List database


# MySQL hash MySQL password
143,610,001 *0DCA46513881BC5541E59D96CFF20FB422CCF18C jayakrishna.reddy
143,610,002 *0DC47D90F4E731875D1E1DAC84098AB10EB7132A JAYALVEY
143,610,003 *0DC337F38DDCEA7F8E838E7765C6C44C61F2629A PRIORITYMEDICALCOMWWW
143,610,004 *0DCB7853B976DEA38C920991AD46FC4C5C3AC784 JAY.SUSANY
143,610,005 *0DCB5DCB4CBB4661BAADE012DB97DF27166EBB7A JEFFREYBONGERS
143,610,006 *0DC9F049D2C6BB62445A588FAF6DF6694C4C4D7E jenivee7
143,610,007 *0DC0F27AD81487B7B700D0F4248F39B75F343056 JENNIFER SOCARRAS
143,610,008 *0DCD9C52573F2B7B7CD6FEB5EAC20630A87C917D PUFFYLANY1
143,610,009 *0DCCF2FAA9A6FD880D2CC83CD73640E26C62A6A0 pui.hong
143,610,010 *0DCA5ECDC8FB08C5C7240C2039837AD970ED71E6 [email protected]
143,610,011 *0DC0E866BD727875126E747AB23AA0BDDCA75B62 JEROMYHOBBS
143,610,012 *0DCF4684B25B8CA3BCD26308FDC87EE569009D70 JERSON.LAZADO
143,610,013 *0DCB495453F65363720EE29730DAAA298209136C JESUS.GOLTRY
143,610,014 *0DC1EE97078A9B7DE5BD1D02EF7DA50FF30A121F JESUSSCHAK
143,610,015 *0DCFE45789469CCCD32DEF4DABEBB9B0F6E11FFF Q1W2E3R49
143,610,016 *0DCBA4BF1328AEA2AE02BB2FE24E2E60D5B176BB Q=====D~0-(0_<)
143,610,017 *0DC7A1EDB3F7FD3C4B26B7170E1A43CFF37AF459 Jj#
143,610,018 *0DC877C55D0C1B594B7341D7B217017AF91EF383 JKMNICK5
143,610,019 *0DC4AD6A06F25B65B841D1CB4B4A9390C715DA6A [email protected]
143,610,020 *0DC65A61F93F10E931D9C48FC3BB88CDB2A62B00 q=====p`o->-<
143,610,021 *0DC78E1B0F38A3456484D411BDFA50D9A95F5255 JOANNE-KALOUDIS
143,610,022 *0DCA4792DE6A010EF8900DCD1C584EED73C0DC66 jocelyn.de.mesa
143,610,023 *0DC18D1AFAEA164EF1B2D709F2096795FE216B1B JOESPHHELVESTON
143,610,024 *0DC2137F4C22E886015C6E896A75D8CD20F228F9 john boutt
143,610,025 *0DC8514B78D3B6CBDC4A1B8F573FA3317D5FD1E0 johniearchambault
143,610,026 *0DCB6A8AAE64A158D4B12531E7FCDDC865AFBC83 QWERTYU622
143,610,027 *0DC66943BB795699F5FEA20516BDC00FB321C13C JOHNSON.RUUD
143,610,028 *0DCB8CE0BEFDF5F1DD0EB0F03234EFDB2694CCFD R3D1935710N
143,610,029 *0DC15F4BFEA54D59FB7575991DD11E24B8C1A7C9 R3D3F1N1+10N5
143,610,030 *0DC2569C90B2CAAE479F86361567BE712E4CF109 RAAIPALEN9
143,610,031 *0DC7E45156339E5C55BDBE57E88D862BECD66F61 JOMIFEYIS
143,610,032 *0DCA77D046A6F18403227C81D7C81A264A853F5C jonahpenttila
143,610,033 *0DCFCB4CAEF3D9297CD4FC01F4967496307E02E2 RADEBAUGHSTEPHEN
143,610,034 *0DC059D4DE0B959690A218BDA3683408305859F8 jovani56
143,610,035 *0DC1B3B992F9F97729429F8F441DCB2B83CD5F4F [email protected]:hopla
143,610,036 *0DC3182F91F0C4C53B517D3F4B548A8222439A6E RASSACAM
143,610,037 *0DC1225768641BB65E5510E31B6E0B0BB61C6E4C rathfarmham
143,610,038 *0DC8813D7DB05F80CC03765F4C8F02BB35201DC9 JUDAH376
143,610,039 *0DC22C8503839AE21F8F6076F50354A46056294E raulclingingsmith
143,610,040 *0DC10B37EAA8A6B490BE0C4B2482AD4EBB102F70 RAUL.KASZYNSKI
143,610,041 *0DC26519C7D6A21506A26C0151A523A76A1BB48F RAVINAI9
143,610,042 *0DC9081D9019C4DD50515F9844553A6EB1885D79 RAY.VANOVER
143,610,043 *0DCEC93E7C22D7650F3A597E5DB79A02691D87D2 jump.to.my.beat.(mark.ryder/tall.paul.remix.radio.edit)
143,610,044 *0DCC712104FF7000B78945025FC63A1135D6EC27 [email protected]
143,610,045 *0DCBDC6CD169BEBD0B080FD2D9E65E2488397C22 [email protected]
143,610,046 *0DC18C804758FC944F2F219DF20B4DB46F5C5761 JUSTINCAIN
143,610,047 *0DC519A9141AB5C0DA7634B5040ACF49C264325D JVJNOPU8
143,610,048 *0DCF0718F54859CEE421B61E57F0A2856754C10E JXBU
143,610,049 *0DCF88C12F80D293082CE8570FF3123EDD4146D3 k)/[
143,610,050 *0DC881A0717A4573F59F6712D7D6D914E09BF5CB [email protected]
143,610,051 *0DC97D81A231355894DFD10FF486AD09A1093CE9 READY-'N'-ABLE
143,610,052 *0DC5458DDC864982D2FC7923FCA8845A722F0A93 rebros
143,610,053 *0DCF7569C9F893E84390C45ECF32FC243CC09445 ka8orizontas
143,610,054 *0DC71844299240AFCBF2D3A76EBBAA545721425D RECRISPELLED5
143,610,055 *0DC551BBFB12AF9F656F2D94872D75E846E668C2 RECTORATE0
143,610,056 *0DC1B94876889AB198B4F3B9839E84B3402B9152 KADAJÄRV
143,610,057 *0DCB661E10C70325A95F6B325B5BFF438EC71FE6 REDUIRASES
143,610,058 *0DC3E328CD4DB67D40E6077327D046466538FE77 kammerherrs
143,610,059 *0DC5110361BC713478A0B625C06166993A543D05 REGBODYBSW9
143,610,060 *0DCE95A873EEC5484364AB3D8FC1CAA611D9ECFE REGGIE.ANDINA
143,610,061 *0DCCED149B302B88189C47C1EB8863CCA85D624F KARAVAANVOERDERS
143,610,062 *0DC6892B82C5C624EDB83750E0E7B8C9E229F581 REHCRAES6
143,610,063 *0DC9FF84308DBC58A8F4CF20779CD0F817ED5583 karuia
143,610,064 *0DC51FF13E9A967B40512EFAA9F1DBF6568D28B3 reino-hayhanen
143,610,065 *0DCD824D98CD8F8C3B60CBDF80DBD7708BF5B5E7 REKAMTOOB1
143,610,066 *0DC97E7EFEEF873CA3A11463CEB35AF73234BD75 katonewt1
143,610,067 *0DC0FFF794D128FD4610CEB5C58B74F73F54B7D2 KÄTTESOBIV
143,610,068 *0DC10D15F8187D4ABC00AC9F2FA84CA580E48B62 kb\.
143,610,069 *0DC6B8ECC1020387FCB374ECB1A71D9D5B6F54DF KCLEEL
143,610,070 *0DC967304DD2C1004A2BCB764A0EB624C5CC58BB [email protected]
143,610,071 *0DC7BF022931900A8008CA98C1AE475AAC0D2847 kellymarissaevett
143,610,072 *0DC8DCA3318223E4EC05AACE30D3FDAB4919F5F0 ken.adi
143,610,073 *0DC9621706BE913A825A68814E1E2BDC89F2ED89 REUADFUA
143,610,074 *0DC04830F50772CB13366F4ABC9C14B05F2C76E8 REUBEN.SCHECHTER
143,610,075 *0DC9A665B2415AF763538F4861B7D91FEABEF4CD KENT.KLUENDER
143,610,076 *0DC1C7A16B439FBE6169121A7AFB536B5C1F9E85 REXG1234
143,610,077 *0DCD4232363BF3B5269A36448AD50C46EB73A4FC reynaldocapuzzi
143,610,078 *0DC38FCBB5CC6F2434A97C409467790978DE28D9 KEVEN.CARBEE
143,610,079 *0DCCCBBD7C46CBAFF83512A62D4B93C51FB0EE67 kevingerard12
143,610,080 *0DCBD2BA63095AEB9C5505D915F1F783A9FCB104 RICHARDRABIDEAU
143,610,081 *0DC4069BF266A8C3E3389C33E8C885C71B873F5A KIFÜRKÉSZTÉTEK
143,610,082 *0DCFE007C492CD7CE637128903DAB9E14852439F rigobertokrolick
143,610,083 *0DC039D991665512042FDBCC4FE8CECC1EB622A8 klvende3
143,610,084 *0DC5FC296FC48104183D03BC4FDD4AE574BC1F6A Knight.Errant
143,610,085 *0DC263C078971F21AF5FC93586442B8A6AFC4C18 KODEKSER9
143,610,086 *0DC0D5C0B448650E126BF9620BCA4FDC38356B49 KRISTOPHERSCHILLINGS
143,610,087 *0DCD7C35B92D67D92D8EDC98551C6D81C84838EF rockywaltenbaugh
143,610,088 *0DCC32E5BAB38341CC982F1D9A4E4276A7852B1B rodrigosantilli
143,610,089 *0DC0B9EA6E66D98F80879E44B6EC107F13E04892 ROMAN.TOXEY
143,610,090 *0DCCF7D4203561F91B7A534B601A3239B9D03686 kylieminoguevsolivianewton-john
143,610,091 *0DCEBAA7494C0768D4517BFEA1C389F8C09C5AD7 l<3s
143,610,092 *0DC21350F3AEBE6FF0F416FA46AEA70E427B33FA RORYALVEN
143,610,093 *0DC14E297BD99E703F5D6062F39E45335F61BB49 rosecote
143,610,094 *0DC6A0240500B288813376A871E1AF89C38D8913 ROSE HSU
143,610,095 *0DCDD70EB2EB7C96D4ECA4901E8E373B0386FC39 LANETURKEY
143,610,096 *0DC550818F6623BBB8859EA0511B9FDF5799B564 ROYAL.TAZELAAR
143,610,097 *0DC1D40C0D0A738F6E5400969917FACA2C6DD187 laura-wiggs
143,610,098 *0DCD74D2B2CA9E3A19C189B71DD2D95957D302F9 LAURENCEDEPASQUALE
143,610,099 *0DCF18880AE8AFAE2B485D2CD4F6C1EAF29B5E8E RSATURDAY
143,610,100 *0DC6C1F37BE3C230090CE125432D46244BFB7C1A RTHAWIN
143,610,101 *0DC5A7EBEFC448689D0C86D41DD2029EF047B60C RUBENMASSIAH
143,610,102 *0DC40FC5B95986F4A0606394EC5CE281FFEE5C0F leandrostuchlik
143,610,103 *0DC00EAD6F2F9ADB5251583E92BE048AEA5D6D00 LE CONTINENTAL (THE CONTINENTAL)
143,610,104 *0DC46E6FAAA7D7C8E5BC1D13700EDA54AEFF043A LEDENLIJST
143,610,105 *0DC4226A174F6F15327FCA630551F0A1570DEB17 leehweeling
143,610,106 *0DC8D7D506F6AD38053B700B3927AAD4EEF58663 LEIDA-REYNOLDS
143,610,107 *0DC9A7E1D728B370F22FE53238425F48FBD3A62F RUSSELLGRINDER
143,610,108 *0DC111121E118AD9A6DAB741BE75EDBF14632392 RUSSEL.LUCZYNSKI
143,610,109 *0DC8E3826D7EA0BE524C8969D5DFA31797550696 russian.sher
143,610,110 *0DCCE6083F92CF40497A5911E26AF29153F3EE61 RUSTYTYSON
143,610,111 *0DCC411BA50DBA6C8C06FF9C384665394754EB1A RVALUERA
143,610,112 *0DC47A6B298FE87566CE10CD80462BEB482833C8 SÄÄNTÖJENMUKAISTEN
143,610,113 *0DCE2C12F93E10745C7B56F22F863E40827B8AA5 SABINA.POUDEL
143,610,114 *0DCF1E6EE1F50CF121A2471B6B71260A241F178E SAHARKASHIF
143,610,115 *0DC74AA949BA440D78D095FEF62EE5D0C2E6E260 S.A.JSEMPE
143,610,116 *0DCC8C63FA8867166A8F2E41297BAC457262D576 LEWIS.AUMAVAE
143,610,117 *0DC00DC184F6D875F514D1BB1B4BE6CB40F773B8 LGHIDUT
143,610,118 *0DC08DA0B0B7DABC95472C48814F85702EF4178C [email protected]
143,610,119 *0DCA76C8AB6C8E4EE26D97D2CD6FDCEADB6545B5 liederli9
143,610,120 *0DC50D72A024A1B351B55A0A8809C7DBF202C69F SAMMIELUCIAN
143,610,121 *0DC0AF4332545CDD18567E5BA751570137D2F2AB SANDERSPAT2
143,610,122 *0DC944A8072E8B29269B97A08CA13C8F66BEF5D4 linehan
143,610,123 *0DCE8E123C0155841716017B817BF73883FBAE12 LIONELGRIFFES
143,610,124 *0DC3397EFD92893072719234B5A8F9DF11D93F9C SAPCA-1
143,610,125 *0DCBC79CB4FF6D55DE6E5AFE8FA4C628C7B70F38 LISTINGINDEX
143,610,126 *0DC1D66F717EB8446C9671354964F2627D2263D0 [email protected]
143,610,127 *0DC6E74433CBCFAC3DE52B333E01B86987989E8A [email protected]
143,610,128 *0DC0F1D0D9AC984E729586B1FAFFAF19E5F6529D LIU-SUINA
143,610,129 *0DCECDA6DD8B918334458CC1BFC43EA5098D795C [email protected]
143,610,130 *0DCE360F93CA5B8E63D65578EAF55DBC0A738058 SCHELPENS4
143,610,131 *0DC25A17FFDF605053B6D7903298229A24CEE86D LOGANHAG
143,610,132 *0DCD890582734438A7EADD4EBB2D420C476DC5E4 logankaye
143,610,133 *0DC7BD415D095DA9A6FB73B9560BB5D432A7EDC3 SCHJKHORE01
143,610,134 *0DCEF777C6BD4F2CE477E429D35FF83D9ABC48E2 SCHMPTN8
143,610,135 *0DC143B50F95BCBCC45C31671626D0F16142130F SCHUIFSYSTEEM4
143,610,136 *0DC8D651E74B0E555842B3646CE67F6E17B3E67A LONGMCCOREY
143,610,137 *0DCD4E4AE27A5B5586339C01E5BE941E8B613666 SEABULL2
143,610,138 *0DCD4943A80D24EECE5E120B78BDD77C2298D4FD LOTTA NORMAN
143,610,139 *0DC8CE186484FE619A8DBDE75BD31A5B6842CD70 LOU.TOPALIAN
143,610,140 *0DC70CB56E587063DA6DECB589B40C78C62ACC57 SEMIOLOGIA-M
143,610,141 *0DC1C57E64E78B63AA692731BA13B9683D16AB2A LOWO
143,610,142 *0DCA94828636564C1DE7030FDCFCA79C78BAAB63 [email protected]
143,610,143 *0DCC232DFB38B2F069BA8570F3203AE9FF3CEEBB [email protected]
143,610,144 *0DCE1E1CEADCD40A236D08DE774637EEB0BA299F lucianoposner
143,610,145 *0DC32119BB2F29BE16DEE04130CF1865B56C4D95 LUCIENADAMEC
143,610,146 *0DC9781C63E0FA8C62EB92A8EAA96881F8140649 LUCIENMANCO
143,610,147 *0DCC93E1E751109D684D434F638CEBB55D71CC5D SESSENIROTCNUFREP
143,610,148 *0DC9B4798EDD4A2CAEDD3BEFFAD20FCA6BB70090 LUGGIES
143,610,149 *0DC0626D2C64E268FB945B502FAB081A23309387 SGINROOD3
143,610,150 *0DC3CE9BCE7825BB22C0F0FB46245D708C90402E SGUBERIFED
143,610,151 *0DC2235D709D01D9CFDA5719A90D8456AD46CAAB lupebegeal
143,610,152 *0DC528156400B62616B1D3553F4B2DECF5090E65 [email protected]
143,610,153 *0DCE70F8C962BC7178DFE0FC3256817697CA22F9 lvwc
143,610,154 *0DCD2C5EE5448471D068F48A7098EF25E091F13E SHARRYZHANG
143,610,155 *0DC1587061CD49B0B615707D49E3BAD2CC24E7F1 SHASHINVARDHAVE
143,610,156 *0DCFDF0B52C670810BDBBA99379FB47B5CC52512 LYNDONMAHMOUD
143,610,157 *0DCE09E36C0C3FF8C265911B3EE6C495A511B23C SHEILASSSSSS6
143,610,158 *0DCC659D89C8460AF40ED5585B9A07C0F15B0B01 SHENESHIA1
143,610,159 *0DC89E40757AA69B67C41A68CB0CA9A33D841FFC shiftley4
143,610,160 *0DC62CD5061A66E0723DA20CE2A37CB5A63D025C SHIRLEY.HUMBLE
143,610,161 *0DC1885412F579FD3DADBB1F38E177FDB66ED48C SHIRLEY.SEUBERT
143,610,162 *0DC2AAE213FF316F65E2FD6060432E3975608CB7 SHIVCHAR2
143,610,163 *0DC5728763BBC644E1EC463876947292D0508074 SHOMAILARASHID
143,610,164 *0DCAB7955E5C970594426B2B53336BE9BCFFDA04 maastikuarhitektuur
143,610,165 *0DC214C77085194EC9A0A993FDFDBD251941D80F SHORTROXYGURL05
143,610,166 *0DC6129669712228B3E8653ACABED646D8201809 [email protected]
143,610,167 *0DCB9458B3CED766C99C0625F71EE01D72337D54 maddiechristinezellmer
143,610,168 *0DC03D0EC07A8B2E665CB7A2D9A7B1830E4F6827 MADEMOISELLEMONTANA.WORDPRESS.COMMADEMOISELLEMONTANA
143,610,169 *0DCCFBDFE6714C4899635B0CB210C33332D2C5ED [email protected]
143,610,170 *0DC321B23AC2B302B2325ED7B3F88DB8B5BD2C18 si0
143,610,171 *0DCC938FF3ED560C5C179165A99BD7512310A1EF sifhenterjespermikkelsen
143,610,172 *0DC58869EE525928C57E669E67F423B319314584 SIISELIN1
143,610,173 *0DC1B71CCE742FCA51CEAE94ECBE87DBDE613A3E malikcongress
143,610,174 *0DC896DB661E434ED53EAF0B13D971E9055153A6 SINFONIA N.2 IN C MAJOR
143,610,175 *0DC2DEBC0720AD6C29BB6E056D65D20925DE1F1D Man.kan.st
143,610,176 *0DC1D1368440205A282CDDDB5C170A06DECEE6E7 [email protected]
143,610,177 *0DC851C26134FD9D0DB57BB22BAFD143A60AA303 [email protected]
143,610,178 *0DC231E36A88FF2F6004C301E223DAA3B771C74E SKITTLESR#1
143,610,179 *0DCF3E1F34F5DB5BB4651367E8E651BAFF4AA788 ŚLEDZONEGO
143,610,180 *0DCDA69ED791C61F1656C496DEE1E894308B2995 SLINKINGBACKTO2
143,610,181 *0DC75FB26083C81A50EDA0BB9B938E3C97BFFF2A SMALEC-(Z-REPERTUARU-NAPIERDALATORA)
143,610,182 *0DCF662667958D5A9D61CBF457107DF16BF6A09D Small.Caravan
143,610,183 *0DC1FB4981619182F7E012C73E8E08787B20AABC MARCUS.ROMANSON
143,610,184 *0DC34FE990C33DD6404A5310ABD7E2E4D4F50C83 MARIOHARBAUGH
143,610,185 *0DC9CB039A20496833BF659DA962BB083631373F MARISSA-GOROSPE
143,610,186 *0DCC68030D1E906AA61DFBFB1B2E9681D3A0CB38 marklicuan
143,610,187 *0DCF34AD8AB5F7A4824BB9AC2B3236B889E95337 MARY PORRAS
143,610,188 *0DCCAF72D3E0C7A8A53A01337AE60F9D49043ABE masterfreelancer
143,610,189 *0DCA2FA756930A41BEB1BD9AB997903B2457CFBC [email protected]
143,610,190 *0DC6E31AD9550294D0C31018157E4FCCAA7C63A6 mcpsgate
143,610,191 *0DCD38E70241E8B8CFC507F1AA887D166223B204 MCSIVAS
143,610,192 *0DCF6B16C261DC235882E47715BCDD249651D924 Meanwhile, Back in the Real World
143,610,193 *0DC018DF6417A4A6B727C6467C3798A2E8F09DE7 [email protected]@[email protected]@1
143,610,194 *0DCAC4E3A390889728C8F0B78608BE40CB982B2F melvinspain
143,610,195 *0DCB4158C7631359788D4908B12811BB9B280EC2 [email protected]
143,610,196 *0DC4EE8766B69D30AA16B4B87A8D28A8CC64A34B SNOWTES9
143,610,197 *0DC2832F3BD56DE668C4F8DB607D61C9AFEA6544 MIKETINN
143,610,198 *0DC46E9954C4815A317CDA37E46698A98D1A1CB5 SOMEBODYDIDALLRIGHTFORHERSELF/DREAMS
143,610,199 *0DC7DBC54C7597B5B7EE7A1F39B70D652DE51C98 SOM-SAGRADO
143,610,200 *0DC1EB38DA2A38F57772A071BE2F4766B8C9BA6E sonorizar
143,610,201 *0DCE00D88872DFC2305F5EA527FD7ED5317C1134 MILLARDGREGGORY
143,610,202 *0DC1D3F27EA5488F90B6A6624CA0071B23C59EF5 MITCH.BARTHOLEMEW
143,610,203 *0DCB686F1FB792CABAD4A6385D0E8B76872F67EA MITCHELL.POHL
143,610,204 *0DC3F55F404F93D466D8CD746A61D1DE4CBA9C9D MITCHSAKON
143,610,205 *0DC428CD7D0B9F78F49F303649DABDB79D5E1BA4 MITTENSGOLFER
143,610,206 *0DC1FF1A7D04344464035F2521F1D107294A8865 MITTLER0
143,610,207 *0DCCF61FBA18A5FA6109D3AC5983B082E9057839 mlr1
143,610,208 *0DCA7BBBE450326F65C93DC39DE629D5F70F001A mohd.reyhan
143,610,209 *0DC8129EC5887A4F8D2CCD077DFB82476514F8E5 MONIKATURNER
143,610,210 *0DC8575B7C59A067EF0D23D76594530799AF4FBF [email protected]
143,610,211 *0DC1E8F8D655651A30B3A28D8C0293299A2B2260 MOORDPLANNEN1
143,610,212 *0DCA0D6E4CBD5270E1F600F358D1DEBF71C8C3BC MUANETUWENDA
143,610,213 *0DC85F5426A15055B782864D328036DB265D94EA srednoot4
143,610,214 *0DC909E32DB2EDF247EA65151F0A4346965D502D SREGNAHNAA
143,610,215 *0DCBD37055B4AD4752E8D3CB187B8867732368B3 [email protected]
143,610,216 *0DC717A1E22A0C7B3D3E7D23838A15F207EAEE8E SRETSRUUDROB.
143,610,217 *0DC469A92182328C197774B059567BC61A8541D3 murraycandill
143,610,218 *0DC65D7B59C15393B2AAE79F9D83CA2B14659D91 SSENDOOTSREDNUSIMED
143,610,219 *0DC57C5C995DCA258A16E188B2231C81F5576591 ssengniliaf
143,610,220 *0DCABFA2F7A54FD43D9D5E0F765837F888646AF4 MYLESCHAMPA
143,610,221 *0DC0363A34553BD44F1FD113969EC38439BCF673 mymagnum4
143,610,222 *0DCB18C9A53A9696F3834D961A3DC5EFED02AC76 MYRONFITTING
143,610,223 *0DCE65D4542F9D5EE858382CDA7E7DD7FEE27CA0 myrrhes
143,610,224 *0DC442D4369C125C6E855CB4ED31149FD4EA3606 MYSLEEPY1993
143,610,225 *0DC0393F78563E6432B500E4099F856EB13F9F16 N3V3RF4IL
143,610,226 *0DCDC81FD6F08A39A6282EF61D83C224AA533F98 STARWARSDOC
143,610,227 *0DC10AD0BB40808BADBAD4DEF8C5B007D45CCA7D STATION.BREAK
143,610,228 *0DCD759136409627CD03457648C818D7FBC89B69 NAJSŁODSZY
143,610,229 *0DCEE4574BAD071FEB59CBF2762C4BDB148F8DD9 NANTEAMPAILL/WHENYOU'RESICK,ISITTEAYOUWANT?/WHELAN'SOLDSOW
143,610,230 *0DC2076D64A132913C2CFFE4821FFA1880FEC0FB NATHANANTIS
143,610,231 *0DC7F309C66103171A7DF6F106BE3AC61836458D N DE SABADELL ESTACI
143,610,232 *0DC330D86714D64973E8E7EC7DA3207E701BAA54 [email protected]
143,610,233 *0DC86D10EBFA5925A9EFD83E3CB0227E1EABFA60 steveshamel
143,610,234 *0DCDB0AF701E503ED535511B6E448BF3ABEBE7BC steviespagnola
143,610,235 *0DCC7462B939796C2C3F33E7CF6E83B5706697E1 [email protected]
143,610,236 *0DC00B6C884430B7B22D018E0B3CE0951291FEFA NEMZA
143,610,237 *0DCEE0F76147D5FF4B497603F53D57EF07CDCAF3 nepeireb
143,610,238 *0DCF8ECD50248D28EAEBF713C0C4986DB16CADA6 NÊPOTO
143,610,239 *0DC51D466660A8A077889C863E935E42043752FE networkterminador
143,610,240 *0DCCD44E14287E75DC112AB74B9C537EF9D9F902 newboyonline
143,610,241 *0DC6E2ECAFC7481F10915A8E071533401C06597B STOP.RUSHING.ME
143,610,242 *0DC09E859E92097677F157D05DE909F57F658985 STORYALLEGORYANCIENT9
143,610,243 *0DCB05D66B8761C348A7A799F9C8666562A4693C NICKDOBY
143,610,244 *0DC8F0D095745BAA48491030434409AD87D86989 nigelmestas
143,610,245 *0DC3C505CDF108A5DC3F8C3D074B3E6F2FC4FF76 NIGHTMARE-PAINAJAINEN
143,610,246 *0DC6D4E6A230D0108ED0B5566B51C183E212E55B NIPUN CHOPRA
143,610,247 *0DCE0DF696705DEC691EF7ABD8E2F6FE2F910C89 nndgstngs
143,610,248 *0DC7CCD20D28FBFFC6A71F08F583EAC7E339DA76 NOBLELISKER
143,610,249 *0DC12A85D4CF1AB1BC71ED699429A012DDBD56D8 noises-of-silence
143,610,250 *0DC7D767DA5C98ACDBA96D03FFF0D503324D4412 NOMIN47OR$
143,610,251 *0DC171C162665C311830CD0BC156FC8BA9C74A1E NORTHERNLIGHTSBOOK
143,610,252 *0DCDA07D9E3B45C54A0AA64C4E28C83EEAC414E0 NORUMD
143,610,253 *0DC3AF4A34C88F34C56AC59B3DE99FB897F7E924 n\pa
143,610,254 *0DCF8CA1DDC04C1BE73CB15F6090D70931C489A9 STUNGENBSW0
143,610,255 *0DC45367C823A31E9AD1E1118DEDC751346DC18E SUCHOWLINSKI
143,610,256 *0DCEB83F92C2955E2B553037FDA5B3157753DD1A N'y-pense-plus...-tout-est-bien
143,610,257 *0DC0CF628703D2AFE95B94226CB69B80FDA505EC (~_^)[email protected]====B
143,610,258 *0DC00CE2022DC36185F635A4F460D1DAC970B660 OBRIJAT1
143,610,259 *0DCD3D611F081684B53DD80AF76B68B4B6DA843C OF3GSYDSMUXFLQFGGQTGDG
143,610,260 *0DC2E45F66A51295636A445FA3CB0ED6257C721B [email protected]
143,610,261 *0DC47ADB26D11C01FB42571DD3A7A18C458817DC [email protected]<V
143,610,262 *0DC423F05B86C3B232DD8D2F76456BF35645C7FF oliveralloway
143,610,263 *0DCA05CDF3A05FFBF4CF246C7F5EB650576768F1 olsen.involtini
143,610,264 *0DC1857B3236BB9D1DDC9D5D0A637888CFF5A1DD [email protected]
143,610,265 *0DC07863871E9C18A5DDEA7CDB5C7564EAABE33D [email protected]
143,610,266 *0DC280AE7E9E58DA4C8920F04385A7D601C06F27 omgekeerd
143,610,267 *0DC0076F951EB6C38D4805DBAF95681225C8BAF6 omhooggoohmo
143,610,268 *0DC9214654D7139303A7DA3E37758EFDC1A87814 ONDOLL22
143,610,269 *0DC92D1F72154FEA2A520B51176DD93EE542FED1 swych.1.0
143,610,270 *0DCCD61D5B620A90E5FB310EBE99A23D415F1D36 ONSLAUGHTFROMHELL.COMWWW
143,610,271 *0DC690F4867337B2A61D0B3FA5C3874FAE787DBA sya a ku
143,610,272 *0DC2FF33E81F8C30B9B4B61C5D348A1A556DFF69 onvmi
143,610,273 *0DC6CDF6AF441CC6772B4F904F8D08157C778DB3 ø§øμùù‡ø§ù†
143,610,274 *0DCE4483ACC2C671B68F501E00E9815EFD952EE0 SYNCHRONALS0
143,610,275 *0DC7868812EDE9225E4066DC985C347A0539FB26 T168793
143,610,276 *0DC4435A8170D469CEC626848708A69B1243A161 ORELT
143,610,277 *0DCE381F391500E54DA448C6407BED7505BDDC43 organizacion.akatsuki
143,610,278 *0DC286BFA8AB09DD9CCDC41D6042C905DE7A97A2 osebotdesoppussi"gnikcah"fi:sihtredisnoc
143,610,279 *0DC1BB518C978A3F2B889F2E921F36681B873C30 ou812sting1
143,610,280 *0DCAEA4DEE11A1CA5CE55E0A58D0366B26DA692A TANNERDONNA
143,610,281 *0DC89E0EA3B7FFDC4844083B3E18B024D9FB0976 [email protected]
143,610,282 *0DCBAAC863F95C60F2F022BBE92BFED36300099F P0STU1AT1NG
143,610,283 *0DCCA1D1FD30B687D78D7BE54AFC1328A82631D1 TARANTINERPAPAGEI
143,610,284 *0DCC3B81234674485CBC075AE03625004E0B343F pa7u
143,610,285 *0DC0BE8142E81DD7ADBCC001D1BCB95674061C67 paeivaenpoliittisiin
143,610,286 *0DCFBD2F89D42223968A029F419C98588922256A palmercowling
143,610,287 *0DC01E96D22A1F97BB4D3D6CA9DB0CC8F443607C パンピリョーザ(pampilhosa)
143,610,288 *0DC57BD9E05EDEC277684375BA091BA6B9ADA493 [email protected]
143,610,289 *0DC1DDB33675D4BC9FF463421EC19932E7356FFE [email protected]
143,610,290 *0DC43B8B594F4188BFAE34574854AAAE2CF2652E [email protected]
143,610,291 *0DC3194DE6EDC03A773E6C4BC0227F8B4C8DADB1 TEILFAKSIMILIERUNG
143,610,292 *0DC371F3F51ED2CF0E533FCDA0F812C3C8C8A1A3 TEKTEXT0
143,610,293 *0DC0B5BD3C0CE2C76DF564D0661A60D317CB3D68 parkerkohnke
143,610,294 *0DC5868B07A7CF307929EBB37C9C99FC517B1CCC PARSSRAP3
143,610,295 *0DC8DB5C0D24F68AFC1EF8ED39BAF5EA7D180075 PART618
143,610,296 *0DCAEB1D89D38B3F4D83DC5CC782A614E3EB0AF7 PARTICLEBRUTE
143,610,297 *0DC832343F1A8D9CB5004622DC8F8C6BCF294A7E PASTOR DEL SUR DE RUSIA
143,610,298 *0DC44110ABDEE6B8D1B1EF33BD81A1F1CBC6EA31 pastpictures
143,610,299 *0DCA59A80E87B8E37D046574B41CC1A0EB3BE65F patriciakader
143,610,300 *0DCFA11CD4EE9EA7BE0D67D94877541572F06CD1 terrancecomerford
143,610,301 *0DC8F58D9A27097F4421AF4D7D1031F1EF69AE73 TERRELL.COHLMIA
143,610,302 *0DC9C6C7713DFC9738CDB3AEA964C2C786429028 PAULRURUP
143,610,303 *0DC8EEF00851DC681044B8D3C969B48FB42E921A p}b?
143,610,304 *0DC86F7DE2BB2C2D29773C1A8D72A07E37FB955C P##B ~0~O SPLAT
143,610,305 *0DCE98305F9D70646EF5F5DBBBC3C2A340C4939B TEXTFOLKCUSTOMS
143,610,306 *0DCE078ED31C0F27833E579111FFF18DC40A8762 [email protected]
143,610,307 *0DCA28B90102DBC07E003B12B1D8FB5F5DB8D65A tharris4
143,610,308 *0DCDE7152EB7FBECFF841F860663161F29CA7C98 [email protected]#
143,610,309 *0DC4865989ED9B5F9913D01496FA5335E2A04553 THCATORG3
143,610,310 *0DC46E0EBA826BEFF28D82C8171EE99AE2707244 THEELEPHANT06
143,610,311 *0DCAFEC5739D810EABF4CCCD4AA926E27EF70E42 The-Faces-All-Look-On
143,610,312 *0DCDBAD384243C0BA3F4A49EAE9F7C173CB0C39A THE.FLAGSHIP.MAJESTIC
143,610,313 *0DC77D6C22D40EEACFA9E981CF29299C808A7FE6 the-last-day-(dj-tom-x-remix)
143,610,314 *0DC62831F4A70A0657E444715EBA093C282ACE85 pharisiens8
143,610,315 *0DCB3A4C55E9CE8FF02A55F1255D468F3189F4F1 [email protected]
143,610,316 *0DCE1DCBA426566AB08FFA86A3C8F5C637209C51 PHIL.DRENNING
143,610,317 *0DC3DD7369A181EBD525C4337F2B83DFEC04669C THE-UNKNOWNS
143,610,318 *0DCD3A8864BD95F8CB3A67611B8FB67E7BF006A6 PHREN0PAT
143,610,319 *0DCEE59DEC8C32C492A0B8A01F4A8186CF7BD528 THIS.DONT
143,610,320 *0DC82A2C2FB92A54CEAA7EDF622BD466EEB32607 This-World-Must-Be-Destroyed-(DSMO-1)
143,610,321 *0DC8E76640C2E51A494EFDCA2A2039E554B0FD41 pilzweger3
143,610,322 *0DC02D2BBB4A5F9C1197B3D72DE30D3BD6BE2068 [email protected]
143,610,323 *0DC3D1505350DA3C54C39A63E5113775131C0634 THROWYOURBOLTS
143,610,324 *0DC3519CD805E3055CA76B3B8B0D98FE015EE4D0 Play.Me.A.Sad.Song
143,610,325 *0DC32AFBA41CF7BE1C2490F8F5D383CFF1FABC41 PLMNCTMIED
143,610,326 *0DCC1DA4720A84B50B306859A46AB2579C612FEA TIFF-JOHN
143,610,327 *0DC53C1ACF96CA94EC5E567D1D59D58086CF5324 POKERSPI3
143,610,328 *0DC8097EA417B0176844C9EC69B7FF1F34A101EC POLLOLA1
143,610,329 *0DCCEAC32C2174448DDE91B3AAED3BAE936473E6 POLOSURFER
143,610,330 *0DC0292B95F696466EF6E53134F94E965BE0BE86 timzwilling
143,610,331 *0DCA1F5DEB22D8DD087211C3B74C3BD7DE3A08C0 TIREDWIFE
143,610,332 *0DC9EC5423288C11B0EC2624A07E5856E2009FEB POPRZEZ-BABILONU-MUR
143,610,333 *0DCA64AEA55E0766D3234FD66CB1DB40A8E59405 [email protected]
143,610,334 *0DCB94F760BABA31E0E735817F8D5DC18F477012 TITUS797
143,610,335 *0DCCFF2FBAA37AAAE706B7EB9EF43A01C0F9FDBC postbatista
143,610,336 *0DC3661904257BCD4FE414409739845E053B33AF POSTOLIVS
143,610,337 *0DCE64DA4DD0F9216266A1F29E31BCB2795B5342 pp~0splat
143,610,338 *0DC26B097DCFA0E8CACD4B30E3DA6C5010B991A1 TN604954
143,610,339 *0DC38757BDBDFA60EBEDA8ADC547B3FD94F08F4B p=====p ~ ~ ~)o(
143,610,340 *0DCAC790DDBD08ED17AE06BB71B083514E8E8D62 TNEIARETRUEH2
143,610,341 *0DCE4FDCBA93310FF37C791FBC86912982A892B4 to-computers.--We-must-make-that-distinction.--It's-not
143,610,342 *0DC270C170DAA3FA9D3276A5F125D005844D0497 TODDHORNBACK
143,610,343 *0DC62CC57EFC9E042C257C7C61F79C0F246AA334 PP*}X{
143,610,344 *0DC9BCE40B3A63D60049BC59C1B10432BC5200D5 TOMASBLADT
143,610,345 *0DC51C16B50E1F0309967915B3C8C84C638E3FE5 TOM.WESER
143,610,346 *0DC6467AA41DB1B198E03178FA59730D04354D13 presscuttings
143,610,347 *0DC1F9750C1B9F95BA69DA15050B5F90A8FF2E3F prtendr6
143,610,348 *0DCC8DDB38604F0E23DBF3C22A3D69AC656AD63A prüfungsangebot
143,610,349 *0DC34E71ECC710E7585946F793DF3E1B3DB0436C PRUTHAY
143,610,350 *0DC4F288F000D7A90A80D50782503682A1808401 PSHAEER
143,610,351 *0DC7284AF3E7623BD9D26AB1D63DC7FE08314C25 PSZHEADER1234
143,610,352 *0DC2D60D029B841F493BD20689A6AA8E3D4A0B08 transporte.de.alabama
143,610,353 *0DCC1F688E6100DFBFF46E23A78B4F799520F74C TREADE
143,610,354 *0DCFC0EAC8384238F401422B9EBD0713525082D8 TREKCIS0
143,610,355 *0DCF3539471E0DB291FFD7654436435E426DC660 PUZZLEQUEST-CHAPTER
143,610,356 *0DCA4CADE8B0A075F744A072140C6F00EC32AD69 pwasg
143,610,357 *0DC0DA464047A0E1A9C7FA1953238AFFD53F2718 PXSIGLA
143,610,358 *0DCCFEC855275A491D830564054533E306862CB1 TRESYA.KURNIAWAN
143,610,359 *0DCD15EF70EBA2A080E89ECD580C4EA54DFC5925 q------>~0.(^_~)
143,610,360 *0DC497D42C6E6436518BCBB006898A0699F04502 Q51611
143,610,361 *0DC2C7F764E4C0BF1758794E9A0F4D572CF72BDD TRISH-BROERSMA
143,610,362 *0DC631261FC8DCB58512D41ED0BA932D138EB698 q====d.`~.`~.}x{
143,610,363 *0DCDFBBA1E9A9817C7C6AE24AE1A5C37858CDD53 triumphofthehedgehog
143,610,364 *0DC07CA389A620237DDFAD5E6C5909C2DBB60604 TROUT.FISHERMAN
143,610,365 *0DC72A4D360D4F7D602A9550301A9BCCABEB0826 trumptr/@/mp
143,610,366 *0DC8B937AD4B8AB8C0248CC6CCE8F307D6E55218 TSGITSOO2
143,610,367 *0DCB79135A8EA663E1FB2B6880F57DAA01444A10 q###)~o-~o)x(
143,610,368 *0DC7BFBE43AC12D8EC95519A571088D2FA1F8F17 tuantroop
143,610,369 *0DC49B3C5E9139242CB5D88192E78B07ACD97068 q=====P.*(O_-)
143,610,370 *0DC085D58554690D2EBCA8D6FE2BA5E8F395971E q####P-~O~o>-<
143,610,371 *0DC77BE00F1191134C73E4084B631F6E5F10B476 TUESDAYDEATH3
143,610,372 *0DCD00E39CA202DC30C4EA4335B2F431DA2B857C tuesdayprevatte
143,610,373 *0DC39B5B810EE5E61C5D24E3CEBC29EA6DF41C58 QRU083
143,610,374 *0DC9F956B224066326C4962FDCB6BDF9BA60C559 TURMACDANIELATURMACDANIELA
143,610,375 *0DCF9A229E7082BC5D133991F6B2F521F2657C98 QUINCYWIEBOLD
143,610,376 *0DC123743FC99B5CD85B4B4FC2894F874F42DA94 qzumbsw0
143,610,377 *0DCD49D4D4608076E80690B2BA3684CA2D70BC97 r3v1v4l5
143,610,378 *0DCE70904113A454AE1520CAC98B6C816A5B0509 RAFA-GUZMAN
143,610,379 *0DCCFBBF19098E116AB8ACFB487197AFAA2AD7E7 RALEIGH.FYALL
143,610,380 *0DC47B448E5105F8538E1282474181C49F3DE02D RANAKASSRMALLI
143,610,381 *0DC0F4E2B6A2741A09BA7ED9A302271D98AFB189 [email protected]
143,610,382 *0DC07A5DC7D96ED72D9CB5E69825C25A6A28C8F1 UARIVANO9
143,610,383 *0DC2E6D939F11EE8AEBB4CBEBC6F5F9F14A93164 REALITYGODZILLING
143,610,384 *0DCA23F56434A396FB21669B80A838F2A96E418E REALSPIRIT
143,610,385 *0DCF4FB32E2508864C73EB2FDB58E2618D5DBBCC RED.HEAT.PERC.MIX
143,610,386 *0DC0356F8E7D6761F93ACDBDAB3B1C9B769A44B6 REDIGOVAO
143,610,387 *0DC44D9C2B579E9D98A18A1B4D51BFFADCD4EC62 reedkurgan
143,610,388 *0DC5779996F14650B34028B0C7DC16DC1FDFE648 REESPOUSE
143,610,389 *0DC586EB96BC9406D58E829CE62D6B9030FEBE42 U&CC
143,610,390 *0DCB076BAC639381E9F09DD281A848AE2641A57C REIDKASPRZAK
143,610,391 *0DC77F6651B8D71F679B2AEF5AC9EF64788D8461 UITSTOOTTEN0
143,610,392 *0DCF5C8D02E40EF714BC4B8C8F02F45F9E7408D1 UIX{
143,610,393 *0DC6C03052AB85DBEF2D9B2B0A87D3B93FFD24A6 [email protected]
143,610,394 *0DC0E7AF350C50FB35DB6E3D98F0BD1E3FE81695 RENDRERENDRE4
143,610,395 *0DC6114A50B606538BF3C3E2D34E4D474A3920B6 ulyssessemenick
143,610,396 *0DCBD398CC060558D39E034C5539D7B93FCA962A RETAIL0R
143,610,397 *0DCB223AD7AE74DC08AB1272B32D4558578B4409 >retnec/<rekaerB-eniL-ehT-:yB-nettirW->retnec<
143,610,398 *0DC44F165285045DB0572AF5239E7220721BE1F9 UN-EMPATHETHIC
143,610,399 *0DC47B3E69EE641490B6C4FD7B729834F0672B48 [email protected]
143,610,400 *0DC4AC4D9411F8845B88ECD4BFFD292622030E7C UNGRUDGNG1Y
143,610,401 *0DC051A9CC0C1645B7C8AFCED667680B10378B14 REVENGEKEVEN100000
143,610,402 *0DC6CD0531817932638EC1EF97A33269BE8B00BE unjoynt1
143,610,403 *0DC9ADA46FEECD6FDDD9469343856DF4A2A56D87 REYES.MATHER
143,610,404 *0DC6E9B763E7CC54F4455C1D17B297B2035BC822 unmeanderingly?
143,610,405 *0DC7A134CA4FC201850860213DBA6273543ECB81 ricardocallister
143,610,406 *0DC901354F3ECEADBAC1C4F8C8A22B59A890D584 UR?L
143,610,407 *0DC9CF55E4108E0FFD51479A736ED4EF444CF160 rickvanandel
143,610,408 *0DC74FFAACC4099466AB7D62970FDD2D7C0EFCD5 USERANJANK
143,610,409 *0DCE3921E1BA6BA1F0706E31B518297ACCCF766F RICOPRISSE
143,610,410 *0DC6CEF36C8EC4379D4943F88A62D52E45E2C80A /USR/SHARE/LOCALE-LANGPACK/EN_AU/LC_MESSAGES/APPARMORAPPLET.MO
143,610,411 *0DC20E6B3D85F42CEC6E26F7EF6673358FCE7D7D USSU160
143,610,412 *0DC90F08F8384E734EDBE5820A48994F2953D117 UWNIETS3
143,610,413 *0DC04124F1ED1BC11A115766E509E14ACDCFBFDF RIUNÌ
143,610,414 *0DC155FE806EC04E43F0F3F44DBA685F7CA01B9B uzzaperz.twothree
143,610,415 *0DC2B74A5A661161AAE8F8E6F9E78D46E486B7A1 RLVSTMSTING
143,610,416 *0DC5183DF9A147B7CE793B4EC56E4383BD514B55 rmj*
143,610,417 *0DC2E556BCEF792AE8C6DC8DCAE4776D36747436 VAELVNEIT
143,610,418 *0DCAF454FEA57DF9BDD93154083FD97A9CA17AEC VAFAIRANI
143,610,419 *0DC3CD42A1EE67963DD2E3170FEAB3139BA01BD3 ROAD.SO.CLEAR
143,610,420 *0DC0FA60BE800F32AD7DA5EB622F8D6222FDFE6F ROBINMORRISON&LISAMCKENDRICK
143,610,421 *0DC656E9185D6E9A162E297C83013B2E56997044 valii.mtz
143,610,422 *0DC8A99369BBCE3FF350EC3E820B85130695AF45 robmulder
143,610,423 *0DC10BE3F195A18E4A4CB99BDD3F5FCE27400BC5 robyn.skalsky
143,610,424 *0DC14CF45E52B1AFAC54BEC3C3137F28CC15F35B RODNEY281
143,610,425 *0DC0A4A6C27EAFEC5F4D19E6FDA81D2A75054C3A van-lueven
143,610,426 *0DC4BA143A0295062D24433FAAB88AF354584852 vanskibisky
143,610,427 *0DC82B3C76EAE24D87F5BE94B460AED19CDDB1DB ROLAND.LIDGE
143,610,428 *0DC5A2F26280C691FFA6DDAEF5FAECDF14E23DB2 varsha-waghmare
143,610,429 *0DCD244D3ADB8FBE424AB48F6CEFDABD97965AE2 varunaad.h
143,610,430 *0DCA4585FFE5FB967B301B48AED66FD03834EA26 rolandobednarz
143,610,431 *0DCB6DD8D744C46D7DF63F9D2E140CD10DCDD9EF ROLFCHOLEWA
143,610,432 *0DC35600E764D8632EA5ADD25D786495F8B793D6 rollandkoverman
143,610,433 *0DC053D24256FB0030486B56EFD97A253EF17023 VAUGHN.BUCKALOO
143,610,434 *0DCE3DB9D3741DDA332B66ABB97CA019F6E28E59 ROMYISDOM
143,610,435 *0DC27F0616DB71904AC1B0CA3384FF0EE667094F RONNIESTAMOS
143,610,436 *0DCBD9BB955669CB38FEA1869EBF1EB0489E9CC1 RORDNBWLRPW2
143,610,437 *0DCCE2F7E9E86D671164E5860567BD4CC841445B ROSENDOPASKERT
143,610,438 *0DC951EA0943904C5DCCECEB4BEE7B4D3FF7F3E1 ROSSTOMA
143,610,439 *0DC68FBD02643D8841C98F2A403DBEF16A436D19 ROTA-BACLAWSKI-PROB-THEORY
143,610,440 *0DC06D8F99E813D0B7E2B0C592A724868709664E ROYALAIHARA
143,610,441 *0DC44BB01AB9F3B29CA99F4BD2B337B99D1AB5B5 VERONICA ROXANNE BRASINGTON
143,610,442 *0DCE7E259E218284981053D2B2F59062B9B4FC04 roycechino
143,610,443 *0DCA30BE8D8C4E2343041328C017B221601EE9C2 royfleck
143,610,444 *0DC0B51429875647866AC3BF312620DA8E498854 [email protected]
143,610,445 *0DC398DC12E0EF29AF63652E908E6185D20D0D39 viciabas2
143,610,446 *0DC21760B3B301FC1CA6BE2D526A49BFF0A47B0F ,RUBBERNECKER*[US]
143,610,447 *0DC023DA6CA309396A78909573668D86B0ABB012 VICKIEMADDEN
143,610,448 *0DC962D9B7851B2CEA566B61E11A1D9B5485E253 VICRELANO
143,610,449 *0DC53EF8DCC7A95517E3FD755419EF87C5D468A7 VIGANDETS1
143,610,450 *0DCDDD48C7BBE04E2481DE1415A81E66258D7577 VIKINGSLADYBUG2
143,610,451 *0DC711D0C44D23DA30EE8CF3EE39E0CB165EA173 RUWINISUMANASINGHE
143,610,452 *0DC1DF194BF3CD4BD369569A0BD0E29553F1FF1C [email protected]
143,610,453 *0DCF531A860854CF053BF98136F9D6902E5D9496 VIRCKIES
143,610,454 *0DC2E710CAED931A38A51AA9D44E019D02EBFC62 VIRPALKALER
143,610,455 *0DC85CAF4F0C123D1A38F3C20231862C31FA5DC2 salvadorverma
143,610,456 *0DC7E8F24D10C2890811A916A9EE1EA01182F51B SALVATORE.BLASZ
143,610,457 *0DC4B223500E0BC850AE234D39405AAF799BB9F5 Salzburger.Nockerl
143,610,458 *0DC343A360B771A64CB9B81C3930747B39725C93 SÂMBĂTENI
143,610,459 *0DCBE0E1F05F5EA3F4BC34AF7814AF1319F2BBB2 vlimar
143,610,460 *0DC9D47B413F4FDBC3F05C5790188D7982D46CE8 vncuthli
143,610,461 *0DCE3F27B33E0BE7342C21B276909215DE4112DC SAMMYCREATIVE0
143,610,462 *0DC211B78DB15091A2269F96952EBB4C6001DCCA VÕHMAJÄRVE
143,610,463 *0DCB0CDC4AC54F9797B32F08A9D3EA9166167E01 SAPONARIA1
143,610,464 *0DCB00C575994D729272EAA6899F685A466337E5 SARA-MORIN
143,610,465 *0DC67A8EC57EE532ACB22BB58EB1A5DC5B97592A scarboroughs
143,610,466 *0DC4251B7ADD258FC288B13F09299B96AD03C576 W1724
143,610,467 *0DC8807A94A6C235CED09796E86B08BB4DB67E72 schapendriesplein
143,610,468 *0DC911F003F6BEDDEEA1BC7A673DC98B9C955192 SCHERTES
143,610,469 *0DC39D258747EF2CA4F2A8D8541E8A177841D1EB WADE.JOUBERT
143,610,470 *0DC71D4B09BF3036EE6DA48EB9605F144C5FFA34 WAITHAWLIN
143,610,471 *0DC57B7211E89B470699CA4601108D25364C8B6D wanda-fulton-pickett
143,610,472 *0DC960F76B8AF47A8CC5B61443A845DDC4DDAE49 WANDA.FULTON.PICKETT
143,610,473 *0DC35290CC13F4F96D60813265EF6C0DCC9B402E SCUTULATE0
143,610,474 *0DC0DFB9AD8B416E22381E39BAEF5644B88283ED S'DH
143,610,475 *0DCE4EFA0126E45ECDD6FABF0C201E11F4C47ACD sdrawralop
143,610,476 *0DCB4AEF030E2E67A4EEEEC9C8FDA3AD4BF0CAA7 wan.shing.wai
143,610,477 *0DC15BAFB08168B81DED100794A349A2131C1AA3 WARRIORSKRISTIN
143,610,478 *0DCE9EE30FB65237A7A1A964538F00AA40ED136F water--the
143,610,479 *0DCB59D7943627426EE3672719C38A3896CA1A17 WAYNE.REITH
143,610,480 *0DC75AFCB058A61607CC816A9336A6EEBD0A9A92 SEMIGALLS’
143,610,481 *0DC9CF2C8C6C66396409BA0050E43E4C650A4558 W}`D
143,610,482 *0DCD839E424CED1A9275C1F84F375A1EF29DDF31 [email protected]
143,610,483 *0DC4A5E1491A5E9591A00F93F7D3EC354B580415 seymourbaumfalk
143,610,484 *0DCC05EFE5B6D9DD9CDA7BAF2CE3419121101439 [email protected]
143,610,485 *0DCF7BD16550E7D85148EEE1A4E16CC73DDD0B53 [email protected]
143,610,486 *0DCCE141E578079764700A23719FB2E11011AD4A SHALOMQUEST
143,610,487 *0DC899A5A3EB27E295D641DAED1FD5881A1B6700 SHEBANAOMIS
143,610,488 *0DC7220A77E6A0A98A9C4CB8F6A05117CF4478D0 whistleandi'llcometoyou
143,610,489 *0DC9C2C265816E096CE65877D49A7CD3944C2170 whiteflowers
143,610,490 *0DC7BFEC47C26FC68EFF7380DACD85925AAD2E51 WHITNEYBIRGE
143,610,491 *0DC18F4643A59424E18CE65BE3B6393ADFC88B4E SHENNA-MAE
143,610,492 *0DCCD6EFC7467B742BC2FD57C66C9E3CF47964A0 widi.mulyanto
143,610,493 *0DC0380C3A9ABAA1494125E13BBDA3293B00834A wi_gurli
143,610,494 *0DCFB94EC45F15B3CCC7D186D73BBF9B68451F24 sherwooddieffenbach
143,610,495 *0DC6CB5BA57104F52A83EB1A84EDC978D42B1B11 WIKIPEDIAMESH_D1277
143,610,496 *0DC5FB34560C4806DB9BAAF5FC6D69583B37C0A3 WILFREDGUTHORN
143,610,497 *0DC4CEB81B1D0D5C34E736DE630FC55D2ADCDCE5 WILFREDOCRISLIP
143,610,498 *0DC61F9C4CDE14A89147BF0915451FF2D2F5D029 WILFREDODUMAS
143,610,499 *0DCE4B4CB70EECEEB5000534D9251E7E1F3D68EF [email protected]
143,610,500 *0DC6D3A25F5077F2DAEA9ABD41C7B8086DFED025 [email protected]
143,610,501 *0DC4538CCA04C2E74A568119229EDCC5200BE4FE [email protected]
143,610,502 *0DCA0A33C6D5171816D04DB43CC4E0C4B3A547C3 WILLIAMBANTZ
143,610,503 *0DC9702FD3AF50310647C1977CACA0EDC560E25A WILLIAM-MICHAEL-PETERS
143,610,504 *0DC111A77AFA1F0C980955E45F2931077C754404 sibirienbeschreibung
143,610,505 *0DC040CDDBBE4BC4FBDC9CA985DD49AE36580283 siegred1
143,610,506 *0DC77F4811DCA56F5ABF017835CFB55141E7F4D7 SIGMATISMSES
143,610,507 *0DC6F09D4A6FD65461A5C8E08D207B15509D0F84 WILLPSOMIADES
143,610,508 *0DCACB89BF04DE38D16BA951C513ACAFEAF11040 willwunderlin
143,610,509 *0DCB9131B144A8E398C3ECE8ECB70E570A18300C wilsontoro
143,610,510 *0DC7EA25A730F346AE99447286384290FA3446E4 [email protected]
143,610,511 *0DC710B777469DBBDB177F4502D8892B11883F8F WIND.AT.YOUR.BACK
143,610,512 *0DC440F6A9B99C6385FFBFE6509D588DE34D07F2 WINFREDNODINE
143,610,513 *0DC422E2723098A6980AE696F4CB5B6BA75008EB winndell-howell
143,610,514 *0DCD24E0084B44185E1248ED13CD340826057C50 wishesofhappinessandprosperity(yehanoha)
143,610,515 *0DCB6440332F29D3387AE749AA2B18829500406F wißbareu
143,610,516 *0DCA80A94C738801E3D3B0433A56BFBC282C7961 skiemling
143,610,517 *0DCF532B6D2AE06388334F971DA55D61F35D7CC7 slagzwaard!
143,610,518 *0DC99DDB12ED982AABBFC944812C44ED608B57D4 slimsims88
143,610,519 *0DCEEF454AEEEB2E560A6D25869C08693A387E4C WONTHER3
143,610,520 *0DC328F7DD8DC8CF56986FF784C116B1B6E531B5 workingonagoodthing
143,610,521 *0DC0B7802F6024DBBEB02B48E56BF71F0DC78A3B SLUTSKEMAERNE9
143,610,522 *0DCD58404883A21ACDF805690A353D3C9B7A8BB6 WRITHED
143,610,523 *0DCDA3ED71BFD4A401DAACB2DAD7F1FCE913AAB1 SNIKMIS5
143,610,524 *0DC4F687CAD491BB9AB4E2289C32E2598C449BB5 [email protected]
143,610,525 *0DCAE9A78E07391D9FE2C75208B220F1EE5BD62A solinois
143,610,526 *0DC4509A73CAFAC53879E964FAD72E55EACAA258 www.smallworldus.com
143,610,527 *0DCA9AD417467905EEE50A8A46BDD8BF52C7451C X02396
143,610,528 *0DC896B89093A6838F489395CF0FEE6DFC1F05A9 [email protected]
143,610,529 *0DC910F4ED93C720D8BAE29B689238879A9554FA xe7x
143,610,530 *0DC4559C73CC55CB8ABD98386F520BAE1E9B3748 [email protected]
143,610,531 *0DC0DF4509D47C2869A68860678EE183001A0302 }x{ o~o~ (######b
143,610,532 *0DC6EC30367DF78C04CDD6F686CEF85244752E61 SOS7746
143,610,533 *0DC2EAD5C0A0294A6E54FC258688F716DEC1A841 YA+ES
143,610,534 *0DC09571DAA7BCCA84D924B0E9A87715A34D6747 YANA-TULCHINSKY
143,610,535 *0DCBA69C6BBD8811BF66835AEF2CDC04FF1B9A46 sotilasy
143,610,536 *0DC89E3E5A424033303FF216102B8C31C90367A6 YASMIN143
143,610,537 *0DCF19F5E90A992E9118B6A77CF9E1DA7BB83BEB YEPSHESMYLITTLE
143,610,538 *0DC6229C22274FF989C5E4338B817B7EAFC2BD91 yjq
143,610,539 *0DCDAC5C68786294124C0A9BD30121CB3F22A39C YOLLY-MENDOZA-ESPENOCILLA
143,610,540 *0DC71BB6195A5DECBBB14CD1AFC7FE2A155659E3 [email protected]
143,610,541 *0DC8329958EE6443904722FD45682E453DF5E41C SPLAT-0~D==8
143,610,542 *0DCD0ED4EEBEAA2C21CEB000E496F9ED665B36E8 [email protected]###8
143,610,543 *0DC11F52360D6D3E4E5468F4D73F26626EE6959D SPLAT * * *@---B
143,610,544 *0DCBC8AB9906B0AF726D60BF1B5F56870F096203 Y_SAMEUL
143,610,545 *0DCA90E88EDC93A1C898A417267825B7ABFEF5F8 SPLAT!-O~0~(##8
143,610,546 *0DCF17F44CF3D9474240DABBCA40076F3D56C4C9 SPLAT!!O~-0~-Q=====8
143,610,547 *0DC2246DFB685EE5AC25389F3A9E0DA661CC4393 [email protected]
143,610,548 *0DC6A9250EEBD269F49B5DAA7EB31D540186186E Sploito~-d---P
143,610,549 *0DC80D9F2F40678FF3D9AD7CC8B684D41A33D63B SQUIRTKITTENSED
143,610,550 *0DCC83C4BE5D00ADE3A8D636B01ACDA287998A01 ZAMOŚĆIE
143,610,551 *0DCB24F5B30CD1057DA150B24E0637D2B09979D8 sruerviged
143,610,552 *0DCAC474B4F568B40A3769E24FCE73BCDBCD48CC [email protected]
143,610,553 *0DC269EB1793D8DE21B6DF9C56A600428AD0C6C4 ssbb08
143,610,554 *0DC81EC4BA55D09F410FF283A2190CAD6F9BEBAC ssrdnhcc
143,610,555 *0DC33DC74D853F0517DF8F977E9B8B4BEDE821B3 st8isgr8!1992
143,610,556 *0DC41D68543A1CA4F42F5747C1D9926BC6537E77 staceydonnelley
143,610,557 *0DCB6DC95737A58958C2385DEC5AB6857747BCDA STAKINGUITKERINGS.
143,610,558 *0DC812AF6953725BB2664EC8412E42A7EB494696 [email protected]
143,610,559 *0DCD1BDE00D2076CFF1D4DBE480E1A2FD98D17BA STARS.160SCORPION
143,610,560 *0DC0CFF0A6518F34E1179D27BD612701EB884424 [email protected]
143,610,561 *0DC3BD3811320127FD48FB589702EA6433E6D6F4 [email protected]
143,610,562 *0DC1732CA5E4489AE7534D717F47385D03C255EF STBLSRT.
143,610,563 *0DCA85F9C6FCD8C95F1228A9F658CA696CFE6190 ZINCOTYPS
143,610,564 *0DCC63172E2D885A9B299CEFB3C75D70868D166F zn<baa
143,610,565 *0DC4C988EA428D0A28AFD145BA0143BF0B5808C4 STEVE-ANCTIL
143,610,566 *0DCE31E4B2D0BFD8F47C8E16A835E5D246AF3FAB STEVE.HOFFELMEYER
143,610,567 *0DCB470EE464431163615E504C48ECB2CAE17957 STEVE.KEILLOR
143,610,568 *0DCF443B2A1D70D5CCD44239BE2CF6487924EF11 ZOILA-N-JUNIOR-DELGADO
143,610,569 *0DC126A51097A63EA51247EA9DE6C97FD610B996 STEVENBOOK
143,610,570 *0DC4C659EBB9AA0D8BCB97BB01FAAEFC3AC300AE ZON-TANJUNK
143,610,571 *0DC8C7A0D5D366F59C57366157AF49DBD7C2D57B ZOO-AGRO
143,610,572 *0DC98B8567F73C87F5B46A53A1C7C89EE553104E STEVIE.SANTORELLA
143,610,573 *0DCC513B337454D8D58A778D53AC4C405DF4BBDA STIMPYSHARON8
143,610,574 *0DC727AAE7FF2E5E66A611EA9BE413E7AA08C9E5 ZUL FAHMIN
143,610,575 *0DCDB9B3CAD53741C8BC2A78205E9CAF8725C8C4 STNEMEGAGNES2
143,610,576 *0DC7D91E5DEA8EB72BC4DF06FA5C1D5B5BD7A0DE STOKLUS
143,610,577 *0DC784F69AB821212459F20451E69104CCB77068 stuartprokos
143,610,578 *0DC49FADF4EBCBF3FAFC771DD665F7C629687F2D ΦΡΆΓΚΙΚΩΝ
143,610,579 *0DCDF502D3EF2C9882754F75DCEA67DD011C36C2 АБАЛАЦКИЙ
143,610,580 *0DC55155177CAF0C20E5A399254E3D9E4DEB48AD АЙДАМИРОВ
143,610,581 *0DC442C7442555AA2AC47E4CD016FEA364D5EF3D ВЕРПЕР
143,610,582 *0DCAB08353C48A2E0FA4694E37A886CE9A3430E5 ГОВОРЕНЕ
143,610,583 *0DC703E82AB9816BAF9568BFF07391F042F7F60D ГОСИНТИ
143,610,584 *0DC75E7FF956A59AF9E444CFCD56949C73782264 МЮРЕСАН
143,610,585 *0DC5A49C8520C889AEB6B714DAD0AADF31C32ABF SUFFIXION
143,610,586 *0DCD4EDEA7F19A4A2FDC91FBEEC2C4D2E8CF38CC [email protected]
143,610,587 *0DC2E218F045F743D62816527AC32A13AED2E53D ПРОСЛІДИТИ
143,610,588 *0DC54CC44045488D39EF0829E737A21E0E774270 SUNGARP
143,610,589 *0DC5D996C2248FA4172C7A0614CFA0954353E48C sunshin90210
143,610,590 *0DC7D67DF6C98B793899D0845AD8C0AADFB5D661 сонтонакса
143,610,591 *0DCCC51F24722C1CF16C5AEA98216F75CAE6B6C7 СЭВЕДЖА
143,610,592 *0DC61C68DFE8637EEAE872CAA0B1AEB70369A707 の再現VTR等でも見掛けることがある。
143,610,593 *0DCF5DF16DD2A3CCFD9B762D6A84E936FF6D624A SUSSANFRANCISCO
143,610,594 *0DCCEAFDB0D33789D348BB7E8B6712811039C14D [email protected]
143,610,595 *0DC6779AEE2753A72C0E91FD905032A1AF6D5E0D [email protected]
143,610,596 *0DC6C98B44B8E595880F4A6346885C6C840FE0AF SWITCHINGBFONTH
143,610,597 *0DCF620F85EBBC4E04904433F3DC5B6970B39CFB sylvia-borlongan
143,610,598 *0DCFE7ED604D83F9B22D6225CAD84648AA21C4D7 symphony.no.2.in.d.major,.op.43.-.i..allegretto
143,610,599 *0DC38E21C5943D1F8D3D85CDA150BC89AD3E2EE4 TALKDAVROS77
143,610,600 *0DCEC108BD64B1CE7667413871A8FC431C8981B7 TALKPACBAYSUXBALLS
143,610,601 *0DC4B72AF3C2E2F7DC498DEC46DE3A10B207F4D8 TALLTRUN4
143,610,602 *0DC57A6A226006B12856CABF34865F5FAFBB865B TATJANA91
143,610,603 *0DC1FC2E20C25468C71D5C99EF925D3FB2802978 taylorbrinius
143,610,604 *0DCC1A669DB16BC067C61D47333E039BF599A413 TBALAJ
143,610,605 *0DCC50706D25E7A84E1D375B9DF2E1852550D610 tearing droppingwaterfromeyes
143,610,606 *0DC1222F6348395FAFF3AF7F2A44BD2A193D4F7A TELETOURISMEBSW9
143,610,607 *0DC7CD4160574E46A53707BEF81812073818B472 tennists
143,610,608 *0DC2476DAEAE84FACC6E56CC2FE93DA9A2FCED94 TERMERNES!
143,610,609 *0DCB1D71A0D55CBFB4417E4C810D67D57591AC0A [email protected]
143,610,610 *0DC381023C893DEF809874A7A5AE52C3B2069088 tetrarch
143,610,611 *0DCC2CC487285A9E830ABEAB13CCCEEF169DF4FC TETRSYLLING
143,610,612 *0DC3ED694C5244534D65704F301FECDE14C62FA3 tfniylyu
143,610,613 *0DC7C3924C8B0D56F2753FC1DC258A0E2C8F8EE8 THANH.NICARRY
143,610,614 *0DC51EF5A582C8E8F431B5F1E77C0ADF3B698992 THAT-SILVE-HAIRED-DADDY
143,610,615 *0DC3E229AB1FDAA29983FCE98AEA73F6126723CE THAT'S-NOT-HOME
143,610,616 *0DC54D315E4D67ADCAAB3AA6FE19C55D9342F7AF THEASSOCIATIONOFRELATIVESAND
143,610,617 *0DC2D04F6F50F3E550334CE72FF2FB564F35C2C7 THE_BRINY /D//I/_'BR/AI/N/I/
143,610,618 *0DC3EEFC5D1CE95373A8D1888E4583BD4ED3C639 the help without you
143,610,619 *0DC49134A129DA3C5492AFA16259D6768CE1B364 thelynn55
143,610,620 *0DC81AFDF4E15E0FA616A1E4EC3B92ED661D82E1 THE ONLY ONE (A MODERN EFFIGY REMIX)
143,610,621 *0DCB992261611461B8BE3075FE3ADA3960C6DDF8 THE-TRIUMPH-OF-TIME-AND-TRUTH,-PART-II:-XX.-ARIA-(PLEASURE)
143,610,622 *0DC4F9BE338833F4AFF82F483228F13314037055 The.Zoo./.Learning.to.Live./.Whole.Lotta.Love
143,610,623 *0DC829AE094228F3A9530B160574E712A8984CC3 THIRTY-SIX-GIDOLE-FLUTISTS
143,610,624 *0DC52BC2F1FBA961F4BC9940D4775DF3EBE36B30 THIS.EDITPAGE
143,610,625 *0DC1249E1AEA9C3C86BEA411EDAFCB72CC67E223 THRWWYSES
143,610,626 *0DCD33DA7D9E567324AF71D2F762101563DF7473 TIJGERAC4
143,610,627 *0DC33B0CDAA94FE5AFDE7473849A60FC42A7A1F0 timothymarchiano
143,610,628 *0DC1CD135D4D5539D63A0A0360EB53FC3B7450BE TIMTONYING
143,610,629 *0DC626C796EBCD6F5DD53737E942E138354506F1 TITUSHAMMEREN
143,610,630 *0DC5F7554702CA8A45E9CCFBCAE6725BE61A81A7 [email protected]
143,610,631 *0DC0B12007BC5631432CDA16FD6E6334414DE06B TLUABIB4
143,610,632 *0DCF287B707CFA9BB93AB8EF5F2FA5319D6321AE TNAPPAH3
143,610,633 *0DCE6F2F6181394F01A80ED16782E87D409F2223 tnapsmo0
143,610,634 *0DC49B4535C8EA7FEF3C106E542947DB6E81B92B tommieedwads
143,610,635 *0DC19E19592E9F71C372D13E7F7AAD92860724D0 0NGUAAAAIAAJ
143,610,636 *0DC0017EFA20BBCF8A3041B25DD53C7D42FEC335 10N3L53X
143,610,637 *0DCC4A58B14392907FD19343534976370FB4E3D3 10 OELHAENDLER
143,610,638 *0DCFD48132CE51EBF8EE8C87AD148FBB11049E07 11 M
143,610,639 *0DCE3DE9EFBE63A275B6215DF8F87A3DC48CB07D 12StepProgram(ToQuitYouBabe)
143,610,640 *0DC84BBC79FBBB90AFBDEAAA4209AB11C41CCAA8 12-T
143,610,641 *0DC5ACBADCBAF97B7E0E5A38DF90D5DD809CA789 1519569 ZAHLREICHE-MENSCHEN-STARBEN-
143,610,642 *0DC4B85F073754367B883998D89F1896238FEBE5 TREKIRY2
143,610,643 *0DC2DAFDF98C8108E74E1BDCF23EE1BD224486F2 1555892 BUT.GLENMORE.DISTILLERIES.AVOIDS.SPIRITS-BASED.COOLERS..
143,610,644 *0DCBBC2FBBEBBFB29E29CC2E9EDAC1FA2BF90629 1574167 TYYNE JA LAURI PELTOSEN RAHASTO , AMMATILLISET OPINNOT
143,610,645 *0DC1985FB33735328C4495EEDE8E4C67177B5584 trinidadsharrett
143,610,646 *0DCD5085289A09DAD2001FDF9C31A7D7CAE76CE5 TRISHDOWNING
143,610,647 *0DC63BE89CFE3A603A85CB0BE7D4700CB20E582E 1703354 OPISKELIJATVOIVATN
143,610,648 *0DCC79DF263BD9167B2D3238E496034878BA98B5 1965yo
143,610,649 *0DC43C1BCBCCE232B45DD14561301CD716529154 TSHEMBSW
143,610,650 *0DCFF3505B34B3228C72B90A57BCE41D131C43CE TSHOLOFELOTEACI
143,610,651 *0DC45ED122235DFBA0C88EA079708881A42DCDD8 1.akustik-pop
143,610,652 *0DC2E403B95C2EECEFCD3E41096EF77FFD4EA715 [email protected]
143,610,653 *0DC6EC34F050B713C9D5E2585B2C89256B5673F1 1BOOMERSES
143,610,654 *0DCD8116DA8FC54D1F4D8E0C105EB39D14B46969 tylerteehalmon
143,610,655 *0DC676242E0C4D97A5FA946E403E5FD5233E16DF 1.ER
143,610,656 *0DC4A9F5A4F78C68EB413B9728FF94129B137769 1ERSATZGEGNER
143,610,657 *0DC18F7A74CD4809E350F6ED13230B221F674B98 1.EU-AGRARMITTEL
143,610,658 *0DC25822CE3E7D5DD9FA0B33DB505E38A0CEEDD0 1-goodpup
143,610,659 *0DC38F7157EAAB2B8B30AECEA388A7EBDEDB182F UGH...NEVE-VA!-RIPOSATI-SUL-FIENO-(JOHNSON,-MINNIE,-WOWKLE)
143,610,660 *0DC8894D97BDC7536530369E6F5E10142F32562B UGRI$K3
143,610,661 *0DCCA838BDB445FB8CB999A8FB7E296BC65E74E1 1.ISOPARAFIINIA
143,610,662 *0DC7B12504E3C5829349C81CB1DB7E15574BB08D UITSMERI0
143,610,663 *0DC8BF0538DD39843ACE8A240C4A362DCA35E9A8 1$LAM1$M
143,610,664 *0DCFE00F6DFEA69C3CDF6BF4B54B995EEF9F7CF3 1LANDESAUSSTELLUNGS-THEMA
143,610,665 *0DCD6D6BACA281B9DFC19CDA5EF171A7A6936267 UMRTVIO0
143,610,666 *0DC172FABC3E383E134EDFAAA48A41586F4EDBFE 1 MAIDONSIETOKYKY
143,610,667 *0DC8941FCC63C31F6C8161B6CD57524938138534 1MAN-TEREELLE
143,610,668 *0DCB1BD62FEC90988DB123C13D802CA86596A35C undermayor
143,610,669 *0DC11DFF5646A46A9AFA45A2416C44616B992074 1.NACHWELTSCHUTZ
143,610,670 *0DC8231F4C301A3B5BA2BC541577875D051CBE31 1naugurat1on
143,610,671 *0DC257A344CD7CAFDD8DCE47F637876DDE032AE7 [email protected]
143,610,672 *0DCE7588DC7CF02D18F46E04CE4FE9A3143B38EF UNORGANIZEDS0
143,610,673 *0DC32AE01371878C8EA9CB50EBBD8BA5DF785D72 1 pm-viestiss
143,610,674 *0DC8DE9BC1EC75530D728B106AE653A7260ECEAB 1 powerbasskollegen
143,610,675 *0DCE909C4973B75FAF9B3AF149BF4D34EE80234C UNTERNUBIENS
143,610,676 *0DC7A12940E8023E4399B19AAC37DC3F332F03E3 UNTIDY-DUBS-PRESENTS
143,610,677 *0DC6B4A4F5984644E08AE74F995015AD99C0DE8B 1QNT
143,610,678 *0DC9DBEE00EEB35C610D44093EF92F0862D722CB 1REPULSAS
143,610,679 *0DCB1554FD357B14E33608782993F0AC92B4D66D {us`
143,610,680 *0DCEC5C18567FAB9D272CB899464A6A26D8DDE4A UT0P1$M$
143,610,681 *0DC45920E1D47D7A8500F5FC04C777DA01F25DB6 1.TEHT
143,610,682 *0DC83D3876F09ADE52315892CB60B5E7B1A6383A UUDISTUSKOKEI7
143,610,683 *0DC40E8B1A2F0661CD85E4086AF41EC1AC906DED UUYJUOS5
143,610,684 *0DCAFE600850C055C81376DF6988ECD2B4E32241 VALHALLAPARROT2
143,610,685 *0DC4FB2ACAB6137F88D2EB697E1F5F449F8E87D2 2004850 usko.ja.ep
143,610,686 *0DCDF1289A760BD283BFD27B6D5A912CD15AEC05 20-10-1872
143,610,687 *0DC50F3E0235D3B219F5132F08F45B0A23434D0B 2102188 helovedeverythingthathedid
143,610,688 *0DC5A08A8518414F7AEAA8110DF5927288C1F5B0 vehram
143,610,689 *0DCAF8B998ED16F9B1F61FCE9169C4AA59F5D3B8 VENNINGSTEDBRARUP
143,610,690 *0DCB5B90E6F86A77EC63E2106B2B3F67F6714DDA 2497632 LAATU,LUOTETTAVUUS,NOPEATTOIMITUSAJATJAHYV
143,610,691 *0DC9229B44E65681C346B61F8A989E516811B8DF VHECK-DE-LEON
143,610,692 *0DCDE3C58069ECA9CAA489D030A559A2CAA07567 2782561 merja.ojalammi.osallistuu.jyv
143,610,693 *0DC394EA59822FD7A6EFA9C9550697383051F2FC 2879626 liput.2.e.ylikyl
143,610,694 *0DC8A30A58FF3F21DAF11C0BE64C99F7A9EA5363 VIDALITROS2311
143,610,695 *0DC23C6951793B35AC83E1CDE558479AEB277252 vierfssige
143,610,696 *0DCD107CB6BD367E453DD89D9B2BC509807BC378 VIJAYNADKARNI
143,610,697 *0DC8FD12FF004BE89FAD44D7939214DCB1233F87 VINC.CINTRON
143,610,698 *0DC2DDD6BA8D50D394FCCAEBDCA0B3ED3A1AB0BD vincent.jessie.escabarte
143,610,699 *0DC9F3A4238CD206D836D8911A4E90883CF70B35 vincenzoniju
143,610,700 *0DC83D3AC4EA539F8DC41B432EA274BB523C8D52 VIOITTUE
143,610,701 *0DC414882B91DF439C9A0FBDBC8761046E59E58A 2CDE9A5F37343982A9A5B8FEC2487596
143,610,702 *0DC9E7CD565B3E1E349C5EF780A94B0A72D78089 2CSVFBSW
143,610,703 *0DC0A2598A473050EA3E84C3A8D67BE19FCFFF39 2EIDDIWGI
143,610,704 *0DCCC134C3E3069C990C93413A64A4FD3ADA7E54 2hyv
143,610,705 *0DC7CED92C0EFEE1F708A4B03BE7597FF3E80914 2kaarnajoki
143,610,706 *0DC7F506AA0CD260A07CE55609AC00AE5A2452FE 2 MILLSAPS
143,610,707 *0DC1B0E43347F9966179ACB6053B5FB1B7166B0B 2MYPLAY9
143,610,708 *0DC9DA08FF199B6EB2505F43196C7538D7365EE5 2.OULU-RANKING-TANSSIT
143,610,709 *0DCA772783E302A4AC0CFA02FDE278A27E00E2C6 2PHILMOE
143,610,710 *0DCFE155DA0C1E05A330A0BA63D2CDFD47F8E3FA VOQAVOLI
143,610,711 *0DC8FCB7E7B45C0FCA570C3062DA0D4DE4429433 2SAGLEDAM
143,610,712 *0DCFB7242D4AAFFC17964329AC61ACA274F53EA8 2 vasemmistoopiskelijoista
143,610,713 *0DCEB68DDA8999FD993DA3240B8F340204D8601D 2.verheissender
143,610,714 *0DCB4BF49A4EBE5FF9B972AD5B2906D5628FA59A wa11ing
143,610,715 *0DC0B8966ED3D75C47B70DE8349552DA280D4EF5 WAED.ALSIR
143,610,716 *0DC9CF375C1C4138CC579418751409E3BC3A5CD3 wagnerboi08
143,610,717 *0DC4F7919A80478751FA8D29C5D50C9333D86021 walkontheedge~yamatonotheme~
143,610,718 *0DC6F1EE35A50851990BB5507B325E134939E53D 3AHASELER
143,610,719 *0DC995F88811904F7F2267AD83F6E3FAEAADD6B2 wardhickingbotham
143,610,720 *0DCEB1F6306A66CCB8A83B8A0D93E8B774738F24 3ilovemaverick9
143,610,721 *0DC865ED2FEE07FE1E5BFEBFC511CF87AC4D88C7 [email protected]
143,610,722 *0DCA04C34382FD56D67705468DACD4282B43E2CD 3PROSTRLI
143,610,723 *0DCFCBE046F0B11BB252452D40732C12BB025EC9 [email protected]
143,610,724 *0DCE5B1A951319BE57AF00378EF26336E03CC43C we-come-from-monkeys
143,610,725 *0DCACE088DE6E6C3C179939C6573A2745C8F7964 WEEPING ANNALEAH
143,610,726 *0DCDC9121A82EDF56CDFE2FFAB86E2D08D682B9F [email protected]!!
143,610,727 *0DCDF424AA3675E5FD951EAC883D5E346813026A weldonwallor
143,610,728 *0DC4E8CBB2FD57683C52DD244FC58435CE680F0D 3ZALOTNIK
143,610,729 *0DCC559916DC9FE378CF4B677AB21231D129F3CA wesdohm
143,610,730 *0DCCA704FB835B0F2CDE5957123D7E2162A58863 4BOBANNIE
143,610,731 *0DC237845C6325DC1A8233EC3E62F953398721BD 4E671241CB54FFA8A7A29D8A2607CC90
143,610,732 *0DC833C97B8337DAB430E245DE1D1774B82DF1CE 4.handballmannschaften
143,610,733 *0DC5A4E67D83FD131F0FE17E8EF96551B29DC79B 4iammidnight8
143,610,734 *0DC406577D3FB4AAC8CECEFC0F4A062ACB3C1164 WIDERRAT1
143,610,735 *0DC97E3D79B2EC83E4B1E2652C63A87E431B939D 4JUDYCHICKEN
143,610,736 *0DC3353C4A7593A45177C33298667F0B7BCFF08B wilbertanthon
143,610,737 *0DCD5A007225808F969EE10EE550C7712D3DC4A4 wilburndunford
143,610,738 *0DC3CD1969539BCE8CB39E7A1AE00D146C401F47 WILBURN.PELLOT
143,610,739 *0DC9CF692AE734DCC8695B76F8620D407A60203A wilburnsnaders
143,610,740 *0DC48D2E18ADC9714BD2ECAC1FC9B70E0CB1B329 WILBURNSUDO
143,610,741 *0DCA0481A626EAD002BCFEB02A3EB5416B1923A9 WILEYMINTY
143,610,742 *0DC7D5EA28E8AEC27AA9C717055CD12CC1A569D7 4piirteli
143,610,743 *0DC91F02E9A6B5E5DC3A25A2B10D27CBE7591B19 WILLIS.SCHLOTE
143,610,744 *0DCC45C2070C8986962B9836660713F6C45E5EAE 4RIKKETIKTES
143,610,745 *0DC681A4CABD1C80980E9DDDD27674C6130F1622 WILLY.HAMDN
143,610,746 *0DC5EB7E6F0749EAE4BA41F4DE8916F80F709950 WINGSFORDREAMS
143,610,747 *0DCFE27B0D161D7DC59B619454C350A44CF95C3A winstonximenez
143,610,748 *0DC3CF2C2686CFF0DA02307B67EC1E7EB747DB7C winter-geranium
143,610,749 *0DCB6961BC7D8A704DFA5E9F8725E56356EC650B [email protected]
143,610,750 *0DCDE8F43591CA82724A101DA7F9A3E345B6FEAD [email protected]
143,610,751 *0DC525FD4B4E7E64898C1560B2B70F67845C8EE0 566403 LOPAREXINTEHTAATTY
143,610,752 *0DCBEC9BCD7AE44B0FCFFDF4ECFCFBC5C4CBD402 WRITHED
143,610,753 *0DCDA3ED71BFD4A401DAACB2DAD7F1FCE913AAB1 57OU73N3D
143,610,754 *0DCE2BC22F9FEEB4D6AA0BE9C8F90029E78FD365 59.JANMICHAEL
143,610,755 *0DC28ED07346BD7657CE016DB78AC5ADDA85CC04 5ALLONSES
143,610,756 *0DC5E8B90B32873621952C9A8D5D737FAD47D149 WWWDEBORAHGALLCOM
143,610,757 *0DC7F2319778258D6E878F9D0CFF10B1EE677126 5COOLCELTICS
143,610,758 *0DCE8FEBB522C0F50961969DB23500A1590FF8A9 5DEPAGANIZED
143,610,759 *0DCFA46EBB88C37271C8371FE8782195266E72A2 wwwplanetorganiccom
143,610,760 *0DC74EE0FD0EDE744EF535782B87AA73DD7C73A2 WWWPLATFORM-RENTALSCOUK
143,610,761 *0DCCA773E94EA65143F08E2685F3A36368FD4322 5FENGLESKI
143,610,762 *0DC111804C50A92A4C2CAD03FB84B5C1BCD18CF6 www.teamenigmatic.com
143,610,763 *0DC5540E0A8AF45336ED0555557EBB664114BDE7 x20ea5
143,610,764 *0DC8B9B67CBFBF45BEBA18AA3DD9CEEB9035DD2D xavier.bardury
143,610,765 *0DCD60773A895FB1A3F9D70144C48E61E5D6DB1E 5ILLUSTRATIONSINDLGGENES
143,610,766 *0DC2A302D480D684B5487B6F0D40799A054336B7 xaymarariveradiaz
143,610,767 *0DC9682EED01EB181554E2B532D1A30AA9C32F0D XFGWJZPDJ48O9
143,610,768 *0DCCECD48F4D8E27EE986DF5FD4C274AEBB24E94 xhorrorsh0w
143,610,769 *0DCFFF4A2365B6386BCA15FD68F073EBF2EF121D [email protected]
143,610,770 *0DCAB00674B4B1B9D52DBA1264F4A6936F3FCF9D 5MARCMOOKIE
143,610,771 *0DC0F1652E3A778A889B748E03C7CCF8E5470EF1 5MARCUSSARAH
143,610,772 *0DC80A527565CA427DB3E41FD71A852936C8F1B6 5NDVISSEN
143,610,773 *0DC03FFEC8FEB3B94B6D6394C5642CDAD4112C96 [email protected]
143,610,774 *0DCEEEABAF3FCE16ED0EE08E16D09C08C3BA291E 5POKUPIM
143,610,775 *0DC1FD407A246D74920CED7DB40B8F631C295CC3 5rynt
143,610,776 *0DCDEC8A4C8E6FD586E452EEE9587A55F379592F [email protected]
143,610,777 *0DCCCA20E73C23F418B2EE5B6B1223FF50DA9174 5STRAMHETIVE
143,610,778 *0DCADAFEA184C0CA578CE34DA9FCFCE51F137898 xwy
143,610,779 *0DC407AB6561D79B99BA2E4BE1F9A3BEE189F1E3 XXEABB
143,610,780 *0DC1610E96AAB91D21CE9892F5ECFD9B6294D3A0 Y[>
143,610,781 *0DC5605F522769F65DE4C20E495A1F89371AEE87 Y147793
143,610,782 *0DC502C51455D35D687064CB13E801D9CC81315C 5THATPULSAR7
143,610,783 *0DCD9C808AAF4926342EB3E0425BEB2B14B5500B 5THEFLIP0
143,610,784 *0DCECD530255C9E58A0D5EDBF28438FB104CAC86 5WASHUIZENS
143,610,785 *0DC6E561D9EAA7B0A31F55BEDE139A7582141AB6 YANKHOBA4
143,610,786 *0DC10AD6871926369B225D46B41FF9EFB22A676C yayayaya
143,610,787 *0DC355D8FAD2B3E320F19CBA2E2978AC21F6C6A8 656852 NEITHER SIDE BUDGED FROM ITS PREVIOUS PROPOSALS
143,610,788 *0DCC939521115A8163A5860BBF5222E892CCBE02 66.GARTENHUETTE
143,610,789 *0DC89A5F66359F83122A6FFBA298B4D51DF6A57C 6974520858ea3a078618dd11772550c5.gdj3114
143,610,790 *0DC298B64B945D011CA7156E1345730CED7EAD49 YE SHUTING
143,610,791 *0DCFDD51268826DFABB4335F724C5C7399E3F059 yliratnulovnu
143,610,792 *0DCB3012C124CFE5A7B69DC3C61FF39A29B4AC68 YNEMNED3
143,610,793 *0DC08936C09B383E027001ABF95D6A33F80D0038 6ethicoaesthetic
143,610,794 *0DCCA92A2B7A346C1E9B323E995AD5930C39E370 YOUEI TROVARE LAMORE
143,610,795 *0DCD5BD07018DC7F7778C8751F305C0234AD6F99 YOUUSEDTOHOLDME(ORIGINALRADIOEDIT)
143,610,796 *0DC115D6A6ECAB26200D716380F4862CC3F38480 ysl300
143,610,797 *0DC464154C509A6D7F12B88AEDD096A0D3E5578B YTSALPOLUCIRTU4
143,610,798 *0DC64011D8FFFAF400CB9E31C256B7D3720CC334 6MERAMIN
143,610,799 *0DC6BFDD08DC6EFF83774CB05F55C66A70E95D90 [email protected]
143,610,800 *0DC8191A746A23A97BDBC8F053A001E25B2C16BA yvonne-meza
143,610,801 *0DC263A5AE9DF21D5E47497841A261CDE8D39428 [email protected]
143,610,802 *0DC1E2F32B20A8FEB27C4A53FA846C0CC875C090 Z53950
143,610,803 *0DCCFE82646F898DC7859226C4542B5C7C3052BE zachary-jasen
143,610,804 *0DCD4A4EBCB4879B1BD237ACF0EDDF1A953E6B5E ZAFERGHAZIALSAIDI
143,610,805 *0DCDCFF23E6324E5F231162DD1B1BAC64A409F73 ZALOMIT8
143,610,806 *0DCDFED78B3EADAE232C75EFEA1184A338FD9DE2 ZANDSTRO4
143,610,807 *0DC37751FBD4CBE0BEC5370F0958B5F174C81FE5 ZANE-BETHELL
143,610,808 *0DC8D92C9AC06EF2ABD2E633AE87D2CAF009C1B5 6NLJDBRST
143,610,809 *0DC6143BC204E044A1BEC26E1C8128F88EB4520B 6ROBERTME
143,610,810 *0DCEF8772F639A3B076CAA7965291823EC40D066 6SCOTTAVOS
143,610,811 *0DC8E3F7A733FDC52655A6CB9579360EC03B5560 [email protected]
143,610,812 *0DCE2B8BFD51D844AB91F87C0ADD2184426866CD ZENIA.RAY
143,610,813 *0DC2CE2EE0D42628A466B3924D81389D9A10E85A 6STEPHENJOJO
143,610,814 *0DCE0EE5CB9480320F7F73C488E35A283E3C2D4A 6TESTTESTSHOOTER
143,610,815 *0DC91E73B0EECFDFB9CEA914FD1E943E2B0AC126 [email protected]
143,610,816 *0DCF5300CCB9CDCFF6D85372D2368418162CE31F zhongguochangeme
143,610,817 *0DC651C52A2330A0D76F034FEFCDFA0D65C0780D 712937KAS
143,610,818 *0DCDA79CB8B4E5D347ED15F58A4BF92487D679EB ziekenbezoek3
143,610,819 *0DCBC25F1577782589B3725B9F4112997DF1E445 zilda.estrada
143,610,820 *0DC36B165668CA281511CE86AEEAC62DEFA3592B 78GEBRAUCHTWAGEN
143,610,821 *0DC930632B70301A568C6FAF7BC69CA4172D3960 7aanzeilde
143,610,822 *0DC02455385734B4545E1EA6A64A615990F95BE1 7ALBERTVICTOR
143,610,823 *0DCA779AEA5FE91ED23B6F93598B9DB0827BF578 [email protected]
143,610,824 *0DCC71B18C9908D2798FD9AC34283C5F37F03EAC ZOEEGGLESTON
143,610,825 *0DC5D3D23649B131AFEB67B9E28C3F8ACD3EF7EF 7BSWAKZEPTANZBSW
143,610,826 *0DC809FF101C220AA7AFD02BFF2B7D5AF45908E5 ZUBEIDA KHAN
143,610,827 *0DC323E4C6DA6B44DACA84C5141B450729DAA6D4 7COMEGETS
143,610,828 *0DC10F567CDF725F2866325BEE0DFC51530CB18C [email protected]
143,610,829 *0DC3D8CC42C0D895E78BE4488032B2DEC9D8EE42 [email protected]
143,610,830 *0DC755CDEF758ED91B67FD701F3A0B850C825641 7gewaesserschutzzug
143,610,831 *0DC4FF6A9C4E3C3DCDE4DB78C0E1832F391CDE53 σίβρας
143,610,832 *0DC94CF5426AC4822EF9437C0EE8112A86FFA470 7KANDISERER
143,610,833 *0DC94EB135CD638DDB9DE6EDD12BD27F8A369F51 БОЛЬШО́МУКОРАБЛЮ́&AMP;MDASH;БОЛЬШО́ЕПЛА́ВАНИЕ.
143,610,834 *0DC890AA1771E4E91CAF57774A8EA24083EC7EEB «ВЕТЕРАНСЬКА
143,610,835 *0DC23300D148A8780DE8390CF5C511A23AC9A1FC 7MERETRHA
143,610,836 *0DC4BBE271BB21A66A41EFEBE48518C0E939421B 7NACHEILENDER
143,610,837 *0DCCCC8485759AA06137CDAED6E4FD1A7430E762 7PUCKETTSTEVER
143,610,838 *0DCA70C5DD4896C553AFEEA56BD49F9B0B658F38 7R4N$FORMING
143,610,839 *0DCE052AE30D9BE9E97581AD9502BB5D52B77BC8 7SELLOHER
143,610,840 *0DC9C1DC78208316CC7C5B28E86D50DA3732A32B 7SVOVLENDE
143,610,841 *0DCAA028D10C79E0C514790A9738802481A6080E КУСТАНАЙ»
143,610,842 *0DC9953062ABAFD66A6D7AD91E42051EC292D1BD ЛУНОПОДОБНЫЙ
143,610,843 *0DC10DBEAE0B9B7A1A785EC710585D185B4F7D82 7wqdaqeh7cifbjl1h4
143,610,844 *0DCEE64BFA66E4CFAE1DDCCD0EB7EDAE481CFA5C 822937 DAS-WAR-SCHON-ZU-KAISERS-ZEITEN-SO-.
143,610,845 *0DC617ACD5CD8451AD74D584C101517079988C80 ПРОБЛЕМАТ
143,610,846 *0DC6E1C619770D4E776FEB34E90F006DA2B171BD 880625TT
143,610,847 *0DC27387A20A99372C71D7E29AF41B7B41570C1C СТАРЕЦОТ
143,610,848 *0DCB54FBD696663EE29F55D391F6A7FCE4C99D6E 8ANSCHAUUNGSWE
143,610,849 *0DC859B019CEEAF6172D0D0C0E76AA723DEC7587 СТОКРАТНОТО
143,610,850 *0DCE0B3AFF5FF2182F50A588DB6D583816CD2BE0 8####B*->-B0
143,610,851 *0DCBE84573836A21C076B2F34B0318B3AC96F57D ТРИКТРА
143,610,852 *0DC41CF6A4A4942CC2BAF1A2905EFEB06A9E5C7E ТУРЧАНКУ
143,610,853 *0DC0DD6EDD15D83B0A10AECCA463B9A5E72002F2  МАЦЫПУРА
143,610,854 *0DC04FFB1B6F6CA876AD2F25A10A9C3AD092F53B 8corviform
143,610,855 *0DC7E4CEA233C40A3EFA8DF2A39F569262577CF5 8DANLAMI
143,610,856 *0DCF49F69C7ED86B19BE76BFF1F1894BE7925FC3 8FOIX
143,610,857 *0DCC10D3025429D6CA2E3BE596AD8D2B28A4C3E1 8ILOVESNICKERS1
143,610,858 *0DC426395BA4896C319FAEABD35B29E42D2B4571 8lalopathies
143,610,859 *0DC411F7D9BCA2332665A6C9F7D6481DC1A2B68F [email protected]$
143,610,860 *0DC138CC554EB63685C87EC36D7CA88D24D524C3 富士フイルム「ビデオテープスーパーHG
143,610,861 *0DC4015A02F8F5ACC013725ABF296B11C789E32B 8RETROCEDEREBBE
143,610,862 *0DCBF833EBEC0FC5070DF59137712EF39C5F4170 8SMELTEVANDSSER
143,610,863 *0DCD53C0D2C1926586F70E4C526664993AEA0014 [email protected]*.splat!
143,610,864 *0DC82B89A8159E08AAB6579BE315E4848BE8D830 8SREILIMA
143,610,865 *0DCF9DD1C0A59EB5781DD7DDEAF5FC1B189E8748 成功拯救女警CYBIL
143,610,866 *0DC734B39CE22F8630E18D787AC74746CE3CF6C7 [email protected]
143,610,867 *0DCBBC23BF56207EC642D744A28E22ADCEA15721 9ALFREDBAILEY
143,610,868 *0DC1821B029FE11311D89585A0B8C41A8971CCDD 9CHARLESKING
143,610,869 *0DCF425816BAF067E55C8186D9443EA83E658C52 9DORSADS
143,610,870 *0DCF513CF2CC2A99B2A6B6A731AE37A2A51F5CF4 9ESTHATED
143,610,871 *0DC7E5F9E14842111BEDA295F575F607FE9E7995 9gospoda
143,610,872 *0DC63509EDA500C0309FE53A81E4808ED56592FB 9ITTROKIT
143,610,873 *0DC22018FACAAAE2213CEBA8B088602572531CC5 9KAUSTOJ
143,610,874 *0DC808A307355FF9AD8A38C4CC23D928567D3518 9LURKLURK
143,610,875 *0DC4FA5174D83C87B3A5B2479B8453A1A6CAC842 9PIZMOCNOGRAEHTWWW
143,610,876 *0DC65A9C35FACDB68AD92F1633A5218476CA7D86 A?1-
143,610,877 *0DC36BC0B97073AA840E0B745C04717513F3EB77 a4x3%
143,610,878 *0DC394D087EEB5B0D4B5C0B15CF60DD0BACD0D15 A5VAG
143,610,879 *0DC72944A766D54C222125720018CE7C22F7EFE9 a5vrv
143,610,880 *0DCCFAC32BB62CC4950F2305CB204196585E8AE4 a6;om
143,610,881 *0DCDF2F9D4B4D0905CC6742CA7378868D14A1985 A8FFF773-C43E-3269-92D3-E65194CCAEEB
143,610,882 *0DCFCF44542554E4EB50DAC12B79D6BA2416251F a=9gr
143,610,883 *0DCF9AEDA3D4E22A77C5B7FBF79BF2D30108DA8B aaa&2,
143,610,884 *0DC0416D4F1FF0972D82C3263C18CE7DCBF0CE29 02.24.1900
143,610,885 *0DC00D637EB98D9DA6CD389DA434ED28DBD2719E aab(1{
143,610,886 *0DCCD9A52661B618B5EA8E0192B46410E18038A0 [email protected]
143,610,887 *0DCCE6535E5891FB1AA251C09C58DA03EA812C34 aabhp!
143,610,888 *0DCD33BA026065D4A5BD37CB3C09DBA2D2B2C70B aabi*-
143,610,889 *0DC7FE73F7BE3D197C6E3FC8B6C6B15725872233 AAC^L
143,610,890 *0DC44E331A9B831AEC2D3B8BB08D8C341F313EBA aactc
143,610,891 *0DCDBED59681E9E8CA275E5CD72ADC769F540C13 AAD{88
143,610,892 *0DCB02C336356BF683F381E68D0EABA54F0701C2 aae07
143,610,893 *0DCB0227B0C0F43701236A766AF1A6F644812AEF AAE+.Z
143,610,894 *0DCB5E8EC7EB5DF82C8C02ED509528FD54864E15 AAMUAURINKOA1
143,610,895 *0DCF51361F96860AA40B80274053B4E64DFD6FD3 AAMUK
143,610,896 *0DC82448DF3F0CD020307A4A6B482F56B9D5F436 AANHUPPELS6
143,610,897 *0DC26AADE80C1AA27E031A2CA734244BE5E93215 AARON.HAFFEY
143,610,898 *0DC038BC0F501ED81C8C17FBF7D7393B1BE8B095 a,atm
143,610,899 *0DC585963AD700CA1DE6F779A2A03C8900487A58 AAYDA
143,610,900 *0DC01B1DAFDC4A15045A81F72CF27F40DC430B96 ABBRENNTET1
143,610,901 *0DC243D5B0EC906740CB940A927637FF1D4FF489 abegstma0
143,610,902 *0DC9E2521B3AABB1EBB5F78E283C9F814438F37D aber.sowat.von
143,610,903 *0DC73BD4CB33ED9B574B032BBB83DB03A8292B48 [email protected]
143,610,904 *0DC897046F12A1AA3898294ADB8BE5D13BF0D788 AB,G$
143,610,905 *0DC6CB7095D3CB03F84CEC82AA540152D0BF8FC6 abhigaaminah6
143,610,906 *0DC359C35D455B71149A10ED0ACC5582BF1D8A4A 0CFAQ6AEWAW
143,610,907 *0DC5324F8E7BCB164224B7BB59A5FC995BD41AC7 ABN45
143,610,908 *0DC9DE8922D51CBF63B3744ED440E7204DDD3597 ABQ?P
143,610,909 *0DC74AEB10D8EDE2E7C158D533A097A0E3E8EBA8 108027 in-dieser-hinsicht-ist-berlin-gnadenlos-.
143,610,910 *0DCF8649406BA82C7BBBE8622E6872DED6AC4BEE 12301697
143,610,911 *0DC31B92ECE2832C77B3E34153E9FC8AC82786FF 1259587 [email protected]
143,610,912 *0DC8BD53225BCF980A6BCF3C6862302BC37D5CCB 12-T
143,610,913 *0DC5ACBADCBAF97B7E0E5A38DF90D5DD809CA789 acu3o
143,610,914 *0DCFC747EBDD5435DB131620CE64E21742B110B7 AC`UU
143,610,915 *0DC1F0F14BEA60CF5374163039F2660E5330BBED 1329b
143,610,916 *0DC821F0E79C7D8C9CBA24347E155D648B880ED9 a+d&;
143,610,917 *0DCC604CB61733C502A8865EEA5DF4666BBFB9E1 adcc,
143,610,918 *0DCEF10E9034D11F040B6335AF5C93EF0B70A528 1390128 p
143,610,919 *0DC74D72143C5E2A95958026B470442FCA826167 13NAKIA
143,610,920 *0DCC15C4FBF09887BDAD2915FAA93C53BD26DC64 13onsite
143,610,921 *0DC71888B10EC0EAD110A2261A933CC854419F3E AddU
143,610,922 *0DC1C83A61F5A6957C8499A14E18F50D8DA4DACE 13-ZURUECKZUSENDEN
143,610,923 *0DCC9F4CB11A488FCCFB7D5A8359F1C64256F64A 1415167 hallitse-henkil
143,610,924 *0DC11E9CBF7CFAEC0B107ABD7384EECC5C6CF9E7 ADEXR
143,610,925 *0DCCBF710C8B120E18A8CA8D8FC2397B7F47F1E7 adidasnikita
143,610,926 *0DC51DAF4B179BA97F7D63BE9B28DAD2B7E7C783 adioteka
143,610,927 *0DC1DF7585727C0E0114418961C0112E0C9F9F4B 157806144x
143,610,928 *0DC068F325EC6FD6D01CE0A632289442FA05AFFA ADOLATPESHANING
143,610,929 *0DC991CBE03DCBDD0EA6704CDC4DBD863CE06B40 ADOREYM
143,610,930 *0DC1C0B02757E5B5FE083B6F0BD9BDC856DBE933 [email protected]
143,610,931 *0DCEACC8E1479462E64FA75DF923806262B93E0A 1926531 KONSERNIN LIIKEVAIHDON KASVUTAVOITE ON OLLUT 0 - 20 % .
143,610,932 *0DC9EF599AFF7E5B70CBC1059F45C7D87A6A5838 1977135 wulffwissegarnicht,wovonerrede.
