List database


# MySQL hash MySQL password
143,590,001 *0DC6AB2B6A47FDBC2484481BC03273EC78E7126A DdTo
143,590,002 *0DC7B4679F1CF8ED3047D5CA2A6C37CE6689DD10 d1121c2a4d4d3972ae02b18c80334553
143,590,003 *0DC510DAFD830DD57208276E602198AF7C2D7A78 deangelolippe
143,590,004 *0DC520BF6A4CC07140C430E44054A05D1566D255 d1p?=
143,590,005 *0DCD6EF25D301C353E56004367263E5EC397B7C4 d1$ta$t3fu1n3$$
143,590,006 *0DC34D1BEEBF09EE859689CAB99A011BB416D8F1 DEBASHISH.SINGHA
143,590,007 *0DC8EE66CB5DC83CDE5B4506EF3B8EE85248B16B D3&0C
143,590,008 *0DCE714FB14C3CCAFA6D570F16AA2911F9A655DC d(3kw
143,590,009 *0DC4F60D0795437866116A62E0B1922B4F70FB7D d,3o)
143,590,010 *0DC4BAE65592072F1DB84CF2488A5BCB73F1B160 DEGRACE2
143,590,011 *0DC4BCF4FEB35C2166AD70F32AF6F575846F57AE D4SI+
143,590,012 *0DC638DA02F0BEACDE48808A1FF33972D8E20AF5 d6ik1
143,590,013 *0DCA010A0430A812F478DCA42AF7E571DAB4D830 D);6L
143,590,014 *0DC173942D7B0A6EF2BD098B77572C05F48A4499 D6wB
143,590,015 *0DC852A82EC9210D6183FCC152F443CAE139CD5F d(7ol
143,590,016 *0DC897E2E895D2A4DD2D00E752C9799444C6DC0D d7sv;
143,590,017 *0DCF2BE5E410AAF44DF5AFBD99D3CDCEC05CC01F d7w91
143,590,018 *0DC4EA8B92837AE54BB12550130AE91C2974096E dab-!
143,590,019 *0DC119E31F73D23A0EE01884DFAABA0BC383BEA5 DENVER.FYLES
143,590,020 *0DCA4DDF7F559AC711D2C86ECDCACF00816B91C8 @#DAEDALUS
143,590,021 *0DC183E20AA0BE6C7394F43AD4D364CA04944152 DERRICK.LEHTONEN
143,590,022 *0DC0137B02B2B5D306B8795A857EE49C73727F11 d#an3
143,590,023 *0DC1A7AB3F933B76F07EF2736AC5998B77830229 DEVENTTER
143,590,024 *0DC8BF47FB77470DD05D912BCE5685039DC9A251 [email protected]
143,590,025 *0DC356D15738D058B4EA5DD0C3DB23566B766ACA dezitore
143,590,026 *0DC5E0F4575F9DA2B685C9048BB84B0E6671815E d+fia
143,590,027 *0DCE9968C47BAC1C8904C83EF2551D19DFD20BDF dfic6
143,590,028 *0DC9BD51C7E0C1CC7E57731CF2BE6F43D03700FE dg:n%
143,590,029 *0DC013615CC35CCF6E0D58B4461FC805904683C4 DAR#6
143,590,030 *0DC29F47D176A18DF14D81C36B57AF2EF1985FA8 DARIO.ESSARY
143,590,031 *0DCF83EBDBED08E8D1C3D8A47939160D3A1450FB DARIO.MCCATTY
143,590,032 *0DC3627135F727CCCE76C00489A25D6AA3A2E68E DARIUS.GROOVER
143,590,033 *0DCB757C520BEBC41A3323310E95625A9D79255C darkorange d/A/rk_'/O/r/I/n/dZ/
143,590,034 *0DC44830FABCA0655306070262A9B3ACECAC3393 darnelldart
143,590,035 *0DCDC782F48BDB152698309FD6DEF8C414A38340 DH!LU
143,590,036 *0DCEC74DAE1165C76629C6FB5EA2181D8D2A8A34 darrickolafson
143,590,037 *0DC370A9F872BB75C9FEA34F45E39C9DDCB2756C d=i-9
143,590,038 *0DC6FFE7AAE8A9EE65192F66E213FE16623808B0 dieidisming
143,590,039 *0DC8192DA891846587FA939A9E8C398E91F76095 darylmegahan
143,590,040 *0DCEA4C6A106E52AB98BB6C15BF979493C2D2FA9 DASYPODIDAE.
143,590,041 *0DC19D0002FA70BAD32CB706E3662EA1060B2584 dillonmacfarland
143,590,042 *0DC4F6FCFF84847C4FBA3FA7F782D41F7B0E3DB6 スクールDAYS(作曲・編曲
143,590,043 *0DC889D0021214D0212F11EA9755E26D4B522DC0 d"$)b
143,590,044 *0DC060EB7916C9F5CA820C5B2612D7F183C58857 d!cf
143,590,045 *0DC8193BE02EEDDAFE96E2E8B730BF7CD94329A6 DISKSEC1
143,590,046 *0DC20B4A8805111B9764B193BB86A882D27D2879 DCLF
143,590,047 *0DC6DD410088978F965D41147884992F992CFC1B DCRB0
143,590,048 *0DC8E02E5B66D142DD98E4F2E1D6F8BF405A2B2A Dj)p
143,590,049 *0DCAF91AFF83392DC6A30EE88EA867C8C6445CC0 DJ%S
143,590,050 *0DCB243E839AA71747C0C99A3E486EB2E260097B DDSPW
143,590,051 *0DC667FA497DBD412CAF6C8D2BE2F3B9696E683C DDW"_
143,590,052 *0DC37F307130F002C5C8DFCF5DFFF58C512D041A DKho
143,590,053 *0DC957504106B8F4C92E9EC2009FA723390E47D9 deadsouls+metronomeintroadjustmentfulltracketc
143,590,054 *0DCA576286F2030B64CAF2268AC98601B236F90D deanharing
143,590,055 *0DCE85D26D05AF0F2A4FE1359E1A09773CA3F95E d"_l
143,590,056 *0DC59972D636A38C722FC91C1D1E26BD538CAC51 DLOGNOM.1
143,590,057 *0DCD014F4AF0DF96C2182165757AF5432FE7588F d=lop
143,590,058 *0DC506798359792DC238A52F6656EFCB1A3B6BA4 DLOSREDNU8
143,590,059 *0DC984412F7EEDE5F85FC3DD1E82C73F86710841 DEDEMULYADI
143,590,060 *0DCE2E2DA18113D41D5062B2219CCC3B4EEAE8EF dlw,s
143,590,061 *0DCEBB76508D59B1B124195A900B89574F59DEF3 De(E
143,590,062 *0DC7F951EA9398490CBDB5C39CE99970F4B5A759 d$ee6
143,590,063 *0DC9071B57F4063F4967A11C15EB6C85C1C4ED5B DEE.TULLOCK
143,590,064 *0DC80FDABABC20CA8411FE5B99EDE336E1DB8B48 d?mbp
143,590,065 *0DC945E12C3D4309F54FECAB66C28C43B1105794 D=MCB
143,590,066 *0DCD842FCE40E3CD5E0873D8EFBB94EE1E08FB78 dei(,
143,590,067 *0DCE33C1C094124E6EB62033A2E910AB58A509C1 DELPHINE.TAVERNIER
143,590,068 *0DCA99DA9597B90C9A47CF35CDF89BCB0F70522F [email protected]
143,590,069 *0DC7697D8822CA254A274E007C22675CD0F76524 DNLFP
143,590,070 *0DCEF7BD3099CA6193E51C5B4F68427F47D15749 dnsk/
143,590,071 *0DC57FEEAFD50762383D864B177E0EB5BE419A23 DOBERDALE
143,590,072 *0DC213B11D5FC50FE335F617381963D3CEF69F8B [email protected]
143,590,073 *0DCAECA2E035D89329BA12F0D97E6730CE8E185E DOMINGOGALGANO
143,590,074 *0DCD52F5C1814BCB49D3B83371B76A9B5FE1461D domingostagno
143,590,075 *0DC6EB7F3AFE579CB48D7F7F90BA3C679F3EABE8 DOMINGO.WINNEN
143,590,076 *0DCEE20E2215C57D27B0248B456A540134F6AFDA DEREVAELC
143,590,077 *0DCB3A5C249312F107DB4C30E9A250D6E7999BAF dominiramed
143,590,078 *0DC98E37C7011D0FB92F27669A79DFC9D5375660 DONELSON4
143,590,079 *0DCE38AEFB10864461E55CF09190B477B8B12B25 donnbergan
143,590,080 *0DC32815A2464DE6FC23AA101B734ECEC31E2D45 desfigure6
143,590,081 *0DC3E43FA25744ECAEF55B5875373971D0718935 desodlle1
143,590,082 *0DC7AD36B84163A41C2CA27EE1DFD00F3B9F3454 DORIAN.SHEPARDSON
143,590,083 *0DC71A664FDCFE6E39A780B98EFB7C044D681ECF [email protected]
143,590,084 *0DC943643BEF985BB9E7C74E585C7D73C469AD0F DEWAYNE-ELSTON
143,590,085 *0DC7C93CBBC7948CDB8ABCF6EDBEBA4EE5AA296A DEWAYNEMILANO
143,590,086 *0DC0E8B536127E5F6D20AA54F40A2205D535F470 DEWITT.GLEICHER
143,590,087 *0DCBCD0559F6EEAFD4D0595935B11BD3F7D5299F DEXTERELSTON
143,590,088 *0DCD889751DB52850D29B9E44FA738BBD37A6F7E D+F$I
143,590,089 *0DCFA45E876160C8BD46B22C1C4453D01E9058C4 dqe8k
143,590,090 *0DCE61B123C3AD744A829BBC9DD647C9A6A10B97 dquiq
143,590,091 *0DC650938A3914CD70312F65F1C58AB0D73C98ED D:%HF
143,590,092 *0DCF09583D8DC802473214B4C1919C4A6BC1A9B9 dhh)
143,590,093 *0DCDE46075559F3A43515F3178907D64595989DB draalts
143,590,094 *0DCA1436915E64908DBB8F11F8354E663663C663 DHI-INDRIYA
143,590,095 *0DC520A983F685D1487E7BC13625359BADC42726 Drd$
143,590,096 *0DC9BAEB54D63F410025A13282F75E61A6E20668 DREW.LITMAN
143,590,097 *0DC820FA30864DD4A05E36825ECA22E2B7E51B84 [email protected]
143,590,098 *0DCF8EB557AF7FC854030D376756C17F96F318C8 driblets
143,590,099 *0DC43D2221F783679E953EC60705FB2BCB33BAB4 [email protected]
143,590,100 *0DCC62F93D54396260B632C87A792CC66250C8FD dienjosl
143,590,101 *0DC21163BA3F63E2E00A7730EF2767FCCD33742B drwynebi69
143,590,102 *0DCD01EE342A12CA66B5CBFD0022315ED42EC720 dietrottelvondersiebtenkompanie
143,590,103 *0DC6C8C01DB128A60A7337A841BC26BF27122DF9 D,SJV
143,590,104 *0DC100A5433EEABA1F36DBB3688A362B68F39E25 DIMINUEZI
143,590,105 *0DC378919DC287F01EDC10FD5EBBF8B32F5C073E dtejw
143,590,106 *0DC740A0990457BB04CB87CBBB1694B7513EFA41 DTH/E
143,590,107 *0DC44AE9BEDCCE68AB518599B33BC09F72B41B09 [email protected]
143,590,108 *0DCDE5A926A5D157B7251A7476939CCDF5AD1189 [email protected]
143,590,109 *0DC989403B71892F13412FDC7E18FC2BA4D00F37 DISORDER—FAQ
143,590,110 *0DCF538201445D40CA005836245FE3EE625A5152 DIVH1
143,590,111 *0DC7474F9EA72017971ED2956202AA87739B282E [email protected]
143,590,112 *0DCD44B1A40794ABAE338EE33B21988F429737DE dulisse5
143,590,113 *0DCB5E8D9A667E947606015310D92121D6CABC7C DUNCANKEARSLEY
143,590,114 *0DCFD610C89AA3B0C5D571E22C777E71CD79B2FF DUNCANTILMON
143,590,115 *0DC1DC59E48B16BB586E574EE55F4DF10629FCC5 DJ%S
143,590,116 *0DCB243E839AA71747C0C99A3E486EB2E260097B DUSTINGARLIC
143,590,117 *0DCD8C3D0A798585420573228810B89467E4E347 D&V2
143,590,118 *0DC6254295544AAD5CE96FF33F9AB7F56E567FC5 dkjj1
143,590,119 *0DCF6F6CA6293CC8B29130C058E59B409EE86FBF DVOSTRUKORIMOVANI
143,590,120 *0DCB31A5E60377D220122BF6FF58804CEF2F6FFE d=l3g
143,590,121 *0DC0A87DAAC3EBB5C60EFB5B2F96A7302219A06F d-"vz
143,590,122 *0DC20063EAAA175C7FC15DF77BAFD5DF2B6433BC [email protected]
143,590,123 *0DC6CF951FBB0282C74CF149867E277E254D6E5E DMFFE
143,590,124 *0DCAC80920C29CDC09621E05053F53CEF01F185A DmHP
143,590,125 *0DCBCD7512FA52D87699B274BF0D4CDB3658CC55 DNALAGANING
143,590,126 *0DCC43EC39DFC7B0ED42442BE5395C05115EAFFB DNATSTKR3
143,590,127 *0DCFD27CA9EEC6B1575D0D44C72DFE54AC52C690 dy+f
143,590,128 *0DCD26B9F08D4375A5F89542D00E5F67F8A3AF28 [email protected]
143,590,129 *0DC047F1084C69B422A0F62B503F68710625E999 DOCUMENTLIBRE
143,590,130 *0DC3E3B0293261FFE7B4BC64824B6D7456D6A614 [email protected]
143,590,131 *0DC4E6A43821150DD9D429391879033CFF185615 Dokomademo.(sing-along-mix)
143,590,132 *0DC6B5452D8D0C92A8E1C3E9BB078E4D5A4D2167 dzhli
143,590,133 *0DC2ACC11B47B33C399AEA288E1FABBB99118A62 DOMINGOPHILBRICK
143,590,134 *0DCF40F65C8AFD409BF54BD3A3344EB5CB8383AB ea&1m
143,590,135 *0DC63621ED6F087A1F10C161891E0D8C6DEFD3B4 donnellerdley
143,590,136 *0DC5B7FA773F3DF49D8226AE47F24FC5FD92694B EAQ?C
143,590,137 *0DCCB258CEF8385024FF80159DF1A8E555A5805F eb)sp
143,590,138 *0DCD852F479B4DFA7B6F8C8E4D1D5E96497853F8 DORSEYROLLINGS
143,590,139 *0DC660CF279931BCFCF49B2E8BA22C7403D0EB0A ecz$?
143,590,140 *0DC112578076DA28E85794EDCF7E9727D1F84FC7 e&D
143,590,141 *0DCFC0773A055832C3237E2F434CC261E81028F0 EDADAMSEN
143,590,142 *0DCC8601CC8F49A760B5E26B1B2C7FAE19880FA1 EDGARDOZARN
143,590,143 *0DCE781B85DF6DE749481E6739FC5479CE05B5C8 EDMAAREG8
143,590,144 *0DC156FF129D68BF8CCDF0A251F5F835580575E1 d"$qg
143,590,145 *0DC804DA1E6AD85C5A326234493F1821A698B8CA dqki
143,590,146 *0DC69C61DED819EB6612DBF3DD782425F1EF09E6 DQY5D
143,590,147 *0DCFE02B601C435A2CB3EE72ABAED96D58D53918 dr8nv
143,590,148 *0DC72B54CA2D5B4243794EED275B9E0E1B86C85C dr-ap
143,590,149 *0DC8D8EB2C260946DF6055A09534733D3774F669 DREWKUNZE
143,590,150 *0DC9B594771C5832F5652B48D1A21234F5CB5D38 edqc+
143,590,151 *0DC459F44D150C6C055218E78051FA34E96DFD8C edrangiopping
143,590,152 *0DC13D4751EA609E7F6FEE4FD517E074160A3285 edrooheots
143,590,153 *0DC445212F7302A2A84FAE4E6FDFB5851980F94F EDUARDO.LAVEY
143,590,154 *0DC5AE961CD1A64DB3A650607B3A2C83786659BF DRIZZT
143,590,155 *0DC70AC733B399B49EB00943C554DC254F491FEE DR,O
143,590,156 *0DC8820E6B10403257E330178525CF434DEA1ECB EDWINELDERKIN
143,590,157 *0DCF97063E4A7217156A53AD60933B4D20D409FF ds48!
143,590,158 *0DC7786F78841B4E05DF7ABD3B93F5591F2952C5 ef:(c
143,590,159 *0DC9D12923DD20EA9B8A6BC353AD6D3C4874C8CD DSG)
143,590,160 *0DCCEF0C2D2838A3F285ADB5CD29B16A9C06A591 DT50_
143,590,161 *0DC09D2B94F139AF768F2270E7BE5E6E0A15EF06 dtins
143,590,162 *0DC468AE93787D90F0F3A82B658983FE0B98CC9B EGITHCULK0
143,590,163 *0DC1E35AF17B3EEE167ED4E068CEB19BA1CB1A35 DU8AP
143,590,164 *0DCC8B9400CA899D8D177AE0BD84CFA100CA47FB dueok
143,590,165 *0DCF68FEE6F1886608FE44C519DA85A08EAB2FE2 du(ga
143,590,166 *0DC4A33DB06FE952510D1CCE291726E0D13DE0A6 DU KAN INTE L
143,590,167 *0DC6805695F217DF292D16E78C7D3B76B1DCCCB7 [email protected]
143,590,168 *0DC8923859BB82E942AA2EB3B221C64637990F38 DUOYKIHC8
143,590,169 *0DC8D1266733F7290EAB4B6BEBCDD03E4D9B9B59 dv;2n
143,590,170 *0DCFEB476E2F4501BF2BA553DF39D6FE7DC8DE5A DVh_
143,590,171 *0DC2D8A5393A4BC877B01778EE56D28A7140D307 dw00h
143,590,172 *0DC8F738BFBB7D98A718D79969A1DE6069A37CA9 dwaalvuur1
143,590,173 *0DC4AC8E08AE98B455C80C71B86FE8FFB96CE0B3 ELHPT
143,590,174 *0DCE8E549B2F0F8559F6B86554DFF265D88F3B07 ELI.BESSIRE
143,590,175 *0DC755A3560659920043849FB763DA30E4DC160F elijahhaboush
143,590,176 *0DC11F3CE7C35B1466ADBFCD6C946ECA1CDDB717 dxk0(
143,590,177 *0DCDDD8E58D5FFF57FF5C97861D12156DA92D3B8 DZCAA
143,590,178 *0DC3817FE50015F87A05258881592E580B59B871 ELPIDLA0
143,590,179 *0DC18E5F6221A99A53CDA232BA9F23A9C8CC52D2 ELROYBLUEL
143,590,180 *0DC1A4815570956127EF3A781946A221A5502AB1 DZSCOOPCOMWWW
143,590,181 *0DC7B7C84D0E9B53325FAA5E6B98A6DDD7D3D528 [email protected]
143,590,182 *0DCE3B0C8E04F9FE16D8DB9F0D7A178F2C90FBD2 ELVISSQUYRES
143,590,183 *0DCA4E08F35F8E51BC8466A9AA20805D6025B9EE e8.u
143,590,184 *0DCAC3A9CE3D0E3F14C782BB2A3412456534B193 ea[7
143,590,185 *0DCA27E28B587E39C061EF814774DE6B50CC1459 e$+ma+0n$
143,590,186 *0DC20DCA63DE5A9F221156BA05E10BC83192090F EAJWA
143,590,187 *0DC3ABC910C76F447BFA8D15DEFC523F8DD6FB4C EMERYMAUTNER
143,590,188 *0DCD5B5E0A233051A680CC924D0745CF02BD8793 EC8(E
143,590,189 *0DC31F03A17B6AC2EB175F335F3B898BDC52AD07 ecafretninanoPRAetavitcaedroetavitcA>P<
143,590,190 *0DCE8F7DBD9554283215AEC7DA0951462BA88419 ECXGS
143,590,191 *0DCA014ABF05D0ABCA6E6DEF0F0DB0659862C45A EDDIE.HOLLANDSWORTH
143,590,192 *0DCF2A26756A85EA0CA99E306A40DFCF40DEEBD9 empo6
143,590,193 *0DCC5E3C49582A30D6C9315526AD9E87E8FAC040 en7sr
143,590,194 *0DC9755B25CB46F5144E0D8EEE785C8CE94B6B4B edqc+
143,590,195 *0DC459F44D150C6C055218E78051FA34E96DFD8C encyclopedicjames
143,590,196 *0DC3C022BA4D3EEBB17AB3B7AD6E7B3529ED9E75 ee2j/
143,590,197 *0DC0BC1273DE054282ABBC5003A94A31F3778645 ee9t.
143,590,198 *0DC7E39ABD024B3D5AF53A2F003DD62A14984C19 eeeh(
143,590,199 *0DC1C43B8F5ED7E69047F931044C0C2E49A22386 enserrers0
143,590,200 *0DC23517DCF243D422A772D17812E0806157856F Enthalpyentropy
143,590,201 *0DC1282368A900278225AC910238040C26A9787B eo.dm
143,590,202 *0DC7A6D1189636AE9BF8D405470511C7C45DA40B EOL&
143,590,203 *0DCE02691DCD76A7B59432BDC16AE185A91F58A2 egw.s
143,590,204 *0DCB0BF351A98BAE21A31466227CD619C1585559 ehbnk
143,590,205 *0DC189BBDA4D5565F1E035F3CAB89D2C0E82C100 ei015
143,590,206 *0DCFF152667726A2D1D9E4AFC3E83E2B39AB861C eqjdo
143,590,207 *0DCEED1F4CCDF17CC1331039EE5D6EA4083B7C63 EQ!UF
143,590,208 *0DC6E4B47887D63F70CF58DEF826ACC710A106FC [email protected]
143,590,209 *0DC001850750FBD270069C26DE41894686BBAB4B ERIC.DOI
143,590,210 *0DC413303108E7C1A2C16F7FD4CEC67E3100FC24 EIW%C
143,590,211 *0DC8C978A2D9E6ABBD605B36680AC2EEF03DF84C [email protected]
143,590,212 *0DC36F3B86F5593181FF3A9AF47321DE15D03DF2 ERIC.SAMAD
143,590,213 *0DC7689A919CD533C2AF051C0A0193EC49906313 ekcolgmr0
143,590,214 *0DC9B33107671BC18E40C4A527A4656BA8AEF7F0 ERNESTO.MANTANO
143,590,215 *0DC6750AC652E6B4950E00A2A1BAE8091B24E422 elbaslups
143,590,216 *0DC40A4D21CAD5B24E5D5C83E9BE8CD3E0BD1313 ELDRIDGE.PERAZZO
143,590,217 *0DCFB13D8D085C21261D9408C0C5DFA65B41D785 ERWARESNICHT
143,590,218 *0DC4692A7D073AA0B6B5B672C5E64529EF581353 ESEKNEK
143,590,219 *0DC12FD2A309CF7F3874CE7EE1FAAC651926833D ESEWV
143,590,220 *0DCD9BF175B86198ED7F57472EC8FF85F1FE097D etablissez
143,590,221 *0DC578F7351FBA400D98EFBEB947A361AD971D6C ETUDE IN F-SHARP MAJOR, OP. 42 NO. 3
143,590,222 *0DC504CF096DF00BE943F1CC07EB57D6288EC031 e$m^
143,590,223 *0DCFEE16147F502824BFBB1F7B330446404216B2 eugeneengelhardt
143,590,224 *0DC7F0B60021B79AF110F66300007BA8EC256CEB emhev
143,590,225 *0DC9D2FCC5154FB426F2A76F2D6DA48175CBB1EC eustyle6
143,590,226 *0DCEBADCD9178F9B2BC3C5DB2A49B8965F672025 evanbravard
143,590,227 *0DC6D090A70DDCB52CB0B59BA8D955C479EAB53C EWXMBB
143,590,228 *0DC47F45939EB8EA361488C8ABA82A336BECF5A5 exempli
143,590,229 *0DC88D0E2B24887DC16E69F168994C00899DED47 [email protected]
143,590,230 *0DC9E842C0FBC93C280A722D45E483C8EA3374BA F00LH4RD1E5
143,590,231 *0DC388332BA32902AF871679005EC6EEFECBDA28 eo(id
143,590,232 *0DCA1FF4F3DBA46B23A78BD3505EAD57325691E0 FABIANII8
143,590,233 *0DC5704DAE3040BF9A64984BDDBA2740DBFB32FF EOPSOA
143,590,234 *0DC949D91BB0C417F0ED24A552B8DD8DE63286C1 EOZUMERZIFON
143,590,235 *0DC3FC111755EE5147644F6825F1260547B553FB ep2lf
143,590,236 *0DCE977181ACC7A8B39DD45D6C9F5EBEEF6C2497 epbn
143,590,237 *0DCC5372D3907A35D644B7A0E7E55F2B63AEF813 epgninohs
143,590,238 *0DC863623545FD4090BC23894924BBCE9A4822FB EPINEUX2
143,590,239 *0DC3060AF78FED1CF00C1A2953391BAF62CFEEB6 epipastic-,/E/p/@/'p/&/st/I/k
143,590,240 *0DCB1EB0A08D8323D9D599FBA374F1CD7DD31E88 EP&!K
143,590,241 *0DCFEB79C4EC8481312E62235195C0BAFA800CCC eqjdo
143,590,242 *0DCEED1F4CCDF17CC1331039EE5D6EA4083B7C63 ERALOZZU0
143,590,243 *0DCBAE1713DC80560F2E801214D427C5A836BA5C ERIC HEEP
143,590,244 *0DC6B755F6D486E7D0E5B519E8D9C90C6833E2FE ERIC.SORKIN
143,590,245 *0DCC10702374284FFE8B3D121C35FC9E3A671F7D [email protected]
143,590,246 *0DCD82EFF45E9D58CA6575C1557E335BBCC13346 ERROLKIDNER
143,590,247 *0DC9F0914E0A247916AFC0C33A489AB51FAACB74 ERTELT
143,590,248 *0DCA75D36040EE007813EFB81FB580881A9C19AA FAUSTINO.SLEIGHTER
143,590,249 *0DCD54AAB086164522AB3123E6BC4DA7A51534F0 faustolacey
143,590,250 *0DCB0106271FBFBFC0F5580EDA6B6DC613AA0710 féléretten
143,590,251 *0DCA13D63175538667FFBEF62B5462290C8641CA etmav
143,590,252 *0DC446C106D5E6D911B59A14B5B101D2D463DACA etremalb9
143,590,253 *0DC276502DE919A71A09B69CB93C061E7E07F484 filipameneses
143,590,254 *0DCB80F6614F2151F39478C4423BA5CC15D4A146 FILLOUX1
143,590,255 *0DC018A05610FE675ACD0C88AF0D2D41E5E1EF44 europearar
143,590,256 *0DC0B0EA5D48201D1DB831339BAAD0142470C792 euzur
143,590,257 *0DCF24ADC29337AA9551747B41450BA6B730666C everetteatkin
143,590,258 *0DCDC265CE39907FC14F79565BEE865F037E3312 FLEDGING4
143,590,259 *0DCD8B89B19B938DDC4AA063BACE08D2F32B4EEE flongessaigne
143,590,260 *0DCFFAB60C503CF02447E5C905456B17E2F0540B ez-z
143,590,261 *0DCCBEAC187D475FD52C0E215951859B1788E016 F1.2074281007052
143,590,262 *0DC8F0581A602732C77E62099BAE1D10971C4E26 f37–38
143,590,263 *0DC202660FB07F544CD2A995BA7EC262E5D4376D F4T4NEH
143,590,264 *0DCBA9BE569F3EC7A605DF53940D620974BF5391 fluitspeler.
143,590,265 *0DC6FE9C1E4A48C8E090A260716ED2296934754B FACE7!OU5NE55
143,590,266 *0DC135BB8E0DF5589D9131D146ECB8FE6A8B216D faji
143,590,267 *0DCE898886C1A044AF837680E5256E34978C0BB7 FALSEPROPHETS
143,590,268 *0DC3A23796C995318408DC6F91DB327790101FD5 FARAHTAMIM
143,590,269 *0DC93EFC2D6E25C961B05C1EC8F6042223B43E63 FOUR-HANDED.F/OU/R_'H/&/ND/I/D
143,590,270 *0DC59C29EABE06C3C5EB66D888A88C4C50F5891A faustinoduenow
143,590,271 *0DC08EDC320C649812BC60200B96A02907F3E025 FEDERICOVILLANVERA
143,590,272 *0DCCB610D5A5BEB9AA96499261C3F1903FB80501 FREDWALLIN
143,590,273 *0DCE757CAC37BE42E8C5CE2B109D3DCB797ED372 FREIGEARBEITET
143,590,274 *0DC5ED56274C4091A2258E89990B7D381750C4A6 freiheras
143,590,275 *0DCEA0928F4D18D1C346C510F1244BF152566905 FELLESBESTANDAR
143,590,276 *0DC3B1171E053BECA8862C8D34B23AFC9AAD5572 [email protected]
143,590,277 *0DC179D55906D65ADCD5322BD3706EEF77AB7626 FROHSTEN9
143,590,278 *0DC3D55C5F5B2C7227CCBB1FA16B991F1AF51E4A FERNANDO.HUTER
143,590,279 *0DCB0B025FC335C729A904D0D4891B5444DF3BBD FRUTA.GOG
143,590,280 *0DCF12BDEFFF4790EF1F2F3483ADE4EEDA6956E8 fernandouhl
143,590,281 *0DCDCB615B19499E94AFAD55419143955B2BE155 F\SD
143,590,282 *0DC8971846C8292057DD6AB8B8131692507AE808 [email protected]
143,590,283 *0DC744195EE4C65D72DE806D199B91FA2EA98719 FHTX
143,590,284 *0DC62B9CAAB5F961AEAD587A59B46E23F78E4FF4 [email protected]
143,590,285 *0DC938DE0EC127F221BAFE2DD6B7168CEB138AF2 G4M8IST
143,590,286 *0DC4493A5906BB1726FD117C19C4D4E27CCC1607 g7m|
143,590,287 *0DC1D60924840F6410A64128A278CA1DD6DA3A02 gajvz
143,590,288 *0DC40F05D0F75F5E8F44552BEFCFFE01B22BFF6B f_k?
143,590,289 *0DCDCFF5EFEABD24B74F15CF3AA0E2589CB93292 FLORENTINO.HADEL
143,590,290 *0DC429CC4C0C88167F8BA7EB0118C1FA6E22D93B GARLANDBATLINER
143,590,291 *0DC34AD82166D0E43CD47028BA06946A6D2DB5DC fondsparkling
143,590,292 *0DCAD3B46F7ACF2C4C1A602B9E7F1B950F50E933 gavinlamoree
143,590,293 *0DC1102E97A3EA7B12AB54A76DB440459CF920E5 GBÒDE
143,590,294 *0DCD61838CF5302CDF95A1BCE9671B2A538D5957 formatting</h3
143,590,295 *0DC64E8FC4D0EE150DA1AC5EB9DA3155FA68270C FPANCHERACCIA
143,590,296 *0DC8C5381E4ADB9C09BD71A87563071E4E0009DD [email protected]
143,590,297 *0DCEE5B368DD347A7FA48DCE91E4003458CB0B27 FRANCESCOFILIDEI
143,590,298 *0DC4C5BF391BFB91FED4CD3C9DDAC4961FA1D2BB gekaspertes
143,590,299 *0DC90B3F57654E788E39765C8F6BE02646E1985B FRANKLINFARMAN
143,590,300 *0DC733A3647A96BD074816EBCBF8D57B42E11DDF geodal7
143,590,301 *0DC71A607D77A03DDF1F317B37038262058D4160 FRAUDSMAN1
143,590,302 *0DC0E676AE125DB063C5F4B8D3C8170E045816DC GEORGEANNE
143,590,303 *0DC58D6EF197D52850D320C272CC574FFDA798F0 FREDDIESELVERA
143,590,304 *0DC0D12D73C66FC72854743ADE4BFD7C9432F52C GEORGETOWNERS
143,590,305 *0DCEA7307478B3F95C5050EBDD3B0B5137BE4CCC GEORGINA.GONZALEZ
143,590,306 *0DC5768F59CA4C24C2C59BB79C3F8101CB635064 GERALDO.BOCKRATH
143,590,307 *0DCCBF58C7AD18F1C45416B57F88A2DC7EA31967 FRITZ.MUSTARD
143,590,308 *0DCDCAAEADA2117BFC365D8F7574E23A67A4FD8B FSSRRNT2
143,590,309 *0DC4A6526EBD91A9181E5366719900798B727D6C GIFQ
143,590,310 *0DC6ACB49DF5A260896E361FD77ED77E2EF853B9 g108e7r0771ng
143,590,311 *0DC7A7D74D727A83AA3A5EFB14B142A231CED1AB G8,K
143,590,312 *0DCDC9562C1C07E1FE73BA3057F576E871E1E410 GA?`
143,590,313 *0DC3FF6318811AE1213DFE187A76693589917147 GALE.GINGERICH
143,590,314 *0DCFEEFD8CE19E4AD82D64E4C5BDDA6C7F594F8C GALINACEA7
143,590,315 *0DC8BE9881F7A6B3BB5761E571F89A549761227A ganeshwar.prasad
143,590,316 *0DCC601CB4662D3D59C82C120C3AEABEA7E74F19 [email protected]
143,590,317 *0DC65D1A7FE02FBF7AA9762EE606CBDF35123718 GARFIELDLINNEMANN
143,590,318 *0DCCB9879BBBD6F728B58636E3A1BF2E44B8A630 GO1DFNCHES
143,590,319 *0DC62F632FADD28D926830B38FEE643C79A0704C goldeneyes?
143,590,320 *0DC49AD000D284FA7C1324A78A562B9BD49DF0DF GARYWRUSSELL
143,590,321 *0DCDF1042BB97DB88976122DBDDF2F060405E52E [email protected]
143,590,322 *0DCAD2FBBB348B5146A06A422B074B690B8D7BB8 grace.valerio
143,590,323 *0DCCF956768DAC4AA6648C5B2E8E98E71058A70C [email protected]
143,590,324 *0DC1DC355CC995C8B6E4BB0040D0FC4B28CE1805 gekondschapten7
143,590,325 *0DCFE49E7849C1A16F3FCFFD839489B42DD30D04 GENARO.PESZYNSKI
143,590,326 *0DC0489FFA09BF360E473EDFB025D0F15B9FBB3F granadafromspanishsuite
143,590,327 *0DCB5E3ECEEDA29168C964BCA1697D2C559F69CB GENE.SOBON
143,590,328 *0DC40CF4BF9690F069802121EDB8A63C90AD0153 GRANVILLE.FRIEDEN
143,590,329 *0DCB9CF17F29FEDEB1A58757C2A19343893C3488 GENNEMSYRINGEN
143,590,330 *0DC4478CFBC0E40C4BD8FC36189F140DEDEF13ED GEOFFJORGENSEN
143,590,331 *0DC8793ED640216EDE895642CA80A9FF0A607F03 GRAPHICINTUITIONSCOMWWW
143,590,332 *0DCC32C1DAC978858772284DC06FA385347D7A18 GEORGEANNE
143,590,333 *0DC58D6EF197D52850D320C272CC574FFDA798F0 gravitationsoundstory
143,590,334 *0DCF77A96603F46B8437EA0747A5F9D3EF7EEDE2 GREGDEBLOIS
143,590,335 *0DC8179B7A81D2A2334547C4E4C8E6F232BA7742 GREGG.RIKE
143,590,336 *0DCAF7130E9CB42080C0E57F02317357D0BA3481 GROWINGPAINS
143,590,337 *0DC5C65E6E0B4CF29FD84BF2EE7AA368F2A71E04 gkschrt7
143,590,338 *0DC785889B42CE1A164277CD10F30D4899DD5F40 GLAENZENDEM
143,590,339 *0DC3E271FD182D0625FB94760C424343E7939649 GLENGOMEZ
143,590,340 *0DC04836ADF55CD8D3DDA4864D15B7BC3EB48B97 glenlachowicz
143,590,341 *0DCCDB04B22F7F25E6C77F3E5D5F1FDA355DD3E1 GYNNARESES
143,590,342 *0DC6BA0E7575C78E5679A255A58F581C5B789FAF gzvc
143,590,343 *0DC6693D44D5DC01F567DDAF87E8324EF7347727 GOMEZ ANAS
143,590,344 *0DCE0DEAB2DDD9AC61A2762EE1E44D1ACEDBFB54 gon2dumanagersethttprid('182x7y4xn4ftf55gksvq'
143,590,345 *0DCD66AB60107AFDF8FD151FE02C0DB050D87EAE [email protected]
143,590,346 *0DCD40F884C7B7012F7643E755CEB9743C93129A GOPOLAGK
143,590,347 *0DC77FB81BF93F155B5B821B64DB1F7A4B8EF1FF GORDONKOFFLER
143,590,348 *0DCFCF96704BB1966180C3725B466575186C4B5D gorgonean
143,590,349 *0DC08D303A0C749C4C3C03A40663C0AE93C7D6E4 HANSSOBECK
143,590,350 *0DC4034320D50C86B8FDCF81E9883CC5E08B7749 GR4N4DINO
143,590,351 *0DC4C014CB51CA620F0D046C9C0ABEB144F96F54 [email protected]
143,590,352 *0DCDF3B765C70C1BE4A4E41297BE2F83FA2DB5E6 [email protected]
143,590,353 *0DC687B3D84AD3B157038D88CF7FD4CAA0301D47 harbourtowns
143,590,354 *0DC2F7894467285F3DED2BC046B1115B23377734 gree+!ng5
143,590,355 *0DCBDFBC045FB7EF24B70A9E14719D5450F2CDFC HARYATYY
143,590,356 *0DCE3151396D2C6AD4363F7D846ACD14F69F04BB haywoodgeiger
143,590,357 *0DC49708631B85AC0A660E02FE0234B9FD4B91E0 HAYWOODSCHRACK
143,590,358 *0DC0051535DF80AA3DDB19E45D4F29E76C06B78D HCOTRONEO
143,590,359 *0DCB0692E5BC1537971803588DA660E3DF0909CD HEATHER-CRAIGIE
143,590,360 *0DC3A858CE3DCB04C90FB23130EFE9D4B97A1B4A hectorbhatt
143,590,361 *0DCD09042777056BF98D20BE8AA974962A1B549C HELSHENNAWI
143,590,362 *0DCBAB3D592D90F139E73FEFD0D9C4D5D71B3AD6 henrygravit
143,590,363 *0DCEB5D4C40D14BBBB476E7DF8D86BDB1432D0B9 henrypetrizzo
143,590,364 *0DC71FFB959B6313D138618D992B9ADF2B81D74A HENRY.SALAZAK
143,590,365 *0DC7B8EE2BACCA3E8C7F7F97F44EE57AC8C4BF1F hevlar
143,590,366 *0DC76265DC1DCCE7092CE4BB254410334E3DDB1C HIE\
143,590,367 *0DC7D7F05DB8B60F40736902E863D3FC9F564688 HILARYGOOCH
143,590,368 *0DCD2E2665C286ACC98D0AF3FD27382F88C159AD hiltongalway
143,590,369 *0DCC55972AE6839C9BE38FA05BAE4B3427E194B3 HANSETT9
143,590,370 *0DC2564491F00953A47D6DFFE41C8427449A4DA7 he?
143,590,371 *0DC82CBCB4BE058D8F21318B910B5944C1BF6772 horsepowerfuelefficiencyand
143,590,372 *0DC71758BD5A6764840DB7579CE4F43E43A14B6C HOTELIERE9
143,590,373 *0DCDA190A09798469E9D55A859338CEEC02EF723 [email protected]
143,590,374 *0DC1E75DC797F9A42C6FC8B35E84682A3F8852E5 [email protected]
143,590,375 *0DCF0FCFD6951C45F3ACA0E8DE1E76D67E457981 [email protected]
143,590,376 *0DC693C3000859AE294B4C151BA7163036A2BAFC HERBERTSUNDERLAND
143,590,377 *0DCBCB1AD5238ADEFB53BDEB81B2E6C03D30D6C6 hero902
143,590,378 *0DC15D5202BA2BA96EF331ACA3D1676472865CE1 H$RM
143,590,379 *0DC6C75A830E11A964C02191C654A69B891D24AA [email protected]
143,590,380 *0DC61465D7F350AADFA9C4DE3A4DCF541BBBDCFC HOLLISBUGAREWICZ
143,590,381 *0DCBC760ECA311E54476156E3DC491CA8A162A85 HOSEAPOLSTON
143,590,382 *0DCC05CF31855E7BD3B2AD362E3D70357B7D79E2 [email protected]
143,590,383 *0DC00BA36DF529D13CCAF74C2671640D233B84CC HUGH.BRECHNER
143,590,384 *0DCEEE4DB6EE94C751E27DC163DA8450B1D9B7E9 [email protected]
143,590,385 *0DC167E00DFD957221E2BD9B94793245B776529C HUNTERTIEDEMANN
143,590,386 *0DCE7872D44C9B469F6FA14B1AEC8B347F9C2EF8 HSTERMIN8
143,590,387 *0DC29A9E02F68B87AE10DCE223594D6B4ECC694E HTTPWWWFINISHLYNXC
143,590,388 *0DC38E4B2F8B2BD438D5158EBA9B21E8C99E8F69 iambach11
143,590,389 *0DCE51A49851A9F2344A68F561E4A95D6CBB7049 HUM--CONSPIRACY--'SLEEP-TILL-I-WAKED-HIM,--YOU
143,590,390 *0DCED87C132FE85ABA03E439CB31330429C66B13 humified
143,590,391 *0DC07E83AC664E0343717C8E793C895A90EB4548 [email protected]
143,590,392 *0DCE496B44D58B1487FA9F7E3206A1D2E81D6D28 ICMCORP
143,590,393 *0DC9279C01318BB33A1EC67497B241BD003EFEA3 IIRAPMOCSING
143,590,394 *0DCA02C85FE22EAF5CAB0B421F3BBBE01E7D78A5 ikamgalf1
143,590,395 *0DCA5D247DD72FBB70D8AD443F655A4314166DEF IAMMAKEITSO83
143,590,396 *0DCD655A40B1EB0C4011A9147CBEAAACEB8E1A43 IANKOEHLER
143,590,397 *0DC94DDB306EBA9AC095DC9B9E9C03DC3F7F21F3 ILOVEYODA32
143,590,398 *0DCD3D998420A2FD957CA23668B68B311785E772 IGHABORROLAND
143,590,399 *0DC55AA194E8BD021A5DA532AA039CB8BCFA5868 ILUVWENDY1987
143,590,400 *0DCE1884513DBBD170E3C961642BF24A285097E7 [email protected]
143,590,401 *0DC7F81B768DB3408C4A93C30A18B60108327F06 IIKSNEPSU
143,590,402 *0DC33B015FF5AD54A0BB0A723AD55F53F61064EA ilocbswing
143,590,403 *0DC61B2D9880FB733B7602C5C1FE619A4E30D16B ILOVESUSANNA44
143,590,404 *0DC3486DFDD715FAED1A869F91625D82C790CEF2 ILUVCLASSROOM87
143,590,405 *0DC2E2B1E719F14E0C5622EC3BC2389563D199DB IN+IMID4+3D
143,590,406 *0DC379D10C380DCE3EF535D2FD9331A4F66347F4 iluvswim59
143,590,407 *0DC605241F57405C3C358ED0639D013E00CFA975 I'M.A.FOOL.TO.WANT.YOU
143,590,408 *0DCD0C7250AB8B46A967446AAC9F3CEAA4B89F7A intercepterns3
143,590,409 *0DCFD3B685DE643CA5CB885450B0FE16EC5A45AC INTERDICOS
143,590,410 *0DCEE63A350D524D86E35BF546050F2C67716A36 interoperateswithaimgoogletalk
143,590,411 *0DC3E25ED8EE2A12C9AE745E3E14B5D34EE0AA85 IM:PULSE.(DISC.1:.CHILL.GROOVES)
143,590,412 *0DC95F6A7DA42457B7F800E4945D76E80F31F75E irene.pascual
143,590,413 *0DC99D2173565364FC9D86A9A0D44CDA729A0283 INGEKRY0
143,590,414 *0DC704484A8F9187B6985278B708AD0CF780E71F ISAIAS.FETTERMAN
143,590,415 *0DCB1179E85755D2F1B5A04E79F32E27B595DB39 ISIAHVANALLER
143,590,416 *0DC650D5C73F8E74AD447B77B9D8E67C64A8CD5E ISIDRO.DAHER
143,590,417 *0DCE63A9F84420DEF5196C96555A2F0BF968F4BA insolubili7y
143,590,418 *0DC26C399A196D2EE6119384CF9FBA26ED2CC013 ISMAELDEGRUY
143,590,419 *0DCFACD1A1E548F5792BB39F279516FF2A02BD48 ISSUEGIOVANNI33
143,590,420 *0DC49EB38BAB691DF6B067720DB76EA672DA1124 IVSPTR1234
143,590,421 *0DC3C7CAE4D3323714C3805FF7B27E2A29DBF5CE iolahpmo4
143,590,422 *0DC4BA67252AC8FCB961614D7C0382EC71C10474 IRINAJEGOROVA
143,590,423 *0DC4F8CF3ECF2B0026F0D65A62A850277BA00EFE ISAACANANIAS
143,590,424 *0DC1A405B4FAE63FA8881393C344BC5F0472F149 JAMEY.FOWLER
143,590,425 *0DC534B255CF236DA84FCF20C6EEA91D9147C3DB JAMIE2962
143,590,426 *0DC07D79AFADE14E95CD49E054E48C35B95840F7 jamieegloff
143,590,427 *0DCB612E2225433AA281819E739CBEEDA9FADFF7 i.yb
143,590,428 *0DCAAD599B56E55CCE83448289AD4BD7F3E09318 j06^
143,590,429 *0DC2216A48DFA5FF88DEE5ED7798349C90A43F06 JANITORIALCUSTODIAL
143,590,430 *0DCA959BEFD76917FADBA220D92A7345AC9678FF JAN-NIVENS
143,590,431 *0DC261D41678A1899B570CCCEECCF1AFFF5CDC68 j3whzimgek7yzol4
143,590,432 *0DC5E29988251AA3978C2A1C534AEE26DF5D9CDE JAD-NACHAR
143,590,433 *0DC7DC0E842087BA2292D22764CAADC291BC34BE JAE.TINDOL
143,590,434 *0DC2CD61D1AD4E1E4E358E57A6F20D97A85D5D83 JAMAALPRASOMSACK
143,590,435 *0DC6A02FF584696A0BBD3B762F675A2CAAAC6584 JAYSON-QUINONES
143,590,436 *0DC20FC0D23C66E075DEB6D51CD5A741E11E9E91 jBI
143,590,437 *0DC3BB6A3F00C3D6BDADBA0557151A7B2BC123B7 jamesavo
143,590,438 *0DC09DA7B4033FD12C33C58D1C71B5CF5E1406B5 je5x
143,590,439 *0DCC8F61389BFDE53E29A171B02A159F7FEC536A JAMISON.GREIFE
143,590,440 *0DCB375D12D9609FC0F575FE8B22248E0FD3E5E8 jeffereykittles
143,590,441 *0DCAD321CB1BCFB2683A5F055ACA2700B8279B72 JAṄGHĀKARA
143,590,442 *0DC2E0E1EB074212FFA05DE56ECB0CBAAF3760F9 JARCHILINI
143,590,443 *0DCB38067B1A7A547D6B6EED3CA1BF402E3F4223 jenny-tooley
143,590,444 *0DCEECCFA5860D986C461215AAB7A0CDD931275F jarredfross
143,590,445 *0DC95E9FD2F26FCABDC3AA89F5C3F88D58BE8972 JARREDMCALEXANDER
143,590,446 *0DC22AD3423905B7EB3F46C2FE40A79FD43EB565 JERAMYFIGGE
143,590,447 *0DC2370C5754B9144819A7588C742A717628DCC0 JEREMY PUTT
143,590,448 *0DC2A4B6F298F1E9F2ADF288280CF5F6E99EF99A JERRELL.HOINESS
143,590,449 *0DC1BBF0B90E71212A07F30491D6E7DAC92B2126 JAYKLARBERG
143,590,450 *0DCBBE87A40FBF3AFFD44CC2666719DE2A155D29 JEWEL769
143,590,451 *0DC365CD7D5F47F30145B412EF3EBE4C07620E42 jefima
143,590,452 *0DC12A7C2F74056B312FB974192829AF3306E99D jelinnek
143,590,453 *0DCE3A28A5D955894D6A5E53F7F50DD25B948023 JIMMIECROSON
143,590,454 *0DC5A985FB72FF16336AB0D508341C5924BEBCE4 jimmy413
143,590,455 *0DCA34337553E05E94C1C21EF0C0550EBE6D78CE JIMMYSTANDER
143,590,456 *0DC76D4B60D4E05657A85AB20AC6E4AF6185E640 [email protected]
143,590,457 *0DC2353D3BB973C85FCF2ACEEAC482E4868074FF JJ5233
143,590,458 *0DC0741F2741135DEF359A1E0C9475E42FBC1BC6 JERMAINELIRANZO
143,590,459 *0DC23AACD317783B2044ADC9D8DC9EB1824411E0 JEWEL.SCHWEIGER
143,590,460 *0DC3E956E9432741A8D02022540E75E177D64B15 JOHNNYKILCREASE
143,590,461 *0DC90AEFF4525B1A592D3940315CA602FE82E9CD jol2
143,590,462 *0DC12BDF682A84133F9D5FF1FC7B196BB013EF89 [email protected]
143,590,463 *0DC8C94AF6F7119CFE0CC728460D0D8827C463C1 jonalun1
143,590,464 *0DCB674166E45388CB6DD897CBCEB54E97D2C5D3 jonathan-cancel
143,590,465 *0DCCD5E33DEDDA7DCE5331C4A71DE031E80CEE66 jjjuuu
143,590,466 *0DCA31BE3501F93C527BD21EDA1806B8DB1786C4 JOE-BEESLEY
143,590,467 *0DC9C95E4C43727E87EA5DB17C57B3AE6BF5E002 joshuagieseman
143,590,468 *0DC83DDDE3AFA18E314509E700BE6AE9192AB4DD JOSHUATESORO
143,590,469 *0DC5E5709961C33A1C11E32BE7A032F98BA12FA5 joshvenditti
143,590,470 *0DC2FFE75380AD947CDB4AABBB0A0D9BBE5B58ED josiahpechin
143,590,471 *0DC27B8794FF993BF89EDA5858CA22FA6ADDE5EE josouladtio
143,590,472 *0DC9E79A23D5136BFEF344465B1ADAC70802673A JOSUEHARRYMAN
143,590,473 *0DC9AEF81400D8D84828C34CAFAE9D27E1D6F64C JOY AND PAIN (LIVE VERSION)
143,590,474 *0DC3E59DC327D9A9C0D36C785FC7A1DBEBEB2297 John.Peel.(Is.Not.Enough)
143,590,475 *0DC8938FF6C268CCC864CF8C15270E1D869B2A98 john-pribanic
143,590,476 *0DC6A9B1A6EB1E81E783280E85115133D93F0E67 [email protected]
143,590,477 *0DC8E267A320C33D5ADA70D5FF35E4882EE24846 [email protected]
143,590,478 *0DC444B5565204B952F3AAC4BA5DF303CFB7EDCD [email protected]
143,590,479 *0DCAF8A76CF0E84C97576CA626010DFFFA72E965 judevanstraten
143,590,480 *0DCF449362073DA671D516AFD7EE5DF14F51FD8B JULIOMCGUIN
143,590,481 *0DC285AA314C77F89032AFEF17CB6302BD10C8A7 JONATHAN.WAINRIGHT
143,590,482 *0DC7E3FD2BA304AD24B49BFB9F7C3C09C6CBA145 JUNIOR.MEZZANOTTE
143,590,483 *0DCDE025048B5094D0DA56EFE8E433AC1BC206E7 [email protected]
143,590,484 *0DCF39D2F45B4CDFD98C0728B1ADCED26F40B70D KAKUNENR4
143,590,485 *0DCCE6A105905C059BAA34D275192F63B239B76F JUDSONMCCLANAHAN
143,590,486 *0DC540AD4A2CA1DE3E645934B46C1F1A80DA399B JUGGONS6
143,590,487 *0DCAB951832C8C9FA1438790A1B0EFF912181A2F [email protected]
143,590,488 *0DCF946AB4C0E82264AC2B99D6209557335E8506 JULIEHUFFMAN
143,590,489 *0DC6BC6393F800830E7EC0AA26A24175E0EEF499 [email protected]
143,590,490 *0DC10CB08CC13331D723D1DDC903B912E8B8DB59 JWH<
143,590,491 *0DCAC22311031AD516F1426108DE00DE25325646 [email protected]
143,590,492 *0DC5711960D89C1CDF2A2CE0942E8F2237031068 károsodik
143,590,493 *0DC30CCA0E1E01D102E57B770DCEA0293C2B1134 K1INIKK3R
143,590,494 *0DC5B4A8019BFB2B485CBC8086E1EAAF91F09928 KAKKESIN0
143,590,495 *0DC63D65E30B39406F03B0E1359774A49F907A8A KB78222
143,590,496 *0DC3C6BFC50139C4E8AC7938279776D88F825264 [email protected]
143,590,497 *0DC533F643B1DA3F678EE351C0AFB9991753E9DA KENNITHPRECOURT
143,590,498 *0DC54E44155856754EF7129B260CC54B3E48B5E1 KATIEXX
143,590,499 *0DC7FBFE7411914DC95BD3702191666481646630 kevintytler
143,590,500 *0DCD7458CA6FDE519924F45E3A5A491EBAF65290 K~H#
143,590,501 *0DCF7F639773B333896104FA0AD4B35715099389 KB217311
143,590,502 *0DCA1A295F5A21B5E53B83EF91FE1D927EC2BDC2 keeley-'k/i/l/i/
143,590,503 *0DCC79319AEF9C46E0F2E5A895F223E19A137798 KEIRAO.2
143,590,504 *0DCA57078D2FC69DAD0C735CAB0ABE72611D6594 [email protected]
143,590,505 *0DC7020E4CF7D2BB84FCCCBCB689FA3916865BAC KELLY.PRUDDEN
143,590,506 *0DCF49347871615F9EE816F916F9BFD10D6CFE2E KISHELS
143,590,507 *0DC1850F429700E68BC94093E96F7EF8A0742683 KMF1202
143,590,508 *0DC2A975AACBE4EC963507F91A8D6B118DDA1087 ketekou
143,590,509 *0DC90CEEDFC7BE068BA5545D84E03207BB9492E8 KEVIN.DINHAM
143,590,510 *0DC8332219F4683B9CC75EEC06BDE9429EDD6B15 KUASAR’LARA
143,590,511 *0DCFE838AB35E742108A0D9B9B7FDF0D799AB205 KUNDENWERBER
143,590,512 *0DC4EAA218102AD5D65868DD2A09B148DB1DB6A2 KUNTZELMAN
143,590,513 *0DCEF523E4B4CED4697CACD745A59E621A7A9452 kup(
143,590,514 *0DCF9865EB68A0EE16F805E5A698C929767B9D56 KYLIE STEED
143,590,515 *0DCCD1056E30E682656BCBC127DBE26234F0D182 KINGREFBUTTONSJS
143,590,516 *0DCFB6D474F7CCF8F682CFC32293F9DF4231752E kirkhaworth
143,590,517 *0DC830DC2A9DD83E355AF28AEC3FB67D512C05F1 kirktree2
143,590,518 *0DC04121A4EDE9FE6C69A5392610BB5699ACFA5B knollenakkers8
143,590,519 *0DCC9B9FFCBA7EE38A866C92367B283DE9E71BA5 KOHRS’
143,590,520 *0DCB505C668CD4DC1FC79A81E8DFE68DBBB69B09 KONBATIIRU
143,590,521 *0DCA4374FC801018B1FC92A19D8C583491BD1397 KONSTITUTION6
143,590,522 *0DCA835CC8F69F26D153F4E5A2A38681E55E247F [email protected]
143,590,523 *0DC9C6D7A01ECBD90AD3FE6482CC933E602626C6 KORTE?
143,590,524 *0DCBEF37562140387F35D050105F6D998E8CDE12 KORYCERMINARO
143,590,525 *0DC4856211AFBCAFF9DC2D53D2A467D447828E62 kotajawa5
143,590,526 *0DCF1403C474DAEE92F5D73D9C149E276A11971A KOULUAMMUSKELUTAPAUKSESSA
143,590,527 *0DCE83264053E0BD21305531040E237CEAA55C3B L#{C
143,590,528 *0DC41D4353F2F55F44469FF1D56412720274E608 KQQVDAORP2
143,590,529 *0DCA324836AC33E4CA31FC5B2CEDB242A41E177D kr7y
143,590,530 *0DC0949EA1CC76259C6244E762A1BDBFB2262D8A kraigsteverson
143,590,531 *0DC565C92A4E06E5E2AAADEC8E6BE7400BD155EC krisforee
143,590,532 *0DC0F527AB98AC056289B8440695E4A63E75FB4A LEFT.WAVY
143,590,533 *0DC6DE657068E1B2E1F72EF145E6D81844318A9F kruiddes4
143,590,534 *0DC8C6FD4A353F0689A32EB9C0D7C148AC4E8165 KRYSMELC
143,590,535 *0DC3FBBB3B7B2647785468F7CB53DFE2B3D78874 LENNYBARBAZA
143,590,536 *0DC364529D4B066336DBFF5B7349AB7ED2826DA1 kvantiseringsst
143,590,537 *0DC33A409D8AE392C687543132598CC2472BE0D9 KVI6
143,590,538 *0DCAC4A3DF6183E08CD78EBFDE93B732D52694DD LEOSCHEFFERT
143,590,539 *0DC50FC82753A90BFF28BD25902AED023DCD1CE2 lacedemonians.1.0
143,590,540 *0DCC69F1E4D48CC4F6DE0E1C7F3598B4100994D4 LEWIS.SCHOREPLUM
143,590,541 *0DCBD7AE38F2059BC7F23F6BB56797D46C4AFFBF LGPE
143,590,542 *0DCE91780AFBF24F14112CE36D8FF365FA5FF260 [email protected]
143,590,543 *0DC3F235111C801445FD2B39FC48D8CDA1BD426B LIKE-POETRY
143,590,544 *0DC1412FA760DBBAC9B012E778C8263D9C79530E LILACEOGRISEA
143,590,545 *0DC39D033EFFD6647DD34EABF43B84227AE3001A LiveInPolandAtBluesExpress
143,590,546 *0DCB43CDB37ACA1F25A1EFACAC5B15BAAFC06E20 LLEON1234
143,590,547 *0DCA40E7F138E7CE60019FEA02943FC011CEA0CB llewon-2
143,590,548 *0DC9650CA654EC2276EA3FA58C3E059CA84F9C31 LMERISTIL
143,590,549 *0DC58FF67F4B0925953590B828BC41173F1D4032 LOCUTAE6
143,590,550 *0DC46AD5F187029C1C4DA2F2812D9AA5751E158F love-among-the-ruines
143,590,551 *0DC8A86670ED9FE216DD4B1028400A556E57F159 LOYD.COSME
143,590,552 *0DCCD82D383BDB5EC6F2DDDD8127C72B875D890A ludes,bookii,xtr
143,590,553 *0DCB38676BC8988715D6411672942F3A63388AEE LANAUNHAPPY
143,590,554 *0DCD76E836EEA85CC4687433690465F4F309F01A [email protected]
143,590,555 *0DCB8DFDE0E60906573C244D7E8DBA5362D12028 [email protected]
143,590,556 *0DC29687B9ECB3D3BAA6BCB90E6B7E24AB804223 LUXEMBURG-LIEBKNECHT
143,590,557 *0DC9CB80E4F26404471E5285558B04F73806BD4C Lyshchyna-Haselnuss
143,590,558 *0DC7FC9D59FAC5599DA04C7C4FC9C136C21E162C [email protected]+35
143,590,559 *0DCF29B8A85A6CFB45D886EF7364360F1E1B7396 M4TRIMONI4RI4
143,590,560 *0DC69C0C6F2CA6CA54AFEF964C05C772E0BDC55D MADISONPROJECT
143,590,561 *0DCFC39D47071336BC72BF9826CAA770FB250762 mandy0513
143,590,562 *0DC8758EB98077673F421003866DD5A47F17D1D6 MANILAYING
143,590,563 *0DC8A5A0D3831D4A9269988C2EE14FF7126D44F1 manuellauerman
143,590,564 *0DC278C891AA72644326BBC6605A672F5AA38B71 manuelmcclenon
143,590,565 *0DCB9D844E89E514D8BB312FBD0CC5367DD174E2 latin1utf8
143,590,566 *0DC65BCF3BFD2121DBEA9B41C5BB7491DE02F70B lazarokintzer
143,590,567 *0DCB2233A67D32F43DAB8587B904D6FA27D12C30 MARIANOSTANT
143,590,568 *0DC6C4E70383A332F0AC7FD7CE31BA33C1D36CC4 maria.rooney
143,590,569 *0DC077851A37A97E3680020A4C7F5A34054A83AA ledamotr
143,590,570 *0DCCB71E11F43A520AFB591CDDE98787A919B888 LEKKMYŚLNOŚCIA
143,590,571 *0DC5F858E4D5051BCE125EEF08D039207BAB5AF2 leonardmann
143,590,572 *0DCBFB3550D610A4F710836C40DF946CF460A70E MASKEW5
143,590,573 *0DC3449EC8862E415928ECE789F136911F4F5076 LEOPOLDO.PISKURA
143,590,574 *0DC8DA1AD74F3A33D39AD7E823DA267D3942E19D LESKELŐDNE
143,590,575 *0DCA7406409B906EF9AB87C4E204B1422C33B3E8 leslieuchong
143,590,576 *0DCAC7F0D14918A6C772982E0970DE76AFE87F9A LES.THANATOLOGUES
143,590,577 *0DC18D9F10F968C305D545C31D83B94B9081D21A [email protected]
143,590,578 *0DC0B01A29456AD06F6CBFFC0880B6639F0BD6FD LEVIWENZL
143,590,579 *0DCB061660A88E3092E46A5E1A67F3E4B6209EDB MAURICE.RAMDAS
143,590,580 *0DC8F5B2FA97EAF60E4119AFD7F0DDFA574E1C20 LGO[
143,590,581 *0DC16B0EBD3FE9B6C0EBCEC3748734B32D0AEB51 L~GY
143,590,582 *0DCB529EBBE08DCDFF3C8F0009FF79734C4D9624 M_C
143,590,583 *0DCAD00785F633A38441560BB809DA0C33411880 mccamis
143,590,584 *0DC7B227CEE61F96D9D1E485619CD72894451EFA me:ActeIII"Sadirmi,scusi,qual'
143,590,585 *0DC0AD615F3D40BEA03B0D36DEA7A7F4056D4D01 melanie-tsoi
143,590,586 *0DCD71BC933A8BD57DCDCDA769FDB00B8F19EF47 MELO-MALAKI
143,590,587 *0DC313A3F0FEF17193422E26AB7629BBA44AC1E9 MENIGHETSSØSTERHJEMMET
143,590,588 *0DCB57A54E1EB9A36F0C635F32014DB6CE54DBBA [email protected]
143,590,589 *0DCF194F93710A6974D3AC282F88266ED05F794A LINWOODWOMBOLT
143,590,590 *0DCB27EA057892A4671725B9118604717AF2B58E LISA489
143,590,591 *0DCC9ACAEF17937691E7FEDEC7CC2472F0A2C1A7 [email protected]
143,590,592 *0DC9990141B0009C30229051D03037E252759DD9 MICHAMOORE
143,590,593 *0DC5F605F7AF43157ADBDE1431F92527C19E95B3 mikfgcxv56
143,590,594 *0DCC612240053EF90FEFAA1740A49ABD092647D0 MILA417
143,590,595 *0DCD88E00BC9B6E29119F325C529D4A027508398 LLOCNONS
143,590,596 *0DC639A48CA5996ACB2955AED98773CC78202832 l*mn
143,590,597 *0DC936781195CF139A5CFD66F8E0A742513FA008 locationhttpwwwnndb
143,590,598 *0DCABF49F7D2F512368D374E303BF50C68445F53 logget5
143,590,599 *0DCE16D8DADA2F60DB199F9314ABFABBA3558A36 MLAR3
143,590,600 *0DCEA16538B21E13D7D583B1E8A9F701390BEBCE M!$+LE+0E$
143,590,601 *0DCC0F416832A37FC80F6B574A53E6F2460D70B2 lonniemacola
143,590,602 *0DC9C8AAF750F4BB73C1E92F6907203883FF3E13 MOHAMMED.AIMBEZ
143,590,603 *0DC6AF9E5B897B5C55DCE1972D233454F8BB2253 MONROE.LARIOSA
143,590,604 *0DC36975EB5EF64E6E0CA8444EFDF7AE931BAC2E lsigl
143,590,605 *0DC8CAF3D3ADDE8102592F0DEBB0E6F99E9CF398 [email protected]
143,590,606 *0DC3909E333833D72C79A68A5EF5B065EC595891 LUTHER.TSCHANNEN
143,590,607 *0DC943B09EC6F7F36A6CBD7B0C4B22F4431E59ED [email protected]
143,590,608 *0DC5A1365CA8CF6FCA99D2BD412C83C63099D236 lyleturtura
143,590,609 *0DCD4A75E56EF52D3E6F1B610697E080CB6C0C2A [email protected]
143,590,610 *0DCA2EC95A86537539A80F95E40D8BD77FF1F602 LYMAN.RENEE
143,590,611 *0DCDA114847AAD8ED5324DB0DEDE728063519875 LYNNEMORLEY
143,590,612 *0DC3E4290663FD82008FCA9F0F7CC62FC0C02F5E ma9n3t!5m5
143,590,613 *0DC172ACE36991FFBCEF3A9542FFD519CA6B53D9 mylesvermeer
143,590,614 *0DC02FDD1F0A0E1BC47B90FD7200A1A2314F496A MYMARINER57
143,590,615 *0DCCF8FA9F5C73510A81C43764CEE26574772F38 MYRKYILLING
143,590,616 *0DC5886CE88E9BA5AD75FFC52559B3AF48CE8609 magic5252
143,590,617 *0DC51995BAA2FF463C2C50DE223B631DDE93741C n130=dcc send:/dcc send $$*
143,590,618 *0DC9C004C183F11845174B029AF2F1D722836D4C MALADY'[email protected]
143,590,619 *0DC28A5939AEED90B9BCF5989DFF9A562A09B042 MALLEABLE.HUMOR160
143,590,620 *0DCD13FF6F657CB732D40BAE1C4232D6EE42D8AB Mangle-0p
143,590,621 *0DC3A1FFC1A508CDDB2BB4D133735866080B6918 MARC.CORWIN
143,590,622 *0DCCCC9300FFF29B6F868D36E1FFF2A864AC99A3 MARJORIETA
143,590,623 *0DCA3F54B878BB394F86CF2FFE687DBFFFFAA81C martinterlecki
143,590,624 *0DC5841842CFC49227EC2F66F22CE4AA6E266D99 NEALPETROCELLI
143,590,625 *0DC44E269C3C6D4F34B0F920424142E4D1195727 NE-APFEL
143,590,626 *0DCB9B6104796C1B4EB0D202356897B9B48FA88F MAVIETOURNEAUTOURDETOI
143,590,627 *0DC06A61E192727F8ADB8E75742090A51A619C77 newsdis3
143,590,628 *0DCDCF3DDDFD69987F733D9CC97CCD82C2DBEE32 MCCARD
143,590,629 *0DC9ADF26AC7000F2C65CC2390C6DF86C611E25C MCKINLEYOLCKHART
143,590,630 *0DC1C14A33256C3CC085FC335E9A233DA34EE604 nhospitales
143,590,631 *0DC65C3BC140602BA4A0755276973EA269F077A1 NICHOLE MCBRIDE
143,590,632 *0DC6C77E98A8F69AA1F273E33E63C7F85175A5F1 NICKMOOK
143,590,633 *0DCDEF8AEFA9826C82B46C1E3263658D9651F49E “menelaus
143,590,634 *0DC9C51C84107DE3E57A0E267DEF919CDCF20ADE merciere0
143,590,635 *0DCE88B7FDFF367F682D6C8D88841AE545D996C5 MERRILL.LANGHOLZ
143,590,636 *0DC40EAD0A8AD23FBB767A65A9EEB555C0C9CFE3 MGARDARSDOTTIR
143,590,637 *0DC4CFC90A086BA1F820B579D4FE88D3934BD799 NOAAA
143,590,638 *0DCF491E1859140CA598863A154D62E68914EC78 NOEL.DEMOSS
143,590,639 *0DC25566DD2BD58A1EC52A0C8CB1870C75BB1BDF MICHELLE-BOATMAN
143,590,640 *0DC3B5DF4702E4772472CDF6F39BC0E7BE7D3EF2 MICHIGANPROTECTEDAREASTUB
143,590,641 *0DC321E6774E7C1C348C1EBCC0834EA1283C57E7 miclose6
143,590,642 *0DCB18035D944EF3D76FE06DA7B56756D9F7ECF3 non-gravity
143,590,643 *0DC7AB66A5DAE4DCCD99491B6EA6B7E0EB16E84B MIKANUNSHUMIKAN
143,590,644 *0DC64C15EA2E58EC6C02470BE73EC4144BBA441B NORRISCORTESI
143,590,645 *0DC95D137230BAB3250A1F93AE2FE3D00679AFDE norriscouzens
143,590,646 *0DC99CC895B5916BC518498F6578C0A5C5CA4C7A no.tengo.klaro.hazia.donde.voy
143,590,647 *0DC40D78BEF05C0CE7844C4276CB92FDB83F3000 noufalqahtani
143,590,648 *0DC459B47CE8ACA02E24146B8F48691C9EE27C43 millionronald
143,590,649 *0DCE87639B158402DC0751C10D34CE850B41EB08 NR9612638
143,590,650 *0DCD336F938A322687A3CB197BB40EB7A58A8A64 MITCHELBERDES
143,590,651 *0DC41A258480E11833D11611A7D0F6AE269D5670 MITCHELLHARNE
143,590,652 *0DC1AE0A017093AD7EBE3473A1E02289A366FA69 mjuf
143,590,653 *0DC64B53639B3EDC833F09E0E100CE9B0B5FDC1F nuttishn9
143,590,654 *0DC912512757213D55CADFCC532026E217FFECE1 nutwoodn
143,590,655 *0DCF925C5175DD6335DE50F1F99F913A8FFF8487 [email protected]@[email protected]
143,590,656 *0DCBC8F4B06C94BC931B202EBDF65DCFFFA8C1D2 Moments.(The.Matrix.dub)
143,590,657 *0DC5E969DC99EC0ED0C84CD2129E99A3D6EC6BD6 ofallDesperations
143,590,658 *0DC7FA5AD6C85ED41AD4F594814F17CF9A842BF6 moralvaed
143,590,659 *0DC7E5EEA223E965507BFEE038FFA4ADBD0E52F3 MORAZAQ
143,590,660 *0DC68E77FDC4064555613EE11F0B27760364540C OH!外人部隊
143,590,661 *0DC906A8DC92F67C68703C777F81287D0F100BF1 mortonashman
143,590,662 *0DC917C1D703C15FD5DAAE98DC97BB1C1BE55C57 MOSESBUTAC
143,590,663 *0DC04CF4B3B41C23EF1579B3F42315CE9BCBC1B1 mrcobz
143,590,664 *0DCE5F47A4AB72C2BC355820F1224EA6A9B79CF6 mreggirt
143,590,665 *0DCA7D85CA2969D431F699044F4E0DBEAC94BA56 MUDDINESSES
143,590,666 *0DCD31CAE460F4D5C755F885A322C95E674FA07B [email protected]
143,590,667 *0DC251070A6E4D2033D180E20F9F0A11AEF72A9D myboyzrok2
143,590,668 *0DC40218A3ED2A2391F7DDC40557CABB224E2D67 MYCHARLIE154
143,590,669 *0DC162704C9723F987142A58A6281FCF3CAADF16 myheadphonesaredeadtones
143,590,670 *0DC33BED16D055FED1CB83A184A97E07251B44FF [email protected]#
143,590,671 *0DC9E74196C5B0939257865A318F69ED70E26CCB My-Liquidator
143,590,672 *0DC839AC071A15F4602317259B446E5ADDECF9C2 MY-PLAYGROND-(ULTIMATE-RADIO-MIX)
143,590,673 *0DC8B988E61D90E0E93F01A18318DD3A168F7D23 N86-844494
143,590,674 *0DC25E6CC0C4D208BBDD8219EF449AA00AC72A70 on-fait-l'amour-(extended-version)
143,590,675 *0DCA22856787A13AC59962A11F4846FB928F1798 ON THE PROWL (B)
143,590,676 *0DC1E193BD6E48C02936F9E5CC9BCE625E551612 naamrub1
143,590,677 *0DCEC231BCBF28D81D1FF15A00781DCF7F510194 NAJNEVREDNIJE
143,590,678 *0DC4DF383AF2CBFB487C113E7F1A1B9458C5CD64 NAMSSEM
143,590,679 *0DCCC5C85D86595EB75056738E8BA20CF3927BC3 }O{.O~.O~(Q
143,590,680 *0DC74D77CFFC6380793CF11677AF14C4FBF24682 openingnight(reprise)
143,590,681 *0DCC4810D7A99ECCD4F970A079D4863494744580 open-(MESSAGE,-&quot;|-mail-dave&quot;)-||<BR>
143,590,682 *0DC38053B5388D990C9553EA915847A8993A8D3C OR9AN1ZA71ON
143,590,683 *0DC7703DFDEBE134D12A3A45829B0D46ED31E139 NATHANIELMORINVILLE
143,590,684 *0DCF68B4E11FF61AEF1EE3EAAD4AC4E7752BD158 „nautical“
143,590,685 *0DCFA2DBFB969C1D57E10DB4902C7C2E62B53E87 OTCS
143,590,686 *0DC3147965B795C71E3370A0B397A12A7DE6C404 OUTOFATLANTA
143,590,687 *0DC9AB76E60CE0E1563207244E797C03D67FE8D7 outrer2
143,590,688 *0DC23C74C8FD26D984FEB4949747C552ECCA75B2 OVER&OUT6
143,590,689 *0DCE0C60A3C435E99DCD5917E1A2B34F3E5A7EB0 nelsonlashutva
143,590,690 *0DCB1B0CF3152F1648A2F731CBC206E39C8AE534 OWEN.STINAR
143,590,691 *0DCAEDF89962E75EC10ED046407A84FF7C3CD6C5 nevergotenoughofyourlove
143,590,692 *0DC30EC4F7B992D49AF17DA6BA4990DD65DEFB57 p3cul47!n9
143,590,693 *0DCF1DC476A23AEC49B9358710B3F7A49223CD63 NICKOLAS.JOLLY
143,590,694 *0DC3F8B8DA75F22469A439C8093E4AECCB3CF3DE NIEMINENOM
143,590,695 *0DCFCF22BCFE0710A22F45D185DD4F4442C8B7D7 panik2001
143,590,696 *0DC20AC2E70B2F25DE348050941A7D997AF98163 parkerjane
143,590,697 *0DC24A7AB617DD5845F8A564568B3F7D32A1740A paschengesetz
143,590,698 *0DC6CB9926ED96510CBD8E59FB363653F18E2FF4 NMOBERLEY
143,590,699 *0DCB9C8ABA09335DDF18CBD33A6C3CDF0EF6D63D NOEL JAMES
143,590,700 *0DCC01C2A7BC77792700B0DD5F6C63C277EE99C5 NOLAN.FARRELL
143,590,701 *0DC01FD7C9BD7B1ACF33BD2485C52A75BB91D786 PATRICKSPRIGGINS
143,590,702 *0DC1071342347BDBD2BF46CEB5A48FEEB88D16C5 normanboal
143,590,703 *0DC848B8660EBB3DAAF20C497A4F70FD2C84EC42 p----b ~ (0_<)
143,590,704 *0DC8F49952473342446E78B75DBCA36B7E1FC830 NORULES'
143,590,705 *0DCB64AC524F37C88EACBB52DF2BF5E61DA1DF0F pccanada
143,590,706 *0DCD4276F178DAEEFB424F48D11D4FED5F3B9728 [email protected]
143,590,707 *0DC79D7CE437DF823DE54057EBE4EF342F00462A n`p[
143,590,708 *0DCFA7563DDB686BDFF73A66FBC64BB511708B54 peharom6
143,590,709 *0DC46577D9E5D92FDCC6C3293753D68EFEB6E751 NSTERHAMM
143,590,710 *0DC287D67D9A9D58FC4838D4E3EF28B67907264F [email protected]
143,590,711 *0DCD0D4F848B8A2C4782B2580D3749DBAC1991EF numberswyckoff
143,590,712 *0DCBFB148F00166DCFF5E326B6AC9229B02C6CA7 PERNILLAHAGLUND
143,590,713 *0DC3708812EA2ED8DE9A929732D6C9A5D752E3AD (>_<).O~.0~.Q#####3
143,590,714 *0DC388F967483606A6AD39D2B3258F50A82C64DE PHALANXCM.COMWWW
143,590,715 *0DC3440ADB234B3A23357D3F4FB9B3A662FE4A32 PHATHON9
143,590,716 *0DC76CCB58B2D9971AC4A3FD089F3CB91E3D112B PHIALFUL8
143,590,717 *0DCC799D81EF6F9FBF611AFAE79F4046618F88A8 ODIS.MILDER
143,590,718 *0DC3853D82A0B63BDB4F33682A12252BAA81A2DE PHILLIPFEATHERINGHAM
143,590,719 *0DCAC8DB9D632084E054BBD98E413CE0F4BCAE8D [email protected]
143,590,720 *0DCBC45386236691BEA71FA0A5E597EBB959E42C ODPLIVLA7
143,590,721 *0DCD6C570B80DC9CC5C6AAFDB6B2B14288C3655C OFFENSABAMINI
143,590,722 *0DC9CDD228FFCAF4072B507D0D5C35B287ECD908 PIERRE.SCHEU
143,590,723 *0DCF29CC35600635938624564B3DFF418EC6DEC7 pifeedback
143,590,724 *0DC6AFB5A64E5F931CD0B0F3AB789CDF0CDF874D oirsbeck
143,590,725 *0DCD541DD23EB5DD1BD3C5539A1D7152DB6073BB olenfujii
143,590,726 *0DC5DA48E3E01227C292A34BBD22C9ED09EA0483 OLIN.TEIG
143,590,727 *0DC7876089CBA296ED7F65F326679EDB3B47BA7B OLIVER'SANDTWOBEERS
143,590,728 *0DC158964C8635E8C23B72D4CB4B7E52562A39BD pin.r4ck
143,590,729 *0DC1321AAC89008B5F758E191B6FAA64898B9CA7 pitesvat0
143,590,730 *0DC166BA9C04CF424561F55CD78A2A3BB368A5C1 OMNITHERAPY
143,590,731 *0DCDCD129DCC741BCC6909A9AD44A77F222545D0 ONAANNEMELIJKHEID7
143,590,732 *0DC9F6759D1A4D037E0A5B8BC6C22CA22A48D6A8 op33no8incsharpminor:grave
143,590,733 *0DC9CC674E2E588C14D717FBBC85CAD06143DCC0 OPACSKEDERID
143,590,734 *0DC7F7500C8639A8486B338835BF3C79703ED0B0 POETICISES4
143,590,735 *0DCD5976A83BDC063AAD15A88555E97255128CC9 OPGELAPT8
143,590,736 *0DC9A978CD0E7DD0FC56819DA43D8B3233157E70 OPH7H41MO$COP1E$
143,590,737 *0DCA8AE1432950A1F8377AC1511096C0CBB090C4 [email protected]
143,590,738 *0DC3183D323F4589E3CA94997B7FAAA3A1A69DD0 [email protected]
143,590,739 *0DC3622ECE57EDCC79096FEC3B596D98FCC016D3 [email protected]
143,590,740 *0DC816CC8FD34DC3B66DD5BDC42B85FDDD303F30 PORFIRIO.SHARIF
143,590,741 *0DCF68952B59295CF0C6324390BDA3D79360EEBB OTTO.JOLIN
143,590,742 *0DCECF12035CA365E82719A2AF76BA33D015E46D overe148or47e5
143,590,743 *0DCC78D8031693E831B1752C13BC03174BCAC0B7 OVERHELD4
143,590,744 *0DCEDE07E29F661E7153ACCD93BC6B79AA9EDFF3 OVER, UNDER, AROUND AND THROUGH
143,590,745 *0DCA84630311A0EAF7FE61656853E1EF65392EBA p{$
143,590,746 *0DCE13B7992A8ACFE71B133DC8EE927B11DDFD66 P===>*-(0_<)
143,590,747 *0DC248BB45BA38D2B7A46A4143BBAE557998A13A P01YPHY1ETICA11Y
143,590,748 *0DCA38314B6AAA19CBF4662333CF7C99CB6B6397 pp~0splat
143,590,749 *0DC26B097DCFA0E8CACD4B30E3DA6C5010B991A1 P3RSON1IG
143,590,750 *0DCA84563CF5FBCCD28C6196CAE3F0A122A447D5 p4r45+0109c41
143,590,751 *0DCE54BBA9615C5DB8387E9574D9D44C78D2C862 PR0CEDES
143,590,752 *0DC167B216CD4C75D8C75DBAC6EF7A314F8804CD [email protected]G10SPERM0US
143,590,753 *0DC2CF6B389C1533646CC2000C4ED2EBD0167C67 PABLO.MURANO
143,590,754 *0DC18D53745EF7238C2F7E13477B79D7CC52CE11 pamelarueda
143,590,755 *0DC75D186D2E1328368C135442DB2F80FA1B2D44 [email protected]
143,590,756 *0DC5EC42D1E12A399F6FDE0434E7215D38C878AA PANZERSCHRANK!
143,590,757 *0DCB1D824F7D5EF37939A4FA3EC2ECF0E30BC7B4 PARAETAKENA
143,590,758 *0DC164A6B18256B3DC0076C9FE14A5E7FDC62C92 PROPR!E7RESSES
143,590,759 *0DCAB532A165EADFD9FFB563E74D25F2462C6869 PROZ3SZ
143,590,760 *0DC73F3D2ACE5872D2DA4658A3F81C3C5F2E2224 PRYTHERCH-2-0
143,590,761 *0DC0CE4880862E3E443EC7595E1E1EC0F8C728B5 PATRISSA3
143,590,762 *0DC49B7B08143FE6B7AA2471CF99994912101B17 paula.glodowski
143,590,763 *0DCEFC853115AF15A17176558DAA09D47A932E8C paultopher
143,590,764 *0DCEB5BFC97B7570CB65E348F05B23CB86154E6D puromosy
143,590,765 *0DC0729DCBBD584212F07A5A00BCE94212F92058 p======B~~>-B0
143,590,766 *0DCD8D41E2E2C013AACB9B5C95E1FA6E9CF71D3D PYINNYIN
143,590,767 *0DCEBD91A4A171BDFF059B0A2ECA99C1164BE60C (~_^)~(--q
143,590,768 *0DC036D318C7254E3A890957816357236D4B50A5 Q######)`~.`~>-<
143,590,769 *0DC21875E9E84F1313C0037C0A08AF3B8D9C571F [email protected]
143,590,770 *0DC4535F462CC1B91F1B3063ABF48AC969185642 qajarit
143,590,771 *0DCB2BEA35864C9D9E2C2D6A75510D85961F2435 >-<~-`q===b
143,590,772 *0DCEE41F0BDC464559F148B4239BC66735A35D32 q;dm
143,590,773 *0DCE371A224EBCC8CD00BE62B5C9981214975DC1 Q#####D~O~O)X(
143,590,774 *0DC3B8F3997BA2FD44DDE153C3B76EA2CAD524C5 q##d`.:p
143,590,775 *0DC8AD507FE16620DA605AEFE363F2FE42FF4668 [email protected]
143,590,776 *0DC83627831C050C50741163D26A160A3F1EA214 qrwqeil0
143,590,777 *0DC51590481A462780AFB1D42FC12308BA5BA039 PETKOTNE
143,590,778 *0DCB315011EBF5308ED9A0FD88EFF0E5C0819C81 QUINNPACIFICO
143,590,779 *0DC7F8F6BB33A997419201B5643C86ED3D9D866C QUSQU'QOSQO
143,590,780 *0DC56DE7A7D2A35079BC1632DB82EE38A86C72FB r0$1ne$$
143,590,781 *0DC3188C506E78BF7DD1A30E1A3250F5C708F4B5 r35!+u4+!ng
143,590,782 *0DCE172C1C22E4DFC998548C28B50E5C9EDDFE32 PHLEBECTOPY7
143,590,783 *0DC740FC8F78BB8875BE6D83AF7DE4180D1B31D9 PHOSPHATIDYLSERINES
143,590,784 *0DCFD30D7D0EA23871E556F374C4EA20D6A29D95 PHOSPHORISTERS
143,590,785 *0DC21881DEBB2CE3D581D394D8933FDEDEAC64D4 pianosonata,no15inc,kv545:allegro
143,590,786 *0DC25EBD0AA24086812B494B36003F99E3BD5174 [email protected]
143,590,787 *0DC5176E02E7B9E925E569921FA4D1E59D2D6688 RÁDŽPÚTSKÝM
143,590,788 *0DC417C4157584093703AC3918AF7DCB9C4F8F99 <p>internet-assigned-numbers-authority
143,590,789 *0DC8827464146555DD082B53C9DD208A1151B957 raleighhamer
143,590,790 *0DCB11AEB63839E28366F09F36BE05507A3CB247 randydoussan
143,590,791 *0DC32D6DF992A141D4320CF6DDE201524BF9F216 PKAP
143,590,792 *0DC66F3599EE9474C107FCE10E379569883FB099 [email protected]
143,590,793 *0DC2E1D6E7E852226A5C29858C6C5A1049D0F5FB RBJDSTDING
143,590,794 *0DC29DB40863B8B09871E83B7743C2E8891E3E8C PLE8E5CI7E
143,590,795 *0DC429913467BC7D29CBEFA967516D3EC1ED5202 PLEHVE
143,590,796 *0DC313389EF63831AE5BB3A66DE80DE7403AC6A7 [email protected][email protected]$
143,590,797 *0DC60DA597385736DF38D49138E486E3877258BE pommetty5
143,590,798 *0DC0C562BB8FDDB9691593B509E144621CA8C6DB POP.ALEX
143,590,799 *0DCCAA6829BF9F9D8E75C98BE66E36A3A46DA6BA POPCORNA12345
143,590,800 *0DCF8073AF51199E7BEF311F08015953739FA07D PORFIRIO.ZEH
143,590,801 *0DCC0D663D7ADEA055243AA19C00F3D45E7EEBE0 pose.pas.de.questions.(feat..fefe)
143,590,802 *0DC3DF2B5DC7EC2371E160294D86271838AB29E0 POST-PLAYOFF
143,590,803 *0DC2375BAF6F54C3B85085E3E5181A5770AD3D5F REDBRIDGEMAP
143,590,804 *0DC0ACD6A89780FC1F4CECB0937E9367C293D54A REDEN-SAMPAN
143,590,805 *0DCF254EB1F3BFB96BC4E44C88BB712DAA293E39 pp~0splat
143,590,806 *0DC26B097DCFA0E8CACD4B30E3DA6C5010B991A1 :p ~` ~`qq
143,590,807 *0DC72F6958DE2A78A1021F75C728B321E57CE4E0 PR3$T93FU1
143,590,808 *0DCC4FFD7219A986774CCB7C5A61DB08E93592FB PREA$CER7A1N
143,590,809 *0DC1A8A92DFA24AF5538AE65EA5F48C6E1A3734F prem.love
143,590,810 *0DC8FA73E68B90DF7555FD957304B71303D6C463 PRINCEOLA
143,590,811 *0DC29800FBFE86695E79809C9ACC8D06EF90126C REKJILGUEH5
143,590,812 *0DC0909DA715E8DE1FF147ABA9C746B9A73B7193 prodomonantly
143,590,813 *0DC7A286EA555AB672FCC10DBC3498505341668B PRO+E5+N9
143,590,814 *0DC42EBE848CBE5AAA08D924F1AF7FCA58253F2D remya.retheesh
143,590,815 *0DC577E61BB12A3B9109C22B329164CB42F3248C PROTECTION.VOICEOF
143,590,816 *0DC318C80EDF6FA455F46C1624AD379B9643A162 prulicted
143,590,817 *0DC1E552A0E0008FE680C2C464196B16641347B7 [email protected]~`Sploit
143,590,818 *0DCF4BBF465FE1803DF499DE614F3F76A7D3CC63 pswd0121
143,590,819 *0DCB83BCA4A993AEB83033307B9F7412A52B0493 PTOLOMEOED
143,590,820 *0DC2BC7CB1B2AE10C9BBB5BE3F882BFB35AC1FBA RESISTOBEYOFFERS
143,590,821 *0DC8C6DC47B82E8353668219F224F90D00AAC281 REUBENARNERICH
143,590,822 *0DC898E400E4C96F77F31529C7C0611F3468A6E6 REYES.CHATAGNIER
143,590,823 *0DC8B05E496800E06A7B0437381D96C476AA40A1 PV;|
143,590,824 *0DC9B6233D2507C4B3730903B0FE6808101B0C76 PWIJEWARDENA
143,590,825 *0DCDB11DE0AB9E809F16E47627C83A040464E657 rhaskos
143,590,826 *0DC7E0D475B7DB6B792674BD9D2F1EFF13BFFB2F RHONDASPIKE6
143,590,827 *0DC1FFFECBA8CEC6CDD9FA78B48639B7CE7F32DD %q.aaa
143,590,828 *0DCC2EA9269330DE0006456CC35C4C7D2AC0B5A3 QADARITE!
143,590,829 *0DC464C1C393F5F9E4702EDD61BB28FC61F752ED qbprlst84
143,590,830 *0DCA358902A0D74779D8D57A98AEA3D96CDA9CEB rick-saria
143,590,831 *0DCA6D64BCB96DF6F89CCF31BB9FD42D4C0B4653 [email protected]
143,590,832 *0DC39285556F7410B821008D24AF00B9445563BB [email protected]
143,590,833 *0DC86007272C49ED1E2F226789C67DBAE2B90377 QUAKILY
143,590,834 *0DCB7765A2543608CCB122BA4E82B6E56D711E73 rklavierundorchesternr.1esdur:allegromaestoso
143,590,835 *0DC58F8FCDE8A581D66382B5D68C73FA070688E8 QUIPANTS1
143,590,836 *0DCFCE1D270448E4CED881BE2F3B7EAEF5802E51 RMARPUNGU
143,590,837 *0DC9D528EF2A9120C0CD8A85ACBC59ADF49C8780 RMPU
143,590,838 *0DCD414C4CF4BC81F903C05F9B14FB8CAF163BE4 RNNRMZRT
143,590,839 *0DC24AB4647C0923ECD0EEA7107D6FBB2BC60347 robbie1234
143,590,840 *0DCF6D14B0EE124C6ABA96D496207F98FE80A97A ROBBYRAFALKO
143,590,841 *0DC82A9B0AD2D675BC6215AB73AADE867061F855 robertashpole
143,590,842 *0DC7F63A5254D5CEB8F1345ED187AEEDFD7EC9C7 r35tora81l1ty
143,590,843 *0DC3F81E1C408C0A9B00C1BCE0F77825C7B6A807 r3gurg!+4+!v3
143,590,844 *0DC08D86203DEFC4EC20C31EBD5BBAE5CAAD8700 ROB.FEARNSIDE
143,590,845 *0DC94E648C02F6458DE4912E60078176751B2665 rachelle-raymond
143,590,846 *0DC1C7DE0A6A22786878FDD84588BFB432AA992F ROEL-RAMOS
143,590,847 *0DCB11FB1363E665B0A1EE343192ABF279660305 RÁTALÁL…
143,590,848 *0DC5603FB13F71D518BC86745B03D7B765762FD1 RBHABANANDA
143,590,849 *0DC9EE199CF5CC1826A4C090E6705F11644DB060 RSF1980
143,590,850 *0DC90E5F3373EA79DEC12D29CB7436B3B6744C7A RDAERAH
143,590,851 *0DC1161724BE6E9A0D54628CDC5CD232F6537F56 R.DOM.SVAGA.OCH.ANDY
143,590,852 *0DC738DBF61E93F70DD87354D4DAA60C88A0EFD8 rdzyktf7mjkko
143,590,853 *0DC1BC1B8E622C90755B6C246649395AECC0CCB6 READYTOROCKROUGHRHYMES
143,590,854 *0DC082A7DB65D2EB82CB777BBA6502EFC0C8A6B8 rudolfburington
143,590,855 *0DC155C0CB33949C5DD03BBE59AB80A6286DB645 RECALMUTO
143,590,856 *0DCE61FB29A5BC359A335ABB571F0476BC64F106 RECOMENDAREMOS9
143,590,857 *0DCDCD4500536E3C1FDE4C4B0E436320DE59B248 REDELIVE8
143,590,858 *0DCD1A87F629397502EDB44F43AEEDEF7372244A REEDNUSOM
143,590,859 *0DCAE49BC3AE33E023924C86144435AB8225CA4B REENKELTBRUGERINGS9
143,590,860 *0DC216F64CDCC1EB8A1D1882D9FE01F92DF95BE9 R.ULLRICH
143,590,861 *0DCC411FEA6F278867EC1A0C0F931FCB24E4AF6E RUNFORTHEBORDER
143,590,862 *0DCB8E182BEDACA916F8BEB7FA629FC5E7559AAA RUSSEL.GOULET
143,590,863 *0DC4F9375793CCB945DF28B96A60B22941FDC998 [email protected]
143,590,864 *0DCBD4ED7D7745287321788CF242E9889317FA46 RUUHKAMAKSUJÄRJESTELMÄN
143,590,865 *0DC850DF2C9111C75FD75613A849735C9219EC1C reginalddallison
143,590,866 *0DCE1D55F2EBF785771154C898DDED0A588B6620 REGINALDGORDEN
143,590,867 *0DCD46FC336498F6D6CF5F521C60AAB191D80596 [email protected]
143,590,868 *0DC859F5F32CE08C1DAB754AA51A51AD54B0BF54 REIDPLATEROTI
143,590,869 *0DC09F881E74BE86EE949E3C487829A5C5D13DBB REINGRESEMOS
143,590,870 *0DC0C47E38296382A7BFDA6C22A1AD7C2E3C9D52 s0uvenirs
143,590,871 *0DCD6CBAA59CDAAA7FC7DE326B776BDC57409666 REMISSES2
143,590,872 *0DCDCB7B3202BFC084DA7B1C2800A5BD290A9A56 RENHSANS
143,590,873 *0DC6D2260DEAD3912AEFC29828EAAD19BB79206C SALOME: "WAHRHAFTIG, HERR, ES W
143,590,874 *0DCE46036484013F147D952BDF8B4FAD4FFEA778 research13579
143,590,875 *0DC080A4BC23035009F9A1074FCE89EEAB5570C0 samirk2
143,590,876 *0DCBB7A951BF3A7F4054C77835E2FD11586940BC sam-manicom
143,590,877 *0DC65607D23DAE753874EFE42A1AB64911245949 reubendaniell
143,590,878 *0DC51B78E529283F52EF6727612C174B8A2E0ABF SANDY95536610
143,590,879 *0DC6BCF4C56E0F92540A28814E1DFB40F58248BD sangaughe
143,590,880 *0DC80D0C4289EF9821E7F16BD2292CDA20369172 santiagocave
143,590,881 *0DC0CEDB02D048481F1E0BF75C466CDAAAA1354C SAPPHICS
143,590,882 *0DC5D0BD32ADC16E5B21EAFD113E6BDCCFD03194 RHOMBODERELLA THORECTES
143,590,883 *0DC3B37CC407940E440159E01BA0F7C2BC8F1D12 SATRÁPIAS
143,590,884 *0DC0AC45F85C554951E5E341917DBD0351EAEF3B ∞SATRE
143,590,885 *0DC69A5F710E45CC304FA2D4BA0D9D59C32B67E3 SCALARCELLS
143,590,886 *0DC0A4BB84C5470C40D5C818C721983BE5B72357 RICKEY.SOLLOCK
143,590,887 *0DC5BE6092F88DB70E22F7B8374390139B34F18C SCHALLENS4
143,590,888 *0DC5059462F9E91F07C95BAD57429F917273DDB1 scheitelkanal
143,590,889 *0DC131BDF4F3C70A178BFE9D339F711BEC7C9368 schodzed
143,590,890 *0DCA4770E1E8486A1AD913DCB214DB390CA2C640 SCLAVÓCAMPOS
143,590,891 *0DC1B225DC8965CCA14F8B618485C990E8D6F3ED SCOT.PUTHOFF
143,590,892 *0DCDE5E2DDB17632F9BA3E25C0A9E951B02F750B RITIWAPIFET
143,590,893 *0DC3AE002E149F7B2AE143F13FC06C331103EF3C seaymar
143,590,894 *0DCE779C17BC003C638054C13B31DF573738A993 SEBASTIENBERTEAU
143,590,895 *0DC0C90A1AB321F00CE431248F86CBC3779D8498 ROBBY.ISRAELS
143,590,896 *0DCB140CDAA5FD274EA2BF1BCAFBA28845A949EC semandf0
143,590,897 *0DCF5C868763DBE65AF94157D15AA8E3C9546068 ROBLEJO2
143,590,898 *0DCC9127B70FE475FFD6D5FFFB63D42B0BD6DD74 rodili
143,590,899 *0DC067C18CD43B56A99882FC0D87533FD2C7FFAA RODNEY.BEARDEN
143,590,900 *0DC8FB81CF7A67468352B42DAB15BD6949FA5EC4 SERVICE.27
143,590,901 *0DC1B521D0DEF6160FED8C9FE179CAE7C9F9FBE7 SETSOLMR5
143,590,902 *0DC90CBADF1018CEAE56DF5ADC8477E4F3BC3D1E ROLIASNIATNUOF
143,590,903 *0DC373041904FDFBF8B9D4119BBFF24A59CFBD8D ROMANISEERDE5
143,590,904 *0DC15729ED52EB09D3B2C81128D2D5E3CCE6CCB3 RORYINHO
143,590,905 *0DC35B571C0ABD7FA9A4462FB4BC4C9321F695BD [email protected]
143,590,906 *0DCC8FC06B5A47237CF760982964D636F9E431CD ROSEOGRISEUS5
143,590,907 *0DC908B345BE311897ACEDD3ED0EAEB7BB040D4E SHAWNDELAND
143,590,908 *0DC53173ADCC5BC8EC7EF3AA643F37835D526151 SHAYNELAITY
143,590,909 *0DC62D82E96F7667F14E560A3A7213CFA8F20930 SHEBIG
143,590,910 *0DCB7CE032AD7EEB7A86C5D8294C52C4D568C289 rowena-pepe
143,590,911 *0DCBB9DE1B0375B2A9ABB85494DAEC3B260D3DBE [email protected]
143,590,912 *0DCEF55984CBBB3B43299FE3F85EA0ACBCF0F465 ROYOLDENBURG
143,590,913 *0DC718E1632A9487B72D9783CDB6AE8346AB7D87 SHE-WHO-CHATTERS.BLOGSPOT.COMSHE-WHO-CHATTERS
143,590,914 *0DC64960DB970F951391AFCAF55CB081CB581D46 RUSSDUBEL
143,590,915 *0DC1593D4E89B29B198ACA4D809B0F3D0384954A SILAS.SLEMP
143,590,916 *0DC799ED45A9BD1BD5EA5E3B7934F7C8F0BF9BF7 RUSTFRIES6
143,590,917 *0DCD3B43077B213F5BE4F5AAFFC92984AE8E7E1D sirskilpadde
143,590,918 *0DCDB55E9A023AB974D7EC3830A4EE6346EF0321 sitidrac6
143,590,919 *0DC6F765DDB05C6F72567D6B97A31AAD71820CEE SITUANDOS6
143,590,920 *0DC288680C874B7CA8734ED59CFE0BB16D55BFF0 SÅ1928
143,590,921 *0DC6AA382AB543A73D0CE19287FF7666D730A35F SKCARKOOB
143,590,922 *0DC963C0E65043195A6D673B4C5346D0F480756A saint.hilaire.delac
143,590,923 *0DC9B15F05C1FC33170BE2F31C56DFA9FF712564 SLYHOFF4
143,590,924 *0DC8A45560A4A5FD501AC4A0F2DE678A7A404A78 SMILEYGROVER5
143,590,925 *0DCCA1E466029A5A9F3EBE19C49A2ADDAA1B2B07 smurfitbaxter
143,590,926 *0DC4CABAB77122F007D880115C597E4E88D00D6B [email protected]
143,590,927 *0DC74EE3C51882744DC954E343EE0F38764FC9DA [email protected]
143,590,928 *0DCEDBF00C7B33F85898B8FE57C77B975D39CF36 SOFTBALLPHOENIX7
143,590,929 *0DC355C942CCE5B065E407829C8E37766F84537B SOLFATAARAT0
143,590,930 *0DC9A2B36241CF5DCB8B5AD8497D0037112C2CDE sasha617
143,590,931 *0DC30BFBA83149656F65FC2CE5639D9CB122B926 sauldenzine
143,590,932 *0DCEBB804ED27BF4294543CABBDEDF2A880001EF sayrafied
143,590,933 *0DC77A69F4D72F9A1B0403D7802BB94A16AB5A9A [email protected]
143,590,934 *0DC8A64F95B7B408AC5E213ACC7EA4813C20F6B7 SONIYAAKBAR
143,590,935 *0DC9B8058BD568DF929B52E0FC6DAA4F8BE1403D SONNYGOAN
143,590,936 *0DCE21D0BFB5AF9893B1381B190A262FAA41575A sceptre
143,590,937 *0DCD05A21D85BB73FD37138F4AD9880436DB8F93 „schellbach
143,590,938 *0DC9EE1DB918C442947C8E89E5A0944346C91E7E scheurkiezen6
143,590,939 *0DC00F6DAC190EEB009083577F1DFDB16046F93D SPAARFONDSES
143,590,940 *0DC9BFFF08FA4A2E5B55DCDDD39D9DEDACE482F8 SPENCERGOFORIT1
143,590,941 *0DCF1F4BA00D897E033A03881033DC4440F9BA0D scottiemuncher
143,590,942 *0DC93C1B0B5EB70FF70DB27C37463D68CEA29EA1 SPICE GIRLA
143,590,943 *0DCD2D1A0FEDF7AF56D5BDCA6BCBC291CC034E77 Segun-amos-aremu
143,590,944 *0DCC26F96A580E64BEB0B6E62E6C1F5914BD380B [email protected]
143,590,945 *0DC6B970319C8C5A659557F6E257C4BD716465C8 SSQ(
143,590,946 *0DC4E466EBF5F6F77EDB646D6FA3C88340928513 seques7rable
143,590,947 *0DC10FEACF1355FEB51554C3E5860C4950BE78AE sergiomostoller
143,590,948 *0DC5B9B378B305F9A69D967BC06019C4003D5680 STADSWERKLUI
143,590,949 *0DC81A315A541199CE8A5ADDA993F078633133E9 SESUETOD4
143,590,950 *0DCC123FB3B0EE121C018EE3899957D6B4752764 STAKENET
143,590,951 *0DCDB28A56AF37CE7A76D42EE9D7A813FA566926 STANFORD.TROYANO
143,590,952 *0DC853688838754A3CD4E9E1F4B8C9FAE0DA0648 SETH.RAYOME
143,590,953 *0DC33F70DBAA06E8CEBC2868F6D9719A4123189F SEUQRAP4
143,590,954 *0DC143183FDA25443F052FC7F17692F5A37AA272 STAROLEŚNA
143,590,955 *0DCCC9B85CB8EED1A3B55B8628684B034811E73C sexualitätenforschung
143,590,956 *0DC6CBD79FBFF80AA8C66C149D8AF759A1FA745D STATION.BREAK
143,590,957 *0DCD759136409627CD03457648C818D7FBC89B69 STATIONGABY7
143,590,958 *0DC326BEC98EF1757134F14E94ABD83EE055B2CC shannondanielson
143,590,959 *0DCD03885B805F7554A3DBA5E32A002168BD7B26 STESQUE
143,590,960 *0DCCF2E49F7DF57473E67180910A040E8598FE17 stibarom
143,590,961 *0DC734E78EB650262743671CF2D69C0445DA4448 STIPTON4
143,590,962 *0DCB1219282154457BDFC2F9657657339B44709E Ston3.f3r
143,590,963 *0DCE4E449A437EEC23D331B42B4D6B6FB30E750E SHIVARAM.KRISHNA
143,590,964 *0DC13BDEF71F87870CE5E8A8169A7A75FD9FA529 SHONLOOMER
143,590,965 *0DC89F200E2CEB74BE0DDA512C1FC141A8A6682B subcranial
143,590,966 *0DC2C05B6F03B437202CC50E0817AAC5BA0DE4AC subsidenti
143,590,967 *0DC7815DD98574E2909B064972623D4295057AC3 SULPHOCING
143,590,968 *0DC30FFDFC434BFB6CFB057EF7A56BBD0A59877E SIMMELOS
143,590,969 *0DC439A8EF6A249910F8F6391BC0F976C5323CDE SININIUQS
143,590,970 *0DCAD168C440421595F716DE4136693180AC72F5 SUPERFE!
143,590,971 *0DC01C24170BEE1B8354943CA504D92B81D84422 sitbahsu9
143,590,972 *0DCE3F7092ABDA8966A04C68BAD4816746BF582C susancariaga
143,590,973 *0DC4351DC7BEC0A7A151ECD174D8693C1FE6BB3C SVISAI.
