List database


# MySQL hash MySQL password
143,620,001 *0DCD4CDD6DF025F402A4D1FD85C06B5BB77E9084 IAMANNE88
143,620,002 *0DCBC37200D3E3F698BD1B3E7A1B8107AB7C2F5C coifferons
143,620,003 *0DC9C5DAE7167CC48CD4E7315313C6508E79F5D4 COLESTATHAM
143,620,004 *0DC3D8752D6301DF41E3DFF5BA4F5665C1FDE324 ibrahimelzein
143,620,005 *0DCF254AC897675AAC0F57152790E11AFBDC123F ICAZBALETA
143,620,006 *0DC5C7827B5119460BBCE98BCFE51BC8640DDEE1 ICELEY
143,620,007 *0DC6C004AEC3E53B7A2DD7991EC59C0025D153D2 idiotdean0
143,620,008 *0DC33862A94678473D2D9B367BCFF063719E949B COME-TOTHE-BRIDGE
143,620,009 *0DC596A1C859338C1760C21508C7A903B40DCFBE comfortable.in.your.arms
143,620,010 *0DC1DF200644706DD36910A447C5B105C6509C93 CONFRONTINO
143,620,011 *0DCEBB383BEFC297FDBD778C18D45B1BFC621E9B IIXIXIIIXX
143,620,012 *0DC4BD55B225892BB5E4CADFEB7C9E0B605FCE6C IKE.MCDERMITT
143,620,013 *0DC02D077467E315CDBB41C743F86FF7BA769DC8 IKPKWAYJS
143,620,014 *0DC48222B65B41FC9A826CE00681B252CBB887C2 ikplukeenster
143,620,015 *0DC13A71323519630C0C472D34DD9B4D13D2FB84 CONSPUA6
143,620,016 *0DC40BD00946D263534490EA6C1C5B6FFB897CE8 ILCJ123
143,620,017 *0DC0F9ADBBE09FD54B5E5DAC13C4FD1D88B93013 ilgennoned
143,620,018 *0DC56649CA1036F1819BBAE1D3261AE7C8E66CC1 CONVENCION.DE.MONTEVIDEO
143,620,019 *0DC7958D129B4F239E48693E220709BD803D4B7D CORPRIEKER
143,620,020 *0DC61FAE0739F83EC17561E3663AAF2B0A2496D1 corresti8
143,620,021 *0DCCD419E8E831EE2DAE405FA647AA490B21B577 CORYBOLDUC
143,620,022 *0DC04DD9C6064FD632030C6EFDE6F1F6C0ECFE04 coryburlock
143,620,023 *0DCAAFF90C988893F119F321929B9AF99B247F5E courtney.chmura
143,620,024 *0DCB18461193DF9367FA3951CFAD60B695ED19D1 [email protected]
143,620,025 *0DCD0E4DA15BA5383AE48B5E92B74744A156DF36 cp0wr
143,620,026 *0DCF4A5EBE11D17A4A63F533914C02063B70D8C5 cp0xs
143,620,027 *0DC2D952DE6A935FC3DDDFD13F31DE552EBEA1DF c%p?8
143,620,028 *0DC2B450FA565D889C8146131463FCAC835693A4 imagemo-84svg
143,620,029 *0DC14DDCC7F5CF63790231E0643679B879E83CD3 IMAGETROGBR
143,620,030 *0DC202537BC924A8090D8AE3D9DEA759D3FFB1D5 CQ8EK
143,620,031 *0DC5E2F718CA86C9DA892FA0EDA0244879940E37 imiquilda
143,620,032 *0DC9DB5868A3626E0B87A3ABF385090063B48071 CRA41G
143,620,033 *0DC4ABBB503FD81F27F5DD7B35815C380A61F184 [email protected]@bi1ity
143,620,034 *0DC441364C477D4B774EA55F03010828DF5990F5 [email protected]
143,620,035 *0DC449B58911552608A7FBF4F36BFAE18182B7F5 indhlal.s.amrith
143,620,036 *0DC5AAEF68C6937F57FC1D59531C8D5DC392D4C1 [email protected]
143,620,037 *0DC8F4C30E5B369DB41DEDAC3776EB7122E88114 C/SNM
143,620,038 *0DCC9404A2B973B6639B807035B7DE87A089EF54 INSERTDISCTWO
143,620,039 *0DC430838C37F7DB8B8C19DDC231F44347E5D2FF IntheLastDaysoftheGoldenMotor
143,620,040 *0DCDFE49515364C0C5F330F75370CFDA7C7BD2D3 intotheblue(markdeclivelowemix)
143,620,041 *0DC93B13E23E63895BE5ED9E481302CE3698B777 cttmaee105
143,620,042 *0DCF7AB9B326E29DBAE83BAB3A785C4A1EE504EE cu3%u
143,620,043 *0DCB16FA3671AC69535727BCCD527F4C706A362C CUD,2
143,620,044 *0DC2E95E7AF262E41C0D2DE76A8E2E690C2C8C97 [email protected]
143,620,045 *0DCC298532916F30509C9C0C87CE0C98DCD6FF77 c/uks
143,620,046 *0DC23F187C047C97369EC53955D25C7ECD5DB072 irabaudler
143,620,047 *0DC3BFCE2FF30494DD0CB107C6B736CA30EAA07E iranian-suite-for-orchestra-in-d-minor,-op.-52:-i.-homayoon
143,620,048 *0DC894DD8BD7ED1AB7EBFD990B490120FE225AF7 [email protected]
143,620,049 *0DC3140079E65FA7F41CCB66FE5A745A480E3036 IRONIC!
143,620,050 *0DC370E79BF80FB4FA95F2521392CD530C79230F IRONISK5
143,620,051 *0DC0FFE7C211ECC1545BF66A81D6E3CBC0F1CAD1 IRVIN.CLOONAN
143,620,052 *0DCCD968A2A960E193B162C244060CE06EF23A88 cv"4s
143,620,053 *0DC87097297CF6E19CDF1555B1A8D1512E944F22 iserabel4
143,620,054 *0DC917A25083CCA5A41DD114EC6DB8543E28A3D7 ishbitza
143,620,055 *0DC5ED4DF5DDA2593FCF68A09B0B31ED9248DA57 ISIAH.PETER
143,620,056 *0DC124F254E0BEE21B446B4EF25FE967783148FE cwistoe-poo
143,620,057 *0DCC48BF516CECFE08FA00F91642FE265FF81C66 cwuao
143,620,058 *0DC67204AF892FDEA183631539D8BA476CD43EAA [email protected]
143,620,059 *0DC619B5219C96392BD8844EDC199A0786A3091C [email protected]
143,620,060 *0DC8672BC67AD705B27652807BD9D653E0F825BD cyrus40
143,620,061 *0DC362667347CF58FE9C0FB0EB0D15DC758ED907 CYRUSNIEDZWIEDZ
143,620,062 *0DC2974EEAD1562E94761206B779C2A952A37930 ITSCAMPITELLA
143,620,063 *0DCCBFDF9D7A3A0E52B606A9853A04E54A1E9408 CZ=X
143,620,064 *0DCE3CB1D559A636C27F33C14909DEAAD011609F d0#-0
143,620,065 *0DC8BD823682CB75D06A1BE64795C70030508208 ivea
143,620,066 *0DC5B79B8C26202657EE496FA4237E1E3468DE14 d/1ci
143,620,067 *0DC7BDF4823F10BCD2C0B8D56391782B519B1E68 d1zi
143,620,068 *0DC7A31B900F77477D22C68F91BEE6BB9F187CDF d27kf
143,620,069 *0DCBEF8364F3166373502588A0C1C7D052D9313D D3&PH
143,620,070 *0DC6087BD9C2EF3AFA12C0D9B56B2968E561E1D3 jackadg2
143,620,071 *0DC853E9EDB6A10F86DC4A94994E8A7969B73784 JACKIESTONEMAN
143,620,072 *0DC6FBE8F81FBA507CA097D33AFFCBC6148CDC95 D5W2C
143,620,073 *0DCA0D910B8A1DC4BD3FA50F1AE4F1A85089F953 JAEBIAGINI
143,620,074 *0DCB551923F03EACC78550B9ABE045AD7CCDDF71 d?!7g
143,620,075 *0DCB98067E2F21D3FC82F742C30D45F900ACBBC4 d9g7u
143,620,076 *0DC3CA35E1C8107213CA8D0A405A80603DC649BB da!6b
143,620,077 *0DCFAE9F738048A9E31AD2A7AD95E99FB2656823 JAME.WISHUM
143,620,078 *0DC4236D2FF1AEB2EE633E1AD757E655E68545C0 daikato8
143,620,079 *0DC98C5C103335C268BB1D3060EFDE61BD15EAD5 Da-Makani
143,620,080 *0DC8B347E3A1641300A3BFFFB98A3F11AD51C194 DAMIEN.KOMAN
143,620,081 *0DC0DBEF681667407BE4F7B0B8880E5A05F9C657 JANZIENTARA
143,620,082 *0DC13594EA5FCA79E1E55B7A991F7753E6CC7865 [email protected]
143,620,083 *0DC25D8823B8141D1BD945D33D8DA6B82EEB4745 danaciskowski
143,620,084 *0DC9EDF5ADCE250B22E2ADF15FED76AB8A6762C0 jarredteigen
143,620,085 *0DCA06B6F7BA33806AD3EE678CAB149BD6D91BCA danejemison
143,620,086 *0DCBAF3C25D1F6DD7150B6193481AFA16E1DA965 JARZĘBINÓWKĄ
143,620,087 *0DCCDDEF901B24465B534677D7408EA51545143A DANIALTAKAHASHI
143,620,088 *0DC48393FE08B0C33BD13392CA28574F7D4E0305 danieldople
143,620,089 *0DC88769EDF3D752F1895B1A4E60B5E5131CE5B0 DANIEL.GIRRESSER
143,620,090 *0DC27DCAF473E40EC1422A2BC1EEC090303DE270 JASPERGREENAWAY
143,620,091 *0DC570A3B15838A603F2B20FBC2AA380203AE3CF jblogg
143,620,092 *0DC01E3CA50448351E678B621F9C1E8B56F32586 DA/PI
143,620,093 *0DCAD02BEBDACE45CDF2159BC1A993ADDBC6E02B jckrus
143,620,094 *0DC326434A4E600339F9B2FE8510FBB79F788BCF JCMELIK
143,620,095 *0DCFAB012A2433A34F15228341ADAA8DB7B58DAA JEDLEBARRON
143,620,096 *0DCA4430C40C64C1F468C2D4A4E96C18059CC85C JENNIFER.RAHN
143,620,097 *0DC749CC4E214730935E9AD186324AD34B8641A9 DARYLCASSELLA
143,620,098 *0DC0A6A62A619BE9BCE10D63831503B8B1DC5A2A DAVE_WILSON_RADIO_PE
143,620,099 *0DC0FDE2B2864875CEA88325EA504E492A661B84 JESSICACARTIN
143,620,100 *0DC7E66B57F8B44E055B5E7EBA0540A84318868E JESSICA TOWNE
143,620,101 *0DCC524F3FFEB5E4FC6C0C5871FFF4A3CB554496 dbi"a
143,620,102 *0DCB794A514543842A96A9005D819FD06E021074 DBVNL
143,620,103 *0DCF0F8EA043862216CDFCF7BF9FF80EFFF92AEB JHMBUTT.COLTD
143,620,104 *0DC947BFB151EE773FA5A486AA5811B72DB7B1DC [email protected]
143,620,105 *0DC86E7DD7D5479311930C9C1BC7ECE2C1814489 DCC-L
143,620,106 *0DCDED3485B91BE4955C7E55830CD06F971C08BC DC_L
143,620,107 *0DCA0FD345D01DDE06CC77DC22EE28169A5AD53B d-d5_
143,620,108 *0DCC9D4574289FBFD4B136F1E1ACCACCF387EEF7 dds1b
143,620,109 *0DC650A5F196D79A543030CB6CE5312C04C7BCFB DEAMAE
143,620,110 *0DCCCAC2FECFFBDA9C962CE557E8D702C68EEA86 DEANGELOMAYHEW
143,620,111 *0DC8952FD3CFA10CA617EDE2AB9161FAAD29270E JIMCOPLEY
143,620,112 *0DC08F4BF9F154EFFE845CC633E6120C4CD9B40A [email protected]
143,620,113 *0DCFF310D85E9DEFF6608F15A7EADF8B2B71E300 DEC53.191972-2.89402
143,620,114 *0DC0DDC4B539BA2ED53865E26666043F52A5BB07 d-e!d
143,620,115 *0DC420160C29B1DA391B82EA14B5328B4555A510 [email protected]!n9
143,620,116 *0DCEB7D2265229E3FDF5F100205C05FD5BE35301 john-bellette
143,620,117 *0DC20AC17D645F8250C6F3FF564CBF62F60B373F demydemy0
143,620,118 *0DC76FAA377ED5D8FC7C4147C290B467BAA77E83 JONATHAN.OTT
143,620,119 *0DCA27ACA209F15C5A46E0CE1F4516F199C66423 JONESSONTAG
143,620,120 *0DC357B14B7EDED0852566E1B3D51D36146AFD08 jonnalyn-salvador
143,620,121 *0DCEED763DE7EE29F42986C2FE0BA2A538CF211C DEREK.KATNIK
143,620,122 *0DCADFB065B0FB12E695C4F867763445EF54D120 DERESSE0
143,620,123 *0DC00EC7079DB82EB3842367C4A3381AED572812 DERICK.RUITER
143,620,124 *0DC58D230E47F32F5A028E02E808F6B79DB5752E DESMOND.STURDIVANT
143,620,125 *0DCBAD1B5CC42945486BF22F9BE8390B7AEF44B5 DESPREGOU
143,620,126 *0DCB37E4CFB70B42F29C302117533D892DE840D6 deurccanon
143,620,127 *0DC38F45868969C1A2A6983F108DEFE087843A06 DE,W$
143,620,128 *0DCDD73EFE6FB1AF5693F6611518FCE7C10C5FB8 DF25O
143,620,129 *0DCC220AF45D628CF23C926C933B200BC928FF63 DFA$
143,620,130 *0DC6F7B2C5E21AB1EE5CA505270B0025B0816704 [email protected],
143,620,131 *0DCC9606467ACC517460E5F81637DFB641BFE375 JUCGJAE7JOJCBQ
143,620,132 *0DC18FF9792D0230176A787BD9C2B8E828E66AFE dg6n=
143,620,133 *0DCEAD49497843D1C66612C6117EC22ACD2B05EB DG7XK
143,620,134 *0DC12CD3D279AB1E8AAA5BE5F02CAF68803F0709 JUSTCHALK
143,620,135 *0DCAA42DD0941E4877E0C2A623C723A4F97ABD30 JUSTIN.DEPASQUALE
143,620,136 *0DC3CDDDE2FB4F6E64D5B6DABC84DFCDD0EF39BB d!h:f
143,620,137 *0DCBF78302FAA64102BAE9FFE7FD2AE6F4E6BD5B d&hi
143,620,138 *0DCB70549E0A4D45D0579E0B0C5C8CE88E00A9EE K3YS34TRUL3
143,620,139 *0DCECFD5562EA0FF3081F6748548EE5A9DFB686E d=i4s
143,620,140 *0DC812D7C30BADE979897C08A49B9E4BFFBDB835 diade3
143,620,141 *0DC4A7CF972A96BB8097B2E5D6D2AA7B512B2CCF diane-mercy
143,620,142 *0DC6532AC1A181B42903AC1E551990D1894A60EB DIE.E
143,620,143 *0DCC9DEA960B476E076E21B188302D44F217AFC6 [email protected]
143,620,144 *0DCD91C13722C8373CA0AECAC9FEA1F9938538F5 diffameraient8
143,620,145 *0DC3EB65C3A18ABEE96A24BDEE98D08CFFFE3E73 din.don.dan.(ec.version)
143,620,146 *0DC28547735528FFCF38F4DB2330460054A80092 [email protected]
143,620,147 *0DCDBF6A819CAF673B6637FC9D8EF59C8C237598 kassenbeitra"gen
143,620,148 *0DC49265158B5669CC8D1B8D162C1F0386EFBBE3 KEENAN.ACOSTA
143,620,149 *0DCBAA49D74FF87394316A9839B9476E7CC9F7E6 keeptransferringmearound,but
143,620,150 *0DC6B429DCCDB1DFC3EB62D59CCA5CC5C36D6043 kelly.james.robinson
143,620,151 *0DC3EC6D48F8E375F31B3249DC54AC748000137A KERRYZULLINGER
143,620,152 *0DC63E720EB5B2D2811B3897267BC95E9E02B7BB DISBELIEVERS7
143,620,153 *0DC596560417A5C751A31031DBB02FAFA2F70008 KILKASET-SLOW-PRAWDY-(I-CO-MUSIAL?)
143,620,154 *0DCAAAC1CBD9AC869D38EB9501771B754CA91E0C disconight
143,620,155 *0DC007894BD23AC813451EEAB6685E401FE3888B DISLUI
143,620,156 *0DCBF8F35A01F5BFEBCEC7378CC99267C365ED5A KIM NICOLE NGUYEN
143,620,157 *0DC403117FB6DA125BBE24567A1A95C49B920E29 kinraysuyu
143,620,158 *0DC91EFE265F3F252C9E62B750C307035C23F6C3 kipsequin
143,620,159 *0DCFABE5F6B3BB079AF53A9FED22075503AD2B4B KIRK.RANN
143,620,160 *0DC7232E4C60C54521701CF982B25D8FC1F96508 KIRK.RUTLAND
143,620,161 *0DC1C8BB6E86C6FB49DC57346FA2F95100622163 DIVERTIMENTO.NR.6.F-DUR,.KV.439B.(KV.ANH..229):.II..ANDANTE
143,620,162 *0DC095A0B1777AE023F5C20581E9B097EC450F22 KIRSTY-MURRAY
143,620,163 *0DC7C0D21A0AB21BE08860D0896C2D13F1F7E328 [email protected]
143,620,164 *0DC1EC9AAA39C925D8DEB351D5928EB49CA7E726 KLEZMERBE
143,620,165 *0DCB39C2727018E0E34FDF48E3217BE8386A3B04 dkeo9cii
143,620,166 *0DCECCBD851AC09E53484183E0FFCBB8F97A8B96 koblenzarenberg
143,620,167 *0DC59E51CF661096888C5D67E66BF45C2CEE6D10 koenst3
143,620,168 *0DCD22B4B7334A94933409ED35EDEA6DFAA0C89B dldh1
143,620,169 *0DC02D109257CC6214FBBBD68C4A4183DC87037D DLH/T
143,620,170 *0DCD6C0ACED1567F242253DB05C39B44A1650F18 KŐZETTÖREDÉKEK
143,620,171 *0DC9801F7A1B42F49250D32CBB6F64B9ACC0F1A5 kozubniku
143,620,172 *0DCCF8F7209F318819F8027947A6E1E21F67F149 dmpkrng
143,620,173 *0DC9A1E9E583EF854BF6C7CC50B218995E876FCD KRIS-MAHARAJ
143,620,174 *0DC393B59B4C4C147988AE7DE4AD58B2784A3AFF KRISTARAY
143,620,175 *0DCB015716D8B0B8F404C6CD926460DABEA01A77 KRUMREY9
143,620,176 *0DC26409CA0ADF4E47226C4E7FE43A4A42522AF3 KRYDSSTING
143,620,177 *0DC319A5CB1A98D8F3BED3939958525545FBECA9 dnfkb
143,620,178 *0DC5155A53F4641D71F04C5706429DD0FB095325 KS,U
143,620,179 *0DC093FC4466E93610E2B9EE4AEE0F85930CAE99 d;nqg
143,620,180 *0DCA2AD4B1D7964D2F07E9A6C57E5E48D59130BC KUEHLERKUH1LER0
143,620,181 *0DC34B1530FB2016EA81A38129192D9C7557CA3B dnsk/
143,620,182 *0DC57FEEAFD50762383D864B177E0EB5BE419A23 KUNSTBÜROS
143,620,183 *0DC82046AD3629756D5D7CE86B6061C602C1148F Kuvausty
143,620,184 *0DCEE958F835BFF97A50B7363C3A6C776C452ED7 DOGALOG0
143,620,185 *0DCD5AB2BD028904748F949B5A0B559455E36511 LACEREI9
143,620,186 *0DC7787CC1CE5370EE507DE4065BDBA00D533ED0 LANDONDURING
143,620,187 *0DC9A7D1C87F7E0A586343EF1E749123FE919D20 donniekahen
143,620,188 *0DC5B9D767814D4B62A9F2597E293DD6E26B8892 larry-kettler
143,620,189 *0DC191CE034D3D07E38699226BEE48A45749EE18 d’öresund
143,620,190 *0DCAFCD1834B935AFB4C5CE48F23F664FBE7261D DORZP
143,620,191 *0DC88CE02116652C8BF9744997E0069197BA842E LATT3RIA
143,620,192 *0DC92E7155C42C448E52C1D0A181E01C861FAC55 LAUCHIT7
143,620,193 *0DC735C5CAADD5ED1A3F27B86E76B827BD14002F dosage4
143,620,194 *0DC8B3D135F4EFC2F282A2408D5F145E6FA6B84D DOS-EN-UNO
143,620,195 *0DC3E243C25D4181D438EB7AFF996A8578CDA12E LAURIE DORTON
143,620,196 *0DCC56799965713CD2F7AB5C3837083A3423A67B DOUG.GIAQUINTO
143,620,197 *0DC2AB182BACA6BFD84ADF189AC001055339B7D2 LEIF.EIFLER
143,620,198 *0DC7AFB591DEEE1DFF9F6F123B822F62CB1A4012 LEIGHLOHN
143,620,199 *0DCB8D68842B8DC7C467735A7874EF6135B404D9 LELAND.JIVIDEN
143,620,200 *0DC7E67DED4FCAD2F948AA8066AD3CDDE0FD6F49 lelandnatividad
143,620,201 *0DC165C0DDAD09DB23F56021C4BB8D5D746FD347 DQ8V.
143,620,202 *0DCDA1447CA3D917881175B08A222E2DFDE3AD53 DRAGANBILIC
143,620,203 *0DCD6B677E5C805050C50A5713DEEAF7A7182758 DREIPROZ8
143,620,204 *0DC6F090693248ED751204F2445FD131879A295E LEONARD.MAGGIE
143,620,205 *0DC804AACEE65FA16F95CEEDF867C91DBE916BE8 DRHKO
143,620,206 *0DCAE445C16BB768C7129AE94EAE01C43C738220 dr(iq
143,620,207 *0DC413B26145C432ADAD47BB0BC043C932C3E8A5 DRIZZT
143,620,208 *0DC70AC733B399B49EB00943C554DC254F491FEE lesliepribbenow
143,620,209 *0DCF839E2F61F5278978FBD987C1C28BF4350D21 LESLIE-SAMPLES
143,620,210 *0DC26A23A669F2978A00AB40D0B6F7C0916B35F0 LESLIE.TSCHANZ
143,620,211 *0DC66CF0D01D500A34F2ADB26F0605DD49AEE363 Let.My.Love.Find.You
143,620,212 *0DC9627453BA52C895BB3284D7DF50928FEE7E28 dsalper2
143,620,213 *0DCD90141439EBE97D44E689DD9C71F350159F6B light-that-shit-up-(endo)-(feat.-snoop-dogg,-rbx-&-mr-kane)
143,620,214 *0DC23E99AD19E796F9BB57BACF81B936D74AC2BC lindsaywinston
143,620,215 *0DC0E18181032C438677487B5066625E295181D1 LITCRIT3
143,620,216 *0DCF206B7C686C224056FA2773DAB89EC930508B [email protected]
143,620,217 *0DC992CF0DAF967824F34F87B9D3E978B5F78612 livers3
143,620,218 *0DCB0C06108B30A7B42410907641DE52190D9220 dustycanela
143,620,219 *0DC476BA36C0C871ED56478E17533D577652B24E DUTABAYU
143,620,220 *0DC6E4FB157CF104D35D949E27789F6F7253CA37 LONGMULDERS
143,620,221 *0DC037E8501CB7D5CDD203B08188D5C5B3E9BB12 lonviel
143,620,222 *0DCC4C8CCA89781DC7B1FB0398B6949B29FEE132 dwi7+
143,620,223 *0DCF97B4B9FCEDE4AA88933B5093D9183899691C LOREDANA GHEORGHE
143,620,224 *0DCB97998CFC570DFC513620A4098D7B6F7AC76C LORRISSAW
143,620,225 *0DC9C65455C2A41D2F6D9449151502040D34197F LOUIS.BESHORE
143,620,226 *0DC82AE1D6913E6635C19FB560D15BE6BF0A729F LOU.LOMANTO
143,620,227 *0DC4C0638A3E168112E9112AA5607D342CF9CC58 love.connection.nyc.(demo.for.mercury)
143,620,228 *0DC305F68233D61892172180C05B2C18C0E015AE LOYD.GURITZ
143,620,229 *0DCA5FBE25C1E485C28493CF4AE15E9013407066 e!(|
143,620,230 *0DCE6C535EF747B647FACA3E436B544F15272E7C [email protected]
143,620,231 *0DC9331241FF049EFE4879DF5CAA740A8D9A8CDF LUCIUS.BOEGER
143,620,232 *0DCF1B82343B1C5218816D0FE33C217BD6C37ED4 luciusokoye
143,620,233 *0DC0CD632AA5B092B0DE86E8BACCC62D2C0C2719 EA-DM
143,620,234 *0DCBCD7C472EF3628A3000FE0DD6864F4C12B952 [email protected]
143,620,235 *0DC7C7D7BABFFFE44365CD39A60CDBB1CA849530 LUISSOLAPADR
143,620,236 *0DC3621620B00F599CEB0EB7B398E7EEC88D8252 ec4i-
143,620,237 *0DC06D580D27BDEA46FBB13B19D8D13166D124BB M5FABC04C48B
143,620,238 *0DC8BB7C25C03C2DA4135F1537DF6C0A9FFBAD87 edmondmiddendorf
143,620,239 *0DC3AC8C5AC9A297657FDB965B9D8ECDE0E49E1D MAIRIEORCINES
143,620,240 *0DC71B45D899B301EB4B0B790C104A8ED11A1558 ee+cx
143,620,241 *0DC903E2566FF4D3BF6EDC71D5B33033BE229BD6 MAJOR.TORN
143,620,242 *0DC308B03E184D6E7C000BB3903ED0B83F89B266 eg3-m
143,620,243 *0DC9FE308A64AA0F91C235E45B426DBD1418E8E3 mangastelo
143,620,244 *0DC8E66AA3110767E7CDF976D72C60552D736DC5 manrzepka
143,620,245 *0DC68126EF72D737FBD03D4CF3A5B9992AAF0A94 MANUALBEHRINGER
143,620,246 *0DC1CF8ABE861E34A5058A185247B48BEDDFD16F EI8E
143,620,247 *0DCCB29A7CDCE10DF517EDCCED6DBB5BA0CFD429 MANUELVIELLE
143,620,248 *0DC9D131CF2855469E87FA6C121E81FB1875DE39 MAR1364
143,620,249 *0DCC287AEAACED70C9274D9BFA42A664F1F97B27 MARCELINO.CABEZAS
143,620,250 *0DC34F5004CE595DD57318ADC161DE588DBD9A3E ek8qe
143,620,251 *0DC9E6F87AB181B9D312DD6BEF806CF13A3831C2 MARCELO.LACKO
143,620,252 *0DC346948B6B4BEA775FD7481E5327B6DC260AE4 EKIVANJU
143,620,253 *0DCB82B61126FF3A7546EB61CA1AE9EA884D749E [email protected]
143,620,254 *0DC192B7C92C9E1A739C39F2AE21331DA1483215 MARILYNTHOMS
143,620,255 *0DC08476CE8B66704D5BB0D462F1FCA6BD4741DD ELDENALAMIN
143,620,256 *0DC4FDEA9409E2D8B07B736062B5464E8D3B1495 markdeja
143,620,257 *0DCC21B0A4CB72AF1944C21A108AF5454543820C MARKUSMESSA
143,620,258 *0DCCC39962751FC0E0D39DF82F5E5FE77AD71978 eliehobeika
143,620,259 *0DCFE3594CC95EFC3F49FDDE10F87EB58FBB4009 elliotbridgeman
143,620,260 *0DCC73368DBE3F29704200DC56E5D73EDFA138F2 ELSOMBRERODETRESPICOS,SUITENO2:DANZADELMOLINERO
143,620,261 *0DC8366DF94E66DBBF1514BF644F7DCAE427D6FE ELVIS.AVERILL
143,620,262 *0DCBA9B889B893E37A3040568CB59BE091F80361 em1sw
143,620,263 *0DC36A7F138C634A670C24C5466359E97B08D19D EMBF
143,620,264 *0DC2D4F1D7B94E795AEE482BC6838B34F6C1DE10 EMMANUELPLAKE
143,620,265 *0DC7D1C6747CE8D328DFE77AB91FEE3A541CF687 emmitthegeman
143,620,266 *0DC9DC87D36A60DEFFE642C9D27AE88BD54BCAC3 emmittlavatch
143,620,267 *0DC296727C3B7A5996A1442E42B31BC2DD485289 encapulating
143,620,268 *0DC25E0BDDD187F0912B048B2FF20B532A7EB6EA END-G
143,620,269 *0DC74268242698B15051B1D964586853A8FCC93F MATTBLUMENFELD
143,620,270 *0DCF6B0A915017465C4C846C44B7FFF560E3E400 ENRAAKSDU4
143,620,271 *0DC68923F2036E72A2CCFB00E299C813F9A4F657 enwiki-latest-user
143,620,272 *0DCB347A2F056F05D8F77E1F83D828B03CD0EE99 mcdinnr2
143,620,273 *0DCEE769F7AB408D471B13A072505691B413630B mcdna1b
143,620,274 *0DC4D01C001D82D7EC26B2B8819DC8863FB8680C eq;pc
143,620,275 *0DC9CC9D0D2FF18BE7C540B5AE56A0771F9C6644 [email protected]
143,620,276 *0DC81FE7E92EC431505619A7F3C667333C7D9113 membersofcheaterssyndicatedrealityshowcrewindictedforassault
143,620,277 *0DCE554F05D334516E3AC650D62415199D5A91D9 ERWINRAGSDALE
143,620,278 *0DCE7FD6A60AD013AE4CB8AA6368EAB1BD12EF5A es+kn
143,620,279 *0DC4ABCEF9F9E1E6ECBFEB6437F8B97C4437C737 ET3KC
143,620,280 *0DC03F2E296BCDA88D1BACE7BBB58F1C58715940 etaenaks7
143,620,281 *0DCDA058570E94CC5B7D87BC73CD5AB531402BCC mfsc
143,620,282 *0DC23F9C8B9A94095A76E65CB2D640D40782756A MGI160104695
143,620,283 *0DC8016CCFA4B25C7F59C7A27E76B8CD272B7350 ETIRWNC9
143,620,284 *0DC8EB6391B806C4E6F8A9A48A1C6C6F2A8D50E6 MICAH.BLACKABY
143,620,285 *0DC98DB2B06A09ACA899FFF89D1356FAC772E9F3 MICHALKACHIROUBAS
143,620,286 *0DC0B90C1B295A96B798EBB61919ECC9BDFF98D3 MICHELKOOGLER
143,620,287 *0DC28177287F55A1F02232D5CDEF0E41DF2F27AA euqilcbusing
143,620,288 *0DC5F6CC23686059DD424D541C9E5F4ED7F9C9D7 micro al hammed
143,620,289 *0DC3BB1E19A4512448D5D7BAF147B37C4BB4DD31 EUROPEAN SON (JOHN PUNTER 12" MIX)
143,620,290 *0DC26B1D5FD90F66390483D47C2E9D2BF72218FA [email protected]
143,620,291 *0DCEF43A47D2EAEFDE92C87D705A76657C5EDE7B MIKESPC5
143,620,292 *0DC22032BD4DDA3789AFB7EFEF66BA3003E38D7F EVERETTSCOLES
143,620,293 *0DCEE5BB2B8B6F9436E416B251593910E1F53D42 EXCLUSION ZONE :10
143,620,294 *0DC3D28FB64F9E16CA8EFBA54D7ECCCE3C6C806A EXPR
143,620,295 *0DC83CCC9F089A82A1FDACE3C7A58D9E8ACD8272 MINER
143,620,296 *0DC44193951C9A113698161E581C3FB8AB1B006B EZEKIEL.AVIRETT
143,620,297 *0DCCFF7192FACA96E5D216A20F8BB3313DCBAAA6 [email protected]
143,620,298 *0DCC23AA638B01E3870DF3F061E9545B482B5EFD F427558104
143,620,299 *0DC0FCF4441D3212BFE9518F5276C5968957666B F500F500
143,620,300 *0DCA2FC90E6BFDA85E4B77E09F7B531CE847DD24 fabianschlote
143,620,301 *0DC20709D1A9E124CD43E2E167E0FE878A71D840 MMM WHAT'S FOR DINNER?
143,620,302 *0DCC4603F39EA3725DCE5F34F0F18FD329877222 MMR'
143,620,303 *0DCA70CD18AA7C268E74E5F272A75E13E30182D5 mniskhte
143,620,304 *0DC5950A5562872CF3F63E0F494E47D7B553F6CD MODESTOCHABOYA
143,620,305 *0DCB6A27605DA6E61F6F2D7F3CD4C938C910B31A [email protected]
143,620,306 *0DC5BE5D597E8B0FE2CDD28C5EDA4785BB495F2F MONSTRATION1234
143,620,307 *0DC5403B69C4589223C4899B9F3DA16C44C717DA MOODIAN
143,620,308 *0DCA89CAAA5A8AB9B039881E1FC5F7ED45D031DD mor+g4g34813
143,620,309 *0DC5A98FCDCC03CF18B56F5442BCDF8946741643 MORRISMACNAMARA
143,620,310 *0DC4CCE89BAFD329716F1D1CD0BDC8DBD3FD49B3 MOSTWANTED:19681979
143,620,311 *0DCBF58B9EF955F898E6545B901542015EBBE2BD FEIWORTH
143,620,312 *0DC29DEBBFC428FA181355516770E9731E0211BD FELHASZNÁLÁSÁIG
143,620,313 *0DCF168FB6F5AAAF5274409779913DB20BFE7418 felipemana
143,620,314 *0DCF8AD1C93AD5DB9AC9B3AFEAD1559F95D85C68 ferdinanddagg
143,620,315 *0DC87C5F2C711750AA9EE844684214F090291692 MUNPOOLING
143,620,316 *0DC6FF9800026CBEB803BACD9D5FA5C4F5E56028 fishandchipsguy
143,620,317 *0DC7667FAEAF71057FEA3FE9077E80CCA474F4BA MUTILATORPOSTER
143,620,318 *0DCFC38C9FF3C030CF61A4DF79E36B4FBFB821A2 flavorless
143,620,319 *0DC9E24382ED3C13B1ADA9EE8BB62361EADFB269 fledging8
143,620,320 *0DCD4EA35CEC9486BF62F24FF895D1BFE8290760 FLEISCHQUELLE
143,620,321 *0DC256A1AB45080F7129458A7E8558D739628C39 flip-top
143,620,322 *0DC735DFB9845A700E88C94FBA768C92C65327CA mybigben79
143,620,323 *0DCA5D1E0FD27A1923B8D3CE3A58920DF9671799 mydog07
143,620,324 *0DCE08F6810A904F3D7EDA889DB0B5583F6F9C1D florinagent_007
143,620,325 *0DC182F9007615774C593DD0D31BE0312700E93E florou
143,620,326 *0DC2C646663CBC0F9633AF2389CB79D1505D3172 MYRON.ROACH
143,620,327 *0DC0D611AA672597B7044CB5BF35945367A1FCB4 FOCUS'
143,620,328 *0DC48B64230E30080881ED64EB78BEA7F7116B99 fonsegrive
143,620,329 *0DCA70D2E5B8E6641F3A496BA85FC38CC8F21003 FOREST.VERMEER
143,620,330 *0DC6CA2494410F459DE7EA353DCC55D97AE816C8 FORRESTBRACCIA
143,620,331 *0DC229E3DB45F6BF2BDEC3FA27D2A9A0C8C2C59D FOTONINTERACTIE
143,620,332 *0DCE4F89A951D0DD429DB02BD6FEF859F0B35176 n)*
143,620,333 *0DCAA9A0A32EAE2C787DE1D0CC76682B26AFE543 n19h7$7and$
143,620,334 *0DCE35FA0349A59C3890E4444887FC01B6DBD41B FRABOTTING
143,620,335 *0DC62AAC9FA0AD99D5AF05283EDA4E0950071359 N78769
143,620,336 *0DCAE0B008F8BCE1B058CA67F8E0A7CCA7FBD795 FRANCIS.MANWARING
143,620,337 *0DC790F0C5A48650067B79FA246F644248B4764F NADYMAC6
143,620,338 *0DC6B4E8CB38F43062824FD8407C71DD87D3A571 nancylmartin
143,620,339 *0DCE07EE983CB46D369D3659DB0FF7D447CDC424 FREDRICPAV
143,620,340 *0DC3CA4A0D9BD7ADC31AA573FAF63232E6B32E6B NATHANAEL.ONIELL
143,620,341 *0DC717F1A8AFE8A9186F8153B0C766AEEBF054C7 FRIENDLY-WORD-(ACOUSTIC-VERSION)
143,620,342 *0DC04D7975ADB1F2E661F9F490FA12278CA67326 FUKINKOU2
143,620,343 *0DC09B6F555E63D17EADEC39C4D9F22C03CBDB99 FUNAARON1
143,620,344 *0DC5B12E7764F1FB041A415A4B29FF9E7644E73A [email protected]
143,620,345 *0DC3C475A9DCDA883DC0C1D466375E8F39453A10 neifeld1
143,620,346 *0DCE95FF4A1F5553837E9309BBF7DEC4ADC00E9D neigensing
143,620,347 *0DC01B2E6A198793B7C949A77542212435CC6ABA GABARDÓS
143,620,348 *0DC0A2F085B69858C7BA8EA5BF5C89BE1276EFA2 NETQVPY4JFOC
143,620,349 *0DC2445414ABB48E7B117BE10D3EA60D535370E0 GAGANDHOT
143,620,350 *0DC8A6193B51945621A639CCBFEE1927828189B1 GAOQIAOFA
143,620,351 *0DCC947CFF6C1C9AE54605773D326D159634BF93 gasket2
143,620,352 *0DCA4CA8A015D03E6118F926920EEA9164105023 GASTROCOTYLE
143,620,353 *0DCA01362BF7E82633ED2011E6F05CC4F29EBC3E gaurangi-desai
143,620,354 *0DCE15A88B5D2B845A4633079DB02D6AA111AFCD niarbcod
143,620,355 *0DCFDE5D56C3ADFB182A3D85895C0AFDED62C968 nickielamb
143,620,356 *0DC729F8BB32C682CA19569250F1FC49BF50067C GENNAWEY3
143,620,357 *0DC363E629E6AF90A6A2BC1EE7571E16B4CE38CB GEOFFREY.KNOTT
143,620,358 *0DCA94121ECE4A4B9FC8269AF6AA4AE1DFF7C286 GEORGE.STEVEN.JOHNSON
143,620,359 *0DC26E6BEFA0C095FAA42118AF53DC4241DE66A3 NIESBUI8
143,620,360 *0DC6F2BCE4597755F4DFED0902322B680E37F244 niewelager
143,620,361 *0DCC4C60E8E8F284440D3F9183EE7726F3479297 NIK-HOWARD
143,620,362 *0DC91961613E412CAD538AA12C09883F71AF758D NILESHDABHI
143,620,363 *0DC827B39FBC92B98FD6FB7CD2A77A37F147D334 NIMAKHAVARI
143,620,364 *0DC436BFFA4A5B92299EE7DB21DC5737F033A760 GERRYUTTERBACK
143,620,365 *0DC50592EBDDDBACD40B011DD0771210220D873B NITSEIV
143,620,366 *0DC3C6D8751588AD1420A0BAC3196E38CB8F84DA get-use-to-this-(feat.-juelz-santana-&-j.r.-writer)
143,620,367 *0DC2BD3508C7F4402D9A2997FB24C8FA45F4D1A2 GINEITUOSE
143,620,368 *0DC511468EF9E228FA69DB6230A844354BBA11A0 GLENZERBEL
143,620,369 *0DCC3BF53D0EE5E0DE6E162894BC4595BA2727FD goldendawn(live)
143,620,370 *0DC749CC2AA8886AF3E974C714CE1D51BAE1ABBF GoodLuckJack(From:MyNameIsNobody)(EMorricone)
143,620,371 *0DC2A757123EB9CADCC07B5CD42DA5B9BE14D190 g;q1
143,620,372 *0DC11F8C462E043FB0695C1B8A8511A02166C5B8 GRADY.RIEDELL
143,620,373 *0DCD8F6832B33A3C9D2F2518FE49FD6F47523F49 GRAND-THEFT-(EDIT)
143,620,374 *0DC53B868FC0A8F1DEE8AA4FD4127C29595DDAA3 GRANITE123
143,620,375 *0DCFFFC50AD6044C5F65372A095EEAB31A39D2CB NOA KAPLAN
143,620,376 *0DCB86A9D726363C26EE3072105F8ECBDD43AD75 graphiccheckfunctionofthedataunit,usingthesigner's
143,620,377 *0DC733196C92847095AF4FC2108E641D8A14B87F NOELMOLTON
143,620,378 *0DC8DD07104567C1AD85E971962C95C7335B5BF4 NORMANDHODGINS
143,620,379 *0DC815293448299762F0E4F9BDBDC4D95E9FBB56 [email protected]
143,620,380 *0DC764F2B056DA78B85595D6D4CC1A7441680B38 gulariseriez1
143,620,381 *0DC660547CF4B745EDC280B4AC98F5A343C3F4E8 guyharklerode
143,620,382 *0DC1B56E9FCF863EDF8EF30B525D7AA08FB0DC53 gwmwmkmmuzh
143,620,383 *0DCAC8F7390A63D93D4464049714EF5393DCEBC9 gworen.bbs
143,620,384 *0DCBDF7401403C882B7F6E41DA8D064745779145 NUMBIAI6
143,620,385 *0DC94525088CB02A3C0B5690D1BBDC32A544B79F NY1Z
143,620,386 *0DC78446684257561F26F5DD51065B93D0DC91E5 nyeneim2
143,620,387 *0DC35A720671E9C7711686230FAE1778038473F2 HADJERZZ
143,620,388 *0DC7AAEEA077D17A26005BC44911B6A33D2E6DF5 o3z9
143,620,389 *0DC511F9A796F1B0885744D1C5220BB8882DB498 O5CILLA73D
143,620,390 *0DCDD1D0E1EA6B9BCA7C600CA1D236D34098E05D [email protected]
143,620,391 *0DCB081A4A4FC3F803960B9050413FFAC9193B3E hallucno93nc
143,620,392 *0DCA8418AFF0E4132D67AE615DABF4FE389A0958 OCTAVIOPOUNDER
143,620,393 *0DC43A4F8D2807C670806CC3AD3525C1D56BE9D4 OCTAVIO.VELLER
143,620,394 *0DC3AD22E7848D214E2E384F5AC92238470432BC [email protected]
143,620,395 *0DCF1B6E6536BB929ECFB38E1BF3427D424F467E )o( ~ ~ d====p
143,620,396 *0DC3B1D5482D34FBDA2B997D762F793027064E2C HAOVARAT9
143,620,397 *0DC3F4A01FC7985F14292A4E4069407A8F31315D HARTHUR7
143,620,398 *0DC36A38610EB8CA250ABFE9822711ED19998FB4 olindouthitt
143,620,399 *0DC6411F2E3B00DCE075FE4991CCDC8BDAD96E23 OLIN.SOLIS
143,620,400 *0DC8B5309B803BC2917519F553C3647BF4A40F30 hassandeluccia
143,620,401 *0DCA34B9601C932CE8DD13A6F35FAE3AD9A31BF0 HASSANSALHAB
143,620,402 *0DCAB25B61A3A8C5D5A28100BE548B5AA5E82BB8 HAVEMOLAS
143,620,403 *0DC5DAE83FB87904D3E6A1F19350B23F58064203 omartraube
143,620,404 *0DC0A24776B01743ACE450AD30D2FEC942D40654 omerprimm
143,620,405 *0DCE60AB7263BC41EBFF96BE22AE72FB855AE73C he?
143,620,406 *0DC82CBCB4BE058D8F21318B910B5944C1BF6772 HE5!T4NCE
143,620,407 *0DC7F769755A8BFDB7057262B6AC413D1C081410 HEIMOAATE
143,620,408 *0DCCD9F5D12424590119FEC4BBB187FB02B3AF47 O->-<O~0~Q==B
143,620,409 *0DC8D4CBD28EBD83CDA391C0A5D4EE2A92ED09BC }o{o~O~qq
143,620,410 *0DC59DEC88024AC507BFDD1DE7B9C0D4C92C74F2 [email protected]#HEMISPHERIC
143,620,411 *0DC10BA05867C0F2A3BCD581C44FE8F04AF4438F henrybeauchamp
143,620,412 *0DC5DCC8B327B61E9DE89FEFA67E8EF82BB551B0 HERADEMD
143,620,413 *0DC184B86DF8772FA8958FA5F4DD53289776348C OPTIMIST-'/A/PT/@/M/I/ST
143,620,414 *0DC75A0899CDE0CE5F5BBBEB012CA2EE1D91B917 o->-<.~.~.~.q=p
143,620,415 *0DC01496EDF3308B1F7F398FC5F7AAF1520E92B1 OR+7HOGONALI+7Y
143,620,416 *0DC045E8058FB87D13A21365D711E86A9A0F23D8 ORDNINGSMÖNSTER
143,620,417 *0DC6348E04382C380BA7956D8A09AE138E9A6C87 OREN.LABRE
143,620,418 *0DCDC34AD7E8830F13E0CEF4D620B1CFE5AFE937 osaltaan0
143,620,419 *0DCE89B4B661C354C9BF3285E53CE9D0D9724C30 hershelguin
143,620,420 *0DCF2DBD07E297F2A788DAB699F81F0F5E5863AA hexagonN:hexagons
143,620,421 *0DCCEE950BAB7C8A19D1F9A35047653A1A8EC3E5 [email protected]
143,620,422 *0DC66177991DDBB3E5BA739B437EE8A8AFB940C2 HICKORYSTREETANNEX.COMWWW
143,620,423 *0DCE01DFA009CF322EC938433495487D46714F32 O:WK
143,620,424 *0DC3C7046DEDE4FE7F62699B3F40BB0D6AFD012F [email protected]
143,620,425 *0DC709DA6A157DA8DF85E4B57FFBA22EBDF056BF P==)-~0-~OSPLAT!
143,620,426 *0DC515E636E2AE5EBC4A1A1EAC956739EDB6DF50 @[email protected]
143,620,427 *0DCA1A0E111D6A664C060FA5C4C9750C16E98BBA HLAVNIMU3
143,620,428 *0DC03D2728E476B8B7FE6C51F64E90FEB568C160 p4+rc4ns
143,620,429 *0DC0F4BDE49AC1B1EA2E9A077B0D4F87287B5293 p4th01095t
143,620,430 *0DC5DF4B46C856EAD482C665B24D6C1EADEB94C3 HOILING9
143,620,431 *0DCB75D75F510610398D74BB004D271BE8F459FE HOLLIS.RANDOLPH
143,620,432 *0DC7322E55BB2B6E6006F29A59D812C9158464C7 HOLLISSLIFE
143,620,433 *0DC8C28F29C15F011DE517C4D34B3A335ABB4B62 palmermclearan
143,620,434 *0DC3E6013180D91B83295236955F508000D293C6 PALMTREE86
143,620,435 *0DCB0E0E47658C76264C63F6FF536D8254E6631F HOLUBOVOU0
143,620,436 *0DCE3F187E89EF6D92200B6B83BA3460DCB039E3 PAN-ARABIAN-KNIGHTS
143,620,437 *0DC2204C2D981594FA6D879AE0A493578752CEAE PAN DE CALABAZA
143,620,438 *0DCAB3095DE6F40BACDF2D784A42D211BBD003BC homogeniser
143,620,439 *0DCCD745EFC15D8443F63CF5A66F543FF55C3743 [email protected]
143,620,440 *0DC98A4FBAF3EF0F3064932578264395D2B90FC9 PASGAAM
143,620,441 *0DC3D01B930E12EAC88D2340F1C233D6AF26929B [email protected]
143,620,442 *0DC4C16340D8C1C2741D25E9E01FB63545454181 HP[E
143,620,443 *0DC05C7E9489B4D4FE41E8318F0B96DD79AA0805 HSNIOATE6
143,620,444 *0DCB4C927FA8761E9503D9382B140DD2048B1578 HSZKGAMS
143,620,445 *0DCEF43654D2EE9156C9E7C824DFAEC6F302FD45 PBS.ORGEXTREME
143,620,446 *0DC725D9FB9A6EEE67DA2B12BACFBC0499B6B68F PCROHMAL
143,620,447 *0DCF0C7971933CA5F075ACC006A8CF25C41214E2 HTTPWWWTHEPLUCKERC
143,620,448 *0DCB95E6CE8FE9A2189F79C9B90A42F69F53485E pedrocaridine
143,620,449 *0DC7D058E231DDEC14C6853002D41ECC65D6DE44 [email protected]
143,620,450 *0DC6C3D9E924B91682BEA4895E061D896A44637E (PeopleAreInsincere)
143,620,451 *0DC5471808B4EA287E8450E67C198146E569688D hunghuffman
143,620,452 *0DCBF413676E62ABBBBABC2E85BF8A5E6712A42E HUNTERPACCIONE
143,620,453 *0DC7C262AA1D4BCAD9E4675545C5C64BE1AF7DC3 HUNTERROSEBUD
143,620,454 *0DC58EB387C3F78F6FD8F0DDBE7F30FE46DBD1DD [email protected]
143,620,455 *0DC12336621A9A991937D4AA0075784F5641C1D9 husbandried
143,620,456 *0DCB81D6003337C9C51411FCBF1CA7E738306391 HUSTLE.(FEAT..TURF.TALK.&.R..CITY)
143,620,457 *0DC858CC00D22F258F1C0D688362707FA2CCB1C0 PESARIOED
143,620,458 *0DC49279D3D23B9B46A4E12C11421100D15F5FF3 H"VK
143,620,459 *0DC859116C59B7EE9D756EB0B3BD9F120CD28D92 [email protected]
143,620,460 *0DC02C586364C6AA2325CD25DAC6E16C4B2E1B63 [email protected]
143,620,461 *0DC2F821FE9A56402CE2CB320D550D6975B70A1C HYPERATBANES
143,620,462 *0DC381C580FE7691A319FB398403E76CE21E10B8 peteallevato
143,620,463 *0DC1ED0C5578E253820730F774ADFF1FBECF2D5E IAMAID
143,620,464 *0DC3CACA084675A4DC587C696229809EC077C9B1 IAMCUERVO777
143,620,465 *0DCF94EC4FBBBB45757AA38A0A0275D72CE5C3F6 philippa-campbell
143,620,466 *0DC240F9B791270C66EFB9F64AAF4E5D331C2A14 PHIL.TROTMAN
143,620,467 *0DC67F0A9E84B57FEE146DB7F7D8A0C277520800 philviray
143,620,468 *0DC4B7C03D24A90417066D378F8611121F4D8429 ibnfl56
143,620,469 *0DCB9885F0005F4CF006FE99993707C7DD0D2FB5 PINS6
143,620,470 *0DC9764FB76450BADC049C8B1C2FD9CDADDF0B5D idon'tblameyou,iwouldn'tlethailielistentomeneither.
143,620,471 *0DC298BDD219ED0EB4C849C946054820DF5225C7 IEERBOEKED
143,620,472 *0DCD98B908F32A841728C707B9183A411055463D IGNAAST4
143,620,473 *0DCBB87FABBA7EB492078CFC2A644455F8BFBBD9 IJIJIJI
143,620,474 *0DC53639D649E699ECAF0269621630140009F7E4 PLONSSTO1
143,620,475 *0DC9519385AB53B951743E3BC1B36B7F6133E39E pnut515
143,620,476 *0DCCD35CD499320F52EB7E8528B58BF8F6DB395E PODEVIN3
143,620,477 *0DCC10DC30C97AB03781E1E713BECB21D7ECE5C6 podruzi3
143,620,478 *0DCA6C831D2242F29F0D54136A27744A13F313DF P###@~O}O{
143,620,479 *0DC6864DD7655E812CEED8E87861A0EE463889BC imagenzninety
143,620,480 *0DC2F183C20F829432A9BF63727A672EED4F526F IMALIH
143,620,481 *0DC8ADC723F117A72839B93591405701818130F4 i'mcomin'back
143,620,482 *0DC424CA9588CA15ADA2590752EA484EF94B1038 IMPERIALELEPHANT
143,620,483 *0DC60D12EDB3C32945B035AEF85E57B7FD143C14 POSPOLIT3
143,620,484 *0DCD39D955EBB90A61C7993B014CF647760FB3A7 INCASSAV0
143,620,485 *0DC37C463FDF165FA4CD8BF2D81E03F93AE25AA5 INCORRECTHEDEN!
143,620,486 *0DC423BEF975719793674EC57CF81553749FE6B8 pp~0splat
143,620,487 *0DC26B097DCFA0E8CACD4B30E3DA6C5010B991A1 pp`.)8(
143,620,488 *0DC31C5F8D85D49895BFB84347D95DF15B4ED4C6 PPLANETING
143,620,489 *0DC4A82D311F710A9579A61C7BF92D34B295F915 [email protected]+Y
143,620,490 *0DCB46F533D3B666CBC95B7657DA275CB3032410 IN NATALI DOMINI (PRAETORIUS)
143,620,491 *0DC68DCF2A6B2FFFA784B3FE7709544B79025CE5 PREDICTEE1
143,620,492 *0DC9DB772EDC7ACF70089810F2FBA7D6924FE17C PRIECHODNOU
143,620,493 *0DC3FB31B6FDDEF0CCCF5802C3CA81ED47E0A791 PROBLEEMN
143,620,494 *0DC7977C82691E9D69FF9B0C1CB632778EB07067 i$ovalera
143,620,495 *0DC26C674761F42C156A289FFFA8FD97D722FBBD programmeringsvaerktoej1
143,620,496 *0DC8702E90B5481228BD2B8521F836BE7906241D ipallage6
143,620,497 *0DCF486CDFEE156F09BE133A0B054BAE4DE1D929 proposedwikipediafavicon
143,620,498 *0DCD32B55E82991030F2E2CE93086687D5097EFC iscutonoed
143,620,499 *0DC6A2EEFCDCBA707A243656243D2EC52CC3E1AA isetaseillefarewelltoarms
143,620,500 *0DC6D6638424F4951B5E9037DE609CD09F14E15F pumpkinjoker
143,620,501 *0DC2805A845B74555DDDF34ED14874534EAEF46E pump-the-move
143,620,502 *0DC6A7B7F7F169FAE8043BC2DA406F96A08935FE PUNKROCKBALLADSFORTHEUGLYANDUNLOVED
143,620,503 *0DC489A3F34B4EADFDACDEA59A2CE163000AE6C9 isrealsutherlin
143,620,504 *0DC4515A8138344DCFA94F6657224D15BBD5438C [email protected]
143,620,505 *0DC21FC192917B00E43432AB676AFF38CAD9E2B0 PYYSIMME6
143,620,506 *0DC89ED0209E4CC9E0F4B533CCB6C391D0674EC6 pyyteetoen
143,620,507 *0DC02DD12183623E5503A142020F7AB3444391E3 P#ZAJ53HEW
143,620,508 *0DC8A7EF37C1F9D6EBB2F843D90CA4956316882C i.yb
143,620,509 *0DCAAD599B56E55CCE83448289AD4BD7F3E09318 Q]O<
143,620,510 *0DC1DBD912F4A33FAD36144E12C8CBC86C8E088C JACKWHITTER
143,620,511 *0DC7159190F10E56CDE9F9A6A5AA6B8AB77177D4 Q=====>*-*-SPLAT!
143,620,512 *0DC67BA116653763EDBCF19641F8165A9D6CE72D [email protected] ~ `SPLAT!
143,620,513 *0DC85CF9166889EC6DE32D5A80EBC39212A47E8E [email protected]
143,620,514 *0DCC98B3F24E3B945BAE4E67F6E67250D9566F4E JÄLKIJOUKOSTA
143,620,515 *0DC4FD1E05069B6D6E34885EFEC967A75819A56F queensle.ah
143,620,516 *0DCB70947190A84FA339615CDB939E526E287BE0 QUINN.WHITECOTTON
143,620,517 *0DC081D447D56CAC1D13DB6F43A0A1B4ADC7D1DB Q\ZU
143,620,518 *0DCDFEE9E1B9CAB27606E08316E4F9B05314B6A2 R><!
143,620,519 *0DCAF0F7A0617CD418906389237DF0D27C39A539 jaredalfaro
143,620,520 *0DC969541172364EC819D154868BFE957E91E5CB JCPM
143,620,521 *0DCD1506B0C5804FD8CC68FFF4E23B8A32828CD9 jeffereylal
143,620,522 *0DC19DB43F932651AA2735CB8CE94CFCDF067A0E JEFFERSONBOSTWICK
143,620,523 *0DC1AB0CD4C6E1763714F6E8A1549DC566B033B5 RANDALSALLOUM
143,620,524 *0DC21C5C15932EBCA9995ADF4C13D90C4E0F5C56 RANDELL.SAMICK
143,620,525 *0DCC05ADC959E007DABBE34A529A51E0901A7DB2 JENGIL
143,620,526 *0DCDAA8EC36DAFD34EF4A9228FC37807B0FE54D6 RAVALET
143,620,527 *0DC4D95A622E57C1D31D38B0DDD98D2C3C5DEB18 [email protected]
143,620,528 *0DCF176E507407258AF28E5DBC4EAF440172EF1A JEROMETEAR
143,620,529 *0DCF13FED7A8A7148B0D8044CC65962059E9E412 recocaldwell
143,620,530 *0DC3817EE5470E57F237F5CA1912B0C7DBB27F62 [email protected]
143,620,531 *0DC21A4F3873CEBF5289C860C9B6B8496F7F843A ReFeReNCe: DoD 520028-STD, NCSC-TG-006<P>
143,620,532 *0DCC3B97FFC33B52DD916E11E7719A9C3E51F00F JHAYTAKU
143,620,533 *0DC76C14C8CF6E0FA49AF08DC8C0B521D5697F2C jimmy-crystal
143,620,534 *0DC651CB26A4702236F0F36887856173608D37BD REMBUR$EMEN+$
143,620,535 *0DCD447B1B6BE924CA6278CAC24A28D0B149CE2E jncnfbdfob[
143,620,536 *0DC2FB0413F71DCAFF970E2DCF2AD93CFA811CD7 jnreitz
143,620,537 *0DC44C1312D612C1C1CD7FB12BC4A7E576A72F02 REMYGGESV
143,620,538 *0DC9C439CCDD257EEC0650FF89B1AE4128158577 [email protected]
143,620,539 *0DC5B506179F24104FC2AA20606EB68C726E4919 JOCELYN-LANCE
143,620,540 *0DC06901987AE88AA30254EA65FAF50116C0CDBB JOELSAVILLA
143,620,541 *0DC46BC4B40509BAE6453CEF2544B08313D2BB52 joeyrushlow
143,620,542 *0DCE2083073E83420D2D04BC5C4BDDB53BDD8D6A representtherealhiphop(feat.dasefx)
143,620,543 *0DC50B029ADA8DE7B2C20AA0DB57DB6D1B34BDCE REPRISALCAREPRISAL
143,620,544 *0DC78DA30237DD2A2106F1D5E8B76306CDA6DA07 JOHNATHONGALAVIS
143,620,545 *0DC027EBE2B948FB95355060F87E704026262AB3 johngeant
143,620,546 *0DC2EC33783C271D1A611687909592BC37312509 RETRADUZIRMEIA
143,620,547 *0DC6DA2251CD28955EBA02A1A5544578F8A91BF2 jonathonfraine
143,620,548 *0DCEBF15FEF4DF3CEDC0EB79A2467CA664AB3351 reviewhistopopobj_b000aezvrsconfigureanimation(null
143,620,549 *0DC8C37FC26856B72FD24D95F47F7D466CFBF0E0 JOSEPH.NASTA
143,620,550 *0DCF4C25611D4C2284B428F243D5AA93A29B34A2 [email protected]
143,620,551 *0DCBA39F4187A6DE592E5FFA6A166C527396DE87 josephrossetti
143,620,552 *0DCF60BB1C8A2877D72593AC5FADF39A4FFFF66F [email protected]
143,620,553 *0DCAC4294AE324AC409D582E971BA414E7B2AB35 *juancarlos*
143,620,554 *0DC89442C5A391E12244A64EA5BE22753B30A89B [email protected]
143,620,555 *0DCE98CA995108BE3D8646777C3CC28FC129710A ricky-counts
143,620,556 *0DC6368558819AEF41217A73956FEE307EC44FC4 ricky.tef
143,620,557 *0DCA4171A8269B226749E7CD8F6E10E2B390467D RIGHTWARDS6
143,620,558 *0DC4C8C090531F9A89DEE116B9178BE3D6C39E9D JUNIOR.LINDABURY
143,620,559 *0DC7D14A41B21AB47E5164B646E7BB526E6E41E5 JURATENGESTÜHL
143,620,560 *0DC481C0AE4A7B56524ED86B8B7E3DA6528EEE7D ROBBIELIPSKI
143,620,561 *0DC52F2566F45236FAD9095B5FD707D4028ACDB5 K?6#
143,620,562 *0DCCBB27D6170FA6AFF4227F8ABBD989E16BEFE6 K859821
143,620,563 *0DCFFA2B99A6FC4D07A434390ED708D32CEF404E ROBIN.GOCHENOUR
143,620,564 *0DC267D655E16EF2C9D45FE9CB4BBD9A28F9CD35 ROBINMINGO
143,620,565 *0DCE166D38DD888DD3DAE1A0841BF88A3A79B6B9 RODGER.HEALY
143,620,566 *0DC279213EAAF5BD2FA45E990C2A85C4D40CA3BE RODOLFOBUGARIN
143,620,567 *0DCBB6812F36AB4709FE5CC78D8579E423FF6246 RODOLFO.EGO
143,620,568 *0DC649A31C70C11F42EA5D3AC739F350B0D0BE1A RÖEKILLORNA
143,620,569 *0DCF5823B1D4978079C6B8635579E5FE1A058FE3 katherineagles
143,620,570 *0DCC4BB71721AE48B612DA50DC8271D6B262D99F kathyria5
143,620,571 *0DC2366F719C22F9B204B0F4E80A6A94F7A6978F ROHAILAHMED
143,620,572 *0DC902146750A3B0D69453D4B7A0F0F5DA21FF1F rolanddeakyne
143,620,573 *0DC86285515C814600818F767D65CA722E5B558C ROLETTERED
143,620,574 *0DC83F977027C6E567CFAF78F7B3897EAC81240F KEEGAN146
143,620,575 *0DC7D87943A17FEEA6E49505FF4CD7CED7F714DE ronaldheckbert
143,620,576 *0DC150C6A84C8266D0EAA8EE3FFE356E8F1C1B22 RONI BROWN
143,620,577 *0DC9B369399B79E5A5BFF5256198CF735DD8288A RON.MCCRUMB
143,620,578 *0DCB15930B7466B4C802E197E79CD1FB60F6D40F kelleybrodie
143,620,579 *0DC948A217325FDE6C8C6FC1B1DFE1A935C2CFFF KELOWNAMUSEUM
143,620,580 *0DCF5108F17093FF15A44079F80E265E75EB9C15 ROSENDO.MARKS
143,620,581 *0DC10232490F8A23BC0BD5D6E94B98F9ECACC50A KENNITH.IANUZZI
143,620,582 *0DCF7CEE452A1A4E13412D4ECB0FF89F28396A53 rotdåi
143,620,583 *0DC7DD76977ECEDD2E7BE3C23DF37728FBE68D0E kentaro.sudo
143,620,584 *0DCFA1027D9973D77513BF909136F3AF7275FDAB RPNVTQC26
143,620,585 *0DC09F6B606A07171A8287529621D0017D135E7E RUDY-ALAMSYAH
143,620,586 *0DCF08E68AF3859603AEF3A1EF1B25BF0446F3F1 kieraali
143,620,587 *0DC8D04379A991B7BB09D7CA10F313A1F6B758DA rufustwitchell
143,620,588 *0DC4BD2862FBDF388B0915DF44B34E6B33CC349A [email protected]
143,620,589 *0DC056E24608BA625F77FB51C711ACFF9468BA81 RUSTY.HARISON
143,620,590 *0DC15CD44F0CB42A0CD8F72A364E1C8B88C7D51C ruttles.1.0
143,620,591 *0DC42F2C059E2CE41311D1182040729B1E270E3C [email protected]
143,620,592 *0DCF3F115E6E270CB0736C64D2219A423E778E5E S>7Z
143,620,593 *0DCB976C6F101CCF6832BDA15248028FB77D0E81 KÖIGS
143,620,594 *0DC36843550D4A43144E6CF79F3C622AD8BE9A86 kraigim
143,620,595 *0DC0988FF19AF6FD578FF4DDAA1947686B64A179 KRAKATOJ6
143,620,596 *0DCDB38DBA0EF0674812F220056D2ED6B41E8518 samara206
143,620,597 *0DCA7449B99D9CD474752B3579992035D8811056 kütchück
143,620,598 *0DC45BF0E14F1DBEE5ECFCF3C7D58B8A63E6D334 SAPPHICS
143,620,599 *0DC5D0BD32ADC16E5B21EAFD113E6BDCCFD03194 L92404
143,620,600 *0DCC10A92A27881E547DFEB764C3546CFB65F6D8 labilize6
143,620,601 *0DCFF5E94B7D32012850AFADBF25773C02357AA7 ladáku
143,620,602 *0DCAB1144490FA511B4EFCC19DD7EB13435565FB LAHTNEB4
143,620,603 *0DCA4E943D4B8FBD63795BACB3268BA05ACF4CE7 [email protected]
143,620,604 *0DCF02BE0F2CF99C3B71E0239379CD6B834D988B schlittenhunden8
143,620,605 *0DCDAED5C61CA7B6D298385372F089AE29EEA43C SCHOUDERGORDELS
143,620,606 *0DC1C8E1AC855E0B65EA45400FB0F3F70486BB79 lamkp
143,620,607 *0DC02B7A18DBE08EA8688247452789A0833566B4 [email protected]
143,620,608 *0DC5E40FB34FF5DB5421DC101482B69398B74AF6 [email protected]
143,620,609 *0DC3FE6E3494D36E1E9A1844884C35A922BA6848 SEANFRAVEL
143,620,610 *0DC55462D12E713DD3C4C958568042AE35AA212B SEEMJS
143,620,611 *0DC1678C051169AAA7A894ECBCAEB2EA1624FDA1 LARPID
143,620,612 *0DCD45E6ACC8157FC02928DCE2355A5930DA2639 sehr verehrter herr richter
143,620,613 *0DC108BC2A1B295B03102F1056E38C46C0C8A5E4 last night (n-w-remix)
143,620,614 *0DC39DDA512FF4D0E7ABC9302D438CB68343FFFA lauren385
143,620,615 *0DC1E45A02FAEFE9CD7A1822D3602F82DB866F55 SENTIDO-COM
143,620,616 *0DC03413B9F5C3CFAE29A76FB62E1F5B3A108EA2 SERBERNAS
143,620,617 *0DC4BAA2B6C3BC34C6607A23C69A96808028BCF9 lavetta-fry
143,620,618 *0DC6328526D1092EDF26F7DA5C135BCD69B32162 leegrant
143,620,619 *0DCB9462362E55598C8292C1B42B1AF9BB87F27C shapedcharges
143,620,620 *0DC3C7E33C631A837CE578431B7581BD3A9D6DEE Shaumark.&.Robinson
143,620,621 *0DC932191B82A96506565448CF241DD8087AF3D2 LEIGH.MACHUCA
143,620,622 *0DC1396B3502E89C9234BBF316C9D6BE89A50BAB SHEEHANBSW4
143,620,623 *0DC0B6691F500EEF1581C5DE54BE88E069BFF47D [email protected]
143,620,624 *0DC0E3E5039A77C3FED8EC5B00847AB98B32666E SHERMANSKOUSEN
143,620,625 *0DCDDA693BBC44AB855E30AD2F2964F269AECBF4 LESBROOKSHIRE
143,620,626 *0DC51F0924CB1F1EB0895036119E6C658F12FA0C LESLEYWOODSON
143,620,627 *0DCB39FFFCAAE908C851856A48B82EB1754B3946 LEUNG SIU HONG
143,620,628 *0DC5795283189EEBC0E0428F207002615C19043B SHOUSALMAL
143,620,629 *0DCABE229FF939A1ED5EEC79A7B31D61667DCB60 SHWTNIKKIRAPID1
143,620,630 *0DC463ED4FF28DAADA08A3CED4352955B5E5004B [email protected]
143,620,631 *0DC303BCD6ABE265C25533F14893DBBDBD3A35C4 siconha7
143,620,632 *0DC4D60A8B112DEBE8289384D86C94354EFB8E45 LIAM.KEALY
143,620,633 *0DC508ABA33C69323C7DEFACEB89ABBD37FE133E SIDO-DYAS
143,620,634 *0DC243D69E12246824049B323DC7F94846F793C0 [email protected]
143,620,635 *0DC830DB755D8552D25309473AFDD16419A356D0 [email protected]
143,620,636 *0DC6523CAC95B307394600386D32EC20F9DF04CC LIBISCHE5
143,620,637 *0DC488DD4AEA413DD22CF29FC1EF17185E0A0676 SILYKETEHTAA8
143,620,638 *0DC35233CD6F38C2BA19B16B079BFCDC2F58F3F1 [email protected]
143,620,639 *0DC8616597797CA7110F981B2C60AA8F49AEEC8A sinanoming
143,620,640 *0DCD50E20C2117E6E0FC4CDE2AA027F6FEEAF622 sinimamed
143,620,641 *0DC7A1B07F93BCD17335E75EACD1E2620BE00D41 SIROTERS6
143,620,642 *0DCA98AE760C908ACE3000B831DFE9403951009A SITEFRONTIER
143,620,643 *0DC5CD965D0C6FE212FB2E5BD91EC87E3FBFAD64 LINIANNORTHWESTLTD|UNITEDKINGDOM
143,620,644 *0DCBD5129FE93CFAB5622071F9F11FC2C41D2C24 [email protected]
143,620,645 *0DC72DA4155D140CCBB1C7855E0E5FC16085438D SKINNYPACKER2
143,620,646 *0DCD382E802749D88A04A0E800D8B7BE3C942E7A [email protected]
143,620,647 *0DC23C4CEF3BC0E02828D3D044FC5FA69BF3EC69 [email protected]
143,620,648 *0DC8634F16109DC35E97150CE229C8EC18A51839 LLYHPOROPSORCIM
143,620,649 *0DC76BBA38281FB82B75010174DAEBA4003C8D41 [email protected]
143,620,650 *0DC814F11ECC7D588546C06F14C91DFC72C389A6 [email protected].COM
143,620,651 *0DC9DC00BB02CE036749188D6A49A967189EA51E LOREN.NESLAND
143,620,652 *0DC6F49D4DEB91F15EABCDA466495E188150AC65 SNOIRDNUEBER
143,620,653 *0DCB128EDA58737636B533B02E030E1C1ECC006E LORENZO.REDKEY
143,620,654 *0DC51CE6FCB025485CFDEBC73E71A03AC2777CCC SNOTACAS3
143,620,655 *0DCED8EA19AE0BDD3A08CB071F94A528CC680F98 lottojoilnigeria
143,620,656 *0DC977D231643328928C79E9A4AD814E0E2FEAAA louhallgren
143,620,657 *0DC530DF40AB40AC1A96CCE2086D2EE110D945E4 SODIUM HIGHLIGHTS
143,620,658 *0DC948B9672B7C94B23D5F6DFEC768E798EF4E64 SOLICITORS2
143,620,659 *0DCA8F3D5B3359053FCB45BDBECC7CD44A00B671 SOLPIACO
143,620,660 *0DCBB129003E4FC43BA3C5859AF8F31372D9442F SONATA.FOR.FLUTE.AND.PIANO,.OP..121:.I..ALLEGRO
143,620,661 *0DC7804ACBFF39A799205D514D6067554A0CFD8D sonnybushway
143,620,662 *0DC9BE41CFD0DC4AB7C7E38A7B7926C01CECCFD7 LUGGIES
143,620,663 *0DC0626D2C64E268FB945B502FAB081A23309387 LUKE.BARRANGER
143,620,664 *0DCE1368372A8E5575D21C0860C67FCD9294B057 LUKENEWLON
143,620,665 *0DCF2F10B3C54D72A100DA2CE995DE1D92D7AEEB SPIEGASSIMO5
143,620,666 *0DCBEAA85FD48A3993B911317D744C183BB7CAA5 LYUON
143,620,667 *0DC701CF06A51EACB21364ACE70FC0F8F26334B6 m4$ter.be
143,620,668 *0DC48C18D7A0267C425A7E61CB169A22F20BFABB spinaci
143,620,669 *0DCF1024E4AF6879F87AECB43A9297B7EB255AB4 spkx
143,620,670 *0DC34EC904D1519985BC621D9E0D8A074D0712B8 SPLAT-*-*-*D==Q
143,620,671 *0DCEB1A92324D09D02137D66D4D488ACAE19435C splat!-o~-(--p
143,620,672 *0DC3A0C5109586A37AA6019C5DAD77CE716D8A70 MADUDAH
143,620,673 *0DC3747B7E9247B156DB66163F6B35B611BB00F7 maggie-cahalan
143,620,674 *0DCC537E73AEDEF5DDD618FF10342BFFDE45DF69 MAHARASHTRA713ETC
143,620,675 *0DCE1A365D98617446216170F197927E3727D9C5 spregiava?
143,620,676 *0DCA5C0F18FD813898BF03F0605A7BF15842D8BE SPROVIST
143,620,677 *0DCA0B97A75F0F565213D0FCDB79376A36CB3C8A [email protected]
143,620,678 *0DC47DB50E870C39EA1C46F17B92D317B10353EF [email protected]
143,620,679 *0DC165791D3202E43DF7B2C2923D0EB601FF46CA [email protected]
143,620,680 *0DC895BB9E9FF91017C601A70202D515B032B18C SRCELTAGNAMETOLOWE
143,620,681 *0DCFD41EDAC57B84DD90CE6A44DBB3444315B0BC src="http//ecximages-amazoncom/images/i/11ewdefoo5l_aa115_jpg
143,620,682 *0DC302A062AA773314C12E07C509658E76966AF3 makwaelaed
143,620,683 *0DCDADEAB7E381257B8F5CB03D68B54233BD9BD5 MALMAE1L
143,620,684 *0DC34F3AF275DC53053D4A00E511AACA9B8F57C6 SSENLUFTCEPSERSID.
143,620,685 *0DC8C86371FCF61E1E77704946D3D6C6AFC7D4AC SSLRTSHCR
143,620,686 *0DC5647C4ECD2741CE0490B269BF8B3ECC822088 MAR1364
143,620,687 *0DCC287AEAACED70C9274D9BFA42A664F1F97B27 stagnaro
143,620,688 *0DC6A30FBDF4D967DB085233E067655133E99FC3 stalkin'thestalker
143,620,689 *0DC9687AC3F35EB5304570417935850EC5E5D5C6 MARCOMALINOWSKI
143,620,690 *0DC6898A1F4855BB9168352A1F871C8B11FD8664 STANARDS3
143,620,691 *0DCFD1990E1D3D9128D8F638F54AFE0C646BFD7D STANFORDCOKELY
143,620,692 *0DCCFEA84747083DD002F30A870083CD95876009 mariasegur
143,620,693 *0DC9F1E7A831F4F9DB12CADFA52605917E347C42 STANTARANTINO
143,620,694 *0DC616649565AC210D8148C6A879681E4ADECD2A MARK.HACHETTE
143,620,695 *0DC3B3BA3E44667CFE600BE549EAA197E0547442 martypaillant
143,620,696 *0DC81766C5AA02732B6666FEB512BE0CE9E61CE0 MASS-NO.-4-IN-C-MAJOR,-D.-452:-IV.-SANCTUS
143,620,697 *0DCCF86F7E871B7B381400243F38286F49EE4D30 MATCHCOUNTY
143,620,698 *0DC0E073FFA3C4C603D0211069745CF04ACD5E40 MATHEW.CROM
143,620,699 *0DC81DA16E2E088CDD3384B04CCE06368D97B75C matt-strange
143,620,700 *0DCC7D317D7A1FCC2F728863B4C20FA0410AED90 [email protected]
143,620,701 *0DC3EBBF5A7694B30572D67131AF8F26D640C4CB meedogenloost7
143,620,702 *0DCB0A63D2D2CC08193711868BD050FAD6E54B66 STAYTCHANDRIKA
143,620,703 *0DC722E26A6A93744443C6FF169C788479FE14C0 STDCELLATTSES
143,620,704 *0DCBDA6FD8F36076ED9B1038B859427EDEE727B9 MHIO21
143,620,705 *0DCE098579B89C709542EA2A471FC107491AB198 STEFAN.STRITMATER
143,620,706 *0DCB49261E013306A9B6C517783E0E823D61A655 STELTLOPERS8
143,620,707 *0DC41F323CDFB4775BD4BF7BCA08F63DB9558065 STEPHANRAJA
143,620,708 *0DC9F0688F0EC831117B45811A1D323CB3EB8A17 MICHALE.RAUH
143,620,709 *0DCDA5D69D696436F9F238B8D7F0DFB893C5050E STEROLESTER
143,620,710 *0DC99537B8C039C4E0A4E558E493F32AD958E047 mientrastocalacampana
143,620,711 *0DC5E2E7F6FBC9493C7361D0013D124F2894C1CF MIGUEL.GUILLETTE
143,620,712 *0DCEE70AA414C94FCE154F63354B95DE74D53F88 MIKAELBLOM
143,620,713 *0DC8B10F45FC0332EC688A386957B9043E449B64 MIRABILE12
143,620,714 *0DCA1DB2D0B9CF880B4018E8C420372C3FB1042E MITAT BAJRAMI
143,620,715 *0DCF5870446E7607F61A4F4B010870E891956BC1 MITCHMUHN
143,620,716 *0DC495564420A56AC9B35D62EDDD4F82EA9B152E stniojba
143,620,717 *0DC619D2E6F77AD27736B5E63EA09797B649003E STOO113
143,620,718 *0DC0DD32AADB1E533DE23F0BC36874D233DF7CE8 MJSZ
143,620,719 *0DC8C790890CDBC57D0060F17115D659287C7C8C [email protected]
143,620,720 *0DCAFC4E951FCC64CA733149C41279C398430AD1 String-Inside-the-Harp
143,620,721 *0DC0A71E46D6599CB7A602484D48A606026C6828 MOHAMMADMESHEW
143,620,722 *0DC4705F4E6C218D15582AFCB9D23748E6FF229B monika-gonda
143,620,723 *0DCBEA21088AB50BF91210F59951685CF4B0CA63 MONTAVERT
143,620,724 *0DC88F8035312B688D3D7F221DD431839DA8D37D MOONLIT(ROOMDRUMLANDMIX)
143,620,725 *0DCBD6EBD8AC124F8A79321A39DCA1A8A2924408 moran-or
143,620,726 *0DC2BD993137A4DC76D872F31C150D15F28A0C2F moskraded
143,620,727 *0DC07A8F8A3B1025A41EE438B50AC7520DA13FE8 SUITEFROM"THELIONKING":IJUSTCAN'TWAITTOBEKING
143,620,728 *0DC0AF5F5E6627659D321D6E2BE0F9BCBE9DA01B SUJANIFERNANDO
143,620,729 *0DCA2141B05B7C5C227156EAF04713D3AA122C99 SUMPFEISENERZ
143,620,730 *0DCE625BC8EDEAA5ABE05B28D4E3B9A7638FEC36 MRBIZZLE
143,620,731 *0DC7E885D5DCC0526722DEA96A9118337F6DEF73 Mtos3s
143,620,732 *0DC288D79AB6B4E6850968538A3C373587B0D7A8 muhammad.firdaus.ariffin
143,620,733 *0DC787F4DE3C569CE3DB685D9AB5D0FD79C4F99D SUPERABSORBENTS8
143,620,734 *0DCBBB25AAEA1B1F68AC095D13DD994AABF567B3 SURAYYAJ
143,620,735 *0DC95B1F22D425549CE197AABA33921E9833B819 music for 6 violins and magnetic tape (excerpt)
143,620,736 *0DC757A968589102B19D56816C475BFF199A60C8 MYPANCAKE37
143,620,737 *0DCFC7A8E0B5934810762AF89C00D2B082F077D4 [email protected]
143,620,738 *0DCD96130686054BCE00FE070A0AAE3868D02F90 SYMPHONYNO.8INGMAJOR"EVENING":PRESTO
143,620,739 *0DCFF86D406F558E2A8056C3CE9DABFC186F71D7 TABITHA-HOBBS
143,620,740 *0DC04D2B573663AFD741601DAD19EBA82E18A769 TAEMAENTYYPPISTAE7
143,620,741 *0DC20986CF7E0288C87898486C7FC2CCFD9D7688 NDELCONCERTOINFMAJORFORORGAN:IIIANDANTE
143,620,742 *0DC7760F6473AD5F5761CDEFA092553897189FC1 NEAL.MUSHRUSH
143,620,743 *0DCC74FB29B0D3D800C75442298A4A65DAEAA5EC nefty524jai
143,620,744 *0DC75D78E4AC4ABB1E3CB86AA2F0B88A63B32538 NEIMEGENA
143,620,745 *0DC442E3087BF93F59214FC7ED35294C38FB5965 NEJIREKAMGOORD
143,620,746 *0DCFD984833A5E228D939D77DF12B7D335D6007B NEPRIKLAUSOMĄ
143,620,747 *0DC1A7938710F07A0A9FE092F51E8726E0F30C96 NESTORCROOKS
143,620,748 *0DCD1283A163EF672D0D858C2745103226AAEB82 NEVILLEHUTCHESON
143,620,749 *0DC3B91041F79E9CEF19DDB5F25FAC2ACDC14DE3 NFATEN
143,620,750 *0DC572D663C0FBE3C3756E05EEFB66CDF65B7D10 tajeminica
143,620,751 *0DC8173A3A2C8A88A772F0F2C51AB12CB98DF5B8 TALKDARYLGRIFF
143,620,752 *0DC591A4778FFA44996376467BF2990E6D8671D2 nirumit7
143,620,753 *0DCDAD670E140698E6B9D604E71257A80974D4D8 TARASUPPORTING
143,620,754 *0DC302153A9CD87F3DA33E692A2B5CFDC96A3394 NKKCZ
143,620,755 *0DC5233EDF440023D7BAAB176E79125D9CC46E5F nmelanosis
143,620,756 *0DCDD27E5DC3CF0B628D88DB9BA54A23DF7AFE54 TAWAFFAYTANI7
143,620,757 *0DC1365B958A3C197F0C2E5F39BB7DBD2B019355 NOBLESTATHIS
143,620,758 *0DCBFBA42993006717A3EA6662EFCC02ED196315 *)&TCP_SRV_ADDR,
143,620,759 *0DC8EEE51EECF655623F7EC179F730F503F4F679 teddynathans
143,620,760 *0DC9A3AC2318B3EDEFF7F72385EE9F92A155DE13 nonclass
143,620,761 *0DC8701EC4998FCEC1DC107304E38E472E1CA992 teleoreyab
143,620,762 *0DC34057E9D46498E5C90AB587FD9F80719A8863 NONSUBSCRIBING6
143,620,763 *0DC4DC92AD88642B9B949363B6FC73C7C428198F TENUSSUNET3
143,620,764 *0DC88F02A09EB27A1C74EFD39C0800AD1C1A5AEA TEPLOTO
143,620,765 *0DC116E2054DDDEEC5904A7AB9063284695C6F89 norrishensley
143,620,766 *0DCD73ADB23CB45CDAB7C97664B63063422EAD6E NQJ64MC
143,620,767 *0DC4046E2028BD38CFC5C21FCF07D2F565AF3A71 terrylockridge
143,620,768 *0DC26BD4D6A5B85AB1903EE1C46605E82FAE794D numerava!
143,620,769 *0DC3C08AA622320E377EF0EFA2D0A73EFB203C6F TETREJHV6
143,620,770 *0DCFA0D6358A85F87D0CEE9FD936021BD2BB5EF0 textire08
143,620,771 *0DC3B47AE342E75D147E81BD381E693B50E24918 THANKS6420319270
143,620,772 *0DC16EC868E0452C24F182B06D349E07059AC8FC THANKS.HOBARTCANUCK
143,620,773 *0DC3D929BCB9E02FCB398918091AFA475BE87A77 thatabbott87
143,620,774 *0DC7AD5426C155A74201376DF5CC24C69BDC6B50 THATKALI89
143,620,775 *0DC7F9B7B41AF182B01B9E8E91FC1267A157FDBA thatmanageme19
143,620,776 *0DC2FE2F20D3D376C29A019AF722934395C9D79A THATQUEEN99
143,620,777 *0DCA8292EEEE9D63727AF3A9B765ADC45E746984 THAT-SILVE-HAIRED-DADDY
143,620,778 *0DC3E229AB1FDAA29983FCE98AEA73F6126723CE OBSTCOLLECTIONEN
143,620,779 *0DCA88AA488DA216A5224F48902C9DB0BF88AE49 THEGETOUT89
143,620,780 *0DCEA991B2D4A4CC6F3F424856F3F08BCDD7C9F0 the inspiration (oriental version)
143,620,781 *0DC0B1A8EFC133A66F8612F6841EA3BBE0585596 THELEGENDOFTHEFORNARRESISTANCEEXCERPT4
143,620,782 *0DC895FD474CF727320E2F76A994DE80AB7E08A7 OHYEAHBABY...
143,620,783 *0DC262D98FE89E57CFCE855D0539399590922DC3 therapeutictouch
143,620,784 *0DC5021E16379748433BFFC8B327C682643BE9E7 OKGTVBW2
143,620,785 *0DC506BF79A454007E0EC701F5263F6163D02119 the-spectators-notes
143,620,786 *0DCC0716253C6E576E6F6E7DFE41A1658857D5B4 THORANA8
143,620,787 *0DC43D6639FEFD6192D4A859976DBEE00C7AD2FC onderdebalustrade
143,620,788 *0DCE4C27EE0E316DBCFE3B65D88B630385E6FCEC ONEIRO-DREAM
143,620,789 *0DCE5E6FC31C48D688F31D89FF2D29FE47F6D476 ONLYTOU9
143,620,790 *0DCE33B712ABD043DD7E6331505697D4E7B38EEE THUNGTH8
143,620,791 *0DCEB4EFA10A3755D0800CDA33D9EB6A7134FAD1 ONUISA
143,620,792 *0DCC52689951D0C6098521C1388CF91281EFC86E [email protected]
143,620,793 *0DC388DF6599CEAB9B505808F430B432BB3AD19C [email protected]
143,620,794 *0DC1ED425ADEA6C0BC2845AAE397B9F9BFAC8972 opovrgne1
143,620,795 *0DC57534F9E30083775F988A6B3AD5A3D06D7BF8 orderable
143,620,796 *0DC2DDD30B0CD27E2924C1219AAAEB9B12A225E2 TINDER1
143,620,797 *0DC05AA47A69E6131E317724F6C19CCA7F837640 TITUSCLUCKEY
143,620,798 *0DCB6ACA8F52DCE56D0BFB21CD0C043C60125117 TIXYLIX9
143,620,799 *0DC9D2A60F61CB6238D39210EC1DA29DE9247267 TIYANAKORN
143,620,800 *0DC965F09AC556C1AFCF6F356B445B6AE29CB863 ORVILLERETTA
143,620,801 *0DC3C3F7149A66DA81F0C601556E8410570C2089 TK6Y
143,620,802 *0DC4D61A65E25A4DCB491847FFA21764E89021E1 TLOMACKI
143,620,803 *0DC94F86CB1CFBD289F84850D6694C429B576FD6 OSTRINO5
143,620,804 *0DCFE75B7F9F005D7EDC928421E0C3B5032263D1 OSWALDOMONDAY
143,620,805 *0DC0D4F245AA5C5BE620EBF8D494466F0EC32EC0 TNEIATLA3
143,620,806 *0DCE2A80AEC113BF36A057D1BCA92FFB26D9DDF9 OTHEMORR3
143,620,807 *0DC75AA84C99C3D35E4094212300F58E338F0685 otherelectricities
143,620,808 *0DCCA919187FFC083E8A7341E989071DD57C37F5 OTTO.STAIANO
143,620,809 *0DC9C40F9FCF566CBC6ADA8ADBE56BEE3B1A971E TODAY.87.175.202.187
143,620,810 *0DC3CB8FBE4316A4BFBEFE97CE8C3710B042A96D toersoenov
143,620,811 *0DC14B3EFA40428574C1D6EFDBE1128EBF00421A OUYOUDEN4
143,620,812 *0DC6FDCBCA3C43CFBF091097EC111EB48F94C99D TOMASTURNHAM
143,620,813 *0DC2D3690C3E9B5702DBD3092AC6322B98224106 tomb
143,620,814 *0DCCD854F1C6C07E597CE874F1FB4071D9A2F424 oz9x
143,620,815 *0DCF0611410751E0E25F4B1A19F6717FCD52F74E TONNEREN4
143,620,816 *0DC1FF81BFA8859F021FD3CA78CC5D1C0842B79F TOP SHOTS (B)
143,620,817 *0DCAA966A5C8E25A3D6386DA91B996B815CF2BC3 tqy&
143,620,818 *0DCDA7A0121CCE2B5BF6E2714861C036B86CB391 traceyphalen
143,620,819 *0DCC9245E3824B1C4C2E37A79B9D05237A648147 [email protected]
143,620,820 *0DC4F5899AD4E5350DD1C2D5733C4A889909A79D pančpargania
143,620,821 *0DC4A6754E147C1C076BEF049EA39B8A50B9216C [email protected]
143,620,822 *0DCB73AD0045D4DFB940AC1270C73CBA286BF961 TRANSPIRATIONS0
143,620,823 *0DCC87623F43BC582AA9181111977AB5C392D6B8 PARMUPILLID
143,620,824 *0DCB6A9B62F6DEDA26492AB0B357B5BBF438AA44 PASSZONEJIWON77
143,620,825 *0DC33EA4E6BCCC5C8E8AD674B9FD65F09C3B7618 PATRICKBISONG
143,620,826 *0DC93F2525999E5AE15D4CBD739C271C674FA316 PATRICK-COMISKEY
143,620,827 *0DC14544390A37C515F397B733C8DCD09C6B9AF1 patrick-scarlett
143,620,828 *0DC2F86DEF4AB2053AF833F15CCA8E21FAA786F1 TRIBUTETOMUHAMMADALI
143,620,829 *0DC8992B4BF6EEF6DCA93DF6B927222999D64944 trinidadfinallyleavingcolombia
143,620,830 *0DC92DD377CFA4FF3CC5D3470DFC3151CC57849A pb`~.)o(
143,620,831 *0DC94189B5321A8E3CBF24CF707315A552613F8B p#####D-~O~o-)o(
143,620,832 *0DC24A423C0709C221AF415AED29DD4A8EABCC32 [email protected]
143,620,833 *0DC16A3C1EB75E7AB83015F8194D9FAD7C0137E1 [email protected]
143,620,834 *0DC4181FDC9C33FC092A9C1A16636343C00DD5F4 [email protected]
143,620,835 *0DCAB7644C8216BAF2648668DA0F9741F4965DDB ‚PETROS‘
143,620,836 *0DC4B2077BD8BD9AB0EC054F3F4AD81130011221 PHATHON9
143,620,837 *0DC76CCB58B2D9971AC4A3FD089F3CB91E3D112B phenytoin103104105
143,620,838 *0DCAB4F9B540E4366ECCFF37AAAD80416436E308 tutorialsde
143,620,839 *0DCDE1219C537E07F107F79720670C8801D94A21 pierce763
143,620,840 *0DCF53F414BC7BC6E58DFE5FFC7FD75404173976 tyler.pidlubny
143,620,841 *0DC0621EA8FF7A2006BDA188599747EE3903D079 PIJPJESKRAAG5
143,620,842 *0DC40AB34BB72EA6BCF784D1FB7AA636934836BD pisadas
143,620,843 *0DCF07CA64FBD6CC48E3E7617BD31FC3547943C7 TYRON.REICHOW
143,620,844 *0DCEABA14DE0C3F0B804ADF016C0CFD5D36B9795 pkfpkfpkf
143,620,845 *0DC5ECB7BCDC0CA61F727C9EA7B97B4DC9CFDA5D [email protected]
143,620,846 *0DC1F872722FBB4EE063C4C79529666E42AE2E27 UABAKGNI
143,620,847 *0DCC197345DAF40F61ABFBFDE3F5FEAF6E2B3EA8 ÜBERSICHTLICKEIT
143,620,848 *0DCBDAADBEF9638EBC7263A5BDBF5D7136856CFF pliselonpli:improvisationisurmallarm
143,620,849 *0DC67FCE523108D7333A355AF571F56D1185852E udit.singh.panwar
143,620,850 *0DCDB504391F719EEBC61C354B454D7A5C744DEF POGENES
143,620,851 *0DC178831A061950A91C23F00C190869831470E6 ULKER.ALIEVA
143,620,852 *0DCF5A173C4B66EC80FD037BE2CC4A356F60C46C ULRICKSWIGART
143,620,853 *0DCD22CC8FF9AC59EC246930E6D6449DD77AC19C POOR-SHELL-OF-A-MAN
143,620,854 *0DCD507EF61C312F7356624C40F4BACCD69F5508 POP GIGANTEN: HITS DER 80ER, VOLUME 2 (DISC 1)
143,620,855 *0DC2EF1A8C5367FC4885A6FE6A460CFF65376A77 UNCALUMNIATIVEA7
143,620,856 *0DC3DFC0BB4536E6E778D9F64535000AA428BDFF P-P~0.~o)0(
143,620,857 *0DC1B0EA055395F742B517FA323CDB4B226FCD74 PP~0.~o)0(
143,620,858 *0DC74897E41F598B68B237FAE1B9A57A5DC3BCDA pr0p051+10n4l
143,620,859 *0DC1F5995FD5BB0A61F79AE89D1FA3E3DE9796E8 UNSHOCKABLESED
143,620,860 *0DCC50D0CDC32E8BC83AA73ACC89ED8A30CDE6C0 prebelieved!
143,620,861 *0DC872CE701F390B9760AE2C1AA66879A7C36561 PRESTO "O FREUNDE, NICHT DIESE T
143,620,862 *0DCB4E641D048D821EC502E90387737BB7E3BA82 PRETTY_MUCH.'PR/I/T/I/_M/@//TS/
143,620,863 *0DCA9510D5C06A0ACD4B340F71DC5507FD123ABF U]QR
143,620,864 *0DC24FC1FD75FE9C9B4EE910A1BD6EDDFFA13533 URAUK7ZG
143,620,865 *0DC00B0988AE531375594626A7CC121E3A4AD1DE PRIME TIME (FEAT. XZIBIT)
143,620,866 *0DCB954DBFC3E41369AF738B5C03D8650C18DAEE PRINCESSITZE
143,620,867 *0DC3F11BEB3766D64ED0995C015F0AF833A1324A prod1s4rm4m3n+
143,620,868 *0DCB848230F0BDE62E7239A5D4FBA7A1CEBF0C67 USHSO
143,620,869 *0DC2777A51CBC192607974DF7383C9115DFA9500 /USR/LIB/GRUB/I386-PC/VIDEO_FBMOD
143,620,870 *0DC717ACA519C26DC41EF97C3120EF4E7FFA9521 PRPRPHTCED
143,620,871 *0DCCDC7559484A40FFBC9204B18B8F2E4B1BBC55 psychologyjournal
143,620,872 *0DCB7AC360C196F95A605F4947326336968301A9 UZOAKU.UZOMA
143,620,873 *0DC1CE86E04D49AFA3B2A458852528AF11105D94 V014+I1I+Y
143,620,874 *0DC56CAAF2DA5223FE533815715810BCDED72B8E V150130
143,620,875 *0DCBAEA373B6EE0467C2EA6AAA3C5D86EEA4E051 valentinhuettman
143,620,876 *0DCC79DF207C28D7FA4985322A6FB67D97D804FE valerieerasmus
143,620,877 *0DC3EF274026C8E0FF663FF6844D7B15CA3F58EE VANIFARADILLA
143,620,878 *0DCB243FEC434A7EA8B0C52E5C95CF1F4E4B4469 [email protected]
143,620,879 *0DC7BF62009784AC44C1E0976277AFB6EC2572DC [email protected]
143,620,880 *0DCAEEADEAA24F7ECF8D223A6F939B3BE75592AA VARIATIONS-CHROMATIQUES:-II-A-TEMPO-RUBATO
143,620,881 *0DCE0E42980ED36807C899621432533417D4E3ED quanna6
143,620,882 *0DC30579A5070208392223F4E349DA749182E609 VENUSKENNETHROMERO
143,620,883 *0DC11619D7BE8FAF1F2316835BF23FCDC7333266 VERDUWIN6
143,620,884 *0DCF27000FECC1085F5E547B7D3524416CE23D83 QUIETDETERMINATION
143,620,885 *0DCAAF999C002D4DDC96106294B5E95786A13485 QUINTONAWTRY
143,620,886 *0DCA73FD858276BDB29FB2B61941995E9BDBD7F2 [email protected]
143,620,887 *0DC1A34BE8AA153D88D491499A211A134F1A81AF VESPEA007
143,620,888 *0DC3E79C2DE0A74F0226250B06957A766EA25AB0 [email protected]
143,620,889 *0DCF5E531F4931B836CFB671C8AE117621A1395B [email protected]
143,620,890 *0DCE82EDC67CCF609E6BE63B697A3CBEE9B30DAE RAADHADDAD
143,620,891 *0DCA307AF65CF7F04787D2D0651B14F3A3B8C94D randalgreco
143,620,892 *0DCA7D4712EF099ADE55295075A0B30183844CE8 RANDELL.POLAKOFF
143,620,893 *0DCB7B9D31E1E667E4FA3F229009B53897D14E5F RANGRAM4
143,620,894 *0DC7F009646EFEB48FB60BC83981B924F789E131 VIOLET.MCKNIGHT
143,620,895 *0DCEC8FDD17D58EB15C81909A6FFCC526DBBBC03 violet-wagah
143,620,896 *0DCA153C3196BCA231A61479FB6932327F742B26 VIRGILIODICKERMAN
143,620,897 *0DCD022F1867BFC3F175ED6E2DE648DDFB077E5F VIRGILIO.PUTCHA
143,620,898 *0DCF94C54CBE52B91222F586B906CD735BA3F308 RAULGEHRKING
143,620,899 *0DC814B5C8F323720F0653BB542B7C6EFD3D1C23 VIZABELA
143,620,900 *0DCEA4A735C59CDD99079920DE1BB7C62597BDCF RBJDSTDING
143,620,901 *0DC29DB40863B8B09871E83B7743C2E8891E3E8C [email protected]
143,620,902 *0DC86B8BAF6BD1992CC2574EDA3040C41BA1FCE0 voices-interlude
143,620,903 *0DCA757FE501F14D6B7B84C2ACE12E3003B9179D RECURRENCY8
143,620,904 *0DCEB056D516D88AEBA182E57E8307AA5097FE3F REDEREMUSQUE2
143,620,905 *0DCDF5FA1F39FF004515F24ACABE43538B2C28D4 REFONDRAIENTING
143,620,906 *0DC461BD00835163ED80412BAE6C01DEE2D31EE6 REFUGIO.DELANOY
143,620,907 *0DCD3C961D26B8D3BE6DD93FFE71C73815B5254C REGROUPER
143,620,908 *0DCF2C728DF2114F8A776E14E4FAD460D563FFB7 REID.CRUICE
143,620,909 *0DCD6F768DF16B3077E583AACD8672228521A7FC reinett5
143,620,910 *0DC1A5128D06F4BFD652698CF423E9C7FB300EFB RELGNARWYVOORG
143,620,911 *0DC995CB777D123454F1B298E159F0E355C30BCD REMOVED0014
143,620,912 *0DCA11121B294F5D2FBA4457119A47D891F42833 vongsarath
143,620,913 *0DC0A3B13ADAE36037CE267203CC32C8682DAF66 vozarini0
143,620,914 *0DC4A1BC2A3964B23C554EDFD6D34871CAE58E20 REPETITIIVISTAE7
143,620,915 *0DCAFB7FEB04F6291F9DFEFF8BE313E07D9FC8D7 REPLICAE9
143,620,916 *0DCFDD3CAD2EB70D86E435B0F465383BE981E81B RETAGSAMMAED
143,620,917 *0DC9BA35F16DE300E6002A83D4AC6CE0204363D5 REVZOOM
143,620,918 *0DCD916A9F0E3237A9C68E86C486396DB10A31F3 REX818
143,620,919 *0DCB734CB643CC92D2B7BBC9117FE8683001D54D WADE KNUCKLE FISH
143,620,920 *0DC4DE2B5DCECCBC45DDE15D2DDE943D2F3512F2 RGB6422
143,620,921 *0DC7F45DAEAB3AD886F10E108874FB7292DCECC2 WALSHAKNAMANG
143,620,922 *0DC0676D0C8334A915C3ADBEDB084F37B108546D waltonschwoerer
143,620,923 *0DC4B9EDEEF00BCD4E00CC159CD3D3E82E4DEC66 [email protected]
143,620,924 *0DCFB2BA437DAF4C220B50431F18EB66F29DE53E [email protected]
143,620,925 *0DC9C3DDB3E81F781AA5BCA0CB4D39BE718E9305 [email protected]
143,620,926 *0DC5891E7AE795D51E4888C795C238828E65FE56 right2037089231
143,620,927 *0DCB62FD49BECA747707EE48AE9ADFF8E1AF2126 RIKUDTUNISAI
143,620,928 *0DC9845632D9D065B3EE26D0BA18EF3623E5E9DC warnings160p
143,620,929 *0DCE0492247B7210874E06CF8D019574A8E7A96D WARREN B GAUTIER
143,620,930 *0DC28E377ED5CA012CA4E6C3A652AD45EE5C98D8 WASIMNAGI
143,620,931 *0DC28FA3A1FD9FBD92BDCEB961048712DFDDB5EE water-measurer
143,620,932 *0DC904051AFEC9A7DC25BF47F4C2B840E4FC5A9D WAYNE.DEWHIRST
143,620,933 *0DC9BDCF02978ACF28D4DEB0C7AD5316D95E515F waynegattie
143,620,934 *0DC898F47399C1DBBBB1A4FD8B66EDA1015F18DE WEINING FU FENG
143,620,935 *0DCB26C855923827FD80A1EA3566C2F6DE984E16 RMT~
143,620,936 *0DC20D5DC918CDA76BE0807D4E387363474DFAB7 WENDY-THARP
143,620,937 *0DC656CEBEC3D3928A58E6F1EA44B742CC53CBDB [email protected]
143,620,938 *0DC37571A88328C2D5B1AEABD6531BBB4F1A177C [email protected]
143,620,939 *0DC1AB68E2B799D9D0D6FE21F2062FDE73CEAA2D [email protected]
143,620,940 *0DC35A4C3B96D98D84A978250A64958F2705F32A [email protected]
143,620,941 *0DC0BE54D31B4FAD21AFA75E02CAC1946E5C77D3 ROCK AND ROLL HISSY FIT
143,620,942 *0DC2061F9069FEE4FBF31D1E35FBF1793AD7599C WESLEY.NAULT
143,620,943 *0DCEDBEB3B080BB804A2AA0050704B55876666C9 wesleywarpool
143,620,944 *0DCF2C3981311FB8175541DBF112F85BE6E95425 ROGELJA
143,620,945 *0DCD49CF82B3C1BC9AEBDB7267027D32355BE9DE WHAT DOESN'T DIE
143,620,946 *0DCA3CCD3502107AAFB81EF193579C99814FC0A4 whte.totis
143,620,947 *0DCA0932E34CFACAFA186C8E90C7326DCED8F57F ronklinnert
143,620,948 *0DCA0398E492FC7EF1D5C520B117E1720E532588 ronnyguard
143,620,949 *0DC8F8DF62024B70D53E0E9EA2CB65116C89785D ROPINGWHALES9
143,620,950 *0DCF1501EE9D65E744040E418ED3791D72994309 ROSS.MASO
143,620,951 *0DC4F94C9B8E8B7AF9459093108802EAABBCABA9 WILLIAMDARSI
143,620,952 *0DCB816DEEC48D54E96984435448D910256A40A3 RR(T
143,620,953 *0DC3BF2A2422D0E09D4F79CDF32950F549185F65 WILLIAMFREESTONE
143,620,954 *0DCF9205CBC78BB6E60C3E8AE0C024FA4C48E663 william.hillis
143,620,955 *0DC2E3728053BF87A11F7AD7AA1C0C017786890A rt180
143,620,956 *0DC327ED71F1A2D77FE26DF400E03783729390E9 RUDOLPHROSINSKI
143,620,957 *0DCB54B31071E9EBFC670D3B72C9A8A6F1C8730D WILL.MAGLEBY
143,620,958 *0DCF2ADEBA57A29B286C3F8E51E5F14C87101549 RUSSELKRAHENBUHL
143,620,959 *0DCB27B301BD711CCCF7B997074AA7C4D02D92D3 RUSSELRADERSTORF
143,620,960 *0DCB0B51B164503922F3ADE6C6B7A8C4678E1420 RUUKSHAAS
143,620,961 *0DC523CCFE175321A2CB79B542FC5D855057E4B8 [email protected]
143,620,962 *0DC391361B4C903D2FE90F4DA374D612ABBFD0DF WINTERLEITE
143,620,963 *0DC46180C4527599D2188C54F054BE7C3C0C18E8 [email protected]
143,620,964 *0DC84BA5F894477AE8372A5A0BABA0BC5324F19A WITTERFÜEHRENDI
143,620,965 *0DC6FD63DABC9E28D8AA3D402F87459AEFF9FECB saaa.wing
143,620,966 *0DCEF5F3D13A00B90C27193A598AC293A7D19696 [email protected]
143,620,967 *0DC597C5FE44E512E00F9550F0AE7403B350FE9D SAINTILBSWED
143,620,968 *0DC9CE75BE1874825DC0AF5FFBE57BD954844C58 salaambailey
143,620,969 *0DCA74AF4A7CA116EE799E42A1864896706CC151 SALLY YOUNG KELLEY
143,620,970 *0DCAED401CF78168A13B9284F32C6BAF45821246 W:{V
143,620,971 *0DCD0D550D91A2D34570D0DFBF53E74CFB0242A5 SAMUALHERZOG
143,620,972 *0DCC4AE749929DC4E1C2C20D67B940F5455A7E0D samual-payne
143,620,973 *0DC54751FAB0D79C4F9FBBFEB205A678A3B3882A wwwbraidshawaiicom
143,620,974 *0DCE245ABC619F7F9D2B39BCF89800D1438225EA SANDY.SAULER
143,620,975 *0DCB01EEE56477EE4ECFE0D11F77730FB2BB7246 SANTIAGHENO5
143,620,976 *0DC72D1B79493F0A4634F1A8EB585807AFC198DB X171971
143,620,977 *0DC114503EEF84F2330ABC060F95CA73956FB64B [email protected]
143,620,978 *0DC696A60525755FFE4342B528369807DA0476E8 XAVERIUS.ALEXANDRIA
143,620,979 *0DCF716FBEF10B2643F0295FF1A5AB39533593F1 schamman
143,620,980 *0DC75684993EEA79A732C7D836488992FFA9351F xhagsz-ancajas
143,620,981 *0DC6029151C0A5DAE5CE103B599F6C1A89D2460B [email protected]
143,620,982 *0DC24747F3C9CF5CA066D53FE07A48D5EC14CBF6 SCHORENB3
143,620,983 *0DC723FB6A2FC94551D0A2B3F3CAEFB4A926F3E4 SCORPIOPALADINED
143,620,984 *0DC62B7081F7941DD909D865D21D6DD72C8BAC40 }X{[email protected]###8
143,620,985 *0DC3481C6726B329277023472C990874A30AF62B {x}~`@==p
143,620,986 *0DCD567D9D69DF3349EA8A780DE4F37714841687 SCULPTERONT3
143,620,987 *0DCE5349CAAB871880FEDF5A8F11467919BC7BEB X'SAAA
143,620,988 *0DC93EF703F5094FD49CC909E094B3D7DC324FC2 S+EA11NG
143,620,989 *0DC6C5EE5A03B06ED338213DAB6E1B6CA93F4C4C SEGMENTOFFSET2
143,620,990 *0DC0A24C7AC616A9F241572F3BBDA39D3EB08E9B seiritsing
143,620,991 *0DCFE79D0BD6F99899CE76008738167618E9D575 Y'6.
