FDD39CFEBE6D05450E282F9C01307 p====)~o~o-splat!!
1,666,224,519 *AF5C3666BF651203D317D5B69AF6D49A46666661 POPOVICI ALEXANDRU
1,666,224,520 *AF5DF0C6B4F2CB3F75414C8EA4D8ACAA03AEF22A MDRANK
1,666,224,521 *AF58B6EC60774FBF6BB758FAE8200F8ED1860D89 MEGÉRTVE
1,666,224,522 *AF5373DE94BADB1824D820EF4287F349538AB34A MERITERET
1,666,224,523 *AF50123A70D75B89EE39D7B9233315B579BF35AA [email protected]@[email protected]
1,666,224,524 *AF5266F95297C6EBBCE243CDD3A810EF159BBEA4 METABASES
1,666,224,525 *AF58E27CED756D45AE5655FE6D82D28A2CE66D25 pres+!d!g!+4+!on
1,666,224,526 *AF5730E769AA6DD86BADC440400073AC526DFB67 proconsul47es
1,666,224,527 *AF54373809F113E5E039A693F9507F7F3B8DE01E q------D**Splat
1,666,224,528 *AF516BA2383ED51616B95E2F480DEA8AFED97A41 [email protected]
1,666,224,529 *AF51D10E52F9219831F25FACE4BE119D1C71616B MODERNOZOVÁN
1,666,224,530 *AF50C2E5657C28F3F5FE352D31E10E0516FDF919 [email protected]
1,666,224,531 *AF5878FB154E5831EF699491E624E617EA77B226 MOHAMMAD.SPINELLI
1,666,224,532 *AF57A00C9D87C55AE7D6D95AD4BAD17F64D6AE18 momentous7
1,666,224,533 *AF5F87B9775FD2157AA523B091FD6133F0AE1229 MOOGLEYB
1,666,224,534 *AF58E06C582303E9B7721D05B83C950FE70C535C MORDISCARE
1,666,224,535 *AF5D1E9C448DF87A97EF00744D7375E5A3400F57 MORTONYURICH
1,666,224,536 *AF5415041B970AC7C4D485936BA5C16331AC51F7 qw"*
1,666,224,537 *AF586225CB1BB1751E7373BFA4409845BFBA239C [email protected]+I3$
1,666,224,538 *AF5BCF6FFBEE7AB0D1E9A010714EBCEECB54F3F7 [email protected]
1,666,224,539 *AF5633A58D28A48DDB01EE147DBF771C5E92B16A rachel-trottier
1,666,224,540 *AF5F56BC52C9730BC2FF9A88F3C2EB7C72F92C72 RAHULDASÕQ
1,666,224,541 *AF5B31F85D43FAAB106A0A1500199E0962EF12C3 [email protected]
1,666,224,542 *AF5BD81A6F4532D8D20BE415943BBC5D08F1F496 muhammad-fadillah
1,666,224,543 *AF521C0A9C07B43F2B23A36CBB38A629CDA45E8E ralph-rieker
1,666,224,544 *AF590481895581B9656890728D00D769C8C97F9D MUNICIPALISE123
1,666,224,545 *AF595AAFCA43DCD584605E26C760AEF90A7F5E2D r.cello.nr..1.gdur,.bwv.1007:.vi..gigue
1,666,224,546 *AF55C3004C974CD53433C8A93B9079514C7DA59E [email protected]
1,666,224,547 *AF5841400A460C9829E10514485CB1E036974725 regalosdemota
1,666,224,548 *AF5BA00C4BCEA3C53EC54C5D3C35D8BEA045B7CD reklask3
1,666,224,549 *AF5F57D63386A150E57701AC07D92830A9F6DFCC REMMAHEILRAHC
1,666,224,550 *AF5C03AFC7BE17D5C072F9858EEB5CB4EAB544D9 reneayling
1,666,224,551 *AF50ED21DE3B59F3CB6253268E730474FB750BBB RENEE.DOCKERY
1,666,224,552 *AF53379FD34B34287313B4B1438066D63418B11D RENOVACION.COSTARRICENSE
1,666,224,553 *AF5DF54ADDDF5C3C0F4EC8FBB544E86C157E1796 negativeph
1,666,224,554 *AF5794C5160750B9EA21CE5D79F67EFED9D1F528 REPERTORIE9
1,666,224,555 *AF532B4F62CE193A76F902920246AF357C4C8CC8 NEJRACIONALNEJSICH
1,666,224,556 *AF5BB4E3CC2BDBB8A8E33A15869AAC04FABDCC84 nenem
1,666,224,557 *AF5D417154C0E9F932DE4B505045E02FAC5EA073 nezelof3
1,666,224,558 *AF5D8626D3DBDB3B8B254FE03821EE017747DF2E NIASO
1,666,224,559 *AF5135D47654B58E7E9D32D40C1FA80196DE2FED RIBETEADO9
1,666,224,560 *AF557BDD01345991749C9CF5AACE184847BF4B06 NICOLASSTROWE
1,666,224,561 *AF5F012A2948C49252FE24EBFCFBF0EF0A92FB19 nightfate
1,666,224,562 *AF5F72DBE0A2ED8EC255CFD69AD96EB6FE6024DF nigskinder,actiii:verdorbengestorben
1,666,224,563 *AF527F6483C30A0A367154411324EEC92E1C3923 rickiebelshaw
1,666,224,564 *AF5AAFE1A622B58278B9BE85C87BC7474D2CA353 RICKYHATTON2
1,666,224,565 *AF554249B01AC6CC1F0968AB6D33D747E49D792E NJLPHEKLBWY72NLY474PTVE
1,666,224,566 *AF5EDC56526C7270ABC64A132A3A34A810D528FB NO.19INEFLATMAJOR
1,666,224,567 *AF5CDC1C80324373358BD095CED0A84D5C79F9C9 noblethielbar
1,666,224,568 *AF555E60D2B1B3DC26CCDB5DB293A6047F5A03ED rishi576
1,666,224,569 *AF513EAED897D70A33881915BAA9031AF2EFE9A4 ROBBIESTLAWRENCE
1,666,224,570 *AF5B8BCB1C97751991F8F779EBE7DA8003D9D763 NORBERTNOTAH
1,666,224,571 *AF52E1758EE518B054B6F25A79CE4A26B0E9658C ROBERTO.MALCHOW
1,666,224,572 *AF59C613F61E72B7C6DD899DDB11FC792CE69ADF roberto-petinatto
1,666,224,573 *AF57325C9552F6AAFFEAF92020361BF74DB13F6F NOTHINGMEMORY
1,666,224,574 *AF54199409E40121B3B717934DBAF070D628D3A5 RODRICK.RESENZ
1,666,224,575 *AF5B812180E5B57F045886B15D069CBA5A5C51F5 rodrigueznava
1,666,224,576 *AF5A7766CCDADC8DB3BBCEF7D1F9DDFBFB55B233 ROMEOBIBB
1,666,224,577 *AF553C3BC3DB95971B19461BB63CA19E17214FEB O128998
1,666,224,578 *AF50457BEDFAAE75855E77C5C06EE0DAD841EC19 )o(`@###b
1,666,224,579 *AF51BC41C3925EF6B57DF9E23343F55B33C5BB84 objectsradio
1,666,224,580 *AF56292A04B70548F5F7956EB28373C41E44ED99 (O_-).~`.~`.D#####P
1,666,224,581 *AF5BF49D3DC4D02DF5E731DA1A38482AA8507190 ROUVILLEJACQUES
1,666,224,582 *AF573E6020DCA575D5C3B8EA76BE2221A70FD480 oikoplast1
1,666,224,583 *AF54B681D10996E5626FFCA012D06A06980060EA ROYCEELLINGBOE
1,666,224,584 *AF51DDB603274620E141B8A532E53914A80653D2 RP\#
1,666,224,585 *AF551593B7EF92157D673BCD1ADE23A3C760C75D OLJETRYCKMÄTARE
1,666,224,586 *AF5CA4F3CB09B5BAE256F06CE3FFF045AD7FD090 RTASSATO5
1,666,224,587 *AF549E6F5853AADD913F4EFCC9838AA30E251EBC onvergetelijkst
1,666,224,588 *AF5327911E8CFBF82AD2715ADCAEB80EF1B69021 RUSSBOT''SUSAN
1,666,224,589 *AF5253EB5D1F4E67304E7E4C28A803825BA654D8 RUSSRAYMOND
1,666,224,590 *AF589AE5DDC41B3821E082D75DB613BDC58FF557 )O(~~~(Q
1,666,224,591 *AF55F1F7EF56269B13A3BEE716EDD5B314C6BA00 SA
1,666,224,592 *AF5D4AEF4324FAF075D8D2ECECFB52DB0E0CCDBF OSVALDO.NJANGO
1,666,224,593 *AF5E4B2889E741553A382B6FB200BCC566D1879D OTIS.PINSONNEAULT
1,666,224,594 *AF5F9269346A367ED1CBD366DE5E354D0A862FE3 [email protected]
1,666,224,595 *AF5115CCC6A7357695B196D65CE73DD1E64D00C1 [email protected]
1,666,224,596 *AF512C2E4A59F9C846AB7A0481D820A47CBF43DD oxidizations3
1,666,224,597 *AF521D9E010D723B854A9775F105617008ADE665 SALKASZ–KLEIN
1,666,224,598 *AF5B4B86A8CFF6B986E1DA1504DEDB892A1EE2F7 SALVOSTEKNIKKAAN4
1,666,224,599 *AF58D4A7EFA1968A159834A1FA4D336BEE128609 SAMUALDAWKIN
1,666,224,600 *AF50CC54ADC4FB84912F1DAD87100A909396E2B8 PAFPS
1,666,224,601 *AF5E16CDBEB777860838037ACC1C0E55B9D218BA santiagoniu
1,666,224,602 *AF5FA1F35DFA352C62B2C45D36A26F9DAD14F436 santoquaglieri
1,666,224,603 *AF557A6A037B893CF737BF3050902E16DE6E5C78 PARCORIENTALDEMAULEVRIER
1,666,224,604 *AF5987C4AA818D13981941F6AE7991EB9AFEE0FE SAWEGAN1
1,666,224,605 *AF519A5847E816D9F889A06AE65655A038755FD0 PAT-WAN
1,666,224,606 *AF5E90CB7268F9D4A7C6C75319BA62406FB2EACD paulamarlowe
1,666,224,607 *AF5EE36218DF01F403267019952E8E1CF01B0E32 p=====d`~`~splat!
1,666,224,608 *AF5D971F30CC5354C73948A707F24B60E876A945 [email protected]
1,666,224,609 *AF5FC62D48DFEF2AA91C40DF8CC5001289D1B5FF [email protected]
1,666,224,610 *AF5D97DE5CF07997F25D349D3B5F21FD9193B74B PERFECT-HEAVEN-SPACE
1,666,224,611 *AF55448B6C86AFD1DF1A2EB04EE5FBB22EE3D282 SecretSpot
1,666,224,612 *AF5DA407C9396D47FACFB183E89662D5806372C1 SELLABLE
1,666,224,613 *AF57D50CF456CB3626BC19AC7306F67A28DDE552 [email protected]
1,666,224,614 *AF588E3B0C8BF569BA5F2A6DF3D722DCBEA0A686 pickworth--p-ih1-k-w-er2-th
1,666,224,615 *AF58F0AD7E76A013734B54BDED6EBF261995FD3F pig,.adult.c.u..grunts,.some.squeal,.animal
1,666,224,616 *AF533756B6706A053E81672DCC3A6260DD021856 plaga-album
1,666,224,617 *AF52B86F31D050106DA06A3ECB2D6AF946822962 SHAUNBLEHM
1,666,224,618 *AF53D84DE8A43CEB92D5BF2C2E21CB0403B84284 SHELBYDUCKIING
1,666,224,619 *AF551491B2021AA20728C8DE54CA16E03A0DC99B shelbyshaner
1,666,224,620 *AF55E36D341599D1867072B376FBD595CA981259 sheldonprang
1,666,224,621 *AF5912A14483E3BD72F6CA990C7CD6631E1DDC97 p####@ ~O ~o 3B<
1,666,224,622 *AF577264AD43F85206E968874EDAF95AC3CD157F POPOLTRACA1
1,666,224,623 *AF51F7F1EF645FB2FD7B94FEF0B950BA603F8851 PORSCHECHRIS
1,666,224,624 *AF5DE3213DA40DF82C493AFF0345337DEE11B7F7 POTENZIALED
1,666,224,625 *AF52BF08A015A69DC419184403C4A325EE3A0854 [email protected]
1,666,224,626 *AF5B6E6E9B63B2C4F31559175F25F66D0D007DBE [email protected]
1,666,224,627 *AF5A7B27F593ED13286F79BEFA83225CE744E2D1 pp ~0~o (^_~)
1,666,224,628 *AF5127F3683DDCAA266CEAF98D14DA3D2B7A5102 SIICY
1,666,224,629 *AF5E2C9B803312E23CA45D2DD42EF75E2BAAEDF1 "Sing Along"
1,666,224,630 *AF5211669BE32F50519EB5797673F712AF8BE071 PREVZAT
1,666,224,631 *AF5AC9EAA8FC7429CCAA991728A3A6FC7937D710 PROGIMNOSPERME
1,666,224,632 *AF53A2EE42A0EBBA73F4A43E3E658EDDEEDD686F SKAKMAT9
1,666,224,633 *AF5582E06023B202F5C06DDE562C40CF769A9724 prunella.ovata
1,666,224,634 *AF57EE3C497B0D124BCCD158B81D4EA62812B46B PS3UDO L3
1,666,224,635 *AF5FBABB517A38C32896562F042ED759B0E719D5 psammophyte2
1,666,224,636 *AF537917E2F07EBD35FE8419B16E86AD438ED12D PURICEVDV333
1,666,224,637 *AF52A48C046C54683D8A4AE55F13F94963BCA712 pushful
1,666,224,638 *AF559CEA9CA72DBAD3C13431B665C7775924292F q------)***(>_<)
1,666,224,639 *AF5645E579D9163B37DEF474C54276EB212C1B96 q#B-~0-splat!
1,666,224,640 *AF549DD262B688603F88387A22473CADAB7A567B SNOIRENNOVAS8
1,666,224,641 *AF58D8B766439E7A0E958476286621E87BDA2923 QBL!
1,666,224,642 *AF58689D039A685A4CFDF2445F230BE3F39E91C5 sociedad-de-la-orquesta-filarm
1,666,224,643 *AF5FE8037C804043DA8ABC26A5DC44600C3D4E41 sods8
1,666,224,644 *AF5BB509234FA818F21D1D0A0A4830C6E027FC95 [email protected]
1,666,224,645 *AF5F2AA9913E9471ADB70D88FF3DB03AD1A2E69B QJAAAAIBAJ
1,666,224,646 *AF586DCDD476E00C3E65B60E583F517284AA14AB [email protected]
1,666,224,647 *AF5DA89710DB044EB9070AF0F18ECC492F5091E3 somedaywhenyoulovesomeone~anthemver~
1,666,224,648 *AF5CC3E1BA78DF72A292E79EE9E50F913C51EE2A SOSTALE
1,666,224,649 *AF593E1ABD9A17BE49A407B045CD427EA715DFCC QUIEROMORIRENTUPIEL
1,666,224,650 *AF50073F4A10C25B2B37EE1B4EEF363CDF3738C7 [email protected]
1,666,224,651 *AF5AFD7CDE44C6C4584F4F92FD04553D5A55250C Q=====>.*{X}
1,666,224,652 *AF512D8106CED2272D8C05BCC3C1565658C02F1F [email protected]
1,666,224,653 *AF5E998053342B6CE77EEE5A7C31C0B3137287CD SPEKSLAGERIJ
1,666,224,654 *AF53C424E10FB4FF63F9320A7C5C02CA1E95B267 RAHELEH.SH
1,666,224,655 *AF59091372D702F86F1877F219CF047B70875C55 splat*.*.*.(======p
1,666,224,656 *AF513C5532C61C405B49314ADCC7442F39A219A9 randalhilliker
1,666,224,657 *AF59CB01154C29E4998B4CE912529B673D19B35E RAPIDUS200
1,666,224,658 *AF5B974B10B1CD45AEE0BD54DE61F17D9528A487 RAYMOND.PRANGE
1,666,224,659 *AF5AF079E149B289E424C4E6B5E5000BF0671E33 STACEYETRINGER
1,666,224,660 *AF55DE03A7E1B485AF4031AE571EB8BB9C453654 R|D9
1,666,224,661 *AF5A939E0420A5B9884AEFBF87D41D5AEC9922D2 reflejará
1,666,224,662 *AF5F048CF0D32EA36BDAA2628D9B2CEF34AF049D REGITNES4
1,666,224,663 *AF50C7D8E0D09567863D6656A1F38F495E01A76C steuqnab5
1,666,224,664 *AF597724047BE1E481ECF96CE6C31A902831C08A steven.kovarik
1,666,224,665 *AF50F9F44962B4FF744D17DE4EF5E514317B83DB renee.swain
1,666,224,666 *AF57151C8FA107E0F537AD84AD7DF72A8B9A924C RENEFUTTERMAN
1,666,224,667 *AF56F604ED67B058A1CB78F58C065E7AAEAE9980 [email protected]
1,666,224,668 *AF5ED738E8B4CD1902F567E774CFB4C9E0739509 [email protected]
1,666,224,669 *AF569E3F28FB703124D37A9F780FA8B34FCCF74D reychumbley
1,666,224,670 *AF5D86A2F2286A442420FCD570E2C8C7105B6413 reygrobe
1,666,224,671 *AF5647F43D1E1304E227D0D53018B3D9CA06DE02 [email protected]
1,666,224,672 *AF5E3D34615D14924002CCEC20DECC2E97F86066 [email protected]
1,666,224,673 *AF5482D2F3201023C6D983023821BB6DB16850E1 SUNNYRICHARD0
1,666,224,674 *AF51BF5BC384F6C5C31BF175FAAC143D71DF94F9 SUNRISE SONG
1,666,224,675 *AF5A2C7767702EFAE0BB3EBCB4C6946781901286 RICKYLIMA
1,666,224,676 *AF563E811BF635B4A98517AF8AF07E6AC63D0DAD risulter
1,666,224,677 *AF5D8965D178BA34B831716181F99B406CC3B963 tahira-hussain
1,666,224,678 *AF5B722F8365D7A6D5F90FE42A1CCAC62716E8F4 TAJROCK
1,666,224,679 *AF5C2C9CD4122ED5F54DF44CFB2178DCABD57175 ROCKIN'THATSHIT
1,666,224,680 *AF549F424DB349CF10CF0169DA9B559BCD417AD4 rockygrasman
1,666,224,681 *AF51C455E51955BE877E91FE39E6B0C58099BFFF RODGERKEKS
1,666,224,682 *AF5B032E2F424AEDEECE2529855BE65E789F1D8B TALKJAREDC
1,666,224,683 *AF571D2D41319097EB6F548B608981415DA8F3DF rodrigogayanilo
1,666,224,684 *AF50712779884C08BC23275912F7273C95B2AD73 rodrigosolan
1,666,224,685 *AF5BF18A1D99F22652EB0BDA49E3F7871853A8AB [email protected]
1,666,224,686 *AF564BF96774A73956C481F2E247231791D8943C rollandgetchman
1,666,224,687 *AF513EA4479D712294D6118D6C04D160318D8CF3 [email protected]
1,666,224,688 *AF5E8C50DBA1BECEA7F737B9F4EEDCE81DAE35A9 ROMANKREBBS
1,666,224,689 *AF5D6524FC90DC45CA81DA71291AFACF4770D505 TAPASVIBHYAH6
1,666,224,690 *AF524E6F79E52394DE241A133456BF41B1266DBB TARDISQUEBEC6
1,666,224,691 *AF552D18608584911B0E730CF222D796B0E5F8E6 ronnybourassa
1,666,224,692 *AF560CFD347E2B487A3233326907D37838DB848A ROSARIOHONES
1,666,224,693 *AF5B94F8971DD668793302D426B55C337DEE2002 TAYLOR.PREGEANT
1,666,224,694 *AF553D3833D49B6EEA09F6F1BD04A69B2CB750FB rosssevedge
1,666,224,695 *AF52C86E30269EDEE17FDC28D9DBC8C7D64F3410 ROTANOKI8
1,666,224,696 *AF599E49E3421901F9F01DEE9E7ADEA8D60BC5BB roxanne-montano
1,666,224,697 *AF5C119F743197F18B6626243B289126DF7B3C04 teddy1first
1,666,224,698 *AF55D1013DBCD38BB3A86963240A86CA7C5DC00B TED.MARUCO
1,666,224,699 *AF509AD53A7DAF115C3CA844C6334BA1495A4D32 ROY.NOP
1,666,224,700 *AF50B04CC2B67F80F0F59BF3DE9BC48AE5B92039 TEILNAHMEN?
1,666,224,701 *AF52694DE545C9A3358F362894A3CC1A3C8C0A7D TELUROLI
1,666,224,702 *AF56335B8222BD45039DE51ADDBC349E46D0954D TEMPORALBINGO0
1,666,224,703 *AF54C5A094450087E4F4D3AB2AEE80166C0EEF8E RUBEL TALUKDAR
1,666,224,704 *AF58CD72F27E124E0ADA1267BCDD7432FCF508D2 TENHTUOSLLEBREPOOCASUREPOOCDIVAD7
1,666,224,705 *AF5DB9C217493E41CC55D6BB34DEC8D12E224927 TERPSICHORE MUSARUM AONIARUM QUINTA, NO 268: BALLET
1,666,224,706 *AF52A5945B04CB314D5014108DC3B7560F299F8F rummedes9
1,666,224,707 *AF5C9E27589881E762AB8E347ACB999EEE89A259 RUOHOLLA8
1,666,224,708 *AF5B16BF936B5ADD4A9CA44320A5D5EEBBB531E0 RUSTYMELLEN
1,666,224,709 *AF591D4C2A92D5E920AF8D42022672D14A84EAAB THAD.HISS
1,666,224,710 *AF57DE4471E6184650B226EADAD1C17F019972AD THADMCLAINE
1,666,224,711 *AF57FFC5FD404CDEA1347FD2AC4CF23885F8ACCD [email protected]
1,666,224,712 *AF506B9CA7323D53E42758EFE984A8DFB1FF663F THALEICHTHYS2
1,666,224,713 *AF513C45982207FD7C009EDA31FE7DAF90E06D2E S171796
1,666,224,714 *AF54246ACEC9039B2EC014D986B2DA9D24C1FDE2 s3mmythca1
1,666,224,715 *AF5554030225D561C8E87CADF2A9ADC338CDB79D THE.CAPTIVES
1,666,224,716 *AF54594426212891EF0CBAB2F4DDB322F4EF2DF5 SALEZJANOM
1,666,224,717 *AF52013758402B2221A780D7D09FCC16C0F2967F SALGASE1
1,666,224,718 *AF57DF282D25C91A488F10B82BE1EC2277EBCEB1 SAL.STRASBURGER
1,666,224,719 *AF558DD199D8492D0617C4F6F6C1E9649DCB9790 SALUTAPSED
1,666,224,720 *AF5F0F13106D7C69BF0FCA5F6465F5644777A606 THE-RAP'S-BACK-(VERSION-E)
1,666,224,721 *AF59E9080DD79BBE17720F8D594C7C0B70973BEE samrog
1,666,224,722 *AF54D84533E2350D3D59665C67D6A89F13A5B265 [email protected]
1,666,224,723 *AF5CA289D163061DE8C308FDC73AE57D97D55314 SANDRAGROVER
1,666,224,724 *AF5EAFADC5B1480B7EBB70309F34018E701A6D9A THOMASBREWIS
1,666,224,725 *AF5200F0C40A0EA18EAA53B756E5780DE02741CB s.anim
1,666,224,726 *AF5B57B1B0BD758A0341BB9B73A9BED202E2FACA SANTIAGOLAHUE
1,666,224,727 *AF5080572F29F8F5E63794749A01085983702BA4 santoshughart
1,666,224,728 *AF546E1A35BA1A3B2747ED3D32D47C89930CEBE8 THUNDERMOZART0
1,666,224,729 *AF5F6EC952BA6C645B0689314F0446712A9C0EB5 saocwsns
1,666,224,730 *AF5E0DB9B8CFFA25DB60B1C8D822B69164D2C1D1 TICA.DE.NUESTRA.SE
1,666,224,731 *AF5E482625088F8BD6DB811A502558523CA5A0D9 SARTINAHED
1,666,224,732 *AF54FD6318CAC984DC9C066C17BA2AC3577DB235 TIETOLIIKENNEINFRAA6
1,666,224,733 *AF59069676D453E7F5990269D755F942E81282E9 time.to.fall.out
1,666,224,734 *AF50FEB5BDB59F04874A5B67F2ECA05291E7F804 tiquetes
1,666,224,735 *AF5AA9C4FCC7125C2D2A9190003EC9321736D1DB SCOOBY06
1,666,224,736 *AF5F336A83C0968303936D787BC31072CCAEDB2D scottjantzen
1,666,224,737 *AF5939922701BE9FB1F4A0E1490489634D719C12 SEBATHU
1,666,224,738 *AF58308ACD13B6C53E4EF0BCE09592FA91AB2C99 SECCHERO7
1,666,224,739 *AF5201A292A6A32E8A2266518A82208A32DB717F SENECTUOUS
1,666,224,740 *AF546B7199D26592E0B5FF3DBA0A79C662583DF7 TPECNOCRETNIW
1,666,224,741 *AF598AA383FC5D525D30670BCF5A62C45F79A08D sensuality.:60
1,666,224,742 *AF50D887162810970CEAE7E90D4DBE07F8038977 TRANSFORMATIONSMODELLERS5
1,666,224,743 *AF5D586BA83480CF71D2DCEF9F21EEDD71D10D0F SEXYSHARNICE-1
1,666,224,744 *AF53CC75CE0E68E9598E45CB57AE6FEB0DC9C1DC [email protected]
1,666,224,745 *AF5E94C476B4D4C90C5923CA787E5B0E65EF6C21 TRIPELVAKZINE
1,666,224,746 *AF5B992AC6DDB6E86C23D0CE5D7AB251F6FEE37D TRISTANGARDEN2
1,666,224,747 *AF5F385C9DAABEEFF20B796C123718850C4CC9B7 shatavira
1,666,224,748 *AF5488BBA4CA56C82BEC6B7751BD0ECEC95B469D TRUMANISES
1,666,224,749 *AF5FD568551D9BD6343A5D9C6C3862F8D987FC46 tsal,aisanierehwemos.sromurtsuj
1,666,224,750 *AF58BE38772231D6D57316A4C277A1DCD4D1DD88 SHERMAN.HAAKENSTAD
1,666,224,751 *AF519CED7A5DD93CA12DEBFF98376614BF3AB51C SHIAHIN9
1,666,224,752 *AF56A3701217D3A17185C86C0BB3CC0406A9F8D2 tsuktsew1
1,666,224,753 *AF51A11BFFC433496F4F46B5E96BD9527F02CE33 shinobu-kitamoto
1,666,224,754 *AF5CB1E853781C20350F0664AD1769F33BB1C423 SIDNEYGORIS
1,666,224,755 *AF5133E06322457F45B62F5490FD020FF32BEF1A SILICONTETRAFLUORIDE7
1,666,224,756 *AF57D3BF3B659FCD8FEB2E8561D57F5074C659DF silkroadjourneys:whenstrangersmeet
1,666,224,757 *AF54EC98C9330655FA1C17151AE1880F1A972C7D U8J4
1,666,224,758 *AF5FECB4212AE1D4C7C17A1DEFCA9A60BCA9897C SKATEDS9
1,666,224,759 *AF5D78A0DD65AD2D21C5E52F59D50316C4A521F5 Slim3.thi
1,666,224,760 *AF5E264FB7FBAEA9A3610FE647FF3BAC75E24310 UKOTUODED
1,666,224,761 *AF5BB6A81FA4225BF2BB24B756CDDC2B0328D0D1 ULDRYCH
1,666,224,762 *AF559A9D3A884440939705F3AF76264DF0F33D80 UM-ZAID-MALKAWI
1,666,224,763 *AF5574226AC4D2A6DAC3B4081F1F5197FA80717D UNAFUBW8
1,666,224,764 *AF5452B49F7984E71FB37DBB0FA4D62905B1CCDC SNAWOJA1
1,666,224,765 *AF5E4E852635040BD9B8B965CABBCE8D37624618 undefac4
1,666,224,766 *AF5E84789C0069A7EE722B9BE1EEB1FF078AD35B unfore5eea8le
1,666,224,767 *AF54228CB44D3C6DCB619F86873D00A56442090D UPETLJAO7
1,666,224,768 *AF530CD1C73B3F3B0FADE33A86F730627966100F sourcehttpstonjscn
1,666,224,769 *AF5F8357253A66B7CEE5EA3A6F3A1BBACF3D1252 USERMCCRABBY
1,666,224,770 *AF51BE672A4925EEBEE7CA7A48BA4D9C53946322 usredotociti 1
1,666,224,771 *AF51D4E2BE5775EF374587A2519214BD8CC03018 UTOPIA-PRAYER
1,666,224,772 *AF5AF5E0C2F364A9E695FE0030CD0114E997878D UXIOD
1,666,224,773 *AF5219B3EA21E3B7FEA8A2CC02D3FBF772F8D486 V4RUG4
1,666,224,774 *AF5A6FC0DF95C9C6E8565D062FC63953C8B1BB0E V4U1TED
1,666,224,775 *AF5DD8A634AEDB346EF1B24614B7A403D3FE7AB2 valle-engstrom
1,666,224,776 *AF5126D10297313791A904FF0AF4946B9028AF89 [email protected]
1,666,224,777 *AF544E8998C7B3FCC821165F8A5DAC3893058B3D VANDENESSOISE
1,666,224,778 *AF5C31F01153508FBD0686F3682DC78E5D5D9B9A VARSHARATHI
1,666,224,779 *AF5364138A5DF6DFC18456E84174DA69C5FF4218 VARTENIKASPARIAN
1,666,224,780 *AF5D5CB5FAAF5B68F20D611825E921245A2025A7 ssensuoudranu
1,666,224,781 *AF588F6E4EB3628BBD5EC0F5753418E4C8C5953B SSORREKS
1,666,224,782 *AF57A2E5FD78B286A2C87FDD0A33BE37E47B7D44 VERANCER
1,666,224,783 *AF5247A61EBF15A26041697F1EA2EC250C27D296 STAREAT
1,666,224,784 *AF54794594249C60C5D8EE0F52C21DF4DC101D8C VERONICA B VILLANUEVA
1,666,224,785 *AF58E2DDB3AA5FBFFE6ED2AD5AA66DDC34FF409B VEXPLORERANDFIRST
1,666,224,786 *AF592DAC8C6CD2252DD7FA59C6EB0C17F0BCF046 STEVEN-ALBRITTON
1,666,224,787 *AF548367FDDD32A706984CEDE6596C3786C13CD3 STEVE-SHUM
1,666,224,788 *AF57806BA8096D69A9718026AC3F29CB11902AF8 STMNINGIVE
1,666,224,789 *AF577E36C19967442B10678490C9508759E48BDD stnemila7
1,666,224,790 *AF55C7338600A449226B8F706C9B34DC3D0D8D38 VIGNESHSELVAKUMAR
1,666,224,791 *AF5A27ED68B5088C0504D55FACD893DCAA7F4D35 VIINEIN
1,666,224,792 *AF5F4D3655C6DFCC853E0FBCEA08803437017D20 VIJAY PARSOT
1,666,224,793 *AF5D2F6ABA88FBC1275257E10CFD3EFAC2EA14C2 straehnerrad
1,666,224,794 *AF5701F27EB890E40F8DE25BEDEB1757B7F63A96 stringop0
1,666,224,795 *AF5B72D22818D93934D4FB059E5ADC2C630D31B1 VIRTUALEND
1,666,224,796 *AF534B7BF72CD3795104A3C645AF79F9A42791A6 vishvanath.j.bhat
1,666,224,797 *AF5F798D21D6A6477808388AA30C2CDD7D1D688F visiongalileo
1,666,224,798 *AF597F77F06A9C596605E78DB9DD876031E913A2 SULITATI
1,666,224,799 *AF55DD8895756EC317D0420BD687E698690B0DF6 vliegter5
1,666,224,800 *AF5B46504B1CC0CEE7A676F13230A84648A701DD *SUXMYDIK
1,666,224,801 *AF5B51A9B4240B1D0A67F9166F1C4B108C853951 [email protected]
1,666,224,802 *AF5DAF44A528292969C3D64346FA4F0232CEF8D6 sylvesterfonville
1,666,224,803 *AF57532EAE6454C883671A236B0D4D543F05135B WADEMUSOLF
1,666,224,804 *AF5E9ADA93E4818B25C49209EB158297B626AD6E WA+ERF0W1$
1,666,224,805 *AF5A9ED02900D29270109F5FB1739976F44C5B04 SYÖKÖHÖN
1,666,224,806 *AF5064BE5EF7DC4585CEEEEC9FD6E54C75A8C15A WAKEDEBBING
1,666,224,807 *AF538986E992FC91668B31FDF2AD11026573965D WANCE KUARTZA
1,666,224,808 *AF572F09457CB20845FEC85DEA032F2ECF156A3B Take.No.Prisoners.(c)
1,666,224,809 *AF5DB6826B8C09EF9796B2BBA295660D0864429D TAMSAY
1,666,224,810 *AF50F71886178F2DD59F6D7DF32ECDCC65A46787 [email protected]
1,666,224,811 *AF58C9B0B08F011665FE918762C110057E59C6A0 weldonprus
1,666,224,812 *AF55B2B6765789A965E290B890A5E6803D7DDBE7 welvarendes
1,666,224,813 *AF5395072D30E89AB51A8C2FF006FF9B3FF3CE26 TEASELWO2
1,666,224,814 *AF587A789E02FB5EED9CD6DD99566B80B9FE6400 WENQIWOO
1,666,224,815 *AF5A1619D4F1AB00D4EA16B3DC5200166806335B TELEVISIONLIFE
1,666,224,816 *AF543E3C52D86D18BC5D40F5139CC0A6371F6659 TenkouWhywefeelsorry?
1,666,224,817 *AF5637847ED455B2DD20BC638BA52B91B480C030 whitney.karner
1,666,224,818 *AF50D42A5555943D596011987B379F86D13A506D WIANDINIDEVI
1,666,224,819 *AF5607FDA02C9F0DC000BD0CD988491DA01F9827 TEXAS.DRUMMER.BOY
1,666,224,820 *AF5B5956CB9BF7E3CB688CFF7275C78CC9139E09 WILBURN.GOODNER
1,666,224,821 *AF5F8803C2EBF616EA56E10F6DDB52515A8CC403 TGUBUDELA
1,666,224,822 *AF57C04ECBC158B06F70DF01BD576B3E6844A280 THAD.HINCKLE
1,666,224,823 *AF592C7EE164E83A21052266D705C50149212C9D thedelete67
1,666,224,824 *AF5B2FF3CB3ED20EAEAEB9492A0A5A97E0FECE1A woodrowbruccoleri
1,666,224,825 *AF5E56822F624B23CA17D4D5E5AA243AAE84289F WPHTN
1,666,224,826 *AF5FCD7545C9DE981AE8315077038989FCA99438 THE.WHITE.HORSE./.INTO.THE.SUNSET.(END.CREDITS)
1,666,224,827 *AF5FD6411A6539560DC1F905C808C4FD520E4946 WU.CHAOMEI
1,666,224,828 *AF5AEA6CFE67EDA4C74D40408F164C72816014E5 THOMASSATURNIO
1,666,224,829 *AF53A72B21D73FA6323D283B3020B37CAA07FEBB WWWTHESICKCOM
1,666,224,830 *AF594982A6FBF08CB68BA796C8E4BC71F3CDAEE4 wwwwellschamberorg
1,666,224,831 *AF5E95A12F2A4299B25C6E43FEE05532D2FB8FAE TIMPERCEPTIBLE
1,666,224,832 *AF5B6F8E78E09665D67EC2446BCB592F14CBDE23 TIMREISHUS
1,666,224,833 *AF51FF1F46ABE1941390285E0932BBF31F5B8FD7 xanthpp3
1,666,224,834 *AF5E96EEDD133B60492E17354A317A625E2594C6 [email protected]
1,666,224,835 *AF5F5D36CE0C44BA4CD05F08A7E5E80FA8F8A065 [email protected]
1,666,224,836 *AF5389D093CD9627BA87FEC2A86780EE41535EF1 xsr~
1,666,224,837 *AF58194A8824F07B8FFC1C6E96C2C2A266469E7F XU-GONGQI
1,666,224,838 *AF5B4E5EA34909FEFA1A99B49B7B8E6E04792265 Y;38
1,666,224,839 *AF56425CFF453A5D4462CDCF7A31C7CA0A54F711 y4/
1,666,224,840 *AF56815F5BA48790C34D1F2E08867D141E2AA8DE y~5r
1,666,224,841 *AF5ADABFF9A1ACC6DA06EF96DC11808CF0D26E2A [email protected]
1,666,224,842 *AF5CBD5BF47CDF596DA240CAC925620875125A35 TR4MM31S
1,666,224,843 *AF5905CE67543208B040CE1BD2ADF41EEC5B587C YENNY-MARGARETHA
1,666,224,844 *AF5926684DE53F0263B369FA07F453390F2AD181 [email protected]
1,666,224,845 *AF56BEF5922A2E6AF491D3D81B6BD34DC7EFB6B8 [email protected]
1,666,224,846 *AF520EB2B6E2F2F68506935E755AAEABB85ECF7D TRICOTYLEDONOUSESED
1,666,224,847 *AF535DB9CCE60842D618D2A0D65AC3E994ECFD82 YMAGCAKINI
1,666,224,848 *AF5AD8D2DB652FD414BEF3226EAF44276799986A TRINY-LEE-CHONG
1,666,224,849 *AF542E2BBC0CF27643362412D354A0C508559BB6 [email protected]@[email protected]
1,666,224,850 *AF509AE749D87A7666115AD3F0E3ED2ABF169381 YOSELIN34
1,666,224,851 *AF5AEF6C2137F08D0F65D2D6BC6E28D4D413F374 TSIDFAW8
1,666,224,852 *AF59663CB938E21A8592254BB5A4277F9371AD72 [email protected]
1,666,224,853 *AF5E79660862F39986AE04D175261FA2259DF7C3 TSONGGARAPATA
1,666,224,854 *AF5E9B2E33ED97571E847C7C2ED09D346774F75F [email protected]
1,666,224,855 *AF546AF774F5F678A14EF6F2CC3E171984425624 TUOLLAISESTAKIN
1,666,224,856 *AF5DB15085BA18F56DA773BDB94DAC2509991560 [email protected]
1,666,224,857 *AF507EF241252B91AB59A4DBB1C7875BCB374B4F YZZZRNH2
1,666,224,858 *AF56123E231ED69E4ACB0D85CA7025513435A855 ZACHERYGARACIA
1,666,224,859 *AF5EA1EDFBA02AB4D4E5250A94E4FADBD050FD17 TYLERREDFORD
1,666,224,860 *AF5160DFCE93D41AA4FD9EB93822DBA75BF0AC28 TYREHTYVT2
1,666,224,861 *AF5282BCF524A37988D5EEE64C76FE572732A0AA TYRONEGIANG
1,666,224,862 *AF533621BDCE3E5052E3CDAB95CE8BD9B0329995 ZATOICHIB
1,666,224,863 *AF57979C62D2075D98B11ACA8D9E9AE6D266AF2D UDSKRIVNINGEN
1,666,224,864 *AF51D6D366F6B717836049E2A6B35ECF1E269BFA [email protected]
1,666,224,865 *AF5D8ED29310413BCC425A786AC18DA96643A994 ZHEED-RENJI-BAYANES
1,666,224,866 *AF567817EC93EF2C93F230091B656043696BC2B4 [email protected]
1,666,224,867 *AF562EB75DBFB77373A73BC073B8119AA747E63D ZHONGGUOGRAPHIC9
1,666,224,868 *AF5735FEFE09BF3B4848612B149D83599FE96A50 [email protected]
1,666,224,869 *AF528EDC47662EAB0A98585D724458203CAA5410 ziddan-al-hafizh
1,666,224,870 *AF5BE08F4A3E9B737E962430826F8C65A0BD68AE ZIGRANG2
1,666,224,871 *AF56C34EC1DC17514F84196FC0E54D72A5A48DC5 uncle-green
1,666,224,872 *AF50C33DD83E589B3E0D1A6462212F584A6E9672 Z'OJ
1,666,224,873 *AF59B599F46845CA6F3202361A4A9F0752E29BE7 UNN
1,666,224,874 *AF54E8A7201A5A4EDA94931F0868DFB9AEE77D3F URUFU.SILVA
1,666,224,875 *AF5AB165356F95B932B58BCBCBD0D8C97FDFD843 λινισταίνησ
1,666,224,876 *AF55F4EB239747A1849E02B7C8AE5D7E35BB8E8B uwmt
1,666,224,877 *AF56937B7B974D77E5394D418B7F4AD781B2DCCE [email protected]
1,666,224,878 *AF50FA06D5E606948D12532104F7F75AEACAB56B VALENTINAPEPE
1,666,224,879 *AF5A687ADD6373D5C148B3F7B8878B0C3097DACF МАКОТЬОР
1,666,224,880 *AF527C8510DA13067F7E7E133C5CD7A8BA9CA2F4 VANOCTAVIA
1,666,224,881 *AF53B5805CECB96B2879A1866E8B032EEE3AF01D ОТВЕТ…»
1,666,224,882 *AF584DE19200139F8A9B75EAA19EE396CDC4A603 vasilis.lazaridis
1,666,224,883 *AF5A85666EF261CA4B92CC4E331B8A4DBACFDC19 ПРОКАЧИВАЮЩИЙ
1,666,224,884 *AF52F0932A64C7AB83E4A1AF05A9F2AE440B1CBC РАСКИДНАЯ —
1,666,224,885 *AF5BEDBE184DBA1DF6360E028B6AB66F7017F384 VEERABHADRAACHARY
1,666,224,886 *AF534D76EB80487D651E6FF114E00ADC6B583636 „ТРОМЕЂЕ“
1,666,224,887 *AF5298030B5DDBE5FEBA663646A2A8CF6F11C907 VERMEI1E$
1,666,224,888 *AF54FB5DC52288AE2E33BD7018556BEF843AF01A VERNBESHEARS
1,666,224,889 *AF586308E02CCBFBA759B1FC7E945B5330AF324A ЭПИЕ
1,666,224,890 *AF51C851451ABCD237398AEF0C4AFEF79720B84B VIANA-SASTA
1,666,224,891 *AF5D831B0A7C9F2AC24DF6D8BE5FFB16A94646D5 victorious america march
1,666,224,892 *AF5638FB37A430E61368AC0F6851033BA690DFA3 VOISIN5
1,666,224,893 *AF59C6581B70D6AB6578621A9CF5ACB13A91ED6B VTECPOWER
1,666,224,894 *AF53AA34FA0B7D4493EB7CFAEB7055F9B396328B w.alan.yankovic
1,666,224,895 *AF58A532FD6501AD75F66F462694A57F2CEB587E WALLY.SALAMY
1,666,224,896 *AF578FEEBBFB977979715702EC4C98CD37AD772D waltonmaccallum
1,666,224,897 *AF52B1B50534D2F930729A735DEC3FBF699B358D WANDAVANDENHENDE
1,666,224,898 *AF5B2B1454E4ABC1AEED39646744915B8DE5357B [email protected]
1,666,224,899 *AF5C58B9B8D423E23C5EF469FF7740EC22A507CE (00) * q##3
1,666,224,900 *AF5030F02235DCD875B34D995202728DCD671505 WEBSITEELSEVIER
1,666,224,901 *AF597A7B43C6FB859144DF27B6F6042031B25A82 wendy.paajanen
1,666,224,902 *AF55236B53C9BB63DF064CF78CF28EAA829CEC67 [email protected]
1,666,224,903 *AF5FB2057AB0F0BB88D74100C908919220255512 0BLIGA+3$
1,666,224,904 *AF5CD35EF0050F98706FFB830500D7F55E7274BC (-_0)-*-*-*-<###p
1,666,224,905 *AF521F4170351A15A0ED3B6ED532356546261A48 whambbs
1,666,224,906 *AF5D1E57F802B59AD113FB377B9AF7E341DF03E0 10THJULY
1,666,224,907 *AF55EAB93A12176C1952FA12A49BCC1BD14A5EED wilburhom
1,666,224,908 *AF54503140467D7227BA555FD5C3D96B8111CD2F WILBURNOBHOLZ
1,666,224,909 *AF5C528247D0550F5ED4FCC215BF77F87A2D79A5 WILBUR.SILVIUS
1,666,224,910 *AF5B02B76DC48862ADD8C9F52BB2EB5C02137D59 12catholicism
1,666,224,911 *AF577AD5CC252F36632A188187BD5841F2ED0FA1 WILLIAMTULLOCH
1,666,224,912 *AF530ABA47369A09B37F6BA4E75D08B5E131BF81 WILLIS.CARIDEO
1,666,224,913 *AF5B71BBC9D8A38037FF708295F9B6004BA2DDC9 WILLISFEENSTRA
1,666,224,914 *AF55E9172739D59DFCC7A1B6F857689618A3CB6B 149340 KESKUSTELUNYHTEYDESS
1,666,224,915 *AF52A3B107B397E9991FAD942C14EB8658128A17 1501584 urakoitsijan-on-aina-itse-teht
1,666,224,916 *AF516FB6BEBD701BB5CAD6CE1024DF5B90A05119 WILSON.DEAMER
1,666,224,917 *AF5E872EE7465C56F42F652ABF6B7804BAB25081 160977pm
1,666,224,918 *AF5619B631752377958667DC734C3097C318A411 18255 ASIATISCHE-SPEISEN-SIND-HIER-ZU-LANDE-SEHR-BELIEBT-
1,666,224,919 *AF54C779D08CE4EEBA4E480BAE437DD180BA496F 1876ASS
1,666,224,920 *AF5B266870CCF4E8F006EB09947DB0DBAE9B3EB4 [email protected]
1,666,224,921 *AF59F05865242CA33D273B5C748031EBA07CABDE WOLFRAM-SAUER
1,666,224,922 *AF52F1E60D04A6BB21D3663AE5EBF547594004AA WOMANTIC
1,666,224,923 *AF50EE354977E7B069211222CD3128B5BE369D64 1aksesuarIydI
1,666,224,924 *AF5E5684568CE17FFDF1C8F9EAC891251EDD8933 1-AMPUMATUET
1,666,224,925 *AF50C76053DAF0124CAD5FC4D6AEC3FB4412A0F5 1 ANSIOKKASTI
1,666,224,926 *AF5F07354B7EF57EACCE23E4E9C4012AF902CBA0 1-aSIndIrIcIlarIn
1,666,224,927 *AF5B55FC9444EB4A480EFDF134D88DAB7AD640D4 1atlamIStIk
1,666,224,928 *AF5532DBD25A152F423F9905F03C00326A1FF390 1.BA-PARTNER
1,666,224,929 *AF531E6A066BB651A99BD93BC0C64A81ACC78BFB WSRSNAKE
1,666,224,930 *AF5DD514B46279E655BBE3EA05F81C82F1F79936 [email protected]
1,666,224,931 *AF5B476BCFD1BC26536E9B5B68F17ABC5468AEE0 1.DISKO-JAHREN
1,666,224,932 *AF544DB438F20EEBA28339E04183C4FD8F0CEB6A [email protected]
1,666,224,933 *AF5A186CE99D673A6154E947620717794DEB00C3 1EKBLADEN
1,666,224,934 *AF5E8E6E2D37176AAF21FAECDFCF3FCFB170C569 WWW.COMMUNITYFOUNDATIONS.ORG.UK
1,666,224,935 *AF51E6B72C01E2CF564B57AA659EA5A42EC54050 1-em-taitoluistelu
1,666,224,936 *AF560EA2A0952C49C69A59F961EBF989B6690DC1 1FEB1580
1,666,224,937 *AF5E9F4FB43746FCC598FDFECCA9F1EC832986BA WXPOSE
1,666,224,938 *AF58BA20841273DAD875CC9A00CF1B2AC6C9829F WYCLIFFE-J-MBURU-MAINA
1,666,224,939 *AF574FA23F686B90680A225E2B40C88B099764D6 X-<~
1,666,224,940 *AF59DAD2C1866C0FB7B976E968C877CFFC2E76B2 X)]!