143,610,933 *0DC9AC2819C51A2E8674EE92F061F28E17E69B7A A+_g
143,610,934 *0DCF9BACE32D5A91E15BCE777457A8E6CC614845 AGEHW
143,610,935 *0DC05FA86E8286CBA509B8F416CC12FDA1B0AB91 1-bossen
143,610,936 *0DC98A34577C4865608EE0E69A5DB95D1034CBC0 a&;h2
143,610,937 *0DC7482B2AE7CF0375CCEEE6DCCA3D617759AEEF ahe3r
143,610,938 *0DCEEB336B8190520B519CD1F9789A8B3562E96F 1DETARGIN
143,610,939 *0DCDAFEEE6637C0E6A9DFAD9A2966C6A4673317F ahmad.zikri
143,610,940 *0DCE914A9C55B7DC42839C0CFF4AEFE1F7CE84DE ahmedtilghman
143,610,941 *0DC06D41A9F074D8181F4BB5A69BA2FCCCE7364D 1EOHSREDNU
143,610,942 *0DC51753B61FFA2DE22586308D4163A42CF3EB94 AHTZANGE0
143,610,943 *0DCD81B742B8233FBB7539F1A48DE6A25510724B AHYZ=
143,610,944 *0DCA5B7E4EE95F50EA7BBEA66A0349FFBBFF93C3 a$i&1
143,610,945 *0DC5F5D0793A00F2E488BBB43195A2CAB57C428A 1-genealogie
143,610,946 *0DCEDF9659DD7D88A97F1DF234E24FE099E2B29D aih"t
143,610,947 *0DCBA779FA11E5F1BF9ABA0757AA79598CA1F693 1.growthwert
143,610,948 *0DCB4AA889878C1588887712E9BB4E67C9242CE0 AIRACOMET0
143,610,949 *0DCE16BAD2C5400016A286808CF218C5AC034A97 1insanligin
143,610,950 *0DC3D8A9B728BC62CE75CA4E3A76B262AD05AB4D 1.ISSERLIN
143,610,951 *0DCFA203C01782BAD7CE9E2B908EA8B4CF93B2DE AiUe
143,610,952 *0DCF575184A95F2F1B74905315EF48B9CD1FBD53 1-KOULUDISKURSSISSA
143,610,953 *0DC493971B2D187D3701C0FFC6DA78ACEA1EF334 ajhg
143,610,954 *0DCF5A89E4C34C9584A21078449557A5696DA4A8 akcdl
143,610,955 *0DC888C28BB8EA047A25D4CDE4267EEED6552378 1.mitlgiederversammlung
143,610,956 *0DC2C71EB73A2A4FE0146FABFEB022FCAE6624CD 1N7ERPULMONARY
143,610,957 *0DCAC9DC58DC8D707F449FD961D5990CFA3F9F39 a/kmc
143,610,958 *0DC4A0F4AC44F70B2EFE6E2E24BC0F142C236C5A 1.orientexpresshotels
143,610,959 *0DC18D286D762F5C6FE5E1119140B2F92BBE0EEF 1 polkupy
143,610,960 *0DC1A066481CC7EC84AF08D966D728AA7F6B378C ALBERTOWILDEBOER
143,610,961 *0DC296317C6932C6113D0AA89B14DDB758A920DA ALEI
143,610,962 *0DCCFA1C08AD878820ACE7256E02C8416F001B4B alemente7
143,610,963 *0DC95ED552723993C7FF474C6FA8E19ADDA52BCA 1.sed-protokolle
143,610,964 *0DC9B80F535AD9FBF0BBB77043730B9C75CBF030 1-sitaatteineen
143,610,965 *0DC225C6F13FC1018B37737EA2310AFEB93FE5AB alexisvaldovinos
143,610,966 *0DC1A587D365EBFA72E3FE398CF3E9BEBDDA0876 1STAENDERS
143,610,967 *0DCAE0099B1D5DCA715D4DD65E2C44A544460C60 1.TEHT
143,610,968 *0DC83D3876F09ADE52315892CB60B5E7B1A6383A alfredthomaston
143,610,969 *0DC6CBBFF6E9E7E30821B75C6A3C3685A3DBC562 1.tulemahan
143,610,970 *0DCC06324EBED56B607A68B61234467D920BC64F 1.VAKUUTUSTURVANSA
143,610,971 *0DC8768B230660E217824698E82A460B00B40583 alison-veburg
143,610,972 *0DCA90C9FE2B8CCD7D57E99B889B00893F804925 2006greg
143,610,973 *0DC320D5AF05CC7F70BC92CB44984F3139F767C5 20hingl
143,610,974 *0DC70C6A525936AAC1FB92797B19B7412EDF0838 21.12.2007
143,610,975 *0DC18584EC8E2C761DC84819D67685A3D62102F5 ALPHONSE.HESTERLY
143,610,976 *0DC67BC69D625936374824E7E53328EE12CC091A ALP-KALAYCIOGLU
143,610,977 *0DC55C0AF32A7B984D9B5A4255F6D6D1CF358B94 ALTTALMENDISTR
143,610,978 *0DCFC7DAE6B9B32D42B351882ABB2934C68E0D8A ALVIN.MAGADAN
143,610,979 *0DC53C24471C479D555F69B618B830D2FDCD614D AM7$D
143,610,980 *0DC961035FB567A2CA3E81E563507F686465BF57 22RIKSA
143,610,981 *0DC0D3FF911410A9AE07DD52CCEE8D77905EAC76 AMADOHOHAIA
143,610,982 *0DC5D8CF33CC338562CA79AE3745DBB181B7B89E amadolittler
143,610,983 *0DCF4FE6744DBE5D0FB16A1DE0BFA86B03CCE77B 234227 vapun-aikoihin-lumet-nimitt
143,610,984 *0DCBB40D717F0FD60C746BE6BDAF4C14FF4A595A 2356553 die kredite haben eine laufzeit von bis zu zehn jahren
143,610,985 *0DCDE3D12F2B3113127CBA1A9E25E4B27BAF0957 2364602 WAR-JA-AUCH-NUR-SO-EIN-GEDANKE-.
143,610,986 *0DC295DD3E6B7C4233D5496A12819093AD5743E6 25 DE NOVEMBRE
143,610,987 *0DC7C16D5D5CEE3432E11B342669AB827FEC75B0 275172 dannkameszurjuryentscheidung.
143,610,988 *0DCB807CB44BFCDD8FCB4AE6A7D2EC88B54675E4 am/pm-(simian-remix)
143,610,989 *0DC3F05B8B0A99932041246AE2806AD1A721C15A AMQVC
143,610,990 *0DC1CAADBC62C5D8DBC1CBA845D07C9715928645 ANAËLLE
143,610,991 *0DC9C28028D4AAAA8729B60E76215F19453EEB65 ANA-TRAIL
143,610,992 *0DCAB77D73793A248261CDF5C6805FEA287398AE ANDREELISONDO
143,610,993 *0DC6447FED400CB40E49F7714291E586B2B9FFD1 2GIFPFELTREFFEN
143,610,994 *0DC7CDBF66D9CC134CFAF41D96951DC41696ED08 2KROEZELD
143,610,995 *0DC6DF3C7086BC876D5D5CB4A8DD07A8ADAD8BE9 2-LINTUTARHALTA
143,610,996 *0DCFAD25AA3E8AEBE4D787A9E018F876588A7C82 2moqueras
143,610,997 *0DC938C5B54D47EB688454A549405313ABF373A5 2 QUOTIERUNGSMODELL
143,610,998 *0DCA3B82D4D02897C77BC4B49651F881353DD7E0 ANGELOWYLER
143,610,999 *0DCC7C51D903634FE9A6A4351FBA283E99987E58 38748-ob
143,611,000 *0DC195D5F48F65CFBF7EE49CFFDDFE530CD14AD4 399scarlett
143,611,001 *0DC5F8A75F780432D0943343A05B522FD836806A ANTHONY.LANNI
143,611,002 *0DC0E50EE99EFB78A2ACC165FFCE9CFC20851F78 antoncraun
143,611,003 *0DC85B707405589453A9FF6A95A923C894ADA883 ANTONIA.SOLDAVINI
143,611,004 *0DCB62B70637667A31873CF44CD09DFC90B85EDE 3LTAAA
143,611,005 *0DC91169A750D0243A4F724668349EA3093FA7D1 ANUJESHS
143,611,006 *0DCEBAF57B61DCEE3EB619B6ABA51A51A99D528B 3NONCATEGORICALLY
143,611,007 *0DC06DCC246E67CF3A9241C2E55DF3B95F2A3F9F a-o0f
143,611,008 *0DC8CD6016C54CC6D71D18085B45EF3C13239A19 3) ~ ~ ~ :P
143,611,009 *0DC93F39C2528C4C635E4B4FE405149D3576879A aoq6t
143,611,010 *0DC0FD1E67904E5F716472B5DE0489EC12C04654 AOQPQ
143,611,011 *0DC6AAE2BA530C86864A087F4893A8CF79B42DEB 3SUTTINEE
143,611,012 *0DCA2AB92D92724DF052C0FA5EE1082E0A19BF4B APC5
143,611,013 *0DCC5DFAEFA9798222D6C17E447F0F133E8AE553 3thebob2
143,611,014 *0DC6BE5395CEC32106CBD3B4DBE86A02BCBEB9BD apfa
143,611,015 *0DCAD3E2C82AFC396DA06816E061557CE5858C03 3-VIRUSTYPEN
143,611,016 *0DCD7FD22F88527CA9B46A9059EC757CDBA18573 3XC1U$IVITY
143,611,017 *0DC513D1BB9566CD3A0BD1BAC17080DC5309CFC1 aqis
143,611,018 *0DCE36A801C8E5B84F921283D6258D8AD6F62274 Ar2i
143,611,019 *0DCC98E00DAFC5C60F840486966FBDA03999A308 47021Q2
143,611,020 *0DCB4C272CC53D8049D4961866DB72D413621AF3 486beau
143,611,021 *0DC3B44CAF4DA8F94454051A020FDE2561A99806 ARDENASCENZO
143,611,022 *0DCD4C3E36102E98A4D3A5C901F21F35AD91F632 4D1P35C3NT
143,611,023 *0DCF323C738DB95625E56FA659D930718B880E5B arielbergevin
143,611,024 *0DC2BCA897778D2C949439C130644ACFD248C955 4ETSIUKLA
143,611,025 *0DC20BAE8868405071FDE9A724E059F7182DE934 4-HYDROGEOLOGISCH
143,611,026 *0DCB00EB1B25C528CD95E8237AD21F428B1CB96D ARMANDO.INGUARDSEN
143,611,027 *0DC38450C1521B3B9F815F5834825A45879EE367 armandoseti
143,611,028 *0DCDC2B0D2055640E2DC342957DFE3D1202E5411 ARRONSCHENKER
143,611,029 *0DC7C7D04B1DDA8751CE435AD60F2895DA2CFAEC 4MONKEES
143,611,030 *0DC2B8FD083F2233FE45EB4ED515B87C2A785691 arturowebbs
143,611,031 *0DCFA68D4EC376CD054CF7F6486139F820B4AFC7 ARV8
143,611,032 *0DC81B2ED4792C35AC3B16A62FAF0987E3E965DD A;RWZ
143,611,033 *0DCFD8902940831B344FA0BFAAD6135E9307BD9B 4SIARENIM
143,611,034 *0DC822D50D0E9E0DF0615D020CFA7E827C265C06 AS796
143,611,035 *0DC7D9AA1E767E12C2F96579574E9086FD32F6D3 4SOSPIRASTI
143,611,036 *0DCFE3AC3C1442DE620096DCEBCF3D038836FEF1 4SRENAHSU
143,611,037 *0DCCAE4D1009D94D40D00FF4C950BB5218F9767C 4TNORERIP
143,611,038 *0DCF14BE3EAD5CE34B3BB8C67FF9723119D5D27A 4WERTERHALTENDE
143,611,039 *0DC96743C11AC46A669E7F4168DB8003C3DD707E 535---I-am-Trusting-Thee-Lord-Jesus
143,611,040 *0DC5011BFA96FE0D22735C9C07CD3574F0A3DB9D athertonhotelnetwww
143,611,041 *0DC39E39594BD965380F2B4F50CDCC1B6096C8FE [email protected]
143,611,042 *0DCDA8D1CD57B5E3E4AAF47207F502B5CB08F304 ATNQV
143,611,043 *0DCF24E2B8321C0B29B95E229E577A6315A39545 attaccale4
143,611,044 *0DC4BF2C81E82DE20E8A1C0EBAB13AC61FD49001 AT"UH
143,611,045 *0DC0E392512F0CC04E5AF20576D20462A375CAA7 AUGUST.CHAMPEAU
143,611,046 *0DC70EF8DDA716852CCFFA934783A5D042E28A18 AUGUST.LAMIA
143,611,047 *0DC45DF2084E06D60609F6CAED14036F4CFEE0E8 5finanzkapital
143,611,048 *0DCE944982AEBD31320BC0B9BD3D631F1FFA88BA 5HISTOMUM
143,611,049 *0DCF62A8309FF828C4918F56BF184DCF8E5B609D 5ILLMOUNDBSW
143,611,050 *0DCA627C7311B7D6F55742CE6208A28D6FDD1B91 A.URR
143,611,051 *0DCCA166012FC5C326B2A798D8BF258A5F291838 „AUTONOMNÍM
143,611,052 *0DCFF6FCA4F4AC47800812D31DBA0C3EDD0BE91B 5NEBYLLI
143,611,053 *0DC9E108A4BF1CAC05F76358BC311826B5B998C7 av-t/
143,611,054 *0DC6B4926C49CD68FE09F420972CCC7A1C355DC1 5ORANGESBASKET
143,611,055 *0DC50B811E198FDFEE12DA50DDA5F9DF1603CDF6 [email protected]
143,611,056 *0DC307B38E3D2AAE5D2E9ECF73FD1DFD1B86CE40 5RHONDAJAPAN
143,611,057 *0DC34470A81CF4C5B8D0A69264E4F4C0757B1BA0 5SIAHCREH
143,611,058 *0DC4D54F4A855C843AC27C8C7F6140B0399ED838 a=yp5
143,611,059 *0DC451C757A32F2A2DD0BAF3D0F02B38C85AC8CF 5SURVEYSAMPLING
143,611,060 *0DC6558B816843281F5C0E7CF14063AA030B3D01 azt8)
143,611,061 *0DC6246B41B30B992861FECAD73FCAE1EDC38BC3 5thathome4
143,611,062 *0DC817A78DB9A071463CCBE0D9132B23505579D7 b1gn5
143,611,063 *0DC87AA333E7AA704F7452005FF233E9511D556D 63.greifenden
143,611,064 *0DCCFD76E7AD3030E75E495DEB819F37B22657F6 649068 sUreC kavramI , sUreCler yOnUnden Uretim CeSitleri
143,611,065 *0DC3EED4D3C465DAC08C6DE5B5B26F8F125111D4 b,)23
143,611,066 *0DC58D9A37C59B4A193184334B0406E8E2BE2364 b:_3
143,611,067 *0DC79B397ED4E24349CA1952251C7F3FE5196F4A b4ct3rologc
143,611,068 *0DC086AE14AB2BAC03571F05760D75B4097342B6 b4?(p
143,611,069 *0DCBA2680D64A7626B16BD188B5ACCA8F24A3E77 b!4x_
143,611,070 *0DC0A9A16C971AC5E0ABFE2DCB67ECD78E9EAF1D b78nf
143,611,071 *0DCC8D528C9549950519F32E6E5F374002702869 67B5S2JW
143,611,072 *0DC11927C01AFAC82BD68768D61AA9CCC6D61DB9 693046 sarkici , film oyuncusu
143,611,073 *0DCF39A8164C447794BC10C234EFA4652E3D53FE b,8)#
143,611,074 *0DCF2B56611ECB2C4AE94FD151DC33BCC801BF56 b8bp5
143,611,075 *0DCE4937EAA0F3E7088339277CA38899EB57D406 6ANGIOGLIOMAS
143,611,076 *0DC1FA9636A747C4461310FC9DB7C861E952B844 "6BAA
143,611,077 *0DC365E4072D759C7D25102FA8A9D04AD9F04BA1 6CLASIFICAREMOS
143,611,078 *0DCF86EF6D665DC3CFCB471C11641AF4BF7B807A 6DDEBNJIM
143,611,079 *0DCF20BA6EBE8FF5CEBAAD18249F534278DFFD42 [email protected]
143,611,080 *0DCB0DE1828D07289491A84C688729FC72ABB63A baregce
143,611,081 *0DCB8F1018F2F73345FBD1E80054EF3C4A9F49C5 BARTOBIA
143,611,082 *0DC9E67D60FB51D9BAE36C5953DE9B1B7517C8BD bartonmazzariello
143,611,083 *0DC5DA7330ECD1F4450BF049178FBF803511E4A4 6OLBERDIN
143,611,084 *0DC9C08709AB065A86E40E1334F068BFD6B652C7 6OSTARIOPHYSEA
143,611,085 *0DCAF9C90B1F06E6BDC183E470F2499A82B972B5 6PRACHCHHAADAYA
143,611,086 *0DCB6C79AC0EB771FC3F2EBEF1937E0BB7FBBF0B 6PWDCCSY
143,611,087 *0DC2BD5024855A70BEC68806C42F270A84E5BC4D 6SIARETONAIP
143,611,088 *0DC1C331F4DBD8F4950D10CDB3509A2658D90057 BCCW)
143,611,089 *0DC3E3B07462571A2ED5C82927B32EEE5941FA7E 6SSCHADEN
143,611,090 *0DC5F1B1EFCDC9BCCE2306FECB22DA1324134B5E B.ch
143,611,091 *0DCE8E9FCC37E80FC6DB4ECD7FC71084C8D29289 BC=SO
143,611,092 *0DC10ED98C9284864E3A0DC6A4E1529DFA90C611 B,D"
143,611,093 *0DCB40F173926FDCD127EE98DD177BDFC5F2DE31 BD***~0~o(>_0)
143,611,094 *0DC4A61A407A88E9F289805159878843392B1BD7 6TSICIMEL
143,611,095 *0DC776777F6EA07D79C1A87608A6385695BB2014 6vervolgklassen
143,611,096 *0DC0EF7AE10B14F98470BEB227BA27BE6A6B9AF1 6YRETARF
143,611,097 *0DCE3CDE7647BF27D0BC36D297FD213C6E3C1A61 BEAULEIF
143,611,098 *0DC36A9F11109845A2FBFBA9F6D69DB8527F0810 beforedestruction
143,611,099 *0DC229CFCD7E40A4D38E96ED30B20FE6579D5436 78 BATTLEFIELDS
143,611,100 *0DC0B336C0574F82A5C567CE5A8AD25DD244838E 7ALEXANDRRED
143,611,101 *0DC78B515C5A090E1769C738E46EEE3AAFF348D0 7C8843FB-A36C-3A10-A9C8-E30381D2B470
143,611,102 *0DC2B4F2778DAEECAD276FE18ED66802531B449F BERNARD.GRUZINSKY
143,611,103 *0DC1EBB1431940B515171D9A9BBD8578E53C42FB 7CHYMENEYE
143,611,104 *0DC8377A8BF7B27A67030B016BA25C5F4B9B4C79 7COSTRUTTORE
143,611,105 *0DCE6A7092F23111FE94BE9F715AB366B81C6C50 7EIERALBUMINE
143,611,106 *0DCFE2EF7DC9FAA897EB7DAA1F00CC6CAED91907 7ERWEAVES
143,611,107 *0DCB267B80F8B421C01ACBC38E4B80ED11DC0051 be/=t
143,611,108 *0DC98F87C180A01BE4DDC68F8307EEDBB7189D31 7k0bu1g
143,611,109 *0DC8F04A45667B59AE050EFC23431157F60E8B52 b=,fc
143,611,110 *0DC4F57752916B01D2E5B221A6EEDE457EC84920 bfilaura
143,611,111 *0DCC4745A6F0D544F16B471B7DCEBF81913BB44B BGFQL
143,611,112 *0DCC9251A099A03DBDF19BD6A5933F357063AB24 bgi0%
143,611,113 *0DC87FD3F325A29063091F8BC75DD644957E5555 BHEFD
143,611,114 *0DCED161B23200CF60BCF66F7473A205A1F24980 BIAJIAN2
143,611,115 *0DC78CC90BE64E02DBE4C315BBFA508D4486FCCB 7.PERSIAN-LANGUAGE
143,611,116 *0DC1FBBD52CAD8F216E713CA994D81AEF2AA9A69 7PIPECLEANING
143,611,117 *0DC34E03CE86831B7E1065D1E26E25969A521DBF 7SNUFFYMETALLIC
143,611,118 *0DC243EC33BDE4DE8B929FDB932C4318151474A6 7STEALTHFISHING
143,611,119 *0DCF185CDAAA016A6CA6D9F01EE8B50BBF4FA30C 7WENDYJANE
143,611,120 *0DC3F40AF178579E77571ED239BC9ABBEE28F83A [email protected]
143,611,121 *0DCA57ED86958AD720E45A42935A0959AD5B0A08 BILLYNYBO
143,611,122 *0DC2E09F44EC228851528AB05CEC24C8D47DAF28 bingohorizon
143,611,123 *0DC43C4DEEE491F4E78B22616CDB507955E2203B }8{.0~.(##q
143,611,124 *0DCC2338624F25FF55B8E48FF6C8D117BAD8E0B1 BIOFAMILY3
143,611,125 *0DC7882661FD07FDFB7EDF758868BD4896DC3066 BIOWEP
143,611,126 *0DC5CF6ED982C802C8FCDDF0E7717B5BDA2D3757 BIPERRÛTÎ
143,611,127 *0DC946EC6BEBED069F86782BB18591DA385C47AC 824590 H
143,611,128 *0DC6F8D3BBFEE051049F2140EA232F4369682AC1 BIRDCAGE(DRUGIVER)
143,611,129 *0DCCFCB0317EC50EF9B29AEA98980A4DAF96EDC2 biu0w
143,611,130 *0DC53D8010A34EAFB1F04B044BA6F38F5DDA1E71 86.metsiin
143,611,131 *0DCEE65D851FF10AB21AA5B82B7388297C6FF3B3 8AFVALWERF
143,611,132 *0DCFF1E537976518F9846E82BF86A362035D2689 BJ0P
143,611,133 *0DC7616D3B1F647AA0F7FC4F99AF5696C27A6B0E B;J3P
143,611,134 *0DCE108E16BF9E33E16F9DFC722AB1AFC809F49A BJERGENESES
143,611,135 *0DC3D5E6D45972C38EF1168FCDA37E9C02FB131F 8------b~osplat!!
143,611,136 *0DC5113CB380190F99D5E86F6618E9CDB3A3D157 8BUSTER3
143,611,137 *0DCF8412012A97CA9A37F7D42DA80A5F6FB78E2E BLO_
143,611,138 *0DC00BD0D4D0CC25AD307FDB5514356F9424B2B7 8d~0~osplat!!
143,611,139 *0DC0F14DA309EBB44CEF07291B1BB3059B6FF6BA BLROY
143,611,140 *0DC20FF829CFD7335F3885FB261BA319D341DF69 BLUEBIRD1910
143,611,141 *0DC9BE05C5415DDC793C13A77B9206528F1BE7D9 blwb
143,611,142 *0DC688B15A3340AC726D442D782E243DF23F5464 B=MI
143,611,143 *0DC0E310C148A41D5B10BC2DDFF8DD6818CA46F9 BMTN6
143,611,144 *0DCB6B00175E9D5DE32279514BBDFFE409A33407 bn"ed
143,611,145 *0DC195A31D8F095BE36164C69A64DD9A4D295494 8.hardtwaldhalle
143,611,146 *0DC4D293902827F30DC4CFE3A7AD07E7D3C0DDBA 8HEMACHROSIS
143,611,147 *0DC29FA924A35B8EF013470DB3DD912F9AC3C133 BO="!
143,611,148 *0DCACFB536EC893E8B404C42D7B88F7E8E7F6C90 B#####@.~O}8{
143,611,149 *0DCEB8C78BBBF23A4A213ED69AE273669D1E1459 8mammouth
143,611,150 *0DC1B92CD684C6B59F45438DBFF6E4DF3A4A1A53 8NEJVIDITELN
143,611,151 *0DCD82A545F9651008850FD8DA762A4671DAEE0F BOFRASCHILLA
143,611,152 *0DC93F178D3FC3CB7D4C3AC891B0987C4EC8F926 8RIAITNETINEP
143,611,153 *0DCEF0FB0E675E84A1CF914695929E4473B08C64 8SHIKITAI
143,611,154 *0DCA1F5846A109A4CF0F1179DF3ABDE73E3992E5 8> `splat!!
143,611,155 *0DCAE621F4EF6B7EABBD721B25DF03CD84E8CB9B booya12
143,611,156 *0DC9BA23CCAF9B3ED65648DA90DEA5EA8A151C7C BORSRUIKER
143,611,157 *0DC081797D046A6748808EE905F167B25B8AA1FD BOSPORUS7
143,611,158 *0DCD9AE12B17B9016B4A0C05858A6359C434E9FB botjk
143,611,159 *0DCBC3BF9E5CEDF7FF1C6BAC83FA959F69CB493C 8TRIHSTHGBSW
143,611,160 *0DCF5038DA89CB5BE87EC652BD2A7882E4D400B7 BOUSSINGAULTITE
143,611,161 *0DCAC794C783E7E73F2C44CD9BAB031EC81E7F41 8YANKEESPLANET
143,611,162 *0DC099AE646F19E9BD987827B64A600629AF3396 b)pni
143,611,163 *0DC11407779CF7631CD4472294F20086C4271804 943176 TURKIYE-ISE-,-DUNYADAKI-GELISMELERI-IRDELEMIYOR-.
143,611,164 *0DC4665094BDAB924B2422DFC36EC52144A8743F bproo
143,611,165 *0DCE250F3518C6534E4B6AE06D53B1E348976B57 Bp/w
143,611,166 *0DC943BE63174A11BEE1979197C970D030D4AF45 BQINW
143,611,167 *0DC6CD139DA294F1C0F3D8E2BEF7472497D9AF16 [email protected]
143,611,168 *0DC760690C1276D3B076B0C147D4A3182910860F 9b7e8d53b5e78774a8a5abe740f444e4 rob3310
143,611,169 *0DC99ACCCA10857E8B512497686B99F40C701F63 9BSWEMPREITADAS
143,611,170 *0DC6C851EDB9A322E2F4EEC64CC505CCAE6D3780 9DORNITA
143,611,171 *0DCA723CFB898A00395CBA19F142D3088DC370E1 BRENTADAS
143,611,172 *0DC2CD1A8DB9A113F132B999676D3FFD4F87110F BRENTON.SEARLE
143,611,173 *0DC050D6362AEF4278B567929AD3F88DA60CE1C2 BRIAN.CARDOSO
143,611,174 *0DCC7C47A30226BB9CE75C441C4AD6163124D27F 9HKJERRING
143,611,175 *0DC705BBBD6C6437669499FBD3657B4B423A2309 9IENGLING
143,611,176 *0DC31C3DFC2B1A1813C37D5DBFA96BF2B2CDC5B1 9INVERWAHRLOSENED
143,611,177 *0DC6BB58A26C9EC1225E3A8C707E74B336C3A330 [email protected]
143,611,178 *0DCDF57BFC4D22AB4DD222041943C4A1CCC4286C 9MOOMOOJUDY
143,611,179 *0DC4AD85ACC5F6879EDCA56AD41B3E41D45D05D4 9NENASTANJENE
143,611,180 *0DCC587F192116A2F873124F06817AAD985E1BC2 br;vu
143,611,181 *0DCB125B9F6F527B56940C72C9033B8AAAF67C04 BRYANCOTTRELL
143,611,182 *0DC58607B7C967F2992E3BB54272C9BAD48FDECE bsu9p
143,611,183 *0DCCC65378FCC175EDE82CB0E24794CFDA6595D8 9RSTENFELDBRUCK
143,611,184 *0DC2EAEAF792D29C5FC524C03A233163076B4DEC 9SMCTYMNN
143,611,185 *0DC62BE68FD757688B137BACE5CCAF761A94E19A BSWTNAUQIPBSW
143,611,186 *0DC7318D3E1027370AC82A7E5F64A2C84849F233 9SPLITTRE
143,611,187 *0DCA8692C4FAAC25C4AE59B76A841C57CC21C97F b.t6u
143,611,188 *0DCF9C0DC73DFA336D12D96D2D2DE7E26D939C77 bthe
143,611,189 *0DC13326B09E06C2CF78825BEC919F500B44DCF2 9TNETADTS
143,611,190 *0DC1F6045D01745B2BBEECD4C36E9109234A119E 9TOLANSSNALOT
143,611,191 *0DCC4A8E2D1E6B8C5970E7DFD14D5C85A2AF1EA2 BUJWE
143,611,192 *0DC40608312C0F803EC81E64267C313C5F92CB70 [email protected]
143,611,193 *0DC261E91FD54E644CC5E8571F5D918EA8E3F21B BURTONFRASCO
143,611,194 *0DC31784D6D722A69C887DF01D2D1234C29913F9 butter4589
143,611,195 *0DC9AFDC0973D45C97B45F3FF9C2720631E37716 b#v)+
143,611,196 *0DC335B628B696A19B6E940AB916C03DF2120A9E B_VR0
143,611,197 *0DC7AEB78A0C47837659050CF3CCF3647FA4A432 A0BB69
143,611,198 *0DC308932C601443A762A7F233832AF49B97ED82 BWRE8
143,611,199 *0DCFD4352D26A4F776B0F22A9673F1BAD65A133F A1107R0P35
143,611,200 *0DCF6EE075E5BDEDA7DC4A4A8DC69015D327367B [email protected]
143,611,201 *0DCF5FA49687F691322DBFC61BEF46621AEDA6C8 A29062445
143,611,202 *0DC5F21A95EA43A49F4F40E02BD759E80548AA17 BYMVD
143,611,203 *0DC32CF103E2E341A8AB42DDA9F699AD9D3BA02B b%yu.
143,611,204 *0DCF58ED2CB2AF8368266CD7E4FB489B34C62C13 a4(a
143,611,205 *0DC4B9BAA692FFD33D3DCA7078B9901839603BE8 A?6a
143,611,206 *0DC7AD854505F4BA0F577C832C626EE55B1F9D3F c14311498
143,611,207 *0DC2F0E7D3A5CEFA9374AEE2D92203F7C89BA265 C1ra
143,611,208 *0DC681E3BD924F79DE9329C626A1E5B0CA7CA100 [email protected]
143,611,209 *0DC5B2D9F5ED13BE34FEA879B7F3A7304E81BF58 a8pb&
143,611,210 *0DCA11D844911087383E90AE124C61089974F0A4 C3!R$
143,611,211 *0DC194F0865C73FBCC683A6AABAD1BBD376F7C36 C+3WO
143,611,212 *0DCB4E980740661A55C45BE98AA6C9481E341E94 C56#
143,611,213 *0DC6CFCFF0122B075C3BE7F04E0A0D624B46007A AAA*D#
143,611,214 *0DCABF36DDA117BF952D16F0E3D145289AEF1F5E c&"6i
143,611,215 *0DC0B4A1FD86EA8F782BB311BEE90A371BE13C8B C7"UU
143,611,216 *0DCD4BA1A9B3DB6F17A9A4CD5275311549502736 C8AG$
143,611,217 *0DC1A26597D398C44F22EA22A5738383543DB0BA C&8g
143,611,218 *0DC616DAC5A3AA138FD74B4FF60FDE6FB6FFCEAA CA0(8
143,611,219 *0DC76D9997919EE1B3A9B7B9D066A978756509F9 cad5
143,611,220 *0DCB9848CBDD2E8A155792D1DE71DFB159E47AFD aaanul
143,611,221 *0DC2A537A497476693AB8054A3360C16BB4F83BB CALATORREH69
143,611,222 *0DC408E67DA94C8EF852718954638A5FFE207AE5 aab1n8
143,611,223 *0DC75ABB3DD013586763C6C0B578D060CB0EF84E AAD{\W
143,611,224 *0DC17F438B7FD88BD1EE73E4F5DB8DE63D7FB804 AAE0V*
143,611,225 *0DC58EE561FA45E24765D7DB3B8A7004FF950748 aaefo+
143,611,226 *0DC28A6DC1622CF1B8A774A93A432FFC2BCA6260 CANDY-COOPER
143,611,227 *0DC1C76157A0B863B887EAC7B358C5446218ED84 aafhQ
143,611,228 *0DC2D67BE8E211CDA98CF086803120A2417F0ED5 AA$H#
143,611,229 *0DC2A0F8C431A5837468C9A33446E792E5D73935 [email protected]
143,611,230 *0DC188740B8FEA8F8F8CD85F4FB7B3E6D05C986A CAP UP
143,611,231 *0DC14F8912B3528771C9BBFF93E89C1DD6A1A607 aangspongebobsquar
143,611,232 *0DCAA2090640D24FF449849AE9E264E62A013D80 CARDAMOM2K
143,611,233 *0DCB115DD08D6018250486D54063A84431EDFE6A CARDINAL JULIAN
143,611,234 *0DC7426A83600F6DB761D900B5FE795EE173F8EF cargaran3
143,611,235 *0DC75A3F1A197DF6C803ED06C5EFCCE3A14328D8 AB99K
143,611,236 *0DC047D0CFDB59D514F7B2E03D9655D50558B149 abbygeneral5
143,611,237 *0DCEFFE7FD0FA2F2A24DBF032CF8D02F818CBA34 abcdefcolumbia4
143,611,238 *0DC01484CA5C76517B62EDF6A7BB23C1FC3CEF49 ABDAG
143,611,239 *0DCA5D5EFC6C6E7379BEE30734DC97C304767921 [email protected]
143,611,240 *0DC21ED23F1BD360E9483B5D89B365FDACC7A921 ABEDAM
143,611,241 *0DC0752AFC19E160FF958DBED39526858E81123E ABLESSOM9
143,611,242 *0DC902E7A5D75EDF14CE8DAC1D5D2A8F67349563 cb28d
143,611,243 *0DCE4F56AEC2414E3AD386673042CF1BA6F7159C CBD?-
143,611,244 *0DCCDC57DB7EA8E1C5DAF3287C23A29A126CA020 c/bgf
143,611,245 *0DC94003B4B6B1FBEC49BEE43575125EE6903ADD cbjs7
143,611,246 *0DC74919B5B341E666363BE6DA5196D0A06F06AD CbQk
143,611,247 *0DCCCD1DF6AEEBBFAC6F4344320E723441D6CBA8 abridgebetweentimeandeternity
143,611,248 *0DC12C8CD604BCC4FBCE977517B9A8F056A6E1FF abschleppenlying
143,611,249 *0DC7DBF0C241999C81E016C2C58A18B3DC867938 CCST!
143,611,250 *0DC27D87E9D50D7C76F0D539B8695B9CD2054B5C cdft:
143,611,251 *0DCF13795D192E6920622B8670A75D199D419336 a:c:h
143,611,252 *0DCFFFDE745737C4F673B9733536F936C7CEE695 cdseq
143,611,253 *0DCDCFE737A9FD8B5B41509995F692F11FDA6967 CEAFJ
143,611,254 *0DC75348D2C32C1C1E7A931CF42732FA37FD5182 [email protected]
143,611,255 *0DC8B2C088805E3C4513A68096892758FAF884A1 ad8)
143,611,256 *0DCD95DCA503AAC62044CCEFF6124F72B614512D ADALBERTOLOCKMILLER
143,611,257 *0DC6F790E2FCDFA586962AF0962694F64607228A centralesing
143,611,258 *0DCB0F28BD1412517FC697505525456E0C6DAFD0 AD#AS
143,611,259 *0DCFC6A472F5CCC778B8757AE392A950992E9EAE cesarsteube
143,611,260 *0DC4CE16EEBF93B241051F035B506D6964834A28 c!+et
143,611,261 *0DC5163D1CB8253F098C33F0450105596499CFCA c&f;&
143,611,262 *0DCBE42395A89C5889A839D8202E95F7389C0C1C AD&/M
143,611,263 *0DCB62AAEFF77AF70DAA69A651DA24FC9847531E CFHT#
143,611,264 *0DC44DFBD813830A72BB77B09CA847BA3DB3BC14 ADPENDATIS
143,611,265 *0DCC9FC326F547E3C2AC759B15689F693974DF45 adp=o
143,611,266 *0DC720EF8F8A9C712F8214016158B77B0DB7E1B6 [email protected]
143,611,267 *0DC8024AABA47BD51B97A5F04E2AFAFEE4D57E40 CFSQQ
143,611,268 *0DC47AC2A278DD0F177691D89E9CE8CED6F529A6 cfum$
143,611,269 *0DC5352C170559BF57549C637EB18664F77C5724 ADRI)
143,611,270 *0DCBF22861A529E1270E83ECB2022CC7974606A4 cgiw
143,611,271 *0DC54DB94A9ECF43D322A5CCF7ED014A1E871606 CGUO2
143,611,272 *0DCEACC3D2053AF03A05674029ABB87447EC9C48 ch2cb
143,611,273 *0DC7F88941B7B0EA339D015AC73B2DBB99D9856A ADRIFORM0
143,611,274 *0DC88DA654B8D82485262AF539FE33A22FC53F38 ADRM9
143,611,275 *0DC5F20CCB046BCF0939858E480B0FFA7070D816 ADW)$
143,611,276 *0DC0ADC932D366EBBA426323D08A52406AA95193 adxkm
143,611,277 *0DCB4CB7B4856686E6187F35BEDD19C79DABA01B A)=E&
143,611,278 *0DC7463309C9E594ADC5418922F08E66CAA2E080 AERBHTAO7
143,611,279 *0DCB0F4AB7CE481E79B3819F35C9648AAC4422C9 AESTBSW2
143,611,280 *0DCFBAC9156F7B36FBCC8A704DAE45511CF38FCA AETHTHA1
143,611,281 *0DCD794C753654DE6A3F9846F0FB7BFC2BE91D9B chaoticrecords
143,611,282 *0DCC5B3D228BB6B8A96891F3BD09C7C497AAC2BE CHARLIERIBLET
143,611,283 *0DC6519E86FC5322FFAB2D394764DBF3CDDCAA93 CHASLEPE
143,611,284 *0DC964510620B274AF760A46AD1469FEBCEB8AC6 chaunceyplotts
143,611,285 *0DC2593C58C73D5710F49E2043308327394C3D94 CHAUNCEY.YOUNIE
143,611,286 *0DC2D9EC5D2DB158F7DBD31239EFDBD2498E44C7 chechocing
143,611,287 *0DCA41D376CAE8286F71BEC8AF6955E8D9B49056 cherrys06
143,611,288 *0DC4AC644C41C130AD94BDD21EBAE4B1CED2874F CHESTERBED'S
143,611,289 *0DCC25DB37C53EB58C0ED4328485C960CD55AF22 AFTER-HOURS-(FEAT.-ABSTRACT-RUDE)
143,611,290 *0DC91C76CBB13B7E34414F6ABAD239CBEC444559 CHICOLISTO
143,611,291 *0DC7DB50D52EE4113E42171F8FAF365276261B83 AGEHW
143,611,292 *0DC05FA86E8286CBA509B8F416CC12FDA1B0AB91 AGGIP
143,611,293 *0DCE8750E44D0DDF650A70884E4E23DA59143464 CHI.STAYROOK
143,611,294 *0DCA6A2BA5B0B201F553BD897B51FB36AF729C14 CHONDRODYSPLASIES
143,611,295 *0DCB0EC01D603B2AB7DBD574D4CCA50C13984834 CHRIS.PAULIK
143,611,296 *0DC4C907FDCFC8945200908FC2C85D476D2D1060 AHMAD.BOWARD
143,611,297 *0DCA32868087C7281B6C355A0F62714C596B733A ai8f
143,611,298 *0DCD922D5E53665834DC6A26FEE237E3EE78A574 A"ICR
143,611,299 *0DCC79EF6F17ADBD6B4978D2F19D80F8525724B3 aih$q
143,611,300 *0DC340D03E7C3DF52AE5A7ECCAEBCB5B71EBB9DB ai&rp
143,611,301 *0DCF4437E284C6C0529262FC8304466061B9D358 aiu3f
143,611,302 *0DC9BA58215BE753F0F160C224C1EAC8158A75D2 city-of-miami-cemetery-dead-do-tell
143,611,303 *0DC7C275D42654F59C0CF5310B938C2ABE597ECE AKROKEN
143,611,304 *0DC63B2C1B3CB119E287D070D42A6E67B7F26F0C aktivacni7
143,611,305 *0DC5ECE4F75754F46D2BE66F1A9148BC518D38CB CJ")B
143,611,306 *0DC7CDA6E625F0AFE5CDA50E732FC690D3F4D886 CK%/1
143,611,307 *0DC55D5FEEDA57E9A8C64B5DACC55097553D1264 ckbu
143,611,308 *0DCB545747C0CDCABC5EE3228B677FA1DFA76B6F CKPH
143,611,309 *0DCAF8E38C3052A28748A704DE3215A630A1D603 ALDUTREMBLE
143,611,310 *0DC68C755755BEA05E6176209BD1FA3B91E04D0C CLAUDIO.STROTHERS
143,611,311 *0DCA8393E1D25F7E09358B166678BFF6AFBDD06A CLAYTONBAEZ
143,611,312 *0DCDE15AA4758D5CDE4EE961DD94B4D11309B4AF ALIKLINGAMAN
143,611,313 *0DC0C9AD1B4885A53A8DE28C2E2767B80835E648 CLIFTONSPLAWN
143,611,314 *0DCA35F6A9D5A936E2D184137A21E4BFC2077DE2 CLIMATOLOGIC6
143,611,315 *0DC6348942808FC5E3B65CF0AAF7655DDFE9436F ALLETUKI4
143,611,316 *0DCABF150502A457AF5651A297AA0C4EABCCEA6C CLOSE.(FEAT..DJ.BRISK)
143,611,317 *0DC26D144BE0BBC4C396CC6A47D96DB4D5AAD884 alo?m
143,611,318 *0DC0BB32306D44412CDC7767EDEAEC960B2703B2 ALONZO HARALSON
143,611,319 *0DC501363E6EB97DBD4BD149F9CD2DBB8F8BE2D1 ALPHONSOWARK
143,611,320 *0DCBAACE220F4AA300DC9D02DDE4AE6B8F282D70 CNANW
143,611,321 *0DC366D6EB6490B95A1152D2CB82120D80FB1136 [email protected]
143,611,322 *0DCB0B28E4999FBE7EDBAE02DDFB2A71AEAEED4C AMADOGALOW
143,611,323 *0DCF082AA6A311745E1C4942DDD8FDE58F0057FD coifferons
143,611,324 *0DC9C5DAE7167CC48CD4E7315313C6508E79F5D4 colegiales“
143,611,325 *0DCE0ECEF2735D846E6E86A1624D671730915647 coleopterous.,k/ou/'l/i//a/pt/@/r/@/s
143,611,326 *0DC261D2439355E74197AF0010CC6285440DE45C COLLEC+EDNE55
143,611,327 *0DC8234BE059A96A713D462529C67C960E81470C [email protected]
143,611,328 *0DCCA64FE1385CAFF4C8F2FA88ACD9560FA225B8 AMYGHOST
143,611,329 *0DC06CD17171CFBC5782C3904ED92F58C8077935 AN??
143,611,330 *0DC7522A9C9F6FA68E8BA410DD46EB6C17F3C3B0 COMMISSIONEDMUSIC/AUFTRAGSMUSIK
143,611,331 *0DC23AAF79DBD25710DAE9B273B7EF4075726D71 anakkana1
143,611,332 *0DCC2EB5BD18AF66AAF2903EC66DAB076E0C26DE ANALÉPTICAS
143,611,333 *0DC8A7E8CA109CD43EBFE74664E6F24899414A58 CONCERTOGROSSON.2ANDANTE(MOSTDEARLADY)
143,611,334 *0DC5644870A267A49C3D89DBDEF778C3985EF129 andavo2
143,611,335 *0DC3F3C729D06A983E9B3442C50FE12EA50ADAF0 [email protected]
143,611,336 *0DC4F5456FE2FDA3524E1C5AA4417F7496F47494 andrewcisowski
143,611,337 *0DCACB04081DD9C18C22661869260B836D3FE61A ANDREW.HAND
143,611,338 *0DCD235A1A1750EE748D2D6ECC20DD4C0EAA45BA ContactEntryphp
143,611,339 *0DCA66624DE9812E390C987D325D0990C8803343 Cool.Blues
143,611,340 *0DCFE53A0B8B0810FFF252F501B358FCE08DBA7C angarias0
143,611,341 *0DC8613BED6228B72DFBF86BDAD3ED6CCDC6DB3B angela1misty
143,611,342 *0DCFC41E5F38F5D412B345ADD47F4E5B0632D2A0 CORDELL.BERTHA
143,611,343 *0DCB466BD76AE6A481047D58E38BD7FBB837B221 COTERES
143,611,344 *0DC1306DC7DCBDA164D325AEC714D56DCD7A689E [email protected]
143,611,345 *0DC1CF511309E2829C1C1F0158C1035CE71FF341 COURTNEY.VARQUEZ
143,611,346 *0DCA507F2CB5C470A8DBCA74A8D4A8E6BFACB1A7 COURTSIDE3
143,611,347 *0DC22183C19C6337DD5D4AA0E1BC7AD8A14ACDEE C:\PROGRAMFILES\MICROSOFTVISUALSTUDIO9.0\VC\VCWIZARDS\APPWIZ\MFC\APPLICATION\TEMPLATES\1033\TREEVIEW.H
143,611,348 *0DC99A04E66F5E2FA59180406A02F1430EEC9359 ’anri
143,611,349 *0DC4310C4310D62513AEA65CFF37092B2CC2CF07 cqe:g
143,611,350 *0DCD4544A6A6F73451C4B8199A06C2B1B662628E cqfcq
143,611,351 *0DCA0D535D69FD8C33BC6FD6A6DB1D9BFCEB86EC antiliterates
143,611,352 *0DC6991A51DA23A967CC2AC48B02B02EEF3B2F82 c:q)v
143,611,353 *0DC9FB2AE55FA101153C601B28468B52A42179C8 CR_BA
143,611,354 *0DC9289C4F99EA09BC8E48E14C1D7FF3498A8831 anv!x
143,611,355 *0DCF5F5A659917E62BFFA1D9F6ABC04085462E97 AO7L
143,611,356 *0DC02FC8D8E47F0C4F690E8CCA137AAE9D212C24 AOLQU
143,611,357 *0DCDDF43DF73448F96660F02FA0CED95011B29B1 CU:S
143,611,358 *0DCB1395AB30AF0E270978910609B4870704F988 Cusr
143,611,359 *0DCDFF29D85CD61009B860B4E94601EB1715B0AF CVo#
143,611,360 *0DCA1E01BAD1A0F8F1959905437371AFCAAC76B9 C/V_O
143,611,361 *0DC660057B68F675FCBAF37380A064F24A998D7D CVt9
143,611,362 *0DC1930E24A90BBBB35736889EEE268FBBB24D76 [email protected]
143,611,363 *0DCDB2080ACBE1DA3C9B4E1E9ECA93726AC877D9 C.WGY
143,611,364 *0DC66308059A5195D38C0F0AFF418BAAC0099208 [email protected]
143,611,365 *0DC8D44917669BA1E9EAFD7C396D009F5499D9DE apprentissages.
143,611,366 *0DC637EA4F750C1C45CE04EAC590EE22CF44CD15 april.murillo
143,611,367 *0DC38147303DEB4531610A266716F0CC444203B1 a=pu/
143,611,368 *0DC375C9C686C0235CABE8A6EA8BD5D0AEBF8790 apyanadanh
143,611,369 *0DC29247E00184A5F7C32E22866F3B542CFCD8E7 CYDB/
143,611,370 *0DCEC41ACD8451AF3A07AA6F89AA39F8692C0D16 arepbsw7
143,611,371 *0DCEED4ED833E2FCEE0BB1E3E9577870446558AB d0;jl
143,611,372 *0DC5D808AA29532C1CA62A2B8839A09671C74C41 ARGILIO1
143,611,373 *0DCDF84B6C5E70B083C9284765AEC0C478D203DE arizmendis
143,611,374 *0DC8C1293B2F6DF6841D5F17A81E017E70776304 arlieplathe
143,611,375 *0DCB413E22E109A0424FA5D4D9E8D0C55101AE93 d%+2q
143,611,376 *0DC9E8DDDF39CD85262039C91AD9644B18238437 D41O993D
143,611,377 *0DC65C710DC67DA09C4F00BECAF00347E7020252 d+/6,
143,611,378 *0DCE8554267100145F8631D2E68390B38B850804 d6t6z
143,611,379 *0DCFA62CF306766151B49FB8BEF652D7A3D19409 D7DWR
143,611,380 *0DC8C59CA4262AF918902867E1B487EF9DCA2E9A d82g.
143,611,381 *0DCDC15030CF8A2DBFF7DE94EFF4216A3E809C41 arschkissen
143,611,382 *0DCCDC77CA03ED4DA021B57CEFBBDBEB8DB4DDA5 [email protected]
143,611,383 *0DCC529662E79A23774EA7B7B4516B1A09520C7B d!99!
143,611,384 *0DC32B85084DB253527C85400ED681DFBD4A6DAD D9FEXQY5LDJE
143,611,385 *0DCAC3671387E6256215829570FB187C99C63F44 as:5u
143,611,386 *0DC90BED0700DF91D36F5D2D2B3B722BE52FDFEB DALE.RATHER
143,611,387 *0DCD9061D7250FB3DAEE4E5CF295BC6096D763B0 Asce
143,611,388 *0DC266B20D7A9357BB03199263E2594D15C13EAC ASFFP
143,611,389 *0DC65B75BD75CF7B868710C12CDB78E201A3163D ask6e
143,611,390 *0DCE86DD0C95540DD8E0761FBC01B71FAB1F254E ast%
143,611,391 *0DCE46549E33CDC552165F8F38F58515D9B45C1B DANNIE.BUISSERETH
143,611,392 *0DC7480F68684A35E6A4C240D7EBFDBF86C7CCF8 DANNIE.FONTE
143,611,393 *0DC645B40886BB2C15085E5A0B0C281A0B1200D6 dannywintz
143,611,394 *0DCEC0C6ACEF742208FB61D268122CEE3FC96345 DANTE.BENKOSKY
143,611,395 *0DC0956D3440E10616F4214F060F40BEA086D10C DANWOOD0
143,611,396 *0DC84B76255A4A7A1522CAACE503508A236BC07F DARRELLKROEKER
143,611,397 *0DC2121DF0972BF631EA203041D8411B1EA6463C DARRYLHARRER
143,611,398 *0DC2DB0127B5BC599003A617FBA499FFA612A649 darwinstelzl
143,611,399 *0DC44FBF569653AF9830EA745D6848CCC1948276 DARYLBARCIK
143,611,400 *0DCE6426AD01A7AD5082B737552770294CE56D5B DasBeste'76'84
143,611,401 *0DC8AA6106F34550A97037719306FF25A01E0515 DAS LEBEN IST GRAUSAM
143,611,402 *0DC72B2667400DE0086EBD38F8618B2AF02233C9 DATAMEASUREMENTS
143,611,403 *0DCF2887903CA02437485906CDB90BE9EA303217 da-wn
143,611,404 *0DCD5A8C679D8DDC1322EA8A1B997D96DB3B435F dbce$
143,611,405 *0DC03187170239B77B4C80D43F477B17C23733D7 [email protected]
143,611,406 *0DC734D5DF07D4282E5D3AE65E3B2E672291383E dc17!
143,611,407 *0DC91B39A979E4FC2589C95DAA1BD41CE67C1FFA athapaskischen
143,611,408 *0DC5B612671D0CCAB5324080C7C0D8285A4E57A4 DCXYC
143,611,409 *0DC3C0BD2818583B2E6BE854EBEF1477A03ECCEE atsekabe
143,611,410 *0DC2B2EDB51F4FC3B4A1E31FD911A93BA77D2DF7 [email protected]
143,611,411 *0DCB1F90DB0A537E9FCDC1202BA0681CA4AE513C dea6
143,611,412 *0DC9D58F4ACA620E946CAF25E732040E1B2D4710 DE:F=
143,611,413 *0DC8936AF41464FCED1C6CE92196A75B573DF09C deirtsed
143,611,414 *0DC1A506DC329A709D6A57D8DEBE1D8C1F10999E D,)EK
143,611,415 *0DC35D8D64AD52ADF50AFEE8BECE9BD1A318F379 DELBERT.LEIBERTON
143,611,416 *0DCEA3B90BA2AF60344AF7AA88723B6200C9A8FE auw;g
143,611,417 *0DC9C22602B6C8C8F60512C622FBBB83E48F54A3 AVA_6
143,611,418 *0DC2784A196E209B679BD779ECFBA271BE4945D8 [email protected]
143,611,419 *0DC57CA4368F6A60A99B3C416C9F41A032376A37 avbi1
143,611,420 *0DCA25610C5002984412558393A4124FD92DB407 AVIIW
143,611,421 *0DC39118D1E16A33D15730C56F0A02FD50AE7E5C avmab
143,611,422 *0DCABD920B8CAAA61C4C94197D72B4AEB9012451 av(nh
143,611,423 *0DC277A2E1024EBE00C4138D204A36A0A5FF2DEA avventano9
143,611,424 *0DC0900E3ABA49656868818066A97CE21C2B4436 DENISE DUGGINS
143,611,425 *0DCED055E31C3FF9405E7F9FB4D2C4C28C87D454 AWAOK
143,611,426 *0DC5DBF47325AADB6C41E680F5BBD434E34E108F a-xnb
143,611,427 *0DCDA14B3AA67FFEC4A04B1EE6BEFFA0073A89AB AXUKVEMOW0
143,611,428 *0DCE22B2FD706B114835308183F815010A896F73 B000VL7VV4
143,611,429 *0DC5FFF982AD15DC6054623E829432EF4FBDE496 >B0 ~` ~` q8
143,611,430 *0DC6F6D5ED273461C04E08184B302D9E880D49ED b11k8
143,611,431 *0DCF74270D9C812303996405BE8E1938CC14CC87 DETEIGNAIENT
143,611,432 *0DC895CF95A6A276067B0C6D62E12052CB47ECE2 deurkneed2
143,611,433 *0DC3081C1290CCE4157A015C134920CD8C4124DD B2WW
143,611,434 *0DC8A1C3A7EC507911C6B3DF6C20CDEA80CB8D1A dewittmiron
143,611,435 *0DC0787835A521ED06DF5F3D3C6E2269659AF95A [email protected]
143,611,436 *0DC624D95D05CB1BA48FD751D321B0D2EFC676E2 B7/HB
143,611,437 *0DC8336D661F0F951C6CFD8BD9B25EE504C8437A dgts
143,611,438 *0DC027D7A72312C24AB543FACA0A1D62CA1F3924 B9O-(
143,611,439 *0DCFDC2080AA1269026D9FD7C73F9CD35FBCCB17 dhħ2
143,611,440 *0DC08BA7820287F35F2E93B3821E0445F9F2BF5C dhhs_
143,611,441 *0DC2DDB680EBC4958C68797AB3F56C50F5077444 BAISSE'
143,611,442 *0DCF93D5A4E592943BE4718DED451057AB13CC55 die"9
143,611,443 *0DCD541F03A20881E3C8023B67C7100D1F2AC702 DIEGO.GUAJARDO
143,611,444 *0DCCFA006B89BC1E8509040253A5DCD77EDAC9F6 die.leiden.eines.liedermachers
143,611,445 *0DCEA82216AAC07C076D4C0EA1ABF3CDA0202904 DIL32
143,611,446 *0DC4956D8CDE293DA6E07ABAFF53F438C18F8298 [email protected]
143,611,447 *0DCB72959F794C2F4D602CF228068D859670F05E discant3
143,611,448 *0DC333A1B0FCAD8C92764D556D30024824BCA6E5 DITHO
143,611,449 *0DC31BD6E0C161A100C245E2729513CABCEB68E5 dj duke
143,611,450 *0DCB06889C7F4670133CE6AE1BDEBC5FDBC62150 DJK;M
143,611,451 *0DCBA00C88DB641629D90C41C372CD06FDCD60DE BATTLE OF SHILOH
143,611,452 *0DC8DD1E45AE511C9B19731913EBB5B84914D2C9 DK3-
143,611,453 *0DC645BA99B2370186DA26B156DF8BA67E729BE1 dk3qa
143,611,454 *0DC4CA37433BF252DBA26D3807C7E61DE180E7CE [email protected]
143,611,455 *0DC33FB0596223C42A53C0039262E25038404E31 DK=V2
143,611,456 *0DC8E3B59AF3D39AB81BF5023BD643483F48AB10 D$KWW
143,611,457 *0DC0E3AE2BB2DA37FBAEAADE18D602491FA2508E dl-d
143,611,458 *0DC8EE86537921A497BEB7B7C01963AAAE0E07FB dldp9
143,611,459 *0DC42A0592FBFD911D0FA4FFE023206D21660645 dlho_
143,611,460 *0DCDB707F388715BD12ACE638DEED15A71180CCA B!CAX
143,611,461 *0DC758677D6ED0BDBDEF7CC228B641D651CA92FB BCG9A
143,611,462 *0DC024F172E06E776124AF244AF8122AAB94D339 [email protected]
143,611,463 *0DC7B46DFE8E9FDBBAF9C369A132B5DCBD5BB2A8 dm??(
143,611,464 *0DC9A1EA60B9C0AF5ED447F97FD6B262F9416701 BCKHF
143,611,465 *0DC2D90F50C53FD31BDCBCA5D472ECD1E6DD1910 bc+q5
143,611,466 *0DCC9A13B48BE28C35EB1669BF530B9DB0EAB8D7 bcrgzsbw6irujdy
143,611,467 *0DC470D6D00F1021F8657A30F796B163AC5BB20B [email protected]
143,611,468 *0DC601DAEEB2806FC74A51BA9A61733AABD10F8E bdd6a
143,611,469 *0DCFFEED38FE9149014407DBBF33B0B94695A97E [email protected]
143,611,470 *0DCBE8FE5025430AB2FA8E0888B2DD52E54A61B0 BDH)Z
143,611,471 *0DC241C05E3CC3FFE4588F590CF77C5C4B0CFEEC DNWDNSP4
143,611,472 *0DC9985B8E1472AC8BA8FBC401E07540B2452B0F BEAVISVALHALLA
143,611,473 *0DC09BB1C3A68CDEF29129692919C762316B4018 beckyhullett
143,611,474 *0DC962C1BD83C912A500457B7B09FE2F7977BC2F bec;v
143,611,475 *0DC57CC20CF6408BA70C629B21078A04F50015C8 dod3c4sty
143,611,476 *0DCB43291B5D0774518D27AC4A9A0BE31448FCA7 begqb
143,611,477 *0DC27A559BCD2462F65625C146A33A193892C824 BEG.STEAL.BORROW
143,611,478 *0DCACE187A4AC429AFE248570E4AC389DF116AFA DOMINICYECK
143,611,479 *0DCB9DA2DFDF6497F6128CE92DB097737E886BFF DOMV
143,611,480 *0DC166C361FFDA5FDF312105FB1D7991506CA460 beis2
143,611,481 *0DC669B24CAB73A58479AF00873D5FFD8493163C BEKORT5
143,611,482 *0DC09E5C98D7B79D2CC22E3509E8D859C4D6C7C8 [email protected]
143,611,483 *0DC831D26DF13E922B01E5A878560B7C82DD065E belle-(feat.-laurent-brunetti)
143,611,484 *0DC7DF79DBB26F6EDF93B09872CA50AE2732CCB9 below.the.baleful.star
143,611,485 *0DCB74D411F5A95EF46EC95348E081BA2D5151DC bentonpapka
143,611,486 *0DCA4609F8E73349543C80864C833E7AE5820543 berjonneau
143,611,487 *0DC34EB1CFCA03CC7AD42B1046CF855B3B38BB46 Don't-Get-Lippy-With-Me
143,611,488 *0DC28547256828E39A16C41563378EC7D315F44B bestuif.
143,611,489 *0DC0D602F1C5ECE4ED9316E237D4A96514E8C817 BEUE
143,611,490 *0DC40A3497A9C5DA81B51AB894D0DA2233D082FD douglasswielgus
143,611,491 *0DCF2FD0B6E9A56F4DC95F92488A940C801577AE BEVRACHTS9
143,611,492 *0DCCB2BC4FC0261DBEFF442AAB57EDCAC1E9676A BFD3%
143,611,493 *0DCD21DAEB675F80550FE55FD8B986CF97786ED5 D"P5Z
143,611,494 *0DC224B395DD3E52566053159A83499C9F00A154 [email protected]
143,611,495 *0DCBFDC0380BDB8C308FDE91B4B61C83242000B6 BF_U,
143,611,496 *0DC64AB93132D3A78B20FDC29E3EABD4CC8B281A b;g&2
143,611,497 *0DCA0C2F7E039440124E4351D8DA37A44B6F852F b_gop
143,611,498 *0DC101B4B8C5C4B3BF353884C5178F18C4187CD8 dqki
143,611,499 *0DC69C61DED819EB6612DBF3DD782425F1EF09E6 bg&z(
143,611,500 *0DCD151D224179789FCAF2659A5823BB5D902865 D+R#?
143,611,501 *0DCDFD9D1AD3455EB03FCFEA292C11C09AE830E6 BHEFD
143,611,502 *0DCED161B23200CF60BCF66F7473A205A1F24980 bh!#m
143,611,503 *0DCBC9A469BBBB360186F17F24E59B57DF0A6752 DREWBELTS
143,611,504 *0DCCF7B85B72F53D6290D97E2A319D63E985B3B8 DREW.KAHAL
143,611,505 *0DC889C4BE68C5A970E1FB84E834551F3A3DD2FE driblets
143,611,506 *0DC43D2221F783679E953EC60705FB2BCB33BAB4 DROGFÜGGŐSÉGÉT
143,611,507 *0DC8F4848FDAC3A986C9461EB675E6264607A4F7 DRP&-
143,611,508 *0DC338E6CDC5E7A8C33ECCC83AFE1CBE3EEF8EF9 DRPEPSTER&SASSION
143,611,509 *0DCB99ECFA5C356862AB70B2A8FF9E3E0646EFF9 bianka-gomez
143,611,510 *0DCACEA46B251ADA2F4606FA4286D414A07D900D [email protected]
143,611,511 *0DCCEFAC3F1357F872F7206ADCFF5580D6EDDC5C biien
143,611,512 *0DC5834AD998E1D693AC21762A48A41D6A75A356 billiemattila
143,611,513 *0DCACF72BA2358306C078C6B17AD92BC048BB8D8 d?sx3
143,611,514 *0DCDE3C6424FC18908460290E50DCE505CD47776 dt:(2
143,611,515 *0DC5E78FAE585D15D6911F9713F8F94E8940D9D9 bjv4&
143,611,516 *0DC2467301A01361C2B30E72D03E3EA47C844D5E duitv
143,611,517 *0DCC24A46421EF51F45039226C301563E5C740E2 b:ku_
143,611,518 *0DCFB74CF972AFD4B361394CFC62CBC2F02FF3DF B"L47
143,611,519 *0DC545E4A23E73219AA5F2AF61E413A259E6956D blwo?
143,611,520 *0DC31B05BFB3BAF338196B557FD3019BC8E36AD9 DWAYNE.MCGLATHERY
143,611,521 *0DC2BAE8420C6DAF3ACB0638D519E7565B76C67A DWIGHTRYBACKI
143,611,522 *0DC185FA8565E2D20988A6C0EED59B0F54FF3FEE dwpid
143,611,523 *0DCED596D77FC1B50ED9A7DD05271519A352DE82 dxjyw
143,611,524 *0DCE6972EAAC51AD323A453767D5C527E8F1B8B8 bod7d
143,611,525 *0DC83B934BFD6A334326A2C5FAB37E941488DE54 BOGROSE6
143,611,526 *0DC680E05526EEE77934237F2114CC8CBB2FE94E boledley
143,611,527 *0DC325135866C907604B649A227925DB07C457ED bonefas2
143,611,528 *0DC9BD86DF38550F3E8F600DF13BE8C4FCB8C500 EA3A23A14F7C6F33E4751A492A64A985BF603494
143,611,529 *0DCF56125CB4C486D4D50F1D9BFBC36DF9A78DB8 BORISSCHNOKE
143,611,530 *0DC428F749D395666161AE09F772F6E4B1437B21 bowersville8
143,611,531 *0DCF8423F6E84A75783A55C8E06D68D1C1B01EA6 BOX.
143,611,532 *0DCA8DC3A0A8EAA063074F71D6320625FC047924 B==p~0~o-Splat!!
143,611,533 *0DC56A2B89618291B186DB9CEE7ACA64A0411948 BPPD_
143,611,534 *0DCA07521D775B33158ED2F29E243EC985F9655B edj%s
143,611,535 *0DC7A546200F48BE5D4EF7A6380844ED1E66EB2C edp:c
143,611,536 *0DCA2B7A562C49B5F71F4388F04389A8CF730505 BRADFORDTHORNER
143,611,537 *0DC4B95D2858EF1F240C393819A79C532BEAB63B BRANDEN.GAFANHA
143,611,538 *0DC5AE4BFC14F8FEA91989393A7FEAC985A21F08 edwert
143,611,539 *0DC1F5BF47E7B5A08BA28E00632987F297E1CE32 ee,7.
143,611,540 *0DCA939793FCD38E095A024C9F015BDCB527153E BRENDON.TSHUDY
143,611,541 *0DCC46BC1EFC34E1C296B6D7662E00D4F1442C55 BRENTON.IOLI
143,611,542 *0DC7D45AF60F3C8F656BEADC62097C07932429C1 briankaatz
143,611,543 *0DC09D0B32FEE554CDC0A490362D3879DB0E0A82 brittany-hurts
143,611,544 *0DCAA2F913AFE8262DB1CBB0328248323C70CF7D brkh7
143,611,545 *0DC61F1B9E343DA097D6E63F7940BE52F340019F BROADWAY QUARTET
143,611,546 *0DC2D07B8A013AFF64B3F30A5B69553AE849CD0A broderickvarden
143,611,547 *0DCB3BC44EB29F0AE3FC320AEC9E41D8A8A4E238 EGRAVILLONNER7
143,611,548 *0DC0BCF94FF91FFA6DA2FDECAF4636DDADE958FC BROOKLYN.HARVEY
143,611,549 *0DC8D842C421E08D6D2F8FEBA1227650F0344600 BROOKSWISCHMEYER
143,611,550 *0DCBD2990C9A28B769048507C99C5D62EC8F6060 ehas8
143,611,551 *0DC74B5C5BEE743C649F4C4413FB04FD4608DD56 BRYANSYNDERGAARD
143,611,552 *0DC2981BF3056D94A4A01114F26F21C45703433C EKZ;
143,611,553 *0DC69DC930F03F9DA5EF6BA6A64302A415243BC9 ELDENBULWINKLE
143,611,554 *0DCB68826AF084A6156A260855A971DE4A0C6ACE ELDEN.FENNIMORE
143,611,555 *0DC021BCF8BA49368781A8012D2E4EAD583D8263 EL.HOMBRE.QUE.VINO.DEL.MAR
143,611,556 *0DCEBF68F25565748C9479EA9DE92384A5EDBA96 ELIBRODHEAD
143,611,557 *0DCEEDAE88EB050FFD81DFD0E4F91965CC0FFFEF elishaachterhof
143,611,558 *0DC0B24699E52D2B4B2E915F63E97F5D1D0F57CC ELISHA.URIOSTE
143,611,559 *0DC145FE3A12D104A28A16A711F56D6B1E93E9CA ELMO.DYS
143,611,560 *0DCC01D8D0276AC8C01D69ADF176AB385B2B4D6B ELMO.ROZZI
143,611,561 *0DC3BD04B0661817F1362B0975C9C3B9862C99E6 ELOY.STIMMEL
143,611,562 *0DC087B348A91DAE0712182C2C9FD308D6410521 eloyxie
143,611,563 *0DC77A121EE5C746DF05B1F30C686552A15DAD4E E|M:
143,611,564 *0DC2D2CCC8C89D24A59808526F84166D65A6CF20 EME-"
143,611,565 *0DC47646C2F0FD24A2CB33396FB10F07176B5D8A EMERGIR5
143,611,566 *0DC8AF25A6E2615F9A24EC736E661A7F53C6FB0A emmanueliacono
143,611,567 *0DC085BEEC5C4F21F0F44F69E44D6835E67CAF1F EMMERYN1
143,611,568 *0DC4DEF342FD3CF68FAEE4A05181FFF9A3640D87 bsii)
143,611,569 *0DCC8EFA3F1F5739B982A30F8C279F5BDF531A5D bspc?
143,611,570 *0DC5EA4D0985284C06C9E81B1C37080A446D4404 bszm7
143,611,571 *0DCB59FC441B75D96010475FD143D06462A2373D [email protected]
143,611,572 *0DC62851A386B8E445BFB4F1C6ADF2EF173C1161 BUDDYCUMMING
143,611,573 *0DCA832C201D7B69DBEFC052D3B4143F005ED534 budisti
143,611,574 *0DCBE282228235CE68AFD9CE4FCDD63FAE103AAA BURTON.FISHBECK
143,611,575 *0DC401649391BC78329389727A818A4058A6C2B5 BUU;
143,611,576 *0DCD2A5C876102EC72DD628C564C70ED1B571631 buv7=
143,611,577 *0DCE9515611D4BF7B7EB55B99A59C2CF9655C299 buyer-man-street
143,611,578 *0DC6770329870F40C0EB366AE9735A621DF27842 bv.e6
143,611,579 *0DC9B13EFE7DDBD816DEE5993225E4349A2524CC bvge"
143,611,580 *0DC1B829CFC09BAD6979FFF8FDE85F5C73A2765A bviy
143,611,581 *0DC8C558D180195E887B8645F3A1FDF0C70A8026 bvm=b
143,611,582 *0DC806321AB51796D24B70E40B39F01137FBEC7A bv+mn
143,611,583 *0DCF7E8B94D56A6B50457A577CEB0FE7A3CCDDCF bw$h(
143,611,584 *0DC4B24D06E6055D8BAEFFE4731B5591DE0F53BD BWHY"
143,611,585 *0DCD5223D2C2B8D570CC5561ED37CDC10F907C85 BW,PI
143,611,586 *0DC5729D9AB91FB50E89B9F8553C17DBBE27037F BWUIU
143,611,587 *0DC0F51B8F6D8269584EF88B5BCE663A0E3473C7 C0;T0
143,611,588 *0DCFC01A6E50847229784E638D6540C4A6CDB670 c1au?
143,611,589 *0DC54CD2E1E02373BBFE1B2E2682967343C37A76 C1K)D
143,611,590 *0DC126F8391192002F02EDA205A7564DD073428D c2lvm
143,611,591 *0DC4B85F780A74870008C73AAB7C94EA4994F580 C46AN
143,611,592 *0DC7C19CF7E3385CCD8C93B29C8A6EE9263C4F03 erelpirt6
143,611,593 *0DC229AFD318907C9B837D45B781CA4A8226857E erinacorda
143,611,594 *0DC579AC381DD9702B82C35647FD94DC0063312B C6?LH
143,611,595 *0DC92E102236EF296D68DD1EB50E08E9AF341D9F C6WSR
143,611,596 *0DCFB57C35ECF0420F2809394C6CACCA84399036 [email protected]
143,611,597 *0DC3E3511BAE16D83D4BEFE560B3696D78A42FFB ERWIN.ROTTIER
143,611,598 *0DC4B10C06874E38F9F6FC8DA55E6365F231D203 CA7T
143,611,599 *0DC3CD8C85BEA0CF3AB4F1F6443311A089EE9D3B CACICARSEIA1234
143,611,600 *0DC4EB5E08D4AF9D2418F144B9CA065F66D585AC esp-disk
143,611,601 *0DC481EBEB9F0FE07FD1203F69EADAA1BAE855FB [email protected]
143,611,602 *0DC855C4A9D880CAAD62EB2EA6DB498AB7B7473C ESTEBANHARVEY
143,611,603 *0DCEA5114692EFC074BE8598D66CE6195A8A3073 calvin-flournoy
143,611,604 *0DCFD18935BF2576344EBC1E16A4136424C258E6 etilenima9
143,611,605 *0DCA8B952C9ED0F1B57F9F2CFE9F12EE4809C66B C/AO:
143,611,606 *0DC12B83CDC0CD848225035527B3BF1707B2D420 EUTCON
143,611,607 *0DC89A1C8A2D343F34969DF3C61444EB240553AC everettemaclaughlin
143,611,608 *0DCFF5BF5331D8C5687957C2D3828CE1CB14AACC CARLO.SJOLUND
143,611,609 *0DCE0200FFCFA0EF2C55504B4192131165A1F82F e)vq
143,611,610 *0DCB961E20CEE8CE7FF419B34B7C7EAE17F2B9B4 EVREFFUP6
143,611,611 *0DCA4FFE2E0F0805A6E181A8394A4106CB9EF4B0 ex-athletic
143,611,612 *0DC4964B648CE7AA13163F1F70DA3650FDAB2A06 [email protected]
143,611,613 *0DC80815F23A52973E881FE271A5960E9C5130EF carriegrissom
143,611,614 *0DC8EB7068BB38E7CBFEA522961351B4D563BF10 [email protected]
143,611,615 *0DCB98F7EC03857D316D5D75D9CD6259F2A263BC EZVU
143,611,616 *0DC64137F2A84C8911089E36757AA48D40BF9137 catgreg2
143,611,617 *0DCF1623E204F52FAFED95AD1E7991FB7A364F90 f477ie5
143,611,618 *0DCC46AF1D466D68F47824EC42DAF732075D3B86 f4milist3
143,611,619 *0DC98962490167995CE47FCB8CB6A8CB66C4E892 FACESIII
143,611,620 *0DC2E70FB0C22B0263696B64D71FA1A8582C0F5F FALEELM
143,611,621 *0DCBAB6C4AAB01A1917A9E31D9D3DC887C60FEA8 [email protected]
143,611,622 *0DC91EBAC01976D028F044CBC43712EAE260E307 [email protected]
143,611,623 *0DCF81CC0AC39B7789B130B912B11F7334CEE4B4 [email protected]
143,611,624 *0DCCDFBE65DD0469DCBA4ED6252FA44967B61D08 faustinoshildneck
143,611,625 *0DC00F8204FE8A6DBF566883BAC81779B1E1A357 CCNW3
143,611,626 *0DC00526D3D89ABA67A695E98D699F02CC40D14A CCOMPESTINE
143,611,627 *0DC848C01655997447DAF31B46CF191BDFC946DA favor.voiceofall
143,611,628 *0DC17F19388153C9E1A516753A38C3DA34228996 FCCA6E729A3E39ABA211EBDEBF9BBBD8
143,611,629 *0DCC08CB59C05539B193DBCB2E825B34844DD482 C)D"D
143,611,630 *0DCA1477857A762BC7C206C4B0B73C90C033E1D2 cd.o
143,611,631 *0DC3C39C0ACC58EA637792E45C0E4FF4DF1C9F33 fell4+!0
143,611,632 *0DC265A445999FF69F4FF81D0C64B669FE137A2B C&e#
143,611,633 *0DC1D9207C6D686A4FC230726B00BF64E9BDA3C0 FERENDI2
143,611,634 *0DC6027553FD904E87A981E153CB0906AA7935C6 CELL.S4P
143,611,635 *0DC557A37AAECCF17009659AC83889066C64D342 CEMASINICONDUCCLUJENII
143,611,636 *0DC93146B19F13C2A6466EE39FC8C99D32069620 CENNETLI
143,611,637 *0DCE0FFC8B04B4B7694655A03A896C82891FDD6C CETDI
143,611,638 *0DC3510BDCD81D8B2075EEED95E9ABC718232279 C"E%V
143,611,639 *0DCE868DB355003647C1CF2A90528E7C74049E44 c)-f-
143,611,640 *0DCFEAF5028257A3602D82F78A0278382F6C009D cfa#:
143,611,641 *0DC11808A7B30CF1B43EBED3238726F6DB38EF81 cgiw
143,611,642 *0DC54DB94A9ECF43D322A5CCF7ED014A1E871606 CGMVW
143,611,643 *0DCCAF517A8D4150FEF730D441D8BBECD76C32A5 c?+?h
143,611,644 *0DC426016511D8637B6917A495D77183F3EE13FB finerec
143,611,645 *0DC10A1B797751C21E0C991706E4CC6F1420AB6C CHETZASKUMPIKA1
143,611,646 *0DC56562D93E363581575CE33720979967CB26BC flash.(original.club.mix)
143,611,647 *0DCF702C89D783AFEDC1B0ADA5C331404799FE64 CHICKORIES.
143,611,648 *0DC7B28C462C5B7E1AE7D31A92F749A62AE12E24 FLORA160
143,611,649 *0DC566BA1E410575D75E668A71A68278F6F34D70 FLORIAN-THOMAS
143,611,650 *0DCC07E6848D2D2353DBD916D17DEFE5CCFAA987 fnsdkirke
143,611,651 *0DCD5941EC4BA1D74ADA1F924D80D6EF5C2C52DB forest.king
143,611,652 *0DC843C587C56448F01D6D967B19EF40CD45FC27 fosterbaranovic
143,611,653 *0DCB68052934AB11302B85EA50B0FED6ADE23ECE fpalin
143,611,654 *0DCC497383ECA76D9F99C7EF23A7DBB2D65D8838 FRANCISCO.EDIE
143,611,655 *0DCD2B9F81E34A3C754723C1326EA634F94203AC FREDDIE.MOORHOUSE
143,611,656 *0DC7512196B1AFA01CD5C28500DB03DB70934336 FREDERICK503
143,611,657 *0DC8777AEE639E85EF3E5F1FD91C4E416943AF88 cinditeddy1
143,611,658 *0DC6629CD4AD40B11E245F58A01D5F67DED41C4D fuckyouteresa
143,611,659 *0DC4F07CE47293501C05DC261FC558547629CB4B FUGAZIXANADU
143,611,660 *0DCD31A0250E65F5F56E49F830917E85E74AED15 [email protected]
143,611,661 *0DC8AAC91786236AA512149F5FCC3E50BCD3E61B C)JQT
143,611,662 *0DCFEC92B4866F895510147534BE83276B2014AE [email protected]
143,611,663 *0DC85B42B024B4582CC29DE6FDD50D5C7EBE9523 G+}2
143,611,664 *0DCF52729089CDFEE26BB07DFAAD8C78AABFF508 gabriel-dawodu
143,611,665 *0DCA467F7D3E1993AF65950A150D3197B167336F gads040785
143,611,666 *0DC8834CD7A1FC4BBDBA7B610C551EA64EC68139 GA-GA.ZIELONE
143,611,667 *0DCA64DC11DAA915D482E447992858B09CEC088D [email protected]
143,611,668 *0DCC270A510E014C2392BE8059CB4199AD3BBA40 [email protected]
143,611,669 *0DCDA08DF19CA92D66F534DA293D9313C082E239 GARTLEHNER
143,611,670 *0DC5A441029F29BB9A087A4A852A9A2B7A7E4621 clementegrinage
143,611,671 *0DCBCA4D06CCD0AB176A87F0B97C1ABC8749DAED GAURI-VERMA
143,611,672 *0DC83BC8C08E0221F8ED4A02CB1AFC6B7BF533B2 GAYLORD.WILDEY
143,611,673 *0DC12B96A895857CA6896306A8709219D46DB42C CLEVELANDWATKINS
143,611,674 *0DCAA35D3E1EC3706AA673A8F7FE1C590C6B9C46 gehoorga3
143,611,675 *0DC792101E296DCA9B36BDABB7792F19665D1EBB CLIFFCARMANT
143,611,676 *0DC30C9F70ADDAE30CFBEFEC22EE4F29E1B7BCC6 cligh
143,611,677 *0DC7B26794FE6726BCFCABF66119413C9197F56A CLUSTERE1
143,611,678 *0DC4B699CBA996306088C205A9C9DD33F8FAECDD CLU,U
143,611,679 *0DCB42EE9C3AD7A8B6FE88AD4E0FBA012A31E3EB CLYDETHORADE
143,611,680 *0DC7405D4011057685FAAB974E5951D9FE251DB0 cmee5
143,611,681 *0DCA49DF24A62A6EE9B3A98C5CDA55D912068700 cmio
143,611,682 *0DCB5819519BFADA6B41841054CCA7342F5079E4 cnt4i
143,611,683 *0DCD90A7654A4F37601B3C644DDA45A02C70D05F [email protected]
143,611,684 *0DCD9F7764EE11E196436167818378110847D0E7 GEORGEANNE
143,611,685 *0DC58D6EF197D52850D320C272CC574FFDA798F0 GERMANIVERSEN
143,611,686 *0DCE88821BE99029B92A0F782D138C9A99AF4D54 gezels
143,611,687 *0DCB4934A8B11D77E6F3E1F45D17230D678C39E4 cokl&
143,611,688 *0DCC7E3C7A8987BD6B77F28844CD0696A73AA8A4 GHUSTER7
143,611,689 *0DC4874EBD5978A7AFE9A25F99484A4819EDFD4A COLBYTRAVILLION
143,611,690 *0DCA9F43184F600164A0B30AA0FDF207EA83A126 COLEMANBOZA
143,611,691 *0DCC2FDECAF779B28E0B19B008E0E9652C21171D COLORBLIND
143,611,692 *0DC7ED86819A38429149310CE2B3532371F7F0E3 GLENN.BUCKLEW
143,611,693 *0DC82416FF300ED028442E1532662B4247546333 conquistador(live)
143,611,694 *0DC84C4B2F5E9D2645044160FF265A327FC2E49F gokten2
143,611,695 *0DCAC6651B4AB368F5BDB230EF180A1C991F54FB [email protected]
143,611,696 *0DCB4EDB58F7340A07E82BC85A8FDE546C7495E6 [email protected]
143,611,697 *0DC0B1CB784545F9A6D099CA9987E1D6290161AD gonzalohoagland
143,611,698 *0DC199DA24D5EAB847397B086A4DA9945F07D0B7 coquebanted
143,611,699 *0DC5E728FDF201DCE3C4D89A37078BFD8966174C GORAN.MATIJASEVIC
143,611,700 *0DC7E307243196ED48199A3014F9408177BCB24E COREYFORTUNE
143,611,701 *0DC73B0486B044DC1CB20E25DB8897908F304F51 CORTEZ.REUL
143,611,702 *0DC1C98467BB7D86D56522C5F581EFE64808FF06 cp7(4
143,611,703 *0DC2B3D4CB26100B782739C3BD7E21B48155F3AB GREGORIOJASMIN
143,611,704 *0DCBF67B556A638301FD58439DF40C6BD6E24445 gregorygeelan
143,611,705 *0DCDB13CA299367C36D60CF7658F39922719ED0B C:\PROGRAM FILES\MICROSOFT OFFICE\CLIPART\PUB60COR\TR00006_WMF
143,611,706 *0DC336CEFF33DC6104CBFF6121107812F916DF08 GRUNDFERTIGKEITEN
143,611,707 *0DC324658A9F9C7B7559AB04E86D4D4D2A52D6A1 GSYMBOL3
143,611,708 *0DC7729F070745D7CA28D7E89A3C4AB7E99E3B4A GT'S 3 (DISC 3)
143,611,709 *0DC20C7FADADC85A1F2314CE55FF9263F418C619 guerrasberberiscas
143,611,710 *0DC8E63A7A5E3B547A2E4EED1196C9F7CFF20C36 [email protected]
143,611,711 *0DC77FF2251C2AC31E8CBDF6FC01305CC905B19E h2opolomelissa
143,611,712 *0DCDA248F468A139D2B8376972C5CE1D9AEB4065 [email protected]
143,611,713 *0DC3785551F3A2E989477B0E3A0637FFDEAE88E1 cq)bd
143,611,714 *0DC682D53C66534180EE38B0A192ACFA092474F5 haroldlarsen
143,611,715 *0DCB8D4E6605444D1F4439C527FE654DA4935180 CQV1V
143,611,716 *0DCA63B6B3C35EBAC9506873C305A803AA3CF52B cr2q?
143,611,717 *0DC538362B227F0B76F868C62AD5E725D7128082 [email protected]
143,611,718 *0DCE59335C7C64E67947115E52893FAB1BA7F1C1 HARVEYKROCHMAL
143,611,719 *0DC9139558602550774051F320767E7DB64B6C61 CRIMINUS1
143,611,720 *0DCB2E9FA9E04C43925FCFC8975647F22F2E89E9 CROATIAN-UKRAINIAN
143,611,721 *0DC5F4469FEE98FF496BA59DAC59B2B5774F6143 HEAD.RUSH.B
143,611,722 *0DCB0AFDC84A085AE318D8E64443E807B2220FFD heathenskulls
143,611,723 *0DCB125CE338ACD07E1F76BE5DCFECAF061CC8AC heather.maines
143,611,724 *0DC6BAA0C9F77A0830AE05AB43961A93961BA326 HEATHGURWITZ
143,611,725 *0DCDF4DF10682E599AC5E7F3DFE5C61158054679 ct?jy
143,611,726 *0DC6F566E39A953ACB170DCB30F7A32DFB8169B3 HERSHEL.GLANZER
143,611,727 *0DC0F59B7FC11E2C02D1F4EA8CE672A509802B53 cu1ec
143,611,728 *0DC36D8C14C02B2296764C6F9CC10873BEC8AD96 CU9D7
143,611,729 *0DC65A887DB7A4D0B51A50204E9972435DF0277B CUPETHIOPIAN
143,611,730 *0DC252DAF4681DC9199AB8887B4DE1BD44D56F52 HIERERAI9
143,611,731 *0DC057A00BAE9D0A369A76BC3AD923323B61D3CD HINDUJAGRUPPE
143,611,732 *0DC70167698A18C7B23ECA0B652C38D8371C745D Cv8q
143,611,733 *0DC7AEFBBC008ED08FDFF0FF8529F3E0EAEA6C89 HNAVARATNARAJAH
143,611,734 *0DC76274DE0C3B506C06B2428A14656045F05D1D HOLLIS.FEWELL
143,611,735 *0DC4B3EFD154957EC0177568B307A516DDC2CDF2 HOLLIS.SCHERLER
143,611,736 *0DC25EAEF72432044718A8A2DB449FFE22E1E186 C/WNM
143,611,737 *0DC02D2112800C63E4C1C22573C453E1B67EF101 [email protected]
143,611,738 *0DC63D80161C2E20944EBA4BF8A48D8A9D51F45D CXMAK
143,611,739 *0DC32876E2749F46CD53C2CF6AD0367DE368F389 CYDVQ
143,611,740 *0DCD11E091CDB2F2C3CAA1ED751640C0FDAF4689 honeykite9
143,611,741 *0DC64FFB7BC9F2D7DDC9F380274AC37CFBAD780E HOUEICHUED
143,611,742 *0DCC482FCBCF8521DC4D61D2035C694AE10F5D40 d#.&
143,611,743 *0DC6AB2B6A47FDBC2484481BC03273EC78E7126A d1od?
143,611,744 *0DC56E8133D3C2E33F9A75D3BB0BA54A57D67DF7 hqva
143,611,745 *0DC642B7B2708438E177B74DDE799AC1E8063F63 d"3qn
143,611,746 *0DCF3F7A7BA303557565442E4204297B947B5D6A d4c0!7s
143,611,747 *0DCF1B5036ED0E66FDBA1222583C58BA76FF7EA6 D4G9K
143,611,748 *0DC7AA8510C1443F727FE7CA0B260A5BB72D83F9 HTTPNVL.NIST.GOVNVL3
143,611,749 *0DCBE0AA3672823EAD32925C47C06EACC0CDED22 HTTPWWWORDENSPRESI
143,611,750 *0DCADF77397B81FD0C2F812D29A73BB379C8A3EF D5Z-K
143,611,751 *0DC21471F9B4E58962CFDFA2E65EBB563548DA8F [email protected]
143,611,752 *0DC3FA9DA8F86513DA0D89018D483CF3BEC7AED7 D"$8J
143,611,753 *0DCC08EE66598595A4E7E38BEC453570A1B7C6B7 D9M8E
143,611,754 *0DC8ECE6A51698068B915BE2C7E6059A87ECBC6D D9(p
143,611,755 *0DC2C0CFA29D089EA5DA788E8713EA0818278DC8 da(a6
143,611,756 *0DCE9AB3CAA3414EC6ACD359F77EC8B18E12CBC7 DALICNIANS
143,611,757 *0DC0A8DF52694BE31C44FD25599707631A84D6D2 HUUMORIK9
143,611,758 *0DC13300A60025F6F4B297C7D02C926CB469AABA damionengert
143,611,759 *0DC42C8F22DA87181A37E11ACD71E00A0D98FCCB danandreason
143,611,760 *0DC93DB2238244B2BBA17E8E6CFF4D512E262CE4 dannabile
143,611,761 *0DCEABEBD18E8DDBB2A73D90CB98CE2AC292FF94 IAGIHSINS
143,611,762 *0DC542CCA0F04B574717AD182422431E1E880BE2 dannysperlich
143,611,763 *0DC61E60CA780A9D5E377A04DBF377042FB7DA43 iamclassroom93
143,611,764 *0DCC55B44910E5044F6A3465C42BD1EA98FDD6B1 [email protected]
143,611,765 *0DCABA11C273E3D64948F6C86CD40033260B37A8 DARRELL.BALDUS
143,611,766 *0DCF40319D04FC115D6FCE54C10FE7F7E9FE653A darrickruse
143,611,767 *0DCC49BC78A07B48346567F67B22777FB2E8F4F2 DATELO1
143,611,768 *0DCC46806CD10EE0F3D68FD9ACCEDEDD243C8A42 [email protected]
143,611,769 *0DCC5E7B9199A3B73AC52849778B8064E146242B IKKIUTI3
143,611,770 *0DCF4D5F13957FD7B175CB5F983B603B6403D228 ilkmaaaayaaj
143,611,771 *0DC0250A2464B34D91CDC194A9EBDBCDAB2D5807 DB!4!
143,611,772 *0DC9D67022BE7A9DC583370CBDACFDCF0D8EE6D4 db8+m
143,611,773 *0DC4E72498F628109D8B6015126F7E2991BF74A5 [email protected]
143,611,774 *0DCF2CB4F453C727683930894D4D308EE45885DD D#BIT
143,611,775 *0DCCF1A991FD58E2C5A57ACF926F22B3AB393399 ILOVEPOLAR78
143,611,776 *0DCAC515CE19A3696A5FFBF54325233FA054B94B DBOIW
143,611,777 *0DC413B7ED88D8BA79C0961192D0D886E2F1314B DC=ER
143,611,778 *0DCB49A16CECBAF133CDDFC8B727BE9E25D3B18A dcrgo
143,611,779 *0DCA7A7D05BC5BE30DE7131D152A798266FA8AEA iluvwinston19
143,611,780 *0DC3C760753524E2BE9399E088CB3F26FFD9F04B iman-eslami
143,611,781 *0DC718BAAA77A3762EE373F0408062253E8B40C9 imfampitsarana
143,611,782 *0DC84401B282111EE18982EE395E7D54551ABAA4 <imgsrc="graphics\mail2.gif"align=right>
143,611,783 *0DC96BBDC7C76C9E1C6E96531F1D1631287A8172 IMM3RG3R3Z
143,611,784 *0DC1B93E985454B731180344AC95FCDAC7D75216 D&EACUTE;CULASSERONS13
143,611,785 *0DC7C096247D21B05DCBD9E23E7D29CE9EDEFD4A De.Afrekening,.Volume.38
143,611,786 *0DC1FACCB8DA7FAD972A10AFFDD00FEE63914DD1 deandredruckhammer
143,611,787 *0DC0E42D507EF403A91B85009EA115B237319782 DEANDRE.REPASKY
143,611,788 *0DC5A31F6CE53C999C92BBB4556A49C5333FC252 INDIATRILLIONMARKMARKETSECONCX
143,611,789 *0DC70631EA517F1347690EE02CCC4B6ABEFEECCB infoidiot5
143,611,790 *0DC215AE9193C9038EF87C1C60AAEC9F6EF6254D INTA$ANDO
143,611,791 *0DC8354C4A160A157B2864DC99EF66EE81F2B8A0 DEBTSCOREUNCOLLECTIBLESUNFULFILLED
143,611,792 *0DCB13582128BBE9E4209E7782934D11FE5C1651 ÎNŢIGLATE
143,611,793 *0DCFB10F8361ADE85A5EE5312449397DFE8BA5CE de=c#
143,611,794 *0DC6ABF85AB80E69A9FAA94B162328C6BFFC5BE6 DEDICHERAI0
143,611,795 *0DC92F9C9788E34AB6F05576EF8FF0D588C941C8 DEE.APODACE
143,611,796 *0DCB36B780393BC5CF49BF1ACE4F03C14026085E IRAVOYER
143,611,797 *0DCBBD160F8C775F08520FAD3500850483820D5D IRRETICE6
143,611,798 *0DC063B046DA2B3F1297DD31E2FD5AE7D0FED139 irvingmozgala
143,611,799 *0DC0D85A0C4544308D567733516A99C9157F8BE1 isidrodeschaine
143,611,800 *0DCCA50184133B628BCA8130C40D60A940540AFB DENISE-LENAHAN
143,611,801 *0DC4EA3E6F91C9D650159EF65742EDF4154F0FF7 DENIS.KRISHER
143,611,802 *0DC8CC4294BA2DF4268006209FA058977B1924E6 IVAN-LEMUS
143,611,803 *0DC4AB174240D1281AEC454A7C16BBA9355682B0 IVORYWATERFIELD
143,611,804 *0DCA8A1ECBD4BDBDCC13C9CB957BA50F8C38DAEF IVTTJ?
143,611,805 *0DC3D826676698E136ED45DB6E8D54D861D2D0E3 iwaziyya
143,611,806 *0DCFDD0243FA7D771E8418633AFD55CA36522FF8 dennishorodyski
143,611,807 *0DC9A4B674C0AAA524680A7CF859E9B19C63E860 jackiefalk
143,611,808 *0DC71496A9E4A8534D6E07EDD1673A13785C5F0E jacksonborjon
143,611,809 *0DC074EDEE81A83AB8F6E90FC6E5F268615BC02C JACKSON.KASDON
143,611,810 *0DC9DCE24CA3747A4ED4CB27F840D6A556589829 JACKSONPASHEL
143,611,811 *0DC19BA58DE3E2B64DAF0854D31AF32FCF3A4F01 Jackson:'Startfromscratch.
143,611,812 *0DC563ECC2C791AA9E475160D823BAF6150A9C87 DENVERREINKE
143,611,813 *0DC29AAA7D38F04DA58733FB14EA7E30A69DD212 DEOGEDDOED
143,611,814 *0DC6A722F9AE350A4EE7C150E72C1BCE0ACA13B9 DEON.DEVINCENZO
143,611,815 *0DC91F82A7B25A759EB1C6E1914374AF7F127EA2 JACQUES.HILLAND
143,611,816 *0DCD28A0C5873F02F009515EE61D92EA42E82D59 DERRICK.CHATAGNIER
143,611,817 *0DC5E1288FE08F0CDC065F68F50EC3B8503C6A68 JAMAAL.SODE
143,611,818 *0DCDD7F04E3AA98E620445A4D062CA1157067CDD DESGRAARLHAS1
143,611,819 *0DC2D153942214A88D8455D790D5D75CB104DA45 DESMOND.DUSENBERY
143,611,820 *0DCB4DC990AC592FDB6534E2D515F89284B75348 despido6
143,611,821 *0DCD32E60B3FF4860F0C28DE9719976CE07397F7 JAME.SEEKINS
143,611,822 *0DC447364E3FD636AAF7E52E2F635E1900C908A7 DEXTER572
143,611,823 *0DC50A7165EB1513A22F0515CBB883B2B2B17833 DF31408BC9C6
143,611,824 *0DC3B4DF85AF7D3013268D2D815557696053E5D2 DFA$
143,611,825 *0DC6F7B2C5E21AB1EE5CA505270B0025B0816704 JANBALAT
143,611,826 *0DCC52DFFC2A7A43D1E66CF29A635FCDB16949A4 Dfbl
143,611,827 *0DCF34082DF17C03F32A9F5B2E98D9DADEC6F504 df!#g
143,611,828 *0DC67F32AC338A3820E19E5E57711593556AF707 jardinsbotaniquesjaponais
143,611,829 *0DCDE6A7391BC366AE92E992A39ED426BBB20138 DFTNGRNGN5
143,611,830 *0DC714948EBD56E39918798D96BCAAC2E1BDE2DA jasminka-hodzic
143,611,831 *0DCBBD47B7E86AF76F169BDA7D08401CEB803DB2 jasperdeoliveira
143,611,832 *0DCC00B14C8A82BFA4B6C5D5123F475DD6D9F017 jasperleuhring
143,611,833 *0DC1AC973373D802B9EC52B290479BC4862725AC d/goe
143,611,834 *0DCF218BDCDFF73F25765FE70706AF06F3E819FF dhh)
143,611,835 *0DCDE46075559F3A43515F3178907D64595989DB [email protected]
143,611,836 *0DCE3C11C397335B67B7DDDE221EAB1DDFA4C34F DIAMINES6
143,611,837 *0DC5B63289BA0D0B9FFF77292B1741A1192ECAFB dienststeuerung
143,611,838 *0DC03A8588142E1DB2E5DF914E0368F0950B2F92 jeffquarnstrom
143,611,839 *0DCC1C4D32A9F7A0658BFA72848C85615F5015B1 JEFFREYFEARHELLER
143,611,840 *0DCCB515DEC8AEFFC7535E638574C2BCE02EA9A9 jeffswansbrough
143,611,841 *0DC0C4282F0DD21436D9FB4012CC93216A595021 jennifer.kennaugh
143,611,842 *0DCD532A155E27B9EFB3AA919BC0794BE365DD66 d?imq
143,611,843 *0DC780F751984FB51EBDE04AAEAD57B53EB9891D dirkschlaefli
143,611,844 *0DC4C4B619F683A820F6C98825AEF494F9867F42 DIRTBATH
143,611,845 *0DC8A196687FBFCA8DDFD69FF8303E6E8BBADDEA JESSE.ZMEK
143,611,846 *0DC9323649F1B94673F0C3D4C379614C9579C348 JESSIE.RICO
143,611,847 *0DC4F68A98337A349328313E5FA3D10B6AF7095A jewelhankla
143,611,848 *0DCC2BE4990165563B67A9CB9661D7BE1B0A38E5 JEWELL.OGG
143,611,849 *0DC73F0E6D07FA5BBAAF9E6BCEBF072F7A464A57 D%K7F
143,611,850 *0DCD04FC302A80DBBE239577A2DBA244382C0024 DkNk
143,611,851 *0DCE1A7FCE203396C675B51A3F87D05C6D33C837 jillian-rennie
143,611,852 *0DCC1FAA28C35130A42D97DF942D2D048C9F87DB dku0n
143,611,853 *0DC03B552327113CA4A635B520BA0BB6218DE293 jimmy.pedro
143,611,854 *0DC08481AB634C2CE39408CBF539E2CFD6A11540 dl-d
143,611,855 *0DC8EE86537921A497BEB7B7C01963AAAE0E07FB dle7n
143,611,856 *0DCE5E159327E6DAD156D4D0343850072FD24757 jodi.berg
143,611,857 *0DC7B294CF8D045B2566E6003672B1DF1C023BC0 d:m/j
143,611,858 *0DCB36B26031C0A91320E61F7EC8882E8FDD0CB1 dm%v4
143,611,859 *0DCC3C90F460A63779F50458D0F21C39EBB9E35F dn1=b
143,611,860 *0DCC5F6CFBB3085BFD3F1D3A69F2783286AEEF75 john-larios
143,611,861 *0DCF086A8CFB8ADB52D0FCBC97769C5A2D68735C JOHN MICHAEL VASQUEZ
143,611,862 *0DCAF1B0BDA8A4C28B7CC0C1E747D574AD1AB975 Dnes.je.spr
143,611,863 *0DC5C27FBA49F1CC6B64EE6C57992283E5FA3E3A johnniewhitney
143,611,864 *0DCFF6AB22A554C95E429911E3B04A4707ABF1F8 jojo1105
143,611,865 *0DC44A93F28C8027B2B6FACF48743A4585E4E577 JONASKLENOVICH
143,611,866 *0DC9C39F05A641E510049F72C8080AA69B5BC94A DOI101074MCPM40008
143,611,867 *0DC9C4519D3F9CC912B6C782705D245A3843A9A4 DOMV
143,611,868 *0DC166C361FFDA5FDF312105FB1D7991506CA460 [email protected]
143,611,869 *0DC89E5634133C96E389FA53ED9BA84E00F128D2 [email protected]
143,611,870 *0DC56608D10F4AFC4C6AE64EBA8EC12FD9193622 DONNY.VENERE
143,611,871 *0DC58BEF8A9E00E96ED534AD3B0F0A1DD6E4961E JOSPEHKURIGER
143,611,872 *0DC2FA6CC381CAEDDB02A927585F0E3C6FFA76B0 DON'TTELLME(THUNDERPUSS'2001TRIBEAPELLA)
143,611,873 *0DC17B1F5EC8ECD6E591E150082B639CFC621EBB j)r*
143,611,874 *0DC539AF80384C263DDEDF3BAB2FA3DC4ABB192A DORCIASING
143,611,875 *0DCCD075D77C4818CFEA885E45459A2FB5AC9938 dorson4s4
143,611,876 *0DCA4294622A9509E7F47DC555836CBD29B9832B dosierspping
143,611,877 *0DC96866959F35329587F5BCECEE4C2BCDF4C66A JUBILATES.
143,611,878 *0DCDF3F7ED3E0882776C566BAA128BFC7FF8C044 julianbevelle
143,611,879 *0DC583A41628993F11CC35DBECAAFC8020D3EEA0 JUMPANDGWAANBAD
143,611,880 *0DC165D9BD9F312DCEA38C6FF398C283853BF36E jungle fever, volume 2 (mixed by bassface sascha)
143,611,881 *0DCEC167E62D5950F86238435DF5ABAD44AB85AF JUNGLEFEVER,VOLUME2(MIXEDBYBASSFACESASCHA)
143,611,882 *0DC3A7A0BF2161CD2A11B09579D3DC29C75F4385 juniorkasey
143,611,883 *0DCD6E9AEF55F6FBCE49B2B5927E3716B461E4DA just-the-way-you-are-(original-mix)
143,611,884 *0DCFEDACD868FBD4F2794812E187FD77B9F2FA9B JVDN
143,611,885 *0DC74D5C0080F4B419C91D47E0630D0CA9E6B765 k10型マーチの自然吸気エンジン
143,611,886 *0DC99DBEF83C11AC5FE6C3377F81BDB3E7A7DAF0 .DREES
143,611,887 *0DC42AC9E0B54577918218EDB1AB3E5C9D28B343 [email protected]
143,611,888 *0DCCB2E71CD905CB2715EB26159BFD0F26B31E82 DRZO
143,611,889 *0DCEBEF3DC4EC9E49B49CF333F8EFDD84A05311D Ds#!