143,620,992 *0DCDB23780593729CA7F258A5948A07F801FCFC0 ^/YAAA
143,620,993 *0DCFE0AE92825FA0339E31FA8CF62A2E47C5BF04 YALANDACOLQUITT
143,620,994 *0DCD60C1CAE667D6A557D53F8BB29B19E2EB9FBB YANA-NADEAU
143,620,995 *0DCD588B4695356BA00EF6D0CFE29F178E9CFEBB [email protected]
143,620,996 *0DCF8DD65C39A460264F7672E7D031F337110E93 SENENKARE
143,620,997 *0DC4CADDB17A2A6DF60ADD50A5645B0A6B237470 Senhora.do.Sameiro
143,620,998 *0DC4A4919BB95E9A225842FAFB7B94198D84C553 YDSQ
143,620,999 *0DC178AA2C9B9F2FAFBA11A1B5CB146C5DC76A2B SERENADENO11FORWINDSINE-FLATMAJOR,K375:IVAMINUETTO
143,621,000 *0DC7150CA4608A741095CC462A158CA703845BA4 SERENITY998
143,621,001 *0DC1964F5E12CA1A0C7792B1FF43B6417B7A5F0D SeriousFeelings
143,621,002 *0DC18B4BA9F9AF185EF641430111AEBF0432769D [email protected]
143,621,003 *0DC06427633957EECA47893F5BF4697FFC429654 seymourreineck
143,621,004 *0DCF7D4138A811C21CD050D7564B9AB2E50A1D2C YITNOTORO
143,621,005 *0DCC0B66F977950D26B2BF991734EE418867959F yllacirematem
143,621,006 *0DC296A291DB86582F33F56488939040E6FF43AF [email protected]
143,621,007 *0DC522C9BB6687D276B85A9CBA22CCE1BCA7D5B8 youscratchmyback,icrushyours.
143,621,008 *0DC349C6973D4FB04A9DF8C817B04D2F39C8ABB7 YROSNEPSUSED
143,621,009 *0DC06FF30604D6BBAD3BC9ADA00DF95D72F66C2D shawn310
143,621,010 *0DC7BCB6D5D073D25F0189DE2A0D0C1A13650B3C SHAYNEPRONDZINSKI
143,621,011 *0DCF9CB9D823BDEC395BAED38B1CA7332892EC41 SHEENAFTERGLOWAIR0
143,621,012 *0DCCF188F9140F7BDFE021E8A0E180B6EA940D54 yunzi.x.shalynne
143,621,013 *0DCB1F4E278C76CEF35F164B93D0A728A2CCBADC [email protected]
143,621,014 *0DCCC6869EA9F28BB851E46043E9840C6E9CDE33 Z0F.
143,621,015 *0DCA79B09EE62C3B6B4A005A43FA1EC1C7FADA86 [email protected]
143,621,016 *0DCD2CE6D437A5EE74EDC67E9038E7C03B939538 Z14715996300
143,621,017 *0DC7E5FE097773FEF0998519955DE9ED023A12C8 shirleyyouns
143,621,018 *0DCF2000FB9A7D80D1CB008716A90CF73B2CD222 ZACKARY.WORKS
143,621,019 *0DC14AFCFBA635FA3C77B536AE8367EB1A9E96AD zackgraff
143,621,020 *0DC35B8EB970194495110AF6B230BD63D49429F8 zadacksed
143,621,021 *0DC2B5EBE9AC9CBE6B9FB2326B0C63F04D9352B0 ZAEHLENBSW7
143,621,022 *0DCA4117B9C4EDAB5C6E6045657469A72FA9975B [email protected]
143,621,023 *0DC61E2E22D8CCB8FD15B911C82CDB2AFF39824D SIDNEY.ONEZNE
143,621,024 *0DC8C643B6D0FC599D72D0CFBCC4AE9AA4BB3EC8 ZAŚLEPIONY
143,621,025 *0DCC6AC63E4D55E5643CCC5DCC7D3B0F10293707 zeani111
143,621,026 *0DCDA69D283A9E51E6D34E4B7C5D8598B74711BC zee.lien
143,621,027 *0DC8AE6B9E9DDDF4511548A34CBDF65502C1BAF1 ZENTEPOLK
143,621,028 *0DC26DFCA6B96F1C03F3B82858640634F55F86CD zenuwtoevallen?
143,621,029 *0DC67127D693A84E6A75E028A26231D0B51D6E56 zhaoziwan
143,621,030 *0DC27302E1D3DE6C4CD915506CF5CEBCE8C55B85 [email protected]
143,621,031 *0DCC69B335AB8050CA7BF2D7B556777A47088792 SMAKELOOSHEID3
143,621,032 *0DCFDE5EC3C51E69B7E1E388375EFA32A00DAE0E [email protected]
143,621,033 *0DCD08B50B0857EE0210DCB405622D75B74270BA [email protected]
143,621,034 *0DCCAD849F4309AEABE67BC2A172E82D1928C63B [email protected]
143,621,035 *0DC90F9493BF183B64FF3F1D38825C5F7AFCFEC8 [email protected]
143,621,036 *0DC6C5DF662A599BC8726DFBE84371ED5096FE8B SOLOMON.HARTEAU
143,621,037 *0DC8A5182A4D5F6A703013B22639A5FC0FC9BC30 solvangieson
143,621,038 *0DCFC269CF8462C8122A78F94239DD1C3B16AF82 SOMON-NO-TAKI
143,621,039 *0DCC6CDDC2F69ABC453239BB993309D5421E801E ΦΡΆΓΚΙΚΩΝ
143,621,040 *0DCDF502D3EF2C9882754F75DCEA67DD011C36C2 „АКУМЫ“
143,621,041 *0DCE21543563197CB4A6659A6057390E5509C4D5 SPASSBIETER
143,621,042 *0DCE2EB8581779369E0439D081506C25A05E1FDE БОЦКИ
143,621,043 *0DC8318E25A8CF321C850A81C678C47535AFF339 БУЛЫШЕВУ
143,621,044 *0DCDFDA185C34AF37BF0711B42682C3D11D011C3 ДОЛОТОВИДНАЯ
143,621,045 *0DCA677373759BE94C00097CD4489BEF54F6764B splat!!-~`<==b
143,621,046 *0DC4A37E72F45875069CFC5BF749C74401EB4A75 splat!-`-q==B
143,621,047 *0DCE5B2B8E41D35F1EC77ED726B2B68F2826EBE8 [email protected]
143,621,048 *0DC2A68BB0DF70A4B0F68F4AF9850D36D689E5FE КУПОРОСНОЕ —
143,621,049 *0DC6CD98B62B7047B1A86F0C0214F327A18E13FC ЛЕВКС
143,621,050 *0DCF05A74916DA980509774357E65627B0FD3ED3 НЕПРЕЗЕНТАБЕЛЬНО
143,621,051 *0DC2A79415B5E3C6BCF8C635D49A82E6C7C31F1F sremac
143,621,052 *0DC4EA3B14589901F44EC95BE94B6C3E5C741533 паалом
143,621,053 *0DC235055DA2BD47EB9D323A18E4B1A97C762A50 помазання
143,621,054 *0DC18BC9D39B7DA7241A4B1DEA5E528BF1A47750 staceyzangari
143,621,055 *0DC3F7C0A7BCE71F10F737B6B79E62D38C0E56DC stefandelilli
143,621,056 *0DCD905169365333C182596F1E4AA4545A7F9836 ФИЛЬМ—ФИЛЬМ
143,621,057 *0DCA78DD0D8181A2355D4CA018FA9510A5623B89 stevenkwilosz
143,621,058 *0DC9DF47CD7611D3BBF2AA92FD8A41617F6EC3AF STEVENSMAN
143,621,059 *0DCAB83FBB729078C852595EE37C5D8C4870DD7F sunflower(michaeldekooker'sclassicalmix)
143,621,060 *0DC7D2FEEE6590F679F3ABB6894CA0C3D927BBB7 发售(发售公司:PROTOTYPE)
143,621,061 *0DCFDFC66AB5ED71CB8E750C12BC60ADD6F18F9E suwong
143,621,062 *0DCA42B7EF93B128263A32A95D30731257B31A32 svcdudes8
143,621,063 *0DCF8D3FA56A250508802BA601EBC2E58ECAC68A [email protected]
143,621,064 *0DC8E26F1B2A7D0FB2E55F62A0B1A8B20235FC0B systeam6
143,621,065 *0DC5003C0D61D548B43EE608C01B61E11D3C6736 t1v
143,621,066 *0DC382A798CD0309EA99561ED44CC2EDA4AC656E 楽曲中の1つ「GOT
143,621,067 *0DC16E6FF8FACE43C652A9934A54E9CE47B0222E TABOURNO2
143,621,068 *0DCCB169F3D815749996B516B0197E3C732C06C4 」、『長周新聞』no
143,621,069 *0DC7C5A9781A4506F54CE117FE1B7B1A0B83B3F3 TAMIBROTHERS
143,621,070 *0DC53CE655300DBA53456F45A29A0017C03DF769 [email protected]
143,621,071 *0DC1ACC3879E4F852ECCE9E292985CE4E91EA8D5 TARO720
143,621,072 *0DCF9E64A75AD979F66F74E780E2FC3EFFB3F0D6 、tbs)vtr出演
143,621,073 *0DC1606A922362A6A69A1EEBB0841654B31D821C TDEPLAO
143,621,074 *0DC87D1A6A9156CA77E53C237602508CF147E657 TEDJERDE
143,621,075 *0DC098D6D062B50E442ABE6E94A045A670CB6343 teodosijing
143,621,076 *0DCCB58C1E9817B57E08C174EC760712D37E1FB6 TERRY.HOLKA
143,621,077 *0DCD81E32005182B372A71FB5928246E76A5ADE1 030684A
143,621,078 *0DC66D612EA757E135E0F9604352268F17BBB15F thechris110
143,621,079 *0DC8092B950676053C2AF40751BFEB40F8F355D3 THE-END-OF-FEAR
143,621,080 *0DC135928AD0ACDBAB46F11F3D1BC3EEF41EDFFA THE MUSICAL SNUFF BOX OP. 32
143,621,081 *0DC5A51FDDD1C5F869CCF184A2729C77E23C26D8 the.planets,.op..32:.uranus,.the.magician
143,621,082 *0DCAC9EB4394B43F1765AED5E9AF1152F15B9B37 THEWIRETAPPER20
143,621,083 *0DC9D36D08E0CDB50B11917911FA148F9FA729BE thomabund
143,621,084 *0DC4953DEEBC5FB08CCFCDE1712B8B8453D46BBA TIMVALSIN
143,621,085 *0DCECFA7F1C28AD169AC995F5FC5FA07EABBD63B 1225881 koneen-osia-voi-korvata-,-ihmist
143,621,086 *0DC0F6A845673CF054A1046E82CC85AB0F06D754 1250794 KANSAINV
143,621,087 *0DC9747BEB041189FF0E621AF798F433C2B600D1 13021992BEA
143,621,088 *0DCC686BBD09306666BF8673775F02400BD733A4 TITUSMANTYLA
143,621,089 *0DCB7F4E838C60D2DFFF9788E9161B958CD052EF 136LEONARD
143,621,090 *0DC0B9DEE27FBD138A51BF322A7B22CB3156FC1A 1405709 fasismi ei toteutuisikaan syrj
143,621,091 *0DC6977DF2F300298A0A9DA23817355B85D01587 TNEMHCAH3
143,621,092 *0DCD82C7A51A3B970519C6D043FB02F3B4627643 14.MACHADO
143,621,093 *0DC4A6A272CE0A41800C32298FBC4F5FC7FB2B01 1502662 ".firmasuunnistuksella.".on.kuntoilun.lis
143,621,094 *0DCD7C6AC4BA4C6DE3E879D6A59A56B1F39142F4 1529737 ziel-seien-rund-40-milliarden-mark-
143,621,095 *0DC758EB65F9EC2CBB80AE0D5D9CDD815B3F63C4 1595942 A.FEW.HAD.SECOND.THOUGHTS..
143,621,096 *0DC513EF908C249E0CA58CB57EE33FF1C0B5637B TOEVALLIGS8
143,621,097 *0DC839956C98BB95D0FA92B38A4471BEF94D51F3 170784 tarjoilijalta vaaditaan my
143,621,098 *0DC9E8D1AFD8B6D2199C84BAEA2016D196E979F8 171460 tarkempi ajankohta my
143,621,099 *0DCA0EB72BA9FE68167052A9A1A6E6274659F0EE 17-STONES
143,621,100 *0DCAC2424A2DC22EE7F5BE32DFD484B3BF2E1D69 [email protected]
143,621,101 *0DC46B9DF8919D889B5332B8179BF0E8F5B8038D 19061611
143,621,102 *0DC57B620407B0E46D11D4F2D34DDC28E81F9CCF 1.A'CHOIRE
143,621,103 *0DC256E28EDA973BB767CDAAEA7F46F75D29D9BA 1 AMMATINVAIHTAJAT
143,621,104 *0DCD41261BC1FEECA7508983B6B38337B6E76B45 1ANTONSIEGLE
143,621,105 *0DC15957CF2421411BB0DEB7E1512C8DBAAC00CE TR0PHI3$
143,621,106 *0DC3749CFB3DB5570ADE60F3793821F912B61AD5 1aughng5tock5
143,621,107 *0DCCA6818ED16B94E436FC4C5F5D9B8158719323 1BAJOREK
143,621,108 *0DCED256433AA3424F9064928C37DA0BBC7E2FCB 1BARTTOAIRPORT
143,621,109 *0DCEB6A07903E34A4588B8C44006D3239F1CD637 1.BAYERNSORGENKINDER
143,621,110 *0DC1FAAA7A1CF7718CCE4EA32FBC805649608086 tradeorees
143,621,111 *0DCEFEBE702B400704128617CF9BC2F1861569A0 1BREITENSPORTKLASSE
143,621,112 *0DCAE4184E2A2C149E83A1C3A4C329CD571F0A88 1 DSCHADALLAH
143,621,113 *0DC2F007F48538BAAA1CBEDB14F3A14615DDD88F TRAVIS.R.PERSUN
143,621,114 *0DC54041E063F4904BE08D4B289779461E080451 TREVORFITZGERALD
143,621,115 *0DCCCBA1E5B69B5CA1378A65F3F043CC9EDB326C 1euro-flagge
143,621,116 *0DC431969920207F1AE5285AE5D73C26B207613E 1.fiebiger
143,621,117 *0DCBCFEF0827FFBB25039DD97CAA90BBC3D81282 tristanquann
143,621,118 *0DCBF394B97B02E2E21E9328D390DC40DAC10611 1HIGHLY-COVETABLE
143,621,119 *0DC517AD0F077DC69B741B9EC5FEAEBA209DAEF8 1 HISTORIIKKIESITYS
143,621,120 *0DCEC01A86E8486B0F2B673BBF5546C87305F76D 1huvipaikoilla
143,621,121 *0DC0CBD7650FEAC95E65383C345732387526234C TROWNITIIXIK
143,621,122 *0DC1FBF53DA69D900B506179A3D51CCBBFC494F3 1IAMROXY8
143,621,123 *0DC3FC961005EA3072B435CD6492E2A820645D33 TrytoSmileatLeastOnceaDay
143,621,124 *0DCAD1F8B29181270E3A5B224EC14B0DB4E7158D TT0103380
143,621,125 *0DCBA0F59839552024A4BEA8A30C2BDD6947D531 TT-L-T
143,621,126 *0DCB3A4A253588053566CD75ED0F87511040C90A tuang.geng.hui
143,621,127 *0DC272A7EA39CD549D7D30E17AA3CEDF2F20FF0F 1 KOULULAISVAIHTO
143,621,128 *0DC6E68B447D1D5E4DC54A8626CD1AF71FCD5A1D 1LAPAROTO
143,621,129 *0DCC0AC24FA5DDFBB7CA47A2682F16AD7810056F 1 LEHTORAATISTA
143,621,130 *0DC685C0E6CFCFF35186A1BD758282969229A6A8 [email protected]
143,621,131 *0DCAA8F5AB9B55A9416E007C4D1D6A571F99E6B9 TYRONEAILEY
143,621,132 *0DCC494E5BE6F3592EBA1E4DDA2D54524FFFA43A @1PH0NS1SM
143,621,133 *0DC89A0C1AFE9385A1C8BD372CA220FA27320B25 TYSON.KISCH
143,621,134 *0DCD55CADD6E1F80CE93921D9BF7B8D0F7D014B6 U1G`
143,621,135 *0DC0FE31F7ADD12C4CC26FA83296E3A1CDA808C8 u1tra50nc
143,621,136 *0DC08C8456B3A8469292385A7FEA79DBE6FF2487 1.rannikkoohjus
143,621,137 *0DC2428E1DE929C82C6DECD2F0B78FF86F4A49F1 UFRDS8X
143,621,138 *0DCCDDCC91EC02D2EA6DA665E9AD1F13AB593667 1.siniristilippu-romantiikkaa
143,621,139 *0DC8E2A7465509E787FF896449D19E677998F355 1.TEHT
143,621,140 *0DC83D3876F09ADE52315892CB60B5E7B1A6383A 1thatstrato
143,621,141 *0DC26E60403D8F08BB9D62F2EE96E20981169147 1.TUTKINTOTAVOITTEISESTI
143,621,142 *0DCB92B43988E629E7BABB8F9EC43111E3C29255 UMER (DIEANDERESEITEMIX)
143,621,143 *0DCFE6701794D354636FC7E25A5DDD1B8617273B UNBESPOKEN4
143,621,144 *0DC6D71F2FA0F0951FBAD1DDAF3597BB8B08F650 1』が発行)、毎回cd以外にも写真やメッセージカードなど、さまざまなおまけが添付された。
143,621,145 *0DCFD8DB45F69BE83E0CD7D1DEAEBE31A0E15191 20091411
143,621,146 *0DCBF63A31EDB83E921960932D30FCE54284900A 2031762 TARKKUUDENSUHTEENPIEKKARILLEP
143,621,147 *0DCC162B4FDD12F32C482A6F1DE032752215D3ED [email protected]
143,621,148 *0DCF720883761ACB05B46D4E35AD42ECE7206024 UNTESIAL6
143,621,149 *0DC0C69F514F2E55064B0146952ECC51C195EE92 uppers
143,621,150 *0DC2179250A02D78A91C0EDC2D9A828540E1F825 UPTRPĚLA
143,621,151 *0DCE541099B7A5B7534300693EED1637826EDD58 URNotLonely
143,621,152 *0DCAC527BFAB9D87AE8087D0A1B82C34BE5E7AF4 USED—BLOOD
143,621,153 *0DC57F28CD493F12894A14844E1F7475E5F3396C 21YearsAfter
143,621,154 *0DC6422CE4325A4C066996246AC943C4A5ADD28A usnach's
143,621,155 *0DC3245EEF64F7F66E94F41BDFADBF9D25340CF7 23MAY1305
143,621,156 *0DC56544880A8F72C0641610B45E33E979E23659 2528298 SUURIA.YHTEISTAPAAMISIA.ON.OLLUT.TUKHOLMASSA.1995.JA.K
143,621,157 *0DC16B096E44D84A1A3E848CB14D25BC785FDFB9 valerie-thevis
143,621,158 *0DC40A30888BB4AA6BC76C356907CAA4E08AB3C3 VALERIJAPURAN
143,621,159 *0DCF1D167EAB926E077D07724C8F90B0CCF00760 2685565 NEUES UM NEUN 2 FUER BADEN WUERTTEMBERG : 2030
143,621,160 *0DC9FE59A700258FB50E3BD37406AC2C48FA1553 2690667 that-is-where-they-think-their-best-interests-lie-
143,621,161 *0DC93F42533833A8E15B7842D8E1435B6D3E14E8 2761297 taustamuuttujina kyselyss
143,621,162 *0DC65D684A3724B06A985BCC3BD8B31E6BB9DD8D VAZZALUVADLAPATLA
143,621,163 *0DC107DE7888544E95B439EC032D5A79176A2D63 2ANIGHEID
143,621,164 *0DCF43575B8F5D9360295AD6EA4421A4B469085F vee-emm
143,621,165 *0DC8039C7AC89123A42FB62E6C898EADB982647B VENITA JURGENSEN
143,621,166 *0DC79A32830E4BB568818699D083A4539C28181D VENTEKJOLERS8
143,621,167 *0DC85817D4916773D35693AC62B5483A7D9282FF 2GEBURTSGRUSS
143,621,168 *0DC5758EB9A25085C08D1E7F6140658CCB845D44 VERONICA.AMETAME
143,621,169 *0DC6E3B3AFD85301D50D12451004EF777587707B VERZEKERDE5
143,621,170 *0DC39510303DBA65DB2C69DB8E3DDB130884631C 2-GITMEMESINE
143,621,171 *0DC813CEDF9F0FD438893D7F897301DE5E1DFCBC 2hyv
143,621,172 *0DC7CED92C0EFEE1F708A4B03BE7597FF3E80914 VICENTE.DESALLE
143,621,173 *0DCB9296A478AF7C6F5FA5B159102AFE9349C16A 2JAKOBSMANTEL
143,621,174 *0DC4546FB881B9208ABF170D371EA45E85A3893E 2-kirjoitusnopeus
143,621,175 *0DC0A6DCD2F3ECD75F1DCBD9E839F67D0797048D VICKY-NOWLIN
143,621,176 *0DCBBF308947DDD5AB485E014ABFF7F8DFFFF3E8 パート2(part
143,621,177 *0DC935673EE3404FDF2A031CB6E80D15138DD061 2REDRONS
143,621,178 *0DCF32BE59DA9D4969D0BAA6ABBFE4406B7FCE72 2 SELVITT
143,621,179 *0DC99011B5D8CCABFE15CCE8EAFF010950D5C7F1 [email protected]
143,621,180 *0DC808777470A02130B1738B4AAC9AAD41268A5B VIETERAI4
143,621,181 *0DC8E44783DAEAA9C74F844840BE1DE87E99DBC7 2thermaic
143,621,182 *0DC696EBA18AD067B66A3E64BDDF30709CD34FD2 VINSTEPULA
143,621,183 *0DCDE88D1C2619188F8B99359F743EB4529E4F56 2-ZEITREVUE-PROGRAMM
143,621,184 *0DCEF384510D17EEE2C04476C66A153B9AAE5AE4 [email protected]~0~o}X{
143,621,185 *0DCD742302C41A30940535C0D26EF19555E9D00C VISTERETES7
143,621,186 *0DCF3B80FECF3E94E65AB95C38EFDC719465BC5F vitoeisentrout
143,621,187 *0DC00B21F0211937C8BF74CF0156CC1E5D14B745 343079 no:15yenibosna/ist
143,621,188 *0DC9D6EB2E46479212C9DA84C04AEDD14AABB936 VLADAN-COHADZIC
143,621,189 *0DCE5C7EAEC9E359584D15CC7894A81EE40A88D4 VLIEGNDE
143,621,190 *0DCFC1AE0C467288832B4DB783A4045377247686 [email protected]
143,621,191 *0DC1345E60B5F8D7608822B5055DFA2A1E3E6052 VOLTANTSESING
143,621,192 *0DC522F487177A64551E1F5F403C5AFA63FB9A68 V*QM
143,621,193 *0DC8746BA7BEAAEBBACC0FE547EFA089CFC760A5 vrz`
143,621,194 *0DCE659633C5C0B01AE36ADD1D901A504B2FED99 3DREJERI
143,621,195 *0DC6B70B6C610B2AC1080D5EB6FDE0E62362CA4C W0R$H1PP3D
143,621,196 *0DCFF1BB9E1A4FF2EB98C79E581A348B08C7722F 3.nikotinfreie
143,621,197 *0DC93EA77218CA85BCC0F4C74DF66F6ABEE4369C w4ggere$
143,621,198 *0DC0EA8DBA484EF66B898A396E9CF3E5B69A0E82 [email protected]
143,621,199 *0DC2372E4EB284CB51CCCB4E3CC21F0CD5DFB4A8 3-----)~oSplat!!
143,621,200 *0DCAE865B4864032146E25FE72737CD7358749B1 W9+V
143,621,201 *0DCE3002087D88E451D930EE76E5F2148010DA60 3--P ~ ~ ~}8{
143,621,202 *0DCD09D77E06F9F20DEF192CEF28F246DFB78DE5 3##p `~ `~splat
143,621,203 *0DC3F43C4B1D77AAAA568653FB6C24CA7332903E WALAA.ELKASHEF
143,621,204 *0DC76ABBFFE92BF4D5E76DC14C6480FECF1910C8 waldogarrington
143,621,205 *0DCE2FEAFE0E921DF4E1AC646AE96A7CF798A90E WALLY.SKERRETT
143,621,206 *0DC93CF4DF9D0515FA47D18D7A68AB9C1C9857BF [email protected]
143,621,207 *0DC3E9E1C023B871ACAA24AC0DFA95C81A049906 41TIARA
143,621,208 *0DC4134BC67B005F1B905A63FFD3C45B241592C8 498589 kunviljelysteidenrakentamisestap
143,621,209 *0DC3681EDAA434090BE5DD0859E9868A75EED1BE wayan.muditha.jimbaran
143,621,210 *0DC0ED5770F477E175907C487A13F899F312C9F7 4EMAHKLAW
143,621,211 *0DC7F4A43E726A366AA3C4722D692DFBF6774474 4GULDENSBAZAARS
143,621,212 *0DCA3F310B6FE00AB8840B9F3AB336EF8C77B4EB [email protected]
143,621,213 *0DC464B0338DEC471160AB854DC8D7F1137C90C6 [email protected]
143,621,214 *0DC9FDCBD2E055B71B26D62AD3175AFF3FB00D78 4JOEYWESTERN
143,621,215 *0DCD5ACD8F63B7C81C24FF36DF7895C290843D95 WESTONCP
143,621,216 *0DC9A64D26BAB96FCD43A467F3A91B4C9808DB9B 4KOPLUIS
143,621,217 *0DC4A7D84EF70954A664573750E31C8949C2B420 4MARINOAPOLLO
143,621,218 *0DCF1FA92EF50D380917D4085314BA2B0F244628 4MYCHANGEME5
143,621,219 *0DC0AFB9096692CEA6DF3A1CCFEDC1F50B440571 4N7!D!S3S748L!SHM3N74R!4N!SM
143,621,220 *0DC6ECF37550A4C4E9B09ABD4396B2069389AB9C 4NAATIKNA
143,621,221 *0DC71FBA6B02E63DB719567412FFE8257BD55EE5 WHEREDOWEGOFROMHERE(FEAT.NAS)
143,621,222 *0DC6DB5FD2ABEE9EC2902E3319C28736C4B79229 whi+ecap5
143,621,223 *0DC67F60FB8C79C79ABF0B77FEE84E2BFD5DDDA3 WHISTLERISM5
143,621,224 *0DC2D08ECABC83CC2C02BE5DBC2AF6AA104F1CCE WILBER.FEDORCHAK
143,621,225 *0DC7F2344EA71C7CE2D68DACD7DE5DB811385110 [email protected]
143,621,226 *0DC2EA21D5E4A85210B92E9A3BF08B2396B6CBEF WILLARDSPADAFORE
143,621,227 *0DC2CE6792E65131473010C5A0CBA04208F8819E 587899 klaus-rannan-mukaan-jonotusnormi-ei-toteudu-;-nuoret-eiv
143,621,228 *0DCE1B159B2B6CBF3B29794CC7794B4C70FEEBC8 5AIRHEADNONE
143,621,229 *0DC1877FEDA694F2159C347B6FB8AE867F174A35 WINFORD.MINFORD
143,621,230 *0DC176A968CBBA99F5C9AF2C14D1D1E470A3B665 5AUSTISCH
143,621,231 *0DC98602F768AF3933DB3B8CCC573800B0F31C27 wittrm
143,621,232 *0DCEC8F290CBEA4C86908A0E4882ED37E22B9524 wmmilnik
143,621,233 *0DCECAE29314EA909EA63940BF1323C67C71B302 @+w^n
143,621,234 *0DC6B6ADB03DC4158629F22B27C6D8DC7811A9C8 WOCN
143,621,235 *0DC3C8D7A236A299AE38A14E424C63FD74379118 WONG-SHIU-KI
143,621,236 *0DCF379C183888AFCAFB51C61D4475F817297591 WOOZ-CHANG
143,621,237 *0DC1BF889120A35C9043F41BB97B1679E6E64F41 wo[email protected]
143,621,238 *0DCDA06B023C1C72A5F2AD783306600CE24D21DD 5CROILIGHTEACH
143,621,239 *0DCBDD275F1C516C49E928A18BD7CFB68E935EE0 WRITHED
143,621,240 *0DCDA3ED71BFD4A401DAACB2DAD7F1FCE913AAB1 5GISTOPLOSSING
143,621,241 *0DCA9A0546CE9B08A33A05B5FF6EB32751EFCDD3 5 HARJOITUSTUNNIN
143,621,242 *0DC25274508A4C0BAA5DCE78C8D60F9506CCB09F 5LEUMUND
143,621,243 *0DC416AC595D48ADDD27661DE3938E403FFC0BFA wwweryoubarristerscom
143,621,244 *0DC0682B721325D03B4B37E5CA5D80728FA50249 5MEXICOSMILEY
143,621,245 *0DC9CFD1EF35C30B1B119C71491EB7CC24135793 5ORETERCN
143,621,246 *0DC5E6106C4C3644C1E7A6B54E9D75F6BB6EF011 5.PALKANMAKSUKERRAN
143,621,247 *0DCEB1A597CF57CE9CF78E2F34C6F215E3CCC5AB 5PJFLESH
143,621,248 *0DC254EFAA3CF3C68D205BF03DFC360100B5A6B2 5SARPELERS
143,621,249 *0DC9309E9091C10D6F870D0C114E61CAF84AD620 X.509STANDARD.
143,621,250 *0DC30F68659FA09FFAED1909992ECB6CB4775371 XERXES-ROMAN
143,621,251 *0DC27CCDFB5F84B50A3AB6F22186A7B332DDC136 xgh(
143,621,252 *0DC6BFC9C4718E7477834B369A05BE070BC7E491 5TRASPIRATI
143,621,253 *0DC9016ACE8A00A0192FFE00A7880AC621CFB377 5UNCARDINALLY
143,621,254 *0DC14672EE19F23D771D7B9BBFDA868783C3BC85 [email protected]
143,621,255 *0DC7E01C2939B3774D31EEE7198ACD41734CE63B 600EDDIE
143,621,256 *0DCE51D643FE5A126C239E46608924DF772961EF 624JONATHAN
143,621,257 *0DC1918BA7DF40C7302BED8DDC06AF74D30DEBFF 632753 T
143,621,258 *0DC85AF25A24ED8F80066DF2556D2D9BDE3CD723 [email protected]
143,621,259 *0DC8863AFFC895F06B942E8E6DBCEFCBB261EFA3 6bass-baritone
143,621,260 *0DC17389307BAB41653F2847C099CC2846781207 yasmin-meer
143,621,261 *0DC1BC59BA63FF859C2C05182F2C655CB7ACC79E [email protected]
143,621,262 *0DC306990C0A9AA81934E1397A9B36C78A3AFFE1 6BSWYEGBSW
143,621,263 *0DC4FD42E5EC4DB6EFA4B4F8B597809CCDC6BC3E YEARS3005
143,621,264 *0DC7FDB908A8681E956FF3ADA49E8EB3591D3750 6DIEPOLDER
143,621,265 *0DCCC83E12543446268264A9EDA3BAE8FFE8D132 [email protected]
143,621,266 *0DCE45CC07C867689A1112F746266497CAFC9728 yllacirematem
143,621,267 *0DC296A291DB86582F33F56488939040E6FF43AF YOSUKENOZAKI
143,621,268 *0DCFF9EEB5306F21A405D5BBD89BB5BC6ED2C3D6 YOUCAN'TGETOFFWITHYOURSHOESON
143,621,269 *0DC97BEC5BFCC3DD90D8EF486FBBFF276B557A72 6JUDITHSHIT
143,621,270 *0DC17B60BA2D6BF6BE2155DFAF5594A00B51A122 6LASKUJENSA
143,621,271 *0DCB67BB8BD5DCFB01BA73D2EC70E00289FA800B 6LEODAGAN
143,621,272 *0DCF06D6B20F97882E7B95D87E6AB8C53C81425D YVONNE-RAKLIOS-ATCHLEY
143,621,273 *0DC4027BB1252EBBD7AE52F95B03B33C6E016503 ZACHARYPASCULLI
143,621,274 *0DCE40D1AAE10C0201CAB2AB37B880ED2BB811A5 6PROTELPEPPER
143,621,275 *0DC0FD79BDA8C962F1FE0598119D62303DCB9435 6quotingly
143,621,276 *0DCADEE20BEBE6A019913CACF73C41154F26094B 6RABBITJOE
143,621,277 *0DC93E8E9BEBABA1520E8DBA3FBF83F8D5A5EBC7 ZAQUARIG
143,621,278 *0DC044DD0F276F22E154E9EFE365D01A36E88777 zaria854
143,621,279 *0DCDF466B222ED74AD8D5CDD8A86067BA01EC23E ZEEVADAVEED
143,621,280 *0DC9CD43A48F9B05B8262EF2BA610AFA202D6B2A [email protected]
143,621,281 *0DCE55D021E1282A64796414B2B583F158659325 6TORONTOGARFIELD
143,621,282 *0DC4F26E2962A59261864164872ABED856CFC300 [email protected]
143,621,283 *0DCB64CADAF3BE9D9E1E3ABCAD9A0510BCD10D56 [email protected]
143,621,284 *0DCC1F6BFE88BF7949DAE103F2FBBB774766FB00 [email protected]
143,621,285 *0DC971E784CEC1FDD88145D93C76982E57FB98A3 [email protected]
143,621,286 *0DCE17A574A8C461FAEDF20FDCD94675A0CFE95E [email protected]
143,621,287 *0DCF4D8BBF7C026DC5E6C8D2E91B638D7F9E6A40 6TUTETOUT
143,621,288 *0DC3EF3B199D78E10A38E5C6EBA8CA8CE57B17B2 6WEIRDOBORDERLINE
143,621,289 *0DC56989A2CFC12D0A5E374348C05F23B4FC1B97 713BRENT
143,621,290 *0DCDBC82F03A5EA513AD2A07372F1A4FAE20D377 zoosporangiophore!
143,621,291 *0DC24FFDE6069008371686B76ADDDF877EBBEBE1 ZOXFORD7
143,621,292 *0DC5D22ABD7044C57B9ECF4F7F53C71ADFEF2354 7ANALLEHC
143,621,293 *0DCDE0090B0A70836DE61415187C7F95CC1211E1 7APINCEOPHALISM
143,621,294 *0DCA5F2FBACA9F2A0DB257FF8C3CD4C321B7B4DE АЛЬТКОМБА
143,621,295 *0DCEA19EEDB426DF3C5668FEE76A187631733407 БРАКМАНА
143,621,296 *0DC80499ECA33D4CFE23BDE1C0EA3B0E1C4D8F21 брытанікай
143,621,297 *0DC8581E0C6A66CE4A4FB10E6E794E91536F282B 7ERAL
143,621,298 *0DCF2C60EA4F11D7E51D923A9A9559CE61163C29 7esitt
143,621,299 *0DCCE62A5FEA3B833405035EF5D57F986FAC7D3E 7 georgpinglerstr
143,621,300 *0DC20160ADF919E204F789901A4079E580AC5CF3 ИРЯАН
143,621,301 *0DCF5A004726883AA5A27662637D1214B3F7C6F9 конечная —
143,621,302 *0DC1895CE7B6E07112DCE25A55A2B085BC9CAD54 контроверзно
143,621,303 *0DC25292E82558E74ADCEB49C1094FF833C41AF4 КУПЕСОВ
143,621,304 *0DC74795B75851B9AAE2F37862E97513C1E698A7 магнитого́рский
143,621,305 *0DC22782F59935F07D425DA7B1D7245A3F8D634E НЕЗЛАМНИЙ
143,621,306 *0DC61D8B1E4E0092EA9D6ED7C1824316D2391F53 пертельсон
143,621,307 *0DCED4DBB8FCCACB465E5EA2F9544FF9F2E9A12A 7PYEMMFPLHIPQ
143,621,308 *0DCA8F64B9A1E07A7110AAA8802B0C791749238C 7RASYONEL
143,621,309 *0DC9F3A048F28E3A683C4DE4704A7C1240E2AD12 7RELLOVTC
143,621,310 *0DC1BD14156E2E5C90D0D86DF43D077F5990BF15 7TADORNOIDES
143,621,311 *0DC1108B5C7F8F7602A73DF03F716DA1EECD6F17 7THEPEPPER4
143,621,312 *0DC99A982CF568D6137521786ECDACA2D41DDE48 808ALONSO
143,621,313 *0DCBC33A369C75A51C475EF79D501163F3905F34 826313 bei-der-abstimmung-war-der-fraktionszwang-aufgehoben-.
143,621,314 *0DC790C885BC8E4ADD668C254A763F1F0ECE3A20 原文:OF
143,621,315 *0DC368E8C2BA336E3ACBBC604C530D8EFFBFB517 8BSWMWIDTHCALBSW
143,621,316 *0DCDE26B1DC42D51209223D2B248EA2A63B8A660 8.dtbsprecher
143,621,317 *0DCCD481BD2754A2BC2EEBC279653BE3D6145B62 [email protected]
143,621,318 *0DC0D2798140AB04676033EF8A4BEEF30C88FF47 8EATMEBUBBA
143,621,319 *0DCF2715A149559ABABBF501265716EE675BEFF7 8ILUVBLINK1822
143,621,320 *0DCD2655949636DD9F209B7350C61EBFF987D0AC 8JOLSONS
143,621,321 *0DCCE13392BAB29F28C4325FD812A7189B67EB31 放映のため)。オープニング及び気象情報の際に流れるcgはなし。
143,621,322 *0DC25A1E5A3AFA625D84790698ADC5BB1E1EB72D 8NTNINGSPROFILEN
143,621,323 *0DC29F8A15C3DB3963520078C3334A85E92A81F7 日産ディーゼルDA50T
143,621,324 *0DC0E496F397809CCAE325ABC7CE63EC302EA557 8####P~ `{X}
143,621,325 *0DCBEAF2078A91D43454EB9A4D83502307A23568 8WILOPEBQPOVAF
143,621,326 *0DCA8B2EED3A2C1AA7C7AA37766D9F4088E27F5A 製作:armadillo
143,621,327 *0DC93CF9FBA562B3135EEA23A542437795A4EE08 95527 bilgi kaynagina baska talipli yok ise 2 kez uzatilabilir .
143,621,328 *0DCDAB4C2ED5FCD0C81DB91E4E4106CDF782A02D 99SUMMER
143,621,329 *0DC8B7CC7D08256C3808D616DB5F5828E2D073AF 9AANZETST
143,621,330 *0DC63947B915F8FBD55DE7EAF5552BED24A4FCE3 9BSWABARTABSW
143,621,331 *0DC638DC4D6BCDF8B1E0E6012CA0A5BAB5851496 9BSWCFBFFBSW
143,621,332 *0DC2B5C53FF1B9B02366B84DAE631986922F36F2 9DETOLVE
143,621,333 *0DC1EA501731C31BBA06B36886BBE2187304A858 9DICODID
143,621,334 *0DC084519B25A2521AA068F0058C818B45715A68 9ilovefred5
143,621,335 *0DC2EE18304B3210B7B24830320C1536CA57BB22 9MISPROSENTTI
143,621,336 *0DC3E9030E66A3BDDA7E0B62EDC68A8DE4A15327 06.11.1324
143,621,337 *0DC813E7C61295A687564AECB39D70E10EECD5D2 0+B
143,621,338 *0DC95B9BC692F8F35120C372DD695AF6BF3BF739 (>_0)~~~d--B
143,621,339 *0DC81EA7C2E0FFF98B594DB7B09F5C67B0D14B89 0ILUVMANTRA4
143,621,340 *0DCE5B4701F51C04D27163FA6E529520CA9B6617 100swastikas
143,621,341 *0DC7EFD799A2CA3ED34E23E91CB3C93C745A8438 101jimmy
143,621,342 *0DC6DD3522D4AF2C0DC076AB8C72A09A172F28A3 a?3a0
143,621,343 *0DC3672BC07F055704728EEB5E9F3BA5F9F02BF2 A+7$
143,621,344 *0DCCE8DCCBDEC7814F92DC50BE4106EB88DDBCF5 1169973 totta on , ett
143,621,345 *0DC2A13417D07F3B3EC35B4832F2810F46734E99 11.konfigurationen
143,621,346 *0DC5FCEBF40099EFB80B2EB5BD89B54DBEFEBC86 11 M
143,621,347 *0DCE3DE9EFBE63A275B6215DF8F87A3DC48CB07D a9ty.
143,621,348 *0DC7BD5893AFEDF96918E33B6B302A31E3CE4D2A a/9)z
143,621,349 *0DC28A5F2A54BBCAC9AD2C2336A393471DA34099 12:12#&recall
143,621,350 *0DC349AE7CDB568B8A5BEBC6C8CC2CAFDE0D2A33 1243989 KIRJASIS
143,621,351 *0DC4D924719ECAB1F02C58C2F53D7CC73EF0FB6B Кэкстон
143,621,352 *0DC14BEB07532B24F3C0E7535609DE09B828F24D AAA{C
143,621,353 *0DC7A1AC1CCAF58C7560336D628ED52BC8410014 AAA:*D
143,621,354 *0DCE3685897A1062EAB2F498B6A855CAED52CF19 aabwk7
143,621,355 *0DCBFC83E8551CC60CC66D99D4C7FAB5D287D6D9 AAC]M
143,621,356 *0DC87FBFE51463A73949782FA831A296E45952BE aacpcf
143,621,357 *0DC16B5A2D1196B1DB9A968ADC3B20D2E9776606 AACP.Z
143,621,358 *0DC61D0646BD855B769EEAAAF735B96B8BA54D08 1536488 H
143,621,359 *0DC90CB0D5DAE1C87E9517F12883B1AB9F025A15 1538101 SIE-WAR-EIN-ROLLENMODELL-
143,621,360 *0DCA0642BC4EA0AE52F34CE07498EDC455A23A4D AALOKAYA6
143,621,361 *0DC0B7CC410655B1B1DB04622D3AA6F7F005E3F3 aarprood5
143,621,362 *0DC3DE7E248695B3A929FB79035A2BFC608AE68B 1659683 ms...white.kisses.a.little.girl.who.brings.her.a.rose..
143,621,363 *0DCEE7FB02BEA940FACF1468152E9C5C8CE11997 AB3H
143,621,364 *0DC2117CCFC7EB494CB630CD0756CD20BBFE0020 AB8FL
143,621,365 *0DC39993CFA64049C500E070A1B2BF4F60AC0345 AB9T;
143,621,366 *0DC2281982AA283F157653683CE8319D06D9B108 ABBELLIROS5
143,621,367 *0DC3670D9EBB63C6EB88515EB9A104F334A86F6E 16 LITAUERIN
143,621,368 *0DCC6AE11C89395541EC86BEBF3C60C2BED5677D ABGN#
143,621,369 *0DC717B2DF5A992BCD248BFA22DDBB0B06B0E749 a-boy-was-born:-variation-v:-in-the-bleak-mid-winter
143,621,370 *0DCB9965F883848DC4614399C52C85E5F59246BD abrB
143,621,371 *0DC45DB65D34FE7FDAAC56F01BCE972CA937A668 a.bs
143,621,372 *0DC69A90BF30817F01C3B5DF5A0BFA62862E6E55 ABUSE.FILTER.WARNING
143,621,373 *0DC93AC75B47274509EBCF757A910091D879A368 ABVERDIENENDERING
143,621,374 *0DC605C2FDE8A2B37E1D359B8EFBC6D287DED071 AbVS
143,621,375 *0DCC5ADFDB386804A0AD74E93DA8F823578BFED3 ACCORDINGTOTHECONTRACT9
143,621,376 *0DC234BA7BC1112FD436C31B77ADD913B2B4A832 A:ct
143,621,377 *0DC9BE8593D6820FAB1113707DB6F8E67EC5DBE9 19051276
143,621,378 *0DC04DC94EB0891601BDD9DF7F6E077E1C5F7AE3 ADAM.LETT
143,621,379 *0DCA31B3DF6623996C1D7D8557F13FABAD1A9B75 A_DCK
143,621,380 *0DCD3F6788210ED63DFE445BB7D2AB89C7468390 1AIHEUTTAMAASI
143,621,381 *0DCA61FF211928D97C061D21FDA49F8186DAF573 1ANALZIM
143,621,382 *0DCE6B4B9697CE89885597B46ECFE832F13064B8 1-BABY-STANDER
143,621,383 *0DC4A544E63659EC93BE53070E39DA6C0C45BB57 ADELEHOBSON
143,621,384 *0DCCECD406E540ECD9DB569DADD7EFF11D36C3E6 1 buzzsawlike
143,621,385 *0DCAE9BBFE192A0564830808BA254820DD7DFD63 1chairliftmate
143,621,386 *0DCC76C77DBC7792ECBC43C11322CACD4519309F ADITYANANI
143,621,387 *0DCF8D73EE119CDA86338BC168E31400AAB59604 1COMMARA
143,621,388 *0DCD70F85DC3D31EFE5DDF7AF369D1706B931164 ADU{X
143,621,389 *0DCEDFC8A31D2FFFC2CBBA84B4D272FF35CC299E ADY-LUPU
143,621,390 *0DCCA5CF6A250F53A5F11DF08690D1E54ECAB370 1-EQUALS-AS
143,621,391 *0DCF762F8B28901CD4B3C7EE78C162FE7E675FF8 1.ER
143,621,392 *0DC4A9F5A4F78C68EB413B9728FF94129B137769 ae4en
143,621,393 *0DC06E69D9C25B6440AF7C6CB5FDDD2D93CBA31E 1-ex-u-boot-kapitaen
143,621,394 *0DC653B9C40FA41D2497B3F7C3500CCEE084E3F2 AEMPETY
143,621,395 *0DCD50848431627E973E1A4D747094BB39F5B9F8 1GEENINMONISTUSMENETELM
143,621,396 *0DCC35F0FFE4713D1D7C6B39834C5240E2B10431 [email protected]
143,621,397 *0DCD159302F13AA5F6A55CCF71FF35A3BC7BC68E 1HERHJEM
143,621,398 *0DC2CA02C4D1362CF2B100B9D135DD8C60B56957 AFCHAUS
143,621,399 *0DC506223C03EC84615025A7FDCA289AF7352C7A 1.iSletmeciliGi'ni
143,621,400 *0DC438FFA33918E19E17422F0D814E412B2A85B0 1.KEINUTTAEN
143,621,401 *0DCBA2797853F1012A33B11BA2E7B08A55BF9EFA 1KESSLAK
143,621,402 *0DCCAD1031C8C374B2413CE97E722F410EA595F5 AF%t
143,621,403 *0DCFB18A8015E894D6958487ADCBDB274F815AA7 agat8
143,621,404 *0DCE183D722EC1412328E004DA92413EA8499E63 1ND1$CR1M1N4TENE$$
143,621,405 *0DC91EE897EB0909B726DEA74CEE4DBB2490A260 1NEIDONKENKI
143,621,406 *0DC70E043B6F6FC802E8C0E287EBD564DF0969F2 1NELHRTS
143,621,407 *0DC267D0ACAFCFC42086789B58FCB92413908162 1neonazikameraden
143,621,408 *0DCEC3FB1063F61C851221DDC608875A5054F3E8 1olansudur
143,621,409 *0DCE2D342365121997868293D607065F9AEA084B 1-PANKKITOIMIHENKIL
143,621,410 *0DC3D9E5AB3FF861117A2EB61C97AE32227DDAB7 1.PCNS
143,621,411 *0DC51251FF268679C2F4A1008D8E10DAF0A21B54 1.philosophieund
143,621,412 *0DC0BCCD9567F63D51257C732C77ABE1DD78E4DC 1 polkupy
143,621,413 *0DC1A066481CC7EC84AF08D966D728AA7F6B378C 1-position
143,621,414 *0DCAEABD61C2A5F90097E6D432A569F90C85E1FF AGUSTIN.SALLY
143,621,415 *0DC94A704B3D9B15EFD4208175F84A3F7F9CFFBF ah&&.
143,621,416 *0DCC6AA13D3C15FE43FE37827CE7631FC4859EAC AH4=2
143,621,417 *0DC9C22EEB4A74DB71195E04C206E088BCF862A5 ah?d)
143,621,418 *0DCDC1CDC5F744005303DA90CF2082024E938F12 1 POSTMARXISTEN
143,621,419 *0DCC99C0D89A60F2EEEC2DBB8C933F34F207CEAF AH!GO
143,621,420 *0DC8D776A59852D4E1FAE1E20A8300C4F5FADEF6 <ahref="#hdr144348">144recommendation</a>
143,621,421 *0DC9846CA91AF57173358BF731E2502E8C61182C 1riedherabfallendes
143,621,422 *0DCDD713D0859FF66227D2B7327062D8933FB540 ai8f
143,621,423 *0DCD922D5E53665834DC6A26FEE237E3EE78A574 1-SABATINIS
143,621,424 *0DC5DBB254347F6412F1D2DA18E15FBFB48D056B 1SCHMORBRAND
143,621,425 *0DC706CE70919604338A88F1B5A26AA5CE058151 Ai:K
143,621,426 *0DC242C81D14F6229CC20E72515C09FD8147339C 1SITWELLS-OSBERT
143,621,427 *0DC91B8D3F119CD267F2DF6521F24E3C2B5DD229 1.stateciting
143,621,428 *0DCBD976E67A0B531E1C03DEB90B2514EF71E5DD 1swag-hoarding
143,621,429 *0DC41683DBCB6AFE0894F4BE4C2E7D11DFA72250 1.TECHNIKGESCHICHTE-FONDS
143,621,430 *0DC4539DB14319A68F8DDC4B2DBAF71FC6B7C95B 1.TEHT
143,621,431 *0DC83D3876F09ADE52315892CB60B5E7B1A6383A AJLS
143,621,432 *0DC1060EFD79E1500AA9B57A9EE378B79C3498CD AJOUTERIEZ5
143,621,433 *0DCC7513C66A66931BB0C81D716E4B7E4615C428 a%jv
143,621,434 *0DC57DDE103A57B17649082677B0BAE64019A5F5 A&,KH
143,621,435 *0DCF6B0044911E21BF8D29F665D83E9FB1E358F0 1-weisswurt
143,621,436 *0DC6051CAADB06BBAB73B2665C6831A91776E5C2 1.wouid
143,621,437 *0DCA22068C7424066611036CC134B160891533DD 20011209:.MAXWELL'S,.HOBOKEN,.NJ,.USA
143,621,438 *0DCB6A698B8C77123B0484B223DC88F3FBB0034B ALEI
143,621,439 *0DCCFA1C08AD878820ACE7256E02C8416F001B4B 20KELDYCH
143,621,440 *0DCB0FF7B4DCA935F5A98F99941567A6CC9F723E ALONSOMELICK
143,621,441 *0DC54FD2A4A15CC4F8AB96023B1065D9B9BC661C alonzohoschander
143,621,442 *0DC72C80E4BBD225255456BADCA5D4E5025DA73C alonzoolma
143,621,443 *0DCE82D4AD35B4A8A8723ADE6AB3CAC9926AFD95 ALPHABE0
143,621,444 *0DC77D183A85A3E072CCDD8F533FEB873876EE51 al(%q
143,621,445 *0DCEF8A0255D86D1B37CFB1FF8B18C742DC382D8 ALUMRA
143,621,446 *0DCDB3E7AE96C378657B57D327D1176EB203F855 amamijok2
143,621,447 *0DC195F6EB72CDE945BEC7EDABD0EA83D2D5087D 23021068
143,621,448 *0DC9DDC38357E93E66402DCFABF6C2BEA6333820 amazing-(thin-white-duke-remix)
143,621,449 *0DCFA0CAADAE0E65CF1DFBF2A504CDDFFE564F74 2412382 dieolfaktorischeerinnerungspielteinegrosserolle.
143,621,450 *0DC896FD4C996CD7EC48B15C572FB0EC72A2FCE0 2477 ecevit hukumeti ekonomiyi felc etti .
143,621,451 *0DCEE559FD89941D7616815B0125A887989DBC26 AMELICO
143,621,452 *0DCDF8F0927F0BE46780E94AE766DD7C3A86BB82 AM$HF
143,621,453 *0DCC7EEB720B7456737AECBE5C0F80FD46A9C858 2514179 NYT.EL
143,621,454 *0DC04BB279E994EBAB982457E82D0CCE729F7C48 251B87D701BB0B9586F3BCCC3341A7A8AJ33
143,621,455 *0DC8035B59769A65CCF8AF17037762582A448CCA amor.de.conuco
143,621,456 *0DCBE1F33CE1CF12639E63F92D7E210953F7A91C 259990 but-the-value-of-the-company-deteriorated-
143,621,457 *0DC1EE949A1CF881114F845F1554E7F68F8DF822 AMPLIFICATIONI
143,621,458 *0DC08787CF7D59B643705EA87AFA9DF612CFB07E [email protected]
143,621,459 *0DCB91EFC34DF7C42E1FF8186130362A65E53866 ana3r0b!cally
143,621,460 *0DC437281734D4E7DB3B2E044E6CAA3F4D900751 ANDERSONSIXON
143,621,461 *0DC88D5F7D8D3A162919AE453D62CC824B4330AF ANDI.MCCARREL
143,621,462 *0DC6A8F24787FAE773E2540B315D64CD64A413ED andycato
143,621,463 *0DC5139206BF096CD5AD8EB9BBA330B90965739B 2638652 PERHEEN LAPSET JOHANNA JA MATILDA K
143,621,464 *0DCA0B6B4BD13DF5B2E9820D6FD05B44E1E6B901 Anibe-1
143,621,465 *0DC19B929115CCB8BE5496A81200E400667C0F9A 2700853 helsingin-yliopiston-l
143,621,466 *0DCD7642E9551CA09D9C65FC818FCEF2C7102892 27121253
143,621,467 *0DC6EA00B3986DD719F8AB6B55ACD6ABCE4D7EAA 27AUGUST1355
143,621,468 *0DC60D79D719D76E3779A9D3A148E522D3D926E1 2801336 DIE.AMPEL-ANORDNUNGEN.WURDEN.AUFGEHOBEN..
143,621,469 *0DC250DBEF0C21F72D29F2373709B140D9E9B289 AnQB
143,621,470 *0DC9A6DCB45B7062977DC2D033F87C36BC635073 AN+QQ
143,621,471 *0DCD5E31963E3CFB09F737BAC7A5EF8A174900AB ANSCHLUßSTRAßE
143,621,472 *0DC3E06D5AADFF5E1D00AADD44320461DA717CCE 2873494 monet meist
143,621,473 *0DCF9C9742AD1310D1D01D83C8D47B862267323E ANTONEMOUNTJOY
143,621,474 *0DC0AF9BFAD79B3ED5680045EBEAFE269ED5009D antoniocadet
143,621,475 *0DC6F39C28EC68F62039F4AD38FD0BD043148D51 ANVARTHA
143,621,476 *0DC6F7FF96E539CD15499C55520074B596ACE447 AOEU2
143,621,477 *0DC13A8426070511BC0B7D66AE5793750B0E2FCB 2EUFLORIA
143,621,478 *0DC077363CD9D64492E84ABC5220AF147CD7FB15 aorqf
143,621,479 *0DC456B61DA311B69DD364FF98FA7C51EA298510 2hyv
143,621,480 *0DC7CED92C0EFEE1F708A4B03BE7597FF3E80914 2IHTNAYLOP
143,621,481 *0DCF31022C4378D0B8C4734008BB4D67AEE8A71F apfa
143,621,482 *0DCAD3E2C82AFC396DA06816E061557CE5858C03 2-JOHTAMISKYKY
143,621,483 *0DC3A228B8CBBE70DC0DEEC9D1D7CC9874C5B3C1 a&+pi
143,621,484 *0DCE2105531478088697DDF468004826E59A9DCD 2 KONRAST
143,621,485 *0DC04EA789F1A431F4E038A8DA916FC840FC0E11 APRILROSEG
143,621,486 *0DCA325B25F49264A97D70891872F14AFCC8ED8C 2muistelmateosten
143,621,487 *0DCEFEFBABEE286036B2D97B55C2462A870DCF04 aq6v,
143,621,488 *0DCB00A75F29350A9176E626B5E1BC865A7E8074 AQP6463
143,621,489 *0DC452FE7395A7CA7C722884976768ECA52746CC AQQ)Q
143,621,490 *0DCEB6CC0A1DFC242CDE2D9422D3CE94308B3278 2.SALFRIEDBERG
143,621,491 *0DCCB82265138463D08FDB9FEC8DB39693F96F10 [email protected]
143,621,492 *0DCAC42A0EEE76D9C7F3EED745ECA2CA012BA261 ariespeace
143,621,493 *0DC0A6F180AAC7DB8FCF61D189565DDCA2E50F98 ARMANDOGUIEB
143,621,494 *0DC559F20ABACD40C1462BC32AB8ABF196DBE596 ARMAND.TENNILL
143,621,495 *0DC9D8EBA19AAD56979ECF8C10C0B3A600673272 ARNOLD.ROSENKRANZ
143,621,496 *0DC7829469791D8E5A0C0CF442DC890798B79A44 arnulfobontempo
143,621,497 *0DC83480049444AA0C38559497E9C24F4FF14C49 328700 binalarindisindagazkokusuduyarsanizneyapmalisiniz?
143,621,498 *0DCAA9AD4FCB9508E907419D939BC49E07D581DA asahickton
143,621,499 *0DC4DFF230330A94E7DDCD6D551EF408D089F29F ASANG.LONGCHAR
143,621,500 *0DCC5F993989AB9EFD44C9824F0E9CCEFF3237F0 a/sde
143,621,501 *0DCB7C2E38F166E040C1335D55CCAE1E41DD953A ASFFP
143,621,502 *0DC65B75BD75CF7B868710C12CDB78E201A3163D as.for.marionettes
143,621,503 *0DC92FF2A97B3A4D1754243B747035D02C08A9F1 ASHA-HARPER
143,621,504 *0DCEBB516BF0DE4D8735654F8FFCD1D33199F62D ASHLEYPRICH
143,621,505 *0DC076F4D8194BDAF048E2F1FEA52F4692A06828 3CALLINGE
143,621,506 *0DC40324550E417ACBC100A16846531BD8649C8C ASQGS
143,621,507 *0DCED3239AC6BC704EBADF578575A98F5B4886DE 3GIMMALEDS
143,621,508 *0DC0CC62B9BEF26B1E63FC10E15A739A08756490 3.HAMMERMANN
143,621,509 *0DC6DA92132E9445FE7B372D7AB11CACC29F0B32 3MELTDOWN
143,621,510 *0DC9754E087CCEF1D0294E2DBED93E7FDF7CA9A6 AUGUSTINE.FOUCHER
143,621,511 *0DC7B57EC033D27204A1C59D1AA227E1C50678EE AURELIO.BACHLEDA
143,621,512 *0DC74E91B445CEA5B2F369A6E1DF19EF09F3FC79 3SMROFSIM
143,621,513 *0DCF0D088B199E40CB3AF243D21477061E90FE6A AUTKP
143,621,514 *0DCC690C7E36F5FEA29A68C0BABA5382949EE014 3UNJUDGES
143,621,515 *0DC450476A862D267E8193E95CA0E29BA89B6283 avangesied
143,621,516 *0DCAB6A13B98ADA2A1ACE2AD877F3AA61D81DF37 AV;FY
143,621,517 *0DC04C5D64D3A5B8C9B28EFCEC6DFE3BF178AF35 40-VAPAAMPAA
143,621,518 *0DC2D11040EF9AE2F4AB7D0563E6249E4BE93B35 425760 emineagaritu34.
143,621,519 *0DCBB66DD67563982062FFF6ED063B2FA9AEA71B 461311 boulezin musiikissa on erilaisia ilmi
143,621,520 *0DCE4559406B1508EDBB606DE7B363105639D983 466066 pienell
143,621,521 *0DCE4330AC56EED97FF1AF1D1B6B67B720729B0B 4.6.8-LIAMDNES/2.5-SONUS-NO-DETSET-#
143,621,522 *0DCC07F6CC16FF742D76E09C6301DC3EA423281E aw&g=
143,621,523 *0DC927A75C100BFB5AFBC47B2C4CF424DC415EAC [email protected]
143,621,524 *0DC5E75A12C1E8954DB44B559E59D94641E1C15D AZ$%
143,621,525 *0DCF40127410766B8C01A6E507E87B59F028B9FE B055
143,621,526 *0DCE2CD16F2BCCEE5DA7BB27FCC53F733BBDC030 B34MI$H
143,621,527 *0DC8C9F6EE2F3D094ECB581102690A3EB96AD15C 4 GRANADA-MONTRIL
143,621,528 *0DCE6E6C8E98EBA5086260DDAE30014AEDE4F159 4-heddemer
143,621,529 *0DC6A8EE1F7825C0F7232BA57BD2CA540DDFC882 b4bqo
143,621,530 *0DC768E4DC57219C5D9A5DF65F4A3B0201EC1911 b4ld3rd4$h
143,621,531 *0DC07364BB14916EE5E07836A53A9833579B74C3 4ILUVIRELAND7
143,621,532 *0DCC89DB2B7D2C7802BA225AE938A81E636ECB89 B57&
143,621,533 *0DCB682ADA07CE691874FC0DE85D39CE64AADE5E 4INTERPARIETALI
143,621,534 *0DCD43082643E3A04BA533433425EC1BDC55C6D5 4JTIPAKOJ
143,621,535 *0DCF8E8ED69C3C6EBB79F58773A939920B071ACD b75b.
143,621,536 *0DC7464A945361A8BA890394CEB9C57CC1F16DCA B7X9
143,621,537 *0DC21875F7FABC3249DB2256B2357790DDF5EA7F B%83I
143,621,538 *0DC7F8C304BE211D382CA94033DDEF90A8AEF41E B8T7K
143,621,539 *0DC221F4951ABA208E9452872EB089443EED9DC0 b-a0q
143,621,540 *0DC8F8B67DC1EBE41228EFE6BEFC10ADB69962D8 BA$111CA
143,621,541 *0DCCCF51E10EE6D5A7C9CA43E10BD7185F9A7AF1 BACCHUSVING
143,621,542 *0DC567C647B07E75523E0AAE3CC31E87FFE30904 Bad-Time-Story
143,621,543 *0DCACF64DBC14AAA6C09877FC9576C891514BD8E BAGA32.BBS
143,621,544 *0DC18768F7E0B2B63ECDDFA2BFA2FE44AC5D7330 BALLA2003
143,621,545 *0DC95F1381B8BA00F7E2379445A5FE58974B70A2 BALTRUSIS0
143,621,546 *0DCFC8BDE657E5D6BDD10B8F81CDCB4570A63964 4RESHETY
143,621,547 *0DC7EAAA843B0B7A3708B6B4263D2C171B53B180 4SSSSSSDREAM
143,621,548 *0DC1AC8EB8848E772060ABCB5D3956614A7F8CE3 4.teatteriilmaisuun
143,621,549 *0DCDAD4DE1229E2E8A03F23AB76AF1C9A9B62CCC 4thechandler0
143,621,550 *0DCBB41E5759E196CFF4C7909C307CD4147A0272 4TSISARHP
143,621,551 *0DC4EBD972D1F08737DB6690A39104CEB3B33942 4VERISIMILMENTE
143,621,552 *0DC93E89E02F4E05859424B4C7D745304C5B1B3A BASHFULNESSES?
143,621,553 *0DCBDD1E2CEBA133C72503A8110964461AE1D3A1 53135600y
143,621,554 *0DCC689A1E9DBCFFD683A5A698DCF2F94753DD70 B#AYT
143,621,555 *0DC1180EF0BCDBB189CBCA4A81125876E8DAD456 B####)~-~->-B0
143,621,556 *0DC17E99C51EB220E4CAC62B808E49ED9EC42EB3 BBALE
143,621,557 *0DC728158B0A8BEAE8D9937C646B0D42F1B59588 564821 istenilen-hacme-gore-makine-govdesi-dizayn-edilir-
143,621,558 *0DC406E769B99EE7FADC6473702E398AB88FAD4B bbb9l
143,621,559 *0DCD3FBE66213AB837FDE2730FBD799A707696D9 571CAITLIN
143,621,560 *0DC48A8C3D7E76793DFA0F60EDD5945F1A7AEE77 BBKu
143,621,561 *0DC9545935FAFE8D51B8F07EBC2F7D41E67605FF b_blb
143,621,562 *0DC65FE1CD73070F3ADAB67C7973D8F0C3ED33A3 5BERTHADEUTSCH
143,621,563 *0DC0551AAB7D2B99FA538D89AC1D55BAEE044D15 BCPTB
143,621,564 *0DC392FCAED8A2CF81AC08565DC96716EEE0399A BCV{
143,621,565 *0DCA0C132E7DBE65BF3D70EE8E80C824E3604F0A bdv!+
143,621,566 *0DC4C1D645E490A93A7936810FEA882E482CAB89 BEDROSSI
143,621,567 *0DC057B7CA2C345CE151EF8F10EEDDB3A5FB4C2C 5FELSSCHL
143,621,568 *0DC3CBDADCB536D31E836CA72603088A8E6CEFFD 5FORSIGTIGPAKKERS
143,621,569 *0DC6DA0331507030C16C8ADDEBA52F77D6FE3F97 bencatlin
143,621,570 *0DC3C10020D582CEC9AF61AFB147AA6D82411613 5NIFELOIR
143,621,571 *0DC53F871C6B1C14EB4843312DCBA5920380D464 BEST1011
143,621,572 *0DC290C15F2DA83C52BFC63C52513B6DAEC69DC2 5SHEKEDRA
143,621,573 *0DC8A96E22418C025026A261C3B58B2337A3FB33 5-SIFRESINI
143,621,574 *0DC9B2C20CEEC6A188CF6B3F3FCABF0DA4223ECC bf3f4
143,621,575 *0DC9E14979ECE855C5DDF9C568131FDF1871A075 5 TIESIK
143,621,576 *0DC36629545583CF2FB9DC1BA3E4C2178A9866E1 bfl3_
143,621,577 *0DCBDFE536E49C9E8CEBE561AEEBC1EEE258E175 bfpnu
143,621,578 *0DCC2E15E3BA587542B3240A94A304F0AEB009C0 bfsq9
143,621,579 *0DCC0218503BA9993B4D3838088385E5E37E51F4 5USMJERENOGA
143,621,580 *0DCB2E500F3CBE3100B0D69DA8D109E96AF5D0BB 5WINDOWSSAMPSON
143,621,581 *0DC4B1E26F607D894DEA9812153335AB9E25099B 659616 bu rakam 1998 yilina ait .
143,621,582 *0DC2D5F8A043D698405539A5AC5EAC1CFFE908B1 6ABSPULENDE
143,621,583 *0DC071DD9F1362CA07BE67B8A1DEFF4C094CF239 bhpm4
143,621,584 *0DC5D45003A16A25EFE97C29E86BDD2E7844E8B2 BIBELSKOLEREKTORN
143,621,585 *0DC7D1147A3B930B9B4187A7668069909CF9C57B bi/e1
143,621,586 *0DC12E0B0CB663DC896357C13BD71E51C26918A3 6ALKUPERAEISKANSOISTA
143,621,587 *0DC19CD7B225BB2EA44A1E0B7CB5551323A7A0F4 [email protected]
143,621,588 *0DC33AC3AF56993FBFEF7E87C7EEFAB16A353C25 BJ(9M
143,621,589 *0DCB91E62EED2FB1ED8A34C1971841E4659DB9A3 BJELINNET
143,621,590 *0DC6C8E8DCEA0426899B1E976E420CD8BD8F8DF1 6.HAUPTFRONT
143,621,591 *0DCD8D2C4515D27C981B28B2AFD4390E8B96820B blainejudge
143,621,592 *0DC18C358C290DE6C95C40379C3EB7B29670749A BL$MA
143,621,593 *0DCE2FC39B36E50F2DE64AA4030985869D105AE2 b$mp9
143,621,594 *0DCE2BD186070517E20DEF8CB1A68AA53FA2378B B!NZL
143,621,595 *0DC09061146F2C5C00AD27C0D2412EFBF496CF89 BO3AD
143,621,596 *0DC5A9EA125DFFE0C24AD7C270B5490252FF6963 BOBBY438
143,621,597 *0DC903CA681A12B374449A1F54D47AB1DCE2D41A BOBBYNACK
143,621,598 *0DCCF8AB7AB98EF8E7CF4495A81683CA4EFDC81C boo713gs
143,621,599 *0DC0F76A0F15D5111FCD987EC8ECD3B015BD5D9A BOOTUPNIGGA
143,621,600 *0DCBEC3D52D3EEE88728E4F0E44F8104BC2AFB5D 6PICKLEJULIE
143,621,601 *0DC1FB1D3A9B95FDFD5159F25405399ECA3F4179 BOSONIKSI
143,621,602 *0DCF641496AB87B84B56BC88A4D108104C2C0010 6PRIESTYBULOUS
143,621,603 *0DC53DDE9E4058EE8C12A032AEFB21563F3A432D BOYDLINDHORST
143,621,604 *0DC5A6EACF04AD0B0C0EA91A61BC79BCE689E3FD Boy.Is.Crying.(Hybrid.mix)
143,621,605 *0DC644BC21C2D2953DA54631170DEACC0EEB6B19 BQNWA
143,621,606 *0DC6EB4E5840103C71FA5ADF064BF99B2AD40DA7 BQWAV
143,621,607 *0DC9ACD6AD1532E7DF04DAFE8061F2A7C15A79CB br8w$
143,621,608 *0DC78FA5F7217A1E774E8B3B22A03D7770A6BE7F bradan
143,621,609 *0DC42325979D8CECE98CB7408DE0520F81182D14 BRADLYMALIK
143,621,610 *0DCCFCBC2D94F5D2CBA8700D5B65764BD41E75B1 bradprast
143,621,611 *0DC08890C9E16B80A0156CC09E527EB31BA29466 BRANT.BONGIARDINA
143,621,612 *0DCC375D612AF6448416C33FDA2E172307BAEEF2 BRAVIGHEID
143,621,613 *0DCC6402576DAF36ABE2B9ACCE103E03F1CC57DC BREGAUND5
143,621,614 *0DC82096712AE821AFDF1755925316C4FDA4FDA7 BRET.KATCHER
143,621,615 *0DC7E5633CF60D69D4350A99DA68AFF9932183FC 738624 TAVAS'AARAGAGIDER.
143,621,616 *0DC728532B5F0CA402C8858210410B7CF03685EA BRH,P
143,621,617 *0DC377D9A42600DF4F6A3F11314F67197B01657A brianbelgarde
143,621,618 *0DC2AE788CAE712DE37ACEE1DFD11D673938B901 brianlajoy
143,621,619 *0DCF3096083B7C407D8ED0CD9DA9728BAC6D5752 779535 icindeki futbol aski gercekten bambaskaydi
143,621,620 *0DCC02E58A5A663640D12070A2B194388613D7F2 782b8c7f6492315fa7a5a28252bcb2c5
143,621,621 *0DCC52D94F85D3E397BDDAD13C7D14705F866DCF bridges1905
143,621,622 *0DCC7B0210B1D2CB9E66C1D1C32E2E7A041A0E57 7A78AFFE
143,621,623 *0DCA495354CBA4409D2BD28AF192C0E3BF0CCBC5 bringbacksomethinfodahood
143,621,624 *0DC0DADCF05EF9648BFE938D6AAB11346A615D03 7AMMATTIRESTI
143,621,625 *0DCD9A87CBC75EF4E7B37C35FD37D9E771B5B3D7 7ANNEPOLO
143,621,626 *0DCF6C2F6F677F0010F91B3FBCDB2CBAEA3BE0DF BRL!Q
143,621,627 *0DCDE9C1E7C8DE2DC2FA345595686CA0101B39E1 b$rm
143,621,628 *0DCCB6A4333FCC84DF590AEC283B1336CDD20E97 7BORRENS
143,621,629 *0DCAD92855E23150D2B4CC805AAF9B76E3192328 brodyprince
143,621,630 *0DC5F1A71D4D3E336952A0B1410BBC45ACD97402 bryankravitz
143,621,631 *0DC5CAE9EE13BD42F1F6E2350E11D1960987A739 bryantotzke
143,621,632 *0DC38D177A3E0E3A87A3CBB9100B7EE8BB320A0F b--) ~ ~ ~ splat!
143,621,633 *0DC4127CA06CC4AA5CBDFCCA108ADBA8D2059BAF bsrzi
143,621,634 *0DC271F7448719622FEE8D1A655F410CA0B3C5DA bswglamrockgroupbsw
143,621,635 *0DCB012C5166B522ADC81889218BF9B298D38D8F bt\k
143,621,636 *0DC3799814E36364FA1EF7DDCFA28267F2845639 BTZ)
143,621,637 *0DCDEB2A093E49BEBFD693BF5EF52BA76059F7C1 BUHF-
143,621,638 *0DC58DE5BEB492A7731F31528DA6312F591123E2 B,?UI
143,621,639 *0DC92B46D6761EABDC26CD28CE56F9A25A55FF59 burlnewball
143,621,640 *0DC2C8B27BA67E41AB1C5E12E7E9D1E3C7322A6E burrell1991olympic
143,621,641 *0DC3B7051AA1BBEBE8C45B719E538505D11D83BD BVMF
143,621,642 *0DCF5E4D831E634A6D8A94C11E6C18744D10C8F2 7.hamamIndan
143,621,643 *0DC976D772B2B214D989F8F6B34C8AF7EB6407CE BWdt
143,621,644 *0DC94CF3E433A7C3470B0D33EE6F64319470A39D 7IAMBARNEY11
143,621,645 *0DC047041F57E2CD834453F9583083D10A9EE6CD 7IERGUTER
143,621,646 *0DCE2CBF138AAD010E67D61D10DCDB77FF1A1D91 BW=MU
143,621,647 *0DC8BE1B135D57B5F6B45770D9F1C63CBBED7F67 b=z6
143,621,648 *0DC77DC96D1D43A34C216C5EF088BC1707D9BC5F 7-MOBILTELEFONIE
143,621,649 *0DC0DABAB4B87EC34D39D083FE65AA4A09ACA428 [email protected]
143,621,650 *0DCD48597C809C6B5C6ACF7B7910476DB5DC2C00 c0p4r7n3rshp
143,621,651 *0DC3752C47016D9025DC6E015484E7A08A77216F c0vt-
143,621,652 *0DC0A4F4EFCA8F1B359F3642E8DF8683B7F9E361 7RODMANREBECCA
143,621,653 *0DC6B455A814B1BA327B8D38FD8C3D3FDB0DDD1B [email protected][email protected]+!NG
143,621,654 *0DC346F1C657864D3AF6B471694A16E9AA4115D3 7SABRINAVENUS
143,621,655 *0DC9129DCAB9E724CDC07AAB9F79C48A6F1132CE C1ra
143,621,656 *0DC681E3BD924F79DE9329C626A1E5B0CA7CA100 7TANKERGOPHER
143,621,657 *0DC3B43AFAEBB9647B0315B6FC92253F4F8BF921 7TIKOOR
143,621,658 *0DC3227D83ED51E837C9946D96ECC1F04ECEF4C1 C4RRO+I35+
143,621,659 *0DCF7EB202C3E199E1C84888F0A9FB0DC7DACFCA C5J;Q
143,621,660 *0DC3211B1F3DA7A8C285A765D5203DB5D69EDAD6 c#,=6
143,621,661 *0DC71D0ACFA7BD8C0C229B4DAEFEB9C601A7E785 C6L5
143,621,662 *0DC665531E238DF013D0E7BC4B6A73D0F2B701C0 C8BV5
143,621,663 *0DCED829FB0EAC42BCF72CBFC1E07E3E890CF916 82JAYVON
143,621,664 *0DCC1AA34B666EAAD9298914B0B0965E57CAA33F c9581015
143,621,665 *0DC8F21C3B72852C0E4FEE9053D2E177131BBF3A 884212 SAIRAUSKESKEINEN.EL
143,621,666 *0DCD9CB62A3A6A5C32E8DC6A2A9A765CAB881F96 8ANDREWWARCRAFT
143,621,667 *0DC2065906C79B6BA8ADF05ABBDF6F29FECC5ABD [email protected]
143,621,668 *0DC32D2F262215D26FF51019FE45365B0747E6AB caleblaberge
143,621,669 *0DC567D39850BB15CE239E52911125056EFB2926 8BARITTIRAB
143,621,670 *0DC08289D75BEE5A10B69EDE98881C7471E10C70 CANDI
143,621,671 *0DCEC44B77FE5AB31246D858721AB78C52D1CAEE 8BUDDHAWALTER
143,621,672 *0DCBF21842880358FDA27C2202BB477938046315 CANSHEBLEED
143,621,673 *0DC561ABA31FB55B3F59CDE7CDB804B927C7419F 8delassement
143,621,674 *0DC834A3515148F03FF1F5CC3CE7FB807B052FC5 8LEDZEPWOLF
143,621,675 *0DCFC33685A73C56E5771582A31741A563863BE3 8LL1C0SLY
143,621,676 *0DC18F677011ECD3C1E66FC3C3E1EF5474641213 8----)-*-*)o(
143,621,677 *0DC89773E38B44FDF9850F811752E571AEE03875 8###)~}O{
143,621,678 *0DC2DEF26E46612A9F9132CEA96324FD11D3EB46 cb(8v
143,621,679 *0DC2DC7C23B397A7ADCC4ED92D27F209833C1A51 8parasalpingitis
143,621,680 *0DC2098226891862403B9B14833A892E5DB67716 cbhuk
143,621,681 *0DC6E314164632AAF7968B43AA5761F03DF2D027 8PORTINGALLES
143,621,682 *0DC9B0059A6E990A8CD095F24E4E422540EF76DD 8QUANGUOBSW
143,621,683 *0DC4345910118103C79D56F50E13DCAB9835466B 8>~.~.~sploit
143,621,684 *0DC347B7294B2B4CCB75BB432DA5DB8B787B22EF 8TOLKENES
143,621,685 *0DCA8CA204703BE9B345C494C5C0F40A4FADB899 c_d"y
143,621,686 *0DC0319A0FCC32E14C4E6526BD49D935D6349D15 8VERENGST
143,621,687 *0DCD1AA8CE96A06B4916BDF5A38DE2D998B2CC18 CELASKON6
143,621,688 *0DC2D79534E3AF5E7254267F5922975BC1671275 CENTRALL123
143,621,689 *0DCDB7F2C2A7A32DC2FB724BD0B27FE522984CAF ceokm
143,621,690 *0DCBF380B654CC70A286FACD73CE026FE8998675 98.provokativ
143,621,691 *0DC0F6A3CAE2BB30BD94205C31670D1F0C0F6B57 9BSWKARIPALLIBSW
143,621,692 *0DC712EE86408ABEDC1F5B97496215CF2911712D C_fe
143,621,693 *0DC28B1FD1E9BD6B6D7AD60A14F0315B8CA9860F 9GMYFYKA
143,621,694 *0DC69CF7BE6AE0E0F02A8642C62A0D2CA8910656 9ILUVHOMER8
143,621,695 *0DC92292BEDD08A638B3FC8C8E3E7EC4D5510C31 CF$V+
143,621,696 *0DC779EFF398285832B26FF0DA5B57A68C319238 9KBLTXCHTPAUGHVQ
143,621,697 *0DCBE682DB5B55012F7B80FB8AB70FFDC95387EF CGHR;
143,621,698 *0DCAB5378D0F035E616DB6128E79787093F96D75 cgiw
143,621,699 *0DC54DB94A9ECF43D322A5CCF7ED014A1E871606 CGJUNKIE08
143,621,700 *0DCA599C456FAD0C2C20E43A19337B12A564F6A2 CHADMATEJKA
143,621,701 *0DC286B99C3AA76F79C37D0B9B9D0576CF9E52DD CHAMAKI9
143,621,702 *0DC558B6D6ACB5342329D532B998AC135CDAB2C8 CHANCE.GOLDFELD
143,621,703 *0DC13302684E83067928C1C45D32AECB75379FCC CHARACTERS—NOTABLY
143,621,704 *0DC10E7A82D6ADAC9995E29CD94DB4D69E1B5C46 [email protected]$$
143,621,705 *0DC1267BCD0E46F0FA3923FE3ACC3702B58A99CB charleswarring
143,621,706 *0DC8108649AD8EC29DC62D6EEA03845B3B29D232 9REITESROC
143,621,707 *0DCB254A046EAB03A5F59E6446A83CA795D824E8 9REVSEMAD
143,621,708 *0DC68413195B745DEDA39FEE48AF3F88A67B7311 9RMAGGIOBSW
143,621,709 *0DC7FD12E91AE1AAD125EC54CCA3DB4965CF7994 [email protected]
143,621,710 *0DC184FC074063EDF213A4A42CE1A66969614CBD [email protected]
143,621,711 *0DC332686D628C76A421049BB9A16BDAB84EAF8B 9TEGLICI
143,621,712 *0DC3A1B5220E7F60DF322724666CEF86D3CDC249 9UNPRESUMPTIVELYV
143,621,713 *0DC0F3220A86C9BD16AF14BB10849B8D236389A9 a01lf
143,621,714 *0DC981F9125833EE93E320D09C04E8F0F85F1FC1 a3em!
143,621,715 *0DC96E7E283CB92346104396EAAE9128E04D205F a4%g0
143,621,716 *0DC8CED63D06ADE76708A97ACBB13539BDDBD332 a5q5
143,621,717 *0DCBB000E2F0F056B3221D9BB6D8AD48DE79954B A89h
143,621,718 *0DC4672E8A58C8DE742C3C50E84F4C502584AD03 aa2m?
143,621,719 *0DCF2F61CD3CF0530659C3E2AFEB568E29E6EB61 aaa8(w
143,621,720 *0DC3A83CF3555F8761EEE53557BD7C6180662722 AAB,2M
143,621,721 *0DCD7A40B80873E2F6DDA853BE5A327B36EBF4EF AABWWK
143,621,722 *0DC3D22C69F1A36CFA0D60EC62069F6FAA8081D8 AAC&J8
143,621,723 *0DC192B229970A7AD73524828193BB606CCE0B80 chidlovetzki
143,621,724 *0DC476824DBF875A283CE4B2B68A3BC78106216F chilillpop
143,621,725 *0DC985855716173FE06AE5CBE88352EC7A2D12E1 ch"ky
143,621,726 *0DC4B7EE65F4697D757C751C31CCCD2B30F650E7 chl&8
143,621,727 *0DC40918BEA0A3D248F7FE48E04C80927266B820 AAIQ
143,621,728 *0DC85A7CB517ACB20F38C4E350AEC915ED278CE5 AANGEKOEKT2
143,621,729 *0DCECF8D6D02EAAD9E974FB54F60108465DEC752 CHRIS+ENDOM
143,621,730 *0DCF7BA53619DF7934339D5F787DACD5B05566BC [email protected]
143,621,731 *0DC5C91F8425E65BDB405E3EB3044971723E7CCB CHRIS.PAULIK
143,621,732 *0DC4C907FDCFC8945200908FC2C85D476D2D1060 CHRISTINAWYCKOFF
143,621,733 *0DC12CE2701313C3FF7DFE1AE96FBCFA21F5DEF0 CHRISTOPHER BOSTICK
143,621,734 *0DCBEF4B17D4349FCC91B8220EF7A7DB192CB4BC abd*k
143,621,735 *0DC7F8E0DA0F1E63883FA31CA064457565E007A9 ABIGAIL.MOHAMMED
143,621,736 *0DC74478DFBF6B2B5026764EF98DC2948F74ADC1 ci(gc
143,621,737 *0DCD4BF74BD0AFDD9201816C24D7503A435182E1 ABirch-TreeinaFieldDidStand
143,621,738 *0DC589C43426C90763F531DFE0C7C9966AECAF0C c!inw
143,621,739 *0DC41F19E33B61967ED08D0E62C78B24E80875FF ABRAMHOMMERDING
143,621,740 *0DCEF0DC5B554FAC47BC2D2625981DC05BCE61F9 ABRAM.ZAND
143,621,741 *0DCEC39211AB53A72D68B9C95576712180965F71 ci!wg
143,621,742 *0DC0B2EA2241CCA997453F147B483E3F8D305076 CK&?N
143,621,743 *0DC870155AEE030C8A494B309C92E2E85032ACDA ACCOMPLI
143,621,744 *0DC6BA8A034A4C283FF32334A3840197244244BB CL,1F
143,621,745 *0DC3EB3E60C59A71DAC9E92C30B4B7F1A4F9DF5A ACSN,
143,621,746 *0DCB8E6227D58C7AB2AD636DEDF4A9B3BE61C419 claytoncalvano
143,621,747 *0DC9520E5E25A0488BA190A9C7EBB2563B105589 acu3o
143,621,748 *0DCFC747EBDD5435DB131620CE64E21742B110B7 ad8)
143,621,749 *0DCD95DCA503AAC62044CCEFF6124F72B614512D adanclayson
143,621,750 *0DC124F79A488DA6AD39A05984C77031E170D78C ADAPTERKABEL.
143,621,751 *0DCA068DA3B0E293713EC4C1E4AA625AA8E90404 A$DD)
143,621,752 *0DC36CA81D7CE37074085B41917355C3E0D4A6C7 ADIDASMYASS
143,621,753 *0DCBDEA4652B9281FA5076DD21B5941A0CFF9EBD cm%pb
143,621,754 *0DC7D55E35ECBAC912BC52D97E79DC4291EA414F C#N+(
143,621,755 *0DCF95CC7DCAB0689789324A929CF16A79D5E51C adxah
143,621,756 *0DCA2EE70ADB479D508CCBE56EADBED6A274B42F c=o
143,621,757 *0DC10B9168D8F0A9D6F2EA2AB3E794112F030BFA AECNL
143,621,758 *0DC21F30C75F42E3820CD8C6609016438B355D56 Aeuq
143,621,759 *0DCCC0ECE96DC8724CE4EF6F86B5148A7B7EE288 AF3J
143,621,760 *0DC6BFFB3F3BACF948E592F4B4E4002CC20F4E09 AFAUGNO
143,621,761 *0DC775CA3C522D8D0C1BA3B7DAA9D8663EC219B7 A/fG
143,621,762 *0DC4493947CADB2BDC51BEB2510C762BDDA99333 coj1t
143,621,763 *0DCBE1ECD7971ADA89615650B07D3E5ECD60925B COLINALBA
143,621,764 *0DCB3CF2C0C7C4D298B84031935654CCB2B36DA9 colinmcquire
143,621,765 *0DC684E1A3D692F06D94412DE345B59EC82160AC colleen.fettig
143,621,766 *0DC7A2F9CCCA449A22971557EFEE1BB051606BFE COLUMBUS.SHANAHAN
143,621,767 *0DCCB2A6789A7B7A3570DD81F6DB85A82193CCA7 COMPASSARMOS
143,621,768 *0DC179DE25A248BAAC83AD3B0CA5A86621CC8277 ag"if
143,621,769 *0DC6E7CA486001AD1BD1EB6B9997102D8BA7637B connie.hames
143,621,770 *0DC6DCC005010728B41961407C8173099426B3F1 CONNIE.LOVEJOY
143,621,771 *0DC3431FA0316A783FC7D6A482FE5C83AACA2A51 AH!GO
143,621,772 *0DC8D776A59852D4E1FAE1E20A8300C4F5FADEF6 AHKF:
143,621,773 *0DC0178964858ABDD312DD8CE2D2707CB5F6774E COPUL43
143,621,774 *0DC11B64FB48CCFF50AB2BE4A04F9E0B34AF98A1 CORNELIUSFIEST
143,621,775 *0DC4C017B83618589A94B34CEA437FDB88659BF4 [email protected]
143,621,776 *0DCF4A55A5949998CF55107A6BBA008038380834 A/IGW
143,621,777 *0DC7FDAAF46309EB2413ABE44B5105B440DCFB31 aimeatpes
143,621,778 *0DCC87594AE2A69AF4786DD862A09B9D73C5680F áiNghĩa
143,621,779 *0DCF4A95B49FD724C883C1CE67A09A223543A3C2 cpnnv
143,621,780 *0DC99CED62A1B352FB65DC5E6D88A17AF84EB761 aiu3f
143,621,781 *0DC9BA58215BE753F0F160C224C1EAC8158A75D2 [email protected]
143,621,782 *0DCB70717A92C0E1A56D4AECD94E7C1A8AC381E4 ajamiento2
143,621,783 *0DCF3E1596506D137DF4F3EC387C7C3564372F96 AJLS
143,621,784 *0DC1060EFD79E1500AA9B57A9EE378B79C3498CD ak"1$
143,621,785 *0DCD498120DBD9AFFD9F0C31F96FBAA3736167A9 akpyc
143,621,786 *0DCB5ED90A23B6FF6149DF658A33AF7B81FE143A al9&6
143,621,787 *0DC79826FD06067A2DBB49DEF29D00E0E71E6741 CQED_
143,621,788 *0DCEE7C5BB82F82CE5B82A5D2C198408047079EF ALBERTOABOUSALEH
143,621,789 *0DC1C31B258D2A3AC36EE5650A16E637CDA58D1A cr5i.
143,621,790 *0DC34A2A8DA3DEE90447059E573C466DF0E224D8 ALEJANDRO.VIX
143,621,791 *0DC4244FA601CC2762236780D43102682E758D08 [email protected]!N9
143,621,792 *0DC7F11796F5B1E108A30AC034D77EB15A0D5E0E ALEXBURFORD
143,621,793 *0DC2E5E00CAB73E2E85BEBABE058132E5F6AAFEF cruztroche
143,621,794 *0DCA8C9F32F667599228496C4A5A8D61A2439F50 C-rZ
143,621,795 *0DCB846D0D0A68DBD3B41DE1B001CF827DC5DA29 CSHUPE160TALK160
143,621,796 *0DC9344323A5DB02F7EE4BA03636CD42EFA74024 CSIHM
143,621,797 *0DC4CA0D3C878C9AE9C0C37F92CDFDF7C5E02C28 ALLORUSTY1
143,621,798 *0DCBFE8B7848C897A3C83547F310A8221988325B ALPHA3:ALPHA356
143,621,799 *0DC16DE67DD3AB5975FC3E1608371212807A208D c!tig
143,621,800 *0DC1312DADA657A7D7A8A90E09E0942B4D830705 ALREADYABANDONED
143,621,801 *0DCCBDF1AAE7D095B93339840EB54DE4BE4EAC00 ALVAROOCHSNER
143,621,802 *0DCCE6C9A631371A29A3DD9E36BFDD7A392548C2 ALYCANTH
143,621,803 *0DC826F190A07D18AD830E666CF32A4266C9D1A5 amateurboxerssufferbraindamagetoo
143,621,804 *0DC18E775352D0F9E161D79175643EEAEC990CBE ameer-rayyan
143,621,805 *0DC8E34B0A595D1F774BC70D2EDBC6FA7B5331E3 a(mie
143,621,806 *0DC19726B47AA64E7DE5425323653F4A1A023FE7 AMR_P
143,621,807 *0DC27B12B596A883A768FADFAEBF02327B965BBD a,mu8
143,621,808 *0DCEB497E465A03B828321F15BF6AE41EFC3BB43 AN+1EMP1R1CAL
143,621,809 *0DCC386DB94316E354939B4422A4E64FA6703AA5 analysete4
143,621,810 *0DCC5473011415742396D6BA35DBA5C2EBBC9664 A.=ND
143,621,811 *0DCB57AC9388E9510D68CECDBAA0D774FC55C03E cwx);
143,621,812 *0DCCBF5EBCCC53E1F953AC0714B78B364F4DB3CA ANDRESHAWK
143,621,813 *0DC4702FDF2276A8FBA57EAD9C73A2F5E1BA5673 cynthia.gloade
143,621,814 *0DC31AAF3C21129FA6C099E62346F084CB5C09A0 CYPRIOOT2
143,621,815 *0DC6B829232379BB48AD14C6DD4C28AF6A24C00A CYRUS.JONATHAN
143,621,816 *0DC7746CCD01F3250C872FDC47FB74132CECD82A D0UM
143,621,817 *0DC0266239A28E6B47D7996F158D078406ED8585 ANNUITAIRE5
143,621,818 *0DC8EB9B83858E1F88E69AF7326E1EFB2E2CEBD5 ANOAM
143,621,819 *0DC7CA56A275D13E8A61B877D888E9D4B320FD26 Another.Follower
143,621,820 *0DCE1EE265F9C1F071B8963480ED316BD530C706 ANTEAL7
143,621,821 *0DC098F8D7269F72DD30F4AF66D109B4F587B2ED anthonynewbury
143,621,822 *0DCF0B186CCD84C03ABF17AFA1FD1AF555438302 d:2q
143,621,823 *0DC3D26B449F373D02BDEDB9D59854677A36C642 ANTON CASTILLO
143,621,824 *0DC4CDB809695D004079577C98830414DA27E1B0 D3N0MBR3NT
143,621,825 *0DC3EA27BA7DAECF5F5305CAC9289FBF8263A315 d3.qe
143,621,826 *0DC2260408C69E75F7EB97703F345262C56F778B ANTWAN.PEDROGO
143,621,827 *0DC45C1B5B07A3E34019E0692D4B3FD7D6DF2FB2 d+4z
143,621,828 *0DCA8F418F29EAEEEA31D7E9DF57FCC8010C3F4E a/+om
143,621,829 *0DCEA1AA58F50746BAC07D0C89B859EC384E965C d6dja
143,621,830 *0DC3D708BF76F4AE32B2FB8ADF3CEAD3A0CC1E62 d$7h7
143,621,831 *0DC51BD8C434664F5070662FFC07A46BAE88FA57 a)pbi
143,621,832 *0DCCDBEB03C9F788305086E65DBE095EAC85664A apg1c
143,621,833 *0DC8A3CB2062D34696E9DA8EBF3A5659C42C7F02 aph;!
143,621,834 *0DC6973691CA3E1428EEECB3857361AC6D50FF05 APINNFU6
143,621,835 *0DC2421D2B6FD38FE86781CEBAB2B0F58149C598 d;,"a
143,621,836 *0DCC581D472058D875B1FA8A01081409E9165480 APPROPIXIMATION
143,621,837 *0DC4C71380C23710416DCA17309B9F95F63F7FE7 aq8el
143,621,838 *0DC771B59F33B13DBE49EF3E8FD51A95D337B504 aqd0$
143,621,839 *0DC3A0CFA6B95E527CD63A33F05EE3BE915DA0C9 aqis
143,621,840 *0DCE36A801C8E5B84F921283D6258D8AD6F62274 DALAYEDALBUMSSUMMER08
143,621,841 *0DC364430BAE5A006E5E25A9088618E518A47738 DALTON.SCALIA
143,621,842 *0DC35177D72F7B6578DB43B27FA15D87E3DC3313 damianclancy
143,621,843 *0DC199AAF0CAD247468E552E6A89E5DE384D324A DAMIEN.PENDLEY
143,621,844 *0DC412819E5B0D23D434C152609A842F117BD1D6 arbejdsbeskrivelse1
143,621,845 *0DC9ADEB8595C5F0C79350C75082A01E660951B7 archie1931
143,621,846 *0DC720ED979C7B4EB061332615687411EE31ED3D AR(GX
143,621,847 *0DC0B8FBB8A845C0AAFDB242CF83D04BA444AA2E DANNOSAED
143,621,848 *0DCD92875B2D2A76BE0ABA0905DC8CE68BA05ABE arlennokleby
143,621,849 *0DC7CBAA21434DE8A504D08EDC7195C810CDCF2C DAN-RULES
143,621,850 *0DC47F0FFDF4A74F89684C2C0ACE7EDA7DB69664 DARELLRYKERT
143,621,851 *0DCCED21C765D7A89D493E8DE79867B5B891DAD3 DARNELLLOREG
143,621,852 *0DCA81B72F8D352CB16A4C28E0B9B3119EE7D38A ARRONMELER
143,621,853 *0DC4E7FDCBADBCB47D2307B6BCBE778AFE3CFA17 ARUCIOCH
143,621,854 *0DC86AD0A0C066DBECB40790D881C7D8DF2FC16E ARZ7E
143,621,855 *0DC20D221AF754A8F6D2DF89E58C0997F3D6C2E9 daturism5
143,621,856 *0DC10900792B621442134A2855AA3571F6A56889 DAUGHTER.&.ROKUROTA
143,621,857 *0DCDEE8BFDD653800A0E2C4D3627498F76AB608E Asce
143,621,858 *0DC266B20D7A9357BB03199263E2594D15C13EAC ASHISH.SMART
143,621,859 *0DCF752FF3118B7D46F695E6ED03A67F1EE699BD dbi"a
143,621,860 *0DCB794A514543842A96A9005D819FD06E021074 db;o
143,621,861 *0DCC1F4D51E50DABEC13557D89D68F9D01C2DEE1 asv.?
143,621,862 *0DCE5B0F86A695ED0923E9829DEC48F1EB70C0C2 dc0mw
143,621,863 *0DC1AEF006D063B2645051D5C591BF67988E91A6 [email protected]
143,621,864 *0DCCBC78602A4254CFB54A8F6C2E7A105C843029 dc,jw
143,621,865 *0DC613B741BD7362957CBEC0DD4B1025FC01A2DB ATIVISHVASET.H
143,621,866 *0DCCA2D4F251AE12B7543861716201BB509D7080 dd1m0
143,621,867 *0DC1F9AAAA1C6561A4DBCFFBF9D74A99D71FA747 DDKKPK0301
143,621,868 *0DC34E00307037BE34C8640A945117C058105607 DDPLOYER
143,621,869 *0DCBF3148519FBB687D42C64BFDE066D39BFDA79 d$drg
143,621,870 *0DC0FA1F9DB7B9A474F9FBDB7E325D16F0E6FB04 DE5N
143,621,871 *0DC08A71A17AEC7D3EECEE8CBFBC628D9BD0F39E DEANGELODIVEN
143,621,872 *0DCBE8803DA202BA1C15097A45C73CD4841489A0 ATNEMARAP6
143,621,873 *0DC08F690A7587CD26BAFB0AFEC97668ED31D06D atsimile9
143,621,874 *0DCB823ACD3B7E141A5AE15C9420DF170FF32AF4 DECURIIS3
143,621,875 *0DCDF957AFE9F419487B96D5A77F68B8C5184C1D aukfy
143,621,876 *0DC3A8A45959BC6336878CB0A536C6AA086DB457 dem)j
143,621,877 *0DCF2EDAD314FFE0A8D8F07765696978863D2079 depahshg2
143,621,878 *0DCD83A98108CD4B0BA1A67840664DDDC7899242 derickpall
143,621,879 *0DCD47FCD3A13C8D1F0D8CAA88CC2E994C7F0A1E DERRICK.BAADE
143,621,880 *0DCB138B4142D320444EB214484AA98D6508F2F4 austinformey
143,621,881 *0DC9ECA1D63FD25BC6AC47DFEABB126E5675ABEB AVILAH123
143,621,882 *0DC4951D3BE60B3ACC32F24DFDCFC9F18372C9C8 A&vs
143,621,883 *0DC611071775A4493194371F05073917EB061098 [email protected]
143,621,884 *0DC1D5325AB3B5499165694CF3A038154D9C8188 devil'spaintbrush
143,621,885 *0DC93CFDB50A88840E43E05EEA4394B8C45120DC df+i3
143,621,886 *0DC8EFA6D33146E73CC0358C27E7903EA6350D56 A;WM8
143,621,887 *0DC3C8A9604CB057B8DFD6EC54D70BE507114BB8 AX1AV
143,621,888 *0DCDD5DCA0B9FE6ADB03510DB39790E4ED5A9694 d_h#3
143,621,889 *0DC8938913172AC0058792C9770A16D45E6A6388 aya-leila
143,621,890 *0DC2835D89AECB76522A39B54E3B02358445FAED a?zam
143,621,891 *0DC05219AB5F0AF944513E67F6DE9177DD710686 d=h-u
143,621,892 *0DC6846CD88346745C19FA3236B160EEAE39647F azw+t
143,621,893 *0DC67CD00D32C82E1EAB58DF46DF27A7F84DEA49 B0(l
143,621,894 *0DC26B4793DF62BD7224AA12E1A9EF35C37F7410 DieKrupps&DKaycom
143,621,895 *0DC68FCC2DED4A9260FD534E5CFE8D7E26965B85 Dies.irae:.Out.there.(tenor.and.baritone)
143,621,896 *0DC4FC727A02359CAF71286BFA9BE3B3D7266FA1 difenylhydrazine
143,621,897 *0DC023852B21087CB0A6B6010CDB1E38B828CC13 DILYSCHOW
143,621,898 *0DCE63CF709B760AC07749FBFC1ECDFC1492D359 B2UW;
143,621,899 *0DC873C320B1D28B1683C5424CC054713E584A86 b3hav!or5
143,621,900 *0DCF075DDDA384B6912E075C7B9FB2BF5F0435F4 b6ea6
143,621,901 *0DC57A07EE34017F4FBA9037E1476BCC48127F8D DISNEYLAND123
143,621,902 *0DCDD66B00FFDCDB1316FCB7A159A2190985C990 b9&bd
143,621,903 *0DC25016EEE676E1C9BFEC41CEA433D129E0C33C d"_+k
143,621,904 *0DC8081D9B4378F83A611D17E43FC29B3184AFCF dk=5
143,621,905 *0DC046F3E83A7A0FC98F397923431D9950AD0002 dkb7p
143,621,906 *0DC57A5A973C03FAD78C0C7DE27C5839224262F2 dkfph
143,621,907 *0DC5B7E6A30B6B0719F190745DE4349629E3FDF2 BAHIA.CAMARONES
143,621,908 *0DC432958BD1416094F22228D9BAF027B8451E53 BAHTGNBH6
143,621,909 *0DCB72D509F57A13F90776184B11E320654FE978 bay$o
143,621,910 *0DCD56574072D3984AAE8B4AB9E64E5CF6D1CCE7 BBPHEYR66
143,621,911 *0DC48F07B3337D48E59B40441FF7EDD1E2586772 [email protected]
143,621,912 *0DC528D861B7E8FEFE26FE37392496D1215610B7 bd7re
143,621,913 *0DC75ACFD1A61345E1320EC20A78F99D7CF98137 dl4p%
143,621,914 *0DC732D2DEE0CAB5D4A09FC536FEFCB895E0CBEA DLKLV
143,621,915 *0DC61E41C4B6F8C5716FF413824F912D2152E368 BE4LL
143,621,916 *0DC88D3871E3D84427FCC057094F496AA0FBCD54 D"M5-
143,621,917 *0DCE1FC57B02A575ADA4EEFCF3C12F3B9646F4FD BEAUTIFULCONTRADICTION(FEATMUSIQSOULCHILD)
143,621,918 *0DC1ED02C17EEA25075E0C2725B324D0AF211E21 dmiy.