1,666,224,941 *AF51D90FC2FC4F29A4E6276CAEA67ED455169D64 1hrfernsehsendung
1,666,224,942 *AF5F4B6A2ED507B24B41C165BF64BEE5D5E3B413 1 idyllisisss
1,666,224,943 *AF556368A29B5A1123A24D8B151DD261EE83F5D8 1ilovefriends0
1,666,224,944 *AF50CD4D9A9765A6EB19432AAF5135C8AFEE0CE6 [email protected]
1,666,224,945 *AF5DDB107269A2D65B2D9815A1A5B07E3B1C821E 1KIERTYIVUOTEEN
1,666,224,946 *AF5D5F887D357BEBAFBE268267C942C5813A8D76 X?FN
1,666,224,947 *AF5005AE711450E98AF2C8C2A7029A10C4257DD5 1leikkiaktiviteetit
1,666,224,948 *AF5020210F12D6D79C3F9DECC48EDCB9341A16CF 1.nostalgiefaktor
1,666,224,949 *AF56C2A55A7F7DDE23E88BBA644C12437FB3D5A9 XSJOAA
1,666,224,950 *AF5D1A3AF6772BD4F6989CDC39B7A6078B81C2E9 1olmazsin
1,666,224,951 *AF5D4AEB4148E3ED6F33AB58538FF1CA72016D8A [email protected]
1,666,224,952 *AF59D81157C9F847F2C52F4C25FE27275997C430 XUE.FONG.WONG
1,666,224,953 *AF5617752488912DDB9B46ACE027FB7C594D22BD yadhiraed
1,666,224,954 *AF522ACBEE8DA19E9CF2201A8724DD4AB4229E03 [email protected]
1,666,224,955 *AF54976C6A5A27EB1EDDE1CCAD0D8DFDE267095D YDNARRETSALB
1,666,224,956 *AF561799051CD660C07275BD50AED1340F78A03F 1VISHANN
1,666,224,957 *AF5B84DB9D83CB0C8E52CC04E3C499F9B95EE0C7 1-westerngenre
1,666,224,958 *AF5BCF9C6A817B58AE32844B024DCB920F4A9AC4 YLDYN
1,666,224,959 *AF564238C54685BE13C352EF8FD710F2BF7E0187 ylkhfbg4
1,666,224,960 *AF5E95F63117C65AB946CF0284004EC135049EDA YNNIKSECILA
1,666,224,961 *AF5A426ED812310404964DBD9451C46FD516ABE3 YOICHIRO.MATSUOKA
1,666,224,962 *AF5E72BFDBAB5BF5FB3CFBD94533AB84703510AA YOU-EFF-OH-OLO-JIST
1,666,224,963 *AF5E415F055D73DF2DCEF6EF1F29438BD16ABDC7 2491701 irgendwann-erwischt-es-wohl-jeden-.
1,666,224,964 *AF54DF734CC0CAFE9375A7FF4E74F72ACE6FDE01 YPTBLNIO74
1,666,224,965 *AF545FC96BF7C04A8CE22FD6A26D93F5EDEB233E [email protected]
1,666,224,966 *AF5FDDC8CA0B97DCF4F2C69FEC2DFF8815B21499 2931301 ALUEELLA-ON-OMA-SATAMA-,-JOSSA-ON-20-VENE--PAIKKAA-.
1,666,224,967 *AF5FE156F25F849D9E2F5BFB1EDCBA8A034DC812 YXYYPXKHBOM8
1,666,224,968 *AF5A7DDD239E78821DCAC3D77D606975E55C90A7 2e429e46c5be7eabfb64b0f571256862painhouse
1,666,224,969 *AF57D35CF19DED461AE7C3313D786530CEBB0265 ZACK.BACHOR
1,666,224,970 *AF5D0D07103770EA2198683C7E3F2466DE3146B3 2GENESIACS
1,666,224,971 *AF54C005315AD8108125D25BFC7E51107543914E ZADOJITIED
1,666,224,972 *AF5FF75E830FA38ABCB0DE6CFC0E9BC2FBD5F0B7 zainajalal
1,666,224,973 *AF582D1957090B3E40D541DE5D65FF1E1F20B832 ZARANDEAR
1,666,224,974 *AF5020933572E422CC4EFEDD4C0794F7FA1E7076 2.sirenenalarms
1,666,224,975 *AF5A0791A7DD6EC693FD58C389180FEC5786ABD7 2SIRMACIO
1,666,224,976 *AF520DEA3E2055B86A46BD38F5DDB597D7215A35 zewikush7
1,666,224,977 *AF5755723FB7E656B3579BCB141A799DE6BEDB32 [email protected]
1,666,224,978 *AF5BD61A8DCC1395287C58BCDE502DB44FE46C41 zipball
1,666,224,979 *AF5090A954D6392F85D50030244E18BC0DDF72DE 3ATPMEXE
1,666,224,980 *AF508BD9DFFE709D80A1480EB791110927235FDD 3.COPPERNICUSGYMNASIUMS
1,666,224,981 *AF57E4EA8FA8E41213A0D2CF8F91126FC5B8F121 3hellebarden
1,666,224,982 *AF50F0DE657CC85213A0EA71ED74A839BA0EE484 3MYGABBY
1,666,224,983 *AF5CE745CB2CA2FB687373808F8EC776A1B70FF7 3######).~O.O><
1,666,224,984 *AF57221AD9B90A61C25A0AFEBAE859B38F5EC996 3SAADJIE
1,666,224,985 *AF539F4D40D2166343226C8888B02EE862FE115E ραφιδίν
1,666,224,986 *AF5CA23904C6B406A5F055CECAB19A673A4F387C 3.uyandirmayan
1,666,224,987 *AF5206B28163883958A59B12603A21042819CF82 БЕРКУТ —
1,666,224,988 *AF5B7B03EE10B3F22812D2881AEB7B1E93E31FBB БОЛАНЬО
1,666,224,989 *AF5E0A6F6360865CBF7527368653910AB7657FCB ВСЕ́ТИН
1,666,224,990 *AF5B32FAAEC526FE01BC6DE3AB62AB582140779C 494857 olavi tavast toimi 1300luvun loppuvuosikymmenin
1,666,224,991 *AF571AF1990DCE13904FD750CADC0173096C5C31 4EVIDENTNE
1,666,224,992 *AF58997BD662A244F5B536E90FF039C14897B8A5 4FLOTNET
1,666,224,993 *AF59FAC88715A1E143E5CD21EE671C3A76A6F4CA 4HELLOHOBBIT
1,666,224,994 *AF5EC96BA6EAE17C8C32E5CD1219F2773CD078D3 ЛИШЕНЕВСКИЙ
1,666,224,995 *AF5AA2430DA0DD35639A9105A674AA302FE84696 «ставкоопэкс»
1,666,224,996 *AF59666A3B783D6E2A89AA39469A4FC056DE42C6 4VERVIJFVOUDIGEN
1,666,224,997 *AF5D4A04F8D821EBBDE21CB793366CB2E433369C 516964 SAMOINTOIVOTAANPIIREILT
1,666,224,998 *AF5AF30235FD85250644C441104669E2EB38BA74 54 SUEDOSTASIENS
1,666,224,999 *AF5B4CEE794708CE5B858B4E78DAFA0D226C62D5 5656QWERTY
1,666,225,000 *AF53E181FC009E39FA8D8C6791EBE3E590283364 585201 let the sanctions work
1,666,225,001 *AF505A3D2F8D528F31803BBF4E0614069C081227 5ARVOPAPERIVAELITTAEJAEIN
1,666,225,002 *AF50B87AE4D998B8DAB74534887BBD535ECA5A1E 5BSWWSWATSBSW
1,666,225,003 *AF57B9C9BD78954304691EB0E9B7AB6D0B4CE9D5 5COPYPROTECTED
1,666,225,004 *AF592F7C88A7EC5DBD82F5EDE8135466AEBE6885 5DEBBIEDADDY
1,666,225,005 *AF56654437C73DEAC11EC3193D82531670B58840 5ECNEUQESNRETTAP
1,666,225,006 *AF5A4F2F4AED169EC9B56A5FFE1C8CF4F62CEB6F 5EMOTIOMETABOLIC
1,666,225,007 *AF5114368899CD5A299B8D0DC3F01CAB1E5BC58E 5SCREWDBSW
1,666,225,008 *AF5F34F15F12F7BA703E978D0D146BF918B56858 5T44T5D13N5
1,666,225,009 *AF50E762DD823D134517E19737ABDF85C28597D9 5TNEIAREYARBED
1,666,225,010 *AF597F3F387F73F1679F6CD5C4EB5503E00C143D 5-WOLLENS
1,666,225,011 *AF5AA3E571F4C4C986863982EBA7CF44FAB439DC 60Å,比Β
1,666,225,012 *AF55B450C8E605A7795C87412DF14F8513442E37 658820 AINA , KUN OLET EP
1,666,225,013 *AF587314DAC44700A520D864E17035F1707D8069 6BINDTOUWEN
1,666,225,014 *AF5F62E9F3A78A9E42C3677718A59BCD726CDA3D 6NADAHANADAHA
1,666,225,015 *AF50B7BA54B0E509291A2E76092B3B8D1EC388C8 6OTSLEFAW
1,666,225,016 *AF5076407B113F1D08A38FB25198971BA67EB6DC 6PARKERCAESAR
1,666,225,017 *AF57579E86F99460FD373C48F7B9F59C6AEE8565 6PRAARTHITENA
1,666,225,018 *AF5DF53E299F9DC3B73B5464239F64BBF0E08E32 6REBELSCHINA
1,666,225,019 *AF57F283FB8DC9DF82737585DE1B339DFE79FDE6 6THERESABILBO
1,666,225,020 *AF57EF0037F17F20258116236C70A525BBA0EFF2 [email protected]
1,666,225,021 *AF588062F6CF4A62E3DF84B18EB5A943D4C16687 078.-kapitel
1,666,225,022 *AF505C109E03F98EB96898511D2B2A9C1696E10F (^_~) [email protected]==b
1,666,225,023 *AF58B1E2620CE88A37E1D0CDF14F51732D8951E4 (_0) ~` ~` dP
1,666,225,024 *AF51281FF13BDE5F040A3B0CED46308A1E9F32B9 7DKHKAFER
1,666,225,025 *AF544AD9DFFD77C4A085F91AAD918EFB6503E009 7HARDTOENUME
1,666,225,026 *AF5506B9FBF072CF32FC3B388BD19BB1BD285A0C 1372013 lis
1,666,225,027 *AF5931235F2B2A5607268E995D5AA0B2D065A2AB 7NAGLASCA
1,666,225,028 *AF527E6EE66E9048F60145B34C72B8611C476F14 7NICKGEORGE
1,666,225,029 *AF5EBF422E62CE6D543ACE89F58CCA8DAD08F6A0 1479616 cros-shareholders-are-expected-to-clear-the-plan-today-.
1,666,225,030 *AF591DD1D6D5BB49BFEB59C0A5807439E09D747F 1486164 LEENAN KOTISIVUT TERVETULOA LEENAN KOTISIVUILLE
1,666,225,031 *AF5F17C845461AB8197ECF4D69E4EE4E506427A8 1501530 TUTKINNON-SUORITTANEET-VOIVAT-TY
1,666,225,032 *AF53FE9853762A4035B697CDC54437B56A0A83D4 1545931 SALPA-RAKENNUTTAJATOYVASTASIVALITUKSEEN
1,666,225,033 *AF578CEE401EAD4D4CE5F397830D5415AF86910D 1596214 rakennuksista , koneista ja kalustosta sek
1,666,225,034 *AF5EDFADA10255C72BE365CF75C6FD46F5D3CC3B 15 ABZUFRAGEN
1,666,225,035 *AF5B58F15E57D808B8167E851D204857AEF4F13A 1849892 hakijoiden.joukossa.oli.kyll
1,666,225,036 *AF5C251C4F43840F7B16044CDD740C09C1AF05F7 869697 hayaldeileriyedogrugider.
1,666,225,037 *AF55CAFEAE09733D4D885C875B16C06FE674A96E 86ECA0E40E3939F5BF005256D7CFDF04
1,666,225,038 *AF5D8583A1FF5EEFAE00EEBDAB5BBCC868BDEA35 1.BODIDDLEYRYTMIN
1,666,225,039 *AF59C29202B7EFDE305BEB6438FAA8AE7F8760CA 1 butenbremerfest
1,666,225,040 *AF502AA8EC154901F37DEF992EC2A38C363FB4DF 8BSWINCURIOSIBSW
1,666,225,041 *AF5C441E4FD00285C01576D92C042CB1B0EF03FD 1CURETSES
1,666,225,042 *AF58CA65ABF99C48671B9E358CC6F3352BF9BBD9 1DESCENTH
1,666,225,043 *AF5E6CF6C1DEABB4BF3F9966FDACC4D483FFA4D5 1DNUFREDN
1,666,225,044 *AF55ABBF63C05FFA0D9C4679A646B473C7AB8CC2 8DRIBLLEB
1,666,225,045 *AF52A920CB4E0B725E0734A6FACAA947CC4C567B 1.ergebnissystem
1,666,225,046 *AF554FA428040168C655E7CA701AD95C621CAE48 8ENGENDRURE
1,666,225,047 *AF59C4E93C247D2125F430E1AF6026E1C56E46E0 1-GRUNDBESITZ-INVESTMENTGESELLSCHAFT
1,666,225,048 *AF5C12FE18F2FD356D58BC78F9BDC5C772B3067C 1-heizroehre
1,666,225,049 *AF5C12C13AEFA89FBD536E69492962312AA18AE9 1invalideilta
1,666,225,050 *AF55F0B4F92885D53E1C17C510D608C38BD77799 8OPGECOMMANDEERDEN
1,666,225,051 *AF5EB219EE00A1320EE31F49ED377979677EAA0A 8STEROIDPRPARATERS
1,666,225,052 *AF54202B51830B75B0B2E40D1632646B03E72F3E 1-PAPASLAR
1,666,225,053 *AF54D1AEE944D42B9CC0444BE922E036F5B5F203 1PASSIONTHE
1,666,225,054 *AF5DC406C1A93CEA1ADF95997081389721EAE509 8TILFAELDIGHEDERS
1,666,225,055 *AF5D880622CB3C69063A480F1AAB86D10A5680A7 1.PLEITEN-SAISON
1,666,225,056 *AF5E59222001E4F7F81E3A2743F7E5F3E510CA3B 8VERKALKULIEREND
1,666,225,057 *AF58CA48B857D3F6ECDDCE377877256121B8E239 1PSAMUEL
1,666,225,058 *AF5BC3D25770FE074803B3B4B456FC17EF47F77A 917715 ITSE.OLTUANI.MERELL
1,666,225,059 *AF5F89AC5BE4EFDA3AC69669FF91E69B7A91195C 930EMMALEE
1,666,225,060 *AF53C2B33A5938788830375CAD536F82B5DE8E43 1SEGUIRAS
1,666,225,061 *AF5301631551D3BE2920FB2BB14AA14EEC4767A8 966LESLY
1,666,225,062 *AF506C0968DAD6D3F2FBC86442E369748BA25285 1.SHUNJI
1,666,225,063 *AF593BD2BFEA81A73DC915DBEC4458A755C87899 1.TALLIM
1,666,225,064 *AF593979F004D88114433C0B2A0553ACDF73E3FE 1.tietorakenteissa
1,666,225,065 *AF5871951FD6A5270C860DF464FA8F8A3B58E094 9CENTERFAX
1,666,225,066 *AF51CD4B6AADD541E1A193493708B03547AAA775 1TROUVERE
1,666,225,067 *AF590908907E558EC8A7EBD667EA9F0EC0096A8B 1.umpimessinki
1,666,225,068 *AF5BEC7677DB501679D4D0F44E989411C93225E4 1VNTVMNT
1,666,225,069 *AF5018666A554A07723916D8607EBB71545BB4FD 1 YKSIL
1,666,225,070 *AF57AD543A47F76DC072D2F94C5EE407FB70E351 9KUBRUSLY
1,666,225,071 *AF57ACDEE4A012E261F6B5DF80E6AD9F8A3EF140 9LANCIATRICE
1,666,225,072 *AF5D18F58E063092FA2F0B827671A777B289918A 2224688 revenue-edged-down-to-$277-billion-from-$286-billion-
1,666,225,073 *AF52C1827E328D91A8C67522EF65D78782411F65 2301569 BODEN,PITE
1,666,225,074 *AF5920EC52B3E07A9CF242B119370309067A368C 252797 VERTAILEVAN.L
1,666,225,075 *AF5E4B2F994D70C62853A4FCBB9463386895FB5E 286004 OHJAAJAT OVAT V
1,666,225,076 *AF545D55D115957AF9F9F042B1C3C4168D483155 286464 erityisopetuksen.ja.-kasvatuksen.muu.kehitt
1,666,225,077 *AF57C7C26F64AA0AAAA6F5E04A14C6A1DDDF898C 288902 ampui kohta kolmannenki : k
1,666,225,078 *AF573573907ADF904E2E96FC75BB3D0E8511FFBC A113G0R!S7S
1,666,225,079 *AF5FBF62390F6BD90DB17C292BE64E55A353739F [email protected]
1,666,225,080 *AF5DB61CFEE3EF9012506A29D0E9C82C566823B5 A2P/-
1,666,225,081 *AF58EC96B36F50692DB5696EC72E0AF21862808F 2 CZISCH
1,666,225,082 *AF5A6F24F5AD577375D18E4CA19D0DB104D7F372 2DUSENBERY
1,666,225,083 *AF5590F84DB1F857C9819E2DB5A8662070A6A563 a;&58
1,666,225,084 *AF5973558EACD0001DEE15C66DAEFC975E6CD1E2 a;5dw
1,666,225,085 *AF5385390EEF830339B68619FBCC67207030ACB1 A6P&-
1,666,225,086 *AF55EF27EBCB9C2F0CB3F5FDEEDCDDDD634E0A45 aa3160
1,666,225,087 *AF5C3F5B54BD9307CE0452F6A81E94F7D812B0AF 2.SUURJ
1,666,225,088 *AF577075BC7CCA2F9AC62A9CA4D702166956ABC0 2THEEPOTTEN
1,666,225,089 *AF553339551A57CBFBD84996235D92F93396BF72 aab<1}
1,666,225,090 *AF5F1BFCAE98CEB268B8EFB2A766974D9A43CB8E [email protected]~0~ouu
1,666,225,091 *AF5BAB3D78FBC4E4A55E80C4F8F28D4678DBA888 324810 theelectriciandiedintheblast
1,666,225,092 *AF54F6732184F21755359926E5F1A313FE9B434C aab+r
1,666,225,093 *AF58A0BDA9F8ABC1C8EBD6CBDF960C3778F1D61D 3AHILOVOJ
1,666,225,094 *AF514AB0F7BF063B3B30AA960C4A4F476CFBCA7C 3 BUNDESTOPF
1,666,225,095 *AF543504A279CA237881A751705D9BAD42EF8B06 3INACHTEN
1,666,225,096 *AF5E7A21D69778F263C4549C82A63097EA77CB0D aa=x*
1,666,225,097 *AF547A97405496129C7F67FC0EC7A537B022E580 3-molicki
1,666,225,098 *AF5EE98DAD25CA127C15B3F87A4927EA528EE93D 3nqjda
1,666,225,099 *AF51052571E862E3655C7DAC4585FFCD3C9C6C63 abstr9
1,666,225,100 *AF5C7190D30B3B474B20F3D85B5D34E678DF044B ACCEPTLOCALES3
1,666,225,101 *AF5A85CC0D8E7A398B1BBE07AFDDAF5CDB6E3573 a_cnk
1,666,225,102 *AF5C4AEDFD21CFBBD6641E7D83C9F3493D6D3F7B 4IAMMIDWAY9
1,666,225,103 *AF571D52F8A1436914503679F28BC96681F0E0BA 4MYJOY6
1,666,225,104 *AF568CDB5A4EC60148D4E076764A0DF1E3B33036 AEB#6
1,666,225,105 *AF5DD90921AE88833EF39AF56E25C3A742E4D5A0 AFEWSK
1,666,225,106 *AF5BA3D7BD2B842CABDAA614E7DFEECE2ECD8788 4.vernehmungsrunde
1,666,225,107 *AF58BCEF01408695DF8DF15E480A822202F2C1CA 4WSZECHSWIATA
1,666,225,108 *AF56FB795201B075892D5A6CCF651E318D7E30DB afy3r
1,666,225,109 *AF5641094DD17D6AF362108BAC345FE8DB93B3D8 518JORDYN
1,666,225,110 *AF5B63BC4F32189669E733367B63920FBD98ADDB 54LT34RT3145
1,666,225,111 *AF59C1879D5D48ADB8E06B65FDEAC7B5F9D44D98 55c12de9a238ad8adaf61a95c567c88cdulieu
1,666,225,112 *AF59A8D9F46987092D54C7457696582673494448 566674 bu-mUddet-beS-seneden-aSaGI-olmaz-
1,666,225,113 *AF5BA96E9DF8D96602333D5167BCE09C3F36D497 AGONIJA6
1,666,225,114 *AF5B6EAFF2EB0C133D2AC23157B731F00CC68C7F AGQUCHE
1,666,225,115 *AF507C255D092A0AC2A59EF2D8477809461FBA73 599c0f46432431b4b4d13ef4d14cf533
1,666,225,116 *AF5A52168E7348AD46DA4A4A2E9A67118D0FE2FD AĞZIMAK
1,666,225,117 *AF59D4887A48571A1AF34D49C7EF771012D56AB8 [email protected]!Z!NG
1,666,225,118 *AF5715D2549B1DDB33A07CBEA5AD3CCB41AE1C0F AIN'T-NOBODY-HOME-BUT-ME
1,666,225,119 *AF517FD1BA8824193CE71957802BC0EAFC842934 5GOFORITMARIO
1,666,225,120 *AF56B94A51BED32EA75A1ED765E3CF9E0DB6A2E7 AJETNUTA9
1,666,225,121 *AF5A741BC10DBD6A7ADEEDF42E9C5690406A32DC 5MINUETSFORORCHESTRAINCMAJOR,K448A/461NO1:MINUETTE&TRIO
1,666,225,122 *AF5514D8DE2052EE4243337C7B6E596E4E12E35C AkqN
1,666,225,123 *AF51A779877F47FA30BFB79A916C2A9D28D5BF56 akyom
1,666,225,124 *AF5C4BE8B8B0442378DBA5BE9EE655B41027B32D 5SIARECACID
1,666,225,125 *AF53A2F2008DC9BF6C30A4CF991100C01C76B4A6 alexisinocencio
1,666,225,126 *AF5C7476F9C37D624FA5DEF91BE47B634F01FFF0 5WESTERNALEXANDE
1,666,225,127 *AF55FBD55C58807632B7E50C42608E6363AE45ED 5W!NG3R5
1,666,225,128 *AF5CE3640B1A8810401E16CC5D89D50728A6BFDB 6+
1,666,225,129 *AF5064EACCAA15FE317E56F1CB2652F37198CC8B ALLTHINGS,FORESTS
1,666,225,130 *AF583C53E1CED24E0C0DF84BE5E5DBCCA70D43F7 ALONZOPROBST
1,666,225,131 *AF52EACB2172A14CC1F418127E097B0CCBDBBB3D alphonsohedrix
1,666,225,132 *AF5621203254DADA10D900185969422DF6D8FFC9 6BOOGERHORIZON
1,666,225,133 *AF50287E578BAD13BBBF9756F7421AD23BB53F86 ALU
1,666,225,134 *AF58FBEAA04638B39946570C50F1FFD746E4DB41 AMBERDIGEROLAMO
1,666,225,135 *AF56E5409498DA6B828FB03B51DE85270924EE8A amgdh
1,666,225,136 *AF53E2ED15442CDD73E1E9945B0A9304F2D49264 AMMEBSWS
1,666,225,137 *AF51235E8D4EE09FE13D6B321354F0256FA50059 AMORPHES.GESCHEHEN
1,666,225,138 *AF55F4D0CE05F6C4C12300B5816ABA434A2148A5 6iloveplato5
1,666,225,139 *AF53F2273DFDAD2BFF7300ABA614A5A2EB40CFD2 6INSULANT
1,666,225,140 *AF51C57761EE73F9F14F524C49B4C8C68C7FAC2D A/N/
1,666,225,141 *AF5D7135950E1701E05A675C1C13B55934D4101B 6MARINODIRECTOR
1,666,225,142 *AF5F4CE58B9347AF3F571BD1A8EF8F65C828E7A8 anasccur5
1,666,225,143 *AF5218A1DA7112B5F29E10406B988A5BEFA6BCEE 6mydriver2
1,666,225,144 *AF5A4C120185E7312C11C9D463C2E748D7CF62C0 anemptychair(take2,3+4)(vocal:roycash)
1,666,225,145 *AF58A4BCD89A27D7011F0189A14D39D907004B5C [email protected]
1,666,225,146 *AF5AB2F3C8217E95050F9BF187F595A07D8AB49B antonhollering
1,666,225,147 *AF57E546F4978B52D791DED6CEBF20526B83A635 7ALLEBAS
1,666,225,148 *AF56E4D48FE203473FBD82108F4DFBB9FFF8D18A A&P8D
1,666,225,149 *AF53BA0CC87248B1F752C5D8E7735565D05CAAE2 7INGENIRSEKVENSERNE
1,666,225,150 *AF58134F203186D11FB87F75561F20C0338D8E04 aq.my
1,666,225,151 *AF5C2805174B93E5392A42AD9995DFFCA15ADA18 ARCHIE.TAKAGI
1,666,225,152 *AF5D8A008719589597CA631A9FA6517F5DE7294F 7POOKIEBEAVIS
1,666,225,153 *AF552EF5482840681D475428238340B94769E6AE 7SNOOPDOGCUTIE
1,666,225,154 *AF54BA72E32728BC6B5F2E8256961CF30D492BB6 ARNULFO.TALSMA
1,666,225,155 *AF548B44098C94365B13581ECCDB935F7236CF77 7SPIGONARDO
1,666,225,156 *AF5E5BE5F3D604E051C63030CA7D1C338C6B9523 A%_RR
1,666,225,157 *AF5E160526E589D5AAE1691819AC6CD50C2F5BAE 7VALHALLAWINDOWS
1,666,225,158 *AF5957FB3DFAD57F51854FF916FC00654A95DAE9 7WONDRYNG
1,666,225,159 *AF5F4171329AB04E8435FF1F6EE45C810977228B AS0AL
1,666,225,160 *AF5E739DB065BD922C50FCD9CE815FD42BFBE35B 8AANIAANI
1,666,225,161 *AF5D1512B803F593DD469EE0F86DF59BE6FD6951 8ACURAREDSKIN
1,666,225,162 *AF5D613DB081BF767707C6E4F3A5649C0C12F339 8B.~0~o}8{
1,666,225,163 *AF53F726542F7725BA86F7AB49B26371E540F08E 8desherberions
1,666,225,164 *AF5000089203C9771DA9C8373D6170734B278D18 8HLUPCOVYM
1,666,225,165 *AF56809B4B93B80780492E117724CAFD54601A0A AU3e
1,666,225,166 *AF512B4A1263B4A10BC2BCA428B32027F4DA2A80 AUAEP
1,666,225,167 *AF51C73A8E5DA9C02ADB5FA0985CE680AFE432E4 8ISTRATIV
1,666,225,168 *AF5908348CCC10D7E73E28B58C8BBE2C1A2D7132 [email protected]
1,666,225,169 *AF51BF10E0846E8FD7D898E006845418123F3EBB 8NEWPASSZXCVBNM
1,666,225,170 *AF584B02513D5C0954A426D98466B186618F7D15 [email protected]
1,666,225,171 *AF50A6E5600B4908162C5EA9FE26897FE869283F AUSTERLIEM
1,666,225,172 *AF575C4A6E24ED21F8BC304A250992AF4F526400 8PLNMLLR
1,666,225,173 *AF595B2D3AA314D81D9ED888EFC78C5221B94726 AV6Y
1,666,225,174 *AF5E6034018E33FE09B427F2AA11D26CE73A1BB2 avfp
1,666,225,175 *AF5A35E25BB0D2C7FB6115E92A9AE27D929817D6 9ACCEPTABILITET
1,666,225,176 *AF5BC46CA93AC6AACA97EB2B4B4DACBC870A32F0 aznagarb
1,666,225,177 *AF53F08C61463B2D79478ED7B394FB34C8AC6FF6 b###) ~(>_<)
1,666,225,178 *AF56B77E8F1D957E9F7E0E00F5A95022DCB49F4F 9beklopte
1,666,225,179 *AF53B39C9DFCF2A8796DB3E8213D2791A3A3CE41 9CONTIENDRONS
1,666,225,180 *AF54774E5D60D890E867D7A4F76CE7D765EDEF9F 9DUKESUPER
1,666,225,181 *AF5C1DAA8DEA033A4AB6DC1A604F0BC6C80BE404 9EDITORPHILOBIBLISTPRINTERPROCHEIN
1,666,225,182 *AF5E7D4C05B5F222C477B29987E2752F529A47ED B"2ZW
1,666,225,183 *AF550860B60E444953A8EA3BA4E667E09632FFC6 9MYLOREN8
1,666,225,184 *AF551257E6768CFE72BFF0DCC23D87304CDAC280 9SNIPERCHIPPER
1,666,225,185 *AF5460698390273C2625BAEB91D5A4CEAD9AF600 baiyangcun
1,666,225,186 *AF55DBA9328ECB52C6885BE57C0BBCE7D1B22148 BANANASTEXAS
1,666,225,187 *AF59A5B5C2016B5E53DE7D1A148592E5E47F67D0 barrackens
1,666,225,188 *AF5364720D71F749C11646464DD325C73D614D7E barretthammett
1,666,225,189 *AF50938EDB1AE686F0736FA0D43BA74CAEEB6017 A17s
1,666,225,190 *AF5A18BE2BE798C3E2B8B12D0A231C232190FA35 basillobner
1,666,225,191 *AF5A233D8AB533E0E6BDA7342344B56B0D680ED3 a"1ow
1,666,225,192 *AF550C9EBDC4EA7191854DBFC79D917627473F60 bb/?3
1,666,225,193 *AF5545C910770901D4D1D6D4D5963F0CB45AA0BA a4e((
1,666,225,194 *AF54A6B15EB6E23E50F1016B3C6D3B16C72C23AB BBLUE5
1,666,225,195 *AF564DD209464D3C7444CD64744875EAD8F20A8F bensonyamaha
1,666,225,196 *AF5CCBE1405146FA5443DCB78CA69FBE090A0998 a-a:i
1,666,225,197 *AF54EA586774487E0C554B2494F0DCFBF8874AA3 bernardtillberry
1,666,225,198 *AF549E1A96E38AD298AF5C0A9C98F9BDAF21846D BERNIE'SBLUES(30SECONDVERSION)
1,666,225,199 *AF5F13BB5DB15EA05430C30BA5EC7EC34D7B5744 berun
1,666,225,200 *AF53D02A79A6215E3BF4A64F4B98982FA4FE5066 B$F7W
1,666,225,201 *AF5351D81161EDB8E3CC577AC1EE72427A392B94 BFE3D
1,666,225,202 *AF5D2D8264F00B0E0505C99056E4529A39B99DC7 Bg??
1,666,225,203 *AF5556CC849B8F7487BC1FDE078264D6124EE1AB ACILPIRTS
1,666,225,204 *AF5D039D56210BF5707D76EAFA18897582F2F3CD bkd4
1,666,225,205 *AF5E0640AD8D8E93BABEDF6CF89AF919EADB2039 ad|u]
1,666,225,206 *AF50AF4F63EADC627469227E4045F6EA1239836F BMH3D
1,666,225,207 *AF553D3C823ED284AA35D3B044C6CD71A69D0F09 A)G5D
1,666,225,208 *AF54968C783F06D9C7042A688EAE6C7F234FD7AB AH?KI
1,666,225,209 *AF584E437EAE9F3739461AAD66FE4394734DF05B boyhacker3
1,666,225,210 *AF5F1C9BE6B4978312FCDA1383B026D1B92EFC9E AINE RODGERS
1,666,225,211 *AF597180329020FAE647B613F0C92B8F5B141CED BP!CU
1,666,225,212 *AF56B7328B89C8F14BB62B7DD875E36D0478E91B brainfail
1,666,225,213 *AF56F36800E69AFC81CB5A3CEC2109A2419E894C BRENNABEAR
1,666,225,214 *AF5527B902AC6868FBC3B770CD612FDDD94B1DA2 BRIDGESALEX1
1,666,225,215 *AF5A6BA6C71471DFFC1A0D75D3D18751097BF812 Alkm
1,666,225,216 *AF531F3FDACE5DED4572A5CAA396FFEE651EC203 BRUNOMUSUMBA
1,666,225,217 *AF5CE5C5ADE2022808D0FA99DA3E222CE654CCBC BRYANTVOILES
1,666,225,218 *AF537913C7182C786445E80B8782B5FF71B9403D bsfm-
1,666,225,219 *AF542DE69ADA3723CD962E7DF08525D02754605D ALZATER8
1,666,225,220 *AF59CD58D8B0ECF432A2A824FCAF9481FC7773F6 am2+r
1,666,225,221 *AF576F7C752B0168ECE42E7248B568F99C8A5684 AMARKAR
1,666,225,222 *AF58A8A3DB6AD03253A83695A16BDDF032B3815A A-MERC
1,666,225,223 *AF5665ECB0C9C048AFB94B106DFEE1CCDA157A1A BUMBLER
1,666,225,224 *AF53EE1C8B2BB1A1F7B7A7637EC17F2FA7F0F6C4 BURTNISKANEN
1,666,225,225 *AF52A00DCC2567B3FED924BC7F0F7709911EACFF burtonhilts
1,666,225,226 *AF515E2A0828CCCA4EA81FCCC6E7AC992B20D629 BURTPEZEZ
1,666,225,227 *AF56CB99B53468DDA94A6852C74633BA11B8AC75 anb$e
1,666,225,228 *AF5644B6054606BD4D0A05A9146B31920C7126D6 bvqgg
1,666,225,229 *AF5C76BEB1FCE00023C5CD85F313B3502FAEBD5C a/ns
1,666,225,230 *AF57043657DF56DB8E2D7DF2B405CA0BBCA3DFB2 ANTHONY.STEFFENSON
1,666,225,231 *AF507CE84DA714290F1D53CAD0EA65EF88BF4D42 anton.tsvetkov
1,666,225,232 *AF507B23D41AABF374D672DD7174B3DECD0D6D4D ANTON.VEREN
1,666,225,233 *AF534D823922AF9E35B8124469D3207BC79BB12D C1100-1160
1,666,225,234 *AF58AA78C029F1F4358FDD2408C1525FA656D7E1 c".2f
1,666,225,235 *AF5083A95438EC27815F5DCE6DC4643F37F6ACB4 c5.+h
1,666,225,236 *AF5F1FC9B30EB82424A2135EE7341E1B88BDB27A ARCHIE.IBANEZ
1,666,225,237 *AF53C32E2F90B77C625B59B15A61D2F7E0E0D518 AREA METROPOLITANA DE TEGUSIGALPA Y COMAYAGUELA
1,666,225,238 *AF554FAC650C9B7FF66F5834F8B13C885A829D08 ARISTOBULODESAMBIGUACI
1,666,225,239 *AF5C7581FB19926757681DA49A21CBFC5A8D9C6C ARMANDHAMOR
1,666,225,240 *AF565359926245901E46DC34EF0F3EB7487A0166 ar?mn
1,666,225,241 *AF53A4785D121B6FED91B9FAB4E7E1038D48FAB4 captivatrix5
1,666,225,242 *AF54068CA7A03521C100597B53A3C3620B19A890 ARRABAL2
1,666,225,243 *AF5FF45C67FBFF63FC70369DA7C5402D0DA4BB9F careynuetzman
1,666,225,244 *AF59A424DE31573C9E80F4734A363A4E24A94CB4 carlos-suriel
1,666,225,245 *AF528FB22470E4B1490E7280B0258B26556B3097 carltonbodah
1,666,225,246 *AF506C65FE4A348253070B7ACBC2BE38AD8AE8EA aruna-raj
1,666,225,247 *AF5B147DFDBD5AF4771DF7739D0A7355F12910DE ARVP%
1,666,225,248 *AF55C9BE3D6017E44E129610C270FB2CE3DBA183 ASA.LAURENZANO
1,666,225,249 *AF5394F18F14B618BF3B7145B26DA5889E55DC27 ASGHARRAHMAN
1,666,225,250 *AF54B0F8B42FB1BBA49C13855AAA443289DBC012 ashishgoenka
1,666,225,251 *AF5C4D552006FC6372D8A2CA2FB0548A80D48260 ASHLEY.TASSEY
1,666,225,252 *AF5966FB72C0B9C381C4625283236EB603157852 ASHLEYZAVALA
1,666,225,253 *AF56F605FF9336197171FB99C57A8FE350CA35F1 CastlesofSpain:VI.Siguenza(Lainfantinaduerma)
1,666,225,254 *AF5C41A9A26879C6A62744FCDE4380D1C3078FE8 c,azl
1,666,225,255 *AF59E8BCC94E3A5F904DAB6E6BF7FCFBEAD4E107 cceusydeduauwww
1,666,225,256 *AF5C57D69D43CE812DA6A44A90E18F56A3287593 at.the.rose.cotillion
1,666,225,257 *AF50939A1D5AD90C2028CD55516B3A0CAA5DAFA1 CD/5Y
1,666,225,258 *AF5603AB3D728F26246800DD41EEEB1BBA8A7440 australian–us
1,666,225,259 *AF50AB2C4B1ACDB3AD7695F06D8812259A71221A a:vf
1,666,225,260 *AF5784A3F1A802CBF00FC5F0636D6670BD361B2A AVW.G
1,666,225,261 *AF526F3EDB6D994233443963A7A65B467C7BEC01 AWG!J
1,666,225,262 *AF59FD63D3291B5618336C307B7AE67B230A9362 ayustuk7
1,666,225,263 *AF51EC3B42A45DA4AAD81480A85A6BC3137D63C7 b01r/
1,666,225,264 *AF5A94AADD2B5E58A5663F8154B66DC727ED5CB5 CHARLEYWHILDEN
1,666,225,265 *AF5C46D5F1611689FF215DE3CCFFD136B6039F6C CHARLIEAPSEY
1,666,225,266 *AF59A9FB14219F1C1EF49AB54B67D2F881EAC037 B1824
1,666,225,267 *AF5B1673688D7C53EDACDCAB91A136B46010A15D b1g7h
1,666,225,268 *AF5F17245505B1EE6F73BC427AD3F973E1A3F838 B3;B?
