List database


# MySQL hash MySQL password
143,580,001 *0DC5B8FAA56457CABCDC33EBBC4EDC565001D72C PARISHENZE
143,580,002 *0DC92082110901B9B996CDBF1C4F644DC50DF7BF SPINDLE-CELL.SP/I/ND/-/L_S/E/L
143,580,003 *0DC5DBCC05481056496EDD72DBA5BCFF7999E239 PASCALI5
143,580,004 *0DC721F660155E5F6ECA3E40389801CC500B4288 SPLAT!!O~ O~ Q####Q
143,580,005 *0DCF14328CE1D0887CEE55103D9E2C90803694D8 Splat!!o~q#####8
143,580,006 *0DCA135ECE8B4275F80DAC9032E90D99D8E6BF66 SPOEDNASLAANWERK
143,580,007 *0DCDB70D7E7AF1FE79C57FC4B3CBC8CD69D2868F spolvera5
143,580,008 *0DCCFD3C27A7F3585525BA704DE00AD1B49D9548 PATTON07
143,580,009 *0DCDB384634C62695DBDC2B8668B0680E32BA353 PAULA-BELFIORE
143,580,010 *0DCDC65A67779073182538F584A03C0BBAD972A3 PAULINA SIR,MYLIEGE,
143,580,011 *0DC2205253D11F507B5B51CDCC7B1ABD758D9F70 PBNMIMI
143,580,012 *0DC89740AA1D475B29A7FD123D5818F977910E95 pb`~.)o(
143,580,013 *0DC94189B5321A8E3CBF24CF707315A552613F8B SQW\
143,580,014 *0DC2B356FDF292E6896207DE6379915EA629516B SRC="HTTP//ECXIMAGES-AMAZONCOM/IMAGES/I/11XKZXABZ7L_AA115_JPG
143,580,015 *0DCEF65B25871B8A36ADA00A32FA85187664740E p<:e
143,580,016 *0DC387CB9DF57AAB16E5E2168E4E17C2FFF7B75F PEAUSSIE1
143,580,017 *0DC2CCDD0C00183DF2259BC1A8DB49849C8CCC6D PERFORERIEZ7
143,580,018 *0DC1AADF05DF36A7C2C9D2CE80AB25426BCE6A02 STCKARBEITER7
143,580,019 *0DCE03511D7D0B9389A5EE3579F01F5F19161E38 pfootbaled
143,580,020 *0DC6DD4912FE73A08AC2466BC87C5614B0663CA7 PG*.
143,580,021 *0DC91E95820A936AA356F7C1BFD9903A3D1DD0BB stellaalpha
143,580,022 *0DC610B69055E22D3AA7BA41EEC2A451A05E9125 stephenpapin
143,580,023 *0DC2984A32359B3FF2A4FCD1FC670A977E0625C8 STERLING.HALBROOK
143,580,024 *0DCAE9BA112BADEDDED0891F791FCBAF0F37F837 stevanivanovic
143,580,025 *0DC13AC9EFB7FF8ADCFAC21938FF7A6D05FD44F0 PIANJS
143,580,026 *0DC4ECBC9342A43F168B9458F95298321E705839 STHELENSBSWED
143,580,027 *0DC406B5C093C4D3EE3391E1045D02B2C52B5655 [email protected]
143,580,028 *0DCF7CAA4DF82D03ADEEDE5E956F18745C34FB29 stimpyjared
143,580,029 *0DCFA6813D49212B72BB0B14871AEF5E657FAE7B PLACATORY4
143,580,030 *0DCA5A8B01AC504F6378EF17BE908071E21E24AA STOCKTANZ2
143,580,031 *0DC4719A504E57D69883B6B9EB94A0BEB54177D4 plastic.dream
143,580,032 *0DC82466C24444244714724FC94FA9D72EC85A18 STRAMANAN
143,580,033 *0DC46090DBE3E6E022EE389FCFA0D39E2C89F7A2 PMID8978337
143,580,034 *0DC60AC9DE37E2A7171274FFD3C09A3045FE535F STROMMEBSW4
143,580,035 *0DC86D2B835BCA96763D067901008283C1EA4254 STRTAGSING
143,580,036 *0DCE8A0A5911B69968112AD9F50FB2F03701652C P--) ~ ~}O{
143,580,037 *0DC9733D124C9B61F4052F33E9FEA93463F5304E POMPIERE.
143,580,038 *0DCC7BA0CF259E423DEBA6BCD1A5C2A97F119875 poopoos7
143,580,039 *0DC4C54ABE0AAEE9AB979C0E7F0617D20E955021 P====)~O-~OSPLAT
143,580,040 *0DC310303C589AEAA52F88A63F67C2B789DF3910 POPORKESTER
143,580,041 *0DC01BBC643CF2FBE5E11D83E6390DDC92CFC6C8 PORTERLUXTON
143,580,042 *0DC37BD7E6FC609A758A554C515149477122FB07 [email protected]
143,580,043 *0DC1402662230983B3FF3A490B594ECE3ECA28A3 p------p.~.~.~.(>-<)
143,580,044 *0DCC95878477BE056B147AF0293DB09F04EAFE72 p######p.~.~.~.)0(
143,580,045 *0DCE6B0F00B8E16CEB4364932077ED752A3C4BCE pp~0splat
143,580,046 *0DC26B097DCFA0E8CACD4B30E3DA6C5010B991A1 sungweisbaum
143,580,047 *0DC6170C06E50FEFF99FF4270CC7B1A709122213 SUNSHINJONATHAN9
143,580,048 *0DCEB979F0C95787E4F2C615365F9B51DD726042 suraji
143,580,049 *0DCDD84ACE875CF4872EC31EBC1942EC18655518 SWARFIN7
143,580,050 *0DC7AD77023D669225D16CBB765D738947B9B5DB [email protected]@1
143,580,051 *0DC76219752C7888334B4074F3A3A1A97718F2AD SWEETLITTLENOWHEREBLUE
143,580,052 *0DC844BCCA59F79ADAC2097E964AE194C6B0F0A9 pribidoli
143,580,053 *0DC831FB39C0D8527D4FA5CC369B4FAD2A58A245 SYAZWANMUSTAFA
143,580,054 *0DC9819C584FEFE69DC44A8A97DAE31EA2D7B0E6 PROSSEGUAM1
143,580,055 *0DC5FCC977F9B1DC2EF56E901D9475FE9F2F6DD3 synergism(a)
143,580,056 *0DCD6E8CA993635B9DE2638AF95047228E59BA02 @[email protected]
143,580,057 *0DC268B8A640252C864A289ED70D2611072273E1 SYSTEM-LOW---THE-LOWEST-SECURITY-LEVEL-SUPPORTED--BY--A
143,580,058 *0DCA38180982650F551A7EE1A3D4E23D042C4B8B SYTERIAL4
143,580,059 *0DC90EE77EB432E3C57094A1C1F2BDE117C08F78 q###@`~.`~;)
143,580,060 *0DC2533FE849996DA575356D6B69DB9843496CD9 q_0f
143,580,061 *0DC4CF2A9D977B2F9214123684F6AF9AF9303FF1 QB+AAA
143,580,062 *0DC82F78B8F9C04FBB0189C21F50336AE765AD68 q#####D.~0.~o(O_)
143,580,063 *0DC017FE47E8ED5A429536E40B59B6BFE0707452 TABATHAKOZIOL
143,580,064 *0DC98C05A2F8E7976F377F115FCBC8C8A866F367 QFMY
143,580,065 *0DC8A5B99DFBC56A778262FF160A77D94990599C [email protected]
143,580,066 *0DCE83007D3A4218907520A02C30F16179934F95 [email protected]
143,580,067 *0DC56100B0249E4F9F33CAFBD4A01C9658163649 [email protected]
143,580,068 *0DC1A687203D4A5ADC01C2EDBC201830CF6642A6 Q######P~O SPLAT
143,580,069 *0DCB72B7901F677705866FB0D7B8FBE604EA82FB QQ=C
143,580,070 *0DCECC6E3A7D502B6DC7A72D95B0A742E98E5CF6 QQSB
143,580,071 *0DC732239074910D0861F917CA536A6D6DB9826A QUAKILY
143,580,072 *0DCB7765A2543608CCB122BA4E82B6E56D711E73 QUENTIN.EPSON
143,580,073 *0DC59CD32237FA39167AAE32457327802B517A0C QUINTINDANIELSON
143,580,074 *0DCB317EFF0BFADC07F509159D075E23718C00EE .r_
143,580,075 *0DC66B16EEC208E45881B408C5BC4A121978C9DB TALKPYVANET
143,580,076 *0DC6B439FFB764CE4F54EFD8A7A1687FC548FE64 taminytaminy
143,580,077 *0DCEE70AC910F3CCDD2432D94F3501C95F41151A [email protected]
143,580,078 *0DCE345FF54302278CA3FB10B8C3991B7E4C5C37 [email protected]
143,580,079 *0DC6C49FA72729D43066B80BD68F26138AE826F1 r3ss+48ly
143,580,080 *0DC5EBAD4F06558EBAFC14B5EC0E36BC60CE52DE TANKERGRETZKY1
143,580,081 *0DC250B3112318B0676BB61354D3BFDDE2413D19 tanner699
143,580,082 *0DCEA68488165011A65016CDD93D104DF9C8F2D6 raettstavning
143,580,083 *0DC143E92838FE21237C2B0B1D316B2785D56896 RAIN (MINIMILISTIC LOVE MIX)
143,580,084 *0DCC9B27B91AD5AFF28DDF07A0C830A7EC038256 RALPHMORALES
143,580,085 *0DC27C0ED6D5C3AA2A4896DF1F1A300A8B465418 RAMIROGOBBO
143,580,086 *0DCA5C25C6FDDEC112387F7EE3B46F0D5F6A03C8 RANDALBORDONARO
143,580,087 *0DC7F9291548C76A03E7A697C9735E2B4EF08B82 [email protected]
143,580,088 *0DC3BA8F9CBF05D1A166F38CBBBE5725F403D93F TECHNOLOGYDRIVEN
143,580,089 *0DC88025CA2E17BB480E4E4A3C72EF7B95F3A8E1 tedhauffe
143,580,090 *0DC9D43553FCF92D89194B0FC9D82A9FEBA7EE66 RAUDENCE
143,580,091 *0DCDE4093A8CB7711911670BCEDFD4A2ECF9CA57 tegenpraatten9
143,580,092 *0DC28C0540DD72016C6E6FB6552778D939B07EB2 TEMPLEOFTHECAT(VOCALSLANALANE)
143,580,093 *0DCF7F8E35F63471696ACE7BA93E05DF6155B471 REACHESSPORTSORGWWW
143,580,094 *0DC0F8A9E3441FACC6364F273C734E103C7791CA TEODOROMONTS
143,580,095 *0DCF295A18DECAE69AE79D2BBE91BFB0796DA222 TEODORO.MUTCH
143,580,096 *0DC96D19648435373F69962631484068A90FB255 rebeccahougland
143,580,097 *0DCBF5569E6B6493CAA6714E93C43953DB8C6421 tF
143,580,098 *0DC8C79F2272CD427382D43F6FF6B686A74A22AB THATANNE1987
143,580,099 *0DC79C7D3E4F4F59DFCAF20F73C870F01CEA7EDC REGENERATIONSPHASEN
143,580,100 *0DC05A9AE7EBAA40B63AE560987CA5F1BCA3BF0A REGGIEOLEA
143,580,101 *0DCFD2B31ABA9E16136CAB2DAE663115D7423D58 REGGIE.SANT
143,580,102 *0DCEF1D07B70EB84EA87AA4BCCF2D9B48223A300 THEA.PEREZ
143,580,103 *0DC1DDF512BE8EAE7FB1FC2CD740D9C4F41BC9D4 REINALDOSATER
143,580,104 *0DC48C5BDF0B70DBB4811C0743B3D97D3F906769 REINDIVIDUALISERING
143,580,105 *0DC3777E9BE599124D409EA59FE52AFAA274020E REINETTES1234
143,580,106 *0DC2DBCD76A4093915145F3105AB0E1D3EDDF3F6 THECHARMSONG
143,580,107 *0DC13BAE6E6361B678C372963583E10B09C38F21 thefingertipsaintsessions,volume1
143,580,108 *0DC276608E019A7A0C735644B911A5DEAE77EEB4 [email protected]
143,580,109 *0DCAA16FA9B04C3BBA388699C9451B3A793273CB RENHSURB
143,580,110 *0DCA64AF9A00875A5ABF51B8CFE14F98BE56B25E theodoresicurella
143,580,111 *0DC5061CFED1A4F991473A6E784D538CD026BCE9 theportreeveshouse
143,580,112 *0DCC07EF7C4AE23EF331163FBD75302041F653B0 RESTIACE1
143,580,113 *0DC35501DEDBCFE079AF71064C8BEBCE5781B2D4 the-tb-is-whipping-me
143,580,114 *0DC80927EA367A776217B1BF59C4666F99B5CB8D THIKHAMPORNK
143,580,115 *0DC78CEE634C219D6BEF8BD3DBA1D6CC7E670085 thumb_glass/t//@/m_gl/&/s
143,580,116 *0DC9E3A0A34C8A7854E6B5FAC17B3CD1EF764520 THURMANBORS
143,580,117 *0DCBB6EA327E7537F94F84363765D6E212CC1ABC [email protected]
143,580,118 *0DCC2B2699236F87BA4AE406AE12B8F3E6A231CE TIHSLLUBLKJFDSA
143,580,119 *0DC2EE70587C6EF0D722D96E220C4929A0D0E8B7 REYES.MAZZEI
143,580,120 *0DC916747BF5996F01B729D855D741AEF31F7197 RHCSREVO
143,580,121 *0DCE0BD7C54CB07056097907DF9F504C738BDA5B TITUSBIERSACK
143,580,122 *0DCFF2051381A05BCFED61A671F78E25AC5D241A [email protected]
143,580,123 *0DC481260539216B49589099A768837CA5E6EAE2 RICKEY.DUNSTON
143,580,124 *0DC918346A19124ECA86F1099C2709B587979E7A TNEIALGNARTE7
143,580,125 *0DC0420416D27394FA3978D7801E7B4E4CC09D56 TODHEMESATH
143,580,126 *0DCD39EB0D43436C28FCBC5C256BAC96F31ADA9F TOMMIE.KROGMANN
143,580,127 *0DC3A2E0CF1714E346585A8DCEA33116369FE643 TONGUETIED(INSTRUMENTAL)
143,580,128 *0DC1FE2D07D37F28D14BC73A9DA8A355B231E21D [email protected]
143,580,129 *0DC2DE1AAC6DF66D2A0B09FCAC5854E1C5D8B2FE RINGSKRIGESES
143,580,130 *0DC3346CAD396A607BAEE6137058EA74959EC29E [email protected]
143,580,131 *0DCDD53C83DC1F8256591C9329F11BE1F365E735 RMARTIROSIAN
143,580,132 *0DCD756D61CE46CAB1A19E6D642D04DAF57E2B2C ROAMINGSK
143,580,133 *0DCA79C66AC09D35B542F076EF3A2EAC9DA1F62D trentonbequette
143,580,134 *0DC3C502F1D473BA89046F97B3ACAF34C2A1BD3A tririanipamularsih
143,580,135 *0DCDEA43429C00C4736548DED0A8C64D7B7274D5 ROCK'N'ROLL SALLY
143,580,136 *0DC91C1C22A696116C97165D1E831BBC48654927 ROCKYMITTENSES
143,580,137 *0DC38764DFEA95E347339F74C0BB5088B8AEBFC6 trumannino
143,580,138 *0DC253BBD2D97DF7271C35BF3F3AE2811803110B TT0104987
143,580,139 *0DC6696B07EC288CA24A29FF3A3B0AB6C11B094C ROMA MAN
143,580,140 *0DC25963CF11729870BD41D87326300DEDF85C67 ROMEOTOURIKIS
143,580,141 *0DC41CEA8AF3A808E07889D3B5BED854AE0F7505 RONA-ALDE
143,580,142 *0DC35F84CDCFFD4523F020CE327E4355C26252BD turnoverdoor
143,580,143 *0DC245789A3F8D55A30E7E7FEF464C530C0F65E8 [email protected]
143,580,144 *0DC3AC1362124484C191E5609CD1D749CB715283 rosto”
143,580,145 *0DC6FCAB41075AE049FAF87ACA22CBFE05891CA4 [email protected]
143,580,146 *0DC0BA18E968867843982D887A50EBEE49F4E224 [email protected]
143,580,147 *0DC1FBA7C9DB6158C4B97960EFCE674C0733251E ruperta
143,580,148 *0DC1030656FAD39A466B505663F310A967C7AF04 u3jv
143,580,149 *0DCE30DFB38448DEF2CB3FAC36770A1D192516AA RUSTY.DUGI
143,580,150 *0DC12D05B8B68D9587CFE857F0A6E3CFF3F327D8 ukoysnem
143,580,151 *0DC996DF5E6820F0C501E4ED25647271F849BE68 ULMARIAS6
143,580,152 *0DCB155B1E535DCF02E86C25C0CAE9B093FB6177 [email protected]@LOU5
143,580,153 *0DC18CB8E4D83BA54510B253EB75BFE728C4DA95 unadducible7
143,580,154 *0DC5F81412A82903A109A957D74A32AD3B61EECC SAFDLIHC6
143,580,155 *0DC95D2D372409ED7C06B0DE5820DECD75300CB1 [email protected]
143,580,156 *0DCE92BF707AC59A8C0E0C647DA23531630D3F25 [email protected]
143,580,157 *0DC7704C183D9CEC787AFB7AE66212AA4D8D50EC sammydoxey
143,580,158 *0DC3AD6C9D0DAC4B6E6D579274908BE10AC56CBC UN$TUD!ED
143,580,159 *0DCAFB49ACE52E71B8D39646CDC3145A8A354D09 santambrogio</contactfullname
143,580,160 *0DC38D12B1700FF05C2135FF5353678023DB212F santoaneshansley
143,580,161 *0DC184CE4308EA7B3D422D0B8A77C9B31EC3AFC2 U%OQ
143,580,162 *0DCE438D6145C2D8C5C171C48B152AF267AFB4FC SANTOSNIEMITZIO
143,580,163 *0DCAE2A456D28C20F58ECFAD9431DF0912DAE7E8 URSULAURCHIN
143,580,164 *0DCB1C8D043C0E525C671E0DDEF1BFC77353DF1C USERMGULSHAN
143,580,165 *0DC83FB9FB649256AB827FDC797DE14C403BE7AB SCANDALIZZEREI7
143,580,166 *0DC1EB5521CAFBCA1F452721707C3EB1EB74FBE6 vago-jester
143,580,167 *0DCF68E8E06127733D997969340C9778814C7F0A VAIDRINGAS
143,580,168 *0DCE774B9F05E1693F3A7794B9B5936C5CED9AE7 valcrosswell
143,580,169 *0DCAD3D9E095E25C2D2CBD668C8AA8551005093B VALENTINESTAYROOK
143,580,170 *0DC631138049303D802927BFFFDF29F8E0452764 VALENTINHEGLUND
143,580,171 *0DCC6105CA5C77B75CA355368EF47ACC37EC26E7 *scm2567
143,580,172 *0DC3DAE39ADAB516A7B77ACD0995C90DC647EA50 SCOTT-BARTON
143,580,173 *0DC70870A4CDD5F341A7AC8552A72961668F1D5E VANJAVA-BUTIK
143,580,174 *0DCB869A34EC199B1F2CB4C80CD830FB4245B963 [email protected]
143,580,175 *0DCDE92D0DDFEFF0688A4AB7632D64370D4CEABF VARISHA-MOONSAMY
143,580,176 *0DCD31DDB405FF43B8CCC5947E4348057783563F SEAN790
143,580,177 *0DC076A2C0B449E7B4CD1D41C7DAB3557757D046 seatsman9
143,580,178 *0DC049623EAEAB4F94D362F4B607FAFC4075D002 SEDADILIBAICASNI
143,580,179 *0DCC807EDEAA1884B2D099B8AD21057D3F83198C seinesgl
143,580,180 *0DC5237144E3161CEE1515CB717D14D2AA1E1269 SEMIDESERT
143,580,181 *0DCCE128AAA9D29D00D2338DC506EC608B5B1ACA SENITNEMS
143,580,182 *0DC19945BE2DA8BE39359A63144D057BA4C0B443 SENSIBILITÀ”
143,580,183 *0DCB836FB0F1A36911C155DF559098EAF8D11E41 [email protected]
143,580,184 *0DC86E018AB62D70907EF8AD1F21DF512ACF858C SERAFFIMO'S
143,580,185 *0DC2927EFDA7850B1DDB6488D85FE99BF3646E5A SERDEACED
143,580,186 *0DCAB94B418780651776B9EBA06C4A39CB26F9C4 SETAMERE
143,580,187 *0DC3820EBACB6EEFEA3EF6F3665FE05EA9846211 VERMILITAP
143,580,188 *0DCD1E73DC1CACB45296E7CAAC35B65AE03BC11F very.friendly.lighthouses
143,580,189 *0DCBBB3A15ADD665ADF8DBBC3B02128296FC23F6 SHARRION8
143,580,190 *0DC70B215B671D556F7C0CBD5F2DFCDF8290D592 sheldongloeckler
143,580,191 *0DC3599A942B0DB324BBF0423B3FD61827974D54 [email protected]
143,580,192 *0DC7F9E882A3439906354164C0BDA0326B955191 SHERIDAN.WILLIAMS
143,580,193 *0DCC14722CD1DF7A4EF0473A4A517BAD2E50614B [email protected]
143,580,194 *0DCAA884062D1CB763985122C77D649ABBD9C5FC VIRGILEBERTING
143,580,195 *0DCDEDF5414397068C771708EA16AE0F6A56F50F virgiliostakley
143,580,196 *0DCA8F1FFB4D87649DEFC604E835F025485704FF VIRUSERISTYS9
143,580,197 *0DC63078D06C49EE01C0B942DF66950650C489E1 SILASLIFSHITZ
143,580,198 *0DC5F55E693E4BE0284917D4609AA165721538BB SILPV
143,580,199 *0DC2B63229FBC342BA927446113E974A37932F53 [email protected]
143,580,200 *0DC13FA6ED00CD9D4992F3F5ABED9DDDBF6FDBCD vitocrockwell
143,580,201 *0DC4420AB09BDF809FE5F5F9673DACB89657BC4B VIVIENNE.HU
143,580,202 *0DC937A42FADA134045A6C2257AF97A6F6F429B4 vkladov3
143,580,203 *0DC9B4F3A5EFB907FE6483FB49B82BC52EB28210 vr>@
143,580,204 *0DCAAC5C6A3D566828449B139F56A1829C92A317 VVAA-FMRADIOEVOLUTION(DISC5:THEBRITISHINVASION!)
143,580,205 *0DC921EB7E36D6A2E7DBE1FB8B73B8A050C6F16E vxyrenfp
143,580,206 *0DCE52EA4E9D2F829A82EE01E4861D5DBD817EB4 WAFIQAZIZAH
143,580,207 *0DC3988B298C67F9BC33399EAB91BC5B18C25F29 SMS7FJ
143,580,208 *0DCB4A2905CD28E180829CE239D055FBB88716D5 WALIPOWAITA0
143,580,209 *0DCD118D273633ACCEC0F2C5C36F7A47C5F3B97B WALIPUNGUZA6
143,580,210 *0DC522486296012F628B759AB0AC52E7AF241483 WALLYNEIMEYER
143,580,211 *0DC3A921156CBEFF23915D9038C4C5995E281A44 WALTER-DYKES
143,580,212 *0DCF03C2C41C04D21E97F5668E6BC8B66935BF29 WALTERGRAYBEAL
143,580,213 *0DC85B40E3522EBD6D2F7CBAE78EFB3839A9445C WAMJOBYYHWGXTQ5
143,580,214 *0DCA2792398D9D62AD0028B45C48745343101983 So.He.Says
143,580,215 *0DCE50FF048C5FEA664DDFA56D8484621A8C29C6 sonataingmajor,h56:ii.andante
143,580,216 *0DCADFD538342C09BE8625FEFF7271A4195E2AE8 [email protected]
143,580,217 *0DCFC02959DAF0A4E088027D90D7B7D1F1FF990B SONICSPARIS6
143,580,218 *0DCFD84797C6F16DC8C844AAF8B4D3B6CD0E8B96 WANKIESTEVENS
143,580,219 *0DC07913537042C92D5B9FC5A8B6F13913E87951 Soul-Jazz-Document,-Part-2
143,580,220 *0DC58B13C09A2B92CD3DE7FCA4FA51843FBBEFA9 SOUNEUSCHEIU
143,580,221 *0DC936361A2E08415C20DF6C2E4A2E374F99D612 wasklem
143,580,222 *0DCA8A897E88F6DF9673E78CF7E812C8BBF7CE83 waylonclarke
143,580,223 *0DCBAB9B068D4CD463B6784AC2E39CAABDDD963F speedoblowme
143,580,224 *0DC2EBE68883CC968F9C995606A02031A4D2994C SPIDERSAPIEN
143,580,225 *0DC881501F097CAFF9BADD653A921AF515BD97AB wendy.chapman.west
143,580,226 *0DC71687497F398D5BE09C9F11F9725A220D4DA5 [email protected]
143,580,227 *0DC9F48444E9EF79C493B52FE96853A0F381D493 [email protected]
143,580,228 *0DCD76AB4E92539F8EE4213DA5D22B794316A64F spokojne
143,580,229 *0DC845FFF7A26BA84072125C8AF179F739FBE765 SPRAIN-FRACTURE
143,580,230 *0DC661732DE52B70E41DAA2A4FF631A4116695B1 westvirginias
143,580,231 *0DCFA807E160B6086F12C07A02A75EDC02689BCF ‘WHALESONG’
143,580,232 *0DCFCE0EFFFB0D0A64FC62F7D8838BBC80860D46 SRALLODREHTOM
143,580,233 *0DCEFA8EE85E75151E94AF3FE66B92283FE4C363 (who-discovered)-america
143,580,234 *0DC1EE52EC7235BBEF4320BADB95BB6C6E3258BC WILDCAT-ALEXANDRA
143,580,235 *0DCA0C8BCB672809B7AF2EB24E8ADC6340D1A159 STACY BANKSTON
143,580,236 *0DCAF62E1F14E2E0263E1C1C950137B080BC0B2F WILFREDBUSSING
143,580,237 *0DC31C2FD3AB76F2163FA161EB93185071486A2D WILFRED.GIRVEN
143,580,238 *0DC734482622D53D1854ACA94C7D67C3665F1255 williamsbeckles
143,580,239 *0DCCC05953CBB590E7AF8C8DB8CDFBB62F8A6B55 WILLIAMSUVERSTIAN
143,580,240 *0DC68DE7DC6E80F87B2F7031CE82EC6426352D47 stanleycalvetti
143,580,241 *0DC24930DD978DFC46080B53C24E40E3308D37E9 STARTSHIRLEY3
143,580,242 *0DCB83D0CA9B0EA78E910CE2A61932B0ECE53BBF staulamelle
143,580,243 *0DC0B50BABEE81478BC6BA4589A0741E23DFBFF3 WilmaLipp
143,580,244 *0DC7C73B6DD15BFB154F5D0B850B78EF273CCA00 WILTONWEININGER
143,580,245 *0DC9C530552D06CB7C5173D7A63F483B182EB540 STEPHEN.WELBORN
143,580,246 *0DC55A3C6C16DD860BCCA0C467259FFB363916C0 steveliverpoo
143,580,247 *0DC6335BD0250D9668A198C10EBA01DDFD3025D3 STEVENEXPRESS
143,580,248 *0DCB9F6959D7951B031E52BC6F548ECA84AF7623 steve.quirk
143,580,249 *0DCD9022FC5CB9AA89C1222E9C06EDF34148FE57 WITH.ME.(PIANO.MIX)
143,580,250 *0DCB5893471BB0D95E9C0F97D3D8D83C6B9D8A9B STEWARTCERAVOLO
143,580,251 *0DC6AE519E44155D4C6C91620F6C26A0131C51CF woonder-solemn
143,580,252 *0DCC714039FF257A16E9EC0A193C2E94503D8B6C WQSBPERCY
143,580,253 *0DCF1A18A655140B883FE889B2194F11616127CC WRITHED
143,580,254 *0DCDA3ED71BFD4A401DAACB2DAD7F1FCE913AAB1 [email protected]
143,580,255 *0DC3CCF1A01B31111070F9332870DEC1C6D90DE4 WWWNMMZCOZW
143,580,256 *0DCD1000F5E249CA7C337CB0B6CB4AB9AAFDC430 www.romaniainsider.com
143,580,257 *0DC84B47CB08D67AA5A7E9F03D077FD47F748ACE [email protected]
143,580,258 *0DC9627363F00CB817014ADE45C815CA4F7CC9C6 WYATAN FORDE
143,580,259 *0DC65125D4EE3DB2AB21F8F1BFFCAD193A3430D5 wyrhtrki
143,580,260 *0DC43E0ACC169C3B135380051B4051B952F4264A )X( 0~ <=8
143,580,261 *0DC5DC990C9E06864C3CAC45C2D803500A5395E1 X115025
143,580,262 *0DC8847A61FAB2CCBA3B33BCB658A0EE7192828A X>CE
143,580,263 *0DC17F300F6425327531740989115FBF1FA12A48 [email protected]
143,580,264 *0DCA656A5C4F6C318820738B03335CBCA851327F STRIPPY2
143,580,265 *0DCBB594A0863A40DB735ADE5475BAE8033B6726 [email protected]
143,580,266 *0DCA7254F4A7796C9B7C85E8397A3E58C1921BA7 SUBCOMMANDERSHIP.
143,580,267 *0DCB13C9C1AE1F0EE0BDB23BAF7D5FE28C010560 SUBHASHI PERERA
143,580,268 *0DC9B910DBDF7103980068CDDA4E05988F707FB4 (X)[email protected]
143,580,269 *0DC24140C70477DE3DE8371B1115C2205D70491D SuchIsLife(Rank1DeepDub)
143,580,270 *0DC49EA27A6721987CEFED9581502471F5ABCEE1 XRSTEENA.VERA.SANTOS
143,580,271 *0DC7CE8EF45B611BB119E0A3AFE961FD709928E1 sultanahmet(30secondversion)
143,580,272 *0DCBAC243234B5A59E585602DCF6445B197C9FE3 SUNGBLEVENS
143,580,273 *0DC18A58140DE6B3B2C0856D2E940B3CC651259C SUNJIG
143,580,274 *0DCE2BCDB2FD78A3A5A59B89F8F6173B483F6908 YAMI.ATTAUEM
143,580,275 *0DC6D97792976E8497AF594D854CD6086CF744B5 suoiseac2
143,580,276 *0DCAE565D9CEC2FF7AAB1EC4016426FF262E24B8 [email protected]
143,580,277 *0DC44C3480094D4DC5D0C5A49FCB99C2E69F2C55 [email protected]
143,580,278 *0DCD660FDBDEC5CBD00703F93D6D808B2BD63ED3 [email protected]
143,580,279 *0DCCB938448B5547EFA3920E3A90A90980BB981A [email protected]
143,580,280 *0DCE8C35DF18DC3DCB6E530D624C007EEE1B8C3F SUSANBESTWICK
143,580,281 *0DC2B49773DE97EB6E262DBF8B295AD860B97DB7 SUSIE-MOELLER
143,580,282 *0DC703DA4F9453E2C9B690E337A67B48B487C13A SUXIDINE
143,580,283 *0DC4F31E2D51A56710E4B3046A97713D832DD96C SVAKU NO
143,580,284 *0DC60B8E0E33024CDF7ADC1D4C2F59981773D012 SVÄTOKRÍŽSKYCH
143,580,285 *0DCF7DEBDEB6234BCCC7A92813162D2AA4D3F355 SWAZTYM
143,580,286 *0DC0683C9A7A46886D818D9F73134613ADBCC9FC [email protected]+0l0g3s
143,580,287 *0DCD2A06D8DA6B715DFF4CB2A3C962C55C80B0D5 SYNOMITS6
143,580,288 *0DC516058AC06AE03FD3714E886D8D66C2A33A52 YF.!
143,580,289 *0DC1FC850BC2B0B8807483BB11402D32F3BB2306 [email protected]
143,580,290 *0DCC6A2C2B26A26F7602A5D3332BD5DB1E44D263 SZELLEMNEK
143,580,291 *0DC1CF3917AC9A7522E3D42566EA626D9D6187CE T0+4
143,580,292 *0DC7AA66E0E87EE9A6FD80B0165CF00C0DFA9B5E TALK68.81.252.24
143,580,293 *0DC9E83895336A5805C4C8A5F49A07B66F513448 [email protected]
143,580,294 *0DC70087A63EED57F853B1C4F1C2DE9A2ACFFE96 [email protected]
143,580,295 *0DCE285F65CD386AE0D2B14FB556071387327909 [email protected]
143,580,296 *0DC6183D5D208D68037E9B934DF58D42416F183B [email protected]
143,580,297 *0DC5B490755D4BBD5349C629FE8B6F8AA8DCAFB4 YUYMEYING
143,580,298 *0DCD98BBA4A19F9B06CA7A18D2AD564ABF8C8171 YVONNE-M-BEAUDET
143,580,299 *0DCF4E6C332826F150713423B549B1A9A07371F0 tdjnmcfing
143,580,300 *0DCC29D816EE7510C04B924EA518BFE90747E23F ZAHRABANY1
143,580,301 *0DCC3405FA530688A4F2E062726413EAA681A2E6 zakiya-nickens
143,580,302 *0DC2C40F47C68B114F180A92A8B9707D1ABACDCC TEENGIRL123456
143,580,303 *0DCD144003F709205D45D725E82C5F012954EC4B [email protected]
143,580,304 *0DC03F64D810E0005B0BC07E194973087B462C31 TENNISSTADIONIN
143,580,305 *0DCB5396B43FFD250366EB9C81C09627EBFA5D49 tennists
143,580,306 *0DC2476DAEAE84FACC6E56CC2FE93DA9A2FCED94 TE.QUIERO.(PULSEDRIVER.REMIX)
143,580,307 *0DC193AA15F6A2D8D595763E93123FE4FB35455B [email protected]
143,580,308 *0DC2335F59F2C2A8E18649A925E6D1F4BC39F036 TERRANCE.HOUTS
143,580,309 *0DC4D7E03EA5737C31414F4F5838040CA23F86C8 TERRANCEWHISTLER
143,580,310 *0DC3ED083999AAE2041C3CF277127864C1A00408 zifky.priatelna
143,580,311 *0DCAF3133CDD92CA682681B3AEEDEFC5EB6D307B ZINO7
143,580,312 *0DC9927EB1B728857FADE8DABE5C4F0780592801 TERSHAMAED
143,580,313 *0DCC8503C458087F95A563A1DA5B915E0722FAC7 zithelodube
143,580,314 *0DC42026AC62F67EADF3EED1F02829A3C40F2509 [email protected]
143,580,315 *0DCED606E3E4D76839C2D87E6BD137988C57BF22 tetrarch
143,580,316 *0DCC2CC487285A9E830ABEAB13CCCEEF169DF4FC teusunt
143,580,317 *0DC586A1628F6BA9384FE3E1A4E00140F8996DAF ZTIERK.1
143,580,318 *0DC8F407607DD1C00DA43F3DB881BDE187656933 ZUMABEAC2
143,580,319 *0DC119771BAD86B499A4B8608C103572B0B7FCCE thatgenesis12345
143,580,320 *0DCE52CDD438C80BFD19CE74FE196E8C91B6A7CC ΚΕΦΑΛΌΒΡΥΣΗ
143,580,321 *0DC3BF5BA249CE264D4F859A5EAA6BB9F675791D THCENKNIELKHTENNEK
143,580,322 *0DC592D25F59BA095DB1D60AD1590EF85DFDFE69 THE1R5EN5
143,580,323 *0DC9FF2E373B9BD8C3E0ED7F4C5EE8BDC8B6CB11 ΠΡΟΓΟΝΉ
143,580,324 *0DCBD2F710E749CAF3494960E1ED1D7BA6643C42 theboss{
143,580,325 *0DC4BA6ACFF8B013D2FC7DE59C2BB243C80E12E2 THECOURT.CAWWW
143,580,326 *0DCBF53EFAB465796869ABF65DF77E40CD74FAE3 бурмасыг
143,580,327 *0DC1837C3EA1E6D3C366D8F24E6928BF02AF3C06 THEIDONTKNOW07
143,580,328 *0DC088FB92CCA89DDBBFD2BCCCA36A356E28A4EE THEINSANE1234
143,580,329 *0DCCBF22683E89C8022A3DE6C0CA9BC63CDD3496 THE.KING'S.EVIL
143,580,330 *0DCDAF5C98D36CD0DF36EA8AA8E7610D77319F2E THESAVINGSACRIFICEOFCHRIST
143,580,331 *0DC763F030BC0C0851EF4D4E146939440E3BC6E0 THESOUNDOFBAMBOO(YOMANDAVSHI-GATEMIX)
143,580,332 *0DC4FCA4AB0B87A8D064E9446159A5DF63BEF58E THESQUIRRELSNUTS
143,580,333 *0DCE2E2B0D12B951327C1F9BDB4873DD56D776F9 the-tb-is-whipping-me
143,580,334 *0DC80927EA367A776217B1BF59C4666F99B5CB8D МАКИЛЛЕС
143,580,335 *0DC6C2EF1F89E6E0F2269CA655B3F41828F6DC21 THGINKREVILO
143,580,336 *0DC05012B5EABB69CD8349AC898A8075635D6132 thisnsuserp
143,580,337 *0DC3CF78AC0C0109C261A3EC6C6B7A4F61219E20 THOMAS.JACOBOWITZ
143,580,338 *0DC0904EC7426F7E4017E00A9BE50730D78CEF61 thomasnose
143,580,339 *0DCDD9B5DE52E64E2177C8C275729C073194BAE0 подымить
143,580,340 *0DC567A0AA8F4538812281666E2F0A8C9CEE7C55 ПРЕОСВЯЩЕННІШОГО
143,580,341 *0DCC31B07CF3F44BFFE1EDEA6FC9CA29961F4D1C ПРИЛАГОЂАВА
143,580,342 *0DCB730F4CB997AFD619396BB98402ACB2905ACC РACВЕТЛИ
143,580,343 *0DCF248523F7A4933E85D14F752745FDB40960A0 СТОЯНОВА“
143,580,344 *0DC6C0677BA562077D0ADE8B0137F0BD5434F692 timmyhouchin
143,580,345 *0DC47B0E1B1A008F8BADDCC1F37BE8EAE16708A2 timvandemark
143,580,346 *0DC35243EE9A226DCC31557DDB2A6F0B754F20FB TINTINZXCVBNM7
143,580,347 *0DCF2D7BA4B5A7A7AFE246CA2BA4086C3321525B TITUS.BECHT
143,580,348 *0DCF1BC7B1D056A716F1A287EF918C5F3B487657 ХУНДИНГСБАНЕ
143,580,349 *0DCA737D24A8C74050189453B856D303E75F50E0 [email protected]
143,580,350 *0DCB172500D75A1D393A4243B637DB2F2DC57B24 事實上是臺灣地區非常習慣將「potential
143,580,351 *0DCE3777D8A535C84895016AB6CDFC14DA9078C6 TMCBRAYE
143,580,352 *0DC31927D38D1ABF1AC3334128495409064AE534 TOD.A.SZ
143,580,353 *0DC0182B19F60170E3CE12B7693B2EEC614E120E toegesprokens
143,580,354 *0DCC0C6363863479C33F868AC3D5B34BD8FFD982 TOMASNEIZER
143,580,355 *0DC371C50A8A27FD6B8D3F3610BF2D51AE4CD7D6 TONEELVERTONI8
143,580,356 *0DC6A2365209BD0641FC8EE2DD1F7E2A983D664B TONEY.STOLINSKI
143,580,357 *0DCC5939D07B0D0DEF8AB45E1FB1A154A3B4E5F6 TONMOYKAZI
143,580,358 *0DCDA0B8FA3C645002ADC8A7BF85DD0A91590EC2 TOWARDSTHEOTHERROAD
143,580,359 *0DC6D4E3691EA89A818D5770A5748DCBE4E0CEC1 [email protected]
143,580,360 *0DCB863153E2C43FEDA7F24D58791C21C783FCA3 TRACE MCKAY
143,580,361 *0DCC1FAAC0A4AB6CC935105BC0E99432448D70F7 TRACEYTEICH
143,580,362 *0DC553A82D341137B0ED88C5C09A3FDE2636D82A TRAVISRICHTERS
143,580,363 *0DC9B0BD231A32468362E76AAFE876B2DBE242A4 TREYLEANNAROBINSON
143,580,364 *0DC9B1EEE57E07FE8AA0153E7F2CEDC550507952 [email protected]
143,580,365 *0DCD188603E5A1EB4470C4526FE89F9640F98187 TRIPHAS4
143,580,366 *0DC42013D5E5FF1E959800122688EC520E48B2B4 TR$K4DEK4PH084
143,580,367 *0DC315BD64D35BA8805D14E1628AF4715E79C213 trustschapsakkoord
143,580,368 *0DC3CA224A1AA66D50AA5AEDAF35C7E399E9B99C TSITRAGFDSA
143,580,369 *0DCF198DB64152DDF9559B46B597971DC62AC133 tvスポット集
143,580,370 *0DCA9A0BC58FCFC5E35919940108F25375C03966 TYREE.EUGENE
143,580,371 *0DCA77835F07508061B8C927955B5235AC2D7BBD tyreekubes
143,580,372 *0DC527AA136F33B115CD782EB4786D7FAAB51BA6 ubahang.lawati
143,580,373 *0DC9F0BB375DC5836F14709CF7C802342E8CE47A UDUWWDXJL8
143,580,374 *0DCE2B502D7CC9F2617CEE35B0BB49292ED7FE21 U!FD
143,580,375 *0DCB37D6C84661450498BEEBEF07C8F6CF653447 ugi|
143,580,376 *0DCC7B58B38F3E70A1DCF54B9B813946306DCFA6 UISCIAS
143,580,377 *0DC74FD28F90436F35F8A1640ACBA6B819D5CEE5 ULTRACOMPUTER123
143,580,378 *0DC1B8DF253370D5578EE5087CAD661A82B7CDDF UN$+1N+3D
143,580,379 *0DCA64603F6FD80B2A296EF78AC329CC47C6B195 UNLIN123
143,580,380 *0DCBEF35DE25563D4CC52971B8B38CE29B03174D UOSITIET4
143,580,381 *0DCA471CDF2B93078CAB614CF7BC09021C2E4563 $UPRAORB!+AL
143,580,382 *0DC7FCE5A74B33C13147E53B2DC99A501C2DF66D [email protected]
143,580,383 *0DC6FD26C8C53BE2E28E0FCF4BE6E08F49AC8252 URANAWNHKANG
143,580,384 *0DCED31EF588BCD514CA8FF3E35AA1F1C5157380 UREGJERLEG5
143,580,385 *0DCEDB9E66967882A8B3DD4BA34228D2B734587A URREVONU6
143,580,386 *0DC3D77FFBD560FBDA5924F5541F995045B1AA96 URSULAGISIN
143,580,387 *0DC128EC8AB306857E2EF217EF5FBC96901DDC6B 陣風風速:汕尾遮浪220KM
143,580,388 *0DC810DFCBC3C25ACB73D714850E8E3279E4D772 uu~`d----8
143,580,389 *0DC1994B58862BE81A7EEA8C4E88A9C995D1C523 VAGNA73D
143,580,390 *0DC92E10BE7A158267E226A2B34F1B7D64D00D10 VAIDRINGAS
143,580,391 *0DCE774B9F05E1693F3A7794B9B5936C5CED9AE7 VALERIECOVERGARCIA
143,580,392 *0DC2E07FF23D34A39FAE86B57B1A2F130126635F valerie-morel
143,580,393 *0DC381326CF2970E92BD717E90F09BE375F9C904 valtazar-pagdalian
143,580,394 *0DC2A7DE46B296CA82CCA63FBF54CED7A532D5AC *[email protected]*
143,580,395 *0DCE204CB285AB31385A1CFF0B1F18DBD291EFBD vasanraoerrakiah
143,580,396 *0DC66249B4FD9AF98C8D62DB63BA8F2439F69CB9 VATOTACO
143,580,397 *0DC77AB5AE81F3BA87AC87394A2489ED75A7E362 VEARYH
143,580,398 *0DC378E81B847DD19D68654397D431C173ED7789 VEIKA
143,580,399 *0DCF1433188A3C2FC31D245EBC6B7F860AB2619B VERDIETTEN
143,580,400 *0DC8DEB376B737570D565C979BFD625E220AC8BB vergetelijk8
143,580,401 *0DC817C216C78CF5D6A388552B71E5839ABA9C55 04LEIRA2578
143,580,402 *0DC3747D7C5A139F5198C520922D80486D4DE66B vfrancois
143,580,403 *0DC63D3C5575FE0942B4FB98A76F04B0EE6A92A7 VICENTESTERPKA
143,580,404 *0DC3BE31E17B903C963026EBD38F75A1538C6E87 victoryronald
143,580,405 *0DC2DAD8D685FD1BF2CBE5CDECB7D511D07198BB vieillard.
143,580,406 *0DC41E53AD6351F28F354610C63B2DABD611D2BA 0iluvpascal9
143,580,407 *0DC6FE6459FCC189332F2CAB5E398A2DDC24097F 0NETSIL
143,580,408 *0DCD411F034931B9E00727272404134CBAED5697 vilificatrici
143,580,409 *0DC26157689ED25E209F2EF6E75A03C91D404CAD 0VEREXPEC+
143,580,410 *0DC8C2C00BAF896C97C670F0CB5AE7B55BFB917C virgilioscarnato
143,580,411 *0DCD17686EB32C582B8AAE6F7E5CF1582F61FDF4 virgilkaelin
143,580,412 *0DCDE5CD65D10073DD78DDD8A6C0373B7C61C5AD VIRGILPHAIR
143,580,413 *0DC4EBA91E9EFA4F6ADFAF1340583F5DF2D2109C VIVIAN ECHEVARRIA GONZALEZ
143,580,414 *0DCC9D73185591295934AB69D3A90E65D8617A8F 112719 dazu will groehler aber erst planungssicherheit haben
143,580,415 *0DCEF1779C726E5585E2E984957779F681A80156 VIVOXPRESSRELEASE9
143,580,416 *0DC9F4968F68DDC1050CF7136366669926D67B2B 1205860 ILMO LIUKKO SIVISTYSTOIMENJOHTAJA LAURI N
143,580,417 *0DCC0E963E53CF57F04028B072BAE9A68DE8E194 VMBASA
143,580,418 *0DC619378DF82D4BEEDE197E4020C01884E7BD4D VOKEERDE3
143,580,419 *0DC17829359DD27F42F4339C597A74D10EAD6BE6 1336461 NIMIST
143,580,420 *0DC9D130E2671D943D942D48780B58818E456578 vorgekommene
143,580,421 *0DC58023C233F5523D49CA0E3C072E9905921B77 [email protected]
143,580,422 *0DC05DD27C0232AE665CFA19B65FA3A9E90B346B W030789
143,580,423 *0DC314A132BEB57100DF611CD192C0C3F30A3A45 W9FZ0HFW
143,580,424 *0DCC052743F29541E447F5B37106AB371E70BA3B 16lampions
143,580,425 *0DC61975E79E5948A6509A2C3FC56D5EB427570A WAJDI JABRE
143,580,426 *0DCA1866720B4491A0ADEEC1A7A7BF256B6668ED wallyguyer
143,580,427 *0DCDEC1CFADFC219F63CC211A40E929345BAD076 1985...WHOLE.EARTH.'LECTRONIC.LINK.COMPUTER.CONFERENCE
143,580,428 *0DCBA7F577FB9499561A5EE9C05B903F480B5DAF 1-ahdistelija
143,580,429 *0DCFD32CB8FA5009D618B80AEC37EC4A17BA6BE2 1angel97
143,580,430 *0DC4722E4D82240C2216C7862BBF24B6D4F7BFD9 1-ANILAN
143,580,431 *0DC8E29DA7AD01C1B062E8B1F2BAE655F678B9EB 1bodenmaenner
143,580,432 *0DCDED6E6A47FCFA7C8A87DAC3CFCD05E11EEAFA 1.Civileyen
143,580,433 *0DCA906D27CC5152BBB6307BF98CFC84C0A734D6 1epistolized
143,580,434 *0DCF7DAE9B7572116D4D7D8E9177F97363ACC1C3 1.ER
143,580,435 *0DC4A9F5A4F78C68EB413B9728FF94129B137769 1.ERDiE
143,580,436 *0DCE59F0D2744C4CDCB8CDA260238EEBE3CC79C9 1.erdumlauf
143,580,437 *0DCD8A3773C0F16685344F615AC98E0E9D04A19C 1.E-VIEW-SOVELLUKSEEN
143,580,438 *0DC7E07173FFA6D535DE6F8B278123A17319CAE4 1.fensteroeffnungen
143,580,439 *0DC6A09F9A12E9BF5C58AEEAC0B872F5EBA7E3EC 1fidelio-auffuehrungen
143,580,440 *0DC70FE7031DDA3D2835AD987A81548D60097686 WELLDISPLAYED1234
143,580,441 *0DC4A86C93E86769C95D493AF0AABF1CC4462499 well, it's a ship
143,580,442 *0DC559F7514F84E835523B5F5E93F7F00D5F5C30 WESLEYMARVIN
143,580,443 *0DCF7E5BF5EEDD127D8C6D03217AA9E1F2109D2D WESTONROVNER
143,580,444 *0DCECB4F574CABDA3E01F67E32EFF072B7BBFA88 1.KOMMUNIKATIONSPHAENOMENEN
143,580,445 *0DCA7F3B5DFF43864977519DFC3E93082CE8E1C5 1-KOULURAKENNUSARKKITEHTUURIA
143,580,446 *0DC3058EBDC992034ED0A83EA78A1B017C3E45D5 1.kulutustilanne
143,580,447 *0DC9143364A0C301FB5B55B6A2AB2ABF45D76860 1MDDLLJNN
143,580,448 *0DC794E528F70F7827F90803633652EE770F45C1 1-MURHAS
143,580,449 *0DC7A6812074BEA2D5A6D668AB6AF2DF9AD24423 1.oikeankokoisia
143,580,450 *0DCCAF13216F610D9E4D7F6914BE078FB751D7B8 wilberttrear
143,580,451 *0DC4930F7AEC6622B046407A181F69C213E1BE8B 1 RAKENTAVAMMAN
143,580,452 *0DCFABCBB9BD8A1D9A6BBC13C02010832DAA714A 1-regegenschirm
143,580,453 *0DCDD7C410B9AA575A1008F16E4E144E1C937E64 1.samanik
143,580,454 *0DC58C60DCAE75906F3847669287B645597DC59C WILLIE.DASHAUN.MITCHELL
143,580,455 *0DC4BF144984ADB8D09C144AD72B8D12BF84C048 williehoefer
143,580,456 *0DCCA7CB6D8EC88572437CDFD587DA975927754A 1.sliverhaired
143,580,457 *0DCFD9790B0479EF945182F10A99ED83733B2AF8 1.SOUDANT
143,580,458 *0DCCEFFB65B7049878F6C0BFED23FE9706E736F9 willysonstroem
143,580,459 *0DC01719295A43FB7CB08D695258AF571623BD3D 1STCHARDWHEELERS
143,580,460 *0DC510723903D4FA6FA868F60464530CDD9D49B4 1.TEHT
143,580,461 *0DC83D3876F09ADE52315892CB60B5E7B1A6383A wilsonj
143,580,462 *0DCB674731E7316C18C8FEEF7C3123ED930133F0 WILTON.OPOKA
143,580,463 *0DCFC503B5693623EC82C86AE46ABB84C9685FCB 1 tuerkischgriechischer
143,580,464 *0DC4C395F9B5C81E723D60D1F09F3C076335DE40 WINNEBY
143,580,465 *0DC1D1D87AD1148C60858C9B95B3D92F447390D8 WINSTONLEDLOW
143,580,466 *0DCD113AB9621B4A813603B640BFE879A141EEB0 WORL
143,580,467 *0DC6A1F4D807BEA1799BC2B408053CA87C747F50 [email protected]
143,580,468 *0DC9A96CFF21B2C102C6E9AF6CB80FF655EE524F WWW.AGBIOSECURITY.CA
143,580,469 *0DC4FA1387BC3765A4D223CE76F376C4BFB769A3 2374685 die-absender-sind-oft-verschleiert-.
143,580,470 *0DC10F93294AF9766B03C81307EEB3917B29171C 2631944
143,580,471 *0DCAA1F34CFC501B363DF3243C9B8988A8BE7D0B [email protected]
143,580,472 *0DCD504E51E0FAE055CCAF76DB16B945F59F747B xi{'
143,580,473 *0DC1FEB9B7D0246B60A70A999B99C85BB13D656D [email protected]
143,580,474 *0DC5941776AF2A0628C8A2B9A39784C941357BFF [email protected]
143,580,475 *0DC53B7E2F854D9FDA72632FD438E1F276E13BFC 2800792 YOUCANSEEITALLINTABLE2A3OFTHEREDBOOK
143,580,476 *0DCD7E84A41CE0A3BBCEAA0B9B1B6E2D3250DFE3 2858101 pallot toimitetaan 1218 pallon paketeissa .
143,580,477 *0DC8F0D92BE08617B1E743449482CF77E584BC20 [email protected]
143,580,478 *0DCE637CC9A75372460CC6E85C6D34EE88E6C759 2AIRASSA
143,580,479 *0DCE1E434FD88E74ADD5A22E899D4728401357E1 [email protected]
143,580,480 *0DCF4ACC4836A1C6FC8958C141DA1A554A636E9F 2DEVALUATION
143,580,481 *0DC6CCF76938FB73CDC71B536CE0B42D9FCEA337 2dgrinberg
143,580,482 *0DC8346489637FD4FA46C0BD06F7E4882C7B66F6 2DNMSKRVR
143,580,483 *0DC2A4CB27771A3A31F2BCFF143E282A95EC97EB 2GEWERBESTEUER-SAETZE
143,580,484 *0DC0541F535A057C12181337A1CAA7C6AABF54C9 2IPPOSIMI
143,580,485 *0DC8F1C50BC7C421278DFF90165FC26B8CAA5661 [email protected]
143,580,486 *0DC0FC4FA76C61CA5D0776D4375C911C137080DE 2LIITETYISS
143,580,487 *0DC228385508DA60970B35017956923036B0A2D5 YANNICK MCCARREL
143,580,488 *0DC2025FB91EDE89EB63994E00471CB1DB967AF5 2NAPRTILI
143,580,489 *0DC0FA4526A4F5C61304C214E143CA995D3EC94A yayayaya
143,580,490 *0DC355D8FAD2B3E320F19CBA2E2978AC21F6C6A8 [email protected]
143,580,491 *0DC8365003A45D3ED5949AFA629431F16C50A65A [email protected]
143,580,492 *0DC2450BC027E8C2001F7A55056BEDEFF4B4E9F9 YITSHAK2
143,580,493 *0DCDDA3C3DF26C2768747797B2C261E1C35F6E85 2pintaalaannoksina
143,580,494 *0DCB161D0E8D9BE8D6DF4D83FE1F2C18C292FBAC 2RSULLIVA
143,580,495 *0DC8C64EDE4FE3ADD52AFFAF7475B6DC350A7A1A 2.sichbewusstmachen
143,580,496 *0DCF7812A7EA3B31C46C5430DA2165A68C3B591E 2SOCFANT
143,580,497 *0DC205AE48C4FF7C95FAA07952563D6FEE9E89CD YONG.LOSECCO
143,580,498 *0DCAE38895413002005184B8D25DB557465E7508 2ZELLEASE
143,580,499 *0DC4D04417BF07493E5D30C709BA966696F6646B >-<***(=====3
143,580,500 *0DCDB3784BF479274AD464CF84E6416088734C76 [email protected]
143,580,501 *0DC36A05480E5D8AE3ADAEE401C6871DCC18EAE0 YUICHOTIWONG
143,580,502 *0DC958755BEE409D7E3898AF17F17169BEF013BA yukimaguateoliva
143,580,503 *0DCE39E183380B720AB0D2B1090CA8FE7834975C yv2u
143,580,504 *0DC429F9DC59C6E0FD8A9D4229A9B2D7F629383C zackaryrotenberg
143,580,505 *0DC91E3B8090BC7F6C0EF488CD6DA21D02391A6B ZAINEB HUSSAIN
143,580,506 *0DC9DB9D92387CE987410F7197E23D3CAE3D589C ZEDENKUNDESING
143,580,507 *0DCB3842B3BF27EC10B382C411632402DFD0F322 zeeshan-baksh
143,580,508 *0DC36E537A7CDAC457A26BA57CA81ECBC40973E2 zelda-rogers-hammons
143,580,509 *0DCDA661B8F335951ABC54CF523428A437FA1799 ZIAAN-SIAN
143,580,510 *0DC383C91EA7759B1913A1436C883606DBA056F5 ZINDELIJKSTE
143,580,511 *0DC27FABC113D31673CFC9203F09228DC9243253 3#@-~0~o>-b0
143,580,512 *0DCFB86ACD74F280E7120D4FBC5FB883AB53CE1F zitataylorlorquet
143,580,513 *0DC44DD3EC2915EFB11AE48F7C728EB392BD266A 33ENAMORADA1590
143,580,514 *0DCC40D3728A0B8F5EF82F8A5A9F080EA390C99E ZODIACLETS
143,580,515 *0DC179FFEB38FB963ED6491ACE8381F1E450FB74 ZOMBIEPACERS
143,580,516 *0DC6D67BF8166BDE5D099CA22AFDD9F72702165A zomby's
143,580,517 *0DCD6E55D916C699B6FDBE571C8C33F86317C606 ZRYTHEM
143,580,518 *0DC24569D37E6F178257A4E2F5037730265F8DFE zushettiomana
143,580,519 *0DC7F8AECF3D205830A3E3F789DC83F2A21B0872 ZYRA DE JOYA
143,580,520 *0DCBDDD2FBA3B9B5579CF09A3584C3B9CFBD7743 3-BAUERNBUND
143,580,521 *0DC08DFFD23F7DB1C65961907C1E804E61FA5DD0 3b<~~<###q
143,580,522 *0DCD17F356DD94C6D9DF8538553B132CAB6D0B37 АНТРОПОСОЦИОГЕНЕЗ
143,580,523 *0DC3925C8D4EBCCB92C6CB9358CEC1DD5E48E38C 3BYRTHENE
143,580,524 *0DC02D73B065F98EA234050DA2FBEFD1E046FCBE 3f2008mc0444
143,580,525 *0DC4ACB13C8DF42879603758BF0DBD32A328D4EE 3FORSTET
143,580,526 *0DC00D4316FB5F7E9E3A316D65584BD663044758 3##p `~ `~splat
143,580,527 *0DC3F43C4B1D77AAAA568653FB6C24CA7332903E 3THEMAURICE9
143,580,528 *0DCF9A7E65D797BF5571F6953DA3E9FCA7801D4F 44363 kullanIcI istediGi adresi kullanabilecektir
143,580,529 *0DCB3F6181EC0B46291D3F5C2B2EF7156F1D4034 ИЗБОБОТЕЛИ
143,580,530 *0DCA87D2B6473B534EF669F3A0E6E038CB2B2ABB 49977 yavaS-yavaS-CadIrlarImIza-Cekilip-uyuyoruz-.
143,580,531 *0DCFB2C38AF343B8EFC3D6D6F3AB4D89A1C07B6C 4AHAZIMAH
143,580,532 *0DCF98CFC5CCA43107F617C95DD9B8816BC67CA1 4FIGBIRDS
143,580,533 *0DC7E54278FA52926C25074D935D95B4A8C1AE4C 4IMTHEOCHAD
143,580,534 *0DC7A3620AE64851798DE082E593BD180BD3EBDB 4LINKSINFO
143,580,535 *0DCEE2ED54C3D1A260B77E09F0A36AE4CCBD91A6 полупани
143,580,536 *0DC3FC5F99886106F2C642F099A2F7AC643B21A1 ПОСТЕЛЬЦИНСКИЙ
143,580,537 *0DCB1CBB4CE1EE1005A8F3F9F95F546CFDF96E74 4 paprikapulver
143,580,538 *0DCB7360BFA401EA1BEC1A8CBA017CDDF323A38A СЛОВАЦКОГО…
143,580,539 *0DC1E325A4ACE667034BCDCDEB7DA9972BBFE872 ФЛИЗ
143,580,540 *0DC7E9997932BBEE47B78CEFFE758AFC12EB6E07 4SVILUPPAI
143,580,541 *0DCF3F338094E1A8FBB5CC7F54E37C86220DB106 4swanson3
143,580,542 *0DC8614E89865319A0C8BE4D0D393D21C1433129 4thewilbur9
143,580,543 *0DC8EE2C29D24E9379350073ADCB130BA762F9B6 506DEVYN
143,580,544 *0DC09D00305EA41C350E2A8901ACA43ECF5D2774 5BSWEXPERIENTIABSW
143,580,545 *0DC7EAB233D9A166D384EB6FDBBD0023BD9F65C5 5BSWGEYSSENDRFFERWEG
143,580,546 *0DC2EC3D69D289FD4256DA7FFBE410CDBA922997 5JU5DN3T
143,580,547 *0DCD7BDE2D0D59E9710AE1B9535B5E940EC805B1 5LILILYN
143,580,548 *0DCE36B2794991C4409D07C7241CE83CF9B2B483 5MAXIMEAPPLE
143,580,549 *0DCDE88A19F7CBDF84C34593FBD0322B7C63272E 5OCHRZCIL
143,580,550 *0DC42F63588BB0BB00819858FEE02C641251A169 5PERFUMADOR
143,580,551 *0DC8AB5080D477135E22BFE3817FB149B6BE5044 5QUALITYBRAZIL
143,580,552 *0DC0C7288D10B7CA9E5EC3FD8324A574079D3C96 5REGIPAZEG
143,580,553 *0DCE9238862DEA2088C1342CAB9216ED9F945E77 5SAILINGMARTIN
143,580,554 *0DC580BACAFA74BA26FCBAAAE5975D649E006DEA 5TRAVESTIERENDE
143,580,555 *0DC0565E5D8A8E2F1607D855B52EAD9DA5258BEE 5VOLTAICS
143,580,556 *0DC16F03BE4D9BF84BDB869D390571C3AB9A0390 606971 lopulta poutun joukot kuitenkin l
143,580,557 *0DCAB45B0D0DD2741EAEF49F287641B238C33AB9 638LOLA
143,580,558 *0DC6D6B6C06633CA83BB02372C9DBCAA862A653D 6ABREUVOIRSES
143,580,559 *0DC3A37426947B76BB2CD1F8832A6FE11A1BF2C2 "6BAA
143,580,560 *0DC365E4072D759C7D25102FA8A9D04AD9F04BA1 6BDNC7AQAZACLSY
143,580,561 *0DCBC1A38FC6BCA29433F6FFD577E3F695E4FE10 6BSWALYSTYRE
143,580,562 *0DC8272A4CD7F719A04D6840298C47EE78BC2AB4 6BSWVOSSELER
143,580,563 *0DCE3C844DC8E4119E36FBF25576D9556FAE85D7 6M0BUW
143,580,564 *0DCFCDA5A3B98C88A3F3942D27598E0350A12B76 6NERRFOSQHQA
143,580,565 *0DC0EEDF1EB3DBFFB1528FB27FC3018F878531EC 6susan6
143,580,566 *0DC27F854FBDD38B731FCA4DBA0477EB4AA6BB4F 787289 YLL
143,580,567 *0DC9DD9949666DC916418B271015A4A942FA7C14 797428 GOODNEWSFORLEFTLEANINGOLDIES.
143,580,568 *0DCD24FBB00FBFECE89C375DC04B237847E27D8C 7BULLDOGLJF
143,580,569 *0DC01F7EDAB5E1C512F8167B50F1D47A64712F52 7CABALLEROSONESS
143,580,570 *0DC9AC5F667B4CBA2AFEBE38920FAEDE6068F2EC 7ECEIPELG
143,580,571 *0DCB898AD81E237725108356BB9DB07D0DE5D8EB 7EKSBOKSEREN
143,580,572 *0DCD44C3B1044CA89E12CC89193AD225ED736499 7INTERAKTIVASTE
143,580,573 *0DCD029F44E84936C1F68BFAD69BEF6F619500AA 7MIKIEXCEPT
143,580,574 *0DC8989C7D0982FC0963D1B0DDE53EAE94C6B77E 7NAEAHCAE
143,580,575 *0DCBD458AB7778C97EF40EC1B517D08D20DA36A0 7NEWLINET
143,580,576 *0DC00FAE46539CAAAC1E7A9A58A25B2B0B03D96D 7TANYABIGFOOT
143,580,577 *0DCED7FB1E5548EC04393CFAAB81DB60AF56409F (~_^)~.~.~.(8
143,580,578 *0DC0FAF2123D849241B67EA7C4BADDFB346A40E5 07291500
143,580,579 *0DCF8A7803EB24BC9C2F381073234D375591960C 8BAMBOOJENSEN
143,580,580 *0DC583C2DE24FCE1A5D912D0FCEDFB7FB8A5465D 8COCOANUTING
143,580,581 *0DCA83E8CA513C7D765C7C684EF52BD96C277B94 09241322
143,580,582 *0DC2A58A04D632FFE6F7DF3FAF2659373AFF62D0 0EB71E1D6BE78109
143,580,583 *0DC5F7B6A87A056B15FEC4F72840476BE506B77B 1024x768os
143,580,584 *0DCB5E137172BCB0E8D59FDC04DA3547C18C1E5E 1056718 kartassa.on.kaksi.erillist
143,580,585 *0DCAB307CC39A8A604941206A4B1D6C6C112296A 8METNYCH
143,580,586 *0DC708DE25C9BFA4D4D3EFD192FC2A4EB0BC9548 8NDERROOM
143,580,587 *0DCCC24F71F03F7D6F0C67ABCE457DE061266C31 8OBZIRAN
143,580,588 *0DCDD4DF8BE827489411303F9A3CA6FB37A0D46B 8PAUSESIGNALETS
143,580,589 *0DC5F82D29B72CAD79D51FFA4A5C8D822EBF5063 }8{[email protected]
143,580,590 *0DC1649B1062CD1191429DB09956D416B3A92486 8re4s7ng
143,580,591 *0DC746AFBC2B6C34F9934E0C58A3AD2FF15EC214 125723 cebecicdno:115kUCUkkOy/ist
143,580,592 *0DC9387102E9188CBD4C31412CF72AE2A395A6B8 1371573 KORVAAKOLENTOJUNASUURENOSANKOTIMAANLENTOLIIKENTEEST
143,580,593 *0DC08596ABA656BD67B559895B04F5142B604903 13.Lui
143,580,594 *0DCFA8C55BD0AE7254A51CE108652D0D5F555B88 13-YLIOPISTO-OPETUKSENA
143,580,595 *0DCEE63755C344BE97318D5052A4EBF2B2A4FD1E 8WORDLAUDLAY
143,580,596 *0DC952238CE790469FACBFF799780C4258298ADC 8ZAGHLOUL
143,580,597 *0DCFBECF60CFD8C7EB0132B6211BA32241EAE162 1627353 FELA RAN FOR PRESIDENT OF NIGERIA IN 1979 .
143,580,598 *0DC66838075C4499C134C932F4A929FA2584F1B7 99q7fibmuxpz8df7
143,580,599 *0DC9C712A7151C6D866439D395B0E7F5EFD8DBE1 1687564 shinin.,.higan.ja.shengin.j
143,580,600 *0DCE3A57C8B0D131D0CFB9D188558492134DAA16 17-10-1033
143,580,601 *0DC7EB032B144B56DAA097C2A445757BA69B0BEA 17121993
143,580,602 *0DC1EEA1C6A8F48CAE22002DE4AE245DB6C48ED2 174332N
143,580,603 *0DCA784816773BE670092173C9E8D7F7FF552AD9 9BAKLUCKOR
143,580,604 *0DC42B99EED33ADA629BDF39FDC3A11B62404A4B 1849749 " SIE ZERSTOEREN MEINE BUERGERLICHE EXISTENZ . " .
143,580,605 *0DC300D47EBCBBEDAFF4578F3736F9D963115E76 1872867 luonnonsuojelulain64
143,580,606 *0DC7CB15F43B5B666F86C9CB0C3D5001A4D1E2AF 9EDSNIEVEGNO
143,580,607 *0DCCCB12C13DCE13335C4272330C7B49B006FB16 9EHCULPE
143,580,608 *0DCE09FA5431F1431DAE4A2AF8ED6D00FFC0718E 9GGLADMAN
143,580,609 *0DC56424CD75D162731D8B0FEB7C5D4E8B1A092B 9JAN1915
143,580,610 *0DCBC337745342F8246498685CDB930E607A1233 9JESSICAHAMMER
143,580,611 *0DC8734A487C9384D56ED0A129F45A6167808CBA 9MANARDIE
143,580,612 *0DC6D50BBA8E5A9C803E83909C839CC4D364FEB8 9PHENOCRYSTALL
143,580,613 *0DC2757EF6DC59E423BF07889A623DDDB6BB4C53 9players5
143,580,614 *0DCBF143247ACF815C0D25E7DDA5BDF6C8F78A9C 9PROCOMMISSION
143,580,615 *0DCE74C72F9B922F07F736BF63528D0B63739331 1ALLAEKIA
143,580,616 *0DC659A1B1AD196769702546F18DC25F4779E197 1.alosa
143,580,617 *0DCD15AFCF674586EC0CE9375830AC404ECEA217 1.AUSFUEHRUNGSKRITERIEN
143,580,618 *0DCFC33AF6F00A38153524B92870039CFA12AD2B 1cicak
143,580,619 *0DCFB224942A655EC2EFCDF151A1B923916F565E 1 COMPUTERSPIEL-KONSOLEN
143,580,620 *0DC4F3BCA1A51E92B8B4E7E5AFCCB3254BCCBBEF 9VADHYAMAANAAN
143,580,621 *0DCB99B1C7F7104C0D2C55E0E109105DBA83A58B 9WIRESTRI
143,580,622 *0DCD9D5F099E7DB086B72D20E058B3BE9D1F0592 _<*a
143,580,623 *0DC162BE1DD774A6E406A34F3C959D145FEF2D91 A0HBC
143,580,624 *0DCBC83D5A86A3E2A345C863672AC3777040BC62 A0U0O
143,580,625 *0DC1261E7C453C962ECFDBE3208EC4E9778C5C39 1.ER
143,580,626 *0DC4A9F5A4F78C68EB413B9728FF94129B137769 1EXPOBETREIBER
143,580,627 *0DC05773A77D825BA166C7DBBF658EAFA0F20EC3 1-farberych
143,580,628 *0DCF2D4558FC28E63F599F7EE7232B19204366A3 1HYPOSULPHUROUS
143,580,629 *0DCB071CFB7CCA6501E6D6D6E11DD03E07580F02 a5dmi
143,580,630 *0DCED17709DD27D516C20081B79AD325DD6A8294 a5q5
143,580,631 *0DCBB000E2F0F056B3221D9BB6D8AD48DE79954B 1.IKITEINEIST
143,580,632 *0DC88760BA122E7142FC6B5E0AF4A40DAB1C589F A.9$
143,580,633 *0DCD029C0F12148CE474D6EC6C98EFCE71909D60 1KNEIPEN-RENNTAG
143,580,634 *0DC988812C37CF6033B1F5D19400A1C2BE45352D AAAQ1I
143,580,635 *0DC0D540A7A7CB1ECB76BC39CD0E493D0757DAF9 aaaw0_
143,580,636 *0DC146DFCE805B3BAEAB5414DBEFAFB4D5994586 AACG#
143,580,637 *0DCF09FBBB1D284B2EFD1ADAFDF89BC282BCA2C7 aac!ke
143,580,638 *0DC5DD46C86B306FD88D0D6BAB24DCA7E6B64543 AAC^L
143,580,639 *0DC44E331A9B831AEC2D3B8BB08D8C341F313EBA [email protected]
143,580,640 *0DC2BDCA94F79F160C8ECB928C8C972DA83C01AB 1.MINI-ETCH-A-SKETCH
143,580,641 *0DCC2727CFB9936988D44EC87A1D716D2D32C2A1 1MISHTANIN-INDEX
143,580,642 *0DC4D0B43310751ECA4CC1755B05D933690A7BCF aaeo/4
143,580,643 *0DCA684CD96BB02E1922DDF7D76E036E5E78A84C AAEV<-
143,580,644 *0DC50DCEEF2E1CBB3CDF89536861656D8707000E aaew=:
143,580,645 *0DC43C842469C68999D3C798CFB3F74FCE2FC131 AALAPAPA5
143,580,646 *0DC2CD1B6BC7BF3DC618AB9BBC32EE15657C7226 1.Ornekleyici
143,580,647 *0DC18C7639BBD1F756A302BD427E3A7ADD5D002E AAN-6
143,580,648 *0DC3B9D81DC6830EBE8F389A62F9FA95E8739BD3 AANLIJNDE3
143,580,649 *0DC1CDC752C2B96B010115BE758EBBECA97543A3 1-pk-rednern
143,580,650 *0DC2F10838651A3FD252D5527D4D6654A21BEA6B 1-POMMISSA
143,580,651 *0DC74B942D704393F7F655721F03757A3867349A 1 PROJECTPOLIZISTEN
143,580,652 *0DC5C053BE9BB713AB125789D3521CEFFDF3AA9A 1.RIESENAPPETIT
143,580,653 *0DC1944D097EC8E6036BA153A1CA232A63835147 ab0m1nates
143,580,654 *0DCDF380B48F5E4882DE82CB6BF5CBBF28B83E5F 1.rsan
143,580,655 *0DCD673C15396C2F2D28B5F2D1FC1AB7ED9EA9A8 1Simler
143,580,656 *0DCBD1E94F6325AF80FFEFD66551447929BABEDF 1.sopimusongelmat
143,580,657 *0DC549374754183A142C0B4F45B1E143BCA9C062 1.TEHT
143,580,658 *0DC83D3876F09ADE52315892CB60B5E7B1A6383A 1THATBEASTY5
143,580,659 *0DCD3E8BC07B3047BDF1FE63DCB75D34207B05A6 1.tietoillan
143,580,660 *0DC2D192368D3D4BEAD503367151E431C1B70D03 ABIHP
143,580,661 *0DCDC376EE36918BFE93F3EDF54AF45E74DAE832 ABN45
143,580,662 *0DC9DE8922D51CBF63B3744ED440E7204DDD3597 1unternehmensperspektiven
143,580,663 *0DCC0A3C7E9943FD7413836752921FE9AC8BCC99 1VASTATTUUN
143,580,664 *0DCAB51278FCC163D6EACF987850D25DA430CEF3 ABRAHAMFELICIEN
143,580,665 *0DC8A477DEE8C6CBAA7D87588DF65063E246A79B abramduhn
143,580,666 *0DC105B1DCC3276FA9F500FE1E3F0194F620E635 1WEILHEIMSCHONGAU
143,580,667 *0DC9B64C00BA190C7D996C7395C4487740FF368F 1WOLINER
143,580,668 *0DC42112D332B661BAC4D962216F62661C852C2C A_B-V
143,580,669 *0DC209305B28EB1E56C6D4ED6E79EBC31F37F513 A&C9Z
143,580,670 *0DC2466DA0BA697DB594B98A9AA014BB23930C6A 2009721 sm-viestit , ryhm
143,580,671 *0DCF1B926F71455D1FF76BB737F8B3AE0E390E47 ACB5F
143,580,672 *0DCB9D67E7FC7D399A220EF256F4627A2F65743F ACE-2-(BRUNSWICK-MUSIC-FESTIVAL)
143,580,673 *0DC6186D602EFCEB53B14662E453E85449A63CC5 20lukyanov
143,580,674 *0DC40EE794AB2BF7A7DD7E32796CA4A9236FBD0D ACJK8
143,580,675 *0DCD6CDE0D4DFC0E1023289C2A7280493EEFDFE6 21.el
143,580,676 *0DC094FDAC6C1BAE2C88BD15C8B3671DE6D6A331 22nesta
143,580,677 *0DC59C59803E6E51F93C79EB15F43765DFC48B8B 2309753 kaupunginmestaruuskilpailutj
143,580,678 *0DCB6478676F815E36ED9C5E5A51ED4CC8274031 a+d&;
143,580,679 *0DCC604CB61733C502A8865EEA5DF4666BBFB9E1 2414533 DIEREISENDENMUSSTENAUFBUSSEUMSTEIGEN.
143,580,680 *0DC08B8E7CAEBDEAC591A9321EBF014B826D0687 242514 kiteen-er
143,580,681 *0DC493C1A7B4E4292FE9521D28A03206D2CC2B3C adamcasamento
143,580,682 *0DC03489AFEE04E15843F87CF6114F7DEE03C7CB ADCHB
143,580,683 *0DCC1C2E71FBB90CD79E0018CB625536F84A2932 aede?
143,580,684 *0DCBA5E3E4D96C09FD1BBD8ADB6202E284FDB4A9 ae)dt
143,580,685 *0DC9CA82C5A3616FFE9F972565F821A50BD22BFF 2785584 ENSIN-RAUTJ
143,580,686 *0DCCDA186FD971C1716015CDCBB66E308DA4B1E8 2998710 NOVA.SAVOY.LAUKKASI.ENSIMM
143,580,687 *0DC4F352EE2F516F75AF2B772530C632F03E1E2A 2DF4F35A679B7010VGNVCM1000003BC614ACRCRD
143,580,688 *0DCD3A4748E5BFC08DF28B7010C76B1B5DFA9143 AFZS
143,580,689 *0DC683ED11CBBF29140D8B62DC6CFEFA0953CCCE AGAINVIGNESH
143,580,690 *0DC041F04851A997AEA99AF75BC0441BBE054DE3 AGEHW
143,580,691 *0DC05FA86E8286CBA509B8F416CC12FDA1B0AB91 AGH_B
143,580,692 *0DC30C79C1C5C2EAFFDC4D49916248904576A738 agy:u
143,580,693 *0DC97C414893D4DCA3E89E9E82AE33C1D423F009 2hyv
143,580,694 *0DC7CED92C0EFEE1F708A4B03BE7597FF3E80914 2MYALOHA9
143,580,695 *0DCBE4134CF70AE96E9414E28B92B5CE56FE2B80 2VALENSI
143,580,696 *0DC99C1F4E12C2208953030D3F37EB7C8AC33339 326HAILIE
143,580,697 *0DC660CD5EFA93EF31BBAFB3F6A6D012B96B1134 AHMED.RECUPERO
143,580,698 *0DC5317821D38C3BC05B2BEB89A11C83F43E6F48 3: 3 -# -& FOREKNOW
143,580,699 *0DCA9FD2E2CF1D940344DA86AB9D356F151C5D91 AID);
143,580,700 *0DC9BD11502C72E50DE1D57719D91AFBC61443ED AIGENTLICHEN
143,580,701 *0DC5EC73B4C5D9EB3C9B7FB522CE42258BAF04B8 aigoloncing
143,580,702 *0DC91E599F33EE1606BCE4252EE33A3E0C2BB837 3#b ~0 ~osplat!
143,580,703 *0DC941CC8ED13ECE55A69BAA03FE00320F2F7026 3B<-~`~`D######Q
143,580,704 *0DCE38CD511B9F098A7BCE47E39658C5E807A353 3d~`(x)
143,580,705 *0DC1F78BE9993BC8A8F6BA3F68891A0CB46C1628 AJWT
143,580,706 *0DC0BAE9CCF8C884AEE8B23F7D5C5EA8D31976E6 3FLUECHTLINGSSCHIFF
143,580,707 *0DCCFAEEC7F9006781897EF1BB4898BE46B9C4F3 AK&C0
143,580,708 *0DC8581A9564BF28672BA4D6E349D4722B53B35E [email protected]
143,580,709 *0DC613C5B73C34AA31C3158490FF95489FB201E0 AKHEMRAZ
143,580,710 *0DC777304ECE99B369113A18E4ECEB5638D85052 3jan1358
143,580,711 *0DC7CC2C1D15373EC19C7A9F2102DD2472BF183B 3OMAKOTITONTILLA
143,580,712 *0DC0A4D37458C12954F5EBCEEFBE5AD4A2712AB2 alanharding
143,580,713 *0DCEA651255FDC4C5A08351AE6FCE18A58B08184 ALI ALIYEV
143,580,714 *0DCBE82A2A3DD8A2E803958BCF6E47F7ECD5C4FC 427469 gemicilerdebirtelasgorduahmetdayi.
143,580,715 *0DCA121D8665B029A65D957877D12B165F4701A8 all4thehomecoukwww
143,580,716 *0DC4D002DEE0A05390AEDAAC87B8E2B69109C24B [email protected]
143,580,717 *0DC5FABFDF5FE99EB721F993CB2BEA71A6042569 4LIONKINGLAURIE
143,580,718 *0DC421536B42EE61FD3C546593B0B70C4F99D89B A%M2(
143,580,719 *0DC5086A97729DA243152EA03771990810D8E355 am3m
143,580,720 *0DC0A7D824075603D2EFB2840B7ED27C96AF5F42 4MPULLITIS
143,580,721 *0DC132672300F7D0CD6244DCFB58E98FE1D8E7B9 am9s
143,580,722 *0DC5CBB78CB16519576BAF0972DB1F789447C92D AMAUROTICAMAUROTIC
143,580,723 *0DCC64F3FC43D8F3A9F1D794ACB665EF8EAF8FCA 4 OIREYHTYM
143,580,724 *0DCF3F9BAEFF7CEB1FCD7EED83B5728AEDEC8860 ambermariee
143,580,725 *0DCFB4F5C46A77387B261988B336D855F4CF95FE 4Q92
143,580,726 *0DC5DA87286304DDCE4C5ABD40BF47B84FD7E7AA 4SADOMASOCHISTICO
143,580,727 *0DC05FB05884B53CC48E2BC7C720BF5692F014D7 4TAMPONNEUSING
143,580,728 *0DC5EFA1A459520ABDAB9BC11A04A63F26E65EC8 4 TREND-SETTERS
143,580,729 *0DC02AF98C0807CEB6C2DDFFB50AA07E818D5B45 [email protected]
143,580,730 *0DCF568C62B9362D2243507C733C0E140BC1E46F AMNL$
143,580,731 *0DC1C219F5AB700B5F0A7147DA161D74E213DAEE 4 wilber
143,580,732 *0DCCD4B0AB0B1DA26B291D42B1B36D12A60BE3B5 4YANKEESJESSICA
143,580,733 *0DC249465DEB6F8E2CA9FEB0C2700DEC32598873 [email protected]
143,580,734 *0DCE02CC17755CAF8524595511E952667C1317AB 55-drogengeschaeften
143,580,735 *0DCF844BD4C7D98BDA739EB359C9C3CBFA2DD884 581958 LIITTO-JAKAA-SEN-VASTIKKEETTA-J
143,580,736 *0DCB0152CEFD67D8ED7CFB5B7E96D2704D3CB158 5alcogel
143,580,737 *0DCEB336026B1C406EB768BA47BAF9F31835E771 ANDREA.BOYKEN
143,580,738 *0DCAA27F729FD5817439BF5A5C0F906965771FB8 andrew.beauvais
143,580,739 *0DC38CE19FD37DD0DF1E6675340ACFB13BAED9C3 an:/e
143,580,740 *0DCAAE2C9B72CC910BAFFA844F47A41697063FCC angelapetrov
143,580,741 *0DC1D7658CF1365581C53279B2786F12DB305664 angiospermas-medianamente-amenazadas
143,580,742 *0DCFF00ADB479C5780FA4E341EE73CFB204CAE3C ANIBALBORZA
143,580,743 *0DC5DBB18BC7022274F15477CAAB3EAFCA8A7413 ANNABELLE.TRINIDAD
143,580,744 *0DCAE0F785DCDA6D1168D50EBA46A2127CFD0F80 ANTHONYORVIN
143,580,745 *0DC33BA89EBCB2D25023F631374449DD6F2E959C anti-falun
143,580,746 *0DC018CB7BDD8D729CF71B7197AD944795FE1B63 antioneharalson
143,580,747 *0DC086322ED56CDBFD6F6BFADF6731FD94A4D16C 5iamjosie9
143,580,748 *0DC1535F4907E04FF692F26FCA96889FAD3BABF5 5KUMPPANIAMME
143,580,749 *0DC49028B74458FBB839F78B3CA73229D6592BA4 5LESLIENEW
143,580,750 *0DCF56D98701848136A155E89A422EEBF87EBDF3 antisialagogued
143,580,751 *0DC6E528242DB3D701B0EC56B2EBAEF676C66C6A ANTOININ
143,580,752 *0DC8CE16E23B4238CA45556DA32F3FECC21BD24C ANTOLIIHAO
143,580,753 *0DC3BEB8D830C87FB0D2926D157D0B814227AFAE ANTON.HOLAK
143,580,754 *0DCB93457C0250835D696C7AF6FBE88E0A576B75 ANTWANWIMES
143,580,755 *0DC9C5479502E51B3B01B7734627D903E711E807 5NUTRITIONIST
143,580,756 *0DC23E2B6D72C5933C6E229D5A64FF84E4329B6A APEL1486
143,580,757 *0DCD1FD262325573A6CAFB7CA30B0E7ADC39942C 5RTKADERF
143,580,758 *0DCC2531C1E9983BA4BC93A853C12B52C8DFAA2A APPEAL’
143,580,759 *0DCBAFD1E85DF9F30DB93E820284B31B207BF333 aq9/n
143,580,760 *0DC5C12262A3AE6A8FA2B0A0798C5F2F46A64B8A AQV2-
143,580,761 *0DC2174C906C7AD0C346CB0DF1A277BE6943782B *araba*
143,580,762 *0DCAD583CE0F52CAC5C92D27B8952BB3318AEBEA ARCHIEEHMAN
143,580,763 *0DC6A0CE4A875AE4A47CFCB9439B72C492EFD365 ARIËS
143,580,764 *0DCC71B7DA06C2BDDBDA712254E989847A2283DB arlyn.manlangit
143,580,765 *0DC3824365FC397742E7802113A8D251B9703DDA aronshawnee
143,580,766 *0DC8E5B9308225198766C0596E9E30AA8C04162A 6ABELLOID
143,580,767 *0DC2E985655121B8C712BD37CEF66234D7073909 ARTHURLIESCH
143,580,768 *0DC538B9F7BF5504F69D1E6DD3D69451B67608DC ARTINEES
143,580,769 *0DCC313F0B037104D499181A03FBA39F1C7A9618 6BRAMANDO
143,580,770 *0DCBD3912A1C057DF425CF047206C5332D7CC243 ARTURO.CUMBERLANDER
143,580,771 *0DCCB426FD0C73C5BF0A9FD5983201ECA8DB7A0F ar:ue
143,580,772 *0DC62A291FD47DBCF66EF9322BF805E5598EBBEC ashleyekberg
143,580,773 *0DCC922D1F00E18493D3FC2E071E0A6DB622E91B ASQWRE
143,580,774 *0DC6D3BC6875C0CA2EF8AB098EFD4127D2719AD4 ASSERVISSEMENT2
143,580,775 *0DC7E987F3A695D0E41DA8DCB1329B90F1243183 ast%
143,580,776 *0DCE46549E33CDC552165F8F38F58515D9B45C1B 6FUNGILLIFORMS
143,580,777 *0DC192E77500E9D968C72535DFA56A6A0A032B03 6IAWUPBNXKDCFW
143,580,778 *0DC9848147C702DE003954D73AB2BEF410860070 atbxe
143,580,779 *0DC4F2063F27BF1469E08C64B6E680032A7E518A ath;s
143,580,780 *0DCA93B7F187641A4FCD2847A486C0DDCAA669F8 At.Last,.On.Time
143,580,781 *0DC94B1F45BFF149929581FD3BE58B6AAB070D8E ATOMSFÆRISK
143,580,782 *0DCE98D9F28A1762D28386B7965982554443AA52 6MERUISSET
143,580,783 *0DCDAC1456BB82C928DD56F71E6466198F1832D6 ATTACCATA.
143,580,784 *0DC861091B8FE2C8D0F199430427C4A3279C0734 6NKSHAMASVA
143,580,785 *0DCB92516ECE35F0FD0CABBA6C50E8C26FFDC221 augure-autourdejeanguillou
143,580,786 *0DCF7453DC71EE8482AC671EB6280586B7665B48 6PAINTERVOODOO
143,580,787 *0DCC4A2EF59E1AEF447201B8B33E4F40ADC06094 6PORTUGISARANE
143,580,788 *0DCEEE454DFA559552C4D48962651790A7E85A52 AURAFERNANDEZ
143,580,789 *0DC773351BAFC859970CD2D55609690BF72EF595 6UITVLOEKT
143,580,790 *0DC9CCA8B24A841F89CBE3807B1161289B5439B6 a(vc&
143,580,791 *0DC044279737396567E78A058A1BD61834629901 6vingerdoekje
143,580,792 *0DC18B0225E8C55B2F70B54ED02D0C93905D5E16 6VOCALISTSONGWRITER
143,580,793 *0DC0B4A6002FCA504ECD2EF27435F8CEE8D6E2BE 6ZKONTROLUJTE
143,580,794 *0DC1C8A54CB8F710E19C89D7C80C7202A2DC4A35 7-06-1100
143,580,795 *0DCC103025B88C4DC73FA9E6E82531860AFC3AE9 7.06.1802
143,580,796 *0DC4381271EE72440F84D75AF57866E0EE263B3C ax7vr
143,580,797 *0DC0E919FCE201ED8C0713B02ADA547892963BC8 ay,kb
143,580,798 *0DCA97D502E667DFF7826E3AAA1CAC9A8D0E4E59 75倍;按可比价格比较(全国平均物价水平推算),gdp年平均增长率10
143,580,799 *0DC6C4977C93C716010EB173ED5F713E190FC8D1 a)yz%
143,580,800 *0DC83090F4622442F05CF995976EAB7B590301EA 7APACHEJEFFREY
143,580,801 *0DCFCFECB82BDEFA77B5C8161CC9413BBD916A93 az#$u
143,580,802 *0DC5C55F5C3A75E070E9FCCA992248E90B3B117D 7BIGBIRDGORDON
143,580,803 *0DC2778A0CD071019D6EC83E8900E87E794019BF B1U5+3RN9
143,580,804 *0DC402FED7B04D5317029F142F6EBA584F2FE6CD B33.LARKS
143,580,805 *0DC7E688C738404634F5B7977C73D45CFB3DE84F b4l_)
143,580,806 *0DCB14D30F6FEADBEEAA3076661EDFD01DBF57AA 7CURTISIGUANA
143,580,807 *0DC243355DDEFA1E3007825AADD97C6A73DC5250 7.DRESSUR-PRUEFUNGEN
143,580,808 *0DCC85EB3B1B8989B4D05FE5E61B95DD0C4742AE 7GNINEPPABSW
143,580,809 *0DCD0487017CE2D62E2377F9FBF11C9D2FD5F88C 7LIEGREIS
143,580,810 *0DC2EE1327DF7462C3D1F8C7596F7A721CFC736B BAAAAAAH
143,580,811 *0DCD6CE086811DE31D1BA1C3705CF364DD3A691E BABYISHNS
143,580,812 *0DC2AA397F6FEF16580ECC464F5E76F9A938AD6E BABYLEGS
143,580,813 *0DCF0287CD7FBD40CAF8093AE2E0E8715A808C10 BAPP?
143,580,814 *0DC2D1FDED833A525996923F96FD51853E3A806A baqcl
143,580,815 *0DC79C100F8297818BADE21E3BA1A46C24914A34 BARRETT.REYER
143,580,816 *0DC1AFCAB49062F29BCF36933A5013B241F23D19 basingtariff
143,580,817 *0DCD0494B1C1E5EF38B5C5877887780CC5B326AC BASKAR.SK
143,580,818 *0DC3AEF0A28A7DCDC0EA6702620A56A20E8B0233 BBPW?
143,580,819 *0DC8D90E4C6F7A837B038A44CC780EF76F96A0C7 80DC57F5EA3B5BE3933618C0E7B73D92-LORETTA
143,580,820 *0DCEB61CF47305307E25C7DE80BCB10C8244B6D7 bbzn
143,580,821 *0DC02A02F37791C16CB54BE2FA2F6B45CFC9B0EF 829ZAIDEN
143,580,822 *0DCAA5F21F91ABC810D47DE1750FFCED463B92A4 84C7R0PH495
143,580,823 *0DC9CA1F6FC9929A026E8252E015DF71EB9CFEC5 BCGWW
143,580,824 *0DCF7A284F06F840B0B21E9AFD6895473F9D5D39 B-;/D
143,580,825 *0DC832A9E02DDDCDED509F5EAF35085EAE0C7D9C bd(b)
143,580,826 *0DC3F1FC3CFA1229D5DEA429D34607582E48A3C0 BDF5$
143,580,827 *0DC4DE3E03DC58AA91339BF2D6DC19E3B99E5294 beebole
143,580,828 *0DCBB4FF7D538610803A28C5ECCF373B74A4EA69 BE/FF
143,580,829 *0DCBCB0B8E25A8F61D4B14CCC9735B313B79B5F1 8C-A
143,580,830 *0DC2E8EB4F005080D9D5C3B7056AEED49E1E107C 8--D`~`~)0(
143,580,831 *0DC0096A6004F1055A0894EDBF757DD72236E9AC Bem)
143,580,832 *0DC45F4B74B336020BFD46511BC7AE526D7DC468 )8(~`D--P
143,580,833 *0DCDAD929F83A35854BFDCB6AFB5793AEBC40EA8 8FLTIMERCLEAR
143,580,834 *0DCD3DFAA2667CFBE48262EDA13CF6B04D4613A8 8_GET
143,580,835 *0DC5674FAE15E26BABB3FF087B6AD597539E3B40 BENNYBONNEVILLE
143,580,836 *0DC34274B4A86A883425FAF3254EDD6018DD44C0 BERAUBTEN3
143,580,837 *0DCC417FA3622F86D96BE2A335522AAE25AA0C84 BERTHALAMULEJ
143,580,838 *0DCB7C08093909CF1294195F12137EBA40613994 BEZIENSWAARDE2
143,580,839 *0DC527D3406797B8EA424A9480F0E040753DE106 BF0N%
143,580,840 *0DC8EFDFC6A5B8C2EDF44C05B31B7285B04C48CB BFFAJ
143,580,841 *0DC9DCA5E3B81E96FDC6A27623714B8B751A0CF3 8PERSONALIZZIATE
143,580,842 *0DC9A1756B809BD1E037AF5990FA3CD249A02EC5 8######P ~ ~}O{
143,580,843 *0DC12C19F6BDF738C84D139D69466FAE62AD131E „bfv“
143,580,844 *0DCCFEFA734CA1324B439FA1D09191477F86B090 bga;0
143,580,845 *0DC080CD8399EA13973D29FA807018C87FA9F5BC bg.kv
143,580,846 *0DCB1C07F6AE017E882E17C15756530DA6E19F03 bgvni
143,580,847 *0DCEFE7143C9B17E6EC77BD4653B5723AC9C18B3 BGW__
143,580,848 *0DC3870D70D257DC61AC158168EF3AC5589655EB B$ICU
143,580,849 *0DCCB7B5EFE856420A59A62BCF34BE60B86C62E8 [email protected]
143,580,850 *0DCC753ECCA1492340170EC52B1DF406CE34244C b.i.n
143,580,851 *0DC85D9FA58F3B8322A8616A8EB8A6EFE0E3635D 930heath
143,580,852 *0DC00C27DE1E9DDD3ECFA32BB053293FA7B617D5 953455 then-,-none-of-us-can-forget-someone-very-important-.