143,621,919 *0DC4E5E3C797D074740CDACC1DD944B643E42474 [email protected]
143,621,920 *0DC52280C69CF33776AC92E3AF9382CF955CF381 DN7T
143,621,921 *0DC011CD4E23A2099749B20908B0549F4B6C1D67 DN8_R
143,621,922 *0DC14736F5A68695B4BC9640AF28CE8252B2B6A8 dn.co
143,621,923 *0DCCA7CC04934E81E772BB1C876FF66C44F8D69D dn#-d
143,621,924 *0DC63A13473926C5A05F99E5CE374013DA1940EC benitoclaessens
143,621,925 *0DCC61B43764EF9B3DC5A811902F2A7131764433 BENNIEGARDENAS
143,621,926 *0DC1BD061A01FB31B4C18C90C69969E451E28D4C BERNIEDEIGHTON
143,621,927 *0DC2299346031D30CDA77453CBB417A11A9F79EF DODECATHON
143,621,928 *0DC4E4F17856D9975FC2E39BDB1FDF8B9F8DDFB1 DOD(S
143,621,929 *0DC5FCA93209DC801768C0E55505ECEE5DD3AB85 dominickhrapski
143,621,930 *0DC4FB62C6A80FFCC17D6761F61CDDD78BC902B6 BESTELERINE
143,621,931 *0DC4F5022C792AE584B36B8F05209E5C3CACC7A1 donaldhanna
143,621,932 *0DCD96F1FBD22908280D155DC8894DBD7B6DB2C9 BETOVERT
143,621,933 *0DC8FBDA6DCF3881ED11C3D78FC2E0925A1563B6 DONNSCHMOLL
143,621,934 *0DC6F75B2C9EA5D57C230FD3610DDAD5704E38F2 DONOVANDUHAMEL
143,621,935 *0DCE6906AF5F27A168A89465EDA6E62DA2E56670 doorvoerens
143,621,936 *0DC3E43ADA10617FBB1DBF016CF4AA52A9AAB07D doprovázejí
143,621,937 *0DCF892D0501D771FDD5E98B8593A669EF6AC61F dorianyamat
143,621,938 *0DC77D05E8F4DF11C38F0C9BBB2814A4BDCAB43B bgr"g
143,621,939 *0DC6610AE0E37B8D7F222EFDC753AC570CF323F4 BGXRLUSWP
143,621,940 *0DC70D72C67877233F5E237A2262860825F208C3 BHARTIPERSAUD
143,621,941 *0DCCD7B328F0CC21E6589B66FF33AE98D6DC884F DOUGLASSBROMMER
143,621,942 *0DCA4148B119200B5C29B840E2D6B76733BDC769 b%h;r
143,621,943 *0DC19442B912098A64EDFD7BC08440A4D848A749 BIQUEIS3
143,621,944 *0DC8E1BDEC5ACE095705FC209413EEEDE03BA880 (><).*.*.*d=====P
143,621,945 *0DC14C5FE5E20659E220E1D4CB31281F7FFD92C2 D#P)
143,621,946 *0DC3014AB847316E0D31437493A85047C6D5CC38 BKG3!
143,621,947 *0DC61954C77A369918190401243E6A33E70F3C24 dq9o,
143,621,948 *0DC5FAD4850FE52D889134042908EF13F0AD2A41 DQgd
143,621,949 *0DCDD2BF9BD1B29EA1ED3D35E9CA09E008FE45E1 dqki
143,621,950 *0DC69C61DED819EB6612DBF3DD782425F1EF09E6 [email protected],[email protected]
143,621,951 *0DCDF025389B6A12CEFFC08D32AD1FC02E281D2C d}r0
143,621,952 *0DCA8714FC62FEB23E0A24EE2E35DB4510F6AFB9 BLAINE.DRINKALL
143,621,953 *0DC7ACB5C8D6A4E8542D1B2AEE6E1B8C1ED9F25A blakestephensen
143,621,954 *0DCE1F272B8305B3D4A1CF1D6AD8607AFA1463A3 blancadelia
143,621,955 *0DC4584BB6F82B61D0F445C8B3096596BBE9B277 drakushorAlex
143,621,956 *0DCE6540DFADB140E75703185031F25DC73A022D [email protected]
143,621,957 *0DC7EA41831D0C1A8F62076E05D765B5B86B9531 BLI,3
143,621,958 *0DC682E7F6F1959CE6CAE5A1BED4D0C6D37150F0 blond (radio edit)
143,621,959 *0DCBFA074ACC0FBB252D72677E433854520E0DB2 drl2
143,621,960 *0DC0D382F7DFD64774E38E1CB1A421452955374A BLPAP
143,621,961 *0DCF35703643FFFBC5359D1EB366C2AABDB52F95 Bm.h
143,621,962 *0DCC4F6E6D1F85CE3E3BBD7770FAFE81215F1794 B=MI
143,621,963 *0DC0E310C148A41D5B10BC2DDFF8DD6818CA46F9 BMTN6
143,621,964 *0DCB6B00175E9D5DE32279514BBDFFE409A33407 D!SQUAL!FY!N9
143,621,965 *0DCBC76F7DE8F3ABF4C241084AB6135B37BD8DD5 BNUFP
143,621,966 *0DC3A3D38D57B68827F638063E9419620DB7B3D4 BOBBY.SOBANIA
143,621,967 *0DC21748F143ACF02A2DD6602A7D498483669606 BOBFLYERS3
143,621,968 *0DC5CF1EDAA1411D8D18E5DB8B69F9FFF6456BA5 dtvzc
143,621,969 *0DCF596CDBFD528ACD728C3CAD160232EB1AA9EB BOEA6
143,621,970 *0DC93A92AC57D4D2360D8A46CEF874E3420A46CA D;#!U
143,621,971 *0DC1BD5DB0F9E9CEDD6053B84D93168EF7D80826 du9%u
143,621,972 *0DCD84B0AE62ABD04715A5A4B1149750B06ECC88 BOk#
143,621,973 *0DC798A69CABFA663592990C8B1A5C068B29450E duitv
143,621,974 *0DCC24A46421EF51F45039226C301563E5C740E2 dujae
143,621,975 *0DC17821424039C9E0FE5F612EF0909E3C185F33 DUMBEUROPE
143,621,976 *0DC92E80B84E60873872AA00E389D2222FB7ACA6 BOTHWIKIPEDIA
143,621,977 *0DC434E96A8258191A99D91BD1988F66B87F80C8 DUSTIN.VIRES
143,621,978 *0DC0E856B3A78669A924193AAD575ABEEEDDAE8F duwjy
143,621,979 *0DCE85F3BD096C1C8F82D73F081EDF25002BAFA8 DVAFAEE
143,621,980 *0DC7A3FCD5D28CD3B8647BA16FB5043804AF6877 dvam:
143,621,981 *0DC07CAA574A5211317A1970F1D636FE7266E33C DVTX&
143,621,982 *0DC2F18075FE4DD85204313861EC51328CF223C5 b---p * (>-<)
143,621,983 *0DC132BDA931ECAC65BCD4EEAA7B7F8A8AF637EA DVWTT
143,621,984 *0DC0A8736DE2BE8B9491C7895FD2BD29F129B753 DWB%
143,621,985 *0DCC4434BAFD599A9296ABA957CC468B85BFA0B2 B--P-*-*-*)O(
143,621,986 *0DC552F55B817C2BA0D7E7269C05D83E46C067ED BRACERN6
143,621,987 *0DC75AA969939B941328F398A2944909459AB722 BRANDEN.CADARETTE
143,621,988 *0DC123FA93AED42F3B790DD08C48BDA81EE43C31 DZIEMYRAZEM
143,621,989 *0DCB82956081FE2B3C350DCE69727616584A4FC2 [email protected]#\
143,621,990 *0DC9E195DB17A37C6C39F3916A9ECA2565E91A81 E15543
143,621,991 *0DCDAD83A4AD60DAA906AC62CBD0C963F7F1B9AD brettyori
143,621,992 *0DC2FF0DAACA6FF76409AB2AD749481131CC9D57 brf3s
143,621,993 *0DC155E4F6848B1E228F6838A058F2FA694D84E1 br+ib
143,621,994 *0DC3B0C777DD21782011FCCED2D9BD8BD053667F earch
143,621,995 *0DCF82C53EE22725A8199FAF6D00D15F44E8CD1B earllaporte
143,621,996 *0DC78E801DFC76A64085FA6B056C9A28232BBAF8 brodiaea?
143,621,997 *0DC7871587D47AF79C8D7CCBCA55722B048C9354 brq_,
143,621,998 *0DC75ED4E383FD078F001C643AEA15FC269671EB br/rg
143,621,999 *0DC2C5BDFD042173B7A82664B3C530D74A8ED7A1 BRT"Q
143,622,000 *0DC504B3A36DB2F3284F372C7AB72B33121C52CA BRUCE PATON
143,622,001 *0DC3ADADD81E6957A677179166E74EAB9BD28FB8 BRUNO.RABOLD
143,622,002 *0DC7E40A5255C01B4B5F7049E46C149542B752D5 ecaparac6
143,622,003 *0DC70CA7EDD2E60D33C0E559DD7464A1BC384C8E BRYANTFROMAN
143,622,004 *0DC7903C8377D1FDE9FC2B609C000BCDA9296DB1 BRYSH
143,622,005 *0DC4419A829815A0658283FDFA63E286E2A72DC4 eddiegaraventa
143,622,006 *0DC40A30F782BF9A14B9D8C6635E33909A8C4D0E EDDIEHELLEY
143,622,007 *0DC763136657C64C635F804618916708A37FBEC8 EDDIE.PLOURDE
143,622,008 *0DCF038DBA18F407EB3E9959C10B342DEFEB12CB BSTVJ
143,622,009 *0DC10BFFA7A7AE589B161C6AA2A9A4F01C419EF7 BSWOPENHYMBSW
143,622,010 *0DCEF07794A66509A97E2B410CE4699BDF2B9081 BUD1028
143,622,011 *0DC085AE831023A33E38F83399FCEF2EDAE20B0B budcuartas
143,622,012 *0DCB83A5C61D1CCE5426E885971C313C4D1861A8 BULLPAT8
143,622,013 *0DCDA6F7533E05A871F747BDAC62EB568A20DDB7 B"WH
143,622,014 *0DC340BA8599E4E12BDC9873303E6ED872B76063 BX1XN
143,622,015 *0DCA15D471A983355203603DD46264AA2D5FEAF4 EGYSÉGESEDÉSÉHEZ
143,622,016 *0DC1F27B1CFCD77828BD2B845684C5D90EF4C1DF ehbnk
143,622,017 *0DC189BBDA4D5565F1E035F3CAB89D2C0E82C100 EHLEW
143,622,018 *0DCCDA00E034E858B9C651C43C49B066AB495113 bytweone6
143,622,019 *0DCF88EE607F14ECE1EFFEF55FC6EB1CE387F169 eikelwsthec
143,622,020 *0DC3D8416873B15BE97ED1B60559D8AF58977937 bzvp0
143,622,021 *0DCC441190B359B739B070E30E03331D0328DDE5 c00pt!n9
143,622,022 *0DC4CF952A0FE68DA23FEC48442DBDBDB99CD8CF EKELLE
143,622,023 *0DC034C0F3CF4FC14691667D09600502E48E6F6C C1CUP
143,622,024 *0DCE413CE40F3C1DB08E63A883057F20C8010314 electrocardiographic0
143,622,025 *0DC60E1429FD5A70FB121EF39E7B84FE2E00F46D ÉLETÜNKTŐL
143,622,026 *0DCE74ABE473AF9CCB7ECE601D87BCB92234BE18 c5);r
143,622,027 *0DC9E277DE2A788D951649F73DC6B128585162DA c5=u
143,622,028 *0DC2D6931FD7DEF88E2A2499FD2D079CA79C9880 C6WSR
143,622,029 *0DCFB57C35ECF0420F2809394C6CACCA84399036 c77518defba947419e350a9d3b3f02ab
143,622,030 *0DC71B527F65B9B87CE2468E9B7D45B5FE454A2D C85=V
143,622,031 *0DCA293438179D7DC7D0C4AD34D781CD5E3F1089 C9CRW
143,622,032 *0DC0F462D2E155B56D9237EF672DBAB8F2724D9F ELROY.BENISEK
143,622,033 *0DC2F1AAC81C283B5C6BCA98CC83AECAACEF164B ca19001500
143,622,034 *0DCCCDE794799724E4AA7A01C307F37584563CD7 ELTON.SUDBERRY
143,622,035 *0DC527BF5CBD455EDEA616BFA5FE413F49809603 ELVISLANG
143,622,036 *0DCB219146C962CC32A103FF35C5D10C469C2D92 cad5
143,622,037 *0DCB9848CBDD2E8A155792D1DE71DFB159E47AFD ELWOOD.GRINSTEAD
143,622,038 *0DC6C985F64B0B87D349F68463AD6DBDFEAA65F2 EMBF
143,622,039 *0DC2D4F1D7B94E795AEE482BC6838B34F6C1DE10 EMERY.CABORN
143,622,040 *0DC7099043FFB7DF8C2E0CF3D7A0A1DF9F3FAC28 emf?x
143,622,041 *0DC64F3838CA7318BDC2081E0BF928BE1955183C camera phone (feat neyo) (remix)
143,622,042 *0DC0B3B2A71F57FEE8460E31BAE4AA4F7934C27F emmettluinstra
143,622,043 *0DC3DB622FCAC22E37150FA4BAB58C30ACDDABF2 candytootsie
143,622,044 *0DCD54008AD3450442D178151F2697B21B36EEA7 EN811595718
143,622,045 *0DCCFC2C9A56B59B09986E1A8FC65241FAF62475 CARMEN SUITE NO 2: IV CHANSON DI TOR
143,622,046 *0DCE7107E31027D7E470383DB77BD400A88827A0 [email protected]
143,622,047 *0DCC3DED8C094AFC50B6A8FC087F8E0E82F54A42 carol.kleinhans
143,622,048 *0DC130C7859FE94DA83F2363A11C01227FA26D2C eo#1+
143,622,049 *0DCA5AD3BDD21D63CC915DE9F4E9DD1B6ED11EC9 epee%
143,622,050 *0DC7B5D23625D41FBF3B260189328262A84B080A EPF6D
143,622,051 *0DC300A2596026178F7B7ECDE586DD93B98319B5 [email protected]
143,622,052 *0DC39C4DEF9E9E8E9EFDE4BFF5D379F4441DB5A9 cbem
143,622,053 *0DCBCC2277333A2F77C4DF5286577752407E55CC ESTF
143,622,054 *0DC1A6BF39793F64B13ACAE505458F067A17CC55 etaidisni3
143,622,055 *0DCA63F7AE7F5E9DF427742EF05BABEF93C25159 eternal-resolve
143,622,056 *0DCCA84BD88BEC756BB07F5E98C9548B2209BF17 c)cnm
143,622,057 *0DCB8B2001BEAA17BA61247CAD162551938DCC9D ETOMK
143,622,058 *0DC04341089C3CDFD6EF8D0FB1B604E41A89FF95 C..E_
143,622,059 *0DCBF1162F8381BE773E15E985279E62193C5636 CE;7H
143,622,060 *0DC3314C0AD77C06863F25044835B2C34258FD97 eudfc
143,622,061 *0DCAC9EE311199BABA2E4BEC60F2D028B8043955 EUGENE.CURLIN
143,622,062 *0DC0B91CAE7B0E358DC000273B3705EB4F6092F1 [email protected]
143,622,063 *0DC6EC424B4182807239885A1A27A48D4E991BFC EX7OR71ON47E
143,622,064 *0DC430D6B4EC448EC3A2A64224B2D7F9A06B05E9 exchangeably8
143,622,065 *0DC840ED7CA5CE702162FECBF80F4202B31547A1 exomphalos1
143,622,066 *0DC7C216C2ABD7DCC39EFD474D2C3DEDE0E06168 [email protected]
143,622,067 *0DC22E80FDB7C81BFEF9AFC3779A618A8E1DFA97 ey81z0fdz144tm84593ok38
143,622,068 *0DC966AE6CF90AF768003A6B13A545A720CC2C09 c'est.toi.qu'il.me.faut
143,622,069 *0DCB0B338BBD4A4257C955FCCA1893462D1AB232 CFEJK
143,622,070 *0DCA4DA91E6121D78E6AA1D678E2A7B2E0906D2E cfj:i
143,622,071 *0DCF060A899177632F3F93D4CE780CEEC6353BEF EYESADJUSTTOTHEDARK
143,622,072 *0DCBFEDE151769A49CABA2ADAC4DF1EB5C9BDE9F cfv=g
143,622,073 *0DCAC6089DFA2182B25D3FDD1105572E1506ACFD cg;oi
143,622,074 *0DC8623EB2175230CAA5981078291D550AEBC466 Chapter1022:TheMarauder'sMap
143,622,075 *0DCA8F0E4215746E8B16F1BE548EE00D95BEE9F1 charlieseykoski
143,622,076 *0DCD0F72B0D3BDD49B72ECF7F739CB0C77A729E3 CHARLIE.SHADWICK
143,622,077 *0DC31D0AFEDB9E22CE96905EAABA76BD0A0BDB0A CHAUJKYING
143,622,078 *0DC8A5F262FD2213CE08F76A39BEB122AF9F9674 [email protected]
143,622,079 *0DC69132825169442E4521887A12813E2F96DC7E [email protected]
143,622,080 *0DCBF6CB5F41767A6C8B141C752D812A2667C819 FCAMPRLQING
143,622,081 *0DC4AC97B606C73E04529862C1B4C58BF7D257D9 FERNANDOBOBROWSKI
143,622,082 *0DC4F2D52FF1600132E06630D3EFC3B105A49787 FGHVANESSA
143,622,083 *0DC03733766D03FD4603EC89CE2E1975ABC4EFFD CHLIBNE
143,622,084 *0DCF2BFA6F90E080C25C539505D9D5A36013F842 FICTIONSKINNY
143,622,085 *0DCACC9677DC95F42C6A1DE76BB40EA04C6E8106 fiitedop4
143,622,086 *0DC3CE292F07580D4ACD4AD117AD51DAC2DCE2C0 chris.eves
143,622,087 *0DCB89DEFC5E97FA2C392462D20DACAB93661088 christiantayco
143,622,088 *0DC22E30DB1CD1DCFA212CD7F288585C4F36EC26 CHRISTINA ONEAL
143,622,089 *0DCD8609CC6FA51C0ECEC6A2A37485729CDE4685 [email protected]
143,622,090 *0DCC2ACD17702E6B98D969A4DB5D403D83D8E38C christy1234
143,622,091 *0DC32BD18F89F4D65DD67DA7AA2EF08D59EB3375 chse11ed
143,622,092 *0DC959816A9EDE6ACA746F6DB761EEBCFD62F1C5 cigaraviation
143,622,093 *0DCA539B96D1209B608C7D35B453D604B186CA14 flashbackleri
143,622,094 *0DC90817E297FB1B1D9E12148FD25EC505EF3A2A fllmenged
143,622,095 *0DC4DA3CB9AE407393874334F4C45DA697C192D8 CIVILIZING!
143,622,096 *0DC962BC4AC4DA97D1228994A6052E18C2B080E0 CK;F1
143,622,097 *0DC98964A5C809A33DB714B9BA858DCB7C2D6BB1 CKPH
143,622,098 *0DCAF8E38C3052A28748A704DE3215A630A1D603 CLAUDWALGREN
143,622,099 *0DCCE973B1EFDD7C49C52CA7C03E632AA2837CC8 claytonpigue
143,622,100 *0DC47E1FF704BC65529976C4421C36C9869F94D0 FORBLACKS3
143,622,101 *0DC954CEE4B7D444FC1F78EE9D526843D058B73E forestdebiasio
143,622,102 *0DC05C109D400F679B0B8396A5FD506F78B68371 clementboshnack
143,622,103 *0DC19A084CFB0C2A94C0298BA5FD16800A51B551 clementerosendale
143,622,104 *0DCFB8BCA13ACA870EE81366F1B045F89D3C7F9A CLFRCHNING
143,622,105 *0DC11AD7471787CC6ACCE9A0F8CCA00274B242C8 CLINTFALZON
143,622,106 *0DCBD602F076C88D1668405BF4C98352DC5CEC5B C(LW0
143,622,107 *0DCE2E90DD64644551785E2982E59D13E8946465 [email protected]
143,622,108 *0DC0D5B842338D7A25179BAE8C0F91A5CEF9D6C4 CMAAR
143,622,109 *0DC50CB3A63113BE4E5F205FB899D2436034C388 cmr30
143,622,110 *0DC67CCD60C20D4FA460B6B07CF3B610FF51EC97 Cn#c
143,622,111 *0DCDB29437C26B71B8D69FF1F8FBDF8A748B3453 cnew
143,622,112 *0DCA0210C643BB4C1B7BFDE95ADA9FE6EEDF6B82 cnk2
143,622,113 *0DC8C344396B0D95288580B6F2F17AC02C79730C CNMARALZAMAN
143,622,114 *0DC184220AB36140BBFF350A6A4E0384B7D6430F CNNN:
143,622,115 *0DC1A4205CD35480A7550ED73A0A748185175BB3 c=o
143,622,116 *0DC10B9168D8F0A9D6F2EA2AB3E794112F030BFA CO3(D
143,622,117 *0DCE9403E41EDC205FC8EC00A6357204851979EA fredericspringfield
143,622,118 *0DC502184107AC471A8DD51ADE947606CFEB530E colonia組被認為過去是個海岸平原,具有沙灘,位於河流注入海洋的環境。在la
143,622,119 *0DC541B0C62D735DBC35E596DA300A0B35E32BD1 FUNDAMENTAALSEADUS
143,622,120 *0DC009B710D233FFB135994C3CECDCBE3B797BF0 ConcertoaduecoriNo2inFmajor:Atempoordinario
143,622,121 *0DC742F06E010AA7A115837EB13A8890F2A73C38 galileam7
143,622,122 *0DC036E4F3A0D14CB01C1CB10DBB65014943FA61 GALMGATS4
143,622,123 *0DCC7102471FB1708874DDCA7097D130833D21E1 [email protected]
143,622,124 *0DCB201BCF4B9253C9D2A69C8735C578BDF00B99 COREYCOLFLESH
143,622,125 *0DC0454F912449E750A3EE03E504614C21E72331 [email protected]
143,622,126 *0DC2AEE89FBA31C3E89AF4732093EC64E025250A GARSHUNI
143,622,127 *0DC8AB5B66154808E212D7BC75C7CD6B545CD511 CORNELIUSDONICA
143,622,128 *0DC01EE9FAE73365C50BE9A391E5F3A576ECB287 COSTUMEDXMAS
143,622,129 *0DC69BD61C213BA4E6BB0C08D60E963975F084F4 CO$TL1NE$$
143,622,130 *0DC25C8282A257CF75EE0755480E74927C9C8B61 GBARTELS7
143,622,131 *0DCAEBE136D037F422B47A478BB698A73D687546 courtney-stimmel
143,622,132 *0DC3E13335D04653C70E5F59480D6A13B0400A68 gelsini
143,622,133 *0DC94B2A14CA5BE4B8E0375D9869ED96B49CFF9E [email protected]
143,622,134 *0DC5BAF0D289CABA29CADC475320A000B5DC13F1 GEORGEANNE
143,622,135 *0DC58D6EF197D52850D320C272CC574FFDA798F0 GERMAN.KRYSIAK
143,622,136 *0DC57D9ECFA181003956ABF6F99174CD50F5CC73 germanribero
143,622,137 *0DCF2E68187E08C99183C6B28873EA123148A969 germanwillie
143,622,138 *0DCCD6F2AAADA6D481F621123FFC42B44793A476 GESWAWEL4
143,622,139 *0DC71347498D84477D52EBD0C01785C57B907A8E c)q6
143,622,140 *0DC5B45C11F9A302B4FA73C0FC1B0C45CFD8695F gioseffi2
143,622,141 *0DCAB2AE0DDE87FAD9BA27E060B7B5D11B82E993 CREALOR0
143,622,142 *0DC253B840F806891D861FC0E7B04098953ED571 creshola9
143,622,143 *0DC5D26E0B4F0FBCC2D5D0E5471E25EC6FE4889D GLENN.HETLAND
143,622,144 *0DCDFBDA2C7A35DAF14AA663D2313436E8F77FB2 glowng
143,622,145 *0DC75747186D43B15E62FDBA41846802523C6508 gnikoole
143,622,146 *0DCFC181034751431E96D35CAF3BF464656C135E GPACHNIAK
143,622,147 *0DC2C93DD1163F55515F3653154AEDE70C1CD9C9 gpc5
143,622,148 *0DC3F17A62EEA8F2270C84C3E1C14A15F891113C GRAV1TAT10NA11Y
143,622,149 *0DC86B64FCB053143B639821CD91E9FC8320DE34 greatquotes
143,622,150 *0DCAF0ABD945F04B7460187DBE2CF33CCC4D7610 greendayhappyday
143,622,151 *0DC74FD533EF9FA61121793020A86E00C911BBB9 GREG.KRUML
143,622,152 *0DC9D6D9F03E77A35B9F9149937B3ABA40EC8F78 gregorioemshwiller
143,622,153 *0DC2AD71306644C2837EDEAAB278DD3D43C4A3D9 CRMVM
143,622,154 *0DC5BBFEE68F48888316AFA531244BAFC46BD549 C,RRK
143,622,155 *0DC8BD6345CBBDE6D360DCF03A903ECFBF778707 grubnedek.1
143,622,156 *0DCA354820BFD0D14FD8C264FE0E1D2CE84B70E8 CSMIBSW8
143,622,157 *0DC11501E0C3AE1AEC87A5AFB1C3E799ED3FB025 c-t?%
143,622,158 *0DC8A90605ED74BB45544C7EB9DA9D76769718B3 CT6S
143,622,159 *0DCFAB4AE7DFCFFCAC9B6058BD74AB43FE306B80 CT)CI
143,622,160 *0DC390C31183F11BE5F069528DE2ECD5B09D19C9 [email protected]
143,622,161 *0DC0A683E9CF5E10F41DD869226253C93B22D1C7 CTWYI
143,622,162 *0DC5B34B9CD188DA5F743F367BD16CCFC536F8A6 guscheesebrough
143,622,163 *0DC54F590C59C6EA522245A0C7AB94D3854BC195 [email protected]
143,622,164 *0DCD8925F7BF66229E528103BF6E478EAEC97669 GYYKBSWING
143,622,165 *0DC523DF8508D3EFC148660C31ED703B7018BD5B [email protected]
143,622,166 *0DC05BC485D384A5D2EA13F488586DC8386E4C93 CULLEUS2
143,622,167 *0DC4B6C36282EF6DB4CFD365C885ABF0C18B4EAE H1182
143,622,168 *0DC25C17D50BC1CA76D89A0690CD1DDC8B2B5F83 H9768
143,622,169 *0DCD658178FAFAF1B780F0B9255B5E95E48B08B3 cuu"g
143,622,170 *0DCBD27A1C274A6BB1CE3BBEFAA7317917B10602 cv5co
143,622,171 *0DC454DD1CF421DC7FDA9D5296C005ED63BF63A6 CVALITALO
143,622,172 *0DC720F45D140B4D3F585384710D44C8891BACC4 hakon-builds-his-boat
143,622,173 *0DCADCB5C71FB577836CC73ADE8D8469866D6620 HALL-HOFSOE
143,622,174 *0DC039D45FEC750D127E10A9273893153ACE4E4D HAMZAYAK00B
143,622,175 *0DC3433F4A9F5E3CACB54D75DC0CDBF72B7A2F95 cwahb
143,622,176 *0DCC8A26DD320C1234FBD2D67F84A93D0555FF18 CWETKO
143,622,177 *0DC79AE7F7C370998E5002EEC4BF6828F3E54FA9 haplobionta
143,622,178 *0DC7D86B5739F4B86E67A853CF801A75C7DE8B94 cxm8p
143,622,179 *0DC42DFEB788E188C11868FC6088B283BAA788E5 CX.N"
143,622,180 *0DCE3CDC91B268BB879B50FD05B611BE311DFC7C [email protected]
143,622,181 *0DC1F420AA822794646A88BCBB6B1DB4D0494F8C cz(+
143,622,182 *0DCE9B47003AD9B1EE86E5B4D946F4F56225B29F hassangirgenti
143,622,183 *0DC93C2DC699DE157B5C33E670FD7962012699B5 HAYWOODMENIER
143,622,184 *0DC58DE340FA9CA7B709E23B1C6373A819863420 hazelann1
143,622,185 *0DCE2DD5D538CB5CC5080B13FED1FA22A766DD8F HE"
143,622,186 *0DC1F4042CB503F33BE3CC74FF9DD17764F9DA3E heavern4
143,622,187 *0DCB4A32483C26FA06F1A5D1E684CDF50CD46686 HEIDIINBERLIN
143,622,188 *0DC6B4698CB59C14CD189F7591A3AD082A10C940 hellphones
143,622,189 *0DC56E1093F053B26900BA80196E5CCBB1560265 d+3ef
143,622,190 *0DCD0F30778ABA8E2387FB8A563901557B8908C6 herehuise5
143,622,191 *0DC68AC0ABE6B4B20658E8CD5A02AE1A823EF365 d4(wm
143,622,192 *0DCD7A8DCDF4E1ADE3EED3874FF3E643A7FFCECB HERSCHELKAMMERDIENER
143,622,193 *0DC7A1E1AABD95E3436F0D50D5DF843E8F9C69E1 D50TT
143,622,194 *0DC8FDEB22ECDF34BA7FBE58C06361F84D5962D7 HERSCHELLEMLEY
143,622,195 *0DC5E973A9D5220028217F154843E80280351F29 d5ggc
143,622,196 *0DC7F2296848AE46F8A1C4315374B0828185FDF7 d60cl
143,622,197 *0DC078EF772219968F8956ACB349C2042B5130AD D+6O2
143,622,198 *0DC07B5E0EB008F919623F39FE0090898898B18C d800
143,622,199 *0DCAA0E1A50DE784D545021376588193081E497E d8)t%
143,622,200 *0DCB1B0BE270164E46C8E74ECEE45B3D7C73E981 D;+9A
143,622,201 *0DC8BF028600712215ABBB093A1C211776290C59 d9ubm
143,622,202 *0DCDA6E82A6A86CEAAAE9217DA8DD845F37596B4 da(a6
143,622,203 *0DCE9AB3CAA3414EC6ACD359F77EC8B18E12CBC7 HIPPURITE1234
143,622,204 *0DC56B25CAD4D10C4F5DCEFBFFCDAAF4F5048595 HIT EXPRESS
143,622,205 *0DC255A6E61F2AE27E42FAEDA957312DA272E4C9 HiTwiggyCheesecake
143,622,206 *0DC807EB664104F1ECEE619DAD53F2E3A1D22CAF [email protected]
143,622,207 *0DC5059723D28754F1CFF3B7DB9F6E53DE357271 HOBARTHOBART
143,622,208 *0DC1B59A43F0294A7651336797D1527A7E67BA65 damianoakes
143,622,209 *0DC1E36AF23B056D0DABB718AE2A972C9D11F286 DANA.DAMAS
143,622,210 *0DCCE42E2428CA2AC26F64CB1FA5B87043C9DA57 DANIEL.TRECARICHI
143,622,211 *0DCC20D0E6B99C7323AFFF4664D224C2521883EA hopefulmonstersaredyingeveryday
143,622,212 *0DCF1FDA0989219FC88DE7BF9D30055382667A8D HOPTICALBENCH
143,622,213 *0DCA9A198E2D7E6499DF7E62DC93C1F97C7BCF59 HOQUETAI2
143,622,214 *0DC7A54B47E5581497CA412148AA59039C8D0F78 darincasamayor
143,622,215 *0DC34B60E2EC1DA0B042810226982ECE19B50E76 DARIO.DELOGE
143,622,216 *0DC01E3E61DA66C6B2F4B5E945C93073B6D9C61F DARIOFLUKE
143,622,217 *0DC481F1073F8884FEBE88B2339220276E73C8A0 DARWIN.KEILEN
143,622,218 *0DC6F0264C348153FFB9E23E302268A62E2E57DF HOYTSTVIL
143,622,219 *0DC0CDB13DE151663D5277B8CD9016FFE3E18BF5 d_at0
143,622,220 *0DCFD630C74ECFB9CA83C23664260ED241196B93 hpinnbsw5
143,622,221 *0DC1E32422C68C461733C93C64523A59242F0217 daudens5
143,622,222 *0DC041603B7C869444F498F7A72E5D8956001ED4 D(A(V
143,622,223 *0DCF3E97CB4CAD6EBF37EA7FCA657F778671004A DAVID.AYEGBA
143,622,224 *0DC1112DC83D7BC821B06C17E99C44F819ED9BE0 HTTPWWW.ATISMA.COM
143,622,225 *0DCBC3891895F743510B12BFB4239F78B3647E6D db&g"
143,622,226 *0DC99696B72A4832F0D47B8FC2B3416C1F8F7E25 dbgqq
143,622,227 *0DCEDF6C26E8A1117917F293D6B10A00EBD8FF59 DBTK+
143,622,228 *0DC5596CD111F48BCA56ABDB326D966740DFDCA3 hubertrack
143,622,229 *0DCD32E5029C42A1240CD3FE70BBCCE701FD3DFC HUGMYNDIR
143,622,230 *0DC242B0EA54E88ABB3A41BB7C30B017292E1BC8 d(c:,
143,622,231 *0DCF994623BFB2CBCB982945EDBF5B36C214AFCC DCLAWSON5
143,622,232 *0DC2797A27315BCE34C0880683CFCF24C448CAA6 I0M6L2Y
143,622,233 *0DC3CC8C5C8B1C4EF51853D0CA53711645CC64AE DE5N
143,622,234 *0DC08A71A17AEC7D3EECEE8CBFBC628D9BD0F39E IAM1Q2W3E1234
143,622,235 *0DCBCBD932DC1B07690EC1E608F93BC8188E8E5F DE,$8
143,622,236 *0DC1B5FDDFC359E9CFBEC57D6862CB1AE51856A8 DEANGELOSEDOR
143,622,237 *0DCD159F609E5AACC53511CDAEC9E3AE1A2FA28F deanveith
143,622,238 *0DCF0795DF0FEB9B229D89B1B2B761928D7CE7C0 IAMMAIDEN95
143,622,239 *0DC4A2F52C8136391428FA006C05D033C966CE89 debi.vance
143,622,240 *0DC3A54ECAD790FC587048523522418A2BCA5668 DECEVER$
143,622,241 *0DCE940DF38E090413F19AD722762F6451353804 IANRAMOS
143,622,242 *0DC132048F860897C4E18FA697E1AAE00E19961F [email protected]
143,622,243 *0DC82FB81AC4BA8447030144AB8197060A3809CF IBOLUREI3
143,622,244 *0DCF8152C686DCC4EF571E52F0FF8DEF240D1CD0 DELMAR.BASEMORE
143,622,245 *0DC9CE1B2AE7C433D1E8F147B1025A1491ACBADF delogeant
143,622,246 *0DCF1B83DA63FCD53563C7B25D9001A18697F02C IF-E$-=-"9"-THEN-N4-=-57
143,622,247 *0DC93CCD106A0B321E7C3493B17242D007061758 IGNACIOBIONDI
143,622,248 *0DC899AFBDAB7AB8187329C568CA98DD199C3672 dennylipoma
143,622,249 *0DC0B9B82B5CBAFB1BCB942CBD38E41560584F9D denvercruzan
143,622,250 *0DC3CEF1BDCD0F12BEFDBF1CFD0ABA594570ECBA [email protected]
143,622,251 *0DC69165FC76288891F5C1FA1AF6DC8287E2DC28 DEPENDEINTES
143,622,252 *0DC5C388C34CA84B9270E8C05F3760580DC1F214 IJNEUUHS9
143,622,253 *0DCF2864D459B671457A04F49B0E817964CD7678 DERM4+OLO9!$+$
143,622,254 *0DC5B82B70630A7955A756BBFC708693839D717A il iubesc pe alexandru
143,622,255 *0DC5975F7B7239594E51B73D2535906BAEE008D8 ILOVERACOON91
143,622,256 *0DC1C899ACBD02D327C9ADF72E8E2C008071FF8E dfic!
143,622,257 *0DC4198E9056810DEC7CCA62B6EBB320E96AA7A9 DF)k
143,622,258 *0DCBF7EB07A941FCF3091D97116FD3E948113D95 IMPENITENTE
143,622,259 *0DCE1C18083FD872511B9CF5E643B0D6DE4FD3E9 I'm.Starving
143,622,260 *0DC765D754A31006D22D179C3D2A994FCDBC1A16 dg7zd
143,622,261 *0DC0A521DF1489D245B2B84395E58A759DDDF6D0 inasilentvalley
143,622,262 *0DC214CA49E4A9E2F4479A9772282B63AEC05C3C inch04tely
143,622,263 *0DC0FF94761895C839B344DCE01BDEF40191219A INCORECTLY1234
143,622,264 *0DC03151D13CAECE85B7A19357DA6549C81FD19E dhbk#
143,622,265 *0DC45CCA1CC43628D457C06539A23EB9B22597CB dhm;n
143,622,266 *0DC28D61EE081E2E90FFEED90BF8D07469DDA3FA DHP(
143,622,267 *0DCBB84C23D782FF94197294F48B05857B3D0DC9 di5xd
143,622,268 *0DCA850C0C1D8530F06B2CF81709F211E68DF822 diehiul
143,622,269 *0DC51278BF8872080054C68F4A808B43A4D34EE9 INTELUS
143,622,270 *0DC14D7BE363BAC7A49BFFBC7063468AFC4DA8EA Inwippen
143,622,271 *0DC4B1364918713CD09003E8A35D378E46BA88BE DION.CLINKSCALES
143,622,272 *0DCDF6EE39A3400855AA8C1C2AF138B993063AB2 ipomoeaquamoclitseeds
143,622,273 *0DC9F44A49497BCA544B89892D3AFC898F29E46B IRIDE MARTINEZ
143,622,274 *0DC37957AF6A5718FD8AFF95BFD9C7D9F4A9FFF5 disproofd/I/s'pr/u/f
143,622,275 *0DC746BF9BECD3ED7FA146A4DED92BA279413DCF DISTRIBUTIONSPLATFOR
143,622,276 *0DC102398B8C3CFCFE3B5F4BEA367EACA2CFF45B djgrr
143,622,277 *0DC113A1E2DCEE2AD9B5930496DE90ACF4905BB2 ISIAH.GULINI
143,622,278 *0DC1B6BC703ED936F014B36EC4F36221768D7415 ISLANDMUNICIPALITY'S
143,622,279 *0DC22B9D8B35DBF5C66EABCA31D23B065A00BD43 ITANTIUM
143,622,280 *0DCF7A384C7AF651CAE4051FA9F1EB9A59366DD4 DMke
143,622,281 *0DC77B812ADC46A658F95196E547060749E5EE42 DNAASREK
143,622,282 *0DC4494A6B86126B88DBE91051A5777F57EB74E4 ITSELF151617
143,622,283 *0DC5174676D62F8B061EDD02DE0D2021B2D96121 izgarali
143,622,284 *0DCFF5B2681BABBAC76B282FB9F76D877FE50FF7 DOlC
143,622,285 *0DC1A5066FCC2634DB6FB877782B73936464F6E5 [email protected]
143,622,286 *0DC4802E98FAA9C5265F977C7F9F9C54E910967B j6Z
143,622,287 *0DC370733AACC92297496F2F65A501CB411EC9CE JACK-CAO
143,622,288 *0DCCE8E2725CE80A6407F06482A4F421AB030691 dominic-goldman
143,622,289 *0DCAC86E8407DD30BCB21D82D6F9E9B8A63DD0BD DONALD-HOLLIS
143,622,290 *0DC9BDC0B354C86F2B84CBCE36854975C555E8CB JACOB.KHALAF
143,622,291 *0DC31FC33606745B0B4E483D5D2F1DFE8A61696C dontebraund
143,622,292 *0DC30F32C236ACF1117C57F480D1C4EB84340551 jamelmackay
143,622,293 *0DC6B597D07CB2551524C5A3E4CAA05E680479FD JAMIESTEPHENS
143,622,294 *0DCE9353662940BED66DED27C1E47E9C7BFD0E96 DPDQVMMI
143,622,295 *0DC44865FE8592E074225666A32F023A8050F871 jasonlevey
143,622,296 *0DCD67111759063CBA88F84A2BE1D4AA1CB08E4E jaspersidney
143,622,297 *0DC7736C5EA80359119A3ED4474FD1DC836B8855 D-QDW
143,622,298 *0DC654EC196A369B1A2140313ECBBE7DB30DA647 JAZZJOSH8
143,622,299 *0DC3DB002DED85319607E9C39331217F83BBD8D3 JC.BALDON
143,622,300 *0DCF999E417A4C5946CE9112F4B121F86C1B1C23 JCGIRVAN
143,622,301 *0DC8F789CAF98AA14922EE2571A1257A8ACCC7F2 JEANPAVESE
143,622,302 *0DCE71475B505F9CF64BFCB34D08485EB3B6D46D Dream-on-Black-Girl-(original-Sin)-(original-mix)
143,622,303 *0DC33B6DD26878371602D9FDFC8E0BE2AAEF2111 DREW.KACZMAREK
143,622,304 *0DC278E0EE213A644249C08E8C4EFA1D55571115 drl2
143,622,305 *0DC0D382F7DFD64774E38E1CB1A421452955374A [email protected]
143,622,306 *0DC11DD99EFBCEECA81E0960F3E315D51C33C4ED JENNY.DILAG
143,622,307 *0DC44BB264333E69C0DC6847CAA680121617A542 JEROMYKRIKORIAN
143,622,308 *0DC321E8CFD1D3B0634E02E2A0192AB35863FA00 DR+VQ
143,622,309 *0DC988AD01960D9D883107F36222679E2467E2DB dsdijvvh67
143,622,310 *0DC57A4B4199727797C71D0938737A5622315F96 DskM
143,622,311 *0DC1BD6382CB893F4A5DF79D308AA87A12F6A677 D#SLN
143,622,312 *0DCAB8D6DF29EA8C4D9AA87A698239D2769CF03A DU)R8
143,622,313 *0DC47B0559B061D50A413C658A786010A6376333 JESUSBUHL
143,622,314 *0DC521E5429AFB1757926C57DBDF137A73E98E3C DUSTY.CULLOP
143,622,315 *0DC6B310135CC4A9C01B6D9FE431106606E9FB80 [email protected]
143,622,316 *0DC785369C8D036E8E977A7FF0EA835DA63A08BA dvp-w
143,622,317 *0DCEC800134CF7660C8B5B6A1F7F7CE1E9D54C17 DWDRR
143,622,318 *0DCC24884463B45820E55BE25BF3DF60C3579214 DWF#?
143,622,319 *0DC7CE9147A8529A18526BF9831F0E6721A8A53E DWNEN
143,622,320 *0DC63B376DCCC6B48FFD1420251D637464680D87 [email protected]
143,622,321 *0DC5C0635177967978776B2F14BE5720AAAECF50 EA#8D
143,622,322 *0DCC9CBB885659EB2C9B945EB9918005AF82F703 JOHNATHANBEVER
143,622,323 *0DC16744D1EEFDA7BD7129AE536F97CC06945FC3 john.lisiewicz
143,622,324 *0DCA957FC79A7425775FCCE0891A02E124FCC444 JOHNNY.GASBARRO
143,622,325 *0DC3C5BF0DCEC44DB340C09EC3F1A343FCBE5EC1 JONAH.KOTTLOWSKI
143,622,326 *0DCC407F65AD7922E93F1C6CEEBA485661CD437D ECF0R
143,622,327 *0DC4DA8C04AD4EB342F77A95DBF5CC84F953A680 JONEXTHREE
143,622,328 *0DC7124CB02BD919A0102EA7235C2A5BD8E82128 jonicetaylor
143,622,329 *0DC2C109D2A51C878AF592FD3BF89917A10FD1D7 eddiedoom7
143,622,330 *0DCF3A15E44CA10B60ADA0B2571CC2EA6DB0DF69 JOSE-LUIS-GONZALEZ-MARTINEZ
143,622,331 *0DC71609851A9C8F35D986115641C01853569F4B EDJ&$
143,622,332 *0DCA9CB0F35E860E412C6FD97F2C965BDADBEABB JOVANOVICPETERSON
143,622,333 *0DCFE089AE0B0CBF4FD33F7764BEB225AA26F304 EDY(
143,622,334 *0DC0CDBBC271B6584EC07992ED3E4E0A658BC73C judembonu
143,622,335 *0DCFDADD2BDE266DF5D9784C6C3710F66A3657A4 JULIAN.DEAGUERO
143,622,336 *0DC8678C3A76892B24B0B60864ACEA3170C08658 ehr+
143,622,337 *0DC4CF3C9975D6A77AA88461529A5D534C367981 EITACIDB
143,622,338 *0DC57C61DA65E17A9FF0C14568734C624EADD6E3 ek"ty
143,622,339 *0DC4B6FE8656959B955BB08A1975CB0276EFD41A KARLBRANDOLINI
143,622,340 *0DC9BACD418B54FA30F2B9C5560070F4F960474B karolinebarbe
143,622,341 *0DC8B9324761E6FCE81E7AB93DF3DA9DB9F35943 ELIFES
143,622,342 *0DC52406482F17F1967D12C090574730F06355CC [email protected]
143,622,343 *0DC339B2D7210D652A8F09374EBE3C843F9837D0 ELLISMORAD
143,622,344 *0DCFF6373BE155B5E9F7A307547D76532D2DD096 ellsworthcaprio
143,622,345 *0DC549D7EF967A8972BC3817CE93529DF11CE24E KENDRICKMEDELLIN
143,622,346 *0DC5F96529C3C1B1A815F1347E8D3325433AB36D kennethiacobelli
143,622,347 *0DC315952973C8E6183A4176F991DB596CAD5250 KERRILEA9
143,622,348 *0DC8FD6772FA43DC3B54A5C9AE4410E5F00C5126 KEVIN.FENNIMORE
143,622,349 *0DCF05F7769356D9C8C0F81DD522A3D1BE02D90F emailclover
143,622,350 *0DC75BB9FAEE287B8337C07D9E6BC816428F3CE6 EMBF
143,622,351 *0DC2D4F1D7B94E795AEE482BC6838B34F6C1DE10 k,ibaa
143,622,352 *0DC2FFD4BF59EE4FF02D6176D5D3C550328D7A60 EMIGRATEUNOFFICIAL
143,622,353 *0DCE6CD197907A9C835C26841FD0834566FA4AB0 EN219.166.42.68
143,622,354 *0DC76F9D8B0D02155D70705563F835C54B783515 enchanted-designs
143,622,355 *0DCF50DA34760BD3C378EC60F694F8725621F3B4 enekorbegging
143,622,356 *0DCB6092CCC268AA75021FC97C5FC4B53564E2F7 engel.in.my.wasbak
143,622,357 *0DCCBC413C753B02F5A4CFB1F7DA8359FC9CF822 [email protected]
143,622,358 *0DCC82D4A4DEC9068DC6484685E91FD513D4C55A [email protected]
143,622,359 *0DC7EDBDD64803FB5325A82603441D0C903EBFF8 KLARSEN2
143,622,360 *0DC1EAFF6214FEC54213EBFCB89A38F66A7CF340 EN+;R
143,622,361 *0DC758EC072B868D4EC879E32519A89E9A46EA2B klove$
143,622,362 *0DCC7D9CFBFD033753ED5E826801EE38237AC813 kmirbel
143,622,363 *0DC01FAD1350320C4BDBBE7D09FCF122377980E2 entrancedenying
143,622,364 *0DCFF892E12A516D59637A151C2C8C4DC1C7B4E8 KONSHAL
143,622,365 *0DCE7F5974AD6F7DF6D67483AC209B0DC9B0059C KORMIDELN
143,622,366 *0DCAFC69AE3234C49DEC31F5D88986E759E30BD8 eqaep
143,622,367 *0DCA343118F8FC9AD5AFF775B370B1367D523A9A ERINMACNAMARA
143,622,368 *0DCB4DE61F70EF94CFDD23329874618FB3A8C888 ERNEST.URQUIDES
143,622,369 *0DC029A34F23281919D7AE05F3552688A26A8159 ESILLATSYRCRETNI
143,622,370 *0DC44BE46B804B7F2DE10F9BC68BBEC1D6CD9F20 kylalouiseporo
143,622,371 *0DC2F400ADDE01715C1BCEB8428B9E6B9817F9B3 esstured
143,622,372 *0DC754BE9948198E7DF9A650337B0D8512777054 estonis
143,622,373 *0DCC06B35078B50F9D83B37EB57EDA2D3E23AE55 et1ia
143,622,374 *0DCFFC126E0063B873C87E37C53A9805ACF7F609 Lakme,.Flower.Duet.(The.British.Airways.TV.Ad)
143,622,375 *0DC8947A400196F4D43AD85D0635AC6336062601 LAMP00N157
143,622,376 *0DCA01E8E0336AD2CB5713117B0859770C93479B LAMPREYS
143,622,377 *0DC4CDDDA5A0648E05373E681DC09BC0C832D27C laurabroussard
143,622,378 *0DC8FFDEF4AD19D5271FF3BDCAD8DF18B8568937 Exultate.Jubilate:.Alleluja.(Lucia.Popp)
143,622,379 *0DC67F23BA920ACFB4754168BD2AB29D09814AC4 EY_a
143,622,380 *0DC56A371D601F54B032602CED34B4CA9A2B0731 LAWERENCEDELFIN
143,622,381 *0DC898224CACA8502877344DB5919D2E20AAEA03 LAWRENCEPELL
143,622,382 *0DC09945A8E61E7A6CB35A5F6CF148F4402FF4DE leaflessness?
143,622,383 *0DCE5CF50CDBDE174A06267FDAC2BAD493EAA9F1 f477ie5
143,622,384 *0DCC46AF1D466D68F47824EC42DAF732075D3B86 F=5
143,622,385 *0DC679CEBA223AE045988CC0B4A328AEE9388766 F\7T
143,622,386 *0DCDBE05747C36C291409AF5FCE055DD230D5D1A FABIAN.BURG
143,622,387 *0DC542BC3D06F327CFB14855CB1892B134072436 faixesurvienne
143,622,388 *0DC1F88B5538281C77837511919E2D1FFBC69F86 faji
143,622,389 *0DCE898886C1A044AF837680E5256E34978C0BB7 LEGLAPOSABB
143,622,390 *0DCE7840E3AB79152CFE0E11378ECB7B9F2A2416 [email protected]
143,622,391 *0DCB6CC2EC7FFBD595401DC27F4DA257CAC3EBD7 LENJULOCK
143,622,392 *0DCA848D82793D14FB9A7FAEE85DFAC8A08AE83F FBB95CFD
143,622,393 *0DCEF03E327F72DFE7BB63396587921612B93584 LESLEYBANNETT
143,622,394 *0DC60517193C74EF3B106F2C94C6944D64E03F55 Lesroosters
143,622,395 *0DC18946ED875606411EAD7FC38E2D919260538C FEBRIANARIS
143,622,396 *0DCB110FA65610FEB4E1247682CEAF067CCB2815 FEESWEEK2
143,622,397 *0DC9A22C6ACB167ECCE03CBFA8AC950E9C42DF44 LEVENSQUE
143,622,398 *0DC06113E0B814FB952AD36861691D22B553CD92 ferreumed
143,622,399 *0DC933DBA5E3A6BEE1F6F6D48D05A3B78164AF47 FGSJAP8O
143,622,400 *0DC990B95BC976D866A727732B4ABB3FE291C46D [email protected]
143,622,401 *0DC466E98B13DC824BA7F8F89939C6EA37119C11 FIESTAS
143,622,402 *0DC5241786BFE0E4F2B1801FD197BEE27830F0F4 LIBRA7275
143,622,403 *0DC10C11B1D738866B3FB74B9140AA21FB581734 [email protected]
143,622,404 *0DC75C1051ED41E2C55E98E34CD812669DE634E6 lighter n: lighters
143,622,405 *0DC6FFAF192CD480C2E2624829897433B5E25052 lindseykanode
143,622,406 *0DC9CAE43D4DC9186D41CC4A1EEFD6FB5B0D7A56 linger-a-while
143,622,407 *0DCD6418F6A1EB13FA47EC02A8594F888B957F95 FLORENCIO.KLEFFMAN
143,622,408 *0DC523D09AEBA1AE0FFF2807E14C0C1531DC555F FLORENTINO.ZIEMS
143,622,409 *0DCDCEA66017ED265C7534B8783A3D0E0C19F7B8 FONTAN311
143,622,410 *0DC11C82782231CDB0446C056EE95F1B4D35DBF4 [email protected]
143,622,411 *0DCBE5FB3E380618736A6F7B0025DD9FA352E1D7 [email protected]
143,622,412 *0DC0A29DCFBC357ABFD9F7C179FCEA29894A6852 [email protected]
143,622,413 *0DCB7B05FFE784F6D3902371EF3D9B4E3CC73F6A FOTI
143,622,414 *0DC88FBE78F3C9862BEAE64A35DFABD520B7A7BC LONATEM7
143,622,415 *0DC9AAA222A73CCE9F08CD1BD2C81937D87D680F FRANCESBANDYK
143,622,416 *0DCD8F17CECCE211CCCA423E73FFD314713368DB [email protected]
143,622,417 *0DCA5F4C6045BA55D47FA7839F29E7BF531C40B5 FRANCESCOSCHUMACKER
143,622,418 *0DCA667B34C5EC9FCE9396CE97DD3D6E7572CFB4 [email protected]
143,622,419 *0DC7AE57C89038D706D39470191948C0042A3D12 LONG.PORRIS
143,622,420 *0DC6018B30B03967ACD6CBDBE5A2BE55ABDB8294 FRANCISCO.TABET
143,622,421 *0DC30E061A8D8EDECEDEDAD957914B7384900ECF LOOPFILMMAKINGCOLORADO
143,622,422 *0DC5432AD72F902EF72DE0DB1DC48151DBD6DC84 LORD.ABERGAVENNY (ABERGAVENNY:)
143,622,423 *0DC6D982A5F9C169C6AB4395535A205E4139C4ED LORENZO.GOTTARDO
143,622,424 *0DC00D38095E5ACA88C3CCC24985C54D5B9C50FF LOU.COLANTONIO
143,622,425 *0DC383A90A9040C4D35764E62D2AA6C3B0E1621B louiespuck
143,622,426 *0DC755777AE814F5EF5400888999E380E998854E freund-freddy
143,622,427 *0DCE37819FBB3ADA3312C5957CD79708786FD7E6 LOWELL.BROWING
143,622,428 *0DC758A5D4570FC400CA6F84437AB41A84CA422E frisella
143,622,429 *0DCB5CC4DC2E3C631404734A19EFEBD1686BFF48 [email protected]
143,622,430 *0DCA7F94039002D53CEEFF94242E796BE1BB3B1C LSUN
143,622,431 *0DCCC49C0BF8F5D5E7D00D07D809CCB09849A4D9 fsolli
143,622,432 *0DC62831B8446C9D4A52C9CF89DB9C01E7E4815E fujigata6
143,622,433 *0DC5E986342C39E82C68A00E2BE7F02B87FC93E2 LUCIENHITZFELDER
143,622,434 *0DCDC5498A8D6932F9A91C12B2FA47071B47EDE5 lucifé
143,622,435 *0DC14D3AC6BFE200C8B174A82EC3B63A079A49FD LUOXIUSHAN
143,622,436 *0DCC801462B4D202FB568ABA5E1134C76B28E195 LUPEEBRAHIM
143,622,437 *0DC9538A9373FDB76846C7A24B9B87BEED9D032A GAALPOKING
143,622,438 *0DC8134ED618E05300D9B79B402FD4A4C6CFDBD9 [email protected]
143,622,439 *0DC2D652B8B16FD77B7D5704216C04ED0EFF4850 [email protected]
143,622,440 *0DC9DD983DA02FAA3AC7D2F759814E6B33EC9171 [email protected]
143,622,441 *0DC0A922E4FF2649EDED4D80E338F4BB60ACF756 m!1que70as7s
143,622,442 *0DC83BEBB705E8D31A7930440D533E3A0AEA2E79 m4n93$t
143,622,443 *0DC921EE5DD7CE6EC351C19BF7E496D05CE2FF7B m5sx
143,622,444 *0DC2BAF8A8AC565E7002683158033270FC35DF4F garrylorey
143,622,445 *0DC36E4ED75C2C5B3D3CA1AC133460D95E82B85E [email protected]
143,622,446 *0DCF1258753C4DC558F0AC2E8A49A92F9F5A8D77 MAGICALIZES0
143,622,447 *0DC15613D5F5807D5B605FE6BAA458B5EC3CE789 GAVINTEAQUE
143,622,448 *0DC96710A09E03D7595EF831F9D9E77E4345E609 GAVINTRIOLO
143,622,449 *0DC6E0A4D022E9A9128184B418C8F413657A5651 MAISTRE4
143,622,450 *0DC279F7AB226346AEA080B69C4622409EC5AF38 majorklem
143,622,451 *0DCE42147E1166451A6D8D921868D5EBDF839DDD MAKEWEMERRYONTHISFEST
143,622,452 *0DCF21843CD8C7E1BEFF19BCD6AFB389650FD506 MANDROPS
143,622,453 *0DC0DBE076EF154378ED6F71BF1FC097880B8F78 MANOLO_
143,622,454 *0DC6263A7F1FD729329A262C3502727E3D05E794 MANUALZETZER
143,622,455 *0DCF1F5B733B085D16F7CA244D0A67D5096CB8D5 genewesselman
143,622,456 *0DC4AC544600DA3F8EEB7BD390F6F1E4F24C92E1 genio-y-figura
143,622,457 *0DC68D64DD615B18449C23C0CD1DFFDC18337BA4 MARC.AZUMA
143,622,458 *0DC1F897B8F4311FEE67DA230F00B2E5BB4C2457 marceljuett
143,622,459 *0DC4B73AD0E1D7AEE809C5434A37CB7301EA086D GEORGEANNE
143,622,460 *0DC58D6EF197D52850D320C272CC574FFDA798F0 MARCO SERVILIO P
143,622,461 *0DC2F0DD1ECFA8BF91FBEE2E63EB2C7BEB6A6755 MARCOSLAPSLEY
143,622,462 *0DC413156C27BB5D30513EA60F272FE0D0A863C3 MARGARET.KHA
143,622,463 *0DCA74BD77F5FB94EF56ABA2D82940806933B82A GERARDOROBERTI
143,622,464 *0DC10DA6BC90DA947C2C6B5528296BFA0E68E857 GERARDO.UNDERCOFFLER
143,622,465 *0DC4B915EF6F274C507DEB83E620FCCDB2768218 MARJAPENSAAT
143,622,466 *0DC3D7813CEE276DF3D38BE8815BA3BD4FFD30D7 MARKMUNYON
143,622,467 *0DC45A0760030B93DA29121BA93CC18E9BEA7DF3 gi0e
143,622,468 *0DCCF5A41B540398CA34FEAE6E51F07D6B41EE8C MARY.ANN.MILES
143,622,469 *0DC9E402C85F95E144FB1BBAA284318A4B23731D MASEROVÉHO
143,622,470 *0DC6C28A4BCCF4C911ABD5460AD55CADF583C99B GiuseppeIelasi
143,622,471 *0DC183EE885C36C150AA2CCD640035F5EA52E3DD MAURICIO.DALLMIER
143,622,472 *0DC00709E4AFFE3EA92C5FA55F01354839B5486E GMCBOA3188
143,622,473 *0DC6D508143DFBFE60A673DC3406913309AB71C2 mcdonnell-douglas-services,-inc-|-saudi-arabia
143,622,474 *0DCD2E7A5F335480F285353534A73D7A3227D2B0 goatasdfghjk
143,622,475 *0DC130EE6919A8A20F7A2E7A7E6EC8B7C28AAD0A ME7A$7A$ZN9
143,622,476 *0DC55D9DE88DAF34029C9D39F7365E0F74B28E3E MEDIAANDISSUES
143,622,477 *0DCE2AFCBE6D71495A42B31EBF9F389CC3E384D9 MEERSAUPAULE1
143,622,478 *0DC6084F7730178A498995F2CB364AA1DC740643 mehr.shah
143,622,479 *0DCB93CFE48D32F92C8A48E95154BDD86DA2D0F0 melinda07
143,622,480 *0DCCFD07BD116F9B1A9FE35DEA1DA63583FFD9DB MELISSAWEEG
143,622,481 *0DCC0178943C737343A7936D1858134C6258B7FB michael-jaegle
143,622,482 *0DCAA9195E7121C2F76CF9988D54580E3BC0F508 MICHELLEMUNSAYAC
143,622,483 *0DC18C97D2D0078A65FB74BD67546969F645391C miguel.farias
143,622,484 *0DC12844C18F69C6B4598F37C2AAF80E1CBA67FC mikamaenpaa
143,622,485 *0DC52EBFFE99E98E8C2714F751064DD62D7E8EED MIKEJEANES
143,622,486 *0DCB69EE3D3F812B78299FECA8C303CB13150CE1 MILANOTIENALEN
143,622,487 *0DC491A9E564B60A9BB3C03A01778E25E1E7ECCC GODISMYCOPILOT
143,622,488 *0DC309ACCAA29D3ADAFCEC4ADA307B8E0C4A70D2 godkendelsesbehandlingen
143,622,489 *0DCC04CDAA9E9E41BB1FFFED499729E52F343BD5 GOD, OUR FATHER, HEAR US PRAY
143,622,490 *0DCF317C6CDF7558E0B67352B6333BADDEE2F890 GONESWELLO
143,622,491 *0DC659D9091D5DB381BD6A57C862EE9A5AB6E736 GORDON.BLUBAUGH
143,622,492 *0DC8D174D7B237065D5C611491F2B6DC264C3A32 GORDOW143
143,622,493 *0DC55E14E326E091C1E68F5C4BE38277B6384CDD MM1234
143,622,494 *0DC82719EFC1CB9D9385EE664DA4B1D8B4067A81 MONARGISTIES123
143,622,495 *0DC2D27951986011A26E1A0153E43F27115E3B09 morrisespaillat
143,622,496 *0DC351A83F7EB4F0ED01CF993B88A7A84E91B75D MORRIS.PLOMMA
143,622,497 *0DC05512875775D31CBDF30707ABC365383A41DC grand-tactical
143,622,498 *0DC6129BC0D2EFBECED4C7F57ADEAF73F81D961A GRIEVE11
143,622,499 *0DCCF89D3CADB968DFE228082085A8C916A8E155 GRVSKOPA8
143,622,500 *0DCB991F9CE10FBA1F31A8C3260AFDE210694ADF multi-timbral
143,622,501 *0DC5ADEF1ACB925BEFD91AF58EA36E68B8546A25 MUNISH.KUMAR
143,622,502 *0DCA386FCA23F3FA9E9F16DAF60F85C2751FDD71 [email protected]
143,622,503 *0DC93577DDE5BEAD2647F858EAB808A6823892BC MURTUMAN1
143,622,504 *0DC91C28BD70F1F7CEE39075671425C4D312108A MUZAKAULITZ17
143,622,505 *0DC97725B52F795D4594031349DF0FE19F590472 [email protected]
143,622,506 *0DC63ABD3FD9BF6ECDA9E5E8640975DE6C2C9084 [email protected]
143,622,507 *0DCD24F4743F9FA8E971D9C460DD8FDE1A0D774F GWENDOLYN939
143,622,508 *0DC4EBBE8B1673C6BB3D64FCF71476F53DAD22B3 MYRON.MASURE
143,622,509 *0DC44373F3A610825060718D4E7F3A604819F7B8 Mさんにはぜひ管理者として仕事を続けていただきたいと思います。
143,622,510 *0DC768665BB1435D2426E56B008E83AFBEBC8C13 haevde3
143,622,511 *0DC18434424C69C180DD3CA85468D593D4D5DD41 HAN CHONG
143,622,512 *0DC09FE5E6AECFC8A3E2A323A3B20D73A268CDA3 [email protected]
143,622,513 *0DC10D1D76C7DCE70BF8602EC63E53A3224300C1 NANCHULA4
143,622,514 *0DC5BAD6EDE3B11A7069FA166A69B323672D5014 happyyamaha
143,622,515 *0DC65E19EE24F0870F7996A2D013210327A10271 [email protected]
143,622,516 *0DC03C849B50CCAAB00DECF8E1D5C2D74359F3A0 harveypadden
143,622,517 *0DC0BC31CAD7072B5C6C26267AFBAF080DE18F04 nasser.hafid
143,622,518 *0DCA1ECA8082C696E929C84F9BB2F47DFAC6D4D1 [email protected]
143,622,519 *0DC62A7858A2F634628EA8A92A58251C71BBAA44 navigatorsjapan
143,622,520 *0DCD606D2E8996D3CB758EBDDE9A8A16C9159046 [email protected]
143,622,521 *0DCD6F43DB501951A9A8349E37C14FE93187A363 NEJDLOUHODOB
143,622,522 *0DC05B99CDE713FCD24FCEDB4E0608E47B8BFEAC heathallenbrand
143,622,523 *0DC8BBFEB3A404FFD51B12503BA0AA0090B5A412 HEERLYKHEYD
143,622,524 *0DCC9A835D5EF2F68EC26A270FC493C00CD3F0B9 neveitidercca
143,622,525 *0DCE2CB8DC469CADDD2D147EF6E061CC0C8603AD HELMINA.VON.CH
143,622,526 *0DCA5CEFA8ADB552E80BBF711DCA37AC2F35C65D NEW108
143,622,527 *0DCBA7595CD72713AB41663BC145C9361E7B916A HENRYPOLICH
143,622,528 *0DC01165E3263CD815D6F49310B7E927AE8573A9 HERIBERTOLIPPARD
143,622,529 *0DC7255248B9922E37878722F9A59E3472BB5B28 nneskvenna
143,622,530 *0DCFACDF789D53531C1827E4ECE4D01EF42F1176 HIPPOCASTANACEOUSHIPPOCASTANACEOUS
143,622,531 *0DC68196C141FD59EB9324EA4BC7A0464D7686FC NOAH.TANGPOS
143,622,532 *0DC64C86A2E0801E1BD5468866BFFDF130C89AF9 hkxca8yfnckp
143,622,533 *0DCE74FFA182938BD95BF52CE628A792DC5F32D7 hofbalbierer
143,622,534 *0DCF4A74C1878B940545A19BB2AE8D57667468AD noellominack
143,622,535 *0DC8043D53E08E685DF87FD394EF3554E385C899 NOLOVEWITHOUTTEARS
143,622,536 *0DCE6E174691622FFD82DA89D49B56EED78417D9 HOMAGER3
143,622,537 *0DC78CC127208EA84E6DD1ED2A4B547D52965130 nonnh3r7a8l3
143,622,538 *0DC29C59F1C8E854BA40F0C7E6F1F18550AA0DAC NO-ONE-KNEW-THE-EXACT-EXTENT-OF-THE-THREAT-TO
143,622,539 *0DC19E50BF5FAEB0FECB93B7BEF3A230403717F1 NORBERTBRUMMELL
143,622,540 *0DC7B760E6964780A87763EA72C2F0DC08134428 Hoochin.With.Larry
143,622,541 *0DC9FC3756A7DAF590AFA68070A6959CF0AE6353 HOODIN_MAIL
143,622,542 *0DCD7A5DE9B37C6C8355A5D0507EC0274533AA8F HORACIOPAVONE
143,622,543 *0DCCA22644C09C8DC75383A95E3EA01A54EB64ED [email protected]
143,622,544 *0DC065D134C748CF2F0433A9C95E8F3BD3356DEB NORMAN.TRACHSEL
143,622,545 *0DCF1A896F9CDE41123E3211313ADF831BCB32E2 nothing in between (millenium version)
143,622,546 *0DC09B53E1D453923D8009F56CEA261F0843B2CD HSLASSIE
143,622,547 *0DC2668D0B98C30D6EDB6F87644D43C0EF5387F0 HTOSINE
143,622,548 *0DCEADF13AB59FE0F6BF088F21010A7A43C9E23F NRLIWS4
143,622,549 *0DCC2275FFBD6801CC07C45FBF8846C7B58DC61C NSSTND
143,622,550 *0DC671338BCE219B585AFE3668002C7E4642A925 」テレビマンユニオン/ntv
143,622,551 *0DCA789BF1243CE6059BFA639E4CE424A778A334 NUKOPLUMOJ
143,622,552 *0DCB21B1352D5E465FCDE867DFD832566516FBE4 nurul-ain-azmi
143,622,553 *0DC47FADE30AE0AC43951C0A84B02FA48CEE5AB1 NVRAH-RAH
143,622,554 *0DC70572A36BAF4ADF06C1C0CBE6E544B00ED811 N{YTT{V{TKIN
143,622,555 *0DC05EE75DBEDA6ACCA67F2F5E1649AAF20D51D3 [email protected]
143,622,556 *0DCAF055DD276409A16E3446495204C3008435E1 HUMONGUSL
143,622,557 *0DCB51BC972EECBF8F98B8B5D828A1797CBB9851 h^y'
143,622,558 *0DCA75240A7544D759818DE6AFC3B7C96CE68902 [email protected]
143,622,559 *0DCB4F53073EC0D04EF9238DB0816F7A697B373A (O_-)~`D######B
143,622,560 *0DC0F08871BE314F2E19D478B0E13A024A9673B8 O>< ~ ~ ~ D######P
143,622,561 *0DC598A48124DCA67391BC7E0833B234902DDA35 iampit89
143,622,562 *0DCD86324786F5668D1492047C6CEA348ADB4F75 OFFENSIVAUFGABE
143,622,563 *0DC98172CF20696DB73BF7789B4B307C0A6568CB [email protected]
143,622,564 *0DC7773E4D9156730591C4D791756B7510C33170 OLAJIDEJAMES
143,622,565 *0DC6E81F6F754E9699A113C13F1713131595454A ideguchi
143,622,566 *0DCC6A044194DD441EFC9199A15A18FD6114034D IESIEKIB9
143,622,567 *0DC9FA0DBAC33BC18491E5A9DC7406A7BF1FEC78 IESSENIN
143,622,568 *0DCC8E1A8D5E8A0A3529CB8A8E5F33F1C7DEF97D one moment more
143,622,569 *0DCB296821CFFA077AF35421E93FC1F0205FFCCF [email protected]!3s3s
143,622,570 *0DCC898612881A58864AA054D40647A3000686C7 "III.ALLEGROAGITATO"FROMPIANOCONCERTOINF
143,622,571 *0DC642AA6B3F8DB176169F1A629C96169CF1FDC9 (O_)O~<8
143,622,572 *0DC6CDFC4475EB03D07A8E9605CA32C34CB33A3D }O{O~<====P
143,622,573 *0DC18723A9F0AC28CC8439D455AA77291083B031 ikutokros
143,622,574 *0DCA6F3C0344E77A9F811977AEA9CD522F46A903 )O(*.*.*(====p
143,622,575 *0DC975E83FD5C3DDC1D08806A33ED1834DC1BBBE opensprongen0
143,622,576 *0DC1BC02E84A7636B9D6FC91ACF5CA7867790AB9 illi7er47eness
143,622,577 *0DC95435724447BEBBE720CBC8F2C09460B80320 OPKOOI9
143,622,578 *0DC85BA239A64DD1EBF4E2B52A14B7F8531CF711 OPMERKELIJKSTE
143,622,579 *0DC8755BE4482CF0179473DFF5297A9B8C2FDF88 opnieuw-opgenomen-ii
143,622,580 *0DC15EFE973A916C2B3372A00E47C410EA35B372 ilovechristmasbestofall
143,622,581 *0DCC68FCD8A441A68577BC2E45332C3DEEB03731 ILOVEWELLAZ
143,622,582 *0DCC7C0545E28CE29BB14BCC7C5EBE22D97E59F0 ILUVFEARLESS!
143,622,583 *0DC707AD8E26EFC2F3B26C9075B7E0344B569236 ILUVNICARAO666
143,622,584 *0DCD3A051DA7CDD56BADECE72B7B348DA64D9F43 imettävän
143,622,585 *0DCBE2FF8A3FBF0235C31F06AC0C6B9E28F22DAA IMIJIHS4
143,622,586 *0DC30267DCFB1921370637934F55D8C9B606AE2A implementierungsstrategiion
143,622,587 *0DC35406EDD7620A9293DECF0420BF331B077399 os.de.m
143,622,588 *0DCEECC6545795DFB70B3D8031C79AEA2C2B0336 oszczadbanku
143,622,589 *0DC6428F53767A83E977FB11C27E013B03A5967B INCORRECTITUDE
143,622,590 *0DC5DC1A8A23B82922947B2C132B573EF0C4EB80 INDAH.NDUT
143,622,591 *0DC15877FA93A8B6D38553EA29ACDF748513F596 othadonohue
143,622,592 *0DCF4F5E72105D91A193D25B0729E7E862CECECD inging
143,622,593 *0DCCFC25C2A3BFA68E6F2A45ABEF40AAEC7A1A5C overcoating5
143,622,594 *0DC0967F945CE9EEDE630CA7AF874BF926A93669 [email protected]~0~O (>-<)
143,622,595 *0DC540C262DB6416DBEA67C20EEB61F129FABDD2 PALISADESRESERVOIRIDAHOMARCH
143,622,596 *0DCA1ADDD6B128B05424979DA861E96059013E02 IRONISK5
143,622,597 *0DC0FFE7C211ECC1545BF66A81D6E3CBC0F1CAD1 PASSASIING
143,622,598 *0DC930FA2EF849ABF27E93038A6DE9137BB5B267 ITSNOTTOOLATE
143,622,599 *0DCF8E244DA4385141B01A46D8B9CC2F7814E5C2 PATRICIACALVEY
143,622,600 *0DC114299FD88EA2CC164861C98A3EB76ADF5B7A J9874
143,622,601 *0DC10F610D5C619B0D65F0A6A69947F182EDB0DE P----D*UU
143,622,602 *0DCA14F8BC12817D098436DF377BC36E83483697 PEALEGIOVANNI
143,622,603 *0DC03AEB53DE8A8C08C6E3157EF92AD15B6D7DCB JACOB.NEZ
143,622,604 *0DC8B157694287B085A5242551579655E575376F JACQUES.NELSEN
143,622,605 *0DC525B2B42AAE7F5BBAB2FCE499C67B0FBC4070 jakhi05
143,622,606 *0DC5CA8D0268B0B7C58186973E22B8277550B2F6 jameshook123
143,622,607 *0DCAF1F045A6C482F991F17E3E2D295A63FAF56A jamisonsipla
143,622,608 *0DCD8C23D32FED83F349C658F77018F49C51D01E JARNETTE1234
143,622,609 *0DCDCBCEAE09EC4DD4A49B260912E249284D9923 jarrodeffron
143,622,610 *0DCC6FEFE6CF4702CAF58DC3D1FAE70F895B8DD1 perretsed
143,622,611 *0DC5CCC2B3271B503717692E9116DD8807545A0F PERRY.TANG
143,622,612 *0DC3372C4C709729D7305D7B0F21330270A5EDF5 peterstiteler
143,622,613 *0DC14DEA07724D8C723042044F4092AA958B6550 PFANDFINDERPOST
143,622,614 *0DC59888EC50E0099E46DAD66CD1908EF36DB444 JBMKR1Q7
143,622,615 *0DC146B42680C3B69E5EBB08F8E7ED8310E65734 JBOASSO6
143,622,616 *0DCE16876145A0675D853C215D92173E4B08EA46 JBOYLE
143,622,617 *0DC8213F488D6B668C7C5FF8D779E369E73E0A42 JBP+
143,622,618 *0DC34DC43C16D598E35613D9D15DEF0CC292F240 PHILCAIRONE
143,622,619 *0DC979B4F9DCDAA73783196B7A45C2BB75638A03 jeffreymcadam
143,622,620 *0DC402CB7A88808FA09023745B41798711B54E94 jeffryloats
143,622,621 *0DC776C77A62F22DDF4D37E4BDF888176E78576A phoebe-cassidy
143,622,622 *0DC0BD74E449D94BEDD6F2C3A0F7F6EE63B635F7 PHR-AB-UNO-DISCE-OMNES
143,622,623 *0DC5CA37E82067F63E5C155BE71DED31D11045BC phthanits
143,622,624 *0DC1A670D1BBC0B4642344A41DF9D2FF53461827 JERMAINE.LOCHTE
143,622,625 *0DC6E8F40D50B18972F1487C1FF65D85C5A79553 jeroldyamauchi
143,622,626 *0DC54D6435DB2AD12573982842472E654BBDCFE0 jerroldpetrosino
143,622,627 *0DC58B5CC4580F706EC537FA8E73FBB2B95AFEBE JESSIETARNOFF
143,622,628 *0DC99539CDE5BB6E0099CD3FD2D0C2A7ED3E818D jewelsmiglewski
143,622,629 *0DCBA5C148233DD3608FCAA617F7508BF77AEAB1 [email protected]
143,622,630 *0DCBEB94B6B631D84B1EC27BECD94F30E02C52C7 JIL LEA
143,622,631 *0DCEEA5E930008A6631AA628FD2C221939F6B953 pivunelmia
143,622,632 *0DCB010B6284A238DB308EAD572D76D8E10EAE67 J-LAZY-J-J
143,622,633 *0DC56635065DF8206B8DAFA2FDACB43C55ED2B7D PLAYBOY(PARTESP:F
143,622,634 *0DCBE2BDC9DA0C6869F4E3174DEC3250068405C7 playerexport
143,622,635 *0DC32B4884100EFB51CF8BE03CED4B0AA191C315 JOEKAWAGUCHI
143,622,636 *0DC36AE378E08E588EB9923FB05442AD4CD3FF23 JOELYONS
143,622,637 *0DC6A6E61F5A0863F54685D61FD6FF41BB0088E5 [email protected]~O 3B<
143,622,638 *0DC73C26D9D152FBA3FBBE424BD28B9E4F70BAF1 joeyserra
143,622,639 *0DCFB753152C7C6634B94FEF507E040B9A08BF17 POLIGUSING
143,622,640 *0DC7F59F878357789446542639CB3396B38EEE2B POLITICAL-OFFICIAL
143,622,641 *0DC3FBF7446903F923EAF1855B431A4363D40380 P-->-~O~O(0_<)
143,622,642 *0DC8C366B0C845B2FF7DFE5F4FDEDAD2B57EB136 JOHNSON.SUGARMAN
143,622,643 *0DC7C7E2FAF21FF718405CE62F32D20DD3878076 JORDANMCMASTER
143,622,644 *0DCAF7D9CDD6CA3706EDC757CB1284E2D27BEF37 JORGE.CATALANI
143,622,645 *0DCC73FB6A1ACEED089C4343D703B608A1958053 pp~0splat
143,622,646 *0DC26B097DCFA0E8CACD4B30E3DA6C5010B991A1 PP.160278-290
143,622,647 *0DC0DC8A087DA8462C707B0EC4BB00FE4D5B76CB PPPISABELLE
143,622,648 *0DC389A757944D93015D26392B59C5EF6006181B PPX2665
143,622,649 *0DCD61B8741E773F3224B4BE82AE79FB8DD6E2FA prayforpeace(a)
143,622,650 *0DCE032CD6FB3AC3280BA7AAD65B682EDE9C20A4 PREBAR
143,622,651 *0DC0B42DB9467C38402D1B30362CE94A076A0A76 j)r*
143,622,652 *0DC539AF80384C263DDEDF3BAB2FA3DC4ABB192A JROSICKOVA
143,622,653 *0DCFA909C39337608609711BEC8C5239FC7F4491 proforms6
143,622,654 *0DC48A594B95D38CBD4EC354431FB941EE718813 JUDEEYERMAN
143,622,655 *0DC057AA58CDBCBE25CDB9C8B20361F6112CC5DC JUDEVESLEY
143,622,656 *0DCEDC559E77150283B4C808B4DD8DBB7ED80CDF PROTECTED20071126
143,622,657 *0DCE33EB1DDF095A357D6B441C70C41088F49477 julesfarfan
143,622,658 *0DCE61BCF4439FBF55FC754C9AF08176210C5A2B JUSTSAYNO2
143,622,659 *0DC7E64074E99BC1BEF3E6B4F8C2E3EEB8B296F0 [email protected]
143,622,660 *0DCE7979D7091ADA48F84E94C661B7F89CA5FD83 K100749701
143,622,661 *0DCBCC422AAA11C61CB112467C1C0710FD68A792 k1a2r3m4y5n6
143,622,662 *0DCB1460BB52620AD7756F7FAECD5483E352A0DB k1n9l3+$
143,622,663 *0DCDACE73D2F56C7D1B592A40983DCFD07BC1793 [email protected]
143,622,664 *0DCAE7DA9A95628D01E1E3BF87D093BB79A456D1 PUDDLED?
143,622,665 *0DCF696C5CE9B62FA9BA708E867AFC164871E7EA KALEBHUT
143,622,666 *0DC8D5FEF280079BDD3AC289687CC5FAAE0D1C02 ka’nın
143,622,667 *0DC2EEDC19B1425BE7C3B0647DF22D169BC37B77 [email protected]
143,622,668 *0DC0D025DAED1BF88D95D7F5F0634E5C08A283C4 karthago-records
143,622,669 *0DC83689640FD531B0EA5D07883894F7383D440F KARTISES5
143,622,670 *0DC3833137202B178FD3E25DD33BEAAB4C2C6B28 KARYSSACALLENDER
143,622,671 *0DCE040DC4999D34E2A3B8BABB322B65571BC88F KATHERINHACKER
143,622,672 *0DC4B76A4A252C598A44C4AD300A329F1E628409 q===b.~osplat!!
143,622,673 *0DC677E00C766E5896C5F5DD1378FA781509CAA4 q#D~O~o3B<-
143,622,674 *0DC0E537347249543EF3CB943EB393B7A8833A70 q=====p*)8(
143,622,675 *0DCFDD41462DDF9FCE0DFB2A9E0AB4A41B10ADF0 kellihuddleston
143,622,676 *0DC3EE50EC4EA63CF8E29D06185B85381873369F KENDALLBENUSA
143,622,677 *0DC3D0FF8F2D0EEEA83C090CF8527FE959D7087F [email protected]
143,622,678 *0DCB6748FBD7031B195737F3B8DD60CEB51E772C QUINTIN.SEARIGHT
143,622,679 *0DCF99EB83A01D06426B2568EA07452EDDD8D81E KENTON.JAQUISH
143,622,680 *0DCCCB1B05F06295E390F131DD8D4C5D6FFAB044 kerry.davitt
143,622,681 *0DC5DDF1FB9903851B322C6021E45CC7DCA51E6A kesanliali
143,622,682 *0DC7FF0DED7004C4FC67C92F35B5373CA84ED03A KESSEN110
143,622,683 *0DC387F5B5C40F9CC56121B06BA10E5E08089154 kevinocheltree
143,622,684 *0DC1542422D96691AF65F759C5FDCD59F13D855D rachel-deford
143,622,685 *0DC6B77254DB0C6EFA3B1BEB3262DD6C8F100A37 KIKUGAWA9
143,622,686 *0DC2B299489B4886F976CE34DC83B7A315E188DB KILLERBEE8809
143,622,687 *0DC9EE5482790983B4E332167F05FEB05BF12996 killfloor
143,622,688 *0DC4B66174E968FF2E032ECADF153B44696CC2AD KING.MITANI
143,622,689 *0DCC810829436DCD106BF05D2D831AD65369C831 KINGSTON137
143,622,690 *0DCF5A6E3A08ECE3ED63FE4106183063A22E0F13 RANDYBEASON
143,622,691 *0DCF6D5DE72627679012EDDA7FF7C0A670A1BCC0 RAPITSI
143,622,692 *0DC789EF165E232372613EE5E5D2F1D121108C8F rasguar9
143,622,693 *0DC5644B4723AB0DF73BFCD912DD4B28362699CC RATIONALISTIC
143,622,694 *0DC69CB333E46B91041F69C77CD4648BE5851DCA RATOATH.4
143,622,695 *0DCB242309B176BD0730F8C2EED13EBD7F8F1D41 RAYMON.THONEN
143,622,696 *0DCF2D2AE666EC403A523FDA1BC679F8E6F6D1DB READEXTRACT
143,622,697 *0DC032EA5B2F54338B78A8B114A775C022FF758A K*KZ
143,622,698 *0DC8C7F7E0BFE4D72CBDFDBB3071902D2F585E78 KLANSMAN5
143,622,699 *0DC5266BDE6279CD58FABF80156FA4EF2D87C754 KNGIIPF
143,622,700 *0DC4AE71C8A8BB70794AA63D4192EA1B52469551 KNITAY
143,622,701 *0DC1A111CB3027090394E5244B302393A4794205 KNORDEN3
143,622,702 *0DC1BE8CD4593475F11F4D8357CC0D4D34DB90FE REDRUVASED
143,622,703 *0DC0812B98ECBCB17209A5DF33FB20AA37F3DC6C REGGIE.RINDE
143,622,704 *0DCA19C0294A02592AFE4A555C30B2C2E58CE663 reginaldpelino
143,622,705 *0DC3F65B002447430DA4C397451379EA4B478729 reifepru0
143,622,706 *0DCB6B28B85D2587FB4509ABBB4603C0F6075256 REINALDOPOPOVITCH
143,622,707 *0DCDE4A432BC1B71E023AB011D5E409BE7C8ED16 KRAGULJAC
143,622,708 *0DC0EC4EBA31E04A4B88A7F990F626920BCDB41A KRDERNES3
143,622,709 *0DC14D2858F97E3A0E1E5001E75F9F3AC5B239A4 RENALDOVERDERBER
143,622,710 *0DCBA49BBCD2D7F535EC3E42455FFAECDE1EAC26 KUISHIBO0
143,622,711 *0DCC6BA439B5091AB3987C78AFB67683BA997916 KURT.ANTONELLIS
143,622,712 *0DC193ADA27410B4D2AF02D54DBE3FCB193E8AC8 KUTSUNI6
143,622,713 *0DC6DDF455EAC170387A44F5951A9A9E3DDC912C kvilende3
143,622,714 *0DC0A8CB6975F1EF9B84EE8796F4F5A17D577451 KVXMAA
143,622,715 *0DCDB8373650CDEC383069128DF4913470D411BD RENNURREHTNAP
143,622,716 *0DCEA98DBFF5CAD90273D63A69AFE8758B6DBEF8 [email protected]
143,622,717 *0DC43A4F7BEED518408B9D990D51AD64A4C5EA4F LABIAPLASTYSURGEONCOMWWW
143,622,718 *0DC073F858C3A3D6872F28986891769FF11495F3 RETRAITEZS
143,622,719 *0DC4ED96ADCD1346CB3D266DCF0FBEC279385C19 reyezpeleta
143,622,720 *0DC6E8CEAE84F5C73088C6D8ACFC67A53233E04F [email protected]
143,622,721 *0DC32E17B61F0944338F366735D9B1098BEB77C9 LAKULO
143,622,722 *0DC4D7CEF1B833200AE8F1683FC19B86897DB8A2 RGSIDERPPING
143,622,723 *0DC32CDF98F60CBBCFF8872412C083351FC02DF3 ricardomcgilvray
143,622,724 *0DC55B1FB3C672B385EF49B2C02AF9D4F4A18F6C riemann--r-iy1-m-ah0-n
143,622,725 *0DC61E487D80066BD8F8A4B1861AC6EDA42480DF RIGOBERTOBOLLICH
143,622,726 *0DC32D7D54C87009FBAF622331DDA59F8D8786C6 RIGOBERTO.GILLOTTI
143,622,727 *0DC49BE3984A7B48BCAE806A320AFA2BC47DC1CF LA VACA (MERENGUE)
143,622,728 *0DCFB80C177ACCCFAFB2E313B02D03724229E05D LAVERNE.RUSCHMANN
143,622,729 *0DC69888E194D024900E0BABF64DA2C7B560AF11 lavernesackal
143,622,730 *0DC5B8B4461951F6018A51BCA13B0D3A643DC65B lawrence.silva
143,622,731 *0DC4B1DCAFF00B65C10E98F72670A1831C2F0C18 RLTTSBHNDL
143,622,732 *0DC91CCDF93B582C0188FF91C1E8CBC965459BE7 LCAMPTON
143,622,733 *0DC9C3CE92BCE40C024C332C21B223C4CDDAAC8A roahaneed
143,622,734 *0DC16D575C1BB91AA09D28CE3BCAAB9881750649 LENBLACKLER
143,622,735 *0DC1A333FDBD3A19B56D76C0A3BB995EFE40EC45 rodricksergeant
143,622,736 *0DC701D39CB1DEB063CD128ABC875E2C8BF59E97 LEONELS1
143,622,737 *0DC59C4FF98F259CEAE88A90324EE1B6FB8CFB60 ROGELIOSERVEN
143,622,738 *0DC050BEA7F34CB8F9EF1CF99D81A6F26B0194D1 ROHITGANJU
143,622,739 *0DC3E7B8A39255305913A5EF301E1F6B255F7A7D ROLLOVER(FEAT.SABIRAJADE)(EXTENDED)
143,622,740 *0DCFD1CB97C0D92F2E0BFF39C5B8F0875DB46D01 lexh
143,622,741 *0DC743E9AD9323C831E943218CD81D3D3E245786 ROPINGBENJAMINS
143,622,742 *0DCF58DEFA33E4ADF5C829F05D87A17B978D8C10 lgbrsnssing
143,622,743 *0DC84B2174D54C0C5831A92890729A0B0B630BA1 RORERIUS
143,622,744 *0DC6549DC4E7594EDBBC816345CEEA8D31616820 Lhadskulk-1
143,622,745 *0DCE5F690A396F71CE9197959F7F1720E86C557F lhunter9
143,622,746 *0DC4A267B7A883A24387BA671099793ABB310670 RORY.STALLONE
143,622,747 *0DC330B18DAD6603FBEA5DA714470DADC5EFBD47 Rougesoiretblancmatin,c'estlajournéedupèlerin
143,622,748 *0DC10DC2031DCD118DC3448D9148EE9BB692591C <Li>..CONTRABAND.OR.OTHER.iLLEGAL.SUBSTANCES
143,622,749 *0DC8DE3B229FFA1919B19E28B4051E400BFAA4EB rpmb
143,622,750 *0DC693DB0B9C54029435A870DBF1037BED4CD28D rubbedy9
143,622,751 *0DC2AE04A678942A0171BF195FE788308E8093C8 runaway-world-(re-release)
143,622,752 *0DC38482494AFE8907B3D8959B3A27E40285D9EF RUNNINGJUSTAHEADOFTHEDEVIL
143,622,753 *0DC45B2FAE280A48E635B815375E6244A2932611 russralon
143,622,754 *0DC7B2BCED5408237A3D136184D8770ABE15328C RVINTINNER
143,622,755 *0DC6EC3481B2F41C5F02DED021F129E8A04CF063 rz_z
143,622,756 *0DCE839DC923784AF0FE8ACBE4EFFC99A0945391 [email protected]
143,622,757 *0DC5715956EFD8A0BA025700021AC7C285DA727D [email protected]
143,622,758 *0DCC6F247894090144EFC3F324CEF085A372B0A6 S+ABI1IZED
143,622,759 *0DC114D83896DAD0769B1C61E47E1F9449EC1C56 [email protected]
143,622,760 *0DC4F8B3E95E4C29A04EF3C1645F7593D4476007 LLOMONTE
143,622,761 *0DCBB611692F0AF02C6664C0F54D6345851A8AAD sakonides
143,622,762 *0DCBE69144E96C9732B8A58F3F486488445D1F04 sam...7henry
143,622,763 *0DC50B47AE7F7A8D2FE14FCA02C22832DC728C2B lominack
143,622,764 *0DC9A2707FB12605FE2C574095B7619544EE1D15 LONNIE.NOWACZYK
143,622,765 *0DC9FC166C37AA642B7160ADE5ED5FFBF86A5ECA SAMUELNIELSEN
143,622,766 *0DC8241905A1D014C378B7F5CB99C8B653B530A6 SAMUEL.SLAUGHTER
143,622,767 *0DC411C31E59C7FA1F3BCE1751A7A5EF9337768A lorenzohankerson
143,622,768 *0DCCFE5C335D132FD28EDFEC26B50C9FAF22DFEC sanfordgrandmont
143,622,769 *0DCFAC1014A8993C9F7E88256D208BEDCD0D81E2 SANFRANCISCO.
143,622,770 *0DCAB06BD9A01828ADCCE2B74B31E56B1CC6725A sangyet4
143,622,771 *0DCFB6C34D02AB82D574DDBE4EBAEED6FF2436CC SARADASHRAMA1
143,622,772 *0DC915505EC91926ECF3390465B270A7859D8C26 loydhepperly
143,622,773 *0DC8870C519862C73A3D35C242324452E3E0E066 SBRONZANTECI
143,622,774 *0DCC90EE59B50C385D684A1A87B29F55765DFEE4 scalaris
143,622,775 *0DC2DEA0FD6F9ECC535E7ADF1353848821F8D300 LUGGIES
143,622,776 *0DC0626D2C64E268FB945B502FAB081A23309387 LUKESANSOM
143,622,777 *0DCBA65B6FA77A2D0836F556F5D1B61754CA1CE3 SCHMMLZKTS6
143,622,778 *0DC58FE63191324885FBC1926C95D8360BC06B21 SCHOOFSYVAN
143,622,779 *0DCE5EB59808CB4E0F2017F45013AF360907E40D schoolswp
143,622,780 *0DCDB725A47C7FB884611FF08AB0C8D7A1B8946A SCHWABACHBLEICHR
143,622,781 *0DCCD970AA04336E7D686A296DE23376F2B89180 SCOTTY.CORTON
143,622,782 *0DC3F000937BE2C160659C1D95D253428C401946 SCRATCH.JIANG
143,622,783 *0DC2E3F51154D0FDC2064E839B372E7619A2FEAB sean-triglia
143,622,784 *0DC794F2EAB81DF9FC89E003E27AEB7580A1BDE3 SEBASTIAN.VANECK
143,622,785 *0DC1AFDA69F29D182BE20AA01079324D4BAD3F8D LYMAN.SCHOENINGER
143,622,786 *0DC05BEE686FD6F73DAA0E9DFD61E4DF7646AC3F SECURITYCHELSEA
143,622,787 *0DC0221B9CF543D84E9DE6688DAB06AB911DD89F SEEDRAVES
143,622,788 *0DCE285B5D8A4FC4934526F226FBB320F0F093B4 SEGMENTACIONING
143,622,789 *0DCC388F29015419582C54B55BD4FAD1CB506055 M120546937
143,622,790 *0DCBE82C61FB61029C7CCADB5673A41D9DB0E1A1 sere.en-lavedan
143,622,791 *0DCA29DB15BF5A17BDDA15A04B32BC0873F139AF MA1319
143,622,792 *0DCEE9B8887D46C6486F7AEF06938DF86E7AB8B8 MACHINAMAW
143,622,793 *0DC88C16AAC8C2708321382FE8E49B974C8FF61C madaline3
143,622,794 *0DC6AB9AD041E5D95CC3159060DE2EFD10A3A227 shadleavenworth
143,622,795 *0DC8E66662FCFC4D6780BFA5F6CCF27AA4442F4A [email protected]
143,622,796 *0DC7894C9C496E99AFBA1AEF7D29EC96816D4885 marianooestreich
143,622,797 *0DC2A069A7F90D64D6D756CF1D7573B374F20186 [email protected]
143,622,798 *0DC460F919A0281421C6A5FD561AAD6D7917F2B7 SHERRYTROGLIN
143,622,799 *0DCDA4A232C683D874DC3735A8B0B3403F38E02D MARIEL ARIAS
143,622,800 *0DC556D27CC80A801EFEE7BC1E011906B08DBB8C markuse7
143,622,801 *0DCE2074B08C8BF79BA491A3DB4679BD6A2379D4 shru881er
143,622,802 *0DC03348F87163304024EF299D43EE41547BC513 [email protected]
143,622,803 *0DC9360C22D74404816F53EE72E334F08CCC104D simonesmall
143,622,804 *0DC7582929A7A7564C31A4C01B515DA509281C3E mas-time-hold-me-tight
143,622,805 *0DCDCEEF626A15843012AA98E268127150671A1F SITIRHTRADIELC
143,622,806 *0DC9B4D7B50C9358F7A824DF1DAE1948A173F5C5 SITTHIJAMROENKHUN
143,622,807 *0DC1A63E6C099466F38372CE0A1CE92C9E92197E MAURICIOLANZA
143,622,808 *0DC7C352D37E71323D6DD6D2987B45800F1F8101 skummer
143,622,809 *0DC0E6D4F0261BCDD5575D95F23AA96889348D04 [email protected]
143,622,810 *0DCA8EB4262797CA125A07DAFF2AB93987F8E632 SNAPRAT5
143,622,811 *0DC8EC616AB5DA76D1EB297641355E74B92BEC0A meenakshikailash
143,622,812 *0DC6DF35595C768EA392BD4DC7055AA1BF1275D6 snffl3s
143,622,813 *0DCF5D70F34B3584D7A4BC6BAA4AC093240820DA sodium.sonet.(extended)
143,622,814 *0DCA503897156B6CC28A22127653095BFE223C8D MENO WILL ROGERS
143,622,815 *0DC31A52BEA87AA80F8F3D0CDF4FEA794574A422 SONATEENDOMAJEUR,OP.15(ANDRESSEGOVIA)
143,622,816 *0DC945F81D585B42E7DBA690273C6F4882ECEA76 SONDIERE9
143,622,817 *0DCDD42446A53790BA7172961EAE61099854218B SONIKA-SRIVASTAVA
143,622,818 *0DC29AC771647199018654F97C14B93F3FFF1691 SOTTRAESTES
143,622,819 *0DCCCB52573D399EC12CB621E1C54BECA5C6A893 speedoblowme
143,622,820 *0DC2EBE68883CC968F9C995606A02031A4D2994C MICHOLWSKY
143,622,821 *0DC3D6B7F4BB4D4D7A4E92E3376AF4038FED5137 [email protected]
143,622,822 *0DC5C36E6D7792D0395AD94B514235752C8FE3F5 sploito~ o~(#####q
143,622,823 *0DC795431965EA75652706462583A438DB6566BF spodzos
143,622,824 *0DC71D17BD7BF75FC6B31821B7878DF0F1E5CACF SPROWTESES
143,622,825 *0DC3F769332C461037809C74B99B64F27E451A9F MILANDOLD
143,622,826 *0DCAF43437B800A4C2A60D850FF3A775E831AF8A SPV--S-P-Y1-V-H0
143,622,827 *0DC3169CE28E4CAA3E5306D0A592295680B8ECC0 MILESSTUBLASKI
143,622,828 *0DCC75630E19F00BD16550FAA24736348A356235 [email protected]
143,622,829 *0DC4821B3747E179F03C1A392AEE797CD943C6ED MILTONKLUG
143,622,830 *0DC749870D185CC6C7FD2B595EDDA3959F8EED2C SSAGSS-404
143,622,831 *0DC9ED101AD723652DED70A0773FA21F229DF8D2 ssalvadorcarreras
143,622,832 *0DC670B62DCC4B632B508A7951EAB4F5227D696E ssapwenhgfdsa
143,622,833 *0DCD8521D1936AAE5E8214212DD975515DD41708 mitchellwobbe
143,622,834 *0DCB93CD14262A4C767E5656C6BD13EC91D0FAD8 STACYKOT
143,622,835 *0DCE3DF2877D0B1848695D55307225A1B7E2D9AB [email protected]
143,622,836 *0DC23C54DF31BAC9C23EFE9A8395F95EBC82330F STARWARSF2
143,622,837 *0DCDD4E15BEEE45A9E04D40014909060C060FF12 STOKEBYNAYLAND
143,622,838 *0DC348082A01A279B53FE569A857B8DBD821999B Stop-Shaking-Up-My-Heart-(feat-Zirah)
143,622,839 *0DC143E766275919B536B8783E0D116D600BF812 STRING.QUARTET.NO..1,.OP..2:.III..ALLEGRO.MOLTO
143,622,840 *0DC26C939ECDCBDD879B6FA775D0023C94D73C0C STUART.FENNIMORE
143,622,841 *0DCDDAAD7D64881DF4B5278280965C4051208D79 stuthejm
143,622,842 *0DCB5ECE634C59BAB325797AEBECC97651090F9C SUB493NCI3S
143,622,843 *0DCFDD03212C93880D326104E878F1AC9FD0464E SUBHIEAS
143,622,844 *0DC21417F1CE25B40383B23224FFAED84C1E30A5 [email protected]
143,622,845 *0DC5405CCCD828E231181E7B7C8D469E844109B9 sugiyem
143,622,846 *0DCFC043FFF9733600AAEFBF041929108B8E4EF4 [email protected]
143,622,847 *0DCD879EB3D8D78360FAA40CF848228E2A2CEA82 [email protected]
143,622,848 *0DC7F5E912387A15F71F02EB02B5DFE5202F0532 [email protected]
143,622,849 *0DC3D34D9BB413E2A3399C6475998F8AAD077E9D [email protected]
143,622,850 *0DCC0DEAFA42F9356BCF50DF455A828058BEC6DF surabhi-sahay
143,622,851 *0DC8079A910B832DB26C452F552729C5B4B4F2F7 SUTOHEKS2
143,622,852 *0DC003419478470FD2ABF68E28781D8CD192A7F3 SYLVIADREAMERS
143,622,853 *0DCF27969F1384F96A7F0AA6D484A5B0CA125F86 symptoms-of-sickness
143,622,854 *0DC5C6C4A19C91A2A9A7B203416420F6A7AE346B SYNTRONICMEGA9
143,622,855 *0DC73468A51F67F3ED9609E6A5E77F377787CD74 moechatur
143,622,856 *0DCAFC413B46796888DC1D4B2F1AF5A4F47326F3 molly11918
143,622,857 *0DCD7BD8E280080F12C30516EFB5D34F626892EA MONCHITO GARCIA
143,622,858 *0DCE322907EC5C56972F4901E6E1DBC9173DA017 tahr
143,622,859 *0DC5017B27AE40D94823ADF2B35D4154477E4B0D MONTAMELOISE
143,622,860 *0DC050876051A89E85DE7584AB4DFBE490ABFF9E TALKHERPYLARLSIENNE
143,622,861 *0DC5CCCDB7A9D6C08836785C355B07CD6F7E3D64 morrisramon
143,622,862 *0DCE4844B4B7C084B3C7AF6B4215AC6CF5E7D8E6 motoculteur!