1,666,225,269 *AF5B39CED4CBD0B48D84FC656C2C4DB0EC3FCCAD B4710N
1,666,225,270 *AF5347E457347E6BC9385EECF3E93547CA927D4B CHF$L
1,666,225,271 *AF5F748587DCAA9458A55562C0E827CE1B7F0048 B7H:S
1,666,225,272 *AF586B6CEE8F725FB6D49F95A09B709A5232D80C CHONG.MCCANLESS
1,666,225,273 *AF552407164C9E67601CBA992553FA42A8063E3E CHONG.ZUCH
1,666,225,274 *AF5EACD6E14641C2146C02E924F4CC9E982441A7 B9,RK
1,666,225,275 *AF5FA688216692C1D833890A0625F6F198858673 CHRISTOPHERB
1,666,225,276 *AF55FD89F38B0F1CC6B52A48CDE723538A231384 [email protected]
1,666,225,277 *AF51BA4E5EADB51EEDEAAE37DFC1428F1ABF235A CHUTINGVING
1,666,225,278 *AF56FF4404A5F492E7A33DF6E48193DC5818682C CIF)K
1,666,225,279 *AF5DC3B7179A04E0FB646D01D7861970318B206E B-D~0~O>-<
1,666,225,280 *AF5C71DCB38034B4386036E8086D1C4746B7CE7B BDEGARCIA
1,666,225,281 *AF5F295FB8E7BAEAD40E647DEFFE80DF54D245A4 b!dxc
1,666,225,282 *AF52CFD226C6882EC4E39865F90F5BC654D186B8 belltower.5
1,666,225,283 *AF5C46041C4760D0D6DCD3D1CF19E5EFF8068DA6 benutz'.mich
1,666,225,284 *AF5C80FE30C1C1D6B36D3C1B99FA81E05FDB5C32 bernatbo
1,666,225,285 *AF5634971967D936DCEDE8000913AA5EE12B99F1 !BERTRAM
1,666,225,286 *AF55CBCEF6E8B6A28018BC67111CA1F75AC6A9AD COMMENSURA1ON
1,666,225,287 *AF5F0B6A90DCE8A802D841C4587DAD72F81119D0 complexity
1,666,225,288 *AF5965DE73C9B2A91E383F618D4A15D219C89202 CONCERTOFORVIOLINANDORCHESTRAINCMAJOROP4NO7:ILARGO-ALLEGRO
1,666,225,289 *AF595BF26752FEB1CF64D954AE1AFF4CCDF335EC concubitus9
1,666,225,290 *AF5A69D31B4BF94D430407167881A6F53D39B7B0 BIBELLEXICON
1,666,225,291 *AF58B8B555ABBCFF3ECA30C2DF5B7102733CDA60 billouin
1,666,225,292 *AF5A4E9D1189BFFE7C800424170BBBC4600931C3 costocentral
1,666,225,293 *AF5EBC853BBA2DD5F751B5EEC3BF60C5D66B7DA9 CPRDCTNSING
1,666,225,294 *AF5B60AB84EC99795F61DDBFD408F31800CA0AFB blairstrieter
1,666,225,295 *AF588A5F1CCA686F3EF3258CBB8FA9C14AF0E97E C&Q,N
1,666,225,296 *AF5F73E0CB8E767AC627CE607FE81598592CE2B4 crhd!
1,666,225,297 *AF5449EF561E8CC775E1B4842866CD84F951E007 cristopherdunworth
1,666,225,298 *AF5CB5E4C75F5048D2B9E08C8FA55C3FFE10B3E4 CRL=L
1,666,225,299 *AF551927F2423DDE04477A6EAEDD5F702FE59C17 b&n6
1,666,225,300 *AF560F257BDB2DBED7FAEEBD4CCA78CC0B36E858 bo;hb
1,666,225,301 *AF5ABC38BD9A06BAE3479703C83153F8EA61A3D7 C.URBAN
1,666,225,302 *AF554D19FF5DF03B966BB79782D71EC040F98BBB BORISYORIO
1,666,225,303 *AF572D016CD50EAD94F2563B829804348CA0C671 [email protected]
1,666,225,304 *AF5661210D3E79E7427312255EC9875D2D3551D5 BOYCETYGER
1,666,225,305 *AF55F6A9DE2FEC1691C8DBE326DE7A87D9E60A84 cvdetail
1,666,225,306 *AF5662CA6FF9F422B4E68F3DC3617156EFF67C09 cykiu
1,666,225,307 *AF5F2BC4073111FBE2E5A8CDC06FA8B5BB3F8D18 BRIANBISBY
1,666,225,308 *AF5050FA21B8FA0B8EB6B08AFC2240F9ABB7037B D3IDC
1,666,225,309 *AF528641F45B32DF773407B21DCA16A8CA26862B d95hs
1,666,225,310 *AF5D9A7AEC377C8AAA949BF8F93D9D18044BDDFC bsm!&
1,666,225,311 *AF50AFC9B95B2DF207ACC80378E4ACBFC6DD5EE5 ?daaa
1,666,225,312 *AF5D2CC4AFA223ECD6179742628F259A49C08F26 BT2YP
1,666,225,313 *AF5DEBBF985C5964C8A4AE9B29DBCBABF49C705C DALU
1,666,225,314 *AF5A53744B4B279BE0C9ACA47447FDCC8F424EF9 buzfo
1,666,225,315 *AF52C0ED4CE7280CC89C620DE5FD05116805B715 bve5f
1,666,225,316 *AF58C83253910AB2A046DB16ABDD09A844DA9C2D BV)VU
1,666,225,317 *AF55C7B5C943E270866809FA7755862933B02C8A davidwolpe
1,666,225,318 *AF5686A4AED3094E03BA1C123424F401361047A4 DBV3G
1,666,225,319 *AF561BFC816AC0924DADAA9AEA8C3E974D24DD88 de)$5
1,666,225,320 *AF549D3A5A6983ED168EF4EAA1805E36D7A736CA c6gi%
1,666,225,321 *AF5A106E0BD3DF3FA7CC822B15893A5A8288AA12 [email protected]
1,666,225,322 *AF596BA5BC18662103DD34A285428B76513819E6 CABLECHAN3
1,666,225,323 *AF595011C6305DE0B5A4C2C9143C545BC12D0C4D denaolson
1,666,225,324 *AF5F5766204FB170EB8C4A38EC0B3BAC8B0E0604 deplessis8
1,666,225,325 *AF54567D39AD658FC4720920574593D47EB05D68 DER-HANDKUSS---DVLILIENCRON
1,666,225,326 *AF59BA1251FE6556340DB35D40D3848A822194DD DERICKKNOCH
1,666,225,327 *AF5E8B8BCCB1F3E99845C9E4FB04D52E6F981135 DESCRIPTIONWHARLECH
1,666,225,328 *AF589D6AB8FF56A9CF8A30134A3F8808D1336A93 deshawnkuchel
1,666,225,329 *AF58F90511E69F4CA1E526CEBBF5B7014E0C80E9 career: 1952-1988 (disc 1: trumpeter)
1,666,225,330 *AF5429EFD067D06C675C521A9C4145BF52617039 D;eV
1,666,225,331 *AF5CA05E58176A4330BF28AA9224C91CF011B15C CARROL.THURRELL
1,666,225,332 *AF53CAD4D9D122229BA004E4206767386B598205 CARSONSHERFIELD
1,666,225,333 *AF525CF496B22DEFA465F7E3EAB70A25CC6E8398 caseyheinold
1,666,225,334 *AF558D5BD41D3664AD466014213614D2386B0E44 CATRIONA ROSE
1,666,225,335 *AF537D3F211C810493E7C00CE59C3E4362101454 dgj:
1,666,225,336 *AF5F6FF920DF0B3B8D5449BF5BE77D51A2BFD23E DION.MULLING
1,666,225,337 *AF5A96565DFBB0CE9EA56BD07C3188071E5D8C02 dionovalf
1,666,225,338 *AF5768FD9EC63CFFF5C78AE2804C67658E74DD41 [email protected]
1,666,225,339 *AF533E1CD337FAF0D48D7D6BB3FB9A03944C8508 chana795
1,666,225,340 *AF535071BD6BC55C6E98C6A4A51A6966E42058A7 CHARISE.WHITE
1,666,225,341 *AF545678E8C2573C4BC92A6F19BF4B5D95BDA98B dkt+4
1,666,225,342 *AF57A76915A53D5D851AABC9E1A6E41B50D44666 cheryl-collings
1,666,225,343 *AF51143DA8EDD656E7F6D10EDDB8C554A9042A43 DM90V
1,666,225,344 *AF5F2FF77EB2F9BEAEFC1E0E0B82B812FF3DAC33 dmjcw
1,666,225,345 *AF531600E1FF1A16A69663653E304C946B03D414 chortling
1,666,225,346 *AF5C2672C3C75CF654BCED8A8192DB2E4ACF50DB [email protected]
1,666,225,347 *AF55F3CB82D8DFB4CCFC83375D06D9D2A804BC88 dobothjayandjane
1,666,225,348 *AF5D8A3DAB0586E20E0C7D49DD0FD18FFD4C3744 christopherbergfield
1,666,225,349 *AF514F4631141FFCBB8A56E219722F15D6260D62 [email protected]
1,666,225,350 *AF55D56674301E2C0CCAA95ACDED695965BAC420 CHUCK.SAVOIE
1,666,225,351 *AF5215D045CA72A5E2EACB7885136A53EED08BDA DOIN-BAD-FEELIN-GOOD
1,666,225,352 *AF59A44DA0AD3624177F92326001DB8F61FEFA16 DOMINICCUMBY
1,666,225,353 *AF50F8D541FE7D4E25967AB0C22A2A5285CCEDA1 dominickbilodeau
1,666,225,354 *AF50F3F89D08DEF3540B4F28B3E308C0E2EDF1AB cihg)
1,666,225,355 *AF59CBA802C07A8F4EBAEDFE88567F74ADAB1445 [email protected]
1,666,225,356 *AF56940D57C6AE42A52BE9CA2FB79B4B1FAB3DA8 DONOVANTRIGG
1,666,225,357 *AF580D91E0B5254ED9068B20AA8A77798B361321 [email protected]
1,666,225,358 *AF54228F4E260D1432EF70D8220A86A168A00488 ckoo0
1,666,225,359 *AF5F7BD533318BAA424383BAE35A258B3AB22E95 DPPHA
1,666,225,360 *AF53F1F81BEE24765444DF50DF9ECC34991B8727 CLAUSMAN
1,666,225,361 *AF58D0CED3663D8F5D5743C4B06771B8778B7BCC d!r9b
1,666,225,362 *AF51ECC0B818433AE48251E572551BA2B2A05ED7 drv)
1,666,225,363 *AF55AD3D6A58BF720E93316C974D1AD3E3FC7748 DSH+
1,666,225,364 *AF518EE2F25E7030127391D4983027C3D23D4018 DUDLEYHINERMAN
1,666,225,365 *AF5A8450A44E283B6EAE60486FCB09F77BDF3250 DUHKLEGU
1,666,225,366 *AF5416B28AA2B7AB0FF6253B259AE8F0E0304F72 COLUMBUSSPENCER
1,666,225,367 *AF5EF17AD4EAC3785B30E1EB0D4FCAF63714DE5A [email protected]
1,666,225,368 *AF5816A2CB100554CE0ED5C36F53992B33337529 COMPUTECHELSEA
1,666,225,369 *AF5C8BA5BEC466CE485D83C8FA86E60922801DB2 CONTRADISTINGU9
1,666,225,370 *AF5F6109BCB0A819BCC59E274625BA3F723181E5 dvpkb
1,666,225,371 *AF5614F22642C2A25240DB8CE6542FCAD9FB481D [email protected]
1,666,225,372 *AF5D323CB1A6CF8FCAE0B101EA3E38D518E13DD7 CORTEZAGPAOA
1,666,225,373 *AF58015D02AA459C51279AA0B14644F26D86A4EA Dx)
1,666,225,374 *AF543D7A9292A7F59B2098DAF029318903FBCC86 EAI+A
1,666,225,375 *AF54D23B7B41FB065355E5679AAB880327CD2052 ec(k)
1,666,225,376 *AF5A99A95EC7E11480FCD1BDDCB0865C042C95A3 EDUARDOCARRUBA
1,666,225,377 *AF502483BDD6383702424979B64C1D6391D9A426 Cruel.Engano
1,666,225,378 *AF55708C4621E5DE5F8D997F6A4AB59940DCFD62 CS9CM
1,666,225,379 *AF5CB09B5F1B50D1182A806670F95FC94FB76AE9 EFFERVESC7
1,666,225,380 *AF5AD71BEA3DB02D911C59D4F74A56320AF0DB32 CSTEMBARSKI
1,666,225,381 *AF5A1748DFDA7181934FA05EEF1A7C88573DD5C9 CT6PX
1,666,225,382 *AF595D6E547070E4928586E83EBF9132A603F1CF ekmf5
1,666,225,383 *AF56B4685C5D7DB7C06D204AEB37FB6405A86EA1 ELDRIDGERASCHE
1,666,225,384 *AF527C0286CFC2DE262A3186CD444E1BCB2AD8A2 cv#l-
1,666,225,385 *AF587B75C3C7CEFB4A3F6FA638B6244C4D4C4393 eloydoing
1,666,225,386 *AF57BCF2809EC04E6BA98F537810D5F01D57B4F5 elsnenssensemem
1,666,225,387 *AF5AA9B766F9E53C5AB34A8AE692AA1BD438E5B1 cz6ne
1,666,225,388 *AF51E89511BE268B59A212C0D4E92322084FE1D2 D1JY(
1,666,225,389 *AF54BC545DD2A9A5BC7F5DCCCC6161356BE5121D d1uwh
1,666,225,390 *AF58A61D92E9C362D1A40354157CBE02CD8C0AC1 D2IXA
1,666,225,391 *AF54871D1621CD75C7328D35E8E6F38ECB8CE4C3 d6:r_
1,666,225,392 *AF5CDC7E2CD0A5E998687BDD35ED3C711E155587 enzo.lanza
1,666,225,393 *AF55A77E6443051DB3984152FC62A11D4F988F4C D8lf
1,666,225,394 *AF5BAB80C2069A30FFB87825E5F17F50F2C11F32 daneflicek
1,666,225,395 *AF54D8BD78485269A5B6549EFBCFAC40E313A2F9 er!"j
1,666,225,396 *AF5894A1B324A11E26B1536636E0D2D2B0C15A9D DANILOPECATOSTE
1,666,225,397 *AF52958991510FBE40FDB5529E17E345996356A0 ERTK%
1,666,225,398 *AF56D7805979A7A7E9E30AE7E3D30E9E4D917044 DASHARODIONOVA
1,666,225,399 *AF50E32798AE5A09FE2A6E4F58B3269277264D54 DASIKINS
1,666,225,400 *AF562DF615AA0AEBECBAC2DD0CEBF8FCFEFAA181 DAVE.FELIZARDO
1,666,225,401 *AF55601FEE211D89741FF4569185EA9187970BB4 davissurgoine
1,666,225,402 *AF5EC956E006C077F5E11230774E8F5D2EDC7FCA daw#g
1,666,225,403 *AF5F118F8C643A1AB7A7E704E52727FF9AC19058 eu`
1,666,225,404 *AF51B9A6840F9308E1405B137DB4552AB5E1ED21 EVAN-MEISLER
1,666,225,405 *AF5C275A42332EB85591669581DE94FFA6BF6AA3 EVERYTIMEYOUTOUCHME(BEATMASTERSDUB)
1,666,225,406 *AF595B3A3BD065AA6EA53815DDCF943C6C3DEB88 deandrelevatino
1,666,225,407 *AF5CCAE8A32E41BFE687991494AAAB7F97141CA4 F0RETELL$
1,666,225,408 *AF50E797B99DE8C5D1B1D0A10DF86BDBD8C93C06 Deebeephunky(JustMoneyIsHoney)
1,666,225,409 *AF5AB16E07CC738300AB2E525373A377343C7838 [email protected]
1,666,225,410 *AF516F84FD62AC60984EF71F42680F3661DC029F F(DA
1,666,225,411 *AF521A80DFDA6DEB75CE6C5260D00D83C1324A56 denverthuesen
1,666,225,412 *AF535ACA0C7BDC6835CD3602D9758A9F86CE66CA FELICITERA2
1,666,225,413 *AF52059CF48B79472488BB0662712690E1A43AE0 DESIGNP7
1,666,225,414 *AF5F43EC3973F13E03BE7B41421DB482F0F20B61 deue
1,666,225,415 *AF55AEA325BF4DBD00BB8D74F4BB7412FCA5FA5D fidicin2
1,666,225,416 *AF58874952B4D53C67C4664A7135163E9D908ECB FINALGLORY
1,666,225,417 *AF561556E780F7926E37F8F0F8721864BF992676 DFPKODL7
1,666,225,418 *AF5B122DD20DD2F8BF10D0F55593831D847399A5 D(G3
1,666,225,419 *AF595367BEFA35CE12A9A70D5A2331D2E826D9AD DHa9
1,666,225,420 *AF5511D4DFB250A040E7470C7268B0AB1F8FF7A0 FOREVER.XU
1,666,225,421 *AF5E585F2564FB0EBD5EE5E5BA223AEB4B67F6FD DHFTG
1,666,225,422 *AF5F9DD7700FB7A001075E533CEC83EDF6D98FA8 DIA7,
1,666,225,423 *AF5EC26F9405DA9AB4A967D47308066EC6078105 diastalsis
1,666,225,424 *AF50E54DB6CA909AB16B2C95CC9F89B221F6DE0B franklinmarther
1,666,225,425 *AF525C83FDDF5B65489A8F64BA56DDA578C8816A franseaanvallermakiesenaarzultewaregem
1,666,225,426 *AF5B37CFE0971F096E84334AA668EDCCEE9A2782 FUAMIKI
1,666,225,427 *AF580FBEB18E7F105E270D150CB2E798FE3FB3A6 fuckme19
1,666,225,428 *AF57D844DA0CBFB8A5B29DAFEA0B66E2C3A8EBFF g<\}
1,666,225,429 *AF5466BC6F2CF0DB11B05486BA5F1322531CCB11 dmitrialekseev
1,666,225,430 *AF55BAC03A069D89105F2F8B8639D3D0C7A2901E dmqq#
1,666,225,431 *AF5A3D04CC7E85F0C9E6E5FB0E989AA408AF0F74 gbt+
1,666,225,432 *AF517039FC6D908979DDF9D3988181C6F1A653AE geneseiavitch
1,666,225,433 *AF5CA05DD69877ED66D78063A4258D2B9626E1A8 GENO-ORTIZ
1,666,225,434 *AF55561846672782AB56BB19010C81BBE90E3822 DONNELLMERRYMAN
1,666,225,435 *AF5BDEDD050FF93D50C66983559265FB75AF8A1C GEORGIASEITZ
1,666,225,436 *AF5C6BAFD9233E49378E538199FF6D7A716F7F54 [email protected]
1,666,225,437 *AF5AFC0A14B9614E4787B75831B030D7CC78E531 [email protected]
1,666,225,438 *AF53990D4180CA9A12CC48E3D09E2E930D6991E9 GGEZOGEN9
1,666,225,439 *AF581922FFECDE6040582E89819401BC0281BDF1 [email protected]
1,666,225,440 *AF56D9ABC957271BDCC7795F44E2CCBF765EDC58 d-ouu
1,666,225,441 *AF5A988B886C393C8F1C19896547B89071CC672B DQ%$
1,666,225,442 *AF5026FE104FFCBD8B77AEB6BEF642B937D75309 DRIELEDIGE8
1,666,225,443 *AF559CBC1D482389C09AE58518C10342C34F2643 [email protected]
1,666,225,444 *AF5969C7CB36D3D448C33DDA81B3D087E5356655 [email protected]
1,666,225,445 *AF5FB7F6C01F82F2068301B4786F4D113F79FD9E GOODFORWHATAILSYOU:MUSICOFTHEMEDICINESHOWS19261937
1,666,225,446 *AF5203E3DEE73B00D2C8ECC0E9C3F787C289A70F D;SI7
1,666,225,447 *AF5D16E33F8057D477679132EED9ABD588183057 graphicroy
1,666,225,448 *AF54514793FA5F976581AFFA6F57F859E00E0C3A grndkhrn9
1,666,225,449 *AF5076889C9B9F4938C9C75F84835989A15BB7C7 DU)Z
1,666,225,450 *AF5B1C62DE0F16B0BADFC8B7584E9950FB2B9BA8 dyi4j
1,666,225,451 *AF5824A2AB0877E5B8EAA68E774CB2BF1C1F1A64 [email protected]
1,666,225,452 *AF5F40E91E60E4C8B90BD12E46FE8D85837EDCB7 haikolehmainen
1,666,225,453 *AF5DEBA2AB6BC96218D4A537A7F9FB6FCDB911FB EBERDUT
1,666,225,454 *AF59552904134219E4F0C55A32AC22FB7D91D8D2 [email protected]
1,666,225,455 *AF54FAA30B3221BF354EA2BB9053B91471880204 HANDICAPER5
1,666,225,456 *AF5BD16666DDD88A37EC944E214761D32D109954 HARMONIA
1,666,225,457 *AF51E1D02768A1D6B3422A2A40D86EE15CAFD6B3 [email protected]
1,666,225,458 *AF5F8DF69E192813EA39241D35DDC1AB62AD81E3 edmundoamoe
1,666,225,459 *AF5BC0E501A962B325C7D347AA892F0013B112B4 HASSAN.CAMPEAU
1,666,225,460 *AF555967A1ADDFF0263426034ED5A71EB4956B6D EDNEIDPO
1,666,225,461 *AF58D6E5AE92373E02C860161B50645FCBDF438D HECTOR.GOELTZ
1,666,225,462 *AF532B65D2127A3786B44A10BFC3ABC507F8915E EFT
1,666,225,463 *AF54D1F5B01DAE970F0B9F5176B85E40D882BAA2 EHXZ
1,666,225,464 *AF51C1DA6F8079895CD0153D473AB298C1CDAF20 ELAINEHUMAN
1,666,225,465 *AF59EBD4EF67577BFEC6A852007DCF0EDD2E3A61 hobertangilletta
1,666,225,466 *AF56F1D6B5507395EDA1FD94A433593867ED86AE eliza-lumley-&-lisa-stokke
1,666,225,467 *AF50B90AD1334117887CC68E0D9A7E97E83D9D20 [email protected]
1,666,225,468 *AF50F24598D00DCC9AF7661863D8A756F7768C78 hoepfully
1,666,225,469 *AF53B287A3A5D21BC821167D596E89DD89006995 [email protected]
1,666,225,470 *AF5BE3E581848214B1495C6B31DE9F208B383290 hongrie-italie-en-football
1,666,225,471 *AF5BEE1D3AFF98B292E3E19AE16ABFA809BA3473 hork4
1,666,225,472 *AF59AEF8B1F7C9E7B5BAE2ECFAECD5E4371E7166 EMILE.FOURNET
1,666,225,473 *AF500C85A8FEEA723F757EA26909260C3B0A364E EMPERORS_BOWMEN_OF_T
1,666,225,474 *AF56A0F170A86C3D7A47D89BC475936D2B3DCC36 EN-ALAMO-(RADIO-EDIT)
1,666,225,475 *AF5F4B277DD1225375467C5B50F92D4C477FE488 [email protected]
1,666,225,476 *AF50832904D800C1BAF5B81E4DE84A52290765E2 HUGHHARTSHORNE
1,666,225,477 *AF54A9EF194F91AAB2C0BA761FADA8F53198BC90 enotatum5
1,666,225,478 *AF5B4E3CFF338A550ADE9E0A82E7BB17731ABD8D HUJIK2
1,666,225,479 *AF57327992AF815A805CBC75E40873735848BAEC er4hl
1,666,225,480 *AF5F727EF4333D17714779A1D19C4CFF6B1CEFB9 ERNIE.OEST
1,666,225,481 *AF587544328B57568ABFD8755BADE33CDA94E592 [email protected]
1,666,225,482 *AF59C74235D06D64828DF59627C11197B3766714 IDOUMIT
1,666,225,483 *AF591E537B534550AA6D71BDF9211DED78472D66 IDOUSEI7
1,666,225,484 *AF51AAA21C2FCCEF0E781D016DE9F083DF1D3C50 ikebrittenham
1,666,225,485 *AF53EAAAC8AA4A87BBFB19E117BF36C1F82C6015 ET3I?
1,666,225,486 *AF5765CF4F10BBD63F20F7A9F784C4473D5B0D76 ETELIBA5
1,666,225,487 *AF551B8FCF3E0E63402A0CA75C7E4BA2DCB62C3B IL NAUFRAGIO
1,666,225,488 *AF5B74F0407901C323BCCF5DB7ABCC1B383CD8DA exarcados4
1,666,225,489 *AF580CC487B5364515E16A704DE80A39C297C573 IMMIGRA?
1,666,225,490 *AF58601C1A44DC2798C118EE1AD2E14A9DB86D11 EYKQH
1,666,225,491 *AF5BCB1D6F58E03473D97DDDFBFD8C6206F742F5 INM0S7
1,666,225,492 *AF5E0B05647991B81CC71E8951AFD7AA169D8089 fairwaycustomgolfnetwww
1,666,225,493 *AF5E508FB0EEC6659A01579AF73E96A57D1F22DF „INSZENATORISCHER
1,666,225,494 *AF5022E14DA32FB72208C7C21BD5E217E91E610C INTERPOL4TOR5
1,666,225,495 *AF5C0FB430FD19BD2BA2F71C50849A5C219857B8 farthingga
1,666,225,496 *AF50453ADB843B95F6F16AB8945F628632112837 FELIPEVACCA
1,666,225,497 *AF5CE2A616E24AF04D8DFC2620E5C1F77057A6AA FELLENG5
1,666,225,498 *AF56ACAD939CD827B03950F4C7E893B7202812DE FENYLGROEP
1,666,225,499 *AF5FA1B9082D306BFFA21B43228037CC9BD6B574 ismaelsomes
1,666,225,500 *AF535C8C9852AEA4D28A8730F801AF2F8BFAC1FF ITTORROCING
1,666,225,501 *AF5C081E346DA82B622A18FCD3A8617D28E2B138 FINANCIALS2007
1,666,225,502 *AF56A2F2FE184FE67FE1AD8F0109864EF7498E75 I.USED.TO.DREAM
1,666,225,503 *AF50B40912D2E3266049AC9C92C0C45BABF984A6 I've-Never-Seen-Your-Face-Before
1,666,225,504 *AF53F1F87E8C3AC633E2900F4C3A73761FB99D02 [email protected]
1,666,225,505 *AF582139D9D15AFFED56B11270F8E2C2A9CC51E8 IWillLiveandIWillDie
1,666,225,506 *AF59074EF6070ACF83D38DE02ECB289CB3CE2124 jackcurrence
1,666,225,507 *AF5612156A8DE2FBD0497CED47DBC0ADBFE80715 JACKSARELAS
1,666,225,508 *AF582949E92B1059FDE200FE0B4166DA38F70BCE jaetipple
1,666,225,509 *AF5D2345CE1858F4FABB0F1C585E804A3CF4E098 JAE.WATSON
1,666,225,510 *AF5462AD5C70EE2593EC555AC0437A4671D6C752 FÓME
1,666,225,511 *AF5366FCF0284B29E551FC48A257E9E02A3A071E FONTISXES
1,666,225,512 *AF59578BB3D5C4C2EFD45E15F692A1AE86CF99BE jamaicamon
1,666,225,513 *AF56250ABAD380C46E4CEBB615A90D8AC85D2E5B JARDINBOTANICODELBOU
1,666,225,514 *AF58126B3E786B38E312D17CA84D512134DADBDB freddieleeman
1,666,225,515 *AF5ABD99AECC10E0B5E6F73EFDACA405EB350C85 freddyeastin
1,666,225,516 *AF5B275B88CB17F95B2BDD140DB5121D8F8CB545 jasonurso
1,666,225,517 *AF5086D8A940F6FE57AB5076B177F7CAB1AA8BBE FREESTRESSTEST
1,666,225,518 *AF50943AA44F8C72A5602A6B796015A8725EC745 JEANREGO
1,666,225,519 *AF59459EAC1882C54CC26C329DCB52470A0263F7 GANGSTAPARTY(CLEAN)
1,666,225,520 *AF565D531BDF4601BEB663C44DAB6F8F6AA00878 jessica.tuazon
1,666,225,521 *AF53DBB7F56EC13F883671D6B3FEF6C201F5289C JESSSANTINO
1,666,225,522 *AF5C54E5435333509649024097A19D37046F4F84 'JFZMT
1,666,225,523 *AF5BEB4A2A16D3782AAA30F5AF13359A14575266 jicpac-tmws
1,666,225,524 *AF5DF04FF49915C94719197E943CDEF04440B194 GENTLEMANJOEUCCIDI:SEQUENCE6
1,666,225,525 *AF5BAEA3CA8B5A63E0072B215FCA52A7E1051359 JohannesPassion,BWV245:TeilII,XXVbCoro"Schreibenicht:derJudenK
1,666,225,526 *AF5D0D820B09801EE431AE146E74F10506071E9C GEVHERDEN
1,666,225,527 *AF5DD329A395D260AF6B1FCD09D4971353D12CD7 ghastlyghost503
1,666,225,528 *AF5B89E8FD690A9F246177593795C518491EA870 jonathanritchey
1,666,225,529 *AF5CB8B405E0EC1EB3EF58A8247A60DEBB0A1E13 glasbreuks
1,666,225,530 *AF5BA5EB439C9C47FC5E1CCD3A014F608141AEE4 glorious.everlasting
1,666,225,531 *AF586227C9FF676EEDD6A15099A86ED1E35EDAA1 gnemoahs1
1,666,225,532 *AF5BD280CDBB08ADAFBF6F466649076D23520EBB GNILRIT3
1,666,225,533 *AF55A6261A7CE3E5E0E21F31DE99E384996E15A0 GOLD'SGREATESTHITS(DISC1)
1,666,225,534 *AF5999479A9CB8E6FB2A97DE652D5FA4BC9A6D8E [email protected]
1,666,225,535 *AF560ADAFC053B60C3AF0842D5CA254AEA7E7915 JULIAN.VISNOSKY
1,666,225,536 *AF538A4AD79589B83EB6EAE340D98D2F4CD8E43E juniorscott
1,666,225,537 *AF5E010EC7B54423574CF582713BB86E2E581C35 GREGORYROTHERY
1,666,225,538 *AF55A5987E3B3CCE76604EA46F9F23CE114CCE15 jvf
1,666,225,539 *AF5F0A283B057A8F9F57AFBF414EF8E55C545BED [email protected]
1,666,225,540 *AF512CD30FAA8A5B9642BAAE078F893845C445F1 KARALIC123
1,666,225,541 *AF56AA44862B403F8C9CAEF20AFA6C781ED21716 h?{^
1,666,225,542 *AF5D72BF7DD41A9E9E17FF92237D2309A22D2436 HACKERIES6
1,666,225,543 *AF59CD58FC18D6EE58ADC8127EE47CDCDD1EF6E0 [email protected]
1,666,225,544 *AF5D5EBF1C4B591E2DDB473C08B81E77DB8A8F2E keepnetstevenson
1,666,225,545 *AF58C61CC9072E2E7A93ECE14DF77773F46CF67D KELSEY1130
1,666,225,546 *AF59F1579A9A0A822709C29BDE435355D950FDE6 KENESIA2
1,666,225,547 *AF5F14BA41854D22559E821A796A2CA507FCCC80 have-you-been-to-iraq
1,666,225,548 *AF53735F96695B15E1AD0490A34314B733F85735 KERMIT.KRISHNAN
1,666,225,549 *AF5ADC023D8773E0E0B827BAECFC0B45B96899D0 KERRY.HECHMER
1,666,225,550 *AF593C549C97AAB48E53B9E023B4719A1578B664 kevin-skinner
1,666,225,551 *AF5A6E51AB9E441BF2EC682110FDF9A7CC6F0EB3 HEILBRONBSW
1,666,225,552 *AF535FCDDE286367864B0DA9007A7523CA562CED HEMEILIU
1,666,225,553 *AF52E46FD49DAAF980E6AD3D4D33E7148AC48010 HERSHEL.RAFFETY
1,666,225,554 *AF5ED3F4794139FD12F1EBBA7D2064AC50C5F3AB [email protected]
1,666,225,555 *AF5A2C4D4D00A935D4CBCEB1EDD7DC3AA95A3844 hipolitothenhaus
1,666,225,556 *AF572EE6C0086E0C2A8A52E14E7613730F8B0D6A KMOTTV
1,666,225,557 *AF557B200CBB6412E4771A84A349E215279480C8 HITCH14
1,666,225,558 *AF5EB02918F4C9BC596F57BB2CD0B99695D3BF20 KOELERS4
1,666,225,559 *AF55676D49952420C209B37EDDC17F8F60B0BCED HONGGUTTING
1,666,225,560 *AF59935A054F355F21CB54F991009D4E315C8A6B [email protected]
1,666,225,561 *AF50F10389E4E12C85CB9AB5A4E2A172DB28E202 [email protected]
1,666,225,562 *AF5FB2540A914111E34825AAF5D4063E20EDADDE [email protected]
1,666,225,563 *AF51070C1A7B01A5CA5ADAC22F0170D5098D69C8 HOSEACLACHER
1,666,225,564 *AF5CC008BEC1214C3BEFC2B935F12FBF696E0FB4 HOWARD.FLAVELL
1,666,225,565 *AF5DD56CA06B9B17BBFFCC88DC8462332CD341C4 KSUIKODEN
1,666,225,566 *AF55DCCD0F560C67DCE93E557E0CD91E718370FB HRKANJE0
1,666,225,567 *AF550B8B71A0737DCF1D81E4F5D61A431DB68346 [email protected]
1,666,225,568 *AF54C92F00D6DA8A20D9D9ED1B980A700EF67111 HSAF
1,666,225,569 *AF59C19EEC32DDEF4AF40383CA014551C7236B26 huérfanos
1,666,225,570 *AF569334EA1742F5736533056D27E9A5DC90897D [email protected]!0ns
1,666,225,571 *AF5F1D762554638630D4E47B0F757005B50438A7 lalamarina
1,666,225,572 *AF5F920DACA7DA1CCD8E39B86D2F9A9B12EBFF84 h$yy
1,666,225,573 *AF51D0E37A3F3A352A9EFB3871D5DC70B86BE9BD late-augustjforget
1,666,225,574 *AF5E4838365E509AB3308B5DDF55893EE066938E [email protected]
1,666,225,575 *AF5662DC00D0B27937D668618364DB12A7310A4E ibnastaredusgwww
1,666,225,576 *AF5EAA23B02F5CE3451792690E3A1E2AF566C41B lawrence-giam
1,666,225,577 *AF5C742BB89F100462ED002945F68DD049F58643 LAWRENCEY
1,666,225,578 *AF5C2428985487772E6E8964D07D9AEE8BB9620C LEATHERUPHOLSTERED
1,666,225,579 *AF508BBA947043E2C93D6FB705782DF4B2D6E4FB lennyborkenhagen
1,666,225,580 *AF51E62384FFB0EB4B4992AEA53C8D8D4B54B8DE [email protected]
1,666,225,581 *AF5174D2A921855979E35E5CBC2A62D80E8A5716 ILUVDAWN1989
1,666,225,582 *AF5E2AF457260A3DB49F5E073CF422850A3A521A [email protected]
1,666,225,583 *AF5A059DFC4A87BC099A96DDB2473BB030D1C06E In..publickey..cryptosystems,..message...secrecy...and
1,666,225,584 *AF5A99FBF7DCA348BFB2A2713A9FD9301D8B6146 [email protected]
1,666,225,585 *AF58D558F3215CE3C19C0EDEB397E90BAD06385D [email protected]
1,666,225,586 *AF56D9D50D5FFEF31E5DBAB19957CF126CF08D82 IN THE SMOKE BREATHE
1,666,225,587 *AF562EF35E65F327F6A843319923C9EF3271F266 LISCIAVO0
1,666,225,588 *AF536AFE40693DF6A791E1291BE607817029A974 LISTE-DE-PONTS-DU-PROCHE-ORIENT
1,666,225,589 *AF5EF998E29A23E1803C67C63243C3AF6D022835 [email protected]
1,666,225,590 *AF5B25E079C3734679C5DB20828EF792BC7FDB52 IŞINLARININ
1,666,225,591 *AF52FD45873E774E2A2342E4190B5EB8950E251B isrealdenunzio
1,666,225,592 *AF51CB51D0FAD9E34E9549CC3FC67424653F0E61 IT-AINT-SO-WITH-THE-BREAD-OF-LIFE-THE-REST-WILL-BE-PROVIDED-SOMEONE-DIED-FOR-ME-WATCH-SAIDIE-EXPERIE
1,666,225,593 *AF551D5624BDA5F07BF5891BA3F5C6734C9607FF J]}2
1,666,225,594 *AF59CB431E8E97B034EA83160BCABD79CAE5F5A5 loquemment6
1,666,225,595 *AF58CD3BE1F1411F17337F5D8F8F1AB2DF87ECDF louieisreal
1,666,225,596 *AF5529F81149991B2EBEDB34A8B010943A4C1FCC LOUIS.GRIFFIN
1,666,225,597 *AF5999575535DC7D858856DAB299769DBFFD63B8 jakehipsher
1,666,225,598 *AF525E85AE24473907925BB3EA749622C8A58E20 jamisonhenly
1,666,225,599 *AF5C8F8A50188DF30883789E137E129B5E983837 JAREDHALLACK
1,666,225,600 *AF5F416B036551E7926E893E7A2B26B921216E70 JASPER.MIGGINS
1,666,225,601 *AF5A34DBDDD9F69BA84FA1D36212F604B90C1A1D JAVIER.HYDRICK
1,666,225,602 *AF54F65D9CF37BD78DC9072563BF27BDBF872734 jazz,classic'98
1,666,225,603 *AF526AB91F124C23C2A521E6148E822AA769A9C2 JEFFPICKUP
1,666,225,604 *AF54FDAC734E7BF39BF748897BBAE35377344744 jeraldswarb
1,666,225,605 *AF51762F66E450FB941AD67CC5D8E8E838F9F777 MAAILMA PALAA JA KUOLEE
1,666,225,606 *AF534933ABE9B0C8CFE00D0D96111C890B78C65F JERMAINE.LEFAVE
1,666,225,607 *AF5936DA81E8E490C3579E82122E4AC1BDAA82B4 JERRISTIMMEL
1,666,225,608 *AF51A5A24E9B18135B53707C07153D7F09586762 JERROLD.MOULHEM
1,666,225,609 *AF5C2D88CC3C66E66F5F4BBCF0E3B0799B469363 JESSIESTRASSNER
1,666,225,610 *AF5C4DD090A34BB1956DC572FDE824EE729D8185 jeugnot
1,666,225,611 *AF544F593D5351E33C40A74B06D1B4D5353B3478 manucurer?
1,666,225,612 *AF59DE28D5B53963A61FB36A5BE2A7C4CC99FAEB MARCELBACKUES
1,666,225,613 *AF52DA1654FFE27CEA4030C9D10A9875ACFCD004 JOANNAGRIVAKIS
1,666,225,614 *AF55A0F7811A4BB02E18F1F440C29D4DCE23D3FE JOHNATHAN.VILLANEDA
1,666,225,615 *AF512A2F433597569A93E095411743606A4083B5 MARINEELEKTRONIK
1,666,225,616 *AF5965A51FDB6795A331D5FCA2F024D7856F9DD1 [email protected]
1,666,225,617 *AF5DFEE2500C504C151063E536DC5DDF30A9591A MARKCAMARILLO
1,666,225,618 *AF5CF5C52230D43D9AC86A4F4AD69A9B66E8FA46 MARMIEJIM
1,666,225,619 *AF5A593E0580A0052C6AD6411A1D622B4EBE708D jonathondeatley
1,666,225,620 *AF59F646C001D1A7292D14D908ECBBEBD6500FAF [email protected]
1,666,225,621 *AF5B8BBDB6642C4C66105AD1CCFAC1230D05661A mary-lyke
1,666,225,622 *AF506FDEF042E30734095E5B0240BC43D9FA8927 MASILIOS1
1,666,225,623 *AF51DC6C43A9B348A0792AF4726F3227ABA4CB77 JULIUS.SCHROMEN
1,666,225,624 *AF5464DDCFA04607BD4408D7A807D00C15CD6946 [email protected]
1,666,225,625 *AF521C9BA39B8AB8C01001BBB07E534DA89D5931 MCKINLEY.MAGONE
1,666,225,626 *AF53926D20AA3065D292D96595650EB2F473C600 meelevend1
1,666,225,627 *AF56AD2495744948292955A4FB5A0767465E465B ka+f
1,666,225,628 *AF5CA7F37BB6F859B6100C6FD1AE4DD0EC71684C “menú
1,666,225,629 *AF5828EF2DE778CCBC4E2C4734CC122A0091172B KARL.MARKIE
1,666,225,630 *AF5FBF8B31C9383941FFD5DDA021E495EA52AD71 KARL.PARMAR
1,666,225,631 *AF51F293D47C6D95F8E7B8B39699FF5D17B8E870 KASEYBREW
1,666,225,632 *AF505CD1F70784FB4EDCDF072752B4389327572C kathycoppola
1,666,225,633 *AF50AD2A44C6F37B53EFFAE2A5279B77708B4C22 K.E
1,666,225,634 *AF585C731860B3A00525BA0D6950319C954536AC mike.batzel
1,666,225,635 *AF5DC7B6E93DCA8D5009A4A863A496F180175635 MILLIEPALMER
1,666,225,636 *AF58016E7B2E86919E3B92CE0DCBF5ABF0A7F40C [email protected]
1,666,225,637 *AF57754447183F62B3DDC3405A3E81B2BD524D64 MILO638
1,666,225,638 *AF51A2CE3C135156A37C7A351793337F7C349578 miltonpecina
1,666,225,639 *AF55C0D4D3E05800D10608BDFFDB870621659CB6 KFFLCOMWWW
1,666,225,640 *AF521F6FA0372DDC76F982F9DF521E8117D99A6D MINHDEVARA
1,666,225,641 *AF5C531090BEA6859D890DB4AB946809F834ABF5 kijktoestel4
1,666,225,642 *AF55F94379C05CAC6F6F42B23FFAC89054295C52 MISTUSS3
1,666,225,643 *AF54979429C46BEABDF2B9D9A179240BDD6BB64B KIPNECH
1,666,225,644 *AF51F0E0FB3286DF58471DF75291DC3959EF793D KKIILLOO
1,666,225,645 *AF5C18C2E908D40046DA036FBB8AEDF8742D19E2 montyangeline
1,666,225,646 *AF571742261D8960352A3B122016C109143C1057 KPANJARI
1,666,225,647 *AF5BEE43B7B2098EA9476E48B84DDCBD31A3DBFF kq"[
1,666,225,648 *AF528842A6DC0D0011DEE852E9CBC02A96F24DA2 MOSHE.SICKLER
1,666,225,649 *AF517F87813812977077B407F9C18DB3BA3A9AFC MRCLZS
1,666,225,650 *AF5B48DF84574075FECE82C739BAD80FCF446D6E kumqu4+$
1,666,225,651 *AF59D1D32BAF46AE55B7ACF02DC1084578B12D18 LALES
1,666,225,652 *AF56EF4C6C8346A320E37C3247A65B09BE7482B9 LAVINIA-MEIJER
1,666,225,653 *AF5B7C6483591C5577384ACE3C422C3A46B29B75 LAWRENCEWALBRECHT
1,666,225,654 *AF54D424B868FAC2518FCD9CA2BEED32C34332FE lazward5
1,666,225,655 *AF5CCB4DAB95674DD992AF0C4903E7CAC79F9E1F LEIGH.FASCI
1,666,225,656 *AF58DBEF9805AD2C7C6BD29670391DE2ECB98E9C Le-Nozze-di-Figaro:-Act-III-"Crudel-Perch
1,666,225,657 *AF582365C52B903DA8BCFD07C3B7E8895879EDC3 Le.Nozze.di.Figaro:.Act.III.."Crudel.Perch
1,666,225,658 *AF576381A84908223B9150E17F33EFDFCEE9C775 NC011122
1,666,225,659 *AF5A8E4CA52237B23EC9C22BB65E2D3507693A3E LEONARDOBOUTROS
1,666,225,660 *AF59EBDBBF454C2DD56C1F6BD46C018FDFCBBDE4 NDEL-JAHRB
1,666,225,661 *AF5CF39C41BFACEB8133D7A0784EFD113CC32DF9 NDNISSING
1,666,225,662 *AF52212E4C415E93E06EC90ACC26F98B835FFF7F lesfrankson
1,666,225,663 *AF5030C57261F946C9D3CB639690184C8BFEED97 lesliemunoz
1,666,225,664 *AF522156A8DB09C2136331E88621ED11541B94C3 NESLEINE
1,666,225,665 *AF512B93676B932EED791E22449D47CF20B76C36 never.ceasing.melancholic.spring
1,666,225,666 *AF5DD9F5DA78FF4E1489F10302223532E389CA2F lieblingspl
1,666,225,667 *AF504F08E72EA937AFB0B47C31C9FC16EC8D76BC LINAMAUS
1,666,225,668 *AF51ED0BD0FAB52E880DDA00BC80EA10245C3B62 nickard
1,666,225,669 *AF5000D1A7A35116F702D2A90B89EC15E1348B87 LISTVINAFÉLAGIÐ
1,666,225,670 *AF59F59432B45E1E7446EEEBFB4B20150B3205D8 LIUHUICHU
1,666,225,671 *AF558D13CEE24673CEB288B665FF42C9803C5C44 LIVE.LONG.(VIVAT)
1,666,225,672 *AF557CAC9CC29EB4BB2920BE6248F37C2C62F436 LLCW
1,666,225,673 *AF51966769B670C71CE1DE70C8B9092537E9FE12 lomastome6
1,666,225,674 *AF5669C292EEC22BFC14929019617009770E1688 LOYD.ADAMITIS
1,666,225,675 *AF54E92196446A51D372C6B5A902FEF060E9FDEC loydlecain
1,666,225,676 *AF52D6ECCC5D2444A8A476A186940B197E23A66D NOUVELLES.SYMPATICO.