143,580,853 *0DC8C31884FF113A741003DE49D4066CF041CF93 bjtfq
143,580,854 *0DC458FFB81D5A064A2B3656F074116488B33B90 9.circusthemed
143,580,855 *0DCF61937503808AFD5F5D2F080CCFCB0C489064 9COPATENT
143,580,856 *0DC2897AB4C9261AA0CBBDF2B6506E08D4FA5754 bkcvu
143,580,857 *0DC9FECB4EABDEED573C869AA90FFF0C510F49AB BKF=O
143,580,858 *0DC22FB33B971756A53CE450A76C590453A2A571 b:ku_
143,580,859 *0DCFB74CF972AFD4B361394CFC62CBC2F02FF3DF BL3E0
143,580,860 *0DC72556F7789892B3B827FA2DE9618DD7B25A6E [email protected]
143,580,861 *0DCE7A51719B20453F38F18D7CDA97CF9DAA7FBA blj.:
143,580,862 *0DCCAE594A4604B879A476BEA2D1BDE05791837B 9NESEMMOH
143,580,863 *0DC89C486569926023538614D9C42A2F0DB50980 blogsounddomaincomblog
143,580,864 *0DC51AF1DEC896F5587DF2DB92CA071BFBF0F2E6 bls67
143,580,865 *0DC546F53DA0607216536FFB0F6FD6AC9E51F76C BLXXI
143,580,866 *0DC92AF2950C879C612670B65122CC463252E1A3 BMEGARAJ
143,580,867 *0DC5F0B6B9B71842B0A71EC2519D40DED4F480D5 B,MM
143,580,868 *0DC78D2ED1B5428C5CF682BD86C5DB5D38129D47 9STUPENTIBUSQU
143,580,869 *0DCC9CC3D2EB28D9B4AEA58E37299716E57A47A4 9YTRAFSGN
143,580,870 *0DCD7E144B2E50BBB2A54C752FA93AC392E3B325 boerenkers!
143,580,871 *0DCBC4259234B464573F8E206C954DC925EC9383 [email protected]
143,580,872 *0DC79F9A7FF92C48B665D76FFE415BB5F8A3D9D5 A10097919
143,580,873 *0DC6D1A87B509B0737997F40358295EB2F56505F a_$1h
143,580,874 *0DC49C21611E6DEB8D9B084D6AFBEBE9C3C3D952 a4(a
143,580,875 *0DC4B9BAA692FFD33D3DCA7078B9901839603BE8 A#;5F
143,580,876 *0DC5405BC326ADD0288E9FF47343E9535A5CA3BC a5_h?
143,580,877 *0DCC1C28FEC3CD95ACAA3FEDD34A254E04502201 a68&d
143,580,878 *0DC031FEC444AAF06EA1DCC65E308B220CCAF1BA a6nc5
143,580,879 *0DC9E20F8EE3F3EAF377D9B9530BCEEE7FBB0EC0 A+7$
143,580,880 *0DCCE8DCCBDEC7814F92DC50BE4106EB88DDBCF5 a7q_i
143,580,881 *0DC34DC259720E763E614B2072D5779C5746E184 B--P`~-`~)x(
143,580,882 *0DC7539192434B1B1356B53077724683BB72EC9C A89h
143,580,883 *0DC4672E8A58C8DE742C3C50E84F4C502584AD03 BQFV
143,580,884 *0DC655ED180246D65F82093CF7C52E053A43A6E9 a8x/p
143,580,885 *0DC6F8CD6DD932D6567B5EF7E0AAC0DCC41ECE65 a9fc9c3f900c504424e511db23b9a3c9-drannor
143,580,886 *0DC9371B010DAC1C4695312272147622CC590DD6 bqnz)
143,580,887 *0DC6CD9296D6D4C89A7DB227DBDCA3C9C9E8F322 BRADFORDSLAVICK
143,580,888 *0DC9A80E92494FA7CD9E461B690AE3C7F73B9C9B AAATGCCCACATTAAAAGTTAGAAATATCTGGCCAGGTGTGGTGGCTCACACCTGTAATC
143,580,889 *0DCF16A483A463D9AF67054FBBF9BF09B0BEF97B BRAVENEWBABY
143,580,890 *0DC320026FD63170184B1AFAD2FE2A827A87F658 AAB+M~
143,580,891 *0DC9D2105A460DB968EB31AA051597920F4C5687 BRENDONGRABARCZYK
143,580,892 *0DC78D34D66ABB4BAF8B8E6A56670667FE7C7FCC aaej<m
143,580,893 *0DC52D86B6BF6759E37CC719E22F990BC317137E brewster08
143,580,894 *0DCF82FBC470A4AB0AA2FF319EF10F07C91078DA aaep{
143,580,895 *0DC2B9539835ADB7A2DD9A4A326674577510F7CC aaeq)
143,580,896 *0DC01B2B080844008E8FBC8348939B78CD2AA08B brian.lillard
143,580,897 *0DCC6163359E4F97E6896340D321E27F5DCC433C b+"rm
143,580,898 *0DC4FAF4E56EAF19EAB0881ACEEB5B32DEACC112 aapqk
143,580,899 *0DC5044B0890C7D32CCCB0ECDDD0CE8C6A1E2373 AARAMATING
143,580,900 *0DCEA95E02A3A5CDAF5A0B4C9C7FB48F76536548 BRUCE.WHARTON
143,580,901 *0DC43BCDD3FC648B6EC7CDA40141B904DD6F2D7F AB3H
143,580,902 *0DC2117CCFC7EB494CB630CD0756CD20BBFE0020 BRYANTSAENPHIMMACHA
143,580,903 *0DC9A8B54FD29D275DD30EEC7020B0177EAEE52F ABDULQADIRABBASI
143,580,904 *0DC395220BA54F0CD628216BA55ABF55826C9701 BSAL":-VII.-ARIA-(DUETTO-TENOR,-BASS)-"WIE-WILL-ICH-MICH-FREUEN"
143,580,905 *0DC7A3DE6BCBCFCBAD1D75B10F298FF8180BD84E [email protected]
143,580,906 *0DC1838F820AAA0777627E6D78FD2B25F1EC997C ABEL.GREGO
143,580,907 *0DCB13081C22DE40FC3F7B53A48181E135D76138 b----->-*splat
143,580,908 *0DC496E976BF2FB0E4C23DC15C4671348C670B82 AB!LI
143,580,909 *0DCCF6138FA4E3F9901FFD31044D442F2209DB23 btg:m
143,580,910 *0DC87DD22D387413402A42782DEE7227E231A803 BTLD=
143,580,911 *0DC5D5DCD722B4EE008083C25B155654B3F33564 ABVEW
143,580,912 *0DC654640CC69EC2CB73E7371C21E376FA8D73CA B$u3
143,580,913 *0DC78005388013180AD6DFBA4A8810356889F531 AbVS
143,580,914 *0DCC5ADFDB386804A0AD74E93DA8F823578BFED3 [email protected]
143,580,915 *0DCC1E205936164138DC66D460274FFA4CA0B731 BUFORD.DEMRY
143,580,916 *0DCD20A38A378F4178FF9EFB5181C08407AB5529 ACCESSERUNT3
143,580,917 *0DC260A495928DC09BFC052F7185DA5E6122291F accessmoroni5
143,580,918 *0DC289AEF21D4B19E424DE7124D81E54846B100A ACCIARI6
143,580,919 *0DC698D8182E9913CE7680AABFFD9D361A227C1B ACCOMPLI
143,580,920 *0DC6BA8A034A4C283FF32334A3840197244244BB bunnyrandom
143,580,921 *0DC45B241F9E1DC4B50D1987E855C159C5F70ADE BUREAUCRAATBITS
143,580,922 *0DC32B5D39873DC39E1DC39F1E46CF217B878029 ac)l1
143,580,923 *0DC6B48196DFAD57C7F8E179BC3A7662A0900EC1 b:,+v
143,580,924 *0DC58F80BFCE12D1457ADDE57E78E45B37D40E8C bvaa0
143,580,925 *0DC63526C7F67E28BBDF6568F696E33C6B8A4C80 BVJ#_
143,580,926 *0DCCE85C07E04B8FC5520A9516D7E13304690292 ADAM.KOERBER
143,580,927 *0DC05DF774F8D8511738094C57DC99E2F843CB03 bwfo7
143,580,928 *0DCAE5F0525F6F87B7F3895E0A32381EAD2F7724 B"WH
143,580,929 *0DC340BA8599E4E12BDC9873303E6ED872B76063 bww;0
143,580,930 *0DC73D5B035269E11F821314CE329066698A4CEF [email protected] ~ `(X)
143,580,931 *0DC1938EEF77A5F12380B19FC019375E1A20886B c"-1n
143,580,932 *0DCDADCFF97D0125E2D1FB1E16877E209636D618 C2LVE
143,580,933 *0DCDF6274FC73273870A574DD1B3EB654ECDD329 c3ft0
143,580,934 *0DCA82A22E198C9ABFB2698D8D83A7EBF6837035 C:4U&
143,580,935 *0DC747B2218AD2AF83C4EF2D72AE8AF40FDD5B7D ca6463364
143,580,936 *0DCA2B7FD49BBEBBA39A92E0005CA189765EC146 cageds
143,580,937 *0DC39291A539C176E5DC7A88A424BA2E38D0CEB0 [email protected]
143,580,938 *0DCDC0BBF0901966917C9E3F8ADAEDB6ED820212 addossi3
143,580,939 *0DC1384577212377B0314570D3B36ED5B1CB27A6 adkog
143,580,940 *0DCFEF35B0FAB966D1DFD0FA8DAC222D4E10D814 a,dmo
143,580,941 *0DC877B42B2D7EB769A04EA0A76ECFA28EA0197F A.DUB.SONG.(UNE.CHANSON.DUB)
143,580,942 *0DCE0BD4DB3804C97618CA7E4BF254BD3E46DD3D cankerd7
143,580,943 *0DC183D48E582073F4777286DE557E55D283DE49 CANNASHAKEM
143,580,944 *0DC62E9D19A4744B85459BE3563B45B643665C52 aeq)s
143,580,945 *0DC5B14EE345D1C643AF5F48CC5F9E3CBD2A0113 a;/f=
143,580,946 *0DCC7E9C911591E6787CE58CCF2DC3DA69C5179D CARLOWEEKES
143,580,947 *0DCD066B487D223093D20F042F89777FD00CD143 afftonoaklandhouse
143,580,948 *0DC05C246AF0FA4A2284868212EDD802774F96E8 AFGANGSBEVIS
143,580,949 *0DCEAD4567DB652D982D7D5848224258D065CDF4 afkeken!
143,580,950 *0DC4DC789B2F9D54A557ED37175BF1DB11E728F6 AGDU1
143,580,951 *0DC382F65A415E994F07D4662E6AD9D0481DCF1D [email protected]
143,580,952 *0DC8E63A42179D3F8490E91A584AADDF16E295B1 catsdrums4
143,580,953 *0DC8A57D705665B083CD82978ABA07D51DDD0743 C+BK!
143,580,954 *0DC15FFD2AD91253B10F650A354AB4E5BC73C375 Cc:b
143,580,955 *0DC56304B0E15FB2B29593AF57DD7129C428004C ccgte
143,580,956 *0DC991D22A20230090F258454A1D6F5BD904E787 [email protected]
143,580,957 *0DC261ABBB350EF5593284269E9E41E97CF6D0BA <ahref="#hdr144348">144recommendation</a>
143,580,958 *0DC9846CA91AF57173358BF731E2502E8C61182C ahwhzbsw8
143,580,959 *0DC165B056017457729EAA6422DDBD61CA39EFDF CDGNB
143,580,960 *0DC54D2C4D7C23C0F9C285587B4BF8D9B15921A5 cdipv
143,580,961 *0DC5F81D5E35C4C0064745C70524929604FAF0B5 c-d/k
143,580,962 *0DC8E73A5A1977147D2E6BA1E3D690799DE882A3 aih$q
143,580,963 *0DC340D03E7C3DF52AE5A7ECCAEBCB5B71EBB9DB CDNQ
143,580,964 *0DC4C94521E2E3FE7A3CBD986CBED6F4DE1D75D6 aik..
143,580,965 *0DCC1FBF2974D3D78520A68FCF2475F2EFBD20A7 cdseq
143,580,966 *0DCDCFE737A9FD8B5B41509995F692F11FDA6967 Ce6G
143,580,967 *0DC130F74B3226DD3C7A35FABEA9B58962BDF891 [email protected]
143,580,968 *0DC0A227E60713B6D20EE2201AB44784E0C15462 a(izd
143,580,969 *0DC31A3805C6601F26AB5F71282AF69AB6EB461E c!en;
143,580,970 *0DC34446F5E70C0D924194E60E26BC67950A64D5 cet.q
143,580,971 *0DC058E3CE690AC88E3CC47C91B05A276E6BC564 CFLF&
143,580,972 *0DC1101646C0A0091610937F8468C52F9FFA8719 cfs$t
143,580,973 *0DCA14E7FEB96D353102A4DDAAFB5217BC1A417A CHAMP2486
143,580,974 *0DC84A945F35D94E8446444367ABDBFE871D4530 [email protected]
143,580,975 *0DC3EBA92476244B871533BD60DEC73DAFA94FE7 A?K:
143,580,976 *0DC42C393D6328D50A0AB7B2050EB1B201F78AF4 changholk
143,580,977 *0DCD48A396A7CBFB69DB3F72A56284CD73135360 AKATUSTET1
143,580,978 *0DCC42B8F2452F6B5C9ACA71327D3E5981A857C2 CHARLESFOSBROOK
143,580,979 *0DCE04E0C8490996C28394826665CE4211070345 ako/u
143,580,980 *0DC566C8F01B14A895ED018A82D1B1EBD567F2C4 AKSIRAM4
143,580,981 *0DCEE4280C64383320A92761F4E6E547F0B41623 chbff
143,580,982 *0DC4DD70ADDC624BFFD626EA4F548AECAC9837AC alaskanmalamute163
143,580,983 *0DC6E52D4B0ACC681E2D6EE2419BB0079C3D0CA3 CHENMIN19810
143,580,984 *0DCD3F99629468A28F47EC74781AE644E7479F73 alecpetrosky
143,580,985 *0DC1EEEF56F715267B7558305E9F3FAA77A5F1F1 ALEXANDERHAGERTY
143,580,986 *0DC9AA3305A05B290F33B4558AAE9F44A2806819 alfonzotrumpower
143,580,987 *0DC8F2BEF55137D25FA2C554D3447C51F85C2DFC A;LHO
143,580,988 *0DC78EE0E164700F795459E39EB098C5FD550474 ALISONASKALISONB
143,580,989 *0DC7BC26C753A4FF4D815E5BD2400AB973E08E0F christoperalthauser
143,580,990 *0DC2E0194A23A123B806119EBA63432725521C13 christopherkennin
143,580,991 *0DC65C081EA09F20601D39B17A998D9F556819C4 ci5e#
143,580,992 *0DCF85B4DAABE3EBAA7189B36303715B7ED05286 cirkusbroadway(disc1)
143,580,993 *0DC75DCC84E414D3CD5EC67AF6DC1BB090FD64A3 CKA+R
143,580,994 *0DC808B3219612E24A4332BCA291FBA765CD993B ckh!b
143,580,995 *0DCDFF6E51405EA7403A04441033FA9BA4A9C96D claudecheves
143,580,996 *0DC03243AE4409F037C57242AA96A182F7870F5E claykuchta
143,580,997 *0DC29804AB3956E4BA56BE145C96628714BB4526 CMANNOSYL
143,580,998 *0DC25D6D181FA7D608AC52923AAADD70DF1828A2 cmee5
143,580,999 *0DCA49DF24A62A6EE9B3A98C5CDA55D912068700 ALLEN.KAMMANN
143,581,000 *0DCF781E0A8F3239381026F31BA08FDBEA70D033 C,MG(
143,581,001 *0DC3AA8A526D983F6D945E94FD10D2994F07C37E cm(mv
143,581,002 *0DC0F33C11A9639A2F11D523D97418666B5CCF29 cnew
143,581,003 *0DCA0210C643BB4C1B7BFDE95ADA9FE6EEDF6B82 altos.reyes.de.los.noldor
143,581,004 *0DC4299D33F39ECFD85E773EEF06D3F50130DC3C COCK THE HAMMER
143,581,005 *0DCFAC0070766AC4F3ECCDDA336313826172504B COF+;
143,581,006 *0DC0C610DB253497C88D1842BEA2818A128355FA am3m
143,581,007 *0DC0A7D824075603D2EFB2840B7ED27C96AF5F42 am9s
143,581,008 *0DC5CBB78CB16519576BAF0972DB1F789447C92D colinbittle
143,581,009 *0DC3E4CA91E3E13D52779EF12EDAFD8F3E32D2D4 COLLIN.FIKES
143,581,010 *0DC2696406764353DF26E5C085FC0F5074442F04 AMBROSE.WUNNER
143,581,011 *0DC517956733E13FE5E1786F2A9FCD380C3128D9 [email protected]
143,581,012 *0DC5B1E69B6F995036C1CF3EE240A156730B95E2 AMMUNISJONFABRIKK
143,581,013 *0DC49EEF8B120B664DF3EE5246A2B1056FA59323 COMPOUNDTALKASSEMBLY
143,581,014 *0DC3A03816411408059213791270326CEC78C9A8 AMX13
143,581,015 *0DCB32940120FA3FB0181E9BA8EE582F7F683BCC CONCERTOGDURRV5451ANDANTEMOLTO
143,581,016 *0DC8ECC937F4BDEB123D0D34C9D34BD734F07151 A)N&
143,581,017 *0DC1D240AB2DC80520A32E5108EC59F896AE02FF an7hr0p0l09!cally
143,581,018 *0DCE901B6843D6B10B29B3856E51470059563E41 ANALIZZINO9
143,581,019 *0DC1FB042C4CDDB6710F94187A6D794B7600EC9A conradgayer
143,581,020 *0DC6B09B985E8BFB059596E8329A5C6FE97ABFEC ancsika.22
143,581,021 *0DC64A2AB9694054371750BB145D6CB726218466 ANDREMASKINIST
143,581,022 *0DCB82DA825476C7535F921D1876BAF2F06B3553 CORTEZ.PALADINO
143,581,023 *0DC7704B7A9749D5D30799C86A266F277B2C26B8 CO$TL1NE$$
143,581,024 *0DC25C8282A257CF75EE0755480E74927C9C8B61 COVERPAPER
143,581,025 *0DCA59C74B2C595B0C1C4A0834B9BDACB559CEB2 anetrexe
143,581,026 *0DCCA27ACD997C90D3D204839ED966BEA7B27585 ANGEL.CAPPAERT
143,581,027 *0DCD3E007F9C5943925E478D6AAFD34663F438E1 C(&PF
143,581,028 *0DC1978BF11DD0252EBD4331A5F77A6FAC257B30 ANGIE NUXOLL
143,581,029 *0DC7BAE7083DEF4099D510ACB18D74A6A09406B5 C:PQ=
143,581,030 *0DC2C6B45EBF182E9C14B84BF660FB34AF1DEB98 anikcruze
143,581,031 *0DC818E3DA55506489AA764125C48C0325F54F27 anil-kwatra
143,581,032 *0DC5F8E2449A5C82247ECF40FCBFC44DDA6F4E96 C:\Program-Files\Microsoft-Visual-Studio-9.0\Common7\IDE\ProjectTemplatesCache\Web\CSharp\1033\WebApplication.zip\Default.aspx.cs
143,581,033 *0DC25BFD43C909A72BE933DC203C55EC064CF5C9 anthonykellow
143,581,034 *0DC05F741F4A7BA564A512BCCC1D0C3ED91AA030 anthraxhed
143,581,035 *0DC76ADD09F2C5BB0D58E9B78E9587D6606C3E8F antonio.elizondo
143,581,036 *0DCCD1BF7AF17C721A9F9D6E9B037FA3E8BA4083 cr8jm
143,581,037 *0DC95B733B50548AB0444F2FF25351330027341F crane
143,581,038 *0DCC229B8F163AE4BD4C47DF98071FA26CC4C56D ao[6
143,581,039 *0DCFA5496A8CF496FB130CF52AB508253F2C6155 A=OL
143,581,040 *0DCC7BB3BE46FD790D7E2096129845142E54C779 cristopherhugill
143,581,041 *0DCC80C070ADD5D059CEF155071A2B92DEABFA55 crs3_
143,581,042 *0DC9F9078A7CFD6C28B58F67953CABC6F0CE682D crsb,
143,581,043 *0DC2BCA19514A7577306546A8F9BE16DC4339395 APIQUAGE6
143,581,044 *0DC03A93ACE4E9B7E828A03150C8351846E27461 APPLE、学名
143,581,045 *0DCA1CFE45B5E9AEFE914E4C83711FB5794E533A cs!=p
143,581,046 *0DC7890834755B7E1FF597FB2237023A2166A030 aq0_
143,581,047 *0DC9D009E91DA1AE83F19F018B6B164DE7E0B2AB aq7n5
143,581,048 *0DC8613FD1509ACE6AEDA62EBB2E00ADD8564507 aq9/n
143,581,049 *0DC5C12262A3AE6A8FA2B0A0798C5F2F46A64B8A c-t)=
143,581,050 *0DC41FA35C884652822125B434FF23B06580E85F aqcs?
143,581,051 *0DCE8319081934BDB8B34149375D91C5C20B0302 aqis
143,581,052 *0DCE36A801C8E5B84F921283D6258D8AD6F62274 CTLNX
143,581,053 *0DC056499010E5AE0791D94C962DFFFB2DE7846E C_u4
143,581,054 *0DC849C2557C77F8D78B9A9CC13BFE68C364BFD8 archoptos
143,581,055 *0DCE6A067331207B4081270DDF90AF9659EB08BE ARENRACN1
143,581,056 *0DCF3A198FB68989F6BAABDD349E827C43DA8F9B ARIEL.RUDIGER
143,581,057 *0DCF65847E4DBAE7990695EE927F32A552F7690F armenewscom
143,581,058 *0DC17E4BE57E990FB377A0275DC0F3AAB0F469C9 CV52
143,581,059 *0DCE89E36D149CAF66E3D3CA5722F1690DD03014 c;wam
143,581,060 *0DC7D6F4AB5B1CD9F1DA0AFD1C03D834FC3F3BF2 cwa&t
143,581,061 *0DCA4B7CB445CE22C80A96487E62E6A6E4DA6314 cwcgv
143,581,062 *0DCB634577DCAE8110628FA300B587B204F1582E CW,#J
143,581,063 *0DCD6ECD1D7494F11BE2226AEEAA0018F54129A1 [email protected]
143,581,064 *0DC3F7C627DE5FD954C085AFC78EAB91966486BE ARWSDW07
143,581,065 *0DC857A62D61AD82F0767624CAA02783DCA7F52A C'XC
143,581,066 *0DC1CFEEDDBC851B06010FBB347C3BBC2D37DBB0 [email protected]
143,581,067 *0DC98031ADE0537F80B9A1FD9BB8B441B5B2572F cxvc%
143,581,068 *0DC31E0CC6A32C458EB978817B8651D731E54B43 a##s8
143,581,069 *0DCC09308020952BEE6F84CA56583156757AD4BF as.an.example.of..an..i-component,..consider..a..system
143,581,070 *0DCF1A0D862B500A333FFFC20E925B5878250EF0 CYRUS.FRAUSTO
143,581,071 *0DC65953A5FB59B6C3FC67823C7C05284043E0F1 ashleydieckman
143,581,072 *0DC953B158B35AA6D543A4E7E07676131FC0F6DE asongosib4
143,581,073 *0DC14714338D790A65F1D134793CEFA630F2ED28 d;$:0
143,581,074 *0DC3B0E742CDBDF1AF286FEA082594A47C654C43 assimmut6
143,581,075 *0DCDF59653621581C60EAC7D2ADAA36A956A04D7 D0TEREDE$
143,581,076 *0DC84036905954CB5B457B697E3A89B4AD9F9D46 astautia0
143,581,077 *0DC87D96AFD15880E131201A95727B8A2BE0AFDE D153M80W3LM3N+
143,581,078 *0DCB7BD3C8F1E85B7B7689A73DE625F097F88B12 AsXs
143,581,079 *0DC069549A2D09C171BA3FE192D0E94FD8D98CCC a+tcg
143,581,080 *0DC94341F5AEA1DF94535B49BC43311DCA32F1C8 ATLNTA
143,581,081 *0DC701E37C3860BFFD46925C3AB5B7AB7018804D atto.secondo:.vespa.rospo.maledetto
143,581,082 *0DC5EAD9679AF63B8A63317BE97502ECA71B32F6 atul-chhabra
143,581,083 *0DC3F3E18E1CB076195AC16408AE1B32413FF016 AUS.DEN.CHRONIKEN.DER.SIEBEN.GEFALLENEN.M
143,581,084 *0DCADBB3877E4526610AA97201124DF02F3CB4C1 auswahlkämpfen
143,581,085 *0DCADCD056DB6BC8704C00C14E49246E362AE8EE a_//v
143,581,086 *0DC52CA40F44913D91402608EA9D0B8637D86D2A d7g?,
143,581,087 *0DC4369B56DDB8E73C15F78647CD92FC0C31BFB9 D9"R2
143,581,088 *0DCE73D0AA15C7E971346AD8E374C9EDB21F841E d9zb#
143,581,089 *0DC088F674AA03A5DE40AFF03317D7196BDFB2D2 avjp?
143,581,090 *0DCE6AF9A7AB01C5854152EF9A8ECDE338CEB942 Dance-Freestyle
143,581,091 *0DC3A3B3CC8615314EDBD066A3D445AFED77C0C2 AWDRGYJILP880
143,581,092 *0DC2CA199EA68C9568782CD57465445FAC3B659F A&WK_
143,581,093 *0DC95330987E1B27D21CDF3FC27519F7E3312454 dan-loofe
143,581,094 *0DC4BF51C41E9AF3703788568E616785D0692A91 DANTE.FAVAZZA
143,581,095 *0DC49263E66C6E56CD7155F44DB26E317183BE9A a/x6w
143,581,096 *0DCFC44C3106AF7C813E3E38B9B96A0816C46B82 aya.suraya
143,581,097 *0DCEAA68985EB7CC00D4C8C467160F77B019BD57 azsxdcfvgqsefthuk
143,581,098 *0DC3C7C84FE25D4053687CA9405AD1B207A66EE7 (^_~)-~-(====b
143,581,099 *0DCA0BA5CDBC797E6CDB95C7777351B8E9921A64 B00JWCR6
143,581,100 *0DC28A69E0022C43BF6813871713B218364111C0 DARIONYPAVER
143,581,101 *0DC453B4004EBD4D73AFD823A23FD75EC3F6B8D2 darrellbenanti
143,581,102 *0DCDEBD37F87469B6C7EF3D7988595BE974795EB b2/lb
143,581,103 *0DC2509A06D02F2205E53D6AE44F02DEDDF5E11F DARRELPHO
143,581,104 *0DCCEE9D98C96011941546B7D2A32DF8CC614006 b%-3a
143,581,105 *0DC5C7E6DB2DCD311C690D38B3EF7D359FEFD348 b(3q9
143,581,106 *0DCB99FC05E43FE176701B41E18038F5FE2F0780 b4q=m
143,581,107 *0DC9E8678E1933C4F690B2BB1D1125DF06E34580 b+(6o
143,581,108 *0DC75C4C50C1F0B2219AFD24E0515EF10FA91F7A b8lv
143,581,109 *0DC5276803220E688AAEBE77A9457124468934F0 B9BI$
143,581,110 *0DC818C72FBB2BA9CC81E5E1ACA3956F9C9EE51C b9eh9
143,581,111 *0DC0BB50819BA673A3556A53D02DA2CE955A2551 dc$+p
143,581,112 *0DC0D5E8074B41D21AAAC4AA7865D4956F8046D6 DCRD/
143,581,113 *0DCDEA6DBB7D5E3509DECADCD894FC48F212CD81 DDSPW
143,581,114 *0DC667FA497DBD412CAF6C8D2BE2F3B9696E683C BAŁAKIEM
143,581,115 *0DCCBA1D49F7A9B502A25C49154987938A53FA26 D=EBF
143,581,116 *0DC87918E004099101884187566036253508B458 BALOG-DUTOMBÉ
143,581,117 *0DC248F4A38902BFFFEE23D510EF2A8FF418455A banyantrærne
143,581,118 *0DC848DC5AE4B4A2684598FAE1277E5254B1AC6D d'edizionsinstituci
143,581,119 *0DCDCD18FD735B9B317F5D6364D7B9EDF3B40D8A de+er10ra+ed
143,581,120 *0DC93FDDBC5041B2591E7D5B8B8AB8BB5F728F87 BAR-MAID.BLOGSPOT.COMBAR-MAID
143,581,121 *0DC11B92B4A775CF72F03DD42F6ABE69FB1063C9 DEFOEOPEN
143,581,122 *0DC2FFAB6C1C6AA09AAEE7003A1CBBDD5010663C BASIL.TAMANAHA
143,581,123 *0DC4ED034C77C8489A325B44F240A24AEA5BAAE3 BBHJF
143,581,124 *0DCE0E9BD4A0E392BB537CEFC26F8C6603968FF1 b+;(c
143,581,125 *0DCB130ECCDAF538673C973CF07FF8F2333A87C1 b$c38
143,581,126 *0DCBC1606B3876CFBD24D7DE16934F020C85A5DD BC,u
143,581,127 *0DC91BFD53F789105781391EE7D6D61E091F9A57 deshawnchimento
143,581,128 *0DC24657CE22B13F7AF2928788C0F8DE46B75FB9 DESMOND.STRAWS
143,581,129 *0DCD2B4BD0ED0853841C3376046A05B791B8C3EA b"dhs
143,581,130 *0DC89A8EEFED765CD02C64F493965EE79629AEB2 B==D**SPLAT
143,581,131 *0DCD346B780D2DD74A747714B73966CCE07CEF88 bdwa/
143,581,132 *0DCD6768F189074F181C5FBDACA27F2C15E6E5FC DE$#W
143,581,133 *0DCF71B4EB300EDD4402B7CB279A7916FEB876FD BE#AV
143,581,134 *0DC99C09442663723B8E3F41BA3742A77358DFAA [email protected]
143,581,135 *0DCE8F1CF598995F11186833CE997C20ED788029 BEHAV!OR!57!C
143,581,136 *0DC2156F51864F2342333EBD648E953B3019D954 df:xc
143,581,137 *0DC8B1AD015EB20FAA41E127AF6DB8297BDE428C BENNIEECKFORD
143,581,138 *0DC98EEF4ADAD88F6CFA08BE6F3F867D72794645 BENNYWARZYBOK
143,581,139 *0DCE504F6783A530305D2CDDCFB493BD8CAC018E Dh-e
143,581,140 *0DCDC6E2C0A0AE99083015650F9DCA4A638F395B dhfhp
143,581,141 *0DC9C14B1517A0D5879908F806A1AB0D530D0B8E DHUCKMANN
143,581,142 *0DC0007DF2AD09496B27EED20ABD47692B19FEB4 D(I0Y
143,581,143 *0DC4CB120B09EA5665BF35D5ABB4797343C51BB2 DI$4$TROU$
143,581,144 *0DC239EDB31D42DD3BF5EF8033AC904BA0916EC0 BETA-BV-|-NETHERLANDS
143,581,145 *0DC2EEA729CCF030970A02446C89F1F0D7FA4992 DIAGRAMA-DE-HERTZSPRUNG-RUSSELL
143,581,146 *0DC4F44C46843DFF788F33731041E92C028E603D DIAMAT8
143,581,147 *0DC90069BE90B6ED9A8516355F8603DFB78D23A4 BEYAVDERÎ
143,581,148 *0DC7EECE2A96C55B16B435C2B6A6BFEE762CA2E7 DICOESTACI
143,581,149 *0DCE19E859010DEA8ADEBA8D2E9D6AB0F403D579 dimerhj6
143,581,150 *0DC223A2178875BFE4B60CAE9240FAE2DBAEBC69 di/nd
143,581,151 *0DCEB1738D902E9CE8BE4F95238E5418CA4021F2 D’INNOCENT
143,581,152 *0DC21429F9B4EC9A4F1023AD4CFF079720008121 [email protected]
143,581,153 *0DC0A4D21835678037232DB6A0B6EC615B55852D DistinctiveStenchofEroticism(Razormaid)
143,581,154 *0DC3A1C3CE7960346D42E50319FC2B1A4C074C17 b%f3&
143,581,155 *0DC5DF7F7D5742D751F9FCCDDC1D5934F001B64B DIVISIONNAIRES!
143,581,156 *0DC42914E16A53434AE0B2260923242AB5C86410 B.FHB
143,581,157 *0DC055E7CB28E11085C815E572FAC26246429AE1 dkbx
143,581,158 *0DCE739FACFC4B0AC0C4E21CFE47DAD09F285017 b"gpk
143,581,159 *0DC15AF6B6E53E9ED2D13A28D56AFEF2B9553CC5 b(h"
143,581,160 *0DC6D38B0B021023BAE4965632F39CEFDFC25CBF b#+.h
143,581,161 *0DC308FD0E1075477E0A9466267836CAD5D76F2E dl-d
143,581,162 *0DC8EE86537921A497BEB7B7C01963AAAE0E07FB DLE%R
143,581,163 *0DC689516B1C2FDA99CDC278597E53FA49396759 DLI0"
143,581,164 *0DC2CCB5EB1207722ACC5F7CDBF33EE210241B35 DLIf
143,581,165 *0DC8A27BF91018DA5A1054ABEA323012EE563437 dlobmur1
143,581,166 *0DC83B975E9A509A526210CD32D49DA07189590E DLOBMUR1
143,581,167 *0DC10211AFBC20F80DC23DD010746D879CDAF862 BHV/F
143,581,168 *0DC638FBDD6EB487142EFA56FCA985A6C567B41D dmiy.
143,581,169 *0DC4E5E3C797D074740CDACC1DD944B643E42474 BIGJKW37
143,581,170 *0DC924089103ADC7CB037CCEC19F60A3EA4D9057 d_)nb
143,581,171 *0DC7BEA29B4CAB7D29B7D8957B84E9A5765FA929 DO87T
143,581,172 *0DC4C06995A7ADCAC43F612E40E99AC4974B9BB5 DOC-BANKS
143,581,173 *0DC7719D6F61F4B9CCD12123F862CF2327724D50 dods?
143,581,174 *0DCC5A98E7EB1662A88329865D2ECF61B13E2779 bisaknosp
143,581,175 *0DCFF742E7C9F94E4F4EAB182EC8336113BDA70D bishop
143,581,176 *0DCD4F7EBA9D9ED48F0208300AC16CA7A6872B3C DOlC
143,581,177 *0DC1A5066FCC2634DB6FB877782B73936464F6E5 domenicwaelti
143,581,178 *0DC5B945D2B962C825CE916FBE14BE7535A2383F domidl
143,581,179 *0DC53CBE4C11F63535C175A6061C8180546FF0EF DOMINICKGERVAIS
143,581,180 *0DC4E37B074705A01AD17BD47AAFE8ED4F47D4B2 BK#8I
143,581,181 *0DC8709984303E2222B40EB4F3DE72A801D99865 BK=JT
143,581,182 *0DC0A495D6A51BF6388D9C34191E476F168D141A B=KP&
143,581,183 *0DC06BC89306B185468DB5896441D4C3614A8F34 DONALD CARLSON
143,581,184 *0DC3BEFBB6B3E1C88B1C5517BA038D14A9C62047 donna.major
143,581,185 *0DC05247393E214158F70C8EE8D7D6C26770554A DONYELSTEAUA1234
143,581,186 *0DCB557D56E908EDCFC151056677463D5B80615C DORSONASALS
143,581,187 *0DCEDF546A7DAC92A5F464D0DDD26775362783FD [email protected]
143,581,188 *0DCAACB4700D4D0BF30080478A8DC9734E98C279 bnpdz
143,581,189 *0DC5849963245023E673AB5BF66119B35F98D47D DQ4P
143,581,190 *0DCA949075990193E6C8AECFE5A89E1C368C0F62 [email protected]
143,581,191 *0DC2DF6CA74579BB5841182322AE2FD645A65DDF DREW.WHITING
143,581,192 *0DC7917F14587EF8B9B1A826599773DCF25708EB bombeamos2
143,581,193 *0DCBB39513E0D136D09C01B1FA6563581DC36027 BOMBZIP6
143,581,194 *0DCFCB7543016F5181F09743E26C77DC741F4001 DR!HD
143,581,195 *0DC3D266EEAC7C40E2B032C91FD146DBF39A456D driblets
143,581,196 *0DC43D2221F783679E953EC60705FB2BCB33BAB4 drksq
143,581,197 *0DCEB4E9C67097BBF7113A5EED63272198F4CA2B DR-W?
143,581,198 *0DC4140EB475948F389A1EE0709266E7A4EE5547 d+srb
143,581,199 *0DC435B1CFA3207829B5976D33D40878C14693E6 bozespri4
143,581,200 *0DC255CF4D80F46B1CBA533F2B7B8158D31BDD43 b######p-`~(^_~)
143,581,201 *0DCADBA0CA02ABC2530E2A5BF8F57F6002F484F7 bp8"2
143,581,202 *0DC5A4378BBE42A342E3AF1422F3F72704BF78D5 duhuskers9
143,581,203 *0DC9A4CBF5ADC0CE3714CD1250E3D874FC234678 BPI35859
143,581,204 *0DC47121892987CEC950F9172D4B48FDC27A30F0 BQEEH
143,581,205 *0DC61CBF649CD5ACCBA254FFDA43A9B6518D52E5 bqj(v
143,581,206 *0DCCDF057C008658EFB21FE03DE303BBDB4D7EFF b&r0
143,581,207 *0DC1A3EB10CF699AA8D83EBF5DF06CCBD5EDDAD4 bradan
143,581,208 *0DC42325979D8CECE98CB7408DE0520F81182D14 dutchjohnson&darrylpandy
143,581,209 *0DCC4395F2BD7AC417D97B4F39B74D251A06E823 bradymieles
143,581,210 *0DCA9F5D6BE97FB4BC2824392B14586BF9032B01 D)W)B
143,581,211 *0DC739C54BB989532A8F18A91A65E00C0D523756 BRETT.ALAN
143,581,212 *0DCEC96541B1782C89C56FB2A5E3100BE02C6AD9 brianarod
143,581,213 *0DC6A5CC38BF2FD213BCBC3668ADDBCA5E1958B6 BRINGARERS
143,581,214 *0DC0C5445E8A1145E4962C655F579F7CFD320000 BRMM8
143,581,215 *0DC120F838D9FF5EF3BB6CB363FCD9A418835404 DZBDQ
143,581,216 *0DCC94421DF123025CC5F3E02E413486A0AD43BE BROWNBANDED1
143,581,217 *0DCC63A3FFBC61A0BA919E03C31709DC9393D45D eamonbreen
143,581,218 *0DC84077AF1E2977EE2F7815D906A0D9A8DD70B4 BRYANT.CIHON
143,581,219 *0DC897141FCBEB7702F190D1DE15F33D02EE61F2 EARL.BILLINGSLEY
143,581,220 *0DCB3FF582D76D1AB052C4F42D4F7BC7DD84938D b#tk.
143,581,221 *0DC04C7AC11FF041F68347B915C5FDF03F5DBD0D b,u;8
143,581,222 *0DC8BA215F172AB23EDF857171AB12594CC94A91 BU8ER
143,581,223 *0DC680BF71447076E8C460DD5131795FC8696B08 edisonbenninger
143,581,224 *0DCB938BF033A873D0B3B6D063794F3B532C8992 edmondcatozzi
143,581,225 *0DCD3467F14CAEC6D94E96A5BEB1DD907903A352 BUCK.LEHRKE
143,581,226 *0DC7D5B2D0444E6F9E3D3D4A2D7040859192A687 edsiegel
143,581,227 *0DC90274A2EC8F728ECD267704C81287F7AA8ACE BUMKT
143,581,228 *0DCA4968EAB6C52F5FB5A1BF460B1C43AE5E7714 e(feat.FreiburgerBarockorchester)
143,581,229 *0DC9ED310CD1088AD18EBBC03A39101C504BBF55 BUSTERCAYCE
143,581,230 *0DC6D470016DD11212ECEBBA44990AB91DDFFEE8 BUU;
143,581,231 *0DCD2A5C876102EC72DD628C564C70ED1B571631 BvBF
143,581,232 *0DC6C22D6FC10383344624E92D9D109E7EC9A49D bw9nn
143,581,233 *0DC5E0CF886555946B6CBF39B0B8C259199FA0FF EIUOFNE9
143,581,234 *0DCB0E27BBBA48E058AE73AC7F9435E9211298F0 bx:7g
143,581,235 *0DCB38B7A36A0AD2663E34D6C030AD27C7DC3F08 ELAINE.ALAN
143,581,236 *0DCAF852D478151035C43F2F05A29D68C5A3650F ELEANOR530
143,581,237 *0DCE5EBBC87D8403205FF27E86F74B89C7307042 BZV"
143,581,238 *0DC557CF91447B87096CAD592C73879036D658D8 eliaspears
143,581,239 *0DCB5845DC2ED22B073AF4E6C99043F9481B9559 ELIJAH.CLABORN
143,581,240 *0DC17901F5F77A1EF323CF750253B0CCC7CB563F elijahguiski
143,581,241 *0DC8DE269B76B3B3DBB0BA5DAD583DB7D984D0FD C0NT35TABLY
143,581,242 *0DCD136BF68054D60EAE5A91733B57BC53914FFE C1=WO
143,581,243 *0DCFD5C685E2C666D9489E733A570BA4A2E354A4 C3!NM
143,581,244 *0DC590A3EA459D1A44A6DF4626662FCE884FAF68 C47!H
143,581,245 *0DC55B6BE3B6B2FB6BE05AAB53EF8FB226BF73AE ELLIV
143,581,246 *0DCE13CEDE94ED2FBC0417F0E1E6526116712C0E ELMEGI
143,581,247 *0DC0078810EDF8E2D91F53C8805C81D9F7FD36B7 ELMERAM
143,581,248 *0DC6E58A5D3641AC83B0DBE71D0EACA0EE78FA72 ELMER.HANSHAW
143,581,249 *0DCCC62DAE22F6AAAC232802AE4E429687DE0492 elmerthe
143,581,250 *0DCAA566BCEC70F3300E7700D40D91EBDC944741 c5rni
143,581,251 *0DCF8ED47E4974106533CF1CA3DF60B6BDD98E27 C5#SK
143,581,252 *0DC22671DF0AC96021FA32511850A065D99AFEEF eltsackc
143,581,253 *0DCF5187575084BA2DE8CDD3E6AE009346338C89 c6v3u
143,581,254 *0DC1ACB793BA7816D9B2D2D6AC5E3AD4BF8FC9B4 EMANUEL.MENDLER
143,581,255 *0DC201C0D9B2688A5B1B160F7FEB4AAB319CDA6B EMERGIR5
143,581,256 *0DC8AF25A6E2615F9A24EC736E661A7F53C6FB0A calvingerrits
143,581,257 *0DCCC712F1A3A3AD8205E29654290C67279E70EA emeryhearst
143,581,258 *0DC5B196A4589EB6AE47CE67A0F3494B2BB3DDB8 campigotto
143,581,259 *0DC5CFA005BCB6A156B6905F3426BD3A4A67A4BF EMMANUEL.CREACY
143,581,260 *0DC51B29BAE5EE8C2C1DF9C4F3AC4390AAAF83CE Captain.Vincible
143,581,261 *0DC5F8417A125CF80DA1142CC9932AF6C45076B0 EMMETT.PAPPAN
143,581,262 *0DCE22AD349A39D11925BD4476334B83AEEA5897 caravaginus
143,581,263 *0DCA8005FDB7366AE8FEBC7F310CBF8B9B4C3055 en6sa
143,581,264 *0DCAC2DA0E510B1772987ABB5C7E70A46BDFCEB7 [email protected]
143,581,265 *0DC3EC2511DC5B2795373A32B7C296BBA8E84545 ENHUMORS1
143,581,266 *0DC9C55712A337AF7663686CD0A66C63F41159A8 CARLOTTA TURNER
143,581,267 *0DC42D342645C121422352C3B7EE705D86761CAB enlosadas8
143,581,268 *0DC5FF5C72B1F4A7AFCC1A1468B2338625352770 CARMEN.PATZKE
143,581,269 *0DC36DDB2A3563D0CF051F2DF0AF64433E5BED74 enotarteted
143,581,270 *0DCCDE25D74715BCBBEA17616D63C77FCFEB3C2D CAROL.BOUSUM
143,581,271 *0DCB2FF9E9F74A7E95F855981AB7C9D26B15A6C3 ENVASRAMOS
143,581,272 *0DC3BF541A83C79C177AFBF285793E9C0495EC2F CARY.RICKARDS
143,581,273 *0DC2A690F6D6D9222B9C98C5149160088A73468F CASPERROPING
143,581,274 *0DC846C2D765AA6F5371F8F05A06C5E30D3DFB5F EPIGLOTTAL123
143,581,275 *0DCE92EA947B48E1111FED582339FBEDECEF6619 CATRENEE8
143,581,276 *0DC2BBBDB1BFEFE182A7D768989AB8C2A39BFBCA [email protected]
143,581,277 *0DCD8A09BC86259107A343A32B37FAC0CCB36EC5 cb(ho
143,581,278 *0DC5D3583ADBEB966CE8BC501FB3CED77B70D0DD CB+J7
143,581,279 *0DCBE4320B1787D2554A0244976F25973726CF5D erickchiras
143,581,280 *0DCCC0FFC79553FE4947422319C76A89F44E431A CBZBW
143,581,281 *0DC5A72B9D7DBFF6AAF5FD167996E65099D150CB cc_#-
143,581,282 *0DC32C6F5B27727BBA3312DD03C1CC234FDB5C40 ERIOMETES
143,581,283 *0DC33E34A3AFF0D4B921B31BD432177CC376E514 CC.+;
143,581,284 *0DCEDDFE6AC2C5A4C3CD9A814E778C457D9893D0 CC,A)
143,581,285 *0DC4FB79D138C938C617F53CF52ED5F25B134C83 C;CMV
143,581,286 *0DC40647590832CE3926E88C7D41EDD0F6812723 ccolocco1
143,581,287 *0DC751B8E7E708D5AFC8D2767CC1D8C631807101 [email protected]
143,581,288 *0DC088B5B44525C8860679D7386BBDF9C565BCC3 ERSUAREH5
143,581,289 *0DCE15C0ECD3620E64A339CA93042012A0E3817C erw#(
143,581,290 *0DC226202CC30FB452F99A722830D938F38BDBE4 ERWINPICERNO
143,581,291 *0DCA957079F4B65E20A22DDDA67E735CA7EFA96F ery(#
143,581,292 *0DCCC6A19BA40B542A57E491A9657516EA4F9AA2 CDCI;
143,581,293 *0DC40D5D222D9DC9D877DBA940C05EFA7280CEFC CD:E&
143,581,294 *0DC5618F32E8E7E67A3163001236FE9F04AD17BC cdnn%
143,581,295 *0DC47104C5F0DFEC7127D00221247D6E94B1EBA0 cd.o
143,581,296 *0DC3C39C0ACC58EA637792E45C0E4FF4DF1C9F33 C,%DS
143,581,297 *0DC8D8379650BEDD8D1BA2B0ED563431F774B5D9 cea?r
143,581,298 *0DCAB6312AD4BA7A7AF61A8D9EDD091D6CC19B7E CECILBYASSEE
143,581,299 *0DCA0AEE8C7D86088B04ACB36460C6D6930037AA (ESOTERICISM)者、文學家、畫家,
143,581,300 *0DCBACA82B53319561D030153EB604DF2B27D05E ètáoed
143,581,301 *0DC5C40BEE50C2C721E1CC9A0792B0A7B4F49885 ETCO
143,581,302 *0DC2B5DF5AFA5EF949D382E4927C413CD3BCA3CB Eternity-(Is-Over-Me)-(feat-Carriga)
143,581,303 *0DCF156CEDA34D6D377E8291B785FCC6AF6B76A7 ETGKN
143,581,304 *0DCDE1F0DEEB79914A92B4FA655A5FA8E5B68715 cft$"
143,581,305 *0DCC996B1AEC35E289E043A5B37985ABED411060 cf!tf
143,581,306 *0DCEE45C15E07D3520728CAE5FFFA3E89601D838 cfum$
143,581,307 *0DC5352C170559BF57549C637EB18664F77C5724 etx4;
143,581,308 *0DC8E20A6AA4775301646336E7161F90F9A9D19B eud9-
143,581,309 *0DC4FF12B92B72E6BE1A81D597FFB890FE329EDC EUGEN1C4LLY
143,581,310 *0DC556E9CFB7C2D0053D51DB3A9A48F5428E87D3 EUNICE OWUSU
143,581,311 *0DCA8D1CEAF5209DD45566D0E6C8E3D0AD310A6B EUPHONIA1
143,581,312 *0DCBEEFB919734D62FDB4A9037BE3481D3FCCB6E CH4RL4T4NR1E5
143,581,313 *0DC6D311D90B3ED8895BF5E072CCDDD995562031 chadwickmcwaters
143,581,314 *0DC20754B6A35CDC5994E41495B816E9E6A2F2CD CHARLES.FINAMORE
143,581,315 *0DC94489225A60F9E269397429B4273F9BB4ABA5 exempli
143,581,316 *0DC88D0E2B24887DC16E69F168994C00899DED47 CHARLIEUHL
143,581,317 *0DC85F32E437249BFE126675C1BB70A9AEFC5224 EZRA.MONETTI
143,581,318 *0DCCF366B16BA881840F445B1EFADA2E3D316C63 [email protected]!$7
143,581,319 *0DC35AE58B57986C020610669202F7DF076E418B CHICO242014
143,581,320 *0DC1A06CA5667A9E36F072EE25338B9BAB0410B3 fbteampalestinian-israeliteam
143,581,321 *0DC6746B957EA1BE54F8B36E073D80FC8AE4CFDB FEDERICOMERRIGAN
143,581,322 *0DCB1EE508B0535EAA54CF1B175EA17432EC9998 Feel.The.Need.In.Me
143,581,323 *0DCD25AFC40C888BD3B262FEC03E90B53C7E53FA Ch$q
143,581,324 *0DC4B567EAACEF49D4AEA06D80A6D9B37AA44E68 FELIKAHU
143,581,325 *0DCBCB5101D45E2C2769182FB0CCFA81FB70C3DB chrispurswell
143,581,326 *0DCE393052433FB7A2AF3300E33DF670B89A5BF4 ci(9(
143,581,327 *0DC4A0A6F243C9E48ADCB4C13CD050B6FBADCDBE CIAFV
143,581,328 *0DC0183EA1C15D8AD88B5F99140C53F7FCCCDE4B CINDY-SPEIRS
143,581,329 *0DC1E6D46AFAD59DE26D3B9812DE2723053EF2BB cins!
143,581,330 *0DC22AAE8ECBB5059DA6BCCC0347F0E3447877E3 ck_(
143,581,331 *0DC661250C31B8FA04235B8AE588392AF35DC123 FINEARTS.CO.ZA
143,581,332 *0DC78088F8CB4018BF57497A9DB91516F18C78E1 [email protected]
143,581,333 *0DCE1D8F6131BDD1D8AFF34C8501B88E2E41B0C9 Clarinet Sonata in Eflat major Op 167: II Allegro animato
143,581,334 *0DC4A55AD0D9B60654761954CEC58597A24A69D4 FLICARI
143,581,335 *0DCFB04B323381F7C04CC71CF67EEF220AFF3D65 FLORENTINO.PAULIK
143,581,336 *0DC5273C5E6AB67539A30003E01A711ADDE28193 florizel he neither does nor shall
143,581,337 *0DC8D4B9BEFB33E8A41DCAA3174155D4276557BD flunstrip
143,581,338 *0DCD887F39D6EA7E6ED3C20C9BB53152B2C26D3C FORSYTHE66
143,581,339 *0DCA8F65ADD49E32664670CF51F235815CD3E8F3 FOSTER.SIMISTER
143,581,340 *0DCCF15A501BC00EDF118238C9754F2133DD5697 FRANDILLAC
143,581,341 *0DCF36A9CC513627E3AE5F2B2E2A975D104B9AEF [email protected]
143,581,342 *0DCB29934B777EA00A01E51DA8F83F880D9F3216 CLU,U
143,581,343 *0DCB42EE9C3AD7A8B6FE88AD4E0FBA012A31E3EB FRANKLYN.ANASTACIO
143,581,344 *0DC72EC10B2EBEB44838DCD243311C7706C1BF62 cmio
143,581,345 *0DCB5819519BFADA6B41841054CCA7342F5079E4 CMPZL
143,581,346 *0DCCCB7407247748015E55813ADC3F84FDD121BB CN8RB
143,581,347 *0DC038D51FFBF406DB84979D82EE0924CBC6F65A CNAFQ
143,581,348 *0DCA089A3BE585DCEA41D83B750F209BD296F472 cndw-
143,581,349 *0DC38308866863A768249FEEE9039C49C584230D cnew
143,581,350 *0DCA0210C643BB4C1B7BFDE95ADA9FE6EEDF6B82 cnk2
143,581,351 *0DC8C344396B0D95288580B6F2F17AC02C79730C friendsofasmile
143,581,352 *0DC0B82BB54FD0767C23AF525583C272E2516244 cocinaderumania
143,581,353 *0DC30D5D112C451D949F1C13E1B204278498EEE3 cocoapple
143,581,354 *0DC8EAA918B5C7F9C15992384976FD5DAF3A8493 FTHENNES
143,581,355 *0DC35EF274065A7769CC418DEFBC6E22FC30CEDF COELOBLASTULA
143,581,356 *0DC2DD42DC054CCB208A09BFF7080BA697533223 coelorinchus.denticulatus
143,581,357 *0DC27D15810C7F8DA987A36EBD46C90FB58033CA [email protected]
143,581,358 *0DCA2CDCAA27062CFD69EF6289CAF89CDBE5801B COH3R3NTN3SS
143,581,359 *0DC092F8210868826C76C7CFEAD37A005651086B [email protected]
143,581,360 *0DC43BAC7502F88D79D441F45B93D926373AC7CB COLATINA9
143,581,361 *0DCC9B8CE14EC76C90B39F6D0A51EF03707E35A7 FULQ
143,581,362 *0DCCF61F6256FD43D8B5E4A506F882C8766F558D colemancromeans
143,581,363 *0DC8FA401484741C501758AE4652909A67094E76 FUSTART
143,581,364 *0DCAE913FAC769E55B850B3D99BA13AF3EA44307 FUTURELOOK
143,581,365 *0DCE45208DACA337F685E3BA7A1BB6A49EB927AF commcorr's
143,581,366 *0DC38FE4BC8801D536A6A11257EB1BA3D3997982 COMMENTPER
143,581,367 *0DC162BA572B25C43EC3D9861A9F2AF73E3D6121 FXGLOVING
143,581,368 *0DC0B0371154DA63FCC4E45A4B7056E4027F36C8 fysc
143,581,369 *0DC50CACCFC9EF1EA31B2222E2650413076AD595 [email protected]
143,581,370 *0DC97330C6B1E7AA298C2B8B45476A1A33E25B38 CONCEN7R47IONS
143,581,371 *0DCF716CCA0045DA8281202DD6B653C8F8CE5899 [email protected]
143,581,372 *0DC8334F21AC41487ED44B8D41C0888B758BCE9C CONSIGNO
143,581,373 *0DC97673A12B6204B34B23A81423A9237227E4EB GALECUSHINGBERRY
143,581,374 *0DC2D64329A1FF887CE432BC41296269D4361DF4 GALIGUISES
143,581,375 *0DCB0ACBCA660157A6143BDA3085EF0DCAF48C22 GANCEREI1
143,581,376 *0DCE538743443FAAFF85F4476D8482CA09ADD5C9 GAO.NIRU
143,581,377 *0DCF9C2BDBF8FA01EBAD1E0BBB3122ADC03C9101 GARFIELDGUION
143,581,378 *0DC82D8E2375517EB57BF061D6B3D6D42964BCE7 garfieldsypher
143,581,379 *0DC2AB53E22E597CECE29F092534DC78F2EFB2B3 GARMAȚCA
143,581,380 *0DCC1CB61E674CA9785F5DD19EF545CA54B21FD0 GARRARDS2
143,581,381 *0DC6480D24CF8CEE741D18ECFBC40DD9FEEC90F2 GARRETNOGUEDA
143,581,382 *0DC595D5E3E62E4E13D561A48344DF99D4490B0A GARRETT.BARGERSTOCK
143,581,383 *0DC2CCD3ECB2F51956DBB30ACE6479B327423363 GARYZUBRIS
143,581,384 *0DC0D2744A65511B7658CEE0544B6E5301881D5A copeicumple
143,581,385 *0DC4220A5ABF428C100A0CBE5751C2B14D6516CC gavinaguire
143,581,386 *0DCD8F4A392255145FF9F237B31E5D4392F987F3 CORNE.D'AUROCH
143,581,387 *0DCFB6BC71F956A7E8CD76D23962538FAC8BFC77 gdtm48
143,581,388 *0DCBB54A8A4D344AD24622CB344723926E8C2FED CORYWASKEY
143,581,389 *0DCB4F944F9E9E186F84D29611F5CE82A87517A4 gegharkounik
143,581,390 *0DCE79FAB08FCF25C99B1F9A6CD18B9E858FC83A courtneytokuoka
143,581,391 *0DC2685CC393D098DA8A962864EA494EB0AA1B4F GEORGEANNE
143,581,392 *0DC58D6EF197D52850D320C272CC574FFDA798F0 cpe3
143,581,393 *0DC26F29AD220D9F04D759ADF89D2ED3A735BAC5 c:\program files\microsoft sdks\windows\v60a\include\ipxtfflth
143,581,394 *0DC7B9D7BF9976576E8F790AC1C32D3B0D0F1E74 GH-ORDER
143,581,395 *0DCA510E2207C5D0CEA8242376CCAF53450806E7 gilbertkrumme
143,581,396 *0DC84C08E20EE3782CDDDBFF3C801C694FC0CD64 cqhia
143,581,397 *0DC8605A272AC38F4AE5C1F46A593676D4FD67CA GIMPCONFIG
143,581,398 *0DCBB7DD65B069CB9E2542E5931E025A1416940F cqlv.
143,581,399 *0DCD778408DBB80AAF38E28FF53C25D72C2688CF c.=r
143,581,400 *0DC03B82676A3E6CBDD03D8385ECAF4F1942F521 gireitmra
143,581,401 *0DC2D824AA7E02F189D291A73D75665574C98D65 GIRLSAIN'TNOTHINGBUTTROUBLE
143,581,402 *0DC8B842F3CF4BCD4B89DD83A9C52435C5664CF5 giuseppebilotti
143,581,403 *0DCCCD0D582D30CB975D9CCADC26181E9EFCA99A c(r,a
143,581,404 *0DC25AC33E668AD2C229769178145B35ADDC20EA crane
143,581,405 *0DCC229B8F163AE4BD4C47DF98071FA26CC4C56D [email protected]@S
143,581,406 *0DCF72C7584201A5DED08969B2A1B2DC7ED927B9 GLENGOMEZ
143,581,407 *0DC04836ADF55CD8D3DDA4864D15B7BC3EB48B97 gnipuhs1
143,581,408 *0DCE92A95264D40661FA3C760C2CCAA6BCB15872 CRISTOPHER.NOGALES
143,581,409 *0DC2A4A6450705213CB94EC66A3192133D7910AA CROMOPROTEID
143,581,410 *0DC4560C49C6CDA29745D238BB32C385AB6CDDD0 crr7:
143,581,411 *0DC982DED541176ACBDA17A3C4F17BE38D0F90F5 CRYPTOMONADOPHYTA
143,581,412 *0DC8549077BBC51CA40D479B288F2A3A1C9E2531 [email protected]
143,581,413 *0DC6C64F8BB82BDACEB1DB63113264D226ABBFC6 GOODBERIG
143,581,414 *0DC78CCFC2A7FF936806FA597CF9EE951093A513 CTHAS
143,581,415 *0DC5DC64E8E1A28094B1549921FDAF652D96ACC8 CTlc
143,581,416 *0DC267C4C396E98898320F4807C0066CF55908C3 CT,)M
143,581,417 *0DC0B24B09CDF8970E009CDEDDDBCF5EAD0B9A97 CTY!.
143,581,418 *0DCB2E0A9288D9578A3AD196713D771DAC5287F4 c:ugu
143,581,419 *0DC75472C32C5957790F098B83C43719FC5A47E1 [email protected]
143,581,420 *0DC2A91BEC66959B290819F8BA94ECA51DEA5669 cuqg9
143,581,421 *0DCD897E4B0FCF0D8CEC3D23A77470B9FB70EF39 CURTISANTLEY
143,581,422 *0DC3CD39C50A2363EF2FE79CA345382C4824146A CU:S
143,581,423 *0DCB1395AB30AF0E270978910609B4870704F988 GROUPFUSION
143,581,424 *0DCD7BB343CA5F4635445499BCEE9B318B80854B CYPHERMOX
143,581,425 *0DCE74889574BDC14DC3E0611724853A568604E0 GRUZIJCIH9
143,581,426 *0DCE6A1D4D5B2730EC4E365E1E98FBEBDD0C8680 CZZKS
143,581,427 *0DC13FA1D4D7644430E3F6AACB9FAA16563E92F8 d0052a
143,581,428 *0DCB4BB5E42DD642761882FDDF3858457FA77B7D D0Y%
143,581,429 *0DC623924541EF395EB3CEF6E7EBD34FE656D301 d1i!p
143,581,430 *0DC08065FD02D3CB32DDEB2769E22D664431E9CB d:2q
143,581,431 *0DC3D26B449F373D02BDEDB9D59854677A36C642 d3lv5
143,581,432 *0DC41C45062AB5D159566C109E834CC4EDE56E63 gum-t0p.t
143,581,433 *0DC0F1E7FB962AB30FF0303FB83C68CBCF9DC11A D4WNW4TTS
143,581,434 *0DC373E735F71A28EA2E7CCEC97764D29D02C8BE d64$s
143,581,435 *0DC47FD0AE4DB4E6CD693D26F4F93541E9DDC870 d6dgp
143,581,436 *0DC59A298053F2C310B14935C31279C239F7BB19 D6W1A
143,581,437 *0DC43942FAEDA18CD5A76209F9756BE6E35D169A d7p6
143,581,438 *0DC7322124D84434085784C0A729F4932132A264 d9kk3
143,581,439 *0DC4BE038B2337075E0184C3D5EDEFDE61EEF6B8 daf6i
143,581,440 *0DCA04B0FF0BBFF3E57F5EA2F42AE672A18D794C DALIA658
143,581,441 *0DCC8DE9BF4EC453015EA9BC54788817B836525D damianchene
143,581,442 *0DC7B0C2EF9148F87F65AA7D2CB857C8D04E3C25 h01bb01
143,581,443 *0DC676F2A468B590E348F0B0BE9432C4536EDAD5 DANIELALEJANDROO
143,581,444 *0DCEEF7ACF4C36D931BB88C399AB092048015231 h41$en
143,581,445 *0DC9DAC71137D3160F12FE4B400F8F2FEF4EC880 DANILO.GIDEON
143,581,446 *0DCFF454C52715B7F792226A897589AF5567FF5B HAIDER.ORAKZAI
143,581,447 *0DCC8A4232C8A1D699CC65700DCA3C4536E5F6BF darrelquiggle
143,581,448 *0DC41C2921C06D46D10F52896618A385B14D3483 [email protected]
143,581,449 *0DC0671A85B8234693A3529D8C93338CAC8D7066 HARLAN.DOCKENDORF
143,581,450 *0DC60BA8A6116D080E15953A660850434F5EBDB5 dataverbindingslaag
143,581,451 *0DCFAA59E16E96B0B686D18FF6472B192AF15BC7 HARLEYKILLIN
143,581,452 *0DC468DAFD548C59A43CE89F7D6012D91A4505DF DAVELONDONVS.DJNITRO
143,581,453 *0DCE17E3B00F9DB470B166443E644B3B7D969E11 harrisonmulero
143,581,454 *0DC6F0C00CF5E550EFA874A0C4AB7F269DCD8581 HAYDAR123
143,581,455 *0DCACD0CC9B9B8B5C36DC5FFA58921B2EACA47A4 HAYDEN.BERNARD
143,581,456 *0DCF3F36E57C6635F2FD89FB35F0A5190043E3B7 [email protected]
143,581,457 *0DC5F8743CDF3C10ACC27997E56171669B3F4158 D-DISINN
143,581,458 *0DC7B80A36457150A232A8328E1322BD9DCED5EB HEATHER MARGARET JONES
143,581,459 *0DCF341AA52BE57BC40DCB3A48B8EB41F764F8E7 heather-vanderzanden
143,581,460 *0DC3E80A3E0EB0682696A8252D0B0C5B86D5F642 ddvn=
143,581,461 *0DC77ED2D33395E95D14D5853A79CDF502395CE6 de4c!d!f!ed
143,581,462 *0DC269BD9CCBACFE8BEE34775C048E9A16802A2E d!e.a
143,581,463 *0DC03409ED4814A8B47EBD763A2F393034FD0CA8 !HEIMAR
143,581,464 *0DC764F6E128D33C042451520DE133CD0CCE60A2 deandrecromie
143,581,465 *0DC59EC85A0C9217A451550C5FDFE98B006BB47D debbiekrug
143,581,466 *0DC285347891F8855A61DB8840D6676AE4152575 DEEANASTASIO
143,581,467 *0DC59093AA94E030D4D4433FBC12B0ED8F3DD02D DELUGEW5
143,581,468 *0DC3D66437F9370A2BBA700FBED3B20A8097DB75 heston7
143,581,469 *0DC7DBBBF07D5C742BDE67EBD97831BC0222BF30 hezrobsw3
143,581,470 *0DC82AFD8790DC954E4AC43F86DCDEB5DCEFD1E8 HFH9
143,581,471 *0DC92BF334800C46A46CC37DEEE189AC79A463F9 denisvanasse
143,581,472 *0DC47D8D300F6EC6DC29B27DF393F56B76D25771 HIGURASHI160
143,581,473 *0DC71C96F14AB4F314A2A6C274C70BDAE48D4E08 himzijas
143,581,474 *0DC7D0C18BCDC1452EF6B668E2023291476CF5E7 hitatibe4
143,581,475 *0DC74A8429DD2D54A840EEDFB9C6BBA9F1DC3B81 deongilyard
143,581,476 *0DCA1F12BCC98C069D4A6C7E15C85AD9AA885059 [email protected]
143,581,477 *0DC6666F8C16CFD3EFDEB1971D457ACA5E5DFFAA DESMONOSING
143,581,478 *0DC1CFE1C151F8A9CCCC8E3764F90C47D8AF8A95 DESTINATIONSMAP
143,581,479 *0DC0D5753116DA03F5CB0E1A28B0C06995AE9465 DEWAYNEURSUA
143,581,480 *0DCAB36A39651FE286869F3296430C7F453FDA87 HONORABAN
143,581,481 *0DC3BEE971F61408D337D239015934EFBF7799E3 D$FA
143,581,482 *0DC09E7789C8856B07E7FE21BD872EF3B16C070F horacedecost
143,581,483 *0DC3B096B050B6E49908C81D1C650DB38F9A503F DG&R$
143,581,484 *0DCD5F8D34AC568159E46F1D90EA52FC6F62DF07 di-&+
143,581,485 *0DC145E854229FDA7F9782E15E8ABD756C7E0BED di8#
143,581,486 *0DCCE37FB9790AE744411BE4AF08A51FCAFC84BB HTIZEBNI0
143,581,487 *0DC5BE2D4DD712B856EAC385EC13BEEE5541D332 DICKCHARLETON
143,581,488 *0DC618AA921CC7BC3668734CCE4420AA2A68CBE0 DINDESSEDNID
143,581,489 *0DC64BAA284931B5BBA82FA96897C948BE286A61 dirklachino
143,581,490 *0DC52300FC2F926ED609647A3E9CFFC608641A5A DISCOMFOR+S
143,581,491 *0DC17551E2224B9269335A1EE63D6560E58CD51F [email protected]
143,581,492 *0DC6AA86F5D91D54A64A5C7B3C34EED52DB8A036 humbertotoppin
143,581,493 *0DCB854043A635E751F738F37B5160B6C4049521 DJ2G
143,581,494 *0DC25AC2137BE0B6D89B4D7DA05E2AC744388A96 DJB"J
143,581,495 *0DCF29838E07898B7C9F2616E975D0303690CA00 h+|z
143,581,496 *0DC63461923199E6CF7DBA8ACA1025A5A8B94455 iamclarkson60
143,581,497 *0DC71ADB94D30FB510D2B66D9BED32CBF86D4FC0 IAMCLOCK12
143,581,498 *0DC7F5636B64221562EB48F3A28D45FFDCEE99B9 iamhistoire47
143,581,499 *0DC134D6DE3F9996493C2A7CB936EB73AF72125E iamripper71
143,581,500 *0DC017D1C071B463CEC909F48DD408CC145D1B10 IAMTATTOO02
143,581,501 *0DC5FA66AC8E231F3857A550F52B5532E04C000D IANBENELL
143,581,502 *0DC09A2F522DB69F1B1418136A6B02E4B0B1EE5E IATLASOWITZ
143,581,503 *0DC60BBA7AA33CAF8A604F2DF34641A364F0F6EA DlC=
143,581,504 *0DC5850C91C789A44092AD21DA08FCEDCF7C0D6F D:L:N
143,581,505 *0DC3CF2CF3790EADE6514D8A79C13289A9A4CB57 DMFFE
143,581,506 *0DCAC80920C29CDC09621E05053F53CEF01F185A D:NB+
143,581,507 *0DCE9D3A7CE501CD3CD347284E65DC69705E8B4C ICELANDIC-CREATED
143,581,508 *0DC7473616D66B46B2B768AA58C3E68F76FDABE7 IENKREISING
143,581,509 *0DC50E7EFD83FCE9A89A7868C1E141DB44939032 DOLINSKIJ
143,581,510 *0DC21932BEA6997AAF32F4DFB2D233C975185B07 domingotuason
143,581,511 *0DC52F39B8AAC5467D4C440DD56FEC10F288D582 DOMINIQUEJANCIK
143,581,512 *0DC9D02ED304F6B2CFBE67F0250C993F535DCE11 DOMINIQUE.MINERO
143,581,513 *0DC75FE6209A07F59F63A44E77E3F45B3390E6D0 DOMINIQUESIAPERAS
143,581,514 *0DC26E8E28F162B4B807DD76CA7BD72031FCEB09 [email protected]
143,581,515 *0DC9B3DC4CB2870476FDA2CE387E1F1DAAD2976C donniemolnar
143,581,516 *0DC31E5FF15881753A7B0791108263E4FF896E40 ILOJGA
143,581,517 *0DC1BC10870FAC589845DC6AF8B44F8243CD0DF6 ILOVE3EEB0
143,581,518 *0DC024C3882BF8F97CF3B10AEDEB4DDBBC84324E I-LOVE-THE-SMELL-OF-POLYURETHANE-IN-THE-MORNING!
143,581,519 *0DCE7342589BF873017A064892E7A7EB7E85EF76 ILUVSINATRA38
143,581,520 *0DC116F7853FDC6C5F95DB9EC375BD66E06605DB IMEYEM
143,581,521 *0DC4285EA70B0E235F69307E1B749779C77F4EA7 DR-CAMERONS-CASUALTIES
143,581,522 *0DC63FAACA3BEE587E1D48F27CAAED5820DC3939 drissidaoudi
143,581,523 *0DC6D26F743787CC0E563934F5A108D9C7CFE57F [email protected]
143,581,524 *0DC2039C671B4E7DEB783318168689FFE55DA230 drusie2
143,581,525 *0DCD765AD1CFF76F0BBEE04E46E449D47158725D [email protected]
143,581,526 *0DC0788445DA28DA3A0321348566A8D86AD13844 [email protected],
143,581,527 *0DC040FEEA2A63F0F8EE938EF4827FAA13B932C2 DU58U
143,581,528 *0DC2610E0573CCFE856A7C30C9B82153A7223C92 INTERLUDE./.ANNOUNCEMENTS
143,581,529 *0DCBBCE09008D92A5D62A3944D796E5A097EB782 DUFFLE.
143,581,530 *0DC6F326FF419B07A7EA5F4FC06ADFE2281CEB95 dugl7
143,581,531 *0DCC73A756E48AD5167D5575571D48A07DAA6628 dujae
143,581,532 *0DC17821424039C9E0FE5F612EF0909E3C185F33 DUMBARTION.OAKS:.I..TEMPO.GIUSTO
143,581,533 *0DCD1388B046BE40A6D5E8E620FA1773A96DF71B DUYV%
143,581,534 *0DC5693C15F3B095DEC7888020998A42F6981A2F D);V"
143,581,535 *0DC1C519E2834B27817BA4CC8C09B96CCF762E5F dwightgodnick
143,581,536 *0DCC39FCC6EE23886176C486770B2C0264434E76 d;w(t
143,581,537 *0DC3436A33558FD42BF2A5335741AE94794D60B5 DWVDC
143,581,538 *0DCBE594A0F5BCD83003F08FC0E575B5A4076CB4 [email protected]
143,581,539 *0DC4719A256357B9FBD733BC0CD3922AC2775EFC I,SS
143,581,540 *0DC4FC29B9F3F2931411399420A085ADF1831A6B IT'S HARD TO BE TENDER
143,581,541 *0DC034D5B4374FF07FFE22EDF4D9314260B304AC IT'SRIGHTHERE
143,581,542 *0DC759855F33556D16B469C58135CC0A2996F2F7 IVAILLUT7
143,581,543 *0DC88099E24B1D5A5FA8A065185195B03E0A6A22 DZXZ
143,581,544 *0DC79897EE655FD738E2FA4EC95EFB65922AABC7 j6Z
143,581,545 *0DC370733AACC92297496F2F65A501CB411EC9CE ´jackmaster´
143,581,546 *0DCF701F2B04315396382D7A8426B9C52EC3123F JACOBAMOAH
143,581,547 *0DCADFF26819F33E45DC57ACA29B0F849838CE88 JAKE&JIM
143,581,548 *0DC2E5A4B32F9B7F0411A36393FD5C6EE1F25647 JAMAALHAACK
143,581,549 *0DCB8BC6522C9AC04BDBA7F473B8370D9D9088C4 JAMARDYSART
143,581,550 *0DC378125CA6AB26A17C62A112326B6D852C8C34 EAE4DF3EEAA73E028EACD097AF6A2B7A
143,581,551 *0DCD5EF50D2EAB3A31D37C2EF8537BB2D998EA06 earlmeres
143,581,552 *0DCD668A9A921C33B7A0422C19C11A78387716AD EDARWARE
143,581,553 *0DC75DEF9AC3B568389A59D68EB3F2D3005AB74D edc,+
143,581,554 *0DC92668776557A97D08E3340014ABF7BB7364C0 JANBALAT
143,581,555 *0DCC52DFFC2A7A43D1E66CF29A635FCDB16949A4 edh8h
143,581,556 *0DC977CAAAE214F4B4862D78195E7DA79BAE1053 jarvissiregar
143,581,557 *0DC15BB588D59665E8043952BC1DE6EE4C459A44 EDNCG
143,581,558 *0DC9F7E245E9241805FCE1DB7CCBE6DD2C30060C EDNEYVIL1
143,581,559 *0DCA516A95B0B81ABAFE8F0D3EBBFC58FD35A1B5 ednlefie9
143,581,560 *0DC3087601A05C249CCF91A19AA33BD8480BF3A8 JAYTONS5
143,581,561 *0DC5487992552F11EE6DAF5572B5F50DFED4B276 EEASIERING
143,581,562 *0DC8CA13B52A62DC7687CDB38865CCA56D2A01B4 JEANISHAV
143,581,563 *0DC2013121C590A657E56127179560D3B1BAD2CE jeanloomis
143,581,564 *0DCC40AF9389B7FC1A4DECC5BAE129205704D955 Jednom.u.gradu.ko.zna.kom
143,581,565 *0DCF3A1EB217FE13A552F44E75D8B4DE7DBD0138 ehr+
143,581,566 *0DC4CF3C9975D6A77AA88461529A5D534C367981 EI8E
143,581,567 *0DCCB29A7CDCE10DF517EDCCED6DBB5BA0CFD429 JENNIFERDENOUX
143,581,568 *0DC13CCF4C8ACFA48DB61F2A32D6EABCF486D3AD JERALD.KERINS
143,581,569 *0DCFF3FB576980589B13AFBBE4FC48A42FD38129 EIUME
143,581,570 *0DCB55555D6E8826C3D366A782C188E96EB9CF54 EIWID
143,581,571 *0DCC75E2C49894C19FD0807AC54B1615D5CC7120 JEREERBY
143,581,572 *0DC69DBC28AF8C661ECD70A27ACBF28EA198D030 [email protected]
143,581,573 *0DCC0442D3900693B9F987D396739A796FD0F204 JEREMY.ZARITSKY
143,581,574 *0DCCB061BF2F98EE74FC30155D80A21929987B44 JEROLDCAPRIA
143,581,575 *0DCD15A1D8503511AB92E5C4C4A1AF416FFCD4DA ELAINEBRAZIL
143,581,576 *0DC796B6C712804C25BEB3D32DE4B2A6CFF5DAA2 ELDRIDGECISAR
143,581,577 *0DCB5ADB043D204C23DB42B15558E53481B8AF5F elegiaca
143,581,578 *0DCAD83F10E8E747C6782CDA3010A4CFFE59DDAD ELEPHANTTINKER
143,581,579 *0DCB927158D21F1ED1404E3004880075B1B21D65 EL GORDO Y EL FLACO PEL
143,581,580 *0DC945DD0B3E26E6BF99D14740D9E2D94BF278CD JESSE.RUTHS
143,581,581 *0DC8AE256EB8D317ACAF97CA4C0065D8420561CA ELLEND.
143,581,582 *0DC07B11D8E31EEF67B2B47232B88D108E706A18 ELLSWORTH.FRYDAY
143,581,583 *0DC7A425753C1DC7D00C5AF5EC3215B3A12DFB29 ELLSWORTHUMBDENSTOCK
143,581,584 *0DC7346BFBE5D2E3E7B5EB573964F84E8D4DF995 eloylorr
143,581,585 *0DCABCE0B43419C9586B0BFF787CC568A938E923 ELOYNEELD
143,581,586 *0DCE6FBB54732CB6079DB87CEF16D6A4FBF1C344 [email protected]
143,581,587 *0DC35FF16B201C986B6E8095A886A4F8A135738A EL&PC
143,581,588 *0DCFCB62B5BBC62EC7C80E281ACB516626D5DFCE ELTSURT8
143,581,589 *0DCA41F60B77A232F9391EC624C257BF39259B73 JIMKALENKOSKI
143,581,590 *0DCBBCCA36B8090E792E42FDDA1669822D0B6AC5 em1sw
143,581,591 *0DC36A7F138C634A670C24C5466359E97B08D19D EMBGL
143,581,592 *0DC2F4EA10B78429DAA226EF8999D8B3D936955E EMMAROLAND
143,581,593 *0DCCE41165126B4C55B2D68ABC15AE3A08483FFD empitiez5
143,581,594 *0DC1A163FE0B98B51E8BF391CFBD7B9B0F71DC97 EN71250592
143,581,595 *0DC9C269E9F5A3DE9AFAC383DC02A917AB847F48 ENIMHARB2
143,581,596 *0DCC6C317E3C950C1DB72EBA9C43B47EC03A5982 enn17
143,581,597 *0DC387E11BC3CE9E3455372603BC7CA6A1584DF4 enxh%
143,581,598 *0DC02DB0F3E8BEC394D4D8AB91AFA954B98A6DF7 JOEPTE6
143,581,599 *0DCB640FF805C4D0504D62583CF59B579DBC7C7F EONVENTIONELL
143,581,600 *0DC86B3A4870897EC21B0C49636ABFFFA0E94BE1 [email protected]
143,581,601 *0DCA909DA1292B184DF0D161E48FF7B289ABA4CF epypleon
143,581,602 *0DC18E3BA59240A170EB4282F094BF8BF6E74821 EQTDR
143,581,603 *0DCB8E8AD286411F91080E3E305E6FFDBAF36DEF JORDANKRAUSSE
143,581,604 *0DC6D8B2A46C34DDBE51B2DB46F826CB89DDA956 josehelmich
143,581,605 *0DC04DEA351F855009A06A2CFA4D77DEAAE39886 ERICKBERGSMA
143,581,606 *0DCE59B09B88C3BE9C5AEF7DBCDC14A4D302BAC0 ERIEL RIVERA
143,581,607 *0DC8CC9591EA3DE39B799522DAB453B0ED091F29 „ERLAUBNISNORMIRRTUM“
143,581,608 *0DC7F3C202582A2094C2F8FCAFCE467B7ACED6A5 ERWIN.BRINDA
143,581,609 *0DC2313319E70CCE12A264483542523EB024A524 ERWIN.KERNIGHAN
143,581,610 *0DC759A58F696D361C089BA805647D4F39A74BE1 [email protected]
143,581,611 *0DC4EA2F5731E5C28414F76680DED82AC1070920 ESTF
143,581,612 *0DC1A6BF39793F64B13ACAE505458F067A17CC55 ESXLL
143,581,613 *0DC384F6DA2F739223912C611758E114D9D12631 juliusboender
143,581,614 *0DC150EFB5561BDAC55918571D63CC95130A5E99 ETTMISEN3
143,581,615 *0DC5AB7C6676BB3A8C8BBA44ECCCC6529DC0102D JUSTINSUPERTRAMP
143,581,616 *0DC643AC7DDE56C0DB087BF8C12DBC6FFFFFBE0A eusebiosporman
143,581,617 *0DC1BAC960214A772224CF672683B7C3962FAFBD K3JU4NST34U4
143,581,618 *0DCB8CA5E0A9075BF6B01BD9F1D49F2BEB0A847D KAAREPERE–VISUSTI
143,581,619 *0DCA830CD0B7EC180147B0DBDBF93BA9560C69DA exempli
143,581,620 *0DC88D0E2B24887DC16E69F168994C00899DED47 kammerthater
143,581,621 *0DC4031D2599F47E015A185408AFD84288257D38 [email protected]
143,581,622 *0DC91972172896B2BCFC129D9783DCA0DAA4F628 eypf-
143,581,623 *0DC5EDA55B0C44523C3DF373B5C3A7C757D9A4A1 karen-brickey
143,581,624 *0DC68F8AFB2A63B1B272A94B7C3545341037FC40 F1ND415
143,581,625 *0DC34A591A0C6FB3C221A7F09027EE3355739495 KARISSA-MALOY
143,581,626 *0DCAE1E9402E96342EE6440DF747466E30873993 f3114+0n
143,581,627 *0DC8F2426DAE90D47D3D464484241EDF8868AE14 kaseysweere
143,581,628 *0DCA1E729B16C641B9CEB8FF11A81D665566A20C KASPAROV.RUMATERIAL.
143,581,629 *0DCB46651EA577524E392FEA1DFF656141723E53 kaspofungin
143,581,630 *0DC21F694BE6ACACEB2BD949D87FA64886E22A2E FAITH-IN-THE-FREE-(FIMA-REMIX)
143,581,631 *0DC48972CF46A41403D126220BDD443A4AF9787B kattyretolado
143,581,632 *0DCACCCA8BCB9433EC59A16E33875CEDBBC6D5D7 KAZUYTHZ
143,581,633 *0DC86FE4C481DE043DA3A77F2C86F30AD53CC653 KEITH.BOADY
143,581,634 *0DC5F2808DDBD0512F8471A58FC255901A41262B feels-so-right-(b)-:60
143,581,635 *0DC70BFE92F998D442A8F34342809DEFEEC70120 FELIX.KAROL
143,581,636 *0DC3AB462455F1CB8B9D4A4CE073C82EA7DA3958 FFAIZEEN
143,581,637 *0DC5790D499F536CFCAADA82515BB062A2AB265F fhstfhst4
143,581,638 *0DCD089C5D512E4D937E0559E4A33D63ED37614C FHTX
143,581,639 *0DC62B9CAAB5F961AEAD587A59B46E23F78E4FF4 FIGHTLIKEAPESMUSIC.COMWWW
143,581,640 *0DC0515C381144470AEFA2232410638E8CF17DB9 FILIBERTO.PINNETTE
143,581,641 *0DC700E9FEE1FC97AA25B5A57E6CED2E7EB59FC8 KENNETH.GADEWOLTZ
143,581,642 *0DC83A1FC44E911C95AD80996F7B461954356EC2 [email protected]$
143,581,643 *0DCB38D29CDF06A7842B612C8EC4B4632DBCC258 fish1joey
143,581,644 *0DC73C63F3C21DE66D46D5176E0B92B6BA361037 KFJAHIS6
143,581,645 *0DCABA7430285109B5B883250F18B5E82E86760F FLEGETHONTAS
143,581,646 *0DCDE492E42F593F8FA7D17BB2B24F2DB41CB344 floydmantell
143,581,647 *0DC3FADDF2817745D89DF7A927708AD402E2073E ˈKILƐNTSVƐNØT
143,581,648 *0DCC84797AB2FA1E4DBE445EF62C2AF14691DA8B kilmak
143,581,649 *0DC2F5C32283E3AAD7D0890DF8EE87366D5E00D7 FORCEJON7
143,581,650 *0DC6EDEF24E771943BA2C7B326D25C8329694F50 [email protected]
143,581,651 *0DCDA482D880323D12CA7245353D41BDA150BF3F formatiert!
143,581,652 *0DCDA3CF393F6E9A52C95BF27E410C1692BC182B KOLUMNOKOM
143,581,653 *0DC087FF0059B5A05D62834316057B35B4B56937 FREDDY.ELDERKIN
143,581,654 *0DC5BB27B56FB6017654206BF067835E62861087 KOMPAMPANIA
143,581,655 *0DC30D51F87D8AFB6F8315E2291BFC1CE926226F frederickjerez
143,581,656 *0DC104CD315BE211D4CCC991ABE40F7C6915127C KONTOSID
143,581,657 *0DCE2C3F2993749EDE3E3FB9F094EE34732509D7 FREDY_SYAH
143,581,658 *0DCD4092A39F5B7E27C2CF08482A9F9678B7F416 FREITZ ROYALES
143,581,659 *0DC0F016A7CDB399BBEF7D64876283FEE6F90F3F FRIENDS OF DAR (THE PRINCESS KIRI / KODO, PODO AND REU)
143,581,660 *0DC2F3E39542175B70BE8BD538980867E308A641 [email protected]
143,581,661 *0DC668E11F0011553162AFC2E7C3EAAFF1E96C5F KURT-ALLAN
143,581,662 *0DCE99D084E6E5151EC54C6F8212068ABDE54929 FUZZLES
143,581,663 *0DCFDC3AD396B5BD9F8FC99689CB417BE87813D9 FYEINGST
143,581,664 *0DC7C1F8EB19BE19744290465E8ACDCE1D7B1F6D G]?
143,581,665 *0DC960874FBC92A24A72AF245D58168E15F9B7EF KYOUNANE
143,581,666 *0DC9FA8D28F966AD22E2494B9B809BB569D0078B la-bambo!
143,581,667 *0DC883A99F69D6A61818BB8C16A3E971649E022C LACTOBACILLES
143,581,668 *0DC02E31440C41DAE7FF2FD48FDE2B32E8DF9424 LAMARSARAH
143,581,669 *0DCC5774767C51C1F931D6C62F899C79E0E181C8 LAMASSE
143,581,670 *0DC1933CEBE2557BE7832CB81A36CF16091DFF2A GARTH72
143,581,671 *0DCD283AAD351799520728230AC9FB189B32EE4E LAONA
143,581,672 *0DC3DD9210F1E254DF91F7AFA7A55237F8B7719F gaylordsantamarina
143,581,673 *0DC01BC08F30CC27DF4006BF3EE7E42F76AD187D GC52481
143,581,674 *0DCCAE25723189F45B7106BFB9BD6FB024202C7C LARRYTHEBEERDRINKER/THEBANKSOFLOUGHGOWNA/GANAINM
143,581,675 *0DCA1A349D118CB849B19247329D462EDBAC2514 LAWTALK
143,581,676 *0DC610E4910E11649CF8F7CF1E0B79F34AF4D2B3 LE9!7!M!ZA7!ON$
143,581,677 *0DC62590A5A72E8CCFD709D537A362357C86F762 leaving-shangri-la
143,581,678 *0DCA77529D7AF4CF98B8532FA4ED15836BE1E911 LECTRIFIAIENT
143,581,679 *0DCD4A3072A7A07C36DBAD0A26B1969982C73ECB GEORGEANNE
143,581,680 *0DC58D6EF197D52850D320C272CC574FFDA798F0 gesparr
143,581,681 *0DC2C5173723F78840C7AB2121A7D8DA7F830E94 [email protected]
143,581,682 *0DC0BDE4A959E16533062A7213DF2C8A6A01D66E [email protected]
143,581,683 *0DC93B779E8CE6BD843C910FEA05812EE8AF55FD LEIH.SEBTAHA
143,581,684 *0DC522CD33DA3F247538220987A2D25217D0A01C GIATTILAS
143,581,685 *0DC9EB06D4699722F48D75C4FA23D9269AC28C12 lelandberwald
143,581,686 *0DCD07CD9F06CA7D2A20E8590E5C139113F47DFE GILBERTMCMONAGLE
143,581,687 *0DC3D5C22FC0F193B347138CE93F546A0C675633 ginovojta
143,581,688 *0DC24A3140E56C8E802136BD82869604D54B02FB [email protected]
143,581,689 *0DC88A1796482D2924C15E40487A5670651E9808 lesboseses
143,581,690 *0DCD527A93893F06686989867DFDED75B2C005BF [email protected]COM
143,581,691 *0DCC28BFFB23E2F6C48260E5A5C77FD65F5C2550 lfen.(here.comes.the.hotstepper)
143,581,692 *0DCD7A5422D4E65E8EF771D4ABA357FF06BEC04B LIBERTEMPAJ
143,581,693 *0DC0A082AD9DD5F6921DA04E518D04014FFF5B7B Life-is-a-kind-of-chess--[[Benjamin-Franklin]]
143,581,694 *0DCE391A7DF4AC006669B0D9832378071A9F0C78 [email protected]
143,581,695 *0DCDFC8FA4B7437DB03E83FDCEBF5BEC5A5393E1 [email protected]
143,581,696 *0DCFEBE83745BD4E5CF88589EC00EE4319EEFC52 GREBENSTEEN
143,581,697 *0DC79B5722BA13396A3AA270177980B383835440 gregoriopolcyn
143,581,698 *0DC36C05E33BD83F3BA86273417E79782D90E0E5 gregoryfrump
143,581,699 *0DC8AD1BB94D5E6C878CE4DA7B9A3EDC41F233FD LINCOLNSTOBER
143,581,700 *0DC00DA937CCEAE8BF5CA582D0F3CAE2887E4841 [email protected]
143,581,701 *0DC6A4B97A56F77207401F9FFF645AD26EB9297E liquigas
143,581,702 *0DC669143940F791BF39B94196435D7192D44F35 [email protected]
143,581,703 *0DC3A3F6762CF8A60BE7F65F08B656F5268D50B1 GX,M
143,581,704 *0DC885018EBEEB39C99901E09B2258FDFDEB6A52 hakushaseishou
143,581,705 *0DC3027EC00EA39292ADE7BF9A8373E0642EBB31 HAL.BUCHHEIT
143,581,706 *0DC9C18157B9E1367B158202B73FBF0E0247938F hanktaglialatela
143,581,707 *0DCB8F53FD2D4290E7751A1FD9103B17889E589B LIVING IN THE PAST (B)
143,581,708 *0DC7825113CA83166E5D4C5D44603606DC5C95E9 HANPAŞA
143,581,709 *0DC08F01AE363EC1B10B16142CBCA9DDE6BC74CE [email protected]
143,581,710 *0DC03C5BE95EF352DB4BE5A1AF73E22C821871B1 HARD-SUN-(FEAT.-SUNHOUSE)
143,581,711 *0DCDE9DFA37DD8DE37002AE67772BDA32EF5BADB harlandsealock
143,581,712 *0DC67AAA63FBD5DB5D4D5C5F21E1E3463044D154 [email protected]
143,581,713 *0DC8A3A24083DBC48053A769EA1ACBE40F52FAF4 HARLEYGALARDO
143,581,714 *0DC7BCC0AECC7A3CA01F4673C9B836DA26864211 HARLEY.WIESEN
143,581,715 *0DC6056A8BAFC0F4EE8D666F8E8C91C78FCFE50F harrisgieseke
143,581,716 *0DC7E554072BC50C831F33B71D6AE4A5D93F90EE HARVEY.FOGLE
143,581,717 *0DC622E96EB0EFAEB594E14EE737D8251BA95FA5 HBHS
143,581,718 *0DCF8BBDD4CE636C94274D71A1034ADA2D22E688 hcamp
143,581,719 *0DC782B4047E9ECC98243321B84394CEA70BD3BD hcivekru3
143,581,720 *0DC7FDA7E665ADC6E68BA3421BA5466B815CE69F HE"
143,581,721 *0DC1F4042CB503F33BE3CC74FF9DD17764F9DA3E heathercalvin
143,581,722 *0DC1268E377E87159D2938B8EC515FAA965964F9 logankaye
143,581,723 *0DC7BD415D095DA9A6FB73B9560BB5D432A7EDC3 LOLALASAGNE
143,581,724 *0DCA5A8E05208AD86A31388588A77C6BF47C9E95 [email protected]
143,581,725 *0DC8E23E01F8D7AD101769B1E77369CC84E85E26 LONNYALBRITTAIN
143,581,726 *0DC827AF323E909B57CBBA3078BC2C85CB7567FF lostatsea
143,581,727 *0DCA6A95344C307E91F021D65791B7842192C46E hgzs
143,581,728 *0DC0186A43B86EF0920A1033E7FAE016CA619B43 HIM467677
143,581,729 *0DC46CADC2B071B064F04FAFBA5DA43E0D2A21F8 LOVELYONE18
143,581,730 *0DCB8CAD34137DCDE9D03D8F45AB66468B9BE389 lovisolo3
143,581,731 *0DCCA13174017ABC4F19BF849F31F8810A2E9334 [email protected]
143,581,732 *0DC5CF4B12A27957970CCB487F666AD2EFD5CA31 loydathearn
143,581,733 *0DC5D49E34C5651B98571843913053A7F7050B79 LSHORT
143,581,734 *0DCC62C68D132CCE040B6C3E96C417F2D06FE456 LUCIA-VIRGINIA
143,581,735 *0DC19E8603290F7BF42FCB14BD4A1DBA6532F4D7 LUDIHWOT
143,581,736 *0DC100C0A7CC5ED5DCE627A43C772A644EC15C29 HOMOIA
143,581,737 *0DC3A71683504E213A0612F998DF868F9278DC76 honungar8
143,581,738 *0DC6C6BF27DFC8222A5529446F0A99C5D2B44988 HOOK AND LADDER (FEAT RY COODER)
143,581,739 *0DC3FF4AA440F4EF23EF9F355AFC5151C639B33C lyndoncorvo
143,581,740 *0DC4006B0AF3AD3E89D64F67D66714A9439DBCF0 how's-the-level?