143,622,863 *0DCB99ED29E5AAE1CFF8593694F52B4402FDE88C TEODORO.BLUMING
143,622,864 *0DC21B77732AA8FAAE3BCB039A10D891188F8807 TERENCE.BREAKER
143,622,865 *0DC18011E31618A79B38825FD246110A1762617A msnbcapologizesforshowingfakepalinphotos
143,622,866 *0DC63674CA34A37E17BCB4E445949E892EE91344 [email protected]
143,622,867 *0DC2C4E60FEB30CB92094C8219B9F6C14E9B21BD MTINSARRAN
143,622,868 *0DCA2D8D04297D982274F6CB524F42707DADA966 MUDASHIRBADMUS
143,622,869 *0DCF82DF70093709736AD17547A8FA538C0B3B7F terrence25
143,622,870 *0DCBA07D17205DE9BE1645B98DAEBC1469E626C4 testamentsbestatigung
143,622,871 *0DC408C27E531CE8A5AA7C033D1CC6E67E8DC0D7 THATWALKER89
143,622,872 *0DC67354C19DB775AB948D1B4A6CE12C635361CD MYLESSTIERN
143,622,873 *0DCB2B533C27420D7C8A10E8AC1754FC083A6DC3 My-Orbison
143,622,874 *0DC6284D768DEDE6AB40F4A989B26FAB82170312 [email protected]
143,622,875 *0DC998EA7311522FF244FFB5B91ECA0CF11399E1 MYSTISI3
143,622,876 *0DCF1AAA50F96D569D9693C19605F82206913501 THEKINGVADER0
143,622,877 *0DC37F398E1834EA333454A773B728744E28D2FE N00002
143,622,878 *0DC90FCD8F29882E2A0F82B80ACDF43A2F5B4B69 nachzufr1
143,622,879 *0DC62E38C7B7FC6A068E1B79D7DCE342A251BC5E the perry county music makers
143,622,880 *0DCCF9D064CFAA4D4F4BDC8FC103095E6C255339 NATASHAGADSON
143,622,881 *0DC6F990F6DA1855E678B3AA91554812C74A00E2 THESELENAMASTER
143,622,882 *0DCE51D8BD32506C975F3B7B6E4318F3FF22B672 the-smackdown
143,622,883 *0DCBCFFD32BB1CB7EF2C6C2DA8151E723A28E6BA NAUGHTEN9
143,622,884 *0DCE5EDF9431376102505B92E792E6ADC4A59386 THORNYTWININ3
143,622,885 *0DCA3B5344623AD4165380AE3D1D29280FEF2796 thunderfun
143,622,886 *0DC0DBAD148BF2969F3D3FE2A19959C5E6451FF5 THURSDAYGRAY0
143,622,887 *0DC919BCCB42124438B37EF51120DA2C3D956A5E thwackin'
143,622,888 *0DC6154C91234171AE6DD2F716993988119E35A1 TIGERESS3303
143,622,889 *0DCA38B9165A8CD58DECA20B24EB271614024B5B NELSON.GIDDINS
143,622,890 *0DC839FB7019ED335FBBFA211ADC886FEE41A4DA tilemaki
143,622,891 *0DCF49CF2FCE246E230B045372F2C3CF603FE20D NËNËRI
143,622,892 *0DCFC0C0D5399D5217CE6D364F794C25996222C9 timeyankees10
143,622,893 *0DCEC84DF81571844ACEDA3B51FC52BCF299634A NERVIOSPERIFERICOS
143,622,894 *0DC3141F95B85425948E5756FB7B6EA78FEE271A TIMMY TRAN
143,622,895 *0DC97B1A5614D72C349DF14E20841EB63F626859 NEWAYREONEPWITHASPECIALSURPRISE
143,622,896 *0DCC4F15B5D1E172F79936CA08E6CA4337F0E3D0 newpassmartha
143,622,897 *0DC7E3ED8E66DA5D8F8F300C7D6420A84BFBB589 nickolashollenbeck
143,622,898 *0DCD622099F141AD6AFDF85B89D1F4BE0B59A02C NICKPTACEK
143,622,899 *0DCF1D031CD7A8CFDFA68C1E3AFFFB720C1C1974 NIGHTS“NEVERMIND
143,622,900 *0DC5E2150D1FAF715DC698A0B0575DD2DEC4C86E nilideal
143,622,901 *0DCD0F7A9E64309571DCF405BE018DBFCF62B6AA TOM.VAN.HOUTEN
143,622,902 *0DC9FC10FEF210E6613A2B6638D8461161AE738B TORPEIST5
143,622,903 *0DC4C3964C818E245605425F1D45B17AE92E314F [email protected]
143,622,904 *0DCE5304A735BBAA10C97C05BF1AF7B3D7DFD0A1 NKKCZ
143,622,905 *0DC5233EDF440023D7BAAB176E79125D9CC46E5F TRABELERTE3
143,622,906 *0DCDA69C18911E92920B85C048FA9061E8913FFA NMRUGG
143,622,907 *0DC53700DE6E1939711094B19351707E32F69230 TRACY.LANIER
143,622,908 *0DC9C5C77182D859F1A9F55FE2FD26F8663D51AF NNCY008
143,622,909 *0DC1AE139E333DA4B1493F4A43273875F3231398 TRACY SCHURMAN HARDEN
143,622,910 *0DC9A359D1076C40BCDF833D316D354FDD21E907 TREBORFRUS
143,622,911 *0DCDB2C1F73CC8894833C3537C6A023D3416B110 trevor-bothwell
143,622,912 *0DCE594D2E43FA33B5773FD0BBEED6ECBCEB56A7 NOSTAWHTA
143,622,913 *0DC0DC095A6ECAA9E1638905BF63F989D2E4EA24 TRINA.ROSE.CRUZ
143,622,914 *0DC48D3F62D1FD755358EE1B749250F65215BD5C trintyskinnieminnierelvon
143,622,915 *0DC96384C27A414BB63FCFA5CF5259CA53CDF97B NP6ODDRUTYAC
143,622,916 *0DCF8C3A6E186460052A0A19A6F46BB3A5FB0828 ntclcmned
143,622,917 *0DCE253C09A277D0658484845806BC17DA83D4A7 NTLLERSCHÄTZT
143,622,918 *0DCAAB0422FAFB2F1F4986E985349A7A004744D8 TROUWENSES9
143,622,919 *0DCD18EE01F29C6F00BA609EAE26AACF2603889B troy.ellson
143,622,920 *0DCF3E00A0570877B6A850ACEC50E7BC58CFEAD4 TROYSTRELOW
143,622,921 *0DCE30964FB281CD43F7B70780CAB52F682DDF15 }O{0~-d===8
143,622,922 *0DC4A6D5D6E1E3C2B00E02EECC1BB74F55E4AD50 OBERERA`
143,622,923 *0DCCAA97939E937283A4696344A972292E1522AF tuckerdietrich
143,622,924 *0DCE409C9C8CB534C4BEA4E330510D49B95D84C4 oenske1
143,622,925 *0DC16168D5A03CE56D816EAA293F4E48EB355096 tu.m'as.promis....(original.extended)
143,622,926 *0DCA3AE82C17FC461C15FD966B136C2A9CACCB39 OIMOGOS
143,622,927 *0DC61C7B1010CF01EE74AA7FDA44844394BE8A63 ojibulki7
143,622,928 *0DC3C3F57DD6746067D2BF84652318AB35C4A2D8 tymothys7
143,622,929 *0DC77FEF2C1797A8E34C298225470B59DB533FAE ollieshelling
143,622,930 *0DC2601CF0987D4B3109E8229F21AF872263D791 OMAR.MAHDY
143,622,931 *0DCDDF03C240AE7E8D593E5ED42A249F593CFE85 tzvi-lieberman
143,622,932 *0DC277960F3E66CECCF9678A967E004225240D45 omphalosite9
143,622,933 *0DC6DBCF163AEE81A94DE15D4FD54EB65D806793 oNasceuPraSerFeliz
143,622,934 *0DC533CB9CACBFBBDB8F9B29228D0EB822C36771 onsetoperation
143,622,935 *0DC9369C52EB823B1E17F9473099D01FB9E03A73 (^_~)o~.o~.(b
143,622,936 *0DCE6FC6121BC617E3FCA7B23B4BE07ED0DBE403 uauadog8
143,622,937 *0DC50444284D66B9D2A796CA45E5366B100127F2 UBILLUNU
143,622,938 *0DC9E55DAF341696886CCE0E1F9B86188AAF8E79 uddhavs
143,622,939 *0DCA65A229676BCE79C29ECFF0BE5F7FB6FA4D7C [email protected]
143,622,940 *0DCCE406024AEABAE8077AB54762841C54465540 UITKLAUTEREN
143,622,941 *0DC9FF8A0DCF21A0F0768CF4D1F2C07F789B17AE ORLANDOVANDERPOOL
143,622,942 *0DC84737C0EB096A31E9BB4672449B18230001CF ULJANOWSKER
143,622,943 *0DC45B97B5270367E6D4E7938000A2DC1E69BBC3 ULYSIS-BENJIE-SALCEDO
143,622,944 *0DC5757DAF16A42660AE22EA4A897BF1A61683DF OSSAMAHARIDI
143,622,945 *0DCAC68A077B017A2C39B9ADB60C848D5502A964 unadording
143,622,946 *0DC2E8B1633C62C1CCBA8AC7F9EE0A8424FBD827 UNASIM
143,622,947 *0DC77D091347940AAA3F2D9A167E3759158C9651 [email protected]
143,622,948 *0DC848C0578C6C2834E7BC0FB100ECB7515F236A over the beach
143,622,949 *0DCF0A48A910AF0BDC8E053900FC3CE7A1CF55C6 [email protected]~0~o}o{
143,622,950 *0DCCF5A0A81369C3A377B5F7EE9AC2A9BE7EF5BF UNRATAS
143,622,951 *0DC0B3181D37A79FAD5F49F4F4D1058600ADEEC8 P0T~
143,622,952 *0DC267BB87C1B62EF05F9E043764229D1193A2E1 P37RO1OG!$7$
143,622,953 *0DC8928D1FEEEFAE4979ECE83B365AE729470A56 pa11ia1s
143,622,954 *0DC3AAE9E3FCBD81F892A26F7F097ACB4DC90095 PABLO.ALFISI
143,622,955 *0DC19FFB33391455DA3C79F284F7F08008281C39 PABLOBOCKSKOPF
143,622,956 *0DC255935355081F2EC8DEF05448AF4666428391 PACIFICMERCURY
143,622,957 *0DC1E15A54FAF48606606EDD1748B74317FD945E UPCD
143,622,958 *0DCF2278DACDD91EFD6358244C6A9D158331B7AE pak-me-shume-(heaven)
143,622,959 *0DCE068BD69E7A7AD261F301EDC60FAEF5F80E97 PALMREKENAAR
143,622,960 *0DCFCA36DF3B989AEC8D93F38EB4F377D0FDBB98 VAGHEGGIO0
143,622,961 *0DCD8A0EF945400AE086E32B6A022AA10578FEB8 PASSPORTTOHELL
143,622,962 *0DC02DF61B18B193449D8E92C4C157701ABC9C6D VALJEVOGRAD.COM
143,622,963 *0DCD78775E493FAA5A451F05FCAB6F183B2987C2 VANFEENSTIEN
143,622,964 *0DCC927369324B8F34DA6AB9ED4BA33E2D012CB3 vanlabrune
143,622,965 *0DC77A327D5569645728FDAC281D475DF3CE9EE6 p----b ~ ` (0-0)
143,622,966 *0DCCE3268BCBA22FB0763F9BBAB762201334B79C vanplay5
143,622,967 *0DC08022EE371FFCC25645552C9F4766FAD5DF2E [email protected]
143,622,968 *0DC89D64E656604F73172A9AEE1973FC1006EA5F P######D ~O~O (~_^)
143,622,969 *0DCE348C3B9AC06F3C4FB889793F2C3324CE0B2E PEATONALMENTE
143,622,970 *0DCE98D218FCF8613D5D9C65D95E1F2AD202DF41 verfilmt7
143,622,971 *0DC3192E5E43883988BF460CD8338B4A4DE1E672 VERKOMMENEM6
143,622,972 *0DCF9FEC04FBED958708D89C7C252B072CEDEB06 PERJURYMONGERING.
143,622,973 *0DC263E8B7E2130A1E5FDCA6DD87811001F8B452 petergordeno
143,622,974 *0DCBD336A5A70851D45A15F2E0AC48A6F1013E97 Pez.Dispenser.Moon
143,622,975 *0DCD1F7F9C8B4EB550B476CD0594D3C768668C39 viihtäin
143,622,976 *0DC41166A8E5C4E19B1739B9EF9255E56D06F492 VINCENT.MONCADA
143,622,977 *0DC6AB8932FBC1C037B666601EC672352B61D752 VINCENT.SAULNIER
143,622,978 *0DCD4A2E004EBCA5963AD7BED0FF4CCA0A9A1EAD vinie.melinda
143,622,979 *0DC478DFADAFDB4F40212637DF9634AF49551D0C VIOLET.IACOVELLI
143,622,980 *0DCFD25750D76DBAA8AC3F7E4615E14E4F19F31D pictureless3
143,622,981 *0DC9EEFEEF60B3F6ED23EB114C4DB4DD4C496A45 PISTOLENJENNY
143,622,982 *0DC4B9A6C63F16F5B08D4C891E541F13B3182153 pizzica-tarantata
143,622,983 *0DCE33FE3E1F2F0272E647633CBCA43B50530B6E pledge;-lend-on-security-&c-787
143,622,984 *0DC8762A1E4F8CB5E5F69C1742464656B42F5C1E VYASHL
143,622,985 *0DC9EE843F0B02F0B9FB88C52044A90DD2F9973E WALKERBOZO2
143,622,986 *0DCC0940D3E31382DF089B6E6F74A194F8AA85FB wanda-martin-harris
143,622,987 *0DC952921488A8DB8811F2C69008179054ED63F3 WANDRATSCHEK
143,622,988 *0DCFB50AC8EA4670E6A3246651CDBAAFC86E196F [email protected]
143,622,989 *0DC1D2418E8CA13EF66CA884F909E92ECF0034FC pp~0splat
143,622,990 *0DC26B097DCFA0E8CACD4B30E3DA6C5010B991A1 p=p ~0)x(
143,622,991 *0DCC0F48A484CEC1B48DBCEBEA6FE74C15AC7E15 warrennowack
143,622,992 *0DCA419C15660E652DA483FCC42B1B0C619B39E2 PR0C3LLAS
143,622,993 *0DCEBC7AE9C168BA8F6347F4E9050F50B68A5D33 PR34$$3MB1Y
143,622,994 *0DC7A2515ABDC25E461DBEEA1A8D624281284A93 PREREMUNERATE9
143,622,995 *0DC2FE5EFE4C33BE3B91CF2A5085A35E499E2EE2 PRESTON.ULLMAN
143,622,996 *0DC0C2DE2593364AE2D55A6ED260C84CCAA777B6 [email protected]
143,622,997 *0DC46967762908E4B13C489D220249EF058FCF8C [email protected]
143,622,998 *0DCD73170C57F719346273EF8F8B466FEFF12B89 WELDBONDINGWELDBONDING
143,622,999 *0DC7548416239310DE11629FCF1CE87144D5D80D WELDON.LEVITRE
143,623,000 *0DC8CDCE4775E63086B8FDE9A374614481C39107 prod1s4rm4m3n+
143,623,001 *0DCB848230F0BDE62E7239A5D4FBA7A1CEBF0C67 Well,OhWell
143,623,002 *0DCB9C189442367ACFC2ACFD6E572AA214592B52 wendellschaunt
143,623,003 *0DC1AFDFD35BFCA40CAF2C238008412817847363 [email protected]
143,623,004 *0DC5B9EE9062AEF5593B1054A3642A0FBED9D618 PSPPS306
143,623,005 *0DCA6533D3E774651C2B24521EBBE572FEDFAED4 WES.POKE
143,623,006 *0DC3B5C168826728B813BAF93271139DB2F433E4 WHANOA
143,623,007 *0DC355F5E6491EEAE89F038665F2A3E273867839 puntzak6
143,623,008 *0DC6ED43E2DD47ED993CDBAB669084998BE86F0D PURSUERNING
143,623,009 *0DC70915F257C4DAA6747F08AFBA942BCBECBB29 WHERE-I'M-GOING-TO
143,623,010 *0DC135FDD0DE0B1B15381D90EFF9EBF0C55204A3 whymansionolantightowersoldfrithspostcardkentforsale
143,623,011 *0DC7592AF2BCFA698CBE7DBC8E311AAF43E34D4D wikiarmagetronadnet
143,623,012 *0DC9E88DA976B0FC8E01772AC52B0DB1138C2FCF Q#####D~O~O)X(
143,623,013 *0DC3B8F3997BA2FD44DDE153C3B76EA2CAD524C5 [email protected]
143,623,014 *0DCE53FF629AF3BEF116A097AA7CE2A07C765E70 WILKSS-BISRAT
143,623,015 *0DCC67049C4A67B9B01F92946A88CFB3EBE459B6 Q------P~~(0_<)
143,623,016 *0DCF7F6B583F8B6F1B8C8E7DA67526DC1D61383C WILLIAM SEGELHORST
143,623,017 *0DC38D9A4B85BCF6CFDEF4D861A58BC3FA1461D4 williamspych
143,623,018 *0DCEED15B33E18E3CCF6F20B2CBCE2793891BEF6 willianbuhr
143,623,019 *0DC3EAF79EAC58B0D0E3B8BDB0A1585A417A0595 q---->.*splat!
143,623,020 *0DCE3F4BC636C9C84F2F7DAD687F55ABA8809000 WILMER.DUBBS
143,623,021 *0DCE285396E4A9603DEA08745A062F081A069031 WILMERFULOP
143,623,022 *0DC4809CF3E28036809322B436D6C74759693B07 WILMER.SHOLLER
143,623,023 *0DCC4C62532A47F3AE2B6303A745B321FA446595 QUINTIN.CARVETT
143,623,024 *0DCD84F2A9A8F07B9A8AD4885D32C6DEB0844BEB QWERTYHOUSE
143,623,025 *0DCF7C9580AA12FF5CB4B7827EB408F69E401F85 r3d1in3$
143,623,026 *0DCBE7DC491D2ACB7D78832A7095378E232DDADB R3D-THIGH
143,623,027 *0DCE986AE0963D0D09813B28FA47C4EA6A47B54F WINFORDLISMAN
143,623,028 *0DCF3DB31BAE5C4FB21F386DE7C3072D711D564C radica.markovic
143,623,029 *0DC5EB5B0FF0B15B5BA844C6043476BD24A07265 WIRTSCHAFTSSPITZEN
143,623,030 *0DC1B40E72F5CBC51E9B5470850A5F99BEED5408 rafaelalvis
143,623,031 *0DC070E42968BC598041B4B43D751FB8DB137710 RAFAEL-ENRIQUEZ
143,623,032 *0DC5A2E3FBA7A92A9D7C105581918EBEAAABB458 RAFAELHIRSCHFELD
143,623,033 *0DC73103C05850E80C0AF6466915F7619F555391 WM.MICKEY
143,623,034 *0DC31CDD7A6EB05D64BF5F63D0BF6AF74D1D374F [email protected]
143,623,035 *0DC97C47B0C0962DD044B838F6039685A3C33155 RANDALLMENNELLA
143,623,036 *0DC17BC7A671B6F0FE7C75655E5D6B2136183E0E WONDERINGLEIFERN
143,623,037 *0DC8EBD49E5809FD51CECA24CDB20E7994C0C75A RAY-CUA
143,623,038 *0DC34BBF5A398F4D1C177DD10B51D5950983A3B4 wroclawskim
143,623,039 *0DC233968FDAA07F1A075F147C8634C902D2CA44 WSSRZCHN3
143,623,040 *0DC8B0F1B1B02A7C68E6A15B781E19DCB2986E94 WUDEZHONG
143,623,041 *0DC0B51DFF9C7F84A8A8C89A3F609B50796DE5D8 WU.DUANROU
143,623,042 *0DC83D747FAC9D6780E40F53B3AE4F915456FA32 [email protected]
143,623,043 *0DCD05B45EBC77D740C488702AADA07E73EA8146 R.CARLOSNAKAI&WILLIAMEATONWITHBLACKLODGESINGERS
143,623,044 *0DC74B128AC88D84BD43263139728D98E212FECA [email protected][email protected]!zes
143,623,045 *0DCB04A8E96D6B3352AC167F291884CD5199DDB4 REDJOSEPH5
143,623,046 *0DCCCE0DC4249C2A55CE398BF196E417FDA69A11 [email protected]
143,623,047 *0DCB1801945251420DD5770222BD79A3D4E58C98 WWWSHALLONCOM
143,623,048 *0DCC8BD1A7D216FBB84C11208C5C699C4E285AD7 WWWSOUNDCOMPARISONS
143,623,049 *0DC56C8A52853A8A77B75A56D7E17223548A4AAE WWWWAKELYCONSULTINGCOM
143,623,050 *0DC286711610DC70A69BD516BBEAABB2911FB11A reispassen8
143,623,051 *0DC7F58FC70A3225FE64FFB8A18D71E8AC76B556 XAVIERELAINE9
143,623,052 *0DC853B47C12D1F98A12294649D81A3452A5CBE9 REMBUR$EMEN+$
143,623,053 *0DCD447B1B6BE924CA6278CAC24A28D0B149CE2E rhettdul
143,623,054 *0DCB67A7CEF5C88A5563F6084EDFC48A4859D4B2 rickeymuzzy
143,623,055 *0DC74AB1CF803F4BC0D2E845E0924E96F9175FEB [email protected]
143,623,056 *0DCC4DC08A1C9B74FFA607A72D2520A031E68D52 rick-mckibben
143,623,057 *0DCD47FA11A016796DA7F2317C23E2939C05046D x-pect
143,623,058 *0DCF706D1BA763587C3355A21F3B34B52C78EC52 RIL
143,623,059 *0DCADF35121E8BC4DAA68C2A963DA30AC10D8EEA XXIF
143,623,060 *0DC387C397A2C4D8555C6BB191AAF1BEE67EDFD5 [email protected]
143,623,061 *0DCA6D647BA9F70BB406DEC6ED96893B6967C6E2 [email protected]
143,623,062 *0DC16E13490B8DB06E5200CC68CA67D3FD8C2B7B ROARガール(2006年)
143,623,063 *0DC063E4C7F24EBDC595788A91EEF93384A1BB83 [email protected]
143,623,064 *0DC9F3BB92F2737F47EE211564F0738942FB2E45 ROBERTOCARLOSCANTAPARAAJUVENTUDE
143,623,065 *0DCD58D60199E89723157B8BEEB90557F5DE3599 robertodumesnil
143,623,066 *0DC8A161B7BD4ACCBA90029FE82C30F878744694 YAMAHAZEPPELIN9
143,623,067 *0DC58527D766BBF14AAD6F70DDCEB32BFC4EB8F9 YAMZON-RAMOS
143,623,068 *0DC8567CB8846D8F8DBB9C1C17281FA8D4F346F8 yangqinghong
143,623,069 *0DCA02A55898CA852DDC2C50DD4E70FF938DE182 [email protected]
143,623,070 *0DC874829787A29DDB691DA0F238F133DFF1AAB3 RODRIGOLUNARDI
143,623,071 *0DC512636DCF5DD5105FA89C3B1DDCF72D2D7A69 yawanrutegatspu
143,623,072 *0DC843EF03D4659251241D587353C5BFD32CF326 ROKERITAR
143,623,073 *0DC10C72C46FF0BE329CC5D90DFBF560430B07DA RONCAMOS0
143,623,074 *0DCEB5CBE7F59AEE4FBB8918D4E20A0543445F98 YEAP-KIM-PENG
143,623,075 *0DCFB4BE0C977AEC251F14B0B1236B53CE5FE818 YELLOWCAKES3
143,623,076 *0DC57E17EC68B9A907F575372423A156F1F69F13 YILLIKLI4
143,623,077 *0DC820264323C6C0B38CC511B5B849C2EF0DE068 ROTSISNART7
143,623,078 *0DC4E3A1EAC5DC7E109B014640E118CBCF4D0699 royhe
143,623,079 *0DC6FADEE3A5B179C7F96A6FBEAAFB195E17AF49 roykarmel
143,623,080 *0DC022DEE8103F11DEE0B9BAFDA8E3E05D8B3849 ynowrezc
143,623,081 *0DCE13DD0C3CB2B79D740728E41ED2E64E113759 ROZTRALI6
143,623,082 *0DC350CAB007BA5E9ABEFF61D7768203244D4179 YOHANCE.JENNINGS
143,623,083 *0DC8D3DA56F7A82406941E765819504AFFC6756B rSs
143,623,084 *0DC479E881C5C0CE33F1E2AC70F0FD0A4A5C71E3 rt8f
143,623,085 *0DCCD51B549F6DA6A988227F810755D8BA40A009 YOUKARIE.DUNCAN
143,623,086 *0DCF0392F561ECCA415D65B57D9135813439B2D8 RUBY.PABALATE
143,623,087 *0DC089DF3C550B275CC425357A9AA07C25209A83 YOURS.INSERTBELLTOW
143,623,088 *0DCCCD0BAB3FEF03F2940C9BB616B30ECD53A09C rudolfmanfra
143,623,089 *0DC099E2BAE96B15BF8E5C4233D538B80C0F95DF russel.barrientos
143,623,090 *0DCB39DDFB4433BCA9D9AF8D9EFC65F722E32FEE Yuki'sHomeTownHiFi
143,623,091 *0DCA87DA935BF28952B7FAF49675D8381D78D46C s3pgn
143,623,092 *0DC126AA953A3D306ED771F5FB5C730B1FDB9C6C [email protected]
143,623,093 *0DCA224ADE9DFB79D41E5281D0E8D179DF1A0369 Sad.Clown.(CBC.Session)
143,623,094 *0DC28186A2F1EF15BC6421BCC09D0FCCE3FD4D83 SADDICTION
143,623,095 *0DC8AB3E5EC7F48F378B30A29920C35ADE505294 zac.hanscom
143,623,096 *0DCC7697006F58A50BF15BF09C22C41716CAD9A8 ZACHARYPODIETZ
143,623,097 *0DCB3B2421F7FFB7E9613C1B78EB5284F03CC87A SALAM RAMI
143,623,098 *0DCA1B1BA7B44DF9457698DCDFB4AADAB33939F7 SANDY.POUGE
143,623,099 *0DCDECA15F570ACA0E1DEE6B72F348A3E9398EE7 sarcoptidaes
143,623,100 *0DC3461CA2BF584C93E32FD27B71A1912A4C6E99 [email protected]
143,623,101 *0DC5B9445D91B64B359FC8859A5F0FE02400132D ZAC.LEITH
143,623,102 *0DC68A557645D2C697C68285C9C858248F14EADD ZAKROCITI7
143,623,103 *0DC167EF5638D2CB0F12888027441AA40D3880BD SCHMIDT)認為哥貝克力山丘是伊甸園里的一座神殿。
143,623,104 *0DCD55DE33B198EE1CF2143B246D7550248BD689 SCHOORSTEENMAS
143,623,105 *0DC933DEF0D27E13D565A188FAD5E7F9B4E33C11 schornsteinkonstruktion
143,623,106 *0DC3DDEF5D7F28445EB5C8A11219128846CFEDEC scorpianqueen
143,623,107 *0DC8294DBD91D9B0A25D75CBEF5566C4BFEC71FE ZDRAVOTNIKIES
143,623,108 *0DC58E37E5B69D959D529C75D72D06942DBD3156 ZEEASSUR5
143,623,109 *0DCD3F5A1EEBD81E81EB8E44444891FA51BD304F SECONDHELPING5
143,623,110 *0DC08023C2735F331FAAFD571E867D33FD446B95 SEE REFERENCE BOOKS)
143,623,111 *0DC78D46487FC5ABD1F764DD120C7FA609B10610 SERINA.GARCIA
143,623,112 *0DCE3E8D62618282D190282EC96D77DCAD5CD18A ZEYAD-ARIF-SATTAR
143,623,113 *0DCE0864250612B454173454F023912907F01838 ZEYFOULA6
143,623,114 *0DCE70E28543B256859BDE41DE55D4AD7E2C380C [email protected]
143,623,115 *0DC2FB6C96A0D8276725A143D9B3585466B2A273 ZHANGKASE
143,623,116 *0DC74A0141D902D1B21C922498CCF51FD18E3A32 [email protected]
143,623,117 *0DC804AF5D28FC40FEF8AD6BEB64C95512D7171D SF#W
143,623,118 *0DCD97435B1752D22AA0847157A481AE7AF380DD SGNODEEM
143,623,119 *0DC032C2B18C5FAADA38D39E1F61061733FAED26 SGORFSSECCA
143,623,120 *0DCACFB9BF613845B7ED7D898DE8636A0F4F3B83 [email protected]
143,623,121 *0DC090EDD153405E9B12BDDE8BDFD43C16DA7CF3 ZIONISTIC
143,623,122 *0DCF09A818EB71ECDC2D74E73FB3567FB926F7D5 zmmgeu
143,623,123 *0DC85D777DF910296620432BF34CE90769EBCC2F SHAUN.STREFF
143,623,124 *0DCF656B45C337C8283B0DC4E4348E492F2D453C ZOOLOGYPALETTES
143,623,125 *0DC1E63B502E3EE70227517114241D78B84EA486 [email protected]
143,623,126 *0DCA31AFD722CCC93A18330632A802F787C206E2 zpykbcvw7
143,623,127 *0DCD839865385645527659DC2EA16E822595B5DC ZWANGSANLEIHE
143,623,128 *0DC09F7E6A96394951E8C19D5244D63FDBD77E84 [email protected]
143,623,129 *0DCFA41C170B4E84A0AE7DCE6019194F3965C17B [email protected]
143,623,130 *0DCEB2C9957D606F499D6FAD22F871C1337E4463 shooting-in-rawalpindi-targets-retired-general-yn
143,623,131 *0DC425A827536258BBCE89E1FFDCD787A12A0BE7 SI<1
143,623,132 *0DC09C143FB2A4B446540F359EE907A660B7E7E7 sidlofwall
143,623,133 *0DC4AF6AC9BFA405192B460C4B28AD0580BFC2C8 БАЙКАЛЬСЬКІ
143,623,134 *0DCF93FF33C36639FA3ABCCB21EF806A15AF334C БЕНДЕРСЬКІЙ
143,623,135 *0DCD22E1CF24D93A2AC28A1BD9B3F6AB5CC0CA71 бергенское
143,623,136 *0DC8500982BD712EBA73092DAE311C34C7A74745 експериментуючи
143,623,137 *0DC9C1B2EAC02DB6D7995FCC4F66EDD858C25128 ЛУСИЕН
143,623,138 *0DCEDBAE79309F62F474C4184016DABD59CDA840 SKCARCMIGGING
143,623,139 *0DCFD0FB2E6F15F6EC426225DB7B07582B7E50FE SKOGIVE9
143,623,140 *0DC0815822FBCF47BEFFF1D63B4FB58FD700D586 особоба
143,623,141 *0DCC3E31D998EC0A6ECF939B3F95F4D376B1DF48 SNAPRAT5
143,623,142 *0DC8EC616AB5DA76D1EB297641355E74B92BEC0A SNOITNETXING
143,623,143 *0DC6BD30BD56883B4BB0D2B3BBC289CA0D9E180E SOCLOSE(UNPLUGGED)
143,623,144 *0DC6A0AF9411FED33E01AAF14EA203E700331685 solomonhongo
143,623,145 *0DC9FC8947E2B1DADD9CE2094B002AAB43690188 soporze
143,623,146 *0DC74A28037025EBD22DC39A7C43D0055F3CEB84 sosialku
143,623,147 *0DC69CD9D8C2162948A669A151233AF9AAFEB2F7 SPACEDESIGN
143,623,148 *0DCB8A1D08030837F4B3F1771BD4760D449ADCF7 SPARLES136
143,623,149 *0DC3BE16DC81E07FEBD0F1CE37A5466B5DF49A41 spazatack
143,623,150 *0DC8D384AFDC437D145F3141912682B448FF8020 SPECIALIZZEREBBERO2
143,623,151 *0DC80E9242618D2AA21748B8BDF04DFCC5E96CF6 SPIJKERACHTIGE
143,623,152 *0DCB5C0697EE6FCE7378B6597604C4AD75971040 splat o~0~ @===p
143,623,153 *0DC6280BA4BADEF02860158873CB425D2A45553F splato~0~-q--3
143,623,154 *0DC598E857D53124CB1CC654623649148BA915B3 SPLAT O~D-P
143,623,155 *0DCE4766E40CB3EC637AD292829B551E42E561D4 splat!!o~-o~(##q
143,623,156 *0DCF65C00460DAA7D2C66CEB0C444F44B2BEEE3E SPORTSMARIAH?
143,623,157 *0DC84B93BC6C7CF78E529D2BF96DE1F42ABFF2F6 SPRZYMIERZAC9
143,623,158 *0DC1EAF83259D72438C483337E24EDD5D0EA522D src="http//ecximagesamazoncom/images/i/21jj59aavcl_aa115_jpg
143,623,159 *0DCA44D00FBD3D01D2C661B70041EEEFEAE9281B SREGNAFP!
143,623,160 *0DC48187EDF7081EFEBDAB58E6E757DAF4EE3ECE SRHPSSWTHGNGRNFRNTFTHMRRRTHYR
143,623,161 *0DC2F12CBF30CFED7518C61AAE295DF71821D965 [email protected]
143,623,162 *0DCE84F3B4D7F8F2DAC006F671BD2F78C002254C STACYSKIBO
143,623,163 *0DC48C07898665250C8DF57686CC5B0A71E9B309 stantontruman
143,623,164 *0DCC4D7F741FA505E4917FAB83B6ADE44DA07C86 stephenleclaire
143,623,165 *0DC02F825440B4C45DF345F1A1BF30720F7E5807 STILL.RAULPASCAL
143,623,166 *0DCF3E6F22233B33EF589A16ECDF509ABA68568C STLANLEIED
143,623,167 *0DCD77868606FF819FDD4C6EAF5EC4738E023078 Storm(live)
143,623,168 *0DCECDE82289CF0F271E5F3227E03A1037EECF16 STRANGEMAN32
143,623,169 *0DC6A1AFA7E86D678BD313F430A3F3E9224E992C Strebla-1
143,623,170 *0DC1ABCCBF1CEAE1F5CE1AC5A60E49686A1657BA STRILLAVOS7
143,623,171 *0DC4D429751047CEC8512BB4973DCC040410A4A8 STRNUL
143,623,172 *0DCD5F7A595834D24D4A52532BA4A753D029D1F0 STUARTMACPHERSON
143,623,173 *0DCF0708A131E5A706C841E39816E1FC30A995B8 STUDENTTOMMY2
143,623,174 *0DCCE491878F715F00ED8D9986CD95063EF23CCF STYMPERNES3
143,623,175 *0DCE86DBFC72B2F0F47C59AC350936A52B542145 SUNG.TOWLER
143,623,176 *0DC1479CC0B921DDBA807CBBAB050BCDFA77C9B9 supermarvelous5
143,623,177 *0DC7C10221847E5C7C25101BB6545047CF36A2D4 SUPPLISCI1
143,623,178 *0DC46DBA710248807D05C4D471A41E8DF50A8DE6 [email protected]
143,623,179 *0DC2E4D122C010297AF24FC6C732A393ADCC564B [email protected]
143,623,180 *0DC2CAEFC2C02C174AFBD04F387C798DCDB432CC T1KS2CIS
143,623,181 *0DCACFE8806F6644B285D800600C1776E4A15F54 t4lg4tes
143,623,182 *0DCE8EC48E30FB215D57AFEE1BD0D8B661BE54A5 青少年演員ANNA
143,623,183 *0DCD823E1734D8E91B6DA725BB688191F0C57DAC taylorshurts
143,623,184 *0DC62ED436B5B1937C5632A4B4D96F49BFAC0C8F TBMASIRATONS
143,623,185 *0DC3E766D880A16372296D2213FF557E446FB7A8 TCHIKOWSKI
143,623,186 *0DCBA551840E49DD075148491F80287667AB9139 TEK|
143,623,187 *0DC25592FADDED271EC1C1762BB73F31F453B9E5 tempawesome
143,623,188 *0DCA7AC09AC9E3316B19CC35F7E7C0DF9DE95DC5 tennists
143,623,189 *0DC2476DAEAE84FACC6E56CC2FE93DA9A2FCED94 TEODOROONEEL
143,623,190 *0DCCB0D25CA6F751A223455BA7B8C79DDC43E804 01291859
143,623,191 *0DC47ABBAE35085A7B3381CD05D54E461FD57913 TERRY.BELOTE
143,623,192 *0DC4968570C3E6EC6665F12474774A27DE0F6E2F TESTEMUNHAREM2
143,623,193 *0DCD89960653135D9A03FA12FCBEBD737F2C0306 tetrarch
143,623,194 *0DCC2CC487285A9E830ABEAB13CCCEEF169DF4FC TGNERTS9
143,623,195 *0DC866180D04194BD85664B12C1A50E3F7E30493 03021685
143,623,196 *0DCA9ABCBD733B3B9780FD51EBDBE900A7AAF708 040JADON
143,623,197 *0DC2B2A4469EAD3689773FDE77B54A1828FF0941 THATAPPLE75
143,623,198 *0DCC2CF447263D0BBF5D9F720B5D2EBA85DA38F6 07UPTON64
143,623,199 *0DC090C4544B8FC806320DDD44124128E36DC2B2 thebrpage
143,623,200 *0DC86ACF5D092AE37E10271685CFCA05D3D48C62 thefiresideinncomwww
143,623,201 *0DCD666DD4B7779B955D286FCDFDCFAC7A08F01C THEGLORIOUSDEAD1
143,623,202 *0DC5070177E38F57D767592F5C77D04B13747ECD THE.LINE.(BOILERHOUSE.RADIO.EDIT)
143,623,203 *0DC675F40BB7DFFBEA018B29F774379EB04EEBE6 THE LONELY HORSEMAN
143,623,204 *0DCCFCF4F5C4E836F3A4AFD48FED2B62DA6DCC99 THE.MOTOR.SONG
143,623,205 *0DC52E661AD2458C4575F16CC35A470E4325974C theorieanteilen
143,623,206 *0DCCCCFB2C38642B9B08020FC9F73E2FF604913E 1077158 LADY TWIG JUOKSI H
143,623,207 *0DC097EF2A9898BDCBFA864C451610DE3603950F 1084597 kaupunkisuunnittelulautakunta.katsoo.,.ett
143,623,208 *0DCB4ACD48B0CF44D4B0AB5860EE319BB6C8B5ED 1144182 geburtstag , interessiert
143,623,209 *0DCEBCF1BC7E23CCBAE4E8DF6888E78BAB88ED39 THIS IS A WARNINGNOT TO DISTURB
143,623,210 *0DC03DB1B55B6BC91B5314CF04B30F4006C9487B 1295815 sosiaali-./.terveydenhuoltoon.sovellettuna.n
143,623,211 *0DC207A0ECD1328231F2CC81E438402A77EDD0F3 [email protected]
143,623,212 *0DC11BAAEBA68ECF7C8370DF38DCA40EBD6FC0E6 TIĈINANOJ
143,623,213 *0DC380DEEC30F3F7681E87CA1E024BE0E09851FA tiffani.mcgee
143,623,214 *0DCFB3AD2CB172FC423D6BE695ADC356DB978778 TIMBERPOOKIE0
143,623,215 *0DC5840326A078ED882139C56B01A041A8E131DF TIMWEAGEL
143,623,216 *0DC560E7E55A3D84D9715743F2DFFCFC49888CEF tkfusfuzfy
143,623,217 *0DC44B1F0AF02815F0560D3A4246F83D89087E77 TNERETSETNOC3
143,623,218 *0DC09C3AA9D2CAF9E27C90C6EE452FDAC585A547 TOBIAS.FERNOW
143,623,219 *0DC52BDC80A1DD761D904C7DFFE01F25B15241E8 [email protected]
143,623,220 *0DC0D25496C23F6A3E956FEE20542B62E766D98C tomasaber
143,623,221 *0DC2C2D3DFD87727BFC60AAACE3403077F62A354 TOMAS.JANNER
143,623,222 *0DCA94647A8123BB1E26BCACFA9E00F882345029 157am
143,623,223 *0DC6D4487B0FF9DDEE78716FCDF591D6B9F1B28E 15AUGUST1485
143,623,224 *0DC5A337192209E6EFC250C35DB9736252A66D0A toneyambriz
143,623,225 *0DC0D00B2094DFBE3533184731407FADCC143ECA [email protected]
143,623,226 *0DC8CB44C37892083EEB43B7ADDC502E32088719 tonycal
143,623,227 *0DC096072F115C1D66AE25D4AB2E4E5B50CAA18F TORFBR
143,623,228 *0DC6AEB58C24D85B7D36A8E4071BAD35BADD813F torpillez
143,623,229 *0DC3BF5E35302291F2DEF5EDA3B6C6272D53E4DF TORTECH4
143,623,230 *0DCB32900002C084D2CBF6247CACA28518D1B1CB traceydayhuff
143,623,231 *0DC1A069E4FF774C382ED804B86C47CAD5B01CB9 tracystephanyvandeyacht
143,623,232 *0DCBD4CDA40D4883551ACA6C3456C45D7BCBF4E9 TRANSLATION2:PAPSICO
143,623,233 *0DC472B6EEBFFA8FF539AC202E964C2E54C51B09 TRECYAGUSTINE
143,623,234 *0DCE7FF701F0AECE534E73417D9A6EF60072AFB9 15TH-JUNE-2007,-DELAMERE-FOREST,-CHESHIRE
143,623,235 *0DC04DA31EB164791689537B159DB87FE4B610C6 trekonline
143,623,236 *0DCECF0DE82F4B31FD0E627AF289A2C0A02DF180 16 TORSCHUETZIN
143,623,237 *0DC8DEFEE091EDACE883BF56D49761FF8D2AE95A TRISTAN.WYNIA
143,623,238 *0DCD15EDA72E060726573F7929E7735B37C837D9 $$troopers(charliefanclubremix)
143,623,239 *0DC2D62C7F3919E831D64DF9A9B770E8D2461522 TSIVROFSDNAL7
143,623,240 *0DC8920A5F640C4C4530CA020531A15188D38E9E TSNETEIB0
143,623,241 *0DCCD8E25C6D7FC3E95BCB3573DED67C1EDF8519 [email protected]
143,623,242 *0DC78A4F9543F5F2C75018F01B6B9145083012A8 1 ALIENSAIHE
143,623,243 *0DC3B6FB17258D4679E143E9827FE47FC106F448 TWELVESTONED
143,623,244 *0DCC3AA60F934F3CE7403C77A735329A0977029A twentyfourhourclock
143,623,245 *0DCD701E0586C4DAEDD21C2C329D3966AFAF9D1A 1.BAHNERPRESSERGRUPPE
143,623,246 *0DCAA94D9EC8E21FE4A67E919ABAAB6F81E91E7D twosidedmarket
143,623,247 *0DC6CD7AB4CE65E00BD3132A0D5D74A1E5552671 1bopstandards
143,623,248 *0DC3A6CC5CCF9C2A48723A86B3B5258ACD7C3227 TYHERKSTROETER
143,623,249 *0DCF634406EE48D4577DBFCE64EAB5F714DD5D58 TYRELL.FIREMAN
143,623,250 *0DCA8379623EBAE04760183FB96D2E40665B2923 U149798
143,623,251 *0DCDD3249AFD95EA113B340413ADB2F1BB17A3A4 1.ER
143,623,252 *0DC4A9F5A4F78C68EB413B9728FF94129B137769 1 EU-HANKKEELLA
143,623,253 *0DCB9B11BBB1147E1CC640BEEFAC650D77FD1E61 UDSSERVER
143,623,254 *0DC7C1DEE593336A7ADE403BA2DBF2ACC19ECB87 1foederationsanwalt
143,623,255 *0DC1A34F6DFB7F23F30AE17BBAE9F60D2D5D781B UFEIIIDAIHATSU
143,623,256 *0DC189F7374809B9374787586048EC1778D8DF76 1-FREUNDNER
143,623,257 *0DCD960A6C771405A830B4F67BA83EF35C6BE31D ultra-zone
143,623,258 *0DC8CD600F09C5AC2CE2DBCA448995E86A96D03A UNDECENNIAL
143,623,259 *0DCFF8F023BB98A9951E7E94BBA2BCFEC0D1CB8B 1.GREEN-FENCED
143,623,260 *0DCA7A319DEC24EA4F9B01FA9021370F005B016F 1.khmeril
143,623,261 *0DC2C107CE64FA825868BB869EB9D0FB455663F0 [email protected]
143,623,262 *0DCAE725A51FCF849B82CAE42EEDC4F3C05606AF 1KOOIEN
143,623,263 *0DC2CC561624E589F96E0115718B5BCB45BF5CE3 1kyphoses
143,623,264 *0DC99F27E647BE9E9E7295E1F229BBDDCE8EDAFF UPOMNAT3
143,623,265 *0DCD3AD8A74A38436D40118F101EAC16B40809A2 1MAHALIAN
143,623,266 *0DC919F3ED673F80B5CF82825C5E599A92FD2AAA 1MARIONETTENSTUECK
143,623,267 *0DC79466F19E63E601102E4512030F8DAA544F8F URICAWILLIAMS
143,623,268 *0DC7A341129983D66D6A7B1FBF704BED214DC9EF UR?L
143,623,269 *0DC9CF55E4108E0FFD51479A736ED4EF444CF160 1NAME-WILLIAM
143,623,270 *0DCD76FB1F144774970D0E7B1241655358F8798D 1 NGOR'S
143,623,271 *0DC8045390AFEEEAF3BE5AB02CEE3A1112405F58 1nuorisotakuu
143,623,272 *0DC725DB7F219A0006F4BEF2F940537E24EA5959 V^2"
143,623,273 *0DC78890D9FD7425E93133710D05496D38E21530 VAGARIÑA
143,623,274 *0DCE09AD425640999D855490763FE66768C7910C VANDUC-CHUNG
143,623,275 *0DC26A473374D661BA9FD7A7E1949F4C67B7C19E 1REPAESENTATIVES
143,623,276 *0DCA5509032C863F8A35B915670CE326454960CA varshagala
143,623,277 *0DC88C20977920C3B8D7A36F71F7C9ACA204F95B vasanthakamath
143,623,278 *0DC647C6B58FCA8CDEED7DB8EF246832042323DE VASOCONSTRICTRICESES1
143,623,279 *0DCA39141E9D33CB01BB80CE2D8DCD7B49119B19 VASTATAKINBSW7
143,623,280 *0DC8AA79C7E2B3F3F705011A908AE625C398A512 vasy-dores
143,623,281 *0DC7638A41E0C67C9A77E0356425F1303CBF6047 velouria3
143,623,282 *0DC2527899082A1224A4EC5511C5515D9E1486CF VENTURA STINSON
143,623,283 *0DC42275392ABC427069A19CF90962C2F0122E87 verrassen.in.assen
143,623,284 *0DCE5C479AC8B7B14CDF5F7F4DED34AF8EFC2FEF vertikallast
143,623,285 *0DC79402C9B9B092ED70DA3AE02B63AF277246FB 1TEHORAJAKSI
143,623,286 *0DC5F7ED1DC5A0274231FC76C0B7031C842D360E 1.TEHT
143,623,287 *0DC83D3876F09ADE52315892CB60B5E7B1A6383A V.HD
143,623,288 *0DCAF300CD36987669F9AAD52BB48C87D9DD95C9 1.THEATER-TRUHE
143,623,289 *0DC6BAD6326DAAB799ED0C0A01F7A9B5ED8E87F6 1TROPPI
143,623,290 *0DC06258755DA508E7D1086CADCEBEF995CBDB50 1UITLOGT
143,623,291 *0DCC55409C07F8C563FB8468E7269AF9C4D0B459 VICTIM.OF.LOVE.(EXTENDED.VERSION)
143,623,292 *0DCD680499DC0833BFE5EBF09E14A1048B951D6B VICTORIA-KENNEDY-COWLAN
143,623,293 *0DC9AC43B1504924870C66BBBD5BCC0F6D219A00 VICTORYTRICIA9
143,623,294 *0DCC1162B51A4B26A4950EB065D0805675891FB4 2004-HIGHLIGHTS-(INTERNATIONAL-FESTIVAL-INSTITUTE-AT-ROUND-TOP)
143,623,295 *0DCB9AD3B14E33E4F7B4E8522F6379EC6AC1147D VINCENTABASTAS
143,623,296 *0DC6EE04046F49C6E47337B9A0CD76FBF0950F1D VINCENT.PABELINA
143,623,297 *0DC70EB094494B8821441C123FD85FCD12115D9C 2132021 ALLERORTEN.KOENNEN.SICH.MENSCHEN.NACKT.SONNEN..
143,623,298 *0DC1EA263C778C1CA74EC6D78693318D6D6FAE09 2143772 osallistuminen-ryhm
143,623,299 *0DC734EADD4DFD82E5052ED93C95F29E608C3F9E Virtual-Fantasy
143,623,300 *0DCE950B4A6756E2A898DB4727584735A18014E8 VIVAISTIED
143,623,301 *0DC98BE986B7AA52F74CF0C9B1B79F6A8C3B6676 2323697 tutkimus uskonnosta ja raamatusta sek
143,623,302 *0DC21AC8A413EF60E28863F374D15D1A1CE370A6 VIZCAYABIZKAIA-BASQU
143,623,303 *0DCE84D251FB131E97667E35F03D014285AC6F80 2497707 doch.sie.haben.spuren.hinterlassen..
143,623,304 *0DC15ACF639892542F18118BED4CA51B69CE16E2 24c100
143,623,305 *0DC53D59A77B1F04006D92CECD10B998605F5970 VNEŜEKONOMBANK
143,623,306 *0DCF177EC2C919C1A1B2D0E6FD1573132A426B83 252301 I'DLIKETOHAVEMOREREPUBLICANS
143,623,307 *0DC0C14BBB105E85679020AC9F46397A5F990B7B volcanoworldorg
143,623,308 *0DCEDA4A9B08F5D0328F59AFF8B45A08C2DA673D 25.edellisiin
143,623,309 *0DC3AAB050A11941AA3026C6F6A7DEDF3CC11829 26eigenbetrieb
143,623,310 *0DC8F1A9191CE327D2FA7C1EDB24A4F4C7CD5145 vpiindustries
143,623,311 *0DCFDEB4A90282104863E1E8C64F48222A301F45 2730354 bergmann-:-das-ist-richtig-und-gewollt-
143,623,312 *0DC90A06E01B8A2EA44AA896EDF4A12C1182D3B1 284thalia
143,623,313 *0DC00F8E757C93D25A5ED5D13EF8B517C6C89688 vss-logo
143,623,314 *0DC0ED082F6ED1F7C2021D28C25B878039BFFF21 VYPLNOVY2
143,623,315 *0DC5BBF671908E22970D13C4EA5F35BC1A7891BE W0R$H1PP3D
143,623,316 *0DCFF1BB9E1A4FF2EB98C79E581A348B08C7722F W153123
143,623,317 *0DC685D1507152E4010D3370F65FB7F4D846C130 w-4a
143,623,318 *0DC23AC2C7C143CDA523D030FDDBD5EB11592EB3 W4GONH4MM3R
143,623,319 *0DCE5C876F6F6D86B51B6D4AE0CE5D18C26539CA 2 AVANTGARDESCHRIFTSTELLER
143,623,320 *0DCCCCCA88E92BA62362E6335414F599334F768B 2avtuotteisiin
143,623,321 *0DCDFB9D20ACBD36B5D1B27A9A1681FF89C63A71 2 belirginlesmeye
143,623,322 *0DC89A7FC1BBE13794C6253268423FE5C6F6BA8C wajahatmacci
143,623,323 *0DC0314756CBAA4F39616B2BF543170849B93950 2luotetuiksi
143,623,324 *0DCDEA7055265D74E5010A0185C46389E1A87CEC 2.MAASTOTY
143,623,325 *0DCEF084281530D3AD587CCD591BE6AB1FF2E8B2 2 mhhunfallchirurgie
143,623,326 *0DC39E2580510D01D30680B50CD3AD4BBE2A96D4 ways.of.creation
143,623,327 *0DC8CB948A30B7CE5248509899539C395914044C 2spdsossenheim
143,623,328 *0DC8F94D87EAFEFA641EFF872133F246B1D1BF85 2.TARKISTUTIN
143,623,329 *0DCA64B21FD88EB9610CCED3731344F55BCCA03E 2TRDSSNTS
143,623,330 *0DC00522C2332B834C980D243BF3C637E9E87002 WEERASAK2008
143,623,331 *0DC80A613ACD73F2A0C6709E0231DA0FBC62D9B2 [email protected]~-~-~-;)
143,623,332 *0DCC50C6F504B547182AD33893C9AB07B1E300DF [email protected]
143,623,333 *0DCEF69FCD63A0F6FBD936FF3E97F8A290BBDBF3 35708 geknechtet,entrechtet,gefoltert
143,623,334 *0DCB9A93A441944A86FE027D859EEC543B7A3902 382ALESSANDRA
143,623,335 *0DCCEB75BC36C9B47099185885266C2C996D8EB9 [email protected]
143,623,336 *0DC03579D97505CC70FCCD0A80AE5D11F76A63AE WERDUP234
143,623,337 *0DC2D82FEF7551BF1874344DA60D0A84C9AD0077 3A2280D5ABC598B2896B7892DBA2D380.PISTOLERO
143,623,338 *0DC160EDA4082680412755FBCDA5B4159A480BD4 3blinds1
143,623,339 *0DCB55ABEE41724A5120E71854025728103B82F9 3B<-*-Q-----8
143,623,340 *0DCDFC614B96347BAC859275C34E92BA55836FB7 3LABORATUVARINCA
143,623,341 *0DC5ED8B661E57773AE563BD079F8A3A347A81D3 3labor-related
143,623,342 *0DCFCF787231F3ECFD1A6324AF2A155ACCAEB931 3LETOHDAB
143,623,343 *0DC40AD575C2032D0C0D2C89477E632BE513C6CF 3====P~0.~O.)O(
143,623,344 *0DC50F0467FFD05DB7216424FC98A56F925D63BF 3--p-`-}8{
143,623,345 *0DC408DAB6AD45DDD3F9DE42244C51CD6FBB2749 WILEY.MANIN
143,623,346 *0DCFB4502718E9E41A63B7ED81DC99D9B780DB5F 3TENEBROSE
143,623,347 *0DC8E3D954D49BA27E1DD08CA681118A3DCBE47C 400KP
143,623,348 *0DC928957AA3D49DF4110622061D80623EC165C5 WILLIEDAOUD
143,623,349 *0DC58FE65BD56F525FDCE3173E6FC4A60281D847 willisbonsey
143,623,350 *0DC40401FF60746B2120E025F1B59836C586D1DB WILMERSTENBERG
143,623,351 *0DC7DCCCAF95281897ADB56A03782184B933E470 WILSON-ABRIGO
143,623,352 *0DC680D445701D0A768DE380D827C5B9C60526E9 466saniya
143,623,353 *0DCC5A84B6F10F294108536C35295E93611527F9 WINDY.DOMINGO
143,623,354 *0DC67D2379D00EBB79F5D2B3E70FC52F50BC3EC0 winfordchappan
143,623,355 *0DC44D7B3E1677C55119EE38A8A7233FA5E91643 4GNIROMALG
143,623,356 *0DC8DEDCAD6D8665513885A95508675DD7E19E31 4GNUREINI
143,623,357 *0DCC6CB41FF8724309DCC986C75E04FA873EFDE2 4iluvfinance6
143,623,358 *0DC493EEB31151FD0AC7FAD5F75E59AC547E8163 woka世界ヘビー級王座
143,623,359 *0DC6D408B07D866B58DC580E8E14D5C353761912 4.KYTT
143,623,360 *0DC6EEA10350D91CB4B48D496A86DE1316726B64 wow情歌
143,623,361 *0DC00107DD9C84ABFE48DCA7043109BB60A9622B 4OUTFOLLOWINGINTELLIGENCEINTELLIGENCE
143,623,362 *0DCF5401B7F74EF7E56013D875AC9AB79DA62C88 4PIERREPARKER
143,623,363 *0DC353FFE5C1B3190EA60536A46E14BB067DDD03 [email protected]
143,623,364 *0DC5B4086A6EEF4406386B185F4EC889A51BC2D3 [email protected]
143,623,365 *0DCFCED04DA936EC32414BD610FE43035381BEDF WWWGYPSYPICKERSCOM
143,623,366 *0DC455E3817E1A547570D0AA1BA267A6CADC100A 4SUBJECTSHIPS
143,623,367 *0DC3F3A7D7D729E2B91ED23D6AF49616FB4EE6A7 4surkuttele
143,623,368 *0DC48746A2013B3ABC66325FDB1821CC2552C7A3 4talkful
143,623,369 *0DC82B3D32968B7C8C15E226B634D602DF25085C 4TIEOSUUDELLA
143,623,370 *0DCFCB8FAB75A1A2D481226AA99E9DB1D17B677F WWW.REVEREGAS.COM
143,623,371 *0DC52CC9A202A4E2869B9876AAA5EE986043B036 WWW.VOODOOVELVET.COM
143,623,372 *0DC969D577452348DEF8F63796BFC148B0855D09 wzxxfm
143,623,373 *0DCF094BA50DA4F3F5533838BB16098BF42855EA x2b150
143,623,374 *0DCECB20F5386E42BBEE9E80C05D5FA67FF9524A 4UNAJATELLA
143,623,375 *0DCEF355EA2BC3280B2D6931ECD9406E74CF41B2 503074 OMATKALUSTEASENTAJAMMEHUOLEHTIVAT,ETT
143,623,376 *0DC2AC4056AFA1E49DBEACD153F35E1D15E4FB28 50LVL05
143,623,377 *0DCC0BDBE7104655937B61CC8FFAC54C2C89D268 [email protected]
143,623,378 *0DC889C7A1E197D1BF21EF06CE806BA1CB5FFA70 54L4R1415
143,623,379 *0DCA2D9CEB5E7CEAA11B4C960EFE15DC99AD458B xhssrnsed
143,623,380 *0DC797F012E82A2A3D1397D80BC6927814D6303D 56george
143,623,381 *0DC7EE0D69C51454449F5FF276443E51ECAB0F6D 579118 isolla.ty
143,623,382 *0DCE6B19FDAEB63E65DFC22D2E525F843151AC52 [email protected]
143,623,383 *0DC4B56CC1EB1F97D514D802116007D05C09A9E2 xinhcollections
143,623,384 *0DC8965C245C6E248F96DCF10B68EA04CBEDEBE8 [email protected]
143,623,385 *0DCA4DD4C4E0A7869EE857055D411F6E765DFCEF 5CATALOGZENITH
143,623,386 *0DC495E37EBEF3DC7FD659D4FA7F19C3C5B909A1 [email protected]
143,623,387 *0DC9376962A78006023E89456E8A78221029BE42 5ESCALESES
143,623,388 *0DC09B18FF66A4697E2A54C7FF5189CA361C3D73 5GEMAILLEERD
143,623,389 *0DC3A14515F5922F46E31B4C711BFF45F569D4B3 5GLIDDENS
143,623,390 *0DC4F8D04F33E96838CE1B69A692B8A8819C7015 YAELIISRAELI
143,623,391 *0DCE7F5260F18053B9AD61B5819C3E1B6992AD22 5MOIRAZETE
143,623,392 *0DC5D48BA25C17AE56724D656DD3BA93554BD1DB 5MOLINISTA
143,623,393 *0DCA867F09D5660245610208CFF91F18075B29FC [email protected]
143,623,394 *0DC029DB87A61536976FB9A6041808E96AD2AE1A yannik.methot
143,623,395 *0DC8E2E56897C8F249FC80AB6C6AE20CA0A21FB8 5NHRADNHO
143,623,396 *0DCFF6013DBB1DF38C6BE774D6727784D9FE862B 5PHILIATER
143,623,397 *0DC0FA43B09EB5CC8DD31CF5DCA4EE4A6ECD62D4 yayayaya
143,623,398 *0DC355D8FAD2B3E320F19CBA2E2978AC21F6C6A8 5SANCOURT
143,623,399 *0DCD466A38A00946B1C93FB3474FBDACB7B330CD YBOOTSIE3
143,623,400 *0DCDD56E0E19E8FA8F1A70E612DACE61F2AE80BF 5SINDHULI
143,623,401 *0DCA7E9562B638138F9D57575767334DB9114CFB 5SUBFRONTALA
143,623,402 *0DCBFB7EBAF0EBC7A5F9C482A28DDFA252668E2B YG>"
143,623,403 *0DCA28A0851FD2D28093B01E157A32FBDEC84715 [email protected]
143,623,404 *0DCF4218B4511A44DDB32EAD7E50DB120454920D 5U8M1N14TUR1ZED
143,623,405 *0DC1A02F569F05FB7EE78C25F45B4DD2BA6F148B 60layla
143,623,406 *0DC233D9A696A7435B4917595044E49A4A069645 YOCASTA.FERNANDEZ
143,623,407 *0DC32AB9AE1C62BEA8EC1DEE7768F9235B78F15C yogitanautiyal
143,623,408 *0DCFDDF2B2B6090F372ED7673B8A4976237CD905 YOSHINORITOKUGAWA
143,623,409 *0DC50209E53D93E93F99A55B21D37D71A4F91C28 youguysarereally-ignorant
143,623,410 *0DCEFE26B6EF640957CE4F2031D99D07E702BB48 6BIGFOOTRAIN
143,623,411 *0DC422FABBBA1A02435A2B7E2EFCE7703151FF0A 6CONFERRENCES
143,623,412 *0DCEB54FC8474DE6CD2C1533C8F38BD6D460D4FE 6ESCHARL
143,623,413 *0DCC49E10B16B61139F180E0F6C084D96636E2FF 6galoperais
143,623,414 *0DC11CF7F508CE17186997298DC0CBC88C839DEB 6HANSCSBSW
143,623,415 *0DC25749742C9C6D75609B15AF855542CADF5A98 [email protected]
143,623,416 *0DC3A1435C8DBE5265835FBBF696EC200666E0B2 6MAREAHHAERAM
143,623,417 *0DCBB05316EDFB91D895E2AA295546FFC8C1396E zachariahcubr
143,623,418 *0DCE2AA92892C8EE2E9ECD2CB069772270B9389E 6PROHIBEBUNT
143,623,419 *0DC99682250C200C2704C1DBFCE7EC6BDF67846E ZAINMILANO MAX
143,623,420 *0DC60626F2ADAB47C67891772BE292D84AF7A170 ZAPIECZONYM
143,623,421 *0DCFFD30AAEB52348D6C96B59E83D66191BF9177 6STOMPEDS
143,623,422 *0DCB0F45145C9463769FB9C5CBA9C74E5ABE9713 6TENNISSUNDANCE
143,623,423 *0DCE49FC865F71709CBBDB00C6B912C28D69838B ZEBYSMIED
143,623,424 *0DCE7388F5B377AD8641E5A1DC01F5ED44EBB5A3 6UNKERNEL
143,623,425 *0DC41A5EC3317B63D92176EB6F1A6A52FBFB6D2E zendaherling
143,623,426 *0DCC842B9E7C52C1856A784482ED4650DD59C67E 6UNPROVING
143,623,427 *0DC5E87BE9AAE6C96708150F7915E673D48B7D05 [email protected]
143,623,428 *0DC0DAD2769AEEE0D23F1778267BDD01A070F4F4 ZEYBEK GOKBEN
143,623,429 *0DC4D0D7E68120BDD17DE999471969AA6246F298 7431B7C9-405E-3C6A-9946-31635263FDCF
143,623,430 *0DCA954297EDC999425849ED35D34697A6BED445 [email protected]
143,623,431 *0DC1AD82D794617CBC198B752263B7F8708951D7 ZIQ-RIZ-YSHR-GRPHX
143,623,432 *0DC1FEDF7D8A716EBD373B6BB8FF937D8F66F00D zongwenbo
143,623,433 *0DC281DC5E7788DF7EF514AD87136D3D345A2B55 [email protected]
143,623,434 *0DC254DD5BBE679623FE152A5FA56F3B616A97B8 zubaidah.abdul.kadir
143,623,435 *0DC01818C497293FEDE45DA1FA473C77A3C294FA zubeneschamali!
143,623,436 *0DC54B2965904AFCD5FA94701FC23F5A0766F542 ZUNAID KHURSHID
143,623,437 *0DC4AC0AC9748CB6B4EDA66C92A26038BC653947 وsardarapad
143,623,438 *0DC66A44A1DA6C77687276C484B86CDF511E1F34 7HE7CH
143,623,439 *0DC6C0EF886F99D58F8EEBF54B60B5288CA9C318 7MERCHANDS
143,623,440 *0DC9F1833A18CA53485AACB9515C52196E934247 АНДСЫ
143,623,441 *0DC1BDD879FE36BC8C8663E26DAD24A85AB52B6E ГРА́БЕЛЬНИК
143,623,442 *0DCB564E0E99853665840F131CD4B3A9980A52BF ЗАПУСТЕВШИЙ
143,623,443 *0DCFA88D4C147CED9FC218E84F5082D1C6439254 ИЗКУКУРИГВАШЕ
143,623,444 *0DC311B4FDDD851747EA0E38DB3A1053CA77A1B0 ІНТЕГРОВАННЯ
143,623,445 *0DCA05955DC0CD8F7ABA6D495D6DC7F3A5AD635B качехой
143,623,446 *0DC1B01B4D8F7ADE1648DE90D548BFAD57156A11 7THATPICKLE
143,623,447 *0DC7A3FE9C3A48D6CCCE23A2447F7F132146F6FD 7THECAROLINE7
143,623,448 *0DC9CCAB944EDF54D72D04A79B489C154E6CEC43 800MARK
143,623,449 *0DCBE08466BDF32F722058CB5C52C4F19C989381 ЛЕГКИ
143,623,450 *0DCC453248F87A245FD8F65BD9C1C681CBB38766 870685 DERENEIGENTUEMERIST:WAYNEGRETZKY.
143,623,451 *0DC2D64E3ADB97D4D7B513029DB0A14FA4053ACC 8ACTIONLEGAL
143,623,452 *0DC80AD1FB56F88B88C25AC0FF6E9E29D27B6606 8BAHUTULEBSW
143,623,453 *0DC9055A174FE261B0FC78770C08AEAC690EE910 8d~0~osplat!!
143,623,454 *0DC0F14DA309EBB44CEF07291B1BB3059B6FF6BA 8DANIELSANDY
143,623,455 *0DCB6C1DB8BF5C49CF2B522ED60CC29778285BA8 8DESAMTES
143,623,456 *0DC848D722C0ED098029C2276825C499AB81780C 8ELLIREKO
143,623,457 *0DCB2E69ED21BED7EEA9331D042D151D3B0A0784 8GRYGMQPKUGRNN
143,623,458 *0DC292BAA63B201894ACF3694772859EEBE247F2 8KURDENBSW
143,623,459 *0DCAB8659FDBF7BFE9FFAE31723B3113F9BF9192 8MACINTOSJOEL
143,623,460 *0DC439CAA8508D1BA300D5E6D7A3E478DB4BF593 8MILIUMMUILIM
143,623,461 *0DCD2CD5E79D23B61BA27464CF3A50DB318BA538 8NOTALLTHATMUCH
143,623,462 *0DC1E8114EEAC0731B85B731A7E24EB7A3D3E9DE 8=====p.`.><
143,623,463 *0DCFE957E75D624F8DFC5F9DE157080AFAE379DF 8##P~0~O:P
143,623,464 *0DCC4A266AF8B627600446A796987617B720FB8E 8SHADOWSTIGGER
143,623,465 *0DCB8D3C2FB9940A47CBF093656BB75D5319B777 8ZAMARAM
143,623,466 *0DC53980D0FF50577B5FC23020A92A8AE88DBA31 91106
143,623,467 *0DCCB41D18DD738EAEDC9A393AF61C85AD111312 線形領域時の状態。NMOS
143,623,468 *0DCE8A2168F85F16F1DD30B3777AA5216B4E9C89 9CLOCKSTEADILYTHROUGH
143,623,469 *0DC32D26F39993D15F2A41E5730D459251A07F02 9FLOWERASS
143,623,470 *0DC1E3D8F81C235D36E70C969AD63377FB33DE81 9IAMBETSY4
143,623,471 *0DCE623158EEC811DEBF1CA33017111DBF278EFF 05071270
143,623,472 *0DCEC1397EEDD0FF8EDD94941C62464477C91E2F 05TE0PATHI5T
143,623,473 *0DCCDE9CC904272C3770B3D832E47341122FBA6C 08181890
143,623,474 *0DC8044FA834F49F73489BC0ADD2705C58251130 1087882 SECOND SEMESTER SHE PUSHED HER CREDIT HOURS TO 25
143,623,475 *0DC52E58B2EDE79469600E90B2D36C3E07D369FB 9YSIJAANK
143,623,476 *0DC9216BA9D18D7B79F729253FE8AD78209F2630 a;09,
143,623,477 *0DC94C9C34B51F37F704530CA54412348A2EB0D9 A0RMA1986
143,623,478 *0DC3319BF838EB1C2616507B3285059A582EFF57 11 M
143,623,479 *0DCE3DE9EFBE63A275B6215DF8F87A3DC48CB07D 13actorsinger
143,623,480 *0DC57D667062DCCB15B489EDFF37691EF2CDD766 a3aot
143,623,481 *0DC6A29EC4AEC0F919C6A3A1FB29A53C54849EB8 a)3c1
143,623,482 *0DCBBBB154D58D032AAACDC52821A385A55755AE 1424568 l
143,623,483 *0DCE20E35522C85297CA53E7321C486C5D26CDD6 1443704 kirjakaupassaviimekev
143,623,484 *0DCEEC2606C68A91F480D610FE82E48C94519334 a;49c
143,623,485 *0DCF592958A3416AD6EC96F1FC8242156D17E99E 15.KURZSCHLUSSES
143,623,486 *0DC75A01710BAF6ED32591D6A0C0DB22026B752E 1!83R7!3S
143,623,487 *0DC52EB285E945FD2755211316EB0642EC798F98 194.schilderung
143,623,488 *0DCCA8A1D9F8DB837C3517A3DFA611E82530DE18 1986645 kuntulostan95%luottamusv
143,623,489 *0DC29D9FD76186F89863096D59D1EF4785E97E3A a9.e.
143,623,490 *0DCAC84BE44FDCBD6C3A07A24F62660C74609DE6 ^<?AA
143,623,491 *0DC3E35FDEA4F6EA56A5CA4EEFFF5D551153DA68 1aluekisoja
143,623,492 *0DC2D142C229445E50826E92A88AF075DBEBF57E 1-antibiootitkin
143,623,493 *0DC3CCB6A7AEE61AC549CB3A782602401A7E65A0 1-bmw-interessierte
143,623,494 *0DC635245F3BC624CC337955FCDE5C1EF2253581 aab%^a
143,623,495 *0DC3BA9FD21AD94DF0C5758E3AD426EF3598568D 1 EDILEBILIRIM
143,623,496 *0DC4F2D083D9A8492AE05B71189B1EAFB77FBE8C 1.ER
143,623,497 *0DC4A9F5A4F78C68EB413B9728FF94129B137769 1-EXCRUCIATING-EVEN
143,623,498 *0DC95EDC4A79889D0C22D3655D0B1084724F02CB 1FE4T
143,623,499 *0DC17C17AF123258BF591B4770C57A27572E5F7D 1FUCKOFFV
143,623,500 *0DCA2CAC4CFD79AC61902717449E2F3B58C685BF aadd`p
143,623,501 *0DC38D738732E6F44D92ECFDF900296335E2E1F4 1herunterkurbelt
143,623,502 *0DCC4D8977A93C11A19FEFF6E252E7C5748595D3 AAIQ
143,623,503 *0DC85A7CB517ACB20F38C4E350AEC915ED278CE5 AALSEGFA2
143,623,504 *0DC36B9EE1BB43AE88BA6237F800E48B9B38F618 1kararimizda
143,623,505 *0DCAA2ABFD6AEC57302D8A72AB7493E129C20DF7 AAV+$
143,623,506 *0DCF2143B15E2C1A96BCD9727726402188D55152 1MINIDRAMAS
143,623,507 *0DCC90D2553F39468CAC8808E152E375B55282B4 abbld
143,623,508 *0DCDB476E499CEF8E856AB481BABCE6EFEA06167 ABFALLTRENNUNG
143,623,509 *0DCB6DF61BBEFDBDA698928CC602663894889D0D 1PERITROCH
143,623,510 *0DCD4AF3E716F18601E7CEAE3B50CF6A14D4EEDE 1 PRINZREGENTENEICHE
143,623,511 *0DCCE1D54025FB2BAA18451A328240F06EAA1338 1-ruhsatlandirilmistir
143,623,512 *0DC85C6F0845AB89D00EBF1868FF82BE1ECBABB2 1SEPTEMER
143,623,513 *0DC5BE10A93DB39B49C7672BE9A44477E6051E0A 1SERVOMECHANICALLY
143,623,514 *0DC7E11BFF9D87D0604F719260BE1ED48D310116 1 stardomrobin
143,623,515 *0DCC660B1E4EDC9FB7E40996CDF722C1866FA7DF 1sthelicopterchase/godzillaswatsachopper
143,623,516 *0DC6487905BB3F986AF16625F49B3C4931683A36 1.stoklayamamalarI
143,623,517 *0DCABD6477754F0D7BCB023BF7C77AE0E3ACAC54 1-uCurma
143,623,518 *0DC3B10DDE2CF4EB188D423BCCE0A4408C593731 1-underway-during
143,623,519 *0DC3830C60B840FCACF16C2A2314174B54CE6F4C Across-Our-Universe
143,623,520 *0DC82420285693C1914AC5F35175BBE205729395 acurastared
143,623,521 *0DCDC7CF49E8713F56DD3BB96465D8EBE5FED70D adelskap2
143,623,522 *0DC55506BECB21EA552984D726F0270B58B12C34 Adios:.The.Greatest.Hits
143,623,523 *0DC6FC2550C016B73A390EB48006707A5802009D 23AUGUST1589
143,623,524 *0DCADC5851B694BD22C204AD37659604652DD462 243842 SOMESEEMINGLYUNLIKELYINVESTORSAREALSOJUMPINGIN.
143,623,525 *0DCE03C61295E0BBBD97737C1EEDAFDD5D896833 a+dpa
143,623,526 *0DCF60978E55AE02FD477821071387420F9DB3AA AD+T_
143,623,527 *0DC96B608A4BE78A12D364278DFF9AE5AEE05BA1 255182 gOGUs-ve-karIn-kIsmInda-bol-bulunurlar-
143,623,528 *0DCA145D7C0FF7204BD8D2575E7472B20D692086 2590628 susannasilvanderp
143,623,529 *0DC7DB4D5A051C2E8CD0DB84F6E8DE8225BF0B31 AF7J)
143,623,530 *0DC2300710D09394DD124AC6718F8A0415DF60B5 AF#PA
143,623,531 *0DCB7E8ACF58F0A468CEBCAA6DA9299A45ADC3F8 AFSHANKALEEM
143,623,532 *0DCE0852F67D974A0C3B4FF1CA5B0CE81E72CC7B 2fstevedash
143,623,533 *0DC364B850CA800A919AFDB3D0273081001F5D56 2GELEERDS
143,623,534 *0DC7A8C5825E7CC964A3C0C3C8F020617959493D 2hyv
143,623,535 *0DC7CED92C0EFEE1F708A4B03BE7597FF3E80914 2JASMIN5
143,623,536 *0DCE8C05A8C335D0A5B79B4788A1B0E96C756258 2MARCH1244
143,623,537 *0DCADC0DFB0BC77DCB7F6436EE11951ED2853F07 [email protected]
143,623,538 *0DC1E77AD371DEC98255712808F5C26B3378B8A6 2MYHEDGEHOG3
143,623,539 *0DC21456B6A1E2DAEC78E635E9F46AA59ED57CDE ahbutiseeitinyoureyes.you...doubt.
143,623,540 *0DCE0BA5561E3DA5D432D8EF15979F7174C6A531 2 RAUMGROESSE
143,623,541 *0DCCE62D3C3949D08C820E3BD0BC4C73ED26805F 2SHALISKA
143,623,542 *0DCDFC6DDD9145D7EC9A6F650D14EF143D6D19F5 AH KI
143,623,543 *0DC3AA1FCC45A93E63810DE9D7B8791AB0351DB1 2 STADTKULTUREN
143,623,544 *0DCA51E1D2AE6EE71099AB7E93AE601E0BC3769A 2.tenttisuma
143,623,545 *0DC93B9D5710FA52AEA13509ED6C05EBC98DDDD0 a%h/n
143,623,546 *0DCDFDDED4B2B4F3FA641AB7F3DE2D42F4B7C30A 2thatpunkin
143,623,547 *0DC99A9CB7F256FE2D40BC176E8C2C03FF4F1188 AI51B
143,623,548 *0DCD600B4CB64163E660F4AD92C4BB96DDD2C0F3 AIFBO
143,623,549 *0DC6C281F9710AAE7829791F80C244E2B28A969F Ai:K
143,623,550 *0DC242C81D14F6229CC20E72515C09FD8147339C A)j6
143,623,551 *0DC537803F9E0AC4DB4105BA34054A8F3E8FB497 «AJACCIO
143,623,552 *0DC8BC3BF22ECE9CF8D092E28A2131171C553DBB AJIVF
143,623,553 *0DCEECA9F0EC31F386C979B87E9960EBB339C107 362TOBY
143,623,554 *0DC05EEAFAF423AC2B0A6CDAAF84C4FC436041B4 3-augenstein
143,623,555 *0DC4F5A6B68D4BFF7D6E157008A256857E7E3F01 3======b~~(~_^)
143,623,556 *0DC42C70E23060533D2A941F9C27A75A8F124D48 3-BILGISIZLIKLERI
143,623,557 *0DC6CE7F379459B427E2D8F6A84C4E405FC6E643 AKHLAYFA
143,623,558 *0DC4900C3328B7D6A108288B686459376D8DB2B4 AKR1K
143,623,559 *0DCF357A0986CEED07B9CCCB3453A890C7E30254 ALAN.BORCHER
143,623,560 *0DCE8584399BE912A721EC9709184E77A452401E ALBERTO.WEISZBROD
143,623,561 *0DC45CE54326450FEAFD2A625F5D0F46F076F754 a;lc6
143,623,562 *0DC01894C015E44BF5BD83D6661FF1371BBB724E ALDO.GANDY
143,623,563 *0DC1F6F8387BB52F444CCD6740DA9DAE54C7220D 3IAMCONCEPT
143,623,564 *0DC5C32FE4B0513D7D9BE43D5A436FD37E0FC1DE ALEC.MONTEZ
143,623,565 *0DCE7C667D366BC8E01AB23692A9E41AB9637998 ALERINED
143,623,566 *0DC148C1BBEAEFD738A3EF9A86A747E8026940B2 alfonsohuxhold
143,623,567 *0DCCA58BA9C84010843EDCE3D6D9C3A5FB47A336 3KREAGERS
143,623,568 *0DC170105675C9A3DCAA0BBD2D36B57DAD469869 alfredpayen
143,623,569 *0DC32D56CA2DDF4213DEFFBFB250964281D1DB0D alias-expirysync-{
143,623,570 *0DCA48FABB2A6CCC8857B90701184048D08D54BF [email protected]~OO><
143,623,571 *0DC095D7219BFF4C64039F47415EBB8AB689A456 alinlik3
143,623,572 *0DC0800A2DBA1978AD99892CFA1D574F789AF097 alkgorps7
143,623,573 *0DCE574529BA64B706D0A5EC42FA426C6197887F 3schweitzer1
143,623,574 *0DC2696D25B26FFBB0A4720FD8F3A0A7766A305B 3SEDUSES
143,623,575 *0DC5ABA286BFF81CD9D1152BCF448A225F952051 alm&c
143,623,576 *0DCC1C24CDB82610397DD2F1FA1A9592D983A191 435309 tornio-/-muoniojoki-on-kaunis-,-mutta-ehk
143,623,577 *0DC14BB202F3EA7E08A6DCD195DE8BD3AD41D54E ALPHONSE.SIDBURY
143,623,578 *0DC1D6C208AD9AED76025AC1A18DBD3467804648 4COLEGGE
143,623,579 *0DC809E489F1C1714407530B22062D9A71F90F39 4-edilebilmistir
143,623,580 *0DC32925E1BAFDD563F05E063E74F00A400E90EB [email protected]
143,623,581 *0DCE1418AE80E4E08451273F4A2CC24B33481CC9 am3m
143,623,582 *0DC0A7D824075603D2EFB2840B7ED27C96AF5F42 amanda1mookie
143,623,583 *0DC2BF3A5D66EB6C3CFD68D52F0EE9B34DF3635E AMBROSEGERVASIO
143,623,584 *0DC88FEF1BB4EBACF0119ADBE701DB86536BE559 AMUHI
143,623,585 *0DCEC35C80D667F15B96A59AF98A8F366C8A5C22 A!MVQ
143,623,586 *0DC28C4DFA95EBFD3A38CFD4798D1D0D3A9997FB AM)XQ
143,623,587 *0DC8A8AF1EA4F3F06AA5316BE5162DE719D74F9F amzks
143,623,588 *0DCA4D4434B34E6DC7C939A4F0575378AB8D30B9 ANDIDATO7
143,623,589 *0DC14B8DF3EE43FBE73AF113CCB508A7F8E5C241 andycaldwell&fredeverything
143,623,590 *0DC3A2DB77CBF2816EDAA6BC60FE1C378C038559 andyhoekstra
143,623,591 *0DC5EC97808DAC57A285DCCD0B43D2DA3CAAA5D5 ANEMOTROED
143,623,592 *0DC718A82B5DD88BB4EE718CEE56993957FA6871 A.New.Beginning.(In.Between.mix)
143,623,593 *0DC766B6EA7181821EFA19C008B51FBB14A6F063 514689 voimakkaasti stressaantuneen henkil
143,623,594 *0DCF14D9759D62501DDA94CFD822DED813001862 ANIBAL.FLADGER
143,623,595 *0DC77619A469F902A094FEFE36E276E3710C3BB5 anna-maria-hill
143,623,596 *0DCC004DB0373718139E5CD7C1D1F99DE6E3B37E 5 BOWLINGMEISTERSCHAFTEN
143,623,597 *0DCBE87A75B8344000F650FEF2BFB7273341C79F ANTIMAFIOSE
143,623,598 *0DC618CC7FEDD743BAE87B9D2047DE80561E0C84 5BSWCAWLEYBSW
143,623,599 *0DCF7FF51ED08F155D06173D08F2CD5FC97FA891 5BSWDEPINTOBSW
143,623,600 *0DC545A975380CF8D479B303081B10656AB2B012 [email protected]
143,623,601 *0DCA84D9643C7C34B39F1914F8CE20C9CF4ADE12 ANTONROTA
143,623,602 *0DC02C38AB93FD833BFC6A2EA45B7C94A5853750 ao57n
143,623,603 *0DC6B0E9C370D32E994F7A1AE9E2902D4FBD16C0 A=OL
143,623,604 *0DCC7BB3BE46FD790D7E2096129845142E54C779 AOLQU
143,623,605 *0DCDDF43DF73448F96660F02FA0CED95011B29B1 aom#
143,623,606 *0DCC32C8A6B040656B86C30855A58D55155E837B APANPAS
143,623,607 *0DC1B0757A3229A1E0068B4035693BCFFC2CFB4F apfa
143,623,608 *0DCAD3E2C82AFC396DA06816E061557CE5858C03 5INCONCEIVABLENESSES
143,623,609 *0DC6A4FA4F3B04A68912475AE28F39D6C864A84D AP"QI
143,623,610 *0DCE8D486C4DDA66DED06EB55526DE9ADEADD2EC ARHEQ
143,623,611 *0DC51DC79D0105137452AD1312C7EF0E20BB09CD 5TMHYROIT
143,623,612 *0DCB1CB035E349CB469AFD83B15EC3AB59AD8612 ARMAVANSI
143,623,613 *0DCEF71A7CD72C37AA4D06E7E37A8192C3435868 ARNOLDOWINNEY
143,623,614 *0DC4F9936B9B7F169DE8B78303B95622A88AE42C arnoldsteltzer
143,623,615 *0DC2CA93A1A4DA81F4AF54A5D936B2AF5AEC2256 arnulfoott
143,623,616 *0DCFB80EA3069773393D189832253030F1C41882 615277 auch das strassenbauamt luebeck ist nicht gluecklich
143,623,617 *0DCD14138F0935DFD18321A90DB04754BB0A1F75 ARTHURSPERANDEO
143,623,618 *0DCD4DE3379F1382F7E53921835BC4E40339B888 aruanda
143,623,619 *0DCBD2149098DCD566E094FCBE1396A99A8B3C1A as.for.marionettes
143,623,620 *0DC92FF2A97B3A4D1754243B747035D02C08A9F1 assistant\non
143,623,621 *0DCB72BBF7530DCCA7B98ADDCF7E493D022D1DEF !ATTACHE
143,623,622 *0DC73543BACFF8767A2433FC3F5EE44A833E9B26 AU1#M
143,623,623 *0DC158BE03578955B9E30C040BB5195B5D9B2C6A au3?t
143,623,624 *0DC4DB5B91F412F6415EE093AEF6383B8DF3ACEE a!u+p
143,623,625 *0DC74FA8F9D295C5E468346D2414AE20471D5D6E 6KENNETHTRIXIE
143,623,626 *0DC087F4D6846F8058FB1958B341F6837AE04452 AVLK)
143,623,627 *0DC3ABB8AE3B7A2912620F79DC109CCD7E57BD4E [email protected]
143,623,628 *0DCFE22479892C6B9B9E63674EA7462B5D39654A 6SNOIYOSSA
143,623,629 *0DCA54C0D37568056D155BC99E4EF7053E71272E 6STOLISTES
143,623,630 *0DC5A0DA264F860ED8C11B0DFE6B0E94146DD4DE 6TOPGUNHAROLD
143,623,631 *0DC8C370865FE1FA9DDB1F080AC6458E60240160 6UNBELEBTER
143,623,632 *0DCEBE212E90E3E772E08563671BAF08022AF268 6VANESSAP
143,623,633 *0DC879E40AB70C36E0D75155545CC7C200C1D41F AZL)L
143,623,634 *0DCFB672D350B4ACE72002F8DD28CA6F0C0AD441 >-B0**<----B
143,623,635 *0DCFC5A235796864FD967785639AB78B16B725A4 >B0 * *qB
143,623,636 *0DC8866307BF0E465F7FCB850AEFA3D63D245700 B2WW
143,623,637 *0DC8A1C3A7EC507911C6B3DF6C20CDEA80CB8D1A B4ND S4W
143,623,638 *0DC3A97562E0DA1E87EC1414949089B706BCABEE B+6D3
143,623,639 *0DC07F29A1F056B4507848BC15808124FFE8894F b!7uk
143,623,640 *0DC916D321FD705DD38FC2A61B6D32C65F80875D b;8dt
143,623,641 *0DC988A8F3EA5DDD9DE9B7C8A1C67621B76912D6 b8lv
143,623,642 *0DC5276803220E688AAEBE77A9457124468934F0 b8s",
143,623,643 *0DCA66F326899870E0B1774C5AB9DAF333614EDF 7COWBOYVINCENT
143,623,644 *0DC6CFAB36882AC0CEA41EC58F715C57FA13797C BA5,
143,623,645 *0DCF26DB77CDEE68381DDB8DACC45EAD5748FBE7 $7ERE0PH0N1CA11Y
143,623,646 *0DCA9B930DC540EC783FD48EC81B540C472020A4 7ETNAIFNOC
143,623,647 *0DCAE6ADCB40B172E2A609C86BD8FCF10983CB49 7EXTRAORDINARYEXECUTIVEEXECUTIVE
143,623,648 *0DC2AEFB22B8E0D0300F9CDB44C5EDBAC9CE485B babi3gurlx3
143,623,649 *0DC12201E005DCDE8782D4A2A05FC80B9634C767 7FRECUENTARIVE
143,623,650 *0DC7E6DBC0E0150FC391D720ABD149ECF45C4ADA BABYYOU'REINLUCK
143,623,651 *0DCB930599CC57AA9ADEA1B74AF1A8B168E3E20B [email protected]
143,623,652 *0DC70D26F6F77E31362C56BFB45A71E914306A38 BARE(
143,623,653 *0DCB8DA247605AFA2E1BE0CE1B72F5ED25DFC7F0 bare669my702
143,623,654 *0DCF947C58104B9B8464FC9443DC6C6DA08D966C 7MUITROSN
143,623,655 *0DC632E3AFF24EB3D8CCF515EFA292FFEEE97183 BARRETTFALTZ
143,623,656 *0DC401D01295D226118B95BE08A7A2E472054E71 BASIL.HIVES
143,623,657 *0DC91A0503574838CAE03EB42445CDA8801B04A1 BASIL.OSEI
143,623,658 *0DCD93F682E70927A5A5291B51A7B09853F5E5B2 7R49ED1E$
143,623,659 *0DCE593CD321FF35A637188CF60146A1738106C9 BATUKBSWING
143,623,660 *0DC49AD7E49B7B29363CC26B715E4E07839BDECE B####B-~0-~oSplat
143,623,661 *0DCCCAE417083199CF27E2AB4748BA39D3F65CA8 BB2LQ
143,623,662 *0DCFB5D44BAAF1BC7F3E2C839241B5193AAC63FC bb?c
143,623,663 *0DC05B218CB84D5ED89EE02FA510445D416EE74A 7 VEREINSSCHAEDIGENDEN
143,623,664 *0DC98C115B0ECCAF5868B60F9F9CA33F26C8D159 7WOLVERINTATTOO
143,623,665 *0DC4DD21D851F77CCB7082E2E72DD30ED23EB5F7 BCA#,
143,623,666 *0DC1523FE9F4D32747A06CF530845B1FD3DE4384 BCKFLWNG5
143,623,667 *0DCDDEF5361EDE18930D4F1C44CD3493E4030DDE BCPTB
143,623,668 *0DC392FCAED8A2CF81AC08565DC96716EEE0399A bcs4n
143,623,669 *0DC54525377F6B0B80C659C1B5AD6BCE0D4B2681 BECCA HIDALGO
143,623,670 *0DC9B86EB63B90D1E734ADC026D16356E03AD3D6 832594 yenibircesaretiCinbendeUmitlekorkuarasIndayIm
143,623,671 *0DCF3C818B5B2B539AB49CA9EF399275FCA40E7D BEINGADAMITEACTUALACTUALITYAEROBIC
143,623,672 *0DCDE293838C1646D8A42DD4F8312CEEA3B9D829 bemodderd7
143,623,673 *0DC35CA0369B669104C5EEB8B2368165894112FA 8) ATARISISSUEDFORTHEVERIFICATIONSYSTEM.
143,623,674 *0DC7AB9D5FC10509C3C301DB8861F7A75C0AAC05 8AURINGOSSAE
143,623,675 *0DCD124F4D3C010D27E7A2FE3A4E555E11B0216B [email protected]
143,623,676 *0DC57DBBB008C5208FDEE38F37843731027BE70D betsy-kleiner
143,623,677 *0DCEE5837092CE4333D67EC9DF9AC8659393ED6E 8f1f83d5af1c729959dd734749df5ec4.19481948
143,623,678 *0DCFD974FE948341272A2C928446EC952B2ED526 B"F+
143,623,679 *0DC3B95E1ACDA8E90C79EDB26D8CC74CD203170B BG01F
143,623,680 *0DC4EE16C77CE73F3B9E3D27D5BB05E213890A0A [email protected]
143,623,681 *0DC6FF3B8E67494D7907E8D7BB6152B29FFB5B58 b%/gt
143,623,682 *0DC5CAB6F5DA6E58E8249FC0000C72ECA35CB52D BGUI"
143,623,683 *0DC38C5528E0A702FD57F6404F57894673E24E16 8myallstate2
143,623,684 *0DC47FEF17C98AF494702F2107CF62ADD4A4B366 bhuutva0
143,623,685 *0DC6B160F91250945381379291875456D19AB6F3 8NHEBHORTS
143,623,686 *0DC6540222F451B82CDB587BB89ED06FE5777876 biien
143,623,687 *0DC5834AD998E1D693AC21762A48A41D6A75A356 BILLIE.ELIEFF
143,623,688 *0DCCF91407C69CE8BAAC174E8CB300630F61B52F BILLY.MCBEAN
143,623,689 *0DCBC5C82EEDCC1FE719E9CD09F15276FAC8DB40 B_J_ARMSTRONG
143,623,690 *0DC9FC90F6B56A69B397E90495678B2B9A93DAD1 b_jfa
143,623,691 *0DC4CAAA9AF664F87AD3499EE30151A285D14CFE 8PRENSATION
143,623,692 *0DC764E83714C788C9C4F6816D12ED9CBA96AADE 8REDIASQUE
143,623,693 *0DCD9D1C05BE1EE1994831EA9FD50AF933324BE0 8SHIBYELSKY
143,623,694 *0DC12023D4775CF0961B408022C21D0F6C4B1415 8SIAREMITNI
143,623,695 *0DC273423FD601C290E38A614BFAF10533AE60AF BKRUSKAL
143,623,696 *0DC5482B51B11AF7361DD14B704C2F66E1E220BB 8TLGRAPHIEZ
143,623,697 *0DC57F0BB00647FD07A7E365F273256E57175506 8UEDISCHE
143,623,698 *0DCA56756B1EEDFD1CDBC43DA8DB61FB5F63FB8C 8UNDURCHLAESSIGSTEM
143,623,699 *0DC864BB6F0788154F4472789292484F1243B37C 8.webhotelli
143,623,700 *0DC7D6EADEF3B919EB7577B0CFE8F79040FB4ACA BLPAP
143,623,701 *0DCF35703643FFFBC5359D1EB366C2AABDB52F95 BLROY
143,623,702 *0DC20FF829CFD7335F3885FB261BA319D341DF69 8zx689a9bo83tj
143,623,703 *0DCB863BF2C05AFD62F1AF02219F94C6BD6A4C53 933e
143,623,704 *0DCA304F4B32F56C7EC122E26EB8BEDA02AFB615 blwb
143,623,705 *0DC688B15A3340AC726D442D782E243DF23F5464 bm6r-
143,623,706 *0DC6ECD05E5150255130B7463FBEE80CBEC74BFC B,MM
143,623,707 *0DC78D2ED1B5428C5CF682BD86C5DB5D38129D47 bm,uc
143,623,708 *0DC8351193211AF439ECAC755B597A3F2AAA3E65 b&n.b
143,623,709 *0DC1A1EF8060A4ACABE3134B6FA335C977498236 97jumalani
143,623,710 *0DC13BCC51E5CCD0DAD25D772AC737E3FB4A5F18 BO3R4
143,623,711 *0DC67E3DBE05B4EAC227DDEFCE4D24525339F8F7 9ASSROBIN
143,623,712 *0DC202EA7DE10242C3A776C8B680DD2B6367E648 BOJOVÝ
143,623,713 *0DCD0B5D2AF2382E2C8E0AD82F6D329C38CB8D39 9DRAAGSTOKS
143,623,714 *0DCE8EA82E4B2511DDB73BBF4AA428AFB072189C 9HEERWAARDEN
143,623,715 *0DC9938309FDB16363957FE3511EE70F611530FC bossati
143,623,716 *0DC673651AA17EBD07D6D0CBCACBE1825017A33B BOT.E
143,623,717 *0DC23E6EF95A5B79B3880856D6FB032813C82C59 bph;1
143,623,718 *0DCED538A6C8EAFB84C615AE3FFDCC2E852920BE 9OVERKOMLIGT
143,623,719 *0DC2A951C8D551E2FD12C48E9B56EE8B28DF8A28 9PONDISCHBSW
143,623,720 *0DC2FC6D1A6B5E21036872D6146366E7CD4281A7 BQE2I
143,623,721 *0DCBB658FBBBCFFDF805E6DE8129E6D62BE8B269 brachtest1
143,623,722 *0DC353053A50840438FD62A63EDCEC60618038F3 bradley-herrick
143,623,723 *0DCEB6385E1C8CD424633D8C59F325A07C2B03AE brainfoell
143,623,724 *0DC80480FEFC47BFAA8FB8AD40DA1B6C300AC3B2 BRANKOPUZIC
143,623,725 *0DC98BAEF1E57182D0FE9F850027A1ED5A501591 9THEKINGDAN
143,623,726 *0DC6DAF2B6A90C3123DE780D5FEA94625B5B1F92 9UNDERLEVERANDRENS
143,623,727 *0DC2F71F4F9F3F3DD242B5ACF91E17A7D7D24725 BRENDON.KULPA
143,623,728 *0DC4AB4521EBF2F0F858A50662CB87B2BB0EC253 BRiq
143,623,729 *0DC35C1B621B663C0381C0CAF5127EB8F2C9304B brittgamby
143,623,730 *0DCB6B1127BABD3D531EB960DD0082E62EB42FBB a2?&u
143,623,731 *0DC5AAF80507FD9C59D9F58AE5D4724A2D51EEE3 BRNSTRPS0
143,623,732 *0DC0160DDC91ED1FF0467C1C8C08C41D6292147C BRO4D$1DE$
143,623,733 *0DCE5D5EEAA495CFFF0B79D97DEA92C8A5214919 BRODERICK.ERBES
143,623,734 *0DC04CD87B1BBBA6C4266A226682DC203B3CFB4E a46n=
143,623,735 *0DC345CED2BF2F94EBD7BB253E16DE5CA40DB224 BRT"Q
143,623,736 *0DC504B3A36DB2F3284F372C7AB72B33121C52CA BRUCERAPA
143,623,737 *0DCD2B0F91DC6C356A881A8529579A7A907CE47D a5q5
143,623,738 *0DCBB000E2F0F056B3221D9BB6D8AD48DE79954B BRVCG
143,623,739 *0DCCB3BD691FFBF1F7610D9A74E8E9B5D7463BE7 br&we
143,623,740 *0DCCCBC2D42D8C6F455B8AAA28679EC57BB19484 BRYAN.SENGUN
143,623,741 *0DCA096C0C8A4D64B70240FDCB81A8BD10AB88FA A!6PA
143,623,742 *0DC24F06B6B2A50E785AEC7B858DC4FDC290BD83 brylee154
143,623,743 *0DC54CFD820FD706833F37560970E469CB707BE0 BS9GS
143,623,744 *0DC96E7D9A0AE1FA2AA2AC19635FA6273D9DA954 B:S_C
143,623,745 *0DC7223FB08E401F93A4823F5C8F6BFA8B86769B BSNの携帯サイトでは、ニックネームをモチーフにした「キダニン、キダニン、キダニン…」と連呼する着ボイスが配信されている。
143,623,746 *0DCA712DA96B9F92F1F3ECB9B0F4A0A9B988128F BSWFIRSTPARTBSW
143,623,747 *0DCD1A6F53ED7675CC5D2F16B7BA121795BA9E6E btg7.
143,623,748 *0DC26AAB6478501721CBEC2437E9075224A80685 BTRLBSW2
143,623,749 *0DCECD06940EAFBE34D2B16600D022F9A8CC19C0 aab>'9
143,623,750 *0DCC38BB00FF7AABD916EB8834C8C0D9D3F75F79 aab|bf
143,623,751 *0DC3C5B6D0122374C19A27AC9470685488602E6F BURUNDIEREN
143,623,752 *0DC81BA491390F1681AB53B047E1666E9188A22F aa:&c
143,623,753 *0DC74C87B1CC61D0723FB2D6E5BC18F38EC37D64 BÜYÜKKÖYDEN
143,623,754 *0DC89DEAB9767868A4F9A50CF1DC2DA0AB8648B2 bv123
143,623,755 *0DC1574FAD16BD6AB3D83BD3F7C599DD20571169 AADDYY
143,623,756 *0DC062465D572A4B922A8ED05AF9F4429630E485 bv"y
143,623,757 *0DCFAA20BD42538B45DA0B009CAEC6F2C226A9F8 BWQT9
143,623,758 *0DC98F3A2DE5A210AF837AAFD1F37B86B5910D1D BXEZ
143,623,759 *0DCEFEC33A8B87A355D30DCDE47CCCD6951E9715 BYRON.HISEY
143,623,760 *0DC7BDBC324F1386F4BFD1F842804F1360D3B32D BYTEBIT2
143,623,761 *0DC632048B2916ECADAEDE5E71044D5EE7B723D9 BZQMV
143,623,762 *0DC7444023B5094820ACD207368076E87413FFC0 C0N5CIENCELE55
143,623,763 *0DC285374B2CA82FE79C56A9DF13A00EFE9B14EC C0N$UMA8LE
143,623,764 *0DCAE13FDBE9E0C4D1061FA16E100DDB1DB39267 abăcioaiei
143,623,765 *0DC4BC633A7B0FBDBADE272153E2C3E5BD0E6185 ABARCARE6
143,623,766 *0DC3507404888DB5938BDE25F97602D72A008EF5 ABCDEFGSPENCER1
143,623,767 *0DC01C69D57CE4E5FFB75B6E846247734B9F66E6 abcuy
143,623,768 *0DCCB14F1FB8964BC5074497A7C8141FB023663D ABE_3
143,623,769 *0DC2D95C6AC211A62D9CCECE6D8D30A9CD959049 C3CJC
143,623,770 *0DCD5B8EB07B5E6F0423E46018D26697209AD612 C3R4T0RHI
143,623,771 *0DCF9A04BB8AB2EE0F699A1E51EB194B4F81EA72 c5e"v
143,623,772 *0DC982B559B0B9DB81BE0EDC3E8D0B4C43BA3419 ABZHLEND
143,623,773 *0DC01C04F3D06F648BDB38FBDC3D53F730D42ED2 ACAAAF
143,623,774 *0DC3C8716E25F73A0A498E41D5D0DBEE0A4A6793 ACCOMPLI
143,623,775 *0DC6BA8A034A4C283FF32334A3840197244244BB acfbp
143,623,776 *0DC4EC8D7CE988B2C1E2096FFA1FDEB8C3AAD416 a;?cg
143,623,777 *0DCC4E0E91F5CCD3FB0955D9FA51AC31D66C7A63 [email protected]
143,623,778 *0DCF7159B59B7A81AE779B07F684D8A5628A9843 Acid.6
143,623,779 *0DCC554A1EE81A9501216EAD07168F5720A8DC53 CALADED
143,623,780 *0DC1B23451DB79AB465267589B88B8D29A19ED46 acjy`
143,623,781 *0DC4D06FADC933CCBBB59163BE13359DBB819873 A#CM
143,623,782 *0DCAAB2AEC36BCF4B19007D6924C843D9F63713D acoiracxe
143,623,783 *0DC6A63FB235EDC788D3DDAAA3375547482F4C8E camsar
143,623,784 *0DC4D28F44BAA7D17E8EB9BADFB4D4CA40846EF6 [email protected]
143,623,785 *0DC73FB6727D552762BB42BC056C6E0FBC7E89BE ad54g
143,623,786 *0DC26A206F0C1BAD54E5A73EB55D4EEE164F64CA CAPTAINJENSEN
143,623,787 *0DC8D510ECF4DF4164988981ADDE8966C548BB00 carcovadoed
143,623,788 *0DC79D9AC7B86180115AD1BAB85754A523B39F2E CARL.MCNEFF
143,623,789 *0DC8E937F583AB599149BDA0F9299B2DCC02E209 ADLU:
143,623,790 *0DCD19F448B8779A0434822C4649400FC0DB7336 ADRIANLEETCH
143,623,791 *0DCCD54A2B795141F30293051BE037862DFF1A33 ADRIAN MATIC
143,623,792 *0DC95BD8CA6B103633B375EB06D6EB2D3E8007EE CARLOSNESLER
143,623,793 *0DCAF809999138747D9A99D9E1CF08E67DCCC19A carlostaibi
143,623,794 *0DCA7B0AC3F781A925A027EAA2D463C18EAB4EAB AERIFERO1
143,623,795 *0DC2BF69588A7456F717AA84FE270A37F800F4C8 Aeuq
143,623,796 *0DCCC0ECE96DC8724CE4EF6F86B5148A7B7EE288 carrollmetallo
143,623,797 *0DC5DAD9E9113D0569AA5AA88EDC02853E549003 CARROLSHERRATT
143,623,798 *0DCDB498864F7A063F954F549461C8D23C5A3C29 a:fgd
143,623,799 *0DCA1463FA55A103745DB58B0D1F45C3B544E103 A&:FH
143,623,800 *0DCE7C29AF3B3C96D10A7C2056D3088DB87A4833 CASAS BAJAS VALENCIA
143,623,801 *0DC40F27D36928BFC2642AF87F69ADF78F893707 CASTILLONERY
143,623,802 *0DC2448A8A338490EC40507F7E5B75E7CC3FFCD2 AFRODITES5
143,623,803 *0DC2B3938A771E630BB2335E8236A6178EABBC77 AFSLETEN?
143,623,804 *0DCAFE55D313718B7B7D7ADA05F7C137064195DD AGc3
143,623,805 *0DC3B2FB2F60E6B6DE9AD90A09E271062F763450 cayojuniobubulcoconsulac
143,623,806 *0DC1C3C27D1BC6AADFB7BA7476B2BD8048E4B8A5 CBEY:
143,623,807 *0DCF987F0AB47A62F0D1D571BF8D3CC58C77B93D agyx
143,623,808 *0DCE0728471BF32A66520D6B41445B3C497808CE cc1al
143,623,809 *0DC5F32282A1A5FDFA4743C8AAE922D38AACB00D ahe3r
143,623,810 *0DCEEB336B8190520B519CD1F9789A8B3562E96F C;CMV
143,623,811 *0DC40647590832CE3926E88C7D41EDD0F6812723 cd/b-
143,623,812 *0DC04A3D4438D3826F465EDF27075F37B4D755EF AIFBO
143,623,813 *0DC6C281F9710AAE7829791F80C244E2B28A969F AIRCOMMODORE
143,623,814 *0DC1C3B28B0661E77D5F97597BD7923A5BD3D096 a/jkl
143,623,815 *0DC38835E448BD90510B38DA97109A8048168504 AJLS
143,623,816 *0DC1060EFD79E1500AA9B57A9EE378B79C3498CD aks4?
143,623,817 *0DC1261A472B680E2C6B8AAB459382E866BD2BF1 ALBERTO.ZAZULA
143,623,818 *0DCC1D2823B8A0E2EC6F2E774915204B962DA6E6 ALDENVONDRAN
143,623,819 *0DCB31A2B4D8D2E6FF57FE498DC9E7127015F284 ALDERSBO5
143,623,820 *0DC63DFF966A0801AF1D0DEA4FDC51AC0C38896B CDEFW
143,623,821 *0DC16CCF9600BE8D430D1A4ECBF25D821BF1B622 A;LHO
143,623,822 *0DC78EE0E164700F795459E39EB098C5FD550474 alk6$
143,623,823 *0DCCE032F45B201FBC001819FA5C695F72946578 CECILHINCKS
143,623,824 *0DCD7A99EACEC22102E048CF830F56512F836670 cervelated
143,623,825 *0DCD594C9AAF117E8199A3234AE6FFB84B7A0533 ALOSP
143,623,826 *0DCE72D29D8BFAA58AE1E2C411D1824270268A47 A,L=T
143,623,827 *0DCB5001E0844EF0A2A5EB810A0C9FD8372B04AC ALTON.METOTT
143,623,828 *0DCA5C332454BBD4B0362EDFFE798DB5BDDC8A1E ALVERIO3
143,623,829 *0DC563B7BEA57B93ECA4B3BA3CDF44464311B668 c%fqp
143,623,830 *0DC266B6382A27AFCE2AC865711CE1D34DEE4D65 CFVOLVO23
143,623,831 *0DC2CD76A79865FA7AB81DB666733569AD055E99 AM5Q&
143,623,832 *0DC1BC8BA579F7DBC38D3E7395A1DD1CDD393F0A [email protected]
143,623,833 *0DCB735ABEFD384CC122CDB6F98D3CF9B4E7E65F amigotitfrommymamadaftpunkvideo
143,623,834 *0DC10EE7B72D6B529FAE735E0DE50D1569381C03 AMIZIALING
143,623,835 *0DCE09D97D34973F5BEC3D7D382B64988FCE1E75 cgiw
143,623,836 *0DC54DB94A9ECF43D322A5CCF7ED014A1E871606 AMNSIA1234
143,623,837 *0DCE0E991EA9FD69EBA974E0122E0480EEA1F0A9 CGT09
143,623,838 *0DCA2BFCD3ADE687971DB8A023E0BD5103470032 Amphithyrons
143,623,839 *0DC4052DE2AF5606F66E54EBAC4DD7FFA6A95EF4 AMY590
143,623,840 *0DCF7E3C3713FE5E8F778F2A5055E4135D6C3824 AMY"A
143,623,841 *0DC68FA99CE90984D91B09A340DF1247E5023807 CHAMBERS OF SHAOLIN (TITLE)
143,623,842 *0DC0221CCC7A0E2BAF28BCFF7520C723FA686027 CHANCE.COMBOY
143,623,843 *0DC9AC5A444333793CDA7A7AD1D27015FE0FB153 CHANCE.HOPSKINS
143,623,844 *0DC929C195E31E9B886B6F442810E3BEF3E53718 Chan+es
143,623,845 *0DC877992C76D63EFB97F63A7EC4405559BEDAA2 [email protected]
143,623,846 *0DCA2BBBEC3596B84B712D161E90A4AC0F1F9F1B charlesarmento
143,623,847 *0DC7755572E243FA4CCCCAFF4CA0C1E09C358E6D CHARLES.CICERCHIA
143,623,848 *0DC494A5B4EC27091A0256C3D208A842C1C4FE9B And.what.thou.hast,.forget'st..Thou.art.not.certain;
143,623,849 *0DCE17CFEAC472AA2E408A336362F3FADCA0703B CHARLEYMEARS
143,623,850 *0DCE4AAF9AE7EE00C5BF33A8302AD7140EC7D9F0 CHASCHAMBERS
143,623,851 *0DC94FCF2C486DE6DA57DA35AC1B5F4C457ABE55 CHEAP-UNIVERSAL-STUDIOS-ORLANDO-TICKETS
143,623,852 *0DC30B9F24474765859E60F686AC103673C5A994 angiemarie6
143,623,853 *0DC70EDB8D113F6A88018683A8FF5F467D5D6CB9 [email protected]
143,623,854 *0DC62A4C434784FC1652358B1C0E4D79FD2CF924 an-h=
143,623,855 *0DC38BF76307C804F3B1D9E5D2CE0A2C6B0C04CD CHf4
143,623,856 *0DC2F9916835121F928F071A2D6AA97C6381BB30 CHICORBIN
143,623,857 *0DCD05CE28F5689F1FEA7CDE8105CE290C2D4DAF ChiềngPằn
143,623,858 *0DC24B4377B5A72A76380ECFC7EDA6F85CC21E00 [email protected]
143,623,859 *0DC6137F983BCFA8EB47B6583A3E80DF1A61E162 CHRISBABOUJIANBJJ
143,623,860 *0DC15EBB2D2BF7DAE2B81719A0FCCCE2F8402A4E ao..)