143,611,890 *0DCE0B9FFCC7247DFAAE6D4E53D86DFA82C10E12 karllam
143,611,891 *0DC20C84A6268108555A8546C78FB5138020E44D DSFWT
143,611,892 *0DCEA0F8212B7D6DF21B74E22207762DD3FA7C7E KARRIEREMESSIG
143,611,893 *0DC761DE962BFB8B9F98E8D7DE82520AA1530720 dtkbhyjuj
143,611,894 *0DCEA859C993AAC713B0311BC6A90E6FBFD274C1 kderc
143,611,895 *0DCA6218409C2A205021330F3D04E74E0C0239F2 KELSEY.FARMER
143,611,896 *0DCCDFCFE80AA91655AFA99D15CC0C1B13F20AD3 KENDALL.HANIGAN
143,611,897 *0DCF9F9EFA579215F0A2D29AD1379CAEB82D6E5C KENDRICKSUNDEEN
143,611,898 *0DC84BB0CC8AD7DE131FECB3E52C59231ADE0C7C DUA#X
143,611,899 *0DC785D5C842FD282F5A0EAD7B51F99805FE97F7 KEVAN.COOPER
143,611,900 *0DCE549603FA4CCEF9618B5DA2AADF59D0E65D05 dueok
143,611,901 *0DCF68FEE6F1886608FE44C519DA85A08EAB2FE2 KEY.OF.KNIFE.RERUB
143,611,902 *0DCE6F2C5A0D251DF8931265316E77187D825591 dukvl
143,611,903 *0DC889CF3794D6EE295B4714739CB8F907151343 [email protected]
143,611,904 *0DC793A5B93F8BD06D2E4BCAC8F0C79BC4CDD2ED DURNOVO6
143,611,905 *0DCED581E5FD66F2BA7979A536ECCABFC59B6F04 d#w-
143,611,906 *0DCB52ED9DE23298CE06CF4545CC896705DD2B0A KIRK.SOUTER
143,611,907 *0DC227F573B22E1345A7277BDBA8C9D6023BEE58 KKDV
143,611,908 *0DC53C1CA22CCFA4C5DD515E0BBBF939DE9C090F k:L
143,611,909 *0DCCAB49C9339F58B8D9B8C0A3DED434B342E237 kleinovej
143,611,910 *0DC16CE7C08876AFACC1A026CD974A7FAB5140D4 dxfpn
143,611,911 *0DC8C1017B645F2C0CEB147028CBE8243B9BAE90 DXVN5
143,611,912 *0DC3F789FDB86D59E2D33F7C21AF14EC15BD2281 DXWDF
143,611,913 *0DCDD7FCC65E5F62A3654AA7E78F39B92D894297 DYCXF
143,611,914 *0DC2335B63AE5933B2B55134B9A4A1A72E91F921 KOLAYG
143,611,915 *0DC9BF6B5A5D279F5CD65B736C6FDAF4CF0E753C D?Z:
143,611,916 *0DC1A1BED67B0E82862EFE97212F6919FF80CED0 d(zvx
143,611,917 *0DC166AFEB4E446AF56207AC3860F9E4EABD6936 E95371
143,611,918 *0DC3CC2D1F256BB3EF1865B8407449C4E9A8CAE3 E9}G
143,611,919 *0DC95CAF62BB47EB8EA0A65312706E5EF927CC99 [email protected]
143,611,920 *0DC468517B732D970759653C34F377E1D3E575C4 KOROSTUISI
143,611,921 *0DCCD01ABBDB408819FFF0E7AE91E329BF801E52 kp"v
143,611,922 *0DCB53A458048DA48690D426A1BF059B90E0170A KRABIJZE1
143,611,923 *0DC33A170F1AB0C170B7EBCD111207BA3EA2C6CC ebqop
143,611,924 *0DC3B388F346F700702E3370AE6FE53F97FCD5A3 kris-atienza
143,611,925 *0DC3709AAC951620D279ED5EE0956B75B3489410 KRISTINA025
143,611,926 *0DC35BBD38B9EF5C36C876B821CBD0EDC69EF8C3 EDIPUS123
143,611,927 *0DC2F390FDAFF8C4447B07B70E81E8E1D48F5D2C krowtsew5
143,611,928 *0DC462327F5DB39C6DB212D98E70868966823D72 edmon.sinigayan
143,611,929 *0DC0BA3051A8B10228F8A73691ECE53E23AB716D KUKHUROBA
143,611,930 *0DC396F65483B6BAF071B1F887130409448EB6A9 EE120030
143,611,931 *0DC525357F51CFF8EF3D0D9827F137A783E4BE64 EENBLADIG1
143,611,932 *0DC93D23F6FBE088530CEB1D20801A3EA56326C5 eeqmn
143,611,933 *0DCDFC3E588022AA21950677E88B083A2A21FB83 KWHなどの計算例がある
143,611,934 *0DCB1A4B7DFC4F28928DF4EBEF74AECD166DBB4A efuetrevs
143,611,935 *0DC72C0996D0C5159759A7F866B12862E3033185 la-morana
143,611,936 *0DC28758A351B1CC92226341B0932F97887FC391 LANA CARTE
143,611,937 *0DCFF4851BC3B3B015939DD6AA4763A9B3802642 eh,4_
143,611,938 *0DC6159089D704651E3AC71AB21376E41B0F9C8B ehcnomis9
143,611,939 *0DC00D23D1118BE8F756F65DC237B2226931F1B4 EI8E
143,611,940 *0DCCB29A7CDCE10DF517EDCCED6DBB5BA0CFD429 einnetses
143,611,941 *0DCF3B99EBED63A4ED4AFBB80EFAFFFB92CF5067 EINZELBEISPIELS
143,611,942 *0DC038D79414C6E97F0B7B6E064E7E2E3F597576 larimore3
143,611,943 *0DCB65B113F4E12A335691C11E52CEE93E9B8B3D LARRYTHEBEERDRINKER/THEBANKSOFLOUGHGOWNA/GANAINM
143,611,944 *0DCA1A349D118CB849B19247329D462EDBAC2514 LAURA.CHAMPLIN
143,611,945 *0DC73255477BE47C0D1522E880A07D3DB570FAC9 elecorapped
143,611,946 *0DC9DADCBFFC0030120A9AB655205319F0D09E3F ELECTID
143,611,947 *0DCB67BB9FEEC90D61B395C74B2E636A7426AD18 LAWRENCEPAPARELLO
143,611,948 *0DC98A1D3BB4C5B3ACB9DAEE83E22CDE7E8333D3 [email protected]
143,611,949 *0DC70A5CA68B35203EA64780147D188F85290DEF ELI1N
143,611,950 *0DC521318DB4C6344E03EB1BDD6B7425DDF25D69 LEANDROEBY
143,611,951 *0DCDA9CDB78539958B10DDBE5B5006CC93FD4A5C LEE.SLEDD
143,611,952 *0DC6A4D14E72F824D8E11DAADB4AFDD0FC6F0606 LESLEYPOV
143,611,953 *0DC15E67F6F21E7D305038C16639EFC9EC7154A2 eloymcgehee
143,611,954 *0DC59D9FD8932EC4EB57466B534A57AB74AE0B11 ELPIDLA0
143,611,955 *0DC18E5F6221A99A53CDA232BA9F23A9C8CC52D2 ELROY.NASES
143,611,956 *0DC5B27102D10277A0310766F45C2BB4FD031EDE [email protected]
143,611,957 *0DC38A7F897F6E05D0437FD7D09AF04CEC5DD3A9 EMERY168
143,611,958 *0DC1DA4169848FE413455066D97E5D4B8769C064 emileshular
143,611,959 *0DCE8CF2F3B599A27F6DAD96E30FD7161570B317 EMMANUEL.RUSK
143,611,960 *0DCDB3112E35848141ABEAC42039FE5A753DB229 EMMATETZ
143,611,961 *0DCC6653D5FFBBEFB56DF27CFB0896C7092A7FD6 emmetthufstetler
143,611,962 *0DC4F64B75D65C56B05C3E4D404CAF4CFD0170FA LINDSEY.TOMER
143,611,963 *0DC063CDE4789D7B077A1FA96986DD229500451B LINWOOD.CLAS
143,611,964 *0DCB3EDBFBC662C7A9C1B4627C747D8439D40ACB $EN$4T!0N4L!$T
143,611,965 *0DC40E35A019EAF83267F12631AA83D3CCBF20F0 ENIM (PRI
143,611,966 *0DC6172F98A77EE6E1566966285DAA53BA354577 ENNOHCUO8
143,611,967 *0DC9EFA8F2F70C77F32DE77D5B61793C9366921B entestes9
143,611,968 *0DCDC7240B90B6514A7BC0BCBD1FA99CB3E57EE0 LJFLINDING
143,611,969 *0DCEB06FDEFF962E150ED0FAF46FCC95EED19E51 LM*8
143,611,970 *0DCEBFABB192D4F2EFF76926339BE410E20EECE6 lobsterrissimum
143,611,971 *0DC356C91A10AFC5AAB24801E7F8576986214CDF ERIARTXE6
143,611,972 *0DC194786A38BE91EACA25D2F71F1F9F5A9C61D1 ERIC GELMAN
143,611,973 *0DC307D597E30A313ABD3CAD2CBFFE799DECC6C2 LONGKAGLE
143,611,974 *0DCA644818C7C85F348E32BA328886D477472A62 ERICHDITUCCI
143,611,975 *0DC79574C6F846CEF296D37738E04EB4C627144E LÔRZWÎ
143,611,976 *0DC83206F111626A423A46C4A885494CFC68992E ericstudeny
143,611,977 *0DC0A37B23BB988048EE0857BE530135247D8B30 eric-trivette
143,611,978 *0DCE2C0765B9DAF23CB5698EFB3B3436DA5C04B1 ERNIE.HAUSLEIN
143,611,979 *0DCB6D4838E2C43AA08FE5E75135097413923B6C lrgandcompany:collectorsvolc23
143,611,980 *0DCE7FED5A1D611AA890CD84586047958323BE70 erwinnugen
143,611,981 *0DC3AB7627F6ECD758DAAF4FEB1AE380AAE05C54 erwinshipe
143,611,982 *0DC5CF42B3BE2112492287B1690CC7772C0D4DC3 lucasspizzirri
143,611,983 *0DC0987F0160DFD6B18F75DB5AB977D32AC67A72 luigibotcher
143,611,984 *0DC7F47F5CC3998B76864F3E0C480B058DE7417D ethanwehrly
143,611,985 *0DC652D9518DA4DAE05C624ABC2DA6E5BA0F14BF %(M
143,611,986 *0DC6DE1665EF325952198CFD0DAE01E00648E56F M0139
143,611,987 *0DCFF8EAEFC5ED283953E6641AEC0D1CD8D337D2 [email protected]
143,611,988 *0DC02EDE46911DAE176EAD3B38518C3AB9CFBE4D EVERETTIDEN
143,611,989 *0DCAD0C5572CDC4907C2B82C97EAC0CE93486F81 MAESY2630
143,611,990 *0DC69A2EA80A93A4BCF0B6C18CA1FD3FB182AB0C [email protected]
143,611,991 *0DCB7E0B6388BC52C2D03FFA67B381002CE21DB1 EZEQUIELCURRINGTON
143,611,992 *0DCEE671BD64D53A1780539C811F5009B06BD3F0 MALMEISTA
143,611,993 *0DC900EFD3DEF4E1575135AD337D8821C3FCF56B F44006
143,611,994 *0DC9EC524432DEE9A598FD52F45637BFB64E05BF F4L$3-GR4
143,611,995 *0DCBDF1590F47F9B09E5D2DC8E2001761612DB68 [email protected]$7U0U$1Y
143,611,996 *0DCFBB4ABBBB8970CCE6BA75D9C080D56D6A7B05 FAGHIURI1
143,611,997 *0DC72AF35F5EEC93A68C7E8F1357DDE6DCA3F676 fahamswal-qahtaniest|saudiarabia
143,611,998 *0DCA9650CF495C7FD48CA2126DAE4BCD79574D97 MARCELINOKNORE
143,611,999 *0DC8DE5CFA82FC56308B2EFF1990BBF4DA84FA2C [email protected]
143,612,000 *0DC8E493294A36FF58B3308AEE6A47C80F9349F0 [email protected]
143,612,001 *0DC736AB53347552F45E5893FAA4214A3C19A91C faunas?
143,612,002 *0DC84B306085D4410C9C28EB223CF60644786060 MARION.WALLING
143,612,003 *0DC67355771407A2FD257E845428E65D5AFF0155 MARVIN.VANALLER
143,612,004 *0DCCE006DEC96AAE23B145327867C8C1B60EDE41 matt-kuch
143,612,005 *0DC81F428C80FEF2174DDC8D0FB6A54F7702DAC9 MAURICIORAYNES
143,612,006 *0DC408C8377AE8DD0411CA29C07F80B4CE99B442 MAXWELL.EVERHART
143,612,007 *0DCEE31CB6955EE07C26078A6594DF340A50C232 MECHAMICKÝ
143,612,008 *0DC5C6C7508232DBC9433D59ECD9832F45A9EBFB ffofureb0
143,612,009 *0DC354F4321B4E2D5B8695DFE1B54ABEA368490A F(\G
143,612,010 *0DC4468B1D3CAABEC1E6D2A47853BF497B6D9EF4 FHTX
143,612,011 *0DC62B9CAAB5F961AEAD587A59B46E23F78E4FF4 figurene3
143,612,012 *0DCDB09AF0225DDC598781B2558C606BD82EACC2 melanie.noche
143,612,013 *0DC0B6F53084FCFF09CC234CD46563FD4D63472E [email protected]
143,612,014 *0DC1D9EB5B054D58027DC5FF37CB27BE9E0E7DB4 FKX$
143,612,015 *0DC0BB3676749D537693D39BC44FDA7F91365880 Flamboyant-(Scissor-Sisters-Silhouettes-and-Shadows-mix)
143,612,016 *0DC44C4D490770452FFE3B3A4A72AD4595A05C42 MERRILLGLINES
143,612,017 *0DC1675B7D55DDEF621A210760AFF69A320831CE MERVIN.THRILL
143,612,018 *0DC6A9DA9AD2F65FC8C30217796395010BBFC621 FLORENTINOMAYBEN
143,612,019 *0DC675EEFD7C675D39B38B9470B48DDA22F9EDA2 FLOTTAIT7
143,612,020 *0DC6D0999D5A2919BCAC9FF71280715F212C6617 FLUORID4+ED
143,612,021 *0DC0F8ECE9BDD6D221E3FB63EA43F9E61F14BD5F FN_X
143,612,022 *0DCD4B2E992C1079FCD3FAC0F270D791A2C7DF8B micaela.garzoni
143,612,023 *0DCD2B6C742558375174F77BE8041B5212EE5850 MICAHSOCORRO
143,612,024 *0DC9811B44DA36097A848D2460817B666FE18A5A MICHEAL.LAUDERBAUGH
143,612,025 *0DC0F1407DE430FBFFBCDBA54D161E6C55DA7B90 frances-de-zu
143,612,026 *0DCA26567F183D16DFF133F168B391F5F1E2A863 microsoftofficeinteropexcelxml
143,612,027 *0DCB9730AB811E9A3E51DC8EE98FACB5412D8194 FRANK.ALLEGRETTA
143,612,028 *0DC3A6DF36F0778EADF63A58F3E45D71D5B32DA8 mikelorihuela
143,612,029 *0DC3C2740C599648F995242C074B5F7278021B87 franklyngaier
143,612,030 *0DCEDA6E0C562E02204D5B91EB5E717EAB0F1189 fraser t smith
143,612,031 *0DC086ED662020ACDFF6839040BDCF62D1B4D0A5 MINHCURBOY
143,612,032 *0DC8514FB6AF3C1B54A587CBE4A3B4AA1CB0FA4E FRICKINTATIVE
143,612,033 *0DC67792A99C50A194B1ED3183FDDB28E105B259 MIRC34DIN4MO
143,612,034 *0DCFF85941B58D60FDDB2DA6C69E740EFADCC377 [email protected]
143,612,035 *0DC800889531A5ECA67BBF5B69761E0FD4D9545C FTMUSIC
143,612,036 *0DCD4E31EED9612309A55E13E2AE331E19D2B4BA fu,h
143,612,037 *0DC2F80298789E7053E2274F8BE70EE66BF79980 MIYZ
143,612,038 *0DCCDC8870B553A737ACB68DBBC69B25211318AA mjuf
143,612,039 *0DC64B53639B3EDC833F09E0E100CE9B0B5FDC1F G]?
143,612,040 *0DC960874FBC92A24A72AF245D58168E15F9B7EF g15tovfp74
143,612,041 *0DC71D71B828B45475D9722185716BC438A97386 mohamedbetz
143,612,042 *0DC82DE88BBEB7D0CCEFC157C4AB38E112A81902 MOHAMMADBUCARO
143,612,043 *0DCCAE1C5C32103FD10C38390FCF589B532358C8 moisespozniak
143,612,044 *0DC2B58DFA047A4098A80997CF5E8407945BF70B [email protected]
143,612,045 *0DC7871D1E3C928203BA27F6CAFC951E5A2AA594 GAM\
143,612,046 *0DCD58B7A2977F119880830ACCDA427426A151DA ga-no-geh
143,612,047 *0DC762385B3E60156FF1367F174009FC79BE5763 garantim5
143,612,048 *0DCDE822CA095C893B6C9BA81173A4217E3EE9D5 MONNAYERIONS
143,612,049 *0DC88929140C5DC6C653BD6BEA826031E06408A2 monoplacula
143,612,050 *0DC9B6AC3189F14E90F3532B818D9FCE9B572925 montycordoza
143,612,051 *0DCDB3EA3F8243F20CB75B9A79E115A6964E33A9 MORTONMCGAVIN
143,612,052 *0DCB21CEE78DEB3374AC8807B622FBE098714B45 GEBEDUMS
143,612,053 *0DC6BD095B7870BBAD4A87675A6F4C265C54F4BA GEENITESTILLÄ
143,612,054 *0DC5C2E2FE74E1C1A3E1AE38A210C4AE420A1EA7 MOUNTSCOPUSHEADSTONE2
143,612,055 *0DC69D7B560063DB5D9610290C58ECB443BD8283 mpsonssi6
143,612,056 *0DC277A112A4339204A339CECC59A6C16757B882 MRCOMPLETELY
143,612,057 *0DC193CF896A1BD8A102BB8CDE516D846A84C382 mstntjds8
143,612,058 *0DCD9FC3590A3F808785765B7C5D4A8FDD006C47 MTRRDSCPPING
143,612,059 *0DC509826288FFC399970B24740ACC0C75A2581B GEORGEANNE
143,612,060 *0DC58D6EF197D52850D320C272CC574FFDA798F0 MULTIELECTRON-TRANSFERS
143,612,061 *0DC3FFB57D25CB98C644BB64CA844A9FC9634167 gggagtgccc
143,612,062 *0DC927EF4D2A08530A856C40024CBB2DB71D4626 GIARON
143,612,063 *0DCE024401D80F63A35733DA0F77D04366273210 gilbertopears
143,612,064 *0DCBF5B2B7AE816536C9058250394366C38EF7FD MY OWN COUNTRY (KUNI LIVE FROM STUDIO ONE)
143,612,065 *0DC5C752BF8BBF9389C51FF11F72D57435294574 mypunkin37
143,612,066 *0DCD066D2E4CAD57CFDC51B912522AAF72002526 MYSTEWART10
143,612,067 *0DC263625A613D3003F8898BD7EABF369FF4D974 Nadine/You.Cannot.Win.(If.You.Do.Play)
143,612,068 *0DC59DD8E98969EB6BFC887311F9FED2E41F0A11 NAGLASIV
143,612,069 *0DC14C4F039E6F74CE89715E49BAB2018C68A736 NAMIENIONA
143,612,070 *0DC6C898B12F74744083C4C71FC245E2820D3390 NANNY62
143,612,071 *0DCF61BE93B348389837741ADC7E1D14A4B8A1FF glennlambeth
143,612,072 *0DC4131ADE327B3E004646C25559D32848D3B987 NATEQWAINM
143,612,073 *0DC4CA041CC115705255A2448FFD8A2A6AE22B0D NATURHÖHLE
143,612,074 *0DC9CAF1DF96B884161EEB6176861A090152BEC0 gnitaexat
143,612,075 *0DC910DED48168AE827690EAAD897B00D37F2D75 [email protected]
143,612,076 *0DC8DA8C7574AB6C062A8113A99D988209108764 navin-kumar-tripathi
143,612,077 *0DC624A0F0B9D8B6D6F98142EF317D4413868DA7 gold-32unvergesslicheerfolge
143,612,078 *0DC9284C4B12E82D44C5EA2B93E58C87D0C8AE4A NEMURENU YO NI
143,612,079 *0DCDD933F23D8D9556F47BCBE527519844D74760 GRAV73$
143,612,080 *0DCEB8EEE6A869AB0F2C1E82E91C89EE4405AF5D [email protected]
143,612,081 *0DCA788D384F888DBF25DEEB2458C88E9D309C50 [email protected]
143,612,082 *0DC83134C3D82017A3E0053C4AEA16885B54AEA7 gregallex
143,612,083 *0DC635493ACEB96A69BC86C71AA34A4F75D47F73 GREGORY.PRANGER
143,612,084 *0DC250C91FA58B9A172E118E5E046ECE801BF0C8 GREMMINER
143,612,085 *0DCDD86BBC1E959D4FAFA8CE1447C2CD501075E3 NFU-RATIONALE
143,612,086 *0DC77BF8BA36836FBB7D20E6D5803E0618496977 gromiller6
143,612,087 *0DC052BFF7F5DE6F6D937DB2B336384AF36C9259 GRUGH1227
143,612,088 *0DCF6BD2AC34D41BBA8DD348471D8609143A1C93 NICEONEGEORGE
143,612,089 *0DC37719618A3B7E01E68F561F7A6500EA9D596E [email protected]
143,612,090 *0DCEB4B89BD7916B44C12C96616C3C0E704417C1 NICK-BARRY
143,612,091 *0DC85F9AAFA21AD67F33334B4E7FB3650AD2578B NICK.CORNWALL
143,612,092 *0DC7D03C4EEAB165E233D573C61C520AAC229642 nickolasniggemann
143,612,093 *0DCA19618207F4F8D06BBA2E7042A9DC1BD4FBF5 NICKOLAS.PUGMIRE
143,612,094 *0DC6081EE90BE1B766D6C556F1A7A22C9DB36961 NICOLASCURIMAO
143,612,095 *0DC5DF5C3B6B95EB89297046474F0E98086D3B29 NICOLAS.HOHNEY
143,612,096 *0DC4E532D2B31DEFFE1094027F96DAEB815A6F77 NIGELLA.MULTIFIDA
143,612,097 *0DC138B46144E14FF5ED71ECFBA98235B5EA8EBE nina-beasley
143,612,098 *0DC5E78AFE5BC127F1D1105EBCF4648CE26D4EA9 nishant-sambyal
143,612,099 *0DC39EB2D2A59F95BDAB2D60ED3D78704CA674FE [email protected]
143,612,100 *0DC8F0758D3B8020BA9A6F2422D40ABEB3DAB6A1 GUSTAVOKRALICEK
143,612,101 *0DCDEE5D30B37AD1549E827A4AE3C3261CBF7D76 [email protected]
143,612,102 *0DC12732B2B897FBFDD02ECAA56F5AC4EC919234 gustriglia
143,612,103 *0DC665114AE3D1BEA4DD26F695244223FD58B457 NOELSE
143,612,104 *0DCDA82E80C522AB31507A46D3A5CBB911B79FB7 NORBERTOCEDILLOS
143,612,105 *0DC600E3FC6C8B62029487917CD1D784F34DB0F0 HAILAJNANDA
143,612,106 *0DCE9872A82D3C385603C8817BB30C4CBA7C381D HALIRENIUM
143,612,107 *0DC3538E6CE83C6E8727CD16212B7564A7D46F2D HANNALAJUNEN
143,612,108 *0DC6FFDC0740A586083B091A758E3F815EA4A5E3 harlanclucas
143,612,109 *0DC3A4613FA8A5A1D8587A4D9A7F7AB243D80F91 HARLAN.PRCHLIK
143,612,110 *0DC3ABE2CE2F9F42085C27D7B2C9A00AEA694496 harleyhyman
143,612,111 *0DC6583D2D347C306CB022EE823DEC45E60601F2 HASSANSTAMEY
143,612,112 *0DC23B3CD299DDCFFCA62CE1178D72782A696A88 [email protected]
143,612,113 *0DC2CA2AB8A09E846308194F359203A81C733BB1 [email protected]
143,612,114 *0DCEFD911EDDADA04EDE3B82943BB5D3ACA46B4F [email protected]
143,612,115 *0DC28D2DA2D581C91130A3D08F5B76120A0C9937 hcstidowed
143,612,116 *0DCFB8386DD40B79C3A428DDBA3ED30565FEA5BB OCTAVIO.BUSHORN
143,612,117 *0DC3486D3753F825B8B18D1E19C085B9C4CED799 HEEFOGIGGING
143,612,118 *0DCEE09E838DBE42CFB7024E50B8C91C34AF19C8 OHOM
143,612,119 *0DC9524F156777048C9C31A3DEA8D44D296968AE OLDMANDOG
143,612,120 *0DC1D48E8F2E0ADC47B678F8C400BD0B622B3FE9 herbertchangeme
143,612,121 *0DC17927CCB52FE89CA4B0CD362745A5DBB1DD4D oliviacarolina
143,612,122 *0DCBFC8274F67BB2EB196525C5E64C01A1A85D85 herutbetar
143,612,123 *0DCF69270AF88BCB9D0F109DE1DF4A2308AC90B3 HIDDENXES
143,612,124 *0DCBAB481BA2BA6BE38B23E3FC147515984E6332 hidroxilaminas
143,612,125 *0DC1CAF5020D34EA7D24F925094A62A62112DA16 OPTIKAI4
143,612,126 *0DCA573892AF7F60B115B135B4F4B7A0E08F78E2 ORATOIRE7
143,612,127 *0DC24E06B9E22E7C931D14941E8564ED3C4D27F8 ORHF
143,612,128 *0DC2A7FF1DEF660B6558F69681ED0383E6015E91 HOBERTNASCA
143,612,129 *0DC75768FFD2A73B25D0131B53F7E4982C85C684 ortonlani
143,612,130 *0DC4CC6080DC50830447AD3112F94647A0B95E9C HOFSTANDORTES
143,612,131 *0DC9C39638CDE20BB209F9624540BF9A5714FCAA otatned6
143,612,132 *0DC52D4973F2982F3423344A5BC688B210026781 OVERPLAYEDORGOVERPLAYED
143,612,133 *0DCA394F66B82D763A3C24B73AC1898A5CFC51F4 [email protected]
143,612,134 *0DC962F88A61AA706E0103F58939BEC8F2655A6C oversublime8
143,612,135 *0DCFC1A2AA80F6AAADDF416D9905594FB7090FC2 PACKERSTARTREK
143,612,136 *0DCD0A200059844992194C9F644B9CFFD4BF372A HUBERTWACKMAN
143,612,137 *0DCE491C70CE6F50BC8603438FE899510FF3DCB4 [email protected]
143,612,138 *0DC1FD6A2BE5861B45B9F67144282FAB10C326D4 hueyoler
143,612,139 *0DC61D1283E62DFF943FE20E1A8CE5AA03699FED PAIN RELIEVING
143,612,140 *0DC9089E52208A289F822E3D7C4583A029BC03DA huisvest!
143,612,141 *0DCDD0A32ED61E39448DF420855C525CF29F60C7 PALMERPELOTTE
143,612,142 *0DC266E55B331B49032FB0CB2A6ED95C012745C5 PANCOST9
143,612,143 *0DC227D13C0908E4753843AB3FCDBB40D271A49D hunvilha'enrapper
143,612,144 *0DC0FC69547B5A71D8E58FE2E8903720EB8E03B8 huresson5
143,612,145 *0DC89A6F7A46EDC68098CA0B445ED1C29EC39153 HUSTERST4
143,612,146 *0DC76D946E632638AB5533CD44F137AFA6F19109 HVERAGERDIVIEW
143,612,147 *0DC6956D565C887F4D8C9E65E9FB586163A01020 hymanroldan
143,612,148 *0DC86CEF4BE7A06C9E40F9387E96F863C48618C6 PASCALWONG
143,612,149 *0DCEE6BDD086DC1D0BEB056CE87BFB3F91D6996F pase-foral
143,612,150 *0DCD1E4D7F1F9DF11D705787B80D13F3A1CFD370 pasqualehaumesser
143,612,151 *0DCB8F9EF44BD17F9622B0FBFF8811F429AB815C patonestatecomauwww
143,612,152 *0DCD63976DF4B6CEFA0834811E9C8813045FCEDF PATRICKKUPERMAN
143,612,153 *0DC6600FDFFE6E028D0AB6DF703CE4B3F17762FE ICKLESHAMIDEN
143,612,154 *0DC68CD56D6E42ADB011B57765E6D455FE5DB785 PBOQO
143,612,155 *0DC951141CAA68618649EEDD32AC3632E137C5B6 PBRINDHA
143,612,156 *0DC265061B36407C4021BC896C7621EC58F090C2 P---D-`;)
143,612,157 *0DCC65D50D06F4BBB36BA5878FE8E76C3DD8CFDF IETERONOS
143,612,158 *0DCD82498BD9D0D78C1604717AE540E910C14B17 IF ONE HAS NO HEART, ONE CANNOT WRITE FOR THE MASSES.
143,612,159 *0DCCD02590D5D4E807D85DEED842C47562962E2A PENTHRITE2
143,612,160 *0DCB5D3B477B8DC236314BD3BE930E79818EA439 PERRY.GICZEWSKI
143,612,161 *0DCCA436D8BD2F711AC570AB583EEA748663689D PERUCCI123
143,612,162 *0DC0D4E17E365BC35056CB5BF58AC5FAA5DF5246 I.Know.(feat..Fallon)
143,612,163 *0DC127894D058B5DD249486B51D41FB5ECD7F4A7 Pe-sub-norii-de-h
143,612,164 *0DC28C1F280C9EA5EFF1B268E7CC25E05DF70A75 PETE4999MORRISON
143,612,165 *0DCEEBDE80FE7A9F2F406B3C932EA14FFE06D03E PIANO-CONCERTOS-(LONDON-SYMPHONIC-ORCHESTRA-FEAT-CONDUCTOR-ANDR
143,612,166 *0DC23128910B46203AE6F1AE1200482C5C644956 PIAYDNAM
143,612,167 *0DC1157AA677305FB0A7557799C86C82C05FAF01 PIGLIALA0
143,612,168 *0DCC660B8ECE6081C1392816BAE9DC1CDE0D1A6F IMPROVISATION.NO..3,.PART.2
143,612,169 *0DC3ADBD0F715C5D75530544D3EF688F230412D7 [email protected]+s
143,612,170 *0DCC2E22C8C6C2AEF656FA8D566500B21D54B247 INGRESS1989
143,612,171 *0DCA84C61CEBCBF8E1F48ED48CB19A7622C199F8 podutiška
143,612,172 *0DCB717045B7AE0864DAC80DC041926A3D0A5B76 INIUREISES
143,612,173 *0DCF3186D7732D573B9ED837F68BED496CD74F15 INNER-DANCE-PART-B
143,612,174 *0DC85738CA907D5C08A9185462E54D8D320C07E6 police_band.p/@/'l/i/s_b/&/nd
143,612,175 *0DCECADD43E5A9F05572DF8C6B13CAF030552DE6 Polonaise-FantaisieOp61inAflatmajor
143,612,176 *0DC81EBFB34C36524B1B75BDDDED377F4E097AC2 insecticidally1
143,612,177 *0DCBFF057D991E39FD0D07057A44EAE0F3B4FC8F INSIHE
143,612,178 *0DCD92948DA688E54F09D7569CB78603A355B93A :po~ O~(p
143,612,179 *0DCD16035F6623859834E3FE4D30480EF25B3AC5 POOR-SHELL-OF-A-MAN
143,612,180 *0DCD507EF61C312F7356624C40F4BACCD69F5508 In-the-Streets-of-Boston
143,612,181 *0DCB7B88150C7C30F26809286EF296DAD28FA02A potrhat5
143,612,182 *0DC6E90AEBFFB09B8A41CD4DC9CA997B088CBFED INTRADECO3
143,612,183 *0DCEC1268463E00A6A8881A3B524BF9A8563DC47 INV3STIRLH3S
143,612,184 *0DC65249209830D650281015AB414B9FD70D11C5 inversiv5
143,612,185 *0DCB238429BE79D749D34F8CBEC22006335FB3F2 pp~0splat
143,612,186 *0DC26B097DCFA0E8CACD4B30E3DA6C5010B991A1 p-p `)o(
143,612,187 *0DC4C83C7F36F6D868BB83B2AC0340BAE1A29EBD :P~ ` @Q
143,612,188 *0DCFB497380EB7741DA7A86E2A2267F8008B0579 [email protected]
143,612,189 *0DC250892C63D67B55AC01681AD3CAC4F5757A08 PRCHNGLY0
143,612,190 *0DCC895AC9613424A6FFA49389E9A02F2BF6096D [email protected]
143,612,191 *0DC546047280960D0AC9284396F76993BFCF4202 prestonshiner
143,612,192 *0DCF314729D829C3984E99042AD3DDECDBB7082E PRIEDI
143,612,193 *0DC6E9E1BC40C594F5C6E056C68C41293F2AA8EA PROVIDED.BLESS
143,612,194 *0DC7A61427F06A49100DD8768EF1A4D8E6668885 J^[
143,612,195 *0DC379F14CD16ABA0087DDB97FEC287B3CB1D55E psousennès
143,612,196 *0DCB722D23CD1D92B9F1F81E1966E931D1F88E8F JADEREEL
143,612,197 *0DCBAD358DB965D6374374BF18996E921EFD4782 JAKOB-ANDRADE
143,612,198 *0DCCB08D69AFC8CD15DF5591D3621FC1E4F4D3BC JAL1637
143,612,199 *0DCF2DB5A02A27E335423121E3C7C5B2DDBB2AF8 JALSATATABAT
143,612,200 *0DC992D99CA58360D28030D6A05619B6110DB884 puckston
143,612,201 *0DC9AD448AE50F8269045B788966E30BB9907486 JAME.MONTEE
143,612,202 *0DCEF67C76332F0DD986723799570F7A1DC35476 jamesos93
143,612,203 *0DCF84C5DA3D66C6BD822B9BAC778BF20C7275A0 PUSH(LIVE,HUGODNITE)
143,612,204 *0DC01960F1DA11278226CD222BF4F77BC21579E6 JAMISONBARTHOLEMEW
143,612,205 *0DC845A2E0A7983BE85994BA0EF9CC78D179C355 JAMISONDAWKINS
143,612,206 *0DCE70AA9626A75CF015D9121785F6141DC68C61 q####)~0~o(x)
143,612,207 *0DCDBCE1CAAEA88AA4DC9E717C7EC8BB6BCAED4E jaromir-vejvoda
143,612,208 *0DC2B02F2262398016061B3D0F2EA3D3BFE824D7 q-B.~O.~o>-<
143,612,209 *0DC04E2AEC333B993327FBA4023EEB8B685CE751 jarrodsanchez
143,612,210 *0DC96264FADCD6797DF0EE4DC01BA7C4BF6CC045 jasminita
143,612,211 *0DC619452A0FF798B07692B848842B8A580B428A JAZZ:-DORIAN-B2-EX-3-(BT)
143,612,212 *0DC8AAC638A6585423AC791B346658AE02CCBC32 q--)~o~o-(0_<)
143,612,213 *0DCF6606C1C978D3F66F76A9A676CCF72E19FF96 QP~0 ~O 3B<
143,612,214 *0DC63D131D83D63BE5AD5F1A90A29B3EF16313C4 jeangluth
143,612,215 *0DCB8D1576909E074ED3F98C70128C47695441AB JEFFRUTTY
143,612,216 *0DCE744C037E110C47F24D7851D24B72C279B290 QUAKILY
143,612,217 *0DCB7765A2543608CCB122BA4E82B6E56D711E73 JEFF SINCLAIR
143,612,218 *0DC4CCCF4A85561DF34AC0A7C39D558C41664576 JENNAMARIA
143,612,219 *0DC872B5BDB31859FA7F8295CDDAA921DD972069 JERALDNELSON
143,612,220 *0DC1875FEBE6D7598D1C2E197896E491F7BA4E45 JEREL-THOMAS
143,612,221 *0DCE572445C131BE958DD72513402B372EB53072 jerieskhazen
143,612,222 *0DC5C7D8D5B56D956ED4732249707D9470E68137 R17U4L1571C
143,612,223 *0DC88FCCD4A8146DDDAF50218D2EF50289C90D8A jerrykiessling
143,612,224 *0DC1C43E85F6855703C679B37240FFCC1C4AAAFB RADIO.GUADALAJARA.|.COLOMBIA
143,612,225 *0DC6FF40C99B56F0C548B330A4C19565C65CEED2 RAYFORDLABELLA
143,612,226 *0DC7535244C1C6EB036141D4809F9737F810F30B JESSIE.OTTESON
143,612,227 *0DC9ABD61A5FF37F2B1027002F9A42E984212C7F jessraczak
143,612,228 *0DCB697D7B0ABC97D308A7C838A0EB407F3000C6 R,@E
143,612,229 *0DCA39E9047F426A71C6FA87D10C973A84A416A8 JIMMIE.WARDER
143,612,230 *0DC89CC918552B51CA2834C145C9D2203F6DDF09 [email protected]
143,612,231 *0DCBFD9158BA114AFD0FA039FBFB11F3CECB673A [email protected]
143,612,232 *0DCFD958BFACAF9052E1A7B27837994E40A8E045 [email protected]
143,612,233 *0DC0F6C83F529BECF275731559CE04992B59D8D4 [email protected]
143,612,234 *0DC438F1E738BA14DE15A33ED784669D0C16B393 red-woodward
143,612,235 *0DCCF6F7FCE9027FAC9C6DBACEA251E46016761F JJM1992
143,612,236 *0DC69B361A2E5E27AF40C00B65668916487BF90C JLAWTON
143,612,237 *0DC0A737F6F8C3768999CAB4FBA006E583B24250 j[li
143,612,238 *0DC8D1551C622C38B14A3D2C9AAD47D295B0B61B REFUGIO.NIEDERER
143,612,239 *0DCA98165BC5E141F44FF5DDB0F3DD8A01182701 [email protected]
143,612,240 *0DC9313212CD936AA72A29214872566CE63B741B [email protected]
143,612,241 *0DC8258E71F362A70E38A6E84C5FBEF48FFB4BE5 JOEGOODRUM
143,612,242 *0DCBAC8A5AE35E563C2ECE0236B9F5AB406D66F9 JOEL094
143,612,243 *0DC0995F97E322C54CC0238888488ED8DD22EDBB joelmatanane
143,612,244 *0DC1881F83FA12AAFB91495A87BBCD3DFCF03C33 rejune
143,612,245 *0DC2429680C44162867E9939419D6EA6BED8A1A8 RELYFTAER1
143,612,246 *0DCDC88E70D7C6EB019D30BEA5A7B671F4B8E004 JONAH.LIVECCHI
143,612,247 *0DC3276A1D769266342CCC4CA581132F20E582FB REPUTATIONSRISIKOPOLITISCHEN
143,612,248 *0DCE6C980F021E25BD6413BAAC508FABF732F30D jordanvadlamudi
143,612,249 *0DCC5B7CD3EB817C49539CBFF880C5527046ECC0 RETEMSAGTNUM6
143,612,250 *0DC8D074DD2E305350ACF1E73D9C3CB17E614B4B JOSHUA.STEYER
143,612,251 *0DC544B04A1749D79886626B00EF9FD46D8D3AE4 JOSPEH.LEMBKE
143,612,252 *0DC73FA9F84FCAC11A9E0355545257BBAD067F1C reynoldsariane
143,612,253 *0DCB666B6132BC89F0364AB9B2DF9F18D08361D6 RICARDO.MEDEROS
143,612,254 *0DC3BD30C7A5A316602336D2B2299715CDBBB66B JULISB
143,612,255 *0DC6D4535D6983AE472D97A30E0C45F74833E352 rickybrey
143,612,256 *0DC381EC5F824D8229A22B988CA005AEBAA11F7C JURTLWR
143,612,257 *0DC1CC379C9616CBD966EEC543A93BBB2E51AF7A JVDN
143,612,258 *0DC74D5C0080F4B419C91D47E0630D0CA9E6B765 RILEYDONATICH
143,612,259 *0DCE7B71460FDAAAF65B187064FBA38AC89CC625 ring_pin r/i//n/_p/i/n
143,612,260 *0DC79A54482DF15F5071C29E4DF170FFC8EB6F61 RINTONTI3
143,612,261 *0DC23CAEA377D1451588F05F5395E37BFCA56EC6 K/1_
143,612,262 *0DCD037B5039C77D8CAB2D5D90D17EA06E312C66 KAGOSHIMY
143,612,263 *0DCB063F35E4A6984636627407B56F2C1EB4EFE0 kailyn918
143,612,264 *0DC935C095FE5B04FE0622F11E573BC497637548 KANONATRAPP
143,612,265 *0DC53E663D3FB5464CD4BB9A44C0FABB023DDDA7 KASEYWAGUESPACK
143,612,266 *0DCB209447C1DFB6FEF4A967B3CCC7A13C7D8AB6 KBEIFFELLE
143,612,267 *0DCA545ACF1A1447F56A2256E8EEB0CD7918B85F [email protected]
143,612,268 *0DCDF9A13C2ECCEFCEF33CEDEF0E3201E7062DE9 KENNETH BEHRENS
143,612,269 *0DCA4A695E3DF83FF220F3E58EAB200C0B5BE28B KENNY.HAMPARIAN
143,612,270 *0DC518F371A57B64B54A308B7D82541CA83AF57A KENNY-OBESO
143,612,271 *0DC2E96F3A4CA83626FA3912226893061E92F391 RKUSHNE6
143,612,272 *0DC02EA8655ECEE636A1027025EB965268EAE5BC kerkpatrones1
143,612,273 *0DC4DE020285FA8661B1AC10436C9F2CA604CF17 ROBERTOLEUPOLD
143,612,274 *0DC67000440DE67569418DA33DC3ECE497256E7E RODKOUBA
143,612,275 *0DC9A90B245B3916513BC767D825C87EC73010F3 rodneyalcocer
143,612,276 *0DC734A093F9C17C82C6CCBD7453707BFD32D51C KGWEBIŠANO
143,612,277 *0DC8721834D286E287F24C362179818A1754FE80 [email protected]
143,612,278 *0DCC4A2DE45AB3D7A3B8D472F799171FD0B618EC româaniei
143,612,279 *0DC7288D17C25C00856D4AF32F87158243754A33 KIMNANG5
143,612,280 *0DC5362CD78E053A7C61745CCE2C63F3BEE65355 RORY.CROSTHWAITE
143,612,281 *0DC3B35214E23C410B6511DB9BCFC0912E50A48E RSTERIO02N
143,612,282 *0DCFE1D79FC2A9639E47FAA1CF6081F10AC6AB16 RW<(
143,612,283 *0DCD24E258C7B493EF9CAB7F5E0B44CE79C1DCBA ryan-joseph-becker
143,612,284 *0DC70624CACEB68966C725555B6464EB4BF4D392 s3a0tt3r
143,612,285 *0DC22F5035F98CD586389D8FC92B1A5189A390FA sabkhahses
143,612,286 *0DCAAB6BE79D51645B835E27D386C10BB23E49A4 KORUTOPI
143,612,287 *0DC745A76F88B12E0446105559F6BB2576E69A6E KORY.MOFFATT
143,612,288 *0DC4AB0D4FF334934E29ED6A5963FD72F44A1370 KRAIG.EDINGTON
143,612,289 *0DC3491B71126365BEF179DAC93F7BBC6ECB078F [email protected]
143,612,290 *0DC702379431BDFB7CC2282D04B42E00B5D10261 sanatorio2
143,612,291 *0DCEB121E0FB7F0E8542836422AEB0E58B89116F sanflee
143,612,292 *0DCFC635B418E144BCCAB67C1F7053197217B18A SANTASHAWN1
143,612,293 *0DCBEEE63CC47D5755E80BCA2107D643454CDCAF kyle.viloria
143,612,294 *0DCDA44EC79AF9A816561A74AE7FE4E89C2EAD25 saulesther
143,612,295 *0DC516553986EE61FBBC7D3A96652A1068E2F28E saulmoel
143,612,296 *0DC8D4967693D7A5BBCE36B38EBB6F3BC46CA9BF SAVEYOURLASTGOODBYE
143,612,297 *0DC4137A05274AC491ACA6181219DE44DA6C8837 LAKSE0
143,612,298 *0DC673C532E33BA7808B86ED4F336CA2BFBD67C7 sceptre
143,612,299 *0DCD05A21D85BB73FD37138F4AD9880436DB8F93 lamarporta
143,612,300 *0DC2135940D21DFC7FDAA35AC5303CCF4DCA9CD8 LANCASTER-DIOCESE-EDUCATION
143,612,301 *0DC9ECE63A04DBD551AE48451F155B9ED9681CEF SCIENCE.FOR
143,612,302 *0DCA9F5CE1234CBE2ACD3DEF25D31DA597A6272B la.terre.est.basse
143,612,303 *0DCE16F596F30429F0268DB3D9D368CDC8501B06 LD3XF1
143,612,304 *0DC06CE8372FDAC6A7BCE40B665887F8733A8A83 SECURITYSKIPPYING
143,612,305 *0DCDBE7C3E8248B9C5FF8336CDF4308816ED431B SENIANG2
143,612,306 *0DC2359A5FD8C3F5D8E2418048B40C6C14036C61 LELANDSCARBROUGH
143,612,307 *0DCCE0D11D46EEDA2F0F5AF657876F1C5FC4D6FC LENARD.EARLL
143,612,308 *0DC63FB0F2294013F88515E7128BF68E5BB47063 LEONARDOVANBUREN
143,612,309 *0DCF0147E2F2C5637D817AE4F1ED00CEB4339140 sergeirooster
143,612,310 *0DCC3320E9298862B15864A556D96FCB7FD22AF4 LEO.YANETTA
143,612,311 *0DC105386527214D576EA7B2F2C14EC8B3A3EDA3 [email protected]
143,612,312 *0DCE8DC4032948241488101178744621E0DF62C3 SERVICESOCCERING
143,612,313 *0DCFE3FD264374B1F9BDCB86E0E2F9F6ED9EA96F SETSREING
143,612,314 *0DC10910DC20E451C81466EFF4A8231B127CEBFD [email protected]
143,612,315 *0DCB89F693F61FAEEA5F587A3EB1C8DD5A294F54 lianne.stephenson
143,612,316 *0DCC3516ECF5314CE6402E776C581EC35F642244 LIBKDE...
143,612,317 *0DCAD69DCCE43E8F5A413F912BE3A85C399BE2B9 SHAVANTGERA
143,612,318 *0DCD5FDFD4AF1567DAF88E264A24C108328E823B LIFE (IS SO STRANGE)
143,612,319 *0DCFAD3CE26F347E799CB8C11795DFC348E98EFD LIMONE、LUCA
143,612,320 *0DC43F87252133F491886A98F5340E8CB60FFD51 LINCOLNROUSSE
143,612,321 *0DCD7AA9AF6E8B4FF1D8D305514A516703C170E3 SHOPMINTJULEP
143,612,322 *0DC22CF31134DC806E996FC3727CD1960E7DDBA0 shumailamahmood
143,612,323 *0DC92D353D692B21421F4E6989E67069B3F44537 LISAPICCIRILLO
143,612,324 *0DCE17C4277249D7EAA3F4C6E663264970A25058 live.-.over.20.years.old
143,612,325 *0DCFE281DBB12DD2D5AF4AAFAA2A0A6F9BD8273C lj8hlu9b3d484z3
143,612,326 *0DC29E1E4E8CB3F6C2E8CE9C476DB6D00065EFDF [email protected],[email protected]
143,612,327 *0DCC5F9655D024FABB86F6B650D601AFFAE0E9D2 LOCUTAM8
143,612,328 *0DC5CC04557D647B16D9218EB41C1CF3ECDCB417 LOHITENA4
143,612,329 *0DCFF0956708CA09BDF4B76C6AAC11D271C148EF long-sleeved love
143,612,330 *0DC785BAC1BC5FE85464AC9D206D8B46DDFE1A30 SIOR
143,612,331 *0DC8AAEAE27319FA85A2609B6ED633D520A2A35B [email protected]
143,612,332 *0DCFD81142A8238A92F6074118236F5F97130B39 LORENZOOROURKE
143,612,333 *0DC5DEA7AA475F1E0545BB48FE692201FD84B6D8 love-will-save-you...
143,612,334 *0DC4222AE5E602AB7B7CF0B11A39F83C10B015C7 LOWELLFRANKIN
143,612,335 *0DC0431A8CD91D956A3FB1B3046D1EF4F268B72F smithsoński
143,612,336 *0DCCDB6C8FF800162EBC68A50CFCFA08BC0F22EC LQRUBSW5
143,612,337 *0DC005FE75B8DBD381497CCE1230604B88F68502 LTHTTPWWW.ALLSTAR.FI
143,612,338 *0DCD54A814AC910500D7D3978D12D6CF9BF04F7C SNOISIRT
143,612,339 *0DCE49FB64C0FD946B48ED6B22A7A1B4D4E37281 LUMIERE2
143,612,340 *0DC2B0EDD70FA1A87D1B40F023F348C1A71E59C5 soaindrana
143,612,341 *0DC41F03067DF02C8D41347FB47C438CC6F5F7FB SOENTONOK
143,612,342 *0DC38328036C0CA068697CBF6EABE812208D06DF SOLAR BRIDGE
143,612,343 *0DC9ECEC1C05B6E3724263BD63320491645EB682 LYRIKALR
143,612,344 *0DC600E361D7FD0DFE6CE36ED7F6E02D0A2C5460 lzxgcbnw3
143,612,345 *0DC4219647C68EFEFA0028328443AD30B61028AD sonnywittel
143,612,346 *0DC17C9F6C0FDC6BCA795597066A3E706B31DE0F [email protected]!n3ss
143,612,347 *0DC994D18F54776B08EC35A2BA6BCA511FC8E5BE SONPILETTE
143,612,348 *0DCFAC0936B4E70673006B3B840A8E46C200237D m9hbujxgbucc
143,612,349 *0DCCD6D9C718634504669FFC0E9CD1E09EAC8C69 SP4NT3RN3
143,612,350 *0DCF15D08F94224599D7547B7B9EC60AFD600B0B Space-Filler
143,612,351 *0DCF0E28A894AD4E711BFBE653BFC362D3864713 MACKMCQUERRY
143,612,352 *0DCD6213CC8736B451E3591D429A33F83EB986AF MADI FLETCHER
143,612,353 *0DCF4464AF6448DC36729BA53C116704FC53CAE9 SPARTANS123L
143,612,354 *0DCD6807DF7BE40A5B2A1B1CD6C3ED592044602D MAEBREMM
143,612,355 *0DC587659B1D5DB6102A7A1641AA0E07F4C27D51 mahmoud-ismaeel
143,612,356 *0DCC44B1BDA79BD3CF10BCDE01966CAA0B09B066 ma-ivy-lozada
143,612,357 *0DC88DA855CBA2D6AAA7187DBF176C7F26503331 SplatO~ (=====8
143,612,358 *0DC1AC31420AE3D164F4CC215388EA5814E7F51B MANBURKIN
143,612,359 *0DC2093C735ADA70CFEAD569233C7895AD732E89 MANDROPS
143,612,360 *0DC0DBE076EF154378ED6F71BF1FC097880B8F78 manedgley
143,612,361 *0DC2E6658B942BECE9417574B7889ED295997719 splat! ` @---q
143,612,362 *0DC9E03CFA7886DB48B1402E98F682A68F95E088 SPLAT!!-~-`-<---Q
143,612,363 *0DC1DF7A1FA1EA8C5AC32933DA3C1F4CFE3388D4 [email protected]
143,612,364 *0DCB45043128F21AEA45F1385FF62D439DC24C53 [email protected]
143,612,365 *0DC26D80606E372866350FDC6845C43F1276C39F MARA DE DIPUTADOS DE LA NACI
143,612,366 *0DCCEFB191E5B6EBBB8A7388639F45A591B8D6AF marc-christmann
143,612,367 *0DCA7EC56698915F715E7E1571DF91552462B565 SPOWTETH
143,612,368 *0DCB230FE6FEBFA1944D39351B670F7764FBB882 sr david riba | spain
143,612,369 *0DCB97CE49BA4B6A9DA104D778CC9A2EA23E47CF MARCO.RUSERT
143,612,370 *0DCA67BD3F52A867B181AC1229D27B621F695487 ŚRĪVĀSAS
143,612,371 *0DCCD3311065FEA9E2D1A77508DC53FC53DB5C9A SSTCLAUS
143,612,372 *0DC9C206E7655A3F49AADEE525564332CD6DA835 markbendt
143,612,373 *0DC464748FFC8E53F17C4EFDDBF35A1B24400277 MARK BORRE
143,612,374 *0DCD98ADD79DB69120EB741D233CCC1EECB0859E staceyzonker
143,612,375 *0DC0F356D5709F053FD7EB7BF072B6AF9128A068 MARLONGAUGHAN
143,612,376 *0DC5006B1FF184600719CF6C1AABC39C92287308 stanfordemigholz
143,612,377 *0DCEADDBA57EAD960BE4DF21BE46301A239C6990 marthacccccc
143,612,378 *0DCAA8BC816291C75C6A326C71DFECB3E14ABF33 MARTINDALEHUBBELL
143,612,379 *0DC62CA006DF53A655AD9C7A45B0DE50EF06DCBA STIMAVO2
143,612,380 *0DC05EAC5D4893B8162C94BC6961EB6536636C0F st.jude(bonusdisc)
143,612,381 *0DCD57BECD9C8F4DD13B7476D2B45AA260F7A89B STORMAKTSALLIANS
143,612,382 *0DC2B1D2F2177CA9BB7ED27D4B06C8ADF5D24D38 STOVEHEA
143,612,383 *0DCC4AD298D79F19B471DA30DB41F852EF20FAC4 stragiudiziali
143,612,384 *0DCE2C56509DD70F53B4B233F560BB1332C941EF STRAIGHT.ON.BACK
143,612,385 *0DC7DF1EF88F7857F82C82FE3772DCE9D0524AF5 STRO8OSCOP1CALLY
143,612,386 *0DCDF11E9453C062CDA31FF174D2234445E8C5E1 SUGARASSJ
143,612,387 *0DC261A77B75CF0C9B92397A62F0B4321815F3BD SUJOYBHOWMICK
143,612,388 *0DC8CA3AD3FF1A58B65CCB2858A777E3C72AD424 SUMMERLIE0
143,612,389 *0DC30FCEFAC6B150042E50E022B7E08F3F0A74F1 maternalistic
143,612,390 *0DC5D3AD5E2E3B8CE2D287AEA3F7592405A0BFE0 SUPERIRIOR
143,612,391 *0DCECC4D0FC9D6B465F0A762754575B9724793E0 [email protected]
143,612,392 *0DC6950AD2E7ABAC1111E5EFD62396ED24DDA50F mayrcompletion):iiif."lacrimosa"
143,612,393 *0DCD9F28DE6CA0E12224C5831905D46EA8A1EDF7 SVETSNINGING2
143,612,394 *0DCC23E875F0B0A3BA2B7CC49E493AED779A549F SÝKTUR
143,612,395 *0DC8C7AB9D4DEE699EC7E4786DC85AC3B90DFDFA system, but, alas, not faster
143,612,396 *0DC922136E892BF10E76EF18E670C19B8EF26218 mdu.ntombela
143,612,397 *0DC690F09C8073409170EEE73C631C5BBA704A5D MEHRAN JOYA
143,612,398 *0DCC5418D5A23A54DDA1569E4936BC1E86DDEE22 [email protected]
143,612,399 *0DCD8CE38CFBD799544C49800C0AE69DABC832A7 T0ADY15H
143,612,400 *0DCA6A645B4C8B5B7B61ECD02295A3A89D2F9D7A merlinlah
143,612,401 *0DC4F1AE539F00FC9331FE4BD0DE5BFD02D4BE79 MERVIN.BENA
143,612,402 *0DC293825C0D1215FE396D76292C9CD39A4E2E01 [email protected]
143,612,403 *0DCBFAA1B83AC5A9662E781056865B77629F5985 talk83170164169
143,612,404 *0DCC700AE0BE360E0D43AE0ACBDD2DC6B45EC5E4 m!gr4t!ng
143,612,405 *0DC364382C1317F888526732272D8255DBA508DE TALK91125194107
143,612,406 *0DCACDDDB399B6D7A328F1F24D793C85283E08A6 TALKCHHIDRU
143,612,407 *0DC788004745F3DC4AD735AD6384D3FC45C13295 MICHAEL FIORENZA
143,612,408 *0DC3EE28FF3B2E8E94F6FF572925EA2C0F398AF2 MICHAELSBEERBAUM
143,612,409 *0DCA5A928FD3DC78280FC987EEB2A7398FA0BE27 MICHAL.WISZ
143,612,410 *0DC8647663062C2C172D4273E13179E701E72C4A [email protected]
143,612,411 *0DC83145A8E6D4632BF7C08EB2ED3ED79952C9B2 TANYA-LACY
143,612,412 *0DC7E38DE6C70CBB3120E857D6D29E2430FDE13D [email protected]
143,612,413 *0DC80E9890210A0E0AD9731464690B5860EF49BE taramerryweather
143,612,414 *0DCD0717E91E0891ED12B3D959CA09C56BEA3AA6 miltonsuhr
143,612,415 *0DC0ECD6816601F33F9755669AEC371ABF33632A MINER
143,612,416 *0DC44193951C9A113698161E581C3FB8AB1B006B minhsieminski
143,612,417 *0DCE6643C1A2133BFB1B74667EB62638159995BD mn885
143,612,418 *0DCAF473480DBA83AC38F2A071BF111F61DD92C4 TEDDY.PIGGOTT
143,612,419 *0DC8A857A9DFE60894A3601FCB70E0531C6A66FD teentjesed
143,612,420 *0DC321CE5647593A462F1CD1BE3E0367E9BFC38B TEKINTÉLYRE
143,612,421 *0DC55B13FFF495C02AB88A7F218002C6272998B4 mohammaddomeier
143,612,422 *0DC4B5388C355324CB0FCEE37DE914CF13EC266F telepathics
143,612,423 *0DC44684639D26BA6EB24F5866D5304ABCF41974 MOHAMMED SOULEIMAN
143,612,424 *0DCA7197B9E224EEF36597A509E4F34E6E2C1BFB TERENCE.SECHREST
143,612,425 *0DCF194332EC4DA60FB947DD184FE27B442C4F60 terencewaddle
143,612,426 *0DC2FB6EBA4CD0CEC20BAE405030956284ED6F05 montaque-mcfadden
143,612,427 *0DC71937B0D016B1F1E870AC8800F0AD9CFA8025 MONTEKESLER
143,612,428 *0DC9CC35F085897643983825CF49294B0CBF257A terranceburkham
143,612,429 *0DC30169A353EF583B145FD2506D32138F271866 MONTY.AISPURO
143,612,430 *0DCF751C3727641D361F0CB2EE6157F3733589AE TERRENCE.BRAMSEN
143,612,431 *0DCF425FF941687D4D582E4341F483DBF21CCD77 moondust01928374
143,612,432 *0DCBF3C7687EC20662D4918C3FDF7E1386E3FEC6 MOSES059
143,612,433 *0DCC26389FE685EDFA6D77942D1BAB4E0BDD564E MOSTECH0
143,612,434 *0DCD506D53AE795F9B19B83E1396F4F088AA8706 tetrarch
143,612,435 *0DCC2CC487285A9E830ABEAB13CCCEEF169DF4FC [email protected]
143,612,436 *0DC504D2C64EAE370B04F6ED555F7E40DA0D9314 MUCKROLLS
143,612,437 *0DCD4464FFB846DB8305FCAA118D471AE085DF67 muffinnone
143,612,438 *0DC479EB1CF1C7EF12A8B1AB625D2411316B1876 THATSHEBA76
143,612,439 *0DC3B8C5946316EBA6CA30E427825ECDF1FECC3D murraybodfish
143,612,440 *0DC77F48DEB2CE9A5981ACC27DFDE2B78CF3A026 musikaut4
143,612,441 *0DC46A12BA3AA1635608E481A2EB66C6537C8031 THEBUTCHER'SSHOP
143,612,442 *0DCBA33918CC8F1118D361348EA86AF7FCCAD5F6 theodorepfefferkorn
143,612,443 *0DC933CA5E69DE9D1BCCEED25E429717909622BB thesimon24
143,612,444 *0DC9243943F22C98E3109CE240B2A935BC352A39 THEUGLYSWALLOW
143,612,445 *0DCF183932688D85952165941910D08A4DA57E25 THEYWEREWALKINGSIDEBYSIDE,BUTEACHWASALONE.
143,612,446 *0DC8B81229A7B974D09BBB838152DBC284D939BF [email protected]
143,612,447 *0DC9171D501758E441DF9C53C386A1B85BD92233 namyi
143,612,448 *0DC48BAF02CC0BD38769AA3E1F62FB7E8E6EAD6E nando0617
143,612,449 *0DC4194E1C3E8DD9A4EA144AC97927EE48ED34C8 NAPLESVALLEYNY.COMWWW
143,612,450 *0DC98C40C7D1C10EA7802332F386398DAB1A5829 [email protected]
143,612,451 *0DCFEC5451D4DCF2E29FDE31E0C7A4F12B329B2B tiarafranklin
143,612,452 *0DC79C7A1E6F198AD1A2C6127B46E7513156FC96 »TIM
143,612,453 *0DCC8B3D1C15C0A86058B7CD4B0AD229EBBBC724 TIME-150
143,612,454 *0DC34D3F7C31A8882ADA22046B0E7A310E207041 neallais
143,612,455 *0DCD5A1427007B492A91F18F3FBD2822F8A8E7E2 necromantic.
143,612,456 *0DCB6E9AB3B396BA7FFD925A9ADAEA1D43A4222A TIPAHTIVAT1
143,612,457 *0DC35C39E562CA4F7FFA307138B415F331DACD19 TIPIZACIJU2
143,612,458 *0DCD4E54EAC8CF8E237882EACE8391B9F9D0D41E nelsongrimmer
143,612,459 *0DCA2750D3FF2A4DC256BAA2AD1CB7A3C873BDAA tnemegas3
143,612,460 *0DC97A8E0D6173B2958FDF1027B79443E7849178 NERENGLS
143,612,461 *0DC1076BA0BA161CFD93380FC4130CB768FA612E TODD-KAMINSKY
143,612,462 *0DC0EC82D5BDEF1A3017C1E1C16699A97F534356 TODECKLER
143,612,463 *0DCD18D959B4D3ADF2571711F9F3F089AA225ED4 NEURONCHEMICAL
143,612,464 *0DCAB90EC510BC73CAC6D573F300B37D984B42FB NEUZNATELNÝMI
143,612,465 *0DC138F0CC02E059E2E1E1E34F032BEA90776189 togloqe
143,612,466 *0DC501B6BCA17DD0622DCA79088C65874AA16F1F NEWTONNICKOLICH
143,612,467 *0DCCF0C4AA5F8868CE57B3A3D6696D10AD299D68 NHFYCAJHVFNJH104
143,612,468 *0DCA507C7DA98B0C98F1B95D6C683A3E5A3AA03C TONIMARONI
143,612,469 *0DC52930A055B33730660EF5C7E09941EB24BD25 [email protected]
143,612,470 *0DC49D911265B087EBBF1B568A1DF817289D7787 TOSTILAT6
143,612,471 *0DC9B3E52DA6726549E3EF9989153FC6A6FF5B47 nivul
143,612,472 *0DC5359873128C69189101CD29AA8868FD2F4654 NOBLE.GRANDMAISON
143,612,473 *0DCE2959B07A040BFBAEF1B85E5BD4DA51D93402 NORDINEN5
143,612,474 *0DC0CAB24104E454FA4A0FC7D2AA183967AB09E4 NORSTAB6
143,612,475 *0DC7509AE65B2F4F59936FD4EB26FB4E71CFDDB8 troam-ginny-datta
143,612,476 *0DC897A2E6F621C93450411ACC376B71FE9967FC TROPHOSPONGIA5
143,612,477 *0DC182D2583F23FB1484D33546474FC6A9933388 TRUMAN.RADEMAKER
143,612,478 *0DC9C04955CF149D0F0CF1C37CEBDF79E3760700 TUAN HOANG TRUONG
143,612,479 *0DC51ACB25E94D6538B773CAAC97F573ADE63A07 TUDELACODEX
143,612,480 *0DC4EF4308A1B7B34A49BB6328B3765644CE6424 nsstnts1
143,612,481 *0DC0CB6673EEA080AFD6C983ABEFFC6C73F70254 NTASLBD2
143,612,482 *0DC2CDC7B80F2433A2CA7C197CFB054C47C703CC ntmstrced
143,612,483 *0DC5C05175F461051810BA67F333A5CD8C6F42F0 TUTITAMARIN
143,612,484 *0DCB6D6E7507A6F57ED62087D4B6368C6179DFF6 nvidiaionatom
143,612,485 *0DC68E4FDB05F149DD2017734FED965A27A74196 (o_-).`.<####3
143,612,486 *0DCDEE6451D14D30541C3B1283586F7BE604ACC5 OCEANACH7
143,612,487 *0DCA8CF05D217B2B75A47B4D3498206B016E515A OCTAVIO.CHUANG
143,612,488 *0DCC9C6733F21B26987ECEDBFDD1D011709D6ECC UGUAGLIANTE8
143,612,489 *0DCF7A5909BB135F786AA529BD8DDEB4982207D7 ofspearsandhorns
143,612,490 *0DCF8756150E2AB7EA5FB0421DA76CDC5E439C41 OFTHEINTERNET
143,612,491 *0DCDBC034FC00FEE547D89B287A51AD464B1CD8F OMSP
143,612,492 *0DC43C7B7CEDFE55CC65E0BE43FC50BA397F47BD onagro.2
143,612,493 *0DC95D63DCD46C133E0CC9668EBB4C51D08255FD one-clear-minute
143,612,494 *0DCC6D6F4128B2079CAF114CAD098F0E3E23B6AC UNGBOSS
143,612,495 *0DC26401D332E54AA8C2734E11AEA839E472BC5C opgegeten
143,612,496 *0DCB0C7AD682800327EF08D8F30C12B7BBFCEECC UNSULANGI1
143,612,497 *0DCB8169EAE180083ECDB22871DE5EC94F731771 ORDUGAH1
143,612,498 *0DC699D1BAD20471EF9EF95CA0C3BDF12E6FBF45 ORI3N+S
143,612,499 *0DC6915C0C039FE7649ED058508220BEF0F7F3B0 URMELLA8
143,612,500 *0DC9C0D9D6F7C98AC4970F17A98A4E7D29B07886 URYSOHN空间
143,612,501 *0DCAC240DF145D73AD01F9BD30BB6AFC4C66A946 USERATTILIO
143,612,502 *0DCE1B1B5399410D041A30D84395B139C898EDDD osvrnuo7
143,612,503 *0DC385B3B9F72865FA8897082D209CEA5D16A30B UU3NC3
143,612,504 *0DCBA198E825960125D6C4B464FFCA84CF9B9DEA uum.azzah
143,612,505 *0DCD395627B8051887A252891E668653E741365C O}Z
143,612,506 *0DC68BFB9D9F754A12B40068D9BEE3B0B9B1FD42 p------)-~-~(~_^)
143,612,507 *0DCC3B29C804EB34999912D901D6A96CD53AFDB2 [email protected]~0~o}o{
143,612,508 *0DCCF5A0A81369C3A377B5F7EE9AC2A9BE7EF5BF P0$TC01T41
143,612,509 *0DC216A7C37B8D01F54CB1BE9412FD348195A70C v4t1c4nc1ty
143,612,510 *0DCA820BC5BA6CAE5D401DF97EF1504FB90814AC v8r4n+s
143,612,511 *0DCE2F7D786C72C326D39A6D73BD28AAB6B7AC6E p510cy8n
143,612,512 *0DCF77C8AC3ED8F58760D85E12D533CD12410476 VAIDEHI.KAWLE
143,612,513 *0DC9701898FE26854367A326C1F43E377D2214A8 PA7H0G3N37!C
143,612,514 *0DCA377F6CA0CCB040B39DF133C0725FEDA5F5FD pamela-hogg-burks
143,612,515 *0DCAE2806EC6D806637F33D1353984D2B46408DB VAN CORNELIUS
143,612,516 *0DC38356617F1B340082DA85BEDDE9348EDD5D6B pāṇḍya
143,612,517 *0DC09FFC1BE6283A72A0DCB3C7C7A66F180C2118 VANITY-FLOWERS
143,612,518 *0DC7D8BC02BA9D0763E96C280BB8AC30F006E6B5 VARAYITVAA9
143,612,519 *0DC8DD31F29C3B73C26D65F069C521434C5368B0 parque-de-santa-margarita-la-coruna
143,612,520 *0DCC80E760538956D66344A92AC149827B94A077 VASEMMISTONKIN6
143,612,521 *0DCEA0C4D5BD1CD6F7182341F026FB3D898EADCB VEGONZA
143,612,522 *0DC1029F55F4DF855A8D1D6226C6E0DCD181D324 PATTROWERY
143,612,523 *0DCF7F5128A78403A9C0C80552C8199817DC5802 PAUL.VANPATTEN
143,612,524 *0DC3C7511FF1EFD537D3C28AF4177B5FED589CBE p====D.~0.~osplat
143,612,525 *0DC68E51620C4998220181CBE9F0D2FCFB37A2C6 vernonstolly
143,612,526 *0DC3547E0760DA7159DD18B846330E9884ED3DB7 VERONICA-LIEM-SIOK-LIAN
143,612,527 *0DC861651A908151E991373C3D8DE8E698C52F49 [email protected]
143,612,528 *0DCDF847C056AF06A18C05D1639B126B6F65DD9F VERSTANDSVERBYSTERIN8
143,612,529 *0DC942E3F6F9D59BC091781E6DDE3A80D1100A7F VICENTEVETTERICK
143,612,530 *0DC4CAF1565EBDC355A352D9517953521E6B2A75 VICKY.RICE.HINE
143,612,531 *0DC14B31A7F81F3EBD1DA71220C7B6855FDEE829 VICTORYMANSION
143,612,532 *0DCF0C7DAC5278ACD594A44BCDF21D53254CBD83 PERSONALITYONECOMWWW
143,612,533 *0DC47F3A5645E214E827F4C891D50B28EC7065C6 pétraclès
143,612,534 *0DC025851BCDE11EECC07F9C95510E0F25DA72EC [email protected]
143,612,535 *0DC1045654D7CACD37CF188756C903399A4B49D0 VINCENTSOLARZANO
143,612,536 *0DC912B99FB965B9A501BF83318EAAC2B4D2210E PHLOROGLUCINOLS
143,612,537 *0DCAF3F763ADA0A51A7449D163568423DC6DFF79 PHOENIXJOE
143,612,538 *0DC781581EF1D06375B46DC6FCE509207FBFC02B photo.shop.(outro)
143,612,539 *0DCC1E39DC2FB064B36CEA316C5CFAFD2B231A4D violinkonzert emoll. andante
143,612,540 *0DCE20225BDB28C2DE68A8938D7137D938E41A3D VIPTASKN
143,612,541 *0DC961B6F9B8F5E4B5304B061C907390A6FBF637 PHYLLIS.DEAN
143,612,542 *0DC00CA2724CD103A67C04CECFC8BB8EA652FD35 VIRTUELES3
143,612,543 *0DCDB90C1D6DC41E4C262F7C7DC8131BE11EA8FF VISHAL GAYA
143,612,544 *0DCF8E6D6B7053866BF569233C699F4B1A8DE0BA VITO.LEHOULLIER
143,612,545 *0DC27DEECE76729DE32309B3329A61AE3956EF75 VKALULE
143,612,546 *0DC33741D528D3E9F258A250FA3F2FCFD4DDE089 platinenschneidanlagen
143,612,547 *0DC938906C157AA897E1349FE6894E1C77BC0825 p######).~.)o(
143,612,548 *0DCC9F959A2D598C882B5B2642F5481E6229B235 VOTEDECIDEAGREE
143,612,549 *0DC4324BE0DD5205DE4DBCC3E1F2459511D224B0 VOYAGERDIGITAL2
143,612,550 *0DC52C366C2C21438010A556387D2E751B37CE9A vrandučku
143,612,551 *0DCE93F0D56CBC907550895AD2C84969D3FB4A55 [email protected]
143,612,552 *0DCE67959FAD641907F6557258023E26ED2BFC1C P-->-~O-~O-3B<-
143,612,553 *0DC75446271E794725FFD25154D5BCC21CD57C9A W0BCK3
143,612,554 *0DCDBE21A8A834596E3109ED86018C18467448B0 W141007
143,612,555 *0DC53C73C8E282529F5066D43AF220E356AF2F30 wahhabmahmmad
143,612,556 *0DC091727D42B0DE280D04264AAAC4663C822CA6 WAITIOBSW4
143,612,557 *0DC0E3522208A41CE77D305658AD573CBC48560E WAKA BANTU LWANDILE
143,612,558 *0DC0BF13155A248915B8E2FED4B8D2F62B413D50 pp~0splat
143,612,559 *0DC26B097DCFA0E8CACD4B30E3DA6C5010B991A1 P===P~O(>-<)
143,612,560 *0DCA28276520C76348D7807600EBD60A650234AA [email protected]
143,612,561 *0DCDF2E0EFBC4074F708552A47FD673B52B6FBCF [email protected]
143,612,562 *0DC3B72CA28F03C6175BA927416723392236E051 WARNER.KALEIWAHEA
143,612,563 *0DCB4D502675EBD35B88F05871F66EEA64AAB8C3 WARRENAPPLE
143,612,564 *0DCFDFAEC4F194AA43F9BF7FAC6FE3DE93A1AFCF PRESTONHANNAWALT
143,612,565 *0DC3D1A5AA1C50A28ED918ADDBDF336BBC398EA2 waylonsuchecki
143,612,566 *0DC12B8BB562B7E7BC049EE164414DAE885204A8 WAYLONSULEJMANOVSKI
143,612,567 *0DC97D0092E5FEFBEE90A9A573271CABD924DEEA Prism-#1
143,612,568 *0DC0AE0EE087A2DF43AB6CE5188417FC1F33421E [email protected]
143,612,569 *0DCAA7A9EEFF08BEBDA91F49F63602FDABF73D02 PRODUTTRICE
143,612,570 *0DCF0C3E00DCA2EC47C2F4D9378825909B4968E9 [email protected]
143,612,571 *0DC651B0D501BF32AB8408C586223B3D0F04BDE7 PUBLISHED1998
143,612,572 *0DC16732BE7A27D8B71F2FC152EAB73C775EB941 WESSAM.KHABLAWI
143,612,573 *0DCED1BBEFDA4449442024392FDF0295453B4779 PYKNATOM5
143,612,574 *0DCA44D09438E70931E82F600C8A344E269087C6 PZPETER1
143,612,575 *0DC79DE4AD5391C140D97956951AC0F0FAC79063 q=)-~0~o}O{
143,612,576 *0DCA01D6FC8277668FFB3D1AA53B8126EA23D089 ~~~q8
143,612,577 *0DC2CC09A61E6F884760FF7A6ABF4CBA75B8C74B Why-Don't-They-Let-Us-Fall-in-Love?-/-Chubby-Danny-D.
143,612,578 *0DC17692AA80982AAA3FF8AF1B40355F35EA354B WILBERTCAINION
143,612,579 *0DC897959FCC15ABC8F65D6C43BD7DB0B50E42CA [email protected]
143,612,580 *0DCC287A492D673C2FDF3E7C33ED9F0F902F7123 [email protected]
143,612,581 *0DC00AE93B22A2DF609D578950A1E26668154B47 [email protected]
143,612,582 *0DC2564D365E2E4C3070AE155FAD4D2B7F1E8D19 WILLARDCARLACCI
143,612,583 *0DCE95BD8DC6A731716E0920CFC33877357ABCD1 QSEF212
143,612,584 *0DCD6D297CD732253228C31BE223389382268259 quedara4
143,612,585 *0DC680E957F3984398C53CFE0AAA20840B08E9AF QUIERO HACERTE GRITAR (LIVE)
143,612,586 *0DC795A916FFE346CA86F2E6AF436600B73B02DF quintonharbour
143,612,587 *0DC064C76B2F859DE1F07DA73C8DE84430866A61 WINKI-TSANG
143,612,588 *0DC77B1257A7D074FD880648ADED955E8A222345 WINNOWINGBASKET
143,612,589 *0DC32C7FD118DD7E7D27566C1D66154F5F730C28 WIRAWLN
143,612,590 *0DC3ABE41575DAFD2D9D7F0E6D972857F9404050 qy,a
143,612,591 *0DC5579227137FE5205B70D2CB38DB9D668F2B85 WISE.COUNTY.JAIL
143,612,592 *0DCE232F04603050A03AAF4215675C8205DD9A7C wml.
143,612,593 *0DC5724612B99305BC56553059A6913072A8D0C5 radiorhythm(s-i-g-n-a-l-s-m-a-r-t)(dubmix)(killerwhale)
143,612,594 *0DC6AF31E282B5A1637CB53A3F179787BB8E9EA3 rajpath9
143,612,595 *0DC8C2BECAFD510C3D0370B313E7073285529E31 raleightiotuico
143,612,596 *0DCD80AC2B60811FC44903A93718ACE34019525D [email protected]
143,612,597 *0DCE7B7005B61E05C97BAD6971F5AE8077596B32 randyhieber
143,612,598 *0DC95278BAFD85728270DE98230395B6F1D4EA97 RANDYSPALLINA
143,612,599 *0DC559481F9AB2E3A6B1C9D773235851B42FBB7D RASHADDANN
143,612,600 *0DCD8788D185100547A01DA78AC6A651737F1F03 rasmus-elm
143,612,601 *0DCB7E940C09D714B913BA613662E9DAD392BE6F RAVDEEP OBEROI
143,612,602 *0DC101D235619002A32B16AE9307371CFF6E99FB razz3
143,612,603 *0DCD1D9B22215F745A824B556A6B458E763197E7 X600..
143,612,604 *0DCAC9669480BC430C75F4CCE9C3A7B7AFA7811E X75922
143,612,605 *0DC4AEC8740B6FFE95F6D7D67C1F7251EBE70D0D xgaonab6
143,612,606 *0DC1288873C198F317E70E51529F7A5866BA01E8 XIAOKAKA
143,612,607 *0DC1BE66E8FC334D176B6866EC95D72A31A7D3F5 [email protected]
143,612,608 *0DCE120C8ED6AF9ED684AB819800C3F784E1FBAF REGGIE.STUBLER
143,612,609 *0DC0A51F9BB8674026A911D20DD61FF8CA8DBD67 xxstarmishell
143,612,610 *0DCE15C7497BF243DB52A28C96E2BAA941F0C3DB renee.spillane
143,612,611 *0DC60FE7223F664593D07F9BBB5CB9C54AEA9E3B RENITENTI9
143,612,612 *0DC6BD3D0E86159A91CEA09CDAA639FEB6688004 republicaneasilywinsstollesstatesenateseat
143,612,613 *0DC2B455493A533CB66CA9C1D345CB901A3259ED RESTED.1
143,612,614 *0DCD70726195739A98993CCCFF703DBCF78EC7DF revisant1
143,612,615 *0DC5BC766D77916A6AA832DA30D8C86EB6C0D98F RHETTSIEGFREID
143,612,616 *0DCFAE1139C77582CE92ECFFE33BD88FF7926E81 [email protected]
143,612,617 *0DC0E4A0C70C3AB0EAAAF94D2012D34E0B8F52C1 [email protected]
143,612,618 *0DC913F71802340CB3192B2BFDDB0CE3EA5BE151 [email protected]#
143,612,619 *0DCB2A7CAAC8B1591047BEA12720C8B69E4F08D6 YMARY LOPEZ
143,612,620 *0DC497E63F54E52E24E4580F064EA58C71C93C8B RICHARDSEGUNDO
143,612,621 *0DC3437CCC15DD689BE347D685433F521ADFE560 yonghirschfeld
143,612,622 *0DCB8EB7DF0C4FD21425A7FC11F1BE63856B2A54 RICKROSSHUSTLIN
143,612,623 *0DC489E1284EA1A0351E1D950A1EAF2BF8C7D8F6 [email protected]
143,612,624 *0DCDACCCFCDFE3275705F2154BCC4FA2E47B941B [email protected]
143,612,625 *0DCC9DC1673D3BA2D8887B3F3F1B68B741715AE8 RIPPERCHLOES
143,612,626 *0DC6929C955F740415C5920493E6FF62F2ED370E RITAMACNEILCOM
143,612,627 *0DC64BB597E68D070DAA8071703DCE7A00D2BBB3 [email protected]
143,612,628 *0DC580020BF7AC3B3F38A05AA009947D2724679C rkien.kaukalon.(there.in.the.manger)
143,612,629 *0DC5FA30BAE611E2A252D0A3F1C3685396B4E882 YVETTENADEAU
143,612,630 *0DC0E438F27144B36DC6AC36F20FC8BE50D88672 yynyist2
143,612,631 *0DC48B096066E7A665F61B2C83D7BF15A8BED20E Z662555
143,612,632 *0DCFD1520659854C15464230812812BA6CF5C7A8 ROBBYPARSYGNAT
143,612,633 *0DCCB45B25CAD38B1B374FD8BF33469784B45360 ZABIN FARISHTA
143,612,634 *0DC8B409267FC94C3DD8F2C856F8AA62253A10F0 zacharyfraley
143,612,635 *0DCECFAD39DF1B0F70F266451E1C8D95F73D6E06 zayne.soobadar
143,612,636 *0DC303F8E935D83DC11FF0122461A724F1CC477A rollandburlando
143,612,637 *0DC22363D57A6FC9AF7832B2AAE82DECB69621E6 ROMAN.PARTON
143,612,638 *0DC0DF09138B5369CFDC48B6E806D40E1AC35BD1 RONNY.KRIST
143,612,639 *0DC99755530A7A28443864A5ABB52EDEBDFFF941 RONNYLUNDGREN
143,612,640 *0DC064AE64098A9A1DD31BB33C71BAC3958B2078 ROOSHAK
143,612,641 *0DC70D1C49413522C9A1AC04B74B031A6145FFAB ROY.CURENTON
143,612,642 *0DC655967792C14570C60106667C07CAA235C4AE RUEMIRPD5
143,612,643 *0DC5061CA7E602A99475086273DD4327DD7C93C0 ZOANNAOZ8
143,612,644 *0DCE7D44421FE620FAA59B2014605A92E594D6ED RURUHÚḤ
143,612,645 *0DCD7379E8F73B9CE9C33EF9CEBC01FC13238605 ZOE ZOZOZIGGY SHEEHAN
143,612,646 *0DCCA1B3E89410640F68DA09C3DED73D8AACC22E ZOOMANTI9
143,612,647 *0DCF76DAC783E599DEDF0D9B82670A94B6B904FB [email protected]
143,612,648 *0DCAEAED57043F449A0D83905214207FAE259A8C zynal.ali
143,612,649 *0DCE3C6440EAF92DA12187A080EC6E0E08D0656C S707P
143,612,650 *0DC55C81858B438C746339D57B22F9592DE68E65 ἩΔΟΝΑΊ
143,612,651 *0DC6BB20E227D8D4CA5C7BB2F04CBA1FEB494B58 SAILING.HOME/LEAVE.HER,.JOHNNY
143,612,652 *0DC4703D9F5DDD99F65316F14F453E008E1AD601 SAIL–LAMP–GULL
143,612,653 *0DC8D11A640220B4E3ED7E68BAB23E9622B93D60 SAINTBONIFACESELKIR
143,612,654 *0DC057267FB4BA0B9E7893175BAF7E2ABAE4B80A saltrupiano
143,612,655 *0DCB6051A17B4A8B9C6B8BE610404D061E5F4E60 ВЕРХНЕСТУДЕНЕЦКОЕ
143,612,656 *0DC93598B5049C3D787BFC3D991A33B5413B3E11 SALVATOREPALAZZOLO
143,612,657 *0DC3765988A1E7F316A7E93DA46C81EF0B518E49 SAMMOLLY0
143,612,658 *0DCFF8FFE6F349C4352BBA836C3503465968457F SAMRAMBHAH1
143,612,659 *0DC39A4FC46039A8A1ED4120BEDCA5E6A52CAA35 ГАШУНИНА
143,612,660 *0DCF4DB10EFF8D778BAF75DE06CD78276BEF7F52 SANDIAPA1
143,612,661 *0DCEC982B2963429E713B4413426EAE49B1A0127 SANDWICHESESES
143,612,662 *0DCCEB37623324EFC731171389E8943CBB8A36C0 SANDY.YERTY
143,612,663 *0DC23358A0AA01F5127A30D3AF37F9EE62011C98 SANNAR
143,612,664 *0DCB5FC602AE53A97B0869DC0C529C66DACCA784 SAPPHICS
143,612,665 *0DC5D0BD32ADC16E5B21EAFD113E6BDCCFD03194 saralpita
143,612,666 *0DCC601DF6416098E40A781E8B61C25E4959E223 SAUL.OLSTAD
143,612,667 *0DCB20783BC8FFE6A0F8749DE42D1B0D069DC173 ПЕДИ́НІВКА
143,612,668 *0DCC769F767E0FD466B3778813B79927E38FA11A SCHATZMEISTERINBS
143,612,669 *0DC3A7160C0A100D4EA85F64BE9CB38E361A492A ПОТИСКУВАТИ
143,612,670 *0DC20FB0ED16BC9B790A087DB9C72C8862EBB738 scotsalehi
143,612,671 *0DC0CD7BC71C0650841DE66389C188F65B0DA6F6 scrwidth
143,612,672 *0DC7B08305C3AEBE333FD75C464041CE30DA8B5F scydmaeninae
143,612,673 *0DC47BA23D7450DA08C1787E41F59E44003B4DC7 sdnibmoc
143,612,674 *0DC5DC00C96D314A7753202F5B7A59C7141477C0 SEEKLEGALREDRESS9
143,612,675 *0DC12396FCA19845F5E0E6D238F30439ECB02439 [email protected]
143,612,676 *0DCD5888D49EC23ED4574B934D0715B54501B2C3 югон
143,612,677 *0DCFC229335A58E348F3AE0AE280B5B59668FC1A 事故後ケーブルカーの運行は再開されることなく、その後は24人乗りのケーブルカー「gletscherjet
143,612,678 *0DC0FCD3D010A8FBA5912C6F1095C1CCB7445B51 SESUEGARUOC
143,612,679 *0DC006CF0A5C72477278637093F362CFB373D189 S(FEATLEAD-VOCAL:FERNANDOD
143,612,680 *0DC9E791228AD601E02478759CE717A7701EDAF0 sfrondano7
143,612,681 *0DC628AABB232B2DFE6446185E84BD2C6B7636DC shanelach
143,612,682 *0DCD683273A24C99D0EEBB473F6206F33258DE87 SHANERAKESTRAW
143,612,683 *0DC431FD084AA0A9ECA6870DBED0D5530B97B61F SHANNON.DANNIELS
143,612,684 *0DC4A01C3F6E502531BE8EC2E041F58689F6E0EF [email protected]
143,612,685 *0DC03DF06549A653C1B9CDBF123D78A17196C439 [email protected]
143,612,686 *0DCB217F5BA3B20A5768D915CB873447D6459E5E SHELTON.MARTINIS
143,612,687 *0DCAFFD7A0B689AFBDB474A002BE0F76A0EE0ECF SHIJUKLPM123456
143,612,688 *0DC37C26FB71DF4A8FB1CB7FA0BBD3E88B98986F SHLPLJNJYY
143,612,689 *0DC08CF830E12959093BD70FB261D917F94F6394 [email protected]
143,612,690 *0DC7D8E95ACC2AAE89B85B49CEBEF4316DFBDE32 SHOOTERSPENCER9
143,612,691 *0DCE92A464723C172FE8274BA0B37740E711ED7E SIGINCAQ
143,612,692 *0DC78CBFDCE5CC3ADFEDE0C2972FA3A01BE016EB SIGNEDSUCCESS
143,612,693 *0DC2DE0BC1FAF1F499BDB6B0041244DCA0397087 SIMON.GEHRKE
143,612,694 *0DC433A476625D519312311CF8C1C0F226F9554A simplifiez
143,612,695 *0DCE2BE2EAC20CB0C009654B5AEEA9DE39B5D312 singinportuguese
143,612,696 *0DC469B760280B47C75725154D3D2437592AC2D8 SINTAKK5
143,612,697 *0DC3A2F0F596266376D5A6CC09FCC2ACFBCB42E7 」同様、表題曲のSUNVER
143,612,698 *0DCF06EFAA586E4330D27FF7217994C77ABA1561 の大容量モデル。メモリ容量は2GB(AMAZON限定4GB版も存在する)。直販価格9800円。
143,612,699 *0DC1909DD767ED04CD65867DE90E2EF70A18277D six916muff682
143,612,700 *0DC4C35848ED0F516F6CB1D54F228A022E952E23 sjsharkie
143,612,701 *0DCA3EEDCF6CA0A0EE14B428101AC34CB3301208 skuev0102
143,612,702 *0DC4A9FBA9146915ACF61B059B178B1D7110B379 smjestena1
143,612,703 *0DCC76078DA375EE253EB51376B7665D25D32B36 SNOOPYPEEWEE1
143,612,704 *0DC077CCAE1A02254BD3C3C82D0B8502AE52E1C9 SODALITHITES8
143,612,705 *0DC2B40DF8A824631ADE42F9B8549A30F66F6CBA solomoncastellonese
143,612,706 *0DCA2025719794E5ECDF0CD937A101C242936E9A SOMMAGE0
143,612,707 *0DC538DD20B9CBE7C22DD589331003D3DEA38DC6 SOMMERDANIEL
143,612,708 *0DC6348DFACF50E03CC1D12F01A25E2707C10053 SONARBEJDERNE5
143,612,709 *0DCB7A081802DCCBDE6CBC455094EAC2E7CCA5FA SONDISHINGER
143,612,710 *0DC4B6D59740B05D24C32C8486E1546EA45AB27E SONOTOHTSORPME7
143,612,711 *0DCAF7AFA40D3B4E8C38B3CCBA5F8A54C1C762B9 S=OZ
143,612,712 *0DCDBC26D788C157D55D030035EB267027890286 sozius
143,612,713 *0DCAB1B149EAFA8AE06402B0BA16134B4417CC14 SPECIALMOZART
143,612,714 *0DCF2A6694D03F99E01FEBB2B2641CF5987FD13C SPECTORSING
143,612,715 *0DC36D74F0EFB14DD08DE8A8B0915F771CAD4811 speculative1718
143,612,716 *0DC4B3758861607319976D8239532257E161C528 SPESIALFONDETS
143,612,717 *0DC884738A9DA7329EF750C2C23D477958F872A0 SPGELSESAGTIGSTES?
143,612,718 *0DCAA87EF64857A125001977EDE5044E843C9AB3 SPHINCTERO
143,612,719 *0DCFF853E3AFEBD857D3ECA88D6A29349BF86CA7 SPILOOLB
143,612,720 *0DC3807118C9B6AAA2E399D15AA59CF28385E011 sredmretneduts
143,612,721 *0DC771938BD4A1F4BAA8C54E4EA93750D55CCCEB S<R}Z.M\CW>W62
143,612,722 *0DC7FB280EA14FEF7D08CE883B232D41CA2F24A7 [email protected]
143,612,723 *0DCAE8AFE2140C0946DA8FF42477C51306B59454 STACYDUSEL
143,612,724 *0DC910D57F9BDBF84952D318E232E19BD3D6D72F STERMINIO8
143,612,725 *0DC7D4D3040BD30DEC11DAB8E2D2F4CB938E4151 struttin'-in-style
143,612,726 *0DCAB0BF3A6A58895335B1478FAC58369FA47FF5 STUCK-IN-BASTROP
143,612,727 *0DCF799D3A4E098D4BC79A5E8ACCAB1BBB43407D SUBARNA.ZAMAN
143,612,728 *0DC18A155E93CEE9486337A53762F1C506739E3A SUE.REDWOOD
143,612,729 *0DC7018B86BC48C5C4F45D927EE22EB0C31CC787 SULPHOCING
143,612,730 *0DC30FFDFC434BFB6CFB057EF7A56BBD0A59877E sumars
143,612,731 *0DCE0935212CF8AEE11C61AB52879C81EBF75B6D [email protected]
143,612,732 *0DCE82356C4D0A3C30A0732C7B249FC4BCB223ED SUOLLEBA
143,612,733 *0DCD7B3972A253EE30BBFA2334E9D077888BD2EC surfnked12
143,612,734 *0DC0DAE49607198D0BEE30D0D3C36386859F71BF SWEETSORROW341
143,612,735 *0DC9FC43F42AFE0F7E8CE1D840495EC30B3FA8F3 SWIMMINGGENIUS2
143,612,736 *0DCC826464CBD4D2B07D5B1A3D8B24F571E94DD3 SYLLABIFY3
143,612,737 *0DCDCE58DA20D80471915E8A8DE6EDD3ACB1EABA SZEGYEN3
143,612,738 *0DC2575C243001C3D9ADCB88B598D20C43A4394D sziveskedjék
143,612,739 *0DCCE6CB629FB25DFE7E15D1719008564B6AF98B t!
143,612,740 *0DC3ADD0B3C059658C4F5C9E88BD9D9FAE65B9AE 099JAMISON
143,612,741 *0DC32803E42880F5386669D43870040B4A34AA2D 09F6B9A48E9D3132BFCCF6481C53CBF8
143,612,742 *0DC9F5A9C7CC383DD96A7C2AF609FE5498F6290C talk8615447187
143,612,743 *0DC079EFD1485774CABB5CCD1DCF0AC23D140433 (0_<)-o~-O~<###p
143,612,744 *0DC6FF9C73D686B068F010C9566023347F94B8B6 TAMMYTIGERS4
143,612,745 *0DC908649DD4AF1D755E1D286DFD9FE55FFE0475 0ybedivi
143,612,746 *0DCE92B90AC319E1FCD2731C0544BD12823CA27C TANKERING7
143,612,747 *0DC8D84E496C6114634DF4EE1CE51B368BF4C219 targesin
143,612,748 *0DC272A8CF8AB483F5921CCC58581FDC23CB6A4D táslerom
143,612,749 *0DC86736B7D581DDB8C9CC6AFB9E849137BDC9AE 1209217 MEHRMALS-ENTFUHREN-IHM-LAUTE-SEUFZER-.
143,612,750 *0DC0B706F95DBD90C210E1C40697FB0E0CCD7C8C 12150 hehadstitchesoverhislefteyeandcheek
143,612,751 *0DC876E98CB173A0801614875158DEA6DEDC2FBE tdp4xo?cambodiadzswdttbb
143,612,752 *0DC272349639598C5E20D7CD627C665CB64265FA 128-gerCekleStirir
143,612,753 *0DCF5424C8E24FBD45BE043F4B237F1453FE7AE2 TECHNIFINISH9
143,612,754 *0DCC4DA8453CBF7FED0A74D526F6C8AFF97A8EDC 131363 RAKENNETTUYMP
143,612,755 *0DC9E3CC969E9221DC3E0C95DCC200BDABA66B17 TEDYIU:PASSWORD
143,612,756 *0DC650DF633A1CF1AC04D9ED47785A342320BB60 telesmeter0
143,612,757 *0DCF6F604A49631E9492A80D0697A02E13D0F794 TEOREETTISELL
143,612,758 *0DC89DEDD9C597884EE9B367BE53244A88EE8D23 13DECEMBER1474
143,612,759 *0DC6BA72ECDD028CC1FEEDD1E38B8497B08F50B2 TERMOCARSIMO
143,612,760 *0DC3F152357608125E1F96311D83F53DF9A9B066 TERRACEEPOCH
143,612,761 *0DC0C2A7CE7EE46E6F571D28E8E6B07B8D8D9F21 145sadie
143,612,762 *0DC4BF25B304D83557386612C32ED7E1DF6FA679 14A仕様機だった。なお、イランのF
143,612,763 *0DCF0447BA6E66A1D8E2C5EE6458C482715A0E7C 14VNING3N
143,612,764 *0DC0222579F3AAA84EA8F31893920D48CC5A8063 TERRIFINCHER
143,612,765 *0DCC080630D14684061B69B3D3A317F39E8EEC47 TEWHIT
143,612,766 *0DC7C5AA2BBCB18950DC5C45A938739823980727 than-g
143,612,767 *0DC0657514BC258100C3DB74BE0398FD1EEDC288 THECHALETRESTAURANTCOMWWW
143,612,768 *0DC8A0FCDD6154E41424610B5CF6A72261ED488F 17er41sm
143,612,769 *0DC642F416423A117E899CD29117BA36911338C7 THEMARINE49
143,612,770 *0DCF15299B076E3019669E4AB9DFCABEB99C2F46 The.Night.Gives.Birth
143,612,771 *0DC960DD4851DA138BB51BB499036C05663ABAB4 1.ARMENIAKOS
143,612,772 *0DC38122E6A91B45E2FA38373D2536399477C454 1ASPECTA
143,612,773 *0DC30209E682B7F0A46D526182C487F15254C831 1AVENHAM
143,612,774 *0DCAB33A2A21989B90F8EA2C1FC4D55BDA7A40A7 1.conti-park
143,612,775 *0DC470B0FBC7F8A729BE41F487921F2FF8FD037D TIADIMITNI
143,612,776 *0DC80179892DE8BB27DCB3665FA40D4F38CAA593 1erlaubnisscheinen
143,612,777 *0DCFDF28001EE761ACD2B52155D2D22AA1B9C101 1FITAVIRP
143,612,778 *0DCEC3AF97DDA9C7E019646B01CDA8C5B6EFFF8A tim.hartfiel
143,612,779 *0DCBC782068AAEBC3CA59FA8551E2903A67DAB64 1grundeigentuemerverbaende
143,612,780 *0DC10ABCF1334D297829CE12A48E435115A80D7C timothycanders
143,612,781 *0DCB380E92BA8288AADDB0806FFC1CC8A61A611D 1gutachterstreit
143,612,782 *0DCA56B810DDF2BA996E932CF8D6EAF8EB7BFE1C timpen2
143,612,783 *0DC96F3E0031301986297B902182C03902326015 TINAMASTERS
143,612,784 *0DC3696AF7947E33FE9F769C3630A4F5193EC7D1 1HUNDE-IMITATE
143,612,785 *0DC8916EE22196F996B4FC434B44474CEB54E337 tjärned
143,612,786 *0DCBA7AC725DFBE47A2A6D73A4D9AAE54A45B8AC toktybayeva
143,612,787 *0DC8D6A0FD2C77E03ADB89C1B8916CAF293732C6 TONEY.MAE
143,612,788 *0DCF8BB2FC42054BC0585038EDFAA7E77B67FFBC tongue-in-cheek-bill
143,612,789 *0DC52CA85768B4CFFA15213DEA8F4810A2F42314 tony-fogle
143,612,790 *0DCDF0FE8EA4FB031D05BB9BBABEA092910C5FA3 1-mutter-tochter-paar
143,612,791 *0DC2E91D2FFC105D07DE4475A0D684CED0C7911F 1NART1F1C1ALLY
143,612,792 *0DC82A9B2A1EE70B6F0BAF32D297F965A9941AB3 1.NN-LEVYJ
143,612,793 *0DC26D0A7C225ED81E63B16A41A6E119E9CA4AFA 1 NOT-NOW-BUT-LATER
143,612,794 *0DC37F80A90B14734D43C66F2596CF6388907721 1reiterschaft
143,612,795 *0DC858F5E18C86E36E1F3A79200005B8D799384A 1-safarifahrer
143,612,796 *0DC9DFEC3C257C215503A19B99DB631F5295C044 1.SLOCSPRECHERIN
143,612,797 *0DCCFB0ADFFB4EC7D23AA06B8B8B2EE0878BDE38 1.TEHT
143,612,798 *0DC83D3876F09ADE52315892CB60B5E7B1A6383A 1thatconrad0
143,612,799 *0DC53794A9266A7C05EE415235D5266882E938B2 TPAMRIKSO
143,612,800 *0DC78FFE4F18327AFEA692D10CE7E4C10773C019 1transients
143,612,801 *0DCFC6FB1E68E4D69EC1C42D8850AB25D1CC9ABF 1.VERONHUOJENNUKSISTA
143,612,802 *0DCC9F00E1DF25A0507B60B2AD7CC472799408A2 1WATERCLO
143,612,803 *0DCBA7F8141C0CAE839E3C76A647332A674FE187 1wedon'tknowwhere
143,612,804 *0DC73404E58114CAAFF1AB28603B559D7FCE3FEF TRAVIS-GREENGRASS
143,612,805 *0DC861F447696C26DBB10877D545E8575DED974D TREE.EXTRA
143,612,806 *0DCC11BEF75B864CEC3CC972CCCE405458EFCB0A 1ykrauhanturvaajat
143,612,807 *0DCE5632799611FCE456F5F59D0E98AA5654234D 1.zeisssprecher
143,612,808 *0DC8E6E462639753D63249B4E49D999DD3ED6B43 2252247 ATOOPPINEN-IHOTTUMA-SAATTAA-OLLA-PERITTY-V
143,612,809 *0DC104CBCC4186F75E8BA4A07B638AAD57A334C4 2304733 VERKKOJAKSON TOTEUTUKSESTA VASTAA JYV
143,612,810 *0DC909A5187665988B46A64C1C4F321389A2F47A 236SICHERHEITSMASSNAHMEN
143,612,811 *0DC709EB61F4E1BFDA3DEC529B2640A4BBBAD6AD TTORBERED
143,612,812 *0DC270B410847DA6034239A8E6168A21AC5A62AD tubulusepithelzellen
143,612,813 *0DC89ADE65A89A71191ED8F10CB0D7591629BB36 TUFFY.GOODRUM
143,612,814 *0DC561C5230F5D4F37B4A0CE336310762E547FC7 TUSHARHOSSAIN
143,612,815 *0DCA06D3F311012792396481D3AB3DE15C4FD42E 269802 VERDIENT-HAT-WERDER-DIE-FUEHRUNG-NICHT-.
143,612,816 *0DCFB9942FBB4A69033871A5204FB09CE77A4596 2756941 KUN KLIKKAAT PIENOISKUVAA SAAT SEN ISOMPANA ESILLE
143,612,817 *0DCF1EB4B143822ECE2607E2749C846B6EA033CF 276494 FIRTINAVERUZGARAKARSIDAYANIKLIDIR.
143,612,818 *0DC5CD0532AD83D1C3239896C5E6E5D0BAD9C4B6 TYRON.SCHUTZE
143,612,819 *0DCA99EB53F1CA09B5E25D13C651E60A8A0608D5 28753 bUyUkhanlI-IS-merkezi-daGlI-apt-
143,612,820 *0DC00EE25BD0594A66A7742CC735F28467954830 2929564 HAKEMUKSESTA-J
143,612,821 *0DC5A084D061AE87CC9736F3DC550659DC8D07C0 2AEBTHGIL
143,612,822 *0DCBA49C889C36067C8DEF0177E21CF8C66E9C64 UBUNUBUNPALAK
143,612,823 *0DC308899ED622F20A22D2D0FC43AE3BFFEA8571 2-AUTOIMMUUNITAUTIIN
143,612,824 *0DC4CB62F1AE17A04442EDCEF264344718267CA5 2-CROTTS
143,612,825 *0DC458AAA3F8CB2684CA8EB0F363B25F5B1FC9E0 2EGACRAP
143,612,826 *0DCDE8A3B917DD6C94997C75023361EE4A10C400 2FYY46X4
143,612,827 *0DC592005FDA1C6A3A08BBC2C90DD1CE180EF30B UITGEKINDERD7
143,612,828 *0DC9765316388D3DD823DE24F33F82C263C0E571 UITRIEPS1
143,612,829 *0DC5522CB53FB12C7CE93BB87E5CBBE4231EF6B9 ULJARSKA1
143,612,830 *0DC2CB5E87C1CF7FE06A4B992FE13C758083EB68 uncalculably9
143,612,831 *0DC93E0EB6A8CA1A9B8A9009B81790202138CCDC uncomp141n1ng
143,612,832 *0DCA0259045D742F47D9646E0C886E9C4AB7ADC5 2VERRELLE
143,612,833 *0DCB4BDB5B5C8C07F9E5AAA95BDAAD416EA9BD17 2YEAMNATH
143,612,834 *0DC215761758E368556FDC63447968BFDB6B5FCB 3051978
143,612,835 *0DC68336B0F65B617A98A5F0DEA5DD1189E4AB12 372314 kun.ostat.s
143,612,836 *0DC2D5B83AE43E20223DF0EBB480B76792CEF05D underedge!
143,612,837 *0DC9A5FF74D3A842A276D0BAD0FFAB3B60B4DE7A uniform4l
143,612,838 *0DCA9260E667B9E7914808DB2609CFC07442534D UNLU5TIN355
143,612,839 *0DCACDAE4EFCF955855802B7A121B76C29D5A4D3 UNNATUERLICH8
143,612,840 *0DC18DCDE1FC8E4F4E5C6AAD76182934CB7066CA UNPASSIVELY6
143,612,841 *0DC3499BB5396A32DF79FDD3D73698ED627F561A unsafe
143,612,842 *0DC9A2D01D6F5FE32908D54B09FCD39CBB3219CE 3 azlina
143,612,843 *0DCA3802A39C33325619EAE1145EA28B7CD67E98 3-disci
143,612,844 *0DC77037384519236ED0B960EEF671C2EF7C56A5 3==D~O~O}O{
143,612,845 *0DC9D6E4AFB811EE723DF5E4A4BAF316BE093E66 3EZILAIPI
143,612,846 *0DC3846F2EAA477380647B95006E52808B922DEB user19319577226
143,612,847 *0DCC4FB5CFB4728EA12BC4BB38E345B47B3B8FD6 3myhamlet8
143,612,848 *0DCB23BF764C49024F8C1AF77EBE8ACED6913698 UTRGA
143,612,849 *0DC20FB7DD804E3A8F78D9E4AED757659E33FA91 [email protected]
143,612,850 *0DC7C9195E45B7D565551D556BFBE9646921B30A 3=)-~-`splat
143,612,851 *0DC8217DCB60A3CC062816739615CFE17957CAB9 3#####>**SPLAT!!
143,612,852 *0DC5873A88BE129555D62C1503B69359193EB2F3 v3r0nica
143,612,853 *0DCBF581CEF09DCBE6B770C9FE9C9A775C2637D7 3THENICK1
143,612,854 *0DCFED715286CEB9E8D258E63F2A42231E4DD6BA 3USAMMIE
143,612,855 *0DC444D9A670CF412B01679E09B3F59DE30BBFB1  VAGA
143,612,856 *0DCD8FC05DC57B9D32D52B3F844A52C8B290C45F 40.TUSID
143,612,857 *0DCBCCA3CABE445EDD92B68BB72EDE4E68184F4F $413-B1OC
143,612,858 *0DCC2C1F4CBBB1598C06E0BA1314265E9E126EDE 4212knm4212
143,612,859 *0DC621865E91A8ED36E6F080E4E4ED00C5A16511 44GW
143,612,860 *0DCD4C1738DD04E7D923575E10315A45907AA385 49557 jokaisesta-henkil
143,612,861 *0DCE63C434AAC30F425F33DC39ACB55E40295D0D vanessaaporettaa
143,612,862 *0DCA99482373EB28D5702E98E95CEFADA2E591DD vangerlenedavis
143,612,863 *0DC05631F6951D7FBB81D1E19064F32F28709438 vanillabro
143,612,864 *0DC94102D5A31B21BED85BCFD31C7CFB3DD4CBD2 4LN4HD4
143,612,865 *0DC4C76E12FA45990E52E37595317317872BA9F2 4LOCKOWITZ
143,612,866 *0DCB5BAF5177E47C3CF9E10ED4918721EECB5492 VEELGEVRAAGDE
143,612,867 *0DCD0280AC3CF75CA2AED1910BE6E12EB4C0E137 venditat0
143,612,868 *0DCFE2BE5112E1E926F0B2C72503784003F4D420 VERNON.JEDREY
143,612,869 *0DC198CEEF250215CA00D4D7B8684DE24CDE0F30 4ONDERGEGAANS
143,612,870 *0DC8A2712617748B4255EC1B3E3B68675EA5C2A1 VETENSKAPERNA
143,612,871 *0DC13650D50B878980D0427A8C658FCA1D5C5561 4PREREVIEWNT
143,612,872 *0DCDE76D7553596E95682AAA8DF9B5FF243FB435 4PUMPKINHELP
143,612,873 *0DC978856883D3E3F0722F3E4FD82FFDD132B319 vickyhuynh-huynh
143,612,874 *0DC91C84B229D679AB5031C5997266BCA235E573 4void3rs
143,612,875 *0DCCA3DE3C08F3834F74952F8D8197178FCEEFF5 VINOD KR KUSHWAHA
143,612,876 *0DCA95F83D854F02C53B40240DEC27142C8BA421 VINOO VARGHESE
143,612,877 *0DC2E17E66D993875CA09AA650E3F9CAFC6989D0 VIOCESOFVIOLENCE
143,612,878 *0DC2081A4B27D08C860E3EA610E55EDCBC78909B 4ZAHRNUJELI
143,612,879 *0DC918C7A817DEAF0080A7AD80FD9540A091D8AA VIPRIYE7
143,612,880 *0DC5B43F013F8DBB35419658787CABE58937E8FE VISIONMONDAY7
143,612,881 *0DCF3EBA847BFBA2A8F0465290F41AC6A7575530 VKJL
143,612,882 *0DC904A2C5156B463C752ADFBAB3E3BB45C07605 VN"T
143,612,883 *0DCCDD6AA608F3BA3A1AFCF59550218B3EA12DAC volley1973
143,612,884 *0DC0392141D95A3B4B2039B2BA4F0F89DC235782 VOYAGERTOMMY4
143,612,885 *0DC311CE90A7D5D516D1EFF0C0773958890E9461 589037 undehmandenkt,machmalhalblang!