143,581,741 *0DC702EE42C11BF2097CBD72CA813B6BCE607581 M0N4PS4L
143,581,742 *0DCB8124E0B4054C6A355F61EB9121A82E09D17B [email protected]
143,581,743 *0DC98AF12B232776CD51B3AD8501FEA94A6648D1 [email protected]
143,581,744 *0DC0D32C019ED02EB5537ABBEC8660DDD72DBA5D MADAO
143,581,745 *0DCA0255490A737B05D94C62C7B04DB284A811B0 mag1120972
143,581,746 *0DC0315DFD4759F7FDD152905C6914FEA2876CBB MAKAUL
143,581,747 *0DCF55E59D920B41CF1ADFB607755B3E94A24EED MALLINNUSKSEEN
143,581,748 *0DC0C4E13E572392266D7BC11D15F4EA39894F6D I5778
143,581,749 *0DCDFE1CEB65C6240071DA0B09F805CCC85AEDBF manalyousif
143,581,750 *0DC08D6C8ADD38B4CD50BE2CB28B0626CD400D33 MANGEASING
143,581,751 *0DCF66B7582C47B43CEDCA48CA053200466C03A4 IANGOWDY
143,581,752 *0DCD565E5467DCBEEE8BD251F0A9548DB43F920F MANUTENTIONNIONS7
143,581,753 *0DC8890D2955A9680276BF8B6167015D5ABC4573 IARECREMMOC
143,581,754 *0DC4111F91FD49C3755C40B22C135F42112E6985 IBMATBSW6
143,581,755 *0DC54220D97AE05E04F77C5A44C8020E9DFC186C MARCELINO.ROSARO
143,581,756 *0DCD33C01275FD05FABDE2EB7B52433FF0A8CDB1 marcoevertsen
143,581,757 *0DCF1CB68FCC23D6448671CFD5F7D0F00722197F marcosleftwich
143,581,758 *0DCF516E002B1DC3E817045124DA26CD1F5FB73E MARIANO1924
143,581,759 *0DCDE7D141EDBCF5ADA51A8D1E3774F2A8476D28 MARIKEBOTHA
143,581,760 *0DCB59D8ADF6D051AA12D19A5A317187A09FD7BF IHIOKARU7
143,581,761 *0DCF686366267C5193450662BA8AB582F859D7CB MARK.SHALHOUB
143,581,762 *0DC19978DB6170241EA1B647845293C9724AA6BB MARLON.PESEK
143,581,763 *0DCD41C4D1473807F61EAFEEA64F3AD08B95ED1D MARVINKENNEDY
143,581,764 *0DCC5CC86BE90D9D4A2A2848F43D87438CB7B992 MASKORRAK
143,581,765 *0DC3C38197469A763B0AF3A6E349DA106336CAB8 ILUVDANCEABC
143,581,766 *0DC4D941CCF0C082A93EE9E0FDC56B1991D36416 iluvredfish92
143,581,767 *0DCCD1A68B9EA8CA51E50D97202BB08F8F17F1C6 MAUZOLEUM
143,581,768 *0DCE586FA0C98D7AC374FC23CE37CE67743CF985 [email protected]
143,581,769 *0DCD5B0AD4FBFCF1C4E29E6FE70AE8074B7EE961 MAXIMOMITCHELLE
143,581,770 *0DC4507D8B7EB6189AE2EF429A5B7BB8816C6454 [email protected]
143,581,771 *0DCD2E7006FA119C51929327F42055459D9F24D1 IMPUTRID?
143,581,772 *0DCA7006BC531A60024694FC04B84626D5F74CAD Incandescent.Innocent
143,581,773 *0DC7203B6D8C4D293B5F6F9466CF35D4F259816A INDIA9.COMWWW
143,581,774 *0DC165D0D32F451E75C75B0BEBBBAF2C5A7DE01C INDICIMUSED
143,581,775 *0DCC640D4CA3AB497B548DD9A305B3B36DE79813 [email protected]
143,581,776 *0DCC9E8BD29EB017E35C539867A33489DE28992C MDELADIENNEE
143,581,777 *0DCDB7C5F3457F9BABC59D2156F0B7871231CBA6 meeting at strathmore / lumps of pudding
143,581,778 *0DC2C016A7424C77FECEF45FCE9486F52636EBDA MEGFOGALMAZANDÓ
143,581,779 *0DC8E5E29E8475B9B936770F199734928A4C257F MELVINWERY
143,581,780 *0DC94E4A05409F9CB93EABB635667AA539EE4807 merlehapper
143,581,781 *0DC2C5D989CCBCBA72F2CCDBA2F83C1CA570770F META-FACT
143,581,782 *0DC29979AA9A3BA2D1A8CB8DA0543F85603EFF10 MEZ.FARIAS.CHIHUAHUA
143,581,783 *0DC8070AE8E76E8768AAD40DB7458F3DDDBDAC4F INKVIZIN0
143,581,784 *0DC2B1A5CF67A3CF43E31CC466729D08B26F7D2B [email protected]
143,581,785 *0DCD9AE424DB7280E5905FD3B2996F22A1CA0733 [email protected]
143,581,786 *0DC6BA120489AB25CE8425C3FE105ABC07C9FF63 michaelbrokas
143,581,787 *0DC4E4136B1A176D4E437C960FCC5C166301697A [email protected]
143,581,788 *0DC1F515D060CC00E2EA9008A9E8317F43F115AE MICHAELLIGNOS
143,581,789 *0DCAC0B632D8E6B7CECA2454BFB154E8B5642D45 michael.oana
143,581,790 *0DC88129550F7BA72327C1E79A3C948F3329DE85 INTOTHEMOUTHOFGOD
143,581,791 *0DC9764931491C60983BC093FF407AD198C57174 INTRESSESFÆRERNE
143,581,792 *0DC8074961EF81FE8C064EBB994148B50645D91C iramuhar6
143,581,793 *0DCBF9A0D9D1D58A8E97BC5F2F3AFE1395CACB9E MILLARDPHILDOR
143,581,794 *0DCBDCD90A4F4BEB50557B2F54610C8CF26FBEE0 iro-politikus.1
143,581,795 *0DC2A019B28333C82FB4543450C29AF051E494DC MILTON.BORLING
143,581,796 *0DC90E05D993FB82C64BED462881EB6293CCB9C7 MIMAGOLITA
143,581,797 *0DC5B7C2671C1B0E0B251750727115503A889327 MINER
143,581,798 *0DC44193951C9A113698161E581C3FB8AB1B006B ISALISTAS
143,581,799 *0DCD5FC64D47653F4106B20F21B26CA7234D14C6 MISSGEBILDET/A
143,581,800 *0DC09F4CC8E5A78D31A89402576BC9801153E6CB MK4E-ENGINED
143,581,801 *0DC38E2FC4F3C1ECE93D210016F9C6EAF2E35284 MMIMITAX
143,581,802 *0DC4CAAD6E56F005C6C11083CB45796A53A420C5 MOHAMMED-NADA
143,581,803 *0DC2CDA12E9A467AA86D48435BE0EBAC704C1DA1 monchyn9
143,581,804 *0DCBAD051D23209FD33165CA080BF7A458F9426B mondricuslindsey
143,581,805 *0DCD8FB575600D7F379B7309DE5EEBC3260C04D8 ISMAELKIRYAKOZA
143,581,806 *0DC30C164860F072D9761915CDAAE0FBF75D1BED (msm)--countermeasures-shall-be-identified.--a-technology-of
143,581,807 *0DC47DC0B7E36F4365650DA0F051859D54CFED29 Is-She-Good-to-You
143,581,808 *0DC8229BE12A1378A3B129BE38708CD3294A8029 MULJON
143,581,809 *0DCB86BC0C86B0C3F574B35EE81BC99C05E2D943 multitendriled
143,581,810 *0DCFF6754B716078371CF7C8910772C2D8C21CD0 mu*w
143,581,811 *0DC7814B67CE677D93F68301877A44184BC0939A [email protected]
143,581,812 *0DCFF8D27CD79747D0F4B593C81102D5B58E4DAE JACTOTSE
143,581,813 *0DCC9C2493322F11EAD43469710E3BCEA9ACBC91 JADEN635
143,581,814 *0DCB5ACAC43B2BBD550FADA3FA5BE8A1E6B7A0DB JALOUSIED3
143,581,815 *0DC63C558CA0084E7DE93C402713A1D8D5F84F95 JAME.ARVIEW
143,581,816 *0DCF18842F7FF3BF99D769D53717E8C49ED1330D JAMISON.CAPWELL
143,581,817 *0DCACAA237435CC28C0238482FF19CB578B8E4BA JANEMARILYN
143,581,818 *0DC7525F033CB75D95A7B1968EF0D4625AAE18E2 JANNISBRIDGES00
143,581,819 *0DCE0369BC6876AAAE65E218298A3295043EFE69 JAQUANBULLOCK
143,581,820 *0DCE36B8A6B51CAD636F87FF6218990D1AFD181F NATASHA.SHEK
143,581,821 *0DC41231AA2CA3A0CF836C242BECCF9FED4F07B0 NATURE 'DRUM & BASIC'
143,581,822 *0DC4C27BEFB1E012080AAADCA44311E71D8F0D1B NEG07!470R5
143,581,823 *0DC65B0F8333BD733F0CFB8AD33E3C40F14C4A94 NEHCTSU4
143,581,824 *0DCF9D1CD1F6C81AE32679FCE76D86464D2CBEE0 nekkertgnilap
143,581,825 *0DC004F90C3E5B79081B62A60B85F2957A1F4247 NETHAD:
143,581,826 *0DC0BB3045B47538E9FE0B01BE4E613297C5D1E7 never.(bonobo.mix)
143,581,827 *0DC706AEF7C17775921A5FF4F9BD9C613D8B2F95 nf:#
143,581,828 *0DCADF63CBA6B28DFA41B497B650B3B753137FA3 NICKOLASHELLENBRAND
143,581,829 *0DCC0FB9AC19608E565504B4B5424FEA01231DBD NICOLASCHARNEY
143,581,830 *0DC8386083F6212B3345FD24F5319A1EF88BD466 NICOLAS MATTON
143,581,831 *0DC8C8F143D3D737B853CE145E6ACF80CFD312B9 JARROD.INSLEY
143,581,832 *0DCD6949CED2DB022C87CB375E7AC54F21C86E7E nijburg
143,581,833 *0DCBD4EDE175C911D1769201956D4E5309D5BE72 NIR ZUKERMAN
143,581,834 *0DCD8617946B75BB5E903C5D3E68FA326696905E JBOLEDOVICOVA
143,581,835 *0DC94E360839E1DC4CAAE9424CDA809213C3CBF3 [email protected]
143,581,836 *0DC6AB014E0DA128C319C68DE84B6CC37A992E8C Nnovus-ordo-seclorum
143,581,837 *0DC1241716C448DCE0AC218CE7BE9B9C5CBA416F NO.7INE-FLATMAJOR,BWV852
143,581,838 *0DC481704939290B981E68945CC35956A09031F5 NOAHRYLANT
143,581,839 *0DCEA092C92CB315916EB83B0B162FBF09DF109C NOODLEMONSTER
143,581,840 *0DCCFAC62FEEC2CADA73FC21B138FD9BEC1F46FB notusedfriends
143,581,841 *0DC5C98063327C00F069A5CC4A204FA03DC79F21 nprdnbling
143,581,842 *0DC93A4B14CD814AE7EC1F103254C89DCFB63CEF nupur.tripathi
143,581,843 *0DCA1B5D30A56137D0FC4E8721E9218907E93405 jeffgrinnell
143,581,844 *0DC8C1212FB69436A36FB9285ABDB1BD18BDCCEF JERAMY.SWICKARD
143,581,845 *0DCA76BC10B70B7FD4DEA9EEB042E3ECA95299A9 OCHEGO4EVER
143,581,846 *0DC6EA1ECF7365EC57D785C93B0C435DDD9CF554 ODÉBBFUT
143,581,847 *0DC7F2D968618A41C20624E9BDAD69F6331EFD82 ODISBARSANTI
143,581,848 *0DC28F4497659F6B69DBFC0E5584970540F92B7C jerrodkiesow
143,581,849 *0DCD30391F53A1EAA40E9CF6FDF0346FD6052156 of a specific character, as shown in listing 13.11.<br>
143,581,850 *0DC36F9EFC7B1DEA5A06808436C1C0D7473EBA44 OFFERDAHL9
143,581,851 *0DC4A9B4261EFDDD103400784245904B131CEC47 JESKA-MCCANN
143,581,852 *0DC196D72ECAD800B64E48F12A2DBCFF87EECE51 oh.dayum
143,581,853 *0DCDF8187A506DB406838AD3A0663A2D2FEF3286 OHEVHVP0IBPK
143,581,854 *0DCB4B8C955D3006ECDE59D8F9186C07479A7A04 -jessik-
143,581,855 *0DC049EF54B79DA90800730C8460BEB5C216FA11 [email protected]
143,581,856 *0DCCB34140512FCB82B84B0508E15A057601B04F oikfotboll
143,581,857 *0DCDDFCE53BA5676CE42B0D213D4BEEBF6AC64BA JHGC
143,581,858 *0DC186DB7F8F1EC8B1B34304706D479AE209B0F1 OLIVIA-YULIANA
143,581,859 *0DC280DAD7836209C3E3045CDF1E7CE45AA5FAF0 JOAN.DERRYBERRY
143,581,860 *0DCA9F1F711B3755B890F856B161FDDDC587BC66 JOEYDAWES
143,581,861 *0DC7BBD742954A6B207B7BB7C4D8B22900F27297 johnathancagle
143,581,862 *0DC82CDE351B6759AA27ED591B0C9383EFB2941E JOHN-GRANQUIST
143,581,863 *0DC24E81FB6E85CC95DE04A5037060C89B4B50D1 JOHN.MC.HENRY
143,581,864 *0DC2296784922C5DCA92E97D7DA6A06316DB4CA6 )o( O~ qP
143,581,865 *0DC5F2659BF05444A341466E2C13C0B547F6BC0C opgegeten
143,581,866 *0DCB0C7AD682800327EF08D8F30C12B7BBFCEECC OPPIAMIED
143,581,867 *0DC8B2B7ED297BBF487D4B672393BAFDB14B4220 optimisteihin
143,581,868 *0DC32C112CB542B3EA89A37A90851D104EBF2523 ORENKITCHEL
143,581,869 *0DCAA25E624E2EDA4CCFF87BC5CA487DED1AFB3C orvalpingel
143,581,870 *0DC0321EBC1EB2B673343BBD8875CFBB24709537 OSTEONSES
143,581,871 *0DC535D2F0715843F26410D3427DA9329FDF1358 OTHER.BANDS.PLAY,.PURULENT.EXCRETOR.DON'T!
143,581,872 *0DCC047AAD5C51FC4225F595475CB29232A87CA8 jordonpatcher
143,581,873 *0DC428130D68381329A189C3B713B34B9C5E5DE6 JOSH CESARIO
143,581,874 *0DC13769579EFF37D032F489DDE636345108A0A2 [email protected]
143,581,875 *0DC6CA6FDD2228CA8D66923F2F75938D87E43820 jsniper7
143,581,876 *0DCF425288C3910C2B88F4AD8047C56A0C2D8F30 JU98N5
143,581,877 *0DCD1D199E67FBB648F10A4A878F41A60D9D33E7 [email protected]
143,581,878 *0DC70EE513916D47E02638A2552BAB1A2204515A [email protected]
143,581,879 *0DC6C9F69B51908CFB97FE1128AED466F1D8A473 juliusschrayter
143,581,880 *0DCE4805E33E0F664F890C4C9E184D760660EE62 [email protected]
143,581,881 *0DCEE8F0DB107F31FAA27AC6C6AF921BF90CA7B1 PANZERKINO
143,581,882 *0DCC2E8C1121D268AA388123D55D835B79159E02 JUSTINMALS
143,581,883 *0DC8D587B5647637A95512AF8422C3FA4EF20EEE PARTHOLON0
143,581,884 *0DC58A6B493766C6F881664D7157897A43C13C8F kade021
143,581,885 *0DCC0AB88AC7AA6FB65DAF301F41EB982A54D20D [email protected]
143,581,886 *0DC827C63E03AF758250D53B0585113CD872124C PATESTEB
143,581,887 *0DC97A493F5449156D4FB329DB5684FCD669693B patriciabounds
143,581,888 *0DC1C1519BBFC5259E008E1F83288230F7C922BD PATRONS9
143,581,889 *0DC48299BD2CF9CB999B96CED9A4B569ABB2B006 kaori-takagi
143,581,890 *0DC77334AA04B4B275FFE212556E0F376300D1A5 paulsaito
143,581,891 *0DC16ABDC9062A6141DAB469D22D1171A46BAFD1 KATHLEEN KINSELLA
143,581,892 *0DCECDE24451CA4441E29AA5D1FB12D32F1A793F PECKPECK
143,581,893 *0DCBF137C184491541A5942118F8D25360EF5853 KAYLEIGH873
143,581,894 *0DC6369BEFC876C2B5E055B906B4E83F790638C7 p$elaphu$
143,581,895 *0DC09690FF9DE1D814BABCDF8420A4B6CDF014F7 PELATWN8
143,581,896 *0DC0879BD7438587A750B540875322976D9E9C4E KBARSNICO
143,581,897 *0DC5B7209A79BC5E0DFD3E256ED17856FA5130B2 PENTOXID5
143,581,898 *0DCA9F48A9F386E175E2F615D25528FC8AFBEF02 k(cj
143,581,899 *0DC53BFFD9BB4636CDF3791816394284D7854795 PERMEABILITYYANDMAN
143,581,900 *0DC5CB7A6CE6D0494EAE50FD4C848D058CCFCC0D PERRY HOTTER
143,581,901 *0DCE898EF6672CE136C0DBE0E00EA7E65F5F2034 keepsakes.(disc.2)
143,581,902 *0DC450C30E46A507EF18B3B6D0E2F8B7A230F742 phantomoftheopera-alliaskofyou(aroundtheworld)
143,581,903 *0DCF4BCB2937DDE8F32436F8F280866CD1EC5FF8 KENNITHOMINELLI
143,581,904 *0DCB4E440128005E1D62301C0B4921736FE545D9 PHYC0X4NT
143,581,905 *0DCF0C58044EA3BFF54D190DEAAD9056384E4A19 KERRY.CUSACK
143,581,906 *0DCBB75468FB33F1033B64E37D8D812309F12430 kerstinphilipps
143,581,907 *0DC4B1893BE8C5415AB760155E5034550AA0C4C0 KERYJAMES,SOPRANO&ROHFF
143,581,908 *0DC6FEF71A3FE2ACF1B9A156D015B014C72E9117 PINK9887
143,581,909 *0DC8D4BB7B06E7DEAD3AA9842DA5FF23F2B5EFA6 KEVINCOOLER
143,581,910 *0DCA71A7E80E86358B89CA954CF283B31B92AEEA KEVIN-NAN
143,581,911 *0DC4F0E90439D209FD82B068F2F6F44C1656F58F KGBCBBS
143,581,912 *0DC1896A00493526605A410C3F327202715EE0C8 [email protected]
143,581,913 *0DC696A1CB1F9F3B6E87EE4989452FDAB080D5BC kimberlylubin
143,581,914 *0DCA6F5AD32C9FB42DB496FD349F5BB18FE307D5 [email protected]
143,581,915 *0DCCA2B542450BD8C8271B415B7F2CE11C313827 kimmie09
143,581,916 *0DC2E2E73B71561B9189091690E6D8DC1EFB0972 kirbyhuie
143,581,917 *0DC8D2203C371EE07BE6469C8006CC9D4D0D5807 KIRJOSIIPITANSSIJA
143,581,918 *0DC5B42A0ED0FB6A9A853FA73C19853E0E6B048A kirkblumberg
143,581,919 *0DC3C0E59988C665265E18B5442E9B96113003EA ?PLEH NOITAZILATIPAC DNA NOITAUTCNUP ,GNILLEPS DDO SEOD 32
143,581,920 *0DC08F8412D391097D7FC60130D4394B1357E133 KL40
143,581,921 *0DCD6EA4F2EB83A5A6C5C8989819D197D688D4B7 PLMAIS
143,581,922 *0DC6317051A7E8A36259144B31ABFCF4FC61D410 plnterromplt
143,581,923 *0DC929CB3D289ACEA7EA8C334828C587086785C9 KMCCRATE
143,581,924 *0DC81D6F2D80B7962C981C24592C58A36CAF2047 KMJNH139
143,581,925 *0DC0DCE1B96753C55C40A36B8E628A867C3BCE57 KOBPOLYANA
143,581,926 *0DC79EECCEE6EF39390BB888FDEA41037692ABA4 posiiiod
143,581,927 *0DCA51B3F1A6AA86F6593BD349D3D548C0FE869A „possession“
143,581,928 *0DCCDABD0CF8A760844A80D4E41E3DCD153DE9E3 POSSESSIONAL0
143,581,929 *0DC0110A62D6F737524EFFC00D4C7AE4F98F9A6A kommits4
143,581,930 *0DC977FC477F76AC6390518F23F2BE3B1D7E606C [email protected]
143,581,931 *0DC363641697C2BDB92C91BFB689F63A53122BEC pp~0splat
143,581,932 *0DC26B097DCFA0E8CACD4B30E3DA6C5010B991A1 KOREY.CASTENEDA
143,581,933 *0DCEF6C9256FF7E7385796B6FA2DBD750C4FC01F PP*}X{
143,581,934 *0DC9BCE40B3A63D60049BC59C1B10432BC5200D5 PQ<%
143,581,935 *0DC5A4C9BBBEEF6DA67C7DC594BCD56C6187651E pr3canc3rous
143,581,936 *0DC838E4162DF128366B57C75FC12E06D03A9D03 PRÆRIEHUND
143,581,937 *0DC03EA1BB1FAEC0D14A10E2320149712024F3A9 PREHLEDNEJSICH
143,581,938 *0DCC5C2F940F39F7611E6A7B89EACB7BF1649E61 Prelude-to-a-Landscape
143,581,939 *0DC841ED127D3A4A7FB4DF345EDD59DD79F5BF76 KRITER 1 0
143,581,940 *0DCDA1CC563F5653356C182320046BF7D35E3B23 PREQUEL
143,581,941 *0DCA7A5E0ABCFC52168B85E3F27DD560CF716C1D [email protected]
143,581,942 *0DC3B635FE5DF9E5DFEFE4CFFFFE396EB8C933D7 KULMANDER
143,581,943 *0DC09B0C394616FA39FCF684BC0C1BE164A26139 KU.MOT
143,581,944 *0DC87935CCEFFC32DF48A5A696313CCD3867D6F0 PROTEOMICS.LIFESCI.DUNDEE.AC.UKPROTEOMICS
143,581,945 *0DC453FAE0BFA708EC6E1205DB025B1BE1493569 kyle-markman
143,581,946 *0DC28DB87F0277BACC2BDDCADFD4D6524368D8E8 L4P51BU5
143,581,947 *0DC775EB74E701650B502AB190BF36A9AA242B0C PUBECENTED
143,581,948 *0DCC658986702BF5BCF68BB5F9F1257CA3DA6AD3 LACYVERUNZA
143,581,949 *0DC2373E584C09AD87F6C1E823CAA8A96F2D1508 pukimai6
143,581,950 *0DC7520776B25608EBE8EC118224887306DE1A48 “pulitzer”
143,581,951 *0DC513A06B2C6283FB17EBF69820FC0912B6FA24 pullstarter
143,581,952 *0DC1F7A0BCDF543D0CDC5970385A0F51C2DA11A5 pum2puy
143,581,953 *0DC3469313A5F41B7014965C1D428C16330BD704 PV_%
143,581,954 *0DC30587967759766EBD458E161644012394263F PYCRAL
143,581,955 *0DCD8DE691373C9F98B43302B5529F3AAFBD6A7A Q8;J
143,581,956 *0DC2E81DF770C13B118525E4A8BD9EF4F3E8D493 qcgwxvx41
143,581,957 *0DC4D586970402FE01D402BFB15AE0C80CDD594B [email protected]
143,581,958 *0DC6F977E8C45187C1FB598AD25FD8900F73A9FC Q=====D~O.~O.(0_<)
143,581,959 *0DCC3BA81C3CB7041303A749B2CD9B8FFD7A9B0B Q#####D~O~O)X(
143,581,960 *0DC3B8F3997BA2FD44DDE153C3B76EA2CAD524C5 LAVERNE.STOUD
143,581,961 *0DC2DFF4B2D532398E783668914DAD8D7DB274C1 LAW-LORDS
143,581,962 *0DCBC4DEAC16873D3AF3FA65733D68134058F912 lay-bozka
143,581,963 *0DCFD6DC82567F2DC4604132F700146FF957B4D7 L^)B
143,581,964 *0DC209E6F66C635853BD55267CD440FE7E41A1AA [email protected]
143,581,965 *0DC6E435A170142535B7B17E8002B4828B122534 QPLZ
143,581,966 *0DC98DE1CA0C6F64056E659BFF81C395BF56CD58 leahbroukhim
143,581,967 *0DCC11E9CE324C178E5E55AA96187914DF8E0093 [email protected]
143,581,968 *0DC98A8AC0C1366D2D8ECC929C169DFB8973A67F quantasaudade
143,581,969 *0DCAE692B3B59B19813483E9B3720DC48C09C15E leighgrauel
143,581,970 *0DCB8D768003858EBB9C56A3225D1F3F221B536C questraven
143,581,971 *0DC1325A36DA027E2B5737A1298AFF5C763DB924 QVIUKXCD96
143,581,972 *0DCE9D2A19E0FD07D73D8945141E6720C85ED26D LEN.POPOVIC
143,581,973 *0DCC1FDBE3ADB0FD99E7F70DA9B15B2C9F1346A2 LENREKNING
143,581,974 *0DC6AB8B54CB568BC65F2A65FC5583CBDFB21D3F LEODOBKIN
143,581,975 *0DC252C068E4137B234953AD61FA003787CEF251 r391st3r3d
143,581,976 *0DC9894A6698234C5616BCEE9D94914AFD7342E7 LEONEL.FEIGENBAUM
143,581,977 *0DCB75733F81873D91DB7E3E311E41602D7D663D LESLEY.MCCOMACK
143,581,978 *0DCC402DF207777DEABE3DB2DD39919C38A1A23B rachel.bellingham
143,581,979 *0DC7137121CA275A2D886EC7079AC2B3A6984037 LETICIA632
143,581,980 *0DC6C4442DD1BD0DF65E322D9FA995C7A4E6D55E LGPE
143,581,981 *0DCE91780AFBF24F14112CE36D8FF365FA5FF260 [email protected]
143,581,982 *0DCBC93932D6B9C1AD7FB23BCC0EF765D6E214CF [email protected]
143,581,983 *0DC219A6563342DD0D345F0AA384A388ADA6A8CB LIBERALIZMDEN
143,581,984 *0DC541BDA86CE851CEC356F91DC62AEB479DD87D LIGSALZSTRASSE
143,581,985 *0DC1A9ADAE3CCC95A02B3C43F6507BA12E657527 [email protected]
143,581,986 *0DCF75219167182A392FB4AF928CB5BD05D5E452 [email protected]
143,581,987 *0DCC4BCAC2B7F6A69B5FAF3E0C0197B1BC69E930 LINWOODJOHN
143,581,988 *0DC47FA80316FAAC496F78EB688C15C43007E015 LIRAI3
143,581,989 *0DC38E3678FE8AEE9BD7F443477884E0C79262AD liv-bennett
143,581,990 *0DC40E629D176DFC6EA6891393F05F4F395F2255 [email protected].CN
143,581,991 *0DCA61D6024147574A174E427173E0CEA96481C0 LM*8
143,581,992 *0DCEBFABB192D4F2EFF76926339BE410E20EECE6 LONNY.KIHLSTROM
143,581,993 *0DCCD0843C1A8767D29E4148C94B635D77F88A98 >rb<.:uoy.nehw.tseug
143,581,994 *0DC81051BF1EA8A9B500B8499E1C8D214145B8FE LOTTOSES8
143,581,995 *0DC493D15E2904A8858F31520589E06DFCEFCB49 re7ro9ress1vely
143,581,996 *0DCD597AAB285AE508495E37D6B80FACBAB759B8 REALMVALUE
143,581,997 *0DCFA60E4BAB9324C6BA5CD974162B9D182C0F0D REANNA-JADE-STEVENSON
143,581,998 *0DCEDD68126F75F71ACA70CFE2134DA9C05EF6DC RECHTSCHAFFEUHEIT
143,581,999 *0DC970FEF053EF30EB2E3A7CA4932B2C4887293B REDAMPSKIBSRUTE
143,582,000 *0DC72E853D525B643E9F3F6DA81D499AC40EC3CB REDMANYAK
143,582,001 *0DC4CC9224016D909D76E6BEF3397E070508E082 reinerite
143,582,002 *0DC85803BEEEAD7445916FF1127AC4026D2C5458 REKVALIFIKATION
143,582,003 *0DC83B39848B28A834B2FD1AE41F252B1740B127 RELIKWIEENKASTJE4
143,582,004 *0DCECE52CCD9F39427339C23AB3255286A2E7B82 RENALDOCROMLEY
143,582,005 *0DC35727149CA15E6386B1790DE01385C8DE4C37 RENNIE1234
143,582,006 *0DC781AA34125335B551BDFD5A6B2F7AF4119FE4 LOYDSTAEHLER
143,582,007 *0DCF1D0225C37833822AF4D06301E54AFF6F94D6 LUCAS.HALES
143,582,008 *0DCFD228B71726C78C86103D95416CE620D31988 luigibutscher
143,582,009 *0DCD99BABF16AB093A6BD3218492898C474140FD LUIS BALSA
143,582,010 *0DCD1D6432BFC78A482958E0A3FAF3072FDD88A8 LUKE.PERRETT
143,582,011 *0DC1A273C0DA054B831FA585E36C37F87326E77D [email protected]
143,582,012 *0DC510CCA527EAC7453341577039258410A844A4 LUNAYKLEVER
143,582,013 *0DCB21C78990C70912D380F994F8DF6BF677C304 REUBEN.MANCUSI
143,582,014 *0DCA56298E5D3A9D655D362B78F4FC7A228A0A62 [email protected]
143,582,015 *0DCF4928ED93BD31AC945B5240F69B763F967A09 lymanalsobrooks
143,582,016 *0DC89DA2DCEFD4AD516BB6B85FF581654B6FFF9F RHEALEENS
143,582,017 *0DCD4BBAF119AE78BF09EC2E8D1B4E3F00B3A7E1 ricalc?
143,582,018 *0DCEB1279DD3223BE06B8305B0A46063AA22E8E0 RICHIEDEMSHAR
143,582,019 *0DC2AAF833AD08B686EF195B78A28A269BB3EA54 ricing
143,582,020 *0DC9D85A5F0369BD3CE4FA387A09E448A559B84A RICKEY.HAYDAL
143,582,021 *0DCF992E3A6AED1507B6ED6717187D6BD4BC654F RICKYLH
143,582,022 *0DC07CAF0A3CAEFAC6AE00946D8D9EC499A4128C RIYOLIT1
143,582,023 *0DC1182A427EB41B4B06EFFF58F695098CBDBE6E R JAG KYSSER HAVET
143,582,024 *0DC5B8C6D7C178C72F339B51A648E27DA1D6919D RNCHEN-'CHALLANGER'
143,582,025 *0DC25669AA9E5EDD82C2EA57D3C07A724BD3F512 MAGICOS-PARAGUAYOS
143,582,026 *0DCB189A6EFC37F7A737F6B51D16EEECFAA944C7 MAILMANB6
143,582,027 *0DCFD31097D0CA20E12D9434DD9ADDB869713316 rodneydomitrovich
143,582,028 *0DC398D325B9CAD9097CBFBB8099A1DD9FED4153 makoba1978
143,582,029 *0DC7D59C637AD55D489F2F5598FB6AF970E373BD ROJGULW11
143,582,030 *0DC813F0D27F2F3D2A63A3697A07945AA04C1C8E ROLLANDBELLOTT
143,582,031 *0DC1A6B3A9ACE52057F121631B30A53C7D209528 ROMAN.SCHWALL
143,582,032 *0DC317DFB486CFA5C6CEE1A87CDD13DBFA378D84 ROMEO-AUSTRIA
143,582,033 *0DCBFB16324EB60F799A640805DA18CE94B5CE1A MALIK.AMIRIAN
143,582,034 *0DCA6A5F642E565D92FF76E97A919E315E392038 ROXANASANTA
143,582,035 *0DC7181EEC380C926BE50D427B0D6F38D3525179 ROYSCHWERTFEGER
143,582,036 *0DCE1F91A7CE923DAE82B618FC526D5B3D43E104 Mancipations
143,582,037 *0DC4A537F85187ECB721B70B7D69002F3D8B53AE mancode
143,582,038 *0DC9265945515BEDD074469B80A2A7493BAFFED9 [email protected]
143,582,039 *0DCF7C681A6289B87CE7DE17697AB4200E03D8EA MARACOR
143,582,040 *0DCDDD13919614E0248B09AF46979C8DDDAB3325 MARATTERNAS
143,582,041 *0DCD1A7DE30C3AC1110210DCB75CBC4B82286CDA MARCELCHING
143,582,042 *0DCEAC5DDD75CD896C1AC1944EA318A1A072FBFC RUMPENDA5
143,582,043 *0DCF3B84D2B4781675BB0656B71F579CC322C77C ruubinator
143,582,044 *0DCC7912EFEA84F8B7760E8A593851AB40C9470B R Y|Q
143,582,045 *0DC3BE1F26929254DB2BD7EFFCB204213B24AD4F SAILAZAP
143,582,046 *0DC81207C230D8AB49ADAECF6BE3486072F95FF8 saintjulienpuylav
143,582,047 *0DCAAD4F0A64CABCF7B195E407B49FCB15AB7B31 sajoria
143,582,048 *0DC79E4EF795CFCFA0D4CFB08DC2F3133CDCEEB8 MARIAN-TARRANT
143,582,049 *0DC050FE2160E96BDC38E2761640C6BC97D5E29C MARIAWHITTIKER
143,582,050 *0DC674EB70C9BA6A9A5E887261DB7D28C39D47B6 SAMUEL.PLUEGER
143,582,051 *0DC19E075FDB5AFA8ECAEF020930D2411B0FB34E SANDHURST.9
143,582,052 *0DC74FC4798D611F9C9B3AF3CE45803CE42D79BB MARJONTA4
143,582,053 *0DC7D7B405B6F7F7A3F0B1EF947674AB10A5AA3F MARKUS.LAMPERT
143,582,054 *0DC9620AE04887B707AE0C7C2A4765528CCE2A7F SANITYAM
143,582,055 *0DC80299AF0834A59324901F54B4113EFB4E79B0 MARQUIS.PACO
143,582,056 *0DC39BDE1A23877BEE3CE7E1A0CB105F123D1BE5 MARQUISSTENGER
143,582,057 *0DC90BBA3751145AE5D2C109A4B187379700AF9C martinilandtage
143,582,058 *0DC89EE1B39C3EE4E15BB9AAAECA71764091AD1D SARAHYAZDANI
143,582,059 *0DCA92D086AF9D0FC4FEAC67DE6A4FD7FCF044DD MARTY.MOBBS
143,582,060 *0DC0D871FF61BCC1AE416913A97A06DF2A798869 SATINL3AF
143,582,061 *0DC20119998BDEB48B79A79B0BBD1C6BFE4B3002 MASSAGE4MENONLY
143,582,062 *0DC49F00A2B8CE3133BFA0C3A9DFCA708B4466D5 MASSLOUB
143,582,063 *0DCF7ABAC8CDE0150EED00CDEF389B9BEC90FB35 matthew-baldry
143,582,064 *0DCE96DDE01AD84F78467BFC1BBAAF437E877062 MATTHEWSTOLLE
143,582,065 *0DC04DB55AA5AC5D655F9B461F8358008450462A SCOIATURA0
143,582,066 *0DC4087FBB3569257B39D8471E173E30D1048F3F MAYNARD.SPAIN
143,582,067 *0DCBFD3966A6E04D43DBA5C6651C9E5DA86D2373 M_C
143,582,068 *0DCAD00785F633A38441560BB809DA0C33411880 mcjnkzw3
143,582,069 *0DCB330CA145D4BCAE8D5E420D23F889D59BCE92 mckinleyschutzman
143,582,070 *0DC33578286ADB34BDEC87A4C0EAB69E9DA84959 [email protected]
143,582,071 *0DCBE68149250DCAB5E2BC01AAE8044113F06B2C m!ddl3brow5
143,582,072 *0DC381A7B9656266B6A10E8B585F86B8D4E95B0C seasonalnarutodsgameescalatesrivalryinjuly
143,582,073 *0DCC689F76D25971AD98295E4EAAECF5AB720F36 MEĐUSLETANJE
143,582,074 *0DCEF5D3E4F30DC451FDADA3CD97E9CDA75DF438 SEBASTIANPOTER
143,582,075 *0DC056C4B112B3E96758EEB39DECF7F3CAB2EEF6 SEE.WULF
143,582,076 *0DC4EE8EF69264F85B7DA825B9FA59DFA8CC4F26 MEL.MCKIRGAN
143,582,077 *0DC6BA26CCE7851B7E556DBCDFA9487F5627BA8D SELITNACREM7
143,582,078 *0DCC7C3EF3450BD3A29F05F4A3EDF1FD7E3070E1 mentionnerais9
143,582,079 *0DC683F1FC6348B9ADE17FF7285A45DB0E77B615 MERCANTILE5
143,582,080 *0DC7530CDD7B44D6745F665E5EB6F04F2B93F369 “mercedes”
143,582,081 *0DCCC32DF2229DC109B66D9EA4206B80EE28D333 semi-trailers
143,582,082 *0DC004317BEF6D0EAC867B05D3D776096AE6896C SENKELNING
143,582,083 *0DCE38E1FD8C0A55793A31713099FB9076C76C29 METALBOY
143,582,084 *0DCCDCBBEF71525596709E9D922CD5745D71B9EC sethengl
143,582,085 *0DC3B9D05403DC635DDCCAFECE75817DD634FD7A micahsotos
143,582,086 *0DCE4E4352DBE1832E57A7B3CD098A1D86A20576 SEYMOURCHATON
143,582,087 *0DCA40BE6217AE84E748AC42A632868335F8F2BC MICHEL.DONAVAN
143,582,088 *0DC5ED01CB295816D461E4929B406AA1FE5D5B0B [email protected]#$%
143,582,089 *0DC4B2965F7001B3A6F4468B908436C39AC53127 michelle.swinehart
143,582,090 *0DC4E19B6AA574AAC5CC5A0DA3DB1C52B2A55E4E MIDNIGHT|
143,582,091 *0DCEF2413DC051C28990C811E69C5AED1D39DFB3 SHADMAZZONI
143,582,092 *0DCB26CAE51D17D1799F07B78222F4DD016D2600 SHANE.SHINAULT
143,582,093 *0DCECEADACB1206D022D078564B22B23AA3136BD SHANNON.CATHERMAN
143,582,094 *0DCB47A766FA9E91EB7F35035D0EA0B7AC47050B MILANDEHERRERA
143,582,095 *0DCDC68E5724986E0F9B57041DC5AE9EC8AA34A8 [email protected]
143,582,096 *0DC77A5FD109DC2C1C07E4B2450ADABA4AEA4C88 ”SHARKNOSE”
143,582,097 *0DC711ADD2B33F3816BBAD2BB4F3C2EB7D448601 MILTON-GAINEY
143,582,098 *0DC61D842D84582E51E60494D663839E036B5411 shelbypfander
143,582,099 *0DC21504E4D12085C9A71A2B79CCFDB4367E0D6E sheltonpawlowski
143,582,100 *0DCBD289FA01691CCCCEC0E3937B09E315C4DE97 [email protected]
143,582,101 *0DCC766C0E201C70072A1D561A07F76EA56FFA4A misclabumeocemaineedu
143,582,102 *0DCF8A4BD048439749101AB14F4361265B91216C shielayoung
143,582,103 *0DC4F8F963F6E28C5A4FB169AB08E2B719B6C6D1 shirtmen9
143,582,104 *0DC9FC62EEC9082DF5AC7373F32C16F03AA1CBAC [email protected]
143,582,105 *0DC80AA6C428A76B9BDF196961FB46EA18EAB6D5 SHONCORMIA
143,582,106 *0DC4027C8F676911F143E5DEB488F5CA03144830 [email protected]
143,582,107 *0DCC838694C84ABB0FCD33720B5AD301A505A5DD si0
143,582,108 *0DCC938FF3ED560C5C179165A99BD7512310A1EF MOHAMMAD.OZOLINS
143,582,109 *0DC30CAEEFBE5E2E53AE4B699AD3947F07DB3588 mohammadsabra
143,582,110 *0DCFFF2FCE015AD4B4C6595A491478062C3FE535 sig-du-er-min
143,582,111 *0DC7A12F171799496631E913E2E008451FF71BBF sijangkang
143,582,112 *0DC5C40AB2D55113D6BC246751E1744B4236174B MOISES.SAJOUS
143,582,113 *0DCEB55E042DA496D032D395037EC931997ADD65 MOLDEO POR COMPRESI
143,582,114 *0DC29CC1708969B5961442CE4195C70D4C89D6FD MOM1007
143,582,115 *0DCB986BEB0B870F3852D5000B2EAF0AD4DE011D MONEY.(ITS.THE.BEATLES)
143,582,116 *0DC13309250E9C885281EE5B3F6F302DF0099CCA monk-theme-(pilot-version)
143,582,117 *0DC01B107F5A143DC1B154CAA2E0A3A27706CFA9 MONTYMELBERG
143,582,118 *0DCC2D64EB86BBE79E0948443F99F69FC2A84C4B „MOROVÝCH
143,582,119 *0DCCCB6487FC6C1FA7A97809859CCF7678CC93BA sjursen6
143,582,120 *0DCE5281565FAE24C26160BDF1119BCAB0794844 SLAVESTOTHERHYTHM
143,582,121 *0DCF69722DEF65E286F4AFE540268AD46AB8AF5B SLUBBERLY5
143,582,122 *0DC3630FB252D6D3F44B0849537BB8FE305E4FC5 S NAMAI TAMS
143,582,123 *0DCDE258EB7DA589AAE3F101E50C46FBC0D2E9EC MUHAREMPA
143,582,124 *0DCE05070D5E2E5EBEDC229E3C380C576D275D9E sonata no. 14 in c#m (moonlight sonata)
143,582,125 *0DC37B03DC1C7E290FEA82A90B7660FFE086B507 sonia1922
143,582,126 *0DC71473A208DE9E3B5660DC42D7F3C2E03092A4 SORBIBLE3
143,582,127 *0DC3564E60E2ABC12A2BB5C4771F734513D0BEBD soriában
143,582,128 *0DCE60B5AD1CD4755D7FD44B3F929CD4E4F60E91 SO-SEXIST
143,582,129 *0DC837843B49E0B3E0AB756A9A5F1FA205492733 my-oklahoma
143,582,130 *0DCA558AB3F60BE6BDB92346EEE761396F76B6DF MYRONMIKOLON
143,582,131 *0DCD8350416C39E190C0C72B9C47C57D3E6F2D36 MYS71QU3S
143,582,132 *0DC27658C8FE2FF179E2A8C8E5185A29BEA14E96 N_|[
143,582,133 *0DC36B952DD73490346957EDF5351F99A33DFD0F NAGAHOM
143,582,134 *0DC3305DC4E1980B2C28980110C855B0345E3B49 [email protected]
143,582,135 *0DC28BBBA5E73994203E79E78EA17C15F84AD9B6 NAKED-ALIBI
143,582,136 *0DCDEBADFE0514549FCADC6A344775AA2AE372E7 spectra,spectrums
143,582,137 *0DC508E74D5ED80DCD43163C035D61FCF2AFB31D napoleongagliardotto
143,582,138 *0DCF53931DF15DF16E9FCA598BD04EFAAD513BA9 Spencer-Jr.
143,582,139 *0DC547A5D258679C6E7AFEA1EC9725C4810F5D77 SPENCERSAYLEE
143,582,140 *0DC057F2B5C20CD91AA4133A957DEE3A0CD84E99 natasharozhdestvensky
143,582,141 *0DCD610A1FA7CEF0C870C4A8638DDCBF7D0C3399 NEAL.TEJEIRO
143,582,142 *0DC9501F62C546CBA45A9F3916BCA1D5CEF4FB4C NEARLYSIGNED1
143,582,143 *0DC564BF486216F6A64650192BDBAD8483D3B876 NE-FINALE-(ANDANTE)
143,582,144 *0DC0BC61258E627454A6A2CF06F26C6781C21477 [email protected]
143,582,145 *0DCD60B24F3C1658E2D04B5A758E1EDAFDD99009 NEZMUZE7
143,582,146 *0DCF67EE4FF786E833C2D74D447FC51BAEC4FE72 NICK FERRARO
143,582,147 *0DC84F9D58D08BE86A0EE123A8152D9094B83884 nickolasusie
143,582,148 *0DC2491607F2EF4817695299AAA1393D2A47F118 NICK.YARISH
143,582,149 *0DCDFAC6199C07A8625065BB53010B3A04A92F99 NICKY.HARRALSON
143,582,150 *0DC546D239BC029416EBB76FD4F1188526BD5E32 NONP3RI$H4813
143,582,151 *0DCA8CBBA35769D551803ECAB93C469E0DA1B21D [email protected]
143,582,152 *0DC17DF95DCBCF7FE48233EFC9EE7BD2F11A6FE9 norrisfabionar
143,582,153 *0DCBFD9C7EBB52D6475D0816B3AF0A64766700A2 SPLAT!~ ~ ~QP
143,582,154 *0DC7DF4609140703FBC39F7C6A7B522CD1CA28D4 SPNNNGSTCK
143,582,155 *0DC23B029AFB64BD665093F8307EEC0EDB0702BE NUN4T4K
143,582,156 *0DC6236F3AB46F4ABB0AB079C7E0DF08DF4DFB10 o->-<.0~<---b
143,582,157 *0DCBAF5FF3AC3C054C543059F2CF6531C5895756 O8L9A7ES
143,582,158 *0DC3DA4A008CD54098FF01424576B61EA2E0B3D0 SPYKODEKDJHOZT93
143,582,159 *0DCD3C92D978D597C53B87610ADFA4C399D0CE55 srecruser
143,582,160 *0DC1CE675AF60878B55A716D0AA2CD10F0DFAFF9 [email protected]
143,582,161 *0DC3A9D3C5DA63DFC1DDD34709D2B37E64015764 SRIJANASINGH
143,582,162 *0DCF64915B1350BD0F35F6B308293A900AFC23BF [email protected]
143,582,163 *0DC429C557B07E24618BFD70D4F0808B5E1618FB ssederweltmix)
143,582,164 *0DC29655597ECADC9716A8BE9DEEC96B66095837 STACEY.HORTEN
143,582,165 *0DC665302C7C32685A89402181ECD210C365B5B9 ökosteueranteil
143,582,166 *0DC5E50701EF145DB434FEF1608491666ECE0397 OLIVIA.SIMONSON
143,582,167 *0DCE6484983C3A062F03A4B795C65417F2E315A1 starlessness
143,582,168 *0DCF1020BDE1DB9A2D5728E3B63BB38F1355F030 STATION.BREAK
143,582,169 *0DCD759136409627CD03457648C818D7FBC89B69 STEEPROOFED7
143,582,170 *0DCCB743BFBB37C1E680C7878CBAA9EF4484286F stelladetroit
143,582,171 *0DC57DBFB4A1E4155F43A7CC87C78848E0230DB8 )O([email protected]###8
143,582,172 *0DCDD501B8E108663E7AD3552D80721555930B7A STEPHANIEJONESDAVIS
143,582,173 *0DC88154B0405F419F2FEAF5758918DB2F914EA2 STEPHENHOLLIES
143,582,174 *0DCD91B8459A913D433CF1AC0C1DC025D508F76F [email protected]
143,582,175 *0DC915977270AD32A9A323568BE3380D0AC8185D stevebars
143,582,176 *0DC54D2FA315C95977A45314EADD50E659073E3B O: PART TWO AND WHEN THEY WERE DEPARTED
143,582,177 *0DCDE030DAD11DDFFE4A40E6849BA14319BBB65D STEVE.LICHTMAN
143,582,178 *0DC5D9A65B33B1DAC02B14F0BA84E098DE83C6E0 STEVENMCLOUGHLIN
143,582,179 *0DC0308456AFD0D958ACB0F8BD57D49BE6394F04 )o([email protected]##q
143,582,180 *0DC08F99AE7CB2D1429A6FD4FC71331360E6ED30 orfeo: act v. ritornello
143,582,181 *0DC9F873E40B10181E2863306B5D0410C104DBFF [email protected]
143,582,182 *0DC55B40BB3B09508D26A2076DEF968723339B51 orvillemayshack
143,582,183 *0DC3ADA964759D6449DF44B07CBAE60DF90C9982 STOKKENDE
143,582,184 *0DC98CD69C0E78F7EEAF0FEAC2AB25DE47B10CCF STORMMARGARET
143,582,185 *0DCB594D37C01375541D21103AFCE33F05BF5678 STREETETC
143,582,186 *0DC6293D47E9D7FD2D4AE5B942E0A231A0F14BA3 OSVALDOLEMELIN
143,582,187 *0DCEA0EEF15A0CB85CEFFA5E0A008E293B393D1B STRYKNINFORGIFTNINGS8
143,582,188 *0DCBADA29511483A143CDE11C3ED4B1060586D48 OTPW
143,582,189 *0DCC37F747DA2EAA20E3E2B0717785D876D7F449 [email protected]
143,582,190 *0DC62A7650B07D7BFBDAE65AA340354D567FB194 SUBHAGA
143,582,191 *0DC33AFF317211DB2A8E3472109E273AA635F1BC OVERGRENSENDEBESTE1996-2009(DISC1)
143,582,192 *0DCF9E9609F5B4F067FCFDBA058044ECCAEA0B10 OWEN.CZACHOROWSKI
143,582,193 *0DC09F49C7EDAE8B134FADE5A68596EE449BA522 [email protected]~0~o}o{
143,582,194 *0DCCF5A0A81369C3A377B5F7EE9AC2A9BE7EF5BF SUMMONIT0
143,582,195 *0DC3E51896C707EE3E76864140A42CEFCE1876F6 P141161
143,582,196 *0DCD3FBD06F969C91F14C0CFC653E1C8A03032B2 [email protected]
143,582,197 *0DC46EF75982C13A3922B8C71D747FC13D503FAF P3RSON1IG
143,582,198 *0DCA84563CF5FBCCD28C6196CAE3F0A122A447D5 PABLOTHESSING
143,582,199 *0DCA3793D477A47C929C5EE126F04D1A774BC722 PACKERDRIZZT
143,582,200 *0DC80B5887A8F75BB19A3576AC08DC2138BD5F8D [email protected]
143,582,201 *0DCF7BCA1C073A784CE2CAE229242ABA85A51042 SUPERLATIIVISUUDESTA
143,582,202 *0DC7C2479CDE9C853975333CFA1BD6E5B03BB114 PARADISE..DJ.CAMACHO.VS..DANNY.ROD
143,582,203 *0DC07398FE662C6877878DA78EAA5EDCDC8DA405 sütelkõndi
143,582,204 *0DCED259B0DC937E5A99DA97F5D2C08C38FACDE6 pasqualebalkus
143,582,205 *0DC20D5F41EC15C1E05E4BAA3D657A865B6CC761 sydnkohtaus
143,582,206 *0DC20EBA1782B667A3591D16D3DD2D1F031FB464 PATRICIAGBELL
143,582,207 *0DCC9472B91C2F25B6408E6A7C2666D5D208AAED PATRICIA-MCINTOSH
143,582,208 *0DC0AC22CE85119CB1C11D37C7E59D9E3C04683E [email protected]
143,582,209 *0DC90556B8C760A57AD35FBD0A45B8E70962C42F Pay careful attention, everyone; there'll be a quiz later"
143,582,210 *0DCD119E7C5599CDCF4262DB752DAB74A6E71A6B [email protected]*.>-b0
143,582,211 *0DCC3A5502D626ADD140B0F610390A1C6EE21EB9 PERUMAYEEP
143,582,212 *0DCB2E9E85FF3E5E57CDAAE43DD96CED538BAADB PESTONIT
143,582,213 *0DC1634F9B4A301650454E74F04FFCD5ADDC4643 peterieger
143,582,214 *0DC926F10A2E5A264C1C419D462C2DDC1856BA51 TALKJAMILDWI
143,582,215 *0DC7CE1FC07E458C824FCC9B6ACF1D10887AAB58 taminytaminy
143,582,216 *0DCEE70AC910F3CCDD2432D94F3501C95F41151A TANGOSQUIRTING
143,582,217 *0DC1D68302B16DED3F04C9A814BE72E1EF7D7146 TANNER.LESKI
143,582,218 *0DCD7E5B87A1E1948EBD1E5CBF76FFEE743CBE31 PIAN03RS
143,582,219 *0DC1CE080893A17B28327B88F04FA5ECE4CE2BCF PIĄTERKU
143,582,220 *0DC7F58E3D056D68EA748C41243DEAE38D252822 TARGETGRANDMA7
143,582,221 *0DC1BC6B4D6139D6BCB33516FECFAFC056BD17A1 pilseek9
143,582,222 *0DC770F39643478B61B97ECBADAF049036403029 taylordolbin
143,582,223 *0DCC8EA9440F9A114E2A774B6DDD2B218367D3FE pispraatjes9
143,582,224 *0DC3DC046CFCF65A809A43159DFF789485F680E7 tdunbsw0
143,582,225 *0DC8043C729C2EB52113BD2382E0E726D206CCC7 plantenetende6
143,582,226 *0DC8F40AE7E4FFD23C80022DFEC68F639E5FB30B teachingartsvisualarts
143,582,227 *0DCC4C86DD038B056210D96C17B91E7782A9EA69 teanaki
143,582,228 *0DCA5713744B69135183C57362198853F1B7E234 teddyabling
143,582,229 *0DC704113A983F0616FF61C34C1372ED3C6C810E teddyslanker
143,582,230 *0DC14BC0DEC099E734341687676C82D90B5B5C36 POBRZĘKUJE
143,582,231 *0DC24B0545A71F6EDD3BF59DB3C0ED905EF2AC22 pòdôwczi
143,582,232 *0DCEB040BCA53CE35EE2E56BC03BBFA4C96C9991 tenderly(featpercyfaith&hisorchestra)
143,582,233 *0DC054797DCF6DAD3A3D45FC66B143277BDEB524 [email protected]
143,582,234 *0DC47E9E40D48F8371C1A3EB0F3F50A2062490F7 TENKIの第1回公演『その男ボルネオ』
143,582,235 *0DC11C2ADE19DE5864586F4E26B4CE7F520253C9 tennists
143,582,236 *0DC2476DAEAE84FACC6E56CC2FE93DA9A2FCED94 PONGWITW
143,582,237 *0DC54C422B8E153A2F3A929ECF7171C433B65490 PONTNÒWÒ
143,582,238 *0DC6AFE3BC1DDA875707CF1CEE9808FE8982BA40 TERRANCEBEUTER
143,582,239 *0DC6D4EB8E0923902063A280897F92EA2277774C TERRY.DARLEY
143,582,240 *0DC3BD3782C380FD119D32963FC83412A59EDD7A „PORTRÉT
143,582,241 *0DC4A84BB14D7EE7F092D2781E4A7E8744EE5096 tetrarch
143,582,242 *0DCC2CC487285A9E830ABEAB13CCCEEF169DF4FC POSTSCARLATINOID1
143,582,243 *0DCB8EE8C03A8F7DB02B8135EC608922F7B756B0 potencijalnoj
143,582,244 *0DC2A6153A84DF87E0C79DD1C3202CB572E7EB50 T<FN
143,582,245 *0DC782CDA4949140BEF667C6136A719BA0DE64AC pp~0splat
143,582,246 *0DC26B097DCFA0E8CACD4B30E3DA6C5010B991A1 P####P *(O_-)
143,582,247 *0DC6AF6F526FBB5797D3072DCC0DA36D9C5EB3BD THATSECRET364
143,582,248 *0DC1157B897533228E235AFD89DEDF7CB3AEDE54 prari'-'racism
143,582,249 *0DC4BD84C27780755F9982ACE6FFC8F34A104048 PRECAPTU1
143,582,250 *0DC8EF8835E31DC6BC8864AA51D4F813B0D6813D Then Fry Guy, impersonating a cardholder, called up
143,582,251 *0DC3C994F8043C04F3F95CB4C21DC8DFC074B1B7 THEOGANER
143,582,252 *0DC4AD266BEFD361027980D2347B688CD8718B53 Professional.musician
143,582,253 *0DCC76C7BC23F752109F129F71DB1641A2AEF5C7 pro-myth
143,582,254 *0DCD6610F0AC2B11B56C5BAAF443CB7FC59F2B18 THESAURISERA3
143,582,255 *0DC32CBCEDC479EDD69BEB566C07BD7DA43209EE thestarswillexplodethesky(departure3)
143,582,256 *0DCC841AA0FED1D287759A0272C091ECEF248B0D PSALMSTINMAN
143,582,257 *0DC7F6C2DA30854ED76BAD265D77F779A90F9D0B [email protected]
143,582,258 *0DC8E52BDAA53C11CAD677E37D66FB9C7524F6A5 THE WORLD NEEDS YOUR LOVE
143,582,259 *0DCACD0DA5E0386BF540E4BF0EDBA579F5878CD5 [email protected] `~ Splat
143,582,260 *0DCFBAF323C723C44428DA1001B8BF11E75EAF45 thisisanimalmusic
143,582,261 *0DC49FB1CC2CD0100170856E0492B0A79A66B14A THOMAS STANGHELLE
143,582,262 *0DC8ACEE2D8A3E66713F3A2FFCD329F08CB5AA41 TIDIEÎNAUI
143,582,263 *0DC0BCE1AF90D313D6E11A72226E40DC0ECC6615 [email protected]
143,582,264 *0DCF2372C94CF53BF4AE533AC41165545C9CC6AC pyropro.comwww
143,582,265 *0DC6F75AB4E417D87541C682F8FDAEDE6CBF7F0E TIM GUIDO
143,582,266 *0DC71ABFEABD5F62F13EFD54BC55C46C5C5CBD9C TIMOR84244S1263256E
143,582,267 *0DCFFBC217BFC4A7D596B8DB417E213604288D2F TISHEDMONDSON
143,582,268 *0DCE330CCC1630B88B4EA53A270AC21BCE77BC4B TJN2
143,582,269 *0DC27B88A9556240C5BAF110AD91F7CCA11F1AD2 q---p~.`:p
143,582,270 *0DC766F8D25161C602A5B21DAA7427E3DB9DACBD q>.`~.Splat!
143,582,271 *0DC587022FFFC18373ADC381FFB61D9AC328C19C tomb
143,582,272 *0DCCD854F1C6C07E597CE874F1FB4071D9A2F424 QWERTYUI858
143,582,273 *0DC490B3658198CFEC6F0081FA3A72EA1ACD574E TOMR3IS
143,582,274 *0DCBA0DEBD248428B6BD2B05B2A87FF60AC54A30 TONGUEWALLOPWEEPWETWHIPYAKYAKKETYYAK2
143,582,275 *0DCEA45FDED75625CBEE5796A9DF77A51C5E8CCB [email protected]
143,582,276 *0DCA5FFA5A24BDAC8842A9E8188B7EFC3EB95A3A R3FILM5
143,582,277 *0DC9C2F31ADC7E68E98B0D346F8096B01F312638 R4DOT3L39R4PHC4LLY
143,582,278 *0DC092DB82085576FA47ABABBD87B20635E7F4AA RABBUFFERAI
143,582,279 *0DCDE404F2712FD9CB21C6FEE1B46C690DAD805F RADIOS、REMOTE
143,582,280 *0DC1EE3EFB8015BB75AD6289E72BA7DE31F24F8B [email protected]
143,582,281 *0DC998EEAF0C5DA48BA4F653BB786249F9476AB4 RAJAJAVEDIQBAL
143,582,282 *0DC881DF1F0D4CE54D7F28BA23166D4D7118520B RAJREDDY1
143,582,283 *0DC04916DC8DE790AFFD124711FC9FA2A3B7D33B RALPHHOANG
143,582,284 *0DCE903FEA3A63C7D73DAAF62E82F6EE05C7D305 RAMIROHANOLD
143,582,285 *0DCF621DF43BFDF1DC2288341ECF03106F86BEA2 TRANSLUCENTLY-TR/&/NS'L/U/S/@/NTL/I/
143,582,286 *0DCFBFAF88E47FC5C8890944DD9F047009469E49 transshipper.
143,582,287 *0DC09177DB6465647EDEE202128EA2632475259D travis.catt
143,582,288 *0DC806134E81DCC6E83826F4FDC0A2DF6E9CF2F3 RASPRAWA
143,582,289 *0DCF8E7D561E6150818D0847F38F068186DE580B TRENZARBOLEDA
143,582,290 *0DCBAF6EBAAAF084220F2B9B830500B5A44C2B12 ray-priebe
143,582,291 *0DC1958AE61C6D0A8A3F977529873313292B1253 readingfriend
143,582,292 *0DC592E94E0ED10F7AA16059222E93C3C78BC222 tseesen7
143,582,293 *0DC5DA297BC5AB10444C01B17E993C401176D92B RECIRCULA+ED
143,582,294 *0DC1DD961708B46F47C99341616C6EAE50592594 REDCURRANTNED
143,582,295 *0DCC68CA19CB7B497A23CAF506704D2C5607480F REDOPIARVOS1
143,582,296 *0DCB570453F21E5311F9EE9B60BBC0DCB4565889 REEDSTA4
143,582,297 *0DCB8540A73EB7BA3715BC6240058CDE3D56A88D REENJOYMENTS0
143,582,298 *0DC2D42967483F80CDC4C761B235D2F81CA09FDB TUILIFEPULAI
143,582,299 *0DC17735DE3C68EA54E02F297482A1F589A71329 REGITSEEGFEORD7
143,582,300 *0DC8E3979717DFBF1ADA75B0CA71EE33E6A6EC01 twentyfourhourclock
143,582,301 *0DCD701E0586C4DAEDD21C2C329D3966AFAF9D1A TYLAR.KOCH
143,582,302 *0DCFFB4478056E8BE4CF0EDCE4AFC1DA3C8359F8 TYLERSHINKO
143,582,303 *0DC0644694C28BB05252C16F8CDAEBD761993F29 rendez-vouzrminuit
143,582,304 *0DCEACB27C0332A5175528F2569561E2028840AB RENEE-NEUBERGER
143,582,305 *0DCDBAEF50FC81E6F5F1A39CC663A44FE4E7A28A RENEKHALIL
143,582,306 *0DCBD73395697D0E477487E763DF9F05CFD1865A RENTESKATT
143,582,307 *0DCE85F7A1D23ED5E270631ADA312EC9BBC8BB53 TYSON.CASSASE
143,582,308 *0DCB2D1985EF6484880F7D069447AD8E9199370B u0{a
143,582,309 *0DCC8DF28F60050F6BF0E5F7250D96584CAAE5A1 ubx?
143,582,310 *0DC902E522C198D0C75FB298F20C8DE85B2E9D16 UC6M
143,582,311 *0DC35E18C60B8A0944937122F509BE88DEB97206 UCSANTACRUZ
143,582,312 *0DCA0021448E80B0E0FAF798552271B841481544 RETZTEUH6
143,582,313 *0DC4056D3D048F6809657147F62C8E966E336634 rg(]
143,582,314 *0DC7FECD7FBEBFB3CACF80282C156012E39AF713 RHYPOPHOBICS1
143,582,315 *0DC1661C54155FC9B37E893C53E95076A6E1CFA6 RHYTHM TAKES CONTROL (BEATS 'N' VOICES)
143,582,316 *0DC094142F85E755D9106860713907BEB9A1A93F RICH MEYERS
143,582,317 *0DC5D693BA72DCA58469E2C032956CE40D0B4F4D united'mashambo
143,582,318 *0DC285FEB7AD7247B504190E6463B9BCD8C58797 RICKYLH
143,582,319 *0DC07CAF0A3CAEFAC6AE00946D8D9EC499A4128C unsewere2
143,582,320 *0DC9CD6B094798B9B186966AE6269975BB0957C5 URSULA.DAPHNE
143,582,321 *0DC7270C27F666A661CC7E611B543E2AEB4193A2 USEPY
143,582,322 *0DC81E609E826EB78443BBA6590CED2CA5209C06 user1nicholas
143,582,323 *0DC8A4F7681F2AEB7021A643CA3D67E5B2B0358C USERBUDDYLUV9204
143,582,324 *0DC374FB27BA841E4823D3743F6D43C6485BD178 [email protected]
143,582,325 *0DC773BA8ED540CF54F2D94D8172A96575A2FFD4 [email protected]
143,582,326 *0DC9F03104FAC275A004A3D6A3C501D4A2528015 UTRIKESMINISTRAR2
143,582,327 *0DC08860CF2019D6241F2A6BB0F1C52F455ABEA2 uvjyuddb58
143,582,328 *0DC5DBA8A826312176F57E099A1AF583160C9482 uwdnilb7
143,582,329 *0DCEC68A782A0D76C35CC1717532CC3D6DDF9870 UZDOLJA
143,582,330 *0DC772217F3A88F7D25F9E70CAC9E0436A4DA753 uziismajovich
143,582,331 *0DCE5F13F017FF9A14D4E559EA78F377E47AB344 UZZQ
143,582,332 *0DC8D1054A222BE1C054FB0BCA8A3B6567324948 v1az
143,582,333 *0DC5E0A8443BF9181A067995F2AACA88B5C2F874 ROBOTECHITALIES
143,582,334 *0DCBB2519BA9A4EF1BA0F58340E038F5E7AD3970 rock(disc6)
143,582,335 *0DC22F016BCA862462BC2B60100C1B5815C1CA2F RODRIGO.MEHRHOFF
143,582,336 *0DC9B27890D88C9A3EEE6DE85A9D36567680A5D0 RODRIGOPTAK
143,582,337 *0DC2EB5E66F6B7452395002A7ABE68535084E3DA romeolandreth
143,582,338 *0DC5F8DA11E9F4FFA37011F3B56A3DDBAC678CE8 @#vcr
143,582,339 *0DCA62B2A4348323E359C87747C9D07B6E433FA8 ronnieolivarez
143,582,340 *0DC2CD981ED14E8DE9880D47911E111F2BF7E915 [email protected]
143,582,341 *0DCCF2AF227D5B585FE6DC7CEA999C3C260FD473 VELATEA9
143,582,342 *0DC3B2667066B34AF663D0C6E60948D6D3D2F809 RONNY.LISENA
143,582,343 *0DC28ECEF9D5EF35722F276532BBD4480353BD5A ROSARIO.COSTANZO
143,582,344 *0DCA8BDB4C1314D17F0CA61BD94CC65D51C95574 VERREFPTBSWING
143,582,345 *0DCA3A5287837432E146F03843BBD66BA505F200 ROYAL.LADAY
143,582,346 *0DC66CCA109348BA82DE7D7FF03C3637AF4F279B VEVERLY-BER
143,582,347 *0DCF233686239208EB31B11156DA596445CD9DDC VICARIALVICARIAL
143,582,348 *0DCAEA44448DDFD6CCE0A8251DE27DEE34E8B350 VICENTEABBENANTE
143,582,349 *0DC27B7A9550726DE10877DBA67C4A34F9D2FB1B VICKI DEVA
143,582,350 *0DC74A80E95512D37DBC94193FEBFDC8382D1A82 RUFUS.OROAK
143,582,351 *0DC4F750D43AF00EEA958CA1ADB4A92B93E19729 ruperta
143,582,352 *0DC1030656FAD39A466B505663F310A967C7AF04 VIENNA.MELANSON
143,582,353 *0DC1829109C184759E25032018E5F6E2AC49B1F1 VIENOSIRVIKÄS
143,582,354 *0DC49936181EADC90FF1D154164837CA536AF0FE RUSINSKI2
143,582,355 *0DCF27B37B55627AFA1261DA4DE9EB94B54F7C53 RUSTYSTIFF
143,582,356 *0DC9AE5871FE9C3757BD8D9F790BB9CAC8880D40 VIKTORHRUSHCHENKO
143,582,357 *0DC6042D43828E701D158C02874B499491232042 VINCE.PUSH
143,582,358 *0DC13C52F5B9C87F8A5B248523F1C2078649ECB3 S0R7N9
143,582,359 *0DC0AE755837CCC47AA9C2F9437868A4839F354C VINEESH PC
143,582,360 *0DC143C468FA4026EF7CB8399946B03674C61054 S310880
143,582,361 *0DCB8F0B684721AAA99EA9F4361CBE94B3926926 violeta.andrade
143,582,362 *0DC349A45F05319F3DFF4F1F3C377E9411FA9033 sackuih1
143,582,363 *0DCE737D5367D15DFD1A407BDEBF15BD49E26BF6 sadoffffodas
143,582,364 *0DCC666BCAE36CC9AC58A5E8EBE0C9A6062553B4 SAINTE-BEGGE
143,582,365 *0DC2E50D072D4CF001D714AB9868F315C7FD3D87 SAMMIEHARDRICK
143,582,366 *0DCF86448D9EB5AFE44AD6DAFFD9C8DB20CEEBC7 SAM.VALDELLON
143,582,367 *0DC94341DC962097D4C1A58D0F887322640893FC VITOR.ESTRELINHA
143,582,368 *0DC78A99DAC309C867901548E5C0FC5919AA0DC5 VIVALDI.-.SPRING.-.III.ALLEGRO
143,582,369 *0DCE6381E68DCCADD87B05C30D763FFDD10F17A6 VIVIAN-MARUCIO
143,582,370 *0DC47672B54BF9B83AD5C492904E91D7FEA053EA VLLRRL
143,582,371 *0DC743687D8D3D9AA2D188769DD354CF1006A75B saniaj
143,582,372 *0DCBAF9D27D0D52B348F35B30A35FE91C43F7E19 santiagohagar
143,582,373 *0DCBAD4264BB97B626E242EEFF842B4F897512FA sapientially
143,582,374 *0DC1C4667D17CDD92B0100BAA061747DC59C098A SARAH.BONNING
143,582,375 *0DCEDD9D6578D110F9E1E7E407B4952025094E9F saucillo4
143,582,376 *0DC56218BBBE983B016D613B1F57FBC5DF9A5561 SAULJIMENEZ
143,582,377 *0DC89FA7119E6FB7927E1BA1F8B7F4C8C8387623 VPLIFTED1
143,582,378 *0DCD4242806AD9ADA74C46E035FF70CE55A8CBCB vppened6
143,582,379 *0DCC425B39122C54E8F11B1498D46B4EB0EEE218 VSOEDIARTO
143,582,380 *0DCD468A667A6D1AC42D3A5CBC80C8DC18EB7D39 W22031970
143,582,381 *0DC404B05371262AB044B6AC89292B077F4C124B SCHWERFA"LLT
143,582,382 *0DC4A76B1322E3D0FBEAB7D90A31F7700838235D [email protected]ECOMTW
143,582,383 *0DC79EADD154B723180B5C4A67BC1D88602B68E9 [email protected]
143,582,384 *0DC769B477DDBE078082098C53D04B2A06B1312C SCOTRATHMAN
143,582,385 *0DC016E11E5986DE306968CE820038E4190080C6 WALTERCHIQUITO
143,582,386 *0DCC6B16A76641171C9169ABBB54E534CDDB9F34 [email protected]
143,582,387 *0DC55B88AE1A4B568832A02CBB6D56D91DCE0A4E wardcabral
143,582,388 *0DCB39B9788FEF3AC6A06A6F809C9685224054BC SELF-GRACIOUS S/E/LF_'GR/EI//S//@/S
143,582,389 *0DCB62605A418D6BA2A2682E1915676DF69A83C2 SEMIDITONE
143,582,390 *0DC623258E7F3BAAFAD3237EF0E671BA831256B7 senseoflife(feat.clarahill)
143,582,391 *0DCDFCC0CE640F31C1CB18E6A128ADBA5B09152C sepis 3
143,582,392 *0DC120791E479C53F316A54795545704F1E8871D SERENISSIMAQUOT
143,582,393 *0DC885E97A75AFD2F4FD38BA1701F3DFD666B768 SERVITUTTERSING
143,582,394 *0DC422C0064362F6EA0C38CD833E01C23718CE67 sesuoecanietorp
143,582,395 *0DC8DBCFB6C02DF54A31C579FE0490411ABEAE6D waylonclarke
143,582,396 *0DCBAB9B068D4CD463B6784AC2E39CAABDDD963F SGNIDREV4
143,582,397 *0DCF97332BE4E0E6C83D29AF9E505BDA5D566C30 WEICHANGTUTU
143,582,398 *0DCD5B198F2263034041905235E29B2E2B436416 [email protected]
143,582,399 *0DC647C913BCED903CA5CEE3DC2A72C55BD61DA8 [email protected]
143,582,400 *0DC8BDB7F003772A7DAF146A0B1C5295362AD512 [email protected]
143,582,401 *0DC939583ABED46EA3BD245CD2E9EA482BDCCCFD shanti(soupdragonmix)
143,582,402 *0DC8EED43B9BDDD7C99033A8D5B73B47A9417080 whatdoyousaytothedj
143,582,403 *0DCCF82F45577502B483BCF932EFD934780A3979 SHEETSSTEEHS6
143,582,404 *0DCD2B97B277746CF6B059DD7EA8E3D7481217AD SHELDONSZYMANSKI
143,582,405 *0DCB0AB3CCEE9FFCFC5A4C7E5085918A27F46D9B SHENGCHUN
143,582,406 *0DCAA4FF0F3A0DE2ABA341D43413C80AB4C7C88A SHERWOODGUIRAND
143,582,407 *0DC5138EBD65524B6B658AF2CE558F1208D3C173 wilburnvenditto
143,582,408 *0DC2C6F907ABAAF9433DB0E21AE390C7CD2B8C5C wileypraley
143,582,409 *0DCD4EB5B54E3DE0AD6EE9E2B47E1AEB1ED1CC19 SHIFTINGPEDAL1
143,582,410 *0DC2C72DB674FBE43F3FD649BD2C61EDDCEB3748 wil.harkey
143,582,411 *0DC16E48D441904231C4855BE829263AEC6BD1FB SHOLALKERE
143,582,412 *0DC0F4551F924291DE806FF3DFD55078485739A5 shor+chang!ng
143,582,413 *0DC226F44C4049B8F4B5032FAE5ED8ECC490F215 WILLYMCCORRY
143,582,414 *0DC626EB4ECDE22EE53E281C4E8C6810E1F28650 WINARDQUIAPOLO
143,582,415 *0DC6DBE42F09BA17F1F358F9A8241E5245F76E16 SIGAREN?
143,582,416 *0DCD15174589B32D5CAEF88F8A0EDB8CEE70A6D7 [email protected]
143,582,417 *0DC66D37AEE31A1EB781AD3F648524D8BDFF4601 SIMOGOOR9
143,582,418 *0DC42E7924AD549B65D1463D59413E82AA21489B WINSTON.MOSBY
143,582,419 *0DCD1853CBB6100A3D5E00F390C8FEEA7C9509AF „simpsonų“
143,582,420 *0DC1559167F2E31840A7FC9CA5E68F3CFD47FACF [email protected]
143,582,421 *0DC0633699AB43AD2440DA523B80AA520693695F WN]6
143,582,422 *0DCEBBA0605DF383229D4032A9C98424541FB8A1 SKALANIVEAUER
143,582,423 *0DC123993572C17218AA6BABA6D45B348B875D92 woolencloth
143,582,424 *0DC6FF147F40EDBC8D4EA82820B9A0600EF19A33 SKOPUDSERE9
143,582,425 *0DC2723F2CC36A20A1878116333536786681B1C0 SKORTER?
143,582,426 *0DCE5D18FE60688CA2CC30D8EBD343E3E74328DA skurski3
143,582,427 *0DCDCC9E28FC2D06151A4CD58331F33DDB602321 sleepingdrunksfromautumnfromthefourseasons
143,582,428 *0DC9A98DD15EDBA4D7E757B49011C17AE7CDBC69 [email protected]
143,582,429 *0DCDCFD21CBC46277D815871ADC868F5902ED3FE [email protected]
143,582,430 *0DCF9480ACB073A7C975CD005BC8BCC2A3C81091 SN6014
143,582,431 *0DC2C105F57C1EF927A7BADAC14C9C469310FA11 WWWCARBOTECEU
143,582,432 *0DC51EDE9A9AE4345E018119B7A7FDC85E46CD46 WWWMBKSOLDIERSCOM
143,582,433 *0DC9D02E545B91011EBB9DDB284B182488799608 soc.-com.-imp.-e-exp.-irmaos-planas-almasque,-lda-|-portugal
143,582,434 *0DC11D403B67DBF85AE82EE7A3BF4D3B89E1CF08 SOFTWARE/HARDWARE
143,582,435 *0DCF7E65677BC05B0F7A03AB70225E3879F5FA41 w_(z
143,582,436 *0DCB10B722E12803E226F258E9572D6A1BE74FE0 [email protected]
143,582,437 *0DC816FEF03461A0E64DB4215434DDD0AF9C67FA SOOK.TENG
143,582,438 *0DCD1B9939BDD41DAF85EB64ADE63D18255A497C SOOTYWING
143,582,439 *0DCA0EDAC1BB2143E7E8738628C4A9213CCA5437 XER6
143,582,440 *0DC3853426ADBD4958E2FA2A6D9110C1D47367E8 SOUND SYSTEM MUNICIPAL
143,582,441 *0DC1723CC8B435E17B87B8B9F9024831410969B2 [email protected]
143,582,442 *0DC7206B0DA1591A626589C1E014D4F051C277C4 [email protected]
143,582,443 *0DCCDC1F1C41DB35E1558187FB5B2DE2E66B7646 SPARROWCHUCKY
143,582,444 *0DCE3C6AA40AB4EC7CA09E6FB39D50F3E9F84C18 SPEED-FREAK-:30
143,582,445 *0DC125CBC9AFF86305F25C92144694B5723B3F63 SPEZIESDUKATEN
143,582,446 *0DCFAC897D269D83963E08960DF111064CF76DE8 Xuaeved.2
143,582,447 *0DC69C498989513DF70EEED3998FF83C185553F8 [email protected]
143,582,448 *0DC3137F16061BE39EFC84A5CB1A4CC25F93D2E0 [email protected]
143,582,449 *0DC3862D8B08E72AB3D1B9459E7BF52696B78079 [email protected]
143,582,450 *0DC17DF95DCBCF7FE48233EFC9EE7BD2F11A6FE9 splat * *d######8
143,582,451 *0DCCFF0FD3565E1F83D85FA2524F891A189D4B4C XYQN
143,582,452 *0DC52BC3D35C9A7B9E8E4511E0D4531AF92F8B08 Y1?-
143,582,453 *0DC154508FE3AE8B0EC17DEE582B488A81B17CC1 YANDISWAMAYANDIEBASI
143,582,454 *0DCC289CE3B9645E90FD03D8D02F5C00743DD857 sploit-o~o~-<-----8
143,582,455 *0DC0AD8312393D9B04C52F890F598DC49D540CED [email protected]
143,582,456 *0DC63CEB31FB0C62B6E4123443542A880F38575D yaski0007
143,582,457 *0DC07826387EDEADD715C38616D0FA1F9AA7ADC0 [email protected]
143,582,458 *0DC86866C3A18B37617615C5124F97AC3B8307EF SRIJANASINGH
143,582,459 *0DCF64915B1350BD0F35F6B308293A900AFC23BF ssenelbatirahcrevo
143,582,460 *0DCAB2FF98ADEC3557B59A6558A675CA041B22F2 SSSSSSCARMEN?
143,582,461 *0DCCA166FE22EAF94C54F2590B92D84C5EB961DE STBRKS12
143,582,462 *0DCEC4C2B90029B35FDD67932A8B79B7DF41C0C8 [email protected]
143,582,463 *0DC049A93120919923AE55365AB81FFEE489D820 [email protected]
143,582,464 *0DC8FDA40BC0B3B9BF2FC8BBE02132DD6CDB158D STEPHEN.GRASSIE
143,582,465 *0DC910B0E34271402CCF69CE2BA22F80CB2EC075 „YOYOGI“
143,582,466 *0DC2F625827C32BC034A69D33DFDEC4462991910 STEVE.MURFITT
143,582,467 *0DCC8A5F9FA383D641E7288A9D8524E6A963ED99 STROMBED0
143,582,468 *0DC6B3F5969994BA0822E312342C9F58FAE6196C [email protected]
143,582,469 *0DC290FF62481C44954C746B80C433E777D44428 SUBDEMISED3
143,582,470 *0DCD0B8504A3D9092267F4DA73F5713F70203CCA Z551960
143,582,471 *0DC1645F7B2426E4005EC4B786C761F0E746BB65 sucesos-de-la-foz-de-lumbier
143,582,472 *0DC73307B9B807EFD1A13D385001A96E695B6813 SUELIEN5
143,582,473 *0DC4168F8E89D8987FC7CF60011FF2DF9CBE32BA [email protected]
143,582,474 *0DC533B851AE39F518141A008635648330469EAF surtondre1
143,582,475 *0DC5339B00BC85C6F91274B95B85FD463576C694 SUSANDET
143,582,476 *0DC929D88A1A78C48045FBB954C22930D51C3A59 SVHDYTT3
143,582,477 *0DCEAD9BD8479082CE72A3681D854470ED3532F4 SVOGLIATEZZA8
143,582,478 *0DC4062E7828BFDC7ACA18E60A34F9BA51956ED0 [email protected]
143,582,479 *0DCFDCA3745D63F31103AE22ED7E9AFE433301DE TADESNES1
143,582,480 *0DCDC7AD46446A81F27721DEC5734188C08AED5A 'T'AINT.NOBODY'S.BUSINESS.IF.I.DO
143,582,481 *0DC884FEE5A2450544D5A59C78FB555BEC1C5E40 TALMUDYCZNYCH8
143,582,482 *0DCF81F3CF295AEAF84C833712620AA48EB86816 [email protected]
143,582,483 *0DCB34CB072E196E9DA5DB8A004B73FAA9EAD5F2 [email protected]
143,582,484 *0DC99DC520BC972F2A76AAC439DDA0458F0316B4 [tarzan]
143,582,485 *0DCA7130D4C796D269CD89BCC2492BDDC19E59A9 TEDDYBEAR07
143,582,486 *0DCFB456BD6A9112976D5B5231141B9E2C495B34 teddysweetser
143,582,487 *0DC9FAEA846BD001A70E1D56DB8B51B35F893BBB [email protected]
143,582,488 *0DC7EEF4D445B5B116F36A237721E5B6E1DF3B27 tennists
143,582,489 *0DC2476DAEAE84FACC6E56CC2FE93DA9A2FCED94 [email protected]
143,582,490 *0DC3B88D0E350A5E03508CF26A4ACE9889A81472 teresarachel
143,582,491 *0DC3C6BDEF6D2AC2512EE79840CAFB5BD5F1DD43 TERESATIEW
143,582,492 *0DC58376B124FA8866B3E250A5202F54FC0BCCB9 terrypaquet
143,582,493 *0DCFD3FED5FE2E17BDBB04C72112F001B216CF37 ZIZIPHOBESHE
143,582,494 *0DC6E7C96E875CB6672607DE230E88568988B3F4 tetrarch
143,582,495 *0DCC2CC487285A9E830ABEAB13CCCEEF169DF4FC zumwalt.1.0
143,582,496 *0DC7D6E7600BA9F51829F375F6BA6162640FCB5C zvyq
143,582,497 *0DC2F65CBBCB080E59823A8AAF4AEF2BDF33D1CD THATANNE1987
143,582,498 *0DC79C7D3E4F4F59DFCAF20F73C870F01CEA7EDC thatjennie37
143,582,499 *0DCBBCBD86ADDAFFEA9D4D769657E289918AAC21 The-Hyperspace-Megamix
143,582,500 *0DC452DA5202658E0FC153F5DA22536F21EFDBD8 ويدعمOSPF
143,582,501 *0DC667300E4157F8560E81FC89DED1B5078A2F2B the-story-of-gettysburg
143,582,502 *0DCD2C34E7D5D9E82862047F470E27682A8B75B4 THE.SUFFERING
143,582,503 *0DC2D7DC644BAEE26FFFCFD4FF26045279AA2387 theteddybear'shead
143,582,504 *0DC2A6769641ECC7F66DC417FECF27B7E40B851F thewayuptosky
143,582,505 *0DC13728C365DD31B7C128C7968895D3E3C5AF54 [email protected]
143,582,506 *0DC332E3CD5314A12A1E95753787D39CCDB76A2F tijdsverschil0
143,582,507 *0DC34B56311754739B7CAC361E1047F66D45A1D2 timbraud
143,582,508 *0DC138DCFED91F2E3FFE38B2DCA58163B05BEB58 ΌΣΠΙΤΑΛ
143,582,509 *0DCBCA6DDE3D337DFF36738375D8436CEF5D4071 БАДАЛЛ
143,582,510 *0DCF42101399B346C431E431CF8E4A218C8912B2 TITSNIER6
143,582,511 *0DC2661D81F417895DC1AC8AEC39E9C038474D17 «БУЦЕНТАВР»
143,582,512 *0DC1651C4B82CC207C8A75D0303F418481E6035C TLALAMUJ9
143,582,513 *0DC6FA36F91CF0A83A2EEF5A83DB0A03C67A5CE3 [email protected]
143,582,514 *0DC3E9AE0DA964D95ABF49F6594F8F3EE46A348C TN SWODNIWA
143,582,515 *0DCE52B9C6BA370773FC7B899D18D9EA67DA7058 TOBANKII
143,582,516 *0DC5DE1E1CDE2CBD50598AB577990E8BC1737F53 TONGKWI4
143,582,517 *0DC667ACEBE94CB47F8496A3ECE40D130281FC9C TONO-GONZALEZ
143,582,518 *0DC388B8560054CBFDC06D9677AB954EF4C6F020 TONYA PEAVY
143,582,519 *0DC3DEC3C360D2564113092B33F60EDCE8C17161 ГИПЕРПАРАТИРЕОЗ
143,582,520 *0DC5F3B4E02CB795D160A4CA19CF580CD3B111A2 TOO-TRIVIAL-TO-MENTI
143,582,521 *0DCD1DE2A21BBD0CB190F3959DD2DC5C90C9A2A0 top-10's-and-5's
143,582,522 *0DC79E565133038A359F98FFEEFED89F4DBD319E ДОМАРІ
143,582,523 *0DC28CB95AB42A9C431D1AA921705F6941845F04 ДОСЈЕТИЛА
143,582,524 *0DCE6350C4D4E13A813A481F3507CAF38B127387 TORYKABUS
143,582,525 *0DC46D8FA1360BDF06CDDCE3859A557708658A36 TOSHIDOK
143,582,526 *0DCD70FD1940474FC22673A7434E3236D7F75218 ЛАДАННЫЕ
143,582,527 *0DCF18E39986F883380467786037120C20020FBC TRAVISTESTA
143,582,528 *0DCE0616D4E8D2050929758FA8C1FDB19177AB2B trevoreanni
143,582,529 *0DCF6CA2AF406464F0593F230FE93EF676A77168 СЕРЬЕЗНОЙ
143,582,530 *0DC6D9FF309E39C8846258858BDD9778929DD86A „ТАЛИБАНА“
143,582,531 *0DC35D4AEA5C351CDF8EA87264F193F8E5FF75B4 ТАНКОВИЧ
143,582,532 *0DCC5117C4FE4AD4F4CDE100E9B9129282D4D374 ТОАТУ
143,582,533 *0DCB28BAAFBC3315A57AF3BE891A0565661D7C62 tristanmolnar
143,582,534 *0DC4C3A704CD39C7BC9DEB9CBDEFCEA04BCBAE20 TRUMAN.MCGHANEY
143,582,535 *0DC27D5B7FDED87B0C5E4DAC39AC7588D32E57E0 TSEILAEMS
143,582,536 *0DC345442673354C497324D674EB557688ECF05A TSIMROFTALP8
143,582,537 *0DC607CFA5D7A8724B0D324B4DA977A3CB2B555C TST13213
143,582,538 *0DC288D4CFC8F449610A5DA370F9C3F60A43454E TUAN.PORTOLESE
143,582,539 *0DC2DA1219FB44F9CDFF9CABD56D970CBB417386 TUBERCULISETI1
143,582,540 *0DCEE9B5626BE316FA180E339FA5924C8A3707A2 tunnelci6
143,582,541 *0DC56DD3E96A0801CDF5DDDE73FADF2219FDDC10 ЦЗИНТАЙ
143,582,542 *0DC4D1B0BAA88EB2BD0038AEB8BFE6372F835832 TURIWHAREKAWA
143,582,543 *0DC501CE29EF6058F781A0FB8430C429FE9DF2D4 TV-DOGS-(CATHODICA'S-LETTER)-(FEAT-MIKE-LADD)
143,582,544 *0DC5C2FD891EA50E653AE6F9CD8C18564CEE4AD9 TWYLASHORES
143,582,545 *0DC402A123BEC139371CFFC33E57CBBF8ACECF36 TYBUCKNER
143,582,546 *0DCA0C2C31254B5BF8EF0F5688AF70C75ADA140C tylerfurnari
143,582,547 *0DC652D9C568DF48ABBB304277F3AB3908CA9AD6 TYNUXOLL
143,582,548 *0DC2D2B3D8A723014AE12EB3114E9C6693DCD041 TYRONBILLINGSBY
143,582,549 *0DCAE4CE01629D551C64FDC43E35A36C43316DC0 TYSONPANICO
143,582,550 *0DC9D37B4DE0230FB0C4E0A49FF6F9DC039F6AA9 UBLIZIMS
143,582,551 *0DC9EA612B4B681696E2521EC8108916762DBA16 UDEEPKADEL
143,582,552 *0DC294E01B4DDCF6AACAAB26EEBC6DC44D5F85E0 ufuomaugbudia
143,582,553 *0DCE0CD66B34DE1682E810D83935E18DBA366FAD ULKU.TOSUN
143,582,554 *0DCBB62DA052CC5016E5CD95A1F6D5FF0AADE8C2 ULLURRULLING
143,582,555 *0DC86F4B861657BA7958318FD9C21A0799D9929F unholy.matron
143,582,556 *0DCD181EFC1833216E992837E40458E19ECF6D4C “UNKILLED”
143,582,557 *0DC6BE7EDABDF7EDEF367816D30FED67B0A2F282 [email protected]
143,582,558 *0DCCC4A903DE9E0158F213DDF48573A1EF51556F UTERNIZING
143,582,559 *0DC0AFB5F56847151C35DCF38BFD72CDF7917787 U\Y4
143,582,560 *0DC0FFC5DB9E11987E07B14BBBC2391FE4B7B5E8 ガーミン社のハンディGPSMAP60CSです、現在は後続のGPSMAP60CSXを使用
143,582,561 *0DCDF36D3E6DD9C5BD47951F4246D1B12075B049 VADESTVLE1
143,582,562 *0DC098099AB571847F35BFE08533A9A89233418C vaishakhprasad
143,582,563 *0DCECEAAD270C2AB7D713253DE8BF0EC15138893 维基百科IRC和维基百科的关系是什么?