143,590,974 *0DC61553ED078171EBA9D113B25497001662E039 SLOBODOW5
143,590,975 *0DC9D77397CFCE0C8607739A7ED3A36628C3227E SymphonyNo2:Finale(Allegromoderato)(conclusion)
143,590,976 *0DC81722B1C4EFFC4E46E3355331C038FCA514CD SZKHEDIOSZ
143,590,977 *0DCAA89E8912B24D3B5319443F58E39584A7B57C TACTICSOFTERROR
143,590,978 *0DC22F6BDF68740C909E2364F115DE8EBD6305E7 soloparatiandrea
143,590,979 *0DC99E13C81532C8F27EE241D9F3F4A73DD01E93 takiharas
143,590,980 *0DC46FA63239AB00483E4710CEF46F5310A5D86D TALUSPAC6
143,590,981 *0DC70295A2222CE543FD5A3A9AE4575EBEAABAFA TAYLORPYTKO
143,590,982 *0DCD2968082BD7C99C66B461EC203ED013C38253 TAZKIRATÚ
143,590,983 *0DCB6D676D72EAF26ADA3B553A6FD25DECDAF938 team.tactics
143,590,984 *0DC4F60671DEE1C70DD859CF8F4E1E8202AFACB7 SONGXIUGEN
143,590,985 *0DCE0B22E2EB8C6FD530E532106FAE8EEF2A8796 [email protected]
143,590,986 *0DC19FC9723A7E54E6C8E633AB39D377BBD56547 tel-basta
143,590,987 *0DC623CC4AD2DFBF6E217556A23ED7A49952FBE2 tennists
143,590,988 *0DC2476DAEAE84FACC6E56CC2FE93DA9A2FCED94 TERENCEPONCEDELEON
143,590,989 *0DCAB006135A7515B17C697E1C61A481F3B7246E SPECIFY6
143,590,990 *0DCC9086D85B4A5BB39A641B15AA14DD4BCFCCB1 TESTPUNKTEN.
143,590,991 *0DCDFAEAC5581A49D47370FDF13535C93BB5E4E4 T&FA
143,590,992 *0DC83C4BCCD5623D5D279930D88A5265EA6C7C6F THALAVANI
143,590,993 *0DC65FD9F795730F134417A7510EF439CC1C9707 the9stepstofinancialfreedom3/3
143,590,994 *0DCEDB40EEE6BD87F54DE0E176241933991D01A0 SPLOIT*-*-D----P
143,590,995 *0DC0EA72002C6B964EBAD6C2B15F26FEB71EBD4E TheMeteorite
143,590,996 *0DC53A7070B61C687B77AE9472EF78C0F0F8E255 spudster
143,590,997 *0DCC513B769BC02CD0D2A55F145FC36A8318A268 SPUSPSB
143,590,998 *0DC924CE811548D93074B73E310D5156A5EDA47D THEO.KANAKARES
143,590,999 *0DC0D5C218E03D50534FCFCF41721DC4F33511C0 SQW\
143,591,000 *0DC2B356FDF292E6896207DE6379915EA629516B The-Rape-of-Lucretia,-Act-II-Scene-2:-You-were-right
143,591,001 *0DC1F0D3E30F0C5967E232E48A6F9C9ACA47A5FB The.Singles:.1984-2004
143,591,002 *0DC59DBCE688D2AEC656D037D3FCE48106CAC6E9 thetawnygoldman
143,591,003 *0DCC46CC7A2B8AEE14E407256F93B038F922241E SSAPSIALAKUUM
143,591,004 *0DCDDE333AC4DFF1965D66F9F200D0E16642B1C5 thewelltemperedclavierbookiino.19inamajor,bwv888ii.fugue
143,591,005 *0DC910ECD2CBA30E25E233A04116C3E205E2409C STACYRICARDEZ
143,591,006 *0DC6C8EDAE2F5B2240DF9E1CB23080B68CDA2E7E STAN.AILSWORTH
143,591,007 *0DCA2BB19940226AD47CC1B29C233B8C8DFF4FD3 THOROUGHNESSESES3
143,591,008 *0DC16AE975C21FCEAFC951488D4EC89419112ACE Those.Fuzzy.Things.(Out.There)
143,591,009 *0DCE6F367852DF45698406FBA20A1CC35CD5226C STAN.SHALAM
143,591,010 *0DC9F0DA6130B0C499AD6087F04C30B52486BE55 TIFFANY.SILVA
143,591,011 *0DC6DA075E4DE35E045A1F7B54BC845C59A5B0CD STEFANIE RUGGIERO
143,591,012 *0DCD1BBE6384531452CD45D97BBF514368753B65 stefanmishulovin
143,591,013 *0DC6E58C0582B5D0359426A879CAFED63FFE7955 TILLBERE5
143,591,014 *0DC08BFE82F895756C50025678DC94C57AC22F02 TIMOTHYDAFT
143,591,015 *0DCDDD1C1FAB974EE479206982B1D078826B4A86 STEPPING LINE
143,591,016 *0DC8FD2FEF4866A411DB8F0B76FB0B2FAF68F05F T|J6
143,591,017 *0DC8C304DCDC3CE55479297B6995DCD33EDCA2DC TNELUCCAED
143,591,018 *0DC683395E18CACA805909A682241234CB6616FB STINKYASED
143,591,019 *0DCD854941BDE4FA798DEC61767FDF33A761D3DE STJOHNWILDERNESSORGWWW
143,591,020 *0DCB6546AD8519B7029846D825807E5AA12831D5 TOBYWITTWER
143,591,021 *0DCD1F5421FE8EB77E5CFAE682EEC6091564178F StopRememberingTV
143,591,022 *0DC3242525871D14A1BF8B4248E19AAFBB978A34 tomdelouise
143,591,023 *0DCA64421CA431CFF71F8FEB5B3CCEF64EE51CF2 TOMMIE.BAYLE
143,591,024 *0DC78C6FCDE36F3777F9D7C84010875429870850 [email protected]
143,591,025 *0DCE9C261E528F4A94F97D25781FE97DBECE96B5 topikes5
143,591,026 *0DCEEF57FB8D79E79D19E4EB58238A3F06F79225 SUBURBSUBURBS
143,591,027 *0DCF2013ECDF24352FFD447D13DC8A9A8042EB01 suiteno3:gavotteiandii
143,591,028 *0DCB9805CDE4E58393B3CDDF6D31F82C923BF681 [email protected]
143,591,029 *0DC3B5CD9FA816BD8544E6411C0CCF71BE39D6AE [email protected]
143,591,030 *0DCFC44CF05260CCC1A81664F9E03B6449441B52 SUPERTRANSCENDENTAL
143,591,031 *0DCF2E2E3123CB8BF67A4843190FAFD8451BD636 TRENIRATE6
143,591,032 *0DCF6C54F887F64FED84C8BAC583F173919232AA TRENTCHIVERS
143,591,033 *0DC59B9A87A708159EB8E8096A0EFC97C5226B37 SUYYAMG
143,591,034 *0DCDA18862F130D4F4EA977BFB8F096193E29DC4 trotto
143,591,035 *0DC1BDD868B1FEE359DC4F5443CF5870508433AF symphony-no.-2-in-d-op.-43:-iv.-allegro-moderato
143,591,036 *0DC739D497C724CC927F156905FAC6F53205FA42 TSACTSRO5
143,591,037 *0DCAC9FD161AF031E59D04B67BF297CC66C83CD6 SYSTMMNDFLNSSPRTNS
143,591,038 *0DCEFF05C6E0279B9F00C6A4AB9DF9FF7E61EC3B T!&;
143,591,039 *0DCCC6D62A479AF0F693DD8C15A1CF3DBA3FD6D2 T102580
143,591,040 *0DC7377B2151298EEAD376915EBC734E42450E85 TT0011979
143,591,041 *0DC82CFC53341F093EFEC102CF2EF1027AB24BD4 <tt>$popped = pop (@array);<br>
143,591,042 *0DCBB96F43A112D647D69C08CD1305A8B2C5DF2C TAALKAARTS8
143,591,043 *0DCCBAE144B934C753C8365B0F4D2A3052CAD275 tadklarich
143,591,044 *0DC0FB7551B537A8EDE9A7A029D2D763C7EBB2A7 tür197
143,591,045 *0DC3524F5E3BAEF5B1F1808D8C278519ED37E9B2 TAMALA-CARTER
143,591,046 *0DC4CB18891CF6497BF8606006D3A4F72F90033B TAMATSUT8
143,591,047 *0DCB46278DD0D8587187623CCBE0A5184019CA6C [email protected]
143,591,048 *0DCD6A7B0D2E6FBC0EABE15B73C75A67B2D368F3 [email protected]
143,591,049 *0DC7811B530CD20D93190D5B7DC58FA6E91CC3C7 U1*_
143,591,050 *0DC2DBCE098B1D6EDBF5FCD2241E45AF4ABADCD0 TAUFELEUCHTER
143,591,051 *0DCA80B482A749C2488ECDD937E593C86E68FCD1 UARDA-MANUSHI
143,591,052 *0DCC738257182B682AEF91207A84F30F8748D860 TAURUSVANESSA7
143,591,053 *0DC6CA07013338B21BD0E8353B2CF08FC47B2613 [email protected]
143,591,054 *0DC48E5E915E9A3BA5AEA4436F30245F8C5F46B1 tazeem
143,591,055 *0DC78C00567024CF0ACA5F30C13B3604C24C460A tefenni9
143,591,056 *0DCDB2C8752722321FBF6096A4AE1B46FC1D1CC5 UK1N
143,591,057 *0DC6AFF94394E5E3FD80E96AEAA4C5B39B3F4D39 ULRKIFLCJA1
143,591,058 *0DC83D37FC3279D292010E37C55486C54116E5DE TENNO123123
143,591,059 *0DC67D5D9419F6D764B8CE25B8330312B90859C2 tequilascarlett
143,591,060 *0DCC3F8901AE67D5CB1994A66A58EC6266D21E34 UMARYOUNUS
143,591,061 *0DC39D255B48240EC228173B213FA592F9BBD321 terencesortor
143,591,062 *0DCEAB6F1B5DF8480D3CDB28AD7D8E5C26A74002 UNAVO1DA813N3$$
143,591,063 *0DC860A7126C26B62F48E85F3446CB58EC13E1CC [email protected]
143,591,064 *0DC9DE378874064A691AEC6113D5D7E5268ECBF1 thanhmcgartland
143,591,065 *0DCBA4F7D4C0CF7F01A420BD33469635D6CE1185 THAT.MADE.THE.WINGS.SHE.FLEW.WITHAL.
143,591,066 *0DCE07FC3E4AC52C5FD1E9F6BCA6F1A95C4A1BF3 UNSENSUALIZED.
143,591,067 *0DCE98B9EA2DFE7C04041825E8AC6981FD6A9D44 thatwasmyway
143,591,068 *0DC5C8DED0481CD111E7A410F13C38CFE2708A75 unusualceremony
143,591,069 *0DC05878D2C438839350718250C95F5A060B9F1F UNUSUAL DAYS
143,591,070 *0DC88D851B627FB2F90EA9040743A43DE8277CF9 ur4nou5
143,591,071 *0DCBBCE44684AD82B93FB60E3F0C8CC3EC5DAEC3 urethrometer
143,591,072 *0DC78B37B9CEB3C9B74C65FC0E23E004D90CCCB4 USERDAMAGEROCK
143,591,073 *0DCC11C83B6E9A005312CE76DEA4DFDC2E13161C [email protected]
143,591,074 *0DCA680AF9C6228D7D25664811E1F4D30148A082 UTLONGHORN
143,591,075 *0DCCAE62875E346730B3998EC9E73E1C4A560588 UTSEENDER3
143,591,076 *0DC9842D06C65DB36176061F780CE544ECC1F26D uxg;
143,591,077 *0DC2E24F76EDEFD563109A3DD56E4FF2E38327D1 THE.FLAGSHIP.MAJESTIC
143,591,078 *0DC77D6C22D40EEACFA9E981CF29299C808A7FE6 vaatsheid.
143,591,079 *0DC2B1B1D8004B4F6AF3D81568B8D7517A52699A VALENTINCARTELLI
143,591,080 *0DC6D799EFCA55F9A72DD58BC21C967C9AEF8985 VALERIANACEAESING
143,591,081 *0DCF3911EC2EDF7CE9380334421A8A516A267936 VALSIONS3
143,591,082 *0DC6742A48485034ED87F15B749DDBD8F4A75B1A VALVEGRINDER
143,591,083 *0DCC8E1857812DA6B730E80046A5F81D53E37D56 VAMPIRES.ON.SATURDAY
143,591,084 *0DC0A90D2E50225BF40B55EA3C781425C7BC8972 THESEDIPA1965
143,591,085 *0DC550250F24ADA14AB34D78A922A0B0D7F1D767 THEVOICEOFTHENIGHT
143,591,086 *0DCAB169E93A1C77BEBB232984A9C85E7DB48730 THEWALLY1995
143,591,087 *0DCEBF7920C74344BBA1A10C9C2059C33B4CBA7C VAUGHN.DURRE
143,591,088 *0DCAAA33093CE0A41B0BDAA7567EE29AD67E2CDA thysplendidmoon
143,591,089 *0DC85932E7C944471AEF44AAE71CB33450ACA2F3 VEDRANA.ROGULJIC
143,591,090 *0DC7D05191BE3394C788505F4D633312DE36D4F0 [email protected]
143,591,091 *0DCB21A226B0B361C3EEC7E874D31782F53BBC60 veeheywood
143,591,092 *0DC940F74B12B379BF4EF09BFD9CFC1275DF84A9 VEELBETEKENEND9
143,591,093 *0DC1381E926E4B261CE0DC2EA451E9344DB184D1 tica-de-la-republica-centroafricana
143,591,094 *0DC09D8856CE8BA5E4DF59366C939CAE307ED4DE VENDINGENE5
143,591,095 *0DCDA5CB2B0BDE0D1528AE7BFD84FFBA515D1F4B tigetnum4
143,591,096 *0DCA51E818F5BD80FA00951D9B5C0C0AD23A5518 tiligen4
143,591,097 *0DC4CF72F99276F4C7B6D2052160B40067DDBBE7 VERDUWIN6
143,591,098 *0DCF27000FECC1085F5E547B7D3524416CE23D83 VERHOLFENER6
143,591,099 *0DC7B6C2D2F67AE82C74381BDA5A18B1F2B894DF TITTENS7
143,591,100 *0DC08D912EA73DD104229D7A768533A7481A5EAB titubasti0
143,591,101 *0DC668A3283A4FBF655AF4069C3D4A1CD6C26A5A TIWTWWE
143,591,102 *0DC8847E60BB2066A02B93F89CC8C4E465345F18 vernalazaro
143,591,103 *0DCEC2407232DC2DC1D91D9C23D6FBD4A83FE3F4 vernonhornyak
143,591,104 *0DCAB254A15967B3948DCE44F2F106843E8344EA veronica.ava.day
143,591,105 *0DCB305F4976E94FA4D134EBBF1B72442865A8F6 TNAIFIRTCELE1
143,591,106 *0DCCB4D3F98EACA2BD475795A8763BF631613E26 VERZELFSTENDEGE
143,591,107 *0DC4419188300A62A5147A0CD38C9EA4BE41C785 todd.cantwell
143,591,108 *0DCC4EA61D62418D7F1238D16B4DCA42EB4A3014 vickilgreb
143,591,109 *0DCEABA2628C4BEAE468AA5DDDD75A825AF49815 VICTORBODDY
143,591,110 *0DCFB175324B9CBB253880438C8997CC012EF4D5 TOM4TO-PU
143,591,111 *0DC343DAB80BFF4CC4C559E799393FAD01117A53 TOMMIEBAINARD
143,591,112 *0DC415A1CAE743F9A14157360CA8E5AE6FC40BC6 VIJAY VIJAYKUMAR
143,591,113 *0DC824B70EFB2C13DA351B06B0AB3E0C4D4247A5 tomoyo14
143,591,114 *0DCC6090CFE5B99A5C4228EA5D06405CF7FD1EB3 VIOLINCONCERTONO1INAMINOR,OP77:INOCTURNE
143,591,115 *0DC5254757653B074FC8B5E8F8FADE7964DF3F84 virgil.muncey
143,591,116 *0DC792141BFB25771B5D47AEC85FED3234D3AB90 VITOPOPADIUK
143,591,117 *0DC6198D57652C5A9DF9F73D279587F2E1AE8FE0 VITTAYOEZ
143,591,118 *0DCACA6FF1E7213910415A5A0208DB4D579ABF2A vladimirkaigorodov
143,591,119 *0DC828C21DFAC4C735916050DA0DC5E603215139 VOUN BROWN
143,591,120 *0DC4AF571FD5BEE06157886062F9730B124B63F2 VRONDON
143,591,121 *0DCF8ACE9569A1D8A1DD891834BBB36DBFC8842F traboccate5
143,591,122 *0DCF196278D4B8328685341FB97616E13262677B [email protected]$
143,591,123 *0DCCF0390DD8349492AE71E2444E0826644518B0 vulture-and-child
143,591,124 *0DC4FBBD8C2333FD47D1C73081B03761BD476100 TRAJANÓPOLIA
143,591,125 *0DC0B2E81DE94CBDB20FBBBF588637A5C70E491A WALLACESCHWIEBERT
143,591,126 *0DC66D65BC14E8C09EE4BB95E55ACBA61EA71AB3 WALLISVILLE8
143,591,127 *0DC84642BD468C1AF27258C13EC4DAC66D871E66 [email protected]
143,591,128 *0DC523561973E89A380156B5DA0F7DEBAC59FA78 [email protected]
143,591,129 *0DC7B9BC71899870C02161C33EC2CEDBC167C11C [email protected]
143,591,130 *0DCAE83BA22252D9C72FF36DAFF23CC652102BE6 trio-caldwell
143,591,131 *0DCDED75DE901ED10264626BD48A7938D3B602A0 TRISTAN.FERRO
143,591,132 *0DC3C89F25F7E1818581234E6CC66207C46E25A3 warrengoreczny
143,591,133 *0DCF4FFCCF39ED906B85BA88D32565A245E18E11 wasana.abeynayake
143,591,134 *0DCD646745243A4CCE981ECA6BDA5AA36C7A9F35 TROMPONSES5
143,591,135 *0DC223E09C6C4BFFD0F2277402BB7063E8CFD8AD $$troopers(charliefanclubremix)
143,591,136 *0DC2D62C7F3919E831D64DF9A9B770E8D2461522 [email protected]
143,591,137 *0DCC5776FA27281C4B54F303830825DB1C2EB924 WAYNE.RODABAUGH
143,591,138 *0DC42FC2FA5A062F46D48E6CDABD9CAF6CDDFBC5 tshedzandou
143,591,139 *0DC33D9F5FB327CAA8B75DBA834214E8E4CC05AA WE DEMAND A SHRUBBERY (SCISSORKICKS 'ELECTRO-BARRIO' MIX)
143,591,140 *0DC46F8EBA0EE4E0B8FA0C1C33E6C598A0685B28 tsneidedfeil
143,591,141 *0DCAF58D527C82C0C1849FACBB61269CB0E32CA3 tufftittyrap
143,591,142 *0DCDEA38362C1B44D67ADD7ABBBDCBE06D583DFA TULKARM5
143,591,143 *0DC4F4746D56BDC33754C989BC4E86DC34245C01 wencyimarga
143,591,144 *0DCE1E8E77F975754C3F25241AFF8EF25803AD45 wendellkasack
143,591,145 *0DC8A184D9184A26D7FFA69F09699B0D6699D1AC Turnoverhinge
143,591,146 *0DCA036E2AB0BAC4FB2EC70263F93D6F2FC80A3F [email protected]
143,591,147 *0DC982061EA578EB3F35F1E828FF34037964DA44 WFOOLS
143,591,148 *0DCDA6EA3D7D09BD4490235FE757C5DAD3FD9310 WHATTIMEDOESTHEBUSLEAVE
143,591,149 *0DCCBB95E8198D0B2DB41AD6611E39BCCA204DAD twentybe
143,591,150 *0DC9FBC1CEE5DA5E16AA9A03B41FC9AE35044E82 TWINS090204
143,591,151 *0DCEA304269790E5C482C7A57127A9CC3446D1AA TX.AFT.ORG
143,591,152 *0DC3C520BC56EEE0EA09211028E88183B56EBFA0 wilbertdussault
143,591,153 *0DC8DFA35806E9D12172B429D155D660E32F907D tylerschissel
143,591,154 *0DC979EBE5B6909E905B50FFAE55BBA923F94AB9 TYRORER
143,591,155 *0DC14F545855014550E9034448D34D8498FA82F4 tysonnportsmouth
143,591,156 *0DCF7515373D7C9529EC4AF8C6CE9509EE0815E3 WILLIESPURGER
143,591,157 *0DCCDD32CDFBAF72E98ED5A62EB39977A95FD640 WIMBRETH HOWARD HAYES
143,591,158 *0DCB20973683537BF0AB9C578292994B71E830FC UBERLESENDEN6
143,591,159 *0DCE593DE1D52C04F2F3589B8AB2045F3C658F3E UDILEH.GAMLIEL
143,591,160 *0DCB3749B7AA657C506955A713C7AE6850B2C699 [email protected]
143,591,161 *0DC5F256974FD1C13C87283553F02FBB33CC1576 WRXSBB
143,591,162 *0DCF64E00EF1C0828607AAF5714E2ABF21988C1C ULJANOWSKER
143,591,163 *0DC45B97B5270367E6D4E7938000A2DC1E69BBC3 unbegrudged
143,591,164 *0DCF912E8C350C46E91815001C5C4B5A78FC15BA wwwyoyoballoonscom
143,591,165 *0DC44AE48DE5CDBBCDE0FD7B4679DE3D631D5021 W%XU
143,591,166 *0DCA7991D0E64DEE04ED0A5C8745C51C86AFFAC8 wyattgoodnight
143,591,167 *0DC9EC52E47C57B405580917164A009A82D81C92 WYATTMYRA
143,591,168 *0DCB08F7E20072EEB753E43BE64D76571BAD0CDB (x)0~ <#####b
143,591,169 *0DC187285FD658A90997C8A046A7ED2838DD3D37 xanaphia7
143,591,170 *0DC093076F769BC42DCBD592509706A1C5152B97 XENIASABAY
143,591,171 *0DCD9CA41E527CF13B5D4FD209D079462F181B1D XHAFER.NURDINI
143,591,172 *0DCE3760AF1CD394C9C654A0801C9D5CB02CA465 [email protected]
143,591,173 *0DCA2F323147575DCCC6C44F349FB00244BFFAAF [email protected]
143,591,174 *0DC5D54C4066966A019D8C373CAB4D31A31EDCEA UNORUKUF5
143,591,175 *0DCA66694DE5732D0A386B7BA01DE6288B8B7DAB XIMENAMABEL
143,591,176 *0DCBA748E0CDD6BFA4956CB5225510787B22AC37 UNRIMPLED123
143,591,177 *0DCB096FEEAF7EA080FAF028F1245CB52D8BBD78 uns14nted
143,591,178 *0DC99D7BA7D418C53B6045F8D1B1B630D32A9F88 $urf-c14m
143,591,179 *0DC32FFDBB77C23AE3B0E5E212DA89727E5E271D ursulaelisa05
143,591,180 *0DC20343C4360598E1704CCA6743A7CB610B829C UTAVIUS
143,591,181 *0DC9A3589E60E5A82D63D4675CBA6B580A0A4D41 [email protected]
143,591,182 *0DC2217D1FD90220B329CE36C353190F873FFB1E [email protected]
143,591,183 *0DCE4B2248CFA9B3DC91684841D0BCA5D93FB50C YANKS920
143,591,184 *0DC1AA04BA4E984CD012FB4AB38ED91EF2562703 YEKNOD
143,591,185 *0DC430FF985E1A6AF0E4AF3CAA0EF316EC7B56C8 [email protected]
143,591,186 *0DCE31C17945ADDB540570AAD0AE770234137189 yhmpaz90ptq
143,591,187 *0DC3DE9D063D451DB905A7B4D270317855EEA4C9 [email protected]
143,591,188 *0DCBD858EDF1F7927BA34EA539F8F72CD4849094 VALENTINTENNENT
143,591,189 *0DCA4B1BE0F215442B4F46B638FE49910CE0B4C8 ykswokar
143,591,190 *0DC5798CAB5F74A66C815A29675D0C9213D07198 valessa.makino
143,591,191 *0DCD6F8168D7425F4C9E3704672CBFB6E77DDC72 YLLACIBM
143,591,192 *0DC314B1EF1A82C24A1279ECA5B8636A4C7BF634 vandanadevaiah
143,591,193 *0DCCD098DC069B11D2B047306E20A72C2DEA65E5 vanessa-sabah
143,591,194 *0DC044BEFD95DBE4969216FABCD002D36D2D5CC0 YOUNGDAE3
143,591,195 *0DC13820C7393530708BCA43E42F6962D0B271FC vanlamen
143,591,196 *0DC9CBC9C2B4B15F7ABB65A4A4E63FC98615310A yousef-abohomade
143,591,197 *0DC48705D8985169C70DC6316F20724F4D3A642C värtapiren
143,591,198 *0DCCE281F8BDA236FE7E8BD89AB1942085509B9A y>r~
143,591,199 *0DCEA7B1F6FA89A2377799F37EFB6FEB40946EF5 Y{:T
143,591,200 *0DC7A29EA527DF9C2C86F6B5E2381886E24CFB63 [email protected]
143,591,201 *0DC290A198A578397F8A6FFA4A077B62D166D3AC zachariahruhnke
143,591,202 *0DCC58739B3B40F12622767608956E0C772C922F VERDENSBERMTHEDS4
143,591,203 *0DC09A493FCA3EE989D3D96910B76E64F475A95B zach-gring
143,591,204 *0DC83E882574616BF978BD1A7178E67259D13052 VESNADUSAJ
143,591,205 *0DC5E9B2A20ECBDD3132A85A650C864AE1B22F7E VHORTMIZ
143,591,206 *0DCFBD6F853BD33ED1716019E63D3E0F09D76611 zedelche160674
143,591,207 *0DC7A3A5A274EFABBE9337A32B730DC6075AD667 [email protected]
143,591,208 *0DC7BC052D2D98755BF1A75CEB1D4DB1AD44CA5C [email protected]
143,591,209 *0DC62F7888B1FF33E792F9739AC0614EA231AD1E ZHEVP8E5
143,591,210 *0DC0042E175959A991026D14B12C3BB659A410B6 [email protected]
143,591,211 *0DC4B9C36B6733D837A143625FD2F21619BB54BF [email protected]
143,591,212 *0DC862B2FF2A5A0AFF6FFE5BBCA00A5F7C31F170 vickie.smith.brock
143,591,213 *0DC24A045FFAB3AC8E4CAA623A3EC950B43CB27C VICTOR-PALAISY
143,591,214 *0DC3F67480504D573BB04D51972A25D4D842086D VIISAUDELLA6
143,591,215 *0DC1F78A13BB7A935BB5ABE9F73029E88877615B VILLUSING5
143,591,216 *0DCBD6C809E66AF638E6DBC2C6ADC10B3B587FF7 zondeloze
143,591,217 *0DC15FE5D1D5A285861259321295DE73EE8D5928 VINEVYS4
143,591,218 *0DC6BD59154AE59572898DD73737F565125BF9E6 VINOGBASSTIAN
143,591,219 *0DC3B0EDEEB40A49B40715FD47AA35039E85FB1C violinconcertono.1,op.35:pocomenoallegretto
143,591,220 *0DC6B6B39C96A2C1AE12333AA2772469869D6BF6 ZSISMADIW
143,591,221 *0DCFF7C2F4989B2327A3BB9955FBEDA8880BBEFC ZUBREGAS
143,591,222 *0DC883B2EF1E83150721D34CFE58E6959AA86B74 ZUTTOPNM
143,591,223 *0DCE281516AF685FA0B33C5850B54C60E327C1CA λουθουανική
143,591,224 *0DCA3A07DB262635A2CEDBACC1EE1402BF4D670B ΠΡΟΒΙΒΆΖΟΥΣΑ
143,591,225 *0DCBEA754A93D6248649A2E12116013843A263F5 τάμμερφορσ
143,591,226 *0DCB34068C504F35562D22D7536A4C837C97923C АВРААМИЕМ
143,591,227 *0DCF0E58CF429A3201FB2A57620C4B55EA07D145 АСАДЗІЎ
143,591,228 *0DC916B5C80B0A154775D99B9A0457837B03182E VITTORIOSOMASCHINI
143,591,229 *0DCB9E7E9E647BFFF80A9314EB0BE81643C35F88 БУМІ
143,591,230 *0DC96D20E7B8703337B31EEDC420FAC7F9903995 БУРДЕНКОВ
143,591,231 *0DC808668D73367AF05114D4663DC1455DB1223A бьонделло —
143,591,232 *0DC7A74EFDBF2401FADAFABEF31F9309C04666C8 VONSIWEK
143,591,233 *0DCDA3EBEA5548685CAC04205CBC7C16C6ACC801 ДАХЛИЗ
143,591,234 *0DC75D1D91857279D2BC28FFEB47383E751CA5A5 ІКСІ
143,591,235 *0DCD3352E6EEA224572D55C1A9792149E14DCC52 ЈИСКАНИ
143,591,236 *0DC173AA057216D135992930E646F8187642661C К’А’К’
143,591,237 *0DC9CDBA4E52378DFC5D4212FAC210D2BAF0700F КОМОНДОРЪТ
143,591,238 *0DC993C2F624D7B541CF6F1D082004C35535C670 ”Л’АМБРОЂИНО
143,591,239 *0DCB146F5F3550F17947CE36E1F38893CE558EA7 лямуши
143,591,240 *0DC015805B310B59E6B07FB90D5CFA6BFCD6E2E4 WAERHAUG
143,591,241 *0DC7E34321AA411D6F0ED84311385BB128748FD2 монакското
143,591,242 *0DC20A01EFEECFDBD054E48DB8CFE4C7425ADFF6 WALKLAND
143,591,243 *0DC019B629340ABFCD431345CA6A043C188EE3AF WANDA-HOHM
143,591,244 *0DC836D1A9D5271EDD16CEA5708367E3C1F1CAF5 СИДОРСЬКА
143,591,245 *0DC83BEBB9D24E45233BBF753A9350E467D40B28 СМЕСЕН
143,591,246 *0DC2BCAC7EE6CF2D064520CED7097A9C8F397804 СОРЕВАНОВАНИЯ
143,591,247 *0DC710D96728F279D29239A66C194E5499077FE8 WARNERCORINGTON
143,591,248 *0DC7CD36AFB938325A0C54284AA8838F465A45AC энгелине
143,591,249 *0DC954E7DBD159C5E47F8F5366DA3738512B1954 WD-CGAZ
143,591,250 *0DC7979D2684B726EADA8EB9F09049A394592BD3 WDIDSOW7
143,591,251 *0DC155EFA668B7E9C2475B3B38E217E141BC272A WEALWAYSACTWITHPOSITIVEINTENT(3)
143,591,252 *0DCE2470A2B007B5E8A6B2E2648DD9B658A976AA WELDONGOSWAMI
143,591,253 *0DC18ABD4119BB72FA0822BBEC91B06070129E7F WENDY KENT WILSON
143,591,254 *0DC8DC863EF7487770CE9D04C73CE7FE921809F1 [email protected]
143,591,255 *0DC765DDB8CA2B110535BF074CA5DC090A45C262 WHAPP3RS
143,591,256 *0DCEDD08A1BF8699EF6278AB01FE2AD38A7C1A45 WHAT'SYOURSTORY(WHAT'SYOURJIVE)
143,591,257 *0DCE6134055FB346842920A456E04A80E6D9ECC1 where.are.you.now.(moonman.remix)
143,591,258 *0DCB407F6AFB642C79579A82335E866565AF2F27 WILEYCHABAN
143,591,259 *0DC27D6A8AFF3745A911F8E40AFFF7B5D13E5F63 wileyvacarro
143,591,260 *0DCDCC8A94960F236482B001C7522BAEA9004DF8 willardmiguel
143,591,261 *0DC08057EFE810E99DC571706D30AEB5391D1138 will-smye
143,591,262 *0DC6768F77C60196A0781330CF44ABFFD0A16E2A willyangley
143,591,263 *0DCC6E88BFB472A080BF947AAF9F2897F9512626 willya-sahasri
143,591,264 *0DCDB53DCD1E29F9BF790D37E0EC7A7D8B50D5C9 WILLY.JELSMA
143,591,265 *0DC4E20128C0279CF3907F27BCFD18D8A1EB3818 WILLYTIER
143,591,266 *0DC8B227E0E9C35F5561191347DE2FEE712597D9 WILSON.ESSARY
143,591,267 *0DCCD28D4C1FD239CC79A68C2C8DAA43E97A601D WINEDRAB
143,591,268 *0DC6D8EA8F7483B3D3F6E27C8A3D34516C74D5D6 winstondepp
143,591,269 *0DC9EACA40E94A8D53D07D455DCA36F369FC0EC7 wombat126
143,591,270 *0DCFD306047D21AD09FDA84F91139A7985747C9D wong-soon-hui
143,591,271 *0DC71CC4380E524375D2DF3F325F28AAEBE8985C WORL
143,591,272 *0DC6A1F4D807BEA1799BC2B408053CA87C747F50 WP-AFRICA
143,591,273 *0DC0C933ED1D5D545363178EF4F78F1098BDC58B [email protected];q
143,591,274 *0DC2DC42CA4D04BBDC4568E74477CB703789F747 WRITHED
143,591,275 *0DCDA3ED71BFD4A401DAACB2DAD7F1FCE913AAB1 W:{V
143,591,276 *0DCD0D550D91A2D34570D0DFBF53E74CFB0242A5 WWW.CALIFORNIACASTER.COM
143,591,277 *0DCD10E23D49397CFDE4A4FDD3DCC9206C67B63C wwwcm-syscom
143,591,278 *0DC2260606286C8683916A09EB552CE2A913784B wwwcnet-scnejpcan
143,591,279 *0DC55F210107A8314AF33DFCD8DD075A38C28BDF WWW.PEREGRINEHELICOPTERS.COM
143,591,280 *0DCA75BE8DE63399C7A557641AE18A55E09897DC WWW.SPEEDTORRENT.TO
143,591,281 *0DCC1296B68A45FEE1F885AFCAC6248F0517290D (X)~` ~` <###8
143,591,282 *0DC79189DE6B7655938F26A51897279FEB62EFCD XAVIERDRAGONFL8
143,591,283 *0DCC05C76E691EDE1BE59D672C80F2A55FE551FC }X{`(=====B
143,591,284 *0DCC8F1FE94A2043950BE0854887982DD79C49DB xéniával
143,591,285 *0DC854CA571FC0E479D9AA1BC88B41F06BBD632A XERXESRANDYMONTE
143,591,286 *0DC523FE59B0F977AC1DB9FD65F2DA956275B9DB [email protected]
143,591,287 *0DC2D07275C25003B6E6BD481321F8BF3CF0D43D [email protected]
143,591,288 *0DCA54A7D6D4733247B1CC266B5AE98A285926AD x>oa
143,591,289 *0DCCD1A4E8C9716E6B32ACCA9E64B5CBA6E485A9 }X{*-*-*(=p
143,591,290 *0DC5FA79088889A75D70B23585439AFA553FA3C4 [email protected]
143,591,291 *0DC4A4881B7ED6AB1AF7F5810900873F4CE15EB8 [email protected]
143,591,292 *0DC53DEBCDEBC4C1A8D7C0F0D5FFD5F5101FAEAA YBATHAMANATHAN
143,591,293 *0DC2AAF9672B8801FEE3BBB4F28FF39122618DE4 YELLOW FIRE
143,591,294 *0DC81C40D55FCFC06AA27745771AE70843F21DA2 [email protected]
143,591,295 *0DCB98D5F36BE99907B921616955365158780FA7 YKSITYISENÄ
143,591,296 *0DC3C3D663901123AE8F345577B647C08CEE1BA1 YMODED
143,591,297 *0DC9B14DAC5B5A2FDCF2FF0BE0CA9D749AD5ADDB 0gjg
143,591,298 *0DC1679A5188678E9AADE6411E5B3092674CA673 1.02.1059
143,591,299 *0DC43AC1DD26AFA38D177E333E16B0DD2905B61A [email protected]
143,591,300 *0DC0C442825515D9FD3CC3FA0F52F855FA1CAC33 [email protected]
143,591,301 *0DCB4806B48B04D8F665C491F828820DB73166FC [email protected]
143,591,302 *0DCA9582CB62BC60582705990EBBE989A2EE1F3A YUKO.KISHI
143,591,303 *0DCD1DFDCE252344D861C218B77F29418DCD596F yvadyffa2
143,591,304 *0DCB6765C39782F4A3EBE5E67279726D06B617F8 yvettenewellwickham
143,591,305 *0DC45F5AB5AE932E67ED896F27531C8276366EFA ZACHERY.SCHATZ
143,591,306 *0DC4EF9724EE50D431271D7CEAB7D99F336E6E04 ZACHERY.VOST
143,591,307 *0DCDFAE825888B1D0D804F543F162C79453D4471 ZACH G SABOURIN
143,591,308 *0DCB6510EDE4CB7C32D97D9ECA746F1EDCC2AA25 1258322 abi infot t
143,591,309 *0DCD3617F4E2999D96C40DB67084897B2221E216 zae>
143,591,310 *0DC42995EF2ADA26C57CE73339C74FE509BD1B6B 12HSD6
143,591,311 *0DCE95BF5DA0C0B492D3F9FD79353626150E5FA9 ZAKOPCANI 1
143,591,312 *0DCA18107832B545216E0E633E05DA6DA299C324 zapeče
143,591,313 *0DC4E381C2CA820921A4FF9E9976CAB6513665D8 140308THEAMO.
143,591,314 *0DCE87D482CD2D85AA826145224E4183CFBA1CBA zeynep.ersoz
143,591,315 *0DCE2C30B0EA287D016BA71DB8E2CC68CD71CE21 16 THIRDRANKED
143,591,316 *0DCF00EAA8080C0080B9EFD39E23083521263A62 177laufender
143,591,317 *0DC03A9627BD3B6C880395970777DCDDBD9B0BAB 1783710 jetztistdasimageangekratzt
143,591,318 *0DCBAD01850A1B670D6469A540AADA492A56D6B5 [email protected]
143,591,319 *0DC25B803A51EC20ACABA25B3D3B2C453E7AC01A [email protected]
143,591,320 *0DCE0838AD39419132C4A37D9C70807880B75169 [email protected]
143,591,321 *0DC17DFF82CB381E559BB5240925F6B0C990EB2B [email protected]
143,591,322 *0DCFB60FBDBFB4A89E4843B7317BF0F6ED0CFAF4 [email protected]
143,591,323 *0DC5DB95B0172F84EEB813F8220243FCED8B4A17 zikra.praja
143,591,324 *0DC29EC32B6660C16B3976A4E5AA7B0004AF91E2 ZKHKKPHXVHAT3
143,591,325 *0DCDA3049B0EE4A33C8A4BA64087FA5A7765BB16 ZN(A
143,591,326 *0DCC64235ABC78C4A01B9E543E83EA5C6D5F7C1A ZXCVBNMSTATIONING
143,591,327 *0DCB334106581272A01A13A5B02A1C302DA59E60 1ACCALORATA
143,591,328 *0DC9FC8CB13458E5A138D148F072B175816A6F1D БОГАЗГЬОЛ
143,591,329 *0DCA5489E6CC501BFAD242478EE539FD93D4A298 МУРМОН
143,591,330 *0DC64AA43D68C53E566FCBF9A3AAF96FBF1D1AEA НЕОБЕЛЕНИЯТ
143,591,331 *0DC7F44B30CD132E48F3E3DA56FFBA9F5015FAED 1.DoTTYe
143,591,332 *0DCB9604FF0E3D128E9BFFFEFFE46D753119A348 1 EFDOTAGUNG
143,591,333 *0DC6FFFD305337C03418BBB130E5A25206913A69 1.ER
143,591,334 *0DC4A9F5A4F78C68EB413B9728FF94129B137769 1ETFLEAHN
143,591,335 *0DCA872490F5EC189E518D2E0FE3E8B0C2F2BE8F РУССКОСТЬЮ
143,591,336 *0DCB404E736D823D3238A5EBDAD14B4F6AAA371C СТАШЕНКОВ
143,591,337 *0DC7E0A2B78857E37F29998302179164B93E75A7 1-ISRAELEITHERS
143,591,338 *0DCA60A971D0BB581619701F16293D2465C3742B ФАКТОЛОГИ
143,591,339 *0DCD7B07DB631BD624F11F1D3D291DE7D2A8BCD0 шэньгана
143,591,340 *0DCDDC5C6E32918EF9174A0E91E06F030FFE4557 1koripallokierrosta
143,591,341 *0DCE97B960E31724EA73B71C82E59A244E4F953F 1.LAINSUOJATTOMIN
143,591,342 *0DC075C8D71A419028B923A6C0BEB0F5CA7C5CFD 1neighborhoods-on
143,591,343 *0DC779A2F0C1291AED1969D128E5210A0DCACB5C 1 NEMOQ:LTA
143,591,344 *0DC81C44529417D32DC0420B584336A9EB844F66 1 NEUGEBORENENWICHTIGE
143,591,345 *0DCE266DAED9C56B57AE0F312A7AF866DE85B53A 1NSSCTVLY
143,591,346 *0DC1F85C6D8AEB1A3A448B7AF62931C6E091CC7D 1.OSZE-BUEROEINRICHTUNG
143,591,347 *0DC53F80610B4BA9B4C6199112D2236A8F2AC19D 1.PENTHOUSE-AUSZIEHERIN
143,591,348 *0DC198CD90875B36758793EE5EA4A963ACE7FBBA 1rokkib
143,591,349 *0DCCAF76D5CB5DCEFAEF307D4D1DE5772B391BED 1 TARMIOT
143,591,350 *0DC3AACE6E4C166E33F2908F454152A04CE8DA93 1UNCARNIV
143,591,351 *0DC749C0330A4E95B3E4E1C4B49A99C690D9A42D 1.verkaufsreifer
143,591,352 *0DC1858AA56190BA1AF9A1F83FF5B77598398E7E 1-VOLKSMUSIKFANS
143,591,353 *0DC85EF6936DD1EFE61A445D13AF398F558763DE 1zdfvorabendserien
143,591,354 *0DCD731AA62653A11E742DE3A06694372694FAE6 2199431 sittemmin.eila.on.v
143,591,355 *0DC1DB00509DDA73290D1E5AE90DDFA6EB199074 2271110 das-nenne-er-betrug-.
143,591,356 *0DC74AA991721B8AF0318056E7D832C388487F43 246amya
143,591,357 *0DC65045EAEAB42AF02DCD67C387A557B22B2B6A 2496485 DAS.ERSTE.GESPRAECH.IN.BREMEN.BEGINNT.HOLPERIG..
143,591,358 *0DC21873BCD6CAE7F62687F9E901C98B3316A11A 2542978 ANSIOON SUHTEUTETTUUN TY
143,591,359 *0DC356F37C2979E6B54477B68D8178FC5E6BCF0E 2601908 ulkomaan-liikenteess
143,591,360 *0DC911D39682D44683E52D87A514FA373B0B100C 26631 kuvauksen j
143,591,361 *0DC4DBE36E9D0854AA4C8053A44F30ED23E115D2 2719110 WHAT-ABOUT-CHICAGO-OR-MIAMI-,-FLORIDA-?-"-SAID-BARRY-.
143,591,362 *0DC25D5BD71C6B8FFFD070284DD527DF96409D34 27sept2006
143,591,363 *0DC293CCABCC2A857DD764933123B2B81059CDBE 2960904 vaikeasti vammaisen henkil
143,591,364 *0DCA8BFE5E4CBD663388935B4AD960C7941D3D3F 2.assymetrical
143,591,365 *0DCA3FB2871E4A4A13DA943DC4B55937F6059C88 2DDS
143,591,366 *0DC971E83A094CB2A5BC73E4F190099C6EC80651 2DF4F35A679B7010VGNVCM1000003BC614ACRCRD
143,591,367 *0DCD3A4748E5BFC08DF28B7010C76B1B5DFA9143 2.HASILASINI
143,591,368 *0DC015A9DC440003930B3A51F42EC726CA9D7EC0 2hyv
143,591,369 *0DC7CED92C0EFEE1F708A4B03BE7597FF3E80914 2RDSTRBTS
143,591,370 *0DC2F395D3183D09BF0CB3A144A2CF4F3C839232 2.RWETRAINER
143,591,371 *0DCE8328464431E6498CDEBA1E5EDA8983AB4F7B 2TARCELS
143,591,372 *0DCB03E54051193ACEBFD08EDA3CF5C7CD677BA0 2.vihakoski
143,591,373 *0DCADA0E70F782D64B1DA980384A60B484C67107 2-WITTERNDER
143,591,374 *0DC7BEA6D8CAE13F601BA30928F4152E9C1A54B8 2.YUAN'I
143,591,375 *0DC349E1DD77682157B236E1394FF8ECE83188F6 38FERNANDA
143,591,376 *0DC2D619D80508E8AA8E0739111414FF3E4FBEB1 3ANILLABAN
143,591,377 *0DC0C120B4CDFE6E5E7EBDE7BDB506BD464787C0 3HELICESS
143,591,378 *0DC0357CEF78E0F09E3279B3C56EF5BCBD8117F5 3LASTERIN
143,591,379 *0DCBF2D1F5DB0B438009F3A50E0465CF7878E670 05051714
143,591,380 *0DC0B788D57D8FB19EC4F189B331343B03EF98DA 07261954
143,591,381 *0DCD96088F45344E3A1886EB2AF692484BBBA4BA 080M)
143,591,382 *0DC0FB2EB928596E2AC8B2CA6FCC680E265BFC49 3thelady6
143,591,383 *0DC86557B5677B3B7B73B77EC8CA9B439F34E145 3UNDTIRN
143,591,384 *0DC8D9D507D762ABCC40520BAE8E2955370A960F 3vrba
143,591,385 *0DC53E6F20C2B0BFBF2590D639408860630BB252 (0_<)-*-*-*(---P
143,591,386 *0DCBBD38C39ADD886F6B840BCFD61B9D8432AE9F (>_0)*.*.*Q----8
143,591,387 *0DC3B71408946E965C803087041F663204177BD6 407FRANCIS
143,591,388 *0DC944887F5504C72F3727299B60C29CCDFDA057 440HowCheeringistheChristian'sHope
143,591,389 *0DCC3DACB893DA173D827810CBC6AEF595908CE0 475383 FORM(A):YILLIKF.B.
143,591,390 *0DC7C32FCECABA019D2CD9B9ACBC6B0EF27EBBAC 4A4B946305AF3094B7A9A876050636C5-14SCHMUCK14
143,591,391 *0DC7148B1A66F5CEA3C555B20427F91068D6A0D5 4.ALOITTAMATTA
143,591,392 *0DC3763467A959CADDF66FB03560B1EAAD5A517E 10-chicken-stealing
143,591,393 *0DC2B65ACC62909A9174A982F37EECE387EB84AE 4DYSSCHE
143,591,394 *0DCCC385E38C8C599C436198EE3DE4E9F9AD73B7 116864 VOTING-DATES-HAVEN'T-BEEN-SET-
143,591,395 *0DC96A82D8CAE32BDAFC17B315D95EDD48E0B867 11ibik
143,591,396 *0DC9F9710904390C5D431CB88DE101273E4F454E 1376393 sgsfimkonmy
143,591,397 *0DCBDAB9EB8092E9E88E51B05D8D79C6F6F79879 1384207 F ESITT
143,591,398 *0DCE19D02079C7144BA5296019E62404279B33ED 1553436 SEINE NORWEGISCHEN EHEFRAU LIV GRETE POIR
143,591,399 *0DC400D01704037FBAFC77A76933299FC225DFA6 15PAARKREUZ
143,591,400 *0DC160490D52406E7C91A8B4E850CE5F00EA1ED1 15-puurulan
143,591,401 *0DCEAA534A8E2F6ADC291B7906595F365221BC53 4OFFERINGCALCINATIONCAR
143,591,402 *0DC5EBBB646FAFD7479344D49987968B3447526D 4RAUMASIVUT
143,591,403 *0DC4B006051F760215AF5AEF6983DEE85F11B10B 4SCOTCHSANGO
143,591,404 *0DC83F00BCBE57A907D496F987D72A8994C2667A 1886406 S-GT SOVELTUU HYVIN HOIDON SEURANTAAN .
143,591,405 *0DCB4454D09966BF41432907277B291ABD7FFACB 18august1490
143,591,406 *0DC9EFB7DFE5192D52CB39E8631DA1C977AF51D4 1958838 u-.-s-.-foreign-investment-in-china-was-soaring-.
143,591,407 *0DC00B572AB98BEAEB8CA8CA7594C77022434585 4VOEDZAMERS
143,591,408 *0DC50A1B87FD5F56E9C0793DD32AE0741D1521E8 4WHATEVELUCAS
143,591,409 *0DCD3FC0BDBBC68D31A8AE6456976ABC6EE386F4 514686 SIE-DENKEN-SOGAR-RADIKALER-,-JA-SCHAERFER-ALS-ER-
143,591,410 *0DC5496F481AD258AA1A7B3D0C331F6C63FDAF69 558732 OLEN.SAANUT.TY
143,591,411 *0DC05A7F797DACA44A93DC777B5343194A55AE1A 1998606 MUSENTEMPELUNDKONSUMPALAST
143,591,412 *0DCA162F0FD1C835C75CBEC75CAFD7D8C3577F9B 59-hazIrlanma
143,591,413 *0DC4D6372DDE48A7690024D5BC5142F81FCEB340 1 ASIANTUNTIJA-AUKTORITEETIN
143,591,414 *0DC6FE933C2C963B9DA99C0E2FD782C4284435D7 5CONFORTAI
143,591,415 *0DCFC4D32B6EE43958B3B51902A3550116B84AE7 5JUBBAHHABBUJ
143,591,416 *0DCDAD53AED9E37E85C151AED2C3F522D54E744F 5KINGSAFETY
143,591,417 *0DC93524F18E95C7A371063F92BBBFDB17376335 1.ER
143,591,418 *0DC4A9F5A4F78C68EB413B9728FF94129B137769 1FIRBALSAM
143,591,419 *0DCEE7D8DBB4F3E784822B7F1A0638AE713F342A 1fleurange
143,591,420 *0DC0597EB7E9DE7C07DA3A52CD6AAB00764A5F01 5MYEMILY9
143,591,421 *0DCFE8F3B7DB4C326F0D87CD8ECAC84448977F03 1-GALLUP-TUTKIMUKSESTA
143,591,422 *0DCBA3E298A9AB9B5A07BB24FAAA809276AEC829 1geisterglaube
143,591,423 *0DC2D48D1A28EAA4A3DB01EA5323357DCD025B09 1.healthsouththe
143,591,424 *0DC13166AE8920550D4962CA0CB14F35ACB410C4 1 IGRI
143,591,425 *0DC6E50F191F75E55909B097C11F87EC213A5289 1 IRTISANO-MISAIKAA
143,591,426 *0DC0DA106A13E1CDC7AB4838D50235F1B213394A 1-KADUTTAVA
143,591,427 *0DCBFBF23553716FB1D3946A40ADC161EF0D9168 5SCIMONOCEORDYH
143,591,428 *0DC3400DAB592EEEF5F2637AF24E94F67CBBCDE9 5SCOTCHSATURN
143,591,429 *0DC9C5E15AE4A06E145BE3679EF25E1D0706FC79 5SMIRNOFF
143,591,430 *0DC255570E009523A49A03E4170AD7FC108ED738 5TESTPATHBSW
143,591,431 *0DCB8BD2DAA12FBB498B5804E71162BE94D2B10A 5ub574n71v41
143,591,432 *0DC987452B84F87491EF4FAE16F23B58E36DC9A3 5YLEISMAAILMALLISIA
143,591,433 *0DC72B621FC4E62B8257EBAF52AE972B8C28F3EB 1-lohnguenstigen
143,591,434 *0DCCED4B5FE02AA14ACA4B83FC3EE0A7D3595DE5 1MEGAHYPE
143,591,435 *0DC298448FBF545B732528F5C9E0C2095337EC80 6AUSTINGINGER
143,591,436 *0DC10AD45E3A157B8C0B51DB4D46129F27874A08 6BUZZBYTEME
143,591,437 *0DC4DC348599B95B7833863041EBD62B387FF246 1POLJANO
143,591,438 *0DCED568F2F6B419DC8C84340FCD1182593F75C5 6CRUDACRUDA
143,591,439 *0DCEF34C0B81AB0306F122EB63E639C1933D81DC 6DESAMARRAR
143,591,440 *0DC5297F490DC087137E6C932D575924E59B6F00 6EVENTDEPENDE
143,591,441 *0DC82AAB8C08B2BC4ACC8BE0F64EEFF9AFAEAE8E 1-studioalbumilla
143,591,442 *0DC5B1F84E13A094785A6327F1969221A04AC174 1.TREUNHANDFONDS
143,591,443 *0DC4FA6B8335EFC7DD5D5C0914F715DF9EFAF9AF 6PILOTPROJEKTERNES
143,591,444 *0DCF618080A91B1036A164101C90F4205E639523 6REDSKINQUEST
143,591,445 *0DC023239F6D27885AE3E2B8C6C321D3698B5CA6 2241361 "-kein-vorspiel-,-direkt-zur-sache-.-"
143,591,446 *0DCE2D2CC05184F28D6C8D1227501E52609402B8 6THATHUEY6
143,591,447 *0DC4556748927A08BD47EBA1EF247F40A612635A 22KAREL
143,591,448 *0DC2FC00907D646610B78FC8B746B6C5A0775575 70WYATT
143,591,449 *0DC13B7E5985CE6DDA257356D81EA57E13D3BE34 24OCT1845
143,591,450 *0DCCB23C13AC73041CD26857FDB1A41309C2DD76 7AVUKNEDU
143,591,451 *0DC2D4D7F2C29B736AC61DA0893C3E017C420B18 7BEARBETNINGSBESKRIVNING
143,591,452 *0DC4BB14AAC7C2934816BFB314ACE80C1FAAA800 2ABOLENGOS
143,591,453 *0DCEBDC998FE28A5A2231B6C3CB6755B979F002D 7GARNISONERING
143,591,454 *0DCE57DB10B20A8CDC4A2825B0259900610584FA 7GASYNGS
143,591,455 *0DCE231D70B9C2B6B3D08D909FE10F0BD16D12ED 2BAGARRERIONS
143,591,456 *0DC2D86F8D8C39B620CF5FBF0F7D5BCE1C5D60AE 2DESHERITER
143,591,457 *0DC87EC70E1432EFC843D4C16CA54915B38C35C2 7KEITHKRAMER
143,591,458 *0DC4BD1BD6DB3FD7E1A7CBB88B5B954F3A6D1A95 7MGCPHLC
143,591,459 *0DC7E5A5B83A7C295281BE490C63C1575A6E18DF 2LEICESTER
143,591,460 *0DCC144DED2F6D23C7F703AC9C104102E6577DD6 2.LIIKETOIMINTASUUNNITELMAN
143,591,461 *0DC6C07285371411987E06EEE69EE17D47E56883 2militaryissue
143,591,462 *0DC0DD186968173DD2C97F73C7008514646AE284 7SCOTTICISM
143,591,463 *0DCB37966FBAE5AE806E97703CF67C439A1C492F 2 YLIMITOITETTUIHIN
143,591,464 *0DC78B496918F58246479E11FDC56BB831552BB8 314531 hiljattain julkaistiin tutkimus , jonka mukaan ihmiset k
143,591,465 *0DCDAC330F7B08BAC0DA9C3831AEB3954168788D 814909 ONMENNYTAIKAAHIUKKAVAANTAASK
143,591,466 *0DCDB64D0079A5810BD57114EF8D16FF17896F5F 330080 BAG KANSERI 8.2 .
143,591,467 *0DC6D1735E80AC4903405B68476FF0C6B8E53803 39.FASTCASUAL
143,591,468 *0DC584EB1E951BAB67C22F7E55F55CB854805BA8 3B<~.~D#####8
143,591,469 *0DCFFB4125459765091C62BDD59559E69D4F2BDF [email protected]$$
143,591,470 *0DC8350E23A79637C6EC0275D6ED077B600499DA 8)`~ )8(
143,591,471 *0DCFE6A943B4506CAA747BE509309DBEAD8BA0D0 8BSWINTERMOLLECULAR
143,591,472 *0DC6672733B972E95DFFAE546E25339BC7DE66A0 8BSWMANUTEBSW
143,591,473 *0DC4E4FBDB76C008E6948CC516B7BF02B74C6E61 8BSWNYANGABSW
143,591,474 *0DC31834C9D16FC8C0A540498BF3156B867F14F1 478407 EDITORMORGANENTREKINWILLBEEDITORIALDIRECTOR.
143,591,475 *0DC8841690054068FF9BC2F7652B42EDBD81F324 489545 teoksessa,jossaonkirjoituksetsek
143,591,476 *0DC4DAE7523AA5A52ED2B7790F1D233C87B7D6AA 4ATNEKKEG
143,591,477 *0DCEB053A08ED96292516315AEFAF30DBD02357A 8dba6922c3cf0a474bb181c0d8c72909.freaky1
143,591,478 *0DCE9BEE22AC421B2DD834DFFFB7DD8543EF9941 8ELECTROSPECTROGRAPHY
143,591,479 *0DC1A59E7478D27AB68E8B13B59E9587C731AE8B 4-EX-GESUNDHEITSMINISTERIN
143,591,480 *0DC23F363A3C202A9FB6DD3C60A095D25EAAFC65 8LADEPSAG
143,591,481 *0DC03C0286A26C1257CC552581CB9A0381F63D1F 4KINDERLIEFDES
143,591,482 *0DC42358E02B37643D510FF3218A17E6D151BCCE 4km8o
143,591,483 *0DC6DBADC5B102F4FA378F05919BCB94695D023A 8NYKYBALE
143,591,484 *0DC2AE0CD83FAF40A30D156DB56A05D24BB4DEED )8(o~.O~(#####q
143,591,485 *0DCBD8872F01DE8DE1F6552E7ACF106A68F436B5 8##p-~0->-b0
143,591,486 *0DCC5AF25D4A2F5F430804F08F993CE6ABE7E670 8==P~(x)
143,591,487 *0DC4C4C72E7932942B4048FEBCA6B57A844F57E4 4SKELETONIZATIONN
143,591,488 *0DC365A42BD6E881178F5C737293C63CC09B1FCF 8SANOREV
143,591,489 *0DC99226A61B95E82A0154F7F25DCBC4D2A04ACE 8TEEMAVUO
143,591,490 *0DCDE2A9A91804E4DF804182D310C91C6CE12CAA 8UNEXTINCTS
143,591,491 *0DC0B5B50C46CFB5C72AC88D34037DC08CC56AE9 8VIIVRINN
143,591,492 *0DC3439ED814F3B5A8AFAFA00143ABE3D523B33E 584358 ihmiset.eiv
143,591,493 *0DC8793D085D099924A54BDC413FA9B705BB4C22 5AANDOENLIKER
143,591,494 *0DC6C5FFDA53FBBCFAC12687C5D5B855C4792E26 5ADHYARTHAM
143,591,495 *0DC7B65FB38B8179FDB6096C9A647B35E5480723 5ATGELDEN
143,591,496 *0DC9953357E7F643981F6B66BE346180A549EF3F 5BSWGUILIANO
143,591,497 *0DC60ADB98836A1ED06AB354E6B0CAFE562928DC 5CAROLINETUCKER
143,591,498 *0DC04C98B3BCEB29B512D886484E23A8B4B2C5C5 5CCIRAPX
143,591,499 *0DC8E1D56F3D06BC941B0FB74A3DD4B2426CF0BE 5CHIPPERSAMMIE
143,591,500 *0DC729CD5E6EFF7219EBB90E730DB406CD84097C 9ALEXISVISA
143,591,501 *0DCACA17DCE7FFC126961BB90926914BEC7EB232 9BELLECOCO
143,591,502 *0DC453706BA2595AEF68A305C9EE4EAE95187AF8 9BSWNAMBAVEBSW
143,591,503 *0DCDA0B594615320C63C04B2C2EC17F644775189 9FORCECOLUMNSBSW
143,591,504 *0DCFCB21A0B432FB3F068CEB717E649FBAEE87D4 9hersenontsteking
143,591,505 *0DC3A05662E85FCF4DF392B0B99924CC58272A93 9HKOXRCHJSFAYCG
143,591,506 *0DCC5E2B2F085550E670781C209876E2B93894CB 9LIONKINGMADDOG
143,591,507 *0DC1AF6EB78FBB55CFF82D8811068D19BE9FC5B7 5gehonoreerde
143,591,508 *0DCE26420F6E3C1539CF5B7896DC2CC101D932A4 5.greasing
143,591,509 *0DC746EFBBDF27A4D5422C88665A9207CE7DA3F0 9PRELEGALS
143,591,510 *0DC6E50DE8416B78B845D0CCE29EB0754B1E1E16 5IAMCOLETTE8
143,591,511 *0DC947B05CD6133B1BA10FE1C5225BA228CE97AA 9PROTJERIVANJA
143,591,512 *0DCAB193CF85DB34E7FB553F905266DCE350C1B5 5KLIPPINGS
143,591,513 *0DC2E9215F2E46520349F958DAC5F94C974AC4CA 9SPNSHSPNSH
143,591,514 *0DC5D96B98114CF2540AEB33A4BD647915368615 9SUMMERBERNARD
143,591,515 *0DC2F6EC490A609D2E7515D1ABDC9305D38D484F A00000008
143,591,516 *0DC713198AC17C46A2088A77A781A369F1DEDF7B a0k$w
143,591,517 *0DCB78B35A77766ED61AB94F199629ADA8E773F4 5NEWSADIDAS
143,591,518 *0DC584799F56883FF73B0C452FADA7DE96FD6E4C 5NEWTONZEBRA
143,591,519 *0DC653DA64148E477578DAC806A901226C9A86FA A1R11N3
143,591,520 *0DCB87D99762151C86D7F42088D80BB3324711CC 5rijksmiddelbaremeisjesscholen
143,591,521 *0DCE948CDCB6D5521204EA354EFC66DDCFEB1A6D a4_bo
143,591,522 *0DC901DA502F5364B5CB69132BEC6C55B6FA0A09 A$4DQ
143,591,523 *0DC28749660116D4BD818CAA44494430C40D6529 5SUDAMERIKANIS
143,591,524 *0DCD50E077C45A844CEF6EADB5E741B16A41109C a5#zq
143,591,525 *0DC8B3D41541A4CBCE36AC76217D8A8D50F2BF31 a/63
143,591,526 *0DC64F500EDE799BBE3363EF93E0D5CF5D422F3F a8h%-
143,591,527 *0DCFB9057B0DDC8A301215FDC64435A54793E76B aa<;@
143,591,528 *0DCB1589D7F5756293CE756655CDCF00E80520FA A=a1
143,591,529 *0DCA6DDF3496A60198D8AAEDD49EB78B27F41892 AA3U<
143,591,530 *0DC817F4702801C48CEC2C5D715D407FE9E904E9 aaa!3y
143,591,531 *0DCDE98264C6A67B15F95D1A832CFFBEF0D0F799 AAARCG
143,591,532 *0DCD6FF18E7E70EE31419CCD7817B38D3018BFB0 Aabd#
143,591,533 *0DC6B1819693E5433F7C9CED1B4092A3AC379013 AAB#G^
143,591,534 *0DC96D2CEEDEDE7D8EF8B01D707B865E3336EFB5 6AFGEDRINK
143,591,535 *0DC76E8A70D02463E5E6922EE50D0592E0B34D3F 6BLNDMNNN
143,591,536 *0DCE4E7DD541832B1373F5E45CA5ABB4DBB82FF1 AACM'K
143,591,537 *0DC9380246CE9BA21077BC0E28F85DEEE8EFF59D AADRMG
143,591,538 *0DC0C58BE8F976DBE6499C46B72DC14AE26D19E3 6CAPTAINPAUL
143,591,539 *0DCF2D102BEA0F8A5F9A3B4F7D800B3A76C1084C AAIQ
143,591,540 *0DC85A7CB517ACB20F38C4E350AEC915ED278CE5 6DISCIPLINAMA
143,591,541 *0DCF8209999B2A711B6B57827CA61FA10238DFA7 AANZWELLEND7
143,591,542 *0DC69A6361786CB3E1459AEC50C40D111DB8A6A3 6FORMATIGER
143,591,543 *0DC9B37D0FF8889C526B0FCADC80D6150EBC7A03 a,atm
143,591,544 *0DC585963AD700CA1DE6F779A2A03C8900487A58 AATSIIKI1
143,591,545 *0DC214349333A8FB6F307E4F19297BDA45FF1F16 6GONOBLASTIC
143,591,546 *0DC01F2F3659C903215273BED6CC61E28E576349 6IMPRGNERINGEN
143,591,547 *0DC283F6E83527F530A238E7073E532FCA859A01 6IRENECANELA
143,591,548 *0DC0E7D214A6302A9A44446FB5E78017DD32AD8E ABBMEHR
143,591,549 *0DC7BA27CD8CF3E88DB3DCBA93CDADE59831E877 abcuy
143,591,550 *0DCCB14F1FB8964BC5074497A7C8141FB023663D 6.labantu
143,591,551 *0DC9B49EF7AD3CECDFF094B706544182EDF8E9C7 [email protected]
143,591,552 *0DC7CFD486F00185487DD94E8E5CB4E3F4C3246C abituandoli1
143,591,553 *0DC45EF31A4C75ED534FE1F1F5A328082914196A 6REBUSTEHOLDER
143,591,554 *0DCAE88F7802A95C3361C0001EDBFD9BE7048607 AB!LI
143,591,555 *0DCCF6138FA4E3F9901FFD31044D442F2209DB23 6SAMMENHOERENDES
143,591,556 *0DC01253244E37DE0C8AADB1C23D1316A1C2C87D 6theironman
143,591,557 *0DC300CAAEB782825C9FEEC6C3CC6CDCCD709A8E ABVEW
143,591,558 *0DC654640CC69EC2CB73E7371C21E376FA8D73CA ac1%y
143,591,559 *0DC929E40EE48537AB9335B33149353EB5F20C71 AÇABILMEMIZ
143,591,560 *0DC875BD1418F5C2B5BE8261AD37D05C2FBA6D58 ACCOMPLI
143,591,561 *0DC6BA8A034A4C283FF32334A3840197244244BB ACCONDISCENDE2
143,591,562 *0DC78C9186C5505F7209B7BDA5CEF7E898E073D6 ACCUEILLERIONSES0
143,591,563 *0DC7D52D44E3EE77ADFAEC4181B15EC7EC032720 acu3o
143,591,564 *0DCFC747EBDD5435DB131620CE64E21742B110B7 ad8)
143,591,565 *0DCD95DCA503AAC62044CCEFF6124F72B614512D 7BATMANDICKHEAD
143,591,566 *0DCB6296519AF020FF7A8E3F09F6E9E790AFCEDC ADOLPHHOLSTE
143,591,567 *0DC18CE2F4898AC9CE7125551255D553648EE381 ADOLPHLIKENS
143,591,568 *0DC1C5CDDDD1817C42281E3E4666F03F05C43B4B AECEP
143,591,569 *0DC5F0560F5E0F1A72A4B6AAF404B345AA644CE3 7EXCUSETH
143,591,570 *0DCF2B369F1E2A550BEE09B9E2774F3C726500C9 7FINGERAFTRYKSPROGRAMMER
143,591,571 *0DCD2E7EF9EE236F79FC07CCF997B5017FF4D342 AE+LB
143,591,572 *0DCE8155209B3DCBC1D6647B9D12CD46B427DD97 AFTERBRE0
143,591,573 *0DC1924D71D60A4155B739218B0E37D9737F46BB AFZS
143,591,574 *0DC683ED11CBBF29140D8B62DC6CFEFA0953CCCE a~g`
143,591,575 *0DCCAF68BECF77B1AC760941A7E7D5B2066A54B2 7HONORABLENESS
143,591,576 *0DC7C3F9CD8D6CDA09E6F248D5FFD736AFB25C5B 7kapjaren
143,591,577 *0DC07E45B395704D447E240D58EB309678BFA68F 7KORUNASES
143,591,578 *0DCD637E002CA4E679C0D2616406E631F94440F8 7LUFSSECCUSREPUS
143,591,579 *0DCCACEE0AB10AB5B1787E75D3F6AB20B297CBBF AGROINDUSTRIE
143,591,580 *0DC42135195BEAFBF6EC985966CCC57646584B10 a$hbx
143,591,581 *0DC1057BE88AFDC3CE3548196E19B249E6A38F8C AHG0K
143,591,582 *0DCF05B9BE572605B186044699E254AC3405D93A ahlf(
143,591,583 *0DC71A609750397EB4D3307664DB14C711B8D456 ahmadviereck
143,591,584 *0DCD5217BBCD87B0F6F4A5709B8AD9F064975A25 AIIP%
143,591,585 *0DCA0C48E15E392A19B7DEC38FD1043596DA3D57 7OSROLIAS
143,591,586 *0DC8D2F3D4730833D87A264EE88A29CABAB00790 7PALAEOTHERIOD
143,591,587 *0DC2038C27273A56CDF7500E0211495E055A7787 7PETTYNYT
143,591,588 *0DC8F743211FA49BCB3841836334AA14F33EED54 7PRINCESSJACKIE
143,591,589 *0DC42D57501F85D3A4C74FA02B01B80367CE7D7E a+iw#
143,591,590 *0DCA6ADCD1D8B4C4DE51264FAE2701E5C024A4AB 7RITORNELLIS
143,591,591 *0DC57AFE2F0B045EEDB1662392C95A80C9F9E007 7SICCANT
143,591,592 *0DCD194D0B04D0E2A6C22A1203073B16F19F11B3 7SIGNYSIGNY
143,591,593 *0DC5C427942D79DA5C979DD50ABA0CB1F258279A AJ:WR
143,591,594 *0DC9E3FBD5313DBE6CB507F71165DE0E227F96A8 a;:=k
143,591,595 *0DC6A228BFA5F2B0324CA00DEB8C3F9C93E9C94D AK$/
143,591,596 *0DC0EB74C49FB028DF9ADEA878E65093FFDEB628 ak2cb
143,591,597 *0DCA95F772EDD1F7B5E12D25EC39FEA503250368 AKUBRA1
143,591,598 *0DC948AF7C6743D208B21C3385E864F95AC2219B al4fq
143,591,599 *0DC01A8968B6C9EB05B59FA8D20B41FB59E007D6 alaisells
143,591,600 *0DC8E13769F7DDE1196C91AD716A14E93FDA2E51 alani134
143,591,601 *0DCACA84E908654C4F41351CC9C81AA925224511 83AU71F13S
143,591,602 *0DCADAC0038AEB5C3C90BD6A6912673F9102C725 ALEJANDRO.AMADO
143,591,603 *0DCDAF6E23BBDCA04419CF53833BD9EFF2AD596A 88imani
143,591,604 *0DCDFEB99A6C30AA9C5C32BBE4DA9868EE5A19E9 aleqm5igygzk8bjugxbxxxhea8nhf
143,591,605 *0DC659370FF41598A496BE127C5DCFCD1606199B ALEXANDER ALVIOLA
143,591,606 *0DC449934ACC69FF8B37FE88A16C9330ED39FA39 ALEX-SCHEPERS
143,591,607 *0DCD29612D0CD0A271F339B40129446E20D93D87 8BSWNETSEXBSW
143,591,608 *0DC19EDFF4A7451D9A379869C94A7ACA21183280 8CHRISTIAHOTROD
143,591,609 *0DC8D2FE774388B73365C612F90DB18B9D5F6B2A A)LKO
143,591,610 *0DC9D49FEE82B5BFDD3F6F0ED14D75B70A23D47E 8DEGONFLEMENTSES
143,591,611 *0DC1FBCEB4285B54325FDE555EB18AA41ED81D4A 8DIGLYCERIN
143,591,612 *0DCDB2BB02684F92675A5A234D04F3882F6508F5 allenwearly
143,591,613 *0DC0DCF062B88C34004F004F3975FBA7ABF74CAC ALLWEARE
143,591,614 *0DCD230504584F51C3695A59810E686F44D1F80D 8ETNASIALP
143,591,615 *0DCB3CE96DBAE9297FA4EC0EABACE1927C316D01 8GAINAGING
143,591,616 *0DC58EBF9FD2688892ADF8B5DC0F22D0F1F5E4AB ALONSODRUE
143,591,617 *0DCC4757B5F2B98CA33A82D3BEF0A33F75F8807C ALONSOGHIRINGHELLI
143,591,618 *0DC6A2D8328ECFA36C36F0AB11AA81ACB4908237 alphonsebarne
143,591,619 *0DC436CFCEA3A6FDC445D025A66A8DE99D2D55DE 8HOMEREARED
143,591,620 *0DC38D41C1ECFA64CF0E0DB8711368C3F4FB26E9 ALPHONSE.MADREN
143,591,621 *0DC122992A8550F816E4C151A66AF170640B945B ALSA'ADAWI
143,591,622 *0DCD980D80D0741AFA9F71DBEA40C2E946DC52C4 ALU7X
143,591,623 *0DCBEE191900297C37BF92950846D5DB2BF333D2 8LCKSTTCH
143,591,624 *0DC40B9B35F4C7E8B57EEE2695DBFA3B36392B3E 8liikuntaesteisi
143,591,625 *0DCB4CCDE746BEBBC08A19402B58F79469E80240 8MOORFOYOTS
143,591,626 *0DCA39E059A572246EA45A65E36C17F5CE622FD4 $AM1TE
143,591,627 *0DC2DF763138DB897BF560A5DD6258C621798AB4 AMANDA ALMANZA
143,591,628 *0DC6DB1AE4B64C3EB17EE8B090538D47A48EAF71 8RECALCITRATEI
143,591,629 *0DC0D480373A219A77DA2AF0F1FA11FABFFE57EA 8ROZMYSLELY
143,591,630 *0DC32C4DADAB394EFB19697ED1775E71D4DA0E32 8STURZUNG
143,591,631 *0DCF088A4BE3EF7CC767B31DD8A8F1511CAA20A5 8ULGINE$$
143,591,632 *0DC3FBA264F4B5A0E094903CA0F33403AA4BA735 ANDREAFRANKOWSKI
143,591,633 *0DC0C81B0AE4346595BBFB837BCB19751C39D1F1 903QWER
143,591,634 *0DC9C9A39EE9DF76F52E72791BA4AC93652497F4 9486WSX
143,591,635 *0DC77EA2E0B7ED00D0D177852F5135FC8FAE7177 angela-shere
143,591,636 *0DCF6D4999BD8FC75E49FF536F0950ABE349308E ANGEL.BAESE
143,591,637 *0DC91FC24D459E0BD9FD20FE7BF586F96722A42F [email protected]
143,591,638 *0DC5672AFF8EFDD1CCB71F7DFBC96CF976307A0D 9BSWGUMMADIBSW
143,591,639 *0DC0E630FCC10934BBB7F176A8A3A7E4498046F2 ANN.ESQUIBEL
143,591,640 *0DC252BD806D38C3F9FF113ED001EC99B25928E6 ANOTHER GIRL'S PARADISE
143,591,641 *0DC8D3F2CA8169AC1839BF92624298EEFD7CE71E AN+QQ
143,591,642 *0DCD5E31963E3CFB09F737BAC7A5EF8A174900AB 9CAROLINECCCCCC
143,591,643 *0DCD6CC7C9668DD17FF15A651E39D837CDD86222 antionefitgerald
143,591,644 *0DC6226FF35037C5E0173D48BEA3280ADBD1C5EE 9kurkkutaudit
143,591,645 *0DCCF3EC3447BED0F17F2C256212092006C6997C a_ov
143,591,646 *0DC3EEC1C719FE0EE6E3F3DFA94802F94F8CEE5F a+p+0
143,591,647 *0DCA9E1B42E18F3871B8FFA12CF6708814E9ECEE ap+hp
143,591,648 *0DC0D2C9E31906F5832A9A5F6060E9293241C536 9PINOLUNN
143,591,649 *0DC533D638BC3043A1E3BC4957C21A85185E7630 APPLESRASCAL
143,591,650 *0DCC1AB48170069CFAE812939CBCE7AF648E22C1 9SFORZANDBSW
143,591,651 *0DC489E2EF5F0D60714627317723680F4A9428FC apxzt
143,591,652 *0DCB20640653BEFE4746A4F10E736CE3CE1AC776 aq+-!
143,591,653 *0DC616842F65E3E3BD55C566D95231204916F5F9 9SYGXWRHSEWS
143,591,654 *0DC5826975E22D601E80C4F5260220699FFF02A1 aqf$(
143,591,655 *0DC2D126B9BA2AA58B31BEB2DAFF6681D435157F AQ(F,
143,591,656 *0DCE9654DBC762B51B21682F1AB510EF293C7D5C arcph
143,591,657 *0DC1135A84519DC698EDC5972E24D1208A7A5F1B a1g?w
143,591,658 *0DCABFEFE706F2A3E6D87DA480A4ADAE88AE1AD7 argzs
143,591,659 *0DC5FB2F0EA738936D321AEDD013B7CF3B68C9CF a5scc
143,591,660 *0DC3993C5CCB77D9663F88A637FBD2E4E0C49ED5 A?6a
143,591,661 *0DC7AD854505F4BA0F577C832C626EE55B1F9D3F A6+UT
143,591,662 *0DCDDE1FE83A8FA15D195B50AF4F157F916DB88A armandoelmaghrabi
143,591,663 *0DC80334548FCDFB67300908AE8A1A467AE4CE5E A"%8
143,591,664 *0DC2F0AF6AFCFE858576F21172C718CE20685559 ARNULFO.BACKMON
143,591,665 *0DC6F6D03E86BF0F2EF9C4B4782040A3CDF1B8BA ARON.SHELLENBERGER
143,591,666 *0DC483F7D1E0136E2B06F095BF4C8626DA34EF57 arronwaiters
143,591,667 *0DC9996F84317D1D8D49BEEB3C473E269745E952 aaah]$
143,591,668 *0DC0881234A28F3A797092054F09DCF92810092F aaat;6
143,591,669 *0DC61E5CA6F8361D392D612395A19C30DA05391F aab'-%
143,591,670 *0DCC49743405662D0B09D40A95928A0EFEC72EE4 asalick
143,591,671 *0DC00536BAC227C807C2825113A7D6E9E522E2E8 AABNINGEN6
143,591,672 *0DCB5B5D0A1A3479D5F5925AA612304F4E0710DC aschemaning
143,591,673 *0DCF8149B3F8FDC5E014F4BF329566B13BFDE7EC aabx_d
143,591,674 *0DC80F9779DE5759E738AFD5DF94D76DD94930C2 AACI^|
143,591,675 *0DCAF403B4F86FE958B9E3FF53076451C72E19BC AACP\Y
143,591,676 *0DCCE9557F5CC7AC32CFF8AF1B0FE8AC4B0C163B aactc
143,591,677 *0DCDBED59681E9E8CA275E5CD72ADC769F540C13 aae&r8
143,591,678 *0DCD6D6C2C6FEF81AC00DF852700091949B3822C AAEXS=
143,591,679 *0DCC5A1C4B6861A55C60DABBE0B814CB03D01003 AAIQ
143,591,680 *0DC85A7CB517ACB20F38C4E350AEC915ED278CE5 AALG9
143,591,681 *0DCE520B1CD85F00F2E5BC50A75FF7A5CF7B4BB8 AARON.COASTON
143,591,682 *0DC5BBF8BA2AB50AB58241A6E9C622EB66478F58 ATOMOWYM7
143,591,683 *0DCF8BF45847077981FD634ED86EB57AD61DABAB A.BALLOON.CALLED.MOANING
143,591,684 *0DCB642B8C6F9E8C7A580FE68BBEB9AA5E8F23C0 AU7H0R17A71VENE$$
143,591,685 *0DC004FB17650864F300971AA12F9C886E0C8521 abdulpengra
143,591,686 *0DC811B48DD5056C2458D1090CA1CB1EDDF5637A ABEL.MEANOR
143,591,687 *0DC919ED215BAC95E6EBE320A02C66E29459A0A9 abgelieves
143,591,688 *0DCC7E60C5D8A09C7A6F465064AA2120DA72D11D ABIHP
143,591,689 *0DCDC376EE36918BFE93F3EDF54AF45E74DAE832 A+B-K
143,591,690 *0DC6887B08409998FAB5F1882B0CBF8FBF5D4686 [email protected]
143,591,691 *0DCE68D21FAFF7AAF3263BE1922D658A3673E99C abortariam4
143,591,692 *0DC3EAEB0907FCD9708DA5F9887F85CDC2467438 ABP9(
143,591,693 *0DCA6677D3C8C8AAC53794DEC7F531D2C31AA492 AUTOBLACKTHROUGHCOM
143,591,694 *0DC5596135B1F46631947F3C3CED12C299F7EB22 [email protected]
143,591,695 *0DC6CC686606AAD41B656182FDBE211FDB2F22A5 ABYSSYB
143,591,696 *0DCBD7A86EBB6E437287A4B4104C04C40110966F AC\?
143,591,697 *0DCBF395D4DD31DB602C2F5939837D7F01690F25 a:c9
143,591,698 *0DCF61A7678C1D138E3A41877A9B302347D402C6 AVDHESHTRIPATHI
143,591,699 *0DC6518A01B546DD99DAB6C6DC70DDAF00BC93A3 av$i)
143,591,700 *0DCC0276371FFD2CE02755F273BF1331083FB983 a?c;l
143,591,701 *0DC1A77CC5BF67F33DC365891F77D1F2AB832B24 acl&h
143,591,702 *0DCF6D96FF61B2562CA38D9F0DFBAF6AD7B491F3 A#CM
143,591,703 *0DCAAB2AEC36BCF4B19007D6924C843D9F63713D AWATTANAMANO
143,591,704 *0DCA62D955173B455CD58BCAFAAC3C29A18104A3 adam.langille
143,591,705 *0DC54F59EBDDA7D33F94535BDEDABEF94664081D ADLEV
143,591,706 *0DC61044385205D160A730E09096E3C9536F3166 [email protected]
143,591,707 *0DCBB00447E8D4BC407BF402C03D673540A13438 ADOERGER
143,591,708 *0DCAB5615380AAE06AC3887117C7A880443A63C3 [email protected]
143,591,709 *0DC6ECE42A87F336E2B8D56BBE52DD6F4659C7C8 b&1ik
143,591,710 *0DC43604BA5A8719FD0F1D4DE4659835B9F4347F b1&w
143,591,711 *0DC88BBAD73A4F99A83A2DAFE020A3D09FF958E1 afb$=
143,591,712 *0DC63F4894C883150B46D1E62E9D4E3CE146C79A B3969057
143,591,713 *0DC2B7040DD36371149138C4172B196CFDC1B6CE afri;
143,591,714 *0DC4B8A9614E7B79A8E2A03FD6A571F544C51FF2 B5AP5
143,591,715 *0DC9907F4C2607EC3F79FEAE0451840D19F05CD5 AGGANCIING
143,591,716 *0DC64B48B611EE1F89638B114213DDF41FC25B76 A%+GQ
143,591,717 *0DCF34443DA928B0C230ED6DDCBB45E4D5B2B038 [email protected]
143,591,718 *0DCAC84DAC53CB683F49B22D038C14C7B0A3EFFD b8io6
143,591,719 *0DC39B344C50C3249E438652F4BF67A4C095643B b9qe
143,591,720 *0DC7C7A782E520DB3629B91397ABBE57A645C19E B)a?
143,591,721 *0DCB73416FD3F0FCCC5618957566F2346E90FDB6 badger84
143,591,722 *0DC82B9FFB98402B29DC37ECA99A1A67612E739F aigkeiten6
143,591,723 *0DCADAEF303CB0AE81EFFC716954DAA39887E6D6 AIMAALKES
143,591,724 *0DC47A156F5B6503D0F450830E03213C4312F5F7 BALATONLOVAS
143,591,725 *0DCE45298C99479D82FA2AAA4B3DC93EDA9D8A4D BAMh
143,591,726 *0DCB65F7DA8FB38126EB5B57923AB7B397D4BF06 aituay
143,591,727 *0DC42079EB2A65B1FA6FDAA9CF6287A7693876A5 bandellium
143,591,728 *0DC09B1C975B76AA3834F930BA15C3F491B154BE banderolleert
143,591,729 *0DC0F0EF8CE0BF7B78E276C8B0890CF67ECC5034 BARRETT.KUJAWSKI
143,591,730 *0DCA426B039C38EE29E9CFAA6A234EAB86555991 akcdl
143,591,731 *0DC888C28BB8EA047A25D4CDE4267EEED6552378 barrydevore
143,591,732 *0DCDF9699F3268AAB03F49C56FD2DCF0754B4C79 AKi,
143,591,733 *0DCD14910D2A32D6896195F6751B04D9AD7B5A61 basilwessler
143,591,734 *0DCF85DD18C5FA3EE3CDD17A5A127C0234FB8A21 A-KV%
143,591,735 *0DC69E2FC6788CEAF2630235576761AB237E5D7A ALABERCOMBIE
143,591,736 *0DC40C4FA2AD49BB300D8D332929D53D68D57ACE ALBERTRACHAR
143,591,737 *0DCCF8E3FBF2C4E874E5A4080775EB35BB82F8EA BBQTSPMIVULTBBQ
143,591,738 *0DC756C2737EB01FAEA5467093852104A245D622 alejandrokennedy
143,591,739 *0DCF009D876293136E6EB0AEB5291C19312AF884 B:BT%
143,591,740 *0DC6F31D9FBB7148BF68915CB1B0AA8F9AAFFEC6 BC-/
143,591,741 *0DC856F7A94A3B2A9C9A347C017A0B02D2CCA8E1 bc=?4
143,591,742 *0DC0CA5D3CA851F08F4CBDCD2E5A62BB156BAB9D bcacciol4
143,591,743 *0DC1320DFDB8CD64100E24CE733BEE997586019B BCGWW
143,591,744 *0DCF7A284F06F840B0B21E9AFD6895473F9D5D39 b"cmp
143,591,745 *0DCF46EC3F1AA2B5919CF9AE4549135B7200B78A Bc;r
143,591,746 *0DC1B926C4D0F40C116ABEA7162978DB2CE5D35C ALFONSO.KAIAMA
143,591,747 *0DC641439155458C41E04AEC9E051B67097DE43D BDI)Y
143,591,748 *0DC58BDD52049832CC655930AF0D4FE89969DB3E BEANS64
143,591,749 *0DC4517738E7660E595B3557785C6DBEFEDA8797 A;LJW
143,591,750 *0DCA91AE42A54739101FAAB75E616ABFE1BB0009 BecauseofYou(featFUTURE)
143,591,751 *0DCC5A9E69C745D1F72DD19CA6CAB91F6264060E BEGINNENWÜRDE
143,591,752 *0DCBD0F7919259B7C7A6947DDA1CE47D80D545CD BELLAS4E
143,591,753 *0DCF788AC562AD6AD18FE0EFEE82D8803853B68E ALONZO.BOLAND
143,591,754 *0DC5DE10CE8512662D9780A33E929A936FA2F7BA alternativtittel
143,591,755 *0DCD5233F75959A0DF951C171EB23D8CF1FB0C01 altonfontenelle
143,591,756 *0DC1A5FF4E8DB0B3007F856C4A84646C2F9AB25E [email protected]
143,591,757 *0DC84FFB5659E281E90D807306C21CDD66A697D5 ameliaacuna
143,591,758 *0DC4ADB3A0538387D1249B11B5620521ECB641F0 BENNY.STEINBRUCKNER
143,591,759 *0DCA1C6889513102D939F8A21D7B1562BD1ED7FE amplexicing
143,591,760 *0DCBDF181303FBB1649F9E755AD5A80F557DCA5E a:n:)
143,591,761 *0DCA7799D59C0029D5C2D0CA0C598172F19A96EF bernardobezdicek
143,591,762 *0DCD4392117FB8E5357DB6FE3D21CB63583EFA72 berrou
143,591,763 *0DCC4E9AB404D02885D90A5A27037A1A98037377 bertlehrian
143,591,764 *0DC4AC1B0161071CCBEAFD791FC6E8E399EBE748 anc3d
143,591,765 *0DC537DA983DA98B3D056DB7CBFDBF8BB74E2442 BERTRAMGIBERSON
143,591,766 *0DC3053F5B8F6DC852E7B865D5C0C35806692408 BERTRAM.VAIKO
143,591,767 *0DCA409306E8C5272C765B71C4C004DBC91FB879 BEUJR
143,591,768 *0DC5C687D966577F5CD51E35AE2B158094AE7DE2 beyiakj5a
143,591,769 *0DC674A2A21603E476B1C0D1E3944844EC97EB55 bezante9
143,591,770 *0DC9FC6C1B3E06949EFEA5444636B57D0B43986D ANDROGYNE
143,591,771 *0DCFC9E4DEBC5E3096F25A0B1A7AAFB46BDCDCE6 ANGEL.HOSCHEIT
143,591,772 *0DC9E1CB3AF0640C5E1A16233C5DB9288CAAEF16 an+holo9!e$
143,591,773 *0DCE4B0A52AB1A26A6987640959726E73AC1A47A [email protected]
143,591,774 *0DC13D7FBE4C251900F731E4CF8B3E528FF0DC3C ANIBALPROHONIC
143,591,775 *0DC2D62EF77C52AD058DAED1A5AACE1868B33048 BIGTRACK9
143,591,776 *0DC2F90AF4555CD7592D7C79B0538B688958EC56 BIJA3
143,591,777 *0DC4110FFF98531E62B6AD3D8C2CE196EDFA99E7 BIJDJ
143,591,778 *0DC80B2215E53820BD64A6578F90A1E6AE2A984F BILLIESUDDOTH
143,591,779 *0DCC0DF8776AEC79A1524C8B09A3C065E4D4595C BIMASTOID.
143,591,780 *0DCEF8F5451408FCAF55803B5A51E4E8602C54C5 ant.ho
143,591,781 *0DC1A49B03215FC17BE20C8D393CD1619C77ECB2 ANTHONY-AMADI
143,591,782 *0DC2D2C2B565A850FD6E008DDD8B086CAAB8CAA1 antigbook
143,591,783 *0DC067D9A0E0841846BF91889D650CDBFC07FF78 ANTIONE.SCHMIED
143,591,784 *0DC2E8CE9CAF19BE8F92632397D2BB0F5A6F1367 ANTIONESIZAR
143,591,785 *0DC9809A73FD7EDCB557DAA7A155A89A924B7C63 BITTRIALS5
143,591,786 *0DCE919544BFDE77DA5137F134369734DD5F56D2 ANTONGROBSTEIN
143,591,787 *0DC168BD09AB1199DE32A2FA87F5B9F426334113 AÖGEORDNELER
143,591,788 *0DC0F5542B00DA1304BAECA13D09EE371E870546 bla8h
143,591,789 *0DC12C9E232663405B0E163A0CAD36228E59754A A&PTE
143,591,790 *0DCE39F7EDF84C4C63167E025D51B0AD9F50D7A0 BLO_
143,591,791 *0DC00BD0D4D0CC25AD307FDB5514356F9424B2B7 blokvogns8
143,591,792 *0DC5AF7C48C30F97FBDB8D19561ECC0552B819CB ARABAYATASKOYDUM
143,591,793 *0DC7F208F72968536BEEBABDF046C5BBE0375C06 BM"3C
143,591,794 *0DC42E34AA5EF658194B1EA601AEACAD30B9BF85 BMCUS
143,591,795 *0DC473F2D3DF4C5C103F63346066ECF34A03EC52 B,MM
143,591,796 *0DC78D2ED1B5428C5CF682BD86C5DB5D38129D47 bmv"m
143,591,797 *0DC8A85650C3FEA62FA458D899484A473DF6CC5F Ar,r
143,591,798 *0DCBEDB1A543505D5E2474311289C075613BAF73 bo$):
143,591,799 *0DC481553AA3049C0BF09247A83E32A8500900B0 BOH;C
143,591,800 *0DC1962319A10C96A4AC7CF47E37E3A5BECD5238 ARTURO.MAINVILLE
143,591,801 *0DCB074E0A1AB9858F3543CF41E1AC21B17CC93C BONNEMENT
143,591,802 *0DC4A795F7E750F187F5EDCFC363404CD10D48DE aryana214
143,591,803 *0DCD9FAAB75596A569CFC61B6A202A9A3B3C18A1 ASHLEYZEA
143,591,804 *0DC69ECBE88BF434C903BF140EC08BD679136B7D ASIAH.WALKER
143,591,805 *0DC47A59E089B42836EB5F0C603029DFEA244591 ASOODEFARD
143,591,806 *0DCE7058A33C387128A7D680292649BB961C90D7 ASOZIGS
143,591,807 *0DCA334B2F808B9ED37471D339A60C906090A3B8 [email protected]
143,591,808 *0DC003F52A0C448CD8B19381D69B55A66993F4C7 b--p`~.)0(
143,591,809 *0DCC65DB907E34C35740CA0F3CA0385EDD6C9090 ASSMU
143,591,810 *0DCB942CE16F8C106BEB09DE16A6D3013E1F1D6D [email protected]
143,591,811 *0DCB32968F2D92C918171F77129F5A0778276E57 ATESTINTAJ
143,591,812 *0DCA9D760A4DEE5A1992879C42F9B81BE504F91C atom』から『marvel
143,591,813 *0DC079B4FF242471B5635C29556132C296DA3C1B BQ,TP
143,591,814 *0DC3DC6173AB1E19A619E92D112C310EA7192A3C ATTOIIIROSETTA
143,591,815 *0DC8C248328856D380B9C289EAB40DA5B4877E63 BQWM2
143,591,816 *0DC6849BDC472E2EFA6364776698AC52D56CCA53 br0dt
143,591,817 *0DC949D032E02ECCBB2A8CFE9429CB39728F16AE br#?a
143,591,818 *0DC1876CBB0B6D2B0366B7D74329AE64B98C8901 BRACTEING
143,591,819 *0DCC92AD2CB0110FB0208F072D612426166C9766 BRADYDRYMON
143,591,820 *0DC8F04FAB16FF5BBC15806EB14C2B28DEB3A6B3 augustinehuntsinger
143,591,821 *0DCD8C07F94666F777569294A817103FC7340235 BRANDYJSBACH
143,591,822 *0DC67F793C6859E00BE01C464B1395D763B99369 brantpelak
143,591,823 *0DC037895F07971A1CD9DEE4B05BE71302269F78 BRASFLIH5
143,591,824 *0DC573DDB8CE5C19CB1AD88D302F9477C1C460B8 Bredase-jongens
143,591,825 *0DCC99DA89E4419C029FAFE56C742AD611E3219B BRENDANSPELLS
143,591,826 *0DC79761A02B2D944EC0EF16611D6E54DA59E2EB BRENDONRIISE
143,591,827 *0DCFD11FE8E0A7F4C48A561E1D0D15E2DEB4FD09 brent.corr
143,591,828 *0DCB0415438686D863C4E7CC10CD032A94C74116 brentkross
143,591,829 *0DC1837BB7A155A653170C2ED4F93FF020204BAC awbnh
143,591,830 *0DC38BCE322411469BF757CC8910BA4CEC965F91 AX8HV
143,591,831 *0DCCA46156C4822E40D1C5850B9494805011F272 brunooneale
143,591,832 *0DCE5C2F0ECF0779FA4AA25BCF996E87A1B7CCB8 azrbj
143,591,833 *0DC84826DCB953797DEB64CD83D49FB8FBE8BCCC b;=sd
143,591,834 *0DC53A37D4A7762D647FEF41EF1893B801441752 b##)**>-<
143,591,835 *0DC7FC7B5DE12941965C2DC1FEF76A7B091D1F58 btbge
143,591,836 *0DCD82F194CCCA6D72166EFFF8C2F4EF90D9DCF9 bthe
143,591,837 *0DC13326B09E06C2CF78825BEC919F500B44DCF2 BUCK.ASHALINTUBBI
143,591,838 *0DC420B4E998390D03EAFAC8C49B52D589116B15 bucket.out
143,591,839 *0DC691F0AF93E46496117C298386F9287964BD40 [email protected]
143,591,840 *0DCB52DE361D1ED2F0F4A0B05C56E5C30B293892 BUSTERTURNPAUGH
143,591,841 *0DCBEC0DB4419341E1EB3A1D3A7146D695E89F86 bveui
143,591,842 *0DCC2F5161BCDCE3C686F4D5767AE3D5DB57197B bviy
143,591,843 *0DC8C558D180195E887B8645F3A1FDF0C70A8026 BXIQ%
143,591,844 *0DCF36649D3D640EC74D162AE01C3E274787E419 byr_t
143,591,845 *0DCDF348DAE161B5BDB5549FB820AAEA924D0FBB BZ3UE
143,591,846 *0DC877311173DB08527E7B536FA526DCE2901564 bz(a2
143,591,847 *0DC02881493DDB29BAAC3FE517225EF9B6E22D56 b1w))
143,591,848 *0DC12203DC76BF0A5132976DF63747DAF03D5CC5 C><
143,591,849 *0DC85D0866D29E400E1C67665EB2894445C1733A C-/"
143,591,850 *0DC37DF6F0B48B10EC95E5BCA82B666ADD1D51AC b3ldi
143,591,851 *0DCB8143121A3494A2FD496FCF21AA206C43BBA1 C0N$I$T3NT1Y
143,591,852 *0DCE10DE30EDD64042B2F35D219EEAC4A0E4C93D b&6-k
143,591,853 *0DCCC33B7B30EF3F8C91C642B67DD4B13B71E222 [email protected]
143,591,854 *0DC58B5124B7FA6ACCD75B3AD6126EAF9E694788 B7/HB
143,591,855 *0DC8336D661F0F951C6CFD8BD9B25EE504C8437A b?=8#
143,591,856 *0DC163E621F02D515DB2549E61080A85AADAEB4F BACILA_LAURA
143,591,857 *0DCDE6EF8B84D326A9D3509D90E90DBB42ED7A42 BADDRESS
143,591,858 *0DCFDDC0623E8D0CC71A1724A4C5BE3BBCB8C3F3 BaF#
143,591,859 *0DCEADDD080AAB9DC5D7AF3B016E77F62A3FFBE6 Bag-O'-Monkeys
143,591,860 *0DC049978808D699C85A4DE5260EE0216C4FD733 [email protected]
143,591,861 *0DC3535F36F0F058E84602D16325849338E551E2 [email protected]
143,591,862 *0DCD3A4BBD288EEC8A10438C2CF8D7511C09C753 c5e"v
143,591,863 *0DC982B559B0B9DB81BE0EDC3E8D0B4C43BA3419 C6-I$
143,591,864 *0DC34A2D30F3A9C5BEB275C9837393EFBC6B5D25 B=AQW
143,591,865 *0DC65E67EDF51442071213EC8A882E244F7C519F BARABÁSTELKE
143,591,866 *0DCCDFA20A09211144ED7A7EF9FEBBFAC0A20F9D BARGROOVES:.BAR.ANTHEMS.(DISC.1:.SOUL.ANTHEMS)
143,591,867 *0DC5AC47877968D41B107A1DC0EE00428544FFA7 c8w!
143,591,868 *0DC7BBB66C7DD09CF1236E4CACE41B8E6EA508DD BARRY.MCELRAVY
143,591,869 *0DC69D848F8CFA9ABF4D95E2EC0F755744010480 BẠT.HỒN.BẠT.VÍA
143,591,870 *0DC7CB11CD073195DE14FA356F29E60B1BD31051 [email protected]
143,591,871 *0DC9E77FF0DD60B809FE77AA7E9E803FC1AA82B4 CAMILA-SWEET
143,591,872 *0DCEF2399E61B40210733E75025C1F5CD8A8486D bd(b)
143,591,873 *0DC3F1FC3CFA1229D5DEA429D34607582E48A3C0 BDEVECKI
143,591,874 *0DC39984084BA0CDBEF0FB13B5AB831B3FEBA8D8 caraeniling
143,591,875 *0DC21E631ED2AE56C9DF380545807AD917850525 bdpsj
143,591,876 *0DC72D4C9CF83790533F2EF8C5E7EDF09285A0E8 CARMINEMONTONO
143,591,877 *0DCEE56F85680AE1784EA840C3B07E6C865FB528 carolpait
143,591,878 *0DC651812FAF9119E2167ECA539F4C42E638A6F9 BEAU.RUSSO
143,591,879 *0DCADBA58FD8BDCFA8D2AD35729AB7458FB0CFC2 CARY.BLANCHETT
143,591,880 *0DC4835182F980371D4DD921247F93DD32EE4274 ca-s"
143,591,881 *0DCB722200A2AACA1EB78646890F66E311BA0299 CASA.CONSISTORIAL.DE.VALLADOLID
143,591,882 *0DC2F8105447CB9AD7107F6EA6F8690D6E49CF3E beop6
143,591,883 *0DCCF4D3C0CDCFAD3FC9C1458F340EC59A2E7D14 BERNIE.MONTEY
143,591,884 *0DC00967A31F76686B9E4D6681E39CFBB1E12385 berryboden
143,591,885 *0DCA33D558CCD3802C445123EDE00EE89AA9B019 [email protected]
143,591,886 *0DC34EF91DD3EB5FE6B8D0182AD51C42AAAD9ACB ccc0z
143,591,887 *0DC08695FB98DE68CF9CF8E8A419993034080DAD cctoo
143,591,888 *0DC636A4758878FAA1FE27AAB51AD43021354623 [email protected]
143,591,889 *0DC150C498A4AC78EA2FB9B2CCB054F7A5146FC9 BEVERLY-HIATT
143,591,890 *0DC153834B226C04F04CBCE1EF989527C89F66C4 BEWERTUNGSVERHÄLTNIS
143,591,891 *0DC4A6639AD44B79ED85C4F1823B8C36787FEAB5 BF3QX
143,591,892 *0DCD12FE9E115F6E7441116F44F27D9C8F5A015B Bfn5
143,591,893 *0DC837C4515D43825B808D40F24197830E04C879 c%/e3
143,591,894 *0DC4C4B354798F806627BFF52F6B719A9309C877 CEQNQ
143,591,895 *0DC22E455B49FF90703C9AEE1D882354E996169B BhBd
143,591,896 *0DCA4088952B9AD37B925B0622BF87702B5630D4 bħr+
143,591,897 *0DCFC50916A8D06BCCAF4EFF482AD9BC8BF70C71 cf")a
143,591,898 *0DC89C2D7D176975E32727C2136971300632FEEA C_fe
143,591,899 *0DC28B1FD1E9BD6B6D7AD60A14F0315B8CA9860F C&?GA
143,591,900 *0DC70FD8BA1968CD155B57419856014379365759 BIGBIRDBASEBALL
143,591,901 *0DC7FCC2E188C4536B8308B84747BA4B02CA10BA bi-h
143,591,902 *0DC433630778015D161476F61EB4D0DA220A48F0 cgiw
143,591,903 *0DC54DB94A9ECF43D322A5CCF7ED014A1E871606 billsuit
143,591,904 *0DC327C894CFAB1AB52D0D655BC13C7D07C61CCF CH.5N
143,591,905 *0DC122576135125139693BEDCFDC9D0BD1518487 bishop
143,591,906 *0DCD4F7EBA9D9ED48F0208300AC16CA7A6872B3C BISHOP DESTINY
143,591,907 *0DC3AC81D866C21612073874DBEE405DB072512C CHADLARACUENTE
143,591,908 *0DC2A99764DD51ED45AE61C72C3F31D143D5A9A2 BJ.B,
143,591,909 *0DC02270C2B9B85BE66059C39301567960FFAD94 b-jef
143,591,910 *0DC4855EE51D4A9267F1DE1A65475624C00BD40E chantban
143,591,911 *0DC1677927294AC1A6060FA5597EB2939D759ECA [email protected]
143,591,912 *0DC6826E091D8B1ED1BE9DB4B9E85AF2D748D102 Chapter14-07:InLondon
143,591,913 *0DC50773D13A26C762CFB0E20DB2D86176AF86CC chapter 1: blowback our saddam
143,591,914 *0DCE809F7582696FD7B376236D8AB55AE1578EA6 charleydopico
143,591,915 *0DC5E00169414A92038468B0DE076522420684AC BKQU_
143,591,916 *0DC7B1A4EA9F4B3D254FE81117A119904E21365D bk$ro
143,591,917 *0DC1F1F7BE339BF2E9628DF77EADC95736937BDD BkZp
143,591,918 *0DCE0B6C0365511E4C499C7106AFEAC2378C278E BL00DS7R34MS
143,591,919 *0DC8A9A8AAB57E178D2DC6B9E65FAD0B6D7C99B5 charmending
143,591,920 *0DC2B9D4CF21DD7BB93DE23839CAE4FDF1B9ABF1 blaircurriere
143,591,921 *0DCD8DEBCE7D15EB2EAD1971374A6DC9AFE37C66 blairsenff
143,591,922 *0DCE40119DE5FB768ED7C59CBC251B9E0745EE7F [email protected]
143,591,923 *0DC727C60939387A7C7E24678FF1EDDEBF7312BB B%LGC
143,591,924 *0DCC7FDE2E24C5DB2D642940B8FF68B1B249117E [email protected]
143,591,925 *0DC7A8A6F84ED86AA153B75214DBEB5EAFE27832 bloediger2
143,591,926 *0DCF913355934D7FADD8AEA475C2229489A8CD7F [email protected]
143,591,927 *0DCC5642EEE5E746B71B1F26E17431547BBDF75C CHER480
143,591,928 *0DCDACC96CE9AE222CA1A0766C88280C77DC494D BLUMENLAND
143,591,929 *0DCEF648E6733AC0C3411EF1D161B99CB11EA78A [email protected]$+i$ing
143,591,930 *0DCAD5D447DDEB8E699A7BC9DE45A34C4FC115EB bmwdragon7
143,591,931 *0DC041E484C4038A00188ADED438684436C2C3FE CHLOROPLATINAT6
143,591,932 *0DC75C6DB7C0AF41BDCC1FB71E5132039C18F2B7 BNQ=4
143,591,933 *0DCCB2340442FE247C72A353886B359D300D3759 CHONGRYONGFJELLET
143,591,934 *0DC0E1C46174D30DA04F33027D8A17E511029BC6 CHOSAHI9
143,591,935 *0DC94FDDD04B43D314644FCC214F39C28027E104 BO&8W
143,591,936 *0DCB736DDDCCF4A8DC95A33D0B0ED1B40F6AEFE4 [email protected]
143,591,937 *0DC51727C7FA74EDA72719FE6F33A5D078B45FF5 b!oenerge+!c$
143,591,938 *0DCE44E80CC0399527C3EA2405CD1DD2A8B0757E bolcm
143,591,939 *0DCF9FD518E5CCA4CD1055182AD5267C017F766B BONMAHARAJ1
143,591,940 *0DCB6B856E443923F55410FDCA4B37D3B7BF6B0E CHRISTOPHER.BUBLITZ
143,591,941 *0DC8B109073F4B4A53C1AC4A1ED5833DA673DA12 [email protected]
143,591,942 *0DCC424C79A8345C699EBABF52D39606C6672933 borisselby
143,591,943 *0DCDE0FCDFCA68C3947B90F7FF8443B56F5BE7A5 ci$$4mp3l
143,591,944 *0DCE79D5D9FC216E4FDC2A211528DF1CA131D15D CI&ED
143,591,945 *0DC4125CAD62B7CD8D2D07058D265FD37B9B6945 B===P~)0(
143,591,946 *0DCCB9C2D1256D221A3548572C0794F281FE7168 Bp~O ~o(~_^)
143,591,947 *0DC06AF03024B14989F3B2CF55CD39DAF4E22171 bpptn
143,591,948 *0DC6943CB154CFBDE3AEBA4A78F85358E48A4372 cj-m
143,591,949 *0DC5881507EC6E49C5A7993256F6C55AA6561D09 ck_(
143,591,950 *0DC661250C31B8FA04235B8AE588392AF35DC123 BQFV
143,591,951 *0DC655ED180246D65F82093CF7C52E053A43A6E9 ck63c
143,591,952 *0DC810CE4C0A3223B8305DCADE0F4AC4EDC60CBA CK(9S
143,591,953 *0DCBE7877FC484C24C5D1584533784F5B36A0E7A ckbu
143,591,954 *0DCB545747C0CDCABC5EE3228B677FA1DFA76B6F c'''k'''e'''r
143,591,955 *0DCDF3D24AB22D4DB2707FAF96290E03B7B2C26E CKK8Q
143,591,956 *0DCC56DC1121245BCEF8F4F77B8662A2A11B3EC5 CL1WN
143,591,957 *0DC44379D3E45CA481858A1D5049CF056B987BEB BRANDEN.TOMASKI
143,591,958 *0DCCB6F042F531A75A4F73D716673D7A7ED6A24C CLAUDE.CLEARMAN
143,591,959 *0DCB5D9BE6A3650C5519860B2FF9783B8981CB7F ClC=
143,591,960 *0DCC933266AE596230811A7BF19610014475B880 CLIMATEENERGY
143,591,961 *0DCA9DBE78A51FB7217004DB2EEEB4C4DEE2CA11 CLINTFALZON
143,591,962 *0DCBD602F076C88D1668405BF4C98352DC5CEC5B BRENTONWEIL
143,591,963 *0DC9845372835D70D200B2136D868512B2CD4112 cloki
143,591,964 *0DC30D9A2224ECD76DDD8D370C096C9C654B1DD8 brfa&
143,591,965 *0DCEC722F2787176F6FBD9FF5E6CD46C2A61EE45 CLYDEGONCE
143,591,966 *0DCE34B1FCD8CD6E79C562F4B58A28FE41B09D9A BRIGFREDERICK
143,591,967 *0DC5337E9DFA6F20D1D47DCFEAB3BDF92C3A56B8 CMAAR
143,591,968 *0DC50CB3A63113BE4E5F205FB899D2436034C388 CMCDEREQ
143,591,969 *0DCF1F92C355F49A69899929B4C82EF2CAE1CC65 CM$DV
143,591,970 *0DC991A9966397560298BA1F7D0A53AA42C02277 CNANW
143,591,971 *0DC366D6EB6490B95A1152D2CB82120D80FB1136 cnk2
143,591,972 *0DC8C344396B0D95288580B6F2F17AC02C79730C BRIXCORPUZ
143,591,973 *0DCDC3461AAEAEC32EE4C923309F84EF577D2864 cnoqr
143,591,974 *0DC779ABCE3DD5705576AEE2C525A21CA956C817 brookstreadwell
143,591,975 *0DCC9D3D4B9F8EDD1767A95BD158EC506420872D coastprovided
143,591,976 *0DC75B9380FF5AC00857D3394E67471AD9866A16 bruce.fenstermacher
143,591,977 *0DC2D7B028A5AF8D5BDBBABD4992EA9CF983B86E C-_OJ
143,591,978 *0DCF31850DCBF5A3E78649AE670B691BE94B6DA3 COLEMAN.GUISTI
143,591,979 *0DC85ACC282B64CB0F289D4738A593D3BE2C3EDD br(z9
143,591,980 *0DCC0D7E0114241184D6891B63034AB4B9110027 bsworticentrobsw
143,591,981 *0DCE35EAD331519C232005C4731CEEFBB240E02F comme-tu-as-chang
143,591,982 *0DC0A64322B62236CA5BEDEBA92B70ED484A90A6 COMPACT-TOC
143,591,983 *0DC36F027FEC4CBAB7722D4F3F69D1E2E3A060EC BTZVIA
143,591,984 *0DCEC83A249958625510125D1F6391B4B3A0FD5E [email protected]
143,591,985 *0DCE74A53CB6713918F565C63A15BAD9330EBAA3 COREYCALVEY
143,591,986 *0DCF615ABD9D8E9518439B4D8E26EE1E8029EED6 B?WBV
143,591,987 *0DCCEE43F3C1FB301C516B20F48EAFF6EBB79190 COUR7ESANSHIP
143,591,988 *0DCDDF724C5E4202764B16869ED2B3680B08E3D2 bx./
143,591,989 *0DCF6A0A30548A3310449AB0F4C28931EBB91BF7 BYGGNAN-THEBUILDING
143,591,990 *0DCC03EA322234CB9F5B060462EA52EE1A4A5684 BYTEBIT2
143,591,991 *0DC632048B2916ECADAEDE5E71044D5EE7B723D9 c:\program files\microsoft visual studio 9.0\common7\tools\deployment\vsddialogs\1036\vsdadminsplashdlg.wid
143,591,992 *0DC6498EA6F70FEC03EDE5206752D78A13DD005F c0mp3n5ativ3
143,591,993 *0DC908ACC008F4B818AACC39FDB2647B058AC42C c0o=e
143,591,994 *0DCD1394CD2FE2F94E30D233C89B1EF60287966A C0T3RV0LL3Y
143,591,995 *0DC3187089255BD1A01BA9733E1C07054B3A637B C1arfca+0n
143,591,996 *0DC83FB8BD642BB610ED2D53B5DA371AED1C9E47 C&/2
143,591,997 *0DC601B5460554B2A8F52ACB8C920E6A1745C074 c2yld
143,591,998 *0DC4040654D33A956B352A5C9829582A78E83102 c:\programfiles\microsoftvisualstudio90\vc\include\cliext\numeric
143,591,999 *0DC5120567FD2B104EB5DF6B3FFFBD607D393AAC c5g0&
143,592,000 *0DC0F4B6A7B229B74AD35BAB17AD854A72A05B10 cptnddu4
143,592,001 *0DC212C393FD101A8550A2C1CC0B3E0D020F1623 C6RBO
143,592,002 *0DC7E3D8F234CB98039145E3FD3ABFA16B12B6CC cq;ss
143,592,003 *0DCF9F3075EC5438B1E7D292537816F2F074B2D8 CRENGELDANZIS
143,592,004 *0DC144F562F759521ED3F2F9ADC0FE37A257271F CAMELLS3
143,592,005 *0DC85D44E375EE521F6EECA83D19F03956F4B3D7 [email protected]
143,592,006 *0DC268ACEDCA8ECCBDAA60426B3071FF21BD8532 [email protected]
143,592,007 *0DCE1FA1E27C98110048738CC7C7BA556D3F2DCA caok?