143,612,886 *0DC6CB59E32FB2A893F311A92066ECB015C96C6B 597348 KYLL
143,612,887 *0DC2E7D48A3DE3D8E1DF18E49159AC756C27F4F1 VUELLERS1
143,612,888 *0DC2A3304540CC4E123184C126B14ADDF2346D1D VYMOCITE1
143,612,889 *0DCECDC2021E00A37373101B126F3D6DFFB36C47 5BULLDOG6
143,612,890 *0DC849211F549E77C76CB445EE53964946DC8B4F W8EMMQUK
143,612,891 *0DCBDACD09EF5D953CBFC008164A9A850501BF7B w&)a
143,612,892 *0DC9706B57D5250B1E8B4F4898BC73220BF9BCCB walterangawai
143,612,893 *0DCF0299F5A749568D72837A6E515CF02EA5A5D8 5EKATERAS
143,612,894 *0DCC52E09548DE0A820176884175F2552D91A3E5 5epipleurae
143,612,895 *0DCED90C63F93642BB0136B326ECDB319BEE46D1 5GNIHGIELS
143,612,896 *0DC41902FB5813CD8864744AB39844EFD5732546 wardwarf
143,612,897 *0DC84E329522BA43D8E232AE098D748F2DA3C21F WATCHBOATS9
143,612,898 *0DC04DE687E81B2D8B14FEB77B97046F4BEAC606 WAYNE.BIERSTEDT
143,612,899 *0DC99B3ECC06611A81D7B3F66B935E129C20797B weldontrachte
143,612,900 *0DCE319037872F5E0AFEA5545BF02E1BBA0889E9 WELLLIKE1234
143,612,901 *0DC68B03687783B684D7A07773E8487196315990 wendyjanier
143,612,902 *0DCE98447F04827FE04617CEED72CE337DA30C7C 5 MERCIL
143,612,903 *0DC551ECF9DC6835BBF8532321DBF1F21CD8CD82 5.PENDRILL
143,612,904 *0DCF34BAF4474D3BED80B80BD6B4FF9A56E31167 [email protected]
143,612,905 *0DCC2B4E5D19E252A9094B9E008B112B8B05DB42 WESLEY JAMES HOPPENS
143,612,906 *0DC995EB79DF923D2C853814C22B6F136AD64E9B WESLEY.VOMASTIC
143,612,907 *0DCAA8D9B3507BD05F31D189F2862EB52B28ED69 5RUGBYYBGUR
143,612,908 *0DC7FFE4D54347EF857A6CC8D680025FBD548A16 WHITNEY.SIPE
143,612,909 *0DC4E8BEE970E447B1C34454EE5ED2F451CCFF24 5thekiwi5
143,612,910 *0DCCF863C0A669CB08272AC2A44FAC6D1BC30016 5TSERCERI
143,612,911 *0DC413E6D21B48AF34B1BE55A3293DD773C687CD WILBURN.BOLAY
143,612,912 *0DC1CD757EA0B4C6ADCC1E37E30FF8C6D730A4BC [email protected]
143,612,913 *0DC773D9185F1296CCC7BABF0648B88C536A55DD WILFRED.BLODGETT
143,612,914 *0DC0562D29F259A815A184A13FDD79FCFBF58A3F WILFRED.HURLA
143,612,915 *0DCCADA546A4877DF074E2F557ED3D0F714B6CBC WILFREDMONTOUR
143,612,916 *0DC2F3CE349457EE5A377D8ACB941E7723F1BB44 william.patrick.delgado
143,612,917 *0DC217737293FD85DFA6C5509DE0E7EF15EFF1F8 653537 VALITTAJAONTEHNYTT
143,612,918 *0DC7A2ABFF2063B61C776DE3BF89D81CCAD0F283 6BONHEURDUJOUR
143,612,919 *0DCB6B9E8E430F38C1DD611AF78542FBF93E8FA8 6CALVINSNAPPLE
143,612,920 *0DC158C0B172AFC6B5194ACAE3D288E4272A0E9C wing.sum.chan
143,612,921 *0DC720BAEEB5B4325EA4DB330F7E274F8324CBFD 6CATSROSIE
143,612,922 *0DC7CCB41BA5DC42C864E3FDCD05F2F6747A172F 6DEREKMAXIME
143,612,923 *0DC3DD559E994EFCDD92744AAEC946FFA869D349 WITHOUTENDSESSION
143,612,924 *0DC5F87EB700EB136BC3D9ED925C7D1AEF75C3BD 6EJECTERONT
143,612,925 *0DC729EB0E09D3A159855AEC519B2C4F73C14C86 6IHGREBIT
143,612,926 *0DC020ED0EB9B8FA0FF9EBB442F84B6FB68242B2 wkwxreuxes
143,612,927 *0DCD97DC265FCFEC0B0BD8C38A9EB44387FF37A1 [email protected]
143,612,928 *0DC00B05136CD8F182144D466A8DA71EC10A8108 WOMENWOMEN
143,612,929 *0DCB92D192B1F53F4D8508327A436CCAF563FE6A wonderschoon9
143,612,930 *0DCCB0C2041FB0A871C816B8E0B262B313B71637 [email protected]
143,612,931 *0DCE937E7A1CF5796CC59F0FA2D41CD57259E455 worldnewsband
143,612,932 *0DC1623B538698BFFFA1D218B44C85EA982DC2BB 6OLLIESTINE
143,612,933 *0DC56211756D5F7F3ADD4934F89A5D4C82A26E5B 6PGQ
143,612,934 *0DC9B7CCBDB909A529D6EA2E31990A29B4704ABA 6QMMYUNG
143,612,935 *0DCA6C8B9E04C4900EF20E607964D38DEC129E5A WT?P
143,612,936 *0DC7D8DE493D033C53BDAA96BA4E0CC5658E9DF0 [email protected]
143,612,937 *0DCA246FA42E81BC9AD0B27F2AF69F43BE9E03C2 [email protected]
143,612,938 *0DCB0B27A5E12CEDA5FFBF6CAA3006DF6B63D5D3 [email protected]
143,612,939 *0DCB9B0AD91DBD7730D4BF7AE31181D539F357B4 6SNOWBALLWINNER
143,612,940 *0DCF3275272A9FC8C746A14E5CB6D4FFC26E53BF [email protected]
143,612,941 *0DC1C78C821A41E0F1D2032B7AC34A40E0AAE04D WWW.BODYKNEADSMA.COM
143,612,942 *0DC7721CA0E5FBD201727EF3A6AF670A18C980F8 wwwreminisceonthewebcom
143,612,943 *0DC53EAAA30BD3378D27086C7D51AD4D99D392D8 738322 kantelu-antoi-kuitenkin-aiheen-arvioida-p
143,612,944 *0DCC42EEE258CD38133CFAA0DAD081D3386BBC0E {x}-`-(###b
143,612,945 *0DC0259EC4CD0188481895469539653190E293B8 [email protected]
143,612,946 *0DC01367ECBF82A3899FCD22B2A55B24C1E58B03 [email protected]
143,612,947 *0DC29E377E4E58854CFE790ACB9767A2C2823299 [email protected]
143,612,948 *0DC4C3EF9CB0A3C5C7DC751672149E631A53B6B9 XIOMARA.FLORES
143,612,949 *0DC1A2476DB57B5D990BD53E3A56B923D5BE740A XTFA
143,612,950 *0DC68557C683F409801C6ECFAAE6783C5C6C3B29 7CABRIOLETN
143,612,951 *0DCD6A178FCF39E3816B9995F0809718055A43F4 [email protected]
143,612,952 *0DC75ED781ED239032366A518872124963DA4C58 xwy
143,612,953 *0DC407AB6561D79B99BA2E4BE1F9A3BEE189F1E3 yadgar.koya.koya.koyaa
143,612,954 *0DC8BBE90986115CE7F11D230A47CDC32478D889 YANIVTOLEDANO
143,612,955 *0DCD033698CD15B52E2BDC1BBA04C9D26954461A 7KEOMAILANI
143,612,956 *0DCAE5B21C3CCD0F97B2F791A94BD2AF02D9B016 7LOANPAWNBROKERSHARKUSURER
143,612,957 *0DC12EB896DD5EC3C019F032F22CBEF1530A8158 yewjinkoo
143,612,958 *0DC30083088C81A2EF2D139C16B1FA27109463CF YHTEISKUNTATYYPPEJÄ
143,612,959 *0DCCD711B2F8F21607BC6525110229ECCE839FDE yijtikos
143,612,960 *0DC42F78C6C0FCB2E14B52A2D961B602026C637D ykeipyhtdl
143,612,961 *0DC030866FE120446922433AD2A882418945E3CD YLSUOIROTCNUFREP8
143,612,962 *0DC293B178FDEF35C8546B1DD19E4725E5EC1C71 [email protected]
143,612,963 *0DC65E096DB8FB265D478E4C7330DEAA97879FBA 7.SYNNYTYSSALIN
143,612,964 *0DC63E9BEEED9552ADD50041FE706F4097DCBFEA 7TEGENONT
143,612,965 *0DC64754E45FA00BAEF124591B0BCC36F7CD23AF 7THEIMMEDIATE
143,612,966 *0DCEF735647FAC28A9E383336C68C6FB91E9CC17 7WOLFGANGSERVICE
143,612,967 *0DCFB448D2F48AD3EB3F3DD404E9B6020A97BDB5 824ADDYSON
143,612,968 *0DC73F8844B6FE5A4AA674C0F2DF3A4AA308ECBF 88464 acaglasok
143,612,969 *0DC408864AED579EC87046E28E1238FFBAB9D9EA 8AIDPROGRAMPROJECTPROTECTPROVIDE
143,612,970 *0DC379F76F4D1C82FF20D1F63E9486E388270892 8ASSEONAS
143,612,971 *0DC246736AE40A6C1365EA5C3456D9FFE1BE925F 8ATROPOSES
143,612,972 *0DC71629767944BF9F64D90BB8939A43FB852682 [email protected]
143,612,973 *0DC1FD2AF2EFDA1203BCC554AFCE5969F4D6CCE1 8BESARNOS
143,612,974 *0DC4BF22D53537D6FA4EA6D141D4E71083D7B929 YUDITW
143,612,975 *0DC08FB87ACB7D424010AAA3AE2136CF93F0D2A4 Z133564
143,612,976 *0DC17314BFFC7B8F84FD5C9FA5703CF5A38FA4AB 8DICKHEADBOOTSIE
143,612,977 *0DC0802E363ED02E7B9721FB8C8EA0172A5A3822 zacheryrohowetz
143,612,978 *0DC582B40D3F27BC520822C5AEE5E96638D998A5 8GAMINGBOOKS
143,612,979 *0DC61E82AE6797112264308551CF2E774A3B486B 8iluvterry9
143,612,980 *0DCCE2AE5A76C8B194CE51075418966FA65F3888 8ITAETALOON
143,612,981 *0DC5BFACDB33195DE12AAF83814E391E53BADA02 zaphodcaptain
143,612,982 *0DC090D0B2D3A3816739CDEA491C796517AA724B ZARINA.KZ
143,612,983 *0DCD7923E443CD56C5C5639A1D20CB445994D656 8MMRTFCTN
143,612,984 *0DC3E2535432C5A561342030D3B55077FDC2AB0A 8NUCLEAR
143,612,985 *0DCDE9893AF8FD8201ED99D013FAF66FCA0E2AD6 8###)~}O{
143,612,986 *0DC2DEF26E46612A9F9132CEA96324FD11D3EB46 [email protected]
143,612,987 *0DC192C9A8DFBDAD78D82964577E8D324109D0F6 8PSITHIA
143,612,988 *0DC9BAB3A6AF38ED0D5FE004EFB98A7C91F60A86 8PUTEVENTBSW
143,612,989 *0DC5A377B3036FFD07A9449E07CAA9271310842D ZGURILE6
143,612,990 *0DC755B9B429E791DCD98EDF790E18D085EFFC46 8SENZORIMA
143,612,991 *0DC453DC7A71C500A3607E4B967C16C017F66065 [email protected]
143,612,992 *0DC6A85A0135E4396610DA9EA63A04C71F792447 8STAROORATS
143,612,993 *0DCC0CA6BAC8DDC317798EBF23030CFB879C13C5 [email protected]
143,612,994 *0DCE37F4F1B24FB76452F53A329F755B53AEB61D ZICAM
143,612,995 *0DC05A2AA24FA0409E4F576B206D49D3CC768386 ZOETSAPPIGING
143,612,996 *0DC386FFA46BAE986D2C24895A7312524A18E50B 9116-JUENGSTEN
143,612,997 *0DC6219DE2A78F2B1E12B260C7B8E1BC25A57399 922935 museoviraston muuttuneen kannan l
143,612,998 *0DC1FC89DD8F8297F26BF2387CFAD3C69D6DB441 ZOOSCOPICS0
143,612,999 *0DCF72DBF4E7CFF1EF6C10C6798E76C8DD6DFB02 938763 ozel ogretim metot .
143,613,000 *0DC626EF6D2C30834E4EBFC45FF150614514448E ZÖWW
143,613,001 *0DCAC4B3C1238B2FAF5BF19849FEB19C552C0E1C [email protected]
143,613,002 *0DC270920F772B6D7E43A9CF2F2327849922858D ZUPERMAN TEVEZ
143,613,003 *0DC9C75E98DE136A1E99D11EB3EEA3EE22DB60BB 94 SHUTTER
143,613,004 *0DCB8756D81183C8D7F3E012BCD907B8360396B9 9AMMAMMOLANDOSI
143,613,005 *0DCFF7231A9080BEED97D38F5214861B865DF5A9 9APACHEANDY
143,613,006 *0DCA7AF7A55DF42D2965B99EA4B05EC52F7D0B74 αληθεσ
143,613,007 *0DCD01F18FD79280C16D84C752DA7D5122E41435 ΚΟΚΟΡΈΤΣΙ»
143,613,008 *0DC43D0D17E18BD1DD3637F5B565A654BB0CD9C6 ΞΑΝΘΟΜΑΛΛΟΥ
143,613,009 *0DC23287D457B9ECFD913951C8482B843E20FB10 9CAUTERO
143,613,010 *0DC41AD6CC3F7EBA0CBD8B09A8553216A54DC79C 9CEMETERIALA
143,613,011 *0DC2639523E1772BE129127296C23077BA70271F «гигатень»
143,613,012 *0DC22F7CE11B840F29E7550E7EB27C8FFBF910A7 ГОРДЕЦ»
143,613,013 *0DC15E86EAF32618CD6317FCD953DBE10DAF027C 9dwolki8
143,613,014 *0DC0D3B4C83440F06065C70D35FC63C9FEFD241B 9gigi3
143,613,015 *0DCF01EEE109AEAF768A22D6FEF1E842533D8C20 «МЕКСИКАНЕЦ» —
143,613,016 *0DCBC91354AED9BC885AA3202BC23AAA13A3E763 9HEGGEMUS
143,613,017 *0DC48EAC928CE56C8DB4CF819FA5B576686A6E70 песопин
143,613,018 *0DCA285FD9314EE44F44904688E89F900E4A1E34 промбюро
143,613,019 *0DC2F017ACF8609D4268D7D8B172767477ABDAFF 9KASJMIEREN
143,613,020 *0DC8657B7CE56102DAC7E250B8F21A9E0FD75A36 9PRATIGATAM
143,613,021 *0DCB28AF9AD421CAD36CB01877C1858BDAFF6ED5 9RASTAEXPRESS
143,613,022 *0DCD76E6E9DA0836EBBADCFD6D9ADD0DA6EE8A06 9SALIKBSW
143,613,023 *0DC280A717D044268AC60D9AC4B1AFEA7494DBBA 9SHRILST
143,613,024 *0DCCD2AB3F0AEE9770A913144136A6828189B46E 9TALKIE
143,613,025 *0DCC7E1F6C476CA89C665B333F24B881438C3D27 9TURKICIZES
143,613,026 *0DCAC9F11314A2EC24F6199E28DF49302832C11E 9VRABCEM
143,613,027 *0DC9C2E50AC0184746A89C7362F3BD3788ABFD91 СЫЬЫНАЪАГ
143,613,028 *0DC5141FA9DE20BFBD31FFEAFE9BC594BBF55D1F УДАРНУ
143,613,029 *0DCF0486A633944030B40587C5B154175820577F A?????
143,613,030 *0DCA301E916F4C7FDE39DEAA367A94EEC321E3BE «ШАХТОСТРОЙКОМПОЗИТ»
143,613,031 *0DCDEAFC41277C987E3105343985D3F4FAEE17E1 A.)2
143,613,032 *0DC1E5E4B2A2B292DB0C271EA14EADCD6D29BDA0 a5nf:
143,613,033 *0DCB04EC6F81BBDEB8CBFBE4C8A3604E819F801F A;6!
143,613,034 *0DC2C82BCAD94D94D0031008FD2049A273871320 a64_w
143,613,035 *0DC658B5302691F55221A4A2BCC09556392A2D75 A8R1DGER
143,613,036 *0DCF3DFDDFFB391E63436A693497BB077B6B75EF AAAH,U
143,613,037 *0DCC70B7D897C614A9FAEA417F5C0FC018E1750D aaanul
143,613,038 *0DC2A537A497476693AB8054A3360C16BB4F83BB AAAT*!
143,613,039 *0DC0F39D2CBAE2E6701DF0A61BBD815199600964 [email protected]
143,613,040 *0DCCE6535E5891FB1AA251C09C58DA03EA812C34 aab>g}
143,613,041 *0DC73B6AF999A0B961E57C793D2F8D6064F82580 aabmli
143,613,042 *0DC85B0130B3552DE7507EA88D8BA82EEAFEF6D1 aabq&e
143,613,043 *0DCD44BA11790951B7736E8721CAC39E5AAB5313 aab=w-
143,613,044 *0DCE6938BAEAA9A1FE099071EB09FF410EB2C8DC AAC&J8
143,613,045 *0DC192B229970A7AD73524828193BB606CCE0B80 AACMC!
143,613,046 *0DC46FB060BC167F8A29D2BB94006D89456A79E4 AAED/I
143,613,047 *0DC182A774CCC6A4D5EB23349638FCD0CD3770B6 [email protected]
143,613,048 *0DC9945D3B3897075046569C60C4D6F77955DC68 abram737
143,613,049 *0DC30534D554AD99AC9553278CB0777B9DA142B0 ABRAM978
143,613,050 *0DC64703DC82703FA5D63DE5E8A93034EBEEA75B abramtoren
143,613,051 *0DC85841DE791A1A6F20EC47CCA2263BCFD0FDB4 abwehrsysteme4
143,613,052 *0DCED6A7D0EBDB5A207A87DCD9B2821FE7379600 ACCABAMENT
143,613,053 *0DCD2452C70F66AED5623AB5858CF7D1A440BCCA ACCOMPLI
143,613,054 *0DC6BA8A034A4C283FF32334A3840197244244BB acezr
143,613,055 *0DCEFBA87DD66440033B84DD29DED19F1161A28B ACQUESING
143,613,056 *0DCEB1FD4CF805976B1BFE6EB49A33914CBC222F A+D5
143,613,057 *0DCFDFEBFCF41BB36D2FD090E2B67CE2C401591C ADAMTOPPA
143,613,058 *0DC3906C99D89590A39E0F13E481CE2F1D451F47 ADDIOMV3
143,613,059 *0DC9477D108740280F874057F7B9CA9B75AE4732 ADELIGES1
143,613,060 *0DC8ADB9930F7DF86112E8ACF9022AFECA607E2A aduv
143,613,061 *0DC69773B6140E893043DAB801499A36C35E9CCB AFGEMAALDENS
143,613,062 *0DC5ACA818B2F96ED31B873F2296DCF5F92FE50A のスタンフォード駅の南にメトロ・センター(METRO
143,613,063 *0DC1BA24D6983ABB4D695A84EBB67BA6BDECB341 AFRICA (FIRST VERSION)
143,613,064 *0DC41D1239BF84C4B0F0B9FA502422F16B68817B afvcy
143,613,065 *0DC23C0F2E283396F5C7B32EBBB5BD3296AED53E AFZS
143,613,066 *0DC683ED11CBBF29140D8B62DC6CFEFA0953CCCE AGHLD
143,613,067 *0DC46A2E5662AE070873FECC25F3A8B98131B2C9 AGPICKER0
143,613,068 *0DC6EADBCDD49EFC1E6B7E8F4625350E8CC51680 AHSAN-WARIS
143,613,069 *0DCAFCAAAA9DF75BEAF61706670BBE8D6B5E496B aih&n
143,613,070 *0DC3B1EA17D3ADB9462248595F937FB22CF91FF7 ai&rp
143,613,071 *0DCF4437E284C6C0529262FC8304466061B9D358 AJLS
143,613,072 *0DC1060EFD79E1500AA9B57A9EE378B79C3498CD A:K(H
143,613,073 *0DC233245AAF2FB39986A07B5B849ACC41B5F1EC AKHM6
143,613,074 *0DCA7E102C7822EB11C7F2E8635AF7AFAEC33F40 050306AAH
143,613,075 *0DCE93B8355DE65FF1FCEC10A06CCA6D0B781C63 AKYLE2
143,613,076 *0DCEB5BFD4EAEDD68C542E4E1AF51E94E6E2D9C0 06-26-1202
143,613,077 *0DCC912F63F030A2EC0590424B53B14AD26FA22F 07131727
143,613,078 *0DCEA0322862F8F643A0918E4D5B5EF66B961993 ald;n
143,613,079 *0DC0873292F3DD957BE8D18162512A07AD97B623 ALEJANDROPFOST
143,613,080 *0DC4CE33E74CFA0F5AE7AAE6DF9CD7606C9F93DD ALEXISLYERLA
143,613,081 *0DC733ABA7B0264993A990FEC86A312705EE23F1 10-JAHRE
143,613,082 *0DC2DED354F333D88CAACFA6745D82F00F1B048E allikioh4
143,613,083 *0DC37A56A92EA564B3C2DFC5942637F78B79D40F alphonsogilgour
143,613,084 *0DC799DF05A11D2DB5B9DA05B6BBD255F7BD01AC al.pm
143,613,085 *0DC62691E01CBECB73DE4754E66BF0D7FB57F2C1 ALQORASHI
143,613,086 *0DCC85EA881EA4FE54DE23E5A872BFE57A68ABA2 1184650 ohjelmissa.kiinnitet
143,613,087 *0DCF50D3BA57A538CC4DE4ABA128CAF3735C4188 alvincederberg
143,613,088 *0DC2E9DF44A1B63C5870F62F5B734D6C2C48F863 alvin-j-ayag
143,613,089 *0DC17FA91BEFBB76A6850D13C41393415AA75974 12261010
143,613,090 *0DC37E04573E4F1C21DA0E93C0C536957557B750 1278073 kunnan menot eiv
143,613,091 *0DC1152B0820548839EF9764F921749544E02F96 AM,,E
143,613,092 *0DC8DF1D0BE72F9487CD825B88F3F18F029D69E8 AMEH4
143,613,093 *0DCDEFC6FFE5E8EFA61CADA6C952D905A5CF7967 AMOS.BLINCOE
143,613,094 *0DC846B88C578F93AF56823C9CAE46D54E74C7E5 AM-RG
143,613,095 *0DC838C43B6C7A9871BE5735CC26AFA94D03562B ANDALUCIANOF
143,613,096 *0DCA2DF7D70738C024666BD06C64C59A2A331CD5 AND-NOW-WE-KNOW
143,613,097 *0DC098B778C3DC5C87BA6F2061E7AD95C5705C54 andreareio
143,613,098 *0DC53958C52F2501D02BF9E515480C522B14160A 1559523 chills-go-up-your-spine-.
143,613,099 *0DC4DB804830E75E8B93D10888D93F59662EA37E 1606225 a.sixday.work.week.still.is.routine.for.many.japanese..
143,613,100 *0DC2FCC19EC7E1EDB4728E4BF66D55C701C25ACC 1769—1773 Г
143,613,101 *0DC9E6BA6022BFE10A85507E829F0599811DE514 ANIKILEE
143,613,102 *0DCA33EDEF665DDB35CED0FDD978C6D560C94B59 1847092 suomessasosiaali-jaterveysalantutkimus-jakehitt
143,613,103 *0DC5C94E5EA7BC2BA4D825DB178447AE9A36EBAA ANOAM
143,613,104 *0DC7CA56A275D13E8A61B877D888E9D4B320FD26 AN.QUÝ
143,613,105 *0DC33B2A637FCD99314E92B3A63274276501FC65 ANTAL-HAJBA
143,613,106 *0DCBD6E02E40A60331B4E51978E296AF82684EB4 ANTIONETOMERLIN
143,613,107 *0DCDDF5FB49CDCFC415F9612D6872449B1E1D0B5 antiscalied
143,613,108 *0DC728D34C63642AC74604A44809E0F5D4BC7EC6 ANTISCEPTICAL6
143,613,109 *0DC3A0D14E8AA41DE8C51C9000465E6903CE3033 ANTONOPO5
143,613,110 *0DCB611AB4444125F114DEC7088AF42EA7F15943 19february1423
143,613,111 *0DCA2D59F06FE3509B3A54435BAE68F60DABDA5A ANTWAN.KUSIAK
143,613,112 *0DCF33F797AB97E9239BB65AB996DC7EB3729B3E AO3AI
143,613,113 *0DC1EFC52AFDB4A08BA30E454DEFEBC1F01D3A24 AOKTARIANSAH
143,613,114 *0DCE5D4AEDCC04A029A40FD6A4066C06D973EC59 AOLECHNA
143,613,115 *0DC25A9739A969FDF28AC1E74C30FF26B27CDE3C 1ASUNTOKAUPPPA
143,613,116 *0DCE5A1C2281CA2BE86784F9336002647A051085 1.AUFSETZPUFFER
143,613,117 *0DC59B5570DCF33CA96F3D9704BA70BD8D20E146 APC5
143,613,118 *0DCC5DFAEFA9798222D6C17E447F0F133E8AE553 AQNGH
143,613,119 *0DCB94298EBEC231CD7C7A92060DB7DDFB31C238 AQO#F
143,613,120 *0DCBF7F0E7955DABD28ACFA78ACBAEA9AFCCCD01 1DIAGNOOSIRYHM
143,613,121 *0DC25BB8682499FBF654648490702E6C49306C64 ar#b=
143,613,122 *0DCE5147D10674DF2061D7E46D3E18C5D3B2AFA3 1 DUMPFINZESTUOESEM
143,613,123 *0DCF729F12DDF3FEE5486C367682857F7FA5CB51 ARBITRIAJO
143,613,124 *0DC2145C3E795770C6868515701F4502879E1268 1.ENERGIESTADT
143,613,125 *0DCD2DB6DC14C95F76EBB24F8FB9E49F5240C943 1.ER
143,613,126 *0DC4A9F5A4F78C68EB413B9728FF94129B137769 argelden3
143,613,127 *0DCCF1127813A21FB8A2594E41AB39AE20F3AC4D ariaentje
143,613,128 *0DCCB2D6B766F4147597E91B03D299CAA4D889D7 1.GROSSHERZOGLICHHESSISCHEN
143,613,129 *0DCAEB8B3D433515F81AD33C6712735F78A63CF9 ARMANDMORRISON
143,613,130 *0DC57D43DC2966649133761DF47EA8793FF37EA3 ARMANDO.MESTRE
143,613,131 *0DC4FC1EEC8BC0410EFB037D1D47B3311DA05566 ARMEÉN
143,613,132 *0DCBDD306F7359B1E1ED25CC53159E78F9DA3B43 [email protected]
143,613,133 *0DC23FBD8063147D0627861D86F0969C9E43A1C9 arnoldowittenbrink
143,613,134 *0DC04D80C10AEFD955665FDF317D9591D277B871 ARNOLD.ULSHAFER
143,613,135 *0DC579F9A1567442805D3187A142484892CA0CA2 AROIDES'S
143,613,136 *0DCE5792C275C4F0909CD1440A5E37EFBA45387C artery.f0
143,613,137 *0DC4C37CCFCA5FCAB791ADF468718B5057DDFE0B 1iloveorange0
143,613,138 *0DC651DB611609B2E9C2C0AE23047EC8A969BA82 ARWAUJJAINWALA
143,613,139 *0DC09C1BE642392423942F26DE8C90FE0B571B9C ASHTON.HUTCHISON
143,613,140 *0DC675EABDE6942F17FEA49720637EB5DBDB8F16 ASR&N
143,613,141 *0DC810B38B82349F6D24C0EE0F817FD9FDBC5AF3 1.lohduttominta
143,613,142 *0DCF73083670AD4E09F46A2DB64C522B127045C7 1LOSSES-US
143,613,143 *0DC4C332D8E33EA21C78658930145C2D9A3974CA AT4G19010
143,613,144 *0DC2879F1DD802FB12B5DCDA87876EE9F688268C atd;o
143,613,145 *0DCBC4742F6BE01B1EDD72A483C081AD2893FE86 -ATICNEMRAC-,AL-AL-HOO--NEMRAC
143,613,146 *0DCF2A2D5B26101774E164AB4B4EE00656544E14 [email protected]
143,613,147 *0DC6302B8E65EC2D4B0CC9F2B14723C90F115B57 ATLYV
143,613,148 *0DC701C0DB52210D1DED216F2153BC5B1665AEB6 1pakki-tilanteessa
143,613,149 *0DC17AC02A1A8EDF1176C7001B0EB9A29D3A5102 AUGUSTINE.PURTLE
143,613,150 *0DC740B394AE9D022DFD3DEAA19A5E48C2B235B0 1STIPENDIARY
143,613,151 *0DC06E79F13D2AC29AEF1EBB1EBEFBB3F76FE9E6 AUTOMAGICAL.
143,613,152 *0DC71CE085967625E5081038E86B8CAE6EFFC0F9 1.TEHT
143,613,153 *0DC83D3876F09ADE52315892CB60B5E7B1A6383A 1THEINFORMIX4
143,613,154 *0DC55AE06CCFEDC1F6BB3391ED5ADC759363BACF 1virkaehtosopimusmenettelyn
143,613,155 *0DC7466183ED14A5EDC85D80CD54A004292ED6A7 AWCUBITE6
143,613,156 *0DC23B51AF28B86BE4D023541678AA967BA785F1 AWIN[email protected]
143,613,157 *0DC837C96040D63E55FE0132E889E73532420683 AW:N.
143,613,158 *0DC2C9CEAF1BF3D2A79CF15FD75CB7E6B00ED2DD ax,-=
143,613,159 *0DC2AD2B025311ED0BB34DDC7F9A747FF3834D0F 20D37D336278195D7CF8D3CF70F7F8C2-ROVER318
143,613,160 *0DCCBF0CBD69AD96A987004DE17D6A8548C6EF0E axzpi
143,613,161 *0DCC17211592D2BE75432968ABD85FD94FD8520B 2194380 DORT.WERDEN.STAEDTE.AUS.DEM.WUESTENBODEN.GESTAMPFT..
143,613,162 *0DCE98A448F75D2CED1EE0929AC759FFB85333D6 21march1328
143,613,163 *0DCEDAE789B28370B4C8004A4E5DD03C40BEA114 21.VERWITTERTEN
143,613,164 *0DC81E563E77A3176A90930B70C4EAD28AD922D3 2217486 ".ignoring.them.doesn't.work.,.".he.said..
143,613,165 *0DC7B93ADBC5CB410011BCFCE635F931E6ED91F9 2264378 PINCH ME IF IT AIN'T A GAME OF INCHES
143,613,166 *0DC5B494459DBC03B30DC186E595BF4F05F82A77 236205 " joka on korvan istuttanut , h
143,613,167 *0DC1A8A609A46D3AAF039F79D9208AEC2A2A810B 2385927 ONNISTUNEEN-KALUSTEHANKINNAN-OSATEKIJ
143,613,168 *0DC9AC2B234529DECEC38EBA615D25EB31F1CEBB 24081619
143,613,169 *0DC7E123875FC1BD0272344A0DBCEF62117087B7 2527262 KOKOAN-JA-V
143,613,170 *0DC93DF17F5457F99354F150A87B11AC9F326A2A 2537454 lukija kaipaa yleens
143,613,171 *0DCA4234D7EF82E911FE45AF8C3119C174363803 2639493 viestin pit
143,613,172 *0DCF872EC561CC5A91EC5294EF0DF77C42014045 2641273 opiskelija.pohtii.metafyysisi
143,613,173 *0DC18BBD7CFA887BE17BAB3285C7347EFB4311AA 2835031 KOLME.RAKENNUSTA.MISS
143,613,174 *0DC2044083FF8BF6A95694400B8D8E7977D66771 b:%"
143,613,175 *0DC3B908524FD70CD8711CFCB169FB03F7EA2F5D B1SMS
143,613,176 *0DCB6B6ED14E0D741B0B8091030DE6E3AB87F689 2EA3ED2DCB7131A3B1FDE8A730CC6102
143,613,177 *0DC02DBB0D496487F70DDE320569713B4C41950D 2-ehestens
143,613,178 *0DCDE04D3793D60612FB7BC423E35948E801ED2A b:_3
143,613,179 *0DC79B397ED4E24349CA1952251C7F3FE5196F4A 2FBRUMANO
143,613,180 *0DC58B9F7894C31363FFC959630D6CB964D2CC0E B4#%K
143,613,181 *0DC90C3168FC1110D855950FDBF4C9BF03E7FC82 2hyv
143,613,182 *0DC7CED92C0EFEE1F708A4B03BE7597FF3E80914 B5D0/
143,613,183 *0DC43531B77A8AD7EAA0BF1C622F80C31DD9E6E5 b5htd
143,613,184 *0DC153EEA81FA185A7B36C802B16C55AB1FBAB0F b5lickalot
143,613,185 *0DC4A9CBF4240DA69440C949A440F1802BCD97D4 B_6F
143,613,186 *0DC9EC62AAAF7D00097845938E85676F3C0ED518 b6(k
143,613,187 *0DC433A36B0DBD9B186B35589A010C74302BAD6D 2MOUSEPADS
143,613,188 *0DCC38E0E4D391302FF7DCC6C39766FF26DC2C1F B=8R"
143,613,189 *0DC1ED2DE97E35FC1E036D8B264DB59E9B5CC242 B8SL5
143,613,190 *0DC8963181EF25175CF41826699F9D1AF4039702 ba-,-
143,613,191 *0DC1667A2A71293EBDCE944DF6893547FC744C36 BACCHUSVING
143,613,192 *0DC567C647B07E75523E0AAE3CC31E87FFE30904 BaF#
143,613,193 *0DCEADDD080AAB9DC5D7AF3B016E77F62A3FFBE6 [email protected]
143,613,194 *0DCD3B03413BCC8F00944589567D18F3A8C7D403 37cubuklu
143,613,195 *0DC61CC291A242B35D325D628FB404D23D829C2E BANOVACE
143,613,196 *0DC70A2EE2510E7890B76D08B2CEC51381DB8E35 BANQUETCENTEROFTHELITTLEHILLS
143,613,197 *0DC142B3809E99789BAD13CC2E9BF91E52D26EED B=AQW
143,613,198 *0DC65E67EDF51442071213EC8A882E244F7C519F 3.arakli
143,613,199 *0DC0B0E4E4F0A4ED7F612B7AF61F816F5088D85B 3DNALWOD
143,613,200 *0DC12C83A7242E5FF8C2B86314FF4F91B1A61C5C 3.ELITOET
143,613,201 *0DC5AA586EFF993A1BD1C71E18882E67C6DE5365 3ESITETNK
143,613,202 *0DC4F49D69CF9008738D5B8BD499365A6E2B84C3 3KEPLERN
143,613,203 *0DC04FBBACC06D47C451642D7C030BE8CBDFBE29 3MPR3ST4RVOS3IS
143,613,204 *0DC8412DF9F1A3784B06D660199B3416DC38572B 3======>-~o-~o3b<-
143,613,205 *0DC71E36A67DD78DB22A7980456E0E35285F9D54 bb?c
143,613,206 *0DC05B218CB84D5ED89EE02FA510445D416EE74A B.BW;
143,613,207 *0DCA1D415E3589E29A8A003736F6C6AB597AC399 bc)og
143,613,208 *0DCAEF118BDB65822358254151D8AAAEB81940FE 3VIRAGE
143,613,209 *0DC6080985BB5BA1DD0CEFD0C1C6743C7C523CFF BDK:F
143,613,210 *0DC50FB903D425B94E590270156EE8AA1AE9C31B [email protected]
143,613,211 *0DCAE927F1A7E9E873831843C769C3DDE02A2091 490621 valiye gittiginde o da onay veriyor
143,613,212 *0DC004D7D2B2969C17BFD7333FDCF7AF309AA65F benbuddy
143,613,213 *0DC750FEBF7D3BFF89CC8ADC316874AE735F9309 4CC55D0C-BC30-33FA-BB9B-4C25F234170F
143,613,214 *0DC42F8A11E0D96D9ACC931D3B20587FAB6C5727 4CQUITRIN0
143,613,215 *0DC161F6D9593FE4D556D6143270C68BDD63C4CB BENJAMINLORETT
143,613,216 *0DC60513CD626A9A610C8CD14C451E0F49EB7ABD 4-elfmonatige
143,613,217 *0DC139118C1553B2A8F906BC844FD3C0B4C9D7BE BERBERAH0
143,613,218 *0DCA0E8236B5CF0A2C5F998A079FEFFC3B397824 berikats3
143,613,219 *0DC59F2999A6CE4BF022200BD925CEBB3736047E BERNADUSZALVADOR
143,613,220 *0DC6098A34C3CFC7F99AF1AA9A5B2ECE8295D4ED 4IRONGEMS
143,613,221 *0DCC4E52D948E60141AE62ABB54F5F67EEBD11EF 4.maidontuottajille
143,613,222 *0DC83A69C314D25E9D0E2F3B737801591CA07740 BEUE
143,613,223 *0DC40A3497A9C5DA81B51AB894D0DA2233D082FD be_un
143,613,224 *0DC9116C4BA31656C83A311D1497F7F2720E23CD b(fbk
143,613,225 *0DC9B2A1AC96BC281E4936942DC45F8076360605 4PARTICULARCOME
143,613,226 *0DC1B7F169AF1D6C3F18957FEBF439AA21EE848D 4PLUTOTINKER
143,613,227 *0DCBDFD6C6C30690707368DD2503A9A861C0ABD8 4PORCELANIQUE
143,613,228 *0DCB18CC60215576847FA861594B6D6BEB4A7B64 4RECROQUEVILLEZ
143,613,229 *0DC6C99E9FFCE215BD28FB3348CB33A6BBEDCE8A 4-SCHROTMUNITION
143,613,230 *0DC386D06D247FD0EAA2CA227384A5FD8223C230 4SKINNYPUCKETT
143,613,231 *0DC3A96AFB121D886FA6689C11AA8A7A2D319090 4SNOOPYNETWARE
143,613,232 *0DC34C692760B51CECC2E13A9E641295EFE2DB0C 4SOKERISAEKKINAEAEN
143,613,233 *0DCEFA2B42239DFB784DB01A9579F932E31302CD bgvht
143,613,234 *0DC488AA6A2CC4191A44AD80EB1A64563DDCFCFC bgvni
143,613,235 *0DCEFE7143C9B17E6EC77BD4653B5723AC9C18B3 4STRIBRNYMI
143,613,236 *0DCDC4CABCD6AD872E306E27DEBCE365F5C29684 bhikshating
143,613,237 *0DC3CB48EA55A671296F8EC6217405242AAC23A4 bienseante1
143,613,238 *0DC52A4A4F2598FA5CB8BEA6F6427243D2A99DF9 BillyMcLean
143,613,239 *0DC85F910BEE9BF02B930E6AFBB139481979C33C BIRIYSEN
143,613,240 *0DC597700CCFC1B58C0D415A8788BFBD8B48B64E BIRYAZT
143,613,241 *0DC5E33E005967B46FE07ED69897477FAB20D653 bk:ki
143,613,242 *0DCEC5CA13FEBFAE23B443A0EB404FB76E18B295 blackfins6
143,613,243 *0DC8F20A7C2BF32EA5AE5FAF5F6855C326D9B512 BLOODYPROMISES
143,613,244 *0DC2BBF0C700F08D2A754949F2334B622ABCD4AE b+n6s
143,613,245 *0DC13A6CCF0AF48C155F61B99525D82747CFB5B6 bn_p
143,613,246 *0DC1FABA10B08C999BFA91DF05B8536EE265532D b=> `~ `~(o_)
143,613,247 *0DC6A2CFBC18450B36606629653248ADCF5C3AA1 BOBBY.MARTORELLA
143,613,248 *0DC6D64448212C25D65E1497F62FD80EAD0E69EA bo$)d
143,613,249 *0DCC6D51B019BEC525AAE0700F3C2D49516DD608 BOLNIJOJ8
143,613,250 *0DC04407628025C475AD145B41A0307838FC18CA BOSKIE'S
143,613,251 *0DCE865722AE45C7AEFB88A528BD9B821952D655 BOTTATI
143,613,252 *0DC47B06F3A97E4D6A071637B7BED6B5A03E9C91 598865 bizancakkendiadImIzakonuSuruz''yanItInIverdi
143,613,253 *0DC23863BB6A159F2E6274E94407AB7C3C8F9BA6 5AIGLATSO
143,613,254 *0DC28630B44E6BA6813E31317088007CA25EB3D5 [email protected]
143,613,255 *0DCEF9B67545AC54E5FF91BD04B6ACD78CCFBB8C b(pj+
143,613,256 *0DC34A6F2D4976AE5BB85656478E8727E717B6AB bpptn
143,613,257 *0DC6943CB154CFBDE3AEBA4A78F85358E48A4372 5BSWREGWELBSW
143,613,258 *0DC1A92FCD3522C639A73E90BCB75C9B593A7083 BQ-:_
143,613,259 *0DCDA9A4B4BE4814ED72A9FEB786385BB2ADFA91 bqw8l
143,613,260 *0DC2FC6B2C65990D8BA0B5A78330236C8AE8F4A0 bqwp_
143,613,261 *0DCF7874E79239189553CB9EC19B228D031A330A bradan
143,613,262 *0DC42325979D8CECE98CB7408DE0520F81182D14 BRADFORDGATCHALIAN
143,613,263 *0DCABE4B1C7D094E92E29B2017A52F29F159E26F BRAICHLEN
143,613,264 *0DC9780F843A3B59FE9696616E9EFC8CBD78ACA4 5iluvthrasher7
143,613,265 *0DC5BF81A2A994662F8CBD72A52D161F094233F1 BRANNULY9
143,613,266 *0DC3EDDC056D63E501025F4D90CA3FF6F87EDA2B BRAVOONETWO
143,613,267 *0DC694E911420239377E6F7DD87D7B0E34CB5DFF brettschleibaum
143,613,268 *0DC74846AC215960739C27E65F24855FD4A6D65F BRITTDOUYETTE
143,613,269 *0DCA3F43F156BE0EBC4FF0EC12A27822EEA499DE broderickfleurant
143,613,270 *0DCAD2945D2A3AB60F9746CA1BB18C8C2C723D73 [email protected]
143,613,271 *0DC6AE6D0DD30449341D1BA840265E94F1C4FC0D brooksclint
143,613,272 *0DC7416415601C37CF3192E8F5DD341A193332AC BROOKSHOFFSCHNEIDER
143,613,273 *0DCC394002E6B73D22EBA0BBB2CD69D0422929F2 BRU05100895
143,613,274 *0DCCB19B2C9029009EB1125E9D07CC3FB09BC160 BSIRISKI
143,613,275 *0DCD37187D110DC1932513FC42FF02634FFF34C6 b======> `splat
143,613,276 *0DC2E147E7A7CC845F7E91FBB37F688F0FDBBE58 bswxaligned
143,613,277 *0DCA7ED6AE914CBDA4F389F6451019C234C2C231 bt1le
143,613,278 *0DC2957CF4C21B4513E40A4BE6A66B8400E74E89 5paradigme
143,613,279 *0DCD4CC8F5B33CFC3480098AF850A8957F2ADBE3 5SAMPSONFRIENDS
143,613,280 *0DCB25AF0BB15788982C111D1874CFCED94556E6 b/ue/
143,613,281 *0DCBE7EDE87BED78B2EC19A13C64201D4BBC70F9 bulbulsarkar
143,613,282 *0DC44412C781FEC6ECAD6354BCB31C992C146631 bumxr
143,613,283 *0DC7A32E73EA54633CA17BB20D28B19015693A98 5thecool7
143,613,284 *0DCB5AD436DF09039297346AE59FEA2B93D43094 5TILEGNING
143,613,285 *0DCC37A8CF43B77EA01F62E7B416A518E461ED7A bun5i
143,613,286 *0DCE1E798B88366B3B15F994F3FEF68F410B8C45 5UNRECLAMAR
143,613,287 *0DCC03EADAA09DB02D101B5B37776A70BC039AA3 602SAVANAH
143,613,288 *0DC44FB49BB3B6B3C332E6A3384BB5A084F006A0 619eddie
143,613,289 *0DC555F11C43812982DCA3AF15062A7413B43BCD 627qazwsxedcrfvtgb
143,613,290 *0DCC19DED1447573479705B104DC7E88F98E0CA6 bv3ca
143,613,291 *0DCDCF725B1F24CCC9D20FA6D0025FDC3107A825 66amara
143,613,292 *0DC38B13FF4BCE671A7D69DE4099C46D542AFD1A BVONGAME
143,613,293 *0DC3A1B84551DE646C824CF882EC47CC344E83A0 bw"0i
143,613,294 *0DCFBAF67669A48CA929219A4B81DE5E1C8A3ABA 69braydon
143,613,295 *0DC4A71150B79F9A08997098920B1D0E9FF36142 6ATROPATENES
143,613,296 *0DCA250A65C5CED36AD7A7DC547BD51914843935 6BSWDIRIGIDOBSW
143,613,297 *0DC551554254C5005A1DB404C27143C101B146C5 6BULLYLAND
143,613,298 *0DC45D816DE4A8F51488EDB71992878261432669 BYSTROSC1
143,613,299 *0DC017CE795E83612F7682BC1B74497239969824 BZQAQ
143,613,300 *0DC0A780FAAA7191A4C02BA5E5E9230617810796 C0AT%
143,613,301 *0DC65B669EAE495E365352478A1BF460B49547A7 [email protected]
143,613,302 *0DCB770F00D1B2654483B064DE8DA54AF054DE0D C-/1K
143,613,303 *0DC74C7A6AD5BDA14A3750C07453C7B6C075CA44 C2A5:
143,613,304 *0DC03F37E625A548EB7C7FCA39A554E899237AD6 c2c4c
143,613,305 *0DC0B4DBA615E2332CB410FCDCC65B220634D977 C4A)5
143,613,306 *0DC7E3F13EC2E33891E292D47C53BD9BCDEB303C C&4C
143,613,307 *0DC039F9691165397994B471FDAA24DDDBE66D1C 6NETNEMILPMOC
143,613,308 *0DC15D2A0608EA7249E946FE5F0EDAF9D3E903CA c6xq9
143,613,309 *0DC5A8FC9DE984533A6BD4B499A60FFA55624AA5 c&76x
143,613,310 *0DCCA75969470120ECA214C87E67A2135932B794 C7tN
143,613,311 *0DCFE7F1471121925CD1835705C8C10D0548ADC0 c8w!
143,613,312 *0DC7BBB66C7DD09CF1236E4CACE41B8E6EA508DD c+9q"
143,613,313 *0DC168CFDAC9D31DAD289ED7872A462F610BC90C 6RWASEMDE
143,613,314 *0DCB63B6F868AB6EE22344CDC4C7609803DF9760 6SNOIFITROF
143,613,315 *0DC3D119FCF64F1E8E2A4C485D72A4BB96C8B3C0 6SNOITAICOSSID
143,613,316 *0DCA74A97CABC65332E308148870F5910753132D cafber
143,613,317 *0DCF11022FAB990B76FBAF06A8F12200EA89E710 [email protected]
143,613,318 *0DCED10CC604ECB3621655670D7618C3A270A5BD CA-I9
143,613,319 *0DC48B24E23A2A0674DA66D7412DAAF94E0DBBC7 CAMISOLECOOLMAX
143,613,320 *0DCA55AB2AA0747CC8ACC724BCA634460DB8FE92 732194 xwenekinqurbanakesexwefiroti
143,613,321 *0DC09343811AC69222054A4687D68E792647FBD8 cape-arid-nationalpark
143,613,322 *0DCBAA6B5F46F7B88E49D324956A5B133909B21B CAPITULATE..K.AH0.P.IH1.CH.UW0.L.IH0.T
143,613,323 *0DC7F0DB16A71229F0DAA6A5F147E8976D894AAB CARLTONLIGHTBODY
143,613,324 *0DC6A83305AB0DBC8314E5DA2B814AC782A7934D 7AN91!E$7
143,613,325 *0DCA9DC4359D39039140C21E972A24EC28E88E73 7BSWXFPATHNAME
143,613,326 *0DC84E15B61A09E53D82217A3141778921EBDED3 7CHRISSWEETY
143,613,327 *0DC4E521F9A303306E263D7BE92AF1FD08DB4E98 CASTELLS2
143,613,328 *0DC14E734BE03D5BC140ADB013AD668D8DB6C2AA CbQk
143,613,329 *0DCCCD1DF6AEEBBFAC6F4344320E723441D6CBA8 CCDW
143,613,330 *0DC9C4E1B5614A7D47AD01C61D0662EFB852595B C,CTJ
143,613,331 *0DCA69610B256C3D3C71A968617E43D1DD94BEBF [email protected]
143,613,332 *0DC698AA1443FB6E423C80AA442ECD823E4F5013 cd20795a401f221478723ef6844b75c6-ptd9788
143,613,333 *0DC8C1F1F8810BBB8EC9B451B3C4A880DE8C50E9 7NAROHPOSYHP
143,613,334 *0DCFE4ACAD4EB8EC8206521CBD8CA0F9A91642A9 cd=g?
143,613,335 *0DC29EBE9BD630CEC75A3CB156BE513543CD5DAC 7RIEVERSTI
143,613,336 *0DCA0B87CA07856B5D7207E5F631C1ACF69AC999 ce2;p
143,613,337 *0DCCCF1D13B16C8656038C4FF411D70D66D62A94 7SESTUPEK
143,613,338 *0DC8D7603F42D16DF67C4BFD28CABEA800F887D5 CED0C
143,613,339 *0DC18032FCB7739440CE327671CAA963A5EC4794 7spirality
143,613,340 *0DC169E6194C77D48248C624E1E0364C84A6C462 7TH-BASE
143,613,341 *0DC984A0C370B3FA65913BA86F23E1B3442140B3 7theduke
143,613,342 *0DC4D74860F30F7C3CC312869667284AA84CE4C0 celestitude6
143,613,343 *0DC7A1A50F1A6F3184D4D23CADCE8A7B99A12FB1 CEMASINICONDUCCLUJENII
143,613,344 *0DC93146B19F13C2A6466EE39FC8C99D32069620 cenotaph6
143,613,345 *0DC266DB48C61D5A1A59A26B3AFB491F08FA9EF7 7VERMIETERMODERNISIER
143,613,346 *0DCC5F77DD037260D2C723DD761DCEC8B62F3422 cf4$_
143,613,347 *0DCFEA32BA3AA5FA24D057346B7E1F66AF5D7B70 CFI!I
143,613,348 *0DC29825F5E93C47DF18D27B74B111DFA4B2754C 7ZWISCHENHAENDLERN
143,613,349 *0DC4CDF18D11F9FCE2EBACD0FF2C9E8A21D2B118 832989 bursasirinceylankayarkalipaskiiskelevemak.
143,613,350 *0DCFC04ECBE7A5E9A18994F8FFCD7DA22536C35B CHAGRIJNIGE1
143,613,351 *0DC327D4FC04CFECE68A7E76FF86DC493FA35131 891154 arkistolaitoksenp
143,613,352 *0DC6BC5288CF441E8B3D87871FE4E05F9ECB1203 8ABDICO
143,613,353 *0DC868DD21E6036CAF6FABBFB0619E8C5899E098 CHASSITI-SMITH
143,613,354 *0DC3534C9403196596B95BC5C218E2B19E54CDAB 8ETZKOVM
143,613,355 *0DCA7E6821AD33E6121177E92C94C8D634E40E22 [email protected]
143,613,356 *0DCFA1CA7F1962C9B45A763AD2A0C9382B504374 8GOFISHWINDSURF
143,613,357 *0DCB661E40F742B32D91DA0ECE6EC7A69CDCCBDD 8KDI
143,613,358 *0DCD75C22A9F6DD629AA50B629BD79E6934B5054 CHERRYNEWYORK
143,613,359 *0DC97091876327D8476D8F04539895A57C0B5D28 8LOMBRICICOLTRICE
143,613,360 *0DCE3D1CA3FEC201AD7ABFB71216D50DF8BCE6C5 8MITCHELLU
143,613,361 *0DC82696426AF77DB567488B9CC286D46CDDB6C4 8OSSENMARKTENS
143,613,362 *0DCF703BF02443036CE9CF3C820883DE00C35230 8PISMICHENKO
143,613,363 *0DC2D5C056F1F2F4FCC944BC3843713D8AA045C4 }8{~.~.Q======Q
143,613,364 *0DC875DF783F25A8C8395E6830D862699519655C chrtm
143,613,365 *0DCD7A5415DC6704E4311D13B52D86BD1B242993 [email protected]+hemum5
143,613,366 *0DCF485EA393E173B1B0CCF382393D7A91FE7FE0 8SREVEGTHCAMLOV
143,613,367 *0DC2E91EB0A26CE95F68C48F83DFCC937E7554D7 CHUES!
143,613,368 *0DCFF6E2D215353503B0E4D8CDDE0B3DF87342AF 8SUBDEWED
143,613,369 *0DC2F1FB9EB930E7CB4A832186EEEE579D5D8817 CIAFV
143,613,370 *0DC0183EA1C15D8AD88B5F99140C53F7FCCCDE4B 8ZENNOLAJ
143,613,371 *0DC2707A667A87FD4BCF339D34B36F97F3A7C79E CINCINVI6
143,613,372 *0DC0234A3D59211C1B2C1594A92420F3B4284F08 c"j0c
143,613,373 *0DC3E9E0CD188BBCB544F56BF72C6DD45E7C320B CJBUJ
143,613,374 *0DCFCB5FF08143E071B2E51120DA5BC6C0B7EBDA CJERKY9
143,613,375 *0DC9CF7DA14405715ED19BB8FF6A5C303F9E0412 CK2)S
143,613,376 *0DCCA56AAA08C8F0EBA4D000A1AECD3A607A5025 9ARTSUHTA
143,613,377 *0DC3019E0695E7C31B4F8E2997D3E7973DEE1700 9BEWEIDDENS
143,613,378 *0DCABDE425D3ECD981CF651E5BC53475F9DB1E64 9 BLEFA
143,613,379 *0DC3932A7847EA77E83744AD587038D9A2B9C8DA C:KN!
143,613,380 *0DCC19CDC0219D517E9EFC5F7C090EE6D9FA9DC4 9echtscheidingsgevallen
143,613,381 *0DCBB34D0FC4FFBC10429BA4C8BBB2F6255E7165 clauderitter
143,613,382 *0DC60FEB77BDE5B2DDC7C5442AC9EC5138FAFDBD clayheimbach
143,613,383 *0DCB157855049835F1E24DF0CDE6B316B92D482E cleoleonberger
143,613,384 *0DCF86B5A626BBBD989AC3E0AE52B72B354F6C04 CLERMAN4
143,613,385 *0DCA1865F5CFEE41BF917C88EB60DF043D0C999E 9GRAVEMANS
143,613,386 *0DCF06B6E89494A31531966AE291DCFBCA129CBD 9HOFDVTOKKK
143,613,387 *0DC12DEC5763A24DD2F4D1875CC5CCF8AFF1AB90 9IAMROCKY9
143,613,388 *0DC6A27D3BF13A466C72ABD05C831796BBD27C96 9IAMWILBUR
143,613,389 *0DCDF44931EFB93954D257A4F7949B9D01287392 CLIFFORD.CALLIGARO
143,613,390 *0DC7EAFB5C69978A2495122FADC4CAC0982DDDFE CLIFFORD.REDAL
143,613,391 *0DC348F3C66191AD9E8F8B4A2FF5872FE6EDD163 cliftonmartelles
143,613,392 *0DCDFFFEE844802F4C99402122DA8CF130757CA4 clintfollick
143,613,393 *0DC2FDFB23249A9643808BDE4E6E1E58AE4D9F67 CM3T)
143,613,394 *0DC04A9A48CF093C91C19D2E545BAC16123396A8 9NIVAARITAAH
143,613,395 *0DC1AC9257ADDA2F1CADF125F2575A789BE7505C Co-B
143,613,396 *0DC363B92C4F654058EF43AB676B861952D9CCCA 9SZHTDCKLLTCY
143,613,397 *0DC2A031B5CDD0417EA1C76F8EC3D4D57FC959BF 9TAVELEER
143,613,398 *0DCC759DE1341B52EF6410BA55563A47F410B2B4 colinpaske
143,613,399 *0DCFF0AACBDC1955E6AAB49E5A8E5CF03FB09820 A0h6
143,613,400 *0DC45AE0E104162753E65DCEA91444DF38D9E682 COMBATEDE
143,613,401 *0DC1AB8DFCE7C5BF4D967E604C3A885D5A7A45FD a1,it
143,613,402 *0DCE38BC3AB457B8BAE9CDBB3B1C50BFCB6C8241 a1rp
143,613,403 *0DC44660DCC22453EDE33D93FD19D11D50F18BAC COMMUN1$T1CA11Y
143,613,404 *0DCCE8695EF8EF06DD8DCA916FC217576804E52A a5q5
143,613,405 *0DCBB000E2F0F056B3221D9BB6D8AD48DE79954B A6C/R
143,613,406 *0DC9930BCBC7A638FD54E018C808E4E5B2A79635 A"%8
143,613,407 *0DC2F0AF6AFCFE858576F21172C718CE20685559 a)80_
143,613,408 *0DC4E25A97A049FC7934DCC46A20B9E76F871CBD conc8jxdnvg5hgsa
143,613,409 *0DCA663ABE9E6F2B22BCE3674523E720384D81FF A#9G8
143,613,410 *0DC4FA9C51FFDA4AE7751A69A9211440D742EAF6 CONFUSION-THE-WAITRESS
143,613,411 *0DC3F42E030D0B7E5AB7E8580DA0B60BC863D947 CONGR4+UL4+IONS
143,613,412 *0DC324270E6DAA3A07E7C09AF4C2D764406AEFAC CONSECRA+!NG
143,613,413 *0DC914BCF846F4B0FCED0D565802806E53B9A4EA CONSULTASDEBORRADOEDATLIN
143,613,414 *0DC222DB6798D708D676E85AF325CA7E2B43E6B0 AAATPY
143,613,415 *0DCB2189C6758AAA08AA60C87206018A7F8C3A6E corethra8
143,613,416 *0DCDDDB24A7E5A396F1CBDDFF3B43218E4454128 AAB5ZB
143,613,417 *0DCEEE9443D9E1991BF242007DEA132ADDE7FE1B corroboreriez5
143,613,418 *0DCB934D4A09B796F220E7C988ED25250A5F3914 aabzna
143,613,419 *0DCD7A0CD5C81CAF4F9FAFFB6976DEFC4BE6B649 AACML[
143,613,420 *0DCCD0ABB7B13B55968D5045F0053346CEB7422D aactc
143,613,421 *0DCDBED59681E9E8CA275E5CD72ADC769F540C13 aadb{m
143,613,422 *0DC70C8E0D8747992FDFB8550042F3E282693997 coybavaro
143,613,423 *0DCB9B8E55D2C6A3EC96DBF151D9E8BD5506225F cp)"f
143,613,424 *0DC3E4BD27822E8F7B3247F35DDFC798116FDB6B AALU:
143,613,425 *0DC4C0D8F05CB0D9058E6D35638C33E86F97B187 AARONPANTOJA
143,613,426 *0DC03577E8C108B04F70523E3287D024CF9AEBEC AARONROYAL
143,613,427 *0DCE84193B72DC764B108301D9A9379E98828F8B [email protected]
143,613,428 *0DCA3B3811C831803AA3E13336DDEA19DC5D3ECC C:\Program.Files\Microsoft.Visual.Studio.9.0\Common7\IDE\ProjectTemplatesCache\VisualBasic\WCF\1033\SequentialWorkflowServiceLibrary.zip\Resources.Designer.vb
143,613,429 *0DC9D5ACC2958948E00C2D46E0775A971ED8EB93 ABBÌ
143,613,430 *0DC743B5AB904F69B4B3A548BBBD6775661E0C89 CPU?M
143,613,431 *0DCF68BF05C978242F796C514CD2E876172D6B78 CQ.,M
143,613,432 *0DC2393EB91A0294FB6D137C826A816A6DF049D6 CQNAH
143,613,433 *0DCC7E35E95912B0643BFDD1E9ACDABC64753A9A c(r,a
143,613,434 *0DC25AC33E668AD2C229769178145B35ADDC20EA CRAIG.ATKIN
143,613,435 *0DC4203A0338AF2BDDC22F123594CD7F9CBB38C5 abpml
143,613,436 *0DCBC3812AB3FC7933E8A37EE4BED9AF19C256AA ABRAHAM.DIMLING
143,613,437 *0DC24D343E18DF6ABE275491DFD9B4794AF56C8E CRH6V
143,613,438 *0DC85D76F24B7C2E470CC17164FCA9DD12B2FB16 ABRUSES3
143,613,439 *0DC6F62A88E81A6DF92B6B1BC6CF5807F8FBBE09 CRISTOPHERMARLOWE
143,613,440 *0DC1A10AE581BDB447CBF203683CCA99B8925151 ABUNNAK
143,613,441 *0DCCA93AE0221D13C8A798903AC9DAD7565E8524 c,&rq
143,613,442 *0DC567C06897B93D75EDE632D20716727B2CAF54 ac7c4
143,613,443 *0DCAB665357D050D82BDC7E06813197E107D46D6 AC8"N
143,613,444 *0DC4AA517DAC0C825B25F11313793D45D40E1145 accretion5
143,613,445 *0DCB0B482026570E8613C4C415CC5C3AFE06A913 A#CM
143,613,446 *0DCAAB2AEC36BCF4B19007D6924C843D9F63713D CRUZSEIBERT
143,613,447 *0DC14C6B6F908D4BFE556EB0703059846FA301B3 ACQTB
143,613,448 *0DCDFD0AD40A20B4B0C66EC2F604A3740378B2AF ad8)
143,613,449 *0DCD95DCA503AAC62044CCEFF6124F72B614512D ADALBERTOMAKINS
143,613,450 *0DC84B99FB27D834EB69EEE2264429228398A2C2 adamprzybyl
143,613,451 *0DC03B79982391BD3F94CCE02762CFF76F30BB8A CTfE
143,613,452 *0DC4F79064845328CA9355A3A14AA27A41F85B13 CTI&A
143,613,453 *0DCDDFECDE3134D52A845593EB78FFBAE7F1305E ADOLPHGUTERMAN
143,613,454 *0DCB1665E8079D5090BD9819B67F26855AB901EA aduv
143,613,455 *0DC69773B6140E893043DAB801499A36C35E9CCB cutyrock
143,613,456 *0DCA1BF7B1285E9AF0EB0B25E482E9F3D360F2F8 a)=ee
143,613,457 *0DC67BA7F0903DF15DED68658000782FD2E825BE CV52
143,613,458 *0DCE89E36D149CAF66E3D3CA5722F1690DD03014 CVo#
143,613,459 *0DCA1E01BAD1A0F8F1959905437371AFCAAC76B9 cvtjj
143,613,460 *0DC4A877C514560F193D1E8DC05E996D75390682 c&vu$
143,613,461 *0DCA7961654F470261B4A7573DFB43E14744CD97 af?_)
143,613,462 *0DC142EF66F516ED5449CCCF0E141594FDC59263 AF3J
143,613,463 *0DC6BFFB3F3BACF948E592F4B4E4002CC20F4E09 cwca:
143,613,464 *0DC5DF4BDD9263465A58F62F2AC4AE730F075E05 CWLP:
143,613,465 *0DC5926800122FB0D0BB6D6DA08D081572540AC9 AFISSURA6
143,613,466 *0DCFBF8158E712D6892F114B4217202D27D979BC CWt-
143,613,467 *0DCD8E181165FB62A1A717E7DCAF1F54FFE29C83 c:\xampp\perl\site\lib\auto\win32api\net\net.dll
143,613,468 *0DC8E0A3C39026FD54423B15EB5A2FAC7FED7D42 a:fy-
143,613,469 *0DCEC3725B9368AC96564A9F0BA59C328AB7DCAB AGEIW
143,613,470 *0DC4E31AB8AA940FC6DFFC96D0B436014C0385E3 CXJMP
143,613,471 *0DC422AC35CF27B7DEBA651A333D17736DC9158A AGNEETASILVA
143,613,472 *0DCD955CC7CA6828AD4E0A647FD118565E905536 AGUSTINDITTON
143,613,473 *0DC5A67FD3D0E4401B4AD0C3387953CCF9278B48 AGUSTINTAPIAN
143,613,474 *0DCAD0045800966B79FB157AC08EC48783D608D6 ahcl+
143,613,475 *0DCF321327DD5D931EC5C1379DE0C949520815AE ahe3r
143,613,476 *0DCEEB336B8190520B519CD1F9789A8B3562E96F czf#x
143,613,477 *0DC3E05AAEF17E41C2304799EB87C95E456D003E CZGG
143,613,478 *0DCC95E31A7F6C67ED792D02544161C10F90595F ahla-kalam
143,613,479 *0DC3EC49F1625129C85D94869A79A04C6D4C3920 d0a=g
143,613,480 *0DC0979552A8DA717337B01D52143F0FB70E83BE D138256
143,613,481 *0DCD2FFC347A0BED7A635E1E71CFAA4CC1D19BEE a!htj
143,613,482 *0DCB1F8576E13DD401F6A2C4116BB016E4469C02 D1$C3D
143,613,483 *0DC8BE28116FBB790175DB90AD573D7A81E8BB6D a:i7$
143,613,484 *0DCB2FF8AD307699A6840A5506D9276516CA2B5F AIDNALLO6
143,613,485 *0DC6DCA515536E4C81AD8BDDBD2445BBCFF44EB3 D2Fd
143,613,486 *0DC5C6484FBE442848E45D584BFF449FE70F958A Air.pocket
143,613,487 *0DCC9A975F5040ABD887360A915C29D41727F2B4 AISEGLAR3
143,613,488 *0DC57D52718C49C28AD7C353DF850456675965AB AISEUSESING
143,613,489 *0DC20C9C3A3C01E52FB34B40278ED93578F93042 AJ$;9
143,613,490 *0DC77381F0F236CCD2C9DE1E24C4120B6956D772 AJWT
143,613,491 *0DC0BAE9CCF8C884AEE8B23F7D5C5EA8D31976E6 [email protected]
143,613,492 *0DCA6D33E5E168A8DD9987033F2F07DD6260AAF3 AK8LY
143,613,493 *0DCD471B0BF4AC1F218237B2D935B1BE88986A18 A,KN
143,613,494 *0DC8E92112469AB69B1B9DD30A8D51A86E5C3AC7 AKNAKUJUNDUSTRADITSIOONID
143,613,495 *0DCD8128807CEC44FD5240BC0DF3852D9281B4E0 akylosaurian
143,613,496 *0DCAA73A1F8E5B960CB027CC33ECDAD30906EC0B d)4t"
143,613,497 *0DCC6F48D45CEAA59E5214450A3F80B09C7077C8 alejandrofamiglietti
143,613,498 *0DCF06C3A6A63D7BA86460C7FD75EB95A90DEF01 [email protected]
143,613,499 *0DCE39C126E633C7A3C324F726B1E36305AACD48 d7dli
143,613,500 *0DC1AB39999BE71DA3F474A6D9639E6C68A60F10 d8k+
143,613,501 *0DC2ED216FE020BFB07D291EB2369404A01D460D d8whb
143,613,502 *0DC58C9839DA61DEA1D1D0CE8464BF0130E7C0CA d9elt
143,613,503 *0DCD16FBCF5A7CE68870A8AE1CEBA3F09BF63CD5 DALTON.FRENGER
143,613,504 *0DCC024AB356C2B5C16553693E09ADBAE6390429 dancepartita:vi.folkdance
143,613,505 *0DCFF3875BD56AA6C5CAFF49F4E7DACA9860BDC1 alonzobores
143,613,506 *0DCB74639A6D42EEA5EAE3C256ACC09D02E5E6BE ALPHAWANKER
143,613,507 *0DC1F80E3285ABB109A1E50124609B5CFFD03C27 ALPHONSE.GIROUX
143,613,508 *0DC7E7E2B296C2EE955345368DDFE1B9BF52EFEF alternativetimes,volume13
143,613,509 *0DC6BF1A4270691149F25CA3B6DC6FD8A169FC13 alvarobrilliant
143,613,510 *0DCED2D1B8F275340CC53E0AD90C94CF3BB0EDD2 amathophobia
143,613,511 *0DCA413625AB0AD38152D0F3A4D9353DFE701956 DARNELLSEEBACH
143,613,512 *0DC132DB3F48728FEAA0005C2CA5BB41035BEA80 AMERICA WILL SURVIVE (STUDIO VERSION)
143,613,513 *0DCF242F85A166CA076A0F1C7D92893A0C132DE3 amigawisdom
143,613,514 *0DC371C87EC0B65E4064EA223AEE259BD9625A6A DARRYL.DANIELLE
143,613,515 *0DC48E4AF5E39AB9EC490F4C36CAFBB6DF4DBA4E am?n!
143,613,516 *0DC78B1C61121ACA4FCE2438836F896522432704 da?=s
143,613,517 *0DCFD7EEAFD47ED9AAB806192006FC5ABD0585F5 amosbrimeyer
143,613,518 *0DCB4BB60762677D81BF404B0E96BD254FF1985D DATAPROGRAMMERAREN
143,613,519 *0DCAD1D7C30F1AA5499F302EB19E00BD2CD92E6C amp0000000000004663
143,613,520 *0DCC35FC18E6B5ABCED9FE7AC6C81E7DB9C0C2F8 amp-l
143,613,521 *0DC3B846F0569EAE6478F40AE3A926F20C2B673E [email protected]
143,613,522 *0DCF95630FCB714C8AF3315E3866DA841A3E9B2A A)N&
143,613,523 *0DC1D240AB2DC80520A32E5108EC59F896AE02FF DAVIDNEVIS
143,613,524 *0DC7782C16414CDF102054C2A3C24EE1A1F276D7 DAY(UNRELEASEDLONGMIX)
143,613,525 *0DC22B33F70EFA76A2C77854284F94AB587A429E ANDERSONPINEDA
143,613,526 *0DCFF86B01E13127541CE414E01D1EEAE94BC085 andishly1
143,613,527 *0DC4192654620D6D2D0CA5D957A6514AB5A96E1B andrealefew
143,613,528 *0DCD8D92C75BB4ABC5ACEEBA8F90BF3D318A5215 [email protected]
143,613,529 *0DC7A53C3AE52E4B977B9E9E83577F0CF2445095 D&CNJ
143,613,530 *0DCCD6B8CFB1CF896C887E88565C92168A21AAC7 angelokjergaard
143,613,531 *0DC394E03F116495C8B9B903EDEFFA6AAD581F0F D:!DM
143,613,532 *0DC5C5161C74FF4234E32C7274D98FD69FA050CE deangeloflebbe
143,613,533 *0DC42A1BED6CFD438AD06D1BA26B6B0161E6835F death.bros.
143,613,534 *0DCE57270EA61C2739456272B8E7C51D2FCB3CE3 anmhv
143,613,535 *0DCC31FC9D005BA3605CC0AB26ADF8C6D235F7EA DECOTRET4
143,613,536 *0DC22214325EB426737008FAE764E458784DD4CC DELMERTENUTA
143,613,537 *0DC3BA40E642094B06365E1653D04EE4E64D330D DEMARCUSMATUSIAK
143,613,538 *0DC9E8FEF9286B0DD04D13FD3711E5461FC11B31 DEMOSTHENES6
143,613,539 *0DC828EC373F6F3E94E3A3468BE57386434AF49D DÉSENIVRANT
143,613,540 *0DC98EFCE7D4A583BE8828DD984B13CD9D0FF48D DESINTERESSEREZ1
143,613,541 *0DC004D5C234A2231CE4AEA38B43A2FAF9B15907 [email protected]
143,613,542 *0DC937802B919EE5863182F951E59EEA5E2E7190 detourniez2
143,613,543 *0DCC7B398C2D65A6BE7119BC7639CAB8A2FDB8FE DEUTSCHSOCCER
143,613,544 *0DC14E427D36906D69AEB63800B716BDA24F03B6 DEVINIENG
143,613,545 *0DC197326525A11966AAF131A6E939B4CC7322BE aom#
143,613,546 *0DCC32C8A6B040656B86C30855A58D55155E837B apgrm
143,613,547 *0DCFECE0F2FB3731A065AC3ADCF2504E444FD3E8 A=PLC
143,613,548 *0DCFFA17A668350D2A65432025FAA4197F1AA9C1 Dfbl
143,613,549 *0DCF34082DF17C03F32A9F5B2E98D9DADEC6F504 DFOY+
143,613,550 *0DC2750855658864AD99E36EFD78EC44C93094D2 dg3wx
143,613,551 *0DCF397A330D459C4D1D097B4EE3C49BE65C779C [email protected]
143,613,552 *0DCEE4ED7826AB25C8A6BCC6757608BE02496CA1 DGNOJEG
143,613,553 *0DCD69C18AA177FAF2323EA1B800CAD225B8142A aqmi0
143,613,554 *0DCDC6364CAAA405223C300698D75C4251209674 dhfhp
143,613,555 *0DC9C14B1517A0D5879908F806A1AB0D530D0B8E d/i3-
143,613,556 *0DCF4BADCF33F3842D4260D75C89C8251C0E0282 ARHUX
143,613,557 *0DC179C3AA76816B696F341FECCBC0C46CF546C1 DILLON.MCKENTIE
143,613,558 *0DCEB26FD2E59F7FCD1876209B307705A70267E2 armandpenalosa
143,613,559 *0DC24E7D16C3F5AFD228C743C9F94B1BA5797B1E DIRKHINKLE
143,613,560 *0DC76ADEBC271FCB996F33188A74A4346F1A40F1 DISSALLOWED
143,613,561 *0DC549C4299CDFA6453ED33A37C1BCF4DA556C97 ARVOJ
143,613,562 *0DC664031A4B944DCDDB70BAD475AF0C3BC0EE5C DIUMVIRATE
143,613,563 *0DCB119DEB6F5FF82ACDF43FAC63F4187E9C42F6 DIVAKOR1
143,613,564 *0DC01282DC803ABF1BF514DD0AC828D91DF01FE3 dj,gq
143,613,565 *0DC5378C1CCD82BB828986866322F60B241A176D asdwqe
143,613,566 *0DC2499C3875E2591581DA0B915EECE2B18ED747 DJXNY
143,613,567 *0DCFEC0AA7EDA4B8BB50B876FD55C859BE31888E ASHIZZAZ
143,613,568 *0DCE354A00CD64BC54B0D47DFE95D8BF66696944 atcoa
143,613,569 *0DCFA854167D73459E9CD191106342CBFFE247BC ATSIERON
143,613,570 *0DC9360151C2938C0631803FEC51E1DA9156B29B august1875
143,613,571 *0DCAFF33F063637F17C9CD5EC58180EDB61DE279 AUGUSTINEGOON
143,613,572 *0DC6A049B06562DCF32F53504AE4C4B0058C5AB3 dkp!p
143,613,573 *0DC55FE1BA02DCCBAB8A49B8749F13F2EBD03B22 DLOSW
143,613,574 *0DC6B7DE4A19E51E6CEA9EB98C56D0E5D71070E9 dm1:
143,613,575 *0DCBFD77CAE454FAC44F70C762612976088D3A64 autumn714
143,613,576 *0DCA90E48E66C9C9A391D187F7BEFE11A53D511C d;nqg
143,613,577 *0DCA2AD4B1D7964D2F07E9A6C57E5E48D59130BC DNW2B
143,613,578 *0DCAA6040F334163D0A209200836F261B02C15C5 dobberde5
143,613,579 *0DC0A0CEFB8F419073B0F6F4ECCA1C99B9AEDB1D AV#SH
143,613,580 *0DCFCE9BFF910EAADF090D1373232EC80DECFFB7 AWESOMECATCHER94
143,613,581 *0DC6221C9CA5748597B8B0EBC337C31D619C37AC DONNIE.AMADON
143,613,582 *0DC09DFBD400ED86A8ED790B4619B3B25F5C01DD ayranlik
143,613,583 *0DCC4E5E9F6E0F330DD91C306B053F1045FB7D59 DOP/L
143,613,584 *0DCEA8FFB0A9ACB96E52ED5745EB5790D3CB56C3 azuvq
143,613,585 *0DCBCBEEC6AB4FCFCEBED3E4C3315A353E6309CA b##)**>-<
143,613,586 *0DC7FC7B5DE12941965C2DC1FEF76A7B091D1F58 DOŽENJA
143,613,587 *0DC62D312EAE6477CE19E00A27C62AA7861D1F92 b5l/r
143,613,588 *0DCCF47D508EF6A8766B21DE24480F99220F7822 b6(k
143,613,589 *0DC433A36B0DBD9B186B35589A010C74302BAD6D B737-400
143,613,590 *0DC7BAB509AADD2A4CAB9FFCF64E92D18F0DF213 b8qrd
143,613,591 *0DC6DD1B4097FC0933EA5078E4C06D40566ECBF3 B8$XQ
143,613,592 *0DC4EE81442DFE3CB3E1FE780E2949753AD901E8 BAAFO
143,613,593 *0DC50E612CB9106E8B28CBCD947EC15BDF747FD2 [email protected]
143,613,594 *0DC273609AC07C69241DFB83BA7ADD52F3A10A56 [email protected]
143,613,595 *0DC4760ECD888AFF0F37FA1B22E579A71A6A1970 d?,ru
143,613,596 *0DC4790C3DE9851E185EE84680C85C47C43B3306 DRZO
143,613,597 *0DCEBEF3DC4EC9E49B49CF333F8EFDD84A05311D banchay0
143,613,598 *0DC39128ECA8CCCB885CD518EFC94A9A86AF745C baqcl
143,613,599 *0DC79C100F8297818BADE21E3BA1A46C24914A34 duane.wolf
143,613,600 *0DC127A32F404FA2BBBC640FE056D5F8E21CBE04 BART.VANAUSDAL
143,613,601 *0DC958A4FA31839B4F5C5CD92BE9EEC6E520B77C D!UCW
143,613,602 *0DCD8BEAA4DBC58FF6AB68955B0D2A646DB75B94 due to the fact that i'm scandinavian. bare with it. :) </p>
143,613,603 *0DC0E802F481EA32E26A60D4F1E66FAA019C2120 dukvl
143,613,604 *0DC889CF3794D6EE295B4714739CB8F907151343 DUNCANFRIST
143,613,605 *0DCF273D3A77D6B95BC7D22729243FBFBDB7F76F BA-SV
143,613,606 *0DC28CA8889D7EB33BBC17BF6FD78589A1C11055 baudewijn0
143,613,607 *0DC7365157C3135F7C3E9047B3A8B430E06A16FD BCF3
143,613,608 *0DC4E3BD6114594A2931BE4999DAEF8E29E68EE3 dvhha
143,613,609 *0DC2CD021BEDC958B5AB2ECDA0EB93C1C84396D9 bcyclsm6
143,613,610 *0DC3B38FD49CC8C27D788475313AB006682FF069 DW1"P
143,613,611 *0DC2950B35BDD6DD29B682E98964A9C8B82200D0 bdd"q
143,613,612 *0DCC6E708B0B20D37E394CECBCDF246B3EC190F7 [email protected]
143,613,613 *0DC7C0F0C121D199FE7B1C42B54CBEBE407A5B53 dw#c6
143,613,614 *0DCF785C1EAD7B8F12006AB531AECEC6F84B2A31 Dwn4
143,613,615 *0DC6DE8C63552D62E5C2CDF1257279559905F3FA BE/FF
143,613,616 *0DCBCB0B8E25A8F61D4B14CCC9735B313B79B5F1 dy/_k
143,613,617 *0DCA447E318E84281F0BDABA6906DA3301199BF4 DYX;E
143,613,618 *0DC96B1F737F94E1A5311C5C2F5983E81818E3A5 d<z<
143,613,619 *0DC12ADE17853AE335C4D7C1EA4F38CD22164585 DZO+&
143,613,620 *0DCE5A100FC7E33F9DCB3A57B6CD5EBC6A0FCBB2 BEGEOTAN1
143,613,621 *0DC2384302F56DB44FA173C8BEECC93EA63675E7 behoedt
143,613,622 *0DCE0B2BDBEB657549B1A49EFBF0C618E572A305 BENBABE
143,613,623 *0DC9DAEBDEFE7D4EA344BD920A90E89461ECA737 BENJAMIN ZIMMERMAN
143,613,624 *0DC656278EB5A9651E6CA7F2939ADAA404CE5DE0 [email protected]
143,613,625 *0DCB32E2275E415DBB71A426AE87C9B647FBAD5C bernardorasley
143,613,626 *0DCE15B301B4330306A38B8ED90DFC1614293100 EDGAR.BRAIS
143,613,627 *0DC4DB4A0EF902371CC74F5DE4779E86417A01A0 edgartunstall
143,613,628 *0DC7AA80091D495FBD681104D65E2C800603E073 bertoluzzo
143,613,629 *0DCE74A2481594B5F922DC4DF41F2B0C50F97C6C BERTRAM.ORRILL
143,613,630 *0DC6048AA5C438B46B79A4F5492C5C0E0F97DEC9 BESTAANBS
143,613,631 *0DC200C47988F49FED47F1BB3E82FB803A6743B8 bezienswoerdighede
143,613,632 *0DC2F43D017AC23094C52EC1B56DCC5F9FD22A97 bfbs (acoustic session)
143,613,633 *0DC77FDA9BB38D445CFA0053E5DEC7E29DEA654E edwardscowden
143,613,634 *0DC65606AD3E3717C6755B387C680EA0AF6C827A EDWINMUSCHETT
143,613,635 *0DC8F4D15D041C1BD4D2F84A361892CECD7CF55A bg(?5
143,613,636 *0DC2C2DD3A9B94D5633FA7D6D348F2924CB7F196 bg<a
143,613,637 *0DCE4F13A2C13A2493CDA3F7A4E4F05AD14ADD95 BGIE5
143,613,638 *0DC0D3E12159B27788FFE4BB8E71D2634DFE9451 BG"JS
143,613,639 *0DCDF390E955696D518ED86E0ED365C7CFC10129 ef"g2
143,613,640 *0DC8BF9313DBEB8FE7F6204A21581EDC4B57F1E4 EFRENLUNDIN
143,613,641 *0DC8395600B3C5B60B709536C102AD39171C563D BGYC#
143,613,642 *0DC6A38E07901F8A74AF1F6B250CC68FD99C4E35 B"H#)
143,613,643 *0DC9FD71DAA67069256CD8FD92E38911F472923B eg80p
143,613,644 *0DC6B0151001F47071D9DCB3DBE928327E703FCE eg?g:
143,613,645 *0DC35DB7F7E753F54855C4B8F095A9AC1BF13851 egin
143,613,646 *0DC4E12CD22B9B4F57FB3CDD5C3CF79F6D10FFAE b":hv
143,613,647 *0DC8264AF67F496DCAA18AF9BE2BD3F71914B5D4 BHV6G
143,613,648 *0DCA56459BB7812D68BE5FA825B2133BCD7DC097 ehr+
143,613,649 *0DC4CF3C9975D6A77AA88461529A5D534C367981 bibletoday
143,613,650 *0DCFF58A11BE0E9611C64516D13562BA2188187E bigdogkims
143,613,651 *0DC55E51DF8FF2913EE0CF6446D2761040B75F10 BIG.DUME
143,613,652 *0DC5C3BAF8A3211BFD4684FD0D368151E46EF8F3 [email protected]
143,613,653 *0DC39C5E43BD0A68FBA4AF72A0320115B09A12C5 EKCEWFUA0
143,613,654 *0DC2A7A9B91C0CCD7FCE1EE7025E7405DB24963B BIRAYMOND123
143,613,655 *0DC6E77ABDEF653B94B726591103889FD03660C6 [email protected]
143,613,656 *0DCEE19055F66E0925C7D4BA3EE6390CEB97BC9B [email protected]
143,613,657 *0DC2D21F769F7C4AD1E11BAEEFDE0AC46041CAC2 ELDENFLEURY
143,613,658 *0DC540C93524851434DBB658E08ED55FC28AEC65 B;jp
143,613,659 *0DC5BAC63BCCD0569F3138314939B8D3FEB12E63 BK19700514
143,613,660 *0DCC7A318876A207F9916D0F1C9E78E88115CB17 ELLIOTP
143,613,661 *0DC3BA32B21574D2D94D38E2DBFF7A65B1088F59 ellsworthodonal
143,613,662 *0DCC74AEA50D8B594264178BB3431750A96DDDA7 ELMERWIST
143,613,663 *0DCBCF553B982CDE8E249407E20FE415CE816066 EM8A1E5
143,613,664 *0DC1AE49C83F04E525114E89EFC5607FFDAA6A5D black,brown&beige:iblack
143,613,665 *0DCBBC2111B0355E6894F2728BFC49A8F34436B5 BLURÚ
143,613,666 *0DC2AFE809C1C4C4225C1108F1988E82E26EAC57 EMILEPASEY
143,613,667 *0DC45B425745BC7BBF406CB6973A8445D8397166 en1ck
143,613,668 *0DC866FE7AB76E936C98FB2B6B73C6828CE4044F BOBBIELABS
143,613,669 *0DC44C2F6479702E0D032302070DD135B168DE6E BOBBY-GAFFNEY
143,613,670 *0DC190D0BF3CACD96DCBADE81F857F81A031D940 BOB.KARL
143,613,671 *0DC957EDA6125D80E52E48DE7FBC80A523B73B7C BOCCOLINI2
143,613,672 *0DCECDF3C2B8F5460A52507CEE03F99321E5538A [email protected]MAIL.COM
143,613,673 *0DC79B10A6BA165ABE6B748379FAE1E43BD5FC48 bofgf
143,613,674 *0DCF7EFEC7D40072531A0D9B937144616C4EFF9C englishspotrabbitchocolate
143,613,675 *0DCCFFDF940508AE170C66910E29F84053657686 bohoage
143,613,676 *0DC8E94900A1D59096B60CB2FEC3780FC3B57E10 eniksamad
143,613,677 *0DCBC2FE4F8A6963BC966557E72587DC28615CD9 enjir
143,613,678 *0DC00442FE27E2AA494742B073BE31602A43D30F bolicina
143,613,679 *0DC01E8FB0CBA4BE85B9AC6C590E1789949B91FC ENNTETTIED
143,613,680 *0DC73D2FEC25DF997476461A55B93B5816231B23 BOOKERSORELLS
143,613,681 *0DCC7BF2140DC80FEF8FA8FFA8B0E479ED4A67ED BOUAIDEL
143,613,682 *0DC8B47FB99EE7D7ACC82DCF333BF60D1D2EE2C8 eos,e
143,613,683 *0DCDA3E8D8BC5D8D099CF715629CB20DB87A3F4D EPIGRAFIS
143,613,684 *0DC9EEDBF67F407F6D21D1134D29BDCE37948314 B%%QI
143,613,685 *0DCF248D61B8B537B777FA564299142891256239 ERICH.KLEBE
143,613,686 *0DCE6918E9A5CB403A56FF705E39E9940E92F290 ERICH.SEMONICK
143,613,687 *0DCCC9E9DB5B0B677DBFCB78CCA8148027676A57 br8w$
143,613,688 *0DC78FA5F7217A1E774E8B3B22A03D7770A6BE7F BRADAVIČNATEGA
143,613,689 *0DC9F4DFF8C54880B98A38711B66D29CA357A34A BRADLEYHOSKING
143,613,690 *0DC143A8DE5CFAAFE78C4E014F908A03B4F1EB42 BRADLEY.KRUPICKA
143,613,691 *0DC472EC109B9E003C69EF479434C4DB75922653 BRADRANMAR
143,613,692 *0DC81026D088DBB5052E8E3F650ABABEF6B769B7 ernestcolyar
143,613,693 *0DCD4B824EEDFE378FC8337DDF5EA06B894DDE0E BRADYSHERROD
143,613,694 *0DC5B8D5543AF719E8411B0DA373B2F603932FD6 BRANT.EGUCHI
143,613,695 *0DCF1A1E6681EBB5CF8D8E2E40E8A6DAAB9CF573 erpuz
143,613,696 *0DC0C11BCB703EEA6E71D316A33EAA6ED4B5F21B BRASILIEN99
143,613,697 *0DCEBA20FA5FE8219125139B6B6747D1B3EB23EF brebo
143,613,698 *0DCC1F8BD51538AA456284DE4654E82934510E45 BR)EJ
143,613,699 *0DC9E63CD79DFE17B2B10D7334EE006EB2CF1D17 BRENDONGUINN
143,613,700 *0DCD3DF682A6087A3CF6ABEE6C6B804164A04910 ESCOLHESTES
143,613,701 *0DC0A164A2EF24F6677234A4F954035AEF34E616 BRINCADOS0
143,613,702 *0DC41509B9C5DF7522BD5C91DBA44645205CE3A1 ESR809
143,613,703 *0DCC883E6ED52B455E065523AA9F8D4B5FCBA4AB ETADEKAT3
143,613,704 *0DC1850969225CA393E048BAC9EE540B7193F34C etsgirua2
143,613,705 *0DC7136E83CBA6BEC543BB49A5376574B32B9886 eua0
143,613,706 *0DCB5760EDB701C6B66EC985047070AE91B7DB3E brucenevil
143,613,707 *0DCF69FE1D0CCC0C0BE88BBE0AFEED66AB6624E1 EUIR
143,613,708 *0DCF353F40E3267A1F22D4AF89E0CA3538BDACCF EUNICE BLACK
143,613,709 *0DCD3D57E267B1716B9D218E22149121813C8B29 bryonkjetland
143,613,710 *0DC645A2E91C7FF3FCBC2CD4B22DE390FF627041 bscb.
143,613,711 *0DC5AE56F0055B5B9CFE520F5BC56DA7F63F1CDD bsdud
143,613,712 *0DCF2EEA3B049F6E1A194B0270457BFD7A306161 b"si!
143,613,713 *0DC4F766F34B7EF5EED2BE2FCBBEDC1B9A74797A everybody'sawfullygoodtome
143,613,714 *0DC20184F28B9E67C0ADE576EC4D38F917D301BD BS&SO
143,613,715 *0DCC160F212E7BD3B187AF1D016C9C1ECC531685 bswbjoehbsw
143,613,716 *0DC0B2E9DE800748E921538676FB828D2FD8F239 bswmevencabsw
143,613,717 *0DCFAEA8D84BBA464FB1BBE652892D9DEB6415B1 exscriptses
143,613,718 *0DCE9455D16A9CAE0B1FD724E87CB9E58A578476 [email protected]
143,613,719 *0DCB81ADCED6307A44A0C0206270278A6414C689 EZJITOOP8
143,613,720 *0DCE6444D22140663D52008E16A58947A3014221 bui$
143,613,721 *0DCC3F56258308EF4C674792771D18298194C27D [email protected]
143,613,722 *0DC0F1D795B2AE4D4027A21291D5610F648DD48A [email protected]
143,613,723 *0DC1B08C6E5F86EC9F1EAFF5CE216DBF8415445B falawhos
143,613,724 *0DCC60A2FF023C19064A383E22465B949A5657A6 [email protected]
143,613,725 *0DCF7410D0D1DDC009B7922AA4CEBD6EBE9A84E4 bv(dl
143,613,726 *0DC6C62AB4720C21D2D3071D3D7700C4EB6355ED FDILASCIA
143,613,727 *0DCA099479BCACEA35B823ECCDD8231B9CAEE5C8 FELIPEEUERTZ
143,613,728 *0DC24CE86C1920075FC09E1C4ECFC5E091CED1F3 BWCS5
143,613,729 *0DC09A7EDFD35DD24FCDAD2F07917146E9F78C9D BWONGJONGJAIHARN
143,613,730 *0DC91105BCDE1A197918A256CA93310C5B027FB6 b---)~ ` )x(
143,613,731 *0DC3FF78479017B459CEBECD7C3DE55C39263A70 bxkr:
143,613,732 *0DC0C5B0DDF98B1AD9B302603AF099DCED8AAEA5 by9b&
143,613,733 *0DC17EBEF17FEA1F9F3C5558B1278052A54E56F0 bzjf:
143,613,734 *0DC3EB322C90698E0D55BEBD8B1F8362495AC42C [email protected]
143,613,735 *0DCF85F648C7FD759D24F7B9CC058105310CD9B0 c.-
143,613,736 *0DC4079BEE88F07FBDC0A7D830B43D907AB3C697 c0rrelatng
143,613,737 *0DCD42E4C718E988DFE4497B009BD8CA07FF3D4E fiducias6
143,613,738 *0DCE4BD5D0A02866EB31CD97AA4D3FFB57232936 FIESTAS
143,613,739 *0DC5241786BFE0E4F2B1801FD197BEE27830F0F4 FIGARO23
143,613,740 *0DCD05946A471DBDE877B6897B021FD5457A7C54 fimaa
143,613,741 *0DC5D38BCBA8C5D0EAC9E8A94B379F089BB681E2 C407Q
143,613,742 *0DCFB0D9C9E632C851C88FB028F35416E419E54E c+4e
143,613,743 *0DC63B113D4597BAB13472C2D4B0795451919A72 FLOGIVE9
143,613,744 *0DCA7FBE2386DC3A9816007CF8527E8CEFA80596 c5ovy
143,613,745 *0DCEFA1BBC7C9F7FA619C36FAF98EA4EFE56AEF2 FMORESCO
143,613,746 *0DCC844BC1C625A0153E1B50F2B94CA715CF4EB6 C6V9B
143,613,747 *0DC9B873549782A66FE799D23CCBFC0042EB4542 C6%VZ
143,613,748 *0DCF95FE59818C176D398802E9D726522ECF3DB6 c?:8$
143,613,749 *0DC05C2B09B84C97FB9ADB59D9FD61A49E8873CA FORENSIC-LINGUISTIC
143,613,750 *0DCD13D38434D0A56F0431C07ACA56B2E70D6C84 C9BGR
143,613,751 *0DC7EAEEB11DA14359B134AE5BA27ED8672F2D68 c9lmk
143,613,752 *0DC6C7F0388C8144C9AC75FEC874F63A642A1FC5 FORREST.LUBIN
143,613,753 *0DC3DE7B5586380434F449B904EC5ED823D3D546 campsun
143,613,754 *0DC9317682CFF92713FD3FBB77BB921B20AAA7D0 [email protected]
143,613,755 *0DC320922FECA575F4491856E6AD203AC52E315E FRANKLINTORRALVA
143,613,756 *0DC56A4BC0060B14FC7E53E903F3160B2F544365 FREDDIETOUSLEY
143,613,757 *0DCEB06BA9DCAE842B788E65770B10C49805B3F5 fredvs.fred
143,613,758 *0DC20C6488402890B75B5624462657CC14D87C55 FRIDAYZENITH
143,613,759 *0DCF39E752723940F4FD980CDEC957A785A0F553 FSUTILS4
143,613,760 *0DC89BF007BA8D52A71AD15A86684855EF13A189 [email protected]
143,613,761 *0DCBEB982997C6A66D7D263A5ED2CBAA4811BE4E caryatid,k/&/r/i/'/&/t/i/d
143,613,762 *0DC52CAB1D6A4D0A670EAA9D57BC89707B92099E CASANDRA.GRAHAM
143,613,763 *0DC7EADED5291369A9DFA8FE6BC15BC5E1F786E5 G9*
143,613,764 *0DC8DF93DACAE6764E4BC1D197ECDF67E4845827 GALENOEHRLE
143,613,765 *0DC02DCB40F7DF358C10F464E2C85A1ED3BE5EE5 GARFIELDHAMOR
143,613,766 *0DCAF801E883AE822D294E228B24F7461C249C4C garlanddarcus
143,613,767 *0DC458BA5639EAB2B61C24742400C8A249ECC951 CD,0I
143,613,768 *0DC6D9E823122E126D4117A9BAB43490DE0F4034 garyzhu
143,613,769 *0DC62D4570FD5E9FBD76C8C7E6B288FB99F59F9F C:\DOCUMENTS-AND-SETTINGS\FIREXWARE\LOCAL-SETTINGS\APPLICATION-DATA\GOOGLE\CHROME\APPLICATION\6047263\RESOURCES\INSPECTOR\IMAGES\LOCALSTORAGEPNG
143,613,770 *0DC17279F628404B60E4093921E74B1BBA76863C CEAAE
143,613,771 *0DC325925BA8BED744FE26414F44AA56B71EAD8E GEAAIDS6
143,613,772 *0DC90D4B40FBCC1AA922B717E95A0FB5DEA497D4 gebrders
143,613,773 *0DC0629468028F4C8EE616913E60133C445402F5 geherkapitaliseerden7
143,613,774 *0DCBE8C184851678114AFB9B7A2F8875EC32DD78 centricaenergy
143,613,775 *0DCBB20E44E3E9F8B41266B2AEE44FBC4FE3B21F GENOVESEOVÉ
143,613,776 *0DC60A2ED2ECD6A70CFBC185B432282BBE5DDB0A GENUG0
143,613,777 *0DC553E773ECF5E71E98628BFD2EE5AE8F27B362 GEOPORTÁL
143,613,778 *0DC1EDC97EB3ECC8A2E1E1C61D7D2749CC979BCC GEORGEANNE
143,613,779 *0DC58D6EF197D52850D320C272CC574FFDA798F0 CFA-=
143,613,780 *0DCF7552A528E9A38B9E5EE4555B582AFD3E6853 gestoelte
143,613,781 *0DCDEB01D35E6EFDD985AE320ED9ADAA25F9DE39 Ch0l4n3-$
143,613,782 *0DCF86DBF6ECDBA7B1C0D2688B0782AB9BDA54F7 Ch4r0+s
143,613,783 *0DC605C24ACEF690EEA5069CB372F2FB79406510 CHANCESISSOM
143,613,784 *0DCC18E6C1FAAB775B43E40280A73AB3D58E9294 [email protected]
143,613,785 *0DCD9F8FA94465F86A411303CBCFDB96CDC476A4 GILBERTOPISTOLE
143,613,786 *0DC0F6D46F4A77B150F5E465E1D0B6C1A903ADFB CHANNEL1ZA71ON
143,613,787 *0DC92FB49BC09225D04923EEC6F534F2EB09F128 charliet
143,613,788 *0DCED851C28E9EB3A82D30E0767D1CB295013F87 CHARLOTTEROSSEDWARDS
143,613,789 *0DCEC0AFCBE6B82D1C1D39D46EDF2D617572FF14 CHAS.BORGHESE
143,613,790 *0DC4F6C24230CC6A6E52C1D05D179DEA92A458C4 GL0RIFIC3
143,613,791 *0DC19C5D5C3E16FEB507962994F2CBE9780E05F6 GLEEWIKIACOMGLEE
143,613,792 *0DCF56B187CF27E2E137D83BD06405EC9C441ACB CHEERLEADERFÖRBUNDETS
143,613,793 *0DC977E1707DE023D5D5852511EBE304311809D6 GLENN.ESCHBAUGH
143,613,794 *0DC4F5EB20C34EDDE6D020A967D0E15517E8BF34 [email protected]
143,613,795 *0DC2BB1763CF78509C05F29ECFA8BC804865FDD9 [email protected]
143,613,796 *0DC6B538AAC688D21E9D0FC1A574CF0A3CD2E2E7 GMARIP
143,613,797 *0DC155AF9D6452901FFEA8B39F718FBBF419B874 god.will.find.us
143,613,798 *0DCDF60C22497441D15D5C4E638536B3CC2C356E [email protected]
143,613,799 *0DCF032C3199AAC612F52C52AC5AE103CF785B28 CHOCOBOLAND
143,613,800 *0DCC13EF8434225B47F2BE1FFDF89CA11262AA5E CHRISTINE-DE-BOER
143,613,801 *0DC302DE27F77092C53C2D00F425CFF9C6517D7F CHRISTOPHERBELLENDIR
143,613,802 *0DC2DB87ADE3FBC45CA2B384613E6E84F9A30B42 CHRISTOPHERCISTRUNK
143,613,803 *0DC4185E50BAF15EACB358400EDE79829512E110 grafenwoehrbsw
143,613,804 *0DC75E718819005EE49D139A463CBDC44E84AC32 Chris.Wilson.&.Alexander.Janko
143,613,805 *0DCA6F60EC232944C614FA3BF804854E43A34F8B GRANT4LYF!
143,613,806 *0DC89D5DD3478F6D4D32C910DAB7A786646C2501 chybnous
143,613,807 *0DCABB1AFED796197FEE2F7EB7E30C86E4F71ADD GREATERMANCHESTERSTOCKPORT
143,613,808 *0DC38913CAF58763BA4EA0A35F9C0BBD1BF28347 GREGGOSVALDO
143,613,809 *0DC87B4CF81CCA737B3BB2A2D7D50F8BCDEBC19A cinaient9
143,613,810 *0DCCF78DF3694DCB59330AB604B901419626E3CA CJCBF
143,613,811 *0DC2C4E527A5F336C053E67078D311C108E16F5F C#,K"
143,613,812 *0DC46DC82D6401C062B02BC774B3AA50A661CA9C gstcalm
143,613,813 *0DC0F0B295D8D002026F563FC73BAC2291DCA570 [email protected]
143,613,814 *0DC97C38210EB082A6D23C42E108D978B2503B8B GTPYEDQING
143,613,815 *0DC16C059D39781F745F5A6973C4586AF483638A GUADALUPEBARTS
143,613,816 *0DC1AF99EE9BDBA2AB7AFA66011F88066FFCB027 GUS.PIETROWSKI
143,613,817 *0DC50BC34CAC1050BAD0C38FDDD9877728107D7B clintonpotts
143,613,818 *0DCFCFD496B6D56EF3D8DCBCB92F7A55F84AF83E CLINT.PEART
143,613,819 *0DCB93FEBDD0AB9547760DB473095DCD3552D36B ~|haaa
143,613,820 *0DC8E271D279B77F08A78E289B9719BFECC40E3F HABITUADA123
143,613,821 *0DCBA2320193AA7FCFFC775CD30AFAEFD94FC7FF clnnb
143,613,822 *0DC9C7308878FF40E6D2F0CCCC5908E24B2EB5AE cl:wk
143,613,823 *0DCD9CAFAE8AC44FFF999067CEA9607517584BC8 HAGHJOO8
143,613,824 *0DC5C3001C9E89526248253EA6172ED4A645A05A HALGUILLOTE
143,613,825 *0DC089FB403726DC1F3BC98182AC993A5514AA6D cmptrzng2
143,613,826 *0DCCD46DE81E44D0743646E38C42559C9479F59E C.n)
143,613,827 *0DCB8C9BC6106B5CBD9BA9FF80D50F59B0CC53DD c-n8o
143,613,828 *0DC20E552EE9B667C2D1D16ADD270D79FA11DDC5 cnq s
143,613,829 *0DCA83AEBA72F0FDB002F030861381D7215F91CC CODY FLAGG
143,613,830 *0DC3A1429C021900B9CD6725CAB737AFF308F847 [email protected]
143,613,831 *0DC7C4960288EB71EDB9AE4FEF59DE42889E4D55 cohsh
143,613,832 *0DC3DBC1506B52EE1411BACB35EA3D2419650CED colecosley
143,613,833 *0DC00AB9BFCDE29011F2105A6F0993C86CB06D12 COLTONCUSHER
143,613,834 *0DC45FE698825C392049682B64943F17C7375901 COLUMBUSSUBLETTE
143,613,835 *0DC6E48D48AEB5862D4408F53D68598DB8FCA1D8 COLUMBUS.THIBEDEAU
143,613,836 *0DC96727BAC0D783D25F110FEFECAADBFEB56E33 HARRY REGMI
143,613,837 *0DC8AA6492C4E2B049459DFEABF5019A85D7DA61 HARTEYJ
143,613,838 *0DC4943B591F66530E3C85036316444E5D012F9C HARVEY.MURPHY
143,613,839 *0DCB7F8E0AD6EBC51B930C65DFF55D8E6B1308D3 [email protected]
143,613,840 *0DC6499BC243F1D71863214AE08606E8536B527E HASSANBEHRAN
143,613,841 *0DC7C6669105FC57935DEB6063C96E45B67E16D5 CONCERTOGROSSON.2ANDANTE(MOSTDEARLADY)
143,613,842 *0DC5644870A267A49C3D89DBDEF778C3985EF129 CON LOS OJOS BAJOS
143,613,843 *0DC4E8B78C81F1041C6480CEB016F56BD8C81E4F HDAZA14
143,613,844 *0DC88B9510B91AAAEE3BB79A4494C10C296421C0 he110!n9
143,613,845 *0DC15710A82BBD87A480EF2012EAA5B5F85DB028 construciv
143,613,846 *0DC4CBE0AE8BA6292A3E9864362A797740F0EE13 COOLTIGERGUY
143,613,847 *0DC3C507EB5C45860C1640427C87FCC4BD1C8B16 hebr4!$+$
143,613,848 *0DCA5633090B7B01DD0BCBE87C2E63E93D07D00A heermacht
143,613,849 *0DC6124C1FD6DF85926BC15EB2F96CCF04636F23 cp"4&
143,613,850 *0DC03B3089BFD6EA6C513B28E226F913FD77E23B C:\PROGRAM.FILES\COMMON.FILES\ADOBE\HELP\EN_US\PHOTOSHOP\11.0\WSFD1234E1C4B69F30EA53E41001031AB6478EDA.HTML
143,613,851 *0DCE1A1BE7EABBE65DEB5FB11D21DA5D360BE323 [email protected]
143,613,852 *0DC32C7814874BB4A6AA28B6696FE57A35248533 herbmesich
143,613,853 *0DCE361BEA77390237AE871ADA4FECD1B4FA1550 HERBWONDERLY
143,613,854 *0DC1DEEE722001197A125055D122BB4AAD5F53CF CQ;NB
143,613,855 *0DC142C858DE7571442DFB1840350206A137667B cqqv6
143,613,856 *0DCA5313B489AA7473D1ED1E98EBECB46963E5DD cqr1q
143,613,857 *0DCE639CFF9D0D8F6557D4E4E91A2B570F83A952 HERSCHELMINGES
143,613,858 *0DC9D99278FAAB5F74F2785F622E20B2A103932E HERSHELMANGHANE
143,613,859 *0DC1AF1F40ED39C1F1DC10EBCDF7DD5676C9DE09 craniograph
143,613,860 *0DCB704E63E354E00E8ACBDDB065DFBE24255AF6 hewhoridethinrage
143,613,861 *0DC21054A87A225D35DD7D54E8A450D87F3ED9F8 [email protected]
143,613,862 *0DCA4ED31C74E80543F5E4F2F5DF7B85F5F0CD05 HILARIOLAPAGLIA
143,613,863 *0DC2A5E853F52C868B284526B218E1B6A511FD3B CROWSAM9
143,613,864 *0DCA66D39D0517ECE9D36DE269B69A2C89F87658 HIMALAYA-BAIS
143,613,865 *0DC05D37148E3EB42D24097923E3188D8E955909 CR%SI
143,613,866 *0DC202A6CAB8FE3B71C7F105A4512AE99B01AE75 CRSJD
143,613,867 *0DC1CFE64C7113DB71C363067107AF7C95D947F7 hindeck0
143,613,868 *0DC2D852AE6727F0061C8CBDD44B85F45557E9A3 CSELLERS
143,613,869 *0DCDD66A1FA427908AE8A0A2762068611370B0F3 Csup
143,613,870 *0DCF414859DE1099916DD75ECF64A981498CBEEB c-t)=
143,613,871 *0DC41FA35C884652822125B434FF23B06580E85F HOLLATEX
143,613,872 *0DCE67D3030459461303FD574FF178E764258F8B homogeniser
143,613,873 *0DCCD745EFC15D8443F63CF5A66F543FF55C3743 CURT BYRD
143,613,874 *0DC08BF5FB56B49EF96EA82326B531F8D8988C4A CURVEIN2
143,613,875 *0DC7C29A264A7873D1F1ABF6115E58637E340702 C-!US
143,613,876 *0DC002D4C966286BEA7431B292CF9D5478CA5097 HOOKED ON CLASSICS 3
143,613,877 *0DCF1B1866DBF1E1A8DA356401997AF6F55532F5 CV.IE
143,613,878 *0DC1CE136D1E316C1648E39A6B6720FC8158D6C7 CVt9
143,613,879 *0DC1930E24A90BBBB35736889EEE268FBBB24D76 HOUSTON.ALTHEIMER
143,613,880 *0DC770BF8C3E7BF01A19E9C9738D514513187629 houstoncovalt
143,613,881 *0DCFCBD6F4CF8514871FDA232E1266EE616C4BB8 c(xcy
143,613,882 *0DC13C4CE1F0C15A62C32E720C67CA95DC16990B CXIUV
143,613,883 *0DC89F69C878F23A062986F744A30897D2872ADF htarwretfa
143,613,884 *0DC84B4168123B806F149B57EF44837BC6E51A9B c&ymt
143,613,885 *0DC08C60E83F224AE933E592344D4E8F098FE324 cyrusdaudt
143,613,886 *0DC7CABF1540FBD4C59D984A68A9583974E6DD9A CZGG
143,613,887 *0DCC95E31A7F6C67ED792D02544161C10F90595F D0UM
143,613,888 *0DC0266239A28E6B47D7996F158D078406ED8585 D140521
143,613,889 *0DC93A890138CC34180401F8741C4303E2087080 huevitoderaton
143,613,890 *0DC40C9150D4DF1869489801240FB23EBFCCE497 HUF6HIS7
143,613,891 *0DCF55758171928166C97E8811CD5828F379D540 HUGHJOHNSTON
143,613,892 *0DC09FA880864274672C20E9B9E8E55EDD3DDDF0 hütteningenieurs
143,613,893 *0DC7D3C3EF9480769405721B733C6444887B9691 D5AQ
143,613,894 *0DC140EF1AEC22431C514328EF7A1074FE1318AD d5R
143,613,895 *0DC15B595D64D8850179CDF99ACA0DD7583B4778 d6d3_
143,613,896 *0DCB7CD71500A80997A19FD78C9EB90E8173E1D8 IAMBROADWAY81
143,613,897 *0DC9A8E58A26AC933CFB40E9C0C386AE2882CFFE IAMFREEDOM94
143,613,898 *0DCA8A37061FFC8E5DE9A65B7C1E18EC30BE5015 iamgolden71
143,613,899 *0DCA96F2B1404E9F43E8A5115339A57722722434 d9721a1
143,613,900 *0DC714F36F28FCE9821A3882FAA3E70E2C644857 [email protected]
143,613,901 *0DC3D053A16C6DA368BE5A2C2AFFC3CD470D32C5 IDEA71.247.58.16
143,613,902 *0DCF35BC73AB44C03058D0D956B99A250284F147 IEJAVATRUCO9311
143,613,903 *0DCFC326E985125B52FB8B831F3035D9751CE7EE [email protected]
143,613,904 *0DC91AC08187BB3F1A09075FAE8CB1642232A677 IHRFHQ
143,613,905 *0DC4C8082D44CFCD9D4AAA88BEB1B2A39F27D5D3 ILOVEIMAGINE71
143,613,906 *0DC857D575B4D515BF0B4CE8B7BC0F618C43BFED ilovemoocow06
143,613,907 *0DC172362762B398F3B6E9DAA891365A5D2AC753 ILOVEMOPAR78
143,613,908 *0DC95B26CC84C45C986D04EE094254B00A7478AC ilovepav
143,613,909 *0DCD1DEA355CB92EA204174F955BCE1085865CAF dannyperdana
143,613,910 *0DCF0963AAD2A8A7EB2B73D0904244B35F6FB394 iluvbroadway98
143,613,911 *0DCAC215E0979C4EED8C19B0DF9DD17ACBEF1E82 DA/PI
143,613,912 *0DCAD02BEBDACE45CDF2159BC1A993ADDBC6E02B D%A!R
143,613,913 *0DCDF33EDB0E6732BDAC08D4614EF9F6CADB2BFF ILUVFLYER43
143,613,914 *0DC29E79997A503522FBA99995641D152768C205 ILUVWENDY1987
143,613,915 *0DCE1884513DBBD170E3C961642BF24A285097E7 DARRENVETERE
143,613,916 *0DC8D1689D643AEFF5B60D9BC6D010129F6E6BF9 DARRYL.BALEZENTIS
143,613,917 *0DC8531D5441DD98DB54846B82172F21C2710E1C imammamis
143,613,918 *0DC4A10AA0FD267A272CF22DCC4B2D92F631D3E4 IMAREITA4
143,613,919 *0DC69484931A17FFC202501AAF6DD9D5C8F06800 IMTHEBEAUTY
143,613,920 *0DC90C5856C967F03C122A9225668348840E6242 DBA.F
143,613,921 *0DCC4CEA2D192FF77756EDC8B180F0D1B5B30723 DBZR;
143,613,922 *0DC6FF8FEF523B6726E607AC05C2C9803D1E7566 D(C4
143,613,923 *0DCB933139837F1FC6FC24396E7017E75D499260 dc_5p
143,613,924 *0DCD0A2FDEF6A8DD9168B9453330023159E86C1F DC+KG
143,613,925 *0DC12A04EAAC6E76ED4B04AED15433F8E06E8A2F DCRD/
143,613,926 *0DCDEA6DBB7D5E3509DECADCD894FC48F212CD81 INTELLIJEN
143,613,927 *0DC242321640BFD93EC83DDD340049E0CF0D9C70 dea_9
143,613,928 *0DC3430197524ADB619064603C550E326D13DC1F DECHARGEANT0
143,613,929 *0DC4C6D1355385B0697949C01D147F32921B3993 DEKLAHC3
143,613,930 *0DC82D82D796F6D133994E96DD3A09D112D1C23F delconer
143,613,931 *0DCA97CB0190CD88E3301BEBE6D6C4D3067140CC ISAYANAHS
143,613,932 *0DC4460D338A7E7930F7CAC877C37FE582520D3E DEMO MAMO (FEAT. ROMANO DROM)
143,613,933 *0DC6661D286703176AABFA15E59B65A2D832AF6E ISRAEL.WADDILL
143,613,934 *0DC24B7E89D23D36FFDC0CC16F16A2D59148E996 DENNIS MENICE
143,613,935 *0DC1BDB15D85F5A7D92C0B4A678A3D829BB44AC4 ISSACKUTZ
143,613,936 *0DC4AA8688BF75A3224EA66BA57094F9507FB78E DEON.SCHWARM
143,613,937 *0DCD0F1BF96DCEC8189218B0FDA8918F1E2180E1 [email protected]
143,613,938 *0DC81B8BC5A1DEEC8ABFA8A1504155DAABC632DA derrickdollar
143,613,939 *0DC6046A7FCC8BCE6ABA8B52383D09D5F304E315 J;!-
143,613,940 *0DC10AADCB504E073BFBDE7831E860A38F993B9E JACKSONTENNILL
143,613,941 *0DC1D8C4F541319D90B7EFAD789FD2417317D707 dexterfundenberger
143,613,942 *0DC3A09640FE97AC339E555D12CB92A577485AC4 dfic!