143,623,861 *0DC321F92A69575BC3C1AC2DCABB042E5CA528C3 ao3f0
143,623,862 *0DC08E5E6DE98BF39F77E7C0110E80881D2BCAA8 AO7L
143,623,863 *0DC02FC8D8E47F0C4F690E8CCA137AAE9D212C24 A=OL
143,623,864 *0DCC7BB3BE46FD790D7E2096129845142E54C779 àolínpǐkègongyuán
143,623,865 *0DC5866F063B3351966CE089A29A1852C4D275C2 aoq;r
143,623,866 *0DC7F50829C5D6E3823F03E28DCE1B2640A595AD a=o(z
143,623,867 *0DC9AB8F81F12DB28C05E835741E2A618FBD9DF8 CHRISTIAN.SHELTROWN
143,623,868 *0DC228E4F9CBBA724B194448E3554625461E9580 CHRIS VENEY
143,623,869 *0DC5788D04F5641D31D268BCC89389E44C1636B0 chubby12345
143,623,870 *0DCEDA22D0AC2878487E479C73DC83863128E2AC aq4_8
143,623,871 *0DCF7716C82AC8D109D9CDC9E1562CF6D9384568 CID%.
143,623,872 *0DC0E97EE86913D299E45E0989ED2AD64E69E1AC CINDYCASTILLIO
143,623,873 *0DCF760A358EFEA25C24D74D182F765CA2043ACC CINPE
143,623,874 *0DC0930C4994114BD6B08D5711AAD1942F9E97C5 a;!qy
143,623,875 *0DC822995C30118456ACB0640399D06E3EE041AF ARANDD
143,623,876 *0DC2CB3684A5AE07AAFE360C9C4F758DE0D6A085 ARAYIŞLARIDIR
143,623,877 *0DCD4453230F8CEA658758741500F1EAD59E8751 ARC:W
143,623,878 *0DCEE08B9EA771E9D75B01C181361A9F43D8D7DA [email protected]
143,623,879 *0DCB3BA500DCC4D7769DCF49B8FE9C8D2E2F9C47 CK7YQ
143,623,880 *0DC6458E052494E005EC2F6516A2380456D6221E CKEJM
143,623,881 *0DC2499FFE36E015CEFBD2A5F06CAF1E571CB344 ARLIECUZZORT
143,623,882 *0DC68A39EB5CA7C17006173846DCB03D3F99E162 CLAN-MACCALLUM-MALCOLM.3ACRES.ORG
143,623,883 *0DC8B9F7ADD9E0AB3398EA909210763BA748B699 CLAYTOSTANOSKI
143,623,884 *0DC2FF9E381F7CFF9E62D35D7F7E7F334ED85A6C CLEO.PITSTICK
143,623,885 *0DC633AB254BB031711E2E3B109C1359E83A3D1B CLIFF.KEY
143,623,886 *0DCC48098319E2C1999C82C55C985E9D0C4042BD clifftyminski
143,623,887 *0DC1E03346D215D67D5C7C91731EA2C16A12B304 cm%pb
143,623,888 *0DC7D55E35ECBAC912BC52D97E79DC4291EA414F ASQFI
143,623,889 *0DC75D8CDD7FDFB7A5EC580D53D7EED721FF2E3A cna/r
143,623,890 *0DC02113C265FAEA94FC3D65BB4D7085C7DF9CB2 c+nxp
143,623,891 *0DC2760FDF88F22948B11BB454F8FD983AC65EA7 cocainizations
143,623,892 *0DCA7D0506A827A850D52E5F52F3A96A4565514D atmp)
143,623,893 *0DC701ACCC8C32003CB6524D6401641798168DC2 [email protected]
143,623,894 *0DC20B8D3B28F51968BC69245E7A1F12357EA351 COLLEFŔNS
143,623,895 *0DCE00C64FFE88E0D12664A788239104B7DB4BE5 aundp
143,623,896 *0DC0E9BA94851D5735B57E66D679CA853107C8B6 aureliomierzwiak
143,623,897 *0DCD805DAE7CA82FA32362AC03D72BE7F90CDEE4 concelebr4tn9
143,623,898 *0DC505F7B564DF9E5879E48A5FD0EE5C5F18CF41 concorderent0
143,623,899 *0DCDC25D073495D0252DD29861E43FEEFC83716C CONGOSHAS
143,623,900 *0DC114BC1ED27FE5896F0CB9C25FD4E025758FF2 controterrorismo
143,623,901 *0DCA9FC8DA03DC442825A4CCE00A8C67A44E900C [email protected]
143,623,902 *0DCFDFEA99F5007F68FFA12A400EDA5B3A44AAD4 COTERES
143,623,903 *0DC1306DC7DCBDA164D325AEC714D56DCD7A689E axagw
143,623,904 *0DCDF1A4FDB7C23F0F5736576C5DB2B78570AA83 ax.-c
143,623,905 *0DCBCE0DEDED0244D70104926DF9EC7F66DB175C [email protected]
143,623,906 *0DC170F0B54494E7EC6F996EBBFB9377A46FF6CD C:\Program-Files\7-Zip\7zip_pad.xml
143,623,907 *0DC4C9E2A5DF82E2856354094280B4241566059A azi%
143,623,908 *0DC1ABE7C6E5A64E6E9A9F9432E6782A7BD0657E azwh)
143,623,909 *0DC0F564B3ACB0048A4ECD63C897C356DB9741AB B0)C
143,623,910 *0DC65C0789432FEA16C8423BDAF49500FCF9DEE4 B-)~0~O(~_^)
143,623,911 *0DCDB9F90D4B3439248ED0502A21E4305D48EE3C b-_(1
143,623,912 *0DCE7FD60E097C6E9488D1CB02C5A10812C19BBC B2WW
143,623,913 *0DC8A1C3A7EC507911C6B3DF6C20CDEA80CB8D1A CQED_
143,623,914 *0DCEE7C5BB82F82CE5B82A5D2C198408047079EF b3-ug
143,623,915 *0DC50F121F05C57FA6E5D3B387C6F8C54A2016F7 Cqn"
143,623,916 *0DC1E93F54B8391BA6DECD27810A55D1F417079E b4bqo
143,623,917 *0DC768E4DC57219C5D9A5DF65F4A3B0201EC1911 B7W:Q
143,623,918 *0DC83C732AA554ADFB2C97A658625F2886039DA6 CRISTOPHERGUTHRIE
143,623,919 *0DC7B2E876637B087AEFB11C1837F206B1CEFD24 B8SW8
143,623,920 *0DC1159ECB5E76CCB7806763995B21121D617C2B b9a5w
143,623,921 *0DCCFFE4765495BD7E5C74FAE8FC0D49C5889CA7 crqtl
143,623,922 *0DC2437043CCED8119EADC763A360E1CBE79505D CRVAC
143,623,923 *0DCF178D2A494C2E4734582E96A4DDD792438D7B BALAJI RAMADAS
143,623,924 *0DCD8509029F7508E38AA87A39A13F6E59B65F19 BALCONY RAILING
143,623,925 *0DCD57A227F680BE42E292913A692AED585CB4E6 CTADM
143,623,926 *0DC1BD2F741DD424217007D5079E41AA7CEF5F94 CULTIVEE
143,623,927 *0DC4976BCB71039FF5933318E3EA5DD7851B4083 BARATHRON5
143,623,928 *0DC5B843DBF62614A8483A9B6213C7F1AF548C4F CURTISMACMILLAN
143,623,929 *0DCF9D6E9515EBB73B627C2E1416B636E36A72ED CVILLEPODCAST.COM
143,623,930 *0DCA2C33930A492D62C5A39385EAB12A97AD73A7 »battle
143,623,931 *0DC21CDCB902E87BADE5754ADCF1A4408A66394C cvrnkaji9
143,623,932 *0DC3906FAE851C0E639E46A82F1B4C00DF66CBDB cw_af
143,623,933 *0DC75ECA1167C3B73348D945BB2AC12C4DF85FC4 C#W+I
143,623,934 *0DC1B3393649196AB7B16767011E81F069F8D13A CW-,U
143,623,935 *0DC1C79F6DC85757B5D2960DD874DA67AD65B535 cyncrylt2
143,623,936 *0DCB6C5DF9385E8EE43DE72578AA19C6FD7C95FE [email protected]
143,623,937 *0DCBD767204585F30A36283747283C4B0068E709 CZGG
143,623,938 *0DCC95E31A7F6C67ED792D02544161C10F90595F D0=+
143,623,939 *0DC9C9C2EC954B2FD6FBC05A563E4A9980B61687 d0al7
143,623,940 *0DCE00460F50F9EB15C921DCB635EC52144234E4 bc7pm
143,623,941 *0DCB6AF5C949F3BB38A7948A0716FAC96637F878 BCF3
143,623,942 *0DC4E3BD6114594A2931BE4999DAEF8E29E68EE3 D12.776.758.374.500
143,623,943 *0DCE0F6BF5E3D5B858DB3AF96236E5FFDB064E6F BCJ49
143,623,944 *0DC60F21FC2CC3032965B82221BEA88291A0F257 bc?-l
143,623,945 *0DCD645CA7869C52538D563CBD62C52CB5B75811 d1tl
143,623,946 *0DCEBCD75578AE7401713CAD6E76BC273AB7C09D d-==2
143,623,947 *0DC02B11AFC35F1CF0768F42C3E6F12902BB107A bcy2(
143,623,948 *0DC0F8373F79BCF61626BF205255DAFAE51B7195 B,D"
143,623,949 *0DCB40F173926FDCD127EE98DD177BDFC5F2DE31 BD$-C
143,623,950 *0DCC26A35760A603AEBFEC5003D2A5BE1386FE00 bdja1
143,623,951 *0DCA02A083A461506BB81AF252007B10771205C6 BDLZN
143,623,952 *0DC2569626F5CA1E6007616D64FB72938D235C6A B###D~O-~O;)
143,623,953 *0DC376EBE801CB0DBB18A1BBBFE58900C1F93CAA d3hf7
143,623,954 *0DC8F5D9E2EF48CC97CA4003C32FFD28B5F9BBBC bdyia
143,623,955 *0DC6068AEA48876A8F8F4D29BAAB89F038971938 D4LB:
143,623,956 *0DCD81EA9E4F3415AF0D73725351E83B207CE111 beauwatts
143,623,957 *0DC9AFD84D14FAB30C4EDB0D1C60D5469BFE50D9 BEAU.WILHELMY
143,623,958 *0DC1E34D7B391A184EB05607D2BAEA552E50576E (^_~).~.`.D###8
143,623,959 *0DC9ABF7CAA7EA0336E739C6BF9A67FF19502B10 [email protected]
143,623,960 *0DC53B2223DF35C85BFA6D0019A398F12959EAF4 BENEDICTPETTRY
143,623,961 *0DCE676DD8ACA0D387A3642B13B488C50A07B0E1 benjaminrichbourg
143,623,962 *0DCE0F41AD51957141FC16C7893BD72275E28E75 DAIMENTS
143,623,963 *0DC38F095737BD7039C64A794E39A845D19C6836 [email protected]
143,623,964 *0DC8DDEF5C19AC206C7934C8E433104AB1E95A88 BERRYURMSTON
143,623,965 *0DC72EF2A59C2CEB26C5546BACE030712A888BFD berzone.remix]
143,623,966 *0DC1B13453936E95AAB21A20E0297A1619D36D50 bet0ne5
143,623,967 *0DC421666C4F8FB9E6CF7D36D20DCA3F5F966C17 DANVAYSBERG
143,623,968 *0DCC460278589F4AB868D6766BEF5F0BD9A57FBE bfactory
143,623,969 *0DCDFBB1B3DC2BFB0E7AD51D2BA8A12C24A54665 bfibarbara
143,623,970 *0DCDC1AC42260DF628AC8882103D0CF7DDE33DA3 BFRV=
143,623,971 *0DC85DB4686EE1F94174F86EBE0C33C10F243BB4 [email protected]
143,623,972 *0DC0EEC891A46C053D3CD58BC13CBB165F8DC100 darrickshikles
143,623,973 *0DC607571B6920C6B688B0CF49A7178AC2CBA5B5 darwinperkiss
143,623,974 *0DC5B9AAA6359124EE30BB6AFA5BC43120FCEBEF [email protected]
143,623,975 *0DC2F3573AE56BC0C4C30DA8537EE79723A4BC80 BGX(J
143,623,976 *0DCD6D5A29C9F322299677F836DE8DB33E383B55 dattw
143,623,977 *0DCA124373EEEC882E80C4251EDADAEDEEA02F7F dawideming
143,623,978 *0DC0A66056BEC21721ED77606C4D44622AD74AA8 B,hO
143,623,979 *0DC808B7095D3E060A996A015BD3F85B511C0B3D b&hp,
143,623,980 *0DC8A63A894ABBF4695CD723C4DD9A0B82E50A10 bhr"8
143,623,981 *0DC6F8D3B93FDE4A4B2B78C082157C59F771F21A DBAU+
143,623,982 *0DC4ED128757CAE470AC8B3AD9B0960C18426AEC BILLIESAMPLES
143,623,983 *0DC1E913D3DE655B77A53513C1F7C6DA5F2B2289 dbos;
143,623,984 *0DC93D77AA433F72EF4C0908F02513B4E1EFEE7F d:bs)
143,623,985 *0DC3F3B91C8CFBDB200F0EF89047CBE865977845 DCLF
143,623,986 *0DC6DD410088978F965D41147884992F992CFC1B BIOHM
143,623,987 *0DC5699174EEFB77A443D805516B3E94B7F402D6 DCMFQXMGTS1234
143,623,988 *0DC1A8EA02974DA3E39377AD1FB07EEE25973971 DC#/N
143,623,989 *0DCCD3A1AA46D6C879F506FB30AE13B1BBC03CB4 D#C!S
143,623,990 *0DC8E12F01B773B5132045C049E03CC2B3FECD33 bishop
143,623,991 *0DCD4F7EBA9D9ED48F0208300AC16CA7A6872B3C [email protected]
143,623,992 *0DC1C1CDA89175503A0AAAC38C90CE6C50D5BB05 bkcvu
143,623,993 *0DC9FECB4EABDEED573C869AA90FFF0C510F49AB DDX;L
143,623,994 *0DCFB9C1959BA09016A245642BD0BE1D21C40F88 DEANDRE.KERKER
143,623,995 *0DC295487FEE4BE574178C591FA3670519D1B00D b=kn!
143,623,996 *0DC768CDB7FA545E046E85514367D43E978DB201 debrouillerait6
143,623,997 *0DCC29D2CB7C69F747F02E7F303B556151B11AD1 decaisserions
143,623,998 *0DC999DD6102CAC5B64579EBF789209EC007776A DECOMPRE$$ED
143,623,999 *0DCC126529D4E19D7BB00E7C773F9F0450EBB284 BLAINE.VAID
143,624,000 *0DC3D6E5326FADEAA085DC24E463D4E89AED5591 BLAIR.DUBIN
143,624,001 *0DCF982AB7B02B59AACCD3CADC8F0F324F9E7E77 DEE.BAUGHMAN
143,624,002 *0DC8C2BED568A584A970B493A57658927F207D8B B%LGC
143,624,003 *0DCC7FDE2E24C5DB2D642940B8FF68B1B249117E DEKADANSU6
143,624,004 *0DCAC68E2722685014B52376FFF49E152FB93A33 delgerbatz
143,624,005 *0DCFDEEF0D2F1D9B6E09DFF11AAA63C69F3FD73B demontons!
143,624,006 *0DC42B8F65DE0EABC7437CFEC26E056C08E6B73E b#&?n
143,624,007 *0DCBD147F90E046A44753CBBEB2A6C02E699AA4E B=N-
143,624,008 *0DC97766F7033804E9F4136490E10455B0FCC612 bn=ab
143,624,009 *0DCFBC76FEB27596E5C262C6A1A8706BFAC1FE83 [email protected]
143,624,010 *0DC42B122A92ED3DDC40252368C5A63DC61E4AA3 [email protected]
143,624,011 *0DCFFCCC28C21A49CA16DF44620E3B89B46D48C3 b(o11
143,624,012 *0DC45F4D687C211C51856365021F62ABBFD877C1 DERRICK.FICHT
143,624,013 *0DC9E245006DDAC7A04BDBC25B71297D22884A5C DESCRIPTIONDELANDSCH
143,624,014 *0DC88C8D41EC6AD35AADFA091DADEE13083E6537 bobbywidhalm
143,624,015 *0DCB9DA21CA26DBFAD9E8B973CB7E2644C8206D8 body of light
143,624,016 *0DC6DB147550F72F4C1536EA7871B7B8ECE5D203 boeotarch4
143,624,017 *0DCAFA17F7D9985F9BF16C6E2BCFEC89A82CAD65 DETROITWATERFRONT1901
143,624,018 *0DC9222A9ECD04276EC06120B109F2E1BB6D8F42 BO.MIRON
143,624,019 *0DCE0819835589A0167F75AE6D216A558E454813 DEVON.MAYLONE
143,624,020 *0DCB8746DE4F4859187D59ED2F08A695B70E4591 [email protected]
143,624,021 *0DCA2A30F56F6C8AD80D90E98568EDFF212BF946 DEWAYNEGAUKEL
143,624,022 *0DC6B87B1E60FC5F9FA6D6EF2B9F9D8027905CCA deya.deen
143,624,023 *0DC75B19855B3A9F750D46E7D4E2FED25C99F207 D::)F
143,624,024 *0DCCD36A14599B4A8D124AE18B05FE14DE69D066 D;G1J
143,624,025 *0DC09E64D7377C4522773C9E73B6F24E337F686D [email protected]
143,624,026 *0DCC9B719D0A2FBFC7D8E8F62AC082B36B7B0A33 DGLSVLLED
143,624,027 *0DC1C65CAD50950C0CDD981FC724F69801C6E785 dgzc
143,624,028 *0DCE247ACF036AC34428C1CCB3B6011F8B4D2A34 dhh)
143,624,029 *0DCDE46075559F3A43515F3178907D64595989DB [email protected]
143,624,030 *0DCB2B85CCFBB9B5A32C28CDE3176BFC7F130BC7 dhmaatah
143,624,031 *0DC6564A06F62D2A718971BCC4A3322A55FC77B5 boš
143,624,032 *0DCCF6B14F6E26509A378035D298E02222077A4D bov$2
143,624,033 *0DCE695E5C15D6331C4F8475CE7D1D829A69D185 b----p-*-*-*(0-0)
143,624,034 *0DC51A026F20D41DE0F0DA70C68EFE917523174C B-p ~0 ~o splat
143,624,035 *0DCBA7FAF51CA361D35EFA999E8EC2329E8E351F B%P82
143,624,036 *0DC02AB99B54F1314546AAFF5C60C98BEE6CE438 dinh.huynh
143,624,037 *0DC0E9523BFF4E88EB2AEAD6ADD302BE7B578754 bpy3v
143,624,038 *0DC7BEBF5CD44BD056124EDBDC081101229E31FF BRACKETTE2
143,624,039 *0DC50F0D3A3E157F40F40CCF22374781C45D6E46 BRADFORD.STANIS
143,624,040 *0DC2F880F56EEE9BC30021C08E80F90320DBBE66 bradyurive
143,624,041 *0DC8655A083FA937EF54FE96F370256B2DA95BCD BRAEIST
143,624,042 *0DCACE57ED142F4CC03E0E1AABE6BE758752391F BRANDEN.MAYWALT
143,624,043 *0DCBA219B644DF5705BA4DEAA9EEA548C0941370 [email protected]
143,624,044 *0DC3B55761BE41E7449F52F7503FBC0441D5343C BRANT.BISH
143,624,045 *0DC3B039CA653EBCE929691C65A5F7D891CDDFA3 dl-d
143,624,046 *0DC8EE86537921A497BEB7B7C01963AAAE0E07FB [email protected]
143,624,047 *0DCABBFBEAE55225193BEF812DC748B3F7B7825C D=MKU
143,624,048 *0DC5D0CDD96EDF5AA1DD37356F086DEE118C918C BRITTPRESUME
143,624,049 *0DC480DC2A2FEBC72498AF854C57AFF1A7869DC1 [email protected]
143,624,050 *0DCA28C33152A959812BF5566CA9826EB6404E1E BRNFG
143,624,051 *0DC2AF41C05F45F33CC2B676A04D12AADF0BC33B DOA4F
143,624,052 *0DCE82A184CAFA158470D241F1EC926EE02E17DC dobberde5
143,624,053 *0DC0A0CEFB8F419073B0F6F4ECCA1C99B9AEDB1D BROGLIANO
143,624,054 *0DC53E35E67AB15B4E73AA093CE3F0CB4377FDA5 DOD(S
143,624,055 *0DC5FCA93209DC801768C0E55505ECEE5DD3AB85 brooksdietsch
143,624,056 *0DCCC563071C5370C3EAD3FDA389E1D5D0994432 BRUCE FOSTER
143,624,057 *0DC31480C78A54B4FB3B2540388C080B5C6FDEB3 dolmaner7
143,624,058 *0DC08F0D08EC45B352ECD58D9874A50E07086877 domingokillam
143,624,059 *0DCEABF63FDCC762633A502BCA978919E3E8176B BRUWK
143,624,060 *0DC4B000486D67ABCDA288B78FABC11580BBBA36 bryan.rawlins
143,624,061 *0DC22A2286D5F270EC297A6D9CACBCAFEADA1749 doms_
143,624,062 *0DCB153302BD6AC9A3D8447D4472C132539DB09C donaldwerning
143,624,063 *0DCC9B1BE9D6777B9271DF420BB12EA5EF4C351D b;s8
143,624,064 *0DCA878E70FDA45E24ABB0BFCE58C32F4AA61CB0 bsoqi
143,624,065 *0DC1164D6192091E967C9BF395BB85F665551AF1 DONNIE.LINDIG
143,624,066 *0DC0B2A87EF5ABD5F01DE76C724E4DD909FE0983 DONOVAN.STEELY
143,624,067 *0DC4E0A42F3695A6668F4511A20BB7E63A2904FD DOP/L
143,624,068 *0DCEA8FFB0A9ACB96E52ED5745EB5790D3CB56C3 DOREENCLEVELAND
143,624,069 *0DC0EE9CF3C704798A0348D8E8DB41337F07AB89 DOUGLASSNATH
143,624,070 *0DCABEB735BE711EA1AF109E82409C7EC209494B dozvp
143,624,071 *0DC36BDCB8C671F8C86228CCAC199212994DEC02 dpav?
143,624,072 *0DC1893B48BEE6EBDCCF6D1854B3FE95C7DCDDE2 BURTONMUNGIN
143,624,073 *0DCBD121EA78B1CE4CA97E7EC3084A06AA035A67 DQ4P
143,624,074 *0DCA949075990193E6C8AECFE5A89E1C368C0F62 burvm
143,624,075 *0DC0731C4EB4D806416EC8933A7C54AFB24D9A87 dqki
143,624,076 *0DC69C61DED819EB6612DBF3DD782425F1EF09E6 DR0D;
143,624,077 *0DC5AB0B16D851F004C555D0188D803B52D46D38 DR9R4
143,624,078 *0DC23EF5B62061913B6B9F47A20E9C246B13B859 DRAGAEVIKE
143,624,079 *0DCF986668E29224F02E3EB42ED2969455029E06 driblets
143,624,080 *0DC43D2221F783679E953EC60705FB2BCB33BAB4 B(?VR
143,624,081 *0DC824CE7AAE115C841A9E29D5A30EC045FB6AAC bw9nn
143,624,082 *0DC5E0CF886555946B6CBF39B0B8C259199FA0FF bwg&k
143,624,083 *0DCF89002C0A88CF8A98344969B443E42628C8D3 bw_(l
143,624,084 *0DC4175D3341D67D46C0A83AAA7EB6714FF5C130 ds*<
143,624,085 *0DC7F082867B5817214F9D76A5E78BCC2E7C8BD0 BXXVS
143,624,086 *0DC1ADBD763A7226CACDF59F9697C703DE36A999 DSEPTIKA
143,624,087 *0DC80BDE593531DAFCBBD5C9271E12186858BD09 C><
143,624,088 *0DC85D0866D29E400E1C67665EB2894445C1733A DTWT+
143,624,089 *0DCCA9A95C15B97B24243C98F54979DCE555F2B8 c0unty-4t
143,624,090 *0DC3EF209C43E591073C9499AF33025DB481478A C19UV
143,624,091 *0DCA9AFF9C5A9D97940E07963352EC4552499FF8 c25j1
143,624,092 *0DC9796EA3675B56C6F34F7ED77AE7B9F490456D duncanlecocq
143,624,093 *0DC3C32DC1E55B7EF795EE2BF3C41E3066727A01 C2-UC
143,624,094 *0DCB6AFF2F337980F83B02FCD6B728282E0BF082 C3B6V
143,624,095 *0DC11E5BF043494637EAD6087A3CC9AC29191A87 c4jgq
143,624,096 *0DCAA7CA45D0528DDE30226A7C8CD9F4899C64E8 c5nrv
143,624,097 *0DCACD759D9EA704625C14DDC7EEF10103948BD1 DUSTY.CARBARY
143,624,098 *0DC554CF49E1FAED1A2DAF822E9093A5E6C9AB40 c:;6
143,624,099 *0DC788C64D47B7C87F76203D3559FDBF76685D49 D-&VE
143,624,100 *0DCF9AC48A3FE537A7A12AB746F2D15581A30072 C8JFR
143,624,101 *0DC03F7B6497C7798DB59EBB7225BA6915D7DE3E DWAINPEFFERMAN
143,624,102 *0DC29BB3D95344E579C1A76357A7D4A69BDDF79D dwat=
143,624,103 *0DC5F208A4DFAF64482B3DE848A92A37045B0D98 DWB%
143,624,104 *0DCC4434BAFD599A9296ABA957CC468B85BFA0B2 CACHORROTEAMO
143,624,105 *0DC720A0DA4BE4ED3C21BEC992549B20AE519594 dztds
143,624,106 *0DCB81A02952D25892A8C39CBCB921C16231C87D DZ/+V
143,624,107 *0DC4092E2DA1466774BACDA201B8005937912266 E>#7
143,624,108 *0DCB52D0E7EF92F2F1D0EA54A90F4FFF1B9EEC7D EAGLEHED
143,624,109 *0DCEA497AA5312F12B0AE47CDD0D87A774F7EEB3 EA+HG
143,624,110 *0DC3F67ED5DA5AEA3EBC48D605F5F6EBE08B4C40 EARNEST.RICHARDSON
143,624,111 *0DC2C1B7DE7DCDFCBED9A645C6D843F51A7A9882 ebs/_
143,624,112 *0DCFD1516AB993F99445EA92B4B144BFB5956D5A capin2win
143,624,113 *0DC8973C56E78CF6EBC18C426EDFFB6E98F1FCD5 CAP&J
143,624,114 *0DCA11F0ED18340DDBEF2E4B0E161D42BE849551 carla-balian
143,624,115 *0DCC3420C56FBE8A1BE6AF2E046A6BB4190DA0BC EDDYTINSTMAN
143,624,116 *0DC8A54717B859F2277AF18CC7F7DB81133BAFF8 carrolisacson
143,624,117 *0DC9C4CA07FEEF144F6A9C6745D20AD902A3EA09 carterhahn
143,624,118 *0DCD5860EA56B4EF4E4025FF6933D82BFBDDD359 CARY.DOWDY
143,624,119 *0DCB4EED07FD2DD25610DF44610BA75D65521814 EEHSNIRPPED
143,624,120 *0DC3140670D78139E8302937FF50355A4413C210 CASON135
143,624,121 *0DC09E58AF627B34A2AA5993445C04DFD1BD439F EFRAINDETZEL
143,624,122 *0DC9BE1376A106B246C6E6CC112898DE74574173 EH7HV
143,624,123 *0DC74D2BA3F8ACFF623F190D792ED8421B52FF91 C,\B
143,624,124 *0DC364224C181C2508D26D42946378BC9BCC743B EINARBEITUNG!
143,624,125 *0DC5B91D96C44ADDEBD89000F095E3220502901B CB;DJ
143,624,126 *0DC162809D2A5702D148B7929DE7B6835E3B6012 CBINNLLG4
143,624,127 *0DCA7AFE4859D439DEA049ADAF00D75EA2F878A6 eir2c
143,624,128 *0DC76328BF3166BF69CA796AA76772D21FEC9D66 EISENCHLORIDPARTIKELN
143,624,129 *0DC3505E209F71DD3E0F41B619BC93FC64281E51 c)c-4
143,624,130 *0DCEB08E0316670FE54F71F60CA8F07FCE28AD23 cc5c,
143,624,131 *0DCA26ECC200F9583EC668846702582BFE763493 EKTA.SHEORAN
143,624,132 *0DC83B855A2F57D4AB606C4BE498C80816A06950 CCUAMBSW
143,624,133 *0DC306C159E3197721389D05C5648CE8BFCDB3DE CDNQ
143,624,134 *0DC4C94521E2E3FE7A3CBD986CBED6F4DE1D75D6 ELIAS.MAYARD
143,624,135 *0DC0F04D79C26427D17F91C498B0FC7CA14D1495 elifbalari
143,624,136 *0DCDE3895AEE01B0E4B917ADC536E16B7304FD33 elke%
143,624,137 *0DCDA3248759A89ED70B68C965C4234661F770DF ellsworthaldapa
143,624,138 *0DC2D711E492C0903A9117CAB24C3CDF71FBA895 ellsworthlassetter
143,624,139 *0DCBB35A744AA9DC3F87C7E4D9D6949E1A86327C elmodechavez
143,624,140 *0DCC8A0F5A137D15EEA64150B0D578D1DEAA5344 cedricstramiello
143,624,141 *0DC33226A03D4BEB22A8B2375E7717BE425F540A EL.PRENAUTA
143,624,142 *0DC28E5E4C2961CB1E18E02A183C8CF1F891CDA5 elvinhides
143,624,143 *0DC3FEE7002442D07A6D2628F841D08AD5BEE3D6 CETAG
143,624,144 *0DCC7AD51366904329561BBCDD56201C53997373 emboweres
143,624,145 *0DC03F6FBFE29A4D51382E418578F5806F2B64DD emerydenney
143,624,146 *0DCD1C977F1E8BD5BF77B12A0C3501E1643D3DA4 EMILIOFOLKER
143,624,147 *0DC2EEBE4B8FB0F88D08FA89C1C9DD75E559922C EMMITTLARES
143,624,148 *0DCBB29B8F90CD2743D0A7ADE3B1CBE241A72727 CF"EK
143,624,149 *0DC49D640ED4AC4F292782A7D1E34929D4FFC64F cfg(y
143,624,150 *0DC4F731474019B5EB479135B7E9376C18EDB6C9 CG9BN
143,624,151 *0DC5CFCDAF71AADB6B7F9477AD99CF4F76A212F3 cg:d-
143,624,152 *0DCBD628BD36A3159CC3D4D91BD8F7C7D0A19A8A EN8110312684X3
143,624,153 *0DC65C6256D35304BE4597631D5A05CEE3C1D582 CGIFC
143,624,154 *0DC1A79199F8F7498C8A14EE63617A2DEEF92F0E cgiw
143,624,155 *0DC54DB94A9ECF43D322A5CCF7ED014A1E871606 ENDOPTERYGOTA8
143,624,156 *0DC6C56F01BB94F0E252964551B7CB1527671337 ENGLESQUEVILLELAPERC
143,624,157 *0DCB6C5564B8ED3B29E87DB2012DCEB1BCFBC51D ENSUIVAIENT
143,624,158 *0DC7FC0ECDB33D3FE088D657AB191B8985E42290 entire-template
143,624,159 *0DCEB5CE51718DE534A4D1F8ACACB4F85DE1F50C CHAMBIERS“
143,624,160 *0DC4D39DE6294BAD74581A1D4A070334981835D0 [email protected]
143,624,161 *0DC416CC3A6FEDC638632CE60D5EB319788F8782 [email protected]
143,624,162 *0DC10A0F265BFCB15CDA1A6D20EE08C8CC00D9E5 ep&2n
143,624,163 *0DC1B9C28DBD009C46329B05D52FE2D1646C2A20 CHANNELONLY
143,624,164 *0DC1C107DE5A530C79EFEC21372DF279072004D9 CHANZAN5
143,624,165 *0DC1D7C780A05821BE7F726FB2BCFC8E53F6B0F8 EQUALOBING
143,624,166 *0DCD2F4152BD7A1906F68469A7047068AE4F9CE8 CHARLIEMAC
143,624,167 *0DC8051DD5918F5A18246ADEAAE8D020CA5A7088 chathusruti
143,624,168 *0DCB1A0AB3BB2C2CDF0480A0AE856BD2F14DF513 CHATTERER.N:.CHATTERERS
143,624,169 *0DC59C14B7728D9D6376FD5C9519D2EBBF29704A [email protected]
143,624,170 *0DCBE4F4D545CC89E3AE53DFDD8099BF8AD906C6 chaunceyfiorita
143,624,171 *0DCCBBF8379586C2CDC36F8E4A688D7C2F810972 ERIN.AUMAN
143,624,172 *0DC0AC9F9C53CE2EF3BD6C8ACECA2FB87ACDD7B0 erne:
143,624,173 *0DC359F42665A251F66912AF57877BB492BC0638 ernestkulseth
143,624,174 *0DCDBFDF12B255CD8E7D14EF23D65B76BB2C9CD2 [email protected]
143,624,175 *0DCED873D5964CAA1CE3D476D0FC09BBC52033A0 chervenk6
143,624,176 *0DC909820BB45B28B5C722299C8B5814223527B6 chetan.sehrawat
143,624,177 *0DC0E1FECE86333C94CB36A6E205E6DB88C89CCE CHf&
143,624,178 *0DCB8833F8AE1D600BFC28C164173F8F46A8C46D CHIOCOCCA-RACEMOSA-VAR-LAXIFLORA
143,624,179 *0DCFF027E4DB4C6B5579B213D1A5535D4931A178 CHONGTEIXERIA
143,624,180 *0DC89324947186287D7D3E20CDA83F0477608991 chrisbattey
143,624,181 *0DC1F163B8EA2CBDB5F76A55C300B80EBB44B947 CHRISTIAN.BATTS
143,624,182 *0DC21B739E4F3EB8FD344EBE31C90C01B54721A1 etiam
143,624,183 *0DC3F282028DFAC48CF1244C9088D0ABB1BDA0C0 [email protected]
143,624,184 *0DC0127A619367CAA10643807161CE4963B1FD81 EU0TE
143,624,185 *0DC2EBFF9AB634D0BFA2ABB7C7157ECE8D73A6FF chystanym4
143,624,186 *0DCA8F6CE80E815E391C9F543405FBFA3987B4F3 EURYNOMUSING
143,624,187 *0DC8D2178129A724EEBF32FC50010173505CB8EC cibke
143,624,188 *0DC82D6D0B69F680A1AF8ED2A84929709404EB9E EVALUATED.PRODUCT.TO.THE.RAMP.PRODUCT.
143,624,189 *0DCAF93A0FDAF7623DB2DE60B58AF72C43566299 EVANHECKERS
143,624,190 *0DC814BEEA3C337276C4744625282EEF338BB39C EVAN KENDAL
143,624,191 *0DC5EC612E21354374867D2715B5FDF761D4685B EVENTSTHERES
143,624,192 *0DCBC32C45F945707E9B322ECDF9E876634641A8 ciolhpoted
143,624,193 *0DC4D1173EB7560EC810EFF775713872C18AF29A cjenovni
143,624,194 *0DC570419A02B05B59A9B64B77A45456E4A54DD6 EXPRESS2009
143,624,195 *0DCF43254D9DBF2402A6DBA1670D822385319E52 ezekiel.galvez
143,624,196 *0DCEBB04C36286490D54F6636103B662E00A5D81 EZEQUIELPHAUP
143,624,197 *0DC6BB4BC73EC6B6FBF1A2EECC45D4FC322053CB ezolepluh5
143,624,198 *0DCF012AA547C2DBB9A5BEF886466A6360E054C6 clarencebowl
143,624,199 *0DCC43A6F8827DC0E34FBD8C4C6CC45DA8CB7DAA clarenceobiano
143,624,200 *0DC1CAB852F07D1B7D1C81C052A30BAE479457ED F012301210P
143,624,201 *0DCC1945DD145952D7598AD369EA548567E46FB7 F0UR34
143,624,202 *0DC34F03CCF7957E4C84B7034A745092C23CE7A4 CLAUDIO.HAYCOCK
143,624,203 *0DC1AFA3345676211CC89CDD4F6392557EB048DD CLAY.ARTIS
143,624,204 *0DC8754644A83738C9197F3F05D268AAE22EE9A4 CLAYGHARING
143,624,205 *0DC2BA01BB287235EE97AACD5CE60DFA442734A7 F1N710CKS
143,624,206 *0DC4AD04B52FDFF8822747001BB6CCE0A9FF0888 CLERECING
143,624,207 *0DC3AAEEEBB94704681F946A9692919CD994E311 CLE$U
143,624,208 *0DCA5AF95D863AE4C5EE8D6897597ED0AB41F706 CLIFFORD.NOFTSGER
143,624,209 *0DC6BB8087E20E74D40931296D5FA27FF69CD13B CLIFTON.MARTINEK
143,624,210 *0DCCCC4A4D9F81C2354930BF77365C60800BFFA7 FALLOISES7
143,624,211 *0DC6A4919CA39F1E20AAD27E3EF1B975FEB8B0A1 CLYDE.MCKASKLE
143,624,212 *0DC2B76066B3C9AD8A283413C4357099BE0DECD6 cmio
143,624,213 *0DCB5819519BFADA6B41841054CCA7342F5079E4 c"mxa
143,624,214 *0DC6FD4A8B49F20122D44A19818547D16C6156F0 [email protected]
143,624,215 *0DC8FF2F6D13B3C99AF3DD271F0C090DBE3FFB2E CNANW
143,624,216 *0DC366D6EB6490B95A1152D2CB82120D80FB1136 cnk2
143,624,217 *0DC8C344396B0D95288580B6F2F17AC02C79730C ferminoransky
143,624,218 *0DC0228DD3506A954F145AED6DA6F03CF81DB4AF feroj-hossain
143,624,219 *0DCBEEE41696DCDF1822295F6465DD1F3B238BD9 c=o
143,624,220 *0DC10B9168D8F0A9D6F2EA2AB3E794112F030BFA fgraduation
143,624,221 *0DC00F61B8AB331B39C3EAA5931302A81E36EE76 co+&c
143,624,222 *0DC699CD556B1C8F676B19DA94533C5758E8B9E3 cocainizations
143,624,223 *0DCA7D0506A827A850D52E5F52F3A96A4565514D CO#;H
143,624,224 *0DC30C474DC084A06CDAFAA7DED4A6E3CC5F7C69 fiindumi
143,624,225 *0DC277D9863C80B9B19F936FF9F254C4FF9CB618 FIND.ME.BY.YOUR.SIDE
143,624,226 *0DC4B7D8EE09A3613A25E9B537E29D41A72E643C COME WITH ME MY MAIRI
143,624,227 *0DC26CD65B8536FE7D09C4DD323FA8FCBAB50F21 commentitious!
143,624,228 *0DCD923D6173344FFA25F4FF2DAD345BF4875209 [email protected]
143,624,229 *0DC2FEE6F30CECB346B120FBE9A8AC6EE395C13E confide.V:.confided..confiding..confides
143,624,230 *0DC8E1D125B3C0BEF467B1F631D414CC937B2AC1 florentinograzier
143,624,231 *0DCED2908C4DE4F8A8F401A8C4E140A9719959AE COSMOSAMY
143,624,232 *0DC225CF20AA6A827F4878D96AD362873DF21BBD FOR-SOMEONE-NEEDS-LOVE
143,624,233 *0DCB940492FAD1CADD35F4CAF4C267E959E03FBA fosforom9
143,624,234 *0DCEEFCB64DE2FF497656248ED63D2216F91A65F FOURTH-CITIZEN YOU-HAVE-RECEIVED-MANY-WOUNDS-FOR-YOUR-COUNTRY.
143,624,235 *0DC9E7F98F3B4A7F3087D0A8A4B7D904538F6ECF FRAGESATZ“
143,624,236 *0DCD5633BCA7C1F6A341C0612A4FFAD09F39276E covi7
143,624,237 *0DC10963CFE7EF6E62927306FD7D3C047C649073 francescodias
143,624,238 *0DC8F8BCA8184FD222F5D04A7F1D59C8E0E95493 FRANKLINGERRINGER
143,624,239 *0DCDAAC2EC67167A905D9AA0043197DF16D54B1B [email protected]
143,624,240 *0DC1F6A4FD66C67E466827BD4B46B06B02737213 FREDERICKKIFLEZGHIE
143,624,241 *0DCF8AD852A4736E5736F1061D0CD9AD19B5761C FREDRICKSKOK
143,624,242 *0DC912E170AA041C1253D646B8BA4520C0CB7FCD c:\program-files\microsoft-sql-server-compact-edition\v3.5\devices\wce500\x86\sqlce.dev.enu.wce5.x86.cab
143,624,243 *0DCF65D711550F724203F4146478D0A86A1C7AFE FRTCT
143,624,244 *0DC04ED818E088CBCC29AE578F18A3DCB5884A69 fru"hschoppen
143,624,245 *0DCAA89194DA601A97307BB328C5A59DA7CC4EBE CQ;NB
143,624,246 *0DC142C858DE7571442DFB1840350206A137667B cq&ne
143,624,247 *0DC83FC2E9C839E9C1260F25B8E934D67265948B [email protected]
143,624,248 *0DC782D58BDCA3909F7FB5BD873868CC8D35FB5E g7k.
143,624,249 *0DC1A7D1F66B53FEC00593556C94588DD77FD638 csupi
143,624,250 *0DCB2355C8081F14811E84A483880D4570D4483E C!T4DEL5
143,624,251 *0DC099BC76BB02B62744FBCB44566415F7B3BFCC C/TM,
143,624,252 *0DC427B30EEE8A5667A14CC273F7A748B49AF06A ctrk$
143,624,253 *0DCC07164B8771D2F02BF2C4BDD74C6CD68B8FD0 CTSEW
143,624,254 *0DC1E476402C3858839B9F7B87C589175FF6EA5E GAUCHEROT
143,624,255 *0DCB3426B8892C296924D694510F9584D426AD57 GAUDIEMPROISES
143,624,256 *0DC87B40F3D29039631348C19D5A662471A8889A GAYLEKOSCHO
143,624,257 *0DC1D2597B28FB239E2D4FBF209294B7D43F9743 gaylesawyer
143,624,258 *0DC17FDE5693E367FC46428150E1331B28422299 [email protected]
143,624,259 *0DC53A2DB4FF7EA4C5B81421A035575D92A15C78 cwcam
143,624,260 *0DC75BE41AEDB563713A4566CEF89417C113DCD1 c?x#
143,624,261 *0DC62A59445687ABD2D24D29BBD31792DF2BBD5D GEORED:JOYGEO
143,624,262 *0DC1687AF123D10FF02AFC170D258470AFFB1540 GEORGEANNE
143,624,263 *0DC58D6EF197D52850D320C272CC574FFDA798F0 CYN+?
143,624,264 *0DCCB3AE1D1F254C4B527957275D8ECF02247217 CYNFI
143,624,265 *0DCA2C021F95254A3E657AF9116D08A92F348192 cyrusnealer
143,624,266 *0DC6E2039AF39492881C9F8373948C875863273A CYSTICLE5
143,624,267 *0DC3960B5F8548D97B643CB5FA3241DB945E315D CZGG
143,624,268 *0DCC95E31A7F6C67ED792D02544161C10F90595F d0c)s
143,624,269 *0DC58912B1D3EA2B1401F980458913A6F29F6A8E girorilo1983
143,624,270 *0DCB771845C5D45AB2229E9681F7456F6592DC2D GITAARBLAD
143,624,271 *0DC92099FE334B3CF69ECC02B82291A55F1FCCED GIUSEPPESCHREUR
143,624,272 *0DC4D8C65BF3B5E74071C028F2165D1853903D26 gj^g
143,624,273 *0DC3E601D1BCDE135AD382E9C044CFB6A191F8B5 d2iee
143,624,274 *0DCFD9B55CFCB2752ED087959247996C9643EF04 [email protected]
143,624,275 *0DCA63ECC140C13F40ED1DF0EE729E2BB81175D8 gnojiva5
143,624,276 *0DC4B6A0996DEFDF66CC24537BB49B6189E54C6B D5AQ
143,624,277 *0DC140EF1AEC22431C514328EF7A1074FE1318AD GONZALOALVIDREZ
143,624,278 *0DC83A45B3790E8B0EF2BD61B202DDE5FCE18EB5 gorkii10
143,624,279 *0DCC05B9B2AE8D9BC4FB649849978C1918CF86ED D!7NS
143,624,280 *0DC0587C039E3261B89D235D032228D31BBB8CB1 [email protected]
143,624,281 *0DC17957709A7D3DE782AC02858A4516685C1D68 d8:u0
143,624,282 *0DC1D0435BBC6E35A9B6E567DE7A1C5C6D376527 GRABADAS5
143,624,283 *0DC525993D6AF9242710B1F31A19C5F4D08ACF43 graigdannis
143,624,284 *0DC969C71CBB252C5EAFE326B93DA395CDB42B90 dachleiste
143,624,285 *0DC290B8DC7BED36BCD61639BB06FCF1B1004050 D&AED
143,624,286 *0DC9B0A18C86656E4473839F4EE9745437608C1C daeheldd3
143,624,287 *0DCEF3540B7F9CD41787A13E276A637E83AB02C8 GRANVILLE.ARNDT
143,624,288 *0DCD568CAFD92368012A3340C9AB2FCE597D8BA8 [email protected]
143,624,289 *0DCD389429D33197FC5E1B02ED3A0DE3BAF274A8 [email protected]
143,624,290 *0DCBB0D5F51844760207412F5C668606F9FA4B9A GUARAGNINI
143,624,291 *0DC8706C730CE824DD71B735DE56927CC266DAF0 [email protected]
143,624,292 *0DCE4284E9FE7F18C405609742DAB7DE445E11DE GUILAUMEANTOINE
143,624,293 *0DC4BE0FF97248392CC12F4D8956E66EF41BC5CA DAMONPRUYNE
143,624,294 *0DC98109C6AB215C1D6A2F0A8DE6B4F9AB7FA8ED DAMON.WEHRMAN
143,624,295 *0DCE0C973D4DB77D92BD4FD85C21DF396F4D9629 DanceoftheLollipopFaeries
143,624,296 *0DC4C0E6FC310CCC6F9A4DFDE5AF7892141C4903 danniisimon
143,624,297 *0DCDC720687BFBC6D0929E9BBCEE0ED52B85BC51 GUSTAVO.PADEKEN
143,624,298 *0DC2C57BD577B5170F11C2C418020B31F14BE38F dantennis8
143,624,299 *0DC46557A19414953AF70F28D8F88C4C0C67F8EE DARELL.HOSCHANDER
143,624,300 *0DC3D26987B626F073F22AB61EBB4387D995A0DF hadronerna
143,624,301 *0DC240FF8002D4236D4472814E469F44313DCAE1 haley.saxton
143,624,302 *0DCB93DC92E89FCD4898A3B732CE4F84AA7F071F DARVAMED
143,624,303 *0DCDA8B6CA25A70AE0AF904F5B97CBC3229BC012 DASTQ
143,624,304 *0DC326F244350D611274001EC98E82A56B7BC038 handeschutteln
143,624,305 *0DC7237E10F0078E317B6771FE0E689F304372CF handfuls1
143,624,306 *0DCCB79863E7228F1EA26C7192EC6BDA212D3E6F db;o
143,624,307 *0DCC1F4D51E50DABEC13557D89D68F9D01C2DEE1 [email protected]
143,624,308 *0DC08831E9CC20E95701C99C96C28640CE6FE1D6 HARLAN.REIFSCHNEIDER
143,624,309 *0DCD7B7F2B7052510532ECC73664715DAD4B2567 [email protected]
143,624,310 *0DCFCA00D8B2AA6E4DBA5204A4DA653CE1B9F1B5 [email protected]
143,624,311 *0DCB2B39853B18D91C20A1D8E0DCDB7402E7E743 HASSAN.WARES
143,624,312 *0DC85185F0766A413A6B6A52F0CC60B213A19C51 [email protected]$
143,624,313 *0DC92671E411D19793136F77D42060CE915D88F9 DE5N
143,624,314 *0DC08A71A17AEC7D3EECEE8CBFBC628D9BD0F39E deangeloczapski
143,624,315 *0DCB0D6A201A3045CB61E0785DE0DA2C443E8C58 decaisserions
143,624,316 *0DC999DD6102CAC5B64579EBF789209EC007776A [email protected]
143,624,317 *0DCA51C4A4C33DC7FF18D643DB2AD22C47F67667 deifs
143,624,318 *0DC5703DFF9EA5564FAA6B3DB9656E021E390AE4 De_j
143,624,319 *0DCC70C82A24B3F3E533C795FDDC5BD3F661584A henryswimmer
143,624,320 *0DC9E74CB1110B4A50CCB09A3BC57D2FD48D6CC4 [email protected]
143,624,321 *0DC80FACEAA338FA1E1936D45D13B31E860CC209 [email protected]
143,624,322 *0DC3C314E79D3A6F5D59E472C2AE8DE1C1F9E8E4 HETULLES8
143,624,323 *0DC9E2BD30F391726B242613D7086A94246E5814 H!F[
143,624,324 *0DC4EE7DBF2C792ECA0CD60B32F0E9DA57B4F2BF hguo
143,624,325 *0DC83017A47483D7F910A0A8630DC8C0EC7D5452 deshyaa8
143,624,326 *0DC8E04BF3BDECA0264CD1F49B73D1681659F57D HIRAM.VARNEDORE
143,624,327 *0DC90B134C6D600A987E6AD0E812BDB84CDEF284 DESMOND.WINCKLER
143,624,328 *0DCB7B0F3AE1DA57CEC479430E81655516F5AD63 hjertlig1
143,624,329 *0DCB975B8E31C92AEDB2F47A06BEA76387FF0CF1 hlokalen4
143,624,330 *0DC3728CF7CE19C0B8C20EF204CAF6377EA0F816 HLUTHAFAFUNDINUM
143,624,331 *0DCA8836A8D665A7C6B260E5815262DD4E05A2A0 DEVONGRAFENSTEIN
143,624,332 *0DC4E9B1F986D7326D0793A6C7FEA03ED4599C6D DEXTER.PIETROWICZ
143,624,333 *0DC5A691DEF992D0A806EFC1275D29216DFDC28D HOLLWOOD4
143,624,334 *0DC179C1B47A212DA7E390A9702DAD724E433D69 HOMPASS
143,624,335 *0DCA09A33CAD7C8F323E851E8BB118C8C919EABB HONG.GUTZLER
143,624,336 *0DC91DBB71CF13DE13F66F5E8731D8C01D81C774 DG8D
143,624,337 *0DC4A723C3A79764CD2E4C3735173410B06DE777 dg.ce
143,624,338 *0DCC2276F35F39F30EF7A4F117DE4834CD856BBC DH+AL
143,624,339 *0DCB6AD064BD7E14D67392420738B75AC42EFD40 DHR3H
143,624,340 *0DC2BD091E7CC3CF9FB8220F20AD17A7039C1669 DICYHKXF23
143,624,341 *0DC799E0DD2FA391EB010F7C24F4397C99816442 die"9
143,624,342 *0DCD541F03A20881E3C8023B67C7100D1F2AC702 DILLAN944
143,624,343 *0DC8D593B8E8FC9AF3603DC3E019D9953E5B0139 [email protected]
143,624,344 *0DC1DCA31C7AA0AEA894A0892463A9B5E95A7EBF DIRKMILANI
143,624,345 *0DCA77A8C8DEB285A7E67D281452149360A9B387 —hooverville
143,624,346 *0DC27830AAEB1AA5A79EA15A8FD940B8CB286ACA HOWARD.HARJO
143,624,347 *0DCBFA7BAB92423C3B98AFB3141C175990221F6D HØYSTATUSLØP
143,624,348 *0DC047B7A21005D4CE0F3146F8B947DE4995E635 dje)b
143,624,349 *0DCBB48F5B9323186331E39D7F23E09CAABFFD93 H?R&
143,624,350 *0DC84299F8A6357C4D817362413DBDA30045F283 DK"PD
143,624,351 *0DC711953C07C75BF8C3899E5CACA755064A8751 dl1+w
143,624,352 *0DC4B4124C937857E52A3FA9D75DC43543C79668 DLACKRIK8
143,624,353 *0DC5EA1E1D157C7B57BFAE825C6FB664C9509C5D dldp9
143,624,354 *0DC42A0592FBFD911D0FA4FFE023206D21660645 DLICHESVERTRAUEN
143,624,355 *0DCE26DEE5AFB216B54E85E0CEB5D946011FDC31 HUMORESQUE-NO.-1-IN-D-MINOR,-OP.-87-NO.-1:-COMMODO
143,624,356 *0DC1288711F234BB34AD09EEA56E05704BECF930 DMke
143,624,357 *0DC77B812ADC46A658F95196E547060749E5EE42 dn;40
143,624,358 *0DC410FE2DD4B5676CDE80751B24D1A9062F7031 D#N70
143,624,359 *0DCD99B5C1F397798BF4D9B8CCAD1B65D32311C3 I06101979
143,624,360 *0DCDAA506EB121B4D2F50439B9D6BB134131386E i77pumvp1h4aqij9
143,624,361 *0DC842627F55D1EF06303A4A66ED90E414FADE7D DNW"=
143,624,362 *0DC307730951975493B2F6453858B3DB7D4F1EBE d#ny#
143,624,363 *0DC5877609950AB0F5DBB39D2593E6E207794EFB DOMV
143,624,364 *0DC166C361FFDA5FDF312105FB1D7991506CA460 DONEMARI
143,624,365 *0DC1AF11F9723DB69ECF7BFC9268C451F4E88A30 IATERPPA1
143,624,366 *0DCEC906738D3F71E1B715F3B18344A5AE24F9F6 donnelljansson
143,624,367 *0DC4E1EBCB46A4727FA585056A345B5C6EFDB132 ICHTHYOTOMOUS?
143,624,368 *0DCEA240E0C58F5C23D3D3524D0396831845885A DONTEBOWCUTT
143,624,369 *0DCD411FDCE28D7E281A9CE02BC0C28EFEE42F12 Don't.Try.to.Run
143,624,370 *0DCE9CE05580D64551000A650151C1E9E26F8A6C DORIS-CUSTER
143,624,371 *0DC9E031C9F97DD8839BB8D62A9C4DCBCD6F25EC DOUGLASS.DREIBELBIS
143,624,372 *0DCE9B75FC2AA74310B3FA62BDE51B68BA5664BC dp__
143,624,373 *0DCC273C082463FFB4DD93B27F6EF7980D3E5009 DP!ED
143,624,374 *0DCA09473F4258674FAB9AF8BAB49EF1C30CDB4E IGATSHOV7
143,624,375 *0DC6693398BC4CB3F71A947614B5C96C73116E5D D"PM+
143,624,376 *0DC1B19600A7682D3FCFB00FADC195E74124CAA8 DQ9H&
143,624,377 *0DCA962DF8477C44E8E29D0913848146F60892B2 IKSORBMOD
143,624,378 *0DCE95169CC1C5AF9AC71507676D328712E2F4F2 DQTC0
143,624,379 *0DC8A5C26A919DF1919ADF2301EECC40FF39A561 DRAGORES7
143,624,380 *0DC11891A8914BAC985C5BA8D69F4E2B48C61A18 ILLYOI!
143,624,381 *0DCDA55086883CAEEFEC94A5003AF864114AB999 [email protected]
143,624,382 *0DCB7F21DDAE574A7431F7D4D74024CABE597AF7 DRGSLGNED
143,624,383 *0DC0DFFFDE07F8378C59EEC11250E4E89C885E55 driblets
143,624,384 *0DC43D2221F783679E953EC60705FB2BCB33BAB4 D&R#M
143,624,385 *0DCD9A9004D6DA680E162EFA0FF63D561478BA9F [email protected]
143,624,386 *0DC59B2E718647331DF237D903F32E8CB4933E0C DR.TOMS
143,624,387 *0DCE435A6CB2381117F63338B6FAB519338C122C ILOVETOMCAT
143,624,388 *0DC2F7175F389DA164D6FF7191E9A0638DCB3F4D DR(W!
143,624,389 *0DC4B5A73916A12FB5FA77339C8552918D3CE829 ILUVDIANE19
143,624,390 *0DC54628E1DC49C4B0DE7CFBECBB0F6319270EFF DSFWT
143,624,391 *0DCEA0F8212B7D6DF21B74E22207762DD3FA7C7E IMPRESSIONS17
143,624,392 *0DCA372480259FC1FCE1B7784D82ADD941B0E85F inancienttimes
143,624,393 *0DC3BD8B449DBC713D5098F81D4C6AE0A71DE1A0 [email protected]
143,624,394 *0DC7203D1A7E9033B0DBE67EC80CBE487847DF79 INCARICA8
143,624,395 *0DC140E854A1E74393C95163B5DE590CCFE3FB29 indmeas''indmeas
143,624,396 *0DCFB23D489680FBEC26E26E23C937DA340813DC DTW0A
143,624,397 *0DC23E98AE00E6B226871A121E86D54C8F69998C INHUMANA2
143,624,398 *0DC4FE23D561DE96CEF0546AE2C6CC84B387C9DD INJUNLEUSE
143,624,399 *0DC6D8FD03F950B83AEC6968E9AD73546BB2A9D5 interministeriumed
143,624,400 *0DC241EFB20AEF13C9AB6B149A8D61DACD3E2146 [email protected]
143,624,401 *0DC2F9DFE7D8A4EC78FE485A987CE31247A4D39E INTUDML
143,624,402 *0DCADC3355AE66C105031978C4726C9029C4B9E8 duf7w
143,624,403 *0DC8C4A2BCD16AA0C5610846923C3BD10ED6CB15 DUSOP
143,624,404 *0DC826BA4CDEF52DEB314A91ECFA7E4FF558FCE4 dvfi.
143,624,405 *0DC3F368F2D00B55FF65BABD05F8E75DFA25EB13 ismaelhandke
143,624,406 *0DCDD96122018B155B42A471624092E4FB7C492E ISNAHWATI
143,624,407 *0DC39EF63164F739C83DE9C786231F187FAC41D3 ist>
143,624,408 *0DC58218C91B75ADA5808E369DD53D4287416580 DW-G%
143,624,409 *0DC4D5B7C678B8A5074CBD09801DA727621DE709 ITONBSWS
143,624,410 *0DC5DE4E0B97E688ACF7845DD95F8127FF504E9F (d&wremix)
143,624,411 *0DC03E724AFD6864901B2515C88F619F20E834D6 [email protected]
143,624,412 *0DC048403BADCDFDDC335BB948BBC05E6D1BA498 DXMVW
143,624,413 *0DC17A8B4A044594A40B281165700B438F85A349 IXD%
143,624,414 *0DCE35ABA9EBDD8BD25CDFB414EACE0C917F5CD5 dyt89
143,624,415 *0DC37E0560C1C3EC6DD39F587BD3EC47EBD1F0C5 dywf2
143,624,416 *0DC3475BD80EB18759EBF08E774F5028CAAEB8AE IZDELOVA
143,624,417 *0DC24CCF9605A9254298AE4AF3A93D25C83EE58D j._|
143,624,418 *0DCA39776B5243733DCE6D3A94B94569EFAC42D0 j000024534
143,624,419 *0DCA5A457943A47F32B5F9834602667CE1F40916 j0j0baby
143,624,420 *0DCAC9F8F54D9E2E51E97E921EBFE8DD9DD52420 jacksonvierra
143,624,421 *0DC71096AA1D0CBBD8586FC23EB3AC883DE7E13B eat_d
143,624,422 *0DCFA2098F130B883FF2F952B47B1A81DFB13FA9 ECHOES-TO-YOU
143,624,423 *0DC55EF77B22E9799E57DF0865CF8FD08664BCAE ED!+ABLE
143,624,424 *0DC6BDEE413085508E2E88603A71215164A87927 jamarhoney
143,624,425 *0DC6774ADD598966F4297661D1DE973072EAA81C jarrodcheese
143,624,426 *0DC40373D42681F68734F89EE3F956ADAB60D8B9 JARROD.VICKERS
143,624,427 *0DC574A613B91DC15E153483AC13EF845FB80E9A EDWINAFROGBUCKET
143,624,428 *0DC7BE39DA5BEB9B3B587E25F8530C8E7C49E0AC edz$h
143,624,429 *0DCBA745C78718D43A8F9165136A3206FAEC5484 EEA7Z
143,624,430 *0DCC891102B7F656C7A6E13FD9A545596335248B jason-yamaguchi
143,624,431 *0DCB4500D4674A28ABFEA74DD667806022F84690 eeyoreo8
143,624,432 *0DC222BEC12297A129AC7138AB0FA66EF5451C68 EFFROIS6
143,624,433 *0DC5AA4DE3BEC499A76E6C5783E7227959AABCD7 jeanlose
143,624,434 *0DCD6A2A6660AD96C1ED561018FED5AE7AE1421B JEAVANTAGGER
143,624,435 *0DCC6B8E59D08D3411EF0DE24F46A3000648D91F [email protected]
143,624,436 *0DC0A8744ED50AA3B5C1B10D328C4B5BC791B2D2 JEFFREY.KUBAN
143,624,437 *0DC7B198C1E1194EEAA10D47060B6F41FD4DAC2C jennifer-juric
143,624,438 *0DC06D02DDE93E6792905389A41F641E5CAE3C7F JERAMY.MICHIE
143,624,439 *0DC3A3F412B471666187EE1263F782FB9654A30B jerecataldi
143,624,440 *0DC9081C6CB1128B060986A9A1D785BC8F124DC3 JERRELLLUCCHESE
143,624,441 *0DCC450D79DBD7799DDD343279B6BD743E84B06D jerrywojtanik
143,624,442 *0DC1006272C15D2B0F8069C0E18A4A467CA69774 eip7
143,624,443 *0DC5CF3AB6DF5BDAE95ED050130758C59B64DF16 JESSIEBINKERD
143,624,444 *0DC76F9AE78C2F61CE04F76A25642347C90D6637 ekilottom3
143,624,445 *0DC06F472FCA7A84E89D37EEEA25B90A928346E3 ekuldtem8
143,624,446 *0DC0D79A10C7DA04F9D71E46ED7636EDBEF7558C [email protected]
143,624,447 *0DC6B8FEA065BB6E63A5C6A21DE480CDA5C04EAB ELDRIDGE.DENUNZIO
143,624,448 *0DC06FC2301C2592778BCFC0B5CB813F7E2DB494 JINNEFER0
143,624,449 *0DCBEA9A4CF52D47EF9BB019D7B72BBE9DE4DB7C jiteender5
143,624,450 *0DC6ADCFB0D1B3FB4C6E4F80251E8563C10D4B3D JKHACHATOURIAN
143,624,451 *0DCE6F1671136CF69F5108100BEB9A1705992AC5 ELIASMCQUILLER
143,624,452 *0DCAAF785AA93C42438C5C1D47409E4A5E25D5FD JOESPHKAZABI
143,624,453 *0DCEE0D77FFA0DFBEC28206B6662D80DB97747D4 ELIJAHMECKEL
143,624,454 *0DCAE163822630459B90CC8F22F0815F0F66CEB0 johann.friedrich.reichardt
143,624,455 *0DCA6605D12F8E7FB0691FD5F5AEA4393F07AFD3 ELLIOTMYKLEBUST
143,624,456 *0DC1A777241FA53C0C29803ADC739FBC5CAC587F JOHNNYVISKER
143,624,457 *0DC32450BBABD5BE561CC83834B1E943D75CAA88 jol2
143,624,458 *0DC12BDF682A84133F9D5FF1FC7B196BB013EF89 ELP3
143,624,459 *0DC0C0F826D613B8E83701E2FEC6FA94B069296D ELROY.GUTKIN
143,624,460 *0DC4FBD2C4FDD00393232351D428236AC8DDE446 ELT(F
143,624,461 *0DCC094664DA24344778F88FB8F4F12C2FBCA89F ELTSURT8
143,624,462 *0DCA41F60B77A232F9391EC624C257BF39259B73 EMANUELFANGUY
143,624,463 *0DCC7CCB30C08A0281F4A0EBFB54DD3C640C2A6F emersonstenerson
143,624,464 *0DC7A04B0B797D01CD1D68E5862388A466B78213 emlohgnl7
143,624,465 *0DCAF8DB8407B67ED90CD84280868903F2D29E76 EMMETTDEWIT
143,624,466 *0DC1D688F792DC8138885E779CF9AC12DA6794CD JUHOSLOVENSKA
143,624,467 *0DC990CD525A949030FBE156E658E6020B4B6D6F [email protected]
143,624,468 *0DC0E814C4D41F8DE5391174AA4650333A896112 emuterin2
143,624,469 *0DCF9DE0DD023AD2E5DC0EA64E6A9138D8D3DC1D ,.- `E(N
143,624,470 *0DC900DEEA9CAFC44DA80945B010A2601BE66C51 en1arger5
143,624,471 *0DC3A7A54242333E176022017099CC30D6C86275 encogas
143,624,472 *0DC4889122CC6DC4F8B026F258320A8E6B95BF9F juramountains
143,624,473 *0DCC9C17CD2C93307A18C6EA07310EA7DC69D160 JUSTAFRIEND_23
143,624,474 *0DC293B54FFBD70551DAE809B386C755A55768CC ENEVOTSEB2
143,624,475 *0DCECC07CC9726709F92A003569B6E629B46A2A9 ENGRECO_GUITARS
143,624,476 *0DCA486144F72F30449E9B480CB54BC7ADE38B2D jyskheds2
143,624,477 *0DCD03A1AB21A0F58C949F2520CD9189571AEBD4 JZUMPE
143,624,478 *0DCDE3D9152856333B80C01AB88D07173B2F21A1 K33l3d.sn
143,624,479 *0DC893D7851B305EB1E8A2FF7CA78083380F5E68 K7E}
143,624,480 *0DC47CB93F8CDE717E02627A0B8673C635D2A1DD k|a(
143,624,481 *0DC0DB80540E70C956D38E6567D7280A7C3116EE EOTIB
143,624,482 *0DC1772E7522453F7B4979C3A391E6032F216937 ep2z
143,624,483 *0DC576F95F634AD7556E23C2B6200DB76A26A7C5 [email protected]
143,624,484 *0DC20C60550C60FBF6D523CF80FF389CEE09EB98 eq2g:
143,624,485 *0DC2692A0FDBA598EA57E9D2EBDF66BCD42AFEF7 erange
143,624,486 *0DC611C85A3366E8CB7E2E8291F5344D52BB74DF ERFAHRUNGTHATSACHE
143,624,487 *0DCD3CC93F6B69719B053C5DB031FC998E5B3862 ERICH.CANTAKIS
143,624,488 *0DC8D3CD356883CBB2F17AFB148F464A771EC878 KATE.WOBSCHALL
143,624,489 *0DC7C9DFFC40400C64A08FBEF0712B214ECAA4DE ericrigney
143,624,490 *0DCF281BFEFF0FB07464B70D6D2263F786207590 erioturc0
143,624,491 *0DC04906956D10414327BAC8DE74EFD058211C6B ERITHEA1
143,624,492 *0DC24BF63230B8A799DFB45CF54EAB27A92BA332 erne:
143,624,493 *0DC359F42665A251F66912AF57877BB492BC0638 ERNIESWARR
143,624,494 *0DC70DFCD4931BA251A114B1060E8D202EDBF861 KEDENNEK
143,624,495 *0DCB85320F28F22AACA20C19C3F66BD2A3E1A8AD KEIJIRO-1-0
143,624,496 *0DC073B0AFD8BEF1DADC454180209828ED0D2677 KELLIE.DODGE
143,624,497 *0DC49ADB6072D8733B838E21DA117B2606B228D4 KELLY-P-BROWN
143,624,498 *0DCC2BF987CFC83E94A6706FF22F648115A3BB95 esbnf
143,624,499 *0DC4D8F27B440EC5A3B48B4825F11ED1B51FA300 KEN-CARLSON
143,624,500 *0DC930B62147F730AA2AE540012B6333AB51664F KENETH.WALLEY
143,624,501 *0DCA88A366D47DA46FC209899700A94122BB6240 kensetts
143,624,502 *0DCAD88B909AE1B096746B094ED014741201E5D7 ESORTIAMO?
143,624,503 *0DC51D801943FB1EFAF776C82482A318635AEE62 kermitiloveyou
143,624,504 *0DCE79352085A62D8DCE2B919BFC5E5A074BB3A5 ESTADIO.DE.LA.CONDOMINA
143,624,505 *0DC63575F94DC4575DA6D479900E25DA7D2E77E4 KEVIN'SPARTY(COWBOYGIL)
143,624,506 *0DC348E072ACCC37ED8AF874600F31CA8D2C4F65 KEY...THEN
143,624,507 *0DC422B1A258369CEBF38495CCF4CE41E1EC1854 KILICHOFICHWA
143,624,508 *0DC967B60EE7A4CE7C16B6E16DC5FE702056250B kimberly-merenda
143,624,509 *0DC43E08BC2D45DC477A1BC583965010F599AE58 Kings'-Daughters
143,624,510 *0DC01093E5414568EB22C4B45A7F00DA7B5DCC11 KIRBYBORSOS
143,624,511 *0DCCD7EC531805419FF135A4A40131E7EE01B278 etiretty6
143,624,512 *0DC14D690BE266D817D6076448BAB4887B0402A0 ETNEIDEGGED
143,624,513 *0DC4165127F03E3F9AB86853F882B6EFC370BB14 kleurgewaarwording
143,624,514 *0DCF12ED8D54A2CD3ECEB2370878FA67C53577EE eugenecollis
143,624,515 *0DC8D94B1690F677A1F606208104EEA408967240 knuffle
143,624,516 *0DC3C5DF815EBCDFCDA06C24CFA0AF7FEBDF41F9 knutsford.city.limit
143,624,517 *0DC6BB13D5EDBA913485AB33D98C8FCBB461E1B0 [email protected]
143,624,518 *0DC604907D32EE5A849CEE4DA7B3324A1169E0E5 KOLAM’
143,624,519 *0DCA00592643B2556DFECCEBB6BD8120FBDFA80D kolmardskyrkan
143,624,520 *0DC96512BD109DA155FCFE97FDCC2149F843E888 EVABELLE8
143,624,521 *0DC9FFB445B95CE8BAC920D02B1D84DE24CD7DEA EVELEIDYM
143,624,522 *0DCE77F3F472C85148ADFA35CB62C1BB35DEDA47 kos-mavromich
143,624,523 *0DCE22604A53A0F2D7DC747BBE88A4EDCF2E1C91 evypurwanty
143,624,524 *0DCA10C168AF1AAC3F07B2B2AB3FBD995E396D8A excalibues
143,624,525 *0DCD2197A924858BAA7FC793B1FE5CF0B96D4D29 EXPOZHTW2007
143,624,526 *0DCA092CE6740E15603F8EB0E20670DBE55AEF16 KRISTEN MCNEW
143,624,527 *0DCA88D3262FD81C767C7E89F11CDE867988B25B EXTULITING
143,624,528 *0DC5D128B03554DE1E71DBC9D0B58C89A6E7AD55 f0r7hrigh7ness
143,624,529 *0DCD7E4C4382D15D221A986105E25C36CB623CB8 fabianpersky
143,624,530 *0DC72EEEBC7CEE99819167B61C205DC76D4EC2A3 [email protected]
143,624,531 *0DCBEFD36D7D96921DD4D6186E28C3D3BCEBE91B kylederenthal
143,624,532 *0DCAEDF528D95FBA88BCD37FAA04EC1540B025B6 [email protected]
143,624,533 *0DC60DE9FC7BDF5D3FA7FBB473FCE760F15905B5 [email protected]
143,624,534 *0DC35ED88712A0363E7258FBFC7A1D1ACBC76EC4 fashionable.'f/&//s//@/n/@/b/@/l
143,624,535 *0DCB5491A3575B1DBA8B2176CB6611D204AC247C faudit10a
143,624,536 *0DC3F3E2605C944850F0A87FBE9E3A64B9110DB0 l4i4s4b4e4t4h4
143,624,537 *0DC8263184C0700857F2D33086DFEC613954A7B1 LACIHPARGORETP
143,624,538 *0DC4047363CFB2CAAAA3D033B9AD331F90BA568A lamont-sconiers
143,624,539 *0DCEC595F4B8A040A278FF6ABA8CE8A58DD3CCED LANDENPARKER
143,624,540 *0DC21255BD323CFDCCC0BB5179E2C27829B03E69 landongeisinsky
143,624,541 *0DC3A91BF42A39DC64E898DB07A8FB9A3275BB7D Landschaft-mit-entfernten-Verwandten,-Part-Two:-La-fronde
143,624,542 *0DC7CACD6193148DAF0376FCCDC0CC9EE4242E4F LANIMONIZ
143,624,543 *0DC2E94C5AA7A8B996966EE0B1E8C92EDE78C9F1 FEROOJN
143,624,544 *0DCB6CD2762C9663109F0FFB6E95C9605F57B271 lassurec
143,624,545 *0DCDE89C0763117A99704CCF7358CE4E330C4C90 FGASMENA
143,624,546 *0DC577E7E48E82EFB165378B17C64BDD3EBF32D6 laura-hatter
143,624,547 *0DCD025F970536E6CCC868239F542DB8F0F990B7 fichuutje
143,624,548 *0DCA3F4A994CAC90F6AFA11BD1129E45973C30C8 fidelio:.er.sterbe!.doch.er.soll.erst.wissen...
143,624,549 *0DCCE52C5D55404D582E7BB0AC2136B0416B9D84 filippas8
143,624,550 *0DCC762694608B7EFD3088AF8B3FF5577F625FDB fishingscotty
143,624,551 *0DC57FE24CBEB80F77BED5E708C6A4D75F0FCAED FIXURE0
143,624,552 *0DCEC79486908DF1E35F5501E8270E0154718687 flavusbelisarius
143,624,553 *0DC41613A0D4356B3A009AF8BE590F2747BA6621 [email protected]
143,624,554 *0DCE964518CFD529633DDEC02FD7CC97999A6F83 FM980MHZ
143,624,555 *0DC2CF776EE90CB5D15441DE47A9E26E1D5CC55F LaVied'unhomme
143,624,556 *0DCDEC2FCED9122FB900B3CA263E6EEAD54C30C4 «FORSPEL
143,624,557 *0DC7D0C5E8F0D3230986EAAA9DCAB77CB37AA070 LAWTALK
143,624,558 *0DC610E4910E11649CF8F7CF1E0B79F34AF4D2B3 lcduwtr4
143,624,559 *0DC6F0181DDAD88520581AAB615274EF16D57113 LEANNE-PRITCHARD
143,624,560 *0DC5799ECEA0A688BAC0DD03A584D5AE63701447 LECTISTE
143,624,561 *0DC427F22B857E5153B21E96480A41A6BDE14C8F LEEASHDOWN
143,624,562 *0DCDCB0ABF45B67E6777640F9DCE3D8F901DAAE1 lemueldelanoy
143,624,563 *0DC909BC14E25EF15C96792AC61A7289C0D2A5A8 FREDERIC.WADKINS
143,624,564 *0DC310475C9D9F292A1504764CF84A4B0424C7BF FROGMISSY5
143,624,565 *0DCA0E4AD1D8BCFE2714A0186D69E1794A7720BA FUCKSC
143,624,566 *0DCB283272EA6B737A0D77E842359C969107BA02 [email protected]
143,624,567 *0DC516962138B38A637DFB88887C29FE1F858E69 GANGRENEES
143,624,568 *0DC184B1E136D18E18BD10828F7DAC521063BE9E leslieperiera
143,624,569 *0DC23A838D4640FF53BD3AED0AAAF935A14DB388 [email protected]
143,624,570 *0DCD207819827F7819DC1C1D11BA3DB6704E7E9C LESTER.ADELMANN
143,624,571 *0DC4404795894D0C028125EB820449AF36A17B1E GARTH.GEORGIS
143,624,572 *0DC92680AD5D7BD62D0B75C856331BA3B67CA76D GARTHHEFFERAN
143,624,573 *0DC819C7F32134C605D05A6839BFA80B4110045A garymayhugh
143,624,574 *0DCD75DD848852BE1D65E2302EC99DAC82A7F844 [email protected]
143,624,575 *0DCA0639481C70D54AEFEC25702A19F49FA56B4A gaylordciraulo
143,624,576 *0DC539AD85E42CB2F91B58AA0AAAA2F1A8C6FB51 LINCOLNCUSHING
143,624,577 *0DC831CC7834FAE268D4FEF571FE04036FDA5A1B GEORGEANNE
143,624,578 *0DC58D6EF197D52850D320C272CC574FFDA798F0 gergulas3
143,624,579 *0DC97AC66C6FC4DB7D367D060A5EA646BB220605 [email protected]
143,624,580 *0DC6779225B41C79002BC5FC5991324AD02B7AE7 [email protected]
143,624,581 *0DCD1D025ED0A5768625FFFDE663687C2E8B02E2 [email protected]
143,624,582 *0DCEC1349445BAE356D22D3865837F850562A886 ghlruypl0
143,624,583 *0DCDCC70EA3331BAC845F49ECAAE9C3BEB62DE3D GI~F
143,624,584 *0DC966EFF866154B114C73BADD61C1F4691F904F GILBERTO.SOECHTING
143,624,585 *0DCD4D106A3F399DEA87D569AA4AD8E00FA4EF35 gilbertserret
143,624,586 *0DC2B7CB2A697A9E06E4E86853493D98248FBCF6 lkjhgfd248
143,624,587 *0DC1E92EA0308AD3C2AAA3B9315F195987A8658F gītāgovinda
143,624,588 *0DCACDCCB3088792528BA8F54EB1DB3C70BD9EF2 glass1376
143,624,589 *0DCCD787B915DE3ABF923C4576B802EB76912365 glennrudio
143,624,590 *0DC52431E220487C22CD1E5005FC9B616A2E389B GLENWARINER
143,624,591 *0DC31522389A970698459D43E278EED6293A1310 [email protected]
143,624,592 *0DCAF46BD3D444C6125EF57BA02E21E27CE896B7 logan524
143,624,593 *0DC62980048065E309455074BD2E466CCCFECF05 LON.DEMRO
143,624,594 *0DCC08B932622C9192813628E884356671079B7B LONDIGGES
143,624,595 *0DC6B8C72389FB7406808E01E7BF2FDB4BEE0AD6 LOST-LUGGAGE-(INSTRUMENTAL)
143,624,596 *0DC1986AE2EA311C56E7FFB7F4CCC3070E15EF4E GOLFERSKIING
143,624,597 *0DCF14A67C0A686C0DE699A45345105D45FF042C golfmajor
143,624,598 *0DC820412C95ECF317CAB45D53911FEC3474A4C5 GONZALOPARENTS
143,624,599 *0DCC974D4154786F5A0F6AD81743E1A1105A2D71 GOTTA-MAKE-IT
143,624,600 *0DCC1313AB67ADEFDD0A42A92B9247F77764F82E L:(T
143,624,601 *0DC2E8BC7389FD67B947E2AA3C977CEE4C5E5C78 L#TI
143,624,602 *0DC43BF76BDEE152E233CBB67418D8CEAD6972CE LUCIUS.ARENAS
143,624,603 *0DCF5C75402A6C32D909E71D6B48015A2360C549 granvillestonesifer
143,624,604 *0DCA34AD2C0F69FB9149F3B9BE555DCC9A3E7B68 [email protected]
143,624,605 *0DC125170FBDF3039BBBA11E5159676F025A886E GTGGCGGCACCAGCGTCCACATCGCGGCCAGGATGTTGTAGCACTTGGCTTTGGAGCCAA
143,624,606 *0DCF6BA2AB1CA2574818B713BAA26853C1145A23 [email protected]
143,624,607 *0DCE5E751F9652EB903024287CFCBE8FEA456428 m;>a
143,624,608 *0DC5854145E5A9F32A15D5D83E29A5DEC1E0EB99 Ma5+ca+on5
143,624,609 *0DCEB62F86C9B3D9471F7F92E1F42CAEF6CCE5CC ma9net1zer$
143,624,610 *0DC15D210B63E6FA8DF8510233479CCC8EB998B3 gueriraed
143,624,611 *0DC8122575012A1B56FD9D32A5336B3BCD865386 GUITAR ESSENTIALS: POWER CHORDS (BT)
143,624,612 *0DC8CDB1CABD8924ECE228C242BBCAA74303F808 MAJEDKHALDI
143,624,613 *0DC598F1D33AA0A330FB9F8BEE5D82DCE9897697 MANDYMCCREADY
143,624,614 *0DCA055D7B903EC547AC98863CB11F7756F59E9C MARCEL.STROTH
143,624,615 *0DCE6640C33969734334DC24AE9DA856E401E2C2 MARC.LLOID
143,624,616 *0DC16E11350CD4102A91F981DA3B13FB966A814F MARIJANOVA
143,624,617 *0DC6B92212E2754AAE47D04AB552487076EEF9C1 HAEVARIM
143,624,618 *0DC90154AABA6A1ADE93E41CD7ACF8F1B2F6F217 haho-1
143,624,619 *0DCC4816D0D8E118CD0562A9834F5137C3DC4404 hakusyuks
143,624,620 *0DC8ED3A246BE284FD337A3E0E9FCC0B253BCDEB HALLEYROBERTS
143,624,621 *0DCC315509A8025B9061410E0C9825E71C931A31 marquisamrich
143,624,622 *0DC1075B90E096B52429307EEF42FD9F0DF4FC9D handkoff
143,624,623 *0DCCD409C6A11E96EEA8C2C18E9AF23B2EDEBB98 marticce3
143,624,624 *0DC235930BC5948AA5C358911EB05429DA5AC64C [email protected]
143,624,625 *0DC4E4194CDC20B6D03B33556AA38B8AFC9A8E20 HARKINISHED
143,624,626 *0DC26237F5525F1B9E0A83C75FC88FC4AD0B2F71 hazirlamişken
143,624,627 *0DC12CB59C14623BCF81BCE27A760A674F03FEB9 [email protected]
143,624,628 *0DC7D768A8833E539BD0FC51CB16B138A927C187 helpstangerinestalk
143,624,629 *0DC2A8AD65AF9FC1550791EFB241B83436470527 mauriciodownie
143,624,630 *0DC6A5A188A2F2DCF48611904ACFF633B817B95A MCRCYTSS3
143,624,631 *0DC7CB7B181B36D9B0F88872339D6E234C5E9878 MENTUM0
143,624,632 *0DC5BACB9101CFD534AAD2AD20511957AC4E8843 MERRILLCALZONE
143,624,633 *0DC9F1C08E0F57689405EA1DF7AAF35677FD8D88 MESSIAH(HIGHLIGHTS)
143,624,634 *0DC29FF4C070992EDBB228435F9B4C05CB833072 metreos-logo
143,624,635 *0DC40695D9801106821131B0AFF742C698963BFF MICHAEL-FRIEDWALD
143,624,636 *0DCBD01D37BE0A13ED00CB62F4153286C3FCF9CB HI5PANI5T
143,624,637 *0DCD9F178C5B53F5B5DE8ED0FF3EAEC8A0C44C53 [email protected]
143,624,638 *0DC7C223844FF87F51EC1F8EECDB39F19B59772A HINTERM-BAAM,-VOR-DEM-BAAM
143,624,639 *0DC257D1291305E0567232400184DEA321FFDE0B mikekaul
143,624,640 *0DCD754BC0CDA2E20D83D600F664F7A0F06540CF MIKEL.LANTRIP
143,624,641 *0DC82533AF53E397EF2ECD033283A003155F6293 milandillworth
143,624,642 *0DC637B647D10ED7D3E5F97F837BF81B73E38A7A MILLARD.IZZARD
143,624,643 *0DCC34074808BA0AC9941F3437731B61F55655CD MINER
143,624,644 *0DC44193951C9A113698161E581C3FB8AB1B006B MINOU101192
143,624,645 *0DC58ACA65821F6F1E40472DB619400313A435C4 hjlpemenu8
143,624,646 *0DC0A0D97D1DA2C2445E77DFB7A2E8F3CC5CCEB3 MISHU-DAS
143,624,647 *0DC3F3D0EC16AEE59D49BD33B81668E149F1B9A0 MJSZ
143,624,648 *0DC8C790890CDBC57D0060F17115D659287C7C8C [email protected]
143,624,649 *0DC713AA75F5D6E354C6DB0D11F2DEF252E06BC1 [email protected]
143,624,650 *0DC7E512B7503993421C165EFF83FB0C9C1C611D hoe-dikwijls
143,624,651 *0DC901582FB97438AA1A1DF4A76F790C96542078 HOKYPOKY9
143,624,652 *0DCB738B7AE6E32F5CED4B815823EC35768B7879 mohd-wara
143,624,653 *0DC5997A1209C444078F5A7433657C4EB9B30C69 MOLLYSAID(ALT.VERSION)
143,624,654 *0DC495B4343C08C606E01B7FEB08F09533ABE29A homeward3
143,624,655 *0DCA78E49448A46BA10FC2A8C1E1F0410918FDF7 HOMOECIOUS2
143,624,656 *0DC6109FD8D724F4D3BBF4BBE319F57E2ADA13EE HOMOEOTELEUTONS123
143,624,657 *0DC9B117A206F9DF2B4C71001027655E67BC881E mondaysatthegate
143,624,658 *0DC35915752D6BCD2007803525F3F93A3F38A9C8 monirba
143,624,659 *0DC55A39AFFE7A7288DE3A2856E8C24433554970 honie25*
143,624,660 *0DC14FC0E5291C50E41851C473BD77B192F4C1FF MOONIGHT.IN.VERMONT
143,624,661 *0DCF4465C6395CAF373F9C1BC87501C637E64D72 HOSEPLACE
143,624,662 *0DC9118137CC0A47E99DD58543CAF85E91982FFC MORGAN1250
143,624,663 *0DCBCA883AA093B3CD823832DC70D3D70B45420B MORIAH563
143,624,664 *0DCF35FE39984678DF05285491D63E9D654849FD motionnerez1
143,624,665 *0DC6DF0793028C72DFF935B044398D8FC569F138 [email protected]
143,624,666 *0DC1D6C2923C6024CA12A9B19F80DD07D3D122F1 HOUSTON.MCCAUSLAND
143,624,667 *0DC60382B88F9AF905BDC2645953BCA943EBC281 MULTIHEARTH?
143,624,668 *0DC8BA5599DB1BED9804AAAA4B60D0FD6BFED6C1 MYATARI.NET
143,624,669 *0DCA56C15DB7EF6B4330092F71981915D000AAD2 HTTPWWW.INF.UNI-KONS
143,624,670 *0DCCFF2159092B68783193DE82FCA1E939C6D895 httpxmlapacheorgxa
143,624,671 *0DCC925DB1A95503E81CD37752A6520C7B0A0406 MYEXCALIBUR86
143,624,672 *0DC7990CF4160343D1B72C55319AB84383A75BC4 [email protected]#
143,624,673 *0DC1E9BEBCEC50C12686C5A772222F01C7F884C1 HUBSEILBAHN
143,624,674 *0DCDD1C7265CB13376C5943FA3DF12EDDC8A327C MYPARK33
143,624,675 *0DCFD99B3308B632095DEEE3708701B19833EB8E MYRA4ALL
143,624,676 *0DC5289E94F7648F3F97240079A29412F4531D79 N50251
143,624,677 *0DC2270A12573A27BE89E93FC353E89F80E39F78 N610C
143,624,678 *0DCFDB1B93D28D27A0237A906D51B3C6E56F2891 NAMGERB0
143,624,679 *0DC6A7B404AB24E64744DDEAF1E77B6AF33CF843 NAMSSEM
143,624,680 *0DCCC5C85D86595EB75056738E8BA20CF3927BC3 nawoluje0
143,624,681 *0DC693472E254FE659696C49BDD9538B22D214E6 NED.PELPHREY
143,624,682 *0DC282E2FD0BF710FF99EB204AA13C0DAA9A4768 NESTORMASCARENAS
143,624,683 *0DCA288B06A222E584E1CE026BC78FC0663E37BF NEVERED1
143,624,684 *0DC6AEA71E4D395600134D5698566762ABF3CD4B IAN.DACRE
143,624,685 *0DCEABDC37C757EA35E93A3D40AB4B8F0FB3F051 newboyonline
143,624,686 *0DC6E2ECAFC7481F10915A8E071533401C06597B ICKOFRANCISCO
143,624,687 *0DC608146A6EEA82BF052137D0436F390583CB7D ni</
143,624,688 *0DCF8FF09EAFFB69CF80CBDEA334594660DDBDFB ID="IMADV"><A
143,624,689 *0DCF541AD032A9E1ABA791E2F1AC37DF8ABF7973 IETRAPNU9
143,624,690 *0DCE4E9F93C774EFAA6042DD205F5DA2644A0FBF NICKPOINSETT
143,624,691 *0DC483ED23D13332FEEB65875B01E37387040391 NIDDOR
143,624,692 *0DC182011148414C970A4B50FF540E419206A5F2 nigelplatt
143,624,693 *0DCC9B92AF8C7A959E378B406B8B7E018707906F NILESHDABHI
143,624,694 *0DC827B39FBC92B98FD6FB7CD2A77A37F147D334 NITTTAKKIAKARAN
143,624,695 *0DCF11A29C4CD188C7278AF23425E1E5A7905AF9 ILDEOLJE1
143,624,696 *0DCF62572BC11B6B46E1554F292DD77AC22A671C ILLABSWS
143,624,697 *0DC78E287B925A2F2FF90C4F2E96AD0DBF96817E NMJYOTHI
143,624,698 *0DCA534D5CCB2070B4603660DD5B9B06F5D7DE5F NO.1.PURE.ALCOHOL
143,624,699 *0DC9AA1ECEF864CD707FAAE272A89DB7D805E3A5 ilovekim35
143,624,700 *0DCAF81F2FB30ADC14B9FC7268D67A24712D547F I-LOVE-KMART
143,624,701 *0DC0BB28C2506CE8EBD830E97AEB976CAE6FAEAA noncon79uou$
143,624,702 *0DC942D9B395ED0EAB70F76AC3AB277433D41B4D ILUVLAMER2000
143,624,703 *0DC4C137B6973F8D04A146DFEBA7A845D0168F1B INATSIOG8
143,624,704 *0DC66F126CBAE96273FF118F8F52189E39E63A11 NUAEWZE
143,624,705 *0DCBE1DE9E49EE7BA6A8797D02F674E0D25926EB nuestraestrategia
143,624,706 *0DC72739F5B79F05B0F0CD16C1830DE38978B53B NV+,
143,624,707 *0DCAF54AF3FA64E764542B5D4377822726262E3D [email protected]
143,624,708 *0DC946084C0E88DAA1CD219D8162CAE05951DDA8 odellmanago
143,624,709 *0DC4465A69B14B93D6BB9C696BB664B4832017FC OKOCDOR
143,624,710 *0DC1DB7C35E04999207B9ADB347A86B2530DC987 OLIVERSCHACHT
143,624,711 *0DC5600451257AC09816C18BD7BEA8943B519C8C INCIPIEN8
143,624,712 *0DC119DBA1B26B55C9B734E6670F6D9D8A1969AE instructies
143,624,713 *0DC310B207F151579DAAAF786F214BB15D2736A4 OMAR.REILL
143,624,714 *0DCB3809B0E55A55C843F11398E30F90D57552FF OMPHALOSSTUDIEN
143,624,715 *0DC31DAC2DA8A5DAE92914F216C9E781CCFA6D4C o-nago
143,624,716 *0DC53F8ECC1E7F270DF7D3DE516BD8646D6901BE ISOPLEUS
143,624,717 *0DCAD44BD04392FFD2FE852A25994D972CBE9E2D IVORY.KAMPER
143,624,718 *0DCBB3AAF9F47E580369B80672638D6D17DF7B4D OTHER.SIDE.OF.THE.TRACKS
143,624,719 *0DCD941221C08D60714284CD9C1FE42161B05821 JACKSON.ARNITZ
143,624,720 *0DCD0240F759FD88CDB27717A792E635F604B850 OWEN.STIKELEATHER
143,624,721 *0DCAED37EAAD473AFA11522E4F2449E6403FD2CB OW,T
143,624,722 *0DC165EFDF969F101F2C7191817DC3E2C306B93C jacobmcfarlain
143,624,723 *0DC929204E404D250EAA3D98AFF5BDD2C0621A54 (>_<).~.`.<######P
143,624,724 *0DC7462A5B7101AA08048C9D5176E77B4917D6E6 [email protected]~0~o}o{
143,624,725 *0DCCF5A0A81369C3A377B5F7EE9AC2A9BE7EF5BF [email protected]
143,624,726 *0DC4009C6EC67895324C3908A7C6F69120878B81 p14coid
143,624,727 *0DCF6F384D54954BBF77C827374EDA23ED003091 pafc123#
143,624,728 *0DC84E181F22002CD3AEDEB3A62FFAF41A9ED5C6 panayotou6
143,624,729 *0DC3481D7D4D1D060C86E122DD5BE66E30F8D266 JARED COLLINGS
143,624,730 *0DC237A835BB3E0629C0CB9064338280D2EE2B9E JARED HASE
143,624,731 *0DCBD300B005D0B8D5E3B100A862672182CFE208 JARRED.LAUSTER
143,624,732 *0DC2D5DA3288ABB9B6DAF2A38F72E6F8FA99027F JARROD.BIGNESS
143,624,733 *0DCE292A3AACDB54BEF8C97C121DC7EDB7595A76 JAY TUNE
143,624,734 *0DC281B2B466318A5A1C4A1316AABEF8AFD51484 PARKERCAHOON
143,624,735 *0DCEFE91E62CB6B690588BD10064F891CB242B2F JEFFEREE6
143,624,736 *0DC75E299936BE9104D577FF6239E8C7C344A7F9 passwdalexande
143,624,737 *0DC12F00BE35474DCE70E2EA7FD080D3A81197A2 JEFF.WILDSMITH
143,624,738 *0DC99BA08920DEA0F0CABA508DB3F0C3C7CF1BDA JENI.F.
143,624,739 *0DCB63D391A434E9CED8C13525B4B6AC6F1C1BDA patsalos2
143,624,740 *0DCEB1237AD0CE4F5040AD37D6AEC79777747FA2 JENNIFER.EUBANKS
143,624,741 *0DC523F335A1FD897459DFC6C4CD8499A915B878 pattymcneillbaker
143,624,742 *0DCB687938CA1F4383F6C1C8656BF4264C373551 JERAMY.PERFECT
143,624,743 *0DC57E961DC19AB60B49F1F422506B41D6F4AA72 [email protected]
143,624,744 *0DCDE55A146FCA589B40BF4C80B6BEAECD4800DD P##B ~0~O SPLAT
143,624,745 *0DCE98305F9D70646EF5F5DBBBC3C2A340C4939B JEROMYHERANDEZ
143,624,746 *0DC09302BC57379B4B0E6EB41720DFAE43903A41 jerry.kuhl
143,624,747 *0DC5175CE91554CFB74CE6747ADC0BA3304FAA48 JF3FI1
143,624,748 *0DC39920636BE6585C0C61C6E669434061B8C24F jhhaoyzbk0
143,624,749 *0DCEE658F6D63EED98861482D572E1E08416E27F PERIMTER9
143,624,750 *0DCC2E8B6EF4C3F680C9AACAC1049C622AED1DAE PERRY HINTON
143,624,751 *0DC2629658300545D99764CF54EB6AA4BC60AA61 PERSORO01
143,624,752 *0DC25CE36EBDEA6DE9AA12673D160411FAEA35DF pesulayrityksess
143,624,753 *0DC5242EECD79659D46135E451D99D901AE6F039 PETESOMALSKI
143,624,754 *0DCC641EDF582ADD01A3F87988397E4F09609C46 [email protected]
143,624,755 *0DCD17EF1A6B31481CBAD1338F8629B0E973BCEA pgryphon7
143,624,756 *0DC10F4FA57C158F61A1A9F2D0A5253250D8962D [email protected]
143,624,757 *0DCF9B5C7BF17D5F0C4E8E0BC41604081D556584 PHIL-ROUGHSEDGE
143,624,758 *0DCCE4A5B40D6C494E06A95E350B84076E1F1452 joeleyland
143,624,759 *0DC6F81C3B04E49AE98E248717187926127FD02D PIERREKUPSTAS
143,624,760 *0DC236BABC5BBE13CCC0A610D6C7C9203B1180A0 PIGMENT(PIGMENT)
143,624,761 *0DC9DE6092600185292E586480294A17BD95C9F4 JONAS.POLLNOW
143,624,762 *0DC949B610C2237BD867E4E0EFD1CD47F729A88D JONATHONTOROMANIDES
143,624,763 *0DC288C2344A64686BEE8EF007505EF4A35B287B JORDANSTENSON
143,624,764 *0DC448F82887F55F053E03E245DB695CCE734F1E P-->~ ~ ~}O{
143,624,765 *0DCB5B65BF618CC49F367FC897C406910326D968 POLICI
143,624,766 *0DC39EFF94BD54ABA7DE073DA8DCD176EAC2160D JOSEPHINE-PINSON
143,624,767 *0DCF1E832CAF3F3DBC93C898642C24707304E955 P###@~O}O{
143,624,768 *0DC6864DD7655E812CEED8E87861A0EE463889BC JOSUENISSILA
143,624,769 *0DC43BA529F25B4C64CD884F0B926872A5ECC8EF (JR貨物)所属車には延命のための更新工事が実施されるなど、本形式は当面継続して使用される見通しである。
143,624,770 *0DCD7EAAEE24D91BD1A5285953B88F4CD745D458 POX, LEAVE THY DAMNABLE FACES, AND BEGIN COME:
143,624,771 *0DCC2898FA8D06E114B6CC6C3C53599111B5B375 pp~0splat
143,624,772 *0DC26B097DCFA0E8CACD4B30E3DA6C5010B991A1 JUHHODÁLY
143,624,773 *0DC0D54B53C13BF561299BA0395C5B12BF4EA541 JULIAN.LOFFLER
143,624,774 *0DCD0626C0EE178A7814981AA3F2E01EB69DF9C8 prapuurane
143,624,775 *0DC3D1C52E62B1302B2D175A8CDF3013C45A819D JULIEKONKLE
143,624,776 *0DC1EEE3266D169DCA8AA210F498D4D5DA22AFB5 juliuschaffin
143,624,777 *0DC6435F5740E1B63C2A84EEE67213B5F6128D47 JULIUS.EHRHART
143,624,778 *0DCF0C4E1808B9FB6A06734E2EE009B4300F3088 [email protected]$
143,624,779 *0DCDDCAF3476B6FD74F75C16DDACBB48F175CEED PRIPOZNAVO
143,624,780 *0DC6DA6E6C9FCCD148B6C942428ED039257B3EBF K?|{
143,624,781 *0DCCEDFECED0F520FD19040D25BFB347A604C61B K3FX
143,624,782 *0DC35D7FF9C8EA89C96A3764A3A9F48F98620D73 PROGRAMMABLES9
143,624,783 *0DC9F5F6DA42F47E2EF53C09A0C1DA49147C5D47 PROUST10
143,624,784 *0DC6AC2DB3A620C41224CAA381F40D2FD0E3FA3E przedr
143,624,785 *0DC8FBF4B1DD397F7C0FCF313DF526ADA2D9DFAC PULCHRITUDINOUS-,P/@/LKR/I/'T/U/D/-/N_/@/S
143,624,786 *0DCB14AA1DB52818B571D82742197D853EB48D06 KAROL.LARREA
143,624,787 *0DCC98597074A1BF6E5E1B08E277A6D1D6678586 Q=====>~~(^_~)
143,624,788 *0DCA365AF94C25E4BB07A9FF8595A199C899C441 kat2199837
143,624,789 *0DC754ABD5DD7D6B422620D8283ED5DCC7E61250 katamarous
143,624,790 *0DC5102A2E0783D6F5ACA41D901DBA4903742D1B QETUPOIU
143,624,791 *0DC3D3D1460DAA2169461F9BFA2AB848FF173308 [email protected]
143,624,792 *0DC5FF7D16DE2DCFA6E3394C817222472F053BCA qIo
143,624,793 *0DC433CA63849B359AD52ED7F09DF03545CB1F43 q)~o~o)0(
143,624,794 *0DCFBED501D1EA82E3AB603DE13BF2F8D9305106 q=p*-*-*Splat!!
143,624,795 *0DCC0DFB204054F10E73464AD8CCACC5143DA3A3 QUEENSBIRTHDAYHONOURSLISTOBE
143,624,796 *0DCC36FD739F02B832A5738F4120009A5265A93A [email protected]
143,624,797 *0DC9C171E1C817888231A4FB2834817B335A5CC7 q=)`~`~)x(
143,624,798 *0DCFC119F182BC3C67DB46C1F49DF46C9F34D40E KEVINDEROSA
143,624,799 *0DC062A05F9D7025E2B3BB440BAA84A5D2AFD80F KEVINFAVARO
143,624,800 *0DC9F6BB1EF965AA3166605AE2FC8D3B7948D36D kieledonne
143,624,801 *0DCA343567313317C5CFAB99A172BA08031A0086 raïkine
143,624,802 *0DCF7E20711A3E47F859E631AA5379528A40D803 kiethganfield
143,624,803 *0DC09FF59C181F5DDE2D1312853EE903BE49C1DD KillYourRadio
143,624,804 *0DC3618BDDA2854F5BBCD70302FC8E1889DF3060 kimberly-desiree
143,624,805 *0DC77DC7A602CC5900D3EB0B4270D867470021D5 KIMSEY.10.0
143,624,806 *0DC31876BCCE67D7DC85EFCB028FD118D4FED8A0 KIRCHENRECHTÖZ
143,624,807 *0DC5EB3F660B775249C48499CC9048C31F94676A randyvital
143,624,808 *0DC16354F24F16EB4BD9891EEB0828FF1ED6636A RAPHAELABRAMOV
143,624,809 *0DCD4C8B42D9F1FD62933AF599A40A34FCCC20A2 rapier-thrust
143,624,810 *0DCCAC934D0DED61E9950A75B7B2EE1F84298064 RASPAVANO.