143,592,008 *0DC39F842ACF69CB449381E5FEC1CB5545C5BB7C cshrcloginnewsrc
143,592,009 *0DC024B6487C8536B328ABD9ECAAD4539482F126 C(SK:
143,592,010 *0DC10E2A068B849DB14EFCA22110A5FAAF94D394 CSTEBURG
143,592,011 *0DCA6369C7D2700BB63C33D8C40983208AA5FE41 carypares
143,592,012 *0DCBA9295F91222F09B3F8F53DEEE6DFCB85CAE3 ct;lp
143,592,013 *0DC0679662237883C632F38C37AB8C4C6BDEF5C3 ctus/
143,592,014 *0DC51B7DB8BBB34CA6BECE3E7F9640CBA38282F3 cu1ec
143,592,015 *0DC36D8C14C02B2296764C6F9CC10873BEC8AD96 C-AVQ
143,592,016 *0DCE1C4D4F614648F46581C020BCD69B5D8C00D5 cazzobsw8
143,592,017 *0DC956939CF65050B7C0527FE2869499BAAAE24C cbem
143,592,018 *0DCBCC2277333A2F77C4DF5286577752407E55CC CBI%D
143,592,019 *0DC12514D7DE030305E4C6D714051F71A0EB3161 CCDW
143,592,020 *0DC9C4E1B5614A7D47AD01C61D0662EFB852595B ccm&n
143,592,021 *0DCA373A55322966F51D13A330B56AA13DB02537 CV(FG
143,592,022 *0DC4893F83CBB94F161BC946F585DD6061EEFE44 CDLA/
143,592,023 *0DC441064BE8910B3DA946874A9077D0F0CBC12A C=VK;
143,592,024 *0DC93D6B65F1A7DF435587A85D0C56F4F2ED6703 CVP)J
143,592,025 *0DCB23A99CDC786A67ECC76F20F553768AC7E66F [email protected]
143,592,026 *0DC9932A98A7F980CCEB2BAF0B0F5B7B1B77353B CZĘSTOMOCZ
143,592,027 *0DCD83E3D9A9C0E6A5063BC45FF71242D905759D CZN(
143,592,028 *0DC9A1F0C95EC3A4E003848E12E162920883908B cettes7
143,592,029 *0DCEC98372C24C4678E2653BDC7ED4379DF48E8C D0UM
143,592,030 *0DC0266239A28E6B47D7996F158D078406ED8585 D1!2P
143,592,031 *0DC5BD1E9EBE72E4E04261999A06081A8FF4FCE9 CFZQD
143,592,032 *0DCC2266678B8A566BA3BD283FD0472A42FC7B1D CG=="
143,592,033 *0DC8196AA4D749F0212CEA7276ACDC815D48B2E8 cggwa
143,592,034 *0DCD8A18EB52CD51B28C177EE4F10F520412E8FF CGN8I
143,592,035 *0DCEE8EDF01AA669B76157CB585D7028A2BECF99 d3b$%
143,592,036 *0DC8BAC5677001BC82036332A2E01A4BECC23E9C CGV/.
143,592,037 *0DC903D3008BADD8C81EF4167EBBDD7AE75F69D5 d3t3rmn5m
143,592,038 *0DCFC6199BB964CF7DBD249C37E35238A4A410B9 D_5Q!
143,592,039 *0DCB0E8193D35B5A2B2BD0DAF002D526E5E952BC d7h"l
143,592,040 *0DC7D1C922815579D9A6F543601B03810B967286 CHARLESTONDM
143,592,041 *0DC397E8FF056A69E460BF0FAA904547E582FA7E d!9vf
143,592,042 *0DCD4605BEA733F231D51CAAE4A651041CF5CA2B Da,8
143,592,043 *0DCDAF10E750BC2E38A0ED56936779921C8F2298 DAGORDE9
143,592,044 *0DCBDA55CAAF0804D0F0045B57688942CD94CBBA [email protected]
143,592,045 *0DC2570A1A93076F091FE6439188B31E3F5CABE2 daitavane1
143,592,046 *0DC8A1D9D1875640326D69AEC2FC2CC4BD9625E8 CHARLOTTZ5
143,592,047 *0DC218E18C0D9EF07A11343BA870B6E953CF9465 DANCERP9
143,592,048 *0DC946050DBEA274273285D44209DFE7391D32F0 [email protected]
143,592,049 *0DC5AD9D3750D77525D92D9DE6E25F872DBEE302 [email protected]
143,592,050 *0DC7A9618A15852635868F4C94B05113F89E4D89 CHERIE WEAVER
143,592,051 *0DCD583B38BFC431181564D08DEDD256806560D0 DANSBYSTEPHEN
143,592,052 *0DCF0771327B0203DA6C9DDF203F81348128CC4A CHI.O
143,592,053 *0DC316EE9DDE998A457C1C2E4575B0C1043F03E8 DAQUC
143,592,054 *0DCEB3B28F4B951E91D5E465CB1DDC052C37445E darenwlodyka
143,592,055 *0DCE2162B806B9C4CCD8FE1D99B8E40E6DE8D0E5 christianauble
143,592,056 *0DCA13A92B0E04F176E6DFD9A6A8D711CD730F1D CHRISTINAARMENTA
143,592,057 *0DC6C0E56BE312A671D22402A97BFA3E245A54FC christine.oram
143,592,058 *0DC6106B23A3454C8B8587D97CA4D3FE080BBE04 DARWIN.DEVANSKI
143,592,059 *0DC6553C12FF725182FD4CAEC1A637D5C71A74BF dattw
143,592,060 *0DCA124373EEEC882E80C4251EDADAEDEEA02F7F DAVID-PAVLICH
143,592,061 *0DCC1EEAE025A5237D81F8BA5CECA7955B9FE7D0 D(C4
143,592,062 *0DCB933139837F1FC6FC24396E7017E75D499260 DC42AAAAMAAJ
143,592,063 *0DCE10C3CA70019D8308252F60854D79416EAF7F DC=ER
143,592,064 *0DCB49A16CECBAF133CDDFC8B727BE9E25D3B18A dc"o5
143,592,065 *0DCB7763267F9BBAC902310845C28DB50A499EE2 [email protected]
143,592,066 *0DC6B33F276926A17F40FE957EBFC7362EEEECA6 c+i)6
143,592,067 *0DC0378A516292CC0191AA703B0247EAF0106B56 ddcbg
143,592,068 *0DC3926911DC1BF6BBF48C993464D50C31A7F162 D_D#F
143,592,069 *0DC67D8EF33044281E937A4BBD047411F4393645 DDIET
143,592,070 *0DCA49FE251E0FF26FDB090E712D6DD6FB7FDE2C CIPRATI
143,592,071 *0DC3AB0EFF59F51C33DAAC584D0FA7B978323B61 cisaillant5
143,592,072 *0DC2FEC5747DBEA1277744CE88D289F6C8D7DCA4 de%/-
143,592,073 *0DCE1500C7D0A8629A11DCABDB8FDFD045699727 cje1t
143,592,074 *0DC2B0097B9A7FCA86C5BBA31A029E16A5014EB1 CJLU$
143,592,075 *0DCF5B18D8EDDAA7A8320B020DADE54762FC53D4 DE$A1INIZIN9
143,592,076 *0DC1D3901EB24D1466259183A49DECEA86D59E27 DEAD RINGER FOR LOVE (FEAT CHER)
143,592,077 *0DC43BDDEB376A4D2362F19A7E650DE18C5CCB75 ckbu
143,592,078 *0DCB545747C0CDCABC5EE3228B677FA1DFA76B6F deathgurgle
143,592,079 *0DC972661FE5F2863E94592302F2BF225DE025C1 deblier9
143,592,080 *0DC5D0C31634A750496036D436B08F2706A3C16D DEBORAH-MOUNTFORD
143,592,081 *0DCC7928F400F3D331FD7C000D0A19C73438211B DEBRAMCCOY
143,592,082 *0DC674305C94910F739A16D6689F1CF32E87F29C DEEPAK.RANGWANI
143,592,083 *0DC0F8B59150B93951B9438B216875B6A0ACECBB defaeldns
143,592,084 *0DC4DEF8CED4742CA45EC372E9C4182AAB06AC2B [email protected]+$
143,592,085 *0DC88A24F89A1AE2F6E3621A716B4CD0F7C6320F clarkbandit
143,592,086 *0DCBB718C713A3C4DE880D011260E0BFA706B572 claudekanney
143,592,087 *0DC98899F39346B1FC7AD621FE1DADE4841386C4 clicking drama
143,592,088 *0DC1F0C0762378EEB881AA19EEC73F4D9398A401 CLICK-IT-LIKE-A-BOOM-(REMIX-BY-HIV+)
143,592,089 *0DC3D9F1B85008C9B10993513088618D9432AF74 DENATURENT1
143,592,090 *0DC120680322685A08D938781E12867A70D2FC57 CLINTON.MINZENBERGER
143,592,091 *0DC2932D88BAF100590F571A9D2C3BDCCAE1E28E CLINTWOLLMER
143,592,092 *0DCE538C89D585BA9334CC4957A9223798264908 DE/OL
143,592,093 *0DCA6CF2FFC7770344601C3711AC4F1DDCB6BEC8 [email protected]
143,592,094 *0DC070AA45F24B811E087771BE66DEB27DC1BB8C DESMONDSAPINSKI
143,592,095 *0DCBEDC259187887EFFF145AB260A76B1A0AF77B cn87v
143,592,096 *0DCB4AC4E37F778899E188E0C682CC4907400541 cnpn$
143,592,097 *0DC95938E0DF0E98D9257F22369A4DDD7757321F cn$-u
143,592,098 *0DCCBEBBB833C8769D62C00E89D3CEA5C032E2F1 c#o$#
143,592,099 *0DC627A32A78AB4B90252C523C742930BB5DC0C5 df2dh
143,592,100 *0DC4F38B8E5324239FDC771AF6F266329897A3D7 coepy178
143,592,101 *0DCDD0A85B6A9FAD3B96F055825F771259634E85 COITK
143,592,102 *0DCCF492F9F2FC4F53BFA83D8B747F224B33E2E2 C)OIY
143,592,103 *0DCC9A40F594ED290941DE2574009384B966B911 colwz
143,592,104 *0DC1707648385A609ACE92FED51EDF55CB0DC337 [email protected]
143,592,105 *0DCEC034A5972060C5B1783EEB00BA4A88229A48 DGY3C
143,592,106 *0DCF0A2E431712CDDCE1B7F3C5339B91B1EB9A18 D)H.2
143,592,107 *0DCC1CB88A6556AE76A5881D5FFAFA03409ADEA3 CON5IPA35
143,592,108 *0DC7929C63C0BF1E969711745A37CF2604420362 dhbk#
143,592,109 *0DC45CCA1CC43628D457C06539A23EB9B22597CB DIANA ELWELL
143,592,110 *0DCD85319CF247F85CA657E9DF23BE683BDA3109 diaqt
143,592,111 *0DC4A1DC09DFED5E9B614B2D4DBA23E92504D4F3 convento-de-santo-domingo-lima
143,592,112 *0DC2D87058EDECC4BA9B0654434817C8085EE316 COOLCHILLBILL
143,592,113 *0DC14208D4A8731C5B57DF15BF6DAB1122726304 CORD-GR4$
143,592,114 *0DC581DE6434F13A7ADA0D03B7601DDE458608BC COREYVILLAMAYOR
143,592,115 *0DC302DB039A5775BB8726A636B52EB7167B5F94 diggerabcdef
143,592,116 *0DC214FDB56934F036E2525B923F4AB87878C58C diggf
143,592,117 *0DC6617BD6BD28B9CB0C8F29951BD81EAF52A321 cotswold lions
143,592,118 *0DC05D04E231E19C45E148F5C5EAA22456ADC0DE COUDRAY-AU-PERCHE
143,592,119 *0DC58FF1F3118AF02E07473AFB38165935FD94DF [email protected]
143,592,120 *0DCC50CF0E65E494AD0B385EED6C7397361F9958 COURTNEY882
143,592,121 *0DC8BF0A75D4EFE1FCA972D4A11FA6D6C4F762FC COVEREDTAUGHT
143,592,122 *0DC9365FC9C7E78D13C6DE0528DA14BC3BBF91E4 DINOCLAMPETT
143,592,123 *0DC2811D537E39AC995913F06C8E324B5715C618 cpnnv
143,592,124 *0DC99CED62A1B352FB65DC5E6D88A17AF84EB761 c:\program.files\microsoft.visual.studio.9.0\common7\ide\microsoft.visualstudio.web.application.dll
143,592,125 *0DC45EA61EEEFA0CC2FB05AF61E168F4245D552F [email protected]
143,592,126 *0DC25DBA0278D6805F341B94318455DAC658A9C7 cr0:i
143,592,127 *0DC478B20166F826385EBB18E6BB0546D6E544CF CRACKTHISPASSWORD
143,592,128 *0DC66008A575033D097B762AE191108918A93E37 craeftan4
143,592,129 *0DC539CEB197B2F80560D7397D9F33456717A0F6 crane
143,592,130 *0DCC229B8F163AE4BD4C47DF98071FA26CC4C56D d!l.0
143,592,131 *0DC7DD46D81E980347E7BB28C98A6F89E08AB3C1 dnbfv
143,592,132 *0DC055169BB4929A8DDCC397D04ECE87A215ED82 cscca
143,592,133 *0DC1C50323834691BF7824D00D0120CECAD3A425 doc$;
143,592,134 *0DC210BEC6055F6749D02E69E4663BE55309490D CSG3N
143,592,135 *0DC542123735308C3C5A5AED0954D6871BD8144A csmc;
143,592,136 *0DCF0B0AD5FF5E22D6F8A35E5AC453BABC7B16B5 cu&":
143,592,137 *0DC6005A8BA1F24E242E885113B3F8794A8BAC71 CU6LN
143,592,138 *0DC1E0477E51F518EFE4615DDB03A9F0D3506D20 cuddlefuddle
143,592,139 *0DC37CFB328BF6981839F8E41F93A48580ABD0C1 don-corrington
143,592,140 *0DC5DBFF4EC3726C0638F07FF2697D93AC0CCA93 [email protected]
143,592,141 *0DCF302B08F8D90E6CC1ADCBBF9947DEB734421A donniecanzoneri
143,592,142 *0DC9037AD03C4DEAE789D3E507DF9B690F98FD7D don't-you-know-it's-magic-(feat.-james-reyne)
143,592,143 *0DC96425D087FE06D33C087D555B8855EC8F16B8 DOOLFREVO5
143,592,144 *0DC712F71D9252816F7EFC9FC2108829E5878EAE DOROTHYDOOBIE
143,592,145 *0DCB91074B41420AF0675376C1BD6AAC833EA89F DOUGLAS.NOLAU
143,592,146 *0DCAC70384EE1D39736D0F76665303731D8D065A DPCP9
143,592,147 *0DC55359850CD86D3B86748811074BC62E5A177D C'XC
143,592,148 *0DC1CFEEDDBC851B06010FBB347C3BBC2D37DBB0 dp%_j
143,592,149 *0DC7AA4214BFDF477C12C9CAC389AAE1B4892F69 c)yl?
143,592,150 *0DCFBA2BAD1521C5A54796386C69E0C0103C0B9C CYNHYDRT5
143,592,151 *0DC70BC4116FB8D14F2FC8D5F37E25B42B7D47DE CYNTHISA4
143,592,152 *0DCD9DC04F044D5ACE3311AC4B1A59D212F4BD11 dq=o
143,592,153 *0DC31EC2D9C72D4173DF195B751DE08621A7474A CZGG
143,592,154 *0DCC95E31A7F6C67ED792D02544161C10F90595F dr!29
143,592,155 *0DCEE6AE61A8960BAD7324D783B5F21F844FAA19 CZ;"U
143,592,156 *0DC618947554BD24D10D4B165A49C6C9866C95E0 DREW.CLUXTON
143,592,157 *0DC26C503F7D9AE91A5075E9F241DCABBAFBC0DA DRUMSAH3
143,592,158 *0DC5FD988A66A81CC3454963A466A2978003AF5F D.2BF
143,592,159 *0DC59AE674E7372D32DB91980B8B6649772A0B01 D2E)#
143,592,160 *0DC4654959B3336044585757A385447E3175D878 d3uip
143,592,161 *0DC1BBE1E386966F25C39620B49C1709D3ED627D D4D.U
143,592,162 *0DC9DCDD8D8E689B4ACFA771E2858E0633BE37E4 D5J&T
143,592,163 *0DC5D2187AEFAB53251E437D2FB2D0099B4A4C1C dtejw
143,592,164 *0DC740A0990457BB04CB87CBBB1694B7513EFA41 D90MU
143,592,165 *0DCF4BA824E784D61C8E80E253F375C88B3D0EB2 DAGENDE9
143,592,166 *0DCB29F95F7B31B5804BE1D0EB999116F28CAAAC DURGASYA0
143,592,167 *0DCF1616FD43627191438233B44731C43726D3CF DALE.BRANSTUTTER
143,592,168 *0DCC80056642B8FF4A2B7C273DFA03D12B63F754 DUSTYROWLETTE
143,592,169 *0DC3ED7C7C485D27D39513AE95149FB785658D71 DUWJ/
143,592,170 *0DC1D676491603B195E5B2ECE9014052ED2773B6 dämpftöpfe
143,592,171 *0DCE36817DD925895FF3F4FFE60C057A4AAA3488 daniel-elizardo
143,592,172 *0DCB00028BD0571B8CEBAB07D6C9C221B8B84A9D DXjr
143,592,173 *0DCD21FC2F8675C124BAE6A1863CBD0A418DDD72 DANNYPAGADUAN
143,592,174 *0DC02411DB12185A1F34C411FF1AF0C44CA5647A DANTE.CLOPPER
143,592,175 *0DC68ED27FF7B0863ECCEC157E1E97B625903389 d;z;s
143,592,176 *0DC513BB2EA3B8B094B3FCD65EE0EEB4DE891CE7 DARIUSHYDZIK
143,592,177 *0DC34D6527BA3583DBF0EE14FB1BE5DFF7A142A7 E3AGGEILOYME
143,592,178 *0DCA1FC316593941C576B1E09E00C877D062C2A7 DARRELPLAUTZ
143,592,179 *0DC8E9A3532A79B538BD048D1D723862E623DAF1 EAWEG
143,592,180 *0DC4C11CC99CA401AB3D42A6DD7F4EB42B4795CE ED74C571-FD2C-3650-9CD0-EEEBE59B121E
143,592,181 *0DC7BED43A7CC9E6D14BBD91714F360025ADF40C EDDIE.ZUVER
143,592,182 *0DCA9B7E791B77B40D4EEDE914BFFB027706DFF6 db&g"
143,592,183 *0DC99696B72A4832F0D47B8FC2B3416C1F8F7E25 DB!NK
143,592,184 *0DC6B1D7D4B7E301899D82C760E0397CA7BA2B04 Dc/;
143,592,185 *0DC93AA31AC75382A2C173439950CE00339F6D94 d!cf
143,592,186 *0DC8193BE02EEDDAFE96E2E8B730BF7CD94329A6 d!cf,
143,592,187 *0DC4895941D01A72FA59B7DEE12A9A70CFFF4E6C DC_L
143,592,188 *0DCA0FD345D01DDE06CC77DC22EE28169A5AD53B edsel-aguirre
143,592,189 *0DCDC5B5D1CEE90A94F1B7587BCCB355FABBC8F5 EDUARDOLASKI
143,592,190 *0DC27D5292CFEFB36CB93E2435F1008E04427E2F dd1,a
143,592,191 *0DC23A7009F57E6E1E00684A59B0553DACBF2A91 edwardomyerscough
143,592,192 *0DCD400256382CB5F55188B0AD398CCA7C0B78E8 De:=
143,592,193 *0DCEC75142D74E23DB4C6A17FB593E1DF63F1F1B EFREN.CARTWRIGHT
143,592,194 *0DC877F9988F5DDE395A557AB84A9B2C6C8C64FC DE'CE'DE
143,592,195 *0DC6CF6A39A32AFF0FFA20AF256F52A805975D41 deck-the-bunkhouse-walls
143,592,196 *0DC19683BF3DD49E2727C6D46B00452BA80B0880 EHJJ
143,592,197 *0DC464C4C8CD07FA21D0BC9A01AA7152D48BB1A6 ehr+
143,592,198 *0DC4CF3C9975D6A77AA88461529A5D534C367981 DEFERGGER
143,592,199 *0DCB79EADFF20C44D47D09DAF0F993D8F25DA0E0 EINOMRAH1
143,592,200 *0DC1B451E5861AE42E53A63DE3EDDC4192DD7DD3 DELETIONJADION
143,592,201 *0DC32B759D0C40B12C97FC041474B535D0A5E57E EIRELLIAS
143,592,202 *0DC63090AA30E35C10DD5D9F64577CD9D9528CF4 ekahkeps9
143,592,203 *0DC15C675A805B066FAB192414F3E99E018DEF94 delpheasant
143,592,204 *0DC30AA7A63E8AB6174DC4D00E4F4D54EBB919F1 DEM0DU1A+IN9
143,592,205 *0DC035CD2F26C4E4CDEE4E3F44CC5B15EB3D67FB DEMONS-TO-SOME-ANGELS-TO-OTHERS
143,592,206 *0DC22593A73C6DCB5D0F1D31690A04C1D6A01AC1 eldenviebrock
143,592,207 *0DC6AFA642F3544D2BEA818E049E502E0ED6278A DENISMALENSEK
143,592,208 *0DC98397D5F6F199B01FF75DB18ABEE66612CB40 dennisdewhirst
143,592,209 *0DCD8699136D2B4408939BB5B25F8390ABB3FDD2 elemicins
143,592,210 *0DC6E838ADE078760F60817C38F54902C260BCC8 ELIESERTRAUGOTT
143,592,211 *0DC5F90308B8FD7AFAD59F9E47F5136D204DFCF8 derickmcadams
143,592,212 *0DCF9C3A7336D015CD56FE08B48E4238EE4C8ABD ELLSWORTH.DOBSON
143,592,213 *0DCB7BE670E66B6D867BE76C445E807027BE8E5A despencers
143,592,214 *0DC55963E2223D442CA6A4249EF39A9BCADF4ADE ELVA.MILLER
143,592,215 *0DC4DC51D949EF75E462A09D4F7458F84F534831 DEVEANEY
143,592,216 *0DCAA220D06B646E4A60A075CC3BF5BE73A48A66 elwu+
143,592,217 *0DCC81CAADE9DEE0A2B25ED45E1B851C7649F5F2 EMBALL
143,592,218 *0DC53FB74D265B91564ED339240E9FF532652225 DEWAYNE.DAHLKE
143,592,219 *0DCC7E6F70E5AB92DF7B5A9947A72DF160EB48F4 empfngt3
143,592,220 *0DCF17B3C510CE4E21A81937F4CBC03AC89E45BA D$FA
143,592,221 *0DC09E7789C8856B07E7FE21BD872EF3B16C070F DF:,E
143,592,222 *0DCFB7179C27D91A1C3B1ACA9F8509E67C48F6DF enfranchsements
143,592,223 *0DCF7621BA67C80FEA448D2EB68B59DFECDFE7B9 dgzc
143,592,224 *0DCE247ACF036AC34428C1CCB3B6011F8B4D2A34 eoh=%
143,592,225 *0DCFAA738615FB6330428B28AD8EDC9C472EE435 Dh-e
143,592,226 *0DCDC6E2C0A0AE99083015650F9DCA4A638F395B dhv(!
143,592,227 *0DC6E3113AED5B6842DF920A7FF0538DE22B71C8 epikeren6
143,592,228 *0DC7FDD93CF9DC4B778057C7DFBAFC775D17A16C die.gruene.minna
143,592,229 *0DCD481955722EAFC91C3201854C3AC3F92D12E4 EPVKW
143,592,230 *0DC5649BD66E5965E718440C046780E3FF6995F2 eq==
143,592,231 *0DCB65EC01B7C669082F768C498EF919D49E433D DILLONLOSADA
143,592,232 *0DC5FFD45FFA10B4ACE86ED365A0E72912EB8CCF DIMINIQUED
143,592,233 *0DC17A31223F31588FBB3A77F495ED4F9516326B [email protected]
143,592,234 *0DC5A9346C065DCCCEEE39BA2466D398F4269D16 DISCDAT1
143,592,235 *0DCFECD299ADD809A2F4F095EAD219B3C8DA680D ERNIE.DEER
143,592,236 *0DC9A08BE589BFE8743F44284F177DD36BF7B018 ERNIE.KARELL
143,592,237 *0DCBFC8A5A231A68AF7E2FEC26BBD91BF5F91CD0 dj?=t
143,592,238 *0DCEAD8640FACED97A5C7E69CE49A850DE5C9204 dka)forcelloandpiano:IIConmoto-Adagio
143,592,239 *0DCDFD36FA0A716AB341C826B1F1EF281ADA99CA DKAUC
143,592,240 *0DC00F6DC6C1ACAD9C0BCAD4E3C7B5ABCAA3F462 DKSTN
143,592,241 *0DC6AD22481ECB769410D8B4FF104FDFB4241BE2 dkyi9
143,592,242 *0DC6DF1FF2D70B501156E1B406C5A9F3147A78D1 dlb.%
143,592,243 *0DCACF6188BA0A176F0CEBB5A1A23D52FA4C5A15 esi5q
143,592,244 *0DCB572796821567AE9BB2B7151A8D652BD9E94D dlu7_
143,592,245 *0DCD2079F6E9E2AEC125B2CD6417C973D9FEC3FC etazzom8
143,592,246 *0DCA56C5ABBCFA5B5E15CC0AFB235CB00162B4A3 dm(ra
143,592,247 *0DCB72F15BD14862A9282953E45398504889A060 DMTUQ
143,592,248 *0DCCDD12E3DB634ADD00F68FCF0C0C7F32C2CE01 ETou
143,592,249 *0DC42B00D1B43050F164ADF6E4D6515864476912 etta.james.and.eddie."cleanhead".vinson
143,592,250 *0DC23DA3EA62EF219009D7AC6C9B5485E42A3B77 EUGENIO.ELIOT
143,592,251 *0DC693EB9F7B411E3E18CC395AC6CDF02C241F7C DOIU.
143,592,252 *0DCEF9C6F00F116158272B207B8C3493D767102B DOMINIC.PASKOW
143,592,253 *0DC8D8C0D7C6E0DB2E6213E44E8F2903EBD4CB00 EUSEBIO.BROGLIO
143,592,254 *0DC876420D471DFAAA00CCF817534EDBC2C159D6 EVAPERALTA
143,592,255 *0DCFF4519B1F333E50E2946D592E69E2930AFD95 exempli
143,592,256 *0DC88D0E2B24887DC16E69F168994C00899DED47 DORSHABBY
143,592,257 *0DC67F336521C03EDA62B4E818DD7D1FF00E7B3F dpbaa
143,592,258 *0DC2FCEB9114D8379439961815C1D5F0C17B455D [email protected]
143,592,259 *0DC9238C1679EA56A0489D28A022965B7020CD17 ey1yq
143,592,260 *0DC02EE90F197B07679C88EC66497FA83CFFB3B2 DR6234
143,592,261 *0DCFFA06F94ECD3D8CF43B27F877534134CD7245 drabufiona
143,592,262 *0DC3F180A47DF2B0D0D63BD08F2946B2CBC749D1 DRA+CH3LL
143,592,263 *0DC2BFD8A0C5CB0A03C2A32DC4026D087ABD08A7 Drd$
143,592,264 *0DC9BAEB54D63F410025A13282F75E61A6E20668 ezekielbready
143,592,265 *0DC28BC7FF2F01D3D36C22F7B1B1297740F60937 DREWRONNIE
143,592,266 *0DC07676838B9DCD7A639ADBDEC57F92175A0F2D f1!gh7!e57
143,592,267 *0DC6B15E7CA04EF3CB0ECD3D483E406EC8E684C6 FARE1234
143,592,268 *0DCEF34081E450014C632410766F1CE88CE2701C farewelltothelandofmist
143,592,269 *0DC7D4C7B0A0937BC797A77E0550EFAAAD741166 DT9KE
143,592,270 *0DC0BCD5FD1CBD454948977BF3BCE9973A7A5A60 D%T/N
143,592,271 *0DC1CB5B09A17D0B7D9266A4CA6413A229D3BEE2 du6&c
143,592,272 *0DC85416E3E9E91A4217EFE60CD255C122335A3C du8m9
143,592,273 *0DCA87BF2C7246EB8AF8DD1EB040BCD2701E979A FBASSIGNAC-LE-HAUT
143,592,274 *0DC7A7EE580F81EE4C1F70B35C0BD4B1C3FD64D1 DUCK,.THOU.ART.MADE.LIKE.A.GOOSE.
143,592,275 *0DC44D0367B282DC6A26AF92DD7848C60AC6864A duhitaa1
143,592,276 *0DC07FD4EB8E37FD416AF17F1072B172D1CB5A95 felixcrecelius
143,592,277 *0DC560CF3FE731C64A8D245544315E8F8A2903B6 DUSTY.HEIDE
143,592,278 *0DC69B7BDD2EA525F9268765AB8821FE8C8D4B02 festschriftd
143,592,279 *0DC4C014E042D0F9CE268A81CEABD17EA84BABC0 DV,FA
143,592,280 *0DC763D7449B8D5D5ECD0E8127A9B99285A0D583 DV=%K
143,592,281 *0DC7C61DBC74EA47D9A5986C3733203FECA8B15B [email protected]
143,592,282 *0DC922BA8A88C5EAF7C51AA7E7811125F12C6BF6 d:w&g
143,592,283 *0DC6E525FFA8310CA8DB5A51F7506FADD497F22B DXJ<
143,592,284 *0DC4D9FD2625AEAB901BB2936E11548EA643634D D)YBV
143,592,285 *0DC5E96B000E03ACA5C2C0CDEAB5E5A95B0E8E03 dzz7w
143,592,286 *0DCB8B4825FE3DCDBD6B97D874DC330B0265998E FIERRAVANTI-WELLSMIT
143,592,287 *0DC21425EC6B9C5E5DEB2C5A263589F21B3E0037 EARNESTLUECHT
143,592,288 *0DC7FEF9B261778E231DC4890713C3B9F10F1240 ea&uq
143,592,289 *0DC47099786095BAA58FEA5FEFA196A24137C071 EBANL
143,592,290 *0DC4F9F41FA7D144E4E53149829782F0CBD143D1 FION.TSANG
143,592,291 *0DC630A5A353DF9CBF6D201ABB34A636C20C285F ^f_j;b
143,592,292 *0DC28BCDBC3796EF908EFE680FE3EA61EF28FECE ECLIPSESOUNDTRACKCOMWWW
143,592,293 *0DC0CFF3DA6B5C412FFA0FC24BA496405BC9F7AB ECX$S
143,592,294 *0DC490B6AAEC6581FC656388D4E9D0E0F9E00082 ed43t
143,592,295 *0DC8761A1D71002E08917DD864D7A9C18A1188A9 EE!DP
143,592,296 *0DC6AEB8D14A6BC8181672EA9AE3FB41E2BC187C for-da-love-of-the-game-(feat-baby-blak-&-pauly-yamz)
143,592,297 *0DCF54349DD7B2B7533EED58A7417E224A11B0F3 EGALISEERT2
143,592,298 *0DC022807A10C81F6CC941DF774BCADD566F7359 EGYMAJOMBAN
143,592,299 *0DC6134B4E31A38BA551CB088F28CF7DA8D17FDA eh=f!
143,592,300 *0DCD105C30E0A6DCB3308005C940F1B961E96B86 EHLEW
143,592,301 *0DCCDA00E034E858B9C651C43C49B066AB495113 ei%8z
143,592,302 *0DC9BD8D7F8252A2E896378ABC9FBB1625F3C4D5 [email protected]
143,592,303 *0DCC3A5618DAC5AB2253391F634F53667C8E604B FR4MBESI4
143,592,304 *0DC8F755FE45ED4F96F4B446EB38D0F3EB2C0A08 FRANKIE.STEMPEL
143,592,305 *0DCBE80195B220FF78FFFBE15A7CFE248303828E el7fk
143,592,306 *0DC6BAFF94F524DC6CB2A66D84C18D717141802E ELBIRKS8
143,592,307 *0DCFC965BE1CD35BE24C5C899F698170B353A712 FREDERICKPERKEY
143,592,308 *0DC3A2F07F7D44F52B28EFA2F45AEB3C1837A0A0 ELLESMAING
143,592,309 *0DCAAC66F4F16CE0D22310EDC127A55297DB66A5 FROMSTANTONSTATION
143,592,310 *0DC0A4EA58E7DBC70FCCBC23F8066B34CD8F4ACE emanuelcatrini
143,592,311 *0DC4C8F4C37CA980FC38BD7B66DE7E17710DE83A emaururuavau
143,592,312 *0DCCFBC3556EC53E0B95243AA6522C4DB931EEF6 embribe6
143,592,313 *0DC55F6A6F92CF878F3D07792445BFD4821F9AD6 EMERSON.MYRICK
143,592,314 *0DC9263611BE9812EB6F4C73E729238D69CA0EBD emersonstreu
143,592,315 *0DCD91385D87BF1D1BCC95CBB637CB8C6C223E2A EMERYSHERIEF
143,592,316 *0DCFECC19FB5B5528109F85C02C0C229819D4202 emilbalasubramani
143,592,317 *0DC5B5652A60535FF014B41BAD469EE5D10FC270 emoryhykes
143,592,318 *0DC91F9733545ECFC194137EBBA68B3EA80BFDBB enrickomohammadrizaldy
143,592,319 *0DC19FA544C976FDE2199B6ACBB1D23086D77F57 ENRICOVITI
143,592,320 *0DCA124E50751BBA992500F9CA27408FAB67E122 EPHRAIMKEBEDE
143,592,321 *0DC2D4761DFD6109C44C1AB9DBADAB78C975ACDD epo/
143,592,322 *0DC4013A3C44FD07D3EE344950CF7785E04A09A7 FURBERAT
143,592,323 *0DCFDCF8F92D0D1B957911165A62D29D6A3A7205 FUROR.'F/J//U/R/O/R
143,592,324 *0DC392877BDF74CF5B1BD246389F1F32E08A30D5 FWEGIJH83
143,592,325 *0DC5FE4DE9682EF1EA035CA0CB254E9AC1C9B5EA |.fy.1978..-.projection.................250..........|
143,592,326 *0DCA68C910D7ED11334CCE5AA1649B33103A4FC9 ERIC.HAWKES
143,592,327 *0DCC7E03451FFD738B4602F15E9D32A905D26CCF ERNESTETHERINGTON
143,592,328 *0DC0F63267FA14D1029DA2C2EAA3C6444E84ED9A galcsenyuk
143,592,329 *0DC9D15A84312F3A548BA76C817BE07E31D2FAD2 [email protected]
143,592,330 *0DC33CDC1E57C2E8AD813804C8976B783AF2D6CC ESCHOSSE5
143,592,331 *0DC6BD3E339B51B7C15ED4B91A723DF80119FF24 GARTHDUFORD
143,592,332 *0DC9AC77CAAFD0AB2248C7F6E617BBEC67C66203 gaylecassagne
143,592,333 *0DCD63B87975617883442ACC4110AAF26E1E6136 estefania
143,592,334 *0DCC25A9FCDBA69F51C4493C4F7FD5BDB1F8DF5B ESTORCU2
143,592,335 *0DC08D503C6C53386057B48AA7D700A0437A3266 etagewoning1
143,592,336 *0DC363D296F67100CD6C4380640534D24F8A2A82 gedagteloos
143,592,337 *0DC348D1671774A9F10D8B91B1A055BDF5A3FE06 gemetrical-symbol
143,592,338 *0DC8341CEED725A00EE617CF43394B0AE1A52419 GENE.CLURE
143,592,339 *0DC3ADD117D1E141E47D522A846562970AF6D4F9 GENEWEISSENBORN
143,592,340 *0DCD6286B5154D7D892657C9818571A784FB15ED etho%
143,592,341 *0DCB2673E2439B42734C948EFE02BD938126C570 GEORGEANNE
143,592,342 *0DC58D6EF197D52850D320C272CC574FFDA798F0 EUKo
143,592,343 *0DCB9BF76E715F17E645BA8A118C844EA8E4B955 [email protected]
143,592,344 *0DCBF4E12608144426C6FF5F1D5EF8770E0DC838 EVEREST.4.LOVE
143,592,345 *0DC9AB92FD54F9C44953459F6CEF30540BCE4427 giovannikilbury
143,592,346 *0DC87A3FC78302362A2EE9C8504353CF17B556C5 [email protected]
143,592,347 *0DCF0A39BAC38B3ED0558F9FC231B834902F325E GLORIANOVÁ
143,592,348 *0DC1BBF05F92DCADE2EA57A02DB1E6A71BB89FB3 EZRAECKOLS
143,592,349 *0DCCEB596E8C63C7296842B78393045CCF121B8D [email protected]
143,592,350 *0DCC5C651817DD68A7783D9DC739555CA950AB46 GOODENEA
143,592,351 *0DC105A83665D7B2789CBA01C196E42E31008C40 GRANVILLE.MCELHINNY
143,592,352 *0DCF636C9566E637274641B8953BCF807A785185 GREGORYHOFFORD
143,592,353 *0DCCEE71184B8341203CA335A5AC3C54BB664F29 [email protected]
143,592,354 *0DC9EB4F5E63A7CD069E60906D7CB3DF6CB15CE3 fanshaped2
143,592,355 *0DC91DF178E23C4F6FC1A5CF0D0A61FE2FEAC38E fantasia.no..12.a5.leggiada.sei.(vdgs.13)
143,592,356 *0DCBA6F9910108379A8AF3CB88B19D1D1C2E2232 GrosseFugeinB-flatmajorOp.133
143,592,357 *0DC7D40BBAF068B3C40DDCB75C5DF2A0D07E927A [email protected]
143,592,358 *0DC397D2E8622DF8DA781DFA2BC124DA8BBD2707 [email protected]
143,592,359 *0DC468142CBD7B9C8FDF570E7438EA9C99B26D7F GUIDOARCTIC
143,592,360 *0DCC6AA9EE62D3F263EA7A75EDFE047AC75BF76B GUILLERMO.MAGUIRE
143,592,361 *0DC04351E3A3620154048E753E5BDF83F78EFAF7 GULBENEBAHNHOFSGEBAEUDEINNENANSICHT
143,592,362 *0DCEA38DE258572E8BB28ED1563ABCC07ECCC655 GUNAVATSU7
143,592,363 *0DC5A2ED85EEECEF31DA193984CADF95E8312F91 feloning0
143,592,364 *0DC61942842624C2F6808E2EF5BEF13438F19D80 GWIMPERSING
143,592,365 *0DC0AB5649CE493883F5004BBFE36989A7A9C35D [email protected]
143,592,366 *0DCD2528F619104AB56BDB6A6637CB333CC71A4B ffloures
143,592,367 *0DC18E41E2AA3531F132C95F6BF7B57C72AD83CC H33333309
143,592,368 *0DC119E717237E77F4F6D783E9A5FDBBE6182754 HAIRWAVIED
143,592,369 *0DC3C7185643B3DF00C17D1553D77C32007CF9B1 haladnuk
143,592,370 *0DCC7561A5A7D8C815D6378CADB7D8BDA4BB39BF FITMOMMAGAZINECOMWWW
143,592,371 *0DC0B06BC6FC7C1B5EBB6B135FA9724064CA5638 FLORENCIOZAPATO
143,592,372 *0DCA9841F97E38909B83EE553F998E5BED03780D HANK.WILSEN
143,592,373 *0DC4DCF6094A9DD8E689C5DB95C587F83C6A19BC HARVEY.FRANGIONE
143,592,374 *0DC2E0FD9F1F540DA79E0313DB761B7642A1B223 hausmarke.ist....
143,592,375 *0DC843A8165EFF71219DB52142E1F5F6C74771CB [email protected]
143,592,376 *0DC005561F1D017B065F5AF9F455C2F15A3EE2D7 FORECATS1
143,592,377 *0DCED3DEA0D18016D3AA4B3908BD81D8C9D638FE HECTORFREED
143,592,378 *0DCD189F0C4C28132716F6539E3A814888DBACB8 FOSTERDOYER
143,592,379 *0DC259029005B6968C52E8147A6B7D442CC1B233 HEIMERDI2
143,592,380 *0DCCBBEFAC416C9069834F67B64942DDD750B432 fourteene.1
143,592,381 *0DC6CBBF66EDE062A006313E3D6937982CA32334 FOXSFOXYCOLITTLE
143,592,382 *0DCCB5949D74A0FB4D21EC042AC01742CC518A18 HEMOFILIES
143,592,383 *0DCA5F9233B43F57EDA54BB279830764E8A2FAE8 herschelbetzler
143,592,384 *0DCA356A20D491AD58C8F9FF81E83AD6D533FCEE FRANCISCOMATEEN
143,592,385 *0DC8AA2F448BDF2B122A4CBD92FC03EBC9660576 FRANCIS.SPAETH
143,592,386 *0DCAE0D9FF30FB91E926261C84560E4885B50E13 hettichs
143,592,387 *0DCC3619B66BB4F119822D012B0ACEA3AC37366E hielriem5
143,592,388 *0DC41127D7476C21D9DD72B7B5E68EB6254DF48A HIKIORO7
143,592,389 *0DCB9731120AE2816517A77136A65ACB42E12170 FRANK.SHINABERY
143,592,390 *0DCFAF302B4EAB5727956D1431D5CBCC0FADB1D9 HIT EXPRESS
143,592,391 *0DC255A6E61F2AE27E42FAEDA957312DA272E4C9 fredgofish
143,592,392 *0DCBA0A7EB5EFBA117CFDC4085D5C9C18C94E986 FREDWALLIN
143,592,393 *0DCE757CAC37BE42E8C5CE2B109D3DCB797ED372 [email protected]
143,592,394 *0DCE3F998CCE03A8AE8250B4165E4F96C77D5890 HORDEMIRA
143,592,395 *0DC62249F1E5798BFC3E6FE96E200592B8CECF04 [email protected]
143,592,396 *0DC15691A2D3195EE637525D60F7662FEDFCDEE4 [email protected]
143,592,397 *0DC93AD794D08535B7EC9CF5DBFC75DFFA2CB74C HOWARDBAMBA
143,592,398 *0DCBA2D42FC82B486FCEE057F04EDAE2B4CC2EC2 h`)r
143,592,399 *0DC2FCDC629457FDE6AB72DE562C24C5E3B170D4 href="/best-war-films-dvd-list/lm/3izkl05o27p0d"><img
143,592,400 *0DC0BD23A69F797F619EA5EF0B70984E4ED13D5B HTTPEFFICIENTCHARITY
143,592,401 *0DC64BFF22832B6CB927429213AC384DD8678CC1 g108e7r0771ng
143,592,402 *0DC7A7D74D727A83AA3A5EFB14B142A231CED1AB HTTPTHEWHITEBOARD.C
143,592,403 *0DC5B8EDE24391E3B5D39DE10417DB9065B30DF5 g'3~
143,592,404 *0DCB796FA94FBEDC885951FDB917186FA7CB2DDA G4111V4NTER
143,592,405 *0DC91F49B84479F4E62587AB6A2C775F45B038C7 HTTPWWWYOURBANKEXA
143,592,406 *0DC0037F1921163AA9A8E13965E602395BD9AAEC GABRIELHOWICK
143,592,407 *0DCA0F1C990E008790C4F0534BC6D0750602E3B5 GAJENDRA-SHARMA
143,592,408 *0DC9CBAE944ECF9FB547352BCB4D41F7D65C8513 GALLINGNED
143,592,409 *0DC1811F4CCC2C4AC1FD55B1E145C2BBEEF4A5E8 GANIMAF
143,592,410 *0DC771E521ED5774512A7D356A58A4658028DDF3 [email protected]
143,592,411 *0DC297DEF06ADDC3C788DADC5E1828917EFAC5D8 GARRYSTICKLE
143,592,412 *0DCF56A4AD9D6CD528C5E0629AC5A2DD393DADEE GARRYVENANCIO
143,592,413 *0DC3710A06AE59DA5FE8610CD8A5CC0AAA48A5BE HYDROSTATICIAN9
143,592,414 *0DC5C13E1F71566F5A5211EF208A4D8DC7AF4A03 g>E
143,592,415 *0DC0F69F96D25AF15B9DFB59C1EF9A393AB841A6 [email protected]
143,592,416 *0DCC23A1557D093712DE871F9F75DB7DD8CBD753 IAZRIEN
143,592,417 *0DC8532B822CEE0D1E094BA58C08A0A459D79D3D genllt
143,592,418 *0DCB503B70A3C429DD8E200F8D3294309EB5A66B GEORGE.DIPPERY
143,592,419 *0DCCB769F6E2695687D726119ECA69EAF749CEFC idlebots
143,592,420 *0DCAF6F241959FC98219489AEB84A42D75C23970 GERMANLAUERMAN
143,592,421 *0DCF85A14A9A424C2C33DC0ADB3865CF1BC6BC03 ifthenelseelseelseelseelse
143,592,422 *0DC97CEB16FE707AB7E4093D36746D8CC02A02DB GET.RIGHT.WIT.ME
143,592,423 *0DC388B2D089F16962873CC918E188421B4C0335 I.KNOW.YOU'LL.FIND.OUT.THAT.I'M.A.GEEK
143,592,424 *0DC32B299D6D49687ABAB87FDCCFF8607CDC47BE ILANSBERRY
143,592,425 *0DC6ED851C8627A590FC786237578650B22E3173 ggaandst1
143,592,426 *0DC3113BEDAE5A55783586ED3A7518A45904DB25 GI123456789
143,592,427 *0DCDD02FAB7530BBF9F028B0B49D93469D83C100 GISELLEMARAIM
143,592,428 *0DCB1D7CC84B039F5B844B760092442181A69642 GIZELINO
143,592,429 *0DC03D58722F75946B247F8531271590CA9827B5 gl`&
143,592,430 *0DC3DA785587FF67B26831E513D30965736FBD97 gl4dd3ns
143,592,431 *0DC90D1DAFD0DDC026D91E15B93063911AB04B76 glancesaroundfrequently.
143,592,432 *0DC53797998D268822A655C812291E4A0572590F [email protected]
143,592,433 *0DC696CA9A791928F3756841AE68AEF33E1DF63E importa5
143,592,434 *0DC6D8DDF23BF83B5A15C84F592001A98860AFC9 INDICTMYSELF
143,592,435 *0DCF5CB443E89346A68023AF4203DB6868233E22 [email protected]
143,592,436 *0DC4A5E0BA657209673A8D47E35E4EFE59E00218 GORDONTELLY
143,592,437 *0DC0FCCDD3A6003D141BE57D1795D0B2F8B04FCC INKTGOMING
143,592,438 *0DCD3ED74A272EECC4D7245119C0DDCD5231D0F5 IN-MY-FACE-(FEAT.-LAST-MEN-STANDING)
143,592,439 *0DC4AA5F5204A8F64C1DEDCEB79995DB0EF8656B integrif5
143,592,440 *0DCB621189A73832CB13460EDAE4A242CB50B29C gpc5
143,592,441 *0DC3F17A62EEA8F2270C84C3E1C14A15F891113C IRISH.
143,592,442 *0DC28C49948E37E1AA7FEC35EEDC8A241C798E22 IRWIN.PUTZIER
143,592,443 *0DCC9C834CB567464F7C13BF39E702E00B761961 GRILLARS4
143,592,444 *0DC1F742B5E20ED71BB5615AC43F4D4AAFB16C4A ISASTERSING
143,592,445 *0DCD4B14F09FD3685D454409BDFA681F1A0FDDE4 ISGOTTEN5
143,592,446 *0DCA499D493A2163175125E18EDFFC5E606FCCAF GUADALUPETALBERT
143,592,447 *0DC795758B7A899E814289B0F54B239EB03AC405 iy-^
143,592,448 *0DC57546BBEC9767C7BF3448325219B409B563A4 i.yb
143,592,449 *0DCAAD599B56E55CCE83448289AD4BD7F3E09318 j3z9pcyl
143,592,450 *0DC152F68D91507CF2147FBEE100B71B433F0CF4 HABSBURGLORRAINEESTE
143,592,451 *0DCD4B9AAC6CE81CB56D4AA228147BE33AAD9D20 JAKECHIAPPARI
143,592,452 *0DCCD17C3F25EFCA6C677B6EFACD13FB7661FFC8 HADLEY542
143,592,453 *0DCD874F65CABB5E051C330EE7F6F711805D2CF7 HALLEYROBERTS
143,592,454 *0DCC315509A8025B9061410E0C9825E71C931A31 HALTUT
143,592,455 *0DCF0C26E03FFA652BF7DCEAEBCC08F9CCAF7918 jarredgerrits
143,592,456 *0DC2BB2599D1381DB50CB4FBD932349C8CDA4A37 [email protected]
143,592,457 *0DCEFB84A063A1F155E2D9EDD2877365C88378A1 JASPER.DENETCLAW
143,592,458 *0DC277E24FB35E7DCDD9BEB3BC615864231A912B JATPROLE
143,592,459 *0DC8B43F0FB1747EA4C9AB43DBD03531F15DFA15 [email protected]
143,592,460 *0DCEBD8178436E940F4094674E55F0810B339131 HARDDUST
143,592,461 *0DCE38B104356CB13B0DEAEAEAEB6C3F7A2DB1CF JAYSON HUGO
143,592,462 *0DCAB30368D18B28174E51D0B19E0BCC5EEB4090 HARRISONSYNOWIEC
143,592,463 *0DCD8852BC342D41FC009572F86F3804A258C703 HARTANTIOM
143,592,464 *0DCCEEBEB87132BF0F38D3F74507D0110B516E32 hassan.mahama
143,592,465 *0DC32E2F71D44B753C4079E1F688768C0433B45D HASSANSTEPTORE
143,592,466 *0DC1BDB1C80DBBC50F761FE86CAF18B6F7988055 jeromeoverpeck
143,592,467 *0DC65EADBC386641D23DB538B693FD9127FA4A6B HECTOR-COSS
143,592,468 *0DCE513EEEB59F3746FFD9D2CCDC189493F27B02 HEIDIHYVONEN
143,592,469 *0DC6365C28F34D152DEAD03446DF38B0AE7C67AD JERRYWEDEMEYER
143,592,470 *0DCFE05EB888E61A185EF5682E7F848845CEFE1F HELL'SOWNCOMPUTERINFERNO
143,592,471 *0DC442BB5F92E2C6983F9D5B5428175EEF0A186F hendrahuang
143,592,472 *0DC94C4658299145D4C82C6EF07BB43138FA47EA JESS.SEXTON
143,592,473 *0DC6C3D8B3BA9A6CA023B392F5FF6310D2ED70CC HENRYLEETHAM
143,592,474 *0DC1FB5EF7A3464C725648543B6E1153C04BAB6F HENRYMAHANNA
143,592,475 *0DC50CB49AAE0DEB5B1A0870DFF55763F5F145C5 [email protected]
143,592,476 *0DC8029284FC6BF89F41FA66EF9DB07710BCB06C hershelturrubiates
143,592,477 *0DC546C0599B6AEBBB0C28EB944C8157F3B32698 JIM.MINTZ
143,592,478 *0DCE82AC03675A6601764681382ADADBD2C899D0 [email protected]
143,592,479 *0DCC33FDD9AC3313A2EDF73460FC8CFDCD6BFB2E HIERONIN6
143,592,480 *0DC69841D9692896868492367CD0A90EAB39063E [email protected]
143,592,481 *0DCD9F817E170F3DF495AF1193CE81C0DC5E84DE Himmel-und-Erde-(Lohmeyer)
143,592,482 *0DC50D4A1EFB40B4DAB3E5C8897459908A4CAB0C hipar
143,592,483 *0DC1A0039B2A330660390BFC0DA65E8F6CB0D803 JOAN.MAJUSTE
143,592,484 *0DCA4F190B68B639E8F738DF8898C7B9F390A74F JOE-D-MARTINEZ
143,592,485 *0DCC116B946DE5EDAA6AB4986CA7903D66DCFD80 [email protected]!d0m
143,592,486 *0DC6361ED95C101C6926415B8D09EFC22E5D8700 johnathanhornbeck
143,592,487 *0DCD4E0050FAA04FF71B242E5C569FA4779C4198 hndkring2
143,592,488 *0DC1B1302F20A1D75B340C47574D008BD4865CF3 JOHNNIE.BLONDEAU
143,592,489 *0DC175489F2986A27A4440E65B113CE84D4F99AF JOINES10
143,592,490 *0DCA64CB14D2F85748ABDD66A02BFF1FAD6191E8 homerdoering
143,592,491 *0DC1C983C079FFAECFAD17877A0F5791A23216B1 JONBENAVIDES
143,592,492 *0DCEAFCDBC38FE405085C0CAC66F3F44AA680CDE jordanwale
143,592,493 *0DC85EA39F5DF2AD8AEFEA28EAF5ABA8D27D31DB jordonthruthley
143,592,494 *0DC760D762673EE86D4D1CDACB902505D8D39536 hongkeim
143,592,495 *0DC9F2A850EAD7C807CB8B32A08155AB64373E82 JOSHUA.WIENBERG
143,592,496 *0DCA43A69AD884F6C2C2730DC9CDE561D45DEA42 HOUSTONLARAGY
143,592,497 *0DCA215B71740EA8003DB3A0653B4C9C8300E39F JUBILEE.EDITION.(DISC.3:.BUDAPEST)
143,592,498 *0DC58243513C00E87741D5F094E11C954A886D70 JUSTINSTANDEN
143,592,499 *0DC295AA74CAB387A57E2815B4BFAD68A25D113C JW&6
143,592,500 *0DC915D1BAE9D922A9165CDB4D0A83C4E625BFE7 href="//insolventbakers/ref=sip_kpl_pdp_1
143,592,501 *0DCAB181D188EB0C1306DA860A0D21C46BEDDA40 [email protected]
143,592,502 *0DCEBEC7A746491FCA689D9D7F47689B4FFE656B kamayawa
143,592,503 *0DC01A12B97C37D2641EE17C6E0EA1660FD544BC HTROUBLING
143,592,504 *0DCEFFC30FB696A12584F59EB1A51D6AED4BB6CC kantanded
143,592,505 *0DCF91023125534210AD1623D2E6029D3B25AF91 KAPSII
143,592,506 *0DCDC0B1C0D256C11E1E9C590F52101C1ED0673A httpwwwnrlcorg
143,592,507 *0DC6AEDA40C8CD2ABF5D1EA8B5FF0DD055B5B3CE KAREN PENFOLD
143,592,508 *0DC430C750EBF7649B2A54F158565A4A5FC6329F KARENSCORPIO
143,592,509 *0DC21ACBDCE3CCE47CA91E523C696487C4D1F54F KARLEY086
143,592,510 *0DCE00FC6A8191096BFE5886F79610985B67A5F1 HUMANSHUMAN
143,592,511 *0DC40FF3122687E2C840A00F8B3EAB6C966E777D KARTMEN
143,592,512 *0DC164263ABA83F935B7BD35C1FE32E2D0BC8F7D KATAFORM
143,592,513 *0DC1B3377F6F809C385F9478AFA68EE215B43D53 huntingbrowns
143,592,514 *0DC8BF8F20776FE08BA85FC5DC3BD2BFDAEBE085 husbandried
143,592,515 *0DCB81D6003337C9C51411FCBF1CA7E738306391 ^+KBAA
143,592,516 *0DCE1EF5DE1D5A285E1F4C72F0CBA7A16AA7CFD5 HYPPELIH9
143,592,517 *0DC9CA9CCFE8AB4EA03BBB5E8FDA1C9F299F1446 keithchilders
143,592,518 *0DC7EB990CAE72A06B6D06A71266D2E75715DE10 I155845
143,592,519 *0DCA823BF575B723F014ED8369FD0B46F9F43FEA I347016
143,592,520 *0DC85C5A16C48B7D8885243DFAA7CA5C54C4C2AD KELLY-DMETRUK
143,592,521 *0DCA942ED3311554EC46151C4C3944BC25A75B61 KENDALLAMALI
143,592,522 *0DC74A991B93615EEBB6A030DBEE176407AE5AA0 KENDALLUNDERWOOD
143,592,523 *0DCF906FF5E92DF4A398B8C5014FD4F28C315299 IAMCONFUSED43
143,592,524 *0DC162AB9BC753D8ABC6E7B70D2B3FB3F5617521 Kengo.Hioki
143,592,525 *0DCA676ED40A0A39078C7E0BC495365B92ED34DD KENNETHCOLECOM
143,592,526 *0DCCC30F98583E58A91787E28527F4BC61B50E6E kenton4ever
143,592,527 *0DC94D8033F1DBDE24BC75C75015B7278E761F09 IAN.CSUBAK
143,592,528 *0DC00C0CA69288C780D5A025B1148FC66BEFF506 IAN.PRY
143,592,529 *0DCCE35E701D9C865A74F98D64BCC2956EF26256 ICAHPLUSING
143,592,530 *0DC1D703D8348D8EB040B0E8FE1712E6514AF94B kh\<
143,592,531 *0DC0FB8EE69C032701C8346016064E9CC524CBC4 ieafkbbfpqwl
143,592,532 *0DC86DBF3E88E5A9AB94833FEB098174F96A2CE1 ki9r
143,592,533 *0DC590496ECFAA5D793FF1EAB65AF790B8760A2F KIETHBLIHOVDE
143,592,534 *0DC887F489E764E6F4DBFEB0B062A8398EB0B19F KIETHDESALLE
143,592,535 *0DC20252C0406BDEA36E903ABC94268050CBF60E kingbmw7
143,592,536 *0DC5B1B29B52ED3ABF9A66565C1A416E07C3989E [email protected]
143,592,537 *0DCB4114C0E657CCC2DDE205C687A8F4B70A4C31 ILOVEROBERTO93CECY
143,592,538 *0DC0F05973E1897D8C92DC2200FC004CB83BEB9C ILOVESTARTREK1993
143,592,539 *0DC9E5268C23EDDE8D0A3FB6F567041498D9A137 ILUVSUTTON82
143,592,540 *0DC48F978DC81FAF2980C3B8B8C2B9BA216ED106 [email protected]
143,592,541 *0DCDEC1BDAA47F9FFA67248BB680C4642203DCD7 i'm being followed around by the cia
143,592,542 *0DC56BA31B3642123183105F9A83CD62DB1C9E33 koreyallder
143,592,543 *0DC2EC14320B06C7F9E5A233E21C60EBF7AD2B92 Incerti (RicercareEnsemble f
143,592,544 *0DC6A9431C09B6BEFCF17A078C90C7E405CB8314 INDIVIDUALNOGA
143,592,545 *0DCEA84C1F51EBC04ED48ABA5F069356C1E8AD33 KRKPPLN5
143,592,546 *0DCD60D68279F786C9C9B04F0E56C72FF04FDE60 krul666
143,592,547 *0DCC6256A39963AE44A7077839C01D55063F5385 krupnick42$$
143,592,548 *0DCD097BEE77F179D8A9A131AB72EE343520A606 krx%
143,592,549 *0DCC27059588AD510E0045B2D60C8D134664DBCE ks[b
143,592,550 *0DC2382B05919311AD3D7B80493E1A4B51028E4E k>=t
143,592,551 *0DCC1C2CFBF69C933BAA96603AD37A833F3A75E9 LABOURABILITIES8
143,592,552 *0DC9D118F359E47B8E6C6702401FE57A82CB6F0F iraverrill
143,592,553 *0DCA16D80A01128550C0BEA5A19174426D6D806A irvinscovill
143,592,554 *0DC5CCA62B4028353583D2A5F21E7D7779C743B1 lanedaughenbaugh
143,592,555 *0DC906B68D211DCA9C24A2529FAEE366CD49553B israelsquare
143,592,556 *0DCC10B0724B3503FF244E1FB457ED53787B8614 ITCONFIGNI
143,592,557 *0DCBC988E7BEB52620F7C558383231A0132DBC42 IVANTALAYUMPTEWA
143,592,558 *0DC7492D7471389105A0A6E22C17C0C57D8887C6 LAVERNCASTRATARO
143,592,559 *0DC2A26D5D2885D83F0499FE5F0B1828C95B4504 lawrencebrosi
143,592,560 *0DC9DC4E57C3D745A9A3482B308330CB34123A14 J0RDLAGET
143,592,561 *0DCEC6CC9C6ECF2CE5B60881ECAE402658398FD8 J9494
143,592,562 *0DCAF2AB2AB1FDE011E7F537FD923108188F2FB2 JACKCAPPIELLO
143,592,563 *0DC4F2D89BD856E074699A51BD957885054F6862 jaishree.kc
143,592,564 *0DC3CC3BBD649CFEA14D82C6EB272C95D936069B le.droit
143,592,565 *0DC9175002A934DA81CFA8399487451130086585 LE-DROP-OUT
143,592,566 *0DC71C9DDB963A6FE1E9A4EDE0AF2F3CFE8F8180 LEE PRESLAND
143,592,567 *0DCF12D7D7EC75C2ABEC6DE7D1184C4BD37EC3BF JAME.STURMAN
143,592,568 *0DC01F604355EC25FA596FC20947687B5438CF72 jamie868
143,592,569 *0DC52AB5AD24649EF2B12F73C5AF2E504425EE70 JAMIE.LATHEN
143,592,570 *0DCDD9A696316713714CCC9704DE24D740BCFBB4 LEIGHPYBURN
143,592,571 *0DCCF83A4D749E9D624DAB106939B744895A446E jarrettmasias
143,592,572 *0DCC54F5FFFB926D94BE3C4F8FDC281CBD437AAB JARSSRAJ8
143,592,573 *0DCB397CDB2CD7BBC21D14331FC46408C90D5460 LEONEL.HARTZELL
143,592,574 *0DC9B797E14A6B7D246E1F4907FA7A614BB26FBE [email protected],
143,592,575 *0DC9F96E01FFFE5B7C9ACE4DFAA031AECDDF37B8 LEROLERO(BARRUJA)
143,592,576 *0DC0301F68C17C96FF9FE401A3226DCCCA44CABA lexielang
143,592,577 *0DCECD3DAD9BEEC71BA4CEB32B8B06F9418726BF jeffereylabrada
143,592,578 *0DC17D56B8494E09EC0B18F85D9799F9DE3ECE0E jefferycasgrove
143,592,579 *0DCAFE4A2A6BB5BE35511E71043B3855FD15956F LIGJËRATË
143,592,580 *0DC2026716954588FBDE3A99A84518F48228312A LIIKUMISTEEKONNA
143,592,581 *0DC82A4DA1E6A8695C0AA1D36F736F5911A96D79 [email protected]
143,592,582 *0DCACBE6FC1A9BB508AED35BD1C578090631E908 jere-brandt
143,592,583 *0DC503D791468EAA348327FA8401F6F39540607C likblekhet
143,592,584 *0DC41794D5B390BBBD69306F50104C5046FA99FA $$LILBALLAGIRL
143,592,585 *0DC91399E29D80625FB7133DF8FF4B088E96EA23 JEREMYJAM
143,592,586 *0DC53C0CE74DF2FCFCF5AA87666EAB6A2D4A3CBE JEROMYHENFLING
143,592,587 *0DC9C9BAB96CFC2526600E3910E45F8EE686E5D0 JEROMYJAHNEL
143,592,588 *0DCD2C0270D0BE64155321E4F234581A87FC21BA [email protected]
143,592,589 *0DCD447CB1A56F118E2D433A0F3042187F76CB1F LIPOCARDING
143,592,590 *0DC52C2760154E91EE816A426780C06DE8272E35 JESUSSALZAR
143,592,591 *0DCE807D453F7A05E53E2864417D254D3ED1BA7B [email protected]
143,592,592 *0DCB0BA7FFA84EC0C2F6F4D9749D8E12FAE43586 LISA RUELAS
143,592,593 *0DC771EC565D075079B25F59930F5C713393A90E JIMU3666
143,592,594 *0DCBF75C2025F750B0C091C79D447A7D10B66196 JITTAU
143,592,595 *0DCB6432E8B3208ABBBD0EF3027E73116BDF7DF7 LIVINGLEGEND:CERTIFIEDD-BOY
143,592,596 *0DC4AD99AA3BB1D4EEFD199D82E179848524DD5E joan.castello.rovira
143,592,597 *0DC359123FDADED11EE4A18D44EE6CAF5B32FB99 LOGOBOY95NEVERDIES
143,592,598 *0DC8A89784905443F5EF4044413F54E28AC86DD5 JODZINA
143,592,599 *0DC9BABD4CC0D22C87F521D7D4CF8E9C3AC6B8B6 joelibrandi
143,592,600 *0DC1E1E6999EE07D631D03D191C7BEE0D18FBBCE joghurtbakterien
143,592,601 *0DC9F9ABF28F06AAB6FA9D643157933F72421D6C johnnysenko
143,592,602 *0DC89E7E5E708CEDC295CD62084BFB630767E339 JOHN.PETRILLA
143,592,603 *0DC10C841D4ABB708903B9BB5E7DCF99919639CF JORDON.SEALANDER
143,592,604 *0DCA2F6DB9B42070EDC11E92E127F783A02E8F39 LPURPLED
143,592,605 *0DCA8D86F145E824C7349051604C9C3F713536C8 LUBLININ9
143,592,606 *0DC8E76F63928D80057D36E52B1FE73065411F90 LUOCH
143,592,607 *0DCC89AF17663AA92A11B5FB6DD2A52CF87F6851 [email protected]
143,592,608 *0DC4542293CD2A75E49BDAC09A3AE9EC1D4C2642 M%/*
143,592,609 *0DC17B1A7CA9F23AFF554F0B1D7FF5D6E95B3CFC M0LD1E$T
143,592,610 *0DCB632042CDD2636286A89A48D784808E312A7B JUSTINBEALE
143,592,611 *0DC068919C09BBAA37059133EA805EEEA8F929BF m4gnet0st
143,592,612 *0DCB62E2668E4CCCF91050FDB2094D8AA1BA14A9 m583570w3d
143,592,613 *0DC7E9B03799985766F4D480C8DC0674CF3BD3C9 MAASEUTUKARTANOONSA
143,592,614 *0DC9E24839F3904B295247EC1EB30BF4D757F03F macguuvry
143,592,615 *0DC2B3A22DA27203D9DC4ADC69EC1BA8BE1C0A85 KADIJA00
143,592,616 *0DCA4E6064C17B7FCEEFA3F0CB9648406D0FAEB2 MAGNIFICA-GENTE
143,592,617 *0DC56E43205CD8148BB2DE001C1C409B5F90BB8E kamron600
143,592,618 *0DCD7035701CE3D76915CA31428F2AD4D9002C0E MAHMOUD ELHAWARY
143,592,619 *0DCC8613B1F922BEABB44A6ADCEBD388F89B14C8 majku
143,592,620 *0DC09814E3AAADD383406EB73BCDA56E01C4CE6A KANTATE,BWV40"DARZUISTERSCHIENENDERSOHNGOTTES":IIICHORAL"DIES
143,592,621 *0DC2509381761E814B5DDFA8B0F25183FD70FF9C MALCOM.RODEMOYER
143,592,622 *0DC30DB8AC739FA6D908ABE2C3DAB95412891830 [email protected]
143,592,623 *0DC6EA3B7964A9CA0B20DADD24A26968042D9D91 kassenbeitra"gen
143,592,624 *0DC49265158B5669CC8D1B8D162C1F0386EFBBE3 KATIEBIGGADIKE
143,592,625 *0DC472A9CBBB46B7C5110EE7FE307E51F0AC7A4C k-aw
143,592,626 *0DCCCF3535C2A3051BF4FEB7151F4ECB85CDFFFB [email protected]
143,592,627 *0DC546BBDF3BF832A67C693826E1C1D469A6F6C3 mansonaebli
143,592,628 *0DC9D654B050C8E2A80E2E3DC1D2EC7787D6048C MAPSTON3
143,592,629 *0DC382FEE9BD13D81C5D24312208451A5EE72058 KEITH.HARNAR
143,592,630 *0DC5015BFB08996EA2417E31ABA94B904231EE98 [email protected]
143,592,631 *0DC69C533BFA1A2A0BE104DAFB39B0422F7162C8 KEN5HY
143,592,632 *0DC6C8CB4C219FE09C088866149A96712CD513F7 MARHARD
143,592,633 *0DCBA4F16BC97CC2D4B90A67F8DA7E349987B24E maria996
143,592,634 *0DC008B2FB68E448F9FA534AABD06CFC24A30FC1 mariohadef
143,592,635 *0DC60671A52A655D4B8D4BB8E0753AAB5A587AB9 marioschurz
143,592,636 *0DCABFF63F74A689A20E03EAF15C0851A90AEE88 KERMITULLUM
143,592,637 *0DCC166E836A9C07BDA5B0133DA3238C07ED6C1D kevendelles
143,592,638 *0DCF0B00B9F59AA0FBEB5E6FD7F3186A5C401427 MARLO.BAUTISTA
143,592,639 *0DC3AE83995E84DBC21AAB3814828300A50AC48D martin-joel
143,592,640 *0DC54E586F51998FBFE9E25E12314A47DDD9C18C kimainsworth
143,592,641 *0DCBB87BEB256355C32704AA7295CD1E34014E5C KIMBORAH2
143,592,642 *0DC2D44DA76EAFB1A9ED8A7CF86AAF3BC7C0039B KINDRED.SOULS
143,592,643 *0DCE4F43B26FF3964DBE444B1F500B68FFF87CE6 MATT.KIEFFER
143,592,644 *0DC09C44B148D8C396DE829FA4E4145A7576818B K+K9
143,592,645 *0DC93CD93D75715F6C924C257383B8F46623C9CA k^l-
143,592,646 *0DC511A952B0A48D152419775810C67E399C6BBE maxwellpedeare
143,592,647 *0DCFA31E961B69A3ACF051DBBF8DFF97B0A1B441 MC5M31
143,592,648 *0DCB204139FB2A5F012253F1C18D9A688D4C0375 [email protected]
143,592,649 *0DCB23DF450F130DC9FAE9A10E6BC124CA1DDA70 MECEGUE
143,592,650 *0DC3B002F0C456009A963772C23434A1FD35C8CD KONKERCELE
143,592,651 *0DC802001A2492BFF65DECD6442F04967326AB14 kortling5
143,592,652 *0DC7C3D123890C1E9B3A318AEAD77533CA768EB8 MEGŐRZŐIT
143,592,653 *0DC94A7AA04D61DDDB746D42AA697C7DF98AA380 KRANSKLEP
143,592,654 *0DCCFAAA4C003D4DD06ED2CE37643296D37F5513 kristin.truett
143,592,655 *0DC7C9E93FBC352E7CE775B5C3D5D0299B80B87D [email protected]
143,592,656 *0DC228B58A5FCB5CCA91205BA562FB4555C787EA KULTHUM3
143,592,657 *0DC6FE956C8204A52103E96359C2097458A3FB9B KUMSULUBISHA
143,592,658 *0DC67EA7E66396E196E9AF1F78C701AA73D7A884 MICHELLE-LUSSIER
143,592,659 *0DC0E4A9C3DD93C6340F2BB248CD9F9D1181F79D LABRANCHEMAY
143,592,660 *0DCD40804FC80F149C0B2BB139F724C51A9B747D lacmoids4
143,592,661 *0DC461C4F150D791B705F8930F298447F7E3AA18 LACY.KEPANI
143,592,662 *0DCCDD2A31E2703745E449B1BC6EA2032293BAB0 LADYABCD1234
143,592,663 *0DCD530B027101A40CE76E19CE4AD1AF833FAEFA mikekomorowski
143,592,664 *0DC37EC5C699374E9DD6B0626205F53432E5E5B9 [email protected]
143,592,665 *0DC974BC336338D158CCB4D9B44ED8D00A170BAF MIKELCONSOLI
143,592,666 *0DC2E4CC9B639880773F660609FB42F8E93CC95C LAMPREYS
143,592,667 *0DC4CDDDA5A0648E05373E681DC09BC0C832D27C MILLARDKHALSA
143,592,668 *0DCA00C76F2AAD479D42F06DF61D1FFB82B8A62A [email protected]
143,592,669 *0DCBDF5D1C71206B99A509E411440C52E93CC9E2 MILLS2006
143,592,670 *0DC9B10AC7ABBC78690D910BB9FF9BD371EA5660 MIRANDAS2
143,592,671 *0DC4D60EE5927EFD00BF0390B8A3DF386FDBBF59 LASLOCAS.1229
143,592,672 *0DCAA8DA7B01309BC281CF1C94263E9B51C08288 missin6
143,592,673 *0DC4D85D8BCD1B1F2D38187BB2E540F2365AA1A2 LAURA-FRERICKS
143,592,674 *0DC088B7B5548D2B41F49096EC1C08E750611ADC LAURENT-WEBER
143,592,675 *0DC8D74CF076284F0181A9A6C0A9C958D3CAE158 LAWERENCE.MELTON
143,592,676 *0DC694C22140661CFA26C04EE5E6CFB039BE5802 MIUREM
143,592,677 *0DC5E64A11CA41684E95649F8FA63D13605D6BFF MJ{
143,592,678 *0DC021DFD938489BCB610ABA1BAB0116FD72E534 LDECKELS2002
143,592,679 *0DCA4619223D56157349AEE621B6B2A213A33BCD LEEDOKUCHITZ
143,592,680 *0DCB3DDD97BBF6F26308FE65E1C2241013D2B24D LEFTISH1234
143,592,681 *0DCADBFE98C58ACDA087B45AA8E88E81C28D6F43 LEIFLOVET
143,592,682 *0DCE220BD0EEFC2AC5EB3FA7D1469C5B889CB675 LEIFSIMISON
143,592,683 *0DCF5846A5C5B6F5A689FA9CD7BC6D944569D826 [email protected]
143,592,684 *0DC65799BE1B33EB04BDE16E9E4715E3324EB086 lelandmccally
143,592,685 *0DCDA45F82616C2F1439219CA73152FC33828660 MOHAMMEDGALJOUR
143,592,686 *0DCA5CB57645038B812F73989979A8346A4799D1 LENFURBEE
143,592,687 *0DC80C28D716CD1A2C3988F0722132BE1B95BB0F LENNY97ZOK
143,592,688 *0DCEAAB5B8929A781ADCA0AB81E5B4DF150AC1A0 MOISESDELMURO
143,592,689 *0DCC4373DB7DA1FB1B8559CFB9E0CE4AC9B18092 MONIQUELALLIER
143,592,690 *0DCE60F601E84DD7865638E38811B812FFD11907 MORE14DERRY69
143,592,691 *0DCB1047CE0A45E80FB37D98CCB0DF7E471DFCC7 ;LeVeL400(uSeRLeVeL)
143,592,692 *0DCDF71F5B82906FA4362DE52303EA115922D171 MorgensFango,AbendsTango
143,592,693 *0DC7FCE91E54C3A5D8435DF5AE7135811F03E08F [email protected]
143,592,694 *0DC23BC0B1176E1EAAC36D464FF83142623C70C0 MORTON.YANNI
143,592,695 *0DC7981771AB2C61BA213BDA6074036D43EC7971 [email protected]
143,592,696 *0DC7C31CCB17A79CBD2F83DF2ACF8CC3618282B0 mosespham
143,592,697 *0DC88450578C73FB88C7436AACDBB9155831DF7F like-more--She-raises-her-glass-between-them-to-disci-
143,592,698 *0DCEF523BAE80224C1806FA4024080C85A58D9B4 M#T[
143,592,699 *0DC5C6A6316B60A44F211F1FE0D90698E40CD7DC MTAPINO
143,592,700 *0DCE618A30F56610D5C04B5B968E96FE2EA7F44E murraymosby
143,592,701 *0DC2EB6E6C1461E773D46AC0288E8010EAAC0ABE myguido1991
143,592,702 *0DC88427241BD42524F7078269F3D74E5575A6D8 MYMARINE1988
143,592,703 *0DC5E9CC5E5DA7AEFA75CD3B70240172143DA3AB myronromanski
143,592,704 *0DC89DE21CA55ADA1ABE920B4C8D4B098F9198FE n)*
143,592,705 *0DCAA9A0A32EAE2C787DE1D0CC76682B26AFE543 N3U+R0PHILS
143,592,706 *0DC1EAC1596016A7A86C99ED386D668C03AE59A0 LITHOMANCY1
143,592,707 *0DCCCE1E956574E04C4AA15BF18EFF7A6C5D8FD0 NABIL-AMHAZ
143,592,708 *0DCA0C3D38E7B65960EC25A2CA187804C29AD187 NADELDÜSENLÖSUNGEN
143,592,709 *0DC6CD7DE1F93AED85A884B5F33581FE0D6E5785 ljlill
143,592,710 *0DC34B54386CE698AE80571A059ACF66785B4E5D [email protected]
143,592,711 *0DCD9202A0C26306F3A08F66825CE261F7D6DCC3 llyhms
143,592,712 *0DC58693A4A695073211B55BE5BC22424E7DA65B NATALIE.PETTITT
143,592,713 *0DC3B3C2096F6C0B3E56FB52FA3D47F2588C16F6 [email protected]
143,592,714 *0DC576A1220CF113761319C136734CDE8A49B1BB ndFeueran
143,592,715 *0DCA640A9E84F701D668459E150B89EBE3DFE2D7 nedrorev6
143,592,716 *0DC8B58390F183B2C89D2E86E2BC36A29D7DC335 LORENZO.ROETTGEN
143,592,717 *0DC0FCDB9F35B82DF81AF368B94FB6693988168E LOUJOHNS
143,592,718 *0DC862D357838DFAC855C4EAF07592C61E8BE18D LOVELAYINBETHLEHEM
143,592,719 *0DC3AD2025EEC2DA9AA89158D8F1C4604377CB43 LOVE.SONG.AND.TANGOS
143,592,720 *0DCDE53D196B125C3F930D9AF6824BE2268BD2F8 LOWELLSKEETE
143,592,721 *0DC4B7EFA46337AEC38ABCE457186838BF6F54C2 LOWM
143,592,722 *0DCF6A9F31FD8B0D7B185C1CC7D24E6A93669AF6 lqsdclwq87
143,592,723 *0DC0F073A608E34F38E7FA58D4FC83EF98723096 networking.2
143,592,724 *0DCFA6ED6472C5C3C4A5DB3076AEFE28BE71C45B ,L-S
143,592,725 *0DCAF020DEE1AE61F02877022BE4AE905EDDE723 NEUROLOGICA1234
143,592,726 *0DC37A298FAC3F803EFB0D23DB61527A3DE02295 LT71748
143,592,727 *0DCB837DDBCA27135D1ACEE5FE130C3CB0DC191A newsky
143,592,728 *0DC293EC74AD37796813D587364B93339314C522 !NH48!+ED
143,592,729 *0DC4F60489280326BAB76E1681816EF6015127FA nhung.ngoc
143,592,730 *0DC197D8CB678E31FF84C9EF6E7C21A299F952A4 ;)niaMesolc.,niaMeralced([email protected]
143,592,731 *0DCCAD6E182908BC07AF435508CEF7DB171B712A LUISHARIS
143,592,732 *0DCF2F8799ADBFB64914A2F8B9A77CE6D7D11B2A lukas_nos
143,592,733 *0DC66AC2E3CBE53B4FBA8AA3E16812E33F5A4673 NICKNORTHCUT
143,592,734 *0DCEF2F16B086DD41AF96560B47CD9EC615F910B luntala2
143,592,735 *0DCBBBC3FF0056D89F227A6C8332A48F95BB0948 nikkilovelock
143,592,736 *0DC6512807996D81F56B62B4DBF5DFB1A5ECBFE1 NILLAN TAIKANAPPI
143,592,737 *0DC5587A8C32B832894015C462C299150C2AB420 LYLE.HOUCHIN
143,592,738 *0DC87068AFBAFAD89B6724710938BE476D9352D1 M0N4DIGER
143,592,739 *0DC51BCE720F4840899DDD8C4298CDDD0A95175B M3DI3V[email protected]$7
143,592,740 *0DCA460B8BDCC77F0D79832E6DE2FB04450D3053 NODON'TTHINKSO
143,592,741 *0DC022B84C6F15E3DC95D674931D29FC6293539B MAGEREM6
143,592,742 *0DCEC461E0122D4409A5C8CE935C1FE7878F2C6E NORBERTDUNCIL
143,592,743 *0DC65DB64AADC14AAEC43BB118BEEDF9263EFC99 MAKAKO6
143,592,744 *0DC9A4E76A4F9D2E8657407A66BE1DCDBE10AD6A normanremlin
143,592,745 *0DC3B4B1E10A0103A90B203E309C59E5E22F2472 nosymbolicbsw
143,592,746 *0DCD44E728CC62B6E67AF2480EAA1D8BE9A6EE29 NSF4YOU
143,592,747 *0DC799FF8A742DA73C21759F27C50DA967A7097D NUMBERS.DASILVA
143,592,748 *0DCDECFE3DB5EFE6B752501DDE7312C40B419E0D NUMBERS.SHEARN
143,592,749 *0DC4AF82A26E19147E2722969A550C25B7D746B7 marcelinogrustas
143,592,750 *0DC73168CB45DC6FFE0D29BE36F7F4E30F6A5D98 [email protected]
143,592,751 *0DC205BFFBFCA53B8B4785E8FF407BBAE565DF1C nwlhtapa
143,592,752 *0DC374D5E89F7FE8BDC3FF29FF1B4880A4A333BC NWOJTKIELO
143,592,753 *0DC8A2DA824015032B12D2560C1339BE71A796C6 MARCO.TEDDICK
143,592,754 *0DC5FB87B1B53333CEB89ACBECC79F099112C710 MARIANNE.PONT
143,592,755 *0DC36C476D3F356CE24FEB582A29F6B7823B4631 marigoldi
143,592,756 *0DCCE40322153F739CC3437204237E4FF808A49B OATMEALWILDCAT
143,592,757 *0DCE1EB897100D76FBD68FDC8B37CF16AB71EFC3 MARKEAGLING1234
143,592,758 *0DCCDC1FAD0078970B06277983F21AA379474CDC MARKUSSCHREIN
143,592,759 *0DC41A9F9D49861DC0D86C41855E33F50DE387F6 MARKUSVENOSH
143,592,760 *0DCB28E95C851127D05AC0FF7C34CC5D7A844EBD MARLON.BETHERS
143,592,761 *0DC674D9C52BC8310A33CFDCBB03E86DA95954F4 MAROYASSER
143,592,762 *0DC0837DCCEE832D73A12B026FE9668DDD57FDA9 MARTYSCHILD
143,592,763 *0DC43E223C918713C4A732C6B0EA672BF3EB6533 MARUNGOTTIL
143,592,764 *0DC9D3A30073C42EAEFD765E70C3C7956E089CB8 mashrur.khan
143,592,765 *0DC9BA1ED33548AC7DEF72780DC0F7C50166DACE MATEMATICI2008
143,592,766 *0DCCE54BE0C8936BEDD7391DB680CB4456866BD8 matthewbuder
143,592,767 *0DCC5C586B9FDD8846AF369BF22CA12D0CAC4A57 MATTHEWHUITING
143,592,768 *0DC25A2FAC326BA2E2841D9D10904EFF40911686 mattias.gothberg
143,592,769 *0DC950B39DA56117F32DAB40B5EFD6AA35CB2472 oladipupo-oluwadamilare
143,592,770 *0DC4DA8A07B7D769FA4D3ADE7D6BD7F8B091684F MAURICIOCATANO
143,592,771 *0DC95898FE2490FC18BB491851152A80366BB3C5 MAURO.HIGGINS
143,592,772 *0DC44BB52FA6D5CEEF3205F304BD0BD271900664 MAXWELL.GATERS
143,592,773 *0DC661B778B9A5AC1BD87C952B38792DAFDFD232 MAYNARD.TOMCZAK
143,592,774 *0DCB82CF1EAAF433B7A0B2CA7402E195B11320BE MCCLIVE0
143,592,775 *0DC086E563EA0DFA0CB603E11F2218DA4F31FF12 MCKINLEYSHEBBY
143,592,776 *0DC3180DC9044762B79E2FDC1CFFD573CBD4E919 OMERBRUINS
143,592,777 *0DCC8BA5A565666B4F533E3786CDE3AA20C8104D OMER.MUNNELL
143,592,778 *0DC97B9DD49707D067CB00D57CD160047F84D06F medtyped
143,592,779 *0DC6311BF0FD432DC916C6CA9B1820F5FA774888 [email protected]
143,592,780 *0DC3B3AB6AD5CA3B22A39FFF78D5691CF4AE9413 meerbos
143,592,781 *0DC4B1FD3904C6EB401DF023591201F96E225345 [email protected]
143,592,782 *0DC38AE7D6A98017A3D2A8F825090AB02BE9CE69 MELANYLEEK
143,592,783 *0DC3B55A580D93B296E8A4068187254753CFE3C0 }O{O~<====P
143,592,784 *0DC18723A9F0AC28CC8439D455AA77291083B031 (O_-)**<=====P
143,592,785 *0DC51B5225BEEB1CCFB436F1E6539DAFB520D936 (^_~).o~q==q
143,592,786 *0DC56764120D81601317C5DA93D6E468BF16CBBD ORCINOLIS
143,592,787 *0DC5B57F1C0DCDB23DD28BF2F1A003FC959E461B mervinzeyadeh
143,592,788 *0DCD5900BE6E827A5DC0386975FE016954A32619 orlandostinchcomb
143,592,789 *0DCF3CE701F15B017F62E4E3A003DE90589D5C2E MICHALEMAROLA
143,592,790 *0DCE62E6FBF9386E2B0DF2A872A3D4A8BA7E6D7D MICHALEYAMBAO
143,592,791 *0DCE37B6E414FBA293592FB408563398CFD129E0 MICHELMONSERRAT
143,592,792 *0DC41D62E0EB65DE3BF6189334245578058CE498 MICHELSWINERTON
143,592,793 *0DC1FA20E30BDC400A328081225F1E7D0B891C9A [email protected]
143,592,794 *0DCA6FC777E9CDDBD410CCAAB0835280067A14B3 oswaldohollingsworth
143,592,795 *0DCA2EF4D73B05FCDF45CCFFCBFFBE42010A3EFC [email protected]@L
143,592,796 *0DCD2D7DF0CCB327EDC6823C19689F3C24CAFA62 OTTOVERBILLA
143,592,797 *0DC7A5EB028EDEAE47F8CCE6AA9AFB71F072F856 OUR-TICKETS-TO-THE-FUTURE-ARE-OPEN.
143,592,798 *0DCE158F8764943A269EC7C54F303060793F3456 オープニングテーマ「MIRTO」
143,592,799 *0DC8F76D30117981D883A07A6F51FA9485D58552 [email protected]~0~o}o{
143,592,800 *0DCCF5A0A81369C3A377B5F7EE9AC2A9BE7EF5BF mo71va7e5
143,592,801 *0DC77FB8559284799A09118DF66ED2763F74D256 MODTEOP
143,592,802 *0DC4DFFAF5F15DA50CB977C1384B6E4C26A9A0AC pablobleggi
143,592,803 *0DC406A027229DFB01F8681794D35764405F0654 pagliaailgap
143,592,804 *0DC1BF712ED3A980B5202DF8200ACB80100990ED MONASMIA1
143,592,805 *0DC0C2DC737863B91DA9C783D068892DF94FEC41 montycreten
143,592,806 *0DC0081C73EF92318672049B688BA1134E246174 MORGANPALMA
143,592,807 *0DC18C9F457D234E942CB43A14C4A8EFF9150A82 mortonchauncey
143,592,808 *0DC7B9EA2A7169AC542BC617884B05026A254AFF mosqueta7
143,592,809 *0DCB9FA9B7228BFB8D26D23906CC3F2571D1A23A [email protected]
143,592,810 *0DC515E79E8A9627E6AB7AE6B74BA61406B97E8B [email protected]
143,592,811 *0DC140D07F462084B54635B95D1A0C54D302A794 PATIRONING
143,592,812 *0DC7BBA7F2772C43F9FAD97310EC20518C3BC76A PAVOJAMS
143,592,813 *0DC4645641906186E72BE93E9AA73D391D40FF82 mularski9
143,592,814 *0DC56DE452FA700F88C2A7E878B7DCE2F8446600 pb`~.)o(
143,592,815 *0DC94189B5321A8E3CBF24CF707315A552613F8B p=D*.*.*)8(
143,592,816 *0DC9A0860892CD7AA8875F660BE8184AEDB3E5BB p###d.~o.{x}
143,592,817 *0DC02E1FCB7E7F9E2F0911355C8FB7CAF92AC3B5 PDURWIN
143,592,818 *0DC72E0E9A137E4A462B535FCBA376422AAEF274 peaturkeys
143,592,819 *0DCD40B8777D65FA2356A44B8CB8C03D5E49A203 myheartisthebumsonthestreet
143,592,820 *0DC9D8BE493515A3206154C4F3B164F6DF4A3F2A MYMIDNIGHT23
143,592,821 *0DC519E50D9D2ADA2D943FFC2A5884018DE830AD myriley91
143,592,822 *0DCD7D895D46DF78EE9B25F7404BAA5659027770 MYRONESMAILI
143,592,823 *0DCED581C55089E154EBD6BBE30CE2E8D51D488D persönlichkeitsexpertisen
143,592,824 *0DC21A2789C7EBDBB306F635430F73A7D65FAF32 PHARMACOCINETIQUES
143,592,825 *0DC584DE29530A253C991AB889CDDA0D15FE5191 PHILSA.ORG
143,592,826 *0DC3193167AC9CB652EA039A479CBBB548912893 PHLOEOPHAGUS
143,592,827 *0DC40C7F54A4C6C0B1278FF65C099E5DC8C15536 NATHANIEL PEAT
143,592,828 *0DC7DE83A3A1F41CB9265CDEE10BA00840C9936D NCQTTBL7
143,592,829 *0DC1BC6F7B9800353EC6C7CE8B35FCF3E4C7BC17 PINHEADS-R-US
143,592,830 *0DC0DC0D0D34241AD28E1BD0F57D1CED75007E9B planetmusic(feat.shanti)
143,592,831 *0DCCBF11DA5EF257B359C25CFC12385CF427B1AF nealbrokke
143,592,832 *0DCB408ECD929B0506E79F2DA18DBA58FE6B9148 NEHILJAIN
143,592,833 *0DCFD3E95B284646A4C6FE187E7ED2F523984E25 POKRAJŠI
143,592,834 *0DC80D19E03B90EEE7C6836CCE70C7901BEFC8D8 n'entarrane'ncelu
143,592,835 *0DC3CDEC88DF27E8867A3B149E8394EFC99DD087 :PO~ [email protected]
143,592,836 *0DC16319106258938BD4AB1F2C91DFC78DF3247D p##@~o~o.)x(
143,592,837 *0DC706A67A0F31C37E9C1655FF288FCB335C7CA2 [email protected]
143,592,838 *0DCF95BBC9833E4CF3F3787CED4B950CAB504568 nesha-herron
143,592,839 *0DCE61DB1C53C802F2D414CF2A8C877EF7EE9B47 pp~0splat
143,592,840 *0DC26B097DCFA0E8CACD4B30E3DA6C5010B991A1 PPARNON
143,592,841 *0DC1F78EC12C66C192E53C73CF156A38D03857EE newjerseystructstu
143,592,842 *0DC9EDC61837E60956C8181F110388B08EBB2568 PRATICHCHHANNAAN.H
143,592,843 *0DC922AD04E4208C3B3E32E059BB3E7ADC144019 PRESTIGEPAVING
143,592,844 *0DCC80C0E9CC582E0E0191415F794882F2BE9A3F PRESTON.LAUREANO
143,592,845 *0DCDD112D33BD375961B2E24F4CB43AF1B79A0E3 PRESTON.MONJURE
143,592,846 *0DC1D61328EF14FBF7D026EF933852DBF531CBEC prickmusiccom
143,592,847 *0DC4ADF3DDB15AFCB5FE845FD2DC7A55135393DD [email protected]
143,592,848 *0DC7BDEF837F06A58A0A5F2F92C57B104072021A [email protected]
143,592,849 *0DCEC15691EB2451299D9E127DF7BA13D6228409 PROVINCIADELSANTA
143,592,850 *0DC647D59CD67BD52156FDAE928C47781B5A3DC1 pulluard
143,592,851 *0DC68AF30173B111B5D076C77CE1F47FF0DE3513 PURSUERNING
143,592,852 *0DC70915F257C4DAA6747F08AFBA942BCBECBB29 pycsd
143,592,853 *0DCFFFCE0B9FB76A462DEABF8D06F37573EFE429 [email protected]~0.~o)8(
143,592,854 *0DC6EC2B821D3A20DB8C7A1FE98FE15F079FDD32 qahat
143,592,855 *0DC08C8D62FB7B0710C8CDD103C9CEA00495CDCA q====D`~-(-_0)
143,592,856 *0DCB7F83623BA5FAD0399AB24248EDE4E463B9A5 NOW GLORIOUS
143,592,857 *0DC9FDFE1FA92E6CB015E27405EF4EC0B2EC5D10 [email protected]
143,592,858 *0DCBFC6BD465F0F036DB17F7A14E017CB530C4EC NSCLPTRL9
143,592,859 *0DC697662591FB9F92FD07DB99E4CF431C308FE6 [email protected]
143,592,860 *0DC28444E7D654B0849177E865B4E61928DC37A4 NTTRNNGN0
143,592,861 *0DC5125E38CCAC6681AE81D745E11FD00EA419AF (><)* qP
143,592,862 *0DC7043888CAE78C56476B1D44ED1F17BEEE1176 QPLZ
143,592,863 *0DC98DE1CA0C6F64056E659BFF81C395BF56CD58 )O(-`(#####8
143,592,864 *0DC2BB5163D7E7B95D0FE1D06DD8C901FD16B5BF QUINN.MEENACH
143,592,865 *0DC3645EEAD59E7C1ADD36594C626BED69B82574 OCULISTSED
143,592,866 *0DC66A060ACE699C33086F11B9A455EEFB13E7BC (O_-)~`-~`-d===B
143,592,867 *0DC247CF3FDF668AD7CC41BF84A82199A8CA95CB [email protected]@7ion
143,592,868 *0DC61FDB909503F97D8C1A9A2D457623B46EA643 R3SP3CIA
143,592,869 *0DCC744CB6BB645CCD2550E35A23932F31F6A785 OFFOFFONLINE
143,592,870 *0DCCF6230DB9BCE487DBD8BBE91DCA60388B0750 R3$UM3RIN
143,592,871 *0DC15A81BAFF197133196DE5E8EBB164E839DE5C RANCOER
143,592,872 *0DC4369ABA02299B546D2EB7885CA25BBBBF3E5F omaingab2
143,592,873 *0DC00E97E25A118DA7FD4636AE99701EA3B44D7B omarcintron
143,592,874 *0DCA5758675CDE675DBA7A4E747FBA3944DCE138 omeralkamel
143,592,875 *0DCCE1A120A7AF9B9F20042D1879D4215382CB6F raqxtrupdates
143,592,876 *0DC313F0C9CD47DB3C498CD8E918BAF566ACB9E9 ONIMUGELED
143,592,877 *0DC514D71CCB08D2B70776A8ED17EA35D42E255C on-the-other-hand.]-counter
143,592,878 *0DCA9EE0DC7212DD17505C12756157CB87CB2A13 (O_)O~<8
143,592,879 *0DC6CDFC4475EB03D07A8E9605CA32C34CB33A3D OPTRNET
143,592,880 *0DCE6E30F707C596888F7D008E9C521A03178C65 RECADAR0
143,592,881 *0DC54154798CAC7B43121C2E7934E572FBBA801F RECCOSREWOLF
143,592,882 *0DC312AD92BF4123C88F32E0BAEDFC9E2B0DBB28 REED.GRIBLIN
143,592,883 *0DC93036EDB718FFC1AF5A385CEB1AB38B696D6C ÖSSZESZERKESZTŐ
143,592,884 *0DCD22E51C236AA2087CCE83254976E038403816 REHCTELFNIAR
143,592,885 *0DCFDD53C13A4409C6759D13EB4FCBE67668C39F [email protected]
143,592,886 *0DCFD31EACB76D94CB98EE90CCEF749E015779F4 REISSHOW
143,592,887 *0DCFD418A1CEBCE609A2244E6CC88D57C0184F63 reissue1
143,592,888 *0DCFB3A007B3B57725507FB38C3BCBA2C9C0F11E REMISKREDIT5
143,592,889 *0DC4F68A6A6BD59B34A95D4E220BC8B168EC89FB [email protected]~0~o}o{
143,592,890 *0DCCF5A0A81369C3A377B5F7EE9AC2A9BE7EF5BF P0STG4LI
143,592,891 *0DCDA42049799E0BC7CC25AF3947B0DD60C7F258 P1A+EFU1
143,592,892 *0DCB628FA8E87ED649F76012F486352518BEC340 [email protected]
143,592,893 *0DC33FA026C4DED56523B2DE04D1AC5385180B9E RHODESIANRIDGEBACK56
143,592,894 *0DCE7B2CCD5D6C01201B742778F217B2B149A1E1 RHYS-THOMPSON
143,592,895 *0DC0E9DDC1E40FCA0DD723BDB83312214CAF6D17 PARISRETTER
143,592,896 *0DC1519B54F5A7CF520D01A798BF6D8ED8C9F602 PARKERUZDYGAN
143,592,897 *0DC9826D5F4B791A53CABD7A4A9EA4856FEDB060 RICERCORICERCO
143,592,898 *0DCF2E33A179C56BB4D6917F93B942E0A00A0D89 RICHARD ROOK
143,592,899 *0DCC28DE06B4EEC9D9321CC152A76E7856815EE6 ricing
143,592,900 *0DC9D85A5F0369BD3CE4FA387A09E448A559B84A RICKHAGGARD
143,592,901 *0DCBDC1ADBD5502944A22C97B10A68F6B8103705 RICO.HORA
143,592,902 *0DC3F20C7AEC817C7E4C639ECAFD24A74D5CADB5 PATUAPATANNUFIRDA
143,592,903 *0DCA283AC678911C26A1867016D91A71FFD9C0DF PAULMAKANANI
143,592,904 *0DC7872D065AB9C4C169BF29F9B618521B56249E RIOKIVIK2
143,592,905 *0DC0B6DEE336BF34447E642C4B5B5A86CC1218A8 PCMART6
143,592,906 *0DC6C8AB02EFC283717AAB1D929DDEA72CCA71B3 R#,L
143,592,907 *0DCA33FC4250008D6931A57A386AB8B970D4B551 RLJONES8
143,592,908 *0DCFF1A30305A45E9B2466A0E8E3690DFA0A52DA ROBERT.PETIT
143,592,909 *0DC28CE7515D8208670177F80D583CE97D213C75 robinsohl
143,592,910 *0DCEFE754A0812B9B37EC8200CCAF95A08330572 rockonia
143,592,911 *0DCFA61F6742919B500DD98D93B0E4501C4C62B1 peteperz
143,592,912 *0DCDD295B49287E55448C70B92D5D8D8804FEFD6 pfrigplv93
143,592,913 *0DC8A7D8BC159B6C28297245BF3DA706EB640836 ROLLANDCONOUR
143,592,914 *0DC99DBA8525F9BB0A7608E41C48730EE204E3F5 [email protected]
143,592,915 *0DCB04C4A4C3BA5244E8A1F6B1DDE03548CA66B2 PHYKNOW
143,592,916 *0DCB4FFA74198A8A7771D95EF54D40C60A3E15C3 rosariomayans
143,592,917 *0DCA387DCBC0B4D33027531C71D5BBDEDCBB4356 ROSCOE.SCHWARTZE
143,592,918 *0DC7B0B1847A942D9A284DE59DD6A99CF040B10F rowe11
143,592,919 *0DC48A995D1C6390257EC54474F263D9FA8C75C7 roycetrodden
143,592,920 *0DCC5CEEF4A785733966FD023EF2F7B31ED4A2C9 PLATONGI
143,592,921 *0DCA5A1F7F777290EA5A59DB8DD37AE61B4F3435 RUBINMAURITZ
143,592,922 *0DC37758DFDDBF8330E42DEF722504FE8BCCEF82 PORTER.SALLAZ
143,592,923 *0DC10B4EE3B13E39A68519E70201EFDC61F8E9CE PORTUGALISHTJA
143,592,924 *0DC413C54D30ED1AE79B59DC1EF45EBB7FED7F53 PORTWENTWORTH
143,592,925 *0DC037695ABDC817886F0BFDA4CEBD07265B7D13 RYUHEIMATSUDA
143,592,926 *0DCC8A615943B9F9FBDB0EF388AE19048849D082 [email protected]
143,592,927 *0DCAD70752C779A8F8620E5BBE790C6CA9C26FE7 S3MIORG4NIS3D
143,592,928 *0DCE273FEFD2B609E67F0061177381E785182398 p-P-~0>-<
143,592,929 *0DCB9A833D8E8B19BFC780636B577E085A38C663 pp~0splat
143,592,930 *0DC26B097DCFA0E8CACD4B30E3DA6C5010B991A1 sakarlabibala
143,592,931 *0DC953C414A8CED3D11133481BD03A715CD2ACBD [email protected]
143,592,932 *0DC3D7E2BD03278956B21ABCFDC57165E660A02F PREĜ­EJO
143,592,933 *0DCA4E2A617C6F10D6F5BE5BEBE2CCC27E17A194 samar.verma
143,592,934 *0DCFEE713C58D8E4AA43F23BC0DC302D529BCDF4 SAMBLUE0
143,592,935 *0DCF2232E7BA92462264853C4CD6454E3602BD83 @pressf
143,592,936 *0DC64A73B82DFBE7042DB6FC711A6F8E3EA73A98 primavera-portena---astor-piazzolla
143,592,937 *0DC920DCD5EA65E20A42292B2F9CF6DA6456236E SAMUELNAIDU
143,592,938 *0DC326B6380B24FFA63752C40208E185CAFF0135 SANCTISSIMAQUE6
143,592,939 *0DC9863CBAEE4459623ADADCCCB1E8D3A0F4275A SATURDAY-NIGHT-BIG-COCK-SALARYMAN
143,592,940 *0DC7C9433224124CA80474F61938C5CDF673F9D8 SAVIOUREX
143,592,941 *0DCEEBFE2FDF15B46AC0727DC06071571C23B740 PUTEGAGE
143,592,942 *0DC8C777430DBCF1AC98334DE27A6B1270014F1E schcemakers
143,592,943 *0DCAFE73E207C86111C0183321CA5DA1BAC2F46D Q{2C
143,592,944 *0DC592C716167BB87A41E098A421824EFD519993 „SCHRÄGSTRICH
143,592,945 *0DC737FEFE94CF5513EB787F3631CA55EB502210 QEC%
143,592,946 *0DC08E1AF410870398A458F0A892E45EEB92D0A6 SECCION-Y-PUNTO-DE-ESTRATOTIPO-DE-LIMITE-GLOBAL
143,592,947 *0DCA3623FC81178427624E694FF406AB99389024 SECTION.VI
143,592,948 *0DC2B23546A1A77B1CCEBC7A1C1F4DC123046571 q-----)**splat!!