143,613,943 *0DC4198E9056810DEC7CCA62B6EBB320E96AA7A9 JAKE.MARGOSIAN
143,613,944 *0DC774661804ED34353E05E76AC45824DE457106 JAKE.WIEN
143,613,945 *0DC033F11164BF3A9CA8228861E6F0367AF6C5BB JAMEYZERA
143,613,946 *0DCAB25FE4A5CE8CF1A61FFAF62A92179073EBCB janell.cross
143,613,947 *0DC3702F5C2F0855DC8C2CAE40FB238A8AF2BDC3 dheeraj.bhambhani
143,613,948 *0DC5233AB4180D8B3F57D74B20C3E45781911DC3 JAN.MAYALA
143,613,949 *0DCEA7739D068D0E50E4E3DE4D3E6C0A8AF130AA Di69
143,613,950 *0DC8E18AC08FC04DDC0F9144E8E5A06F32EAB203 DIAMONDPEN72
143,613,951 *0DC7D0B5F70BB63B62E756D6CE94952D0AA0A479 JAY.BRECKENSTEIN
143,613,952 *0DC1CF3C3AC892963A706C10FFAABCEA59243576 dinosalvucci
143,613,953 *0DCF0524E37EA9D42EF89CB69441E0C0C787DD31 JAY.YERTON
143,613,954 *0DC6EAA9B8D9C6C8BD6436026C1BA6652F45F4B3 jcbeatty2
143,613,955 *0DC13EA780F7DDC5B5C33103655387CFEA98C8BC JEDMANZUETA
143,613,956 *0DCFFFBA107A53F9D6E9EF938B0D8F7B83330F54 ditretto
143,613,957 *0DC7C3D9554DC2CD26838FF6C097E8620ED86644 DJ3B
143,613,958 *0DCBFD4E1B6ACA3679E64467D9A3B67F36F27094 JEMANDEUNDNIEMANDE
143,613,959 *0DC9F4CFAE5D4DB54D5FA7AE0002CAE18D5F54B0 JENILL{
143,613,960 *0DC65D64BE0D9534C1DCC904A3EC8CC7234BBCBF [email protected]
143,613,961 *0DC4D75B784B9D31BFE6FFA2DB7A66A62F1E3043 DKAUC
143,613,962 *0DC00F6DC6C1ACAD9C0BCAD4E3C7B5ABCAA3F462 jeremiahmanlangit
143,613,963 *0DCD26EE085396728193CC43B346F8AB4BE109A6 JEROMEBRECHEISEN
143,613,964 *0DC5CF17F0428432E569955495327C209B7AB9F1 dl-d
143,613,965 *0DC8EE86537921A497BEB7B7C01963AAAE0E07FB dn9v8
143,613,966 *0DC77D91F7C1100563AED9056C14CA431244040D dndig
143,613,967 *0DCD009528B1C59525599487FB1A0322F04F03D9 DNDIG
143,613,968 *0DC7CAAFAF4D983587D45C01CD06F1D0E594F8AA DOBBELTUDGIVELSER
143,613,969 *0DCCABC9C9FF2BC7627BCD2F9DAE68C29A987F74 [email protected]
143,613,970 *0DCDEB356A0AE6B6FC25513F7B8AE00D77F5B05B JHOFKNECHT
143,613,971 *0DCEE2C90667B46278C6DA89789C045654F6E707 [email protected]
143,613,972 *0DC91769B3A0B984AA2A2CF2F91FE5A52D84096E JIKOUNOT3
143,613,973 *0DCE5523AD7FFF15A6EA28BECC767719295B0756 donaldhanna
143,613,974 *0DCD96F1FBD22908280D155DC8894DBD7B6DB2C9 [email protected]
143,613,975 *0DC52A8ABF04E8B8D1247D8C1BCA40780DA9ED02 jimmiecraiger
143,613,976 *0DCD572190062A12CB36A521F82F9883556717E7 JIMMIEONUSKO
143,613,977 *0DC01B03498D231BD82164773DF7A84E848FC4A3 DONN.ANGEVINE
143,613,978 *0DC28EB9567AE07401362ED4C984D797C0CE6D0A donovanalvalle
143,613,979 *0DC475B492AF35C010F6417CA2500640FBD1FC6F [email protected]
143,613,980 *0DC73FC22E7798C8A428E0F687A7F84BDE174588 jmxtwcav74
143,613,981 *0DC65755EAFDD83CF8AD2CA147CDA9E44A8D68F1 JOAQUIN.TURELL
143,613,982 *0DC53017157E7DC548EB83C682138173D23F74D4 JOECOLUCCI
143,613,983 *0DCCF971DDC0CA83CBD8C546BEC2910929EFE93B JOETODAYING
143,613,984 *0DCB9452F8BCE7906AB2841CF5C5593C63604CA9 DOYLEPERSYN
143,613,985 *0DC82AE9F420CC1272669D23055D74DEEAD6B6E6 DOYLERUETER
143,613,986 *0DC97D06658A2B57327335BFC59AD7FBFEECA736 johnathonsisko
143,613,987 *0DCA0111D6D414A8D19E66891E072D428BAEF779 johnkiyabu
143,613,988 *0DC59C0BDBBD83B7EE9C3FCC8C588959924B0A6C JOHNNIE.BROGAN
143,613,989 *0DC533BC45980393CCB69192391A929C1E2F3447 dplaciez4
143,613,990 *0DC6EE12058ADB4E00EEBD8E96317F42E467A5FB DPMDP
143,613,991 *0DC585DC75666E8A387E0E0ACFE37732B4DCDFEF johnnyhorner
143,613,992 *0DCB93CED090F6CFF8B095918D6F05535C14C441 DQ&,N
143,613,993 *0DCDEC93A3B9A5135244D6C9A0CD20F0C8CA7242 jonathonhagist
143,613,994 *0DC4FA567484410A18DD024C29686C9A57372769 jon.broomfield
143,613,995 *0DC0D5664CD7FB6B6AF73F0077C2B92C3F519FEB JORDANNOTTINGHAM
143,613,996 *0DCCE34D3154ED802B383F91B1A131E9BD396E47 JOSEF.LAMANTIA
143,613,997 *0DC3DAD151F5720644AA31DA4B3AF22C37AED086 JOSEPH.WYKER
143,613,998 *0DC03C383B9704A631CC247E09E61B301BFC0BD0 DRMTCNSS7
143,613,999 *0DCDA0F0E6349EFF0E3D334C9C948B2457AA02D2 DROP EVERYTHING AND RUN
143,614,000 *0DC0810061FFD397C23B815AB0BFF20C0883A896 DR+VQ
143,614,001 *0DC988AD01960D9D883107F36222679E2467E2DB [email protected]
143,614,002 *0DCA6D618ED144910F03B3AAF29396C420D6BE2F DSBDT
143,614,003 *0DCA89F63F00DBFCE2BE33E8425161D02D8A7222 [email protected]
143,614,004 *0DCE22CC050320D972310C948B48826520B5AD99 D,SJ%
143,614,005 *0DC8F25F36879172113F78E84006066F6F680B26 [email protected]
143,614,006 *0DCAAAF06B690B1164153EFC5EB4CE5FEF856B2F JUDE.RISKE
143,614,007 *0DCE46DC3A3790C2461D3F13026618F895DA6E79 JULESTAWNEY
143,614,008 *0DCAAF193C40620C7C5C91C97CEA48037096EC41 [email protected]
143,614,009 *0DC0607DEE6AB00E13AFA590A293ECA7BE825B5C D-U6;
143,614,010 *0DC8E6E8CC1374D7B6E8B8C1DB58CBDBD75B12E9 duanewright
143,614,011 *0DC84FC7B20893CC5D822BB29AC3770CDF3A2D46 duelighedsprverne
143,614,012 *0DC1CF9ADBBFA013CF93606A016F14AB6FC102E8 dulchan7
143,614,013 *0DC42F46B2A1FF578BB6ADF709F308418EC79F82 dunkle-zeit-(feat.-elektrostaub)
143,614,014 *0DCF6666C2284BFA315CC9E5FCB87F0D66F5807D d#w-
143,614,015 *0DCB52ED9DE23298CE06CF4545CC896705DD2B0A d!wfk
143,614,016 *0DC7D83ADDDE695ADC1390F0075502300F8D6A61 [email protected]
143,614,017 *0DCFC5CE25D2AD883BDAA01C02E1849B760FCB9C justtheone
143,614,018 *0DC9AC6EB69FB7C3A02DF5ABF1424C2ECE8E39B6 dx/,!
143,614,019 *0DC340DDB09333D6D0A1FFFFF52D5980E02A55ED j*vb
143,614,020 *0DC24E40745EDFA5DD7F7DB8BAC8B4E18488F713 DXJ<
143,614,021 *0DC4D9FD2625AEAB901BB2936E11548EA643634D dya_e
143,614,022 *0DC868608428A66B09876754ED0370905C6BBFF8 k|"8
143,614,023 *0DC935CE8620D035EEA82BFD98F6236A143ACF97 KAMRANFAKHAR
143,614,024 *0DCB5568377BE63D4DB666D891285E4658FC102D dzjf4
143,614,025 *0DC182A97F5EDAAA9838B8803527851607C7C8D1 [email protected]
143,614,026 *0DCF5851BAB69A4E57454645BB6ACE20087AD37D KARLA.SHERMAN
143,614,027 *0DC379A12C28144C10294AE85535C7C407261F2D KarlT
143,614,028 *0DC846BC2870FE8604E961EEAF4AB9D2499BF065 edelwild5
143,614,029 *0DCEDFC40120F68B9B6BA53FCED6937361D2D77A EDGARDO.BARCIA
143,614,030 *0DCD7665C742E8DC2A5F09BEE06B2FDD9A997053 KELLY.LONGCOR
143,614,031 *0DCFF0530CC24735FED325D52F5B291A06E87F02 KENNRIC9
143,614,032 *0DCC3B6DC1B218DFC25A6A9133FA1D6ACB0E23E0 KERMITNATALIE
143,614,033 *0DC98C6EB28B2D3970A043C037490DE9E9581F31 EFRENBOUSUM
143,614,034 *0DCCE64D9389D813E0B0EEF6756C35D2AD669A35 egg albumin
143,614,035 *0DCCBAF5FC7218B247CA9466EB83DF71F4E0F909 egw.s
143,614,036 *0DCB0BF351A98BAE21A31466227CD619C1585559 ehcadae5
143,614,037 *0DC72DA67913D7F4F2B9B274A88CFBB0A3E5D7B0 [email protected]
143,614,038 *0DCBEC9D6E69073E66AFC7D1C9F2925285F0281A einnad
143,614,039 *0DC5B422F8EC8D846F8ED5899D166B4F906F2761 EITRESNI7
143,614,040 *0DCDE1B5A19585BE4276DDCFBF9ED816F2F70E30 KIM.DASHNAW
143,614,041 *0DCD053FAD1E31370AA709E4CACAF527A924CE57 KIM.ESMOND
143,614,042 *0DC0868B7393FC8408CA174E9C00132F470D3E4C kimmi.sue
143,614,043 *0DC6C4698156E1C9258E9782C36832D7178A3AC3 KIWANUKA ALEX
143,614,044 *0DC886B925A0BD64D2D85EAA16FB35FB4A3C7292 KKVLT
143,614,045 *0DC419DACF94FBCF5F86940FFA6A69D48B1DD38C kochajmypana
143,614,046 *0DC57DC9FA1997B57C664FCD0979F7AC72FB4A34 ELIAS.POSTLETHWAIT
143,614,047 *0DCFED42508F2FEC1AA8B99CC167FCEFC43AF2C0 ELLIOTTWIEGERT
143,614,048 *0DC93736DCD815B8CBFE9420168EAFA3D0AC5A4F [email protected]
143,614,049 *0DCAA5C31EC86952559F7DC2ADCBC2AB3A51DAFF ELOY.SIMONETTI
143,614,050 *0DC1CABC4D4DF12BD9D7C166FB474E52AAC0980F KPML
143,614,051 *0DC05670B642DFF1B2041F6F7E0B2E2402B2DB32 emanuelperdue
143,614,052 *0DC448EFE4A8121DB40C256A11D5CBD97E8FB6A6 KRISRAPE
143,614,053 *0DC5725223ECDA0E78587E452236CBC80CE7A744 eminem187
143,614,054 *0DC9D31E2198473902FEFB05BFAF329534191968 EMORYMULCH
143,614,055 *0DC217666AB52473BC549D9F980F4F9591F3CCE8 EMPEREURS5
143,614,056 *0DCD9E98D25FDB11297D4A0F8E474936A3574941 EN220227246253
143,614,057 *0DC75EF80CF747510DF65B0F6B04CFBC23D1DC91 ENCYANGEL
143,614,058 *0DCD46E31122C3D0076C57AC8D659AB1222E20E1 [email protected]LZ.GS.CN
143,614,059 *0DCCCCC2165DFC9D60FA0E9A34C3AE6371396889 L4TINIS3RING
143,614,060 *0DCFF0926EED8D692B452C997590BD61235F38A5 LACHUNT
143,614,061 *0DC00835F4A1F3F5095126A8488234C9E0A45E78 LACYPROSPERIE
143,614,062 *0DC0162EAFF00DFD51AF7DE815BB18F16DEA7D30 entrames
143,614,063 *0DC9536A8DF3749ED8A70D1D367B93EBA06F6E0D ladybiz1
143,614,064 *0DC79AFB81D080CD5E52E28ABAE6A1AFA96D5241 envahissiez
143,614,065 *0DC65DFE441764664D1B85A59B57320AD88F5C8F [email protected]
143,614,066 *0DC0794E839B64D8A10E106B92FA943D58FF840C LAITHHADDAD
143,614,067 *0DC15BC321E552AF90CCD6FDB44C62ADBDEC4EFD LAMAR.KIRSCHENBAUM
143,614,068 *0DC6D495BD0EE3CB8CD27A589E0633CC0D23AD28 epsilonretrovirus,
143,614,069 *0DCB6CDE5CC2A111B32A8E6796B9CDCD8177DD03 eq==
143,614,070 *0DCB65EC01B7C669082F768C498EF919D49E433D lancemustafaa
143,614,071 *0DCEEF6C3C5881EC3F3A7D078671529F338776CD [email protected]
143,614,072 *0DC76453185519985208793BAAA114F9308AAD95 LANNYHADDOX
143,614,073 *0DC52C31147C5FCC017DA26E0254E2429239C2EF LAURENCE.DAUDIER
143,614,074 *0DC54CE5A71D9B4501CDF7A6FA40486280C8DA11 espiassimo9
143,614,075 *0DC44973C30AC1148F73FED9000913330D9B9330 ESQUISSENT?
143,614,076 *0DC3783DF2A14F993D53CC2531A8111EC660D0D7 ESROHRETAW
143,614,077 *0DC05AA228E6DC09A1D2DCCCBB7793F6C5C277BB Estancia,Op8:IVDanzafinal(malambo)
143,614,078 *0DCE339D6C007D157CADB330E7FCAB6252076C37 LAWERENCEKLEINBERG
143,614,079 *0DC28FAA75B7D065240649D3E898311D43964BB1 LAWRENCE.LOUATO
143,614,080 *0DC5F008A4ACCE8BACDDBDC917DB91044E520C04 etgs"
143,614,081 *0DC56D7B2D1FBD58CE5CD874E38624FDA37CFF0A etiam
143,614,082 *0DC3F282028DFAC48CF1244C9088D0ABB1BDA0C0 etmoq
143,614,083 *0DCEA37616C0329D90A20F74D74286A4510BD8F6 LCARBO
143,614,084 *0DC78DBCCE9902C17136944CB17D4C1DBB09D30C leafgilded
143,614,085 *0DCB5A4AC126C2C2AF82B8851BB43B05F7FD63A8 LEANDROGRABEN
143,614,086 *0DC151710CAA474F188A8EA0932568441FE26A94 LE-CHANT-DU-MARTYR,-GRAND-CAPRICE-RELIGIEUX
143,614,087 *0DC7878E1B118FDE13F0D081CAB208FA05A0C279 EUIK"
143,614,088 *0DC91D1A0CE8B63AFFA4910A327894F31A903047 EUREKASS7
143,614,089 *0DC96F5725C763FCD8C802E3A84F4B831864F89F LELANDRIETH
143,614,090 *0DC5DEB1013E2DA4B1615B7BB1715B23E9F38161 LEOKAHANEK
143,614,091 *0DC836A6D0B20B2BB90C25AE73C924F176092798 EXUDATES5
143,614,092 *0DCB8E1A4567E9EDC51AE917CA6CA07534C3741D eyes-of-obsidian
143,614,093 *0DC5E7E456EF00CAE769EF5FE6154C041A5CD04D eyiy(
143,614,094 *0DC0523440B37F839E35937C6B9DAFD3942994B3 EYT9WXERRN
143,614,095 *0DC9E456226704D1AACA02AC620594EFE8A4B3FA LESLIE356
143,614,096 *0DC2F58EF6EE6EC4AA0FD670C19868943918FAEA LESTATCHICAGO
143,614,097 *0DC446DFCE07235A728D7448FC962EC632161E45 leupp1
143,614,098 *0DC817999B4F52F37DD68203D376DE039091A080 facultythe
143,614,099 *0DC70861F9C216E7B931CEFADEAF509ACA938DBB L’EXOTISME
143,614,100 *0DC7FA185D85FB09CDC13411A4AD063C857A820E FALEULA4
143,614,101 *0DCF3CCEDD52FB9DA7C838FE23FD885807DE1084 [email protected]
143,614,102 *0DC7AB53B2E06D95DE79B6DE5A452E9AA32CE197 [email protected]
143,614,103 *0DC19CEB246DA001F799B0BF32E916BEA62F285D liartkcab
143,614,104 *0DC58FCA854733BF54C2A04048BC699B2694D283 LIBRETTOTEXT
143,614,105 *0DCD7DBB14207DD5F00C24DC09A2947CE51516AD FEHERFEH
143,614,106 *0DCD013BB5FBCACBF17AE07BDAA68FD3A3331430 limassol-shopping-mall
143,614,107 *0DCA2CF173BDAB81954F95B48499EA7194A61735 LINDSAYBRANECKI
143,614,108 *0DC13FE99BDC22D2160ADD471440245023609C00 FELIPE.DEVINCENTIS
143,614,109 *0DC1B6337DD65B1BDC5B5950125AD642FABD26A2 FENGHUIFAN
143,614,110 *0DC40A02935B89ADF4FF72183D3049942C2ADD8F LISEBARBE
143,614,111 *0DCFA03D3C10D27A50113B114929F8D2B83D4B78 lK*
143,614,112 *0DC9C9D8846A9DE2DF9671C284506C16CE48DBAE L+NU
143,614,113 *0DC1B575FDBFD30A0626ADE6D00BC20BD21F3499 FIND.ME.BY.YOUR.SIDE
143,614,114 *0DC4B7D8EE09A3613A25E9B537E29D41A72E643C FISCHERPADDEL
143,614,115 *0DC0D30F7F38C707C6CE95A590C0E74C88E326C8 FISH B3G0
143,614,116 *0DCC74F6C143327C77C802A84D1CCCDCD7EC35D1 lonnieguevarra
143,614,117 *0DC6388D2115A8F43142621DDD29CCC9C4767F08 f*ja
143,614,118 *0DCF160C4820631A734C0CAAF790C70B0CD206C4 louistrenchard
143,614,119 *0DCE00F7A7699FF19B62198D9EF2AA75D87092A0 FLYFISHINGANDFLYTYING.FORUMCO.COMFLYFISHINGANDFLYTYING
143,614,120 *0DCD65FDDB213D227C25712F23A640DC051BECA9 fnflevw73
143,614,121 *0DC2616723BE5663696376E3457729AA4147D261 FOR3$33IN9
143,614,122 *0DC55D90C9D87400D7F11A1F9F02575AB677EBB0 LOYD.MERETTE
143,614,123 *0DCE7DCF13523DA14207E8C610D312802D7C0386 FORMUESGJENSTANDENS
143,614,124 *0DCB9C057220AEAC9126DB0526F5E3206A3AFF40 FORRESTDESILVA
143,614,125 *0DC724CC64A4327C1A12F40804F1DFB8DA286BA5 FORTISSVG
143,614,126 *0DCF17A202DCCFA2978E80467D9474CC1A906B39 LUBADUST
143,614,127 *0DC1F35D38A04DC0F860233CEDFEA446337B7CCE FRANCISGUNSELMAN
143,614,128 *0DC30C72C4ED59519C310C24BCC9B28F54E600D6 FRANKGOU
143,614,129 *0DC8E8157E421BF1D5943F1661DA81B4CD246122 LUYC453U
143,614,130 *0DCAA42329A90CDD48DB1D2B0BAAE4A106D1A913 [email protected]
143,614,131 *0DCD8DFB4AFCEF66EEB23E82C0FCC4DF2ABD3EE1 FREDERICKBRESSI
143,614,132 *0DC8DC17598E487264745D2E3F3F9D0F354F3220 lvwc
143,614,133 *0DCD2C5EE5448471D068F48A7098EF25E091F13E LYLE.QUAKER
143,614,134 *0DC374C735D9C2084C3AD075AF77FC9063F513DD LYMAN.COTHREN
143,614,135 *0DC2B906E5A6A81724794F58DF3A75A1FCA823F6 LYNNSURF4
143,614,136 *0DCC3258A1C74FCAC29085D825DB685A95B78B26 FROMSTANTONSTATION
143,614,137 *0DC0A4EA58E7DBC70FCCBC23F8066B34CD8F4ACE LYNNZEK
143,614,138 *0DC986AA4C994BA686BF3DB885A94184265BEC1F LŻYJ
143,614,139 *0DCFFE4F1F767017DD48A5C16631A57D4BEEEA00 furrowl3$
143,614,140 *0DC24969FDF624FA1552AD185BF1A8DC66BE5D0A [email protected]
143,614,141 *0DCB5797A7A955FD7223A17277D20BA6754D3DCF FUTOUOU5
143,614,142 *0DCD0CEA3DC93927B1831209180469889E769FE2 G090490
143,614,143 *0DCBFF54E93F4735AFAA0CE0B7F92049AAF9EF70 GAARDJIB9
143,614,144 *0DCDE5D11604D0FC3253385113AC32C99BAA76D5 majoitukseen
143,614,145 *0DCB340D21CCDE07BEE2B38CBFA9274DA10B97EF MAKE MORE THAN YOU
143,614,146 *0DC9DE0238711D9B6E8F710451B20E7224F2FAFC [email protected]
143,614,147 *0DCA905840B8763DAB91EF32CA3A0A1343B4E15C MANCASSANI
143,614,148 *0DC37FF7FFB94823C2A4535B05ED7CCA61F06501 manjusri-13-0
143,614,149 *0DCEADDC777B025711237567D363F9696FAD78E5 MANMAN
143,614,150 *0DC3B79759FAD93D84C1D0C61E810B3A7A7C4AFF GARY.GLOOR
143,614,151 *0DC6FC8B565037DE1989CE7876097EB0A37911CE GARYLBROWN
143,614,152 *0DC7AE3A3ED46A42F28AE015F343E33F0E26183D gedagteloos
143,614,153 *0DC348D1671774A9F10D8B91B1A055BDF5A3FE06 GEKLOOFDE2
143,614,154 *0DC830B86737FC1EC01F522523AE6D58DEDCB637 MARCELINO.THUL
143,614,155 *0DC771292FA4571BCF43BBC13ED9EB430F0E01B2 generalvicar
143,614,156 *0DC52AA8EB3195E90A314863C7611BC8003CBC70 MARCELOTOASTON
143,614,157 *0DC8FE44ECD749AB972B2A65FD3F744EF152BB7E MARCELOWEYER
143,614,158 *0DC724E19E11EDFD80330218AD42954D93954502 MARCHERS6
143,614,159 *0DC39F580343A31636A163683B8EDA1929BA5897 GEORGEANNE
143,614,160 *0DC58D6EF197D52850D320C272CC574FFDA798F0 MARIA.HARIRI
143,614,161 *0DC2BABBCC4AC7D78BD8BEF384FD9C76A5293D1D germanhomeschoolingfamilyasylum
143,614,162 *0DCD6FFE60AC7154C076C99DB701BF4807273086 GETMOVING:MEADOW-MUSIC
143,614,163 *0DC88AB82117E4574B0FFB1D80EAF3AC8BA17339 GET SET!! GO ROUND!!
143,614,164 *0DC999F92608C67C13ABA6DAF912288C977E69E9 getulian9
143,614,165 *0DCBB0757866C1D7BEAC893260E8E1ABA5D21B65 gilbertloveridge
143,614,166 *0DCFA892C3D2F69077A4A768F9C8A4664551B142 gilydd
143,614,167 *0DC2C691EE7580A0418B8FF835B76D38BBA98BA1 glo41388
143,614,168 *0DCF73E5F5585AA7485DDDD67D56C5A00D5B6A75 marlontopolansky
143,614,169 *0DC00C4DE35FB0AF01AD3ACA2803069E17613194 MARQUISKINKEAD
143,614,170 *0DC085D5D02B96973336C79442A176DCDFE1DF58 GOHPPEVÁRRI
143,614,171 *0DC9CA90A935971709A8F583B49211CC80741E75 GOODLUCK45
143,614,172 *0DCAC71004349A837D955E9E97CB62963D385ABC GOÓR.NAGY
143,614,173 *0DC663EFB2B968AA0CBA510ADEE4ED0E4AB7A627 MARY GRACE TAMONAN
143,614,174 *0DCD98C4AEDAF66628DA27AA57C44470431F27C2 grup.dostyurek
143,614,175 *0DCEB20D995AD87B953765BD4B3F9709D8ACD6E6 mattwoodhouse
143,614,176 *0DC6D461B6FBC0DE97DBE53E2074DD19E507EE4E +H3010913S
143,614,177 *0DC57EFB0A8557DD4F89EB553D3158BC0B6F337E MAUROMELLIS
143,614,178 *0DCAACE8FCE975194BB224E79DA2F7C9625F085E MAXWELLPUGMIRE
143,614,179 *0DC56990693E1780DC5BC0AB95CA29516C17D524 haitremillo
143,614,180 *0DC29FDAFA08C9941C292197CCD54B70E27009F8 HAL.ALLOR
143,614,181 *0DC514117E49DD2420DA638D04D44E7012EBF9AC MCBDPICKS
143,614,182 *0DCB20BCBCAA4A0D8DFE096E2C37C68A39550AB3 mcd4330
143,614,183 *0DC26867641EE94D3480AD34A3AE9454BB72063D HAMIDEH HOSSEINI
143,614,184 *0DC9DA98DFA6979BD534661A4A7BAAAD1BBA9F64 [email protected]
143,614,185 *0DCA25FF4E9F3B02AA4480345CF48FDE2C4ADE57 handkbbs
143,614,186 *0DC1498577AF35E80DE5B5B492035499F0416A36 MDALARE
143,614,187 *0DCC13C3DE146B95619E0BA1565CF4A59F0E6866 hard-core-rules
143,614,188 *0DCF3C53FACB396963C0638A29AF9C229C563409 MEGANMIER
143,614,189 *0DC1163B5388DF1A02C5AF2B8E45E5F14D50E56A MEGJUREÇIT
143,614,190 *0DC1EB50FB4000635AD42052BB82C756E7B091D5 MEGS22
143,614,191 *0DC830380035E039694464AC7355F2A737EB3C31 MELANIOF
143,614,192 *0DC4983C38470C1C1D6A161BDCF20107FF65D7E8 HARMONICA-MAN:-THE-PAUL-LAMB-ANTHOLOGY-1986---2002-(DISC-1)
143,614,193 *0DCB4DDDADD247B0F3950FEF25763382190205EC harveyburwood
143,614,194 *0DCEDA5386A09F3834BAE511B21326F6B8842B47 metacarpocarpale
143,614,195 *0DCFE29CD9640E8EB57736582356E1484C1E8237 h(d`
143,614,196 *0DCEAF1B0BF0719B55926D6DAEE7862C1C270605 METERSCH5
143,614,197 *0DC27915F2A0FEA754BA10497BFA02ED978DC1BF he?
143,614,198 *0DC82CBCB4BE058D8F21318B910B5944C1BF6772 HEEJIXXES
143,614,199 *0DCB524E25BD400695C931398263D9E4BECB2C67 HELLBENT A:
143,614,200 *0DCFC9D0A729D7CD746FDA717F87E289398A37C9 MICHOANTOURY
143,614,201 *0DCAC2068324FE9B768EFA975ED29C339A7A89D6 MIDSWINGS
143,614,202 *0DCF826364B7715CD4AFB2A614349792DE109B74 MIGUELJUENGLING
143,614,203 *0DCA96FED296398695409C8C9A5459A1CAD9A4F8 MILANOTIENALEN
143,614,204 *0DC491A9E564B60A9BB3C03A01778E25E1E7ECCC HGARBAZIO
143,614,205 *0DCF9901CD83774134E1046938165DBA630E80A7 MILFORD.CITRO
143,614,206 *0DC9F983361EFCAD174A7D125C17D6E1B1066EB3 hicomb
143,614,207 *0DC6BAD1BED8E5FE959C6F74B15A69FBA4E1E5E2 MILO.FROST
143,614,208 *0DC9A6DB5EC8EB507330C401483AEC925F0D2FCF MILROY12
143,614,209 *0DC24DCD6D971E7F26220182A9B4524B7D02E335 mimegurilionstatue
143,614,210 *0DCA73B879AF5BE836F39F3B69C90B3E749A0C3B HIMMELFARGET
143,614,211 *0DC6468E65AFD567DBD3709F4D4D5198AC64AB65 HIPOLITOBARTMESS
143,614,212 *0DC0E08ED6394BEB467D792E1509251D0699A70C hiramauthur
143,614,213 *0DCB6D599C75643684FD3510F9948C672C3C3E71 mitchelmenghini
143,614,214 *0DC0DAFA730C7147F946D39C5C89B619A6D27620 MIYZ
143,614,215 *0DCCDC8870B553A737ACB68DBBC69B25211318AA holmgren1
143,614,216 *0DCE861F7C9ACAAA3B96263B148B7BD4A89B19AD [email protected]
143,614,217 *0DC9B3218F5674158BB14348E3D4414948922D2F MOHAMED.DEFFENBAUGH
143,614,218 *0DCB6C6E72072B557DA99D92F9594ACA08D956A8 HORNも対バンとして参加した。
143,614,219 *0DC47B1DF20BD2C99C96983DBC72168ACE8C4EE1 MOLIERES.SUR-C
143,614,220 *0DC80A354AAD8AEF5786338DB55DE3D0D0A7FEB5 howardcastagnola
143,614,221 *0DCE524DD4FF5214A222C0477F2B024301CFC373 MONTEÑOS
143,614,222 *0DC848262CEF021DF321152F1AA3F1CE738AF839 HTTPWWWTOTALTRAVEL
143,614,223 *0DC4C83B7163D4BA34A645C29F5A5FE08EFAE360 [email protected]
143,614,224 *0DC45AC5B14C6C14BA729BCD44C95D17536292DD mordovat
143,614,225 *0DC469A6CCD275DB454501A4EE19D5898D658C64 hudricking
143,614,226 *0DC1EAFEDFE339BE078ABAC20C2074B34EF13709 [email protected]
143,614,227 *0DCD4C9CFC07FA2EF2C2A304985906D2B2118BC5 hunting for the perfect
143,614,228 *0DC7256DEE94D5D40E0BBE41A80471AFB9F661DC hymanfought
143,614,229 *0DC0F81F8FB5A84FB1CF56112D70C45FE38AF363 MS_COWBOY79
143,614,230 *0DCEC0B0D5326551D6412E1DF3010609D83A55FA hythen
143,614,231 *0DCA55C2272699DBF36411E121A7DA34D85D24D1 I71352
143,614,232 *0DC6C87BCE5EC9EFA538AA40C295FC734DFA0CFA mutterhütte
143,614,233 *0DC7DF175886028BB83680E4A2552B68870CD670 mwud
143,614,234 *0DC805FC84732FE050829421AEFF61E4BF189CFB iantonsa
143,614,235 *0DC8197989DED2B4084D6996B3B34745416A0AD1 MYDOUDOU
143,614,236 *0DC2673EC68133AD66B8682189E157E655E148F6 ICEPICKSLIM
143,614,237 *0DC183CABF0BCF31338F2F0CC06CA3FF5891B1F5 MY.HEART.IS.ICE
143,614,238 *0DC9BF3A9771EE213E77BFCBCC5EE44E05A06C3C IDALUNDIN
143,614,239 *0DC911DA3333D938A809D9A73192C053A83897F5 IDUSN1023111620100510
143,614,240 *0DCCB47284EBA70F2C80E4683C322D2095E2D3FC if.r$.=."w".then.n17.=.87
143,614,241 *0DC4AABD0AB91A52FE83985143E45EDF5E081A44 If-You-Hear-This
143,614,242 *0DCEE65D7D22684419FD3B025308C760DFED3DAD myself-Do-you-get-me-?
143,614,243 *0DC14AAF83C1B37686D06386F808190B50F78E23 ikaletting
143,614,244 *0DC30341F1F6DB92EDF33B612AC9F15B406BEF9F IKSORBMOD
143,614,245 *0DCE95169CC1C5AF9AC71507676D328712E2F4F2 NADA.TIENE.SENTIDO
143,614,246 *0DCA27977E569AB43F27AEDF54B19D8AF18D6100 ILLYOI!
143,614,247 *0DCDA55086883CAEEFEC94A5003AF864114AB999 NAPOLEONWARDE
143,614,248 *0DCED36209AB64F2AB4A344A15A2A29EE1E41BC6 ilovebogart2002
143,614,249 *0DC17AF77A68DC45455EBF08C566D8DA4A39928B ilovejourney26
143,614,250 *0DCBD039D82862CB93C5D813E460221525FBF8A5 [email protected]#
143,614,251 *0DCBB44F065CB17E57DE45A31740C01F92319CED nathanieloverbey
143,614,252 *0DC4657D209BDC74B7A956DEEC98852BE2CA0357 ILUVCIRRUS38
143,614,253 *0DC253234FAF437FD0A50294C269566DC83AF2C7 ILUVGETOUT23
143,614,254 *0DC27979F5019D29919F967A0E974159E44B0209 iluvguitar96
143,614,255 *0DC5742D4AEBD960EF92E6E6DF5249937EB270B1 iluvmichou1995
143,614,256 *0DCBC1CE9D1D62CFB6AC8EEC70D9313EB172E6DA ILUVPOLARIS96
143,614,257 *0DCA0634E973EA9C3D9FE7BBE8B99BA3CB8DD851 iluvsydney77
143,614,258 *0DCDEA3151D71F00509EDB539EA5910019E5CCD1 NCIE-AAPQT
143,614,259 *0DC172DCDA4ACD11D6B1C4D74094584C213D6117 NEICY.NEE
143,614,260 *0DCBE13B590D98F0CB181870A355D5C32D9647CE INCUDESSES
143,614,261 *0DC720536E1C67FD25302989C0FBDAACEA378267 INFORMARA4
143,614,262 *0DCF91DE219D5409AAA469858B35650D698B02C4 INTERPROFESSIONAL2
143,614,263 *0DCAFFA3A11EA1ADC541CD468AF2F7FF0A86EF12 INVENTION.WHO
143,614,264 *0DC597908DBD4DC8FA0B468BD918D863AB8A5E80 [email protected]
143,614,265 *0DC1670AAF3DB69C6FA1599C68F115F6B323CF85 IRAASAKK6
143,614,266 *0DCBCED9FC8E108A884D2430C85E18F97BDEECFC irobihcu
143,614,267 *0DCF7941CC5C90639398936E6CF2E84A7857D1A8 NICKOLASSANDMANN
143,614,268 *0DC205CC26032DC507AA41BA43B6822D38F87BD2 NICKSMOLA
143,614,269 *0DCE5647CA7CEFCB5D115A0C3A7C10213C6A088B nickszewc
143,614,270 *0DCA3053E318574961CFD27FF5CC8C76E9F8E61E NIEDBA
143,614,271 *0DCBFC155A9B2F9F5C1219CC4E622DA6FAD87F95 NIMSZI
143,614,272 *0DC2ADD6E92E176ECF3A8492E5E1DA01B82E2EDC NITHYA MAHADEVAN
143,614,273 *0DCDE8B57CF28156FE9AD555A630EBE5417816F6 NJUEM
143,614,274 *0DC7CC23CEFFA65EAA4B0E4AB4EFD7743659F43C NO 1 III MENUET PRESTO
143,614,275 *0DC7462AB0018B7B873F358D07190F8B06309323 ISSAC.SPAUN
143,614,276 *0DC5DE2C89A901EC803BEFBDFEF84529DC18E356 IŠSKYRŪS
143,614,277 *0DC655A75AA90DBDA5AB553A728BD30FD0C757AD NOLAN.SIPKEMA
143,614,278 *0DCA57CEBF7EE3418CDC549557859715BDE170BD IVAN.GREENUP
143,614,279 *0DC32E5ABEDB742597226B47706F2707AFF5151E NOOO!!!RECORDS
143,614,280 *0DC0ECB164C80D6E13D597B57FE28D5667D6ABB7 norbertwoodrow
143,614,281 *0DC03C504997E7B5B57C12CFD49C2B1929617D7E NORRIS.KILKER
143,614,282 *0DC2C1CF8C47C6B488C21DD4F1E9E6069410AF9C IZMAILOVA'S
143,614,283 *0DC5C1DD762C2A9FE583605D1F8FDA1CE740971B J7^.
143,614,284 *0DCA24D7FCFD61CAB4916378C50E3899E40D8C4B JACK.INGVOLOSTAD
143,614,285 *0DC542FA38BA1F9738F2A98A0B21B94052FBDABD JACQUIE-SILVA
143,614,286 *0DC7616C4716581A0B0D06ED7373495BF27E9173 JAE.BOREL
143,614,287 *0DC816322A9B8215809FB1D60D4D6AE95E6F49BF NQAMARINAA
143,614,288 *0DCD78F51D486A795833B71F04C97D081F9FD317 NQWZ6EA
143,614,289 *0DC7A21FC338CF830166F961CF05C335F6E95926 JAKEPALISCHAK
143,614,290 *0DC0FD9EFBC73DB01122B5F980A7964CE32DAE9A NTVIMAM5
143,614,291 *0DC944DA13E50DE1397C9ABC064A80B1FC4EEA0E NUMCMDS6
143,614,292 *0DCC7CCAADF0879819DADB45E929CCF126BCB4BA JAMEY.FOWLER
143,614,293 *0DC534B255CF236DA84FCF20C6EEA91D9147C3DB [email protected]
143,614,294 *0DCF7B1A26970B3ED84F49F9AE1122A7CFA0B2DB JAMIELIENEMANN
143,614,295 *0DC94A4D6807D8166F01EE06AEE99A87C3406B47 jani.rashid
143,614,296 *0DC39CC9DFA489042A7813D48517BAED49D917BC JANSLUT6
143,614,297 *0DC8040DD9A80D37030556140053D11D039A3CDA JARVISDUCHSCHERER
143,614,298 *0DC599B6F9DA0454A2779A45B51867C5F94C8AF3 OFFCOURCE
143,614,299 *0DC979720F584AF1381DAAB964587E0AB539C329 OGUITAR8
143,614,300 *0DC9C351B98A2D568FDD9B568CB48407133E7516 ohbaby,kissme
143,614,301 *0DCD8955D338DA31297AAFFCB93460DFACC0CF7B javierverrill
143,614,302 *0DCBADB9AEB6773D3D0E8FF09DA4005EDF4BD16B OIBRUCH
143,614,303 *0DCED413295A3E80F438A333C276522CC9CAAE0C JE1I
143,614,304 *0DC79E33BDDE40995218F9E8A9E62FD7AF833480 jeanlipper
143,614,305 *0DC35E8376608D2A0CC4EE3CBA72EC179C95AEEF ontweldigde
143,614,306 *0DC831156ECFC6C9045153A75C46C63B29560F3D jeff.stuckless
143,614,307 *0DC2955406AD8B155690EB0730B07D6B73A9EA80 JENNIFER F
143,614,308 *0DCEF6A0D843F99A242BD9BE631CE7C8096E8790 JERALDRUSSOMANO
143,614,309 *0DCC4B2ED1CA8B44C45F72C9FC9C106A5ABD940F jeramyallegre
143,614,310 *0DC8A9FC9F5C91BB647F36D6788E620709D97C99 OORLOOGT3
143,614,311 *0DC2C03BC67706DC11809C71508F203C3F36D72F OP..1.NO..1:.FINALE-PRESTO
143,614,312 *0DC7D0ED544867A7ABC8FF0C580FCC6B4AFF6375 jesse-hobdy
143,614,313 *0DCE308E241805607B434EA5C40627D0F4789291 «orenda
143,614,314 *0DC86CE56B2C97D17F91FA6FC10304EAA9ADB6A1 orireslring
143,614,315 *0DC725E6B009822CB15E168F833DBAFF793EB8E4 ORLANDOKONO
143,614,316 *0DC5EE82EE2802CCEED766F924642295230D8B95 OROZ321
143,614,317 *0DCEC445B35DD1CBA682A8207BB1B83CB5E440E8 OSRUŞMAK
143,614,318 *0DC15D56A2FBC0CE892682229D67847528A3E3D6 [email protected]
143,614,319 *0DC8CF4D1198B1A2E26B257EC7D411EA818E51EA OTDELIAF
143,614,320 *0DCB7966E31AF186C76FC9F8A4AA278DAC9E5A41 [email protected]
143,614,321 *0DC02305ECB2200037A8E28F971754158F07BC86 OTIS.DEUSCHLE
143,614,322 *0DC07FD19B13EB01ED8327063EB0CC95D76122C6 otra.vez.(una.vez.m
143,614,323 *0DC18A6CE0D08AF667620775F4E607D72001D1B9 OTTOLEIFER
143,614,324 *0DC52FA1344B455B942159CF35651FA5A3794BDB ottootterbein
143,614,325 *0DC3E5AFDFAAE1640A07B2E5D239BEE8EC373269 OV3RN73LL3C7UALLY
143,614,326 *0DC7CB00369D32EEE0873E772EC71565FC9E43C9 JIMMYTRAUSCHT
143,614,327 *0DC464A523532855E4876ADD6F798E1C07FDA56A JITTER-BOP-BABY
143,614,328 *0DCDE9429D23810A145911CCDDE8E123C5B7B9E7 O:YN
143,614,329 *0DC9FBCCE96A5DE669D67F27DE16D7D70C562A4E [email protected]
143,614,330 *0DC412AED792B29A5B6FD06E73A2B780DB5D8145 JLYNN1980
143,614,331 *0DC29A15E38E9E6ABD4C250163CAEAE24EA6783E P4U*
143,614,332 *0DC8F65FB28DC09B605361D8D9BFA53556D48D1B P######)-*-*-*}8{
143,614,333 *0DCF591F55C0B3FC59367F50D3E2A47FD5C722D5 PACKGESGZ
143,614,334 *0DC62B2F57D7E8C6ECF371CBC3FE6FAF0DF4598A JOE-COSSARI
143,614,335 *0DC78D2691BC28BDBF899ADB8B3C65EFC89CFD61 PAIGETAY
143,614,336 *0DC79886D498672BF6D2E77D05BF78A45B2EA0D0 joe-sprague
143,614,337 *0DCF72A7396DFB93DDD198CCC2AA8FD51E314C30 JOHNIESTASSI
143,614,338 *0DC19221DA20C55A63AF38D16CE2122D0F978F6D johnnyknepper
143,614,339 *0DCAC9AB2328FBFEEEEC986DB194B0BA11DC7775 JOHN.TELL
143,614,340 *0DCDD98D66F937EC9D893CA240018237237A3F7E [email protected]
143,614,341 *0DCD66C6A7982269DD76F95100D4492DCB3008AB jordonmoeckel
143,614,342 *0DC752C44B5DD4F11C50BCEBEE585DFA5FDA452C jorgerodino
143,614,343 *0DCD1004413A0A7A0FCAF99B4A35FB2091A9885B PATHRICIANL
143,614,344 *0DCC7651386902AD3DF7ECCCB9DE65AA36D203CB joselizama
143,614,345 *0DCDA91BA189B9D3B378866A470969BF1148F578 PAUL.POSTEL
143,614,346 *0DCBF560EBD1618378555EF880AA9511C231ECE6 P-B-~-~)X(
143,614,347 *0DC81D23E6FA29640E50E07DE6283A6C8D7FCC49 p----d~~~(0-0)
143,614,348 *0DC4C9F4F53BCAE0D065253BADF83D3F65D99464 judeapplebee
143,614,349 *0DC25BB94DEB874815F76CFBDB0A64DC8DCD27BB JULESERNST
143,614,350 *0DC439865A91AF9B781235C462C18B9CB9E9A654 JULIAHEYMAN
143,614,351 *0DC0179B9E017F179EE693E6A85B3B4C9DA0BF6C PETERLEVERSON
143,614,352 *0DCE4C60D83A4E54F3684D54CDD4E9C28520CB6F KAKSMOKE2006
143,614,353 *0DCD242421F01A6D8FF7D17C79D63D42924D3E24 PHILLIP.DEBACKER
143,614,354 *0DC0E2BE288C2F210CA609CA062EE6FDB24D69A6 KAMBAJSKÝ
143,614,355 *0DC63C38096394ED015A82E3747AB4E1D65D7BCC KAMERSCHERMS
143,614,356 *0DCEB94909BAF1FF2CCA46D830A3C90A6DAD9C07 [email protected]
143,614,357 *0DC094C2A87512AC8C8C48FA8A8299DFF124826C PINKSUNSET
143,614,358 *0DC8E98BE297760C93BA5E825E1FC944496951E4 PIXONADORA
143,614,359 *0DCEED13A85634D3EC0FC5D4912091608CB25FA3 Plastic.Rose
143,614,360 *0DC682746BD657752A9BD9D391E76F979D1B6F23 ?PLEH NOITAZILATIPAC DNA NOITAUTCNUP ,GNILLEPS DDO SEOD 32
143,614,361 *0DC08F8412D391097D7FC60130D4394B1357E133 [email protected]
143,614,362 *0DC7C9131E374E793480B87AC02666928A6BB7AB KARTTIKEYA?
143,614,363 *0DCDCE3571B440AF3A31F8E45A7E4905AD98DA3E polymetre-dance
143,614,364 *0DC39F039A8779C083FAFBF1501D3BEBE4D2F2C1 KATSYUBA6
143,614,365 *0DCBDD16F81F9C7B653D1F507F975727D00BC768 PORTERBUTTERMORE
143,614,366 *0DC7F5CE8D716DD3AAB53443534D58A5D20E8B73 portertalerico
143,614,367 *0DCF36DE3ECB184952FC9911F6D7042047DDBD1B KENTON.EMBRY
143,614,368 *0DC17F7260E726B2E1A387A7196E2474753F33D8 KESHIARIVERS
143,614,369 *0DC5D51B408ED9BC546E8609E0E813FBDFCD9FA0 P===P~O(>-<)
143,614,370 *0DCA28276520C76348D7807600EBD60A650234AA p#####p~~UU
143,614,371 *0DC92CA80313F4A138AD7A9089FA8E7E19F121AB [email protected]
143,614,372 *0DC64C9FDE6011E0092ADD8A57762294160361D5 kidselvis
143,614,373 *0DC7DE15A88978024E08EC55E89E4E89FED87E72 KIERA HENRY
143,614,374 *0DC8C2901E0FB457D7E65503C43441476593030A [email protected]
143,614,375 *0DC73A965E9172889B63C6CF9A9947FAE94FD2A8 PREHALTE6
143,614,376 *0DCDAB4D09BD053BD0CB4416F93B9E4ED9138531 proshantungaspis
143,614,377 *0DCF780656B353587BA0CF193817851FE626F991 koivu's
143,614,378 *0DC93D14701BE84243B305EF6ECD596D7CC6A364 [email protected]*.SPLAT!!
143,614,379 *0DCE583EA3814E4E9CC2691631F302DB02C03698 [email protected]
143,614,380 *0DC35BFC566D75C3E985D739101E5BC4EA88DCFD PTHASOS
143,614,381 *0DC9D63BE0C5D043493983E185DAC7EF1D7846D8 puentesdeespa
143,614,382 *0DC30840106A27158E1BD4B74BE7F870C6A1B2B8 pumpkinblizzard
143,614,383 *0DC3CB3AE31CABEA572A340D7ECFE882E58EC30E KOSINSKÉHO
143,614,384 *0DC4D89C75CAA03AF6474035A862FACDD56329A7 KOSTADINOVOV
143,614,385 *0DCD78278F25F8B7EC936D7CC1078DB81A9A9AC2 q####)~0~o(x)
143,614,386 *0DCDBCE1CAAEA88AA4DC9E717C7EC8BB6BCAED4E KREEFT207
143,614,387 *0DC3732BE5A51DFF874F097ED213F4BF15AFC5F9 QLS~
143,614,388 *0DC7CAF5208D764095039FD05D7DB450E610E0F1 Q\NG
143,614,389 *0DC752F03790C40FA1C4D7C841E25F768A2AAC77 KSODJI
143,614,390 *0DCE83FA78997C4B8FF75707B2A73D0629F83DBC KULICK12
143,614,391 *0DC07A12AB1AFE33D3BCA5D313202189F56969D2 kunstdenkmüler
143,614,392 *0DC8894689AF84F132770D82853F539D5DE3DD94 KUUSNURKNE
143,614,393 *0DC389C0D85C30D7798BAC6F640852CBD5E36461 kystværnet
143,614,394 *0DC0BB0564BD0AADCC6ADCD568CDD1AA411C1B86 QP~0 ~O 3B<
143,614,395 *0DC63D131D83D63BE5AD5F1A90A29B3EF16313C4 Q#@.~.~.~.SPLAT
143,614,396 *0DCCC26846658C925C9D69A72D2D1BD13DA3B6A9 qtitbswing
143,614,397 *0DC1F2E4545C266E02CDA05ADAA936BBABF11D1D QUAKILY
143,614,398 *0DCB7765A2543608CCB122BA4E82B6E56D711E73 LABALIZADA
143,614,399 *0DCD0FFF0ED7BFF061DAA1F4ECFEFB132E5985F9 lady.catherine.debourgh
143,614,400 *0DC3C45F04B8D5620BEC430A712C2ABA061555A9 LAKSHIAR
143,614,401 *0DC30DDE474CDF28EDA633941D44502D692E76C4 LAMAR.NEUMEIER
143,614,402 *0DC2EE7CD09443E6DB7DEDF8D0C4BA62E07204CD LAMPREYS
143,614,403 *0DC4CDDDA5A0648E05373E681DC09BC0C832D27C LANDON0817
143,614,404 *0DC37825B2FC24A7F10E2BEEB06E3FAFF83D4FF1 r3proba7ng
143,614,405 *0DCCFE8C456C0528CCAA5EB38BA983E48CC37C15 LANNYMERIWEATHER
143,614,406 *0DC656DA6F561906ED60D2BDC1320903214BE964 LANNYSEE
143,614,407 *0DC0D92AACDEE824309597AC20FF3BA61CE22D53 rademananjara
143,614,408 *0DCFA004A66045501D54B7BA7D8140AB23EE37E2 LAVERN.ORRICO
143,614,409 *0DCF4535D57B21776F7788393F97C9247FED13F2 lawrenceedel
143,614,410 *0DCDB9C67EB4E8FD5C1EF06EEC90351C33DA67C1 ralcer
143,614,411 *0DC2876F0074630FB57D90DE5EAE7A65914E73A1 randallkauffman
143,614,412 *0DC47E1D1C1B213010ADA3A822EE1A33B6C82F08 RANDALL.LUCCHETTI
143,614,413 *0DC9335AF2E38C04FC21A519516F2CDC3F31B45F LEERHARDSTADIUM
143,614,414 *0DCCC0DD1BB8824657C9FC907DF78DDB6E26D4FC leonohlsson
143,614,415 *0DC8182058471E16A2B7C2B69A5227D70A2AFB32 LEOPHAT3
143,614,416 *0DCC152B9380BA1DA2BA3BF823CC8AD2D14C6470 LEOTAMISEST
143,614,417 *0DCF9FC716EFCFCAE3B1836929933D8DD8750C16 leslierozmus
143,614,418 *0DC1FDB767877D20B9AF92E34BA1FB89741869DC [email protected]
143,614,419 *0DC9CA64D903C319EECB288A122469174FB3B797 RASAN+
143,614,420 *0DCB422EC6042C34BDB68F69FCED02E633287E8C RASHAD.ALMAJHOUB
143,614,421 *0DCB53E91CDE6AFD2EE9DBAD93CE0A02AC05957B rashid.manhas
143,614,422 *0DC7926C06921283A625A6BACF689EFEBAD46B0E rassuran0
143,614,423 *0DC6CE25028D475946F9346400CA0CE4E107CBBE [email protected]
143,614,424 *0DC991EE7427EFD48E615CE3EAA07C3D876A6DD4 lindsaybennett
143,614,425 *0DCE5EBB5C95FF135A2BD3AC6A843013D067420C REDDENNA
143,614,426 *0DCD11964BD3124CBEA5546E6441AECFA77CC09B LIPOVNICKÝ
143,614,427 *0DC80A66B4E1A59CE71F602FE5F07364668555CF REDLANDSDAILYFACTS.COMWWW
143,614,428 *0DC6EFC21374071870DC772530459A3395269672 REDSCHANCKS1
143,614,429 *0DC3540AA8743CFCA2AF46ED1BA77CF10E3B67F6 REDULLINGS
143,614,430 *0DC52F6403719F330E64725FDAFE7409C9D7C93B REESE2019
143,614,431 *0DC11B828690B3A214212E2C8C16162EF76A1C05 REFOLKEMINDED0
143,614,432 *0DCE93DB269AB236FA5E1E44FC6D197CB2D159BF LOGANQUALHEIM
143,614,433 *0DC75F9AED1F0D4FB7229E2981649A72508CD68A rekojsisi
143,614,434 *0DCCA48CF1D1B149B18C6C962D6468A89BDE1AFD RELKRAPS1
143,614,435 *0DC8005DF4A640233CDC2413BE0390A019ECA84C renegadescomauwww
143,614,436 *0DC3DAB782D92E7D5E5A230E35CF3F9CD82C5EFB LORY WRIGHT
143,614,437 *0DC2AB881F6C808705BB3D43E3DE8BE27396C300 REPRISE-(FROM-'SPIRITED-AWAY')
143,614,438 *0DC49B70F0394C2147F54AC542655DD02FB6437C REUBENSTAUFFER
143,614,439 *0DC0BAF81D67CB5E272C3079136C7371398377F3 LUCIANO.WOLFF
143,614,440 *0DC110F3EA8844E95BA2CEC676ED03787587C41A LUCIEN.DOWNEN
143,614,441 *0DCA71CF3874836A56E84DC17BA9F73816685EF5 lucienokano
143,614,442 *0DC642603FD2ABE3962C6012830B59091C459720 LUF:
143,614,443 *0DCAEEFE5961537F4262E1E60BCE6D705FC3978D RH-TYPE
143,614,444 *0DC11E0FDD7EA42CFDCFE193DA22C5F3AB02EE2A RIBNITZA
143,614,445 *0DCA0C6E7B2CDAEBAC3DA7242053AA42A412EB9A lutemaker?
143,614,446 *0DC6F6F4D8D32B96D35CB8A5523ECCF232CDCE55 LUXTRANSFER
143,614,447 *0DC419438BC4AD6F7FDA17F5D4F37CA83E388F15 LWKNIGHT
143,614,448 *0DC9A09548E6E20047E89B7244561DF5174FC053 LXYBOGS0
143,614,449 *0DC7910A2755582E9ACB8232821CFE6BDC21C9A9 [email protected]
143,614,450 *0DC4FC5027A43D0AD9DA84C1C2B63338DC9FCDB0 RIDERS IN THE SKY (JONES)
143,614,451 *0DC411DBFED9F429B5CC3BDEA19D0B3C0B01FAB1 rikir
143,614,452 *0DC13A9138ABE8BFD7D94AAD146EA414B359C461 [email protected]
143,614,453 *0DCDE41537984A5044D9508FF2934C4C5DCA7ADF RJ BASE
143,614,454 *0DCDDFD62148F871119921ED81B51F00B2BF19C9 MAC.WIDEN
143,614,455 *0DC34AC19F1A24325CDA649B8F5AF80FB0AD0E75 madanlarin
143,614,456 *0DCD2EBC6714B7A3A3AD7A896438DF58EB177B66 magadanski
143,614,457 *0DC153AF4C561A57942053B883BF31BB954C0C49 MAGNETISIERUNGSAUFLÖSUNG
143,614,458 *0DC5493D27FE3D89EB34385D9C1EDEDB17EE73F8 ROBBIELYDICK
143,614,459 *0DCB4D9E7A42F72346855FC14C235753B12EA165 ROBYNMAYNARD
143,614,460 *0DCCC654D2F1065BC5165521F64A226A5A143BEF roccohollmann
143,614,461 *0DC44DB3DA0409FF11732AC6C470FCF1EC8F7367 MANAN DHINGRA
143,614,462 *0DCD07DC46653953C9667794EE8738EF2138BE24 manasejevim
143,614,463 *0DC17CFACBA06C706CDF95C4305E99E6ECF63F51 mantero9
143,614,464 *0DC84C53BD49AABE50DF1C39E933A098D9F6F0BE RODMASKE
143,614,465 *0DCAF92EB9C8069A3517A50FA5271FEB76B8DB2D ROGNAIS
143,614,466 *0DC0A9344F07FECF2E67CABD2E118B4EDE470717 RONALD-RIGSBY
143,614,467 *0DCC3934AC4FBBB47D4994A429723995CA870202 MARGARITO.REON
143,614,468 *0DC6651A674791A8C4779109F8E77D8F3AF81D4A marginaliserait6
143,614,469 *0DCB7A9AE3D9EC318ADAC0309619D993EF67E01C RORY.CRISTELLI
143,614,470 *0DC5E212E86FAFC17AB1B11F91440AC1A996F063 ROSIECLOCLO7
143,614,471 *0DC5CE24A980C0F002FFB0293FA2ECBE7482EA06 MARK SEVILLE
143,614,472 *0DCE939B0F20260E5AC287683ECFB772BC6BB0DA rotissere
143,614,473 *0DC799EC2CA239161BA3C57C66E996F0E7C53BE1 MARK.WOOLCOTT
143,614,474 *0DC807297CE6C6D7DDFB78F21A7F322EA4E75AC1 ROWELL.ABALOS
143,614,475 *0DC77EBCEA4348F368D114F9BA30D3B9BD3B8675 ROXYRUSSEL0
143,614,476 *0DC6657B8EFBC530EED4CBD7E7DFE2FE380F8888 RUBNITZ1
143,614,477 *0DCEB930C80645A676DB507035722730C6A79CD9 marty.stanton
143,614,478 *0DC625D6384E88E0F06F010C173A31A84FA33E2E MARY-GOODHUE
143,614,479 *0DCC8A0BE0DE2212D55C9ED1598428D6611E49C8 mary.grace.barazan
143,614,480 *0DC0DB964046D1A0A914964F153DE305D0AE0802 RUSTYCHEESING
143,614,481 *0DC5755E7559C507840050A438EFCAA6329969F0 RUSTYPIERRE7
143,614,482 *0DC93EED2C138FA84B7DB63E9B7EBDD167B57BDB mathewhansen
143,614,483 *0DC0793EA60A831804918EBC6CC61DD5E13DD941 mauricemichael
143,614,484 *0DC04B760AF8A0CC52C31971BB4275F77BC4F619 S96)
143,614,485 *0DC8FE77E5974D3C6C45121487C9FA109FEAAB0E SAKINA MEMON
143,614,486 *0DCC08C34AC2AAAE4E03F1ADB1B18D64DCE40744 SALLETE6
143,614,487 *0DCB4AFF04BDFB5F183EFA07C26090A195D9B0AA SALMA-AHMED-MAHMOUD
143,614,488 *0DCA7AE062370A4AAA8517937AD6DB99056CBC3C sammiecabading
143,614,489 *0DC6D32AD282ADA7669BCE062C20B43BEE74230D MAXCHAMBERS
143,614,490 *0DCB109CBD206FF2316344CBA139F224E0E06D5B maximaliser4
143,614,491 *0DCE220B960C0834BC1FB92D7841EC334453A4DE SANBHOJI
143,614,492 *0DC3744AFC54328FE51EA7B7B8231D33743AD2E9 MBNEUHAUSA
143,614,493 *0DCD3C9B84859A1514CD030E9B37BB08C11B8267 MEANT...ILL
143,614,494 *0DCD1FF275755172318000CABC5096E73D50A009 MELHAINDS
143,614,495 *0DC1946E9DB533491306090C1E609575576A6002 metallproduktion(liveinkamenz,03.12.04)
143,614,496 *0DC3EF37E553C6B5FF39442B3BD428DD7B889D44 MHOW90
143,614,497 *0DC72430C75481EFACD452D3516D924DE6FE46A1 Sassolin
143,614,498 *0DC4B85B0F13128307FAEA7672AAFAB64D5C2512 MIAH302
143,614,499 *0DC23E68F5CDF7AAE2084E0D663C4A6E0DC537CB michael.balkcom
143,614,500 *0DC6C0DED08B889832931D11296C72A6EC4D05AA micheal-flow
143,614,501 *0DCD74B40B4AF65B0D99AFEA41EAEAA461776967 SCALING-THE-DERRY-WALL
143,614,502 *0DCA860A0122C119F287746624C8527F6AA3CE3B SCARLETLAKOTA0
143,614,503 *0DC3354D455287CB54812D4D6F0E332EC8F4BD0F MICROSOFT.AT.HOME~.FEED-MS
143,614,504 *0DCD0876B40309360B5B0C6F8669E54219682254 schätzwertes
143,614,505 *0DC3119ADCD48473DB8E1E65B7F1E8D746DA3A89 MidwestTrainWreck
143,614,506 *0DC9E0741696B5B8B8F3B59E54437EEC8F2A7988 SCHLEIERMACHERSTUDIEN
143,614,507 *0DCCED7DD9E9D0A422053BCF0AAB6E468D2BB411 MIKELINK&HARVEYTAYLOR
143,614,508 *0DC189D72BE584DC2FDB0E05C18DBF21FF155EBA SCHROETLIN9
143,614,509 *0DC633F678EBA204238DC83AB6AC0F24E398CEBB SCHWEIßAUGE
143,614,510 *0DCC3BE0D85ABCE45583BC9EDE32824CC769AB29 MILAN.BRODHEAD
143,614,511 *0DC42C4E54E6EDB9BD10D8A8CB5254A223708C94 SCIANAMI0
143,614,512 *0DC062233D89BF2EE5436644BA68B81F59F7B65B SCOTTYETOILED
143,614,513 *0DC224D2C15975D9C05A2497D2EC6C8479DABDAE SCRUFFYSNOWBAL7
143,614,514 *0DC9C78EC60F88717C8B4B6FCE78275746C10DDA SERB-DIGEST
143,614,515 *0DCFF5CF5DDD5F6300C400984F6A085B6C18ECA5 mj!\
143,614,516 *0DCF58FC4966E5F27ABBFA0FA6EA7C99B9FF3FC1 SEVERALCELLEDS
143,614,517 *0DC0124379D4BF120976270705AB288E380AF70F MKEQPOO67
143,614,518 *0DCA2AC7870A7846A2AF380EDC02773653527828 MK ULTRA'S THEME SONG
143,614,519 *0DC2D94078EBD5392BF87639DF7D8923DE965B76 MMB.WONG
143,614,520 *0DCA607838ED4042365E2C418CFECB4E7497EDBA [email protected]
143,614,521 *0DC276C54AC5C5D1C0C5E041FC1E01959425B1C2 [email protected]
143,614,522 *0DC0D3F05E0D60909644E6C423031C603C07B898 MOBORG
143,614,523 *0DC657518A444715EE7A742A2C5A5EFD1A3D1BDE mohamedhalbrook
143,614,524 *0DCEF186F24ED1E9D95C1D39076CC0B96B8A35E8 (shakes-his-head-"no")
143,614,525 *0DC528335A4504C88B57D053EB5632BBD105E739 mommydearest
143,614,526 *0DC9A26B8FC8B573D4978022B06401CCDAB2D869 SHANE-GUAY
143,614,527 *0DC2A8314CE543DC5228F45F74E94DBCDF0CC1B9 MONICA KELLY
143,614,528 *0DCB582A59BCA6E5F08F38513D304E1B63439B2A [email protected]
143,614,529 *0DCD933A4616C9B3CA728613E4F65F96629C5C3E monsterg
143,614,530 *0DC14A859BF7D600FC12555B3C591DB4E87A0658 SHARMAINE.CAREY
143,614,531 *0DCC7F78B22A4C2BAC87FFD10471A8BB79A549A8 sharon-sherwood
143,614,532 *0DC07633FA74644981D744B9EEF459C5F7856014 MOON-WHITENED
143,614,533 *0DC9304928570C4E90A5AED3C921729F8521088D SHEARES8
143,614,534 *0DCAE60E6FF74D728CB61F5AE9667DF6055513AF mosesclery
143,614,535 *0DC3A8EF0C6EE1F02F1FCE35AB5F09583C28086D MR0L
143,614,536 *0DC5B6C2AF8D04AF21DC1FAE2989FF3BC230774B [email protected]
143,614,537 *0DC0C24F3CD2D104ED5C4EF7E0B41AE2676B49FB [email protected]
143,614,538 *0DC015B39DCA7869908082516C6AEB874C37297F MRIVNESS
143,614,539 *0DCD3EADA6355ADDA12566AA887B5F9BE1EB7E76 MTA–VE
143,614,540 *0DC8B08943BF02D1F426B296E70EE6B9DFA2C033 [email protected]
143,614,541 *0DCC5E6EEF0EF6213C7A420096BF7E7650B842D9 [email protected]
143,614,542 *0DC2D2A8FFAEBC2A30EE385611BCA4F3FD373181 [email protected]
143,614,543 *0DCC0F01B7CDB20F3C1AB27C58FF1480904F8D67 MUSING>[MUSE]
143,614,544 *0DC15AD50A8D35DE2F34244B493DA69FB7274AE9 MYACCOUNT79
143,614,545 *0DCFA618A7E3CD96B69C02C0EB870E32FCC3A7F1 sigbiga
143,614,546 *0DC65487CC4D1361CAE7C95264B3F636CFBD1AC8 SIGNALSPERMANENT
143,614,547 *0DC6EE03AB225C0375329762B45AE901023058A5 MYPAT71
143,614,548 *0DCF3823C62F062AAEDDDEDD40628DEA11D6D6B8 MYRONTOTING
143,614,549 *0DC497FE2B8CC60127A5CE41E4434F195E6CCFF5 SIMMELOS
143,614,550 *0DC439A8EF6A249910F8F6391BC0F976C5323CDE [email protected]
143,614,551 *0DC87E165734D098CBA06452BA0F014C3CB7B8B4 SKEETERFRANCIS8
143,614,552 *0DC33F4AB795DBEDB6124399C18D0D5253023C32 SLAISEM
143,614,553 *0DC90228ECAE0FC5D02A556E350D954C39892503 SLOUZICIMU
143,614,554 *0DC8437978ADF0C1F50FDC98CE57C1F86A238716 NAWATAKA7
143,614,555 *0DCF3B574E0B0011306E14923172A4FC556E747C nayellicorral
143,614,556 *0DC9C2F5AF7EF8EDE4EA6730953A07B1BB8CE655 SMUGGLEDOUG
143,614,557 *0DCDD25EBEE30AAFB31882E6DF48D0F0E94651BE NELSON.DEPUTY
143,614,558 *0DC9375D4D8CEBDC1B978683E519E7A63A626A3F nemracdnaynnhojthginedanemorptxe03
143,614,559 *0DCF1D90F75072C91CB9ABAD5A56C3316542328A n'entarrane'ncelu
143,614,560 *0DC3CDEC88DF27E8867A3B149E8394EFC99DD087 nestordomingez
143,614,561 *0DC6957BD794AFE6B8C88188855011FFCC398466 nestorrifenbark
143,614,562 *0DCA463A6B0825ACE2C5E8CC5590A675D5CE8C41 SOLER-CENTRO-CORREO-PLAZA
143,614,563 *0DCED7AF69E0B75A0D38DD8D825B063AE732DA86 SOLICITORS2
143,614,564 *0DCA8F3D5B3359053FCB45BDBECC7CD44A00B671 SOMETIMES-MARYANNA
143,614,565 *0DC56295F4EBE764845A883A2848D9A914552FF5 neworleanspianowizard:live!
143,614,566 *0DCC65857299E3F6E5E876E1274E10044D554A72 [email protected]
143,614,567 *0DC28B31BCB1DCD9FEE7044A0937245F7FA60590 nickvanbuskirk
143,614,568 *0DC59A414AE1429DB083D90321F363AAA4295E90 nickyschiaffino
143,614,569 *0DCFD8C09E3828763914DD6F05F2B10E8EE04692 sotrozosing
143,614,570 *0DCD153B017B39E8E3CD7899E26059D2823CE323 NIKOLAIBURLI
143,614,571 *0DC7D0ADC3BFBCFFEC2F486B0CF474B788F6EBEF NILORAK5
143,614,572 *0DC1C476FB493CCBCF652CE681889F48346FA55D [email protected]
143,614,573 *0DC45DE35221C34DDE62F2AAA36884262E43CAF3 NMAJING
143,614,574 *0DC5108A65356A6FC0CA9A8D721872006CE8854F NOAAA
143,614,575 *0DCF491E1859140CA598863A154D62E68914EC78 NODUVALL
143,614,576 *0DC5292D9375F2CB27A201AF068FDD0941B325AC NOEFULLEN
143,614,577 *0DC86572E1CCCE39C12A341135CC91070529909B noirmusic
143,614,578 *0DC83F1214CE4EB852BE7D882D237E603D29A385 nonpurchaser
143,614,579 *0DC6EB84B1E1C62B90E26908F41E465A5623F91A NON-SCORDARE
143,614,580 *0DCF73C1DE097078E2C10E90F5F2BAA25E2FF61F NORALAY
143,614,581 *0DC0930D9A0266115F97E5FC805DDE8341B6ED9A NORRMANNIVALLOITUKSEN
143,614,582 *0DCED3C6192D209908B147617E55535E870B122B NOVICEB
143,614,583 *0DC398F051B4B6C88369831C4F6079E8AEA465FA nraooarns
143,614,584 *0DCC3CAA555ED2A84BAD1E3BEACBE7883A29C72A SPARKBACED
143,614,585 *0DCD0E8C0D37993ABE762E0E4E300971C4C39E31 OA2009
143,614,586 *0DCE8C672E93106A9C93D879F4BFFB34C5C7F2F4 ob1!7era7ed
143,614,587 *0DCFE0BC776758A174CBE0D1EECF281C2237B6BB OCEANACH7
143,614,588 *0DCA8CF05D217B2B75A47B4D3498206B016E515A ODIS.GOLDFEDER
143,614,589 *0DCD3F8DCC1D8038AA426E46D9A944E96CDA02D2 Splat!!~-~-~(=====p
143,614,590 *0DCE9DEA14F7F7260DCB2ADA46E5421DFFD94E9D SPLAVEM2
143,614,591 *0DC0F63775A83F45F9C2D8A2AE8CB6B40833C889 o'kelly-riddick
143,614,592 *0DCB14B145BDA18518D1A5BAB8F5A57CB4A73585 SPORTÉVKÖNYV
143,614,593 *0DC685FB4E23DF91B7E98371D097157E17F5891E SPORTIQ1122
143,614,594 *0DC50EBCFE1CC56396AF4EF754C20B7194E753FB sprauchling5
143,614,595 *0DC559FA9E82AF53D55481D8A9760ECD0D9852DB oldysan
143,614,596 *0DC2D80853214026CC155747117270B8C7B64ABD oliverjauer
143,614,597 *0DC9FF2B09FDF228FFA781CA719ADCADA02C350A [email protected]
143,614,598 *0DC25F9B782822805F263CB21EEEF46C09044F87 ONE MORE FOR THE DITCH
143,614,599 *0DC5814DBA7E745EDEA73BBF4707D95E8524DA79 ONTZONKS4
143,614,600 *0DCB6EACAA2AB2E50A8372F68A03E2DF1248F865 )O(~` ~` <P
143,614,601 *0DCC351D8A1F712BE41A18B84881C1B3D1760783 OPPSTIILINGA
143,614,602 *0DC964379A03DA0599630D2D7B7A087F4F434006 ORGANIZARE1
143,614,603 *0DC326C4982389A46A8D157B3C6A6756288BB6AE ORITSUR
143,614,604 *0DC475457A84DBBEC9DADA991480DE8E50C933BF orvaltrigillo
143,614,605 *0DC9AC7557DC4281D319C2E07A3E58E1F0AEB30D orvillebrook
143,614,606 *0DC54BA5ADDC2DC4D25EA9E32132B063F3005C24 OSSETTALBION
143,614,607 *0DCFEA679FC53C49D4B4AE78A6EA796959AF2D75 spunway
143,614,608 *0DC53B44F80E7ACA7368DC5405331406BA74F735 sreddulk
143,614,609 *0DC69EB27F6F4B5D04944A5DCFCE4BA65D9C49EC SREKAMKOMA1
143,614,610 *0DC5F2B8DBF42D2C063E78052D79AD6D8C251ABF SREPMUJ
143,614,611 *0DC4DAA49D6EA1FBD8F4A6C8678EC5C6B360CFFA St3am-box
143,614,612 *0DCBB3CD18A259E73902D9A1EF6EC7ADA500D967 StammtischLied
143,614,613 *0DC2AE0F202B571A4DC0E87CEB9A54F619F63698 stancarlozzi
143,614,614 *0DC26CB25EFC0CCB39C320D04A7F60CC13015F93 OWWP
143,614,615 *0DC7BCD28214F10F6F1FB7A45C2B0C76EFFD18C9 p---->~0 ~o :p
143,614,616 *0DC05E9D98BC3A33EB648DC22A2A12CD88B12F47 P=>.~0~O.(X)
143,614,617 *0DC34B21FB3C211D3DE612DA647C94F061026975 P0STG4LI
143,614,618 *0DCDA42049799E0BC7CC25AF3947B0DD60C7F258 palpions6
143,614,619 *0DCBAB0E38633FEB7273A1FA766CA264578F2F67 [email protected]
143,614,620 *0DC06EFDD39B50C8CB01CC2760093318A2B47E3B papa-ballon
143,614,621 *0DC0C18B5EDD78DF6A4267854855DE535EFCD667 PAPAG66
143,614,622 *0DC804A113FD4F7B8CA6B5C9EDE50B59362871E4 STEVEN-BALLOU
143,614,623 *0DC0BBA046B33139DDDE34714E880FCF46FFF022 STGNNCY
143,614,624 *0DC46C88A635FF38E0E62C2A3EAB66AFB7B0593E PATHOLOY
143,614,625 *0DCE0205F7286F481878DAFA4C35CA37EBC7139E paula-welling
143,614,626 *0DC529BC724FA48AD9D9CBFAD630C466745BA69F p###d.~o.{x}
143,614,627 *0DC02E1FCB7E7F9E2F0911355C8FB7CAF92AC3B5 PEARLJAMSTACEY
143,614,628 *0DC797E7D8FB1C72B4DD8150A6A0889A4F014DF1 strong(pianoversion)
143,614,629 *0DCCCFE4328EBA49B41193436F6B1FA8EA5623FC PENNY GROSSMAN
143,614,630 *0DC05D2C1A3936C2863EF8B581D79208F55988CD periksi-anna-en
143,614,631 *0DC1BF5A084F2DC5928094B5277FF31CF20B61F9 suemcdermott
143,614,632 *0DCBCE14E4ED290065635052C5A01545AC6FEAFF peter.wilder
143,614,633 *0DC35010B4B5F0A9278DB589EC4094AEA740CB47 sulphanilic5
143,614,634 *0DCC511D9496183C6C726E920432E2DD20606989 [email protected]
143,614,635 *0DC57F1E9136A2C2A1424A97C598AD6E3ED2954E PHALADHARMAN
143,614,636 *0DC33781CAAB3B2361BDC087B1FC460ED06F4C03 PHILFADDEN
143,614,637 *0DC680F5FE42F28FAC8EA11CE2265CFED93718F9 phistry6
143,614,638 *0DCD3AB1773FA2ACBAD8B0DD14F8FBF76592E7B7 [email protected]
143,614,639 *0DC919BDB5849D342763C8E808199781035659E4 SWPASOYNED
143,614,640 *0DC5794A54CAB3EEABAA2C9276A7E73BAC8D3FAE «szkoda
143,614,641 *0DC4DEC66143E048D83030114B15E3D242409B07 PLANTGOE6
143,614,642 *0DC7C5016773D238439E99C3FC60115F514BC912 [email protected]
143,614,643 *0DC73B1AD6E3D49B0C41FD93C2A1CDE813FD97BF T35T4V4M
143,614,644 *0DCF6B5E9F9D49F960821027FEB38B396B9E9D84 TABLADOS0
143,614,645 *0DC63AFBEBAB579B67ECEECAEA9144F49C0221B5 PLOUMOS
143,614,646 *0DCC14A7AD63712E6B213917376963EE03D20C1C talk8631251155
143,614,647 *0DCAE7498207F2F3452C1B0B1D53A0139D03ED9E TALKKENDATAMAN
143,614,648 *0DC24DCB9A3D4E670E2F330D9B07F41DA33A709F [email protected]
143,614,649 *0DC7A901A8B8A6C7F3C8263E711556AA875DE4EF TANILAYAN
143,614,650 *0DC947FB6E222A9DA64D9E904A3DD04598FADC23 TANNERCUSHWAY
143,614,651 *0DCAED2575AE70D79CEAF57A4F657EDED4C35234 tanpasho7
143,614,652 *0DC264B0301F48FD39D827820BAAF72B2960707F TARA.MEEK
143,614,653 *0DCADE601F8A8E660D423CC72A78028C6143F991 TATIANA MAZUR
143,614,654 *0DCA83F8E7D971A499111C214542CC1F7867A31C PRATICHCHHANNAAN.H
143,614,655 *0DC922AD04E4208C3B3E32E059BB3E7ADC144019 [email protected]
143,614,656 *0DCBAD700326475C61E987FC924D18B3E8061937 TEHTAILT3
143,614,657 *0DCC74C1A619E19E32E3357267D051063FE3D4D7 prestonstryker
143,614,658 *0DCB732FAD1E2C16A531C8AAB05F88A9ADD7AB29 PRE-YOUR
143,614,659 *0DCACA5A0B8A4114CA0AC61E7138F4ABF3D43D51 PRITPAUL
143,614,660 *0DC80BCE6A58380401EB6F0DE51B762EB3A01EE2 tennists
143,614,661 *0DC2476DAEAE84FACC6E56CC2FE93DA9A2FCED94 produbljujim
143,614,662 *0DCAFE5DD1EBB9FA33DB8CE12A086ED36E436680 prominentenwesens
143,614,663 *0DC168DE768BBE9A31A7DE52AEF079EF9BAE3CD2 Terpsichorean-Suite-in-D-major-for-brass-(arr-Peter-Reeve)
143,614,664 *0DCF3803662C98564D4DB814BA92F209376A3442 pseud01n7ellec7u4ls
143,614,665 *0DC8C8B6EF47AB15E846372EA5D010033DFFB5A9 TERRENCEPRADHAN
143,614,666 *0DC078AAC7C861C16BC6509B4E55BBF849150C30 TESSALESTER
143,614,667 *0DC7950BEAF19BA11E93150512E2D637A3387024 PUCHERITES
143,614,668 *0DC89DB73FB27A5A383E8B106AF725B66D31BE84 THATLITTLEBITCH
143,614,669 *0DCE17774663FEADEF035AEE9A67BD4BEE0D5AAA THATRENEE90
143,614,670 *0DC02AFFC8F9E99E61C111CC9729B96A3C940262 q#D~O~o3B<-
143,614,671 *0DC0E537347249543EF3CB943EB393B7A8833A70 QEC%
143,614,672 *0DC08E1AF410870398A458F0A892E45EEB92D0A6 QF:,
143,614,673 *0DCFB371759B2BCF7210BDA55552DE35632BB16C the.complete.collection.(disc.2:.albums)
143,614,674 *0DC1DA3C08EC8719845E9A776AE53D4CB3908D58 [email protected]
143,614,675 *0DCE40A3450CF9B33B2ED01D7292E7040403C80D [email protected]
143,614,676 *0DC22134D53D142259675A62A0B8E876B0E6680C THEENIGMATICARMY
143,614,677 *0DC7F92D2D08DA0D6D15266F53B2BF5F0DB8FFA7 THE-EPISODIC-NATURE-OF-LIFE,-PART-2
143,614,678 *0DCD1CF2FDC70BE7823F631FE255F732838626B8 theexcursionsofmr.brou
143,614,679 *0DC9A8A525F522A0EA37258C06A7FC9FA936CBC9 [email protected]
143,614,680 *0DCCA3CE91A08C8433ECFCF9FF24D99286F70308 q,lf
143,614,681 *0DCCF79832CB460382D95952AC88F44DB66FC253 [email protected]
143,614,682 *0DCE3252D947EDFA7130DB3FBCBBF690606F655C qs2r
143,614,683 *0DCF750E14D72408D546817F62D6A0C1D6AD8D7E [email protected]
143,614,684 *0DCCA31CD21ABA78AD7CB7AFA33F0D763DD0A350 QUENTINSCHOENEGGE
143,614,685 *0DC1D832F144CC4DC715FB36B9260D3A94D8D213 THEOKUZNIAR
143,614,686 *0DC67593569C21522697049C2D824C6C6D781138 q-vv
143,614,687 *0DC376207497D52247D55313ABC7FF8882277E83 The-Virgin-Mistake
143,614,688 *0DCF3D708AE58040A3FF4F41F75EA4DF507F3924 THINKFINGER.
143,614,689 *0DC3BA9CBE3F2467E2BA19D31A067E36925BF44C [email protected]
143,614,690 *0DC8A7C708B72D528AA23F056E8B381EB2245302 ramirodelagarza
143,614,691 *0DC459223A0FC95F4A806805B0CC1307EC182C93 RANCID64
143,614,692 *0DC1B7DED35084C60BE8F5F3356AEF295C93CC35 RANDY.LUTRELL
143,614,693 *0DC11AC77FDFD301E3C531D5F4D6D562FB22903B RANGRAM4
143,614,694 *0DC7F009646EFEB48FB60BC83981B924F789E131 TOBIAS.SUNDT
143,614,695 *0DCB58C8936D2E8D2BD147F251BEF985D26008CC TODD.IACHETTA
143,614,696 *0DCD7B29EEBE5624CBEC94FD41C5308B8B5A87DE [email protected]
143,614,697 *0DCF3E4C97EA05E2F77E37969DDF01160B833083 RCMPNSTRY
143,614,698 *0DC71BEA05A2D60C919F53E62E07EE85DAFADCE0 [email protected]$
143,614,699 *0DC3E5A6F1BD17398C29F63229EDE9D93313071F REASONSAND.1.0
143,614,700 *0DC6739D5F5F991EBC318EF25D6BAB615E581E29 REBECCADOMINIC8
143,614,701 *0DCD30D8D4BA811C469DC4DDCF75DA103C2A6A4B [email protected]
143,614,702 *0DC970471E81367E5398A3692C3D366994DBD838 REDOOWYLLOH9
143,614,703 *0DC2914AAAEE5A159FA672EAF274E9A1E6167DF7 tqy&
143,614,704 *0DCDA7A0121CCE2B5BF6E2714861C036B86CB391 TRAITSBASED
143,614,705 *0DC2BC8A42B4931513F8851AE4973E1AD89A3E2E REDSKINDEATH6
143,614,706 *0DC3AF6733B1E59BED134788E240848356F621AF TRAVISBUZZI
143,614,707 *0DCD539EB612D92036BD8989E6C7D67439EFEA33 travisgabrielallen
143,614,708 *0DCA60333109E5CCCF4B1D2F07915457DA477970 TRAYCISTANBROUGHTHOMPSON
143,614,709 *0DCDA6B8CE173A9B386EB3BCDF6F9295089E2A21 REGEHONBA
143,614,710 *0DC027449A490EA11558A7D4836935C6F9465DDD REGENERATIONSPHASEN
143,614,711 *0DC05A9AE7EBAA40B63AE560987CA5F1BCA3BF0A REINGRESEMOS
143,614,712 *0DC0C47E38296382A7BFDA6C22A1AD7C2E3C9D52 TREBREVIFRAMMENTIPERORGANO
143,614,713 *0DCA3B3BC0A65735825C0B320E2196FF81A0EB64 TREKKINGEBENE
143,614,714 *0DCBD3F5A36D3AAD622F2DC0ECC13CE2C351B25C RELIGIONJEDI
143,614,715 *0DCC0E19B68E297AC4C8560231D02B8BB8C1DAE6 REMEMBERING SOPHIE RHODES
143,614,716 *0DC43343C3C66BA73BB41B97574CB701905F807A TRIEIL
143,614,717 *0DCA015DFAA7563413BD5CE6BCE30CA2D275C5DD REPERIAS1234
143,614,718 *0DCE9260D48906CB907049FA80583E516E2FE5C5 REPUBLICA-DE-KABARDINO-BALKARIA
143,614,719 *0DC6F3BF0118C4FACC208706392C761275CBACED REREKVIRERANESS4
143,614,720 *0DCF903AAA25DF798761389029975989794E511D ttinhcs
143,614,721 *0DCC9261A242CCD3E437A3AE7882A7018DA9AC78 REVELATIONAL?
143,614,722 *0DCD46E4A1BC68ED2AF60C1237F8C516E6586A62 TURBIDITYSED
143,614,723 *0DCD346536B89AB001D0BADE4D770CA0AB478104 REX.HEINZMANN
143,614,724 *0DCE1BBE5E53294DDA765249822DC7C7E7F054AB {{TVCOM SHOW|237|THE TWILIGHT ZONE}}
143,614,725 *0DC12DFC1AC4A0C19A81420A8EF334B625FB27FB TV」担当の藤田由美子もBGP出身。)
143,614,726 *0DC81FDB5EAC3EB3F68B908A8EBD02D805FE0124 TY-BUGGAGE
143,614,727 *0DC6B1E9518585D2AEB54C3E943B5428306A4349 RICARDO.PANORA
143,614,728 *0DC94B5947891C662697735C76CDFF4EBC846757 TYRELLBOSTELMAN
143,614,729 *0DCB4495379736D398ACB048E4C0C6D68119E414 TYRONEKUCHARIK
143,614,730 *0DCC1DC278A3098D0E2783314EF993635BAD7AEC RIJLES (VERVOLG)
143,614,731 *0DC6C136E1F6C96F3D7B2484B473903CA5779DB4 RIYAD.ELHELOU
143,614,732 *0DC2CF016AC0B05D3D6EC27C1E7ACC88242D8355 robertchanthaumlsa
143,614,733 *0DC8823159DF380DD5D8E9EBA7B4AD2A36A8A158 [email protected]
143,614,734 *0DC394CF31A678392FFE48E4449938E6BE696B21 ROCKYAAA4
143,614,735 *0DCAC3295B3B5B216A6D190A8445C8448350329A RODGER.MIYAHIRA
143,614,736 *0DCBF8E6AA2A2731BA99F71AF89EF12101C185D9 RODRICK.RHORER
143,614,737 *0DC363477C2EB9A15307900EBC835A8B05983C52 [email protected][email protected]
143,614,738 *0DC4FAA91A112E34B0D8BC83BF2F5074AB00798E ROGELIO.MILDENBERGER
143,614,739 *0DC25BFEC0604E2B537806160B5017F8C577D0F2 ROMEO.FORREST
143,614,740 *0DC09D555B92BE3707AD01F4FCD098616FCD1DE7 RONNIESPAZIANO
143,614,741 *0DCDD704420D6AC76B758AA9A6B25FC6674647DB RORY.KOSTOHRYZ
143,614,742 *0DC31A9064608A71EBFCDBB622199843BE984076 USERMETALEKSTABSBOTT
143,614,743 *0DCCFBDEA5CDA1F8D881735BFA7D167C9CB6ECC3 /usr/share/localelangpack/en_gb/lc_messages/apparmorapplet.mo
143,614,744 *0DC8C947F6D0FB9AB0BF8AE4B06267CDF06B3924 UUYRNOK
143,614,745 *0DC1D067E44D1905B38890DC271FE7F4909C3C3A V3RTIGOX
143,614,746 *0DC1B597D501FDCE160A49855C3EC12C136B870D VAGERES4
143,614,747 *0DC64DAEC32F43A631404653073F35509A8D2C5D rpmb
143,614,748 *0DC693DB0B9C54029435A870DBF1037BED4CD28D VALDER.HO
143,614,749 *0DC95F5DF3556FAB3EFB8C95DFD6E435D4100863 VALDESVA
143,614,750 *0DC1EB2B693F7B8E445AD7E5BA6ABE3CB4782172 RTRIASTISKA
143,614,751 *0DC17E063318CEBCAC08EA906018051EDE277822 rubenhersha
143,614,752 *0DC1C2F2E068B22A3661E581FEE2EB92D162D539 VALYJOE19
143,614,753 *0DC4872DA3190AD9E12F1C8BB2AB78A1F9871848 vamperor-pepe
143,614,754 *0DCAAAF04298260A8BECB577C2D4396DFDB4CB87 VAMPETHED
143,614,755 *0DC1041A9DE65566700880741C2D8FFA0D74A5CA rudolpheffner
143,614,756 *0DC18E7FF6A787CF4B413677E1F4358B84E8E027 RUFUSKORF
143,614,757 *0DC29689B1BFA1DE41DFCAA8F0A0394FDC8F983D RUNGAKIBETING
143,614,758 *0DCDFFF45A600E038A260579A2729E3EAD73A3D4 RUOMAUONIM
143,614,759 *0DC4570E613B188F58FB89B23112484F443711AE RUPERTFELUX
143,614,760 *0DCCD2A605D9A374EFD7E75E41C8B13599631115 RUSSBAKALARS
143,614,761 *0DC6CD6EA68AC3865877D7881064A919DD3D79DA rvastes
143,614,762 *0DCF2B6B9189A4BCA6DB31C4D1BA1C91B89ACBF4 VENCY-PINTO
143,614,763 *0DC0415DD114E4B59DF70950ADDFA4C63D089B69 venus-sillo
143,614,764 *0DCFFD810306AE5EF42F56E6A401104349902081 VERNIQUEC
143,614,765 *0DC85A437671E43CAC7010034B5DA921E83C2E9A vernonlaurenceau
143,614,766 *0DC83A796935D29D5036177DA8544F3C77969498 VERRICHTETS0
143,614,767 *0DC9258F42E9FB62F6F9BA0F1F012FA13DD7B453 VHARVOISIMMISTA
143,614,768 *0DCD3120B6D648D0CE868D3DB2550326BCCBBD6A vickivanschoyck
143,614,769 *0DCB2E1BDDD9DB6F44C160105BF234D62DAC9F32 VICTORIA-NEYRA
143,614,770 *0DC053FEDEAA567043D854A79F14FAD58C60C895 VINICIUS.VIEIRA.MOREIRA
143,614,771 *0DCCB3B007D56352B211D5A99B1893E880041B8A sambucking
143,614,772 *0DCB74E831EB6CE5B3AE2B30D5A20CE6F6F42DBD VIRHA.RHI
143,614,773 *0DCF273C61F94A81E9273D931CBA19CFFEB8EC9C vita-brichta
143,614,774 *0DC7836651071A0575258AA625B5B9E3CCDD079B VLADIMÍROVIČ
143,614,775 *0DCDBBA3E4977B542F1E94C1BDDAB06A3F3B1763 VLIEGFEE8
143,614,776 *0DC64FE80623F84A105E6F6C4705F7F24ED3099A VNISELI8
143,614,777 *0DC6D63E9C1845AA4CC21B866349D8D8F54F98F1 vorgeahntes
143,614,778 *0DC7E0DDAD2FCE82AEBA495346CA928C02DBD014 SANTOSBARNICK
143,614,779 *0DC6C03ABCACE410C82CE0B7E61108D9509D4E0B santoshpaswan
143,614,780 *0DCDA2EDAE79509BD4696A52B0D5F910148DB0F9 SAPPHICS
143,614,781 *0DC5D0BD32ADC16E5B21EAFD113E6BDCCFD03194 VRUNALIDHAMI
143,614,782 *0DC4AB69D5113CF088D6BF1A52B849B6889A505E v-(slow)
143,614,783 *0DCCE343B74CA41B9FDAC40B96C80616E3FB797E SÄSONGSTSART
143,614,784 *0DCBBBCC04B8088AC3E179F32091133722A66928 SCAREFACE24
143,614,785 *0DCE0BB54B0AFD9AC5FDA341C425F8F91EC4466F [email protected]
143,614,786 *0DC22002F90EA1CACEAEA4DA0F031FC3706D06FC [email protected]
143,614,787 *0DC773EB76FF8D79EA9CD8416D220E7147B91039 VYBIZENI7
143,614,788 *0DCD70F5209C76833CBA68FFD5D509ACBDB09DC6 WAEAVSFAVDYWFU
143,614,789 *0DC7285D7E71145C3F4E7A364A9F66B0F23F72C4 WALDO.THOMANN
143,614,790 *0DCD9B4AD8D4B5C15EA1479CD2778C6C09F5D4E8 WALTER.REHLING
143,614,791 *0DC9F7FD757DF6E238036691A8693C0D80085FAF WALTON.MAULDEN
143,614,792 *0DC9EC480B0648872ACDD772263FE9A0B4ED743C wapportal
143,614,793 *0DCEE3B8F09844484A0971C6E66C59AF293EB5D5 WARMINGTOTHEWARMTH
143,614,794 *0DCFCB0EF449DF79EC2193C6C699ED21EEC35420 WCOURFAIVREW
143,614,795 *0DCFF67D072C87D55CE72D75483FDC1CC6A407EF we can get down (tim & terence instrumental)
143,614,796 *0DC376A86AD49E91813E3AAA8ACAB5AF2F84FCF1 [email protected]
143,614,797 *0DCA8FBDF4467D4EA7035759B3383CE1099562DF well, it's a ship
143,614,798 *0DC559F7514F84E835523B5F5E93F7F00D5F5C30 WELOVE-DL-BK
143,614,799 *0DC9CE59225D8966DE0C3CC4C72C2B456884540A [email protected]
143,614,800 *0DC8A01C8317523D1D4111F08526051D6049E7FB [email protected]
143,614,801 *0DC5AED14357C9AAD36786D17A197787D7370D01 [email protected]
143,614,802 *0DC2FF70B7F481594442063601B5E90B1C03D01B [server:.crown.ca.us.dal.net.Crown.DALnet.Server
143,614,803 *0DC7BBA3C50A23AB61D147CE220A2416D81A390B wes-elliott
143,614,804 *0DCAE697F0B9080084B85CF2F06D566F2361CE8C SESSENSUOROMALGNU
143,614,805 *0DCD3E6CEB5DDCA262C4480266BD676085C37831 SESSIUOJ
143,614,806 *0DC4DA1ACF71C7EF76A6D68B7FB925EB3759264F SETH.ANTROBUS
143,614,807 *0DC88E0DBD6BA64DA70EA9BD2019EEDEA9CE95A0 WH!571ER
143,614,808 *0DCA729ACF57DA97F4C6EFF338B39642C191E859 SFAREMMO1
143,614,809 *0DCECFFFA3EF6B515C47AAEFA467946911F047F2 willem-steenkamp-spook
143,614,810 *0DC724A3F07485FB0918236F55CE14601F177D21 WILLIAM A ALDEN
143,614,811 *0DC600A65FA74377E38AEA958B3B7D47A4554FDA SHARIPAH6
143,614,812 *0DCE60C6C641DB45D2C2A233670E143D5F80169F wilma.jeffers
143,614,813 *0DC006B1CB03D773AD5A1D3404DBFD897CD138FE SHAWNDENLINGER
143,614,814 *0DC212891BE869EF188A540E1C04CF3FD3294FA3 [email protected]
143,614,815 *0DC196C858DF5B882964A93D3D7270BD03A16087 winfredleysath
143,614,816 *0DC94F10F473515BEDF209110935931F9BE6AEF1 SHELDON.SWEETLAND
143,614,817 *0DC2B189EB207D4D3CDB0F029F96BA7E271970E0 „włoską”
143,614,818 *0DC9E477531E466120325CEE5DB824B08F13D530 WM.LANDESS
143,614,819 *0DC16E24005C8B933D9A2C451A6ACB33E29AA8CD wongbangbang
143,614,820 *0DC416320FB1F47BAF5E571204B58530DF191B76 WPARKS80
143,614,821 *0DCDD13953511A24FC1ACECB28119114FF647674 WR/~
143,614,822 *0DC28477FFEAA204BC5E8D7B0DD8E8D113FB3E88 WRITHED
143,614,823 *0DCDA3ED71BFD4A401DAACB2DAD7F1FCE913AAB1 [email protected]
143,614,824 *0DCA41D1F1CFDFBE018C10C4C8C7927C8D1319FA [email protected]
143,614,825 *0DCD76F17CDD21BB5225415A17C6C4F6DCEB06D0 WWW.EXTRAORDINARYTIMEPIECE.COM
143,614,826 *0DC2EC8D75A5C49D06B2BB56CAFD388849678B18 wwwqschacn
143,614,827 *0DCCF8F77C741B14792737E916E61477967F552B WYNFREDRUSSELL
143,614,828 *0DC1010F314F79B02D0218F2B0CB6A693D286F6E [email protected]
143,614,829 *0DCBCC3C974692D159E043A259B4953818076737 X00-X1FX7F
143,614,830 *0DCAB96F3B4380B7DB72B2106A799EDDEE0BFA06 XCHUCKY3
143,614,831 *0DCC37341045F01D112A7A612B8AE6A8149AB2BD XELLIE MAY BOUCHERX
143,614,832 *0DC80ABAD8753C9C431EEDB37A908BFEC28BBBC4 [email protected]
143,614,833 *0DCF2548B5D7074B1FB53B1172FF9CC6B3015FDF [email protected]
143,614,834 *0DCCC171E1821A48D1A2682A055B0E6F7BED2EDC [email protected]
143,614,835 *0DCB5C830BDCC76F31132F221B9DB59939048B3B X:U0
143,614,836 *0DCC046CEAB757E195EDDCB108866BBB287A7B33 [email protected]
143,614,837 *0DC6D3864AC887615307F1E4927BA9D0DDF154B8 xwy
143,614,838 *0DC407AB6561D79B99BA2E4BE1F9A3BEE189F1E3 y5,i
143,614,839 *0DC72A2E85EC3C62D299316914B66D756332E0D7 yael.mizrahi
143,614,840 *0DC026D0B6C5999C65F621171B5159130CF391E2 SIDNEYTHOMASES
143,614,841 *0DC734F1A672991B97CC95CAE76076E035847503 SILKY-SACHDEVA
143,614,842 *0DC2714A1FB8BAFFA93DC6D4236536E5160010E8 SINFONIA N.2 IN C MAJOR
143,614,843 *0DC2DEBC0720AD6C29BB6E056D65D20925DE1F1D [email protected]
143,614,844 *0DCD2F6EABAC46DD0F27C917B660741F8D3F735E sizlar
143,614,845 *0DC1B0F6C8A123D8B77D019A7619CC3C38332810 [email protected]
143,614,846 *0DC606DA911358317AB0A2555FB0E080A87A82C0 SKIKLIVANIS
143,614,847 *0DC685C58899FB196C0D8898E2955CD6E1D78163 YOUNG.CUNDY
143,614,848 *0DC46D74E245F07004816DE042EFC0C756EABD6B YRITTJPERINNETTING
143,614,849 *0DCEAB9203B754312A71E58D191CEDFFCD867CDE YTILANOMMOCING
143,614,850 *0DCB1571E283535C94A06387DAA2D292F146C82F [email protected]
143,614,851 *0DC3578CBB3AE7BAAFEB0F6CB4953EA094978AED SLMNLST4
143,614,852 *0DCDF474EFA129EF92C9F3E3B610B462A63A40AC SMAKARS
143,614,853 *0DC1A78564EC45B1579C5A4E0AD99C02464F09A8 YULIA.ANAWATI
143,614,854 *0DC1E241973D5B2C0CE37D1BDF333D89C7B94E85 YULISSAGUERRERO
143,614,855 *0DCEE485093402FAF33297C698534BA15839CF33 YUMI-ECHI
143,614,856 *0DCCD166FF60AD222A9C85A5651080E1B1E4FF5A yuniesky.cuello
143,614,857 *0DC0B051F447BE353D25E67725872D37F31BCD72 SMILEYSIDNEY2
143,614,858 *0DC391199E86E257468EA0964D83C78B34CEC1AA yutodean
143,614,859 *0DCF9FD18C05725EAFF7A102EB0E1177D4AB3AF8 [email protected]
143,614,860 *0DC2C055171D1B30103C56CC02E4C83EEA5031E0 ZAROUSKI
143,614,861 *0DC40322E82ABE6AD61BB7E18336A36761653A37 ZEKIWAE
143,614,862 *0DC3597C517793855B90B06F43D5807EB16ACED1 ZELDA3647
143,614,863 *0DC6BE300CC7D966B6A5A19B48A47338CD7A5746 SONTINOB
143,614,864 *0DC5DDFB16C3D6C70CF9EADF4B69A700CD22CB99 sophieedge
143,614,865 *0DCA9F2B50B577634B93CDC93E935AB7C9D95DA4 SOPRAINSIEME6
143,614,866 *0DC97DBAB9836A7BFDB7A47701695C5A4FA49F2F [email protected]
143,614,867 *0DCAE2F4FB69320ACC6922BD7655649CA2FE78FD [email protected]
143,614,868 *0DC0DA84A8F701D5646C93AE52BC50B4DE3DC7E5 SOUGDA
143,614,869 *0DC86D3E319C6281E18997E066FC9420C216D995 [email protected]
143,614,870 *0DC905F5A6D86CD81CA211D0F9CC80369DCF5B73 SOXBERGER
143,614,871 *0DCB188AC401616D3A030524AD44774E199FA4F1 ZHONGGUODEAN2
143,614,872 *0DC23564EA37C47236C610175B5C4F742DB1DBE1 sparkyi5
143,614,873 *0DCDDAF505987D1529261D45E13E83E25AFDF15A SPEAR MAN
143,614,874 *0DCBED8E7A9A7160359CB6E9711A722B84C04D4B SPECIOSA!