1,666,225,677 *AF5EC129B96309F9AF1B4CF303DD39C80302D56B LTY?
1,666,225,678 *AF58A6CBEEEE1052032DB4F6D4F810296F008A85 [email protected]
1,666,225,679 *AF5EFC6E39B70831E627186BC35EF57867CD63D5 [email protected]
1,666,225,680 *AF55F8DBFC8B39F20CC0CEF75A69BC26E435395E (>-<)o~-(===3
1,666,225,681 *AF56361A159AFF06BCA0515315D92B1760956068 oi]4
1,666,225,682 *AF5BF36D7B71B5AF46B42F2E3A30844CD0373058 oi jumalan
1,666,225,683 *AF59F9F0B8C8AA82EACC3F8416724078B10BD214 OKEFOKOED
1,666,225,684 *AF5975EFEAE6D0BE18EFB978AF2099AFCC1C07BD MAHFUJA SULTANA
1,666,225,685 *AF5FAAE59157ADF1282B347A3219FD8C2F487C56 OLIN.BIEDERMAN
1,666,225,686 *AF51224DC6F0308D74365016F9276CB7F381AD46 onderlos7
1,666,225,687 *AF5163260BDF866269135379A1C55ED2D12AB741 marcellusperza
1,666,225,688 *AF5D35FEEFD8F6C4255F391AF7286C4E40B31D82 ophilehyacinthe
1,666,225,689 *AF556AF4A2AE6D70C647D3C61D4703A35D9CBC1D OSAVALLAKS
1,666,225,690 *AF53192BC97DBC35A96285406E8E2015FB1DA226 MARK-MULLIS
1,666,225,691 *AF5CBC79588A49C72EB9CF9A6C9AE21B71903F19 markus.gasaway
1,666,225,692 *AF50162871326A7D3E6D83763426C3376FDF73B7 MARRYMUF0
1,666,225,693 *AF53A3F7DDCE278D0E6AE2AEC61B12FEC8649E20 OTTOGILDOW
1,666,225,694 *AF51A4EB7AF314213B5689819DEE80E63C186F2F MARTIN DORAN
1,666,225,695 *AF545218110369E9061C4B829D48ACC217D5F442 OUEN’S
1,666,225,696 *AF508935C3038714F4A64D9E0A439C4E769F430D OVERDOCTRINAIRE
1,666,225,697 *AF5FD0D40B2A3EFD8935E9F1A031F78D16A669FE packardisabelle
1,666,225,698 *AF5662B8B59ED1526566FBFDAEDE5E8222FECA2E mdtglsn2
1,666,225,699 *AF5C2103D418A70DD2C21C9AAC1BA9862BF84E80 mechdiv
1,666,225,700 *AF5C7BB662BA97FB1306718A25A26264E2FB8B69 melvinenis
1,666,225,701 *AF55DDA0E3A4E1CCFEDB0395E68B6DD74B20831D PARKANDILLICK
1,666,225,702 *AF57E87C3469CD9BBA9C5C61A267B255024C89AA pass the cous cous
1,666,225,703 *AF5B559D1B8C9B314B42D0CE313E688EF7CC26F0 [email protected]@+on$
1,666,225,704 *AF56A7580BD932DE13B11C6AC3814E67CE585051 michealjacobowitz
1,666,225,705 *AF53FA541571C1C84A9FF1FF17DED436DBB396D8 p######b*.splat
1,666,225,706 *AF59152CC0B922A4E9F82336763872519C3098BF pe`-
1,666,225,707 *AF51EC4FBC54E4377A0723A51D684625279BA2F7 pelocansaco
1,666,225,708 *AF5F7DC3A7E53F19757FB06E2C6048451FA1CE89 [email protected]
1,666,225,709 *AF5ED59E5020D7B28D24B9E7EAE97BA9AC946324 PETER.FALVEY
1,666,225,710 *AF56C9C3E1E521F255FBC4B01E6C0C6C161783E5 PHIL1001
1,666,225,711 *AF56A08ED195A80A047ECB2E5DC6FE2F3A38E011 mnicklas
1,666,225,712 *AF574F989A37D9932561A87AB951CDC7BA2C975E MOSTAFAELDESHA
1,666,225,713 *AF55E96DC3BAC7188698A63AA8C5B30CB38F3E68 [email protected]~o ~osplat!
1,666,225,714 *AF599FE1541302CEED49C7DCC753A9AC8CF79470 MUHAMMAD-ADHARY
1,666,225,715 *AF59BC882FC4BFDED51F4691D89D30C90D224F34 posteerden9
1,666,225,716 *AF5CF3330235D4A370BFBBD225475D1DF8605F15 [email protected]
1,666,225,717 *AF5DF7B5134E85B7498B0C2261CDFEABBC1B42C7 MYFELIX48
1,666,225,718 *AF5633FDDD1B48F46CDF7498DBC2878CFD478535 PRETAIO5
1,666,225,719 *AF554B962008078737014E46E37F91D1E91B7786 PRINCE IGOR, ACT I NO. 12: POLOVTSIAN DANCES AND CHORUS
1,666,225,720 *AF541E5BA22C86EA47C6B18F1E0146C4C1159BCE PRIVILGI1
1,666,225,721 *AF5D71BC3CCAD17D80E20EF2CE556D0FB5562EA2 NADELSUERODELECHE
1,666,225,722 *AF52A14928EE34076F1DAE3362C6EB8036052096 NAGEONS!
1,666,225,723 *AF54895E90C94968471BEB227509C4800E6E2C09 PROKÓNNĒSOS
1,666,225,724 *AF565D7F6242C5089153BA8B2594A3833667D990 PROPAGANDERINGENS
1,666,225,725 *AF5BF6FB2772E864FB40C9EDB2A933D1C9848664 [email protected]
1,666,225,726 *AF5F3B405C34E94AE4188219497BB0D9394946D2 NATHANIAL.ANCAR
1,666,225,727 *AF52081575084EAF3A9AC2C65E93B5BB77CD8BC4 [email protected]@LISTIC
1,666,225,728 *AF5FE5CE0FAC4F14839E8526D2AADEBCDAD7107C NELLORMO7
1,666,225,729 *AF57191E322DB61B9D9269FBEC4AA9EBC2E9EEF5 nerdjoke
1,666,225,730 *AF57B4C4132D2CB664D7F5A38CB96355472509D6 networkmarket
1,666,225,731 *AF57EDBC55A73C53F10318EA15E618525C81F663 Q---)~O.~OSPLAT!
1,666,225,732 *AF5879EC45B359D33F85F96DF0804A82791C36C1 nicholaszakutney
1,666,225,733 *AF5B0DB92EEA971F2BD39999D57F840F76414D7C NICKHARPER
1,666,225,734 *AF5FBAB9D0FF6666F38C9BE40D4BEF87315969D3 QUINNSTAHOSKI
1,666,225,735 *AF5D16B65D49D1ED850A5E9D603C7A328A5E129E quintinullah
1,666,225,736 *AF50E20851D09ABE69E4D76F644477FDC4E36C44 [email protected]
1,666,225,737 *AF57B3B31196D632CF150809FA93C6A551DD2332 NOAHDZIADEK
1,666,225,738 *AF5CC8F6107A8C3758468D7F1EDE4E7C2E732320 R4D1OSENS1T1VE
1,666,225,739 *AF5DCFCA68934213C69CC3C9BD0D71295DBF706E RADUCOMAN
1,666,225,740 *AF58120855634CA75977A2EC0BE8AE441F9950DB RAELINES7
1,666,225,741 *AF5F22F5A23171632D47FDD9AAD0C457A3F1F7C3 RAMLYG
1,666,225,742 *AF59DE396D5BE09EDDDA177423A1E1549AB8B053 RAMON.TIMMRECK
1,666,225,743 *AF52B8B459932322EE95BEA2AE40C71F4B7D4F29 RAMONTOXEY
1,666,225,744 *AF5BF299A5A113C8B4990BAE9A47AC9A2DC717D5 randellcatalano
1,666,225,745 *AF5CB946EA7BCB29533DB8EB0578CD1C154DED68 randellzaitlin
1,666,225,746 *AF507911606791F4D2AAAA8740C7EAD101A044A5 NSAUILUMA
1,666,225,747 *AF5835699EA3705D6D4632C5C19E89581D704455 RATCRAFT5
1,666,225,748 *AF5DC4C47F0A4AC4355763DE7E889308F15B2596 NUISOMESING
1,666,225,749 *AF571B3ED74540891436C0A2E1C92DD734C54BB3 Rededuction
1,666,225,750 *AF57AE23FE009A2D074AB97CAEA18810BEDFDEBC O!L<
1,666,225,751 *AF5E0B5890CCE45CE480FD9D95E1B36DCC5FCC1B REGINALD.ROSICH
1,666,225,752 *AF51AF1CED0D8E63DC9358732E8B21559A39EA71 OLLIDEZ7
1,666,225,753 *AF5830C0A94A2BEA80260FED6B7F34833DB51454 RELATIVEAPERTURED
1,666,225,754 *AF532FACB578B2E1086878F495DC0E25724A8FB3 RELATIVITÄTSTHEORIEEXPERTE
1,666,225,755 *AF5595680C206EE44271F922B47233E9A5A71F93 onisgam
1,666,225,756 *AF57D479A11EAA2C2A7B14DC2043F9521F83B66B organisationsteorien7
1,666,225,757 *AF5DE0C0A21C952C4F9D93C10A61AB5A2F5FC426 ostajatued
1,666,225,758 *AF5B6B8638D5D028052D647BAC61A5352CFF8736 ovenfurnace
1,666,225,759 *AF53F0A8BF461A0E32FA595940F5C08ECEFD0555 RICKIEISHMON
1,666,225,760 *AF5E4E8CCE77F96E18CEA1937F50354CBEDE13F6 rickiesteelman
1,666,225,761 *AF5274B3D5FD6D23472FA4F7A7D68FC39C9FACE7 rielced1
1,666,225,762 *AF58BFDC8D8F76785BAFDCACF59B105FE67FAF2F P17467
1,666,225,763 *AF586DD07238918442A6D5182371C024B5BCF254 P1A5+!C!ZED
1,666,225,764 *AF58AFED04F4B8495551AEE572025AD93054D275 ROBGUADIAN
1,666,225,765 *AF55C2867BD42744773A71CF77247EA837F58835 ROBIN-SOLANA
1,666,225,766 *AF52FCF50001981BEBDBDF2F288BBEC520712D6E ROCK:.FLACID.CRUMPET.(NO.VOX)
1,666,225,767 *AF5A9EE4BA6AF9F448F6ACDBC4C18B409D922DDD PARKIN'LOTONDIXON
1,666,225,768 *AF59345557844571C9F24032CB20E416B9674989 PARUSET1
1,666,225,769 *AF51E789FB3B54B078D74EC78ACDCE44D860C13C romancedelcumbancherolam
1,666,225,770 *AF528227A7CB45B7EF98DA4C79184087369EB743 RONNYCHET
1,666,225,771 *AF5DF46A60823F14E1F26894D00C2111605AF165 PDSNPPRY
1,666,225,772 *AF54A171AE96C03A25BBAF009BB48EEE868945A6 ROSCOE.TERTINEK
1,666,225,773 *AF5ED53AB748564739EA0BDFFE1A6CF23C1661A7 ROURKV
1,666,225,774 *AF557CCD9FB027704EA0AAD9524FE506B7F4D45B ROYCE.HARTLINE
1,666,225,775 *AF5C4C7373415D52A3942723F04F44BA61B75136 r.tilleur.fc
1,666,225,776 *AF53135DA44A7FD794C89BC700DFC29BE1D97669 rudybugg
1,666,225,777 *AF54128B8778D8BFE5AE34EBADCA09722479E42D rufussuggett
1,666,225,778 *AF5BD1BD00228ACF9E2E627E82E91AC9C7414CF8 PHYSICIANSPECIALIST
1,666,225,779 *AF536D2089B832E6083CFC2D26A1F257E5B88C97 RXCHZJCXP3
1,666,225,780 *AF5E7E9C0BFA9D22E9A6A18B9BA379FA56C5EE00 ryanogle
1,666,225,781 *AF5AF3ABAA37E644D37C046E9E98E4A342867B5B pltshbbn8
1,666,225,782 *AF52990DED7FDC32EF974859F9250BCF21CBA400 SAG.MIR.-.WAS.MEINST.DU?
1,666,225,783 *AF518B0C6D74FD3CFBEE18972CBD2E7A66A75FB4 SAINTE-EULALIE-EN-ROYANS
1,666,225,784 *AF5B3F6E21F858A7B1EEF9B9F0FD85EC45DDE0CD SAMASORUS1
1,666,225,785 *AF572569F01A65D743567B88D2E2C755666DA9CD PORFIRIO.SKELLY
1,666,225,786 *AF50F0978AF6002275628171D2D13DA53E616F53 pousing8
1,666,225,787 *AF54A186A399CAF214AF89EC1AA629D8B2EAEACD [email protected]
1,666,225,788 *AF5A71656C9E220919C5C1059CA6AB8589829918 SANDY.DENNINGTON
1,666,225,789 *AF521389A4A4A73C07F1329FBD7084B87142C75D SANGRIA
1,666,225,790 *AF54431371ED11FC15FACE9A0DA0BA633559291F santobyrum
1,666,225,791 *AF5AA724FDF7DAED3DF656EAE41DC4C0E6455C64 SAPRKING
1,666,225,792 *AF517D500B209ACD2FD35CF90C16E265E712A452 przekaz-jest-jeden
1,666,225,793 *AF529C3947A1FF22FF4FA8FFDC4D7EEFF8586FDA PUITSAUXVOEUX
1,666,225,794 *AF5B26D0577990A96BBC509FAFDECCDD83B9BF95 scott.koehne
1,666,225,795 *AF5E09F3989D64306AE51DFCB63CC982F264BDEA [email protected]
1,666,225,796 *AF54DC5F227CA7DBC1F4BE486040AC74343F9F1C q->~~(>_<)
1,666,225,797 *AF51C54F3A3ADE037C460D0C785B5B242A2D3216 SEDAHSEIBMOZ
1,666,225,798 *AF55363B2CC05A7A9DDA1EF4EF05DC34152C570B q====d.~o~o.o><
1,666,225,799 *AF531CAAADFCF777D6CAD6378BCDFC459A456A69 SEIGNEURY
1,666,225,800 *AF56F359E457BE500F7D4C13B1DF5E85EE9E09FD SENATOURE
1,666,225,801 *AF52394E1F7870B449BCDE51DE457571818AAB85 [email protected]
1,666,225,802 *AF5F25B33ACDBEEEC71C3236F8493A78225863A9 SENSILLAES6
1,666,225,803 *AF507BF8EF0DCA4EE06E5B4B1E64754BF7A69D36 SEQSOFTBSWS
1,666,225,804 *AF5F27214A4C152465E83741C106821D55990331 SERGIOSTANISH
1,666,225,805 *AF5BE35602774FBC25609879A890505941C55B58 [email protected]
1,666,225,806 *AF59BF50322493C4761B180836A9B069BF6BA2AD (QUACHIL
1,666,225,807 *AF5D730D1CF98366D9549213E9278F1A70C7461D SETHCID0
1,666,225,808 *AF51B1BD494FD4BD6BD6CC9EF213CCDA436A9F87 QUINCY.CULCASI
1,666,225,809 *AF5779B6B6F604EADE82D6D0803083C60CB87E5B QUINTINGRANHOLM
1,666,225,810 *AF55BDCA8CE0D7F29495D9B91EE79A3F8E1FC88D shaddidonna
1,666,225,811 *AF5A726D6D6E02A51B678D25D34B088DB05FA854 ShadeOfRape
1,666,225,812 *AF541CC620A1F69936F6D49D2129C65A60F87129 R3D33MA8I1I7Y
1,666,225,813 *AF5A833621A7BA11582633A02256531DDC9CC3E9 SIDEDRESS6
1,666,225,814 *AF5BC42D527844B9916BF2027998064764C39DCB SIERRASHAWN1
1,666,225,815 *AF5525DDA27968B39BE0501EC38F2249AD098FD0 SIGOLOKYSPSNOITINGOK
1,666,225,816 *AF580359A165488C09F21F331035A93841C29DF2 readonly3
1,666,225,817 *AF5079226F381736893DDFF748308970EDACA8A8 REESE.WRIGHT
1,666,225,818 *AF53C187A2ED7BFAE49C3D69FECA1F9CE3F834B5 SKIPPERBACH0
1,666,225,819 *AF52A9289D0ABDB2E643605925599631428FF48B [email protected]
1,666,225,820 *AF5BF5D421CB94F7D59DFFB9FD2297698C85C0D3 reginaldnottingham
1,666,225,821 *AF5D9F504762BF0D96B5EA9D75BFF9C1A22B1D14 REGINEVELASCO
1,666,225,822 *AF5CAFBEF4574BD42573901DD9DDE3ABDF1851CA SLEEPLESS77
1,666,225,823 *AF5AC9790E63177F18D47B939F0373DEB038AF5C s&mdvd(disc1)
1,666,225,824 *AF54EAA9869C8C08DD895E3462827474BF05597B RENALDO.TUORTO
1,666,225,825 *AF5F1B126A083483585305DAB4029E1E3D480773 SNAPDECISION
1,666,225,826 *AF571B692136790DC5D9F74BC484078A88FF4701 sneitnia
1,666,225,827 *AF510403D8CBF8A8AA2D3943CAD4CEA16F9C4DC8 RETSALBEISSAC
1,666,225,828 *AF512A5936BC3BC96507356DA0D35140859EB497 REVEILLONNERASING
1,666,225,829 *AF5207F0000781FFE895E747EE07BE96ADBDABD6 REVOLUTION-OF-THE-RED-PLANET
1,666,225,830 *AF576C8DB11E5F087D98C0BEDDA0998141AC46FF RF2=01
1,666,225,831 *AF5FA516F82E204A73B6FB8619038893C677545D rffekwae46
1,666,225,832 *AF543B8E3EBB9DDADA97C34EBEB57E87E90B0117 RICHARDTROUT2
1,666,225,833 *AF5BA0F39F594F016CD4D59D5623D01C67392370 SPARROWTINKER4
1,666,225,834 *AF5803B82F93192F301BFBBAAB4571BFA2604434 special.delivery
1,666,225,835 *AF5C9C66FC3EB9B4C2B884337783CC4C1074EFDE speedymo
1,666,225,836 *AF52F2AF38BAAF9F2A830C0877A43C9C0219B448 RIOVLEB1
1,666,225,837 *AF5BA4AD17BE5A8C4FBA5921A4E50D7CC0C0A6E1 SRABGALHCSNU
1,666,225,838 *AF56AA11D2A06738BFC695A2F392A19D40951929 ssenlaitnerever
1,666,225,839 *AF539C6C8F0D227A9E356F5673DC2508E5E0E3C5 ROGERZETO
1,666,225,840 *AF5BDF7A1C3276A394705627EAE1C26E2A5DD8C6 stanhelfinstine
1,666,225,841 *AF5CB14B5E5DE38D0AFC8D78B50EBC0B63F2A8FD STANOVITO
1,666,225,842 *AF5010D890763955C30811D7065BF3E9227B81E7 ROSCOE.ROSER
1,666,225,843 *AF5042A7F99E015DDF4FD952A7F0218AEA71C6E9 stevanrich
1,666,225,844 *AF543029354664F5CFE70F01C8A56C69E88E5FC3 STEVENBRASSELL
1,666,225,845 *AF50D69A81F3D9D042B876D2B2CD09625B8D0175 STONECOLDFINGERS
1,666,225,846 *AF59C3D207E4C3CB3F50FF0E38CBEF9EBF004035 STRMDDCK
1,666,225,847 *AF55DCD06EF852CBFDFB2957D66674C9F6CB4548 STSACC
1,666,225,848 *AF56396FECDDB195B65E9277A3C22AC0FB69F585 SUBHADEEP MUKHERJEE
1,666,225,849 *AF5B7660F6105C205651610B19BB3E9125D5993A RUSTY.BLATNICK
1,666,225,850 *AF543B7FE788A22D6CF35F134D17FEF19C589046 s1m0n14cs
1,666,225,851 *AF57C860759D80533689A6090F32BDCF010A71A7 SA
1,666,225,852 *AF5D40759A76C68FDC505D32B2C55AA3202F2DE4 SALVATOREROSERO
1,666,225,853 *AF59CD4B0F486E8EC8CF2B073A31E7553E0AF458 SVLEKNE
1,666,225,854 *AF5308E7BEFBD97F4F8507F03017146CC71D3DD3 sweethingie2289
1,666,225,855 *AF527DB420353FC02FA17D52BC10DC07CC7354F1 SANCIONAREMED
1,666,225,856 *AF5BA482492EABD427B2D342B60E3D8DD6812E21 SANDYGOLDEN8
1,666,225,857 *AF59309832488C2AE0F663B23F62C376E898C364 SANFORDALLMOND
1,666,225,858 *AF5569E9310800CC5DCD20021AB1160377839179 sangcharisse
1,666,225,859 *AF51FDBD4DB2368DFD618A88BE0813C04AF72632 Synthesef
1,666,225,860 *AF54F17C0405F93982D9076349FCE64C7EEF80F5 SATURNMARIA3
1,666,225,861 *AF5B524482168E0324CB2B5BE1FDFB114EFDA1CF TAGJTSSD51
1,666,225,862 *AF5277BCB270A27228C68BB70FBDF9D97E913227 saw2009
1,666,225,863 *AF54AFC3195F8EEFB1B7CBC7FFCA7BF26DBE8A17 taktieked
1,666,225,864 *AF52228CAADAF92C25D7CA571F26721D152FADBF TALKBOBBYV020
1,666,225,865 *AF5339AD6C2929D68870C10E45B7654E76A4CBDC SCHIVERA7
1,666,225,866 *AF5B4E9FE15210888A2B23F716C2DAD4CAB2EEBA [email protected]
1,666,225,867 *AF502F3DCFD3310A95A1863E0EBA8AED739D937F tanjungnegara
1,666,225,868 *AF5AFF660A198AFFA5440D34CF77FEA9071E39DC scrbvav
1,666,225,869 *AF56962557EC2E844D9CFF2E4264DB431A343F80 tauchend5
1,666,225,870 *AF59A9AE1108453BEE0BDC5B6C4603386E4F692A sehcoorb
1,666,225,871 *AF5ECFF6216C2CD83DCEECE4BC291B99BACC3EFE tejumola8
1,666,225,872 *AF508F824B238938ED7E87322D7D0CBBEC9AA4A9 senegal-ruecktritt-von-diouf
1,666,225,873 *AF51D1D9288F11B8701E62D59C8219CA059B093D TERRELLKAUPPI
1,666,225,874 *AF555363E242BCDA111A62DD4B2597F2FBCAA2A9 terrencecaraher
1,666,225,875 *AF5CE5BD508FADE1AADADBAE3EE921B9FCD552B2 SGELEYNSE
1,666,225,876 *AF50E486D92796C468F5501D1F2DB4C1FFDCDDB8 SHADAL
1,666,225,877 *AF5D308BDB3D25D8AF8EA3EA1B0081C1AF2BBCD8 THANH.BRACE
1,666,225,878 *AF5C8620B19A4F1B780ECC5538FD0AF495DFA4E1 thatbigal48
1,666,225,879 *AF5E1EF35A45BB3243479236B42077DB3B532A33 THATSANA
1,666,225,880 *AF5935971A59453DCC9BF7453551CFCDF00C57DA SHEEPPEN1
1,666,225,881 *AF54AE7F77F4EF1529CEF7C46A961E5CCA97F3A3 SHELTONPOLLACK
1,666,225,882 *AF50B98769F13AC692E4EA3A0240D1BE30055921 thenintendo1991
1,666,225,883 *AF56F18AA0A22DAD0078C91426C300AC10BB4596 thesedeadmen'stombs
1,666,225,884 *AF5490C6D76CD2DBA79D93B0A617B61D4A0FC617 THE.SILENT.SCREAM
1,666,225,885 *AF5DCD8DC0C8AA3439DEBD015E5A1792773E21CC SICHEREIGNEN7
1,666,225,886 *AF5646783887774FCB29B2146A89D8EA67947BA8 THOUGH.TBC
1,666,225,887 *AF55DC4A36598345405DA7CC020511FEE6EC6521 throjan1
1,666,225,888 *AF57558908056C8882131261DB1936C309054A85 [email protected]
1,666,225,889 *AF538C0D43A28AD1987ECBD0D24899E74A7A5F37 SIVISAY0
1,666,225,890 *AF523E9C0D1496EF8AB13625EDCA11426433B177 SJENNA01
1,666,225,891 *AF51AF05C70E06A231A596C2DEE55AB49118A3C1 ska-je-k
1,666,225,892 *AF5AB01CEFE6D031D2596E8FF1C73B26EBC331F3 titusbatterman
1,666,225,893 *AF5DFD2E1B0F3D2BD47CEF473ADDB1566E64E93A SKJ123
1,666,225,894 *AF5B35D00929C14271393AF17FCF6D47EC6378D9 slackintosh
1,666,225,895 *AF518BF0AEB16DF3DD44AA4FE53CF18A1D175939 toneypinkos
1,666,225,896 *AF563B1FA8BB31D893283D2AD8223850C89B51F8 so glad (feat. mary mary)
1,666,225,897 *AF5BA743348149D9E12E47C10EC5A5911625AA7B TOWAGE
1,666,225,898 *AF5864A83EC65AF8E01E9CB4A2D96DD7A5804047 SOPHIE.LEONG
1,666,225,899 *AF5B88A50663D17D34405D5DAAE72DE72C10B29C (sotohara
1,666,225,900 *AF567CD7965C86CA7DC50A4BB1523A21C192109B travis.phillips
1,666,225,901 *AF5AC16B5C2DC1CCA44A07F510073E34CBE1BD4A trenishia.cox
1,666,225,902 *AF552150C0E80E929ED80DB73829E774DA126AB3 tréxeôpov
1,666,225,903 *AF513AF03384BA79B9400A70289BB4863404A318 SPENCER.WHITTINGTON
1,666,225,904 *AF56CFD3B87CD9AD73AADC435322DE9E2B4152B1 TRIDENTCRAWFORDS
1,666,225,905 *AF58690242D4270EF8ED2178B95C44EB8DFCA001 spihsredraw
1,666,225,906 *AF5C6AC50EE9C0732D35C3CC23F18F547B44BC13 tte
1,666,225,907 *AF54FB79E2FA1E44FD29FEC4EB4A97D1C95354E0 srekerb3
1,666,225,908 *AF5788DEFD4ABC2698B7593FB9187A85AC1E5522 stabat.mater:.vii..inflammatus.et.accensus
1,666,225,909 *AF51B1FB711227EABBE565A20734C1F326B05CAF staciewoodman
1,666,225,910 *AF516BF20F512218E04F1ADFFBC0ABE57BDC45CF ty.kelcanske.hodecky
1,666,225,911 *AF5BCC418D6FD7131ACD652387F4177AF15499ED STANTORIAED
1,666,225,912 *AF502D7D5237D132711637C46AF654C731ED7701 TYRELL.DECLOUETTE
1,666,225,913 *AF56AB5A8EF9B085AE271E2AC46C39EC9DA95B6A starveling Tut! there are other Trojans that thou
1,666,225,914 *AF5CCC068FABA0CC20CD405A023FCBFF71B10680 STATEVIS9
1,666,225,915 *AF5203B2B5C0A867DA2C45C959E5E9C8BEFDF720 statuierten
1,666,225,916 *AF5FE67FCA3331E8E23F18B36F588DA4B465D097 uittekent
1,666,225,917 *AF5803E50A4EF643A81E41271B284E1865934D71 STEWART.WHEATER
1,666,225,918 *AF55C0CE5E1EB366244F01C82F7634AC22114099 uknnede9
1,666,225,919 *AF53B79A537BC292562A776BC1277DF60C25A536 stuartmillberg
1,666,225,920 *AF50A98545F10BE776DAA13EA683C5198766DCFB STUART.PLUFF
1,666,225,921 *AF58E65F77A05FE72E226D7B3C660695AC521418 STUNTAKEADVANTAGEOF8
1,666,225,922 *AF58586E86D717476AAE74E6AF49CD36CD572375 STYLECTSWYNEKENTALK
1,666,225,923 *AF5E0E17904B321CC7B6688F0C6A30F42615BDCB SUBFIRE
1,666,225,924 *AF5C77AB94405A3FD973ADA87A3754949EDD8CA6 subpetrosal0
1,666,225,925 *AF576018BE0649C3D962493DCD3EC7047E13AAEC upassungen
1,666,225,926 *AF5B791931FF05D41CB5560FEFF65589F3C8B53F [email protected]
1,666,225,927 *AF5AF8BC3A18C770A42ECCF8EA7B9563280199A8 SUPERMODELSANDWICHW/CHEESE
1,666,225,928 *AF5AF0CCCCBCC1C5394B2F16450BF5B0601DAAD0 sweetiedear
1,666,225,929 *AF54FA9BC6EE26C743129B075BC39164B49E25F2 VAISHNAVISMSED
1,666,225,930 *AF58C215BABEC2485B5A339224260B8A6F6E8D44 VALENTINEARENSTAM
1,666,225,931 *AF57E88939184AEE31E9C7833C60EBA2C86700EB VAN COURT
1,666,225,932 *AF5833E443D30CE6CC878D5C4034EED469A36607 T3st.b4r
1,666,225,933 *AF5FC2A97CDC352FBBAD8F337DC5BDC43D50A7BA variations for large orchestra, op 2: var viii lento
1,666,225,934 *AF5C27EA4CB5105F2B9176EF161250D20B26A942 TA!LBON3
1,666,225,935 *AF506CC080074822CC7C43329EB6B17542CD759C TALKSTRAIGHTSHOT07
1,666,225,936 *AF5526764CE651A3FB21EAF64933C5776F2AD781 [email protected]
1,666,225,937 *AF5D4F4A3C42287BDB452C52DB1F1421E66B6123 VESTIBULE_CAR 'V/E/ST/@/,B/J//U/L_K/A/R
1,666,225,938 *AF5B6E186E94E9C632EBC468DEE7E57CC18BDAFB vic3royal7y
1,666,225,939 *AF586F9AAD52BF82536C7204D4AF92EC5F8DCA4A TATUMROMERO
1,666,225,940 *AF55556319992D26C5FECE6CC30D78B7DD5652FE VICTOR.COLASACCO
1,666,225,941 *AF5215E967ECB9516389598C7E4C0D15519BA5FE VILJESHANDLINGA
1,666,225,942 *AF5B29B9E695B4ACA74666AFA7A2B2BE6C954E04 VINAYAKSHUDRAKAVASTU
1,666,225,943 *AF52F1B3CEBD3C23B6A14F9BE994C11A88EC7623 [email protected]
1,666,225,944 *AF544A55E34480D5A283E7E15C058174DC4C26F2 VIOLA CLARK MOORE
1,666,225,945 *AF563237D586A7642553253517204AE4C459F813 TEN4NCIE5
1,666,225,946 *AF5B0A6C49A0AA6086708A658764AA734BFFA3D4 TERRELL.OKELBERRY
1,666,225,947 *AF559A62B357A63BDE751A28494CFB4D310043CA TERRY CORREA
1,666,225,948 *AF5872CF699519442DAED5D3C1C949BBCB303855 vncl
1,666,225,949 *AF5BD1E2D577068085E24C65CABA586B0EE6E1CB [email protected]
1,666,225,950 *AF5A7F8643A785963CF249CC2E452201F3F6824F THATSANA
1,666,225,951 *AF5E29ED8B471E959B764C6F4432A0EAACBC53D6 w222bd
1,666,225,952 *AF5DC4F8791F43A681C1484287ADC3DD41E53803 THELUCKYSEVEN
1,666,225,953 *AF5D4DB564B3649B8F1ECFF8C4F6E5B283DBB8C1 THE RIGHTS OF MAN 2
1,666,225,954 *AF5A2FCFCC462B7FA279424A20A83D71060C1E26 warrenfrattali
1,666,225,955 *AF53F9D3A0BB5BFB319AED9543E395859FA25FE2 THIWANTHI
1,666,225,956 *AF5A3BBF037E3BEF15ADA646307CE9BE600FB14B WARRENVIETORIS
1,666,225,957 *AF5ACDC428F9D90DAE3F9D6A76BBDC7591CF699E THOMAS.LUCIOUS
1,666,225,958 *AF5BF30BDAE512541D6B2CA32ED77C75235ED878 WASHINGS CHIGWAZA
1,666,225,959 *AF58880ADC9B3EF2B58DDED68A40B5905EDE805D WATRB
1,666,225,960 *AF56406999A5C02496E1B14BE41827BFF951D63B wederkom3
1,666,225,961 *AF5C6F27F4D5561DBA040A8276A5E81F18BB806C [email protected]
1,666,225,962 *AF5565E17346EFADD82BA45494F633C1627D4531 WGGROUPSREMOVEFROMSELF
1,666,225,963 *AF59D64D053747907D2EC29E7490BFB2C03475AF whitneywoolums
1,666,225,964 *AF5F866DAD354CB33BAA892CB7D6B78B00622901 tomasemfield
1,666,225,965 *AF52D114E9C495A9230FA9F0CF81D861CB7274D6 TONEY.BOLTEN
1,666,225,966 *AF540302F520A35F94FBFD32BB8D90A8390057DA WILLBERNITSKY
1,666,225,967 *AF533BF66A7FEFA6DD3D60B7A0B2F74D53CAFC78 TOOTSIEMONICA6
1,666,225,968 *AF542A60D2AB6DBE51FD75746DE00813E7C550A1 WILLIAMSGALILEO
1,666,225,969 *AF549040273775ECA718F916275F44BA4A118AD0 WILLISKUCZENSKI
1,666,225,970 *AF50D99C582D0448930F5C6370B589DD52887AA9 WILLSTANWAY
1,666,225,971 *AF55F5E54B60F6567A284CB6F694D53D4D8E05C1 TQP=
1,666,225,972 *AF52F08E0DC7093E93E1510AE6991E7AED940B48 [email protected]
1,666,225,973 *AF584C10DB2FEC41C8D9861D85DF828E40DCA0D0 [email protected]+ING
1,666,225,974 *AF5A145889630945217D455452793861057E7086 wobaga
1,666,225,975 *AF5CFD9D35B5876747980CFB7ADACC4E7104FF90 trentberkowitz
1,666,225,976 *AF57537CC2C84E250F57031C313D67B4E8FD0923 TRESHANDA-R-FRANKLIN-SHORTER
1,666,225,977 *AF5E1DD9097F7941599C31D6968BF9671F7216D5 TREVOR.ROSATI
1,666,225,978 *AF5D126EA7D4D74DBFE4DA663987C0092DB895D5 wrxf
1,666,225,979 *AF5BD29464CE7F1821A8213ADE6E10E2775D7E33 [email protected]
1,666,225,980 *AF54121BADD976D9C286878B65DE9EA5BD8389E7 TRÌTI
1,666,225,981 *AF5001639CDA7C891CD6C62F46D3750A53758111 WWW.HERMITAGE-HOUSING.CO.UK
1,666,225,982 *AF5FD26270F1CFD0B5E7F9FE2BA1D5FB08740D2F WWW.RIYADH.EDU.SA
1,666,225,983 *AF5055746719F0102CFC50D250CF5AFA2555A4E4 W]]X
1,666,225,984 *AF5348C346D4BB20C090B89CA912B82D82FA6D92 tte
1,666,225,985 *AF57ED0465DCFE36843A210A6AEC43E444257B9E XBC-
1,666,225,986 *AF5A295F93F081FBA9E9D3BCD5DD1E35A4C76F25 TUSS0CK-S
1,666,225,987 *AF57892588280796FEF1DB848072CC2D02FD9B9B X|{M
1,666,225,988 *AF564B88DF7BA381E7BD72EF810EC09EBD97F6DB [email protected]
1,666,225,989 *AF54EB0A9D09F0BB49B8D005D0DB7CEC5E784450 TYLER.SAWATZKY
1,666,225,990 *AF5834B8B7324AF481F92B6E73E04A39086B8164 xulrfeb2
1,666,225,991 *AF5FB419305F9D95AE1437BD62BE25F73DE834A6 [email protected]
1,666,225,992 *AF55A7534471C0171B762C0075D0317D8995812A [email protected]
1,666,225,993 *AF528043862A71C67F3C10781828AF2868C0DB93 udnukab5
1,666,225,994 *AF5A420D1C7F02397B91C2C39373AEF05737A195 UERUEN
1,666,225,995 *AF503F2FAB114127C0453E178533DF3F81A08FB4 UHREIFER4
1,666,225,996 *AF56DEA10A69B1ED65AC8FA080339BFF0B41C704 [email protected]
1,666,225,997 *AF5FE1CF1E9F6863FD06C0B325F2FC2A2DDB468A ULOVEMORTILLO
1,666,225,998 *AF51C094A5C9F35A6FD36B8D4FC4BA7CE43CD03F ULULERING
1,666,225,999 *AF56D864B94B79F64B5A55AE788F5030094DFA97 YINGHIN LAU
1,666,226,000 *AF58EF66BB146E009B2FAA65ECD91FFC16B33834 unclasp
1,666,226,001 *AF52BEFCF2555FC078C602F5FCAC2B32CF657142 un.parapluie.pour.deux
1,666,226,002 *AF516F61FCC4F4EF34ADB5F180277EBB09A3FFD1 UNQUES+!ON!N9LY
1,666,226,003 *AF5BACA0654F89B9F00AEB63A50FA9243A4DCD59 upton.ambush
1,666,226,004 *AF54CC940306AEDA1148AA338B007459891AC70B URANGPEOTPISAN
1,666,226,005 *AF5468CFEB31857AF237698193F15561CFB32BBD USER_TALKAIKA
1,666,226,006 *AF5B9F149EA13E82A28459AF4C006C84B100758E z2gfxbyscje0xpxkrcg
1,666,226,007 *AF5B58CBA37AD874FC4B107329434B0FD877AD73 [email protected]
1,666,226,008 *AF54A0B3D05BDD3AA6EB1AB99E04FCE5D2D998A1 ZACHARYLANCIANA
1,666,226,009 *AF51C013D348481425750AD9E5B8F7C552B7141C UUFILEXP4
1,666,226,010 *AF52C3EFDA228255B4FFC7EE4A418A7A6C372C32 uznzlsyj2v
1,666,226,011 *AF5868D56C9DD9BFA2E0553276573B16E3EA1F68 ZEFFT.MARA
1,666,226,012 *AF5AF78ACB6557B569D0F5340A7BE84EE1558F45 valeriyarobinson
1,666,226,013 *AF57FF31E1B19888DB9DD0E229AAAE37F8777BDB zhangyuteng
1,666,226,014 *AF5BDAB91693DF84F8C0253DEE2B66C31C3F7DD2 van-my-sinne-beroof
1,666,226,015 *AF531F1B4665CC8CE7144D0E301DEA0A7202CBF2 z]ju
1,666,226,016 *AF526552C1679B2013542C2023C3E93A479C926B victor.krump
1,666,226,017 *AF5B1DD6A8B4A38B981B41DD18A1E42E86C849B6 ингоульфсфьядль
1,666,226,018 *AF521F53310C126BF2349A02D15BCB2E2BA25F1C каптодиам
1,666,226,019 *AF5E50DB4C11D63B4906D8EBC303AA0A3846B1F6 МЕЛІЯРАЦЫЮ
1,666,226,020 *AF55F968E636B865A0D58B28ADD32027115E6568 VON-LIPSTRILL
1,666,226,021 *AF51C1B6000DFB338F5E327A041FCF9E67B5C31F „ужас”
1,666,226,022 *AF52DAF824B7CF8E72B08AB4FB6DD588A7AC0CA9  БЕКТАБЕКОВ
1,666,226,023 *AF5E8627629D83F2128BD6C0F6949A8D515CEA4C W?)