143,592,949 *0DC65A4A026CBC82D1FEB79EBE545FBFA58CB696 Q==>*SPLAT!!
143,592,950 *0DCE80EC66715F3A00B889AEE87CDB1644164FAD QUADRISPINIS
143,592,951 *0DC42CC3DCDFA3D12B6A3E9428A38C19B63F0231 QUAKILY
143,592,952 *0DCB7765A2543608CCB122BA4E82B6E56D711E73 QUARTETTINO:IIPOCOADAGIOMACONMOTO
143,592,953 *0DC5E82B8F9301E2E99A543D0550B763F6931649 Self.Applause
143,592,954 *0DCA6BDB7A459858117540817224EE04AE69E361 QUENTINKRABBE
143,592,955 *0DCB46CCF311B1A4D8234C2D8F0CA96EF396F07E QUENTIN.PADON
143,592,956 *0DC35481F2747734040B4744C04EBB5064D8259D sere.d'agosto
143,592,957 *0DC555034EEF72AB15A0804BF91FA366AC60C5CA [email protected]
143,592,958 *0DC57F5BCAE38798129B65A3D357DC459756DA20 SERGIOMCGRANN
143,592,959 *0DC47A97243CE5343730E3460DC85834E8548FE0 seriousclubhits2002
143,592,960 *0DC3DAAC1DC41AB3D523024FF15F0D07028E72CB SERVERXSGIXSUNXVFB
143,592,961 *0DC398BCBFFA8650C658A5E083204D3DE71CCFF4 [email protected]
143,592,962 *0DC596C3FE80E2109564CA6C797545724F6D3CA3 rabasaris
143,592,963 *0DC1EAE4A2C04D3E1A60AAF3D3BA8B284B646BBB ra-de-lyon)-(disc-2)
143,592,964 *0DCFE6D3ABC1AC35611A7C3640B60F14831DF02E ralgnis1
143,592,965 *0DCE2C5480CF66EB454BA5E40A5C3764D98C20C0 rallongement2
143,592,966 *0DCD615B3D508488853B9D7E5C4939239F95819C RALPHBORYSZEWSKI
143,592,967 *0DCCCA6529B42C8120B36F47FFCF6856B6DA2544 SETNATIL8
143,592,968 *0DC4AF7EFF8C71223EE3D678427F25ECD66D927B SEXYLEGGS
143,592,969 *0DC4220B5A63C9662529BBDD8B940027E5D9BB2B RAMPOKKOPMAR
143,592,970 *0DC231AB056D95742380147C66C1534705547059 randallpniewski
143,592,971 *0DC023549DB6761B63806F04C40ADE744240CC02 RASHAD.COMMENDATORE
143,592,972 *0DC721473A365462AD1A3F9BE07E29F6E9887866 SHANIKA.MCCOY
143,592,973 *0DCF95776BFB6547988A76265E578E2657F1EC85 RAWCAT
143,592,974 *0DC50334044111BF22DCB98666A5F94FE807DEC9 rayza.wilson
143,592,975 *0DC94B9CCFD35DD6EB50B92C29C67CA99316188D shaynebuttaro
143,592,976 *0DC44C0F2C3BE4E68E4749049B99A1F6120227F4 ReasonableDoubt(d)
143,592,977 *0DC281756C7CC24D825306C71C2760AD4B3D8035 SHINSHIK0
143,592,978 *0DC9E757B3B4FD1A6FF12D9DD0146F1B636FAA07 SHIRLEY.GUARINI
143,592,979 *0DCCE5505C0BF759B580CD0C9AED83DB7DA4B1A8 reediglesia
143,592,980 *0DCD23E770BE898402D022EE608063FEE4CDD5E3 SIARESSAT3
143,592,981 *0DCE2460DD3908946042CA68BDDF59E22637B38E SICKOP
143,592,982 *0DC656CE2AC30BE0B27DF658A64BDD732E1F8307 REGERAMING
143,592,983 *0DCC3F6D2387F106B484A8F20907E25CABF66C1E SILAS.ROLLO
143,592,984 *0DCD865B203559A6E492EFDEB9D656A3EE170D3C REIBHOLD
143,592,985 *0DC1AD1D4C4251F6D2B3B8B378B6C9A697B32865 SIMOHAYH
143,592,986 *0DC81E7C2C79C1740CEA533744F63AEF562FFB6B REINICK3
143,592,987 *0DC194A41B6F54FAD156B6FA31EA148C2216EEA4 SINNTOI
143,592,988 *0DC9742318DC875456CBFB37F3C7AB2D644D31C3 REKOLORIST
143,592,989 *0DC9D916345A51CA769BA7822F6A3F850B645B5E sis{lt{v{{
143,592,990 *0DCA964148BD5B9B6931D895E3997076E00397FE sitefernelmont
143,592,991 *0DC56E2450218F3AC00DF036646DBC74F592CF22 SITZUNGSLISTEN9
143,592,992 *0DC4DD14DB039839A5E65B0C28754BD13AD70BE0 RENNIWERIALC
143,592,993 *0DC64BCC2FD6EFE82CCB69F009F4AFAFBCC50744 reosenruman
143,592,994 *0DC1741035CC5EA56F46E11ED41E420531724758 RERAGGEBS
143,592,995 *0DC84973306F6F54828AF13698A21CC5E7AF7CDD RESMOOTH.
143,592,996 *0DC2C0FC65F3077F70955852ECE5EA89836717AC SMARINERO(FEAT.ALBERTOPODEST
143,592,997 *0DC81E841B1EFC4659702ADA041968C25C0AA835 s,.Mi.Peque
143,592,998 *0DCB9DBD18C615BF8FA15E7361B611D69CDDE6B6 [email protected]$$umn9
143,592,999 *0DCD9A74859248E3E20ACE45489E5D976D9AF19E snacking9
143,593,000 *0DCE77F799F91B96535DCB8DC051CBACF537316A REVETAHWEIKCAJ
143,593,001 *0DCCB3F856F03308A569A8A97595B47009BBC0A8 REYES.BEYERL
143,593,002 *0DC6C560DC666CBCEB90BD127C970232CC0DFED4 snsblst8
143,593,003 *0DC328FDAF391FC9AD9D7306BA46FC994E12973A SOGHMAS8
143,593,004 *0DC8645B4460050F85303449EBC22CD0C786D163 Sonatepourdeuxpianos-Allegro
143,593,005 *0DC1BF59CA59DEB0C99463F9BC2F4AD474CE9DC7 SONNERIES1
143,593,006 *0DCD8C1A596716F4C35043CC6DEC90A1B9F1A559 SORIN1234123456
143,593,007 *0DC962C71AF53314B1F08608EC7A78355BD56F6A sortiaria
143,593,008 *0DC98FECA6BEC1094D1EE87E55ABB57F7146C4A7 rhondashuman
143,593,009 *0DCDCFDFD81F8FDEEF301B186FF4C7554FC81F3D [email protected]
143,593,010 *0DCA4928F3BA478483ECB399EABB621E35B2D8B6 richrettig
143,593,011 *0DC50CBC539BF19FAB57814AC3602B95377214B2 speichers
143,593,012 *0DCB2030DF72CF6C14339609AF2A07D8AD6B6A06 spencerherren
143,593,013 *0DC1868969F9A4C9DAFAD98B5829300D8A1271DC rifath-hassan
143,593,014 *0DCB43CF4621C54C5F83CBFA4C5FB0AE079F045F RIL
143,593,015 *0DCADF35121E8BC4DAA68C2A963DA30AC10D8EEA sphinxmoth
143,593,016 *0DC0F9EB3D73572BAC7DA2D32AAD3477F066D5EB Splat!O~.(######3
143,593,017 *0DC80CBE2BA7B5CC42F925E22BFD959022033C86 ROBBIE.GECKLES
143,593,018 *0DCB7526B866D1DE6D62B07A2FB71C711D14ED99 robbiehuddle
143,593,019 *0DC31FAF27076BD801749B17DF4509CF760EE316 ROBERTLANDENBERGER
143,593,020 *0DC346CF7F8AB080DAFFB7F59724DEDD764954EB rodneygelabert
143,593,021 *0DC62958E3E5DA5AC44CACA0B9F3D8ADFB3E12CB RODNEY.MCCALMONT
143,593,022 *0DC6D7BD85F82F3810E3A33046CCF6FD16B1367C RODOLFOPACHUCKI
143,593,023 *0DCA35F6C5DD6910A33DB64009B20C1B50BBA50E ROFNIELK3
143,593,024 *0DCABB2EB518E726BE40182545F8A329EF512055 SRC="HTTP//ECXIMAGES-AMAZONCOM/IMAGES/I/11ZACGLLOIL_AA115_JPG
143,593,025 *0DC19EBD1BBA20843096994A99412F91182F3CB3 ROGELIOMOHRBACHER
143,593,026 *0DC95528577AE3E8B0B75AA82A769BD06CD8ECCF Rolf-Royce-(feat-Stephan-Graf-&-Hadik-Wildner)
143,593,027 *0DC0C3ED87E33B5376E21898E0BCBA14EF55541F SSAPRONZER
143,593,028 *0DC32190264ADDA3F14D2A137EDBE21BFA896814 ROLLANDGYATSO
143,593,029 *0DC3ECB54E85406C9736DABE56D003B751A3BB09 ROM3D3R
143,593,030 *0DC4440D5D1B0039424AC656B6176910A3EC28BF STAKENET
143,593,031 *0DCDB28A56AF37CE7A76D42EE9D7A813FA566926 ROSCOE.DISHNER
143,593,032 *0DC7D05813025B9A1407098F7157B5B64B511DD4 ROTAICNOC2
143,593,033 *0DC9503C9718D478F7F2B9DCEFD2700BF8CECDAA STEGEOSES
143,593,034 *0DCCC2E750D797A7439C18B87C3D400A80A4620D stelabbsw
143,593,035 *0DCE3A09F6573D6F22E1345D1C8B9FEE38D03FC4 STIPENDINO
143,593,036 *0DCACB255458032CC8FB06EB2AD1BE972C786DD0 STIPTYK2
143,593,037 *0DC61F72E681A43B8244DC464523BE10A538A392 STMDSTRCTNED
143,593,038 *0DC4FEA5DF39D4F2434322534BF3CC157568F6A2 STNASEPPING
143,593,039 *0DC48F0FAD45CA6EF04F8C1BA164A528DE398C58 rusarusaed
143,593,040 *0DC0DFE0426925C194DD5EFCA0464AAA6F79EA97 stratosfeertochten9
143,593,041 *0DC30F0B16A11FB001E4560AD07CF0F53BA76BDE RUVINI.CHANCHALA
143,593,042 *0DCF3438DB743F86CAB66A5D95421EA9B5E6FA1D RV37S
143,593,043 *0DC473C41B19861A3DA6DEC2E97354D60310DB8E [email protected]
143,593,044 *0DC65AC3C222E4087D26C3A0442ADF7449CACB1D S8LOCCA7A
143,593,045 *0DCA72FB00712E3C464EFDAA08C44B0E00AE7EE9 Sub.Project
143,593,046 *0DCA065441F8B9BBC4D320C02E7799925F4D57DA SULKI.KIM
143,593,047 *0DCB9444D091221530DCB3411D19A6E7D5267DD1 [email protected]
143,593,048 *0DC69BC99FBF0A02052AC042BC6EEC50644202E2 SUPPORT'''THIS
143,593,049 *0DC70378AF407479DDABE6FEB0703C1F796DFE79 samualgeryol
143,593,050 *0DC1440D31D0EDF408F7D8F250E33D4684928BF8 susaneldridge
143,593,051 *0DC33ED573EEE2201EC77C9A2D64C4BA32C62AFA SANDESHHTAVYAM2
143,593,052 *0DC69B12E90A589C14F24F3B5A145C3F7F70F0F3 suuheking
143,593,053 *0DC5B668D8C6308992D2D21276512C5D8496199B SANT MATEU DE BAGES
143,593,054 *0DC6085067DC2A978A5088376F8683ABE057C413 SARVAVIDAAM7
143,593,055 *0DCD5C73362975D525581E90E4BADE3D6B28E311 scithopolis
143,593,056 *0DC17E1B9CC2AC3D663FEA52B175797881BB0CA2 SVHDYTT3
143,593,057 *0DCEAD9BD8479082CE72A3681D854470ED3532F4 SVINEREAN
143,593,058 *0DC7B31979120259DFCA87FDEDA54A18216671D9 SWITING4
143,593,059 *0DCFF4306DA1E25C8F3B70B8E11E8AF18ECBD81E [email protected]
143,593,060 *0DC297E25D7748CDD62581DD4BDE3875496C9735 TACHYMETRES
143,593,061 *0DCC93B46C8D15116E088D005AE3210875EFB736 SECLUSIONJIM
143,593,062 *0DCB22BF2EB4BCC8A8EAFC5579A15B6BD8D0296D tan-sing-sing
143,593,063 *0DCC48B9EF0CC87DCE63BAC8D825E1FC1CCED1B9 taylorstrictland
143,593,064 *0DC2EE015062E4A9A87EEB762259134F12340FB5 SELLS-WITH-A-SMILE
143,593,065 *0DC9FB1D8A8FE09BD0C1AB2193B9339BE54AE8FE tennists
143,593,066 *0DC2476DAEAE84FACC6E56CC2FE93DA9A2FCED94 TERASSEP3
143,593,067 *0DC0357C7AA37BBF5206AD0431B68CA97A43C474 tetrarch
143,593,068 *0DCC2CC487285A9E830ABEAB13CCCEEF169DF4FC TFARCHCT9
143,593,069 *0DC684379319F709EBF9B7C2DF947239A9F6F18A thatmarina07
143,593,070 *0DCCB96898E9378B91D2FE68C56AA96FF24B1D27 THATPINK67
143,593,071 *0DC9B9BA0210C7BA327E0F784DA70F563903691B THCEFEGZ2
143,593,072 *0DC182C025462FDF62D38E6A2DDB7372829BE3C2 the-complete-published-orchestral-works-(disc-9)
143,593,073 *0DC8FB1844D71EF9BA883B5E04B2D35082E5A6B8 the-frankfurter-kinder-choir
143,593,074 *0DC88E79A224C08A57E3E3942E33323103322B9A The-Inside-(feat.-Tiffany-Paige)
143,593,075 *0DC0C4F4946E6EC90E2BF07248E779539C7A2FC4 Theme-From-'The-Deerhunter'-(Cavatina)
143,593,076 *0DCFB90DC79997C891755A0FECDD76F2EF771B9F SHALUPI
143,593,077 *0DC9B9A726E24A727FF2E440279AEFA859E033F9 shaun-ong-jing-long
143,593,078 *0DCD0028D7DB7CD80C98F2EC21772F7841C2EFC3 THE-VAMPIRES-OF-DARTMOOR
143,593,079 *0DC254F39C2AF5360A05A59001F67BF776203188 theydid6
143,593,080 *0DC61AF6285D37F3C59862335F09AB4F165A8899 SHELDOM1
143,593,081 *0DC1FFED365DDAC94FC2F367EC2C228F607F0F75 TIGERMASKS
143,593,082 *0DC4AA0192AF63BD9A804195A54177762CB6ACB8 shirliawong
143,593,083 *0DC41B3290F4ACCE90C1ADD049E2E8A77C33D6B2 TILE-BR
143,593,084 *0DCB6DD8F6D4BC721DCF54F33E463D9F6C02A331 TIMJAVIER
143,593,085 *0DCE24EFF9ADB43F167F0A636E1ACD2432F002FC SHUFORD6
143,593,086 *0DC9CBDD4760D6B6A24AE8FD97A6932AB7A080BC TIORREDOXIMA
143,593,087 *0DC8B9A6C29F4C720F437617F100F4AF34C45772 TLZ%
143,593,088 *0DCFABD816794E819447CE84744B19DF19D1BA91 sirfstar.iii
143,593,089 *0DC7A1C93B9F1BAB0E2C7AFB32A0B066E16740B9 !-SIRJOHNFALSTAFF!"
143,593,090 *0DCFB9180829E37E79727D4D401D1EEB31D3209F tom-lyannas
143,593,091 *0DCF6996FD63A387B60138EE5E3BAD7EF03A7446 TONITE, I'M YOURS (FEAT. TANK)
143,593,092 *0DC39036E9E4B1F49C6402A48B648FD83E11ED15 TONYA1392001
143,593,093 *0DC6B22225B86CFC1D45F4872FBA81A8FD07C79C SIRWANTONIT
143,593,094 *0DC200D0B067F523E8986FE51C4143012980DC17 SKIDOOEMMITTING
143,593,095 *0DC320DEAAEB01090BBE66A16C235AB9FFFC152D TOUFFEZ!
143,593,096 *0DC632BB897E9707CDBA507ED89BE1473437A586 SKINFORD
143,593,097 *0DCD3CDD92FA6F0C5B4F32BC171B40EA7A258D97 skitserne
143,593,098 *0DC9EB3CEBEC3738BA267C83C56492276C908014 SKRFTTGNED
143,593,099 *0DC020888278D026AC449FC008556D5FD98B643D SLETAUNES
143,593,100 *0DC8018284A1F69BFEC470C9403DBDDE999997AD TRACEY.TURNS
143,593,101 *0DC1C7F9E184D31CA8445B2952D23E296C28EF45 TRAVELCAMPBELLS
143,593,102 *0DC00ACACC648F55C62D1B403F4577D8B7C55DF9 SNELVOUWHEK
143,593,103 *0DC56DD398904357F17D6A4E3A8628F01C48C082 traviskribs
143,593,104 *0DCA4DE7ED579BCA2DD413D458CC9046875EF366 SNIPERVICTORYING
143,593,105 *0DC1E65294D6DF9C8832AD27BC69F8487EC90C99 trevor-sang-pbj-lee
143,593,106 *0DC9494FE27495FE6054E11B3CEE6E8CFD0E4AD3 SOFABORDETS4
143,593,107 *0DC8D8F225806E61395123E80BED484EF4DAAE73 SOFIE VANDERMARLIERE
143,593,108 *0DCAE3D870D56DF98A17751FFCA0C05CE81BB238 TRINIDAD.WINGSTROM
143,593,109 *0DC4B8BED521FE4FE0C34384D8DB8D33F820F165 TRISTA-WILKINSON
143,593,110 *0DC04A12DA6B5B0202B392A7D00CA65BBFBE257E TSCHEOHBSW5
143,593,111 *0DCBC0EC33D296D54FA211356D6F7AE22D1A9ADA sourcehost.mydomain
143,593,112 *0DCBF27795BC73CCD480FD7BD6BD7FE5CBF55CB8 Sow-Seeds-(feat-Sandra-Melody-&-Toastie-Taylor)
143,593,113 *0DC686C9208CC98F9D5456E7504F594A3571EDB9 sozius
143,593,114 *0DCAB1B149EAFA8AE06402B0BA16134B4417CC14 SPECTABIS!
143,593,115 *0DC143AC997B8543A514829CE16D26AC0BF2C2B9 spectrumsgamma
143,593,116 *0DC8206229AFFC3839B67E5F5201770FF83A24C9 [email protected]
143,593,117 *0DC57CA656C20DE3BA5C9CD4C9273B6C66515DF1 SPETSFUNDIGHETERS!
143,593,118 *0DC86D36F372B84C50755E3445F2933819A78CD8 SPEZZANOBSW8
143,593,119 *0DC9A3A61827DEA38EE2811940710FB457866CD3 spitalofanfaro
143,593,120 *0DC064E1893743D8A022B2B7BB88E539049C2BE2 SPITKIDS!
143,593,121 *0DCB3207E5E15CDBFE5EBFC29801FBE8221C027F splat 0~ <####3
143,593,122 *0DC5111DA06D3C135FD266FEE517B321A51B4C9E SPLAT!!O~ 0~ Q--Q
143,593,123 *0DC3D28C2845056E8ECB09D3A909BA44E84CD898 splat! o~ @====8
143,593,124 *0DCECFBA80C4D973AD2636610F460099C60278B8 tussenresultaten.
143,593,125 *0DCC9E65AEFB181C3BFC5A4DB1C5F68A8F7257DB SPRINGCFJING
143,593,126 *0DCA3DD6C988C2748A5ECC5A9892FCA8874626D9 SQEFVU
143,593,127 *0DC7C843A81472C486B2370F1534D3CC98671A14 TYVOLIN
143,593,128 *0DC84F438E0FB289FD58E4D66C46A9D39F899A1E uchitaihs
143,593,129 *0DCB07E38111BD9A0085A40AE4DC4EA4133C05A4 UDIPTTA.RAJKHOWA
143,593,130 *0DC977FD85831237DD552796320E21FEAD2BFFF7 UFFRIREZES
143,593,131 *0DC3126576B665784B18CD72DB0129AD36A881A4 STAISLAW6
143,593,132 *0DCA9FEA25E1CA0700476EF84687569EEA8B7155 ukon.ganteng.ganteng
143,593,133 *0DC4048BC2125505FE91E2606EEAED42543E2073 ULTIMATE1991
143,593,134 *0DC9CF8587C5443C56D26951A87133DD674685B4 ULYSSESJYOUNGBLOOD
143,593,135 *0DCC0A38B7F50E65AA890D31464BAABEEBCA81BF UMAVATSHVAI
143,593,136 *0DCC6BEC43E85548A9EEC66D53D01F48ABA3CE89 starwarsandotherscifithemes
143,593,137 *0DC6ABBA149B3783CB83E0DA35B6496658B0766F stephaniecoughlan
143,593,138 *0DC04256AC71282CB6553C891CB200261D01F81D STERKT
143,593,139 *0DC4AAC7651407DC08B20000368D955807D98CBA universellesbsw
143,593,140 *0DCBF4CF12E4F4641842A23FD84F2C62477E51E6 UPIREALITYTVWORLD.CO
143,593,141 *0DC69C280187204857E82B22A5C814BF19997A97 uporhtna
143,593,142 *0DC48E7FAA38A04BDF967DE631F0934ECBD90938 uppers
143,593,143 *0DC2179250A02D78A91C0EDC2D9A828540E1F825 stevenneu
143,593,144 *0DCB965CC15F984FE185BF5347B2CEC08CBD3330 stevienagel
143,593,145 *0DCB6AEF8719D9AF3091D3F1214F0BE33ABCA0B9 STNGRPH1
143,593,146 *0DC70DD8431CE63AD125316DF460AD121572C76D usPassionBWV244:XXIX.Choral"OMensch,bewein'deinS
143,593,147 *0DCE805E2A654BBE2B0F65FFB94B58AB03C8D51B utietbudi
143,593,148 *0DC4E3FE263CAC6781AE2D5A99B88C65F64D3C66 UTIOREMU2
143,593,149 *0DCA15E405010C060D750113683F565BF0FB960A V12274507
143,593,150 *0DCF625BD64D7C4E3AA659DA47FE5F2DA18ED3F0 v1nd1c4710ns
143,593,151 *0DC60A95FF5A0F0421CA8761292C6272B9C5EB56 vadamalairajeshbabu
143,593,152 *0DCE02F245F4EA123D03212E89F6487A00C26ED0 VAMOSPALARUMBA
143,593,153 *0DC0A796D5FCC8D58CD2188278A51752633226D4 VAMSERVICES
143,593,154 *0DC357309E58FB20D84EAE607B230559EC79091B SUBJEKTIIVI
143,593,155 *0DC5F63E7A1D2FEB4E1A1DFDAA15188CBDE211D3 varunkumarrajput
143,593,156 *0DC0FC00D1629DE450DFEA085030C3DCAAF256E0 vasumathi-madhavan
143,593,157 *0DCB7BBE9A31488DB1340A3C9743B041CB59F90B VAULLGENE
143,593,158 *0DCF6B46A53346C47B065402C15584A10B333E49 Ven4+0ns
143,593,159 *0DC68B5F765A6A298AFB94B894CBFCE85CB9DD65 VERÄNGSTIGE
143,593,160 *0DC7DDE9CF8579B91393CD1AB45893682B1A848A VERBALISIONS4
143,593,161 *0DCB1AD768F71CD2EE1461E9242009EA5C0BDD7B VERLAN-ZIDOR
143,593,162 *0DC0041BB9331B08E00A2CA3773D16B72937A421 veronaangenaamden
143,593,163 *0DCC8C7F0AF421E41494552F891AF71A637046DB [email protected]
143,593,164 *0DC35BA2B4D1B767580F2ACFE70EBDBED369B8A8 SUNIL.NAGARGOJE
143,593,165 *0DC8C3F8F29933FB85ED77F57128974253D22213 SUNNYMAL
143,593,166 *0DC6ACF773D430D584791894D67981430C990A5B verteidigungskomponente
143,593,167 *0DCA891D5E1F923965076B05AFC3E1EA9054202C VERWATENHEIDS1
143,593,168 *0DCFB247470C01DFF26E2DF45A52700FFE2822F2 vicci.watts
143,593,169 *0DCBE2F25497CE52D7C014F325C58DA4D1149742 VIETNAMSTEVENG
143,593,170 *0DCDC7FE28E14A6183DAFB2D1538F80D4EBCBFFB VILMA-CAYABAN
143,593,171 *0DC4DE2AE01B44676D092BFD1F92A2E87524378C SYLVIADEE
143,593,172 *0DCE33EFEFF3FB46FBE02178FE3DCA3AE3911D43 VINCENTANDREWKOLBE
143,593,173 *0DC451DCBDBAC5E8C6E41777F50C08399588F8A2 symphony.no.2.in.d.major,.op.43.-.i..allegretto
143,593,174 *0DC38E21C5943D1F8D3D85CDA150BC89AD3E2EE4 VINCEPEASE
143,593,175 *0DC073F32227EBAEFD05DF55DE7AC46893C32E4E T9R7D7O3KH
143,593,176 *0DC7B7AB67AA46730377632061D8CAD56D28E8BA VIVIENNE LEO
143,593,177 *0DC9080A4BA266D83FE23B9741BBC2464BC84CBC VOCES.INTIMAE:.STRING.QUARTETS.1890-1922.(TEMPERA.QUARTET)
143,593,178 *0DC89BF66BF0F1A393E5F36CC8B8E30A5A0542F7 TALEHREUNDERVISNINGENING
143,593,179 *0DCDAD9BA76D8923AE4196325BF064F116AAFB6C voncil-wooten
143,593,180 *0DC5607D10972F30295123629604640EBC8571D1 VONGLEICHER
143,593,181 *0DCA7D26F848A054E9F8814137259B3AA76F4E73 TALKQUASISTEADY
143,593,182 *0DCE09F498221B6070475D89AB1CE7B5AACA491E TALKWEBSTER_TARPLEY
143,593,183 *0DC2FCBE24E4C095AE5FA81E0DEED151B165198D tamanying
143,593,184 *0DCD64474D2168D43667C51E76A836D9B9F1F8F5 [email protected]
143,593,185 *0DCCAA7B0DB568FBBDCC6FED6A4B7C6F520D3D3B taniec.chilona
143,593,186 *0DC7AE154CDF175D114AFDFC8E0AAE9C7A1CEE4C waichingyau
143,593,187 *0DC42B7335AC943F6728BF4FC4F730C0CBD917C2 TARTARICHI-(CON-LAS-MANOS-EN-LOS-BOLSILLOS)
143,593,188 *0DC14318C052363E57BD0B2BFA6D0B38FDCD3AC5 tass3l.p0
143,593,189 *0DC66F08EAF4DD940E2187A0CB62FDB469F070FE TATAGTAATTAACCCAAATGCTTTTTAGTTCGTGTGACTTAAATAAATCTTTTTTGTTTT
143,593,190 *0DC378BCB1B063614741DFA2542880D7241D72AF WANDA.LASHLEY
143,593,191 *0DC9AA4E861B2742495C5DB2BE7AE1D8ED8BE400 warnertissot
143,593,192 *0DC5036A476C176B47A5B34C529639514566DE4C TEMPLATEFIXED
143,593,193 *0DCE98CE9DC21344F1C9698B14308BDB28C83839 waykingyau
143,593,194 *0DC3A170EEBA92E1E1FCACF6B3EEAF56B5B34F9E tennischris
143,593,195 *0DCD852C8A3CA75D5A160DB67584F3CB0BAAB64A waynekingdom
143,593,196 *0DC70F47DA32755E886AA4932238AEA1BB3BC0A9 TEQUILADARWIN6
143,593,197 *0DCAC4E906D7620BCCD99A455D223B65EEB94A2B weggeredenen8
143,593,198 *0DC225869B1DBB27A032FE38C82A9E97A60D85F7 TERRY0299
143,593,199 *0DCE3CEAAFA6AF93AE31F658BBF3E0E073684658 terrykasik
143,593,200 *0DC59BB15C4C15A557D5A96421E4BED909722893 TETSREVO6
143,593,201 *0DC280DAC3E801767B3D7653BA980F651B65DFAD wendellreber
143,593,202 *0DC4467F9E2A1A5DF6445F3B1AD4AA00ED92E999 T#{F
143,593,203 *0DC9DAF3F43E63A8D95538107A900095BEE6D533 THAD.BRANAMAN
143,593,204 *0DCF8CBA3C730F99F0D1ED03AA64BDB52D5604C9 THAD.WOBIG
143,593,205 *0DCE13C80D165BEB1D5D6F406EE2E9AFE044976F [email protected]
143,593,206 *0DCD71A6CA9780BDB3CA626FE37DFB857C69C4FE [email protected]
143,593,207 *0DCFF474D948D701BD4ED0102E3B981A45F18F5C THATBEANS33
143,593,208 *0DC64984EE9EA926EA0C004C4448DFB17151412D THATBROOKE4
143,593,209 *0DCBDF990B9E095FCE153614E36397B07CB7023E [email protected]
143,593,210 *0DC577E0031B79750DF67DFAE5101373B73A336C WERBEMÜLLARTIKEL
143,593,211 *0DCD6520920925BB798905AA7E30A371B42A0816 THATQUEEN99
143,593,212 *0DCA8292EEEE9D63727AF3A9B765ADC45E746984 THATSCOTCH21
143,593,213 *0DC2FF946A07280D0DC96691BDAB69148BD8B373 thealexis55
143,593,214 *0DC09E0BEC08E89EC642AB76B6708D102570762B westonkinzel
143,593,215 *0DCF6855A11FFC63CE7A2D7F88C54C2D04F38F9B THECOMPLETEMODERNANDKENTRECORDINGS(DISC1)
143,593,216 *0DC0827D1A9ED1C22F3D4C5A059059AB4074EC74 WHITNEY.JOSLIN
143,593,217 *0DC5335E96A3B788A0482E884AEEEA5BADEE9164 WHOLEONS
143,593,218 *0DCFCAC9D328033775E6115A161E28E75743FEC5 THEMETALBOX
143,593,219 *0DC0F14DDDCD0E4762A2AA5BCA5344260E97C17D thenationalmuseumofcomputingreflectstheenglishroleinmoderndaycomputing
143,593,220 *0DC156FFAAC3F76773DDE94402B29311C7FA8CBC WILLIAM.SZEGO
143,593,221 *0DC9AC94DEFAC27AA5C23EA4B73B5757A12470F7 wilsongoodgine
143,593,222 *0DCD64DE744B935439CF4135828FF3D73E58A819 wilsonj
143,593,223 *0DCB674731E7316C18C8FEEF7C3123ED930133F0 WILVER-NEPOMUCENO-BARGAYO
143,593,224 *0DCC5C86C169A5902EA82B14222242F02007B529 windfall-n:-windfalls
143,593,225 *0DCF7EDB7C879560428A3AADF76D0551D22C9A76 wineandbrandy(alternate)
143,593,226 *0DCAE9277693FC8594D607C65B97B5654F841CF0 WINFORD.SAA
143,593,227 *0DC194B9FF91C9BD93352F2B8A754B156652B141 WINGS(JJ'SCLUBMIX)
143,593,228 *0DC321D76C7C4BEE5691ACFFD12E58AEA056008E WISHING YOU WHERE SOMEHOW HERE AGAIN
143,593,229 *0DC535F88560442AAD2A4AD20F7474103C1DE0D3 WMDOERHOFF
143,593,230 *0DC9071F4FE1799E80C1DAB1DCB1D0C2018C6520 theshadowoverinnsmouth
143,593,231 *0DC2382A1A52B7B8F15D5D2864F2B8C5112F9C6D THEZXCVBN0
143,593,232 *0DC86C1D5B42B89E0C287EC5C4EB59872CAE80DF wr0c
143,593,233 *0DCBE6F7518D0CC3565BCED103AB514EA3E67EB3 wrapped-around-it
143,593,234 *0DCF801A8260D800908E5659ED06DD4B8935C57D WRITHED
143,593,235 *0DCDA3ED71BFD4A401DAACB2DAD7F1FCE913AAB1 WTMC
143,593,236 *0DCEF5C81A61F4C6CC6CD4ABDEA5C8D8B94E06BF WTPGXFZW
143,593,237 *0DC695978F72F6AE600858211464F00334145986 [email protected]
143,593,238 *0DC0778F1E930A17D6E05E6EC8073F905455C9C0 wwwmyndsportscom
143,593,239 *0DC41EFAB62BBF603DC6F2267707AAF559F0C0F8 [email protected]
143,593,240 *0DC9B4CBA600BE423F90A9D1291A0CA00294C2C3 TIFFANY.TISDOL
143,593,241 *0DC985A880A0990F00BB87E2F9B3D859B728CED5 WYATTSOLWOLD
143,593,242 *0DC8797053FE580D6FE70DC4B168E68B16FEC6FF XANADUCHRISSY3
143,593,243 *0DCD8F43BB74989E384916E7C9B7142405936DB5 XAVIER.FELIX.KING
143,593,244 *0DC180334A1D002C7A844C567F86BC93F165A828 XBTQQ0
143,593,245 *0DC3D3EE1493FFF4024412E51FEB9FC6FF87205B [email protected]
143,593,246 *0DC52B6288F83ECD09BC99B5BDC12477B8A8661D XU.DUANTAO
143,593,247 *0DCFABA56A788007FAE93F0DCD58680681667D55 y.3t
143,593,248 *0DCC1C83079AFEEDA100FD40EF201A5B94E74B07 TJP169:TENORSAX
143,593,249 *0DCB86C8911E4D07B4AE295A11BB590C6EFC469C [email protected]
143,593,250 *0DC0E1F7E0BB39C86987AC4C62285A59182A2E35 TMBNDA
143,593,251 *0DC1BE4B7B1F1A0561DFEE420CEA96BB4CD6DA39 [email protected]
143,593,252 *0DCB5591AFC04A30326F39E9464A408034CBC315 [email protected]
143,593,253 *0DCFB62F2CE7669541F5EE0BB331B73A55B0F847 YAYUK-SUPARWATI-RAHAYU
143,593,254 *0DC9DB2A8E64074129A769127F2E9C927597358D yeastpowder
143,593,255 *0DC9EF792CAEC6E42E87BE89BC1C8A607314BE47 YELENA.KERNOGITSKI
143,593,256 *0DCEAC6D97F0FA36BAF21430AF61C825A06E5887 YFBNHFPREDKN4
143,593,257 *0DC6082C79649883EB929F07BC03639A839CAC23 tobymanlove
143,593,258 *0DC8BC3F03DF2FC57B86F1874108A4ED56BDABE8 YINGCASTILLO
143,593,259 *0DC4C91E23CCAD06F1F87166CDFB6BA7BA8F4CB9 todaystodays
143,593,260 *0DC39E6F6F0B950AEAAA8431612D35EC8C43F2E0 yinjay-lim
143,593,261 *0DCBB0EA1FA20C73E7681D4DF00E0A2B1215FADA TODD.PERFATER
143,593,262 *0DC55850F0302C4D0F6D2A05A3E066DAC09FAA34 [email protected]
143,593,263 *0DC1CB1C05CCA3209A619749A2C71F0517B2AD6E tofcourtofclaimsto
143,593,264 *0DC363E4966E70E06FE804A36DFCBDC08423B33C TOMBE…
143,593,265 *0DCEA506299AC27827E062EDF5D6DA4A6751FF1C TOMBLES7
143,593,266 *0DCF305963A867FB72BB5B00FC593893AF0F6847 you0148
143,593,267 *0DCC16221DF0CF31DDA12B5B8A52666708D308DB [email protected]
143,593,268 *0DC63A919F566AB8C509E4FC336811B0E9563AE9 [email protected]
143,593,269 *0DC3301822AAA38D8137B2AEB921E069F14634E6 yulme123
143,593,270 *0DC8C04AF333DB95FCC171D30A0C09DC7EEBAAB9 TOYOTAJSBACH8
143,593,271 *0DC940D5CA34170C3EFFE14438EF8E9133E7D904 YVETTE-GARCES
143,593,272 *0DC1BB6FF5DF6155542C3CAEC6A87B1F190F09A3 [email protected]
143,593,273 *0DC7CE411C2500F3C2B7B09F364EEBB366229E1E tracynush
143,593,274 *0DCFF85CBA9A7A032BCB6EBCF0F86463C12A0C93 ZACHARIAHDASOUZA
143,593,275 *0DCF8F5B941E659A109762EA050B49BC9672482C ZACHARYCOSSELMAN
143,593,276 *0DCCC65E6A26FA9817D6890CB64E2E19A664AA17 TRAM.LE.THI.MINH
143,593,277 *0DCA3E2D8D17A8EA326A319934EF4C87C0F9A8F6 zacherycavaiani
143,593,278 *0DC2FE725DA3A05AB8A44D3CB00354135A395C34 travis-robert-vanlinden
143,593,279 *0DC394C66B70D7136EFAB9AD1CEF6D711FB3BDC8 TRAVIS STREAN
143,593,280 *0DCE9D480198DEF4209C7D326625F773B5023A5C [email protected]
143,593,281 *0DCB5254DB89602A5B042821E6A7C1A3539250BA ZASĄDZAJĄCEMU
143,593,282 *0DCDA60F5CF451F03F07053877CFED638FE3210A TRENTONVOLLMER
143,593,283 *0DC39F5520EC5203667A9A798F3F9269AE29AFC4 trevor.vellenoweth
143,593,284 *0DC27B8943A05FA074FEF33420A03360CD77531B [email protected]
143,593,285 *0DCBF7FDAC273126BA88723087376E02BF8D3827 zes1
143,593,286 *0DC7866F458529CC8D8F7BE7D7EA0762E43F36F7 [email protected]
143,593,287 *0DC3C1D0F7625842C9092671C6F2ECC3C255EBB5 [email protected]
143,593,288 *0DC2A52E740436102AC8C93EF0AAA8C16202619A TRISNOJUNI
143,593,289 *0DC4F9B9D93B498B4D2BAEC8DBE6C19190C84E34 TROY-MASTERZ
143,593,290 *0DC635596EA6596CF95CA1633AFC96EDB73D605E ZJ95JLH922
143,593,291 *0DCBC2DBE09ECA24D829BF65E1339870CCDE7C3C [email protected]
143,593,292 *0DC2D45736A374A42BEC924C53BC84742376F7B1 TSILPHIANTY
143,593,293 *0DCA12F53FAFD4715CB07A123815355E67439161 ZONAEDAHMAD
143,593,294 *0DC310D2A81118ECE4C7DAD06C596C733FB7AA40 ZORHLAK.NIELS
143,593,295 *0DCC0E8BD678F613606D2FBE68ACCC9FED2348BE ZOSOLLOB
143,593,296 *0DCB8E5891DA8485C249CE106A74303DEC8F75EE TUANSPETH
143,593,297 *0DCC41837AECAC960E40A631152F4BE432813308 TUDA.BA
143,593,298 *0DCAEBF94C0B9DF3A4E2D230A74164FE0CB08CD8 zugaben-(wiener-walzerpotpourri)
143,593,299 *0DCC430D2DB92DE049306AE56DEE22BD2B38B251 turnoverdoor
143,593,300 *0DC245789A3F8D55A30E7E7FEF464C530C0F65E8 TVIL H
143,593,301 *0DC4927F7431E7906589E5B16E73B24BF14E199F –ΣΧΆΚΤΙ
143,593,302 *0DCA3D3A633CDA91A0EAACEBC86C5D9C32FB0CE1 АКРИЙ
143,593,303 *0DCBAD28AF65DA0613109D595D63FCDFF14BDF28 баласт
143,593,304 *0DC0757EAFA7807116A4F9AF0AFEE75B4BE7422F беременности
143,593,305 *0DCE0422C80D3A52CBCE5B5AFC7365CC0EC0DFFA ГЕНЕЗЫ
143,593,306 *0DC76A25339BBB221F6A011469B146BB2030B8FE ДЖАНДАРБЕКОВА
143,593,307 *0DCC78F9CF716EC946661D14DDE0C4D837B3E3FB «ДЬЮКС
143,593,308 *0DC1BFFE47142C9AE1908786A8E529B68A2976DE TZZIRDREPMUHT
143,593,309 *0DC3DB78EE71E163DF35F492799A2FF71909710F U53605
143,593,310 *0DC109E035538729EA535BEACB52A5FB18158543 UCEHELINS
143,593,311 *0DCA3CA75BD52233DF68C82D94DF9372679DABD8 кванан
143,593,312 *0DCE27E965B38F5DFB8E7D260E3E0B5A7E988792 ОВЕХТЯВАЩОТО
143,593,313 *0DCD19DFB7535E4C382B46ADF680F845E0E70CCB ПЕРЕДЛЬОДОВИКОВЕ
143,593,314 *0DCDCEA6267257FE5495DE47928DDBFD05941D25 UNARIMONER
143,593,315 *0DCD6A78C013D52299B271DADE51C4DCCDAEC070 [email protected]
143,593,316 *0DC2E4588C4D80735A003FE43157C9EBE1C4D32A undere$7m47on$
143,593,317 *0DC9F165FBA4557931AB7BA71338EBA966244634 UNHEAVED
143,593,318 *0DCF18BDF3B447E2E1C7D49F73A340E809885E1F [email protected]
143,593,319 *0DC0EF6AE650773DBB7D6ACA2CF43F6421F3AD77 ТЫСМЕНИЦКИМ
143,593,320 *0DC8EC270DA8AABD0CD4B15A2C4A804204AFE00C хаксевар
143,593,321 *0DC0CD27EBEF8A3E122A97AAE5D0E44747D67B3B ՂԱԴԱՔՈՆՑ
143,593,322 *0DC93D0D6884C41A8F2507317C57CB5C95F53B10 UNWITTINGINVOLUTED5
143,593,323 *0DC059DC3648659F9FFC721BB2712224932D2DA2 (UOBぷらざ、
143,593,324 *0DC23D1C4DABF965D0EE38E333D407D0E7F9F360 URSULA GANNON
143,593,325 *0DCD99152BC2A3D80DC3BCA3DC1622BC70316E58 USEFULPAUL111
143,593,326 *0DC2B1D71ABD34EE5B1EBDE5A0218AF9F272B2FB USERJUNKO
143,593,327 *0DC580F0C371580C9A8454EBF3819AE55269EC84 V14B111+13$
143,593,328 *0DC4B675B36C4BC04FA9E2315C2E63A962BFE7D7 VALENTINESTEPHANS
143,593,329 *0DCB205725246D5D17CD0661FC75D5BD0CB06997 VARSKUETS7
143,593,330 *0DCD5250461605D4A2AC99FFE90D67C9F1AAD895 VAS A VOLVER
143,593,331 *0DC0BBF8F6556F6FD4F5575F265002562C618132 vesseyveh1siy0
143,593,332 *0DCD802FD97ACA0F93194A0D057264CC1E4DBE2C VICKY-LIAU-VICKY-LIAU
143,593,333 *0DCD13714E0CF0CE45A2A6C3BD4F05C567AF63A7 VICTORHOLLY0
143,593,334 *0DCDDAADA2F6204B3EAE95FEEB921C2DC63B9F22 VICTORIA-BALZESKI
143,593,335 *0DC58B1B517C15AC3B400E528166B804B07EBFF5 victoryronald
143,593,336 *0DC2DAD8D685FD1BF2CBE5CDECB7D511D07198BB VIDEOKAMEROIDEN
143,593,337 *0DCC74968E25873617ACDD0737165FA2A03348FC vienstevia
143,593,338 *0DCCE37F84A9F4F83FB0D899ADBAE131B3921869 vincepachelo
143,593,339 *0DC591051F7273344AAE4F9988904CDFC099BCD6 VLADIMIR RAZY PETROVIC
143,593,340 *0DC2F152F7CCA5F445CAFF86D81C0BA17EED1DB8 VOWEL-MOVEMENT
143,593,341 *0DC70A185DFB80DBF1FE8550EB602B61D5817461 VPIMYGELEDXQ
143,593,342 *0DC67DAE96D4B1ECF35BDD9CFBD1292B8FE27183 VRPNBRNING
143,593,343 *0DC68FB585F16BC0EBB6643A83B8F9198436D388 VSINGER9
143,593,344 *0DCAB91BC2F4E5C6D08998727068D119DAA0C177 VYSHALI.KURUBA
143,593,345 *0DCD34D7119A021708A31B3AE600FF3894211F69 WAGOLF
143,593,346 *0DC70AA3BCB7D6D7A05FEC80E13161F30BB8447F [email protected]
143,593,347 *0DCAF87375BB321282E0D87E63B3E1FB5D553D04 walkerewig
143,593,348 *0DCDE8DE77885180B7234BFD480C7FD02A510770 コイル方式と放電衝撃方式は、主装甲の外部に副装甲ともいえる金属製の防弾板を取り付け、これの飛翔によって敵のAPFSDS弾芯や
143,593,349 *0DC3DD956866B3AC1D6E85B0573924D7D20169DC WALTON.GOAN
143,593,350 *0DCDA43F0AD2301A7500B4A6E9F062729C873893 WAMAPDOTONSALMON
143,593,351 *0DC4F6D3EBD79C22CD41C415134BE5297EDD9B77 wandapieper
143,593,352 *0DC9FD22A948ED0AD187619E937A916CF83DAAC8 warneratoe
143,593,353 *0DC9F407F6D1148069BB1572E5363B96A3133E65 WAYLON.LUCKSINGER
143,593,354 *0DCA22702C75B7CE747FBAC0DCF304D153F6D639 wayne.leyh
143,593,355 *0DC062BDFC923BA7D4EEA914B5A2228D59BC9BE4 WEBE PEBOONTOM
143,593,356 *0DC141AE4BECD25DF549F45E155321DA68CB6B49 [email protected]
143,593,357 *0DC7E696511D64AF0082C958418E23012486587E weldongarlock
143,593,358 *0DC20C91EF2E1450E2793642D43E7497F087AC37 [email protected]
143,593,359 *0DC655D0933098B211EDCAC51ABB722E04FB853D [email protected]
143,593,360 *0DCACAA34FB99EB673C21B1543B0AF405E82905F WFERIAC333
143,593,361 *0DC8735129BE50900FFE51FB3142677CAD374B66 What's-Going-on-Tonight-(original-version)
143,593,362 *0DCD8CC5AB7915AD757556B99E5649FDDEF76E0C what ya gonna do (original)
143,593,363 *0DC2001DE57A93E1F16D8188563B65B5AD53C6F6 WILFORDZADOW
143,593,364 *0DC09958414879C4656EE3456992D5ECEB86C823 WILFREDOYOCHIM
143,593,365 *0DC31D9FA4F626F7DD7A560A97D4760492E992E8 WILLIS-AYIEKO
143,593,366 *0DC9A913568A7D8D44AE8C74A0D890790F2D0B10 wilma-ablis
143,593,367 *0DCD318056DA9AD3A06FD58BC1A66B95B3C9EA17 WIRAWAN-AULIA
143,593,368 *0DCCD96057119CE353C68DC44D3A8FF08C925DCB W>:J
143,593,369 *0DCA768431D8E533ACECB996402F92C8B3C09578 07151960
143,593,370 *0DC2EB3EB9B98C1E496340702C1158B93655F080 0glbaa
143,593,371 *0DC5DDD45072E765FA8FADE3DF1F3DAD78F25705 (>_0)O~ Q------P
143,593,372 *0DCC4B987A5E535075BCA1DD16E683A433E22D8F [email protected]
143,593,373 *0DC1A61FF263C07B70A653B4749EFDEA9C13FF68 [email protected]
143,593,374 *0DCE65285D3E4051B1026EA884DC64BF3AA7432F [email protected]
143,593,375 *0DC320F86E8D4D0A19A79F0F16229B4B57D5EA12 wwwhotelalcottcom
143,593,376 *0DCA3B5433F229EA132CCEFFFD0D89940C637911 WWW.KILLDISK.COM
143,593,377 *0DC726DFE6A3924EFE48CB00CD0D2E246E1A6939 WWW.POSTONPOLITICS.COM
143,593,378 *0DCF3B06BF7E17BB18B9573B73728E89A4A464B6 [email protected]
143,593,379 *0DC363E7559862F2870F2EAD138A5C9C1F985EEF WYATTSHAUN
143,593,380 *0DC5656D8A31E619D55155D674B7AD3A554E1812 X1F58
143,593,381 *0DC75AD430C2E156395BAC74AC5016DFCB9EECF5 1332617 HIEKKA.TUPRUSI.PY
143,593,382 *0DC7F6B0600A071AC2A1BB5BF5954FD29C414CDF [email protected]
143,593,383 *0DC0125CEC7EE0BB50306A4D86F42831334D019D 1460110 diese-schoenheit-allerdings-gehoert-unterhalten-.
143,593,384 *0DCCD7A03501A0208FA21541A80F43A9FF30C5FB (X)O~O~Q##8
143,593,385 *0DC694E1E22B4A3605C9DA45AB342209A2D6BD59 1698109 puuttumalla-aikaisessa-vaiheessa-ongelmiin-p
143,593,386 *0DCE9D71AF14445A78B29C8E72D4611F4D6FAD61 1741049 DAMIT IST DER BAUMWOLL BALDACHIN ZU EMPFEHLEN
143,593,387 *0DC84CC80E8D168580BA31F991B68E66DD03BE1B YABUDE
143,593,388 *0DC53D9C07EF521262A7A3E1DE6AC97DE0263163 YALDDLAY0
143,593,389 *0DC6A8ECA05C45B5E946D04C27E6DEA4EC3D3D21 1ALUMINIUMBEREICHS
143,593,390 *0DC0F7D71ADB7344FB52F15232A1DC54FCEF6B99 1 ANLEIHENPROGRAMMS
143,593,391 *0DCBAE8030AA9D23D2EB4DE57EC3DC9CE01D4FFF 1-automatisoinut
143,593,392 *0DCA13EA385D0C6141A6950C99857ABA00F8C605 1-BECHTEL'LE
143,593,393 *0DCF0B8F0B4396AFFFF38FAD40642878E80DE0D5 1bergabenteuer
143,593,394 *0DCA8B433DE673715FA8969D83546D60C07630EC yazen.elshaafi
143,593,395 *0DC182AB80C6FF8781F33E37D9229AC715E4675C yazminrios
143,593,396 *0DC2EBA13201F292FEE578D6B533EB5AD95BC4A8 YCKHO-FERRER
143,593,397 *0DCB558830445CB9B70890F89C0EBB9911F8B830 YELEKREBO
143,593,398 *0DC1D407540BE35B56010E589A362FF0075E4994 1.callhome
143,593,399 *0DC72ACABB9F7D991E611B7184469F65D6FCE13B [email protected]
143,593,400 *0DCBE0D7B0326D15AC09C2B00F366CC341A8C17B 1DERAERDN
143,593,401 *0DCCF376896FDAD3C04CF3E67FA7DFBE50F97C35 YITO1983
143,593,402 *0DCA0ECD2E238AEFD7DCC7700B247DEA040EC858 1EBWEGOUVERNEURSRATS
143,593,403 *0DC2C5861039DAC4D7CD1A41851C64BBE932B59F 1eliberndt
143,593,404 *0DC63A00916E2ED13E1D6E838E0C492895B012A6 1entropy4
143,593,405 *0DCE1337F3AC78DD896A434ECCC0F8362B8A7FCF 1.ER
143,593,406 *0DC4A9F5A4F78C68EB413B9728FF94129B137769 1ERKLNILE
143,593,407 *0DC1FD7F0A33A565D60E1D1AD23E08901B7F8A3E YMOTCETNEREFED5
143,593,408 *0DC2EDC1954D078C4D5B7017F08D627191A5F92C 1.guajilla
143,593,409 *0DCFDA48F5A99BF95CAA59C4E6C98E3C17F49F53 YONGYEEJ
143,593,410 *0DC8CB1C1E737229761D2D2F7237BC11A0AFB8EC 1jが緊急発進し、現場上空からの映像を上級司令部である
143,593,411 *0DC0CDF20F9666E260C26A5963393D91EC122108 [email protected]
143,593,412 *0DC7731B9A6843D3CB219E365AF21B5A3F8E8117 YUDIE BRANDAL
143,593,413 *0DCBF5B999BC1A550F08499E72E81DA097588435 [email protected]
143,593,414 *0DC92F28636664BF557956BFD9DFF22D694CF576 1-MERKITYKSELLISYYDELL
143,593,415 *0DC22B87C98A4AF208C23EAD0ECA19B4040E9048 1 MOELLERING
143,593,416 *0DC37058C477880647A2EA3244111DC832550D0F 1.mscibarometer
143,593,417 *0DC889E0CDD81122FD04380F4929E940BD03EC00 1.museums-projekt
143,593,418 *0DC2B716982A4DF90D76ADBE136BB36198AF6250 Z154409
143,593,419 *0DCA5A630EC99B8C86157D5C29A2C83B6836EDCA ZABRZEN7
143,593,420 *0DC0446710AF392695842A619A978181157357F6 1.osc-team
143,593,421 *0DC9200EBA66149A22EC2061E14B0E032911FAA3 1-OUACHITA-BERGEN
143,593,422 *0DC20EAFDA6553840D1E033BC65A6B0114D31D07 zachytim
143,593,423 *0DCF35A43BC6C7D2A0CB0BD329C77D20D91A485D ZACKARYTITCH
143,593,424 *0DC23D77FC57ABE529A64DDA66FE71E2D5FC1CBB 1 polkupy
143,593,425 *0DC1A066481CC7EC84AF08D966D728AA7F6B378C 1PYHINAE
143,593,426 *0DC3C1AEE7E6F338B4F3C300260223A78846FD05 1 RASKAS
143,593,427 *0DCE7F63CC50C5166CB72DC2A5CF44CCC9EA5AC7 1 rysk
143,593,428 *0DCBF4EE77469604E00F18139294237E29411F24 1SDRATSAB
143,593,429 *0DC5366032E9C45298903FC05F0BFEAF7FE77B92 1sloganinda
143,593,430 *0DCA3356DD8C298D70D1876DF8F2465D9508A7E6 1-sonnenenergie-revolution
143,593,431 *0DCC2CEB881F8230ACC8F411DBDD312093DD6C01 1-SUOMEN-RUOTSIN
143,593,432 *0DC1E8BAC62149F29F063BDF5FFA0C54793289FE 1TAMPPING
143,593,433 *0DC9E8A78A09AE6C03047896B890DDFEB91D360B 1.TEHT
143,593,434 *0DC83D3876F09ADE52315892CB60B5E7B1A6383A [email protected]
143,593,435 *0DC2B02F3CEDFDB302C7F88F3967FC770DB3BA8E [email protected]
143,593,436 *0DCB0920583BFC11BF0D3580A442BFCB7FE7399C 1-torgau-where
143,593,437 *0DC26511C41F03FA78F895B0B13D82D65C77D82F 1vapaaajanmatkustajillekin
143,593,438 *0DC8CFEA1B66BBB7812C7ECC55EF8D5682D59E3D 1-varoldugumuz
143,593,439 *0DCB7E5C33B44C4E6FB643C7FEC9065040D1D1B5 ZIWA-LYDIA
143,593,440 *0DCDC458A245B0DBB24ACD32C056DB1E318FB5E2 2006394 OSA.KESKUSTELIJOISTA.KANNATTI.MY
143,593,441 *0DCF260C0468507A48A8CF1DCE623ACEB2B1ECBB ZLUCNIKUS
143,593,442 *0DC2C5073810CC40D0ECC4CE56BD898C4F48449B [email protected]
143,593,443 *0DC615FF22C2F2EBEEB835A88C0D96DB536F3BD1 zong.cha.vang
143,593,444 *0DC3AB55D5AB06513C6BA165149A26CC519D4149 ZORAIDAPANIAGUA
143,593,445 *0DCBD34E0D5913BDFFC8D5136D8963D600FF10EC zoricca.mokhali
143,593,446 *0DC14B4C1D6F4263D2CFDF35278AEC66D7806BBA 210archdiocese
143,593,447 *0DCA1B221F1BCF2A559ED63619398A19F3E90C82 zw4
143,593,448 *0DC5FD568DE839C9D09319AB68C6E94622321D78 «ιδαίοι
143,593,449 *0DC8A4DCCDCF39903A42DFBB60797E849B210734 АТЛЕТИЧНИЯТ
143,593,450 *0DCA9169AD2434C7AA0BAF84B459FBDE33970E55 246582 BOSOLANLOJMANLARINLISTESINIHAZIRLAYANPROGRAMDIR
143,593,451 *0DC7725398675253995A65FB5F146DAC925E59CC 2672301 huhuilta.katkaisee.siivet.parhaiten.luotettava.tiedonv
143,593,452 *0DC4332A29EB7FFFE49E4BF2427D10BEEBCE175E ГУЛЛАМ
143,593,453 *0DC0E0107AE3346B879E2F046799504CD0982F57 269dud
143,593,454 *0DCCB422CB19CF338A5DA8BAE02D2E69D896A868 «ДЕЙСТВУЮЩИЕ
143,593,455 *0DCDD10D254E769F566A2FC0473D97C9CA9B77EA ЕССЕКУБО
143,593,456 *0DC81BBF606E40E24E2193D56474B4E6689DA873 285998285x
143,593,457 *0DC9D2C6FE4478644EA3FB4AAF183B9F091D41AB [email protected]
143,593,458 *0DC1046980402A29FBEFCE24EDAD472FB81E0908 КАРАЛЕНАЙ
143,593,459 *0DC6DBFB03944472C8DA03FD0067F117F430927C ЛЕҐАТИ
143,593,460 *0DCF80979979710D8A6D9BE15D2D46C7D6928102 МАЛАШКОВИЦЯ
143,593,461 *0DC307EE459ACE2345DEA84AD0B4EEBF0C837821 [email protected]
143,593,462 *0DC8DDDFCB178E81FA34E62B9B0AF3DA2B57A0D1 ОХОХОНЮШКИ
143,593,463 *0DCB720F062D16CB75A1F904738BBC4D7C0186DC 2eigenheimgebiet
143,593,464 *0DCD8960145FD9B56D2D2625D2D53C86DE954904 ПРИЧИТАНО
143,593,465 *0DC9DDE41639DE81B4A98886548552AEACDDC889 2fwhiskers
143,593,466 *0DC5701E98F724D0073BE29DD5641763AE42BD09 СИМА
143,593,467 *0DC7B8F2ECA1DCF6E24460F8C2A80DEDF8EE7222 СОЉАЦИЋ
143,593,468 *0DC324EDF33BFB15A748E9F13D601745F3FDC25A те́рен
143,593,469 *0DC3A17D13285B54DC44A0F06AA81F83D803E4CA 2.HEKEMAAN
143,593,470 *0DC2455D6A942B92506EA3BE0DEA2F0185145465 2ILANLARIMIZI
143,593,471 *0DC3BAB5D256A0F232E403FB0F04700ACEE01A6F 2JAKES
143,593,472 *0DCC8C286E73410468A6D4CF802EE3F5D63B9CDD 2JIROCHAS
143,593,473 *0DC1D2EC29517D2B9B4E76AB267EE1961139F59D 2koslow's
143,593,474 *0DC416F6A521639C340431F3F2960EB5B8008E8F «ТУПЫМИ
143,593,475 *0DC0F4BA4BFE0DE5C09E3600C01078A555E1E888 2MACLERRAN
143,593,476 *0DCDD82A2F623C657DB90CBAA86B90397CCAF528 ЧУРОЙ
143,593,477 *0DC0845A8EDEB695F92350AE6542BBF23A2E9D5A 2njplclcnw
143,593,478 *0DC41E29C9EB632C60369E5A04D84ABA548EC86E 2.taa-mitglieder
143,593,479 *0DCA51588B780BBE95D6E0775A03143733777184 2themine2
143,593,480 *0DC95768E4D2F0D55E47CA7C2F0E523ABB6362CF 2voitonn
143,593,481 *0DC114C2D94D6929F7FE30F03DB438E27264622B 3-03-1915
143,593,482 *0DCDA19B01024244FAA435C08B43D4CEF0D26F7C 3B<- ~` ~`D######P
143,593,483 *0DC7F94AF1F698EC118D9C3F50A84A8F74A64A86 3.lepp
143,593,484 *0DC5C70151CD7A993EB76ED101D2109D5C15587E 3LTAAA
143,593,485 *0DC91169A750D0243A4F724668349EA3093FA7D1 3MYMICKEY8
143,593,486 *0DC9AF4DCE29A8707FB002AA3A9E9F17D8CDC02D 3######p-`~-`~)0(
143,593,487 *0DCD395EAD9494A5FAC6E33489CB464ADF5421D7 3とpv
143,593,488 *0DC1522FD048E0AD71DE204486A184AA94CF2F7E 3SPYROS
143,593,489 *0DCE114FBE8A69D422860BA3AC5BF13E04867172 3 syvill
143,593,490 *0DCB31F4F86595704403A826EE640041EF2C8C1E 3THATFARSIDE0
143,593,491 *0DC5F14A7F83B3B7221766F237FCFD4F36B52E98 428DRAVEN
143,593,492 *0DC0FDE45409F38CA7DE26E7219CA4A98D2C12CB 徳満駅(JR北海道旭川支社)
143,593,493 *0DC94B414D23204F065580B1271284B89DFBB943 4ALEYSSA
143,593,494 *0DCBD478B4F822BDFE0A7D82798F19BA00FA2F49 4-dunkelrotes
143,593,495 *0DC3415C2C7219481174A205E10300560CD13EFD 4HUNGARIANSOV
143,593,496 *0DC36698DDFCB9D3E4EF2A47A91CA1948EDC8314 4IZJAVNE
143,593,497 *0DC74C274BD79AC85CAC9F38C8FC25DDC1D9EFB2 4JIRIFKINBSW
143,593,498 *0DCDAAB86AB2EE3BB0516E4BDF3B686B1358B4AA 4MEALLADH
143,593,499 *0DC0DA8ADD7724D5B0FCE07EDFEBDAB12211B3A2 4METAMEXBSW
143,593,500 *0DC8829470B39BB47911497706C38593BA4AF0A6 4NEGNILEKKIWTNO
143,593,501 *0DC371D8183836414CE6FD66AB124C082402844A 4OILTHICKENIN
143,593,502 *0DC10DFE80C2E7D37B566EF7B34CA6CA8B9E364E 4PERIHELIAL
143,593,503 *0DC3B2A16D47CFCC2E6F5F3EC8DAB1F51101DBD2 4RIULFNOC
143,593,504 *0DCBB183C9210D0A8A5C62C3EF26B5A3701A5606 5AAVISTAA
143,593,505 *0DCD95EA591705F2290470F7860E1ABC178BA54C 5BNCVGC
143,593,506 *0DCADCEEE10D5ECCD39778E637A4D5F44633A84B 5CAMPINGBOOBOO
143,593,507 *0DC75C8BC2B0EF6FE1504FA1EE026089FE4070E5 除了《THE
143,593,508 *0DC736A1D4834908F2B2BB782452EC16BCFAD31D 5LAYLABEN
143,593,509 *0DCFAC05B15AD5D229E926A029F04EEE67FBC900 5onbedachtzaamheid
143,593,510 *0DC17F38AB9179CB2ECF58D9C7AD5FB76F5665C9 5P3CLTV3
143,593,511 *0DCCBF2859AF656578998F62984F28E1501B26C2 07151960
143,593,512 *0DC2EB3EB9B98C1E496340702C1158B93655F080 0glbaa
143,593,513 *0DC5DDD45072E765FA8FADE3DF1F3DAD78F25705 (>_0)O~ Q------P
143,593,514 *0DCC4B987A5E535075BCA1DD16E683A433E22D8F 5PIOSENKE
143,593,515 *0DCAFF78B5AF9FD5FBD043F583B47DCFE3E5F46A 5SECERNERINGTH
143,593,516 *0DC61CFC71A67FAA7EA7DDE8D751A44BD1A937E4 5SOROSPHERES
143,593,517 *0DC986F5DD16DC90DDC781DFD61F8CFE22D710A0 5VEZENIMI
143,593,518 *0DC5287D105D0515FBD9890DAF3828BCA1D7AF4F 1332617 HIEKKA.TUPRUSI.PY
143,593,519 *0DC7F6B0600A071AC2A1BB5BF5954FD29C414CDF 1460110 diese-schoenheit-allerdings-gehoert-unterhalten-.
143,593,520 *0DCCD7A03501A0208FA21541A80F43A9FF30C5FB 613494 HE-WAS-EASILY-HURT-,-"-THE-KGB-CHIEF-SAID-
143,593,521 *0DCC9CB70B0A2473F15F5E309DC5B68469C514B9 1698109 puuttumalla-aikaisessa-vaiheessa-ongelmiin-p
143,593,522 *0DCE9D71AF14445A78B29C8E72D4611F4D6FAD61 1741049 DAMIT IST DER BAUMWOLL BALDACHIN ZU EMPFEHLEN
143,593,523 *0DC84CC80E8D168580BA31F991B68E66DD03BE1B 697865 MAAKUNTAKAAVAPROJEKTINTILANNEKATSAUSHELENATER
143,593,524 *0DC458A63611D5A495D2E9781DAE5AF63013A746 6ANTISEMITOM
143,593,525 *0DC194EC91F5E9FB2B5A311EA82194E9CA7626AA 6ARTERIERNES
143,593,526 *0DC54A44737269D95DED51C2D25A3C3E1B7A1378 1ALUMINIUMBEREICHS
143,593,527 *0DC0F7D71ADB7344FB52F15232A1DC54FCEF6B99 1 ANLEIHENPROGRAMMS
143,593,528 *0DCBAE8030AA9D23D2EB4DE57EC3DC9CE01D4FFF 1-automatisoinut
143,593,529 *0DCA13EA385D0C6141A6950C99857ABA00F8C605 1-BECHTEL'LE
143,593,530 *0DCF0B8F0B4396AFFFF38FAD40642878E80DE0D5 1bergabenteuer
143,593,531 *0DCA8B433DE673715FA8969D83546D60C07630EC 6DNEWUEEG
143,593,532 *0DC8AD3CF0B3845564E9506911F14358216C3273 1.callhome
143,593,533 *0DC72ACABB9F7D991E611B7184469F65D6FCE13B 6ERIOTAVRESNOC
143,593,534 *0DC10BA86F0FF466A997DEC9B0BF9F79D8F59DE5 1DERAERDN
143,593,535 *0DCCF376896FDAD3C04CF3E67FA7DFBE50F97C35 6KINGUUS
143,593,536 *0DCBFA062950AE569E5D1E1271B7157A6029D665 1EBWEGOUVERNEURSRATS
143,593,537 *0DC2C5861039DAC4D7CD1A41851C64BBE932B59F 1eliberndt
143,593,538 *0DC63A00916E2ED13E1D6E838E0C492895B012A6 1entropy4
143,593,539 *0DCE1337F3AC78DD896A434ECCC0F8362B8A7FCF 1.ER
143,593,540 *0DC4A9F5A4F78C68EB413B9728FF94129B137769 1ERKLNILE
143,593,541 *0DC1FD7F0A33A565D60E1D1AD23E08901B7F8A3E 1.guajilla
143,593,542 *0DCFDA48F5A99BF95CAA59C4E6C98E3C17F49F53 6MIDESKURV
143,593,543 *0DC0A71C7C42E979C9C8B58DB38FA82BAF886D94 1jが緊急発進し、現場上空からの映像を上級司令部である
143,593,544 *0DC0CDF20F9666E260C26A5963393D91EC122108 6PROMETHETECH
143,593,545 *0DC3979DAEF52296E9DE4954E3DFCEFEA6467A8C 6RELICTENS
143,593,546 *0DCE9BC62F72C2E78694915217401CA020B541DD 6RUNDSAVENES
143,593,547 *0DCC77DBD559025746657F03B0E1445C41114DC7 1-MERKITYKSELLISYYDELL
143,593,548 *0DC22B87C98A4AF208C23EAD0ECA19B4040E9048 1 MOELLERING
143,593,549 *0DC37058C477880647A2EA3244111DC832550D0F 1.mscibarometer
143,593,550 *0DC889E0CDD81122FD04380F4929E940BD03EC00 1.museums-projekt
143,593,551 *0DC2B716982A4DF90D76ADBE136BB36198AF6250 1.osc-team
143,593,552 *0DC9200EBA66149A22EC2061E14B0E032911FAA3 1-OUACHITA-BERGEN
143,593,553 *0DC20EAFDA6553840D1E033BC65A6B0114D31D07 1 polkupy
143,593,554 *0DC1A066481CC7EC84AF08D966D728AA7F6B378C 1PYHINAE
143,593,555 *0DC3C1AEE7E6F338B4F3C300260223A78846FD05 1 RASKAS
143,593,556 *0DCE7F63CC50C5166CB72DC2A5CF44CCC9EA5AC7 6WQSBSPAIN
143,593,557 *0DCDDA3A4DE2E4F1025D3A16764F839F13F87C01 1 rysk
143,593,558 *0DCBF4EE77469604E00F18139294237E29411F24 1SDRATSAB
143,593,559 *0DC5366032E9C45298903FC05F0BFEAF7FE77B92 72F9B8
143,593,560 *0DC287A52E0360E867D02C075D59C7ADDBC13F5A 732738 COL-.-OLIVER-NORTH-,-WHO-OVERSAW-THE-IRANIAN-ARMS-SALES-.
143,593,561 *0DC1F0C910CE0BB7FEF5E09F740D245B843C2A06 1sloganinda
143,593,562 *0DCA3356DD8C298D70D1876DF8F2465D9508A7E6 1-sonnenenergie-revolution
143,593,563 *0DCC2CEB881F8230ACC8F411DBDD312093DD6C01 1-SUOMEN-RUOTSIN
143,593,564 *0DC1E8BAC62149F29F063BDF5FFA0C54793289FE 1TAMPPING
143,593,565 *0DC9E8A78A09AE6C03047896B890DDFEB91D360B 1.TEHT
143,593,566 *0DC83D3876F09ADE52315892CB60B5E7B1A6383A 7APUPOJAN
143,593,567 *0DC02D1328F0717C83BA7B06612A054BB721E37E 7BSWABEECHBSW
143,593,568 *0DCBA09B658EABAB7CB97BF19AA70E68D7F7C838 7BSWHOKUSANBSW
143,593,569 *0DCAB0557DBB6C7586CF4F1A4354EEC2F1039F4C 7BSWNEDDIRBSW
143,593,570 *0DC3395761CA87F90178D647399769F6086403DD 1-torgau-where
143,593,571 *0DC26511C41F03FA78F895B0B13D82D65C77D82F 7CLAIREDUSTIN
143,593,572 *0DC0D9D813A931C489ACF51A51567D7CD64971BF 1vapaaajanmatkustajillekin
143,593,573 *0DC8CFEA1B66BBB7812C7ECC55EF8D5682D59E3D 7DEFENSIESYSTEMENS
143,593,574 *0DCC41836CD1523900B6F23ADB6EAC95D4618C3B 1-varoldugumuz
143,593,575 *0DCB7E5C33B44C4E6FB643C7FEC9065040D1D1B5 2006394 OSA.KESKUSTELIJOISTA.KANNATTI.MY
143,593,576 *0DCF260C0468507A48A8CF1DCE623ACEB2B1ECBB 210archdiocese
143,593,577 *0DCA1B221F1BCF2A559ED63619398A19F3E90C82 7FORDXSAL
143,593,578 *0DCCC91647E63E99986B9AD726718813DB0CF041 7GETALEERDE
143,593,579 *0DCA6C4F5F83C2D731E180A780279930076D8D60 246582 BOSOLANLOJMANLARINLISTESINIHAZIRLAYANPROGRAMDIR
143,593,580 *0DC7725398675253995A65FB5F146DAC925E59CC 2672301 huhuilta.katkaisee.siivet.parhaiten.luotettava.tiedonv
143,593,581 *0DC4332A29EB7FFFE49E4BF2427D10BEEBCE175E 269dud
143,593,582 *0DCCB422CB19CF338A5DA8BAE02D2E69D896A868 7MOOTMANS
143,593,583 *0DC9C437DA6F904A5960E63CDDACD7F2068D6256 285998285x
143,593,584 *0DC9D2C6FE4478644EA3FB4AAF183B9F091D41AB [email protected]
143,593,585 *0DC1046980402A29FBEFCE24EDAD472FB81E0908 [email protected]
143,593,586 *0DC8DDDFCB178E81FA34E62B9B0AF3DA2B57A0D1 2eigenheimgebiet
143,593,587 *0DCD8960145FD9B56D2D2625D2D53C86DE954904 7THERMOGRAPHICAL
143,593,588 *0DC6D369A52FE2E2B794C58614B9F2CBBD9A9565 2fwhiskers
143,593,589 *0DC5701E98F724D0073BE29DD5641763AE42BD09 2.HEKEMAAN
143,593,590 *0DC2455D6A942B92506EA3BE0DEA2F0185145465 7trammell
143,593,591 *0DC53716AA80B5DA0CD6FBFE8682A9441825F72B 2ILANLARIMIZI
143,593,592 *0DC3BAB5D256A0F232E403FB0F04700ACEE01A6F 2JAKES
143,593,593 *0DCC8C286E73410468A6D4CF802EE3F5D63B9CDD 2JIROCHAS
143,593,594 *0DC1D2EC29517D2B9B4E76AB267EE1961139F59D 2koslow's
143,593,595 *0DC416F6A521639C340431F3F2960EB5B8008E8F 2MACLERRAN
143,593,596 *0DCDD82A2F623C657DB90CBAA86B90397CCAF528 2njplclcnw
143,593,597 *0DC41E29C9EB632C60369E5A04D84ABA548EC86E 2.taa-mitglieder
143,593,598 *0DCA51588B780BBE95D6E0775A03143733777184 87E94336
143,593,599 *0DCDFE32A5C65A5ACFBBFCE0D9AEC687E6487E62 899JADIEL
143,593,600 *0DC5C7E88451AA73FD8B5E7A3A69888278907FC1 2themine2
143,593,601 *0DC95768E4D2F0D55E47CA7C2F0E523ABB6362CF 2voitonn
143,593,602 *0DC114C2D94D6929F7FE30F03DB438E27264622B 8===b`~splat
143,593,603 *0DC47E04C5172443197162CD33A6D8D913298C5A 3-03-1915
143,593,604 *0DCDA19B01024244FAA435C08B43D4CEF0D26F7C 8DEGREVA
143,593,605 *0DC56543793AC89330F911B3F31D1B6FFFB1DEC3 3B<- ~` ~`D######P
143,593,606 *0DC7F94AF1F698EC118D9C3F50A84A8F74A64A86 3.lepp
143,593,607 *0DC5C70151CD7A993EB76ED101D2109D5C15587E 3LTAAA
143,593,608 *0DC91169A750D0243A4F724668349EA3093FA7D1 3MYMICKEY8
143,593,609 *0DC9AF4DCE29A8707FB002AA3A9E9F17D8CDC02D 3######p-`~-`~)0(
143,593,610 *0DCD395EAD9494A5FAC6E33489CB464ADF5421D7 8ISUOSUUY
143,593,611 *0DC3B33CC438CD9EAA32E09AE8C394109049C99F 3とpv
143,593,612 *0DC1522FD048E0AD71DE204486A184AA94CF2F7E 3SPYROS
143,593,613 *0DCE114FBE8A69D422860BA3AC5BF13E04867172 3 syvill
143,593,614 *0DCB31F4F86595704403A826EE640041EF2C8C1E 8MADDOCKTOPHER
143,593,615 *0DCB2629278CBF3A99F33EC587295C57E8C98B76 3THATFARSIDE0
143,593,616 *0DC5F14A7F83B3B7221766F237FCFD4F36B52E98 428DRAVEN
143,593,617 *0DC0FDE45409F38CA7DE26E7219CA4A98D2C12CB 8######P.~0.~O>B0
143,593,618 *0DC169999CF81890619964F35FA8F9B077D1AC08 8##P~0~O:P
143,593,619 *0DCC4A266AF8B627600446A796987617B720FB8E 8ra.'b^s
143,593,620 *0DC3011322132CE0D6A6EF11DC65F7A7100D489F 4ALEYSSA
143,593,621 *0DCBD478B4F822BDFE0A7D82798F19BA00FA2F49 8REFORMOIDUN
143,593,622 *0DCA204FD1595B864C9707EDDD916B04F3114708 8REGESOFFEN
143,593,623 *0DC661728255A35E6EE1D6929E4F5B76C0D84E59 4-dunkelrotes
143,593,624 *0DC3415C2C7219481174A205E10300560CD13EFD 4HUNGARIANSOV
143,593,625 *0DC36698DDFCB9D3E4EF2A47A91CA1948EDC8314 4IZJAVNE
143,593,626 *0DC74C274BD79AC85CAC9F38C8FC25DDC1D9EFB2 4JIRIFKINBSW
143,593,627 *0DCDAAB86AB2EE3BB0516E4BDF3B686B1358B4AA 8symphyantherous
143,593,628 *0DCA92A0020F78F7AE4C10D98586B6D902DE3E99 8TAERKEISSAE
143,593,629 *0DC2E03825BF313312A8F31F065DCFBE45499CD3 4MEALLADH
143,593,630 *0DC0DA8ADD7724D5B0FCE07EDFEBDAB12211B3A2 8==>.~.~UU
143,593,631 *0DC5C5F45845673CFDAA705D50A0B0E5F2B67D8F 4METAMEXBSW
143,593,632 *0DC8829470B39BB47911497706C38593BA4AF0A6 4NEGNILEKKIWTNO
143,593,633 *0DC371D8183836414CE6FD66AB124C082402844A 4OILTHICKENIN
143,593,634 *0DC10DFE80C2E7D37B566EF7B34CA6CA8B9E364E 4PERIHELIAL
143,593,635 *0DC3B2A16D47CFCC2E6F5F3EC8DAB1F51101DBD2 4RIULFNOC
143,593,636 *0DCBB183C9210D0A8A5C62C3EF26B5A3701A5606 955527 mavi.acilari.cekeriz.hayatimiz.boyunca..
143,593,637 *0DC6E4AFEB3379E55CAEAA12B5285022295733BB 5AAVISTAA
143,593,638 *0DCD95EA591705F2290470F7860E1ABC178BA54C 5BNCVGC
143,593,639 *0DCADCEEE10D5ECCD39778E637A4D5F44633A84B 9CHEMUSHBSW
143,593,640 *0DC2F773FAF32E58B34E1C95B99A65B449CE8D35 5CAMPINGBOOBOO
143,593,641 *0DC75C8BC2B0EF6FE1504FA1EE026089FE4070E5 9FYSIOKRATIET
143,593,642 *0DCFE1402891AF05A83A6A6B39C9B400D59C6287 9GIVETHESLIP
143,593,643 *0DC1BE1F064189DD0FDEE1BE0B4A1C10971F340B 5LAYLABEN
143,593,644 *0DCFAC05B15AD5D229E926A029F04EEE67FBC900 5onbedachtzaamheid
143,593,645 *0DC17F38AB9179CB2ECF58D9C7AD5FB76F5665C9 5P3CLTV3
143,593,646 *0DCCBF2859AF656578998F62984F28E1501B26C2 5PIOSENKE
143,593,647 *0DCAFF78B5AF9FD5FBD043F583B47DCFE3E5F46A 9SALTURTENE
143,593,648 *0DC6886E52BDCB5B3BEFFB2F2CD8F6DC10B5AA6D 9SCHRAALTJESES
143,593,649 *0DC5478F042AF238C7EA41A204DD42908D659CEB 9SURREELLES
143,593,650 *0DCDFABDB06A5CB697F79E134833F970A1717B97 5SECERNERINGTH
143,593,651 *0DC61CFC71A67FAA7EA7DDE8D751A44BD1A937E4 5SOROSPHERES
143,593,652 *0DC986F5DD16DC90DDC781DFD61F8CFE22D710A0 5VEZENIMI
143,593,653 *0DC5287D105D0515FBD9890DAF3828BCA1D7AF4F 9.VIINILISTA
143,593,654 *0DCB202BF9D1A60EAA98C739A0263EA9FF4CB019 613494 HE-WAS-EASILY-HURT-,-"-THE-KGB-CHIEF-SAID-
143,593,655 *0DCC9CB70B0A2473F15F5E309DC5B68469C514B9 A0.A
143,593,656 *0DC7EA308ECCB665C8FEAD4465EC964E54C383A6 697865 MAAKUNTAKAAVAPROJEKTINTILANNEKATSAUSHELENATER
143,593,657 *0DC458A63611D5A495D2E9781DAE5AF63013A746 6ANTISEMITOM
143,593,658 *0DC194EC91F5E9FB2B5A311EA82194E9CA7626AA 6ARTERIERNES
143,593,659 *0DC54A44737269D95DED51C2D25A3C3E1B7A1378 6DNEWUEEG
143,593,660 *0DC8AD3CF0B3845564E9506911F14358216C3273 6ERIOTAVRESNOC
143,593,661 *0DC10BA86F0FF466A997DEC9B0BF9F79D8F59DE5 A+6R!
143,593,662 *0DC79A0A0F9D2ECB5B9306089D2C11D2E28B16CE 6KINGUUS
143,593,663 *0DCBFA062950AE569E5D1E1271B7157A6029D665 6MIDESKURV
143,593,664 *0DC0A71C7C42E979C9C8B58DB38FA82BAF886D94 a8maf
143,593,665 *0DC8346F8EA2A736EFFC06253F12322143618BA5 A90v
143,593,666 *0DCB7B7C2E98A80565F3307C3715DF815BEEE1F1 6PROMETHETECH
143,593,667 *0DC3979DAEF52296E9DE4954E3DFCEFEA6467A8C a9yv"
143,593,668 *0DC756BA84ADD6494A6384723813E20209A9B7E7 aa/_$
143,593,669 *0DC48130AE8420B0DFDC377E65AD7348939CB5E4 6RELICTENS
143,593,670 *0DCE9BC62F72C2E78694915217401CA020B541DD 6RUNDSAVENES
143,593,671 *0DCC77DBD559025746657F03B0E1445C41114DC7 AAAS*_
143,593,672 *0DC1863A8C4E5F45866476C668698519CDE694FD aaasu^
143,593,673 *0DC7B1CE3B8E213DC48DCDD5179B9CD21337EC6E 6WQSBSPAIN
143,593,674 *0DCDDA3A4DE2E4F1025D3A16764F839F13F87C01 72F9B8
143,593,675 *0DC287A52E0360E867D02C075D59C7ADDBC13F5A 732738 COL-.-OLIVER-NORTH-,-WHO-OVERSAW-THE-IRANIAN-ARMS-SALES-.
143,593,676 *0DC1F0C910CE0BB7FEF5E09F740D245B843C2A06 7APUPOJAN
143,593,677 *0DC02D1328F0717C83BA7B06612A054BB721E37E 7BSWABEECHBSW
143,593,678 *0DCBA09B658EABAB7CB97BF19AA70E68D7F7C838 7BSWHOKUSANBSW
143,593,679 *0DCAB0557DBB6C7586CF4F1A4354EEC2F1039F4C 7BSWNEDDIRBSW
143,593,680 *0DC3395761CA87F90178D647399769F6086403DD 7CLAIREDUSTIN
143,593,681 *0DC0D9D813A931C489ACF51A51567D7CD64971BF 7DEFENSIESYSTEMENS
143,593,682 *0DCC41836CD1523900B6F23ADB6EAC95D4618C3B 7FORDXSAL
143,593,683 *0DCCC91647E63E99986B9AD726718813DB0CF041 7GETALEERDE
143,593,684 *0DCA6C4F5F83C2D731E180A780279930076D8D60 aab+ia
143,593,685 *0DC838FFC8116B6CE89D7BEB091EA5B16D329D90 7MOOTMANS
143,593,686 *0DC9C437DA6F904A5960E63CDDACD7F2068D6256 AACHAARYAAMHED
143,593,687 *0DCAEE39E7CD4081F2B6EA78FC1610E05FDFC130 7THERMOGRAPHICAL
143,593,688 *0DC6D369A52FE2E2B794C58614B9F2CBBD9A9565 7trammell
143,593,689 *0DC53716AA80B5DA0CD6FBFE8682A9441825F72B AAED/I
143,593,690 *0DC182A774CCC6A4D5EB23349638FCD0CD3770B6 aafhQ
143,593,691 *0DC2D67BE8E211CDA98CF086803120A2417F0ED5 AANZWOEGT
143,593,692 *0DCD8A4A590A1CCE9BC6406409F553BB2159EDCB 87E94336
143,593,693 *0DCDFE32A5C65A5ACFBBFCE0D9AEC687E6487E62 899JADIEL
143,593,694 *0DC5C7E88451AA73FD8B5E7A3A69888278907FC1 8===b`~splat
143,593,695 *0DC47E04C5172443197162CD33A6D8D913298C5A 8DEGREVA
143,593,696 *0DC56543793AC89330F911B3F31D1B6FFFB1DEC3 [email protected]
143,593,697 *0DC2FBD25157C8A93365E0A0A88ACEB77A4EE83A 8ISUOSUUY
143,593,698 *0DC3B33CC438CD9EAA32E09AE8C394109049C99F AB8FL
143,593,699 *0DC39993CFA64049C500E070A1B2BF4F60AC0345 ABBIEHIEB
143,593,700 *0DC38969F85D0A5225C2D6B48AFF28815B460F2A 8MADDOCKTOPHER
143,593,701 *0DCB2629278CBF3A99F33EC587295C57E8C98B76 abd`l
143,593,702 *0DC0FEF03DAFCD3A5775349BE24702EA4A3AF935 abelcifuentes
143,593,703 *0DC0A6CBD4AF31259DAA17B861A4E4E59C13049E ABELTERSIGNI
143,593,704 *0DC4C2360864E7A33ED75D3D3CF87CE5AF886132 ABEPASKOW
143,593,705 *0DC4A92853B23F286DFF0474BD3F5800BAA11670 abergavennymuseum
143,593,706 *0DC973031B9535C3925DB3F08C3A291D82C52EF3 abigail.crook
143,593,707 *0DC46EEF618B312B7F87BDCB9477E30C25DC1283 8######P.~0.~O>B0
143,593,708 *0DC169999CF81890619964F35FA8F9B077D1AC08 8##P~0~O:P
143,593,709 *0DCC4A266AF8B627600446A796987617B720FB8E 8ra.'b^s
143,593,710 *0DC3011322132CE0D6A6EF11DC65F7A7100D489F 8REFORMOIDUN
143,593,711 *0DCA204FD1595B864C9707EDDD916B04F3114708 8REGESOFFEN
143,593,712 *0DC661728255A35E6EE1D6929E4F5B76C0D84E59 8symphyantherous
143,593,713 *0DCA92A0020F78F7AE4C10D98586B6D902DE3E99 8TAERKEISSAE
143,593,714 *0DC2E03825BF313312A8F31F065DCFBE45499CD3 8==>.~.~UU
143,593,715 *0DC5C5F45845673CFDAA705D50A0B0E5F2B67D8F 955527 mavi.acilari.cekeriz.hayatimiz.boyunca..
143,593,716 *0DC6E4AFEB3379E55CAEAA12B5285022295733BB 9CHEMUSHBSW
143,593,717 *0DC2F773FAF32E58B34E1C95B99A65B449CE8D35 9FYSIOKRATIET
143,593,718 *0DCFE1402891AF05A83A6A6B39C9B400D59C6287 9GIVETHESLIP
143,593,719 *0DC1BE1F064189DD0FDEE1BE0B4A1C10971F340B 9SALTURTENE
143,593,720 *0DC6886E52BDCB5B3BEFFB2F2CD8F6DC10B5AA6D 9SCHRAALTJESES
143,593,721 *0DC5478F042AF238C7EA41A204DD42908D659CEB ABRAHAMSTOUTAMIRE
143,593,722 *0DCE9F0D979CA30371A056768E23031F2848CA39 abrahamvartanyan
143,593,723 *0DC3552AA7F3357AFD4A2C6F919C2F18A7B4875A ABSOLUTBLAZER2
143,593,724 *0DC02A66E0C705F91A88E3450F62AC3D0375312F 9SURREELLES
143,593,725 *0DCDFABDB06A5CB697F79E134833F970A1717B97 9.VIINILISTA
143,593,726 *0DCB202BF9D1A60EAA98C739A0263EA9FF4CB019 AC*CC
143,593,727 *0DC34A798751DB07AB7C508AB82AEF0B0D43D389 ACCOMPLI
143,593,728 *0DC6BA8A034A4C283FF32334A3840197244244BB A0.A
143,593,729 *0DC7EA308ECCB665C8FEAD4465EC964E54C383A6 A+6R!
143,593,730 *0DC79A0A0F9D2ECB5B9306089D2C11D2E28B16CE a8maf
143,593,731 *0DC8346F8EA2A736EFFC06253F12322143618BA5 A90v
143,593,732 *0DCB7B7C2E98A80565F3307C3715DF815BEEE1F1 a9yv"
143,593,733 *0DC756BA84ADD6494A6384723813E20209A9B7E7 aa/_$
143,593,734 *0DC48130AE8420B0DFDC377E65AD7348939CB5E4 AAAS*_
143,593,735 *0DC1863A8C4E5F45866476C668698519CDE694FD aaasu^
143,593,736 *0DC7B1CE3B8E213DC48DCDD5179B9CD21337EC6E aab+ia
143,593,737 *0DC838FFC8116B6CE89D7BEB091EA5B16D329D90 AACHAARYAAMHED
143,593,738 *0DCAEE39E7CD4081F2B6EA78FC1610E05FDFC130 AAED/I
143,593,739 *0DC182A774CCC6A4D5EB23349638FCD0CD3770B6 aafhQ
143,593,740 *0DC2D67BE8E211CDA98CF086803120A2417F0ED5 ACJ=I
143,593,741 *0DCE20EAB11BDEDD49D652FA1D84EA1E82A42D76 AANZWOEGT
143,593,742 *0DCD8A4A590A1CCE9BC6406409F553BB2159EDCB [email protected]
143,593,743 *0DC2FBD25157C8A93365E0A0A88ACEB77A4EE83A AB8FL
143,593,744 *0DC39993CFA64049C500E070A1B2BF4F60AC0345 ABBIEHIEB
143,593,745 *0DC38969F85D0A5225C2D6B48AFF28815B460F2A abd`l
143,593,746 *0DC0FEF03DAFCD3A5775349BE24702EA4A3AF935 abelcifuentes
143,593,747 *0DC0A6CBD4AF31259DAA17B861A4E4E59C13049E ABELTERSIGNI
143,593,748 *0DC4C2360864E7A33ED75D3D3CF87CE5AF886132 ABEPASKOW
143,593,749 *0DC4A92853B23F286DFF0474BD3F5800BAA11670 abergavennymuseum
143,593,750 *0DC973031B9535C3925DB3F08C3A291D82C52EF3 abigail.crook
143,593,751 *0DC46EEF618B312B7F87BDCB9477E30C25DC1283 ad!w&
143,593,752 *0DCAE4A06E8190316DF7733DE7A02F8D45186C3E ABRAHAMSTOUTAMIRE
143,593,753 *0DCE9F0D979CA30371A056768E23031F2848CA39 abrahamvartanyan
143,593,754 *0DC3552AA7F3357AFD4A2C6F919C2F18A7B4875A aebt!
143,593,755 *0DC8C58092920F70B2B17FAF6F1AB007F9671253 ABSOLUTBLAZER2
143,593,756 *0DC02A66E0C705F91A88E3450F62AC3D0375312F AC*CC
143,593,757 *0DC34A798751DB07AB7C508AB82AEF0B0D43D389 ACCOMPLI
143,593,758 *0DC6BA8A034A4C283FF32334A3840197244244BB AFGASNING6
143,593,759 *0DC5E45D7DF1659C205364318768DC003C4A0E7A A.FISHING.TALE
143,593,760 *0DC29922831DC2E4D630DB54F10F9A080FC3D72F afkrabbers0
143,593,761 *0DC52C16415CB4062B209CF7AF8584C8C9C660F5 AFPAKKEN
143,593,762 *0DC59F398F1F531EDBD0FCD03292EF292369BAB6 ACJ=I
143,593,763 *0DCE20EAB11BDEDD49D652FA1D84EA1E82A42D76 AGB3X
143,593,764 *0DCFE78C67CB487E9A89CDE26F5A11A50EA3F353 agiokonto8
143,593,765 *0DC2BB7D8685050403957E8025485E3615E3D9B3 [email protected]
143,593,766 *0DC7C36AA6EBE033D6520FD18384F1C773AD07DB ag#no
143,593,767 *0DC649203A25B10C201C3DB470F60494D7883423 agskraft4
143,593,768 *0DCC5819A1F9638D5E66803C5236F9728164A88C agyx
143,593,769 *0DCE0728471BF32A66520D6B41445B3C497808CE AH7;V
143,593,770 *0DC76306E3B4F5333E8FD4229B4C1F0DF068EF9E ad!w&
143,593,771 *0DCAE4A06E8190316DF7733DE7A02F8D45186C3E AI(:!
143,593,772 *0DCA605DC3C8369942CB87B7359B31231D4C69E0 aicitcring
143,593,773 *0DCBEAAFEC1F6F36AD71E475247D40959509D184 aebt!
143,593,774 *0DC8C58092920F70B2B17FAF6F1AB007F9671253 A_J)9
143,593,775 *0DCD0A09666D75025A5091B8339A676A1CADC1A6 AFGASNING6
143,593,776 *0DC5E45D7DF1659C205364318768DC003C4A0E7A A.FISHING.TALE
143,593,777 *0DC29922831DC2E4D630DB54F10F9A080FC3D72F afkrabbers0
143,593,778 *0DC52C16415CB4062B209CF7AF8584C8C9C660F5 AFPAKKEN
143,593,779 *0DC59F398F1F531EDBD0FCD03292EF292369BAB6 AGB3X
143,593,780 *0DCFE78C67CB487E9A89CDE26F5A11A50EA3F353 agiokonto8
143,593,781 *0DC2BB7D8685050403957E8025485E3615E3D9B3 [email protected]
143,593,782 *0DC7C36AA6EBE033D6520FD18384F1C773AD07DB ag#no
143,593,783 *0DC649203A25B10C201C3DB470F60494D7883423 agskraft4
143,593,784 *0DCC5819A1F9638D5E66803C5236F9728164A88C AJWT
143,593,785 *0DC0BAE9CCF8C884AEE8B23F7D5C5EA8D31976E6 A?K:
143,593,786 *0DC42C393D6328D50A0AB7B2050EB1B201F78AF4 AK8LY
143,593,787 *0DCD471B0BF4AC1F218237B2D935B1BE88986A18 agyx
143,593,788 *0DCE0728471BF32A66520D6B41445B3C497808CE AH7;V
143,593,789 *0DC76306E3B4F5333E8FD4229B4C1F0DF068EF9E A,KN
143,593,790 *0DC8E92112469AB69B1B9DD30A8D51A86E5C3AC7 AI(:!
143,593,791 *0DCA605DC3C8369942CB87B7359B31231D4C69E0 aicitcring
143,593,792 *0DCBEAAFEC1F6F36AD71E475247D40959509D184 alc4d
143,593,793 *0DC0AAD8E92FC587925E404948BBBFD39D0C0167 aldenporraz
143,593,794 *0DC9B392A6BC2EC7BB23082A410D43CA515AA25E ALEI
143,593,795 *0DCCFA1C08AD878820ACE7256E02C8416F001B4B A_J)9
143,593,796 *0DCD0A09666D75025A5091B8339A676A1CADC1A6 aliahaerunisa
143,593,797 *0DCBEDE1B3A004C736DB2C213F6C6784F26B5FAA AJWT
143,593,798 *0DC0BAE9CCF8C884AEE8B23F7D5C5EA8D31976E6 A?K:
143,593,799 *0DC42C393D6328D50A0AB7B2050EB1B201F78AF4 AK8LY
143,593,800 *0DCD471B0BF4AC1F218237B2D935B1BE88986A18 ALLAN-HOI
143,593,801 *0DC74E8F4B92A84D4D7F1E115B5C3A2CC7191A00 A,KN
143,593,802 *0DC8E92112469AB69B1B9DD30A8D51A86E5C3AC7 alc4d
143,593,803 *0DC0AAD8E92FC587925E404948BBBFD39D0C0167 aldenporraz
143,593,804 *0DC9B392A6BC2EC7BB23082A410D43CA515AA25E ALEI
143,593,805 *0DCCFA1C08AD878820ACE7256E02C8416F001B4B aliahaerunisa
143,593,806 *0DCBEDE1B3A004C736DB2C213F6C6784F26B5FAA ALLAN-HOI
143,593,807 *0DC74E8F4B92A84D4D7F1E115B5C3A2CC7191A00 ALMERZIG
143,593,808 *0DCED4FC79F6DC9F95EF296FF67118929DB5A173 ALMERZIG
143,593,809 *0DCED4FC79F6DC9F95EF296FF67118929DB5A173 alonsotencer
143,593,810 *0DCA2F675DE799B0ED7BDCCD9281CD63F2ABB651 alonsotencer
143,593,811 *0DCA2F675DE799B0ED7BDCCD9281CD63F2ABB651 ALONZO.DOUCE
143,593,812 *0DC6EC429AA7D8079CE2772DF8B2C1680EC5B61C ALONZO.DOUCE
143,593,813 *0DC6EC429AA7D8079CE2772DF8B2C1680EC5B61C [email protected]
143,593,814 *0DCB9B1C6828B65490DE94583DE19CAF0C4921E1 [email protected]
143,593,815 *0DCB9B1C6828B65490DE94583DE19CAF0C4921E1 ALTONSTIPPICH
143,593,816 *0DC80CD0D9FD5D80C223FFC42617F03D77322057 ALTONSTIPPICH
143,593,817 *0DC80CD0D9FD5D80C223FFC42617F03D77322057 amamzing
143,593,818 *0DC56B5DFD90272BA91D2DB4326A4EFAB031CA99 amamzing
143,593,819 *0DC56B5DFD90272BA91D2DB4326A4EFAB031CA99 [email protected]
143,593,820 *0DCAD9B8472D5E32CE8B3A8A4BC6BB94E77867B8 [email protected]
143,593,821 *0DCAD9B8472D5E32CE8B3A8A4BC6BB94E77867B8 AMUU6
143,593,822 *0DC9E5DF5AD7FDC737A03DC0AA14DE049AAE6D4F AMUU6
143,593,823 *0DC9E5DF5AD7FDC737A03DC0AA14DE049AAE6D4F ANDREAS MEISTER
143,593,824 *0DC6D9C04B091E7FF4553D9EE8C7821ED4BC6144 ANDREAS MEISTER
143,593,825 *0DC6D9C04B091E7FF4553D9EE8C7821ED4BC6144 And-Westmoreland-and-Stafford-fled-the-field;
143,593,826 *0DC5C84346847B1B0FC0800068FC44812FDC9D7D And-Westmoreland-and-Stafford-fled-the-field;
143,593,827 *0DC5C84346847B1B0FC0800068FC44812FDC9D7D and.you.have.to.smile.
143,593,828 *0DCDCF4E42D3DB73BB4E5A2518881D758352238D and.you.have.to.smile.
143,593,829 *0DCDCF4E42D3DB73BB4E5A2518881D758352238D ane$+he+!z!n9
143,593,830 *0DC44AB6D6F974F02A2FAC1F7E23C1C6693B3990 ane$+he+!z!n9
143,593,831 *0DC44AB6D6F974F02A2FAC1F7E23C1C6693B3990 ANGELA935
143,593,832 *0DCE48A967B9B3DE59D8C65A7B09D4D91508A5EC ANGELA935
143,593,833 *0DCE48A967B9B3DE59D8C65A7B09D4D91508A5EC ANGI0$T3G
143,593,834 *0DCCA36D8178D60BD3D10A7D965486846E2E7C88 ANGI0$T3G
143,593,835 *0DCCA36D8178D60BD3D10A7D965486846E2E7C88 [email protected]
143,593,836 *0DCEF8A2DF2364F98E4912C5DBE4BB04AD3D718B [email protected]
143,593,837 *0DCEF8A2DF2364F98E4912C5DBE4BB04AD3D718B A=OL
143,593,838 *0DCC7BB3BE46FD790D7E2096129845142E54C779 A=OL
143,593,839 *0DCC7BB3BE46FD790D7E2096129845142E54C779 AOPU;
143,593,840 *0DC7AB472D3FB8FE2F8C77BEF5A6BEFBF23FB243 AOPU;
143,593,841 *0DC7AB472D3FB8FE2F8C77BEF5A6BEFBF23FB243 A(P1T
143,593,842 *0DCCBB2B2EE94A10842FCCDF86F1F7C8F4FD90ED A(P1T
143,593,843 *0DCCBB2B2EE94A10842FCCDF86F1F7C8F4FD90ED APASCANOVIC
143,593,844 *0DC01C54C85AFB4471C14134C6EC5D70EC8C013B APASCANOVIC
143,593,845 *0DC01C54C85AFB4471C14134C6EC5D70EC8C013B apd_d
143,593,846 *0DC9D2272A38060ED0F0A1DE07D7F78CA3164233 apd_d
143,593,847 *0DC9D2272A38060ED0F0A1DE07D7F78CA3164233 apfa
143,593,848 *0DCAD3E2C82AFC396DA06816E061557CE5858C03 apfa
143,593,849 *0DCAD3E2C82AFC396DA06816E061557CE5858C03 appport5
143,593,850 *0DC99171EE3D3236700A003EB411F11A8252B89B appport5
143,593,851 *0DC99171EE3D3236700A003EB411F11A8252B89B APSILANKYMAI
143,593,852 *0DCF4C089FF031448F0CE148B19D52E81566AE96 APSILANKYMAI
143,593,853 *0DCF4C089FF031448F0CE148B19D52E81566AE96 aqk,u
143,593,854 *0DC608CE78EE93F2578DB47095A6C49504D10061 aqk,u
143,593,855 *0DC608CE78EE93F2578DB47095A6C49504D10061 AQ?T.