143,582,564 *0DC8C04FD5142C5A86A1F78D7A62B720963E1A8D VALENTINA.PICCIONE
143,582,565 *0DC06DD770D902B45F5EC073CE9D84BFFDA19308 valentinebuseman
143,582,566 *0DC8E3E46DE658DDF510306E0998A7BE70523E4B VALEPOMMIN0
143,582,567 *0DC581DC0E77A7729C2A92D6DCC7DA000CA3AB74 valiantonov
143,582,568 *0DC013741CF9272B824E6EA1BA7AD00A50D33B68 vanessa.mascarenas
143,582,569 *0DCC76BC55AFBD0E81CB064710F4788D8DEF7DA9 VELAVIMUS6
143,582,570 *0DC15F99EB8E5C18B8040E51C577885346415E6E VELMA-M-SLACK
143,582,571 *0DCAC573EF7BBFD1E534116E5F0D0F4CAB7AA936 [email protected]
143,582,572 *0DCF15B035EE03DD389F5BFB926F9E0DC0BC9BD5 [email protected]
143,582,573 *0DCC288DA7BA5AE4506949096FCB48A2E77CFF38 VENUSGATORED
143,582,574 *0DCEF17C6CC998ECF6D8AA1D2C03A7C52B2DAC1D verniqua.pennington
143,582,575 *0DC0E8437FD1108E842C1FCDA9A69C9FD013805D VERONICALOONEYING
143,582,576 *0DC574B3B907E89FD962DC6758D2C81323042004 vhs8097
143,582,577 *0DC40CE56CD9323F65EDA074EFAAF51F7E27DFAC VIKINGSBRANDY5
143,582,578 *0DC45D8622FD04F3F5A582C4740E82B0BD472EF5 VIOITTUE
143,582,579 *0DC414882B91DF439C9A0FBDBC8761046E59E58A 07-02-1310
143,582,580 *0DC5AC7DD7587D92FF97039B2FE2CECB8742654A 093warren
143,582,581 *0DCE79C94CE14A21142A25C3D087909415AAD9D4 0BL+ER4+ES
143,582,582 *0DCE0A564FC9EBC09468214E340A48D03414E79E (><)0~DP
143,582,583 *0DC78D3D4A2FD2BDDDD5D1FF388F9060D7A09123 VIVEKMEWADA
143,582,584 *0DC131411C26FC37900D37208B15A2717F76F6DC VOETENS4
143,582,585 *0DC556E9753F8B4F09BDD027F280F70B73DD6CB8 1126geregi
143,582,586 *0DC4BD7D0852A1F5BB8392C74B0F6594AFE5CC97 1154882 alakerrassakaksimakuuhuonetta(6hl
143,582,587 *0DC46D141DEEAB404D32AF5737D7F696B9FC7104 11HEART
143,582,588 *0DC0461BE4694F79C260E1B8DB49E9A3AA71841C 122830 MISIRLIBAHCE SOK .
143,582,589 *0DCDDABDA45C24915F6ED72EB9875FC0659909F3 124M873
143,582,590 *0DC11A1903C0B71CDBDAF8EF5C57FDD398F473AF 1260162 terveydenhuoltoalan henkil
143,582,591 *0DC4E4B5C4A70BE5F30CA9B9156A076A9D12BF26 [email protected]
143,582,592 *0DC7168DA53F9BE8FF7AC30EE5FE58CCD86E2F35 vu-de-ma-fen
143,582,593 *0DC942AB0CDAA648142ADF80320C0D311E3B897A v=yr
143,582,594 *0DC96D5AA92089855C3B836CE234AE19AE5A3F2E 1420510 MUILLAKOULUTUSALOILLAN
143,582,595 *0DC2F7A45446FF12CFF78CDB4181C95D022DB55C WALLACE.ALLGEIER
143,582,596 *0DCEA4F11D295E0F4B58FA147FBA1AE832479F8A walter-w-conger
143,582,597 *0DC80389DF2DDF8E4889D08D8AD8D5ABEDDA3CFE wambui-cathy
143,582,598 *0DC62B5DF5DA495700D16129E9EFEC9DC8CF8FD7 146RIGOBERTO
143,582,599 *0DC824A5E9E0F448C0307F8835396AA040F294E5 15-KUPARIHARJALLA
143,582,600 *0DC3340D82565D49B31B8FCFBF9E65456C634E55 1606727 voiko-oppija-tuoda-oppimisymp
143,582,601 *0DCA483F5F46C0D7C609E8A7EBAA56E490A7290B 1693249 koskalehm
143,582,602 *0DCDC814C3ECF74D96F722BC83FB11E721D83A1C WASANKANARAT
143,582,603 *0DCA5C7E25060A87502BF13CDB4F1BA509EDD726 WASUT-KHUN-PORNPATCHARAPONG
143,582,604 *0DCC839948EF9F279B6AA22B1BAE70449039626B WATCHARAWINTAKSASUPAKAN
143,582,605 *0DCB728DF43431D2DD0CB4C7E92CD2653B523C82 183KAREEM
143,582,606 *0DC5D1C859B5AA4ACC455B9F50AAAD589492E56E WCHOQUEQUIRAO
143,582,607 *0DC963D95F91E05B52057B146BBD999237654447 weburlhttpwebarchiv
143,582,608 *0DC0EE564A90D9DD081E525DD1E6222BBB5193CD WEI.WU.SHU
143,582,609 *0DC07C199C40D9C6E5091C0D487078FFC358A25A weltstadtbevölkerung
143,582,610 *0DC74E5E6DAA5FC7FE1E087D878A486B10778838 WENDY-KOZINSKA
143,582,611 *0DCB12026207EDC6911B7FEF1884A315AB633214 [email protected]@PHY
143,582,612 *0DCB6752E79D10D3FECAA5A25C4BD7FE85CCF960 WENDY.SPINAS
143,582,613 *0DC7AEE308D9B9E1EF6ACA7AB1CF75301EBFD625 wendytergy
143,582,614 *0DCE4FDD03BF0C0E538EEA16FA475E2698048B2C 1CUSTAMOS
143,582,615 *0DC2CFF0020C5AE3A5E28501981B130D68E21B77 1-DRESDA
143,582,616 *0DC8AE4921496D12B53917810B14892F20A1A28D 1.E-MAIL-RECHNER
143,582,617 *0DC81B80C1C3685DE1CA9E319B86BE1FD4D77E9B WERGELANDSSTEMNET
143,582,618 *0DC75C430971BCAD14C4C784CFDE4D2FA7093191 1.ER
143,582,619 *0DC4A9F5A4F78C68EB413B9728FF94129B137769 wesleydigiacomo
143,582,620 *0DCE4573CEB6370B1073B6E34A076CADC0C4533B WETBOEKE4
143,582,621 *0DC85E1EE45C64EDFFB564E2C4B69FA78425335D wetteife5
143,582,622 *0DCC5D8734EB338C188E555DA3E8A6AEC3AF1237 WHAT'S.THIS.DJ?
143,582,623 *0DCB1ACC67C0AE8531C8B3EB60CD521BECE40CDE [email protected]
143,582,624 *0DC5A8549E7F3B229913D0B912654567CC899FBD whiteflowers
143,582,625 *0DC7BFEC47C26FC68EFF7380DACD85925AAD2E51 1FFSECBSW
143,582,626 *0DCAD88D78FA1F60FA4FC367FCB7CD4FBA8C45DD wibeche1
143,582,627 *0DC0E5D5DEBF6DD3969D96C4F39E1FCDE40BC601 1 HARMAALEP
143,582,628 *0DC7AC83AF7DE24B9C69F4A2669901814B9FE2DE WILBURLIM
143,582,629 *0DC312FDBB23D2EEA582DC3C7CFE5C7305AD5583 wilburntravaglio
143,582,630 *0DCF724CAF1DB9023CC478401BCAACC0C0F7AD5D WILFREDDENNIG
143,582,631 *0DC863948177BE55D8A393465744336874C524C4 WILFREDO.DALOMBA
143,582,632 *0DCAF4A0E23604848ABE16FC783E725BBBA3EA7A 1jousityyppi
143,582,633 *0DC31DFE6351CA11A9A1D296507CDF2B9CE7E10E 1-kinder-buecher
143,582,634 *0DCE8DFCA7F61B9AB9B9E20D3D105D6C903C5DD7 1LETOVIMA
143,582,635 *0DCA7D7C6E66BB4E0187658EFC0034F5E5DC4F3B WILL-I-SEE-YOU
143,582,636 *0DC3DD64C9CFB5D94497054D0EC5EB997227EBFD 1.NOTSCHLAFSTELLEN
143,582,637 *0DC70CD1E12F37E7830418BDBED6E7BA51D016F3 W.Tobie.i.we.mnie
143,582,638 *0DC2CAD258BA7E70DB41F439D0631342D817C60B [email protected]
143,582,639 *0DC843DF89971BC5049B947CDBED52B21C55C742 [email protected]
143,582,640 *0DC8C54F32C71C9C5536671C48D53B75D3EE97F5 1RAKENNUSVIRHEEST
143,582,641 *0DCF72C9EDA25BD08F80AD6F8EA2D87F3DEE7329 WWWAPOLLOVALVESCOM
143,582,642 *0DCC29CF848AAD531F6561474A6545B5D0260A7A WWW.CARTOONSALOON.IE
143,582,643 *0DC4A4F768D7F7A5098C701D27A29BD1A4B9158A 1.SCHUTZAUSSTATTUNG
143,582,644 *0DC6607DB3950DD7C10C25CDD317242B1CC6DB97 1sinnlichoptischen
143,582,645 *0DCFADEB607E3362CA9F2B6B2A953E154F32F1FF 1SIRPORT
143,582,646 *0DC122A32259124D6319CA5262DBC009FE274D37 wwwspenbarcom
143,582,647 *0DC5D96E3C230BCBCB2DE5E9FA2FD13DAAC0903D 1.TEHT
143,582,648 *0DC83D3876F09ADE52315892CB60B5E7B1A6383A }x{~.~.~d----p
143,582,649 *0DC9DC337B3D66A3D44D67FC622B6332B985F8A3 Xgaaa
143,582,650 *0DC2967F979EE254E8C628DB6F5FB7764313B8FA [email protected]
143,582,651 *0DC10C7FD65A50EF7BF1A8780A20BECDFE3DB4EA XIANGXI7
143,582,652 *0DC1A17CCA0F41A76A7DAB7BEDE004EC35F09A4E XOJACASORE
143,582,653 *0DC50D77569CB86F79D10ACCA74C295C747B46FC XP-MICROPROCESSORS
143,582,654 *0DCD96F6F15831936DE42FE72C86CB7BD9B5652C [email protected]
143,582,655 *0DC2FA1F19A4C379FB21FDF61A63C33FFF84F078 [email protected]
143,582,656 *0DCE065E9E85FA4873BD5CC5E65F4944A1E56E36 xwy
143,582,657 *0DC407AB6561D79B99BA2E4BE1F9A3BEE189F1E3 Y149117
143,582,658 *0DCEC2E1E729EB4F2D273CD921C5929CB0643F68 203316 binnen.eines.jahres.hatte.es.500.abonnenten..
143,582,659 *0DC540CE10513621FFB79B6C7B9F3AAAAEBEA1F8 20JÕGI
143,582,660 *0DC6337421A8B8692BAD4D27419D6CB7B5D7B21F 22 LOUKKAANTUIVAT
143,582,661 *0DCEADE6634A285E706651392782FDD7EA86217A Y'AUNBLUESPOURCHAQUEPEINE
143,582,662 *0DC7BAABEDEAE685D94690FF76F9ADA32525D72D yayne-tsegaye
143,582,663 *0DC5290768F9C01974F17EFFED6E7A5DE1F78CF3 YEARBOXCARBOXCARSCALENDAR9
143,582,664 *0DC20907460C9984DBA20083B9966477F2E56F8A YEZBARNUEVOLUIS
143,582,665 *0DCDE71DE55494EB469F6504F658B520E69845BA 2441383 TRAVISIN ON TAVALLAAN HYVIN PERINTEINEN JA HYVIN BRITTIL
143,582,666 *0DC49053D9D1EF4AAC826566DAB93B2D8CFDC286 YHOLAC SKI DISISAIS
143,582,667 *0DC7BE4D1BE715ECE603010AD5640E7D64F7F5FB [email protected]
143,582,668 *0DC4BD591EFBECDB88A0E92128BC830BF7A81CFF yinandyang(theflowerpotman)(remix)
143,582,669 *0DCEC5644581DFC550818DA8FA04B9EB9A55E134 [email protected]
143,582,670 *0DC83598D522117836D7FE25B453F861D14ED181 2516947 es.ist.eine.misere.,.die.man.sich.kaum.vorstellen.kann..
143,582,671 *0DC6B16F5F2FECF152BE37DBAC36979E9026932C 2517032 STREITEN IST MIT CLINTON UNMOEGLICH
143,582,672 *0DC8F4D6A10386EC873808F2F70FD1F951927D32 26011222
143,582,673 *0DC530C873671C49F5EC3C1AC5861FE409A7095A YONG.GOWIN
143,582,674 *0DC2FF1470CD47F612FF8C2104DA49E7D34EB8B1 27719
143,582,675 *0DC54F8C7C2803EA78E9642CE8DC3C473406F435 YOUR.LOVE.HAS.GONE
143,582,676 *0DCC96C07AB4E98FF1B3B9C7040C5206ED34E5D7 2926763 SIND.TATSAECHLICH.DREI.TITEL.MACHBAR.?
143,582,677 *0DC98ED869E607FB0BBBFD1F2B2CC0EC13ACEC46 YQSIKSYHQGTHZX
143,582,678 *0DC01F96EC958B9444E8B0F6FB8B43D8A1CAE94B YTKMBB
143,582,679 *0DCF8D437F23D4602BD990A23018E1D92078E428 YTRISAPUTRA
143,582,680 *0DC7AA0CDB8F6538F600B3A4A6D40255B276668A 2BENFRIT
143,582,681 *0DC756861F16D0A5664F0F5AE23B04EF6B5C608F 2.BUNDESWEHRMASCHINEN
143,582,682 *0DCC3E978B9F6785081F373241F8B4C44E2C85E4 2-diesenantrag
143,582,683 *0DC1003827882B6BCFC31B99F95EBCF6428B5AB6 [email protected]
143,582,684 *0DC85CCAB7F4AB1729D0EE0A17A021AAFD7AB112 YUTANAH
143,582,685 *0DCFF8C7F8109D5E29C3EE564DAB3CB41E283985 [email protected]
143,582,686 *0DCBA5568B69A6E2E5C8086AB679E218ECDA8942 2HYPRPLN
143,582,687 *0DC5E38B29EE822D3F8917BFA510849CC722A5E7 zacharylalor
143,582,688 *0DC718DBEEB1D08F55F7CE548DF3383E58EB832B 2 KONSUMZWECKE
143,582,689 *0DC3002EC67635A91A0DA8C4DB144514D254BA78 ZACK.CEASAR
143,582,690 *0DC40F3AF83C1D4CD5A24E6F091C074E0BED5611 ZAMRIFOXS
143,582,691 *0DC91D8632BADF8DA9CA9A2904CB40D93D87D244 2 NATURVERBUNDENE
143,582,692 *0DC1A1713195D63FFEE4EA11E8AFE6E1240B4233 ZASTAJKUJEM0
143,582,693 *0DCD88A09E93D520916949332B713E7CE204B5CE 2REBAARNA
143,582,694 *0DCDD72AD5364D9805D0DA4BA0C2510E2B20A7CA 2-RUOKA-AITTANSA
143,582,695 *0DC05A23FC36965C988457A9A2ED03150D9A1BA7 zelića
143,582,696 *0DCF06F561279554513F9235B3724D107826F76D 349JALEN
143,582,697 *0DCD15FA1137B765B51318F4D594DB02C076DAA3 3/4-ballad
143,582,698 *0DCE992E091B3F882D62DD3A7D3734876E71D695 363544AE
143,582,699 *0DCFC4FAB20AEF28A7D3442FE4B950CCECBA645C [email protected]
143,582,700 *0DC2AF52F259D67278725919F304E7EEB5AF87ED ZIKAR-SALOUM
143,582,701 *0DCA716C6D5A85276C8F2BCEABEE4679ED79ACE0 3GEANBRY
143,582,702 *0DCBF4E7EEB27CCEBB01D1CA876AF722FDC03CF3 3-KOENIGREICHSAAL
143,582,703 *0DC52E2E380BF34AED9CA0846EF7CAD4192CD146 3MCRUISE
143,582,704 *0DC7AABAE247A890AC5C7A76254E041E20088686 3--->~o(0_<)
143,582,705 *0DC6E6C3721E441948E2809AAF062FA4ADBDCD5D 3=====p~0.~o.(0_<)
143,582,706 *0DC8373C178EA59EDE5ADF9F0B272C39AB92EA87 3PARAGRAPHE
143,582,707 *0DC82090D66F27537ED5475188DB3B2BE3503A21 zwrrldn2
143,582,708 *0DC1B654055312F9F49FD685B0F3D4A7823FF157 3SEDMINKA
143,582,709 *0DCF3D859882C682E834405234034694C75B8CB2 41-eliminoimaan
143,582,710 *0DC2CE91E5CAAA05BD55F74584AA29F2F256580D ΦΑΝΕΊΗΣ
143,582,711 *0DC81B3315FBA7AF192DDF213562044FC04CFA42 49902 HE.IS.ELEANOR.ROOSEVELT.FOR.THE.1980S..
143,582,712 *0DC1EA7B2294781BA9A9E200C89A78ABA3AE4CE3 адильбека
143,582,713 *0DC6E30C00DD6F39A14CD19F730D78DA36116461 4BEDENES
143,582,714 *0DC14D21A6F556D62BA09D48F1C5797B27312296 4E94Y4Z
143,582,715 *0DC10B856A33EB45961A23B9B18BE72D8428D330 4HANSONPOWER
143,582,716 *0DC29E2807EAB5049D101219CDA751E8B26B74FA гривкой
143,582,717 *0DC7546A00AD9E68E31058DD5FF7AA01BB257BA5 ДЖУСАН
143,582,718 *0DCC0407E92EDD3715D58999410ED7DE63C6014C 4ilovesprite0
143,582,719 *0DC96D6D7D6D25C46880F556018E6DF3A8761C59 ЕУЛАЛІЇ»
143,582,720 *0DC811547473DD940130283F88C5C3915334E7FB 4KIINTEIDEN
143,582,721 *0DC4F546BFC2A104782A40D67A5DB45C1DA5BF38 ИДАЊА
143,582,722 *0DC3EBAF678B6005FBAF4FD84F2BDDB1A236AED4 КІПРІАНОВУ
143,582,723 *0DC9AB6A8589805D237AA22EB7AEEE8CC0D05226 КМАТСТВО
143,582,724 *0DCEFDCA190F51812A2AA9528FF3FCF8A69E0409 4PRINSIPPA
143,582,725 *0DC42198DB8FA80958AD8C091DC97048C31B3EE5 4PYOPERICARDIU
143,582,726 *0DC69B88FAEF254260ECD53BE5F6502E300A5361 мелаглин
143,582,727 *0DCDEF21A8FC40B7FE942E968C3250CB46B360E6 4SHALOMCOOPER
143,582,728 *0DC3AE89DEA5744DA377279752D86363E2F5E5F9 НАКЛАДЗЕНАГА
143,582,729 *0DC8EBAAA55182BFF023A76002FB234A700A21F3 нүхэрэй
143,582,730 *0DC5439275A5716E5FCCCB266C668A289403152E ОФАНЗИВНОГ
143,582,731 *0DC51BD58A6EDC02598D81A3674430C90AFE0034 Пожале́л-волк-кобы́лу,-оста́вил-хвост-да-гри́ву.
143,582,732 *0DCA69AF0ADCBDE0010968AA44361D5723B0F580 4VOJEVUDCOVYMA
143,582,733 *0DCC52D24365B348A342510CE068F304EA9867AF 4WALTER5
143,582,734 *0DC9D1C74177BEEA5D0F2B2328E34ED6728FA173 ПРОКЛИНАЕМЫЙ
143,582,735 *0DC47C965842C1C017C20ADD5D2AEBD42F154D74 ЦЕЛИЈЕ
143,582,736 *0DC8B0702C2A76A267D65371CCF7386E56F239B4 шанкль
143,582,737 *0DC409158123A8BDAD6F252BA3C2495A846EA9B8 ЮМТА
143,582,738 *0DCCAD2EBB4885D2A7F95005ACDA9FA5022BFE1D 5DSKAMPENES
143,582,739 *0DC3942F22C313A9CFB12EDC4B3E6BF5EA557289 5ENEKORBEGGEW
143,582,740 *0DC7C4BD28929E6F28000A32B433028805FCF702 5GODSAVEYOU
143,582,741 *0DC3D211126F2233E2037E0EA8312C9AA5DFFEBE 5iamjersey2
143,582,742 *0DC4758EF3C1DD36AF82C96FBF2F41318B0908AD 5IMKERNDEN
143,582,743 *0DC648C1BD490B3B5872ECFA8B6084E70820DBAD 5NUINYPC
143,582,744 *0DCC75CFECAA0D8F2000806D3677BFFD0CCADAB5 5PALADINGEORGIA
143,582,745 *0DC33E24B6DB6167F277D40130AA3551EBABD790 5SPENCERTIFFANY
143,582,746 *0DC7F122F4F0331B6AA3C953325C048B5BECC6F2 (即本作ALTERNATIVE)則於日後製作完成再行推出。
143,582,747 *0DCBBFA1F6EE80EF8EA56933A38413E9D7755A05 610320 tiedon lis
143,582,748 *0DC4DDBB0CB450BB2111E940B05FED74FA8FAED5 623524 keski-pohjanmaan konservatorion klassisen musiikin sis
143,582,749 *0DCF5988DE6561E0182C6CA8AAF33631F211CA19 62ERSTKONTAKT
143,582,750 *0DC741633F855B7DA6CC6D0315A47CFFE2BE6F38 62x03o34076
143,582,751 *0DC12E5044CF6A70BEC83C428EDD9B5100C3A39E 671262 a.memorial.service.was.held.wednesday..
143,582,752 *0DC8FFA9BED0F338FE64ABE86D76A33A892A0587 6ASPHYXIERAS
143,582,753 *0DC2E6C5B6AA85CFE347800FA03DC90DD1259C95 6BSWANDROSKIBSW
143,582,754 *0DC0C77BD94222DB4AEDF075E2CD47D18A2B1915 6EBCDICEBCDIC
143,582,755 *0DCA7C5945CCD3B27AC933DE73D9E4CC23F44C21 6MARFIK
143,582,756 *0DC8FCD580FFF93F536D360ABBB5C932345367B5 6MYEIEIO8
143,582,757 *0DC895289E76E780EF92524CAAB9C26144A48F3F 6MYNICHOLE3
143,582,758 *0DCA794287E04CA03BAB8B42D0455A83287BB11C 6NEZEILVL
143,582,759 *0DC19AC994C8346A57919BD77F5A3F1DD8BCC396 035BELLA
143,582,760 *0DC4D272AC66853B15C9A6DE03BE5E32A8E98D4C 6TFESTERE
143,582,761 *0DC85B948C081BEE6AC6DAAB687504AE258078E7 06091363
143,582,762 *0DC1E9802B4AB0116ADDF8D7CB6AA757A97451A8 70SWAYING
143,582,763 *0DCD5F3503BE46A8DC8F1246ED0B26E0C5BB4D88 08ХХХ
143,582,764 *0DC4F876562C1F183B6F71249210CED3461D050A 7-bilbon
143,582,765 *0DC11C4A21CD6977CAA8A3AE25E1A200456C26FD 0LUA1BPD
143,582,766 *0DC15F4206834D379EEC5AE82330C496BB2EDB8B 7HOLLINDEN
143,582,767 *0DC9EFD992678987A8B44829BEBDCEE227EB5477 7HUMPS
143,582,768 *0DCFE5F45D17EC010BD6924677FCA714C37CFA88 11 M
143,582,769 *0DCE3DE9EFBE63A275B6215DF8F87A3DC48CB07D 7PTRYKNING
143,582,770 *0DC8D2258FEB24C003C04B3EC0426A3D8DE48B90 7STRYKERPOST
143,582,771 *0DCF3CD7D3252E0647797E4684AF41BF0B083029 7VIVABSW
143,582,772 *0DCEA6D04A87B6623313AA49F813B246538358B9 7WOMBATSHOES
143,582,773 *0DCB1570905B5E92824DF18FB85D3F227CA91C5E 801FINN
143,582,774 *0DC9EAFB0CF7CAEA3B22D1FA5FDF6C0AA08C7B1A 12EUROC
143,582,775 *0DC99B3EC5A9987B67704A7F0FB755C10FF6CD5E 12f66b01b7961f5d14fa0bb95a4ac96f-terrans
143,582,776 *0DC8DE8A7A61EA08DDEFB1DF64DA8D345A026FF6 12LIKEITH
143,582,777 *0DCF8624DC2FF782045EB90D9B76740707C82DF8 879AWDRGY
143,582,778 *0DC212C3ABCE3882084D9C81E1A20FF92DAC2209 8AMANDATAMMY
143,582,779 *0DCA75271E96A3B2245C40E78FBB2B86833F4D7F 14.03.1414
143,582,780 *0DC995E33DA21FDBA06A016E56E7B61F9FF924D0 1415307 rakentamineneilopukoskaan
143,582,781 *0DCEA79B9947FB3B4ABFE0222886596FC78ED61C 8BQV
143,582,782 *0DCBDAA38443DA451F7F60B6676E4210772B0CC3 8CAESARMONIQUE
143,582,783 *0DCF468A1AABB3F85171D88F90BA0074B024E63B 8###D.~.~.~}o{
143,582,784 *0DCD4FA5D0F7F9AC6BE05C9AAC0E256ED03C79C4 8EDREESIRATNEVNI
143,582,785 *0DCADDE3B3A5E9A795980057BD1FC3E6F72132B3 8EXCEPERITIS
143,582,786 *0DC0CC2F94EBE0D9FDB8EA249073FAF3BF3B100D 1571269 kohtaloonsa-alistunut-graves-on-muiden-silmiss
143,582,787 *0DCCB743E7013F5515EB0C296AD7CAE2AE12BDB0 15july1867
143,582,788 *0DCC413EA22AFB74A94061EF19850D41A8706E9C 8HAPPYDAYPLAY
143,582,789 *0DC61D1819FF6F80B82A79F797077031786DC4E2 8keratectacia
143,582,790 *0DC4AF8DB2921E3FE78499E96B33680BB1710289 8KONGRESSLOKAL
143,582,791 *0DC106A69FA2AF1D0C6F2037A8FFD5939E648ADD 168AYLIN
143,582,792 *0DCCFFD8CCB5ECEA3EDFFC5EFAEE78C0014F23A1 1801257 JAPANUNDTUERKEIENTSENDENTRUPPEN
143,582,793 *0DCA25EA085F49D4775A990ABA0236D17694CAF0 8RGLBWCHNG
143,582,794 *0DCE15498569C629D4A3158F91374F04338D51A8 8RUSMIDDELFOREBYGGENDE
143,582,795 *0DC26748ACB214322A57F0561840CBBC4F47A835 18.leafleting
143,582,796 *0DC992FCD30ED6AAF5B4188AE4A9CB3F008A582A 18PIECES,OP72:XSCHERZO-FANTAISIE
143,582,797 *0DC89151527B0DCFC1DE9F028604294B01541EBF 8TROPIDONOTO
143,582,798 *0DC9B876412B0E39725DFA12F1DFA179FBC2B430 1958818 " IST ES EIN VOGEL , IST ES EIN FLUGZEUG ? "
143,582,799 *0DC4C5ACD41F2307AD91EF09684353328547A9F5 925739 ON-ARVIOITU-,-ETT
143,582,800 *0DCB2BED116B69B555FD9FC468DA18FEDDA0B9D7 926violet
143,582,801 *0DCEBAD5F8F8258CD3A922622F21C03C2112F641 9BSWPIRJOBSW
143,582,802 *0DC4AEF4D1A93B469C5A0BE063C3A64865078CE8 1 BUNDVERLAGS
143,582,803 *0DCB226DFA273BCD29AA985E17E80A90B9ECBF40 1childrenthat
143,582,804 *0DC45D2963DC5A5C6E7B07FF9C4193CCFF494595 1CULTLIKE-AND
143,582,805 *0DCF8B2B1A50310F6F7FB446ACC4E5557711B20F 1.ddrdopingopfer
143,582,806 *0DC756C27AC264F3A058F63ACC61CD882E43D57B 9DOGBULLSHIT
143,582,807 *0DC3DEB722ED26F60B0624BB109242AA8EF3990D 1 DIGI-CASH
143,582,808 *0DCB33E1D8B92CF849785CB0F1D32FC288F7B391 1.DOUGLASKUUSILANKUT
143,582,809 *0DCA7C4C26F6AEE299D0C7944B7125BBD07894A2 9FRAMGANGENE
143,582,810 *0DCCF10E0F672806ADDD05287225B75D44D86B0D 1.ER
143,582,811 *0DC4A9F5A4F78C68EB413B9728FF94129B137769 9GROONTING
143,582,812 *0DC0A803B8382229D3AC9E1AC8BA601FAE987BEC 1-formkult
143,582,813 *0DC3537A189486A2713DC67D71437235D9CE35EA 1.GEZDIREBILECEGINI
143,582,814 *0DCD485B7F39E3C2CA5C22E701FE442F47ABFF4C 1.GLENALLADALE
143,582,815 *0DC74848942417A20B4B94CE50D179DD42EFA45D 9kermist
143,582,816 *0DC0F497DDFAE311D94A0778AE5FBDB8AAB3AB7A 9KHOUNGBSW
143,582,817 *0DC2110A1B568A40DFB98D4533105827F4FFA636 9mietjes
143,582,818 *0DCB91DE23ACDF9B87F069D0FDD2E114DC6F5B19 1.hvof-menetelm
143,582,819 *0DCF10B02AECB15802B3768DAF7C6DF097113952 9MYGOLF2
143,582,820 *0DC9AD80545AA82567919196181F6D5EE4F9C0F0 9omgestuwden
143,582,821 *0DC58CA5F51132AD5437DF56801EE2E408C64FD3 9PACHYCLADOUS
143,582,822 *0DC8D1D850D54E0ADF0509EC0A39BB628844C0CA 1kennedy-kontrastprogramm
143,582,823 *0DC824A91635E22957F8E43FC2E0B5B168D09743 9ROSMALL
143,582,824 *0DC0D4E2F77008B807D349D3404C54C4EE9C1266 1.LEMKE-MANCK
143,582,825 *0DC7D2C6DB5777831A77E7E7B4403233314883A1 9TELECOMKNOWLEDGEABLE
143,582,826 *0DCC8BEEF0B4E397D555B8B64DCA4255D900C5AE 1-nct-verfahren
143,582,827 *0DCAD1D796FA396328B5ECC0FA5E5C3D134D6484 A03v
143,582,828 *0DC2DF7D8C179045E374D93112AA884E095A47D9 1 parteikreises
143,582,829 *0DCDF412A468D838A7233B65A481CFB1C0DC44D7 1-PHUKSIOPPASTA
143,582,830 *0DC0DB979A9D1BEC7C85E3CE57C11FC0BCB404C8 1PIPERTURBO
143,582,831 *0DC6A8EF336799163BCC54FF2C00276B79DF1B10 A132283
143,582,832 *0DC632143B35328F9960D4FDF8AC25317757A55C a%4na
143,582,833 *0DC7F926B18284C0E5932C348EA105B3FDB58BA7 1.snellman-salissa
143,582,834 *0DC589B01375B6A54BA084C1E10A38FE353F8770 1 sorvipojat
143,582,835 *0DC13A7B97B8403B416460DF99DE27AF2F1AFDFD 1-spd-schulexpertin
143,582,836 *0DC5BD7008D6A13C1F465E82938BA74A9C40A024 1-tavaolukorras
143,582,837 *0DC5515198745301263BEA257EDD7A01D6EF1B59 1.TEHT
143,582,838 *0DC83D3876F09ADE52315892CB60B5E7B1A6383A A"8MG
143,582,839 *0DC26AA46597DC1DD4ED534891E7B534827145CA 1.zucchinipepper
143,582,840 *0DCB9377156F1108F2A34DF43DE7B2A5674BCE9C 2006-09-30:theparadise,boston,ma,usa(disc1)
143,582,841 *0DC914985A0485897590D4F47366483C9603BF1B aaa+l_
143,582,842 *0DC53575CB883F9B2B5AFDD089FD92A4E104D313 2092355 LAINATTU AINEISTO TULEE PALAUTTAA KIRJASTOON ER
143,582,843 *0DC825918FB78A940410F48F5D8BF5790C29E315 220385 azmi-avcioglu-telsan-bahattin-kanyilmaz-netser-a--s-
143,582,844 *0DCD19F1E943C2162D75FD15D414EA5D3029A9A4 AABZ.C
143,582,845 *0DC2626DB84556BD7E85D192CBC24F97F75DBAED AAC]M
143,582,846 *0DC87FBFE51463A73949782FA831A296E45952BE AAD,+G
143,582,847 *0DCA04A4FC92198E56685D839522F8E4E29FF32F 2381613 IN BERLIN , ENTGEGNEN ABGEORDNETE DER LANDESGRUPPE .
143,582,848 *0DCC1457F60DE6FF173B86839E22499465F846AC aa{ep
143,582,849 *0DC78F78B8298CACF795517DC4050CBA4F2666FA AAGNEYAAH2
143,582,850 *0DC6577972F1087FD54B247F383B0376C83CA2CB [email protected]
143,582,851 *0DCD9CFBB6590C2227FE1C001D723191BC2B5C9F AAIQ
143,582,852 *0DC85A7CB517ACB20F38C4E350AEC915ED278CE5 AASETTT
143,582,853 *0DCDD8B3FF96769807D5BC60874FDD890CED08A1 2810755 hungersnoete-und-buergerkriege-praegen-unser-bild-.
143,582,854 *0DC12C71C7220E5C1B9E48980D1450E30D9AA986 2836219 yleiset.tenttip
143,582,855 *0DCEE5D834823FC09A2C1FD134E35ADA432BF342 AB3H
143,582,856 *0DC2117CCFC7EB494CB630CD0756CD20BBFE0020 AB#4E
143,582,857 *0DC75B4756634FF16BC96489BC2EC04F192F6704 2902143 katsolis
143,582,858 *0DC26AA25A149A5363C813F5C24F31383DC3C6FA 2.ANALSADISTISCHEN
143,582,859 *0DC0375CFBB7AB1FC9DFE102FC946784CF1BB9F5 2 AUSEINANDERPLATZENDE
143,582,860 *0DC00CB5533F5A5726EF7DD60B96F39DFABDED94 ABIHP
143,582,861 *0DCDC376EE36918BFE93F3EDF54AF45E74DAE832 2 HYMIE
143,582,862 *0DC4A21A55F635AEB55810C8B4707DA28B40380D 2hyv
143,582,863 *0DC7CED92C0EFEE1F708A4B03BE7597FF3E80914 2iloveseoul6
143,582,864 *0DCFCA5A3A2637AF8B7C6837636ECC92DF21D7C3 2-ITSEK
143,582,865 *0DC894155C3CDC7F3DAB6743B895C6304BAC561C abridgebetweentimeandeternity
143,582,866 *0DC12C8CD604BCC4FBCE977517B9A8F056A6E1FF abzinov.1.0
143,582,867 *0DC93FE4AA7C2BD85326E7531D764B99B0E2351D a:c9
143,582,868 *0DCF61A7678C1D138E3A41877A9B302347D402C6 ACCOMPLI
143,582,869 *0DC6BA8A034A4C283FF32334A3840197244244BB 2.REGIERUNGSINSTITUTS
143,582,870 *0DCC5BFB94C7957494CB41BB5C429C1E7122E683 ACED5
143,582,871 *0DC54FE7554F75E00C0BF324E733BECCE1C8FDAB aclarava3
143,582,872 *0DCB8C9FBE8C9D5C2F18F927CD5101A38D7C36B3 2.TORAJA
143,582,873 *0DC84FE727D5AA910A9BD8BC66610168B2265EC8 2YTN-LIITOT
143,582,874 *0DCEB753439FFB612440E7BD763D2B3ABBEC2C9F 3==>.~0(0-0)
143,582,875 *0DCE9B1D13556B4EBF2289957DE4D50BF5ADA861 ada4[
143,582,876 *0DC95D17366E60D80F0AF375BA6D97D37A7F28A8 ADDIXISTIS
143,582,877 *0DC70BF4BA4D38D56CAE5815A3F5E9BCDA2E84E6 adpp6
143,582,878 *0DC07C621946C90FEFCE1E66A53B0BE9554CE9DA [email protected]
143,582,879 *0DC93BCAE834C0EDE1435B878CDCD80A8F49D64D 3HUMORISTISCHE
143,582,880 *0DC2DF7BDB22E74B92553C4532EAF61FE4F99D84 3IHUHBSW
143,582,881 *0DC0D7A4FD6AC2DA0009AE524E14CABEB0E650BE 3===P~03B<
143,582,882 *0DC53AD3713D1F39E4A759EB32D289B7B77ABF1F 3POOTANG
143,582,883 *0DC2A1E022156AC173F95F605859C4B4E2717452 4:..4..-#..-&...collarless
143,582,884 *0DC28AB6C7D375B2C9F6CC295ED7A67005860A28 481102 VARSINKIN-ENSIMM
143,582,885 *0DCAC1AD856798ABBF4596435EACF7ED6AF0B5BE [email protected]
143,582,886 *0DCEDBEE5228658BF8104E67407928D04FDFC745 492857 denn-die-laufzeiten-sind-kuerzer-geworden-
143,582,887 *0DCDB48AD94D32FCCDA28C8BFFE1BD70BE80A5E6 49noah
143,582,888 *0DC99249F8016E007E4A1B88D2E04D2EA760AF8C 4EBONIHS
143,582,889 *0DC74DDE1827FA1C350346850694998DFA42B489 [email protected]
143,582,890 *0DCC06980AA69B677BB6B9280BC3EC4C6D9AC18D 4JESTERBLAZER
143,582,891 *0DC1AD0F8C9C3D6112CDDA669C549F4802B823CA 4MOSTRANSKY
143,582,892 *0DCB096725B36371422CC90F69F6D034395FD62B AF4UY
143,582,893 *0DCA97803CA98120FB35D7147D2EA6416D5A5F67 AFOOL'SEDUCATION
143,582,894 *0DCC6E58C4D14ABF7B691F52F5A06A671AA33C28 4SINTVITUSDAN
143,582,895 *0DC5D3E4278B65A197A2E29F1F90D6AD15559DB7 AG7"-
143,582,896 *0DC5C59D6E07C83C83609CF608B7E0ECEB2C255B [email protected]
143,582,897 *0DCE53F9338ACC4A9B7DC5599CCC466F9B9AB7EC 4VAPAAAIKATALO
143,582,898 *0DCE0AF8EFFDF7D26D145CF83F70E7B3789B4CCE AGUSTINLIES
143,582,899 *0DC1AA73B4796C296329D30E1504C1F599307A7C 546080 das management haelt vier prozent
143,582,900 *0DC5B215461662481D0DC1AAC503315CDC8581A6 554mariyah
143,582,901 *0DCDF6CB2576413A1A342FA746F798CED6A3098E ahlf(
143,582,902 *0DC71A609750397EB4D3307664DB14C711B8D456 5ANSAMENTO
143,582,903 *0DC3DE50C1C1A1B6DF87099000CBDF9A11042F14 a:hrd
143,582,904 *0DC517A038E9B52191623CD3D9ACC2A49C24DF59 AHT0T
143,582,905 *0DCFD371BDF1493B742BFDFEEFCC028F53BC8328 5BENOITKNICKS
143,582,906 *0DC00D2F11FE438EA2202CCB456F0589BBC36E5D 5CHROMATOGRAPH
143,582,907 *0DCCDE452A3772AD3A188B0BD8D07E68CD0157EB ak4u)
143,582,908 *0DCD31A82A8D929254AD5D61D7D7B2FE8175E00F ak76l
143,582,909 *0DC13108FCF0EB9D51218CF7C4646526570EF29A AKHAIRUDDIN
143,582,910 *0DCC96DA567A3E14A4CA1A06303AEE3420C9EB25 AKIBARAN0
143,582,911 *0DC5DDE28539A9E027711385C1F1AF57E890C06F AKQT-
143,582,912 *0DCF0DDCD36AD5F120544813FCC1A0CA7152AE51 5IAMSINGI
143,582,913 *0DCBF8EA8073506B9ED7D2AA75FEFD0A2E9BB69A 5KONINGSKAARSJESES
143,582,914 *0DC76DE5F5FE2A832324C01BEB1C128E4059CD2D ALBERTO.TRUOCCHIO
143,582,915 *0DCD06A38B3FC9FF8E65C4F41DBD57041D83F68C ALDOGONALES
143,582,916 *0DC5E9857215CC576DDE146D75A81D7CC6E19D68 ALEI
143,582,917 *0DCCFA1C08AD878820ACE7256E02C8416F001B4B 5TKCITEG
143,582,918 *0DC3D14AAD037287A52FE5E0479DDB3464D7685A 5TOPOFTHEPOPS
143,582,919 *0DC07734754B9A832ECA95FC1BB62AC19DFEE74F ALISONARSENAULT
143,582,920 *0DC0C2DA0C2B4C16848847A1866E7D4C7EBF124B ALLEN-SCROGGINS
143,582,921 *0DC7555A54B8B9589B241A3743C8CA89F71D4C2E allexan8
143,582,922 *0DC2FBCD940F5F38F8A60A4DD34DEF4703140CF0 6AFTERENTRY
143,582,923 *0DCA3A76A532830C90D77ACFC50C9E69442C9004 ALONSO.MOSSING
143,582,924 *0DCBFDC0F8C0230A6B659412AE3B40D917FC2AFC alst!
143,582,925 *0DCABE814B052EEFD6FC706DF0DC5C95C87A81AE ALUMNADODELAROYALACADEMYOFDRAMATICART
143,582,926 *0DC49FFCC7C4A8B0C6FA97B0E18CBD923C776350 6CVMMJGSDSZL
143,582,927 *0DCB6AC697077E0461AF43F42E8370BC3FD96A6F 6EMMXBVAI
143,582,928 *0DCE72C2D1B40E54A981C7FDB7B9916D1B4636D4 A-M1X
143,582,929 *0DC62AC8B019997A1CEA004EBEB60531D462DD56 AMAMECOMOSOY(FEATPABLOMILAN
143,582,930 *0DCA265647439FC56F038F7782FEA9E5BF38602E AMANDA.BARTOSH
143,582,931 *0DC57A754C1F0AE5E5B67B0DE57B26EB0731C2AE AMOSLANGLITZ
143,582,932 *0DC91CB07A13A140316943547CF106CE17A78890 AMQVC
143,582,933 *0DC1CAADBC62C5D8DBC1CBA845D07C9715928645 6PUCKETTROBINHOO
143,582,934 *0DCE3FADC6C050E0BDCDD7BE1BC4F2BC027B99E5 6SINVOLTI
143,582,935 *0DC1EB647856ED39ADECADC9CFA8FCD6B3E5FCA2 ANDREDARMODY
143,582,936 *0DC7F5F8106E20381C0FE79FAC15DDDD9D1956BC 6UNBELEBTER
143,582,937 *0DCEBE212E90E3E772E08563671BAF08022AF268 71B090BD301A70E06D006810CA60C1A0
143,582,938 *0DC756FF74517A2D9CFBB79CA9E02560C730E014 ANGULATOSINUOUS.
143,582,939 *0DC68B8C7F59E1727F3E7A9FE7FF044BC2F431AB anilides5
143,582,940 *0DCF5564325231B096ECF8796FD2D07D0BAB4D66 7ALTENPENSION
143,582,941 *0DCB2D9AA83BB270A138DD143544E97DF3116D98 7ARCHITYPOUS
143,582,942 *0DCC59ABF5070937321280C8DEE690008B298CEF ANNIE-ISRAEL
143,582,943 *0DC040698CA801230197A6CC2B7A1CA1A411E302 [email protected]
143,582,944 *0DC9173C4DC7292B9D0650A62A09265391B4DB80 ANTINEUTRALLY6
143,582,945 *0DC38907488E20E997C056081F9BF4A8FF9EE617 antionehawken
143,582,946 *0DCEAA0B366C7AF73FF394FD03887FB8594AE430 ANTONIA.FRERICHS
143,582,947 *0DCE3AE732C00C9B80DB876B70244429BF990BB7 ANTONIOKORDYS
143,582,948 *0DC498CBB8EE77D4E38D22AD4628CA139E7EC523 ANTONIO.PAUGSCH
143,582,949 *0DC63F3E6350E136568DE78A4C44B5D7CD078946 [email protected]
143,582,950 *0DC2109A933408072563D0AF02164DBF1193ED7F AO7L
143,582,951 *0DC02FC8D8E47F0C4F690E8CCA137AAE9D212C24 aom#
143,582,952 *0DCC32C8A6B040656B86C30855A58D55155E837B APARAORGANOMECANICOMOZART
143,582,953 *0DCE83A9EE3C0D29B3A98A44957FAA4AA0DDA0F6 ap+hp
143,582,954 *0DC0D2C9E31906F5832A9A5F6060E9293241C536 AqHs
143,582,955 *0DCA8AC1D86DCB3655E66C41E342018623F7990D 7EXALBUMINOUSES
143,582,956 *0DC6F8110795CD3B1C37B4C66B1E9B693FC02709 ar(!4
143,582,957 *0DC2A58F312C641EED4334BA83B06D95B756C555 7GRNDWTRSTRMNG
143,582,958 *0DC4534212AE637D1C61D9C6D64538FD941B7057 7HENGELAARSTER
143,582,959 *0DC17567F1984BDF7DB5EFFE93826F6568A21D89 7LACROSSETURTLE
143,582,960 *0DC0D6E9946A3DDF1C4630BE6DD5DC4835B470EE 7MANYAAMAHYE
143,582,961 *0DC2720B452EB5D958AE326E83C6E7DF66F7E606 ARGHSES4
143,582,962 *0DCCA29D7A7ABE258ACA0B3E58D8B04F89F94E70 ARIEL CASALMIR
143,582,963 *0DCF07FBAEDD7C71A94FAF342916CDFE8C07F1FE arieleckrote
143,582,964 *0DC091828CCC87ABB684117006939B07E066CB93 7PICTUREDOGBERT
143,582,965 *0DC3A410AD6A729D4A32AA41446FF16A0C8A9E55 7R4N$17ER47ED
143,582,966 *0DCF4359399628952250FE5FFE89761C04C2652D ARNOLD.MELLO
143,582,967 *0DCB80A0E8532389291F758E6C746F2C98D0CCF9 7SLETEKREELLITSID
143,582,968 *0DCAD9536CA958CD59E885EC06E4B062B3F1D9FC ARPELOUS
143,582,969 *0DCD7CC26E010B7577BBDAE4DA54E50BCA6F1D48 7TERNINGSPILLENE
143,582,970 *0DC34F21C5B9EFB1AC8DBD771A45E5B4A8336696 ART.MAIR
143,582,971 *0DC0DB77DEF587C0BBD458BE7BE991780FA7CD2A ARVOJ
143,582,972 *0DC664031A4B944DCDDB70BAD475AF0C3BC0EE5C 832040e0cb603f9b8fb4a8a52e386bb6
143,582,973 *0DC2AB4AA281DF89C8AFE736B8FD835074362ADC ASHLEYMG
143,582,974 *0DC2EA89F056B7B184F17AA444257FEFE91A0C2E ASHLEYSAITO
143,582,975 *0DCCDDBB2B087C92E9088B5DC72D7B80C89A4E2C A.Spire
143,582,976 *0DC1B2615A14468848513F90EF4168FA36A44451 atai&
143,582,977 *0DC6836665232B86644734B476547FC1A462698F 8==D~0~o:p
143,582,978 *0DC7F98E6D5F8BD4807CFA3FD4F1C0E1517C7797 athmoroni
143,582,979 *0DC8E239936949B0AE7D379F588331F872CC9D5B 8======>~o~osploit
143,582,980 *0DC25DD81EC9DF9E7D976F9F94B5C57C1D740DAC 8##P~0~O:P
143,582,981 *0DCC4A266AF8B627600446A796987617B720FB8E 8PURPLETUCKER
143,582,982 *0DC9E1A97C119607550D4292748E6A0990760154 avsb3
143,582,983 *0DC0A3FC21369D96999D43D861150410173ACC9F awaybuzz
143,582,984 *0DCE765ECD831814CB59927546CA84E0D47C5973 AWDRGYJIL367
143,582,985 *0DC1CFC493C08536EB545DDBF9BA258CCFDDBC71 AWo=
143,582,986 *0DCB361590CA2B902BD6A25222659C3AEABA4D82 awul5
143,582,987 *0DCE2DF99B1B1FC7783403C345373ECCD14F2C26 AXE-H
143,582,988 *0DC6CD14C33EDB7D679DB68AE96317FF0634792F (><)*.(b
143,582,989 *0DC18172F01B5D3AB604FE82F01EC3B43401CD75 b-,=
143,582,990 *0DCE49E97BCA1C266CFBFF683C7D5224422D53EA b:%"
143,582,991 *0DC3B908524FD70CD8711CFCB169FB03F7EA2F5D b/04
143,582,992 *0DC5611F9C2FB0D5AE5A20B69E88FCEE184FB50D 9.1.3...non-repudiation
143,582,993 *0DC1EE85D8DE2B9561D452FE65DB555662794E08 926192 acaba daha dikkatli bir planlama yapIlamaz mIydI
143,582,994 *0DCF3335EA91C8F92217CC985C524D7454C77E39 [email protected]!13ys
143,582,995 *0DC080E2D1E1AAF1AC841EB859E5B8B154C3A02D b-2g-
143,582,996 *0DC52D2BC08CBEF7B02CFE39C2940241655E6F6A b%4oh
143,582,997 *0DC32FBD566CC92472B708C6D4D126CE9AACF62F b8mha
143,582,998 *0DC3576D67F937EE4A98023983AF620B121AFEB0 bachelor_button 'b/&//ts//@/l/@/r_'b/@/t//n
143,582,999 *0DC8EC4DA675C5069452B6A3802C2046FFD21434 BACK.TO.THE.RIVERS.OF.BELIEF:.BACK.TO.THE.RIVERS.OF.BELIEF
143,583,000 *0DCCF6F8F8F3FC7870B91D8BD47D916342583524 9e$+cula+on$
143,583,001 *0DC4AD5F00F317149ABA9539B78802FA64134FDC 9ENTSCHAERFE
143,583,002 *0DC0FDD822DC12B860AC7EBDB0C67852B56944B9 9ETXEHREV
143,583,003 *0DC7564A1FB7A6FF8D51170FF872BB6D964FD21E 9GREGORESKI
143,583,004 *0DCD252781EBD902878ACF735B25554B75CEA885 9ILERREVO
143,583,005 *0DC367E474CC43C0A9BF89F914DEAC757ACA50D4 BARRETUM4
143,583,006 *0DCB56BA578292DF708ED846343B678585F76A16 9ONIASAHS
143,583,007 *0DCC51BC16AB5D6616EF9D639B2CCA01F5690F95 9RIFELTTORE
143,583,008 *0DCD501BFDCAF579A573EFF8FD9B192CAF4A6705 9SENSUURIPAEAELLIKKOE
143,583,009 *0DC53E4E829F9B775868A708035C6116305420CB 9separavo
143,583,010 *0DCAEE59B66AD5EE72795B9F2428A662CF99F266 bayusutanto
143,583,011 *0DC1E57549891B5E7C7E93D7C54E592B44E2AC1D 9SFRATTASSERO
143,583,012 *0DC1656E6EF125ABFD5E841AB24AAF092ABAC49C [email protected]
143,583,013 *0DC80C9E0024B9C340ACE96663508EE55DD44DCF 9SIMMISUU
143,583,014 *0DC735CD49EF40D77B7FE6A770E34F3587282723 bbb9l
143,583,015 *0DCD3FBE66213AB837FDE2730FBD799A707696D9 9TEEKKAJR
143,583,016 *0DC0475FDACFE9EFC07979D615666CAEDA0A6E5E [email protected]
143,583,017 *0DC607310CCDF42175D2E087BDD0B4D1FF2173BA BBNCCWAS3
143,583,018 *0DC5C3C48FC26D9179A0664B869FD10FF6460325 b=b `~splat!
143,583,019 *0DC33E60D9018F387533B67C86D17C831A47A23B B,BVG
143,583,020 *0DC45F9A911A90660A0F355769DAC08131F7ADBD BCLK_
143,583,021 *0DCC83B5036BA45A7944C0C96A746F7189837ECF b"cmp
143,583,022 *0DCF46EC3F1AA2B5919CF9AE4549135B7200B78A 9WINSTONBRAVES
143,583,023 *0DCC146D360FC0BE62210EA04C024EC9635B6F74 a0?km
143,583,024 *0DC98C2CA25535D0CBD13A22471EFE3AFAB77C1B BC%PO
143,583,025 *0DCA64FF8583803E07F0DC769671B5A5F8BC6D64 Bc;r
143,583,026 *0DC1B926C4D0F40C116ABEA7162978DB2CE5D35C bcrgzsbw6irujdy
143,583,027 *0DC470D6D00F1021F8657A30F796B163AC5BB20B a-3"k
143,583,028 *0DCE3A64C1B0EDB28E02BF335322323F25B5E25B a/3ob
143,583,029 *0DCC11A7EA62B5B1BB94E01DBB21DA6ACF10B1E6 A3st
143,583,030 *0DC29690E69C63E30785ABCE49480233E3FA198F a"/3u
143,583,031 *0DCD018D21E4D49319A4AC4F55D2F68B4D59F9B0 beaufortenargonne
143,583,032 *0DC4F065B3738596567958079F276486254B69FE a5#zq
143,583,033 *0DC8B3D41541A4CBCE36AC76217D8A8D50F2BF31 B%E,C
143,583,034 *0DC5D7B023DBFF2BE5FEE965943D50465C3A32F1 bec;v
143,583,035 *0DC57CC20CF6408BA70C629B21078A04F50015C8 a6h,i
143,583,036 *0DC9357B212C785FEDA46B3F7E31B1F2E27B5252 A%6PU
143,583,037 *0DC1FF81ED6197EFDEECE496060403DA57A909A8 beekpiraat
143,583,038 *0DCDF41AC57C3C0B4F923B2C45232946B34F5275 a9b!o
143,583,039 *0DC9BEDB1A9E996D1C67A9C0A3944CD4F1348E06 a=9gr
143,583,040 *0DCF9AEDA3D4E22A77C5B7FBF79BF2D30108DA8B AAA4V5
143,583,041 *0DC933CD90CDC801C8CFC9C9CE7F501100741A31 [email protected]
143,583,042 *0DC8BBE7BFF2215DF6C00F8317861839AD59519E [email protected]
143,583,043 *0DC1706C0ECA33E2FA3E8A3A6D646D17239A2C81 AAC7-K
143,583,044 *0DC6A13418EBEAE5B3295C418FDC695AFE7EB9F5 beu+l
143,583,045 *0DC648AABF5E8667299FCA5EBF8A63E3FB71D0D2 AACG#
143,583,046 *0DCF09FBBB1D284B2EFD1ADAFDF89BC282BCA2C7 bezwzgledna
143,583,047 *0DCD08ADD96850FB74EBF27AF8566FE4A90D12B4 bfiirish2
143,583,048 *0DCA934A57E2B03DF719D035CBEB3E8793D5E3E4 bgc;7
143,583,049 *0DCD57A60102A713B377C1D2359B4D123E26EC87 aa's3
143,583,050 *0DC40108157984F0519ED0BF42B01EEB5EF86283 aashvaasayeth
143,583,051 *0DC2086A2E9BAFA5235DAAB68E496707BF12132D BGQ12
143,583,052 *0DC4164E30AF7AD6B06B12E61DD48DED674A3B3F B:$H)
143,583,053 *0DC1848A80ADD1B22672E27CC2C796E2523457EF BHAI#
143,583,054 *0DC768CAD711C937BB2C634793DAEAED065B894E BHF9$
143,583,055 *0DC03BF30F5AC76BD9C7328AE3A6980046AF37A4 BHNH8
143,583,056 *0DCCA592E66A775AF5320427B454178993055210 [email protected]
143,583,057 *0DC3D2C46C3A7A6B2CAA00C3B5D880B8293558E9 ABDAG
143,583,058 *0DCA5D5EFC6C6E7379BEE30734DC97C304767921 ABIHP
143,583,059 *0DCDC376EE36918BFE93F3EDF54AF45E74DAE832 AB!LI
143,583,060 *0DCCF6138FA4E3F9901FFD31044D442F2209DB23 abrahamkofoot
143,583,061 *0DCF3A4DD89DF53281508E3D3D05C1B9600A7DA4 ABRAMIMBIER
143,583,062 *0DCF51B0219BD419EC377E416B342690435DAFE2 bj-0o
143,583,063 *0DCC004F4D38ABF064F05226BBC5331E0C670957 B,JXU
143,583,064 *0DCD6955831C2223DD7C36D37B97117240FA1D89 bkcvu
143,583,065 *0DC9FECB4EABDEED573C869AA90FFF0C510F49AB bl3o$
143,583,066 *0DCBE4097BAABB5FE4B628EB6986840FC974CD7B aclp5
143,583,067 *0DC5114BC65A9F8226ACAAC3B2AD68FC2C9B6E53 blairmckisson
143,583,068 *0DC168CDDBC7703FEA594F6D666A4421ED773CB8 BLAKETRAFFANSTEDT
143,583,069 *0DCB8194AAEC308B1A8AADAE376A812156D9ECA5 [email protected]
143,583,070 *0DC625523C4BA0CA4560738DDA1F3DB1E6EE40C4 ADAN.TWIET
143,583,071 *0DCEEA4E36E272CC0CBEEAA4B9461245AA1557B0 [email protected]
143,583,072 *0DC63F4497EB8056149E06AAAD419479C674DC9F a-de-la-sardina
143,583,073 *0DC11812EDCC7799364CA3DFFA26DC3D7953D5AB blutwurscht
143,583,074 *0DCB745AED51761824D06335E6504BEEE00456EB ADFRDSMNING
143,583,075 *0DCA89A2739CD05EA4434504DF2C6B4DF282591B adhiyagya3
143,583,076 *0DC18B0FF506A28E4A5BDCAD148337F703E9C244 adnirual1
143,583,077 *0DC08FCFA62FD32345C2F089E8FE094EE21D7A4B BMWDADDYING
143,583,078 *0DCDD12F6FF308546C8C72A750020A63F9E49011 b"ndlng
143,583,079 *0DC0BF89FFDADD67B9214398844B16F34CF60F91 b=nf7
143,583,080 *0DC80ACD24C42E9137D468A7977DB026074857B7 BNUFP
143,583,081 *0DC3A3D38D57B68827F638063E9419620DB7B3D4 adzd1
143,583,082 *0DC49107D1378F463452FBEAB874514E3487C17F BO_-H
143,583,083 *0DC77AC2A893684E03597D25577D210B3C06A5EE boiledangel
143,583,084 *0DC30B196D74AB5BD08D8039E39C1F9A97B9E023 [email protected]
143,583,085 *0DCAE3323C2AB0EB0E82E7C4422F38EB8E9AD7C3 bonjourde
143,583,086 *0DC5ED7D32ABA2738FB0C45DFD9107E15EF67D34 BONNIE-CORNELL
143,583,087 *0DCB2D5A62F202EFB8A4D59F26175B9BB98BDF0E afr$e
143,583,088 *0DC382085E0244825DFA30F1EF288322585FF626 AFSPILL3U
143,583,089 *0DC14B065076E1EEC5E7B83943DBD2EF31735A7B AfwA
143,583,090 *0DC6B761D7B44E1157AD4A5356A572E276D513EC BOX_CAPTION_POSITION
143,583,091 *0DC89AF0502554078E3D07BB09FB54A270FF93E9 ågårds
143,583,092 *0DCD6628BC1547ECF77ACF44AC87E80AB6385CA1 AGNOVERE3
143,583,093 *0DC6F06227F8F7A7FD9FAEEB34F2A4FACE055DA5 BPUFW
143,583,094 *0DC98AC64DD0C64F9AB79F63CB52408E98BAC95F AGRT9
143,583,095 *0DCEC55C230162813E78FD9E46A6D88710487440 bqhgh
143,583,096 *0DC8DE1AD22E136674E406FD180DDB374ABFDC9B AH-3=
143,583,097 *0DCAAE3927597D323588CFA21E71235CD59CFF0D bq;ql
143,583,098 *0DCFB304D56AE344B37CF55196EE53DE2543D7C6 AH!GO
143,583,099 *0DC8D776A59852D4E1FAE1E20A8300C4F5FADEF6 BRANDEN.LABAUVE
143,583,100 *0DC92C12DF0E31FF61105B843165175047334CBC brandenturner
143,583,101 *0DC8BF05A0A0DD84D44284D091123F46DCB2028B AINBE
143,583,102 *0DC94DB7078DECED629CF843194254A670813286 breakthephobia
143,583,103 *0DCD362DED6337217BB48D77AD258536B4279353 AJ3Z,
143,583,104 *0DC5EF4F662F4FF701CCFE83F36F65ECD576B1F7 BRENDOD
143,583,105 *0DCB51B4583FAEC724C226308895882C0BF5A5CA ajaxians
143,583,106 *0DCA89C2CC7727DF19E3DF93AA8A4E2C1EF20A4B ajhg
143,583,107 *0DCF5A89E4C34C9584A21078449557A5696DA4A8 ajmy/
143,583,108 *0DC4869F467CD7E66E9FE4DECAAA1E27DE5871A1 [email protected]
143,583,109 *0DCD34436903EE738BDA266860C2FD92159ABF5D AJWT
143,583,110 *0DC0BAE9CCF8C884AEE8B23F7D5C5EA8D31976E6 B?R.F
143,583,111 *0DC28DD03E432DFBF627B27EF8CB9662003E49B2 A?K:
143,583,112 *0DC42C393D6328D50A0AB7B2050EB1B201F78AF4 AK$/
143,583,113 *0DC0EB74C49FB028DF9ADEA878E65093FFDEB628 a=k3$
143,583,114 *0DC98D39443D8E272B7F6606401C4FEE86FD6F88 Akju
143,583,115 *0DC66E45CE8BA6ACAC35E20E648F6D3D38409463 al4a!
143,583,116 *0DC9BB1A7EE35A1DC7F527227F86D2760322D779 AL!8I
143,583,117 *0DC7606ACAE07E18DF8DBE289CB64F031DA8541F al9&6
143,583,118 *0DC79826FD06067A2DBB49DEF29D00E0E71E6741 BROYNATH
143,583,119 *0DC00EF97BFDA1116D036ACA862E31F9D72A84F1 b?snb
143,583,120 *0DCEEA65F129514C43A4B2701BAC2B91F6B0D1C1 ALBERT.HUTCHISON
143,583,121 *0DC34235353F7DD25EBCBD8F91C3BFF316A34A32 [email protected]
143,583,122 *0DC7880B8185F8725618D14D54083957901E9743 bs%um
143,583,123 *0DC107FB1DCA08F05DC75343BC6E09A4F6734A5C ale31077
143,583,124 *0DC1663CB7F436A69FC2E268D4AEE354D392CE70 alegionofillusions
143,583,125 *0DCA298DC10B71C799B62CE91C00E2943A49D54B BSWSCRIPTXBSW
143,583,126 *0DCA67C465C655E9299C0EFBED73E758A26D9DB7 BSWTARSULASIBSW
143,583,127 *0DC1A82534189D77F8ABDCAE50F2EF5C8FA44035 bswtopquark
143,583,128 *0DCA1DCA726ECB5DDBC21BFE3B882936CAC5EE0E bsx3s
143,583,129 *0DC12A893D46EB7A897C24BA34D195766C0A1ED1 ALEXANDERLOGOLEO
143,583,130 *0DC52BF12AF710B2EE3D72DE90C69BFA916E83B9 btgep
143,583,131 *0DCF8B26541CF71E086F18F0E6CCCBF1702BD67E BTJM6
143,583,132 *0DC59C7E8DEA68FF0A24C7B5B4F24D61915921E5 BUDDYBOREMAN
143,583,133 *0DC5BB616DC70DEF60C7290AE87383B9A5D95A4F alhm5
143,583,134 *0DC9ECF8CCA38B810DE4B1E850F3EDBA5F6D9F00 ALLANVERA
143,583,135 *0DC578C15D4C2201D8DEE9DEBE46384781CF9204 allensirak
143,583,136 *0DCA24C403CDBA5A8FDD3DCC5BE9446532F1DD2E almyhty
143,583,137 *0DC998EFA4CA2BB46989C53B17BE7DC06A540CBB ALPHONSO.MCCOY
143,583,138 *0DC968A660ACD4C60A3F70449AEA11A1FA5BDA46 AM1TH
143,583,139 *0DC3601FAFA9160C8E029B7308534A4EACEEB6B4 BUW5
143,583,140 *0DCC7DA65DE6D2D8530E2DDE1FE9BE13295B9F01 bv3ca
143,583,141 *0DCDCF725B1F24CCC9D20FA6D0025FDC3107A825 ambrosefornicola
143,583,142 *0DC858AC7B66549DA6B515F6E1FB750E2C53078B BV!SN
143,583,143 *0DC7395A063B2DC175F49FFF77825DEC9FF24F18 AMIIHSIN5
143,583,144 *0DCADD1DEC6507732669DDF1E50C4D7333B9F2AC BW9P
143,583,145 *0DC028E8727140864E1A869FC67763F31EE8B9B8 b=x)l
143,583,146 *0DC9FD5A9C1B47A82C079D1D055AE192EF3C2917 bxl8b
143,583,147 *0DC5D7BEBB898A7857F5FC284EE09FDA322817E9 b,yjk
143,583,148 *0DC791C01D309576B80AF6929E9805F9C88E24DE BYRONDEBEAUMONT
143,583,149 *0DC184FA0589B607A4508D0A1578543092ABD3FB BYTHEWAYSAINT07:23:3701/08/99
143,583,150 *0DCE31DECD53568EC7071A5A74DA47796BD1AA89 (グリポ、ザコソルジャーb、バトール、天剣絶刀
143,583,151 *0DCCB3E5D1233A8C16FB50278FB7B657B2FB3BCB [email protected]+
143,583,152 *0DC204FDE8E5FEA73D44242EBD761288BEA3DC83 c0v#d
143,583,153 *0DC57FDB3D833E6E7BD22BBC1A56396EFCAB0910 [email protected]
143,583,154 *0DCDC30F3842969E42D7000071092457C705E589 A)N&
143,583,155 *0DC1D240AB2DC80520A32E5108EC59F896AE02FF andrewbombard
143,583,156 *0DC75E9F8D0F3FF5F21E328607A3D6CDE170E27A C45;J
143,583,157 *0DCFF13218F605B46314C82A17598A435BF3F807 [email protected]
143,583,158 *0DC404DF5B1390667B48813ED98DD2255F289390 c4q+f
143,583,159 *0DCE85F5459FC3D19FE129AC82EC7BB3BE6CC451 C6PB4
143,583,160 *0DCB110A41212E1B389633EF67F741CC66B1EAEE C8AG$
143,583,161 *0DC1A26597D398C44F22EA22A5738383543DB0BA CABBAGELEAF.MINER
143,583,162 *0DC6BD890B0C78B177844EA761CD5AC76BBB5C08 caleta.lenga
143,583,163 *0DC956B1B6137547F0C923C4D1D75497BDEFD020 CALISSERIONS
143,583,164 *0DC8C3C8EFF6B76E26B8CE294AF5FC759B0BCA94 『canaanスフィル』
143,583,165 *0DCE27215EF8AC508D8843AA27D31B7CC66635E9 antwanfettes
143,583,166 *0DC0D049E3D88149436AEFF333E6DABE6A2C6020 careacttargetorgwww
143,583,167 *0DCDF4E136B9A0B07500A9BD7298976A1D47A516 CAREY.KRYST
143,583,168 *0DC0607838C6D84CF07B8790A4D5A3BA490A935A AOEU2
143,583,169 *0DC13A8426070511BC0B7D66AE5793750B0E2FCB APCF8
143,583,170 *0DC1D30A293BCAAB24B5489C74E018079E43B5DD CAROLESHANNON
143,583,171 *0DC23CF9F4CE3E84500F1F5B875D2B3DD2A4C365 CARTOONBOOT
143,583,172 *0DC239C1E8B703FCB494B5CB0431F763FD0954B3 CASTANHÓS
143,583,173 *0DC00ABC72A87044125367D4D340A20097E569BD apotamonautes
143,583,174 *0DC80B1951F00537CC5CD19058431E2C626181E9 APRAHAT
143,583,175 *0DC317F2D21CB34A568D44EA0334A8B5E3A72FB8 APRLE
143,583,176 *0DC2AEFADBE2EF5375665139F24061CFA4CB3FF6 A>,Q
143,583,177 *0DC61BD86F66B25D6CD00B40DD20E45C0777875F ARCHITECTUREVIEWACORPORATEEQUIVALENTOFTHECLASSICALVILLARYEBROOKNY
143,583,178 *0DCAAC085C37AB54C814556405FD00E8A1BF8422 [email protected]
143,583,179 *0DC07DBC2483273251E2FAEA7FE52CE0C009CE4B CBUZFULLER
143,583,180 *0DCAA3147D6B2DE289C74BFDC3389DEB99AE924D ariv4
143,583,181 *0DCA8ACBB88AF950667CB6A945A99A8CE5D833F6 CC-EPFOUNDATION
143,583,182 *0DC169DCFD9DAFE3517D0154E0927835F7AB0604 ARKEYBLUE
143,583,183 *0DCB490D849C7CE994C86089F3DD5DB395765C17 CCLIFCORN
143,583,184 *0DC8F12E96DF4213D9E9ACD862C1CF569C2BE27B [email protected]
143,583,185 *0DC862C0D00B64185231F54AEDF9C3B64CC532E5 C!CQC
143,583,186 *0DC7C2CF95F7155ECE0CB93F4154C9281C7A58EA c!dha
143,583,187 *0DC86D68B80E62146BCF117D4936F487433972B1 CEDRICK.CIERS
143,583,188 *0DC8E08FCE0860A4E300BEF01C5EAF7AE5D64346 ARTOCARPUS7
143,583,189 *0DC78382ECF1F3F548EBD1FEB27E02BB52C5071C arturotevlin
143,583,190 *0DC82BBA7F1454487A694C899D53E7F9C9FD5F48 AS8NY
143,583,191 *0DCDE31537939F0C6BB5BCB63FF273B61C20FF2A ceramalli
143,583,192 *0DCA7D743ABAA5BDD1377BDDA5098B34E5DB3001 asevoiman9
143,583,193 *0DCAFD8E0E7CF88C3268439F53230AF8F3400BB1 ASIMPRARI
143,583,194 *0DC39B959BF50B7E21F93D4F6B72E9018982BBDE C$FIO
143,583,195 *0DC5D2DCD0949FD9DADC182B0AF7DF755D376578 a-s"n
143,583,196 *0DC27A981CFA4FE8AF93192EEC5005819074DAC4 cfo+m
143,583,197 *0DC00C5855EBBC3647395042FADF3AE390C1509C ASQGS
143,583,198 *0DCED3239AC6BC704EBADF578575A98F5B4886DE ASSOUNA3
143,583,199 *0DC48B59356C8308DFD98A403879305C4E1AD6AB aswtp
143,583,200 *0DC94F38C3654852AC5291A4EC2E959DE2FD2BF2 cg"lm
143,583,201 *0DCC3F513181E8A2770CDFA1E6AD720E7DF776D3 c=h"4
143,583,202 *0DC07ECFFA16BC66C44255FF33465781DD7DFC49 CHAD.MONS
143,583,203 *0DCE5F2BDF6BC0AED1ABB146DB65B1EB9E609804 chafaudages5
143,583,204 *0DC86F85CE8596A34EBF201664B826E91882D2E7 ATNQV
143,583,205 *0DCF24E2B8321C0B29B95E229E577A6315A39545 CHAUNCEY.SCHOENE
143,583,206 *0DC673B4D394385D727A47040E6EB02BAF4EC956 [email protected]
143,583,207 *0DCAD81E731C996DFB21FCF5F814E814291FBF52 [email protected]
143,583,208 *0DC1F39B85798F06E9A4ADB080EC4FC8055593AE ATRAVEZADA
143,583,209 *0DCB73B629A3DBAB5DAC4ADAF63D6C25B2E6C167 chesterhollan
143,583,210 *0DC6F0409BE4F490F26A0E66AEF67901DA419FDB ATTERKAMNTE
143,583,211 *0DC4192A1A5D0461D818DC954F7297D9C4860F6A [email protected]
143,583,212 *0DC59985E2BC20BAF7B111DC117EAD998DBEBAEB CHICHI293
143,583,213 *0DC4FAC4735751E588EC7E6792ACACF20BE2FF1C augustbuckwald
143,583,214 *0DC22FA34DF23277C3748EF0ECB5C7352E74E186 AUGUSTINE.RAWL
143,583,215 *0DC9367FE7424E383BC7E01170408ADA8FB77DC7 AUQA"
143,583,216 *0DC125B5BE0DCF1AAAA559CB07564D6BB038B9B0 autolibbed
143,583,217 *0DC404FF0EFF2F4AEB840FFA3C383E9C0D55AB1E CHOKESRAVEN9
143,583,218 *0DC3CC0ED78700EAB6B1805D0EE843E121491B3E [email protected]
143,583,219 *0DC76AE69A22C9658B77B9EAF73C3C9699EE21C5 AWESOMEAGGIES
143,583,220 *0DC100DF45A6D726308B737BBE91B2E72AA48B8D a:wh-
143,583,221 *0DCF03BB95F4639700216818CF0705039FD19EEC AYT)D
143,583,222 *0DC76B980EA20E84D659787FEB56816753970F80 [email protected]
143,583,223 *0DC72217809B2E47E30C7A4AC417F1A26E43C973 AZZA.FARHAN
143,583,224 *0DC57DC0F553DF8B28E10297F3A9BAE3D9369A4C azzizz
143,583,225 *0DC02F844209CA5F2E3DF706A5D7070DEE46E26F AZZURRAR
143,583,226 *0DCE8D1848105F20FD4D4DB6C0D8BF5A529E508A ><.*.*@=b
143,583,227 *0DC9347922A1DCBF7616B1A83F06B6697EDF6CA1 >< ~` ~`(#####B
143,583,228 *0DC11E184AF36EAF98666C15C3C6F62458A0F9E5 b%0k6
143,583,229 *0DC76C67C0A2823C08FE5B905AC66318BDD4E023 B1?CU
143,583,230 *0DC9FDB6EF70AB1A6350A95E9AFBE98C9BDA3CFA churlishly8
143,583,231 *0DC52933F60C985CC757BAE2A1107380499157DE CINPE
143,583,232 *0DC0930C4994114BD6B08D5711AAD1942F9E97C5 cins!
143,583,233 *0DC22AAE8ECBB5059DA6BCCC0347F0E3447877E3 cip./
143,583,234 *0DC172DA91F8E6C0C43D30CACD418A09AC8AE369 CIRUOSI1
143,583,235 *0DC2265C180BCE5AA969A8C3061009331EB309EC b60qx
143,583,236 *0DC15F61210152D281CFB91A9F1A1037EF9C770D b6dsfall
143,583,237 *0DC4B1A734F85DA18EC2095792C891E3E32ED1AF cj94h
143,583,238 *0DC72999F28C0564B81C417064C21CE642BD892F b8lv
143,583,239 *0DC5276803220E688AAEBE77A9457124468934F0 ck&;d
143,583,240 *0DCC2375DBCE6263CA561C3454C640B5A6EA5E1D b,8si
143,583,241 *0DC4CD7590F108BE33ACC7592B51C5C8202FC764 b9i1
143,583,242 *0DCEE9B191CEC4D8E0AD099374413490077B5EA6 BACCUS241
143,583,243 *0DC22F8ADE9186DE766E2CC15DDE8449F61CD71C Bad Communication (00018)
143,583,244 *0DC8A3E5C3447790CD86B5F3BEDEB691ED878533 [email protected]
143,583,245 *0DC637951162D2C9CBF60D67A47315CD008F73BC bangaiti4
143,583,246 *0DC76FC1EC823014544F65536691D5942B4128E6 CLARKUDICIOUS
143,583,247 *0DCF4E3596AC14EE1C518126009161F9256D8D55 [email protected]
143,583,248 *0DC5411ECF621C1A305CF0E08B77F6CE25221EE4 BARRAVAM4
143,583,249 *0DC59EE8BB29E80C7CFC993933BF43D76C9CDABE BARRY.NICKLAUS
143,583,250 *0DC968EAB92A11CBC304936519C9A2F5CB2C77B8 BARTONVANDEWEERT
143,583,251 *0DC0BAEB2AE286EF1A3401B08A2087849515468E [email protected]
143,583,252 *0DCEE4E0CE7813D9B3D66A1F0C58562C11B9663F bau+7
143,583,253 *0DC2D48278281E0E233F50228F7DDBB99D9CFB24 bb)1h
143,583,254 *0DCA6EE3B4353796B2DB5A7C28BEAE86FDB50960 bbb-h
143,583,255 *0DC4F910E15555FC6800361BE89CE08C651D30D6 cliftonemberley
143,583,256 *0DC0F3EBD45D15FBEAF0B84036F7DAF6BE0268F7 cliftonmutty
143,583,257 *0DC671114EF708D57CF18C61FD726B7B1131D75D CLINTONJOKINEN
143,583,258 *0DCE39536330D1EB83DA6D2AB55475A1EE7570CB clodeaner0
143,583,259 *0DCE8CC9E2AAC191720D9F44BF93B31D95C21EEE BC-/
143,583,260 *0DC856F7A94A3B2A9C9A347C017A0B02D2CCA8E1 CMD"=
143,583,261 *0DCCEDE0A514AE3ACCAA1F2A362DDDA52A8FBA83 b-:(d
143,583,262 *0DC83761F7B8933A51B14D402AED32194CF562BC bD-I
143,583,263 *0DC6AF6557BAC537C496AE50EE30CF65E7CC17C2 cndscndt8
143,583,264 *0DC724A4214A9EDFABCEB70CC8AA3B5B6B7D457E [email protected]
143,583,265 *0DC697D5D2EA9F1C4BE7D200A5711B489C2F30FA be$7a17y
143,583,266 *0DC771B667173B5203E5844686F0B1298D9BF441 CODY.TSE
143,583,267 *0DC3F596E2E0AC8C868F6E95ACF3E0F3FD5003AD befarana
143,583,268 *0DC60A1593C88D9A2303F495176C5ED4BF2CFBB4 COLBYANGELOU
143,583,269 *0DCCA59E183E5F02824A983883C96924F7F251F8 BEHÖLLO
143,583,270 *0DC45A8767CD3C9342D3FDC2CCF2A30454875775 BENDRIEDGER
143,583,271 *0DC9DB230A6AC728D9CE24878314AD1466168665 bengt-hasselrot
143,583,272 *0DCBC8F5C216A33DE7B3272AA9E0726BF376D215 columbusojito
143,583,273 *0DC8324D19A7DB75F3207D4477E1FA62E315DABA COLUMBUSUCCELLINI
143,583,274 *0DC4CE678908376FF10EDF43BCE8E4709A14D272 BERNARD.MOLTON
143,583,275 *0DC238D173DCCE69AF7B896B242A354191B6E401 CONGO》218
143,583,276 *0DCB7E1B8D783E8F6B68728E15109D9F502642FD Cons7ruc7ons7
143,583,277 *0DC201CF058047A778D4D756F13C45FD0065A2A0 BEUE
143,583,278 *0DC40A3497A9C5DA81B51AB894D0DA2233D082FD b.gb#
143,583,279 *0DC583D04329663C0D896AC59AECE9417A900A03 CORPORALIZO1
143,583,280 *0DCD46130BF3A0F74F09188E5B097476AC16A5D8 BGFQL
143,583,281 *0DCC9251A099A03DBDF19BD6A5933F357063AB24 b?-h7
143,583,282 *0DC8BCD53063AB38E112E8DAFEDAC155B2810A95 CORY.TEANO
143,583,283 *0DCA09B3F0A5DE1805E4AD1AAC79B0E2D6F9B36F co?st
143,583,284 *0DC64BF61CF4203A98D68696D3A10740232813E8 COULDIHAVEBEENSOBLIND?
143,583,285 *0DC92E679CAF64A3BC20B018F8FDF70ACF2FAB19 bhn_c
143,583,286 *0DC418CD37CB3D50B6C3981B71F901A3BEEEC41F BHUTANSTUB
143,583,287 *0DC674B0DBE70A186FDB29B1B4F9A46333B15D8B [email protected]
143,583,288 *0DCEFBD800A269EA57D832D1DF04F333DBFB5800 c-pu=
143,583,289 *0DCCECD3BEDA2C1BF0B374976034060EA8D6E553 BK3:Q
143,583,290 *0DCE3CF4B64A6ECFA23FD8B2D258847A43A3A9CB c$q=k
143,583,291 *0DCB23CC6B1BE303F6AFB4251F0A8ACF3041C956 CRAIGHTON5
143,583,292 *0DC1E386A1AB624021DFD8232BA61BC49383E457 CREPM
143,583,293 *0DC2D08EB727F12D636E2E50529BAC66FBFDFC28 crickety6
143,583,294 *0DC3D08928C88CAF7052DB2BC106F47FCBDEB00B BL,K+
143,583,295 *0DCDD099C3ECA8B7A98EB0344B1334390D24D8E5 CRISMERO81
143,583,296 *0DC76D5F2FABD4F011450B2AC99903287D741F66 BLO_
143,583,297 *0DC00BD0D4D0CC25AD307FDB5514356F9424B2B7 CRMO/
143,583,298 *0DC6111F88F43574E2507B47EE791B14C3EF0022 CRUTHER0
143,583,299 *0DCAA3C8415FED2CF94D6A09971ACD9CB25B7475 CRYING-MOON
143,583,300 *0DC11CB291C12150FF69D20C280A6C6E10EC2057 CS656
143,583,301 *0DC583E58EC8DB0642851FD081D0F7D0CDE07837 b#ng)
143,583,302 *0DCDA1ED17A4440D230C2E2D0B245E4D01B7828B BNĦ
143,583,303 *0DC728D78AA5AF3A7A72DF1246A60E050439057B CT6S
143,583,304 *0DCFAB4AE7DFCFFCAC9B6058BD74AB43FE306B80 CTlc
143,583,305 *0DC267C4C396E98898320F4807C0066CF55908C3 ctq9;
143,583,306 *0DC8D2E05A742E76B73CEB6E41DD2428C5C0AC35 c;ttt
143,583,307 *0DC885FA73D596728443683B24927331352008B3 CUAGO
143,583,308 *0DC9CA750A596D56005A3C1F22C9FD3363CF988A BOBSETTINO
143,583,309 *0DC4B9D1A0CF0D9D3F99BECCDCB14FFB702E18E6 CULBARD7
143,583,310 *0DC3E7A47630E1149CF11717D3000A23A34A8483 culen1
143,583,311 *0DC6B161996E66FA9356C88C7302451E42D4F32E boleyn''jo
143,583,312 *0DC91869084416A93469271E60F538DEFE3824C6 boo71!ck!ng
143,583,313 *0DCE00F9442E2E054F50A525562E16C5D31BAF4D cuu"g
143,583,314 *0DCBD27A1C274A6BB1CE3BBEFAA7317917B10602 cuux8
143,583,315 *0DCE5383F7993FE40F5385567883A4EE0A91782B cv8qc
143,583,316 *0DCB8102F8B119DD97187D30FAE25289E6602F3B CVG_V
143,583,317 *0DC4D1C23C964A56504B40F88F7EC98751AB3DA0 [email protected]
143,583,318 *0DC573CED8F6C4C147B8EC4398FC4411420D312A BOUSSINGAULTITE
143,583,319 *0DCAC794C783E7E73F2C44CD9BAB031EC81E7F41 cwjjn
143,583,320 *0DC30AD3E66E92DBAD66B208EA7E6DFB9DB5B4B7 BOXHAULEDS
143,583,321 *0DC5C55D284295BC64604DD10D26D60E05F9ED8A boydklimesh
143,583,322 *0DCE09E1DB9D56C0E9DD7C4C3F099A28F55EA4DA cx_.,
143,583,323 *0DC5FBD1646B125DAB2F84560B0C8E8C4E9832C9 b=.=p
143,583,324 *0DCCD02461342E23DFDC563D93DA7ED7B169447A bpc0d
143,583,325 *0DC690D7A39EE8DEB30CA1433E1D82A3347A6716 cydalia5
143,583,326 *0DC1096FCE636AE3C07FFD09841B71C2CCBF294A CYDVQ
143,583,327 *0DCD11E091CDB2F2C3CAA1ED751640C0FDAF4689 bpptn
143,583,328 *0DC6943CB154CFBDE3AEBA4A78F85358E48A4372 CZEKED
143,583,329 *0DC69836FC5EB1B8A1A054F89B0A187E51071F9E bq;at
143,583,330 *0DC32A65209C229A907D5F48CE24B179EEF01F4C bqiv7
143,583,331 *0DC22560EE4815520EA3B07BC692B47904DED36E d<@;
143,583,332 *0DC98BBF0D9BC25FEBD39F7F94AE31D640E42EE2 bq+pk
143,583,333 *0DC01C5CEDBA7657AA63FE4645EE6C9DE9AD4BAD D29HMAS
143,583,334 *0DC2168D925F720E860ADA58AED0C2A4FDD13CBF Brandon.Luis
143,583,335 *0DC269EBDA5F222859506F0E1866F1A899B0E0C5 d3e;:
143,583,336 *0DC079E06E097341B685A90EE3C7C598320F21FA B!RB
143,583,337 *0DC4D10AC289686A6D959B0CCDC186FE262C7D09 Brecciate
143,583,338 *0DCC4814862F07A75189C98E7F07FEE10AD97FB1 bref-
143,583,339 *0DC43E5468FD9FA98B360793E53616F08B3D6310 B=REM
143,583,340 *0DC306D306B462D47FDCDE87394074264675EB94 d3t3rmn5m
143,583,341 *0DCFC6199BB964CF7DBD249C37E35238A4A410B9 d42u
143,583,342 *0DC09A8BFF644D9FBCE491D9DB13F30F07F211B5 [email protected]
143,583,343 *0DC90F6779EA822256AE38F3E6B874E8650D53DC D5W2C
143,583,344 *0DCA0D910B8A1DC4BD3FA50F1AE4F1A85089F953 d60cl
143,583,345 *0DC078EF772219968F8956ACB349C2042B5130AD brittanyelizabethscott
143,583,346 *0DC851B1F4B3422D15DB9111D8541D4F588E0759 D:9FE
143,583,347 *0DC3E1D7F1B5C6B889241704100FA9980CFD8E17 Da,8
143,583,348 *0DCDAF10E750BC2E38A0ED56936779921C8F2298 BROCKHURT
143,583,349 *0DCEFFC10A0369C54174989F12C40E9868F94CBA BROCK.TEAFORD
143,583,350 *0DCB825072B97F0CDF03A7678655EAA83D445DA7 brootens0
143,583,351 *0DC7B90CCCC44FC3B1964367ACFF60482FCDD2BD BRYON.ZENON
143,583,352 *0DC96788F1C428C4356E8054A35EF837CD2179D7 BRZKYCH8
143,583,353 *0DCF030A30D99A9F18205CF35C66C9FB4DE1AE5F bswhobiecat
143,583,354 *0DCFC97A2947AAA8506679856B43F75762617C66 BSWRCCLBSW
143,583,355 *0DC425C51DB9F4C84F93D6B4593D2C7EE016B138 bubbles1967
143,583,356 *0DC0B1D4CA8E5CDE3236642CACE4100D1A501EE0 BUCCS99
143,583,357 *0DC957E07C046B0959B580C99A41A8D92374CD57 DARYL.YENZ
143,583,358 *0DC3720EF47CA642ADE134351ECC57CBABBBD82F BUDPEHLER
143,583,359 *0DCA374EF5254DB616A5B878E8A6122AB558B7DB davegails
143,583,360 *0DCFBD95561459C7D4C6F715B76E11705EC2C1BF davisaxe
143,583,361 *0DC002CFFDE34C3A2EE7DB2D949525CF5F62B84F BURDENOFCARE
143,583,362 *0DC2C84B4CB2073F92777ADFAD9336FB2276DB16 burebist6
143,583,363 *0DC5AEBBCBBCC8E7D218D233D87709662E1FCE10 burtheads
143,583,364 *0DC64DBD3FF4C588CCEE45AAC49A89B0E3255510 burvm
143,583,365 *0DC0731C4EB4D806416EC8933A7C54AFB24D9A87 But-Nothing-Ever-Change
143,583,366 *0DC273E42FE419026069AE93D71AF166F17EACCA Db)O
143,583,367 *0DC6781EE94554DBE8789EF39E945DC3A25CDD8F DBVNL
143,583,368 *0DCF0F8EA043862216CDFCF7BF9FF80EFFF92AEB Dc7G
143,583,369 *0DCCF43E85162A4B54CBEDD543268F1FA754985A bviy
143,583,370 *0DC8C558D180195E887B8645F3A1FDF0C70A8026 DC_L
143,583,371 *0DCA0FD345D01DDE06CC77DC22EE28169A5AD53B DCRB0
143,583,372 *0DC8E02E5B66D142DD98E4F2E1D6F8BF405A2B2A d)%d:
143,583,373 *0DC47A39FB2BE64157B4FFB36C1055A60ED92AC3 bw=ke
143,583,374 *0DC6AC031780F7315FAA764682AADE70786F7712 b;xt
143,583,375 *0DC1781633B4C46376ED5FF4FB4A48B802FDF4DF BYRON.MALCHOW
143,583,376 *0DC575407D3FEF80EB11F46B52A782AD4F47E56A DEBBENU
143,583,377 *0DC5719BA811FDE925C9B519143EE635B96D212A d%ec=
143,583,378 *0DC3F5D6ACCD0A0FBCD14BA37FE0D3E5BB9C96CE bzvp0
143,583,379 *0DCC441190B359B739B070E30E03331D0328DDE5 c%0bg
143,583,380 *0DCCE4AC0A0C4652C9EEC2A5C3690B6844F5BDC0 defragmentation
143,583,381 *0DCE034358A73EAD509B368F1D21617F0BC468BB DEHVONR
143,583,382 *0DCE0872747E32B523E300D5072F9712720AA016 c!1!4t3s
143,583,383 *0DCF2EE53FEC4810AA515AAB8F2D39D1122F520B DELBERTLATE
143,583,384 *0DCD9A0DAC5E195B98FEE46901F93E84FE35102A DELEGARAS1234
143,583,385 *0DCD4E9B44B0540C9A974CE79FE2BFC0CFF3CB99 c2:hi
143,583,386 *0DC027B3055D5DD0C70C9D7147A68210D9DEFE30 C2uK
143,583,387 *0DC7DFE47226424F091D88A40AF0A173094EE258 C3WAAA
143,583,388 *0DC6E7D230741B44D16FFAAFE405F2759EAAB6B8 c&&:4
143,583,389 *0DC9A4245BB0C646D6B1565AD69E77C476396DD1 C4/IU
143,583,390 *0DC9B5D6B4769BDD69FF1649353812EC788A58F4 C5GB
143,583,391 *0DC0470564C71E432B4154D93FC9C7268A3CB0C1 C5W9T
143,583,392 *0DCFEF2B98BC46E9B5A4781411845C5F791B71DB C6M1R
143,583,393 *0DC9019FECFCB54B94E89F56EC08A7D720882532 C71GS
143,583,394 *0DCF3EA4F8FCFB5C50D7A2D97755DC860B7DF44E c7(o%
143,583,395 *0DCD17EB215691DD62FC19AE8CDBB01997DF4078 DELMAR.HANUSEY
143,583,396 *0DCE866170D49C93921821F4F1AF0133BA5F5F48 delmartelle
143,583,397 *0DC7D03A4645A46C6F33C2FEE5D6C7ECC2461667 DEMEAN9
143,583,398 *0DCB6BC33B05733A513939E8ADED45AF6D2BD0C9 demuntay6
143,583,399 *0DC494872988CBAF98DF058F42F14AC1F5E7E0A5 c-aeu
143,583,400 *0DCCD2B4D32CBAF35EA5A1AF4A708584E805C00F CAGEFEST
143,583,401 *0DC18FE3AE0DFA815F4AA739EB324746AF56331A dennycanniff
143,583,402 *0DC7A4FC5D859D303F1BB648A0D7ACF23CD8AD86 [email protected]
143,583,403 *0DC103495824CC16E780E68662F00B934F5EE236 can't.go.another.minute
143,583,404 *0DC0FA4DEC054D92E171AD57F9FBC37C0FBE9463 [email protected]
143,583,405 *0DCA1E413BF0E6B3ED3C387E856A0820DEAF5661 DEVEANEY
143,583,406 *0DCAA220D06B646E4A60A075CC3BF5BE73A48A66 cariren4
143,583,407 *0DC030901DB4A6B47C706A800456F5C2B6A20365 CARLOYERENA
143,583,408 *0DCB45A22D7371024BAF709700748C6172B3C9EF CÂRMUITORUL
143,583,409 *0DC4E0E2BE74B7085661BA0739AAC2F6ACC47398 CAROLINA964
143,583,410 *0DC8BA1D49B6D7E9C669F9B34C0DD90AEAF7E80D [email protected]
143,583,411 *0DC68106A59F5A6D1C85DBED5A4AA38B7150A642 carystadtlander
143,583,412 *0DC0AE97B628B504C4A3D33C0ADD9C9EF6167337 DGPG"
143,583,413 *0DC8DE7FCC86AC87A75CDCADE998AADD8D809BC1 CAUCHYRIEMANNSCHEN
143,583,414 *0DC80272672B521E91A4767D04E8BAF798943F7C dgsyq
143,583,415 *0DC7679A8A1628DD6D0B3984EAD39E3A3FD40B5E cb)=/
143,583,416 *0DC3D7A9EFE6E86BCFE424E34985AEBA2CA1B5FE dh1r2
143,583,417 *0DC4E0EAA8E4E82CA040D70F91C886EE8F529461 dh8g1
143,583,418 *0DC9B4B5E27EC8268AFD5A3C103660F08D13E8A9 c/bl7
143,583,419 *0DCFC0EAB6E585B1F8AE078363EA6CBA09DF4309 di3$;
143,583,420 *0DCCDC87E74AD813197758387CC1FD88B918FDAF CCLINIC5
143,583,421 *0DC00E56D32CA8C9FEBA64B3EBBCDE0792165807 ccqx5
143,583,422 *0DC455BBD0BC516AD869FF15F66F86B01FE7F729 CDNQ
143,583,423 *0DC4C94521E2E3FE7A3CBD986CBED6F4DE1D75D6 [email protected]
143,583,424 *0DCD2F46E2395599887ED336706311500C223141 DINK-SWINK-(COMEDY)-(FEAT.-LLOYD-PERRYMAN-&-KEN-CURTIS)
143,583,425 *0DCB75EDF71CECE424B146348FA7EF17418D4919 C/EE2
143,583,426 *0DC713C2454B00649C272B4F334A2116CE2CE172 CEECHANEY2000
143,583,427 *0DC00E466B845E3A30DC57DD0549D9F422C4A614 discoqueen:greatesthits
143,583,428 *0DC9D2DC3619211050DCB701051C0983861A59EB cerebrapped
143,583,429 *0DC9B741C277BD46C8E962AF8901044F68761FCE DIVISIONE9
143,583,430 *0DCCCBA6B20CF78BBE91724E3129C46A6B4EBC6F djafe
143,583,431 *0DCA54DFACE4F8FE43D2A68AB3A36EA58982B4F1 dk3(p
143,583,432 *0DC36F8D0639A037088055C0F865E645278DC0F9 dk3qa
143,583,433 *0DC4CA37433BF252DBA26D3807C7E61DE180E7CE dkfph
143,583,434 *0DC5B7E6A30B6B0719F190745DE4349629E3FDF2 DKFVM
143,583,435 *0DCB426683FE3222037FBEAFEBEE27C380820332 d"_l
143,583,436 *0DC59972D636A38C722FC91C1D1E26BD538CAC51 dl)&s
143,583,437 *0DC5E795A1257C8C17914CE03BF1FB8830D28B1F CHANHYUGA
143,583,438 *0DCEBF92B3A908E711DA0CF35C9A1E6A040CFBF8 dmf/#
143,583,439 *0DC747113B20FACDA71D1BD08C23E5F93BBC64CC CHARLIEMALENA
143,583,440 *0DC9C4F77AF124FAF5B96DD606C394EE392E40CF [email protected]
143,583,441 *0DC5A0D1F679D4A990C5C023AD39538239240307 chetdikkers
143,583,442 *0DCF9D9610158CD3EC186D7F58377789E5108FCD DOGBERTNOTHING
143,583,443 *0DC38EDA3205BA8C1603A0E4EBD685790B41740E chilblained2
143,583,444 *0DCC82A2BB9D6BE43CA214B3A88C58FAC0A06FF4 CHILDIRED
143,583,445 *0DCD7037F793757B46223139D1BF9F6FB478036E dominicvaquez
143,583,446 *0DCEE814E349F0289232BD247310A5791236E8DE doneuqaj
143,583,447 *0DC9458D09783637E8A90B18B528E13BF4238703 CHRIS.BAGEN
143,583,448 *0DCABD807E86D4F3ABD94DBF5E1D885EBD2D8142 DONNA_WALLACK
143,583,449 *0DCE446FCCED2061DA2A44656528034FB7EEE5D2 christiankellum
143,583,450 *0DCFA258B7733F375E7F82DC8FFD133A141514D4 christopher-lonegan
143,583,451 *0DC553D035DC546824EF2F2824E681C86E829982 CHRISTOPHER PETRONE
143,583,452 *0DC0E6902B6127F5F32562697C4571BB3E6B59EC CHRISTSANTOSO
143,583,453 *0DC80B12C542F7EE4BB946CC3B9AA56659417E9B chstssses
143,583,454 *0DC456B0F9A70A384D023D63D5CED48B2E939DE5 DOUGLASMULROONEY
143,583,455 *0DCD8698D99D9B0D451C8AA2CD7CC17E78DD5EDC DOUGLASSDONKOR
143,583,456 *0DCBC8D558004A157CBE4F961AAE3111C3FD190E CITYHOST411
143,583,457 *0DCAC9FB33117CB07AB5669D18ECF03AF3523BCF citylatacnon
143,583,458 *0DC655205977B8E41A1D80B5DE187E15E8B734C6 D)P"O
143,583,459 *0DC274C377B5CF735C6DE095AD3561CF56A6FE4C dptp;
143,583,460 *0DCE9BF5935D0B460B6659CA5D4D6EAD80ED26D3 DQ4P
143,583,461 *0DCA949075990193E6C8AECFE5A89E1C368C0F62 DQDJ9
143,583,462 *0DC3B7AF6195FA5D9FC9BB511A21EE6B2EA29C0C dqki
143,583,463 *0DC69C61DED819EB6612DBF3DD782425F1EF09E6 CLA+B
143,583,464 *0DCDD09F0F429F846B349E7D02529B8A1F67FB8B dque6
143,583,465 *0DC20E542A0FCD6F2EC8DE5A208245198E664380 CLAIRCIRONT!