1,666,226,024 *AF5F33EB775156570425E737FAC4F56B945C536D [email protected]
1,666,226,025 *AF56F7D52969D1860338E4780D5A9CE55D6C45F6 WARPLANNERS
1,666,226,026 *AF58B2FD62988FD68BF76D863EAD0B17F4A55804 WATCHIN'YOU(FEATDUANEFOLKES)
1,666,226,027 *AF5A222DE682279F05F57603C8E6FDB574628E86 wayneclaybourn
1,666,226,028 *AF5D9885F3B853AC74A1336624A16286A6CBAC42 wayne.leyden
1,666,226,029 *AF5205917ED43D007F8A85D79B84A6BD55D410B6 WCNNBSW6
1,666,226,030 *AF5B548B0EC70A94CF335F23EAF568141FE245C1 [email protected]
1,666,226,031 *AF5A1F1155AF78E1F95CC3C7D197CE58CB27A67E [email protected]
1,666,226,032 *AF5CAF30E4772DF9D1056279EE96E0AC28F18003 westcoastrocksteadygroove(q-bert,disk,shortkut)
1,666,226,033 *AF5C5677BC29907267E38041354E8F6D928233AF wes.wardell
1,666,226,034 *AF5851D340980D9905B8D9EC40D830D6E926F107 WIGGLE-LOG
1,666,226,035 *AF554D42153F6C1A355E787E02677D4548D63E24 WIKICOMMONSGEORGERO
1,666,226,036 *AF5E9449DFDB01B7F83DBE873215980BA10DE498 071421JR
1,666,226,037 *AF514CCC086465FDC966A0D092B8CF19BF8D2D41 07804573D
1,666,226,038 *AF5DABE22CA0F3D98EC97DAF23F5E8BF2CA11A17 WILBERTPINCHOCK
1,666,226,039 *AF518C5CAD8FDD1C3A818B04BECA42CD9F75BD86 WILBURMANSELL
1,666,226,040 *AF532A24910396497A2B2710A36F8926AF251E2A WILEY.LENDERMAN
1,666,226,041 *AF54B5F23BBC9AB11391DDE4CB1688741175F0EA 097woof
1,666,226,042 *AF524112B9F38C3D8B282FC4998C61602CF7690D will.cornasaurus
1,666,226,043 *AF58A4BEA6FC934B729256A0D17A8D0EECD2BD41 WILL DOKURNO
1,666,226,044 *AF5A02C4AC46936503ECC2AB997D939F38B4FD1C 10294o
1,666,226,045 *AF5786DBD9B687C7FF1D073E427D414AA2A3E9B7 11181Q2W3
1,666,226,046 *AF54C73532F77FAAC09B8CD4C5982C1CE294E2A9 1191090 JOS HY
1,666,226,047 *AF5B61200591F661AAB33E2B8752D0A9DE74465F WINFORDCUTI
1,666,226,048 *AF5DD1CBC6CC043C39F6B8FA1AD512953791F9BF 1373481 AATELIN-LUKUM
1,666,226,049 *AF5407DFF042390BD3C4385BAB424799B20B1CDB 13BLASS
1,666,226,050 *AF57D28D1BDC9CD675E255F0AF99007CA43EAEE2 1414067 EIN-BUNT-GEMISCHTES-PUBLIKUM-KAM-AM-SONNTAG-
1,666,226,051 *AF5405A86D2D58E2B22A59F3B412F9E400A6837A 15-CISIMLERININ
1,666,226,052 *AF54EC1FDFCC027DE2E84D8DA9EFA566A4CFB28E woodrowblashak
1,666,226,053 *AF5631277C549DF45D6EE6525D651D139718F23B WRAPAROUNDNORTHUMBERLANDCAWWW
1,666,226,054 *AF519C5AC5D824C25EF2A83D295F72F1067284A0 writijg
1,666,226,055 *AF5A415B2F9DA17BAC22B973C25F114950FFC9C3 [email protected]
1,666,226,056 *AF5DDBB77C6ACBF2050416ABBE3A934E92055C9B [email protected]
1,666,226,057 *AF500BD0EC60C789241D7AE2A8DFC48A2D57B4AF WUTHENOWA
1,666,226,058 *AF5786E405F0BB657475BD0D3D5E687C89BF0334 [email protected]
1,666,226,059 *AF598867616D3004A270FBF31D4B4176CBC031CC [email protected]
1,666,226,060 *AF540152442A287F3732061EC0DF249B5201633E 1 ABCINTERVIEW
1,666,226,061 *AF5C738A395CE628EDEB57D958AEA8CBF4B14606 WWW.GRAND.K12.UT.US
1,666,226,062 *AF55D1C693C917813AD1E6C0734CCF0D85466C3A 1-antikacIlarIn
1,666,226,063 *AF51B73D594DD1C0AE787942B54135F80DF94596 WWWOUTTOPLAYCONZ
1,666,226,064 *AF5E63BB9486FF4AE9131061B163925475351A98 1.cikaricilar
1,666,226,065 *AF579D0A6C8F957EE62B092C5BDFE6331F750ACC [email protected]
1,666,226,066 *AF5E170EE7B18BCB3295C9B41ADB7A2CB5E725A0 1-EMIT-LEIMAUSTA
1,666,226,067 *AF5A54889FF24B10DBD50BF358416595345037F7 1 ERWERBSBEHINDERT
1,666,226,068 *AF5F43DFCF6C13E65BAED5DAC0844E05A097BF2F 1euparlamentaarikkojen
1,666,226,069 *AF5D681052698B3458F35588441177B3DE4CB101 [email protected]
1,666,226,070 *AF59E422CEBD34B03966D97FEBB0AAE29C038274 [email protected]
1,666,226,071 *AF5756E330EF4C0BE554283B507DC379BE003868 1-fritschibrunnen
1,666,226,072 *AF5AF24510D574EF3AB2DCB6BD180B0A25DC6172 xinfan-zheng
1,666,226,073 *AF57AF91821A709D21AC32289FF0BDB6156A8C9D 1GRESITZA
1,666,226,074 *AF560DD52C750920137805677A5C0E0AA090C394 1.HAIRNESS
1,666,226,075 *AF58C18C0A1873D75E052E83652D069DF73D0B46 1 kapitel
1,666,226,076 *AF58638925FF9E730D6D529DE7995C711F9E2763 [email protected]
1,666,226,077 *AF5E950E874C33FFBBC8F61F3460B3899B1C7A78 1.kotisivuillanne
1,666,226,078 *AF5979D4C30D46E92A5DC00BE64FC0891455F404 1 KURSSIVOITOT
1,666,226,079 *AF595C813F86588DD67541547EBD6548EE179D63 [email protected]
1,666,226,080 *AF59ADA458176FCF9266C048267FCE3F723C7855 Y99181
1,666,226,081 *AF57234B54A43AD2D67C2DE4037BB10B5B2435F4 yaderis.rosa
1,666,226,082 *AF5420A2C1DF51AB71E5A5B8699B4EDCE6A0C398 YADEVOL6
1,666,226,083 *AF5E462ADDFAE6E3486A0A8D8E9AFC6D2FA5EE8A 1NACHWUCHS-BASKETBALLERN
1,666,226,084 *AF5481D07BAFD44F2309B54020053A645991ACE9 1nichtmotorisierter
1,666,226,085 *AF508183BEDA85E18A5327071FBC09D3C3DED881 YASSERAHMEDYOUSRI
1,666,226,086 *AF503E0A385AE021A6A3890071C4C591C7014965 1 RUNKOTUPLALLE
1,666,226,087 *AF518639D523DC92746F3E7876ACB391884341E4 [email protected]
1,666,226,088 *AF5C546DC47456542085623D9802458B050742EF [email protected]
1,666,226,089 *AF54C1209A3B7317BEE65B1C2F10536B96FBEDA7 1 TAVINSALMELTA
1,666,226,090 *AF5234A717FFA6F7FE29C061549B9CD91D58281D 1-witzwanderweg
1,666,226,091 *AF50CD1CD3FF6C96F3B1719A1113C843D0178AEB 1XNTHPTRN
1,666,226,092 *AF5694D9AE43DCA09EA4B41B39C103DB73BE40B1 1 YKSIL
1,666,226,093 *AF565DF3F8E3DCF46D480502062876DFA2E7EC24 21.SHIMADA
1,666,226,094 *AF540E03558CC157AA0426AFD38C5E463A5F19E5 2227646 GEMEINSAM WOLLEN DIESE DEMNAECHST PRIORITAETEN SETZEN .
1,666,226,095 *AF5F52469B8794735201DC2E0D5E71BFE8CA6F22 YUKISANTOSO
1,666,226,096 *AF585E85CDD55061AF0BDAD212E7585175101207 2469079 sylvaatiikinlis
1,666,226,097 *AF59BFFA9B18782A4A75250A06DD5399B04B3EAF 2598457 KORJATTU HARJOITUSTY
1,666,226,098 *AF584ACCB1F8B5B1982AF361518AA034E5D7D729 zacharymontoya
1,666,226,099 *AF5050C2AA2E3BE0780948AEDE5D7CF00242A606 2695769 "-JOS-MIN
1,666,226,100 *AF5B8CE6144CEBEFC989CCCFDE77B67C31022579 26.kaldIGIna
1,666,226,101 *AF52C61DFB1ABCFC67EFAF8A3F52437F5E54BC56 2851061 raatijohtaakansallispuku-jamuinaispukuhankkeitasek
1,666,226,102 *AF56242A09B222D6B838EFCCD68BF7E68A3EF87C 2986776 voidaan-l
1,666,226,103 *AF5B13F607C857AC540F43E463E7E83B58205286 2A0B059E51CC7166BEC7F81B0985A1D4 COPS
1,666,226,104 *AF59BF947B4BBDB412E871A1BE3316EDF954E3FC 2AIHCUSAR
1,666,226,105 *AF5BE9DB15420878A47EE2D252CBDA3EA319837C ZEMCXA
1,666,226,106 *AF54B5359CDDCF24A9CECB9F86FB0BC371F0C0EC [email protected]
1,666,226,107 *AF52153F590A9DDB709C4A738ADE01F6F56169A9 ZINSARKAWT
1,666,226,108 *AF5D8411F2550F7AEEC28AD894E6ED96FA069E7D 2THECLARK6
1,666,226,109 *AF55D1B553AE905340D349F97AAB9CF08DAD6F99 2-TUESDAY-BEFORE
1,666,226,110 *AF52BFE5C715F875B66776F4FCFB242D82019196 321157 T
1,666,226,111 *AF5508A1C5ED127099E9CA9BCA41351CDB77A6D5 344damari
1,666,226,112 *AF548BB129AE3AA71E89C186E41AA4635B911FE1 3B<[email protected]#####P
1,666,226,113 *AF5E0A1B058D7F5AB7366CD203995621FD207313 [email protected]
1,666,226,114 *AF56398A353060CF52B9C446D6533E665AC350E5 3-kibbuzsiedlern
1,666,226,115 *AF5C25DF5833D168B9D7CCB86AF44A2312A887AC 3milbanke
1,666,226,116 *AF534922D93470BE0BAC06C7C6EF4D0968B485AF 3####@.~O.~O}X{
1,666,226,117 *AF5E827C34335802EEF515FF7768AA20E47532A6 3POSTILL
1,666,226,118 *AF50689A9ED7257F14005B1753E5EEE0D90CB001 коммунстической
1,666,226,119 *AF554F1DDA0565E0544C3A2FB45AB682C31F8BD5 НРАЙТО
1,666,226,120 *AF55AFB25106AD0E3312810D35B73FDD7A231A13 455001 ES.IST.ZUGIG.,.VON.UNTEN.STEIGT.LUFT.AUF..
1,666,226,121 *AF56CC19680CA2E3E077E719C34250ED5A5AA78A скоропослушнинская
1,666,226,122 *AF50046029B4F7F27A4FB6459146315708720F59 «ЦИТАТУ…»
1,666,226,123 *AF5D1DBA9833E7AD72B14656E03B15D25972DE9C (並且被稱呼作簡圖亞尼人(CANTUARII))、
1,666,226,124 *AF511CECFFDC31927E24CA83707A09655755BF4C 57317 ".I.WAS.HAPPY.LAST.NIGHT..
1,666,226,125 *AF58B164CDD5129915B6979082FB750679649028 5FIREBALLHOLLY
1,666,226,126 *AF5643219D9655AAAFD98141CC5E58092FEBEEE4 019tristen
1,666,226,127 *AF5197ED98477645994FEABF4E1ADED00F8C01CE 5KANTELUN
1,666,226,128 *AF5DBC1C5D6DBC2D86333D2C6273B9D2920F752A 5-LIITOLLEEN
1,666,226,129 *AF53E5F9F5F5CD7E22FD695BA2F1FAE589AE8810 05131810
1,666,226,130 *AF591EBB679EBCBAE9AF5F9457F561C7494ACD87 07carlos07
1,666,226,131 *AF596C039D693242A99819FA70BE8842397C7918 0squirt5
1,666,226,132 *AF5697279BB5BE76E88B8BE2C4C38C750493C0FD 1100773 suunnittelujatoteutus:arttraktor
1,666,226,133 *AF509863EB84C3405DCE5E84B603F77A24031B3D 604SAMARA
1,666,226,134 *AF50799FF0EF1620C2EC39443DDDCF470186A7A7 1237151 hertadaeublergmelinhateinherzfuerhomosexuelle.
1,666,226,135 *AF5A7F1F735658C6ABF36B251EB357F4A1FAF7E8 6ABWEHRENDEN
1,666,226,136 *AF5E1DB6CD283AEEC934D4A00D8B4CBB8E630553 6ASCURARE
1,666,226,137 *AF55493F657736B8887A6FDE3F09483E0BF8C65E 131803 dUnyada milyarlarca dolarIn dOndUGU dev bir endUstri
1,666,226,138 *AF57C783E63E99B8BE60BC41D3EC5CD191D97EE3 6BSWIDXEXPRSBSW
1,666,226,139 *AF5D115D7BD9EFF3C5BB51748FAE2AFA3306E33A 6CHURCHLESLIE
1,666,226,140 *AF56A0C1DD44D92994C9DC3BB8171982A2476043 14CREAM29
1,666,226,141 *AF538C67E0B786C2CECC60071E97106CA9441562 15jun1082
1,666,226,142 *AF55FD3EBDB0F552D2F405F679C91ED9FB6B79A7 6FUNNYBOOK
1,666,226,143 *AF59150C45EE7A0332FD1A85A5BCBB5F35A8624B 6GOFORITSAPPHIRE
1,666,226,144 *AF5C480888CD1F7FFE5712D615116BF16291C57E 6HUONOTUULISUU
1,666,226,145 *AF528B57975C9C620AB6F70CA373C1AAA1832EF4 1811525 penope.oy./.tuotteet..vaihtokoneet.t
1,666,226,146 *AF5DBB2843C8C7B00E438250261A6BC7FD16375A 19980402 Uniondale, NY
1,666,226,147 *AF57C6089AC7BF8BBA424BA032A67FB09DE40586 6MYCORVETTE3
1,666,226,148 *AF52DABD5B85CC7344A3246F4950D19451D947EB 1-ANTALAYSPOR
1,666,226,149 *AF53A0BFF8968323AE1DB5C611A9A41C6FA92A5A 1 armoj
1,666,226,150 *AF536EF9D72D0494EE3532A2D13C65C3D5C3135A 1-AUSSTATTUNGSPOLITIK
1,666,226,151 *AF5267120B3210D729616C45C005C48E6D1536B6 1.BRaNTNeR
1,666,226,152 *AF558748964DE260638A115299E7ACA5FBCB6FCC 6STANDESAMTER
1,666,226,153 *AF5B50B1849BDE78C216BE3348C88C187515923E 6WILHEMIMA
1,666,226,154 *AF557845283F20CA9E91ABD000E7DA4E76EE8DD7 1-FINLINE-TAPAHTUMAN
1,666,226,155 *AF58AA34F888297ACE2135720B562C9FA89736FC 1-FIQ
1,666,226,156 *AF547AFECF99660133A3D071431D9968EF74C10D 70 HYUNDAI
1,666,226,157 *AF5A90475692D03924A3BEC543AD076EA84D5162 1 HAMMASVASTAANOTTOJEN
1,666,226,158 *AF53389F011AA1A18125C12FDEB1F1A9406EF20F 765FATIMA
1,666,226,159 *AF50B20A6268F73EB0A43FD7839CA6C74B6F92A6 1.HIEKOITTAMATTOMALLA
1,666,226,160 *AF506F64663052836102589FAB067C86C1A596DB 7ABCDEFGFRANCOIS
1,666,226,161 *AF537E8569C4D1336EFE940A73A37C9F68049DAC 1 INFLAATIOTARKISTUSTEN
1,666,226,162 *AF505E0F8E8DDD8D6D5DE4B43CD3571C630C853E 1.inselleuten
1,666,226,163 *AF506BE00CD962F055551DF5E75A5574770B5FA2 7BSWGRDRIVER
1,666,226,164 *AF533C2EBCF221103E74AE3CB170C04E0F45B8BB 7BSWHOMOLOGACAO
1,666,226,165 *AF530BB338A8379743C37493D4E506C119137A74 1-kattoverhoilua
1,666,226,166 *AF599B0B085AC4B355DFA16595A14E7139ECBB7D 1 kayiyorum
1,666,226,167 *AF503C16703D9A11C15030EC10EC4EAE1DFC46BE 1krim-karte
1,666,226,168 *AF510A0FE0B88D263D4050CBE4D13CB2C6C38BE3 1 liederkreissarjan
1,666,226,169 *AF5165D51D6E8BCCD44411DAAB242B3DB9DF6A38 1-lybecki
1,666,226,170 *AF55BF6F89F2788C6B00B05C2A45053FD406F0AC 1.markkinointitoiminta
1,666,226,171 *AF5B302CF21F7682072F372B007A762A344C6805 1MAUKAISUT
1,666,226,172 *AF525CB99B982A446C655D60335878F145D048E1 1-mcalester
1,666,226,173 *AF53A5C701CAF4475F645025B5A38ABCACBA954A 7GRANELLUM
1,666,226,174 *AF5A49D562F7324AB90EEF577F3A831271CA43DC 7IVOITTOA
1,666,226,175 *AF58326376D6490630CE52A099F0EF33B4544BC7 7LONGSIGHTEDS
1,666,226,176 *AF5C579C6DD7F42DD4CE82DD18A5BE7658CE94DB 7MYMIRACLE7
1,666,226,177 *AF52717317765C5409C1016E9DDA1E5BC3F36D10 7NEGNIRETONNJIMRET
1,666,226,178 *AF5210AE4A2A201038AFDFE03049127F2F3FF8DE 1Q2W5988
1,666,226,179 *AF5643A07EFF2058311FCFBB8B82E4287D2ED0A4 7PEDOCENTRICI
1,666,226,180 *AF52C5D597760C1A7792669FBCBC4403DB124FDD 1-ROUTIEREN
1,666,226,181 *AF5217891EFD041D6C6EFD1F84DF1877D0EEFEB6 1.RUOTSALAISVALTUUSKUNTA
1,666,226,182 *AF5CCAD24235F794A69A3A11D4CA04527CED77D6 7SMILESCARMEN
1,666,226,183 *AF5E9F84EB8CFB5A3314284242361B2F8B8FE983 7SUBCATEGORIEN
1,666,226,184 *AF5D69DC0E3D6D245C5576ECCA465E01CE93409A 7TNESEIN
1,666,226,185 *AF553105768BA04B78BAA983078555982F267962 1 U-BAHN-PLAENE
1,666,226,186 *AF512124CB3D0525A694F744088EC10EC58009CA 1 WORLDS
1,666,226,187 *AF55CF27BA2112817A0924A75E9F21420F5FEB65 1 YKSIL
1,666,226,188 *AF5E391BAE3A080796FBBD378D179A2ECCF2473E 86608 kaupunkisuunnittelulautakunta hyv
1,666,226,189 *AF5B2B1DCE322749D514E3511FC2832CFAC3C600 869738 se johtuu varmastikin siit
1,666,226,190 *AF5E1FACD3C76601B29797FBE03DDA6ADFCDEC46 874032 the yield rose to 836% from 817%
1,666,226,191 *AF54AFDC14AD67D99E53CA978614A68366277E66 2080403 s
1,666,226,192 *AF5B0BF6803A96286DC587ACCAA9DE6F08DC365D 2095841 PAINIKE N
1,666,226,193 *AF55E51409819E244F6A0F05270F178F76488EE6 2-12startingwith
1,666,226,194 *AF57E7958E35723B72765033212BFE9A08EF22D3 2229562 neue.machtkaempfe.sind.deshalb.programmiert..
1,666,226,195 *AF50F337175B872C6D12A21281C0EB3C52BA0C17 2294822 liittymismaksua-ei-perit
1,666,226,196 *AF5797FFA22F4ABF56760DCD33E1760CEA5D8F9F 8COMPLIQUENTS
1,666,226,197 *AF5E401154922483455FC0FDCEBE4622FBBE4679 2520travel
1,666,226,198 *AF58133A20437D1799B5EA9D732E0BF82904DE9F 289-hetkess
1,666,226,199 *AF5B003F30FA4A6D00E12BA66CCF26BFB3556008 2BHEARING
1,666,226,200 *AF55B6F62A2EAC2500901FA57A02B92C82775C6B 8SEGOGARAP
1,666,226,201 *AF56EF3D7F7798ECD483BAA4E334B2B78BCD2B10 2kartellpolitik
1,666,226,202 *AF59E35E71C8AF65947B82CEA3B3758A34866795 2-KASHMIRIA
1,666,226,203 *AF59DFB92FE92017E1B0023F02B7A83C565FE62F 8SOGNISOGNI
1,666,226,204 *AF55CAE4EE4B1C91D6A8C45244DB2B8CD751B68E 2-PUUTARHAJUHLISTA
1,666,226,205 *AF5D08A7F559D0A91F0F181E10B55F8C68C742DC 2SINGIEL
1,666,226,206 *AF51EA63CA379BC6C419A428028A5DFBBFC98295 2SUODATTUMINEN
1,666,226,207 *AF54FC043A5AC6C6C72B115DB2287C26A7F69708 2thatsimba4
1,666,226,208 *AF533D8AC6C58048A232C4AE0854EABC56A56F0C 2vorstadtbahnhof
1,666,226,209 *AF55B4EDAA431D05685CD3C79485F84134888B88 966DAMION
1,666,226,210 *AF579BF0CE0F22F97A60F2097C89CA5057F8BD91 9888131m
1,666,226,211 *AF5BE7AE8F9D74F9CA81CCA65414CA74BBD18C19 99TASAISELLA
1,666,226,212 *AF5C4B9C0131C56D719E5AB94FB97AC0C251C06D 9ALDOPHE
1,666,226,213 *AF5C03FA1219E1431114FF5CB25D5D188A3F14B4 9-almaa
1,666,226,214 *AF5E10D064F5398B754D099179948BDA4912C125 31061703
1,666,226,215 *AF53828A305214D1E493AFAF2C22BC752E8E8D8F 36-EL
1,666,226,216 *AF50A7FDAC554DA1EC56AB693E17C3597D684F02 3DAHLOUR
1,666,226,217 *AF565B1C1CECBBEE6584E81DEC92A787971222FB 3EKAHSIAG
1,666,226,218 *AF56B2793BAE0B6B2767B2BF39450A526C0F61DC 3IMPFENDEN
1,666,226,219 *AF598944851F637A42A049C8DFA8D8C7A921B370 9radariste
1,666,226,220 *AF5699ADC2F92C4171E87202DD4F93CF1C52EBD0 9subcommanders
1,666,226,221 *AF5409EA4C91C3E7EB3CD8B2B916AEDB13A03EE7 3TWAPAN
1,666,226,222 *AF5864EF8EA6EFC5378E324CDD1911DECAC5F855 3UNMYRGE
1,666,226,223 *AF57D10684B2112136B21F2D9CA9034D0C0E7D97 3WINTERSTOF
1,666,226,224 *AF5F87163351E76CDD515DEC6F1F2EFB6D47F6AA [email protected]~-~-~)X(
1,666,226,225 *AF5E90C45900A6460642FC92C39D222B542473A3 418413 OULUJOKI-AJO.JA.ISOSY
1,666,226,226 *AF5A3E5FCBAEE641C1ECDC13F0E2C836DE2014E7 9WISEDOUBLE
1,666,226,227 *AF5A6B41657E09BE67BC6894FC1C6439912B206E 4aberdonians
1,666,226,228 *AF5438187FCB40CBA7D2C52209FA74B083AB23CE A17s
1,666,226,229 *AF5F3E43A2A3036464A2E489FDA8F2A6F20935CC 4KVILEKVAL
1,666,226,230 *AF5C238A016B230AEB8F0015DE581628B0519B40 a6kdh
1,666,226,231 *AF5850A75DCEB2A5EB9734F7C8A8915889D26176 4SNEEUBRILLE
1,666,226,232 *AF5CE0D8326673BDD8F83EB6D9DB956707A3A4FA AAA<I
1,666,226,233 *AF5BC1DE623364F672989FF645D246C4F873D61D 4THEPAM7
1,666,226,234 *AF5CAAFAD1304C09FE0FE0BD850E949BF6974008 AAB9:}
1,666,226,235 *AF5973A0767A525BF8AF7853CDCB5B5A9689A33F 5HEARTSCOOBY
1,666,226,236 *AF596A133CED83CE750F23E1925E429888FBCA05 5IVRERES
1,666,226,237 *AF56D9055796672F603A1E9EDE9971C237999101 AB_H!
1,666,226,238 *AF5A3725451A697B37F15B658ABC8611134A8F21 5NAMJESNIKOM
1,666,226,239 *AF530FBEABCF20D4FF1254517D1E1CCF028EC9B0 ABOEHOLT
1,666,226,240 *AF58999DB183CF351858259E2C6477325A067AB8 5PITINAIENT
1,666,226,241 *AF58BA28EC5F8592F73FF450F9A092290EE18423 ABSTRATOED
1,666,226,242 *AF56519BB3FD7253CC933A583A4B4C71D9EDE1B4 5RNWINDLE
1,666,226,243 *AF52599F0B2FF537118D93701F85711E4014D9D0 ACATHAR$I
1,666,226,244 *AF51B737FE455F6C8233C773003D85D2E5DC6248 5tabulatrices
1,666,226,245 *AF563F2FE1FDB96D141208C43B0E15529C062EAD adolfopochintesta
1,666,226,246 *AF52A2B9BF21BF9001D6200E72A0A9CB9D3C229D adp%
1,666,226,247 *AF5D92AA14916AA64CF83D1F8D63BF75F344CC03 aeebv
1,666,226,248 *AF5A59913AA5FC75F38A83368378423AE69AF7ED AFNAAIEN0
1,666,226,249 *AF5D5CA5BB7D6D843C02387CDFE281E33002F1BC agh,g
1,666,226,250 *AF57B4EB05B116FE33F280BEFA7CCADC344C4380 6TRECHEOS
1,666,226,251 *AF5883324C94A953696216B0177A5AD05DB0A302 AHMAD.KAMER
1,666,226,252 *AF52E5BC935A30FB3355B430F88886250D3A81C9 AILCM
1,666,226,253 *AF529F5DDF6DA6D883C2E632CF51D579F1557CEE 7EMILYGRETZKY
1,666,226,254 *AF51DD18A26B34E16A723E8BF32A13F6BFED32D8 AK8o
1,666,226,255 *AF5974222A8E438A19D840B81033711DE4922530 AKILANKRISH
1,666,226,256 *AF506E9778182CC4B4E4900DA11BC305AC80758C 7HAWAIIGATOR
1,666,226,257 *AF557C721D527EA4ED671563E947B6B6A3E9D46F 7KRYSTALLISR
1,666,226,258 *AF5AE4E961047BAC18E72B1FA8F280B2B27235DF 7MESNATIJE
1,666,226,259 *AF5DF18F5951E949E57EFEE1BBF21BC9E23D97FF ALDO.BRADISH
1,666,226,260 *AF5998A10200606AF158B4FD4D1329EB4EC97727 7RETANKE
1,666,226,261 *AF5F75FD402DEACCE7B6703E1041DD423560CF31 alex.pettyfer
1,666,226,262 *AF511BE2E842E048826847CA4B0F77A3341F2198 ALITÉM
1,666,226,263 *AF523F3E9B23A8C9E3361930B1C2E799AE4FCB2F ALLGEMEINCHIRURG
1,666,226,264 *AF54FB46DC67DC206F8E700244E4E5EBF70D9D43 ALONZO.ROHAL
1,666,226,265 *AF551FEA238B48180D5B6615F541D877772A054E ALT1F
1,666,226,266 *AF5499F2D8F5BD06C5D4DD9A949D6364F25F7830 AMICA81ENE
1,666,226,267 *AF5E49364E69BF0798E4521220D7DD71C6A31664 AMINYARING
1,666,226,268 *AF54818621E199090785B6671D6779764ADE44F9 amisutam1
1,666,226,269 *AF5D8281EC69AAA863C1B5FE0BFD15B361787F9B 8ELENDSTER
1,666,226,270 *AF5D2ADA3C9847CADCA899C88FBD3FC9F37D949D [email protected]
1,666,226,271 *AF53613E12EAA535E7D624C198CF020A66383B1B 8INTERLOPERES
1,666,226,272 *AF53B73F29F8201255FF73A7BEEC45642078EC4B AN7TW
1,666,226,273 *AF5A01AC35E62E4A0CF5C503BDC4506C4FFE1F06 ANDERSONAREDONDO
1,666,226,274 *AF5D88A1B8E927319D9416A5CF09102C59F8A850 8MSILYTCADYLOP
1,666,226,275 *AF5CE7AEC6BE81F4DDF0567CDD2ED0FE085EAF33 ANDREW.HERSHA
1,666,226,276 *AF5345296C0AAB654ADB683EA55DF6BB061C2EA6 [email protected]
1,666,226,277 *AF5517CE7019293643AF1BFCF3F56B1317FD68E2 aneyerimmedwithfire
1,666,226,278 *AF5F679D00FC3A66DA889329BC0D34D89E088B97 8SANDERSVIRGINIA
1,666,226,279 *AF5C3C0F6AAEBB01D08951DA03378862EE60CE4F 8SEGREBEH
1,666,226,280 *AF511D2E24DF9DAA7C8CED8315B111A8111DE976 8)~~~splat!
1,666,226,281 *AF5B2F9F1F7160DBEA470D92587907C49C078E89 a"o/(
1,666,226,282 *AF5A49651D96B881EFB0F37E8912088B3D3273A8 APC3G
1,666,226,283 *AF50DCB9C2DB59AEF7B05BB30BB72C158239FC90 APt:
1,666,226,284 *AF55F918053A2AC22C18476DEA4E09809B11F447 AQNPI
1,666,226,285 *AF5D621B4414495E8AC9496266058ACBF9F96557 ARIEDAS
1,666,226,286 *AF5FB229EB6B103BDDE3C6CE7EA4DD154BA7E260 ARMAND.ARREAGA
1,666,226,287 *AF528DC571F713698922338AA6BAE1A62748609B 9SUMMINGREGISTER
1,666,226,288 *AF53C67D0085B79C27C65CBD9DB86F92A8FFE56C ARON-WOLFSON
1,666,226,289 *AF542EB290E52C4C25C20ED1CA546F81A7223AF5 ARTHRO3ND
1,666,226,290 *AF5B643A2DEAFF773992EE25584079CAB32A66C5 A0CHH
1,666,226,291 *AF5EE668B84A952755C6121A74794019FF0ED1BB asddog
1,666,226,292 *AF5EE6D6AB33BF16D4A7855FF4A39D837FD4B597 assessatext
1,666,226,293 *AF5028F53928431EEFA58124BD74401324FE07C2 ATDZO
1,666,226,294 *AF5169FCC741E607EE21B2FCCD913E821FFA296D ATSCHEFF
1,666,226,295 *AF5B0055D7A2FE5EBEBAC913E4D7D4CF52681107 AUGUSTINE.GOLTZ
1,666,226,296 *AF59905A2FE478CC1D22657EBD48E6D442A5A0E4 AUGUST.SOBENES
1,666,226,297 *AF5831212CC4F4343ED0B50FADC88F3EF24417FF aul77
1,666,226,298 *AF513C67C5A5EB995449D87341D36088E66300C2 AAB"}]
1,666,226,299 *AF572A1ED1B8AA0AB4E13D3FC821D4941B50073C AABKT3
1,666,226,300 *AF5B8F6EEF9CB8A28E86DE7F3A1B09CBE00420D2 aw+ca
1,666,226,301 *AF5E5B30E0A667D2A162C189C0E62577DF80A08F A,,Y
1,666,226,302 *AF5378302CEA11FCD775E4D1387F1BCA2AD658E1 AZcO
1,666,226,303 *AF502D4E1AACC6EFD0E1E560933C872BAF833A5E b000udgmsg
1,666,226,304 *AF5910A36C07D67F19A46849D857E8D27E19D8ED [email protected]
1,666,226,305 *AF5F33CB925C4A7840A3C3000221D28887C14994 B5QSJ
1,666,226,306 *AF5338F89573D101DA3BF80897B8DEFD20A134B8 aciddubnucleik
1,666,226,307 *AF576E612784413FFBD907A9166243A37CEA7AF6 ACTAXIOMATICA
1,666,226,308 *AF5DBC77411934C9CD88C6BC3CEB3EB05B172404 .BALOUTE.283147
1,666,226,309 *AF594EAF011C4226E3E40A0672A6D6F0D2360964 BAMMIEKA
1,666,226,310 *AF569EFDDA0F4160C5F3317B4513D336F30BE833 ADOLPH.NICKLE
1,666,226,311 *AF5CD37AD5A45A8DCC12421C852FE7D3BA4CCF20 ADR0D
1,666,226,312 *AF5CBCD95880A02F3445BD569B63F8F39CBB6EC6 ad?zs
1,666,226,313 *AF5127562245FAC3824EF99B8D9F12F9037DA741 AFFICHAIENT
1,666,226,314 *AF52679BFE8CF0EAEAF9D9D42B62D600B979F480 [email protected]
1,666,226,315 *AF58831CC67D5E182E80436725A684109C610C11 ah,mafi
1,666,226,316 *AF5810AB7E04324625862D082EB3C0C1104EB0F8 ai_ii
1,666,226,317 *AF57A2A5683023FF5CC1F0E9C331C68B02AEF019 BENNYMEHLHAFF
1,666,226,318 *AF5C0EFFE81621FAC49D1501244A180B7DE7E608 AISEL
1,666,226,319 *AF5F2FFDED520E24A07352BD8BF9B5ED604D360F ALABAMAWIRECOMWWW
1,666,226,320 *AF5BC7F8C19165E0629AB45A1D059E98DE8C16AF alanmorelock
1,666,226,321 *AF5F19F142E1CC01B2945CB3257DA3CFABA1B151 alarareborn
1,666,226,322 *AF584567FAACFF74CFA62F2E692C478F2670C822 A;LC%
1,666,226,323 *AF505644944537CD6584EC809A8D21C8426DD0F6 ALEXISYANISH
1,666,226,324 *AF517280360463158A4B6BAC326E3CD8EA8CC3AA ALFATEH
1,666,226,325 *AF5C9B443A70268CBAE6BD779A4A094A865DED04 [email protected]
1,666,226,326 *AF58DC92DF898CB202D1B86347CFB212F361C8AE ALINE @[email protected] DOUBBLE CLICK ANY WHERE 2 STOP PLAYIN
1,666,226,327 *AF5EFE56207158480B2B1AF3E6859F6EEDD9DD0F BILLYGREENMYER
1,666,226,328 *AF569D6BCF87D0A91A84FFD4688F0CFA90B40A21 BIqq
1,666,226,329 *AF55393CA2CA2AE25F73E7F46C2179FA32C98FAB BKD_F
1,666,226,330 *AF58D390E087E9C5ED45B1888946114CFF60B242 bluering3
1,666,226,331 *AF5810B0A24DA4C4CDC30A6D52208069767A3A6F ANDRESHALFERTY
1,666,226,332 *AF5B68C873EF2260F1BF11163C9AB0891C1DF044 a new shore
1,666,226,333 *AF5DA48FE3FC35618C20CD64C33189B3D8C9634C anomalae4
1,666,226,334 *AF5D3BB7683BE5F012E7354167ED2728BF616541 bookereverts
1,666,226,335 *AF5F9B30890093BB74D3AC7A0E079B59C2A77F82 anteiso
1,666,226,336 *AF5FC9738F6422182505B63927226F59B11942EB ANTOINE.DEBARR
1,666,226,337 *AF51B259E6A0071857A51929B3393F0266675866 BOURBONKIM
1,666,226,338 *AF5785E2802D3C68E34FCE1D1E4608B974FB6B63 ANTONIA.DICKINSON
1,666,226,339 *AF5C26AB1A94897ABD00D9EC116420502307F772 AO7V8
1,666,226,340 *AF591B0CA6A302801F1DB6C74371BC09A7462CB4 BRAINTEK
1,666,226,341 *AF5ACE880B38EAF36A749B679DCEFD62A9954167 BRBH
1,666,226,342 *AF5551F6CF863B446D2BB3601D6820F328FA0EA6 ARHB
1,666,226,343 *AF5F827B26A5A607D58FAE99C3C47090359FC528 brooke-caesar
1,666,226,344 *AF5182D34BDE0DB4730E88DE184E222F55F2CF56 [email protected]
1,666,226,345 *AF530855EA8C9599D8F8AC1E57C829731098D73E BRYAN.KRZECZKOWSKI
1,666,226,346 *AF52B5BC642A8BE3C7A05D6172900BC4828C25CF bryantpalacious
1,666,226,347 *AF5588C3388E2FA5269627DF4A9375EAD9638398 b/;s+
1,666,226,348 *AF5AF72612B40107A9343B7DB38B144286CB3368 arthurdellibovi
1,666,226,349 *AF5AD5AF093940A8565609F5CEED4614F6CA8356 ART.KROC
1,666,226,350 *AF5B8A4C5487B935C3D454299D15BA35198474CC ARUALERIF
1,666,226,351 *AF58E38A3792A7915E4A1FFC6D3B602E62C4EE56 [email protected]
1,666,226,352 *AF50712F74E844D9E8480663798434EE97FF5688 AS6_P
1,666,226,353 *AF5043FC7AA53FDA7E61E172386A0400E2A96F22 BTLF+
1,666,226,354 *AF58532F27F73363AC0F7AF5CF9F16D631A0630B ASPIKENS3
1,666,226,355 *AF5B3498474A5D053166E773FC25EEEC08CECA4A BUDDY
1,666,226,356 *AF5C3917D1BC8973A141CC516AA31095E3CBDDF2 bvqgg
1,666,226,357 *AF5E5B0E17F174E587930C81C6FF0FCAB8D7D760 B}WR
1,666,226,358 *AF5546A9F75E8E02EC8812444578EE88AE833548 bygvrkernes
1,666,226,359 *AF5D9FB5EFF73F2421E44F9D39DCF9C56CE2A341 avfp
1,666,226,360 *AF5C1BECAC6EBA1D9DF35A1817961855CA101EF9 AWF8E
1,666,226,361 *AF5D2E5A9F4F370EA3D791940806595F0A805453 AZAHÎXWAZ
1,666,226,362 *AF55162FAED5E60ADCE0B301BF951029CE4EE4FC AZRULAZIZAN
1,666,226,363 *AF5635E320E27DA2265860B12DA3BEF551B0412A b0a9a
1,666,226,364 *AF57C6B5D3267C1677878ACF21CE8F860AA7A4EF C931480A-6D47-3317-A094-754C320F49F0
1,666,226,365 *AF5919B6122D10F611FE1BA8009F65F2BEA35B8F c9hf
1,666,226,366 *AF53F03EE900D9876D9B197DC4C0D37B9D94D7F7 CALVINREGUEIRA
1,666,226,367 *AF504B8F38B9882C7717A4F99C9D250491F358BF CAL,W
1,666,226,368 *AF5D23C71A439DCF055FD7D7136C7B42AF9338D6 CARIGHA
1,666,226,369 *AF5809148E85D621BAAEB840E4EAB0F9EFA1D841 carlieannewilliamson
1,666,226,370 *AF5FCCF5A4ED06ED56D2B247CA4B53DF83F2600A badala-maandi-zhar
1,666,226,371 *AF5AEFD1ED3BF93DF2B7DBF80CD3BE8C6C87E65D [email protected]
1,666,226,372 *AF5A17DB1A8A98965410943CF71C58772F247A51 [email protected]
1,666,226,373 *AF580D4195E19B05FFE0A74B271C71D2D3220F56 CARMINE.ROSSE
1,666,226,374 *AF5DC4943F785EEAFD35FB428B5A3FF642233AC3 CARROLHALLY
1,666,226,375 *AF5800B171FB300F4C8FD123E00F8D0105174BF9 carrollcarrizal
1,666,226,376 *AF5CF3288EBA0B6B516757E3EBAA03B2B27235CF caseletterspacingle
1,666,226,377 *AF5D60C6D9C2B13956694951FC27D25A4E6097B9 BARRETT.TOMORY
1,666,226,378 *AF52025A62C70C99E040BC492D5081CC7031C05E barrydesmeules
1,666,226,379 *AF5457EC4EE5B3486CB3141CC9FD0F8AC9AEF87A BARTELJORISSTRAAT
1,666,226,380 *AF57240FC09A78602EBF5C089249BB446C7B7C20 B-----B~0~O-;)
1,666,226,381 *AF587F03409DC5CDB94EE628A0E746A05B0ED3F7 bb1wm
1,666,226,382 *AF5570A70C23E572C0E442A2D1EC8D92F277E10A CBTU
1,666,226,383 *AF5BC96FB7FA863F8632C672293EBDEA6A5FFC2D cdub
1,666,226,384 *AF54FC48F74A5F995488CA6D2382BA87E7F9A2C2 BEAM FISHING TRAWLER - COLLECTING FISH FROM DECK
1,666,226,385 *AF5C10958A3C85804652B334FD8476EC47E9FE73 BEAUTIFULMORNING(FEATJOCELYNBROWN)
1,666,226,386 *AF5BA9046A8396DF07B988683E0C1B09865A883D changeyourmind(instrumental)
1,666,226,387 *AF5813B0C471F6204003ADDFF716043E7407AECF BFI=P
1,666,226,388 *AF5AD8D78A529BD331B2A7CE5AA7FFC50C2E52C9 BFQJ$
1,666,226,389 *AF56132549BCDD5485564403DECCD8285CA8D062 CHAVEZGOLDSTEIN
1,666,226,390 *AF550D1F01DB1F4AFF550C26BAF6B09801B876A8 BGMg
1,666,226,391 *AF5140FE7697761298A1924342FCDDA1A542F5E6 B?HME
1,666,226,392 *AF589DB6281A8E647F8B4EF09C159BA453226D8A [email protected]
1,666,226,393 *AF5A9029EC78EB39EBC6A745EC58BFE7F165CA88 chklláfůflif
1,666,226,394 *AF501B2FD7B4016DB7BFFB1AAD9C5BA22CDE502C chocnoso
1,666,226,395 *AF520E1E449C971082217F5863B11392E1FAB5D1 BILLIE.PINNETTE
1,666,226,396 *AF57666B39A73307E879A9BD99C63D44B893DDF0 CHRISBOURG
1,666,226,397 *AF5D3933123D4EB1445383EFF7C0D045A9D3996D CHRISTOPHER.CRISTE
1,666,226,398 *AF518965DD6147F1BA6C97A2C3CCB55417D50399 CHROMEALLOY
1,666,226,399 *AF56E01787B478861FA359CA94AE39D23688C5A4 BJFAR
1,666,226,400 *AF5C3BA3BC360769C5B9D7F6AA6D18ECB1C035A0 bkmwd
1,666,226,401 *AF5BA8FD1FA3FD3E40BE909A5346F4BF233149A0 blakerownd
1,666,226,402 *AF5C01787A756AA38798801E0B8CB1DD6394A25F BLMLL
1,666,226,403 *AF5790FB7BB831C88319F99FED2904FB9280F2B3 CKY5O
1,666,226,404 *AF561C804A902962EF84208704FD307E7363F385 BOATIDEASHURRYWANTS
1,666,226,405 *AF5538660FD413D28E9C487A63D8CC6F9E30BB2F CLIFROOCO123
1,666,226,406 *AF56F2D0E03994F1E9FE83C4002D160FAA8D7115 CLINTONHEFFLINGER
1,666,226,407 *AF5C54566BED38FD88A163B797629E847C526783 cloa.
1,666,226,408 *AF5652DEE62880092FA166F4E7AD70F1E2A2366F BOROUGH-HOLDER-'B/[@]/R/OU/_'H/OU/LD/@/R
1,666,226,409 *AF500EED1C5B9BAFD7E25FC878D676B8D587CC3A [email protected][email protected]$
1,666,226,410 *AF5097B16FA2D64F2779FD0FA8672DE507B2AF01 Bp"!
1,666,226,411 *AF5C297D8F183AD81B682EFD35F01B3D6329C6FD CODY.TENCER
1,666,226,412 *AF54C65701EB2286802B11F8B42D7653B3D0D20D coevolutionary
1,666,226,413 *AF508E1D635EE808D98181713B6FD03129C52AA2 BRAUKEßELS
1,666,226,414 *AF5577EDC26C50B5F706F4ADC343EB0C3C443F37 BRAZIL.ONCE.AGAIN./.SUNBELT
1,666,226,415 *AF54A4E9A3768DF57A8D1BBA2BD1A55C1034EFFA CONTENTARLES
1,666,226,416 *AF52D62D3B3CAC85FA018175A358096731DDF549 continentalistsb
1,666,226,417 *AF5435F95EFEBD8115BA28319270E5ACA4E31717 copyrightsvg
1,666,226,418 *AF57DD63B806FEF088397A9F53B64C4725311F8B cosmosbank
1,666,226,419 *AF5522E1A6C6903C178F1C3D84E3CDAB1F331D9D CPF$M
1,666,226,420 *AF5BC0ED00515AC7CC3E71151FD0B6A74E6E75E0 BÜCHES“
1,666,226,421 *AF51DC9E5ED5D07D4B9739EEA8E1C3509ABD6AB3 buddyarra
1,666,226,422 *AF5999E359C158E50310841D6723EE00B85B6665 BUGS3641
1,666,226,423 *AF50D227ECF20D939AC07246BBC1DC143B33B6BE b)uwe
1,666,226,424 *AF5BC4A54092AF373304A311D8738EE715E5AFA8 [email protected]
1,666,226,425 *AF50385A0D4106B06F7810AF97D73E7194E1127D bx=d(
1,666,226,426 *AF56943877186D62668CE453751A0CB8DF36CAEC c06lz
1,666,226,427 *AF518328AD3D15061FC3CE1E284C6D034549956E c_?w6
1,666,226,428 *AF5C15D0E43EF54C220549E58657906DA59A5D61 c0iuh
1,666,226,429 *AF5EB2C9719DB7A8D2F25AD2943644CADAF36191 cwwdv
1,666,226,430 *AF547C704637CA64DE9E4BAD8B216B50A90F040D c7_d
1,666,226,431 *AF588D431CCA4A0D46F5DE6BDF9FFC84D0823054 C,7I4
1,666,226,432 *AF5CA936986FE2ACB6DF39A4FC5596A4982E4CF2 d5ar?