143,593,856 *0DCDDCC01C9701D9FB2D34919985D5A12763FFAC AQ?T.
143,593,857 *0DCDDCC01C9701D9FB2D34919985D5A12763FFAC ar5kh
143,593,858 *0DC3B36D11D0D6C56656AADF05F5729AECC6CCBD ar5kh
143,593,859 *0DC3B36D11D0D6C56656AADF05F5729AECC6CCBD ARETPANY9
143,593,860 *0DC21250C6872C4CCFAA374DB04FCE5CA8306BAD ARETPANY9
143,593,861 *0DC21250C6872C4CCFAA374DB04FCE5CA8306BAD ARGIBSWED
143,593,862 *0DC8CED9E5330D6B7BB25D84FF53FFC704D41971 ARGIBSWED
143,593,863 *0DC8CED9E5330D6B7BB25D84FF53FFC704D41971 ARLEN.UPHAM
143,593,864 *0DC6EBB57015362AB0C5FECC82AD3D4C3182F22A ARLEN.UPHAM
143,593,865 *0DC6EBB57015362AB0C5FECC82AD3D4C3182F22A arnoldosuda
143,593,866 *0DC57A1B88180A9594D3FB46DA0D725F844F06C0 arnoldosuda
143,593,867 *0DC57A1B88180A9594D3FB46DA0D725F844F06C0 ARNULFO.FAHL
143,593,868 *0DC842040165C3F246936517242CE48A27434701 ARNULFO.FAHL
143,593,869 *0DC842040165C3F246936517242CE48A27434701 ART.RADABAUGH
143,593,870 *0DC8503C9EE5D58F38135E73A787691E76226632 ART.RADABAUGH
143,593,871 *0DC8503C9EE5D58F38135E73A787691E76226632 ARVIDSENING
143,593,872 *0DCDFB0845879B297FE408A3188FC9DEBC430540 ARVIDSENING
143,593,873 *0DCDFB0845879B297FE408A3188FC9DEBC430540 AS1L;
143,593,874 *0DCF433991A8EA385B58A7AC338FA16942067436 AS1L;
143,593,875 *0DCF433991A8EA385B58A7AC338FA16942067436 ASAROETTGEN
143,593,876 *0DCC009FBF99FDEFEF995186CF6EA2AEED33D19B ASAROETTGEN
143,593,877 *0DCC009FBF99FDEFEF995186CF6EA2AEED33D19B ASI#;
143,593,878 *0DC0B9FA7949E8BD0F45A1393887973D59EEA3B2 ASI#;
143,593,879 *0DC0B9FA7949E8BD0F45A1393887973D59EEA3B2 ASSMU
143,593,880 *0DCB942CE16F8C106BEB09DE16A6D3013E1F1D6D ASSMU
143,593,881 *0DCB942CE16F8C106BEB09DE16A6D3013E1F1D6D au9!p
143,593,882 *0DC209DAC89334E1E2360223A82586CB6CDEB995 au9!p
143,593,883 *0DC209DAC89334E1E2360223A82586CB6CDEB995 AUSRUFEN
143,593,884 *0DCDB7E7703E5169752466B4AF1DFB8DE32ECFE2 AUSRUFEN
143,593,885 *0DCDB7E7703E5169752466B4AF1DFB8DE32ECFE2 AUSSTELLUNGSSTRATEGIEN
143,593,886 *0DC44DB68924FFC11D4926D24082D45CB9CF5979 AUSSTELLUNGSSTRATEGIEN
143,593,887 *0DC44DB68924FFC11D4926D24082D45CB9CF5979 AV8LP
143,593,888 *0DC80087CE8580206A7558412D309CCCC9D28ABC AV8LP
143,593,889 *0DC80087CE8580206A7558412D309CCCC9D28ABC aviston
143,593,890 *0DC6B50B1D7E58917B5C6F0C4B61F05175E8BE4A aviston
143,593,891 *0DC6B50B1D7E58917B5C6F0C4B61F05175E8BE4A avnp3
143,593,892 *0DCC11182D644DED2B9489A3C69C5034C64C0D54 avnp3
143,593,893 *0DCC11182D644DED2B9489A3C69C5034C64C0D54 AWQ89
143,593,894 *0DC430623B4F4676E633630FD90ACE56A46BB715 AWQ89
143,593,895 *0DC430623B4F4676E633630FD90ACE56A46BB715 AWRITESHEEN8389
143,593,896 *0DC637F33601214F1746546BA2F3A5EDFF5AE6A6 AWRITESHEEN8389
143,593,897 *0DC637F33601214F1746546BA2F3A5EDFF5AE6A6 a.xq?
143,593,898 *0DC5B24641376506E9DA90671D08D35FF67AE923 a.xq?
143,593,899 *0DC5B24641376506E9DA90671D08D35FF67AE923 AYAGENIFED
143,593,900 *0DC2ABC7D5117E5D7B022D693C0AAA73161C885A AYAGENIFED
143,593,901 *0DC2ABC7D5117E5D7B022D693C0AAA73161C885A azi%
143,593,902 *0DC1ABE7C6E5A64E6E9A9F9432E6782A7BD0657E azi%
143,593,903 *0DC1ABE7C6E5A64E6E9A9F9432E6782A7BD0657E A-ZNB
143,593,904 *0DC864372BEE9BF6EF772244D4C0CD7463A4DF01 A-ZNB
143,593,905 *0DC864372BEE9BF6EF772244D4C0CD7463A4DF01 [email protected]~-~(^_~)
143,593,906 *0DCDA04906BC2D88B6962FDC37B47712981BE078 [email protected]~-~(^_~)
143,593,907 *0DCDA04906BC2D88B6962FDC37B47712981BE078 B!%(
143,593,908 *0DCD0462C5DECB941174F8701FE99117B607E191 B!%(
143,593,909 *0DCD0462C5DECB941174F8701FE99117B607E191 >-B0.0~.d###q
143,593,910 *0DCD1D672C6CE34D4D50114DAF6EA37AA479F9DB >-B0.0~.d###q
143,593,911 *0DCD1D672C6CE34D4D50114DAF6EA37AA479F9DB b/04
143,593,912 *0DC5611F9C2FB0D5AE5A20B69E88FCEE184FB50D b/04
143,593,913 *0DC5611F9C2FB0D5AE5A20B69E88FCEE184FB50D B2GL:
143,593,914 *0DC66DDE5F8AF10A5EE7FB9851C9455D2825BB17 B2GL:
143,593,915 *0DC66DDE5F8AF10A5EE7FB9851C9455D2825BB17 B4?5R
143,593,916 *0DC0F9DB3D985F55F3895A560A168BE5EC5E610E B4?5R
143,593,917 *0DC0F9DB3D985F55F3895A560A168BE5EC5E610E b$7g;
143,593,918 *0DC711C9CB3076110FF66AE2510F1935919BEB2A b$7g;
143,593,919 *0DC711C9CB3076110FF66AE2510F1935919BEB2A b"8he
143,593,920 *0DCA86E53BA5F7D0F6863692C3D1623D3B393FF6 b"8he
143,593,921 *0DCA86E53BA5F7D0F6863692C3D1623D3B393FF6 b99hm
143,593,922 *0DC5F02398E4550337CAEBED441B50C5924B08AB b99hm
143,593,923 *0DC5F02398E4550337CAEBED441B50C5924B08AB B9R1S
143,593,924 *0DC18C915A0B792A132234365DBF8C7507C7555C B9R1S
143,593,925 *0DC18C915A0B792A132234365DBF8C7507C7555C BALAG
143,593,926 *0DC5414317261224FD61007678E8F21D8100FECC BALAG
143,593,927 *0DC5414317261224FD61007678E8F21D8100FECC [email protected]
143,593,928 *0DC12FDACAEE473AD936DA9E8DAB0659946E9FDC [email protected]
143,593,929 *0DC12FDACAEE473AD936DA9E8DAB0659946E9FDC BARBARA-SIMONS
143,593,930 *0DC567B9407D5E8DAE8AD090DD7157163C996171 BARBARA-SIMONS
143,593,931 *0DC567B9407D5E8DAE8AD090DD7157163C996171 BARNTILLSYNENS
143,593,932 *0DCCFEF401A9DA0FCAA1FCA128D78D6EBE7BACE1 BARNTILLSYNENS
143,593,933 *0DCCFEF401A9DA0FCAA1FCA128D78D6EBE7BACE1 [email protected]
143,593,934 *0DC41F6BB4448B55CB1E25103C1589756FECD25C [email protected]
143,593,935 *0DC41F6BB4448B55CB1E25103C1589756FECD25C BBSIL
143,593,936 *0DC753921916BCF4295DA1E8C4BEBF7732AEC1F2 BBSIL
143,593,937 *0DC753921916BCF4295DA1E8C4BEBF7732AEC1F2 [email protected]
143,593,938 *0DCC31F01846B43DDBB82EF641697D81ABC56A6A [email protected]OM
143,593,939 *0DCC31F01846B43DDBB82EF641697D81ABC56A6A bebobalulashes
143,593,940 *0DC96ADCF72857C3E73EE7F97DE594BE40C1B62F bebobalulashes
143,593,941 *0DC96ADCF72857C3E73EE7F97DE594BE40C1B62F BERTCONDA
143,593,942 *0DCF94725855D36967AEFAAE6B3C700377BC409E BERTCONDA
143,593,943 *0DCF94725855D36967AEFAAE6B3C700377BC409E beseide3
143,593,944 *0DCE8BA42560134B2D17BA689A1A44CD200DA59C beseide3
143,593,945 *0DCE8BA42560134B2D17BA689A1A44CD200DA59C BFKC5
143,593,946 *0DC155B617DF576F5DDAE4BB6126C120496B5CE0 BFKC5
143,593,947 *0DC155B617DF576F5DDAE4BB6126C120496B5CE0 BF$OB
143,593,948 *0DC3290624DE40B71012EBB48CA6FE0D37BEC800 BF$OB
143,593,949 *0DC3290624DE40B71012EBB48CA6FE0D37BEC800 bg)sw
143,593,950 *0DCD04DFA47C99C2BA00C38288233E8722E24DFB bg)sw
143,593,951 *0DCD04DFA47C99C2BA00C38288233E8722E24DFB bh(o)
143,593,952 *0DC6E94782C1B560DE85ED520D256A6802A5162F bh(o)
143,593,953 *0DC6E94782C1B560DE85ED520D256A6802A5162F b=i9p
143,593,954 *0DC1DB35D5C7B7405980789FEDC3B41A83B1F24A b=i9p
143,593,955 *0DC1DB35D5C7B7405980789FEDC3B41A83B1F24A biodegraded,biodegrades,biodegrading
143,593,956 *0DC341ED49C0F9688433DE1E3F9739261683B6C0 biodegraded,biodegrades,biodegrading
143,593,957 *0DC341ED49C0F9688433DE1E3F9739261683B6C0 BIRDJK
143,593,958 *0DC3EF4B3A64426F342FE04A588E3328B73DC4AB BIRDJK
143,593,959 *0DC3EF4B3A64426F342FE04A588E3328B73DC4AB BÎSCA
143,593,960 *0DC8EE9C232475D4EE3B459BAE061E42F2B43336 BÎSCA
143,593,961 *0DC8EE9C232475D4EE3B459BAE061E42F2B43336 bk7qo
143,593,962 *0DC548EAD7FFFE79082B7AA8105394CDEB4E4F28 bk7qo
143,593,963 *0DC548EAD7FFFE79082B7AA8105394CDEB4E4F28 bkn/n
143,593,964 *0DC095B0F134299357AA49CFD6160F15165B0B01 bkn/n
143,593,965 *0DC095B0F134299357AA49CFD6160F15165B0B01 bkr$j
143,593,966 *0DC995C5149EF8A856C57AEA91081F0936DDD8DC bkr$j
143,593,967 *0DC995C5149EF8A856C57AEA91081F0936DDD8DC BL7PH
143,593,968 *0DC533234532C263CC67E54FE3A95A990C74FE00 BL7PH
143,593,969 *0DC533234532C263CC67E54FE3A95A990C74FE00 BL_A
143,593,970 *0DC77ECFC174167A26C3BE32964CFCD6C69E086E BL_A
143,593,971 *0DC77ECFC174167A26C3BE32964CFCD6C69E086E blijspelouverture
143,593,972 *0DCA608B849054EF19603C1337B2E75654696143 blijspelouverture
143,593,973 *0DCA608B849054EF19603C1337B2E75654696143 BLWGI
143,593,974 *0DCF16DA6F591BEAAE6EC5F972597145BB040BD2 BLWGI
143,593,975 *0DCF16DA6F591BEAAE6EC5F972597145BB040BD2 B=MI
143,593,976 *0DC0E310C148A41D5B10BC2DDFF8DD6818CA46F9 B=MI
143,593,977 *0DC0E310C148A41D5B10BC2DDFF8DD6818CA46F9 bm,uc
143,593,978 *0DC8351193211AF439ECAC755B597A3F2AAA3E65 bm,uc
143,593,979 *0DC8351193211AF439ECAC755B597A3F2AAA3E65 BNM=
143,593,980 *0DC4FED955F7BE3E28170F4E86E667D015874288 BNM=
143,593,981 *0DC4FED955F7BE3E28170F4E86E667D015874288 BNUFP
143,593,982 *0DC3A3D38D57B68827F638063E9419620DB7B3D4 BNUFP
143,593,983 *0DC3A3D38D57B68827F638063E9419620DB7B3D4 BO1WW
143,593,984 *0DCDAA65CEA1489B9103BDBE62D243ACF175D7CC BO1WW
143,593,985 *0DCDAA65CEA1489B9103BDBE62D243ACF175D7CC BOBBY.RAMBO
143,593,986 *0DC2654880C73531BDB510B16B371A4679AF9BCB BOBBY.RAMBO
143,593,987 *0DC2654880C73531BDB510B16B371A4679AF9BCB BOILINGLED
143,593,988 *0DC594653F9FC30DCE1860A7D84025344C84AA4C BOILINGLED
143,593,989 *0DC594653F9FC30DCE1860A7D84025344C84AA4C BONCHES0
143,593,990 *0DC911411C773A67C7048DFFF158E83B01208F0A BONCHES0
143,593,991 *0DC911411C773A67C7048DFFF158E83B01208F0A BONSBAISERSDERUSSIE:007
143,593,992 *0DCBB30FE0BA3855112D31DE8841EA08F5DED215 BONSBAISERSDERUSSIE:007
143,593,993 *0DCBB30FE0BA3855112D31DE8841EA08F5DED215 BOO6$
143,593,994 *0DCDE0D3E323DDA17FBE25D60796CBF95EAEFFBB BOO6$
143,593,995 *0DCDE0D3E323DDA17FBE25D60796CBF95EAEFFBB BORETK
143,593,996 *0DCAF0A9B77916A92AD056880D24C157E982590E BORETK
143,593,997 *0DCAF0A9B77916A92AD056880D24C157E982590E boxerovou0
143,593,998 *0DCCAFF57F6AB93026B2DCBE5E361CF597B8B75A boxerovou0
143,593,999 *0DCCAFF57F6AB93026B2DCBE5E361CF597B8B75A b==p-~0-~o}o{
143,594,000 *0DC1E21B16EB72CE9E3A08327EB6CCF5E56B511E b==p-~0-~o}o{
143,594,001 *0DC1E21B16EB72CE9E3A08327EB6CCF5E56B511E B--P-*-*-*)O(
143,594,002 *0DC552F55B817C2BA0D7E7269C05D83E46C067ED B--P-*-*-*)O(
143,594,003 *0DC552F55B817C2BA0D7E7269C05D83E46C067ED BQ1BF
143,594,004 *0DCCB35D82F15B2C6B13526D1E54A30DFE2E323B BQ1BF
143,594,005 *0DCCB35D82F15B2C6B13526D1E54A30DFE2E323B bqn$7
143,594,006 *0DC274F4A7D4BC187BB3F4B4C60D87F80774FAC7 bqn$7
143,594,007 *0DC274F4A7D4BC187BB3F4B4C60D87F80774FAC7 b;qyc
143,594,008 *0DCE7EBB6D9EA422046BFC971720A4E0B470A8BC b;qyc
143,594,009 *0DCE7EBB6D9EA422046BFC971720A4E0B470A8BC BRADCORUJO
143,594,010 *0DC0C98DDD86CDBE273AEE4E543121C03369B81A BRADCORUJO
143,594,011 *0DC0C98DDD86CDBE273AEE4E543121C03369B81A brandenturner
143,594,012 *0DC8BF05A0A0DD84D44284D091123F46DCB2028B brandenturner
143,594,013 *0DC8BF05A0A0DD84D44284D091123F46DCB2028B BRIAN.CARDOSO
143,594,014 *0DCC7C47A30226BB9CE75C441C4AD6163124D27F BRIAN.CARDOSO
143,594,015 *0DCC7C47A30226BB9CE75C441C4AD6163124D27F [email protected]
143,594,016 *0DCE94D75CD3D31C6AD1D84190D106B8F032DF73 [email protected]
143,594,017 *0DCE94D75CD3D31C6AD1D84190D106B8F032DF73 brigit?
143,594,018 *0DCD7D55E07B6D491EECDCDD42A67144A89C1051 brigit?
143,594,019 *0DCD7D55E07B6D491EECDCDD42A67144A89C1051 BRITT.CELUCH
143,594,020 *0DCB7B34FBB3728C72E0F8C7815FD14B51BC6BAB BRITT.CELUCH
143,594,021 *0DCB7B34FBB3728C72E0F8C7815FD14B51BC6BAB bryanwuori
143,594,022 *0DCB4799D658D053F01E6DE36DB06A027D1AD72D bryanwuori
143,594,023 *0DCB4799D658D053F01E6DE36DB06A027D1AD72D BRYONGIDDENS
143,594,024 *0DCB5EF1B965608D055D6AE21285C4945EA3CD38 BRYONGIDDENS
143,594,025 *0DCB5EF1B965608D055D6AE21285C4945EA3CD38 bt%0i
143,594,026 *0DCBB4749536620BA6D146497EF5CF76874E5217 bt%0i
143,594,027 *0DCBB4749536620BA6D146497EF5CF76874E5217 bthe
143,594,028 *0DC13326B09E06C2CF78825BEC919F500B44DCF2 bthe
143,594,029 *0DC13326B09E06C2CF78825BEC919F500B44DCF2 BTHOOFT
143,594,030 *0DCB17109A0B5785F33AE7704A04F7EA313832FE BTHOOFT
143,594,031 *0DCB17109A0B5785F33AE7704A04F7EA313832FE BUFORDBODIN
143,594,032 *0DC9202F9B8AC88AD260E0A44036216B334AFC76 BUFORDBODIN
143,594,033 *0DC9202F9B8AC88AD260E0A44036216B334AFC76 BURSTING.OUT.WITH.THE.ALLSTAR.BIG.BAND!./.SWINGING.BRASS
143,594,034 *0DCD64AE3A3F701008274CE506843DAAA28C7B9A BURSTING.OUT.WITH.THE.ALLSTAR.BIG.BAND!./.SWINGING.BRASS
143,594,035 *0DCD64AE3A3F701008274CE506843DAAA28C7B9A BUW5
143,594,036 *0DCC7DA65DE6D2D8530E2DDE1FE9BE13295B9F01 BUW5
143,594,037 *0DCC7DA65DE6D2D8530E2DDE1FE9BE13295B9F01 BUZX)
143,594,038 *0DC61C40DA07143E4804E7437232AD6341155F58 BUZX)
143,594,039 *0DC61C40DA07143E4804E7437232AD6341155F58 bvci:
143,594,040 *0DC8FE5888F88EC8A18854580674ABAF25CF2C13 bvci:
143,594,041 *0DC8FE5888F88EC8A18854580674ABAF25CF2C13 bvcjdgio60
143,594,042 *0DC89E9ACBEE3D8E8FE009E3D1D71CEDEC9CEB2E bvcjdgio60
143,594,043 *0DC89E9ACBEE3D8E8FE009E3D1D71CEDEC9CEB2E b$.x=
143,594,044 *0DCE37E3953055028EED386133DE4ADC78E8D4C2 b$.x=
143,594,045 *0DCE37E3953055028EED386133DE4ADC78E8D4C2 bx./
143,594,046 *0DCF6A0A30548A3310449AB0F4C28931EBB91BF7 bx./
143,594,047 *0DCF6A0A30548A3310449AB0F4C28931EBB91BF7 byronnoel
143,594,048 *0DC1AF6FB6B7A86F81EDC319CDB5805F5D4296EF byronnoel
143,594,049 *0DC1AF6FB6B7A86F81EDC319CDB5805F5D4296EF c.-
143,594,050 *0DC4079BEE88F07FBDC0A7D830B43D907AB3C697 c.-
143,594,051 *0DC4079BEE88F07FBDC0A7D830B43D907AB3C697 C0D1E
143,594,052 *0DC337C70F5E51CF6386FEF2256F106DE68F6D3C C0D1E
143,594,053 *0DC337C70F5E51CF6386FEF2256F106DE68F6D3C C0RR035535LH3
143,594,054 *0DC5D1DBEBC3855099BE2886DE4AC030A996FFE6 C0RR035535LH3
143,594,055 *0DC5D1DBEBC3855099BE2886DE4AC030A996FFE6 C&4C
143,594,056 *0DC039F9691165397994B471FDAA24DDDBE66D1C C&4C
143,594,057 *0DC039F9691165397994B471FDAA24DDDBE66D1C C4VK%
143,594,058 *0DCF59E5CCFFE8B44B75C829D56D9CA975023D8B C4VK%
143,594,059 *0DCF59E5CCFFE8B44B75C829D56D9CA975023D8B C5GB
143,594,060 *0DC0470564C71E432B4154D93FC9C7268A3CB0C1 C5GB
143,594,061 *0DC0470564C71E432B4154D93FC9C7268A3CB0C1 C"5TB
143,594,062 *0DC7CA8F6CD21C54375AD72E7EE90CED5B97A3F7 C"5TB
143,594,063 *0DC7CA8F6CD21C54375AD72E7EE90CED5B97A3F7 c6xxc
143,594,064 *0DC36E5B255BA82549E6C3D5FD15E65E398570B1 c6xxc
143,594,065 *0DC36E5B255BA82549E6C3D5FD15E65E398570B1 [email protected]
143,594,066 *0DCC7D6631B7E14174BE307EEECCD0215BC035CF [email protected]
143,594,067 *0DCC7D6631B7E14174BE307EEECCD0215BC035CF c#+(9
143,594,068 *0DC8F9C8E068130ADA43F0FC512A1662CCBBC916 c#+(9
143,594,069 *0DC8F9C8E068130ADA43F0FC512A1662CCBBC916 calmosas
143,594,070 *0DCD045C3707519C38D09FF37BBA96AF5EBABF55 calmosas
143,594,071 *0DCD045C3707519C38D09FF37BBA96AF5EBABF55 carrolschaer
143,594,072 *0DC4498B008FBF0B490ABC92AD1BCDE626D8B70F carrolschaer
143,594,073 *0DC4498B008FBF0B490ABC92AD1BCDE626D8B70F C,ASK
143,594,074 *0DC047E97F28B582FBC1ABACC4A503F5D535035A C,ASK
143,594,075 *0DC047E97F28B582FBC1ABACC4A503F5D535035A CATEGORYBALLAD_SINGE
143,594,076 *0DC89753D453F42C5DA2E228D309E818890EFB01 CATEGORYBALLAD_SINGE
143,594,077 *0DC89753D453F42C5DA2E228D309E818890EFB01 câu.vắt
143,594,078 *0DCD5519D5E3E259BBCD1144D68ADC4DFD2CF6FD câu.vắt
143,594,079 *0DCD5519D5E3E259BBCD1144D68ADC4DFD2CF6FD C'AW
143,594,080 *0DC126C05C7CC13EA77CE211D4A4BECF6CC35B66 C'AW
143,594,081 *0DC126C05C7CC13EA77CE211D4A4BECF6CC35B66 CBUNX
143,594,082 *0DC5D32A8CB047A316C49F34591A340A60FF9082 CBUNX
143,594,083 *0DC5D32A8CB047A316C49F34591A340A60FF9082 C&C&D
143,594,084 *0DC1A352EF23CBD27801EAAFC7690E58D4ADE01C C&C&D
143,594,085 *0DC1A352EF23CBD27801EAAFC7690E58D4ADE01C C_C$W
143,594,086 *0DC62D6271DF13F97B5104013FD4C278D1DBCA0C C_C$W
143,594,087 *0DC62D6271DF13F97B5104013FD4C278D1DBCA0C CD3(G
143,594,088 *0DCEF9905E4A2DD8E6FDE9C7078906AFB3B5453E CD3(G
143,594,089 *0DCEF9905E4A2DD8E6FDE9C7078906AFB3B5453E c-d/k
143,594,090 *0DC8E73A5A1977147D2E6BA1E3D690799DE882A3 c-d/k
143,594,091 *0DC8E73A5A1977147D2E6BA1E3D690799DE882A3 cd(w!
143,594,092 *0DCA9CA9698642FC52F3093A62C0B7BA6DB3D6B9 cd(w!
143,594,093 *0DCA9CA9698642FC52F3093A62C0B7BA6DB3D6B9 CEIF(
143,594,094 *0DC73998165F860FD04D4B8E410D4DB8C5C43CC5 CEIF(
143,594,095 *0DC73998165F860FD04D4B8E410D4DB8C5C43CC5 cerkh
143,594,096 *0DC952A2E8965BC55417CD0C30A7DA4BB19003E0 cerkh
143,594,097 *0DC952A2E8965BC55417CD0C30A7DA4BB19003E0 CG&T9
143,594,098 *0DC92C1190F3FB49A0D01402F601C9683B38A770 CG&T9
143,594,099 *0DC92C1190F3FB49A0D01402F601C9683B38A770 ch24ju7
143,594,100 *0DC76D3DB435A717BDA4D201BABF01CC88A0B7C9 ch24ju7
143,594,101 *0DC76D3DB435A717BDA4D201BABF01CC88A0B7C9 [email protected]
143,594,102 *0DC6D52996EFBF9A245710813E2499F898580D03 [email protected]
143,594,103 *0DC6D52996EFBF9A245710813E2499F898580D03 CHAPTER 31-06: THE THIRD TASK
143,594,104 *0DCF1FD06202A91D8E8FACEF56EEE7E9F73117A3 CHAPTER 31-06: THE THIRD TASK
143,594,105 *0DCF1FD06202A91D8E8FACEF56EEE7E9F73117A3 chary.velez
143,594,106 *0DC900FE2FB6DD69BF7AF90C0FBA64DFD75C56A5 chary.velez
143,594,107 *0DC900FE2FB6DD69BF7AF90C0FBA64DFD75C56A5 CHASIDYPOOLE
143,594,108 *0DC57640234F8FC5C9F90576138D729EEBE34457 CHASIDYPOOLE
143,594,109 *0DC57640234F8FC5C9F90576138D729EEBE34457 CHATHAMHOUSEMANFIREDBECAUSEPROISRAELBOOK
143,594,110 *0DC029E2E8BB9260A32375969FE45AB07526DADC CHATHAMHOUSEMANFIREDBECAUSEPROISRAELBOOK
143,594,111 *0DC029E2E8BB9260A32375969FE45AB07526DADC CHEN6917
143,594,112 *0DCBAACB773412D983F808591D1AE8B1A204CB35 CHEN6917
143,594,113 *0DCBAACB773412D983F808591D1AE8B1A204CB35 [email protected]
143,594,114 *0DC599FDB7BB2FFF0EC3C96C43D5E11CF5F7CCCF [email protected]
143,594,115 *0DC599FDB7BB2FFF0EC3C96C43D5E11CF5F7CCCF childofmidnight''midnight's
143,594,116 *0DCECCCFCC33F03892EE0945482CA1331CF17C3F childofmidnight''midnight's
143,594,117 *0DCECCCFCC33F03892EE0945482CA1331CF17C3F [email protected]
143,594,118 *0DCB0C17BC2AC62A5607DECB082C3A49DBB6CC2B [email protected]
143,594,119 *0DCB0C17BC2AC62A5607DECB082C3A49DBB6CC2B CHRISTIANWORSHIPORGUKWWW
143,594,120 *0DC278B5CD3377057E3D9F52ABE2E1679854CFEC CHRISTIANWORSHIPORGUKWWW
143,594,121 *0DC278B5CD3377057E3D9F52ABE2E1679854CFEC CHRISTYPLEASE
143,594,122 *0DCFEF5F822E12E18F4F1AE1E10ECD930F4249BE CHRISTYPLEASE
143,594,123 *0DCFEF5F822E12E18F4F1AE1E10ECD930F4249BE ci7g+
143,594,124 *0DCE662B0B87215299237E878354C19560814BD9 ci7g+
143,594,125 *0DCE662B0B87215299237E878354C19560814BD9 c"ii-
143,594,126 *0DC5975365B316B3CF2237176417B12F7C3D616F c"ii-
143,594,127 *0DC5975365B316B3CF2237176417B12F7C3D616F CINDERNEWS
143,594,128 *0DCF27947B157A94821AB946973DA92AEF07AD32 CINDERNEWS
143,594,129 *0DCF27947B157A94821AB946973DA92AEF07AD32 c!inw
143,594,130 *0DC41F19E33B61967ED08D0E62C78B24E80875FF c!inw
143,594,131 *0DC41F19E33B61967ED08D0E62C78B24E80875FF ciracsam7
143,594,132 *0DCA4C53ACAF5DFD2571177AB61212902526DB78 ciracsam7
143,594,133 *0DCA4C53ACAF5DFD2571177AB61212902526DB78 civa%
143,594,134 *0DC0EB91B11D065CF4EB9BC07E0C7E349C0E9AF1 civa%
143,594,135 *0DC0EB91B11D065CF4EB9BC07E0C7E349C0E9AF1 C=J#9
143,594,136 *0DC92EBCA1225E687951EB2324D0DD929241AA01 C=J#9
143,594,137 *0DC92EBCA1225E687951EB2324D0DD929241AA01 CJB9A
143,594,138 *0DCCED54DD0A080A52C337EA78BB6EE51451BE2C CJB9A
143,594,139 *0DCCED54DD0A080A52C337EA78BB6EE51451BE2C CKIEGT
143,594,140 *0DC73F2BF28CF01BE57D3A74C591C73580638B6F CKIEGT
143,594,141 *0DC73F2BF28CF01BE57D3A74C591C73580638B6F CKU?D
143,594,142 *0DC3BE1D2F67DF8CCD13A41E540B0993AE383DD0 CKU?D
143,594,143 *0DC3BE1D2F67DF8CCD13A41E540B0993AE383DD0 cleanbre2
143,594,144 *0DC7EFF77B495CA15808020A722B1D824EB05424 cleanbre2
143,594,145 *0DC7EFF77B495CA15808020A722B1D824EB05424 cleolambert
143,594,146 *0DC13A4F4FDEB966F08A221B3992C5C4B4ED1844 cleolambert
143,594,147 *0DC13A4F4FDEB966F08A221B3992C5C4B4ED1844 CLIFTONLOJEK
143,594,148 *0DCC791495911346324DF8BD65ECAEFF98B45949 CLIFTONLOJEK
143,594,149 *0DCC791495911346324DF8BD65ECAEFF98B45949 clint.philpot
143,594,150 *0DC90536C4B76C7844EEE3D0577003594DD73F3F clint.philpot
143,594,151 *0DC90536C4B76C7844EEE3D0577003594DD73F3F C"lO
143,594,152 *0DCD684FCA430E534AE9E6E99F1ECE8A20583B36 C"lO
143,594,153 *0DCD684FCA430E534AE9E6E99F1ECE8A20583B36 CMJ$P
143,594,154 *0DC18DC892D13D1AFF5979E37C07201FB943D7F5 CMJ$P
143,594,155 *0DC18DC892D13D1AFF5979E37C07201FB943D7F5 cmk~
143,594,156 *0DC07EDDB61C0447307A173917C6783A1484245A cmk~
143,594,157 *0DC07EDDB61C0447307A173917C6783A1484245A cnew
143,594,158 *0DCA0210C643BB4C1B7BFDE95ADA9FE6EEDF6B82 cnew
143,594,159 *0DCA0210C643BB4C1B7BFDE95ADA9FE6EEDF6B82 CNKJJXTING
143,594,160 *0DC294AA1AB07DAAB23E7D63516D6C081AC58519 CNKJJXTING
143,594,161 *0DC294AA1AB07DAAB23E7D63516D6C081AC58519 c=o
143,594,162 *0DC10B9168D8F0A9D6F2EA2AB3E794112F030BFA c=o
143,594,163 *0DC10B9168D8F0A9D6F2EA2AB3E794112F030BFA CODY.SALSEDO
143,594,164 *0DC7E8BFCABA6314CD206BC862012BE70427BC11 CODY.SALSEDO
143,594,165 *0DC7E8BFCABA6314CD206BC862012BE70427BC11 colemandellaporta
143,594,166 *0DCBCD5F3C22600307173C702745B7C33A578AA4 colemandellaporta
143,594,167 *0DCBCD5F3C22600307173C702745B7C33A578AA4 COLINCARREON
143,594,168 *0DC18B357C57695163C6FBDA90838245EAB1D693 COLINCARREON
143,594,169 *0DC18B357C57695163C6FBDA90838245EAB1D693 colligib9
143,594,170 *0DC3DA07A1725C44D46AF1333B6BF8976DCFCE47 colligib9
143,594,171 *0DC3DA07A1725C44D46AF1333B6BF8976DCFCE47 COMICSGOD
143,594,172 *0DCC82BD8AACF7BDC1BF57D682038E47302A36CE COMICSGOD
143,594,173 *0DCC82BD8AACF7BDC1BF57D682038E47302A36CE CONTENHAMOSLHE
143,594,174 *0DC525B3B00B2A43635DF9270EBC21D9537B1F36 CONTENHAMOSLHE
143,594,175 *0DC525B3B00B2A43635DF9270EBC21D9537B1F36 CORNEVA9
143,594,176 *0DCD6BC48149791C9A1D45AD0BF1A881F8DEE88C CORNEVA9
143,594,177 *0DCD6BC48149791C9A1D45AD0BF1A881F8DEE88C cortezroughton
143,594,178 *0DC063624173A69B06531FB4D84D1BE635A95709 cortezroughton
143,594,179 *0DC063624173A69B06531FB4D84D1BE635A95709 couragiez8
143,594,180 *0DCD80FCD9FB2BB53C7B95E45B609A073F70F2DD couragiez8
143,594,181 *0DCD80FCD9FB2BB53C7B95E45B609A073F70F2DD cowboyabby
143,594,182 *0DC049DE79CD7214D4AE7E3E512802F8E3C83746 cowboyabby
143,594,183 *0DC049DE79CD7214D4AE7E3E512802F8E3C83746 c=pb)
143,594,184 *0DCEC1C27113E40F36ED8C59D600278D784CCC65 c=pb)
143,594,185 *0DCEC1C27113E40F36ED8C59D600278D784CCC65 CPR-C
143,594,186 *0DCFFEA9D9F36BFE5C89CDC48E2C81F47C5C9FC7 CPR-C
143,594,187 *0DCFFEA9D9F36BFE5C89CDC48E2C81F47C5C9FC7 cq2vv
143,594,188 *0DC1605981FF63D9A829726313E578E146B61093 cq2vv
143,594,189 *0DC1605981FF63D9A829726313E578E146B61093 CQUI9
143,594,190 *0DCF3377F04A919AFA33027B25CAD8E33C528B6C CQUI9
143,594,191 *0DCF3377F04A919AFA33027B25CAD8E33C528B6C cr9)p
143,594,192 *0DC13916C8B2E620B38456FDB242AACBD4843EE0 cr9)p
143,594,193 *0DC13916C8B2E620B38456FDB242AACBD4843EE0 crane
143,594,194 *0DCC229B8F163AE4BD4C47DF98071FA26CC4C56D crane
143,594,195 *0DCC229B8F163AE4BD4C47DF98071FA26CC4C56D CRAZY_CHRISTIANGIRL
143,594,196 *0DC5127E48027435F877F1666F9A3783BEEB1A3D CRAZY_CHRISTIANGIRL
143,594,197 *0DC5127E48027435F877F1666F9A3783BEEB1A3D CRYING-MOON
143,594,198 *0DC11CB291C12150FF69D20C280A6C6E10EC2057 CRYING-MOON
143,594,199 *0DC11CB291C12150FF69D20C280A6C6E10EC2057 cse=?
143,594,200 *0DCED7B2A0BFAD9DD91981B9A0B83B27104953CF cse=?
143,594,201 *0DCED7B2A0BFAD9DD91981B9A0B83B27104953CF csn4c
143,594,202 *0DCF86A446B42E9E69EC382DDFB7F9090D35B7E5 csn4c
143,594,203 *0DCF86A446B42E9E69EC382DDFB7F9090D35B7E5 CTADM
143,594,204 *0DC1BD2F741DD424217007D5079E41AA7CEF5F94 CTADM
143,594,205 *0DC1BD2F741DD424217007D5079E41AA7CEF5F94 CTG"X
143,594,206 *0DC6F5C3517B80001A00938229A8BFAA6A2D8058 CTG"X
143,594,207 *0DC6F5C3517B80001A00938229A8BFAA6A2D8058 [email protected]$T!LE
143,594,208 *0DCB8F7AE78D8D97002DB5DE7484FCF26640EE04 [email protected]$T!LE
143,594,209 *0DCB8F7AE78D8D97002DB5DE7484FCF26640EE04 CTSEW
143,594,210 *0DC1E476402C3858839B9F7B87C589175FF6EA5E CTSEW
143,594,211 *0DC1E476402C3858839B9F7B87C589175FF6EA5E [email protected]
143,594,212 *0DCDC181D6DBAB6D20C53C30217B25AE9EF62F76 [email protected]
143,594,213 *0DCDC181D6DBAB6D20C53C30217B25AE9EF62F76 CURROUGH
143,594,214 *0DCE2CE3649BAB0BB3B10DBA35763DE87E4A219D CURROUGH
143,594,215 *0DCE2CE3649BAB0BB3B10DBA35763DE87E4A219D cuv2?
143,594,216 *0DC48DEDF22D8B79EB07FEEC08FBD198E30BCCD2 cuv2?
143,594,217 *0DC48DEDF22D8B79EB07FEEC08FBD198E30BCCD2 cv-9b
143,594,218 *0DC2EA08CA804344C8D9A003364453BC7D18D921 cv-9b
143,594,219 *0DC2EA08CA804344C8D9A003364453BC7D18D921 CVALUTAZIONI
143,594,220 *0DCCDE896B0014D1FA01D16977FE0E4082B29719 CVALUTAZIONI
143,594,221 *0DCCDE896B0014D1FA01D16977FE0E4082B29719 cv?g,
143,594,222 *0DC5E193F0BBA08F19060139CACCEB487A0A1675 cv?g,
143,594,223 *0DC5E193F0BBA08F19060139CACCEB487A0A1675 CY10L
143,594,224 *0DC76684CE7C0EA18F297271A74715EE4E71E349 CY10L
143,594,225 *0DC76684CE7C0EA18F297271A74715EE4E71E349 CYRIL.BEEGHLY
143,594,226 *0DC0EE8BD5B2894E463ACA54382BA60AACC2EDC0 CYRIL.BEEGHLY
143,594,227 *0DC0EE8BD5B2894E463ACA54382BA60AACC2EDC0 CYRILKILBERT
143,594,228 *0DCE2EB035BEB13B13E8C09552B257D9CF56BFCD CYRILKILBERT
143,594,229 *0DCE2EB035BEB13B13E8C09552B257D9CF56BFCD C?ZQZ
143,594,230 *0DCA78C5957ED367BFB6791FAA57863839CE379B C?ZQZ
143,594,231 *0DCA78C5957ED367BFB6791FAA57863839CE379B D4ARX
143,594,232 *0DC0B66CC666F30185DA14BF573EC1C3A8DE6706 D4ARX
143,594,233 *0DC0B66CC666F30185DA14BF573EC1C3A8DE6706 d9ig:
143,594,234 *0DC1BF2DE1BF1B3DD73E2061E3C4FA084C913CE2 d9ig:
143,594,235 *0DC1BF2DE1BF1B3DD73E2061E3C4FA084C913CE2 d"&af
143,594,236 *0DCD1D2092AF1207A6222C695F3C4F2E031282BF d"&af
143,594,237 *0DCD1D2092AF1207A6222C695F3C4F2E031282BF dagboekj1
143,594,238 *0DC18ED6050C98011313A9D094F196160395C003 dagboekj1
143,594,239 *0DC18ED6050C98011313A9D094F196160395C003 [email protected]
143,594,240 *0DCF3B65EBCA3D89F922A048F2C59620F6203674 [email protected]
143,594,241 *0DCF3B65EBCA3D89F922A048F2C59620F6203674 [email protected]
143,594,242 *0DC5A3398282BE659D45470F613CD63DAD9754ED [email protected]
143,594,243 *0DC5A3398282BE659D45470F613CD63DAD9754ED DAMION.LEMMEN
143,594,244 *0DCDA8CE09550028C19A8FACF0B25718346932B9 DAMION.LEMMEN
143,594,245 *0DCDA8CE09550028C19A8FACF0B25718346932B9 danemackintosh
143,594,246 *0DC27C361C2A3A705438B221779AA5C42790EE4B danemackintosh
143,594,247 *0DC27C361C2A3A705438B221779AA5C42790EE4B danialmcglaughlin
143,594,248 *0DC47D1FA9BDCBEE570A88012B17BD2348EE1148 danialmcglaughlin
143,594,249 *0DC47D1FA9BDCBEE570A88012B17BD2348EE1148 DARENBURGOS
143,594,250 *0DC7A4469993DDF32E1E04E9FD1BEE13A00BFC54 DARENBURGOS
143,594,251 *0DC7A4469993DDF32E1E04E9FD1BEE13A00BFC54 DARK-RUBY
143,594,252 *0DCA97C745A0912B763BB7710743C4468CC02812 DARK-RUBY
143,594,253 *0DCA97C745A0912B763BB7710743C4468CC02812 DARRICKSTEELE
143,594,254 *0DC810F5F968D3D0D2D2622CA88006FB2D6D8F30 DARRICKSTEELE
143,594,255 *0DC810F5F968D3D0D2D2622CA88006FB2D6D8F30 david-duke
143,594,256 *0DC0BCA718CBBA006293BB1F5A160D2CC5B5BB88 david-duke
143,594,257 *0DC0BCA718CBBA006293BB1F5A160D2CC5B5BB88 davidtw
143,594,258 *0DC41E433F7B4C3AB9AC3FDD030E95EE87FBE148 davidtw
143,594,259 *0DC41E433F7B4C3AB9AC3FDD030E95EE87FBE148 DAWNRAZOR4
143,594,260 *0DC63236C39E8D3D0CC6E19861668EB7570E3C72 DAWNRAZOR4
143,594,261 *0DC63236C39E8D3D0CC6E19861668EB7570E3C72 d;bi(
143,594,262 *0DC77EC8AFB4184E3B3593E5F94331E4769C26D6 d;bi(
143,594,263 *0DC77EC8AFB4184E3B3593E5F94331E4769C26D6 dbi"a
143,594,264 *0DCB794A514543842A96A9005D819FD06E021074 dbi"a
143,594,265 *0DCB794A514543842A96A9005D819FD06E021074 dbn1o
143,594,266 *0DCF915A3BFDF074F222802416FF437E873379FF dbn1o
143,594,267 *0DCF915A3BFDF074F222802416FF437E873379FF dcusw
143,594,268 *0DCF08F08913FC98AF83B0C8BDDEE8265A117257 dcusw
143,594,269 *0DCF08F08913FC98AF83B0C8BDDEE8265A117257 ddmvs
143,594,270 *0DCA04BBDADB35A55D21EC4E1C6D44B7A948C5BA ddmvs
143,594,271 *0DCA04BBDADB35A55D21EC4E1C6D44B7A948C5BA DDT61
143,594,272 *0DCC061BFF0EFBFF0BC2A68DEE0AD30AAEC36F3F DDT61
143,594,273 *0DCC061BFF0EFBFF0BC2A68DEE0AD30AAEC36F3F DECAHIDA
143,594,274 *0DCDD40BBB7E0C438FDF533DA8861003312C6A27 DECAHIDA
143,594,275 *0DCDD40BBB7E0C438FDF533DA8861003312C6A27 delangeorg
143,594,276 *0DCCB3A7EF74FC28D62C0B81124F8DF820513D52 delangeorg
143,594,277 *0DCCB3A7EF74FC28D62C0B81124F8DF820513D52 DEL.LYNDAKER
143,594,278 *0DC5433E4EE8C4BADEE9A46221F13177CB109692 DEL.LYNDAKER
143,594,279 *0DC5433E4EE8C4BADEE9A46221F13177CB109692 DE.NEERGAARD
143,594,280 *0DC7A5D848717D0180606E5D8241CFBEDA886C15 DE.NEERGAARD
143,594,281 *0DC7A5D848717D0180606E5D8241CFBEDA886C15 [email protected]
143,594,282 *0DCECB0ABDFAC9A49B80856F28A46591DBA83474 [email protected]
143,594,283 *0DCECB0ABDFAC9A49B80856F28A46591DBA83474 DERICKALDROW
143,594,284 *0DC34D65D4DE8A16995E591ED5F1A47BF178EC02 DERICKALDROW
143,594,285 *0DC34D65D4DE8A16995E591ED5F1A47BF178EC02 DERICK.CLUKEY
143,594,286 *0DC29A5C76ADF26AA1CDC2E2C03C2737C3718B5F DERICK.CLUKEY
143,594,287 *0DC29A5C76ADF26AA1CDC2E2C03C2737C3718B5F derrickmcnamer
143,594,288 *0DC13265B19886F54CE1443EEA329D3ED537A88E derrickmcnamer
143,594,289 *0DC13265B19886F54CE1443EEA329D3ED537A88E DESMIDIOED
143,594,290 *0DC3773D727FA880D2F7A96935042D50133A90AE DESMIDIOED
143,594,291 *0DC3773D727FA880D2F7A96935042D50133A90AE DEWAYNESCHOENSTEIN
143,594,292 *0DC2FC50FB56AECE48BE02860834FC3637E2238C DEWAYNESCHOENSTEIN
143,594,293 *0DC2FC50FB56AECE48BE02860834FC3637E2238C d#$ey
143,594,294 *0DC0B719C430D4B3D11FCBE2B6494876E2640244 d#$ey
143,594,295 *0DC0B719C430D4B3D11FCBE2B6494876E2640244 D$FA
143,594,296 *0DC09E7789C8856B07E7FE21BD872EF3B16C070F D$FA
143,594,297 *0DC09E7789C8856B07E7FE21BD872EF3B16C070F dfb%_
143,594,298 *0DC5B33A7B4F1CCC0317279ADCE921AD54CBDE78 dfb%_
143,594,299 *0DC5B33A7B4F1CCC0317279ADCE921AD54CBDE78 dfi01
143,594,300 *0DCAB98FECE0F782B8C0454F9760DD7CF1B1CD4B dfi01
143,594,301 *0DCAB98FECE0F782B8C0454F9760DD7CF1B1CD4B DFV-SERIES
143,594,302 *0DC2206DB6B6C59716037DBFFF96DF736E71AE44 DFV-SERIES
143,594,303 *0DC2206DB6B6C59716037DBFFF96DF736E71AE44 dh6:k
143,594,304 *0DC657E37D5AE1637016B972F32954BC53A1F360 dh6:k
143,594,305 *0DC657E37D5AE1637016B972F32954BC53A1F360 dhfhp
143,594,306 *0DC9C14B1517A0D5879908F806A1AB0D530D0B8E dhfhp
143,594,307 *0DC9C14B1517A0D5879908F806A1AB0D530D0B8E D=HGG
143,594,308 *0DCF60E2ECF765B22F28D297E63CDEA8881AC860 D=HGG
143,594,309 *0DCF60E2ECF765B22F28D297E63CDEA8881AC860 DIYANGOCHEV
143,594,310 *0DCDF397BD97915AACC2639B60ED618E67E357B8 DIYANGOCHEV
143,594,311 *0DCDF397BD97915AACC2639B60ED618E67E357B8 dkbx
143,594,312 *0DCE739FACFC4B0AC0C4E21CFE47DAD09F285017 dkbx
143,594,313 *0DCE739FACFC4B0AC0C4E21CFE47DAD09F285017 d(m3h
143,594,314 *0DCE48FD7E7AEE58B74217CD6A6C3E05644C1855 d(m3h
143,594,315 *0DCE48FD7E7AEE58B74217CD6A6C3E05644C1855 DMEJL
143,594,316 *0DC8332A3DDC8919AB7DDBA4F8398E6A83528CDE DMEJL
143,594,317 *0DC8332A3DDC8919AB7DDBA4F8398E6A83528CDE dnr310
143,594,318 *0DCD93E891B69C414537CE22E989549CAC15B504 dnr310
143,594,319 *0DCD93E891B69C414537CE22E989549CAC15B504 DNW"=
143,594,320 *0DC307730951975493B2F6453858B3DB7D4F1EBE DNW"=
143,594,321 *0DC307730951975493B2F6453858B3DB7D4F1EBE DOLORES LOWE
143,594,322 *0DC3978246076B8BE6F20191F9E45A63FFC29FFA DOLORES LOWE
143,594,323 *0DC3978246076B8BE6F20191F9E45A63FFC29FFA donlichtenstein
143,594,324 *0DCE68DC3642B4B9756DEBBE2C6706941405374A donlichtenstein
143,594,325 *0DCE68DC3642B4B9756DEBBE2C6706941405374A DONNIEMALAVET
143,594,326 *0DC324862DF4287553F19B0D4800F7BE62586972 DONNIEMALAVET
143,594,327 *0DC324862DF4287553F19B0D4800F7BE62586972 d#orw
143,594,328 *0DCADC59DDD8309FAB11665AD1DA7238FE897E03 d#orw
143,594,329 *0DCADC59DDD8309FAB11665AD1DA7238FE897E03 dospelo8
143,594,330 *0DC1FF193694507A96E7B29EB74E9A71CAD8DB01 dospelo8
143,594,331 *0DC1FF193694507A96E7B29EB74E9A71CAD8DB01 DOUG.ARCAUTE
143,594,332 *0DC87D80B0E64964B89CEB3F8B7F701062A760C1 DOUG.ARCAUTE
143,594,333 *0DC87D80B0E64964B89CEB3F8B7F701062A760C1 DOUGLASX5
143,594,334 *0DC0AE0D6F9BC75D53689064DDFAE81932050B2C DOUGLASX5
143,594,335 *0DC0AE0D6F9BC75D53689064DDFAE81932050B2C dpuv0
143,594,336 *0DC7F81EB16DC4F8A1FBE8EC1D6C7967BAB67553 dpuv0
143,594,337 *0DC7F81EB16DC4F8A1FBE8EC1D6C7967BAB67553 DQB0G
143,594,338 *0DC7E2B4612C5C12AEBA4AD658BF0FA14730572F DQB0G
143,594,339 *0DC7E2B4612C5C12AEBA4AD658BF0FA14730572F DRAQONES
143,594,340 *0DC2DB8082C848E62D61B783A040893C189C5C08 DRAQONES
143,594,341 *0DC2DB8082C848E62D61B783A040893C189C5C08 Drawingshave
143,594,342 *0DCE8BC6CFF58E13353E7B93BC62504955B35CAD Drawingshave
143,594,343 *0DCE8BC6CFF58E13353E7B93BC62504955B35CAD dt(lw
143,594,344 *0DCEC9B823294BDC03D952AC373FA2D7B80DC7F6 dt(lw
143,594,345 *0DCEC9B823294BDC03D952AC373FA2D7B80DC7F6 d"t)n
143,594,346 *0DC58936F4283C6A62CE41004121AE3C3EA74490 d"t)n
143,594,347 *0DC58936F4283C6A62CE41004121AE3C3EA74490 DTY-Z
143,594,348 *0DCA4A2F03C71F23A00E6158E053D2D22838DE79 DTY-Z
143,594,349 *0DCA4A2F03C71F23A00E6158E053D2D22838DE79 [email protected]
143,594,350 *0DC5B09CD026ABA98FE96194A5A9C6FB7B4D384F [email protected]
143,594,351 *0DC5B09CD026ABA98FE96194A5A9C6FB7B4D384F d_uh1
143,594,352 *0DC271C82E9BB368D522582835F494AD7FB618AF d_uh1
143,594,353 *0DC271C82E9BB368D522582835F494AD7FB618AF DUKE-SOLINUS With-all-my-heart,-I'll-gossip-at-this-feast.
143,594,354 *0DC095B9922089A5EC0D7D91F7C1344D48660A9B DUKE-SOLINUS With-all-my-heart,-I'll-gossip-at-this-feast.
143,594,355 *0DC095B9922089A5EC0D7D91F7C1344D48660A9B DUSK (NEXUS MIX) (FEAT BILLY)
143,594,356 *0DCC0858607BC7E837739712781B74A238FE5DF6 DUSK (NEXUS MIX) (FEAT BILLY)
143,594,357 *0DCC0858607BC7E837739712781B74A238FE5DF6 dusty.roy
143,594,358 *0DC57A0476E82CBF6481F2CC08DE4CB26C627B76 dusty.roy
143,594,359 *0DC57A0476E82CBF6481F2CC08DE4CB26C627B76 dvhha
143,594,360 *0DC2CD021BEDC958B5AB2ECDA0EB93C1C84396D9 dvhha
143,594,361 *0DC2CD021BEDC958B5AB2ECDA0EB93C1C84396D9 DVQAJ
143,594,362 *0DC53373B4C210D42414A98BF48130857FE37A20 DVQAJ
143,594,363 *0DC53373B4C210D42414A98BF48130857FE37A20 d.vqb
143,594,364 *0DC3CE95CE45D77158D650036245FBE5D413F83C d.vqb
143,594,365 *0DC3CE95CE45D77158D650036245FBE5D413F83C DWIGHTAUBRECHT
143,594,366 *0DC55FB39E6C4CB12E35EA84C552556D824BF613 DWIGHTAUBRECHT
143,594,367 *0DC55FB39E6C4CB12E35EA84C552556D824BF613 dwl(.
143,594,368 *0DCFAAEB3FF1C6738FB0BC5A4522F0433FD3CEF9 dwl(.
143,594,369 *0DCFAAEB3FF1C6738FB0BC5A4522F0433FD3CEF9 DWSP.
143,594,370 *0DCE3931D4C65F05C55FFB4AC3E0CFAC4255B223 DWSP.
143,594,371 *0DCE3931D4C65F05C55FFB4AC3E0CFAC4255B223 DX裁剪模式時為
143,594,372 *0DCC90E6922ADA5EC124D56CC449F660927CCCCA DX裁剪模式時為
143,594,373 *0DCC90E6922ADA5EC124D56CC449F660927CCCCA d:z"
143,594,374 *0DC32F02F3EC6F495ED3BD36F2CFF0E9C2B0CA9B d:z"
143,594,375 *0DC32F02F3EC6F495ED3BD36F2CFF0E9C2B0CA9B d(z=9
143,594,376 *0DC42350106F4062FC762D086971A95AA609CAE5 d(z=9
143,594,377 *0DC42350106F4062FC762D086971A95AA609CAE5 DZBDQ
143,594,378 *0DCC94421DF123025CC5F3E02E413486A0AD43BE DZBDQ
143,594,379 *0DCC94421DF123025CC5F3E02E413486A0AD43BE dzzx1
143,594,380 *0DC1206463FA27080C2BCA1DDEEC4B5223CF8A14 dzzx1
143,594,381 *0DC1206463FA27080C2BCA1DDEEC4B5223CF8A14 ebrz0
143,594,382 *0DC566303CBBC8A80F60C1C192595E18365D99A0 ebrz0
143,594,383 *0DC566303CBBC8A80F60C1C192595E18365D99A0 edward.mullin
143,594,384 *0DC9A45A1B3F9CF0335333C0A2ECA45E7D27883F edward.mullin
143,594,385 *0DC9A45A1B3F9CF0335333C0A2ECA45E7D27883F edwin.dare
143,594,386 *0DC475B4EEC1943F69F83972831DFD0221A2D575 edwin.dare
143,594,387 *0DC475B4EEC1943F69F83972831DFD0221A2D575 EERCLLIM
143,594,388 *0DCC8DF8650CFF85CB27F4C7B6A41E86E122288F EERCLLIM
143,594,389 *0DCC8DF8650CFF85CB27F4C7B6A41E86E122288F egin
143,594,390 *0DC4E12CD22B9B4F57FB3CDD5C3CF79F6D10FFAE egin
143,594,391 *0DC4E12CD22B9B4F57FB3CDD5C3CF79F6D10FFAE egitkale6
143,594,392 *0DCE6B7B1E7FE005B5593EE0050EC82BF53F1638 egitkale6
143,594,393 *0DCE6B7B1E7FE005B5593EE0050EC82BF53F1638 EINSTEINPLANET
143,594,394 *0DC47B38DF6E9903064BAB81955860B454B63F17 EINSTEINPLANET
143,594,395 *0DC47B38DF6E9903064BAB81955860B454B63F17 EISKALT”
143,594,396 *0DC7A063CD23427F79456A898C505ED6AB3D4A3A EISKALT”
143,594,397 *0DC7A063CD23427F79456A898C505ED6AB3D4A3A [email protected]
143,594,398 *0DCB1212FC71BCDBDA155D308418F1AB4C4CAD7A [email protected]
143,594,399 *0DCB1212FC71BCDBDA155D308418F1AB4C4CAD7A ELIAS.NORDLUND
143,594,400 *0DC38539C96DD9038C73143D61781757E8691251 ELIAS.NORDLUND
143,594,401 *0DC38539C96DD9038C73143D61781757E8691251 elizabeth.dicaro
143,594,402 *0DC1C8E4F62660590E6C2B51D182E429BDECA691 elizabeth.dicaro
143,594,403 *0DC1C8E4F62660590E6C2B51D182E429BDECA691 EL)OD
143,594,404 *0DCA92A8001AA9E66C417DDC6C2C35596C7321DE EL)OD
143,594,405 *0DCA92A8001AA9E66C417DDC6C2C35596C7321DE ELOXERETS3
143,594,406 *0DC0EFF8BE38060A0CF45BA0749266B010EA11AD ELOXERETS3
143,594,407 *0DC0EFF8BE38060A0CF45BA0749266B010EA11AD EMBALL
143,594,408 *0DC53FB74D265B91564ED339240E9FF532652225 EMBALL
143,594,409 *0DC53FB74D265B91564ED339240E9FF532652225 ENERISIN6
143,594,410 *0DCA1BEC0410ED0198EA4E302116FFD9E99F0ABC ENERISIN6
143,594,411 *0DCA1BEC0410ED0198EA4E302116FFD9E99F0ABC eo(ne
143,594,412 *0DC3E16A4870D4D3EE1B2430A3F7AAC28833D16C eo(ne
143,594,413 *0DC3E16A4870D4D3EE1B2430A3F7AAC28833D16C EPITASHES
143,594,414 *0DCDE776F568A4D0FA7A19E3E35CCB3A054C389C EPITASHES
143,594,415 *0DCDE776F568A4D0FA7A19E3E35CCB3A054C389C ERASMIAN!
143,594,416 *0DC1BD8EBC664AC0DDB2A8DA14259D0DE3A9281A ERASMIAN!
143,594,417 *0DC1BD8EBC664AC0DDB2A8DA14259D0DE3A9281A ERASMOTREDENNICK
143,594,418 *0DCD0206BD4B1E20DDE169E14B4681963E135CB9 ERASMOTREDENNICK
143,594,419 *0DCD0206BD4B1E20DDE169E14B4681963E135CB9 eregirfa1
143,594,420 *0DC07CF67BCA032C664F4EB5F1975B4B41D0172F eregirfa1
143,594,421 *0DC07CF67BCA032C664F4EB5F1975B4B41D0172F ERICGAP
143,594,422 *0DC48B6D3611E2EFD7E1540CBEBF952C4387954C ERICGAP
143,594,423 *0DC48B6D3611E2EFD7E1540CBEBF952C4387954C ERITREA-DIKDIK
143,594,424 *0DCC24CE201029CD646A791FA6C8E1ED5F6205E2 ERITREA-DIKDIK
143,594,425 *0DCC24CE201029CD646A791FA6C8E1ED5F6205E2 ERNEST.FARNWORTH
143,594,426 *0DC49A208A07A0B6985A7DA6DC7D8E97A00BDA7C ERNEST.FARNWORTH
143,594,427 *0DC49A208A07A0B6985A7DA6DC7D8E97A00BDA7C errolgrattelo
143,594,428 *0DC9304FA3E17399338E76BA42CFD84A0A1995C8 errolgrattelo
143,594,429 *0DC9304FA3E17399338E76BA42CFD84A0A1995C8 ESIATREK9
143,594,430 *0DC02677650AD2819D11D55EA64C20762CFDECE7 ESIATREK9
143,594,431 *0DC02677650AD2819D11D55EA64C20762CFDECE7 etalphtoed
143,594,432 *0DC6E473B318AD1176BE016CCA2ACB68B02427BB etalphtoed
143,594,433 *0DC6E473B318AD1176BE016CCA2ACB68B02427BB ETCO
143,594,434 *0DC2B5DF5AFA5EF949D382E4927C413CD3BCA3CB ETCO
143,594,435 *0DC2B5DF5AFA5EF949D382E4927C413CD3BCA3CB etgs"
143,594,436 *0DC56D7B2D1FBD58CE5CD874E38624FDA37CFF0A etgs"
143,594,437 *0DC56D7B2D1FBD58CE5CD874E38624FDA37CFF0A ETHAN.GILLECE
143,594,438 *0DC3083B9D7178C001F654CAE3D284C43FBDA304 ETHAN.GILLECE
143,594,439 *0DC3083B9D7178C001F654CAE3D284C43FBDA304 EUGEN1C4LLY
143,594,440 *0DC556E9CFB7C2D0053D51DB3A9A48F5428E87D3 EUGEN1C4LLY
143,594,441 *0DC556E9CFB7C2D0053D51DB3A9A48F5428E87D3 FABIAN.CZARTORYSKI
143,594,442 *0DC95A1EAA7A36A042D916D754EA7D9DEFB612C2 FABIAN.CZARTORYSKI
143,594,443 *0DC95A1EAA7A36A042D916D754EA7D9DEFB612C2 fb7p
143,594,444 *0DC0A16DA42DDF61F52F4CBBCD7E49C87D307B6F fb7p
143,594,445 *0DC0A16DA42DDF61F52F4CBBCD7E49C87D307B6F FBEXECLING
143,594,446 *0DCAD672400B6B469A93FF9338C829D4E91D360F FBEXECLING
143,594,447 *0DCAD672400B6B469A93FF9338C829D4E91D360F FELIX932
143,594,448 *0DC1E2392CBE14B5844FFB03807EA328A83E7342 FELIX932
143,594,449 *0DC1E2392CBE14B5844FFB03807EA328A83E7342 [email protected]
143,594,450 *0DCA1786A1592EBA9B58438FE3CD7D7CFB845861 [email protected]
143,594,451 *0DCA1786A1592EBA9B58438FE3CD7D7CFB845861 FERMINARATA
143,594,452 *0DCB95ACA5659776A6FB8447A3E0B93063117A94 FERMINARATA
143,594,453 *0DCB95ACA5659776A6FB8447A3E0B93063117A94 FITTONIS
143,594,454 *0DC242E2861EB7EC4DFE846CFDB3283544B5A3E9 FITTONIS
143,594,455 *0DC242E2861EB7EC4DFE846CFDB3283544B5A3E9 FL32666
143,594,456 *0DC830770E6BFDD89CBA45369B3DA7BE2CC20B00 FL32666
143,594,457 *0DC830770E6BFDD89CBA45369B3DA7BE2CC20B00 [email protected]
143,594,458 *0DCAEE5495391A5F1F6106139ECE43C514F7D0B7 [email protected]
143,594,459 *0DCAEE5495391A5F1F6106139ECE43C514F7D0B7 flip-top
143,594,460 *0DC735DFB9845A700E88C94FBA768C92C65327CA flip-top
143,594,461 *0DC735DFB9845A700E88C94FBA768C92C65327CA florentinounnasch
143,594,462 *0DCA2CAB695E3809F4B93503A9AE1DB3973D8FF7 florentinounnasch
143,594,463 *0DCA2CAB695E3809F4B93503A9AE1DB3973D8FF7 FLOYD.GAULDEN
143,594,464 *0DC1FAFBFE0500197F565053062A7EFAD79825E0 FLOYD.GAULDEN
143,594,465 *0DC1FAFBFE0500197F565053062A7EFAD79825E0 fortifieriez3
143,594,466 *0DC54FC6AE39BE18031BAAD732FF607A87DDC41D fortifieriez3
143,594,467 *0DC54FC6AE39BE18031BAAD732FF607A87DDC41D FOWLENES4
143,594,468 *0DC333F553C51D2E971A7FA6BA4D0B94F7566077 FOWLENES4
143,594,469 *0DC333F553C51D2E971A7FA6BA4D0B94F7566077 FRACJI
143,594,470 *0DC29C8C4BBEF9A1CF687160783F95ECED0012BB FRACJI
143,594,471 *0DC29C8C4BBEF9A1CF687160783F95ECED0012BB FRANK.ANGIOLELLI
143,594,472 *0DCB17680931C971594271206A9D1984837A5982 FRANK.ANGIOLELLI
143,594,473 *0DCB17680931C971594271206A9D1984837A5982 frattarolo
143,594,474 *0DC8ADCCFD8C86538BED9144A01EC5ED80858F25 frattarolo
143,594,475 *0DC8ADCCFD8C86538BED9144A01EC5ED80858F25 frederickdougharty
143,594,476 *0DCBE1D4A51BD42ECB751A93E700962F1ED46A76 frederickdougharty
143,594,477 *0DCBE1D4A51BD42ECB751A93E700962F1ED46A76 FREDRICKBYRGE
143,594,478 *0DC7E5D8AA1D23D2E27B57F62ABD1B3C78C1821E FREDRICKBYRGE
143,594,479 *0DC7E5D8AA1D23D2E27B57F62ABD1B3C78C1821E FREDRICLARSH
143,594,480 *0DCB53850D429E9263BD845A599592A1940A4B36 FREDRICLARSH
143,594,481 *0DCB53850D429E9263BD845A599592A1940A4B36 f?s
143,594,482 *0DCE077C40819B31605E89DC79ED2A253B84F240 f?s
143,594,483 *0DCE077C40819B31605E89DC79ED2A253B84F240 fuenfkamed
143,594,484 *0DCE027EE61C3396C93FF70F8B09925F055A1C26 fuenfkamed
143,594,485 *0DCE027EE61C3396C93FF70F8B09925F055A1C26 GABELWEIHERS
143,594,486 *0DCAE6F8BA859CDDA1E66FD3AA07FADF7301788A GABELWEIHERS
143,594,487 *0DCAE6F8BA859CDDA1E66FD3AA07FADF7301788A GALLEYPUNT1234
143,594,488 *0DC8E0C9E9EDCF989B86004E9517EC3B2AFF743C GALLEYPUNT1234
143,594,489 *0DC8E0C9E9EDCF989B86004E9517EC3B2AFF743C [email protected]
143,594,490 *0DC0EBB11ABED8636114A21FC79C8EB027669116 [email protected]
143,594,491 *0DC0EBB11ABED8636114A21FC79C8EB027669116 GARRET.LABARRIERE
143,594,492 *0DC51F3E8F6F02D1C1875B2D0FE72DCCE9F4DE11 GARRET.LABARRIERE
143,594,493 *0DC51F3E8F6F02D1C1875B2D0FE72DCCE9F4DE11 GARRETT-KECK
143,594,494 *0DC9D7EA8B3755FD04CC60CEFEFC2153305A7A2B GARRETT-KECK
143,594,495 *0DC9D7EA8B3755FD04CC60CEFEFC2153305A7A2B GASBEWAHRUNGSANSTALTEN
143,594,496 *0DC00ACCD1A676E20DE37374B3580E48FD632216 GASBEWAHRUNGSANSTALTEN
143,594,497 *0DC00ACCD1A676E20DE37374B3580E48FD632216 GENAROGAER
143,594,498 *0DC2E087BE88F11832153759CAFB2220261FFF42 GENAROGAER
143,594,499 *0DC2E087BE88F11832153759CAFB2220261FFF42 GEORGEANNE
143,594,500 *0DC58D6EF197D52850D320C272CC574FFDA798F0 GEORGEANNE
143,594,501 *0DC58D6EF197D52850D320C272CC574FFDA798F0 gethinsgrott
143,594,502 *0DCC50B5DB09CC6409E16B6C0764A32C97300C9F gethinsgrott
143,594,503 *0DCC50B5DB09CC6409E16B6C0764A32C97300C9F GITOFORMAT
143,594,504 *0DC8DA8FB5775C48931BA051341C40628F1A1EB3 GITOFORMAT
143,594,505 *0DC8DA8FB5775C48931BA051341C40628F1A1EB3 GK28
143,594,506 *0DCFB38CA5DDBC1228EB0EE37A2453F763149382 GK28
143,594,507 *0DCFB38CA5DDBC1228EB0EE37A2453F763149382 GLENN.VERRETT
143,594,508 *0DC9C27D0ED6B72491312CE97E54ABF5A522837C GLENN.VERRETT
143,594,509 *0DC9C27D0ED6B72491312CE97E54ABF5A522837C GNT7
143,594,510 *0DC28ADB17D0BADC9AF21A7C0B2C23C7D67A674F GOHKENGSWEE100520D
143,594,511 *0DC36A3AAAC5AC1685E7BF3DA04AF942F297342B GNT7
143,594,512 *0DC28ADB17D0BADC9AF21A7C0B2C23C7D67A674F GOHKENGSWEE100520D
143,594,513 *0DC36A3AAAC5AC1685E7BF3DA04AF942F297342B GR4MM4TIC4L3
143,594,514 *0DC7A4A8B876E32BB29DAA6C823B47EF7B200FDE GR4MM4TIC4L3
143,594,515 *0DC7A4A8B876E32BB29DAA6C823B47EF7B200FDE gradyeverroad
143,594,516 *0DC0567B1490B68351D063F74040F4C4669DA45C gradyeverroad
143,594,517 *0DC0567B1490B68351D063F74040F4C4669DA45C grafije0
143,594,518 *0DCCF924BF4F93C62647D910244BCDDC139168D7 grafije0
143,594,519 *0DCCF924BF4F93C62647D910244BCDDC139168D7 graiglush
143,594,520 *0DCC9F1528A05F3B80741BD69D0B9144B515AFFA graiglush
143,594,521 *0DCC9F1528A05F3B80741BD69D0B9144B515AFFA GRAVHUND
143,594,522 *0DC104110A94F5C7E83FB56430D5FFF78532AAB9 [email protected]
143,594,523 *0DC8FCF32E3B8E61476199EBD9A43873E2533C8D GREGG.VANGUNDY
143,594,524 *0DC46DA3D162D48206E9C57CE5218A7DE2EC17B9 GRAVHUND
143,594,525 *0DC104110A94F5C7E83FB56430D5FFF78532AAB9 [email protected]
143,594,526 *0DC8FCF32E3B8E61476199EBD9A43873E2533C8D [email protected]
143,594,527 *0DCEE3CB8AC89E80A33294EB30E78A65BCE3E31F GREGG.VANGUNDY
143,594,528 *0DC46DA3D162D48206E9C57CE5218A7DE2EC17B9 [email protected]
143,594,529 *0DCEE3CB8AC89E80A33294EB30E78A65BCE3E31F [email protected]
143,594,530 *0DC29A8E4D18421A654D3F0CF57EBD58DCB914D2 [email protected]48.NET
143,594,531 *0DC33F0A52B0329AA2D244DE5310F9B9B7EB2F5F [email protected]
143,594,532 *0DC29A8E4D18421A654D3F0CF57EBD58DCB914D2 [email protected]
143,594,533 *0DC33F0A52B0329AA2D244DE5310F9B9B7EB2F5F ha1rcap$
143,594,534 *0DC05F0A2B14D7B6FF913DDDED96FEB144A7F4D4 HALO-TU-PORTIER
143,594,535 *0DC5C9F1AF3F6C7AF303AE6F62CEF139502C8623 ha1rcap$
143,594,536 *0DC05F0A2B14D7B6FF913DDDED96FEB144A7F4D4 HANSKÉHO
143,594,537 *0DCDB24DF21A9D944720A5819FD712DA30D29F31 HANSNIBLACK
143,594,538 *0DCFB861BD9A4A1701DAB1BE7263EBBC109D05A9 HALO-TU-PORTIER
143,594,539 *0DC5C9F1AF3F6C7AF303AE6F62CEF139502C8623 HANSKÉHO
143,594,540 *0DCDB24DF21A9D944720A5819FD712DA30D29F31 HANSNIBLACK
143,594,541 *0DCFB861BD9A4A1701DAB1BE7263EBBC109D05A9 HARRISHAMLER
143,594,542 *0DCE55C23C2478B4C53EC0CA1F31015784ECFE32 [email protected]
143,594,543 *0DC4AD46A2A6A1BEF29A6615DCB6A745DCD91F93 HAVIKSBEK
143,594,544 *0DC5C27E24AADDAACC25CAD72F47A2D839D71AC2 HARRISHAMLER
143,594,545 *0DCE55C23C2478B4C53EC0CA1F31015784ECFE32 Hazeremon.Una.Merenda
143,594,546 *0DCE69BA22071F9EDFFFD460CBECBB5632BC8250 [email protected]
143,594,547 *0DC4AD46A2A6A1BEF29A6615DCB6A745DCD91F93 HE"
143,594,548 *0DC1F4042CB503F33BE3CC74FF9DD17764F9DA3E HAVIKSBEK
143,594,549 *0DC5C27E24AADDAACC25CAD72F47A2D839D71AC2 hear'st
143,594,550 *0DCB117A6C6B1EC060570A0DDC5E27C3CF6A1B1D HEATHCABANILLAS
143,594,551 *0DC6825F591CF52C3833597DF404D0E29A3F41A6 Hazeremon.Una.Merenda
143,594,552 *0DCE69BA22071F9EDFFFD460CBECBB5632BC8250 HECTOST0
143,594,553 *0DC060861684267D891EA9907339C52CF519E0A2 HE"
143,594,554 *0DC1F4042CB503F33BE3CC74FF9DD17764F9DA3E hear'st
143,594,555 *0DCB117A6C6B1EC060570A0DDC5E27C3CF6A1B1D HEATHCABANILLAS
143,594,556 *0DC6825F591CF52C3833597DF404D0E29A3F41A6 HECTOST0
143,594,557 *0DC060861684267D891EA9907339C52CF519E0A2 henryhuertas
143,594,558 *0DCD2E90768D905C9B831926CF548E178A52C6AA HERADEMD
143,594,559 *0DC184B86DF8772FA8958FA5F4DD53289776348C henryhuertas
143,594,560 *0DCD2E90768D905C9B831926CF548E178A52C6AA HERADEMD
143,594,561 *0DC184B86DF8772FA8958FA5F4DD53289776348C HKKERUPS8
143,594,562 *0DC0C30674EF060660A192A8A911957BADDCD4C9 HKKERUPS8
143,594,563 *0DC0C30674EF060660A192A8A911957BADDCD4C9 holliscamejo
143,594,564 *0DC4D94EF52413043CACACA496E1D8FD979545B8 holliscamejo
143,594,565 *0DC4D94EF52413043CACACA496E1D8FD979545B8 HOMERHIPOLITO
143,594,566 *0DCD17B921AB3071B86CAF16F4FFD890ADE0727C HOMERHIPOLITO
143,594,567 *0DCD17B921AB3071B86CAF16F4FFD890ADE0727C hongpeteuil
143,594,568 *0DC1D1F6639F1D774EE77B016475FA2FA5745FE2 hongpeteuil
143,594,569 *0DC1D1F6639F1D774EE77B016475FA2FA5745FE2 hoytpruskowski
143,594,570 *0DCF14FDE178856073AA1F8BCF8B0BC3C55B205F hoytpruskowski
143,594,571 *0DCF14FDE178856073AA1F8BCF8B0BC3C55B205F hoyvoyaasesinarte
143,594,572 *0DCF9D4B190ED189A8E5A39311AB92AD6A862637 hoyvoyaasesinarte
143,594,573 *0DCF9D4B190ED189A8E5A39311AB92AD6A862637 httpwwwdashinfashio
143,594,574 *0DCE2C6F043259C34E240D3220172FE3D763AB64 httpwwwdashinfashio
143,594,575 *0DCE2C6F043259C34E240D3220172FE3D763AB64 HUF6
143,594,576 *0DCF90B17FBA8D44AC97FFD6EF351FDC9AA3A0E3 HUF6
143,594,577 *0DCF90B17FBA8D44AC97FFD6EF351FDC9AA3A0E3 HUNDREDSIF
143,594,578 *0DCA004C102521970B439F6C0C25E251A296EE6B HUNDREDSIF
143,594,579 *0DCA004C102521970B439F6C0C25E251A296EE6B i9!x
143,594,580 *0DC019FEBFBD13EAEA1148BB4043CEE757B6AFEF i9!x
143,594,581 *0DC019FEBFBD13EAEA1148BB4043CEE757B6AFEF [email protected]
143,594,582 *0DCF9EB363E6BA8AF7E8AF5DDFB9D981C31B548D [email protected]
143,594,583 *0DCF9EB363E6BA8AF7E8AF5DDFB9D981C31B548D ICEMANYUJI
143,594,584 *0DC1C71FF28BBA48F34066C3626AFE504D3E8D7B ICEMANYUJI
143,594,585 *0DC1C71FF28BBA48F34066C3626AFE504D3E8D7B IFIHADASONG:THESONGSOFPETESEEGER,VOLUME2
143,594,586 *0DC2D802E2532770C30BEAC93DAA4D4FC3D9DA1E IFIHADASONG:THESONGSOFPETESEEGER,VOLUME2
143,594,587 *0DC2D802E2532770C30BEAC93DAA4D4FC3D9DA1E ignaciofalker
143,594,588 *0DC888B3F242770AD5BEA9309D79A0088C1D65E5 ignaciofalker
143,594,589 *0DC888B3F242770AD5BEA9309D79A0088C1D65E5 IKE.TENZER
143,594,590 *0DC4A8E1F5E8C387D2ED664B2719B4378B3DC63E IKE.TENZER
143,594,591 *0DC4A8E1F5E8C387D2ED664B2719B4378B3DC63E ILAIZIPS
143,594,592 *0DCFF9AA03C0DA249B99F6083F94616153A10BAE ILAIZIPS
143,594,593 *0DCFF9AA03C0DA249B99F6083F94616153A10BAE ILUVBRYAN29
143,594,594 *0DCFE1327A46BBB5A8C9E8C2914605381910DF20 ILUVBRYAN29
143,594,595 *0DCFE1327A46BBB5A8C9E8C2914605381910DF20 imageny427.svg
143,594,596 *0DC81EF11AD787E6FD320A00F0F04CD6C1DEB371 imageny427.svg
143,594,597 *0DC81EF11AD787E6FD320A00F0F04CD6C1DEB371 {{imdbtitle|id=0085106|title=V(Originalmini-series)}}
143,594,598 *0DCC24EC5AD5EF9DD14C197AA519CE82D6DA7C80 {{imdbtitle|id=0085106|title=V(Originalmini-series)}}
143,594,599 *0DCC24EC5AD5EF9DD14C197AA519CE82D6DA7C80 INAUTTIDS
143,594,600 *0DC287F682F3F39CF6B68FCF59F080D96893F009 INAUTTIDS
143,594,601 *0DC287F682F3F39CF6B68FCF59F080D96893F009 INDVILGE5
143,594,602 *0DC0266907F70AEEA4386517F27E8645EF0B7D5A INDVILGE5
143,594,603 *0DC0266907F70AEEA4386517F27E8645EF0B7D5A INGEKERWE
143,594,604 *0DC38C572373DA3602C21BFDD794899F3CD28D49 INGEKERWE
143,594,605 *0DC38C572373DA3602C21BFDD794899F3CD28D49 INT-VELD
143,594,606 *0DC54A23DC4489B62D84D3A0C2F126E3740B21C0 INT-VELD
143,594,607 *0DC54A23DC4489B62D84D3A0C2F126E3740B21C0 INZUSCHICKENLY
143,594,608 *0DC471570E8571A66B80A27AA46EA4BE6FBD79B4 INZUSCHICKENLY
143,594,609 *0DC471570E8571A66B80A27AA46EA4BE6FBD79B4 ioiif
143,594,610 *0DC906F00D1B96047D1454E0775A74894B3935CC ioiif
143,594,611 *0DC906F00D1B96047D1454E0775A74894B3935CC I[email protected]
143,594,612 *0DC79935F732CA101ED51CB23386648197B6EA01 [email protected]
143,594,613 *0DC79935F732CA101ED51CB23386648197B6EA01 irvinglasalle
143,594,614 *0DC42F007306F5ED830C22230B38E09C38989880 irvinglasalle
143,594,615 *0DC42F007306F5ED830C22230B38E09C38989880 ISIAHMCKAMIE
143,594,616 *0DC46C71B4D972340FE6547C675F4F355853B5EA ISIAHMCKAMIE
143,594,617 *0DC46C71B4D972340FE6547C675F4F355853B5EA ISRAELSILLAVAN
143,594,618 *0DCDF6DE1A9E3D3E6127A10B18E04F636897D780 ISRAELSILLAVAN
143,594,619 *0DCDF6DE1A9E3D3E6127A10B18E04F636897D780 it)のパロディ曲“eat
143,594,620 *0DCB29A06B005C2FFD70276076E6B711D60A6F1B it)のパロディ曲“eat
143,594,621 *0DCB29A06B005C2FFD70276076E6B711D60A6F1B i-will-follow-(phatts-&-small-mutant-disco-vocal)
143,594,622 *0DCC57C5CB63EFBDE552D2B80CE2B043D32741D5 i-will-follow-(phatts-&-small-mutant-disco-vocal)
143,594,623 *0DCC57C5CB63EFBDE552D2B80CE2B043D32741D5 i.will.grow.in.love.with.you
143,594,624 *0DC09F96AFB142726E3BEACC4577A068E4E23831 i.will.grow.in.love.with.you
143,594,625 *0DC09F96AFB142726E3BEACC4577A068E4E23831 IYLSRD
143,594,626 *0DCE3479AE0EC9998FA42B34CD87BDB5C217A4B9 IYLSRD
143,594,627 *0DCE3479AE0EC9998FA42B34CD87BDB5C217A4B9 [email protected]
143,594,628 *0DC2FD7C90ECA3D59DF7B82471F5D58817927D5E [email protected]
143,594,629 *0DC2FD7C90ECA3D59DF7B82471F5D58817927D5E jacintorabsatt
143,594,630 *0DCF50AF450D6260F969F0181AC08E0E8EB7D657 jacintorabsatt
143,594,631 *0DCF50AF450D6260F969F0181AC08E0E8EB7D657 JACKGRAMMER
143,594,632 *0DC3D3A0BC71361BC2652E57E555426495A7BD23 JACKGRAMMER
143,594,633 *0DC3D3A0BC71361BC2652E57E555426495A7BD23 JACKIEAMORALES
143,594,634 *0DCA121C68074E15F7A904A989FA45CD8864AF94 JACKIEAMORALES
143,594,635 *0DCA121C68074E15F7A904A989FA45CD8864AF94 jaevntsed
143,594,636 *0DC245F85A659D0CF2420F74658BBAB82948D41B jaevntsed
143,594,637 *0DC245F85A659D0CF2420F74658BBAB82948D41B [email protected]
143,594,638 *0DCF03C873F2B94C8273B187DE8E53017A2FAC4D [email protected]
143,594,639 *0DCF03C873F2B94C8273B187DE8E53017A2FAC4D JAMÁDAGNI
143,594,640 *0DC58500D371AD47E300DFC7F15C4894CCE43D68 JAMÁDAGNI
143,594,641 *0DC58500D371AD47E300DFC7F15C4894CCE43D68 JAMAL.STROER
143,594,642 *0DC20CF9E6467CB77806B437FCA7A66577E2E4D4 JAMAL.STROER
143,594,643 *0DC20CF9E6467CB77806B437FCA7A66577E2E4D4 JAYPERESSINI
143,594,644 *0DC665305944ECE91EC098B68CAE01D1DD0331B5 JAYPERESSINI
143,594,645 *0DC665305944ECE91EC098B68CAE01D1DD0331B5 JEANFORSTING
143,594,646 *0DC3C00E21A406778A6A61B4474DD4046CF46760 JEANFORSTING
143,594,647 *0DC3C00E21A406778A6A61B4474DD4046CF46760 JEANNIE-BLANTON
143,594,648 *0DC2047CB554ED34BA573882359C5A36C779D6C5 JEANNIE-BLANTON
143,594,649 *0DC2047CB554ED34BA573882359C5A36C779D6C5 JEASLEY2007
143,594,650 *0DC0EA49E755CF3BF3B658763397546177D90522 JEASLEY2007
143,594,651 *0DC0EA49E755CF3BF3B658763397546177D90522 JEFFREY SOBERANO
143,594,652 *0DCBDBBFDBEB833D311BDAE1B03CDEF216816A32 JEFFREY SOBERANO
143,594,653 *0DCBDBBFDBEB833D311BDAE1B03CDEF216816A32 Jeg-husker-det-som-var-det-i-g
143,594,654 *0DC3C85023F754826510D45881428AD918152B38 Jeg-husker-det-som-var-det-i-g
143,594,655 *0DC3C85023F754826510D45881428AD918152B38 JENNIFERSHELTONARMSTRONG
143,594,656 *0DC3FA5B781B9628BBEB03395F3EFD347EED2946 JENNIFERSHELTONARMSTRONG
143,594,657 *0DC3FA5B781B9628BBEB03395F3EFD347EED2946 JEROLD.ZENKE
143,594,658 *0DCB5C00D1B7DE862CDF27032AB98F2FFF082CB6 JEROLD.ZENKE
143,594,659 *0DCB5C00D1B7DE862CDF27032AB98F2FFF082CB6 JEROMEHENDERLITE
143,594,660 *0DCE96993476ABF7B382D7B15C42344861B103DD JEROMEHENDERLITE
143,594,661 *0DCE96993476ABF7B382D7B15C42344861B103DD JESSICALIEBERMAN
143,594,662 *0DC6BE305B4D23ABDA0652F42D2EC406D1555A0B JESSICALIEBERMAN
143,594,663 *0DC6BE305B4D23ABDA0652F42D2EC406D1555A0B JESUS.ERIXON
143,594,664 *0DC1DD98AD64E51540AD10DFDAE8429EBD8FA8A9 JESUS.ERIXON
143,594,665 *0DC1DD98AD64E51540AD10DFDAE8429EBD8FA8A9 [email protected]
143,594,666 *0DC264E255C7054B0E0854EA6A4FBAC2314C63DD [email protected]
143,594,667 *0DC264E255C7054B0E0854EA6A4FBAC2314C63DD JFST
143,594,668 *0DCA0B25113FD4A818295E24C5EA6A95ED43B40A JFST
143,594,669 *0DCA0B25113FD4A818295E24C5EA6A95ED43B40A JIARUNGBBS
143,594,670 *0DC86183C81ADF0E7B6F5C351B10E419BDB105BC JIARUNGBBS
143,594,671 *0DC86183C81ADF0E7B6F5C351B10E419BDB105BC [email protected]
143,594,672 *0DCADB760A357E2036BDC74B8307529E948C014A [email protected]
143,594,673 *0DCADB760A357E2036BDC74B8307529E948C014A [email protected]
143,594,674 *0DC5CD3EA3BC185C64F613047D3F603D938D7079 [email protected]
143,594,675 *0DC5CD3EA3BC185C64F613047D3F603D938D7079 joevirden
143,594,676 *0DCAE19E92D4BE75F464294F20C3D2CC2A422A46 joevirden
143,594,677 *0DCAE19E92D4BE75F464294F20C3D2CC2A422A46 JOHN DOMINGOS
143,594,678 *0DC6D7CD0DCA1A4B33DC4643AAA2FC8B69F7737C JOHN DOMINGOS
143,594,679 *0DC6D7CD0DCA1A4B33DC4643AAA2FC8B69F7737C john.k.hill
143,594,680 *0DCC9FB6ED01FA14043E5AF41EEA7CE236DFBB1C john.k.hill
143,594,681 *0DCC9FB6ED01FA14043E5AF41EEA7CE236DFBB1C JOHNNIEKALINOWSKI
143,594,682 *0DCF331D9BFDE58E9DF625B9FC46EC65501E56FD JOHNNIEKALINOWSKI
143,594,683 *0DCF331D9BFDE58E9DF625B9FC46EC65501E56FD JOHNNYHORTON
143,594,684 *0DC20A9ED7F7B74366FAD3A1EA225BEFE6E6FB79 JOHNNYHORTON
143,594,685 *0DC20A9ED7F7B74366FAD3A1EA225BEFE6E6FB79 JONATHANRABY
143,594,686 *0DCE2D594E79DE2EE8E0706A93A7BD3EA76BAD31 JONATHANRABY
143,594,687 *0DCE2D594E79DE2EE8E0706A93A7BD3EA76BAD31 JOSHUA.VIVIAN
143,594,688 *0DC8787E810FFAE75B957F5E2B6C1D1687B0751D JOSHUA.VIVIAN
143,594,689 *0DC8787E810FFAE75B957F5E2B6C1D1687B0751D josiahpetrash
143,594,690 *0DC66BEB1F911C0FCFAEEAFC0A64E5ACDA745AB8 josiahpetrash
143,594,691 *0DC66BEB1F911C0FCFAEEAFC0A64E5ACDA745AB8 JOSIE FLESTADO
143,594,692 *0DC05E45E7E9512433E4B29DD1595598305BE2A2 JOSIE FLESTADO
143,594,693 *0DC05E45E7E9512433E4B29DD1595598305BE2A2 JOSPEHRAIL
143,594,694 *0DC554E915B23E7D4DD99FC20ED68F340E537859 JOSPEHRAIL
143,594,695 *0DC554E915B23E7D4DD99FC20ED68F340E537859 jrmafia19reals
143,594,696 *0DCD3F7CA3AB8AD60F0C7E1E22D412865BA77746 jrmafia19reals
143,594,697 *0DCD3F7CA3AB8AD60F0C7E1E22D412865BA77746 j{sk
143,594,698 *0DC2838CF257DB77FACC87146F9D3B95DE3A12E9 j{sk
143,594,699 *0DC2838CF257DB77FACC87146F9D3B95DE3A12E9 JUSTALITTLETIME(NODRUMSVERSION)
143,594,700 *0DC9A17D42E501259A400BCEE6D5D5F786E3279B JUSTALITTLETIME(NODRUMSVERSION)
143,594,701 *0DC9A17D42E501259A400BCEE6D5D5F786E3279B jywv
143,594,702 *0DCC281CCF5B6325027BAEF3573EB55B7C98A59C jywv
143,594,703 *0DCC281CCF5B6325027BAEF3573EB55B7C98A59C JZAGNY
143,594,704 *0DC7FA6040B1C2AC21BFBAF6E1C4C3DB43D16512 JZAGNY
143,594,705 *0DC7FA6040B1C2AC21BFBAF6E1C4C3DB43D16512 K01.752.256.830.650
143,594,706 *0DCF5053EC62DA2A4D0ACD0A30D26929B07FDF0D K01.752.256.830.650
143,594,707 *0DCF5053EC62DA2A4D0ACD0A30D26929B07FDF0D K060584
143,594,708 *0DCBBCDC764D6191786A30154F4EA52C8DD569B7 K060584
143,594,709 *0DCBBCDC764D6191786A30154F4EA52C8DD569B7 [email protected]
143,594,710 *0DC3C01874AD204111B0E981E5CB33813CDA525F [email protected]
143,594,711 *0DC3C01874AD204111B0E981E5CB33813CDA525F kaprí
143,594,712 *0DC3BDBD8D505DB2820EFCF8FEDBFB9E8FAA4FD8 kaprí
143,594,713 *0DC3BDBD8D505DB2820EFCF8FEDBFB9E8FAA4FD8 KARADARIA
143,594,714 *0DC59E59387CF49BF4F10EB6F1BCAB36EAE1B862 KARADARIA
143,594,715 *0DC59E59387CF49BF4F10EB6F1BCAB36EAE1B862 [email protected]
143,594,716 *0DC557E5C4F22D2283F21A054199CAFE3F67AC6B [email protected]
143,594,717 *0DC557E5C4F22D2283F21A054199CAFE3F67AC6B katecarvell
143,594,718 *0DCB4F27DBFB8460B7343CB8116A45BAA1C14E61 katecarvell
143,594,719 *0DCB4F27DBFB8460B7343CB8116A45BAA1C14E61 KEENAN.ANERTON
143,594,720 *0DC4AA225FE11C8D68E5E2054B3712C3973B4801 KEENAN.ANERTON
143,594,721 *0DC4AA225FE11C8D68E5E2054B3712C3973B4801 kendallreines
143,594,722 *0DC4CC101ECAAB6A751B3111B3A82AD5BDD540C9 kendallreines
143,594,723 *0DC4CC101ECAAB6A751B3111B3A82AD5BDD540C9 KENNITHAUDUONG
143,594,724 *0DCE14AB14EA98C37FA8D18DFDAFCA2A7DB13834 KENNITHAUDUONG
143,594,725 *0DCE14AB14EA98C37FA8D18DFDAFCA2A7DB13834 KERRYBUDIN
143,594,726 *0DC0215C48B7BF996AB69651C1011484F85066E4 KERRYBUDIN
143,594,727 *0DC0215C48B7BF996AB69651C1011484F85066E4 kingston.14
143,594,728 *0DCDBC48EC5A4D8059DC1D0B33273CE4A6445019 kingston.14
143,594,729 *0DCDBC48EC5A4D8059DC1D0B33273CE4A6445019 KIRK.LABARGE
143,594,730 *0DC685EBABFB8E2AE660B070001D010341703AA8 KIRK.LABARGE
143,594,731 *0DC685EBABFB8E2AE660B070001D010341703AA8 kitanabi
143,594,732 *0DCD8758DED82E707443CE3CD8E90F9B6EC6384D kitanabi
143,594,733 *0DCD8758DED82E707443CE3CD8E90F9B6EC6384D knickknack-N:-knickknacks
143,594,734 *0DC0362FCA567887FD070BDAB1ED191C531DB77C knickknack-N:-knickknacks
143,594,735 *0DC0362FCA567887FD070BDAB1ED191C531DB77C KNOG1ER
143,594,736 *0DCF8EA539890E22BD93F3A13A60CB9FA59E3AF0 KNOG1ER
143,594,737 *0DCF8EA539890E22BD93F3A13A60CB9FA59E3AF0 KOINOPRAKTIKOY
143,594,738 *0DC1A0CFA4732065A19297468AA3028DD30D27D8 KOINOPRAKTIKOY
143,594,739 *0DC1A0CFA4732065A19297468AA3028DD30D27D8 [email protected]
143,594,740 *0DC02E69F1D8EC9EFD5DD43246F93833307C280E [email protected]
143,594,741 *0DC02E69F1D8EC9EFD5DD43246F93833307C280E kookboeken
143,594,742 *0DC1E944A720B0C46E9A8BB8115FE9488334EA4D kookboeken
143,594,743 *0DC1E944A720B0C46E9A8BB8115FE9488334EA4D KOREYMATZEN
143,594,744 *0DCEC5A8A0FE273548561824E3005F97BCF5FD97 KOREYMATZEN
143,594,745 *0DCEC5A8A0FE273548561824E3005F97BCF5FD97 kotick?
143,594,746 *0DC4265E9D66EAC3A21E947392ADAB05B8EC07ED kotick?
143,594,747 *0DC4265E9D66EAC3A21E947392ADAB05B8EC07ED „KRADLER“
143,594,748 *0DC3B11A722A2A3DB9FD72DA38847AE23102A84C „KRADLER“
143,594,749 *0DC3B11A722A2A3DB9FD72DA38847AE23102A84C KRISTOPHER.BBS
143,594,750 *0DC3712BB791D5879E26685208C4C1DA0F7E990F KRISTOPHER.BBS
143,594,751 *0DC3712BB791D5879E26685208C4C1DA0F7E990F KROVOVOM9
143,594,752 *0DCFD170E75971593CDCED9DADBFF778D351AEDB KROVOVOM9
143,594,753 *0DCFD170E75971593CDCED9DADBFF778D351AEDB KURT.DOUD
143,594,754 *0DC11363C795C67CD134D2B03F41517A1CB61C85 KURT.DOUD
143,594,755 *0DC11363C795C67CD134D2B03F41517A1CB61C85 KURTLENZ
143,594,756 *0DCD88C92EE9D159AEE7C0EA5C25EB724A4A3931 KURTLENZ
143,594,757 *0DCD88C92EE9D159AEE7C0EA5C25EB724A4A3931 kurt.spies
143,594,758 *0DCA9B11FA07D63D6169CA28A8C78A2C0C8071EB kurt.spies
143,594,759 *0DCA9B11FA07D63D6169CA28A8C78A2C0C8071EB LA BASTIDE-D\ENGRAS
143,594,760 *0DC2A96C883C2C22E5F5BE5AEDBAB96FFCC7EDA4 LA BASTIDE-D\ENGRAS
143,594,761 *0DC2A96C883C2C22E5F5BE5AEDBAB96FFCC7EDA4 lacyapruzzese
143,594,762 *0DCD4513F4C3390B76DC37563C63DC812CF241E4 lacyapruzzese
143,594,763 *0DCD4513F4C3390B76DC37563C63DC812CF241E4 LADYRYDERTRUST
143,594,764 *0DCCA41BDB9FCEFACB981662F4FEF07888C9D17A LADYRYDERTRUST
143,594,765 *0DCCA41BDB9FCEFACB981662F4FEF07888C9D17A lamborghiniv12
143,594,766 *0DCBE3FED0FC8A80A2EF8AB8D7A10D0334406625 lamborghiniv12
143,594,767 *0DCBE3FED0FC8A80A2EF8AB8D7A10D0334406625 LAMPREYS
143,594,768 *0DC4CDDDA5A0648E05373E681DC09BC0C832D27C LAMPREYS
143,594,769 *0DC4CDDDA5A0648E05373E681DC09BC0C832D27C laurel.and.hardy.laughtoons.(kooky.koo-koo)
143,594,770 *0DC911D4583461B68037F86CB20FE639C343AF98 laurel.and.hardy.laughtoons.(kooky.koo-koo)
143,594,771 *0DC911D4583461B68037F86CB20FE639C343AF98 lc7156
143,594,772 *0DC62982950A67849E0B2D2BF3F1FC1136B1EFC9 lc7156
143,594,773 *0DC62982950A67849E0B2D2BF3F1FC1136B1EFC9 leanne-and-coral
143,594,774 *0DC83CA912E2995BD28791EFADE9B1E1D6A16964 leanne-and-coral
143,594,775 *0DC83CA912E2995BD28791EFADE9B1E1D6A16964 leesutliff
143,594,776 *0DC12E427224D06F135A939F0F979F7ECA64C5DD leesutliff
143,594,777 *0DC12E427224D06F135A939F0F979F7ECA64C5DD lemon.pan
143,594,778 *0DC22F70B5F4494DFDE3AF01A6181FB5D1F5C0E0 lemon.pan
143,594,779 *0DC22F70B5F4494DFDE3AF01A6181FB5D1F5C0E0 LEMUELRACHELL
143,594,780 *0DCFD06D8B4EEA6206CB9C622D96F43DA68F3671 LEMUELRACHELL
143,594,781 *0DCFD06D8B4EEA6206CB9C622D96F43DA68F3671 leninskkouznetski
143,594,782 *0DC426DDAC2D6DE0846E2F0EAEDCF09A6D3353A0 leninskkouznetski
143,594,783 *0DC426DDAC2D6DE0846E2F0EAEDCF09A6D3353A0 LEO.DARAKJY
143,594,784 *0DCF381820E51317A6574B02DD7D7836E79F1A08 LEO.DARAKJY
143,594,785 *0DCF381820E51317A6574B02DD7D7836E79F1A08 LEONARDO.CREGAR
143,594,786 *0DC7248E980D3898B6E413FB937C0B22FF310D35 LEONARDO.CREGAR
143,594,787 *0DC7248E980D3898B6E413FB937C0B22FF310D35 LEOPOLDO.BRZYCKI
143,594,788 *0DCA566A13FF4AEEDB95BC5CC4688A6B831D8B22 LEOPOLDO.BRZYCKI
143,594,789 *0DCA566A13FF4AEEDB95BC5CC4688A6B831D8B22 leslie-doyle
143,594,790 *0DCAC802B9F878CBF0E728326ABB8E5E74E29A81 leslie-doyle
143,594,791 *0DCAC802B9F878CBF0E728326ABB8E5E74E29A81 LEWINDOWSKI
143,594,792 *0DCBF75F154FA2EFBC37AB381FCD10EAA6EE926B LEWINDOWSKI
143,594,793 *0DCBF75F154FA2EFBC37AB381FCD10EAA6EE926B lexy.johnson
143,594,794 *0DCE7F3750D1D15ECD84C7B530A7FA0CDA0D3871 lexy.johnson
143,594,795 *0DCE7F3750D1D15ECD84C7B530A7FA0CDA0D3871 Lgnaz.1
143,594,796 *0DC98B0B1D5B5C3E1B92BEE322547AB3F288A1F0 Lgnaz.1
143,594,797 *0DC98B0B1D5B5C3E1B92BEE322547AB3F288A1F0 libertyst135
143,594,798 *0DC01375BC1124FB46B49905846C7BE467824994 libertyst135
143,594,799 *0DC01375BC1124FB46B49905846C7BE467824994 LICHVKA4
143,594,800 *0DC2D7CE2399B85111FDDEC4900F9D1FA7BCD5F5 LICHVKA4
143,594,801 *0DC2D7CE2399B85111FDDEC4900F9D1FA7BCD5F5 lick.a.message
143,594,802 *0DCCE2CB7CCFBC41266197B37B62119B87EA5F4B lick.a.message
143,594,803 *0DCCE2CB7CCFBC41266197B37B62119B87EA5F4B [email protected]
143,594,804 *0DCD8DF05E17654C1005107861AD938F29669635 [email protected]
143,594,805 *0DCD8DF05E17654C1005107861AD938F29669635 [email protected],
143,594,806 *0DC492A05BE13DF65EC434DE707B07A0ADD53A2D [email protected],
143,594,807 *0DC492A05BE13DF65EC434DE707B07A0ADD53A2D LINWOOD.SCHWIEN
143,594,808 *0DC4C9C8D171EADFE32E93A1E5D82AA4E1DEC267 LINWOOD.SCHWIEN
143,594,809 *0DC4C9C8D171EADFE32E93A1E5D82AA4E1DEC267 [email protected]
143,594,810 *0DC7B292A09B65D99DA2675F938A2AFFA0816F5B [email protected]
143,594,811 *0DC7B292A09B65D99DA2675F938A2AFFA0816F5B [email protected]
143,594,812 *0DCCB28C439F6D41772BEC5931B1525B9BEA211D [email protected]
143,594,813 *0DCCB28C439F6D41772BEC5931B1525B9BEA211D [email protected]
143,594,814 *0DC339F3190A2EAB71FF3C78A710AD8575A433B0 [email protected]
143,594,815 *0DC339F3190A2EAB71FF3C78A710AD8575A433B0 [email protected]
143,594,816 *0DC704BA204316B3ACDF60EEC57125E7252D4CCA [email protected]
143,594,817 *0DC704BA204316B3ACDF60EEC57125E7252D4CCA LONELY(COURTCIRCUITMIX)
143,594,818 *0DC486ABC8B4A76152D04FCF5DFAEEA38812EDD9 LONELY(COURTCIRCUITMIX)
143,594,819 *0DC486ABC8B4A76152D04FCF5DFAEEA38812EDD9 lovelyforbes
143,594,820 *0DCDDD26A4BE9CE2B49451B20DA180ED5394EAB9 lovelyforbes
143,594,821 *0DCDDD26A4BE9CE2B49451B20DA180ED5394EAB9 loydorewiler
143,594,822 *0DC8BDAFCA12A83CA24CCE17D8E73ABE06F23814 loydorewiler
143,594,823 *0DC8BDAFCA12A83CA24CCE17D8E73ABE06F23814 LUCAS.DONTON
143,594,824 *0DCD1ED50C3F775E778948344EC8A46C6A90E4F7 LUCAS.DONTON
143,594,825 *0DCD1ED50C3F775E778948344EC8A46C6A90E4F7 lucasgrube
143,594,826 *0DCD9461DC485B990F8E08FE21B0B4536EA1F755 lucasgrube
143,594,827 *0DCD9461DC485B990F8E08FE21B0B4536EA1F755 LU K
143,594,828 *0DC34E67D65688FC763C7BE301624604B2A34455 LU K
143,594,829 *0DC34E67D65688FC763C7BE301624604B2A34455 MACTIBBY4
143,594,830 *0DC6670EB028AFC39892487CF746E43B1D1D5EB0 MACTIBBY4
143,594,831 *0DC6670EB028AFC39892487CF746E43B1D1D5EB0 MAGNETS:II.UKRAINFOLKSONG
143,594,832 *0DC11533FAD9A757A69E59F37380F9A1A6EBD0E5 MAGNETS:II.UKRAINFOLKSONG
143,594,833 *0DC11533FAD9A757A69E59F37380F9A1A6EBD0E5 MÁGUSBAN
143,594,834 *0DC60D0F7BF5A5B235A2A6ABBF778FADB85F49BA MÁGUSBAN
143,594,835 *0DC60D0F7BF5A5B235A2A6ABBF778FADB85F49BA maichishan
143,594,836 *0DCF90D8EB7214B63D72FAEE17E3F9B6FA867467 maichishan
143,594,837 *0DCF90D8EB7214B63D72FAEE17E3F9B6FA867467 MAISONNETTE8
143,594,838 *0DC91DCF0884B4C677A7DBDA1D5D852C78CD8BD0 MAISONNETTE8
143,594,839 *0DC91DCF0884B4C677A7DBDA1D5D852C78CD8BD0 malcolmbaudoin
143,594,840 *0DC40CC3DEB95D772CD589F8CB0B5D8F65FC45B2 malcolmbaudoin
143,594,841 *0DC40CC3DEB95D772CD589F8CB0B5D8F65FC45B2 MALCOMVIZCARRA
143,594,842 *0DC008E743DE7ED22C0693E1EE4BF57B014470BD MALCOMVIZCARRA
143,594,843 *0DC008E743DE7ED22C0693E1EE4BF57B014470BD MALENVAL
143,594,844 *0DC0FB18418DB559473B5CC3D203E861B4A2EF82 MALENVAL
143,594,845 *0DC0FB18418DB559473B5CC3D203E861B4A2EF82 MANATUIKSI
143,594,846 *0DC8F5084A1CDCD0D338FC27A64286A063AFE1CF MANATUIKSI
143,594,847 *0DC8F5084A1CDCD0D338FC27A64286A063AFE1CF manche.m
143,594,848 *0DC2D650F940AD2FD2881DD1064C867D2091AE4B manche.m
143,594,849 *0DC2D650F940AD2FD2881DD1064C867D2091AE4B MARCO.KLEINBERGER
143,594,850 *0DC3906EE6FC29FE0ABF226C0E7F2DE37013D35C MARCO.KLEINBERGER
143,594,851 *0DC3906EE6FC29FE0ABF226C0E7F2DE37013D35C MARGARITO.GALOW
143,594,852 *0DCF35BCAF2C2F515D95C80ED42B455585955A16 MARGARITO.GALOW
143,594,853 *0DCF35BCAF2C2F515D95C80ED42B455585955A16 marieclaudelaurin
143,594,854 *0DC7CEF6ABAD091906BC79D94160269681DA71C8 marieclaudelaurin
143,594,855 *0DC7CEF6ABAD091906BC79D94160269681DA71C8 MASTL1K3
143,594,856 *0DCD874D7307E834AA9B98D3FDCAB69D3F5564C4 MASTL1K3
143,594,857 *0DCD874D7307E834AA9B98D3FDCAB69D3F5564C4 MATTVAGLIENTY
143,594,858 *0DCD695AB8200FF72C353DE74D409E87AD2FA4B2 MATTVAGLIENTY
143,594,859 *0DCD695AB8200FF72C353DE74D409E87AD2FA4B2 mayesty_8
143,594,860 *0DCC878619029041DEA462B813F72C539C249006 mayesty_8
143,594,861 *0DCC878619029041DEA462B813F72C539C249006 MBUTTONED
143,594,862 *0DC3CC64A00510C68C94B81D704419ABA33ED39D MBUTTONED
143,594,863 *0DC3CC64A00510C68C94B81D704419ABA33ED39D MCHINJI6
143,594,864 *0DC4196DA3A98994B96B56F7719542F3102BFA42 MCHINJI6
143,594,865 *0DC4196DA3A98994B96B56F7719542F3102BFA42 MCMADKAT
143,594,866 *0DCF3FEDCFE5B089F5DEB3AC1020F35F02B55466 MCMADKAT
143,594,867 *0DCF3FEDCFE5B089F5DEB3AC1020F35F02B55466 mededeelzaam?