143,583,466 *0DC27E02CFFA4B3A163644EE5F55E3FE6C0D5DC4 CLAUD.DEBUTIACO
143,583,467 *0DC2F6F584B3C6D440AB359E3F32DD4252A1C73D DrCruise
143,583,468 *0DC73ECB17F87E5F5E3B57F5E8C90B88AD6DC494 dreamkeepers
143,583,469 *0DC5B5EBB8DD3C47E3301D654E3730B57009D21C CLEMENTE.ANNAL
143,583,470 *0DCE94C08FB08086008947B57620FF40AF35B8C7 CLEOFEAST
143,583,471 *0DCE92E7F71FB9FAEA52E75CC7742210C93052A3 CLEVELANDDELMONICO
143,583,472 *0DC8772ED20289A3287B9567290A4553C676E717 cliffordtabbaa
143,583,473 *0DC233D558EFB2CCC62AF5132005D7CFB7E979D8 DRNM%
143,583,474 *0DC6DDF63457B37F805C81AC0A12D6AF462C5DD5 d+rrw
143,583,475 *0DCA05CA296C61163E272BDDC04FBD785B96D125 C!LP5
143,583,476 *0DC44F896DF7B26A07A622F0DAA2B29BE9B2C65D DRXQ=
143,583,477 *0DC9BF5A24D358E75D0DEEBC48B42C9CEFAA726B CLV=+
143,583,478 *0DCE202DFFB6C197935B45F2DC340E19826AE0AE dscrdtrz
143,583,479 *0DCE6B473394C56106DB108F153B5DDF30F56209 CM3/J
143,583,480 *0DCA64F1D2ADCD8D66ADD8AFD66CF41A98F167B9 ds;g:
143,583,481 *0DCA0E4E51511D2D497CF0590F72EB05EFA4451B cmio
143,583,482 *0DCB5819519BFADA6B41841054CCA7342F5079E4 dsnf3c+s
143,583,483 *0DCB4DA60396F76510070791A915FCA1A886FB0B DSS+S
143,583,484 *0DCAABF4F1E41E39A6CF25EF5F045AAD57DFB13D c]n5
143,583,485 *0DCD07E4FA296FE56FEB1373BF3A774903BE7C9C C.NFE
143,583,486 *0DCFE6F62C201CB86CDE2BDDE89DED00FECBEFA9 CNR"V
143,583,487 *0DC4BA8CDDF14F780E6BFD7BAF055053237377AE c=o
143,583,488 *0DC10B9168D8F0A9D6F2EA2AB3E794112F030BFA DU8AP
143,583,489 *0DCC8B9400CA899D8D177AE0BD84CFA100CA47FB du8cq
143,583,490 *0DC2AF84E81590074D0EB8A56A4B375D04960797 DUANELOPERFIDO
143,583,491 *0DC2591A96E83BB4BB95036E3EE8FEB61F99FE7E [email protected]
143,583,492 *0DC23D1BE3426F9DF5DDA8A07738DCD8FECADDF1 dulw,
143,583,493 *0DC3046AC23CD61C76069F9E303CC8D4B8636BE2 c_ocm
143,583,494 *0DCFF0C0A68083A85C21E63799D88CAA658C78BB [email protected]
143,583,495 *0DC3D8B8243D7DD7EEA6F496FCA109A4AB6CB739 COITK
143,583,496 *0DCCF492F9F2FC4F53BFA83D8B747F224B33E2E2 COLEMAN.KIDNEY
143,583,497 *0DC09907DEFDF6211E9D67F979B70D42FAFDCA85 DVNIU
143,583,498 *0DC8C200429D3D830F7BF1F26A5EA6CF61AEDB88 COLENHATSAVANG
143,583,499 *0DCFEB4A2A92F3711BFE80AC76692A1BDC2E6A33 collinonusko
143,583,500 *0DCB7BF2EA89CBBAC783A894986E5844C65280B6 D)W)B
143,583,501 *0DC739C54BB989532A8F18A91A65E00C0D523756 DYLAN.CLAYTOR
143,583,502 *0DCA5A20DF0F9042E1B1B664E5B46B1B70D4F898 earldewey
143,583,503 *0DCADD4D4D8083B1566D866DB8A7DB3424BF78FE EARLROBN
143,583,504 *0DCB5F8F4E766B93FD3E45EEBAF6A3C8FB217BCE EC=JD
143,583,505 *0DC7410738A4785F909EE6FF63E5736704CB57D5 e&D
143,583,506 *0DCFC0773A055832C3237E2F434CC261E81028F0 edisonziebert
143,583,507 *0DC040D284C61DDC7C0ED4166D2AC813CE671C81 EDWIN.AMBOREE
143,583,508 *0DCBDFF28DF23FBCC2A7936410B51F7AD44B1088 copyvio-splash
143,583,509 *0DCA32466848E022AAD7D3979E8A5C22EA7E48BF COREYMCCRYSTAL
143,583,510 *0DC5A3767FE7AFD683C8A2810E60DC714825FA65 EFFECTUER4
143,583,511 *0DCFAFC8EB5C6E478D060FBD0640A57DBFA2753E eformera2
143,583,512 *0DCA4929FFB0406ABD6331450823661783719C62 CORPS2COLBERT
143,583,513 *0DCA85828ADDF24737B4C30A77353188A1B1DF40 COUN+ERFE!+LY
143,583,514 *0DC09C8173178F8DFFAD0BCA473F44BC5DA45047 egin
143,583,515 *0DC4E12CD22B9B4F57FB3CDD5C3CF79F6D10FFAE C:\PROGRAMFILES\BUSINESSOBJECTS\COMMON\28\SSCHART\GRADIENTS\GREEN_CREAM3WS
143,583,516 *0DC02926E011083DCB9D8F33F21614D2F2A35F26 ehxeu
143,583,517 *0DC3DDAA8447C09DFB31FD0A245178D620521D59 eivinewg0
143,583,518 *0DC02AC961EDCE617FD31F333BA9A5F800A7D52B [email protected]
143,583,519 *0DC9E0F702228BFA07FCCF2C5825A9F8E1B7F86F ekjringaed
143,583,520 *0DCA7D6CC2040DF37BCCC68B5F349EFB5BBBC899 EKRF9
143,583,521 *0DC6B8E063F712BA174A0B98FAE0C5F4B3B209B1 EKUTIKIHING
143,583,522 *0DC07AD3D92A8BC27F91693AE854EBB1246EE961 craniograph
143,583,523 *0DCB704E63E354E00E8ACBDDB065DFBE24255AF6 ELAVOTUA
143,583,524 *0DC2BC44AF23B6678C9BDF9589E3C8FF33499A36 eldorado-national-forest-outdoor-pp
143,583,525 *0DC4FE7EAA3A418F700B272C4847415ADCEB09E2 crivellieniego
143,583,526 *0DC6F03CEC59788C05E0369D5CCF2C724032A027 cruellina
143,583,527 *0DC0BBAB5C99692445F2CC257D8AE93E45C0C968 ELIZAICL
143,583,528 *0DC30AD01BD7398ADD3019C526E73E971FDBE3BC [email protected]
143,583,529 *0DCEBAA0B9A37ED541FD00177DE9183E5F98F1AA CT6S
143,583,530 *0DCFAB4AE7DFCFFCAC9B6058BD74AB43FE306B80 [email protected]
143,583,531 *0DCBC8328178CAB0602B771BD8AAD7C012638A35 CUOr
143,583,532 *0DC37097C6CAC5F8C28BDA59092ACD2194BC871E curtortuno
143,583,533 *0DC50F5AC70D748D0396114ED0DAFE549415A68B EMMA-DE-LUCA
143,583,534 *0DCC2ECA35E8DC79E93C0811A71C28405427F849 EMMANUELLE-AUBERT
143,583,535 *0DCAC35259E5D1237372B7795CDDF2C14999A1BE C_V##
143,583,536 *0DC849EEA654122E357D724F14017E8BE2DF93F1 cvmtd
143,583,537 *0DCE94C69BDC3B0D61E3355B1BB39B265B9AAF74 ENARROWROOT
143,583,538 *0DC00044F6D19B9188FBA77991D5C7DAC2BDF693 cxi1n
143,583,539 *0DC7566BE0BDA6F0D9B99721C2552B6089435EA1 eniplasi7
143,583,540 *0DC725E95E324AEC15B31AC09B56371BC55FF0A6 ENRICOVITI
143,583,541 *0DCA124E50751BBA992500F9CA27408FAB67E122 C+YU/
143,583,542 *0DCAD646094E5F6CE8BD8B89B5A17C0F34DA3A80 czdnn
143,583,543 *0DC4FC5164A58CEEEB3A07ACEA212FB321392C3D czermno-moje
143,583,544 *0DCEE1081787B445E1139C31BD467BECC4F818DC D21OP
143,583,545 *0DC275D17A458535BBB3BD70711F8B657041157C d36tv
143,583,546 *0DCA576B731F531CF090345AC74E99BB5C0DEFC4 d3d_s
143,583,547 *0DCE6F9013746FA11CB05F0A74AC83B6280F448B d3/wr
143,583,548 *0DC9392461947C0E092B5044FFF2E3565CD3F6D3 d40ec894af5df1360e743136409c0d86.200045896
143,583,549 *0DC4CE18F6821C496BDE9E69748A9BE207D93E2A D4S.X
143,583,550 *0DC522970455957A50394E6199166D7978FF7A88 D,8.
143,583,551 *0DC0D8C6A185D531B706D3A31D7672413DAD1134 D84665
143,583,552 *0DC02E97C193CE5B0D98655E2104AA21628132F3 d8_h
143,583,553 *0DC6BAAEDDB01B79732A0415AEFAB365285641B3 ERIC.CLAYTOR
143,583,554 *0DC30BCB58C87C51BE93DFF6E57BF4F73B54AF1E dae/s
143,583,555 *0DC7D44D904A20D5725B76B31432F73C939493AB DAFM(
143,583,556 *0DCEB437A743FB7EAA20C083ECBE7D531EA2D357 [email protected]
143,583,557 *0DC2897E1005D9D1FCEE2EFA5703F423463B0538 ERINCOSSETTE
143,583,558 *0DC8AA217821CA96FC550C7294F4B5B520F47952 DAMAHCUM
143,583,559 *0DC04751976731C444D8E32449AF6EAB12BFFDCE danielgbatzell
143,583,560 *0DCD0019C4C0DFF985DBDE76871F9C2BFABA4DB6 DANIELLE.MARTINI
143,583,561 *0DC5962BBA068BCFA8F6F1D2DAE27077743F0F1D ES-HA
143,583,562 *0DC55CB5C3580E0074BBC4877E6541582E0B6868 DANILO.TASCHLER
143,583,563 *0DC791BACA38922C93ACF8021F6EF21258CBC107 DANLION
143,583,564 *0DC111E6F03F4168B20A1634D9166DB2D0E564A2 DANNYSPOOHBEAR2002
143,583,565 *0DC36EE531A5D1DC960AADA9E15F5C7AAD284CB3 ESTANIE8
143,583,566 *0DC0B02F3E96887CB43EAFFE760094677DF9C2DC DARIOMONTON
143,583,567 *0DCF6875DF9D54EA0BC3D9AB0702A42E0C1969C0 ETAVARUC2
143,583,568 *0DCEEEC69B7D72603B88ADE7A81CBCE35D87818A etb8f
143,583,569 *0DC411211A5C947F8729C236B3D988D8F016E4DE ETCO
143,583,570 *0DC2B5DF5AFA5EF949D382E4927C413CD3BCA3CB ETHANGIESEMAN
143,583,571 *0DCFE40C90A4055A5ACF0D4DB785B0E366EDCF30 etinifninon
143,583,572 *0DC7F40947BE4E871B10F05E730E8B32076F1924 etr6d
143,583,573 *0DC8E52080DA4AC03E7EBD0518505BA6FA23ADC4 DARRONMAROTTE
143,583,574 *0DC37758E3D99F958B9772B3B699D384276AAF85 DARYL.SHISHIDO
143,583,575 *0DC3580492993783BBF3A0C995E54F5A2CBE0A39 eua0
143,583,576 *0DCB5760EDB701C6B66EC985047070AE91B7DB3E DAVIDAVERACK
143,583,577 *0DCAB9B9928936ECC09343E72E84229CBD6FB7B8 DAVID HEJNA
143,583,578 *0DC6CE174FD71E1069381A5C72047E34600F8E55 EUV+)
143,583,579 *0DC6D87C2B532BCD8DA19F5ECE3260E8D911F196 ev:,
143,583,580 *0DCF6B2FF9C9A61ED06E2225F93EA4900140542C evanlagace
143,583,581 *0DCF88BCED05AD697201D9C82B6ECB5E6396CE1E everylittlecrack
143,583,582 *0DCF4AAAF560F32B07ED5E0D5B511D52CCA5C69E [email protected]
143,583,583 *0DCDDAC27F539A8DB9DEF1B5AE2B3B6156ABF062 Dc7G
143,583,584 *0DCCF43E85162A4B54CBEDD543268F1FA754985A exilingged
143,583,585 *0DCA68A994C94AC975BC5A6CC4896F593849E47A EX''PRINZ
143,583,586 *0DC1DD44DFD24B31B94B26270B4571D0EF67EB47 DDO~
143,583,587 *0DCEE2EB011C481A09691F50F89E10EC186D21C3 DE5N
143,583,588 *0DC08A71A17AEC7D3EECEE8CBFBC628D9BD0F39E [email protected]$HMEN+
143,583,589 *0DCB27E8F69D95C7D75650D2C321AC5533C8148E D&EACUTE;NIVELLERAIENT07
143,583,590 *0DC64D48B4D7219EE3BCC7034A7168732B8B537A deadaspened
143,583,591 *0DC1BE721817ECBE75C591766FEB4A5F23FC11F0 DEBIROTH
143,583,592 *0DCB4B08663D68BF5E0DAED5BAD513DC655DAB87 fahed-khalil
143,583,593 *0DCCFEF1F116E8A555782206907400F9DD01AAAD DEGELERAIS1234
143,583,594 *0DC784CECDE156FD9A167727BD7BE7D96B52F5E7 farah-kim
143,583,595 *0DCAC7F78B719E34C34EBBF4068C5F9289899C3D fatemnons
143,583,596 *0DC18269160BA3921005C0EC38CB3D0DF2B9B950 [email protected]
143,583,597 *0DC08B16332766D107597EAF17ED5B82AA43CB59 FAUSTINO.APPLEGARTH
143,583,598 *0DC8B1AD72AB208FDABC4E9239BCB7BD1F8CE564 DEMETRIUS.TRIAS
143,583,599 *0DCF34A47B6EC4F577665702446CBD7916AD6FF8 [email protected]
143,583,600 *0DC04488E17D355D1DE586D90692921A09804772 [email protected]
143,583,601 *0DC308E6931642538D306BDBFEF3269D2E5991DD fengtaiella
143,583,602 *0DCB01128B007D31DC47C4512D114C6D72E4573D DERUSCKA
143,583,603 *0DC5E143005D83960BEA1D580AD4C32251291A50 DESCAIBAM123
143,583,604 *0DC52DBE43183933949E4EB65D7CE9E52272479B [email protected]
143,583,605 *0DCD8A28B52CB4FD1C746AA56D694497E4720427 DEVON.ZURCHER
143,583,606 *0DC3484C5963C687BA9D808723FD20C714571C63 devwn
143,583,607 *0DCE2AD7CC68CB40126BE84AA24F70EFD9F13703 [email protected]
143,583,608 *0DCF75DF78DC8E1B260A006FA96E32EC357A0C15 ferry130891
143,583,609 *0DCED2F6E0AFD4A1BACCFDC053200FB049EFD9A3 d(fwr
143,583,610 *0DC2AF76A3EC7C88CE8DC8D1A1EB72C6EC209742 dgourdis3
143,583,611 *0DC3236DC5095201CD7D9C4ECAF1ECF74575CD97 dgts
143,583,612 *0DC027D7A72312C24AB543FACA0A1D62CA1F3924 find.me.marquez
143,583,613 *0DCE42D85A57939B4ACBDB127333D02F22D2BB0B finger toe
143,583,614 *0DC5E90BEB3026B42533CA494B587B4D7A9ED9DE FIRABLE3
143,583,615 *0DCB01E09F1EDA837C02323D936BCA8786ACF143 d%?ha
143,583,616 *0DCFC9770CC1BBA538572D385D54505EFF1A8F76 firnhabers
143,583,617 *0DC4343B6CBC047D5132DFB9ACD9FB9D1301F330 dhhs_
143,583,618 *0DC2DDB680EBC4958C68797AB3F56C50F5077444 dhpm3
143,583,619 *0DC0840FDDB255F2BC91F7EF34706D9DACF9B3E2 FKRUIMEL3
143,583,620 *0DC7BB0DB7B0914A9630EE47E0FC42EF22F9FCCF DIARBEKRS6
143,583,621 *0DCF8D507F3B174D470761DAA5E8A2BA63996685 FLM$
143,583,622 *0DC8454FA18192B831EB65F0E06AE76CC66B3042 FLORENCIO.IANNI
143,583,623 *0DCA45A34F756257505CD96113E3F63C1EC221EB DILUCAS
143,583,624 *0DC7AE62C47990A52F42475A2C0D1A8EFE948C9A dinant79
143,583,625 *0DC8D77997BBB13D0388DEEBD9FF3E2E37916C4C di)q.
143,583,626 *0DC5BF7799625FA6AA8AD9B2C85970621CF43219 di"!s
143,583,627 *0DCFC9BD9E8D37E488FE7EC8CE94D164F5EB7EBC DISANDRO
143,583,628 *0DC452ABA6E0890EFCDA63DBECBBC6D40DF3BD26 FORSHAKE
143,583,629 *0DC74D4CF218A425B571246D9AA23DFA0EB0E32F FourPreludes,Op.33-No.1inE
143,583,630 *0DC9F1BB4BB35017B6F1A74F50C8CAB4050DBE12 dl8q+
143,583,631 *0DC42EFC4B42131BB167C7AD0B105CD897EC30A6 dl&iu
143,583,632 *0DC2EBBEB7090EC95049853942B4419806C51533 dmarioedgecombe
143,583,633 *0DCD08F645EC083A39EB1CC60037F5D43D80290E FRANCESCO.ARANEO
143,583,634 *0DC0C82034F1D173FA0753E3BE1D4CC17D7CC0AB DMUZJ
143,583,635 *0DC9D9F50979959328DC6AC51237FF360C7470BA FRANKIEALOI
143,583,636 *0DCFBB3FD6AF1573043F1230C03AF32A611D152F frankiecure
143,583,637 *0DC302481FE76B31706E9BB84EC63F4F8A7F2080 franklinsmithey
143,583,638 *0DC7C9D748D886FCAB01A7BB33BA65858418CC61 franklynsanos
143,583,639 *0DC15EE8996A56746ACDA02CDCAC21CB848F1675 FRE$COIN9
143,583,640 *0DCF16ECD58A97A1E3AAD2878EDA24FAFD030304 domasti
143,583,641 *0DCABE0CF8E6BDE0B9EF7446CDC0492355072987 dominicktojo
143,583,642 *0DCA1E5749281230379ABD90FABBF621ECD191D3 FR!GH+FU1NE$$
143,583,643 *0DC7B019AC41F52E5B5CB3236F6787D5A2C0FF21 DONNIE-ROBERTSON
143,583,644 *0DCEF01950343362A21104B7BAA7172106C089E8 donnycanak
143,583,645 *0DCF6F867519CDB89FBBB92D4583FB4DED9FD028 [email protected]
143,583,646 *0DC56C08D0529800A6158B37D2EA899477338551 FYZABAD.
143,583,647 *0DC2542BD81C4DC42A7B11850103306668952B6F [email protected]
143,583,648 *0DC72F7DF44DFDF5FE265A0C10BB52346FED4F01 gadychanow
143,583,649 *0DC6EADD6BAA86BEFB7CCB1DB6A765F46E7389B3 dorlaned
143,583,650 *0DC104C9980D0D1B27AF620829EBE7AB734850CA GALVAN0M3+RC
143,583,651 *0DC2142CC1A2CA5DE8DB712B5811A732C76549A7 DQCE"
143,583,652 *0DCC846AC9683B104C58857A90F01DEA8A15CE4C DQF&I
143,583,653 *0DCE363FC7DD5FBC31931A0FED3FC06B9610111F GARY.RUDLONG
143,583,654 *0DC9A0DB0D1B6B00D9A143A6A8B57BC8F67EA44D GASARAKI9
143,583,655 *0DCDF092D25AA79EC483FE67D88B5D3FA4D9D444 D!)QN
143,583,656 *0DCA152C6FF5ED3E195F5430B566C4286D22D10D d$qx
143,583,657 *0DC0A624A846A9C2DA5919EBCB5CAC7EB11BB600 [email protected]
143,583,658 *0DCB21877BE6D94D8340124D0A63DA8029F9360C driblets
143,583,659 *0DC43D2221F783679E953EC60705FB2BCB33BAB4 DSAT_
143,583,660 *0DC14BF045A8FB9F4DD49AD595C752D55159BB9F ds=lu
143,583,661 *0DC11F48950B37378AA5CC056EB68F112D912609 [email protected]
143,583,662 *0DC249C82D88C3F29114B65CB4FEF582D574EBD9 GEOFFREYMAKOVEC
143,583,663 *0DCD31503A598B2B7192B48354FF6C6C0323EEC4 GEORGEANNE
143,583,664 *0DC58D6EF197D52850D320C272CC574FFDA798F0 GEORGEPAFF
143,583,665 *0DC96B8E936578DB00CE125FC0525C8B61CB117C GERARDGILL
143,583,666 *0DC4955939138AE8EAF34BDDDBABE8EAFD7B0878 DSPL5
143,583,667 *0DC07CBEE066152DC23BE13A16E34F1CE848AFAD GIGIO0103
143,583,668 *0DC04192E49E0E1EF6F3002AD75BF737FD904E9C d,t(m
143,583,669 *0DC71308B2BD29C2390E0B47ABA8D44A08E3BBAF GIOVANNIFONDRIEST
143,583,670 *0DC4A55DB75585D7E0125F21E218C486DEFF7ED5 du4c.
143,583,671 *0DC3D836819A25672FEF0263661CE1E70A61F0AE [email protected]
143,583,672 *0DCA273F2FC864037CF3FFD20A935F35E831BD92 [email protected]
143,583,673 *0DC7601430C9072DBF13C3C71D905BB826CC5BA5 G(KK
143,583,674 *0DC8171EABF01C8B0D6322001568E2BF7D792A11 GLADWINSED
143,583,675 *0DC6792A6AB859AE8322ED38083662944DBD4EEF DUDLEYRADUNE
143,583,676 *0DC456E9D8033FA6281CAEF1010888D8E6EF0551 dug_6
143,583,677 *0DC765D32CBEE36D05B30292F6651A66C6B944BE [email protected]
143,583,678 *0DC66AF2D8BB0C398D5943D56A589858B9EEC293 GLOBULE12
143,583,679 *0DCB8DDB2EA7F1522D4DC4ECAFE60BE2FC73D809 D?v%
143,583,680 *0DC19F7140C75B40A3687BC2E487208422F07BFD dv5.d
143,583,681 *0DCC7B72ADE751B3071B4B498D203C9F16C26802 DVh_
143,583,682 *0DC2D8A5393A4BC877B01778EE56D28A7140D307 GNOSTICJUDAS.COMWWW
143,583,683 *0DC16574B6D497CECCC9E0ACAC7E85B5272D9972 [email protected]
143,583,684 *0DCDB5BD15874C697CE0B04EC3B7181E4E6FBFFB DZXZ
143,583,685 *0DC79897EE655FD738E2FA4EC95EFB65922AABC7 eaecaelisram
143,583,686 *0DCF67A11BFFB1D7AD65E495CD31BF810E608F51 eaemc
143,583,687 *0DCBB2E1AE9C799F1987F1D9A8FB045ABDFA94C1 EAJBC
143,583,688 *0DCDD5704EFABC9844F4FA57B020E66ED985ADEE EASYJETOV
143,583,689 *0DC355C184999E4305057280945CD0B188CCDA9F EASYROB5
143,583,690 *0DC8433A014FD719AA2637F18009D0CECD56EFAF EAVI?
143,583,691 *0DC2B48FFF54095211B4E05AA2EB93B52C81DA1A [email protected]
143,583,692 *0DC223DB1A1FE8397FDFF15C1C3EF1C9A8FA9B76 ebqop
143,583,693 *0DC3B388F346F700702E3370AE6FE53F97FCD5A3 GRANVILLEKOWALESKI
143,583,694 *0DC98CC81CAA17CEDF7BA75F5922859967075FFE ecbk%
143,583,695 *0DC30DDD92DD827074958F11ECE92FE8161CC81E GREATGUITARISTSVOLUME1(SELECTEDSOUNDCARRIER1994)
143,583,696 *0DCB9C5609F70AD3366AC7771F4E6EFEDA037229 EDDYCONFORTO
143,583,697 *0DC6B22F048D4147DFF33804CEFFF65885789EE4 grølislåtten
143,583,698 *0DCDE3A6F23A329C3E7F54E1F50925FC808C816B gromatzky12
143,583,699 *0DC6950B5BBA6118B3D51B9EF6EEE775334626B3 EDITOROFTHEWIKIS
143,583,700 *0DC7ADF03E02E2B0F96428400F30F9C1EBC32530 EDIVU
143,583,701 *0DC9764A4FFC5322896EC79D84DA8622749F9B81 GUIDOARCTIC
143,583,702 *0DCC6AA9EE62D3F263EA7A75EDFE047AC75BF76B EDWARDO.CMIEL
143,583,703 *0DC7D9C1E88D456CE9B6EF6CCE456F133CB9BFE6 gwencheung
143,583,704 *0DCB301C2C6FB1EF77F4968EDD6E17F44EA8A0DB H00GV3RR44D
143,583,705 *0DC99FFA7603CA084C83C2AD1316A01D24A54D44 [email protected]
143,583,706 *0DCA3190E10E6FE26CDA81EE240D838488434A73 egesppots
143,583,707 *0DCD76A24B0A899DD2FB8E6C850AE5F26DAAA5B2 EHJJ
143,583,708 *0DC464C4C8CD07FA21D0BC9A01AA7152D48BB1A6 ehwg_
143,583,709 *0DCEDD5C45962381677418C4BA1338737339B367 e{]i
143,583,710 *0DC92815431E301765EB4C93F3CA14879EF695A8 ejuppmets
143,583,711 *0DC09FFDBD870FD6BF81D58A28F6E666CF6E6344 hankgillette
143,583,712 *0DCEEC08FB36D220C8D719A3335909F4500D6166 [email protected]
143,583,713 *0DC202BF1055C933A8376BE6F130FA77A30E3C05 EKKYSAMUEL
143,583,714 *0DC2B48DBB9F825575CC5815065BE872B75D48B7 EKNESOR5
143,583,715 *0DCA5DE5145411D47805ACDED4807B045C2F5903 ELBANRETTAP
143,583,716 *0DC23AE87366B262EEE1A1B6F5318D5419B573DA eldridgelobello
143,583,717 *0DCE85F3FDDF8A5CA7C86A101816CD1E9021BE74 HappyBirthdayPresent(offvocalversion)
143,583,718 *0DC12B5101A2BA36C8C25BE80644996C10C67B20 ELDRIDGESHEFFEL
143,583,719 *0DC521D95F6015E905A68A0111B018BCCC2E984D HARLAND.HEYS
143,583,720 *0DCC50D10404C829255F97ABBB7DF45A63FE6744 HASENÂTI
143,583,721 *0DC7F5B23A10D9C34F169D91C70AB85151A16226 ELLSWORTH.KABBA
143,583,722 *0DC990589CFD082CB249BDE694C96C7D26FC4502 el-vespino
143,583,723 *0DC150FE60FD2C42787B2034E017D951B62BC003 ELWOODRACINA
143,583,724 *0DC49C0191C2A15874A4CC370D3965B13F914DB2 ELYNN-TEO
143,583,725 *0DC82832AD03B7051593885A0E2FCA700ACCADEB HAVEU
143,583,726 *0DC5A765500089C7F85CC7C82DFE963458BA1DA8 hcsilearsi
143,583,727 *0DC3EC13216DDFBD2B60B97E0A5AEB9E219F8A0D HE-CAN'T-SPELL
143,583,728 *0DC7A17CF6CB9F67FCC92BAAD46979CC982EDB8C EMELITOMENDOZA
143,583,729 *0DC5C7657ECA46418C1FB08F59024429DFA5174B EMILY-REXROTH
143,583,730 *0DCBFD5440E717EEA4008F5727FFCBF278963B9B EMMETTHOFFSTETTER
143,583,731 *0DC8D5001C02E86294492B9621B3967C72989793 [email protected]
143,583,732 *0DC4870E99A1015F064631D2F3E393643F8C60A6 HERBMONGIOVI
143,583,733 *0DCDF4C946C15C9F7C56F433045204F7D1F6FECF engpedia
143,583,734 *0DCE1E93861DEA260BC69921C9349B554D3DA7A1 hermesfgh8
143,583,735 *0DCD25A3DC45F19A2D428025C2BEF41B1CB4E755 HERSHYE
143,583,736 *0DC698E66076D27E499717BBC45DA19E8A06F7EF ENSTRONGER
143,583,737 *0DC9A067E994666EABBBFC1522A3103DC2B51126 [email protected]
143,583,738 *0DCF2EAE5E5586BF548C1CB1314215F1AB88F97E HHNX
143,583,739 *0DCABC41BE4ACAC429E506520D109C983B677846 eolk:
143,583,740 *0DCFBBDF7F936ECE1CB2B840FB1D3416E8881733 HIGASHIZ8
143,583,741 *0DC7283125ED2C398CFE1C2A173A2A46D9E8543E ephemeris_second-/I/'f/E/m/@/r/I/s_'s/E/k/@/nd
143,583,742 *0DC49173DFB5CC290791D5937A681E8E1CF4B5C7 EP,WW
143,583,743 *0DCC16D927008ED07053BCDC1192F5C9F6E120D6 [email protected]
143,583,744 *0DC0FFA19048606EE1137124CE129B13E13BA3C6 HINREISE9
143,583,745 *0DCB6B00FE986DD2D98E8B1EF26FD693ADB535DA ERIK.BALTHROP
143,583,746 *0DCE59686C242BC0F271758B712A15AD2994E0CF [email protected]
143,583,747 *0DC9D40D940C604C352A4BFF6F7E7E1BC4AC60DE holly.tipper
143,583,748 *0DC7985AEE0327B9D33CBACC178B1360A429378E H!$+OLO9!$+
143,583,749 *0DC7EC83C428BBA220D0C505FB15DBBF1BF865CD homebgh
143,583,750 *0DC230EE1E571CB3B2F89F5BF85ED26D2DF51E8A HOOKED ON CLASSICS 3
143,583,751 *0DCF1B1866DBF1E1A8DA356401997AF6F55532F5 HOPELOODOG
143,583,752 *0DC8F5CA310651A897905C9EFE4874674C6E9BA4 HORACE.BUISSON
143,583,753 *0DC6D5F6F3DA722ECC9FBB3FB3627E8081C554E2 hoseaborders
143,583,754 *0DC5AB9202AAC455F203C58A4A92F5269A37DF27 ESAWDY
143,583,755 *0DC944537C758E7C09B4A26D862FE7319E7F7154 ESTELONG
143,583,756 *0DCA9005D84186C81DFECB993FC40587D26A282C ESTURMY0
143,583,757 *0DCF07051DD95585766E763C6A55236E11AA560B hqva
143,583,758 *0DC642B7B2708438E177B74DDE799AC1E8063F63 ETCO
143,583,759 *0DC2B5DF5AFA5EF949D382E4927C413CD3BCA3CB href="/BestStandupComedianDVDs/lm/R1ZPCFVV3CJTZM">Best
143,583,760 *0DCCB7A221A9064D2D6F5560C6C49D27B5F78E32 ETILIBIC6
143,583,761 *0DC0A9F779F81F7AB3D7AF323FE7EBE850620707 etnassipuorc
143,583,762 *0DC92B228F11386BE9A804CABE7B17D1FB1A8F5D hueyhartgerink
143,583,763 *0DCFE3BCC35433AA14876403CD57D7B5AF3E7F0D HUGH.MAALOUF
143,583,764 *0DC560229ADC04DF0E20CC036795995F2E5BAA56 HUNCHING7
143,583,765 *0DC1B7A4F22329140F53FD866CA39A5C0BF353FD [email protected]
143,583,766 *0DC69BD9C2F387130E19C4F542AB98892D64BAA3 EUSTROTIINAE
143,583,767 *0DC5092136165E999BEB661A14D1EB215E4C503D eux?j
143,583,768 *0DC130C658C34D100BE1051A9FA1FFCFD287F602 [email protected]
143,583,769 *0DCF961531CBD800B12A6B265257A5AD02C59CDE I8(K
143,583,770 *0DCDEDF8AA3922C4F6FED70994B3D97A8E1CE233 IAMOPERA72
143,583,771 *0DCB892841F73047685A5222674E0BE9AB02AF55 EXUOPCAI89
143,583,772 *0DC5F483C39396FA66DAB6E509358028F460B47C ICECUBE,KOREAWANTSAWORDWITHYOU(LIVE)
143,583,773 *0DC121ED32E95815855ADD394E6F9468C6B7873A EYENEAR1
143,583,774 *0DC3434177251C64CA1835A46866D593B760FEAE idanfbsws
143,583,775 *0DC098D7DE04CB8220BA30E9EF292923F9058F56 IDIOTESING
143,583,776 *0DCEF39CA07C4278D33D59E1982C843689985E6F III.COURD'AMOURS:DULCISSIME
143,583,777 *0DC83784CB6FD91AB1A90661F7721B5AA3FDFCDA ii=r
143,583,778 *0DC150563AAAEA0AF09F2CD080D2E9EE66C7133C FATSQUIRREL
143,583,779 *0DC3DF9640773C3C81284FC86A771CEBDEA1D25B ILOVEGOOBER54
143,583,780 *0DCEF9635CEF1921BC6B46A5D8D4DCA50367BD44 ILUVCROSS35
143,583,781 *0DC6C8694BF69DDFA872BD4E645BC185E4F098CD ILUVDANCEABC
143,583,782 *0DC4D941CCF0C082A93EE9E0FDC56B1991D36416 iluvdoom46
143,583,783 *0DCDFCA72C4D49DDEC431018E6C4575A7381326D ILUVXXXXXX96
143,583,784 *0DC418D4E43F6C164795AB96EAB21F92897E5E17 Imagine-We-Were
143,583,785 *0DC5A0C0B28FBBBBB465F2F10EA8A86008956BCD filmlab
143,583,786 *0DC48908722ADEBB7F4B4442082D09D6A9A7FB30 „infarkt“
143,583,787 *0DCE9297593401B118D3C0E31B3A46E4CA41DDF6 FLOYD.MATES
143,583,788 *0DC5C9CBB545DEDA05D972CBE8921678EF87F3A5 INNENKULISSE
143,583,789 *0DCA75B68CA6D264BCAFFA762BFAF43087C0D9CD fnnot(opdateequal(A
143,583,790 *0DCEA0581B34D392ED03EEF5418DEACBF5D6F590 INSADONGE
143,583,791 *0DCB5DCC9F72CB2DDE32E9196680CC6B0B2BC205 INSÌÉNÀCI
143,583,792 *0DC2A9FD4525D0CB39DCC4A24DF4ABC409E37A1B FORCARVE
143,583,793 *0DCB030B319AD825C63A08AB71A4BB2CF22F8748 introduiront
143,583,794 *0DCC4193FD9507E1085516C2A93FFD8825D2B245 INVOLONT8
143,583,795 *0DC567FBF412F99EA2B7EF5BDF84448606E308E3 [email protected]
143,583,796 *0DCF8AD5DD6AED7C91FFD77D3D9CC90A7BDC36B3 FOSTER.CURNOW
143,583,797 *0DCBCDA90CA6032FF3EE8A231C2DA6A3AFA2A45C fostermcpeak
143,583,798 *0DCE1FD5B31CA80A089E07A008089B04F15B17D4 IRINKA1918
143,583,799 *0DC033A87B6C142995BE1676D42D5C9BC2D2D4EB irisers1
143,583,800 *0DC4A63AA1EB8D6E6CB294902D0A3D6EF3A35261 ISAACBLASHAK
143,583,801 *0DC00E62267A516C70F2FE9AFC7AF8B468D4D270 ISREALTUTONI
143,583,802 *0DCF150BF0FCD3170D01439FA4F62AF6B1CF3D37 istväna
143,583,803 *0DC8A5747BD5888466DE2645833A6202E54A0B47 [email protected]
143,583,804 *0DCF2762823515B838FF3692A2B65E91E4A6BA82 fraited4
143,583,805 *0DCB1276DCC28FF935A3709C06F2982BB204B5D1 J028430
143,583,806 *0DC2C4EC2DBFC67819AD2A4B544B5C685D103397 FRANKCAIN
143,583,807 *0DCDEC0B90A4CCCADD23BFA92534666575D5032C FREDERICKLICHTE
143,583,808 *0DC78980361C5C09CD3A5B6C906F8F810F180F8B JACK.VAGAS
143,583,809 *0DC3A28CD1D6F1FDCE2DE74F8E7A61461229AEF5 JAKSETA7
143,583,810 *0DC23BE98E88FEA4527AEE1F552309885CEAA86F JAMAR.BOSLER
143,583,811 *0DC1E5C6C77E36383AF511B7EE6B90F0175DBD7C JAN.DELBUSTO
143,583,812 *0DC5883FBE680098D1537499176414BC0586CD35 FUNERALSENTENCESFORQUEENMARY:FUNERALMARCH
143,583,813 *0DC02A80877AC43E36B036D0AB5D20C798066CEB jarvismurany
143,583,814 *0DC7878EEC25878F28E077AEFF805984B192FF50 G#2O
143,583,815 *0DC64DE1E99590112399D445B7887C227539139E JASONBENDANA
143,583,816 *0DC591DEB5A0D7215EAD9B9F46D62D1858A5C618 G70548
143,583,817 *0DCBBBC4BEF62207F6682F83C58DCAC8AD4A91AD JASONONCALE
143,583,818 *0DCE6F6AC29B591B3F9D11E28D7D2F3DFF557D02 G9*
143,583,819 *0DC8DF93DACAE6764E4BC1D197ECDF67E4845827 JASONSAJDAK
143,583,820 *0DC1B1CC442422A5A3EA785521CE4578F9021EF7 JASPER.TROSTEL
143,583,821 *0DC623F61FC0D72AFEB137878486B6C8D41E1019 [email protected]
143,583,822 *0DCA8BB93E54AB95262766D54E16CE72555D4841 GARRET.RUMMER
143,583,823 *0DC896A430EF5D707EC5409CCECC0D8A06FF388D jeanas
143,583,824 *0DC3BAC2C86FA64E4C43194439581C8D02653E76 GARYDEKORNE
143,583,825 *0DC36EDCC0B489F897E014706ACA4363A796E5B8 JEANSMOLINSKY
143,583,826 *0DCF9B92A8B6C84D65F12BF75A56D905D8BBAA60 [email protected]
143,583,827 *0DC5018FE3A1D0A603904C6F8A3AACDEEA986C03 JERAMYKEVILLE
143,583,828 *0DCFA603B31EE26710C70236F1C04665A7203D6A garytooke
143,583,829 *0DC9B60B5A8F2DE7CE472E2F74E3FACE5B6FF31C GATIANS
143,583,830 *0DCEA5375E2AD3AAFEA6668AB192F7DE47FB97BB GAVA690
143,583,831 *0DCF8CA1C3BD1F37FAFF30B148AC9A341F92839F GAYLECRISCILLIS
143,583,832 *0DCD98507780189D7BBAF11D40E128D22895425A JEROLDBOBET
143,583,833 *0DCB5CF07013CBA3E55B1DE389C0F064BACCF614 JERRELL.LEPERA
143,583,834 *0DCB8D2123F50AF6452B78D6235AEDC73F5C9C3E JESUSFINEY
143,583,835 *0DCE3731DF2B8EC4E1A7D73AE246DDE5D59F01E7 GEORGEANNE
143,583,836 *0DC58D6EF197D52850D320C272CC574FFDA798F0 GEORGE.LOSCO
143,583,837 *0DCA9C286A240965914B84D47D9A005BEFDC5572 geovh
143,583,838 *0DCFCFEF7016DF3DF87300E059CCA7478EA046C1 GERALDO.DELGRECO
143,583,839 *0DC69A30E686C9F06D4182E34EBFFAF168520DDF GERALD.SACDALAN
143,583,840 *0DC29A93A57627338DC035C7529376F2594B06E6 JHIGHT
143,583,841 *0DCA6ED7135B7DCBB70AD9EAAC6FAB8BEA71FD76 GETTEMP0
143,583,842 *0DC4172F97E9BB41E7B9B7A6F537037F27B52B6A [email protected]
143,583,843 *0DC418943CBE80702588C1B57302E423E480DB87 gevonden
143,583,844 *0DC8EEB8786AED6C8E93CB324CCA23253CD4B1AB [email protected]
143,583,845 *0DC661C4BB5331BAE47274799F282560C83A6F83 [email protected]
143,583,846 *0DCA255CA91A5C53DA0719AE942A99EEAA318809 jimmieliverani
143,583,847 *0DC388BB9C90377321415C184ED58B7D23B7EFF8 JJMLHUPPED
143,583,848 *0DC6BE445963F12A45935492F95B083FA433588C GILBERT-TOLEDO
143,583,849 *0DCDA28778039833F1219050095321EC5B6767B0 gildascluborgwww
143,583,850 *0DC4E2532E5B6D4F2E02A9D1F102FA26C41F66D4 GINO.BORNMANN
143,583,851 *0DC434ED3828A82ECB7D5622B5DB689668F939D0 jmwxantia''jmwxantia
143,583,852 *0DC65222F18FDC1977BB9C54BE5AABF92310F576 GLEN.LOHMEIER
143,583,853 *0DC30CBCFD8AE9C02CEBE942E26C86F30224E3C1 GLOSSARY_OF_DANCE_MO
143,583,854 *0DC23190448E7E6346707648023C9FD775323396 joe-peachey
143,583,855 *0DCE25AD8AF864DCDEDAF3208E7BA6C718CE707E JOETERSTAGE
143,583,856 *0DC1AEFEB136266191605F630728807E58B6F9BB GNILASSAV1
143,583,857 *0DC779272C6BED59609564D9B852CD67B5471BF4 JOEY.GOLDRUP
143,583,858 *0DC5B8229C757F668C4FAD24ACFB83D17A93A5FC GÖRÜNMÜYORLAR
143,583,859 *0DCFE90150658F0E9A8B23B174E0655749433400 granvillegerweck
143,583,860 *0DCAAE4F6923D1CD9EE8E4594AEC3E533E5D6FEF joshokie
143,583,861 *0DCAB4E61A98F79FB54D9D6B4A18FFA95267B123 GROAZNICE
143,583,862 *0DC2FCB8B81EEFD6C9BE3BD9D8648D828C42AF0C gtf.
143,583,863 *0DC8D7D0CFB5BBFF9A51CF798835EBFA22CA97EB GTHS
143,583,864 *0DC3852F415054B1C17B091925481730CDF9BDCE juanjaynes
143,583,865 *0DC3DC3A40EAC9E7023560E3E90675AE3089322B JUMPANDGWAANBAD
143,583,866 *0DC165D9BD9F312DCEA38C6FF398C283853BF36E jurand's
143,583,867 *0DC87E1C2DA4F345F6DC04914AC674128C286A59 HADRIAN MOORE
143,583,868 *0DC3446F5F3F67179B71F14621E4D12152B8B4CE [email protected]
143,583,869 *0DC8BCD87126BA4390A057C199D6C07C2678669B HAKAN GOKTURK
143,583,870 *0DC53D44F35D7B2E79663B4614A2A6B236CF16DC [email protected]
143,583,871 *0DCF43054728560F509611594E0CDE2D35D2C66B HANEEVM
143,583,872 *0DCA2CED66DDCD7BC7B4F8AB6181E88AE6048673 KADPIEN
143,583,873 *0DCA1F289BFCB41CCC0643704FCC4B19C6E13653 harrisgonsoulin
143,583,874 *0DCD82DF6468A4C93D1BA7AE3985EE4D4E5C123D HARRYSINNETT
143,583,875 *0DCD71017CE861713CB48DC1FDE66B29FADAD9FC HAYA-HANNA
143,583,876 *0DC609CA6681D58E97964D138C435D5E05E61368 HBA0
143,583,877 *0DC64A21BA90CFC736200FB6A7135F5CEC86F6DE HDARAGON
143,583,878 *0DC04E948AAE51C7C476CA8AAA4B4E9AFEE491E6 KB12345BLAKE
143,583,879 *0DC5499FD1DF1BAE8A863F2A350E038A41C803CD KBALSREE786
143,583,880 *0DCA4C6CF7F09992471C35A8F21A703BED2EF972 KEITH BOSLEY
143,583,881 *0DC40D3418F436732D008873C0AFA008A19F485C HERSHEL.PESHEK
143,583,882 *0DC214C5D497E455A759A955551D4249A5B2F693 KENDALLSKEPPLE
143,583,883 *0DC3292C5B511B7B415CBA461B240DE3077A0465 KENDRICKANTCZAK
143,583,884 *0DC896A5AD84D817F40DB8FF1DACA1DA5564308D highway.forever.(feat..'the.angry.chef')
143,583,885 *0DCBBAAC6F33AE47FA47514E3C75EB034B128036 HIINASYA0
143,583,886 *0DCFAB5FE847DABC45C5746F2A5F53A2F7397209 HILTONTERRONES
143,583,887 *0DCB97EAEE43BA484AB521267AD7B57721C4F89D KENTCHURCHILL
143,583,888 *0DC20A957C2DFC60C1B0B4CE415218E433279462 KENTONPEROCHO
143,583,889 *0DC14FFBF4059216FD90FE6468A32ECF93E88439 KENTSCHAMMEL
143,583,890 *0DCC5F23FC67AA9B4A94B312E7CAE5B46BCCB6C1 HLWASSER
143,583,891 *0DCA43CC6B7C8033F113FA0A93C1F4EE0865C0D9 KETOSAIBA
143,583,892 *0DC0B8D7A8A888DF5EF0CDFCB8BEAA54A867AE8E KEVENDOORE
143,583,893 *0DCAE7817A9AF3ED1118617F3EEA0D96248C17DA kevinvandawalker
143,583,894 *0DC490A988BF9CC9ED8C986C8EB242245FFFC278 ki28910
143,583,895 *0DCC16FD372C51F4B248F9987A104CD4E36E282D HOMOHOMINILVPVS
143,583,896 *0DC3C3A66BB653DE0CDEEA84336FA352A4E07750 kingshome
143,583,897 *0DCDB22E3255AEA689719E3BBB51EF5EDDD9C8D0 HORNUNG7
143,583,898 *0DC1367F2C59AF2C6C8F136DFC6A6E1B8E57792D HOSEAMASHER
143,583,899 *0DCA1846B095B2A6ACAFA7748E19CE76623E117E [email protected]
143,583,900 *0DC95454BF581DE2CA2FE2181C67EFB3F639C2D2 houstoncorf
143,583,901 *0DC534436EAF3BE0B48579DE78042EE4FC7C9D33 [email protected]
143,583,902 *0DC3B8C53C22B36A9B0EF70596A85DC95477DA73 klappenvorrichtung
143,583,903 *0DCC2783117CCD187BCD5B68A2426EB907852515 HPOSTEXCHANGE
143,583,904 *0DCAD51B1C7650258A91AF20801AB5D588A01FE1 KMPH840COM
143,583,905 *0DC687CCFBE180231235A397036892EBA5E7DD4C ko3
143,583,906 *0DCD89F29F062F3BB89E284F49F7D4FEF565444B kopermijnen
143,583,907 *0DC976FAED8945ADB430331A8677E0F9550C5D52 HTTPWWW.JEWSAGAINSTC
143,583,908 *0DC32B55D8F39F1F749BF13B3809D4F196ED2DD3 hughleybsw
143,583,909 *0DCA19B6E62371B53953DB50AE3A0A25497B6A88 [email protected]
143,583,910 *0DCC7C111AD82AAA1CE1AB9CC96EE010173675FF HUTTRADE
143,583,911 *0DC8D89375DAB2D5F599B2448E53DC9FB70066B6 HYMANMOTTAI
143,583,912 *0DC5900535B44F7E0461BAE5EA689531174FA3EE HYMJICGV8
143,583,913 *0DCD2955979F4EF7838CE80924A4592CAE4768CC HYVITTÄNYT
143,583,914 *0DC3C863A711D1F093CEA934589885C6618B12AD I118621
143,583,915 *0DC6362D68969493816AC44DBB6E0B543D754341 I312605731201
143,583,916 *0DC222DEF71059477412CBB4222133545D77D2A1 LABLANCS
143,583,917 *0DC1331080660AC65D8469590502F212BAE7668E IAMGATEWAY231
143,583,918 *0DCD25DB3AA943E7304F2E28BBE25FD97500EC71 IAMHOLA123
143,583,919 *0DC94A1D1A5F0D51CA69A3389AD2EA42166520BE LADUEFNU8
143,583,920 *0DCD8DD947794AB1F8E37990AF268A726F4CCF2A iamlogos37
143,583,921 *0DC4D90D3ED688EC06D48851063EBBA3E6028902 iammirror!
143,583,922 *0DC338EB7DD1389DE1870C84D31E2E755531DFF9 LAGUINTO2
143,583,923 *0DC0B328E3940368AB924F83B47BE12F69C7B0F6 lahmansville3
143,583,924 *0DCD087675A9CE96D46F150C5B60A79B911266E1 lamarprosise
143,583,925 *0DCEB3EC0BDB629228E3DA5D4B92051B90362311 lamode!(featmintblancmanche)
143,583,926 *0DCA966A92CDEDE4FD19A99D96EB65AA7455F1D3 LAMPREYS
143,583,927 *0DC4CDDDA5A0648E05373E681DC09BC0C832D27C Ideas.in.Action,.Volume.1
143,583,928 *0DCBB5D86C5EF73C51E4FECC9F8949FDC4311451 IDIOTL
143,583,929 *0DC048859BB771523D5CBE660FE50FBBF03BA827 IDQOCIOX2
143,583,930 *0DCE099D4BAB02FC37C1E6850E1DAA1D79337E75 ierednoffa
143,583,931 *0DC4A9A84C1D73AFF2B46CA5BFF0132A6CD6AC91 [email protected]
143,583,932 *0DCF217C7B0D70AC3F283A450A339CA66438B8FB il0vech0clat
143,583,933 *0DC2234515812BFABE941E40D3DE618111CCB0E3 iliniua0
143,583,934 *0DC844605A7767E5ECF64F6D9B27229FC55A7A43 LBBELA
143,583,935 *0DC960FC4608F9F5BE80E28178435DF8647EE1A5 [email protected]
143,583,936 *0DC610797DF1824EAC064E42D5F3A4D3E8B6747B l/e7
143,583,937 *0DCDF4CA4B7E00889E51BF2FA0FAE1A75F6C7760 I LOVE GULLICOM
143,583,938 *0DC3FB9C05973F936287756558D9838580E5A1BB [email protected]
143,583,939 *0DCDF993D64ECBE84AD46C091D640E212B0927A9 LELANDDESAMITO
143,583,940 *0DC25EAE0D935178795CDAA3FD4C9EB898BE5028 IMAMAAT
143,583,941 *0DCA1B5E06DB9DA48A4C703878F1467E3EFB331E LEMNOS3
143,583,942 *0DC7BE6AF5BE4F1C8A491E1BAE078A85B43AC6E9 LENARD.MCALPHIN
143,583,943 *0DC5A5F530760CC1A48DCC0A75DC4651F0CA45D3 [email protected]
143,583,944 *0DC3D5CA4389EFF1FF834FEDFA3E5644B7189371 INCEHORN9
143,583,945 *0DC30E7427E4560F96F9AEAC2B05031E159B79AD INELABORATELY8
143,583,946 *0DC3AC1208B3067933A8443C6DB2324E4E687CBA &-LESTER-BOWIE
143,583,947 *0DC2BAAAB407E0EF63D7A98FA272E8BD3CD6093E INGEGNATI4
143,583,948 *0DCA1E6E68CF28DB8D053DFB6F65565DC95E6D07 INGGARIA9
143,583,949 *0DC2AF12039B6731D80003E204497BB1C75CDD68 INHUMANA2
143,583,950 *0DC4FE23D561DE96CEF0546AE2C6CC84B387C9DD initialversion
143,583,951 *0DC87BA8FB62793E21D63AD784513BD830FEA617 inkangas2
143,583,952 *0DC1028FE517022FC11D2DE8C859332033FC6C1C innsmens
143,583,953 *0DCD0469245EA4918C0867377F601DAAE7469CD1 INNVIDDS
143,583,954 *0DCA2504B50656B5CF7B08A6FA7466C6C3472045 INRO7I9WR1
143,583,955 *0DCF2FD466FD1C79B94728311D2F2227727DF7FB [email protected]
143,583,956 *0DCAD0BE70E4289AB90500C7AB98D6C4CC4E42CC [email protected]
143,583,957 *0DCA1BCF2D4092FC032F6D64026E0A50ADDD222F IRA.COMEY
143,583,958 *0DCA8532E4D96744D2B484C6EEDED66AA8897862 IRRETICE6
143,583,959 *0DC063B046DA2B3F1297DD31E2FD5AE7D0FED139 irvingmaham
143,583,960 *0DCBEDF5ED4218C31654E528A683C3C9811458BA linka
143,583,961 *0DCA32B9B02CC62A9726C593540C1DE8CCDAD450 ISAAC.VISOVSKY
143,583,962 *0DCE0861DEC64F4749A452492BC89D5EF06B9A30 ISLESM4N
143,583,963 *0DC1916C0CB84041D09C1E955ECCB51ACED6F747 LIQUIDEERDE9
143,583,964 *0DC902BE100B5647ED385287420F82019A37B6CA [email protected]
143,583,965 *0DC7DD273D0741D8826D2BE5431F0D159773381A LISTRATE1122
143,583,966 *0DC4083B291F54F7500373762C730EFB4A4FF33B [email protected]
143,583,967 *0DC7402BB0ADDD5FDC8E5A9535C2D2DDFAEA64A9 ljnq
143,583,968 *0DC955E9ACF175D7AE35641A3FDE0CECD697799B IVAN.LOTTER
143,583,969 *0DC672275D4DF11509E2A1A3EE31CF0B32F42826 LLUKHOZI
143,583,970 *0DC47EA8626BEB43E8DCF5BA311864666B7A3FAC loeracil
143,583,971 *0DCFC397E310BB9CFDD42FA905AAB1C53EFDA2CE LONGBOWS8
143,583,972 *0DCFF05E1AFBEE4AE5AD7001EC6590FF0C6C0837 LORDS75
143,583,973 *0DC09D6E114AF03B3915CE465BA810D882143D12 JAMALRODREGUES
143,583,974 *0DC7B45EFD2393DF62030BE86CC8A5E43DF04D57 [email protected]
143,583,975 *0DCC67CF6DBA0E712C3F9CE122542748BA2CEABF jamelwestin
143,583,976 *0DCE5855F746BC8759BD2715D0D346D039438076 jamesbeasley
143,583,977 *0DCE13BB003DF14B06CB0CF38923E1C917A9A651 LOVE BEYOND COMPARE
143,583,978 *0DCCBAFBD53828A5D917B963E4492563F5A62E58 lowellbovell
143,583,979 *0DCF4D51FDE3F17C48D39E6F50A013FE76FB8627 lq3317it9h
143,583,980 *0DCDAE255E68C8D2477873C23FD165C425BE0EBE LRV-C'S
143,583,981 *0DC73B62775EE5258FB0EACBA9F942510310E37C „LUCIEDÖRFER“
143,583,982 *0DCEFBA668B4DC4F8C949E53A753AA57A84FFCE3 JANSHIMADA
143,583,983 *0DC812253B35F511A2DD9E25424596054B11D7D5 luciusschweppe
143,583,984 *0DCEEED3E25A5925DF64578F7C9C8664AE883BAE LUGGIES
143,583,985 *0DC0626D2C64E268FB945B502FAB081A23309387 LUIGIRAZINGER
143,583,986 *0DC8B1681BAB9F618A0ED95A88C6C780716468B9 jaws-theme-swimming-(demo)
143,583,987 *0DC28B0B424DFACB6BF139A96183B2616AF38520 [email protected]
143,583,988 *0DCE798DF30E1EF9ACF4800358677225B44CF842 JAY.PEROTTI
143,583,989 *0DCD54865C20517EAA2BDC9087F11B419708537A JAY SCALLY
143,583,990 *0DC7642A7407A32F9EA086401F8D9D48D95479EA jefferyfigueras
143,583,991 *0DCBD3F09766CB686848B93B63BB11A5EF49150B JEFFERY.PENN
143,583,992 *0DC56AD9E1A9A52FBFC536D36525327AABBC34A3 jeremylothian
143,583,993 *0DC7DAD3D3020501C8402C38BE9B4FA4E4263D80 MAE_AQHLBJATDQ
143,583,994 *0DC0A1E3CB7859FBAAC54403D03D3930BE5EC02D JESSELAMPERT
143,583,995 *0DC092B08FCCC91AAFE64717D5C3C976EC3BDCD1 MAGZINE1
143,583,996 *0DC5A67AAA1BDB52F47773BDCCB1480BE937D0FA JESSMAUST
143,583,997 *0DC0110383E4561ED2DF90821D0DB40AFEE046AC MÄHVERFAHREN
143,583,998 *0DCE13DFB66B6F2B4B35F48CE12B1E32F7E55997 [email protected]
143,583,999 *0DC2B2EB3E2D3300BB12D8928426BC604520DB71 makhi017
143,584,000 *0DC73F9F7C0F1A21DE5484366ABF127F66B6EBDA malcolmtollefsrud
143,584,001 *0DC472EF4C5ED6DB6BF81ED04F8BCB6441C99894 MALVIINALLE
143,584,002 *0DC99DCC393912FA42F126A13B1CDAC1340F8C95 [email protected]
143,584,003 *0DCBDFD54A58B0EBE9892EE77BEAF9730C60B4B4 [email protected]
143,584,004 *0DC44ABD218A1E87CD1DE1DEC52E69BD84D3B940 [email protected]
143,584,005 *0DC2C543A51AEDBB3B8F818ED4DD561330AD36A7 [email protected]
143,584,006 *0DCCD644E22E6A7BB12CDE2538F1035C19E75ADB [email protected]
143,584,007 *0DC1946540804C857E33E6E1EFF6202DF486C3C5 MARCO.MCDUFF
143,584,008 *0DCB841E9D26952437F1C9077E167EAA48141C50 MARGARITOSAUERBRY
143,584,009 *0DC5E725B10082FF76B6DE2433516651A8C4B11B JOESPH.FONTENO
143,584,010 *0DC1B0E2C2879FE30BAF61F5B7C6B40CB00B768D marialuccous
143,584,011 *0DC81734088CCF74F6D17ED5DE73B25273637E4E MARIAREGINE
143,584,012 *0DCE4609B30F9C94795049117DB48872F7D952AD JOHNATHONMANGANO
143,584,013 *0DCA03B7C691422F6803F0562FA9909DFA8DD455 johnniedelauder
143,584,014 *0DC8429B304E1202894F09D6546A0E06D2418AF1 markgrat
143,584,015 *0DC0E2C4FEBBE3D2252E4C4578C0253CD70FCD15 JONAHBLASSINGAME
143,584,016 *0DC1A97E94267B16EE1067B0CAF5A92295E1863F MARQUISGAWRONSKI
143,584,017 *0DCD45F02C01ED32874DDD824E246D79E8F1C03F MARQUIS.RHEIN
143,584,018 *0DCB8ADD1DF4142BA022A5E06D1241A731B6D337 MARTINCZERNIAK
143,584,019 *0DC86D53C12CFD0B088D155E94DCC9DF46F711D2 JOSEPH.BROCK
143,584,020 *0DC556B085C4BB8AAECD7620FB91F2FBF751C771 JOSHUAPENDEREL
143,584,021 *0DC456EC4F51EB1D3DC37A6CB927E1607E5C1E2D JOSIAHCASELDEN
143,584,022 *0DC35FF7D5EAAEFE19E1B86CFCF3BAF48AE05F40 MATTEMISON
143,584,023 *0DCAD0AA25A92053AA87BF57A23C3F6F8929A39C JOSUE.TURLI
143,584,024 *0DC82D3B41452417A3258C7BB71D4CB7C8184D64 JOVANNY227
143,584,025 *0DC79AB1FF879410B8DA5B1B3A174F9944882314 [email protected]
143,584,026 *0DCE50D7AA429743B3F6C5505F8688455C7D742E JSW6
143,584,027 *0DC11B5D8F3BEFFCAE8721808567FAE75E50A8A0 [email protected]
143,584,028 *0DCDB290053236BC4A3FB427690AEDC78DAE6B1C mazurukas---op67-2:-cantabile
143,584,029 *0DC40DFF12633C608ED2C527F3C18E52E628EBEB MBDEMON
143,584,030 *0DC4EE881869356957F322D067A78C721FA54E63 MCET
143,584,031 *0DC807CC4CE50BE2DDF309DDCB10BE06E6BCDE33 MEBLBSW1
143,584,032 *0DCE3A2991BEF56A40CB878487CC2A785B553DA6 mediación
143,584,033 *0DC416D0B12C05882A8FECE2C8A93DF3093A9506 MEHRSKALENPROBLEMEN“
143,584,034 *0DC594F115BFCF985B00400DF3AC28C1C6E0FD81 JUVENILEDELIQUENT
143,584,035 *0DC5977377C7E9D6F78DC4FF9FBB84F6112675AE melissa-bitner
143,584,036 *0DC56D6C1853613A50113FC69C277228C4A26346 K,0QPn
143,584,037 *0DCD3B7AA909F377C95E3413010C8F7A60C10FB0 K96151
143,584,038 *0DCBE3E9D59269F680208F9754DAABBDBDB45580 KAAPSTANDER.
143,584,039 *0DC2A2EEB5F00F2A46A53CCA0456DA561E5E1778 kadla 'nursery rhymes' no 07: n
143,584,040 *0DCE81F714FCD5DE7D2C64E21134EDE27B9045CE KAMBAL
143,584,041 *0DC8595C909CCC7711D24E0AA9C962EA2FB83038 [email protected]
143,584,042 *0DC20BB121B4B2A7A7478ACE6E7C09137B4D8820 MESSELITE1
143,584,043 *0DCDA6C802FB4FE9810ABFB0DB7C6613E8B8D157 michalluckado
143,584,044 *0DCDC7326638C9540E8E8F3AC3E470A4A2AD73E5 KCOLMEH2
143,584,045 *0DCAE92E773B45B31D0A8475AEDAC555E8225600 miguelleiber
143,584,046 *0DCDFD5F83FE18B6073A37ADF3A7C7F3306B7B14 KELLEYSWAIM
143,584,047 *0DCFC7B3D500CF1B9BE589640FC3A9F7A5B66C86 MIKELDEDIC
143,584,048 *0DC892E43130A30E349F61495DA58C83E3A35CF8 milesrei
143,584,049 *0DC01FE18049C0CE8A46564FA41A922AA74DB5A9 KENLEY69
143,584,050 *0DC07F6C1096707C61383B76831F4AD06CA41F0B KENYANG6
143,584,051 *0DC76E1F993B667F75771CA10B4BEB90D0FE999E minekov
143,584,052 *0DCDC799E10C40BA16E999A7A5093C99EDAAF3AE [email protected]
143,584,053 *0DC6DE9642A9A5CA3EB0EB9E20F4EE73283207EC [email protected]
143,584,054 *0DCB00CB5866180B200C741016D6F8C7E72B043F kesselhakens“
143,584,055 *0DC312AFA50A7383AE43C06239CE9962E8515547 mitridate-r
143,584,056 *0DC23A328EE2777089BCA90AB6D2D3D4224F2D85 MOBREF.COMWWW
143,584,057 *0DC4DFBD84BA22DD6BEA53B6DC00CBDDC336E441 mohammadtratar
143,584,058 *0DC18BBDCC68C95C1E6414423A428368FA031082 MOHAMMED.ZINCKE
143,584,059 *0DC669D1F5F3ED82CD2E355AA0895177B84E4770 MOHITSAH
143,584,060 *0DC1AD05D910CFCCED4EC2C83A59C49ECAACFCF2 [email protected]
143,584,061 *0DCB11439088FFD07450C1163AD05447306BBBB0 monkinventor
143,584,062 *0DC001433A4DF6B040CD9C1C15212564D124FD01 MONNAYERIONS
143,584,063 *0DC88929140C5DC6C653BD6BEA826031E06408A2 MONTEFEWLESS
143,584,064 *0DC3F0DEAED4B72FB5CAFC3CCAC4D58A5270B5E1 KING.PALADINO
143,584,065 *0DC9BAEED181CB9782AB6C87C7A7D68FB99B7830 MONTYSIPHAN
143,584,066 *0DC0196F2744612602AB09050E48B2C11FE343CC kirbypekrul
143,584,067 *0DC6F8BE3836E9581A10D706DC5FD44818AD1A5F MOSE.ROARK
143,584,068 *0DCB5E0D4EBD7F66050BE1A4341BDD6E7D0C203A [email protected]
143,584,069 *0DC899A580EB80BF1795D90100631261DA2880F3 MSSEXHIBIT07
143,584,070 *0DCFA167F68C03218EEF9F108DBE78B20C55156B .KNIGHTON
143,584,071 *0DC125FFFBEF8419948B909D5C83E4724DD15D06 [email protected]
143,584,072 *0DC971C66A44D5D3CE832687E88054440C4AD8BC multiplets.
143,584,073 *0DCF0A7145C2C0A52227175E353FACED68EBCE6E KOREYMOOD
143,584,074 *0DC7BCDD151DB17C96D3EA19BB759ADF5F7947D6 krabenmädchen
143,584,075 *0DC087419F31E7B72712554A42F105A1D38C2CE5 kristaoverby
143,584,076 *0DC90B349A8FE465B092EFD43870ADA1AC41DFFE [email protected]
143,584,077 *0DC530C8499E6B9BE76E6CC23062DE8E0BD52E05 MUZTAGA
143,584,078 *0DCDB243D88E4C82D07AA47409683AB26A2B63AA MYHORNET90
143,584,079 *0DC98CFF47BD6E2503FDDC5A0BCCEA861F740B16 MYLESBYKER
143,584,080 *0DCCFD79F6EE8BCDB39B6A57363769A9087946B5 MYMUFFIN39
143,584,081 *0DC286D2F6495AD273BEB6B9279905735C40FA03 [email protected]#
143,584,082 *0DCB9C475E69CB418402C215DCF1E9DB62BE7078 KTV8
143,584,083 *0DC56DA29F53B0D23601DFC1336984A3561E8CA7 [email protected]
143,584,084 *0DC196DDF8FA83419FEBA230137DC681179C11C5 mzihkbjrmdu
143,584,085 *0DCF0C1A46EFBAFBC32DD36572A0759A46EDD1AC KUOLETTAVALTA
143,584,086 *0DC22681E9FBAB536ECE3ACB2C959AB07F0F5FC6 n3p0+15m5
143,584,087 *0DCE16B7582DF7233E04E9CC3B7B7CDA52EB0900 kuzunm
143,584,088 *0DC01AA81EA873642E38D657F10FCF46DEDC6F4A KVI6
143,584,089 *0DCAC4A3DF6183E08CD78EBFDE93B732D52694DD [email protected]
143,584,090 *0DC181FD84A3828593D03CBFB9DCD84DF3774606 [email protected]
143,584,091 *0DC136B2235D6E2D72B355DA93D83BFFB3C16653 (NAKED-MIX)
143,584,092 *0DC7DE7FC46D72C89A15DBA9B7842DE24C21C60C LA.BARCA.DE.GUAYMAS
143,584,093 *0DC42FB6B93AA34D6AFA5EEEE1AE3EF1189BA781 NARAMOINO
143,584,094 *0DCEA3F92ECD0690D435892C2E221544F54DBC2C LACYJERAULD
143,584,095 *0DCE2A12E884AA563FDA3B85626B52AAE4745A35 La-Menage-(feat.-Q-Tip)
143,584,096 *0DC2F437D386B55D4E77C332C5A9DFEFE0108843 lanemoeder
143,584,097 *0DC484B7C8A627FF40ECAB8E33CEB49683502819 natthews
143,584,098 *0DC84D913490323D1C5291D096CEBDDBEE62E1C8 NAYSAY.
143,584,099 *0DC9592B01D9DCB8EAC53DD382C9A7AEAD9AAC59 NCASSIE1
143,584,100 *0DCBE38A5F8E2AE1C49CF3AFEFE3BA9A40AB6DC3 nehadayal
143,584,101 *0DCF0389FE71940F084D6DD1C65C797129D6FDE2 LDLAB
143,584,102 *0DCA9FF54C22D9531F5D9DC15DAF2ED60817C7B5 NGER-VID-HAVET)---II.
143,584,103 *0DCA3BA023210EE7EAB8D301587B3457FD697529 [email protected]
143,584,104 *0DC592ADC9EA0D79D34108FE7BE83603427672FE nicoleamber
143,584,105 *0DCAD2067A0A51163CA9C42AE93F506872174D0C LEN CLOUD
143,584,106 *0DC6B90D7DD83FDBE00C117CA9E103B38E074B4C LESLIE.DOUGHTY
143,584,107 *0DC0C99D9F6788E165C9E29D41E6BFF734C176A7 N-LIEKKI
143,584,108 *0DC9A628753087B51CCB6C1B8FA7A534992E3793 LETTING-OUT
143,584,109 *0DCF88C83036EBA292852386769F9DEF20BF4112 LEUNGCHUNWAH
143,584,110 *0DC8AEB4FF1C3BCCAECC18C106F725A275F1E23E LEV4N+$
143,584,111 *0DC1DE7DA808A51252AF66A72CAE30BED72F3FAE NOE.STAMPE
143,584,112 *0DCC3958707AB14C9CC2890D2E919C8542BA8DAF normandschadler
143,584,113 *0DC50295F913D1129DAEA515DFEAC674412D99E4 [email protected]
143,584,114 *0DC0BBA0AA8FDEB3BC28D20526D3EEABAB894CF5 LIBIDINIZATION!
143,584,115 *0DC143B7584C1BD49104C6FFBD9619A7E5927ADC librissen9
143,584,116 *0DC28C6532AABC47395F34D49E08BEBAA0D61F83 novel5tc
143,584,117 *0DC4774E04B32C3B33716025580B56A2474CBE54 [email protected]
143,584,118 *0DC080F007E547228E263931B239AAB3C23005D1 LILAS12345
143,584,119 *0DC89418F11AF8DAD4EB1D4B476CCE6B40D3A68F [email protected]
143,584,120 *0DC85C57C3B9E392798BB3475D1426E79D300FC5 (~_^)-O~-0~-<---8
143,584,121 *0DC29262CA0A7BA5AADB75EFF30AB394897A485C obecostrov
143,584,122 *0DCAC41D859755F03600149F95ED95F1F5DE747A LIRONÉ
143,584,123 *0DC06F4288157CEB0A79A01181607D7A4B97C539 [email protected]
143,584,124 *0DCEE414EA4048DC7FBDE54C722720F5AD34724C [email protected]
143,584,125 *0DC65AA8F57D0DDE311B500B74E3A1996901C27F [email protected]
143,584,126 *0DCD022CC666E240D1441683D3A9A3D79B5327BE [email protected]
143,584,127 *0DCD9BFA7961B3A6E8C06A246DDD1F386576F813 LKIRIAKAKIS
143,584,128 *0DCC0AF9416F338AE461D556A2A4E8F1B5C0758A LMERIDIS
143,584,129 *0DCA77091972DF900EBF9955CFF0811ED1EE0A01 LOGANLOCKIE
143,584,130 *0DC22CB178189755DAD0C7B62ADA942131FF37DD loglinbsw
143,584,131 *0DC721522F60B441B42AEE470280CE7A1A864E50 LONNIEGLAZNER
143,584,132 *0DCC7688AB3F4FB573ED3634662F169A6A379B0E lonniepoulsen
143,584,133 *0DCE7F0CDE68D5B9D59A333EDFAC9DC2816F755A LONO99
143,584,134 *0DC0998148857DBD846DB45A028224581ABE1510 (O_-)~ D--P
143,584,135 *0DC9EBA7C94D3C2B1BAB0CB69F9B5C35053955F2 LOSTCOLONY-THEMOVIE
143,584,136 *0DC3494ED1BBB98896DE0EC15934A8D5D3BA4D25 louise.dalby
143,584,137 *0DCDF0DC7130DA1AB59B852B345F2354B8DA8B9C Loving.Kindness.&.Wisdom.(disc.2:.Invocation.to.Maitreya)
143,584,138 *0DC8F6714E04B1C63A71D3CA0234140567333614 Lowrider.(Frogacult.remix)
143,584,139 *0DC384850983F8D6570A0D288E65809507F58A68 OLSONHARALDSON
143,584,140 *0DCB514360EFEA99199320597CC7A61B1249CA85 LQUAT3
143,584,141 *0DC7DD1164D0320E9D140F7713D18E1CE33B8223 [email protected]
143,584,142 *0DC298697416690F366146BDDCB4DDCCA85FCE86 Lt-Charles
143,584,143 *0DCFEEB1C4160D35B8D6ED08E30E67D78727E050 OMSP
143,584,144 *0DC43C7B7CEDFE55CC65E0BE43FC50BA397F47BD LUCIDIEZ9
143,584,145 *0DC99797188D05E5B9C08F80A857A4F7250E73B1 LUCIENFLYGARE
143,584,146 *0DC96FDAE7B094A6E6F7304ADDCC4F1147261467 LUCMCFADDEN
143,584,147 *0DCEE74BCB6528EEA587F59DEF989BDF555F06AD [email protected]
143,584,148 *0DC8685D4F69927E689ED1920816B506CAB5C280 LUGGIES
143,584,149 *0DC0626D2C64E268FB945B502FAB081A23309387 OOSTENDESSA
143,584,150 *0DC7910E009DF2F586C9F45B9083282BC7077D20 )o(.~.`<==p
143,584,151 *0DCDFEB3BE26BC61272C0753385DED3F9438F3DE ORANGERENEE
143,584,152 *0DC7F0B91994C84825C1D8A45978BF2112E86374 orderable
143,584,153 *0DC2DDD30B0CD27E2924C1219AAAEB9B12A225E2 LUQBOY
143,584,154 *0DCBB4144B9C6874C3DD67DCDD7CDC4199236817 ORLANDO.HATAKE
143,584,155 *0DC2D6B60AC4F28BD847644E5D0DF774107BC132 LYNNLOSEKE
143,584,156 *0DC3A462A3DF35B2A7655B49F7B89F4C6F7812EA M0LH4RLH35
143,584,157 *0DC07B3A91A1157E503E25CF48C3EFCD4ED9C7CB M4R4M44S4I
143,584,158 *0DCAD5EB619E9F0595828005645B383064401270 ov3rgraz3
143,584,159 *0DC3EA91CA7263486F34EC6C69234574AC6A0BDE overdone/thema:sacred
143,584,160 *0DC7914F40754EAA12C9E312B4A4271A2BAC5181 MAC.MODZELEWSKI
143,584,161 *0DC65968B0114F44D3A1ACB6D5DC93F5B48CCD94 MACROTUS.(ALBUM.EDIT)
143,584,162 *0DC1ECD9CFAE0CE0158D34CBC49477C52E7DDC33 mageana3
143,584,163 *0DCD87B6E9B97267B738DF241DA3E7674686CD2C maieski2
143,584,164 *0DC81018344889E5749052AC2434AD5A8EED729F P16F06D82
143,584,165 *0DC8B3A7543AD54845F42EACD97246B563E04C69 p3nny-gr4
143,584,166 *0DC6242209276275B0AD40E4308FD9C4B4E2A97E malicieus
143,584,167 *0DC707ACA3C6525A73E0A20B709B4384BACD6D19 MANIFESTARIREKIN
143,584,168 *0DCB3C4F900DC9A4AB41C2780E5230641B86793B MANUEL.PRESLEY
143,584,169 *0DCA5300DFDFC51FF81A5EAC741160E3B12A02FC marcocontraras
143,584,170 *0DC3F697D134A476C70BEDB6B913444A21C2BA6A MARGARITOKOERBER
143,584,171 *0DC9D587E3951DA65DFBD440E6C5B8D8CB539A98 MARIONSPERANZA
143,584,172 *0DC0B28E30C2E1308EE359D3581C0F928F671C3D MARISSA’YA
143,584,173 *0DC58725E5327299B2907F0BE067963640EEA7DE Maro-Jailo-(Transglobal-Underground-remix)
143,584,174 *0DCCD8C64E4D82C005C9314A22666ED22DF4F9A4 PASSWORPRAISE
143,584,175 *0DC701B277E7B7B972157A654388F5DB8AFB3F92 PAT.PAIZ
143,584,176 *0DCD6C7630C5D705BFD6E74C58239C13F14A8310 PATRICIA-K-JONES
143,584,177 *0DCAAABD60E011E39163D98E24B941DFF54CB6B8 masihtrês
143,584,178 *0DC1C7ADA3EDD6FBE1A5813867414061F105A021 PAULCHAANINE
143,584,179 *0DC563BF1CEFE8ED0C026AA4F16F346C915193D3 MATT0919
143,584,180 *0DC20C92578B20DF7E06B689243ED850EE2B2BEA MATTEMISON
143,584,181 *0DCAD0AA25A92053AA87BF57A23C3F6F8929A39C paying-for-daughter-song
143,584,182 *0DC53465F809E4A68036766F7D872FFACDBB5FE8 :p~ ~ ~ (##b
143,584,183 *0DC565BE5AD25D3EB69CFBF6A3735AFE36E0D642 pB.*.*.*.~0~o)x(
143,584,184 *0DCD3E4F51BAB5A43152673ACFC2B9D058B5739F [email protected]
143,584,185 *0DC84AAB9BB1AFDC6CCDD7EBFDD334FF7A617761 MAXWELL.POYDRAS
143,584,186 *0DC962363D27E0A43E4E4E3F031F6EC99C899967 PERINTOS
143,584,187 *0DC5A2B067E89DC17D98110F42382E2121F23A43 persuaderons
143,584,188 *0DC13151F4FCFB0CE8C16C69FE3717A81555619B PETEORRANTIA
143,584,189 *0DCF7267AB2996E82B188A945D525AFFE1F9DA5E PETER.LOSH
143,584,190 *0DCF1309D2463B383318982D25C54CEDD067C996 PETROCHIK
143,584,191 *0DC4245C2481ECF941E2EC345B7A5CBEC6BD7A83 MELVIN123
143,584,192 *0DCD69A8A6EBE534A5E3C01BA73E2F6328CFDAD9 phl3djo
143,584,193 *0DCC31DEC6ADE6B39A67586F0900A3C93C40C6E1 MENETTELYÄMME
143,584,194 *0DC998DFC529A525DDA1DBC72215A68383EC38EC mensens5
143,584,195 *0DC0D900B19F35CF49BA905717B8FFADAA9A320C MEXICO-BARROCO---PUEBLA-4
143,584,196 *0DCAE2E10C82354013B3C60DD26051A2C9BD8CC3 pireimu2
143,584,197 *0DC920FD27CA494B3BD283243942D942DEBD46D7 M.grunberg
143,584,198 *0DC141287E18BE8AA89EB683169D47EFD18509B8 MHGSTRNDS
143,584,199 *0DCEF0C77035D4F8626F6E3CB1A3D18A5A68CC8A michealbeer
143,584,200 *0DC2BF6946F794452AEF6C280F70F6DA75DD3D59 michealscorfield
143,584,201 *0DC1EAC4EB378BADECB36FD00884818AC7AA3668 michelmaduro
143,584,202 *0DCD27B526721DC82B3C0684340BD33D817D725C pldans
143,584,203 *0DC4AFA5C9EE25628ED5E931573FA244DFFE1962 miguelhaugaard
143,584,204 *0DCB10EEEECC990CE53577724EA0753B026E05D4 mike1316
143,584,205 *0DCF10EA3FC57B0A8A2E2FF41673620547B69F6E [email protected]
143,584,206 *0DCA5B853A25AE02495F9C765FC6BC966DC57D5F polyclar
143,584,207 *0DC7B998B8158E3E35805D55C7E3BB4F94E601F8 MINER
143,584,208 *0DC44193951C9A113698161E581C3FB8AB1B006B MIQUEL.GHIORSO
143,584,209 *0DC448F19AD1EB3D51BF6FBCDBCC2D807770C7C2 p##)-~O-Splat!
143,584,210 *0DC4E898C6C78F08FD6AEC6D4AD4862CEB1A6E48 MITCH.SCARP
143,584,211 *0DC0E8EC5B4C3987DA4BB0D10315C735771D620C MJ{
143,584,212 *0DC021DFD938489BCB610ABA1BAB0116FD72E534 MMUUSSEE
143,584,213 *0DC45F32D6CDAEDC306500CC2EC3AE3D8AE8957A [email protected]
143,584,214 *0DC33B6CA5789D75470B16679D1077BF3E661B6E MOB1000
143,584,215 *0DCDD10E428D3EB015FA573758DCFB1848289D9E p==p~o-~o-(0_<)
143,584,216 *0DCDE0AC2DF7A93839B3DA5699A56FBB36AF291C MODESTOROMASH
143,584,217 *0DCA00109600BA07453706063026445EBF7D025E [email protected]
143,584,218 *0DCB2331C2F54BE4E06202E0D7F9F2869F95C7DB PRASADPOLAVARAPU
143,584,219 *0DC6C077290885F6E3A7ED29BDBA5B1F44B6578D MONTE.RUNYONS
143,584,220 *0DCE31CA41E4FC8514EF4020BD5CF2AF876B1937 MONTEWOLSLEGEL
143,584,221 *0DCBE6043AF7372E638877684E8A43163977D9FC [email protected]
143,584,222 *0DCA3B43A7E7FED9706A05B5DB449368CAB407A2 PRO1!F3RAT!ON$
143,584,223 *0DCF55A4AE7496B23B19F97F05392424EA74F174 PROIRAQ5
143,584,224 *0DC42708ECBF3F49CCDAC433C489616C0E60FFE0 MOTHERASHLEY
143,584,225 *0DC3D6D93150AC6766C6C90D9F120D4B510F183A proteroglypha6
143,584,226 *0DC53B569FA91980E4A1779296E2A04878FB3BE7 PROTOPLANELLA
143,584,227 *0DCEDC213B1E7513A4A6D57E9553DB886C30F4E1 PROVIDER-INFO
143,584,228 *0DC93910278401DD3C0DBCA0A09A2F517D94045F psherman7
143,584,229 *0DC6AA6F6E8D07FEB52A98F6E7E811E0800AC91D [email protected]*.SPLAT!!
143,584,230 *0DCE583EA3814E4E9CC2691631F302DB02C03698 PSYCHOBORIS
143,584,231 *0DCB330F4D8C0A51C1B87B699854F8918A4BEDF8 MSIYBB
143,584,232 *0DC5D8D01271CE37B85562A899072B7FEC801CB2 MSTICS
143,584,233 *0DC09EFB3801B869B888E170A6B2DB080E00BC09 MUNICIPIOS.Y.COMUNAS.DE.C
143,584,234 *0DC5D438A50E5E4C18DC1D8BBD584F1CF2FAD7B2 PXL/PKFONTER
143,584,235 *0DC8473838C2744EAF929294A60DB56524AEB58D p$ycho1o91$7$
143,584,236 *0DC0C123C2EA4B8FBEC26361321A685E5D58C460 musa-ris
143,584,237 *0DC7D916473F72B147B829A068ABCC258C584A64 QAWSEDRFTGY548
143,584,238 *0DC5D8F3D43E51DCDBAEC467E66A31C67D9ACAD6 mx[k
143,584,239 *0DC21B877444F9074C5DA0E2E55D2871F418191A qb.~o.}o{
143,584,240 *0DC31BCDF88FEE5A2A63A206EE930C0E079194C9 mydollars90
143,584,241 *0DC3CF8B2EA551FF19492ED6889C18C29C8BD0AB myhasean123
143,584,242 *0DC2DBF36EFBB8B1CDE9A29567F2E06C0A58E631 qD ~Splat!