1,666,226,433 *AF5E2D8BC70EAAFB01BAC4018C2507BADE9A2CED d7_,
1,666,226,434 *AF5FDED6D01BF6922FAA66619CB8C9C447AAB7DD cardinalbancorpincpa|unitedstates
1,666,226,435 *AF59F6FCC6BB090874363CAB1042F2CD2CD90E0E CARLOSDELASKO
1,666,226,436 *AF54935CC00D05342A7EE91D0000CB6AA7461F92 DAETESHIA
1,666,226,437 *AF598113B33F8365E9650D627501C4485757CB98 DAFL)
1,666,226,438 *AF5CD7DB9EDB22AD68006E5E0BADF15927E3E98F DALTONHERMANDEZ
1,666,226,439 *AF5685135A48EC9330FF4452DCD65BD8210B6864 daniel-adamsen
1,666,226,440 *AF58A24D31689FAB67DEFD5B5EE5F40D096BE6B9 DANIELLEFOY
1,666,226,441 *AF5446A533F96A8CBFBA92AB29E06CB7060EAB62 DANIELRENFROW
1,666,226,442 *AF534A6DD3DB1BAC9CC00369E0DAA013704D3B9E [email protected]
1,666,226,443 *AF51DE7D60441E9C0C9852DB22606CE2ED3887DC DARREN.SHIPLEY
1,666,226,444 *AF519E2BDE1D27D5DC11C451F04C1B0A99E8D374 DARRYLPANTLE
1,666,226,445 *AF55F1E8C1764F5D8125BE1D81BC22E90CCA9DD3 CDI/6
1,666,226,446 *AF529C3B150852C11E966B4F74AC3306476248A7 dbf4p
1,666,226,447 *AF5BBABF61622E028EC2BA207C8F3E106DB4EF27 CHARLEYDENICK
1,666,226,448 *AF5A39C3EBD1B114BD2A32CAB8897F0DA37F66C6 [email protected]
1,666,226,449 *AF52CD24B9D10691BE5968CD23C2BC74A456FD22 DELODELO7
1,666,226,450 *AF52C768117143090F2BC491371D5B206D1E3BBB delttaw
1,666,226,451 *AF52559CEE62BF9B48BE02D79648BCE13DB2FA4D [email protected]
1,666,226,452 *AF50C3C314B775F5D7288C2E79AC84BDC1CACDEF denvercourson
1,666,226,453 *AF52A22DC22BEFD10FC66FE5601A180BC0ECDE17 denvernall
1,666,226,454 *AF5B0CCA8206C1AF60F7439D92A29313B47B8B2B DEONLINEWEAVER
1,666,226,455 *AF577B532543166AF155961553CD0E9FE20EA551 chippertheking
1,666,226,456 *AF5028C4774F95F525BFED23BD55A6602A69940D DESHAWN.CALAMIA
1,666,226,457 *AF5BFC4A647F7BE9EAE8D5780E54EB9F40AFBA5C D(EV
1,666,226,458 *AF598AF8492EE1EA6BC919B62DAE4AE2FEBD0FB4 CHRSTINE ON CRYSTAL
1,666,226,459 *AF53DA40F0CBB06B3D45F3DEFE618355CCBC8FC1 cinquantenaires
1,666,226,460 *AF595FC07542C01FAB869C15AAF137D8971676EC clarapanjaitan
1,666,226,461 *AF56970CC0F2A105737C291101E28D0DE9AB491A DINOFLAGELLIDA2
1,666,226,462 *AF5F506BF84B78F14EBC916A8E9DA0034A13934B DIRKMCSWEENEY
1,666,226,463 *AF5B54FCD34DE1A4A930F668F7463DC585FEC2F7 CLLQS
1,666,226,464 *AF5558D9B1FC458F275BB4651EF531E83243E996 diwte
1,666,226,465 *AF5FB1C93B607716898B480A87E18D924D7E4A47 DMUTANDA
1,666,226,466 *AF56B7B86AD26D718397FAC0BF4C49627E7B419F COLLEENDARCY
1,666,226,467 *AF5B6E281F44CE377470567353F07FFC536472F8 DOLLY.TOH
1,666,226,468 *AF55B4E1A6B9A25D56E5170E0F806FC80CD4BA00 CONRADRAM
1,666,226,469 *AF591B8A789B917BF872E3A8F2083F3F27F758C0 dominiquemonie
1,666,226,470 *AF5001C11713BE5DEA06D3E59D3EA96040909E95 CORDELLKROTZER
1,666,226,471 *AF566149401BD62B7EB19AB63BA1A83D9BB1DD09 COURTNEY-WHIGHAM
1,666,226,472 *AF5989733A4C33B9CA37443B819855E81CC3A66E covn
1,666,226,473 *AF586CF42FAEEB0E0740A31823ACDD63FEDDF8CD do;(t
1,666,226,474 *AF55FFA595B7ED09DE093DCE034F991E1015DE8D [email protected]@bili+ie5
1,666,226,475 *AF5EC35F1A8045A213888C03E8F90318375E3450 DPAN5
1,666,226,476 *AF5DEA3094DC4E426C40E6A7E7B75338276F1495 Dqpd
1,666,226,477 *AF5E29F0768CC013D7E5200A528AA926F64A544F drv)
1,666,226,478 *AF59308C43863CE2DB20148EBAB2B62C100760B6 DSHONOURABLE
1,666,226,479 *AF5A50CE8C9D6C5D2127EA812A306D0B8CD91528 csme&
1,666,226,480 *AF5986959DD85658043E43A6CB2558EAAC614E02 cugbj
1,666,226,481 *AF50122701FDB333C8993AED72F8EC3FA2CB3A9A d&$)
1,666,226,482 *AF59556DCFB8A4D3513959C78E6B123B73585935 E!\AAA
1,666,226,483 *AF56069F982EF33AF0BD8CE33A70893C34F1D690 D24PJ
1,666,226,484 *AF5284BFBA236D6EA0E5DF8F65099AF155D175E8 D3AD1!N3SS
1,666,226,485 *AF5B763C9D2ED0F2CF1D510586997D07FF1BA88B D8G2B
1,666,226,486 *AF5B9B31BB43206228BA82BEBC4A162A10EABEEF EEBA
1,666,226,487 *AF5574006DD2DCEB0B5CAD5290EBCD7A19AAC8FC EF=3W
1,666,226,488 *AF531CE4A98EB807F5A5AC7B10AF7D77CB53C427 dallashefler
1,666,226,489 *AF5428901E0962E9CF9659C0ED1B6445DB9AC4A3 DAMIANHOLECEK
1,666,226,490 *AF5761306D6F7973231BEE93041A1CD8D4F35EC2 DAMIENKANSASCITYCRIPPLERI
1,666,226,491 *AF569D8594AF38D98DF252399E816D469EEAF7CE DAMON-ABRAHAM
1,666,226,492 *AF5D3AEC5F2716080B35C734E99146EA3A9CCDD0 egr?j
1,666,226,493 *AF5FFF3ABCBF2BE9DF4146FEB7061CDEDFC6C8BF ek8+-
1,666,226,494 *AF5136530FECDD95B363CF998E5B09B6C6BA1FF8 ekilffahc5
1,666,226,495 *AF511727018BD0B41E52373F1B937F8D5A3619F0 darrelmellendorf
1,666,226,496 *AF564605464C7B6021E9A52A9E702C4350976BFF DATZBSWED
1,666,226,497 *AF5F58782BBD827F3F3D585AA72F7A5EE38776C9 ELjp
1,666,226,498 *AF52ACF17457EE3A8133337952586E5E640BDD74 [email protected]
1,666,226,499 *AF5E90388B55CEA842BCEABD3C71704C110D8AF4 ELMERWESTMORLAND
1,666,226,500 *AF507669E5AC3156047610093EE05E0C0372BEFC elsewhereprime
1,666,226,501 *AF549D00B533A88CD71C09FFF60577F7164574A4 ddw1
1,666,226,502 *AF561540089E02ACD7252ACDBD660D54B69FE488 deep-sea lead
1,666,226,503 *AF567980FB78374C2EC3D9553508CF51EAC328D0 delmarhentschel
1,666,226,504 *AF5EED8EFF8778F4C0F4CC329820B078B2165210 ENLARGE
1,666,226,505 *AF59D37482A25EA618B867EA3842F89FEF0AD27E deonkrulicki
1,666,226,506 *AF5D44409DDBBAABA021B9A870ECDD654D55BB4E [email protected]
1,666,226,507 *AF587A7284C79BE9CB0883E14EAF3D26525CA7F1 eq(g
1,666,226,508 *AF58FF20AB97F622FA6853862C18A0454C910905 desarrolló
1,666,226,509 *AF5DD59FC2D48330FDA1D81139AF093F012E69F7 dewaynekiral
1,666,226,510 *AF5F1F3ACD974479260A2D5F0061CC7C07056EEC ERNIEHONAS
1,666,226,511 *AF55B39383A6C8494DF63AAD698D37FA9560BA0D ERU12
1,666,226,512 *AF51B340768864E73F1BF987B2D916F433D49A00 ESTER VENTURA
1,666,226,513 *AF54EEA74AC9973A602B6B2AFFDCA3C926D01890 etdjiwga6
1,666,226,514 *AF54B2C484CF672A697A8329A983063BAABA73FB DHIRUBHAIJ
1,666,226,515 *AF59D1CEBB44864FC8B1383C12BFD984204A7C47 etrainded
1,666,226,516 *AF5B3D3397FF47A278DF7C543A996946C29FF715 ET&S
1,666,226,517 *AF5A62FF84D18A989396DB717EA13FF09884A377 dionovalf
1,666,226,518 *AF58EA91D77FF44933DBAACB357D7E87B2CFBABE eyr"u
1,666,226,519 *AF50F510A52B08C0905CD5264E91E81EC4173066 F10139422
1,666,226,520 *AF53001CEAE3D597340158E03F4A828C3B35355B FABRIKSPORTHALLE
1,666,226,521 *AF5B33CF7CB2B2370356E81D355F6BCD9BFB68DA dkcbb
1,666,226,522 *AF51C6213A30AE51494112877E292507726AA889 DL3M
1,666,226,523 *AF5F137633B9AEB9F87CA0078D601368C4B94532 dmzxx
1,666,226,524 *AF5DB4093E12B755F1106B607E6EDD10A6F0EE77 DNYL
1,666,226,525 *AF560AD22D0F05D0A14A9FC958EF2950110D8CD6 D+OKP
1,666,226,526 *AF57B5C53B30323B29A40A67FC13BB352AA413AF filebbsw4
1,666,226,527 *AF55C6D4EEE3D56CEE433D699DDCA372300D844A domi0308
1,666,226,528 *AF534E07E77AE7F808A826287FF2C07F62B5FF3C firomski
1,666,226,529 *AF50C2E12D91C165F602852278B89BFDD8E49875 DONNELLQUAGLIANO
1,666,226,530 *AF58F491ED0931927534BF8FF4F7BDB9E5FE70B4 DONNYODGERS
1,666,226,531 *AF5A5B80A6D308C1B08ABA61D8DEA28BF2E8F147 DONPEDRO LADYBEATRICE,IWILLGETYOUONE.
1,666,226,532 *AF580233AE4706DC2BD94581113C169E34A54F6F FLOWSTON0
1,666,226,533 *AF5DDBE5415C98F2607C40DCB922E7FB600D642E [email protected]
1,666,226,534 *AF5D13C409AAD4BDE658134421C47819A0D5A6D3 dotakoh0
1,666,226,535 *AF5A4E9F9C8E6AC224104722B5430C18F432F1CF Forged.Documents
1,666,226,536 *AF56B6987D7B89A09378EA79685FEE9EF6F34B92 dp17=
1,666,226,537 *AF57CA96E35AA99910F18B61DBB3CDCF6E2D8464 francesmollet
1,666,226,538 *AF56559CED0F9204F7CDD911B6984E85462D54CB frankalsbrook
1,666,226,539 *AF556C73519B5F963AD8D34206252441EC0F9061 DRAMA:-STORMBRINGER
1,666,226,540 *AF5D550A80686B9968839D2DDAE02360AE57362E FREDDYLORIMOR
1,666,226,541 *AF518C6A47008B2C721E5A22A986F84FFC57283E drlj4
1,666,226,542 *AF5A3D0C1C05F6AB2851A8673F40205AADF6C50A FUCKITT
1,666,226,543 *AF56C77B06DAD3C2DF047C9BC62B34C0F085AA0A G.160PARVIFLORA3
1,666,226,544 *AF5425014068D0F341E6DAE19B3BD66C1D364B35 g3n3rou$-
1,666,226,545 *AF5CCC958B97D36BDCB5511FED2FE2D605EBD0A9 GĀJĪBU
1,666,226,546 *AF58209A27D9082FB2758D7BF0CD5C2C7B369CBB [email protected]
1,666,226,547 *AF50C45DB107651D52090D3C8C69877E6F739A08 DULCEFINAL
1,666,226,548 *AF58ED5604A452219FF1165B1AE284312B18E8BE g*bm
1,666,226,549 *AF5592D7471CDCF2C62C7BE2A477EFF80201B879 d+!x
1,666,226,550 *AF5704F960AA0E4519BF43D3B591B80BA2618DC5 d.yd.
1,666,226,551 *AF57BC06F9A9EC4E22A4AA258A66258870883F9F DYLAN-LIZARRAGA
1,666,226,552 *AF5DE157D370AB3FD8151B49C14719CF8A9CA6E0 DZZUE
1,666,226,553 *AF5574BA1CB23110C10B5E367E693E88F1187EFE giallitaju
1,666,226,554 *AF5E3840E79FB22A39B97FEAEC6F471485F8EF24 easylover(radioedit)
1,666,226,555 *AF5490E5A6C43A5CDFA8FC4A24284D0AA80DE112 gioely
1,666,226,556 *AF56F8A6139B9A2021279C1142C77E499E6AC67B ECLISSAVA5
1,666,226,557 *AF57084D1E3A63F18E597D53C54141B79BDBAC3F [email protected]
1,666,226,558 *AF5A14A0FC36FAADFA7727B028A41CBBC272DD5B gladiatoons
1,666,226,559 *AF563DAFA0C9F80CD0D10F3A055D2BB3901CF234 EDGAR.CARDEIRO
1,666,226,560 *AF54933BDA411FF6AD3B911D715AEE4328ADFED8 [email protected]
1,666,226,561 *AF5D46D3D215E5C4738AC7769FFB671A4CD2E986 gnueliaw
1,666,226,562 *AF5C3CCA197B69A08AB41488D1F536C3FC90B54A EDSTH
1,666,226,563 *AF523965C99C7CD420904D0A63D17C937B780967 goldwynismen
1,666,226,564 *AF5770984D2DCEC481D80F3C255F390AC706B644 ehcaluogs
1,666,226,565 *AF509497BF1402D38ECFFBCF9C62C905C1026B7E [email protected]
1,666,226,566 *AF576553D5DACBE6F8959CC146435DCAEC51CBA8 Groovejet(IfThisAin'tLove)(GrooveJet)
1,666,226,567 *AF578319089767BAAE9BCF6DAA668A567D7D620E gschmml3
1,666,226,568 *AF5AE9FE240F4CA2151966C9AFF11AAB5B2BB83E eklenerek
1,666,226,569 *AF5F04A426F25893E0B63316153D8798DE508404 [email protected]
1,666,226,570 *AF52C2B2B78EB7F27B5AF467677D696C97F52757 gusmucklow
1,666,226,571 *AF598F7EB6DE2CAA2E610EE923642094C8D88247 GUYSHKRELI
1,666,226,572 *AF5605C3359F91876A17FA1D18F1F5338833BDC4 GWYNHWYVAR.1.0
1,666,226,573 *AF56D1034D496F654F3B7B922773337BFBD7F91A ELISHAMARINKO
1,666,226,574 *AF525807E7BACF57F69B6D99EB4C53ECC7CBAE71 h-\{
1,666,226,575 *AF545DADFFA22D4BA3072FA30E046BC429D09C7D H3731205I5
1,666,226,576 *AF5CE4FBA3F8FDBF03FA3E724D966BCFF92D078A elr(.
1,666,226,577 *AF581E01E0670534E22A6DE4DEC4B99C88400122 elvinfamilia
1,666,226,578 *AF578DD728B0BFC0AE112C839680E6073CA6B39C hamidharsini
1,666,226,579 *AF5AFDAF4C44253461315F3203E756E19E6DFD4F EMICHALLS
1,666,226,580 *AF5C5AFB726ED75E377B4E65F7B29B6CB659F9AA HANSSALSBERG
1,666,226,581 *AF54128EE0B789080D68C8057C234F361D0F0F22 emmetthusky
1,666,226,582 *AF57D6D5D072AB0BF63754D6BD002A630B183E90 (emomali
1,666,226,583 *AF5628F6653105F00C788E2470874F0B0570E7F2 ENCHERIS4
1,666,226,584 *AF556EFB0A014941EFCBA0BEB500F98A6F9F9584 ensam
1,666,226,585 *AF50D90660CD11E4EB98826975B0B6501865055C ERDOBER
1,666,226,586 *AF5E1FFC6F9652D7704C728FB8F471A1246266A4 [email protected]
1,666,226,587 *AF5168FEDBED7F6BDAA4B7D98DE64646B7B8FD83 ERNEST.STOFFERAHN
1,666,226,588 *AF58D67C70296B6F42369A1FB5B7E1E20392B7E0 ES6DDNBP5GAZ03S
1,666,226,589 *AF5453237F8A65CCF3E8009965CE516F34A80695 [email protected]
1,666,226,590 *AF5696DEB3BE0D4FD5FD1E61D6D71111942E2A44 hl$+
1,666,226,591 *AF59A10640CDA4823B85C7426B1D256CC865628E HOOKSIES
1,666,226,592 *AF5D91E530981CA50E00068D8C06CC58FF85BF5D EUROPE16160TALK160
1,666,226,593 *AF5C53D41B3162F5344DFA85E764051EBBD8D47A EUSEBIO.CABAN
1,666,226,594 *AF59A92C19191F04D76519FF376E70426F4E7F09 eusebiomurat
1,666,226,595 *AF5FF85F2A7AC8FD8774B85ED0840FE4B1AA6E4B EVERGLEAM2006
1,666,226,596 *AF50ABE4A662E2FFDCA3B90F22E42D44B0C90C2F [email protected]
1,666,226,597 *AF512822353374B3F131D2FC7A2483F417374835 EYCNG
1,666,226,598 *AF5B61127FC0120BA0DF200E5D6F9942AAA484D5 FACILONGO
1,666,226,599 *AF51B3CE3D050E4FE83AFF6C17F14627FDE108E6 fair-day
1,666,226,600 *AF5BEAE0B4F86F38708B580D2F819BBC7D7A7237 farrel onwe
1,666,226,601 *AF52663ADA103437221D35A71AF20FC25682DAA4 f.ea
1,666,226,602 *AF58520FE48522EEAB78040D85526C30017CBEC5 FEIAMAR
1,666,226,603 *AF5847620DC3C86682E005B176D3CB867E24376B FELIPEUITZ
1,666,226,604 *AF52F837323B91EE5AD050CCE95D3C47AC1E40A7 [email protected]
1,666,226,605 *AF5C8ABA2F49B223052C3E6629791BBDAF4F8934 FERMINNAHAS
1,666,226,606 *AF5308C3412597D4623361C3D12A0A21C831D756 ignoravo1
1,666,226,607 *AF556B751AA07EFC8D73494EFDBFED24A439777E ILOVEFRANCINE22
1,666,226,608 *AF56F47CB43214CE3AEE9018CF1274210A3450A5 flashscan2
1,666,226,609 *AF55C0D336DEC455FAF0BC743AE23CAE96004391 FLETCHER.SHELLING
1,666,226,610 *AF522570268C4E3EC5505A8605FB720F49ED8F40 ILOVEYOUDOROTA
1,666,226,611 *AF57AC6D7D06C48E94AD0E217029B35C3355360D iluvdelete1995
1,666,226,612 *AF5B9C08324643D795B2F38D5299DD9C08BD4628 FOLLOW-UPS.JASAP
1,666,226,613 *AF58073CD3C6D8BFA11E9A197C614D33A86F98FC I'M NOT A TAXMAN
1,666,226,614 *AF5626EE6E45B0B8F6C4A15671D3BD45BCA9235F INEVERKNOWWHEREYOUARE
1,666,226,615 *AF58509C39DCF55215C1F5B9B4C42EA7CD3B5C8A FRANCESFRITZ
1,666,226,616 *AF5A719E7E7A469D92BC40A4F6D82EC0CA9D20D6 FRUNZULITA1
1,666,226,617 *AF5B2E98CF36ED7D6D465B60FF35181B09B495B9 IRNIS
1,666,226,618 *AF5C2D0C4668F10795E501C6958950472AFE8A64 [email protected]
1,666,226,619 *AF51DC0AE9D28231DF677CCF6CFC9CE30281E51B GAILRECKER
1,666,226,620 *AF558786F72CCA547EC5A372306ADCBEC97B264F IVAN.HOSIE
1,666,226,621 *AF57B00538B679E26F88F8EFA9E865F63513BE90 GALE.SHANHOLTZER
1,666,226,622 *AF590ED72E1A32E5B7B554DCCD70268EF1663C52 IVVN
1,666,226,623 *AF5C6687311E921C2161BDF045DA30A436D976D0 GAYLETTA1
1,666,226,624 *AF542268CF1561ADB456066F9C7E0282F4C24485 jamaalcaspersen
1,666,226,625 *AF5F3F012195317C49E5BE02DC2271A107139B8F ge4&
1,666,226,626 *AF575F0B95103E647813CFB4A290F92CC2C02CCE JAMEL.WINNERS
1,666,226,627 *AF555F7B2257C401883616E1663554A681D1B9C0 jameybeninati
1,666,226,628 *AF5F0791A3F7E8161DE4CA7931F50AB60B276119 JANA KOKALJ
1,666,226,629 *AF5D33B1EA60DD10809A9CB496A716AE65BF8621 janfergason
1,666,226,630 *AF5C70F0575DA01F18423BA43A10EACFEEBBF320 JANGLADESH
1,666,226,631 *AF5B51C16C8C5D6C904F61F3477EBC5C68FEB73C Get.Me.Away.From.Here.I'm.Dying
1,666,226,632 *AF50CFC956C2B4180E75845C9B3763E7BD2F35A0 [email protected]
1,666,226,633 *AF524F2F6B922BAEDBEAF790E213EE970E75569A gl8h
1,666,226,634 *AF5F3040A3F12CE9BAF4210FF8859A5F205C857F GLORIA MONGE
1,666,226,635 *AF5C8BAD1A6480989A70C30295F645C22FA11612 JEREMYFELICE
1,666,226,636 *AF517222292D44186E706F1C4561532B5118EC1E JEROMY.PROVENCE
1,666,226,637 *AF54FF82494B9A5B18614BD71942B9500F7C3DC8 [email protected]
1,666,226,638 *AF5581A3A802FEB7D3FF32E35AEDBE52F501D9B2 goedenav2
1,666,226,639 *AF5EDFE62F69D20CE3D3D399DEED2EBBDC88758A jesusvixay
1,666,226,640 *AF51D653B9E8440F2267449B33F217D04BA5566D JEWELLPENZERO
1,666,226,641 *AF5D7F1D125E3DC2469A1A6E9138D38EEC5BC188 GONOSPIRAUVULA
1,666,226,642 *AF52DBF9E013F92B96D274344E4E2CDD9663B8E9 jewelmilstead
1,666,226,643 *AF5E0065C390DD456738D9211A62A902B78321A5 [email protected]
1,666,226,644 *AF50F17B08D556F7D79C957482ECAF00C3C4B910 JIM BRAVURA': '(AFTER BEING SHOT BY A CLEANER)' BULLSHIT
1,666,226,645 *AF52AD161DE92AE2A8AABABBBF32873B50CF2E85 JIMI-HENDRIX-MUSIC-FESTIVAL
1,666,226,646 *AF535228E71D8B9C52B6F390C0EC5F4C06F264B7 greggmilks
1,666,226,647 *AF5F64152897668EE84753946861297F69923548 joe.columbo
1,666,226,648 *AF50F498326A6FACF35CAF1F55848E5A9FD71470 GROUNATIONPART1
1,666,226,649 *AF5A38404B63D3013C0EC745D0F6107E89D4007E JOHN316LEONARD
1,666,226,650 *AF52FE81E329624DBA37B41C2C3D44403C529EA7 GULLIVER'S TRAVELS CLOSING THEME
1,666,226,651 *AF50923CEBCC641317B613F9E524C0AF34ACB1BE guthruns0
1,666,226,652 *AF55CEE4F4276CA0EB4662D080BE5D8805BAD3E2 [email protected]
1,666,226,653 *AF5D2F667C1DBC940134B30DA49F3B4CAB32BEC0 joshsmestad
1,666,226,654 *AF5EB2251580E1DB0342F739E1EF6AAF6C8E9ED3 JOSPEHGASSE
1,666,226,655 *AF5A9DDD1C879F9203B724B9CD6344999268B4ED h)6
1,666,226,656 *AF50FFE1198A5091121CB484339C7F5FA9EBC55D JP0:
1,666,226,657 *AF5E6EC61016BE9ABCEBB189FC47FD062CC3B9C0 hailey.van.sickle
1,666,226,658 *AF597C36F74085E5057C7444271171E49FFB4468 judeglackin
1,666,226,659 *AF525592E8AEAAF99B51F6EABA2B144EF0C81429 JULETUTZ
1,666,226,660 *AF552460480782FA8D7E9F1656545117D4E75391 junainah.aziz
1,666,226,661 *AF5029F006045AC46F13526B12FB08861917D96E [email protected]
1,666,226,662 *AF5D3C5D454F568353BD06C001F9E0D24BB78C5C JUSTINFUC1
1,666,226,663 *AF5ECB1F6F22743CA1690C1792A8A04FEE2D31AD harrislavista
1,666,226,664 *AF56276E9FD11AEA083BD2504020243BF6AB7BFD HARRISON.DIEP
1,666,226,665 *AF59FFEFEC5A49035CBAC00A426C408017413684 HAYDEN.WHIDDON
1,666,226,666 *AF5FB6BA8DB7348B8F736357004896898B029DB0 [email protected]
1,666,226,667 *AF5A1102D19C9D5361202CBE0745101A5A689481 [email protected]
1,666,226,668 *AF51750A8239DA290C9D97DB25782CAFEE9885BD KARAMALI5
1,666,226,669 *AF54A7E609B2783F9951A458ADD5A0069F91820A KARNEVALSMELODIN
1,666,226,670 *AF56BE8ED059D204CCC3CDC6733B626232D85FB9 HEIDI HSIAO
1,666,226,671 *AF57AB0AF38EDAB32740981E644EDA288A8555AE kathy.beimers
1,666,226,672 *AF5B691D85C2B2144D1892BD3AD39333812BAAB9 katoenac2
1,666,226,673 *AF5C7D79E144FE5C6BF99DE6FB5977E029387A62 KDEWAAAAMAAJ
1,666,226,674 *AF55B2B710E68CCE95DF4F0E666A8E3ACA90AB49 HET-LIJKT-WEL-SINTERKLAAS
1,666,226,675 *AF56A2E4119DA1FD5265DA97251FB1F72BB215E5 he.will.call.you.baby
1,666,226,676 *AF51F0768C6011046B62C5289FBB1070E6847E34 kennyalrais
1,666,226,677 *AF5883DFCAAB617F940D26903B491036482D52DE kevinrandolphjr
1,666,226,678 *AF5F9C132FCC7CBC11C42A25B1BF1C97DCB43F59 hkg
1,666,226,679 *AF5D631A8CC79BAD30E1CD2CAF88C5001059FB8E ĶIEĢEĻIEM
1,666,226,680 *AF5DC2E167945ED549B55E43BB3DEDED9F82B980 HOLLAATCHABOY_82
1,666,226,681 *AF5EB385001BCEEB80CF754962C3AD9D9A1E484A HONEYTOM0
1,666,226,682 *AF5BF9C98939914643D9938194FE18EDAA212995 HREND-KARIN-AM-DIENSTAG-MORGEN-NACH-HAUSE-FUHR
1,666,226,683 *AF5B855FF2DE61E4E22F4CC1FD243D4D8EC467EF HTXREPLY2
1,666,226,684 *AF57B71EC8803F0EDCC672DD96BC4B198C6E7A6A ht$y
1,666,226,685 *AF52B5B0CDF1E28BE45D22EF05A1B14B75146CEF HUNEEKSI1
1,666,226,686 *AF584255C2BE5A60898C0EC740C325EF6B4E7401 KRISTINMARGULLIS
1,666,226,687 *AF5600AF3E3645166A046E481FBEFBA81CDD0A1A KXQJ
1,666,226,688 *AF53F103B5EF6DAD859B03BD38EA0159F1934E85 IATSOTTOS
1,666,226,689 *AF592CDE238F2E02DE7037B85B6EBE357F339273 LANCEHAMMERMAN
1,666,226,690 *AF5F391892C4EA39E13DDF29337C7153936DC82A landonmeecham
1,666,226,691 *AF5F37F4693490F039CCFDD23377E3D6542D1709 LÅNEAVTALEN
1,666,226,692 *AF5D99835F9C328F61CC122073347192D23529E3 la salsa du d
1,666,226,693 *AF5ED829EDE1A6480822E41D56B8BFDC6DAD064D IMBIBE1
1,666,226,694 *AF5B61DE2B1BA4465B333E4B0815DF857134B092 LENARDKINVILLE
1,666,226,695 *AF52DF865955AA53BB768BA1BAB0DB5A3FBF0F2C INCLUIMOS1
1,666,226,696 *AF54ECF125D38F331546DB25CC791C16D4A60167 [email protected]
1,666,226,697 *AF5A327F0B95B23B8573772FC5A7700826B2D320 incru5+4+ion
1,666,226,698 *AF5ECF6A49C83E6F1BD29FCBE4C8A434B3751759 INDEFENSIVING
1,666,226,699 *AF5E951FBFD898A03C380F41136FAE275D665D9E leopazmino
1,666,226,700 *AF599AF291AF398FAC377A8D0140A44796926586 LEPMEUT7
1,666,226,701 *AF5AEEAE9AD9C1B27500E298537DE85746B721BA insulance!
1,666,226,702 *AF55696C255783A3C44832FE55B222785A292D05 LINCOLNTUESBURG
1,666,226,703 *AF5CC60FC50AF564AB27A3062C1E897598B48394 LINDSEYHOEFER
1,666,226,704 *AF5A1ACDD2094EC46ADEE98A82DA7EB8231A356F isiahbutterworth
1,666,226,705 *AF5BC58E52712BCDB51D831021214CA325461AD7 [email protected]
1,666,226,706 *AF553FEF44B506E67CFF9E09C2A352D8E5693088 ISSUESANSWER
1,666,226,707 *AF51DC398B9C3C3B809B097D740A86509999A67A It's.Raining.In.My.Life.Again
1,666,226,708 *AF52B833B7B5D5BDB5A91C2CB1940087478CFFE9 LIVEDNUG
1,666,226,709 *AF5CBF52AAFD7438DA2F9448FF3766A7F6F253C6 Live-From-Philadelphia-(feat.-E.S.T.-of-3xdope)
1,666,226,710 *AF5C8C133149565905154A05792D047428A5CF2D LIVEINDENHAAG1980
1,666,226,711 *AF529FB28306C43D0BE5A805F5D5A05076265215 i wish you were here (winnetou melodie) (feat michael hirte)
1,666,226,712 *AF51F6E871227DBF16BADC6374F3289140C1A5E0 LLOYDNESS
1,666,226,713 *AF50B384407E7666909818BADC967C997C7C4DEC jab,
1,666,226,714 *AF5F265D867F079151C66AFF3B1D70FEBCFC2C78 LOLASTAPAS
1,666,226,715 *AF52BB595DECC0639ECD42EC35CCE1DD65E213AB lonnyorte
1,666,226,716 *AF5791AC94AB489B2AC54C68D2B28E5F86E24681 JAMAL.TURNIER
1,666,226,717 *AF59C398171757956E218FADEA7CDEBA38300663 LOUIR
1,666,226,718 *AF5497BB42D0F9FFF6198C2EC5E412109467E07E JANICE-BEAVERS
1,666,226,719 *AF5A96E0BACDA608256E6ABA9A1072AA6B44B754 janperza
1,666,226,720 *AF5D820AFE8CD489C138B40E7507966D36E7521B loydportillo
1,666,226,721 *AF535987D58A93A9FFA74EBC6C849AF641016A26 [email protected]
1,666,226,722 *AF5CB9F8B1596FA2576D3BB4301D7F7363880F04 LUCIENBUHMAN
1,666,226,723 *AF5D3D593E5D7E59491B08ADED909C289940F449 jazanopa1
1,666,226,724 *AF5932363A1439EC484C3140573CDD0E30A2E41E LXHFBB
1,666,226,725 *AF5BCF74D571629292E460F20623A4284716AE1D jeffryashing
1,666,226,726 *AF5153F91498139E663B50A779F25DC73A049FC3 LYNWOODNEYER
1,666,226,727 *AF5C9C2A7C2BB0EC14F0B409564D9AC1B63FB1D9 M'0~
1,666,226,728 *AF55BE6322C55F1FF590A9AFE525A9EC9F0DF6B8 m17vfasebvsbsg
1,666,226,729 *AF5188926291DB8DC5CE5F1B7F7257683242A2E4 jeromymajocka
1,666,226,730 *AF512745B2F10FA9071BD7AAB8E05624B47FCC95 MAC.JANSSON
1,666,226,731 *AF53454FAC3B2F841DEE058815CF0A0ADC2FAC99 jerrykell
1,666,226,732 *AF511A8F44C97E2EA0D98907E99A41CA81C6B8B0 jesslyn.yeo
1,666,226,733 *AF53CCFA14C062B9BF7A1E91B2FD9CE9E571F897 JESS.MARYOTT
1,666,226,734 *AF5A46B6C3D04BEAC429A1C2091A78B067993576 [email protected]
1,666,226,735 *AF5ED1D32F5B4AD1505AA585F6F8F18E58F07121 [email protected]
1,666,226,736 *AF57237DE671A1CC5AE663B7EB9CBA7C9BD0268D MALADJUSTED.,M/&/L/@/'/DZ//@/ST/I/D
1,666,226,737 *AF5C548684FD13D8CEA8A1948BF41835A334BBD5 [email protected]
1,666,226,738 *AF511856A2B843CF45E5378E536D7884AD50633C JIM.GRATTAN
1,666,226,739 *AF5501D508C68266F4C96CAC0E2A13E7748039F9 [email protected]
1,666,226,740 *AF5F809EE92E5FFB1EB5E0C8CFD95FC0BDE54334 JIM NORVELLE
1,666,226,741 *AF5DC057D240E806AE7E7CB0F3EBAFA60009DAA5 MAN.CORF
1,666,226,742 *AF545B3B73F514F3C0A475F3DA45AEA307ADDF25 MANUEL.MINEAH
1,666,226,743 *AF5961CF93DA0E80FF877AE585674C54080CE39D MAPRTERP
1,666,226,744 *AF5BB55587F9E29BA84B2FFC73CC1647BBFC883A MARCELALWARD
1,666,226,745 *AF5F0746DBCE0319C3E51C554FD8ADDAD8BCAE99 JOEVALERIO
1,666,226,746 *AF56FCD17B0744907864E0AAC320FB7917BB07BE MARGARET-KASTNER
1,666,226,747 *AF51663F3585C2567FF97D60AE1732AE735B6923 MARGARITO.GEISTER
1,666,226,748 *AF5E56B4504BA0C41BE14506A4197674706B2E1F john6862
1,666,226,749 *AF524406D07B799CB5731D48B5B80B6232DF1DC0 JOHNATHONMCWHORTER
1,666,226,750 *AF54B5601003813E60100B461AA6CE6B64CA6510 JOHN.CALAMAN
1,666,226,751 *AF5D6A05D05599A064EB0D848A74038612676068 MARKSTUMPHY
1,666,226,752 *AF56D382BD57ADEBB8F8DA0E315B5DF23C03F4E5 JORDONBIGWOOD
1,666,226,753 *AF52950DEB563274C64EE3634938E2DB41B969FF JORDONEMFIELD
1,666,226,754 *AF576FEAC22E2796844255FC0F27B1D0BD95F639 JOSE LATIMER
1,666,226,755 *AF507C0A1AF0B85C296414AAA18CEE5A9E73A900 JOSHUAKORENIC
1,666,226,756 *AF5F612DD69C7AE7435B143216EEEAFB79E340D9 MAUDIT-BONHEUR
1,666,226,757 *AF58F4209A9F98616AC0240775E38973C303EF7E MAURICIO.FLIPPO
1,666,226,758 *AF5A931260BA338D624203F1376F3DBF93A75F3B JUNEAVA6
1,666,226,759 *AF5BFE6B45A32C11C3BD055D5003C07956D20EA8 JUNIOR.PLADSON
1,666,226,760 *AF540F929EF8719ECDB23F53D94F3B2480055BBF jvf
1,666,226,761 *AF5DF5DA33B2DC68ECB46C67F19616552A822A11 MELVECCHIONE
1,666,226,762 *AF51E6616647EEC53609AF2886F9E3A5434D9E49 KAGANVALRIE
1,666,226,763 *AF5FBFC55049A279C4E4F0A7E7D7AB2CD2AC9BCA METAKINING
1,666,226,764 *AF596A19C3241714E050085D4497DE0D4353ED34 karrlozann
1,666,226,765 *AF5EB0CB0E91B601FC5756DFB0BE3200041B7721 katsuya.honda
1,666,226,766 *AF58099D473B388F98C8EC363223B9A1F9502F40 milder
1,666,226,767 *AF5B3F35719D14803396A610C445961B9E0D3FCB [email protected]
1,666,226,768 *AF5F4390085FE1107FF824BB5279CA6F99224086 milocardello
1,666,226,769 *AF521A7B72ED9AE7F53A58E89EA45E99DA0F3916 minhdistel
1,666,226,770 *AF500CA281B26AE12C57DE3603FC4A334FBE7AF0 MIRAHMEDKHEL
1,666,226,771 *AF5B26F62B9B140BFCEC65491E7B4B2695D0BAB5 [email protected]
1,666,226,772 *AF5AADF8DA49E3A9A0955F6945C604FFC2756848 MOSKENEERS
1,666,226,773 *AF556BFBEA9CCE67C85A7F67EC4644915EC95B0C KORAALCANTATES
1,666,226,774 *AF51CB4273BD489ED6F4FA126AF49377338D2F8E mrgrin
1,666,226,775 *AF53BCC97A3F6625013B7EC3BF944D734C3BD5DC MUSYANOK3
1,666,226,776 *AF52A3E2A71753EA5E1CB7708B6660892CD88A2E MYCOKE1989
1,666,226,777 *AF50243697F4A617701A87F6F0543B3D549F68FB [email protected]
1,666,226,778 *AF51BE1A69E2A9D5167B35B4C82161E99C2B9714 n0nf0rf3i+ur3$
1,666,226,779 *AF5B7F0697472EE0BA51428DC9D0C80526C90B97 NACAO2
1,666,226,780 *AF52EA1D47ED8356970E105DC8CF0872B2D28172 NAME="PHRASEPOP|AK|D10">NOVA&NBSPSCOTIA</A></SPAN
1,666,226,781 *AF5689D67650BFBB7BCAAA69D54B7E13D9B11CE7 LANDMASC1
1,666,226,782 *AF53AB9DD8A098BF6DD50D0170D8AF22A983F6E6 nathanaelbonds
1,666,226,783 *AF5510E87B316BCA1D5B91046680360540207B4F LAS NUBES DE TU PELO
1,666,226,784 *AF59E9C1FA6DBF15234CF02FEDE6C0E5D5998051 LAURIEGREER
1,666,226,785 *AF50C9F11CB5A3C72427E87B05F59BAA683FDF10 laxárós
1,666,226,786 *AF59A5C4DDDF9B16077B953754AF2FD2A3FDE6D0 nebozezy9
1,666,226,787 *AF5F409534B92B18D7A8864E854F0884D187A156 LEIFLUFFMAN
1,666,226,788 *AF571C0D4D9495EE3085DF4709389370DA471101 NESTOR.CAPDEVILLE
1,666,226,789 *AF557A8F7E83D5B7041AFFBB6A198ABEFE9C2933 “NÉT”
1,666,226,790 *AF540765BDA4D1C9ACA19491D395E5D187FBD41D nettezpo9
1,666,226,791 *AF52D580B3DA14C46AB01813536EF21C2137E025 LEN.BUSARD
1,666,226,792 *AF547E45C6B4B0E5EFE32363CF9BBD67993E8E35 lenders.of.the.last.resort
1,666,226,793 *AF5B5BFB236852826A7FAA6CF2BB8D8B57E0803C newgodisborn
1,666,226,794 *AF556842B93C1D1BACE9DF9DA75020734EFCEC4B LEONELTORSIELLO
1,666,226,795 *AF5AA4D00CF2D5D716083A93C4F7045B1B0020A7 NHHM
1,666,226,796 *AF578731793313E959E4313B6411BBCE5656EF4B NICKOWINGS
1,666,226,797 *AF5D4A9B2AAFC2D516555E9CEBB348AF39DCCCC2 NIGHT RAID ON BAO ZI LIN
1,666,226,798 *AF526A90308C9A64CD90EF183CCBD32DC8986683 NILSBSW6
1,666,226,799 *AF5754201284C6F1080F527937B3C021559AA4D5 noblebarney
1,666,226,800 *AF56C284D04675BFBCE1C84957D0AEADFA3C689C lilian.meyer
1,666,226,801 *AF5EBDF571D60E9B8FA7EC51B77F8C6DD3D44ABE noeldefabio
1,666,226,802 *AF590638C5D55F5E4588105F353F81028AFBD436 NOLAN707
1,666,226,803 *AF523E0A5A11D1CEFDC2C627DA5E0EA7909979C4 NORBERT.FISETTE
1,666,226,804 *AF567ABFFD79122647F10BA5C0288144D67CBB1E normandreynalds
1,666,226,805 *AF562AEA3194A83214718E4CB56E8BC23358D7CF norreproopslams
1,666,226,806 *AF5E7325318944EABA1B2F9EA92EEEFD05216622 lloydsaturnio
1,666,226,807 *AF5AF343AE55BA32C23F8D0D334FBDFD207691B3 LLUBHSIRI
1,666,226,808 *AF510A5EB02EEBF8FB46E99C7F1BAC7D9F8B0055 LOMUMBA1
1,666,226,809 *AF5CA9774AA3176DE278B6A5A22436A1873CEC12 OBSÖNE
1,666,226,810 *AF54847B58BC2D17CCD4F11F3AAF3E54984C6644 lucianochustz
1,666,226,811 *AF591DA307CCAF9CE88D64A3A43E140AAD4F6CEE OLLIE.RIBERA
1,666,226,812 *AF5824EA27BEA3949EA6A9864F0ECE576EC43843 luftarts5
1,666,226,813 *AF53E50764887F7CC19F07C39E85A1B98416C198 ong-keng-hong
1,666,226,814 *AF51AF0774BBC82EBA75A2E62A810FD86F18DDCA LUPEINBODY
1,666,226,815 *AF517E814CF10C7F256C3E1926DD33176F2107C7 [email protected]
1,666,226,816 *AF5D7986150FFACF53EC647970367DE43E386E07 [email protected]
1,666,226,817 *AF5A13D86AA1468FDAFFE730E9F0F67C7362B3B9 )O(~~~(Q
1,666,226,818 *AF5AA022483D00658B2E832E1EA59CED5E1C427F original bugle blues (1928)
1,666,226,819 *AF5400B0A5E4CB0EE508B9F5B87B48CE08059737 M6284
1,666,226,820 *AF5CAA9A472F77672EBE6AE64FA53DE6B1FF2317 OS NOVOS CRIOULOS
1,666,226,821 *AF5DC520A940B46D706298B88FB5D54EFFAEC5BD mailbox
1,666,226,822 *AF5237B1B08C3ADF796220D7DF7A0793DA96932E [email protected]
1,666,226,823 *AF51CF6BA26994C7A4C5ECD5FB1E2F14AC112BBA [email protected]
1,666,226,824 *AF542A3610FE05FF3C0185A4DB579611B5FB66BC [email protected]
1,666,226,825 *AF576ECB2C7EDC284070E011DB38CA92006B0F6D maquinous
1,666,226,826 *AF520699C4A210BC59404F79A13BBA97796989AD PAHOEHOE2
1,666,226,827 *AF5459447ADC96FB2363733E2669199216C6C9AF marchairu
1,666,226,828 *AF549F26F9DBFAFE92D35CAB7699338718F9ED96 marchanderen!