143,594,868 *0DCA96471A74DCBDFD6AB684DA7E25923B0202F0 mededeelzaam?
143,594,869 *0DCA96471A74DCBDFD6AB684DA7E25923B0202F0 MELBOURNEQUOT
143,594,870 *0DC5F020B65221A6AF72D79878F573070B309AFE MELBOURNEQUOT
143,594,871 *0DC5F020B65221A6AF72D79878F573070B309AFE MEMORIASTÄTTE
143,594,872 *0DCE8790E79EC538896E082E1DE8E5A288B4BFD1 MEMORIASTÄTTE
143,594,873 *0DCE8790E79EC538896E082E1DE8E5A288B4BFD1 metallproduktion(liveinkamenz,03.12.04)
143,594,874 *0DC3EF37E553C6B5FF39442B3BD428DD7B889D44 metallproduktion(liveinkamenz,03.12.04)
143,594,875 *0DC3EF37E553C6B5FF39442B3BD428DD7B889D44 meu.vicio.e.voce
143,594,876 *0DC8969112D0E6A61F8F5A6B0179CE2CD419B23A meu.vicio.e.voce
143,594,877 *0DC8969112D0E6A61F8F5A6B0179CE2CD419B23A michealsincell
143,594,878 *0DCB42395E70B707126C8102DBC85456BE832B80 michealsincell
143,594,879 *0DCB42395E70B707126C8102DBC85456BE832B80 “MICROCONSOLIDAMENTO”
143,594,880 *0DCE274E945044E3F5A37ACB9547519472EA7275 “MICROCONSOLIDAMENTO”
143,594,881 *0DCE274E945044E3F5A37ACB9547519472EA7275 MIGUEL.VANDEKIEFT
143,594,882 *0DCD18F4BDFD9C30FB22BECFE5325A53F7680D82 MIGUEL.VANDEKIEFT
143,594,883 *0DCD18F4BDFD9C30FB22BECFE5325A53F7680D82 MILES.KISIELEWSKI
143,594,884 *0DCC01253FE96BF6EAF75672204A47E03231D139 MILES.KISIELEWSKI
143,594,885 *0DCC01253FE96BF6EAF75672204A47E03231D139 MILFORDCOLCORD
143,594,886 *0DCBC81947D535D9950EB4A8346185DB4F317E45 MILFORDCOLCORD
143,594,887 *0DCBC81947D535D9950EB4A8346185DB4F317E45 MILITARY-FITNESS.MILITARY.COM
143,594,888 *0DCC22D7C8BEB503650D73FDB94898331454D074 MILITARY-FITNESS.MILITARY.COM
143,594,889 *0DCC22D7C8BEB503650D73FDB94898331454D074 mitternacht?
143,594,890 *0DCEA741DD8B26A8C524D2D327F9BDD0EE48E017 mitternacht?
143,594,891 *0DCEA741DD8B26A8C524D2D327F9BDD0EE48E017 MJRFRSIED
143,594,892 *0DCA0BD48B3E6FAAC829D2846F7E0D9CF775A4D9 MJRFRSIED
143,594,893 *0DCA0BD48B3E6FAAC829D2846F7E0D9CF775A4D9 mommydearest
143,594,894 *0DC9A26B8FC8B573D4978022B06401CCDAB2D869 mommydearest
143,594,895 *0DC9A26B8FC8B573D4978022B06401CCDAB2D869 MONSWILLÉROISES
143,594,896 *0DC936228B5F7E5C5B32B967E7FC67036D03CD69 MONSWILLÉROISES
143,594,897 *0DC936228B5F7E5C5B32B967E7FC67036D03CD69 MURRAYGUILFOYLE
143,594,898 *0DC380BCF8C6B81491DFCF883FC0E41C032CB7D0 MURRAYGUILFOYLE
143,594,899 *0DC380BCF8C6B81491DFCF883FC0E41C032CB7D0 mxvdbsw0
143,594,900 *0DC8E8D6B893D3748BDF935670796F4006A817B0 mxvdbsw0
143,594,901 *0DC8E8D6B893D3748BDF935670796F4006A817B0 MYASTHENIA ,M/AI//@/S'/T//I/N/I//@/
143,594,902 *0DCCFF69B2900AC25A69E9589153FF91DCCE3D73 MYASTHENIA ,M/AI//@/S'/T//I/N/I//@/
143,594,903 *0DCCFF69B2900AC25A69E9589153FF91DCCE3D73 MYCAVIL
143,594,904 *0DC0962BAFA98C25BA58EE57886921BDC106333F MYCAVIL
143,594,905 *0DC0962BAFA98C25BA58EE57886921BDC106333F myhedgehog92
143,594,906 *0DCCAF0CCA09A669A062563366924027D90804D8 myhedgehog92
143,594,907 *0DCCAF0CCA09A669A062563366924027D90804D8 MYSTISI3
143,594,908 *0DCF1AAA50F96D569D9693C19605F82206913501 MYSTISI3
143,594,909 *0DCF1AAA50F96D569D9693C19605F82206913501 MYSTUD09
143,594,910 *0DC31B5908CEDC93C17A8E6E024F4D015FB69482 MYSTUD09
143,594,911 *0DC31B5908CEDC93C17A8E6E024F4D015FB69482 N33G4RR4
143,594,912 *0DC9952E65E0392B3AB2588B2E9788EA857D4BFE N33G4RR4
143,594,913 *0DC9952E65E0392B3AB2588B2E9788EA857D4BFE NACHGEHOLTEM
143,594,914 *0DCF4B4D31953BAF1CFC7584FA46C544968C499D NACHGEHOLTEM
143,594,915 *0DCF4B4D31953BAF1CFC7584FA46C544968C499D NACQUES8
143,594,916 *0DC5FDBA379B7EE61BECDA37F964F6DECD2268A4 NACQUES8
143,594,917 *0DC5FDBA379B7EE61BECDA37F964F6DECD2268A4 NAOMI.PEREIRA
143,594,918 *0DCC5E234B62AEA1B2C2DDAC03FA4BCE9564CB4B NAOMI.PEREIRA
143,594,919 *0DCC5E234B62AEA1B2C2DDAC03FA4BCE9564CB4B NATHANIALFUSIK
143,594,920 *0DCF179B218C06C84CCBE5452461A9E285461FDE NATHANIALFUSIK
143,594,921 *0DCF179B218C06C84CCBE5452461A9E285461FDE NDUBLAX27
143,594,922 *0DC52BAE5C3270810F5FFD94D60211E0150638F6 NDUBLAX27
143,594,923 *0DC52BAE5C3270810F5FFD94D60211E0150638F6 NEDFEELREH
143,594,924 *0DC8E27CFEF54C32FEE4D18F9BE0FC20B056B65B NEDFEELREH
143,594,925 *0DC8E27CFEF54C32FEE4D18F9BE0FC20B056B65B NELLABSW
143,594,926 *0DCF9FC5C0F3FE82EB32C97167344A35A662440A NELLABSW
143,594,927 *0DCF9FC5C0F3FE82EB32C97167344A35A662440A next-gen's
143,594,928 *0DC470F1097924734DD2E89A93733CF379088478 next-gen's
143,594,929 *0DC470F1097924734DD2E89A93733CF379088478 ngoại.hôn
143,594,930 *0DC729B6A8DB17D6E6F583AE6708CB979E3036F4 ngoại.hôn
143,594,931 *0DC729B6A8DB17D6E6F583AE6708CB979E3036F4 NHAMBARYAN
143,594,932 *0DC73C34FB0FEB437ECD246C079C250FFC009ED3 NHAMBARYAN
143,594,933 *0DC73C34FB0FEB437ECD246C079C250FFC009ED3 nick-mcneely
143,594,934 *0DC665B87C77BE8B5C5A2B7CCFBECA8EEA3B28CB nick-mcneely
143,594,935 *0DC665B87C77BE8B5C5A2B7CCFBECA8EEA3B28CB NICKOLAS.MAHUNG
143,594,936 *0DCC23DB194F4528D6EE1DA092AA7D72628264A2 NICKOLAS.MAHUNG
143,594,937 *0DCC23DB194F4528D6EE1DA092AA7D72628264A2 NICOLE BAXLEY
143,594,938 *0DC1FF8F2187C85C3C4971B81FEB865127943090 NICOLE BAXLEY
143,594,939 *0DC1FF8F2187C85C3C4971B81FEB865127943090 NIGELSAULTER
143,594,940 *0DCA619FA0723938CDF2C7D267BB634479205837 NIGELSAULTER
143,594,941 *0DCA619FA0723938CDF2C7D267BB634479205837 nixschei
143,594,942 *0DCFAA901A7E8804C41DDA213AAD7FCEBFCCD5B7 nixschei
143,594,943 *0DCFAA901A7E8804C41DDA213AAD7FCEBFCCD5B7 NOAHLAYLAND
143,594,944 *0DCB1ECD5C605760C467A6E2B596E11B9EA9D73B NOAHLAYLAND
143,594,945 *0DCB1ECD5C605760C467A6E2B596E11B9EA9D73B NOCTURNEING-MINOR(OP15NO.3)
143,594,946 *0DC5F1EDB612145AD5AC437B28CD07AC7BE03766 NOCTURNEING-MINOR(OP15NO.3)
143,594,947 *0DC5F1EDB612145AD5AC437B28CD07AC7BE03766 NOE.DEARDEN
143,594,948 *0DC0BBE23FDFAD6E5FE41E2B2379C7951F64CC30 NOE.DEARDEN
143,594,949 *0DC0BBE23FDFAD6E5FE41E2B2379C7951F64CC30 nolankozinski
143,594,950 *0DC6CD64B4E2D6165BF20598D552E212899966AB nolankozinski
143,594,951 *0DC6CD64B4E2D6165BF20598D552E212899966AB normandy1944infowww
143,594,952 *0DC0A15DF8D3EEBA7D002EE3BFA3E23C92DCA9DF normandy1944infowww
143,594,953 *0DC0A15DF8D3EEBA7D002EE3BFA3E23C92DCA9DF normansolonika
143,594,954 *0DCC825FF9287013DC4AEB10B8A7A7509E198FCB normansolonika
143,594,955 *0DCC825FF9287013DC4AEB10B8A7A7509E198FCB NUQ-
143,594,956 *0DC888671D6A83D913CEF4D05BF48624BE375ADA NUQ-
143,594,957 *0DC888671D6A83D913CEF4D05BF48624BE375ADA nwodwol7
143,594,958 *0DCBC697FAFCE2B989448B6CFC86EEBCCB5497E3 nwodwol7
143,594,959 *0DCBC697FAFCE2B989448B6CFC86EEBCCB5497E3 NYMLAL
143,594,960 *0DC75154AEFC37D4486D4CCD3F0933C3EC68B24F NYMLAL
143,594,961 *0DC75154AEFC37D4486D4CCD3F0933C3EC68B24F OBITUARIN
143,594,962 *0DC94700C5A08D1AFE47196BC1D0E00F720B1847 OBITUARIN
143,594,963 *0DC94700C5A08D1AFE47196BC1D0E00F720B1847 oconselhodafada
143,594,964 *0DCA9FDBDD5EA568A409BE743E28DA056DAD9FF0 oconselhodafada
143,594,965 *0DCA9FDBDD5EA568A409BE743E28DA056DAD9FF0 ODPLAVENO
143,594,966 *0DCBF1924CABE1329533A7F9E6A7F5EE95305F96 ODPLAVENO
143,594,967 *0DCBF1924CABE1329533A7F9E6A7F5EE95305F96 o)eu
143,594,968 *0DC7E384E5A19122AF997D21BD0B632A5110B86C o)eu
143,594,969 *0DC7E384E5A19122AF997D21BD0B632A5110B86C OJEKEMIA
143,594,970 *0DC0B9761BE8966743819DE24F281A35137318BA OJEKEMIA
143,594,971 *0DC0B9761BE8966743819DE24F281A35137318BA OLAJIDEJAMES
143,594,972 *0DC6E81F6F754E9699A113C13F1713131595454A OLAJIDEJAMES
143,594,973 *0DC6E81F6F754E9699A113C13F1713131595454A ÖLDÜRENIN
143,594,974 *0DCFFF7B950E3534AE90F6D887D5033F27BC1DBF ÖLDÜRENIN
143,594,975 *0DCFFF7B950E3534AE90F6D887D5033F27BC1DBF OLIVER.CANCER
143,594,976 *0DC20874AF98DB41564954CFBF0546FC9D312A4D OLIVER.CANCER
143,594,977 *0DC20874AF98DB41564954CFBF0546FC9D312A4D ONNOEMLIJK1
143,594,978 *0DCA0989BDB77B27F5E5A11E0C051A153DDA1E68 ONNOEMLIJK1
143,594,979 *0DCA0989BDB77B27F5E5A11E0C051A153DDA1E68 ontstelde
143,594,980 *0DCC1E0F568B34888DEDB85116CB73848401689F ontstelde
143,594,981 *0DCC1E0F568B34888DEDB85116CB73848401689F (~_^)[email protected]=8
143,594,982 *0DC8CBEAC90D2EC373D88DD11E69BFE4689817A0 (~_^)[email protected]=8
143,594,983 *0DC8CBEAC90D2EC373D88DD11E69BFE4689817A0 OSVALDO.GURNEE
143,594,984 *0DC227053343A9FC63E0A6174F26A3DB00FF9CBB OSVALDO.GURNEE
143,594,985 *0DC227053343A9FC63E0A6174F26A3DB00FF9CBB oyv+
143,594,986 *0DCFA5143BEA695D3423B2582199DBE094FBEB13 oyv+
143,594,987 *0DCFA5143BEA695D3423B2582199DBE094FBEB13 (^_~)***(====p
143,594,988 *0DC800FD5D3804519DD75E738D1B8D70E3136568 (^_~)***(====p
143,594,989 *0DC800FD5D3804519DD75E738D1B8D70E3136568 [email protected] ~0 ~o Splat
143,594,990 *0DC7283DF5E1819278EAFD76947F1F23CA712B7B [email protected] ~0 ~o Splat
143,594,991 *0DC7283DF5E1819278EAFD76947F1F23CA712B7B p------> * * * ~0~osploit
143,594,992 *0DC81E3B8BC504C574B80946767CEC8AA2F83D0A p------> * * * ~0~osploit
143,594,993 *0DC81E3B8BC504C574B80946767CEC8AA2F83D0A P4$7eurz470n
143,594,994 *0DC1F6E6EE6A9103FC64DE50367AA52411ABF711 P4$7eurz470n
143,594,995 *0DC1F6E6EE6A9103FC64DE50367AA52411ABF711 PARISOFF
143,594,996 *0DC012CE5B587B90E7BFF6314E6F812C582766F9 PARISOFF
143,594,997 *0DC012CE5B587B90E7BFF6314E6F812C582766F9 pasqualezevallos
143,594,998 *0DC35A66FC999D120157E40F7202279105CD4383 pasqualezevallos
143,594,999 *0DC35A66FC999D120157E40F7202279105CD4383 PCCADMIN2
143,595,000 *0DC694BC01F99C3F162FA02B03D1E5E6C50E6FF3 PCCADMIN2
143,595,001 *0DC694BC01F99C3F162FA02B03D1E5E6C50E6FF3 [email protected]
143,595,002 *0DCB783460EE52C9C2BF148E4BCE3CC218FE1138 [email protected]
143,595,003 *0DCB783460EE52C9C2BF148E4BCE3CC218FE1138 PERCYGUSZAK
143,595,004 *0DC1E076D4059C9E009E5CC9941F1561406E2F91 PERCYGUSZAK
143,595,005 *0DC1E076D4059C9E009E5CC9941F1561406E2F91 PHAMESHES
143,595,006 *0DC46DDFE55B1F0983D8FAF1FBA089FD80476F72 PHAMESHES
143,595,007 *0DC46DDFE55B1F0983D8FAF1FBA089FD80476F72 [email protected]
143,595,008 *0DCEFA16E620810A5F0368C64B4D81DB6996CD9B [email protected]
143,595,009 *0DCEFA16E620810A5F0368C64B4D81DB6996CD9B p-jean-fr
143,595,010 *0DCC6ABFE86813C9DFB91142435029729D5F3995 p-jean-fr
143,595,011 *0DCC6ABFE86813C9DFB91142435029729D5F3995 plantadeenergianuclearpilgrim
143,595,012 *0DCF7E4B74A87EF5B1786C9F30FEB8D227DDA878 plantadeenergianuclearpilgrim
143,595,013 *0DCF7E4B74A87EF5B1786C9F30FEB8D227DDA878 PLATFORM'[email protected]
143,595,014 *0DCD021FBFA5DEB9652ED21A9BECEE8F20678497 PLATFORM'[email protected]
143,595,015 *0DCD021FBFA5DEB9652ED21A9BECEE8F20678497 PLUG MYSELF IN (FEAT. MARK E. SMITH)
143,595,016 *0DCF43EFE1E133134CDE491D5C92CABFED358A5F PLUG MYSELF IN (FEAT. MARK E. SMITH)
143,595,017 *0DCF43EFE1E133134CDE491D5C92CABFED358A5F POLOPONY2007
143,595,018 *0DC61BDA4AED6E7202FFB18922A6373404973463 POLOPONY2007
143,595,019 *0DC61BDA4AED6E7202FFB18922A6373404973463 pp~0splat
143,595,020 *0DC26B097DCFA0E8CACD4B30E3DA6C5010B991A1 pp~0splat
143,595,021 *0DC26B097DCFA0E8CACD4B30E3DA6C5010B991A1 PR3NOTA$T3
143,595,022 *0DC7037B3C588DF289F88EA9AA647BFA9AA74653 PR3NOTA$T3
143,595,023 *0DC7037B3C588DF289F88EA9AA647BFA9AA74653 pratima.nepal
143,595,024 *0DCA5291ADC274346A637F8E588BDE064B3F1150 pratima.nepal
143,595,025 *0DCA5291ADC274346A637F8E588BDE064B3F1150 Precautionary.Steps
143,595,026 *0DCA61C50C7342E188B59D4C488108865034640D Precautionary.Steps
143,595,027 *0DCA61C50C7342E188B59D4C488108865034640D pulga951012
143,595,028 *0DC59E40B30F787F89981221AF264D947E729A70 pulga951012
143,595,029 *0DC59E40B30F787F89981221AF264D947E729A70 PURBIDA8
143,595,030 *0DC0B69F514B40A2EFEA15595E28DCA9F8A2E82E PURBIDA8
143,595,031 *0DC0B69F514B40A2EFEA15595E28DCA9F8A2E82E p---) * * *uu
143,595,032 *0DC717B8813912B7B804415743BE7524F82DBD80 p---) * * *uu
143,595,033 *0DC717B8813912B7B804415743BE7524F82DBD80 [email protected]
143,595,034 *0DCB3614127F13CC2C9EB38ADE1B445713F4F438 [email protected]
143,595,035 *0DCB3614127F13CC2C9EB38ADE1B445713F4F438 Q1R?
143,595,036 *0DC55C46778C77447776096A59521D807988E613 Q1R?
143,595,037 *0DC55C46778C77447776096A59521D807988E613 QARMA CHOIR
143,595,038 *0DC936EFF2C1BFC2606371151DC5FF6BE6960AEF QARMA CHOIR
143,595,039 *0DC936EFF2C1BFC2606371151DC5FF6BE6960AEF [email protected]
143,595,040 *0DC3D44B6BAF147BAC1D501756BC60021A77A416 [email protected]
143,595,041 *0DC3D44B6BAF147BAC1D501756BC60021A77A416 [email protected]
143,595,042 *0DCDBC7B1D4E901F45F843F1A9B4CAC7323E4DFB [email protected]
143,595,043 *0DCDBC7B1D4E901F45F843F1A9B4CAC7323E4DFB qu4dr00ns
143,595,044 *0DC74F9CC876FFB902E8DFADE1D3918EB1FA6062 qu4dr00ns
143,595,045 *0DC74F9CC876FFB902E8DFADE1D3918EB1FA6062 QUAKILY
143,595,046 *0DCB7765A2543608CCB122BA4E82B6E56D711E73 QUAKILY
143,595,047 *0DCB7765A2543608CCB122BA4E82B6E56D711E73 Quatrepoemes:IIIBenaresNaissancedeBouddha
143,595,048 *0DCAFD2E644F996FC9183DAD5876C3C01E739E92 Quatrepoemes:IIIBenaresNaissancedeBouddha
143,595,049 *0DCAFD2E644F996FC9183DAD5876C3C01E739E92 Q--->*-*-*(X)
143,595,050 *0DC95C693D55823E4251E35B77C8D8467830514A Q--->*-*-*(X)
143,595,051 *0DC95C693D55823E4251E35B77C8D8467830514A [email protected]
143,595,052 *0DCA8C656F16CF1D98C4AF9F944189D23B19C01A [email protected]
143,595,053 *0DCA8C656F16CF1D98C4AF9F944189D23B19C01A RADASHASH
143,595,054 *0DC3A4EEC2130422680ECEDA2FD28277595BAEB0 RADASHASH
143,595,055 *0DC3A4EEC2130422680ECEDA2FD28277595BAEB0 RAFAELBIRKENHOLZ
143,595,056 *0DC67E30281E82D18AEDB6984ADA40623A240962 RAFAELBIRKENHOLZ
143,595,057 *0DC67E30281E82D18AEDB6984ADA40623A240962 RAMKEN
143,595,058 *0DCFC714F3E41308165B9BD119981934BC5696D0 RAMKEN
143,595,059 *0DCFC714F3E41308165B9BD119981934BC5696D0 ramondove
143,595,060 *0DCC1093A01BB0ABBEAEDEF36816651F45181C25 ramondove
143,595,061 *0DCC1093A01BB0ABBEAEDEF36816651F45181C25 ramsbergmdta
143,595,062 *0DC2CDC44142714224846A74797561DB778E5DF3 ramsbergmdta
143,595,063 *0DC2CDC44142714224846A74797561DB778E5DF3 RASZTAN
143,595,064 *0DC02DBACD59CA836956E824787F934350F82BB6 RASZTAN
143,595,065 *0DC02DBACD59CA836956E824787F934350F82BB6 RATIONALISTIC
143,595,066 *0DC69CB333E46B91041F69C77CD4648BE5851DCA RATIONALISTIC
143,595,067 *0DC69CB333E46B91041F69C77CD4648BE5851DCA RAYMUNDOMEAGHER
143,595,068 *0DCA19E3E47CDAC132927C29B12852BBED4BCA67 RAYMUNDOMEAGHER
143,595,069 *0DCA19E3E47CDAC132927C29B12852BBED4BCA67 REGGIEHELVERSON
143,595,070 *0DCDC0850D96ACB5C0CB101DA790EAC0CA4B6DEB REGGIEHELVERSON
143,595,071 *0DCDC0850D96ACB5C0CB101DA790EAC0CA4B6DEB reidkauffeld
143,595,072 *0DC92FD1A809792C73CB9F29494E5B28A3BE1B37 reidkauffeld
143,595,073 *0DC92FD1A809792C73CB9F29494E5B28A3BE1B37 [email protected]
143,595,074 *0DCA97FCC62990D05B9914A1D87DDD9178724A9B [email protected]
143,595,075 *0DCA97FCC62990D05B9914A1D87DDD9178724A9B [email protected]
143,595,076 *0DC36D979DE1FB63FB66FB6D01965FEAE67CE620 [email protected]
143,595,077 *0DC36D979DE1FB63FB66FB6D01965FEAE67CE620 reroyalize9
143,595,078 *0DC9691BD255FAEEBE04BC14D88A61A02D0A8A55 reroyalize9
143,595,079 *0DC9691BD255FAEEBE04BC14D88A61A02D0A8A55 REYMORIARTY
143,595,080 *0DC9CC74A7BEC1FB8D86DF869E5E24001835106E REYMORIARTY
143,595,081 *0DC9CC74A7BEC1FB8D86DF869E5E24001835106E RIBBĪ
143,595,082 *0DCD21BFBC7E94E52C01CBE3E4384A7E04E985C5 RIBBĪ
143,595,083 *0DCD21BFBC7E94E52C01CBE3E4384A7E04E985C5 richardmccooey
143,595,084 *0DC14634E2999B4541B6EC0E420660F74F489C1B richardmccooey
143,595,085 *0DC14634E2999B4541B6EC0E420660F74F489C1B rickyvanderveer
143,595,086 *0DC42AC5C8D830B5D588F63F477F053DAFD1A0D1 rickyvanderveer
143,595,087 *0DC42AC5C8D830B5D588F63F477F053DAFD1A0D1 ricoalman
143,595,088 *0DCB6C3B5A2C60453DC5A29DD6CA832CB7AFB479 ricoalman
143,595,089 *0DCB6C3B5A2C60453DC5A29DD6CA832CB7AFB479 RILEY.GWYN
143,595,090 *0DC521E851A9C973F055E2B82C2245A85B72BE89 RILEY.GWYN
143,595,091 *0DC521E851A9C973F055E2B82C2245A85B72BE89 RIMGAILAI
143,595,092 *0DCFD86E3D1E2F25F50521A668AFDA9F3D935E93 RIMGAILAI
143,595,093 *0DCFD86E3D1E2F25F50521A668AFDA9F3D935E93 RISATUL ISLAM
143,595,094 *0DCA0225CF8DBA3A2E655146D383FE9B53609A92 RISATUL ISLAM
143,595,095 *0DCA0225CF8DBA3A2E655146D383FE9B53609A92 RITU NEB
143,595,096 *0DCE532BED9AFD5824D14DBB4246FF6884E020DB RITU NEB
143,595,097 *0DCE532BED9AFD5824D14DBB4246FF6884E020DB rmcglinc
143,595,098 *0DC49E6AB1A519890334A45BABB796E89536B0CC rmcglinc
143,595,099 *0DC49E6AB1A519890334A45BABB796E89536B0CC RMCRADICAL
143,595,100 *0DC49EE064550C4A211503D5DF30DDDB8086FBC8 RMCRADICAL
143,595,101 *0DC49EE064550C4A211503D5DF30DDDB8086FBC8 robertofurcron
143,595,102 *0DCD98A35EAC4E160CEACF4696BE68554B782F43 robertofurcron
143,595,103 *0DCD98A35EAC4E160CEACF4696BE68554B782F43 ROCKETIRISH4
143,595,104 *0DCE86C47B093B548747B06F27624CDCE7A32074 ROCKETIRISH4
143,595,105 *0DCE86C47B093B548747B06F27624CDCE7A32074 rockwell's
143,595,106 *0DC40E32648D3345325871CB02570CCC049FEA9A rockwell's
143,595,107 *0DC40E32648D3345325871CB02570CCC049FEA9A ROLF.NORDON
143,595,108 *0DCEAA48AE1A91931F65C0A8993BC512A5CC25B8 ROLF.NORDON
143,595,109 *0DCEAA48AE1A91931F65C0A8993BC512A5CC25B8 romanticが止まらない(オモシロmix)
143,595,110 *0DC993CC1088A50B8B451BB0B7C8A075A107B4F1 romanticが止まらない(オモシロmix)
143,595,111 *0DC993CC1088A50B8B451BB0B7C8A075A107B4F1 ROMEOBLYZES
143,595,112 *0DCFF261E8363F5CBF7E2DC85F695AAB5F5BC231 ROMEOBLYZES
143,595,113 *0DCFF261E8363F5CBF7E2DC85F695AAB5F5BC231 RONALDMCLERNON
143,595,114 *0DCF44EFF87018CEE07EA8355108EC236C0FF266 RONALDMCLERNON
143,595,115 *0DCF44EFF87018CEE07EA8355108EC236C0FF266 RONALDNEUWEG
143,595,116 *0DCD9CDE2BC0DDF2CA89BD9EEF025DE71AB0B1A9 RONALDNEUWEG
143,595,117 *0DCD9CDE2BC0DDF2CA89BD9EEF025DE71AB0B1A9 ronnielebeouf
143,595,118 *0DCD2918234C4DB6B2A8FBF9E446F6081C97AEFE ronnielebeouf
143,595,119 *0DCD2918234C4DB6B2A8FBF9E446F6081C97AEFE RON&RON
143,595,120 *0DCEF0D7700563C2BD62562B0EC644A305586B77 RON&RON
143,595,121 *0DCEF0D7700563C2BD62562B0EC644A305586B77 ROOSEVELTKAPINOS
143,595,122 *0DC1E54159E2D34BEA5BA084424B4E44E78DCD09 ROOSEVELTKAPINOS
143,595,123 *0DC1E54159E2D34BEA5BA084424B4E44E78DCD09 «rore»
143,595,124 *0DCE2DA9E752AA0D84AE27F54D5A16A96AF7D12F «rore»
143,595,125 *0DCE2DA9E752AA0D84AE27F54D5A16A96AF7D12F roryswett
143,595,126 *0DC9CF6C4767B8AB9748758958137741DCC8730D roryswett
143,595,127 *0DC9CF6C4767B8AB9748758958137741DCC8730D ROSENDOKASPRZAK
143,595,128 *0DCC9A72C99645A6E9D9FC7E570F78D631223DD7 ROSENDOKASPRZAK
143,595,129 *0DCC9A72C99645A6E9D9FC7E570F78D631223DD7 r~|q
143,595,130 *0DC42C98C4327426299751B4E115DF4A54B7E5C0 r~|q
143,595,131 *0DC42C98C4327426299751B4E115DF4A54B7E5C0 RQ8888R2
143,595,132 *0DC931B23D0950F82A89D4C1D29C91D3196BE8A4 RQ8888R2
143,595,133 *0DC931B23D0950F82A89D4C1D29C91D3196BE8A4 rupertswatt
143,595,134 *0DC6233F72049C0E2DB5A79F6D10B62FDFC7C4B8 rupertswatt
143,595,135 *0DC6233F72049C0E2DB5A79F6D10B62FDFC7C4B8 Ru$tc4t3d
143,595,136 *0DCD6BDF4C50756F4B45B4496D82F9822C3C6930 Ru$tc4t3d
143,595,137 *0DCD6BDF4C50756F4B45B4496D82F9822C3C6930 S3$P
143,595,138 *0DC09C5D1B135956AC747742EA5F10A07734F966 S3$P
143,595,139 *0DC09C5D1B135956AC747742EA5F10A07734F966 S890322
143,595,140 *0DC648DC269DC0DF4498088F58ADE86E4814EB12 S890322
143,595,141 *0DC648DC269DC0DF4498088F58ADE86E4814EB12 sadiespicer
143,595,142 *0DCF5C799D1645538FB0B467D9E666DF0A1B8C81 sadiespicer
143,595,143 *0DCF5C799D1645538FB0B467D9E666DF0A1B8C81 salladernas
143,595,144 *0DC6D9C184ECF308A260E9496FE1855B93D40778 salladernas
143,595,145 *0DC6D9C184ECF308A260E9496FE1855B93D40778 SCHATZMI4
143,595,146 *0DC5FD4B7D87F7DAABCCBC186B16063BCE6B6FB1 SCHATZMI4
143,595,147 *0DC5FD4B7D87F7DAABCCBC186B16063BCE6B6FB1 SCHEEPSTYPE5
143,595,148 *0DC2711A6EF9311E0AA951B2FC6CDCFF9B28EC55 SCHEEPSTYPE5
143,595,149 *0DC2711A6EF9311E0AA951B2FC6CDCFF9B28EC55 schlachthöfe«
143,595,150 *0DC3BE06DD2401B778DB95F3F475C4094C66B1EB schlachthöfe«
143,595,151 *0DC3BE06DD2401B778DB95F3F475C4094C66B1EB scottyashley
143,595,152 *0DC18E2F4608D84DA937CD8AF3CB8944A2CE324C scottyashley
143,595,153 *0DC18E2F4608D84DA937CD8AF3CB8944A2CE324C SEREBBULG
143,595,154 *0DC5B35EAC73B38FFBFD97180DA969CF603DEC09 SEREBBULG
143,595,155 *0DC5B35EAC73B38FFBFD97180DA969CF603DEC09 serenethong
143,595,156 *0DCBEC308A49A52BD5AB4920C9EF7F9A37E6F206 serenethong
143,595,157 *0DCBEC308A49A52BD5AB4920C9EF7F9A37E6F206 sessenelbatiusnu
143,595,158 *0DC562A5A6087A95F43845C0511E9FEB37D1CC9B sessenelbatiusnu
143,595,159 *0DC562A5A6087A95F43845C0511E9FEB37D1CC9B SETHCOLIN
143,595,160 *0DC5E45F06944C099D443EB07E48D3DD0BEC7F4B SETHCOLIN
143,595,161 *0DC5E45F06944C099D443EB07E48D3DD0BEC7F4B SHAWN.SHARROCK
143,595,162 *0DC2607E79C5E2C5DCC4FC3DEA1A3CC2F6C2E31B SHAWN.SHARROCK
143,595,163 *0DC2607E79C5E2C5DCC4FC3DEA1A3CC2F6C2E31B SHELBY.VICORY
143,595,164 *0DC19C6580D2B2798B550977219FCFEA7F0F631B SHELBY.VICORY
143,595,165 *0DC19C6580D2B2798B550977219FCFEA7F0F631B sheldonhockman
143,595,166 *0DC18735A8B2AD61DD52EC06553F9820EBB52676 sheldonhockman
143,595,167 *0DC18735A8B2AD61DD52EC06553F9820EBB52676 sheryl47
143,595,168 *0DCAE532964D674A73D5E51B8F7810AF41DE8F90 sheryl47
143,595,169 *0DCAE532964D674A73D5E51B8F7810AF41DE8F90 SHOTE.(THREW.WIT.MONEY)
143,595,170 *0DCCE6CD449E4BBC4A6053E2A35693FB2946DC3F SHOTE.(THREW.WIT.MONEY)
143,595,171 *0DCCE6CD449E4BBC4A6053E2A35693FB2946DC3F SHREWD-HEADED
143,595,172 *0DCDBDBB23C2DC79E4BCC6861332CCB6AFEFFF7E SHREWD-HEADED
143,595,173 *0DCDBDBB23C2DC79E4BCC6861332CCB6AFEFFF7E SHRINK-ZOO
143,595,174 *0DC9501CDAA90495A03AEC786BC885FE1FCA81BB SHRINK-ZOO
143,595,175 *0DC9501CDAA90495A03AEC786BC885FE1FCA81BB SHUVO.HOSSAIN
143,595,176 *0DC2FECFCF7E7B49F77BF02AB0C600E634701BFE SHUVO.HOSSAIN
143,595,177 *0DC2FECFCF7E7B49F77BF02AB0C600E634701BFE SIKKERHETSUNDERSØKELSE
143,595,178 *0DC900BD4817E74161754386BB64910BA3900658 SIKKERHETSUNDERSØKELSE
143,595,179 *0DC900BD4817E74161754386BB64910BA3900658 SIKLASTE
143,595,180 *0DC74C402492CF83DF43A5F912C2374DCAEA5643 SIKLASTE
143,595,181 *0DC74C402492CF83DF43A5F912C2374DCAEA5643 sittimtől
143,595,182 *0DCBCB80D58ECBC23E746869E55DDEDE069283CB sittimtől
143,595,183 *0DCBCB80D58ECBC23E746869E55DDEDE069283CB SLUTPUNKT2
143,595,184 *0DC6458C9B355C24840CA0CFE6701243F3F0AF9C SLUTPUNKT2
143,595,185 *0DC6458C9B355C24840CA0CFE6701243F3F0AF9C SMALOWITS
143,595,186 *0DC327F640EF8F55DE4E4C4CDAF068F23D5D48E3 SMALOWITS
143,595,187 *0DC327F640EF8F55DE4E4C4CDAF068F23D5D48E3 SMILENOTHINGGED
143,595,188 *0DC0E279C9CC927756F53A9F3F07009AB43C9AD9 SMILENOTHINGGED
143,595,189 *0DC0E279C9CC927756F53A9F3F07009AB43C9AD9 SMITHSINDIAN6
143,595,190 *0DCC7B4DAFC14DA6420EA84BB467FFDCBE58CB5C SMITHSINDIAN6
143,595,191 *0DCC7B4DAFC14DA6420EA84BB467FFDCBE58CB5C SNAPPLEJASON7
143,595,192 *0DC2992CB81EF2666692681EB6E6B2F4AF30F8E7 SNAPPLEJASON7
143,595,193 *0DC2992CB81EF2666692681EB6E6B2F4AF30F8E7 SODBLSTS
143,595,194 *0DCB968D1BE59B92C4A8DF01A0D194E4873BDCBA SODBLSTS
143,595,195 *0DCB968D1BE59B92C4A8DF01A0D194E4873BDCBA solomonbagnell
143,595,196 *0DC830E4B561978569B0C2E92B637010F72B849E solomonbagnell
143,595,197 *0DC830E4B561978569B0C2E92B637010F72B849E SOMALI-EXTREMISTS-POST-VIDEO-WARNING-TO-PEACEKEEPERS
143,595,198 *0DC3C0A7D0E6F1794624A4149B07F8E1CE795E10 SOMALI-EXTREMISTS-POST-VIDEO-WARNING-TO-PEACEKEEPERS
143,595,199 *0DC3C0A7D0E6F1794624A4149B07F8E1CE795E10 souspeconneusement
143,595,200 *0DCEB1F9054B0D18EF1418CD1F52C2D29D25767E souspeconneusement
143,595,201 *0DCEB1F9054B0D18EF1418CD1F52C2D29D25767E souzentoed
143,595,202 *0DC8EE9B563D95D8DFB2D5B3710440487B960A6B souzentoed
143,595,203 *0DC8EE9B563D95D8DFB2D5B3710440487B960A6B SPAINTOM
143,595,204 *0DC9D2270DE1CDEA5A0F59F208B98A4409130C18 SPAINTOM
143,595,205 *0DC9D2270DE1CDEA5A0F59F208B98A4409130C18 SPANISHTRAINING
143,595,206 *0DC1DA608FBDF99ED0A982BB11909066A16BD4F6 SPANISHTRAINING
143,595,207 *0DC1DA608FBDF99ED0A982BB11909066A16BD4F6 SPIRALIZZARE6
143,595,208 *0DCC93AA8F95A07E9E29DD165E28C385B64A06B2 SPIRALIZZARE6
143,595,209 *0DCC93AA8F95A07E9E29DD165E28C385B64A06B2 SPIRITKOALA
143,595,210 *0DC0669C4D52F6F4C95AE5E35518D0CB691EF2CF SPIRITKOALA
143,595,211 *0DC0669C4D52F6F4C95AE5E35518D0CB691EF2CF splato~0~ (--b
143,595,212 *0DC288C2A2ECAAD661081BF8A4151033391D8C4D splato~0~ (--b
143,595,213 *0DC288C2A2ECAAD661081BF8A4151033391D8C4D SPONGEOSITY7
143,595,214 *0DCDE845B18005A49B1BCAF8BC11CF7CE5377FF6 SPONGEOSITY7
143,595,215 *0DCDE845B18005A49B1BCAF8BC11CF7CE5377FF6 ssdhillon
143,595,216 *0DCBD22A87201EBA1F242A549D5EEC08B11D9E90 ssdhillon
143,595,217 *0DCBD22A87201EBA1F242A549D5EEC08B11D9E90 ssigkeitsgrenzen
143,595,218 *0DC1959FEDB086E85AAB3D25A843E0019E3A6C69 ssigkeitsgrenzen
143,595,219 *0DC1959FEDB086E85AAB3D25A843E0019E3A6C69 STANTONREDDOUT
143,595,220 *0DC1A40AE3C8CC2D9B4139D8536C49457E9A60AE STANTONREDDOUT
143,595,221 *0DC1A40AE3C8CC2D9B4139D8536C49457E9A60AE STANTONRITZIE
143,595,222 *0DC0FE5618211B23722997547C62AD4BCC8486BE STANTONRITZIE
143,595,223 *0DC0FE5618211B23722997547C62AD4BCC8486BE STEELWORKS,SEAANDSKY
143,595,224 *0DC293AAEBC02FD94B7E7039E527AE1ACFD67F98 STEELWORKS,SEAANDSKY
143,595,225 *0DC293AAEBC02FD94B7E7039E527AE1ACFD67F98 störchereichtum
143,595,226 *0DC1BE6E54DE969A8BB9FF0EAA09225DD0AD2475 störchereichtum
143,595,227 *0DC1BE6E54DE969A8BB9FF0EAA09225DD0AD2475 STRNUL
143,595,228 *0DCD5F7A595834D24D4A52532BA4A753D029D1F0 STRNUL
143,595,229 *0DCD5F7A595834D24D4A52532BA4A753D029D1F0 STURGEN1
143,595,230 *0DCF0490A0AFB9B13F1999695E00C21F961FAB49 STURGEN1
143,595,231 *0DCF0490A0AFB9B13F1999695E00C21F961FAB49 [email protected]
143,595,232 *0DC07E67C768989EB1B4801F158F5BBA3A84CFBC [email protected]
143,595,233 *0DC07E67C768989EB1B4801F158F5BBA3A84CFBC Subs++u+ab1+3s
143,595,234 *0DC7DCD038AE46F8BD4940736063DD3C7CE556E8 Subs++u+ab1+3s
143,595,235 *0DC7DCD038AE46F8BD4940736063DD3C7CE556E8 SUIJUNKA4
143,595,236 *0DCE6BC62953136208396E820C5FF564CB2EF853 SUIJUNKA4
143,595,237 *0DCE6BC62953136208396E820C5FF564CB2EF853 SuitePee.(live)
143,595,238 *0DC383B094249532612231062EB30BB1A93BC5F1 SuitePee.(live)
143,595,239 *0DC383B094249532612231062EB30BB1A93BC5F1 [email protected]
143,595,240 *0DC2F13F9573EC8568EE6F8019A5DE0A4486594C [email protected]
143,595,241 *0DC2F13F9573EC8568EE6F8019A5DE0A4486594C [email protected]
143,595,242 *0DC7F2456D01BC3FEB397DF2BEE906A6A1F0C49B [email protected]
143,595,243 *0DC7F2456D01BC3FEB397DF2BEE906A6A1F0C49B SUPER LADY CHARACTER ELEMENT B
143,595,244 *0DCFA5E143C3F033D4CD54BCB00BE8180EE6AC76 SUPER LADY CHARACTER ELEMENT B
143,595,245 *0DCFA5E143C3F033D4CD54BCB00BE8180EE6AC76 Superna70nal
143,595,246 *0DC9415A913D06431969D51A64832FAEC755A2EC Superna70nal
143,595,247 *0DC9415A913D06431969D51A64832FAEC755A2EC sutelly6
143,595,248 *0DC548A41B734D4BFCCADCB54B6CFFDAE64B47EC sutelly6
143,595,249 *0DC548A41B734D4BFCCADCB54B6CFFDAE64B47EC swiss-chem-soc
143,595,250 *0DC6FBF7A387157326D652A42F4BC699CF884B70 swiss-chem-soc
143,595,251 *0DC6FBF7A387157326D652A42F4BC699CF884B70 SYMPHONYNO.1INDMINOR"GOTHIC":III.VIVACE[PART7]
143,595,252 *0DC43853748D4B0EFB10DA6C5251ED085149E0B2 SYMPHONYNO.1INDMINOR"GOTHIC":III.VIVACE[PART7]
143,595,253 *0DC43853748D4B0EFB10DA6C5251ED085149E0B2 [email protected]
143,595,254 *0DCA6EEC78FC5875C4FE522D8FD05E97E038F4F4 [email protected]
143,595,255 *0DCA6EEC78FC5875C4FE522D8FD05E97E038F4F4 t15t35
143,595,256 *0DC5EF75D5AD83655F87E21E56F26E44CCA9338B t15t35
143,595,257 *0DC5EF75D5AD83655F87E21E56F26E44CCA9338B t83089
143,595,258 *0DC381F641EC5EFABD5FE8DE07E5B3829ACE3648 t83089
143,595,259 *0DC381F641EC5EFABD5FE8DE07E5B3829ACE3648 TADCIHON
143,595,260 *0DC7C7F11B6DDE4A5C7DE0C7BC2EEF084E5D3896 TADCIHON
143,595,261 *0DC7C7F11B6DDE4A5C7DE0C7BC2EEF084E5D3896 TALKANTISEMITIS_ACT
143,595,262 *0DCDCF504B6B2FD91A210ABB086AFE94A87D1505 TALKANTISEMITIS_ACT
143,595,263 *0DCDCF504B6B2FD91A210ABB086AFE94A87D1505 TALKLESLIE29
143,595,264 *0DCBA017052CC466A1973BB910B119CA84BADE32 TALKLESLIE29
143,595,265 *0DCBA017052CC466A1973BB910B119CA84BADE32 TALKMEMEARCHIVE_4
143,595,266 *0DCBED87B20882644490CD00462479C63FD8FD30 TALKMEMEARCHIVE_4
143,595,267 *0DCBED87B20882644490CD00462479C63FD8FD30 tamesen6
143,595,268 *0DC93EC90A4571D24963A1AA87D3C038F4456EC8 tamesen6
143,595,269 *0DC93EC90A4571D24963A1AA87D3C038F4456EC8 TAMEZ1125
143,595,270 *0DCECF55B924E46E248D02AD98104AB21DEEF4EE TAMEZ1125
143,595,271 *0DCECF55B924E46E248D02AD98104AB21DEEF4EE TAMPUZ
143,595,272 *0DC68C747CAE461906EA5F06ED627066C8D3CFC7 TAMPUZ
143,595,273 *0DC68C747CAE461906EA5F06ED627066C8D3CFC7 tardati0
143,595,274 *0DCE27688EB60BDBAE9CDE369752B92F03C113A9 tardati0
143,595,275 *0DCE27688EB60BDBAE9CDE369752B92F03C113A9 TARDISBADGER1
143,595,276 *0DC73C6B457049597D1F5EC01802AA90620D213B TARDISBADGER1
143,595,277 *0DC73C6B457049597D1F5EC01802AA90620D213B TARGETKITTY1
143,595,278 *0DC0560063066D057968FF9BDD5B905C13A358E6 TARGETKITTY1
143,595,279 *0DC0560063066D057968FF9BDD5B905C13A358E6 TBLADERT8
143,595,280 *0DCEEA61DB0E60199B3B9B7A5F9F109509F82D1D TBLADERT8
143,595,281 *0DCEEA61DB0E60199B3B9B7A5F9F109509F82D1D TEHNOLOGIJAMA6
143,595,282 *0DC606F890EBBF1D950F8082053B92C589BD76EB TEHNOLOGIJAMA6
143,595,283 *0DC606F890EBBF1D950F8082053B92C589BD76EB teletubbieshow
143,595,284 *0DC2C2C1560775D096B20A7198DD7020BF39A0A9 teletubbieshow
143,595,285 *0DC2C2C1560775D096B20A7198DD7020BF39A0A9 TEMERAS6
143,595,286 *0DC04AB589CE6DDE7F15256D962DCCC6BDF54120 TEMERAS6
143,595,287 *0DC04AB589CE6DDE7F15256D962DCCC6BDF54120 TEMPLIEN
143,595,288 *0DC85EF023BE0F1EF8A27E348CCFFE74605DD7A2 TEMPLIEN
143,595,289 *0DC85EF023BE0F1EF8A27E348CCFFE74605DD7A2 terrytanaka
143,595,290 *0DC669BF990A0971D0CACC61DFEB199A1782D3E0 terrytanaka
143,595,291 *0DC669BF990A0971D0CACC61DFEB199A1782D3E0 thaddeusbellavance
143,595,292 *0DCEAD9BA78BC697CB7ABD5B32C09DD345C556B0 thaddeusbellavance
143,595,293 *0DCEAD9BA78BC697CB7ABD5B32C09DD345C556B0 THAWANNL
143,595,294 *0DC8E566BFD1F791C587DC06272F8C6EF1B9F726 THAWANNL
143,595,295 *0DC8E566BFD1F791C587DC06272F8C6EF1B9F726 the.complete.stax-volt.singles:.1959-1968.(disc.3)
143,595,296 *0DCF96D184F1EEDBE2FF37E2CEC06AFF9F2741EE the.complete.stax-volt.singles:.1959-1968.(disc.3)
143,595,297 *0DCF96D184F1EEDBE2FF37E2CEC06AFF9F2741EE THEHIDDENFAMILY
143,595,298 *0DC0AE7F05450B8DB394EB654B618E5DDD7CD8B3 THEHIDDENFAMILY
143,595,299 *0DC0AE7F05450B8DB394EB654B618E5DDD7CD8B3 THE MAN FROM RIO
143,595,300 *0DCD4A0E5940A81B4C00B243D177FB23A3BE71FA THE MAN FROM RIO
143,595,301 *0DCD4A0E5940A81B4C00B243D177FB23A3BE71FA THE.NEW.POLLUTION.(REMIX.BY.MICKEY.P)
143,595,302 *0DCCDC1A8575AB217204CFCFB71329D6DBD8A5E5 THE.NEW.POLLUTION.(REMIX.BY.MICKEY.P)
143,595,303 *0DCCDC1A8575AB217204CFCFB71329D6DBD8A5E5 THEN & NOW (19821996: THE BEST OF FAIRPORT CONVENTION)
143,595,304 *0DCC876D83720BE18167DF1AACFF30562745C162 THEN & NOW (19821996: THE BEST OF FAIRPORT CONVENTION)
143,595,305 *0DCC876D83720BE18167DF1AACFF30562745C162 THUNDERMICHELE7
143,595,306 *0DC660D198BFA97499856BA4306C5B331E42A0B7 THUNDERMICHELE7
143,595,307 *0DC660D198BFA97499856BA4306C5B331E42A0B7 [email protected]
143,595,308 *0DC504169D7A265C0418CEB00DB2D21C924DAB7B [email protected]
143,595,309 *0DC504169D7A265C0418CEB00DB2D21C924DAB7B TIGHTFITBSW6
143,595,310 *0DC0E2C297D63CCA68E7B27AB79765C3BC07A7FF TIGHTFITBSW6
143,595,311 *0DC0E2C297D63CCA68E7B27AB79765C3BC07A7FF timothyfels
143,595,312 *0DC1A0A3463BB3AC4CB1741EEC215EAAE9E42EAA timothyfels
143,595,313 *0DC1A0A3463BB3AC4CB1741EEC215EAAE9E42EAA tintinnava5
143,595,314 *0DCA69E0DD21FBED6D5539985605A68BBA30CD42 tintinnava5
143,595,315 *0DCA69E0DD21FBED6D5539985605A68BBA30CD42 tmnsuuruine
143,595,316 *0DC9EC63BC892FDBCB85BB2F761E85677BB00AA7 tmnsuuruine
143,595,317 *0DC9EC63BC892FDBCB85BB2F761E85677BB00AA7 TMX:TM::.:::::::::::::::.::.:::::==HMI:::I:=MM
143,595,318 *0DC54AE6FE99F5DF93235B4286742E1F67376B1B TMX:TM::.:::::::::::::::.::.:::::==HMI:::I:=MM
143,595,319 *0DC54AE6FE99F5DF93235B4286742E1F67376B1B TNERERTIBRA
143,595,320 *0DC883179DD2CEAC783829D8F7625052C5B3F457 TNERERTIBRA
143,595,321 *0DC883179DD2CEAC783829D8F7625052C5B3F457 TPILAR
143,595,322 *0DCA32FE72CDA1DE9A8C8FD10F18517A2F387F42 TPILAR
143,595,323 *0DCA32FE72CDA1DE9A8C8FD10F18517A2F387F42 TRANSMITETI1234
143,595,324 *0DCE70B0187BB2FA98E995989845E9624F2A153F TRANSMITETI1234
143,595,325 *0DCE70B0187BB2FA98E995989845E9624F2A153F TREKJACHT
143,595,326 *0DC150A6A5237431134095EC109E3724B9A461E6 TREKJACHT
143,595,327 *0DC150A6A5237431134095EC109E3724B9A461E6 trenna4
143,595,328 *0DC591D014D2D339E0AA042DD0366A6641C9819A trenna4
143,595,329 *0DC591D014D2D339E0AA042DD0366A6641C9819A treytonames
143,595,330 *0DCF1E9B196F0A09D25A13FBE277387D436BCB72 treytonames
143,595,331 *0DCF1E9B196F0A09D25A13FBE277387D436BCB72 TRIKYM
143,595,332 *0DC084BDDBC03F0BC1A26E52D83CE8A8C2AEBFB1 TRIKYM
143,595,333 *0DC084BDDBC03F0BC1A26E52D83CE8A8C2AEBFB1 trmtllsm1
143,595,334 *0DCD44375600490BF84EFCD529773BF92943A1E6 trmtllsm1
143,595,335 *0DCD44375600490BF84EFCD529773BF92943A1E6 [email protected]
143,595,336 *0DCE7FC79C4B5B491432BBECA281984F32849E3D [email protected]
143,595,337 *0DCE7FC79C4B5B491432BBECA281984F32849E3D TROUBLE AT THE DOOR
143,595,338 *0DCD6AA5D82F04AAC93C514D7A52823A9E1737D0 TROUBLE AT THE DOOR
143,595,339 *0DCD6AA5D82F04AAC93C514D7A52823A9E1737D0 TSPRANZ
143,595,340 *0DCF5A12C22EA0EF5C53BE0442DCFF36A30CFE50 TSPRANZ
143,595,341 *0DCF5A12C22EA0EF5C53BE0442DCFF36A30CFE50 TSTOMSEG8
143,595,342 *0DC43104E146B0621F2F24F6F648965FE083E398 TSTOMSEG8
143,595,343 *0DC43104E146B0621F2F24F6F648965FE083E398 TUANQUAMMEN
143,595,344 *0DC0CEEF420CF9AE72D96A3D1437D24235428143 TUANQUAMMEN
143,595,345 *0DC0CEEF420CF9AE72D96A3D1437D24235428143 turb04cce
143,595,346 *0DC5B301707E31EA91CC91C617D524A44612DAC2 turb04cce
143,595,347 *0DC5B301707E31EA91CC91C617D524A44612DAC2 TURKILLESTON
143,595,348 *0DC51BA66CD1D72F761498E7AC7C39A020DFAB63 TURKILLESTON
143,595,349 *0DC51BA66CD1D72F761498E7AC7C39A020DFAB63 TURNKEYTRYAGAIN
143,595,350 *0DC3019A95FAC66EE3E6176E6024BF686F567010 TURNKEYTRYAGAIN
143,595,351 *0DC3019A95FAC66EE3E6176E6024BF686F567010 [email protected]
143,595,352 *0DC11E8B2A0A0A7F439F4E9A0DF0B51FD211F7ED [email protected]
143,595,353 *0DC11E8B2A0A0A7F439F4E9A0DF0B51FD211F7ED [email protected]
143,595,354 *0DC3AFFB2D7175C247BB42C001E912CF1E25DD8A [email protected]
143,595,355 *0DC3AFFB2D7175C247BB42C001E912CF1E25DD8A U8$A
143,595,356 *0DC8FF3E0CDF7837359CDFFA2BBAD5A3F67F7E81 U8$A
143,595,357 *0DC8FF3E0CDF7837359CDFFA2BBAD5A3F67F7E81 UBERHEADING
143,595,358 *0DC88059D11142BB33886D9862D2D73E70205104 UBERHEADING
143,595,359 *0DC88059D11142BB33886D9862D2D73E70205104 [email protected]
143,595,360 *0DC0C55182779B11A3AB967B9E7F2A680B3EC8B8 [email protected]
143,595,361 *0DC0C55182779B11A3AB967B9E7F2A680B3EC8B8 UEBERLASTENDES
143,595,362 *0DC3CFC9013C0328637BCCA44F9FCF9BF5835EBC UEBERLASTENDES
143,595,363 *0DC3CFC9013C0328637BCCA44F9FCF9BF5835EBC UHM.YONGSIK
143,595,364 *0DC223DE28FA94E32C3A722E62DDBD062B6679C5 UHM.YONGSIK
143,595,365 *0DC223DE28FA94E32C3A722E62DDBD062B6679C5 unblock-auto181137
143,595,366 *0DC77EE8332205BE4F255292D9A3DC0AEBC83D22 unblock-auto181137
143,595,367 *0DC77EE8332205BE4F255292D9A3DC0AEBC83D22 uncontiguous
143,595,368 *0DC4B55CBC78E31685D83F55747C8DEF340ADB4B uncontiguous
143,595,369 *0DC4B55CBC78E31685D83F55747C8DEF340ADB4B UNGEHORTERES7
143,595,370 *0DC1346F4283FFFF92AFA24C5A06F43DE96773FE UNGEHORTERES7
143,595,371 *0DC1346F4283FFFF92AFA24C5A06F43DE96773FE unsafe
143,595,372 *0DC9A2D01D6F5FE32908D54B09FCD39CBB3219CE unsafe
143,595,373 *0DC9A2D01D6F5FE32908D54B09FCD39CBB3219CE UNUNIĜO
143,595,374 *0DCE8EE0EB607BFC32D37AE4FF6F3DFC9410F1B5 UNUNIĜO
143,595,375 *0DCE8EE0EB607BFC32D37AE4FF6F3DFC9410F1B5 UPTATTOOTEARTEARDROPTERMINATETHE1
143,595,376 *0DCD9FA281D8B34FAB31429C6EA26B3D3C4045E5 UPTATTOOTEARTEARDROPTERMINATETHE1
143,595,377 *0DCD9FA281D8B34FAB31429C6EA26B3D3C4045E5 UREIC8
143,595,378 *0DCBB642C9A1630B74F8106D9126523A87C8BE9B UREIC8
143,595,379 *0DCBB642C9A1630B74F8106D9126523A87C8BE9B [email protected]
143,595,380 *0DC8D3735FE5E27D5AEF4C55554855CB15812BBC [email protected]
143,595,381 *0DC8D3735FE5E27D5AEF4C55554855CB15812BBC uu~-~q-8
143,595,382 *0DCF33FFE7D9F2694AECA76D29AC618AD4D04D09 uu~-~q-8
143,595,383 *0DCF33FFE7D9F2694AECA76D29AC618AD4D04D09 uvæ
143,595,384 *0DC7E74B992F150F0F432393F0B363D68758E350 uvæ
143,595,385 *0DC7E74B992F150F0F432393F0B363D68758E350 v5or1355
143,595,386 *0DCBFA268C8356DC4735690BB8520AF13D60825E v5or1355
143,595,387 *0DCBFA268C8356DC4735690BB8520AF13D60825E variationsonanurserysong,op25:risoluto
143,595,388 *0DCD42A02EC60C1C69B487CF479C9B5418F182B0 variationsonanurserysong,op25:risoluto
143,595,389 *0DCD42A02EC60C1C69B487CF479C9B5418F182B0 VARUN WAKANKAR
143,595,390 *0DC0B90878C9A41CE13E8F57FE596E01DF794040 VARUN WAKANKAR
143,595,391 *0DC0B90878C9A41CE13E8F57FE596E01DF794040 VAUGHNPRADA
143,595,392 *0DC2D6ECBD9085EAC01440B2BF073E0CA797F372 VAUGHNPRADA
143,595,393 *0DC2D6ECBD9085EAC01440B2BF073E0CA797F372 vcdkapaği
143,595,394 *0DC4797A42BD6A3827AAB4CFD20E489192EFBC1F vcdkapaği
143,595,395 *0DC4797A42BD6A3827AAB4CFD20E489192EFBC1F vdigital3
143,595,396 *0DC615401234A7A68EBEA2D101E75CE2088C7FF8 vdigital3
143,595,397 *0DC615401234A7A68EBEA2D101E75CE2088C7FF8 VEDAPUDI1
143,595,398 *0DCF99C5E14762FDF4F60D10C6E3522E55FA4065 VEDAPUDI1
143,595,399 *0DCF99C5E14762FDF4F60D10C6E3522E55FA4065 vegetaĵoj
143,595,400 *0DC421EF3D6F7E58BE7A7D0F8F04E0E00AF6901F vegetaĵoj
143,595,401 *0DC421EF3D6F7E58BE7A7D0F8F04E0E00AF6901F velleyeo
143,595,402 *0DCE9E34D3CB4EDBE97C44D6BCF97FC31E4C28FF velleyeo
143,595,403 *0DCE9E34D3CB4EDBE97C44D6BCF97FC31E4C28FF VERGEBT6
143,595,404 *0DC0AD2A5236EA55684F7CA76D21E4958CC4301B VERGEBT6
143,595,405 *0DC0AD2A5236EA55684F7CA76D21E4958CC4301B verndooling
143,595,406 *0DCF77554DD37E3AC4718E5F25FE22921CE9FEFB verndooling
143,595,407 *0DCF77554DD37E3AC4718E5F25FE22921CE9FEFB very.soon.everyone's.leaving
143,595,408 *0DC8C6C8760E8E78544181B9C2582D8F79E4CFCE very.soon.everyone's.leaving
143,595,409 *0DC8C6C8760E8E78544181B9C2582D8F79E4CFCE VIALEEN9
143,595,410 *0DCAED02F9C992DC1112CEADD240BD323E929DBC VIALEEN9
143,595,411 *0DCAED02F9C992DC1112CEADD240BD323E929DBC VIAZERBAIJAN
143,595,412 *0DC24D55265804C05CF7D9477C7FA844914CD3BD VIAZERBAIJAN
143,595,413 *0DC24D55265804C05CF7D9477C7FA844914CD3BD VIJAYNADKARNI
143,595,414 *0DC8FD12FF004BE89FAD44D7939214DCB1233F87 VIJAYNADKARNI
143,595,415 *0DC8FD12FF004BE89FAD44D7939214DCB1233F87 vincentdovalina
143,595,416 *0DC5F095C7396C07E543DA2F924529A53B1855DB vincentdovalina
143,595,417 *0DC5F095C7396C07E543DA2F924529A53B1855DB VINCENT.MAURELLI
143,595,418 *0DC3593CEC9415E8DCC9E297E0A58CB9C921FC6B VINCENT.MAURELLI
143,595,419 *0DC3593CEC9415E8DCC9E297E0A58CB9C921FC6B [email protected]
143,595,420 *0DC2E9344084169CC4FD6BD184AAABA030404319 [email protected]
143,595,421 *0DC2E9344084169CC4FD6BD184AAABA030404319 VIOLET.WOLFE
143,595,422 *0DCD08A50DD01F87D81A14356CBE417F8674EA9C VIOLET.WOLFE
143,595,423 *0DCD08A50DD01F87D81A14356CBE417F8674EA9C VIOLINCONCERTONO1INAMINOR,OP77:INOCTURNE
143,595,424 *0DC5254757653B074FC8B5E8F8FADE7964DF3F84 VIOLINCONCERTONO1INAMINOR,OP77:INOCTURNE
143,595,425 *0DC5254757653B074FC8B5E8F8FADE7964DF3F84 VIRTUOSONO3
143,595,426 *0DC9F267593EF2C74044CCFC5117E6FC5E1C62B9 VIRTUOSONO3
143,595,427 *0DC9F267593EF2C74044CCFC5117E6FC5E1C62B9 VITO.BILL
143,595,428 *0DC74829961E025337AE167412495417AD9306A4 VITO.BILL
143,595,429 *0DC74829961E025337AE167412495417AD9306A4 viviane.gygax
143,595,430 *0DC7C64712A52967D30FD0FA0E64E8DCC959C897 viviane.gygax
143,595,431 *0DC7C64712A52967D30FD0FA0E64E8DCC959C897 [email protected]!9r3tt3
143,595,432 *0DC91C338E210308ABCD5E22527F5A528A8498A4 [email protected]!9r3tt3
143,595,433 *0DC91C338E210308ABCD5E22527F5A528A8498A4 VRCHTLST7
143,595,434 *0DC55EC831F1D70EAD707148728C3E4F72986A4E VRCHTLST7
143,595,435 *0DC55EC831F1D70EAD707148728C3E4F72986A4E VULCANÓIDES
143,595,436 *0DC37A9DAAA92948C34A17A462CCE6B0A1B7C452 VULCANÓIDES
143,595,437 *0DC37A9DAAA92948C34A17A462CCE6B0A1B7C452 VXVZINJKVS
143,595,438 *0DCB4276B7F2AC1D885AFD5A047D5C398121A4A2 VXVZINJKVS
143,595,439 *0DCB4276B7F2AC1D885AFD5A047D5C398121A4A2 W4V13$7
143,595,440 *0DCA135F94D394CCE2B3D46A3375C59EEE89D020 W4V13$7
143,595,441 *0DCA135F94D394CCE2B3D46A3375C59EEE89D020 W93469
143,595,442 *0DC47E8ACCE4A11C6B1F0FB26F27849C907A349F W93469
143,595,443 *0DC47E8ACCE4A11C6B1F0FB26F27849C907A349F WAJIR RAIN
143,595,444 *0DC01B68A919E59164B1782DE4E8BB6B3ADB6B09 WAJIR RAIN
143,595,445 *0DC01B68A919E59164B1782DE4E8BB6B3ADB6B09 wallymarhefkasr
143,595,446 *0DC53CA65EDCBAA03AF2244420D8514A868D5AD3 wallymarhefkasr
143,595,447 *0DC53CA65EDCBAA03AF2244420D8514A868D5AD3 warfare-usa.a10,.2.fly.over.firing
143,595,448 *0DC44E8BD4AA695FEDC0AA9EAB8E8A22D0B0911A warfare-usa.a10,.2.fly.over.firing
143,595,449 *0DC44E8BD4AA695FEDC0AA9EAB8E8A22D0B0911A WAYNECARSTENS
143,595,450 *0DC738AFEA2D39E1188BEA82F5AEF687A9E50794 WAYNECARSTENS
143,595,451 *0DC738AFEA2D39E1188BEA82F5AEF687A9E50794 WENCESLAUSJUANIS
143,595,452 *0DCA7D48977CE93B0A6B93EB553878B9A3C2F41B WENCESLAUSJUANIS
143,595,453 *0DCA7D48977CE93B0A6B93EB553878B9A3C2F41B wertannas
143,595,454 *0DCA071EA43AC8399DB9F17854FAD925D2C489F1 wertannas
143,595,455 *0DCA071EA43AC8399DB9F17854FAD925D2C489F1 wesleyjet
143,595,456 *0DC6302EBC30C2EA1A6AB8DD39AAF0F8A1CB4F04 wesleyjet
143,595,457 *0DC6302EBC30C2EA1A6AB8DD39AAF0F8A1CB4F04 wikedgreasemonkeytobody
143,595,458 *0DC55C3EEBB05A684C0BB6C5732D47F04C149836 wikedgreasemonkeytobody
143,595,459 *0DC55C3EEBB05A684C0BB6C5732D47F04C149836 WIKI.OPENSOCIAL.ORGWIKI
143,595,460 *0DC02334C932FA876736B06787B7803E56ECB91B WIKI.OPENSOCIAL.ORGWIKI
143,595,461 *0DC02334C932FA876736B06787B7803E56ECB91B WILLIAM-LAUGHERTY
143,595,462 *0DC5B8B3AC65B5F692B336A81E75F043AE34F389 WILLIAM-LAUGHERTY
143,595,463 *0DC5B8B3AC65B5F692B336A81E75F043AE34F389 WKINGSHOTT
143,595,464 *0DC2E40E1400F4AE44C42A685A6172FC1463E785 WKINGSHOTT
143,595,465 *0DC2E40E1400F4AE44C42A685A6172FC1463E785 [email protected]
143,595,466 *0DC5391D3FFC0BC88539AD201B55BEC9DBB1DAFA [email protected]
143,595,467 *0DC5391D3FFC0BC88539AD201B55BEC9DBB1DAFA WONSEE
143,595,468 *0DC440BF9F3A59A795803B459418F3F86683A954 WONSEE
143,595,469 *0DC440BF9F3A59A795803B459418F3F86683A954 WOSELECTION
143,595,470 *0DC6C286E88C5C304F1B3BCEC5D8992D5AA1CBBA WOSELECTION
143,595,471 *0DC6C286E88C5C304F1B3BCEC5D8992D5AA1CBBA WREINDEER
143,595,472 *0DCCE3BD1B06D0759A32BC3639CF0EB0BBE8A285 WREINDEER
143,595,473 *0DCCE3BD1B06D0759A32BC3639CF0EB0BBE8A285 wugunwen
143,595,474 *0DCAEF28C143E9C2E216A5C916B36FD9EFE509F7 wugunwen
143,595,475 *0DCAEF28C143E9C2E216A5C916B36FD9EFE509F7 [email protected]
143,595,476 *0DC876689DB3D024B47F534B804831F65ACB7834 [email protected]
143,595,477 *0DC876689DB3D024B47F534B804831F65ACB7834 [email protected]
143,595,478 *0DC1839C881CBDF26B7AD61DCF488F229C1C6D95 [email protected]
143,595,479 *0DC1839C881CBDF26B7AD61DCF488F229C1C6D95 WYATT.OTANI
143,595,480 *0DC591978AB1FD6F4E6A9A2652654BBC4778E4E1 WYATT.OTANI
143,595,481 *0DC591978AB1FD6F4E6A9A2652654BBC4778E4E1 [email protected]
143,595,482 *0DC726E50521BF905F3F86B740685CF598298480 [email protected]
143,595,483 *0DC726E50521BF905F3F86B740685CF598298480 [email protected]
143,595,484 *0DCFF278E93D3C5758EF7C45DD74A929CF745F3D [email protected]
143,595,485 *0DCFF278E93D3C5758EF7C45DD74A929CF745F3D XO&BAA
143,595,486 *0DC5A2D03081877AFA09D5799A4B2C25E63A38DF XO&BAA
143,595,487 *0DC5A2D03081877AFA09D5799A4B2C25E63A38DF XTFA
143,595,488 *0DC68557C683F409801C6ECFAAE6783C5C6C3B29 XTFA
143,595,489 *0DC68557C683F409801C6ECFAAE6783C5C6C3B29 [email protected]
143,595,490 *0DCD0384B037CBBAF6002D78A6D4647D9BAD5596 [email protected]
143,595,491 *0DCD0384B037CBBAF6002D78A6D4647D9BAD5596 Y01W7CAU480C
143,595,492 *0DC7D95A2444C11BE73C2756FB2532DE744165ED Y01W7CAU480C
143,595,493 *0DC7D95A2444C11BE73C2756FB2532DE744165ED Y030176
143,595,494 *0DC704743D56CA60E254EF0199C3BC0CED4E3E58 Y030176
143,595,495 *0DC704743D56CA60E254EF0199C3BC0CED4E3E58 Y139064
143,595,496 *0DC028210DF18DEA09C26D93C08EEFA10FD2FB99 Y139064
143,595,497 *0DC028210DF18DEA09C26D93C08EEFA10FD2FB99 YANA AYZETOVA
143,595,498 *0DC1692A12A531495BA7AAE3216711AC516ECA96 YANA AYZETOVA
143,595,499 *0DC1692A12A531495BA7AAE3216711AC516ECA96 YELL-ITOUT
143,595,500 *0DCFDC49FF4A51B53B741C407247F330A734EE3F YELL-ITOUT
143,595,501 *0DCFDC49FF4A51B53B741C407247F330A734EE3F YETKIN.BERKUN
143,595,502 *0DCDF85873305AB0EA730BF492DFA8E21A70F758 YETKIN.BERKUN
143,595,503 *0DCDF85873305AB0EA730BF492DFA8E21A70F758 [email protected]
143,595,504 *0DCBC32888E7D48E411B4A235A494F8B539F100B [email protected]
143,595,505 *0DCBC32888E7D48E411B4A235A494F8B539F100B YORDALISES
143,595,506 *0DC2BE8C46F743610D5DAB48B8FADB9FDDD9B949 YORDALISES
143,595,507 *0DC2BE8C46F743610D5DAB48B8FADB9FDDD9B949 YTIENARTED
143,595,508 *0DC318EA1D5DD966E16D1FEC1A2E94BD4ECD23A4 YTIENARTED
143,595,509 *0DC318EA1D5DD966E16D1FEC1A2E94BD4ECD23A4 [email protected]
143,595,510 *0DC9AB0E37DAF878DD2DD86F1F8165CC067E8B87 [email protected]
143,595,511 *0DC9AB0E37DAF878DD2DD86F1F8165CC067E8B87 [email protected]
143,595,512 *0DCF9AC8B248A51595582CD1E527A65B745074EC [email protected]
143,595,513 *0DCF9AC8B248A51595582CD1E527A65B745074EC [email protected]
143,595,514 *0DC7AF9447D70341345FD891BFDECC9261E035AB [email protected]
143,595,515 *0DC7AF9447D70341345FD891BFDECC9261E035AB [email protected]
143,595,516 *0DC4EF997717A1099281E0D12215D365970D82CE [email protected]
143,595,517 *0DC4EF997717A1099281E0D12215D365970D82CE [email protected]
143,595,518 *0DCE0E070FED720CD9FF6BD9B8E5436E6FE0EBE5 [email protected]
143,595,519 *0DCE0E070FED720CD9FF6BD9B8E5436E6FE0EBE5 ZABANAAZ
143,595,520 *0DC10A866E85C5BB9FE98149517EB3B3C28229BE ZABANAAZ
143,595,521 *0DC10A866E85C5BB9FE98149517EB3B3C28229BE ZACH-BURDEAU
143,595,522 *0DC423D84A007F1FE87741A547ECCE644D9DC084 ZACH-BURDEAU
143,595,523 *0DC423D84A007F1FE87741A547ECCE644D9DC084 ZACKIWASKO
143,595,524 *0DCDDF773775FF8CD47491ECF9320481CA988AAD ZACKIWASKO
143,595,525 *0DCDDF773775FF8CD47491ECF9320481CA988AAD ZIOMARIEJIMENEZ
143,595,526 *0DC46AD1B9234289235ADAFB4B10455BBA34480B ZIOMARIEJIMENEZ
143,595,527 *0DC46AD1B9234289235ADAFB4B10455BBA34480B zk>x
143,595,528 *0DCE89439BA47D54003B0B2D21E32CD122543BCD zk>x
143,595,529 *0DCE89439BA47D54003B0B2D21E32CD122543BCD ZNL+
143,595,530 *0DC6757B019F5697040AACDE1A4AA9A077281478 ZNL+
143,595,531 *0DC6757B019F5697040AACDE1A4AA9A077281478 ZOTTSAGANAK.1
143,595,532 *0DC34714C9B3DAFBC37B8457421B3822CAE89375 ZOTTSAGANAK.1
143,595,533 *0DC34714C9B3DAFBC37B8457421B3822CAE89375 ZUZKAVONDRACEK
143,595,534 *0DC18FC1A70184FC9B08FCA95D3E48CABD25078E ZUZKAVONDRACEK
143,595,535 *0DC18FC1A70184FC9B08FCA95D3E48CABD25078E ΜΕΤΑΤΎΠΩΣΗ
143,595,536 *0DC9C5F33287A0D9EE3E794437384DEDBDE5F11C ΜΕΤΑΤΎΠΩΣΗ
143,595,537 *0DC9C5F33287A0D9EE3E794437384DEDBDE5F11C АДОНИСА
143,595,538 *0DC3159B8F842C65297DC140AAF354BC6ADBB0FC АДОНИСА
143,595,539 *0DC3159B8F842C65297DC140AAF354BC6ADBB0FC АЙТЕ
143,595,540 *0DC500F244EA1700A7080CA896AC6BBCA61D9016 АЙТЕ
143,595,541 *0DC500F244EA1700A7080CA896AC6BBCA61D9016 зынгæ
143,595,542 *0DC6D05A51EC5861C878212580E321D12FF31222 зынгæ
143,595,543 *0DC6D05A51EC5861C878212580E321D12FF31222 КАЛИТЕРНА
143,595,544 *0DC04414D6B0DA93D1DF53C97667B692CD2A6842 КАЛИТЕРНА
143,595,545 *0DC04414D6B0DA93D1DF53C97667B692CD2A6842 ЛІПЫ
143,595,546 *0DC32E11A839A42823E757987D46C3AD8BF5D241 ЛІПЫ
143,595,547 *0DC32E11A839A42823E757987D46C3AD8BF5D241 помимио
143,595,548 *0DC12DCC9D2564353BCFFB888B79C32C2480A509 помимио
143,595,549 *0DC12DCC9D2564353BCFFB888B79C32C2480A509 таїфу
143,595,550 *0DCDC5E3AB9755FAF9B16CBC36DE56DC1FA4E9C7 таїфу
143,595,551 *0DCDC5E3AB9755FAF9B16CBC36DE56DC1FA4E9C7 ЧАЙКИ»
143,595,552 *0DC94B36A7A1854CC6AD30357469618E63F1A244 ЧАЙКИ»
143,595,553 *0DC94B36A7A1854CC6AD30357469618E63F1A244 штемпеля
143,595,554 *0DC9677E56CECA079436EBB891AFB895EAF23AF4 штемпеля
143,595,555 *0DC9677E56CECA079436EBB891AFB895EAF23AF4 ээтиона —
143,595,556 *0DC22B5CD8D95F23ED81976E90E8CDB12279FBD4 ээтиона —
143,595,557 *0DC22B5CD8D95F23ED81976E90E8CDB12279FBD4 東京ガス 2-1 jr東日本
143,595,558 *0DC1F264747352EF451C3B116B4E4EA5E461ADFE 東京ガス 2-1 jr東日本
143,595,559 *0DC1F264747352EF451C3B116B4E4EA5E461ADFE 00000000RCN
143,595,560 *0DCD341A18B3F29C462F71408CA99687DAFBFBB8 01.24.1076
143,595,561 *0DC944D3E4FE061A562B5D84B0E92F41EA956F98 02mm
143,595,562 *0DCCB6D3662E57BE91BFF1E03A3336D6C6B794B8 079FRANCESCA
143,595,563 *0DC3BEB2766791F8504DBF2EFFB6C4E31FDC68FB 09111817
143,595,564 *0DCE3D538ABD46A31F4B36A194FD1675313315A3 (>_<)0~-(=B
143,595,565 *0DCA18FE6C6F7997F131353360F711B507CA329C 0b77c28e29d03768b9a415505bd1a799
143,595,566 *0DCF3DCDE9F73D5E3D14ECA0736E4C069A94A73B 0BCLS112
143,595,567 *0DC357637558077D5C0AD673971CA337A35F4604 (><)0~DP
143,595,568 *0DC78D3D4A2FD2BDDDD5D1FF388F9060D7A09123 0FINUNYLHCDT
143,595,569 *0DCAC7623F2CCF18E499C04F7A96D8A35ACEA118 11:.11..-#..-&...INJUNCTION
143,595,570 *0DCCE709E9DB7494C99EFA38888FE02B00C8784C [email protected]
143,595,571 *0DCA91C9DD504575400AC305E53CC78BB084A0C8 1311878 PARHAILLAAN-TAIVALKOSKELLA-METS
143,595,572 *0DCEF82E133D8BCE7D8A8C850C7AB803D445AB21 1352307 theutilityisseekingatraditional27%rateincrease.
143,595,573 *0DC7D122F45AC9153A398258BC507920CC52DCCE 13DECEMBER1474
143,595,574 *0DC6BA72ECDD028CC1FEEDD1E38B8497B08F50B2 11-29-1726
143,595,575 *0DCBB3E1B29DCA0C4429B80D591EC83F6217E71F 1129249 HIEKKATEKONURMIPINTAISTEN.PES
143,595,576 *0DC5477666FA276DB13E4F47CCDD941DB1CEAFAD 125katselmuksen
143,595,577 *0DCB0AD67099F6E6E3AC0E3CB7A5203D6AECC2D5 1304125 olen kirjoittanut siit
143,595,578 *0DC5787F70A1F8525FE427525D8AEF78CD37F69B 1348618 soitajuhakaukoniemelle0400638630tail
143,595,579 *0DCD26EACCBC4C071663173AFA3D83964E140258 1465567 hs/nyt-liitenagisaoshima:tabu"olenomistanutel
143,595,580 *0DC7C926BDD4414389D64736633B4BB0B59A9296 1480257 RASKAAMMALLE KALUSTOLLE ON OMA K
143,595,581 *0DC4D537891FE5410B5C77F36013409EAE106C0C 148628 juha-villanen-ja-jussi-korhonen-voittivat-ik
143,595,582 *0DCE105958496EF3FB51C243EA0F59BBE4528407 1518284 lis
143,595,583 *0DC88BED2E6783820061B1CC2F182FC99401F3CF 1532759 thepricehasmovedup$6.50overthepasttwodays.
143,595,584 *0DC6467E60F2C3DD373AABEB0368CC7D584EB36B 161AUGUSTUS
143,595,585 *0DCC232149F24226DCBC8F5CE67B8BF23F7A2318 177EMILY
143,595,586 *0DC590C44A2F50F4F6AE91923170CFF20B9BC6F7 15march1917
143,595,587 *0DC0681D3150F3B472CF7E343CE1F9E49CE51B5E 1634483 lis
143,595,588 *0DC537A54BED4D6DB4D25D453C98609F8A7D53A4 16hotspots
143,595,589 *0DC6C328C51C630F1F85266B8411525AE46A4321 1950C67A664041EC125702FDD4CC7FBFKAPUASS
143,595,590 *0DC36A78FC3991EA20F413ACCDE7B45CC7D5C0FE 180BABZUWEILA
143,595,591 *0DCD70417E5BD3354310EF18DCAF0378B69CA38A 19march1962
143,595,592 *0DC8612A29DFB05B9495A1450CA5ECD0645A2E4C 1937512 PASI.:.YKSI.SYY.VOI.OLLA.,.ETT
143,595,593 *0DCB12A5A37F28622300B200A77CFF7EA07A064E 1947318 JA.KES
143,595,594 *0DCD5308A42C8343E9FF27CBF8B3565B34F019BA 1 ANTI-KRIEGSFILM
143,595,595 *0DCFCC814E593823AE163A3B31C4C88A12940954 1ATTEHRUM
143,595,596 *0DCC2E9611E5A6378DF5BDF3376B182B87D8618A 1-beckenteilen
143,595,597 *0DC9739C0317DDDF55AA3E74B6ABC35C974326CF 1.biomarkers
143,595,598 *0DCFD9E4D759B5133B1FA7F4F81E86700E6D5AFD 1bleak-faced
143,595,599 *0DC9DCE63FD77D3CD0FE65664679CF3C38BFFA5B 1ATLIULUK
143,595,600 *0DCD0DD6FB0F94461A0FEA1387F3A8E0B7CB71CF 1.BARENBURG
143,595,601 *0DCDBB01C1ACF480C3496DD9A9CA04FE27F19CF1 1DEREK5
143,595,602 *0DCD9D585C9A986E378746825B509E9FA2275175 1.DUEDELSH
143,595,603 *0DC193C5170E00FE4D562049F8362D7AD13AABBD 1.BouRi
143,595,604 *0DC1EFE537DC2C0E705BCB8D43C41641A7FB4031 1EINZUSPARENDE
143,595,605 *0DC87ED10187E63E1C30B9D74D65D5E34B079E3C 1-cgt-mitglieder
143,595,606 *0DCD9C212ACBC8A37974E27CDB82CAA961124E81 1.ER
143,595,607 *0DC4A9F5A4F78C68EB413B9728FF94129B137769 1-erikoistarvikkeita
143,595,608 *0DC8CC86C295986A81DB01A417AB5FD7ABF05553 1COSTARICANISCHES
143,595,609 *0DC6DF58D386C6311A70E9D8742836E34B2758D5 1CREATUREFEATURE
143,595,610 *0DCB006B6D7EB3B926402C5658408B6E09621342 1.ER
143,595,611 *0DC4A9F5A4F78C68EB413B9728FF94129B137769 1.flotierenden
143,595,612 *0DC83959D96119EFE855A534CFE99976C239655A 1friskily
143,595,613 *0DC73CF6CF69E5C59E51303942A4CB58876D6C4D 1.hinder
143,595,614 *0DC8758F41515DAFAB564453FACD31CCC85446D5 1hupfeld1234
143,595,615 *0DCA79127A6B924F7CEAD0FE89724DCC2CA301D9 1IAMMONOPOLY1
143,595,616 *0DCC372E0A39F743E7C2E2F907F32CFBA2D593DE 1KAKSIKOITA
143,595,617 *0DC4B2D6443BA5D629753FF38A819A079F719786 1 KANTTISAA
143,595,618 *0DC7FD20CB1260F67D668C8F1C532C40A8A52671 1kampfstoff-fabrik
143,595,619 *0DC65BFF0829A4BFA1EA2942AB4CCCBEF8D67B99 1-kaubam
143,595,620 *0DC69C30E6294D498EFC56C4AF58590D04B384BF 1-kaza
143,595,621 *0DC85780319FF211C66489A7349A2E4490869AD9 1 KIRJALLISUUSMEETINGEISS
143,595,622 *0DCD2BA325C7F50DF09952561BBE4D114DF3517B 1 LANDBEFORETIME
143,595,623 *0DC2CBA8910EEC7AB3988A0AB443D1A1CF9F76D0 1 LOMITTAJATY
143,595,624 *0DC3FEB4A6DE55CE7786E4262950C83163B083FA 1maapohjatiedot
143,595,625 *0DCB708C9BA07B503E140EDEF95B1A8828379DBE 1museokorttelin
143,595,626 *0DC4556B2796BA3469EB913FE799D2504B8DCADF 1NEDMAAEB
143,595,627 *0DCC1BE71105D8CB472F45C14ACAB73294FB288B 1MESEEMS
143,595,628 *0DCD13090BB7F36D88CB388830CE25062A6A2139 1-oksentele
143,595,629 *0DC42F80DFCE129BA39D80046DFBD63ABA91C662 1 MORASH'S
143,595,630 *0DC5E21E79997ED1CADD1D96A71FBB91F47C066B 1 PATRIOT-AUFSTELLUNG
143,595,631 *0DCC7996538825015060826BD9A4F3498C385B5D 1.NATOPOLITIIKASSA
143,595,632 *0DCE8E029D9DA8920C6AC5F839FA0CDEE661974D 1NATO-POLITIIKASSA
143,595,633 *0DC58FC5DB75ABAF214C14533E985E2F4C867822 1-projektitukihakemuksen
143,595,634 *0DCE5281219187C3A16BA500AE8BD62A877BC4D7 1 polkupy
143,595,635 *0DC1A066481CC7EC84AF08D966D728AA7F6B378C 1.TEHT
143,595,636 *0DC83D3876F09ADE52315892CB60B5E7B1A6383A 1 ranskatietous
143,595,637 *0DC6FB6D05742F379B8D9A0487AF5EB73E71A8B7 1-ULFANE
143,595,638 *0DC1977077DADD1F128A6154E5AF6CF7BCCBF4AA 1.urnenbeisetzungen
143,595,639 *0DC075F7795FC98340EB8948E05AA09ABADCDC27 1VERDREL
143,595,640 *0DC54F4D2D6ED0FA6886E3DF7B47C3771116F075 1.weisbeck
143,595,641 *0DC2A0DEDFF899014A8C8EB2828CE38C0784ABC5 1soudattaa
143,595,642 *0DC7A352BBC006D67BB132547FAB9226E9B41562 1XSALADA
143,595,643 *0DC6E38D48A859EFE04DD4D39315E9175146B21F 1surrrkeasti
143,595,644 *0DC2A8131EF8C810DD0B614684F9C54C88BCF8B0 1.suunnitteluviranomaisen
143,595,645 *0DCB1C1913E7BE93B4F98B3B83276252F02595F0 1.TARJOTTAVAAKIN
143,595,646 *0DC239BC6E01E1BED7F63D82ECBAF8008968FB12 2003-04-29:.ALBANY,.NY,.USA.(DISC.2)
143,595,647 *0DCF8013CECDF4F07BC88D083E526E0E3362B679 1TUULETETUKSI
143,595,648 *0DC90CC533B58221F8E13D02D4E3B3CF1F2786CA 1.VERJAEHRUNGSGEDANKEN
143,595,649 *0DCFF3A4C5366D769CBF24CFDAC497AE6866FB29 1VITUCHO
143,595,650 *0DC8EDCF19872D558B3944E693FE71B38101E2CA 1.WERBEEFFEKTES
143,595,651 *0DC9EAB0A5807DACE0EA3A7118D9B5F38F336472 1 ZIMMERUND
143,595,652 *0DC756B0DD4CAA365F59172C40AE3A3D98FF3C68 2317390 daslehnenwirentschiedenab
143,595,653 *0DCB4FE3209E761984AB244011A6898146BC841F 20fate
143,595,654 *0DCF4C8E3E9BAB3F684F7D478CDD501273EA5B96 20MOLINIER
143,595,655 *0DC64C022AA36F7B16083459E25A56190282BB5E 241982 NEDEN-KATAMADILAR-?
143,595,656 *0DC3F718C3745FC1329486991BD0C4E1E4D37391 242937 mutta.on.v
143,595,657 *0DCD8BB4BE8E59F328E305905F829ADE88D667C2 2552544 es sind halt banker
143,595,658 *0DCEEF72E6C37B3EFBB4BBDDFB319957335255F0 [email protected]
143,595,659 *0DCB99B27FDEFB7279BB54EE7CFA2E5D117D1E2E 25DEAGOSTO
143,595,660 *0DCB73E0E6AA4CB1F4DBA3728D0A6AC4C8007B42 2607684 steinerkoulussa-lapsella-on-ensimm
143,595,661 *0DCEF5668FFE6866E1507675829C74D4F428A27E 2440664 ratkaisevaasiap
143,595,662 *0DC7B7901715358C0763198103A4FA585ACC9D2A 2BARRAGONS
143,595,663 *0DCD94DFBC693AE29569FEDD0302DED7DDC93A2E 2CAHOTSES
143,595,664 *0DC74768F8F4462187AF7D3AAC2F9564D6CAFC3F 2AFKRAEFTELSE
143,595,665 *0DC88660BF9786C96E33C5CB1FE6B0ACBE8141C5 2FROW08BASICINFO
143,595,666 *0DC4167AB9D89532327E4D7E95423D641ADFA918 2IAREUQIX
143,595,667 *0DCF83D597575540E54C796F3B2D98FB630F2849 2-[[User:InvisibleSun|InvisibleSun]]-23:15,-5-January-2009-(UTC)
143,595,668 *0DCE968C61468C2962740241060C16360CFE43D7 3105DANCING4EVER
143,595,669 *0DCE67B86EA28344C8655C05D46C5A182528AAEB 31apr1332
143,595,670 *0DCD347469A7C1FF39C49B02AC688CD800D130DB 2.nasturi
143,595,671 *0DC3F8CD5C50D6A783CD65DEC1471E12266F9C11 マイルドフェースサンスクリーン[35ml]
143,595,672 *0DC318893384C9B4CC9F35DD78D6E9C9E4BB5E2B 3763AB
143,595,673 *0DCC8FB6BD427E0E50482FC9648B05563AA36363 3.antiwomen
143,595,674 *0DC98E662853272DFB76DCE3E8DBC3C384F7858F 3CO1O9S7
143,595,675 *0DC0A273C639093E40C5F0210EB89B4CD8700A13 3-----d ~osplat
143,595,676 *0DC06E72D81194CC1790BA4C29C6ADA952BDC6DB 3 FENSTERFORMATEN
143,595,677 *0DC126C41A6873694F49D82316D35A6F8DC28C23 30.Thorleifs-Klassiker
143,595,678 *0DC9921A8CDC8A96C53671B288E8614645CA5A17 [email protected]
143,595,679 *0DCED1557A45794CC58F164CDD01EB18E7D8D4EC 370330 uretimkapasitemiz7500m
143,595,680 *0DC64FFB840EA73E5D5BDC96CCE88A1C741D501C 39.vastattava
143,595,681 *0DC013ECAFDB09185B3BD1B26E5BC79CB0E67B8D 3.puhuttelivat
143,595,682 *0DCF3DDC04ABA773E2E8525EF8661CA574EF76C5 3--D~.`)X(
143,595,683 *0DC749DC035E045AC3C20A7ABA6127D836D09A8C 3HAMBROOK
143,595,684 *0DC9C13E6D3D44274DBD8FD54AFB2DCA33A3776A 3TIVERTNE
143,595,685 *0DCFFB4A01F64767F107E46AF56651EE47810156 [email protected]
143,595,686 *0DC3CDEC6FE1CE35856E4D637C39A910AE4081F7 3TRIXWTO
143,595,687 *0DC97D6188E77620087A976CE39CA8619BE6FFBD 3---->~.`.)X(
143,595,688 *0DCFA2813C2B3B35205A02BDD9C00D2C3ED2CBBF 401862 suheyl.unver'e.adanan.2.oda.bulunmaktadir..
143,595,689 *0DC390DF6F0D7ED2B23919E568DFAB2EA9381882 3LANGZEITFLUEGEN
143,595,690 *0DC258F814808E9603EB7E01131B831A290D7D4A 461408 TUKHOLMASSAVUONNA1975
143,595,691 *0DCE88C770DFDB8C07CFC4CF41D740E625239F1B 3==P`.(00)
143,595,692 *0DC5B16EE7BE286C37786ACEB8F6AF013A0CEBA6 3####p~O.~o;)
143,595,693 *0DC705A24E87A9562812FEA9278642B03C17D6E4 3SOLACERS
143,595,694 *0DC1365F11D11BE8C57E82C0029EA5E45C78FAC0 3=====)~.~splat
143,595,695 *0DCDA4CAB6D91718BC6A5245D833D14D0DCE45A3 3VERTEMATI
143,595,696 *0DC5CAD502CBF0B493EBD1AFF59320FD3F6137D3 4GAITHEL
143,595,697 *0DC83B9DAB4C9E6497E673C4AE8A75A0F722E751 407clayton
143,595,698 *0DC52C2E84066AF67F18B0F307B737D73617EDD7 43BRIAN
143,595,699 *0DC776FDE2E180B1BBD7C0AD3B934298FEA62716 44UB016
143,595,700 *0DC57FDF348BC6A28A02FF603F0368D669C271B0 462CHRIS
143,595,701 *0DCBDE7386CBCCC1B301F5E8206E87A589C6F983 4MONOCLAMIDEA
143,595,702 *0DC342D96A02B98F73DCD9B312FFA3212B2410BE 4ntv-televisiossa
143,595,703 *0DCD5CF92D354FD80232A06653F5714F85BECE8B 4DELOURDES
143,595,704 *0DC767D2E9A1D90136BC046778B2B587847B505F 4fc4184ad9f9ddf4ceb5e792384c7a4d-folly
143,595,705 *0DC70B4ADCA5863E2DE42C73D57DDE57C310D40C 4-GESAMTTENDENZ
143,595,706 *0DCEA7398FAD9246A9EFD52F290733BC8854961C 4PRAKTISCHERBSW
143,595,707 *0DCB657406FA05501B75A531181E2A78464E074B 4RELATEDLY
143,595,708 *0DCA2A5B6FF53BB3024292F3588E38B6FD177B34 4JESTERANNE
143,595,709 *0DCF1464F60EF66C9AD9359C618AF34BCF8FB784 4TOCOPIEZ
143,595,710 *0DC0C88F84D0BBFDF0440EAC5E8D4892911A211A 4MISHAWANA
143,595,711 *0DC8E5178490238AF8C7DAA3557FAB2E25D740C0 4UVACLHCC
143,595,712 *0DC43F8351A55A388CEC493BE3F67EAFDE944EBB 4-pickin's
143,595,713 *0DC5B95C38445C89005741EB9112000FFCA47A18 520782 kararbUyUkOlCUdeOGrenciyeaittir.
143,595,714 *0DC6DDC9C7D875170A725639E26FA2CDF4C3F4B5 4REMONTOIRES
143,595,715 *0DCCF7CBCF24DA9E8061B5A0D6C0D0BB83C9FC07 5ATTILAPHANTOM
143,595,716 *0DCD379709F310AF1FF111EA38649F08691FDDAD 5C1LLT1N
143,595,717 *0DCFFF9CDF3BC1E8CAD17B2B4F5A98EA8B00C32A 5CHAUMERLAYN
143,595,718 *0DC0D20F1C3EC206146474BC0935DA161EDA0349 4TENTENVIWWDASUNEDRAWYGGEP
143,595,719 *0DCB7783F08095D315ACB9DA0A617EF5620E51F4 5EISTINGBSW
143,595,720 *0DC227E230D1532940DE3C80F922E9E48FBDBB34 4YPOIDRAC
143,595,721 *0DC9D834620BB170C4E61BC9196566187B704DA4 [email protected]
143,595,722 *0DC1C7E434F87C7A130282AF9642B4B5735B14D8 596054 GELINBIRLIKTEDINLEYELIM.
143,595,723 *0DCF35E01D39B5FDAFB19C9820200061BEFAA607 5LEGIFERERAIENT
143,595,724 *0DCDF103B8099BF0064CD6F1CF5896131DCC9182 5BOWMELO
143,595,725 *0DC184E546BE9802379E264F1D7FE2BCFA288DDF 5BSWKGROUPBSW
143,595,726 *0DCB61C3E95577AA056912B161678BD4F419AB9D 5ORCHIDBRASIL
143,595,727 *0DC84644485905A20ACDEE291992E2550544053A 5.PHARMAKOLOGISCHE
143,595,728 *0DC9B8AB724D8AEC923FB43C4BE3A8C4E7998798 5 RANSOMED
143,595,729 *0DC0927823077914276426193586B3BB7A9E5314 5SEULONTOJA
143,595,730 *0DC574355D74ED0AA41E33A3E13062D62C2C11C1 5UNCHANNELIZED
143,595,731 *0DC66E3DC9AF0617E03D4E9F42952198F5DCB7A5 5KILCOYNEBSW
143,595,732 *0DCCAB5E6ACFE05C75D75B1F5C4C7F46BBA784AE 5LOSERSNOWBALL
143,595,733 *0DCF4BB5157F48DAD3D2EFA31F008BFBB17B6849 6arimaspian
143,595,734 *0DC39B8806985FA94A441470EB186D6A11A14617 6AUBKKAP
143,595,735 *0DCB452A2FDE62945C6764C3EEBFE8FAC7AA902F 5SUNSETWARREN
143,595,736 *0DCCA2801027F71C9EF03534A2194C3391F67BB1 5SUPERLEGGERO
143,595,737 *0DC511DEAEF332DD1DC6EE7F3D3DFD4CA28134EF 6BRANDIMAGIC
143,595,738 *0DCFE491114129B43BFA0F540A2FA0F76B992B0E 5-WANNE
143,595,739 *0DC70E79A398ED8764A6E8C6D873AF57DB84ECF2 6.emzirmesi
143,595,740 *0DCDB585585FD709729EAAEC35CBB04BA68C936A 6306 ipek-cem-,-dernegin-baskan-yardimcisi-
143,595,741 *0DC71FC66A1067EEAF2A127A0A0237864D0A532E 6FUBARSUNSET
143,595,742 *0DCCC30B674DB6AF73ED8630D02026DB6E77B3F6 6HEERYNG
143,595,743 *0DC0B7FF3D08027BF6EC0ACEBA26CFAA21489C6A 6MARIPOSACRUISE
143,595,744 *0DC89BAC0E32DB4BB5C1A80CD399CFE5999B616E 6MONSTERSCORPIO
143,595,745 *0DC5F4561FC23DCF5F15875245F2B80D36166573 6DRESSAGE
143,595,746 *0DC7BD302AEE0BD183F8CBF7B9D4A1612AD5D50D 6HARDRIJDER
143,595,747 *0DC7AF168CCD3AC65B058730CAA2C00CCCF29FFB 6TAMEIN
143,595,748 *0DC06151A73D2F78338BBC52D22F9BFAD769A590 6TAZMANSUNSHINE
143,595,749 *0DC8ABB410670338571A05EB740FD3129A5EBB42 6UOEMBSW
143,595,750 *0DC37869693F0739CE8C5496398069B582CAC3F0 6 POSTVATICAN
143,595,751 *0DC8E0842D8409D3DFC9DE19B4B82C8BF7837F78 6RESYVER
143,595,752 *0DC8C35D360B18744F3A81A6ACDAF7D17C87548D 6RICHWELL
143,595,753 *0DC10DA9504E71A0649D90B1E8DEED041BACCAFD 6STUZZICEREBBERO
143,595,754 *0DC9A6CA80BAC1C9BE3403D7A8A6F93329D00781 7DEADHEADFLYERS
143,595,755 *0DC4842A0F0FA111C2F9C1EF520D8F9157C7EA9F 7EMPRISONNONSES
143,595,756 *0DC8F35ED4724AACD8060C12E2144AD8EB87BD34 7ETADUEFNIBUS
143,595,757 *0DC4E724D7917ED8D19C7323A99C36D8EA634CFE 7HANDELSLAUGET
143,595,758 *0DC2B56D6997DF4DE9EF9EC46F4B33EC448504F1 7BSWOSTDEUTSCHENB
143,595,759 *0DC1997A669AF723EB27AAE44135B985E8724555 7KBUSINESS
143,595,760 *0DC0D01C3A6F080031691629C1F01854F80C0BD6 7MARIEPINKFLOY
143,595,761 *0DC78C52193641EB636BEEB94E234CA08B476D03 7MUFFINHORSE
143,595,762 *0DCE9D3122C558100C21312A96C3FA25E82C3AE1 7FAITHLYNN
143,595,763 *0DC043CA1F911213C37A3C4D112AC743867C454D 7FRIERFDDER
143,595,764 *0DC97DE170467F656E7E7C401CC692999E86FB32 7PORSCHEGERMAN
143,595,765 *0DCC7CFAF9F4B77A1DB2B5BA7CC35F90C7A111EF 7RETURTANGENTEN
143,595,766 *0DC48300AB3EC623DC1489C8B4BAD99862AC5971 7MICROSOFT7
143,595,767 *0DCFC502E03CD8CF0D4FAF3CC18CF43E27051CB3 7subcaste
143,595,768 *0DCA68DEDBB6DFDA5D2B7DD05192E1FCE82CD1AF 7MYCELICA9
143,595,769 *0DCE98A84B429D1A951BB1E207B4929F6B132063 7UKU10R
143,595,770 *0DC51A57424D963995EDF36759B3D79D6914CAA8 7UXOIFHBMLCW
143,595,771 *0DC825311DB22EF27ED61703D2FAE36218CC5338 7YLGNIRUOP
143,595,772 *0DCE84EFBB7921D884772B6F2D364DB5E3746E5E 804575 seminaarip
143,595,773 *0DC3FAD5CDB1C4EAC426DD2CCE89DE48ABEDDA49 8APPIANWAY
143,595,774 *0DC023C87DD1723BCA2627B5F1BA39840BB68432 7WINSTONINTERNET
143,595,775 *0DC6716767F3782CA9D4D19C451688D31ED05184 824983 bunun-icin-gerekli-kod-yazimi-su-sekildedir-.