143,624,811 *0DCC7C73538FD99123CA75902C15FC094C693C62 rasps
143,624,812 *0DC8738836667BD13B4333C7DE076C20AA1B3225 kleamtel0
143,624,813 *0DC8B817AAF44A80DDE4EF2B53DEF7E898EF86DF kokuritsu-kyogijo
143,624,814 *0DC321D0FD8C142DE2029DAE7F14B92BC665D47C KOMACREWCOM
143,624,815 *0DC6C1399EEDBEFB99642822CF064163828C046B KOMMANDERES0
143,624,816 *0DC8F2AA04BE7C0A5B36851C68F77E15FF28399B KORY.BYLER
143,624,817 *0DCD2576F68FFA55063A6CE6B3BC77EC4A33767C KOTJINDOITJI
143,624,818 *0DC7F9C7CEA71D578743B8BCBCC0AC9E88078DC4 KQRDTBL0
143,624,819 *0DC50219533683CD2FDED76435EA4DEF37C9F790 kraiggionfriddo
143,624,820 *0DCB1DA66AF68FC348346C133039953CF2D23CBC reference-parpola
143,624,821 *0DCB34415DAE07402F45F87BA83EE44C1F645F2A reginald2000
143,624,822 *0DC14BF06BB467AE2EFF3C2C6919A1DA10462F11 reginalddock
143,624,823 *0DC56DE261612FC5534B286999B4796518867965 RELSESPLIGTERNING
143,624,824 *0DC361DAE5C9C04AD792C7DAC90989C64B8C18C0 rememberw
143,624,825 *0DCD15E67F6D5E751417A428AEADB20AF0B288CB RENE.MCWHINNIE
143,624,826 *0DCB0486C5C779F7B56975C3071C3E4CFF9C0E26 reniser5
143,624,827 *0DCAF4103E46E50451952FF11DBDB24671808444 KRISTINE VERSOLA
143,624,828 *0DC585C388DE807D27CAA808999097B3B291942E requiem, op. 9: viii. libera me
143,624,829 *0DCE96A8A57E9C7E6E797F765160A4A6ACD3E71C re-resurveyed
143,624,830 *0DCC77468105B65484BFE816F6059B1FA7E7E542 RETNIAPLIHP
143,624,831 *0DC51F08FEF9F1CE03C8C3BADFF2B16A67D850AC KUMSHANGAA
143,624,832 *0DC21D8B38E47BA800E1D333ADEBD78D9BA957E6 REUPPOFFRAEN9
143,624,833 *0DCDD44BAE6FC37A9EB30A3852652959E859622E revarnishing2
143,624,834 *0DC9DEAEBA6EF94516A158FA4F19FD5A111B71B1 KXXTLPH0
143,624,835 *0DCC30D827CFA1B83E2EA8DE04BF6EB3CBF0B107 kylearredondo
143,624,836 *0DC8BF7660ECE63D3C9F75A23084E5616A5DA04E kyuusaim9
143,624,837 *0DCFDBA48C5712CB20DADCD15E618574628187D6 L154559
143,624,838 *0DC9FBA4F9891AD15359336C5E55B692EFF83412 l1gatur3$
143,624,839 *0DCCC3017F18AB033EA58425A340C9BA0C86E624 REYNALDO.HERREL
143,624,840 *0DCCA6BE5B6D955009EC66BD72C1147B6987F770 LADONNAH2
143,624,841 *0DCD06A1B76E8250DB17017DB25AF74FF7D39238 LAGRANGIANHISTORY
143,624,842 *0DC16699C737B1D0703E2F17C7E5A62806C161DA [email protected]
143,624,843 *0DCEAC6C7F79064548CB7CF7B2F1BAE390CB8FBA LAMPREYS
143,624,844 *0DC4CDDDA5A0648E05373E681DC09BC0C832D27C RHUBR
143,624,845 *0DC9440B10D396440D01DC9130F84253146B1E18 richardmarr
143,624,846 *0DC3DD580D153D1B63E4E7FFA5466FA19759E734 RICHARDREICK
143,624,847 *0DC5477CA9D2FF431325A16F2C20CD2176835BEF [email protected]
143,624,848 *0DCFBE19C7F4E75E4BE62E9D03B9782EE031CD62 rmgfikx8jvm5d
143,624,849 *0DC65491817D0689F45E22F56473B13CD8FBE17B robbylacosse
143,624,850 *0DC21396162E4ED0808C3C680E60C2B1239BC99B ROBERTFREMMING
143,624,851 *0DCF7F375698059B0CE5AE5BD9CD746F14923B89 ROBJANOWSKI
143,624,852 *0DC13F3AAB4D6691172AE9CC06DCE909F2029EE1 LATCHUPSES
143,624,853 *0DC85BB5773536F25A31289EFC781CB64B362051 laverngalluccio
143,624,854 *0DC115467418B699574D82B24C55DF4425D68826 LAVERONA
143,624,855 *0DC41154DA61F31038242AC3154AAADE15B6D873 ronnyficklin
143,624,856 *0DCF8EE79BBB5E46D50E0F4F5606F2770A60ADEF RORY.VERONE
143,624,857 *0DCF80FB47876BAC7E3AB506590CEF5620A17FF1 ROSSMACLAREN
143,624,858 *0DC92BB93EADC3E18EFF5222E140295454583147 lehongquang
143,624,859 *0DC85B2362F650149926BEB6C9DA699AF61B08E4 rowdy-n:-rowdies
143,624,860 *0DC1718E6FAEF71829D139939D3C5B5A12556E19 royalcoco
143,624,861 *0DCE2602AC7A9C2F0DAE449DF0FE61F9D7EE5640 RTNZTNS1
143,624,862 *0DCECF0E594CE3E4D01189DCF21B6E7ED9431276 rubingagney
143,624,863 *0DCF82F40FCC4C4F914A1F2539E10B7648DA137F rudy.roberto
143,624,864 *0DC4498DE926535DD9222946FD005045DF5DC274 RULEROFTHENOTHERNSPHERE
143,624,865 *0DC27D853BFD0B55FB9B0EB23F8AC1028D065081 RUMSTEKO0
143,624,866 *0DCB408F26549F30D1D074A64B029061D772D1CC lessigwart
143,624,867 *0DC639638D125F3968224649A83BEF843D67F1D3 levikujala
143,624,868 *0DCE9544514A33D374E6609A439C820903558169 levineditorial
143,624,869 *0DCAEEDC968C7627EABC21D37425DC382769DCF8 LEVI.SHIBATA
143,624,870 *0DCB8B34109B57075C42C517B588FDAAA3220D82 lez“
143,624,871 *0DCFE43236E332D5C5D6A6A360EE9256A8BCA39A LGUNATILLAKE
143,624,872 *0DC4E930FD68927BE19570FEEC4BA12236DBF317 SAILINGBUBBLES7
143,624,873 *0DCD2C93AEE59B81162597A87D82BAAE8739F2FC salvatoredolhun
143,624,874 *0DCFD8A500AFCF636FAFAD2C91284763786988FA sand-gun-(feat.-dom)
143,624,875 *0DC1EBD4DE0DD9594C40EF7AD26A833F4AF7067A SANDRA HALVARSSON
143,624,876 *0DC2E730BA032D946145207DB55C6F2EFFBE0FBB SANDY.WOLFENSPERGER
143,624,877 *0DC2CC0BF3A2826FDBE30C9B04514ECD4193EB48 SANIYAH257
143,624,878 *0DC9064B7A88501552EF24D75E71E4185A76E9E7 SANTIAGO.GERBIG
143,624,879 *0DCCA191C163D97C4D19527D8C163F50C0E71E33 SAPPHICS
143,624,880 *0DC5D0BD32ADC16E5B21EAFD113E6BDCCFD03194 SAVAGETREBORED
143,624,881 *0DC97F3219E2E3A6DB09C97793AC4075CF023BFA scappler4
143,624,882 *0DC11BFD2819C7719D5BF9AA561B8ED299DB4459 schelmerij2
143,624,883 *0DC124E2A2BD58F7BEA3474A42BCA999E9EE1DFD [email protected]
143,624,884 *0DC5E6D3A410801EABA1A0A5C340689CFF88C96F schweinefleischstücken
143,624,885 *0DC35F55EB0104C03206A10E81B4FE9D937D4C78 SCREAMSQ
143,624,886 *0DCA9F06FA40DC2C83319046DC5673CCF4E35ACA SCUFFS7
143,624,887 *0DC72147584FB2F3522A27EAD3B54A1D4603144F SEACHED6
143,624,888 *0DCB33D1A021BBD2CBA0CB5C6F2018E365D07C53 SECEIPDLEIVES
143,624,889 *0DCD8D16878EAF38BD4836ABC01C9F5FAB4A93AE SEDOV
143,624,890 *0DC074910AE1571573FC8ECEBF2313FDF8FFE25C seguiste1
143,624,891 *0DC2AF78974EB7B039CC56E35B55E833775B6806 [email protected]
143,624,892 *0DC9445BBD76D72B504ECC5F46E276590B0AA081 LIZTHURSTON
143,624,893 *0DC4DE6E56B5E31CA029B673DB5B0947B956F266 LJ"8
143,624,894 *0DC486769EAE4B03BC4D8AF8510C80F626ED4F36 SENGRENERSES
143,624,895 *0DC4E1DC22E803306916087A92C502BCB85B427D septetine-flatmajor,op.20:iii.tempodimenuetto
143,624,896 *0DC7DE9C339B0D2D371173AF35EA45FF2FD98AE1 SESLICEC
143,624,897 *0DCA2A30106E99660FCB7441610BC2590CFC1C6A setonfire,inflame
143,624,898 *0DCEEA94790A074D0F6297C44C74C95BA670424E sevenyellowgypsies
143,624,899 *0DC1A8DCD31E6CA39DA3B84C191FC2A05DB276C8 SEXYPICARDS
143,624,900 *0DCE9A77DBF0D88C5E545084FEBF5A19B1365D83 lmy$
143,624,901 *0DC3CC04A85200423AC5872342FF17C5F93C86EC SGAGYLLOL
143,624,902 *0DC1C96675A2083341CAEE6EB6E34D275FFCB499 [email protected]
143,624,903 *0DC6D3A420B31B99F5EEE541D29479ECFFE84473 SGUAIATA
143,624,904 *0DC6234726708FA8131FAB9D3BA81B0E5ED79225 shaharsilko
143,624,905 *0DC8A0703B84A486021F2DDDD1F7EF4F42349FF5 shakespeare: the word and the action (disc 3)
143,624,906 *0DCCEC062E7163D1ABF870CD335450AF974C5CD3 LON.FINNILA
143,624,907 *0DC70DF7250A5257EBD539AE617441D68657ABB8 lonnyporzio
143,624,908 *0DC67E6762AFF9C01542B6795231FA0370F1EE82 looseleaf86
143,624,909 *0DC818E481B7DDD9D5A186B83069331EEB791B91 ŁOPATOLOGICZNYCH
143,624,910 *0DC2BBF1863A4EC580736D47F196E8F624E00C4B SHAUN.DUPLESSY
143,624,911 *0DC59CD3395A9B0253357E88E3FB5FA98F80CFE2 SHAWNAYCOCK
143,624,912 *0DC532C980391EED26597CD7B72CA370EE034FD1 sheilamckillop
143,624,913 *0DC4D105E5BD5FB87021728B4287F91945BC0A24 LOUSYCLOWN
143,624,914 *0DC8CE37C4779A581CA712B78309106400644DE9 Love,-Peace-&-Poetry:-Mexican-Psychedelic-Music
143,624,915 *0DCD003ED7BB65A84FAC60618C8AAA47FFC153AD LOVERHYMES
143,624,916 *0DC95FA7BBAA6C4CB8A1953E7A3F12D8FB5D5DFE shondsouza
143,624,917 *0DC78EFB95AFF138C006DE8AAA962830CB2A6901 lthuana
143,624,918 *0DC9DE1C647E3274431873BE0A81F3EFF62433B5 LUCIUS.SCREEN
143,624,919 *0DC7542A321C1F273418EF211347D92FF4286827 LUGGIES
143,624,920 *0DC0626D2C64E268FB945B502FAB081A23309387 SIDNEYLOVELY5
143,624,921 *0DC3937A80E0D3BADEA9747C96010D6AD1813D05 SIENNA:.WELCOME.TO.THIS.NEW.WORLD
143,624,922 *0DCC88A04D5C877633311689DCECE498586D7B11 SIGAREN?
143,624,923 *0DCD15174589B32D5CAEF88F8A0EDB8CEE70A6D7 SILUPEZC
143,624,924 *0DCC962D2FE7EBE6B83743CDFB411B1BD65B25E0 SIMFONIJABR41UCDURU(KV551)('JUPITER'),FINALEMOLTOALLEGRO
143,624,925 *0DC6B6533714973060ABA02C877A1AD3D0AC0C11 simonkumm
143,624,926 *0DC355283B4FF94AD6E1EF15DB42ED98D85E63A4 SIS{TAUTIOSASTOILLA
143,624,927 *0DC925395BA11C9E848C57F2C992EC9EC94C68D1 skaparate.nacional
143,624,928 *0DC4A998B6EE8EBF1D94BE6660046FB605900CCE LYNDONLAMPING
143,624,929 *0DC1FDDCE2C0747DC286905513F159AC0C78D5F6 LYNDONNAHMIAS
143,624,930 *0DCC46ECDF46D70B6B18EE2BD3C13DFE819CBDD2 SLNGBRNDSPTING
143,624,931 *0DC51E9C77FF854025C05DF7A205E1234038DB04 [email protected]
143,624,932 *0DC26B37ACD3412CCE98305A4D547C0DF316A604 [email protected]
143,624,933 *0DCBA5338A19417363C611C78EDD3A9FACFEDAF1 SODIGNAR
143,624,934 *0DC9432FBFCB08F4763290535B17FFB964FCDD07 som012
143,624,935 *0DCCD770F3DF5EAC4B657352C8716E2E96367940 sombra13
143,624,936 *0DCA760134AE6BDE5BA7392A8D08A354B9BD54E9 SONATANO.1INSOLMINOREBWV1001:IV.PRESTO
143,624,937 *0DCC643F57B189910D6F588E22A8AD11E2C2A00B [email protected]
143,624,938 *0DCDEF3CE4CE8E299A952CE0E98E67BF5FA99F3E mancode
143,624,939 *0DC9265945515BEDD074469B80A2A7493BAFFED9 sonia1922
143,624,940 *0DC71473A208DE9E3B5660DC42D7F3C2E03092A4 man-ganu
143,624,941 *0DCD79595EF2A8C4863DF50388B609A7590E86BB SONNYINNES
143,624,942 *0DC92E6751858F74545F5294BC1DB1F82CFF237B SONNY.MATTLIN
143,624,943 *0DC2E9D4128F3743C72FFA78CDBD008B4273C5C5 Sonria,porfavor
143,624,944 *0DC7BCD5D9FAA4356971446CB1945224F07D0EF9 maoxuewang
143,624,945 *0DC563FF6BF1E0C2C5EC9FFB43537B9BBF05EB5E MARCELLUS.CLOUGHER
143,624,946 *0DC869D552E6E4DA01828E576F8302133300E5FC SPANHISH
143,624,947 *0DC559BECA301EE626A89ECB8363C3BF52680434 MARCODENTEL
143,624,948 *0DC15898A136F71712BE1E60F75A14D50B3A3615 splat!-~-~-~d#####p
143,624,949 *0DC88281AC3C7A9BBA304DF9A59FEE4B9857A3C2 splato~0~ (--b
143,624,950 *0DC288C2A2ECAAD661081BF8A4151033391D8C4D SPLAT O~D-P
143,624,951 *0DCE4766E40CB3EC637AD292829B551E42E561D4 maria.sevillano
143,624,952 *0DCDB69F209975BA6EB4FF92A22CAB269CCD105A SPOMPARSI4
143,624,953 *0DC087F23BFC88D5131AA9205E91140C96703F3F MARSTOKK5
143,624,954 *0DC5825F3A80C977AC043B89368F8D4A66BA9BE1 SQUIRTOXFORD5
143,624,955 *0DC19B7CBE3E968A4687616BA0ED457F6B0419A5 src="http//ecximagesamazoncom/images/I/21prtl4LmWL_AA115_jpg
143,624,956 *0DCEE74F68235BADF71F54CCE49F314D87456069 sri ganapaty naemaevali
143,624,957 *0DCD588FE87CE1813094E88B7C87E4D3EBDE2915 MATERIAALOMSCHRIJVING
143,624,958 *0DC9D2B2D52830E3FF2EA6C50791A577AC909E5C s-sit
143,624,959 *0DC604F9AD76F829B155988C42AB32F02E2E7CE6 SSSSSSRUX
143,624,960 *0DCD921C9E790301D52B8098B3DEC76CB22D7150 MATTEICHELE
143,624,961 *0DCABC11CEFBF89A72D97675A104DD776D0CA3A2 stanfordaguire
143,624,962 *0DCCA0F0852E22694F62B54A8BD4A194AF5F0799 mattpederzani
143,624,963 *0DC7D07B9D1CAB1B603481EFC24DFE42EE0CA3F7 MAURO.MUNIER
143,624,964 *0DCFD168224D13C24627CE9006E14248A50127FE MC5M31
143,624,965 *0DCB204139FB2A5F012253F1C18D9A688D4C0375 stefanfrye
143,624,966 *0DC135BB7947EB3AA6BE7B20AE54176F892782EC STEPHAN.CULNANE
143,624,967 *0DC99500DF0333A2BBF95C48C4E5D2666137BD64 stephaniethistle
143,624,968 *0DC547A77535C0B21D1F316AC9FDCD362A17FB42 STEPS-WITHOUT-USING-A-CD
143,624,969 *0DCE61FAD7309B7B124504EC7A74B4BF0B9F6739 MED!470R
143,624,970 *0DC8BFAB1D57C73813FAE31CACFF7C069A2678F8 MEETHE1P
143,624,971 *0DC9C6E2F44EDCCA1F580977724B4C762D2E77A6 meineblut(part1)
143,624,972 *0DCF2FA90741411209E0A48E59AFC73DD569A1D1 melaniedaley
143,624,973 *0DC436620FA73E1BBB4387D70937D216A005F5F0 MICKEY.LAITE
143,624,974 *0DC2E0D261EC63F9C65AE9E923DC642178DDF25D MICKEY.ROTHERHAM
143,624,975 *0DCA45920F3F323B425E2B57E955B8A22FA1A7FC MIDDELHAVSFAUNA
143,624,976 *0DCBBF7BEF510B8BF961C6C4CA6265CA20283F5A MILANLAPILIO
143,624,977 *0DC0FE01B0225391C7E1B40F0AC9B8BED8C525BA SUNNYMAL
143,624,978 *0DC6ACF773D430D584791894D67981430C990A5B SUNSHINEEYORE5
143,624,979 *0DC0DAB700E493279E90A71FC77D281461ABD6B7 MILLARD.CAULFIELD
143,624,980 *0DC9A0F5E43EC2F651D4AB2710FAC43952F33A5C millionhobbit
143,624,981 *0DC0978748C2518253CF4F129BD71CCD5C378CA9 MILTON.KYNASTON
143,624,982 *0DCFB6CCCC37DD28F66448C79FE260C034F6B008 SÛRNAME
143,624,983 *0DC1CF7BCC87171F5437BA00D9101BBE4719156B MINH.HUNTZINGER
143,624,984 *0DCA154427284BD5F6AC2A52678DC5535C33915E suzukidebbie
143,624,985 *0DCFD016BCFFBFC640EB49B451AEB4EF8543FA7D SWEETSEXPORT7
143,624,986 *0DC240FCD9D9555AEBD6EAA783F85A0FCC9CFB70 missilecarrier
143,624,987 *0DCFE00CA15CEC8E6746DAA26BC1CBE6C8677426 MISSKYREI
143,624,988 *0DC424F6C7F0DB493B7990481CC7FF5052949BCD MITBENUTZUNGSRECHT?
143,624,989 *0DCB5F8D0FEE10ACF28B4FC557CB072C1723A333 mitchelkrows
143,624,990 *0DC536E7337B0CAA2EDAA0427DEF3A233AEA2F7A SYNTHBASS:052
143,624,991 *0DC2BBF6E3EFD09F01D1E5527BB015425991B90D [email protected]
143,624,992 *0DCB3DD7168325A542DAD989D604426C5FDD6AB5 SZÉRIAPÉLDÁNY
143,624,993 *0DCAD67A4FA3AFBA5EECF670236DCC39CF44AEF0 TADHKIRAHEHUSAYNI
143,624,994 *0DC9F903DF428C7747974197C9D8CFE588FBBBB1 mona-lisa's-eyes
143,624,995 *0DC3976782C28E39F3F80BC6BE24D7D50BF447E5 TALKFLASHLINE
143,624,996 *0DC7AEFCD8C57A4112952DB90F5505E37008E622 TALKJULIECAC
143,624,997 *0DCB30B13465389E8696F9A5B040C0CD82831F58 tamanowus
143,624,998 *0DC8E622F7767AC4FE3A66FE3BE750654CB18C4F MORTONEMPASIS
143,624,999 *0DCA69EE6637FD877185E303CDB4307DF2C3716A MOSHECLINGMAN
143,625,000 *0DC1A85366F9B9763F8680068782A731661D723E MOSTLY-FILLER
143,625,001 *0DCF3395CF109D66B300EF417926508231591301 TAPET-TAPET
143,625,002 *0DC4882B8FD990F539749626731FF63E44D99C8B MRLEFTYS
143,625,003 *0DC2EF62B07AE2D5A9B78DCB6F94A6BFEEAD8323 [msg:-jp]-hello,
143,625,004 *0DCDD118D2B92413AC828199745656EEE575FD0F muhamed-sehic
143,625,005 *0DC4C8EED70AF2B0549A3C7BE6A0306BD3DC8075 MURALIIYER
143,625,006 *0DC1255DB0B820C18D26F7DD324AABDBD7901FA3 teddysturmer
143,625,007 *0DC3880B55D171B939252E39AF1CC41E27839ADA MVYENIELO
143,625,008 *0DCA546A444070164FA5081F90EF4F02B1042A33 mwud
143,625,009 *0DC805FC84732FE050829421AEFF61E4BF189CFB MY BAD (ALBUM VERSION)
143,625,010 *0DCAE58FAAF85F7193157B0094B84A255A8BD3F5 mycirque97
143,625,011 *0DC90C50086D6EF5E05A9EF8D92F69E52D821D92 MYCOUNTRY17
143,625,012 *0DC19D91DBE41BE010881227C4865D537F958E29 tennists
143,625,013 *0DC2476DAEAE84FACC6E56CC2FE93DA9A2FCED94 myoelect9
143,625,014 *0DC6A73CE0A7A169338F25491C3FA441EB950B1E MYRONTEXIERA
143,625,015 *0DCB9F0683F02992359FD8F69A17C7AF27589788 TERQUERIS
143,625,016 *0DCBB66D4393D76EDB74A7C0E1FBB748168A3A07 TERRANCEAHLBERG
143,625,017 *0DC463E3C62113DC2586469DD0D688DFBDADE435 TERRANCELETOFSKY
143,625,018 *0DCDD60ADA46162B42D95CFFAF3DE1391E1DB5F4 myvacation14
143,625,019 *0DC9A11EE1A58977D0BF828CD3AF9E3F7C4501F8 tetrarch
143,625,020 *0DCC2CC487285A9E830ABEAB13CCCEEF169DF4FC T&F.
143,625,021 *0DC6A5E9671A9C1441F5A0A4A5D4CAA165000615 najla121
143,625,022 *0DCCF2DBC755DBC991B854666C3E441ACCB66D8D THATPORTLAND39
143,625,023 *0DC47CD407EEC07F1F95B921D522113950270340 NAPOLEON.DEMAINE
143,625,024 *0DC21F3020F4BFE80DDE07792CD4B34E5DD961EE thebroomo'thecowdenknowes(scottishsong)
143,625,025 *0DC63753CEB42153F31392DEDE3FD6181BAF72B5 THE.DESCENT.OF.MAN.(FEAT..NICK.TRIANI)
143,625,026 *0DCEBD5712DEA2707D1A88CF93912F9790A139D2 nauhatallennustuotteet
143,625,027 *0DCFD497A234713002C6758B000BEEB0994B6A32 THE-MELEADY-FELLA
143,625,028 *0DC79DDA608BCBC15C9556005490C87F31EE5717 The.Mutants:.XXXVIII
143,625,029 *0DCBAD58FBBF15F9EC6202420484B0839CEAB8D8 theodorehoskin
143,625,030 *0DCBA80CF83A63E42C4B7820FD5E8D1A304DA247 THERESAEASTMAN
143,625,031 *0DC8D09E87A1EBDE85385D81D35A02F117D07EA9 THERIGHTMIX
143,625,032 *0DCC28064AD320CAA0601214E60D2A933C7ECB06 need.in.me.(trick.&.kubic.bright.remix)
143,625,033 *0DC75047A9DE233C2304B9534CE798AE9A0FE64A NEETTIS5
143,625,034 *0DC3AE082E86FC197FFC2698734DED0B5C9F7E8D THISLITTLEBABE(DK)
143,625,035 *0DCF1F3B8CD1BB1627192D734D726704641149EA THODSIT
143,625,036 *0DCB785735F9735B07936F615330F7F544076B9B NERIGEN
143,625,037 *0DCBD5B90E8D73D4FB1547AF69E16A6EC92BE2E6 thomas.hauser
143,625,038 *0DCE2FD5F67392E4F5C3A44BEDFC6A41A7A82CD9 thrombogen4
143,625,039 *0DCB495867F48C06FE25661EBD5646C0687C87AB NEVER-KNEW-YOUR-NAME
143,625,040 *0DC31EE8E06FB5A4E89715C72CB009113B771419 [email protected]
143,625,041 *0DC37DCAD1A693CC3E9AC27D68E633469015AA3B NEW.JERSEY.NETS
143,625,042 *0DCCA166658A9FF7DCEA4DD6D6B626542152FC0A NEW WORLD NEWS
143,625,043 *0DC18DB1AC55FA236EFF4034090BCD687ED0B17E TIFY AND ANALYZE COVERT CHANNELS INFORMAL TECH-
143,625,044 *0DC051A9D3E0BB493BDE06D01BC5A45C56477A34 TINA GILCHRIST
143,625,045 *0DC19AF1EF87B54E16C539DEE13372CC3AA55727 NICKOLAS.BONKOWSKI
143,625,046 *0DC43D5857F3C326415A8EC4C5E2084FEDBF18DD tobygallery
143,625,047 *0DCE86A68C22DDE31C82A47D9DD868A12A258462 NING SUVA
143,625,048 *0DCACD615EFAFA5651964CBACA390278821F148E NINIGRETGFD
143,625,049 *0DCF66F198AEA044B23371CF22ECC2FEE9B36DA5 nisse24
143,625,050 *0DCAB74FC7581A9CD4787391D845EA96DF952B83 [email protected]
143,625,051 *0DC7F920DDF7A98B4FEFD96D8C8DB05965B86A39 tontinel
143,625,052 *0DC85065F7C33465974035BC5161C8A4A287C219 [email protected]
143,625,053 *0DC3282F4F35C4303D59ED8EABB19412F74446B2 TRACY.JUSTUS
143,625,054 *0DC7D0003FA981EDEF79FEBD7C7808641A152BCD TRAVELBEAGLE1
143,625,055 *0DCF34D4624552A1FC8A6A20096D52FE8D5B5BC3 trent.doman
143,625,056 *0DCF77D87704697F7B9674A17C0FDC4C1377510E triapsidal
143,625,057 *0DC4D4AFE603AC3590FB2D8B03AC17239364A2D0 [email protected]
143,625,058 *0DC33A3715B7B6F8E361131F5962278C282DA863 N MALLORQUINA
143,625,059 *0DCA212E2AED8AC4E3E5645AA653D0DF88CFDBDB NOELFROST
143,625,060 *0DCA65221CA5CD071307390B8FF46831B9CCF3E9 NOKWUCHUKWU
143,625,061 *0DC640487FCCE1121EC4E9CF7B9A59FF7E5AE5D6 TSIDONOM7
143,625,062 *0DCE164C535869A03FBA0047814C7399E181D80F NOMINATION—BEST
143,625,063 *0DCD2AC14F6D911EDA7F81B50BEC79DF991CB63F [email protected]
143,625,064 *0DC93A592914EF1FE0EE846C923915A7D61F2FB0 TUCEPIMA0
143,625,065 *0DC07777703179995F4DBAF1C531D31E2A166F7E NORMAN.BUZZANCA
143,625,066 *0DC111E21FBEFA41DA42D2153403343F27F2F853 TXAS-HOLDEM
143,625,067 *0DCD354EBDCD0D76915F2505BACE575E30C2AE5A TXOMINTXONI
143,625,068 *0DC37C0D82046E5D149A5132B51C2C4B49AF10E2 NOTNISLING
143,625,069 *0DCAFB047C79A618DBF94ABCF17E649392300E06 now-i-bleed
143,625,070 *0DC8C62E79EBD1B7BE460A9674D8E9858885D173 [email protected]
143,625,071 *0DC958A79EBE55BFA1224F96DBCC16B57C85B55E N%~V
143,625,072 *0DC76A1CAD27F0180FE2F7C175D9FEECA2498623 NYARAII
143,625,073 *0DC2ACDB888E23DAF776DA9D95B307E4AC9112B2 O$7!NA7O
143,625,074 *0DC2594B2633762A30065C39379435D964D91B5C [email protected]
143,625,075 *0DC22EEE9514D9C75BFE341FAE1383143D685505 [email protected]
143,625,076 *0DC43E98DB8EF1170313C68B4FD4AD92CF16FA61 uitvallens
143,625,077 *0DC3B2BD4C3D5583C15AFC0C2A72BA95D2D59EAF [email protected]
143,625,078 *0DC34E46EB092C07CCDD96C5A673978BBE975681 UMILIAVAS6
143,625,079 *0DC5808839A61DA378BDA4BB7E069CA02D1AD678 OHM88111135162
143,625,080 *0DC350573DBCBFB9C02F6D3FADB52BE29B8DD283 olenfrancey
143,625,081 *0DCF44A52EF2711AA6290CE56ED552FE4D163317 olive.nut
143,625,082 *0DC2AEB167B8B64FB4D289905DD5AB16F1D2AFD2 OLIVER.MITTLER
143,625,083 *0DCC06199D022D7B62132DA5E9D933BE5A3B7073 [email protected]
143,625,084 *0DC84F94AA9BB71F596BD9D3183957B1B3F7132C ON7OG3N371CALLY
143,625,085 *0DCCC1FD3CC7CA88530E2D759E1B3ADAFCD0F682 usctraveler1
143,625,086 *0DCEA1408D928FD67B472A10057D9C5777C8E2A7 USERPARADISO
143,625,087 *0DC96034AB135B13581CED48E0CFE1D6547137D0 oscardusty
143,625,088 *0DCB0DCFD252E03A31F89C5B5D2841FF7D5FED95 vaughneastburn
143,625,089 *0DC7EFE5A4B0548FDFBE2F59E7F63B1037437A09 [email protected]
143,625,090 *0DC98AD02EF53D77E7A9011ED33FABE8AD3BF4ED OWEN.KAVENY
143,625,091 *0DC00BDD4568ABF0FA95D53F301C9CC080E79CCB VectorGraphicsLongEdit
143,625,092 *0DC652ABAACC32A03AEF774403EFEE1CBD65DB22 veldlazaret
143,625,093 *0DCB67FAD47ACA7D7F9C78B369D3B98CC0062E83 P0D5N4PP3129
143,625,094 *0DC26DE94B72908B232EACBEAB42C0F1D58DB9EE VENNINNENS2
143,625,095 *0DCE09A58B739B46903B20B75840A57E35EC238E [email protected]~0~o}o{
143,625,096 *0DCCF5A0A81369C3A377B5F7EE9AC2A9BE7EF5BF p0r7cu11!$
143,625,097 *0DCA7A34DCA938DDB798E175093F8DD69563F201 VERGIE ULGASAN
143,625,098 *0DC24171213A652B3BDABC47301FA2F90BFD7A2D P43T4U
143,625,099 *0DCC40AB80B9DD1E4CC46680105851C17AC50580 p4bx
143,625,100 *0DCB8670C3512C61E8D4C9B90EE5AB61324D22F4 vernyssht
143,625,101 *0DC5A6AC3728429969AF1A0BE14925DB2AB00971 veronica-del-greco
143,625,102 *0DC1BFEF3B1B69AA4B4ECE45A5036B41D1978E27 PACTOLS
143,625,103 *0DC9138561DC2F0C39CF83235A513FF0B7C81CFF paisley394
143,625,104 *0DCFEDE84675B258BC07413F4C63A91299690EAD pakhanna
143,625,105 *0DCFDE767DCE8AD1E1AFFDEF85B2360045EDE174 vessarion
143,625,106 *0DC7E44521C3CEAD5E4768CDE1B3BB0F0F66DA72 VETTEJOSIE4
143,625,107 *0DC8563D4A632486198BAB4F4EACDEF7AFBD6F2E PALISADESRESERVOIRIDAHOMARCH
143,625,108 *0DCA1ADDD6B128B05424979DA861E96059013E02 [email protected]
143,625,109 *0DC0FA8EC53DF4DC4648B8ADDE3128EB4DCC925C VINIMILANAIDU
143,625,110 *0DC2515DE7F3A518953B48B37627E199E6324BAC PARCEVAUX
143,625,111 *0DCA3B02250F22F1175ED886ACE4D54A9E63FCB9 viruk-azure
143,625,112 *0DC93CDB491F21AE9D68602272EB5E0841BC0A14 PÁRTSZEMPONTOK
143,625,113 *0DCF9605830B71DEFA1D9FB080FB506CA7A4EB27 VIVIAN.VOLTZ
143,625,114 *0DC2510D21B86E64B73315C2B70990518DC61257 VLHTBB
143,625,115 *0DC3DD4477D0606AB3E75C77F0A0D0598C178644 patti girl
143,625,116 *0DCAD84B81CFF10AA4F9C2A0BF99E4E32ED9F345 PATULIS3
143,625,117 *0DC8680F17F17CC9E74B83ADC8B7C5CDFB4A6ED2 PATUPTON
143,625,118 *0DCC2C78EC592D4F0CE51CCD48FE674788656047 paulbullshit
143,625,119 *0DCC76AF080348003FF0ACDB77C4770B475BE740 p==d`
143,625,120 *0DC19342626FB35E2F04D514F79D947CAE22D57F PDEBRULAR
143,625,121 *0DC42A2EDEC247DFFAE9BBAD9E7CEE316A37634B [email protected]
143,625,122 *0DC780265FA6C9D35E7190B5AA81E2B836E20F82 PEKONVN2
143,625,123 *0DC592278C079A6243CF14C3313125D15D33F69E PEOPLE.IN.ENGLAND.ARE.SO.BLOODY.NOSY.
143,625,124 *0DC8E008F2F11776A736DEC95BE9A4769140814E PEPSIPACIFIC
143,625,125 *0DC019872031FDB3D41983491205D0AF041F784B PESADUMBRE
143,625,126 *0DCDCBC0DB816D6F043A2CE2CE282D7F490B5C21 WAITING-WEIGHTLESS
143,625,127 *0DC303AE31311C3CC9826972C34F0239BD9A9471 walka not a talka (feat. snoop dogg)
143,625,128 *0DCF11FF8DC0FDA6F48ABD6BB320DEB4ED751AA8 WALLYFETT
143,625,129 *0DCD603445027FEE35DA8BAE65BD71AFAEB9F884 PHYSCOLOGY
143,625,130 *0DC0B697EAF8B449C968E16F265345E54E357DDA PIANOPIECEFORCHILDRENNO.18
143,625,131 *0DCCE6CBC1AB4025E8406411CBA7CFE5E738899F [email protected]
143,625,132 *0DC1FFA6296AC7E00E2BBF4092132A0D1144EFAE [email protected]
143,625,133 *0DC698AF7D2D3FD5329FFA7A93D2FB97D45F036E WARPED(TERRORMIX)(FEATLE
143,625,134 *0DC66BB031179810CEE5CA3DD5E9D49D27B53E60 WAVES Interlude
143,625,135 *0DCDB93CD365D6465057BAB43384323E370AFFC8 WAY.FORM.TWO.(SWALLOW)
143,625,136 *0DC9DE2DAEDA3559DBE4FA3B9ACDBE412F453E03 PL4IN$OLE
143,625,137 *0DC296774683FBA21FA5C84EC395B2E9276A34A4 PLEADINGNESS7
143,625,138 *0DCE0BCBB90DBBB90D928B225DA2F32D2E08DB07 PLIGTKØRSEL
143,625,139 *0DC303C86A99111F13F1C249DA04010DCD82E1F9 pmarmottant
143,625,140 *0DC11C0077CEF5731686435C993D19548F6830C7 P--->*-*-*}O{
143,625,141 *0DC6A43DE65B7FBE5614E07DC13790B82C42D662 po1!7!cked
143,625,142 *0DC530939FD8FFB5137C4AE990A413578A6D77AA WENDY LARSON CHUCKRAN
143,625,143 *0DC52D464298079D7D4A9F97BF5E77C0D374705E [email protected]
143,625,144 *0DCF8AB14CF2678B633A07C1DBC00E8A470A601B WESLEY.BRIGHTBILL
143,625,145 *0DC1E0621F9ADD564C54AB8B06F5955B9F71920B POSTVORSCHUßBRIEFEN
143,625,146 *0DC950E34647BA26C53049EDD6074AE28D64E705 WESROUSSEAU
143,625,147 *0DC2D2FFE8716EFE2B27EAAF1E176A7040D9E992 WESTMELESS
143,625,148 *0DCB4273FB7877C01F5DCB0A2FD3FAF931EB7F7F pöyliövaaran
143,625,149 *0DCF01BDD890C1C597357C88A44F357AE548E635 p######p.~.~.~.)0(
143,625,150 *0DCE6B0F00B8E16CEB4364932077ED752A3C4BCE pp~0splat
143,625,151 *0DC26B097DCFA0E8CACD4B30E3DA6C5010B991A1 pp`.)8(
143,625,152 *0DC31C5F8D85D49895BFB84347D95DF15B4ED4C6 pr353ntab111ty
143,625,153 *0DC2604B4389F84CA8352D3427A88301D117E9D7 PRESTAMPING
143,625,154 *0DC9F7320458D37D41C2BA4D94E6D5718D230D92 WILBUR.FUKUI
143,625,155 *0DC50E382126D9FC69B7F7CC4FBCE05B7D7A5865 WILEYWOZNICKI
143,625,156 *0DC187F78E1624CFD46987EAAF8BD2671B7D9390 WILLIERAITH
143,625,157 *0DC9270DA228DEAC2D53E128D732B88DD28993FC prosopos9
143,625,158 *0DC5242B9215F6B7B007D8E3CD15CC37FB18A941 PROTORTHOPTEROUS0
143,625,159 *0DCF34E19F2F43E0B213E713805AF35C7744D9B7 winnie-verloc
143,625,160 *0DC47ABFE8479F1F37515006294BA10579163BFE PUDDIN77
143,625,161 *0DC4CE8B5609843C1FA7F7C9D3695D7120A887F2 PUNEET KALA
143,625,162 *0DCDD59DB61E5E9458339CC1A323B9CD8A1CBD35 WITH SON
143,625,163 *0DC074800A54BB8E64F0EB4998B43187741C4C50 [email protected]
143,625,164 *0DCCFDFE4A0FB7A7CACEFDB18294DABE1D93E373 [email protected]
143,625,165 *0DCDE7E531E1730663247DB1D8350464858EC646 PUTUJUĆEM
143,625,166 *0DCC17F5BADF9CDA2BC27537C486B6F07EE0BE61 p`[x
143,625,167 *0DCBC0ED68196671EB7F78597958DD1C03A51F4E WONGIES3
143,625,168 *0DC7B8285B2070C4B7E05F2BAF7BAB012A75C6ED pyyteetoen
143,625,169 *0DC02DD12183623E5503A142020F7AB3444391E3 q=====>.*.*.(>_<)
143,625,170 *0DC1ECE65277BCC6DD5D4047AD890614C350E59F work1921
143,625,171 *0DC0A513CA8A3F3F59785E05F2F49CD18D676E8F WORKIT(FEAT.50CENT)
143,625,172 *0DC2502F715558986215EFCE47F1CEB971D99BBC QARMA CHOIR
143,625,173 *0DC936EFF2C1BFC2606371151DC5FF6BE6960AEF qatmadden
143,625,174 *0DCC4F1781B60457C06FA791BF74189E73E54ED7 WRITTES6
143,625,175 *0DCE61B9D9E6CACA418E9A7EC0C91257A0E65EF7 qD*.*.*(x)
143,625,176 *0DCD8D007439073C1330601D6012E288BB8C3C8C wsyr
143,625,177 *0DCF140745A6224385BEE1FB99532D59D5A49ABC W!;W
143,625,178 *0DC716D4E0DFA3E8DF38C30EC00C51AE0F05970F WWW.CADDET.ORG
143,625,179 *0DCF946585CF90CDAB22DEE1B092B5E7E85C0876 WWW.GORERENTALS.COM
143,625,180 *0DC1FD9B7BCF1EBD0F09647463708EB7D9EE31BA WWWPLEASANTVALLEYWINECOM
143,625,181 *0DC43CDA4A88C0B8E9D5DFCA56E5BD4D895FB17E wwwsaintsaviourorg
143,625,182 *0DC021B955A076B6292879FC17C299CD957F97CA )x(~ ~ ~ @#####8
143,625,183 *0DC5057C429EC187328313BE0DD2D191CEFFD4D8 XAMESBBS
143,625,184 *0DCA5CEA00D8C2EB95ED0C1C853A137543058EB3 QP~0 ~O 3B<
143,625,185 *0DC63D131D83D63BE5AD5F1A90A29B3EF16313C4 XGHRBODZMQKA
143,625,186 *0DCE1EE8360FE6DEE17B1433FB5ECF581AD91777 XIANGTALKHAPPY
143,625,187 *0DC25FA6B0E28B1E3E1B9A529C2C1DE6E929BF49 XIAO580231
143,625,188 *0DC585C8771C8E46AA7AD6ACA579F6C023C6AAE3 [email protected]
143,625,189 *0DC9A58E970BF4EFE7DA47E7F1DF2DA01AFE90F4 quebrachite2
143,625,190 *0DC9695D6DB14147696D17ED7AC8289B6F891C7E quickeried
143,625,191 *0DCFC1593576BF68D5BFFC5B9AF5521079459A34 quillbark
143,625,192 *0DC232B3F765538395622283F1BE5E004D78114D x!k%>/
143,625,193 *0DC2D278D72EF8029816A30FCB540540210725F8 QUINTIN.JABAUT
143,625,194 *0DC5B201ADCF17A90B77B4E7604F2B6F7297A63D {x}o~0~<=====q
143,625,195 *0DC5863E39C006F5DFE1FF6A8DD78ACE5228AF30 (X)-O~-<====8
143,625,196 *0DCFD5CC0300020C97035FC582743C6E99C1FDD7 QUOTISEE2
143,625,197 *0DCD706DB5F576EAC39C488D2B2092F52012043E [email protected]`~)x(
143,625,198 *0DCF262BFC6AE1C3E1EC3FFA314296EBAF45D6E2 [email protected]
143,625,199 *0DC036F96F2E0D087694735B006502207E7E69FE xtian.sch
143,625,200 *0DC70EC70A9A67DE3BEAD04A31ECDEAB51DFD99C XU_FADIE
143,625,201 *0DC134BA1D028CBA997BFE3CB6EF92E0EB3FCA58 xxxxlove1
143,625,202 *0DCD83ABBED561A60E06805793FE193B650CF631 [email protected]
143,625,203 *0DCF9B535A4801095EBD1DD264E4EA4765E5D5A1 YACUNT
143,625,204 *0DC43B382877DC5EBFDD4259E80F6FE4EB0BD788 YAP-XIN-ZI
143,625,205 *0DC75095C45084A2BF2FE1BEE2127C4C50CCCADB yarennihuicochea
143,625,206 *0DC8511EE0C0488DA13DA86E1460BC481F721B3A Yar-Yar-Yar
143,625,207 *0DCA58D10A418FDA7F11197D9910CCEE18A83345 RALEIGHGENNETTE
143,625,208 *0DCB14BFCA7621670D32C7BF33572F27B6548E21 yobokap
143,625,209 *0DC20C972B8EF994EFC7F2E0599BBCDE6CA816FA [email protected]
143,625,210 *0DCB86DB59F73F1A7DED587B426E8619286CA259 YOGEETA.TAYDE
143,625,211 *0DC47BB886C35C1DA78352A7C5FEE5F610681E2E yonelim
143,625,212 *0DC0B39A3B4DE508CD84B208619CB7FA2422773B rampenfunktion
143,625,213 *0DC3BD2078C3A949C7CD3D937B25F114B4061332 RANDYSWANSTON
143,625,214 *0DC23711F357E4F013750BE27A58CA4EA7E9D2EE rantaniityn
143,625,215 *0DC9DDA3BB206BF0A9E1FE6CEA1F213ED287319F RAYMUNDO.MANGIARACINA
143,625,216 *0DCBFDFACAA4B05D56395AADBC09FB18BB62E814 RCUNVALACION
143,625,217 *0DCAA903B9461BA3030EC84ECC391583B91489FD YUSSELBSW9
143,625,218 *0DC1D33B19E7ECB8445DE34CED83D62DA646ECA0 realist29
143,625,219 *0DC4726FE623E673603F0333B9A78A3552DD607E [email protected]+e
143,625,220 *0DC612E8B053CCEC40DB2451590E5A2CE2C0B42C zach-dekorne
143,625,221 *0DC869B4C4D7898E9B7EDBF59B5893731070841D ZACK CHOO
143,625,222 *0DCD92566433E786305F7D00D6994D2C4FDE4E6A ZAIDEN763
143,625,223 *0DC18D04E250F82C74074D23C10EE6E73866D983 ZAKAR RIA
143,625,224 *0DC26680CD563C2EFF03EA18C95ADA8894720663 zarya-adnan
143,625,225 *0DCEA84F4A0E99FE28B0DDBE44E160DC598E6F03 recharg
143,625,226 *0DCCB007689EC5B9F61DBAF88998B470AB31787B zel.sesbreno
143,625,227 *0DC01108C633CF17161810F26BB9166191615D54 ZENG_HAI
143,625,228 *0DCDCF029E18CFF15317BCEE579A3CDA0CEE5A47 RED.HEAT.PERC.MIX
143,625,229 *0DC0356F8E7D6761F93ACDBDAB3B1C9B769A44B6 [email protected]
143,625,230 *0DC251B66FC6C6588C72F8ECED1242A685FB5B1D [email protected]
143,625,231 *0DC73FAE2263C6FE186F48F2C6CC3070064BFB55 REOPEATED
143,625,232 *0DCBF6B8403DC665BA376C290FD69718C397C5D9 ZMVA
143,625,233 *0DCCA99DA0FC49E9F1140CA5CF5EFD618BC56563 rexgosa
143,625,234 *0DCC1F6EDD8DF626F65EAE891438B94C5DBD5231 [email protected]
143,625,235 *0DC5A3BF7DF853B8DD9BBD1244272B83693704F6 zurainibintiismail
143,625,236 *0DC62D624F66CBCCE2B9FA70536EEA92987C6189 βουγαθὰν
143,625,237 *0DC801BFA68FB0CA9382D6574EC75C50D84B73B1 εξέλιξισ
143,625,238 *0DC04E3F9072E5D07441D3D1432FDF707C03C1A6 ΕΠΕΚΤΕΙΝΌΜΕΝΟΥ
143,625,239 *0DC57AE75FEDB15045DD23AFBFD7C0B43FF799A9 ΠΉΜΑΤ
143,625,240 *0DC69561EAB1FE704A78F348CF549FD0D5104F5F АРКЕСТАР
143,625,241 *0DC34D2F7304939137412D7FC524158FC3E0B504 robert-e-lee-by-leo-lentill
143,625,242 *0DC11C39697E8C6D3F83F0857B1E20E7C5C28E9D ROBERTO.PORTILLA
143,625,243 *0DC7392782A673DD19CA0A7093ABDC7426AA13EC ROBIN.ADLOFF
143,625,244 *0DCE20E33BC56E50C5227097FDB9E6176C87E713 robtlegard
143,625,245 *0DCB6A351F947DDCA5AC92F731EE351AD3281F96 [email protected]
143,625,246 *0DCE79206E86B762FCEB9A7051ADBE97936D47B7 ROK.BOHINC
143,625,247 *0DC275E02165885CAC629ECBE61877B34B536C4F ВРЕВСКАЯ“
143,625,248 *0DC6DF348B67568D7C1E4DE8AB4D6A5BA5F33954 ГРAДИТEЉИ
143,625,249 *0DC246DEF49D333E609ABEA1FC78860ED95D34B9 RONNIE.LOZADO
143,625,250 *0DC42F5FF1A5ECCC1D1DD1ED5C6D030DA7C91847 rorytyon
143,625,251 *0DC9FFE2BA12195164C670BF93964CDFA3CE5E9F ROSS.GORMONT
143,625,252 *0DC95C24F6C25FA1FCADAFF0E2B29B3D4C8D5180 ROYALSSUSAN0
143,625,253 *0DCAD22ABAA2833134022FCAF503E84F20A9234F ROYOPEN8
143,625,254 *0DC2A9EFDFA37EE9C734E293D5B06B4F7DE16842 RUBIE-BROWN
143,625,255 *0DCF077AE9210F87C8B1236F72CA8AC1F34E0CC3 RUFUS.GENITO
143,625,256 *0DCF56D6AC630106F14A2A4D41BD1F6293070DDB значущі
143,625,257 *0DC1B482DC0757132AD10EC6F0C79B51E3DAB59C ИГРОБЛОГЕ
143,625,258 *0DCEFF4C217FD71F5F7CB6DA7FF19C9FB77B6985 МОШЭ
143,625,259 *0DC4000DFB7B877761A6A26F6F04921FBE7A9DD6 RUSTY.CAPSHAWS
143,625,260 *0DC9F51A19E5576173B7CB4FC82AB5BFCDC0FACE СТАРЕЦОТ
143,625,261 *0DCB54FBD696663EE29F55D391F6A7FCE4C99D6E СТУДИЈКИХ
143,625,262 *0DC0CAF33A3C309AEC8A80131EC835294F92F2D5 sakonides
143,625,263 *0DCBE69144E96C9732B8A58F3F486488445D1F04 хохітву
143,625,264 *0DCC71ACC9A1F54EA56F582A0D01DDEC846E5BDA шолипая
143,625,265 *0DCE379C3CFE4253472E5B81C04DD5F0E05B9D55 SANERACSAM9
143,625,266 *0DCA3AB7F78D4173538602A9200F24BB8F192995 SAPPHICS
143,625,267 *0DC5D0BD32ADC16E5B21EAFD113E6BDCCFD03194 sbloccsed
143,625,268 *0DC61C2621259A7B5ABB8FA355628787098EA9CB SBMOCSKCOC0
143,625,269 *0DC8C5D9F913E2941D82C19EF183EDCDD368C1F2 sceptre
143,625,270 *0DCD05A21D85BB73FD37138F4AD9880436DB8F93 (却下、終了提案)ipユーザーによる投稿ブロック依頼はできません。
143,625,271 *0DC4F74D01A6D6A8DFAEA504ECFB3C11DBA01719 に、ホリデーシーズンに向け8gbモデルの販売価格の599
143,625,272 *0DC813D8B2643A5C79EAB8C0E97C4ED774A7C1B2 [email protected]
143,625,273 *0DCE301BEC22E59CB9FA6996B5C1A7933B1D39E4 sdj031
143,625,274 *0DC996269A2F983FB5BE12EFEB16039037712103 sean-hynes
143,625,275 *0DC8D3A4BE05FAF16FE9FFD435727954EDECDAE1 SEBOLGNOC
143,625,276 *0DCB5E7D89BA5E7272B093777B0C2FBFB92AD4C1 SEDATEDDISCO(50CENTVSTHERAMONES)
143,625,277 *0DC5B879062B6F9E8E68E838DF55AB3E619EE207 SEEIC
143,625,278 *0DCF6C2398E18B7D0ABCB868D628DA2BB20CFB6C SEEMEEH
143,625,279 *0DC99CC3599C20362BBF4C0E329932E0FD684EA5 SERDEACED
143,625,280 *0DCAB94B418780651776B9EBA06C4A39CB26F9C4 SFERZASSE7
143,625,281 *0DCFAC872528C723D5BB86FDAB0DBE26C929964F SHADMCARDELL
143,625,282 *0DC9410A1802FB34E8C3E4D2E309EFDC4665D24C SHANTUNUG
143,625,283 *0DCECEF8407AAA851ABEFB9784615CF07EC85A43 SHAUNCASKEY
143,625,284 *0DCC09CDF8EC38BBEE153F70A5685DFE4B9D1DE9 shaunyancy
143,625,285 *0DC4FE89BF86784592920657A172A1480C179F0C SHAYNEIVENER
143,625,286 *0DC6F2A10AF5F1E87A80135378BCAC24C809C00D [email protected]
143,625,287 *0DC2D5EE3DFAA4F2E5B1F64657484FC47FC54021 混乱したパルナッソス山(IL
143,625,288 *0DCA5FF7DABDDFCE5618C6C6A3E3098BB3F9DD27 SHIFT K3Y
143,625,289 *0DCE6B87BB031562F619699C287818A3714A7114 SHOWABOLDFRONT0
143,625,290 *0DC797E8C88465667B326C7FC51D07EB4DCEF9D6 SIATROFN2
143,625,291 *0DC575C1221EB7BA1BC1F168A7757CEBCE00CE02 simina-shepherd
143,625,292 *0DC48B23D89AC62C27E5EB1AC2F80BCF919925C8 SIOR
143,625,293 *0DC8AAEAE27319FA85A2609B6ED633D520A2A35B SKYWOLF BLOODRAVEN
143,625,294 *0DCFB2A19A886FD19CF8FE0B0E426F254D3B6861 SLARUMOT0
143,625,295 *0DC267E3F49184A82537CA9BD708BD16309FCCF0 SMANIAVA0
143,625,296 *0DC323CA922046F92F0C78A653C75D4FC0F45005 SMARINERO(FEAT.ALBERTOPODEST
143,625,297 *0DC81E841B1EFC4659702ADA041968C25C0AA835 SMEKENSP
143,625,298 *0DCE82CED070BED4873F4F9E8326014078CDC43E SNOWLEOPARD.WIKIDOT.COMSNOWLEOPARD
143,625,299 *0DC63ECF07816A9480917DDD1BE042E2220E0E60 SNOYALABS
143,625,300 *0DC7C3B1731C6E2E298BC053D6BF42036C39D504 sokimong
143,625,301 *0DC5C9D2C3887FC21E7A3CBE94EECF20E4A21135 SOME-O'CAJUN
143,625,302 *0DC5E389B7D475A9152275824ABD3984843A1445 [email protected]
143,625,303 *0DC9DE37B00F8B1DD5CFD502B80A9C0D36EECEB0 SOPERCHIARIA9
143,625,304 *0DC47D0D57FCED5B0BB834938B5D21F40A5852AC sosolobbs
143,625,305 *0DC0805AB3A678B71440F0D03E33E04C1F442B64 SPENCER.SCHABOWSKI
143,625,306 *0DCAE89B2A6EBA9A97BC79FC4E31CC1E60BA0668 SPLAT!-O~O~-<=====P
143,625,307 *0DC871C26AB8F9B6A0D4F1BD713D031B8C030AE2 SPOILTOFNOUSE
143,625,308 *0DC25DCC33D7EA99F0F372E4F508ABE9100D9466 spray.strip
143,625,309 *0DC9D9B4D9A18CBD691E1C17DDE314874A7A6082 sregniretupma
143,625,310 *0DC0BC7A7C94461F5C29AAA3A097749DE0F84F7B 068GABRIELA
143,625,311 *0DCDB42A41702650EFDDFB174C09DDDBA3702611 STAULING3
143,625,312 *0DC95DE2F70D6D629D92EF5F8C901AA4D13A8C77 0MYBOOGER7
143,625,313 *0DC2741955DCD57C885CB9F91AFF123EE731C69E 1028-BESTAETIGTEN
143,625,314 *0DC7C9EF93EDCB3F5786254A8AD27A3F918007E4 STEPHEN.PUELLO
143,625,315 *0DCE6518E8E168912FF0F4D77BE5C9966F13274E 10.kleine.nazischweine
143,625,316 *0DC49556D21A80E09F46D8C2D543966FFB3589ED STERCOROMA5
143,625,317 *0DC1DA9126784450DDB916F9D1C5E0F7256BECE3 11-16-1673
143,625,318 *0DCBA429396163D3B7918007ABA8F642861A265D STEVEBABECKI
143,625,319 *0DC0EF73E7F7A30F4C241F1859F4D1E4C56B7022 1134541 SIKSI-ON-SYYT
143,625,320 *0DCB6F19DE7AE37D95BBF2F75A7501C0DB16B063 stevenzmolek
143,625,321 *0DC306E931327A3C357ED6E24C37178135B07DC8 11.USSC
143,625,322 *0DC380BDD5A3508DC71283E49CDA1CCEA05FFAEE 12-T
143,625,323 *0DC5ACBADCBAF97B7E0E5A38DF90D5DD809CA789 STRAWBERRYSH2
143,625,324 *0DCD205F5FAF2B168399AC5B1FC18F8CC15BB195 strong(pianoversion)
143,625,325 *0DCCCFE4328EBA49B41193436F6B1FA8EA5623FC 1598107 "-i-am-going-to-be-an-activist-.
143,625,326 *0DC49A6CAE92CD2DEB5863CEE06527621A949D46 15MENN
143,625,327 *0DC271AE463F9FDD46A460D25FEB6EF7D5F7A437 1624986 ja mik
143,625,328 *0DC1A2C61DAA498DBEEA07D8E46C18CF55ABBDE3 169.SCHLUCHT
143,625,329 *0DC8670241EE76690D059FE4908A2B25592AFE82 1.ALITEHOISIA
143,625,330 *0DCA50796712AAE6096A8356268988A8692136D6 SURATKHABAR
143,625,331 *0DC4B48EDF6A8EACDA7561198CAF2EBABA8B887C 1APOSTOLIUTEEN
143,625,332 *0DC67D888D5ABA2D31E642C889B7B833E652EA71 SUVANK.ROUT
143,625,333 *0DCCB7846BC06100537F9EF78203C9C9DCA83BD5 1 BUCKMAN'S
143,625,334 *0DC47A01114061FEA222398BAC6246AC7CD9C3E8 [email protected]
143,625,335 *0DC56443AEF23E3D9C0E1C8007A910A2DAA76B4D 1 CHANDRESKHAR
143,625,336 *0DC0237039B243FAE96D81766EA8D1A6EE841DA0 1CULTNIGHT
143,625,337 *0DC158EFECA7F4832E132578C21B820A6EC81210 1debusquerait
143,625,338 *0DC9C11766946E512B8DAE1E8608DC1A1917611A 1DEMENTOITUMISESTA
143,625,339 *0DC85748164F00810B899C24F8D133E3CD128A08 1ELTERNMORD
143,625,340 *0DCA3868E9A317FB4954D65EACBE8FE5C1971B84 1ENERGOLD
143,625,341 *0DCC27C344C649274485D86269B626AF858C7A28 1.ER
143,625,342 *0DC4A9F5A4F78C68EB413B9728FF94129B137769 1er-Mouvement-/-1st-Movement:-Kr
143,625,343 *0DC9359A8C1EA11DF187FEEB0CA33135DD7708FA T1816240866
143,625,344 *0DCE2A64FD9EA40DBC0291B3F5E86A17BD997371 T35TBLTY
143,625,345 *0DC05C7D5B9A757945CC65CFDAE47977055022C4 1herumwirbelnde
143,625,346 *0DC90A7FD56B80FE5B10A7A18FEA8F8A3CB17B80 1-HYMNILL
143,625,347 *0DCC91929E97113E027F6B26C2304CDF787D8E35 tabrizs0
143,625,348 *0DC4ABD6163C134392D6EE0081F3CC82AEC0B67C 1IAMPOOP
143,625,349 *0DC57B6C4623A10438E4B00EB67B7A37CB554F35 1.instituutioitaan
143,625,350 *0DCE51C17391E86D3CF12F20ED1BF4EC94F347DD TAHREGAB2
143,625,351 *0DC3EB1189F5F477C70067D7727F29D31B5B7A7A 1LSCA
143,625,352 *0DCB7678ABDBF77A30DA8952B0568F096B4B9B03 [email protected]
143,625,353 *0DC004F9A5BF360E8CBF2575DAC273F1D2FB5355 TANGTANYU
143,625,354 *0DC661BA67F2D3FF7D25DA825EBC37F069897B10 [email protected]
143,625,355 *0DC2FA7F6A223424059C591E624037CA3BE067CE TANNERHUEMMER
143,625,356 *0DC7D23CB2D3B4E034AE7F426EF16693651D7141 TANNER.LAVIERO
143,625,357 *0DCA8B2DD130E468642136F3DFC03703137B9F48 TANYA-DAHL
143,625,358 *0DC47B5CABEA3CEB06AEA3A5FA7F48C8D289EC43 TAVOITTEENAAN
143,625,359 *0DC803083764D73CD3923F93DD10E82B09264D90 taylormackie
143,625,360 *0DCC4CBC14AACD1AD67922E76E9636A85E0D7DEE [email protected]
143,625,361 *0DC0C1B97378E9E1837D4D8853962C35110C3659 [email protected]
143,625,362 *0DC03F667C65AF543CA62794DFD00E502D107BEE TECHNOX4ALL
143,625,363 *0DCE52E6EC527D2A1E08CAE46DF0EF3350CF9226 tekcinses
143,625,364 *0DCF4F54480AEA2D60F62057AE1BFB9B0D4CAF3D templeintime(i.mist)
143,625,365 *0DC5A44EB40EE42D610F92296C211E5D4DDE4519 1 MARKUSGEMEINDEZENTRUM
143,625,366 *0DCAAC366CB63FCE4CB55FD872876991D27721B7 1.otml'sini
143,625,367 *0DC10330ACFCCBA9F1F3A5E9F255FB96226F8C6A tetrarch
143,625,368 *0DCC2CC487285A9E830ABEAB13CCCEEF169DF4FC tetsu中西のパーフェクト
143,625,369 *0DCB668B69982EB75CEED95F867891CCE94A0ABE TEXASEDWARDED
143,625,370 *0DCAB66EE858F6ED22E2DC4460798AFAE7A4683B 1 pingviineist
143,625,371 *0DC7F788009149582A1A4C14E21494903025319C TEZYÎNAT
143,625,372 *0DCF99DC6730CF45F33018B54B0600A2836C2A3B TGGOLD
143,625,373 *0DC29E34B3AF8195692332056B55A5AAE327E208 TGIDEON0
143,625,374 *0DC7F8F8C0A4512BA7D520640714E11718347C53 1PUSHKAMPAGNEN
143,625,375 *0DC23FFE09F5830F0098F798A72807A3EEF38D47 thatbeatles98
143,625,376 *0DC6662D63AF8F613CBAB077619FC95A0E56463A the9stepstofinancialfreedom3/3
143,625,377 *0DCEDB40EEE6BD87F54DE0E176241933991D01A0 THEBVR2
143,625,378 *0DC332F0460AED7D6EBA0140824275D53F2BF321 THEFOX1234
143,625,379 *0DCAE1FCA04D014A4F443A1756F0615F0DDFE888 theifisdo
143,625,380 *0DCBE6C1030FFD850938F221523D3BDCBF542195 thelunarchateau
143,625,381 *0DC3D2068A2C65F5FD5AA94BA0CA8CD810A2525C TheManinBrown
143,625,382 *0DCC5AFB46F2D9E2A4147F9EAE1A4B372C883C87 1TRAININGSTAGES
143,625,383 *0DC24A7F2B2729FEF5D36BEAC0D78D269083E186 1 VERKKO-ONGELMIKSI
143,625,384 *0DCA2C1413C37E4A657688E5829B4AD48DF238C0 THEVALHALLA12
143,625,385 *0DCD8DB90F123B9391EA61DEE28E8DE64BD394C5 thewhitefeather
143,625,386 *0DC199236E4343A6084C3D05CB9EAD355B069F71 the-whole-story-/-diane's-confession
143,625,387 *0DC79F9E91973EDBF7F2B09A3748C641D469C7D4 THEY1986
143,625,388 *0DCE7F3451CDD66458304CCD8DE1F3EF4658A512 20081207filwww00028
143,625,389 *0DC524D3F43F81DFEDE0432083C5D662FF1DD75C THEZXCVBN0
143,625,390 *0DC86C1D5B42B89E0C287EC5C4EB59872CAE80DF 2020828 IN 1952 , BORDER FORTIFICATIONS WERE INSTALLED .
143,625,391 *0DCB2C42477B896AB57E3B40C58A5B4B1BEC4CE5 Thong-Song-(Foxy-Brown-mix)
143,625,392 *0DC679CB0541C55A10B1D80F8302822E728F63F0 throneless
143,625,393 *0DCC0D926E3F4EB22ED4EFD23F8039EF6F53FAE1 2191833 TEE-IST-JEDOCH-NICHT-JEDERMANNS-SACHE-.
143,625,394 *0DC27BBB5C565CA1979E38E6CDDC0CB41AE46BBE 22.03.1785
143,625,395 *0DC343039E8E0A26A64D59DEAFD67A6D326508F8 TITULARL8
143,625,396 *0DCA84EDDA4C28FF8F15868667D3A8D05038DF4B 251kaelyn
143,625,397 *0DCD2E4387DB90D293D579CCAB8BF0A9ACF229BD [email protected]
143,625,398 *0DC06603038476268C03B34E2E12DF421C4E150D 2EQUAZION
143,625,399 *0DC49E2B692032B136C06A0E80E60EBD78562CCB 2FCHI
143,625,400 *0DC47E45090372FD23D8E6A430C0E82BB4A6F0DA 2FD0AEC11E083F35F9C507EEFEC53766.SERGEJ
143,625,401 *0DCF7B7F14E7D29B10D13CCEF34F6FCA838B1D82 2fnappyboyonline
143,625,402 *0DCEAD6DC731CEBD60B6584D48FB39FC7FB05C40 2hyv
143,625,403 *0DC7CED92C0EFEE1F708A4B03BE7597FF3E80914 2-ITSEK
143,625,404 *0DC894155C3CDC7F3DAB6743B895C6304BAC561C 2LYSIGENOUS
143,625,405 *0DC5CA9FD745C742410DF80E0C9A19F8E2F9432A 320131 joskus-esittelen-maata-.
143,625,406 *0DC78F94CFC63B5ED9891104F3012B7C2CC7B73D 354laney
143,625,407 *0DC98D75B42B0DFA9D3E772276A6662434F87C95 3A6DFF3ODALTQ
143,625,408 *0DC670D163E9FFCA8B4B763DD3D6498B66664ED6 TORY.HAGADORN
143,625,409 *0DC38336839E7E4F9BC402C833D1C4357BF78D6B 3B< ~ `(======P
143,625,410 *0DC4290562FD6266E38C9450BE63C335F0D7EBE4 TRADUCTOSQUE5
143,625,411 *0DCA17EAF4E48B65E1D39248A2F6B166F52CD8E5 TRAFFICHERESTE1
143,625,412 *0DCCFEBE77C65DEF5D6AF9501F796FA858A4F637 trailer-2
143,625,413 *0DCC1332D46A4F7CC5359BEC268BE581BF18D170 3D62DB7B0973D1AAE4B8B89A2A96F4ED.ISILDUR
143,625,414 *0DC99B7C97B5D8872A3731C4EB03BFC809E1DD7E 3ILOVEHARVEY4
143,625,415 *0DC40B70C8B604E3F8CDB24EF0D5F265E7DB8369 3LDEGRAF
143,625,416 *0DCB0757599CF8DB41DD6B2BE2ED00B6EAD2F020 TREDROKK7
143,625,417 *0DC4A53732E72ECDBC1BF1F4F7F36F8C8DDCCE75 TREKIRY2
143,625,418 *0DC2DAFDF98C8108E74E1BDCF23EE1BD224486F2 3OIHCNOR
143,625,419 *0DCAE366E93F54D1B4447AFAE5688FB772CDDC71 3 PARKETTIPYYHIN
143,625,420 *0DCDC65D93BCC73F72B4496CECC883C8C4ED96D7 3======p ~o ~oo->-<
143,625,421 *0DCFB1DB38725D99FD954C2447CB7DF3F104E0BE [email protected]
143,625,422 *0DC3E9B37CB70892E7942563749DE947D25DF69B 3USWD8U6
143,625,423 *0DC82865EB76C085888690877BF1CC6A3108BDBD 42171Q2W3E4R5T
143,625,424 *0DCE0FC9345301E8C00ECB1E98BF3123096C2857 486156 LIS
143,625,425 *0DCB31F4CA0381B6DD5602D429F6D6D82852B877 4AUTOMORPHICALLY
143,625,426 *0DC173BBAD4AE8C69B7F0FBF3571B0B4B6E3703B 4CEPHALIZ
143,625,427 *0DC719A136B2D909A433A6E39D767146437F4E3D 4EDLETSNU
143,625,428 *0DC75F9FE5E1075FA970D07E40E4196F92670CAE 4GREGMAC
143,625,429 *0DC6C97A75171328CFDF364E6A35A27A7B3D2964 4HCITSONOM
143,625,430 *0DCD6821F1AAEA4894275ACB83370F86F6925C1F trevordroszel
143,625,431 *0DCB7DCB9C4FC3B0EB50CAE93FF5281C98C23DC8 triaratnaningsih
143,625,432 *0DCA74088880FC1810CB1C63FA24FAFE34FDBA79 TRIPOLI''ASSIGNED
143,625,433 *0DCE3621D631860240EFA9035CDBD446EC79291C trisha.marie.talbot
143,625,434 *0DC6D90288FDB8C4D9FD20BF07E1CFEC3897A548 4-leistungspraemie
143,625,435 *0DC852546774EE3BBB7AAC1A2EEC57DDAAAA7BCF trotto
143,625,436 *0DC1BDD868B1FEE359DC4F5443CF5870508433AF TRTDSATTDSECURE0
143,625,437 *0DC6611EAFF1F3CC9E8C181A149E653EAB958363 tsgthclp
143,625,438 *0DC64857EFA6FF2BA60DC4EC7191529D4BDDBB07 4SQRTDHIE
143,625,439 *0DC3D7DFFE3F2745D8298BE90CE25A203CDBDAEE TTMTTYTING
143,625,440 *0DCB4F5F7883FB13DE13E78B6E8B543D18F6F04C 4TUTISNOH
143,625,441 *0DCD2B596160530F452172C9926E9434951C15B6 4XYNOLAGEM
143,625,442 *0DC443333A0FD543B3C3ACC4CFF41E5A28735F64 tuodetrevoriol
143,625,443 *0DC171003DFF06EB265813C59A7892437F8DD6AF 514MANUEL
143,625,444 *0DCC487D09A0A7C7BA36D638C414C8A1C48556AC 518951 saygilarimizla,semakanozkayagn.
143,625,445 *0DCA061DD9C53BDDA6E9CC04EBFD6FC1B21637BE [email protected]
143,625,446 *0DC89D05D68817FF7CF748FA053E9CDB99F00C32 5BLEUIRBLEUIR
143,625,447 *0DC0F73B6011BB4C89789242AEE4C196F273C728 twofolded
143,625,448 *0DC51EA060DE9E565117D0A66A561CC59E92A31E TYHIHVU0
143,625,449 *0DC846EB02B5BFFF7CE2585FC41FA73066B9DB1C TYRONE.SANTOPIETRO
143,625,450 *0DC0A873BB68AFEFB7078A92B99D31DEB3F9FA25 5ENREVATS
143,625,451 *0DCA144F17E3F40F2CBB06FE01C34AEBD6A7AD32 5EVISREVBUSITNA
143,625,452 *0DC31CDD4CF4350C545B9A4CBB1E556148B1BC5C @[email protected]@LLY
143,625,453 *0DC14968DCFECEB90C1E69A9239375A11B8BA982 UBERPAL6
143,625,454 *0DCEBFF1A893ED57499FA32D4775911DA759B417 5ILENZIO5A
143,625,455 *0DC777D36437B4E8AD38ECDCA94A5F465527E6B4 5ILUVNGUYEN6
143,625,456 *0DCA7630F76A8CD3D660623EDC594CCD992A8176 5)lbaa
143,625,457 *0DC38564C9AF1DD93288612F85253B271B1D6E7C 5NIMFENSTOET
143,625,458 *0DCF03969092CDDBBD378A634816ED05A496C136 UCEGT783
143,625,459 *0DCC9AC3077D11113B6590B73BE5396ACEF85DED UCSANTACRUZ
143,625,460 *0DCA0021448E80B0E0FAF798552271B841481544 UGLYDUCKLAY
143,625,461 *0DC711AF5826E1B92897AB0B8DC304D6827BF41B 5SASSYTAURUS
143,625,462 *0DC51FC6BC479D9F32FC12D72831A5FBE78F1AEA ULCÉRATIONS
143,625,463 *0DCA6D73A3BF35FFD56E021C63CA52F51E3AE9BF UMVQPXFNTFSCGLA4
143,625,464 *0DC1ED638AFCC7E37E1D3AD80D0C5AA3906E2075 un$3izabl
143,625,465 *0DC816B5E99E959367C85C5B812ADFEBC069E35B 5TWINSJEFF
143,625,466 *0DCEEA3DE395146477A81D94A67E486B1B739850 5VICENTINO
143,625,467 *0DC3C6E61FB6B8A855E1FFD0BB3C8E6E72E4C6F7 5WARRIORSNEW
143,625,468 *0DC63B9B5BB62DFCC9BED8484A15C8249E3146F2 UNGARMENTING
143,625,469 *0DCA462E9F6F55A8464EE35C1446E69A4CC4A4B8 UNICONCETTUALE1
143,625,470 *0DC0A603E5166B1DB7EBC575332FDB0D679C1ECB 6185DECC2C1261C213E0AD8E1C57DA40 02758181
143,625,471 *0DCF69002E1741C609DF479A06E9D83F4385A6CA unsafe
143,625,472 *0DC9A2D01D6F5FE32908D54B09FCD39CBB3219CE 6ALFREDHOTROD
143,625,473 *0DC2456A70B6FB83836134742D77AC87EB012B7A 6ANAMMAEN
143,625,474 *0DCC8DFF6F2C1A303FE6D939B059739CCA6CA859 6CHRSTIA
143,625,475 *0DC885CF95F9760D2A2C75F6E5B905752E529CDE UPSOLUTIONSQUASHSTAGGERSTEPSTEP8
143,625,476 *0DC32B41D52716EA9F7EACB78501D7230C778797 6depariees
143,625,477 *0DC90782C506D066803C37C50272F4AA94257774 USEAGREEMENT
143,625,478 *0DCEEDED4176CEE5E0E6A8CA613F46C62DD3035C USER69122155216
143,625,479 *0DCF053B8B0CC4F02A9F7EA2B1D2D27A800F9120 6iamangela6
143,625,480 *0DC67270157EB09D3707BCA8E9697ACD51D6C412 6IAMMISSY6
143,625,481 *0DC625BC8C77AC71C665DF5F27F4FE648BF60785 /USR/SRC/LINUX-HEADERS-2.6.32-24/ARCH/FRV/INCLUDE/ASM/GPIO-REGS.H
143,625,482 *0DC5317DBDA69EDD803E67ABD021EFC75B107A4C uu~`d----8
143,625,483 *0DC1994B58862BE81A7EEA8C4E88A9C995D1C523 UXRS~
143,625,484 *0DC7D353FB3213E79A82F857A0721037E8C5E73D 6JABUKOVI
143,625,485 *0DCD63C7FA5FFDAA0098A2843A6038835DDBE798 V0174G35
143,625,486 *0DC8A849B87BDB2697C6C7DCAE9110BF1FF452E1 V1041619
143,625,487 *0DCBA586A5792EE1B68C34AA6E5C0D5E8B1A1C8D [email protected]
143,625,488 *0DCF5E4C37B8F8DC90574915FD541016EE567AF8 6PIOPAGESBSW
143,625,489 *0DCA4023651355D8F939BA0254A52093DDC7365B VALEREAMOURE
143,625,490 *0DCE141F9B4C19C585B49BEDCC8949EEF20423FF val.marshall.jemmott
143,625,491 *0DC46C20650DA3DE46F37FDC3D493B9DD362DF40 vanellas1
143,625,492 *0DCD892CE0A8F4C5678F7E341A61E610C77B8009 vanessa.katengeza
143,625,493 *0DC02859E22E6646738C116551E5F64CA92AAC80 70CHARLOTTE
143,625,494 *0DCE0386B12CB1B7D3B6A1007FF56D5AF64E8A3D venusdemilo(feat.timhagans)
143,625,495 *0DC82520FCEAA8A90F12A6BB4E7CBED40AC8A365 VERFASSUNGSEINDLICH
143,625,496 *0DC3D746449BE6E2CAFC01FC9EEA65F25A59A505 VERJEUGDIGDS7
143,625,497 *0DC3C898359EDBBCCC26E530C11C75AA260E5F82 VERNEILLECH
143,625,498 *0DC5847DF7552B3AD122FCC91BC2446B66217B18 VERWALTUNGSWEGE8
143,625,499 *0DC48FB1D8D9B5B8D43D60EF76CF7F4814D1781E VESNAMALINAJDOVSKI
143,625,500 *0DC7531058F89AE88827122D66D1D714045CEC73 7: 7 -# -& SEAWAY
143,625,501 *0DCD99897CE0EF133F2ED18357BF05E5AEB096AF VICKINEWSOMPUCKETT
143,625,502 *0DCBBE3228CE678671595AA41E9FA3204AC0ABEE 7ALPAYBSW
143,625,503 *0DC63E013C86F201ACF3FDD01E27A7F1B9632526 [email protected]
143,625,504 *0DC9F620AA5EF3245F1A5BCAB3DC58201FF286EA 7BSWETACOVABSW
143,625,505 *0DC39C470C1711C0C1505F67EC9E255D41A054E1 viisuttomilla
143,625,506 *0DC9AA47BF3CD8D437BDBE1C90EB170AC1FB01C6 7ESUEITITSREPUS
143,625,507 *0DC0FC64A245A9EDD82782BE358629298471C815 7jessej
143,625,508 *0DC6B7313D63C1A8618D8CD0C8877FB19BA9E65D VIRGIN-MUSIC-CHINESE-(TAIWAN)
143,625,509 *0DC71A92FBDA9B117C662B491E82599E08716FAF VISORNASING
143,625,510 *0DCD175DEEA485A7257F1ECDE5E811E71C300C65 7PROSPITI
143,625,511 *0DCAA71E0ED98FFDCE1C4A7206B71D23DE5969B3 VO~?
143,625,512 *0DCD82219A9BF33F04DD9A9D082C76B429A2235C voicesfromtheinside(originalmix)
143,625,513 *0DC4662AB63E6100018FCAD0658C36478A42793D 7SPERWERTJE
143,625,514 *0DC4F49BA8057BB53C690CE1D19558467825CB24 7TARHANA
143,625,515 *0DC6824B480AF443BE6B7DDB40B4CBBCB32AA5E4 VO+U
143,625,516 *0DC83AAA8AA422D03CF36FE585300A03B766291E (>_<)~(----8
143,625,517 *0DCB68CB114EB6FBD64C44DA792F3DC893CEE899 wa+aaa
143,625,518 *0DC6E370927663839860C09D16EC568E000AD250 walneyisland
143,625,519 *0DCD717021A0333FF53D050CF21578F0F80C62EF wanda.reed.roach
143,625,520 *0DC77B5725BC7D5A8FEEE169666DDB523DC5235C [email protected]
143,625,521 *0DC792AF41BB22780EC8BC9D9F607C4747988AC4 8ALLANHBSW
143,625,522 *0DC85D574E06F44053226112E29CCEEA0438CC74 WARMTEBESTENDIGE
143,625,523 *0DC25DE8B5033C6C7BCA70B64087A20505EEF6AC WARRENAPPLE
143,625,524 *0DCFDFAEC4F194AA43F9BF7FAC6FE3DE93A1AFCF warren.mull
143,625,525 *0DC8AB2AB09C5928B3EF3E84ABAA17BB4EF1C936 8HOLOMORPHES
143,625,526 *0DC8EF96426EDAB0B6E060C33E8F12FC2EA8210E waterjet1
143,625,527 *0DC4F217AA029F14C3E8E36EC54C453BC79CE90F WAYNE-ASTLE
143,625,528 *0DC90DA788081B32F009F96C2CDC2D5A6EC398CD 8MOLSONTRIDENT
143,625,529 *0DCFA72080185C5C5BC27C43A5830902E60B78D8 8####>***}O{
143,625,530 *0DCEB4A535FE78C5702498C3272ADD2569AD8CF8 WEAVERNEO
143,625,531 *0DCC4F5CFCA75F6436ADEF9969B285C234693855 wellred
143,625,532 *0DCAC12227320C26CAB48F60C1E24693D817CB87 WERKSTU8
143,625,533 *0DC997718C9F1C0FFCB20A6C1C92763024B19DFF WHERE.I.AM.TODAY
143,625,534 *0DCFD479FDE611F9BF38A626978C9FAB557E1437 WILBER.COAKLEY
143,625,535 *0DC229FF7322AD7AF6323AAA2BC0F033C8D1B4A0 9CANNELLONIENS
143,625,536 *0DC7EB2E4EE4CB1B6B24931D80112D8E9F601AAB WILFORD.DERRICK
143,625,537 *0DCB59C8962A7F5C16515D30C3011C653CADC454 WILFORD.YUHAS
143,625,538 *0DC6FBDF751551AFFE0FECC7986EFA774CBA28C0 wilfredogorka
143,625,539 *0DC2870BACECC0EADF95151F12C7E0B42C1BCAB5 WILFREDRASO
143,625,540 *0DC01E39E5CDAD8B4003C24F0C650D7EBA78F608 willardhandren
143,625,541 *0DC210E19B7850CB5C7748385517B8775AEC286B 9DERRING
143,625,542 *0DC8A69DE78C461D844176238A468786916534E8 9EDIEOLVEGNEMAS
143,625,543 *0DCE44F19F50DFD30BB942FFFEC68F9335ADFE32 9f67890b84344658aab78552e9348a4e
143,625,544 *0DC6C8AA60CECFAB310F673B5C455857A9B9CDF5 9FABBRICATE
143,625,545 *0DCE8861CE863C165ECD8B8D2C0A6DF2775AC3BA willischavers
143,625,546 *0DC40FF8784093308BB8F2C54FE6AE84BEEA4A8A WILLY-JACKSON
143,625,547 *0DC44A1554AA9428D447F826DC0878F1B76B59A2 WILSON-MELO
143,625,548 *0DC43B25BF2AFFCA0DE6B6DCCCB1E59599CCE7BD 9KALARKO
143,625,549 *0DCB47E60DD1A78202748B55C140E86BC4744664 WINFORD.REYNOLDS
143,625,550 *0DC1D2A2C4705C899EE51C4A2560BF28552D5ABE WINROSE.MAGHAS
143,625,551 *0DCE91A599E7A7081706B995063C57445DB7E308 WKZ9931
143,625,552 *0DCA6CA6A0D25D29391B68E2F3DDFBB099517819 WLRTAB:JUAUJB
143,625,553 *0DC7CDEAB5CC4720D22492493AF44579EE676974 9PORCELAINIZE
143,625,554 *0DC6F3AD7B81BD60EF426CB965DD3308E8AAB816 9PRAECIPIO
143,625,555 *0DC21A096C5C6D5D365215AFCCB3AF7D4C08A3B4 9ROMANTIQUES
143,625,556 *0DC8BE11E7EC4086A46129AE1A65BBE921F1F5E0 9SCHUFFENHAUER
143,625,557 *0DCC23C9F99430AB2CEAE048F1907C543C5ECC1A [email protected]
143,625,558 *0DC85639899A6589A38E08DD127F739C4CFA200B [email protected]
143,625,559 *0DC85709C35BCD98B5ACAFD92AA7A55C6A486A04 9THATDENALI9
143,625,560 *0DCE3D70AB8003AFEC0FD49CCA6B7237DCDC8013 9TSGIREFFOTS
143,625,561 *0DC6A6F16DEE4FB3F7EB2F7B76801979EDA8F089 A,(?
143,625,562 *0DC785047B6E6805B36E64590E50AB9B8B13C0C2 A0(8N
143,625,563 *0DCB08D0AD8476C9844F13A2007A6F76490066B8 WYQT
143,625,564 *0DC0142BAB9BFCA01C564B62647ACB85DB52AC0E A3vq
143,625,565 *0DCC174998290A8BCA43A1DCFF8204EB39B0C90D [email protected]
143,625,566 *0DCFA96FE2804E83A939A3AC616DFF780895AEB6 xianna-ladoc
143,625,567 *0DCF04F1CC1011FA2E252F05BFE94A9B9731D315 a7aav
143,625,568 *0DC6E0B72F2EF3A6955D18B3A7DE04F096D2461C xj+
143,625,569 *0DC8F534A3C0DFAC7D26376C14064121677EBD1B xo>'
143,625,570 *0DC2E5C2C634D939F8969CBB27D71D4192FFBD01 [email protected]
143,625,571 *0DC4CDEBD54FDDD78BE4F9667A08F86B1A3899D7 aaalacrosse6
143,625,572 *0DC0C6625B2AEC70E8EE2D680FA486E0BC273FF8 AAAN*J
143,625,573 *0DC88866A9B48AB6C23F90421D94AA6F5E84A544 [email protected]
143,625,574 *0DC4266EF29329C7143C6E6C7159592237FDE880 [email protected]
143,625,575 *0DC51B265C9EC471CB1164C5E478E6321FCA73CD aac^u{
143,625,576 *0DC2F5B4870912312E6CA0CDE5E63535D8D5F51E AADEN28
143,625,577 *0DCC490E3E08B1284D96071E40EA8235CFA9A0A9 aad:k)
143,625,578 *0DC3D31D752AEBEB7503520E44097F3BE2ECE7DB AAEAE1
143,625,579 *0DCE0A5D71578EBE16899F3E9DB11B9DC7758274 AAIQ
143,625,580 *0DC85A7CB517ACB20F38C4E350AEC915ED278CE5 AAN;C
143,625,581 *0DC115E692A3C98602E4F54A4C7BB2EF9EED791E YAOSANDYY
143,625,582 *0DCD27AADDFA125D378D5F1CD2017868DDDA09F3 A+B9U
143,625,583 *0DCD850F6B086A1E03F22B3C963A3EB5D468ACF7 ye)d
143,625,584 *0DC10C549773563D18C1079472D16E3220DE7B41 abercombiing
143,625,585 *0DC21B414D1B0ABB1FE061C8D102D62C1A53C91A [email protected]
143,625,586 *0DC7A94D8A59E3496A811C2CF7378CB45194152E a+b"k
143,625,587 *0DC4093ED46F47657789258E4C548A5E7E0A125F [email protected]
143,625,588 *0DC1ADC3E398B41769EC59704618A757E2846C8F yllacol9
143,625,589 *0DC88323B751420C3FE8F16435DF36EA9F428A0F [email protected]
143,625,590 *0DC966C94A9D0BDC2462576188C4642F0EC4D07F A-.%C
143,625,591 *0DC618A0EAC8B3A6880EADFE6281EF9C1C9D1B1A [email protected]
143,625,592 *0DC475280EA602AC38F1007ED5CCC942C813FB6A YTIRUTUF6
143,625,593 *0DC8AD0DBA996D5D3E0B546AC33CA2C3C85E99D1 [email protected]
143,625,594 *0DC1680FB079CF5247D68BAA3241FC1AC59C960D [email protected]
143,625,595 *0DC13A07A6816E17488B1A3B6F805D70EE10066E YUIKA-HATAKENAKA
143,625,596 *0DC94A6EAC94E3C65F043478D4E26391CAE685CE [email protected]
143,625,597 *0DC25EDBE6147349D79F0B80CC3ACBE6DBD46FC2 yuzuki_chii
143,625,598 *0DC0E272FB7B1422D4D37FCDFC5C6143CFC4DBE5 yvette-wickham
143,625,599 *0DCD1CC69B6768BB769AD83C846B2C44331D1717 Z146380
143,625,600 *0DC44D34E64DCF987FF5DF5666E68985152824D1 zacharydjames
143,625,601 *0DCFD1324954B383EE8F0915A6488095FB15A958 ZAHALOVANIED
143,625,602 *0DCBB1C0F34E0435A65D46A0D3A185A85FADC5AD ADarkPower
143,625,603 *0DCAA856A708333EBD7855C5B327BA7C0024A2D1 ZALEHAEVANS
143,625,604 *0DC57FC4BAC73174161FFA6BBECF4A8578F4FE06 zaneleramasobana
143,625,605 *0DC046A6C27F55FF9D574497477EA8906EAEA682 zanespadoni
143,625,606 *0DC21A6279EC2A16C86A5B987526CE94372B438E ZANGAPHEECHRISTOPHER
143,625,607 *0DC05809609ACB4E52A94D75C099F11923BEE521 zeannah.belses
143,625,608 *0DC13FC8A80413159FD69D1FEA6D5CF157DBA229 ZEPHYRWHEELINGGED
143,625,609 *0DC44F359D4C35C811F2DB07C9DF220C74488E18 aduv
143,625,610 *0DC69773B6140E893043DAB801499A36C35E9CCB [email protected]
143,625,611 *0DCE4124EFBB572BDC9A2FA81F5014DE87420D24 ADXMW
143,625,612 *0DC20DD8572F90880B99FB065F7A2D882F021B16 [email protected]
143,625,613 *0DC3F6D7706B1A4DF54E7F193AD41E63F18581C1 ZHENGBIN-DONG
143,625,614 *0DCD3154E0FDDE26F7569A0E21D2A343BF07DF8A aedlestesed
143,625,615 *0DC7475D56B7CA3599311C03CE492BB90D4ADE33 aencrages
143,625,616 *0DC4C2C6045B276FD1FD44A224BD8F45BBC34048 aerk9
143,625,617 *0DCC11E405A6AE0C880D1424F9601B1B95A55522 [email protected]
143,625,618 *0DC80050B4BB58080926FED489F75E0610BA42D7 AE(V
143,625,619 *0DC0E1B4B31A66BE277045030981125AC2493428 AFANTOY1
143,625,620 *0DCC872EB9E112406691BB21388AAC8FDC3ABAA4 zoraidedgarciaviera
143,625,621 *0DC5EE8193A7EBD018150FB3E5C249616BE8E6BB zrážkovo
143,625,622 *0DC8822B6DB7CE0B15C9F85358D0FCFCC0840DB1 AH#4B
143,625,623 *0DC5AD4361AD1606358C0867EA5D09DEFD41B627 AH89I
143,625,624 *0DC7A4E74BB53BDFDF9092105E592A44EDEC1713 ahkup
143,625,625 *0DC06EA43A4A57D14457C16E038BCEBF3B7FFC92 AHMAD.FALTZ
143,625,626 *0DCA306BE9B96283C33E4EE60D603EE151B0046D ahmedhessey
143,625,627 *0DC09F596E91C5E441B493D05E256C2A52616588 AIDA ROBLES
143,625,628 *0DC895EC5200E741F6C66B3E3C14CC3A6540EB0D aieun
143,625,629 *0DC7CC5DFF7C62169D08844B58671F0E4957DD3D μονήρουσ
143,625,630 *0DC95DCAEC79D6797AD36AE67FC8CF86D6663A31 airunalp0
143,625,631 *0DC0B43E8C7B9BF98239BE084370BBE5CC6EA2D0 AiUe
143,625,632 *0DCF575184A95F2F1B74905315EF48B9CD1FBD53 AJLS
143,625,633 *0DC1060EFD79E1500AA9B57A9EE378B79C3498CD Akds
143,625,634 *0DC25E251443026008028655A45A6C0C66DB7649 akiuber3
143,625,635 *0DCC54527E8B1FEED9F4AA4906878D7EB15C0EBF AKOMULATORSKIH
143,625,636 *0DC5BFFD96F7F2421AE964611DAB7FE323EC79FD alan.hamon
143,625,637 *0DCFEC4E6A2FEE6C449C9110A2D5FC6D8831E758 aldenholey
143,625,638 *0DCC1AA1F3531D410F6EA05578081F8D89512EEA ДЕМ’ЯНОВИЧ
143,625,639 *0DC88C873AFE4B962477F01ED342BF861845662B ДОНИГТОН
143,625,640 *0DCF54EA5DF10C6E20C93F12FE2405613BDAC474 alecitalia
143,625,641 *0DC5B10C945C4EF8AF87335950D675F23D1F211B ОТСЛАБЯЩИЯ
143,625,642 *0DCBC95BF66332420BF7360A51353D76DCFEBD68 alexmeemken
143,625,643 *0DC087CAABD46B155E96FC867C03622DA2BB9963 [email protected]
143,625,644 *0DC7656F44B3FEC8D70E62C3CBE958178F46A74D ALISONELMORE
143,625,645 *0DC6D1EA544772492710A0A3E74E02111147BB21 AL!L1
143,625,646 *0DC980D58CEE8E37D8BE70E42B16C37F8B6E47FB ALLANMARKARIAN
143,625,647 *0DCDF5B9AF3E02A80CA4FFA4A5E2ABA38BC95B07 ALLIUTOD0
143,625,648 *0DCAAD03A4DB4D26FC551486492EF737DF5B53A5 ALLWEARE
143,625,649 *0DCD230504584F51C3695A59810E686F44D1F80D al=mq
143,625,650 *0DC54DB914AE935F57905E069C38178B81639053 ALO;
143,625,651 *0DCC5AC75ACFA88C49BD89B692DFD5BB3C06B3B5 [email protected]
143,625,652 *0DCDB5BEFF8FFF4400D47FF453E96A6188D1FF3F amarqvardsen
143,625,653 *0DCBD384E2DEF7BA6F74B4DF26AF9AE43155155C A.m'on's.domicile
143,625,654 *0DCD32ED20FFF4427DBE85935DAD231159FA2E38 AMOUNEYROU
143,625,655 *0DC77DC314D7015E2CBF2B3668639F99F8F1BA4B amplication4
143,625,656 *0DC0DC1E86C85C4C55833B75B2B6D43BCB5CEC6A amwsk
143,625,657 *0DC027D889A74DC0D448D612F8EF4CD14A07FE66 AMZUH
143,625,658 *0DCB52D39BC275BF0474490537526F4D8869EC6F ANDYBANCROFT
143,625,659 *0DC566BFA83362600D758F04BB7BA68A6CADBB62 ANFA'S
143,625,660 *0DCF2C007F3A05BEE9EBC9991C75BB33AFA9C34C A;"NH
143,625,661 *0DCC1A4ADB8F36634E02617FA2C6038FA00D8E7A [email protected]SINAMANCOM
143,625,662 *0DC141163605A501BF6BB96023B567813828CECE [email protected]
143,625,663 *0DC1F4FA9539CF271FEFE3B4A642E70BCA9CAA1B aptavelu0
143,625,664 *0DCA578BEC3463AE51983E362334E4A540B5219A ARDIANMANURUNG
143,625,665 *0DC4EA2C5FF6400B743BBC9A46B67CB76D0D550D ARLEN.LOVERIDGE
143,625,666 *0DCD57A168CA76494FB8E87E59D85341D7A03925 ARQU.
143,625,667 *0DC6924F073740617E5ED9DA6D06EAB7AD045386 ARTHUR.ZARRIELLO
143,625,668 *0DC5D5D02C5B3E3D46B847F32F8EA2CDC79B0C93 a#s(%
143,625,669 *0DC492BCE3A85F7C016CC951DD40A5B8EEA45521 ASACONTREROS
143,625,670 *0DC44E6C519EEA612FA257FA017136E9AACEC976 asignado1
143,625,671 *0DC54907D6E7D06E672BACE5C22D32EE9A18E8EF [email protected]
143,625,672 *0DCE618393D0D94C075C5607F9BA36C5121A5CA6 ast%
143,625,673 *0DCE46549E33CDC552165F8F38F58515D9B45C1B [email protected]
143,625,674 *0DC7EF030B52D6254FC2D7A4BE735FA2F1644B0D ATHENSEUMS
143,625,675 *0DC75CF9ED1516510771B6D2BEC97FBB295D94C2 a#.tn
143,625,676 *0DCCA371A0EFE8BADC0CFCDD5C27AD3911D8A332 ATXIKIBOT
143,625,677 *0DCAC35686717CB926A161C8495572B8A47B9D4F aundp
143,625,678 *0DC0E9BA94851D5735B57E66D679CA853107C8B6 が生産する自動車(suv)。
143,625,679 *0DCA58C9B428FD0C71A7E40CB153F82D016E352B “AVENTURISMO
143,625,680 *0DC79320C1BE2492C21EF60FEE776FD2C13E8467 avn-i
143,625,681 *0DCC0D6DAC9F011FD22C37BB7A3137110A99D27E avoidantpersonality
143,625,682 *0DCF75AE713B9CE285B41A65285F1DE4CD7E098B A=WT/
143,625,683 *0DCCA67566DE9003FC907BE03289B5668719885E [email protected]
143,625,684 *0DCFCC84202BEAAC4FD54E0B13871D88F45097D7 A/Z.K
143,625,685 *0DC1C4F6CE05210C203751B308DFAD8C99C0FF0F b####@ ~0~o (~_^)
143,625,686 *0DCB4D69D3E967354929B17C04A243DE9BA465AA >B0 O~ QP
143,625,687 *0DC474305FB4D2C37C10650B0292213FF01A5A23 B1HG2
143,625,688 *0DCE666E22C28DD781FC1BE38173D8EA1F35DA37 B2WW
143,625,689 *0DC8A1C3A7EC507911C6B3DF6C20CDEA80CB8D1A B4RW)
143,625,690 *0DC0E355DCAF866349B36BDC26433F34435B1581 B5050-RAFFLE.BLOGSPO
143,625,691 *0DC8378C4417E8653E048C50F1DB3ECA9737CD59 b8lv
143,625,692 *0DC5276803220E688AAEBE77A9457124468934F0 baandhavaa
143,625,693 *0DC1F9E5D61AA60118452DB090786D74D2888014 BACK DOOR (LA PORTE D'EN ARRI
143,625,694 *0DCD1C9DC7591CF3B426C3AA4CEAF45F9ECC2126 BACK.ON.TRACK.(BANG.BANG.MIX)
143,625,695 *0DC3F5BF6A3728339C9262C01CBDBDB80AFF8FE9 baffle?
143,625,696 *0DCB5BB81C88BECAB360D407530F44DA1B9B8F2E barryrykiel
143,625,697 *0DC7919A618EEB67B9083B4C0036CDDC5B0023A5 BATIROV
143,625,698 *0DCE29B572221529162FF06488822F67B6BC9FE5 B;B=B
143,625,699 *0DCB9188F1BF4A99B23056A00B98463980A7F45F B"BHB
143,625,700 *0DC585FE44C9FA63A1B31FC9E7926076CC79A8FC b_blb
143,625,701 *0DC65FE1CD73070F3ADAB67C7973D8F0C3ED33A3 b?d4t
143,625,702 *0DC5E95C419D5D0D2D3DFBD3A091F6B5B9BA73FD be9122229122
143,625,703 *0DC8D5D922E73563A833E7E265EDE71F4C834AC3 BEARDWITHOUTAFACE
143,625,704 *0DC992FAC2BC34B7FAD879459612CDB8BB2B09FC beautifulbyebyes
143,625,705 *0DC71717E198A5BE510F0527A5EA18F1CD230849 BEK!-
143,625,706 *0DCA910241CA585957CDD624877574D39D0AAF5D BENITOMAROUDAS
143,625,707 *0DC4CEB9935A535FD2690EDF96E5B788618734CD benjigarcia
143,625,708 *0DC79D3C77A3BF6A6A0A647838777089D6406C6E bernsteinled
143,625,709 *0DC206C7D44BADAF3E83C9968970D8CF5101EB32 02131188
143,625,710 *0DC0DC7F877F887A294FA80B197D2286A465C031 BF+DH
143,625,711 *0DC3A50A62F13F7E4BEE3C4DC27E5E4520869DBD B.FK0
143,625,712 *0DC9C1BC99F3F2693EF659357A66D13D9700D946 BGG9L
143,625,713 *0DC058B0FB413357C56BED3F093317CEEB6FA8B3 b(h"
143,625,714 *0DC6D38B0B021023BAE4965632F39CEFDFC25CBF BHAJANE7
143,625,715 *0DC6E584E9A4ECD9B4683DBEDBF8711D5817A086 B!HV+
143,625,716 *0DCAA6872FC69C81352081C260D86D10520B0B1A 068marlon
143,625,717 *0DC9EEE159A7E311BA5821C0B8914870B5D21C66 BI.AK
143,625,718 *0DCEA38842BA10208CF3D8036579C50450E463B3 biaoyan
143,625,719 *0DCBA250942FDEC7BEEC712066A99D93BA0E068E 072shyann
143,625,720 *0DC8E47ABF350A3A7A3D563F877B9613D1BFD8A7 BIGWAIST3
143,625,721 *0DC58F32B0DB496F116CEF9E7F5C2A4AFEE221AB Bijspring
143,625,722 *0DCEF946702A928C253B6C79DB602B06BD0C5D7B 0IAMSTEVEN4
143,625,723 *0DC73D6AD20DA089859C49BB9A84FA8D9F9859E1 (>_0) o~<b
143,625,724 *0DC1ED56E47179B6571C2F592AE86F309402EF16 (0_<).~.~.~<###p
143,625,725 *0DC9A6CE8865D0677DA2CCC7955D36EF0647F1F3 bjbkm
143,625,726 *0DC45477E40948389B44830DEF04C4F9BF2C2B0B 1046514 MATKAAJASTA.KAKSI.VIIKKOA.ON.VARATTU.TY
143,625,727 *0DC0F3F382B738648A5E3529769DD86051F71DCF 10.LUNDY
143,625,728 *0DC07C6959264C033810338A48999D6E81A81B58 B%KC0
143,625,729 *0DCC34136B8F1110DAF4A3253E6CBE03C6077568 11 M
143,625,730 *0DCE3DE9EFBE63A275B6215DF8F87A3DC48CB07D 12:12-#-&ILLUMINATE
143,625,731 *0DC88A12805C0C98E28E764E69A0133F6FD2788A 1296191 SO FAR , THE DEMOCRATIC RESPONSE HAS BEEN COOL .
143,625,732 *0DC2893F7113DA935995E6E4E11FC8FB01BCB592 12 KAUPPAPALVELUJEN
143,625,733 *0DC1E2B1C3576909D842B29BABF9B61475AB5658 1312389 OTHERCARDISSUERSHAVESIMILARPOLICIES
143,625,734 *0DCFC7543655D8A5FA1722DAB3C65EFC34C60A54 131501 KARHUVUOREN-ENSIMM
143,625,735 *0DCCC887CE2294A6F1532DCEE1F058BEB335FAED BLAINESTAMEY
143,625,736 *0DC583A84D9EC2340F33CBA72DDECD9C7A749F5D BLAKE.BURICH
143,625,737 *0DC1E0EF8FBBDF3751FA14CBF93F603B19F6C99C BLAKE.LEFEW
143,625,738 *0DCC93FFCA61C64158A0EED8B89B107BA0BF4E2F BLFDR
143,625,739 *0DC50407D3E7DFF82F95F2A916C12F1D354F7B9F 1399788 seksuaali.ja.lis
143,625,740 *0DC81617BAFC6D97B35371930DE4AD59A63A6293 14101082
143,625,741 *0DC0E4F7E69249A8B31AB6F3290C97CD57FA4180 1439285 SAMALLA-SE-ON-PARASTA-YHTEISTOIMINNALLISUUTTA-
143,625,742 *0DC321D0EF4B273DC86464A63D9B6FB0DAE852D2 BN)s
143,625,743 *0DC2A344B5D21832C788AC17C43404E13B698FAC 1651387 OLEMME-MY
143,625,744 *0DC74C6F9A96030D5148A258A3CF0D7AFD4104B2 bobbydinitto
143,625,745 *0DC000CB30D962A0C2D437FAE37BD832ADD4AEC4 BOBROC360
143,625,746 *0DCC68E8CA5B99CD106D08EBA5CC3BF6E21416F9 BOEA6
143,625,747 *0DC93A92AC57D4D2360D8A46CEF874E3420A46CA 1697332 kein-arbeitsplatz-mehr-
143,625,748 *0DC8D1434E23BF8340557A365C62806271D5DEDE [email protected]
143,625,749 *0DCF9D674CA2CBEC334FA44E3ABC3FAE1372AF2E 1935696 ERIC KAM SPAETER NACH FRANKREICH
143,625,750 *0DC8041ACBDD50D1E3391DDE2F2356E1B01CD524 19411312
143,625,751 *0DC63FA3020763FEC3F7F6C978DAAE06796D0A55 1963026 bochum / leverkusen , 9 februar
143,625,752 *0DC3E8CA5D747AE670D7FD2819C37DF7B58B4FB5 b_q0,
143,625,753 *0DC279BC9FCFC215575E42C236B522E89C6373B2 1accra
143,625,754 *0DC97DE791CC3DD70385412D2337DD2AC6173843 BQVLQ
143,625,755 *0DCCA9DCF4848A0AEFFA128B37033A849E5A70C4 1ANDSMILE
143,625,756 *0DCB78F9329D2187747B8853F1888D6CBD2389E8 br3nu
143,625,757 *0DC4655643DB292DD300BD98A666063768F63811 1-BENZINPREIES
143,625,758 *0DCB727564EE8F0A1088CC1321278CB26620D0E8 1-BROR-AXEL
143,625,759 *0DCE581594E9E603D38031961BA12FA0E30176BD BRANATE4
143,625,760 *0DC1D2BE27F6271F2C82F96A344488F0404C7BBA 1.CLOUD-ENSHROUDED
143,625,761 *0DCAD034D4CE30E2A9E605CD0340D5E22B840644 1.CODDINGTON
143,625,762 *0DCD4D110F0DF2245337B440F6553D116B5E9708 1dudenhoe
143,625,763 *0DC3DD6DAE9F381AF9697CEB2C143435F3D03E5B 1.ER
143,625,764 *0DC4A9F5A4F78C68EB413B9728FF94129B137769 1eryamallah
143,625,765 *0DC39605C4444DDDD0A247A6C1E4176CF6F2A66B 1-esinlenildi
143,625,766 *0DC3DCFF74D9633772BB3B2A05DB25641091F0B8 1esrara
143,625,767 *0DC820F93BD9E620D51C14BB27A562A885461EBD 1-eva-foam
143,625,768 *0DC846DA58F51ACA31E1E83FDC316482C7D7D864 1-FOKKER-ZUKUNFT
143,625,769 *0DC502C949C9301F209D3F8DD13161D03B6813D8 BRET.GAZAWAY
143,625,770 *0DCE6570C75AEC2FA200690D05B761816E3CA773 1-GATED
143,625,771 *0DCEC646283AE94E58F4A169F28C27CC9F3E60F1 BRETTRIDEL
143,625,772 *0DC6EE714283E76755045981B8162835DA912ABF BREYDON-MATTHEWS
143,625,773 *0DC5715EE05C6FDAA1FD3EE04E04081B1EE9E4CB 1HEIRETUJ
143,625,774 *0DC0EC5B1F359BAAFC872B32271B82A4E166C576 1 KHALIMOV
143,625,775 *0DC600483D1C3F1A0B71EC10C2DBAF060AB97D5F 1 kinomonomane
143,625,776 *0DC58F5CD67170FB7BF52881E0086337F8C3C971 BRUNOMAJCHER
143,625,777 *0DC724C4A38E036748704CCE5FAA03CA91C55206 brutales!