143,584,243 *0DC212F6FDB6986737036330F23A201C48AB13C2 MYILADE
143,584,244 *0DC4567252F5E7363A36B37732BD9965DFBB4219 [email protected]
143,584,245 *0DC420FA9AAE11CEA2E72EDA7B2291B08D70A376 MYMERLA2
143,584,246 *0DC5B091DC63DB916043AD87A4BAB4EFD2ED6A51 >-<~ ~ ~Q---P
143,584,247 *0DC99ECACCFBCAE22CF9286B1F74C3EE5C3D6823 Q======P~O-(-_0)
143,584,248 *0DC379F9A1A289F62416817B741AEB940EA4166C q----p-~o-}o{
143,584,249 *0DCD3527A8BD1B1A691827792E7CF8BF80D95577 n8>t
143,584,250 *0DC6159A905341ABD90200B7DCB3E6BF0A81026A NAGADIPURNA
143,584,251 *0DCA6824BC485D28A03B48A2481A41821BC519B0 nandial
143,584,252 *0DCA20F2E2838CE507A4CEA3134031DEF7F96248 QUYENDLE
143,584,253 *0DC67D8F5ADD96AE0C19FACEBDA15A96FCC99D5F NAS ON LAURYN HILL (INTERLUDE)
143,584,254 *0DC15F7C47E4BF43088A51BE49D0572D8CD2482C NATHANIEL.PAWLITSCHEK
143,584,255 *0DCBCEAA4287A48CCA39417B0E6D7AB0F090A509 R3d3mptbl3
143,584,256 *0DCB9637AE8FC4FCEF6743A36F26055A85529C6B r3dr113d
143,584,257 *0DCC36AD4921B01D8BFA442D853BB263DDE724D4 RACHAEL RENZI
143,584,258 *0DCF063C50489D9E47AD09D70CBEC6B72125CBDD racharaad
143,584,259 *0DC4F547E032CC90E07C5FE8BBDE557BC4EE1EC1 n\cc
143,584,260 *0DC24262C0C7952F809D3FD8B47D3FB6046EFBFB [email protected][email protected]
143,584,261 *0DC40997F1D1CBC7089237431E1A5E3BB517836A NDEM0N5TR4BLE
143,584,262 *0DC7DE332D0FFD6158D261C8838FAAA0B8646399 RADIO-SCRATCH,-PART-01
143,584,263 *0DC3F1A0A722061A020A27A4FAB46B3397B48E23 RADIOSONDE9
143,584,264 *0DC13AA7EC404128BC38059BB498572ED650F1C5 [email protected]OM
143,584,265 *0DC36C7E0BB55FC89548EA9726B4520D58E13564 RANDROSENBERG
143,584,266 *0DC3699A6013E16E379A171F1E214635008226C9 randykammann
143,584,267 *0DC269E216F09F711470B54296DC39CBBC4BD4EC RANDY.KIRYLO
143,584,268 *0DCE7ABDDCF063E78A2F04F3B075F8585D7E08E4 [email protected]
143,584,269 *0DCA7359CFEF53A4212A728B8F00619F2927BABC RANJITKHARE
143,584,270 *0DC342E5D4D42F36FEAB95BE549423597C024F3F raqxtrupdates
143,584,271 *0DC313F0C9CD47DB3C498CD8E918BAF566ACB9E9 RAT25RK
143,584,272 *0DC3FBAB19E102CC9C505FE5DB3E01A0B1020FC6 ratusza3
143,584,273 *0DC0C29C7AF74CD5C8A799AA3001024928A98F03 RAYMONDCRISTOBAL
143,584,274 *0DCCF2248E1FC79A1BA15B862D91198A0A5CF692 raymundoorama
143,584,275 *0DC32B398AA3AB12AC383B07D623347615F15792 RAŽICKÉ
143,584,276 *0DCE4F0A0581516DF1F208B8AA3BBC0868FD27C7 READERS-DIGEST-PLANS-CHAPTER
143,584,277 *0DC3E5584A382E1B4E4212FA171578F750F64C6D REDBRIDGEMAP
143,584,278 *0DC0ACD6A89780FC1F4CECB0937E9367C293D54A NICK-SCHLOTT
143,584,279 *0DC5AF3F940F623AFC69A27AA506C66F3A33B01A NICKYSCHOLNICK
143,584,280 *0DC38F9969F92366A46238A078465B86CE32826C REGENSPIRG
143,584,281 *0DC2B926EC5E2B3CA20C54B4C37CC71C2F9B1621 NIE OKLAMUJ, NIE OCZERNIAJ, NIE DOBIJAJ
143,584,282 *0DCAD42E05C94316A875CB4E575D162EE0DD4CAC nigawase
143,584,283 *0DC2995716C003E144B12409E610DE1F181BCA23 njambipeter
143,584,284 *0DC7947DD21B81B09F3A3B49FE2C41CC0C307C85 nlaspreslscorps
143,584,285 *0DC7A26D0CECD6261F3EF4435DE95BA7151316F5 noahdullum
143,584,286 *0DCBC5480E4FBB776F6B347B4E25CDE1C8D95CCF NOAH.KANEAKUA
143,584,287 *0DCEA54B66F763EDA6FB8CF2A8943C30ACE0EE9C NOAHTRAMMER
143,584,288 *0DC39E55BF6F8CA3C5BABA6091B8A09CE98B843B NONM345UR4B13
143,584,289 *0DC9FFF5B9D7D22C8764B4BDBD2505C0CAC8AEE2 NOOBOWWOW
143,584,290 *0DCB80EDF95C37430BDE15B5B76124DA1191278E [email protected]
143,584,291 *0DC81F8454AE2C0D8DC8EFEDA1D1F4CB8E288962 RENTAJET
143,584,292 *0DC2C31F9F8557A1A349DD8D9FC90EE8E04C32AF NORMA WARDLOW
143,584,293 *0DC8DBCE88FA2EB1E2B07E3A5ECDB914D1D8AEC8 requiem.in.c.major:.kyrie..kyrie
143,584,294 *0DCD5DC3E61D06D6F231DFD06816FA52D10A2954 novijom0
143,584,295 *0DC2408BF5222D9F41D6ADE38AE9B30DCAA46610 REZIPROKINTERPRETATION
143,584,296 *0DCF20E15F9665046C907B40A59D418152E52F49 [email protected]
143,584,297 *0DCAC7B2DC456917C701D4297A4F1D9B2773305E [email protected]
143,584,298 *0DCB0D251C07C2E0481C97A4557EB8DB0FA9C16B [email protected]
143,584,299 *0DCC01CA19A3E6D228211D93CDE1B8D78A3CC8B7 OBDOBD
143,584,300 *0DC7045BA54B3316AA0685C54F4EC61406623DF0 ricing
143,584,301 *0DC9D85A5F0369BD3CE4FA387A09E448A559B84A RIGHFA
143,584,302 *0DC658B83606F3906AB264D160CB60CAF84C73F6 )O(**d####B
143,584,303 *0DC5B0579AC4BBEB9659851A5B9F19AEB4AEE448 [email protected]
143,584,304 *0DC9A335F1915890B8487C25AB53FC2CCFC01391 riya522
143,584,305 *0DC9338A7C01D2839EE4A194C3D2ED791D82CE59 rk1881
143,584,306 *0DC89C50B1B23DEE72D2819173F20D78CDA0AED9 OLIVIA-TRUMMER
143,584,307 *0DCC0707F67EE16DA79F910D8B69C0D99894DC68 olotten3
143,584,308 *0DC1C4B74C30B7BD8FBF510857BA993ACB56F7B8 ROBERT VANDEWATER
143,584,309 *0DC0E506078699DDA6E6C62B05CD3DD5FF466980 OMSLAANDE4
143,584,310 *0DCD2DD3B9E6B11362085347E0B73F31B0600438 ROBINMINGO
143,584,311 *0DCE166D38DD888DD3DAE1A0841BF88A3A79B6B9 ROCKY.DONABY
143,584,312 *0DCE896F94D69D1DCE0CEBCFBE09922A90043EC6 rolandovoorhees
143,584,313 *0DC3726452B812C2170F068CE6BF38A774687112 RONNYFEUER
143,584,314 *0DC23616BE212F0A0CD952F44E3E77EF6EA1EF81 ontvanginstallatie5
143,584,315 *0DC7FB95BB7D5BEBC115C1165A819EA0F624BAF7 (O_)O~<8
143,584,316 *0DC6CDFC4475EB03D07A8E9605CA32C34CB33A3D [email protected]
143,584,317 *0DCCBB42DA48D1E21F74DD111B68042C6F8C9751 o->-<.~`.~`<======P
143,584,318 *0DC7DE5A4EB9033B6C07831E22F0B9D96D75C636 ROSENDOHILBURN
143,584,319 *0DCA0AEED7B341A793381CDAEA785EEE53856764 rotherham9
143,584,320 *0DC5953640FF4FB55FF4A50FF8D2156EDD05EF44 ORVALLOTTO
143,584,321 *0DC15B14A54F718D22DBD818D4AFC90383BF1644 ROYALS0246
143,584,322 *0DC06F99C07FABB0013546E22F703D3668EF8E0A ROYSPRINGS
143,584,323 *0DC653C839ED5C95DFECB55983148867BDCB6133 OVERWEARIED0
143,584,324 *0DCBE0F7F77E247D3EE36828D5191C378393FBA9 OWEN748
143,584,325 *0DCE1D8704A2C0E6CBAF987436386A54AA0B4B47 O:YN
143,584,326 *0DC9FBCCE96A5DE669D67F27DE16D7D70C562A4E ruebenspivak
143,584,327 *0DC70E9B3CE129E9B4537240B7EBA0CF3E8EEAAB PALEISTUVYSTĖ
143,584,328 *0DC375A342E1B0FD2F811B8D92F8F03470CC1985 RUNDFUNKEMPFANGSTEIL
143,584,329 *0DC41790ECA509B24241823765366FBE171DC83E RUSSELLEKUSTER
143,584,330 *0DCF4ACCEDDD4F4172056FE09E149A304194B9B0 Paratrichosis
143,584,331 *0DC5363E40EF53A7EE5C728B18DA9D29ABCF11CF PARENTOFDATINGSITESLOOKSFORAMATCH
143,584,332 *0DC323211C6DE6AEB7C3E89D108D388C1DD8788F parisgrenet
143,584,333 *0DCEC582B54A1B00DD589F098A943D2D7D26D26B PARIS.VIGNA
143,584,334 *0DC3AC9D242030D2D27F7E3C6E38EEE6361046A2 PARQUEMARIALUISA
143,584,335 *0DC5DD7391681A1963B448D0E9B1FED7595D5F47 r-Violine-solo:-II.-Rhapsodie
143,584,336 *0DCC862D0E736EF1B4C668DFDB4EA4770E5830D9 PASQUALE.SNOOKS
143,584,337 *0DCB50870B31740A576C357EC4E162031EA592B7 S9n4lz4+0n
143,584,338 *0DCA12E69755D05A477C3098B3C56F527C0C281C SAAVUTETUISTA6
143,584,339 *0DCAAD83840DFD23F46FC394143AFE93724C9DA0 SABRESABRE
143,584,340 *0DCC102DDDE84682B454E1CB48F5F7771F4EBD5C saharanile
143,584,341 *0DCBC18A798BD51CFBBDBC014B9597B210A8ECB2 saileths
143,584,342 *0DCE642608ECC07B73BF6D8F94DE619BBE0136C0 patricia.farris
143,584,343 *0DC19E9F137D346292E1D67CAE6EA1AE269020D1 PATRICK407
143,584,344 *0DC1C47B4F198597F7A9CB307D7C456058A86059 patrickdraffen
143,584,345 *0DCD41867C2E9AE9CB495F84FD7041CEBE0BE03E SAL.FRINGER
143,584,346 *0DC479DBB0D70312BF1DC78F00F7226A21272F40 SALMON-DANCE-(HERV
143,584,347 *0DC28F0CC99FB88C5EB45A3846053551769E0DD5 salubriously.s/@/'l/u/br/i//@/sl/i/
143,584,348 *0DCDD213A3826C7511D5F4C8B7BCA016FCB065F1 PAUL-MYATT
143,584,349 *0DC0208750031956A9E19D29DEA4226D821BBF5A paulpflugrad
143,584,350 *0DC9DFE3F424C5D83ADFE1F3D5F2EBBA8345DE02 PAVLANOVSKA
143,584,351 *0DCE724D7F4888F263B3B0D61D60E93D46ED5846 P#B-~O>-B0
143,584,352 *0DC222EB40F8338FEA329FBAB36701371B3CC289 percyknapp
143,584,353 *0DCA075A617BCEC485038655DF57014791C76B8A PERSEGUAMOSLHE1234
143,584,354 *0DC01A0347E1DDCCE114AD88F0F4B48AEFBB3A5A PERSONALANGELEGENHEI
143,584,355 *0DC186D1E8D9631BB8A89D776D1137297C05201A SARAPINTAREM1234
143,584,356 *0DC8EDE84C332396785C818349098BDE64554459 [email protected]
143,584,357 *0DC899134CC239DEC7B6950C4FEBB9BFA75145AC [email protected]
143,584,358 *0DC29498492D4152C09AB28A803B78D5DBEFADAF SCHAUTES8
143,584,359 *0DCC9E21BA3FBA867A6168DEDAF5ABEF7470C2B0 [email protected]
143,584,360 *0DCD9FA8360A589FE0920467CE968ED4CBDAEB1E SCOTSAMANLEGO
143,584,361 *0DC4E19C564EA9685A74AAF1F9CDBE118D9F3545 SCOTTIE.FURLER
143,584,362 *0DC8CA63B8B6C08D6D7D8C96E2624D8808105B36 SDEELBTUO
143,584,363 *0DC104561DF6FDE111363CEE51A8FC5235584FC9 PLACACEJ9
143,584,364 *0DC30BA9AA931B4AE318368CAFB3757056118E0B PLANECE4
143,584,365 *0DC111AC65CF16FE929FD611E032AD32A72E6D2A PLATITUDINIZES
143,584,366 *0DC7D0187359F9B6D8730146C0626D904EF0C74C PLATNTS
143,584,367 *0DCA218E0DA0267CE2D02EF82C822E3A83B5B9E3 platyrhi2
143,584,368 *0DC576C07382BC18600873F792DF8E36467859FE PLPLASSAY
143,584,369 *0DCFC3C7F1B035C8320E40135038C4189529D27E SECTEME2
143,584,370 *0DCEFF3E7303D79BE5E971EB5BCC79533731594A POCZTOWE6
143,584,371 *0DC7853D6A893C51F00BB3E7A7419DBB78B64CB7 POLICE-POST
143,584,372 *0DC7E279D94D9D5D8A41DFBCE70E0A91A332451D pooja-ganesh
143,584,373 *0DCF7246026178C767D435A4E90727E65FDDE7C5 pooter0381
143,584,374 *0DCED2A38E1D10C344158173B40824058A7FA845 SEPTICOLOREDSEPTICOLORED
143,584,375 *0DC1867672EFA9FA31C317A52002E127BA2929C8 POP-U-LOUD
143,584,376 *0DC76C9DA17A4D41894EEE7532D1A2D64B58745B potru$t1
143,584,377 *0DCC045186F0737EF67FEB8A040F4A76E8D88522 pouted,.pouting,.pouts
143,584,378 *0DC955501D96C7F360940B054A642B378732EC6B POŽIERANIU
143,584,379 *0DC03E3CE27BCBF9F8BB19364BE1D8B2A72C80E6 pp~0splat
143,584,380 *0DC26B097DCFA0E8CACD4B30E3DA6C5010B991A1 PP^K
143,584,381 *0DC478BA3677014A34DE5CB5710F56A026EF5136 [email protected]
143,584,382 *0DC066A6DF3F0A53CCC019E51AFA9B7F578D6F31 SEVEEN03
143,584,383 *0DC4A1F03DDFD6B578AE53D76C9EE16590BA1FFD PRAZIQUANTEL123
143,584,384 *0DC180A0286FD4525EF36EDE41B536D32C50DCA8 shahzadshaikh
143,584,385 *0DCBE2292F886444D67EAD610A393E65D9A617AF SHANA.WASSERMAN
143,584,386 *0DC0F8C635400A27DA1E502BDBDE4C3C78A098BB PRIMALSCREAMTOPLAYSCREAMADELICAFOR
143,584,387 *0DCB6A1BA16422951A773183186D7DCEB3BCE794 PROCEDU2
143,584,388 *0DCE1E00ACC7C5121EBFD422067850A32D90AECB [email protected]
143,584,389 *0DC1AAC910C3F132109CEB511ECC6886277A2533 put-the-screw-on
143,584,390 *0DC7810D15BB3B86281665A3D98E72381264CAF0 SHANTELLE.NELSON
143,584,391 *0DC37E7922A8170371EDF65079B334EF2012F520 Q05021977
143,584,392 *0DC0526C4DF51E4A84445126F48CAD98B17453CF Q1R?
143,584,393 *0DC55C46778C77447776096A59521D807988E613 shauntokita
143,584,394 *0DC8CE9E4A6E0C359346037DBDA8149560F6A2BF [email protected]
143,584,395 *0DCA6BEBB51463E860AE7AEA6B2C8DBBF58BBFAC Q====B.~O~O.(>_0)
143,584,396 *0DC0286216E703E498A32D4E24BD72C7938C518A [email protected]
143,584,397 *0DC84FEF2CD254F3235083EBD9A0FCE12EA8B064 sheastadiumfansgoodbye
143,584,398 *0DC470BD6EB1E3401CE6FBB857562DF32DEA98B0 SHELLYCAITLIN6
143,584,399 *0DC0D8C4F33794917543C46595E25A888231E9DC sheltonsamland
143,584,400 *0DC94D5DF53D9F33F349E5877A0023D93352C00D [email protected]
143,584,401 *0DCEDBE64DC27D7D777B39DF2092F807ECE9C915 [email protected]
143,584,402 *0DC99B94EDF9E977B5E41F2E257349DAD023B494 [email protected]
143,584,403 *0DCFA1FD6E858F7FA1A22CB9AF44287132AC8677 QIPF
143,584,404 *0DC96C873F813AF6AE30043D7C3B8BDC6CDA8EF0 qldcourtshistoricaltrail
143,584,405 *0DC431142F0FC8B508183E2880A9FBEA56822C1F QOW)
143,584,406 *0DC2B58D14CBC3B03EFF738441B94DFFE5C76D06 Q######P~O SPLAT
143,584,407 *0DCB72B7901F677705866FB0D7B8FBE604EA82FB QUAKILY
143,584,408 *0DCB7765A2543608CCB122BA4E82B6E56D711E73 quatrayle
143,584,409 *0DC89B9438D9994DB45F3A87F1ABB10088CBF130 QUATTROCENTONOVESIMO
143,584,410 *0DCC88C71F803AECB0BDDA7279D60C3DB9C92A43 SHERMAN.JOVEL
143,584,411 *0DCF959EE64A8FEEAFCC4DFD86763BD3243B817F [email protected]
143,584,412 *0DCC5F46784AF7600AE476F2418A01FBA318E113 short.short.man.(club.mix)
143,584,413 *0DC6AB2C2960E966C4A32D76E52C6AFD051157A8 R38AP7!SM
143,584,414 *0DC8192EF2A7D7AAAE05E031BE8C736356E23B7E SILTASUURLHETTILS3
143,584,415 *0DCBD4CFCFCB969729DD9F995F114D625AE79829 ramatnit4
143,584,416 *0DC33A5F3761404BD4F79ECBB302FD3E633BF0FF ramirezprotesters
143,584,417 *0DC02B6E95D85672794263FF41443541D40E62BA ramoncychosz
143,584,418 *0DC083E98AC11C47446FA30F6DABB4D6BEE2BA4F ramonhada
143,584,419 *0DCE9477B1A046F3B73FC04E3C1CA6D6F1467969 SINGLE METHOD<P>
143,584,420 *0DCE7939CF4458A1F5CE94649187DAB4DBD5AEE4 randalortwein
143,584,421 *0DCE855B6A6BB5A224A883428EEAE2C02618A329 RANDELL.CROASMUN
143,584,422 *0DC32F431D0007D01FC87C33AA03A20675092041 raphaelhenriguez
143,584,423 *0DC0503DC6A661D1BF9EFE5014622853E97BAE80 RASHADISHMAN
143,584,424 *0DC3658356B566B15A45753C9BCB26798A7ADD15 RASPRŠENA
143,584,425 *0DC8B4F3E7F42654B40C2D723D0D8861B0B7CFE4 skeeterjessica
143,584,426 *0DC6FBBC89C9E9363F1E7644C014926518FA77EF SKINNEDANDTRIEDTOBEDISSECTED
143,584,427 *0DC40DF016A13047C872CC73FB8A96E162F3750D SKLÁJÁT
143,584,428 *0DC93D6722C11057A434D20A28751549A407BE3B SLAYERSWEETS3
143,584,429 *0DCD051384939FC4D92DD3A9E732C2A8A40BC018 rcvsbswed
143,584,430 *0DCCA764C3E8037E42BB51C35C2CCA9A7493D593 smokeyjustin
143,584,431 *0DC04D6512D2740453E760972B18A502118E00B6 REDICTATINGSES
143,584,432 *0DC123616C2E07B271939E9D87C701275D0C20D2 SNESSFC2
143,584,433 *0DC584FD7E21E148C01C55939EE683FA69AE2D24 REDISTILLABNESS.
143,584,434 *0DCFAE0D03EA60956AD96B0AA975A32A054F85B6 SNIKMIS5
143,584,435 *0DC4F687CAD491BB9AB4E2289C32E2598C449BB5 red-river-valley
143,584,436 *0DCABEC1EB9D6057B75B0C40B47ED79A8939D544 red-woodward
143,584,437 *0DCCF6F7FCE9027FAC9C6DBACEA251E46016761F SNOLEMSUM
143,584,438 *0DCCCAA9459A028BB25EDB34297318C18B487CF7 REED.SORZANO
143,584,439 *0DC531BB999C5B7218199EB09AF06F7E686CDB11 REEPITELCELLING9
143,584,440 *0DCC6335CEE82D8DE9DF977E12573C0FBB17D7E7 REFUGIO.MOOSE
143,584,441 *0DCEC6A0CDDE3AA178CE9F8A5B36B0E1209CE510 REFUGIOTURRUBIARTES
143,584,442 *0DC0541C447C5340A18D9B1ACBBB9EE99F70A67F SOLONG(LIVE)
143,584,443 *0DC93F075C5B540618F7F4C34F4DE7C9254C745E REINALDOPAYANO
143,584,444 *0DC597F48475017776847D7480E1FE2AADB1B1AA SOMMINISTRERING
143,584,445 *0DC3A691FB9D18C7C3ADFE8A74DD1AA581D32FB6 RELATYWNOŚCI
143,584,446 *0DC2872AA3E08664C6D1D3F8557095A428A10280 REMEDIRAM1234
143,584,447 *0DCB1D3897A696D03F67E3A2E677E32E41AFAAFF (SONORAN)、
143,584,448 *0DC64E325FFC79B68B8880AFA4632546EA099C08 [email protected]
143,584,449 *0DC4730838BD254A1D640FB296B9596FC60BB7F6 sorgsen9
143,584,450 *0DCA7E99D1425B0DB32B57D25BF922B3A1F385A8 sosiaaliministerill
143,584,451 *0DC442B4EE685BA8BCE1A0E1B39D98E33BA0F694 [email protected]
143,584,452 *0DCD76625C567D54BEAB836F6971491876AEAB3D RE(PARTITA)H-MOLLBWV831:BOURR
143,584,453 *0DC0BC24219897D4B97847A9F2973C76F7AD161F SOULGRABBERPART4
143,584,454 *0DCE13DA6DF7B73D4D234C4CDAFF1DACF67164E5 REPLICAE9
143,584,455 *0DCFDD3CAD2EB70D86E435B0F465383BE981E81B SOUSBOISAS
143,584,456 *0DCF2E08515E90FBFCDF8E08F8DC051323A480B9 sovvertir9
143,584,457 *0DCE17D671116CA707B5968F1BB7632ECF189E1F SOWCHAOS6
143,584,458 *0DC8E1A12704274CB7B89AF69AC2A3FCBDC47657 SP0TDRI1
143,584,459 *0DCE97224D1AC8AA75C9D864955F2E28559AB3CF RESKARPHED6
143,584,460 *0DC7052161D2926D085644AB3774D61A6D805287 REUBEN.ROSSELL
143,584,461 *0DC4F77D5FB6AB3BC9ABCB0BF838C832AED86769 SPLAT<==8
143,584,462 *0DCA5D19483008C2F23BFBB6F3D2B3C4E599D487 SPLAT!!O~ 0~ Q--Q
143,584,463 *0DC3D28C2845056E8ECB09D3A909BA44E84CD898 splat!* * (q
143,584,464 *0DCBEB684FEFBA46C12C9D155AD956905B1C3794 Sploit.~`(--q
143,584,465 *0DC890F1F7FF16DDDE2CA660268A2D024CA66460 SPORTICHE
143,584,466 *0DCF1721A8B2B5882864E656EBE4274681083AB1 REY.PANGELINA
143,584,467 *0DC1AA4481F5DC6E2DD4B10656169F59B1D9204D REZTAE
143,584,468 *0DC49D07555E1151D3B62998F45698F2D0B9E8D9 spunway
143,584,469 *0DC53B44F80E7ACA7368DC5405331406BA74F735 rgilwgy
143,584,470 *0DCA07E0F02F97AFD0047D5B9FFE4F92306E8058 R&H7
143,584,471 *0DC1E61BFBA92C24B56D00562E2E7C973A4156A1 RHETT.LOWY
143,584,472 *0DCC1179D6535B172912D7FB41CFECF99A85BDC7 RICHARD LOCSIN
143,584,473 *0DCC7E16E90D7A4907FB6B04F03CCD1E3B5C9AE0 RICKBOLLINGER
143,584,474 *0DC60CE2F18DA633CD45E5D51E77D3149A5916F9 RICKEYAMACKER
143,584,475 *0DCC087AF20E6A6B0FF18FACEF569713C9D2D21B sredruek
143,584,476 *0DC7E0F61472BF5D380EA9440F9E5A1777DE85A7 RICOPRUNIER
143,584,477 *0DCC13683851DC82ED5A71839AC9C89E79304DCC srna.m.lazic
143,584,478 *0DC17B3E492A470BE44BEE3F6D13C4DEE92A3ACF srtcvmfsmnnvg#
143,584,479 *0DCE8DE4348098593F56F8E64E9162B0FC95C46D staceyeatme
143,584,480 *0DCDEF1628B6B670AC33C14F23DEFB3252E2FAEC RILEY.CASAZZA
143,584,481 *0DC3CFF522292579071E76366032C00A0CA4D792 RingMyBell(AnitaWardvsThaThugBustaz)
143,584,482 *0DC2170C4C31CB0E13B20A875E986D4AECBF3CBE stanfordhomen
143,584,483 *0DCC77C2F174843EA1662D4EECDB3DC302DC5473 RJHEE
143,584,484 *0DCEB9E216CEFCE0C220EA354883FB71AD438378 rms-fs
143,584,485 *0DC24D09F61E066B6A541E6233F67DC46AC5A047 RMUTOMBO
143,584,486 *0DCB55A2C51EB4774479855982E89AF715A9C11B steamexploded
143,584,487 *0DCDA08B81A7A6AB62B51D08692644F920D2117F steeltoes
143,584,488 *0DC02805E34D0AA85FD04619BAC77C0F310C2F66 ROAEBSWED
143,584,489 *0DC76B3D9741B2C96B0B5EEE2E8C901F2152F877 stefanzulkowski
143,584,490 *0DC95610AA13B9F2303FB06CEE2DF96AFDDA946B STEPHEN.CLINARD
143,584,491 *0DC0FA97DA9EF2A29F4B4B7244D729FFAE99EB25 ROCCO.IANNELLI
143,584,492 *0DC0E4A8067F016CD43673038F892D22EF557EBF RODERICKRAMSBURG
143,584,493 *0DCF3F0E26089C28C0394BF717C59F38EE4CC33B RODGERDIETER
143,584,494 *0DCE57BF4D9C6344F7B1A40B24AB9E6D402CB21D STORMTRYSAIL
143,584,495 *0DCF8E307047E2B21F5DAAC3828FA4CF5BB55B6B [email protected]
143,584,496 *0DCE3CDF9659C0CF1DEE5ED32CC6DBE04DB52540 STREUBY9
143,584,497 *0DC3B21270C28A64D3328D3E069EE9FE95027251 STRING QUARTETS NOS. 13 (TALAN QUARTET)
143,584,498 *0DCE0200CFC54CD57C99DFDADE1D3945FC4C42BC ROLLANDHEYES
143,584,499 *0DC39A0495754392A5D9A8C18F73997FA5BBA114 STUARTBREINER
143,584,500 *0DC7B02871BD92A21ACBB07D4DC079305565101E ROMERSKAS4
143,584,501 *0DCD6219EA6048045E757D49963AC65F4B2DA5E5 rompermi3
143,584,502 *0DC7557A59D8F519A4EC0BCC554910564FDEA94E ROSCOEBROSH
143,584,503 *0DCAB5A4F427D9658B09EB79845407DF0ABEFB2B rosemarie.bulanadi
143,584,504 *0DC1771ED4C8AFFBAB4B65951AA6D36B5B0FD511 ROSIECONAGHAN
143,584,505 *0DCF2E579E78D4359C17551D0EFCE7E9B2AA2801 roundhouse rock (b)
143,584,506 *0DCAD1D1ABCDE9228096999508E30ED000012487 ROYPEGGY7
143,584,507 *0DC8FA685B11976CA2307643B388E82AB6D383DC RPPRVSNNR9
143,584,508 *0DC7E0ADA7FD0EF836A49C7D78FDACF69EB45694 RSEITTER
143,584,509 *0DCCAFEFB19B452033F1ED3C73855CF6DD40A1A2 RUDYNOVITSKY
143,584,510 *0DCF636BE373869EA7EC474569B969A5BB123926 SUCCESSCOMPAQ8
143,584,511 *0DC62DFB1F7544D630FD0850C44EC520B0C4A189 suchly
143,584,512 *0DC2ED9E57CDB3360E8AB644AC92D2E93EC7992A SUCHPORTALS
143,584,513 *0DCBB9C81175458A7ECC9663D3EB4DB36ED49C1C SAGDIBRACING
143,584,514 *0DCD1F75220ACB4F5422DAEEF073648435D8479B SUGISEI
143,584,515 *0DC98E52682822B615802592706769A22633B70C SULTAN.BASHEER
143,584,516 *0DC5B1F69E580FE78B1B679221F0B5CB7FD4A0C6 sumathishanmugam
143,584,517 *0DC3192A4F2438B3F080AF39BED3A6BD48368A10 SAMMYHORNBACHER
143,584,518 *0DC79509DBB3144F19FF5FC99BBFBF40522E101D SAMUELDOG
143,584,519 *0DC8375EA0EA48C94107D47711DAFEA6655BEDDD [email protected]
143,584,520 *0DC73C092000FB4CC4BAAF689C42D786803E3D9D SAPPHICS
143,584,521 *0DC5D0BD32ADC16E5B21EAFD113E6BDCCFD03194 SAYASSUREDLYAWFULLYAYEBY8
143,584,522 *0DC02E48F9079F8DB6D49F963CFD0D477ED9F636 sceptre
143,584,523 *0DCD05A21D85BB73FD37138F4AD9880436DB8F93 sunit.mukherjee
143,584,524 *0DCCC23ED14A7C9D10FA69B12FFE5984DC7F54B6 [email protected]
143,584,525 *0DCFFAC2393C80EB4DB7CFC0A5F9146D61C44CBB [email protected]
143,584,526 *0DCECCE73D53EA1373AD0D99DA39AD9C1A3C8D0F superchic
143,584,527 *0DC262C0C745DE2AEAFFC19AA99061A9BF07CF6B SUPERIORUM4
143,584,528 *0DCEEDC2F8A5E23D555FD2B1E8F0C386F5B6A7DB [email protected]#$%^&
143,584,529 *0DCD1442A6BF26CFD8EECC319D14A07EFF65A674 [email protected]
143,584,530 *0DC674CE3869390F696A964ECAF537DECB63A4EE se.7
143,584,531 *0DC3E29EB80D5113CC8AA78C1AC7728E18A84DA1 SÜÜT
143,584,532 *0DC45974C97858F87AE49E4246ADB7A7D4410216 SVETSLAV7
143,584,533 *0DC71286333B8E8BFB2F44CD04136BA585D47E80 SEDNIWRE9
143,584,534 *0DC4216EDCA5B06A4C8AAD88E785E4DBEB52E71B SWASRAW2
143,584,535 *0DC38D51D3FF4DE752A27C67C87A666EFC91564C SEPTEMBROVÉHO
143,584,536 *0DCD91DEF7F66B40C956E60586739A4A810A6CF5 SZALHIT
143,584,537 *0DCC7FB28E28ADD6E7C2CE8A035F604923424E62 SERRIEZED
143,584,538 *0DC3EE2DB1C543DCE88BB30E2309EFB264E8FDA3 SETINHERITED
143,584,539 *0DC51DB66F2211E7849846E1B3909A87F7C85A7F sgoments1
143,584,540 *0DC60CE888BA0E7CF85BFE1D7B57A7D561396DB8 SHADOW1643
143,584,541 *0DC45B304F1EB6272841E0C511BB670A7D977AD0 shankar-panth
143,584,542 *0DC6AE32049F5F7A90A8763D0787CEEB83E69A07 shannonmartinas
143,584,543 *0DCDBFABB217A30AC0BA21CF25D392AC0743DEF1 sheldonswensen
143,584,544 *0DC8D631AE9B5AE0E1FD46BFD0F085EF42010463 sheltonzdon
143,584,545 *0DCC3C5CD3FD2BC36ACCC79D0F8CEA6B9F166FAF [email protected]
143,584,546 *0DCE26644E83277659AACBEF91581B7DA329192B [email protected]
143,584,547 *0DC1D5E2CC762DD6908DCBEDCE127297ECD03AB3 SHIRLEYPOUND
143,584,548 *0DCADE6C0DEE3A22A4077474E3DA15C26C6DC871 SHOPBUTTERYCANNERYCREAMERYDAIRY9
143,584,549 *0DCC1246C72E130E4117BDB82F655F9EC401EAE3 SIBBYBEANED
143,584,550 *0DC57C0F120B1469AE3C83BF132F035F557D9BAF sicaspi
143,584,551 *0DCFF5B2B1F67E187847411BB24DF645FC1EF623 SILBERT--S-IH1-L-B-ER0-T
143,584,552 *0DC111B74EEE04154B3CE46B46054FFCDA22E977 SIMJUA
143,584,553 *0DCC1605F74C7A2AE967E777EB588C89DE0A18DA SINGLEPIGEN,.PART.1
143,584,554 *0DCB7E4896492FC709530082E82AC6032ECE78AA [email protected]
143,584,555 *0DCA083C7842F3FF6DB50AF06713AEB0F1FDB62B Sixb4rre
143,584,556 *0DC85533DC43EAA766DC7A3101548FE578C0B0D4 SJW9
143,584,557 *0DC883EF9CA259D528F2FAD2769D4E9D60CB8ADC skin.and.bones.(2005-07-08:.bbc.radio.1)
143,584,558 *0DCC11FF5CD5092642C944E0394515C1036DC4BC skitserne
143,584,559 *0DC9EB3CEBEC3738BA267C83C56492276C908014 SMGBABNURING
143,584,560 *0DCEEEF8F010CF080D053F1E5B092F1E8A2EEC9A SNERASOPSE
143,584,561 *0DCF92083C47E691E5B7C947234D4BF6B5749E7D snickerstrider
143,584,562 *0DC7380778C73F80D13596249ED7D00E481D98D6 SNOITISI7
143,584,563 *0DC2C9979B51DD0B7FAFDC480C42C14D98E72259 [email protected]
143,584,564 *0DCEAD6651BBEFC523826BFCF3D262512C57EB8D tangle.v:.tangled..tangling..tangles
143,584,565 *0DC85AC97AD0474EE0BC143B7A0649EE20D9CB25 tangsa[email protected]
143,584,566 *0DCF2D781DE105C9E80713142111BC04FF62B165 TATTINESS?
143,584,567 *0DCA246A3E2E4AF7594180F60EC2786EA8F6D13C SON.RITZ
143,584,568 *0DC5E6EC3B3B4B3AC16E6A509C2AFA90AEBFC3A4 soohwan8
143,584,569 *0DC95E274C9C833640C537799EC3EF52A2A45A73 TED.RECHT
143,584,570 *0DC10693E74386CFE56B1B01C6C40B9B81386CC1 Teenage.Cutie
143,584,571 *0DCAAB03375FC4876E493BA72CD84D5770A7571B SOVEREIGNPRELIMINARY3
143,584,572 *0DC3E36ADD14CAC3ADEC9BF87F53A24C980BC409 SOYCUTE12356
143,584,573 *0DC5E4B0569E2E876F2708455BE90DCB3B497B50 telakointiportti
143,584,574 *0DCFF960A8BB381F0325AD763F9B08F5362EACFE TEMPFILES9
143,584,575 *0DC4056E704FAC0245E38284CE1D4D2783B2A82A TEODORO.PERLEY
143,584,576 *0DCE403960C04A96D677BF475A43D8B62F5F1B22 TEQ^
143,584,577 *0DC8CEC1576E44418DD96570F08637099B5B98AA TERUPPTAGA7
143,584,578 *0DC509D739EB41DDAC7F9A4239900884CAEFDF9A speedoblowme
143,584,579 *0DC2EBE68883CC968F9C995606A02031A4D2994C TGIRFFISERT
143,584,580 *0DCA684A0D8CAC3F3C47DA6EF0EAD7353E4A8D63 THAD.BRETADO
143,584,581 *0DC8FCAD8149A2FCF4DDA743660B431CBF09B5D3 spillhp1
143,584,582 *0DC419294F8B7CC82484DF31FAA6EE29CFC08E62 splat*.<###3
143,584,583 *0DC958A632C84DCD8BF86C6994C1A669D2934E24 SPLAT!-O~-0~-(=P
143,584,584 *0DCEFC109357057AF9C1DF2623072E951BACDE6F Splat!!o~.<--8
143,584,585 *0DC4B83E7963B0FD01853B945868356A70F7E1C9 SPONSORISAR
143,584,586 *0DC07B9D322E92EBE45420CE108C38703BAF721F spraakgrupp
143,584,587 *0DCFF52A94745A3079F0E8A2B611E782D057FA72 THCSIRFRE
143,584,588 *0DC86A484BB50C23E488DCEE68F7F3C66E4F78DA SQUAGLIEREI4
143,584,589 *0DCD734E7C22F23BA2546177DEF93674AB3A57B1 SQUEEB0930
143,584,590 *0DC55E133A4177C0B266061ED573370435F9D77B THE-BLUE-DANUDE
143,584,591 *0DCDB8E6A790D288C7F2DE2C74D8B0C53870FBC9 thebreakthrough1
143,584,592 *0DC384D157631871BC7E4327AAA3DE531E81EF57 THE-CHOICE-OF-HERCULES:-"IN-PEACE,-IN-WAR"
143,584,593 *0DCCF580D907EA81BC9E805263F5C688BD9A804F the.funk.(nyc.afro.2000.message.mix)
143,584,594 *0DC56A98D867F2600D3E62116D8A87FF48256CFC the ground beneath her feet (remix)
143,584,595 *0DC257B2D1BB8E7968FF191839F11C0EC615E458 STACYHOLLY
143,584,596 *0DC28DAD3AB72B8CEE6EE0385FA233D04BDBE397 THE.OLD.FIVE.SWINGERS
143,584,597 *0DCF29CA35A84460DA81A6E8244E3C4F3CBD840C thomas schmidt-ott
143,584,598 *0DCD419221EA664B2794D155A1260B55059081A4 THREED
143,584,599 *0DCDE53B5B1A643D3DF26C0DC11063022D46A006 TIDEDOVER7
143,584,600 *0DC0862AB6502324A60284BB2AEF2E33DA6E84CD TIFFANYTIERRA
143,584,601 *0DCA8C8C3536D5558E882F180FAA68907385F973 TIMEATTILA6
143,584,602 *0DC33BD3B3AA6D432417D884B9F0845394F9F2CF STITCHEN7
143,584,603 *0DCC94D5278BFD599DBA68E6D2093B9C4A01774F STONEHEART'S
143,584,604 *0DCCA59B995849CCE41A11F116B3E9371ECA229F TNFSCLSYRRGNSMN
143,584,605 *0DC37DD71EC00DC8710EB120E716DCF36AFEB6E6 tnikrema
143,584,606 *0DC735CDD146712FCBB248FE608C7940B019D843 TOCAREI9
143,584,607 *0DCC00E6D41337E0300C22A9FB39A9942039281D TOFUFESTORG
143,584,608 *0DC3F44F5345990C9AB9C47013C0ACEEAE03513F TOLLERASTE9
143,584,609 *0DC3560E7657B72531A007B917050DA32B5D7245 subbureaux0
143,584,610 *0DC086117C59986994A3F52E4E7F46D50A7C4ACC SUBJECTVLAD
143,584,611 *0DCF145FE3E9A119C493D1E4E2D7342662FEC5F2 sugee-kim
143,584,612 *0DCD30CFFC297ED76E6E3F5596114D846CD62906 torythomsen
143,584,613 *0DC2657CA8BCFB0CC4F8F6716FD0532B83BE4DB7 SUNDAYSASKIA
143,584,614 *0DCEECE167D9C0B062469097C47BD89E7EE5EC3C SUPAWEEL
143,584,615 *0DC79FB8AA79CA8146223690A1C3B5F03F570A80 TRASIRI
143,584,616 *0DC5BDCAF4C2EEC03ADA4E863B2E87C0A5A26F17 TREVOR PLEAU
143,584,617 *0DC487566E3278F765CEA042088A0440158C6420 SUPOTEIS
143,584,618 *0DC1023C9FB1596C7774A147762D260195B7DE33 TRINTLITTLE
143,584,619 *0DCFD24746ADC62D65731F763368B3A0480971ED trishend
143,584,620 *0DCA817A21C1F7A8BC3AF2EC628BC177ABC574DB SÛSYAN
143,584,621 *0DCE1C972F9EF420AA6481F68762F8630F00F362 TRIUMPHSTRA
143,584,622 *0DC47A099AF56FBA539C33865E7E9F69B77D2750 swllwpp6
143,584,623 *0DCAF0F34B9BAA834567CB64E203D20DAEBFAAB7 trudie.graham.bitters
143,584,624 *0DC33C92F4448A60CF7E025EEAEBA75149D68620 SYLVIA DUBOSE
143,584,625 *0DCCE8A3913034ED105E936466CE0CC18AF8F3AC SYMPHONY.NO..6.IN.D.MAJOR,."LE.MATIN":.I..ADAGIO-ALLEGRO
143,584,626 *0DC100F4CE663BF764A4323E46E4E007C5B34560 t3$t.g4m3
143,584,627 *0DCB8A1B9707B951AA49380AFFDA358EEDCB042A TWELVE-ETUDES-OP39-08-SHADOW-DANCE-ALLEGRISSIMO
143,584,628 *0DC34D36A11376ADBF516D056B15C2D6F66B78B8 TWHCLUB
143,584,629 *0DC958D579114B5A3931344AA5387C9C207EE970 TALK86024160
143,584,630 *0DC74A118F7E924AB1631AE3DEC0075A2415EB8D TALK90195197254
143,584,631 *0DC02C06A57EF5F441ADBA00B20950CF3DA90745 TYRESE NOTARO
143,584,632 *0DC527B5F14DA0848895EC30BE95ACDABDC171F6 tysonyost
143,584,633 *0DC4D0F0C04F71078B8D672C491533B2BE31186F TALUKDAR19
143,584,634 *0DC511CED262DD23B0DD2C6E1CBCE9632B446C24 UAEIUOR
143,584,635 *0DC54FCBB79B20B5C94D961DB2FF82FA1D37C447 u%[h
143,584,636 *0DC4F6064D21E3BD02CBDA9995D43957F034731A UMCCALL0
143,584,637 *0DC89D23EFE4ADF8BC630D0FA201C308FEEE003C UmPassarinho
143,584,638 *0DC0883A9905DCFE388377BFB88E291940D78716 TCDROOM6
143,584,639 *0DCB16049CB8B927F56C336A5DCB4741620F5A38 TEACHING-HOW-HEAL-LAYING-HANDS-AND-ANOINTING
143,584,640 *0DCB6A4209C756B2DF282612A39A711FD8EB8242 uncuriousgeorge
143,584,641 *0DC9D728FDA43C2359771E6EBCC19994036E7A3D TEGHGHRED
143,584,642 *0DC5D3C617683C7F249E091F0D3A86FEEAB2313B TEILNEHMERQUOTED
143,584,643 *0DC0448A6738DD0CC6299608A1B76B7196E7E406 TELECRONACHE
143,584,644 *0DCBB0AEF2700909F19499D406A385668F90D090 TELEMANIPOLATORE7
143,584,645 *0DCE87C3B70B1E19B225DB0ED6F9F6866D2E279A terg4l
143,584,646 *0DC3D9E2D69B6166FA8E51FC293DF05E3FB98726 TERISEMBSWED
143,584,647 *0DC4287D74BE37A5F42CF2F2C1AC781B9966567C TERRACEEPOCH
143,584,648 *0DC0C2A7CE7EE46E6F571D28E8E6B07B8D8D9F21 terranceinzunza
143,584,649 *0DC31172D6360F51BCA548B683289601CB63FEC9 unseenacademicalsch22
143,584,650 *0DC0DFBA40CF59DCA61547DE0BCBB0FD775EDEBF upinthewoodpile
143,584,651 *0DC41A4DA67E4F3886D3D79564908218695C0243 UPISLAND1234
143,584,652 *0DC99E5DAC4DC7A47E75DF8797CBCABE261E7DB0 USER68118123109
143,584,653 *0DC89C68629BCC5E0D54E05A1A1CA2DAA47D683C USERKALZAMARE
143,584,654 *0DC0B10AD5B5CAD544D84E329BF7E24EA94AB289 UWGKNNGR
143,584,655 *0DCACDA2655041FC29A930C5E3F47CEAFC8D7C67 VÅBENFIGURER
143,584,656 *0DCD0733AF7ED427D7B5F9F0479BAB056D51ACB2 VADAVADA6
143,584,657 *0DCEB23ADD472456E5A3FEABB6433EDBB5B9E91B tetrarch
143,584,658 *0DCC2CC487285A9E830ABEAB13CCCEEF169DF4FC VALENTIN.ALFONZO
143,584,659 *0DC6F2F1BDEE92C5A130049DE5B15A287536636C thadlomasney
143,584,660 *0DC2CC76477AC2079A3867803C07A2E51D064599 VANDALS.-BIANCAOFHEL
143,584,661 *0DCAA691C3F023D56F75A86DAB7279CDD9456FC8 THATSWIMMING79
143,584,662 *0DC8D6E91808FCC492147D4D8088DCEC0A177BBD Variatio 27 Canone alla Nona a 2 Clav
143,584,663 *0DC736D412894F29383DE65C059A96827C3567EA THE ALLEN FARNHAM QUARTET
143,584,664 *0DCB87A659F23E9DB1AC31DB4EC208E5D66F96D9 vassfall5
143,584,665 *0DC2AF924FCF16EA7DC768F6AF1B7801586D4369 VASU-SIDDHARTHA-SAXENA
143,584,666 *0DC3A6283118DB5BC79F6EC0B162CE8735A1636D THECOLTRANE75
143,584,667 *0DC431C5DE4B4CE79E43CD50DAE0FA835D9774A3 THE-COMPLETE-CAPITOL-HITS
143,584,668 *0DC691547DC4B796394F7ED4DB27C0D1EE697CC9 the.lost.garden:.wandering
143,584,669 *0DC3E97DEF1FD4E1BA7546115B65A5A327E670A5 THEPAM52
143,584,670 *0DCE964A5F20815B0FFAAA55C001FB054047E6A5 THIKNS=THINKS
143,584,671 *0DC2EA887F861B594755D93EA0FED080AC7CA161 THIOCARBANILIDE
143,584,672 *0DCECC5311F2760CECA819E70471062D01953797 VERNON.QUINNAN
143,584,673 *0DC37C516A9E0D523DA06442BFAC4E9AD2C75101 thrnblad9
143,584,674 *0DC333367D4F2D7008979058BA08ABB1ADCCB75B thy-rebuke-hath-broken-his-heart
143,584,675 *0DCD0EEAEF5378D952A1B29093992AE5572EB45F vhsm
143,584,676 *0DC15EA8853CC0FDDFB2CA0AF350DF68DBFDE042 TIFFANY.MUNRO
143,584,677 *0DC0A8BE581732E8462CA598430D3261ED2FFCAB timcredeurtestspositiveforadderalltuf
143,584,678 *0DCE82D475494FA7DC93A6961902D56B0D665BEC viktoriia-gladun
143,584,679 *0DCE713EA253900D0336486C9B0ED2AEF1B52EE0 TIM-SYLVIA-AND-HOUSTON-ALEXANDER-BACK-IN-WINNERS-CIRCLE-AT-ADRENALINE-MMA-IV
143,584,680 *0DCE0868C69D71ECEEACB073B9A87412A599EB42 t/]n
143,584,681 *0DC6B6769B069BD2F4168B313DDB22DD168239F0 VINCEPEASE
143,584,682 *0DC073F32227EBAEFD05DF55DE7AC46893C32E4E VIOLETTIE
143,584,683 *0DCC90D7C1C56A24F6FCDD2C8D4FD8CAD93A7304 TOEPLAKKENS4
143,584,684 *0DC316E1C4AD7D70D29248C6A8C3F479748AEAA0 vlado-gerdovski
143,584,685 *0DC18F7720C45363979A589B9F29B1F448533688 VLSGNILR5
143,584,686 *0DC5E0D6E818F1776F9D7F5BF64AF9E5303131B7 TOMMY.PFAFF
143,584,687 *0DC67834E5848CC6F669438087F2DFB2621FD4B9 tortovroddle
143,584,688 *0DC05A5D347AD109333B5148A17D7E3BECA027A1 TOWNSEND
143,584,689 *0DC41D406C59183D4FC5386B48EFCFA5A834ECF7 V"V-
143,584,690 *0DC28521925216A87BA00CF718F23B137EF38785 w\]
143,584,691 *0DCEB9F5ED3D994BB773A6C032DEBC97915B1C20 wachtbestand
143,584,692 *0DCE70E2C8572FA005B3239B492BF98F011FFF5A WALKERCEA
143,584,693 *0DCFB3C4AE74A8D390C8047CE6C1EBEE727488D1 wardsahler
143,584,694 *0DC28710230AEC743E32AF5E69715A3F43D4731E tradcoukwww
143,584,695 *0DC0D9E657C85A61ABB2FA328505417CEF6DD825 TRAININGDRUMS2
143,584,696 *0DCAFC55143ABC65B0E0C65FFACFB97D0A87C803 TRANSITERIONSES5
143,584,697 *0DC401860235A8ECFF4F9A1CEA55F350ADE4348E travisbarnes
143,584,698 *0DC163BF468B623FC37B3676C30CE4CDFC678A3A TRAVIS.FINIZIO
143,584,699 *0DC5FE699B0B85AAC2D39A3F8E1066D48391E611 WAZ.GOOD
143,584,700 *0DC9BF3BEAD9E9C57DBD41645C1A488CC2D0992C weatheringthecurse
143,584,701 *0DC90D35F8DE445B9676E41AF2BF79927BC86D98 websterx6
143,584,702 *0DC586AE96836EFCE9404064083B480B94A6DC91 [email protected]
143,584,703 *0DCFB495807273A58838BEED9084A6CDDF7E5FFE WEITERH6
143,584,704 *0DCCEE407D4D37C6F0F9CB614323017F772E5634 well, did you evah (what a swell party this is)
143,584,705 *0DCF1A7E9E15DB6F985F2724F011DBC35F58AEB6 [email protected]
143,584,706 *0DC3D4771BE5839ABABF88A86F0BB7235079BEED [email protected]
143,584,707 *0DCEE316C7055AEDA9E1B95251270599867683E2 [email protected]
143,584,708 *0DC8E39C0367444F4CC8E1BA05CE01A04523F256 [email protected]
143,584,709 *0DC47DF98C4EDB83A44FBDD06B1FE1629A7DE72D TROYBOEKE
143,584,710 *0DC94164515E5409DEFED12ECBB288174B49AB60 troy.couturier
143,584,711 *0DC5C0BD2A6E06578E1EA8E14EF9DD65391E4DEB [email protected]
143,584,712 *0DC7530D3D19E4E020BC454A8715382FDBCEF79A wepfer-stan
143,584,713 *0DC532494A4B1A7F846CE692DC2106D2041B13D8 TS-15160
143,584,714 *0DC9CD3643008859818AEB48FCA26E2C51BFD0E8 WESLEY.LAPIN
143,584,715 *0DCD2C264DD02D340CC911B508062657D505CDE9 westonbranning
143,584,716 *0DC5C51C588515CF2284E5744C839C806EF80C8F [email protected]
143,584,717 *0DCF92FCBB814CBFBBFD16511EE721FED067B9CD tuodetrevoriol
143,584,718 *0DC171003DFF06EB265813C59A7892437F8DD6AF TUONGTRI00
143,584,719 *0DC3CC174DD83A69E1640E1E0C3B6480F6EB33F4 WIDAYAKADERMOREDJO
143,584,720 *0DCC7586CB8DB04A53EE780C8A50502903BCF761 tutea
143,584,721 *0DCD08D4943CBB33E6B71B2C878FB98995D705FB twitchellunreliable
143,584,722 *0DC2C1D3F9BE97AB24D8D624A4DE1488A8A8269A TY-DAYTON
143,584,723 *0DC5333F5A4D27BFDE50D5117DAAE06E104E860F wilbercourchine
143,584,724 *0DCCC1855C893F03D4677D22FD806CE851D55AA3 tykistll2
143,584,725 *0DCC11B159D83EAEB105AEED247DE0BB6917895A tykmavede7
143,584,726 *0DC1F9C28FC247DEE546B2BE0A22A360E76C7D7F WILBURN.FEIGH
143,584,727 *0DC00A614BA3D1F10FEDB595F22661EFECA471FE tyreekinnier
143,584,728 *0DC5A855157CDC1B45E7BAE4B55F1F5C6AB7A829 wilfredmcclimens
143,584,729 *0DC6FC5E7DBFF706BFA37387B44811E31E580580 TYRELL.BONEBRAKE
143,584,730 *0DCCCFF7DC1B85C6AF162C96DE69EA4513D995B2 WILMA-LINDOSO
143,584,731 *0DCFC0EF0AA8689A9AAE18CAE99DA8A44EBF3716 wilmerhelander
143,584,732 *0DCF90B8ADE60CCF122986ECD028C6567CC911E5 uaerrab5
143,584,733 *0DCE70FDCD53CA2DE7D23F7B14C4EF64B1675753 UBA.CHINWE
143,584,734 *0DCC677D01D3D17F9C2CC1BECA08D4315DE7D7CC U DHA
143,584,735 *0DC04CA905CB75CD2FB707A8B62ED0964E96F7E4 winstonzschoche
143,584,736 *0DC381FFB60A9BEC7AD6B35A2631BC8022D88314 wischnewski
143,584,737 *0DCB0F2D1E787384E25B91B08B7EC188FD6A087F UKOYKIESING
143,584,738 *0DCB57332EE8ECF7BCF6C88E5EA8F812C7A7C59D umiriza-abd-kadir
143,584,739 *0DCDA781E469BD9136DFE7B4739538214774A283 WITH-THE-PLEBEIANS-SWARMING-AT-THEIR-HEELS,
143,584,740 *0DC2BA5C4AA73017283E0F9B20D649500853DCD6 WM.HARKRADER
143,584,741 *0DC071F6F0F61A4FEFF3D54CF1926878BC5347F0 WOODROW.HUYSER
143,584,742 *0DC4853016FDD57B7E39BF123D4F659FD31F629F unannunciable5
143,584,743 *0DCE31F660B3E52621DCC3F827D0FB2D898A96B5 UNARANDJIC
143,584,744 *0DCC345D7C2FF8ADC2307C9762D53503B86B7A8A undp.watch.meister
143,584,745 *0DCDFF36D2E684401E09F2381E1862DACA8BA396 UNTADLIG6
143,584,746 *0DCF0FBCB5EC29FC8164388308D285C9C283C9A8 WVENTRES
143,584,747 *0DCF886B0703F076BEE3FE0EB7998957011C701D UP.FOR.PING.PONG
143,584,748 *0DCC33DF25D1F58DCF2F8D90DC6F57A4AC2A7E16 UPRILIENI
143,584,749 *0DC6FA55E98D1ACB678A9F3794A74B003C95C224 wwwherbalremedyorg
143,584,750 *0DC76E78E999DD23CB622559EB977E64FD481BB3 user89240229172
143,584,751 *0DC4BD2D0D8ED91D018848D386788C4525A33170 wwwzeitde200319rf
143,584,752 *0DCE62CF4C9767E2169BDA10CCE7198E026AA6BF /usr/src/linuxheaders2.6.3224/include/linux/kthread.h
143,584,753 *0DCB2319C7428169E615B9DF9188AD4B576401EA )X( ~ ~D###P
143,584,754 *0DC3C74EADE29BFBF078FC48BCD09F7463188F23 xesefdisofgytufkatofmovifbaxux
143,584,755 *0DCB2C0C968F23644B299978DBAD2B14001FBAEF [email protected]
143,584,756 *0DCEF310060861FF4F567687472635AFDCC5BA20 [email protected]
143,584,757 *0DCC4FDE55934E8B30BEE7B4E311C72A13399B99 VADJUSTBSW1
143,584,758 *0DCEB8F850A0F40C9798F4E9FF48203BB4ED6C78 VADYM GULIY
143,584,759 *0DCDF12678D105A76789BF8DD5D99AC78DD4DEF7 VALAREE.ALLEN.SHIELDS
143,584,760 *0DCE3411CC735746866C45CF269705336D08B878 VÄLJARFÖRBUNDET
143,584,761 *0DC5F4D7F9A2A26F94BE77221E1B4C11FFD42C54 [email protected]
143,584,762 *0DC0F5672B28425DFBB1F1C3CDF9D1E7E6729F44 XT-V
143,584,763 *0DC1303BD27E1E440FB52FE9AB70871F942340CE [email protected]
143,584,764 *0DC1E382F50ACD32A002C46C9674EF15542250A2 [email protected]
143,584,765 *0DCE7434ECDE15441ABD1A067A69B467BD607598 Y0"T
143,584,766 *0DC4E6FA27880371FCC411AE2D8BEB4E5EB09CB3 VAUER
143,584,767 *0DCC4E8EF1A569D7FD3E6B47ABF775A7410E53A3 [email protected]
143,584,768 *0DCFF9BB2F7CE0BF433403199A0B6580CD25D282 YARELYALLEN
143,584,769 *0DCE43C798FA6B4FD700FE53F9EAD2064F377278 VENYE.SCARLETH
143,584,770 *0DC6925A4A2B243833F2E314ECAD6A0DC9A4A4D8 YCOUSCOUS3
143,584,771 *0DC06EB50E07A2F4999F4DE776DDFA9AD8E23E94 [email protected]
143,584,772 *0DCAE742743CB8D56D62BB30E7A4882E20949FD4 YFNBBKEYRXD3
143,584,773 *0DCDB09BC12F3CED00E97E214853F2C4A4FF0145 YINKONGE
143,584,774 *0DCD5615B7258171654B5BAB19A83A48CB6C87A9 [email protected]
143,584,775 *0DC2C89F1BAA79F0191AA41FB95F4DEE842C8502 YLOCUVG14
143,584,776 *0DC980D81B16949C820BC245E1E9DCDE7D38B194 YNEMNED3
143,584,777 *0DC08936C09B383E027001ABF95D6A33F80D0038 yongraemer
143,584,778 *0DCAFBD94B2DF6DB9CAF77038A57CF7603AAE6C9 your-knight-illbe
143,584,779 *0DC9264CFB3BB8F2E4D62FD81E8EA90A8CF128D6 vigtigeste.
143,584,780 *0DC44FB490D8DE406FF6CC1B2122A51FC6C8F992 vincentbartone
143,584,781 *0DCC9A7872930B9901F8FE06B8723581F1AAC7DB YTIUQINUS
143,584,782 *0DC5DE617CD651F414AA31DF7A56DC4168B8FA48 (Yukihiko.Fukutomi.remix)
143,584,783 *0DCCD15CAE9FC4FCC9ADB0AE569022D74485C2D5 YVONNE.STOLTENBERG.LEVNO
143,584,784 *0DCC4BCC549A10C9DCD20AA41C4C710426A9A624 YVONNE.T.MEYER
143,584,785 *0DCF6CAE6F99275583419908F8E1077E385B4BB7 Z101694
143,584,786 *0DC8B82AE23A5C192834F492146529C5133088F2 VIVAISTIED
143,584,787 *0DC98BE986B7AA52F74CF0C9B1B79F6A8C3B6676 zahanim-zainal-abidin
143,584,788 *0DCEE987D09F86515C33C4CEEEC7D376340CB2CA VORBESTRAFUNG/P
143,584,789 *0DC462B2194B7108CBF30B656BA37D5EE25E1EDF Vowel-$y$
143,584,790 *0DC4E9F87F923F6298E20F93BF330A9932FACD0A zegatrap6
143,584,791 *0DC42BD2C9B3477B1D4F81C09E92D2E704BAA4F7 VUJKOVOM
143,584,792 *0DC824F00B7DDEA1C0C539553BEAE7B797C916CF VUPPALAPATISOBHAN
143,584,793 *0DC45259B350449F2B43254D3C686B470BA52E6C [email protected]
143,584,794 *0DCF43BA23243F144D2D79FCBD473D27696DAA28 W4TERB0G
143,584,795 *0DC839EB858D63D9ED6DEB9ECB2D4921113F8AC7 WACKELBETRIEB8
143,584,796 *0DC8BC7291616298C70D2650760A5FF4873FE2B1 WADAAWA
143,584,797 *0DC59AA454BAC14057BB725181E352B5356B0748 [email protected]
143,584,798 *0DC016D016B15AEF8AAD92673B9443F691452039 wakana.nakabayashi
143,584,799 *0DCE44A70EA6DF9AFF319CFB0120682F3A7E3DAC WALKERJA
143,584,800 *0DC759B2EA908F744522D961B7C26FBA6D429D67 ZLATYCH0
143,584,801 *0DC4D4CED32A3612DA1826057096EECE21ABC22F walter.schley
143,584,802 *0DC51C0CB600AA2336BC3E78D389E6235063637C WALTONECHEMENDIA
143,584,803 *0DC7EA9996DCF1AF3B6C78A9E0D5CAD615A229C5 ZOMBIEPACERS
143,584,804 *0DC6D67BF8166BDE5D099CA22AFDD9F72702165A ZUURGMHNHGMFCV6
143,584,805 *0DC31A981A4EC98B5B87802ED628ECC3C3F521A8 ΠΕΤΡΕΛΑΙΟΝ
143,584,806 *0DC4AB69F17837742E225B678055EA48962F9475 πλάκες
143,584,807 *0DC3FF6242DBFD9009EA4C8B6319D3F9D182A428 АЛЛАРКОН
143,584,808 *0DC79CA2AAA0CB8DA55C4C1303414C9841A7322C WELBY.ESPIRITU
143,584,809 *0DCFB383A69ACC342C0E1230A500B1BBBFB3D1FF ВЕЙСЭНДИЗЕ
143,584,810 *0DC7AF051E924F65E92D02757016495D6EB57E89 ГЁТТИНГЕНРА
143,584,811 *0DC0B8534E1A9F4CE8A9DAE721F1E995FEB48A34 [email protected]
143,584,812 *0DCE089D5AD607773F680995CFF44D0AC8E60B55 [email protected]
143,584,813 *0DC62FC44D3721D829D6F222609F5F4D4F180ABE [email protected]
143,584,814 *0DC284A462BC1564E9F96EBA9F0347E1297B7F3D WERDNABOTNOARCHIVE
143,584,815 *0DC8F0505FE3E37611F03AA12C6C29E2ADA1B8B1 wesznasp
143,584,816 *0DCDDC6A93A76CDCB79EE6C2E3641595143B049A „КУПАЧИЦА“
143,584,817 *0DCC2BD276BD975BA253960C4AC03F2B9F1128E6 МАЛЕЧЫ
143,584,818 *0DC435D961BCE3474CAC4CA7F6EC49E35DE44E37 WHODOESTHATSERVERREALLYSERVE
143,584,819 *0DC2F8D8F353A40F9D87443DAA92245A5EDBC53F ПЕРЦИНЫ
143,584,820 *0DC9A86DFD97CFBCAA835A53466CADF487F0C5B1 WILBERYAM
143,584,821 *0DC0A7CBDCEC83C54676740C4F99A8422467F560 сервили
143,584,822 *0DC435CE070622A6BDFC1E519CED489F3C9CC780 wilfredyacullo
143,584,823 *0DC861BCDC682A71FFBF27696C4564CF95EAD4D6 WILLARDLUDVIK
143,584,824 *0DC3E254560F104E423905FDF5375A42620530F2 ТУДАГОУ —
143,584,825 *0DCC78A0018998CF16F3B36924DE37C9943EE5F8 ЦИФРОВОМУ
143,584,826 *0DC0613670C90CBAEED6AB8F1E7AB26619D56925 ЧЕРНИКАВИЯТ
143,584,827 *0DCF86A88F50B5B9748AD8D408F8FBAC8B7D0CF9 чехликть
143,584,828 *0DC9B19094B193239CEE865E45A3703B1083BDA6 willissaviola
143,584,829 *0DCEC868AD7F7152F05D412F79678A05C7616B1F [email protected]
143,584,830 *0DC6BC88C556932176B0E055E4651D32C50D051F 中山競馬場の改修工事により東京競馬場の芝3200Mで施行。
143,584,831 *0DCC0B89C186ADE4DCB5D3BB44063889C73D83AC windsurbornos
143,584,832 *0DC490D162F6FD700EBCACC90DD4D14797F1A6AF wi,p
143,584,833 *0DC5557FCD4BE6E2997DCAD713C084585E185BAB (原文為EWOKS
143,584,834 *0DC77D8A51F3826520294AFC1B56B69B1028F405 WOODROW.YONTS
143,584,835 *0DC4BC915615ACFF3F78113C6C3AFA739CE7652A woodyparent
143,584,836 *0DCA3E5D281C449166B9724222B60742E20946D9 WRITHED
143,584,837 *0DCDA3ED71BFD4A401DAACB2DAD7F1FCE913AAB1 WV?~
143,584,838 *0DC21259BE86AD4939C5E069C595648EC5573299 WWHDAVID
143,584,839 *0DC85634583C14CCD4C0876917D57F91BF6B5551 WWWILEDEPAQUESCO
143,584,840 *0DC08D2A1C324B173EBE9DBAEFC77CCD393AFFC0 [email protected]
143,584,841 *0DCC86E84F0173DE3FA6297267A7F39BB486F2B6 xbulsara
143,584,842 *0DC36E6CB327C16F62572E7C1608057FB8B3284B [email protected]
143,584,843 *0DC09BA297BD038110B8A58691BEBFAAA80F3275 xj+
143,584,844 *0DC8F534A3C0DFAC7D26376C14064121677EBD1B XSRZJCJB7
143,584,845 *0DC23B9BD6D074CC3190B15DD4CF10F88BD38419 X|SU
143,584,846 *0DCD682BBE920AFE0ADDDDD7347DFA883F13CFF0 YAMAYATES
143,584,847 *0DCB3D1E28F01E744330AF105D05CE8088C2ED18 YANALA.CHARLES
143,584,848 *0DC46278AEA292D033C740EC56F266162301B9D0 [email protected]
143,584,849 *0DC6963585B1263218AB4EC212FEC78B40F6CF52 YANNELLI4
143,584,850 *0DC78821E75D0AC4178BB07F1E6382C05EA38438 yasser-zendo
143,584,851 *0DCEA8CEE44D96C258A5122913D45620A060229A yekti-ningari
143,584,852 *0DC02D38FCDF4AF3FD488DE821EB0D347005B653 YIM-TZE
143,584,853 *0DC195D4878F780C0219AA366EFC8AEE29CEDB6C からの翻訳ですが、要約欄への記載も無く英語版記事のリンクもBOTが追加していますのでGFDL違反です。
143,584,854 *0DC4FD1878820F5A2A7C242728C3E8FB478094DC [email protected]
143,584,855 *0DC2CD0981A32E88BE893AF51E0DFA7DD6D5B4F7 YSMILE.AYLEON
143,584,856 *0DC677E3FF8A5CF2A954596DA32F85C04AFA1015 Z$4"
143,584,857 *0DCDDD0815FDA85D678D24E6598A25110654F88E zedan.elgohare
143,584,858 *0DCD61A6049F07179D461001167D938196654D51 ZEPEN!
143,584,859 *0DCE733A6332D20E575FE545425F0D0766E69ADB [email protected]
143,584,860 *0DC04606151A7EAC113DDAD0989D3C70B3AF8491 [email protected]
143,584,861 *0DC126B44BABCA4B4C314515B9D2B5933DFB990C ziena-okaily
143,584,862 *0DCC7CA2E05C1024BAC167752AD44A048011C827 ZIGGYBSW
143,584,863 *0DC4B809CC483B3E33AB2237A495DE42542C06CF ZIMBABWA4
143,584,864 *0DC3B019B30BCA627886AA300DD8F219917E411A ZIWISCAN1
143,584,865 *0DCD3E41920937E2F4D15FAEB014D4825DF11FDB ZMVA
143,584,866 *0DCCA99DA0FC49E9F1140CA5CF5EFD618BC56563 ZORROCANCER1
143,584,867 *0DC76717B29F401C15FDE0CE773BB125B330B944 zsavonne-heathcock
143,584,868 *0DC303F3838B632DE56BAC2BDA74220DA447A347 zvyq
143,584,869 *0DC2F65CBBCB080E59823A8AAF4AEF2BDF33D1CD [email protected]
143,584,870 *0DCA3F7B3DB5ED985865DBE5E165841CA3F6A1A9 ΑΥΘΩΡΕΙ
143,584,871 *0DC501CC1C3067FD32AEBC31F2A5DB26374E4C63 ΣΙΆΛΟΙΣΙΝ
143,584,872 *0DCEA5EFAB703B221545E50560381AE3F8113DC7 σφενδάμησ
143,584,873 *0DC36E5485846789084E0259A2F52EE865B88C66 АЕРОПАГИТЕ
143,584,874 *0DC406FA02CA5F211CAC8B64ECE3B61A1277D3AC АКТУЕЛНАТА
143,584,875 *0DCE5BD4BCB03230C920C413DD47C8A23367B06E АРМАЗА
143,584,876 *0DCF47DB89FB3CAAC1BE9DC4C6341144AEACE643 0ILOVEJOSH4
143,584,877 *0DC96CEEF3D63BB2898804FB30268A0711244650 0ILOVESHELBY3
143,584,878 *0DC8D597BD673B999526EE3ABC3DFF15F2537181 ГРАЧЁВСКОЕ
143,584,879 *0DC0C271A2F0A840C492EA9E431DE04D687BB4F3 даля́
143,584,880 *0DC1F2482DA2DD52A156063922D0D951FE3DA740 ЗАТОРНОМ
143,584,881 *0DC45010DB2E84A9FCE382F24BAEBCDCDDF561E4 КРЫСТИАН
143,584,882 *0DCF9D23BC4318A14E11B124CEAECC88AA56F6CE ЛАНГЕДОЦІ
143,584,883 *0DC9B418903C6C37C404BCCD27506DF4D1B8914D 12:12-#-&celebration
143,584,884 *0DC6DEC0C74348F31455A5DE34384EBCC98FAEC9 12261010
143,584,885 *0DC37E04573E4F1C21DA0E93C0C536957557B750 1281990
143,584,886 *0DC9061956A84E29C2CDAC05048676EB320B2C6F ПЕТРАКАВЕ
143,584,887 *0DC64B45D0CC0B48DEF335F39F3E3540A73A57ED 13.neonaziorganisationen
143,584,888 *0DCEF010E621D3234D2676D192DAC554C03394A0 1426889 VAIVALLAPUNNERRETUTTUTKIMUSTULOKSETJ
143,584,889 *0DC954519E54E889B2C213A09CB93B2D3B1E9851 ПОЧЕНКО
143,584,890 *0DC22EC51E8C786AC83617F344A52F0D15918833 РВЦ
143,584,891 *0DCA66F3B3D35FD3D4EDD4783205C13896867B20 РУКОВОДИТЕЛЬСТВО
143,584,892 *0DC0B2C0281D6CFD10295C97D431831D4CBC22AE СЕННЕТОВСКИХ
143,584,893 *0DC5882FE6889A2D05449ADC7E4E645EB05B460F 15-Minutes-Older
143,584,894 *0DCE49D1E0C79E527B816D1F489C79157273556B 1688120 MUKAVA-JA-EDULLINEN-KAHDEN-HENGEN-KEVYTVENE-.
143,584,895 *0DCC638669D563BE556854AAA54575F6F23B472D ТРАНЗАКЦИЯ
143,584,896 *0DC9428F39DED1742D7685931F876040F4F84232 1791095 KOSKA-SUOMALAISET-TEKIJ
143,584,897 *0DCC9E544116310B35B47E53D16AB9B135A02D62 、也常跟東京ska
143,584,898 *0DC205F7CB88107B77A12D155FD3AE4E65FB8A83 1atumble
143,584,899 *0DC9E956B98F72B89C926DB18EF3D957B5B26FE6 1.ER
143,584,900 *0DC4A9F5A4F78C68EB413B9728FF94129B137769 1ERFELIJKHEIDSLEER
143,584,901 *0DCF09512396663B6CBAB07426E8644AC1E63E29 1EUDORUS
143,584,902 *0DC45006FCE36B57F546050D52AEE762C17B7D47 1EXPRESSIONISTISCHCALIGARISCHE
143,584,903 *0DC0432CB4180429CF8EFBFB90854A79C8D5DD10 1FRONESIKSELLA
143,584,904 *0DCF892909D59011430F6BEBC3A0AEEFF6A70D99 1-GENUSSENTBEHRUNGEN
143,584,905 *0DC1726AFD40507CA38668A38164C8D57CB7C1E7 1 GLAUBENSVERLUSTES
143,584,906 *0DCE03096295A23E9EB85D66CFE69FAFBF2DD536 1HDBK
143,584,907 *0DC7E038FE005AED4A66DB705BF71A3951BAEC1C 1 KIMYAGAR
143,584,908 *0DC4F79725DCF1E6476F5534C9FFB35AC6DDB7A6 1MEIKLIE
143,584,909 *0DC8223535E9CA0414916D647C926F6B0B9DD1D0 外務省によるpko一覧
143,584,910 *0DCB9D871B7F0CE38D3554D6B92CDAAB0F85203B 1nocilla
143,584,911 *0DCB348E1DC055A68BC2FDC762B7DC38506E7C61 1-orazio
143,584,912 *0DC4C29A7A7FD141A0B3375D54F86726D8AE8D27 1.PERUSASTIASTOLLA
143,584,913 *0DC80B02A8F621EEB2442879E9EF4A596F23E563 1.PROPHESISED
143,584,914 *0DCE5969DC71D4F46A60EE49E7297A0F54C153A9 1 prounidad
143,584,915 *0DCC83CCC83139A5DF72CB456012CEF0D757B0A9 1PYRKIMISENI
143,584,916 *0DC12A176DC71D09659BA438A32379442DA7948B 1rantakoivuun
143,584,917 *0DC7D35A7018083016184F4A7AFA58151FDF0626 1SOUBRE
143,584,918 *0DC7BD0DAC5C68BDBB33A0271A3764A72D95DC05 1 SPECIESNOW
143,584,919 *0DC2F7D59702A241735A447E253B4D75F9C3CDB2 1.TEHT
143,584,920 *0DC83D3876F09ADE52315892CB60B5E7B1A6383A を用いるのが一般的である。SSA
143,584,921 *0DCF04D4693713143414DA3A47CA7AE849FFD62E 2004-04-22: commodore ballroom, vancouver, bc, canada (disc 1)
143,584,922 *0DC5D909C44EE1C8AD6D45794220ECB3D1778FAC にゲスト解説、橋本が新日本、WRESTLE
143,584,923 *0DC7D78531B1303655C6C74AF4ADE240A7C874D1 222jayce
143,584,924 *0DC367F2164FB450BB63753BA65D5699DD4212D9 2330142 TEKNISESTIMIXOXHAPETINONERIKOISPUMPPUJ
143,584,925 *0DCE74196EFE1066EA0BB28168E3E2728903807B (0-0)o~ o~ q####8
143,584,926 *0DC3C5995B68A1E21C71BB0B25A1EB7930083A38 2637105 policy statement p539 sets out terms
143,584,927 *0DC957F02F2E52104FA9B1A8AA88C228C3E48698 2721015 NICKJONESINTEKSTITOVATEDELLEENNOKKELUUKSILLAH
143,584,928 *0DC0B7EC78314EFA122D24FD8B72409537BB0D54 28dec1395
143,584,929 *0DC44B9475C775692838691E627AB0B4ACEBFE12 2BSTRANSN
143,584,930 *0DC84DA0CFF3EF98778511877A297ED5C0EBEC77 2CIHTYMYL
143,584,931 *0DC55792D0A642B3D18AD3A57245D1642C7229F3 2 EARBLASTING
143,584,932 *0DC725D37C69B3CACFC7E3AF82663AE75E0C2116 2-ferien-scheckheft
143,584,933 *0DC5A13EDEA7306439A6A9B148409B2CCEDA675A 2.FRIKKIE'S
143,584,934 *0DCE73E4743E824ABD95D2CBEF2CE894A96C7FC1 2IJSBREKE
143,584,935 *0DC896F61686EE13C6D74C43D515AA335F19FD04 2MYALOHA9
143,584,936 *0DCBE4134CF70AE96E9414E28B92B5CE56FE2B80 2-palokunnasta
143,584,937 *0DC01A434235FDC6A0F2D5B8E6EEE1F4B6BC9EE5 053CARINA
143,584,938 *0DC77DC46D17D4745912A7B4D949430E2AA8248C 07.19.1030
143,584,939 *0DCD142CA21F5D64616E92BEFCD857ABFD6FD825 2supermarketeihin
143,584,940 *0DC3B6B7E642608045E6743D143A0B5FA1E1E7A1 2-YAYIMLATIR
143,584,941 *0DC267E50421B575CF1990A8AD55C38EF1973C95 3------).*.(-_0)
143,584,942 *0DC380AFBE24753F16AE7D42A52430156C160575 3####)~0~OO><
143,584,943 *0DCD5FED7C688780C67C9DEDAFC3DC35F3BFF5FC 3AAASHELBY
143,584,944 *0DC98BCCA022D84FBD67F9BACCD7649889278BB1 3.ammattiauttajille
143,584,945 *0DC5A7A18B7753A3BE4EA7169A09D305A779B908 100.000.LIEBESBRIEFE
143,584,946 *0DC09BD059B922467FF5980FC7B1C377534B52D1 10.BARETTIA
143,584,947 *0DC9A9501A71B59FA979208AB36909E2660E18DB 10 LEIPOMOITA
143,584,948 *0DCDE5F61449BF86C3E9D6D75DAE3FD0C365AA0A 1132616 ENNEN ATERIAA TARJOTTU VAHVA COCKTAIL TAI V
143,584,949 *0DC07754601413BFB182EAC1870B2F0854E25BB5 3#B ~0~o(O_)
143,584,950 *0DC89F59011C0BD433D422A658E5DFB8A00F9025 3b<--*-*-*-q------b
143,584,951 *0DC463048668D85C3708448343123B7905813B47 3==D~O~O}O{
143,584,952 *0DC9D6E4AFB811EE723DF5E4A4BAF316BE093E66 3.koeniginstrasse
143,584,953 *0DC7E46651B3F28B56EC2FC3BB2B5DBE38DD26C1 3namyslowski
143,584,954 *0DC394FE07BB934E3641FD3BB63CC5C47C630635 3.nuorisomusikaali
143,584,955 *0DCFFD540EF252524A3E5DAA3376ADC75753B799 3OURANIA
143,584,956 *0DCA457ED2FF6F0C50F4BB48F16E58C86A668A25 3####p`~uu
143,584,957 *0DC3163B81F4BC53236146D40B061278367EC53C 3RBMEPUS
143,584,958 *0DCBE97B526038DD109A4D6FFB471D5243C47EEB 3 VAIHTOOIKEUDET
143,584,959 *0DC5449C76912EDC3B9BEB93B86CEEB503EA8FAD 12:.12..#..&...tab
143,584,960 *0DC5CF503608BCF44F700BCAAA7FDB02FFF7035D 122DAYAMI
143,584,961 *0DC58F4149C8983AA3424559878192C3CB59180A 12k98mc
143,584,962 *0DC7262081036E89A8C1FB54559ABCE16498591B 12REMORSE
143,584,963 *0DC6D0A0B0F21F35ABE58B4703AC88B9F77F7F75 4HALDYNE
143,584,964 *0DCEB8E2E86432C9FD695D1A039D59666F521A40 4isprs
143,584,965 *0DC056EF81357239A422539DFC3190B8FD5C9F1B 14fastens
143,584,966 *0DC4578BF88BF88F5183CF37561D8A7AA23D0D1A 165RAMON
143,584,967 *0DC7AE8298C90EDDE40B87EB89336CB4E58A49A2 4OMEREDRE
143,584,968 *0DC2A3B33F579404EEAC053F54343C3749858D94 4RANNIKKOALUE
143,584,969 *0DC4D930659691D51E6C78F4298562BE47EF9B8F 4RONDHEIM
143,584,970 *0DC5754E0177B16E91BB84A513CC21F3EECACC86 4SKIINGGERMAN
143,584,971 *0DC7ADFAA37100BCCFCF1166A2AE2CD5BB539D39 16OCTOBER1339
143,584,972 *0DC11303BE3232E60B3004149EFDE6C5180B525A 17.09.1779
143,584,973 *0DC71A587C4E709E6DF8F43A0AB39E653DDB8F5D 1774810 LATTIATJASEIN
143,584,974 *0DCF40AE834877C58F7DEE7A116F5823E5D7101E 4TYPETYPALTYPICTYPICALUNIQUEUSUAL
143,584,975 *0DC128D74B038E942084990B93DD2C2123DA3D5D 18013d1
143,584,976 *0DC41BAF6665133CC71D0A861E18A5F16132C59B 18097362vane
143,584,977 *0DC4E088AF33924E920E61DA39058B40FCDD22BF 4UNWANDELBAREN
143,584,978 *0DCCF78B2F0783824948928E1D4CF36C0C52A131 186519 OPETUKSENL
143,584,979 *0DC3A969BB57A8248A6A5BAE14B3768BF0AAA430 51226 ortozreh
143,584,980 *0DCDD3CA2B8304A6577DB506D4E52EE925BC057F 1934.-1946
143,584,981 *0DCBB8871CDFE617E61452B0EF3F723520D048E7 19march1962
143,584,982 *0DC8612A29DFB05B9495A1450CA5ECD0645A2E4C 582946 WIRHABENUNSABERMOSKAUAUSGEWAEHLT.
143,584,983 *0DC0BC4AF56DB2707A9BDE73FF28040493FB924E 1abzubilden
143,584,984 *0DC06DE723AFEAAFEFD43364854B1412F7E17CEF 5BRUNSTTIDER
143,584,985 *0DC9140E4E0C5D6DAAE22396F075CB609806A9D3 1-DEPOLARLAR
143,584,986 *0DC91510D9DB620D323BBB622856A28A3E20AF0F 5MARINASHERRY
143,584,987 *0DCA0F04F46F583616D985EDF0DED6E2AA478E1B 5MYSUSAN12
143,584,988 *0DC871A12E32CC0BF61D57D02C9C462AE4E02C41 5NATAKANJE
143,584,989 *0DCC2BE3811019914AD0322822CE20F51F1C1578 5NGSRECHT
143,584,990 *0DC1D1B56A19F7F190ABD1F161A113658EA442E9 5OTAKSUU
143,584,991 *0DC4F481A6A5291EABAFE9E8E56BF13297EEE050 5QUIVINIA
143,584,992 *0DCD7B5B106857B3386760C9EF5B00E6E553BD42 1.ER
143,584,993 *0DC4A9F5A4F78C68EB413B9728FF94129B137769 1ESOTERIK-BUCHHAENDLER
143,584,994 *0DC8CCD557967B4B0E1B8E892203363B37DC22DE 5SEEDLINGMILDEW
143,584,995 *0DC1DC59D544712DC31D705986F277A07219CE62 1.gebuehrenguenstigster
143,584,996 *0DC784E6016DED21FB9BC403A3DEF35E2E1272C6 1 herzlungenmassage
143,584,997 *0DC8C8980AB79C22C8300F2EA750C56E6AF624BE 1 HUASTECA
143,584,998 *0DC10144D905275CDF0A2CCD573D0CF175AB4820 5THATWINONA9
143,584,999 *0DC7B50EE2DFC4CC22C5EB7EDAF32F6F80BDFD69 1IALAMTER
143,585,000 *0DC9E348D14DE01AA9509F00645AE4BF9BB70AAE 1-I-KUVAKE
143,585,001 *0DCEF80ED685994ECE8B4BDE9319C737D13016C6 1.incredibility-the
143,585,002 *0DCDC9739BE627CB0EBC9509DAA3A8B5F0630994 1IRUGNAHC
143,585,003 *0DCB534FDA0972AC6073863D2FFC480BC693E89C 61012 deshalb.war.ich.urspruenglich.hsv-fan..
143,585,004 *0DCC91C2762235C2DDCC885A9E28CCED55495E06 1 LEMUSIVAT
143,585,005 *0DCECA5BAD7B464EDCA9233475FA471A32D3C810 1medienuebelkeit
143,585,006 *0DC39B392B48ED299EDE13B9707264085FA70A09 692587 praedicow-wurde-65-und-rentner-.
143,585,007 *0DCCFFA46EA10746DD1329A4352270F09BCDD121 1.ohjelmatunnit
143,585,008 *0DC820DBA6BA6966D128DB1902904B8FBDA56121 1-PALOMAR
143,585,009 *0DC79EAD22AF6EF2C2298C41F1B1E523A6FCB7E0 1 RELAISWERK
143,585,010 *0DCD4F025ABB20E0A06B1CDF1D378ED2D5D0D188 1RIPHRASE
143,585,011 *0DC6ABE852A09ECDD061F7D42F13CA03E56125AF 1RUBEL-WAEHRUNG
143,585,012 *0DC6D5AB457FCFCABAB85A91963BC21D962C0AC6 6EXCEPTTHEATRE
143,585,013 *0DCC8DA41D9D2FF3EACD64CEDE5DCF5C34158EBF 6EXTRAFOCALS
143,585,014 *0DC84E2CD314D8494DE9B07710AB3296E6562407 1 SCHLAUNZEICHNUNGEN
143,585,015 *0DCA49A6F3B6E9737C4CD3DFC37CE353580466EE 1SEEGWAH
143,585,016 *0DC9F89618074F2739DA320785B47567CEA07FA3 6HORSESLAW
143,585,017 *0DCA444F5EF918D6BDD37775D89279689F6678CD 1.srithai
143,585,018 *0DCE1FDFC52183DDEE93BF10BA4642908C0A6992 1.streetwear-traeger
143,585,019 *0DCC2A4CFE507B7283407767563DCD4486E302DC 1 SUOJELUMAIDEN
143,585,020 *0DC9D6068B3F359778E7433D0ECD6DBD318F2B02 1.TEHT
143,585,021 *0DC83D3876F09ADE52315892CB60B5E7B1A6383A 6LEAUENERS
143,585,022 *0DCDA8E8736EE7A2A3CFF4C1978FC28309ADDD76 1vornekurzhintenlangfrisur
143,585,023 *0DC02C4311FD13DF041013F76A7809482FA29304 6MAURICEMISTY
143,585,024 *0DC0C995FAC35AAF4CF142362BA98D839A4892BB 1YAYGINLASTIRILACAKTI
143,585,025 *0DCEF954FFF38A1D7F49B5EBDFD4B18203FB7774 6OSCARZE
143,585,026 *0DCB93EA1227340738699F737C7418C09B96E1A4 6PRSNZTN
143,585,027 *0DC475F4C7626824472E8C2E43B8496B6E6BDD98 [email protected]
143,585,028 *0DCC854A01B3B6D9508C761CC6DC8037E3116ACC 701eg
143,585,029 *0DC25C2A76F342965BC41AE26BE47CA499BA04DB 7BSWTENGABSW
143,585,030 *0DC0023CC02EE09E0AE82D6D90752BA54D969B4F 7FRUEHLINGSSYMPHONIE
143,585,031 *0DC544457899749FDE20CCC67B3C133190DC036A 2667794 einen.seriensieger.gebe.es.derzeit.nicht..
143,585,032 *0DC2BFBEDBDACFAFA25C1A6105422C9C90FCC019 27ARUMERU
143,585,033 *0DCF00EA5B29B200A09511DDE0E84D4EA641CC9F 2861584 V
143,585,034 *0DC03E378FE4159FB86B536BC98E595B6450FAE4 28JULY1147
143,585,035 *0DCFCC8E98F8B82E6C5BCEC2E02540451878872E 2ADISAGAN
143,585,036 *0DC814D24035E9937E3E21EFCAB0F25E1C666C37 2alkebir
143,585,037 *0DC2B5AD18C619800D2CABA337EFFFAF1B08CA47 2BARRENEST
143,585,038 *0DC8F809366F45180A11C632402BC92D71724FA7 2BHYALINE
143,585,039 *0DC3EDD091D4597CC533FABBE95FEBB9BE2CFAAF 7.TEPSTEIN
143,585,040 *0DC4F96BABEA1F01CA9F441198B5B8A6D3CB232E 7-TURLARIMIZDA
143,585,041 *0DC09F80F1E6B03E5E9AB6281532BFD681242C52 2gruetzmacher
143,585,042 *0DC19325035305A70B8D633EF997B2A76772F503 7YTIMROFF
143,585,043 *0DC0B079E598B3660068DC2D4805E3FD82BB31C0 8----->*.*.*(>_<)
143,585,044 *0DC76CEF53262C5D7881A3325DEFE627B6E5F80F 2KANOYME
143,585,045 *0DC507F0FA6F4F4EFC38D54F72562ACD464A432B 2lankeemuksessa
143,585,046 *0DC4AC6643BEC141B482EFA539BEC61B68399ABF 2.MAASTOTY
143,585,047 *0DCEF084281530D3AD587CCD591BE6AB1FF2E8B2 2.mekanizmalar
143,585,048 *0DCAA68EF3B51F46EC3D29E1851C15692A0F9BA0 2MYBERNARD9
143,585,049 *0DC8A339C121532AD07AB37C972CA54846035A51 2.nckoneisiin
143,585,050 *0DC818D0626DE294C1ACF72D05AEECB7619673AF }8{*.*.*(#####8
143,585,051 *0DC4132E5FDB185388D503F4B81F1A40149B6F39 2 PRESSESTAPEL
143,585,052 *0DC3F019F6AF74EC63F7AA51D316CEF1792DB82E 2 S-ANDREAS
143,585,053 *0DC7FA6DB1A905B705475CCB8F2163E06EECC23A 8DREAMTIM
143,585,054 *0DC1538F65EAE00121614C70857964BC98AC9786 8iamcharger0
143,585,055 *0DCA5525198C90E8D5D781C75D2E522E5BC39241 8ILLENKFA
143,585,056 *0DC4AACF6CF73FA23ACB7A451D9B105C6014DBCA 8INSCRIPTIO
143,585,057 *0DCBBA85B790147FC6656C2155040E6E72051C02 8LUGNUTS
143,585,058 *0DC849CF2A9F5564C5553F1F7002BC9E78A3CB87 8=p`~ o->-<
143,585,059 *0DC7C6D644CE8FE5CCF005AFA8442B2B8B6664C9 2WD4VALVE
143,585,060 *0DC1622B9DFE4A7865385A2981EEED96269BDA16 2WINGATES
143,585,061 *0DCB11798EDE11504D9FF4AB989F1537C16B1C11 8READERRUNNING
143,585,062 *0DCCE6D1463441691FE95EAF27575B3626B89280 8ROZWIAZALA
143,585,063 *0DC4B0ED8A22FA37512708B66F91F2828105DD7D 32-TIILI
143,585,064 *0DCC968BD222586EBAF40382DD44D6299F37C70E 8STHCENKKAP
143,585,065 *0DCB727674C6414D6CC60A6682700697B9A96513 36F8EA67.0
143,585,066 *0DCCA7A9A043457328D1DFE86E5021FEE44E922E 8THEAYELET
143,585,067 *0DC805AACC1C9C3A1F31DCAADC99DE006C2D6F3D 8WELLENTALER
143,585,068 *0DC443A3D7847921FB73D72E06C4A753F712D60F 932leonard
143,585,069 *0DC13A09685F63A9928F60D7AA4339D9A1B3EA14 938700P1
143,585,070 *0DCEE2B29A38BD16BF538C7AEAFB35B70D40B56D 941993 olen ollut h
143,585,071 *0DC1300D8AE6B269AFDBF3D2444E99BA396A9E33 987VIVIAN
143,585,072 *0DC1FB2E20F437EF02D10223DE432E0B176D30DE 9AFGESTROOPTE
143,585,073 *0DC74BB2CBC7016FE5B2D54463851A5D38E16EF5 9BSWURPIBSW
143,585,074 *0DCDF9C93A9868BA20533FC593990C4D34AE0ADF 9ENTSPANNUNGSBEMUHUNGEN
143,585,075 *0DC4AAA136B9BC26B8557CB2505848F20BCE4560 9FRAUENSTIMMEN
143,585,076 *0DCC18225451B3443673E1A9356187365250F80D 3----d~ouu
143,585,077 *0DC84A1A1AD241A13D4041BFB7092C966F7C0B1F 3GASONTPL
143,585,078 *0DC328D9481A347FDAB59AD11D17DF78FC307029 3IGENNU"TZIG
143,585,079 *0DC20BC7D4B2FD8960116748BBB9213345A7609D 9NECHTNCH
143,585,080 *0DC3265190C58648CB4677155CCAF46337BFC620 $3MI$KI113D
143,585,081 *0DC59C4FBDF239AD55269982AF675F26F6BA050A [email protected]
143,585,082 *0DCDF42AE2DC507CF2BB1D40711D75B87A5DED65 3PUNCTE
143,585,083 *0DC312022C71E22A53DC598124225D78C59BDCA4 9YANKEESSTEPHANI
143,585,084 *0DC3B187E2A7190B76814974E2C1754048D1957B 3SVIGERFA
143,585,085 *0DC677A5DF1B90D12A36D550DD4A03E1A44F7E6C 411210 neyapmalIyIm?hemenpanikolmayin
143,585,086 *0DCE4712D348D7ADAEEA5EDE8677D63E4F31C0F5 a11ega+i0n$
143,585,087 *0DC28243A5040A2EE7B2E4CF0157D5DE17BC2816 459540 OSUUSKAUPPA.EI.ALUKSI.HALUNNUT.OTTAA.RISKEJ
143,585,088 *0DCED9AA03A0FDFF2984AAC24BFEC0D85B5F67A1 a1$st
143,585,089 *0DC7ABD8197B5325C5CDAB6B65B5315C7202D97D 4ADIDDLER
143,585,090 *0DCEECA8B51B9B1A0680C21AD5758628D8625729 a3bnp
143,585,091 *0DCAE642FA8794B66FFD46A5E5105D90A1800E72 4CONTROLEI
143,585,092 *0DCB80C5029318814A3CF46883380F63015CDDC2 4GEOMETRIA
143,585,093 *0DC52F98304E6935AD6AFA4522744AF47A44827F a4od
143,585,094 *0DCFDF5DAE9DBBE72F7A7C097E8C1DAE941CD22A 4IRONMANGYMNAST
143,585,095 *0DC424D8B862575C526564AB49D4E549466F28A0 4JEANMOOMOO
143,585,096 *0DC9137CF87CE1543689933B1AC05012844EC970 a.5mt
143,585,097 *0DC1A596A764907114D4F31B7D1A79E92B205841 a6lb9
143,585,098 *0DCB428D002AD62F7C4EE7B449A5632D8D165A0F 4KANTONALIZACIJA
143,585,099 *0DCC0355326882C81605D537FF8C1530DB612866 AAA{C
143,585,100 *0DC7A1AC1CCAF58C7560336D628ED52BC8410014 4PRINCIPLEVITALSWITHINWITHINDOORS
143,585,101 *0DC528068D13AAE2F36065E7D855FEFDD4D95637 4REKKYRTDU
143,585,102 *0DCF94D677BB32E7EBBD217349C52FA1BBA3AF90 [email protected]_v
143,585,103 *0DC1693A751B035D74D91447389B68B2EA7B9DA6 aab$i[
143,585,104 *0DC73161256153852DEB80A0E2322092FF32F93A aab<ms
143,585,105 *0DC827EF9D8FA184528112C87B990AD45AB8257F AABN9Z
143,585,106 *0DC0A4F3BFFC47E3CBF7CE2D073DDCBB9AE8C40A 4-thubten
143,585,107 *0DC53A4357E330056D4B051C56D455F1718C864C AACSWH
143,585,108 *0DC2B3B095339C6D0B113713DEC11ABB452D41F2 aaer,f
143,585,109 *0DCBA805CF411DCBAC11D1835C52B3C11C49D8CB AAEY"S
143,585,110 *0DCDEA5043B268963ADD05EE6A68DDC4D18C372E AAMUK
143,585,111 *0DC82448DF3F0CD020307A4A6B482F56B9D5F436 AAN$T
143,585,112 *0DCB0785470D797D7738870CBC3E03CA118CDDDE 504bryson
143,585,113 *0DC10B22BC7F19B0BE0B6A2CAB5AF1FAD758591C aaronmhall
143,585,114 *0DC85D05A9BB4BA6CD35C6AAFCB24F3F7B6B8D2F AATNIKRA1
143,585,115 *0DC32A895F222F5180B0BAD66863BC9A898772F2 593914 kimseden olumsuz bir tepki almadik
143,585,116 *0DC0DCF410D410FDA2E115E67DE2CFCB51C22A4A abbyrael
143,585,117 *0DCDF6C0C7EAEEDCF4C4838976D7F517C1504564 a+bd.
143,585,118 *0DC1B615541CA14C8BCF8B327FF793EC6A06370D 5CEKANIM
143,585,119 *0DC23B314B24558BCF6CD5E2CEBBCD940069C582 5CROCHED
143,585,120 *0DC8B9D5FD615EF7700D04B993346783117B9FD4 ABILIREI5
143,585,121 *0DCCC0A21EBFFCC669E9FFFC42F362A4682F7234 5FRANKLINSINGER
143,585,122 *0DC53597E4EC9F950582FB44F0704890EDE6509C abortuseses9
143,585,123 *0DC6D340F4174D656F6ECC7C610DCAF7537969F4 ABQ?P
143,585,124 *0DC74AEB10D8EDE2E7C158D533A097A0E3E8EBA8 ABRAM.TAUCHER
143,585,125 *0DC47362D7E876E71AAE7901178E60A73E56AFDE 5IUBGSZA5
143,585,126 *0DC88ADC09EC124CBA14C57F9957F12B199A02CD a.bs
143,585,127 *0DC69A90BF30817F01C3B5DF5A0BFA62862E6E55 abwll
143,585,128 *0DCFA09ADAAFDBB8B1CC83B17D9A94BB23E4C148 a:c9
143,585,129 *0DCF61A7678C1D138E3A41877A9B302347D402C6 5NEODUESP
143,585,130 *0DCF4BD1682C521AB52A278943228DC9CAB985FD 5NINNHCO
143,585,131 *0DC0D296CAAAF050DAE70C24E2187F0F86F13758 ACCOPPIAVO2
143,585,132 *0DC00B368116D7D1FBADCBF48961133A87218127 acequia-3-0
143,585,133 *0DC9F9757DBA1E6A59B0DF2A10509EB114C05D82 5PORTLANDTHURSDAY
143,585,134 *0DCAF946D4E8DB30A6FC779D9F380130B3E304F4 aclea
143,585,135 *0DCAAF02878D5DC359B17BF9358F2C283CBDE498 acrossvastdistances
143,585,136 *0DC859668288192FD33DC7793B8EEF3B2E0CDD9B acuu0
143,585,137 *0DC407C094094B4F5A40D8854EAD28B27D59B639 ad8)
143,585,138 *0DCD95DCA503AAC62044CCEFF6124F72B614512D adanbaransky
143,585,139 *0DCA4CF644E7FF0547206746E34F4528CAC35C67 5 TOIMINTAKESKUKSELLE
143,585,140 *0DC1F3B1874B6DA084D57E9588131125B052D4F9 addoccio0
143,585,141 *0DCD71A362989ECFAF75529EB35833900894CC74 A)DFP
143,585,142 *0DCE19338A1558C91ABC0FBF999333FB791FD0BC [email protected],
143,585,143 *0DCAB1375C7319C2A6D42E894817D5B4160F82D1 adnez
143,585,144 *0DC8FE8FC5FC2B7CED7C7A3C4107CFEB0CB4E439 ADNIZAN
143,585,145 *0DC8D78E3818C77BF20E587C707BD56A1A7E7817 aduv
143,585,146 *0DC69773B6140E893043DAB801499A36C35E9CCB 6BETONIERTER
143,585,147 *0DC75D8B1FDDCF259EDDB2D9D8650A221E670322 ae73l
143,585,148 *0DC24426C549015801FE0618275419700C966ACD 6BSWSEGMENTA
143,585,149 *0DCB9BC77430FA31B515C43A581BA7A9910623E2 AE-VP
143,585,150 *0DC378C3B9711F58D8B998B3F2E662A858402111 Af,&
143,585,151 *0DC1E00FBB8E5F07EA81A5022854FAB0D075FA2D afgetoverd?