143,595,776 *0DCF3DF7CE7B6274BB6947F0BF853FA542797488 83rhaetische
143,595,777 *0DC8C3368448DB29A4194BC302651ABB67321670 88TAT
143,595,778 *0DCA3E4214B60C9602AAA0F5B5ADFAC3F7CA3151 8ALIMONIESES
143,595,779 *0DC5630F92312A067C028290B0625521AF10BA04 8---B.~0.~o(^_~)
143,595,780 *0DC588D6ACF54EBCDA1EDBC1610196113C85EB57 8--B-~0~O}O{
143,595,781 *0DCFA846163542437975E6CC0C0E0131A8694A8B 8DVACETINSOBKU
143,595,782 *0DC0D999C7D103B1270A685739B8505838381309 8===b`~splat
143,595,783 *0DC47E04C5172443197162CD33A6D8D913298C5A 8FE40F642E4DE7DB5082B47F271B7316-990101
143,595,784 *0DC06656C3D4258EF5A80D366718902ED1C32A06 8BSWHUESGENBSW
143,595,785 *0DC28446D8677DC9DBF26EB27FD952F3215FCB63 8iluvshoes4
143,595,786 *0DCB4F5C2D218E258A3466FB9F23B4778C6B5A85 8ILOVEDOWNTOWN7
143,595,787 *0DCCE1ADDEF1B5E0CFF4A1B33D66AB4E4487D32C 8NENTAUFE
143,595,788 *0DCD5382F1DEA31D5A5F32DDEEC535275A1A56DD 8november1283
143,595,789 *0DC0207A1F53A02F29491CC10AB0C10BADABBFAB 8KALLIDINSES
143,595,790 *0DC29BE16844C226640F7ABAD9F639B0B0F956E2 8#####p.~splat
143,595,791 *0DC9D047904945C44CC5C3C5DD1FDFEC3F78CFFF 8RAADJE
143,595,792 *0DC80B75071C45CAB5DB5F642EC862A7975192C4 8SINTONIZZI
143,595,793 *0DC527A3621E7D762E26EA68B026AA9A65825249 8PONTONNETJES
143,595,794 *0DCFE8C0AF2523729B80AF900FD99D8088015CB6 }8{-`(====Q
143,595,795 *0DCFDA4E016A9C1F79226F34F7485FD913CED736
143,595,796 *0DC23B69956BC7328D16DAFF284B59A5B6891A84
143,595,797 *0DC1D882E7D37ABA7C37BD5F0652A9BD1FD78936
143,595,798 *0DC213DDCF068081D24205F07CE3AA24CCB6A12D 8STIGBJLERS
143,595,799 *0DC4F45F5B0FD136F5D6F97A7CCB3EEEA8B3BCF3
143,595,800 *0DC0E85E550E74906C094845819A8CE70149B3D3
143,595,801 *0DC19FCEE511D83ADD4113883982F6DB56BB20BE ɏ
143,595,802 *0DC1E7AAC4BA061F09E13E142A798915A76B92B3 9111066
143,595,803 *0DC7EC1569E42CBD72F5C64F673D6926C8758D14 '
143,595,804 *0DC581221C2CFEC2C47E6AE7DDDD9D99AE3200D2
143,595,805 *0DC4DF774B8CA1CC997922E7D9373BFE1DEEC529
143,595,806 *0DCD84C9823B679942B16247AE9D5378AB95B7B0 6
143,595,807 *0DCA87167619E476E347A07CA8A56D65A13CA462
143,595,808 *0DC543A98494DC8A4A8168FA4725AD063436F2A8
143,595,809 *0DC14270670DD14A399942C5E7C1F9C55767C1C8 
143,595,810 *0DC4631BED56488D071F1CB61DAE81F140B02CA9
143,595,811 *0DC1F044F687B0048156DF2B6A71B0E9D9BD50BD 9DOUILLIS
143,595,812 *0DCFFAA12DC25B40165452CEADE62A80DF63687D 9EDICRYPP
143,595,813 *0DC52B69F973AACD973D8A9FC84740D1A49D3275 [email protected]
143,595,814 *0DC3B5028F558A87F803C3B2670FE93AFD8F7433
143,595,815 *0DC96C9497F9E0949335C468F8392FD2C9FBF96B
143,595,816 *0DCB2ED420A5FDBACE523EAEF0C4DDF967822172 9SOLDFIRS
143,595,817 *0DC461A5BA3F1DEDEB06D40F42B7C793DCC2F755 5N
143,595,818 *0DCB2E56627041205ADEAE03F189CE05BF0D188C 9THATALLO8
143,595,819 *0DCC53CBDFF7317642AC61328B4D127B19A78EBA sNay
143,595,820 *0DC0F778D33304B7A4998E6AB2E93ED2BEBB75DC 2N
143,595,821 *0DC9DFACFB07E2EFC19CD2EA1D31F6DADC46B978 pK
143,595,822 *0DC46BACB7412089278CABE4C36ACDC9197C6E3D 9UPEVOKEGET
143,595,823 *0DCBD4C6A0CB2B0FFB5195917BB41B4F202CB241 9VANMANE
143,595,824 *0DC9DD82B03E48AAD787DF6F80FC387D3D9E2206
143,595,825 *0DC9F47BE1B81E9D498D7FC0C32F553FDDA44D67 9ZAKAZAK
143,595,826 *0DC6215BA920E214986C5964B25E3E9A86DFBD57 (Xh
143,595,827 *0DCB43F3008B530F81C2DE40FC41DD633C8CA258
143,595,828 *0DC5C411ACDE3256FC362C7865E6D799C84A9E40 [
143,595,829 *0DC3D4D4E4A4691DFD1D02E4877045EA4E98D72C 
143,595,830 *0DC326DA0FC8BB4A35EE06A8D630DF2C0280A3AD a+30l
143,595,831 *0DC4687D5D672E3F6E22BA2E670DA158371C5835 A3#N
143,595,832 *0DC6FC7E2CEE2DE75983A9384ABC80B062EF04A8
143,595,833 *0DCC885C7A2987E14F7E343A371199AED86AD7FA &2
143,595,834 *0DC3D225DA17465247863D28922065BE986043A4
143,595,835 *0DC40E4547597BA1635B8C53D93123061FDB51C2
143,595,836 *0DC24A6A3214E88AE84BAAFF34FA2527F969CBCA F
143,595,837 *0DC182DF4D94DBDFF4179271E53A17C246027BC6 a73c0
143,595,838 *0DC86BF13B50A80630630491F0E2CF030416D9F0 #
143,595,839 *0DC9938DE4AFCFB95D03AA260647C972A96984B1 &
143,595,840 *0DCA9F619AB49FC7A3D3BD4A64E0E6508B235484 A9HSI
143,595,841 *0DC1632B24255186F051324CA2E23B345BF14ECC
143,595,842 *0DCD9C179E83FB9AAAABF1C30089F486A423C4B8
143,595,843 *0DCBFB31EAFFC0ABE4FFF648FCD39CBCA0BE0D79 n$YCq
143,595,844 *0DCD32F3B67E82CBB81D1F9C5AA2F5B383D70980
143,595,845 *0DCF3537F4B445E29C76F46595C79CB313B470E1
143,595,846 *0DCA123056642B63D7C17738C06E43FBB6DCF8DD AADORI
143,595,847 *0DC83EDADE6ECC5E8AC70CD08FB5F54C1C456EE0
143,595,848 *0DC33B955656F177D16CB84C13515DD88D955549 شpB
143,595,849 *0DC6D0EF06EB8FBBE46B184ED2DECBAF1D67BF95 aaeq)
143,595,850 *0DC01B2B080844008E8FBC8348939B78CD2AA08B 
143,595,851 *0DCABA3F9CCE11D342E4174B32A996A53D47CEFD =L͇
143,595,852 *0DC9B04F1407C814BD535E4525D0ECB3D1E7B152
143,595,853 *0DC8F4150DD9C2BCA7664637AD441E722A591448 I
143,595,854 *0DC765413C825CE7FFF17BC5F556CB7C5047332D D
143,595,855 *0DCFECA0AFE243F9CDE6F7EAA6F64C20192AD2B0 [email protected]
143,595,856 *0DC7BDE1963D174A1D303F22554631C669702365 s1x*
143,595,857 *0DC9F2BDBE75AD23CA19BACC3286309B99401BCC G
143,595,858 *0DCBE4BC71306C049D8B2005FF41DCB778258E5B t
143,595,859 *0DC12A1DE0C16D6C2927A365CB6B4D8236CE449D
143,595,860 *0DCFF4E291BE42866C1E7A0CCC5A0A7AE4EA12FB ABDULLEZIZ9
143,595,861 *0DC60F237A8E8ED43BBA463189EAA2D6D40D92DA
143,595,862 *0DCFF5B7E2929CCD7A45CB8E0EFF0786717076CC
143,595,863 *0DCEE7C42A43B7456F131219C29609309A50AF45
143,595,864 *0DC519D524775B91477ED2DEE926ACC7726A9876 3
143,595,865 *0DCC343268FDC8933C6C110CD949F14A5D85C5C8
143,595,866 *0DC686B354234EDA3B66ADCCB567FC1402CEF0F3 }
143,595,867 *0DCE78705CF07D4375D8F6FBEE66F74F2283C981
143,595,868 *0DC98BEA81BE239DEB7091BB07E3B48B57FCADA5
143,595,869 *0DC6438B3DC35E50F19E0A02BDBD8448A28F48E0 T(
143,595,870 *0DC2BEC4432AB267774A7F40EDF9FAB06C0D2190 [email protected]
143,595,871 *0DC3C59BFBB7551CDFC5355A72FED4059894EB93 ab?jr
143,595,872 *0DC975BBC38E6FD25A333456070A404A3ADB1F54
143,595,873 *0DC28A6CC67140E26FB26687A0B6D57455829E0B A;BR-
143,595,874 *0DCFC111C5FE380603CF91915A110DA9EFDCFBCD
143,595,875 *0DC7819BE652FD5C71FB7D9B24C3EE4AAD659E95
143,595,876 *0DC02EADCEA8F4B323396A01E1BD37F5EFD5C90B [email protected]
143,595,877 *0DC3D146FAAC71D71A6B25A965E143B550AA00E0
143,595,878 *0DC423D6CB85B4EE824B4C4F1364107202F222FD 
143,595,879 *0DC094FCF7BA7CF72571EA4CBB8FBA5D4232057A ^
143,595,880 *0DCFFCB0EF204BB7093AEB4ED1B440CFF07FD9C3
143,595,881 *0DC49034EC0C47B49BA3AFE21D6578289F1A6C69 lL?bL
143,595,882 *0DC3E7CB7CB087E7FFFB65F390A3A0E8B3797AB8 ACL5Q
143,595,883 *0DCAF50CF7D56A96871012E0DBD45A5CD5D7EDE0 acnds
143,595,884 *0DC8CD8C2849CEB275CD9181EF4388515885DF4E p
143,595,885 *0DC2A4D1F6E36D56AD40BEB14040A4E766A8ECAE ac?p(
143,595,886 *0DCF1478A020EC47A72681633D7EBDD6FE0CB909 c
143,595,887 *0DCEB3A8B8BC5A30A5FD4B80C637068F9E419CF4 K
143,595,888 *0DCCCD49AB4303D069E12892B6EEB30659D9FA95 .
143,595,889 *0DC425E56BEA314851D3641245A73231FA30B0B6 Wx
143,595,890 *0DC602AA7DF6742EAE792D7F8E2375925B4CF4A7 *<
143,595,891 *0DC651173B6A64B047C8143B3DBD4DF4521E0B20 4z
143,595,892 *0DC5F6D5A379081DCE7C0311D58D513B9BF58A6C actaualment
143,595,893 *0DCFF42BE40108F413C96292DD26991FABF187C8 ACW2788
143,595,894 *0DCEF85AD0E2F5C161C30F3926F425FD72E8EC3A ad3rs
143,595,895 *0DC21291556AFA845FFFA40F4220B8DDE3BF4A4E A+D5
143,595,896 *0DCFDFEBFCF41BB36D2FD090E2B67CE2C401591C ADAGINO
143,595,897 *0DC97B6B2BCCF970FE35B7ED0FA086100F713A9B
143,595,898 *0DC3E6243E821E40BFE75DF0FC3340D980C26611 ADFRDSMNING
143,595,899 *0DCA89A2739CD05EA4434504DF2C6B4DF282591B @2
143,595,900 *0DC8C3BA5A25013F94A5BDABCDB8C56600F95E81 adkog
143,595,901 *0DCFEF35B0FAB966D1DFD0FA8DAC222D4E10D814 l
143,595,902 *0DC9FE85FED029A0D2BF43357B3482478642A199 aduv
143,595,903 *0DC69773B6140E893043DAB801499A36C35E9CCB aestheticallypleasing
143,595,904 *0DCD4BBBB602AA71CB7A47FC7568C7D1930E12A8 aew$
143,595,905 *0DC69EFCC1A613765EF02533A7D9C1B8217F0A6E AFFA7IC0
143,595,906 *0DC597BBEE5A5DDE2E153574C12BB87300D38F84 AFUAAIE123
143,595,907 *0DC15FD0B28CC1F768D0FF1ADAC6D21891836575 04101077
143,595,908 *0DCAB5D9DF8EE456C44D13D081831F7338F7EF83 AGALLIAC
143,595,909 *0DCB4CFF5F5EC7679FD0A17B2D91B0D0A1A815E1 agnisyln4
143,595,910 *0DCBE713715D9B164F2BEF8C606710AFB80524C4 AGO.73
143,595,911 *0DC0A6A52FC98D696456A6F3DD4225651CE14A0E 0cecile4
143,595,912 *0DC6726A5498300B057A10381992263E668ED169 AHSU1
143,595,913 *0DC217A62E6A7CFAF0C0C4DBD78DC90F2C13ACE7 (-_0)o~o~-<----p
143,595,914 *0DC7538848A6B0F8D9C8C92EDB6610BE5144271A ai63u
143,595,915 *0DC1E55FADE99C7F8B73539CE21E95FE9EAD939B 0THEHERZOG0
143,595,916 *0DC391D263D218DED8E7F2E2D988C87276481148 ÄIKESTES
143,595,917 *0DC8479EC4E9FF9376A53B4D24F91E171FF1BE01 1016950 COMMODITIES : OIL $2133 A BARREL , UP 14 CENTS
143,595,918 *0DC7CB2EF2EBA295F620972436435F170D92F7C0 ajdi%
143,595,919 *0DCB937E4EF1A0FA22686847BCC2A8ECC5D72667 a"k%7
143,595,920 *0DC8B359C9CDC940B1663AAADA4B3965D5DC5239 akpzf
143,595,921 *0DCEDA92109752412F7655B6894EC940B67D5FBA akwt=
143,595,922 *0DCD2E562712BABE833D59B601B63AE0D1F06FE2 a!_l9
143,595,923 *0DC4564C817D216FFC9F01F95BF49160453310AF alberto.bosio
143,595,924 *0DCCAABAEB55EF74D792EC682507B6B0A0A55F95 [email protected]
143,595,925 *0DCF3ECD6EF6709F9395C1C379A09F9611AAA04F ALDEN.COURCHINE
143,595,926 *0DC44C866F215BA697147B3231FA580222698FCC ALEI
143,595,927 *0DCCFA1C08AD878820ACE7256E02C8416F001B4B 1364357 JETZT-LEBT-FRANKA-POTENTE-WIEDER-IN-BERLIN-.
143,595,928 *0DCDC2075ABFD1DA657427450E9BAF175C8E4ED7 1384406 hankkeen.tavoitteet.olivat.hyvin.laajoja.ja.t
143,595,929 *0DC81C345222F0949B66F1390FF362FA283167F0 ALEXISCZOLBA
143,595,930 *0DC1B18D5BB4E4CF8201C1AE7A7E415A96EF7058 ALEX-RAMIN
143,595,931 *0DC58764849D83CFF24BAF52EA5E83AC4FB7407D ALFREDO.PIERCEFIELD
143,595,932 *0DC26718495E2AC8A2DF1BDD72DB7BDE8FDE5324 alina150
143,595,933 *0DCDD3D5013F0A1FACE15FB7D4E0A3D37FD398EC A;LJW
143,595,934 *0DCA91AE42A54739101FAAB75E616ABFE1BB0009 1523680 waspassiertdamitdersprache?
143,595,935 *0DC5CE416566CEF727FB132EE1F8CB0C51CCC81D 1537968 meid
143,595,936 *0DCC0181DD6D3F77D3AC0367BCE8D65AAF02BBA5 16111989DO
143,595,937 *0DC13A1F4F74E196332B9D2726CB3EAC396A3D41 a(lpa
143,595,938 *0DCC2B135FD7AB6EFD1D7D9A8C1CFB13D9FB1003 alysha.walker
143,595,939 *0DCFC485C5FB8B62FE201A8B72A3E5D0B774C2F6 ama:q
143,595,940 *0DC783F191D33D6B17812A2ECE8DFBF519F66A15 ambroseyaple
143,595,941 *0DCCD5AA5A61778EBC1A66299640A6BB32F66039 A(MS0
143,595,942 *0DCBC32B0A8E8107E12D834F75284DF42574773F 1ATSALPUK
143,595,943 *0DC9F63FC1AC31FD6363AA19B0BB52589E2127F9 andereck4
143,595,944 *0DC89ACE860066A8B6E2AFFD7D35530F15A68E86 ANDRECALLOWAY
143,595,945 *0DC920CFBA5376FE63FABD7997876D01872C6DFD andretna
143,595,946 *0DCA58BACCAEDE6BB649F395E4C6A8E813625BF8 1.ER
143,595,947 *0DC4A9F5A4F78C68EB413B9728FF94129B137769 angeloosche
143,595,948 *0DC2CBD043F0990A0061C7CC3C7E24817A66FA09 ANGOLOTI
143,595,949 *0DC7233CD5A456FDD4CE87DA701D479C4C7D00D4 1.geCmeyeyim
143,595,950 *0DC2E12B700587CE04C1CE0E9BAE928DF1D8F64A anorakker9
143,595,951 *0DC962CF342A16627CD15A84AE9801788E1B92B3 1jan1647
143,595,952 *0DC5240F67C6C1F94FB7DA15A3088078311DF363 [email protected]
143,595,953 *0DC694D898410906681183216EE9B31C4C11A7A5 1katz-trio
143,595,954 *0DCBB295742048EA5E064CB02E5E98A2B2174D31 1kersmash
143,595,955 *0DC683369B30FFFA97CD9D8D2A98D0D2082EA673 1.kl-hallintopalvelut
143,595,956 *0DC258CF8B342D66666C3585E62BCB6C4CF0F3FA 1.KULUTTAJASUOJASTAAN
143,595,957 *0DCE0E6D50FC9FA55CA66E066929BB41A7C5D85B 1 LASIPOHJAINEN
143,595,958 *0DC2993C1AC7510D1C140C451C74B20D9F4E4914 anyelbbok
143,595,959 *0DCCED68A1D2055B98FABBF7DD33F4195FE0566F AOLQU
143,595,960 *0DCDDF43DF73448F96660F02FA0CED95011B29B1 aoos%
143,595,961 *0DCA396B7D760C2A2F6FE72F05A767116E86F483 1-originalvokabeln
143,595,962 *0DCCAE1F67ACBF5DEB69617674BA23BDB948BBF2 Apathy.Two
143,595,963 *0DC40CD425CED380C2B466C1F2A2011BABD202CB apuee
143,595,964 *0DC94227339E237DBBC351FFC3387090C4500912 1SMAKSATT
143,595,965 *0DC2E39AB9D9178E98B8CBD7B8B7FD83A2B3B9A7 a=qwn
143,595,966 *0DC77821F2A4D42EEE912F43A0514A5F2AF6316B 1.TEHT
143,595,967 *0DC83D3876F09ADE52315892CB60B5E7B1A6383A ARB/9
143,595,968 *0DCC98759B6EFBF7EC0A0CEA46AD8B801B33C121 ARCHIE.VARRELMAN
143,595,969 *0DC4B5F0FBBD56C9273154202F2F2C658039AECA ARCUADO8
143,595,970 *0DC7160B61935A2584EE61638523FC65E93BB952 1 WEIQUN
143,595,971 *0DCA2630BDAACA3E622682BE339006D5BDE4FEA4 (2002年2月26日、アリスJAPAN)
143,595,972 *0DCE4A386CF4CED9AC2B9BE2A4F56D1F8876C6D5 2152283 TOIMIALOISTAVAHVINONKULJETUSALA,JOKATY
143,595,973 *0DCDD6013D7F572D131E3622DF5584FCEC630BD9 ARNOLDO.WICKLINE
143,595,974 *0DC3FDC3944FD44CCF6F7E63138773B11D4692EA ARNULFOHADAWAY
143,595,975 *0DC4618BAC1367F185547B42FA23D0C507810BE4 22apr1232
143,595,976 *0DCE7CA3209978348719F14ADFB2F5E3ADF4E12A 22.kaunistaa
143,595,977 *0DC1E43951276B48FB96029A6E029A0DFBC859DF 23july1691
143,595,978 *0DC0A0BE923CEF1E4E815DD03DE18D94F61768ED 23PLUTO34
143,595,979 *0DC1C523A4FC9D10DA7E35429672523474A5291D 25.YEARS.(DISC.2)
143,595,980 *0DC71D6DAD2609AAEB229CDADDD573668B813BB3 2709000 RAIN FELL FROM IOWA ACROSS MISSOURI AND INTO ARKANSAS .
143,595,981 *0DCE47F9D1B8A097AF2470E197FD49EE1AA11A46 27LDKFY
143,595,982 *0DC4EBEBC931F0EEC9B6150F0D0D362A4E305D5A 2913176 RAIJA.LAHDENPER
143,595,983 *0DC4B422CBFF74C71A5D3E9031A80170CAA30491 2FTT0383574
143,595,984 *0DC7E0D90E36ECC826B6525D1FC2306D158FE13C 2.grundgesetzmodernisierung
143,595,985 *0DC63F075066961426F6593A421C545B84B78F95 2iamjudy7
143,595,986 *0DCD52A3F4DFDC1599551C462FA3C03E2C9B8B7E [email protected]
143,595,987 *0DC89F380FB250DE459CD45F1A3573D55A878397 ASH.LEE.LEE
143,595,988 *0DC448058258340D210F1A3B9DB8811C3D174217 ASHLEE.TOMLINSON
143,595,989 *0DCC29AD73112C99ABCA57965B4DBE546929C360 ashleyflorez
143,595,990 *0DC52851184917B3343800C8279BDFDBC1811388 2RASEFORD
143,595,991 *0DC9B506F758212EBD77D110B40FA15FD93D8C5A astreds1
143,595,992 *0DC16F1DD6B99155D75BC1EB905E2CB64069DBF3 2.TARVEOHJAUKSEN
143,595,993 *0DCF935A59FE4CD52145ECF13469385162847682 a-th.
143,595,994 *0DC6640A7F2FD7C03CFA6266170B4DC65E81D65F 2VERLIJMD
143,595,995 *0DCFC2DE0110442E94ECCAF4E6B714F1A062596C 2voitonn
143,595,996 *0DC114C2D94D6929F7FE30F03DB438E27264622B 2.warteminuten
143,595,997 *0DC80496846A5AA3EA65AE74DE95CFF6FFC40669 2ZWENGELD
143,595,998 *0DCB0002F6A5092BDE78D3B64A8FE887E538AA65 304744 ES FOLGTEN ANGEBOTE DER GROSSEN HOLLYWOODSTUDIOS .
143,595,999 *0DCE30DA854CD7FAB9B35C119EC622A78C925AC8 ATTACHMENTEXPERTS1
143,596,000 *0DC1A3BE8B6F0BE03B5F1FE75BB841B3AF017D39 38-tunnemme
143,596,001 *0DC4F02653BF657C909FA0AA058F53A56158424A AUGUST.ALLIANCE
143,596,002 *0DC3EE86082B0D7023DB99A214CFDB4E5A20EF91 augustlakers
143,596,003 *0DC459FDE09B0721B02B0AAC287865C0B36D18C4 3FBREFER
143,596,004 *0DC2AF2CFEA2079F9902F229A30113417EC38347 3FQ68UHI
143,596,005 *0DC4A11B6092A6B3D177235FBD174E8AE77FF6CA 3 NUE
143,596,006 *0DC42912790DCC15917B3DB9FFB043D49A843A88 3-P* *}O{
143,596,007 *0DC256D4E816C7D1EAA8BD4D21C4CDE61807F385 3REGENTEN
143,596,008 *0DC79E03B95F2F47D26F51087D65E42A35633323 a/uz0
143,596,009 *0DCB9D8E06498BB088F94BA1E1B5A8968F4E7046 AVERYPETTAWAY
143,596,010 *0DCB823E092022B103DE2DB9A73C6F387B429B1E averyvelverton
143,596,011 *0DC28553FB7DB645F713F41B6785C0AB7BD016B5 402456 YST
143,596,012 *0DCE9B399D8DD4990E8B385F5CAA7644C7E63DD3 428DRAVEN
143,596,013 *0DC0FDE45409F38CA7DE26E7219CA4A98D2C12CB 43.charite
143,596,014 *0DC00AB6D3449C25EB58F77C260082211F3CB725 AW_M"
143,596,015 *0DCCB64AF2FF6ED4E6E0047F0A827D7009A40AFC 44-camellias
143,596,016 *0DC868AD49E262EDA1703BF5A816797EB0ACF8BB awt-%
143,596,017 *0DCF379E74D183AD3612788DB2C93096279579E2 4HEIDIMINOU
143,596,018 *0DCBCEFF1B52CE520CF52B010AE4590B7B1A8876 4LOUISMATH
143,596,019 *0DCA2A9FD1BBD03E79D2AE5FCBD59C02FE4F506E AXVDU
143,596,020 *0DCC24F09B590D5FBD089A7E2D9EAC55F0AD041A 4NEWCOURTYVONNE
143,596,021 *0DCC3C88FF76675CF9041B8A4EB956A3E3932BBA a/zq-
143,596,022 *0DCCDA1C3B9D92A96F55976538267159E210BD61 (><)*.(b
143,596,023 *0DC18172F01B5D3AB604FE82F01EC3B43401CD75 4SCHUITEVOERDE
143,596,024 *0DC33DA1639EF264FDDE423EE4E119D3645E960D 4STACIONARYE
143,596,025 *0DCE3C397933B2D2881C258A0B9D3983D8449932 B%2&
143,596,026 *0DC4430A5605C7B39451A8383B6A67615081A82F B2C7)
143,596,027 *0DCDEFA81C9E873A718E16C06C6D065071306ED2 b?,)3
143,596,028 *0DC46D512AD1145FFA7831DF489C4EDD21676B3F b3ldi
143,596,029 *0DCB8143121A3494A2FD496FCF21AA206C43BBA1 B;8HO
143,596,030 *0DC20D94F31FAA6BB8CD729B6E3A63BB6FD5E4A0 B:8S3
143,596,031 *0DCB06DA4C6B2B75CEFA9F942AE1EEC1050C5AC4 5BOWLINGSCIENCE
143,596,032 *0DC88EF7D6AAF2120D48F6DE40871657B2FFB726 BAIGNEZING
143,596,033 *0DCDC5351F33CD2868A39358CA969269D230FAD8 BALDTRE
143,596,034 *0DC569EF2667DCB3C7A0328546FC5D0502ED30DF [email protected]
143,596,035 *0DC535B1B9A22F2EE948733DF50D440696CA9500 baranya.(lok
143,596,036 *0DC08E50772E5A6B2CB56225AE24DBCDFBC8A023 BARENBUR8
143,596,037 *0DCFCBB748EB0419910DB635CE227207C3EE87BA BASHABALLA22
143,596,038 *0DC7F672D7A94E9F41F1FED5736BFC7EC793C5B3 5EMP1ICIT
143,596,039 *0DC7AC80E52CC8D540EF66C4F295529D6EB9AD67 BASILGOULDMAN
143,596,040 *0DCA41589495DF7B5165988EF14A60AEF7370306 5FISHERCOBRA
143,596,041 *0DCB271A64FE6220E454E1CA684128D3D81905D6 bataddni8
143,596,042 *0DCFEC38E06BE5B0D0448DDE67CBE8FC20FDDFE3 BATAIATEGIREN
143,596,043 *0DC4CE3EC2815930D0C529E961A716C5352DABE6 BATTITUR0
143,596,044 *0DC3150D610A7C03BFF96D2C6CAD8002BD35E1EF 5 HINCHE
143,596,045 *0DC06B1D01DBB80F2A35BE97130E1768E5B8D734 [email protected]
143,596,046 *0DC86B3C767DA4A65A281483F1B83C392A03EBB4 5IMPENSASQUE
143,596,047 *0DC09EF15AA09448C30DD1CA7886C264BAB01FBA 5JASMINEDONALD
143,596,048 *0DC5C0D81A0BBB19BB885503BB205258772F8ADA 5KATHYBLUE
143,596,049 *0DC1248A1D30BEFAD0CDF4D9F17BDBA62A8565C5 5KNOTENRESOURCENS
143,596,050 *0DC53C1B83C125DB3005C1F9B00ACED7AE6D1541 bbstats49
143,596,051 *0DCD78869631C4EB3F8957720BE332570924DC50 BC16JPEE
143,596,052 *0DC4C22ABBB0F75D68201B8FE7A51903BC23D8C9 [email protected]+E5
143,596,053 *0DC4307E580307194891C4EB7FB0539C0CA7E543 BCIC_
143,596,054 *0DCD3EA5E070E8A77E35280EA69009A8F2F884A9 5SOTSKCUR
143,596,055 *0DC29FE1D748ACEE78973AB4D24BD48C68EE1EE6 5SUGARPENTIUM
143,596,056 *0DC833E4A18032F45C6E51C11BA77B22F5F86354 5SWEETIETEACHER
143,596,057 *0DC4966EA8DAC522619AAFCFD92CBE482F6089A8 BDW/H
143,596,058 *0DC09EF555A52F9A2AC9CF3D111B850115517C5E 5TSUALAEL
143,596,059 *0DCB468F1C57339A85BC92279356F4F9F82EC780 5VASTAKKAISELLA
143,596,060 *0DC03D9DF8D34B0D4DAA2E1C3D6AAC12651D0304 BEGTNAA7
143,596,061 *0DC334CD425584F5C3F36C1C1715E1269B3FD5EE 619AEB0E
143,596,062 *0DCDDC72DB02B2CBC0D5C8A58D4F1B42B3DA3937 BF4/(
143,596,063 *0DCF777C2B7DC97C791004D02B7349296267543C BF89K
143,596,064 *0DCC048E5D6211764EC14D493EC480A681E65013 BFQVR
143,596,065 *0DC2F00B047BA9DA5FF5DDDFAB2168BDDA3CBA6B B?FTU
143,596,066 *0DCD40E881AD96225DDC7876195C5EE135AB1F83 BGG9L
143,596,067 *0DC058B0FB413357C56BED3F093317CEEB6FA8B3 6HOENACK
143,596,068 *0DC59511FF84C7B9EC151752D59CA1D3D8AF4D15 [email protected]
143,596,069 *0DC2330BC251B2BA35A42B0DB3E92EFECAE7C0D7 6INTERPRETACJA
143,596,070 *0DC66A42D8A2CA162B651033FA2BD706139F160A bhdj%
143,596,071 *0DC7B6813711639083670DA0BC9C13344E4C12FB BHUG#
143,596,072 *0DC209FD8C9702B21B8C6D6D7AB5DDC07941238C b_.i/
143,596,073 *0DCF137E6F5DC70170114A9B64E4226EB9EE8260 bi0zp
143,596,074 *0DC6A17F799BF9C76560EA72E65978BF58065399 6ONDERDEKKING
143,596,075 *0DC88F99E8024FE198F917B4A59F7CB82F2349C0 b&im"
143,596,076 *0DC63B6B44AF67A70FBD338E60CBBCFB25FD83B1 6THATNEW1
143,596,077 *0DC391A006B93CD849597380ACAB1AF58E83F5BF bivgg
143,596,078 *0DC0413AC8C8CA4F474CFFFD7077F619DD4A5761 BIZP:
143,596,079 *0DC1A5E35D2681B131B1A3E402A596DA40E135E2 BJX0D
143,596,080 *0DC86DB048BC42F5DDF54D0FFAF8A50CF377C734 708403 se sijaitsee tavallisesti s
143,596,081 *0DC139E27A05D5CA1C29C510FF813F1EA4799723 735cohen
143,596,082 *0DC3E9D484804000453C250E59E77E6287BC1C02 blp4_
143,596,083 *0DC692200F49D77ED841A479CA45FCB2B5DD130C [email protected]
143,596,084 *0DC10C568B8A9854207B59D0110D9D2B2116A51C bm6r-
143,596,085 *0DC6ECD05E5150255130B7463FBEE80CBEC74BFC 7AUG1146
143,596,086 *0DC9164493E722C2569695B04318EB74396A27D0 B-&N
143,596,087 *0DC7AE9456326DE257ED84600AC25555BDDBC36A 7CHICOTOPGUN
143,596,088 *0DCCE56B572C34876DA736FD65EDE33F1EB14AB4 7EJERLAV
143,596,089 *0DCD2C566D7082F99A7C9B191F14862F46CD0AB2 7GRNDPLTT
143,596,090 *0DCA0BE02425D043ABA929B9C09DD557E11CE667 BOBSANDMEIER
143,596,091 *0DC0D67BB14B140EB9A2B6ABAE1F7865B63ED196 [email protected]AHOOCOMHK
143,596,092 *0DCAA28E6F9CE06989A24F4991F33A851C5F1186 boekelt
143,596,093 *0DCF017D23BB0CFE57F8C1FE0CCC8AC0E9F66FA1 BONNIE.BENDER
143,596,094 *0DCE72E3C03682A8FC8B7681D2FC06D6967E5A53 7SEATLEJU
143,596,095 *0DC11E8BFE99D4A2D84B59D9822B5B8B9FEDA640 [email protected]
143,596,096 *0DCF3034FA2CAE8E7FC81F3562644527E96703EF 7SOLTAIN
143,596,097 *0DC6C6D0D239747D7624E87BED8EDB4B79D28B6D BOTHA061
143,596,098 *0DCBC1543F70841C41AE8FCE10972861E170EFA9 B--P `~)8(
143,596,099 *0DCC552B9613BF66FCA9BAEFB45A3E06C58CCDBB BPATTON709
143,596,100 *0DC94A2329F1B20ACF72615E9563B2D7B4B1349B bq/#9
143,596,101 *0DC148E9FD3A59CAFD0BB3E31C7D4CDEF9AD5802 BQFFD
143,596,102 *0DC6BBB129ADCB499258305D5B3A9734E7D578B4 BQGR!
143,596,103 *0DC7BF5EFD293E2D1A4D420EFA3D4665D18153AE BQNWA
143,596,104 *0DC6EB4E5840103C71FA5ADF064BF99B2AD40DA7 b&r0
143,596,105 *0DC1A3EB10CF699AA8D83EBF5DF06CCBD5EDDAD4 8ATNISRAK
143,596,106 *0DC4BECE2F9AD174176E854D0FC0F4597C17943F 8------b~osplat!!
143,596,107 *0DC5113CB380190F99D5E86F6618E9CDB3A3D157 brandenaldredge
143,596,108 *0DC97D6D725571AC39541CD38B43733040CD0609 [email protected]
143,596,109 *0DCC74D94F38DDD8DC89167CD431D41A5D776447 BRASCA5
143,596,110 *0DC7282404BF1E4EBC0F0B098D22741577BD113B BRCWTOYJ5
143,596,111 *0DC1CC06586FAC61A25449B795C6F6CC7847AF77 8EFFECTIEFSTS
143,596,112 *0DC093A8A5E1C865AF76B5062EB71ABAF2A34027 8HORIZONBEATLES
143,596,113 *0DC1181E229969DEE735B6C1C14CE608B647D378 BRITTMULATO
143,596,114 *0DC9FA99BD59A14CB5878C43EF9F230E056327B5 BROCKVILLAMIL
143,596,115 *0DC11C4DB3341A06253A49E7B973E969E2106CEC 8PLAYAFLY
143,596,116 *0DC93D7A54F54583CADA7E024EBAE5EBFC6DE045 8TLEMRAM
143,596,117 *0DC5BA50EE72977CE06AE177D048BACC3FBC4559 BSLY-
143,596,118 *0DC0E87E3EDA9E4DA95F4A3C0ADCF070D7BB2500 BSNNES
143,596,119 *0DCD8DFEEF4CAA352596E0E2E9A613FF5EAE8373 905929 bala-cynwyd-,-2-.-august-.
143,596,120 *0DCFB1BD6F2D5A14C0F1AF40173C846331B5ED59 BSWMCRIPLEYBSW
143,596,121 *0DC69B4EFDC73319EEC584F00696567DD908DE4A bs=yb
143,596,122 *0DC0E7728E0524592D087348AFF12FA831B075AF BTTCHTN6
143,596,123 *0DCEDB2F72408A0CD7451EFFB65040AA0D79327C BU4f
143,596,124 *0DC2A38B92152A2D24B0C2858344634F5C3F1669 BUDDY.HOCHHAUSER
143,596,125 *0DC8F1D2DA545BF9A4EE9556565C97F2CD819246 bumptious-a:
143,596,126 *0DC070D283063772026E0401EB09F463BB2AD21B BURNSIVAN
143,596,127 *0DCB1861A66E0A12A4EF14400624FA1EF98994CB busterbirr
143,596,128 *0DCD583CC410197A0DBDCD638F9C2E52DDDAE0A4 busterchisnall
143,596,129 *0DCBE5D1DAF488611B781F1151F54D12546247EB bvda8
143,596,130 *0DC9420690EB9E70778D9A702C89FB73B6532F94 bveui
143,596,131 *0DCC2F5161BCDCE3C686F4D5767AE3D5DB57197B 9BSWFRANQUICIASBSW
143,596,132 *0DCDA23B59C6F3B1F7469E1A61463963AB370A08 9CHOIX
143,596,133 *0DCF37EDE6A9ED694BA7E80E13C9D22178A0AAA3 9CONCEPTLOGICAL
143,596,134 *0DC241E33F2CA9D67035F6FFB950ACD4F6837E0B 9DALLRAEN
143,596,135 *0DC99289B00BA92B6CAEC45AB55AF234DBBCB15D bwindeyer
143,596,136 *0DC30910CBBD8E1E3EE082F864226D01E1D4B698 BWQU"
143,596,137 *0DCCC985A207156AE5B19D8B02D3B833A7B1F945 [email protected]
143,596,138 *0DC3967CD6C11B1246168E589C9F8E7377025FE0 9RAINBOWHONEY
143,596,139 *0DC2FAC389A47D4E39E6668400AFB4BD5E539FDF c2i(s
143,596,140 *0DC2B0C9F5D3F28F1515BB1FB50B058E573E266D 9SANDERSSUMMER
143,596,141 *0DC2C804805967FCAD30FC79FDD33D95F7EAA80B 9SKINNYCRACKER
143,596,142 *0DCD3C6A5EB3D4B5F395E6DB05AA63DF31BBC869 c4gwv
143,596,143 *0DC2B7527F8841DA74207C728CF38E468EED9170 9WEITERBILDUNGSEINRIC
143,596,144 *0DC441098B18CD0D0BC35150E6B7072BF607C1C9 9WONXHWA
143,596,145 *0DC3639FCA066DE2DB69BA8A2EFFAED69EFCE9E7 c%/5
143,596,146 *0DC8C1D9FD7D8BA325BF08CA5C9DA3F779CE8896 C5W9T
143,596,147 *0DCFEF2B98BC46E9B5A4781411845C5F791B71DB c/6gt
143,596,148 *0DCF9991F5506DCC034F16106925DBBAC3216685 C6L5
143,596,149 *0DC665531E238DF013D0E7BC4B6A73D0F2B701C0 c7j_r
143,596,150 *0DCDA04689DF13896793BD4806FE6E0BC5A32A06 C8JFR
143,596,151 *0DC03F7B6497C7798DB59EBB7225BA6915D7DE3E CA7T
143,596,152 *0DC3CD8C85BEA0CF3AB4F1F6443311A089EE9D3B CACHETEE!
143,596,153 *0DCD2681B536E4209D3A41B983E64B690EE33E3D A3st
143,596,154 *0DC29690E69C63E30785ABCE49480233E3FA198F caesar1924
143,596,155 *0DC4F85A86233E1B65ACD4131FC8818759B421DD caestui6
143,596,156 *0DC3F0523145989C5E70A3EAD61A2A068E92BD81 a5?qb
143,596,157 *0DC349B162A19332125850ED9688F3FEFC56DD76 a9d:r
143,596,158 *0DC9BD2DB23CBE9F01A0111F5350D1E3C8C0E1BC A9PHORE
143,596,159 *0DCC6291013BB128C282692E9EB6C1076637F624 CALDODECANA
143,596,160 *0DCA5A3BC7C976CE90DD14282426E1A6D322C2EB aa4ov
143,596,161 *0DC1E54EACA908CDC549A2E75FFD60799BE8A4D1 AA7116
143,596,162 *0DC0FC5022687E5EE8A998F2235E1B9775F1C695 caposdistrias
143,596,163 *0DC3BC2D149CDFF0365A759F32AB4C4293C9E507 AAE;VU
143,596,164 *0DC8CEB5E5CD2B1518F86779F8DE2935DCDDEB3A AAEY"S
143,596,165 *0DCDEA5043B268963ADD05EE6A68DDC4D18C372E aanci
143,596,166 *0DC7D24D4D5B3B4684BE6A193F24A227665981BC aandeleportefeulje4
143,596,167 *0DC3E15B1A3B58EB5F817A92E94D25FE26F6C119 carmelobuchmiller
143,596,168 *0DCB2779B5BF53E013FD0CC0428C85E78B7E4778 [email protected]
143,596,169 *0DC733D404952BFBC43FEB76DCBF029DA6C7C71E carri12345
143,596,170 *0DC1AFB1CC1724FC82EF5FAD158F9B5B03C2835F carrolvillani
143,596,171 *0DCC4B07EF52658843C3B4BFF2C9E3544B6DFD50 ABBOUD14
143,596,172 *0DC6B2ACC2DD02885024A2FB46EF52B7F0699AD2 ABBY.FORSHEY
143,596,173 *0DC7FB6AA7C37555223D6F67A73B47A68FB5FF94 CASEYMALABANAN
143,596,174 *0DCC901E015BF828A89C747E20316BCC53B18DEC CATHYLINDA
143,596,175 *0DCA72CEA493E0D9921B28605AE1C8415E1D2246 abwll
143,596,176 *0DCFA09ADAAFDBB8B1CC83B17D9A94BB23E4C148 ACCOMPLI
143,596,177 *0DC6BA8A034A4C283FF32334A3840197244244BB CbQk
143,596,178 *0DCCCD1DF6AEEBBFAC6F4344320E723441D6CBA8 CCC4E
143,596,179 *0DCE023069E610077B9B4074DA1C98FA53893E38 acnds
143,596,180 *0DC8CD8C2849CEB275CD9181EF4388515885DF4E Acte-II:-Le-voici,-le-Roi-des-Rois
143,596,181 *0DC8ADEED5C65A85BDFD9DBB3D62F5FED0948502 ACUTILEM5
143,596,182 *0DC087AE002450656BD007F3E12C3666AD118AD7 ADERYUSHEVA
143,596,183 *0DC4C0C8766CAD8ED0EEBFC5B7567BF4A7A48B2B c#dhe
143,596,184 *0DC1609E04AEED05000FD6E5DEEA0DC96D86FB6A [email protected]
143,596,185 *0DCD840A25584316B8695A0BEA98D094BC876C9C adnez
143,596,186 *0DC8FE8FC5FC2B7CED7C7A3C4107CFEB0CB4E439 c;dug
143,596,187 *0DC9DAF0B999E3EAFA802AF639E725B13C86E6E4 ADOPERERETE
143,596,188 *0DC65630A255AD20AF518B691FD91FC2133AEEA8 ad]p
143,596,189 *0DC50EF563633331A4E37CC90AFD2A4ED6878A62 adriancallum
143,596,190 *0DC55F24CF30CA093017D7B67DD28529476F3B66 ADUOCATO7
143,596,191 *0DC644AB8A1669F663AA954064296CB6B16823C9 ae2bf
143,596,192 *0DC754D355EF121AAC5690C9F54BF4D3C0E0F699 AEAERTAE4
143,596,193 *0DC76F056F5EAC5BA40D214621334310273BEE96 aen522
143,596,194 *0DCB597C1D25994F4751FF7F9A2F7CC3C3B956B8 cettes7
143,596,195 *0DCEC98372C24C4678E2653BDC7ED4379DF48E8C CF0QF
143,596,196 *0DCDAB0F72F1C480AE1C38C06B4B3A63AE638196 CF2SR
143,596,197 *0DC75AC880830A28AD3881FB8B2DD565E918897F CF"EK
143,596,198 *0DC49D640ED4AC4F292782A7D1E34929D4FFC64F CFI!I
143,596,199 *0DC29825F5E93C47DF18D27B74B111DFA4B2754C CFSQQ
143,596,200 *0DC47AC2A278DD0F177691D89E9CE8CED6F529A6 CFV2C
143,596,201 *0DC1F1FE10890F2E4DE524E4297F523F507970AA c_g2p
143,596,202 *0DCF2BF14AE2C284FA22F60058C853E41F0A34B1 AFRASONNENAUFGANG
143,596,203 *0DC4106529545DF8FD5D05D18FC2211EA1815433 cgf1,
143,596,204 *0DCF5763D55C5E8AE02DF31A87740C208DF39F43 cg/z=
143,596,205 *0DCF1AB5813F325EBE15B4279EDF542C54555E66 CHACONNEINFAMAGGIORE(HWV485)
143,596,206 *0DC8206BE3EF852A9C47AF73C3077540EC30E690 AGELNEUE0
143,596,207 *0DCD7493E67EC66358B5E806851FF064F0E91C1F agerhcoh5
143,596,208 *0DCAC2AA021B7DBE8047698D61E814FDB7C90BB7 AGNIE
143,596,209 *0DC0E9126418FBA3A298A821B064AA8E413B4518 agnoomis5
143,596,210 *0DCAD3C7AD2C6CC19CEC163082B5E2DF8CBDB48B agxkoax
143,596,211 *0DC92F1EDFDC412D8CEB6229CA0B007B2D822D41 ahkup
143,596,212 *0DC06EA43A4A57D14457C16E038BCEBF3B7FFC92 AHNBAR
143,596,213 *0DC7F20D867D9456A14D7EEDB5E65C45141AF0C4 ai8f
143,596,214 *0DCD922D5E53665834DC6A26FEE237E3EE78A574 charliet
143,596,215 *0DCED851C28E9EB3A82D30E0767D1CB295013F87 CHARLY-LOWNOISE-&-MENTAL-THEO
143,596,216 *0DC47B7C60C315EE73043C83AFAB583D874630E1 AINBE
143,596,217 *0DC94DB7078DECED629CF843194254A670813286 CHEA.SOVANN
143,596,218 *0DCAB7CC6EA8893B7427F30DC002A5D28D1D18BC [email protected]
143,596,219 *0DCA29DB5EBD109AEB5A6CDC3953089A6AB4F1DB CHETGRUNDMANN
143,596,220 *0DCB681FB282AAAF9FEE9FFE44EAF7B7E2BBA0C1 CHETSCARFI
143,596,221 *0DCCDA50FC3E594431857EA432DEF883D32E5C83 CHIBA747CHANGED
143,596,222 *0DC1E2256E0C7B5E0729615016C0E5FB501FC89E AK1U$
143,596,223 *0DCAD876528D4D9446B281784A78E1B41B9715E2 AK&F2
143,596,224 *0DCBD99F3830C1C892C7603F743C7D39C4BF0B88 ak?l7
143,596,225 *0DCF72D5D5C8D890422125B622A25FE0F3A37148 CHONGEUBER
143,596,226 *0DC9E754A464DCB4222A8AC0C30758406378244F CHONGHEKMAN
143,596,227 *0DC86ED0C098807C5A21E32B46AB7D26C2E45EF7 choppies2
143,596,228 *0DC720D6FF6086E05C50EB9C142C7D4094E0D84C ALANREVELS
143,596,229 *0DC75E41CA98E0F7845F16375A44362EB188BDF5 ALARBUSES
143,596,230 *0DC7B2AA7B8BACE363661DC101F655497CCA99E9 ALEXANDERMILAK
143,596,231 *0DC9D00E54B39BAD1F562090D85ED7BFD4503993 [email protected]
143,596,232 *0DCAA4F28FC1B24D28D491F460A6056EA142073A christopherferr
143,596,233 *0DCF20CB4572C3B4CC7285E27B2BAF12CF295394 CHROWALD
143,596,234 *0DC11E76F2C6AEFA91CE7CE962C98153E9B95F73 [email protected]+hemum5
143,596,235 *0DCF485EA393E173B1B0CCF382393D7A91FE7FE0 algc5
143,596,236 *0DC19CC4525B3B8DDCF7C798BDDE91C1D3A61D32 ALI.AHMADKHANI
143,596,237 *0DC3341B9F54030AE3FAAC121D27F32E87A07472 ALIUGULL
143,596,238 *0DCFFCE3C6B5EC73B0307EE9E23A1985BF6B9FAE allatyes
143,596,239 *0DC34AE36E143B032F3895A88DB331AFF934ABF6 ALLENCORTES
143,596,240 *0DC1DBF3746684676B95A70C6049E7788794AC84 CINDERELLA,-OP-87:-ACT-I-INTERRUPTED-DEPARTURE:-VIVO
143,596,241 *0DCFFF6B23DA487CFCA034CB9DCB5AF371675D58 ALMETYAC
143,596,242 *0DC7FAAA3C32A2A1018375CA9C7F448EA05D0AF7 cio__
143,596,243 *0DC109DB738178511C93F73ADAFF47E53C3EECF4 CJFMB
143,596,244 *0DCE836FA6EAE4051D4CA5D2B85E9CE8CB738B3F [email protected]
143,596,245 *0DCCD9F3331423846474094DCCCD8542C213309B alphonseali
143,596,246 *0DC722A90F24403F4D9AA0B2B3377D77462243BA CKPH
143,596,247 *0DCAF8E38C3052A28748A704DE3215A630A1D603 ALY5Y
143,596,248 *0DCD54A587E4A109CB1337DE4A8E5C898BD0A5C3 claudchristou
143,596,249 *0DCC2263946BF1D17FBCCBBE7FE454C1AC5724B2 am3m
143,596,250 *0DC0A7D824075603D2EFB2840B7ED27C96AF5F42 am4qd
143,596,251 *0DCA189A6299AAC9241EC98B698241F38F7D5EA5 AMACETNA
143,596,252 *0DC2F75565918620BDD2A1A3D48CFB4F08B8FF87 ambtspenning5
143,596,253 *0DC4FC5017470D7EFB961C3FA1850B566E9EF64B AMCVV
143,596,254 *0DC6FD3AE747F9FD4D6F56F0F2E23510ACAFE974 [email protected]
143,596,255 *0DC24E63756ACEF407BEBEE6E5B91C29C244002C CLEVELANDWELDY
143,596,256 *0DC355412333A56EDAF47AEA5B105D13B095C7C4 cliffordmountcastle
143,596,257 *0DC5F0A029A1DBC5A9D4C13EA710C680FE58A00E anaxande6
143,596,258 *0DCAAE1BC0B7A6B38C934698A154B690B636FBEA AN#B/
143,596,259 *0DC6068F787B0683589900E55255B320137A8099 ANDRE.PEIPER
143,596,260 *0DC9073C7826A05BE3A38F9D893A6DA38BEF7AEF ANDRIJANAIVANOVIC
143,596,261 *0DCDBF9C894783C82D35D25BD275601A05829218 cmio
143,596,262 *0DCB5819519BFADA6B41841054CCA7342F5079E4 angelenock
143,596,263 *0DCC561084086D72C59AB2151974A9A333D2D1FD CMODKINS
143,596,264 *0DC689C535EC5D255A805F50239A482AA1F144C0 COC9A
143,596,265 *0DC6969F1AA90BED72A1A7E099F93905060393B9 anirl
143,596,266 *0DC3F7CCEBEEA9DCAF917044A9C209ADEF7954A1 Codomain
143,596,267 *0DC44F357E23FB7337A08495FA1DC47FBEDD9854 ANTHONYBECKLES
143,596,268 *0DCFFE00CF502B2DA006CAC1B94449C31EB456AB comoedie4
143,596,269 *0DCD87327D82092A40AB5182FDDB6CAC4973FC91 COMPUTERWOODLAND
143,596,270 *0DC8F2000EFFCCD36AAE15790C6A2C99ECCD81C9 [email protected]@RY
143,596,271 *0DC850B7645B83373CF9C279EAAB3CA2FC2A92C3 ANW7E
143,596,272 *0DC047BE1135B22628F0B699D74C317E05B58F93 CONTENTIOUSGETAGRIP
143,596,273 *0DC48D2AAEE73A7ADDAFAD26F4145FB60911D3F1 apfa
143,596,274 *0DCAD3E2C82AFC396DA06816E061557CE5858C03 CORACINE
143,596,275 *0DC5F3E5F450AD9CD42CF2ED90F6B588CF5A543A APRÊMIS
143,596,276 *0DCD6C5160F6ACC1D088E6E32E1B2E329CE8FA54 CORNELLDAVI
143,596,277 *0DCB85E15E7BF05A01B2170DA54E6063123B0363 countrysuper
143,596,278 *0DCD7E02D5C7E9A3431A7CCC240EB39BA74A626E [email protected]
143,596,279 *0DCA04BC4FBD15D8D2E4C5A11E77B5E5CAE630E6 arcticize4
143,596,280 *0DC04271E5D925AE60D26C3D3E0D2C30B404DA9A C%PIE
143,596,281 *0DCF7D60603B1E3A57D4D39025DBDA314A5BF0D7 CPR-C
143,596,282 *0DCFFEA9D9F36BFE5C89CDC48E2C81F47C5C9FC7 arielcurl
143,596,283 *0DCABF9352A3E7A1C4E3B351F20C32E4D48067EB ARLIE.GECHAS
143,596,284 *0DCB2F8443153CA71B676FA97E83FEDC56741AB7 ARLIE.ROSSLER
143,596,285 *0DCDC5BDD26D0BD5B3BB26DADB8D34EF59D373B4 armandoodette
143,596,286 *0DCD90E30A938CDA01D52F96781D4C735D0191C6 ARMENTEDS
143,596,287 *0DCD1B26C75ADC333FB7C3EA911C583C1E3B059B AROQP
143,596,288 *0DCFAC58C4D2FE9A4846B51F97ADEE4691141546 C:\Program-Files\Microsoft-Visual-Studio-9.0\VB\Snippets\1033\os\EventLog\WritetotheMyApplicationLog.snippet
143,596,289 *0DCC83302D8083B10013E946509875F4425D210D C:\PROGRAMFILES\MICROSOFTVISUALSTUDIO90\VC\CE\ATLMFC\INCLUDE\AFXOLEDBH
143,596,290 *0DCDAD08BA7A27C2C11EDF5C82373C0958218526 ARTICLE1486663
143,596,291 *0DC78F2A2856252955B54462772103394142FF4A ARTISTAUTHOR
143,596,292 *0DCD3B37EED4F5C4260EAA2621239C5F7B8F6C35 ASC3U
143,596,293 *0DC829460880067D55AA75B48FB3395333E3F5E8 ASHLEYHALSETH
143,596,294 *0DC2F8A5968B7B142A17EBA46A704A93FB52EF10 asia-union-stub
143,596,295 *0DC565D48A8EB3F21759934C8F9073D0157821A4 c)q6
143,596,296 *0DC5B45C11F9A302B4FA73C0FC1B0C45CFD8695F cq7);
143,596,297 *0DCD4AE6FA56DAB628311240FE4BBB62B49B39D3 ASNESATU2
143,596,298 *0DCA8681EA0FFE51698CCC3F45D9FDED35BD6356 cqfcq
143,596,299 *0DCA0D535D69FD8C33BC6FD6A6DB1D9BFCEB86EC assivism2
143,596,300 *0DC45BCBA5D635E2AB9DB2E360564601C5064A82 crqo!
143,596,301 *0DC922B77D94A4B2F561874147CBC1C34232760B augenlidsed
143,596,302 *0DCE27FCBA66B1E90A7DCA2586FA96CDEB5ACE74 crwpr
143,596,303 *0DC638E735F2B32ABECAD08430287D682A4AA58A CsHt
143,596,304 *0DC1C110979F84EEE07086866880CDDC83EBB03C csq;?
143,596,305 *0DC3AA63952D12D2FDCFB25C389DF5EF7BF2EBF8 CSX5T
143,596,306 *0DC2C6E3B6F80D00E3062907D64A333BB63AA629 AVECILLA3
143,596,307 *0DC0F77B5FCF107B1E3DE4456278B0274D04A611 ctt4
143,596,308 *0DCF1CC3A8C9C20B3D88E942607983CF82018225 CUAGO
143,596,309 *0DC9CA750A596D56005A3C1F22C9FD3363CF988A CUCOG
143,596,310 *0DCFD4B5297B9E28079C29DB12503E5AAD3D9064 aweuw
143,596,311 *0DCA874B10DA3432D35B27C16AB0CBFC3AFB2C21 [email protected]
143,596,312 *0DC4A61E558567FD9D82C7641F80C828303601C1 awzrn
143,596,313 *0DC17525AD7B0048E82D9E5088B924BB42A1A7A9 AXE-H
143,596,314 *0DC6CD14C33EDB7D679DB68AE96317FF0634792F CURT.STOLL
143,596,315 *0DC6DF6A6F8D851EF479C6B5471CB1B88E56DD23 AYSAKAT
143,596,316 *0DCFE7ED7D2C2CE724003CF181C36BFE6F30CF98 CV,CD
143,596,317 *0DCD92A85530F08B36856A62967BB8E993811EB8 AZ$%
143,596,318 *0DCF40127410766B8C01A6E507E87B59F028B9FE [email protected]
143,596,319 *0DC4C993E5D3975A1BA4FFAAA59E6383B1ACC384 >-<.*.*.(#B
143,596,320 *0DC6B8595B21A21CCA78796CD86DB9A8D27150D9 [email protected]
143,596,321 *0DC3FD4B6012AA0E0C240690F775E71291994FE7 c=:wn
143,596,322 *0DC9658D8263401B3B88121640326B02E42A5442 cwwdp
143,596,323 *0DCCF9FFE54DDB6E15ED249EA0C1A17F5C1865C6 cx6qb
143,596,324 *0DCBAA288C15E16DE9DB899D3B9A0ECEA8292604 b/04
143,596,325 *0DC5611F9C2FB0D5AE5A20B69E88FCEE184FB50D B($0K
143,596,326 *0DC7526F42826D833017E103DB6C3D474F632E92 B0(l
143,596,327 *0DC26B4793DF62BD7224AA12E1A9EF35C37F7410 B0_;L
143,596,328 *0DC3E2AF53DB9B20974117D3FC4A598F39DCEECA >[email protected]=P
143,596,329 *0DCA022AAD2E6C544F46E69C82EDDC702E343A9B CYBERMRK
143,596,330 *0DCB9A063F6AEEC8CDA21DB645F1D2326ACDDE0F [email protected]
143,596,331 *0DC622E537099589EC9CDAD7EE109D4F8DFF112B c!yrn
143,596,332 *0DC273BF9B02A45740B871E987DD224F0DBB1577 B2WW
143,596,333 *0DC8A1C3A7EC507911C6B3DF6C20CDEA80CB8D1A czdnn
143,596,334 *0DC4FC5164A58CEEEB3A07ACEA212FB321392C3D CZGG
143,596,335 *0DCC95E31A7F6C67ED792D02544161C10F90595F b3!wb
143,596,336 *0DCF70296A38AD3202907B88CC39265AA9C2186A b5uhk
143,596,337 *0DCCBDBB0C1D5C7D9631D2542D63AEAB6EC06C0B b6hl%
143,596,338 *0DC593130DAE88D6FB02162DB39523B38F4BD5BA d1tl
143,596,339 *0DCEBCD75578AE7401713CAD6E76BC273AB7C09D D2UR&
143,596,340 *0DCCD508B40BD92CBD71C0DC54C5DB4C07D014DE b9qe
143,596,341 *0DC7C7A782E520DB3629B91397ABBE57A645C19E BA&5H
143,596,342 *0DCC1E6E1823359799D038D16A65507D345F07EF BABYLEGS
143,596,343 *0DCF0287CD7FBD40CAF8093AE2E0E8715A808C10 babylon55
143,596,344 *0DC6632EEE5950FA9C2FE14F6EF4B1FFC2D66715 backtocuernavaca
143,596,345 *0DC510AE49111A0C1824E3326A3D67851701DCAE ba-ej
143,596,346 *0DC206638C0AA7CDA35BE94A5D401589EB67BFD8 d5b3f50b0cc331308b907976d3754717
143,596,347 *0DCFD13D36CEF36B5230090954BA30975A08AFE6 d5du
143,596,348 *0DCEE36DCA140106C87B544A54C476EB442880BD d$7h7
143,596,349 *0DC51BD8C434664F5070662FFC07A46BAE88FA57 d7p6
143,596,350 *0DC7322124D84434085784C0A729F4932132A264 [email protected]
143,596,351 *0DC92A1922537595A5EBEA2FB08EED10168ABF29 B'''ANNED
143,596,352 *0DC92A16AD19A94BC3F0419DE7B689E27B8CB818 [email protected]
143,596,353 *0DC198252D366D76CE8EABE9FD4C6A611D81F78A d8_h
143,596,354 *0DC6BAAEDDB01B79732A0415AEFAB365285641B3 D9GPF
143,596,355 *0DC4962ACC51F2B7086FD5DBBDEE608D0BCAD98A da7vc
143,596,356 *0DCE7140C10B824563DCDE2C28E847F999F0E0CE da,go
143,596,357 *0DC0D3D53DE6CEF80CC287B0546753A39ACB1440 BARTONGOUKER
143,596,358 *0DCE0A7C4AEE094641240362AE526F39C0E66251 DALLAS.ELLERBUSCH
143,596,359 *0DC72310BF15A37E49E36E4107E1E8C50AE8E12A DALTON.CARAVETTA
143,596,360 *0DCCB66C1EC544C996F66882413733C1D11544B9 DALTONSILVERIA
143,596,361 *0DCDE4F9A219DECB4F3C7B4CD8772393674B8F36 BASILTAQUE
143,596,362 *0DC45D21B813751E4D8FBD15C4CD5A0B2003AF20 DAMIEN.HOLTGREWE
143,596,363 *0DC836741F2FD155EC64808BBF94519FAE28C1C7 danilolamb
143,596,364 *0DC9F86125C18D3E43EC581DEB2CFE1BA586CD46 b:cc_
143,596,365 *0DC660E82555ACC53AE45A303CE495646C634B1A bc)og
143,596,366 *0DCAEF118BDB65822358254151D8AAAEB81940FE bdd"q
143,596,367 *0DCC6E708B0B20D37E394CECBCDF246B3EC190F7 B==D`~.`~Splat
143,596,368 *0DC8DC0BB88DB6D07FB633ADAB46902AC698AA1F bdubs
143,596,369 *0DCF9B2BFFD8C20D7BE10DDA2EFF8412C2FEF83C BEAUGOY
143,596,370 *0DC761A019A2B343881C126CFEC16BE929BCDBFC BEBOUWBARE
143,596,371 *0DCD56F9A1951C300F78E5831F9ABA33B108ECBE BEIRATSPRÄSIDENT
143,596,372 *0DCB05C1F0B4F8E31FBFABA040DB3BE18E60C9AF BEMANGUE123
143,596,373 *0DC991C49CCA3255E8433FA6B9006C23D53B2EA9 BENJAMIN334
143,596,374 *0DCF4AE089CE60B1309D0ACB641F7A59394F580C benjaminbruckner
143,596,375 *0DC6077B0BA75F28C61872922CE1B6D8266922D0 [email protected]
143,596,376 *0DCB1099B00C414BE2D9829CEBBADE389265E6C1 DAVE.BANKSON
143,596,377 *0DC0943E01214FBDDCEE3967F430E82E7A2F86C7 davidleemercer
143,596,378 *0DC69FDAD6BB41B388BCA461B69A9841EC3AE463 BERNIE.KON
143,596,379 *0DC68873D0D8E25AD53C3533015ED3114E9CC0F6 DAVISPOLKAMP
143,596,380 *0DCC3D6ECBC129DA40B7F0D16E22CEE937DF6142 d;b3w
143,596,381 *0DCC1FFFD819056037A73DCDB888BCC402AF4EFC db;o
143,596,382 *0DCC1F4D51E50DABEC13557D89D68F9D01C2DEE1 [email protected]
143,596,383 *0DCC917EF4D9F68A3A4989988B52F8892E6932FE DC_L
143,596,384 *0DCA0FD345D01DDE06CC77DC22EE28169A5AD53B DCLF
143,596,385 *0DC6DD410088978F965D41147884992F992CFC1B [email protected]
143,596,386 *0DC087DB42C7F971906F6E8B40FC8F39924C96F5 [email protected]+ely
143,596,387 *0DC7D8EB0CD8857F4B50A3A6ABCAFE81426CE9FF bf6vl
143,596,388 *0DCF45F66CCA30A4D63C2E1CA7CF1020AAA7B442 DD4EF24FE14336CA82EAE0D0B86E1806
143,596,389 *0DCB45B5308CB9D6D8005BB3C0C68FAA4A675B18 BF$OB
143,596,390 *0DC3290624DE40B71012EBB48CA6FE0D37BEC800 b.gb#
143,596,391 *0DC583D04329663C0D896AC59AECE9417A900A03 B_GCR
143,596,392 *0DC20B525B3728CF912288C334A9F7148B79BBDF ddk5h
143,596,393 *0DC5D96FB475430972CF8ECEC48D3B7F832716C0 [email protected]
143,596,394 *0DC5DC700CC9F25F57B86CEE6DEA45E31C376780 DE0M;
143,596,395 *0DCB030BEC7E30D9DBF53A96572988A75D0CDBF1 b(h"
143,596,396 *0DC6D38B0B021023BAE4965632F39CEFDFC25CBF deathagonyfourthinternational
143,596,397 *0DCFBF3469140EC0E7C260AF547A61DC2519C6E1 decurionate7
143,596,398 *0DCC932AB2A8A50324FA44CD5C09DBA123D5E8C9 DEDERATING
143,596,399 *0DC1DC01C416C7C4AB09AF66B4EA5DDCBCBFDC6F degammurcs
143,596,400 *0DC4A43F2236F213706F98CBD68112B7DCE69477 deivilalltidklagaogkyta
143,596,401 *0DC926EADE1C2AF9056F4618B17DD255FA7B6B46 [email protected]
143,596,402 *0DCF03B03E2F971F5764A180615C8FC644247513 DENIS.VONHOLT
143,596,403 *0DC171F300EDFC1F29F346D3993D7FCAC36465F4 DENNISSICLOT
143,596,404 *0DCC60EEB872DB6352522B03BBFBCB85C6A0D1C5 bit.bang
143,596,405 *0DCF86D3C4CF0536B4AA551F0CB52D828049090D BJ0P
143,596,406 *0DC7616D3B1F647AA0F7FC4F99AF5696C27A6B0E DERICKHOSENDOVE
143,596,407 *0DCC769B5724086BB777706614F7370B7F2B0CF9 despinis
143,596,408 *0DCEF5BFE30487F05439964FD48AAFF7AEE2F19C DESTAALEMU
143,596,409 *0DC0529D0AA69B4ED5D855E5598CF590C40612A9 deurccanon
143,596,410 *0DC38F45868969C1A2A6983F108DEFE087843A06 BLAME.ALUN
143,596,411 *0DCE37D682E413905F3A5D58C831D395F21ABAF4 DEWAYNEMUNSTERMANN
143,596,412 *0DC9B62AB3B2745337538003119676055E35D012 dextroduction4
143,596,413 *0DCF24DF087DE16ABAE5C8C8DEC1E3505F4B920C DFA$
143,596,414 *0DC6F7B2C5E21AB1EE5CA505270B0025B0816704 dg$el
143,596,415 *0DCF4B4903850508E51EE21B0827C634B0B28CBA D]^H
143,596,416 *0DCDC24DBEBDB27DB3E2CD24CDE39EFCBCE730C6 dhh)
143,596,417 *0DCDE46075559F3A43515F3178907D64595989DB dhp3.
143,596,418 *0DC63B3A3657171C67EA75C7DBCBA3D65EAB290B dianewrobel
143,596,419 *0DCDEFF8094B7B3FDE8BDFB178B30994CC6F3ED1 blockremove
143,596,420 *0DCB21ED9F166CBD72F48161507C59D0175F7F13 blowmecowboy
143,596,421 *0DCDAFCAF08A7A37D2897C25DA45133D6019A73C DIE.E
143,596,422 *0DCC9DEA960B476E076E21B188302D44F217AFC6 DIEGO.KUNDE
143,596,423 *0DCCD91484D25A248E8836094D1562B42668BC93 DIEPDENKENDHEID
143,596,424 *0DC3FD9C623447B65B2449CD46E6E34EDB94E460 DIGEAIS!
143,596,425 *0DC4F160B9D4F818EF45A53043B1B0FF850D3469 diggins?
143,596,426 *0DC4019AE95C8A869C33EAA30901D5620E41A384 BMAZUCATO
143,596,427 *0DC583C1ABB6CF92C8605629C9ECCB90B6BFA5E3 DIIFE
143,596,428 *0DCC6DB27FB1A0AAE14B11EC55F94C8D02AAB014 DINOKLAYMAN
143,596,429 *0DC2485AE0E6E7AAC5B951787648F619F638A3EA dixonpc
143,596,430 *0DC16971D268D53FF510821021E21AACCD62ED62 djfraternity(unity)
143,596,431 *0DC750E31AECC709E12337EA96C83BA443B0E951 djlu+
143,596,432 *0DCE7011D4DC26BA5FF7425D00E939A9F874D8DF [email protected]
143,596,433 *0DC80EE0E4F354D75A5155A833A0CAC3AFA4D424 bootham.park.elegy
143,596,434 *0DC9FD05F4CD233710F896E7ABF49A7D0A1DF326 bopo;
143,596,435 *0DC853F4F5D06E7D0D4D1F9D3901601B2F05A4E0 d"_l
143,596,436 *0DC59972D636A38C722FC91C1D1E26BD538CAC51 BOW_HAND-B/AU/_H/&/ND
143,596,437 *0DC160037570879DDF514624E97DC01A27A9302F boydreos
143,596,438 *0DC72C7248E575F304D00ACC581CC3592477351B bp0cs
143,596,439 *0DC12C521E400262E520BCD47FC54D0ED1073737 [email protected]
143,596,440 *0DC1968DDD9AE05D99B0FFFCC0A029DC8119068B b)pni
143,596,441 *0DC11407779CF7631CD4472294F20086C4271804 [email protected]
143,596,442 *0DCA66EA2AB72C93F8B05A142B24B6E795DBEB84 BQFV
143,596,443 *0DC655ED180246D65F82093CF7C52E053A43A6E9 bqn$7
143,596,444 *0DC274F4A7D4BC187BB3F4B4C60D87F80774FAC7 DOĞRULMAMIŞTIR
143,596,445 *0DCF8E210AC6B59A5B0E0BD6C66C7CA6896B0161 BRANDEN.GILMORE
143,596,446 *0DC7DB2A3C843D7E44674270467EC66890934AD8 DOMV
143,596,447 *0DC166C361FFDA5FDF312105FB1D7991506CA460 B!RB
143,596,448 *0DC4D10AC289686A6D959B0CCDC186FE262C7D09 doodsoorzaken8
143,596,449 *0DC97588857DC95669210760186ADEB9D93C0A72 DP3)A
143,596,450 *0DC7408CB02E91AB721CEFD40DFAF5D8EFF151CC DPAAB
143,596,451 *0DC56666239C873905EDFEBE85C44142BF5976BD dq9o,
143,596,452 *0DC5FAD4850FE52D889134042908EF13F0AD2A41 Dr/;
143,596,453 *0DCD79E0D5EF3C3AF7E90E7E1DECB6AB6F152880 brittmasloski
143,596,454 *0DC973ED42D03E7DF9DD979DD87BEEBD49BD5CD5 brittvallelonga
143,596,455 *0DCE4A9DEE49EB11CFDF41B9BF0159554A77A509 brockgaskell
143,596,456 *0DCBAFF7E6F94A2A043FAA0B469AFC08C53313F5 DRTF+
143,596,457 *0DCDF5B726B3D7B883B1DCCB4BE56C46B7F318DE DRZO
143,596,458 *0DCEBEF3DC4EC9E49B49CF333F8EFDD84A05311D d_s."
143,596,459 *0DCC5EEE4E9594E4DA2AB42ED2E36928D383AF95 ds+4i
143,596,460 *0DC3CB82A070F2F04F7B7251A4A7F8A4B1AD3561 dscrdtrz
143,596,461 *0DCE6B473394C56106DB108F153B5DDF30F56209 DSUF9
143,596,462 *0DCFD26E3B11785ABE3711E1734FE3B3CF239AC3 bryonanslinger
143,596,463 *0DC2986AE22ADB7C192BE789755D00C957F6D02E BSNT?
143,596,464 *0DC63A27A49825FD41F91AA4BC6A4758ACFA891B DUCKLEE4
143,596,465 *0DC12C1C63B612DCD6E56EC9C5549FCA1E30154F dueliging
143,596,466 *0DC2CFD6C6804F23F6D0F2A0A46C6DE107B2199C dulw,
143,596,467 *0DC3046AC23CD61C76069F9E303CC8D4B8636BE2 DUŃCZYKOWI
143,596,468 *0DCAFEA480D5FA2B0F8BC511BE53D1BE1B875EB5 [email protected]
143,596,469 *0DCE436B99EFD87177D55617C88A63A5CBE0CEAA DURECOWOLKENSERIE,VOLUME180
143,596,470 *0DC10788F89D5568567DC46ADD1147E1F25519D7 DUSTY.SCHRODER
143,596,471 *0DCC28ACF5CF55177659B1ECFEE34BB6B1A8320E BUDDYLEGIER
143,596,472 *0DCFA4E94DB5E6B1DCA733C80EABC5231E90FF97 BUENANGEL
143,596,473 *0DC9852711154E6E583336C3A2EFF95150D1209F dvb7%
143,596,474 *0DC4F3CE0DC515844164B8900600A73BEF99FE06 dvi5u
143,596,475 *0DCA9337055DB4B0B750FDE767272111D11801C9 dvph$
143,596,476 *0DC29EF5B70CEB6F37AA3FC78EB20BB5A02090E0 dvu/f
143,596,477 *0DCDFD9E97FCF40A9D96D3A4DE8DDA21A04AA418 BURL.TALAGA
143,596,478 *0DC877F6C18B7BB073B5ABCFD9653F377A72539F D:WH"
143,596,479 *0DC680A5C5E46ABD232534D5E901991566305D79 d:wi$
143,596,480 *0DCDAF26B051B4D12FE012F626D74C35C5C7915F DWIGHT.BECKFORD
143,596,481 *0DC52018725DD93CB2E8EBA411A3FC93EB5AE294 d:w-r
143,596,482 *0DCF500D4BEB5C8858292BA618940A23D74C7AAB DXG#P
143,596,483 *0DC538091AED8B3C34CEEB04D3596743E924AA4C d)xva
143,596,484 *0DC91928D2848B25C6124F38DD960584A0798832 dynbd
143,596,485 *0DC35E8FCA3FAD5E5A40CA8B609A7C92255B25B7 dzmcp
143,596,486 *0DC063F05FA339B5EB33B8B5860D25A93E0A23C0 BV5$L
143,596,487 *0DCAD7FFF068C6D6168D2088C6068AD95B503BAA bvg,o
143,596,488 *0DCA92AE55D98A7A3DEFA69D3936158560300A44 ealcf
143,596,489 *0DC8A7A8CBC6F13D603C4349719CC20BF05DD2B6 [email protected]
143,596,490 *0DC63F5DF6C6D52C5B0F0805623D5412F745E80B earlporritt
143,596,491 *0DC23E23CFA9E8266E7A25763DDE1702EA24CC19 bypf6
143,596,492 *0DC4A5FD111D2AD79BF155D90815AB814239C2B2 b%;zb
143,596,493 *0DC2F0A4882EBEA03CC3FBBAD606E741BE85ABB0 c_(?
143,596,494 *0DC1FBC72BA28936F7D9925D26F2B9F912A59239 C0A9ULAN7$
143,596,495 *0DC9D725580E0F7B19FC8C189E4544B5A1596830 EDGOSSARD
143,596,496 *0DCB393EC5236B75D4E3BB44CF0FE4D377CC3AB9 edificio.ed
143,596,497 *0DC5848A018AB948F934108A20F54433E75AC65B [email protected]
143,596,498 *0DC7B3A5D70F6F0AB9326573079FDA5676F1AF8A EDITHMANZANO
143,596,499 *0DC2782A2B6AC007A43FDDC8F6EB5931E1359E92 c"1js
143,596,500 *0DCF943515076AFB4C92D64C463DCB08404C1B6B EDMOOREGFA
143,596,501 *0DCCF7EB1B6FB267BF16BC84BA98B49B661D2B5E c22#r
143,596,502 *0DC5774A1A8909C131AAE3501B8D7D2DB833BA63 c29di
143,596,503 *0DCC7FE72D78E739CD5BB6E40E217344E79FECD9 edmundsimi
143,596,504 *0DCD301A244D2A532F5ADD9FD241A50A5C336C77 EDUARDOHJERMSTAD
143,596,505 *0DCA5F31EDCAD3DF1DEB75CFD761FEE1853180B2 edwardohrna
143,596,506 *0DC8178251D7D7354F63F147F888A088E5F2F305 EDWINAGLASS
143,596,507 *0DC7DBC6696B83568759F31AE250CF85CCB649D2 edylauw
143,596,508 *0DC415DF4AA2C3363F2652C409032D27400C0AFA CA7T
143,596,509 *0DC3CD8C85BEA0CF3AB4F1F6443311A089EE9D3B Ca9N
143,596,510 *0DC1F6C22D0E6D7638133CFCD7B4275CF385541B eg;bo
143,596,511 *0DC035B508F073BBD6FD6E9FFFF57BD336D1857B eh/+o
143,596,512 *0DCCAD7ADB2E4ED5C96E05529AA791DAF414BFA8 ehsan-aldaghi
143,596,513 *0DCE27FEB126D345625A5E98523174EBE2C8D556 CALVINKACHMAR
143,596,514 *0DCF09CB088A93A1378CCA19D8C2687701C27AC6 EIRE0928
143,596,515 *0DCE316E3769C5D1A5A02DD866584FED9F95E9E1 [email protected]
143,596,516 *0DC58635F29E106C14C1591FD403C87256D731BF CANAPONI9
143,596,517 *0DC82E19935EF629F50D8B30F68C0C6D47C39118 EKATSPEE3
143,596,518 *0DC096226AD8348AFD580CF4787E5732E3AF2382 ekilarbez
143,596,519 *0DCC6940333EE78A1AFE381F6AFC44E26C18461D ELANORLEAH
143,596,520 *0DC4427ED3B61191203D7FE3617CF39EDB820B30 element009
143,596,521 *0DC20DE0B93FC02976B09BBA000D0F32332A3292 carltoncleal
143,596,522 *0DC668A5B5BE07ABC60B62470429AD9D84059359 CARMENREHA
143,596,523 *0DCA217D481606D68A8F530D64D2D400ACBD2C19 CARRINGTONCOVERTAUSTINTX
143,596,524 *0DCC1CA19942A0A90DA04BFBDB643C2FA6E337B3 EL-JEBARIYEH
143,596,525 *0DC668C510F21D4C9E3E3C49DD98C6BCF53544C4 elliottnolie
143,596,526 *0DC45B3ECD2CA1DAF1B91C8110F9B476F3931927 [email protected]
143,596,527 *0DCB3C342887D2B7BCE79CBC65C44EC1EBECE840 CATALIN-LEONARD
143,596,528 *0DCC96C3EAED195EAB08F10A7245F4FB5AB86CC6 CATHERINEROLLAND
143,596,529 *0DC585853F20C8762DEBCDE2815E392BB8BF8E67 CATNAPPER
143,596,530 *0DC74FA200CA78BD205BA18537338147A5447717 ELÜTKOMMANDÓS
143,596,531 *0DCAFEA7BBE5CD997BBEEFD67E836318DE79D2D9 c(:bb
143,596,532 *0DC5C43631FBD174B30C9AD6101EC0BCA856B94D EMBALL
143,596,533 *0DC53FB74D265B91564ED339240E9FF532652225 EMERSON.PAGEAU
143,596,534 *0DC7887C0974D9BF9292D215D7234C9265087EC1 cccoi
143,596,535 *0DC73EBEFD5865705227B26728D160BCFDC03A76 emf?x
143,596,536 *0DC64F3838CA7318BDC2081E0BF928BE1955183C Emir-J
143,596,537 *0DCC353E484137338A03FC509AEC2F2E6A781B46 CC;SN
143,596,538 *0DCA08518F48AFE2C7080291EAF66AB84DE157EF EMrK
143,596,539 *0DC83F2AE3D93F117DEF2DAE78CE9F6F26EE3891 EN71213185213
143,596,540 *0DC0261C01764E04178DBC3061785511B19D76B0 c:dnq
143,596,541 *0DC54E08B2A4D73BF1550CB6BED78B14EB278E6B [email protected]
143,596,542 *0DC072387FA619E84D164B3E1BDC58DE1E043AFE ENGPIBER8
143,596,543 *0DC3334D834592BE65713C95679B482F2ABBCCBE ENOCHMASIH
143,596,544 *0DC7E4AE441C3D44E885F3ABF0BDA4722EE66A87 [email protected]
143,596,545 *0DC5C38F6EB481DEB20EC02277942832278A69FF CES DIEUXL
143,596,546 *0DC72E99F7ADFA09F31F1667DD77B453C87C3F99 CFA,.
143,596,547 *0DC373F1C815715143BD7DBB25FEE3A4158EC114 ENTZÜNDUNGSGEBIET
143,596,548 *0DC285476865C0261E98419EACCBB6A43337FDB3 epbn
143,596,549 *0DCC5372D3907A35D644B7A0E7E55F2B63AEF813 EPINIERES
143,596,550 *0DC93C35493C33C7D4CA74E7137B280146210A2A EPPINHCS6
143,596,551 *0DCF31F323D13F227BDDE9CE10465791C5E9BCF2 cgphd
143,596,552 *0DCC640BA909F0979366941AA24B9EFC58FA58D9 Ch"_
143,596,553 *0DC8E59FFBC338D1E0DAC00C8030E2B39DDC3AA6 CHACONNERED
143,596,554 *0DC2368632F84DB1626C1E1A42EBB995DBE76FB5 CHARLIE.BRUNA
143,596,555 *0DC6AF488E4210E94A85A3565971F0C16B54A9B2 ernestobjerknes
143,596,556 *0DC61AEEED7B353D649541E5B7D923E9E3E10C5A CHFFTNCZ
143,596,557 *0DCAE68469AD50ADBA201810E86874207CD8824F erreginaldia
143,596,558 *0DC31ADF2F1E07A6C8AD6E3885068B0F3D9C470A CHINAG-DETT
143,596,559 *0DC1F6D68D4331233C14E8DE2788EDCCBA8DD12E esolucsa5
143,596,560 *0DC7B453163B3A7C391B92B54E139BBF78DE8DA0 [email protected]
143,596,561 *0DC928DF0E1FF1E9B8CACC916650D1CEE117B5DD CHRISTIAN.BATTS
143,596,562 *0DC21B739E4F3EB8FD344EBE31C90C01B54721A1 EUGENIOBOSSEY
143,596,563 *0DC16295C771735B60D7E912669A4D52C5FD2725 Euphoria(Ambidextrousremix)
143,596,564 *0DCF7C2696BEB6726EA25377BC98C81B82AA1E48 eventdateid
143,596,565 *0DCE53B65216BFE2A8CFA2A685C44A1D0EB51A85 evllollx8
143,596,566 *0DC2CCC9B032505B995C0471E0B53A4406E52351 [email protected]
143,596,567 *0DC8554CBC047874B586566A20AABB9F8706FBD9 EX7ERM1NA7OR$
143,596,568 *0DC5510BCAA755936C5F6C7381C2902E5A76D400 EXCHANGE-RATEDOC
143,596,569 *0DC9D96D4A4637391AD68DF5998A16CA375D73DB EXIT(TYPHOIDREMIX)
143,596,570 *0DCB45C933A4E126ED20F494B388116D4CCE1E2C ci,m8
143,596,571 *0DC15B69A3842C7D75130E0DCB456BE5B10F660E ey$qc
143,596,572 *0DC5265741FED107B502BCFB856885BD6676766B CITPESA8
143,596,573 *0DC009AD85A00A27CAB2049E3C9FE73FAE09F388 EZEKIELDOROFF
143,596,574 *0DC881CCF8DB53A0D049910328587078DCB4B4D3 cj96bj6
143,596,575 *0DCC22F26AA356A88F2F1CB8FED0506DFB05D2F1 [email protected]
143,596,576 *0DC690420807AF2957D26383CA89D206855A8264 cje9
143,596,577 *0DC80831C68B982981239D3113496A28F766D3E0 CK&0N
143,596,578 *0DCA160013B228D0B2F7E6E92AAEEEB2F45486F5 CKJ/M
143,596,579 *0DC7BE48963D9E81623C2C41E91EFAFEBDB7F8A1 ckuh0
143,596,580 *0DC33A9E3603F649CA2643446F0C77DABA282AFD F5855C97A8201D276C3BCA26B61814CA8759MJL
143,596,581 *0DC0D6B6E19F435B4A0ECC3D71904E89D4BD2422 claber85
143,596,582 *0DC834A5D8BDFC014B3ADD1544B5C301C72B4ACE fairbig1
143,596,583 *0DCE8486F463A3FA0B6C90564646952BF83BD6FD FÁJLRENDSZEREI
143,596,584 *0DC7B8D8C1FF28ADBD4BD7301E3BFC0839FC4097 CLASSICAL.MASTERWORKS.(DISC.27:.VIOLIN.CONCERTOS.NOS..1-3)
143,596,585 *0DCF837963E986463592AFFBAF0E51C5E5AC0A5E CLASSIONS
143,596,586 *0DC36BE937FFBE712CAE78CEDA000B77F933F045 CLDG,
143,596,587 *0DCE564C77AC2F25A59495ABD62B69CB21BE7508 Fan+as+calness
143,596,588 *0DC35AC68ECB8D87284B351AC448150907A75FBD FARMASY9
143,596,589 *0DCB3DBD4C05AB11DB951E181BF5FB734747F0BF faustomalchow
143,596,590 *0DCE1BDE32332277597B4207F2C25CCA5474430A [email protected]
143,596,591 *0DC00969FFCBD57906387CB6CCDBBA572453D3D4 [email protected]+I+IOUS
143,596,592 *0DCF92418709A181F39637F16B37E482C28CAE87 febres*
143,596,593 *0DCE03CDCDD85AE39AED2E0C08C32C8B77981AEF federicoepple
143,596,594 *0DCB4AE51A9B07E0408E168DA5E7504427F4738D federicomikula
143,596,595 *0DCE1D2374F70C2F42011CF4FA8E8FCE44DA5096 federicoscierka
143,596,596 *0DCE9EAF474DE32843911F92B38D00299EF295EA FEFTKUCHEU
143,596,597 *0DCDC23D88A329EE56171DD6671A153F144D06BF FELFEDEZHETŐ
143,596,598 *0DC08BE548242D10AAE76C026485F460B1B8D69E [email protected]
143,596,599 *0DC39AB2E475E45848FF554692479B4D3FA528B8 cleogerosa
143,596,600 *0DC7E2B702BA79C7B415F5C60B5F0B993B526864 CLETUSHULSTRAND
143,596,601 *0DCB1236F8E786A88F5BFF81EB324C410A2C44A6 CLH)-
143,596,602 *0DC8828E6513051742F8DC50BFC750E3E2DDF97A C"lO
143,596,603 *0DCD684FCA430E534AE9E6E99F1ECE8A20583B36 club)blog
143,596,604 *0DC7912F3C03E5BB0705787346C6C1A785CCF54B CLvH
143,596,605 *0DC53D073FDA80C07EC1D9840048677F0C58C89F clydejerman
143,596,606 *0DC368CBA2DBD8292FD690410BF6BF7E07418737 FINDSOUT5
143,596,607 *0DC7D049DEC601F168021F1A777E126F95638714 FINLAND-SAUNA-WORLD-CHAMPIONSHIPS
143,596,608 *0DCEC069706D5BD275DF2172CEB89A7273F4B946 CNBLCAI1
143,596,609 *0DCC3FD64841F7C69073E8A673DE24D6A8C902A1 cnew
143,596,610 *0DCA0210C643BB4C1B7BFDE95ADA9FE6EEDF6B82 c;o?
143,596,611 *0DC1C03B20A5CFA54350990D552C4F468780B71F [email protected]
143,596,612 *0DC313AF5AE4F2679C24EF2E762033F3E91EA863 fktjowva4
143,596,613 *0DC333A6ACE60B65A993AD03E96E39324B827FEB CODEGEASS-LELOUCHOFTHEREBELLIONO.S.T.2
143,596,614 *0DCE5A2E9584254CDB7A1306EF135D098944E69B CODY.REIHER
143,596,615 *0DCDBB4DF678AF076BC5972F9CF6F4518A85E57E coho+
143,596,616 *0DCDDC55269CEC416DFFA1186648DE1934018721 FNHFSS
143,596,617 *0DCBA4B91DA3897661DB438347F8CF27B8FE073D COLTON.KNOWITON
143,596,618 *0DCB16504EEA1AEF4A1CA7BA51F61378BB45998B COLTONREICHMANN
143,596,619 *0DC252E8823F77753A0C24E76B3AECB70EBE7B03 COMIZIO
143,596,620 *0DC55595C0F935A81855A068BAA5E1E796D0119F COMO PERROS Y GATOS
143,596,621 *0DCE990084EA32F28F7454B87686A49CD650BFA7 for-saadan'-mildheds-gaver
143,596,622 *0DCF6E1649DBF7CC1BFFCB6D55FA67808C8F14C7 [email protected]
143,596,623 *0DCB96804F35A5420CE22366CC9E426C3F8ACA6D FRANKIE.BUENROSTRO
143,596,624 *0DC2CD30189F67C4F70F51A407CA57E8D01750A0 contrabalancem
143,596,625 *0DC337E4EE4C0C80FA0549D9F61F7C4AAF8B1BAD FRANS DEKKER
143,596,626 *0DC16E8CC2DDF4CC2DE1B374A894D0A5DCD51037 fredericfobes
143,596,627 *0DC98206882BCEF02802E6144BC707D826FF5D41 FREDERIC.GROSKY
143,596,628 *0DCFF2D3754F86DD71616E79AF6BE4C453EF1DDD frequentlypypex
143,596,629 *0DC7EC37EC816338408817246BA795B0CBDA0A4A FROM A MILLION MILES (EXTENDED VERSION)
143,596,630 *0DC7B6B96F93501FF0BA2CA65A044883CB7C292D courtney.billings
143,596,631 *0DCA40E11CAF266EEF04C96A872A8255288B54C5 fugl3ung3
143,596,632 *0DC2D7936DD7ED1688C309937E3F2A7EBDBAF4E6 FÜLLVOLK
143,596,633 *0DCC506706F32A6DA6DC249B4A0F1384DD2008A6 [email protected]
143,596,634 *0DC5ED8B074F625AADABF2429128846CBB170394 G]?
143,596,635 *0DC960874FBC92A24A72AF245D58168E15F9B7EF G3N+R!3$
143,596,636 *0DCDAF57A6C68D8C8672BA191AC5C541D9294BF8 G48037
143,596,637 *0DC2539D3B22F8AF81C49D07518425D1B897A7E0 c#q41
143,596,638 *0DC685DD80F625EFC43858E8AAD61ADBF09B7E9E CqfB
143,596,639 *0DC71500F52B5C146CCAED14A5C70F6D9B87EF18 gamel.gamal
143,596,640 *0DCFD5A0C4D77E463EB54F054AAB54B09CCD787E crikp
143,596,641 *0DCF4EC7348E803D5C110BF3FB79607332D39216 crime」はドラマタイアップに起用された。
143,596,642 *0DCF458EFFBFE07E4CC70A11E88B7C5A9AE961D2 CROOKERY8
143,596,643 *0DC4C511EC22AAC36775565D7BBF4E4F87DBCA70 CROSSSOURCE
143,596,644 *0DCAC03CE7D3F3A3F841D10133B5AE2E1A92F907 CRYSTALMCCHESNEY
143,596,645 *0DC69994DF4633EB6E22AE4CA6E1E583FE7B00FC GECOMPAR4
143,596,646 *0DC14C7BBB9EEDA959242DCE12D7DDDEE1AA2FE0 ‘GELDIM
143,596,647 *0DC0916257FAB25D4A4D74E97E092FA63FF3DC70 [email protected]
143,596,648 *0DCB2DEBE6DB62F7343E079D9DF3200946ABAAEA ct((k
143,596,649 *0DC56EE23C3490AFB3ED1074D5E3247AFC5E5113 GENERALIZIRA
143,596,650 *0DCC4E187A69A0F996A8C269DA82F22E65F79213 CU1=Y
143,596,651 *0DCE43CE987852B0E1760C3FE08E7C7B7979D296 georgeannan
143,596,652 *0DC18FC7297CA9ADF282CDD614500656DF64FDF9 GEORGEANNE
143,596,653 *0DC58D6EF197D52850D320C272CC574FFDA798F0 gerardyu
143,596,654 *0DCF677E10CA7BF74D056F93409ADC45FAE22593 CURTALEKSEY
143,596,655 *0DCA7E544896DD5DAFEA03A6AB31B8FC4AD12D8F CURTISNEGRISOR
143,596,656 *0DC9173E4C5EBB3BDC4662EDAD2B1FB4ADACD893 CURT.MORRON
143,596,657 *0DCA5136509C4A717A402880FC2571F3B67971E4 cvuu8
143,596,658 *0DC286B23478DCA24E515F3E24B5F3C1CA96A251 GILBERTO.DEFREITAS
143,596,659 *0DCE89336407EAD6D438CAD93DC5E690C9A9766E glorytolord
143,596,660 *0DC24419D9BBB459EFA3DB92497BCDCB2FBFF7AA GNIXIFTS0
143,596,661 *0DCCFFE9305D7EA3A1536C3C63296F56E87DBFAE CWN,"
143,596,662 *0DCDF001D2BD66657A9B7E281C549FE3269065FE CWNQ2
143,596,663 *0DCB4B6BFBE64E0570E30460F87E8F97DE820194 GOIN'-CRAZY-(ROCCO-VS.-BASS-T-REMIX)
143,596,664 *0DC0F1F1B0E02A0C44071324D69F6E7B40729C65 CX+RI
143,596,665 *0DC3DDCD37417D938F2CCB31361CA30AD9CCA201 GOMYCETED
143,596,666 *0DC856C7ABD4D8B8327F9442F0EE1B42E9F5185A [email protected]
143,596,667 *0DCF28793A81105109E62D61C9D12DF814BCF3F2 [email protected]
143,596,668 *0DC36478AF99C7011B4CA985EFF863B7D90C2DFF GONZALO0000
143,596,669 *0DC33C389CB7365ACF506AE2FA5AADD45C8EFE55 cytties8
143,596,670 *0DC77D7B5139C70B63195049583A0B8336094260 cz(+
143,596,671 *0DCE9B47003AD9B1EE86E5B4D946F4F56225B29F govthistory
143,596,672 *0DC7029D85B62A8A1EB4129B7B11D2FE6F111053 gradybudinich
143,596,673 *0DC30069663321C1570DA03EEC134B394FD432D0 d.02m
143,596,674 *0DC65647FA0302C303744DD259A4FF7FC807FBB6 GRANT.GEIDNER
143,596,675 *0DCE3978DD0FBC197F0DDC7D046FE2DB321CC257 green.pea.soup
143,596,676 *0DC0D1396E1F2D2D29DAD7E7717FD9A21DD77315 GREGORIO.FORSLIN
143,596,677 *0DC94669272BE8206218C3E40C014108E93ADDA5 d0,n/
143,596,678 *0DCDA77F30FCAB4C05EE07D2BC018C32401507C8 D0UM
143,596,679 *0DC0266239A28E6B47D7996F158D078406ED8585 grimashommorgonen
143,596,680 *0DCC7CE96E358185342B909D89622BC77BDC98EB [email protected]
143,596,681 *0DCE00C49FA17B9828C2C1663A8D04F17E4364BD guillermohuyett
143,596,682 *0DC6068863C90B3C529E800686F0D4AFD5DF353E d4-do
143,596,683 *0DC42C6EC75A72328356CC70FC7F483D311A7791 guitguit
143,596,684 *0DCCC7EF56243DB35897F983FD4C82E8BF9213D1 GYMNDND5
143,596,685 *0DC64A6FCBF45DCF46FEF0E41E62E178DB1A0AF6 H2OPOLOSHITHEAD
143,596,686 *0DC267BEB35708D6FFF4A3BA39CB0D9D29590075 d7nvm
143,596,687 *0DC8ACADB675C7FD28A56BADEA02CFCBD52E2DD6 d8mhn
143,596,688 *0DC533E244E4B4AA055794792EA422CBF02D2F62 halslostad
143,596,689 *0DCB965407A9F2A9B8DE3B33C7D5AB88A5CE7E32 DALE.NORK
143,596,690 *0DC49469705B9848E49F11347B904C83A5CE1713 DANA-DOCTOR
143,596,691 *0DC142A70037B8CE0EE75D79641F7D6CC58E8859 HANSONNIKITA
143,596,692 *0DC4537321FF544D418AF6C546434CDF0960550B DANCE.TO.THE.MAX.6
143,596,693 *0DC787A7D431A384A85502EAC4FCCCEDC5FA0BCB havanese593
143,596,694 *0DCB6ED5966D939348C4E8D9CB1F751103F04445 DARIUSD/@/'R/AI//@/S
143,596,695 *0DCCCA6D1A3940213FD42D2FF78EBBB293B585BE HBINESH
143,596,696 *0DCDA6F5AAFAA2D64F0BF74CB83CEB22B73E3F4A hcplonline
143,596,697 *0DCF182E10C503F91CC09B27447E4F7E56CF10E8 DARRELTOUDLE
143,596,698 *0DC7B2007BB934E3B7513949B76A563AA878B7EC HEERICK
143,596,699 *0DCDD35BBAD254A76033C125599355AE9485421C DARYLMICHELSTEIN
143,596,700 *0DC020158D77CE209E846E1DCE04CE3F16E89EBE HELFNER9
143,596,701 *0DC06477A44D06B03B78BC6E57FC6BBAF68A4F7F dattw
143,596,702 *0DCA124373EEEC882E80C4251EDADAEDEEA02F7F HELPGREGGED
143,596,703 *0DC1119E84B51A528C79D3877AD578885FBE49F6 henrybeauchamp
143,596,704 *0DC5DCC8B327B61E9DE89FEFA67E8EF82BB551B0 davidmonckton
143,596,705 *0DC0D6735F75F5D827589396AF644BDDCA1703F0 DAVIDROUGE
143,596,706 *0DCF9360507F800993F47F2EFEB5F1360C5C3B16 dawo-menter
143,596,707 *0DC1AA979FFD3CC4277CB22116F1E008B1FD92EE DBbB
143,596,708 *0DCC5C1F09A2155CD20E2F6FE64222785896851D HERSHEL.DRIVERS
143,596,709 *0DCDFEACBCEABF83287D47B6BB22A2D0B836716E heupjig
143,596,710 *0DC4978222E96446731D2919C482B6846CEF7929 db;o
143,596,711 *0DCC1F4D51E50DABEC13557D89D68F9D01C2DEE1 DBVNL
143,596,712 *0DCF0F8EA043862216CDFCF7BF9FF80EFFF92AEB high-tide,-low-tide-(feat-don-abi)-(ganga-remix)
143,596,713 *0DC3BC9A033F54E3374B0A548BF40831CCD7D836 [email protected]
143,596,714 *0DC683A0264468F62CCC35E1B0F628894CF45448 hk1716
143,596,715 *0DC455C8AD6A5FB3C06BFC51C4196ABAA8A02D93 hlichkeit.und.gute.laune
143,596,716 *0DCCB9D20403FE2552CF0BD40DEC79DCB3CDE6C8 de726
143,596,717 *0DC27BB89F2BF2A0F922DF725B745A9EB902C5E1 DE886746139
143,596,718 *0DC8778953BECA434BFF392DEECAE4153EB270F2 DEANNA-CASTELLANOS
143,596,719 *0DC426DE989AC1B8B37EB8DA3F01508F859F3652 DECANINI0
143,596,720 *0DC8F48250E732473F444132DB9AE1BC65D0F4CD declivities?
143,596,721 *0DC0E27B236060781925236A11BCAE596ED6B5E6 dekabristički
143,596,722 *0DCC9D877AA9B041DB4ED7205E13E095F8FC3963 hongprunty
143,596,723 *0DCB217B511381D5AD48552EC74C37D2BCFCC6E7 $HOP1IFTER
143,596,724 *0DC321689F4DDB260FE17C8AA955F7C5FC23FA68 houstonorts
143,596,725 *0DCEC5B678EC9C671A232B9A46733A66A2F7FEF2 housupply
143,596,726 *0DC432D1656C0B2866620E3180ECA8A8166CF234 DENITA.HICKS
143,596,727 *0DCF4FC93A846DE65D842996F905D5727325EC92 HSTERMIN8
143,596,728 *0DC29A9E02F68B87AE10DCE223594D6B4ECC694E [email protected]
143,596,729 *0DC351007B9132B137CE36B1A577D0ABA88BD601 [email protected][email protected]
143,596,730 *0DC274B5CE6FF9427F6175A56456DBBB978E2AC9 HUDABSW4
143,596,731 *0DC4A9C012523C2896A4C0A618175D80345FD294 hueyopara
143,596,732 *0DC1E5977F4A85A24483BC817FE66B06A4DBB38D [email protected]
143,596,733 *0DCA718E941653DC41E7DC0A01B1977C2C0BDCFC DESPERAŢIILE
143,596,734 *0DC129C7D4A5EF6C8F67A0791EF46EEE08348E80 dfjlg
143,596,735 *0DCCB868844754A559541BDD65E0098D9CAF7675 HYDRMTRSES
143,596,736 *0DC213E2D90F3A7859AAE73708355BFD911AB314 dg";9
143,596,737 *0DC4A8E9F019D81E42213FFCB89898D110E5D717 iamboston5
143,596,738 *0DCDE9D34F57C501E7DF33D839F6D9D0229A335C iamlaserjet46
143,596,739 *0DC9E5F921D9B2333D01C44685D87F6D8E6885EF iandockstader
143,596,740 *0DC8B0D7466EAA0776438C633C61311ECAF5FE7B IBIZA TRAXX - CLUB WORLD TOUR, VOLUME 1 (DISC 2)
143,596,741 *0DC0EFEF7EE6C94A81C3B0BFD1D11230FB61642D icareoftheblues
143,596,742 *0DC866D67CBEBC33DB90EE697EC21A06ED36862B ICECREAMG6
143,596,743 *0DC59836CF3C30010977467C4DF6421AFF181A21 ICKOFRANCISCO
143,596,744 *0DC608146A6EEA82BF052137D0436F390583CB7D [email protected]
143,596,745 *0DC9AFD0FC933D700CE75735E633D16A5ABA5272 DILUCAS
143,596,746 *0DC7AE62C47990A52F42475A2C0D1A8EFE948C9A iglesiastana
143,596,747 *0DC4CBCDF07FD2B7C1C3727885A5366865DB4B5D D!IP.
143,596,748 *0DCD0C4D9A2CFF8D28F0B52890C1B1BA4A5B2519 DISMALTING-BOTTOM
143,596,749 *0DC31FA1B659D6A1593DA87C3BF78E14BD1B15F4 I'LLBEGOOD
143,596,750 *0DC27F7FD3858FFAFD771E5143A2EBD92C5996EE DJW(D
143,596,751 *0DC6A8F6F5E9BA03AC13A0339E3F96C3959A02C7 i.love.music.19801984.(disc.3)
143,596,752 *0DCCC01A881BA35EB37084DC78A87331E5733F40 Dk?o
143,596,753 *0DC2FBB2048E442FC3C3AF6CFBA462793DEE5EC4 ILUVLEXUS11234
143,596,754 *0DC4F7C711B34A772324B2913BDB188DFDD6E6D5 iluvlizzy52
143,596,755 *0DC3E03858BB36AB59621AF4C5C6559F786EBFBA imistohp1
143,596,756 *0DCBBF939655465DBEB90A110693859C93E5275D DMROPEN6
143,596,757 *0DC2E0ABBE690C35AB7029C41A40B1959A69144D DMTUQ
143,596,758 *0DCCDD12E3DB634ADD00F68FCF0C0C7F32C2CE01 INCREASD7
143,596,759 *0DCED1F4F110C908F72AC4DB53B3ACA45D3A7DF2 inde5crib4bi1i+ie5
143,596,760 *0DC570C4D72492F5303C50039EB3C9195BD40AD0 indevidosing
143,596,761 *0DCFC7E209D7AE53B1F2DE902910141CFB706ECB D"NFM
143,596,762 *0DC737515C2C849B185E61182D95BE62AE4106C6 d#ngm
143,596,763 *0DC112FB818068597D3BAC2BE9FD1BF4AE68DA2B dobile
143,596,764 *0DCF4E19771699BD13F2A5566EFC0BAAB238156B DOIU.
143,596,765 *0DCEF9C6F00F116158272B207B8C3493D767102B dokakiop
143,596,766 *0DC4FBF98DA2C6DD83AA4495155A18D701075A22 domenichuffaker
143,596,767 *0DC5A27B6F0FBEA0FA58F61DDEFDF71171D8BDAE DOMESTICATEDLAND
143,596,768 *0DCB21EC10EE3D9AFB5E41EF67852AA6708C384F DOMINIC.NOA
143,596,769 *0DC2553639BFDDF361C6C984AEF8F74E4C4265D7 inzoomen9
143,596,770 *0DC11ECFB9A2BAB87607105CFDED684D43049532 IRIS-DORSEY
143,596,771 *0DCE2564EAF3FA3711FDB25EF2154FB9F0DDE7C3 isa16ac?