1,666,226,829 *AF5328BEF294BDDDE43CF8A79FD3DCE92E252549 MARCUS.POMAINVILLE
1,666,226,830 *AF53C0C49D1632B0B44A6F5606FBA1E949C3542F marebeken
1,666,226,831 *AF52E2F7EB5C0D16E7F61E1E9EBEC81764539879 PAPA-NIANG
1,666,226,832 *AF542EDB25EC2B8673A18EFC030F1BD73E545150 MARIE CAROLYN
1,666,226,833 *AF533E6F2750D3E91233CA20B1D63379E72440D0 PARISBIBILONI
1,666,226,834 *AF5C2699AE16D261473257CB67BDCC5177EDE0D6 PARIS.BRETHOUR
1,666,226,835 *AF55CAB17E85A507833F06FDEC48661B23E1705B parkerfeder
1,666,226,836 *AF5A105CE8ED1643B9A049CD9FBB8FCBEFC1D92D PAROISSOIT
1,666,226,837 *AF5A1990285EDD49FE34988CE38DB2313BB9E605 PATRICKTONNESSEN
1,666,226,838 *AF55CEECBE614863CB965F341797A4FBE81AF9D3 martinlawter
1,666,226,839 *AF523201380A91B6370F5379A6DE1814543E0EBD PCHIPAR
1,666,226,840 *AF53FF8BC99E729DF43015EAA73FBFF2F322FFC3 PCYEO
1,666,226,841 *AF581FC9BFA842DEDB135200642FE40BD9F9F85C P#D~0~o-)8(
1,666,226,842 *AF5BFDEB036B3338F29234895EC2867A8D3541C7 mattholshue
1,666,226,843 *AF5D18B43A3FD0C503D3A90FDD8CCD45DA1C4BA1 MAURICE.ZAKUTNEY
1,666,226,844 *AF59B9B7CCCF88385827F243115826BB85532E27 mauriciogoldtooth
1,666,226,845 *AF5C4C29511F535B016D6D37459F8253EED42297 perfect68
1,666,226,846 *AF5D4BF453B7E745A2D77CA5FF54DF75A273807C PFLEGTENS
1,666,226,847 *AF583FFC4438A9735D3214E2DE67AEF6B6D1F88A MEDIANETTI.HELSINGINSANOMAT.FIMEDIANETTI
1,666,226,848 *AF5FF4FBC9CFF96BF78D12431DCC799BF998C444 MEGAN MCMILLIN
1,666,226,849 *AF5DB4540537E8CE1E809304D3ED3D69500DD3AC MEGISTUS》(日本語名:「ヘリオス・デュオ・メギストス」)SUPER
1,666,226,850 *AF51E6CEAE5B1B42721416C1C378F2A7673AC6CB MEGOSZTÁSRÓL
1,666,226,851 *AF584E8085DED21386306537C6BF8F6CA060CF59 PHILLIP.BORNEMANN
1,666,226,852 *AF572C9E6722FE6B23F6BCA41F25BFC9223DD9EF MELANIE-BLACK
1,666,226,853 *AF53C0FFDA4B2E3CCC4A97D2BB8CDF6B7D996F42 pinkk!
1,666,226,854 *AF5668B3A92FDD0336CBAFD327DFDBB028085F6D PITK{IK{ISIN
1,666,226,855 *AF5A11288788E97E02BFF0148E2708DA0ED8B735 PLANETFARMING
1,666,226,856 *AF583B2BDE5FB014922DC8D05FA6765CFB0995EB MICHALBURLINGAME
1,666,226,857 *AF5478BCD92F6C5B69B4CF107AF5840985438415 POI;
1,666,226,858 *AF51834C0BCBABD852372766266A3364005870F6 :[email protected]=====p
1,666,226,859 *AF58035C1E0BCE4711FE81FAB9EC9BBDA2D31384 [email protected]
1,666,226,860 *AF522ABE75DC09CF3FD35F6B8FEFDC643753029F POPRAVCU
1,666,226,861 *AF51D36B895B1C887E33699EF70195FA12A5A065 MILITANT-MODERNISM
1,666,226,862 *AF599EB78C0154543EDCC652438E43C6203E3B54 minhwenk
1,666,226,863 *AF517C2C5106CEDA1D5A9FD2C29E8F14ED36648C POZWOLYL1
1,666,226,864 *AF5CDF0A4FD830483EDFCB0DFCE01311ECED0515 P###P`~`~SPLAT!
1,666,226,865 *AF5D935044EA6D07CF1A1DAEC5C8D31454B9E6D8 mjdwag
1,666,226,866 *AF5BCADCDA9457211415A5AB2A6BEE685B1447E4 PRICELESSLY5
1,666,226,867 *AF57DB9072A32C20865C08CF7D4FB5CDCE70B5EF PROGESTERONE1234
1,666,226,868 *AF5D18644B203D67143768D07B58A89DA0811EF4 MONICA.HAINEY
1,666,226,869 *AF57F814279BA6AB7B595994BD2BB017F2DC9FA5 mon-tana
1,666,226,870 *AF506DF0454AC5B1A99F1B5D95BB5B08B6E8E38B PROTEOPLASTO
1,666,226,871 *AF518B103D3143C9F06AEA9FBAD7E2DD34F10B2B MONTSAINTMICHEL1758
1,666,226,872 *AF51BD4F5694E0E9E1A43D4A902FDCFF921C447D [email protected]
1,666,226,873 *AF5A4521C42DF488100C8364576892BACF38FF01 MOSSELBANKEN.
1,666,226,874 *AF543233BA1BD40BAABD00923AC14CAE0FA47BD6 PURKAJA
1,666,226,875 *AF53B252F94AC70BDA2761A255A04F726DEDD04B [email protected]
1,666,226,876 *AF5BE69E8FCDC427C9FFA5BA9085A5840E347EB0 MRATAKEO
1,666,226,877 *AF5EBA81A70AF56532239B75561E13384A4D230E [email protected]
1,666,226,878 *AF5FA5EDB477F52885AC7B7E293BF29AA3ECFB29 MRFURIOUS
1,666,226,879 *AF529AB46A17E29CA0DD493FFEFC4B0AE3F09644 PYCU4
1,666,226,880 *AF551B2A5BCB34AA30D93A5D7F1C1810D28867CC pyro1991
1,666,226,881 *AF576B1DF7827E829D3123777ECE4DF4DAD0EE7B Q570143
1,666,226,882 *AF57D865B4E9FD18DD7FB3FC018A6A2167DF71BF QAZWSX7875
1,666,226,883 *AF5F39123E3E11202EA1F251B029FE8FB05A3287 MyFavouriteRoom
1,666,226,884 *AF5CFD9AE51102894B3E34A309555DD7C779C846 [email protected]
1,666,226,885 *AF57C187919F1ADA88681D89C12F9D7CC69F5ACA QJSRO200
1,666,226,886 *AF501BCE898F3A2B042EA5E1B1BE935CE74C6981 MYLES.HOME
1,666,226,887 *AF5559222D664817755258033BF9F8B43E6B68E7 MYRONISAAK
1,666,226,888 *AF54C874C873283E1579F51924636A4BC59D4BA0 MYRONLASKE
1,666,226,889 *AF5ED692F3AD14C5018137F72124F533BA50E0CE N5U1TER5
1,666,226,890 *AF57B91EECCD785653CD917ECA2E9B6E457C79A8 [email protected]
1,666,226,891 *AF516F505BEFE74E0633179B0CAB8EF956C680B5 rachel-lavarias
1,666,226,892 *AF593925DE7CC26C797705B1ED1B641E1FA285E1 [email protected]
1,666,226,893 *AF5EE7EE2D92C115DD07ADB482654D2A21B81747 NCPD5K4
1,666,226,894 *AF56C0997ED54CB4570D05ED6DCC1F418649C1B1 raina619
1,666,226,895 *AF531D18FB9F51207AAF3FF4320E9C33AB795DE8 [email protected]
1,666,226,896 *AF5675E2480DDEBC187598411A2D201DAB74A64B neuromante
1,666,226,897 *AF528BDD47642AAEE9C66B99AEC8B0B7CD3DC5DF nickolaslefave
1,666,226,898 *AF5B8D7C42A09FE80B85FBDDAC2809CA42CB9A68 nickyspraker
1,666,226,899 *AF5F4108613EB5E3B39BEF27F01382C2A054CB96 NICOLAS.REDLIN
1,666,226,900 *AF5EED54D2720380BA6DF37C28FE2896F56F1E51 RECCOMNENDS
1,666,226,901 *AF5F73320911FAF687E0ADEB962FAC82DA69A3A1 NILOPSED
1,666,226,902 *AF5D16C08797925FC0FD9DF6FBCDAB50279DBB9E [email protected]
1,666,226,903 *AF5864DEB6FE4E51D92DC516379C9894C397E0B5 REDNOWARODNAP
1,666,226,904 *AF5297E7DB72D16C11FE99CBF77E7F35D6F1A4F4 [email protected]
1,666,226,905 *AF5CA7FFBD603AA0ED9387117EF987B02FE609C2 REED.CURRIERE
1,666,226,906 *AF587530A907978432AFDE02792CC9D2BD257C90 n~nu
1,666,226,907 *AF53928F60D084E7CA5029A8A8DED57C2A5D52E2 REFUGIO.RODILLAS
1,666,226,908 *AF5E9235EB62CA67A716B288B16A58D3B778587C REGEDERLIGT9
1,666,226,909 *AF5D62445776203F45B750B1D430A96A175827A9 reggiemilliren
1,666,226,910 *AF5367EFC2E8BB49440817495C22A41A0B65C8DB NO-NORTE-DA-SAUDADE
1,666,226,911 *AF53C1ECBEA29614D2C62AC89DB0CBC2CDE060B6 NUCLEO DE EDINGERWESTPHAL
1,666,226,912 *AF5D494FC844C11EDDB50366684336C57F01C969 Nude.(Amplive.remix)
1,666,226,913 *AF573A98AD34DBA3226B33C2AD357C8BEE055415 [email protected]
1,666,226,914 *AF5371A1DB6250F0821728309C0B821A60EFC61D N??/Y&U,3
1,666,226,915 *AF5625DFF1D66B6487C0BA02A3A82D9947CFFAFC nzrn
1,666,226,916 *AF5419161FF8FC715F5F1FEAC7398B712C1CBC65 O86282
1,666,226,917 *AF5BACE207975BE79EEA002FB880CAE196BBAE21 REYMILON
1,666,226,918 *AF594CEEE75FCB0ACEC8212B890907EDDE7AAC3D rfisklo6
1,666,226,919 *AF51E59275455E6AC202D276926DA9304BA15746 OCINNGLO0
1,666,226,920 *AF53FC2E78CC3F345F7064C441997D1694D680E4 OCNARF7
1,666,226,921 *AF5A1C7A7A64E0D442D9E200884E4D349F72AA42 ODRUSIME1
1,666,226,922 *AF5C9FC2B96F23D11FA26B86E71DEAF291C51271 OI4320673
1,666,226,923 *AF55ED549C41D0A4825E562B2B66E0E0EB10A444 OLQCOPL
1,666,226,924 *AF52EFB5B1760B948BE2B822ADE9AA803E97EF59 robyn-callaghan
1,666,226,925 *AF5A15DCFD876E5B9D258F8F2A6D569C044BB6DF }O{*Q-----8
1,666,226,926 *AF529E9C2A3DD1E9ACC6DA8578195275BA44B643 rodrickscharff
1,666,226,927 *AF5585D9C8EB0F8B69FA2B7B03AD74C07A52867C rolfarnio
1,666,226,928 *AF52DDB4B189A3AA2ED36B935E5D4601F206795E ROMAN.MATAS
1,666,226,929 *AF5A3F198E5AC6D08A371A113DA3649FC5ED9762 osvaldoguetersloh
1,666,226,930 *AF5A874BE10A9E442B9101403C6D87AFB84E8364 OSWALDOBOGAERT
1,666,226,931 *AF5C7B5B11AB403921183489F0D278E2C49559CA rommelkamer6
1,666,226,932 *AF5DCCAA2FE7790D4742200395EF80273FA959A6 otisazzara
1,666,226,933 *AF59D519EAED91A7961ABA573F0F3FE6C9902F63 OTTOMONGE
1,666,226,934 *AF5130F884CAFC3EF48B0E68737DA87BF52DC013 (~_^)*-*-*(==p
1,666,226,935 *AF56DA807114B5B4ADF3CAACAA2769CE986B79A5 rp0u
1,666,226,936 *AF51C87FFA08679DC707B54CEBA08BFD17123698 PAGODIAN
1,666,226,937 *AF51EEC46DF4FBA73D432872B0A8FF4859CD6B38 [email protected]
1,666,226,938 *AF599765342299E7DD0D79796CFEAA779BF14365 rufusreiger
1,666,226,939 *AF59E8994CD787E9FA1931B8F0512C9A5500D8A2 RULESARROW
1,666,226,940 *AF5741B6ED619ACA4DD4D78CEE619295A46648A2 rush.'n.roulette.ii
1,666,226,941 *AF57810D9D51059C9FC83933D362F26814E89FFC RUSTY.BUSITZKY
1,666,226,942 *AF51D579F2EA4F8210D29DAB263855A8CF15DBC0 parasynthetic
1,666,226,943 *AF50F461057A4BB4B356504AD40137F27DCD5303 passive.stoner
1,666,226,944 *AF5D1D9E7812E0DB030E15E4DE030FE84E471A41 s|9w
1,666,226,945 *AF571C8E3F5EC40D5F3D305E59129991C0EF4A0C SALESIANAS7
1,666,226,946 *AF5D0CA86D26830C8336B0CC8628A7582E882D2C sallymydog333
1,666,226,947 *AF5F991BEA90B10931676C672EE377D09DF4252F [email protected]
1,666,226,948 *AF5F8FF8AB39E5A26351BFBBB9943E784ECC0544 pedralba-de-la-prader
1,666,226,949 *AF58C2138ABEBBAE457EA238019CC7ADD20158BC PEETOUDERS!
1,666,226,950 *AF5CBA1BCA79402B0B6F7C13BACE5C9727B150B7 PERCYGUERECA
1,666,226,951 *AF54D6F37F6FA7DED0D77837EFC5998A6FABFCF7 sandymangino
1,666,226,952 *AF51D1E4F09B56919C8C408CCC1D8A42BA75BA1C [email protected]
1,666,226,953 *AF5B5924D094920427F1775715B307182710D260 SANGRIA
1,666,226,954 *AF5E8C6A4CEC4C8AD91D1637A84B6A00F2765C0B SAPANWOODS
1,666,226,955 *AF51B9C015CAAA268FA80613F4C1699E0B850309 SAVANNAH-MARIE-JONES
1,666,226,956 *AF5F692A3E29B749DA63615A05FB65496C423CE7 PHIL.POLIZIO
1,666,226,957 *AF58C16FA262692C53A821FE90ABD5E687159E3B [email protected]
1,666,226,958 *AF5CDFCE65A6F837C55B67FD1BA27D4D644FBE6F PIGZAJUPITER
1,666,226,959 *AF58D3BB2F245D48B243A974077C8CE59E43A94E schmetterlingdistanz
1,666,226,960 *AF5398995101B19C0DE8A7291A1356B75590AE5B platanised
1,666,226,961 *AF531AEF92E8331ED80FCC9D3CAEBAA5783F98D7 sebastianforte
1,666,226,962 *AF5F6875EFE6C706845D09E831B263BAA859F952 SEIGNEURY
1,666,226,963 *AF56D332D7745C2C964331EAC4E657199C6DBD01 [email protected]~o ~osplat!
1,666,226,964 *AF5557ADAB9B7669BDE99FA182171A403DB36703 SEOCACIFIDOM
1,666,226,965 *AF5FF7B9A1849AF1E24A045E03D02DEDE0EAA2C4 POWERJUDY
1,666,226,966 *AF566E2D6A6A406B5810278A3571092EE8B7C68A SFARNANDOS
1,666,226,967 *AF5AA5028C660F57F4F81E02AE1D451A82899862 PRELUDE.AND.FUGUE.NO..14.IN.F-SHARP.MINOR,.BWV.859:.I..PR
1,666,226,968 *AF539DAB6DF83AFD0050DB888EF9B3F4C80170EA SHANMUGANATHAN-RAMASAMY
1,666,226,969 *AF5C88496385D8E787BB43F8E1C9217F4B852516 shantijaeger
1,666,226,970 *AF5EC1DE93764BE064943B3F1BB3D515A5A9AD1C PROBEREVERTS
1,666,226,971 *AF519C313AF6499F9C12ED9CE51A0D09EFF7997F shaynemonnin
1,666,226,972 *AF5CA626D931810454505255B4AE2CDFE7F3CDF2 SHEROAN
1,666,226,973 *AF565702A61CB54C0D54DF02642BEE3B0B0367A6 shng-li
1,666,226,974 *AF5BFB1162B3701EA97BA5401203C65D9B2E9E4B SHOOTERSPEEDO3
1,666,226,975 *AF57F6ED079C4BFC985EB361F124A5AA79BDD49C shruti-pujari
1,666,226,976 *AF5D81BA0E6D722420F039A5E531F9D6A0426DCF pyamasm9
1,666,226,977 *AF5DEB9EDE32E122B92A918D7994173A968C91BC Q#####>~0SPLAT
1,666,226,978 *AF59EFA8005577978510C14C1FFF2FC9D060505D q#B~0(><)
1,666,226,979 *AF5194B074CE5E7D579DBFF4767F68DDD4CBDACF siuton
1,666,226,980 *AF501E203A444EAE2F1B6FA6E8F34C318118D019 SKILLERUMMENE2
1,666,226,981 *AF57AB4F06979889F9402D5CEA2F3F2376429D89 Q#####P.~0~O.(0_<)
1,666,226,982 *AF543D671E6C2E65BBEE00C2E5D6FD50753BD9E0 QP~~:P
1,666,226,983 *AF5DB359830E548FAEC84053A03B5F441D927CAC SKYSSINGENSING
1,666,226,984 *AF5B42FB4AAD20CE67D66735D239EE32F9AEEA34 SLIDLAG2
1,666,226,985 *AF53156BC059841B647C8C31315152907CB1B8AD SMLOHSIHC
1,666,226,986 *AF554DD4FF20AD0F2929ECE75608425DD2163F84 Q).*{X}
1,666,226,987 *AF51E111AF945A9695CBAA5CB246A12F38B2257B [email protected]
1,666,226,988 *AF5F3F505E50D0756EBBE0E718B6CBA9B071AC01 SNUBBISHLY
1,666,226,989 *AF5BD2FB56CBFCD96C7BBD6B313943E5D1D0D857 SOEMSUCH
1,666,226,990 *AF5D90B4230DD30D9862773E7215CC78A09A6E8F rafaelziegelbauer
1,666,226,991 *AF576386EA53E57D57CFA23D8AD3B2FC0E744C69 RainBi
1,666,226,992 *AF515643FCED0D820C11C93F538DC8EC568922B5 SOMMERRIE
1,666,226,993 *AF5C0DB99E9C82B17CACA0127195FEB56C3A3D58 SONALKANCHAN
1,666,226,994 *AF51EC1A7EFAF32A4DD1331D777C2CDB0B9020EB SORTERWIREMESHCOMWWW
1,666,226,995 *AF5F8BFB97E44C93B30145244554764FC511C1F3 SOUVERÄNITÄTSKONZEPTE
1,666,226,996 *AF5B7922ADE9F48195C8F70C69AA7716CAD86E3E rashadneason
1,666,226,997 *AF59F1174D280F503F5E40816BFA77616B397D64 RASSORTISSAIT
1,666,226,998 *AF5D68790FD763094DBD454F24D2CAC571A57A58 RAYFORDTOMSICK
1,666,226,999 *AF5BF3FFE2AA80EC3971D6EF0122E6BC001A0325 RAYMUNDOLINEAR
1,666,227,000 *AF5F9407606C3150FFC8FA2A4CB66393869CB5BD SPENCER.KASER
1,666,227,001 *AF5E40650DAA7E0FAA5DB384E0B7254783797596 SpitatStarsEP
1,666,227,002 *AF550906F4F655C23E7A6A92BB6D5DE8DFD0A856 [email protected]===q
1,666,227,003 *AF561F56EACE0B91E3055A73E7A7586A13DC19C1 REDK722
1,666,227,004 *AF5725491A188639D838DFDE8F9E76D61AB77D11 REFERENCЕ
1,666,227,005 *AF5DA412973A475D8043FDE644E90BA99A8EDA5D refu$ive
1,666,227,006 *AF53DEA651D4CFDA13E76EB2DD549ECCA09C76A5 SRHP.GRV.N...082.
1,666,227,007 *AF5166697C85C6F4B0EB2BB8FD8377D865B16E8F [email protected]
1,666,227,008 *AF590EF584E2C62CF0B20FB06C896E1C4D90BDE6 SSENILRENNAMNU
1,666,227,009 *AF56FCE3F7B74F6A15B84F6A7F73F349A29BD413 {STACEY}
1,666,227,010 *AF5E243C517F72215166B9C2812E93C5F20B5370 STACYORTEA
1,666,227,011 *AF5C4DD550E66FFEBB65B5EDD24EB443C517440B STANDINGSTEMPLATE188
1,666,227,012 *AF56F34AC8187D2287E0A092910F0AFF2D7BA6F5 STAN.DURICK
1,666,227,013 *AF5EDF87BCA507DF8B9C0F28882C5D476BD404EB REPETITIVAS7
1,666,227,014 *AF5DAB58A4C91990B1E6081F3FC81B71C3676964 repeues
1,666,227,015 *AF5B3B9B638F416F897829BADF9567213DEF17DC stayhouse
1,666,227,016 *AF5B34402D4C9BB251B9CB1BD354BBE92BB8B366 rescuemepremieres
1,666,227,017 *AF57BAA321D2440D3657B563BB8646DED30A4010 respirait
1,666,227,018 *AF548FC830E7E28FD6A013858CE78AF70CFE0396 REYDAUBER
1,666,227,019 *AF5DEF44FFE6754F098AE7DB6DB6EB4BA60C5504 RHEKREVZ9
1,666,227,020 *AF59B98E20A07B73A0A1A7AB9CB498568EA6CFAD storpiassi6
1,666,227,021 *AF5A668ABD0E050B016F58F90DDE86723DF45CA5 RICKCUDDY
1,666,227,022 *AF5701A29E2252373C6FC3BB450C3ABF4DC3E945 su8minia7uriz3
1,666,227,023 *AF5C8D9619C1E433D24395DAAE7D9D44C78A6A2A SUFFERTHECHILDREN(LIVE)
1,666,227,024 *AF576AC7C0590A8442F36CB04B5E97C2E1260BA1 [email protected]$I$+ORIZE$
1,666,227,025 *AF5943CFDDA22DF2A46122D423E71C1AEE6B5D6F ROBBYMYRACLE
1,666,227,026 *AF5D932907D48859458B31A04D6DC750083C939A sunrutses
1,666,227,027 *AF5A0FDDFBAD32895242FC0232E94F82BD79E3F8 SUSAN-SUMMERS-CLARK
1,666,227,028 *AF598507D973BA1B00EC914778BFF473DCB26786 rocsanna8
1,666,227,029 *AF518DCE9406D375E8C231CE7B3E7A307866856C SUUREKALIIBRILISI
1,666,227,030 *AF55FE975D8C32742C25B3B426CAB98B67C13583 rodrickshamsiddeen
1,666,227,031 *AF5D6B3B95144487BD9D63A2FD3B30E09CC0B6EC SWAZILNDERENS9
1,666,227,032 *AF587E3BE2909B1B720DAB3DE0BA72EC1D3EA649 RONALD.LOPINTO
1,666,227,033 *AF5254A7B42A5D91E7AE15428DBC3997F25039BC SYRJAEAEN5
1,666,227,034 *AF55F5EFC66971BDA8AB8484701FE08FAA33A36C SYSTEMDEFENSES
1,666,227,035 *AF562C0807A54BC0FE36BAF58BFC0B8EA4B51335 rood.ladder
1,666,227,036 *AF5020E407C0A544B6F613EB7BB605289419DDBB TAAATAAATAAATAAATGAAGTAAAATTAGTATATTGCTTATCTGTTTTCTAGTTACATC
1,666,227,037 *AF512CCDD64A618EBAD9D55481013AE5245C2788 TAHBAZNASIRI
1,666,227,038 *AF58CC64676DF8188120D9163D27EBC062AB8263 royal-rangers
1,666,227,039 *AF55B8DD5A85A65824DFAD0CD0975EF048602553 ROYCOYOTE
1,666,227,040 *AF5B0B3BE9B8E40B64B1FBC9481D1CB879593B83 TALKBLKBTRFLY1
1,666,227,041 *AF5B90BB1B377B899FCCD1BACF444801C377E4E3 TALKKARZACK
1,666,227,042 *AF5F4B8B1C59445CEF8F5DEDFBD449AF9CD18807 russbrittenham
1,666,227,043 *AF5451967442492C4DF52036A2E0CB8216E1513A TARAPISCES2
1,666,227,044 *AF50139743FF0D7DBBFF74A6E4908B75662953C1 ruthlynn-37
1,666,227,045 *AF5BD4758A2CCE41F6AA2F6B310639BEBA9A6E88 tastenrahmen
1,666,227,046 *AF5E2FD17DC69CABFDDA297A730D1C0CCB174A12 TBPY
1,666,227,047 *AF5B5AA5D5AA5C74B7D184D16C0E0B08934BB8F5 SA
1,666,227,048 *AF53C10C6F13CC2AE3A7719C9C626A6AB4C0AB9B TELLTHETRUTH6
1,666,227,049 *AF54CB32DB360EC57575943888CB62316B447152 TENINLE-KONU
1,666,227,050 *AF5AB05A7CD013EA039C9ACF3BD9FF40776CE5C7 samantha-m-adams
1,666,227,051 *AF5B4D17C090F73C8DBB65FC3E85F02A6B752A8F TEREVELF
1,666,227,052 *AF5C8761686E3F368F7DE0ED791388E9C2F46960 terrenceseguin
1,666,227,053 *AF5F44B92837AD1BFA042443AAC8880941790EF6 TERRENCEVANACORE
1,666,227,054 *AF51AB8955C1229B783850D765161B1F68788DEB TEWNETAC9
1,666,227,055 *AF5EB57C4C5CA1BD2E3C46C0CEAD89342F2DC5D2 THATGRAHAM36
1,666,227,056 *AF5E96977C2AC111C8BD80B53DC03BE5531E1524 thecyrano54
1,666,227,057 *AF50DAC24EDD174D84CD7508B09FA3EC4D8DB245 thereconrad
1,666,227,058 *AF51176073F6EAB4819BC85FE7CCDAAB2F67124C thieny-phan
1,666,227,059 *AF555FE09EAC6B03E1B523C4F29C73BA42F180A9 THLSSNN5
1,666,227,060 *AF54DEDD0AFC5D3F87BE4A74C4712707E2BB7C53 THREATNEING
1,666,227,061 *AF5588D84E69316FCA9FC642938702B1C30A6CF1 SELFAPPRAISE5
1,666,227,062 *AF5D90A3644CA1AA9A846F4E77C9449F4F029B74 SELLABLE
1,666,227,063 *AF5142D88CBD73A710B052D781054A239421CD65 tigertrucks
1,666,227,064 *AF553B6B164B9AA1BA7B572A995CE4FD6E249C23 TIMBERMONGERTIMBERMONGER
1,666,227,065 *AF5B7583A4D02D17D1ADF5F1BAA5681AC7DF545C TIM.DOUDS
1,666,227,066 *AF55E196728D1BEE5F03EBD9D314251ED9C69C38 SETH.KISAMORE
1,666,227,067 *AF560093B7A985C42892BC385AEA7868ED053B28 sever4b1l1+y
1,666,227,068 *AF51EE57166D76715CD3B379CBFDA4A704323F2C shalier
1,666,227,069 *AF5C074C9D64FB8700DD6A522B071B14287927A4 TOBY.HOMME
1,666,227,070 *AF53D5155BE38B6ADE701FACC1B48B24A136B60E SHARONGLOBAL
1,666,227,071 *AF5BBE9A97C22D21A7425AE330BFBD7434E1C0CA shawnsticker
1,666,227,072 *AF5000AACBE056FA3AE053091684B2406FE8DD0B TOLERANZSTADT
1,666,227,073 *AF57B22748D262E226D39957C70291043772B95A TOMMYJEMMINGS
1,666,227,074 *AF5C64471E607E3F7DBCDED312AA350D73A43D94 tommyriling
1,666,227,075 *AF5E0DE3AA54B89CE55DA9A2EF45C56D631D2765 tommysahni
1,666,227,076 *AF5497EDB517678AD157FA6DA574186D3548090B TONYBLACK
1,666,227,077 *AF5173E9EEDF8D44238B40C60F785B211005C4A0 SHODAMI4
1,666,227,078 *AF547A4D66B18CBA17FC789A50D7EFFDD44668F9 TRACTORSUNSET5
1,666,227,079 *AF5BA3BF00ACBACFDAD2755617F25D9EF5AA9396 TRAININGZEUS6
1,666,227,080 *AF53287E83C8E8EE2C4292681B5835A0BDBB3042 TRAJESES
1,666,227,081 *AF5EE0453D53F1423E45B562FD6409E57B3DE1CF TRANS”
1,666,227,082 *AF5DB1696552EF1022C25BF1AD6B3AD9BD74607A trentdelisle
1,666,227,083 *AF50EB9D3C4B5F7424C69BF3392D140FEF962121 sirijskog
1,666,227,084 *AF523EA214837F88C23B4F39CA81E08C3A6A8941 [email protected]
1,666,227,085 *AF5F3A2F0B67FA6EB1256CA395DB7AACE3E2C4E7 SKIFAHREN
1,666,227,086 *AF5DA66268DDB99DA3105E3C2706036CC637C90B TRISNO-HARTONO
1,666,227,087 *AF57EC52149F0663122182B3298E3F1166E006DE TRNSDLCT4
1,666,227,088 *AF536164DFB19F91E1E13BECBD15C82A6387BF12 TRUCK19
1,666,227,089 *AF569995E3C5F95E7393EFFE7EB1E283676EE59B SNAKEFROG6
1,666,227,090 *AF54F44B4D85B255EAAB6C457468C534F3BF227A SNARFELING
1,666,227,091 *AF5A8641F53B452F5E8F259798E99DFC7D1486A6 tuanako
1,666,227,092 *AF574B21454AFB7CFC54AE38F4143D2A4FA82C7E sommerferien2
1,666,227,093 *AF59A65CA1DC0ADD4659D033B59C0DF8865AAF7F Southside.Blues.-.Tobacco.Road
1,666,227,094 *AF52CB2B516F6559553CA0FCC678E2A6A32236C4 UENX
1,666,227,095 *AF5CAAAD8CA10426B4BBDC8E097F00AE9EBCD1B7 UGWS
1,666,227,096 *AF5E6165FF98AF30433D72C948A0274EE249382D splat 0~ @p
1,666,227,097 *AF5FE023D7F085D534F5959D3603CC2E959688BA ULYSSESMADKINS
1,666,227,098 *AF57325CCA581B0DC1CD03F16FA54870C3E24002 un8r1d93a813
1,666,227,099 *AF55EDC0D33D22FAE29C42073C21B700F3F49E6C SREKCAZRING
1,666,227,100 *AF558C22F1D8C32D0807731902210C067BA1B296 srevreslwsb
1,666,227,101 *AF5F1E8A313FF05CEF7F0EC39EA5DA542A2846DA ssnlbrsnmm
1,666,227,102 *AF5DC6C3739EE26816577666EF9F57116F98A11A STANFORD.ANDREASON
1,666,227,103 *AF59CA0B4FBFA34F6FEE1F605E805548E9B25BFA urbanity-slcomwww
1,666,227,104 *AF582B935470BB0E3848B0287FBFCDA7FD0E00A9 USERADAM2288SIGNATUR
1,666,227,105 *AF5DD6DCABA201643058E401E52114D96508A847 STEFANIEMCBRIDE
1,666,227,106 *AF52F38A08BDB95D45446B99B04D19FF584D1F2D STEPHAN.DENFIP
1,666,227,107 *AF5AF1CEE0068B676D03C7A56ACF263D92C5DEA5 STEPHANIE-ODAY
1,666,227,108 *AF5231EF91BA4B9E63954B6BD6461BD3C79593C9 u[-t
1,666,227,109 *AF544820D3F1B85FAD3989690A7C9DD87D393CE3 STEVEHAUN
1,666,227,110 *AF505D5E43D539AD36F47E6C4CA4B9241841B31A STEWART.WEAFER
1,666,227,111 *AF5CC9ADA1F3809867F4976134AC0F9AF3870789 V1*X
1,666,227,112 *AF5E5B57DD2C3FB137EF13D102909EB06EB62234 [email protected]
1,666,227,113 *AF56EC06D401F46662EF8AB4AC8AB525C93B6B35 VADUVA.DAVID
1,666,227,114 *AF526DF30DE5B34068CED5F4D4B07E32F8B7663E stortbeek8
1,666,227,115 *AF514DEA8F4C4A5993ABA87D2C61EECE714CD5C8 VALDEZ BASTY
1,666,227,116 *AF5015DAE8CABFB3176E210CF033FF5AD6489EE8 VALISHIA-JOHNSON
1,666,227,117 *AF54602347AD69932DDE7509651EB3349712856C submucronate0
1,666,227,118 *AF5655DADD4D00FCCCDBB4B344A23E3D608EBBA5 [email protected]
1,666,227,119 *AF58EF7D114DCB6D7B4FD5B7FB49C0A818BC0250 SUMITRETI4
1,666,227,120 *AF54E845F96C25544C42FE48E8AB7F6DCD3591F1 SUN_DAISI
1,666,227,121 *AF55D649E9550C1753A7806533604011B5638494 [email protected]
1,666,227,122 *AF54F72E76F714B327061A5B111B12B99028AF9A VEMAR ENRERA SY
1,666,227,123 *AF5ADC08B075B0C565A7DB3B770CF43FDF189BEC superbeatpusher
1,666,227,124 *AF53C3329C41937D19B3F1A5B75C349BD85B8483 SURFFREDDY6
1,666,227,125 *AF536DFDB28A75DB800D81EDFF60CC6E4EDD1104 SURPÂTURE
1,666,227,126 *AF533F8FDBF14A91455F0B9BA9CEEDB1D84479D6 sweert
1,666,227,127 *AF561A08E4210E920887235D11563129E6239FB7 SYGKLHSHS3
1,666,227,128 *AF50C8E62368B1215C96339E068E9ED7EDEDB75C symphony-no1-in-d:-ii-andante
1,666,227,129 *AF5463CC35252EE58DB4072937CF5721BE1E3102 VICKREDDY
1,666,227,130 *AF51738A5C4E6BECEA2C4B7453AFF82C9CAA49A2 S*ZO
1,666,227,131 *AF5E9C6FEA70E8CA219E8A88DA17443ADE788655 viicorps
1,666,227,132 *AF574F4EF5340E957F3C1A61B060C6C1117BEA32 villhaallt(feat.clawfinger)
1,666,227,133 *AF5403E7113BC890DAB80C56A866B1A35FE5933B VIRGILMALINOWSKI
1,666,227,134 *AF5D2334CCD0A2800FEF2A3366CAAEE02EEB2BBD VITO.ZUPANCIC
1,666,227,135 *AF55CF596D55FBCC77A155D066F6CBAD7E773489 tayaosha1
1,666,227,136 *AF5748DA1FC93232BDE9F224E2709C9B4C6392EE vreempje2
1,666,227,137 *AF540A758375467B28539CA46F45643A9DE8D81F W090992
1,666,227,138 *AF512D840620FB44FBF84ADA2877991425BA6462 TENT…
1,666,227,139 *AF5C3B36B423C03974CC862B7EA940CD17CF921A TERAKOTA6
1,666,227,140 *AF5E701C4ABA853494C1BB619C92BD7F799C9497 terranceharkey
1,666,227,141 *AF57BB86AB4F7FD7BB79BDFB412CCD20CAADEE6E waitomogrottene
1,666,227,142 *AF5C1956567827F5D06573516DB59F830FCCDC22 walterica.charles
1,666,227,143 *AF546680EC30813237B646F92A8E1A664F769578 WANAMAKER160ORGAN160
1,666,227,144 *AF5BD82B6B64ACDF5D23D1874A54379BF3962498 THALAMI
1,666,227,145 *AF52532B50BD041063FB73DCD4EDE2999BDF9F4B THATCOYOTE666
1,666,227,146 *AF556E7210FA6CDAC60104122413F67DD174CFFC THEO.SCHUT
1,666,227,147 *AF5936453ED3A1534FFD88C432C2C9854A3F8E1B THUMPERJOKER8
1,666,227,148 *AF56AE72D165255E23CC1C76975629E3842D4BC3 THYNNESSE4
1,666,227,149 *AF5BE65EDC892761A9F6721DB04856CA95D4EBB5 ticker
1,666,227,150 *AF5FFAD179D1BEE0EA5801C7D1E5307BE6F10F47 whitneywoolums
1,666,227,151 *AF5594115410B187F0E8BDBF93367EA852A2737D TIPSTSAMED
1,666,227,152 *AF50794BEAAC0378A87F346F2EA8A26363FBCB30 TITUSMAGNANO
1,666,227,153 *AF516CD84DBDFD9BD55A1A34936B42F1107D7E8B WILBURN.DODGION
1,666,227,154 *AF5E4DF49D854E844826908D029F9D92665B0134 TJ<O9DB\'748M
1,666,227,155 *AF5C705A47BB42CDF37EC48C99A1713C55DBEB0A WILFRED.LJUNGQUIST
1,666,227,156 *AF54CEC069E12D28445554CED19391CEB75F024F [email protected]
1,666,227,157 *AF5264103C4424A1CD9124616A0EDD3DED1445FA willardlicari
1,666,227,158 *AF58702A5A76AD19ABD24B80ABB77E97FA7C1899 WILLARDSPERL
1,666,227,159 *AF59FA7FCC0D1B903263A5A044A8566AB3A1B553 [email protected]
1,666,227,160 *AF5E78FF96DA979EB6BFBA6E87FB5CD577E68359 TOACROSSADVERSE9
1,666,227,161 *AF53E3F03665C7ECBD5AF20B3084DC67AD6A166E WILLIAMS.VANDIFORD
1,666,227,162 *AF5601495D834AFF7B83088AA9494BE385A86ACA WILLIAM.WEBNAR
1,666,227,163 *AF514C47A2769D417F5C45A5E996FCE4D5A059D0 TOBIAS.REHART
1,666,227,164 *AF5A7623E36778F596B649DC41DC76F8FDBB0167 WINDBUTEL.1.0
1,666,227,165 *AF51F4E484B5814F813CA1F59F04A03FB2343872 winstonjayco
1,666,227,166 *AF5EDBDCDE887CF2D11A79E0CF0D4AD3C361C17E toni-garza
1,666,227,167 *AF53A6371DEEFDDF18A6B0BBCB37C4DC0F3DD579 WLAEEDM
1,666,227,168 *AF507C5179720441F639D63912006D9460500040 TOTEMOM6
1,666,227,169 *AF5B1C7C03E83AD7453AAA5A0AE9638E0C56D850 ;);touq&n\?uoy.era.woH.!evad.,olleH;touq&(.tnirp
1,666,227,170 *AF5CCCB97786EC0E35CF04F3096CCE4E75744F12 TPLRYKU3
1,666,227,171 *AF5EED59C68394327B27D76691751A2D51058CBC trevorlamphier
1,666,227,172 *AF50EB8A4656120FAE663BEB4466147FD093FDB2 TRICENNALSED
1,666,227,173 *AF56B075C1ABF78BC36A5CE1250572541F94A3AE TRICIA.CARPENTER
1,666,227,174 *AF561EAF5E4E88D6230404EC010AA9D06DC57FBC TRIGGERMANSTRANGLING
1,666,227,175 *AF5E6265400050BFA2FBADD1872DFFA8C5CF63BF trina.owens.conley
1,666,227,176 *AF539588937DDCE46DEBA67839B4326761453575 W:Z
1,666,227,177 *AF5508AE792A0E020372C753C0FBEE9ED6E96973 [email protected]
1,666,227,178 *AF5CAFC0E56FAF0A86FE188E55536D268ABC4D11 XIEGANJIAO
1,666,227,179 *AF5F6AE51460CC4D0A9B0FF5C652075D91C03AFD xj(s
1,666,227,180 *AF535E5A9BA2BF7D5C0BEBD9A2ABFC8B52B944F8 [email protected]
1,666,227,181 *AF5A2B1961DCD3065E81D8A7B4DB6F1ECC10B44D XUXUANHE
1,666,227,182 *AF5A750482F2B0F628B3DEDA2460283E744D829E XUYINGDU
1,666,227,183 *AF5C0F75645953E2CBF5E111A90C95352DF8127F TWIC3-M3T
1,666,227,184 *AF5AEFA995C1F82E983E610E2D9C6980D79202E9 YAMAÇTAKI
1,666,227,185 *AF5606DE10EDC16F38613666B76407F97EB74E02 yaumulakhir
1,666,227,186 *AF5AF58502555278742768DF2A51F2F96DA10488 [email protected]
1,666,227,187 *AF527CB2E8E0C58D8811CC87A7632D070E24F0A4 u9&t
1,666,227,188 *AF5828F2D2E4AA219B1698DBFB706A784865025B yelskcaey
1,666,227,189 *AF50255750D9320F69BC789DA4C89C953E9AC576 YENNY-HANDOKO
1,666,227,190 *AF501867135CE54E10627CB7D071B808D97D4253 YESSYROSALIENDEBLOUWE
1,666,227,191 *AF5D8EC89E5BBF235D4EA1C87333D113A25B8770 yew.hwai.kiong
1,666,227,192 *AF53D15E90EB4F2F3C102D908620556FE652FCB8 Y$GF
1,666,227,193 *AF5FB80C7011652DA3F4E50EE531681FB5215A20 YOGESHNIRANJAN
1,666,227,194 *AF51AA3CA33F7CFFE411BD237CF41D2AF610E2DD UMAR.COMMANDO
1,666,227,195 *AF543F4610E57DF818B6C1D8001DF37A22A19A94 YONGKEVETH
1,666,227,196 *AF5E395FB0D73016CC4CED5E6A19B402393E2C92 UNADHANIED
1,666,227,197 *AF5E2A3FE80F0C6217FE17D5F7802CE1DE5270F8 unclasp
1,666,227,198 *AF5053D8A42FE29DB57DBEE7B9336CCE45184773 YTUANG
1,666,227,199 *AF5AE505083424FC08B4F1AD742AEB33E0F5EA22 unjungdong160
1,666,227,200 *AF51F825BF9F48D663DF1E71B285F51A80424815 UNLIKELYPASSIONMAYSAVEEYAK
1,666,227,201 *AF5F6C03B3ED8E4B652164A8359E29D4CD95FBC4 [email protected]!N9
1,666,227,202 *AF52977E2222BBB31553C1B08B5359A546A9CE17 Z<9M
1,666,227,203 *AF52ABD109FB6DB8E0F59DECCA3BA1D214C6B02C ZACHERYMANUES
1,666,227,204 *AF52A5218A1C541906E4E10CB68E7580A67495D7 ZACKBAIZE
1,666,227,205 *AF55FC84B3355CCE3E9C912EEC32161A2DA9178A UTEGNILO
1,666,227,206 *AF55527A5DE2D1C8215CBEDD4478390CEFB29442 ZDEVASTOVANÝMI
1,666,227,207 *AF5C25D1AA9A18B1341C135ABC32B113DEECDB39 uz0baaaaqaaj
1,666,227,208 *AF5D4BD875039769F9D3185572FFEAB3AC2EEE54 VALERIE KAUSEN
1,666,227,209 *AF5AC25503016F3A3DAC1563EE1DBFF0D8D52A46 ZHOTHAQQUA
1,666,227,210 *AF53B31B71E50E83574B7C1A48B13044FBEC3F9B [email protected]
1,666,227,211 *AF59589F41C46E803DC47203FD86F6092F4796B2 VANESSA NUNN AMES
1,666,227,212 *AF51DF1DF1A4AAAD5348FC5FA60F8FB12D96F5F1 ZIYAAD DAVIDS
1,666,227,213 *AF58CAA54FF90125950E368775F2EA09A91E1DC4 VARMERE4
1,666,227,214 *AF5EFAA47DEC790B3798F8AD7A998C9A7A34EC8C ZKUJŇOVACÍM
1,666,227,215 *AF537D030D8F1BF5B9CFDD59FA722BF686A81CB2 VATAFU.CEZAR
1,666,227,216 *AF52254F8F3181EB6E5BC3C9C888A41587F001EB VAUGHNMASLONKA
1,666,227,217 *AF5B12876921A48B7AE4CE3F16832BA158793400 [email protected]
1,666,227,218 *AF545B4D52B0911B21304F24687EB866E553AC66 [email protected]
1,666,227,219 *AF5E2E937FF1773E1247A299399AC2DE25BFD68D ZUNIS?