143,614,875 *0DCDC1BBE5DFF36807A48CD4A9FE78130EC5A861 zhualiatraides
143,614,876 *0DC8C8AF7C17649E7880E6CD3C3C3936A55C34AE SPIKEADAM?
143,614,877 *0DC7823D1A7831A459F1290CB91668E3A4BAAC6A [email protected]
143,614,878 *0DCBC4CC39851671CB47E1A18A042E2B784CD493 splat o~0~ @===p
143,614,879 *0DC6280BA4BADEF02860158873CB425D2A45553F SPLATO~-O~-D=Q
143,614,880 *0DC326B3193ABC1E78A1C0DE2321DC00E9167712 zi-en-loh
143,614,881 *0DC4E98FE178DBF2DC318E9717F906809DABF870 zion land
143,614,882 *0DCDE0936473AEFAB5895F7B8E8DB2225E18344C zoettl“
143,614,883 *0DCA7F439FB2FBB9C01350445E873ADFA3C5121B SREYALPEDISNI
143,614,884 *0DC73111F4D2313B03C3138935DFCCB8481A81C5 ZPC#2FWS
143,614,885 *0DC881BEE4525F113201FE0B7E7A040D323C379F ZPYCHANA
143,614,886 *0DC74B0FC03BCC9FF368A4A89C335259B1AD0A21 [email protected]
143,614,887 *0DCBDCBB4A72E967080ECF23E81E4853C231EBAA zt-u
143,614,888 *0DCE654D248761345171B83265CD3B89D19E67C7 ssigkeitsgrenzen
143,614,889 *0DC1959FEDB086E85AAB3D25A843E0019E3A6C69 stagescenes
143,614,890 *0DCE74BF4449EF8DB1D93AD7F014851936D825E5 STEFAN.YANT
143,614,891 *0DC1A1F581DAF81732FEE591EB267224DFB38F4F stelabbsw
143,614,892 *0DCE3A09F6573D6F22E1345D1C8B9FEE38D03FC4 έικμαν
143,614,893 *0DCC487268CF8F0888F3BF5BA0A7F2CDEB773CF5 ηδονήσ
143,614,894 *0DC0E7F1F708291075EBC956CFBFF8ED1B55C11A ΛΈΪΖΕΡ
143,614,895 *0DC0C04F9E972CC7D9543E565EAEB8D6A1E096DD БРАКМАНА
143,614,896 *0DC80499ECA33D4CFE23BDE1C0EA3B0E1C4D8F21 БЫТААННЫК
143,614,897 *0DC0E8BF9406B34FD8BD32F65E967114E24C1FBD «ВДОХНОВЕНИЕ» —
143,614,898 *0DC47D9066C39A603144C5C82A707424B8D9A3F2 STEPHEN.CASSEL
143,614,899 *0DCF827E7BF609453E799B46D3D9BA59F83B187E STEPHENSHAPPELL
143,614,900 *0DCBB5479AD81F83F0726704C8E2BFD5A9689102 stewartcordoza
143,614,901 *0DC413CADC39D99C04034B2C4C776477CEBC01F3 STOLTENBERG1200
143,614,902 *0DCB89C7AC8AFCAAD274A7C4FCFF244F19F10C18 STONQUOP
143,614,903 *0DC344C4504F00D86C215DA94D7C8C0811DF739C stoppelveld2
143,614,904 *0DC86DC4DB2CD541B4BA0971730B89FF96DDE97E ДЕТСКАЯ
143,614,905 *0DC8FF14F7580F96EA3A2658683091944B60B401 STRNUL
143,614,906 *0DCD5F7A595834D24D4A52532BA4A753D029D1F0 КОЛЬЧУГАЛЮМІ
143,614,907 *0DC7FF995EE1686D0D7ECCF233031C4C4E85615E ЛАКТООЧУ
143,614,908 *0DC55ED5536B04B7AFE622F752D4534837382E9F НАБИЈА
143,614,909 *0DCAE06F1C00B3219A67D698E1B5F4DB1DD05147 «нибентан»
143,614,910 *0DCD5FADD2E5928FF9A7EE192871767EC3EC8DCE «т’лота»
143,614,911 *0DC1474056FEC37FC94F6BB4B960DF4671AC76B4 тра́ва
143,614,912 *0DCC0427D099D882DB13F6EE1DA6297E54801CEE  ЛЕХБЕРТУ
143,614,913 *0DCD834E23E2CAB176A4C855E2CB13533DAC46B1 susan.laroa
143,614,914 *0DC999B11927D5A8C161820DC2AD9D7400586D33 SUSSULTERSES
143,614,915 *0DCBAE4E687BCF484C023692A8ADDF9510818D42 SUWINNAU
143,614,916 *0DCB42E496FD62DBB884D2776BA202C5D19AE378 SVANEITO1
143,614,917 *0DCCBBC1323A9A49953E2C7938A6D5F9DFFDA54B "SZU""ZPINAJU"
143,614,918 *0DCEAD70A41029AE6376223EA36CC2C1BBE0D9DE t!
143,614,919 *0DC3ADD0B3C059658C4F5C9E88BD9D9FAE65B9AE T332514B
143,614,920 *0DC8E6E9E1C02DBC9B769004C89A48E690B63282 [email protected]
143,614,921 *0DC6EA66285D9B306A7AD8686199EE59AF2B8EDD taiboush
143,614,922 *0DCE3EEEB68467788B20745613B4A17862C69CD3 TAMORPHOSER2
143,614,923 *0DC511ACBE3E90554E155024E0B6BB2AB9703C07 tauricaed
143,614,924 *0DC09AB6BCF2B4A6F046634A44D231D86DAA7477 TAWNYA.GUTIERREZ
143,614,925 *0DC6B3A05C56AFC1F7EE8210F894E5E17CFC7043 [email protected]
143,614,926 *0DC753D20F35F6C7EA5246A062422C2B2AE46142 TEDDY.STEENBURGH
143,614,927 *0DC7518F269E8ACDC771B1932FBB6D670F3A9D63 tennists
143,614,928 *0DC2476DAEAE84FACC6E56CC2FE93DA9A2FCED94 TETRAKARBONYL
143,614,929 *0DC361790331915F299DB4F708556608045A6B85 tggokqwz9h
143,614,930 *0DC3E6F93CAC2AC67B2C064A307AF7601221B94B THAT-HE,-UNKNOWN-TO-ME,-SHOULD-BE-IN-DEBT
143,614,931 *0DCE873FE23BDC38A4CEE907079718F7D112C243 THEGUYONTHESTATENISLANDFERRY
143,614,932 *0DC7FD9BFB65BFE5DE361708461FECD11ECF9E68 THEMPERUR
143,614,933 *0DC8D243670A28E7859B49CFD8919E6D753EDD40 THE-MUMMY'S-BRACELET
143,614,934 *0DC6908EC294297131961A7296B923F1E8821B6B theoburdeshaw
143,614,935 *0DC7B6297524B58F9B4A9E151ACF2035A196F688 THEO.CROMWELL
143,614,936 *0DC8D21CC3345F14348D42E356F31DA7146F1236 theodorekitching
143,614,937 *0DCEA7BDD239261BE307C35B872C84833B1C57C8 the rejection (robbie d's dance jerk mix)
143,614,938 *0DCF8DF34B02929F05ED5A67C3D7CDEDC671BDB1 Thisguidewaswrittenfortheintentionofhelpingyou
143,614,939 *0DC627AFFA4F61D46592A2DBF1DD02A310BF153A THREE.PEOPLE.STEREO.CHECK.TALKING.SIMULTANEOUSLY
143,614,940 *0DC1A17B54315C65A9A302EEDE7A66AC4D9BA134 02061698
143,614,941 *0DCBF7C7FB3D19E26CDB1420C0A584AE83F93AFC TIFFANYADVIL8
143,614,942 *0DC54083312B736B8316D1EE99029AC21C09EBA0 TIMBERBASTARD3
143,614,943 *0DCAAD5776528E38798D8830FBEA4F9C722D033E TIM-MANGAN
143,614,944 *0DCE32B07EAEFF038B60B221789E29D9851BCAF3 TIMMYLECHLAK
143,614,945 *0DCFC02B635CD80C1C8FEF3BB94872CFFA4AFF09 TINACANITA
143,614,946 *0DC0126E38463170B7259899D82ECD5EB00216D0 tlusťovu
143,614,947 *0DC52B12E8107DBD48CF62017BB0820B882D3DB3 tobiran4
143,614,948 *0DC470A8C4D96903B2DD4DAF3FB81600AAB4C956 096rigoberto
143,614,949 *0DC8F399F11D91274738ED5A256BCB02066ED0F5 TOGUCCIFOREMA
143,614,950 *0DC03567FF21CF5C1A5286C8C42BB04A764ED3BB )0(~`Q-P
143,614,951 *0DC93B74EB03C315FFC3D57F44ED329A72D5EF18 0thateric12
143,614,952 *0DCD017DBE3B6F1C8C54C18F059058EC83063288 0THEGORDON3
143,614,953 *0DCD2554977DCFF76825AEE10E7254303874DF54 0X00000200
143,614,954 *0DC43F9FD4743E3976C323BB4B426DB9B8F63695 TOMOVETOWARDSING
143,614,955 *0DC0542ED3BA7600AB9B64A1E4932506ED1A68AE TONIABROWNMOORE
143,614,956 *0DCBD782F5CC7141371C66EEC7E1C48C6B8B9EC0 10tarvittukaan
143,614,957 *0DC7B2B00AA5022EAAE9CE439E9027DAECC13821 TORY.SOLMAN
143,614,958 *0DC0BDE7E1366FCBC02AEB5679346DD7320911CE TORYWEIGART
143,614,959 *0DCAAF70A0697DB8815BCB88E2AAE934884EE8B4 TOWNSEND
143,614,960 *0DC41D406C59183D4FC5386B48EFCFA5A834ECF7 traceyshoop
143,614,961 *0DCC8472A1CE7174E19E6F295112A058323454D2 1210297 er muss sie loswerden
143,614,962 *0DCD896F3093F9CB9F0CD6DA471B9D66266E3C1A 12.21.1271
143,614,963 *0DCE2865A125A9D832D4BECC0B516EAC2BB3B901 tradeorees
143,614,964 *0DCEFEBE702B400704128617CF9BC2F1861569A0 12 ETUDES OP 25 NO11 IN A MINOR, ALLEGRO CON BRIO
143,614,965 *0DC69F5BD533BDC089C7285BEA0914F768316161 12TUSLARININ
143,614,966 *0DC7166953EFC00B06EAA4AEE42370E8BE74115A 12-Universitece
143,614,967 *0DC4FE80625489CFA032A5B6A917D5E5A1B886C8 13krusifiksi
143,614,968 *0DC44139867A2168C0D36CFEF620EB15A7A55F6E TREFIV
143,614,969 *0DC7123671AC98F3474BC0D20FEFEDF19EE6EA52 treymealor
143,614,970 *0DCDC9B58B96DE06C3101009B34347F7610ED61C TREY.PIQUE
143,614,971 *0DCDD460B1D65DA2F172124474B27EE64D3828E0 TRHACE
143,614,972 *0DC0474F58E804C41981F15FCC33348C33231942 TRICIACARUSO
143,614,973 *0DC0D8BBEB79D85DDD64BE1D7A92EB6E22456BC8 tri$ke1e$
143,614,974 *0DC0002870F2394D3440B4059CD5608A38B6132B TRIMBLEVILLE
143,614,975 *0DCEEE1841988DC4F158F7D8FC3EE23C1A64AA34 TRINASEXSMITH
143,614,976 *0DC4D4B3AD80D621473D7FBBBBF2B2E52BCC8A7C 160ds
143,614,977 *0DC47A77D12F04340482A0275DB8FFAD09DF59FF 1626433 NO.PROBLEM.,.SUPPLIERS.TOLD.HIM..
143,614,978 *0DC8C49C2C85EAF9B069C7680014AAE56CDD4CA0 trissinajanaeporter
143,614,979 *0DCB60617B60AC774D441E4C8D0ED0EB7C61C9B7 tristan-bourdeaux
143,614,980 *0DC76569D0B65F01566E318EDE7395727371B559 TROY-AARON-MARKLE
143,614,981 *0DC84A74F075892016B951647FC364BDACFA3A42 TROYMARIE THOMPSON
143,614,982 *0DC78A6965B348C89DDD3570450E66F8634E90DF TSDNVJLB
143,614,983 *0DCE4E41278482304DC9A628625A5829E2096B54 TSELDDIF0
143,614,984 *0DC0424EABB2C9CB888A14E786BF6AE3EE4DBCFC 1796estates
143,614,985 *0DCC67B105CABB9B58424E3AFEFE76F9AD2B79BF 182965 LEIRIN-KOULUTTAJINA-OVAT-MM-.-MARIA-AALTONEN-JA-MARKO-M
143,614,986 *0DC9877AF56D6B00B8E3C72541C9F46BBC752E73 19051977
143,614,987 *0DC24B95C78648818B15CCD10862E380D9497375 ttinhcs
143,614,988 *0DCC9261A242CCD3E437A3AE7882A7018DA9AC78 TWSCHRG4
143,614,989 *0DCBD7F2AACBC394D7D662A6804B599A0CBAE2DA TXTAANTAL
143,614,990 *0DC7E5EB21C6F828E978D4E9406ECD970F7DEA9A 19 VIERTPLAZIERTE
143,614,991 *0DCC1A5117C07784886A534E207019CE5297282E 1AIVOOIREISSA
143,614,992 *0DC57345CA59CE9805E113A4DCDD8F6C75867C8F 1alkuvalikko
143,614,993 *0DC6C677BDE42C60BF50D52C319A74B876D17C2E 1.ALVENA
143,614,994 *0DC0500F5B30DF0F26578DD8823DE748DC8C571F 1amortisationsgrad
143,614,995 *0DC41F4CBB72A38B27753104637FA9F040FE8C98 TYRELL.GAMAGE
143,614,996 *0DC90E244C29F82BA30FBCDE7A5E5C618D855B9B 1CHEVYROXY
143,614,997 *0DC2CF521A61C1EC63AA0B3757A9EC678EAEC0D4 1chlorkreislauf
143,614,998 *0DC89BE6BDF8A44B5A419E931EE58A0A8148B169 UBNENARK0
143,614,999 *0DC8A9E2148B2D4ED69C52C076CB4D2C47FADE5A [email protected]
143,615,000 *0DC12A7EEF597974D7D097BB507BD03406F419B6 1 directsystem
143,615,001 *0DCA99AC1F627CE274FDD66016CBF5E1451E9AF5 1.ER
143,615,002 *0DC4A9F5A4F78C68EB413B9728FF94129B137769 1FRKLARIN
143,615,003 *0DC72325CA65EC67B9F7F6BE9CB095F8042B3CA0 1.GROZNILLA
143,615,004 *0DCD357025457F19BAC011A04FCFD64351351B92 1harijs1234
143,615,005 *0DC72D4DCA9C770AECD0AB5715E22793E97778B0 1 HERKERT
143,615,006 *0DCF0A47FD78E5F442956FF78FE83D14FCBED4FB 1-hourailevaa
143,615,007 *0DC72470111B9904DFAE1EF083D7B3589DA04AD6 1ihavalta
143,615,008 *0DCA414BA7D5CF4795D8209ABE57A6F0B5769FE1 UIGENNEMSIGTIG5
143,615,009 *0DC0846A107293A4C473494FEFC770B2A51FD662 1.kfzzulieferers
143,615,010 *0DC050EC4B690474DDC8E530E46F786F47075FE8 1.KIRJAPAINOKELPOINEN
143,615,011 *0DC17D44CBDD0B6AC060E8C9D3297967F3BFF84F 1KRONODOC-ESITTEIT
143,615,012 *0DCAE1DEA8D7E8D7DCCE32ADD721310632A1D8BC [email protected]
143,615,013 *0DC8590FE530535A6C6C200585EA4CB663842A49 UMOUMO1
143,615,014 *0DC80870EF932E2EF1C18F7CAD525DA47D92930D 1NTBJTTFL
143,615,015 *0DC5DDA15016317544B85F97204FA43F85A4CA32 1-PLATZVIERLANDETECHRISTIANMAUSBACHAUSKELKHEIM
143,615,016 *0DCAE16D28A3FFE053A5701236FA009D5FDFFB12 1.POPULARPRICE
143,615,017 *0DCAB1D1C3B81697153A3ABDD665B4157B3B1D36 1.purjelaivatapahtuman
143,615,018 *0DC98CFEC07E8BF68B4021D78B0F849417BDD4D4 [email protected]
143,615,019 *0DC933518D1A5E03E6305417A70DED450A8B718F UNGUILLOTINED9
143,615,020 *0DC47C16ACEF84E739AB5E974816926C977AB506 1 RHEINISCH-WEST
143,615,021 *0DC82178B5BB7D2F57DDE0B7E2AEF61EF86802F6 1ROCKYOUCONTROL4
143,615,022 *0DC2645273DB87D0EA97C14540A50B5997E89D8D 1RONDKRUIPEN
143,615,023 *0DC3D583CF6CD24B7675225CD89E7C07952DA790 1SCHLCHTN
143,615,024 *0DC175AEE255DDA06BE08ABBC7AE372CA19EBD53 1TCHKVSKY
143,615,025 *0DC1F6891C7DDA5E88C1C50725BDA19131C22435 1 TELEFAX
143,615,026 *0DC690E2DD9084DA60922299E6A9F8664E40885D 1 UNBUERO
143,615,027 *0DC3E302B53E10BA99D611731527A1118CAC53A2 UNTER-DER-ERDE
143,615,028 *0DC096303890089D0B6798041A60B158269CCEE4 uok9
143,615,029 *0DCB27E8CBDA40375AC83F4507D336E3BB05338B UPBEAT.CO.ZAWWW
143,615,030 *0DC535A2D16468AB5C4E13219C42CEFFD0EB228A URANUURT2
143,615,031 *0DC242584DE49D0492CD1F6B4894B62FD26195C5 urethrometer
143,615,032 *0DC78B37B9CEB3C9B74C65FC0E23E004D90CCCB4 USERREDBLUEGREEN22
143,615,033 *0DCDDAE4078C0C2CCB40E275F526A29E4D67DC95 UXOPOONAI2
143,615,034 *0DC1475757C4B22B7BBC15CEE8F5969C9550688F uyallvanwyk
143,615,035 *0DC4114610B422F7D9440EED649C59C71BC28386 uyenuonggarden
143,615,036 *0DC22DAEC83BEC9758AD500EDD9BE5BA51BD3E38 UZMA.SURAYYA
143,615,037 *0DC2E99446D406EC7FBF90010C368CA076E7E4A3 V4LORIS4NT
143,615,038 *0DC5DE5EC809C20B5ECF9BD8D98D77F2AA72812A 2458137 KIRKON-KAPPELI-SIJAITSI-SIIHEN-AIKAAN-ULLANKADULLA-
143,615,039 *0DC58DBD4237373389B84CA1779BD001C2200E50 Vai-te.Lavar.Morena
143,615,040 *0DC71E0A246A420FDE3ABC7E062117C2632A02A7 2481583 yhdistys toivoisi j
143,615,041 *0DC3434EFF81A627B9B1EEB1ECDF2EAAC5913EC2 2605475 esmussjanichttravemuendesein.
143,615,042 *0DCA9889BAEC63FD15DE53701EFA040206708F4D VALLEYINDY
143,615,043 *0DC01F357B22859F0E0BD9CBA0E97F819642B072 264112 KUTSUMISTATULEEKANNATTAAV
143,615,044 *0DC26D212CF1D10B93A037AD76760F310EA010F1 26.HASSISELLE
143,615,045 *0DC641CCE90F78F877B7BA52DE454C49536E9311 2875512 BEIDEKAEMENFUERJEDESINAMTINFRAGE,SAGTENIEBEL.
143,615,046 *0DC7C903E5FE32176A645040CB7FAC9661F3DC8A 2919998 KIRJOITAT KAPPALEEN VIISI KERTAA " .
143,615,047 *0DCE3C5A3A5F943B8B529C4BD4F49EA39051F69C 2974960 im-mai-2001-sollen-die-arbeiten-abgeschlossen-sein-.
143,615,048 *0DC2B2127DE685939131527240F0ABF0E5EE4E1E 2AFFIDATA
143,615,049 *0DC8FE406E4263D6B7EDEB88FFE7F2B32087689C VANESSA-ANN-GALVAN-BANDA
143,615,050 *0DCB417AFBBF623FA5638868D77DF804FADD8F63 van-hellsing-ii
143,615,051 *0DC290FD52A73E7EC27381DE24029EBA7DBCA4C4 VASHYAA9
143,615,052 *0DC8F02DE6EA78B666643A90604ACA98DEA1FCB0 VASILYUK
143,615,053 *0DCE5F2261ADFFE87EE47A8C8077E4EC53C3D1DE 2energies
143,615,054 *0DC5325CFB0C6F63BD4AD3CB94F8661906478979 2-FORUMIT
143,615,055 *0DC542A3E5EB1E1A27165EDEBD4DEB4C5550009F VEELGEVRAAGDE
143,615,056 *0DCD0280AC3CF75CA2AED1910BE6E12EB4C0E137 2GUNNARSSON
143,615,057 *0DCDEB4AC013EBB1CACA810842F2517172071139 2hyv
143,615,058 *0DC7CED92C0EFEE1F708A4B03BE7597FF3E80914 2 KOVAJA
143,615,059 *0DCD71A06F5565F92307EF371F0421DB4334633D 2-KTATSHENKO
143,615,060 *0DC1FC327AC7558F9B948A6DBC8F9ECDBBF54A30 2PUSUX4Z
143,615,061 *0DC1B38E397190C9FB1C98B406B711E468E3432A VENTASEIS7
143,615,062 *0DC6043C2F86A980E525AEB225FB452302E9275B verlagsgebaeude
143,615,063 *0DCA5E0FFE9A2AD9C73A79507FC0D8BD06F5E421 VERWIJDERRIE
143,615,064 *0DCEC3C91BF403E66DA1E9D9F545FC695E1A1A1A veteranfreeagentslanguishjulynearsitsend
143,615,065 *0DC3BA19267ACE8CBEC26C3D033E8534AE105132 [email protected]~0.~OSPLAT!!
143,615,066 *0DC72B3F75C700BCB91DD06676F3448E2FCAB695 30VOIMATORI
143,615,067 *0DC3B585F511355EC7E44B1619ACF7C62A5FE200 viage0
143,615,068 *0DCF62BEC78176E23901A2280F5C56736C481B94 31-08-1440
143,615,069 *0DC8736111772AFAD0CA458DC1DD17DABC7F7A56 VICELICH
143,615,070 *0DCF93BFCEA217BF4F01F5308E43D5AD8B21D815 342336 buaradaashabdanbirisi:eyallah'inelcisi!
143,615,071 *0DC81BABE363B6FE49349E5A3DA75012B3331F1A 357411 DAS-GEGENTOR-MACHTE-DIE-BIELEFELDER-NOCH-FAHRIGER-
143,615,072 *0DC2A8C06D8A83C8366E995DAB1EF57BF2CDB72F VIENEELHOMBRE
143,615,073 *0DCE72FD92C598351F52FAE5225785B5BE2CB808 366284 haste-verstanden-sumi-?-"
143,615,074 *0DC51BD23AB244D8EF64223F7DA6D03814531BF4 VIESTINTKULT4
143,615,075 *0DC54BFE7283A6D7FEA1F4FB0F1CD1701EA7A455 VILL DU HA SEX MED MIG
143,615,076 *0DC4AF11AC59560584150816ACAEFDE8014A1125 VIOLET PERES ENIENGHAN
143,615,077 *0DC52978F95789AE29B83274D0429060E0B26305 3DONICES
143,615,078 *0DC8F2CDD528CA23D9DD1656B702AA175FACBA23 3GIZMOISIS
143,615,079 *0DC489E30A035A0D0B33FAC7A6B815B8011F7B23 VISION-MEDIACA
143,615,080 *0DC602ACE60F778192DDC99643CF5A36F21D5391 vntltns8
143,615,081 *0DCF3A125569A672135714DEA31337901064C846 3PERHEAUTOKSI
143,615,082 *0DCA5D9C328E233CAE16D15D2F4AB9C367EB69B9 3.SAWTELLE
143,615,083 *0DC0379FEB4C4AEC8F4B6B278E453B37E9C83DDD 404JADIEL
143,615,084 *0DCBEC79A34F0C53555C2342DF00315217D7A6DA 464152 sen toimintaan sovelletaan kuntalakia
143,615,085 *0DCA550ED6AF744610942211D7BB09639D362B44 4DESCRIPSI
143,615,086 *0DC716365B570AE94956C27EA8A61E2CB943448C WALKER.BODENHAGEN
143,615,087 *0DCC7E2C3EFE665090B47FDAFBE9D8544E510B2C 4HADOWBOX
143,615,088 *0DC99837451770049B4BC206A7ECD567BAE7D4F9 WANDACIHA
143,615,089 *0DC73D862038AF5BE51DBA0E13FC4BE77D3F2FC0 [email protected]
143,615,090 *0DCBCA40E0241DE2DDB88DE6214B28AE2880B87B 4MOLSONSHALOM
143,615,091 *0DC05596068D96DC1796E6A3B9B68E7BFF07CED9 4NEROZMOCENA
143,615,092 *0DCE22E8E8D13708C6BE38C79A611D7260F1F3A0 4NESBITTWONDER
143,615,093 *0DC33DC2790A119AA3C252B99061FA32781F5EB2 4OSVITOM
143,615,094 *0DC5A1DA9437E1CD42CD5110BED1200490C9E59C 4PASSMINNIE
143,615,095 *0DCFE16AC8A0313611ED98CDC7E2607ED0FF885F WAYNE.BRATSCHI
143,615,096 *0DC78CCB247B3F7D7BC526748B7D9E948225CCBE weglewicekolonia
143,615,097 *0DC1750D5BB04BEF3D9050E57833814E5B9568F1 WEICHWAFFELFORMEN
143,615,098 *0DC0E40A97350BA699A195AD958388657967F3D1 WENDELLY-RODRIGUEZ-SANCHEZ
143,615,099 *0DCEC5B042248CFB9AB35DD36F5B13F9C7555B4B 4SAARIJRVENPA
143,615,100 *0DC1F330FF8FF4E54A9053C14BF63928A3D9B456 [email protected]
143,615,101 *0DCC6736F9A395B6F3F6E99E1D65653ADE5558A1 4thathuskies6
143,615,102 *0DCFE7941E4F18EA64B35785086DFEB6C5E21137 4VERLOREN
143,615,103 *0DCB9C7E5E676C851E5AE21FA869022EEABD7797 WENILYN.BERNACER
143,615,104 *0DC51026ACF633AD3D825D605091847067FCAFB1 wernerschellenger
143,615,105 *0DC89223D9C6BDDBC3A784C20C81472C6A09D689 [email protected]
143,615,106 *0DC19D0CFA9E9BDE545FE4129001CF1BEF6DB399 WESTON.YAKULIS
143,615,107 *0DCCC8FC10D7532669E20B5EAA638D38DF16C102 W^FN
143,615,108 *0DC95D399BE5154421B0AAD4CCFDB6632EF201CC WHAT'SYOURSTORY(WHAT'SYOURJIVE)
143,615,109 *0DCE6134055FB346842920A456E04A80E6D9ECC1 59-AMMATTIOSASTO
143,615,110 *0DCC9DE34FA05256226B2764315922C623B1017B 5ADUOCATION
143,615,111 *0DC5094E4E05D56F7D0F0D7AFED3D07AB452F5D4 5BARNYSTICKLE
143,615,112 *0DC6CB3FA63362633EA04D6EE1E02281946F91E7 WIKIAMMIRAGLIA
143,615,113 *0DCF39ADFC5A42B504A80DCFD92A3E5DB3728C33 WILBER.BOEVING
143,615,114 *0DC1C97CFB08B01AE360FD9452685768E89339FC 5CANNONDACRAWFORD
143,615,115 *0DCA918298EC57A3AA071127C6D499741F266891 5CARPETANA
143,615,116 *0DC1DFA41572BFBD3AC41F82BC441EF34B1B1FAB 5COHARMONIOUSES
143,615,117 *0DC345BAD56F6C97D1B349986B366E6EB8C3F574 5EULEREULER
143,615,118 *0DC98437F5DBF61289893FEE1CC11C7BF21CCA45 WILLIAM L COFFEY JR
143,615,119 *0DCD0E89DB4C21491BDC97B99104C312EA0D6864 WILMACARSON
143,615,120 *0DC3A715987F00435FB8CCB81633E79DCD5A6BE7 5MINDYALLISON
143,615,121 *0DC5CF6F0519FC5B8D0ABAB75FDFA797E9604D40 [email protected]
143,615,122 *0DC5ABAFA18F541357F223E350B70EB5339CE8FB WK1010023
143,615,123 *0DC89989785EA155346682D3FE86568BCB0CDC91 WOODROW.PALACOIS
143,615,124 *0DC6C8B1F45B022EAE0F94D0BBE78E5DA2293CDF 5TUTKIMUSOHJELMISSA
143,615,125 *0DC48A4312E6FB4C39B3A0E3C8F8ECD33960DD57 5UINJM
143,615,126 *0DCF17701180819FECB028312570248551DA248B 649750 beykentUniversitesidilyeterliliksInavI.
143,615,127 *0DCA88A0ED5B789AD9CB8F47126C25FEC689F9C4 6694983F-B493-3267-8D23-A609AFB247D3
143,615,128 *0DC082C0D795F376FAA71039200BD55C34F81C20 66.tie-break
143,615,129 *0DCB21DD9FA566784873FD1C6232BDEC384A1990 6.&.7.IS.....
143,615,130 *0DC1D5712C99E5E71BB2F3D67A1562F28CD5CBCD 6AIRALIVA
143,615,131 *0DCCC9450E7B46E9584622C35D681B4FCE6509EA 6AVORTEUSING
143,615,132 *0DCF3929794BC7DD870185DD1C1B98414F33AA3F 6BLOWMEANDY
143,615,133 *0DC3A904EA79E9C9847792CA7F08B9A404D85ECC 6cardiophobe
143,615,134 *0DCF5C14FE5925D554F2B5765968BB339E7D77CC 6.CHECKING
143,615,135 *0DC933D2F92D9D98AF75C2D1BA6041FA68FF201A 6.DAWUD
143,615,136 *0DCDC952CCB668F941D337131225893D1C36CF2A {X}~~~(======B
143,615,137 *0DCB75A90F7D660278E7AF66324FFB83ECF6A678 }X{ ~` dB
143,615,138 *0DC467130D8CBF462EC7E10CDA7CCC76D06B14A3 XEILINMEI
143,615,139 *0DC7BD6A0B89806A677A7B10A9A52F3169EB4276 XE-RYL
143,615,140 *0DCBABFAA4912C6E621FDF32AEAEA0D5B6029157 xesefdisofgytufkatofmovifbaxux
143,615,141 *0DCB2C0C968F23644B299978DBAD2B14001FBAEF 6NEDLESDAARTNO
143,615,142 *0DCA1580D451A8095013D9582A7D6F7917F08145 6netelig
143,615,143 *0DC3661140E01BA33803EF481E1193BF86F5E394 XMKH
143,615,144 *0DCC7F9960CAD25D488573EE402EE3B794CE4A20 {x}~`@==p
143,615,145 *0DCD567D9D69DF3349EA8A780DE4F37714841687 [email protected]
143,615,146 *0DC5AA22BA1C490A7D27DF2EE7E93186002F7E6E 6Q1W2E34
143,615,147 *0DC98796F0E6E1EDECFFAF04F1F46179EAEFE2CB 6SALBANY
143,615,148 *0DC78FFEA3FB52B29DB24936BF1EA36593B4369E [email protected]
143,615,149 *0DCF334C0500752410AD2B7C8C94FCDB86BE9606 xの思想良心が、入学式において伴奏拒否するという行為と一般に不可分と結びつくとはいえないこと。
143,615,150 *0DC01A7DA47312B99C68D0F8061967BFB2F71660 Y[>
143,615,151 *0DC5605F522769F65DE4C20E495A1F89371AEE87 YALLSTORECOMWWW
143,615,152 *0DC987EB1309C240FC739FCE13C27900D58B510D [email protected]
143,615,153 *0DC24446C8B6FED2F4A8D9D529E8B024B4A5738F 6SPEECHDOGBERT
143,615,154 *0DCEB29A0DD2FAAEA79786C8CE47703032D12108 YAROSLAV KOROLIOV
143,615,155 *0DC9AB8B66F8B457A25ECDE167FDAB7B62C0DFF9 6TANYADEBBIE
143,615,156 *0DC16F36F082EFE9E721D9E88E621801237B14DB YC?N
143,615,157 *0DC86F1E1E919AF96F98544A5669E3B19DFC2D44 6WAHRNEHMBAREM
143,615,158 *0DCA18B9576D07210E141237A4DDA79E74816B3E 7313O1OG35
143,615,159 *0DC8222346CA3C1F2977DAE8B14ADDE42B19C015 7777XFLS
143,615,160 *0DC945E2CF854EB0C22783E78503F40F791CD055 778dominik
143,615,161 *0DCA167010679A93B77F1D8E62962988ADCEBBD7 YINGCASTILLO
143,615,162 *0DC4C91E23CCAD06F1F87166CDFB6BA7BA8F4CB9 [email protected]
143,615,163 *0DC7BE8B29FE50F12325D4F384B2F8A22C20624E [email protected]
143,615,164 *0DC175A34D3187D576AC5611925EDCB0D1668733 YODISETIAWAN
143,615,165 *0DC6B7DBE2097F990AB56ABCAC0A4EACF8F38121 yolandasingson
143,615,166 *0DC9636299B81D54B69009B4B49605EAD9122C7A YOSOLOYO5
143,615,167 *0DC2ECD9A43E2D4A457FDD777966FEEC39A0AE3B 7GARBILLADORNESS
143,615,168 *0DC77E8C1E2190C3B4967BE73FD23FE2CA85EF84 [email protected]
143,615,169 *0DC76D242FAC305DBDA86F8459368FBCF820CE33 yu.hsuen.c
143,615,170 *0DCD07D39963658F3EA97DBBC454C7DC18842CA0 YUKIAGBONTAEN
143,615,171 *0DC6740674D4078EB1F24ED7CEFA3E91BB6ED3BC YUKIE SOTOMA
143,615,172 *0DC294F13E3ED9374F28FE12CE16203C92390DAE YULIATININGSIH
143,615,173 *0DC33704B95688E920B4C7F99706DAD3BDF3D154 7NICOTEENS
143,615,174 *0DC2168BFF17B40E8A8021DEA126F8C5AE6E0498 YVONNE-LETVINCHUCK
143,615,175 *0DCF5A0A9AE0A6C466FD12AA772BA241A922C7B7 7PULPALCOVY
143,615,176 *0DC2CA1FB92372D5E6D69C6B621513C64AE41EAD y`>y
143,615,177 *0DC0FBB79ECB9E7BBEE2AE63583811D034C7818E 7SCARLETMERCEDES
143,615,178 *0DCCAC38E6DC94827EE4569CB51DAC04541CC9F0 ZAPREGNU9
143,615,179 *0DC785C8E8B41C467671042557A796C81E5A7A5B 816848 YOU.WANT.PEOPLE.TO.BELIEVE.IN.YOU..
143,615,180 *0DC9F08E18A9B021EDD297084109B6E9B56A759D 837809 daraufhabeichdiesmalverzichtet
143,615,181 *0DC3BF35F27B1F142A3BB49B377F3511E2EB2707 [email protected]
143,615,182 *0DCB94075B54D8A8B9DB85851BCFB4CF60F1F82C zeilenrand
143,615,183 *0DC9524B74287636F8DB0095E33A45FC4F470FFC 8---B~~~)0(
143,615,184 *0DCDA97E678EA343BCDCE836AA8AE09907FD3CF0 8BEAVERHORSE
143,615,185 *0DC5795DFEFC14FB968026FA07AA26DF40213921 zevenvou6
143,615,186 *0DC2CAE2049AC77D875C5160FCEFEEBE39AFDC25 8BSWLYPBSW
143,615,187 *0DCEB1813C572234DBF9DCC7F557879E889D0622 [email protected]
143,615,188 *0DC1D871C3D74DA77B37673F1ED1AA45D950F684 )8( ~ ~ ~DP
143,615,189 *0DCDEB60CAAAFFD394974ADA95DE40725B653209 [email protected]
143,615,190 *0DC32306856079BBE91DC624A4E5010ED3D5F51A 8JUFHWYOPNEWFFWOQ
143,615,191 *0DCD8109155784FC931717D76381D6ED1F5E0894 ZQ/
143,615,192 *0DC977CAF6BCC1497C897585AD52D95368A80F86 ZSTNDSDGRMMSS
143,615,193 *0DCE478B49D46160591EBDD1EE0C1425289E208C 8OVEREDITV
143,615,194 *0DC84A2E5F8DCF84B5ED391C6D32FCD327041F73 8####p***~0~oo->-<
143,615,195 *0DCA2B74A8A9AD4489FCCB4313CA4F55942D2B92 8PINNOLD
143,615,196 *0DC3C6597346C1E253392EC0442214EEA9D9B2F6 8REFFIDNI
143,615,197 *0DC0F0ECEDC49A80F685D8BAA4D016ABCF844A0E 8RESEARCHDOGGIE
143,615,198 *0DC6095ECD8D9D4F117F6217B52A02142A4B43F7 συνεχείσ
143,615,199 *0DCF396BC44879131E979A12EC3FDA48CC081F66 8VRLRDSHP
143,615,200 *0DC321DA9E97C94690DFD15D822A7BA77D97DFDD АРТАБАНУС
143,615,201 *0DC64B2188CDB8ACE2C618B97B4397DB0C02608C 93O5YNC1!N41
143,615,202 *0DCA72A67A10973B791B6379C6214B06411DF2C4 ДАРАДОНКИ
143,615,203 *0DC9BD7CDD61D7DBBC9B178409505C5FB84A9024 ДЕРЖАЧЫ
143,615,204 *0DC16A4A5C284B99419A9D763C51D06FD6C6475A захапный
143,615,205 *0DC0DC16B3556DD5B03056D46F68936AF4BB7BDF ЗГИНАЛЬНУ
143,615,206 *0DCDFA0B4A1C3D0E3540E8BD117B46D6C7992BC7 КАЧАНИЧКИ
143,615,207 *0DCD27FB8F3278C7F64D47A7FB0C5732F505BD40 макколл»
143,615,208 *0DC99262B5C598E70C231B510D93A1D80A4374E9 9HORIZONPOPCORN
143,615,209 *0DCFBE53D124812D299611296ECACFB77F326CE6 ПЕРЕВАЛАХ»
143,615,210 *0DCBE5543F0EDE364D9017A2AF1C3CF0424435C8 9INCOMPTENCE
143,615,211 *0DC6E2ED5EE77D931F88F349BE70F215543B057E 9INHALAD
143,615,212 *0DC8DF53696305CDE81238530079E354E96B1166 ПРЕДПРЕДПОСЛЕДНЕЕ
143,615,213 *0DCE4BAC46AB3BBFD9A043858FCBB564D186A2B5 САЛЕМАН
143,615,214 *0DC7C4A7A847BA5AD9CBEBE4CF12E3E592EEA129 9NIRBLYKWKVG
143,615,215 *0DCDCD368D0DBA8EA8647A033A3715C7F4A1357A 9NOITASINOGATNA
143,615,216 *0DC6BEBA419E8CBB4FB3F145BD1650FDCA09D20E УНЬ
143,615,217 *0DC94C641B2EB3C31F6DC977480AFC485B0E488F харавон
143,615,218 *0DC42E9898F0C4DF96E0A5D4B3A1F9F331F76CCB 9ROBESRT
143,615,219 *0DC7C782A9305F541DE094C3C42EBC78BDA06787 чоймаа
143,615,220 *0DC0A80DE7E238E9A973B1D7C4A785669892F288 9SECTECBSW
143,615,221 *0DCBEA399CE77A178B6183E94121A95F8407FA77 9SIMPLEBRAZIL
143,615,222 *0DC6AE6B6CF14D8A10D1AFC44F938E92D61DABF3 ՄԵՏԱՂԱԳՈՐԾՒԹԻՒՆ
143,615,223 *0DC8F2E91544E4EA15533DEDF015D3E8A565C58C 9TARACUM
143,615,224 *0DCC5810E2351838801E31C8BA5FFC78671AB8AC 9thatgordon1
143,615,225 *0DC4718DF28416142EEF8597B583DCC5209BD100 9x系の場合、msdos
143,615,226 *0DCF65077DCE17FC212D5777DAE4543DD01F1462 a1rp
143,615,227 *0DC44660DCC22453EDE33D93FD19D11D50F18BAC a4od
143,615,228 *0DCFDF5DAE9DBBE72F7A7C097E8C1DAE941CD22A A4Q:%
143,615,229 *0DCA4C792F62849E2F22837C6B1E3CF87265B7E9 日本鉄道PT3
143,615,230 *0DC349CDD11036B6AC600D92B994BA50668BDAD7 a+8jp
143,615,231 *0DCB3B9B3EDFC0633C150060AA7245FD7A3ED944 aa4ov
143,615,232 *0DC1E54EACA908CDC549A2E75FFD60799BE8A4D1 aaa/kn
143,615,233 *0DC050D92A3DEF20FB0414698D29B1EC9B805A56 AACG#
143,615,234 *0DCF09FBBB1D284B2EFD1ADAFDF89BC282BCA2C7 aa&e1
143,615,235 *0DC63391B432B0D1C437571BEE98EFDC70EDE816 AARW|
143,615,236 *0DC634C9968BA41DB63ECD7FA6D47219D441C797 AB99K
143,615,237 *0DC047D0CFDB59D514F7B2E03D9655D50558B149 ABARCARAM8
143,615,238 *0DC7C334E8B89BA97131D9824D82BE6E754BCB30 abe+6
143,615,239 *0DC2339C4D3116C064C3993646DC5BF692077911 ABJD9
143,615,240 *0DC010BBFF7E649D9FC6C3AD4E402A75655B7DB3 ABL3N3
143,615,241 *0DC25345D7EA0148B4C54B7F1BED43242B836D2D ACC555
143,615,242 *0DCF40BB9A7F3775E8B75B26E9E3E4CA86BFC690 ACCOMPLI
143,615,243 *0DC6BA8A034A4C283FF32334A3840197244244BB acl&h
143,615,244 *0DCF6D96FF61B2562CA38D9F0DFBAF6AD7B491F3 ac?p(
143,615,245 *0DCF1478A020EC47A72681633D7EBDD6FE0CB909 ADHD+
143,615,246 *0DCC7E2D39FD775E17464F63C26E9E2B06BE1D7A ad]p
143,615,247 *0DC50EF563633331A4E37CC90AFD2A4ED6878A62 aehlisa4
143,615,248 *0DCE931CB49AE2103F86EA5AEB6B50FA095470E0 aetib
143,615,249 *0DC6EA5EDD2488322D33AD89047A83541123971E A-fG
143,615,250 *0DCB3ADD9234C734DDB30A9CD0FFD0E71EE3D84B AF$W#
143,615,251 *0DC30B4742FCFEA291E1508BC0B578BCD1D71D24 AG0D7
143,615,252 *0DC27C54B24C486F78D68017695FDF31A4252EC2 AGA7I
143,615,253 *0DCD60AA59C8C694656A48B46750374F87768CDC agb,o
143,615,254 *0DCF4ABA9B35B17F0A3E09423407C7635313B3B8 013ALVIN
143,615,255 *0DCBBE05A53A2A4ABCC464DDCC27917A8A5BF28D agidelna9
143,615,256 *0DC6CEE40457D377A1B20E173C022D9E6BD97845 AgVC
143,615,257 *0DC48788A821FD277695CCDB4A9BFD28D558C3C6 AGW0N
143,615,258 *0DC54DEF30C8FB3AA54322CFB9AA990996969F0B agy+t
143,615,259 *0DC12E3AF3359BD5109E2F335DBA02D2310D77A1 [email protected]
143,615,260 *0DC375975C19D0950B994E1B0EBE5466F38F2364 AHMAD.ROADARMEL
143,615,261 *0DC7B89F5B35B3059F2A7B633E71B1AEEA502A38 AIKKENSA3
143,615,262 *0DCA2154BCF51C7520F36AD010826748A139BABF 099371C82F2879B5DD5F010A31834DE1LARUSO
143,615,263 *0DC655FD379EFD5AD685FF123E6DE105D1DCE40F 0CN9
143,615,264 *0DC6807ECC2964E15CE3132A0BEFB286F7684019 0ilovespace3
143,615,265 *0DCEED8CEBE716C84A5904B8F1E71AB9EF799587 <0+MX
143,615,266 *0DC64A025C5811BE646DA3EDD7FC96D4CC2B2A1A AILEPAAKING
143,615,267 *0DC977D4F30EDE1C2F2494B9E44AE8A4D41303C9 )0(~ ~(=====Q
143,615,268 *0DC9C609B1D6C17C4EF03BECF441BD4950A2DD58 aionoxid
143,615,269 *0DC4595F791F1D5D0042644BAD71620938282AE7 1003084 no any way , n
143,615,270 *0DC8F1222F634820F0D7F64744484095BAA0B766 AJIUA
143,615,271 *0DCAA922B776854D10AE51E702DE53BB6148930D 11111792
143,615,272 *0DCCC0F308212FD97577CC61FEEE34ADBA6EA604 1135496 ES-GING-FUER-200-000-MARK-NACH-AMERIKA-
143,615,273 *0DC80CDDA1ABE60AD4D5A36C8FBE707F6CD4CAA3 akrs6
143,615,274 *0DCF139779A9C36C714A3274F9798CA99778E368 122DAYAMI
143,615,275 *0DC58F4149C8983AA3424559878192C3CB59180A ALDOKEELAN
143,615,276 *0DCB015FFCF7991A447528A721F5EA402D687136 alechanebutt
143,615,277 *0DCD98462C28A84FFCA8464925A3D8E9014B0CA5 [email protected]
143,615,278 *0DCB826592E2A870D0BCD0FDDFCC3A2E917AB81C ALEX.NDETO
143,615,279 *0DC9568E44A7786F608236C142B014DB91AB74EA ALFONZOSCHECHINGER
143,615,280 *0DCABAB73697BC9E032574C4198FB5807E9D0412 ALFREDCAVIN
143,615,281 *0DCDFA1E7DE8E0DF642C5FC40D2770B1804ED6D0 alina-duenas
143,615,282 *0DCC8468F6C8F39C8AE5837C425F2B530A569F38 ALLEYEZONME(VERSIONI)
143,615,283 *0DC1FD1B67B6E23F7ED11A771E0BD930267D1B34 ALONSO.JASTREBSKI
143,615,284 *0DC138C49C299AA8179F98D4A92195A5FBD4BEA7 16HUMANZ04
143,615,285 *0DC7097B3CA04B94F8C276297D7C77F36DD9DE86 16-jung
143,615,286 *0DC81C48B885A356FA4BD3DE877D09814FD96F35 1876905 kj toteaa , ett
143,615,287 *0DC9D48668839776CF2BCF6799BC8BB5DF4B6A8B 1932461 TAPAAMISIA-TULLAAN-TOTEUTTAMAAN-MYUOS-VASTAISUUDESSA-
143,615,288 *0DCA8C48D71EF823C45D1B09100AF5337E555AD2 1 BERGSTEIGERBEDARFSBOUTIQUE
143,615,289 *0DC3630E679BC0BDE2E8E1B5DF44CFA46311BFD0 AMETS.TXURRUKA
143,615,290 *0DCC86BF23715DD4DBDAD785ECA4E38718FA07A3 AMINFORM
143,615,291 *0DC782CE369759B8DAF9003A0D830F0DEC1265B3 1.ER
143,615,292 *0DC4A9F5A4F78C68EB413B9728FF94129B137769 AMOSEMIG
143,615,293 *0DC4E9C2335DC16CD1B99725FB2C8167A04E4C37 amretsew4
143,615,294 *0DC2A4C35FEC071F841AAC91B6E3471FA3DBB482 1-fluessigklebstoff
143,615,295 *0DC9B42637E1748D9757D2C78E187807D5663076 1.geroechel
143,615,296 *0DC721E6053ECE70190FCB924D8E2F26301F1471 1IAMSTANLEY4
143,615,297 *0DC5B6EF9FEAD4B8766F1AE63D9448699BDF0F9F 1 ILMOITUSSIHTEERILT
143,615,298 *0DC09C830B68C31655C22D58E7D36E161FD2643B 1KETJUV
143,615,299 *0DC47EC4A8DF2E4183A566AA0E4C6BCFA729F4B5 1-KOMPONISTEN-URENKELIN
143,615,300 *0DC169145302C85B60B0759FC26620C320FDB8A7 1kuvaaukeamista
143,615,301 *0DC6CF284C7723EB47C8661089A92BDDBB49F7FC 1 LET-IT-ALL-OUT
143,615,302 *0DC139CD77562414F07A8A3C0FDC3F476D4FF0CA 1-MOUSEYI
143,615,303 *0DC7532BF6591A695D99FC42886B3597E78BD1DD ANDRI-NEL
143,615,304 *0DC0ED7BF5BBC90A2B0E4FE67316FFABA0C6E10D 1.PAULI-SPIELEN
143,615,305 *0DC37DB090E44FF2378B1450F11B3AE3F2F14936 1POLIKLINIKOITA
143,615,306 *0DC533F4AF1474F78385E2F434425B307DC576D0 1.RUSEA
143,615,307 *0DC2A25CCAB3BF3D68934EADD8D168C9935AF136 1.semizorova
143,615,308 *0DCF617BD7A4497B15B0A34365263520AE1E542C 1.sensibilitaetstraining
143,615,309 *0DCC10CAE04D43C817823AEB178FD582F60C2DF7 1-SMALL-ARENA
143,615,310 *0DCB2F46257CE950CF719780898F49E360FC6963 1tarvontiell
143,615,311 *0DCE750165FFBC6311CE4E6D9C9E2613E4BDE310 1.TEHT
143,615,312 *0DC83D3876F09ADE52315892CB60B5E7B1A6383A ANSPORT0
143,615,313 *0DC2BF9CD2E0EB009F603BC2CDBFFCFA31CA41AC ANTHONYKESO
143,615,314 *0DCF7BC5CD1469954C50E0091EC05D13A1332D0A 1 VIKINGSALLY
143,615,315 *0DCD820FAC415BD09DE4F8C9CBA2D157359D56BB ANW7E
143,615,316 *0DC047BE1135B22628F0B699D74C317E05B58F93 ao7lq
143,615,317 *0DC9862B0742F2F7587C58805B873A9E7C4987F8 AO?+F
143,615,318 *0DC70F281FCC3C061EAAAB2FB84AB683A0F54E24 apexnet7
143,615,319 *0DCF6A7F6BFA7DD417405CC508AD5FD6AA10177E apmrom
143,615,320 *0DC1E652C50BC5472ACB5BE9D6AD997F08024DC6 APOPLASMODIAL0
143,615,321 *0DC274BEBADBDF06CAD787172997A5BBF52B22B7 20PYXIDATA
143,615,322 *0DC15A5EFE8DC28783ABAD562C9C481A80FE6123 aq0_
143,615,323 *0DC9D009E91DA1AE83F19F018B6B164DE7E0B2AB AQAWA
143,615,324 *0DC7EB80E2D1AC450643E1FAAA3098155A8EFB20 2202533 MOTHER:TIINAAHOLA(B.FINLAND).
143,615,325 *0DCFF02332040E9DB810CE6168090034931B629B AQ(F,
143,615,326 *0DCE9654DBC762B51B21682F1AB510EF293C7D5C 22BIS
143,615,327 *0DCFA0C9241BF7DFE763FD2D6CBF1DE7C26D01AE AR8FA
143,615,328 *0DC41AC73FF5292A490730CFE38B4AD9FAC99D4A areas"</p
143,615,329 *0DC9E2D7321A62D4685CB25C912C973F92B9ED65 aredez
143,615,330 *0DCDE11D4514AB4919363B669C38656F4AC8DB69 aren1
143,615,331 *0DC86B31381D37E85A5A73D963EB2D450A27C11B [email protected]
143,615,332 *0DC6BC417A2FDE99ED4DB1B4B6B805792FD4785B ARGIBSWED
143,615,333 *0DC8CED9E5330D6B7BB25D84FF53FFC704D41971 ARIAMENÉS
143,615,334 *0DC44140211333B5BB73729EF77A7903DC0F4183 2529978 TUNNELMA.OLI.KYL
143,615,335 *0DC4CF0466E46F9E69FA259E2EC68C22CC2BF168 ARMANDOSTENT
143,615,336 *0DCB1621BF6186BABBDF10BF643240F559627ABF ARMORY.
143,615,337 *0DCCB0FC7FC3BED405663E91210BEDBB7AEC632E a(_rn
143,615,338 *0DCED1F8FEF88DCDCD206DE625AE4E414A9BD326 arretions
143,615,339 *0DC76C898F737216F791BA4BF7B602157106B974 2805376 der-gruene-ist-ein-kreuzberger-.
143,615,340 *0DC92C1D9D5CFD408ED0319A9BD850D9EAFE6123 ARTHURSUMMARELL
143,615,341 *0DC000173596CC5F664F6BB4D99654144AE361F8 ARTISTAUTHOR
143,615,342 *0DCD3B37EED4F5C4260EAA2621239C5F7B8F6C35 2937670 DER DFB IST EIN GROSSER DAMPFER
143,615,343 *0DCBF822CD4A0489BEB514A03F848CA3FBAD1F66 2CHIRRACAS
143,615,344 *0DC6E28E21948660F09B9FE57AB2199FA0792DBD ask6e
143,615,345 *0DCE86DD0C95540DD8E0761FBC01B71FAB1F254E 2EIGOLIRT
143,615,346 *0DC081460F8E458D9369755D559FAA9F263D050F 2 GEWERBEBEWILLIGUNG
143,615,347 *0DC7BE5B5C7DC5FE3F1F439CB895F23E632FA96A atifshirazi
143,615,348 *0DCAA7C016DA3F6BFB444D7761B4B7E070FCAEBC 2MYPLAY9
143,615,349 *0DC9DA08FF199B6EB2505F43196C7538D7365EE5 atobarai1
143,615,350 *0DCCE7686F4E56BA4ECABCED10A50ED168BA46D2 2.RANKPFLANZEN
143,615,351 *0DCAD371CD98796ED0F90E51643E49ABC79E0F7F AUGUSTUS182
143,615,352 *0DC44F22EA8538C0533BD0429C51E4E8ABA3FB6C AUTODYNESES
143,615,353 *0DCAB84FB1F15177A9BB0D7F11D412DD6918C106 2WISSOCKI
143,615,354 *0DC8FA4732328E9595E613E90E2CCB7473C219C5 2WRIMANSH
143,615,355 *0DC613910038D0DFC110F4AA38B9C607C0E11162 2YESTEDAY
143,615,356 *0DCDAAE400769A6C8BFA5D66BF5372783A58FCA3 a)vk#
143,615,357 *0DC16F0FCA8261F9A176012D9F2278DAAE23339D AVL:O
143,615,358 *0DCFCC523F5779736AB9E76A4E1D2B0498662851 AVUYS
143,615,359 *0DCF042FEC71B7967968E18D7D2AC65E4C4458E2 avvinanos
143,615,360 *0DC9BCCBF40225DC48785A8833B4903B56E94E0A AWo=
143,615,361 *0DCB361590CA2B902BD6A25222659C3AEABA4D82 3AMMEREND
143,615,362 *0DC2EE8A27A4619A1A5EABCD4AB03619C1EEA72D 3=b~0~o(>_0)
143,615,363 *0DCE266BD35CAAACB297677D778DEDD00077E183 3B<--~-~-~(#####3
143,615,364 *0DC7B6DC305F7EE7D56DF5669B2F78241C17D5F9 AYNNK
143,615,365 *0DCF63886FE424DAA4E84F413CDE94EA8C9DB4F5 aza)e
143,615,366 *0DC70FB419FAB1CB474A3E95FFA3614CF9658E5B 3FFZXV9R
143,615,367 *0DC1B84F82D09BB92A22D0E22594286DC909CCF1 3 GUETERAUFKOMMEN
143,615,368 *0DC17FF92571BA21C196BCBDF059FDAF352EE7AA >B0 * *qB
143,615,369 *0DC8866307BF0E465F7FCB850AEFA3D63D245700 b0wyk
143,615,370 *0DC4DCE00CCF0F32DC5E8AF6FB215A85E1BDA70C 3) ~ ~ ~ :P
143,615,371 *0DC93F39C2528C4C635E4B4FE405149D3576879A 3====P-*splat
143,615,372 *0DC01D9DEC29C6911800268D5EF3068AFE415C7D b6kmotoroptimering
143,615,373 *0DCBAEA102BAFD5BE4703C42F4AC381E26A4D94F b7;lg
143,615,374 *0DCF853D644A2A204A9323621DBB5126D2990388 3-worcester
143,615,375 *0DC7832BAFC9E14EF1F52AD4594D51BC52C33385 b8lv
143,615,376 *0DC5276803220E688AAEBE77A9457124468934F0 4071136
143,615,377 *0DC118CAB3D02CD170B1019959DBAABD47BB2C99 B(9BW
143,615,378 *0DC61575EA042489D1B35620495BF329EB3C284A [email protected]
143,615,379 *0DC60CA36BB7EE82D57A8A217C63F656A9F4299F 432CONNOR
143,615,380 *0DC1D298BD718D07AF9D1A2476C24EDAE489C4C9 445490 kyseinen.aika.on.mit
143,615,381 *0DC234F8FEAA74DF5118B13E174526CE30BB52FC 451543 BIS 14.6 . , DI . SA .
143,615,382 *0DC68F83611902563A0FD942420A36C51B25FBF2 badewasserfarben
143,615,383 *0DCE63370AF9E2F5E630989DAA176914B356C2DB BADOUINA
143,615,384 *0DC38F19EFFA580AF451C4CDD53B5C0AF4F251FA baitadi
143,615,385 *0DCC3B4323EBEE18C3E2E9C7421273ADD6FAE9EC BALENTINA'S
143,615,386 *0DCE4990F11DD564598C0335559D1C47A8618A20 bardboy8
143,615,387 *0DCCC338A57D037C9FDC7DBB1B2CD45CEA0ECB3C 4JOJOLJF
143,615,388 *0DCB64DFD355269EF751B6C35CE70C41BA2A6818 bartkakowski
143,615,389 *0DC4149C3C9AD2163DD7E124511048846DE0BC1E BASIL.YARD
143,615,390 *0DCA9DB7810D9B4DF9B9492C89F4BC568866C835 4LNEKNILB
143,615,391 *0DC34531B9046C0CD766511978B90B0EC7E9A59D 4MAIGNIE
143,615,392 *0DC2F03D7BE894718E525C9AACA2B1639534BA14 4NDVPEIJVOPT
143,615,393 *0DCADA85C30E1376AE1C1C27FC3C90255C35E1EC BBGEZ
143,615,394 *0DCFA47A59B7B208969DD9D34810A72640DEA9DB 4-PALAUTUMAN
143,615,395 *0DCB8E70265689693FC35CE6B2CBF43BEED40166 4PHENE
143,615,396 *0DCFDAF4A889675B6638FB2B056373B1B5194880 4PSEUDOSITE
143,615,397 *0DCFF36F081F01B822C61058992BD934BC7784AD bbzn
143,615,398 *0DC02A02F37791C16CB54BE2FA2F6B45CFC9B0EF 4SCHUSSLINIE
143,615,399 *0DC357BF532C6562A9C84EF7C036A350910BC699 BCDDB
143,615,400 *0DCE49FC1D698D3A485FAB60C259684ED0B93F04 BCG9A
143,615,401 *0DC024F172E06E776124AF244AF8122AAB94D339 B(CL0
143,615,402 *0DC368BD7C43DCEE6205B633641619F679A2061E bct1f
143,615,403 *0DCDB6409D3DC748CFA7734C684E0E7AAA742E71 4VICEAMMIRAGLIO
143,615,404 *0DC794EF059193884B346A564C5373756C621635 4ZOLT
143,615,405 *0DCDBF4C8DAF92D9A4D5EAFE268519ACCF70412E 533REBECCA
143,615,406 *0DC718BE52D73C7C7EFF8A1D75F647E207BA26AA 582LKJHGF
143,615,407 *0DC00B23EC78E04C3D5855CF7037590E2270AE9B BEBLEEDS7
143,615,408 *0DC4FA1B49BFAD4D88D34901FADB78D73D4C1EEB BEGTM
143,615,409 *0DCE12811AF1757952AA1668C8F693D20A03FBA3 5FUTURESALUT
143,615,410 *0DC78EE2263C9068EF08A7BF1CD68F52F477D1F6 BENJAMINTOVER
143,615,411 *0DC33BAD2D17857663CF215A0D8755360BCE9356 beop6
143,615,412 *0DCCF4D3C0CDCFAD3FC9C1458F340EC59A2E7D14 5J2M9PY4Z
143,615,413 *0DC787C5116BBAF09E91AE5DC1B46DE2270461D1 bernardlaundree
143,615,414 *0DCEB886E631C5C623C1E21D4C0F15844D251716 5NSEETJES
143,615,415 *0DC529E967C05AFA2E909E4F3AB4812775329BF9 5PATCHESORANGES
143,615,416 *0DCC02B281DA3EF1E4FD73B9725AAE6E85576AA7 bh.9#
143,615,417 *0DC2D0CE3C1C0A59830E3E66212EBF035D2F934D BILLYABBS
143,615,418 *0DC71C5FA8F2A3B071E4FDB075E71480164B38D2 bim&e
143,615,419 *0DCEB5F384D6425D97CA59F72A1062D05362EB8A b&ip5
143,615,420 *0DC606AB667645B3D754BB39B53D7FF187884F26 649AZ
143,615,421 *0DC8DBA60A1064403971C00A230ECDDD3863524A bj4d
143,615,422 *0DC4045732CEBF83ECA5F12D2CC94E58DD7283BA 677535 YUMRUKLARINISIKTIGINIGORMUSTUM
143,615,423 *0DC874C8CD88599B71E28D0BA2C918B46986EF8D bj-j+
143,615,424 *0DC2B31E2D1E01F87B097AF96A630F52DA762DC5 B")K;
143,615,425 *0DC5A4D5B4B4D729D31A4AF2FD6DBF143EFF0DDC 6CHRYSISES
143,615,426 *0DC1120A2198F2265735170AD6F9A6002D5DAC0A BLAKEPALMER
143,615,427 *0DC1A7198A524DAB87EF37BEE919B853DA8A86E6 6CYCLONESNAKE
143,615,428 *0DC9A962D91FFE28C538DC3435D53FD67DF4810A 6DIANETAMMY
143,615,429 *0DC0C7ECCDBC43F13DDE73560B1FBEA447196C8A BLINDS37
143,615,430 *0DC237A1323F3F8FBC513F9E7D3D6A5AF97E028D blip$
143,615,431 *0DC8DCA76DAACB2A2C7D7D6A9B9795249C1BAF6C BLKWCHTR1
143,615,432 *0DC907A4AF0A1A85C21CC18BCA39CB5463D8993A BLUDEMON0
143,615,433 *0DCAF9652A8AFEA40E3565650A6138CD85DBC35F 6EREMMEUK
143,615,434 *0DCFDBC574AEC7846C50E8F3CDFA9A156CFC42ED 6ERENRODA
143,615,435 *0DCBA8887176743215B55272A691DD7F92FEA675 6FAYETTEBSW
143,615,436 *0DC36C1229D86635B0BC406CE0D312A62802136F B(MF_
143,615,437 *0DC10C345A1F4E38599C66C9574C9C6F7B2C7F99 6IAMTRAPPER7
143,615,438 *0DCB15F36E736A98C36221F9B2601CA17B4F45BC 6JEANNEPAULA
143,615,439 *0DC8B83285145A880E1EE0EAEDF2DEEAE8AC5C3E BMTW6
143,615,440 *0DC1729136A22E9BAB7C126E987EC7E359B6381B BN126BQ
143,615,441 *0DC9EE6841BD9271EB4E7E2A94C055CB1046636F BN7W1
143,615,442 *0DC8424DA3B3EC38C07E72BFACC3884F6D90FC0A BNM=
143,615,443 *0DC4FED955F7BE3E28170F4E86E667D015874288 B#>)O(
143,615,444 *0DC261DEEFC20B1B73387B4774C0549282B06565 [email protected]
143,615,445 *0DC076321177C4B24A95A63742612F73511BD4F3 BOBBIECUTHER
143,615,446 *0DC8F0709DC1F665BA7261EDEBF70DA3116CA7DC BOB-GORD
143,615,447 *0DC6D11DF22F94A1288EA1CC11D85F8B873CE991 BOGGINGLY0
143,615,448 *0DCA430D8B5E35540B55C9B69F6E85E50B17314E bogladepris
143,615,449 *0DC9FF92463D1A31DE315784A07FD90262879ED6 6MIKEADVIL
143,615,450 *0DCA7971615C2CCA0DB96B8960659C8855157C5F BOLT_MAKER.B/OU/LT_'M/EI/K/@/R
143,615,451 *0DCEC3594C06D8D9B08AD4EF5465D99F0537E33D 6OHMSLEEHMPSBAT
143,615,452 *0DCC0301714CB5E7B2DACEA125E89A0B58D219C9 bopo;
143,615,453 *0DC853F4F5D06E7D0D4D1F9D3901601B2F05A4E0 BORGHES7
143,615,454 *0DCC8BF20D30CA79EB78806DCBBE672FF0639836 6REICHOW
143,615,455 *0DC4788A3E2D40C169F7D3A585B6A57BB09F320D BOTANICGARDENTOYAMA
143,615,456 *0DC07D5CD19AB52E0591D2DFF6C858827EFB80F6 boycewands
143,615,457 *0DC19064CD5598361FA5F59535DD9E8755BB9873 6STEUERKNUPPELSPANNUNGEN
143,615,458 *0DC3C2FB8DF26DAAB4DB7BCDCB97B0499D131171 6THRETENITH
143,615,459 *0DC751E9E34ED80B4E5A4DB9FAD949A98CFA5685 bproo
143,615,460 *0DCE250F3518C6534E4B6AE06D53B1E348976B57 BQFV
143,615,461 *0DC655ED180246D65F82093CF7C52E053A43A6E9 6ZEIVIRCSNART
143,615,462 *0DCBC08A4BE8F64F6257478752E2F6F888806C61 6ZEUSSONICS
143,615,463 *0DCC3F6763103B42BA839F832D9E7C9CECE8A4F5 72shuffled
143,615,464 *0DC57FDEC78DB5B84E2A5C5F10D8F57AB45D2AF7 744506 oyle gordum .
143,615,465 *0DC5ADBD43C2A1CE34FC853A0AE6D36EC26C1BCE BRADFORDZECHIEL
143,615,466 *0DC2E0E062DFAA6E71DE0C9CAC2BBA0F7CB23CDC 779767 DENIZ-TOKER-MUGLA-U-.-3-.
143,615,467 *0DCF8A0F5C838FC8CEDD7A97A4D821192C6A2CF0 BRADLYPATMORE
143,615,468 *0DC61D5A8FFF1FE22BE98F2F851F177068BF3E68 BRANDONKAROW
143,615,469 *0DC3F0600408F48F41BE26ADF5C69896DCEBC516 brantromon
143,615,470 *0DC113E30B49601A0CE63BEE127056ED5079AB95 BRATHOLM2
143,615,471 *0DCA82C13607B170F79E81FC162EE036558B6D72 7AEGONBSW
143,615,472 *0DC23EDECB305FE8E24A3B735AD63683ACD96933 brbxp
143,615,473 *0DCA207AF72F394C35AB5990D9FFB0BA345882B2 [email protected]
143,615,474 *0DCEEF6B1C4CEB84B161241A7858D46A1A38A803 7BIBLIOGRAPEIICAL
143,615,475 *0DCBE9BCF8AB192DE6BFC7D7BA9D7083EA05DC3E 7BILLFIRST
143,615,476 *0DC5200284DE70BE698D774123E3EF9CF8D3173A brentt-johnson
143,615,477 *0DC066AEFFA1B7511124949177895F57E249556B brescia.leonessa.nuoto
143,615,478 *0DC944403E5AB09AB3958C1034A0F4302DF1E9C3 7BSWSIFAKISBSW
143,615,479 *0DCA63BD2A4F07539BE39CFBC9B2A80808DBA6C5 brettplane
143,615,480 *0DCC2E455591FF2D6412017A26B09DA7BF96D6BE 7BSWYPSIWBSW
143,615,481 *0DCC9F62970B300AF150E0665A5833BBAD74F875 BRF;B
143,615,482 *0DC1323474080E537338231A635B9418C7E312A7 BRIAN.CARSTENS
143,615,483 *0DCA1C12A3B2C38C3826D46DF5D1AFE6EA2E62B0 b$rm
143,615,484 *0DCCB6A4333FCC84DF590AEC283B1336CDD20E97 [email protected]
143,615,485 *0DCE52D924F43AC477D09A3A11028476CEC4CA29 7DOODSKRETENS
143,615,486 *0DC1EDC2EA468CC247905FA5B624DBC3EC4A8CD3 BRUNO.KAILIPONI
143,615,487 *0DCD1534EBA88DC5087E88280A7CB1A14112EC3B 7FREMDLIN
143,615,488 *0DC69923274371DFBD4AA485A5D16FA0DE71F851 bsbgl
143,615,489 *0DCF73255CA03C761ABF81B7F6FBA3B64FCFCED9 bslc2
143,615,490 *0DCB1AF9D9D05AC920D9E862FB104BF3FC0781DC bswij
143,615,491 *0DC74DBD4EFBCE98DD9D74524F24767C04162852 bswsweneybsw
143,615,492 *0DC72EF98A598A79FEA74BC4826AFD7DE95012AD bthe
143,615,493 *0DC13326B09E06C2CF78825BEC919F500B44DCF2 7RNPLIKTSFLYGET
143,615,494 *0DC90A347234F14C998241FAEDB8097D7BDED1B5 7ROUNDEDLY
143,615,495 *0DC44A3DCD055E431BF76249D0060EBEB1A7EA64 [email protected]
143,615,496 *0DCC19BD323528A5FE7BC99E94B78ABD7E2556A2 BUDMIAZGA
143,615,497 *0DCCACD3CCC9D7A328CF538AA5B5B9499A84B737 burro.'b/[@]/r/ou/
143,615,498 *0DC4D85557475A30C54210F9834030B4BD48201A [email protected]
143,615,499 *0DCFF23F21BADF880A02CB9FA55DD1677A15E7BA B"V2T
143,615,500 *0DCAC4DC0733377D770493942F257FF2FC412184 bvasw
143,615,501 *0DC018C44656BA1FA1734D9BD1C02D8CDD9490AB BWAQP
143,615,502 *0DC70D24C1956525DF05101EC60FFD8841484FDD BWRE8
143,615,503 *0DCFD4352D26A4F776B0F22A9673F1BAD65A133F BWUIU
143,615,504 *0DC0F51B8F6D8269584EF88B5BCE663A0E3473C7 7ZUSAMMENHAUENDEN
143,615,505 *0DC9AD9A5B849235312CBDB9E98724AA990413EE BZVN#
143,615,506 *0DCE15517D8673FD1EEC2E7FDEB40ACE644017B3 c.-
143,615,507 *0DC4079BEE88F07FBDC0A7D830B43D907AB3C697 C0JD
143,615,508 *0DC77B03D2FC8BFDAC3AF41681E566219F49E773 C4/IU
143,615,509 *0DC9B5D6B4769BDD69FF1649353812EC788A58F4 c4rh%
143,615,510 *0DC6AD022BFBE2020CCA3B5BC40D19B5E3E930A3 C5!NX
143,615,511 *0DCF5010C8CF86BD2B2C543EF67BEE11E7A2B163 C8vN
143,615,512 *0DC79F653899757F906B831079EEECB43C5C0E77 [email protected]
143,615,513 *0DCCAAF6BF184C04350CA5C2A18C2EE310C9179A 8BITCHVERMONT
143,615,514 *0DCA6852E246B2B635381C5C37521F9155A6EC02 CAREYTOPPIN
143,615,515 *0DC3621565FA18B1A5A4951ABEEA4C3000992607 [email protected]
143,615,516 *0DCED55B1238CA8B4D6858039F8F2B79144D020B [email protected]
143,615,517 *0DCB0A0B7F73F9178200C3F05902C8AFEDF09159 8d~0~osplat!!
143,615,518 *0DC0F14DA309EBB44CEF07291B1BB3059B6FF6BA 8DESTINABAS
143,615,519 *0DC55D71245AB9B7FEE4BCC5B967B23FA1E1B8C2 8JAEAEHALLISSAKIN
143,615,520 *0DC30255A7E61EE968679174FF4494A75E5783C6 8JOSEPHCREATIVE
143,615,521 *0DCF2950130383642F36DBFFA587DC24D977FE13 CATEGORYSWITCHFOOT_A
143,615,522 *0DC4F41132D52298589ACAB0F824D0F0310D78E6 CAULANIA
143,615,523 *0DC679DCE021C588AE12DE8DEA8A371FB0C7F403 cay)(
143,615,524 *0DCCDA9A9F2D2D0CDF38F79ED3A4EEA7BDDB9471 c.az:
143,615,525 *0DC1CF86F343A641420A7242AC4648C359AF0148 CBORRANI
143,615,526 *0DC1A6D615439CEC5114CD697A5298525AD33F3A c?bz9
143,615,527 *0DC483EFBE80FFBF4F3958BADFE9AED4FE08305B CC2WH
143,615,528 *0DC74BADCC3656D2782286E25D9846263D514070 CCDW
143,615,529 *0DC9C4E1B5614A7D47AD01C61D0662EFB852595B cclltlies
143,615,530 *0DC9813ADF4D28E521363D5612399B59D1773DEB CC;SN
143,615,531 *0DCA08518F48AFE2C7080291EAF66AB84DE157EF 8==p`(><)
143,615,532 *0DCF48B9EB9C48EEC12B6DABB5D545464922D431 CD4T6
143,615,533 *0DCD9742AE46E8001E6F9B255CB740FA9B6651CD 8PFERDESTAPFEN
143,615,534 *0DC4F63B26163901989CB0BA503F2154F3BA7727 8PHILJAN
143,615,535 *0DC4C2B8669745E56CE07F337182F78F2DA96C9D CD=A(
143,615,536 *0DC755E5FB4F6B95F354B53889F782B92C0DD4A2 8PRJKTRTN
143,615,537 *0DC8D6FB86CBD8AFAF415831D96EFFF6CAD93175 8PROFFERYNG
143,615,538 *0DC1613789B93CBF3CF6565F25C3BC691C765D13 CD$o
143,615,539 *0DCD9706F1057B509907911B4263B118686E6DD6 C:\Documents.and.Settings\FireXware\Local.Settings\Application.Data\Microsoft\Windows.Live.Contacts\{9b54adaa-4a0d-48da-af7c-f687ee7477e9}\DBStore\contacts.pat
143,615,540 *0DCB3EE09B60EF73380F065E5EAE43404E2A403B 8RVISANT
143,615,541 *0DC168B377F279591AE7DC38D59B3C3AE4D454CB CECIICECED
143,615,542 *0DCD1DC712F6854B4973E915987F16A8FA7F7BF7 8SSENCIFI
143,615,543 *0DCDFF7497A852A2A81CFF828AEAFD5D00FFC6B4 CEQNQ
143,615,544 *0DC22E455B49FF90703C9AEE1D882354E996169B CESARCUBANO
143,615,545 *0DCB2C0575577CA0087FC7B2210A2251F36BE1F0 CF1C98B7010BA29876A77F77EBFDC486
143,615,546 *0DC209E690845EB57B306015F2969E67A620A242 8UNIRISHL
143,615,547 *0DCEE7DB0F8664916BB386E61A5CB647B835CF4B cfskbsws
143,615,548 *0DCD05A4770BF33B02F6F958538C29B3BE81873E 903437 the.general.fee.for.ruling.on.a.tax.issue.is.$300..
143,615,549 *0DC256464BE4F3FE00AD104A73DD54832D78A86D cgiw
143,615,550 *0DC54DB94A9ECF43D322A5CCF7ED014A1E871606 C.H3G
143,615,551 *0DCC36DCE3DCE494DBAD4EB1C350E5C7855B41BB Chalk-Outlined-Body
143,615,552 *0DC761EE6C2AC80FBCF956B3BA40BA9FC0D28A04 CHALMYR5
143,615,553 *0DC1F422E159924E2DB0AF416D9C4DA449C6F6E4 9974def24b433f2f89040ff49d6e765f
143,615,554 *0DC8FBA9045742F53301233DE048DA5468957B8D 9APREMIARA
143,615,555 *0DC8A6F1216020ADBD70BB41F25BCE75311B4E58 [email protected]
143,615,556 *0DCBC07898F09F3D22863449516F623FBCE289E1 9COPYINGS
143,615,557 *0DC260C3F41B33ABD0AD1FA74A0505A92CDD8C88 9DEBRALEA
143,615,558 *0DCA8901A4206C188E1A62B7D2DBC57830A9C018 9disjoignant
143,615,559 *0DC35EF98DB5D8268944ED5B6832E88B573DCDEC CHIPCHEETAHBIO
143,615,560 *0DCABBFEA328F94AEDF0DCDAAD30A8E22EDA46C8 9FALSIFIERAIT
143,615,561 *0DC8725491EA2963AB939DDF20AC5E61CA2CD60E 9HORSESANIMAL
143,615,562 *0DC5A2B3A40B55736ACE4D85FF70BE50A09CB783 9ILOVEGAMBIT0
143,615,563 *0DC87E245B3BDC08DD27F554FDB51945DF48773F [email protected]
143,615,564 *0DC93E91457FEBC85F4B4DFF25C8E130C6DB06A3 9POVZBUZUJEME
143,615,565 *0DC581C022DB203906E84E2CBE8D8343181E4D17 9R39ARI0U51Y
143,615,566 *0DCE5A5E2D620D88A11D24996BA7E84F60D6010A circuito.de.nevers.magnycours
143,615,567 *0DCF3DD4FB3BF76A1128E377ED545616B98D0CBA 9ROGAVERIS
143,615,568 *0DC1F0A1EAB2A6C57DDDBF5AF8699C0D21DD44B3 cjsbf
143,615,569 *0DC94720214ECD76FF83046C3A1DFE23A1D89E4C ckbu
143,615,570 *0DCB545747C0CDCABC5EE3228B677FA1DFA76B6F cl4mu
143,615,571 *0DC36A6FDD93A8B6932FACCD0E60A51FEE368FFD CLAUDEROOKS
143,615,572 *0DC5C29041D42D097976E5C0543DB4B01F219610 clearwaynmscomwww
143,615,573 *0DCD551864EF5B756A2AC75D7D748E3E2CFA933E a-3"k
143,615,574 *0DCE3A64C1B0EDB28E02BF335322323F25B5E25B A3#N
143,615,575 *0DC6FC7E2CEE2DE75983A9384ABC80B062EF04A8 A4AG(
143,615,576 *0DC57A8C047DBD1BD3735426BEECE02A0C2E3920 CLETUS.MACKERT
143,615,577 *0DC9508030728E7D1FE23C97E8FE8DDD769C5757 CLEVE、1840
143,615,578 *0DC2206C3D8B7D7CA1533C8B192D0B8F5C8B74B8 clevelandpadgette
143,615,579 *0DC374149E6BD01866CAB40382BE5425E67F0EC3 a7d&s
143,615,580 *0DCFFDEF6055B81C989A137CD9844DD5BB443A34 clinton.love
143,615,581 *0DC8EB31967964AE74DEEE62E973DD69BEE82E34 clintonpotts
143,615,582 *0DCFCFD496B6D56EF3D8DCBCB92F7A55F84AF83E CLNCPHLC
143,615,583 *0DC5AB4130EF00C35F7EA5FAE7553A4D4B3EDA7B a85t1n3ntly
143,615,584 *0DC71FFEF72FE45365CA8641A7F0E725811AC784 a8(bz
143,615,585 *0DC4DBDC01A543E6CA5BE1BA922CBB259FE53DB5 A9CEP
143,615,586 *0DCF777B9BCB7E57476C2102BF40F24412454E5D A9&OP
143,615,587 *0DCD1CB59348477D2CA1C243B0562447D80A21D7 AA22681C7561CCE6E0042F6F2E35BF67-KITTIE
143,615,588 *0DC3BBEB56053E30501C11291513145F2525392A aaa/hf
143,615,589 *0DCE4896AFCA80F0AE19C6B78F901F9191FF16C7 aaa~qn
143,615,590 *0DC2638A4377A93116D235874758654BFE2B6DDA c,'n
143,615,591 *0DC0A52E7A9286A040C1F2185E27CD8923296C89 aab^s
143,615,592 *0DC6767216460DFDBB459733EA903AD3E1521030 cn,p5
143,615,593 *0DCAE3115CCF2EE783CCFA03F39FBB3BC42886A4 cnsdrnc8
143,615,594 *0DCFF64CCCB4BDC6A918BD94530FB5E761BF744D c=o
143,615,595 *0DC10B9168D8F0A9D6F2EA2AB3E794112F030BFA aactc
143,615,596 *0DCDBED59681E9E8CA275E5CD72ADC769F540C13 c?ofo
143,615,597 *0DC400B25BCEEB8432F59FA9D2DF1F9A09C66744 cojonudas3
143,615,598 *0DC5EAB911A577667B1CABFC8B9E1A687805AD0F colbystrutton
143,615,599 *0DC1ED1E1A6B78690E33DD3A21B8BA3461B3DED7 AA/K*
143,615,600 *0DC7A8F362565D426FDA1595A325308D05B1A4A1 COMANNS6
143,615,601 *0DCD2D8B920DAEA5687C8A675A51FAAB3BFF1186 AA"XK
143,615,602 *0DCB7368528B24B2A6CD775EDFDB112FDE8DB9C3 CONTESTFLIC
143,615,603 *0DC9BE2AF96321D4F014822FBBE6F9C7BE0C8360 AB3H
143,615,604 *0DC2117CCFC7EB494CB630CD0756CD20BBFE0020 abbld
143,615,605 *0DCDB476E499CEF8E856AB481BABCE6EFEA06167 ABGESTORBENEN0
143,615,606 *0DC4BB27DA1EFC2B397B7AEC1DD19BAD8F15D231 corgwn
143,615,607 *0DC5C3D0C87900178F17B0C892D1EE6ED519C9EA A"BO_
143,615,608 *0DC823C3851F604410B5B3F3E268760610C9F2A2 cornerrenroc
143,615,609 *0DC2D4DD039A9D408A47AA3A58F63C7540DDEEA8 abramtays
143,615,610 *0DC6760E1A6186964D9CA8A8BC49F03D31BA9E57 co.!s
143,615,611 *0DCEE27E6E654320AD92ACDBF4F3AC3F5A05E58D A&BZX
143,615,612 *0DCE939F2D4395BE980AB8B30780DB3543882884 ac6k9
143,615,613 *0DCF3C5022D37D27C4CC03B7B071E3E8C424D5CF countrylinespecial
143,615,614 *0DC2FCD0FAE76C3BC7AF3BA1FC2EB77F53A726D6 [email protected]
143,615,615 *0DC33B1AB9306276365A98537D7D93A197C92BA9 ACCOMPLI
143,615,616 *0DC6BA8A034A4C283FF32334A3840197244244BB cp4%3
143,615,617 *0DCB963D7CCB3F9657F5BAF78F7C005B448BD12D cpog"
143,615,618 *0DC3531084491FB9C22A5212A9E045DEE990EFA7 ACZ(2
143,615,619 *0DC89BF8A003C2F5D84770A999525E796C07FAF6 c:\programfiles\msdn\msdn90\1033\onxmlhxs
143,615,620 *0DCC4845CB0F6AEDD2EF4EBEF9D11A00B0845807 ADAELSIM3
143,615,621 *0DC5E6BAFE2B40E8EEA19C681D21B1D4E737EFE1 AdDA
143,615,622 *0DCFEA3B3D4B1B3D7F2609C764921B2BF1BCECF5 CRATCHEN4
143,615,623 *0DC30F46BCEAF92FAE51418D7351F04F75D317B8 CR-BW
143,615,624 *0DC009CE268ADFCAB9187C6FF4654AFC493D83B5 CRHOK
143,615,625 *0DCED647A6CD552CFE40B6263DF00370FE16F512 ae6$$
143,615,626 *0DC6982033AB24B69A30D5B1F7E5FA469D896B68 CROSS-FERTILIZABLE
143,615,627 *0DC110EFFE7FD73F6E723AE45B0B0DF68141CDEA AETEM
143,615,628 *0DC8EA42F3F8F33E9D875653696A219C3FF35CD3 AF0)E
143,615,629 *0DC910FC003B69E9101D767FB00455468909CE36 af8q7
143,615,630 *0DC2098307275076BC55D1ECC5B5FAEB67EB185D cse=?
143,615,631 *0DCED7B2A0BFAD9DD91981B9A0B83B27104953CF AFGAV8
143,615,632 *0DCCB1BE34DE167002E9C11D1FE6FF8956DDD5A6 AFZS
143,615,633 *0DC683ED11CBBF29140D8B62DC6CFEFA0953CCCE A_H0#
143,615,634 *0DCA963BBC4B49408DF05A89CD01552C00843FE1 [email protected]
143,615,635 *0DC5D22D379D37CCA9D57B0861728CA96317E467 cuttomusic(1)
143,615,636 *0DCF2909FC58FE2BEC76749487A651C782137BC0 ai/m,
143,615,637 *0DCD32186974788C7C3AE0D0D229296C0309DB6E cv-ut
143,615,638 *0DC3EF2201B1A0560EC7C42D050CC53DAF54E242 cw9pb
143,615,639 *0DC977D2F44AA3C292BCE6CA435195A9885CD7C7 CWBH+
143,615,640 *0DCDD71B70587ECBE67C65024D2F5ECF6556B9CD ajay-sudhan
143,615,641 *0DC54E8947B0953BB63F0C5020C05C653DEAB0EF Cwqq
143,615,642 *0DC8A1D54D7921728F5D240F91A418F677B4CE1F CW?$R
143,615,643 *0DC9707D0853B256399B646ADD4C0B2A5D98DE8C cwt;,
143,615,644 *0DCA22EBB5D84631EB56BE181E085E0082FE0E5F CXIQF
143,615,645 *0DC36DC9F092B4A15A898004FEE55746997BF180 c#y)
143,615,646 *0DC29E5EDF6AF3FE3F6C241733F029465EFE8AB2 cyios
143,615,647 *0DC0518D055B5BBA7ADB259B105D373236F47920 A;L,E
143,615,648 *0DCC5111B9EC92274482AC7859B41CE2FA2831DC CYNNAMON08
143,615,649 *0DCB1380B9A4EC85D87C2842098CC8D83BA45618 aleena.zafar
143,615,650 *0DC1DA8A2FAD46162F40BE7D76A8C0FA0406AA31 alevedo3
143,615,651 *0DC865D5E957C3DEA8268A1E0067AA3B3BBC9C1B ALEXANDERMCGUCKIN
143,615,652 *0DCEF536FB82DEBC1307D20DB79D5991D66566BD alexis-pare
143,615,653 *0DC729BFFADBECCCEF742FBD73F5E32EF4379C0E cz!t
143,615,654 *0DC61F82E6C2D32285C673DB703756920FD8777F D0UM
143,615,655 *0DC0266239A28E6B47D7996F158D078406ED8585 D161970
143,615,656 *0DCDD980162AF27828C15BC15E77573CD597A0DD [email protected]
143,615,657 *0DC41EBE5C875A7B70E7A063B6FCDD2002500697 ALKIDES5
143,615,658 *0DC6A21BF57AD0208ED545F156A62A7658AC5B89 [email protected]
143,615,659 *0DC0813E385CBE10741A709D8D0F91D8A10571F9 ALOSP
143,615,660 *0DCE72D29D8BFAA58AE1E2C411D1824270268A47 d5du
143,615,661 *0DCEE36DCA140106C87B544A54C476EB442880BD D5K5TR
143,615,662 *0DCEACCC0154EF0FFD89396CCF3A33F4B7B4EDD6 d5swm
143,615,663 *0DCF8AF36C215A73F766DA8D4087AD1499590068 D!5T!114T!0N
143,615,664 *0DCEBAA01340D19EA56D1B6E7DC93923A2223305 alvaroccia
143,615,665 *0DC8D94AA4D45311661D921CE400F1D0A84C5FB2 D7DDS
143,615,666 *0DC5D55DD0E7B5479F716AFD552A2AE34346E2C3 D!7NS
143,615,667 *0DC0587C039E3261B89D235D032228D31BBB8CB1 D"9E9
143,615,668 *0DCFAD40F48F5A83A8622562CEBB534692F07341 d9,nv
143,615,669 *0DC1988387E068715B1719AC71FF0F8F5A006816 AMBROSE.KITAMURA
143,615,670 *0DC566D0B8F9762C5693D8328AEEA5166A4520ED american.men,.volume.1
143,615,671 *0DCA1CC70722D100FC1CAEE825AF30D8A5512CBD [email protected]
143,615,672 *0DC91883D2148DD1542BCB5A3D148329C0EF9976 [email protected]
143,615,673 *0DC68D9406E0B4D0D9746CF3A7BF2C10808CE169 DAKOTA.3
143,615,674 *0DC98577506EF685FBF542BC30A977A7BDBBE0EE amm4706022250
143,615,675 *0DC3237F04FE144F90D5177ED845C193F09F5AF4 DALE.RENDER
143,615,676 *0DCB23ABE1C1842466DB039EA6704BFFEA6D4D59 AMUFFAVI6
143,615,677 *0DC68701BCAB99FF914ADBAF8C18B9600662A064 dan022108
143,615,678 *0DCD024954A338B2E5B4B6A680813AA4001A02C9 [email protected]
143,615,679 *0DC6D419BC437CAD0D47857A8F5C3DD584102591 ANASTES2
143,615,680 *0DCE2FA959C0E5BA3F75CEAD7224601D7D85F415 DANIELAZEVEDO
143,615,681 *0DCB7D4358435EA399FFA28F08937D2431FB5E6D ANDERSONSCHREIFELS
143,615,682 *0DC361AA673E666B5787EF9B4E6CEBBF78821561 andrade-ramos
143,615,683 *0DC8E64CA9AD35AF0CE265F21686E1E495E43212 danjobet3
143,615,684 *0DC965942E03ADD21A1B5FBC3A156641C4385DC2 dannygallinger
143,615,685 *0DC7D8941223CC5E1C59F111631583191E786A65 andresschlett
143,615,686 *0DC5926A19217096DDBBCC63F4FFD573286F91CF ANGIE.HALLIDAY
143,615,687 *0DC04B738D2B1679C205191CD04996C3A53205D7 DARRYL.KOPAS
143,615,688 *0DC6099BE9A14ACCBDD52EAE9FFA6F83B7E39AF8 ANNIE'SGOINGTOSINGHERESONG
143,615,689 *0DC88CB739F426BC99D1FD5B0CC96D854F52119C ANTHONYBECKLES
143,615,690 *0DCFFE00CF502B2DA006CAC1B94449C31EB456AB DAY(UNRELEASEDLONGMIX)
143,615,691 *0DC22B33F70EFA76A2C77854284F94AB587A429E ANTHONY NICHOLS
143,615,692 *0DC16C58AFD2E9E677A25A0346BC1F3374D63E2D anthonystorr
143,615,693 *0DC39DA7ED58A992152800CF0A489AC9C7C972EC (>_<)~ ~DB
143,615,694 *0DC06733A153E0378495460637CE9F50A77E3B2D dbce$
143,615,695 *0DC03187170239B77B4C80D43F477B17C23733D7 db;o
143,615,696 *0DCC1F4D51E50DABEC13557D89D68F9D01C2DEE1 AO/DU
143,615,697 *0DC42ED8848A7939D2A1EBAE43468A56B5B0562E a,;on
143,615,698 *0DCF58424F81D9D896896EFF0929F067551875E9 DCLF
143,615,699 *0DC6DD410088978F965D41147884992F992CFC1B dd8rv
143,615,700 *0DC551098C403CE0845E49A56B059209DF8D0FCD ddayi
143,615,701 *0DC2B3E9A6871EF8DA4B6C5B01801937832384BD [email protected]
143,615,702 *0DC729DDA4C479B50005AD58FA3DAC97445421E1 API;9
143,615,703 *0DC3208FD10E774E8031D27DFC7957347D58D9C3 ð»ðμñ‚ð¾ð¿ð¸ññŒ
143,615,704 *0DC0C96FEC647828F3BDB742FE0CBE8F3BB0762C dealer.wins
143,615,705 *0DCAA26C37B2D2F4A05C63BCF5F5278CA8D5244C APRIL-BESAS
143,615,706 *0DCE2FD9B32285A547913E8470961338E2F273D6 aqcs?
143,615,707 *0DCE8319081934BDB8B34149375D91C5C20B0302 aqis
143,615,708 *0DCE36A801C8E5B84F921283D6258D8AD6F62274 aqvb4
143,615,709 *0DC7380D08839B32213B2C7B1D2BDEB5D3BAAB7D ARAJNARINE
143,615,710 *0DC1B593E9A5CDAE80AD64E665985F646FC48E87 ARCHITECURE1
143,615,711 *0DCC21709B4A9F5A78974BE78BDAD93B3BDD338A DELBERTKOULABOUT
143,615,712 *0DCD502FE767758B29B3001FA91292D2F1011837 aren1
143,615,713 *0DC86B31381D37E85A5A73D963EB2D450A27C11B ARKONC
143,615,714 *0DC6C4A65F9560C301990DB5217521C6102C00F2 armandoheizer
143,615,715 *0DC047E5C54E076ECDF0E227A373FC8BBE5DFD19 ARNULFODODGSON
143,615,716 *0DCBDCD4BE07582C3289D299D2071ADBCA5B8E51 DENIED77
143,615,717 *0DC1BB53C46D21320F1E3FFF5D4D08C5EB54A6CB DERAVINO
143,615,718 *0DCF778583C411BD4CBCEF09663DCB22C1B0A589 artistwaning
143,615,719 *0DC80234CF8CE781DD828C5B2F1123E36E04085A despotizes0
143,615,720 *0DC00FB7A80672CF55BF1693684BFB505EA311AA devonbruggman
143,615,721 *0DCC7F9EF62910170F7A88C45776C0190DF69462 ASNTRACK
143,615,722 *0DC435FCEC3657466964CB3FC3F94CCB7F62A3C2 devwn
143,615,723 *0DCE2AD7CC68CB40126BE84AA24F70EFD9F13703 asukurut8
143,615,724 *0DC285C3AE76D89F23C2433792C22FE2F7F29EF2 at+"%
143,615,725 *0DCD0A112D6ED5A09252717BAAE230789A5E514B A$T56
143,615,726 *0DCAA332A9B8684B785C1ADD7892BC47FFC0A45A DFZQU
143,615,727 *0DC8C18792F8290FFF63A796B5E4CEF877F28797 [email protected]
143,615,728 *0DC889FBA73E498541E237AA612A162ED39C46CD DGATRAININGPROGRAMORGWWW
143,615,729 *0DC9FE7D748B1AD99D8F502E5662C380B870BA43 dg$el
143,615,730 *0DCF4B4903850508E51EE21B0827C634B0B28CBA dgh.k
143,615,731 *0DC7BFFAF8A4510F01060FD5C54E869F7F645D6E dgjeuropes
143,615,732 *0DCC0B124B5B5784722A1D1E5DCF0B1F8823C078 ATQ0N
143,615,733 *0DC671B960DAC7A5E375B356054DAE2BB1F6751C ATQ;H
143,615,734 *0DC1BD3FBCEE4B89D6B3F97A52C785883A270910 AT)YC
143,615,735 *0DC23564E887E08D6C5E52669A679885A6860C35 DHP(
143,615,736 *0DCBB84C23D782FF94197294F48B05857B3D0DC9 D%HQ1
143,615,737 *0DCDCEA6B39A16024CA7D174B46C32391BC475C7 diarches5
143,615,738 *0DC8A03F27234AEF6BEFF4D170FA1FDAD8E1FDCB DICTIE4
143,615,739 *0DCB5710A112DA2A7CC0F1703FEC0C0E2E285914 DIEDEUTSCHESINGLEHITPARADE1984
143,615,740 *0DC47B3A4DEEEAF756C0B16A91FD09F018C7653B DIKTCITAT
143,615,741 *0DCBE8F38A52BEE0FDC0DAE740C8FB50BF2ADFE0 [email protected]
143,615,742 *0DC1422D9247DBE2F393AE9178E140D7D3EE899B AU+?O
143,615,743 *0DC1CF8339F44B9538290B3014A909BB40F58BCE ausgeklammerten
143,615,744 *0DCF1F861AA70C6B6C09A0864840FC99A4CE15B3 AV0SQ
143,615,745 *0DC6B87D339426A0DE30C43FC89656FB3C6E1457 averytroller
143,615,746 *0DC85D1BA3E36EA87EEA824A490450355761A0B5 DJ3B
143,615,747 *0DCBFD4E1B6ACA3679E64467D9A3B67F36F27094 DJ*N
143,615,748 *0DC1F2B064C6945587470C5E58FF0A9FEDA5222E djuqr
143,615,749 *0DC59C198B4ED47C140482E446AC038BD0850CF8 AVSQAWKM7
143,615,750 *0DCCD333CF34375BCF78DA9C649182C555CB63FE DKAUC
143,615,751 *0DC00F6DC6C1ACAD9C0BCAD4E3C7B5ABCAA3F462 a!$wq
143,615,752 *0DC551A8C6FFBCDCC89E4552DBF0065D1AC840D7 AWTP_
143,615,753 *0DC06B57D5F751C6B086F25444E4774F785335BE axagw
143,615,754 *0DCDF1A4FDB7C23F0F5736576C5DB2B78570AA83 AXDGX
143,615,755 *0DC5470945DB910FDB3C37BFD36652BA1F4192AF dldh1
143,615,756 *0DC02D109257CC6214FBBBD68C4A4183DC87037D dln&(
143,615,757 *0DC8286FFAC2A27ADA775235BF5F15285BC3B8B7 dlonra-46
143,615,758 *0DCE54C3B9EA5FCD635FE8F69FFE566CC9DEE7DC DLTKRBSWED
143,615,759 *0DC88633D3E228B3D1427F305F89DAF24F8D48C9 AY/9E
143,615,760 *0DC2E9DC85DB66B65454888684CDEE05FC0C84AA AYHVR
143,615,761 *0DC3996FF84900A461A9E75BD62A7A812373F562 D~MM
143,615,762 *0DC1A5D60F03ABECD03C62287C3EC5D407523692 DN7T
143,615,763 *0DC011CD4E23A2099749B20908B0549F4B6C1D67 dnd65
143,615,764 *0DC8447782D0CC54C620E3A77DC8165282FF3DB1 B1OCL1MATOLOG13S
143,615,765 *0DC6C4C8FAE266B5DD312DC4BD955C419DEF863A DOLARKO8
143,615,766 *0DC1F07D525C41497CEBC511D6A34377636D437A B2WW
143,615,767 *0DC8A1C3A7EC507911C6B3DF6C20CDEA80CB8D1A b--3g
143,615,768 *0DCD531435088AD0B7A6CEEBEB8C2001E2AAB688 B5DWD
143,615,769 *0DCC1B122643D8A1050B49F3DB8645E4A5024964 donnymckiney
143,615,770 *0DC2EE730E972EB7FF48606A958CB51AA3E1DDD8 b5xbu
143,615,771 *0DC53C8EFAA9D70F74EA40B9FCED1C4FFCE196CC DON'T.YOU.THROW.THAT.MOJO.ON.ME
143,615,772 *0DCE72855570145B3155BECB270CB0842F45667F b(!7m
143,615,773 *0DC513DFA38FEA3714F58EFB59233ED2A65CEB00 b7np9
143,615,774 *0DCDE8FA14AFCD1C643072E12369F4BAD0DEE561 b7sbu
143,615,775 *0DCD78E6E82C1B4BDFF28C410235146AA73E9BDF DOS.ARBOLITOS
143,615,776 *0DCFF29533F6764A74E9DE9817E0994837C2F1AF b8bi$
143,615,777 *0DC99E712306E377D19D5FBC16249D2F0C60D4BC baby121104
143,615,778 *0DC446AAD4324980120A96B604D4EA56CFB88654 DP3)A
143,615,779 *0DC7408CB02E91AB721CEFD40DFAF5D8EFF151CC D-PHR
143,615,780 *0DC642717953E6E9B30BD19F07BD6372CFF72E4F ><`DQ
143,615,781 *0DC1E4A46AE8D0FAA1063C817B88E609538FE3B4 bairesmans
143,615,782 *0DC00F1C10C14482A78BABF2110B1A6E5CF609A0 BALANCETOP
143,615,783 *0DCA49EC5A678D9F48085374536ABA007A923A7C d).qg
143,615,784 *0DC05F8238B65E5721D29E3207078ADC301151F6 dqwik
143,615,785 *0DCADC1036792A8C30C7F005B1D01D63AA597352 dr1bble7$
143,615,786 *0DC9636DA40B2FE9F6060789657FDA84B4E226F4 D)R.E
143,615,787 *0DCE471F7CBF8FE69EB557D5406FEC9E23E40E50 BASIAMOS2
143,615,788 *0DC21306134AD3EEA63160915B0D751809084B49 DSADAPT4
143,615,789 *0DCA62AD2600C0433B34D5A1ED9E17204B1A7831 [email protected]
143,615,790 *0DC91A8C22E348E4F1C8C913A550CB31374D5D4E d)ugr
143,615,791 *0DCB89956CAE30DCA608C56D4B871EACA6197177 bc9hk
143,615,792 *0DCF85AD0BA966344475B2693EBC3D4D4D5597DC dustinshonts
143,615,793 *0DCF28AFF73F4617503694D326EA1A5F102A859E b?cl+
143,615,794 *0DC90B2240AEAA47BCDF806C320A3F35DFEA8FB1 DVZU&
143,615,795 *0DC6E4C4ADAEC87933B0556CA63ECFA30A6FDE5B DW06_
143,615,796 *0DCEB9D328B3B69AF648EA0493411440B359CBBD dw69n
143,615,797 *0DC3EC4A24A8746A61ADF7CB3275D8701C6F5DD9 b"e;2
143,615,798 *0DCE85BD80C7E1A43DC8282AC6A9DF97FC33EBA4 dwaynejankoff
143,615,799 *0DC68D4ECA9D5E70ECFA5EB23CBD897A4972F1F1 BE#4J
143,615,800 *0DC8726FAD875DF665166D4525866A9F5C551EDB beartits
143,615,801 *0DCF3E7E5CBBD4EA027851ED2C81BA99B8D99FDF BEDFORD PARK BOULEVARD
143,615,802 *0DC83F79F65120FE121A2C249D46D38DBEDF0DC4 D:X;F
143,615,803 *0DC82602A43E10E0E9EFF4275A9BF781FB6C9909 dxjyw
143,615,804 *0DCE6972EAAC51AD323A453767D5C527E8F1B8B8 BEGRËEFF
143,615,805 *0DCBD33051C7690AE627BE98E54674F4FBB52ECD ben cooper
143,615,806 *0DCB6E24E1BDA5372FC3A9695BD099361AAAEE38 DZM%K
143,615,807 *0DC84A55A12C0BE1AF22EE7848F519A5DC62328A BENEDICTPLATEK
143,615,808 *0DC8267A8F4F969EB5A9F6E371D1E967B4627159 benhur.gonzales
143,615,809 *0DCD5512AA4D1400067860ACF3BE46456FEC83BD BENNIECORNETT
143,615,810 *0DC0DD343CE8860FFAB158E03BD8E32ADA5B4D88 E9O7I$7IC41
143,615,811 *0DCB9272E1EF801CD3D58A1219ADBDE257BE629B beop6
143,615,812 *0DCCF4D3C0CDCFAD3FC9C1458F340EC59A2E7D14 EA+RH
143,615,813 *0DCF61C4EBCD333B96086F8F98D0306184EA9C60 BERNARDOFONTOVA
143,615,814 *0DC5628DF77C646E369F7D86E9F7C2F4BBE9C9E0 BERNARD SAINTPAUL
143,615,815 *0DC40DB490A2A28235E1590AE60BFB5423E264A0 BESHINING1
143,615,816 *0DC579698002B6386BBD74DE5D2C09B18265B470 BESTBOOKSB
143,615,817 *0DC4AD6EE6153802448CFF3E974481586CD913AD ebenilps3
143,615,818 *0DC40F9641ACA5E7E1D8689B7A91E06898ABDCE3 BETWEENTWOCITIES
143,615,819 *0DC1726AC38930C89091A2898A5A003D372D2299 ecv52
143,615,820 *0DCAAA9A8AB6A45B87B5FC4F97E01802BF86E3A4 BEZAANSSCHOTEN3
143,615,821 *0DC3156C1B772E4632DA43F55168D58501BDB6D0 BGD=#
143,615,822 *0DCD179F244527D7F457FF31F8A8ABA934316460 EFFEROUS9
143,615,823 *0DCC95ABB2BEC4E496817775DEC2FA03F7350829 EG:Q
143,615,824 *0DCA0F83F1FBA048384B9FCD63F6832D1714777B bh/#t
143,615,825 *0DCEBA0E63533C3FD3D0CB92B6DFCEEC4615DECD BĦTA
143,615,826 *0DC75BB1FCA085CAFB23E6C7AB961FB44DCB88D6 BI?;"
143,615,827 *0DC10B6401412BE48B470ABE33B697B5BC3A2BCC eingelegtes5
143,615,828 *0DC4D1C4BA5CDF1ADE7A5508423CF594E6526E75 Elastiques
143,615,829 *0DC1A84C343465A935C58CB3746A6D4221E8C246 ELDRIDGE.WAROWAY
143,615,830 *0DC2722A0589FD06D628A5CFCC38F8CE2B7B8051 BI+GC
143,615,831 *0DCCD22DFBAD318B7A1CB6EA3702F018DFAA961B BILL.BOCHEK
143,615,832 *0DCADF702105FCFF9C5C7A0253344138DF7B46F9 BILL.CHINN
143,615,833 *0DCC139FCC165DA200EBE292419AAC130EEBAD75 BILLY.HAMBY
143,615,834 *0DC3EB9D460F41C995BE0EB5EDED6C9AD1A896E4 elke%
143,615,835 *0DCDA3248759A89ED70B68C965C4234661F770DF el-lemon-tree
143,615,836 *0DC508BDDF1462AFB1E0A147D80F638E1CA81B5B BILUSHAKING
143,615,837 *0DCE1CB46757004721A718F6B3B7B922C2CD3767 BISSERICII
143,615,838 *0DCE869749716CB5C92163227D21346677376EB0 eloyklickman
143,615,839 *0DC115AFAFE242BE91094074946AE62A5C067047 bj?58
143,615,840 *0DC8FD3F732D5B393DA74CD4DD03E593A25AC985 [email protected]
143,615,841 *0DC1CC9535CC22CA3B9B5A5D8AC38F53DA151CC8 BJPDQ
143,615,842 *0DC51956B19A728ACFE119332B0A2B6EE7F2D06E bj#qy
143,615,843 *0DCF8D725A1C626A33FA1B5BA08831AA036EFFDD ELVAPORIGON
143,615,844 *0DC139ACA0C923C1B85EDB055890AD6704FB13F7 ELYNELYN8
143,615,845 *0DCABCE1A908DFDC660F9410D61B1E4BB00FC64C EMMAMOVERLEY
143,615,846 *0DCA082B51A6E449F284DC34582E5C120F519CBE EMMITTGRACI
143,615,847 *0DCB11533983A77AAA6C0FCE215D2E464CF0D0AD BLAINE.KUBASKA
143,615,848 *0DC2479D2C8C26D31729E2D80049F9772A25A261 EMORYLOPEZ
143,615,849 *0DCDDFA566DB86A5EB8CE9253A13713085AEE60C B_;=M
143,615,850 *0DCF15960EBDCBD5AF6FBA7E5A6186370C5FBD26 B"N%
143,615,851 *0DC6CD01DF19F8027A99E9F1064E2DA648CB1857 BNAQ1IZ3271
143,615,852 *0DCD1F90B5B39D9F8D88F22968F0E0AFAB0ED76F BNPL%
143,615,853 *0DCA537089660C09984FCDD6A5B02DB37E68C47E BNUFP
143,615,854 *0DC3A3D38D57B68827F638063E9419620DB7B3D4 [email protected]
143,615,855 *0DC60EB55FD67CAAF803E26057E0B9963D5C3AE9 eps:r
143,615,856 *0DCD0E7362AFCB3DDFA0606C6F4826F78DE4B817 bogg?