143,596,772 *0DC08F745CF02E9819F1C6CA7C609EC20E5A1965 DOUGLAS.B.REID
143,596,773 *0DCCB4942BA0AF7DFBF50835A154FA4F46592F58 ISREALHILAIRE
143,596,774 *0DCE54C322F855E8E7C41205784ECDE867EF1E56 [email protected]
143,596,775 *0DC90379E10C3DECFD96CEC5C12155D2BFEE23DF d>pt
143,596,776 *0DC45887E5075A58B1222EDE789E5D904934FFCB dq88;
143,596,777 *0DC992CB38AC360C0F5D53A2DF877C5293542120 IWannaMmm(Foundationdub)
143,596,778 *0DCCC544FA022612BBE2D404C950A2ABFAFCD1BC DRAWEESES9
143,596,779 *0DCE08204E9D4D30C6FEDE40F7707D3A075A8DB2 JA.ACHMED.(PARTY.VERSION)
143,596,780 *0DC565156473CE85609EC20943CE033A51C4945F dr(iq
143,596,781 *0DC413B26145C432ADAD47BB0BC043C932C3E8A5 jacobprestage
143,596,782 *0DC8E0F95DE6F3966F885DF12CE01457AD1C14B6 d%!sd
143,596,783 *0DC890E4645CCA2E989ECB7883F4FA0110AA3F40 DSD/M
143,596,784 *0DC1A4A7041F70681617071D4DBEA362EAD858E5 dskokoz
143,596,785 *0DC4890D215B3305B33D91CAB9DE320ED87E652B DSU0;
143,596,786 *0DC6DBB10A46D38A050FB8F01D23C4DFABC6C70D dtins
143,596,787 *0DC468AE93787D90F0F3A82B658983FE0B98CC9B du8cq
143,596,788 *0DC2AF84E81590074D0EB8A56A4B375D04960797 duanebarrieau
143,596,789 *0DC917A73903B09A693BC663E594595AC55CD992 duaneeberle
143,596,790 *0DCA76467CCB8E45702C2E8594CCBBA6977C0BF8 DUANE.PUTZEL
143,596,791 *0DC3FDE861E1D4378D4C160E2E2EB2FA089B7E18 JAMIEGEBHARDT
143,596,792 *0DCF18D87D8A45DD419D43E4499C581CDAAF3C44 jam-to-remember-(breaks)
143,596,793 *0DC0C7941745F4E693699C0568798B822CDFEC67 DUDLEY.RATKOWSKI
143,596,794 *0DCD90D2CE3E31D3E98E11B629EDB021C9145CCE dunedinmusic.compilation3
143,596,795 *0DC68D4EBA3B86C571C6AE579A770F09B155D4BA JAYDIN56
143,596,796 *0DC7518EA73BD123C78E419AB2286650582A1A0E jaylaino
143,596,797 *0DC2BA45C1942A262DED707FA44B02E4895392BC JAYSON.RASICO
143,596,798 *0DCC28176E445C29FF2B47C47DA0AA8D55F27126 jayweiderhold
143,596,799 *0DCB554EAB97BD034871386A70F44AC5E05F8DCB jblogg
143,596,800 *0DC01E3CA50448351E678B621F9C1E8B56F32586 [email protected]
143,596,801 *0DC8A0D1FE19E3409CD878529840C5535AC49DEB JE1I
143,596,802 *0DC79E33BDDE40995218F9E8A9E62FD7AF833480 jeanette-kong
143,596,803 *0DCA23D3A2D22F48C48B300880A8BD02D177F30A JEFFEREYSTAKEMANN
143,596,804 *0DC666ECC06EEB75E643E1DE682E0DBEB5F63593 JENREGER
143,596,805 *0DC3AD7C09630A875DA310BF6C7D4D40D33BEECF JERALD.REVERING
143,596,806 *0DC5E3741B88A702417FC0C6D186FC1D248C2D51 DWVDC
143,596,807 *0DCBE594A0F5BCD83003F08FC0E575B5A4076CB4 JEROME.WILHOIT
143,596,808 *0DCA996A31D3F440D02F883F97D8C16037186BD7 DYK[
143,596,809 *0DCB82C9B3C94886A161470B380093CA9DEC5FD2 JERROLDBRIAND
143,596,810 *0DC16832EE07E84F98902EE90DFA0C68E7443A95 dynmm`tr
143,596,811 *0DC199A13CE36CBDA9F9A9155DDAD81EBC16157E JESSE90731
143,596,812 *0DCEFD2B18E7DF02352E32E50743D8FE165A92A5 dzhli
143,596,813 *0DC2ACC11B47B33C399AEA288E1FABBB99118A62 e4j9
143,596,814 *0DC2272147E5005B8BB76432078589628FF76BF1 EAECAETO9
143,596,815 *0DCD584404C3A8D3E16197D615BDEE650CBE8BB2 [email protected]
143,596,816 *0DC4F95CBE97531CF395EB6CF9FF62D71F82AF04 EAOe
143,596,817 *0DC4168FB37E73B5E9FAB1FBE7ED8DED84D7AA9B JIMDOLE
143,596,818 *0DC435327307265714DD0BBDFF29D67DC441A927 JIMGRAHAM
143,596,819 *0DCBD123C0D88E1194AB9B5B3A01E8363FAC8263 e>/baa
143,596,820 *0DC4A1664131358622BA8EC19EAA30DE71F5AF04 EBHG5
143,596,821 *0DCE244B678F2CF2186768EC6D2B10E8BAF644DA jimpecukonis
143,596,822 *0DCDC28631B225393207686FB69DAB317B67B526
143,596,823 *0DCBE2AE1F930D7FBFD504A194CE6711D3B68CDB [email protected],
143,596,824 *0DC24576DA6695AC6E4DBF2B3F107B0226527191 JOAQUIN.WITTERS
143,596,825 *0DCC1DD1D7755C903767DA1999CA7A2A48A939CE ^>7O?
143,596,826 *0DC2ADA4AC89B8BBB3F648A530C09899338C0799
143,596,827 *0DCEAFB1B902D036DDC0E77ECFF2619AE8A04C33
143,596,828 *0DCEC6C8676985CD52C91EF47A037E7F285BC790
143,596,829 *0DCB7059826B1F0A7F134EADCB169F2F5175B3A7 @
143,596,830 *0DCE5AB2CBA8A376B55AF66F97E737B23641451E
143,596,831 *0DCD43C7B907BB4E6F47E6A1E8C88BA9D016A167 johnathon-gibson
143,596,832 *0DC4F53084307810099326432DD5729C6690436A JOHN.LAUVER
143,596,833 *0DCDF1896751FAAD2131CC09EC567E18DDBC580D JONGENSPPING
143,596,834 *0DC1F7E03F7C34B0A588B38C1432C8B27AE56212
143,596,835 *0DC16F49F94BA117C99FC86DC210EA83E17E0530 [email protected]
143,596,836 *0DC394B171537A2EE8839E40FC5C7D04035716C3 josiahseat
143,596,837 *0DCAE5794D31DF3D6B330305299AEA965DB619BF judensteines
143,596,838 *0DC742456C3A0EC71406C11CE4751D07EA1550A4
143,596,839 *0DCF703F9392149764EE032868A179A22D831113 juleymonstor
143,596,840 *0DC8154450806DBD9EC5374FFD43E36AD345A240 JULIA778
143,596,841 *0DCD6B5707DD00F30141778522C26003277DD460 julie1snicker
143,596,842 *0DCB329DD9CC9BC8E2EB0F0D9D3D0B2E7677D3A3 Ob
143,596,843 *0DCE1440956085D04521275213E0D6C21E570C74
143,596,844 *0DC1B5864426AC8ADC6747111E103DDBAAE9FD26
143,596,845 *0DC0A8B700DCC1F7C205FD7C6FBDBA9E7AEAAC3D Q
143,596,846 *0DC4EB95E12A266134E8302F0AA806B79C9AB863
143,596,847 *0DCC9458B3101A4F96C9EAD09FD7B857A01C5561 
143,596,848 *0DC8C6AAD6566C1E041D4F916B9125DBE613DD81
143,596,849 *0DC07BC03DA85117A35E8D2C2ADBCB9222F29DB4 6?
143,596,850 *0DCA765CF30493F3D601E0B643240FFEE06A61E7
143,596,851 *0DC85BC83ABA0C821D8678DE786EBCB5842281B0 >
143,596,852 *0DC36C58C6ABC9567EA0497B12C8101106BEFAF6 <
143,596,853 *0DC0B6B17A1E76A903B0AED679033E18879A332F jyoti.jaura
143,596,854 *0DCB6CF6C8D3544C109196BE63B45792B5C6E301 JYUSEIRA5
143,596,855 *0DC98E55117BE9662CD43DF5A228A92C3E14B7A7 ѡ
143,596,856 *0DCD71739B267351D2B0778A4F8BC049E0D817A7 
143,596,857 *0DC5248704A6789106C615A583376B1F5BC6705F k4ppen
143,596,858 *0DCDCDB0EA3EB063C3DE1266A5339244FDAD9ABA KAMLOOPSBCCA
143,596,859 *0DC78D6782310A4045DAF5F16FAB575124C7FE9E q<J:-5
143,596,860 *0DC844DDD340D77ACE1450FB787264ED894A1C84
143,596,861 *0DCA6E39C56194863310C1D5FABECA687B2AE045 y
143,596,862 *0DCAAE4D985ECC675B570178F6440EE6C19217F9 t!
143,596,863 *0DC3ADD0B3C059658C4F5C9E88BD9D9FAE65B9AE karakterstudie7
143,596,864 *0DCC6A69B4C787B6A077D1F0CC53A29B24A978D2
143,596,865 *0DCA794F87A1FEA025D231974559D6B75F52AFB8
143,596,866 *0DC55A6559AC8C1E88C57DD33DE3FAEF09DD22B2 9o
143,596,867 *0DC590708F66C2A1479B577A13A87D8A484D9675 KAUNLEY8
143,596,868 *0DC8E6520B8D0D41F859EA870F111327F5B82A3A kaysea55
143,596,869 *0DC75FA3D33C5A736B2457B7DC5CB375C351CC40 KCAPNIL9
143,596,870 *0DCA9B6CE83A7405A6B6D09095DB8F2C1E1596FA
143,596,871 *0DC170F2C2C36FC154FD8266C2FC22C27C627C8D {
143,596,872 *0DC1964420A6CB1D368EAFAB94F82D92AD666A3E keenanjukes
143,596,873 *0DCB359D5737566B050DE9122CEC145703F6AAEA KEHBAA
143,596,874 *0DCE8FF61FF6B4137CF503525D55583E25F06D8A "@|
143,596,875 *0DC489FB3A7536332AC343594F79741E6ED33411 KEITH.KASZYNSKI
143,596,876 *0DC55C4D1A269F03AC1B660F8E11768437BBEBF8 *
143,596,877 *0DC692911C59997021B0203FC63EBC52A3B65AC9
143,596,878 *0DC4F3EC3CF1414B3390E7F749CDE596C8FFB159
143,596,879 *0DC1269363732CF23122A8D7F7FBFAAA3E49DEC7
143,596,880 *0DCF09D3663A61B4725776419702BDB4806C4E6A L\^
143,596,881 *0DC1FC3C367B7A1AD73E01F8094321F305E7C732 [ 
143,596,882 *0DC24F61F40D2005D2A50A9EC3D95FD76D57F720 kellie.michelle
143,596,883 *0DCC2BB5A83A3ABCC2B6F31544FF30F8F8C759C6
143,596,884 *0DC525D1F6AFDFEFD7FD11E53C044011D920A622
143,596,885 *0DCFC2DCB10C747D9EB97E0C65FDE0246ECB2A13 KENDALL.BORRIELLO
143,596,886 *0DC3B51659CE4B0AADE45B93BDAE9B582A46BF86
143,596,887 *0DCC7A7C8A04B88288DEF9FE5887156C51761A5F N
143,596,888 *0DCC32759008DCCCB9458EDB1910D4EF35D8FCB8
143,596,889 *0DC4A73D71AB5AD7C012F49069716AFBE75B3EF7 I
143,596,890 *0DCFD77D0EAC38C12F548236AACCFC8625866F6F KEVEN.ORIORDAN
143,596,891 *0DCAEF850D31328203F72F1A3BA6CE974F0C4925 
143,596,892 *0DC1F6B77185D95658209DA3E3307AD541BE1148 V
143,596,893 *0DCB10A1CFEF7D8FCBB83DC8C68010C81A1CBB0E `,
143,596,894 *0DC52EC7C4FEACE2FB66673C21FAAE6BB9F8B18D
143,596,895 *0DC0891C9A12854B575CE5090E642F1E842D8932 #&
143,596,896 *0DC79E498E70CF2E71DF91D0A83AC9A421CA3859 KHIDHARS
143,596,897 *0DCF0C16CC9B30C411DDC6B3EAA00C280FD0111D
143,596,898 *0DC8138CD89A3930515CDEF4E8491D8BAA7B505F KHULAN-ENKHBAATAR
143,596,899 *0DCD686D31CA69B37FD45B60AAB3357A408BCC69 KIB65875
143,596,900 *0DCC5EB193557C770510172A8726108DC0C877A9
143,596,901 *0DC16D0C7CB002188E24C84BB7E0E18058472B56
143,596,902 *0DC96A8C4386DD34EBA806865063797760DFE9DD 
143,596,903 *0DC8DE184CF333BFA0AFE64A7E199B83FCA6AAD2 `:
143,596,904 *0DC0BCF646BB1144023BE77E72E9282EDF0301DC KING.DYCE
143,596,905 *0DCB6A832A9A3AB35C97AAA60E0C7964738EE2AE
143,596,906 *0DC7359C6A38C013D64F2C2470537BC6BEEE6037 kirildilar
143,596,907 *0DC26A9A14E3A02748AB8D5D8B352D70A7E3DE6C kirit-rathod
143,596,908 *0DCEE9549E34B5910AA6F089916CB2C935310D7E KIRKHAGEMANN
143,596,909 *0DC9911C9BCB35D22B4571987661675C54B90CA3 [email protected]
143,596,910 *0DC011482786135775263AA589079D09798209C9 C
143,596,911 *0DC6C696C632371C426B83915EB57E502DC4C9F5 &
143,596,912 *0DCCAF3234A85C4A0E52021A907BD62272AFEDF2
143,596,913 *0DCEDED682726CCB0FFF4C0ADC7DBAEBD51FF32A komesari
143,596,914 *0DC98E18214F612E74F1E8AB208789C89E0DEB6F KOREYHUNNELL
143,596,915 *0DCD28C081C9929FCD799C4FF4CE03AC0140E2CA KORMIDELN
143,596,916 *0DCAFC69AE3234C49DEC31F5D88986E759E30BD8 korybennet
143,596,917 *0DC1BD021E949C95FD992F3141ECC037DCB9290B «kourú
143,596,918 *0DC9D759D4EC0C55036D4C7248E687FD6A6AF8B8 [email protected]
143,596,919 *0DC8CFBCFCDA28200941DE221500776112BFCD4B
143,596,920 *0DCCFA302104F2199E0EFAB862E600CA87D0D401 KSITNĄ
143,596,921 *0DC198EF1B238B4E515471F1C8A13FD93E45B3BF KSTRINGS
143,596,922 *0DC28EAAEE01E613C7205ABB51E5CF1D42D25ACE kurtmcalmond
143,596,923 *0DCEA7EF6464021C38501DD53F625485712B30F3 L0VEM4KE
143,596,924 *0DCFD75109936E99B90AAE8AAF1ABAB032CF55DE LAMPISTERIJEN0
143,596,925 *0DC7920EF66CEBEF9970CBFB45E2FC10D7E78C2B 05-03-1847
143,596,926 *0DCFBEC232168C6FAFCF086594FDF6A603C7B6AF LANE.LAXTON
143,596,927 *0DC6D8383F2E9E38D166E0C17163E40363A7798D LARΘIE
143,596,928 *0DC24FFA8135572B25857B5DF74B9E12D78037AE (0_<)~-~D=8
143,596,929 *0DC4E50B4D79A9842AC969E573265419C5BC77EC (><)0~DP
143,596,930 *0DC78D3D4A2FD2BDDDD5D1FF388F9060D7A09123 lavernefaraco
143,596,931 *0DCC472F54E0DB5B736C445270A09BD4B8E3BBD5 0V1D1AN
143,596,932 *0DC7023DCBBE18BEAEC4CFD1C90EC4908653FB5D 1018952 se-ei-rajoita-viljan-kulkua-putkessa-.
143,596,933 *0DC9B03FFD9940278696AE2F1CD049D3AD947332 [email protected]
143,596,934 *0DC80075217FC99770EBD083B2095FD758482123 1101979
143,596,935 *0DCE2835EB96F6634EE1CB7F17015D0CCBED1185 112027 T
143,596,936 *0DC25B088DA79CFD03D2B16CF8D0354675C1A3D0 1147406 huuhtasenmielest
143,596,937 *0DC4AF620885ACFBDE0E6147891EE981BAEEE02F [email protected]
143,596,938 *0DC7A2044F586DD3E72E6A33551ADE338C779436 LEIFDURISSEAU
143,596,939 *0DCC6E55D0F33BA5F292F91C57FD6F79D95A3940 1245514 OPETUSOHJELMAT-,-JOTKA-OLEMME-TEHNEET-
143,596,940 *0DCB16DBE5D7ADE76F3A746C9A497B9E065E7D7A 124.DOW-PUNKTEN
143,596,941 *0DCC1F10B56CAEEF1696DDDCCB559A1AE1A680D9 12.laajapohjaista
143,596,942 *0DCAAF1DB7C3FF0890C8FF626F033F03D1EACF1B LEP[email protected]@N
143,596,943 *0DCF42C5FF0EA2A02687031AC2F68B716252B746 1456477 suoritin.n
143,596,944 *0DC35EF0606FD1F752D1D1B0B7E3E342869B52F7 LEUCOME0
143,596,945 *0DC24207F905F5B93E34712158F67E0BD2140B7C 1510198 KUVITTELE.,.ETT
143,596,946 *0DCB7D078C492784AD6A40BF7348BAF5919125FB LEVJOY160TALK160
143,596,947 *0DCC9DDEBC823EE64597F9CADD0E9F4825AF9C2B 15-VERWENDENS
143,596,948 *0DC4828DFDFCA948986C8FE3DA19252D58A7E3A7 1697312 htmlkomentojen on oltava hakasissa < ja > .
143,596,949 *0DCAE9F462D03267C7E4CAA45C78B4F471CF48BA 17.02.1454
143,596,950 *0DCB6580496C783F17A43F2C61E1ADEEFC531D33 life-functions-critical-(1992/93)-d-flatliners
143,596,951 *0DCE4F3B1C138EB299B2596963B17A10FA7D4762 [email protected]
143,596,952 *0DC13F8AD7FCD968208EE2D3A809BDB8EA063BB1 1907—FALSE
143,596,953 *0DCCDD8991DCC8AC8A126F78EF8FA24CACBA97FC LINKÖPINGSBASERADE
143,596,954 *0DC7BB49A3624B1100264A91A7E638B3DF25B3E7 LINMYYJ3
143,596,955 *0DCE3F9E4EB2DB93DD7570544E79E515AEB1C938 19-SUEDLICHES
143,596,956 *0DC422A7DC18083B3EF5EDDF389B2BFB5C0EDCAF little.betty.and.amos
143,596,957 *0DC237E27663378C08417692A2B4CAEEF9A0F910 1AC0D72D238C86B2029C8419BA2574A2LOLITA
143,596,958 *0DC896C3EE55FDCDC28823215EA2076E7A14DF20 LNDRYWNRS
143,596,959 *0DC56A335E5408ED8590E4EFE3B204BD2008897C 1druifjes
143,596,960 *0DC247E11CEECC3B5ECD8005183154934E542635 1.EMUPROPAGANDASTA
143,596,961 *0DC29B885AA8ADE487F4749D7E7306F0C5E94B13 1.ER
143,596,962 *0DC4A9F5A4F78C68EB413B9728FF94129B137769 LONNY.FLEURISSAINT
143,596,963 *0DCA69AB6CC124921FEBDB4D9A77F37D8DE5CA4B 1.fosfatidyyliglyserolin
143,596,964 *0DCA950DD11F7D00AF2B82BCF37DE293488F274C 1GESPANNNTEN
143,596,965 *0DCD82A6EFAE9BC59B24FAF32713A0151FF57D58 1 gyman
143,596,966 *0DC551767A64A212305ABA1FA074482DA16C8861 LPERODDY
143,596,967 *0DC03A850F16F26CE4F7D8447180BCED9802DABC 1katilimcilarinizin
143,596,968 *0DCD2B57BA9E95E34DA1D296C5DAF82526F2CEC7 [email protected]
143,596,969 *0DC7E792ECEED7E8EA44E33DD4776F4FB254B0C2 LUCAS.KENNAMORE
143,596,970 *0DC96F472D43B41E4846ECF109D2A5D5AE8E9ACA lucianoromines
143,596,971 *0DC92AD0245FBFFE13CCE3431895E375490B2B9D LUKESIEGFRIED
143,596,972 *0DC2B455B1FA3B0806248E8EFAEC5E609C0A2134 1.MUUTOSTARPEEN
143,596,973 *0DCE1320600A164807BB986578821ED1639B25B3 luof
143,596,974 *0DC009E6FC899D3A8060863B32ABFE1F83368B42 [email protected]
143,596,975 *0DC87C97047F69B59C5FD6FCA1CDE7B1D827F82E luppite
143,596,976 *0DCD791816BEE5380E7D75638C7CD71DEADD342A 1Q5L
143,596,977 *0DC5509611852F0D3DB5285E98F6EF09F54F87A0 m8|aaa
143,596,978 *0DCCD20295588BE786E691ED7F76FAA3ADC49956 [email protected]
143,596,979 *0DC3DA55CCA13BEDB9E751915A6126C613FF95AE 1.SYYSTARJOUKSIA
143,596,980 *0DC91E891AB0576BC7CDF815036B56CEAE9FBD7D 1.TEHT
143,596,981 *0DC83D3876F09ADE52315892CB60B5E7B1A6383A MAGGIE.BLACKMAN
143,596,982 *0DC462FC532F411C80FA5D6A4966FCACD1131E1E MAGNESIUM-LIGHT
143,596,983 *0DC1BB36B0396D081B4124D00B9BB2B921DFA908 1.timjamissa
143,596,984 *0DC4E4638CB3BE9E91EF7535E4800F925C673787 1 TUTKIMUSPALVELUORGANISAATIONA
143,596,985 *0DC6B98CEFC8983968CA8E57F863F29BD0ACE125 manche.m
143,596,986 *0DC2D650F940AD2FD2881DD1064C867D2091AE4B MARIA PAZ ROJAS
143,596,987 *0DC8108CCD7341A88036910A9CD62840DA01C6CD 2261264 ".unser.ziel.ist.eine.flatrate.fuer.40.mark.im.monat.."
143,596,988 *0DC28358CBD125E9D36DC0D07D5A1741AFF6816B MARISSA’YA
143,596,989 *0DC58725E5327299B2907F0BE067963640EEA7DE markschoettmer
143,596,990 *0DCC8029932F0DC8795FE23C46FD403650EF9C70 MASTIEKTEN.
143,596,991 *0DCCAA0CA6B7968C8A25794DA2F988996DB7E119 MATEREN0
143,596,992 *0DC9B5B153EAF18BDE11DC3DF9574FD025B1FB04 26-krsko
143,596,993 *0DC5F026A4EA9F9168B87608F3F02E813D6855A0 MATT.STOCKDALE
143,596,994 *0DCB94847336372763B4641C9B8B53FE561CF07B 2825226 lopuksi varovasti tyrkin kylkipelti
143,596,995 *0DCD93ACF2AF4E9E41774560CD50A2F46F0EFA3F MAURO.EICHEL
143,596,996 *0DC92D21F65FF3CA202ADC5696E8B1D60831A157 MAUWRY
143,596,997 *0DC6CA8723E920B2A6D91F84C12BD70055AFBEBE maximogalbreath
143,596,998 *0DC04B24932AFFB82BAD8F8E3F39E07B7878A1F8 MAXNEIVES
143,596,999 *0DC485555F9578B62B7F63AA0903DECABF8DB3AC 298OLIVER
143,597,000 *0DCD01823E4B6114F566A37FB313FFB96648FCB0 [email protected]
143,597,001 *0DCB169AB153F74899243BE918EC2EB7D2B7D2AF mbpt2
143,597,002 *0DC2DEE7381BDABB8939338B1BF26C952FF8320D MCEXALANS
143,597,003 *0DC27EB6FBF6FCC4CFCD0F83FBBF294B3CA94548 2BURNSISTA
143,597,004 *0DC17DDE767B23E42FC3D1BC3B388CFAA728E967 melissawelcome1
143,597,005 *0DCE33190C238C99C2E40C87F1A931B6A446422A 2iloveskeeter0
143,597,006 *0DCCFC0C047F8568A17C00AFFE5DB90EB92067DF MERRILL.OVERFIELD
143,597,007 *0DCD09A68E7C6E29D23B7A120F1805BEB723DED5 2mymargaret8
143,597,008 *0DCFD234EE8DDCA50E9E6F7C5EF544AE96D78EA0 2.TOIMINTARENKAAT
143,597,009 *0DC98B1D0D0F902BAD1B33EC7A9DEEC377F4310E michaelreida
143,597,010 *0DCF011B09C930666AD839F4F3AEC01239E4BE0F MICHAEL.TOM
143,597,011 *0DCCDA78648479416B72075A843569C1435DB7AD michellemarcoot
143,597,012 *0DC58D766822581C22A01DA78406EB1C8E72FABB 33cea3426f953a3aabd485829c3d3bd7
143,597,013 *0DCA9C4CF3CEAF04F9B66B6F32EDF24D06A11833 [email protected]
143,597,014 *0DCA3D8ED8F6CEFB28C50E685F366F0837DDA49F MICKEYDEYOUNG
143,597,015 *0DCAA9951FA4BF9A45FA9D25C56F8A6471363003 39.WALT'S
143,597,016 *0DC8718C96AC089D33A2F9B1B0643992FD17EDA3 MILES36
143,597,017 *0DC237693CCE25A5559CCF1CD7073AFCF8B6047B 3CLASS03
143,597,018 *0DC65AC50AC7A5F578DF4064AF8CAF822BDE9E79 MILFORDROUMELIOTIS
143,597,019 *0DCF69A4E7082774F60302097E7135C8A9EDD4B9 3##D-~O)X(
143,597,020 *0DC4081076D51B15F0AE208A9EBC3A6E623DDF19 3 EARTHORBITING
143,597,021 *0DC6B85FF76A917A3B4F0C20351474567EF2CF37 [email protected]
143,597,022 *0DCEEF4687AE501E7256D7C4F360C32C2FF74A05 3IMANNES
143,597,023 *0DCCB62EE90DE7E086FD203EB923AD6724EC026A 3LAUNCES
143,597,024 *0DCC57C1381CE3879987D0A5418A49A65BFEB3E2 misongkim
143,597,025 *0DC0C2008CD4BD8BB6918CE843E8F78784B9E602 3->~o.o->-<
143,597,026 *0DC9F7FA941CFF9DD7411192213656CA5DE336D1 MISSINGNUN
143,597,027 *0DCEC6E80133FA4381C980B0CCE314039599694A MJ{
143,597,028 *0DC021DFD938489BCB610ABA1BAB0116FD72E534 MKORPITA
143,597,029 *0DC47A4CE179D314BBB8BB431E29A900E6602C8E MLEJH1
143,597,030 *0DC9017CE6B7E064FA39564C90E9971AE2AA7C50 3TOEJLES
143,597,031 *0DC9EBBA484631BE387907CA295684A07E544BD2 48858 median-tulee-v
143,597,032 *0DCBD31E46076EE88AE0CB72866CFBA1CB0D0CA1 MONDJIGENT
143,597,033 *0DC711FC7EACAAFEE9A24E761FE92E2451D4AFA0 [email protected]
143,597,034 *0DC74A0824F050E9533C12897FC9C1B487C36D63 MONSTERWALKER
143,597,035 *0DC2E62EFDF2FE2F487A33087E231C3DEAE18720 4getout0
143,597,036 *0DC832CA2A9B67A46DCAFAA7BBEA981AD8E1A119 4ICEMANLIBRARY
143,597,037 *0DC5E13B6E5D1F9DC21B16893D43C96CCDB74475 4KAYUKUHS
143,597,038 *0DCF08DDEA154AFCF6A973F5A0491266761D14A7 mprgntds
143,597,039 *0DC609DD708465B24CABB2A669142515C28F9AFF [email protected]
143,597,040 *0DCF70727A46A9147A8D1EDE935F97995221D159 MrJellyRollBaker
143,597,041 *0DC321AB48B5B602C7CDBE8DFA7A1659D6B18898 MURMUROSO123
143,597,042 *0DCB075AC276B09B24D26D01FBF72A6360323203 4SSENELBITSEGGUSREPYH
143,597,043 *0DC70FA45B1CEBC8CFCDEDA9CDD1066180AB92E9 4THATMARKET0
143,597,044 *0DCC773FBB457A3C346F35463CBDDABE62A1EFBA 4TINKERJOHNSON
143,597,045 *0DCF94D8E4B9B782873C0F7DA961299E9AD2BEDF MYFILECUE
143,597,046 *0DC6C21FEF3DBBFA3D6EE169096403BF633764B3 mygusanito10
143,597,047 *0DC972CEA88527DE39DE94D0F631C22754D8C893 MYMUFFIN39
143,597,048 *0DC286D2F6495AD273BEB6B9279905735C40FA03 mymurphy2
143,597,049 *0DC5D04174C0185D78472B5C266D5F00B547EB77 4WEGVAARTS
143,597,050 *0DC44C8DDC0B90EE04B17A2FFA3E8603460B48B6 500374 konya'dagOrUlecekCokSeyolsunistiyorgOnUl.
143,597,051 *0DCBE96CC34B03C07EA2AF7DE6EC0FAD669E61CA 507181 VALMISTUKSEN.MERKITYKSEN.V
143,597,052 *0DC2665EC30829F0D80E46B3890EDA7DA0931DB8 [email protected]@70RY
143,597,053 *0DC0BB83BE950344102B09F167DBB9A780927FDA [email protected]$1y
143,597,054 *0DCE1492F6896125A3FADF74512A5FF43038B51F [email protected]@+0n
143,597,055 *0DC424D61BF58A40E0B3E2A4184A8E53BB86E696 !N7ERCONNEC7S
143,597,056 *0DC22F560843F321A11D4D744D417AC75510E3CD [email protected]mocomtw
143,597,057 *0DCE63F8EA899F46ECB73E5ECA09D5A942BACAB5 NADIELASABRA
143,597,058 *0DC8E8216F0FA5A7BBC3A264FFA65032C3D92094 NANCY.TERRAZAS
143,597,059 *0DC0CDF27B32D40391E3BFAF3D8F6C1AD5494310 narayani.koirala
143,597,060 *0DC281DD7218396ED1096377FE7AA0440EAC9017 "NAVARRA",SPANISHDANCEFORTWOVIOLINSANDPIANO,OP.33
143,597,061 *0DCE197D788BB86C037D797111E2E8455B5ACDF2 5ANGELENIGMA
143,597,062 *0DC4CCED2594D4F8F817FC2402C4BEA063729197 NEANDERTHALERVONDSTEN
143,597,063 *0DC8F643AA4A2C2D6A53D07CE1A0C452CA130A85 NECESA¬RIO
143,597,064 *0DC2099654E8AA5B522D770D449559D9C7461D9B NEEDLIN9
143,597,065 *0DC0406BE03F08A71AC12261BF771B6D8211311B NEIL.ARBRY
143,597,066 *0DC2B729742CE891A4BC298986237520A005D8BE 5DITORIALISTE
143,597,067 *0DCCA777552F602956753BA3FFC5E1A7BEE39367 NESTREVE
143,597,068 *0DC8384BF89EE3AFD23096AD18273C1BF6AD990A NETSIADAD
143,597,069 *0DCE004003B31F63FC9D6765F1C6822AD2C259B8 nevillebalsiger
143,597,070 *0DCBC44D644F11508710DC78327285C4821CCB37 NEWSSOLHEIMTOPRAIL
143,597,071 *0DCD9C67BE1C4B3723641FC75DD71DB18804FD73 [email protected]
143,597,072 *0DC305344977680AD5DA9EC3BDBE5B340E8F8CA7 NICKOLAS.HEAFNER
143,597,073 *0DC0708CA7C092F0E84876F52A3B5AC352DEB7E6 nick-patricelli
143,597,074 *0DCC457D0C555ED44570B94FCBC9002A71B20993 5influxious
143,597,075 *0DCFDC3E9583E15E2EB72D940ED9CAB8EC165B69 noeljapp
143,597,076 *0DCE4E31F21907C2D7CDD2C4CDBE79336A8BBACB NOLETTAS
143,597,077 *0DC23DE802D19B1A4252F54CC1D5CE9632A1EB89 norbertbrawer
143,597,078 *0DCCFE59342F2FE708ED697C992E51024E68F34E NORMAN.BICKERTON
143,597,079 *0DC5FD12F43C2A7298471B5812C492BFC8E615F2 5PERSUASYBLE
143,597,080 *0DC2FCE460194A494DB8819F7D21C73FD6974D31 NOTSYNCHRONOUS
143,597,081 *0DC78E6C33A30D28EAFC25651F3D2A3CC992279C nowthat'swhaticallxmas(disc2)
143,597,082 *0DCFCB47C5660DA3BBC420AEE6AF8A923FE3EDDC n.picante
143,597,083 *0DC8818683D705BC1D583EEEDA5E89055C2C528E [email protected]
143,597,084 *0DCE10BD9AF8CD91964114813576799D96DE822E nq|s
143,597,085 *0DCA84A84F28916BDD99B4A652196001369F47DD NSHAFERMAN
143,597,086 *0DC19257E9814FE259C4839541D01DD5262DA759 5SCHOPTTPOHCS
143,597,087 *0DCF8BC14703801D1A2EFA8F366504947362FD4B nvttyls8
143,597,088 *0DC4A523A1A5F1DC71C481B679915A5A26F2F8F2 NYRKKIPAJASSA
143,597,089 *0DCFD45D46DEAF3ACEDA254F7F704E9ED58B8FBF O5T3N51B111TY
143,597,090 *0DCA5A5A556028A4A4E8C0D6A34575CF208635BE =O;AA
143,597,091 *0DC42DD24A9F10130E0185A00DDBFF33384EBB77 obnnwsnve
143,597,092 *0DC60B3B06B17A20A518C7D832C01D859247BEC8 609esperanza
143,597,093 *0DC1E8752986115132CD8B6B77CEFB4E759DD210 obvinnmu6
143,597,094 *0DC48C503CFCCEE4F2C90A4017AF654475FE3A02 OLLEPLACS
143,597,095 *0DCCA3612F4E5EBB7AED200093709755A881B6E3 [email protected]$M
143,597,096 *0DC6D1E755F958A7C95B4749F0E54C5D4147F106 6e8cd3602016d9189a327487ed769ea7
143,597,097 *0DCC5A4EF173AEDB3132AE50C6594414729E2FAE ONLYFOR1234
143,597,098 *0DC03E12F965DF8CC6482A3E61BDDB18FA4CB81D 6FLADSTJERNENS
143,597,099 *0DC0453F777E3ACE3055DB536A99CB54BD62CE8B ONYCHODONTIDA
143,597,100 *0DC9FFBFFAAAEA811411114440ACBD2FA2508A0E 6JIMBOBTRACY
143,597,101 *0DC00C2B2A136CF0797913DA7EB509D47B092898 6KACZMARCZYKS
143,597,102 *0DC448DD11771FD910832CF332518FBC1167F8B9 6LENLIAME
143,597,103 *0DC9A0848AE41748D0D9FC5808804AB7D596A2AC 6LINDSAYFUCKME
143,597,104 *0DCB06559607155FAF0C81E4B046414585A82CA1 ORDOSIIDAE
143,597,105 *0DCE576B449EF9C037C64CE3CDC3E0E01216B19A OSBOURNEU
143,597,106 *0DCAAABCCCBC78B7FF5A5A09E32E1518977C2A0C 6RASHTIS
143,597,107 *0DCA7D4196D25F8F8A2C63D7090FD6D7D8C38262 6SHAASISHHYATI
143,597,108 *0DCE30088B98034C0B136F55F545F2C784C0A716 6TSALNEVO
143,597,109 *0DCC6250F2FC13BEE04742E4DDF6CE43ACE84AF2 OV3R1NDUSTR1411Z3S
143,597,110 *0DC8E5A67046BECA9B6A55F395FB20C5E621025F p{$
143,597,111 *0DCE13B7992A8ACFE71B133DC8EE927B11DDFD66 [email protected]~0~o}o{
143,597,112 *0DCCF5A0A81369C3A377B5F7EE9AC2A9BE7EF5BF P10108
143,597,113 *0DC69349B6F64817288CDE42DC37306491D47D4D p3rp13x1t13s
143,597,114 *0DC3AAEE3388548AB523178961885C387633810D [email protected]
143,597,115 *0DC36BA03C6AA52D38E58710F864E76568E2D22B PARKER.DAOUD
143,597,116 *0DC74058E64C482E4B3BACD1F266FEA28676FF9D PARTISANCOMMON
143,597,117 *0DC93B4FCFB7E22C1DEDD79760E06365AD45B5F4 7CHRISTMASSBSW
143,597,118 *0DCF76918AF3C454A6D630897DFBD08C5D37D43A 7CONTRETENEUR
143,597,119 *0DC3416030BE3D8EC958C4386FFD0D53512FB922 pataky-3
143,597,120 *0DCC5A7357925F321FEB6FCD47B371A2E066C881 7EHITYST
143,597,121 *0DCB3945667902E4244CD47686C9C6710465B05E 7ENRESKELFER
143,597,122 *0DCF2D85906EA4420F084924C083CAC50D3ECEA5 7EUCL155000
143,597,123 *0DC08D9045C2B36D163A48334F28129872669FBA PAUL.SHERWIN
143,597,124 *0DCBFBBD3EED6BF3B558185DA0F7878FA636A432 [email protected]
143,597,125 *0DC472C7FD32649383ACE069E382B877B02D9416 PECECOM
143,597,126 *0DC0EF5229106C4B82BC0A54B362E5976BA46039 7PISTEVIRUS
143,597,127 *0DC814EDA95B2DABD8A4EE3C08393ECA11D08726 7RADIOASPEN
143,597,128 *0DC87671F54543DADF2D9A57C96CC93B5E827F37 7SCHARPELICH
143,597,129 *0DC74AB49E2E4466AD08960E5428B88DC75B4302 PHILIPMEDEIRAS
143,597,130 *0DC52DD13102B81E551354370D5ECFCB53A4E639 7THISTITLE
143,597,131 *0DC02E15E827F1A5958A40601ED347489B25375D 7WARNERGOFORIT
143,597,132 *0DC94F4230155290DD0C806F1CE06DEBB9710AF7 PIONEROSING
143,597,133 *0DC97C4E8CA8DE5414320901CBE65B8C72B8CEC5 800GERMAN
143,597,134 *0DC85AD76842E4B6674B97BD9B3A5454F44F1C69 PISIENS
143,597,135 *0DCB98A946477AF6E8839507A0C4CB58702F414E [email protected]
143,597,136 *0DCA175324FB799024E987260FF56ADD29E284C9 83.PLETHORA
143,597,137 *0DCA6E6BE2FB6A0084BDE8D5AB6ACBDEC44A71E7 PLUKWOL
143,597,138 *0DC1BD6C943E6D1AB3538EF19B383C545AB41DEE [email protected]
143,597,139 *0DC4AE03D94164B462093616933D19EA2CF51079 POREKLA8
143,597,140 *0DC5CC86C17F2E758C892D2E2B3633B820790925 [email protected]~O-Splat
143,597,141 *0DCEFB890AAE0AEE2BCAB00A79B8EE0EF39D213E p==p*;)
143,597,142 *0DC08DC7A80BF87974D09299909A8EAE87EE084E pp~0splat
143,597,143 *0DC26B097DCFA0E8CACD4B30E3DA6C5010B991A1 8-b`~.(0-0)
143,597,144 *0DC4304F8750A31AF5F0418D729A0B1FECF6FDE9 [email protected][email protected]!$T!C
143,597,145 *0DC98E9EBD8A1625CA25850B55D44C0C09E4A2D8 8burlarono
143,597,146 *0DC1918F7C336FEC1F47899C33C902DA56C7CCBC 8--D-~03B<-
143,597,147 *0DCEF76A3485070D6F005C73F39C8E9F181F4FF0 PREIN5PEC7OR
143,597,148 *0DC5F222DC832DC476B214BED84604F038E4E086 PREREPUBLICAN9
143,597,149 *0DCE8B49888D8248C248E0E2E1D7820E7971F423 pre'''s'''byter
143,597,150 *0DC32AE827FF2A5C9CEBBBA6850FF3BBDF6A04FB PRESTONRIZZARDO
143,597,151 *0DCB72D654161E130E68611A3CC7BD63D5D348E0 8iamitaly
143,597,152 *0DC5F332102E4E2772DE731711CBE24ED9D6E626 Proper-Thirty
143,597,153 *0DCC9AA849A827392D3DA9912CEF8324F4BE387A prophetand*phrack*
143,597,154 *0DC9BCCD0B7DDE2515B544F840960121FCFE62B5 PRYWATNOPRAWNYCH
143,597,155 *0DCDB6E3AEEE98ABA0758423A2C278D58F5925BD psacimied
143,597,156 *0DC8FC4BD8002C9EFE798C60DD94377010881A7D 8NIJANSO
143,597,157 *0DCCA5D7FC534AA96BE838185D0673FEA3C5882A [email protected]*.SPLAT!!
143,597,158 *0DCE583EA3814E4E9CC2691631F302DB02C03698 8OEYEBLIKK
143,597,159 *0DC618B160AB38A51A89E480C644C7D3328D2961 ptjsmrkt6
143,597,160 *0DCE5A68052E38F5B33A81BC5B2BB055F1238F47 PURPURLOEI1
143,597,161 *0DC19AE69F80F0F407D563D6193694F3ACFBD138 8SACRIFIDEN
143,597,162 *0DC78A9FB90B053E02A404392C252919DF744B3A 8SAMANTHAMARINE
143,597,163 *0DCE7A3457D1A0C1CA4AEC0BAAE408C982EAB8BE 8SCHMATISATION
143,597,164 *0DCD758425F3A173649B58EA5E496A970D71ACFB PYRAMIDINSIDE
143,597,165 *0DCC2623D2741891D43BA5D088406A40FCFBB8FB PYROGNOMIC9
143,597,166 *0DC8D1458A4E3D289E5282DC780F80796FFBAA71 Q1W2E3SHIRLEY
143,597,167 *0DC83907750351BDD40FD7D4DBEE89CB5D598206 8SVADHARMAAT
143,597,168 *0DC0DBB4C22D798F9DF37A94BEE81F349FA69A04 8TEKIELS
143,597,169 *0DC4CD880F5F6DA1E3827D2A9A7CD3905211EE82 8thecaesar5
143,597,170 *0DCF265531A2279BEEAB4395EB4DC98D045A59B2 8VALTIOKS
143,597,171 *0DC5FB54634E1BAEF902DFF048B7BC27D29B4BED 944102 cf-:-desmosite-;-spilosite-;-adinole-
143,597,172 *0DC3598EA535284897F695AF121006134DDBE937 QKW8
143,597,173 *0DC981EE11B9D514C5F9A0F513C31A7AB51EC682 q==p * *(><)
143,597,174 *0DCED24BAE56262963A9C4DBDA09612258D40FFF 995LIBBY
143,597,175 *0DC38BC27716F1C02F377678502A7518BC091D19 9CHALLENGFIONA
143,597,176 *0DC81238D04E559F3447A03FE95F3D1EE124DDA1 9COWBOYWESTERN
143,597,177 *0DCA2B141248DA8AA2B561D8F2F2F002BF75F221 9CUNICULTURES
143,597,178 *0DC5B4F384EEA8F0C480368EF0EAD3350020B448 9DEPPANEG
143,597,179 *0DCD98C485E7AD510245F31801DF290D1254CAF6 r0$e77e$
143,597,180 *0DCBFE9BD7A1CBD1A4C8BF4385831F040A2E2CCC [email protected]$
143,597,181 *0DCA329ABF43E25D19F31010ED608D1892157D2C [email protected]
143,597,182 *0DCA8C656F16CF1D98C4AF9F944189D23B19C01A 9iamcarrie2
143,597,183 *0DC1E284119E305E7E44D12D028118019C165440 9ilovesnapper3
143,597,184 *0DCE36590DEDBB18367214AEED1C422BFCEA23D4 9INOPERCULATED
143,597,185 *0DCE1E1B02B0D67BB551049CFE5114EBF09284E2 radio-free-mars-talk-5
143,597,186 *0DC01C690F290E77EB2296EF5446391995952C8E 9.krabbes
143,597,187 *0DC0E60BDABF6234AE4EC1616A2AF531761A7F96 9livreuses
143,597,188 *0DC025798A0F7B2D0AF97E95586BF5EE76728B96 rain1986
143,597,189 *0DC127FC2091CFE056A871CB06F4F8449ED742F1 9OCT1244
143,597,190 *0DCC8830AE681A02C5971564FC99DD6E8446F866 ramonvanham
143,597,191 *0DC752E09033C33A5F6D08B6F0ABDB383541877C 9QINDARS
143,597,192 *0DCF9130E92677927030C1C013F78675172F6F29 9REGEILVTIU
143,597,193 *0DCE07A0628EA127C0DCF5C7F83D1D465516AEB6 9retrocognitive
143,597,194 *0DC2E4D1D8AFBB3B82B3C50C4E9AA07A36E75842 a11021999
143,597,195 *0DC5D6814D1AE3A95694C24C11133395919DFBCF A;3#
143,597,196 *0DCE409C588EBE66FB061C4A3869DA4FFC93D9DA RATANAPATISIBBITAṂ
143,597,197 *0DCEBED64087162BF99396CE68E5AEDC5F1093D5 rauljiles
143,597,198 *0DC81DD7C1365D77A78F8B2422F91AE6BF4027FF rb*aa
143,597,199 *0DC7CFC17669F6C01F19677012F623AAA807E91C RCREATE8
143,597,200 *0DCC185D672FF9913EE6BF8D603ABD405757CED6 A71557155
143,597,201 *0DCC1261272BA423C3F40FF96579CCF4EB404340 reachupandcatchthestars
143,597,202 *0DC72F8ABF613D1790AE102B6E5144EACCFAD81F rearmoning
143,597,203 *0DC0AC910C77172C97878E99FE8098243F528A79 RECI+A1S
143,597,204 *0DC25A18FEC08AD692927080AAD29B0F676A7B7E aaa^t)
143,597,205 *0DCFC69EB55B0667EB3BEAB598D68C4139E647E8 re,.cordes.et.basse.continue,.en.si.mineur:.i..presto
143,597,206 *0DC9130638966BEFC511CE010695C3D93DE6B8EB REED.COPPOLA
143,597,207 *0DC5ADFCEFDF2BAD94C356E034D87CB9C6BD41E7 REFEDESTIED
143,597,208 *0DC7B1E7D635E5D5F81E56284DAB7A245BF76113 REFRYGTINDGYDENDES
143,597,209 *0DC0A533195213C0BFC2BB93F47BBBAB899C7388 refusera5
143,597,210 *0DC81C33F236E8191CAE7C3E883383C83D6D278D regularbuilt
143,597,211 *0DCA4A7D47B7887DBCBC5F3F32D50DE185DA8D13 AAIQ
143,597,212 *0DC85A7CB517ACB20F38C4E350AEC915ED278CE5 aamasew1
143,597,213 *0DCC455C658595A83F941723F1445FD3D0690F85 AAMUK
143,597,214 *0DC82448DF3F0CD020307A4A6B482F56B9D5F436 aanci
143,597,215 *0DC7D24D4D5B3B4684BE6A193F24A227665981BC AARON DIAMANT
143,597,216 *0DCC18EE7C056AEA2C1B0C4B6011AB40E8C1AB44 RENZZAU
143,597,217 *0DCADB6D0328BF95EB70BADC87333304BD417B0C RESBBSW0
143,597,218 *0DC7995A47D9C40E761FA814F80928EA77005519 abd`l
143,597,219 *0DC0FEF03DAFCD3A5775349BE24702EA4A3AF935 RETURNSHUTDOWN7
143,597,220 *0DC24648601DEFAEA28FE8EEBB3B876F263076AB ABENULE5
143,597,221 *0DC3F186DE93FE746D80D40FA847445284FF0C52 rexcouty
143,597,222 *0DC2A1D8244999A112BC716E3ED487F8A4CFA703 REYQUINK
143,597,223 *0DC97F7FD2765D5E8A7485707BA4129733B56CF0 rhaisilied
143,597,224 *0DCF82A354E615BCE86E0B09DD126DFE8417ABF4 RHETT.DIPIERRO
143,597,225 *0DCDF59FCE1F2A92438ED2C94B448EBB6F8F8C04 abigailabcdef6
143,597,226 *0DCAA8EBBAA0E8076EBE49FB28E6FA870529DDCF abrahamstattelman
143,597,227 *0DC1A4F731277922DEA930A1C31A258CDEFB4D5A richluffman
143,597,228 *0DCB9524FF3B26C96039F35634B4FCB6E570E015 ABWH1
143,597,229 *0DCA5145E6A844B12DE55A62F0C5667970C88AF7 ACCOMPLI
143,597,230 *0DC6BA8A034A4C283FF32334A3840197244244BB ricoluikart
143,597,231 *0DC80163B233050452C26853EC90B13D5EF0B5EB RLLSPLS1
143,597,232 *0DCE660E0F91DFDEB59F0F68E536648F0F6567A9 achimost
143,597,233 *0DCD2F85A17E9B7C0E4DB553E05B910D5655F4E4 ROADEXSPB
143,597,234 *0DC2B64FA7BAD0B6BB2EF69EC41FBD137AE1A6E8 robbie.stokely
143,597,235 *0DC7ABEA46DA09B40F855F85AC8C8628D3BD25E3 acnds
143,597,236 *0DC8CD8C2849CEB275CD9181EF4388515885DF4E ROBINKALA
143,597,237 *0DCCAE6273EF7B8EC2863D56750B1BC0482C8E67 acw_b
143,597,238 *0DC89DF076456B892D61D99D405A3364E73FF145 ad3rs
143,597,239 *0DC21291556AFA845FFFA40F4220B8DDE3BF4A4E adelphogamy1
143,597,240 *0DCD12C7AC3079451D1A7AC5E0F249E929601D1B . A DESCRIPTION OF THE CHANGE THAT INCLUDES THE FOLLOWING:
143,597,241 *0DC5E8C73F9667B9416C84781261D7FE767C452A adkog
143,597,242 *0DCFEF35B0FAB966D1DFD0FA8DAC222D4E10D814 a!dla
143,597,243 *0DC0AD7B99021C81B2D2F1F19B90B32204C62671 RODRIGOBEATH
143,597,244 *0DCE31AF21072FEA28FBE65146D0C5D62A089F81 ADOLPHKINLAW
143,597,245 *0DCD907483FE5CB6B47C834F41E0B616E457B9C7 ADOLPH.MOHN
143,597,246 *0DCD8F6A4730AE42B3C028E8022C790621CC07AA adrianaltic
143,597,247 *0DCA86FA84E3DCE69E7562A175BC55BEFD022C1C ADXMW
143,597,248 *0DC20DD8572F90880B99FB065F7A2D882F021B16 ROMARNS4
143,597,249 *0DC797BFB5C056576065DD09DEF8B44C56BD1CD8 ROOSEVELT.MOSLEY
143,597,250 *0DCE6EECE4A2DE79760AD11FD06954037F32D6FB AEXTZ
143,597,251 *0DCB5F9263E89E00CF0F5E5E3B30BAC6C97A99E7 AFPAKKEN
143,597,252 *0DC59F398F1F531EDBD0FCD03292EF292369BAB6 AFSA$
143,597,253 *0DCEA862B1CA9CE2BF3439EE739086F7DC4FF114 AfwA
143,597,254 *0DC6B761D7B44E1157AD4A5356A572E276D513EC AGC%0
143,597,255 *0DC34C13FBC5C956DA4199F2581D257F1575FC6E ag-x:
143,597,256 *0DC75CA12D9C56653EE3DD8FC740886E44B2ED9A rundgesp0
143,597,257 *0DC1BFDB3E00213F17BDB2B60CBD6820666EF2E3 RUNNING-FROM-THE-STORM
143,597,258 *0DC4E10C5C771EDDB5A69BDF03F2D68B0D2944B9 RUPERTEASTLAND
143,597,259 *0DC7057231115526F192B850E965BBAC3C7D38C8 AHMADNAZIRIN
143,597,260 *0DC4B622305F1CBFD79679EB735FE33DBCE64A92 rustyberanek
143,597,261 *0DC28B829B6A24B47992651A0B3104BCCC98C73E AHMED.JAVAID
143,597,262 *0DCE2BA954B0AC21A227F2F8FAB34E7F5D3C4573 RUUSSEYC
143,597,263 *0DC50018A3B96A69CE3ED2E6BA210D430A0F89FE RYAN MAHANEY
143,597,264 *0DC2930374224BDA55B448266F17A3795DAA096F RYLANFOSTER
143,597,265 *0DC7D3F8C4CE02A0A7A65186249BE5D2A0123C26 [email protected]
143,597,266 *0DC6493656D0D7047B0CBC939DC68C1B3E8695A8 AIDAN.FOLAN
143,597,267 *0DCC8816D9C83F3DAC2FD37E3E5E30CE4F4FD53F [email protected]
143,597,268 *0DC256AFE31948681375BCA88F7C0D4646CEE7AB sacrabo1
143,597,269 *0DC91C52134C8D1A86DFD3BCD3D6A1407A09A4AA [email protected]
143,597,270 *0DC69469A02AF00BA46C5DD533E8729F8AAFD532 Akju
143,597,271 *0DC66E45CE8BA6ACAC35E20E648F6D3D38409463 a/kmc
143,597,272 *0DC4A0F4AC44F70B2EFE6E2E24BC0F142C236C5A aksyd
143,597,273 *0DC4E772DB655426DAFC2449DDE99EA4F52252FE ak-_w
143,597,274 *0DCBF55FCCD4807DACF4891F347F32190EA48B01 SAMUELKESETE
143,597,275 *0DC3341B833DF09B840FF10D39797E403BEB87D8 samuel-tamakloe
143,597,276 *0DC50E9A7014CC814C70FFA8098DDCC6869E27E0 SANCTIFED
143,597,277 *0DC189520FB5F5EB0075C6F83D8162B5D9C92E1A alcalisation
143,597,278 *0DC1E3B7231AFBB77C1315B6A3C43157BE3C8C09 aldenchassaniol
143,597,279 *0DCA015341E2E51226929EDBC8DF09D85CF5579D ALDENSPENDLOVE
143,597,280 *0DC555EDD043840905EB695F15172404566CFC7A ALEXANDER.ATTEBURG
143,597,281 *0DC20872A05531E19E45BA319D97D94A373CD518 ALEXANDERMINACCI
143,597,282 *0DC7D4503E8673D20AC2804F344438C0A6F78999 ALFREDOSFORZA
143,597,283 *0DC063C15046599F73F1B3F506887D65BE56B6C7 ALI.LEFLORE
143,597,284 *0DC9843C16EDAAEF8E6E6840A617506E9677BC2A satyrsillo
143,597,285 *0DCAB1EC24242015392240EACC59C3EB67E79AF3 SBRIGAVATE
143,597,286 *0DC91F1A211A5577DA4F0408F750E0889EE284B4 SCHRANZTOTAL7.0(DISC2)
143,597,287 *0DC1C580EC3B4CA7F7A6FF7307EEDB394B3AC785 SCHRIFTVERFASSUNGSRECHT
143,597,288 *0DC72E22EE4438E99EB9B5185B1514E46E860184 schrijfinkt6
143,597,289 *0DC1D4DF7368F23365C93D9ADF5A74BB3EA43B38 alletti?
143,597,290 *0DCFDE4EE14DA9158DA215AD485E7CC741F83EF3 ALONGWAYTOTEMPORARY
143,597,291 *0DCEF11F51F760FB86366003459C677BD6A3B4D6 SDNOBDNOBGNIDEELBTNEMEERGA
143,597,292 *0DC53550616241F8E8BC67EDE1305C52C81F20EF SEEDS-FOR-SALE
143,597,293 *0DC03D97B26B623A05146A9822A409C55DE4339A A.M-8
143,597,294 *0DC53B7C03D27C21BBCC42DDD0D4A366F2D1AD55 ama6j
143,597,295 *0DC582F4959692542B30E9DC4BA7C0F030AEFD4B AMBARUM1
143,597,296 *0DCF823C74DB946FBC9120226CC92CD255AE832C SEKVENTA2
143,597,297 *0DC70479A2A146D03F3A5194AFAA4D0069F15987 SELNEGAR
143,597,298 *0DCDB2B9AE93A3FF686AFFD7099684318EB4C91B americacindy
143,597,299 *0DC1F3A1093A9494240458A4D13F8910916125D4 [email protected]
143,597,300 *0DCC099DF5A6D2942CF0B3008811D7AEB3DFD9D5 ANDRES.CERVANTEZ
143,597,301 *0DCF597B6BC939BF33E4AA303B771838BB48D54C andreshotgun
143,597,302 *0DCA4A550DBC3329F0B6BFB1719968F0A78C8CC4 SEVENOAKSMPS
143,597,303 *0DC5ECB9040595760E745C358A7D890F05A21543 SFOC14TE
143,597,304 *0DC95BBB5E0040311E25FF8BAA79B842920D94CC ANGELOLIEBENTHAL
143,597,305 *0DC5776DD4D896E3BEEF54B4B38108268D00FAAA ANO6B
143,597,306 *0DC6B4B03091A2F39A43EC8692799675290AB166 SHAUN.DRUMGOLE
143,597,307 *0DC859866BA30C40027D38446AF8ACD26245E8A2 SHAUNJAPP
143,597,308 *0DCDEEB3A8E95F4EC07FB14EAB01FF44FB7DC8B2 SHAYMINT
143,597,309 *0DC9210A55DC7A76E6E241CB5CDC9EC2728BDF79 ANTIONE.DOLIN
143,597,310 *0DC271F1F3DC406093843C661C9CFF164572AD88 sheebas6
143,597,311 *0DC8631F70FB44F37B11D77912A505242A9A4D78 [email protected]
143,597,312 *0DCC8429610EE6F6D357450068B05868FBBDB7AF SHERRIAL5
143,597,313 *0DC42336DDC0501032CD810ADBFE050E996EEA25 SHIPFIN3
143,597,314 *0DCF94E1CDAEC62EC8EC4A968722076F0623A05B SHORTYCHERRY
143,597,315 *0DCE269A466A2E93875DE34A39B0ECEAF229FE4E sickhorses
143,597,316 *0DC14B6D097959C2DA743A44453957BDC0888382 ANYMOREGLORIAMARIE
143,597,317 *0DC68EAAF0ADC090A9B742278A8381FB83683865 a&."o
143,597,318 *0DCAC4A25F351CFC870C85D18B7D6CB4C68B71AD AOA_9
143,597,319 *0DC8838BFADC297EA41BD6EE69D8171443DB6048 aofhz
143,597,320 *0DCC5FE619B2133281F308F701525C8E9F1A8D77 A!PBS
143,597,321 *0DCCB279A08D1B1C5C5D4EE346D6AB75B17FEE9B SIMPELST
143,597,322 *0DCAE4636DB6486BE298457497AF04250177DA56 SINGH-VIKAS
143,597,323 *0DCDF36E38A83508FBCE8F909EF9983AE9B10B24 APRIL-PULLINS
143,597,324 *0DC5EB79FFC39E55288CA0C3712583EFA9A5E011 sitiey.fairuz
143,597,325 *0DCFF340254BC30F79EACBA9890DD43B4B5E0F0A A#)Q7
143,597,326 *0DCC9C273B1C7F40743ABE18CF042ABE30F81792 SKAPURR.(FEAT..DJ.STIX,.DJ.VIX)
143,597,327 *0DC031BC9DA8EA44CAE8A2E2AEA4C39F4F92E3B9 ŠKR…
143,597,328 *0DCE4178F32305657EC2C82657374B7AD405CFB5 skylons
143,597,329 *0DC868B0327E6F48631B60C81DEAACDBDC8D2374 ar7kb
143,597,330 *0DC48DCA0BBF09AE858FEFF9164540558205199B SLEEP ON [1992]: I BERCEUSE
143,597,331 *0DC5AD2175018E8678A8D26D2640C46CBFB18BAF [email protected]
143,597,332 *0DC1D3AD9EC8FEDBF59E1053BB2D0893BCA1D261 ARCHIE.KAIAMA
143,597,333 *0DC9A056F9DD60645F9AA186116FA98D85302972 SLUGTWOBIT
143,597,334 *0DCCEB3B6459AF9DDCC43795433360CA55F81ADC ariel709
143,597,335 *0DC24B7C4C19212F492422A7A9E6CCBE6CC14897 Arktinen.hysteria..Demot.19851987
143,597,336 *0DC2B6B6EB41474DC07BC7B5D499A16F5F30254F A;R+L
143,597,337 *0DCC2899B79150CCEEA09A40B99F88E9847DCB44 armandofingar
143,597,338 *0DC25D044C6AE4708C075D246B7BB612078D902A SMECHANI
143,597,339 *0DC1FB4B53D1BC53E80E2B235832138359632A87 snodasti3
143,597,340 *0DC33C7B88061B9FCDC59D479DBC11A0BF5DE606 ARTHUR-L-SCHAWLOW
143,597,341 *0DCDFB0753576134D3AD563527146282FCC47633 arturovinson
143,597,342 *0DCFFCAB0FDE018EA6DE560859F4EADCFED9480A SNTRKLSDCHTR
143,597,343 *0DC5DAB6706D14FBFD2EFAEA4143F1117552CF47 SNUEAD
143,597,344 *0DC0DEF7C15741D65A440D376784C525D2E45207 soccerfb14
143,597,345 *0DC2407074742122B64626DB2CC2F5926731C087 as.5-
143,597,346 *0DC5BEF50DB7BBE371FF0EBA31A26D4468C80ACD SOKAM
143,597,347 *0DCE374B3E43C70D8558F84B015F0A38A5985378 ASHORTSUITEFROM'RINGROUNDTHEMOON':POLKA
143,597,348 *0DCCFC49FF19435FB2911DC368345A604F0EEBD8 SOLOMONMONCE
143,597,349 *0DCB245829F8E2813056FB5022C76DD7D502A472 athikur-rahman
143,597,350 *0DC0DFABE349B9D07462B69161E1DC2784CA5A70 A+TRD
143,597,351 *0DCAD8473B8AA1CF43B2DBD9A6B8D6001869C0F6 sp9372
143,597,352 *0DCDA1D8D2D771263C61FAFC23A3B8E5F487047D spastiko
143,597,353 *0DC4FCC49F2B32754FBB7379CC9C11DC1F7D21E0 SPB416
143,597,354 *0DC49BCA60F98349F181056B27946787A0457A8C spice-girls-present-the-best-girl-power-album...-ever!-(disc-1)
143,597,355 *0DCB85E2BF2AACFD42F842F2695F6F1DFBD9651B splat~(##3
143,597,356 *0DC3D1C96BB6EEBBCB4B40ECE174C8EABE53F387 SPLAT!*.*.(=P
143,597,357 *0DC825469A98374A6AF6E4C72D4333969413F159 sploit.~.`[email protected]
143,597,358 *0DCD9795AD94CCC480A29EABD80D18376FE59E36 AV2VP
143,597,359 *0DC550390F13CB6F66DA8F283E38BA0BDECF0E0C AVERY.DECOLA
143,597,360 *0DCB095A0685669F97D76F126AD23C59C8BCAB02 averymiyagishima
143,597,361 *0DC387ACDBEADDB8E2D4AE479AB14C63DD393441 STADIUMKANSAS
143,597,362 *0DCED4A2CB5011D187A1CB8CB5BFCA21FF62CA1A AWVE!
143,597,363 *0DC479A39045058CE9D1DBB077D6D0FFF3DB989B awzrn
143,597,364 *0DC17525AD7B0048E82D9E5088B924BB42A1A7A9 STEMPLER9
143,597,365 *0DC336A0C315B6CE17609F7CF1E37D7F0755CA89 AYA.AJAMI
143,597,366 *0DC5D4BCDEDC252458FB0AE91552AB972C26F9E6 AYMARISKE
143,597,367 *0DCD2F334B94BAD1E44DA89CE5340F8B24256BA2 STJLLZR6
143,597,368 *0DC6A905DFBC9B7F17269BD0D67FCA14FBE7B626 B0,0K
143,597,369 *0DC8DF3A456D1EEB72BF17805F6387DD65A7D6D7 STOIKERE8
143,597,370 *0DC8FD40A0FA5A94804B001AD26FC686B66CF4CA b1w))
143,597,371 *0DC12203DC76BF0A5132976DF63747DAF03D5CC5 B5DWD
143,597,372 *0DCC1B122643D8A1050B49F3DB8645E4A5024964 B.5ND
143,597,373 *0DCD8EFB23152613AABD674EC79EAF5CDA3A4E01 b6##l
143,597,374 *0DC3EF7C22CE9DC827F01A22480A5FF4CD7A17BB STURULES07
143,597,375 *0DC571A9FDBD89E08D4FC9C728B4F93A4349CF8A STYLUSSES
143,597,376 *0DC0E0A8E2B7C17728BBD48AFEF3BC890360E94B s~u7
143,597,377 *0DCC1EE66DFD150BF05594883EA511A920571DF3 B%7FV
143,597,378 *0DC73561C9AD6C38B5CF8A3B4C80AE3D01B8FD87 [email protected]
143,597,379 *0DC0DCDADF50B685EAB4B70A91FE59886EC6FD0C babasdeperico
143,597,380 *0DC977C26FE3ED6E74E781EE869B4EEE400F4DDA babuinuses
143,597,381 *0DC74DB005FC4F9FE6C80AE4C38BF7AC08BE78A0 BACK-TO-ZERO-(ORIGINAL-MIX)
143,597,382 *0DC76DEC97154F74E6F3B1ACAC6D3666D2DFD799 SunLakeRinsed
143,597,383 *0DC7225E2319A83680FAA096F9F177691C7A02A4 [email protected]
143,597,384 *0DC5C29DA127AA6C34BC620B4593CA51518B8C87 SUOICIVN3
143,597,385 *0DCE57DA63B7592E4022CDC68FC7AE3DC8AAA39A SUOIROTIDORP7
143,597,386 *0DCBC5B282CDEAC14DAD587796C8E76021B42A3C SUORITTAMAMME0
143,597,387 *0DCB61E75C8FE18400C7162061DC252FF6A33A4D SUOTAMOLEYM7
143,597,388 *0DC22B4D5D8BB0366C20580F17592FB30E2C950F banhale
143,597,389 *0DC1BD26CEDE0E667414CB488A3FBB5BB3EBABBE surrens3
143,597,390 *0DCAEEF66D59BEDAE37890B091BDFD806DEF5C97 [email protected]
143,597,391 *0DC9FD5FA0207E065DBEF14761327E8786991131 bateti
143,597,392 *0DC1FAEB4E5E1E702C0797233D5BFB24A8FBB66B [email protected]
143,597,393 *0DC26C7771B2BDA905E2FA7209A7F4D11A3F9A26 SWE3TSTUF
143,597,394 *0DC9FBB30AE7AF930DDCC2446CC7477E2F663A9C bbb9l
143,597,395 *0DCD3FBE66213AB837FDE2730FBD799A707696D9 BC-/
143,597,396 *0DC856F7A94A3B2A9C9A347C017A0B02D2CCA8E1 SYLVIAECLIPSE
143,597,397 *0DC75CF74EEEABF2747C23B974D8F0F6408942E4 sympathiek4
143,597,398 *0DC8C52104DC693E98AF3B09D9B27AFBB3987150 SYMPHONY 3001
143,597,399 *0DCBD34A847BC0F161EB80831AD04AE148B21D8C BCW39
143,597,400 *0DCFB0D0949593CADB71B2A184655517331F6887 SYSTEMTALKARIADNES
143,597,401 *0DC3B6BBE4E8B9533C85922669B2C41F22D405A8 beekillers
143,597,402 *0DCCD687A297750E72B174991BCE40EDBA732CA3 begqb
143,597,403 *0DC27A559BCD2462F65625C146A33A193892C824 benjaminbencosme
143,597,404 *0DC677D292B16F9B26398CB405F3758BEBCCC04E BENJAMIN.RENSING
143,597,405 *0DC4CFA9F2AB04CE12DBB92817E393DB9F184703 b$eom
143,597,406 *0DCDECB1937F18D31E0D54D21AA00E1C4363FFFE TALSMENN7
143,597,407 *0DC7C71D2930EC9C13C2AB72D03FDF433B565F37 bernardoburda
143,597,408 *0DC02C5C94ACD5D57D47065F7A6C9645ADE23B8B berniekilbride
143,597,409 *0DCE5A1B3BE959AB22F5290556B78F29FD04892C bf5g"
143,597,410 *0DC084EF9B2E6AB24C07DA25DB4023E6B58414E4 [email protected]
143,597,411 *0DC21C64E94741063E103F13898AED8A13B2D820 TENDONNODNET9
143,597,412 *0DC22DB2B71BB48AFDF0E4EA9BC4BDFFDBE4EF8A tennists
143,597,413 *0DC2476DAEAE84FACC6E56CC2FE93DA9A2FCED94 TEO'SINTRO
143,597,414 *0DC533409A2DC4975F92F300B4E1073E7A9856F2 teresarachel
143,597,415 *0DC3C6BDEF6D2AC2512EE79840CAFB5BD5F1DD43 teritate
143,597,416 *0DCB767C26B7E6DD718477FB791B7ACB95DE97A9 TERNER
143,597,417 *0DC1D1CBB9744F0BE2AC441CDF5A3C1808D0D185 terrycolon
143,597,418 *0DCD5B53F71AFF6D1DAF9D7C3DD807ABD0C0F50F tessa-schmidt
143,597,419 *0DCA248E341E4EFB7C22CF957B1FBE87345C6DCC testx:coolx
143,597,420 *0DCF770FC173960B4F30D8E1E0427463B067E47F bhqvy
143,597,421 *0DCB608D7538C2C49E06B1EFB5D9946E13450CE6 bi4fr4s
143,597,422 *0DCC8B006AE790F709B2348EE33784394042742E [email protected]
143,597,423 *0DC78F96865FA14AFA469DAC285B70C685F242E8 that-awful-day
143,597,424 *0DCE9BD6271A20BFA8B53847BA940304D0BEC8C4 biçoku
143,597,425 *0DCFEBD20D66A74784181603DE8E72B63F728E81 THATHUANG5
143,597,426 *0DC9C711119DEF324D8AFDFC976FF4603509959D THATMOLLY94
143,597,427 *0DC4AC68DBC3000B437F33970FA594228E4223E9 TheAfterParty
143,597,428 *0DC4518DCB609B989E9A6AAB95E3DDB6FC0533B0 theavalon2010
143,597,429 *0DC1A1CC7FE2D3D8C8C0B833A9ED9577BAB43503 thedivx
143,597,430 *0DCA57673962FEEC78108AE0500ECFF51FDAD722 bishop
143,597,431 *0DCD4F7EBA9D9ED48F0208300AC16CA7A6872B3C THEPETEY32
143,597,432 *0DC07AFEAB9B1BC4A5B10768888FB4A618E454B3 there-is-something-on-your-mind-(feat-little-sonny)
143,597,433 *0DCFADC05B77C99F914BF4FF4CD089A728398A8F THERONZOLLICOFFER
143,597,434 *0DCE6F28AC0D0953823A2548B47D450C952EF61C bjyj1
143,597,435 *0DC6D355DC721DB6B7F8FAF844D563881872188A BKFR/
143,597,436 *0DC5F68518A5064D77F8DEB60956D4951586794B BLACKBACKEDGULL
143,597,437 *0DC67B46144A296FB7B680E193B463838C79304F BLAUGRASES
143,597,438 *0DCDD737F3490F8FD7741B272C5A5DA663AFE38C The<TT><FONTSIZE=4>H</FONT></TT><FONTSIZE=4>Command:Listing
143,597,439 *0DC90377ED10EB520377D651F9BDE2E442C9D297 bljsi
143,597,440 *0DC29AAE14018BA7B223336178913390D232445B blorbur
143,597,441 *0DC69386A5E6850CE90DC102B8F95E39BF43B0DF thurmandalitz
143,597,442 *0DC25935770BED09F15EE4910215E19A0540967A bluray66.8.194.25
143,597,443 *0DC8370690A7EFEFDB7058C1345A9CAD4A19B22E [email protected]
143,597,444 *0DCB521810C8C0301BFE6CFB9C99257F8B87B28A blwb
143,597,445 *0DC688B15A3340AC726D442D782E243DF23F5464 bm6er
143,597,446 *0DCE1A9A4AF2222EFC2D4322611D5B85BB689CD6 BM_Y%
143,597,447 *0DC3BCA4BF8C07FD8CD998716E586F8C37040303 TIMMYOPULA
143,597,448 *0DCFAD19E8550673DCD12ECA1437A6DDBCC8B4A1 BOB KLENK
143,597,449 *0DCD83590533F9DCD3E32B74E6F1AC338D1E0871 tintiniloveyou
143,597,450 *0DCF46422A83A705D3460415574690E30286168F TISCHALTARS
143,597,451 *0DC6CA19A0B40F550BC7190DDC04B06C15E6E200 BOJAV
143,597,452 *0DC7525AF38FB8A6371A63E0D89BD617E748B71F titus andronicus an if your highness knew my heart, you were
143,597,453 *0DCFD673A5C97519788A06DCD6EF70844057DA6E BOKENNIE
143,597,454 *0DCA29B566115A26AB98CA061F7D89E46B0FED66 b;o&m
143,597,455 *0DCE0EADE6605AEDF48B01B8763587714D8F11F8 TMPNNMNT8
143,597,456 *0DCABF542C3EF6034699FE80C53AB48027C8B3A9 TNEDNECSEDNOC7
143,597,457 *0DC8440F0544A7E56F7B540CE2F7591F9EA57862 BOOMSCHORSEN1
143,597,458 *0DC39957011B2FE4C4E0BD9BC72A1F2EE8200840 BOTTOMOFTHEBOTTLE
143,597,459 *0DCF99E244841F3BE7908E3C6A3CCED71294AA50 [to-jack]'-Only-a-dolt-would-exchange-a-cow-for-beans
143,597,460 *0DC1DAF2EBA9C18E90310ECC70EBCF430B2DF772 BOX.
143,597,461 *0DCA8DC3A0A8EAA063074F71D6320625FC047924 Box:-Tallow,-Felt-and-Ice
143,597,462 *0DC97015B84699C88F79B85A255AD8B9DFC16686 tookta-tatook
143,597,463 *0DC0739B13688885056F937ECB624CA082E14D82 bp=5j
143,597,464 *0DC3A8E818598FCF76ADA45D4278C327915D071C bpc0d
143,597,465 *0DC690D7A39EE8DEB30CA1433E1D82A3347A6716 TORRADOOTHERS2002
143,597,466 *0DC83D336098706A42BDB06B70A5F61357EF72B0 BP.O_
143,597,467 *0DCD8205019F7B4A31BBA114C597FE1FB2A0502E b_$q,
143,597,468 *0DCB98CA4D4BB1F074145D6014EE91D6FBCB550F TRACYWENCL
143,597,469 *0DC8EB9F308F8828BD4D2F4061288F3E8F740E0D traumatologies.
143,597,470 *0DC929DE4F8A52E4217710707334009EB6CAAD40 TRENTONWOOTTEN
143,597,471 *0DC0AF9C4E47CB5EE69E5D4D4FEE294A0818FBC8 TREVOR.SMOOT
143,597,472 *0DC98046C84A123C26422306CE85E9972D8831FB brandon766
143,597,473 *0DCCCC85E495F8FC0EEDB8C79801BC3B8F7C8E61 BRANT.YORE
143,597,474 *0DCCF4F3B872C03EF3DFDCBE54F84AE902A25F54 BRENDAN.FOUYER
143,597,475 *0DCCABE7734CF2C0118C0A914AFD91E0694B055F TRIANT-XYPTERAS
143,597,476 *0DC2EF8C90F20FAF9B7BDE7DAFF5473E84658FBB BRENT.GOPEN
143,597,477 *0DC33E2A0B400A52A1F1DB7E2CE630FBB8B2BA70 BRETT.STANDBACK
143,597,478 *0DCBBB616B922527DEA2A573DD56A261B245A531 [email protected]@[email protected]
143,597,479 *0DCEB6E58EABD44BF0474E290149A7F1B01D0B8E troie”
143,597,480 *0DC2E1C7BA201161E3EC1B25AE29D360A19A6E38 BRITANYRENEE
143,597,481 *0DC11A1C74F3ED368EDA77DB23E4A642E2401517 BRITT.SCHLIMMER
143,597,482 *0DCD142452416DFA2F07A73815F56CBC3F05AFB3 TSELBAF2
143,597,483 *0DC51E7037E40A5AE6D4618DD5EE202FBBFC3D67 TSIGOLOMLAHTHPO4
143,597,484 *0DC1CADBB396D3D87472F36104AAF30D2D3DC5F4 TSUKISAM6
143,597,485 *0DC2ED012C77DFBE7DC619C15FD94CD8800FEA88 TSWUAGLUG6
143,597,486 *0DC23EE5932B6F8B896BF40BE7FF092822A51DE0 Bruu
143,597,487 *0DCA2670050F6BD489EBD2730DE7E7BC01075B21 TU-ES-MON
143,597,488 *0DCCF33C7FCD5E819223BD171946B998BAFD5F36 tufftittyrap
143,597,489 *0DCDEA38362C1B44D67ADD7ABBBDCBE06D583DFA TUNASBALICOMWWW
143,597,490 *0DC142A7E7009B2323CC966D573E1D6427CA7B28 [email protected]
143,597,491 *0DC0007FEFA4A2C10A86ED599700EC35C84BA4EA BSPB!
143,597,492 *0DC750B5998086D67E9FD3AA02D40ED73171A82B BS=RD
143,597,493 *0DC6245702DDECDE102F2B6BAE5A648A8D98A430 TWELVEVARIATIONSINFMAJOR,OP66:VARIATIONIV
143,597,494 *0DC9E748F3A6B68CD74CEDB3B2C4E4057C98D9A1 BSWAD
143,597,495 *0DC924E32DDB07F5AB40588005E6298FC9C0B5FF bswchalfontbsw
143,597,496 *0DC4110D146CE420B164F8A844140AB07B54804B BSWKNOWLEADGE
143,597,497 *0DC96B94D11585E7B96865BA4C201ECAF0AC7C65 U+}+
143,597,498 *0DCF9526042C0B8FC81734596809A74A908A93B4 BUCHSLEKTOR
143,597,499 *0DC8A42293202A00A728476948D5CC9216A093C5 UGURERDOGAN
143,597,500 *0DCA53BFF20F8CB7661546CAF3FEA9C00D04A6CD BULGARIATHE
143,597,501 *0DC822C2C6EBD42EB52323C9C2B23B502C34DD09 ujmnhz
143,597,502 *0DCB8ABEAC24DF4F0BB219CEBA127545BBFE69FB UKAZUJEME6
143,597,503 *0DC5835966D593EC9ECB77D57F60E5326CBDDBB6 ULMARIAS6
143,597,504 *0DCB155B1E535DCF02E86C25C0CAE9B093FB6177 busterminogue
143,597,505 *0DCD87696AEB4DB904476AEB62D1ACB69D408EBF UMM.VIOLA.ALPHONSO
143,597,506 *0DC1D8D97D988C822C4CA602494A9F60A2B341C4 BUW5
143,597,507 *0DCC7DA65DE6D2D8530E2DDE1FE9BE13295B9F01 b.v&$
143,597,508 *0DC512C06B59335194B720601052FA03A381DC23 B?VRU
143,597,509 *0DCE720DF2F2DB0AA42C4C30D9D74AF51132BDD7 bv::u
143,597,510 *0DC4954C4F883853EF543DB955981337B850C8B2 B"WH
143,597,511 *0DC340BA8599E4E12BDC9873303E6ED872B76063 b=whn
143,597,512 *0DCD696DFAA0ECCF2950EBE14978029D511D667D BWN!K
143,597,513 *0DC19B17EEB7007745955AAFF66A38C73074D4F6 B.WS9
143,597,514 *0DCC4B8E2EBCACB1395FE30BFC01D3386E55088B UNEINIGER5
143,597,515 *0DC151247885D5080947DC7F73C9DFF375B6DC2F UNSZOLVÁN
143,597,516 *0DC5C95A37A2D8C8EE100C33BF5D6194B2E8403E untagining
143,597,517 *0DCCAEFE2D396A9BF2CD616F4651419040F00589 un$ub$+4n+i4+ed
143,597,518 *0DC3DB9EC2C83B0E13B561C6BBCC378047C20B5C c0l0n!z4t!0n5
143,597,519 *0DC2F5671787EB4C86258D08C98A6A06BD52A466 c1p&l
143,597,520 *0DC48FAF6BB10AA47F3999E46C4013A4826E13BA c-2es
143,597,521 *0DC56D63F72B5BBAE92FB1C7696F54068E40AEB2 C)2V
143,597,522 *0DC0F1AB7F4E8919786759DB77DE1B3CB57B4F85 USERSTARABLAZKOVA
143,597,523 *0DCDD9B5E63E280C27D871B266C0322454923EE3 c4r3tun3
143,597,524 *0DC5534DFAF82ED878D2D64CF15BA0F545F64CD1 USMANSAGAR
143,597,525 *0DC8F0C99FCA678288CB9E26E0E87A7DEA254AF6 C5_b
143,597,526 *0DCD7B9B997BC8EDF45C419686E33D57A2C0E255 C!6/
143,597,527 *0DC3F5BAE95B8B0A968D2E287DAF21B79C623EB3 UTP3R10D1C
143,597,528 *0DC65AE8A445EF802FAEB26F0FDF39E13B4EBD45 uz/6
143,597,529 *0DC11EE0BAF7DF61BB35CE5B9B71B4E1C4FF46B5 c:85k
143,597,530 *0DCD42FCCE9C1A271A211DA9FECDD63B525D61A5 V4NGLORI4RLH4S
143,597,531 *0DC520E9A56752B889FCAB8D58090A3805A457DC C8TTP
143,597,532 *0DC148EDAF36EE09CB23F3CC0BA4113E2248C2D4 c8w!
143,597,533 *0DC7BBB66C7DD09CF1236E4CACE41B8E6EA508DD CA7T
143,597,534 *0DC3CD8C85BEA0CF3AB4F1F6443311A089EE9D3B VALENTINEHARMANN
143,597,535 *0DC2B80E2D74FACC7CFB8D47C36C79C49D8D5378 cafevienes
143,597,536 *0DCC567B986C2D33B4F7063AFBD5FD4C08600083 cakracara
143,597,537 *0DC3AF5DA57E55973C9C3B32447D6B586D4FBE43 calaigian
143,597,538 *0DC1944D0EBC64445B46609BBFC63B72BB93D646 CALAIJOS
143,597,539 *0DC7E80B7A5AE0CF9EFE0241FC3E028ADE104BA9 CALEBTODESCHI
143,597,540 *0DC4B800F19FC727BEEAD33CB56D5901AB7A93E3 caliche121
143,597,541 *0DCCB8197B54EAD6DA5E7D7ABE989767DADBE7A5 CALI MIST
143,597,542 *0DCD6467660FA4B55C685CE5B22DC494DF7EEFFE CALVIN.ELDIB
143,597,543 *0DCCC7DF18E668C40BD892E0208FD2D80346B387 CALVIN.HUBBARD
143,597,544 *0DCBC74363B08C387AB03BF4B71255EC9DD783A2 VAR.GAN!
143,597,545 *0DCD3CB2B33CEBBFA202DBA3237168920103CD5A vaughnblaida
143,597,546 *0DCA4467A93A88549E386A2D1FF3254B70F43B8B CANCERTHENAUTILUS
143,597,547 *0DCC28B60E625C0D25A1D7F4260E4E970C35BBCA CAO-BAO
143,597,548 *0DC64828002D844C927EF0D0DE78209FE0475A88 [email protected]
143,597,549 *0DCAE64041DDE8CB54DCE7E2215FDA795A4615B0 CAPACITIVESENSING
143,597,550 *0DCD954CFB338D18FC738E4AC082ED2004EC5B1D carlonailor
143,597,551 *0DC3338CB9E095A59D9D7E0BEAF55FB5789095A1 venetiqued
143,597,552 *0DCF1943DFA33CB46A46E4D2057DE05AD25C394D CARLTONSCINTO
143,597,553 *0DCFD22704E8A192E788C02F18E484DC7CCD3D78 CARMENFULLENWIDER
143,597,554 *0DCF1F1D98CB32DF2D8889810C06A43F7589A032 VERNONMARICHALAR
143,597,555 *0DCD226016E47A0502FB2993A4841D4B48886FBA veroveringsoorlogen.
143,597,556 *0DC1C1851423A85D20DFC3A8371053559ACFF745 VIBRERENS7
143,597,557 *0DC8F560E33A4A606637C19CB80315636AB24676 cathy-wiedeman
143,597,558 *0DC19014E7200F4C35DFC37B583763BCF7BCA8AE CAWEGFUA1
143,597,559 *0DC059A8C07755533AC977303DBAF991DAE97009 VICTORDEPARDIEU
143,597,560 *0DCDBC51965250A8F6A8E3A6931A0FF0DE78CA09 videóval
143,597,561 *0DC29703DD26B35BE89BE48FC3AC29ACC0611B46 VIDPUORG
143,597,562 *0DC559D02E48FD4D64A70530152CCBFAACDC138C [email protected]
143,597,563 *0DC5403435143386F43CACE33E846D9CA879E5AB vijaybhaktha
143,597,564 *0DC3765F8B32015C822711A1D8CE17E1749A0F54 CD4+CCR5
143,597,565 *0DCFC92495101FDA501AF2BF949FD8630C4C04AC [email protected]
143,597,566 *0DCB16F5EDEB0599E0258C13E828C6D6095DDFAF CDV/O
143,597,567 *0DCC7738E37EBAD63305827E4F55493F6CB3E6CF C/EE2
143,597,568 *0DC713C2454B00649C272B4F334A2116CE2CE172 CELL.S4P
143,597,569 *0DC557A37AAECCF17009659AC83889066C64D342 VITRIOLICALLYING
143,597,570 *0DCCBE10D123A7EDE08B721EA6AD36DF1226658C vivian-vanessa-viveros-medina
143,597,571 *0DCEB2F66979A8F6E0BDE502F5AF4270B6EA6642 CESARDIDONATO
143,597,572 *0DC10B0C5F3EC0C85B17042C5D0170153FBBDD2F [email protected]
143,597,573 *0DC850B4F16CE4C8C9179D44F25F62752DD9D545 CF;3D
143,597,574 *0DC0A0FD56A0A978486693B01F5568DD55C1892D V":M
143,597,575 *0DCD19470A73215EBBFF0CE71565E7497046B95A CF$V+
143,597,576 *0DC779EFF398285832B26FF0DA5B57A68C319238 cg*^
143,597,577 *0DCEE986C95C62262FF956F3E3D022AADA0F49B9 C#GE0
143,597,578 *0DCFE2E5A085335530AA02FE09B25C8E80D5AF1D CG%MH
143,597,579 *0DC5B1CB94A6F4AE2AFAD99B73FEA854EBE669F9 [email protected]
143,597,580 *0DC909BF31600474F3C6C449BBBFBC6F92CB5FDD [email protected]
143,597,581 *0DC024BD90275D81F3EA65BE18916F95390E9B35 WADDES
143,597,582 *0DC158F0E9806DE985CD64E88A967D0E1988937E charles.taormina
143,597,583 *0DCB9E4F2187051C82B249DC1CA9BD5802D4762B WADEPARRENT
143,597,584 *0DC0C96DB0CFDBA90C3C4782B8B8AC41CF426A58 WAFIK-ANTOINE-GAZALE
143,597,585 *0DC16A9AE56DBFCE3B79462A3032B84C48637FCC WALDO.CASARES
143,597,586 *0DC7F7AB3031D58CFC235BE46F74618F096CD3B3 waleed-al-rawashdeh
143,597,587 *0DC28E8CA088E2B3C0288264441E81F2AEDC6F49 CHETADERHOLD
143,597,588 *0DC77AA44F1F0DCF0CB9EBEF8B664D618FAAA0A6 [email protected]
143,597,589 *0DC50057DE700F3F940A3BC976B840552FF677B2 WE DEMAND A SHRUBBERY (SCISSORKICKS 'ELECTRO-BARRIO' MIX)
143,597,590 *0DC46F8EBA0EE4E0B8FA0C1C33E6C598A0685B28 weggedac2
143,597,591 *0DCB5623F6D5F081EA24637A96CE9EAEA81AA2AA CHRISTINAARMENTA
143,597,592 *0DC6C0E56BE312A671D22402A97BFA3E245A54FC christinabellman
143,597,593 *0DC438DF106F06446C043A5D562047C41111F19F wennevold5
143,597,594 *0DC0F5C88A0988EC86DA5C58AAB94EFD9D92259D christophersanocki
143,597,595 *0DC7FC7127FD5E62E6BCE042459D6950A298AF53 cħwk
143,597,596 *0DC9F3BC135E8A1A52788B9103602F5F6B669DCB CH,Y0
143,597,597 *0DC286A095FE10E466D8B21B042C2A0494F33709 [email protected]
143,597,598 *0DC2828D7AE3BB033356E460E9B5FC216638CB2F WHEN IT'S DARK
143,597,599 *0DC6F963FEF2E8E2D954D1C612C2C16B0B532FB5 CI;PS
143,597,600 *0DC4C37D0F16B4A68FB266E6C732905F44985F8B CITYOFBUFORDCOM
143,597,601 *0DCC8F6349DF14569DFD5171160C6CC936F7A587 WHITELABEL-REPUBLIC-(DISC-2)
143,597,602 *0DC1F6DB09BDA366180C3BD0D5A4C2FB7F17AF8E whitney-boatner
143,597,603 *0DCD62CD86F9CFDA50125A364A71394999F7149D WHOIS 43
143,597,604 *0DC03AD3D6D92FFFD36ECF900951C07CDF3D1C02 CKPH
143,597,605 *0DCAF8E38C3052A28748A704DE3215A630A1D603 CL27D
143,597,606 *0DC5E65D07EA5C7C955A5D88EA7162531E3169F1 clarenceleidecker
143,597,607 *0DC1A09DB60693A994CB6FB56F5163E8FFC24543 WILLIAMS.NOSIS
143,597,608 *0DC7B32AA53A705740AE60878A355FD1F1A449CF CLAYTON.CULBERSON
143,597,609 *0DC7BFA84338B2CCD964C182F1E20A3078023681 WILL-ORTEGA
143,597,610 *0DCF96D03683588AE65FE78EE87C80FCC03C237C C;LGS
143,597,611 *0DCFE7039A28E92B6387256B884DC8F838B51D6E cliffshern
143,597,612 *0DC1D96489AA25DB56020AC3198C22A38FB2408C CLINTPESAVENTO
143,597,613 *0DC7B7CBC8D445B317D64E5ECDD3EC63F847A9CB wisdom.yaw.ghartey
143,597,614 *0DCD206D3CECD716078E796F142820C7849E5D8F CMAAR
143,597,615 *0DC50CB3A63113BE4E5F205FB899D2436034C388 WISITKOMTHAE
143,597,616 *0DCDCB59E6EEFC00AEE724C9CE2FD66981698A6B WISSAM BARGHOUT
143,597,617 *0DC9DE1F090D6899AF2147F86DE516379D010D5C cn?fs
143,597,618 *0DC94E554858585A39D96C0B801BF47BE2CCF94A CNVNTNST7
143,597,619 *0DC0203A8905D590DBBA04780457E60190BF93BB c=o
143,597,620 *0DC10B9168D8F0A9D6F2EA2AB3E794112F030BFA COFFEEANDCHOCOLATE
143,597,621 *0DCEEAB9C8361C955956F98D56DA58B0E6BE35EF cojyc
143,597,622 *0DCF1A5387FE01EE61A5FAD2DC79984D4B63CD5A cokl&
143,597,623 *0DCC7E3C7A8987BD6B77F28844CD0696A73AA8A4 WOONTAK0
143,597,624 *0DC64FA70BFF37462CB01B795BE686A2AEEC7CDC COLLEZIONANO
143,597,625 *0DCE97998EC87832F91DA348156F044D1728AFDA WÜRZNOTEN
143,597,626 *0DC2628D340C9A91496E838C289852234DF6D50D WWWDEEAGIIRLHI
143,597,627 *0DC9522DF9F96FA8FD019576FCD2712D75173A97 WWWELECTRICALINSULATIONMATERIALCOM
143,597,628 *0DC2732DEA8F32D381534189D89B0B12DF2A4A5E [email protected]
143,597,629 *0DC499A71B1F4D2FB26F0A36F8755E0A49EECE90 CONIUNGO7
143,597,630 *0DCDD87E0E4A02921ED711BD65E1A726B40937D8 wwwmielevacuumelitecom
143,597,631 *0DCAC0DB2AEEE9CA31DF0B3551227FEF2CB5BA4D CONTAMINER1
143,597,632 *0DC2663C99CCC2302C81FAF2EA9F5FDA7FF69187 CONTARLAS1
143,597,633 *0DC281C82CF7E75A95A5331AFC8A3E270DDF29B5 CONTRE-ATTAQUERIEZ
143,597,634 *0DC5415988099BD54BD84772049DE15871549449 W/!Y
143,597,635 *0DCFBA0502978D44DD1DF8F55706C606EE80A62B "[email protected]
143,597,636 *0DC8C6309B67E6CC2DD579BB54B89D3A9A1D3D07 xchadleonx
143,597,637 *0DC8F2E12918A623D5BF1CC9E40EC77FC19870BF )X( ~ ~D###P
143,597,638 *0DC3C74EADE29BFBF078FC48BCD09F7463188F23 [email protected]
143,597,639 *0DCF01DF0EC981CE0C95F4281E2EACD7E6D1B9F5 [email protected]
143,597,640 *0DCE0FA028CB668FDF80186224EF08CC78E6144E cowf?
143,597,641 *0DC92CE5B32C664776E26498CDE062FA5909C55D COYHAVEN
143,597,642 *0DC37EAFC401E7EA4B7AFB071E2E335BE699BA72 CPFUX
143,597,643 *0DCA11A486A4869D22152A0D363D01A727CF1F4D [email protected]
143,597,644 *0DC23233FAEA24C3EBAC3657733B3621FB045334 [email protected]
143,597,645 *0DC51423033E1FA4E7EE066CBE4A1AD5C915314D C:\PROGRAM FILES\ADOBE\ADOBE BRIDGE CS4\RESOURCE\ADOBE_EPIC\EULA\BACKGROUND.PNG
143,597,646 *0DC8A9C39941BEA75F001E6F32F168A8F371D3CD C:\Program-Files\Common-Files\Microsoft-Shared\OFFICE12\Office-Setup-Controller\OneNote.en-us\OneNoteMUI.XML
143,597,647 *0DCBACCCC9B7F1727B4B6F4EE5DFBB4D02148EAB C:\PROGRAM-FILES\MSDN\MSDN90\1033\OFS12SDKHXS
143,597,648 *0DC6229CC61F576B5E5BBFE64126176A480F5AAD C?P_V
143,597,649 *0DC334346B457CF920697EB711EBE60A8BC63A0B CPY+W
143,597,650 *0DC6A9D3AF50073CD9392D48B98A3202E9DDC8BC c?/r-
143,597,651 *0DC61A80877526183DE667273EF8D2656DAFD59A CRAVINGS!
143,597,652 *0DC62920E71DC8DBD4A4E3B1F3D73D4230EE4532 CREDITS BEGIN OVER:
143,597,653 *0DC3DE3364243E4A773EC748CE4192AE7A1BA6BC CRH6V
143,597,654 *0DC85D76F24B7C2E470CC17164FCA9DD12B2FB16 Y912236
143,597,655 *0DC9ECA4B07EF47FABF652C43EBA75C8D8333CA8 yadz-sanchez
143,597,656 *0DC063770DE6639BFECEAC4C9A01874436F74E3B CR%SI
143,597,657 *0DC202A6CAB8FE3B71C7F105A4512AE99B01AE75 crying(originalinstrumental)
143,597,658 *0DC347617E4CFADD173B00397BF7BCCFEC3AD8CD cs/2o
143,597,659 *0DC07502617D26AA097C690DFA47531AC29F5D89 [email protected]
143,597,660 *0DCF46D75D10F826316C2DA0615068EDD9D80100 [email protected]
143,597,661 *0DCE1A49971CF8A4E1EAB36E67EB7FE9A3BDA0A3 cspring
143,597,662 *0DC7FB8A3F03F4E9E66A6B369EC43193D96D8DC9 CSQEU
143,597,663 *0DC63E804991686D5A909D90E11EC67F343019E5 yd4v
143,597,664 *0DCFCF165242144C73F8DBAEFE9D714387C90707 CT6S
143,597,665 *0DCFAB4AE7DFCFFCAC9B6058BD74AB43FE306B80 [email protected]
143,597,666 *0DC3CAD6DAD7CD1DCB398D117A232E9F94A86C9B cu8o(
143,597,667 *0DCD3B2764AA8033B99D65DB4055E0DF0AB89B8D YING KANG MAK
143,597,668 *0DCA17CFB7ED927F184F27C5F2F3B2610966A2C6 [email protected]
143,597,669 *0DCE66B5F584F955AE44DF80A11AB8E4A9687E1E YLINDSE7
143,597,670 *0DC9FBB223EF75E9FF3BEB71397EBF6C692BC8CF ymatrebla
143,597,671 *0DCF0A9E499B1BECE7369340A9109AE29150CE9B Cusr
143,597,672 *0DCDFF29D85CD61009B860B4E94601EB1715B0AF C"#V(
143,597,673 *0DC5D45F3DF37349818A4A106B285BD79E386032 Cv8q
143,597,674 *0DC7AEFBBC008ED08FDFF0FF8529F3E0EAEA6C89 YOUNG.GOTSHALL
143,597,675 *0DC5B20D38D104E6E5EEEB9E6275B08D80AC702F cvomu
143,597,676 *0DC65956119099F5F2924D42CE1C2654616DF7E8 CV-T=
143,597,677 *0DC8893D70D3CB7C8A8BF33F1846C2AD5A9BA045 [email protected]
143,597,678 *0DCE5FC15C01BFA1CA5E9DA2ACD1CBE30926EE3D C$VU
143,597,679 *0DCD5A5B7BDB4693C1D68A6708AC09E02768C12D CVW,;
143,597,680 *0DCE599440D89FACDE3CB71E5BB92E376FBB2D2E YP%B
143,597,681 *0DCF90BA26BCF161CDB7A120BB92C32E5BD0C608 cxdx_
143,597,682 *0DC3D8BDD7E53A4EB1654D399BFE6715A4C98E49 YULIICHIRO
143,597,683 *0DCD457EF7B8D89530CBBBFE2AEDC7E4704BF03C CYCLONEB
143,597,684 *0DC5D8B4F5AAD1ADF75C9807386AE1BB4FE5BE04 YYF53FE
143,597,685 *0DCB08A4B86C3F97F83D1F39708CFBFD3BADB635 ZACHARIAHROST
143,597,686 *0DCB5D7BE1B13985C0BE96998ACB4D45DF5428F2 CZN(
143,597,687 *0DC9A1F0C95EC3A4E003848E12E162920883908B [email protected]
143,597,688 *0DC22000C7E50CAF1A2AD6B24BA614AF07819D00 zakladajúce
143,597,689 *0DC950FD6461218BC37485C4A1D5704DD144D57C D13WK
143,597,690 *0DC81819ECFFB016FAB35BEEA8F16740BA90C475 ZAPATAROBBIE2
143,597,691 *0DCD607EAD1A8BF639B9C11D76C58956F072C05E d1(bp
143,597,692 *0DC2947E3D328489C9A15E7282202316326FBD26 d1tl
143,597,693 *0DCEBCD75578AE7401713CAD6E76BC273AB7C09D [email protected]
143,597,694 *0DC8ED142CCAC9D4238BBFFF2FB7DA5DA5486113 [email protected]
143,597,695 *0DC60451AF50AEE54FCDA61FF28D3C1E489B3D13 D5XA
143,597,696 *0DCD61600E8109113960A146F0DC04A2655BC51D ZGKGSQHY1
143,597,697 *0DC3745E4EFAD439B1236583243E27A2F7B89E5C D6K14
143,597,698 *0DC6D69CA993C78327E78BB29537F1D1FDFEB37B D7=2H
143,597,699 *0DCD8CFE010A3959A7507561059023E1F4D38CF8 [email protected]
143,597,700 *0DCB15F79EA293692EE65C0814834EB7F4861219 d7oik
143,597,701 *0DCEFD9232B0D7A7F636A6A24F9FBEC85F598934 [email protected]
143,597,702 *0DC88201EC04FC1BF9D1FC81563B2475FCEC61CE d8rkk
143,597,703 *0DC225B376C856D81961C54F2D3CB0AE90019C64 d/#94
143,597,704 *0DC0E950DA2E99E28AAA6D840547AAE795E99B26 d9zb#
143,597,705 *0DC088F674AA03A5DE40AFF03317D7196BDFB2D2 znmw
143,597,706 *0DC48179C47C01F6F607CCC433AB9C744DB9FB27 ZOANNAOZ8
143,597,707 *0DCE7D44421FE620FAA59B2014605A92E594D6ED DALLAS.SENSENIG
143,597,708 *0DC3A69122717843A68F5CF643026262D9F37DED [email protected]
143,597,709 *0DC1DA8E90985319E9AC7B0BC4116B5C212A44F3 DALOKBSW6
143,597,710 *0DC6F1D7F3A865610E4FC25B17F41EB122B1545C ZUMBILI7
143,597,711 *0DCB4E0C8715DEF2635E04B72CA57FD563126E5F ZVUKISEV
143,597,712 *0DCA240BA26D6B4E1D467FB20621D62FB71FE22F ZYGZAKOWIEC
143,597,713 *0DC399A6E568CF7C7A018DA42F9E1EDB2153668E ZYRUXG
143,597,714 *0DCA9440231D142988B14FAE53D84BD2AFCEF4D3 danielluskin
143,597,715 *0DC4FDD1616235D91C93CCD9B8F0F2025F298B8E ΕΞΥΠΗΡΕΤΟΎΣΕ
143,597,716 *0DC0F9466573DA80E4C377818EDDDF72559A3309 darellmihelcic
143,597,717 *0DC75C187ADD2F7453B1253EF93CC93486A1D2CF DARONDEMIEL
143,597,718 *0DCC4E759E1855928E5075BE8E6BC9BD4BF153DC DARREN.VILEGAS
143,597,719 *0DCDD47EE7326EC9E2343B114A55185DB28A9EB8 dawgroad6
143,597,720 *0DC81FEA3BA68F7987B4CD3D59CCD446B6BB338E зимины
143,597,721 *0DC1269E0CA455B3C00712DFD2D14315670C7CB5 КАМИЈЕВОМ
143,597,722 *0DC93C7A1920CC949615FDFA1BCA4E44B564A4E8 DB)%J
143,597,723 *0DC44812120B06857B2EBBA1D4D04ACCBF6F8E46 мзимела
143,597,724 *0DC3C9066483D7F6F023BB373DE9CAA20CF2AB35 МИКЛУХО
143,597,725 *0DCBC4CA6F8F46C55B27F47505544CEA485968D9 МѢСТОМЪ
143,597,726 *0DCCF0FE1601377C538708BF239F4928D3C8929F dde3p
143,597,727 *0DCC48B5F88C055EF97309E28B1AB4B9474750E8 D:!DM
143,597,728 *0DC5C5161C74FF4234E32C7274D98FD69FA050CE D&DVH
143,597,729 *0DC6681B986BE6FDFF539E56923F4E9EA90213F0 ОБСКОГО
143,597,730 *0DCED2DFE9CB07A295D2887680E20112A94DD2B3 ОМАСОВЉАВАЈУ
143,597,731 *0DCA61D0BB8C146DA56A5091D4FFEA14A80AC915 «ОПИЙНЫЙ
143,597,732 *0DC7711E9943472416D6CBD8538AF81B34B8A84C орша—смоленск
143,597,733 *0DC1C1C101D10A9C4254225069C368BAD1A0413D D&EACUTE;CAPER
143,597,734 *0DCC793CB2C5FDB1C0CEBBA67C3F6D0D57428D4A decaisserions
143,597,735 *0DC999DD6102CAC5B64579EBF789209EC007776A реквиемін
143,597,736 *0DCF39D2E8F3D03089E200E4D0FB297888071F85 de#h5
143,597,737 *0DC068F7B16D9EA0AF108FF86E01B5BB7EF3768F [email protected]
143,597,738 *0DCA76588EFF4C300457BB940A40B2C4BDE30A72 dephenolised
143,597,739 *0DCADC96CA0A1A9D1872C7A05F95A2939B4ABEFC depr7
143,597,740 *0DCBBDD5D91E752E218EF9F17440179DFDE638B2 DERICKCLARNO
143,597,741 *0DCA4CD0FA5A4611A3C00FF2CC1D2ADFBA93F77E ЧИТАТЬСЯ
143,597,742 *0DC94C0BD8D567324F7584855C4C35EC31B1BD00 DESMONDGREMLER
143,597,743 *0DC37FEF9EBE5C501FE9FF8065EF60190786956F detiendront3
143,597,744 *0DC6151E1D162F390D9F93CA81CB7465F1D32A08 DETRUSION5
143,597,745 *0DCFE5E488C3C71443994871DBE79C3C43E741C0 いずれか一つを使用可、DOUBLEではMIRRORのみ
143,597,746 *0DCC5834A567E2A08758BC11C096B30265ACB57C DFIL+
143,597,747 *0DC239C6AD86B9C6BC80003723673EF02C97230C 二行程越野機車,開始在台灣生產及販售。而光陽則於1984年,獲得honda母廠授權,
143,597,748 *0DCE6E66129C161341C665810EA02CAC527C6820 d+gi$
143,597,749 *0DC517DE2C1B998CA9DDCD7EBDBAB6D75DC60B34 dgq8-
143,597,750 *0DCDEF09BA92261C3FDD7AEA481395CDC53B7CEB に入る。さらに600mほど歩いたところにある山家道交差点にあるバス停留所からは、jr
143,597,751 *0DC0C8970BB3B047E2C963E1FFF02CAECE40A197 DGV4:
143,597,752 *0DC2A89D3AF133694086A113FCAD71249A6C58E9 d_i/?
143,597,753 *0DC6FEC5722518E3757D709395D59CD1A63B1A9D dichloroacetate
143,597,754 *0DCE591E884BA5FCE8E70E17FDF80863429C970A DICIICID2
143,597,755 *0DC735154D89F1E327309D3AF5E3597DE6759038 D;,IJ
143,597,756 *0DCBD9E6C4C2680D260D5FAF99C124D6C24BB730 DI$JOIN+ED
143,597,757 *0DC51A48C8F2D5810A346C5751BBDA18A449F94D dinowilburn
143,597,758 *0DCD00E281BC6964D49DCCF237626A16311D6AAE dionwalgren
143,597,759 *0DC2EFEF0B4508D7451C33AEB1E0949D40613A5C disendowed9
143,597,760 *0DC3B953D5EEEF104DC99A4C952DB9AB3131E4D7 distritos.de.basileacampi
143,597,761 *0DC62321F