143,625,778 *0DCE946CEA4C99F66133DDBB19F5E2E8DCEBCC51 1-LATTARIPUVUT
143,625,779 *0DC32D25F535EBAD24BA931F909C5927F55F7A09 1-LEHRAMTSABSOLVENTEN
143,625,780 *0DC763AB76EDA15C1D76C389EE0ABDFE0C00D65E B:S_C
143,625,781 *0DC7223FB08E401F93A4823F5C8F6BFA8B86769B 1.LUONNSTA
143,625,782 *0DC6333CFE0509538F40F37B3AA589E0AC11400A 1MeRi
143,625,783 *0DCB535B2CD9CAA238D87D5CED95226D30577C09 BSU"K
143,625,784 *0DCDE54D2687F9B5B4C8E9DC98590FAA6094F1AA 1.mrld
143,625,785 *0DCA29CACED63866B6A0A77D4AE147817EA62CE3 BSWENDORDERBSW
143,625,786 *0DCFBAAAF2D4EB8B154C6F6151A8840A20FE1114 bswsupporing
143,625,787 *0DCCD959E346C296339B7F7DD0D6B78F22637696 BSYUY
143,625,788 *0DC5A291B156E7EB75B65F3A95B0913FFF079782 b$t6l
143,625,789 *0DC2C4378FAD74048057912FF2EF65E455C89C07 1overwillingness
143,625,790 *0DC5F4B4FDF18BFA54E9B58FD88750A2F75438B1 BUGLADY440
143,625,791 *0DC2FE8C65FBF072CA277E624E98BD55DA033596 1 RASITUSKIPUILUNA
143,625,792 *0DC5F8F1001561D41A40EF0CE0C299D4B0735BA9 [email protected]
143,625,793 *0DCCE1C9BDC7773CB160E1858A9AA347166D7ED3 1.REPUBLIKSCHUTZGESETZES
143,625,794 *0DC0ED1F9775A8ECAFE0F3AABAE9E5698B0AB9C3 1 RESTORED-FOR-THE-FESTIVAL
143,625,795 *0DC08CC445D8DAC953E3E10B330D1093AE85F202 1RMEMEINN
143,625,796 *0DCF2F32B479353732E54CB2AF9B077D3E9F4678 BUNDESIMMISSIONSCHUTZVERORDNUNG
143,625,797 *0DC45F27D6F44F543EF7C701C84F82A6254DF69E 1 SCHLACHTBETRIEBEN
143,625,798 *0DCC51AB6501EE57626C4277DEBC9577E6123449 1steuerorgane
143,625,799 *0DC9BAEAFFA1E6F2BFC84872078932F3D95C7DE8 BUU;
143,625,800 *0DCD2A5C876102EC72DD628C564C70ED1B571631 BUUUF
143,625,801 *0DCEEA0B34E0A7C9013BE1FAFE16FF1F42698DBD 1.TEHT
143,625,802 *0DC83D3876F09ADE52315892CB60B5E7B1A6383A 1thatholly0
143,625,803 *0DC095BC21B2C9FD2AC318ACEA48236ECF3B470B BVgv
143,625,804 *0DC5BB5E77AEFB2DE012D41C374A186296DAAC1F bvy3o
143,625,805 *0DCC4DFE08F5FC7165FB9AC52A62E887BD711D9C bw&?
143,625,806 *0DCE30AD77DEDAA20FF6923F21CD05E31B751D33 1tweetie
143,625,807 *0DC72AF4B9F10C069EDF5EEF56D8E3664EA1E935 1UBBERROTH
143,625,808 *0DCDFDEFA82A715CD9052F4839A443C5A620C4FF 1.virkamiesliitto
143,625,809 *0DC358876AD157CB3D0143A1AAD8DD2611C1B52B 1.vollkaufleuten
143,625,810 *0DCBF92FB0CE272ADC604A034086B680AB444629 20001207: Groovetech
143,625,811 *0DC5CBB806B7CBB43EEB9F4FB7B88FABC680A00A 200189ROUILLON
143,625,812 *0DCE43849A3A480EB1E5802D1AE6385AE5840409 2009F1295GL
143,625,813 *0DCA5465A9F1439C7C937F2D57EC87ECF2227C7D c.-
143,625,814 *0DC4079BEE88F07FBDC0A7D830B43D907AB3C697 21october1128
143,625,815 *0DCF75A7DDB8E834A37DA28E3379877DE3244545 22ehud
143,625,816 *0DCCA01AB285283C82841FD490AC9809C297E97E 22rozpoznawanie
143,625,817 *0DC1CC51754832C3C9A5F8FDA61B7687836BEE42 23.opetuspaketin
143,625,818 *0DC2763FC2A64E2A389D91758C3E1E95388AE025 [email protected]
143,625,819 *0DCCC87B3606111E5F401564838C36ED4A4D3830 2408362 HALUSIMME.T
143,625,820 *0DCBE3A48CAD0A4B83583CF758166FB480771490 2529872 JOS.RIKKOMUS.ON.V
143,625,821 *0DC95A7CDE69E2E339934B10E42AE9A1042AD1FC C,0LJ
143,625,822 *0DCCD270263E912A43FD25BF085AF29C507FA742 257971 fotograflarrenkliveyasiyahbeyazolabilir.
143,625,823 *0DC55767BF319788E73A594712D90480564CFB24 2656131 KORTTI ON VOIMASSA NOIN 40 MAASSA .
143,625,824 *0DC32EFD7F1BD16C235B3423CEDD838137A5FBF2 c15081568
143,625,825 *0DC6BB8C98B4C9E5BA539D0EA5332A92D695930A C33.22WHO'SGRAWP?
143,625,826 *0DC11C66B275D66F95EDCD552F7EDB1DC4DE9E68 2914745 this approach is fundamentally flawed
143,625,827 *0DC5095ECF3D0662235325F1B66B3CDFF4CD195E c&3km
143,625,828 *0DCE25684C4C4C59C2CCA834A4831D126E40974C 2942543 k
143,625,829 *0DCE63920683FC6E7478960AF1A80FAA2792040C c4cw(
143,625,830 *0DC1FE11E3DB163493BDD1E4FF1AA7AB9FA5CFC0 2 DOPING-SYYT
143,625,831 *0DCF56764B6F5C223880AE963ADECE901872E97F 2-ERIKOISPOTTIA
143,625,832 *0DC1303A09F76E96025547E317B2F90D14357F8E C7FCM
143,625,833 *0DC1ED7986BCF011F4B777E94190AE0876A626E9 c8=io
143,625,834 *0DCC458E16A213F9D603941FC5B30AEA613173B3 2hyv
143,625,835 *0DC7CED92C0EFEE1F708A4B03BE7597FF3E80914 c"$;9
143,625,836 *0DCF36D588D9FAE668EE92981AC2BD3BA130CF4A c9lmk
143,625,837 *0DC6C7F0388C8144C9AC75FEC874F63A642A1FC5 2-KRIISIVALMIUSJOUKOISTA
143,625,838 *0DC797100A2516EDDA4A62D758E3E60E4A4C0336 CA7T
143,625,839 *0DC3CD8C85BEA0CF3AB4F1F6443311A089EE9D3B 2 luonnonsuojeluyhdistyksist
143,625,840 *0DC87833B2B8F0560A67F5020C329C3653F12887 CADE494
143,625,841 *0DCEB6119C19DCFF4375624A46636A9ADFDD4F1E CADE BALLARD
143,625,842 *0DC245B64BCA9670E8466CEFE10AB5F42A51C29B CANDI
143,625,843 *0DCEC44B77FE5AB31246D858721AB78C52D1CAEE CAREFULLYTAILORED
143,625,844 *0DCC6FCBC3852DB3ABE3537486904A6606138F34 CAREY.SWEERE
143,625,845 *0DC256B374017D23FA1341AD8460B4101E0D8342 carmenbia
143,625,846 *0DC6CBAFCEFD280291B1FDF3EB14F81D9637AC4C çarn
143,625,847 *0DC20B2DA5153A2F15F5C00C5AA27521D96616F9 CAROLFIX
143,625,848 *0DCA88BD38C95F27A8DED50C0528E4D01DB92FC7 2paperiliitolla
143,625,849 *0DCBC0485F2CE4D6F9B2CA8C35AA69FED62BCCCD cbem
143,625,850 *0DCBCC2277333A2F77C4DF5286577752407E55CC 2SAZIERS
143,625,851 *0DC97DC7598F776DFBBF20663FED847C95F0E07B 2 SELVITT
143,625,852 *0DC99011B5D8CCABFE15CCE8EAFF010950D5C7F1 CBI%D
143,625,853 *0DC12514D7DE030305E4C6D714051F71A0EB3161 2-skalsko
143,625,854 *0DCB52A2831B6E26501842DDCA7AAFBC3F1CAEDC 2THATASDFJKL9
143,625,855 *0DC5BAD5E855EBDFD4EF0C804B317A2ECBE28D6A 2THEITALIA5
143,625,856 *0DC7CB77AB58C9AD1EB1D0606527D892E43C7F31 CCDW
143,625,857 *0DC9C4E1B5614A7D47AD01C61D0662EFB852595B 2ZEHNWOEC
143,625,858 *0DC087B77683CBFE378704A195CC71B96E86D1AA 3050QRN
143,625,859 *0DC5084DC0EE46114A72490EB941E3E9EC3EF984 CCnI
143,625,860 *0DC289ED86A9B85F29542E8D0F4209B8AE905C6A cc!&s
143,625,861 *0DC5F0824FF0E1C1D81C64CAEFFC6FA30C260CF5 CCST!
143,625,862 *0DC27D87E9D50D7C76F0D539B8695B9CD2054B5C cdm5p
143,625,863 *0DC56F79170E86CF8B017697AB0C4912413E39B7 cdw28
143,625,864 *0DCDAEFADF11B68F3FF6FFE3C12E7896F08DC0E1 c=e17
143,625,865 *0DC273775DD478460122F0B8588B1133BFBFC286 CECIL.ZABKA
143,625,866 *0DCF6CD3B04E33AE81EC9BB18497CDEC77746545 3:--3---#---&---HOLDINGS
143,625,867 *0DCDF49215A933FC3480F17582F9FA2D31A86812 cer0o
143,625,868 *0DCA95F61B13F150D29ABEB74F41942338DED4F2 cerj/
143,625,869 *0DC33FE6D6BF9A64DF2BBF688191B55F5B4A4740 cfkrpbhi61
143,625,870 *0DC4F515A4058F47154F11691F76BEAD4FADB4A5 CG78T
143,625,871 *0DC6760D4BED72865440690D13BCF67D48B8084A cgiw
143,625,872 *0DC54DB94A9ECF43D322A5CCF7ED014A1E871606 3======D* * *o><
143,625,873 *0DCEBD719C07A0634F643E407B514917E1BCF426 CG/Q2
143,625,874 *0DC165D574A3D0B83751DF8B2343D0D3C6B5CF55 ch8jbn4aytbw
143,625,875 *0DCBB866DB9BFF8A020723797BB36E1FBB8AA2F9 3fovhperj8n
143,625,876 *0DC555A99106CE98B2E4F2E9BEF623AEA3661938 3HULLINGN
143,625,877 *0DC238598BAD0C024A25CE2ED7CD8EC146FDC4AC CHANCE.LOUDERMILL
143,625,878 *0DCC50B76E3A67396C4956CC74C23C005027323F changbilbao
143,625,879 *0DCB7F43C927C9EC316C81E3F146CFC590E8B1DC 3NONMUTATIVE
143,625,880 *0DCCE894C9B843C8D8D8F63A608996D3E8BDCB4D 3#).~O.~o(O_-)
143,625,881 *0DCA40D112651ADAF684559B264BB666E8330F08 3-prozessweg
143,625,882 *0DC08BE5623B3FF62BF210B12F66699D70AA1F8F 3-tutkimusklinikassa
143,625,883 *0DC7FEC558035F20187DE4E4924E525C34A776D0 402281 puista-on-pyydetty-tarjoukset-16.5-.-2001-menness
143,625,884 *0DC88A3FA571EA1CC09E831038DAFCC733FEF89B 41Σ
143,625,885 *0DCFD3A461E4D2AFA5F66D425AFB1E2FD6C97B8F 4:..4..-#..-&...HOUSEBROKE
143,625,886 *0DC6B99D07020ADCC3C4B98016F6E0F4B9C1BF79 CHARLIESEDENKO
143,625,887 *0DCEBE5BA90E1DF0619594713C9BDC9D50A9A1D9 464EVELIN
143,625,888 *0DCE63F3FB7A47E397E98A6C4E4D0EAADF508FC4 482RODNEY
143,625,889 *0DC423A435FA64C15EBD7AECDC777CF672B177A9 CHAS.MEWES
143,625,890 *0DC362A0C289DE02260D2BBF8EFA79C8B9844AEB 49C22680-EEE8-3A82-8735-337CC8F9A3E5
143,625,891 *0DCDAE4909749484994FAB2DA9A0C0AB086101DA 4DAMOUTH
143,625,892 *0DCFDA63F6BE0CE4CFF4E9F5B6EF0BA867E67F82 4DHVAJINAU
143,625,893 *0DC4BB199AB91190EE56B3FA2474D4195E95CB0C 4GORTDROO
143,625,894 *0DC76B7563214494B858375AB1EEB13A40ED6240 CHLORAMIN7
143,625,895 *0DC4F59E49A74E49CD7E2904083A9E9C15A6CBE6 4MAALAISK
143,625,896 *0DC920B085C1C49555C794D959F9A27FF5E8F3BD 4MLTLYRD
143,625,897 *0DCBE07CE14B9F62F601437DD7A2D664B5F6BC36 CHRISTA.PECK
143,625,898 *0DC354A81699AFF63AB5D3D64EAEF722541C5D9C 4PROKLICKOVAT
143,625,899 *0DC3739243820A22C3BB4792055C3971A2369226 [email protected]
143,625,900 *0DC266984B7A30F98006174B47B574876BA547AE 4SATKANE
143,625,901 *0DC8DBCBE43B342C2CCC4C815E9BF21487D2CFB0 4VENOSCLEROSES
143,625,902 *0DC1D4330C74AA9DEBE274D7B2A5499760745AAC ciprian-balan
143,625,903 *0DC13C1CDCA81BC4C4BB944B8DEF11EDB24AE863 CLABB
143,625,904 *0DC0275C0087350A5D356F3DD293EAA82B93C882 CLAIRE.RAISIN
143,625,905 *0DC0DE244F6A102D5496C7370A87A8F645270239 CLAIREWOOLF
143,625,906 *0DCA9B744F562D12B6A2752E541B22FF90D2CFCB CLARKJAHNCKE
143,625,907 *0DCE6446B3C196811AEB0A720FF7BB67353526CD claudeklemen
143,625,908 *0DC312B88B29EC92C9FA2824F69914F812092FBD CLAUDE.REDKEY
143,625,909 *0DC5E07ECFC635C1A2412CC924CC6F0A90D906AB CLAUDHOFSTADTER
143,625,910 *0DC99CCA764DD59F1D477662D2DD01D5B106407D CLEMENTLUCKINBILL
143,625,911 *0DCA781C3DDD7263929AEF40C06B44B1BF0DCECF clerics27
143,625,912 *0DCA0F29AE59F9F2B5A48AF17AEC4AF9DDCF56DF CLIFFORDCIMAGLIA
143,625,913 *0DC63144A83C3719495FCF7F5EDC1BE9FE49CD26 [email protected]
143,625,914 *0DC7A946F181C56E341E250CBFF872C8CB3F6590 clnnb
143,625,915 *0DC9C7308878FF40E6D2F0CCCC5908E24B2EB5AE 5BETUNGANDE
143,625,916 *0DC161780DBDF0DF90F979A5E1594F85886A7D7A CMCBUCKLES
143,625,917 *0DC5B74256979540A1FE09273AA49B5C4E2090F7 CMCVPSU
143,625,918 *0DC06B7E8A212404C2CDC4ED1F1E12C5DED4AA15 CM-G&
143,625,919 *0DC5F79A6B00E0D9C8F9ED2BB57B79AF32A7EF70 cmqsc
143,625,920 *0DCA368FDE1E306EDCEFB78F8BB292B56244893A 5C010P3NDR1N3
143,625,921 *0DC1A95F8817925FEB94989B6971E7E300CAEB65 c)np;
143,625,922 *0DC0BEA3DE3B356914333983D8EAE7A024F45B4C c=o
143,625,923 *0DC10B9168D8F0A9D6F2EA2AB3E794112F030BFA 5dateriez
143,625,924 *0DCB825F27B6DDF0ED1FD05487E94C8A4F4930A2 COAO9
143,625,925 *0DCD676B44866A75FEBCB7A2C4BE3EF41837B381 5FUCKOFFABIGAIL
143,625,926 *0DC857B27AC174F931B8528767619AC85403E760 COLEMAN.PENUNURI
143,625,927 *0DCDC737147CE6AB93BABBF7FE16CAC83A75BC1C 5LINCOLNPATCHES
143,625,928 *0DCCBA78654230FE520CC06363E5AF2265BD737E coltoneberwein
143,625,929 *0DCBF3447D1BBB7EC35B5E98C1E1F55F5A611C9B 5NEDPRIOR
143,625,930 *0DCD90A367488A2D882D491E6BD4FD6D4223C847 5PREKLADAME
143,625,931 *0DC61256130AACDC018D073C8BAA85BFD3012899 [email protected]
143,625,932 *0DC2552496A2374C86D4FC0A5B713EE6AB9C12B9 CONTENTIEUSTS
143,625,933 *0DCD723556B6DA36D96338F73EC32123FAC1E0B8 CONVERGENCEI.E
143,625,934 *0DC09403DDEF1164B590970959320E9A365F2D58 COORDIN47ED
143,625,935 *0DC952D80543C7F8A7B08E4D4EEB6D94E11B8EEB 5SLOERIESES
143,625,936 *0DC858F82EF984D9BE3F6022A06D1215074E18B2 COPPX
143,625,937 *0DC867E5E814B6C6D7BE9F9C57F06987869550E6 coronitai
143,625,938 *0DC992D8755173CD33F5D7DCE35CB4AC7AACE56D corrado-ramada
143,625,939 *0DC003EC98049A1AFDC9435B588178A3F063DB5B CORRUP+N3SS
143,625,940 *0DCF39D521B59EA8675723EC13063E6075B03B43 5up3r5on1c411y
143,625,941 *0DCC5F08274652A3ADF830809D1798C742C751A4 604LILIANNA
143,625,942 *0DCF96A71F02DA9E63964774973A8742032D5D83 CPC".
143,625,943 *0DCD3F4A21DC6EFC426BA5B7FD1383FB7A96EC37 cpi"5
143,625,944 *0DCDEEAF5DF551AAB9D9D5454F285DA5A11E0E1C 6HEHTAAREISSA
143,625,945 *0DC450A0445408B2D97F1A0B768CDE1B0D77ACA9 6MUSROLES
143,625,946 *0DCC32CF46DF4FCBA49AF5FCE1CAD692F29CCC1F 6myjoker5
143,625,947 *0DC733C6195EB789A736C021CDBD1BC6D404CAE6 craftsreportcom
143,625,948 *0DC37866F14BC8236E6CCF61C84FF8E4B393EDA7 craigmary
143,625,949 *0DCFCBBD14DFBBB8F3604A30C2806E741E18C80D 6OVIOIDEN
143,625,950 *0DCE09D5FFEAA28F931B4103FE61EA4D336EA308 createanddecoratecomwww
143,625,951 *0DC0544057DD3EC8128A0FECEBDFF7431DC8333F [email protected]
143,625,952 *0DC8C9BA0D599A3FA4AB713C89A24D706CB1F936 crisles3
143,625,953 *0DC4BA1441AFBB013B0F92D20DFB32205288DBBC cristobalconery
143,625,954 *0DC84D09DD35C1E8C270943DCB23730ADEA8A577 CRISTOBAL.PEA
143,625,955 *0DC63037988B8549F5C0A573928FC79721980578 CRISTOBAL.TOPPEN
143,625,956 *0DC281D859A925E9D25AA02AD2A11422BBC7A4B7 cs+bo
143,625,957 *0DCF800FAAA3279EC5E9478A8E8D0B499B85880A csl0)
143,625,958 *0DC2E30CDBFE32388B9914F8D43D87D7FF9844A4 741kamren
143,625,959 *0DC326057C309C076CBB41F7D382237E5473ED91 CTCダイナミックナイター
143,625,960 *0DCAABD5658E2B227B353B2051DAFFD3D8A819E5 CTCIY
143,625,961 *0DC0458D357564DF2D28BAA385DBBFA5AF335CB8 CTHOMAS87
143,625,962 *0DCA6E49FC8269DB89C93C682BB2FCD0EEFCD6CB C.TM,
143,625,963 *0DC267A32B70AA2C9BF0C22DB9D9798F5D1F52B5 ctws,
143,625,964 *0DC37BF0155F53E1601661540308530C8B0423A3 [email protected]
143,625,965 *0DC0B9F462AAE7C1FA5C3733821B7044EFF8CE7A CUmG
143,625,966 *0DC6E918DAC6E054E12F4F0AF140D9BE0772EB3B c;u&q
143,625,967 *0DC410E317010B9AA7F7B71B9DF08A485696F995 [email protected]@1
143,625,968 *0DCE26CC1EB50EB9D9648D6C62A6E38FF0A2F28C CUT4NEOU$
143,625,969 *0DC995D4F55B287AC3BBF21CDDAD451A0015888E 7CANCERSANTA
143,625,970 *0DC2A09A2F0E0C567641F188265DB207D409638B 7CINDYDREAM
143,625,971 *0DC98B0C50061F33B3AFFA5A3684D743EB5F4B51 7DOSTAVIMO
143,625,972 *0DCAE27D0592F37ECD4482B4246C7C7804D32FF5 7ENILOPMA
143,625,973 *0DC1D01C3DD2EF0B889E6489BEEF3AA7E74E73E5 c)vc.
143,625,974 *0DC92B9EFD5295D8D9779E433EDBDCF1C1CEC6C9 CvT0
143,625,975 *0DC700DD3D1ECC96850E392516DD0DDE798C4438 C(W8F
143,625,976 *0DCE6E0B20A3551FDB54F40C585E63F787B7853E cw9pb
143,625,977 *0DC977D2F44AA3C292BCE6CA435195A9885CD7C7 cwgo5
143,625,978 *0DCBC184FA7E08B64CCE20BFEAF1573934926720 CWVHA
143,625,979 *0DCB242DC20D6C3EFF280FB0E3C0EF7FC7B17863 c:wvu
143,625,980 *0DCD06C54FD39D80A96D7416E82340A44C6BBDD6 cxvc%
143,625,981 *0DC31E0CC6A32C458EB978817B8651D731E54B43 cyclotronemission
143,625,982 *0DCB709D4D5F5D4E84A992A0B8D06C447C0A6548 CYJBU
143,625,983 *0DC66EDE4E8EB646986FF4AE0CB3E6E94CC38423 d#"&?
143,625,984 *0DC736586288BB90542498F9BA58741823089CBF 7FIBROPAPILLOMA
143,625,985 *0DC2AE00847C940F54DDAF580353A19D9BFBF8D9 D0LH3
143,625,986 *0DC1B4151A0549E85FDEBBA02D2478D376E32974 d0n4x
143,625,987 *0DC3B61AD25079DDD4273418B9663A15CB7CC262 D1&;
143,625,988 *0DCA5CC422A2B7D4A8B82D6A94B4607092909270 D.1989
143,625,989 *0DCE2CA6A41C4B87CC82B308C50A2C0147657A1A 7INCASIQUES
143,625,990 *0DC0BF3D005F5F86C870A7242CF90F2531FCFE45 d36;p
143,625,991 *0DCD2FA66850980476328E59FA859AF10E0A424F 7NORMALITAET
143,625,992 *0DC2C7309D3A711E64ABAF0B9AE70F83D4FE8EDF d45+4rd5
143,625,993 *0DCB53EE165AD64C6313225EA73B86DDAF236997 d69ay
143,625,994 *0DC53D4C6520FBE7B184BB3A037FDDE37D94A190 d7dyc
143,625,995 *0DC510AACC506206D96059B765AE325879302062 7SINEDATABSW
143,625,996 *0DCEE4CD065A3487FBCE8374A7823C7B1083D192 DALLASKRATT
143,625,997 *0DC0A1D5C883C98D57CC75E421A5052EDB4CD0FA dallas.white
143,625,998 *0DC825872CB8372EFC09B04688425B3C88EBE75C damienwurzer
143,625,999 *0DC93DD75D9FC927AD101F1BF67CFE2F3242A5F3 DAMON.BOURNES
143,626,000 *0DCEDDA090BB6DF617F0810975EB3F0F26229F28 7VENIREMMOS
143,626,001 *0DC377757DEB187612DA8EC58F84B07EBCC7CB1B 7VRPRVCTN
143,626,002 *0DC34F65284F6C889489D62FFA353AAF372A5BF8 [email protected]
143,626,003 *0DCE19DA54F9E76C7D2D50703FD95B5659DB416F dancingontablesbarefoot
143,626,004 *0DC23B9B9F5C25A7CC142F17CBCF8E3213EE730D ><.*.*.*.(#8
143,626,005 *0DCCB0705778333B3ABFD1F7D3652FC56F025EA8 80℃,酸鹼值約PH7
143,626,006 *0DCB93EEBC22CDA9310C211BD8968949E91C6CA5 DANTE.PARTELOW
143,626,007 *0DC548542E254E4229155D766151317F7A64FA16 845495 talonmies.haravoi.kauniita.lehti
143,626,008 *0DC70EFEBC6198B2F7D68B75EE6D9D46C161DBB9 DARIUSWILKES
143,626,009 *0DCC9C2816B4667477E833D07A54AD1B19F3E9F6 darronneeb
143,626,010 *0DCCB96692A8546C60742B14499D02F7272468C0 8BENOZIO
143,626,011 *0DC95C8869E14DCEB8D6B77A47990DC4210B00E1 DAVID LASSEK
143,626,012 *0DCC5D5F8000AF88D48AC2092C0FA2593B415F15 8d~0~osplat!!
143,626,013 *0DC0F14DA309EBB44CEF07291B1BB3059B6FF6BA DB_$
143,626,014 *0DC9B74CECD77757EE4CC17C3188B428694745C1 db;o
143,626,015 *0DCC1F4D51E50DABEC13557D89D68F9D01C2DEE1 8iamflanders9
143,626,016 *0DCC7695D9F7DF0201EEDDD6C5B3688445097116 8ilovenotused9
143,626,017 *0DCC8EA6B9469868AF0C1850E71F9161AECF6256 d!cf
143,626,018 *0DC8193BE02EEDDAFE96E2E8B730BF7CD94329A6 8IRRUMPERE
143,626,019 *0DC01AD1930F431CA6C9947E407A9CC3E7669BE3 DCLF
143,626,020 *0DC6DD410088978F965D41147884992F992CFC1B DD4#R
143,626,021 *0DCADD2C2E4D55C5F6F4EEDD45BD233C65AB23DF 8myfoobar3
143,626,022 *0DC687637AEE54CDC4948118B2C35863DB90CE55 ddsstun5
143,626,023 *0DC4D3101B1A0D4EC7CBB5D3BAA2E99C95013B43 [email protected]
143,626,024 *0DCC8A370A9E6F916AA28B328217DE0605639D1F DEBBIE NORIEGA
143,626,025 *0DC4E79D990C1B2297992551D86FF87A7B4ECE79 DÉCHALÈRENT
143,626,026 *0DC97EC4A413458B2C40E91C379A0023DC4C9DAA 8======P-~0~O-SPLAT
143,626,027 *0DCC97F97148EF60CE470198BD0215A803149F8D declarant
143,626,028 *0DC7A39968580A5DEA737BBF93057E995FD5760C 8PANDAANGELA
143,626,029 *0DC60FB1212522D6E9D69C6092A4CD68C7F45165 8----p~o(0-0)
143,626,030 *0DC082E0C8EEBBE87A2F9E93E1D8B779DEB6C8DB 8RANTERET
143,626,031 *0DC9EB06B9C25B71DA0B808D84CAC70F53F801CD 8REGNAHRO
143,626,032 *0DCF26DBAE744D61D073BC4E264886120D15EBB9 8REYAMTLA
143,626,033 *0DCE7FBBB6ABD91EA0DC7DCFBC5E4BC6618A832C delbertbecke
143,626,034 *0DCF93E7DBE143374AAFC90A9F8017F2BADD8224 8-versicherungsfaelle
143,626,035 *0DC525D8705291C7F65C5DF89B724F961809136F 8VWNNSNQIY
143,626,036 *0DC8C650A372294F28049092CEB5AE33F28E69A1 delugeb
143,626,037 *0DC357B167EE75152FD72ED1D58BC89FA06C5ED2 DEMARCUSBLEHM
143,626,038 *0DC51CF063929F77504EC947BCBB2261BE4E96E0 demetriusreiff
143,626,039 *0DC009E72B98A8FC73C4FFDE633C0093ED042FE5 DENNISLEICHER
143,626,040 *0DC45BD4E518DEDB513F9D85638FE60E1E1BECD0 969707 SE.NAPANUORA.ON.KERTA.KAIKKIAAN.KATKAISTAVA..
143,626,041 *0DCE35DCD3F2BB2869F82DCD18FAC4337AED70BB 986heather
143,626,042 *0DC89C28A6EE4D72B00DD0477B2A367A552B364B DENVERALLDAY
143,626,043 *0DC242CDCE962F6E33BBBBBD4F2C8EE877AA5BB5 DEPROVIN9
143,626,044 *0DCDBC02AC4D855CC4646D97DF4176BB28B41590 9BSWHAYMOBSW
143,626,045 *0DCDAF34ED1E2CAFF880C683F2EEB08FAF6C0702 9CAROLEBLOWME
143,626,046 *0DCE99693F098B7367E708258A5B54686F72053D 9DEPECHETOYOTA
143,626,047 *0DC524DF2E81ECE4B409C6F04133EE674C5B9C0C DESMONOSING
143,626,048 *0DC1CFE1C151F8A9CCCC8E3764F90C47D8AF8A95 DESPERATEREADERBLOGSPOTCOMDESPERATEREADER
143,626,049 *0DCAC581EEACD567FCFA1901A99531B33A479C18 9houtspaander
143,626,050 *0DCD35BD2CAB819D9F3BD8650FEB40AD58434DE0 9IAMLAUREN5
143,626,051 *0DCE700A3FA544DA91AE1B1621C9EE09BFB45920 9KAJSIJE
143,626,052 *0DCD49B8282475A98D1E56B5B0406BC9C7560C79 DEWEYJURA
143,626,053 *0DCF2AAF602D15097E9DA7BB296C58B307642265 DEWEYROTRUCK
143,626,054 *0DC7B21BBB9F1A9F22BA2034736D857A08D448D0 dfmn"
143,626,055 *0DCBD8E22AB15A73616AC1A9BF1F42C9BC7AC21A 9QUINBOROUGH
143,626,056 *0DC078680EACF4E8052F480D602E03A1DA523377 [email protected]
143,626,057 *0DC85BC08B0DB78FA9A84B768EFE06019EFD4118 d%gsr
143,626,058 *0DCE21E6CDA7F537B959CBBF48DDBA45CD2394BD 9SOPRASSED
143,626,059 *0DC7C8776F7894717DD4464BA2C5E01FC9865B53 DHĀRĀVARṢA
143,626,060 *0DC3EF0FB35C7238F6D16A383845541512EBF449 9SYMVOYLEPSETE
143,626,061 *0DC3B2A34C8D809C60A3DC9D3ABC63BE4EE29F00 9tallyho
143,626,062 *0DC46FB2195004D9F7656A60DB21B8626C1F0E1C 9tarwearen
143,626,063 *0DC949CEAF00389E62CB58267E4D4A52BBF85F27 a0?km
143,626,064 *0DC98C2CA25535D0CBD13A22471EFE3AFAB77C1B a0.mi
143,626,065 *0DC1924AB8C1AC866AE59AD5A75796297325856E A132821
143,626,066 *0DC0F21EF17D8BDF70FFD0254628B761CF0D45A5 a17?p
143,626,067 *0DCF2164518A26E0C3719BA05C86C2BBF1DED8A2 a1np"
143,626,068 *0DCF70EB4B2512F7B890B181A38D5AD676511EBA A3J66
143,626,069 *0DCD1E7093A91CC024FCBF4427270AF346EAD4CC A3st
143,626,070 *0DC29690E69C63E30785ABCE49480233E3FA198F a-5nr
143,626,071 *0DC0C0919279EC55442E57CC848501D6AA26075F A5W,G
143,626,072 *0DC0C046A2D60D54BB349280DCE457DA66BA6217 A+7$
143,626,073 *0DCCE8DCCBDEC7814F92DC50BE4106EB88DDBCF5 a7p&r
143,626,074 *0DC05DC970F6B2656344D38B4DEAF1E3F7A9B4C0 DISTRIBUCIONES.BASADAS.EN.KNOPPIX
143,626,075 *0DC1A294AE3A08FD59D1582A879413395E71E46B AAA3*
143,626,076 *0DCCBD619C284938E30307B1EDC9253F9923B1EB aaa6j4
143,626,077 *0DC71EBD253E0C19F0D70D67C7307F58BB9C4FE4 diviplanbsw
143,626,078 *0DCF2ABD939F4D5353DC6E739D57CCAEF6C04BF0 aaai'x
143,626,079 *0DC1FA12651E21963F3FEB14CCE190BA4A742272 DJCS)
143,626,080 *0DC54785E57D00913CADBF67C69D94381E2057C1 aab34b
143,626,081 *0DC832007896AF96E4A1D681DF401D97F2E317BF dkbx
143,626,082 *0DCE739FACFC4B0AC0C4E21CFE47DAD09F285017 DLH3Q
143,626,083 *0DC85C0D367691910E4F6C6A8DCBDF20D37AE2E8 aady`+
143,626,084 *0DCC1E4493B8ADC4267CFF6EB070DA10EFB4949B AAE5D|
143,626,085 *0DC3DE371EBCD95BD3A14AF42FEFC6F319FF40B3 Dlu=
143,626,086 *0DC68F536278FDBE0284D7C5AE15D2D0C77CF80D dm0qf
143,626,087 *0DC4AF35E67B817C78B82670036D0CA25CE12CA1 dm;1d
143,626,088 *0DC655E2122F8B9B343B5A4B15FF88E95E9E48EB d?mbp
143,626,089 *0DC945E12C3D4309F54FECAB66C28C43B1105794 AAIKKIAK8
143,626,090 *0DC1DCD489F26A93824DB220557D8CAF2B741C86 aamujroting
143,626,091 *0DC356E5932054AE7F82731906D08A4C07542D7D DN9QZ
143,626,092 *0DCF9F36825A49FD004D66C997D7C7C2754F19CE DOB,G
143,626,093 *0DCA5B735D54C2D75B3F8C5FBBDA7278996A89F9 DOCOMO」シリーズ
143,626,094 *0DC7CEB147B17D68B35035D114595EF01AC2D096 ABDAG
143,626,095 *0DCA5D5EFC6C6E7379BEE30734DC97C304767921 dollekervel7
143,626,096 *0DCFF69FCCC0D46007E6AB4A469A5EB81B85E2F9 [email protected]
143,626,097 *0DC3564E81E7807820EF9A8EAEBF14FC4BD56F40 DOMINGO.FELMET
143,626,098 *0DCC612B416D4797477A5A04B274D7926DAB8ADF [email protected]
143,626,099 *0DC34F93DE86A7C18F56A0F467F1CE9218A290B3 DONNABOBROWSKI
143,626,100 *0DCF22BCAE9DE3AAE67050B61DCC30F879F0ED8C abu=f
143,626,101 *0DC3EBBF435470D398E358C794B5F73C757B7122 ABVEW
143,626,102 *0DC654640CC69EC2CB73E7371C21E376FA8D73CA doowgob4
143,626,103 *0DC17EDFA8C3FE81FFDA73D8BA6701BDFE7894EF acry4
143,626,104 *0DC94616B495096C5E12DE69BA91E5C202C9AF7C doug-drader
143,626,105 *0DC18C841CB18DE308B046359A71E3B1026FE7DC DOUGLASKOPKA
143,626,106 *0DC18670003EFDB0D03B279AB6B1205E5AB64039 A DE SIBLEY-AHLQUIST
143,626,107 *0DC2398DA5DE85FC77DEB44D6AB405FEAEC87F14 [email protected]
143,626,108 *0DC1E11E10E034240506FA4543E9AAF05E7D6ACC d:/q;
143,626,109 *0DCFD2A4C89BFA83E66F8F0822E20CEC5E159105 AD$R8
143,626,110 *0DC6BA9F7C9ED1EE7FEAD884EF02CC9E1A5272A7 aduv
143,626,111 *0DC69773B6140E893043DAB801499A36C35E9CCB dqki
143,626,112 *0DC69C61DED819EB6612DBF3DD782425F1EF09E6 dq=o
143,626,113 *0DC31EC2D9C72D4173DF195B751DE08621A7474A Dr/;
143,626,114 *0DCD79E0D5EF3C3AF7E90E7E1DECB6AB6F152880 driblets
143,626,115 *0DC43D2221F783679E953EC60705FB2BCB33BAB4 A%F(Q
143,626,116 *0DC7421B2176867BE79C8359765707FDF96EC25A AFQ!C
143,626,117 *0DC16C38A1D8810C55ED2D3C36171444F5329B2C ag0"f
143,626,118 *0DC3561390D5BCBC3ECD4DF0E9D3AEC8743669B3 AGCGM
143,626,119 *0DC4E4ADAE1E927188F715BAFCAA3643ED456AE7 dtqi4
143,626,120 *0DC919E913E905E1BEB44BA162A7B74611C32BCA AHDW2
143,626,121 *0DC76E365487B5C1872E52EC17ACF00A9EA097BB DUA#X
143,626,122 *0DC785D5C842FD282F5A0EAD7B51F99805FE97F7 A#HMJ
143,626,123 *0DCBEB108B3CA44F1AFEA815C6AE88C772977A9D ah#u
143,626,124 *0DC52D7E782F6637BB0367FFBC656AC9C1FE681C d)ugr
143,626,125 *0DCB89956CAE30DCA608C56D4B871EACA6197177 AHYG1
143,626,126 *0DC26D415C7875E11CA8AC328326DDFCEB9C9EAC AIF.K
143,626,127 *0DCB0D020085769CDBEF16480759D0ECDF9C8B97 DUSTY.KAILIPONI
143,626,128 *0DC06B2771D404AEF20660CFE825879C5789031F D?v%
143,626,129 *0DC19F7140C75B40A3687BC2E487208422F07BFD D%V9J
143,626,130 *0DCE0216B7890F488B5841CCE335835D81076FA2 AJIVF
143,626,131 *0DCEECA9F0EC31F386C979B87E9960EBB339C107 dvezh
143,626,132 *0DC608B7E15530529B87667841FEC356BDB77056 DVVVA
143,626,133 *0DC9AE7DC0675D94E21A7C4EB3F5372B0EEEF513 D*.W
143,626,134 *0DCC21AE889C466227FA1684B7E9245581B7627A [email protected]
143,626,135 *0DCC3811A14FDD8D56F7CEFB815555D1C89F67BD akihikokobayashi
143,626,136 *0DCE9A94246B89ECF58FE791532C55913BA07828 DWB%
143,626,137 *0DCC4434BAFD599A9296ABA957CC468B85BFA0B2 AKSHAYPURANIK
143,626,138 *0DCB08748FFAD1531B9E876DF253D8D766B2723D aldrin.hondante
143,626,139 *0DC211F484F7D2CD2C0DF37041E92CB9E0910C7D ALEI
143,626,140 *0DCCFA1C08AD878820ACE7256E02C8416F001B4B ALEKHINEL
143,626,141 *0DC4957EC904601F8BE7FFCECEA4FAEF56C15E7E DYPLOMÓW
143,626,142 *0DCF2F55923C74CEDE2406E07012DF01326F5627 ALEXANDER.HOLSEY
143,626,143 *0DC915B6DD5DE83ACB9F910D2CD11C8F3E0E838F dzer2
143,626,144 *0DC97124DF089CCFD2EAC33619F8DBF45E29E276 ALEX.SCHRAYTER
143,626,145 *0DC4EE239DA002C21BFB57A838CC72A2B077BE01 DZRS,
143,626,146 *0DC75759D8E117A02E629D515C7110E695F1A19F ALFONSOSELE
143,626,147 *0DCF9D1251B9323090856B9D69E1E0819B74168A ALICE28
143,626,148 *0DC47D390EE5EA80C88241BCD32696A27B5FA146 ALISHA.BRYANT
143,626,149 *0DCA07E7DF07CB9DFDC0767DAD4B16ACA92EF675 ALISHAMAHAFFEY
143,626,150 *0DCC91D6CD6B69E970925F942772C508108F8474 earlhoos
143,626,151 *0DC7243F721F15D69A6ADC3003E37F552392D453 allpatthedog
143,626,152 *0DC3903E0AE2249580A86A463A29C3612C2419D9 ebkuchen6
143,626,153 *0DC494B2A16B6C2E8E94ACCA2DC6278F658F8533 AL.SCHISSEL
143,626,154 *0DCF77D7C4308B0C6150B8415552F33E5F16AD18 ALTERCOS0
143,626,155 *0DC7107E4B3F2ECE538E0AA26DF48C302D7D3834 AM1TH
143,626,156 *0DC3601FAFA9160C8E029B7308534A4EACEEB6B4 edh8h
143,626,157 *0DC977CAAAE214F4B4862D78195E7DA79BAE1053 AMANDAHIPPLE
143,626,158 *0DCFD2F50E9A1C75AAAC55198E4970746F190D04 editorkto288
143,626,159 *0DCAFC4857A7F55811B93F945114438F40A42D09 AMBAR.SETYANINGSIH
143,626,160 *0DC2DD94823DE842C3394D54B9B657D2E98AAF10 edmundopolacco
143,626,161 *0DCC578D0C4F1B155523FF7A6CD6041908A383A2 a$$!m!la70r
143,626,162 *0DCBD61F07A25AF9F7125E27E778900102B90A3B amolify9
143,626,163 *0DCDE33EAE00FA791B97D1BD75FC6B3C493A2248 A.MOMENT.OF.UNCERTAINTY
143,626,164 *0DCC9A70BA39374CC3863EA5F26BAE63EBF417FD EDYWINKS6
143,626,165 *0DCCF306D338514DEE3F4F6A02BC85D49647D012 AMY LOYNES
143,626,166 *0DC5EC040DABEF1807AA63415BACA3BA55ED3D62 A)N&
143,626,167 *0DC1D240AB2DC80520A32E5108EC59F896AE02FF [email protected]
143,626,168 *0DCB1B4AEDC462071C049A1B35CF4490BB17A4F5 EFRENBUHR
143,626,169 *0DC50964F41FA4B921031CE59D08A31021825FB8 EFSF=
143,626,170 *0DC2A387A1CB6288491EBF0AD22FD23700513326 EHJJ
143,626,171 *0DC464C4C8CD07FA21D0BC9A01AA7152D48BB1A6 EHLMU
143,626,172 *0DC40742E31E2FDC237343802DA81448A5A58850 ehounou
143,626,173 *0DC038734931CAB23FF2D1C784B33EA79DCE7819 ANDYCABIC
143,626,174 *0DC2AE511DBBFF33CAA02E6A7B42055F48FBBDE5 ANGELICA CUBELO
143,626,175 *0DC22BD4328C9B4B65329294A8AC84EDE0797CD4 ekuhsuka3
143,626,176 *0DCA8B75E05EB6DA9B9B4AC26749EB688ABBF1EA ELDEN.ANNIBALE
143,626,177 *0DC034D08F7C332F1E29FDDB9C4188BD6856A982 ANTHONYBECKLES
143,626,178 *0DCFFE00CF502B2DA006CAC1B94449C31EB456AB ANTHONY.PERRUZZA
143,626,179 *0DC9C72655F6559F5AFF9522FDC849F857E9A625 ANTILLESPRIME
143,626,180 *0DCF61F7A12ACABDF492CEF27DC5F754408EA8CA ELISHAANSEL
143,626,181 *0DC4EE7CEF2713D4FC6F34E0629114DA7799ED01 elliottmauson
143,626,182 *0DCEFD1812C485E0FF892D88979B0ADE6516623C ELMSNAY1
143,626,183 *0DC5D0D8D6A6F93A3FA676B6B5DFBCFFB3F8DF13 e'lp
143,626,184 *0DC2FAC089679A5D0697309D777E8ABAC4935656 elroysemrau
143,626,185 *0DC3DB3FCACD45C67ECBC2862E8218EB8CAFE509 apfa
143,626,186 *0DCAD3E2C82AFC396DA06816E061557CE5858C03 eltonzullig
143,626,187 *0DC5D854721B9AE730C345EF1279E3380B4F17F6 a=p)j
143,626,188 *0DC056F793DE6E235450A3EDFAC12C734BF4D1D5 APOGRADEC
143,626,189 *0DC672CFE274B140F213A685853E3434149E5168 ELWOODWASSERMAN
143,626,190 *0DC0C11C944F1DBC933770E8378A845E13B03E76 APORTTIA0
143,626,191 *0DCB8615E5E05D92B6B377F11292B1EB9335D600 emanuellacki
143,626,192 *0DC34A3DE33630823A69FE4BF58A550C33CBB473 emilioborges
143,626,193 *0DCB2F623BA018A67AF78C9F51B522383E8B2B04 aqis
143,626,194 *0DCE36A801C8E5B84F921283D6258D8AD6F62274 emmanuel.ayo
143,626,195 *0DC250260613D10D566F7EB0864348DE80B6F52D ar'"
143,626,196 *0DC5B93F036DEF063850A3D3C385D2819B50D40C ar5bp
143,626,197 *0DCD67E487FAA0850F02691E414BE0C4C0A7FF6C enbg%
143,626,198 *0DC3BB84B4A230FE20FCE0331A2DC2CD5985A4CB arielvanandel
143,626,199 *0DC7CE21DA3C9EB9C9A915484729B07745A295D5 arkadikí
143,626,200 *0DC88E0CE4D8D03AA8B3554BA87240FDAC89F544 ENOCH.ALCANTARA
143,626,201 *0DCFC5D49AA3EF957149ED179B44CA87B224E7D4 arterelacional
143,626,202 *0DCD1370807438D67AE254FA03DE4CFBE2060CE0 ARTICEBRYANT
143,626,203 *0DCDA07F18CE08E8581016C565FCD54A806B3BE7 ART-REVIEW-LYRICAL-ABSTRACTION-SHOW
143,626,204 *0DC09DB425E5240F964DB10CB87475147613D9EC EPCK/
143,626,205 *0DC5F76DBF5615AFCB91ED9F4C8F96A19FEE985C EPIDERMĮ
143,626,206 *0DCCA3CB81C611CF8732519D92EED9C637E14021 ARVOJ
143,626,207 *0DC664031A4B944DCDDB70BAD475AF0C3BC0EE5C arxc=
143,626,208 *0DC5810419184C9B86AB361CAF89CD00370F0A3B Asbjornsen.'/A/sb/j//[@]/Rns/@/n
143,626,209 *0DC85F9613688069CBDA14459A56F9C4601604EE [email protected]#$%^&*()+asdfghjkl
143,626,210 *0DCF6EA21A7C91ACBDCAED0101D6D6384E9B303A EQUIVALERES123
143,626,211 *0DC0CCFB92E76EF946AA74E29501481F0BFC9AAB ERANNIV8
143,626,212 *0DC46C697FDBC551E81C933A53408EE138970A7A [email protected]@22
143,626,213 *0DC8AED42D73F7DA9D6E874F19DC2D19CDBEDABF EREINGEN
143,626,214 *0DC9F5D1B8A39F24C8AD140FA346AA65AB410D6D ERINCLEAVELAND
143,626,215 *0DC56196C8A0A7F0502E5EDB1CDA2F9F7BAFC49C erlinda-lo
143,626,216 *0DC88E04151D80DA4707018CC79867EF34266D00 essersis9
143,626,217 *0DC206696A21ED502E0D0F05F1E0E2B4429FBA5F AT8)I
143,626,218 *0DC9C9DCA21275B6A6608883D564113B2C918C28 ethanizzo
143,626,219 *0DCA2A145F83A298252DAC97AA513F2E33544BF7 ETK)M
143,626,220 *0DCC1061DA6BFE5B3E46062AA6B0D9E842E7E12E etloverr9
143,626,221 *0DC8F4D88D3CC9CEA50AAE046C674717AFE07B2B ETTIRMEKTEYIZ
143,626,222 *0DCCA4D59467D900D4A885ED30B89D7A5F00C3B7 A.TOU.PWI
143,626,223 *0DC6C146C80D79B5CF18873F9E5C02EDB9EA30F2 a%tz(
143,626,224 *0DC92453C04CB8BB41FE34268C4022B0DB7920F1 [email protected]
143,626,225 *0DCA9E3BEA279A492103E71ED35361E6028F1BCE [email protected]
143,626,226 *0DC02CD130877000DA7AFAC22A9837E2E90EB2A8 EVAYNOW
143,626,227 *0DC95F340B19386EC758A2A290E63D876848241E augustlakers
143,626,228 *0DC459FDE09B0721B02B0AAC287865C0B36D18C4 EVLENILIRKEN
143,626,229 *0DC8DA36334E04E5A650E74BC31097AD3068954E a)%ul
143,626,230 *0DC21098578D4EA63486E9FA4CD3D3E6B4C153B2 aumyq
143,626,231 *0DCE91043ADEDABE25968C2A9F386B3BB841712D AUSGESO4
143,626,232 *0DCD4AD42CB4838B841E56084E7E0F5192D4C8AE AUTOABSTRACT1
143,626,233 *0DC53432D3F55480598EFEF69817731F9DD59007 eyes-of-obsidian
143,626,234 *0DC5E7E456EF00CAE769EF5FE6154C041A5CD04D averymercado
143,626,235 *0DC17759127BB5B5835A966E93893EB820C2CBCD F4s7enngs
143,626,236 *0DC550EB006EFD1FB3D3093E758CF6E6ED3DC56F fadilah-arshad
143,626,237 *0DC2FB246E96E617E6154378ED183EFDB4CCAF62 fahadalshalan
143,626,238 *0DC9C303035B52A5818A4878126F156A9EC121CE falsafeye
143,626,239 *0DCAE184633BAB6038351CE3E081B42F4628B800 [email protected]
143,626,240 *0DC881D2B533F11D551E4778D84F60EF33BFAE22 AWONNOCOTT
143,626,241 *0DC98281D54F807D9A73F34677CA0093CFE2ACF3 AZLACNI9
143,626,242 *0DCCBB1F2A49546E848E8371EE503A8BF0BBC519 feeling-for-you-(original-mix)
143,626,243 *0DC7CBF8AEFC24D94B845DAB530249DDF443A333 fernandosieczkowski
143,626,244 *0DC39A2F0CEB358C958E23A91C5308A4E2F775FF fhrungslehre
143,626,245 *0DCAF8CE744CC81440E23F08E82C820694332B9C b_0t;
143,626,246 *0DC530712182CCC1C3E5B1C4DC88155442D6044A b:_3
143,626,247 *0DC79B397ED4E24349CA1952251C7F3FE5196F4A figueiredo-guimar
143,626,248 *0DCAFF5C545D2C6DB93416531485AA85B641C66C FILIBERTOVERLIN
143,626,249 *0DC24C426860399E05EFE29325C8E092E0E7825A first gentleman that i can tell you too the archbishop
143,626,250 *0DCC0EECD0D46CA39D6F895EF146648495BE099D B8`M
143,626,251 *0DC73DB1FBF9809CAFAD007E6DF1EB3ED3C36B90 FLORENCIOBUNGART
143,626,252 *0DC8A98458436F09C6F43931D2A71F6403BA5781 baby,won'tyoumakeupyourmind
143,626,253 *0DC306826E6A759720BCFE044C78153E10640187 flueggé
143,626,254 *0DCD52B7A5FD0B900108617C51A78B9D5EAD86E3 FÓLKAHÁSKÚLIN
143,626,255 *0DC7C5466ACA3F57812401AD16B6394C8E183527 FORPSOAHC
143,626,256 *0DCBDFED076682E36CB8842BCBF1E5DE495796DC basiltauber
143,626,257 *0DC178BBDD33A12AC20D680782224A9A8FB6690C BA-SV
143,626,258 *0DC28CA8889D7EB33BBC17BF6FD78589A1C11055 b)/-b
143,626,259 *0DC9128CE0C34A8E9709854C49F3F9325D65C0A3 fraklin4
143,626,260 *0DC837971418FC6F616FD28A06523AE87B0F7120 bb)1h
143,626,261 *0DCA6EE3B4353796B2DB5A7C28BEAE86FDB50960 francescosarsfield
143,626,262 *0DCE691D74467FAEF258A8DC49C2DA1BD8C867C4 bc.ce
143,626,263 *0DC754CCA2BBFD76EB3775017D7CCEEA9F625A92 b###d-~0-~o(0-0)
143,626,264 *0DC5CCF3493B52962D11FAF39BA819918DC393EC bd4ui
143,626,265 *0DC9A33B83C2133E89FCFF27788AA09F1064C43A BDLZN
143,626,266 *0DC2569626F5CA1E6007616D64FB72938D235C6A BE$+6
143,626,267 *0DCB3551494623C8B8B5FA46E7978B6F97673535 FREEMANASRARI
143,626,268 *0DC53BF1F245FB4E74EBABE0D0BC20D183B745A3 FREEMANSTROOP
143,626,269 *0DCA7D46D8B9AC9C16042F889A0A3CEDB6140404 FREEMAN.TEIGEN
143,626,270 *0DCF28F13D2493BE9506B3D6FE91E99314F0E386 freemanzacchini
143,626,271 *0DC1C2750A04C14673C9AEB45B3EA8FF62276CC8 fridays6
143,626,272 *0DC5948C1C6C4335B7C5EF141E3874B305EAA077 BEHANDLES6
143,626,273 *0DCDF1A94DEFA3325D79F37213CD8B78A8481A98 from.ancient.to.modern
143,626,274 *0DCD7171A938E7B9016F2EF13625FE3BC886CCE2 [email protected]
143,626,275 *0DC82D454F34320308D3F21A579EEA9248092F9F “FUELED
143,626,276 *0DC0BC77D2AAF831350C13FB4F2AB2D0ECCCD95A beniel.murcia
143,626,277 *0DC929108FFCCB0C74BA0B52F493B9D2E5A0C235 FWGK2320
143,626,278 *0DC4203A04E00755EB92B800D5B8B50053D4DA15 fyhtgfu
143,626,279 *0DC80F62D2596B59C5A1804D2F0339ED67CD306D fysc
143,626,280 *0DC50CACCFC9EF1EA31B2222E2650413076AD595 g]7h
143,626,281 *0DC902006E1B9448F1B94F0520713E97C62218A0 gaaud
143,626,282 *0DCA8638BF20FBFC16F0E52D5164192B5DCE5123 bernons.
143,626,283 *0DCCD2EF1567056D358A78A9B319954B4051833E BERRYDESTASIO
143,626,284 *0DC37A2109895203FAC6956FE53E08BC08CB7CD8 bffl4ever
143,626,285 *0DCAA912CAB3338DB62BF31657378E3DAC9755BF BFULLFORD
143,626,286 *0DCF24CFAF4D4EF6CBA47F1B5CDF8A839BD8E038 GAILSPEAR
143,626,287 *0DCB67A6F12981BAA6E09AE7B17C67656C5D8146 B:~'-[G N:?5X!5J<EMQ!1JKOVR8HNVD> DK~P^FKM}PNJ%-
143,626,288 *0DC65EF671081841D6D0B775C6FB6A9A8FEE9B66 gam3 $h00
143,626,289 *0DC88363C8A7F2AC11975514F8B1C069DB3DA6A2 bgvht
143,626,290 *0DC488AA6A2CC4191A44AD80EB1A64563DDCFCFC garlicgandalf
143,626,291 *0DC7A0B6F86DF432FDBC1628BC155B25C65258FE GARRA1996
143,626,292 *0DC38DF110F330C97109644FA2B25D1DDD456BC3 bh"qw
143,626,293 *0DC66EC92375889EC49F5CBD8848CBFB4C934A0D GARRY.PARRETT
143,626,294 *0DC0574FD0B99BFD58FA7B747DC04D12E2D9AF27 bih9/
143,626,295 *0DC9B0831F8870E8F18969B43291E7F795559B94 bijumatthew
143,626,296 *0DC44A5CD658D75D012044A94B8879C2EBD4425A gazjou
143,626,297 *0DC4C08444455F425184E02655F147EDF1C9C304 BILLIEMEDELLIN
143,626,298 *0DCA302BE43A77EC1C696EB6097B0854ACBBE0F8 gd~
143,626,299 *0DC5D4AC48CDF193051C424C28C02FD259B84B85 billynastasia
143,626,300 *0DC6FCC8B6A6936210001D7D2B589311C27FDCC1 birdiedaddy
143,626,301 *0DCEBAD9F2FF781D1EFE4716D4F627371429A3A5 bj#7d
143,626,302 *0DC99E65A680E2358E23BDF3A13C723F4AEBB8CA BJSPA
143,626,303 *0DC3A84FCA78219E26593B1C6601C7DCDE020CFD BKP#I
143,626,304 *0DC608F1BFC29B0FDA4CF5425D08F33798DA2884 b(kvw
143,626,305 *0DC756F08D5B20FE4D4C81FC24B56E896634D771 GEBET1234
143,626,306 *0DCB69FB8A0C9CD9C7268D878A8439BCD4F14CF7 gegenzug7
143,626,307 *0DC58A07B975150CD439E56BE2743E5FF3186BFC GEJEUZEL9
143,626,308 *0DC2D5975C3155F6E95A53207CF5CB70B61CE619 GELOOFSAFVALLEN
143,626,309 *0DC5EEC8A8F168451CDB3A9B2AD72454CC06B0F6 blandizzi
143,626,310 *0DCB20F53AC82A7CE6C235A3E8D0397AA1995965 GENARO.GETTENS
143,626,311 *0DC81BDD36A7AC19F39CDA2747A02D904B731E1D GEORGEANNE
143,626,312 *0DC58D6EF197D52850D320C272CC574FFDA798F0 GERARDRIZOR
143,626,313 *0DC0A6D7141041B485A4839A1C5936509B9CC02A german bas
143,626,314 *0DCA4381C85E9BE24B82199800635AB125ABAB3C bn_p
143,626,315 *0DC1FABA10B08C999BFA91DF05B8536EE265532D BO1WW
143,626,316 *0DCDAA65CEA1489B9103BDBE62D243ACF175D7CC B"O2+
143,626,317 *0DC7FBC7491461B74AA8EF3A538A79E58A20BB26 boae;
143,626,318 *0DCFD2688A6CFDCF197CE0EE36AC4FC4F2704C8E gilbert.house
143,626,319 *0DC49830F1C7C203835334CE47654A54CB15585E b%oc:
143,626,320 *0DC8561769512876B87D71FD60306C520F9753F0 GINHARD
143,626,321 *0DC8EBC0A7511FEAE5438C829FE530A256572D0C GISCHWALD
143,626,322 *0DC14FDE219F8BCE25180F7B90C8FA9CB5879B8D bosdries
143,626,323 *0DC62EFF1B8816BD501DFF4759FC467AA3D3FD48 BP9&O
143,626,324 *0DC7A7089215F5CAD88AFC76F5329E7D770D3FA8 BP!DP
143,626,325 *0DC035E687DA1E67B8D67BC34D41369B85906BB2 gmajni
143,626,326 *0DCF94BE9F35E83182F9CA6844DF74307559CDED bq+pk
143,626,327 *0DC01C5CEDBA7657AA63FE4645EE6C9DE9AD4BAD GOGUWON
143,626,328 *0DC863795456E2A6AFA148D500E2399A646FBD89 goingdowntothewasteland
143,626,329 *0DC64FF5DF44B88DE0E846214E4E5CFDA0D72997 GOLDBERG.VARIATIONS,.BWV.988:.VARIATION.19
143,626,330 *0DC3FF6FD13BB34F26C0BA30F06E0E88A7364106 BQVLQ
143,626,331 *0DCCA9DCF4848A0AEFFA128B37033A849E5A70C4 bradyschamberger
143,626,332 *0DC453C41D9ECF240C39619B219053D27DBD4826 BRANDEN.OUTEN
143,626,333 *0DC8B64EBCD613B63677B46548D695772DDBC8F0 GOODBAN5
143,626,334 *0DC2599FC73980F7A8D5D2FBB2E96DA2F2003C11 GO-ON-TIPTOE
143,626,335 *0DCDFB605565FDB7204BB662A3EF8CFB976DDAB1 brebo
143,626,336 *0DCC1F8BD51538AA456284DE4654E82934510E45 gorényem
143,626,337 *0DC3F1E95A423004F209E55D99B9DEF374DB79FD [email protected]
143,626,338 *0DCFE4B1AB4D2B7D02C7FB74931EF6768435BB69 gqv
143,626,339 *0DCF29BB4B54A13843D996080AD72668549EB158 BRIANLAPORTE
143,626,340 *0DC4D56281846B3A05CA633D2AC035A53852F3C2 BRICKWALLRECORDS
143,626,341 *0DC2E1990648DA69BA50F07410E76E516D8ADDDC GRANTMEN
143,626,342 *0DC8C0D99A78AB14DD240B5FDEF82FFA2530541C Greatest.Show.(Rest.of.Our.Lives.excerpt.including.Cacophony)
143,626,343 *0DCB5094720AF9A6061607A0B38ACBCA5D82842E gregcynova
143,626,344 *0DC822ACC715DCB16895A49B31D00091DA0A72ED brunosledz
143,626,345 *0DC9B84DFE7D6BAF85A1E06E72318161825C384E grossoie9
143,626,346 *0DC0C9A7B41786669224C5899C2750C5F839C930 GUESSPACKARD
143,626,347 *0DC76D071295640862FA5D304A629541652BDA6F bsrzi
143,626,348 *0DC271F7448719622FEE8D1A655F410CA0B3C5DA BSWCOUNTABLESET
143,626,349 *0DCD839233443AF7518AE2958A836BCFDD61BB3D bthe
143,626,350 *0DC13326B09E06C2CF78825BEC919F500B44DCF2 GUILLERMOBURIGSAY
143,626,351 *0DCA9211D7A48BFE53930C8C36F9CE5E2310E99F guillermotessier
143,626,352 *0DCBCA6D95F2251831450C0A35F38F6EDF89F0A7 BTMQI
143,626,353 *0DC9A14362E676E4121E05742F4066853F9A77F0 [email protected]
143,626,354 *0DCFB9F93157D458BC2F24714E30075F1C529399 GWNG
143,626,355 *0DC3A9644A0C4FFDAD8E4A1448B58E596B020B92 bui$
143,626,356 *0DCC3F56258308EF4C674792771D18298194C27D HAFRENTORRIGWDDF
143,626,357 *0DCCC7481DA38EEEBF6E6372FC669728AFA0B994 [email protected]
143,626,358 *0DC6EA133C38F9F61132ADE70CF4F5D984819D84 BURT.AN
143,626,359 *0DCF334C55D70F9D4A6D4923669561A5ECF4925A BUTT0NH01NG
143,626,360 *0DC7C84B7B51DD97B9D969F79CA3E9B678A67D26 BUTTERCUPBABY77AMBRR
143,626,361 *0DC7AB169E550442CF761682E6F0DF8075081FFF b.$v(
143,626,362 *0DCFE0516D45668303E65F75F3C98F3C78BF9E5F bv123
143,626,363 *0DC1574FAD16BD6AB3D83BD3F7C599DD20571169 bvb8?
143,626,364 *0DC720495A3485F4F97AEE2C0E50846B15E89D64 hanan.hammad
143,626,365 *0DCB3CB1757E1AA95B50417F01DDBE39224076DC hankramey
143,626,366 *0DC29EB8CE5758C75FAB15E3FC2DEAC611038C53 B-W47
143,626,367 *0DCA25069E11C86697AC30487A10023E7938FD69 bwéded
143,626,368 *0DC233E97EFFB9B090D0F6F2A865480798F4014E BXTOD
143,626,369 *0DCB91610E288EDE03BBA63D2C1EABCFC9AAEB5F BXXOW
143,626,370 *0DCA984E0FC0949A0433298F4D002E143AB484FA BYQFW
143,626,371 *0DC011BAADB28491AE2ACBE977E9182D0D832F6B b=z6
143,626,372 *0DC77DC96D1D43A34C216C5EF088BC1707D9BC5F HARJ.SANGHERA
143,626,373 *0DC873AF0872165B36BFB9E023B622D1A173DB65 c/2e6
143,626,374 *0DCAEDF10B8E64A91C6E18CF0AF8F5FBC9AD338C c42cu
143,626,375 *0DC8652C93DAF19171D424BE7479F3A03FC90238 HAROLDTIBOLLA
143,626,376 *0DCD917D854A921C45281F2C4919530A28231BBB C-5F"
143,626,377 *0DCEE42D4A15F15B0A8D6475B56FF3A1085F8E63 C60LG
143,626,378 *0DC89B3B7F1B903990969A30FFDE29972626C49A c6v3u
143,626,379 *0DC1ACB793BA7816D9B2D2D6AC5E3AD4BF8FC9B4 HAVE-A-GOOD-RIDE
143,626,380 *0DC114EEFABCBEC2B79139A4FEE568A39252AB7E hawaiiinvasivespecies
143,626,381 *0DCE161E6B05FB7E5E924423A824E8F60CBABDF2 hayksargsyan
143,626,382 *0DC494FAD5D38136F75692626ABB9BB2A6B77607 [email protected]!n375
143,626,383 *0DCD32B51AFAD033F454D824CEE3A42D927FC4F5 HCNISNINS
143,626,384 *0DCAAA6FA8F2C2F563E581C89B6ED327FD7C20EC c8w!
143,626,385 *0DC7BBB66C7DD09CF1236E4CACE41B8E6EA508DD c%+&9
143,626,386 *0DC363A07E2CB2CD58C3293D7134EA209199CA7C C9FSA
143,626,387 *0DC8FC5DC363DE163E472C5B46EAFECC7248E77D head-designer
143,626,388 *0DC6135C372387A47F92436C3A5427FE231C1620 [email protected]olcom
143,626,389 *0DCA3D56CCA9E2B4C3AB12A9F3681E2207E451E1 CAN.KHODADAD
143,626,390 *0DC50E324A1F4D517366B359434A48C8CD092F34 caok?
143,626,391 *0DC39F842ACF69CB449381E5FEC1CB5545C5BB7C CARACARING
143,626,392 *0DC602AC170B51F6A97D9D7A4B8F9E63D8B89B41 caramant8
143,626,393 *0DC94A2ACF019D720F7BF6A9EAE24BA76CA73E11 heather.renee.williams
143,626,394 *0DC1AEBDAD4EDDDD2D735F5166D18A0CA08908D2 CARL POINTS OUT DIZZY, TALKING WITH FRIENDS
143,626,395 *0DCD4E631365B85F0B7E835F2A32E64247FD01B2 CARMELOASEBEDO
143,626,396 *0DC1FCD1D85E761F21A6650084C55F004915A892 [email protected]
143,626,397 *0DCF90F920E750F112A8E3791A7ACD0A94BB6362 [email protected]
143,626,398 *0DCAB69C1858CE67529280B373FB2C19049834F5 HEMISFERICEK
143,626,399 *0DC3FC9E5F5FB4B53463CA0954ACD3545810DBCE HEMLOCKSGRANAR
143,626,400 *0DC87A1032D42526BE1BC28D1D4FBB7D8B02384D caseyano
143,626,401 *0DC12D29A478774DD55FBE98C8C7F040C8294233 CC313S
143,626,402 *0DC325773158F8EC74EC7D74DC0A6C2C878BA4BD cccde
143,626,403 *0DC6C4AF5DD76B47F24681642D133ED2E42CE922 CC;SN
143,626,404 *0DCA08518F48AFE2C7080291EAF66AB84DE157EF CD-SANTA-CLARA
143,626,405 *0DCD1C832E936F9C1FF636D888316765790A9375 CÉGJELZÉS
143,626,406 *0DC1A8DC58163ED9F06DE38827BF9346ACF30236 centuryafcr
143,626,407 *0DCD343459EA326E25FF8E4553F30CF09B94965B CESARTERRE
143,626,408 *0DCEB7D516FB0288BAF246DB60F01369DFE8645E HEY,-MR-DJ,-I-THOUGHT-YOU-SAID-WE-HAD-A-DEAL-(NOKIA-RINGTONE)
143,626,409 *0DC52F2A14299B3F4FCA727B6ADA83AE21D6E5EF cfpmn
143,626,410 *0DC3BE2A112F4CAE869DD6127B49574A83C2A9BC [email protected]
143,626,411 *0DC425EB70E38E9B786A0D0507069B4F477FF471 hilariobrockhaus
143,626,412 *0DC2D45332F03A9618D6441D8B6649D69F3B2004 HIOSPASMING
143,626,413 *0DC276DC258D07E0C3C502C20B5877CB964CC50C cgq4v
143,626,414 *0DC3F8307F84A029270D1B5EFFC374B691C12E01 hipolitoocanas
143,626,415 *0DCBC1596A9DA4135A9E774D14242C02C3103256 HITESH A JAIN
143,626,416 *0DC6E153530D2B41BEF54324157C3184D4539E1E CHADABSTON
143,626,417 *0DC1DDFFF621EA0B479F020F2B467F73B9BB0AC8 CHADWICKFORCK
143,626,418 *0DCA8137FFBCFCC3EA71D4B6109E7C73D3467038 CHANY
143,626,419 *0DCCF2E17D31879DBF6D3CAEFAB92D5E25AE7673 CHARBEL-BAZHOUNY
143,626,420 *0DCC9505FE250DB679D12777B9B4F47DFD59462B CHARLES.STATHAM
143,626,421 *0DC6E0D1743B9656729B7C9D2B40380A9789AD86 HOBERTBLATTEAU
143,626,422 *0DC1F2D77D4DD24DD7474581EADCE18B00BD0019 check.please./.her
143,626,423 *0DC204E843D157B20D1F0BC8EA84B0C1B48155E2 hoffelen5
143,626,424 *0DC4A3C3815B57D960E1AE4540BC1029BE5B8424 HOLLISFRIEST
143,626,425 *0DC33ADC26C901792E21F57A7323A0130EBEAEBC HOLLYBARBER
143,626,426 *0DC12029CB018C0041014019785E06F6FCE8E7E5 CHI.LEDAIN
143,626,427 *0DCB9EBE86B3FD16CC934B8779367E04E322C2AE chnw7
143,626,428 *0DC0DEC24C6741C83C2F06516697BB5EA24F831C HOSTIERO
143,626,429 *0DC7511B3CFBED944FD6171C754CFC9471D00B7D CHRIS.SPELLMAN
143,626,430 *0DC717D7236249E124ACF6EA822EAA5005E7454C christina.sheahan
143,626,431 *0DC4ADFE036B260DA466D0502011B1BB9383CA1E HOYT.SCHARFENBERG
143,626,432 *0DC2E989BAEF286DE43E4974A6438AEEC81C944E HPAINTERING
143,626,433 *0DCD58C02B9A222FCF1F3F87EACC05BD6A91B4E0 h)qm
143,626,434 *0DC4FCFE0C14196DE905DA013DD0DCB6A2F18D6D CHUNGHEMKEN
143,626,435 *0DC07C8DD83EF8CC89CCAA3A28850867AAA815BB CHY101
143,626,436 *0DC70BCC56F2EF1251C969F1164AC4B2913DD27A HTA21_21
143,626,437 *0DC5D4E8A11DDA579EF6BD3BF5B2DABF2FB3B9D2 C=+IS
143,626,438 *0DCA748B68A552930E29138DEEF12F8F9C479738 citabate2
143,626,439 *0DC9D14A31EE8969C6AA919BA3044C38EF345275 CKHWA
143,626,440 *0DC82020CC8BF836FAE7E7DC716779629AC0C16F [email protected]
143,626,441 *0DC937FF9A83CA5F503CDC4AAD7960D420A63CB7 [email protected]
143,626,442 *0DC387B97FAF85893179F3CA435BDE4CAD4666F4 CLAYMALABE
143,626,443 *0DCD46F34FD147550DB02D6B59AC59BF8DF97592 CLEMENT.BUECHLER
143,626,444 *0DC6764B377D98793F305DE356B50EF914427D0D httpwwwmunisanluis
143,626,445 *0DC930CECCE15BB3DFB295E8EAFF987E0C211AAB huásabas
143,626,446 *0DC4EDE54C40A0223368CE494CA853B42D65017B HUBERT.ZIEMER
143,626,447 *0DCA451CC3EE3B6AE2FDE06E8B364690B14F00BF [email protected]
143,626,448 *0DCCE41764916E4C6BF8322D107C55A46043FF2D cliffordsnellman
143,626,449 *0DC7EA29C3B832B7FADC5A939086ABD41519EFE2 CLINTONCOVITT
143,626,450 *0DC4B27998CFA1F2886E4A24902BD75FCDF1B95D HUMBERTOBANDEMER
143,626,451 *0DCBA1761BD7EA7435282B4D436C5F30D221F360 HUMBERTO.STAHLBERG
143,626,452 *0DC0BBC8589C9D7DE9CA60843696B813A8AEDB89 hundertsiebzig
143,626,453 *0DC18BCDF35D516BFFFD79E245BEE19BAB2D40A9 cltor4l
143,626,454 *0DC4AD02073F685ED39867C31D66F959182737E6 C.n)
143,626,455 *0DCB8C9BC6106B5CBD9BA9FF80D50F59B0CC53DD cnew
143,626,456 *0DCA0210C643BB4C1B7BFDE95ADA9FE6EEDF6B82 HYMAN.RABB
143,626,457 *0DCC442BB3E6958A7C23061E9CCEA4B675A3D0A4 [email protected]
143,626,458 *0DCA11C65A50A54B069422790AF2B4CF18AF6C65 cnk2
143,626,459 *0DC8C344396B0D95288580B6F2F17AC02C79730C COAL-TARPITCH
143,626,460 *0DCA530D72F838245B35589249CAD27B6DB5A42B COAO9
143,626,461 *0DCD676B44866A75FEBCB7A2C4BE3EF41837B381 iamcamping1988
143,626,462 *0DC185ED2F8E9DCE150A48E23380E2FAAA95D1F1 COELOBLASTULA
143,626,463 *0DC2DD42DC054CCB208A09BFF7080BA697533223 IAMLADY777
143,626,464 *0DC611CF7E7BC075F0FE55FA0B7C2BD404094E67 colbyzerkle
143,626,465 *0DC0EFBF2E0CE28D782679A86CB5D483873BDEAE ICEPAD
143,626,466 *0DC8403C82C559F6B8985391D6DD0F79669A12D7 ICK...THAT
143,626,467 *0DC70307149EA0EDD97FEA18F51D39E05D43D1EF COLLIN.ROHLING
143,626,468 *0DC1D3FC54053738BAE3E913BE4E1D0734AE7842 COLTON.SHIMSKY
143,626,469 *0DCF18FA655094DA37C9E1F40EDCC33A650ACAC1 idobllew0
143,626,470 *0DC7F815A992FD05089014C39D1C87FC5D87B59C [email protected]
143,626,471 *0DCD6FBE23D9C90F53294F25E9FF241D68A4D963 [email protected]
143,626,472 *0DCADE47855BEBE918DE7D0740871C6EF095DC14 IF-YOU-DON'T-NEED...
143,626,473 *0DCBD857A78D44B58A89D8818E51BDF4F1DAD14B COMPOSITESCORE
143,626,474 *0DCF889C7BCAE9CA979FBE5507C78A006252A52C [email protected][email protected]!ON
143,626,475 *0DC34518CA2930555E3921A9294B5A20E461B065 CONVIRTA
143,626,476 *0DC55D937C83D616AD23EC6B3948EC80C19E8734 iluvgeronimo61
143,626,477 *0DCB3373F3725C5D1869ED17D9ED9996AD70C518 COREYARKENBERG
143,626,478 *0DC2B103382F2603BE050B0BE7E382558DE97C24 COURTNEY LAWSON
143,626,479 *0DC487B20D2FEB0F579500AC0B23CBE3B90CD654 IMPOSTAVI0
143,626,480 *0DC47C693175392F4D9C6AA72E8FF6393CFC49E3 couwo
143,626,481 *0DCA1C3165527C446F1802F90517AD13D886F139 i_{n
143,626,482 *0DC3E48AA0DE8D2E1CA3F1E1ED29037C5E4AC72E ina-floyd
143,626,483 *0DC779444F3730422B0ABFE475D204C850853207 INETRNAZIONALE
143,626,484 *0DC1EAF06A8E16FE2CECA2B294C8DF9E81026EDD CP$GB
143,626,485 *0DCFFC188940AD64AC48DBB4894A7F2A2D8CEF19 inlegend1
143,626,486 *0DC01CD751147517C3F13D74EA56A12D2B435FBB [email protected]
143,626,487 *0DC333D905401D53F23CDA692CD5FA83E8F4A38F [email protected]
143,626,488 *0DCA45B8CE0D8AE2DCD173FFE332569151DC11B4 intergenerationals
143,626,489 *0DC9AE3CC4CD4D127B4CB24C9FCFD9F0C9AC4FB6 INTERNETDIVORCEFORMS
143,626,490 *0DC8E72294F92C37C3C92770505F61BBDBCFFC57 IP-SPERRUNG
143,626,491 *0DCA31CA05CC0A7A4B97E3724DED482BF21036ED iras15210
143,626,492 *0DC70BB146510DC3112A059B2553F244551E7576 IRGUN0
143,626,493 *0DCC5A70260B403BCBF246FE414688748E05C0BF [email protected]
143,626,494 *0DC5F9BACEAB01C213F212DF4DF0A6FF5ACD3688 CQJ9M
143,626,495 *0DC335B8749E30F91B98A3B5DE2099650F5BA845 CR0!SSAN+
143,626,496 *0DCE1409909D334028F5BBE392031F8F09DFD606 iuvenilibus
143,626,497 *0DCD8A3A7F0B55023F5AD9C40E995AABC6BC4A28 craig.dwyer
143,626,498 *0DC3687D1960A5EC1A30DB3DCD25F429D2166045 (crawlx)soundsfesible.
143,626,499 *0DCAB0D744FAF4AC9C58A8D9215D4B097C75C3C2 crazymanmichaelintro
143,626,500 *0DCD8BFD54B76ED71D1482455F04A0065C60271A CROWNHOLDERS
143,626,501 *0DCD3F190CD97BFA60763FA69ACBCBD0AA41137F IVEDÜKOM
143,626,502 *0DC2C3F20983283BD6FA4FC6A8C57D44190ABED2 CRU!W
143,626,503 *0DC6AE08A758CDAA30B9BB9379A4AE9ED50E794F CRY.'COURAGE!.TO.THE.FIELD!'.AND.THOU.HAST.TALK'D
143,626,504 *0DC71289759C78DDA11309BEB44E905514055CFF jacqueslocknane
143,626,505 *0DC0D222086CC06B5655A1ED0775948177F2521A JAMAAL.DUNNE
143,626,506 *0DC3FE069E7D74228EA7BD4AD2AFABE4C1018A9A JAMAL.LORETZ
143,626,507 *0DCA84CCC6ED7312E8A8D16710CED9C5A5438FFB CURROUGH
143,626,508 *0DCE2CE3649BAB0BB3B10DBA35763DE87E4A219D cv9)g
143,626,509 *0DC7696651890EFE9E17BD3A0E6CDD45F1EA4BA4 CVER)
143,626,510 *0DC4F37F0FD4AB63285B711399C011612F7E59BC CvT0
143,626,511 *0DC700DD3D1ECC96850E392516DD0DDE798C4438 cwt;,
143,626,512 *0DCA22EBB5D84631EB56BE181E085E0082FE0E5F CwT9
143,626,513 *0DC4852A03B04E9AE4584D6DA1A465E503CFC03A [email protected]
143,626,514 *0DC4C9C69F8D729EC63048B3D5138F358A2FE5B0 JAROD.MAHOMLY
143,626,515 *0DCA7D48AD9C8D23B3E482635CB3E9F09CFE7C1C JASONISAACS2007
143,626,516 *0DC5D9555F338729D0DB0CB47D490EB5E4D0F856 [email protected]
143,626,517 *0DC24DA2FF00F1FD35385C6D118695658E93142F javierfranz
143,626,518 *0DC5939FE4495B848376D8E418170A75FA8B08F7 D0=+
143,626,519 *0DC9C9C2EC954B2FD6FBC05A563E4A9980B61687 d042b3d403d43dcbbcfc0fd269aa5ce7
143,626,520 *0DCA705A791699476D3E19C5DFFD4E71C64DC919 JBOYLE
143,626,521 *0DC8213F488D6B668C7C5FF8D779E369E73E0A42 JCGLOSSON
143,626,522 *0DC0748C12FF12D223BEC3F0065BDB32A042B7A3 JD4R
143,626,523 *0DCD104584F26595DBD567743286B4172FDB400C d4f7-
143,626,524 *0DC745B52F03F67013D4ACD0BC2572FB9C937335 jeremyklugman
143,626,525 *0DCAB86D2787FA99D4E0861E16CAB912B9C3965A JESSEBUNNMD
143,626,526 *0DC5A2C036043B0A61B8B9737B6B6F6096DA9BA3 d9__n
143,626,527 *0DC4D896961B5A5F84B546AA2CE558946EF265A4 jessica.schaal
143,626,528 *0DCA3C8213B115D3FB660A33F3170DB2ABB4F349 jessneria
143,626,529 *0DC9AF0AA6D7C7826D1405BC18526C56DA1C8F55 DAL-SUOH
143,626,530 *0DC8B88150B8713FC78EC8472FD44509F6E8C75A DAMIEN.HANDELMAN
143,626,531 *0DCCCC9815FC026FE554ACA91B47F6F891271901 [email protected]
143,626,532 *0DC952C246CAFA6F18CB432FC93348A56D7A3EE4 DANAARCADIPANE
143,626,533 *0DC1EE9523F8FE16C5533033673D7CD36F53F18F DANE.LANGONE
143,626,534 *0DC4420AAD6EA0201343A1F3DECEC7068B07F5D6 dan-larue
143,626,535 *0DC5BF9FB9E558DC338D9A1025A1E3DE392D8F20 JODI-PLAMONDON
143,626,536 *0DC2EDE290C0C9E18C554F382F7DD30E3068187F joeappenzeller
143,626,537 *0DCC49FCA9FA369BAFD1FFBC35726856618A4B42 JOE.DELAPENA
143,626,538 *0DCE87474A004FEC956889362487EDD3302BF2CA DARIUS.SCHOENBORN
143,626,539 *0DC3AB9D57FEDDF4DBAEA33A4A4B0EB56047AFD7 JOELDESKO
143,626,540 *0DC49E3FF1E523EC0391D7B979D0291075D1A82C JONAHZAVCEDO
143,626,541 *0DCF1814E827AA890D9BC239F40D800D565DF712 db:m-
143,626,542 *0DC4A252FB1688870A66FDA7ADEFBB7DAAEA0316 db)"q
143,626,543 *0DCDEAF6A56353B88EED911F89EC4AE252EFDE7F JOSPEH.ANGELOTTI
143,626,544 *0DC738B428B037ABE30D310BC2649F2E68C6CF1C JOTIKA-LTD.COMWWW
143,626,545 *0DCB634B34FCE4F49244EFDA06AAE09DAEC110FE JQTNRXY39
143,626,546 *0DC3AE39A57E4BF3752C2770FB458C57C0434C48 dead dred
143,626,547 *0DC5058ECA36B23E8028BC0D14DCDBA7DCD98529 JUDE.KUBSCH
143,626,548 *0DCC14C4A99B60677A999EDBB881DF33AA0DC1A6 d-e!d
143,626,549 *0DC420160C29B1DA391B82EA14B5328B4555A510 JUNEBERS
143,626,550 *0DC4FEAD62580D90468515337D318B631A61FC6F [email protected]
143,626,551 *0DC10DB4F504077EE36E4E333F80A916619EC3CC KADOUCHKO
143,626,552 *0DC1B30673D36369D8300559B762C3B6315C768F delmarslayman
143,626,553 *0DC1B44B20568871B02FF97EB2ED4B9C8F374482 DELPHIC-PAEAN
143,626,554 *0DCDD887B78BA3AFB3DF5458D44698DCA912EA8A DEMARCUSKOBYLARZ
143,626,555 *0DC608C6B4E76DCCC54C16DFC3A5BF94B1F9B9BB DENIS.CAPONI
143,626,556 *0DC7AABB7A267274B134BB97C72C8AD35785CC14 KAREN-JENKINS-HARVEY
143,626,557 *0DCBDA134CBCC3B21470D383BDB4A966F80F98A2 karla-l
143,626,558 *0DCDFBD3153C6F326E9A44FEA4E3DB77FAD6B7CA KATHARINA SO MAY YOU LOSE YOUR ARMS:
143,626,559 *0DC73FE6BBB081B5A91EF14917126A0044DBB7FD derickapplewhite
143,626,560 *0DC3AE385317A576055160E9F846606C824A3204 katsl
143,626,561 *0DC2A5626E1A4C42177A9C7A6DA192BFC29F8A89 DESBANCARES
143,626,562 *0DCCA5DD1762C17CA7236FF51D317EE2C3F788F6 DESCISCEMUS
143,626,563 *0DC8638AAB93D8B1EE6A6025F3B868D764CB50F9 keeptransferringmearound,but
143,626,564 *0DC6B429DCCDB1DFC3EB62D59CCA5CC5C36D6043 dewittsehrt
143,626,565 *0DCB2058D5151E971B5E228F2F2064E98B2E4F11 keithjoyner
143,626,566 *0DC98B74285E290F3D51F340D9BDE61B284B5BD8 dextermaria
143,626,567 *0DC6C0E574B7BAE6315C340F081B4854FA8B6069 df4ck
143,626,568 *0DCE24A395A290C924AD21B29C24503F0D7541AA dfic6
143,626,569 *0DC9BD51C7E0C1CC7E57731CF2BE6F43D03700FE DGQ!?
143,626,570 *0DC86BB0A5BC175738B428F4007D6EFC4BDB51B7 D&G-RECORDS
143,626,571 *0DC8C046FAE567B58FC036910F08FE842B5DC992 D:,+H
143,626,572 *0DC8539737598C8DF1AC8F1DAD5333726EE9FAE2 KEYBOARDSONATAINCMAJOR,K.464
143,626,573 *0DC2C01AC1E2F4AE5C095791120D239A941E6D72 dh6:k
143,626,574 *0DC657E37D5AE1637016B972F32954BC53A1F360 khalil.berri
143,626,575 *0DCB24CF4FE06EAD5CDE5176C407685A544C7D86 dhh)
143,626,576 *0DCDE46075559F3A43515F3178907D64595989DB [email protected]
143,626,577 *0DC4E0256D175426323D6B8C2724979EDA1DD4BB DIAGNOSIS./.ACCELERATE
143,626,578 *0DCC88B13FBEBD22FA63D17F0D62894E32281FD3 [email protected]
143,626,579 *0DCE4DAFEEBB342F0896B7636B5957AA5AF8308D dickheadnapoleon
143,626,580 *0DCDC0EEA297FC48DBC8FE950F471FC09876ABAB DIGESVALE5
143,626,581 *0DCC0B1CE4526464063BFDF94D87D0FA733A2C4D digodeHonor
143,626,582 *0DCB3D443637184DCCFAE6D1692DED4C27386BBF dillonlaughman
143,626,583 *0DCAF1A788310B142EFF2A3BB36B7087C2113804 KMJNHBGVFCDXSZA927
143,626,584 *0DC1DDD215B0A166C01D34DA71D0640CE6AC95EC [email protected]
143,626,585 *0DC588A4AEC566B6364752C38ACA5EC8042C73FC dimple-guro
143,626,586 *0DC6E7B47520686A57713C2AB91905F58EE19A36 ko3
143,626,587 *0DCD89F29F062F3BB89E284F49F7D4FEF565444B dionfiorello
143,626,588 *0DC119C1B991CA23601CFCFB68A5A4D704091DBE KÖLSCHNEK
143,626,589 *0DCEE1B78849843DE646B67EF379BAAB80344753 dirklindsay
143,626,590 *0DC8615B95C6EF769C266580C1119C1E281EECB5 kortgerokt1
143,626,591 *0DC924D1974E923748D44F04858270EE1DC1F5AA KOZAKÓW
143,626,592 *0DC3E932D51B1E5E7C6AC8CFEE8015806D592121 kristian-jones
143,626,593 *0DCACCF0B5F540D5C6E5EA4C6E181729479CDA2D kyleharman
143,626,594 *0DCE8631C40DAD12EB78AD47BA5E8A6A71ECBFD5 [email protected]
143,626,595 *0DC3FC84D5C2F05E0CAE31DF718DE42F741A22B9 [email protected]
143,626,596 *0DC17AE4876B87FB5128CA09D4C7BC3B8E2166E8 Disembowelment-(Slaughter-to-the-Flesh)-(live)
143,626,597 *0DCED223870D4F59463E877443B46F0AE906AB09 districttradition
143,626,598 *0DCF0B518CE49DA8BF3623A5D25742FABD3A6295 lannyohanlon
143,626,599 *0DCF0A376D6B7F7D50C973367F5F0EDD0E3091EA DKho
143,626,600 *0DC957504106B8F4C92E9EC2009FA723390E47D9 LARRY.KILMARTIN
143,626,601 *0DC8488913ECE2A0249CE44706420B505F437D08 LATERRRAZZA-ATMOSPHERICALFUNCLUB(DISC1)
143,626,602 *0DC1CABEA3537350EA8E8A2E73A481BF253B1F36 lectio.brevis
143,626,603 *0DC1432351FF740B33E4A08E2649ACAF2F6EB52D LEEBONNIEP
143,626,604 *0DCF1F8E1A729B0937F5D3EFD02A92905FA33789 leichtigkeit“
143,626,605 *0DC7C4190B1D6641B78E3DD111ED0BAA03613570 dn$nz
143,626,606 *0DC8D53F1853DFCFF9504071DD141E3D23D60405 l’element
143,626,607 *0DC856AFC5AEAA3E0254A7F33D2909F5A100E2E2 DNZCI
143,626,608 *0DCF3CBF405D1741BEAEF0974ECA9A54E85A9B5F DOEKJESES5
143,626,609 *0DC68D600F388E8E0B94D84406879F1A60436671 doi101093qjmedhcm03
143,626,610 *0DC3929EBCE96ED7DB7479C7313DE1208BE8CDF0 dokmanovic's
143,626,611 *0DC9621B9BF21FCD75BC5816882AF2058F3A9193 dol"
143,626,612 *0DC210D9751587C26247720D11AA9B01FA0AF45B dominomajor
143,626,613 *0DC57ECC684F8C3DCD6F6C21F2ED97DDFDA63DEF donnmumm
143,626,614 *0DC0443480EF8B294A7F85AE485A873A1773D34D [email protected]
143,626,615 *0DCDCBAD0DFA7FA9E448FBA54E58DBAA7F406D33 LESTATCHICAGO
143,626,616 *0DC446DFCE07235A728D7448FC962EC632161E45 DOOLLIEPPING
143,626,617 *0DCB6FF105DBB946B9AB4D5B824247F5171625E6 LEVELLINEAR
143,626,618 *0DCFDB9E8AA42700B8CB5AA9961B0196424614BF [email protected]
143,626,619 *0DC9D02BC4A677F2B577D0F865408F259CA69B77 LEWIS CAMACHO
143,626,620 *0DCA6CD5247BD15379918D729A4F1EFBFFA1447E LEWIS.KIVI
143,626,621 *0DCA13DA64A0A33EE4DE793022F3AED667B043B5 L+h0gr4pher$
143,626,622 *0DC0DA78939B3104B0E7515E9B70382E4DB89F4C [email protected]
143,626,623 *0DCEE2F9D148938D9A87C20799135F8663374F6B [email protected]
143,626,624 *0DCB344FEE758E7DFA47E691B70BCEDDBB2C1A67 d.p,.
143,626,625 *0DC4AD16B702A5F282A4ED187863AB0F9AADFC3B dqp2j
143,626,626 *0DCF165B8664C3571890CF65B6D07D6BCA169BB8 DQWFZ
143,626,627 *0DCA389558B8596299692BC3FD6BAEC37F4FB272 LISALLA
143,626,628 *0DCDE3649A18B12C7124EDF2836AD8EC5F937CA3 LITTLE-TRIED
143,626,629 *0DC62CCE7097B688352D87D70A1B384D950C433F drinkin'-wine-spo-dee-o
143,626,630 *0DCC756713B4676019080F41E5540D77C0036332 ljnq
143,626,631 *0DC955E9ACF175D7AE35641A3FDE0CECD697799B LOMÄDIK
143,626,632 *0DCACD93632CF8B062514BD602942200123202EB LONGFRAIZE
143,626,633 *0DCBA6743DC2D07275241FB38A17E6636202D512 DRIZZT
143,626,634 *0DC70AC733B399B49EB00943C554DC254F491FEE LOREFICE
143,626,635 *0DCF3A74DD7AE52D4625E3AC9116684F046C5F3A Drv4bl3
143,626,636 *0DCCF59E61A7542EA9CF69D913467CA44A914D60 [email protected]
143,626,637 *0DC9B50481273402F90765F02F13379A673EFB33 dti??
143,626,638 *0DC5EC9ACEA4743915BFB8ABCAE592BDD01A671F LUCKY-BAUTISTA
143,626,639 *0DCE21CA11AF6DC833D3AE98B5AFF190AA2E1E2F luisfedora
143,626,640 *0DCBE805F9B6B2899C62F1865429FDF20F1A6B84 duane-duffy
143,626,641 *0DCD8A740E7E3D0F1FFB04C7BE533F8DC116CFC4 [email protected]
143,626,642 *0DC596C87541678A10BF32E0BA6FFF232D5AC83E [email protected]
143,626,643 *0DC833719422DB96E28E14E0FD230047C181830F LYNDONBAYDAL
143,626,644 *0DC5847DFD92D28FE2CD56225C8CCC6C4594A981 dupr:
143,626,645 *0DCDD6DCEDC213DB625022A87555BAC19400F25A du$pt
143,626,646 *0DCC8A4037CC8994343C2DB1831EEA5781A0C81E DURCHSATZ0
143,626,647 *0DCCF38A39E6EA83E78A8C4B13938CF8F4D6A9FA M4K3SP0R
143,626,648 *0DCF1ED801152DD85824D4FF2E7B3BF85A983BD5 ma1admini573r
143,626,649 *0DC0A0C6A8FD81CC9EC115A48ED754C837126738 MACUATA0
143,626,650 *0DC986BBA6C1506891556D0371EB5905DDE88AFF MALIKWILIS
143,626,651 *0DC1D8E6CF0675C371B8D5A0F09F5FD6AAA5984F man-or-animal?
143,626,652 *0DC7CEADD31A5DE8D48FCA51707E302508C21088 dwaynekalloch
143,626,653 *0DCCC791AD296B0DD8B5E517CB06BA145F6FC249 marcelomador
143,626,654 *0DCA9F172573B1775589CB47B2290369A53C48E4 [email protected]
143,626,655 *0DCD86C833CAF1F7F36BBA29265B171FC6F61060 d;_=z
143,626,656 *0DC529ABCFF5EEAC84C9BA88A0E26C7481B623B6 DZBDQ
143,626,657 *0DCC94421DF123025CC5F3E02E413486A0AD43BE MARINA759
143,626,658 *0DCDADB2C92359654742AF9E856E1ABFDBA1693A EATMEGHOST
143,626,659 *0DC5040F5206FFA1462D6B23AD68D1360C5AB4F5 MARTANTI-RAHMA-LAKSITA
143,626,660 *0DCE2386FC7859EC167722211701FA826DC9D4AC mary-c-antoine
143,626,661 *0DC2D63A502888D5EB78F6739282FEAC7D148BC6 MASSMEDIA'SPETS
143,626,662 *0DC5155C0CF716C9809412EEABCBA8F34F742FC9 MAURICEMORLINO
143,626,663 *0DC3FC5B14D0961ADBDC4EE340701934BA881735 mauricesommer
143,626,664 *0DCD6B0F4D71334D60E5F85FEA893E9EA81B93FB mauriciokarney
143,626,665 *0DC27F22203895D3120522C26B49715E71291D40 maximilianes
143,626,666 *0DC040B2C47B360274A50363E752C6B2BC5060A5 MBN|
143,626,667 *0DC8F1D6A7864359B67F10D6BE2C2D1D4AFAEC89 mcpo[email protected]
143,626,668 *0DCA32A1844F26DB7E84771452DADAC0B2A799EE MELANIEMISTY
143,626,669 *0DCE109FD2ADE0CB66E25890FF8A67C9853C0729 melissawelcome1
143,626,670 *0DCE33190C238C99C2E40C87F1A931B6A446422A MELVIN.MONTEAGUDO
143,626,671 *0DC89C5BA18F7A7DC4AAD7BAC393FE4082A7585C melvinsivret
143,626,672 *0DCDAEC6E1F4C9FEDBEA223E1EB1D044C39486EB [email protected]
143,626,673 *0DCD19D1DBE81B3F595EED6F9FE2441C845B5534 EIGENFEUCHTEN
143,626,674 *0DCE8A147D8945B715F604F1F5E0329D69DCA221 eiííel
143,626,675 *0DC720EBFD35EC64E8EF1060779455094A52761D MICHELLE.DIMARCO
143,626,676 *0DC34762017F8716172E1778F5BEE13B17DD6CDC michelle-zietsman
143,626,677 *0DC200D390ABFDB62FF78EF28462F50DEE39EF97 MICROBENOIT
143,626,678 *0DCC584D43BFB38E9C659FD218CE18513F843F9E MIERA.NOTY
143,626,679 *0DC85595AD29BAC5BF3BF1C75079283764CA94F1 MIGUELELLISON
143,626,680 *0DCA9BC840B73ABCFFA3E64D80F7096DF21F2C9E MIGUELHERSHELMAN
143,626,681 *0DC311A56A0E56420A2DEBFA889F2ACC9E89947C miley_hands
143,626,682 *0DCA4E068C7129B48E2ACFA004B9ECDFE6E1F314 MILFORDCEPEDA
143,626,683 *0DC5467029EC42F1A4AB66C5E9FB012CD85E2CF2 MILFORDMATTICK
143,626,684 *0DCC976B646FD6D77FEBA226D84F7B8C122787D1 MITT-SHAH
143,626,685 *0DCA5AED033F99A34FBFC390EFA3FF34CC58B0A6 EKZ;
143,626,686 *0DC69DC930F03F9DA5EF6BA6A64302A415243BC9 elbatcil7
143,626,687 *0DCAF77986D08B13C0B8AD266D965706FB9149C6 ELBERT.KINDLEY
143,626,688 *0DCD125779397EA900FD3D18801CB777FD7A2844 elisabete.carvalho.pina
143,626,689 *0DCA3CAE36481E38FB91F08DBB7BB202C4FEDD05 moreen.dutt
143,626,690 *0DC54B20331DD9BA756F92591EBBA6EE211965BF motoren,walzer,op265
143,626,691 *0DC4207C54C77A4A0BC5B5FC09CA7F7B08E1BFF5 MSQRDNG6
143,626,692 *0DCA60AAF86CF4C51989E1F6935BA29827019685 MUL+1N4+1ON4L5
143,626,693 *0DC0D68290F5F69D4FD951D8C1C74DA7C782E834 ELISSIES
143,626,694 *0DCA998EBC721CDD19C5E70EF2EEDB86246E9E73 ELLA RETURNS TO BERLIN
143,626,695 *0DC2BDD49A962E9DCF27CFAE3CD7135A543392A7 ELLIOT.DALBY
143,626,696 *0DC7DE587A1D4C0839B6990F4DA3B02AE742CCF0 MÙSNINKŲ
143,626,697 *0DC4D8B72173179E82C517ACA78593A0BD9609E0 ELLSWORTHEDD
143,626,698 *0DC15BD72DD1721E8B2DC666C16BE4139B843F2D My.Father's.House
143,626,699 *0DCDA9B565246547A3492633E0B96FEA0C0F875F MyFlamingSoul
143,626,700 *0DCD056D7F038914D9DF8230E261E39CC0086738 MYHILBERT1988
143,626,701 *0DCC9D5DFFD52FB2358F503C5BB27E03D23D85E0 e'lp
143,626,702 *0DC2FAC089679A5D0697309D777E8ABAC4935656 mysmile11992
143,626,703 *0DC1735E3E2A2C41B3B80F9E60422A90F5309644 N51=..JOHBOTS:/WHO*=*=*
143,626,704 *0DCD3C2EB8F0D591455FE2273AAAF65B4F464796 [email protected]+35
143,626,705 *0DCADB58307BFEF427453D6787D3E9F8FFFF0CA3 emau8
143,626,706 *0DCE9CA5CC80DF211330B8D57CB7DFB792ED63F0 NAAMEAME
143,626,707 *0DC18030C05510F27113511AA0E603FD2B57499D EMISARIO”
143,626,708 *0DC1DBF2F34D42E34DFDD20F83C896A517B442AF NATHANAELCHIARA
143,626,709 *0DCEAC806F2010F9C8D0176C850572B956385488 EMOTIONINFLUENCED
143,626,710 *0DC9D139CCBC241A02373F6605E19179EA8EBFAC nazivlja
143,626,711 *0DC5C0B0CE2378518913CCD52398FD84627DEFF3 NBFSCTD9
143,626,712 *0DC335C6FC1DB44A5D8C5F76C5CE461C894302F1 enetelif
143,626,713 *0DC439B8A0B843914243013879EB2141D4749AC2 ENGINEEQUALSCARCOMWWW
143,626,714 *0DCE4591933D38A31904DB22843F80A4F6F5D3B0 NEALGUIBERTEAU
143,626,715 *0DCCEB94CCB368E764AF3831CC3C09059BDD2001 NEESREVO3
143,626,716 *0DCDB987C47DD2614B94B19A7A03F8A6CDECB66D enochwalega
143,626,717 *0DC03031507D703378B2E11EDF278467D523F0CC nelsonimperial
143,626,718 *0DC0EF1AFFB01C3BCF085E23C9D051BD8DC257A8 eopmd
143,626,719 *0DC4E94219BD0982DB8CE3BAB239AE381DB4098C ep2lf
143,626,720 *0DCE977181ACC7A8B39DD45D6C9F5EBEEF6C2497 nevillemancha
143,626,721 *0DCE7D8D213264176C9F55A143652C2C264B4768 [email protected]
143,626,722 *0DCF9875AE0D2704D8A21451B5790D863872483B erinfripp
143,626,723 *0DC00188EC1A22EE5793F00D20B45E1FE72484EC ermel
143,626,724 *0DC06BFCFF8CF64E9AF81C9308A5DF0A63DF1506 NFG08
143,626,725 *0DCD0E6EA10FB7AE751A18409F31F84BF90732D6 erueaszl8
143,626,726 *0DC9CF70E1A16909924D699B72CF82643CFB77BF ERVLUCHT5
143,626,727 *0DCE98F348F9A0178964F6BC80ABD6AC186B5021 ERWTENBLS
143,626,728 *0DC091344A7799A1907E04C8831672A1698935A0 NIAPSAAA
143,626,729 *0DC094CB0B7C203A1FEC0D01A1A26890329DA695 NIARBROF
143,626,730 *0DC27DB3E4ABA40E7B6BF15B5A108FC893625880 NICK PULOS
143,626,731 *0DC212F7147061540C673D5B01A94D1796E44ACA nighmost7
143,626,732 *0DC7900865D71F94B2D4957101982E015205E75A @Essen
143,626,733 *0DC4320D09C09A436F91B68CCCF6031C2FD4C43A !EST!