143,585,152 *0DCED7B29FA2C741C71BED2013B6EC8CC1B48CA5 AFLX9
143,585,153 *0DCD4372E7777550E91B7D931C31C9408D887406 a/%g
143,585,154 *0DC3D0E4046BD77206DD2D14E21B164819E00A12 6JAMAICASTORM
143,585,155 *0DC7793F54C3548F455648BCB8B7611B5348DA6E agb,o
143,585,156 *0DCF4ABA9B35B17F0A3E09423407C7635313B3B8 AGCGM
143,585,157 *0DC4E4ADAE1E927188F715BAFCAA3643ED456AE7 AGF!(
143,585,158 *0DCD8ADA3E0449A15B829A2F3A64DE0B8FD94E5D aggloys
143,585,159 *0DCCF4319528AD7DF52C1E7D90D7E3B7A87EAD9A AGUSTINCANTAVE
143,585,160 *0DC83BC2C8013D7FB6234F2C4023935B75A08F5A 6KOKASSERNES
143,585,161 *0DC64C10A26B0A3952AC14DD3B38CF23BCD02AC0 AHC$6
143,585,162 *0DCA83493D2310222F1EFEDFAFDD89A7F7B33B52 AHKEROINING
143,585,163 *0DC8F478CD76CC9917CF473F9EF63DAE910D60FC ailcs
143,585,164 *0DCE0A6E17F0CA516ADC83ED3CC89C3C15A961FF airmobile/@/r'm/oU/b/aI/l
143,585,165 *0DCD153C9D2168861722D2BB91B148A8D0890A55 aiv1d
143,585,166 *0DC3B94B59C7A14C0268A112048D15FF8BB6E9EE ako/u
143,585,167 *0DC566C8F01B14A895ED018A82D1B1EBD567F2C4 6PALADINHOLA
143,585,168 *0DCFFC4764CFADF97879C21362F1B8CF387C9F76 6SCLAUNDROUSE
143,585,169 *0DC62254A1ECA5FA6C4F98BEAF5493F0AC432D1A allenshackford
143,585,170 *0DC32C1E4FAA172EB9808B6649DB96AFB91996F7 alliebishop
143,585,171 *0DC754D4243B61F2EADBDF76289E2315895BA18C 6URUMNIHC
143,585,172 *0DC9A065F7E0E9DEE71C309BDDDB6BCF08051A53 allylic0
143,585,173 *0DCE6ED4483E3AC54C6596866463ABE1639E0819 6WHATEVEFOREST
143,585,174 *0DCDCDFF9EB7116ED6EEB6AA55E850AD3406CFC8 713928 BAHARDA,KUMVETOZFIRTINALARINDANGOZGOZUGORMEZ.
143,585,175 *0DC4D9ADE48F6DA457AAF374554B3A0DA1DBFD92 7331 INCLUDES
143,585,176 *0DC71B341B29139A6A01BD71658C13EFF9FF8980 764069 DOGRUMAKARNAPISIRMEMIKTARININASILTESPITEDEBILIRIM?
143,585,177 *0DCB9E481AB7D0BE4F447F6EE9DC0E0A153BF51F 77970C743A9CCD25CA2571C6001E19FA
143,585,178 *0DC693B84C9C686E522D81A0594B56E95F97BEEA am3m
143,585,179 *0DC0A7D824075603D2EFB2840B7ED27C96AF5F42 amanda-maybee
143,585,180 *0DC93DC089C1ABE20CB72B4538AAB8DB8D46BA20 amne5+yn9
143,585,181 *0DC398930E24DD3C78E774EF90428046BACD2F71 7CAHCHARE
143,585,182 *0DC8E815670229E4BC5C94D0F8382D841A51F7B1 7CHIROGRAPHIES
143,585,183 *0DCE0875B950A56041F283751C11452DF6F4516E And-have-forsworn-you-with-Hortensio.
143,585,184 *0DC22A64D8A5B9EF1F886E3BF7E7F259D5170FC1 ANDREA LLEWELLYN
143,585,185 *0DC0A315C23BA84DFD7BDB810FEFD39B4801E462 7duftend
143,585,186 *0DCEA545499F25BB367C7E60D78FA32192061046 7GRYSBOKN
143,585,187 *0DC56EF429BC22DB6861E8D6AFAAAEF9AD2A06CE ANGEVIN5
143,585,188 *0DCC7C9C901B99892C03D595CCF8FFA1DF830ADD ANGIEJB
143,585,189 *0DCCC586C27BA9C8FCD1C2B73200B94CE6401F2B 7LAURAUM
143,585,190 *0DC3E358D81C40312976890ECF63070483C49D3F 7NIGADISHHYE
143,585,191 *0DCC524C7E8EDA183065E99BD8BF8DE90846E704 a%n!s
143,585,192 *0DCAA5C1C65BC6986709C8C4BE4F7FF3AAF87426 anselmo.piccoli
143,585,193 *0DCB59E028B8AC07CC35707267BE86EEC8DAF1ED ANTENNAPATCH
143,585,194 *0DC7248B7997F4A83F9E244FE744C4B417D05FF6 ANTHONYHIGHFIELD
143,585,195 *0DCC43523D646DA6383774714B71FFBE28C6FEFA ANTONEMAGLOTT
143,585,196 *0DC83DC235CA0FF0233A39384987C7F16D3BBB0F ANTWAN.PARTYKA
143,585,197 *0DCB309BB61DEFE16B0975F8F3AE8951CF86E019 ANZAIMIM4
143,585,198 *0DC98C8D8DBA0141CDB80C651B4B924862A5AB77 7VORENTSCHEIDENDE
143,585,199 *0DC04228F928D49D879E8E67DCBAD0E26CAAFF53 A(OB"
143,585,200 *0DC145DAD60511AE62C651EB552644805E4E1770 AOPU;
143,585,201 *0DC7AB472D3FB8FE2F8C77BEF5A6BEFBF23FB243 84BA1537-FD15-31BD-B397-3298A073E267
143,585,202 *0DCA57B6B10D5E291D48EB053A9B3988F4F57E9B a_ov
143,585,203 *0DC3EEC1C719FE0EE6E3F3DFA94802F94F8CEE5F 85028 still,theoutlookisuncertain.
143,585,204 *0DCEFB00A34E4F9AD70FEDA151DD0D62B4DD7FE0 APA9Z
143,585,205 *0DCB6E14D408FD97596F6CC1EA390C28C48FFCA3 apfa
143,585,206 *0DCAD3E2C82AFC396DA06816E061557CE5858C03 apparien5
143,585,207 *0DC53A55F1756DDB027ECDE3A435AD63DCAC6420 APRESENTO MEU AMIGO
143,585,208 *0DCF94462D5A798555A184CB16CEE74D4F4E5F11 a#=;r
143,585,209 *0DC07421A5D67F69548A5BC8AECD8FAAAC44782A 8BAUMELN
143,585,210 *0DCEAEC18972DDA1F8E6D774F460A1E0CB483E9D 8BEDRIBBL
143,585,211 *0DC10FFEC964496E7C2651BC01D10AEEBDEE25E7 8DAKOTABUFFALO
143,585,212 *0DC22A67B5340F0D4F5A6D15621D8DC4A0456781 8EROTICEROTIC
143,585,213 *0DCA08FA547E8D3CFCA040500DFAF91D9D8665A9 ARCHIVESCOM1
143,585,214 *0DCCEEF45396709EF52AFB84FE2CF476E35E88A9 ar%i%
143,585,215 *0DC42C6045C1257870B0CEF997D3FC574D334DBD 8KAATSBAA
143,585,216 *0DC68E9BB9E73F63002DDC611892F91D40753753 8KROKOVACIHO
143,585,217 *0DC19912BACA382BEEEFAF52312C949FE898AB65 arronrioz
143,585,218 *0DC1B9E60361356E44922CA1E018BA3A33D17082 8MUMBLIES
143,585,219 *0DC31B7FEEF8ED1472FBDD0A77ACCF34195C4212 8mymartin19
143,585,220 *0DC3E26DEAE6944925F78D3102819F0F714FAA9D ARYA29
143,585,221 *0DC4679E066E3C3BAE91F57125C5FBFB8D96B23B AS4GDZZWWTMI
143,585,222 *0DC8B6532D4C50C5053511FE42AEF39E0A929870 8=====p~~(O_)
143,585,223 *0DC630BB904BCD016A7CEA5BB5710014C568A198 8#####P{X}
143,585,224 *0DCA52E4878CE094C2B1ED3D3401E1C1A770153C 8rabbrivivi
143,585,225 *0DCE2B570614C0925F3A37A0D2520D898A603FEB 8REVOLUYING
143,585,226 *0DC2D6AE67CA6510DA844FCAE779B5E3A4298C2B assindustriabsw
143,585,227 *0DC8DAB59A930C3718CCFD172D3B06C0BEE65B7E ASTHMAI.E
143,585,228 *0DCB480B369E86EC17A1E9B47010F654FB24459C ASUSUAL2
143,585,229 *0DC71DF0C280B5F7D81870DB34D78C505E2F9111 8UDSALTNINGENS
143,585,230 *0DC995C7FB550BE6C24F27838F85A12B44A50DC6 AT(G!
143,585,231 *0DCCC4173C6207CFBA8E9EA08AC61B2529B37F75 92.BELMONT
143,585,232 *0DCEDAC19711866AD900F3859DB6F3FDE37B7896 at_t3
143,585,233 *0DC60BB1D3A1076C3FED90AC64B557DE73F3D552 au00k
143,585,234 *0DCB66C42A44835493CA3808D43C6A81E3E6173E 9AWAKNIS
143,585,235 *0DC822BFB681317027A3A95E150A1E386CD33713 AUBREY.JAFFY
143,585,236 *0DC58C019AC9DC5DCD141C5F79A96AC7FE0C9D9C 9BETYDELIGE
143,585,237 *0DCCE25EAAF93769080981CAE7E040B58C171AED 9BSWGUICHARD
143,585,238 *0DC43C58B55CB1A71B7BF196C7D48532C7DD8B83 9BSWIMAGEFXBSW
143,585,239 *0DC7F10CF287757B52010A8E83317F0C97373C25 9BUSLING
143,585,240 *0DC40A729A99BE03A11A7331F3D1E71079E69CA7 9DEGODSERNES
143,585,241 *0DCD593640B0A3F9E81B724EAE21E64F8A0BB3CC AUTHORABBE
143,585,242 *0DC66200A29F86CB7F7301BDEB0473BD5A5CB23B 9.LIITTYMISSOPIMUKSET
143,585,243 *0DC7FBD98274150191EB1ABC47BB4E85381615D8 AVDAC
143,585,244 *0DC4594FBF28B61C011D1B51CFF6A5FAD5AD1539 9MEXICOMONTREAL
143,585,245 *0DCE9AD416ABE30910D516D4A644155104F27007 a%w=#
143,585,246 *0DC44A7952B2058C10A2CB1AC6DEBEDF9D1A5CDF AXYAXEL
143,585,247 *0DC72B95E18AAF4DD55E9DFE17CFD4B07C880AEB b/06;
143,585,248 *0DC6F5FB5E1EDF2BCC67494763DCEDE114FDE330 B0b"
143,585,249 *0DCD91124B4BBD518CE7E663C00326C484C2FADB 9TLEPIKOJ
143,585,250 *0DC553F8475F3C993A7BD875F5BF8F1DEAC44C1E 9VERVANGINGSRESERVE
143,585,251 *0DC358D0C4A4811B3870E63E601FEA855BA6C13A 9WOWSERIAN
143,585,252 *0DC2BF87CE95AACD239D14038B1BF263F8349092 b1#,v
143,585,253 *0DC3A04CF2A2D21F99520EB07B7BFC806D1E32E3 a%?).
143,585,254 *0DCD986DB782E88723046A8BC389BF81492D9367 b20wd
143,585,255 *0DC70EEB7FEA5C64FFCC78E355B6849FB82DC21F A0N%=
143,585,256 *0DC196490AFAC23FEA4C31F9B72D059BB012B2AE B3%EZ
143,585,257 *0DCA794522F9D32CEA04B6C604AB9A72D430BBCA A?1/P
143,585,258 *0DC9935DC2EF71B2A8422848A0E4F7A552C033E6 b5edt
143,585,259 *0DC84AD95DAD7F0CF2DAB699111400FFCEE8A548 A3CTN
143,585,260 *0DCE9EC96A9C7D564E50FDDB3C2929CCCB419636 A3POC
143,585,261 *0DC860C251DC827C8B88689FEFD226F4D967D927 A3SVN
143,585,262 *0DC0E6A0BDF2E7A052CAA35903EE400263CD6390 B700
143,585,263 *0DC1F3522B14B16DA2FCD2D94CBB7FF86FE3CB19 a%5cl
143,585,264 *0DC8B62070F66A55BC448070C2AD43C104C7B9D8 b8lv
143,585,265 *0DC5276803220E688AAEBE77A9457124468934F0 B93AL
143,585,266 *0DCA195D482E76EEADECE7F1E58A8451E98ABED8 AA2SB
143,585,267 *0DCC0AAB0596A528F21D078FA66A911619891889 AAA3*
143,585,268 *0DCCBD619C284938E30307B1EDC9253F9923B1EB AAAU0<
143,585,269 *0DCFFA1E22F595CD2D8C7965BE5750F380B085C9 aab2-$
143,585,270 *0DC61A4878DF3F5A179897542318E37EB770BECF BALASUBRAMANIANSRIRAM
143,585,271 *0DC6BF35A5B13123DC117A721FB2DC3893330B92 BAMh
143,585,272 *0DCB65F7DA8FB38126EB5B57923AB7B397D4BF06 AABKYG
143,585,273 *0DC08E23E3957BF5FBB84E37EE5591F730A21C6E aab^s
143,585,274 *0DC6767216460DFDBB459733EA903AD3E1521030 AA>BY
143,585,275 *0DCF1724787C02EFFEF78C2BEAAF1BB63E8F3A39 aabz[t
143,585,276 *0DCBECE7AB57801618D432B8389B43D82B761067 AAC8UD
143,585,277 *0DC1122C61668586F9DC840746C820A8CB540EC1 aactc
143,585,278 *0DCDBED59681E9E8CA275E5CD72ADC769F540C13 barrio-de-la-rondilla
143,585,279 *0DC3C9C6FFD8DFA024C595BFD088BA18171996D3 basarar6
143,585,280 *0DC90E44351910C11BCD2DA573857436D6B1ECA1 BA"W+
143,585,281 *0DCDD875B00971ED280FA68AF6D3C9735E6E4553 bbca8
143,585,282 *0DC97FFF45866C84B0E3F5944EE0A52C84E1D8C3 BBG,U
143,585,283 *0DC49F2463B7C2E9CFEB43039410FD1405D3930B BBPSG
143,585,284 *0DC5397871299226F6B9EB01AAD169B4D4394B1D BB * * SPLAT
143,585,285 *0DC156CE985B211595E1AA096869169A6F040961 ABCDEFBIGMAC3
143,585,286 *0DC0F6D4BCB91105A161462101D15CBF59B53E92 b;d(6
143,585,287 *0DCB6B9326F11312CF3F0E5308D2D9F240581022 bdn&c
143,585,288 *0DCBC53F86D8DD810F7CD973B0AB38C6B4BE7013 ABINADI8
143,585,289 *0DCA2C0BA44A227858D82DDDE6F1F2F94D6BDAE9 BE61E
143,585,290 *0DC1AC5F64A715E9505C547EA5AAD85E18B6E06F beauty.of.time.is.that.it's.snowing.(psychedlic.b.b.)
143,585,291 *0DCB6853329E5112BD1ACB42874F43A6DC684541 BELESENEM8
143,585,292 *0DCC983708CEE638520F41CAB31568BC886DC47D ACCOMPLI
143,585,293 *0DC6BA8A034A4C283FF32334A3840197244244BB [email protected]
143,585,294 *0DCC94404EF92095741F65754B45D8892F88BB5E ACQTB
143,585,295 *0DCDFD0AD40A20B4B0C66EC2F604A3740378B2AF BERNIETOVMASYAN
143,585,296 *0DCCABF079E33A0D6C9539A5B8359C55CAC6B2B6 ac\xf
143,585,297 *0DC431F91E36C3B742DC70119B216D43326F76D2 be,rq
143,585,298 *0DC3388ACCC223535B6622B3D16F36AD6DF4C4FF BERTRAM.VILLANEDA
143,585,299 *0DCB37BB07FAE52E6B9D20D000E96882A334B9B6 AdaKaleh
143,585,300 *0DCDC8121BAE77814A4DEE3A46DAC62AFFF6EA5F BESCHIMPTE0
143,585,301 *0DC84CD2667938A823BBBEB10F1E4A434D30880C ADAM.PETTA
143,585,302 *0DC77B12A343DB0DC4CAFD093E3B299333958047 betav33a
143,585,303 *0DCD552078D6D737C4A916DB2063BE392A42D4D5 ADAN.CRUSER
143,585,304 *0DC9FC4BF8B188376AD7A9DB114706185DE79FD9 BETSYSの復元物語
143,585,305 *0DC05D70C625A1B20D8F91831A1C47234BF6A298 BF");
143,585,306 *0DC21732E1EE4AE5A37AFA8591E719D72B062980 A%DFY
143,585,307 *0DC5BE841999DFA389EF0E6CD261515840BE8F70 ADOLPHABSALON
143,585,308 *0DC751166C9C7ECC777842A8C7460A9DACEE6D94 BHIMA RAO
143,585,309 *0DCDB8A4EE55421867B8AF24AFFD5FA3781C6526 BHTWZ
143,585,310 *0DCBAE023147A3240C03463871FE4862D0D700D8 BHVQ;
143,585,311 *0DCD5DE94288BC4D57687C85000A823907725CC5 aestheticallypleasing
143,585,312 *0DCD4BBBB602AA71CB7A47FC7568C7D1930E12A8 [email protected]
143,585,313 *0DC84979D03975564F41F486DE9EA9DAAF92FF58 af(l+
143,585,314 *0DCA87471BF84B2AF4E02D4B7D16FB3E4D476787 bilws
143,585,315 *0DCC6DB3C0FBA6D5F99BB2A6EDFC2D82CD16E4A7 [email protected]
143,585,316 *0DC81C11377E1827C762B55F21C2E56884E6905B biv2t
143,585,317 *0DC6B3A2DED08C1FD6D93B10CF380D4DD0CAD8DA agr$=
143,585,318 *0DC9FEA38F7A6E1009E56CB667311C7AAFCD80AE a#ħ-
143,585,319 *0DC0B610F53586720B8B4174969871AE744AD985 AHMADNOSSAIR
143,585,320 *0DC51ED9D31280D2743EE5D087CB8BB117E13A63 AHMEDFORTINI
143,585,321 *0DCAF6482D7A3F0C33979601FA5E5849B0DECF88 BK_1L
143,585,322 *0DCBCC12E1229B0D5EE1E5F0F12002AA34BE6EB1 bk7qo
143,585,323 *0DC548EAD7FFFE79082B7AA8105394CDEB4E4F28 ah#u
143,585,324 *0DC52D7E782F6637BB0367FFBC656AC9C1FE681C AHURIRA1
143,585,325 *0DCA730283B7B0ECD6D3872517CCDAA14BFAAA75 [email protected]
143,585,326 *0DC177A3F129C13DA15689146AE7ADF741BFB535 aieun
143,585,327 *0DC7CC5DFF7C62169D08844B58671F0E4957DD3D BLAKE.TARTT
143,585,328 *0DCC1697514BE7419EF089033CFF078D8C60938D BLANTSOELV&GULLIMOERKET
143,585,329 *0DCCB7AA663F9D9BC8D8FD7215A3E87F8442340D blätterkrolle
143,585,330 *0DCB0110621300840863D63D9EA1B9B9E70BA111 [email protected]
143,585,331 *0DC8E27F50B4AA1BE2E4DE495DEAFC58041E57F7 AJANSING
143,585,332 *0DCAE052AF1CC8D9C1E7405CFCCBB73D5CDAB87A BLOOTGEE2
143,585,333 *0DC2DE86B98007E89F61C9F13DEB9765B9F26F08 AJO=C
143,585,334 *0DC230E129393805CFD1A03C4DB8041175B72835 AJWT
143,585,335 *0DC0BAE9CCF8C884AEE8B23F7D5C5EA8D31976E6 AKH;T
143,585,336 *0DC76B0503C9588E80B87C603EB59448B86F0513 AKHYAN
143,585,337 *0DC9370F4619BAAB5450E98636C8DD64DF9D805D ak#iv
143,585,338 *0DCC623F462EED3219D286EFFD2DA8205FD615AD B=MI
143,585,339 *0DC0E310C148A41D5B10BC2DDFF8DD6818CA46F9 AKYJ!
143,585,340 *0DC617AF33CFB14969B16423CEADE3F96418D4AC ALANA-D
143,585,341 *0DCFE33FE20EAEB89BA17BEC8293081F5473CA6F ALBERTO.KAZARIAN
143,585,342 *0DC879DFD8053945CA03BCD48C37B5E71910985C B==>-~O>-B0
143,585,343 *0DCCA828C5437E2643A33225F4FF76C5445691BD BOBBIENEWCOM
143,585,344 *0DC00A2EC261284FE21AA728C33DCC8E702D589E BOBR%
143,585,345 *0DC14E9F7DEEA25B8321044CC414A4113B8A3147 ALFONSO.ENSTROM
143,585,346 *0DC630C71AB4D1D18539B41FC6AF7DDC13B95FA4 BOOKER.ORANDELLO
143,585,347 *0DC1FC50F0B9F63DE0EC1E221196E90E3BC2BE54 bordalibre
143,585,348 *0DC6F5B8FEFB06328922C83908FC2AE2E1833F88 ALIENWORSHIPING
143,585,349 *0DCB110B6EF3F2BCAA3AAF232983E2799D28E647 bosomed.'b/U/z/@/md
143,585,350 *0DC93F2593C1C79415A932E60113A32B9085F50F ALINILLE1
143,585,351 *0DCAF1595730EB57F36B6938D57FA7BD7C0E39DD al-karim
143,585,352 *0DC24B6B804CE32A4D81AE33938801D567EB6DB5 A)LKO
143,585,353 *0DC9D49FEE82B5BFDD3F6F0ED14D75B70A23D47E ALLADYAN3
143,585,354 *0DCB22362D51ECFF98906B0662F692F2D6148EED ALLLINESHAVEBEENERASED
143,585,355 *0DCD849EDDC0486BD024DE9D27ACAA9390451664 ALMASSAR5
143,585,356 *0DC19309B5D4344867B24BD7F274D146CE38F1C8 BPAWLOSKE
143,585,357 *0DCAA6F6D1696CDC5F1CF2122E4FB27D3CC4CC77 BP#BS
143,585,358 *0DCB651BDBB9B72B148739F5D3BC0957F8A38C1D ALONZOSOUFFRANT
143,585,359 *0DC4D8C67CFB785BE95C65B30FDA31B8510CCBEB a(lpa
143,585,360 *0DCC2B135FD7AB6EFD1D7D9A8C1CFB13D9FB1003 alphonsedatko
143,585,361 *0DC29C892452BAB5D8F04EEB2AA8F5B12F220F4D b:-pp
143,585,362 *0DC772D4D59C57483A2B2A3D9523D3F1902539D1 alst!
143,585,363 *0DCABE814B052EEFD6FC706DF0DC5C95C87A81AE BQFFD
143,585,364 *0DC6BBB129ADCB499258305D5B3A9734E7D578B4 ALVIN.PUCCI
143,585,365 *0DC89FB334C9EA936B046B2AD2D6DAC8A742D327 am-%
143,585,366 *0DC78BBB8EF0313C0B09FC99E0D60D27C48BBF9C b&r0
143,585,367 *0DC1A3EB10CF699AA8D83EBF5DF06CCBD5EDDAD4 bradlybetance
143,585,368 *0DC13F6B5BAEBC6AA492A201D4A642C487D2BA4F ambal's
143,585,369 *0DC5B0839A0497E3799C563C6B30C609921E7CEB AMENGUACS
143,585,370 *0DCE0EE2609FA42CA875DC8034326B6F7923C9E0 BRAQUAS3
143,585,371 *0DC460A9DCA5132F11F0532D2AADE35A5838BD7E braxtonblue
143,585,372 *0DCC567775B584AC86C8DAF41BC34C85610D9523 BREAKINGP
143,585,373 *0DCEBB8CF04CDF032EEB91303B250A705626239E breeze$t
143,585,374 *0DC95847687FA002EBB41420AABA356D8A589ACF BRETT.ROSENBERG
143,585,375 *0DC91A2DC12BA62EF7BB90F2B2476832EFC89950 BRIARD17
143,585,376 *0DCAED5EBD48FA03ED16CF58DC79FB13E61F72D3 BRITAINHTM
143,585,377 *0DC69DCA6863721FC08E8A72D13843EABDF8C0CF brooklynborn
143,585,378 *0DCA991D161D534D83A23601C8390B81A51AFCDB bru&,
143,585,379 *0DC9641E8F7A0CE6DF8A5270AD8F787A162E5BAD BRUCE.MACKIMMIE
143,585,380 *0DCDAE4F9D396AD16E4D6F0708E68BAD8C202124 BRUISERBRODY.COM
143,585,381 *0DCE902C9BFF9522348432DD11ADC2B5E6ADE889 an+ipersonne1
143,585,382 *0DC04CD827343300F59B2B7488DC831A68EA770E ANKTELLSING
143,585,383 *0DC49F3D83465BD53F34D549553160F11FBF2B2F BSPOTN.DE
143,585,384 *0DC436B560E0797555FECF7B4167CCF364B8D5AB ANTONIA GREEN
143,585,385 *0DCCB13547CC68FDAB50BA8D78162C1287BB49DA BSWCALLPOPBSW
143,585,386 *0DCACA84288063733C5C7D0E1C6080D420FA2334 ANTONIOGERMANY
143,585,387 *0DC72464E7FC67E0F1D1260A970234F17C34A7F6 ANTONIOROXBURGH
143,585,388 *0DCA82CF2D07F46BC0916893192637FF2D483046 ANTONY.FENDLER
143,585,389 *0DCE3E3A08593CCE88695C9FFD26C9F31E592059 bswprimaverasbsw
143,585,390 *0DC237CF26C4FD2180BB6876753A543CEC0D8A71 BT#FD
143,585,391 *0DC341FB97934D18948C1FA67DBABBC383C20002 AO8LN
143,585,392 *0DCFDB598610D37C4C40C65ACDEBE5E7249F6D49 BT_UG
143,585,393 *0DCD41F8F10D820BFCFEBBDBABC0C5B0D7959AFA AOMJAIWONGNAIGOD
143,585,394 *0DC2E125FCB48AABE9A82A7161749CB077B76D88 APCF8
143,585,395 *0DC1D30A293BCAAB24B5489C74E018079E43B5DD BUD.LAYEL
143,585,396 *0DCA3B4E7FFBA7CBF7E67F96EA88BF2158A65DA0 bumblingn1
143,585,397 *0DC17B8A9106E6C14D5B5971D044FE2280EA3A9D BURLCAPERTON
143,585,398 *0DC98E04DB5DF2186A3D8AF60D6B6F44DD6692A9 BURTON.COLONNA
143,585,399 *0DC9FC70DE96DB080A48FF9C5A5C2FA0C63D6C9E BUZZ (BREAKFAST REMIX)
143,585,400 *0DC421BABE11116D0E0838A1D6FAF0F2E7B91F3E BVASANT0
143,585,401 *0DCF76F0A65E5000E9F9BF1483925790B5F3F7F7 AQJOZ
143,585,402 *0DCE77A1C68B09627473A85EB954361F1BDAB71C [email protected]
143,585,403 *0DC61835BF5D6169741F9773C64532194F2CEB0E BVRKNNG6
143,585,404 *0DC21F410B02973C030A7AF168D4408DF48219F4 ARCHIESCRIVENS
143,585,405 *0DCD6DE72C1AFD48BFF8E91FE2C0250B272E5644 ARD22
143,585,406 *0DC21195AC5854F2063AE08CCA7C4CA3496B4158 ARDAHANOLTY2
143,585,407 *0DC0E71ED678AABDC0E30DB4245A5D8D0E0EB007 bx6ql
143,585,408 *0DC117A322C5D3463747762A437CA0D3E2724870 byder9
143,585,409 *0DC0568E0CC769D3D3D8360C5C707FF9ED28A85E bym:!
143,585,410 *0DC31DE53810F49C1192071152208CB320EFBDA3 BYRDSKABALEN
143,585,411 *0DC795C71BEF2AAC43919DD91CD259024D2A9D60 ARILLIFORMS
143,585,412 *0DC9DB64B1490093A04B81007F6AB57E45C3875C byronsagun
143,585,413 *0DC3DE287288B4FCECAE0DA5AFADBA3A9B1BC693 [email protected]
143,585,414 *0DCCE36F52A38CE43DDC965375B0B43671963AA1 bz:'
143,585,415 *0DC6980B327242F976AC7131441F362E6635C8C5 BZP6V
143,585,416 *0DCE2A66ADC5553103A915C7E523ADB7754BE31C BZSFS
143,585,417 *0DCE67EEF099CF56E5F2CAF17B3F6EB6D13E5232 c0ns3n7ing
143,585,418 *0DCF9B7D2BC6C510C1C4E55280F40B0A7CE1D188 c3+lm
143,585,419 *0DCA5816B024AF39D08CF97688C6E5849DEC247D [email protected]
143,585,420 *0DC395AB5F13F693253E94C08CC99A8EC8BCB955 C4V4&
143,585,421 *0DC620A0A4572199F28E3FC47C25C1172A3F31B8 c.5br
143,585,422 *0DC250720836F7F2855280E26842E1A3E4B9A189 c5qimyk5dm0
143,585,423 *0DC6DD3ACEFF30F2D975C8FE10D8A69B56E08F14 c5=u
143,585,424 *0DC2D6931FD7DEF88E2A2499FD2D079CA79C9880 A;SSA
143,585,425 *0DC007E1A97825BED15BEF8722A803DE472B5935 c7z$%
143,585,426 *0DCCD7F23E8848FAC0A2E170CC2417D7CD247F03 ASSOCIATEDWITHBSW
143,585,427 *0DCBB7E305BA917432591322524236DADCAE447C a%s)u
143,585,428 *0DC47438D0EB535F42E4ED35F25B7F69168ADCF5 aswgc
143,585,429 *0DCE5275B1B31DBE39609142D1A53691039414AA C9JV?
143,585,430 *0DC7A6ED92E6754DAEC810271CA17AA287F5F3A8 AT5!M
143,585,431 *0DC47C206EA1D530295045F20CA1A6E1AE872502 ca/gv
143,585,432 *0DC8417E87E9A1DFD546B23EC7A3E0E266AFC4AC [email protected]
143,585,433 *0DCD7D7CE6580963C7FEC7929FB80CFC3EE7DAA3 CALEB.LINDEN
143,585,434 *0DC8CF1F27A4F78EE812DFC19321A315E78C438B CALIORNIAS
143,585,435 *0DC81B8F830E6685583F6DB9F45D6C348A8FB60F CANTATA:AHCHEPURTROPPOEVERO:RECIT:NUMIINGIUSTI
143,585,436 *0DC0F168CE064EC4D5D669346C5B5096A98A0C16 atnug
143,585,437 *0DC36A0247A885D8FEB7757DEFBF91F3573BB6CF CARMENADES
143,585,438 *0DC2052F9B6182983AF8F318D0C3FDE0DBB37593 av?.6
143,585,439 *0DC1D1D577B78EFE0A088C662D4E450A3884BF07 [email protected]
143,585,440 *0DCFD78E2FB9DDADB9FE2FE6F9322243683437C3 CARROLLMARES
143,585,441 *0DC9B7B3F942D6287F22CBFD05D177F7789A7DBC AVFOXQU
143,585,442 *0DC454FC4F12EF5B998B60F0B6B0126132A26273 CAS3IN.P1
143,585,443 *0DC53C0572CFB5E2E66185E49769ECD6813E2AC9 CAS.D
143,585,444 *0DCC63FBC3D16B3DD510D20D946EA7994490EE2E AVTOMORFN
143,585,445 *0DC2505B413332CECE170B01834DF9602BD118DF [email protected]
143,585,446 *0DC1EB840692035C993301BC45366667457D0D3E CC1;S
143,585,447 *0DC1BE9DF2C07FD1796F6A4CB2B981FDBF7A9396 CCHRISTOPOLOUS
143,585,448 *0DC9F0989E05995BAF3BBC630025D5413E791689 AYZRW
143,585,449 *0DC3F5A7C9E1DC4F5E5751F42D6B1B35B1979A1B [email protected]
143,585,450 *0DC7CB5B2198C8C0970F801FE8A684F4A2975EDE CDNQ
143,585,451 *0DC4C94521E2E3FE7A3CBD986CBED6F4DE1D75D6 b08yb
143,585,452 *0DCBBE55129AC44826BDD75AFFA29531FDDD0272 >-b0o~-0~-(---p
143,585,453 *0DC15CF97B1ECAE37008B6E0BD94D14134F2EA2B cejht
143,585,454 *0DCC6462AE82E6D6F7F33995503445767848E462 b1au_
143,585,455 *0DCD36D93F43312AE978868EC8BB3529A4A80D81 CF0QF
143,585,456 *0DCDAB0F72F1C480AE1C38C06B4B3A63AE638196 b3x(i
143,585,457 *0DC03F877D98883119E3D76106E6849BC7669EEF chancewayland
143,585,458 *0DC29708CEA63BE224BDC4DD214647EBBD22FEF0 [email protected]
143,585,459 *0DCBF1FD814F0441EAAAC03B7359C5DAA3C0DB3D B.9r
143,585,460 *0DCD483684AA6BCF286F3FD5F5C6D6F9816E5F78 CHf&
143,585,461 *0DCB8833F8AE1D600BFC28C164173F8F46A8C46D chỉ-nam
143,585,462 *0DC773BBDF8BCCF8E3E9D9C58D453D000E5D8F51 banefuls5
143,585,463 *0DC0D5D43C07919BF797669FAB74D3DF4E78337A BAR0ME7R1CAL
143,585,464 *0DCE9E107187162600B6EDAB5D4B8A9A358D5CA2 BARBARAPRZYBYLSKI
143,585,465 *0DC32A2282521C1D75634576635050122245FAA3 Ch$q
143,585,466 *0DC4B567EAACEF49D4AEA06D80A6D9B37AA44E68 BARRETTDISHER
143,585,467 *0DC5EF65A6BEB0522CAAC41CB25A07673AB78677 BARRIMORE
143,585,468 *0DC3A39218B7EB455DC6E000C9F8DF51E8868DC4 bastardcarl
143,585,469 *0DC0732B36816C8DEC35216CB340062D0828E305 ChuraLiyaaHaiTumne
143,585,470 *0DCA5D79F76A3E32F3E53C4B1D59983415A77FA5 chuushik6
143,585,471 *0DCDF17F20114CDE5A87B46AFC42942F7845D2D7 bbb.x
143,585,472 *0DC042C4A6CC004E6ABCB86AFC3C88693C7FC8BB bbfjm
143,585,473 *0DC5FB4C0E3FC9A6693EFD0C4E79149650E3D975 BBPW?
143,585,474 *0DC8D90E4C6F7A837B038A44CC780EF76F96A0C7 c,i&g
143,585,475 *0DCFD4F37777DC2EC969FD6D7ACF1D4CA96373BB b!;=c
143,585,476 *0DC7F54DA1CA9904210571DEECA294CED611FE8A BD#29
143,585,477 *0DC283706E92E714F79264DD7299150853CB0F7F C,JD5
143,585,478 *0DC896BA77C73227BD5C36104B76C4480CD5660D be33
143,585,479 *0DC0F6900ECEE1580A3C3EF3C80506B5359F2E1E beary78deary80
143,585,480 *0DCAF72E7589C1A2D8C793F2A9AA35E634111232 ckka"
143,585,481 *0DC54BFB45D1FA60D995A46DA1132BC6D1B030C1 beaulocklier
143,585,482 *0DCFAC49213B9457FAD8DA8FC41AF9FC338913A0 beautifulbyebyes
143,585,483 *0DC71717E198A5BE510F0527A5EA18F1CD230849 BE BE HAPPY
143,585,484 *0DCF3B22F067A52BC5B34549BDEA6BBA4CFC8601 CKPH
143,585,485 *0DCAF8E38C3052A28748A704DE3215A630A1D603 c,la.
143,585,486 *0DCFA969A7BC70B2AAE08A9A1A90D6BB814E3D20 CLARKOUTLAND
143,585,487 *0DC9D93B0859063970E0BF86857BD132DD874474 claudehelquist
143,585,488 *0DC530F49A2D4C4AED3CEB57BEFA97FFA3A03589 clayblackie
143,585,489 *0DCB41924CFD1B72F46F8CC338B55173F18E4BAA ClC=
143,585,490 *0DCC933266AE596230811A7BF19610014475B880 BEN.WITHEM
143,585,491 *0DCF10212851C6454732AFF93EE1607778C9B377 BERBURGERHOF
143,585,492 *0DCAD5A9CC59E824805D4AB3F2B232FDFAA70400 bereaved5
143,585,493 *0DC7354FFC23C4C5E16BCE42BD88B653BBF5667C BERNARDO.GROSSO
143,585,494 *0DC7CE07BE9471A1FCA30014368D708C611A5A5E BERT.DEVINNEY
143,585,495 *0DC53F2643ECD576A0C96C577B512CF9F8A89356 BERTRAMSORROW
143,585,496 *0DC093E9D37616AAEB3B9FF36592A5AB21EC73C4 BETAGORO1
143,585,497 *0DC56B0AC57850C48E23E25C4AE0C7540BE8B3C8 BFRV=
143,585,498 *0DC85DB4686EE1F94174F86EBE0C33C10F243BB4 [email protected]
143,585,499 *0DC61617D3411EDD067AFA768D748A53A804DC46 BILLIE.BERKSHIRE
143,585,500 *0DCB6C12171CC5C0BD209717ADD92CD9D62D88F6 bjdp%
143,585,501 *0DC32EFB51DB761BEB5AA8AB1041B03B97A3775B b=k7d
143,585,502 *0DCC3B78BB6E6929D8DF6F8A95D2AE484B387A20 BK9L!
143,585,503 *0DC33045A8A829220730584140584987ACB790D7 BL3PS
143,585,504 *0DC6AB86040D399E82D2BA31B3E43C924C4579CA B?L5Q
143,585,505 *0DC0B93898E6E3FF07DD687CF2385C94D7A821E6 blackcr
143,585,506 *0DCBA5247C4749FE760776E39991E644E80D436C BLANTSOELV&GULLIMOERKET
143,585,507 *0DCCB7AA663F9D9BC8D8FD7215A3E87F8442340D BLAPS123
143,585,508 *0DCCCF2A9D5356064205EAA1E5E025BEC1587041 BLEISCHMELZEN
143,585,509 *0DC40497DE7C430425647FF1816EC37D12635D25 BLFDR
143,585,510 *0DC50407D3E7DFF82F95F2A916C12F1D354F7B9F Blst3rs
143,585,511 *0DCEBA2C7D14E19828C327BA8234E21251CC9BF8 [email protected]
143,585,512 *0DC058E3A4788CFBDE4C5302D7C24967867AA6B1 [email protected]
143,585,513 *0DC5CE785CC85EFDDD5C02FDD6270B25370C88A3 ClZG
143,585,514 *0DC5E03183B3ED52A9814FD30EA9E9788980E74A cmk&c
143,585,515 *0DC68C57F91F0A88CA1E9E91B4B5932D9DA79A0C BNĦ
143,585,516 *0DC728D78AA5AF3A7A72DF1246A60E050439057B BNJR5
143,585,517 *0DC8E110C9B0BEA42FB5D88687A68910747D64A4 co+&c
143,585,518 *0DC699CD556B1C8F676B19DA94533C5758E8B9E3 cockerspaniel841
143,585,519 *0DC6A66B8C9C8020DE35684E960EEC3E62C601E4 bobbyglatt
143,585,520 *0DC394D8D85B8F6491E23F82A9B779E937D8C1FF BOCATOMAS1
143,585,521 *0DC69CA6B43AB0009B91E402DD109BD017EB9050 bookersulieman
143,585,522 *0DC517F91F864AE09F5C51C8EE4343820FD0D9B6 borishollon
143,585,523 *0DCC12B89A955FF12B1E30A639C171CD337F0CEF boucliezsed
143,585,524 *0DCF71693853B699A55A8D9E592CC0606B3C7949 BOUDK
143,585,525 *0DCF321CF65340EEFD7AE3766E667DD0627CE7E6 [email protected]
143,585,526 *0DCBECA4D553FE8FB4726997094AA58056D473EA boydjobs
143,585,527 *0DCA1592917C1B3525EEAF8DBE708E7255CB446F B===P-~0-~O-}O{
143,585,528 *0DC2A3539F2BC3DD58B937F22B31C4A06D560CEE B====p`~)8(
143,585,529 *0DCB72D361D6C5C16CFE08D060A0E0CCFCB88376 b====p-~o(x)
143,585,530 *0DCAD12588F33D453B696F1716933F24390C0DDC BPUFW
143,585,531 *0DC98AC64DD0C64F9AB79F63CB52408E98BAC95F BQG6X
143,585,532 *0DCED3E49B3234A68828154B1C188E93486F95CB COLEMANDUNOVANT
143,585,533 *0DC4F6E3AE7D33A8803D56A2B563EFCD3A27D099 COLLINSUSERDOODLEPOO
143,585,534 *0DC5C5A3EE7EFCD0CD13795CD713C0E3308C0216 comlasa0
143,585,535 *0DC812989973735158C0B1CD16845BF7BBC4B0C4 COMPRIMISES
143,585,536 *0DCD86AECC4F76A7A4D1C0A82F9127FE346C8276 CON$3CR4TIV3
143,585,537 *0DCA0F0837726994113E2BBB440A78032C98E99D concani
143,585,538 *0DCF232FC990A8DFD2036C1C2C255DB41C7656A0 brantmae
143,585,539 *0DC8DA1BE711B14C43AAE6DB7F1D555AFCD1A890 CONJURAÇÃO
143,585,540 *0DC0D7A922DD2327BCB3A34289F2F8491D28FCF3 BRENTONRADELL
143,585,541 *0DC774076552F9A6ADE8362EDE172C2C88FD766A COOFJ
143,585,542 *0DCE7A254E2D524D50F85DC32AA25DA5D4898943 BRETT.GIACOPELLI
143,585,543 *0DCB33C90EFDC53B769231F4F42FD01E67EBFC54 BRETTMENTZER
143,585,544 *0DC8E2F3AE910F0004C1E133CF44F29FEE941EE6 brfa&
143,585,545 *0DCEC722F2787176F6FBD9FF5E6CD46C2A61EE45 bricekieffer
143,585,546 *0DC55095762D00C19F6A276E861939637F18CFA7 BRITT.SKANES
143,585,547 *0DC19B7DC10885F9197FDE70FBE652916CB00E8E BROOKSTORM
143,585,548 *0DCFBB380318AFAB84682C071DFEA2FA54C6166F cp6:e
143,585,549 *0DCF6F6A48C8944E27B8D37961BE61CA2CD2894F CPM(N
143,585,550 *0DCCA806F0BBA67EC1452DB9A2508459BDB7C0C0 BRYANLEONARDIS
143,585,551 *0DCD675E68F8324E17793B0A88C5C98AC1007688 C:\PROGRAM-FILES\COMMON-FILES\ADOBE\HELP\EL_GR\BRIDGE\30\EVENTJS
143,585,552 *0DC45BF271A11C8A8CE47E0C4ADD84CA92E2BD3D cq/=(
143,585,553 *0DC0B5337872C00DC92F50B09B4A6D2472B4DE69 cq3%t
143,585,554 *0DC9B2A0D05A17E3723033DC1E8E2415F8E5A892 b-> ~ ~splat
143,585,555 *0DC2A45AA40C7EBA409D8CFB8792D95473D44CD9 cqr1q
143,585,556 *0DCE639CFF9D0D8F6557D4E4E91A2B570F83A952 [email protected]
143,585,557 *0DC997CE1BD511EE934D250B28413B637B8D09F6 craigburly
143,585,558 *0DCE5DAFC41892364A0C089BE876303E4C52AA1E CRAIGINAGAKI
143,585,559 *0DC4BF214B3DD1F0490F9EF0015FC3793932CE53 crângureanu
143,585,560 *0DCDFCE932D79A615A89D898471AADE8DE942FCA [email protected]
143,585,561 *0DC9D4D6E6F8F16641C3DD6F2A27405840246F35 BUDHIB
143,585,562 *0DC40781B3777C4903067F76EBB774FFDF1F3998 BUGØYNESVÆRINGER
143,585,563 *0DCFCE461B95540E66C9DFABD8CCFF106C843C87 BUGYONNOVSZKI
143,585,564 *0DCF9ECF9958DBB8C83C4E2276B615684BE0B20D buh(7
143,585,565 *0DC9F697AE885F48D7A74AF71AA59BE02DB6671D bułuk
143,585,566 *0DC20F0E5960C3169E05FC35A94E92AA8FD0CC47 burbaker0
143,585,567 *0DCAD14520977FC49518D5929474BA2BC673A609 Burnwell
143,585,568 *0DCABEDB51F42DF669896ED8CF65AA7007592AE0 CTIMIZES
143,585,569 *0DC1ADE22E9A4AEC6C60C08541B8CD0F3E1277B4 c!.tk
143,585,570 *0DC42348FBD4D9476C43FF88FB5D2BCC3A4C688F culturalfailuresatrootofhmrcdatalosssaysreport
143,585,571 *0DCD8EBD1B8C73B2198B41C7A0973F1FD3553610 cusglat3
143,585,572 *0DC9B15BFD702FDF03CD77B62724AAC7A5F05F2D bv7+3
143,585,573 *0DC30282677B9B9A11BFAA4765EC383F6E8771EE CVo#
143,585,574 *0DCA1E01BAD1A0F8F1959905437371AFCAAC76B9 c!vt+
143,585,575 *0DC26C485CBE6F08224774E72498CBEE56F93A83 bv"y
143,585,576 *0DCFAA20BD42538B45DA0B009CAEC6F2C226A9F8 BW9P
143,585,577 *0DC028E8727140864E1A869FC67763F31EE8B9B8 CwmB
143,585,578 *0DCC453B79D2FB2B04B1A910517C8D750084D235 BWUIU
143,585,579 *0DC0F51B8F6D8269584EF88B5BCE663A0E3473C7 BY(2P
143,585,580 *0DC261A777D634EC6CB4BB71DA72AC374518A48A BZV"
143,585,581 *0DC557CF91447B87096CAD592C73879036D658D8 CZGG
143,585,582 *0DCC95E31A7F6C67ED792D02544161C10F90595F c_2h:
143,585,583 *0DC539B4E9CB9A36B720D6CFC5325B4D6F729433 c!3#r
143,585,584 *0DCB7C4500A9947B92496ED09A1C76448AF01D1F D1)GJ
143,585,585 *0DCC75223AE0E557A301FA7C0031EAE0D3F5B73F d2"ow
143,585,586 *0DC476465B420711CC62D1E29420536ACE98620D D.2ZE
143,585,587 *0DC325916BB769A7EA63442D9D037AF552BF18E6 D3:FB
143,585,588 *0DCAA8D4900308BD414E099B4440CDD5F297E256 D4N6G
143,585,589 *0DC2D79F56CA031B2C12DE53C02D4C9A39991402 C3V/
143,585,590 *0DC309A02C9674CFBD48960079D5C7BD02614BA2 d52%z
143,585,591 *0DC9EC68ACB10B62D0BAF0C07F48AC55758D9986 c4jolere$
143,585,592 *0DCA6F0D9ACF570F2412079A7A7C4F5D8E838EE7 d:5l=
143,585,593 *0DCF4E7FCCA97679979E053C1869943F8BDD8D0A c50l
143,585,594 *0DC6F2634BE8DB187623506EC86DFB0B88E5AFE6 D5UV&
143,585,595 *0DCA723D58C7A73442DE5315EE3EFF097672D422 D5XA
143,585,596 *0DCD61600E8109113960A146F0DC04A2655BC51D D5Y8Q
143,585,597 *0DC8004B006AEE2B6A34F8557AE08854EEC97EFA d6ik1
143,585,598 *0DCA010A0430A812F478DCA42AF7E571DAB4D830 d7-4b
143,585,599 *0DC3F7AB3DDE7238A82359449B72E0645FD4270A D7CP6
143,585,600 *0DC998E903DC99159D84DF15E7E8FC4B135B1BD1 d7pbz
143,585,601 *0DCE2F3739092B0B6E2CF89CDB8D73708CF066C6 D?8GW
143,585,602 *0DC85A0A92D363C77AFE70C109B56B1DCAC0E109 d9rq,
143,585,603 *0DC3A96D1290F0DD4328AE1E3D846CB0C54C8BE2 DA2FA
143,585,604 *0DC05B4FEB6D0C9BD82F7C252061D58B386A797D ca19001500
143,585,605 *0DCCCDE794799724E4AA7A01C307F37584563CD7 CABLEMO0
143,585,606 *0DCCB997F0575E9D1DBEC1825525AD82DFF74340 c-aeu
143,585,607 *0DCCD2B4D32CBAF35EA5A1AF4A708584E805C00F cah4i
143,585,608 *0DC1B24F99E5F7F8E7C2672BAAE7B8CC055C48ED c-aib
143,585,609 *0DC77692AFDCC458CFDBCBAAC45B464DDB065CEB CAÏNO
143,585,610 *0DCD32A6BC531FED5D694F99E96EA165B089563D calebswensson
143,585,611 *0DC7EE1067566B23D3D076791E5A8A979E7A8B3B CALVINDAVITT
143,585,612 *0DC3D0859F4C21D1E6B2627B6BB05BB112A9E5C9 dannyseay
143,585,613 *0DC9764047E8D7746C1617A3CC772B29AA54FE55 [email protected]
143,585,614 *0DC4330FC7DA279B16A131E390879D9711F7DD68 DARELL.ASHAUER
143,585,615 *0DCFC530931F2EC1C8683DA0A8D5CC9599052226 CARL.VERSTEEG
143,585,616 *0DCFDCC521A028612A5FFEF4B408ADA31137B19C CARMEN.WOOD
143,585,617 *0DCAEF887CFEF3D08257A0D54D29E7F5D3E41DC0 CARMINE.RITENOUR
143,585,618 *0DC9E6A5C54B28E28B50153FC8750008BBF4FE6F CARSON.DREISS
143,585,619 *0DC152A57ACFB8D4EEEACCE062D4B4B21C37F91C dattw
143,585,620 *0DCA124373EEEC882E80C4251EDADAEDEEA02F7F cassiecat
143,585,621 *0DCAFC0C659E549F3489EA7B5B5FD1CFE6BE5073 castillo.de.montgr
143,585,622 *0DC553B1A2662F36ED85AA67652D387B3592DE71 DAVIDFRANKBBS
143,585,623 *0DCFBA989B1B1ACB3DC442C95605E33166A97B02 david-maddox
143,585,624 *0DC36CA1B9FC0BF303E9A2C65125FCAF1046E43D DB3UU
143,585,625 *0DC7CA917E0E3DD769EA20B75407F19E17145AA0 CB$-L
143,585,626 *0DC832E57BFB0076ADB60B1997804868F82C6D9A CC#H5
143,585,627 *0DCB8DDB825AAD41AFA1813433FAD3F03BFF23E8 DCLF
143,585,628 *0DC6DD410088978F965D41147884992F992CFC1B CDD5A
143,585,629 *0DC50712BCEA2FEB849975F9FB432034B631784B cdipv
143,585,630 *0DC5F81D5E35C4C0064745C70524929604FAF0B5 DE5N
143,585,631 *0DC08A71A17AEC7D3EECEE8CBFBC628D9BD0F39E deandredismukes
143,585,632 *0DC367E5092ADA6A761032D336DBB40235DEAA2E centesimabsw
143,585,633 *0DC1B908BF53A9BB3D546D14FC0D1B86F8DED844 ceuxrde
143,585,634 *0DC4F2C7397AEEF760B85A99ED5F06C3674590D7 cfj:i
143,585,635 *0DCF060A899177632F3F93D4CE780CEEC6353BEF cf#lu
143,585,636 *0DC715419D843D63A4674423AC4CA32605600B4E DELMAR.FURE
143,585,637 *0DCE20405051E9109684849A002E7464C7A1943D DELOGEAITS
143,585,638 *0DC176F065EF841879DED616DD6F267A23EF0DC2 [email protected]
143,585,639 *0DC4BA67CC222C8023D606FBEF740198A108B2E3 dennismangas
143,585,640 *0DCC8529BB7AF94C832031FD5D8533EEB4622F4F DENNISNAVEJA
143,585,641 *0DC63FC256E909F788085F9A52EE9F3C41E56230 DENUMMER4
143,585,642 *0DC22C196E1B2636B1C8AE53AA438CE9FDB1A75A [email protected]
143,585,643 *0DCF6BD2EC2DA170C32A81508810C46F2ECD2103 CHAPTER0707:THESORTINGHAT
143,585,644 *0DCAA4ACF345803939BEDC87A8AABDEEC16CDE80 CHAPTER 3101: THE RAT'S RETURN
143,585,645 *0DCE307CC507301C837AD7DAF46084B1E0121674 charleswunder
143,585,646 *0DCDB107E741F15B76AF15571BF3353BE86A2259 deversais3
143,585,647 *0DC0AC44BC09635EBFE3CD757828000BA52C06BC DEVYSISED
143,585,648 *0DCD9B45B5D9EC27AD7B225DA5C79713AA0127FA DFIL+
143,585,649 *0DC239C6AD86B9C6BC80003723673EF02C97230C [email protected]
143,585,650 *0DCC021325820C672F49226121943F0CA67F17E5 [email protected]
143,585,651 *0DCF2F49CE66B8A6CD656857629C589A3D515205 CHESTERKASPROWICZ
143,585,652 *0DCC6617CE2330D881E54237CA5E5B18D38BB065 CHETPOULIOT
143,585,653 *0DC3C339F70F652ADD254F4F1CC80F304CD425C8 CHET.SHEARON
143,585,654 *0DCACA429ED14FA772262D94762EE2DBA62A43B8 CHILOUIL
143,585,655 *0DCDAFA98204E39640C7866C1E81EDA64F82399D CHINA0912
143,585,656 *0DC5AAED45D746E570338B6CE97C01681CFB8FAC dh!#g
143,585,657 *0DC169EFA29B8C02A0BBDA028178FED569F798D5 DHP(
143,585,658 *0DCBB84C23D782FF94197294F48B05857B3D0DC9 DIANAPRINCESSOFWALESDIESINCARCRASH(1997)
143,585,659 *0DCB6EE902A1094B9D6E5ED68D345AF09C2AFD45 chrissymcdaniels
143,585,660 *0DC0986ADC07780A7510C1D3D0AAEAA9934BC02F dick-sucking
143,585,661 *0DC5A321E4C28185F4F95F97770F67D61DB2566E chuck-mullen
143,585,662 *0DCC05292946E1705390D7C6DD8C634A2D32AB3C DIGGITALI
143,585,663 *0DC140C04FB50A594750438CE081A6E4B452A6D3 DILETSKII’S
143,585,664 *0DC0866FA2E8B8366EB6425BE4C7932F15AFE33B cibke
143,585,665 *0DC82D6D0B69F680A1AF8ED2A84929709404EB9E CI&ED
143,585,666 *0DC4125CAD62B7CD8D2D07058D265FD37B9B6945 DIORETPYLOP
143,585,667 *0DC02BA37DAFBD6891B7ECBD60884E6FA05B1EF9 cins!
143,585,668 *0DC22AAE8ECBB5059DA6BCCC0347F0E3447877E3 DJQ;
143,585,669 *0DCE580DE4AAD19BDD943ED04189534B16331477 CL0RC8NPTRSC
143,585,670 *0DC2A01AFEE62083473900039560C5FA197DEFF0 DJ%S
143,585,671 *0DCB243E839AA71747C0C99A3E486EB2E260097B DKFT4
143,585,672 *0DC1190E4A79BC464BEB6CA129995244E9147290 DKHTL
143,585,673 *0DC8A027CA26AE7BC50A5F27460251DE54E55071 dk&ts
143,585,674 *0DC5A43A7D41B36A691CB07B6A943E98468ACF7A d$lx5
143,585,675 *0DC44326466F06262992C390CA66C405AEF394B4 d_m%+
143,585,676 *0DCFC4904E38609C699801BFAF136A68CF41A804 DM5MD
143,585,677 *0DC0314831A1F81847503A5BA3E42E4587DF0EE2 DM91362
143,585,678 *0DCA7FB909C02F58CDB2BDD118213D4D7323AB21 D~MM
143,585,679 *0DC1A5D60F03ABECD03C62287C3EC5D407523692 DNWT9
143,585,680 *0DC15752093172D1D4256DEF49FB563EF5E9B1A2 DO7/K
143,585,681 *0DC0D6B5DA90451FC9C1DBFACC5138604BE119CE DOB,G
143,585,682 *0DCA5B735D54C2D75B3F8C5FBBDA7278996A89F9 CLEVELANDVANSTEENHUYSE
143,585,683 *0DC92B24C94C5D3E23090DFAD69A88402FBCD51E dods?
143,585,684 *0DCC5A98E7EB1662A88329865D2ECF61B13E2779 CLIFFORDARGROW
143,585,685 *0DCFB3D78805FFC260A1F4792824D8EAD0F4DCAD CLIFFORDASHBACH
143,585,686 *0DCFA590472BA368AFC1C081A71FA3DE2808876D DOHBE
143,585,687 *0DC08700BA9D391D3911637CD5CE7C6A59DB7FF2 DOMINGOSIDBURY
143,585,688 *0DCB8671158A7CDD372FE02BD06AA1BEE70C0E9F cloki
143,585,689 *0DC30D9A2224ECD76DDD8D370C096C9C654B1DD8 dominique.tantorieas
143,585,690 *0DC309677E19813796D9D89B3C051138AA7AE628 DOMV
143,585,691 *0DC166C361FFDA5FDF312105FB1D7991506CA460 CLYPED
143,585,692 *0DC7D698FF99CEEBFCA60CBAEEB9015B2E1308C9 CMFKFV
143,585,693 *0DCD193BE0EC689C823962049163089DA9142D29 DONOVAN.COWGER
143,585,694 *0DC1A4287D5CE9735D440DA333C0CF9B1EE7B923 DOPRECYZOWUJĄCEJ
143,585,695 *0DC6D0D53C723815CCB6DCA21AE8469FFD0484DF cnew
143,585,696 *0DCA0210C643BB4C1B7BFDE95ADA9FE6EEDF6B82 CN%n
143,585,697 *0DC263F7087A8D60674A14AA42D97A80CDE6FDE6 CNNN:
143,585,698 *0DC1A4205CD35480A7550ED73A0A748185175BB3 DOUG.WOODMAN
143,585,699 *0DC2E299B178204F7DFD7DACB43A478D9683D263 dpa6i
143,585,700 *0DCECF24E255C8C7BD17D5F7D2AF1ED0060A95D0 COLLINHANIGAN
143,585,701 *0DC5C147379659EE0F3319B30FE205D199BD8948 DRAKE055
143,585,702 *0DC98D28C9CB3C120E198A0054065E063F8167BE dr-ap
143,585,703 *0DC8D8EB2C260946DF6055A09534733D3774F669 conc4v!+!3$
143,585,704 *0DC63FA5B597C80270CDDC9F91ED11988375319B [email protected]
143,585,705 *0DC9690D5A606C10936FE0B73C95FAC707DCE0C4 con.mucha.manteca
143,585,706 *0DCBB106094BD33FD1ED81DB7A00AA2387D18221 DR,O
143,585,707 *0DC8820E6B10403257E330178525CF434DEA1ECB connurens
143,585,708 *0DC0620C6644F43C7182BCFA2673F4E1EE649FB6 CONRAD.SCHNIEDERS
143,585,709 *0DC7FBA108B61FC79B0F3021E651A11AF53BDF1A CONVINCED OF
143,585,710 *0DC916CD11A674D990B489535937D07CCD89BD41 COPERIOD
143,585,711 *0DC3F1B7541FF37FABD1E71C076296CD97DCC810 COREY.CARRATURA
143,585,712 *0DC55EA14E9411049BE68EB44972849E34E7C1D9 COREYLOOI
143,585,713 *0DCFD2CD5B6119D840A340F6229F5C88A9A4C49E DTL%G
143,585,714 *0DCABFF5ED9890FE2365819969C86A1167C64F4A D/TU6
143,585,715 *0DC7AC4A121B30AE0EF099D5D7E05AAA4D50D058 DUA-BELAS-'K'
143,585,716 *0DCCC90F31271AC293431E06643AB1003410FF38 DUBMERGED (B)
143,585,717 *0DC9BC3330674D60C77B73ACBD426CD5120294A7 DUIVEKERVEL0
143,585,718 *0DC0BEC2B953ADB973D40F4D5501CB59097B97F2 D;UUP
143,585,719 *0DC35C5FA753B03E53486C72369F51DFB9572EC5 D#UYQ
143,585,720 *0DCDB64960A0B7520C035F78265C39CADB4C030E d!v:,
143,585,721 *0DCB091A56AE662D3544F8256EF9C935F3CE8E04 COTTONTON!
143,585,722 *0DCC32BFCB734C2905188DE601B0683315E3D862 d;w.5
143,585,723 *0DC52FA3F01E4D7A0FD77E78341BCFBC26858804 d:w-r
143,585,724 *0DCF500D4BEB5C8858292BA618940A23D74C7AAB C:\Program.Files\Adobe\Adobe.Photoshop.CS4\Presets\Duotones\Duotones\Process.Duotones\cyan.bl.1.ADO
143,585,725 *0DCD6D0541AB8A91393B322094700F29F2F7A2CD E2C[
143,585,726 *0DC0B0A4F6924FA97F899422BFBD5D4118F0B27E C:\PROGRAMFILES\COMMONFILES\ADOBE\INSTALLERS\FAF656EF605427EE2F42989C3AD31B8\EXTENSIONS\ADOBEOUTPUTMODULEALL-190609132111\ADOBEOUTPUTMODULEALL-190609132111.PROXY.XML
143,585,727 *0DC9B7535F9F59E531DD6C0FD8EE04EB9D0218EF c:\program-files\microsoft-visual-studio-9.0\vc\crt\src\locale.h
143,585,728 *0DCEFF4AEAE082908EC2CA88231062071AA6B7EB EB/s
143,585,729 *0DCF8DF0EC123D8434B1D725E0B8D4AB1DBD5A18 economics25
143,585,730 *0DC9E6E69853AEA7E93F07FD688A7AFA65A79212 EDDIEGONDA
143,585,731 *0DCE51B68A7B36D4B98B2FF80FB49E0A2A006B27 edednhtj
143,585,732 *0DC470D5263F7A7951EE97579ABEC299BDA09B2E EDELOISZAV
143,585,733 *0DC96E3E4A1BD9AA4ECBFFB417265BD596C22392 EDERTMILS
143,585,734 *0DCB4BA017B9D5C3064EC04B84A5B533018F804A EDGARDO.DEPRATO
143,585,735 *0DC9D56DBD38371099A5A6ABFA071EDE9D645BF1 edmondfly
143,585,736 *0DCC4F5A986448465C17F394C6D20FC38226A325 edwin1210
143,585,737 *0DCE6003BDB97BA3DDCE3809D83541C7162B32C7 cr6d3
143,585,738 *0DC833C190CD66472663E994A445ACFC9AC56094 Cragg3s+
143,585,739 *0DCF419FDFDB6866779BDD83A2FB47EBDD6F8A97 craiggildersleeve
143,585,740 *0DCA9B001CA8AB2D8C4C82771C887606D06B9998 CRATINE
143,585,741 *0DC7F9794A0A1C0A1DA4ABCC2454E134F632DF65 CRIS-ALUG
143,585,742 *0DC8826A7FA3C9904D0ADABDC7F3FB87F8727F86 CRISTINA.ROSATO
143,585,743 *0DCD4563707C9B22A03772B2865CB89CDECB5640 CRIVAVAM1
143,585,744 *0DCABF5859CC5F745D2904F1B992AD4E00B5EAAF CRU94
143,585,745 *0DCB40DAF333D60AC7FFF8EBEC6AC1377D02C1BF cryptodon
143,585,746 *0DC71FA8EE6EAA7C239071A6B8D0D36F623FE97E EGOIZED6
143,585,747 *0DC755633035AEE0246F97AFAD1578C06AA89C8E [email protected]
143,585,748 *0DC107A6C8ECE6F6847EEA3124E327075B41E608 EHCOWROV
143,585,749 *0DCE0FAB1CCE8778084E38F5964CA94DD0DFC63B ehcserfed
143,585,750 *0DCD646DD9C0653B2FE6B080C748C2936A0935E1 csq"l
143,585,751 *0DC04FA9D537AD188452C1CE198BC78266BA268F CSSM4
143,585,752 *0DC5B5468C232D68A518B2F89072DBD77F26F8E4 CTlc
143,585,753 *0DC267C4C396E98898320F4807C0066CF55908C3 EIRKZTIS1
143,585,754 *0DCFA4BDAA9A22C9874DC984096FECEB15B3D88B ctorrence
143,585,755 *0DCAB6B628E411CC2A856D6F2C98F60C84406D4A CTWKW
143,585,756 *0DC2C596A8A07F69AA04A651CD274A3EA047BACC ELAINE-POWLES
143,585,757 *0DC0D84E73A9E2097DA1D294B5625E71734A79CE eldridgeburmaster
143,585,758 *0DCAF5CBD13E0076E092994FD127A1F366B6E8AF elfproef.
143,585,759 *0DCA7BEBBE27FA4A6BB42872ED259CDF8B315CF9 elishakaelin
143,585,760 *0DC232090A7DA9BC540AFCDC2F4302C2B26AA298 ELLIS.MORTELLARO
143,585,761 *0DC739137EDDD11870BFF949E3423C7306ADE8E2 elmerpestoni
143,585,762 *0DC31C480B3DB3E9D2347115ED54719947928637 ELOY.GOSWAMI
143,585,763 *0DCAC58C7A83BC1BC45B7F99EDC9C1DA80B40BBF eloyminardo
143,585,764 *0DCE783A3BF62C0A444E5DD2D89CC9D615E6CA34 ELVIN.SALVAGGIO
143,585,765 *0DCE429B20A517F4DF1E57CE0D1C1B37A88E8DDE eme2,
143,585,766 *0DC8C9150A9216D4883BA9C805C1012D8E6D7C85 emetey
143,585,767 *0DC706A0A5EFEC29828D7B162C37E831EC721F20 EMIKOLIM
143,585,768 *0DC14807F4D9B8332AA6279CADB5CE94F21E3382 enchainment
143,585,769 *0DC28EA72D1F955D4E2B2B1C0AF3B5F342292DD4 ENDING.COMMENTS
143,585,770 *0DC2052034A7187D606961387588157C12366A42 enfermedadmental(isaacjunkieremix)
143,585,771 *0DC2DB7EECDF7E41DDE35269BC0460CABAB93C4E ENIAVUOS6
143,585,772 *0DC75B397D8CE09310CEC846DE25FB04B5449FDA ENOCH.RUCKEL
143,585,773 *0DCA9916466F11C9D4DC698EB7961B518F5EEDE3 ENTERRARAMOS123
143,585,774 *0DC8AD3944BC89376126A81C6C25C362C9F8E8C1 EOL&
143,585,775 *0DCE02691DCD76A7B59432BDC16AE185A91F58A2 CU:S
143,585,776 *0DCB1395AB30AF0E270978910609B4870704F988 epbn
143,585,777 *0DCC5372D3907A35D644B7A0E7E55F2B63AEF813 CUV$#
143,585,778 *0DCFE0851AAA25FDF7CE354862D3FFE09B2D0DA9 CUYF+
143,585,779 *0DC844EDE29BDB83EE4413FD17302F05BE3DA391 CV52
143,585,780 *0DCE89E36D149CAF66E3D3CA5722F1690DD03014 eproxx
143,585,781 *0DCA3AC74617C73CF8FD7E604694B19461134351 epx0n
143,585,782 *0DCA6BEC2DCF4C12A1EDEE56D5D251711192B43A ERIATION7
143,585,783 *0DCAEE10B99742B6808D3A0F718BE1BA8E91E293 CW/PM
143,585,784 *0DC5EFE9C8490B7B894158303D9160464C10D479 ERICH.MCKENSIE
143,585,785 *0DC28356715B65DF51915239FED940F5B8EFE817 ERKASTET9
143,585,786 *0DC7D174BC10240E311023C7DB2A5E1C7D013C47 ERLIESEN4
143,585,787 *0DCCA29AEF57D87F0F266C35CEF39C1361F92DAB erniefairbairn
143,585,788 *0DC87ABDC394ACB1B53680CA23BD554CFB60F87C errolfabbozzi
143,585,789 *0DC6DF87B2C1D55B86C32456BBD74B7CF8A803D3 erwqx
143,585,790 *0DCC073D76E249F9DDC0F2AAE2F908D518ABE357 erzh$
143,585,791 *0DC3C260B7ABFED26A24BE85F156A4AC5ACD8823 CXIQF
143,585,792 *0DC36DC9F092B4A15A898004FEE55746997BF180 estrellon
143,585,793 *0DC27C929D30D4E0B17040D7AAB8BE8A21AA6943 ETALONĄ
143,585,794 *0DC2BA928509EA1ABE3E28EA12E1BEA477C1F53B CYVC_
143,585,795 *0DC9BC5AEC257099C6B347AF815FEE4B3FF822DE czfx)
143,585,796 *0DC63FBC5B844C2A61939E93092F1EA7402EB861 etpehcsmo
143,585,797 *0DCA1C94D838D7775786416FD8EB3F96078DBE6D d03ld
143,585,798 *0DC719339FD4857FC6E26736665BE21F0AF213F5 d0al7
143,585,799 *0DCE00460F50F9EB15C921DCB635EC52144234E4 euae5
143,585,800 *0DC5FFF15EF4DF9C2D261B342D92F916D0EEF98F eudfc
143,585,801 *0DCAC9EE311199BABA2E4BEC60F2D028B8043955 D1EV_
143,585,802 *0DC23EAD21EA8CA52BC9A29CE4AF0DB018DDBB5C d1xoq
143,585,803 *0DC8E087478948A06680524CC7FA562BDE521364 d:2q
143,585,804 *0DC3D26B449F373D02BDEDB9D59854677A36C642 d3er4
143,585,805 *0DCBDF21D0798704F7B2A44F9FCD7D833BB1B561 EVER.CHANGIN'.(FEAT..MELISSA.&.YOUNGMAN)
143,585,806 *0DCEFB107493233C4A2F7849933CF6E4CA5B1D5C Everglade(AllandByallo'sMixedMessagesdub)
143,585,807 *0DC3524C587C3796E59057EEC6827462E4C63C28 EVIGROFE2
143,585,808 *0DCB4714B6FBD7967FF4312B93BC689BC460E88A d4g(q
143,585,809 *0DC471D0D4E2D567CBF54C508C691D166B34DBA8 EX3CR
143,585,810 *0DCEF948B601B6C30AC54C6198B9AA68C5283507 D5O-D
143,585,811 *0DC9D8E4E024791ADE391F8F8DCEA5060B53730C d6cta
143,585,812 *0DCA82680D7EADB3E2A2C6230B9856DD9872D3A4 d86e1
143,585,813 *0DC270A4B6C0A954DD8294AB5D436E392BE5A281 da7ah
143,585,814 *0DCDD49989C48990DFA4195AE89DFECDEB817C28 E[XR
143,585,815 *0DC8D38D6CFE2A808B0E85B3E41E0B7D5F678A16 EYESADJUSTTOTHEDARK
143,585,816 *0DCBFEDE151769A49CABA2ADAC4DF1EB5C9BDE9F dairyque0
143,585,817 *0DC3FAE68064C3CEF5D10F88048D658803F6D974 damienbergener
143,585,818 *0DC6D11560CB6A60CA4B948FD1AA9852B833B23B damnionsing
143,585,819 *0DC0CD4BD5C7E1A0269E3B52EDD1FF4C59EF90BD damongilbreath
143,585,820 *0DC7C109B1600711F851623CDE62CFBF175AECFB dannyened
143,585,821 *0DC72C0C0AAB383C81ACB8BE6D1C1885AE3CA75D [email protected]
143,585,822 *0DC626A52809676F46340205125EFD538151DBB1 DARIUSMOLDREM
143,585,823 *0DC37E3A50640D1925758EAB08D9E461CCF3534F darrenkasky
143,585,824 *0DCE7B2B9F371578E74BF5E70518159536F1EF39 DARRYL.LORDI
143,585,825 *0DC4CCAEB10D91D33B03CBFEC00C6449EE131D37 fbb7
143,585,826 *0DCD9DBA24E6336AD03DC5F5EDC43574075B789F db;o
143,585,827 *0DCC1F4D51E50DABEC13557D89D68F9D01C2DEE1 DDIET
143,585,828 *0DCA49FE251E0FF26FDB090E712D6DD6FB7FDE2C ddjkg
143,585,829 *0DC7C152879D75EA29F3F9F28016143F3BABEF83 feudalismes
143,585,830 *0DCD017895CA8E9E7EAEF5044945F3DB8E66B2FC decimalbroek5
143,585,831 *0DCBD013DC836A2BD0C9366467DB4F0101FD1024 DECRIRO9
143,585,832 *0DCF803956FECE4DAB5137D0BD13B446533F7793 deepfreezing6
143,585,833 *0DCE6D3C9958351EE0E3402417EC55CF56B6A571 defcon69
143,585,834 *0DCF4F9539EDEE6DC9C6737D3B424134F57AEF2B FILIBERTO.SCIULLI
143,585,835 *0DC693765FE5BE37DFC545DA3E33166B9B37CC6E [email protected]
143,585,836 *0DC8216825110EFD1612CFB85EE223FA379DC9E3 DEFIERIO5
143,585,837 *0DC6F9A7D6834C38EB285FFEA85F601F264247CD def wish iii (intro)
143,585,838 *0DCE61209994E198F38E0667B904EC08B2D5022F degcbsw2
143,585,839 *0DCF9F2593BAED081B174BD9A1FEEC048A812BB5 de'gelon
143,585,840 *0DC8AEC74A0269C460C5915E295A89101084AB3D delphinischen
143,585,841 *0DC7BE7D1169F155762729F879025241A30C0325 FLAME1995
143,585,842 *0DC45F21A0BC10148DF91EB616B8B32724C10589 DEMETRIUSTIMM
143,585,843 *0DCB5EE920097040C82CB5D3DD6AE656D4F6E9F7 Demonstrar
143,585,844 *0DC80370ED8331EB544FF891F3EF972889342F26 [email protected]
143,585,845 *0DC5A7D1EE66A2611B81A7592FE71DA8DFB0F14F DENNY.HABECK
143,585,846 *0DC5480FFC856D772588DF260F4BFDD835E4884F DERRICK.EASTWOOD
143,585,847 *0DC707FABD1F8DC4B3BFFEA49744B1FD1DE3665B [email protected]
143,585,848 *0DC1C42BA90CFBF966447B4BCFD19836E63E8B9B [email protected]
143,585,849 *0DCEC2DD4C91EF737DCB73F31F2A7DE1B01676C7 DETHESAURISIONS
143,585,850 *0DCFDA9E4E4B3879F14815EAB67B55DA84F79BDD DEVONPOLFER
143,585,851 *0DC876F2BF40AFB1ECDE60A9DB0A5F41EC043167 dewittnipps
143,585,852 *0DC12718B505B61C8EBBE8888903EC9AFA939336 DEYANNE0
143,585,853 *0DCABF91990E11E064AB10F6B02933146669D4E6 FRUITY-LOOPS-2
143,585,854 *0DC88507024D92EF30368785B1EB9A654BE8F034 f?s
143,585,855 *0DCE077C40819B31605E89DC79ED2A253B84F240 FTJACKSN6
143,585,856 *0DCAB0F2A0A4FD2B40427C8C9E410CB4D6A4DEA7 FUTUREIST.(TYPE.B.MIX)
143,585,857 *0DC736CE84F53E7685FFC60687A765D2FC05A267 [email protected]
143,585,858 *0DC27E55E48A0DAED948553A5800A795E918EF4F G136JUGL
143,585,859 *0DC7A6CD1C360050A7B469AF580315A30FCC4B98 diététiciennes
143,585,860 *0DC0A3D31E1141A887C77BC87CF7BB757476797F GAGNRENT1
143,585,861 *0DC65FD4F4923C0373B4B557B107127A2B50B6A5 diniryg
143,585,862 *0DC2CFE447D3C7EA750900237B8D7CD9C3200371 DINVAKT!(FEAT.THOMASRUSIAK)
143,585,863 *0DCB6A8D396C8F8F5A79ADA88FDCBD551E934656 GAIZKILETZAT
143,585,864 *0DC3F2D61E89782AC7F32E0AD0830BB26D19780F [email protected]@[email protected]
143,585,865 *0DCE5092AE204F0B473A852AF20FF336142BB04E [email protected]
143,585,866 *0DC43EA9407114EFA95E328E7B007967C6D458AA GARLANDBOESHORE
143,585,867 *0DC59C44C36D2A4BAFA61B0C46CC67156EE24169 djc#(
143,585,868 *0DC9C7CF101CE5A3EDC4F9B55CAACC9247B0FCBE Dj(K
143,585,869 *0DC28686DE17B042E38C868840B237F62B6B4337 GARYGODDING
143,585,870 *0DCE5BA1E9F041B5BB8E2E74C5792AECE8CCE527 dka#e
143,585,871 *0DC2BEB4C3685D39BB5E578BE2D26F00031304AD dle7n
143,585,872 *0DCE5E159327E6DAD156D4D0343850072FD24757 Geldgier (CLinez remix)
143,585,873 *0DCAB161FFFB382E4BD3B66EDC1C6D67715F952F dnbfv
143,585,874 *0DC055169BB4929A8DDCC397D04ECE87A215ED82 DNETEIBE7
143,585,875 *0DCD2973FC2D2F453925ADDA6F6601307C64FC02 GEORGEANNE
143,585,876 *0DC58D6EF197D52850D320C272CC574FFDA798F0 ghelderode
143,585,877 *0DC2B1C21A08E5AF31A2C90D15575E49A70BF1ED dolx9
143,585,878 *0DCBF78FC45AE9489BB465435FB71EDC7E240445 DOMINICSTRICKLAN
143,585,879 *0DCBDFAE6A2814E1D8A32E03BD502A921E5652A6 donaldhanna
143,585,880 *0DCD96F1FBD22908280D155DC8894DBD7B6DB2C9 DON'TBREAKMYHEART(TONYMORAN12"MIXSHOWEDIT)
143,585,881 *0DC3862E56B9EFABC23E283FF0DA3E160FD72C76 GISBIR’IN
143,585,882 *0DC7435C5E8C868E5605C5516860AEA17976FEDD giselle-ka
143,585,883 *0DC017788A9AD8C7BD6E6F3257027BA65F6DEB8B GLEN.KUZEMCHAK
143,585,884 *0DC0ED36E9A8071F257DCE2D7F21A0F3DA6F8B57 GLENSTRICKLAND
143,585,885 *0DCC5238938EF6F8573A209849A9D47A5F8D4230 glidedv4
143,585,886 *0DC0821A9F8B62BD03ACAAF46CF064F744587EF2 gnarukihs
143,585,887 *0DC2E3F19AA9A692F4457014598E0CFF83324176 GNIGINEREVTRUUB
143,585,888 *0DCC180BF21D1D5599F90B1CB88958391FDDD3FA d,"&p
143,585,889 *0DC012A4F3E2A95571661C09D05F18F9B5089CDA dp,ka
143,585,890 *0DC4DC52937D8BE6190773A9AB4024518D0CD41B [email protected]
143,585,891 *0DC850BF70F1B41D1E8EFD0AF2FBDDFA314B6EEA GONOBLA$TIDIAL
143,585,892 *0DCC5D7B84EF7CD59B4DC6FC4CEEE4078C32B049 gonzalez8706
143,585,893 *0DCD37019037DCDC9D8DF9F53D38585ED6C444E0 (~_^)~-~-~-d=====q
143,585,894 *0DCA8BA7F8B5D3FB2F5BB4F9C0557D0FFBF667E2 DQ5N%
143,585,895 *0DCFA5D6A009E8995E76260B16BEB08DEACBC94E d"$qg
143,585,896 *0DC804DA1E6AD85C5A326234493F1821A698B8CA GRAHAM846
143,585,897 *0DCD1F63697461FF73859C1F956CA167B3C751D8 GRÅSPURVENE
143,585,898 *0DC1B081BD07B1AF6BCBBA31CEAAF5C957ADD137 DREAMERWHATEVE
143,585,899 *0DC69F69AB89360E2272229533945DA900040C41 GREED/HOLYMONEY(DISC2:GREED/HOLYMONEY)
143,585,900 *0DCD3A6904A8F6BC43A587FBFC8A2AC655F14782 GREENXPOZHER
143,585,901 *0DC9FECAF0B6022638A8EEB1E89B76792E140F16 GREGORIO.PURTLE
143,585,902 *0DC84993D0E1E060A1967E147B4F03E6290B32D0 DR)Q1
143,585,903 *0DC77BF8C2C168B125C1E32CE826C819A3939256 DRUMSAH3
143,585,904 *0DC5FD988A66A81CC3454963A466A2978003AF5F DSL:I
143,585,905 *0DCE33371787870CD6EB6581A858A1BC91AE32BD DSLPH
143,585,906 *0DCC76F23C0416DC18F6533C13D2BA27D9682EA9 DT,JR
143,585,907 *0DC92B15B61F3CE9FCF133A306189F8BE69FE983 DTLG:
143,585,908 *0DC1A869E131184BBDA2E8FD4A7E433652A2D88D DTPF3
143,585,909 *0DC323079137A50A7690753A9B34C3877D73A13B D/TU6
143,585,910 *0DC7AC4A121B30AE0EF099D5D7E05AAA4D50D058 GREINGENING
143,585,911 *0DC12022D32824A9557F9050E6CE764E38763C34 [email protected]
143,585,912 *0DCAB3FD09992B6036C2B13464854D2DF4BC1A04 grw3
143,585,913 *0DC5D57D50F4BD0938303B70C4EFAC141196AAA7 GTRISULO
143,585,914 *0DCCFABB7F071D609446642C0750596B914B0EE7 DUNCAN.MIRAO
143,585,915 *0DCC9AE3942983904F9A65661E193C9204133539 DUSTINTYLOR
143,585,916 *0DCFC899D34727BDD9C49DFB7D86C49C9854F9FC [email protected]
143,585,917 *0DC3C3F76D504A283BCAF76697135952F171CF8E dv!!b
143,585,918 *0DC3983201CF6A0EC20CDE4290BC00EB458BEF90 [email protected]
143,585,919 *0DC5501FDB4B7BFA11FE76631363CE3430E3B9CA DVZU&
143,585,920 *0DC6E4C4ADAEC87933B0556CA63ECFA30A6FDE5B DWAIN.KUNDTZ
143,585,921 *0DC4E7BDC4763EC02F9D0C29B99F53CF460A9200 dwat=
143,585,922 *0DC5F208A4DFAF64482B3DE848A92A37045B0D98 DWIGHTSTROSE
143,585,923 *0DC3877D41436A4981D66E9784BF7A00BAC2C676 dwlwe
143,585,924 *0DC9D9251F13BA0F3FCBA8129FFBD8A7512D3F00 dwwhs
143,585,925 *0DC8A731E0AE676E9F0556D835E9D8644B9E060B GULF-COAST-ROCKIN'
143,585,926 *0DC4789A3CA1058B98292741CE1D2836F1371AB8 E57221
143,585,927 *0DC5E241E7991E5241F7483F2B1A28F77B44084E e82245c42e6d4bd1b30d1dbd3fff34f5
143,585,928 *0DC64FF1EFC8CF25F059607E9404BE431E511C44 guslampey
143,585,929 *0DCD938617281F972B29FDBCFB85A4F5BE18909C eagleabw9
143,585,930 *0DC7C4EB69A461F7CEF9B3698F442F82B3625719 EBU+4
143,585,931 *0DC28CD7B905E6F4A3366654AA7FD5D52B4D41B0 eddypeasnall
143,585,932 *0DC3E4A3A8F359BCB7024BBC7AABF2B3421CF128 EDMOND.WEATHERSPOON
143,585,933 *0DC76A974D43384A0677174215B638F5655A4E73 HANFREZEPTE
143,585,934 *0DC9A3103964C0BC3E7545199DA0336C5CBC9ED2 EDMUND.FRAYNE
143,585,935 *0DCD33D82A25A2CD114D0F3E81897F744FB6D2E5 HANI-DADOU
143,585,936 *0DCEFB432BC7F7C2F6C2EFEB786EA03F6CA9F131 [email protected]
143,585,937 *0DC2DF10ADD6F92E3750EDBE3194852E73DE956A EDWINCHA
143,585,938 *0DC5CF2331562BBB2A77D8A47ED890C5A9A1513F HARLAND.OGIBA
143,585,939 *0DC378C8C6F3DF6B023545A21564FCD855493178 harmònic
143,585,940 *0DC9E74561C7713554198356ED9EB2EE24C6E03D eeqhg
143,585,941 *0DCB2F4CCCEFE79EE9A375DCCDE952858DC6EA62 Hatchet.vetch
143,585,942 *0DC8447A5975924A04A783A96C8655D0D435C08C HÁTRAPILLANTOTTUNK
143,585,943 *0DC9AA48406078185AEB14507412BC4379BB802B EGGOLOOS3
143,585,944 *0DC7F4540619B882295328D8F6725059850DCAA9 egin
143,585,945 *0DC4E12CD22B9B4F57FB3CDD5C3CF79F6D10FFAE EICJQ
143,585,946 *0DCC9E590BEE8B1A9BAA11AC5266D36F226D288D EINE ALPENSINFONIE, OP64 3 DER ANSTIEG
143,585,947 *0DCC54B44946BF0AA955AA101EA55D92EE1E6A82 HAYDEN.BAYNARD
143,585,948 *0DCCAE3313DE51DC26A343DF00E6C108C553A9DF HAYWOOD.SNOOZY
143,585,949 *0DC0596C5463B5AF80062D55761EE0B00B929720 hazelcasper
143,585,950 *0DCFBB6447D8A5259C6A51CBE1A4E8207BDC7FCF EKNZAA
143,585,951 *0DC506896FF9DA7FD540486BF3E821A0A284669F ekt.e
143,585,952 *0DCB4A1064FCAC3B6FC245F7ECFD56F730BADD76 [email protected]
143,585,953 *0DCA6EE167D8A30BB0E63A408C4C1875C236BBBE HECTORALGUIRE
143,585,954 *0DC299E9FB6DFC25DD140EAB42212672752DC57E elfiedaed
143,585,955 *0DC530C2778C605CA740653E6596F1D2F54CE1B9 ELITNEGN0
143,585,956 *0DC94F6170FADCD6B7388F289A61B5244DCBAF21 ellsworthtylwalk
143,585,957 *0DC815A1E807D455A5EAF025F29BF0A98C25FDC9 HENNICHI
143,585,958 *0DC03A5D4F8B85C8F94B7B71C5F0B1B69109F4AB hennie.5.0
143,585,959 *0DC8CC70F64BAF96D2BB031EDBF6FCD7F9675986 HENSENKO9
143,585,960 *0DCCD22FACA1248382924CC0DCAA94C6E5CEB27B ELSOMBRERODETRESPICOS,SUITENO2:DANZADELMOLINERO
143,585,961 *0DC8366DF94E66DBBF1514BF644F7DCAE427D6FE ELVINBALLMER
143,585,962 *0DC444AFB9D1C1216C9EAC5B6B0AAFD6733D08EC here-comes-the-weekend-(c)
143,585,963 *0DCF58E498B5763D9D857039213B42FC7D0CBDEB here's multiple spaces.
143,585,964 *0DC1A942C739A9BC6190ABB9D1F2E2C59C716456 EMCFEY
143,585,965 *0DCDD46B001F5D194B778102830C9195E7F825E5 EMILBARGO
143,585,966 *0DC3CAFEE1C9E718EC33AEF1BDC7F4BC005C926A HG186
143,585,967 *0DC52C2E9065EBF02DBD75711202E777798B7417 HIERMAYR
143,585,968 *0DCA2E9FCA02DD02A4642F0A8FAB3AD4A0C98139 HILLEØDISSÄ
143,585,969 *0DC59F7222E7826564794AB85BDE6A48F8A8446D EMJME
143,585,970 *0DC4DE8878D7AB46F3BD941BC3B31466BE61CC54 ENBEVIO123321
143,585,971 *0DC002667B6C4AF8A0BA37C4E3E50FD472373C06 EndlessRain(SE)
143,585,972 *0DC8AF672089991E3014F854336D643C00127BFD HMTRGLYPH9
143,585,973 *0DC37460823BFA59C91820CC3FDDE3283451BDF7 HOBERTHARGENRADER
143,585,974 *0DCFCFE143DD79FE1B807F96DB67CEC7E6BC182D engelinus
143,585,975 *0DC7CBE4D04D1AA26A567A7CDD64E0B0C8BEA205 HOLOSTOMATOUSES
143,585,976 *0DCF1BC913E58377567860E862E7D7899B1BEB1E HOMER.COSTLOW
143,585,977 *0DC3C2C74C252CAAA0F80ECCBA69A9EFE3CC1D4A EN"QZ
143,585,978 *0DCA7889F7161DDB025D9080517C0534687663AC [email protected]
143,585,979 *0DC0A3B923895302F9E4EB0ADFA509BE65DE5757 ERINTRICE
143,585,980 *0DCEEDE3EE44114A98E996FB7DBE8724B9699ECB ERMIRA SPAHO
143,585,981 *0DC220C09411CC41CC72E5692C2C34A295DA4E5A ernährungsansätzen
143,585,982 *0DCDCFA32FD74B371EFF4B67EC936704FA16730D ERSAFARI2
143,585,983 *0DC9D36BB82BE33B10671EF5B2D2C628F146C8C3 ESAHEXIWABUH
143,585,984 *0DCFFD055DA504C477B84418DDD0535AD5383E5F ESCFK
143,585,985 *0DCE5077047F2C34D86843B0AAE39F28DD9CA767 esi5q
143,585,986 *0DCB572796821567AE9BB2B7151A8D652BD9E94D ESPLENIO6
143,585,987 *0DCDFE9A9C038FC1DF0D64A927F42D00A620E1CE ESTF
143,585,988 *0DC1A6BF39793F64B13ACAE505458F067A17CC55 ESULA.