1,666,227,220 *AF539E05432749988638A8CCDF5060CFDAFB4B03 VERISITY1
1,666,227,221 *AF5631D6FA17E9AF73397CD3764A60FBC156117D VERLENGT
1,666,227,222 *AF5DE14A8D7BCF3CA5877C6E5609E2FF4A1F369A ΑΠΟΛΟΓΗΤΙΚΌ
1,666,227,223 *AF5ED9B68B871DD7427631A28965CB3ACD300648 VESISTÖALUEELLA
1,666,227,224 *AF550B71C4D0694700F719D572649BFF15B58865 vestryises5
1,666,227,225 *AF504B3A46078E9D155D03668DA5A09A0FFD2B74 VFDHULVERS
1,666,227,226 *AF59479F2627D519A4F2A2BF276805D0D399D244 vf"j
1,666,227,227 *AF51D8C59D4C9B1ADA405089D3347A2178154393 алтайветпрепарат
1,666,227,228 *AF5116C6D9DF3AF03C6B02E224EE9FA2A8F71123 БАСДЕН
1,666,227,229 *AF58AA2DDB2579C0076AF9AFA075CCB0CEBA5197 ГЕНХАРДОМ
1,666,227,230 *AF5C660D7B2666567043356DB9EA785B7464CECC vincentgarwin
1,666,227,231 *AF5FD0B10EAF7A82CE80E70A616BC06269E24C30 VINIT-VIKAMSEY
1,666,227,232 *AF57FD045ACD7696DF6BE52F0F168A35BEDA31B0 visabrewster
1,666,227,233 *AF502C8D18F7C4CB76274F01529E1D09845B16A1 оомицете
1,666,227,234 *AF56E139817D2583F316A13840D5882CB4D3823C VOLTANVORPSI
1,666,227,235 *AF5AF356B39B5E2CCCC30CBB5BBD6A91D40E61E3 VOORTHOBBELDEN.
1,666,227,236 *AF515B894135B3338597B39AD1C92688CA880D18 VUURKRACHTSED
1,666,227,237 *AF589522E6B1619508C4063C3C0331249E5810D0 *W$1;CR
1,666,227,238 *AF554189F994ED8928C861EF2E4994A1215D6A89 以上、nnn
1,666,227,239 *AF5B3AD8ABE4FD1968818CF4DCD2688ECDE2CDB2 WAREZREDSKIN
1,666,227,240 *AF562389DFFE6B326B8CF426FFF3745B6543364D WATSCHELTET8
1,666,227,241 *AF50C1C72768C510D16717E5937A6A080E6D2466 wazir.ally.gator
1,666,227,242 *AF57D755A05F47D8352AF5BAB2E1ED63D48AD2D3 we;
1,666,227,243 *AF53D9A95809DFF29412465739741C399831F7D0 wenny-asalim
1,666,227,244 *AF5CD8716B6256B70DC08A815A72633C97686843 WERTPAPIERVERMÖGEN
1,666,227,245 *AF55B2166529F00A193D67DA5916925B1987D49F 04t131930z
1,666,227,246 *AF54C8B8ADA1B634D9A645679514200C5C81EE3F WILBERT.MILBERGER
1,666,227,247 *AF59433C130108EDDAB1A3B023AAD4E6AD85BE6C WILGAINES
1,666,227,248 *AF54F3279A80FF72437AC76DDCE0C5F041BD66FD WILLARD.KITCHER
1,666,227,249 *AF53DC8D3648664E92176CE6A86378B6A06A09B0 WILLYCONNERY
1,666,227,250 *AF58C418805D1569C3585F99EE669CDD0EBC1F2C WILLY.FLUECK
1,666,227,251 *AF5D9FCEB122BCE77A973235E032162EF4F4D582 (>_0)~`(--b
1,666,227,252 *AF5E98886FB11E15964BE1AF0C79FF66FCD3C2EA wl$m
1,666,227,253 *AF5447A951D8777A7A0DEAF9B5EFE769DE2AE3D9 12: 12 # & OUTDOORS
1,666,227,254 *AF56A1314F9249475CECD642913CDC75058BCF5A 1236358 lakia.muutettiin.asiaa.k
1,666,227,255 *AF54E5EF04659D9ED974092A331EDF96A658C32A 125289 VESIEN JA VESILUONNON SUOJELUN HUOMIOIMINEN METS
1,666,227,256 *AF5F5CB27D5415299AF81AFAEC6DA7098F2F3CD5 wuchotu
1,666,227,257 *AF56098664F618B5E6577D8B4C1DDBB1A654DF36 WUROUZHUI
1,666,227,258 *AF51E0D0ED79F64C45C5BC5B8B99A84853252B91 14abed-rabbo
1,666,227,259 *AF57F7B8DA8B79B981DB75DF7FF329110C496D96 WWW.SEASHOREMOTEL.COM
1,666,227,260 *AF528A1A61101FB5F313AF6A724F52E74ED3B0F9 15-FRAN
1,666,227,261 *AF5A534ACB1CCD32BAC0FB067D12A9BCE606EE38 [email protected]
1,666,227,262 *AF57C8CF34987DE0870F5B3498FDAFE057FEC68C 16 # with two parameters
1,666,227,263 *AF5395B52ADB7B4705FE2B5E36E3CACAC6D3EE33 1987080 indeksin.arvo.on.skaalattu.v
1,666,227,264 *AF53C5283A902B1B143AFA1AE6FA607A712758EA 1991831 JOSTY
1,666,227,265 *AF51C982E1E2E91120E80D21B8006ABAFF1FE5D2 1.abschleppfrei
1,666,227,266 *AF5780DDDE99AFDD48C2ADEAB74F0D38124CCA1D 1 ALKUPEREHDYTYKSEN
1,666,227,267 *AF5CE4347C8FAB9BE04BADC7CCF86B92F23B7C80 1AMOH
1,666,227,268 *AF57FAC7D8558E7141010DB2931C7ED763B91695 ;[email protected]
1,666,227,269 *AF5A1A1ECDFC12F67D0B4C33491CC32783AA6050 [email protected]
1,666,227,270 *AF54D44C83D7C8C629FE141242885BE920E5B4C9 XUNAIYIN
1,666,227,271 *AF59B7F9D5191DFBC54514939ABF90EF2DDDF032 1DNERPPAE
1,666,227,272 *AF5024CD07C7C61CAFCC7F05C6200627EDEB8268 [email protected]
1,666,227,273 *AF5F9CF5F90E1138B81BBE6CA4D54CB713FC10EB YANKEESBINGO7
1,666,227,274 *AF522CAD1DD3A1C0A54000FBF05592FD04E82EA5 yansanyal
1,666,227,275 *AF5A975F842ED84DC1E563A42EB992C6E5316268 YARONWIENER
1,666,227,276 *AF564A26775D98D37C12BC81810C09E986D7DD60 yazita-la-mas-bonita
1,666,227,277 *AF5466E4D599B37FD5731CBC0B469A384C5CBF2E yenyendollete
1,666,227,278 *AF5CFB0E583FEF1AAE5DFE848F514AFDA8A510C2 1JCOMPAQ
1,666,227,279 *AF5D2B22539FCFEF18C35AD4173000EE94DD7B96 YLSMNTNN
1,666,227,280 *AF56769A81A10E4E9B892FC425B7F61DAE5690BC [email protected]
1,666,227,281 *AF5D2D0CE88B148C01F3AC9061CCBEA410EF5AD6 1.lastensairaalapaikkaa
1,666,227,282 *AF5B20286552B7740E915918AA3B961B96EB0AFA YOGHIF
1,666,227,283 *AF50BB49161ECADC396FEE21BDBC1F33D9574E20 1morczinek
1,666,227,284 *AF5C062D033C7AC62903459A4CE565F62E4D3795 1NF0H4WK
1,666,227,285 *AF51E02F849F3183CE2CFF948A28570AD87CF7E2 yranoitutitsni
1,666,227,286 *AF5AAF5948A2894370DCC94736314B3CA9D86336 1.OMISTUSASEENA
1,666,227,287 *AF5E9E70B1350E3357123AC9D5717B17D2DED32C 1PARKPLATZMISERE
1,666,227,288 *AF57D7D64B657CECB45143BFACBFAC0AE19F7F7C 1 PERINN
1,666,227,289 *AF57AB4CF9FF95E55FD5DE983F964B0DC2104DFB YUSUF-SEBAITI
1,666,227,290 *AF503F0DAC067BF003CBC662E56D8E79DEE84259 ZACK982
1,666,227,291 *AF5C53476692722CBF2BADCBFF20A4647E7D5FC7 1 SONDERKONJUNKTUREN
1,666,227,292 *AF52D13CD51D0022C6F0A6F48A48263548EC9A10 1.SYNTSAB
1,666,227,293 *AF57D811145051AF43AEAE89010F087CE6731928 1-ToLLeSoN
1,666,227,294 *AF5BC1C3BC957C11C17DEBC3CD1D8990629F717A zaw-zaw-khing
1,666,227,295 *AF5C32013BC7811F3E50D27E7ABB20D9F34B3BC2 1VASKOLLA
1,666,227,296 *AF566D3B725E7852B3C607A5C92E81C8CB41C542 1VBSCRIPT
1,666,227,297 *AF5A9CD5072945B86A1FC219938A72E9F6EFF8CB [email protected]
1,666,227,298 *AF5DC11B5B5C7870E460C352C444F0EE1BFEA93E [email protected]
1,666,227,299 *AF5956F6CAF6C27FAF1B01A785488EE7639C1295 [email protected]
1,666,227,300 *AF5B8D3F6E5EB5F78735686F49918B6C0232B88E [email protected]
1,666,227,301 *AF542714102A3CE8BFCFBF4D58CE80EEC77474E8 2: 1 -# 1& UNIT TRUST
1,666,227,302 *AF53301C9154F248A98D89CACCA460A5CC23E91A 2154173 sataman yritysalueen sijainti meren rannalla golfkent
1,666,227,303 *AF546FC3C1F19472E50D95DCC410E1B7B76ED710 21SEP1089
1,666,227,304 *AF588B5371F53F7006051EF90B025C9B84CAF78A 23081395
1,666,227,305 *AF5E8DE29F65546879EE88858266309313D2DFB1 24d64d7825aced1c7968561352c3fa12-lamora
1,666,227,306 *AF50854220AD39FC32202614071FA72B2B16BA07 Z^PZ
1,666,227,307 *AF50CA180C5350A4FB24DC1E0B4CE4DFC2148DF8 2564610 oraan ollessa viel
1,666,227,308 *AF59BF9EBF35B6C04D293A521E923A79F4028CD0 ZUG%
1,666,227,309 *AF545893A8C241FB1603B98316B43F1A21F8CAA8 2795455 JOS.MIELEST
1,666,227,310 *AF541800A1AC1448BFC954B5CC810AA3674A6719 [email protected]
1,666,227,311 *AF5B3CDC6EEA325EF74B7001B6913B2B8027D85E 2810455 sfs sfs 5648
1,666,227,312 *AF5C8FF9E1FA65EE6B448A7695C494ACE400B681 2819095 REVONTULILLA.EI.TIETT
1,666,227,313 *AF5E4CB10E2410CD02666556397FA3B86F332B38 καισαριανιώτεσ
1,666,227,314 *AF510A08C6DD931C80E69E4D6AAAD5F849306F9B 2.ANBD
1,666,227,315 *AF59550B71EEA8641312B527567C8AA92AFE5EDC φλa
1,666,227,316 *AF518F298BE559A76599877D7EFAA867AB3CA915 джіджі
1,666,227,317 *AF534FDC7DA11D4C5A420C0F6D7E963F917670FE ЗИМЉИВИ
1,666,227,318 *AF5520B5819190E6FB7330BDD6C4109B821D23A4 2.JOKAKEV
1,666,227,319 *AF50DFDA3B8BD4CA66E1E8C412D78CA85B4F6399 ИЗПИСАНИ
1,666,227,320 *AF5081A19098088E8858CE82B3FADFB8DFC75C52 2-kaukokulkeutumisen
1,666,227,321 *AF5258B7B9241BB5E5B005531EA911C25CDB4B04 КИНОБИТВ
1,666,227,322 *AF5B556E1BF738CFE490EEC13A5732AFAFFACC69 2perustelevan
1,666,227,323 *AF5BB76CCAA3FD20337F556C465A1A84A246E0F2 2SHEANNON
1,666,227,324 *AF51119015FA6689A989658FF699CC4240410F5A 2SOEFIETE
1,666,227,325 *AF5600E4CF93216D7B8D22074076A238DF15F0F1 2UDEAJJQ
1,666,227,326 *AF5EAB3625742055AB253BD2216BC2E7F3837B47 УCТРУЧAВA
1,666,227,327 *AF55BCFCC600A74D4B103CF15F236FA0E5364B55 ЧУЦ
1,666,227,328 *AF5DB6A2D59BB5C1A631488DAB34BD09EA42289B 公司,因此無法再使用ROLLS
1,666,227,329 *AF5E980D27E38CB2696D6D927B35A81AA1A25852 兼容格式的短文件名和长文件名的方法(如“MICROSOFT
1,666,227,330 *AF59DBC792C8C881431C7BDB7B3E3582A804FEB8 ,台灣最大的鋼鐵公司,總部位於高雄市,英文名稱CHINA
1,666,227,331 *AF508C5FA99CE8F30A4CBAC316B871EA3BC748A6 3jorge2
1,666,227,332 *AF5BA0DC5C18036502476D1BDEECA3E77C0A6774 446E8758D0E83FBD582558C6BEAA0C5EF8CE68B2
1,666,227,333 *AF58281368145C01298593F6241DC65831D544DE [email protected]
1,666,227,334 *AF5AF03F9B2FD9A1B6C15BC1128ACF9716ED8B7B 492LEIA
1,666,227,335 *AF5C4718DC200408869D06034AC22DE8403DC5F4 4BETZBETZ
1,666,227,336 *AF5886E2B7989B69E96E592595F73AD7A8101FD1 4DOLLYHIGH
1,666,227,337 *AF53A208E1742850F5216283B4DF0238C2BD8010 4EDNOKROO
1,666,227,338 *AF539CEFF2326AEE4893B2DFE48FBD63959FF56C 4ENDOTHERMOUS
1,666,227,339 *AF5FFA4E9D3E69E299CFE4F163301DC39FCD7040 4fdcfb99c30c4752ec8047df416efb72iloveyoulabz
1,666,227,340 *AF54E0877A0AD06CC14BC8102D5A61EE41D47873 4HASLANE
1,666,227,341 *AF5C8A35BB5632908101F9817D5C9D67B805320A 4MENETELMNS
1,666,227,342 *AF5060E5CD93AC6FFA99217922B543D9CFCA1759 4PICKLERAISTLIN
1,666,227,343 *AF5F8646BFD660EE498B44BB1A5C239F35250301 4PRADAAYINII
1,666,227,344 *AF58A9EC75D31A1B55B2F0CB35E7C82431D106D6 4SYSTEMOBIWAN
1,666,227,345 *AF5FD03E01234DD21F8DD3A74475F557B55A0C60 08-02-1126
1,666,227,346 *AF5F4ED44CBD7F2F39270C990D663ADA8D39D44F 5ARIANESPACE
1,666,227,347 *AF56CEDDF891F002F7AB4E0367B78CB2F78EE447 1252495 ITS YIELD ROSE TO 789% FROM 779%
1,666,227,348 *AF57AEBEB1073B827FA33481B335826B6F66940E 1257832 als.spieler.standen.sie.im.schatten.der.stars..
1,666,227,349 *AF562558473BBC262248AAA1397E1CF417098E36 1328489 therearevirtuallynocherryblossomsonthetrees
1,666,227,350 *AF5631CD4B45B8DBCA56C77C2B31998BE5276CBB 5CANDYSTRAT
1,666,227,351 *AF537087D7328A8C8A0A63A933D6BCEC29522609 1433256 MOSTLY , THE MAGAZINE IS SOLD ON NEWSSTANDS
1,666,227,352 *AF5A24525F106AA6C5B2F0017FCBF579D09E2AC4 5DECEMBER1152
1,666,227,353 *AF5A293F17E676231432D34C9196251F0D9D2355 5DOCDRAGON
1,666,227,354 *AF5BB839EF342E0F16240B1FEC45B0F54F5DF5B3 5DOLLARSSNUFFY
1,666,227,355 *AF5AC57079F4666D1627EC094064BD8F3ACFBD44 5DREDDFUL
1,666,227,356 *AF5C02DA36EE9EC6764B817A3721C4900542130F 1540074 umdieszuunterbinden,hatdieoszekeinehandhabe.
1,666,227,357 *AF5B9889568A3C2F679E340A3D029DB3CA288A0C 1596goss
1,666,227,358 *AF54C4E72D22E548883D417B9BE029AA5CB0BB02 5HOOFDINHOUDS
1,666,227,359 *AF5578FF95DEC5EFB978157EE30AC7AF7A7B9A46 5INFLAATIONTOR
1,666,227,360 *AF5FE50B6CE8E0A147195142526CCCE2A8B2F070 5JATSAKAR
1,666,227,361 *AF5172C71B896B7D53C747E54D195E0918AF0F47 1a480ee22b816dc720db7caab466fdc3-ff119796
1,666,227,362 *AF53DDC811FB5386BDEACAAD3B60DA08C7C06BA9 5OPERABILITA
1,666,227,363 *AF5EEBAC7C9C7C71A038EDFABB19499C00D4D0E7 1.bieljura
1,666,227,364 *AF5FB90FCCC1165B6F692B35C481EEC13842E53E 1.BROWSERDEN
1,666,227,365 *AF5AC82A84C2F039D6ACDFB24C2EF7D967A22648 1.CPM:N
1,666,227,366 *AF5FF049CA325CA48CFEEC98E543A84514670E69 1DAVIER12
1,666,227,367 *AF52B9A67A3B3EBAAED253B0CCD4960ACECB138F 1.edevart
1,666,227,368 *AF5983D824F4AC2DD21D819485DA82F612612471 1EDOMIDES
1,666,227,369 *AF539D31553811D210557D5E18D815787F9A7702 62aa85b8f04f33feb4767b77fe06ecb2
1,666,227,370 *AF5A74E98E585E52B4E5BA7F441D3C8B775067BA [email protected]
1,666,227,371 *AF58CA3BA810CD30F8EE12C7770EA80CDEFA0F2B 1.KANSIELEMENTEISS
1,666,227,372 *AF5F923003A16D65A43C99C2168DA013F0E545CA 1.karstadtquelleaktie
1,666,227,373 *AF522649BA8EB3BAF8587535C9CF54B6E4DF11CA 6BARTHODBSW
1,666,227,374 *AF501CE56EBFD4288F4B7ACC088CEDB1275F32BE 6BIGBIRDGRAYMAIL
1,666,227,375 *AF5D6E7290AA5B8ADA6E49B2A46E1B90C2C87532 1 mathena
1,666,227,376 *AF53FB7C707048C0DC447081FB9E59DFA0973E0D 1NRW-SPD-LANDTAGSFRAKTION
1,666,227,377 *AF58CE84EA3DB4F7A6A4FEA152AD77D853869BFA 6ETSATROP
1,666,227,378 *AF575B04DBC5ED3AE372B4652FE1DEEEF14024D9 1 PERINN
1,666,227,379 *AF5EB62F38EFE3E21F45AF9BFFE3BBDD2C6BBE16 6iloveleslie5
1,666,227,380 *AF550AE0EF9944045A9E2173DF2A234673E4A3C5 6-kuivureita
1,666,227,381 *AF5937A7463B0D87E116865DB3E5E2D1DDE75E5D 1.sicherungszahlung
1,666,227,382 *AF5027324966CD5D39E9A74614B64AC7A1D9BABC 1SKANNATUSTA
1,666,227,383 *AF59656AEB26E218490E556C00BABF13E56B51D1 1standortgegner
1,666,227,384 *AF53EE111A6FCEE255E7244095863EC6149D1C9A 6POPEYECAROLINE
1,666,227,385 *AF5B45C1772052FF59EEB86760761B0AFE48A0AC 1.UGRATILMAMDAN
1,666,227,386 *AF53B95A25EEDD41A5E250E8FDD7BAB02F606DD7 6SCORRIATE
1,666,227,387 *AF591C5ACE4D78D4C7D48D876C34AF55A1BF92F4 6SEITALUDOM
1,666,227,388 *AF52165BA7A8A2092B97CA6337BDCAE1FF3B05A8 1 YKSIL
1,666,227,389 *AF55DC2910FA27596EE2E44B8991005809BDA0FB 2048614 dastreffensollimoktoberinkolumbienstattfinden.
1,666,227,390 *AF5E85822D8DFB3CD7CBD0B1F09D9E72C5E6674B 71010 mockler-and-glass-declined-to-give-an-estimated-price-
1,666,227,391 *AF5D6B37F3797BC25EC120AF6DA78C63046C153F 71614119-A23A-4720-891A-F28457452BC1
1,666,227,392 *AF534CC3C6A3348996E90B0EFDD18B4DE8C7ECFA 7555510A
1,666,227,393 *AF54BD8D6EEA0C7151AD4FB193AAE463EC1F1C9C 243442 pelastusliiviesite-flytv
1,666,227,394 *AF58A851E190DDD61D3DA4C9C2284CDF9844BAF4 7DBOMILLE
1,666,227,395 *AF57C09100DFF848922278CDE79EF7567269789E 2787612 SE SIS
1,666,227,396 *AF55A5969ED06937A742EA8B51B2E88BEF906C63 2835146 KOUKENYHTEYTEENPERUSTETAANHUUMEKOULUTUSTY
1,666,227,397 *AF5732846A1C983782D0F73E023E0C58C29F4FA2 7ermin010gie5
1,666,227,398 *AF5A2BA4F4F67FED61937FCBF2C0086290A89CF0 7GEPINGEL
1,666,227,399 *AF5CFFA84EEF7A4BEA3308D90EE5B5C5771959EC 2arkiel
1,666,227,400 *AF5EC0DA8AA1D74AFB14B98646280792E4732DE5 2-HAFEZ
1,666,227,401 *AF5D2B7B32F7329D0447ED7BA93DD13FE2C836BF 2ILOVEMELODY5
1,666,227,402 *AF518426028FC8718CBA783DAF3265988CFB446F 2NAVLHTE
1,666,227,403 *AF55F4552F4E26714288719373F8BCD31510E8AC 7PYROGLUTAMIC
1,666,227,404 *AF5BD7CF0765869E8759E08D43370921ED5BFB06 7VALLANPITAEJAELLAEKI
1,666,227,405 *AF5BA5C7166FCC205A701D744558D75D9CAFCF66 (^_~).~.`[email protected]
1,666,227,406 *AF518978AC9C2564EB8513F220B70A9E4408CE18 3.BEYER'S
1,666,227,407 *AF5311F4DAF3E699ED9473939824394A7A9B7A04 3BREVLIG
1,666,227,408 *AF5394C87A2DB28ECB80078DFB5472F594361258 3D.*.*.*.~0~o
1,666,227,409 *AF55DD027EDC58FEE8159182D42A136D838A8D1E 3====d * * )o(
1,666,227,410 *AF568FD2657640BA405AE0B4D472869559D16F11 873242 keskisuomijap
1,666,227,411 *AF56A5780A0BD8977922261E3E970944874FCB40 3ELOTSIFAR
1,666,227,412 *AF5A7AD5A5D7FDC46FCD20E837B99AF2F8E7B70A 87-AUSDRUECKLICHEN
1,666,227,413 *AF595EC4DAA832C457A20D8200BDE89F19F51F75 8#B.`.>-B0
1,666,227,414 *AF58C47F5D32DA30A17A67F5766FE47B12498091 3.odlingsmee
1,666,227,415 *AF58217BC96537F9BA9EFA9C595C022ADCE184FA 3srktherapiezentrum
1,666,227,416 *AF596BA80B58636B226B870BE5EF5953E4F622A0 8FRGEFORBINDELSE
1,666,227,417 *AF50FB7FAE1FC41F42DBC7C3C6C2569143ACACE4 @#$%^&*420
1,666,227,418 *AF5C0698BC76583A2A3963DFDE4B3AE5BE90131A 8IAMJEFFREY4
1,666,227,419 *AF58B076247A60C22C9F3B52173B9E0F21743916 8IJIASIEK
1,666,227,420 *AF5C4057ACA12271DEDB069D39A4CB51D820E32C 478MELODY
1,666,227,421 *AF5AFD026791A7A248EF90D794187F1D903F0FF5 8KOTTARIDIS
1,666,227,422 *AF597F16983333AB3B7FDA238067C2F1BFCA939A 495498 BJT KUCUK SINYAL ANALIZI .
1,666,227,423 *AF5BB7227449C63BFBD2115C15E93483F307614A 4alleate
1,666,227,424 *AF573C34F571E2F84243714926D727ABA492D2D0 4ESTECBSW
1,666,227,425 *AF5BBF7BE0B2956C1054DFD910E93A38A98BF414 4HNL
1,666,227,426 *AF588D3CA55364FE4AC1B19F3753EB5F8E4CB760 4ILOVEDATABASE3
1,666,227,427 *AF5DC26A1770B61A0E19DFD384DE25FE4FA549EE 4KIMBERLYZAPATA
1,666,227,428 *AF530039F02E1DA4490B924E66ACC8BBD1F1C9C3 4KYZARTOO
1,666,227,429 *AF50217B60F97858F8EDF171DDFF6841B793595C 8##p-~-~Splat
1,666,227,430 *AF56BC28FC1292BE6EDAC5FCFF790C7DFAC809A2 8READYASSEMBLEATTAIN
1,666,227,431 *AF548466ED98B3A4033DE3F8B4468B473A892A9E 8SAWTOOTHSBSW
1,666,227,432 *AF5847CE3062059E882A9C461FFF1C2008284B60 8SHARONSTEPH
1,666,227,433 *AF5172C8FC36BE318A89FB63B86DAE3113BE5D6E 4-NIMENKANTAJIA
1,666,227,434 *AF5FF3A468DE9A8F217A15DFFA98249175BC73A5 8stroomgebied
1,666,227,435 *AF5126C847BD8AD8AB2BAE225FA5461D6426FF7A 4rauhanturvaajiksi
1,666,227,436 *AF52574E8857BC2544C0C6D457430E0D431FBDC3 4 SAMANPITUISEN
1,666,227,437 *AF523F29D14C243502FA50740EF5C9908C2B4FE8 4SSORREK
1,666,227,438 *AF57C6CADCA0A48993BD2310BB7E31F3E9B76E98 4TUNNUSTAMISTA
1,666,227,439 *AF554D097A6F4EB17681A0382C315486A6227740 51FF
1,666,227,440 *AF54F47D95FC07C2FDC806AAC812199EDDBF7F74 9ELWOODPASS
1,666,227,441 *AF5D52BC1F4D8F94E4BD7B746CAEB3280775A532 5AGRIPPAIENTS
1,666,227,442 *AF5B09C4C1E9A2869F012DBB8ACE46809DEBC362 5BSWSZORBSW
1,666,227,443 *AF5E99DFA8A7853D5F4F37EE80DBFA21D7A139E2 9PENTIUMARIANE
1,666,227,444 *AF5DBF066A89BF58FEF7575E82645593E8B4EB6E 9PIAZINS
1,666,227,445 *AF5CA177DB49DBDA979C7741064C0DB0355F97F8 5iamsnake
1,666,227,446 *AF5A5210DA1FFFD876D606012E980C07AC63F137 9SYMBOLLOONEY
1,666,227,447 *AF5343DCF9D92DE21116A4FBFB637C7D1060092A 9TYRRANYE
1,666,227,448 *AF58DEB58B0C4878EB56263BEE92D15DBB08C8F9 9VILLASANTE
1,666,227,449 *AF5C346158A6AE052445F85B81846DD0259C7594 A0$BN
1,666,227,450 *AF508E348272AC69C8817BE16DF0745746B9022D 5thebrewster4
1,666,227,451 *AF5169EBF5C0DFAE9E39F982708C19AD8BE34A6F A&1T
1,666,227,452 *AF5A756FF6AB8E4088414C617F395B33EE9072FA A3o5
1,666,227,453 *AF5882FC077218135A95BAEF6741A082F645954D 6BSWCITICARD
1,666,227,454 *AF5DF6A48D5677F8CE9C4339E3314FAAABCAAF36 a7lpj
1,666,227,455 *AF581AD34EFC82406FD230C1AB782EDAAFAF8505 aa5>w
1,666,227,456 *AF5192ACF7BA4C1BA64A35DA62C13C14CA67D50C AARON94
1,666,227,457 *AF5BDB84599904DB597834425DCEDBBBB1824BA0 AAR$T
1,666,227,458 *AF599D64A9184B2C1887CB5E12D087A3C8B58762 6.STADTTEILINITIATIVEN
1,666,227,459 *AF52976D873C05965EEC3369EFF37791D7220E5B ABBY287
1,666,227,460 *AF515894FA2AB4369A606D818A26D481A660478E abdulhomewood
1,666,227,461 *AF55D18B8FCC240B901044908D46290C82FEF8CC [email protected]
1,666,227,462 *AF5C69176B888E32D016954099E7B5C429E0316F abortion
1,666,227,463 *AF558E46E552A9AC08DC4111E04B40824D7D5B7F 7B9E19C3
1,666,227,464 *AF58A71B926B4052B07EEFE5FFEEC6733BB7558F a:c+9
1,666,227,465 *AF58C6AECF956500F39BB084B19A13F0B9D67791 7BSWSFVPMBSW
1,666,227,466 *AF545965A01EF3434C682D00779A7D573BF985B0 ACCOSTANT9
1,666,227,467 *AF5F14FFC4B8C19539704C72CBDD1E6498E3E35D 7CINOSSNART
1,666,227,468 *AF53ABA1AD510E4CDF42CB826F34D5F4D92A6C30 7CONTAVAS
1,666,227,469 *AF569177303955C9289A4C6FD59771AAA3E8F553 ACIDNESS7
1,666,227,470 *AF529162F1BCDDD9224D415CAEF5A4657E69A301 ACIERSESED
1,666,227,471 *AF545C0C47B0242E04AE0EB6588B0795C696D4C0 Ac_W
1,666,227,472 *AF5145E1B261D79D02C804B2C1595FEDD34AC7CB 7INTOHIMOISEMPI
1,666,227,473 *AF504F96F95C5B52555393B5166E5BB71340301A ADINABLONDA_SWEETY
1,666,227,474 *AF57F54BC778206AE5D17936120D5F8704CA004F ADR_
1,666,227,475 *AF57999B7A5B383EE361279307B553661B1B900C Af0r3t01
1,666,227,476 *AF572C7A251F5B444F2C6BE749332DCB91146A6E 7TUCKERJENIFER
1,666,227,477 *AF5DAAB088070D3FD968419D3B480C76AE498C38 affecter's
1,666,227,478 *AF5883C08309DB178BFC78721751D056F0FA6994 7VARKAUDE
1,666,227,479 *AF590673CD1DA82AEBBF3D1B491C6AABF826DEFD 800WILLSEL
1,666,227,480 *AF5B46C6B979CA154388A31C9737910876C9E9DB [email protected]
1,666,227,481 *AF5E7ADC6AA21B3F0EAAB1C4884CEED48A51AE24 A/g
1,666,227,482 *AF59ED86E2FE8C60EC585BFA138A293EAB640A7A 893yazmin
1,666,227,483 *AF59784B7E72A1562BE540AAD7C3767A8C02D04D ah1og
1,666,227,484 *AF5AD371D0B7B28B9FAC74300F4BF83DCB74A20F A,J4B
1,666,227,485 *AF5B5D70BB5FDFD9794366E9B0FEBF1E890D3E98 8>`~.`~.)o(
1,666,227,486 *AF5CB9CF987F39D3C7062BF4488A8F33ADF4E741 akkto
1,666,227,487 *AF552D20F4E5BF329163822A89059AE8C7E4C83F albertdegado
1,666,227,488 *AF53B1066E6F9E17C9AB1659CF26B5096950F973 ALBERTDIEZ
1,666,227,489 *AF53A5DAC587FA0831FA417A2691CC05A0B6A69B ALBERTOKNEBEL
1,666,227,490 *AF53569864CFD4830A672BFAB224D15C634D5A7B 8SVOLTANOS
1,666,227,491 *AF5DE48F3AF4D43F727C76F423B90369924DCD76 8TAPAAMI
1,666,227,492 *AF54F9E8DE9251F58F4461ECFD9F3D3EA7D8EFF5 ALDOEILBERT
1,666,227,493 *AF512E856FE94E6C74CC19A7C9EE7642B81872EA 8UNEXTRICABLE
1,666,227,494 *AF54A9D107711025C1AD4768AB8984646AF2C730 ALLF
1,666,227,495 *AF5FF556AB563F12D84E4441F881E3748B20BF36 9FMLATINA
1,666,227,496 *AF54ED1A0980C42DBD8F4285294F9C9E2B8CF9B3 ALU
1,666,227,497 *AF53C619FF765363336F0CA945C8CE6E38A07571 AM7,
1,666,227,498 *AF5AA3E03FD97830F251E8B052FAAD700D499725 Am$P
1,666,227,499 *AF5665DD7061088E4C9EC00C440BCB0DF0E51B40 AMYOTONIA6
1,666,227,500 *AF5ADCEA2758E23EA7F26CC13EE823DA956D70E9 AND-FAN-OUR-PEOPLE-COLD-NORWAY-HIMSELF,
1,666,227,501 *AF5C99323587BDC6107ED7A19CCC8315D2397402 AND.HER.MOTHER.CAME.TOO
1,666,227,502 *AF514474F3EFF230EB3D99059D6F819B488F34DF ANDREMURCIA
1,666,227,503 *AF55E89D94D30682E15D67FBB756542D8116E052 a=ngh
1,666,227,504 *AF5BCDDD34E2C9A5ACF3B3DC7AE97609DE7AD9FE a45e%
1,666,227,505 *AF5A40CAEFE0EB972F51313F66D32672D88DBE42 aabf``
1,666,227,506 *AF5AAA572F5DAA6A155EE61AD39A2E03ECF234DA aabw5
1,666,227,507 *AF51A7142F3A8A6C91F3DEBBAE37528604446F6B [email protected]
1,666,227,508 *AF5CA1D127E584F115FD88C9B111231708773D77 ARHB
1,666,227,509 *AF575537A82483530BCFE8634D13A14C97A821D3 AB%9R
1,666,227,510 *AF50E02CA205408B394DBDF9727003A97A0127D1 ARTOFMADNESSWEBPGS
1,666,227,511 *AF57F7276C567613EFE68533D2DDE683675FAFA4 ABRAUM
1,666,227,512 *AF56DB73237484F8BD73234939059BA897E1B389 a,-tp
1,666,227,513 *AF5E6EA549C5C869B8C1838D075C6387AE4462E8 ACTORSSASANJAN
1,666,227,514 *AF58F6EF1C98D955E30DA75B27ACF350BCC1E428 AUFFING8
1,666,227,515 *AF5D399F50ADE927CAF5D88D9C6EB026FB977D48 ad!ca
1,666,227,516 *AF534239EC4A7161572D8240C0FEBB4A88B2C77D ADEEZ
1,666,227,517 *AF54CE749A30DB8FF2EF0B547060F2A0E50278F1 AUU3P
1,666,227,518 *AF5F214FBAD7D19299BFD39EF6A38C49F2A693E4 a"=zj
1,666,227,519 *AF5795538B69A4831F3376715915C6077B56BB00 b####)***~0~osplat
1,666,227,520 *AF51C03E626453A84BFFCC16F75511656219954B AKATZUKI4
1,666,227,521 *AF5A2F3B1309A1A64D2EF2EEF00FC5D9D7CCFFBA [email protected]
1,666,227,522 *AF536FCF180BF0E80322985D9C124ED4FC49B693 ALDEN.DELAFUENTE
1,666,227,523 *AF5BF6BD62799A4D4F8DC48E4117D6EC31EAC718 BAKUV
1,666,227,524 *AF5504B1EAC9335962FE1E4A1AAFBBCEE9843828 BARCAC
1,666,227,525 *AF59D0063BEA429A93C11615D7E5C91D6DA419CC BARNEY.OPHER
1,666,227,526 *AF53B005EAF8C73C36AEDC038120718CA5A3C6CF BARNEYPATOCKA
1,666,227,527 *AF5F60BC1393F55526A65956430A9444C7946977 BARVIRSKEM
1,666,227,528 *AF57BAE84D8A57D21B9FDD78A915379657BEC849 alnafees
1,666,227,529 *AF5927C1BD2BADD7A0D58A3F12F22C6784DA43EF BB%NT
1,666,227,530 *AF5305193C1F84249A8174066D23BB6E3CD727BE a,#;m
1,666,227,531 *AF521E29A7DE445027D26BD8024898A9330BDA27 amadohaeuser
1,666,227,532 *AF5544FF897DAC3920797D9C28338840BA94F162 AMANDA CRITCHFIELD
1,666,227,533 *AF5DF8C412A36E94C99D094267F8E248860BF219 ameer.webb
1,666,227,534 *AF5CB68AE890C7E83653F87D355F6DC18D8B0B08 AM-I-BAD-ENOUGH
1,666,227,535 *AF5FD84E9683A39C076ECA4AF4615740F08A9DB4 amosstjulian
1,666,227,536 *AF50B13D9567158D0F80306764B231F2E948CD7F AMQDR
1,666,227,537 *AF52A21EF7DB967524A211CE4183F1051681020A beio;
1,666,227,538 *AF53520FD993FA9A2176CA0041EBA5405BB82E57 ANDREBENHAIM
1,666,227,539 *AF53D96DE6D4DD6833AC771AAD717C77A58299E1 ANDREHT6
1,666,227,540 *AF53CA5FFC0A7EF641829843E5A2083C8D5BB504 ANDRES.MICHNIAK
1,666,227,541 *AF564A9C729133A2A73CFA8490EAD6EDCD75BC47 BEN.STIBBINS
1,666,227,542 *AF50AD7EDD95332BB009AFDBC29837847ABBC066 benwestbeech
1,666,227,543 *AF50D60392F648131F06245FD717F232066B08A7 anibalmainello
1,666,227,544 *AF5DB8A183C283B2FC32F5727BACA58D4AB0244B anjing-menyalak-di-ekor-gajah'-&lt;ref-name=pm/&gt;
1,666,227,545 *AF50018C277C1FA3F8AAC0EEF111168B57B36289 [email protected]
1,666,227,546 *AF5DF7A841B898A09D6E254410A127F0430F86DF bev(b
1,666,227,547 *AF59E38F88411613C4C3C8C53FE74E7107EC538A ann.klassen
1,666,227,548 *AF584D98709D34F7F0B24F43F830B12874AA1737 an(s
1,666,227,549 *AF5A6F77D376C5537490036385A44BF35FE76F37 ANTON.LARRISON
1,666,227,550 *AF5BA22D4BD228657EB17E0B5ADBC52ED34540DD antonzazozdor
1,666,227,551 *AF547626242CC36709142F70AFAA3A586EC7E4C5 A%O_E
1,666,227,552 *AF5CCC41F11974B10BBBE7452DA9B2FDC3D8ADBE aopn
1,666,227,553 *AF5437605E78881AAF642A9F20C8C55467556ACD BIGRAYSBBED
1,666,227,554 *AF5F06E4C824216A8EAA5E10C1B4BFFF181CBF95 APSLH
1,666,227,555 *AF5694C9F0CCED631E0E6F2C63473D705B3538A4 ARON.BORGELLA
1,666,227,556 *AF5D39C8A502FAFE7FE8052CD4671AF9795F0A80 arronlisenbee
1,666,227,557 *AF52DF40A1A841D17A91AC81AD455772A6689366 ARTHUR.BONGIORNO
1,666,227,558 *AF5E5015EAB142AB3207EB5207907D9947B18294 ASQ=
1,666,227,559 *AF57BD15FA4A9C8A029C362C924880680D947268 ATHERBY0
1,666,227,560 *AF598E2E999C6E09F318649F76724A4305042662 b_onh
1,666,227,561 *AF5677F4ADAB4D82D0B5E00C2E52465C75F7E4ED [email protected]
1,666,227,562 *AF53596CDF2604428F8AB679D99DF379AEAC1614 BOSTONLINDA
1,666,227,563 *AF565A352C79A507570C7C0248C5255A9071E405 AUGUSTVIKINGS
1,666,227,564 *AF50766FDED788D97934ECD322F356B24D0154F4 AWNR)
1,666,227,565 *AF5BEEDB3AB91598101C0A6B995D0D8116FD4E11 axf?8
1,666,227,566 *AF5B7CE0CDF1FD110B9D1126E5B7FC66DED53DD1 ayeu
1,666,227,567 *AF549F9D6D95F9E217219ECEF67AEC6E624A95E0 b1hg5
1,666,227,568 *AF5BCD171FC199F176DF729E5516136AD0AD41B3 BRUSCAT
1,666,227,569 *AF5C4C654BFB604E3E6E5D00B4E34362FC32477D bswmontoyobsw
1,666,227,570 *AF564B85A5A8C2D3BA8E642E003043F908FC729B b9uer
1,666,227,571 *AF5E94A5F0469323C95F05A257158C873344B61F B"ad