143,626,734 *0DC0B47322730C6A8033BE3B9E944F693A6FB748 estanzuela”
143,626,735 *0DCDF3B6E0A50F1AAB43152DCD7416587684F35F ESTATESENZATE
143,626,736 *0DC2687F9B848FF4D6B0C32EA7050851FC438727 N-IS-EGY-KICSIT
143,626,737 *0DC037D0734B58F078BFEC6C303687C18AA20C9E No..15.in.E.minor
143,626,738 *0DC73BE2F110D56C2C09E5A5E72D0A507926E285 NOAAA
143,626,739 *0DCF491E1859140CA598863A154D62E68914EC78 eudfc
143,626,740 *0DCAC9EE311199BABA2E4BEC60F2D028B8043955 EVANMASTRIANNI
143,626,741 *0DC20655A260C065A316372CAE43A7DC47DBCE75 no-one-must-ever-know
143,626,742 *0DC9C66419B116892EE518A06CC009FCE549BE98 everettdettori
143,626,743 *0DC50D78872CD58D48A0D9790D14F1E10BD7C9F4 NORISHIG5
143,626,744 *0DC5CF4541FEFAD78687B4CD2A88E449464F2554 exempli
143,626,745 *0DC88D0E2B24887DC16E69F168994C00899DED47 EY:+
143,626,746 *0DCA251DA6336FC906248E4CA3A8131C17743F2F [email protected]
143,626,747 *0DC8DBB285A839C25937336B9A2470C201CB25DC F1CT10N411ZES
143,626,748 *0DCA92D3A81FA6B13C29CE5124AA39C24C886F0D !NST!TUT!0N411Y
143,626,749 *0DC8DC568C0C94638E3B8D0B67F1EA4D7A52C8AE nude-as-the-news
143,626,750 *0DC46745559D13FEC08470E6B5AC00514EE209A5 (><) O~0~(====8
143,626,751 *0DC2BBD00CD8B6CEE5DE1796B61402FFE6EED163 OBAATAN5
143,626,752 *0DC28B94657A20DCAC96270BA4B1D100CBB4114C [email protected]
143,626,753 *0DC3E67836CACD85D94D6CBD0CC72A33824A1ACE FACQUES1
143,626,754 *0DC95242A0E4BCC5B17C2B4E807C30DCAF69BDF8 FAIRLEYS1
143,626,755 *0DC241C6AF665DA5DD24D65BFD5076B9A9E219AB FALM3S
143,626,756 *0DCC0C4F40B3B28683B3EAF85AC0D5AF9A488B05 farmakeios
143,626,757 *0DC24D7355ABE312E66801AF729DA91B2685E58E ogiベンチャーキャピタル
143,626,758 *0DC1D39D453F82E418BB1A4C0090FFD0441A86B0 OKIYAMU
143,626,759 *0DC9C16376D1EAAF227BBBD52075329288DEB485 FEI NIAO
143,626,760 *0DC0FEF7ADFEC620753C54D31D9E76AFAF42C0CF OMERCOUVILLIER
143,626,761 *0DCCA3AC91BDD7B5722B0255478DD39E3BF9FC97 only for love only for you
143,626,762 *0DCAD0A0553648212DA3CCC6FCDD31D5BA48E33D [email protected]
143,626,763 *0DCC0628E5681FF7DFB9EF4EFFF64B62656E005E }O{O~0~(-----B
143,626,764 *0DC037C33E28B84DE78F9F8BB2660F2AC4C8B5CE (>_<)o~o~q---3
143,626,765 *0DCE3482F65CF1867DEC95AC587EF59C9177FADC openingsredes1
143,626,766 *0DC419D69F7CEEF135C54329A2845ACABEC872E7 [email protected]
143,626,767 *0DCFCD1CACB09B0BEC4B275EE33CCA3440D7E6B0 FIDELFUSSELL
143,626,768 *0DC6E74B2361B2F42DFAE29639EC485E5F0A7290 FIFTY-FIRST-STREET-BLUES
143,626,769 *0DC25D4950723D5C4007C065AD1B9ECF2EED364D FINNKAMPENIIN
143,626,770 *0DC94301745A6D22EF5E200AEAB8EA7D4DDF87BE [email protected]
143,626,771 *0DC54879078B9270C10D10AC716F9C28BFD6972D OPREGUI
143,626,772 *0DCA945A92F1982969EB1DB3E3FF5DE6616479BC FLECTISTIED
143,626,773 *0DCA11CCC521AE3B5E4FB60E3C605F8ECA620331 ORGID
143,626,774 *0DC931D3F99D5AA0BC003AABE03F3B9A7C38F21E forever~」の1曲に入っている。
143,626,775 *0DCF38DE2C2B91432EF2CF3B9BE47F306D951CA0 overforwardnessed
143,626,776 *0DCA140D0AC4E84C4041EF7366D343E9F960A183 FRANCESCOSINDLINGER
143,626,777 *0DC8573B8F7722F5CF60689FAAD1A5222609A88F FRANCISCC
143,626,778 *0DC159CA33B012B0AB5F3593F0AB3DA62F9D1573 FRANKIEGRISWALD
143,626,779 *0DC3CB44BA828655AB54BD38D54213EB4642A480 franklin.bourne
143,626,780 *0DC41033B482C8DA12D00BBFEF9EFE5C4EED08EC [email protected]`~.`~.(0_<)
143,626,781 *0DCE4FD618B4BBC23986EE670E8E18D2A85826D0 FREDERICKWINCE
143,626,782 *0DC8083B950EE1EEEC1BE31F84263DA57CCDBA1E P4N.IC3
143,626,783 *0DC978F0DBE11D664E8620F26E0E61FA2F6BFD51 FRED.STEADMAN
143,626,784 *0DC6ABF989D54C361746B100CA57AE5190169773 FTL-Games
143,626,785 *0DCA1DA5A72FAD6BA4867547CA635B71BDF8AD21 [email protected]
143,626,786 *0DC00D63452C893230F0CECBB62653A04A78BB82 fwnextweb1fortwaynecom
143,626,787 *0DCEB04205A1C74AAF5EC64D2460E7C61601A477 PARDILH0
143,626,788 *0DC5F1E06822750E38173E9825E7B8D60CE0B048 parisbrandolino
143,626,789 *0DC246582E65733A7964D69E0CFF919CFF242183 PARISCOBDEN
143,626,790 *0DCAEECCEA231867EDC4D3F463879C00830C5367 pascal-feos-overflow-(timo-maas-remix)
143,626,791 *0DC2DA26350E9A483D5CCFA49AD57F26EDAC4E70 gabrielh2opolo
143,626,792 *0DC8CD6A1E33F766D3F42F59237EB8A18F0E4CB8 GAELIC28
143,626,793 *0DC8C709D1E9421432A200222D13649ED877A1C0 gawaragiriya
143,626,794 *0DC47D8E5FDF83EEB955335531070CBA0EC26F99 GAYLORDKWACK
143,626,795 *0DC22BB144BDD867534DAAAB0EAAB11B2D4CF80B GB_IHK71
143,626,796 *0DC66CBC936A21AD8AC7BBB85BF4567E1EFC49E0 g-du
143,626,797 *0DC7C4E7E02BFD9D70C399FBAD246B3BF4C16F99 PCC-AUG$
143,626,798 *0DCA351DE74C6107BF1C3C868EE86F1E6C1F4E85 GEORGEANNE
143,626,799 *0DC58D6EF197D52850D320C272CC574FFDA798F0 GEORGEBREMER
143,626,800 *0DCD735ADE65FE3CE75792ADB53EC9E6214653E9 geraldsommers
143,626,801 *0DC620EF4C8D91A53C500E93C51FC4BB1CDADD7A PENSKECHEVRELET
143,626,802 *0DCF4E8CA5D25997C8F87A5FC723258FBC74F348 PERINATALES
143,626,803 *0DC0370430A7DB7BDAC4FC7F244A2856486AB578 PERRY.HUGGINS
143,626,804 *0DCFF9851760B61E115742721C53A60011D1ABFF [email protected]
143,626,805 *0DC80031A8F2630A8AD12D6FB381DA5AC733BD41 GLNNBIGGS123
143,626,806 *0DC1E25FB3EC0D345F638A6D72D76095BFDA9A9F PHILLIPABCD
143,626,807 *0DCC85B410BCBA096EF6334B5821692B0CBE9CC6 [email protected]
143,626,808 *0DC949D341ECDEB7B5D4FA0CD1E1312A1599FC13 PHOEBE-JASON
143,626,809 *0DC0450A19E717D0152DD2F0FEE829C529DBE550 godinho1234
143,626,810 *0DC4702CE700B1D4D3C29791BEE4E805CD7A05D6 GODZILLAAUFSPEED
143,626,811 *0DC4C2E432684DDF3A3BA54EF40D10735D1F1ED5 GONE.AGAIN.GONE
143,626,812 *0DC15E5B10208A44B14518A6D878B62E661D6546 pikaresk7
143,626,813 *0DC5C46EFF5C71A24648975E347FD94F702A9C35 PIPÁLÓGARNITÚRÁT
143,626,814 *0DCD879F95201B813D3817C7AAE97800E84DFF6F gotehya-cha-cha
143,626,815 *0DC0DEBC328A1EDBF045B70614CF29A20D6F7CEF gqv
143,626,816 *0DCF29BB4B54A13843D996080AD72668549EB158 graphicly5
143,626,817 *0DC3955C1EFB6BC23380E6E63FFB87C4BA1BB99D [email protected]
143,626,818 *0DC19E63A11769593775183F914B13895B965780 GREATWITHCHILD
143,626,819 *0DC928B2DFB52FA3837E02D2ACECFFBC0D6C5614 Poaceous
143,626,820 *0DC00DE2D7AB375C0C0D713B54661739C919DDCA [email protected]
143,626,821 *0DCA04E551580E51EC33AC5BEB642D916D2F0419 polyclar
143,626,822 *0DC7B998B8158E3E35805D55C7E3BB4F94E601F8 [email protected]
143,626,823 *0DC5D0FC4608B23675FE96026AC699F0B97D5C96 GRQ7GVYX51RJU
143,626,824 *0DC5E7C1ADDD7F4EE0E2692626C3FDCAD7EA5C78 pooprox
143,626,825 *0DC7E132EA181CD2B6DB4894E3FFECE0163A32C2 PORFIRIO.KELEMEN
143,626,826 *0DCE9BF5AB82B5DB38EE590DE1FE13E46939076A PÓŹNOMINOJSKIM
143,626,827 *0DC2D45635AA36252D898D1BFA825C59719188AB pP `~ `~(00)
143,626,828 *0DCA281766148E7A6EC7BF68CB27057267372AD3 pp~0splat
143,626,829 *0DC26B097DCFA0E8CACD4B30E3DA6C5010B991A1 [email protected]
143,626,830 *0DCBBDB0489FC415E56EDB24EBB8D529089A4277 pr0b4t0n3r5
143,626,831 *0DC48F750777389A7AD8FEB9536140CFC0900A4F [email protected]
143,626,832 *0DC4205D9E105ECBD5CB8C1F94516EC0AEF3E032 [email protected]!n9
143,626,833 *0DCABAFDA9964D82BF288D74967703E9B706F215 [email protected]
143,626,834 *0DC7356EBD2E0D0AF9BB3523E0EC61D203BB455B pressmarket
143,626,835 *0DC828A652CD3F365157741386126B24062E0E1D HAGIARCHES
143,626,836 *0DC7E6474FCF58A63559F31C2FE6F5564A9B0600 HAHMOTTELEMAN
143,626,837 *0DC73A2EB3C944D9D431DFD1FF3CCAB2F6E42433 PRINCEARRISON
143,626,838 *0DC12598336CB8089E8700E80CAB9B0BBB624276 programmierhilfen
143,626,839 *0DC25A0A177EECB5BBD9FC887957DD8FAB0EA88F HAN-LIBERTY
143,626,840 *0DC2CE6A7FA79867253660C2E0DEC2D02D941BBD PROMEAN
143,626,841 *0DCBAF14CB44512E09D31B8BBB2BB49A10E40238 HANNAHORNETS
143,626,842 *0DC0A6133EF46CAC0C50ACD9CB4E3DCBBC2EAAA9 Happiness-is-a-delusion-of-the-weak
143,626,843 *0DC4669A9A182A2C453980CE105E6F0B0F9023A4 PSYCHOGNOSY8
143,626,844 *0DC844C7BA8B82E3EE9C5602DE6D0F0B1D45C625 PURELIFE
143,626,845 *0DC311AD7C8A74AE4B44EED3C2E39DA8C087B203 PYYSIMME6
143,626,846 *0DC89ED0209E4CC9E0F4B533CCB6C391D0674EC6 HARRISONBISOM
143,626,847 *0DC1DE9641528542D4C12F0DED4EF532C0705D83 QNE]
143,626,848 *0DC7FC454485E64F3F507A35218806EE3435E538 q)~o~o)0(
143,626,849 *0DCFBED501D1EA82E3AB603DE13BF2F8D9305106 QQCMDZVIEWITEMQQHASHZITEM
143,626,850 *0DCDDDF3B94D68520AA99FF7B8966C43E7DCE969 hazelkings
143,626,851 *0DC2FA38169C55FE1552226AB03A23A0FC18406B [email protected]
143,626,852 *0DCD439FA99236B07A44EE5A4D4303A58D967B54 QUAKILY
143,626,853 *0DCB7765A2543608CCB122BA4E82B6E56D711E73 heartbeats:now&forever:timelessweddingsongs
143,626,854 *0DC996137582AFDAB66A1C2C662A5B010ACF8656 QUINTONWARSHAM
143,626,855 *0DC8E826E6F77A1E57098AF7949AB4AAB8EC26D4 QXNI
143,626,856 *0DCE23C5028A73B38136D5CA9714FE81F8778BB5 [email protected]
143,626,857 *0DC764EB729FE696DEE5C57FD0709B2705C12F14 [email protected]
143,626,858 *0DCA2EEF767D57F603301F2D433D3D76DFD5AAB2 hh}v
143,626,859 *0DC9CE66D0B4A380BE657964C9AD0C9607694116 hikareta4
143,626,860 *0DC2471F04FAE82CBB76AED0B1439F17D9DEE090 HJB4
143,626,861 *0DCA4C7CAD3A0945DC5788C0E000E1F6CBC9A9DD HOMAGE FOR INUYASHA PIANO SOLO
143,626,862 *0DCBECCA850D7A0CD83D080F2BB6A54F6CBD7F09 rdit
143,626,863 *0DCDD03F0D311A51211D593AFEEDDC1EF4A78572 honggoepfarth
143,626,864 *0DC43A43BE292CE73EF27543F6EEBB532778809E RE3A
143,626,865 *0DC63AAAB33E6887224C284E347A82B54317381D realitytvaboutcom
143,626,866 *0DCA29E71CEC448A6B460A69DDEB899ACCC0CC0E REBELINTHEDARK
143,626,867 *0DC3CF83A30D033BA350E7ACCE51BB634204F745 [email protected]
143,626,868 *0DCC7A3F7528F67C0242259989B56FFACF465087 rec-soap12-part1-20070427-errata
143,626,869 *0DC3B6A1D634D9B581845E9F6728BE060E755CA4 REDMOND.SHOOTING.STARS
143,626,870 *0DC0D46D5714B9165CEED9F59CF592C08DDE68E3 REFUGIO.ANSELMI
143,626,871 *0DC091F922BB233FB018CD98297157BEC00BC31A REKLAPING9
143,626,872 *0DC0883A72026CE469BB2A79FF36C8993DE65618 REMOSSIVE6
143,626,873 *0DCF17CA5C132271C6218D6648845B59CA2BCC7C RENEODEH
143,626,874 *0DC0123AB80A2C14683B8E6C5FBE0C8AA7CBFF28 RESSARCIAS4
143,626,875 *0DCF280CE21EB9D157F0CF43558E73E2CAE1C99C [email protected]3.NET
143,626,876 *0DC21A432607AE9FF96DE7F003FAA12B5FE67600 RETRIMMING
143,626,877 *0DCF0C0BE9CFDDABDF4EA1780AA12CF94D41C8DE RETRYTO
143,626,878 *0DC657F975F8EF54693C94F5BBC379B6FC5B492E retselom5
143,626,879 *0DC261E3D207D070038B6B1ED841C2FEE239836A reubendockray
143,626,880 *0DC8E7FCC82A2F35E5FC667D661B9AFFEED69832 HUKMIDA
143,626,881 *0DC5B247A3E93CCAB58AB0BA1043F43A23888BE4 hullett's
143,626,882 *0DC819D12AF684EC86CE10A3844C002F76F638A5 hulpgidse9
143,626,883 *0DCF9174857CCC935A9FE8E17D1DA701441CDB6F hüquqşünas
143,626,884 *0DC6FE22CBE86744737C29D95E3AF7D82DE8B49E rhowen04
143,626,885 *0DC71FB5C6882775DBB898B1E52277CCF233720B h"y=
143,626,886 *0DC0EF50D9AB7EE5748332274284567312B83B63 hyggef
143,626,887 *0DCD2D214E945A743D11031CC0538AD69463B268 HYLLYNS
143,626,888 *0DC4CFA81781E7144CC8D7C7C9ABEBAE151BF2D0 i9,x
143,626,889 *0DC718C9B1B458F54BBC5C592395E3E947143F2D IAMCALIFORNIA59
143,626,890 *0DC62D5645AA60B2726930702412DDD6C2FEE9A4 RISTIPÕLLU
143,626,891 *0DC91DE7E38B2BA492726D735824AE1DAB4A32F4 IAMPOPE53
143,626,892 *0DC44327F05F789AEBD38961684CF22BBC2BDB6B roadphotoscouk
143,626,893 *0DC2F975FBED40072DD9487F9FAC4678C62BDB0D ROADSMEN8
143,626,894 *0DCFACEA1822B5F9BA918F0A856596E220417DEA ROBERTO GASPAR
143,626,895 *0DC7CB54E0357B5B66F1CD9833274AE52FFC0A79 robinmaiava
143,626,896 *0DC51F588A1BBF7329C81C7BF8B85B0170B5A0DF ROBSPRINGSTEEN
143,626,897 *0DCEC0E26B08FB90CC82D83A7A303EAEA3EEF9A2 [email protected]
143,626,898 *0DC4ED4922059FD79B666657E27A9E9F94222B5A rodwampler
143,626,899 *0DCBFF941ED4181986E84F8D3E83FE9DFF9E7E65 ROLANDO.ACHESON
143,626,900 *0DC576A2BACFF973ADFDCD6E85341864EB1993EA rossballantine
143,626,901 *0DC85623811E3C0CD46CE77592B5D2EBFBD2FB43 'round town
143,626,902 *0DCC24DC417C2BE6AA2941BBA7F36397590BF4A5 roxas y acuna
143,626,903 *0DC7C521145C52877E187B0996279BB6ACE566A8 ROYBOTTONI
143,626,904 *0DC8C260F4423B15B8565EEAAE6DFA030271CDBE RSSBALTIMORE
143,626,905 *0DC29FCA9B3AE3A3EAF8DF92163B89700C6635F6 ILLEGIBLE
143,626,906 *0DCCED87F2F50917A1118697F5DEA7320AE1980D ILUVBACH1994
143,626,907 *0DCBCFAB1BEEDB9C4B45FF61B4AB217C6E5E91C6 iluvchip89
143,626,908 *0DC4A054BCA5B0B177262378023AEF97EBCEA678 ILUVDEF1996
143,626,909 *0DCC1CD46CD9F1704367B834E97EB0F30F11C849 ruperta
143,626,910 *0DC1030656FAD39A466B505663F310A967C7AF04 ILUVJACOB2001
143,626,911 *0DC8C1EA34187978943D1CC4380D4CFD65517264 ILUVROYAL76
143,626,912 *0DCBE05FA1A8D9DF3D891552B7B47E73063AE640 iluvswim59
143,626,913 *0DC605241F57405C3C358ED0639D013E00CFA975 RUSTYPOPEYE7
143,626,914 *0DC94A8AB1766E0871D3A0E212415A4829E10C70 IMAGINEZ
143,626,915 *0DC8A196AC31F491AE995250B84C0DCE20C8F2B8 RYAN-PATCHETT
143,626,916 *0DCC4A6EF5841884C7D7426A958F51F903DC870C S'3{
143,626,917 *0DC6529F026CB7FD96FA434BDB0D0CB77B6678FF INDEFINITY1234
143,626,918 *0DC22127ABFEB25BB23D82439FD200A161A5F95B INGUSHES8
143,626,919 *0DC5C0230614086B8E0687AD0DAED301B9193320 in-his-love-and-in-his-pity
143,626,920 *0DC0A4C08ECC85EB8DB988772A559325F7F646FB INIKAINE3
143,626,921 *0DC867810F17A10ED97979C004D40680B1205784 inswelg5
143,626,922 *0DCA84F1E0142405E694A82BF69396E25E3429B8 ŚALYAHARTṚ
143,626,923 *0DC07393E6F0222E342D79D589D71E3C88D82CD2 SANGCANEZ
143,626,924 *0DC3CAE19031323ADD881966B0A928D454F9E17C SARA AMED
143,626,925 *0DC00C133FB354FEC27778EEF20AC87ACE9BA4EA Sardinia-Memories-(Early-Evening)
143,626,926 *0DC561992B4F802A3456CAEA4C1028E56AA7E70C ISAACEZEKIEL
143,626,927 *0DC53F497D385C8628788AC92F3C358947821324 SCAMPI-CHEZ-ANDR
143,626,928 *0DC0C8DC6244936323E776327820F2810B7A28DD SCHALHEIT0
143,626,929 *0DCEA716D8B0ED1F3F977AC14B801ED18E47230F [email protected]
143,626,930 *0DC341DFC7CDACC38060A0853D74FAF30F2DBB88 [email protected]
143,626,931 *0DCEE0266FC45F5F1A7D406B6D67F3142DF24FBA SCHURFTZALF1
143,626,932 *0DC56CCB5FF48892047C76D261923321DA288C44 ITALIAN-CLASSICS-(DISC-1)
143,626,933 *0DCDAD6961D68FCC6D3457E4764CF1DEDEF47B17 ivanlis
143,626,934 *0DC034031F97027E507B2F23BFBDC07EC1D71837 I.WON.'T.HAVE.YOU
143,626,935 *0DC85FCDCCE6578ACC2F5C4C782B653C12E1B3A1 scuttle-butt
143,626,936 *0DC0644D1CF7B8FFBC0343A8ED5A30513AE41865 SEBASTIAN.WATSON
143,626,937 *0DCD4375B70B31ECAB88C889B4351F6E6C314FAC SECONDLY?
143,626,938 *0DCAF63EFF981C4A5AEA7B095C3ABDCC15E9F653 SEHCSIREMRAWHCS
143,626,939 *0DCE1AF4B6032727170C85E16BC20A0C6A3CCB9D SEIMREHTAID
143,626,940 *0DC4073F667538F282AF9A3D67E32F06A906CF33 SERGIO.GRIPPER
143,626,941 *0DC3B3163DCFE306E45AF52490CCF2EC8751980A jagor
143,626,942 *0DC43C1760D7D2F3D6114E5B0AEEB652F06B9F1B jamalduenes
143,626,943 *0DCEBB4518E11323C70F6533E7A116B6DFC51E75 SEXUAL061703
143,626,944 *0DC3D41E0ED8FF719184E76AB47E1E63FF0D0C7C SEXWFSD46QQC
143,626,945 *0DCB95BD3DAE443498D8EBEBE63F618255E582C9 JAMESGEESLIN
143,626,946 *0DC1595A73B584160EB3D93CF2B0D6DFE66F8F85 sharlene.bean
143,626,947 *0DCCA37237EE4B03AC46D3BC34D2CC0A6972D2A3 SHAWNGAGARIN
143,626,948 *0DCF750F3472D6610F95C10F36104F63B5CF5EB9 [email protected]
143,626,949 *0DCD5D7FB8C3A003D9BA789232508153A2AA3861 JARRED.BITONTI
143,626,950 *0DC5F4A950E4FF7EB5F62F0670B1925652F987AA shiftup
143,626,951 *0DCA192D32B9C2DF70B370A6996629917E50C90A shinoba5
143,626,952 *0DC3CCF81088A3965588A6B19753459523A5AD9B SHIRITUG2
143,626,953 *0DC61201B3300860A85513BF8D1F1DA3FB6D155F [email protected]
143,626,954 *0DC8F0A78B334A1B1B04C824832E0492287CC889 JEDSUBER
143,626,955 *0DCE637CBFF4ABBDE392CAE66A98382216994951 JEDWOGAN
143,626,956 *0DCEEFE8985232A0539AD5B0A7E1CAE3DF06681C SID.ASAI
143,626,957 *0DC6391BFCDFA9AD963672875F4EEFEB7140C8C5 silasminderman
143,626,958 *0DCC4EFF483908DA04F923CBB9140636AB4EABAA SIMCHAT TORAH -- A FESTIVAL CELEBRATING THE END AND
143,626,959 *0DC857152816B65D7E6F110C5D554EE773C22857 sinsontillos
143,626,960 *0DC26A4078B6C95692B8758BD66825DAF7AAA670 sirgalahad
143,626,961 *0DC7D40AA2E241F22576AE436F112E6F77A5835F SITIUATION
143,626,962 *0DCEA258BE92757F77902A207F92E8A47D84E77F [email protected]
143,626,963 *0DC1D4E4D355CBDE5D1AC51FC05475722ABB9C5B JFNAICILE
143,626,964 *0DCAA1F538C352B815A12CAB38CC06BD5DCAB4E7 SLEGHINO.
143,626,965 *0DC9C8E717C6017E74AD6B9381D363D580DAB980 JIMMYCULLY
143,626,966 *0DC69BB390E0509A200D23905B5C4BC0D5952F82 SMITHSANJUHL
143,626,967 *0DC2C4FD48099451909CE03985F5541EA033CDD2 [email protected]
143,626,968 *0DCC0B3E7605369550BE66EE04F35B28F72AA334 joan-walter
143,626,969 *0DCB3DFD5E00F4368A8C8407B43989C3F821320D JOAN.WINKOWSKI
143,626,970 *0DC5F52D6AB8F8D5BFB3F9173C553DD05F654129 snelop
143,626,971 *0DC0F555C3DDB6A6EC6B7B858D8F0892C4D5AE8E JOE-BINKLEY
143,626,972 *0DC4D0BFA9B91717B18F53F2764D3B75E7438655 snoriugnal
143,626,973 *0DC30324F7E6C6490DA97399ACE88D60A4314DD2 joesphmertel
143,626,974 *0DC51D115B30002DE417075FCBBCCD2D5A1FC8C6 JOEY-SEYMOUR
143,626,975 *0DC7073B49848E37DC2ED36CB6EB3D1FDAA9C242 SOMNATH SINGHA
143,626,976 *0DC806A7043A276A558D5B0ED5BC71234E56F5D7 sonata-(2),-op.-117
143,626,977 *0DC8A43104D801BAFC164232D58774817E9309B5 [email protected]
143,626,978 *0DC39A127BE1040DBA1C91343DCB443FECD2DE50 JORDANLOOMIS
143,626,979 *0DC78D1F00707C514F3845C41DE1197EC761F96D JOSHJUDY1
143,626,980 *0DCF363073E71EC4AE252ADE6F5E74F787B45ED5 JOVANAJOSIPOVIC
143,626,981 *0DCA666A6A2E6951BD52818FE91C8F14E03644AF [email protected]
143,626,982 *0DC26EF0A5A64A159034585BB75626005F581A8B SOUNDINGBRASS
143,626,983 *0DC17B5858C347A157C66A0F668617056E6AE153 so.what.(feat..kokane,.masta.ace.&.pretty.ugly)
143,626,984 *0DCA08429DA4FCBB88ADCE573C5339B01FD3C025 SOZIALISIERTEM1
143,626,985 *0DC808F087F721D95DC26988B862D1A8CC0A12BD JUDEOLLER
143,626,986 *0DC061945B2E247D633B6A88543EC778375B4AEA julioglew
143,626,987 *0DCCFC4B51D4B88CB53FFA49C08082FA627B87A4 JULIUSBAQUERO
143,626,988 *0DC3AE19AB1373AB29041BCF68190D0835A93C2B JUNIOR.ZUSMAN
143,626,989 *0DC898F87A8355EE48A2755A1103FEBF2354120E spis li, milke le (if you are sleeping, milke)
143,626,990 *0DC23133ABE416F4E24A711BDCD106E47BBAC38E [email protected]
143,626,991 *0DC17DF95DCBCF7FE48233EFC9EE7BD2F11A6FE9 [email protected]
143,626,992 *0DC4B62FE97D8C939142AD2012D6B94D87888B26 [email protected]
143,626,993 *0DCB118C2E8A665F19E85A100AA960BA2D00E4A1 KAKETOE?
143,626,994 *0DC3374098D90DC366AC4D59BCA66A1B449D9C62 [email protected]
143,626,995 *0DC61CE34EB9283DD7BA885A9CDB40E2982BD3B7 spunkyvanessa
143,626,996 *0DC3EE55DF8A8A729B4A90F1FAEF8BB37D6D67DE kapobsws
143,626,997 *0DC9D62C3931E242B8CEDBF360E639CE4AA4D2A7 [email protected]
143,626,998 *0DC7CF3040B34CC8D7081E153B033EC9C9CE837B KASEY.VIZCARRA
143,626,999 *0DC9581E8FC249AED1F3F51072A3AEB8DB5E3D6B [email protected]
143,627,000 *0DC0504189CB62DCB34C0352720B09F384BAF10E KBJULOML
143,627,001 *0DCDA82C20B36FE99F95BD78A34172D8FFF53996 STANTONSLAUGH
143,627,002 *0DC47348931087FB825174FB54BD9A698ED864C6 STEFANCASASSA
143,627,003 *0DC96A7BFD29FFF20F2DA089359FD42A7ABFA7B4 kermislieven0
143,627,004 *0DC2AFC6BE3BB49FE1646C9A7492C53FC29D11CB KERMITLALONE
143,627,005 *0DC43A6AC044C4AFA53411E3E4AB64A55782E0DE kevin.paine
143,627,006 *0DC7FEDD7DC40BEB7C914DB372135640FF7CF2C9 STEVENGANINO
143,627,007 *0DCECF90F7F8FCCFFFA48CAACA31FF122967DFEE KHALEELUL-HASAN
143,627,008 *0DCEF70F00FF1957E29C31684A23538891E228D1 STEWART.ROSENSTOCK
143,627,009 *0DCF6A0620924E98B9C07444B415517FCBBF6121 stneilas
143,627,010 *0DC3CA3A432A80BEEDC0F72B3A25E020DA27D86B kip$kin$
143,627,011 *0DC7D72AF9F8D992F8D00302065932A035844051 KJODOI
143,627,012 *0DC4E0677BCE7E4656D6471353E4E912AE695776 KL4SOND3RWYS
143,627,013 *0DCC1FFEF9189259AF8321A4C434D7054F3DBD72 KLOOSTERRESTEN
143,627,014 *0DC46E7FC4D28644674DBB2740673AFAA118687F [email protected]
143,627,015 *0DCA50037C62775A9DF037FE01B68E487EACDECE SUNRISECASEYS
143,627,016 *0DC2AD8B88AEE5A428D76D6321D8EB769CF78016 [email protected]
143,627,017 *0DCDB709C149648856F2FC239A90A463DBCD03DF supercolumniation
143,627,018 *0DC7BC61C1475256B7D20229766448276CDE2023 KRISTEN1945
143,627,019 *0DC5ADB51F18D6749EF5C073CF89DFD1E769D006 kristoferwojtaszek
143,627,020 *0DC78EF4EB2D4007652BF86DBB077396EC5EDB22 KRISY DAVIS
143,627,021 *0DC93045B4678C7E1AD53BB500D7CCBA715763C2 SUSKINDBLITZER
143,627,022 *0DC77E24F5DD49E97A04DF472C35C3127B3E65A0 [email protected]
143,627,023 *0DCDA014517A14084068F4E9BB7C61198386A7F8 sweta.kamble
143,627,024 *0DC921B5B69E6235F806755048CD76A31BD23565 `sy+>{{
143,627,025 *0DC33073D206C2B79C2C1331DDFA8FFB5CE3D7CD KUWAMOTO5
143,627,026 *0DCB2D00104B5E362C8203A613D273DB9A770F1D SYDNEY.BRESOLIN
143,627,027 *0DCFBF275A63FE7BD716246F80D65B1901F7795E symphonyno7-allegronontroppo
143,627,028 *0DC7B28194F2BB667840D75783A2B70EF1BBFAF5 KYMSIMOUNDS123
143,627,029 *0DC661154FFC9B59E9EEBEE6247A1B379B0FE16A LABBATT
143,627,030 *0DCD34B3A2E1A2FC68471FB24A118036A9835DCC TADUEFNI6
143,627,031 *0DCD8318823B918B5CAEF472372991BD5DBD6F2A laivurinkadulla
143,627,032 *0DC728382C0D0D83F8A5CB80969C72569E0E54F5 TALKJMMURR
143,627,033 *0DCF85366243028C7DD09AEA797A5A2D686D4134 lambsesed
143,627,034 *0DC54165B11A83BB299F8C2C96856ABBB3EAD1EA TANKERWOODY6
143,627,035 *0DCCC1D49DE1EF0DA3DAD37A9FFA2CE452747549 LAMPREYS
143,627,036 *0DC4CDDDA5A0648E05373E681DC09BC0C832D27C lanemcenroe
143,627,037 *0DC70580A74E7D01EF2AB60157FC3955A5C4205C TARLANDOSING
143,627,038 *0DCEAAE32D4769E04155611E01E47DCD5CED151B LAPROVOTES
143,627,039 *0DC1AADB40015E17E84AC5EBD5DE6463A7F99482 tathagatapandayahoo
143,627,040 *0DC2703E9EF2B681523D7D20DFC266C31F97E756 LAURIE-FRAWLEY
143,627,041 *0DCDD7BBEFE99338B6EA664DB4A50810ABEA2A15 LAWOTSEB8
143,627,042 *0DCF368FE9E9242F0D4DB73DAD2E944321AB8920 LEAD.US.FATHER
143,627,043 *0DC916926758094652E51467C0BE7421C45D5C79 [email protected]
143,627,044 *0DC7ADA5B0B505EBB152F17CF61A5EEA3FF38446 TEKSTMATRIALE
143,627,045 *0DC7F30FDA5699F8D3E6458ABA85BC8E5A91343B TELL-A-NUMBER
143,627,046 *0DC9B0160539FF1A6D981B4E912EC5390F8875AF LELANDEGLOFF
143,627,047 *0DC2EAE2062E72D793CC127F9E38D5AA8C3688D6 LELANDLINKKILA
143,627,048 *0DCE6181AA05AED4833D59A7FB928EB725FB2984 TEOMUS
143,627,049 *0DCC072F4340434A256B3CD7868E536A06223136 TERECHTHELPT6
143,627,050 *0DC1D0C9D21BFC7580721C78319810F2FACB4CAC lemuelyarosh
143,627,051 *0DCA69D288223A93D7B60ECFF0D6856DDEA71D69 ternisez7
143,627,052 *0DC885BE9B25BC540A8CA9D0365D022DB5F5F8DB LEOBERTI
143,627,053 *0DC8AA30911AE6794E0AF2B17942C9E21C845686 terrenceniemi
143,627,054 *0DCC393E947A3CB191ED96ABD475132F5EF053E1 LEONARDOFRICKEL
143,627,055 *0DCD5E3904A2DC719D2811C439C29523A89F741B TERRYGOODE
143,627,056 *0DCD4ABD0229034EE11F8D91F5C5727ECBE5C61E testseed8
143,627,057 *0DC3721E34AF980A7E4A628D497CE01065085D2D leovanaller
143,627,058 *0DC218112441C6132546AB71BE9B9B3B72DD9929 leviskaff
143,627,059 *0DC942877757E9A692DF89BBF1DD995D82A3CAA8 LIANG.SHING
143,627,060 *0DCD30195C33F5FC5E41ADEB2546A64D10490DC2 thatpunkin04
143,627,061 *0DC9C1F4157A07C6E31C7481F1C4931BA993059D thegretchen1997
143,627,062 *0DC10458F46EF667D381DF70BF7F9A2161740710 lidiebei
143,627,063 *0DC9C6EF3088253BFD469AA458C1160DDA5AFA9A thejimi94
143,627,064 *0DCCE1CD92C07B905F61877639096CA30F19828C thejubileesthejubileescd
143,627,065 *0DC3ADADA230973822328CF424702DFB232753EE [email protected]
143,627,066 *0DC033B14449231157CCDF724558D2BE57AD6AB6 linda-devenney
143,627,067 *0DCEB95046172591D18CD5730EA388DC2E8A0FF9 THEPICKLE9
143,627,068 *0DCF76FC6A6C05C16AA55CF3F37CC545094E2AB2 THERENE93
143,627,069 *0DC851CB86479FF528F7C1E5C926353B5895EAF5 [email protected]
143,627,070 *0DC8C5891762671F1636FE19C5D0EE5D5086395F THERON.GUERETTA
143,627,071 *0DC388F75FF704174A7D367E4DBD1DA9707153AE listuen7
143,627,072 *0DCEA80C752984EF278C909B1B241A0A01503151 thewayuptosky
143,627,073 *0DC13728C365DD31B7C128C7968895D3E3C5AF54 THOMSONによる75分のドキュメンタリー。2007年
143,627,074 *0DC39887EEC3BFAC1D3BF97B0FC47B220CCA1D5A lln21722412
143,627,075 *0DC6CD3A9AC220DC0C8108A0C23E5C35044389EB [email protected]
143,627,076 *0DC748AFB01156A9DA6B9A34C591EFD302EE4A35 [email protected]
143,627,077 *0DC366C9351716AFA698A91FB0BEB72517891AF5 [email protected]
143,627,078 *0DC791D7A7BCD5737695FB1A37C2441FC8578EA2 LONMARTINEZE
143,627,079 *0DCAB2A7C67B039D39CBB5659A4532924A90D938 TIM.BRUNOW
143,627,080 *0DC63CFD3B932E74088F9831599D0ABEC5A97C7A TIMOTHYDORANTES
143,627,081 *0DC17215D8B0151420671097832A1388633F75D6 TIPIWHING
143,627,082 *0DCE8C41CDE367692757149A5B3B5055E2D7421A LOUIS.MERCURE
143,627,083 *0DC390EE9EAA636B7597B80FB7E4C4CD6A21C568 tneuqilb
143,627,084 *0DCC0BD3D8EFAE99C85F9AA45AC9881F5AAA39F1 [email protected]
143,627,085 *0DC2B6B95976378FAF0A473771D3678CA422C9BC LOYD.ATHALONE
143,627,086 *0DCD65164352EBE0040E14C7D9ABDD0B70592496 LOYD.MAIN
143,627,087 *0DC5D1347BBFF96F88425DFD853362A99A2FBFD6 TOMMY.MEWES
143,627,088 *0DCF526C37FC87E25FFAF7D2A4B30F156058399F lthttpwwwmtphumku
143,627,089 *0DC160C72D27EFD2DF6E6A02EF1B4C9D21F31645 TÖNNIESBERG
143,627,090 *0DC265078C04BFEA511F4A5001019F37F1CE8CF9 TONY.LEMUS
143,627,091 *0DC417DAD3355FE50632DEBE9355BD045A408B2A TONYZAIA
143,627,092 *0DC94FA64752F576FD0C9D229B4E8F04C1CB9378 TOPHERRAQUELING
143,627,093 *0DC9F2A6C9133DED1115C8FF7DC0904E58A84598 tornino
143,627,094 *0DC83500BA05A2115BE185BDA5E704F7F5AA7F59 LUGGIES
143,627,095 *0DC0626D2C64E268FB945B502FAB081A23309387 luigicriswell
143,627,096 *0DC78765B650780B00387EA89B7ABC8CECCDFF2A lukovim9
143,627,097 *0DC9C3A3F258C73FA408D05E8E26202DDD8E6A33 TPDBBB
143,627,098 *0DC2C6B8DCCE25583E2FBB67AF81B90D40B80E8C [email protected]
143,627,099 *0DC219DAE81DC18EBD74DDCBED761A13A6716F67 TRANSMISSION-TORRENT
143,627,100 *0DC415501D52A5E6A609690EB0819C6EA734EF05 TRANSVASERONS?
143,627,101 *0DC4E9EDACD3681C4F91881122A6FE726B60B0EF traveloffers.co.ukwww
143,627,102 *0DC76CA2FD1F5DFA71AD79F4798AD483CB0F203C trentonkiening
143,627,103 *0DC93F4A139FFA3B1A06AF78E1CA20309966C90A lynwoodraisler
143,627,104 *0DC7AEC2E3B5CDD0D70C9F0358AA40AE5A17213C Trinomial-name
143,627,105 *0DC3A1AF7B93C27F3E34BC0A04F83905E6ECB1B0 M7479842
143,627,106 *0DC02DFDC3B1FFAA9C2C8D0CD75BE570733833C3 TRITOMITES3
143,627,107 *0DC1CD5A6FEAC0408D86227371429D7218DECC8E MADMANT
143,627,108 *0DC5306DA2C10497123F5B42D9F5F5292215E6B9 madonna.dell'angeli
143,627,109 *0DCDF78DC5AC0C85FBFBB7627B529E4A0784F8F0 Tú-Thịnh
143,627,110 *0DCCCC57F61C3359AA0FDABA5C70E0BABB939B3A two-fold131
143,627,111 *0DC783B7E7989FCF2BD2882E04E249AD48AF6E22 MANZHURIA
143,627,112 *0DCC81AD9D10FB270F6B990E060DE36B23393D86 [email protected]
143,627,113 *0DCF8156042E45B8D5197A4B69C2F5D32820AA8F TYBIAGAS
143,627,114 *0DCE50D8A3FE2AACC01431F9E2DD06714FD58A07 MARCOS.DEBACA
143,627,115 *0DC03665B2F43ED113336BD80AC25EB0254C3044 UDGANGE5
143,627,116 *0DCF4D5857DD7A4D41E59D3482746BEDACDA043A MARCUSSIU
143,627,117 *0DC8D847FE4EEA2FFFAABDEE6D1924E2030B2617 UITEENGEBARSTENENS3
143,627,118 *0DCD4E27A466FC48DA2D49CD514F041CCA6D4618 marianokreutzer
143,627,119 *0DC5FAA3EF04EEC895F4D8F6C611C31695C876D2 umadaop5
143,627,120 *0DCCEB9CBB8A671F0FC2DCB2B8DF7EF73AA9649F mark.keali'i.ho'omalu
143,627,121 *0DCB94E18A7134CE677B15CEFDC49E5C84656BF6 uninomin0
143,627,122 *0DC2E90D0441509121F879A7B213D374FD084BB7 UNNATURALNESS8
143,627,123 *0DCDFE60368D1A539BBE8716086F680AFA867582 marywolfgang
143,627,124 *0DC8262868EA75EEC624B37FCACF9BD98880640E UQUHMIGFYVSD6I
143,627,125 *0DC604F4917C740EDF70CD64630C6F4E5B9182AD MATILDAVILLE'S
143,627,126 *0DCEDC2A495832FB56589CFEE249F859C923ABF7 USAF.SHARIQ
143,627,127 *0DC7A0F4FA93EC86A3457FC1D8A1EF7E5B158E91 UYDDAIII25
143,627,128 *0DC56C19F63A34C6E3697E0131FBBF1C6365E4D8 uyvxhfs7
143,627,129 *0DC2DBECB9F2CD2FF223FFA5685007277AD5E48F VAHNWAWA
143,627,130 *0DC7A0324ABECE7E69C17B2E77BC4A4A62CA48F1 MAVIETOURNEAUTOURDETOI
143,627,131 *0DC06A61E192727F8ADB8E75742090A51A619C77 vanjei.mendoza
143,627,132 *0DC1E3B6C4CFE70438005E6CFF7DB967A86CE31A mcneal10
143,627,133 *0DC68DD2AE5FA839454C4BC37F16E6AF8BFDC0FE veilmining
143,627,134 *0DC42D8143E8591BFA11438D00AD3E269847386E VENS NAIL POLISH SHOP
143,627,135 *0DCAFCD34AA2540136983A664AE17996FD6E8A88 VER71C4117Y
143,627,136 *0DC823B1A85054976F731FF23F39F674B56ACAAB VERBODEMDE
143,627,137 *0DC69298BB1C64406506F0E339B595A7D893F9F6 VERENKIERTOHIRIIT7
143,627,138 *0DC6DBAF491B0E597D919AE1C961B43B3C2E8577 vernonkarcich
143,627,139 *0DCCD8E56F99358E31E52B5AC97A4AA8FD40DA8F MEGIGÉZTEM
143,627,140 *0DCF5CFF1722147FF5829D15D86DC54667C834CA mercyhymns
143,627,141 *0DC9185D2AC54662DC0021F875D8D898E5093F72 MEZIMST
143,627,142 *0DCF1CEF8C424DA80F115B3D1BBC9544D4B87A0C m<hbaa
143,627,143 *0DCA8A46D43C118A5A2AB0B07F6089F33149CE82 michaelamber
143,627,144 *0DC45B7F717C42E3127136B48259EBDDB8603BCF michaelrockefellersohndesvizepraesidentenverschwindetimkannibalenterroritoriumpapuaneugui
143,627,145 *0DCBECE1B526274AFE8DB761DEA51AA6B25BC590 VICCINTAX
143,627,146 *0DCE62DCEE93BBA6C930C6EFB3C3A7C095B482D8 VICKEYRACHEL
143,627,147 *0DC378F882A4EAD4F3086BECAD15009694F31A30 vidago1972
143,627,148 *0DC50AD16731D95FA551FAEE86B0E431F9CDA9A7 videorosie
143,627,149 *0DCCF1303765EF60AFF09B68FF87F69D888BCDF5 VINCELETO
143,627,150 *0DC146CFA4AABDE0CBB0A8B307588013CDEAF3D9 MINGYUFANG
143,627,151 *0DC8DA882B663CFCB8845CF1E99C71988D4F927C MISTELDE3
143,627,152 *0DC3CF6B65F1D2FE3E7501A7F6318EA50058521A vltlsbls5
143,627,153 *0DC51C41B4AF0D990C56411356D12561B84D04BD VPEANUT8
143,627,154 *0DCF42B5DFEE38FC220BFB817FB5EC60AD9B8265 V^RN
143,627,155 *0DC1F0FBF2B9C9C8E5BD28F0AB775F4C6E114CC0 VRNITEBENYG
143,627,156 *0DC4C510F34FA8EFE4C89C53608BC0C10E05B173 molyq
143,627,157 *0DC10217FDAE1FFA8978DC45B73A29DEC336A3E4 MONESAH
143,627,158 *0DCB90CF3D9C02F76D8A2F0AB343F321FB72F0CB MONEYLENDER1234
143,627,159 *0DCAC0ED2A5F09ED5E02FE32AC64CF407D09ADEC MONOFILOS
143,627,160 *0DC29EE05336D26A9413B97226B515F3749A1044 MORGANRITSCHARD
143,627,161 *0DCD1C02B7442EA14A77CE6AA7D44AEBD0B7262A morrislacount
143,627,162 *0DC24DF994DDBAE283AB31FDE40AD0884A47C511 MOSEJAMEEL
143,627,163 *0DCDA0D5414AAD2F7B32249AB6213298EC16A393 WBFEXZL
143,627,164 *0DC89F7BF1AAE2092C1AB98874280223851F62FD wbsh58psorw
143,627,165 *0DCC4ED9B77694C83DDC8CB83374CC5BBC818AFC «MOVIN
143,627,166 *0DC8A38E736D1D568344DBF7231A269ED6164F30 MSILGEETHEGALUEDETUMBIHAADIDENUVOL3
143,627,167 *0DC049A138F5C479329B2A343BCFF95FED68BF9B MTTNDRNS
143,627,168 *0DC9087A7D9BA19170DE7C6407623E65DA158C00 WEENINGGWN
143,627,169 *0DC1D7240A30CF67A090917F2536AA99040C9059 we gon' rock (clean)
143,627,170 *0DC209AF3895C91216790B3A63EE62A9943DCAB5 [email protected]
143,627,171 *0DC5F2A00714D6C02EFE81A45C3A983AFA993427 -MUSIC BOX VER.-
143,627,172 *0DC5DE50844DECBC3FB3F71DE7ED0C707ACC732F MYBYTEME11
143,627,173 *0DCCDFD8392E1418449584108D60CCDD228B6D68 my.father.was.a.great.ice.cream.man
143,627,174 *0DCC6F2B5D2546DCDC9F1126A389D7E35CFB7813 W>FR
143,627,175 *0DCE35A2BB238657AA94EF1C178678646A0DF826 MY.HEART.IS.ICE
143,627,176 *0DC9BF3A9771EE213E77BFCBCC5EE44E05A06C3C mymichael176
143,627,177 *0DC71B47FC587D2CE57F749709DB6B9138C3C8F9 MYSIGMACHI1999
143,627,178 *0DCE68C1446D35F70FF72A50C58D0069120CA104 WIJNDRUIVEN0
143,627,179 *0DC748B972DFD46CFAAD1A5FF3C859ED25733B9A WILBER.PRECHTL
143,627,180 *0DC37E7AD53DD61025BEF6FBA6E8736450F1F784 n23=..aline.-l.$remove($col1,
143,627,181 *0DC78259B0E29A9B0F74C3AB6FC686B951D2CC51 nangjere0
143,627,182 *0DC0D0A33F075513CB712CD40F76E35AEEF3950A wilfredootega
143,627,183 *0DC0C6EDE615D26C0AAB41E9E6CE7F04CE5985A7 NARALANDPLANNEDPARENTH
143,627,184 *0DC7A9C96B9D5F29942F4BF598E5ECD4EC5963C6 willianluppino
143,627,185 *0DCE76CAF60A393C99D744A4B18A0FB31ADB4D3B WILLIEBRICKER
143,627,186 *0DCBF3A32AC31E701E92FD6F0AF1B5B8A14790DC NATUURWETENSCHAPPELIJKE?
143,627,187 *0DCC03BD0F70EE14195FE7AC9F4485D4ABCAB3B5 willyknarr
143,627,188 *0DC10374494F9B5B3C8CA109E71B41E34DA63DCF navio.pr
143,627,189 *0DC99DC49F65AB5F78BFE3996723EE4044B503B3 navroopsinghdhillon
143,627,190 *0DCD0E16DDABF1267C0479FD87110A402AD6B8FA wilmerkoza
143,627,191 *0DC346FF6C8B89D8AB4353ECACDE30EF130302D5 wiltonjimenez
143,627,192 *0DC898D5EC1E01DB4A1E96D74E44AAEAA82C0158 WINFORD.ABDULA
143,627,193 *0DC3633ED98CDA83F3C8E322BECF4CF909B428AF ncreeping barberry
143,627,194 *0DC6F1C80B6650B231827CE16761E1D22674B648 N DE ELCHE CARRUS ELX-CARRUS
143,627,195 *0DCE2020B7B67B66710C2BCB40EC465FEE26CEE1 WINNAME7
143,627,196 *0DCC182E51B4ADDD91E4D283D06FC26581E26E8A NE9O7A7ED
143,627,197 *0DCA22F6D7C233D9577AD5CFA42CE352268495AF [email protected]
143,627,198 *0DCA12264781939D5D5D6652E8394678CD053B7D NELCORPIUNONMISENTO
143,627,199 *0DC2E62E10CE304E1C994432BB3A59005ED62E64 nellivel
143,627,200 *0DC59D4DC23010A6C3DB65BC405E9825CDD39E02 newlife.(lange.mix)
143,627,201 *0DC5B6781283BF20C5790433CB41EF4A8781D8D9 NEWTON.EPP
143,627,202 *0DC26F72B77D0B7A3196C4BAAFD94E3170691AA5 [email protected]
143,627,203 *0DC08DC12932F11C514405B4FE27614AA1206A9B [email protected]
143,627,204 *0DC3954FE21B366244F59C41003EE5FBB9CE74F0 [email protected]
143,627,205 *0DCAFAED7FF457F33375624252BB054046913F86 wuhan
143,627,206 *0DC039D7606E0775EF54AF2B3E153F04FF4D22A8 [email protected]
143,627,207 *0DC3BB348B448787C6660A4BDF7182879AC66292 wwwhrcapitalistcom
143,627,208 *0DC769D4B9FB337D314BEA58200CB694EF1D63DF WWW.RINGS.NET
143,627,209 *0DCFC39753E89FDA7C4BB0EC9E793165C46FC54B [email protected]
143,627,210 *0DCB7207777DDD7A936BDE4059967624DF7B8AFC nickbfi1
143,627,211 *0DCD0A4546C0B5EF058CFCF283A8042C085F0845 NICKHUYARD
143,627,212 *0DC2F246D540E152AF0190D1F7573258C7975895 X4FSQ0
143,627,213 *0DC20CA37C3A4183315C5DD3892238522CB26A55 nigelpoisson
143,627,214 *0DC114B4DAEEB538328B8558202BD6C59FE9F519 XER0TR1PS1S
143,627,215 *0DC8330C8A096AA2CC705269C6E340CEEE3EFA3E XEROGRAP5
143,627,216 *0DC0A931F4D6D492807FF4FD56136391E9F8C285 [email protected]
143,627,217 *0DC969FC4A06E33D6D495EC0121543A31CF65F86 [email protected]
143,627,218 *0DCE9D5D2B877229F4CE853394B37A3F58519466 XIEGUCE
143,627,219 *0DCAF6992E91F1CACC6AD7C0C5C1EBBA66CC21D6 [email protected]
143,627,220 *0DC4DE6B4460CF6FC4C95313E5E00EC74A686373 NNMMBLS0
143,627,221 *0DCFB48356336014278F29E88C3E2A9E807981E6 xrrubouxcohxdslotjfml25xookn0tddu3
143,627,222 *0DC29C612E82362FE60B1E9EBB91452E199BD426 XUETOMC
143,627,223 *0DCDDCAD17FEA158BBE7F8611DCD0B86A2B081B8 xuroulin
143,627,224 *0DC8F7E06400F58497A8F06DEB6B16777BD0388F XYRA-MAE-FAMILLARAN
143,627,225 *0DCD1C559C9C532AC4063915023CEB71252D579E y34$t.c4k
143,627,226 *0DC8433A955BA33151043ADA82AC3AAFF826B5CC NOSELEAFS
143,627,227 *0DC871F2C311242CDBFCBE81B3084DCD1F291C16 NRBRN
143,627,228 *0DCCF44CB1232C8CEF2EB4422C7ED5F0D4851832 YDNASEHCEPED
143,627,229 *0DC0B26B2BA37AA39DB480B89FC95A9F01C00C69 YEKIMTAC
143,627,230 *0DC1EAA3DCCB871025CBEC2C1EAA84C709566DAF yenniferjosefina
143,627,231 *0DC978973356C366C8ED4E815A6302D9109007C8 yfrfpyfz
143,627,232 *0DC8006F96B0CE4B9EB820C0C7C39D1F57868C8A [email protected]
143,627,233 *0DC7B28AE1360505E84096DC0C52C12BF162C1EE YNAHPOTX-ELIO
143,627,234 *0DC9414F6BB463FA4A0250A1668E06552DF97401 YOLANDIE-VILJOEN
143,627,235 *0DC6DFB5AB98EDB66732DD7598D67CF3935E1A76 OCULISTSED
143,627,236 *0DC66A060ACE699C33086F11B9A455EEFB13E7BC ysmasimmons
143,627,237 *0DC4E4F2D4587A8E89921AC6EA0285D86FBAE9A4 YUEKONG9
143,627,238 *0DC622BB37B03EAAD7755094846E4B6084F713BA [email protected]
143,627,239 *0DCD23F0E78C0281A2843B688DCDB0353CE01BDD [email protected]
143,627,240 *0DC619F301C588EFEBEE2DA934FC0049FA96D80F OLUŞTURMAMIZA
143,627,241 *0DC82B34FE7494D9DF77879C7B74922459D6F261 OMAR.CUFFE
143,627,242 *0DC66833912D68634BC9D3B1D8B5583383BD4ED7 ONLYFORAMERICANS
143,627,243 *0DC83047C75652E4378CAA57B510D7BCAD2AD69D onorassimo3
143,627,244 *0DCB153862A86A00393B3A6369F17274BC83B612 ONWARDS,.PART.I
143,627,245 *0DC50B68078D23336BF6D4082948AF7E9EA3A343 >-<O~ O~(######Q
143,627,246 *0DCD82AA10A8C292B93209B63CDBDAD38A98A61E ZAPREGNI4
143,627,247 *0DC9D73389EB278D801AECEE8EEED3AFFF2B59D3 zapregnutih
143,627,248 *0DC796EF59F3599DAABAC04E3BF134CBBFE02EB9 zarukaming
143,627,249 *0DCD0497C6467DB087D7856B345C7F3658144728 opgegeten
143,627,250 *0DCB0C7AD682800327EF08D8F30C12B7BBFCEECC zelpha-davis
143,627,251 *0DC0AA5FC49F2B7D65DD13DE592A593C230C909A ORENZOFF
143,627,252 *0DCC885B5AD0265B3F9F1D6D76E3693CA60A993B ORGANIZABILITY?
143,627,253 *0DC4EE30842DD19820F13EE1F6F72C7F991E9ED1 ZEVENTIENHONDERDS4
143,627,254 *0DCF85BEA05303C64B4773B7E350BFEB8560C781 orvalfitzke
143,627,255 *0DC69C2B3E9687F773D46FBD0699329A86B8DCE4 OTCWSVPN78DIEZ
143,627,256 *0DCAAC946771B3D15AE9AF5F01516C06490BECD9 OTISSTMARY
143,627,257 *0DCC00706C81398FC2706B519D20968FB21982F0 OTTO.BUNYEA
143,627,258 *0DCEC59DD8ACC70B8086F920673969400E694A22 ZIGGYTASHA
143,627,259 *0DCC8A34D9629BD3BF09641A3A765A1ECD8A2F48 ZION.17
143,627,260 *0DC142F0CD89E4820734549B505CDE1BE945321A zjzcatl6
143,627,261 *0DCF8FD42EEC168F2C89BAD6C4EF4C18A6A32FB7 zn<baa
143,627,262 *0DC4C988EA428D0A28AFD145BA0143BF0B5808C4 overseas'-'study
143,627,263 *0DCE4900C6913C27821B1235D2AD3E272ACC2A6D OXMATHDES
143,627,264 *0DCA7BDCEEA6A1DC3EAEFFCF7071A2E4B1503476 [email protected]
143,627,265 *0DCE5D1D4CEDBEBBD11B5670C2A658FCC7D5EE8F ZTHELASERGOD
143,627,266 *0DCF401225EB90C14E320B32FC714210AD3B03CF ZWTSRLND3
143,627,267 *0DCF3AD7614FA8FAAC3FF23D9E3033721CD217AD p14coid
143,627,268 *0DCF6F384D54954BBF77C827374EDA23ED003091 <p><a.name="n_586_">586..</a>..t1.at.61.
143,627,269 *0DC7ACF4E3884B052025E084EABB2A4FB96FC7CD PAPPILAN1
143,627,270 *0DC6B5C5A9474D660578E84D5BAEE4DD31358AE8 PARKERLEIBY
143,627,271 *0DCFA8A3399E99A6C9652125402594F8FAE96F24 PAULPRIBNOW
143,627,272 *0DCE5A8800F8240DC7C4DB06F4D057DF6C96880E p------b~0~o-(x)
143,627,273 *0DC5C7EBC7C646269F81EC1205216D09D5D8A2F9 P-----B ~O ~O{X}
143,627,274 *0DC5E3A162AB88D3639102DBCCC6082F017A4639 НІСИМУРО
143,627,275 *0DC0912A4E145BEC721DD78EEC469F02D438B55D P##D.~.~.~.}X{
143,627,276 *0DC242FEE9950FA7D2E7B8BCABC0C5AF7546C540 PEACE-&-LOVE:-THE-WOODSTOCK-GENERATION
143,627,277 *0DC7572C29FAAB8AAC6166E1C2A1F9E62AFB8383 PEANUTTAMARA
143,627,278 *0DCBF359468FC5EE0F6349DDBB57658D3F589581 PEARLRIVERCOUNTYNETWWW
143,627,279 *0DCF859B48ADFAA6CCFF2A2C0A49BC103554DEC4 PELLITORIES4
143,627,280 *0DC58A529F7244F9969D4E91DB40C39CB3977B7D pencill
143,627,281 *0DC4C9F545CEF474AB9BC7DFEBE2B851275E46CF PETE.MUSTARD
143,627,282 *0DC440AC8123A7FB4A8C6599627A706539C8ADD1 PGRLCN
143,627,283 *0DC66AD2D94EFED6D9AF81AF89AF6B2FF74AD6AA PHOTOMA7
143,627,284 *0DC3E50E52FCE2DE71977AA67CE30CF33489BC78 piekarnie
143,627,285 *0DC08059888DCBE5CC03F561D47732D7C20CC0AD PINKBOBBY
143,627,286 *0DCFE174F933247E88B91CF09537E5EB6C9E3C48 PINKSUNSET
143,627,287 *0DC8E98BE297760C93BA5E825E1FC944496951E4 pizzoli3
143,627,288 *0DC6AE1D8AF3BF96796C2DDC199535D2DF12A029 POLYESTER-'P/A/L/I/,/E/ST/@/R
143,627,289 *0DCE528D2DCFAA3451D264E2B0A48068C3C52E79 poorlittlelostbaby
143,627,290 *0DC0A95A7F8654FE0490594152F9D4E41A0E4A59 PORTCRAY
143,627,291 *0DC5D1810305A2C46070D37521A4B4D31288F9F4 pp~0splat
143,627,292 *0DC26B097DCFA0E8CACD4B30E3DA6C5010B991A1 王麗薇、ben
143,627,293 *0DCC7FF5104ADB7051CE7A8BF5FE061C8D7932ED PROGRAMS—WILL
143,627,294 *0DC799139972F9AEFA451FEF78049C8EEC2F0457 第二期ED
143,627,295 *0DCF74A393F22D6814AAE57AA374AC4C58C934E7 PSAKARAT
143,627,296 *0DC0E1F4B49F97037C9B28D93F677FFA29121504 [email protected]
143,627,297 *0DC7980354C7123D6177E3B29C37527A8C04C66D PULPVX
143,627,298 *0DC736BA01C1CBC2E747656E0F1EB80CA72505A3 PURBIDA8
143,627,299 *0DC0B69F514B40A2EFEA15595E28DCA9F8A2E82E putyourselfinmyshoes(bluesversion)
143,627,300 *0DC05D779B95851CE6F25D50905A3F4CEB900359 pwpipecom
143,627,301 *0DCC3D35DB2942F6ED2EC06BBC3580D8808F5424 qdlk
143,627,302 *0DCBFCF91175C887337DBE493CD329CDECDCAFA2 [email protected]}e
143,627,303 *0DCB54F7D1974D0431F54402BD20D0E7862140D5 [email protected]
143,627,304 *0DC7807F7016BA83FC43E0F7F8501F67B08B98FB QPLZ
143,627,305 *0DC98DE1CA0C6F64056E659BFF81C395BF56CD58 Q=====P`(O_)
143,627,306 *0DC787813BDEA9EA3DD8CDF8923216DAB084772E QSEF591
143,627,307 *0DCC3F7753547E84AD05BF6291CC2B506FEF4087 [email protected]
143,627,308 *0DC7D15302EAB7B669B80584C95A23015021AE01 QUEDANDO4
143,627,309 *0DCA32A7F20EEC65739A17382F1FC2166CC6A936 qzu'
143,627,310 *0DCBA7377B6F8E039A77DD9AB2728A0B48151D75 R1NG+A11S
143,627,311 *0DC3124BBC60B5779C99460A0E3543FDD4A52651 RADIOLARRY
143,627,312 *0DCA9A341B1493E140CE2EC909D89FC3E33A9724 RAMAHVAHSHINIE
143,627,313 *0DC4D1FF3427EADE1D71AAB336184C85C6FB067B RAMONGIANNONE
143,627,314 *0DC0B137DDD3C97E8E9818AF8C86B225799A6AB9 raven's shadow
143,627,315 *0DC0DA6D5D8CAD66E40089EFD3845233BBE439DF RAYFORDDASTE
143,627,316 *0DCEB7E8BE6725935729F93EC5F246441153A09E RBLACKWO
143,627,317 *0DC6275F25B5CA1BEC000E3A01E0B4C32F7F5F7E (00)~.`Q=Q
143,627,318 *0DCBB9646A9F345F2BA676EE2CE2C6ED5A60F0DE reactiongungadin
143,627,319 *0DC3090CC473F505553AACD46379211FBB7EF767 RECHTERBENENS4
143,627,320 *0DCAC95CE154BFBE26DBFF4AD1515251304DF210 03ltmas
143,627,321 *0DC14477719B7A363A7DB0F9AC89E29976D0B4EE regimet
143,627,322 *0DCA7D1194970DFBB801BD641F39BFF0FDB9879A REGUNGAED2
143,627,323 *0DCDA6C94A26F1B3C58225269A2898B3F928A840 reinaldocomparoni
143,627,324 *0DC599E5A13E434D3C31AD0BD7B679A930E33047 09311393
143,627,325 *0DC3A6FF1960B5ABCC278EB138C949CE507C1E21 [email protected]$T$
143,627,326 *0DCCE3B333FAB36CD145439D515429C8A7579C63 0ILOVEDETROIT2
143,627,327 *0DC708C0A4BC835F1E101A2A46773369D095B418 (-_0)o~o~-<----p
143,627,328 *0DC7538848A6B0F8D9C8C92EDB6610BE5144271A )0(~ ` <####Q
143,627,329 *0DC2FAE393BB806821E2501E0AD9AF26B7359AC6 REPHARD7
143,627,330 *0DC19D261FA43534A87315E47FA94ED169F547A1 11kitarisan
143,627,331 *0DCC5AAD0D1D91232AD541C65DF7C7C1EAAD947C 11 M
143,627,332 *0DCE3DE9EFBE63A275B6215DF8F87A3DC48CB07D 11 RUMAENISCHEM
143,627,333 *0DC88C8A640F88FC39B136EB6F18ADF0BD8E1C88 12-T
143,627,334 *0DC5ACBADCBAF97B7E0E5A38DF90D5DD809CA789 14CH1M0
143,627,335 *0DCECE0AC1408F76C6FD227E4A30BF09DF8110FB rickeyvongphakdy
143,627,336 *0DC0F611024E1356F4ADF36DCE4DB4216681EFD8 RICOPRISSE
143,627,337 *0DC6CEF36C8EC4379D4943F88A62D52E45E2C80A RIDITAA
143,627,338 *0DCABC44FF594E2FE92C7654E8D36C0ADB5FC19C RIFUGGIV
143,627,339 *0DCB8C023815854A0AB5C4F34D9BB29A703ACF4A RIGOBERTO.DESOTO
143,627,340 *0DC551001D8315629E66F2A81E7025DAC218968C 1624067 butoshawaworkershaveamilitanttradition
143,627,341 *0DC8553ADB47F9D19C596A02F9A879F5DEF3F164 166.2125...washington.field.office.(paired.with.165.6875)
143,627,342 *0DC2320DA0BD67158A84361E32667EC53919DFAF 16 AUTOKAUPPIAS
143,627,343 *0DC6C938F2816AF34563AD848A861D488251EB01 RINOAHP
143,627,344 *0DCAFC8332C3D4AFD48E359BBBE28C1B83C835E2 RLLSPLS1
143,627,345 *0DCE660E0F91DFDEB59F0F68E536648F0F6567A9 1817504 bisherstelltederaethiopier16weltrekordeauf.
143,627,346 *0DC52F191B2A6439676C353A9194CAB3F2827FB8 186SANTINO
143,627,347 *0DC2B18C03629C0A6A162ACFAF7F1986569F9114 1935197 mutta.elviira-
143,627,348 *0DC000CE1AB9BB6B696DA6451EB987FC7796D39A ROCKETMA
143,627,349 *0DC9D280CF7ACCA8862ED50697EA9010CFE233BF RODOLFOLEZAMA
143,627,350 *0DC3787F7B68CBE6EB5238660BBEBB6CBA5E997F 1 ANDIJAN
143,627,351 *0DCACBA16ABFBF474FACC95782BF6276FAAE6CD1 1bastida123
143,627,352 *0DCAED9DFDE6EA228FC05D2BE0E84803775FC1AB ROLLAND.WOODDELL
143,627,353 *0DC9DF4E88EA22F100E7C1DBB015A84AE0BA0984 romeozoldesy
143,627,354 *0DC4726455BE9A520816EE2BCBEE4E25A8082C02 RONALDVLADIMIR
143,627,355 *0DC2C1FFA8C90FBE4596B2418568DEF065805B1B rooseveltquartararo
143,627,356 *0DCF18D25686A8A63F0BC5E706307ACF96DD2C4E 1.ER
143,627,357 *0DC4A9F5A4F78C68EB413B9728FF94129B137769 roskrepp
143,627,358 *0DC9128EF05B069CC20A884E12B45CF9D5D28EB8 1-expditionen
143,627,359 *0DC5B047F753729C6FC655198652E7B04D6AF184 rotaria
143,627,360 *0DCEB36DEBED498CA7D7FFD0FACC8A9D4CE04275 1 flugzeugenteisungen
143,627,361 *0DC85C6E73DF01FBA985BEC005BB1D99B9772D29 1-FOEHNPHASE
143,627,362 *0DC8822E42E0FEDF8A098B0E9B7A725DEC671286 1GAIERONS
143,627,363 *0DC6A6CD54C525F61909AFA300FFBC0747EBCCA2 1 GOAJIRA
143,627,364 *0DC621AF98923B6EAE542D60AB8F905F8B53A6BC RR948LE
143,627,365 *0DC17DE0F2B31061487C659AAB3B8EA5D0F46B3C 1-HYPO-AKTIONAERE
143,627,366 *0DCEC068028B9791E6C3E3210AB72E58EB68CC83 1ILUVEIEIO9
143,627,367 *0DC67A4BF26DC715C047C9CA348CC8B4E1A158D6 RSUUAVE
143,627,368 *0DCA16582925E250D61B15E7D285FFF001504E93 1-JAHRHUNDERTANGEBOT
143,627,369 *0DC3C41C1E2B8A68CCBDF08B79E2FB6D543201AF 1 LOMITTAJATY
143,627,370 *0DC3FEB4A6DE55CE7786E4262950C83163B083FA RUH,
143,627,371 *0DC0BEF7A8745E64113CD46A55356A16A5EF160B 1MENGHERLE
143,627,372 *0DCFBDBC95481D64656C5D6CC1C7B1FAD3D0A157 ruperta
143,627,373 *0DC1030656FAD39A466B505663F310A967C7AF04 1 PIILOUTUMINENKIN
143,627,374 *0DC23C1495FE777853142CDCDCFE5DFD11AF5DEF RÜSCHENBLOMEN
143,627,375 *0DC53B57F5D2B8D61672F127B95A775B11E3A3C9 1.psychiatrikonzepts
143,627,376 *0DCE9922A291A55D02434DCEF98BA4B2E602F379 1SCHANKER
143,627,377 *0DC0BBFCFAF064992895B9B8B850BB77A9D7B4FA RYAN-ANTHONY-SUMMERS
143,627,378 *0DCC2EA18D72D75DA9281BCF3F448D2CEC93CB4A 1SPEZZAME
143,627,379 *0DC99758630F6ACD1C5A80E8DE73778B4DA01581 RYANWINDAM
143,627,380 *0DCD4F11E4186565C60E6E0E5CBD88C5E61AC11F 1-TABUSTA
143,627,381 *0DCA43DB375D0AF67189166E832F1C4E1D8AF149 1.TEHT
143,627,382 *0DC83D3876F09ADE52315892CB60B5E7B1A6383A s33d-134f
143,627,383 *0DCAC2358C6BC00037B0CBE5D2832E80964DD342 1-tieftarif
143,627,384 *0DC5D8102CCB963C632A0100C771C96E1B78722F 1WAYLICK
143,627,385 *0DCB7E56632A781518F0869D710B80B561CB2B39 20MARCH1172
143,627,386 *0DCDAE42698CD50B046D330748929FF1D5BB4ED1 2216583 ORVOKIT.SIET
143,627,387 *0DCE5A1358FF7352A6DEA77B3480799EB6765B82 2:--2---#---&---antiphonally
143,627,388 *0DC5450C3B30273E1AAC8F38BFA54232D243A5F7 23081924
143,627,389 *0DC5B2EF5F4A65D2FCC135048018D7ABF59DDE68 23.stromimporte
143,627,390 *0DC6315F57A896F8EA0CB24E5EC66E1F2503198F 2575283 KURSSILLAETSIT
143,627,391 *0DC6F7C736CCA4B1E764CCE389D6DD918117E58A 25june67
143,627,392 *0DC6DFD207B3A99D4FF1F6F5012CAB211F5C3C54 [email protected]
143,627,393 *0DC596354A462D5A5AD538B8DB1E6E88BBEE7018 28illegale
143,627,394 *0DC3436812A6F1A9112741560116C1CEEBE0BDE8 2958381 deutschelaeuferwareninsestrierenichtamstart.
143,627,395 *0DC16C1191FF1E014135A7B366928DA8C1490488 299113 luonnonsuojeluliiton mielest
143,627,396 *0DC791F55649749FEF651BD1566E472EEF537EEE salvatoreseekamp
143,627,397 *0DC97149A062968ECDDB796CECCB855F120D24B1 2.DODD-BOND
143,627,398 *0DC456B309E7E9960C1B8E6BB8271EAB23E8CDAA 2ILOVEPEDRO12
143,627,399 *0DCE8D415F85238F56FE3F10FCC44268BCC83EE1 2JCILIBER
143,627,400 *0DC60D1E29D5082BB8E4C96029293749B13DEE44 SANDRALUEDKE
143,627,401 *0DCFF1EBD4F7466D78C364477CAAFC203FE49684 2.KAULUKSIA
143,627,402 *0DCD4FACDFB7ECA760ED310F82DFC0A1DF4E3B6E sandylecher
143,627,403 *0DCD96E4F86CE97FD9495E8ADA1A6EF66AD8897B SANTIAGO.RIVLIN
143,627,404 *0DC31DFF976FDD1656B40A3A0342276A195687C9 SAPPHICS
143,627,405 *0DC5D0BD32ADC16E5B21EAFD113E6BDCCFD03194 2 SAMOTLOR
143,627,406 *0DC82371A50630C31A640924C72A3270A3B18566 2stacie123
143,627,407 *0DCA236E300F98087604AB194DFB3C9F6B37C1B1 2STERKEL12
143,627,408 *0DCFB3777507D6ED72E153AE3576640F8FA6F4E3 2voitonn
143,627,409 *0DC114C2D94D6929F7FE30F03DB438E27264622B 309279 "-es-geht-uns-doch-darum-,-dass-wir-sie-verstehen-.-"
143,627,410 *0DCEFB4AA55BABC25371840D299A0CD4EAE9FB20 324489 NO-ANNOYING-SALES-PITCHES-.
143,627,411 *0DC448FB80F3615BC0ECE6D809BD9F21A86AD0D2 SATURNCELTICSED
143,627,412 *0DC15DF881FA1D56895E378986B1CD4B7D6556B7 SATURNSCOTCHED
143,627,413 *0DC5463B2EF4FE842DE650DD8CF249D651B46D8C SBRIGAVATE
143,627,414 *0DC91F1A211A5577DA4F0408F750E0889EE284B4 367908 thosetalksbrokedowninaugust.
143,627,415 *0DC3F2C8FAE986F820B8EBEDCA3B378582EC23E5 38 ZEUGENVERNEHMUNGEN
143,627,416 *0DCF5D26A06E4FE887B463849ACCEBE4D6288F07 [email protected]
143,627,417 *0DC5BD97157B3BC081028EF8C993EC0BFBA36AC2 SCORREDERANNO0
143,627,418 *0DCF6D4D6CB94FF48464724030DC625F2F658BAF 3MYFIREBALL9
143,627,419 *0DC05B88C855E184225030157FC7BE968FADD737 SecureNet
143,627,420 *0DC34A0E500F89ECDE14E72FCB1FB5313329488E 3SUKCHANG
143,627,421 *0DC897AA79B3942EE42FB2793115922AA8089DED SENGJO
143,627,422 *0DC773C85ECC8E1D8DA24A7677DA025C108A7185 Sen+men+a1+y
143,627,423 *0DC77057635B44ADB68A1639AFC9BCF277E0B023 45dajesussgeborenwarzubethlehem
143,627,424 *0DCBAF3F8756AFDA6DEE08B2CCBF63BA6CAC2FA0 462NEVEAH
143,627,425 *0DC5179CF45BB84F81EA8584C5EC65BC34D01E81 SERBANTS5
143,627,426 *0DC7F57D679ED80F5CDC8C68B416E6F07085CE45 SERENBE9
143,627,427 *0DC604B68F5C39F6C83647D26EDD196F0CE82478 4ATHFARER
143,627,428 *0DC9745FF543CE85109C398CEEB08059BBBAED62 sethanhalt
143,627,429 *0DC3EE119D5976FCA72EF5F65EDE0072D3536010 4FA3BC94B9307C20
143,627,430 *0DC6362BE66813FCFF93554ADE01F8146FC47567 4FAZERESES
143,627,431 *0DC8A14D6F59CC648A62C60376B5C808C67327ED 4ILUVPAROLA0
143,627,432 *0DCA0145F27BC1669DD985EE4860B6A25102D274 4KASTROT
143,627,433 *0DCC076DE6D5B51D2D2A77DB3C5FC7F03A0047FC 4MYCODY5
143,627,434 *0DCFB0C12ABE37CCFBC7FC6A0C669638A19EEA3E SH3LL4CK!N9S
143,627,435 *0DC3F459A57BC4113948B756319850C5CAE2FFAC SHABBYS4
143,627,436 *0DC40C601A8F709CD9C72A8A1AF17CA2A2A20516 4NOILLEUDREP
143,627,437 *0DC103F8AD42CAD1E0907D5FC942E94F13FDA770 4PMCAAAAAA
143,627,438 *0DC61686C66FA32218042C4EEFF390F5F4513A89 4SUBCORNEOUSES
143,627,439 *0DCE1C9649B1DA5109C2F836929D08597BEE0902 [email protected]
143,627,440 *0DC0C1DB5E4BAB6A35BA2AD812DEF4B9657CAD28 SHDDHYRTHM
143,627,441 *0DCD96930393EE43B8CB373430FC6903A16266FD SHERMAN.BALLAM
143,627,442 *0DC9C90B5019768A7BA1F32892C8DB65B314D6F6 505712 THE-DOCUMENTS-DIDN'T-SAY-HOW-MUCH-EACH-FAMILY-WOULD-GET-
143,627,443 *0DCB497279B55765C346EAF6CF9987EFDBC47D35 58044 ev-esyalarindan-cikmamiz-gerek-
143,627,444 *0DCDC3C906339DD12C817127EDAD9B49E002BD33 5 AKTUAALISEKSI
143,627,445 *0DCA0D4EE43106B8FF9E4A33B8EACFBA040F1A78 5AMASE
143,627,446 *0DC846BC5821F82AB7EBA8D133A6A405D935ABDB 5ARIZONAGARNET
143,627,447 *0DCE74989E4020324A970D78BFB6059C9C7F2CBB 5bancarotte
143,627,448 *0DC9AF2E6F6D980DD07FDF757E9886C4C3422F55 [email protected]
143,627,449 *0DC659E789760C3249260A58A9A3AF015489C28C [email protected]
143,627,450 *0DC24F6815DF448D49CCF27CF90997B4F2AD1BE5 SHINETHAPA
143,627,451 *0DC9AF4362E58D9575DEEB812E5BCEF593AF5D34 SHPFCDNSS5
143,627,452 *0DCD60F32F195E752FFE873EB81CC792BD64AEC2 [email protected]
143,627,453 *0DC1E1657F7726463282427B3F1F7FC2652CC073 [email protected]
143,627,454 *0DCA594641608FFA998D1F1961A7D2D501DB4695 SHYRETTA JENKINS
143,627,455 *0DC205B1446D6FB926F228AC5EE6755DFDFB52D0 SIGSMONDSED
143,627,456 *0DC5E1002FCFDB39D7268F4D81C3B500D630D293 5GGRUPPAI
143,627,457 *0DC72A40AC92BFFECEA8A82C891A9370DB4990F9 SILANTHIOLE
143,627,458 *0DCDBF572CE697FD910EB39E7341B8AC82B15850 SILAS.KAKOWSKI
143,627,459 *0DC725EA02C8EBCC3DC9D493101C68AD7DEC442A sinamor
143,627,460 *0DC9524BEFFCB05ABADF55203F7D2407AB1A40A8 5JAPANGUEST
143,627,461 *0DC5CFFBE68416860AE20657753CD6510388CC01 5NOTLAGERN
143,627,462 *0DCFD7604104EA5928A2FD4D41AEC0F31955A634 5ROYALKILLER
143,627,463 *0DCF1D0E85A86A8DB86808235D1FB6A103A80AA9 5SEMICONVERGENT
143,627,464 *0DC0138DBAFA3F44B9197F4C9B1162879A52204B 5thefalcon0
143,627,465 *0DC1D0A1CC327D02ED8A30CDF7876E517DC0B5F1 5VTSYNONN
143,627,466 *0DCF98DF85FC974D94B7C36D2D3898C69095F5E6 5ZAJKOWSKI
143,627,467 *0DC9D7DBC866B678E7A6B9B5C7AE56FF98E2BDC2 smolnakloster
143,627,468 *0DC51B822CEC2777848DA55331ADFE0395DAFC97 614carmelo
143,627,469 *0DC95D4277D63C41552A44356A277F7ABB5113E0 SNEHOVE4
143,627,470 *0DC30DF47FF1B9B475E6D50A1C535B6D09DB67A2 SNUOICACESRETNI
143,627,471 *0DCF7C3247FF2EA06897E26FBC610760E66F34A9 SOMATENES7
143,627,472 *0DC9B339699D69973B37DB53D3DF641A6395C7B6 sombra13
143,627,473 *0DCA760134AE6BDE5BA7392A8D08A354B9BD54E9 SONATANO1,FMINOR:I
143,627,474 *0DCB185AD70E7926A8429AD27E0B2081272CAB4C S[email protected]
143,627,475 *0DC33983F7CDA2025AB489B355F6665158361A1C 6BALLSTOYOTA
143,627,476 *0DCAC5EA7F99FC0FB74C63A8211DDD5B632E473F [email protected]
143,627,477 *0DCB258F503150A59E8F31B234B25D0B3A9441B1 sortiaria
143,627,478 *0DC98FECA6BEC1094D1EE87E55ABB57F7146C4A7 SOTTILIZZASTE4
143,627,479 *0DCB0E3872879E50F9C1A50D789030D0523DA748 SPANKYSAFETY7
143,627,480 *0DC04697321BCD9FB17FCB31140EB938116F4674 Splat!.~`.~`.(######3
143,627,481 *0DCC35C49B06AF7966285CA6E582005F15BF02CF SPLAT.~.<####3
143,627,482 *0DCF2E5F6AE158C6F1D6BE2DB9D9B1A51736B24E splat!.*.*(------8
143,627,483 *0DC58A6A5B005E932ABC8B6A79164016655B4260 6j.s
143,627,484 *0DCDCE291D33E8264B91427EC036B54C4280218D SPLAT!!O~0~.Q####Q
143,627,485 *0DC16229697FA54F40C2BA5827C604BB75C572F5 splat!-*-<#q
143,627,486 *0DC86AFB290A901120D7D29FB19855BBDC847F02 SPLAVEM2
143,627,487 *0DC0F63775A83F45F9C2D8A2AE8CB6B40833C889 6miscounted
143,627,488 *0DCD3FFFA5486125E65CDA2586074BAE108228ED 6MRKSDLAF
143,627,489 *0DC61C9070B54688D696C2A4FB92C91D273E9A1D 6NICOLEMEOW
143,627,490 *0DC2EFBAF6176231FFEB050FF10BACA88170B7FD Squ4883s+
143,627,491 *0DC26C3AFAE46552D83E070014819B1875690AE1 SSENLAIRETAMMI8
143,627,492 *0DCCEBA2929946D5EFF962D9E78A6DC35D7B1926 STACIE-BARTH
143,627,493 *0DC6A5A2492C2E8C62E584B37A8BA135448F9B29 6ZERESIRATILIM
143,627,494 *0DC18194F199C1019D5F05EA4D2DE3689AB5F9DE STANFORDCARFORA
143,627,495 *0DCBD7580D29E3A31230817A5A07B3D38838830F STATION.BREAK
143,627,496 *0DCD759136409627CD03457648C818D7FBC89B69 STEFAN.TARAN
143,627,497 *0DC91CE5B05CF95B67A2125126AB10A4AD04C435 stenchfromthedumpster
143,627,498 *0DCD84521C8276611C9CF6A29D6638A2E307B8FB 7appreciaties
143,627,499 *0DCB83681AF7816B59276029F48652ACC59BEF6B STEPHEN.DEPTULA
143,627,500 *0DC8FC00CC161677234BB091F71F4CDEBFF5C2C3 7BSWISAACBSW
143,627,501 *0DCF4661C0B9DF5739A7B03F649DDAE71B1EDC8F 7CHUUYOUK
143,627,502 *0DC66AB73028BEF0C2F2EB62DAC230769B8B9D62 [email protected]
143,627,503 *0DCD1DFE4B9CEC14EE7D9103CF0E174A8B6E0CF5 STHLLTKSKS
143,627,504 *0DC34375DFF1FCCAE5DCA88FE8B51E91BAF4ACFD 7IHIJNUG
143,627,505 *0DCBF9E28D514D3350EB79722359A8DCE5A73228 7IITHENNO
143,627,506 *0DCAAF17A1D7AA1DF064DEB12C0D9A3D2D9DEE6B STSIPAREHTOIDAR7
143,627,507 *0DCB243C6FF9663207D8BEB41EB049A03B7BF2FA 7MYFINANCE4
143,627,508 *0DCCF97A0E008EE55E6E2148A18ED817271A9F01 7PAPERFACED
143,627,509 *0DCE6F568145927EB5369871C6D1A8DD4A2A3530 7PIECIOMA
143,627,510 *0DC5203BC2B954570BEAFDC3F3DFE59F624017DD 7STYNITOU
143,627,511 *0DC24EF41F0A2ED497D7AD8EB364D5D28DEAE502 7TUCKERQUEST
143,627,512 *0DC7196DC321BD122117FC702C86D040E1B7FAA3 SUPERINDUSTRIESES7
143,627,513 *0DC0C98E29D9D2CBB9009D5CAA35A6C525A5AFC6 SUURPOMMITUSTEN
143,627,514 *0DC5D4AAEDD9476FEFA15ECB1BC712725F90295A SUツインキャブレターレギュラーガソリン仕様
143,627,515 *0DCE82B92BF7C2F58A627457102A643DE62F9501 8#####@~~~(><)
143,627,516 *0DC7588368D3CAB537633BF26D5A5E87F095429F 801162 SERI VE PARALEL REZONANT DEVRELERIN DETAYLI ANALIZLERI .
143,627,517 *0DCFE13756966952A9E2B74B5361720B3AC85A54 88577B1FC2198847
143,627,518 *0DCC1003F65A4A1F5194DBDFE7B58DA37183C442 SYSTEMMASTER6
143,627,519 *0DC9EBE8E286F23C382DB446FB478D10A37EF451 szaksci
143,627,520 *0DCE6C3C7D16C167D0235CA96F39712C5C99E92C SZERYNGIEM
143,627,521 *0DC5DD010DFB96CCC56B63A13B3D19340BA88539 [email protected]
143,627,522 *0DC55E2573EC609E1451BCCB40A6B844D7250520 8D.~.~.}O{
143,627,523 *0DCD01A6814967993E49822650BE871F4607A793 8JLYUYPADDZYF
143,627,524 *0DCF76658D9588CE33A66050620FA4598AA4701F 8JOELCHARLIE
143,627,525 *0DC2586E175950641418E63E2A5D8C062BE30531 TALKYEMANAPALLI
143,627,526 *0DCB43401FB376FEDED4BAC273A03B7BE43C8158 8NASIRBSW
143,627,527 *0DC943AF0ACBE9D05F86E0B869CC2800BEBDFC85 [email protected]
143,627,528 *0DC2908ECE6AFEEC64B520CD5781A79EB2565EE1 [email protected]
143,627,529 *0DC1CCFEB2BA77E5C410CAA1CCBD72FBEE56E38A TAPET-TAPET
143,627,530 *0DC4882B8FD990F539749626731FF63E44D99C8B 8REPOSEESOPER
143,627,531 *0DC8BB3642C8C7FA720E343201664CAF74E55798 TAROTCANADA.TRIPOD.COM
143,627,532 *0DC5AD4EFDA1EC28FCEF0CA04DD7574F64F47E9B 8TERUGZEG
143,627,533 *0DCC44719AA1D4FFF7A8EE422B4118F1B314D8F1 8TONYSIMON
143,627,534 *0DC093A77882F6BC7D241D8AD716F35622EC9CB3 940de5d71431f935a15752c0a96e948260
143,627,535 *0DCCA98B3CEEFFF81BA230E0023731035910E2D5 941804 tammikuu.2002.syd
143,627,536 *0DCA0D7E056BB727F47E93B2761C8AD917DDEFE3 tennisbällen
143,627,537 *0DCB26E9CE4AA6B63280A563F5CC036E749DBDE8 THANATOSIFICAN'TBEYOURSPART2:ORCHESTRALWORLD
143,627,538 *0DC1E1884242C12055B0EF0BCB003A7F8B6D18C3 9FRITIDSPDAGOG
143,627,539 *0DC21538ADE7842680EA15E4E29D156E357DA7B9 9GREENDAYBARBIE
143,627,540 *0DCB63039F3042CCA342F16280008BBF5FEAD1A1 thatjimbob61
143,627,541 *0DCE14A74C1ABC160BA33961FBD4F99140263B71 THEBUDGIE80
143,627,542 *0DC3BDEE25FC21250973046D73E200ADA70AFD36 THE-DUPONT-CIRCLES
143,627,543 *0DC463C323B0C2AC7F8B65D5A26A8240DCD6E27F 9NANCYMARKET
143,627,544 *0DC556E2FE64A5955E90047298DCCD4CB46F5BC9 THELASTDAYSOFCHEZNOUS
143,627,545 *0DCDC99CFE7F0C0CF9FF0A954907E35A01BB5C68 thelistmagnov08
143,627,546 *0DCA428455854F2E28E8D9BC5B5EECB22B620123 9OIESBSW
143,627,547 *0DCC3EE3E3B4A79683C3E5A66C68068FB80DECE9 THEMELLON2002
143,627,548 *0DC9BB02785CA630368CE6A75F13467518000A6E 9THATBOOTSIE4
143,627,549 *0DC7DF95CA4F5CDAD04BD94FFE4328DFBF4717A6 9THATPAINT5
143,627,550 *0DCE4982E57943BA746F4FD50D3E9F326F47DA15 therondemmert
143,627,551 *0DC1F351C3F1EFDEE35CCB76BD55D7A451AB70FA thisistheposttitle
143,627,552 *0DC664760D8AD298EFE7EB01E856A36A43938E0A THOSEMACHJOK
143,627,553 *0DC429D88E91FE135C41389CAA2BF9D51D2972E4 THUNNUHTED
143,627,554 *0DC5F318676526246E685E8DBE04B088B71BCCC8 THURMANNIGHTINGALE
143,627,555 *0DCD11A43ACAED2445553846144CF34A7BBD1C3D A?0F;
143,627,556 *0DCDEA8DED3D65A0FF7A280DD2C6F7C752F266A2 a0nzw
143,627,557 *0DC956EB60242C631914CB9186BFBAC62AAF2F4F a2nt;
143,627,558 *0DC7E0293613EFD04A3B3190C325AEA242E776E7 a2uf9
143,627,559 *0DC87B3E59362920F8328262D5D830317730996F tiarennoisuf
143,627,560 *0DC09F7EB82095723321AD81AB6414CFC4ED4FCD A3vq
143,627,561 *0DCC174998290A8BCA43A1DCFF8204EB39B0C90D A4EXPLORER
143,627,562 *0DCCE6A4FDF63F09CBB0BCE001DD318D35CCEE26 a5dge
143,627,563 *0DCB9F7A934E39EE51D55C8C43B5AC1D03640899 a5q5
143,627,564 *0DCBB000E2F0F056B3221D9BB6D8AD48DE79954B [email protected]
143,627,565 *0DCD9FFE9F1606E29A9BFD861AA58DF8C57D298E TIGERWOODS101
143,627,566 *0DCB4C28696C984C788B6095455632E11526996B TIMEJESSIE6
143,627,567 *0DCB14CE2961DD93D4F2E41914828307C78111F4 TIMEPAIDING
143,627,568 *0DC3E702B9DA485A50190BB32E3C29AE7B9CA1B3 A"%8
143,627,569 *0DC2F0AF6AFCFE858576F21172C718CE20685559 A8B6#
143,627,570 *0DC3018837C1BA7219EA1FCD3AA6A2A77FF18C1F a8ir.
143,627,571 *0DCF38DBE510AB35E8B5014786148A6DF8D0AAFA [email protected]
143,627,572 *0DC4F9ECB92F13C6B4F4028B711AC67F4AD9674F titlenglycosylation
143,627,573 *0DCCCF939B63F4B6DA3290FD7EAF3D8F82C4D2A6 aaaa:n
143,627,574 *0DCE82BE6EF0A7023B759CF88EDF6C9353E9DBCB aab+ia
143,627,575 *0DC838FFC8116B6CE89D7BEB091EA5B16D329D90 aabi|b
143,627,576 *0DC953A0C8170A51069805916D699C839D4ED609 AABK,J
143,627,577 *0DC89C89D09343E4583F8673391FE85728FF52C0 [email protected]
143,627,578 *0DCB0593EE502BEF6FFAE87E3B64B9E888C9A505 aabV`
143,627,579 *0DC133889E2376949814908C2F81302153CC043E TNASIRADILOSES
143,627,580 *0DC494A9E0DA5C411DAD8A283D39DC2A5C1AC855 AAC^L
143,627,581 *0DC44E331A9B831AEC2D3B8BB08D8C341F313EBA AAC%TT
143,627,582 *0DC382CECD5E2CD1A0E926A103A35768B85E5EB4 tobiaspreciado
143,627,583 *0DCCF06682B9625B644741D496D5D2FBF217698F TOFAGSVINDUERS8
143,627,584 *0DCB585269B1299F9024AAC21E1F1E61453A36C0 TOLSLEDNED
143,627,585 *0DC0D9498B09B2CA55C4BA7E49328E3F747778C0 tom-diakit
143,627,586 *0DC0C1DB7FC05230075A10664AD0B974E3F63059 AAEW.C
143,627,587 *0DCC9B9FCF86B66B1182FE2F3833CC24C3A28089 TOMMYSTRIPLING
143,627,588 *0DC936EB7721E263E46D80AB6C9E16F05A506DDF AAIQ
143,627,589 *0DC85A7CB517ACB20F38C4E350AEC915ED278CE5 TOO MANY HANNAHS
143,627,590 *0DC502206F31F3519346C9350D693310D68D92FF AAN;C
143,627,591 *0DC115E692A3C98602E4F54A4C7BB2EF9EED791E tornabaed
143,627,592 *0DC108ADAA2E01EEB7CF089D8F0D88A02D3D135D AA!OG
143,627,593 *0DCF00232BE1778D507FF62E4D5939B9E9B1AC93 townpepperellmauswww
143,627,594 *0DC57E3E9B0E3EFBC079F4D58FA31038A9B3D7BC ab,>
143,627,595 *0DC8906CC7290537728AB7F7626AFE840A0F65D0 (ABDOMINOPLASTY)和
143,627,596 *0DC97582756B6AA779FDD4C10134D87832C9319E ABDUL.RYNER
143,627,597 *0DC0A709F4C1DDFBF010D240D640050701210D14 TRACK.8..SLIDES.107109
143,627,598 *0DCF5BBFC6D071E2BB26F5709F761CEAE1453710 tracy-conroy
143,627,599 *0DC1C871D375F54E6FADFE588BF7CC2F4F89F7C2 AbqN
143,627,600 *0DC6A4E5875B92CE7294237676C75A728C85D461 TRAN5F1X1NG
143,627,601 *0DC358EA5D2DCA88393A95BC6BEF945A62285A5A TRANSFIGURERS6
143,627,602 *0DC2DEFD40162033E6E3BF702437825823B925CD TRANSMISIOANE
143,627,603 *0DC04A8A1DBF73C965BE66955EFCC8FC9749F522 TREKPERRY5
143,627,604 *0DC5B9A085D2440A758F5A14CAFE27462213EE2F TREVORISITOOFLY
143,627,605 *0DC4AD4B1C915C1D954E1BF5265A23C2A7FA2F51 TRIADRUID
143,627,606 *0DCBE101F65DC51E0433C3E78B3EA90F9CDB3201 acn0a
143,627,607 *0DCA265AAB1727B19246475F824C488673408F29 TRISHA-MALIMBAN
143,627,608 *0DC9901C7156AE76015BDF96B92C8F15E77D9388 ACT I: YOU DON'T KNOW
143,627,609 *0DCD78C2C884CBC4EE203417B920240943D02C8B ac$ut
143,627,610 *0DC33673FDF1EC70B3D5FFDEE02664C08573A69B tristan-nix
143,627,611 *0DC1FF69D1737B05B60D8490FEBD633D6A2E1BA1 ADAMEK9708
143,627,612 *0DC73714715623DAE586FBEAFD33D6C221DDAF45 TROY-WILLIAM-STANLEY
143,627,613 *0DCA7E2B3D4DA7A83A8FE10F74DF121C6D44F99C TRSKNING0
143,627,614 *0DC2B437065458586C1C08B937A9B7A331FD1346 ADAN.CENTANO
143,627,615 *0DCC093B7D3BB6429FFA7C4A58D351171ECE251F TRUDY.VERTREES
143,627,616 *0DCE65FA099C529FA57A72B511B1A45DF6F22D35 [email protected]
143,627,617 *0DCEB7636CCB485F843410568F203C05D679453F A DIFFERENT RED LINE
143,627,618 *0DC483ACE61C815974C92778D0F123CD61CCD57B tsitsiridakis.dimitrios
143,627,619 *0DCCE40336B08529E3E5DE053DD6C89A10BE987B adolfoimholte
143,627,620 *0DC9F11D04501FD9060F98537764BCCFDA34A4B9 adsu4
143,627,621 *0DC8191C195E2BA187316CCD8FCE71CAA925C1FE TUTKALO5
143,627,622 *0DC96164A8843EF0927175EC703DA53BF0F9DC80 TVÅPUNDSKANON
143,627,623 *0DCA6118EA78B3DD7F5D301A4D1F4B5770B32B71 [email protected]
143,627,624 *0DC799392BB38680AC95D3BF25847F0B365FFC2E A$EOS
143,627,625 *0DCDCD3F998ABBF1B0FA1D0157C3314A653B7B28 tylerschairer
143,627,626 *0DCD6E8CAFC5166AC1244DC6D126CDF4C0A99B57 TYLL RODGERS
143,627,627 *0DC695DFC7454CD3640C6F4F1C003A3742516AEE AE(V
143,627,628 *0DC0E1B4B31A66BE277045030981125AC2493428 affermirez9
143,627,629 *0DC35BD452968D74BD2C623203231763B90BAD02 UCITIVEL6
143,627,630 *0DCD6D64F3FA66496F8C81ACA904ED68BCEFBEA5 UCTURALE2
143,627,631 *0DC1DAA71DD2C2D7230E6AFD42A26613C1E269A6 AFTERCHEERCHIRK
143,627,632 *0DCF6C09010763C8CD8EF28F726743B79E1E7966 AFZS
143,627,633 *0DC683ED11CBBF29140D8B62DC6CFEFA0953CCCE AG0C(
143,627,634 *0DC6F046A4C5437F9D7FA77FD064ADB0FAC735F8 [email protected]
143,627,635 *0DCE21E94A82492A33C8944ED42B8209C80C7B08 UG~>
143,627,636 *0DCF73877C7F84695FEEA80E58110F2E5FF879E9 [email protected]
143,627,637 *0DCBDE6141F30D9E954DA76FBB02287F2EFBA8AB AGLSEPPEL
143,627,638 *0DC9992B99E8FFB8F8C49D21FE22768F23BE51FE umhiccups
143,627,639 *0DC127A4715324D52553A4AC64DC8C80E8F3F8E3 UNDEADHOOTIE
143,627,640 *0DCD6BC2B60213891415893C9B1EA74334E646B4 Un-duro-de-amistad
143,627,641 *0DC9D12944168A1B8CCDBFBC36372E2BD7236066 [email protected]
143,627,642 *0DC026BC0DE25E61371E2068509E8E35D5A21720 UNEXPLORAR
143,627,643 *0DCE5D65101C7E5A1B5CF797D852E0CBA9080A57 aih&n
143,627,644 *0DC3B1EA17D3ADB9462248595F937FB22CF91FF7 [email protected]
143,627,645 *0DC292BBF5708F5F69D83C6792A38DAB4FDBCAE9 ai_q=
143,627,646 *0DCD0F6EF01E1B48067D5E379FAC3A384698F21B UNMEATED.
143,627,647 *0DC3E0BB47EF0E8314CCC60263FB4817331F0217 unnnftännde
143,627,648 *0DC6AC082D06C8EF5C273B3BC52454B2B0BACD6C UNRE5ENTFULLY
143,627,649 *0DCAE0AD4557C6E447A2BE827673384C4FF77B47 AJLS
143,627,650 *0DC1060EFD79E1500AA9B57A9EE378B79C3498CD ako:4
143,627,651 *0DCDAE2A55EC88E740153F9327B0A55E11353868 akusizi-nto
143,627,652 *0DC09BF639DD6CB9FDE4C523F09755988BD863C3 URASAWA6
143,627,653 *0DCF59938381C1632D91C66633F06E8D17993883 ALBAANLASEST
143,627,654 *0DC99912C2037B6A026F6F6A484F9D67398F73F1 USERVICVES
143,627,655 *0DCBA0C462D4CE2BDF1380CA4DB43BAC30ACEBB8 ALEI
143,627,656 *0DCCFA1C08AD878820ACE7256E02C8416F001B4B ALEXISES5
143,627,657 *0DCF70057FE6B0B7BD6D72D2A1CFD37E6353DF55 ALIDENTINO
143,627,658 *0DC68E6A68F3B3DD43EA30C4C126942274237646 V0972
143,627,659 *0DC65ADBC177D50CB6194D2313D94F8A0650729A V24552
143,627,660 *0DC136D05F5C27C0DC84748D140502F294470BCF v5or1355
143,627,661 *0DCBFA268C8356DC4735690BB8520AF13D60825E ALLANVANDY
143,627,662 *0DCD3C334E3A5EFB5C8D2CEF7454DF3251640FA3 VALENTINERANKIN
143,627,663 *0DC79735F6BCF74E97BB20909BB5E91A3886BD2C valeri-camacho
143,627,664 *0DCEA62C42893E2E712600FA408994FE5BEB6D91 vallee.harper
143,627,665 *0DCD87D332880BB986E486AD9F0D5BBAAAAD995C alphonsohull
143,627,666 *0DC2ADEB718F204694DF3A1DDEC3F2A9508D02D5 VANCOUVER.TALMUD.TORAH
143,627,667 *0DC77CED93A8DB9CCBB6770EA5CD007C7DB10569 VANDUDSKIFTNI3
143,627,668 *0DC2C4CE3D643DC29AFA2ECA2C343F3B18EF753D VANESSAJANEPATRICK
143,627,669 *0DCF2CA16AB506A208828B1DAF624CB8231AE771 VANNESSA.SAFRAN
143,627,670 *0DCAB4989B03D151F44B791A53A5CE31923B2E14 AM#"G
143,627,671 *0DC2BA438370E914206096E7065B4E65B58E97F6 veddy
143,627,672 *0DCDD22C0674184C7DA27810BD3B749E9C9A711B amorenbaltimore
143,627,673 *0DCAB6A0B5FD539B035865B605163CCF155363B9 amphoe-related
143,627,674 *0DC8EAF9CC7FD1DA090E9CB5B16E756385BF5E02 AMQWSGVGA
143,627,675 *0DCD056635F8016901229EA33D7B3B9C224E82C3 ANCADIACONU
143,627,676 *0DCA1B2512E6F192E575A0EF2B5861B28F66EBB0 VEER.DUDHREJIA
143,627,677 *0DC673BA32213008F788227953D60AD070AF56AA ANDREW.MONOZ
143,627,678 *0DC6E8360B8A4052583E798FAA6201C0F8CE2883 VENKATESH.MANCHIKANTI
143,627,679 *0DC623484E542276176DD6B324C4EF84F094378E ANGEL99402
143,627,680 *0DC32DD37BD7D3A5BA63BE33A806631FB2DCDDE6 VERLEAS.POUNDCAKE
143,627,681 *0DCAADD3F554DF274CF6CF2F1FDB6E28EF8DA605 anirudh-chaudhry
143,627,682 *0DC3A6D3200051018EEA066B4FFC0B6B93AA548E antihydr6
143,627,683 *0DCD4BB9F3A654CB9C3F3115C2DB6E24E0B7F78D vibeke-helander-bolstad
143,627,684 *0DC5907797703FD33671FBC16AA1DCF28D0B69FC AN'T.LIKE.YOUR.LORDLY.LORD-PROTECTORSHIP.
143,627,685 *0DCBA9058E9F9842AEB7D237D0CBE621F3FA705F [email protected]
143,627,686 *0DC6B36C545A77F901E835A170BD967C0A0062DC ANTONE.TRAEGER
143,627,687 *0DC1AFA3888F3C49BD3190020120088E03E1BF91 antoniarosebure
143,627,688 *0DCEA5A08827EBA550CC4EE6F85F30742D9DD1F8 ANTTILAT
143,627,689 *0DC9B95FAA236D9960F85DEAD79C9CFF1BE64409 ANTWAN.MENZ
143,627,690 *0DC3A862E6F77AD3A1253855608B488C9FE9112B VIETNAMING5
143,627,691 *0DC3DC9281DA0B326773FCA7E665A2B512CFC163 VIIMEKEVISIST5
143,627,692 *0DC87D39FED2AA2BF8792FD02EA159F417722B38 VILLEBECQUE3
143,627,693 *0DC62B01EBE6EA2FB4B353BB3951C9A9F3ECCFA1 VINCE-AGGARI
143,627,694 *0DCE3DDD3F859026C825E2BB099DC52525FE3137 A!PBS
143,627,695 *0DCCB279A08D1B1C5C5D4EE346D6AB75B17FEE9B APPARAYL
143,627,696 *0DC69CF8258B140872CABAF6CE2650E4AE8FD960 aq.hf
143,627,697 *0DCD1FB8963AB14FFACF8EC5B6A036F5C33FD65F vitocousineau
143,627,698 *0DCC289B0960A2FE8F4AC0406EE96BCA5A04F60D VITSKREMDE0
143,627,699 *0DC9253ECBD1B7DA3C6BCC928C133B6F5CCF73F8 vivaveronika
143,627,700 *0DCC2012D10BE212F9A793EA383D0AECBB792BFA VIVIANIGUZEMCLEAN
143,627,701 *0DC780E7CA4991456FC52778F8999B2A111E34B1 armandgrisby
143,627,702 *0DC4698F0461BE68BA5F4815B0F32C18719E4941 armuqwied
143,627,703 *0DCF4F5EFF043D071F3A23F2ABF97EE94C3C6F1A ARMUQWIED
143,627,704 *0DCFA12ACF7A477FDC8D9A566B7EDAAA48BC3AA4 VOLLEYBWHEELING2
143,627,705 *0DC7B95A2D8EAEF2FC603E37A3ADA909F4681A0C ARNULFO.DELORE
143,627,706 *0DC9DA7386A317F560C07CB4DAEA667A326FF244 A.ROTERT
143,627,707 *0DCA9A5B8FA89CEC1C900BAD4954703F81A82693 VOORUITSNELDEN
143,627,708 *0DC307D7CC0F5C84BAFB2A96463BF126AA134DCE arr$r
143,627,709 *0DC42C34267D1B6A332B0C33F52BC4195C15786A [email protected]
143,627,710 *0DCF610D9FD389197346797E69A876D66EEBED71 W4ll.sp33
143,627,711 *0DC85590DC581AFD2B9658E0001744D560BD6474 ASTRIA.FEBRISUSANTI
143,627,712 *0DC059BE3E9A19969AC0D64EA59A6AB214A55961 A?T1E
143,627,713 *0DC0899DAAD6B33E7DF871985063B68CCE5A3F8A ATALHEMOS1234
143,627,714 *0DCDE2897375800FCCD88AD07835A6B9856DFC33 [email protected]
143,627,715 *0DCBD072580E749756A1CF6BF176E42BD52F5563 WARD.TALASKA
143,627,716 *0DC1C21A8B70B93829E331930D757A0B73BB6959 warreneka-simmons
143,627,717 *0DC0DE8FDECCBAC8CD7D823BB6BF321BE43FF432 WAYNETILLIE
143,627,718 *0DCA2DA61C8641A05EEB6A6E7BA5C4ECC51FB369 atthestream
143,627,719 *0DC61218A9225C746C545DAFD82151EC78921983 WEDNESAYS
143,627,720 *0DC405AFF044C2CEC246AC8023474D521AF22BC9 aureliojaubert
143,627,721 *0DCB8DB2BC9ADEB89933E7272FF12F6816A7F560 WENDY.BOMBARDI
143,627,722 *0DCC3072E1F11D7D8E0C248DACA13DA168FA7F51 AUSE,
143,627,723 *0DCDE469907F05251CFDC1E299470921B9EBB527 [email protected]
143,627,724 *0DCFDED8EDB8FB3CEBE788C86687A9CE2ED6FBE7 [email protected]
143,627,725 *0DC176432CC401191EE9ED8CFEE6743D29DD5DF1 What.a.Diff'rence.a.Day.Makes.(Montefiori's.Duetto.remix)
143,627,726 *0DC040075109E93E186BF9DF8052534D5EC7C4A0