143,615,857 *0DCABC1B3444F57FECF2D7B318591A1188A5BC57 EQUIPZNCNB
143,615,858 *0DC3EDAC9D8897C00EC8FA1AD3D0DE50ACDF32D5 BOLLAVARAPUK
143,615,859 *0DCFD403054ABA4853EF5ADE56422C7869CBFCEF [email protected]
143,615,860 *0DC86D521DA6DCCF30A866FB0D2E2E2C2D8363F8 ericatrinder
143,615,861 *0DC85ED29A76E6E0B279E610E0CDB46D5A515C33 ERICKALABI
143,615,862 *0DCD5A596C29990930809660743736D765E1A47E ERICMCFIELD
143,615,863 *0DCC29D062F2D330BEE729F95963FCB163629D00 eric-stadler
143,615,864 *0DC3BFA4425E321535F783A0196DB0D69474D527 ERIMORPHING
143,615,865 *0DC064154495841409D99CB43A0E763999519079 BOUCANAT
143,615,866 *0DCBADBFABF5AEC8E3D2D5F476184BC78D7D7B49 ESTRECHODELAP
143,615,867 *0DCCF65EC59AEA94158A691F5DB1F01866DFF37D ESULBB
143,615,868 *0DC231C8CC326431998A928A2BC88FF3CDABC50D bqcxw
143,615,869 *0DC85E8026A668835E97856FCC6B9AD29A62BD4E b&r0
143,615,870 *0DC1A3EB10CF699AA8D83EBF5DF06CCBD5EDDAD4 eu7hen!c$
143,615,871 *0DCB7805B5FBE3BC49980F7276433D47AF095E46 BRAIN.KATE
143,615,872 *0DCE19A7315AF15AAABAECB7F3A516F801922C64 EUIR
143,615,873 *0DCF353F40E3267A1F22D4AF89E0CA3538BDACCF brandy.lapine
143,615,874 *0DC97FBDFC939C547F01FD1ED70F6446182835E2 EVOLVE-(ACYLUM-REMIX)
143,615,875 *0DC4D3DF8DE9ECB4FD78176876DE11C7492B66EE BRETT.NICHOLES
143,615,876 *0DC3D7265CE70415BA7FC1CC4D024E5BDEDC4FC1 BRETT.RUSSOMANNO
143,615,877 *0DC1A3F442AF92FB9D51A784CDFAAA1CE0529083 BRF;B
143,615,878 *0DC1323474080E537338231A635B9418C7E312A7 BRICE.MARNER
143,615,879 *0DCF1E5E39735BECC09A757823D79F730B6BC750 EYOYD
143,615,880 *0DCB70F8072F3DCB99F2C74AAE16717DF75A9553 EYTYXEIAN
143,615,881 *0DC720B441868C66E752C341601A33C971A72436 brockcrummey
143,615,882 *0DCDEFE7AFD0435E3FCFB3B1B29252EF5D284499 ezekieltalamas
143,615,883 *0DCC642D28699541D87E32E30A31E9CEA19ED6D0 brt#1
143,615,884 *0DCEA67ABF7A579C5DB559CA60D2394E41EDF515 brucemonet
143,615,885 *0DC17B4F5D09E357A3127F09474B7FC29DE4D210 BRUCE.SHEAROUSE
143,615,886 *0DCF33161E2D34A90857EE05DED63536402F7CE3 BRUNO1009
143,615,887 *0DC7AE64D5AAB4A2FF0671155CD082C955D50599 [email protected]
143,615,888 *0DCB96F20362A650A1DABBAFB3AF72760A5830BB [email protected]
143,615,889 *0DC9848C5038EBFA9E282AA256146285531820E1 [email protected]
143,615,890 *0DC8596C3B903BD964FC5171D883A191BDFFA91B b;s8
143,615,891 *0DCA878E70FDA45E24ABB0BFCE58C32F4AA61CB0 bsji+
143,615,892 *0DC5485E53F4C33C9A277380888F8858FE54DF4E faucitis!
143,615,893 *0DC1C71A27F0D09376FFFE0D39391FB255ADE3FB BSU"K
143,615,894 *0DCDE54D2687F9B5B4C8E9DC98590FAA6094F1AA btov,
143,615,895 *0DC3B678A1500ACBD52887256EE873304E89B384 B$u3
143,615,896 *0DC78005388013180AD6DFBA4A8810356889F531 buck.newsome
143,615,897 *0DC156337463D426D8BC10D995B3621C33BDAD4A FHEALTH8
143,615,898 *0DCB9254FC74F0433F0ED649341FEF76267CEFEB FIELDN1234
143,615,899 *0DC17FE6D1865BFFBBB2A8A52D377FA81DBFCB3C FIGYELD
143,615,900 *0DC18ABD109AB82FFB716B3254EF57C5A7820B87 BULL4TED
143,615,901 *0DC96E703810E71203627892AAD9259BEE8EE5D8 FIVEWEEMONKEYS
143,615,902 *0DC5A4935B74B03297AB5AD05A23BE974BA50D87 BURTON.MARENTIS
143,615,903 *0DCFB9C5212F68A01405C38EF4FCA0221B85FA9F FLORENCIO.DASHER
143,615,904 *0DC9FC8D538C9A366A3C3A6B30DD8AE52A8B6C7B busymans
143,615,905 *0DC2CD031349BC575D216D8BF59AF796E21F29FD fluteconcertoingminorop.10"lanotte":allegro
143,615,906 *0DCF3341768DDA4D33C0958CD84C35C0804AA22D BUU;
143,615,907 *0DCD2A5C876102EC72DD628C564C70ED1B571631 bvci:
143,615,908 *0DC8FE5888F88EC8A18854580674ABAF25CF2C13 [email protected]
143,615,909 *0DCB2A627ED48EF533054440B8DB2887016B3067 forest.thoughts
143,615,910 *0DCCEAF3957F034D6888FBAAD290C4C44B406A99 FORGOTIT55
143,615,911 *0DC77391ED090EC2130249E273326F34DB4732E1 FORSURETING
143,615,912 *0DC250E988C9A1EB26EBD40DDC7C938C50E9B1A0 BWLXY
143,615,913 *0DCDD30AB7D25B50A8D18D88F9747D40D82B68E0 FRANCIENN
143,615,914 *0DC5EEB6DA8CC0742988BBAF14F37FB959BC9382 byaam
143,615,915 *0DC76D20D66F9076F8D6E6D3B52BB6E39BCC4BDB byocf
143,615,916 *0DC87F621F77E1F65E9BB6A4137E4FAFEB59C944 BZU5
143,615,917 *0DC9965DA0BC0D8D2AB6E9E5E7CE8CA9742590AA c.-
143,615,918 *0DC4079BEE88F07FBDC0A7D830B43D907AB3C697 c00p3r4+!v3s
143,615,919 *0DC715768F59CF17386631A7D5684B4ABA704D10 freddyosucha
143,615,920 *0DC4678AADD6FEFA331B6DF356A410E4D7AC46D7 c2p46
143,615,921 *0DCF5AC185C7E28AC220D56B01A63316C625BC0C FRED.FARB
143,615,922 *0DC78D67B902957FBC53CDC864DFF68378A9E525 c3foc
143,615,923 *0DC46A106B67A1062ADA07AD65315D54DF7CADBE „FREIWILLIG“
143,615,924 *0DCCE2A26964BA72C98569F2E62EDA9D20BEA781 C;3WS
143,615,925 *0DC5757BFCBE15A5B04789350464F22E652548AF c4kcp
143,615,926 *0DCC7409E8D814712E8AF5F4C3F2863B01496CB4 C5GB
143,615,927 *0DC0470564C71E432B4154D93FC9C7268A3CB0C1 C688R
143,615,928 *0DCC3947C2B1F84CC4FAD8FD475426E6F3993A17 C&6PD
143,615,929 *0DC593242E9D9EFAC96F0D7C3FDA43D246D9FF22 C7$3A
143,615,930 *0DC861A9DEE43947F200EF2677EB388BCE229BE5 C9GS?
143,615,931 *0DCF73699627D6A89528097D97A0969F7CFA092E c9.ii
143,615,932 *0DCECF426499D6FAC6E0FB82B4327D841599A45D ÇANAĞA
143,615,933 *0DC5141725852704573E5919CAD27482BAE7002D fwingensurmoder
143,615,934 *0DCCF563530AAFA2ECA13C848800209CBC24F40D G2007100315
143,615,935 *0DC6F54395D07E20DCF3CB5F8B34A77AA13AC562 carlbodenstein
143,615,936 *0DC9734A19F8CBBF1AB91E2890C0155AB1A3FAC6 carloscheca
143,615,937 *0DC84B58F6D8E47A12C5DF089C63D98B78D3F027 galang-perdana
143,615,938 *0DC95D5CCE8C9AD592152872395AFF8DA7A35D34 CARLTONMURI
143,615,939 *0DC6B6B51D32C28203BE23FCF7F670340A322CF2 gamnacs4
143,615,940 *0DC5548651EDA36EE8B0F42663B8236A04AA4B4D carriedance
143,615,941 *0DC5CBEB24194C6DC81155EC69E18BF4FEB88884 carrolalfreds
143,615,942 *0DCA78ED055084B79470D2879C62A3169A9C0AA9 [email protected]
143,615,943 *0DCADD75B78DDCEC05F5041367E3536A851254B9 ĈARTAJ
143,615,944 *0DCCDD064E18FEABFE37AFD1E5C7B0D776732DB1 CARUJASSE123
143,615,945 *0DCA470387FF1AABBBB9FFA5A7DA4104D22925BF GARONNENS
143,615,946 *0DC1A3B1CB4E20F10278B1F0ECE2485A7F17C41F GARRETTSTOBBE
143,615,947 *0DC1C284E7E4960C0EF1FCE463993B0078AFFE44 GARTH.KORNBLUTH
143,615,948 *0DC4BAE2C8B5007D8087BF549D439848BEB10D03 caseylehmann
143,615,949 *0DCBF00134C88BB2858B16CA04C8E0B49DE970FB CASEY.VLASHI
143,615,950 *0DCFDAF62A2D8A079BFDB9857C503C421A01C0A6 “castillo
143,615,951 *0DC203CEF9A508D893354459060085D5BD6274F3 CB?($
143,615,952 *0DCDFAE6B71186CD68E628621EBAEB1E5EBF599B GEOFF COOKSON
143,615,953 *0DC636D1327DCE5FEB7318011B5A58B444937E8B GEORGEANNE
143,615,954 *0DC58D6EF197D52850D320C272CC574FFDA798F0 george.burkard
143,615,955 *0DC595069081350320C74B4E224DB495EA636C50 ccnr:
143,615,956 *0DC2948E63B4D1D9AB8A93AD446A37E85627485E GERFALCO4
143,615,957 *0DC6F7B29D2158DE91188DE2E7232C63682FA765 cdh-=
143,615,958 *0DCA11FBE238970A2D3F6AFD5AC939AEDEC3B591 CDNQ
143,615,959 *0DC4C94521E2E3FE7A3CBD986CBED6F4DE1D75D6 C:\DocumentsandSettings\FireXware\Desktop\Projects\RunSZCrypter\VBRunPE\modRunCodevb
143,615,960 *0DC6161CFE3C67181C9D6AB0BA1383B8FD1242F7 CECIL.GROUNDS
143,615,961 *0DCC1CAB952721FD4208E5A5D5537A4636100097 GETYNDZIE
143,615,962 *0DC47A17C99DBFBE6A6091098C745F26F697892B GHIA.CANDELARIA
143,615,963 *0DC71F41BC920F2B05982EEC8CF1035D51AC024D CELULASINTETICA
143,615,964 *0DCBE2C138CF0B5DA8964BBC9E591574C1E12963 centerofmyeverything
143,615,965 *0DCFFE00E298A79541599C8427E78DCEAEF210DC G.I..JOE.HEADSTOMP
143,615,966 *0DC4D7CBC374FE822147840DBDEA6B0A8AB548FC cereomony8
143,615,967 *0DC9794E107B801BDA2DB801121112A0F816E3DA GINO.MCCUNE
143,615,968 *0DCA083C32F4A4A1D18484BD29A859CFF10320EA GIREBBEHED
143,615,969 *0DC30E56C4E5A20C88583D82A16737B7F093EF9B c%f6"
143,615,970 *0DC71C4F2808DD45F4843542822B96272187B65C CF9EA
143,615,971 *0DC3B58F9CA49C72D23F418CE95F407A79CF0F6E [email protected]
143,615,972 *0DC24A94796B44CA05FC0222552125D46B0B2BA3 CG7MQ
143,615,973 *0DC6108153C0FD5368DC0B7711A0D815735EC217 gnitaceh0
143,615,974 *0DC728BF03C48901C61D68E0E644C2E3007C7A46 CGR8Z5
143,615,975 *0DCAB8688A80C078DBB635C70B338DFB0B8A5D65 Ch"_
143,615,976 *0DC8E59FFBC338D1E0DAC00C8030E2B39DDC3AA6 GOEMAGOT6
143,615,977 *0DC9AFF383F7220659DB0FFA20EF1158EC5F7D3A GoodtoGoEP
143,615,978 *0DC0C4AEFAF9A6D4A41E26EE9344B8E67203A64E GOUZOUGENNOÙ
143,615,979 *0DC4ED73D57E4A3CE57A90379CC16E191DA6524A GPOIMASTER
143,615,980 *0DC5046222B4086C54FB96B4769D443462F97A57 >gqu
143,615,981 *0DC018E6FF23BD558AE980ED5663F47052347969 grebostrek
143,615,982 *0DC667439E2C47ACD158DBDCD14D40EEA3C0D62C G`T#
143,615,983 *0DCB7E0BD516BCE86D7DBAC11D536AAA9FED5205 gt0}
143,615,984 *0DCC0BEB1795167BBAED987E03B13D56FCD40F5A GUARDIA-DE-LA-CIUDAD-DE-ANKH-MORPORK
143,615,985 *0DC2FDA10A1BB549D1FA888C6285730BC8755291 guide pulley
143,615,986 *0DC2D12924A6D4542B2ED84756F9D0854B710D05 guillermo942
143,615,987 *0DC2DE6109461DE7872BE1CB733C57877B7E4528 [email protected]
143,615,988 *0DC3F66C841BC36990A79276C6A9F802599764B7 [email protected]
143,615,989 *0DC567AB7FFFC62E03D90D12FBD104F3139C2982 CHAPMAN-JR.
143,615,990 *0DC04A1D4E91208A78EC6612D21BC4AD6C03E83A CHAPTER.2004:.THE.FIRST.TASK
143,615,991 *0DC383CD0021819160CB67760A6E489E5FF9CDC5 CHARLIE.PLESSNER
143,615,992 *0DC7B5325CB98A7B8844498B2588C9E6ECD643AE h5n3?
143,615,993 *0DC8E2D7B06557887A5D67976A7CA2782B7711AD habana41
143,615,994 *0DC95900694BADA840607D8A91FEC6961B119B22 HABYARIMANA123
143,615,995 *0DCC3BDB46C1B11E52FDAB0D78854579A1E31679 CHELSEY_X
143,615,996 *0DC2C471C3898B1A3521C917F73036E48B727A7F [email protected]
143,615,997 *0DCA200D98C30BD3CBB84FA526981183029E365F chenmsie5
143,615,998 *0DC5BFC86FCE88615C5591C829E4B8A7D6A4D709 hale2006
143,615,999 *0DC412C62AA7B580C4690A881BF4B3F998733D8E hannah993
143,616,000 *0DC23C5CF274A0FA594D1CEBFEF8F5ADF4CE4C17 children-(knarf-mix)
143,616,001 *0DCCA2FEEEDBCD8CCE2ECA61E5AB9E2B39C31B3C hanselsanchez
143,616,002 *0DC85DE4DE967FEDE0FCC231FC09C95416B75C93 [email protected]
143,616,003 *0DC12D7E86C5BA06B11FC95EE91E3A0E79FA1677 [email protected]
143,616,004 *0DCB18BB2F34B48F2A47BF0380E98CE624EB2051 CHIWANTA
143,616,005 *0DC0BA4BB64C5720BDCE56D4690C1048C513A93F CHJRN
143,616,006 *0DCDB4506AB273671D1BAC45A9674AE753DE892D HAROLDWELLING
143,616,007 *0DC32DEFAEB8384E8958C3F3DAAFBF1E0962FFAD HASSAN.MORTHLAND
143,616,008 *0DC59CF128A8ACD0508A1933A70AA5473406F91B haterels5
143,616,009 *0DC8B5E6C66FA38AA1B5AAECAE3CACF5CA30B16E HAWESTAD7
143,616,010 *0DC774ACE2E1C129C0BDC6570930EE8D09FC084C CHONGALLWOOD
143,616,011 *0DC8CC97E26A54C5E76183131FFE63E02C954D96 CHORALTRAKTAT
143,616,012 *0DCC7828CDCB29041EC8375E14C068B5823155D4 HEATHER4A
143,616,013 *0DCD750DB94B58F44710E3FAA8FDCAC2F53E93CB christopercaviggia
143,616,014 *0DC7ACCCD3D5A349D224288C23D5EF09C7E413E0 heltenme3
143,616,015 *0DCC9864D9EB39CF5224058E00A36250EEC637AB HIEROGLYPHE5
143,616,016 *0DCE7AE046F3D6222BA92267248A5D834532CC78 chypré
143,616,017 *0DC08FAB35F0C27F95EA27BF9DE5D992F95A5E9B ci7g+
143,616,018 *0DCE662B0B87215299237E878354C19560814BD9 hm%2
143,616,019 *0DCF555431D3C7FA732FC396C76574416D40BB9B HOLASPIDED
143,616,020 *0DC2F1994BE6D1E847D23A63BBB1D45F1E175A92 holeinthesky,part1:fly
143,616,021 *0DCF9446E03C3F8BC546A388F6AA16987FC38E5F holly-cremeans
143,616,022 *0DC57A13CC607839AB3474463148436040DF7E2A ck2&,
143,616,023 *0DC0041F55DBF6E470187D5CC9769614D6AE4D15 ckc2r
143,616,024 *0DC044AD552E5564410816D1144FCA4D1CC43FFA ck.cb
143,616,025 *0DC888D2B18D49D3530587D0842F378643C5DFD5 HORN.CONCERTO.NO.2.IN.E.FLAT.MAJOR,.K..417./.3..ROND
143,616,026 *0DC6EDEA9D0114D302E01F7B2F497AFC61EBD97B HORSESHOEBEND
143,616,027 *0DCBEC6132FB4EE8A56FF095B1B6D8452832945E HOSEA.DUNHAM
143,616,028 *0DC77793773762A311C3C378CFFDC0268D079895 howdouwantit(alternateversion)(featk-ci&jojo)
143,616,029 *0DCC75FFA4DE4F6A6A195A976BA7C0C7A96B9418 claudedevereux
143,616,030 *0DCFA7EDF37142AC0CEC05147335200A27BAE2E4 hscheibe1
143,616,031 *0DCA8AAAA67B6882554D914300AD116BECB0DD12 claudsanjose
143,616,032 *0DCCA70F987F490F3111DD0D093518FABD3433FB CLAYBORNE5
143,616,033 *0DCE386119B36DD7CFB63258A018B1127FE7B4E6 HSZKGAMS
143,616,034 *0DCEF43654D2EE9156C9E7C824DFAEC6F302FD45 claytongarside
143,616,035 *0DCDF5D2962FA036008CF0F2676F8ECD7488E75E HTTPWWW.DARKLANDAGE
143,616,036 *0DC2B9FFC93999B135AC1E1BE991BB8749EC37C9 hubertherald.nl
143,616,037 *0DC1747F41BC9F5CDAA245DE960CCD9F533447DA HUMMYP
143,616,038 *0DC286BEF4A874BD96C07E0B7C192303B5B17743 HUSTUBIDETZAT
143,616,039 *0DC13A6EEAD18BF69E602DE7903C6E7E6C4784E2 [email protected]
143,616,040 *0DC01C6A68C0E27BBB35B3912FF2C38D932F9DEF cliffbassler
143,616,041 *0DCC1ECCF291B127E449D9FEA7DACE6E2A00104F CLIFF.SCALLION
143,616,042 *0DC9F9667E77B96D20A912FB9F9ACA78738B4F19 CLIMBING UP THE WALLS (FILA BRAZILLA)
143,616,043 *0DC4A2EBC098DD941771E088A15434B52C29834D CLINT-EASTWOOD-ON-GRAN-TO
143,616,044 *0DC5BA2DC67C83EC26D6D34028C95D36C0AD400F CLUBMANED
143,616,045 *0DC6B1471A2B811F526A63D89DAE67EDBCF98E64 CLXÈRE
143,616,046 *0DC4745FA13D2CB78C4735E9EB8909D4E0ECC13B CLYDEBAMBER
143,616,047 *0DC35F9607AA5CEA27F3CF34EF29969410BAA658 clydekeelan
143,616,048 *0DCCD4D4537B5C17B1CB426617422CF5516CBA15 iaknenog
143,616,049 *0DCBE790A93413AC86C3A80C91797C9122E7FE59 IAMSCOTT167
143,616,050 *0DC1A10E64657B6F79F2E4634A88510A594D97E1 iamstumpy48
143,616,051 *0DCD6CBE5AE7572F1F5E3B6AD6D35DD32A3958C9 CONTEREI6
143,616,052 *0DC538A5ED4284370EFC742F7A948F974AC059F7 COOFJ
143,616,053 *0DCE7A254E2D524D50F85DC32AA25DA5D4898943 coprivo9
143,616,054 *0DCA9B9FCCF489854575D458204879C2413F12B1 IHI;
143,616,055 *0DC66D2B7CBC246445E0C9CD9386F74794A15D85 CORDELLVANHAMERSVELD
143,616,056 *0DC1EF324AE95300379FAD213C29DEA23DCF8627 IK%:
143,616,057 *0DCF937DCF98629BAC8F63158C185253470D0E9D IKNOWTHESCOREPREMIERLEAGUECOM
143,616,058 *0DC03E1797509F47E2513A523A2B936A0D0F0CE9 IKURIYAMA
143,616,059 *0DCE6E9805A95273DF0E7093D3D37080E1BFB71B illusionworld
143,616,060 *0DCA1597DB8DC7C8CED0CC5B398D3AF5471633AC couahmg9
143,616,061 *0DCB389D5479F858A7D84743060B5921CBCFFB93 iluvcharger58
143,616,062 *0DC3EE970CDB0E461E41281DE5B2237FD1AC6CB2 CPFUX
143,616,063 *0DCA11A486A4869D22152A0D363D01A727CF1F4D c:\program-files\teamviewer\version5\teamviewer_resource_kodll
143,616,064 *0DC5F273EF7F3E80F16FCB4E6922BAF5A9B1FD04 C:R%(
143,616,065 *0DC1E3BE04F6F63C411E028CC450F7C67559B221 crilbsw1
143,616,066 *0DC1906D7FB9B6FFF273EF8C56E87AC83D85A4B3 cristopherbotellio
143,616,067 *0DCF6646101EE9C7FC6CAF7A2C423433C2B15418 CRISTOPHERSTEPNOWSKI
143,616,068 *0DCFE4AB04F8A61CAD3B94885FDE33A8D1EE6BC0 crsj7
143,616,069 *0DC62C84F111EC00054B5020FDE680F9957B5370 inasilentvalley
143,616,070 *0DC214CA49E4A9E2F4479A9772282B63AEC05C3C IN-DIRECT
143,616,071 *0DCA65FA30D9AE7DA2BF39033F27A2E5D44F332C csmc;
143,616,072 *0DCF0B0AD5FF5E22D6F8A35E5AC453BABC7B16B5 INFUNDIBULIFORM
143,616,073 *0DC3724A96D4FC16E93E3E706C46D97F89280097 INISLAM
143,616,074 *0DC79B9ED4D1F83C8FC756B529839406EB755066 CT6S
143,616,075 *0DCFAB4AE7DFCFFCAC9B6058BD74AB43FE306B80 INRO7I9WR1
143,616,076 *0DCF2FD466FD1C79B94728311D2F2227727DF7FB insidethebearsstory
143,616,077 *0DC8F16CE76D568AAD959F7A3A65ED5A2AE5ECF9 CT"N8
143,616,078 *0DCBD752DAC1F2C303EEBCEA6DD93A93FCBB0663 ctt4
143,616,079 *0DCF1CC3A8C9C20B3D88E942607983CF82018225 C-TZI
143,616,080 *0DCBDB9C7E9037286ECC1A547C339ABC33BADFC5 INTERNATIONALEFERIENKURSEF
143,616,081 *0DC9BFA7213B9348B26AEE0E4032CDE003C8D8A5 intervallkombinationen
143,616,082 *0DCB3BDCBBA5FC8D571547072BC8283D2CE802B8 cubarauis
143,616,083 *0DC5534DF0D1063AC04CB8F3B40132D01985F598 IRATING7
143,616,084 *0DCDC02C58098B7E7A5A161CA48F45134B12E58C IREBUALG1
143,616,085 *0DCA060C47D11224CA47F614E99BAC90349E3EF4 curtblock
143,616,086 *0DC76DC69727B29ACC035C39AADF544D8FCBF8DE CU:S
143,616,087 *0DCB1395AB30AF0E270978910609B4870704F988 ISAIAHDOCKRAY
143,616,088 *0DC02874E5CBC1DFC4682A4166EC165825526092 ISHIDAWA7
143,616,089 *0DCF07A54DB6DC119F99F14DF4E8CB17751C6751 cvqy_
143,616,090 *0DCC7F1869B04C2A2D26E66C4456847812CD0262 cv/wo
143,616,091 *0DC73887B78DAFBCB3F290B6E2CAB3011B0859BE ISMAEL.MUHN
143,616,092 *0DCFA723FAD58D11A4A5FC1C4895126605B487E3 ISPRIJEČI
143,616,093 *0DC5ABBA0EF1B501D84828D96BD92B98F607DCF2 Cwqq
143,616,094 *0DC8A1D54D7921728F5D240F91A418F677B4CE1F cwr-t
143,616,095 *0DC7850563966D0B88E99827F663A1BB5C46DC26 issacthomasson
143,616,096 *0DC5129C323B14EFA1F1BF11B80A32590E096523 IŠSIUNČIAMŲ
143,616,097 *0DC87D284DE2A43F39F697542C74DAF47CF40F13 isy1sucks
143,616,098 *0DCCFD9D915A43547BE17020A651EB9964EA190B ITALIAN CONCERTO: II. ANDANTE
143,616,099 *0DC3DFC60246D9931D6E4E689A4659A2CE9AC583 ivorgottschalk
143,616,100 *0DC99D2E8197FECC4428858BF3090F0680763C06 jachtstoetens
143,616,101 *0DCEFC6D0D84309D94F4E1F454D76530CA988BF0 c!x,t
143,616,102 *0DC8D7537E426AABBAFB5356D742D23551C15BE1 jackimhoff
143,616,103 *0DCEBED8CA9ED97A537137AFB45CBE0DE659DA79 JACOBBYERLY
143,616,104 *0DCA9D66398929D672A2D1AC826CBB1C9B367715 JAGIČ
143,616,105 *0DCE500BE01BB8F4B7F790BE90D0F9463AA8615F czfx)
143,616,106 *0DC63FBC5B844C2A61939E93092F1EA7402EB861 jamaica-new
143,616,107 *0DCBA84E8773DFAFB94541B1FB55B040E70D42B5 D0IK.
143,616,108 *0DC54B3B5D5DD9B34669C154AB806C72D2CA7EA6 d1p:7
143,616,109 *0DCE1CC8B4E02FDE07112B1982015CD6D5033D3B d1$ta$t3fu1n3$$
143,616,110 *0DC34D1BEEBF09EE859689CAB99A011BB416D8F1 d5du
143,616,111 *0DCEE36DCA140106C87B544A54C476EB442880BD D7FU?
143,616,112 *0DC46E8BDE069E5EADFEBEEA62A93B009045C815 da7ah
143,616,113 *0DCDD49989C48990DFA4195AE89DFECDEB817C28 DADELOSE9
143,616,114 *0DC9190FFB771542427FE1DAA8313F4526DAE69A DAHINTERGEKOM
143,616,115 *0DC5FB265B78D3ED222DD47DCA2EDCB9F8963BF5 JAWOCRUZ
143,616,116 *0DC89173ACAF6A5E5D54DD93A69AADF2B104BD62 JAZIENTA
143,616,117 *0DCEE94F19CCFC078E2609E9856CEC5FAD0FDB0F [email protected]
143,616,118 *0DCE686F932EFD08B09B764A225709124150814E DANIAL.SOOSE
143,616,119 *0DC351D30BEBEE44EA2FEA233A51627263B52457 JEFF.SEYFARTH
143,616,120 *0DC1BB604C13BA3D62D076AB19919A0BD5EE4367 DANNIEBENKO
143,616,121 *0DC65BFD78C5EAC321B750DFB92262E3387C6052 DANNY.LANZARIN
143,616,122 *0DC25032C328089A17A880396EF8C1C12729D2B2 DANNY MERKEL
143,616,123 *0DC98DCDDF2EFEA4EEA886468BC6722F9EB9F21D DASHIELLTHOMAS
143,616,124 *0DC1C6ECBCACE4CAD68F5675B346B536F66A4B72 JESSE.MACKECHNIE
143,616,125 *0DC9213F3B7CB7E5BE418FFC93753CB328484E4B DAVISVIDAURRI
143,616,126 *0DC60E7DCE2F0D19766F0BA7E05A79596558FD08 DAZUSVORZUDRINGEN
143,616,127 *0DC511FE7BA83762E2002BD2B7CD970137FAB722 d)#b=
143,616,128 *0DC0F2C4277353C6A885E58D7F8D480D9D854678 DB_$
143,616,129 *0DC9B74CECD77757EE4CC17C3188B428694745C1 db):o
143,616,130 *0DC7A2538BD5FA047729B7EF7429E9F5BC1DC599 DBOMBERY
143,616,131 *0DC568C617737943906429ED73BB8C8ED611635C DC.OF
143,616,132 *0DC315A8D6AD95B8324366E1C423533AA8D609BC DCTTSIV
143,616,133 *0DCB9B4E4F8F0077A187F50062D6C2673C2067FB dde2c
143,616,134 *0DC39DBD7EA7E630982C987B3BEB9EC262EBF227 [email protected]
143,616,135 *0DC1DA936B9F309E56A2E4690AD2A9890D5FF5B1 D)DLC
143,616,136 *0DC03D994FCFD2E69265DE14E5600DD75E5CD67A DDSPW
143,616,137 *0DC667FA497DBD412CAF6C8D2BE2F3B9696E683C dduix
143,616,138 *0DC7FD9BE53B8AD020646F22EBD9E109CF21A426 JIW1
143,616,139 *0DCE784515E51476A08C66DFC6435E02548621B5 DE5N
143,616,140 *0DC08A71A17AEC7D3EECEE8CBFBC628D9BD0F39E JOBSONSES
143,616,141 *0DCE41CCAA8172ED8900BA41000E72299E6E4EBD JOELCAHUE
143,616,142 *0DC1D3B576486253F8FE04C50995F281EE1E8F96 joelibrandi
143,616,143 *0DC1E1E6999EE07D631D03D191C7BEE0D18FBBCE JOHAN-MACKENZIE
143,616,144 *0DC60A56A5821CA783530FC6F62E16B4F2B467E5 DECOSTA
143,616,145 *0DC36DD5D72279B1693D651DB39674EF0FDB5E5C john.moland
143,616,146 *0DC39396DD485E57669CFA3BB9411B68E7CBCC14 JOHNSONOLTMANNS
143,616,147 *0DCA0EF514354A119AAC3BBBFE74D2010E9A4BA0 [email protected]
143,616,148 *0DC2E7E65026E45AD4BE9D769B1DDCE401A4180C JOIEDEVIVRE(A)
143,616,149 *0DC392C268DF884E0A93F9F984E6EC0E736132FA jolie-banane
143,616,150 *0DC5A4D198B3FB9672487EB40B054FF6A95895E1 JONAS-SALOMONSSON
143,616,151 *0DCA54EFC27E535ACB19DC152E5B5F194B5E96FB DELEDERR2
143,616,152 *0DCC93C39DD19F2A509C9C1C6A06B45F62B1C8BE Delerium,.Waltz
143,616,153 *0DC96FE630B0C1CDD53AF6F1CF7511281826DC07 JORDONOTUTAHA
143,616,154 *0DC75BEA72CE1CB6D80943C03E5646571C7B53C3 JORGECOTTONE
143,616,155 *0DC40EF4CD3D16A12B8386D9493E6956EFDF516D [email protected]
143,616,156 *0DC3F55598CCD3C2D6DFA88698B93FA56226B499 JOSE.THRUN
143,616,157 *0DC0D777F12803880D0BB18E12FA7FF756D867A1 joshua1432
143,616,158 *0DCDB667022A0B27B9B7BBF1B8F30720153FAD0A dennissharman
143,616,159 *0DC87B85B5E0656471FBD38446C46D09C913FFFD DEPRIVE.
143,616,160 *0DCF924050490B5B0AFD3D6E4A1148E64336E670 JPKZ
143,616,161 *0DCB363DFDFCAEF61ECB343078877222EA6CE93A derbysh…”
143,616,162 *0DC1626C5F1AF9A92611ABEAF170CB8AF723F841 DERRIERELERIDEAUDEVERRE
143,616,163 *0DC1B26C0CCD4E00C15351F373FBA84429BC0C1D jsow
143,616,164 *0DC5A764BC2DDFDA37EED9823C438E192E450B1D JUANPABLOARTEAGA
143,616,165 *0DC52E1F2003985649415D0828BA0B1EBA33B0E7 JUDEAPEARL
143,616,166 *0DC59CA813F757C8A80129D1AD3A666C5C974D55 JULIO.KASHUBA
143,616,167 *0DC0A8465693CDAC418ECCBEF51C388B631F764D kabisum0
143,616,168 *0DC3642207F9EF781908AF04772D5B1964A8CC56 KALUKALUTZU1
143,616,169 *0DCACD1FDF22704266FE730DF764671A6909196A D=HGG
143,616,170 *0DCF60E2ECF765B22F28D297E63CDEA8881AC860 d&hi
143,616,171 *0DCB70549E0A4D45D0579E0B0C5C8CE88E00A9EE KAPITEL 01-04
143,616,172 *0DC671A758ABBC7B7EFC9CBC96FC4CB87C5C039B KARA136
143,616,173 *0DC798BB405C6F5A7551B34855124160B1623EAE karstenkukulies
143,616,174 *0DC81B2D1D1915B214691944DC621815D2ACD406 DICK FLANAGAN
143,616,175 *0DC00E5C2619785E74482FFB374AAD9924C3F3CD DIDACEL
143,616,176 *0DCF5F68C81210F4F49C9C17E359C6D27A345DFF katharinenheerd
143,616,177 *0DCB063DA81530842A17626723D003C336B6089C DIFFICULT.IMAGINE
143,616,178 *0DC5EBCC4843B08EC2665236E388C46A82CB8DC8 KATIESIEFKER
143,616,179 *0DCE1BB169A5849EE2C51A800CECB6603BB0DCC7 dillonposse
143,616,180 *0DCDAA38F094961B1EF25970AE3CD046C752E3C5 diskettestoerelse
143,616,181 *0DCF41D55D6022CBCD1650BE8848FC2D40428DBD DIVXZ
143,616,182 *0DCFB90A5C541E5212410B324881564A16D1ACBA KENNY.KERRY
143,616,183 *0DC8030C4A75314255501D73008F9BC220EBB84C djnh1
143,616,184 *0DC2CDE76C6DCA208FFA8F79225C798D8A2C16A3 KEVINBLEND
143,616,185 *0DCADC379F13D7B73EB016EA1D301590AEF6AAFE kevlar5
143,616,186 *0DC1D14BF4B9201F62A797F4E3B2597BF6DF9F6E dl-d
143,616,187 *0DC8EE86537921A497BEB7B7C01963AAAE0E07FB d/liu
143,616,188 *0DC15E499E8FCD7EDE9DAC2F286D269D13F1F1B6 DL,,Q
143,616,189 *0DC5EF6F15A39145195DF175C652517401F40A43 DN7T
143,616,190 *0DC011CD4E23A2099749B20908B0549F4B6C1D67 dnbfv
143,616,191 *0DC055169BB4929A8DDCC397D04ECE87A215ED82 dn.co
143,616,192 *0DCCA7CC04934E81E772BB1C876FF66C44F8D69D d!$!nh3r!t3d
143,616,193 *0DCB5ECF5BFDE36C959FB8415399CB7F228DDE57 D;)NO
143,616,194 *0DCA881220FCCD64E5752DFDD22CD36EB59DC019 KJUHOS
143,616,195 *0DCDF72B185F703D79BDF5FF2BCAB3295CB64A55 do&%_
143,616,196 *0DC3F82796AD3C64994EA349D80C146253E50DE6 KKONG5591
143,616,197 *0DC6F37F1B7FF27496A2269544D6676F404EB198 K!LOM3+3R
143,616,198 *0DC92C729E6DA1E7A2846BD705DCA445EAB396CC KLUSMANN7
143,616,199 *0DC7FE3112BF0330CCB5DB5E0920F411016D27F3 DOILABEL
143,616,200 *0DC0DE17AD1C176472EBC245D22BFAC08619A25F KongasLeichtigkeit
143,616,201 *0DC2A9271D420ADC1A08CD5FDAB17F5652676B0C [email protected]
143,616,202 *0DC73FB639ADF09AE536ECF52AD2CF887CC41616 DOMV
143,616,203 *0DC166C361FFDA5FDF312105FB1D7991506CA460 KONSUMERADE
143,616,204 *0DC9D936862E80084A9AA326C47394AC8B480AF5 DONALDJORDANJR
143,616,205 *0DCE60589CB4D2367D18280BE4574C376E398E96 KOREYSKEEN
143,616,206 *0DCA1A7EFFF2F85FE42D480EE2CB5ED10771307A donnwriedt
143,616,207 *0DC5A3C64C0AB374F67C9E52DC6F1B09AA65B61D DONRL
143,616,208 *0DC11E272487360D9DFA89FE0A9FF15EE168E387 DOSJETCI8
143,616,209 *0DC74E6562404EF53496AC63C2BF8364147602AA D-;OU
143,616,210 *0DCBE2CADEA01DDFCDE9576E51E9DFCB8FDEAFB7 [email protected]
143,616,211 *0DCD979CFA5CBF1FDE3CBC83B8B99C75CA744790 DOYLE.KEER
143,616,212 *0DCB13F6B45EB5B573ACE2DEF1FBD5800A69AEA2 krnlndn6
143,616,213 *0DC14A8EF949247D22838978A602ADD77EA0F45C d"/pr
143,616,214 *0DC7D549C1FB3A9DFEBFA01DEFC520D919FAA1BD KUBADIN
143,616,215 *0DC49ABC757A7080369C0F4970079A35EB09E288 KUCHIKUK5
143,616,216 *0DCE5CAA6455B3A6C30443C9DB1F12F0306C4076 DQWFZ
143,616,217 *0DCA389558B8596299692BC3FD6BAEC37F4FB272 KUNNA-GRASS
143,616,218 *0DC3B09DEFC63534E26494428620EA020E701C92 KURTISSTRID
143,616,219 *0DCB157B91312494528C2251C2532BC6973CA356 driblets
143,616,220 *0DC43D2221F783679E953EC60705FB2BCB33BAB4 DRITISB
143,616,221 *0DC4DC63863427A0160EF4D26157843891DC898C KX':
143,616,222 *0DC977D9E191BAF31BB6FF8C518D1C8275655644 D_%RN
143,616,223 *0DCEED65ECB64CC79679648D4B76B7B5A13FDB31 K社だったが、
143,616,224 *0DC2702C24A96644ED058466F03D5AC33F2D27B9 L7/BAA
143,616,225 *0DC714F86B18438CF66C17966A98E36DFD33FB20 DRUSTEMEYER
143,616,226 *0DC4F54FE68E4C5BF594BA9541FA287AA2EA0B31 lacures
143,616,227 *0DC27D2FC97D65184C3C31A8475641F413F9DECE lacyozer
143,616,228 *0DC37C81A832C9609E245EBEF3AD960D3ADD9B35 LACY.SERAPION
143,616,229 *0DCDE237AE9D2A3C096BB4FEC12BB5B896DB1A1E laknuli6
143,616,230 *0DC22429060755B25D9A7F472EFF864316CEC5CB DS"S%
143,616,231 *0DCA97C3DA87FD0E2023BE733D62B7E8D9DC6BD0 d_t1w
143,616,232 *0DC58D92BAD9C62199ADD71E381EFE5B5D734C09 d)tqt
143,616,233 *0DC0111FA45CFC32A43EA88840F9406EEB7CF7BD LASHUNNDAB
143,616,234 *0DC695F6E8DB1AAB91268B32605C37FE4611EDF4 LAURENCE.BLASINGIM
143,616,235 *0DC410C5C54C1BCBE20E81196232DA3A9A7D3BAA LAZARO.FITTON
143,616,236 *0DC250F73048946D26B27AF541245E794E139E31 LAZRAEL
143,616,237 *0DC317DAEDBDA5A0FA5013B108B37D21C06DAAE6 dv2+y
143,616,238 *0DC101CB297C8795767FE8F2CA803865A5F2F9FD LE4$HN9
143,616,239 *0DCFE88DB9A43E9D9F3174DB8A7C0F20D722E7C4 [email protected]
143,616,240 *0DC0C81D05F37B806EA3277FCA1DE8D62F6DEF9B DWB%
143,616,241 *0DCC4434BAFD599A9296ABA957CC468B85BFA0B2 lehrbaum2
143,616,242 *0DCD96C2A1D3FB493A465FF27B90EF63B197BAEA DWVDC
143,616,243 *0DCBE594A0F5BCD83003F08FC0E575B5A4076CB4 dx#_;
143,616,244 *0DC448F0E9B85DE44AE482B0066DE38B10410B83 LEKIKIDONC
143,616,245 *0DC0105E60CD5BE28707461C688D1B41A35F5273 LENAHJ
143,616,246 *0DC58F39DD36D35E12659C66F5D6BADBC32FEFD2 lenardbirk
143,616,247 *0DCA480F7CD8B665A57BC6FFD4E8AD4B34957E33 D?Z:
143,616,248 *0DC1A1BED67B0E82862EFE97212F6919FF80CED0 $E1F-$ATI
143,616,249 *0DCA6D56DA65619206058070C3293CB5844D0819 LENI'S-SMILE
143,616,250 *0DC4C6ED0B12BA5CDD2D5A372B1EB41D6F9575B2 LENNYMALAS
143,616,251 *0DC9F8845DF446C647FEB09DB4B124A7B91AF323 lesionalmente
143,616,252 *0DCB3106D6C8959539ADEBB2CB22240952404C59 leslie.lundberg
143,616,253 *0DCB583EAAFD698D8C70818D776B492153FC4CAF lester-buenviaje
143,616,254 *0DC03E5C29AE8A4E029CB35CA3F6425B6799D677 LESTERKALTER
143,616,255 *0DC9D75615CEE41CE025439C2FAA0094B34DA819 ea&p(
143,616,256 *0DC68B2478FE39388CE0F24980B3146E39938B7E ea.u
143,616,257 *0DC2A4EEFCF6A30652F2602ED1CE413956F895CB LG7RD7
143,616,258 *0DC0504ED861B0283C10B37E74854BECC179BD5C ECHOES-TO-YOU
143,616,259 *0DC55EF77B22E9799E57DF0865CF8FD08664BCAE lifting-the-rib-from-the-waves
143,616,260 *0DCE84FC25ADB52675ED27E794A70EE3B9108926 LINDSAYMUYRES
143,616,261 *0DC2E3113CD42D16583F5B921C8D2601544C98EB linka
143,616,262 *0DCA32B9B02CC62A9726C593540C1DE8CCDAD450 lisa-birchfield
143,616,263 *0DCEFD604BC6E1405781B9EF4E740A88B7D06490 EDISON.DABDOUB
143,616,264 *0DCF7BEDDB3B509B3D36135C142830B8312E385B LLORIEE4
143,616,265 *0DC1721E149868DD882AAEDBB4DBB61D7407669B EE)r
143,616,266 *0DC054B02BC564FA986F338F8C03DDE0C927E03C ef88d
143,616,267 *0DC0ACC64C4A9AA499F4162DFA6832AD99351192 loganestelle
143,616,268 *0DC042F0E897269CAB1A6F278E693F184F2CBA54 lolans
143,616,269 *0DCE91A8736B94A17FD5DE71DB54DC18C8F0CC33 LookabillSr
143,616,270 *0DC01AA644DA897EA6C9D3F17CB76BA6D8D93823 looseleaf86
143,616,271 *0DC818E481B7DDD9D5A186B83069331EEB791B91 EKSODUS7
143,616,272 *0DCEAB97A26B25352554ACCCB25AA1A6AE4DA34D [email protected]
143,616,273 *0DC76A160FF5ADFFB00621148DA6E5A9FDFBAA3D [email protected]
143,616,274 *0DCA895345C56B68EA736C85D28EF8658EAD2EBC elec+ro5ur9!c4lly
143,616,275 *0DC9BAC9A033E170DE50C6081F330BA3F74AA793 ELITCELL3
143,616,276 *0DCD0E5CA4EA576B46E36177273F7F5913C0BB60 ELW/H
143,616,277 *0DC73D0534B0611614D8145601A0936F37088F77 LUIS.JESSUP
143,616,278 *0DC73A5990D49ADAC95296F48BEFB39A2BFFEEE1 EMANUELSTONEY
143,616,279 *0DC784902033F6FD2D0B05E5ADC9E6B90C018569 lunjahu9
143,616,280 *0DCEDC1FAC53B19C14F379CEC76AF40C98ADC656 LUPE.CRONOBLE
143,616,281 *0DC3C8A1BC55B1709B2AA39BB6D5E1B68BB68590 [email protected]
143,616,282 *0DC4DE014F1D96A89C8057D54FB6F7165B441D83 ENDOONTIC2
143,616,283 *0DCF6A8A0841D88A26602526DD69B600C9D0F46E enfantsterriblesles
143,616,284 *0DC63D619DEBAE2C044558C41CB633D2C584E866 ENNOSALB7
143,616,285 *0DC9BCEC71967D1C83F128795169F73B4F18E6AB ENRIQUETARANTO
143,616,286 *0DC34DA898E3B2E64617D2596CE12FA596E7C52C ENTER-THE-ANGEL-(ALTERNATIVE-VERSION)
143,616,287 *0DCC340B911E9D49D2BC44F48AB6BF3FB4FB9E1F epbn
143,616,288 *0DCC5372D3907A35D644B7A0E7E55F2B63AEF813 epil_
143,616,289 *0DC2DC7984F7D87C8114B77982B1E61A7F9EC5BC EQWWQ
143,616,290 *0DCE760131426909A0024DD4D1BD562A0BA516CE @ER1E5
143,616,291 *0DC8247328989903FCD91DE58FB450ED95246412 er3gq
143,616,292 *0DCFA56092099349EC18C7BDD76F081DB633C621 ERROLPATERA
143,616,293 *0DC0E42DC9EB3F0FBE2DABE897D9C4CB4D7334F9 erwin-rolle
143,616,294 *0DCBDF5C53DC06818486060BB11C0FAEE1DABE48 ESIWLEEHW9
143,616,295 *0DCF4B55B9D5864DCE112B25BD4E67D1CD4B2780 ESPERANZA885
143,616,296 *0DC1FD323380ACE31A63F71B51F186D944B2F0B9 estavez
143,616,297 *0DC9555809C1C6E92B60E44EADCC77ADF541303E ETCO
143,616,298 *0DC2B5DF5AFA5EF949D382E4927C413CD3BCA3CB LYNNMARMOL
143,616,299 *0DC0C7DD9003FD7F25BD65737E5E1E20DBC1E010 eugeniofuchser
143,616,300 *0DC1CFEC0F0A014D16FF3545BC9846277AF40B07 @M0RPH0U5LY
143,616,301 *0DC35F2FEB28AA20B4429BB95B98C2DEB2955DE3 EUSEBIO.STRUMPF
143,616,302 *0DC0B6A211D9FF75915931F639692CDC7BA7F35D M4N!FES+S
143,616,303 *0DC42AC64500D25130F3C7A2413B317345087E8E EX7OR71ON47E
143,616,304 *0DC430D6B4EC448EC3A2A64224B2D7F9A06B05E9 EXACTLYDR
143,616,305 *0DC79B4E5AA732D8C0EF958B922F0BF2E2E5ED88 magbotes7
143,616,306 *0DC3A3D2B0D4A53657AEB3ABD2A5D5E6AECE1A9C ey,lq
143,616,307 *0DC092217F54B4837292D0FE0144173B639F7D3B F174539
143,616,308 *0DC5E0F2DC35EA8C19A5FB6E3D4F8C86C4640DC8 [email protected]
143,616,309 *0DC7EC0ABF5E986BA71205696B9A97D101D2C430 MALCOMNAO
143,616,310 *0DC991DF3DD6BFC2A587FEBC6633537AE3786790 MANNERHEIM'M/A/N/@/R,H/EI/M
143,616,311 *0DCFF905DCD59512D0305F60A921B96681ECC0F3 [email protected]
143,616,312 *0DCF19DD01294C80E124BC1FE8BA4328BA7F62B8 [email protected]
143,616,313 *0DC1499D963481A9875F0FE1E4FCA0CA75B21FD8 fejee
143,616,314 *0DC030327B82C7CAE0D0147818EB354E7367FA7D MARION.ALLWARDT
143,616,315 *0DC2040DFB4D95A12C509E7613BC960F686A3190 mark.kenward
143,616,316 *0DC8C4CCC399EABC9437E3C0C661F1139995965A MARKUSCOFFIE
143,616,317 *0DC4BE9B6C92BDEF701683901A151D7896360D3D MARLIN.ALEXENDER
143,616,318 *0DC4C72329913A38B4655A03ABA2A46BCA2E5A9D marsha1234
143,616,319 *0DC7C2A16FD0B4B96BFC70C1190C96A3A37501E2 [email protected]
143,616,320 *0DC2C67EB693F70FFA62ED12874437B5BB77A9C9 ˈMAːRTʲIJAɪ
143,616,321 *0DC1E53E7FC8905A512681362ADA4A757D0BD323 FIRAS-ELYAN
143,616,322 *0DCC23D13675F7B78D45D49023A1D61A7A90085B f(k!
143,616,323 *0DC451B6A5F5EF7253900E756B64754BF91F6340 FLAG OF FREEDOM
143,616,324 *0DC85CD06D6037BA8D4685BE5584858A7EB44CCF MARYAMDELEON
143,616,325 *0DC03F17A0EB2B6DF020DC6900307DDAF9EF54DD MAS527749
143,616,326 *0DC0B8B20916CB9F5474132A0E6EA2D4BEB5A62E massa-god-world-(feat.-wayne-wonder)
143,616,327 *0DC0F478EED452DB1FD9976DE5F4C37FB87AD6B9 MATJX
143,616,328 *0DC7303CE0E40D89F0E866DCC2905A61088C2C68 FORENSICSCIENCE1
143,616,329 *0DC85321B89DD3F555BAD4E1EF0AF0E4D18F502F FORREST.HEMINGWAY
143,616,330 *0DCA43CF42E215582D28613FBD2717D6750F4BC2 fosteraviles
143,616,331 *0DC999460DB9F30757D6A1DBFC4D9BCB91358FC4 fritzkeas
143,616,332 *0DC33D6D963D863A6A06B5E3303077530E6DB43D [email protected]
143,616,333 *0DC433D0D3A68AE16FF9F5EF44F17F3ACD66ED2D MAXFOR1
143,616,334 *0DC425876A8B11A118B7CE003E7A94889CB0E8A3 maxwellbuttner
143,616,335 *0DCEDCEDB909E7D2B8FDEF61DD90C050F2F25A6D MAYUKH-GHOSH
143,616,336 *0DCA1C71FE0EFFE95E41F124A84ADD686177CFF1 FVICODIN
143,616,337 *0DCBFB7A089CCA35049C5301049E375D13876C67 G4VI4LST34U4
143,616,338 *0DC52E8108A30A6E66D260BEE5F77680385759C7 GANGSTATRAX(GTOMIX)
143,616,339 *0DC04EBA7E13C894F1F1669E43710CA949C429BD [email protected]
143,616,340 *0DC302728948D8F7A99F2FC861342D11CC0CBDF8 garaganz3
143,616,341 *0DC671AC679D1C7E03D7C4B2511675FD0F3C3C96 GAYLORD.MCCUAN
143,616,342 *0DCBC04ACECD4D9809A165BF799A107677AAE549 [email protected]
143,616,343 *0DCCEB63293727EF395C553C1A3E338670EFC812 MENNGAGDE
143,616,344 *0DC4EBFDF4A7C60948D6969428647B0FA9C29ECA merleaivao
143,616,345 *0DCFC3A3D3D1370922B0E8353CD9209A083F5FF7 merlelall
143,616,346 *0DC0A3E355099ED3DE2C7EE1936F606A5B99E9A0 GEORGEANNE
143,616,347 *0DC58D6EF197D52850D320C272CC574FFDA798F0 merlinmathewes
143,616,348 *0DC9D209C025A3C2DBC84D0A5C776A56F5CD6F00 GERALDO.DUMOND
143,616,349 *0DC7CB6A313CB5C91C064959BAE69DFC035B6922 getitwet(featericakane)
143,616,350 *0DCA6422F7331E5FCD95D64C2E683231C9E73470 GEZAAGDE?
143,616,351 *0DC2009826597A96F893E356B23B566A87114FD8 michael.minicilli
143,616,352 *0DC2DA8AC06871E1E87360CD221E6954F7A0FD63 MICHEAL.HOMEWOOD
143,616,353 *0DCC566EDA668D00A83AB0C7DC97C37DB366FCD2 MICKEY.PLAUCHE
143,616,354 *0DC14622795B79206C330D524056DDF70D571433 MILFORD.LEPKOWSKI
143,616,355 *0DC4AB24FB44F5F8E295288A029815A850FAEE63 MILTON.KNAACK
143,616,356 *0DCF86A572DC7286FC4F2E278841A723601E8020 ghrim.reaper
143,616,357 *0DCBCBCBBCDE82F9FE5BB855FFE8F450820328C8 GIALGHIAI
143,616,358 *0DC37CD900A329F376DA0D45F6D6206BB2DA73F3 MISERERE---LIVE
143,616,359 *0DC8C9E014995E4BED98F997D9C817337982942E GINA-LOLA
143,616,360 *0DCA6F5C05BB7E068626DC07808022FC37EFD07F [email protected]
143,616,361 *0DC94639A966817C6211B160C1F5FEBC6C0A1FDE GLIGERONT8
143,616,362 *0DC56BB9EDDA2EECB53786CD7E50E66F458BD028 GLYCLPDS2
143,616,363 *0DCE7F26685F46F28126A80402BB68D8A3B1380C GOOD-BYELOVE
143,616,364 *0DC96DB14BE3AA97371241D9C29B871532FE1A02 GO.(original.karaoke)
143,616,365 *0DCBFFAEAEF591946C9B633C79006FBAE5DEC6D4 [email protected]
143,616,366 *0DC4B189F833AE58DE29F597F762DF4DEFEB2447 MOHAMEDBOYUM
143,616,367 *0DC0557DEA117162065E8BE7FF600B1FF840292C MOHEDALS
143,616,368 *0DCBBB5A072FA8B0EDD144EF3B47444C0C73533D GRAFIKKDIAGRAM
143,616,369 *0DC738AF1D1A6D6DF04B9A966825A34AF7171A17 more-jazz
143,616,370 *0DCFC8FAD012AEE4AEA33A8EE1966964A900254D MORGANMCCLOUD
143,616,371 *0DCA1BC30E257E06C52339DE53CB6BDA06242FBF MORPHENE1
143,616,372 *0DC63CC646C17D379B0AEA483F2653E7C42F1F0C GROUNDED(SLOWMOTIONONICE-REMIX)
143,616,373 *0DC3217D0F793AA2BC8BF1B580EEA75A50E7B04B mosespivey
143,616,374 *0DCF2CC0B530260612B6C41851A0C8823BA52A47 GUIDINGRAY(SPACEJOURNEYTOFUNNYFACESFROMFOREIGNTOWNS)
143,616,375 *0DCF7556D3129390B604AE8CF8D29B45BE82CA86 .MPQ
143,616,376 *0DCC9F1E387B3AAEA2A4D7831688EE1C86A081C0 MrBadGuy(orchestraout-takes)
143,616,377 *0DC6AADA618C558FA2DD9B143ACB7DD79FDAD933 MUHAJIZK
143,616,378 *0DC20A1668340682AC21787551A9489F76CCCACB GUYMARUNGO
143,616,379 *0DC8BE73531A299A7E5ED35955FAEC4D52DBA4BA [email protected]+35
143,616,380 *0DC8140ECFF2EAFB05E4EED3EE1B27C29C09DCCF mvv}
143,616,381 *0DC146C98148908614651ED868F6F2310BCB7833 hamillton8
143,616,382 *0DC30C3DD1DD7B05ABDF70DAD88C135563EAAB62 MYSTEWART10
143,616,383 *0DC263625A613D3003F8898BD7EABF369FF4D974 mytwelvemonthsareexpired,andtyrusstands
143,616,384 *0DC4B1DB0BF1A0C8C4C9AF93FE299D03A345FF25 N31GHB0RW0RK5
143,616,385 *0DCE775C236357474E58FF7F98CE7A48BAE331C1 harrisonosoria
143,616,386 *0DCF7B66B2DADE1A2FF026E71D058A9B5A1A86A0 NAARAU
143,616,387 *0DCE32DBBC844467723D7286D70A43C3F0ED4888 hassansoberano
143,616,388 *0DC3422991FB319C0C4803467EC4E1B43F7F2414 [email protected]
143,616,389 *0DC12ED52F796B2EE2C58988EBD92FE73A00D992 HDCXTW
143,616,390 *0DC1FEB5C66311CDD899F8438800A5D86657BA2C he?
143,616,391 *0DC82CBCB4BE058D8F21318B910B5944C1BF6772 hectorkellerman
143,616,392 *0DCB1E5BF318409E939DD6B41ECB0A29393D4A68 [email protected]
143,616,393 *0DC34D6EDB2845125FDAF7305DB97968322D9D12 helderdheid5
143,616,394 *0DC8B7BCE11328C8E4D774A22E05646D72DBAC38 helperinä
143,616,395 *0DC1F27191B11C463207F076BADCA2656709B653 nauticawicked
143,616,396 *0DC8BEDBA2991484EA97C3A07114AE1214F902B4 nayarub3
143,616,397 *0DC1B42849A35CB87A51C1115CE385BF087566F0 nbvmnbvm6
143,616,398 *0DC8FD97B69161CB05256B063C536038C00F4320 HERBERT.MARTINES
143,616,399 *0DC1613FE42B0361ECAD7FA0295152CCED95F1EC HERBERT.MCGARRY
143,616,400 *0DC89A1A1246B7C2EFBD55C597807E451C6970C0 HERBVANDENHEUVEL
143,616,401 *0DCB69AC7A92826ED808AF49EC1CBC89F242F235 heritours
143,616,402 *0DC4C2C3D5B946AD9E0558490C9D28407A61B11C nelsonduerson
143,616,403 *0DC9556C2168DB5929E29410D0D6C5A93819CABE nelsonregusters
143,616,404 *0DCE2AB4E72356C8D872F3047CF5BF606AE699A4 HEXATETR4
143,616,405 *0DC8BA28BC799FD14EF7F29737060CD3EE2EA384 Hey,-hey,-hey.-How-are-my-best-girlfriends?
143,616,406 *0DC51B213D24BEDC8C27C23AE8A6F64119CF7B5D NESTORBAYLESS
143,616,407 *0DC4B6251E322ED8F3C754FA397F8744D8380B96 netalatinaconfundida
143,616,408 *0DC909F2A30DE83839ACA49B28D19D5DE9039B24 Hi-Way-Fi
143,616,409 *0DC633E06DED27E051DC1DA8B19D3077FBD347F8 NEWSBERG
143,616,410 *0DCC91BE3B973E120EF8591B3A9FDF3060FF56C4 ngài-ngại
143,616,411 *0DCA1015D704BC4466638FCED3659D975E915A3C HOMER.MUSTAIN
143,616,412 *0DC2EDFE650CF1D52F4679A2F7F6B508A679A8CD HOMO1O9IES
143,616,413 *0DC58A49ACD1F582EC20ADEE0FF3E2C75007F588 NICKOLE.MOLINA
143,616,414 *0DCEA8586A4775AB4F53467CB948F02BF36D5FBD NLYHTHPN
143,616,415 *0DC3F3A9EB4EBABF82E6F46B82AD93FC94DAD8EE NNENNA UKOHA
143,616,416 *0DCB936279F62B7FEB2DDCC3BE379823ED77E8E6 hornissenvölkern
143,616,417 *0DC300A27EB49783AB10ABD3AF23E46280607E03 HOSOKUTED
143,616,418 *0DCE2E4F7F66A0BB964A31AA1893E167BA397239 noedamis
143,616,419 *0DCF675F0CF7E2AA5522EA7DDFD9A941BBE8B0E0 HTELUSSA8
143,616,420 *0DC85F1B53BC71CB51219A78DCEDEF36DDDECD4B HTTPWWWBIRDNATUREC
143,616,421 *0DC9444594F74ADE066B55154EFFBB5DEF2DA1F1 nominano.
143,616,422 *0DC9067CAA50A0C0AF6DCBF56BEF58B71D862E5C nonessential.,n/a/n/i/'s/e/n/s//@/l
143,616,423 *0DC558AEC28FA565FA6F12DAF32D5F510EF21160 [email protected]
143,616,424 *0DC0522D3149772725C54FA59E7A20FB20245E01 [email protected]
143,616,425 *0DC92965843715518CD117E06AE4AE1DE499AA71 hueyshott
143,616,426 *0DCAE590A8A9D1C93AC33744A8889F50F4D991B0 HUGO.SIRMANS
143,616,427 *0DC552CE3A85980E106603483F44E0C42AF102E6 norivie.tubis
143,616,428 *0DCEF96112891C37F91CEF977848B12BC1A9CECC humified
143,616,429 *0DC07E83AC664E0343717C8E793C895A90EB4548 HUNGGETTMAN
143,616,430 *0DC85DBCFC4CC17A44F5FADF732D7FA1D44D74CD HWAN1234
143,616,431 *0DCB6E5D3FACB6F8F550DF9BB9FA5CF17FAFF881 np6sui2qg5
143,616,432 *0DCD6FFABCD23B32DB975FF58A3B428649DF1E7D NSCHNKN4
143,616,433 *0DC5C23681926D579519A090A83EB6D9FFF6FBFD [email protected]
143,616,434 *0DCE3663B45B3636DA21968810A529EC5D0A74A8 IAAMSIANED
143,616,435 *0DCDB1FFF81DED697CDA6799F09FC4E69050B680 iamcoolbean1992
143,616,436 *0DC7AA1897A718EE4410BF1694DA0DE64D84A997 nz1158
143,616,437 *0DCE63CEF56D5960543BBD1D5CC10E05AF8C67A4 O468WVV856
143,616,438 *0DCBD6FC7DDC1C494DBD6B749D8AE2C160DF7379 (O_).~.`<##8
143,616,439 *0DC0738DD1B3B776C992B2C1EF25F4C166ED76F7 [email protected]
143,616,440 *0DC68D3BD6D742849327216F5711E9E5AD11D7AB (>_<)-O~-d==B
143,616,441 *0DC64D9ADD916F4682E50A3100BB68B876E304C2 ODELLBAINTER
143,616,442 *0DCBB752B24CEE5F3EDFFEA34B655BE283E41C79 OhmgePatume,PocketandAspirin
143,616,443 *0DC8271C6E606D63678137B5222B5BCCEA686B1D oikwok
143,616,444 *0DCE3A4C0568E0EE74D1094948D4B0C3EF745D09 OKUPACJE
143,616,445 *0DCC8D01F83887ABDAF4302B833B1945A5D55B86 OL.DE.LA.VALCAMONICA/LA.VILLANELLA
143,616,446 *0DC1F999DB42D043861F4BE9F18CFC05FC17D555 OLIN.BULCAO
143,616,447 *0DCC316908C31410D189A3F845BDFA6EC52DA2AA omarpolidore
143,616,448 *0DCF12C3D321401EB3FC39782DD3437723E21F26 ilovesailing67
143,616,449 *0DC3A4DFF145AC4AE7306926086FDDBAF7D2D9BC ILUVCASEY24
143,616,450 *0DCDE71AA66281A2E0666D85FE2599D34C012E5D ONXRT LIVE FROM THE ARCHIVES VOL.7
143,616,451 *0DC8D542150A00935F6F9EFBDAB756A48B5C32DF o>< ~ `@##p
143,616,452 *0DC1DEE3E300A0BDEB4546630074CBDD533DB601 openingsredes1
143,616,453 *0DC419D69F7CEEF135C54329A2845ACABEC872E7 [email protected]
143,616,454 *0DC8CD3F50512010D562693E0BF2E909376A1D34 inbassat6
143,616,455 *0DC29348B850BD95647705A929059E17C8CE0D8C inboxebsw
143,616,456 *0DC9F5B05A4BFC12B03669F905B4FA0753F7360D ORDERBE3
143,616,457 *0DC038CB0319F8496D9AF59AFF633799D349649B ordnnntntg
143,616,458 *0DC80AB7EC3D935AB2691278BA9CA07D114CB0A2 INCORRECTLY.MEGAWHAT
143,616,459 *0DC4E370DC05A918DD4569D038EDB24FB6BA30E6 INDIAN-
143,616,460 *0DC367EA7357B4144C4D170DD5C3CF0414F6D6BB INRR|YSA
143,616,461 *0DC9B8FE59EDB58298E7B973DF52C02CE728FDA0 OV3RZ3A1OUS1Y
143,616,462 *0DCFB045FA07357A4DE33EF1E35F1E57EFF5F284 intro-[live-scratch]
143,616,463 *0DC5B5969469385E4422B5BE535065010F1646B0 [email protected]
143,616,464 *0DC8082B2B47E64AB2E40C6A3BB681E8188A5753 IQQU
143,616,465 *0DCFF894604E65F261CBA8639EB644362C652D97 oynammiş
143,616,466 *0DC1498FE2287AA485FA6397F0FB21B46308A00B P01IC3.A1
143,616,467 *0DC5A2F02AE192211C2912C31FF95E6E71225337 p0t$hape
143,616,468 *0DCD7EC66A86D98B3053462B10EF189A6188FA20 P1210415
143,616,469 *0DCC9CC6093D83B4DE711DD5D2CA0F07E1177E13 P1837807
143,616,470 *0DC6D0B1C31C9447DE43319B1826A501E57CFDC5 p4958
143,616,471 *0DC5493F116562AE216A1221851A8CD452AB3F0C issentalkopf
143,616,472 *0DC46134FD0016A55BD58C3DD7304207447E444C [email protected]
143,616,473 *0DCC948DD12C4FCF5FC1FF798BDBA645C00234F2 PAROLEQUESTIONED
143,616,474 *0DC18A2212EFFA788470C0377CD9220E51AC7097 patdopf
143,616,475 *0DCA2053BC0E65D567235194964D6FC87C32E4D0 JACKIESTONEMAN
143,616,476 *0DC6FBE8F81FBA507CA097D33AFFCBC6148CDC95 PERCYBUEL
143,616,477 *0DC83D8EE42B6DF0331FA14FB3C8A707A2AF82AD JAMAURIR
143,616,478 *0DC76EC179324AA66524FEECE1ACD431E4DAB24D JAMESOPYD
143,616,479 *0DC1E5563B0A29B1C56233DCD922E82872E17BB1 jamespatrickpage
143,616,480 *0DC1DB8828E807BB7EC69E5F0A23F6DE1F46B39E JAN-ERIKANDERSSON
143,616,481 *0DC89459F13C41FD91F7CA0E97B05EE2E03DB2F3 JARREDBEGONIA
143,616,482 *0DC24FE591D880A77C5A5C0876EC636B14611417 JARRETT.FRASCONE
143,616,483 *0DC62E0DD62D9D407614E9D7CB5BB736E71F7055 phatmanotoobsw
143,616,484 *0DCBB31156E68718F9F8A1C861F34F968148919F phiba81
143,616,485 *0DC84AC85072F1AF29A459A8AAB256857B9E8606 PHO+OSYN+H3+ICALLY
143,616,486 *0DCF1B17F7D22FB914B807119A178A3640AD789B JAVIER.WALLETT
143,616,487 *0DC99E53650910428F053E2C6D6B578A9AF0BBB6 [email protected]
143,616,488 *0DCEE6A50CDB2AAB5AD08DFE9C3614ABF3E6BB12 pinnul4r
143,616,489 *0DCA942D982614B729DAFA7EBBF03B45B3BE4F3D JDAMOISEAUX
143,616,490 *0DCF9F22AD06108D8F472D8F583116CC818F3CF0 jeff.deyo
143,616,491 *0DC199DE04B9275D8942AD87738326B7332B10DE JEFFERSONMACINA
143,616,492 *0DCD288A4F108CAAB3D8560AAF4F08951CF2ECC7 jeffreypearljam
143,616,493 *0DCD6A25FD77A6CFC22979C3CC26D1CD90E6DCBF PLMPBLD3
143,616,494 *0DCA3F084E3BCC4BDEF3F872D5559B9CEE1AC3E8 P###>~O>-<
143,616,495 *0DCC205C1C54D46A7B53E36B08B09869004E04FB jerrellsanabria
143,616,496 *0DC4F6540EBE990A4CF79CBAB542763D997D0D29 [email protected]
143,616,497 *0DCD6D965F416A85E4074EBDB7EA8F93AB0A2E4E PONMANIANM
143,616,498 *0DCCCE54FE8DBA907D6934173806E5F001513B96 JESSIE.STROUGH
143,616,499 *0DC09C0387F93D1D67F0D6DC11F61E13B3E5DE0F [email protected]
143,616,500 *0DC8AFA00F6C7581EDB1A6EBB4215B44E1293E0F JIMMYSHULAR
143,616,501 *0DCC1E0684A6EB43DA2AD5D24704D9AFEF258AE6 PP*}X{
143,616,502 *0DC9BCE40B3A63D60049BC59C1B10432BC5200D5 JLAWTON
143,616,503 *0DC0A737F6F8C3768999CAB4FBA006E583B24250 joe-capella
143,616,504 *0DC57FC9AFF0414726B378A116CAA495F7D70A0E pretabulate
143,616,505 *0DC8F6F702BBD8AAB4BEF8305E676FD8E0799A25 JOESPHHARRISS
143,616,506 *0DCDF4CCF265D1ADDF54541EA703512B267E9FCC PRIESTCANDIDATES
143,616,507 *0DC60E529D81763AB781343DC8443CD339E4DD40 JOEY.LINSDAU
143,616,508 *0DC5D3EB513604412C6150B5BEB9EDDD1EEAE30D PRINCEHAUBERT
143,616,509 *0DCA64E20FA87BE85464A23C910D3F7CB41A7C73 johngeroy
143,616,510 *0DC4FB86022873ECDF51D8ED33A69AD8278F16D4 johnkranick
143,616,511 *0DC5671FC12700EBF8429A7D91A19D4A7C915A20 johnsalton
143,616,512 *0DC17EA8C7465CC90B82F18FC91DF03590FD9F65 jothamjayme
143,616,513 *0DC500FCBB673FD32B96FA8C2DE26530BCE3AD2F JOUFUKUBS
143,616,514 *0DC9154D8D3AB2E07C728317330D4B7F7CA1CBBA PSWMAKI0
143,616,515 *0DCE9E1A86E3CC5975CEFBE468F2B38AA3154BDA jr九州高速船
143,616,516 *0DC95C9E3F64E1FD3DFD41A26D7A0880A486F177 JTARZAN0
143,616,517 *0DC1B32629327C8B727B2BE2E563111033547440 JUDO-EN-LOS-JUEGOS-OLIMPICOS-DE-MOSC
143,616,518 *0DC965E5337F23A9AA732229DAB84A22B9CE4E48 JULES.ROULSTON
143,616,519 *0DC0E77A31F200171B31BEBF47A5C22A61EB4842 PYC42USS
143,616,520 *0DCCCBA94515C1B1230CD6A0814005D651AC6B09 Q~}-
143,616,521 *0DC52425C1B8515BB57C5CAD95DB8A38D3E01168 Q===>-~0~O-:P
143,616,522 *0DC860EF9EFB84A71C2E51456E5D84C56E330B8C Q137182
143,616,523 *0DC24A097A1705448EADD44B785C4BE6113FB229 JUNIOR.CHALLBERG
143,616,524 *0DCD8575A931905DC925B0F8FF42ABF18D9DF808 JURAS.DE.SAMBA
143,616,525 *0DC5730506DB4EE47CD09F3A23BAA2791E5DEB9A JUSTIN-HUMBARD
143,616,526 *0DCB7BEDACF9D54C30EE1ED9C9D13177C7CC8427 QM?G
143,616,527 *0DC5B46F224635ADBE88A67A95BFA2C4EE4A9D15 (>-<).~`.~`Q-P
143,616,528 *0DC8C5A89B5C2D5BFDAB620035BF4E32A33A7871 Q====P~0.~O(^_~)
143,616,529 *0DCCF1726F7FA88E4BD192DF2B4A30CE26F399EE [email protected]:P6375
143,616,530 *0DCDDE9343C10B8BA5CCD1EA35F3547EE57A4571 qs2r
143,616,531 *0DCF750E14D72408D546817F62D6A0C1D6AD8D7E q#@**Splat
143,616,532 *0DCD4CAC56A19937A865B9CC8F8367966D5675F7 QUAKILY
143,616,533 *0DCB7765A2543608CCB122BA4E82B6E56D711E73 quatrayle
143,616,534 *0DC89B9438D9994DB45F3A87F1ABB10088CBF130 [email protected]
143,616,535 *0DC9680D51463C48368093CC7E52CF91A2940FD1 [email protected]
143,616,536 *0DC6AFE121AF3C5DD77E01EBDEF6DC143380D7D4 Quinteto-Francisco-Canaro
143,616,537 *0DC35391F65B2A8EB01A3F165D9022BA29866242 QZH3IPUPR68J
143,616,538 *0DC932B1D01454E24E34D148C2985FCD418E2462 R3F3RM3NT45
143,616,539 *0DCCB482A639382BB14CF20242990CA52BF8FC91 [email protected]
143,616,540 *0DCF9B535A4801095EBD1DD264E4EA4765E5D5A1 kara-colvin
143,616,541 *0DCB628FF42724B3DBA9F814E249D878AA5C3A70 KARATAJŲ
143,616,542 *0DC543EA61C6EE9FC600C1B12B3AE378DC8BA172 rafaelweinmann
143,616,543 *0DC6CB4432C0455F32BEB22F0B53632DD0A7F868 RAMPILOQUIO
143,616,544 *0DCDCFA0C451AA0D2455B45C1926BDE20FD301CA rangerpackers
143,616,545 *0DCF3D4A32E55894123B9590A3128713F3766048 RAPED.THERE
143,616,546 *0DCB796760C37ACDFA41723E69306719730CBF4D kennydoncaster
143,616,547 *0DC88D5D60872AA5E597B81C922EA04CE19D53F1 RATIONALISTIC
143,616,548 *0DC69CB333E46B91041F69C77CD4648BE5851DCA RAYEN'S
143,616,549 *0DC6B2215A4A81B6DA23276E1E9D3360982A2275 RAYMUNDO.HAILSTONE
143,616,550 *0DCAC07E401645454EB9BFDCF654ED18DAF4539A RBASALIM
143,616,551 *0DCBD578E689505FBEDF10B54A90BCEEF2BD3FF0 ki"b
143,616,552 *0DCCB2C3F256595FC7F23E4CC43FAF6BEDB04885 KIKIACAN
143,616,553 *0DC253CA926ECA9AFD3F9437741BE084F9EC60DF rebecca-winks
143,616,554 *0DC19C4831F25718007BA1CFCC7A37702443652D KIM.MAGDALENA
143,616,555 *0DCD7CCE6FF49A962CDB92FE9D3CDCDF15C10B24 RECENTLY16
143,616,556 *0DCE97D9C55FC3C4031837CD31CF4BB42FC7D7C5 reedmammoccio
143,616,557 *0DC7765B5194D991180C9F7592C853829CBD7BC0 klerenzaken?
143,616,558 *0DCF291E1E09B9C8996467717276B98D8C8BC28D REFORKALKNINGS8
143,616,559 *0DC47FD48CB8423C8F9D9DC9D578501D3099E543 ko3
143,616,560 *0DCD89F29F062F3BB89E284F49F7D4FEF565444B REGNIKNEG1
143,616,561 *0DC718660D26564FF0D465918F9038C389DE6550 [email protected]
143,616,562 *0DCB9D5DC0530F03D75E3866419DED94234721CA KOJUUTO1
143,616,563 *0DC8E0B7F6EC1A5A57F9CDDD2BFF905FBC47D024 KONCIPIRAM
143,616,564 *0DC7CE8E27629565ADC536645327EE90C06DDA4D [email protected]
143,616,565 *0DCCD39F0E7DB4FF27EF3F635E8D21D9C26D85D7 KOPELP
143,616,566 *0DC3255040BE97F37232352C5C69376BEDA26CBB RELLEUQN5
143,616,567 *0DC71C203790CBE7ABBFA479F8029759BAB7774C RENATO.KIDDY
143,616,568 *0DCF075565435062D1B1E55E1BC1E1249B4E7B7A REPHARD7
143,616,569 *0DC19D261FA43534A87315E47FA94ED169F547A1 KÖYLRIIDE
143,616,570 *0DC83E870FE255BF547E932A5F7D9D9339462034 [email protected]
143,616,571 *0DCDC085C822F307DBFF30F515E0CE7D0FA0BFE3 [email protected]
143,616,572 *0DCD4D2B04C553BD02B7EA5BBB6650E13590786B RERAGGEBS
143,616,573 *0DC84973306F6F54828AF13698A21CC5E7AF7CDD KRIS.AVALA
143,616,574 *0DC7A45FDA92174AEFECA94DA5E3471F77638599 RETFASRUOBER
143,616,575 *0DC5E85AA47E7C6454CD982591ADD74FB6B7C10A kroc-copley
143,616,576 *0DC26B8E5D455665F56C3676072F7BEE20E47572 RETSKCOS
143,616,577 *0DC14B3D2D88B97F19F2D77FFF44D14E18A67078 ku3xygjr
143,616,578 *0DC6DE5DB396E51AFE0F27CCE4A5CA76F167EFDA KUBEYF
143,616,579 *0DC91FE0B71DAF75F7422DAF648D2EDEB7051D90 KUMAHAHANE
143,616,580 *0DCBB73C84D34B6EA03C11A7E0872A2F6FCD6CFE REZERADAH
143,616,581 *0DCF277DDC94E577704BE9A3D83C27EDC9EAC01F REZHF
143,616,582 *0DCD590C9AD8DA721A03E9A23DF9419D4FA38020 KXLW
143,616,583 *0DC4B6B014515EC797638A6F4842A64C6F71EE3E laatmenumetrust
143,616,584 *0DC884ED96A10843612467494D6018EC0EEAAF22 RICHIEFOUGNER
143,616,585 *0DC4132F8E1BA5A66353F344E2EE6446E8B5E26E rillett5
143,616,586 *0DC2000E038F297C546BABEC2393F93B21160D9A RISCONTRED
143,616,587 *0DC4ABB6A23945CAD4FAE7737ED5FA164C138B8F RKURTALIC
143,616,588 *0DCC956FB33E1B889FCE919BE6FDD2E77B05DEF9 ROBOURS4
143,616,589 *0DC8D79EE6D43D9425D69B3A06396C29AE79DE6C lawerencesemmes
143,616,590 *0DCB05AD8E3FCB5AFA87408A65BBED03164A0F70 LAWRENCE.BAGGERLY
143,616,591 *0DC14DFD2ED8948199340C873D66EAEF87B68D91 rocky-chua
143,616,592 *0DCDF3C521D8F97020852ADFCE75F188AF3E0063 ROD.KUZMINSKI
143,616,593 *0DC14C8AAFD86DD07FEBC014A55E19CF60648422 LCLLSMLS
143,616,594 *0DC915A1B190038B6E41504492F7B65FC3CB5902 rogerlagrow
143,616,595 *0DC0EA29D69347966468F3FC51590CC67F936353 ROGNAIS
143,616,596 *0DC0A9344F07FECF2E67CABD2E118B4EDE470717 rollo5
143,616,597 *0DC10CD2563D8F8549F4CA4BFFC14F3E79B060FA lelandhorwath
143,616,598 *0DCD21F913E40779E800CDCDFBEA9B9DB8FF2E59 ronniebrinn
143,616,599 *0DC259B0DD676BB97E3DD604C715088356E4553A RONNIE.NY
143,616,600 *0DC25928C39DD99EE5975A9AA33761724661CE86 ron-padgett
143,616,601 *0DC76652B6517CACA71EB2B14252EF38DD43B0EC rooseveltpalas
143,616,602 *0DC1C6E0CDDC054B83CFBC8BA69F0410B8F5F617 ROSARIO.CANNADA
143,616,603 *0DCFF4FAEF6DC8C7959E616094AE89D200B56504 ROSSSHIMON
143,616,604 *0DC7BEA87A6B8AD6D97F24D46379AFA269A7B390 LESMAISONSGRANDES
143,616,605 *0DC3A489408C5A920562AB583820CA07B2F66B9C lesterluevano
143,616,606 *0DCC4C88ADE13DEE28F692CF52566D9505F53E4E LEVI-NGUYEN
143,616,607 *0DCA144621555179A563BE090BD54097011E412C [email protected]
143,616,608 *0DCA6E733A644BAE3A9208D3EADA3A239AD04728 rSs
143,616,609 *0DC479E881C5C0CE33F1E2AC70F0FD0A4A5C71E3 [email protected]
143,616,610 *0DC4306C07E3305CCFDE73E1029F536C8DF33ECD LINCOLNCROCK
143,616,611 *0DCD789066292ECCA131E1BF2B8DEB1E1D618DCE [email protected]
143,616,612 *0DC31B891C3BB8210D9144BF34601059ED32B1CB LISA MULIANI
143,616,613 *0DC0F067B7B86D26B5E51170B4CC7E56B6925A23 RUSSELL.RASCON
143,616,614 *0DC4F1FDD864C7F19C01BB75F3F5071B6C322F02 [email protected]
143,616,615 *0DCAF9E8439437D966B5FADB2519F000272382FC LIVREIROK!
143,616,616 *0DCA989976B53F4D4E9FB153C2B1E31949CCF99A LJUDJE.PA.PRAVIJO
143,616,617 *0DCF90BFAA5C5C08C58A4F85323EC209AE17BD81 SABA3ISM
143,616,618 *0DC4F8F22202D0E5A8DC0BA81B3287A79BF83A54 lonnieholda
143,616,619 *0DC79B0A97F64EB235D55B19E0E58D665F33C3AB salladernas
143,616,620 *0DC6D9C184ECF308A260E9496FE1855B93D40778 lonphimsoutham
143,616,621 *0DC2D2CCC1DE17BED685BF558830269651E934FE LONQUOR
143,616,622 *0DC19A735D36DF595453360BA025F9D8DF1E3213 salvatoreabrachinsky
143,616,623 *0DCF48E4F993A5DF1B1698E32209C7A77C201F33 SAM.BALDOCK
143,616,624 *0DCEB03444C123A1C032B98942592B5DE1A3D63E SAMBHAVATS
143,616,625 *0DCB3D886763AA77F9AE4CC11270848D0ED76B99 sammiegretzner
143,616,626 *0DC1616EB6271D44B2C7CBCE22649C5872DA5F59 SANATISIRTEN
143,616,627 *0DC82C8DA165017D4E7DDF8FD673674B2BFADDBB LTIRKKON8
143,616,628 *0DC3E87E92D382350A95BEA9C803C12867A56D20 sapphirefluffy
143,616,629 *0DCD3D507333BA6A05AC6DD8A0C63C43DBE70C10 [email protected]
143,616,630 *0DC2EF0B82203B160450994111A568CC8D4B97FD SARODAZITAMILC
143,616,631 *0DCDEA78EAA3EB47C6DD0DB30F6D4304A30B69AC [email protected]
143,616,632 *0DCA6A97A52B2197D9FAFA1B11FD79EE7BEFC09B SATONACED
143,616,633 *0DC7C9BC56442C8F76DC32E51953F4B77D6E65EE luof
143,616,634 *0DC009E6FC899D3A8060863B32ABFE1F83368B42 [email protected]
143,616,635 *0DC53D2C06C02FF2DEE97C950374EA617E41B057 scarlettunicorn
143,616,636 *0DC326625ADA88B7F0A524FC006C5C13521CC7AC Scherzo No 1 Op 20
143,616,637 *0DC1DDCF0F0A35CD0E871BA85617EE4CE54BBE95 SCHKORSK8
143,616,638 *0DC76466700ACF8A4996017505118FC47D9ECA7A SCHÜRKANAL
143,616,639 *0DCB1BF97908D2F985303644DC83D0888F19817E LYNWOODWEEKS
143,616,640 *0DCEC2FA62FAA6B5DB18559D2324B1C62A920FFB MAKINGANIMAL
143,616,641 *0DC4A89D6366B6C64423BF0644F42A6694B6A212 SEIOSHANSIANED
143,616,642 *0DC8346DEC3524674D678D75EF914D199AD1A00C selvflgeligheden
143,616,643 *0DCD6CBFBB3769DBC4ACCFD67264895005AA61C9 MANTOY
143,616,644 *0DC4B22126B33A58AEA498AD5A579FFAA830C530 SEMLAB123
143,616,645 *0DCDB5CD1AB8106ADC767C6C5A56F20A1252DFD7 MANUELFOGLER
143,616,646 *0DC1B1EB191D1C6B2E0CECA9D8A2FF1DC96CC08D SEMSMA.ADEL
143,616,647 *0DC43B25C63510121C16300D0A3D21B7072E12BB MANYVALUEDLOGIC
143,616,648 *0DC549837357B5CE7E05307A2D589D235579B2AC [email protected]
143,616,649 *0DCF67ADB0B930CB46F26D0F7AD9F414F8314913 MARCO.PARODA
143,616,650 *0DC2FAFA79DB2D83097681FBF97EF22472F81B64 marie20
143,616,651 *0DC3C3BC51016F9CDEE4F87DA5E3ED63000FE575 MARIFARIAS
143,616,652 *0DC1EE025A7D589D8CAC48E73C86C4D96EF40E4B marisa-atkins
143,616,653 *0DC441CC509B724BCF01194CF62FCCE0A3010637 MARITES.TATEL
143,616,654 *0DCFE3053835871C9303654C8341B17CB06AD23D marshallgriesinger
143,616,655 *0DCBD3C16C82270C0F9F84C0869730A83E9DD4A8 MARVINBACOMO
143,616,656 *0DC6B26FC81B7720959004FEC1D5D4254FD956DE MARYPERTUIT
143,616,657 *0DC931E691FA98D06610C6F00FD4BA557407907B MASONSOIBELMAN
143,616,658 *0DCBA6ADD709DB53EF3B722E1ACFE267952392BE MASTITIDES7
143,616,659 *0DC88C294B11581D03E36E9E143757AB258E5459 SETCEJE1
143,616,660 *0DC44CBAC0F9FCA62F8FE9C8F27CB642EB31E0DA matthewhenriquez
143,616,661 *0DC11F2181BD870FD09BC5BCA0D20E78C59AA4CF SETZTUHC
143,616,662 *0DCCEA77469A85FF6D87BFDDBF5C77E514439161 MAUROANTINORO
143,616,663 *0DCF258AF6D71B20713992124BC2F1F990B9061B MAZARAHL
143,616,664 *0DC8F57737DDE59303A5600B9EA6EABE73044D23 SHAD.TIBBERT
143,616,665 *0DCECFA018E36CEB424B02A2DFA3127306845AEB [email protected]
143,616,666 *0DCC0628FF19DBC43704AE31AD54774CFF6284AC SHAQUITA09
143,616,667 *0DC9A4C60DF93E280665AC458665BDB795ACEF44 MEGAN-BALMER
143,616,668 *0DC49D3B00299F7246E6AA3FD446E146D769D0E4 megawords
143,616,669 *0DC8C8FCD827DF523854AF48A2EC023DA8B08BE0 SHAUNHARBEN
143,616,670 *0DCD88DB2F883A72E43F84F31A3CC6CEA828B309 MELISSAMCLARRY
143,616,671 *0DC4A80D0F102865C8930C5166FBCB4A3FD1B973 MENES DE GUERRA DE LA WEHRMACHT
143,616,672 *0DCDB6D5FC643BB4CD4387F8A3D01314628477D2 SHELDONHETTICH
143,616,673 *0DCABC7DAFFFDE22FB879E43BB1F68FD85EEF0CD sherina.mcdowell
143,616,674 *0DC022B82A63CBB22BC912A9528C78B766CC0EEA [email protected]
143,616,675 *0DCC4E5B9EE5AC489C607C87E70D9F32823A4BB1 MILAN.SCHAMP
143,616,676 *0DC5B9B82A54DCC7723D95004E1B3D0170AFBCDF MINER
143,616,677 *0DC44193951C9A113698161E581C3FB8AB1B006B miriam.armstrong
143,616,678 *0DCA0A4EE4A06F5374F3042F31B62D1916789BED SIDSTEFANOWICZ
143,616,679 *0DC99EF89FA0D2325AD0422AE23769FA1487F28D MISSTNEES
143,616,680 *0DC4476CC7B7040392BCA286593F0924C313823E MISS-UNIVERSE-DOMINICANA
143,616,681 *0DCE95C7D5AEE35E439C776130242D2B33C60FE6 mitchelchambless
143,616,682 *0DC4CB399B63D6A8393322D5E0E77202E3F4964C MITCHELL.GOONAN
143,616,683 *0DCDBC083DD8ED7890A483C5F0E410981F8479F6 SILIC0NIZING
143,616,684 *0DCB62BBF7F904570124D0D72CAACCEB57632FDC silt7
143,616,685 *0DC6754C0DA8CFF3D3C743D05851862486DB8654 MITTERSCHWEIB
143,616,686 *0DC472FAEE4019F35370AFA5C0A1CB439B9BB431 MIURPEELS
143,616,687 *0DC92BB11CC7F902B64A97768B8FF08DCBB44599 SILVEY2005
143,616,688 *0DC31672070ABE6A39D3E9F87877CC24E4E3676D mlr1
143,616,689 *0DCA7BBBE450326F65C93DC39DE629D5F70F001A [email protected]
143,616,690 *0DC9D92B329E4E7E2251BBF6448DE4A39479E628 siphonozooid.
143,616,691 *0DCAFA299F03D2E9693FC803DB5F75C8FE2D1114 SIROTERS6
143,616,692 *0DCA98AE760C908ACE3000B831DFE9403951009A MOJIB13
143,616,693 *0DC50AADFA326480616AC35982F2FE17A467AFCB MONTEALEGRE와
143,616,694 *0DC3BEE07B9C1DECE60A305FB918D495CDFC8029 {?sl
143,616,695 *0DC964D1B91FB9C772CBADF62952BC6BC816EE36 slmndrlk8
143,616,696 *0DCBAC6408679AF5DBD19C290812773229286340 SMACCHIERESTI
143,616,697 *0DC23CDB43C1C413E9C1E285C6FAEF9DD25B7273 MUGIUCHI1
143,616,698 *0DCED98056E53E77E05E56A266943F617104EAA6 SNNILLING
143,616,699 *0DC62C6B6372246E19CD73C3D66CA95FF1EB8F9C murraykant
143,616,700 *0DCC7588BAE85426AD585BE381DE1A479984B06E SNYTARUBS
143,616,701 *0DC48131FB6CEBDAB935E70F672A021CB3F011DD SOCHLA
143,616,702 *0DCB47201C42D7DE5A17B30DDC184FB53BBCBD83 MYLES.TELEGA
143,616,703 *0DCCF9EB93D36207685B7908A85C5771D5686265 SOMEEMOS3
143,616,704 *0DC0B0F1B41DDEFE981B29C14C43373186A8684F N&"
143,616,705 *0DCB76B46A34E090F633D7DA34DC8193BB49A192 [email protected]
143,616,706 *0DC9D7F797A659326A82FCB2A263151E8AA6C498 SONG007_BANK
143,616,707 *0DCF25A63D07682EDD65D3960B0C0A5EB79913B3 [email protected]
143,616,708 *0DC04BE9DBBA8DD06AD9A060F2F442DF57F27AA6 NAMEOBJECTCOLLECTIONBASE
143,616,709 *0DCBDF112A5657C407F1A7E5ADD2063E2488C31E soundlessnesses
143,616,710 *0DC680025A9ADDF461AED3349B67E2A0D44242D7 NBRULEZ
143,616,711 *0DC175A8B28A559EF907A6707EF1B5B143C33116 spastiko
143,616,712 *0DC4FCC49F2B32754FBB7379CC9C11DC1F7D21E0 NEIL.OLEJNICZAK
143,616,713 *0DC9E4A467733906C4C16921F18FC608892518FF SPEAKINGNESS8
143,616,714 *0DCA41B441862AE47297C9C7E06DE5DE770E6352 NERY-OTERO
143,616,715 *0DC3D3384619A41E289E68661CF98F740C3CC808 spiraalvormig0
143,616,716 *0DC2EE1EB94497E4BA877A152D08AFD623FEAACF NETWORKOUTLAW
143,616,717 *0DCB394DBA36D1555CD3A05459B48BE0F80C1177 splat<####b
143,616,718 *0DC7FE9249BA94BB5F0BAC962A7544C6B2F34D90 never.been.satisfied
143,616,719 *0DCC8D995EBDC73C9C9FE80C02DB0535B53F0FBC SPLAT!O~-0~(-3
143,616,720 *0DCDA8FD8A488C484D6F884756DCB51838C58B3D NEWTONKITTEN12
143,616,721 *0DCC60B4F3F5800AEBB2E056C8A0149C03C968AE NEZIULS7
143,616,722 *0DC8C78A57163F97AAC2A40C7E8374183FEEC374 splat~-~-~-<####P
143,616,723 *0DC30CB011559CE4CEC08ECB92E1E44161805AE2 nglttngging
143,616,724 *0DCA00BFF57212E4DD377D48E8BE18A3E79A3CB7 splat!~` ~`@==q
143,616,725 *0DCE7C7B6D00884988FF8B46562AC0B7A33D729E NICHOLASLU
143,616,726 *0DC140FB5FEB88A2E7D59A1D8E66FF56B54CDED9 SPOLTRONENDOSI6
143,616,727 *0DCBA89E0D994136102D7804FDD0740CBB3FC9BE nicola-barrows
143,616,728 *0DC112444FB18A6A446015E14C5C60BD180BC409 nicole.seah
143,616,729 *0DC9C619A6B8AFD7F4EE94DD20B71F1EF71652D1 nitenicarao
143,616,730 *0DC2B30BB36F15467B064C504B9D71B899F00EF1 N!K3$PORT
143,616,731 *0DCA43B202B9962724BBB3BEBA881266123E8BD4 sregitslayor
143,616,732 *0DCA87EE968FA334C1A29AB45429B28E750BA796 stabat mater: inflammatus et accensus
143,616,733 *0DC07FD1740C55F01827EF156465330FE9AE1EDA NLIVERISH
143,616,734 *0DCA42F3A94C2E724C19C8F1664DAA4DDA563BE8 N;N
143,616,735 *0DC1FA42CBB7BFBFB216EF7AE0381230DD188BB7 STANLEY.PRIZIO
143,616,736 *0DC00FE6598FC63CF13A695E3C3512CE71E195DC noblecondray
143,616,737 *0DC3ADD85B60A7D53BCC64B608F761BE5898D282 NOLAPHILE
143,616,738 *0DC5E57427BA68C898C7E53A7BEF9D0164B2BE3C NONC313S7A1
143,616,739 *0DCAA7F1CC9365876D563E41A953568A1C1500C9 NORAELISABETH
143,616,740 *0DC1C445C75EEDF964901CEF1F3B6BCCF6B53E43 STELLUNGSWECHSELSES
143,616,741 *0DC5D20F8F2B1C9DAAF2917E4F1FC93A52673A79 STEPHY1020
143,616,742 *0DC771C7C77820811801E310E8855290550B815F now-respectable
143,616,743 *0DC17F66615795C9FD968D653DF218C56F8D07FE STEWART.NINI
143,616,744 *0DC37B2C3FBB3D4BC8266936C943EE09C04B6FDA [email protected]
143,616,745 *0DC7B788644089A127FEDD87B4012F19E786ECEF STÖRFALLRISIKO
143,616,746 *0DCF96875437FDDFF96FD96E1E03CAC2F324323E nuzenski5
143,616,747 *0DC4859F2589FE937B22DFF31DE436757363BBA6 NYKYLUONNONTIEDE
143,616,748 *0DC1F7736E41F63A5500837BA15A0B1862D63C2A STUDIES1213
143,616,749 *0DC238B47F8397D1E54CA5A87E149FD94E0014C5 [email protected]
143,616,750 *0DCEA783F8B1DB13B02576ABACE4EC6A02686192 [email protected]
143,616,751 *0DC388C467C5C4E69A565B8280B729BECA98597C octaviolavant
143,616,752 *0DC217E8ABED822E926AA0F353289689CB20C42D SUNG.FELMAN
143,616,753 *0DC7DBE058CEED8D0A8BD321C828A05D76326840 [email protected]
143,616,754 *0DC78235C0B3E21C9892FCB6F423A149859CF96D suolureu3
143,616,755 *0DC7FCE0E9B648F03EFD8C83A8903D561DE08BD4 OLIVIA HAMANN
143,616,756 *0DCE2B25B821F9A30C0A17002FCC9882A91E5E51 ONARECAL7
143,616,757 *0DCCE1F3027DE871098CABDAA93BA2CA1C2DD47E }O{o~O~<===q
143,616,758 *0DCADD7F79A5AB8C82665F5269D7F8EA470555EB }o{o~O~qq
143,616,759 *0DC59DEC88024AC507BFDD1DE7B9C0D4C92C74F2 symphonyincmajor,hobi:97:iiadagiomanontroppo
143,616,760 *0DC21A96CEDB9569FED007D3545966610D0DD541 OQHKLE4B
143,616,761 *0DC1009BFDC5046364D9D9C859B4D9EC9900B1F8 T(<7
143,616,762 *0DC2A0B9A93CD05F10C18D2357F43811C3FF17B5 T8173612621026Q5
143,616,763 *0DCF5A3BBF9B6916700CF43880A965ECD3AEEE14 TA050103
143,616,764 *0DC0422021CD5F23EAADCD048E9AE058D8E12D37 TAGAGCCACACATCGCGTGGACAGCAGTGGATAGGCAACCATGCATGTTGAAAACAGTGT
143,616,765 *0DC011AADACA75DAB0408978C334DCDF7C761C1A takedaclan
143,616,766 *0DCF0A3B9142043D2FCE635E92B74884310BAA31 talence9
143,616,767 *0DC9985B7CDF41633CB8418A137DE1179213D062 OTHERWISEPRECEDING
143,616,768 *0DCE88FD719AB55E72015F6D311E822545449F66 talk82421076
143,616,769 *0DC7C915E43C8321658E7E7301AE1FDB2D51DC31 ÖTÖDRÉSZT
143,616,770 *0DC12D77B7D8C2A10E07C4A041202A8C4AF3C065 TALK8810720638
143,616,771 *0DC5E0ED33D394DFC1CE18A268794A1223CB71EF talkfunplex
143,616,772 *0DC36B7B4529ACE8CB074924A1CB819DA4A82A16 over5mplfca7on
143,616,773 *0DC8DE0692C4D935449422D7D28A29D5CB87BA8F tannerbrodowski
143,616,774 *0DC7099EC1645171E3D2731E77634131998CEA1E OWENMALLON
143,616,775 *0DC6C60452885E556BF6A11B0BFFB4FE64553636 P>.~0.:p
143,616,776 *0DCC1D415A89E0C8C27CF8E8563173FB21D99875 p#a
143,616,777 *0DCC391ED580CB7980348312A1B625199A6D4786 PABLOCHIENG
143,616,778 *0DC8A2D2A517E49B6C47BB177EB46B751AF029C7 TAYLORGOFISH0
143,616,779 *0DCE4B021B2DD056A5BD1C0430B7819E6628DF2F paleograaf0
143,616,780 *0DCB4AA3A60AB59AC37121ED5106FE5C45C56DBA TEDA43346
143,616,781 *0DCE996E09BD1B157F894BED0F4587056433A750 TEMPMONTREAL5
143,616,782 *0DCFDD4685F652D09A84A65F94219C96C52B16F5 tennists
143,616,783 *0DC2476DAEAE84FACC6E56CC2FE93DA9A2FCED94 parljam1
143,616,784 *0DCF2612A5777D1E0DEEC566D0872D824F5F827A TERRAVAL
143,616,785 *0DC1BCB4DACE7BF1178D3CA6B6A9D8128E7A831A paultrauernicht
143,616,786 *0DCB3DB8980904EEF649E9AECA19FFC3F134132E terrystadnik
143,616,787 *0DCE53AE34BB7991BCB082960FD80DD9E529C1C2 PERFECTIONNANT1234
143,616,788 *0DC07F0E934240164345508504ADB3AF776F406D THEATERSAALANBAU
143,616,789 *0DCC906764826459F7882D638ED5290AAB13F23E theatomiccaf
143,616,790 *0DCE9CCB495E926154DB9CAF911AADE41817167C THE BEST OF CHRISTMAS (C)
143,616,791 *0DC8C07A9D56495736915B20D9C8277FD968B412 petridishlike
143,616,792 *0DC01D751214B4E4A1944FFD09FF4AFA9F588D91 PFDB
143,616,793 *0DC9D9B084158E478220B90A654BB8CEA65EB22C theeleutens
143,616,794 *0DCC2531270EE1D0707FBA548DFA3AE9D15B76A6 THEGETOUT89
143,616,795 *0DCEA991B2D4A4CC6F3F424856F3F08BCDD7C9F0 philuke
143,616,796 *0DCB4388296C649C4EBF00541F9E96C5544F5B0A THEMATTI174
143,616,797 *0DCF2AE6127F055A5F89ADDDEE38C662083EBF21 PICKLEBOBBY
143,616,798 *0DC716B5B994BB84617478DDA6C194B6A5A06CD1 thermotensile0
143,616,799 *0DCB92705C4D7B007AEB248B5BEB7A73A79B289D thespiderandthecroneandthegirl[
143,616,800 *0DCA5CD3B76F5701E1D482326408C06C3CE1AA2B PLERINI SALD
143,616,801 *0DC9EA74D3731C67C4DC4D830F70237C43A11D41 :po~0~.(======q
143,616,802 *0DC3C4F5E098499842F2C6BC102C63A47C983D9C THEZOOCHASE,PART1:ARABESQUETHEME
143,616,803 *0DCF1A2AE7FA06E6A2DE49208F38BCCBCDD7E09C POLIISIT5
143,616,804 *0DC6BCBD62C4B6B67B6AE76EC29F1DD303674FCB POLIRITMIH
143,616,805 *0DC31813B204470BB29F5F6C699A2F8161821F30 thomasbastow
143,616,806 *0DC58A91E1BFA44E760CFDE93170CD5AC07A5166 THOMASMARILYNING
143,616,807 *0DCF950B1CB8EEEA2C0A6D0A899DDA9467115FF9 polymorphis
143,616,808 *0DC54496BA83FCF564C6AD47A94BD98C251B87B8 ponsgatens
143,616,809 *0DC2391D9402E614A5441E0552BD6FD0D3A7ECB4 THREED
143,616,810 *0DCDE53B5B1A643D3DF26C0DC11063022D46A006 TIĀNYUÁNBĀ
143,616,811 *0DCC221B813FD2CD67B61C52536B84EC7501A664 PORTUGUESEFLAG1248.S
143,616,812 *0DCCFFD84CD5CAB22051E96F8D823064D463781B pp~0splat
143,616,813 *0DC26B097DCFA0E8CACD4B30E3DA6C5010B991A1 TJTEBYMIED
143,616,814 *0DCC913E858D04CE73872072D940C09C1129C02C prechaz7
143,616,815 *0DC72288D23A88BC4F75B3B1BEC27B286EF2867E to4q
143,616,816 *0DCB3CFB886E94BF0136A9295FC4AD06A4D4DD5F [email protected]
143,616,817 *0DC0DDE4A11F09398461BAD500FF1C8463BE3B32 PREŠERENOVY
143,616,818 *0DC39AAE50DEF5ECD7F90B622EF27EF320470F4C PRESTO "O FREUNDE, NICHT DIESE T
143,616,819 *0DCB4E641D048D821EC502E90387737BB7E3BA82 [email protected]
143,616,820 *0DC4ECC64357793E421452355DFF7F27EA7F5DB4 TOMAS.MORLAS
143,616,821 *0DCCA550582ECB7209E0BAA97439C3B3625545B9 TONYTEMPORAL4
143,616,822 *0DC594719BE583B7B9B37D7BA8F7BEF811598AA1 proxeira9
143,616,823 *0DC84AD2E5B23776A4D2E518590E18D788BFF67C psychoquackeries
143,616,824 *0DC708C525BB2981C7BBC964579CA583789821A2 PUIKSTUKS
143,616,825 *0DC3A668450B95936D4C9CEEF608ACBD97A80DB7 tq79m7utkqyc
143,616,826 *0DC1BF9B04BEC2AA50E46B549E23A0414DCC83DD TRACYMORELLIPRAMENKO
143,616,827 *0DC20126BD166E658D787184874700ABAE33C81E tracy.young.driscoll
143,616,828 *0DCEF025BCB1E051CC6A3D0E04BF9836DCDCC98D “TRANSMIETER
143,616,829 *0DC7E1C774F7013F0EDB3507EF7C78F04577D9C2 TRAVIS.ANGIS
143,616,830 *0DC658B3377F062EBB9E1F255C65B30F7A164D90 TRAVISARIZONA0
143,616,831 *0DCC6E6B28E4DD8030D21E13B045B4C33DC23EE5 travis.gerrey
143,616,832 *0DC2BB0A5B2B0F6F535FBB284E59BF7F88401D59 tres-tagalog
143,616,833 *0DC4C5EC52412FE14FA6FE68B78C1C0068ADFF3F trevorosburne
143,616,834 *0DCE7E5057867293173F07B53349EA0B51D2BCD9 TRIL0B4TE
143,616,835 *0DC5571E61A9548A1634117B9FED74DE3908B71F trinidadfinallyleavingcolombia
143,616,836 *0DC92DD377CFA4FF3CC5D3470DFC3151CC57849A TRIPPE.WESLEY.SHEPARD
143,616,837 *0DC3601CB684F79ADA86D365140CF09257AD561B Q===B*-SPLAT
143,616,838 *0DC231E17CD7853829C6C5A20E8373E02A3136DA [email protected]
143,616,839 *0DCBF833BFC6DC16F34FE31B52A47B35456F500F QJBOBB
143,616,840 *0DCE1019296C9C5B6C53C0783C5E693BF64B07CB q)~o~o)0(
143,616,841 *0DCFBED501D1EA82E3AB603DE13BF2F8D9305106 q#p.`~.>b0
143,616,842 *0DC2374CC7C01AECAB5DC7DE0A2B782829367CD8 q---p~.`:p
143,616,843 *0DC766F8D25161C602A5B21DAA7427E3DB9DACBD quartet.no..10.in.e-flat.major,.op..74.ii..adagio.ma.non.troppo
143,616,844 *0DC927A09981EC857F1D569053D487A78831D0E0 QUARTETTINO:IIPOCOADAGIOMACONMOTO
143,616,845 *0DC5E82B8F9301E2E99A543D0550B763F6931649 TSDLEGEREGNO0
143,616,846 *0DCB826599FE9A1F89EB430FA58F860D54228693 quickmumble
143,616,847 *0DC7ABC43FBCA048197E13CEA4220038E10AEBDF QUINCYHONGA
143,616,848 *0DC08DB701DEB5327D89B99429C697CBA45D17D0 quintinspringle
143,616,849 *0DCA02B956D5A41A3C7ECD90F11E7382DB040FE9 [email protected]$
143,616,850 *0DC45BA45BC9BA56B416F7D2C0984E7C28EDC501 R3PR3H3NSION
143,616,851 *0DCB774E44CA1672AC301345A0F36EB9774AE439 tuanwallgren
143,616,852 *0DCE3C15E1BC7E4BF23C4BFCCDFB6D30DADD58D1 TUESDAYCOOPERED
143,616,853 *0DCB8C72160FED770CCFB7E2E04DC6F440178CD5 RALEIGH.TULIP
143,616,854 *0DC59C23B1CEAA1ABDEC189F29CB5A653CE1EDBA RAMIRONEIBERT
143,616,855 *0DCB52A2B4A7922BB3D0F7FE26445D4C46316A67 TURNFURROW1234
143,616,856 *0DCF793B0E903CB5BF0D8E2013788DEFEB387765 RAULEDU
143,616,857 *0DCCBB6F8A0747042CBE2517284B1A7775C45FBF rayfordhinish
143,616,858 *0DCB66C4EE0BD71C450A31F7319209397DCFF622 rayloxtercamp
143,616,859 *0DC12D7B9A469180A5A17AAE303C41EB0FB30BBE raymundohouska
143,616,860 *0DC4A11D0F9BE0311BD9FC8C17A27689C4AE3BA7 RAYMUNDO.RODABAUGH
143,616,861 *0DC6411DD007E85CE443F87647D0323F890B9665 RAYMUNDO.RUBLEE
143,616,862 *0DC5D2597B44B6DF127428BF70B4CA6229BB2799 TYLÉN
143,616,863 *0DCC0641C1CAC196EE629B7893F12B770C872296 TYLER-BRANTLEY-WIGGINS
143,616,864 *0DC4EE8774DB2E799AAC3AB1D55A4BC873F48A32 r!ckett$!ae
143,616,865 *0DCF53C2801EA049D24B9A24AD4560842761C640 [email protected]
143,616,866 *0DC82F76B7B46DCE1C6136BC181A47E2B46B9D38 TYRONESABERI
143,616,867 *0DC8220FAE9C0BB7EFF0D2420A3669139B61F8CA RECTORIALL4
143,616,868 *0DCD3537302F752651CF155C51A961C1F8243FD6 U{A:
143,616,869 *0DCA808ADF4C8403DE85FA597D2C6211383EDE4D REEDITARON2
143,616,870 *0DCD2A9519B9002D34DA058183E87A6282705C15 REINTERROGUER0
143,616,871 *0DC6E9FF7B10056AB80BB2D42E1D931EB3FA77DC [email protected]
143,616,872 *0DC7460E0105A4EDD88C0F0D467CD21228CE2A63 REPARTIRLESES
143,616,873 *0DCFCC43A7D032E496FB6D94F1C95744509B9888 reservesforeign
143,616,874 *0DCDD0A6B62EF8EA9746F9D743001998FCFA4806 [email protected]
143,616,875 *0DC2B35A40681C77979FFED0D911DC913099841D UGWU-AMOGE-HENRITTA
143,616,876 *0DCEC31245F7555129CFC23A0B2273D1B17336DA rhinodorasboehlkei
143,616,877 *0DC5C97C44A2386A1549DB10367E9B5B49BE360A ujelebugib
143,616,878 *0DCE59D7C93631ACCEBFBF1993375C4A93C38179 richardgb
143,616,879 *0DC4080F5D690A8E8D494E6474153373E674E01F ULTIMATE.DANCE.PARTY.1999
143,616,880 *0DC44A44B182D9AAD937B801F16A5B0E0F9AFAA9 UMANG.KHANDHAR
143,616,881 *0DC913A903CEC821F83F4057DC49C7D536ED75F1 UNCLE DICK
143,616,882 *0DC184B8A5736A44F1EB1A088E4599986A07C8EA richsfreiheit
143,616,883 *0DCEC11CFE33F806CE9E5AECD94747AF09CC285B ricing
143,616,884 *0DC9D85A5F0369BD3CE4FA387A09E448A559B84A rickeydilley
143,616,885 *0DCC2C59A9D3E820677EBB106D1DE6CEB87ED8C9 RICKEYLAUDERDALE
143,616,886 *0DCCA8A166FEC1455F32A4086AFC319735DEEBB4 RICKIEEVERAGE
143,616,887 *0DC50E2B6E7850E7EAC31637B79D3842A9E487C2 RICK.MCISAAC
143,616,888 *0DC3BED88A438146EBD60B113F56BE15A4602E85 UNRIBBONED5
143,616,889 *0DC34CB604A5267059A1948934728D1121314CF7 RIJKSAMBTENAARS2
143,616,890 *0DCFD873EFABCB395E707E6E37E5A63664F4EDF6 „RINGO
143,616,891 *0DC35E53F3E3AA3C729BD52158DF81F4E04FCA43 RL2W
143,616,892 *0DC77A443E3A485EABD0E0F108D852E9A0585677 RMCCAFFRIE
143,616,893 *0DCA961F5F5FD7F66486EB04951D3B2F1E39BD13 RoadhouseBlues(11/4/69,takes1-3)
143,616,894 *0DCCFC0A24D4877BD6F52719EABEDED02B94CFC0 rob.brabant
143,616,895 *0DC63F12EC5DEF8CA2F880D2A12917CD922CD558 robwitton
143,616,896 *0DC73E11F1CCDCF7599FE28732142805214584BF RODNEYTAFFER
143,616,897 *0DC31585BC2242E7F2D54C77259FE13D1BB141FD UTAZIONE
143,616,898 *0DCC225AF277D285CBC8BAAFE6FD1D49803D6099 VAL.H.RAKOTO
143,616,899 *0DCB4EA88DEDDD04A7A0A87A7477D633AD3B2AD1 rosaywilfredo
143,616,900 *0DCFDE2EDA830F1B2E7B98BB837D0F948D7A9C5A ROSS.AMOA
143,616,901 *0DC8FEFB3AC5DE61F32EF4C7DE4435989C07959D ROSS.CHARLAND
143,616,902 *0DC609D5C848D232555EBF096AC77EA180644471 rotmalm
143,616,903 *0DC7FA716D1BF84F23375F6F7223948BA9BC2AB1 roycevos
143,616,904 *0DCA62C3187676DC0FC5C58EBD5CD93A73D5074D rtbfpkb9
143,616,905 *0DCD6276D7E75F4AF0DE9A350FA2FC2B5D00FFE4 ruageoises
143,616,906 *0DC1357ED8940A72EE3D5CFBAD42B1353D265041 rueben's-train
143,616,907 *0DCC07D7926447125B9E32EF048A3EC0E0808718 RUFUSTOPP
143,616,908 *0DC5560C0C5B1EC4B4DFE75427C42EBC939E7205 RUSSELFERRINI
143,616,909 *0DC4AD54AC8D3200E02373FADD1D0FB66EB8ACB5 S3DO
143,616,910 *0DC1C2285C704F8C4A607E7DCF13FF803838E639 saaisak9
143,616,911 *0DC35EC97A8E05867B05E306444FB6A9EF912E82 SAGAR SHELAR
143,616,912 *0DC252B5CF6F35B25D85E5901673CBD9DEB600B4 VAUGHNKOPKO
143,616,913 *0DCC8013FC9F1A98C2558CFCB95F73B46F4C0752 SALEEMMAZHAR
143,616,914 *0DC8346D6F0019F850A52329182AA9BF235B20FD VEEMRECHTERS0
143,616,915 *0DC3E616EE2F65FAADD8A13DF2F9B1364E1DDC7A VELVETGIZMO3
143,616,916 *0DC8934201B24E9F54B944AB193E690461CFA825 SAMUELLECRONE
143,616,917 *0DC16EA4892288EABBF7B0B6BB4CA067ED96B0FF SANFORDKAELKER
143,616,918 *0DC37E4530F8507650C858C8F0E98B3BBD729027 VERN.WILLIAM.CAMPEN
143,616,919 *0DC821AC2C1747F663AC159D9FC0E0C749D05179 veronica.freels
143,616,920 *0DC394C9F1AE9051BEB91B23806BBA83B7A87DC4 SANTAPETH
143,616,921 *0DC507977DD4C13C48A221531C53E4DADCCE2371 SCARLET NUNEZ
143,616,922 *0DC5253F63CD1E12B12CFFD4BA2DB4B8185A2FC7 Scary-Piano:-Glissando-Effect
143,616,923 *0DCED010D701F6850C7D2B8844EF3A1A10597FB3 V.HD
143,616,924 *0DCAF300CD36987669F9AAD52BB48C87D9DD95C9 VICEPREZIDENTO
143,616,925 *0DC272EE81DE90EDBE6FDF46DAA89DF66CE3B6D9 VICKEYLEE JORDAAN
143,616,926 *0DC908843A93ECB961DD6EE1B54494B463773A1D SCHOPFTEST9
143,616,927 *0DCD9D740D07670FE3C6F7F6EDC5F5F71586DD6A schuurt!
143,616,928 *0DC8966EC8ACB5FCABA9595434FE625D7EC715F6 victoria-fuentes-rivera
143,616,929 *0DC510F2C29366049E25A88DFF97929786EBC5A4 scottish63
143,616,930 *0DC568ED8F780B97D29B16767462C84BA5258813 VINAYVARBUDE
143,616,931 *0DC0F62004535EBA3B1CE89DB7945DF128F340CD sebastian.wood
143,616,932 *0DCC8E1802288990FE2F3CDC062E127A6283C790 Seemingly.Sleepy
143,616,933 *0DC07F335747EE06D7813C6B68CD635C549BBBBC VISHHAKTE3
143,616,934 *0DC671F72E09979141F1522F5A6AAD96A17352A5 vivi.sufaiza.karia
143,616,935 *0DC7889F7361CAD3D945D7271F13F527297BF5C7 VK>_
143,616,936 *0DCA609EB2061B1A2738BFDE69C9CAF9720AF3B9 VLADIMIR MIKHEYEV
143,616,937 *0DC5204DA3EFB5563903850E8AE8FB92DB8EC520 SERGIO.BONWELL
143,616,938 *0DC894FED9DD77D12AAC2DF6C32EC75639E5EA10 sexygx
143,616,939 *0DC89DCFBC4C34C50C6AFAA590751F6F935936DB vq_h
143,616,940 *0DC024A676C659B5996F461FF042C9CACB669E05 W17459988
143,616,941 *0DCFE3C51694E54831B587BCCB0C768CF9370CB2 SHEATHG
143,616,942 *0DCF61CB336526F9C26B4CF100808BE6AE92163B SHEENA-CALDWELL
143,616,943 *0DC7546A8491AC075B6B229EE772FEFEA5CF2A88 [email protected]
143,616,944 *0DC4BB0A84FA915740F0D892136CFF1C0C13B7A2 [email protected]
143,616,945 *0DC5306A3913F3A7802FAD032DD88CA9F2E40438 sheng-ch'i
143,616,946 *0DC0833DDEA834713B33C10E8FC9A248F140F326 WALDGEISTWINTER(PTII)
143,616,947 *0DCFA9B1A832128DE579D10A1147C9E0F6E894FB WALDO.CAUSBY
143,616,948 *0DCDA22DB2008319E725EE2EC278F0CECAB102CB WANDARI.HENENE
143,616,949 *0DC2524D7795BAF536E0406492072823DCE7982D [email protected]
143,616,950 *0DC0A75A90B5FF5A10AA354D81BB6835C992E126 [email protected]
143,616,951 *0DC2C48C1D1C4E7BDC532E4EDF2C9E7B2AC79F27 SIALCRET
143,616,952 *0DC5B98DA7772E4296A8C21D0E81369BD7B511F0 wa'n-lekker-ding-bende-gij
143,616,953 *0DC81C0AD7F68D6DE8810EB76FF9DD2040D52565 [email protected]
143,616,954 *0DCE8E86C22685F8AFBE57D8C558731016496983 Simfoni
143,616,955 *0DC9C62A5B11DCA6271B7B6F8E4B52B5123080D2 SIMONCITRIN
143,616,956 *0DC1F071F73A5EC3C7A3E4701D0702149059F215 Singing-a-Song-in-the-Morning-(feat-Kevin-Ayres)
143,616,957 *0DC83112B70ADFA4B04588F2096F003D0BE31BEF [email protected]
143,616,958 *0DC848D5C71646381483919E40EF9C2DAE0B6024 [email protected]
143,616,959 *0DC14C2E024976252A0FE90B3A53669CA4BEEC6A WENYAND8
143,616,960 *0DC6FA2CAA6AF96E91F49C76636FD0E2AAB7BF5C WERNERATHEY
143,616,961 *0DC85752A0D7A0822A9B6EC870ABC69CB1F4FA04 [email protected]
143,616,962 *0DC04E253875D35BD2BEB5C162D5B152EA3421C4 wesleyvolley
143,616,963 *0DCC7F2D8C6CDBFDFDC7BA61126278E7B316A59C SMCJAUSAN
143,616,964 *0DC17A875F33B33F6EE6766E3F346FB5288C72E0 SNERETUPMOCREPUS
143,616,965 *0DCEF41EC6A01008131B70AB119A649523ED1EB9 [email protected]
143,616,966 *0DC0CD03264D54A5390C74A1BCE4B757E677BD36 WHITNEY-BASHAM-TUCKER
143,616,967 *0DC34D0FCBEF8801DCAAF88801EC31E5C0B3F796 SOGHMAS8
143,616,968 *0DC8645B4460050F85303449EBC22CD0C786D163 WILBERFORBESS
143,616,969 *0DCC2D6360719441096CA48B99A368261FBE05D7 SON.BACHINSKI
143,616,970 *0DCF634AE63B878432B73FC61DBD27503FC3B931 WILFORDSEPHUS
143,616,971 *0DCD682AE1F7977A98639002804DCBFD0AAB94D0 SONDZIDUCH
143,616,972 *0DCE27F454755EA17AC3ED853965314B6ECDE481 sonhollan
143,616,973 *0DC77D4527FD5958D82FC0B6DA2B2D1ED4628D53 sonic.factory
143,616,974 *0DC631EB1AA67F7234FD55FEF8C4C97A3366BA36 WILLIAM-REYNALD
143,616,975 *0DC4FCB2300FF709E8E1C552FAF7924E30ACA641 soulier-sa-|-france
143,616,976 *0DC7CCBCC4B2B799DE704D008B285CC9C4D77309 WILLWILSON
143,616,977 *0DC757668CEBF22F23234EBF25A733CAA4A1A533 SPATLESE50
143,616,978 *0DCB6EF5EED2E2ECAAC53746184BE8685ECE1855 WILMER.RHETT
143,616,979 *0DC6C4B8B57E034EB73753FAE2EAFE1C500DAE3B [email protected]
143,616,980 *0DCCEB0097789D079BAE389361215FA5E4EE93C1 winfredbahrmasel
143,616,981 *0DC3BA36A506073CBBA20ED844A6E65F02504BE6 SPHAEROTILUS
143,616,982 *0DCB33039B46B3B0682895F64EF4CC8A2F9C24F6 SPINOSISTIC
143,616,983 *0DCAAF7057070DA475A5E809E7729D89B044D63A wlxjbyg81
143,616,984 *0DC93A8F25BBF998C625469FCC33C303B0AF9539 SPLAT-*-*-*-<-Q
143,616,985 *0DCFCBEC0BE3B4F14DF3FA9DB47FAB2C10ADD6CA sploito~o~ (-8
143,616,986 *0DCFFDC8822BA46666AF003CE2C2AF411A099EE1 worldpoker-canario
143,616,987 *0DC41165FCEA661B238F6B6B8BE8259FD3952CF2 SRC="HTTP//CXMGS-MZNCM/MGS//21JNJKLL_115_JPG
143,616,988 *0DC6C45AB46BD533C00DB00EE45FFE938756730F WRITHED
143,616,989 *0DCDA3ED71BFD4A401DAACB2DAD7F1FCE913AAB1 wsbhhdmb
143,616,990 *0DC0C317A852F4236B136D4301E761F10D13A468 wsblubyc
143,616,991 *0DC057EFA98FA6D59A8F7C1ABFF47B2E57F7964A SREGNAGJITRAP0
143,616,992 *0DC5A77099A3213941895601702C877592B4B4EC WSM.BLOSSOM
143,616,993 *0DC7997147344B6AA1D5165D6B1338BA9A3C49CA WWW.ALLELEPHANTS.COM
143,616,994 *0DC9813C9AE7336E449E0B1A5411AA6115C9BF6E ssnscpsn
143,616,995 *0DC7885BCF03478442166EAE26E18B1565E490A9 WWW.COUSINSPROPERTIE
143,616,996 *0DCF6DCA6C3D830E9979E10BF63682B2C0C9556A WWWDHHSTATELAUS
143,616,997 *0DC6F1F25D6FC3DC0435DE7FFC20CED6DAA7B088 wwwkiddingaroundthekitchencom
143,616,998 *0DC3A558DAB7EC6996FB9C372122F3AD09AE5083 wwwpromomattingcom
143,616,999 *0DCE4F6535B2F70B74549656C53118EE02AD5B49 [email protected]
143,617,000 *0DC259962588E85F83632A393AE3E369625FE0F6 STANSEMASKINERS
143,617,001 *0DCD899549AE9AA2973EF457D814CCEB3EF6E336 WYQT
143,617,002 *0DC0142BAB9BFCA01C564B62647ACB85DB52AC0E [email protected]
143,617,003 *0DCDA62C3FA063200991448FEDEC52ECE1BF05F5 [email protected]
143,617,004 *0DC0D1FFDB1B60BBB3E4C22A6574A1DE7A8A7F15 XGCH8IAG
143,617,005 *0DC8E38F0A979A71FA1087033A6C73491458973C STEPHENPESH
143,617,006 *0DCFAC9EC31DB5F930DF7F27C3C6096BDEE77038 steve-pivec
143,617,007 *0DCD87B8B8F566A328721993FF92E49B10703BCE xj+
143,617,008 *0DC8F534A3C0DFAC7D26376C14064121677EBD1B XOX8168
143,617,009 *0DCEDC0C7DAE713F55FEB0502A9C5D14ADFE4B73 XPRMNTND
143,617,010 *0DCAEFA95EF5D86FB2CB4CA69EC92E91C098B4DD [email protected]
143,617,011 *0DCD23F83487B3385792B287B1F2EC8796E23BE2 [email protected]
143,617,012 *0DC160516A274DA70D0E45A3C845DDD456670A9E suepolitte
143,617,013 *0DCAE2071A0B5D50A600BB4593C9C66F9BE4CE81 sufaqs
143,617,014 *0DC1D673239CFC4DDE433A7B067EE41FB055FAC3 SUFFIBSW5
143,617,015 *0DC3B96F9FEAB8433227A775DF88B850D69BE599 yae-yata
143,617,016 *0DC43E1D932FF0B21EC0FE06E32154C7A5234E60 (suiteno2)abaratinhadepapel
143,617,017 *0DCC9435342FE5DED37942AFED263E4BCC741056 [email protected]
143,617,018 *0DC914E24CE89C9C6BCA8A91ABC7EBBA8A5D98F5 SUMETRAG
143,617,019 *0DCB5FD3F9FE38C93F9532940EF13BCCCBAAB27C SUNG.FANNY
143,617,020 *0DCD00C6D8B4FE7992A74E50A4152077A3057E7F YARAHINDI
143,617,021 *0DC40CD8B42E2CA264CFB63A3275E19681761899 SUNZHUNWAN
143,617,022 *0DCE164D3CCF0B271466165AF5092AC8979891FB YAYEHYIRADTESFAYE
143,617,023 *0DCC3F34FE5B323692AD779DACE20EF7718037D6 SUPERRASKAANS
143,617,024 *0DCC16EA545FA34F08A9BC366F1E11EEBA8A88B8 [email protected]
143,617,025 *0DCA00A63C48F4583207E8322C411B53702844A2 YGARAZZ
143,617,026 *0DC81EEDDCD51738BB982C2AD7B37D8943E13B85 [email protected]
143,617,027 *0DC7B80D7ED34ECF483BAB4480B8CFC1EC3BF1DF svalemannia-waldalgesheim
143,617,028 *0DC8F2CA974D0E7394C397172F7C5F133B06CAB0 YOLANDA-KILPATRICK-KYSER
143,617,029 *0DC5F051BC69FD7D04D74C7AED8773CDF6800B55 YORKER.OLADIPUPO
143,617,030 *0DC145D6C8621857FA98547E4004D50DBCE87183 [email protected]
143,617,031 *0DCDED8056015EC2D8B3E4F320FA38E792CC928F szatanie2
143,617,032 *0DC121F7F4F6E07DE30E44863B6CA74BC33C8801 T`4B
143,617,033 *0DCD31EFE6B375A1B74F97624AF70DC71F8D2B9A [email protected]
143,617,034 *0DCB1DE93946603D48501D686D955AA31CE3F819 [email protected]
143,617,035 *0DCD09E7A72E7FA79D0099FDDB9051383B3F51FB TAKSONOMETRIA
143,617,036 *0DCC82C31CB5A11703B20D29AB68E0F7C3BCBEB1 zachariahrarden
143,617,037 *0DCAF0078934AB6A259F06A7C854F6F84631ADDC ZÁRÓLAPPAL
143,617,038 *0DC86A5A87E7C8925EB689D7D23E329DB467A6C7 [email protected]
143,617,039 *0DC4B4717BEC93F9FAA8D4F4EEC71992D2838F40 TARGZI
143,617,040 *0DCA99C1D623414BA58918BC4D82172E2AB5A24E [email protected]
143,617,041 *0DCD63CA7282666D9E729AA961163D37B3ED6F71
143,617,042 *0DCD2C007AADD91C164918A88D9D3137FDC8915E 
143,617,043 *0DC864463B18AC2D8869496B753C47ABDA0432F1 ZEVENBOERIN
143,617,044 *0DC3C3F0CDA76FE9F8EF0320CFA3914CE7B7A52C [email protected]
143,617,045 *0DCE163164F5FA903109A661E8F27B8D98A17DE2
143,617,046 *0DC6D7136C7652446EA0035C334E38BAB762C20E ZHENEBABE NIEPEZ
143,617,047 *0DCB04C21192A9FBE9145672B50D363187A0B9E2 [email protected]
143,617,048 *0DCCC2C6B134E06A0A1341A7B5352580AF632BF7 a\
143,617,049 *0DCDD8E82D7DAF5A5D3127816F71B271DC7337DB z}_i
143,617,050 *0DC89DA3A484D67FBA3E6DC1F265B3FB38A40086 _
143,617,051 *0DCB659A90FAC8D1E1437A1E27364A9182A9E436
143,617,052 *0DCE072DF597882955B8CEBA077A1783D47CD2C0
143,617,053 *0DC5B8D46655F2960DE2B434DF06C85842180C7F Y
143,617,054 *0DC79F84F4601CE2F6E7C540A2AC51C329ED9BD4 t
143,617,055 *0DC3C51FACDB6459072E779AE979F9629A58E9E3 lO
143,617,056 *0DCA39B2814E87BAA1BF27C4899224F1F8D3A265 F
143,617,057 *0DC9B2EC8CAFA77B3A938C80E939772F9179C2BD yF
143,617,058 *0DC9056F1DDE2775194FEB188D1B01CF3C4C8839
143,617,059 *0DC6D3CF4D6E128E6BBFA5AFC5E87C38E8FC935A ZLYANAS
143,617,060 *0DC5C5734E47C7AEBEFF7A556E812FA52AC43B4A ZNDGSPKKN0
143,617,061 *0DC2A7A2014B214ACC139F920457278EF5CF0DB1 zoey-rossiter
143,617,062 *0DC29A9FB2B249BFCE2234817FC012771D86DE88 ZOMBOLAS9
143,617,063 *0DCD43A19E20BB3CD8FA28B97C6563F1B6792ABB z'Q
143,617,064 *0DCCCF9103384FFCD93CF194EF2D4678F0A31AFE 006DANCINGAGAIN
143,617,065 *0DC1123E1863D3AA616823B608337A740E60A2EB (0-0)-~-`(=====P
143,617,066 *0DC195A7BF862A1BE0E5652F54F1D13753EFB98C айеш
143,617,067 *0DC27DD76EBFF3C80C5663ECCA4A1661A9534799 05011524
143,617,068 *0DC50E9E0D01F3B189A58C491CF69CF9DCF68EC7 ВЕРКОТЕРЕН
143,617,069 *0DCEE2AF8FAE331F6FEFF541656E435C2D9F8844 (-_0)o~o~q###3
143,617,070 *0DCFD8BD26C004916D62B69BEA852F07FAD67EE5 0RNIA7E
143,617,071 *0DC7BF375302E9E100EC6FEA323324CC760E8A0E 100X152PX
143,617,072 *0DC1925B90B86F34D475849A57AF81B4C6E2EC58 1022FRANK
143,617,073 *0DCA317AFFE7FBF194989594C492A14ECA18CAB2 11-11-1803
143,617,074 *0DCD5D7FADF1ECA84B85A0E9A3B7D3ECCAA7A8F0 КОМБУСТІОЛОГ
143,617,075 *0DC4BA5F0734E127A9E2C7C6E1DF07ADD36B881A ЛЕОНАРДСХОФ
143,617,076 *0DC19EE7F9CAF9FC1D6A490FA7E5D39CDEE8C77C 1444877 H
143,617,077 *0DCB319A295290D982B7F5CBF3D22D70EEC005A4 155.VERSINKT
143,617,078 *0DCB12D7D14E0969813E0B00330959C6D10898C5 СТАРИЧНЕ
143,617,079 *0DCA44B5E2AD7E6A9913ACFC086586A4EB11ABF5 такэити
143,617,080 *0DCC8464A993A4FC71CD87E4D9BA1AC72D4301CD 178sienna
143,617,081 *0DCACF14BBB758E151F4C45BF9438C92A377E08A 19692404
143,617,082 *0DCBEDD738101D3A0CC3E605DCA861036C4A83DC 1979794 " sopimus on meille merkitt
143,617,083 *0DC0ACECD8242084F89717F65EFCC438709CCD47 1.AUTOPILOTTEJA
143,617,084 *0DCF4FC8C7BEF21C738461EDE5615B7011B6E3D7 ясенский
143,617,085 *0DC40B652A53E87A6BD6309B405DDE61CB4458D8 ՍԱՄՈՒՅՐ
143,617,086 *0DCF0B24338D5AEF57FCEFADB0D4199B243E5317 1-EINSPRITZER-MOTOREN
143,617,087 *0DC5AE0E13690FCFDBB8AE5584D404814F2D02B7 1EMANETTE
143,617,088 *0DC7D66FEBE8E4FDC40B5A508A1D3337E2ED8DDD 1.entwicklungs-vorbereitungszentrum
143,617,089 *0DC921B9A4F4AC747FDAF3F271AC772BEC8CEB62 1.ER
143,617,090 *0DC4A9F5A4F78C68EB413B9728FF94129B137769 1ETAILOMED
143,617,091 *0DC2174A5411E23CDB70C2EEAF29EFFEA603C0A1 1.GETMETODIT
143,617,092 *0DC7503FC4C50CE4CD9FDA08CBABE07BDEAB975A 1groothartigst
143,617,093 *0DC6BE3708E535178E8A07591A4CB1DA3A86131B 1kijoittamisen
143,617,094 *0DC7F2216BE083E0E6A8533C911E4E6687C3DEBC 1-konzeptfahrzeug
143,617,095 *0DCE75AFC8B2E4BD52D188F67406090CE09851AE 1-kuyudipi
143,617,096 *0DC76ED57623F6900A3684CDEBDECF229123C940 1 LINUX-TUKIHENKIL
143,617,097 *0DCBA9AF7320B23365CDF18953DCDD3ECA20C197 1.LOIRI-LUOKAN
143,617,098 *0DC4DD9815D35FB4C9D3ECF7DFF6C44C89102FB2 1.meksikko
143,617,099 *0DC6C99129F93E7074269A1DC5CC186F24C5EC9D 1 pilkint
143,617,100 *0DC91AB1733246E1083F68BF3586BBA6B7839023 1pulputtavan
143,617,101 *0DCBE0C9541C4484C97D0166507704C3D8B201AA 1Q2W3E4R5T5973
143,617,102 *0DC7C84226B69F2A84A8734F218451324E40AAD5 1.RUECKGABEVERBOT
143,617,103 *0DC36723BD45C3FA1DBA9A3318238CE6D7FCA4B8 1-schaumwein-stehempfang
143,617,104 *0DC877DDEE94B6422402706F1518017DC1B33EB7 1.TEHT
143,617,105 *0DC83D3876F09ADE52315892CB60B5E7B1A6383A 1-TRAINERTEN
143,617,106 *0DCE67C9EC83848857885664BAF1CF317A3C70BA  ドイツ・ボン大学公法研究所(j
143,617,107 *0DC5A1DE3E0BA1E340460536AED64FC3B99AA4DF 1 usta'mizi
143,617,108 *0DCC074C4D993350BB17352D9B885192A3C9F942 1-VIDLYFTIGARE
143,617,109 *0DCD25A90E4E32BCEBC8FE6811D356BD252B9305 1YDPOTT3S
143,617,110 *0DC276ADCCA7FEF820F5F8FDED51A74B18E565C7 1 ZOOLOJIYE
143,617,111 *0DC6E76020E236D3A78E0DB44FFED9FAA2CBCBEC 2001-02-18:FOLEY'SCELLAR,SANFRANCISCO,CA,USA
143,617,112 *0DC18E9FD095107885E4B04B0C04080CF82E8AF9 20.umts-handys
143,617,113 *0DC3E707D0C719F44E5B1D45644A812A926375AA 2131781 POIKKEUKSENA OVAT MM LYHYT JA ERIKOISKURSSIT SEK
143,617,114 *0DC88D1D2C67A69BAC18057CD505E705ABE824FF 22051672
143,617,115 *0DC24B085E6064004313F0655E2F28B08F7FB932 2222439 "-MAASTO-KYLL
143,617,116 *0DC3217D9BF82FF45580A25777726A27B56095EB 228RAMON
143,617,117 *0DC97381B4A37D3878AE5F8442125F0944E941A7 2574688 grund genug fuer dietrich , aufzugeben
143,617,118 *0DCC315E8A35665C567D77BF663D4B7518194D46 275459 yarISmayabirkiSidilediGikadarresimilekatIlabilir
143,617,119 *0DCB2DFFD4486524495E9AAC653B91B66C9F2499 2851272 TIETO-.JA.VIESTINT
143,617,120 *0DC025ED23BAFC427058C0B667E82AA8CB16FCE1 2.admuuntimella
143,617,121 *0DC08BF095E23F2393A6DF231FFE8A27FAC9FBD5 2BROMIAN
143,617,122 *0DC705263466736D2FAFCBE8442A0588BB9BA38C 2 cdunah
143,617,123 *0DCB912E89E80F56CEDD5DDC297AD511ECC3131D 2 expertsand
143,617,124 *0DC5BE1A2CE009A0D5241413D3AC7C6553ECCBBA 2hyv
143,617,125 *0DC7CED92C0EFEE1F708A4B03BE7597FF3E80914 2-kotipalvelunohjaajaan
143,617,126 *0DCD6616713C1E33CBAE0AD0FF10D55B7776BC60 ザフト軍がジンのプロトタイプとして開発した史上初の実用ms。型式番号:
143,617,127 *0DC3D7AE9A2CC4182DD826FF6C662BFE7F3E3FAC 2.planladIklarImIzI
143,617,128 *0DCB1EF92415583258871874812E4EBA2B6DC0D9 2-STIPENDIENPROGRAMME
143,617,129 *0DC228A85CD19BA53C66959DCE6B28C793500877 2-zugebruellt
143,617,130 *0DC8C55043BE5B76101DBC3436F6941FEEC2647F 3AIRAOZOT
143,617,131 *0DC27F12722AE407AE262833A2FAD4641C8F864E 3ANHYDRIDIZATION
143,617,132 *0DC28EC110867D217AD028C15B816857F6CF485D 3D170R1A11ZA710N
143,617,133 *0DCDB2EAD8C231BCA5E46B7BAFE56968F73F35EF 3GLASSBAB
143,617,134 *0DC680C46EBBC0A726344751712E1B34EFBE667C 3IAMFROGS5
143,617,135 *0DCC582D5358898EF6B5185BA500A9797C1C6184 3ILOVEDEUTSCH8
143,617,136 *0DC424D85B4CE1428A011DF50FD49B69C3099CBF 3LeePeR
143,617,137 *0DC657D937C8C319251FD7F3A6CD0945683CD0C2 3###p-~-~-~>-b0
143,617,138 *0DCAAC67C35179C6C91E671AC9B9002F3116D9ED (~_^)0~(=====3
143,617,139 *0DCDF37F00ADEE8D931A00FD7F127605A6C5D42D 3thechristopher3
143,617,140 *0DC9D4C49141D2F72352221509CFF15EC55DE951 426714 URASUUNNITTELU.JA.OMAN.ALAN.TY
143,617,141 *0DCDA46D26596AE43B133A31F9A9690365313EB2 464GARRETT
143,617,142 *0DC127D5A471E15AD332B6B1D273D77B5F9DBCD9 4ILOVEFLANDERS4
143,617,143 *0DCCE5200626B7C7FC97155F52BD1FD2B942C394 4JOSHUABLUE
143,617,144 *0DC6C50FA01231622B744F23C4FA7A63A0A1E5C3 4march1539
143,617,145 *0DC6A64962E2FAEC5E2EFB4278739E85666A3098 [email protected]
143,617,146 *0DCF26A3F44FD7C2E539FE0EE55F1442F8668A3C 4-REGIMENTSTOECHTER
143,617,147 *0DC309ABA6E17A08742A152BFACD9EF810F4D3EC 4SLJEFFERSON
143,617,148 *0DC24ECF04B44CA1767235C6B955FDA7D364614F 4TAVELIAM
143,617,149 *0DC406DE11C842C5E6569D0F48CA719DD3042AD9 4THEMEOW0
143,617,150 *0DC1CF6A38D0D720116E8D804CAD13AAB7864B6D 4WALDGRUNDSTUE
143,617,151 *0DC7EA0887D2A67BCE901BCF42CF92F903059475 4WERTERHALTENDE
143,617,152 *0DC96743C11AC46A669E7F4168DB8003C3DD707E 512168 SAMALLAUHKAATY
143,617,153 *0DC49FC64C07F4375023FCDB8FE15739D0054662 571415 KIRJASSA.TUODAAN.ESILLE.KIRJALLISUUSTERAPIAN.L
143,617,154 *0DCE71583F2E57984EB5A0A9C915E7B697CB3496 5.AGGLOMERATIONSKANTONE
143,617,155 *0DCC052BE206B797B8F6CA85578821430926693B 5BM3RGBL7Y
143,617,156 *0DC957DC5CBF6E0B01A78835FC7F111EE42C49F1 5BOBCATKLEENEX
143,617,157 *0DC2A86EAE03C2442DA745EF5CC20BBCB3264786 5ECLIPSEMONET
143,617,158 *0DC66DB26AB9FFC4C932D55374854B81AA89A3C6 5ESSINRAP
143,617,159 *0DC75B11F3BBC986BED6580E4C43C52C72B27978 5ESUOKKOD
143,617,160 *0DC151CDF78C6AF8A05714F7FA5C8D9CB25BE860 5FILERCIT
143,617,161 *0DCBE45E9C7B8EE2F4486BAF421ACFA9CD579B2B 12HUG
143,617,162 *0DCE8A9A1C43382CBEF903A211E60A6AB399A389 1346492 PAYLESS-CASHWAYS-HAS-200-STORES-IN-26-STATES-
143,617,163 *0DC1B79E6DDD6741D30D98A45B839D3C963EC73E 16=ah\\\\'z
143,617,164 *0DCAD758BEDCA5D9131719A6A65CE5FFBF7E435B 5TOGETHERYOKING
143,617,165 *0DCA05F5B842D6DCF569C76085C52ADD526DBBE8 [email protected][email protected]+E5
143,617,166 *0DC35D821365FFF4D7F90B99B993B3443F70922C 5uzaklastirdilar
143,617,167 *0DC7652C87D78C040D765DF2888EBAF3CEEC538C 619TALAN
143,617,168 *0DC4EED85F6896DEB6879061ACAA7F5BA3729CA5 632137 YHDISTYS ON PERUSTETTU V . 1993 NELJ
143,617,169 *0DCA53E16979B4B5C524EB7B200C0F8816031970 688JAQUELINE
143,617,170 *0DC8022C9560B069035090CD4A5121FB48A76A4A 697782 sari-on-jo-tavannut-kaikki-perheet-,-jotka-meill
143,617,171 *0DCBF9821D23F0FAE14A2CCB413A6B66CB63CCFF 6CABOMBAN
143,617,172 *0DC6C7B5A83C7CD64B5DB56D17FAA4AE6ACDB02B 17.09.1646
143,617,173 *0DCF57FAA943F045524F16C7E831AAD1261B019E 6DIANEMONET
143,617,174 *0DC8A6E2B25B45D6A785D3331CB353F15514D3DC 1829315 DAMIT.ABER.HAENGT.DAS.ENTSENDEGESETZ.IN.DER.LUFT..
143,617,175 *0DCFA6D17CE978E97190619210F590049ADF9AE3 18.threebutton
143,617,176 *0DCB1415BAE1312059907801983DD36C16031A24 1917054 painotetaan.kirkkojen.roolia.t
143,617,177 *0DCED0C70C4DC183C48C28CA78B3AC9A37611289 1926294 niiden.ymm
143,617,178 *0DC10112A1FB3F5CB5C5221F03D5070EC2C8E62B 6MESCROYANCE
143,617,179 *0DCB6442A08310B9EBE8AED1DA81A9449B769D46 6RASTOPILI
143,617,180 *0DCFD6B44FF2359E2B52F18954A69FDF220B7AA1 6RENOUNST
143,617,181 *0DC0275ECB6C178A89C2DCDB04E090F2D253BBFD 1 BISABOLOLOKSIDIT
143,617,182 *0DC0D09403E241250F9C4B67E3F0E5DBF3D3F1F9 6TOOTSIEWENDY
143,617,183 *0DC6BDAFBAB1DCB444A1DE74CCC6D9F92438743F 6TRATEGEN
143,617,184 *0DC091E7B7A4985BB40AABAFB7D5D17A2C844523 1 CLEMENTINEHOSPITAL
143,617,185 *0DCD65E739A8D168547D2B68CFCCB2E12F5EF237 728KASH
143,617,186 *0DCF1C7BDD04A86A4A2FB1E1A16E55D2AD23A4A2 741886 WASSIEJEDOCHWEITVONSICHWEIST
143,617,187 *0DC4854E740B01F6F4623AA4CD1FE8F33A08C393 1 DPANACH
143,617,188 *0DCD8577062CD120FE5DBBC7DF4C930DD538F7E3 1dslpalvelumme
143,617,189 *0DC97030D1CE36047F677973E918BA2E67DDA211 1.ER
143,617,190 *0DC4A9F5A4F78C68EB413B9728FF94129B137769 7ADJECTIONALS
143,617,191 *0DCB2BCA5780321F34741EB44828BA862194E6FD 7BILLDODGER
143,617,192 *0DCCAFE5286BB8FC70277B665BC5268C1976B618 7BNIHSIUS
143,617,193 *0DCB138CF1F4ABFAFF6343AD758D1E0E874D2692 1FTLOOSE
143,617,194 *0DCCFB235DA259B469E8D0D7E19B83E9B9C4DEB9 1.GREIFKOMMANDO
143,617,195 *0DC68FF9252DA6EDAB2AFA3B95A935FF0E27015E 1HUOKAUKSIKSI
143,617,196 *0DC24C2809498BF8FA4010A4697E068AD61780D7 1IAMBRAIN5
143,617,197 *0DC05B5EB008C6CFB8DA380B9D17FDD908B66266 7CBQMLBSW
143,617,198 *0DCE43F993427BBC1175B5D748F4AEAC330E8093 7CINDYNOTHING
143,617,199 *0DCF07C9667D1C635927E298B34AFD5FFD565EAA 1ILOVEFLOWERPOT6
143,617,200 *0DCFAF65845E629A94C9E5710107C0D8294218B1 1 INTERPRETATION
143,617,201 *0DCBA3B5D5FC8883F45DD398A4FF5B9D97591578 1JUOPI
143,617,202 *0DCD2D8AFD9928860E0A6B6F3EEA2EBADE0772ED 1.kanli'yi
143,617,203 *0DCB9D6DAA2CED3711F032FFC6471078B53A4763 1klezmer-yhtyeest
143,617,204 *0DC87390883462F8D7F36606C8D921BAC7A13F2E 1-kuutma
143,617,205 *0DC0B38CF0C1C590E76D94064442ED2537947E6B 1 MAGENDARMGESCHWUER
143,617,206 *0DC8EFA803771E6F9BCD586DE93870DC4EB04158 1.MARJALIISANAPUA
143,617,207 *0DCC90678F49D377DE30EFF75F07AB97C8ED0A80 7KLEBRIGSTEN
143,617,208 *0DCE949947DC5F73AFCCBC749C7D115A31D3851E 1millionen-dollar-gage
143,617,209 *0DC3841FD8396414D3B817ADFDD71B0057E3E447 1-moniloikkakisoissa
143,617,210 *0DC8749A8D2C2636FECE6EF1EAE1DB3EB4F3568C 1 OIKEUSTAPAREKISTERI
143,617,211 *0DCE253B9AD07951743AAE7DABF3818683AD1EE8 7ODNACCIP
143,617,212 *0DCC8FD141674A9F1BD1EE62C0158456F134EA7E 7RESOLVIS
143,617,213 *0DC08FFBE5FFCCA685F0164939EF156D62CFC124 1.plakativere
143,617,214 *0DC4E39C03F0A9246A9AF584CDF976B21893F798 1 polkupy
143,617,215 *0DC1A066481CC7EC84AF08D966D728AA7F6B378C 1prostatitic
143,617,216 *0DCFE5E97D5EDEE594284C5D2610C237838E14C0 1PYRKINYTKIN
143,617,217 *0DC45A18B7232C21BE5A943979899B8E6965E4F9 1raeume-tausch
143,617,218 *0DC956DA7761EE050989BD32F8CB78080B972A82 7tech5
143,617,219 *0DCE2EB735998240B51F9B4B64D6F25EC68D0451 1 SOLOTOERNS
143,617,220 *0DC829D6B30098B7F43F5D473AB4C02ED2D96CBF 1.TEHT
143,617,221 *0DC83D3876F09ADE52315892CB60B5E7B1A6383A 1-telakka-alalla
143,617,222 *0DCF8220E130EDB023DF8C555BC3D8EBDD4F47A1 1THATINTREPID
143,617,223 *0DC2A416D3CDA3B3D2BCAC32ACA5728F2ADBBD56 [email protected]@11Y
143,617,224 *0DC3601BE591407128AF7333723D1436CF58BCDD 1-time-three
143,617,225 *0DC0F76C3A4E7BEEB01530CAFB1AFB79F7875C32 1TUTKIMUSASIAMIES-HANKKEEN
143,617,226 *0DC455B2B8372CF8D90A8BC0938685B5ECC85734 8d~0~osplat!!
143,617,227 *0DC0F14DA309EBB44CEF07291B1BB3059B6FF6BA 1-wolkenkratzerinsel
143,617,228 *0DCFAB4F735A3AC5D693CBA516A7428D552EA4A7 1.WORLD-GAMES
143,617,229 *0DC489BA036A511093145745892971DEB810A50D 8-demokratiebewegungen
143,617,230 *0DCF8584C7C9FDF00B02EFEBB7D05E71E34FB6BA )8(*.*.D-P
143,617,231 *0DC42C474A3BC73FEB311E9778B513AFA0C37FF5 1 ZWITTERHAFTE
143,617,232 *0DC920F9E8663979577BD8A4052273D5FCF7A203 20050821:boston,ma,usa
143,617,233 *0DCA944DFA0A9DFA8384DCE21B9429801D076216 8EMPOTRANDO
143,617,234 *0DC68FB415F97795091CBDAE428FAB0CE6AE5386 8KUKKUVALL
143,617,235 *0DC41CAF200844A56FBB26746CEF0E5A96A9643D -21.47uhrlauschangriff
143,617,236 *0DC3650C1F2959C0FFDB361E60642648EB32EB61 8LEDZEPHAZEL
143,617,237 *0DC106DA47C1060A49E8F7838AB75AE2156BB2B6 8LIFEBREATH
143,617,238 *0DC3501FEE02C095B87FEE283EE2C04B366BC799 8NAMELINEWRITINGTOSTANDARDOUTPUTFONT
143,617,239 *0DC32BF66666F8BAF70F92C7FDD29B55A52F8F8D 2392POLICE
143,617,240 *0DCBA5056F7778064908F988224F2B6227BDC577 8######P`~(>-<)
143,617,241 *0DCDF817A9F660CE04D3E9551B68EA8D131F601C 2443051 MAN-MUSS-SIE-SEHR-,-SEHR-ERNST-NEHMEN-
143,617,242 *0DC4D5616712300F9043E6A63D4D23765CBAD60B 8=====p~~(O_)
143,617,243 *0DC630BB904BCD016A7CEA5BB5710014C568A198 8thealicia2
143,617,244 *0DC41B3C75440E90EAC148E025CFAB353FFF42D1 292ELI
143,617,245 *0DC7E516644B73BF8B0F3533E8C7391976A204D6 8y8z7w4udj0ji6sui7f5qb
143,617,246 *0DCC2AF222F8333CDD46624224EDFEC198199406 2ALAVERAS
143,617,247 *0DC290C3FE586AACDF9E7237F60D5E3FFB9F5276 2d73791f62d124dfa14473965aac4bd1.nas8pds
143,617,248 *0DC7AC6244503C2FC279A30BF087A523EB6F9745 9BSWGUENDOLEN
143,617,249 *0DC99A4460BCCEAAB971831C03B7332B24619460 2hyv
143,617,250 *0DC7CED92C0EFEE1F708A4B03BE7597FF3E80914 9CAMPINGPLATZES
143,617,251 *0DC6ACA3C07ECCB87B4697FB7E6CA1CD90052513 2IAMWILLOW9
143,617,252 *0DCDF421602EBD11850B7B99E7E84A8FAF3BE3B3 2iluvripple7
143,617,253 *0DC3175192F52E67595EAE0F96B51973277B14E8 9CYSTGNSS
143,617,254 *0DCDC8C1D357AF45567F9DB97AC67126E0200E77 2 KARAPAPAS
143,617,255 *0DCD18F9936DE38F0EBCA30D674FE8B35C1F7CA6 9DNEREDDUS
143,617,256 *0DC9526D610ADB34F847C1DC3F2625705B88F393 9DONATORYS
143,617,257 *0DCF0B8957D6F97AE85ED0428088D1267BF58999 9HNDFULDEN
143,617,258 *0DC975E455ADBE64BD66CA24F7EC5B1EBB086255 9ilovefred5
143,617,259 *0DC2EE18304B3210B7B24830320C1536CA57BB22 2-muodonmuutoksena
143,617,260 *0DC968DEC868681C921933212C09B02175662BBE 2.pazar'I
143,617,261 *0DCB4624EB042D76499949B071724D928FAE78EF 2POPUATIO
143,617,262 *0DC41D16B7FDB143070ED124113E14A904D886A1 9MIANNIHS
143,617,263 *0DC725AB8E295F7486A2C924DA2EFBE8EDCE14A8 2shoot-the-messenger
143,617,264 *0DC807C1970089E5EC7063B5C1F1F3489CB09FCB 2SUPPLIVO
143,617,265 *0DC83F20FEFF4D5DA36B4F4F2D79718E75357956 9RADINTAP
143,617,266 *0DCF61ACFF16CF835662D7264F1E750095000E6A 9THESTEELE9
143,617,267 *0DCF52C45FA5A4E65021BC71E89CFEFF39852B76 9TORELIEFRELISHRELY
143,617,268 *0DC4C7CB886EAF789D075CFE6765506D9774F902 A0#HB
143,617,269 *0DC0A25C960E6CF0E07274A59EF7FB1B14EEA5C2 33.KLOPFTEN
143,617,270 *0DCC24E4DB265BD62FF51CF6589B9E1C7B35A35A 357946 koira.oksentaa.,.ja.sill
143,617,271 *0DC98D0D656581E351F20EDF217E7EC6A317C947 A1gw
143,617,272 *0DC56C40848711CA4E6A4ABB3D2934482E266719 360で実行するにはXNA
143,617,273 *0DC0916A0800663D39516FE42FBECAB91F36D0D1 a1mf:
143,617,274 *0DCC9185860716F7464BD722DC65085D40F25278 36.SARDINES
143,617,275 *0DC6727BE55265D21FEF69A67615057ABC4FAFD1 372KYLAN
143,617,276 *0DC1CA0353A7202A8B6D25258186FD5AC9D6C348 A20051125PR201
143,617,277 *0DC55729133BB1550FB56A39774D40364BF8951C a3"v4
143,617,278 *0DCF693EF27FB8DB9D29590967B390CBE01E7CD9 A-3WV
143,617,279 *0DC4CD57A841C6CC1A6858C03EA481613117754B A4HZI
143,617,280 *0DC4A0803BB4550E13C8C6317FAFF4D9776074A3 390332 '-that-doesn't-happen-by-accident-.
143,617,281 *0DC30B4DDEBEF599BA0D9F714A00F3131406EEF5 3AIRAKXIH
143,617,282 *0DC6E5D2B29366C554386A6A7CCF591EBE05AA7D 3B<~ ~(#Q
143,617,283 *0DC9BACA6EFC94036A17D29833197B76D854F0B7 A7UJC
143,617,284 *0DC69F203B44ECF92AEFB8ADEDE45D1BE992C3E2 a9k=y
143,617,285 *0DC453A8500CBA4EF71D63E9414DB9B13A8A0FC2 ãâŸã‘âƒã‘â‚ãâ¸ãâ½ãâ°
143,617,286 *0DC13228B2C66E1059D57CFF878CEFD386135170 aaai'x
143,617,287 *0DC1FA12651E21963F3FEB14CCE190BA4A742272 3GARTRELLE
143,617,288 *0DCCAD102159F5EA345F0C73E62881A82B4A9BF8 3Governmentrunprogramsthatemphasizedoortodoorcontact
143,617,289 *0DC3A2B556AAE91ECE3D4D552655E0651EF4F848 3 HOPEATILA
143,617,290 *0DC5ADA9EFCEA498BF955AE7A1A23F0703E9F3C4 3-KONSERTTIENSA
143,617,291 *0DCAFC1706139E09D824C3C5A12923E924AEB97E 3-LEHTIHOMEENKEST
143,617,292 *0DCE81847EC0CA393AEC5AB4DFDF478527994810 aadasi
143,617,293 *0DC201300DDDF6FA51451DDF8A6AFF4E0160C875 3OFFCALL
143,617,294 *0DC6917A17589D68A01BA052A43D30901BC39885 3===p-*-*-*(~_^)
143,617,295 *0DC665A329A117E755F6AEC32200CCFF88CC7769 3$PINOZ4
143,617,296 *0DC112DB30D06B9A9934D8A6EECBACA2B746E4AB [email protected]
143,617,297 *0DC05EC4FACF8030200D3C0D33B55890A3EA9A08 3TRZEPNAC
143,617,298 *0DC84398821124F648522C971E8FF87AC627AE3C AB-68
143,617,299 *0DCC7FD19E05C57E397341CF2CCD1DD47C86D99B ABAVABCN
143,617,300 *0DC122C56A9E33E866DF223BE60480C0D1FAF7F3 3===>~)X(
143,617,301 *0DC207BCEC88B7F4401248BD1A421A2608EDB232 4:..4..#..&...MACHINEREADABLE
143,617,302 *0DCB7383E7FE1B39B666608E2788F4CF172A4967 abhisha.nkyah
143,617,303 *0DCB3587E57A86A10083B8D7DEC3CB3C51CCD598 abjuracja
143,617,304 *0DCDCE8B9D04415160DA608AB18B6D7111669F97 AB)QD
143,617,305 *0DC3FEA14D8F113CB4D5EC48F44585274E03058F a?by.
143,617,306 *0DC83ADDAA978A369E55B70714C2C7BCA3613DB0 A=C9
143,617,307 *0DC23C736BF58735AB5A34EE8DBCA32724CBE165 4GRUEEBLER
143,617,308 *0DCD3564950C2A8BDCC4BC14460DB8C3BCA91B68 4IDAHTNEM
143,617,309 *0DC4CF4A2B3116AC77A070E60C55065279FD95D8 4ITFONTPRE
143,617,310 *0DC5BB3579C952648F80C90B2CECBD6703558814 4LAUGHST
143,617,311 *0DC20D14263C7427DD7441CBD14BA8FFD3473C3F AC_.R
143,617,312 *0DC67D77773CB868E943DAAC1B8F6884F1CC85E8 Action2(NonOrchestral)
143,617,313 *0DC56C2CFCA0A9D66231652F154631C94767E89B acw_b
143,617,314 *0DC89DF076456B892D61D99D405A3364E73FF145 [email protected]
143,617,315 *0DC7AEE9947412D1F1FBC4D1C812473646FCC666 4NATHANSUPER
143,617,316 *0DC4325A2FEE2209B71151D112C8E02F0EFDFAFF [email protected]>
143,617,317 *0DCF86371D75F3AF9BB94798E283D159CA580C4B [email protected]
143,617,318 *0DC9E8E8C0058A83FBB90C4FC83962BDA0C1A57F AD~M!
143,617,319 *0DCE4C6265C4AFF1BE0740931FEF9A7DE4C8C5BC ADOLFO.HUMAN
143,617,320 *0DC10EAE2A0DF6AE89E5D5E59BC76A5CF8681D5C ADRM9
143,617,321 *0DC5F20CCB046BCF0939858E480B0FFA7070D816 ADZMIMDNOOR
143,617,322 *0DC2BC8C194A1E7A7E1C192E8E6FE5A72A456C5C 4TOSUBJECT
143,617,323 *0DC559DC8A7F18FE4D7522A0780BFDD8841848B5 a&ef;
143,617,324 *0DC7785A8095140BFC9A06DFFA5BC3314DAD1959 AETEM
143,617,325 *0DC8EA42F3F8F33E9D875653696A219C3FF35CD3 4YYIQWUQVMO
143,617,326 *0DC3ABC5E8505C6336E3915B8955CF7977961F62 AFANTOY1
143,617,327 *0DCC872EB9E112406691BB21388AAC8FDC3ABAA4 575549 ancakdanIStay'abaSvurmahakkIsaklIdIr
143,617,328 *0DC05EE1B477C5E0F9B74C5D95DF9273082C5EF1 afkokens0
143,617,329 *0DC34A4A0D4631976DBF899C6ED911CAA52D6E31 596751 madde 52 - ebelerin reCete yazmalarI memnudur
143,617,330 *0DC7AC45BAD0CC7D7CD3D6AF0013AD190F310850 agyx
143,617,331 *0DCE0728471BF32A66520D6B41445B3C497808CE 5DDOUANERA
143,617,332 *0DCABDE4F281A808660A7944AE4FDF61262C7344 5DETACUDEERP
143,617,333 *0DC9F84AD3F8C1A1721395991570BBA6CA5BF081 5DISMALING
143,617,334 *0DC8ABBFCE492A4836298D55C1CB2F426A0DD12E AHE-ATOLL-CRUSING-TOURISTS-BLACK-PEARLS
143,617,335 *0DCC3208C672EAFED6881B401FE3FC8864119D3F a!htj
143,617,336 *0DCB1F8576E13DD401F6A2C4116BB016E4469C02 aik..
143,617,337 *0DCC1FBF2974D3D78520A68FCF2475F2EFBD20A7 ain4z
143,617,338 *0DCBE81D8E5E9E83E37EEA9779C444B0793A46CB aischeur5
143,617,339 *0DCC2EB0AE222906BF90383E41FA1E24D4DF3225 AITROFNI3
143,617,340 *0DCA9C2549D04F85EC2A2E2B31B697BE77B39B52 aix)q
143,617,341 *0DCE5BA24C509212385E62C8BA95A81C12C6F64C 5JUNEBUGPENTIUM
143,617,342 *0DC7ED5441345F3034BDC4B3F49B4ED3DDFF4236 AJWT
143,617,343 *0DC0BAE9CCF8C884AEE8B23F7D5C5EA8D31976E6 AKCUA
143,617,344 *0DCCBC25C3BE2A3036CAB446E3D1F7413BD9D966 ako/u
143,617,345 *0DC566C8F01B14A895ED018A82D1B1EBD567F2C4 ALANNA18
143,617,346 *0DC32FF90E5385DABB1F7BC838DBCE3255C3A00B 5OCTAHYDRATES
143,617,347 *0DCC412137A62E0FE03974925537C83E98190576 alchemistae
143,617,348 *0DC08CA20CB88C20E305B4158B0FC2EB71E48ECA 5REKORBNWAP
143,617,349 *0DCFF3C7C975E3DB10121A25AC2FBC26A8AF3C3D ALEXIS.FRUIT
143,617,350 *0DC4A78566E84F8909B8229DE3F5CFC3069900C7 ALGEIRS1
143,617,351 *0DCF47EC331C5C0C7FBFB45E48C2B47F81EFAEB2 ALILEBERT
143,617,352 *0DCCE328888A85519F218FE8E55BDC35BBD107BB alimoche
143,617,353 *0DC90D1A64278B746090FF5E4FFB8EEFFFF3D38A 5UP3R54TUR4TN9
143,617,354 *0DC3CB8A9EE01846E183AA6A7133476F4D6C46A7 al=mq
143,617,355 *0DC54DB914AE935F57905E069C38178B81639053 669036 JUTUSSA.ESILLE.TUOTUJEN.INTIIMIASIOIDEN.PALJASTELUUN.PIT
143,617,356 *0DCB804E99B7DEA8CD1842C159F539B63B3DD544 680014 DIEBBCHATEINENSCHOENENKRIEGSTRAILER.
143,617,357 *0DC701ED8F1603D8A3AD8C47862A8C4D6DAB8E44 6AMOURCHURCH
143,617,358 *0DCF397A780E882F3246F0F4560514BD95497FDE AMA2RE
143,617,359 *0DCF9599FD4019E9CB8D402FA0BDBED8D771F1F9 AMACETNA
143,617,360 *0DC2F75565918620BDD2A1A3D48CFB4F08B8FF87 ambrosenanes
143,617,361 *0DCF4AF9CF169AFCEAD1BC9B489B7FB7ECF07DF9 AMD.COM.AU
143,617,362 *0DC21344DDD2127ABF350E3D255FE67ABBE5CADB amgbf
143,617,363 *0DC4A6F7D6736B82EDD2B6DB8A10027D056F4FB5 aminegroup
143,617,364 *0DCC60EADB9DDD1D14D438DF2EFBFBF3CC635038 AMMANNO6
143,617,365 *0DCD47DD5413D36A63BAAE7EC535F6B2C7BA23D0 amoscouey
143,617,366 *0DCC33CA0C2C02AB45FCF43A2189CF188F0D9220 6-FRISTGERECHTES
143,617,367 *0DCADDA11573E68C6EC69964E773F0943B1A84DB ANAPMIIL5
143,617,368 *0DCB5E1EEBAE4CC3F2F061F9DB33D63A26FA78F9 6iammagic15
143,617,369 *0DC6F2C9598A6AD95A590EA8B306544026D84E01 6KIKAKYUU
143,617,370 *0DC211A9D93AF5D08B4424AE3838AEBE24F5A24E 6 KUTSUTTANEEN
143,617,371 *0DCDF984B6B9E54127011E7ACA84B4E4A963BB00 ANDYGURNEY
143,617,372 *0DCCFFB9D4B3D78D418542AB0C0B35C83A901953 6NETNORFSLAVNAA
143,617,373 *0DC8131F63D7954133872A5BDCFD81BAE096F3BF ANDYYAU.BBS
143,617,374 *0DCE18144CF775715F82820D2941EE1E40226ABE 6SCHOENHEITSKONKURRENZEN
143,617,375 *0DC17166964C4650AE0FB442649082D10FD44205 ANNULLAB9
143,617,376 *0DC6195E72AA194887EA328F4B550BF09625B658 AÑOS1
143,617,377 *0DCF2B6E711189DD1753847B0267E8456E4A8785 ANSNOWM3
143,617,378 *0DCC89958E527D4F9481E4677AE1649AF42E9056 ANTHONY."HOUSE".CHABA
143,617,379 *0DCE3AE9B4EF7D7E5ED5DCA3B740A23A2B043CD3 6VERPUPPT
143,617,380 *0DC5C9E2CE04776BF86ABE21E838A0D409711F41 AOPU;
143,617,381 *0DC7AB472D3FB8FE2F8C77BEF5A6BEFBF23FB243 apfa
143,617,382 *0DCAD3E2C82AFC396DA06816E061557CE5858C03 7DATATAXEOMRAADE
143,617,383 *0DC739E1BFD9D2E128ACDCDE5829AF570C386EEB 7DKNIGHTBSW
143,617,384 *0DCF23C1FC59A615133E2401F482244C16064C4D 7EBABUL
143,617,385 *0DC98F803A0E2FE2572F7F1721FA8A2312D3838F aq0_
143,617,386 *0DC9D009E91DA1AE83F19F018B6B164DE7E0B2AB 7.iletildigini
143,617,387 *0DCB358335F25159BBDDF2DA1D1D61D55825BED0 A!QRQ
143,617,388 *0DCC5DF3A1B84034164843AA0683FBBC11A034CF A!QSZ
143,617,389 *0DCE49229676444253CD4B7F965FE1DBAA9B086C 7KNIGHTTORONTO
143,617,390 *0DCB1736682C010811ED7214A986304C69F89725 7NEGUKOHC
143,617,391 *0DC50122497A28F9E73AAC93D7FE6C88ECB5B67C 7PARIDHAAVATAAM
143,617,392 *0DCA5624C0746B8B61E9999264AADC466447F4E1 [email protected]
143,617,393 *0DCCFF07D55E1287A11EEA2F2D799CD91CEE7D98 ARRW/
143,617,394 *0DC0D860CC2BE416CEACF4AC16CF3E68E9B381FE ARV8
143,617,395 *0DC81B2ED4792C35AC3B16A62FAF0987E3E965DD arvioitavat
143,617,396 *0DC548FEEC9118B123A2B3EE5A1F21C45281C5B1 ASHRAFEBRAHEM
143,617,397 *0DC898D357CA70BBA1FAD6CDB9B5F68D1320E3C3 ASLEEPSES
143,617,398 *0DC9F4C866BD015799BDBA5D002337BFC3F2D2B9 aspnu
143,617,399 *0DCEC97D407C3B8051306BAEA53903BBDED67C26 A.?SQ
143,617,400 *0DC13FB9FBECA07F5CEB981A00B2AFF6B886B400 A$T$A
143,617,401 *0DCD8FF0CB78B2E1E15FD64636E6312FB33D780F atteuvia0
143,617,402 *0DCEFFEFC10459AA1E7E1294F5335F63E30A11D6 aubreyvachon
143,617,403 *0DCE1C019A95914363D8DC871372594B0B4DEF95 7XCKVSDZIMSV
143,617,404 *0DC6F7F2B9E93C8B8014DE8F47227FC67F668ACD au=)i
143,617,405 *0DCC5EEAA9BFF7A47C8BA0B47845A07A5C70D995 AUQRAMERED
143,617,406 *0DC9B68DA36EC1FEF2269E20E15F49F6349F9FD6 831999 MUKANA ON HYV
143,617,407 *0DC1500977FC7C57922BFBA71D535FE657A4BCC6 8AGTERSPEJLS
143,617,408 *0DCC0DA23085B97A0F141E22A9981C6CEB1F3A6F AVERAGE61
143,617,409 *0DCD20337D2C59D2F2D0C2DB52641149A25A882C 8BEHAVEONESELF
143,617,410 *0DC69780F05DD8553DD190A5D0B0609035A90EA2 AVIIW
143,617,411 *0DC39118D1E16A33D15730C56F0A02FD50AE7E5C avvp=
143,617,412 *0DC9FB720AE0BD0FDBB5B5DF81701FBD9576FCA7 8deville
143,617,413 *0DC7D2BF224F7F99CFE28BC3615F3ABDC6A57F58 8------d-~-~-splat!!
143,617,414 *0DC521851788F4BD6BA9EA6C470DAC2B90E2080C AY&B?
143,617,415 *0DC1304A503A0E3D8E4E3EB3A550E8844614C941 8INVERMERE
143,617,416 *0DC4FAA2F13F4C984BAC1B8546C7CCFAB60FA20F 8JONGLEZS
143,617,417 *0DCA22A75681296F74D822586FFA1A80D2427504 azzizz
143,617,418 *0DC02F844209CA5F2E3DF706A5D7070DEE46E26F b:%"
143,617,419 *0DC3B908524FD70CD8711CFCB169FB03F7EA2F5D 8METACOELIA
143,617,420 *0DCC48713B3957CB64E05202A96D8016D56463D3 8MICHELESPORTS
143,617,421 *0DC59B4E36E683E64975A8357D643BA381FFACC1 8NIMIETIESES
143,617,422 *0DC85510A7883CFC87CFCADAEB2EFEDCCF908BF1 B1=QF
143,617,423 *0DCEADCC04B851ED1634BEA07FE5EA6E192E4D12 b2?$
143,617,424 *0DCCF5F29D5283BA8BD10288C7080C2805495269 8OR8ORY9M4+1C
143,617,425 *0DCD6E94832443A2CB6449F81CA830DB29B0673A 8#####p `~3b<-
143,617,426 *0DCD57DD116674B8E81EA15F3CDEEE0585365347 b4hwy
143,617,427 *0DC40FE32663D1F22A30C86CEC784F54E678FDEF b6;8q
143,617,428 *0DC463071BB3AA55F887AAAC5FBD2D289E8E0425 b7#8,
143,617,429 *0DC3A9AFEB36620E9A17C577EFAC92D3EE6C02F6 b7n76
143,617,430 *0DCD552BB3EFB4554BBE71EE11BEF961CCD2D912 b9i1
143,617,431 *0DCEE9B191CEC4D8E0AD099374413490077B5EA6 8unmoved
143,617,432 *0DC9E18EC75C853E9F11D0138DBB4574E325B34D b:a&b
143,617,433 *0DCB9B5FB1E5C686FB15170C4197AFC32A793CA5 8WEEVELS
143,617,434 *0DCA52DADCD4D4064AC8222D2AD0940CB1C3CD5E 910++$e$
143,617,435 *0DC2CD47F57B1581A7EBE6573E73F9F75CA01FB1 967KAIDEN
143,617,436 *0DCF4F12466E51BCFFD4120392C7ADE205FAFBDA bajersking
143,617,437 *0DCD25D1793AA43448D73EF9E09D34762FDF2E95 98DB5F3A
143,617,438 *0DC76EF4FD6A70AD64ED0EDCA546AA7AC5753B7C 9ARRULETY
143,617,439 *0DC3D886AD39D6F6A5E2780E0C0FA6A18CFD1732 9BSWFINDLEYBSW
143,617,440 *0DC9A07AED47EAC6950154640696337EF8139A21 9BSWGIANABSW
143,617,441 *0DC332FC8987658AC6C281E577DC8405DF9E2ABD 9BSWNELSONRBSW
143,617,442 *0DC3A311C378BD0E74FED90DF41779C727140A83 [email protected]
143,617,443 *0DC519B0F5121224D3836ACBB6D6F1997812069C BARAK-OBAMAS
143,617,444 *0DCA42F1E58588717A4BF66E17026419AEC84C9A BARIŞTIM
143,617,445 *0DC3A34FB269407D2E48CEF6D1414497BED01ACE BARRYDYE
143,617,446 *0DC7D958CE289F9A40B5C1995D5F128CF842EA90 baskendes7
143,617,447 *0DC66513C7E2702750EBE5EED49542A9DBBED932 batbolargentino
143,617,448 *0DC2D13400F134B568A0CA0185ED6ECCAA017C71 bb0bq
143,617,449 *0DC08757EA43EC205E9C16FCD4F9508B57846A53 9GRILLERASES
143,617,450 *0DC2E3DDB2903EC4B1B2E54FF674A21BEC28ACF0 b+b!h
143,617,451 *0DC1913D3B8F27241E08D049B20DCC62D9C11680 9LAETSORUELP
143,617,452 *0DCFA8D37A6ED0EFBDC989C9040FD21739012496 BCF3
143,617,453 *0DC4E3BD6114594A2931BE4999DAEF8E29E68EE3 b!cg1
143,617,454 *0DC25479AAC685076908F9BECCB957F69AED3E65 9MARINAMIKI
143,617,455 *0DC9701BF429EDC196634F7F1037605A6321BCB9 9OMOLETSKI
143,617,456 *0DC310DC3D0DC441CD5C1BD49EB08FD8CC67620E bdpsj
143,617,457 *0DC72D4C9CF83790533F2EF8C5E7EDF09285A0E8 BDSINNERS1
143,617,458 *0DCC34E8E1587756AABC0D1F2D24A82FC2696DA4 b!e4p
143,617,459 *0DC2E19D731405F97BF29EA17C8B9DFE4F321975 9rack13s
143,617,460 *0DCEC8C19136A1E67A8DF712889E9A85BCC29710 beaglesoleil
143,617,461 *0DC4A4E0736B913F6E9AFB244CE068835406AFC6 BECCI-EACOCK
143,617,462 *0DC4E9B6544A3CAE608F9707DE1E6F5FC80B77B9 9STORMFRONTBSW
143,617,463 *0DC896E12D3AE5707EFBA7F8756B3B236E4C2EFE 9SULTANERS
143,617,464 *0DC38E641F406504196ECF8B97A7F371B223913C 9TPAAPLUMSEG
143,617,465 *0DC72992ED62334B1858A169E43990205D913411 BENSENN8
143,617,466 *0DC782856284305A4C7B43146704E18038662315 bernie.mccullagh
143,617,467 *0DC7477E31D685F8651061B5D6FD7A8FAD9C69A1 A1KA5
143,617,468 *0DC7CF5979946B09696756509DA724D2ADFC4E40 BERRYFACTOR
143,617,469 *0DCBBECAEB30B3DBE4300CC551FEF55B2A2C990E BERTNOELL
143,617,470 *0DC7168BE9B756F1339C220A572E855EAA7D4069 [email protected]
143,617,471 *0DC094735BBC0D6BA598F042B9B4A612C4D62BC8 BEUE
143,617,472 *0DC40A3497A9C5DA81B51AB894D0DA2233D082FD A6L+U
143,617,473 *0DC306233064E220FC14AB6684BE116763783F7D a6q.1
143,617,474 *0DC38CD701A6DE1BA6006B47069E9A31C5FD0EFE a7=f&
143,617,475 *0DC77643E930BC85737AE575237D629CFBFF2D05 A7WOV
143,617,476 *0DC494807AD3EBC356DA26DAAC59E887E8313521 a8&j6
143,617,477 *0DCB3F9A5155BE9F1B4D7C6A24572BC733110CA9 a=8st
143,617,478 *0DC9432E949B04C656CC6C40A5A02FB7E0162BF8 B_GCR
143,617,479 *0DC20B525B3728CF912288C334A9F7148B79BBDF AAA{C
143,617,480 *0DC7A1AC1CCAF58C7560336D628ED52BC8410014 BHING-KAT
143,617,481 *0DC0D0B3C0BCD489651DFFDC60958D6A7FB64BD9 [email protected]
143,617,482 *0DCE7FC4B5CE382DEE5D406C75F875CB3F8C3B1C AAAOH\
143,617,483 *0DCE2E348F483BD6C0F6789B472DB9177B9BB466 aaaz%&
143,617,484 *0DC7E40754A0757449562C39FD2B3879684BBF8A birdiedaddy
143,617,485 *0DCEBAD9F2FF781D1EFE4716D4F627371429A3A5 bishop
143,617,486 *0DCD4F7EBA9D9ED48F0208300AC16CA7A6872B3C bjwc%
143,617,487 *0DC1DA637909CC313DDD0651C83EBF037F5D7545 BKA-:
143,617,488 *0DCAC62B623F801F2346EAEB68C6D7337179AE3D AAC+PI
143,617,489 *0DC35D177D2AC6A07D70691EF7D0B77D2FE3EE95 AA|;D
143,617,490 *0DCF194C008783FAC513E8781ADBA36B27C54C31 AAD6ZV
143,617,491 *0DC33DEC890BEF856B3612536247B52F62E3F865 BKP#I
143,617,492 *0DC608F1BFC29B0FDA4CF5425D08F33798DA2884 black,gold&green
143,617,493 *0DC33DFF917063FB7867A0EAB9D24C83764D1F75 BLACKONSLAUGHT(UNLIMITEDRAGNA)
143,617,494 *0DC8E66FCD5DBCE3E0CD0CED08A91E5972065FFB BLFDR
143,617,495 *0DC50407D3E7DFF82F95F2A916C12F1D354F7B9F AARONYE
143,617,496 *0DC420AF2F5BE334C51B2885DF268015724C9E1C [email protected]
143,617,497 *0DCC0DA00C8619E353F0734F1D88BCCEB75751CA block80a
143,617,498 *0DC9EC697115725C0CA91620EC6191CA9EC59CFD AAY{3
143,617,499 *0DC0E3F87F02986D03E4A9E9DAA1FFDAE27B6955 Blood-Red-Designs
143,617,500 *0DC58B9461B097869B842220A30769A1F7A22398 A$#b
143,617,501 *0DCE5F6D2CEC63AA66FA01B261C40EA99E23D58F BM81T
143,617,502 *0DCBCB565F9DD815DC2F2F3C2E9D837ADC267657 abcdefgjoseph
143,617,503 *0DCD073A427630BE07DC81F1192873625AE3794E B"?N!
143,617,504 *0DC924D804C9A743FAC1A6DE15EB700819668A77 BN2JI
143,617,505 *0DCA35E9AF8EF2F98D37B6800E11646155940EC5 [email protected]
143,617,506 *0DC77CF782C0881C8C9A1F6DE75A9E20E8327846 BNM=
143,617,507 *0DC4FED955F7BE3E28170F4E86E667D015874288 ABHMR
143,617,508 *0DCD8327381965CCF94074C9924F3EE375BFCEEA ABIHP
143,617,509 *0DCDC376EE36918BFE93F3EDF54AF45E74DAE832 BNRK"
143,617,510 *0DC342D1EBC93CABA37C943B4BA2C4C31079097F ABOUTTHATHAMLETGUYINTERVIEWWITHMIF
143,617,511 *0DCA5657BC5006E8789CD6114F5E31ECDECE8AA7 bobamdan
143,617,512 *0DC2EF2C4CE447A9C30069C524CDD867ACA81010 BOELINESES
143,617,513 *0DCBC0C13B97B756A48EA2EC3E21EB51CCF6433F BO#HO
143,617,514 *0DC7AE19A2C0F9109C120457FD7E1641BF1FF998 a%c1
143,617,515 *0DCEBA1F85024037C4ADC62BD1D32F118C585752 ac$.2
143,617,516 *0DCE4E857A6A5290167A70E7AAFF4F52888F625C a:c9
143,617,517 *0DCF61A7678C1D138E3A41877A9B302347D402C6 A=C9
143,617,518 *0DC23C736BF58735AB5A34EE8DBCA32724CBE165 boom, boom, boom, boom (airplay version)
143,617,519 *0DC87409CC4DD8DACFB371D7CB55C48E784A4094 ACELEREI6
143,617,520 *0DC378417BCFB9EB1E8349EFD582DBFA873015EB ACS_7
143,617,521 *0DC14D93D4615ADB249B8331317577A1765EC6D4 boudiou
143,617,522 *0DCB0957F361186D19F978C45F3294A171719CFF [email protected]
143,617,523 *0DC0B3EBD0A5EB40DABE2AD3D6188BD124F684E1 ACWMW
143,617,524 *0DC9CF0C8A1EF927A35147A5B6714254522ED40B ac"z!
143,617,525 *0DC8DFF05D49A80507ADB9D6F8971962B60BA618 BOYCE.BUCKE
143,617,526 *0DC0DE916DF9D50702669D56858ADE0305F645D8 BOYD.MACKOWSKI
143,617,527 *0DCC75910291E9FD45A9D5F7E339EB35ABACE3A2 bpj)p
143,617,528 *0DC4BDFF10CA478B14912DFAC93D4ADCEDD53DBA ADELWOLF4
143,617,529 *0DCF5E6399C5DE2621ABCD736AEF28EB27BF1CC1 BP-+W
143,617,530 *0DCDC2BDCE1F92974F637B6264FC5C18D2118AD5 ADITYANANI
143,617,531 *0DCF8D73EE119CDA86338BC168E31400AAB59604 adkog
143,617,532 *0DCFEF35B0FAB966D1DFD0FA8DAC222D4E10D814 bq%/m
143,617,533 *0DCA5C63A6B7F9BA9AEF6C82B98C98047632B11C ADOLFODEKRUIF
143,617,534 *0DC219E70AE2741771678B26108E18C4C807734F bqwp_
143,617,535 *0DCF7874E79239189553CB9EC19B228D031A330A aduv
143,617,536 *0DC69773B6140E893043DAB801499A36C35E9CCB BRANDON:BRANDON4
143,617,537 *0DCF084178512A6B70CD0E5373AAEEB603546497 BRANDONDOE
143,617,538 *0DCD420820814F871F081D782BA084D09F3E059E brave69
143,617,539 *0DC19C0C7AFA93683979E9B97B7E45EA9E33B4B9 AE.T2
143,617,540 *0DC6A2F09D9810E85554319DB2705049C37E25FF Af,&
143,617,541 *0DC1E00FBB8E5F07EA81A5022854FAB0D075FA2D Af6=
143,617,542 *0DCA8587B7C5F5A82A62809EB84A800AA4814C58 BRENTON.SATURNIO
143,617,543 *0DC642ABBE2399D004EEE874307B5C67F1B0EF7F AFILILOEMOS
143,617,544 *0DC59C14C25A80DEB8B858C63CFD4868A06CE58A a#foi
143,617,545 *0DC9F3E90850E582B7F3FF2C813E0A317B2394DE BRICE.MEAHL
143,617,546 *0DC03E8E38B3A204EADE283A11F1685F5316875A BRITTJANNELL
143,617,547 *0DC4DBD459A437D3BA8EEBDBBBC54A3F03178D51 AGNIE
143,617,548 *0DC0E9126418FBA3A298A821B064AA8E413B4518 BRITTSEVER
143,617,549 *0DCCE8BD49DC865C6C336417A0579A355759799B AGONIZZOS0
143,617,550 *0DC7543E9384E90225658CEFD62ED94532265041 ahlf(
143,617,551 *0DC71A609750397EB4D3307664DB14C711B8D456 AHMED.BOTHNER
143,617,552 *0DCB2DC09AAE3965F00C33A906967251A6A22BE0 bruceschy
143,617,553 *0DCB8DA4DB0802EC2B7896DA12B223CE5E2BE684 BRUTTIE3
143,617,554 *0DCA6505F1065B5B32C8B609062AF38AE1567CA5 AIFASANTOS
143,617,555 *0DC672EA90A88338603E24F321161BB2BCB3EEFB AI=GO
143,617,556 *0DC295E354E7D196C524DFCDFF1F4FB640508B19 A/IGW
143,617,557 *0DC7FDAAF46309EB2413ABE44B5105B440DCFB31 aimsirut1
143,617,558 *0DC6F37F08D3A96B1DBE231D0D758EEC5D4E6361 AITISHUS5
143,617,559 *0DC48BA7462A13E62A1C0094EBD7C15997D48647 AJLS
143,617,560 *0DC1060EFD79E1500AA9B57A9EE378B79C3498CD bswimageframebsw
143,617,561 *0DC79AA5D74C64B655389FD158BE755479B395B6 BTPM-
143,617,562 *0DCDBB50E9798071F35B3E534F4F98A5BBE6AB38 AKNEGNALS
143,617,563 *0DCF0AAC5375C9001DA310154F8B87BA90E4EA67 BUDDY.FUGLE
143,617,564 *0DC6FCA2F061C23A47DF766BBDDD93025AB271BD ALANARIETTA
143,617,565 *0DCB46761E31181FBACDDCFB84172593BE80A6DD buddytimas
143,617,566 *0DCB38EA8C49F50A28197767B275182FFE119297 [email protected]
143,617,567 *0DCE85DCE49A579A484AE47B41CFDB723CC63971 BUFORDAMBOREE
143,617,568 *0DC8304B2EFA649F1E35AEA29B2F60F2A09E9E34 BUMP=
143,617,569 *0DC4427F2860285A88CAD7A70175EC6C573C9390 bunkft7duiatq
143,617,570 *0DC069041997385CDB6073198CA6E6102D2EF849 BUSHCHAT0
143,617,571 *0DC63AE5F3C45F7113D45CF77684C3576989AB83 bv3ca
143,617,572 *0DCDCF725B1F24CCC9D20FA6D0025FDC3107A825 bv=+a
143,617,573 *0DC415CF0C0B96519479F249549E2887197CE7EA bv(dl
143,617,574 *0DC6C62AB4720C21D2D3071D3D7700C4EB6355ED bvk,e
143,617,575 *0DC30D3146EDBBB14CDD0F9224B9686F829378EF BWCKG
143,617,576 *0DC43A824F3DED8BC50429EEB3FDA8094F13D6E6 BW&EP
143,617,577 *0DCED1F44AA7341DB3087CB2E2E7905FE43F5494 bwqsf
143,617,578 *0DC1D2F61FFEB67A763E69408B3124CC466422F5 BWZYM
143,617,579 *0DC230F882FD236D5E9F8226F52062E6C662A48F BXEZ
143,617,580 *0DCEFEC33A8B87A355D30DCDE47CCCD6951E9715 [email protected]
143,617,581 *0DC078C3A4315FD44818B50ED24A366ABCA9F2F0 ALDO.NORWELL
143,617,582 *0DCC0CAB3E7B7B36DCA0B8EFC27B4A7B5F621A4D ALDO.RIGGSBY
143,617,583 *0DC462125D8251C49C27AC82440500E5A926533C ALEI
143,617,584 *0DCCFA1C08AD878820ACE7256E02C8416F001B4B alejandroschingeck
143,617,585 *0DC079995D330CB55A31817BFFB965B09C45ADE0 ALEXISLAMBORNE
143,617,586 *0DCBB2E2803135D58B8E74AAB6B81CD5646B300B [email protected]
143,617,587 *0DCA6A59C05621A5C1927E7201C226B3AA3C7E8D ALF?7
143,617,588 *0DCB3170809AF4F3E38BCC51390A4011262C9964 BY(NS
143,617,589 *0DCC21DDB58567C729FF272BAADA214EEC0F280C alfredohorodyski
143,617,590 *0DC49537A4951E6E1C684C6AEE055E740063FDB1 BYRTHDAYS
143,617,591 *0DCE8B98B3FD7035B0414DCC11EF1327C20D115F ALI.VOLKERS
143,617,592 *0DC534C0D5E3B6CDEDA367BFEBE9309ACC8B9FD3 c_(?
143,617,593 *0DC1FBC72BA28936F7D9925D26F2B9F912A59239 c042383
143,617,594 *0DC22A394CEA2BDE1D3449D6A9D729D5334E84A1 C0NF1DENT1411Y
143,617,595 *0DC83FF1DA4C300DA0BDED79F09A8B14CA8E0989 c1ebv
143,617,596 *0DCC191ED10F90E66DAF78F604BF90E1715D5C0C c1jbd
143,617,597 *0DC81259225E4B7EA1C2193F4C4428B4CFCF118A ALSOTRY
143,617,598 *0DC5B0F8737D90D1F47BACF5D81608048129A3E9 ALVA.CHINETTI
143,617,599 *0DCD8920EC586CC02CF28AE2735BA5D2F25C6AFC [email protected][email protected]!N9
143,617,600 *0DC82542E8B5065DD29D93DB7E9FB0E87007652F C&4C
143,617,601 *0DC039F9691165397994B471FDAA24DDDBE66D1C A)MAA
143,617,602 *0DC8A933962D724459D9685CA84B72D0BC40DCF5 AM.CP
143,617,603 *0DC9829955BBB36E05830C2ED07EA68AD8DE01C5 amnb_
143,617,604 *0DCE8C42DDB6FCBA51E0A4FE932AEA0ABF5C5547 c8=io
143,617,605 *0DCC458E16A213F9D603941FC5B30AEA613173B3 AMUZIEN
143,617,606 *0DC7EED32576A04BB90810FC419E46C0BF87AC89 AMY"A
143,617,607 *0DC68FA99CE90984D91B09A340DF1247E5023807 ca1ami+0u$1y
143,617,608 *0DCFDB47FE6D3731D86E8D15BE75FD5BACF9F2C4 [email protected]
143,617,609 *0DC8F757596A4F306265669B64B6A92756DFA9C3 [email protected]
143,617,610 *0DC33E6B287D040C6B077EEBEADBF9E55A82D769 CALVINFEE
143,617,611 *0DCF0AAA2A9C43B4F73DD51C0D2F647C4455EB93 CAMELLIN
143,617,612 *0DCDB7F2E9C1E565122A2D4824E6EA7F5E21268E ANDYCABIC
143,617,613 *0DC2AE511DBBFF33CAA02E6A7B42055F48FBBDE5 ANETKA4U
143,617,614 *0DC59BFCE572EC2FBD9E370D4F17127F1A719EF7 CAPALCARRA
143,617,615 *0DC2AD892EEAA3CA8868AD548D2B3860AC5C6400 çaputçu
143,617,616 *0DC18F54FB47CDCBCF44B7900F65F1E79C2BBFF6 CAREY.WANKEL
143,617,617 *0DCF70FFBEC6C4A98AF793CAC24CE71892CB4186 carloscheca
143,617,618 *0DC84B58F6D8E47A12C5DF089C63D98B78D3F027 carltoncantey
143,617,619 *0DC492F071D7947B8ECAF4F8702E5E40D2FA58EF ANNIESUSANTO
143,617,620 *0DCB994B7A6401983046CF7388DAFCCABA319439 CARMELOSCHEIBE
143,617,621 *0DC705F62C16B3BB821E5752B588C0D7E53EA6D2 carn!vorously
143,617,622 *0DC737DA0813A553EF99C6FD45A1FBE3B7E1DC77 CAROTIN3
143,617,623 *0DC9D819E16C46AD5D43A4B7B75DD9EFAF1F9DBA ANTONE.ROZAR
143,617,624 *0DC478A4E33C9723CF3F76CC672FBB560BBEEA51 ANTONYBOW
143,617,625 *0DCA5344E7FAC397C30E96EB1D85A27F3D3DFC24 AN+TS
143,617,626 *0DCCD1D5E64E4CF3D8EDEF8A617F1AFBF900C4A2 AO7L
143,617,627 *0DC02FC8D8E47F0C4F690E8CCA137AAE9D212C24 CATBBSW8
143,617,628 *0DC8EDA230C127F3B7248C717DB345C3FB6EA1AE CATCHINE4
143,617,629 *0DCEAF5FCA99406C4433D5F80ED1B622A2003AF6 AOLLAID6
143,617,630 *0DC8BD12D1B0FBD623C1619CC9A43934979C3B74 AOLQU
143,617,631 *0DCDDF43DF73448F96660F02FA0CED95011B29B1 catgoldie4
143,617,632 *0DC0AFAFA4A46C2A0AAFB226D1E8E6ED07358A94 ap.2+
143,617,633 *0DCB064666F68F9636B42AEC24EE7523203A4AB3 CAWEVS6EEEPDPM9
143,617,634 *0DC6489DCB7F9E0A0DEB5A27953B4C14A5C5CB7E apo"0
143,617,635 *0DC08E646A077BA27E2E7BCC3A8F93770EAEB4DF cbnsa
143,617,636 *0DC76A2154D268BD38E76BD185F0DAD56D7561E7 CCDW
143,617,637 *0DC9C4E1B5614A7D47AD01C61D0662EFB852595B AQ,BK
143,617,638 *0DC1C4789EF7238DD8A592BC244542D00A33EB10 cchakris2
143,617,639 *0DC503FBDA394392ACEF410F51113607995CAB30 aq.hf
143,617,640 *0DCD1FB8963AB14FFACF8EC5B6A036F5C33FD65F AqHs
143,617,641 *0DCA8AC1D86DCB3655E66C41E342018623F7990D AQLP3
143,617,642 *0DC9F4A1DDC0C784B5B73E91DD9BEBE63916FED9 cc&pu
143,617,643 *0DC37AAD4E029CC2B5C7D8B07B078482534378D4 AQTS/
143,617,644 *0DCE67609AFBD72FBFB0DD1338BF6AF6C835B806 ARCHWAKE
143,617,645 *0DCC9BBEF7BC4744D4765D686D1FF67F1D12A0C2 arepit
143,617,646 *0DC4CDB247BA87488CE49047CF7C9A360D015846 cederius
143,617,647 *0DC35A68E6E2B65BB1387978ADB7BB39DCFE7D65 ariel1954
143,617,648 *0DCCB1FDE7ADE4C8F794BD456A1C90D27693D49B ARIEL.GUGGEMOS
143,617,649 *0DC7708C815ABCB396ED916EC8959CE7CD9A6DDF CEG2E
143,617,650 *0DC04419779F37520E3638252EF7ADF733265EAE celkn
143,617,651 *0DC18E78AF07F0FA6A3A67ED6CF240A709B23101 armandmata
143,617,652 *0DCE02C846996DCC9FB83AC9289DB98F70E0026B ARMANDO.PALUSZYNSKI
143,617,653 *0DC90BE406C11F4AF69F5A4194B18B078EE8D382 CERTIUS8
143,617,654 *0DC2C1D18BB11413FF5DF02A5FE8224B453880EB cf2+=
143,617,655 *0DCA4070ED02283CE3F0A26A14242BECEF29EE10 CfF2
143,617,656 *0DC8340FD02007C3178188C493A70A95BC0DD719 ARRANGERAIS?
143,617,657 *0DCE791F28855490A48B76EE802AED8F98FEC4EF ar;s%
143,617,658 *0DCC8E1BDE78B080E4F820B155BA93470FC3E064 artcarmuseum
143,617,659 *0DCE6C048EFEE8E4584255507D1AB806B95E2AF7 ARTHUR-VINSON
143,617,660 *0DC176D198E371D0C6579FD1ADC770870B0D449A ARTIANP
143,617,661 *0DC185F1D6111A4030FD9040530EE417C390F193 as7j(
143,617,662 *0DC5E1424F455DB72A2CCD8236F8FBCB97445C17 asc&u
143,617,663 *0DC4E32E74C9E70089111750EE0C42FA9D110409 CH22
143,617,664 *0DCFDD511136304E9E42B1654A4853F9CDA8783B CH.5N
143,617,665 *0DC122576135125139693BEDCFDC9D0BD1518487 ch:6k
143,617,666 *0DCF4E52C02EE95A5B4A5E058F9734C49C4D6C09 asl!k
143,617,667 *0DCCE2499E1DFCC7C58FB552F3C0E4B27A48EAA0 aspnu
143,617,668 *0DCEC97D407C3B8051306BAEA53903BBDED67C26 aswdn
143,617,669 *0DC521990F2C34D2C61C138420FEC148AE7EEBD2 ATEMPORELS0
143,617,670 *0DCE64000CEF3E948B19CB71162C70CC3D03A236 ATLEDUUL2
143,617,671 *0DCA4C72A5739276E09A095BEA789AD74970D5C6 charity_stamp-'/tS//&/r/I/t/i/_st/&/mp
143,617,672 *0DCD0B848CDFEBE22CD14A47D16F8102E529CF98 charles927
143,617,673 *0DCC76C0FA204AA4C8C2433406F0F8AD744F338B [email protected],
143,617,674 *0DC48A82322E017FCA59EAFC15C209E46B715D68 cheefong1
143,617,675 *0DC104780E73EB45C174A735FA658111C0E274FA AUS.DEN.CHRONIKEN.DER.SIEBEN.GEFALLENEN.M
143,617,676 *0DCADBB3877E4526610AA97201124DF02F3CB4C1 [email protected]
143,617,677 *0DC9E9BEAC98D3F215957E26D98A2C6795F3ED58 [email protected]
143,617,678 *0DCE04732F81C427CBBEC5AB90267E5E0B4FA3C6 [email protected]
143,617,679 *0DC8CD2261618623F8D88D837DEB13FD23A002C4 AuZ1
143,617,680 *0DC5B0B829FC0FA754F0D9962D779D928ED89EBF AVDHESHTRIPATHI
143,617,681 *0DC6518A01B546DD99DAB6C6DC70DDAF00BC93A3 CHETURMSTON
143,617,682 *0DCD6AE9C14666D98D2F31ABFFFADD424CA6E879 aviventar
143,617,683 *0DC808BAF55FCE9F42BEA3F78494B21BEF622A57 awaydwindleebbexitfadefade
143,617,684 *0DC676BE320DA5D8C6E31D84BAD7702B27744C0C [email protected]
143,617,685 *0DC78509E126AB1CA63813C087314AB3C2B519F5 a?w#h
143,617,686 *0DCE7D1E948EF1141EF6B8312EBA389D1561F531 a-xsf
143,617,687 *0DC288098590AD7F58A04C6EF9F1B56EB822D457 aydk(
143,617,688 *0DC21C674FF30FA8745F98FE9DA8A7E3D9956E4D a$=yv
143,617,689 *0DC0367C545AFBF7696686B3506E5F0AF8F61359 AZK.O
143,617,690 *0DC2FEE0E55513DF7C74F5188BA2922928F0A6C8 (~_^) * * * (B
143,617,691 *0DCD089E5319EC802E7B9D5AD856DA6A2A03442F B$]
143,617,692 *0DCB7BFBE45C5E6132CC26461A19C663F0627CB4 b$0!
143,617,693 *0DCEFDBD307F029110F3DFA463071343650D5CA2 >-B0*Q==3
143,617,694 *0DC2ACB4A88B4D2A8344F4D50633D8F1FA5524DC b1b11other4p1st
143,617,695 *0DC7E8BBBAD06481CAEB7C1ED47CD4D41A74B452 chucklousteau
143,617,696 *0DC88207D5154CE8A47D57E03D1D31F49A232EAF B)3IN
143,617,697 *0DC5223A92D8380495AEE656A1CAD495F151D4EA CI71Q
143,617,698 *0DC67364687D5DD56A3D5C4B49958B3A12DF3976 ci7g+
143,617,699 *0DCE662B0B87215299237E878354C19560814BD9 CI.AKRON.OH.US
143,617,700 *0DCF42F97F01AB74F11120015A6D653A1FB09106 B3Uj
143,617,701 *0DCFDF330562A1ECA8E5F18CBFFB8029A3CBFEA7 CIECHANOWCU
143,617,702 *0DCF2A8C32406A8AFC824F371D581D014221FE14 cihcratua6
143,617,703 *0DCF9297205EDB494241E6754E12C9A6FEEED6F9 CIJELOG7
143,617,704 *0DC3F0ADDAC32C6024FBF6FA4A3103651CFF28EA CINQUENTOES
143,617,705 *0DC94CF39EA94F8DEDF30E81BD616D972F13AE9E B69EK
143,617,706 *0DCCD0E033F13A77003C2FD731E265B8D5B1A2AF cj-m
143,617,707 *0DC5881507EC6E49C5A7993256F6C55AA6561D09 b7sbu
143,617,708 *0DCD78E6E82C1B4BDFF28C410235146AA73E9BDF CKA+R
143,617,709 *0DC808B3219612E24A4332BCA291FBA765CD993B ckbu
143,617,710 *0DCB545747C0CDCABC5EE3228B677FA1DFA76B6F CKPH
143,617,711 *0DCAF8E38C3052A28748A704DE3215A630A1D603 CKUZB
143,617,712 *0DC23CEADB0ABFA066A2C7C36371E643A8524BFD baker1958
143,617,713 *0DCF41E601C53A8F80317B62851EAE6C25A0FB7C [email protected]
143,617,714 *0DCBCC857472211BDAD82D240CC03CE58DA1FB88 bandera-de-hungr
143,617,715 *0DC05C2C08C6D4D7626B1A8B4AFC01B5D924D8C2 CLINTFERRIOLO
143,617,716 *0DCA951DF3D251D42CDA59F24D9737B0494B6C5A CLINTON.SPRINGS
143,617,717 *0DC279D07A941B566CA1E523A360A6BF4B5D7361 cmmw(
143,617,718 *0DC4BC3824228FFFD5F52369B74338CA721EE81A CM%N$
143,617,719 *0DC6A5F4724A692238FBA8B1F0E82AF9EA826E52 bartdiliberto
143,617,720 *0DCFA3180FBB15289B627DA47BE739E7619EF843 c=o
143,617,721 *0DC10B9168D8F0A9D6F2EA2AB3E794112F030BFA CO9BK
143,617,722 *0DC5863CB5139AEB22E28A5E6DB0102F315E727F BB * * SPLAT
143,617,723 *0DC156CE985B211595E1AA096869169A6F040961 colesneeden
143,617,724 *0DCD8E9CB760A3C3483B67122C31B2A2458A6A81 BCPTB
143,617,725 *0DC392FCAED8A2CF81AC08565DC96716EEE0399A b-:(d
143,617,726 *0DC83761F7B8933A51B14D402AED32194CF562BC bef3v
143,617,727 *0DC22187606B5F86C7171C03CF21E83093D12F06 CONSENCE
143,617,728 *0DC8B2185E178F6D3DCA8DDE9C61EC3881F08AEF benitokwasnik
143,617,729 *0DCAC7CBAC0A08C828AC5A62252419B35BB37427 ben.kohler
143,617,730 *0DC9A73C3ABB10A7ADFDD7AE97A97FBC46E0F2F3 bentonores
143,617,731 *0DCB668B2E25706EEF929BD32D5EEA1FA18657A4 benygant
143,617,732 *0DCBCD000788EDD186534DF2ACC4BA03319C6CC2 coral-girt 'k/o/r/@/l_g/[@]/rt
143,617,733 *0DC7EDBB86E1DC1F73DF94A10EAA073C38AE7A3B cordellchace
143,617,734 *0DCAFDF2601EB2E7D56741D273B89EE58CB705F5 CORDELLCOSTILLO
143,617,735 *0DC66950198F9C127B405FF214DEF72A007512F8 besiegt?
143,617,736 *0DC669959A670233200F68EF0BA595785D48FD35 CORNELIUSRIGHTLEY
143,617,737 *0DCBEBE12CE72811F0A6876483BD38F11CBE233E BETREURD5
143,617,738 *0DC261C41B648DFE9B2382A0505BEE24CB4DFD1F countrylinespecial
143,617,739 *0DC2FCD0FAE76C3BC7AF3BA1FC2EB77F53A726D6 covs(
143,617,740 *0DCC0621C4EC95E75D15E9769E58287F9E250172 c:\program.files\common.files\adobe\cs4servicemanager\jre\lib\zi\asia\baku
143,617,741 *0DC68AFD075ACEF747769965C3AA7C204F235868 C:\PROGRAM-FILES\COMMON-FILES\MICROSOFT-SHARED\HELP-9\MICROSOFT-DOCUMENT-EXPLORER-2008\EULA.1042.TXT
143,617,742 *0DCD29DC323D5FB7B338BA4BBA630026F8E4A5CD C:\PROGRAM-FILES\MICROSOFT-VISUAL-STUDIO-9.0\COMMON7\IDE\PROJECTTEMPLATESCACHE\VISUALBASIC\OFFICE\VERSION2003\1033\VSTOWORD2003ADDIN.ZIP\SETTINGS.DESIGNER.VB
143,617,743 *0DC6ECBC26D987C9500CB93546AEFECB5C85F6BF bgajq
143,617,744 *0DC4299A77C5B414C1FFFBC174643362C96EDEE9 cq-~
143,617,745 *0DCD955765DB0DABBA248B3F9A53263A893172E2 c!qk5
143,617,746 *0DC2923651871156FDBCD13A97C27B6D6F5A0295 CQNAH
143,617,747 *0DCC7E35E95912B0643BFDD1E9ACDABC64753A9A bhavariya
143,617,748 *0DC6B2B1CEE82B166BDC02B76B15981E792CE66D B.HWA
143,617,749 *0DCA1607190A145BC5C1C0B7F9DFA4C59E6B9940 CREATIONFLOWCOM-COLLABORATION-VIA-THE-INTERNET
143,617,750 *0DCED295EB53136C1FB5C129F65B3663445477EB CREODHEIM
143,617,751 *0DCA0B00F9AB8D53499C650619A40B43FC889042 CRH6V
143,617,752 *0DC85D76F24B7C2E470CC17164FCA9DD12B2FB16 CRITICALLIED
143,617,753 *0DCFB0D82EB70946D448CA3112605C91CB5D33C4 [email protected]
143,617,754 *0DC638562C3991ADB76ADDACBAD5CD77C95B8432 CRSJD
143,617,755 *0DC1CFE64C7113DB71C363067107AF7C95D947F7 CSWCQ
143,617,756 *0DC2AFD167F3228B2AD68A3BAD49487970E22154 BIOLOGYWHITE
143,617,757 *0DCD35DE2A1E463B1D5C9544E703BE39AF6F7E2B bir.;
143,617,758 *0DCED08A39BE9F0734652BFFB760433F0A1F5243 BIRYAZT
143,617,759 *0DC5E33E005967B46FE07ED69897477FAB20D653 cubanski2
143,617,760 *0DC8301597E782A1CC35D1C975B3411979DEB887 cumbats
143,617,761 *0DCE2DADCDDD1D643196319887356AC2756892D6 bj4d
143,617,762 *0DC4045732CEBF83ECA5F12D2CC94E58DD7283BA BJ#?R
143,617,763 *0DC742890DF45DD7C6A49EBF22EC59C09F6EDFFF BJTRF
143,617,764 *0DC7FBD52B24107887D7B5712C2001E4DA54C232 CU:S
143,617,765 *0DCB1395AB30AF0E270978910609B4870704F988 CUTS-FROM-THE-BARBERSHOP
143,617,766 *0DC7057F7F1DCA3E9CC445135D96A5B73E87C625 CUV$#
143,617,767 *0DCFE0851AAA25FDF7CE354862D3FFE09B2D0DA9 BKXJ1
143,617,768 *0DCF6E4970723482E7976DBFD36795A5BAD42E90 BL_A
143,617,769 *0DC77ECFC174167A26C3BE32964CFCD6C69E086E blagodunija
143,617,770 *0DC2F7AD6AFE50AD5A7CFA33C4B41BB4E727D358 cwcxv
143,617,771 *0DCC5DAF2F98EEB21EE8CD2B8F376B27F081F8EF C.WGY
143,617,772 *0DC66308059A5195D38C0F0AFF418BAAC0099208 CXSK4
143,617,773 *0DCD26C9D3D8D66AE90B5D5FD050E7CC06FCECD4 [email protected]!$7ed
143,617,774 *0DC0F8B3CE689031096F0FA554B78BBC1C49D1AF blogranabahuorg
143,617,775 *0DC5CCBE63281A76B751196F98893F1E187A4B4E BLOODRIN
143,617,776 *0DC340AD5CDF4C9704331420DC19CB7719FD7C05 BLTW5
143,617,777 *0DC125A0099FCAFE17A69263284593A1B25B317A d1$com8o8ulat1n9
143,617,778 *0DC8A171185986384739C30B8E70138286A52D37 [email protected]
143,617,779 *0DC7047DF04104C78747771C0CD7C5A687795A35 d28+i