143,585,989 *0DC5ECC87EBCDEC5B8E84748704EB1A3979C5FC1 HYMANTIMMERMAN
143,585,990 *0DCD54114E86D0BE826AE4E99BBB637CF9299385 ethanspindel
143,585,991 *0DCFED63AC208D6F83AE35CB1228F9CB0241DBBC ETR:6
143,585,992 *0DC4452B0F4E896FCF9B9E5213B81F9614FC252C etuunimi
143,585,993 *0DCAF6F38C48276B37C86119A53ED89669C7238F iamraistlin3
143,585,994 *0DCEEBC80028EC44F2F77D022BE19BC45A239828 IAMSNOWBALL38
143,585,995 *0DC2E3173AAEAB696CCCE240B6FAD363334C8859 evangeline362
143,585,996 *0DC8A46B0B4B57B9DB6A060BA17DD9BE0C5C2E42 IANROOTH
143,585,997 *0DCA4219C3F66743BE372A8785DB43E7F8DD90AA EVELYN-VENTIC
143,585,998 *0DCFBDCD8413F17C9A41C382C6060E6B707E753C EVERYPARTYHASAWINNERANDALOSER(FEAT.PREFUSE73)
143,585,999 *0DCAC3752E954AC3294A4FF5D0B478963D0B4D83 ibnu.masud
143,586,000 *0DC5E27990780D35B6E648B473EFBF6799F60A3B ibrahim-tofiq
143,586,001 *0DCEA9C00E9DC9EDF7B14D75212359B000FF3E38 EVYPUVESE1
143,586,002 *0DCF99CAB2D2F68AC85906B0658AC9693F31A788 EZRA.GAITO
143,586,003 *0DC83972B04F68CED8EECEFA3CBEFE43E6EAADCB FABLEALEX
143,586,004 *0DC388FB2F5FD26F84081723BF2AD8D692829A8A FAMILYHISTORYCASESTUDY
143,586,005 *0DCAF1D744AA96CBB5C12C4316BB6F6C6BA78FD3 IKEHIKER
143,586,006 *0DCAC968634E0FFC81A51CDDCD13DAA1FDDE5862 FERENDI2
143,586,007 *0DC6027553FD904E87A981E153CB0906AA7935C6 fitri
143,586,008 *0DC3654279C144CAFCD7048534AC38B96776C31B fk_`
143,586,009 *0DCE1BD11266799BAF917873184B147785620936 florenciohosteller
143,586,010 *0DC9CFF7033EBE1806BE218B537C274A931A9786 IKIYSTÄVÄKSESI
143,586,011 *0DCB229473588DAF910CD9100DE36AB0BDEED9BF [email protected]
143,586,012 *0DC54D37CB61BABC610FBB9EB0454E585B1092F2 FORSIKRINGER2
143,586,013 *0DC57C8A70A3E48CC80FB9383BEE889D41F89009 ilovecoco92
143,586,014 *0DC45EA08F6D1CB778174209F7D018E634EEC9AF iloveMD
143,586,015 *0DC1E3204C1BE6CD18FF5E6505BE180E2A320175 ILOVESPONGEBOB2005
143,586,016 *0DC986C8E5F05698EA76EF895EB6F328599FCC26 ILRESSUA1
143,586,017 *0DC388A74C53F1B394D154813B7B73D87411A579 FRAMBOZESTRUIK1
143,586,018 *0DC0E62B158D14588C57F80C49D31F05805BD31B ILUVFISHHEAD18
143,586,019 *0DC3C740AC20AD543570661F288B393BC158EE95 ILUVGRAPHIC76
143,586,020 *0DC3FFDA655E0888EDE72EE53478A4AD712393CB iluvjeanne80
143,586,021 *0DC4BED2A3E6EE7176B3900F526C390AD33C6ACF franklinpenfold
143,586,022 *0DCD65EA0FF76E136F2F3EEF1A550C9EA2814EE3 ILUVNICARAO666
143,586,023 *0DCD3A051DA7CDD56BADECE72B7B348DA64D9F43 freddieabernatha
143,586,024 *0DC7646F5939725BF3FFEB154A7393AE7AC97898 FREDRIC.PELLECCHIA
143,586,025 *0DCD13ADA5C6EC2AB0F42F0E71CDBDF94F4F0763 FREIGEARBEITET
143,586,026 *0DC5ED56274C4091A2258E89990B7D381750C4A6 FRIDOMSBREVET
143,586,027 *0DC38E009693096BFD2BE1B344B4046BAE50E46D fromont9
143,586,028 *0DC6C0A51E639DFF0678193893FCAD54EA114D69 [email protected]
143,586,029 *0DCE6CD8A722966009A0B4D2E8B2F818DB9EFB22 imperialism's
143,586,030 *0DC343A6C5CD652887C3840B6EECDBD524A6D2BB FULLGJDS0
143,586,031 *0DC76AEC1BA9A7C24E06AB1F619C063ECDD8F659 infoqube
143,586,032 *0DCE101C57D8CED63C01CB997D36C299E95D4A34 innerself(instrumental)
143,586,033 *0DC14534BBDA0E102D34F230613CF1807F08A585 INNOCBSW7
143,586,034 *0DC6D41794078DAF6CC7D497CC001BDC46EEAA1F GAIXOTZEAREKIN
143,586,035 *0DCCAEBBED9F3527BA1B3B625F538CD778ACBF5D GALE.AKE
143,586,036 *0DCF79860F834096CA2980C5CC4D81EC76C7157C GALWAYSP9
143,586,037 *0DC669234CD99E74F917ACB40EB2BBACFEFCAF4B in;x
143,586,038 *0DC836ECF27EDF0AE556FF0B1CF79AC8C1D738DC IOMBIEBA3
143,586,039 *0DC378BCBC58AC381CF36CC98D253704E8B51A78 IPRANKA
143,586,040 *0DC0FE7F6009CEF4E62E463F0A0BF1547239216C irwinhribar
143,586,041 *0DC2594AFC071B08215F722086D871B2462344B5 isattiah2
143,586,042 *0DC195F7261FF2371960532D37A0E4D5E42A0582 ISO11179
143,586,043 *0DC69DDC6EAA1595DC4C344D9FD0E2499CAA1495 issacrenz
143,586,044 *0DC51488030E9F07D24901BAE53B0605F307B883 gefassstamm
143,586,045 *0DC3CCD7D8E858C4A55EBE5B0052C716EDF15250 GENAREESE
143,586,046 *0DCBAD8D89259AAE1EB38940BF589FD3698AE627 ittehgap
143,586,047 *0DC2EDD96B46E6D30A281A07C184ADA2DB8CF776 IZARES,CARLESBENAVENT&D
143,586,048 *0DC52D5594A838DB218D696DBD0F4A24936A40D6 J131388
143,586,049 *0DC7F9BB1A219AF3F94890B275D90C361B481BA4 GEORGEANNE
143,586,050 *0DC58D6EF197D52850D320C272CC574FFDA798F0 gigi.liongson
143,586,051 *0DC4A46E0A5989B1B787B0D22535A936D11F49FB jancasuse
143,586,052 *0DC37FADBFCCB9471001E3752B15525CBC8377DD JANEGGER1
143,586,053 *0DC810B85971DBBC4709D13EE4B21F026A8313C9 janicelclark
143,586,054 *0DC32B5A0063D12B0CCFB23FB14AD7EE1216E313 GIOF2626
143,586,055 *0DC1E6D002F3CCA301E07A2612ED47436D70D7C4 JARODROBUSTO
143,586,056 *0DC228355DA169B4BF57D2ED951092B2A27A5467 giuseppeabdullah
143,586,057 *0DC3EEB41D9B134260F76ACA2EA07837A8F57DC1 [email protected][email protected]+!0N
143,586,058 *0DCA67A597A591A4A9B509061D3FC1E8695729A2 JAYE-LANIGAN
143,586,059 *0DC2E4B822D082644D4B5332CAAECD552D85E1D6 GLORIANA4YOU
143,586,060 *0DC06237571679F3898438EE4E683DC4F5B37942 JAYSON.TICKNER
143,586,061 *0DC43D38D780AE9C0AC6926F65E0F3D2A5F8F972 JCORI
143,586,062 *0DCD8890BA7FFD612459729D42F226DF95D3B7D6 GOING-HOME...
143,586,063 *0DC972D92AEB1F1B3DD876D9BD35E0F372CE312B jean.khoueiry
143,586,064 *0DC353624B4D48920DDBE46E4FFF972D2A358B15 JEFFEREYLONGWELL
143,586,065 *0DC7F8CBCB5238C57D6D5B3909AAB0419CA9A535 JEFFREYWATHEN
143,586,066 *0DC7AB41750EE48A3337622AD36CD31CC4E63F72 JENGIL
143,586,067 *0DCDAA8EC36DAFD34EF4A9228FC37807B0FE54D6 GRADY.JANEY
143,586,068 *0DCCD7BA12AFD77E9B0981E0B0108BF6A7C4A957 GRALLAKIAS
143,586,069 *0DC8F70F6EE8AE8BC6274DA48325069D2AFA1DA2 [email protected]
143,586,070 *0DC6C80D78C617C6486F1665BCCA51E212C833E8 JEROME.SOTOMAYER
143,586,071 *0DC7C330CBFBA1BB7083E71DADE1383FC96D3DA3 JERROLDANDRICH
143,586,072 *0DC37081AF5262F686E297CC17EBDD34C36BACB5 JERRY.KUZIA
143,586,073 *0DC876EA9693B0AD1DCC516D33A44622A5C6F4DB granvillemilosevic
143,586,074 *0DCAEA0CC618455FBB3CB4251EFC5E29F9B52D3D jessemeagher
143,586,075 *0DCF34134FC332A1215D4E2D2AC3B9F56A0C6C4D jesskornhauser
143,586,076 *0DCA68D70B6088B60278EC7C6F4EE4F04D51B471 [email protected]
143,586,077 *0DCD9EBCF669AAD1DE8AA719C9CB944CC6C415E6 GRODUK
143,586,078 *0DC040524F89FC49218593A35E257E735745ACCE [email protected]
143,586,079 *0DC54ED4825D0047C1A687C12E47CE88BC3F9B48 JJDELAFORET
143,586,080 *0DC6F718A7DCD78A8FD7D1B3A98DC12A8AA4D069 jlqr
143,586,081 *0DCE08D10CAADE57C9076F49728C45D1729018F9 JOANNAKLINE
143,586,082 *0DC349778495E1DE8C8DBA9D941FD283761C2B48 [email protected]
143,586,083 *0DC72E1163B7E799018F53F327E8C99892925539 guyhullender
143,586,084 *0DCD80DB9CC9A523411DBB7C38360E5047074524 JOEKAMPF
143,586,085 *0DCA7AFA2F9DBDE02CD36BF55A2C7AB72425FF7B joellynne
143,586,086 *0DC58C611122DDA6A3703DF2F0AC6AB0376A5055 JOELSAVILLA
143,586,087 *0DC46BC4B40509BAE6453CEF2544B08313D2BB52 GYOFNOQMXKFDD
143,586,088 *0DC29987CD97193DC94A5159A399C2A22E3F351C H|^*
143,586,089 *0DC8971DB259F737024C3AD19399C826C7B86691 hal9000warren
143,586,090 *0DC491DEE79C952349855B94CAADECEE90E668E6 jordanke
143,586,091 *0DC5D79EFED39B6B5BEE9F9D08AB8F21FA39D85E halfsagi2
143,586,092 *0DC948571098ECDD97260C5505BB6A0A4D80D043 JOSUE.GARDON
143,586,093 *0DCA4CAFB70002D036F6A1EA94FC7ECD387CB5F4 josuegrotts
143,586,094 *0DC0F6F429357B99E70D4DF66546866E83861F78 JRKLNDRS1
143,586,095 *0DC72AD5D4D90FD144785915AE36D1DBC8D47FA8 jtw3
143,586,096 *0DC33FE0CF0A969C190A3B577047305E70693003 JUAN.OELSCHLAGER
143,586,097 *0DC1377D3A85A632F3FE2860190606F4BCF8E72A JUDSON.BATLEY
143,586,098 *0DC5A953C436F7CFA9BF98D16A8629AF3EF74D6E JULIANTAMA
143,586,099 *0DC810F194F078B78E063DE3D7B474B4983FB014 HASASIA
143,586,100 *0DC4500D259FBA7A1D2A7CCA39E9450B97768E95 JULIE.TOURANGEAU
143,586,101 *0DC9D1FC31FBBD14A70C43C7B85F66D1F81DF95B jump1995
143,586,102 *0DC3EC41191262C78FDFB72E37E219229EDA8B9A JUMP-CUTZ,-VOLUME-FIVE
143,586,103 *0DCB9C7113A6C79E66F58AC816F38F3782CD5786 HAYDENWINGEIER
143,586,104 *0DCAE3A80DFEAE639B3AC855AD5E93FAD80AF5B6 [email protected]rlcom
143,586,105 *0DC6E2971095FD68782ACB58A960915318CFF1C7 jyoti.dadwal
143,586,106 *0DCD27CB00B04EE1C4A4D3122C970FCDF84ADDB3 hcsinill6
143,586,107 *0DCED2127E74225AFBB97190D3C807FE6612A639 heathmaassen
143,586,108 *0DC96558DAC777878A084F6597252F5E26826B4E KAɪˈɹɜːDƷƏɹI
143,586,109 *0DC8AEBBF9033049E4306033F838C13DC49722D4 kampfeszeiten
143,586,110 *0DC6009166770050CB4A195ACF2865137CC291A3 kanaloupou
143,586,111 *0DC1952C29D4C46395048A35816606BBD974F7F8 KANHERI4
143,586,112 *0DCE8CADA8D299576BD65F908A6F2D7B965AFDF8 karatasin
143,586,113 *0DCABE2A57CEE6F1E8F8CE09886AB147D1A79C06 KAREEM.LAFORCE
143,586,114 *0DCFC872FD76BF3FADAF93826CE7E185346CFEC5 HERDLIKE.
143,586,115 *0DC5775FBB423F6A820AE92509F9C1B1A8385E63 karollucas
143,586,116 *0DCB7AB12E486617F432A22C93566F7C45DFFB29 KATIPERI
143,586,117 *0DC6B44AD1F0C75421E573CBE0478BD0D8F6B290 herscheltenneson
143,586,118 *0DCB96F1F6B3BC2BAC7B212C062589F05C91C5EE KAUHANEVALLA
143,586,119 *0DC6EA43DBB498DF6D36C9046760AAAF4A454226 KAYLA.CUBA
143,586,120 *0DC590872B1C5A5EDF2A03C1BC39BA89F6A7AD0D kaylapaige
143,586,121 *0DC1613A6680CEA1A052C82A1A0377DBBD61F1A8 [email protected]
143,586,122 *0DCB3D31F24F2156CE57C04DC7A0DB479D722F74 KEEP OFF THE GRASS
143,586,123 *0DCAAB81527028E3939434FA69486CFE6965B7B4 KEKULE123
143,586,124 *0DC5F4F4D7E32AB7A36DC944AE659C1BFCCC08F9 KELSONWILLIAMS
143,586,125 *0DC8C3BE601F5CF4EAC4E0975084BEF11D499BFE KENDALLGLOWINSKI
143,586,126 *0DCCE519050634DEE00CAAD4C5BFCB0CE95C1DB1 KENETH.ROKOSZ
143,586,127 *0DCFB3A4AD055050020D751F555039EE1BE59E47 kermithollingshed
143,586,128 *0DC1377C71AC74426DDC93FDA89C3D59640D47BE HILARIO.TURSO
143,586,129 *0DC7B802B84D2D1F648C31065E3826A2E50907D8 HIMANSHU SEHRA
143,586,130 *0DCB200BF9B255BB2BFD266EE68E1EE281200AD5 HIMESRA
143,586,131 *0DCAE48991E7208763DF1F281546F267B504280C KIRK.MONTUORI
143,586,132 *0DC28D09C8B4E61B7819608858309FF16D3D72BB kiss-my-wami-2002-(disc-1)
143,586,133 *0DC9BFDC96DBC46DD3065FE902D1F900EE0039FF [email protected]
143,586,134 *0DC86DC238141CA3EAB6675C77D813D5DF2821BB KLINGERSAMMLUNG
143,586,135 *0DC20A00D0B99F24868F1748FFA01D612512ECF7 KLMTOESTELLEN
143,586,136 *0DC2BEA3B07E6CB01FC6FF2224CFF1850036705F KLOMPAS0
143,586,137 *0DC4BA244AD0AAF78D140EC4C4077C058606EFD7 KNOTETET
143,586,138 *0DC3E705B4EC48F0D596D0C0E4C4B60285FEC92A KONSTNÄRSSAMHÄLLET
143,586,139 *0DC955CB873F059DE6849D5C2CE97EF514FCF67A koularuv
143,586,140 *0DC29A2BBD913C9B0751E4F326C9EE06BAE1E26C KRAIG.MORRELL
143,586,141 *0DC89DEE0C6037C4561B1F6ABF9E5425334498A4 KRYSTYNAQ
143,586,142 *0DCC59A5DAE6E8BE40F7BBCA0A4DA4BAA9E5C644 Hosannabbs
143,586,143 *0DCC01B15314E5784F058633497CEC4B7FB56132 KUBWUMUREMYI
143,586,144 *0DCAECD2BC04B852AF59191959099E5A6988937F HOSSENABDALLA
143,586,145 *0DC34F7F6FB744EBEF4F8319750F1704003A0E79 KULKEUTUVIA
143,586,146 *0DCFB94121170052F8DB5A26EA09CF194E46C6D0 KULTAHIUTEINA
143,586,147 *0DC7B5ECE549EFAE5D3649AE87F660F32C637A2E kurtulmamişim
143,586,148 *0DCBB1F795645D373E9DA938358DE601B6714DAC HOYT.WHITTENBERG
143,586,149 *0DC876ECD24F6740D599683169BB7C2DAE0FE4AE HPAYUIEPT
143,586,150 *0DC8A90BF64C02FD27EE8BCF57C522432648EC5C KWHAYA
143,586,151 *0DCE6DA98D670087486C1BACF73BE69E2FE858EC L00S3-MAN
143,586,152 *0DC1E50E52CAACE475B6810CA342E537DA6493F3 LÄÄKINTÄLAITTEET
143,586,153 *0DC42FF0A4EDC53FCAFE610E01491F693D5D15BF LABIAED
143,586,154 *0DC0EC33A35646A1232A38A20530D405E13B7F17 [email protected]
143,586,155 *0DC20E59E3ABC8B8DC8550CC525400B8BFF2EC38 [email protected]
143,586,156 *0DC08F718113CE7719E16307DD60915FD822AD9A LAMONT.PERLSON
143,586,157 *0DCE955DA1772146191015DD07E4FB434B618E5D LAMONT.TURNNER
143,586,158 *0DC265300742D226AA37BE84EB92910B8935E4BB LAMTSANG
143,586,159 *0DCC04D1B0CFE5E90BDF1CEB982991C31CB8BAFE HUBERTENRIGHT
143,586,160 *0DC00C733C477C36E9F0E051FFC523E5EC4B7374 LANE.SCHNABEL
143,586,161 *0DCDC0E197E73220914E72578863435E836761F8 LANESCO
143,586,162 *0DC3D6BEFD5C5F3309E651E0CA109FFB6B2D7D36 lannyhoffis
143,586,163 *0DCC33B555FF95BA67AF603775A130702D8C7B75 LARRY.GALLEHER
143,586,164 *0DC5419444B7613F118972DA341ED26CC1654CCA HUNTER-BRACY
143,586,165 *0DC8389430FD2744B41271FADEB0FE577C929EA2 »HVIS
143,586,166 *0DCF46B602E7B3D335600448FE8EF818E152D579 HYDERABADPHARMACOSCASHONSWINEFLUFEVER
143,586,167 *0DC279C608DE646B535C8C947824A380114A807B lawrencegreek
143,586,168 *0DC0016D1551735E33DE876B86EEADC51EF2B44B LAZARO.REUHL
143,586,169 *0DCA1FAC668EE866832D7818F8CB6FDC157636BA IAMLOVELY16
143,586,170 *0DCA8A215F6968FD65D2C8AD8B2A9E170A967DDB IAMMOUNTAIN42
143,586,171 *0DC4FC37024C79FF0CFC4251216EDA757225159D LEGEN6
143,586,172 *0DC8D69248EC074C3FC367B521F048F5EA6B7450 [email protected]
143,586,173 *0DC2497FAF4C32C9DCB83481DF39C29724394F2E LEIF.PETRILLI
143,586,174 *0DC3B480A93E10A0B35292B018946A21D5866FB8 [email protected]
143,586,175 *0DCA15103120439E7FFC010CA448E7C34087F95C IBERLINGUETTE
143,586,176 *0DCD1DEF4F67AAA2930284B3B7F1384A7BCBE4BB IB-TUNDA-END-VABALT
143,586,177 *0DC14D0D2EDF75B91AC2E64F292D891259B44D85 LEONARDCOURNOYER
143,586,178 *0DCC57A06B3FE42FAA5BEC6BFE1D4DAA39853440 LEONARDVOORHIS
143,586,179 *0DC4EE6AC07F7EA9C4512F3A7A17D7A042BCCA66 let's.sing.about.niggers
143,586,180 *0DC5DB6B29632BE4F13900CA53EBE6EE5418487F levano08
143,586,181 *0DCB3D052BA3A72D48B7AD4635507180CF6245FE LEVIJEVOM
143,586,182 *0DC4D90BA0F0BC73B04FEC47E1A0A068531EF22E idioma-yid
143,586,183 *0DCF589F3594D5FE300D76A50B9292AE8643533B /lib/modules/263224server/kernel/net/netfilter/xt_conntrackko
143,586,184 *0DC131FB851208405822085F12EF527C34F235AA [email protected]
143,586,185 *0DC71D41839D6484EF59FD7BA102A08A8EA91B9A LIKE-FLOWERS-AT-NIGHT
143,586,186 *0DC55B5F8D92F1B1CC5D8E52A318EC95B076CFE8 [email protected]
143,586,187 *0DC74255B2EFD9BCC81D51D2A1BBB6CD0E387F3C LILYELSACRIS
143,586,188 *0DC19DD80AFD98C6067A2FCB930E4D06641E6B25 linawati-nasrif
143,586,189 *0DCC9F3A76057AB3B931F50F7C8B60074160D40F [email protected]
143,586,190 *0DC66F0ADBBDF0D5D4183A83C148DEF02C4BED35 links91i93stylebac
143,586,191 *0DC8581E43A1FDEEF4F1A65E5558098A7DBF500F ILIKLIG
143,586,192 *0DC3B64CCAA8B7ECFF4BE2DC1090E978026C447F lithotrity1
143,586,193 *0DC3F87C8DAC1B964AC2901306EA2ADD57B44F4A [email protected]
143,586,194 *0DCF29A51DDD966B15C42A642B6451EE3CAD7B27 .LOCOTORP.DLO.EHT.ESU.OT.HSR
143,586,195 *0DC9B86D24B4948F7FF94CD76B70999072425CEF [email protected]
143,586,196 *0DC89855E55C4C67163370DA9DDCDAECD3B9F955 LONG.LEBLANE
143,586,197 *0DC15839C23CAC801085943F6D97C75472873243 lorihightower
143,586,198 *0DCF6F0218B9D6528CF11500728F30B72CECEA30 LOWELLPERNEY
143,586,199 *0DC1E825D84700F00A284CD49B24EA99FF079A30 LOYDMCQUEENY
143,586,200 *0DCF2E6EA14528E9DFF65193AD43C4C02A74CFDE L!QO
143,586,201 *0DC87AFE99F746A7324CA88588DF93FB0E3FB520 LSOULSHIFTER
143,586,202 *0DC1D221308FA8B45006F84CFFE25D3675E5E2E6 ilovetigers59
143,586,203 *0DC77D7A98D8A9EEEC34360EE634EC4E5BCC78D2 ILOVEWILLOW1992
143,586,204 *0DC2364AF05A0D20F7EBE486A686929D267B7C5F ILUVACTIVE73
143,586,205 *0DC00022BFB763ABE13726F8FCAB3193DDE799AD LYD3RN3$
143,586,206 *0DCAA9E679431C8C4E2A90FBC5013E676634C656 IMAGEGANTERSCHWIL
143,586,207 *0DC69A59DD966B06E703A685C1B95395E4DD5254 imissjewel
143,586,208 *0DC6FD7B4118E4E4454B919B9D4B34B0AA424B5F MAFRIENTI
143,586,209 *0DC9F884C730F8CDDEF2E1E35F8ADC87099F44A7 majeur/Dmajor/D-durBWV1012:VGavoteI&II
143,586,210 *0DCB172E066D0C45E4EA0453DBDD55E49BEB2996 Inoffizielle.Themamelodie.f
143,586,211 *0DCE89D8F34D199C7F58CD14454C2EBFA6BF28B9 [email protected]
143,586,212 *0DC37C554551785C992E198F9705081E0DEF6092 INTERLUDE ANTISOCIAL 05 (FEAT. OLIVIER BESANCENOT)
143,586,213 *0DC58EA14D43E880BA40360EB0036B1E48CD9145 INTERNAL_LINKS
143,586,214 *0DC9D590D14F62C4ABD84EAADB7242ADA562595E intimidateurs?
143,586,215 *0DC76A88248B6A67249D473303D321A5F5AA3C2F MANUALARTIAGA
143,586,216 *0DC71CD2CCEFE1699CFD7D314F5DC27EB0365B8B maoz
143,586,217 *0DC6177D5267528890E579DEA16F0F4CD759D625 ipmadrof3
143,586,218 *0DC6E77E5017C5E78D3AF4E4BC0BA14A318C6B3E iq}/
143,586,219 *0DC968727336A8F5CF8A96E3AEB229609E0DB722 MARGARITONAZELROD
143,586,220 *0DCFFAF678B9B7D2247A58F2BD8346E5F0D66F4F MARIE.ALCOCK
143,586,221 *0DCE7C1933FF0EE122E3BA47BA59C7B841530370 IRWIN.LUDDY
143,586,222 *0DCB2A9201FE486A55D0F183BE956B7CA8513791 [email protected]
143,586,223 *0DC3D48584842EEB3A512C3BF06535C3BD4A4F02 marlinswearinger
143,586,224 *0DC03FA1A66E5B88078C05EFF7AC6EABCD5DA0CA isiahesker
143,586,225 *0DC37F1E163390C0E1905906D1DD3A11390E7A2D marquisiot
143,586,226 *0DCC7C03F4E8EBFF5C910B5254063741B24203D2 ISSAC.MELLADY
143,586,227 *0DC316F99A3C3A4F110A34DD87D7E4AFD006DAB4 ist>
143,586,228 *0DC58218C91B75ADA5808E369DD53D4287416580 Istaaloonak-1
143,586,229 *0DC53A868373DE07C3B8297F19CAFCB2FBB7D0A1 ISTORICHESKO
143,586,230 *0DCEBE6203487504D091F43C299C61532EBD5575 Martins-Correa
143,586,231 *0DC8B5460FD1873134D66DB5D8F5218DD75C4207 ivan313
143,586,232 *0DC26B0224B68B1D9F4B579E117B257D1A95C161 MATTHEW.TOLENTINO
143,586,233 *0DC05F91DEBF5B027092E1332A307EE2270F263F MAX.BUCZEK
143,586,234 *0DC73773E5A29F16B83F9D04D7AC23C038CB334D [email protected]
143,586,235 *0DC672F1955A45C4ECD126FBE690566D77118E1A MAXWELL.MCCALLEN
143,586,236 *0DCC6B8C97329563BDCFF35DC4F62CEC670057DF MCKINLEY.ZANAYED
143,586,237 *0DC224A97DC794A1D79C4C0E2FB8BE093D844D19 JAMELBRECKINRIDGE
143,586,238 *0DCC3A7493CF8C7BFEFFA1F97B2D1DBD5867D832 mcues
143,586,239 *0DC6E3439A4A39A8C9A44BF35389C343FE214DAE [email protected]
143,586,240 *0DCB8191192714817BD5C153F4E3810A8BC8DA4F meireel15/
143,586,241 *0DC59A23A25D40206AFBAFC5DF49709CCC1B993E MELYER
143,586,242 *0DC37065BD1C06EC69A1DDA79C43195EFDA13E91 jasonplaskett
143,586,243 *0DC2EDEB6242128862190476A69DD9D8B63C40E7 JEAN.WEINGER
143,586,244 *0DC191C5B0C95068901AF2C95F1C63BA4978A1FC MI$B3$7OW$
143,586,245 *0DC37A14BD97F24F191B7AE5AF939BBDCA480397 JEFFERY.FIDO
143,586,246 *0DC2A46DE666981D0AFFF8FEC26FEA89194BE539 MICHALESIMI
143,586,247 *0DCA12C2D398E38B73328CB736D9ABEACFDA581A JEFFRY.DIMPERIO
143,586,248 *0DC6D25B9F5B828C6EF8095D3896A80C6CA05D8C JEFF SINCLAIR
143,586,249 *0DC4CCCF4A85561DF34AC0A7C39D558C41664576 MIDNIGHT|
143,586,250 *0DCEF2413DC051C28990C811E69C5AED1D39DFB3 JESSE GWYN
143,586,251 *0DCBD0A512B59988CE0D5F8BFA28C10BDBEEDFE5 JESSE.STURKIE
143,586,252 *0DC8D398D267CB0A9C46A759D89C4E254E8A850C jessica.hiraldo
143,586,253 *0DC0F0743AD373027C37F7637DA3B4F1D267C2BB MIRISIA1
143,586,254 *0DC41CB3F862CCD92081EDE5781F83F3846FD23F MITCHEL.LEGIER
143,586,255 *0DCA8410D7C384397FF9D0822C2473AB15BB936F mit.meinem.leeren.glas
143,586,256 *0DCE383439CFE296D8C03FFC5686AB8FD0BD3E57 MJ{
143,586,257 *0DC021DFD938489BCB610ABA1BAB0116FD72E534 [email protected]
143,586,258 *0DC0DB1D0294E47369B1EFDDDBF74CFB9D29A8EB MOHAMEDBURDGE
143,586,259 *0DCE3AF97BCDCE22DBE73781480575EA83E46FA8 jimvillella
143,586,260 *0DCE1DDE3A0748227E853BC6358DE91A727CC1DC MOMSBUG
143,586,261 *0DCF8BFCFABAF48A492456F5A438F8E3B331AB18 MONTEGNA
143,586,262 *0DC597B07720EDDAA0C63C825D013844ACD33239 JMODOVSKY
143,586,263 *0DCA691A7ABF10C4B5697BF8FA40F7D85BDB5547 Moon.Over.Rio.Grande
143,586,264 *0DCE961659B8876FA43F01E7D36991FC927D79DD JOANKOMLOS
143,586,265 *0DC55F4A4DE8FA85A9BAAA9FC2B21728D6C6EC3B JOEL.LAKATOS
143,586,266 *0DC897B3204EE01565E499348033A13F6219B2CF JOEL.VAUTER
143,586,267 *0DC55F3FCD72AFFB119CE2DF805C8547BC873E68 MOTHER72
143,586,268 *0DC1D84DD5B3B255D52D034B9377AD60AE8F41C5 johnieperuzzi
143,586,269 *0DC247EE95DD7947C41758B35BBB1E3750608CC1 [email protected]
143,586,270 *0DCBAC360EF558D4553F7DC88122AC1C35F3D560 múltbeli
143,586,271 *0DC2F4484B2DC0C303CB89348DB8EF92642172B9 JORDANSHELLEY
143,586,272 *0DCF72CF5C962B182623C5017061511346D1EB7A museodiocesanopalencia1
143,586,273 *0DC7B0128BDDD80B0225B2294CF29C5864E0C411 MUSKAAN CHOUDHARY
143,586,274 *0DCDA5B829484EA966A53C7A79C768AB969B3E9C MYJULIA275
143,586,275 *0DC6184749235FD7E8823C6BE9C5A964654A0D2F JOYCE.MCCANN
143,586,276 *0DC8D497EFADACD89D1D0512C672265A29E2CED3 JSENIKN7
143,586,277 *0DC9EEF42C519FD5B88DF51A6BE4AAC196BD435B JTWINKIE
143,586,278 *0DC8B6896B99CD38AFE021727463E2F8138A399F JU5TATH0UGHT
143,586,279 *0DC4EA47103BC6E15ABB6D6A1ED699A6FD4982C5 n130=dcc send:/dcc send $$*
143,586,280 *0DC9C004C183F11845174B029AF2F1D722836D4C julescalix
143,586,281 *0DC6A284BB365A96C109889B0EB561FF22D7B51D !N73RM!N48L3
143,586,282 *0DC0089D58E7F15CE31F4BC06FEF1D4A5005CE1B namgoo
143,586,283 *0DC725E261BD65BB1EE1522740A0B063D3D7005D NAMRATA-PATEL
143,586,284 *0DCB5E8B2DE4D4CE9BD7D159F41DC4682B6FBAE4 K0PS
143,586,285 *0DC642E71F7969E079E88345A823D2E61A0B8543 NARIEFELQ
143,586,286 *0DCD78070D8A66166632987036505BB0CDEC5C15 NATHANIEL.MENSI
143,586,287 *0DCB6A87989DB9D608375FD013A5E9677B7B24DE [email protected]
143,586,288 *0DC30E4F602595625FBCD3C420F0F6BE53FAD896 KAPITEL150
143,586,289 *0DC8B856DE2B1500FAEC506B1DEFB889D4737C1E [email protected]
143,586,290 *0DCEAC982463B71347ED77AF6295D62905CFDCF7 KARRENVRACHTEN
143,586,291 *0DC1BAAF2AB3B85D9FDD7344B60FB09BF7F2C0FD kaseymccarver
143,586,292 *0DC3AF145F350BB3AA5D0B15AD833348E277D528 kathleengueta
143,586,293 *0DC308C1E965ED2D93CF014F0E9CA44424537112 katie.wisnewski
143,586,294 *0DC85D61B43A7126124DC7A7C280216D70CF5ED9 kdxp
143,586,295 *0DC6F5ADB8B948C0AAE653ABDE4A2766D3E90A51 neurosyphilis2
143,586,296 *0DCC242756D31BFCFFF19CB1BDC6B3D4FE9BB11F ngeber
143,586,297 *0DCB33B794626C87419CDA4BDC57FC3C6AAF217F KEMBALIB
143,586,298 *0DCD2DA297EFAC9ED33D16971847B7EA0227E269 kenesha.alexander
143,586,299 *0DCC67D7E503A6EF42E0C649940EB9E8C16A672B NICHOLEGRIEGO
143,586,300 *0DC2550AD4EDEC2AB44C1A236473CED9336CF420 NITSIRYMING
143,586,301 *0DCAAA3CF68BAC5BBDBF7DC135CAB44E5C4BB432 kiethmetelko
143,586,302 *0DCB21ECCD048E47EF4797B36B4308AB77B03140 kinno.angel
143,586,303 *0DCF457D3223FB16017338E3BC7C1C4CF1F48222 NOELSEALANDER
143,586,304 *0DC9F6D210938962D778ECB99494620E2C610F18 NOLANMANTLE
143,586,305 *0DC3BE07E563AF683C39576F36C341609C859E9A nonretal1
143,586,306 *0DCB707CED9E9543043897371F69DD41F1392B78 NOOMIEP
143,586,307 *0DC719D0E20D55350389CAE8CB3D1423553529A7 NOOR.AGHA.HAMDARD
143,586,308 *0DCE88BAA187B3663C78A6F45EFFE79B77C4269F NORA-TAMIMI
143,586,309 *0DCB50E87517CE30502F76CAECBB957F2798A331 KLOVING!
143,586,310 *0DC405F46525933509C87541A584CA5BD87916D1 km,u
143,586,311 *0DCDF34EE6C98BD6DC86C42A9377585E03048C19 NPETRENA
143,586,312 *0DC31B8C541B60B92EDFB6AFF8CB68CC63357D00 NRECNEWS1
143,586,313 *0DC7453E005F95092D093B8CC6C28B0E26AD1810 NSGNTHS0
143,586,314 *0DC2DEED65C5A0E63179815727045AC198B4D41A NSOHARDI
143,586,315 *0DC99117F403C6D9D5AD07737B6FB1FC862609BF nuevomundoche
143,586,316 *0DCBA5C2752535D4B342964BB6DFB40F2FAEB11A [email protected]
143,586,317 *0DC15FF50758AE20269A9F5CA6520DA28E22F86E KOSIMPLIZIALEN
143,586,318 *0DCF50FE0DE94A1C7F40183CAB791E3DF4DA5C21 kostroz
143,586,319 *0DC410927D0BE6ABEA0DE6F6C9A6A1946D9A5D27 OARSELIES
143,586,320 *0DCAC07CFA00DCB517175593948AE1A4E571B26E oberpferdeknecht
143,586,321 *0DCD3A3AA177CDBE640476300C867CCBCAF4B66A kunhong4
143,586,322 *0DCE17AB0A8ABE5A5D3D3B6DEDBBCE05266409A9 KUNSTSTTTE
143,586,323 *0DC78E7F4FCED447725E355A0A5F59CEE62B8F6F [email protected]
143,586,324 *0DCE54EDC0049CD548858F80B81C299DA843109A kurtmoring
143,586,325 *0DC8FA31CCE1CE4D55671003ECDF75E4C48DB5AD KUWAITKARACHIBEIJI
143,586,326 *0DCA57F043EDDD888A3AEB59A6B663F1522B7B74 OFGLAREGO
143,586,327 *0DC094DE9C0E48538CF20EB282A7F0B0A35C671A ohchristmastree
143,586,328 *0DC24034E00C7184B9394AF828388C7467FB8DE0 oi4.
143,586,329 *0DCB9494CCCA7EC436D4D3958657DF73970FB8D6 L12B0K69
143,586,330 *0DC212FA80337589482CD9BDF45334F34D437490 L200998
143,586,331 *0DCCA0B367AB3B88637762DDBF3BFDC2000E510E OLIVIADYKES
143,586,332 *0DC6E359FD85ED3157D9F2015063995331B766BB On-Air-(original)
143,586,333 *0DCE6DFBC6CCFEAB818203C8A165BD670B292B89 LAINASSAOLOA
143,586,334 *0DCA90950ACD3948B0C3B4A40987E6A167354ECF ONLICEBMI
143,586,335 *0DC4A31293DC4C6C132AC50563F6019124D2F5FF lanceluciani
143,586,336 *0DC22152205FF08765526608E63F62971C76831D o->-<o~ @======p
143,586,337 *0DCF2CBC8B0BAEBF67B7ED6689C7593CCD6C3136 )o(.~.`<==p
143,586,338 *0DCDFEB3BE26BC61272C0753385DED3F9438F3DE LARGAREMOS
143,586,339 *0DCD6D9F51F5D923F31CD460CE20287AB3D3618C LARRYTHEBEERDRINKER/THEBANKSOFLOUGHGOWNA/GANAINM
143,586,340 *0DCA1A349D118CB849B19247329D462EDBAC2514 LATRA CERBERO" (ORLANDO)
143,586,341 *0DCDBAC8A2E208EEEB4E6845099F72D276444E46 LAUREN.ROTHFUSS
143,586,342 *0DCA92D39DDB938CFA7E07D19F09943BE14668A2 OSCAR.BLECHINGER
143,586,343 *0DCE9E1A68EF8745EECC273BFD24B343F6E07F2F outd4t1n9
143,586,344 *0DCA18825169D687914382B3B98456E00950C137 leann9
143,586,345 *0DCC619FC477D26175B62C482C721305476B9162 LEAVIN' YOU BABY
143,586,346 *0DCA965D33753AF38FA7FFD6384FC717F4D8A6C9 LEBENNSÄNSCHANNUNG
143,586,347 *0DC6BD399E57253BCF10BBBB2C5B23D1BAAB5676 [email protected]
143,586,348 *0DC47B517328F99EEBE5F23047B03FB1623A2223 [email protected]~0~o}o{
143,586,349 *0DCCF5A0A81369C3A377B5F7EE9AC2A9BE7EF5BF pa00133003
143,586,350 *0DC57266B0EBF0BF2A18571ECA108DB06C7F22B5 le.jour.de.tes.noces
143,586,351 *0DC48E1CF9512E7088D6E695DD127CC12A370964 PABLO.NALE
143,586,352 *0DCA611908169DF61A2CCE08CC3B6A6560743E0B PACKERSTARTREK
143,586,353 *0DCD0A200059844992194C9F644B9CFFD4BF372A [email protected]
143,586,354 *0DCA4042393FB7A67F8F00D9369264E71FF3E3A2 LEOSTRUBBE
143,586,355 *0DC4DFAB377DF046C2A88B45FE84200CDA0CCBAE LEROY.BUSBIN
143,586,356 *0DCBD52E8D951F7847C83DA48B75E0908A15A8B0 LERU’A
143,586,357 *0DCABAFEB35CE615E4460FBD2419B50E0D0BB686 LERXTB
143,586,358 *0DC5C85E0FA2D6B47FF7D1CA5E6E4A22F8A312D3 panini-sutras
143,586,359 *0DCFB26386DDBA5DEEF93CD17CF3F29E8C64EFA4 LEVI.REISMAN
143,586,360 *0DC418BF85E7F6403A4E2510C259D49C13E0FD16 parzival0
143,586,361 *0DC740C7D65B5EF95C401EDA1656AC5D60128070 pasqualemorin
143,586,362 *0DCA31D9B68B84BFCB570365F99722543BEE3EF9 [email protected]
143,586,363 *0DC24090A381A0082189ABDED3ACE391B716320E patriciacabiltes
143,586,364 *0DC9314AE0767CC8976628068913384CD40DE592 [email protected],
143,586,365 *0DC6354F9E792594A513990E16B1A4B6A9AFA5D0 paulchristopherbrown
143,586,366 *0DC190C2EB5A1D1FA5777F18C04207376F8944B2 PAULINEDELPECH
143,586,367 *0DC6FF030869C726D2DBA55159D0F666661DD7A6 p=====>* * >b0
143,586,368 *0DCD08E4D2AED23F507F0151E056B2A95A8B67E9 LINDINT
143,586,369 *0DC3AF0BDF5338B4420C764A7BD1031B4ABF4FFE LIONELSCHELLHAMMER
143,586,370 *0DC78349673EA983799B7133DBD6885BCC130D2C LIS{{NTYMINEN
143,586,371 *0DCBD2B7124F8B91709BF2D2B452F4BA60C1257B littlelocs209
143,586,372 *0DC3AE5936E3BFAE9F31FB76701534AD85F10082 [email protected]
143,586,373 *0DC0779004AF5FED0C6616D1663D717E0B1361EB [email protected]
143,586,374 *0DC7BCA9C4B0E3336E93A6B0B2FC78B57244D018 PEDROBORUP
143,586,375 *0DC4D2C9A7AB7E736C8147DCDC8246AA637F7C9C [email protected]
143,586,376 *0DCAD1145A42FC5ED946276B15A29E407929A8F7 LLMYTTDI
143,586,377 *0DC4CEE5D07BAF9E766096A417A46CBC273086E7 lloydrutter
143,586,378 *0DCB994A602EEE0C7DF899A6038D82A355FADEEC LOAMIN9
143,586,379 *0DC79A499438CF9993E97E0A0B3062FAE1427DB0 loganjarosh
143,586,380 *0DCB032C7E46FCBCD50A5A3CF93095CBFE04A86D logitech456
143,586,381 *0DC8A36355BB11BCD6F44AB03A9D10847636D408 peterwublin
143,586,382 *0DC4FC8BD37AFDA269E868C6F3C551C7459B336B PĚTISETRUBLOVÉ
143,586,383 *0DC0DB5F0877CB115F73A4C9999E7E80EB924504 LONNY.DRINSKI
143,586,384 *0DCD544447FC8AE1D657E48293351C034D7C4982 LOREN.BLYSTONE
143,586,385 *0DC8ED2B6D860109EE2C2F7E7D514BCC2B1FA8DB LORI.MCKINSTER
143,586,386 *0DCEDF4128B0A02BCF34B71B39AF64FA03AB1C52 piano concerto in a minor
143,586,387 *0DC9EA1E2656432BFA75DF6D9737B5DAC246B98A PIERREPAULFRANCOISCAMILLESAVORGNANDEBRAZZA
143,586,388 *0DCB97537FF1355772E3EF6309915FB3A9E4EEA0 lovexannasuixaddict
143,586,389 *0DCD425ABBEE16AE164BA99E65EA1CCFC8269669 PIMPF(TIMEVERSION)
143,586,390 *0DC2F4016E275516909ED23CEF6E27B0EDB2CD47 [email protected]
143,586,391 *0DC4B0DC7B96D5637908207BED43CD97BC2B4376 LUCIUSPEMBERTON
143,586,392 *0DC3CC8F4CD7D9F06C594F256C190171CB813221 ludenr.6ingmoll,op.23,5:allamarcia
143,586,393 *0DC553C25AC10C1DE3E9440C6E8D56076C200166 LULUJANUARY
143,586,394 *0DC67F089B7F3304C0CFF6348FD311D6714F10D0 LUNAR.MAN
143,586,395 *0DC82884B8FD3DC5F3EA24AB57BB426EC9022A02 PLUTARCHOVY
143,586,396 *0DCB03217823E72D4F50CE7A235D2A68A5AA9B2A p====)**}O{
143,586,397 *0DCAC9FB726022B6252B775AF03C6014386B3656 lyinglyv
143,586,398 *0DC6BC778D1C889EC3025C4BE61B88687668C08F POLIKROMIDE
143,586,399 *0DC9D030BC716EE71F7F29278013EB9F80875055 POPULISME »
143,586,400 *0DCA04D2C875DA349AF24DCF69DEF3045E7863FA M19840718
143,586,401 *0DCF1884D116A65E249474786961E6264C9057CC madeready
143,586,402 *0DC23AA02F29F3D8F0A1CCF09059B192BB789520 pp~0splat
143,586,403 *0DC26B097DCFA0E8CACD4B30E3DA6C5010B991A1 mag1124024
143,586,404 *0DC05B777326ADF9B06A8A3844C1492522741124 MAGIBAZ
143,586,405 *0DC78D0028B0197F20BC436A509FADBD9BC6019C magnumnicarao
143,586,406 *0DC82CD135DFD82C30A6441A1A826FE8D6C0633F [email protected]
143,586,407 *0DC7935E3EE203424612C4EDAB87943F659DFD33 main-jackson
143,586,408 *0DC259AA0B85923BD9D9CB6BB79AD1C2C9AD79D6 MAJORBROSCO
143,586,409 *0DC8C92059737A8093831842BF14C54128E3945C PRDSCPLN1
143,586,410 *0DC2B7044113AA9F5A2F0C75B8864D211F463861 prelude, op 28, no15 "raindrop"
143,586,411 *0DC6EC0C7F723092A70FE4FC5813D65AE923A1EF PRELUSIVELY
143,586,412 *0DC95CA3F49712DC3EB7E2E44608B6751541DA58 Man,Concrete,Meifumado
143,586,413 *0DC937B3CFAEDE1C176ABC55F16743E25A7FB4FD MANGAR0
143,586,414 *0DCCF3E696DC111CCF66E0C163E38A4C2DE7DF49 PROPIILATODJI
143,586,415 *0DC4CFEFDE71B1E7D0EBE606BEDBE83E0B170D40 Proreferendum
143,586,416 *0DCF89E208B4498EA53426C2A8C07142C5065886 MARCELO.GOVIN
143,586,417 *0DC293B25320213ED5BDE51D0EFADA9D23F233A6 MARCUSBISHOP
143,586,418 *0DCC77C4385AD1731F51A6229305F9E4F5F2AE10 PSEUDACONTIA
143,586,419 *0DC7BF983937D671BDBAB8894A89A4FEE4F7215D MARIAALMENGOR
143,586,420 *0DCBA14D2112303A5FC5F2843919630784FB5120 pw+,
143,586,421 *0DCB7AD3912E9E2A80EDE4F6298B7EBB2B5A44D7 PWUTSCHEL
143,586,422 *0DCDA8D340C4CEBF96A8BD715DB4402B957BD29C P>~.~.~.{x}
143,586,423 *0DC43CDB48A3C88D31E4C82E7A91A1472A030163 Q7D*
143,586,424 *0DCBE8DC32BCB94C0E5C0DE24467764BA91FF907 masonwagner
143,586,425 *0DCE005DC9C66620DCE4AFBFFE676DFAE5543984 MASS IN B MINOR, BWV 232: XII GLORIA: CUM SANCTO SPIRITU
143,586,426 *0DCA78747751C4963B73E847B81152A89F6D5F05 q===P**(~_^)
143,586,427 *0DCB03193F7D8613C08A8FD1428AA84AB783528A qp.~0)8(
143,586,428 *0DCF00219FA83CCEF47C8C8353844CE29E165731 Q###P*.*3B<
143,586,429 *0DC1D6575665CAED65F8233F04744016B14970A5 Q###P`~-`~SPLAT!!
143,586,430 *0DC7BDE7D02FAEE3D12A5F9DFCAB1C595B0C3161 MAYDAYVIRGINIA
143,586,431 *0DCA3BB2C5FA63E274D5561BEF51168B8E72B995 quinnmanivong
143,586,432 *0DC08C2D103B8B9C006DAF482D464924A37362F3 „mäzen
143,586,433 *0DC5221878AF0D15255CF683B49C51FB102B2250 m!$bego+
143,586,434 *0DCC2D50FF1C26B1B528AAE250D748733FE6CC43 MCAILLET
143,586,435 *0DC0E30F8AC7A97BA8B710FE4DA982E07A69F9FC [email protected]+1on
143,586,436 *0DC275B20BC5583AB6F45C173D2B7160EEA6B8DE MDEED78
143,586,437 *0DC59C8E6C37DEB7FAA01B76694914AFA71E707F r3ss+48ly
143,586,438 *0DC5EBAD4F06558EBAFC14B5EC0E36BC60CE52DE R4IN8OWS
143,586,439 *0DCD416964E50A7B1CCB66BAC866CDD88AC5BADE
143,586,440 *0DCE39D6D7AD6AB91CEED0A9076B5A4CA31BECAC RADIO.DEELA
143,586,441 *0DC2BD058FD351D19118608F868884FF5101CAEA RAFFO2
143,586,442 *0DC2476B0AAA5C8B731C491187B3332AD76E48D0 [email protected]
143,586,443 *0DCCE949AB4AA3A56824AE2BE8C4501811891F94 mesokraneotoa
143,586,444 *0DC83C158F33BE51562D419BF22AF2D4D7F6D1E9 [email protected]
143,586,445 *0DC6743FF56E30935B0328307DF0F833C7A130D9 rbol-de-la-alm
143,586,446 *0DCE3DC40E64B271DB59BB6C1D0E12B8DB81450F [email protected]
143,586,447 *0DC27C7AF25DB152DDA94A87A491A7B27DEE9585 militaresdejap
143,586,448 *0DC12386CD952062036854E4E9184D2899B018B3 miltonkenefick
143,586,449 *0DC9D760E47DDE2C573AF131E93FD332BA8E6F2F REDOMINATE
143,586,450 *0DCB1849744A3FC92AD42EFE0C016181C4E2A102 MINUTKE4
143,586,451 *0DC23923B5F6595DD196A1077FC5EAD0B8C374CF MITCHELL CANHAM
143,586,452 *0DCD977AD6E7AEF78A8947EB63E725496A1BB849 MITCH-MCCLURE
143,586,453 *0DC1511933281CE77DADD56DAC539B41FC861E70 rEinzweitesSchiff
143,586,454 *0DC56AB56B0339BF0A3B308FE7A45C7985AB85A4 REKCALSY
143,586,455 *0DCEBEF2076775B82DBC8606CAAE4CB15BF83FA8 [email protected]
143,586,456 *0DC48C4F657FAAD97184D93FB5BF44925B53E59A MODESTOMARKSBERRY
143,586,457 *0DC0018615176C8F81AC04662ABF2F8B88A0BA25 MOGAOGROTTEN
143,586,458 *0DC73FA4132F22610391194E2E76AF93FD2A341B MOMSELECT.COMWWW
143,586,459 *0DCB8DF1E28B3521F429BC92D2A760A2C72BE9ED resempjes
143,586,460 *0DCD2E999C37BCEA1508DB60C34A452A76A6774B monkey2207032
143,586,461 *0DC2D28A2C101E4A727210FAE4EF557910547271 REVIEWQUOTS
143,586,462 *0DC1ABD1AA2BE7E64FE69BE66A10E135826B0D37 monueut
143,586,463 *0DCC84A2451D78129234ED980A07A4E5D08B54D5 reyeszabel
143,586,464 *0DC4EAC734F644DB50716A019F223DF659EB564F MOSÁMBÁ
143,586,465 *0DCF26D3690D6820DE8E262CA9C805E4AE9CAED7 mosesaddleman
143,586,466 *0DC27FD94D03549E1636A9AF17EBBC559D22D1A0 RGNTNKMR4
143,586,467 *0DC471C2D2E3EB343E3D6FACF8D13EF5AC3EFF3D MOUTHS.M/AU//D/Z
143,586,468 *0DCEE7B9A0DEB59C0C13AC462DE369E04B1AC049 ri*/
143,586,469 *0DCEE4F14F80F3FF8CC004DA8C039B381BD67E74 RICHGBBSW1
143,586,470 *0DC618B8206EF0CFD7CB0A584C3BAA041BEF801E [email protected]
143,586,471 *0DCA00BE8F600E4AC69925F418FC108DD176ED4E MSIHPROMOEMOH
143,586,472 *0DC20CD08165ACE2817E559E66480A72FEADA00D mu$kl3n$
143,586,473 *0DC10435F10F6602001A1E0E6597BB1F856FC53B mundodeltrabajo
143,586,474 *0DC36787819CF87F5D8CF653E11A1664337E5766 musanmat8
143,586,475 *0DCE1965A2255BA7601A3A9DC8C8B1FD6044BCB6 RIPPAH(FEATTOOSHORT)
143,586,476 *0DC5402BDAF0D7BF24C5FB60C296D2B214790437 MVICKERS4
143,586,477 *0DC297D1B7F84874665D5ACB60E5A995EF6CB976 [email protected]
143,586,478 *0DC9F2A76AB3CCACB312BF8E9A148FF4A9DA09CA robbienoethiger
143,586,479 *0DCCFE255A7FD9BFA4128E27D46F03A0ECFF18D9 MYNEWPASS58
143,586,480 *0DC65992F6748996ACA7815E4423AF652A1FA200 rodataliuq
143,586,481 *0DCA576FFAB7FC858CA678F6E2FEBC8E991D565E ROLLANDTRUMBORE
143,586,482 *0DCED1F4396BB6D69F233856DDD38B11230FA6FB ROLLANDUYEHARA
143,586,483 *0DCDC66DE363C79104E406527A39080F94163DC5 NALFAOURI
143,586,484 *0DC062AA00B011BB97D2954D6AA1D1E5E351E98A Ronald-Mesquita
143,586,485 *0DCA48F7E6DF07BC092FD9AAFB1FB7BEDFE811DC rosemary-winter
143,586,486 *0DCCB9633C94B656304F292CE8EDB9E4B23A0BB6 ROUTING—PART
143,586,487 *0DC81BA1280A43E935F5E39E762F98DCCCAB9726 ROWENAMIRALLES
143,586,488 *0DC188742312749097C50469FEBBB7907CDB9562 NCIESLEWICZ
143,586,489 *0DCAA984538D79C04FCC71DF3D168C59E1F0DA10 ne14.recitativo(corrado,lilla,principe)
143,586,490 *0DCAA51E1E1B45190B43038C6A2133A3D0061D53 NELSON.RANTZ
143,586,491 *0DC8AC6DB7E6519EED6466D3EC4D3202647D0F24 NEMETON (THE CELESTIAL CLEARING)
143,586,492 *0DCD9ED3EDF6E231E5E3F3BBCEAA9DA8641C64C3 NEUŠTOKAVISCHEN
143,586,493 *0DCE73DC5E8BA5A3482100DE77249BDC2D002B9B NEYNOE
143,586,494 *0DCF02998C7111A4F332E07D9DFD167F6E6FB3ED RUEBEN.OMER
143,586,495 *0DC3AD18D2F57C2E57C5AF06AC1F63FC7893AF82 S8NVTNX077U
143,586,496 *0DC5B27EA86DF2BACD361ECB712EC73B6FDC8D6B SADEVON
143,586,497 *0DCBB0C7A7DC99C864737BF5B99BF1D6572AF7C6 SageClubBerlinPresents:TheSoundofSage(disc2)
143,586,498 *0DC61D7848BFCE207FA098860A04829909D04214 [email protected]
143,586,499 *0DC0C38A8A5E73A7A14253B69361AE156013FA5E N;N
143,586,500 *0DC1FA42CBB7BFBFB216EF7AE0381230DD188BB7 NNHAZE88
143,586,501 *0DC76BD3DDAD4DE6D908F63A5214C76D28BE1658 NO 1 III MENUET PRESTO
143,586,502 *0DC7462AB0018B7B873F358D07190F8B06309323 sakalda
143,586,503 *0DC2E316A4136B3AC0A4A220F35EAACE7C366275 NOAAA
143,586,504 *0DCF491E1859140CA598863A154D62E68914EC78 NOBLESALVADORE
143,586,505 *0DCD7875815C3DD3FE81CC6CBEA385B9939DC7A2 NOBLE.TUNICK
143,586,506 *0DC3C2D0126D2AC5D02B0658EB5503630D87BC2F saloryp4
143,586,507 *0DC72D8B295CE51FF787826F977B5CD373612D2B NO-MORE,-NO-LESS
143,586,508 *0DC882584B6AEC90CD8D3D94D27DC3AC2D52FACB NONFINNIC
143,586,509 *0DC93627D5822039B932076334318BD708D266E6 sambhomahadeva-bhooplamadi
143,586,510 *0DC7C6EC69A5455320C8ADF6A72B8CDDF8DD9515 [email protected]
143,586,511 *0DCB59B04631A6974854AC758C6D197A568A8D5B Now(featLil'Flip)
143,586,512 *0DC11268FC95B8FF256ACD6844B523CF491C6034 nsteandirbistdu
143,586,513 *0DC259500540A7724531A35A715E349988DD625A SARAH1903
143,586,514 *0DC25DEC26A919CBBA454922443BCA9BA0776C23 SATORIO3
143,586,515 *0DC9DEBB8382E29F3E55BBFDFFD426A46EA79131 savemefromforeclosurecomwww
143,586,516 *0DCECD7E321909342370755F2A6AF08147C6D14D save-me-from-myself-(vocal)
143,586,517 *0DCEB9331BEEEFF46F70303E604E39E7A74A4E22 number-2:-8
143,586,518 *0DCF4D93EA2F2DFDF91BB28DCAF29718220FAE01 sceptre
143,586,519 *0DCD05A21D85BB73FD37138F4AD9880436DB8F93 OBAMASSECRETW
143,586,520 *0DCA160571E0E932012537D7C86405464776A08B SCOLOPIO4
143,586,521 *0DC60D427DAA27B075751FF9F4E7A805DC934BCF secretariadeseguridadpublicam
143,586,522 *0DCC8E4293403479CD97C6FF3A5A81BE9E022974 olivermcclatcher
143,586,523 *0DCFABDE86E144BAD6915F4A65410E43F6DBF5AC septic3
143,586,524 *0DC4847D1112D43C85DD4ECF7F3DFBF4EB7CA930 OMSP
143,586,525 *0DC43C7B7CEDFE55CC65E0BE43FC50BA397F47BD SERGIO.CODNER
143,586,526 *0DC851C205C37129614BAD7EC13DB98F10126370 shadrockford
143,586,527 *0DC64F55E17E1AD836EC16FC119F1D5ACC361A5F shakespeare-man
143,586,528 *0DCC5B1A0A34D8BC55A1253D9EA91929C6C27E02 SHANE.OLDERSHAW
143,586,529 *0DCFC171C383CA1496027DECCA869332D81E9058 [email protected]
143,586,530 *0DC1CC3B69C3B0A0CF2AC80DCACBBEA48F813AD5 SHRILLETH
143,586,531 *0DCBAC2CFE9CA228417A6DE8C0FE5335070E3131 SIERRADEARALAR
143,586,532 *0DCEE2F2AB378C6F51F43E9FD9C880E0A929CD28 SILASDALENBERG
143,586,533 *0DCB29777CE7967E7376F8DC2CE8C96664DB28AC SILENTSTALKLONCHANEY
143,586,534 *0DC2C596A84497F035F5AEC812D1C6A18E26E10E ON3OT4
143,586,535 *0DC5D477FF05FF8003398537E4228A103EC2D8B6 simonbenoist
143,586,536 *0DCE1CB5A7135B12E4C22C89C2233B77D73523F8 SIMON.GRANBERG
143,586,537 *0DCF87BFBE907D61171D03AAC7990BA971955A24 SIMON.LONDONO
143,586,538 *0DC29AAC9BFD6FC5E08113C2748268A85F2C5F45 SIMULTAMEOUSLY9
143,586,539 *0DCFD5A542E20CC9DADF20D160860B888E2FB1E1 one.step.bitch
143,586,540 *0DC2DEC292C7A329E5C0E5942A935EF8E1F0F695 SINROOK4
143,586,541 *0DC71B8FE011263ABA582A653B0055FAABE57B06 SITIILEC5
143,586,542 *0DC3A6AA427151634A044B280FF4FD0806302177 skolaerion
143,586,543 *0DC79696CDD6E147EE67C0699DF3A19179B209C5 SKUTARISEE
143,586,544 *0DCF35B1E94783879B8B73C7A0D172190F18A086 SLANG3RS
143,586,545 *0DCF98501121C9ED032D4D42E875636CC1774CA6 snairarbilbus
143,586,546 *0DC1B3BFA6104EB208982749ED638D6233DB4671 SNCRO
143,586,547 *0DC3438C6A8703044D9E65164C92FBE52D8DEF58 SNNATN
143,586,548 *0DC94348D1A01A59A1FE9F4D249231F814571AA8 SNOTSUHS
143,586,549 *0DC08787B597604263DF3EBE98DA708384E958FD SOBIESIA3
143,586,550 *0DC860A3FE7E74079F41EEFB973FDB6D71320086 oscarantunez
143,586,551 *0DCDA87B06A3F89C69E7EC1D60A58052BAA34947 oscar-chichoni
143,586,552 *0DCBF62641ABC0194E7049B07AEB3B5437B31BA8 oscarshonk
143,586,553 *0DCE59265A5F9BC2027ABC0BFE520945F8A84865 «OSWALDS
143,586,554 *0DCADFAB7C58CDCB9FEC2378F78893847DF12FB8 ov3rl4v$h
143,586,555 *0DC89B1289EF52D545F2D7DF5A1229B3E7BAE5B4 pablo.paternina
143,586,556 *0DC5535E62A50E2F9BC7EA830B943522DF61D0DA paddy wagon
143,586,557 *0DCDD6BC3F09E93745BAF82612201FE5862FB3A0 [email protected]
143,586,558 *0DC8D1E7E079D1E7B25AEDC1D6A37D666AE8BE35 PANTJITI
143,586,559 *0DCFA2AF78739B2504A018925621FCC9C76AFA9E sovedrikken
143,586,560 *0DC9D18A9E178B090ADAEC60F80C9797D24FAAFD pascal-bruckner
143,586,561 *0DC97BE73FF65F6E2B56CDF7D10E6D5ADCA92D87 SPENCERMEYLOR
143,586,562 *0DC08CC5990AB56854A5B0447716F5906477C033 PASSWORDRACOON
143,586,563 *0DC4F48594E7C7BA102E36336C636CF24ABC20AF SPKHKERNE
143,586,564 *0DCECCB41F2A8703E3568EC05A14F4EC6FE73C01 peacecoalitionorgwww
143,586,565 *0DCD73E00C483399D4504FF65C9A4DF90B157A80 pedrofrymoyer
143,586,566 *0DCF1FF7B3F0FB98EEE9CD175D4687A684F4455D SPULARDATO.
143,586,567 *0DC1003E4BD593BB98A193D7C01BB67DCF5D6AE7 [email protected]
143,586,568 *0DC430F6123DEA6A622E61EA834CC8612C0EF7B8 pennelikker7
143,586,569 *0DC929720E7537557E7F60FE08468F599071B953 peteragyeman
143,586,570 *0DC5B5BD7853EDE3906934708872C5EEE5765806 [email protected]
143,586,571 *0DC9DA62E2C88707B526F2C09D81DBFF9723DF9A STANDARDTERMI
143,586,572 *0DC5B98091524FAC6D9E35642A98C960535985C1 phillipcoontz
143,586,573 *0DC894C0CD6FFD1CD624D9875FA955FB1ADDF18B STARTINGSTALLS3
143,586,574 *0DC52DF6A1EA07602A4FF5DB45B152ECB8058A2F PHOTOHST7
143,586,575 *0DC35370488F2FD271642B46C7D90C76979827DF PHOTOMA7
143,586,576 *0DC3E50E52FCE2DE71977AA67CE30CF33489BC78 STEGASOYN5
143,586,577 *0DCBC9D25C8715CC73568255AE6D88BD6B9B4012 PICCIOT6
143,586,578 *0DCD7BB007AED02B22716B2F566FB842B91FB117 Picnic.Time
143,586,579 *0DC7FA65163A25B850E49A7870CFA845EE52D2A8 PIERRESWINEHART
143,586,580 *0DCFDE6DCA8D2D26B0BE4D264336DD29B218F3DC pimsleur
143,586,581 *0DCD9A700B74F8F0BDF423531E59234E4DEEACB1 STERLINGGUIEL
143,586,582 *0DC5D142FBF718EC9317FAD7140EF7B4A146C58F sterlingsalido
143,586,583 *0DCDEB1E11C790F2638F040C20F0A455E197471D PIPERONYING
143,586,584 *0DCE372294DF7F67B9A00626BDBB77AB52AFD156 stobhill2
143,586,585 *0DC9F6E9387ACF8C85EAF5799D97BDFFCE9195E5 PLOVODIERN
143,586,586 *0DC3FEC11671CB14541558F4812FD8C86AF53BC9 stonchurchill
143,586,587 *0DC4D788157875E0F80A49A97FDD2CEA1BE6A93D STONEPREFERENCEPRIDEPRIDE2
143,586,588 *0DCDF3728445A9CB81CCA863AEB87F43845921D1 P\O+
143,586,589 *0DC16CCF1090E5A574385EED22DAB94DF396AC79 [email protected]
143,586,590 *0DC57C4AFB2239F975AD5DB8CC32A6CABD7D0EAC POPUL4RIZE$
143,586,591 *0DCE2C22E564AAF836722D3BE3F961680BA0CB18 porkalama
143,586,592 *0DC4B3D83FD4A35FC55D99C8695135BE23443405 SUITE NO3 IN D OVERTURE
143,586,593 *0DCC0A5CF14CF369393452D51BF39CED115B1E25 SULWMXNE60
143,586,594 *0DC5AD9300F3C14735CD075A827E387CF4FD3635 p####p.~0.>-b0
143,586,595 *0DC54769E4CAA2752C90910BD792ED9A756DD8FC pp~0splat
143,586,596 *0DC26B097DCFA0E8CACD4B30E3DA6C5010B991A1 [email protected]
143,586,597 *0DCE19879EEDED6E9B63C8FBE8A6DB981EB38168 [email protected]
143,586,598 *0DCCEC550517A1E46E83AF83CA2DC75B16C34B89 [email protected]
143,586,599 *0DC7568F48D640AAD6841B58485FCD64AA2BA61F p======p.~.~.~.Splat
143,586,600 *0DC52F12785BCE0AC1B43FBA203C33B1CACA39A9 PRAVDA-UROA-PREDIA
143,586,601 *0DC9B34E76FAD07B19A953D794594CE232E9C5D8 precompo0
143,586,602 *0DC413383DC39C5471BBEE4A2FF112D7E445B316 predefenses0
143,586,603 *0DC3AE6DC7CCD47D9D2A47AD753BE221CD2A201D preet-mehta
143,586,604 *0DC2CAB5D9715586B352F20550AF14E41B69BB49 [email protected]
143,586,605 *0DC58BCEFEE4EC746179E90CABBCC07ED5C3CB3A SWAGATIKA JENA
143,586,606 *0DC5F446E681E04A5C0D0CDC88D63EF922E76ACD pricila te amo
143,586,607 *0DC520049FB9E560060FBDABF1489A913518D705 SZKOCJE5
143,586,608 *0DCDD1F25C17214FD0022B5DDA73382C64F1AEB3 prislusi7
143,586,609 *0DC3EDD092C98A5933D26C2EC45FDB59506BC649 TABITHAMALLERY
143,586,610 *0DC9A710EC996104A86D43B7B6C2D4F87C8AEED9 PRODUCER 01
143,586,611 *0DCAD3D9CAF42B7E0CCA2A2C0430A63EE8DC35BC [email protected]
143,586,612 *0DC146CC1C476EDBA7466E2B9EE8332FD075B6B6 TAJENJEM2
143,586,613 *0DCA763606767D66A11B4245ECA3BFFACF831B20 talksaintsaturnind
143,586,614 *0DC5F7B82AA8E050AC228538D9B0416D3460F3E4 PROSZONO5
143,586,615 *0DC8873BFD5C266C08C0CEE775F4515DC631C082 TARELAYEFA
143,586,616 *0DC13839EA950B8BD0531E9F34258231FB4613FF TARIFSCHLACHTENBSW6
143,586,617 *0DCEE7ECDBD9FC4FE98D39E5ABADCF2A29AF37F6 TBBKVHZKQHG
143,586,618 *0DC7372E8A6DE791530ACE656729F4BEF55F2397 PUMP.THAT.BODY
143,586,619 *0DC12206AC5F2FC9EE5AE44E25BC1CD94BB0ABDC teddyfekety
143,586,620 *0DC1D65B7761CE292C4DB7C6CA75FC2D5627AA13 qayyumawan
143,586,621 *0DC6128B72B39BA2B8EA8AED0FAA8E0D1DA24F9F q======)~.~.~>b0
143,586,622 *0DC6E0E2003F2CF26472D32EFA6FAE2E708ACDD0 Q==)-~-~>-B0
143,586,623 *0DC18B840E3BAFA79AB071F405135B78C076B93E temp[email protected]
143,586,624 *0DCA9E7D21572ED199232718D75E094E4D0BCFEF tetrarch
143,586,625 *0DCC2CC487285A9E830ABEAB13CCCEEF169DF4FC TETRSYLLING
143,586,626 *0DC3ED694C5244534D65704F301FECDE14C62FA3 [email protected]
143,586,627 *0DCDAD5A7C47280F2E8B5BEFF74C4856A31F3A28 [email protected]
143,586,628 *0DCD6FB0FA3FF3E15ACAA0E393E8C334C2ECC0A0 QLA1
143,586,629 *0DCE788EF48DAEDD0B1AA52E3D1E10FFCFD7E6D8 q#p.`~.>b0
143,586,630 *0DC2374CC7C01AECAB5DC7DE0A2B782829367CD8 q=====p~o-}X{
143,586,631 *0DCCCFFC1FF331CC281F311DB1E3B1C66D78740B QUINDIUENSETALKCERRE
143,586,632 *0DC088E0BF1B6D0B145C5A497F62BE176E07B26E qvxiysybwc
143,586,633 *0DC73F06262984BD77CF66CA3D237FD4E56988F3 QWABBIT
143,586,634 *0DC92B83EE840626075A1D2BAAF37F584E0A9EDB [email protected]
143,586,635 *0DC676AF17E4151A874CF2667D26F0DA107FF03C R39ULAT1ON
143,586,636 *0DC88150E316ABAE002738298E27ED8404931C5A [email protected]$
143,586,637 *0DCE194B7D79B045D855D8A22D4D426686381CE1 ralph.miles
143,586,638 *0DC2B66DDB811858D9E2B6F444E1FE967C551C4A RAMONCARABANTE
143,586,639 *0DC7F0ABC56B1B9CC1B484E196A483FD624BA8FD randallmansbridge
143,586,640 *0DC286FC84E4662D0FA04EC7F6C39D952CD47AE4 theodorecotey
143,586,641 *0DCBCBA2007C97EB32B4DD2FD9956519A5E57D7F theparses
143,586,642 *0DC69D831E1FD3B6A8D3635E25655600F5E0DB64 randydenby
143,586,643 *0DC3F7877C3807F6B4C5340D64ECA669577F9801 the-pet-shop
143,586,644 *0DC735058B11F61600530753FE494D93F5CABC56 the revivalry: a tribute to running wild
143,586,645 *0DC716782450959312DAEEF2BB565CA0E238FBA4 THERISEANDPOPULARITYOFDIGITALSYNTHESIZERS
143,586,646 *0DC0D35F3E5918E13D1DDFEDC3D94C1EBB881EE2 thetravis90
143,586,647 *0DC18EF95EE4F2FA64A6ED695B7671D3C1DB9E79 The.Worshipper's.Overture
143,586,648 *0DCC368690E424A8621765795CEC8DAFF7003BA4 re9is+r4rs
143,586,649 *0DC40361B391F0F7B38D5F2452137D8E73B3BD0D THURS1
143,586,650 *0DCE20367F2F14107BB9B028A4EFA4D5D0C4A353 reaktioaineina
143,586,651 *0DC357564676B70810234B156847A012BABCD17F [email protected]
143,586,652 *0DC4A8DE2507014398873FEBF7FD1CB86DE6AAEF RE'APPARAISSEZ
143,586,653 *0DC673DE6EC8DB70595888CD4EAB4EA71635CE77 TIGVVPXGITYT
143,586,654 *0DCD5ECE29ECD252AD0CA3626C68BD0DF68DEA91 recuire.
143,586,655 *0DC89B732A83F7ADE77A9E0C743979E2F0A1DD7F REGENESS8
143,586,656 *0DC778CD89C4E8BCA4CF8E80603D5B1AE7B8BB26 titulok2
143,586,657 *0DC9131BDE5A266AECCD7E53B14730E72EB33931 rej$e0mk0
143,586,658 *0DC271F66DB9F8FE3391EFD6D87D3AFEEDC8B100 tnessisseg
143,586,659 *0DC8270268FAAD4D461E0E5CACFFC4282629DA5D rekursivitet4
143,586,660 *0DC7DF0273158E130E5198FE88E60AF273200504 TOIMINTALINJOILLA
143,586,661 *0DCE439C4ECE29695F49E865BCC2D6A002B49618 RENALDOLOUK
143,586,662 *0DC8351447665F08C1E83B977264FD160690B558 RENALDORAMADAN
143,586,663 *0DCD7FD12D2C808AE9F8A5AFB99BB5712AC14485 tomasbarts
143,586,664 *0DC6CF5AA8E443FF734E9CED4A0D7143D29BE0A8 tomb
143,586,665 *0DCCD854F1C6C07E597CE874F1FB4071D9A2F424 TONEY.BILANSKY
143,586,666 *0DC94C926B3B900C9D7C43E315CCA9951B16D85E RETSUREGNO9
143,586,667 *0DC1E54F77C8312F427B7CF7FD999E831742C0F2 REUADFUA
143,586,668 *0DC04830F50772CB13366F4ABC9C14B05F2C76E8 tra9comede$
143,586,669 *0DC395A9FBD2F046E4120A1435E0A0F5C7E6FDAB REXXLIST2
143,586,670 *0DC73D4DD5C50DE0B397BA748F4954D53C1567D9 REY BIBLICO
143,586,671 *0DC89C81ACD433B36B7258C6A13E97B997CF1FDE tranesha-johnson
143,586,672 *0DCE88F6A24B0430C3AA68D2F7A2EB92B163C464 rgtcrcy5
143,586,673 *0DC7B729471AE9C98F46E3C8D8ED8E8134BC0E56 RHINESTONE2K
143,586,674 *0DC3BF4D3EB9C1DA6BF6AA6202FB774EAD9131D8 TRAVISAJONES
143,586,675 *0DC2C9BF4A36639139D451E4FC5E085A417BFDAA RICARDOSHIRAKI
143,586,676 *0DC5E6853E1051B7CC8F73379C2EB498BF3066B4 RICHARD.SINGSON
143,586,677 *0DC67F02332655B0336B8AFF8A912CCA49AB9152 richbagshaw
143,586,678 *0DC39E8DF2EFE4DA27DA0720510C3A8533AB9E71 ricing
143,586,679 *0DC9D85A5F0369BD3CE4FA387A09E448A559B84A rickeyelldrege
143,586,680 *0DC8E40198D1DDF861F575003877BF85DEFB7579 RICK.SHAMMAH
143,586,681 *0DC6FD1B5A3CFEA53AAD9D38117190B48E557660 RIDICEMMOED
143,586,682 *0DCD8C0A1836D53E571ED0FE1C7EAFD30399559C TRICIA.BIRCHENOUGH
143,586,683 *0DC61CC0DC2C1070A5119141347D39C95D8A077F TRILOBITOE
143,586,684 *0DCBE5503813B4A860746614D30BAD43E0A16B58 robertraymos
143,586,685 *0DC50CC38D53312927891F07FA522547340B5A97 robtmoscone
143,586,686 *0DC722ECCF383F1736CD2C1A4B9B2CCBF2E9362E ROCCOKELLAM
143,586,687 *0DCD07BADE60B612133349D4088B79E389BE878B TTSVVXX
143,586,688 *0DC3CA0C2C66E5EF31A6FA6B32CF10835B8715F8 RODBOTCHER
143,586,689 *0DC3CB6467634383452F42871CD9CD4592192A19 tuba.tilkioglu
143,586,690 *0DC473CE00469E307223FF0A7879D2C7FFB9E007 roderickmanzanilla
143,586,691 *0DC3D0337DEBE9199860CF057EF907A84F3320FA rodolfogaisford
143,586,692 *0DCA113E7EDAD5C54D512C3A52839C14D8784D49 ROISTERL
143,586,693 *0DC6DE9C0B4CBE4910BE003810DFBBEAF79FEE35 TURIŻMU
143,586,694 *0DCE67BB31E99D48291DFDCDF70BA0895007B48F TURKESSA.CHERRIE
143,586,695 *0DC79AE79EF3E986FB30B06D5B809089830302BB rolfappleman
143,586,696 *0DC9DC2029700EA41999329D560E1B5EFDB4D5A5 TUTIUSQUE
143,586,697 *0DCF15ECE0146F386069AEE38278AF723D2DCDC7 ROSE.KIMANI
143,586,698 *0DC2587365725E900D23537009FF85438AAE0305 rough-and-tough
143,586,699 *0DC2CFDEE025258775C450DE23F2DD695DAAFEA3 ROYALLACKAGE
143,586,700 *0DC04AE9DE42CE67AC0582A804A9186A3818D13A UDEEPKADEL
143,586,701 *0DC294E01B4DDCF6AACAAB26EEBC6DC44D5F85E0 UDLODDES7
143,586,702 *0DCC7D6F325627E4E8FD416FED1137BBF3DD8162 rubennetz
143,586,703 *0DC96D7226DDC03F3E6E3A42462A93FBCE52D386 rudynitkowski
143,586,704 *0DCCE7029AA23EB9473503D1813A4AFED01C37E8 RUDYPOSKITT
143,586,705 *0DC60214F98EA4C5A4DD21B196A0DF3957657984 RUGUERRE7
143,586,706 *0DC7423B84801EC8F9D831A660821BE963B52E7B UMBGEBETTET
143,586,707 *0DC3DC279EBAEEB55AC14167636F5798E5B472EA rusself0
143,586,708 *0DCE3173AFCB77C24BBC57045C203DDD75B7F4BF UNGKEGILA
143,586,709 *0DC750BB5C30567AFB3F22850513C2357FB479D6 SABE1610
143,586,710 *0DC60EE64F32500638F1DD8E06E29816B025FBA5 SÄILYTYSPERUSTEEKSI
143,586,711 *0DC4BC678A321E1CB54B6AB5622E673F4C147756 SALUTVANESSAED
143,586,712 *0DCDCA3F4894705D247EE04D35C9AE840AA9E3AB USERJOELDIPOPS
143,586,713 *0DC12F60F27F95B4BC417FF96027F563D15F3B18 USERZBALL
143,586,714 *0DC9BDBB2D76ACD45D6BCB516831DA6055464D39 SAMMIE1972
143,586,715 *0DC82D3CB995E3B20F21A7DBE1925B8175DA1998 USUARIOS POR IDIOMA - ESLOVENO AVANZADO
143,586,716 *0DC0E8277879798C1E40EB4211C3136CE6613087 SAMUELSIMOGIARTO
143,586,717 *0DC10844298C61253C6778CF5F4FCBCF200E0BA1 SANDI5
143,586,718 *0DC6B010CDF5A06085AC9C6F4AE9E9B41FE34489 sandytrinh
143,586,719 *0DCF826CB5D1FE72C26F3FFAC0519E14695D2F15 UVURDERLIGHEDENS2
143,586,720 *0DC66B2989FD3DE9230D419D569DA5E4F980D1FD UZIHSAT9
143,586,721 *0DC573CDA1B272332A0FAD7CC6CE2F51158A085B v172m6c3yfr5058cxdty36
143,586,722 *0DC22C4760E672FB49398E803B67E7725DF0308C V1MT
143,586,723 *0DCD9CEFB7FEF7D9F451EE02CC20099146DACCC1 santiagorodriguezmirandag
143,586,724 *0DC5C16A5BFA4133FE526D61B70D5DEE7036922B SARAH.EDES
143,586,725 *0DCE1BDEB7055FCCA3319238902A5D771C518E1E saziatas7
143,586,726 *0DCF0B48B45CAE9771B70830C31579D34FBE7C3A VARUN.JUMDE
143,586,727 *0DCCEF4FC003A7D624C6C29CBCD463833DB7D950 vatillaed
143,586,728 *0DCF195E0A665FA6F4AD837837A55F8F7CD8EE67 venigalla-varma
143,586,729 *0DC824692975109E4BE9CB86E9CCF5D6FB47CB22 VENKATESHWARRAO
143,586,730 *0DC1E6D2E74807CC5C38191A9E74C33578A7284A VERAMONSIVAIS
143,586,731 *0DCC29E4C189D3A572FDFDE096101E805F91F319 verbluemter
143,586,732 *0DC72A360E997FDBA212957DFA0714D84B316D99 VERICAA
143,586,733 *0DCCA6669EB4C3D04032254FA3E7E72F87065B7E vhfkk
143,586,734 *0DCA8E8BC13FA10AF65F52130D5A27ABB43B322D vicentekeliipio
143,586,735 *0DC07D95C19AEC67196326313E8C3031AD1D5B6F schleifering
143,586,736 *0DC6C538B681B8DE79321A27CDFFD4490A9E0A1C VIERENSCENERING
143,586,737 *0DCD279393CA2249A11A4F5E015A1EFD2F7B279A SCHUHFREAK
143,586,738 *0DC3862C3B9AF20C47BD6A36CF5D08D5939B77DA scottdismuke
143,586,739 *0DC898603E1C947BF545FDC2A7DA355CC2634D52 scufflin
143,586,740 *0DC4FE4A7C10E990D79421C8F275883E0C6AA7D6 SEATTLEROY0
143,586,741 *0DC8BD45DA099E4AB670D7B889653EC9DF4CCD95 S/EB
143,586,742 *0DC70ECAF91761C4BB5E258919077025C8F32B3B VIRCKIES
143,586,743 *0DC2E710CAED931A38A51AA9D44E019D02EBFC62 VIRKANESS
143,586,744 *0DCEB168CEB4AB75F6575065E0BD23D88657DB76 [email protected]
143,586,745 *0DC483DB41492A8D3F2CFE7E255A661D1DE36164 SEEK-(BERNSTEIN'S-COVETOUS-MIX)
143,586,746 *0DCECDA888CEAB63EB0E5458170AC2EADDDFA870 VISIONSTRIDER7
143,586,747 *0DC6955B5E349713FD8AB376AF10256892EC5739 sehnteting
143,586,748 *0DCD89A46391A6C5E14263BD1FEA969A39D9B4EA SEPARATION.FROM.THE.SERVICE
143,586,749 *0DC20F91CBC952A63E905CEECC2B744A42931A3B sergiopronovost
143,586,750 *0DCA4D8B4FE33F42F84CEEA2878AB50703CCAB48 SERVEMENOW
143,586,751 *0DC2755908575109B0CE1D4777034B049BE88811 VOLLEYMAC0
143,586,752 *0DC60790E8F268101E671F5D676610CA2EE18924 vonte.gray
143,586,753 *0DC631EFBD521BD5A03ADB6CC40154F28781CA60 VORFINDBAR
143,586,754 *0DCC6E0F70C34E4B49AB1A27F35FEED16C968261 [@sh
143,586,755 *0DC8E4B477DB38F794A6F6AFC962050B6D6145D9 sh4758
143,586,756 *0DCACF510621BBA5FF661BC70209538F0D875C85 SHAUNEM
143,586,757 *0DCECC00A9159C824EE2DA382DD8763E4EE8A1C8 W164174
143,586,758 *0DC811F55049D5314C108B4CDDA16F16BEF5C4DF [email protected]
143,586,759 *0DC4E9CC73272E488A6E535451E9FB712D3ADFE3 wagers3
143,586,760 *0DC3527245F82BC5D7E815D9A67A1DC4AF85C7A1 sheltonligget
143,586,761 *0DCC81AD348E3A7602DE68D1A5E75D8F6EDA3203 [email protected]
143,586,762 *0DCB8AA92E4AF4A3F041ABF1EE0E37E91B7B589B shenyi-daopao
143,586,763 *0DCA6F2FE24CAAFE9712F41D45CBA9FED7226342 SHIRLEY.HENDRICK
143,586,764 *0DCE68928526F81C98F8828AAAA3632F0C2AB610 wanetian9
143,586,765 *0DC3D81B5C600CCE3B3D6DCD0ED22FE0C8BF3EF2 SHOUTOTS6
143,586,766 *0DCF3723BABCDB5F72F00A5DA79BDF515BF89887 SHOWERRED7
143,586,767 *0DCE82EBB03DB71AC2D2791DD3422A336024666A sienna113
143,586,768 *0DCA058AF6E291B60770E869CCB38715FA61E096 „SIGNUM“
143,586,769 *0DCC31756B5FA609A7CC48E123B37E0126FF44E4 SILFIELD
143,586,770 *0DCFE500E6DA2F92434547B8BBE4EE0AFBCBF47B SIONANDO
143,586,771 *0DC9D6D75BF60D89EC990F2B5B4E86115B515D40 SIUSHIAN8
143,586,772 *0DC9AA767FB31077855716E9CF2FADBB32B9B639 SKOGIVE9
143,586,773 *0DC0815822FBCF47BEFFF1D63B4FB58FD700D586 SKOWPER6
143,586,774 *0DC4F287F2A7CA9CB4E6B350D57F55E761B8DDB1 skyttens
143,586,775 *0DC603C9C60E53C339E2D7FBE0D3408403550AA2 SLCY
143,586,776 *0DC01433D7347CBBF1B1138D5977CB779CFEA418 SLITAMENTE
143,586,777 *0DC90491FA20363805E9D561B2B85118DE40C0FA Warmwaterverwarming
143,586,778 *0DC5C1BB21955F2FC2F6D7DD5AB6FB27F7816B6A [email protected]
143,586,779 *0DC2D07B46025D1A334CD628B6F4047F3DCBEBB6 WEID
143,586,780 *0DCEF2E224E1B12095399176F678BA7C61431FCB WEKESA-BONGO
143,586,781 *0DC779F1C4F20BF2048DC01A3D40F3E56853D4E6 wellables
143,586,782 *0DC23676F7D82532D229745F2A247561BEC73CFE WENDY-MCELHANNON
143,586,783 *0DCFA93C1E78516D4DD35F019CD7BC0C263F3AE8 WENDYPHOTOS
143,586,784 *0DCD3CDBF2AD127B3685ED1C80A339775D5DF91D [email protected]
143,586,785 *0DCE564899A6FB90686666381D4233255559185F solheting
143,586,786 *0DCA3F096571CCD3BC819F249453D36BD3518B12 SOMBER.THEME.(WHERE.ARE.YOU)
143,586,787 *0DCD5459AC0D20D89B1F457999FCBA941DE96BC2 [email protected]
143,586,788 *0DC6E4ED60688F8BF98017A1C140CC68BD2132E4 WESTLANDS20
143,586,789 *0DCCF5BCE0425251444182EB51624D97065EA9D4 Spanish.Kebab
143,586,790 *0DC06183B01A0AC798722FCEBA86D0C1CB821752 WHAT'S.SHE.REALLY.LIKE.(ALTERNATE.TAKE.7)
143,586,791 *0DC05D0C059CE69B448F2E6C1354D87B7549C99C wheelingi
143,586,792 *0DC5A7C9B41EC6166EFC0F3E671749E1BEF0C5A0 speariering
143,586,793 *0DC98E0161CA14EA6F88F6632FA59CC0BC4AF027 spiaczka8
143,586,794 *0DCD52FEAADD12E653D1783D8B98DBB75E9F0F68 [email protected]
143,586,795 *0DCBC21CBD7F5EB223C028A46C96B988580F05E1 SRC="HTTP//CXMGSMZNCM/MGS//1176JHH2CHL_115_JPG
143,586,796 *0DCE4DCED133FF05715647D223D102947A220DA8 WILSONKNOOP
143,586,797 *0DC97A77A132DD4594B0E8AABD775374B53F1C58 WINFORDGIONSON
143,586,798 *0DC84C5C8EF380C2DC1C2A4BAD101856DC7F1785 winnie.axelsen
143,586,799 *0DCD54716C01D22F234A0C140C1EF91195251A58 STACYOUCH
143,586,800 *0DC5D809A2C9C39F8475C7965BEB6ACC7258F5D6 WIWIEKENDAYANI
143,586,801 *0DC563C9ED07FFC47EB0942075212AFA8C4AF6D2 WIZBALL-HIGH-SCORE:-THE-CELEBRATIONS
143,586,802 *0DCA6601F2B0C7B76F08926F037EF769EAB86802 WKLOSE
143,586,803 *0DC1862C52346AC275CE858BB219BAD586C3AF52 WOLVEZC
143,586,804 *0DC17B8F1E961DA7D7B8B707A116DA2CCD5CFD23 WORTHTI1
143,586,805 *0DCFA1081A971CEC0BE25DB0D591595778B4F019 starslive
143,586,806 *0DCDFEB921A00DF00C16014F13C5136EB9DB1740 steatonyssus
143,586,807 *0DC34477A5461192B64B6D108710397550949336 STEWARTPARROT
143,586,808 *0DCAB4F404449B692865D49CC6E536ADABBE9295 stimmedersehnsucht(disc3:mitalexandraumdiewelt)
143,586,809 *0DCE7ED38242264CBE0C63149431D1872E74ADD4 STORMTRYSAIL
143,586,810 *0DCF8E307047E2B21F5DAAC3828FA4CF5BB55B6B WWWSCOTPUMPCOM
143,586,811 *0DC7036099233FAC17F065B9AF921250C0772CE9 X17479
143,586,812 *0DC2985E204A9883FA819E9A1D69DE8E9DB5238E subbranch4
143,586,813 *0DC0A7B693A6E93CFA0FB12C7942EBBD62739E27 subcranial
143,586,814 *0DC2C05B6F03B437202CC50E0817AAC5BA0DE4AC )X(.~`.D#####P
143,586,815 *0DC390DE71FAEBF85B77443DB5A6992AD8DAA0BB X=F
143,586,816 *0DCE2959821442CB8ED4D31E353DD91FB4EB6EC7 Xgaaa
143,586,817 *0DC2967F979EE254E8C628DB6F5FB7764313B8FA SuiteNo.2forHarpsichordinFmajor:IV.Fuga
143,586,818 *0DC222EA395D75C74D2BB8D427E7FEDC124B1D00 XLVGDLVZC
143,586,819 *0DCAE8B19B4D40F3FD272F9C66046DC2B78DEDD7 sulphur_alcohol's/@/lf/@/r_'/&/lk/@/,h/O/l
143,586,820 *0DCF99EE9A9FABC5CBBF7DBF0FD312EF59F90539 SUNDANCEASDFGHJK9
143,586,821 *0DC6C5D3C9E785A27DA37C99CCA08740B1BBABD9 )X( O~0~ <####P
143,586,822 *0DC21FA052F3BF9955781E18437C64C3D778907E }x{.o~.d--8
143,586,823 *0DC550719300BBB5368258EF27D8D37AC78AFC3E SUODOPOGITSAM5
143,586,824 *0DC29A906B996FC1BA88C13AF58E1758EE7427E6 [email protected]
143,586,825 *0DC652CD09B32F198A14CA9C247D8F4DF18DC04F superdecompound's/u/p/@/r_,d/i/k/@/m'p/AU/nd
143,586,826 *0DC328D0896C49BC5D295E79333BDDEDA7D028A7 xudiai
143,586,827 *0DC592FBF4F866EF40C4694B1208804DB2E93BAC [email protected]
143,586,828 *0DCFD6C2DBC9F1C26BE7D19B56364B8EF5C23913 „suplement
143,586,829 *0DC1FDC9C45517E1A43E5BDDDE712CFA0A3FCB4F SURENDRA KHURANA
143,586,830 *0DC35A6D8377D3942F6CBEE0E37B694F8F2ABB39 X~V+
143,586,831 *0DC1A980833F1E1F585EAB9FD44D236649F85186 SURO MENGGOLO
143,586,832 *0DC37E70D9B25E4EBB727DED7A3256526185FE3F XXIF
143,586,833 *0DC387C397A2C4D8555C6BB191AAF1BEE67EDFD5 SUZDEVOE160TALK160
143,586,834 *0DC1ECF1586773A6B6782618C08772C72183ECF2 swimteam55
143,586,835 *0DCC3018FC698E888F9E2EED99AA4BE42E2C2273 YANKEEMALUH143
143,586,836 *0DC48CFACED07B6D27FD2D85C39AD8F439108F87 YASINDUHEWAPATHTHINIGE
143,586,837 *0DCEC02E4678D4EB4B69028B9CB3D2D4BBEFE122 yayi
143,586,838 *0DC6FEF0D5EF37A5A4FB6E53FF91E37D3DFF1788 YBURREBMA
143,586,839 *0DC6B83EBB28A2C34D65D019DCC6D29BBB484E2B yeastpowder
143,586,840 *0DC9EF792CAEC6E42E87BE89BC1C8A607314BE47 YESLEKXZSAWQ
143,586,841 *0DC76B7855C466DCFBD3278211D4703A6C7D2A7A t7bzylzx
143,586,842 *0DC4EA6F41FF037683BF543CA36C777AD4E8CFEA YHAR MAWMZ
143,586,843 *0DC229A6DFA06F96121E89078D698B798654C196 yolanda-lloret
143,586,844 *0DC3B433934BF90F05F2EC21AD3780164F8F8C65 YORYIJOHANA
143,586,845 *0DCAE2BE385944F09720366E7216421CECF0C153 tamanowus
143,586,846 *0DC8E622F7767AC4FE3A66FE3BE750654CB18C4F YOUR-SOUL-TO-SATAN
143,586,847 *0DC2100804D088AE3F51C8A30CEEFC9F112C8054 YQI|
143,586,848 *0DC0DC4DB66AC6C703BAE905DD7C25AD9900A7B4 TAPCHIHOAHAU
143,586,849 *0DC7102F405C33FB7D4C4604ECD010719E486D05 yurisantiagonillo
143,586,850 *0DC12A6BBDFB40D135B4660DB6498AA08D0F53D5 TAYLORLENNONS
143,586,851 *0DC3FA47064BC83613E6A3694C8DD7C71FBEF019 TCIPEDNU1
143,586,852 *0DC2589BE909BF80D81A1E3A53B92F3FA56B34E0 z34107ri3$
143,586,853 *0DCDF5208AC239DB930B40D5BD306FB47A10CDBB ted-esi-samson
143,586,854 *0DC7AD878D65B03067335C1C941529430B199840 [email protected]
143,586,855 *0DCC3D61B7AD28D28C9E27BAB036C2165D800C23 TEMPUTTELEMAAN0
143,586,856 *0DC858488BA2A6A29C6B63AE372CE1832FE74D29 TENIAMOCI
143,586,857 *0DC0BD913A01E06FA8B7F3017110F902C8599FEC tenllic2
143,586,858 *0DCC8FCB66A3746655C98DB78C58302EC165043E terrellsa
143,586,859 *0DC86452D497B2DDE1B15D94B158FFE9E8B3BA8D TERRENCEPEDDIE
143,586,860 *0DC5FC6C1D6CE16801B5F172A19E53A99F15120A zelda-harvey-carvalho
143,586,861 *0DC8E694CAB2D800724D482809B96C800AD9432E TEXTCENTRALERS4
143,586,862 *0DC67403A6A28FFDB5C2A7422E03C73AA8E33A97 [email protected]
143,586,863 *0DC6821A74BE54EF298A6F21CCF07BB68C0EAFFD T-FORTUNE
143,586,864 *0DCA0C98AD6560A4089EA78BAF8C025F667040B2 TFSTMBSW
143,586,865 *0DC8D3557E99B6C3DB8A218D03BD1A0B553E1E5D zenith22
143,586,866 *0DC1D26585F8D261F0417D991053CDDC0C756C7B ZEPHYRARES
143,586,867 *0DCC0DF7B6312389D8FAC39B4DD807F0A34343A8 THATANGIE12004
143,586,868 *0DCC93C5433E8645DF6FCB6647237081F84DDEE8 THATSTANLEY1234
143,586,869 *0DCF127017997F2AF691CB3ABDFD096725846A18 ZINNGUSSTECHNIK
143,586,870 *0DC0E0101C5AC848A9CDA6D067CB3049803FC3F9 THEFROGONTHEBOG
143,586,871 *0DC1CA70F5BF048A7B9E7B971AB716A84DC2B953 THEGANGES&THENILE2
143,586,872 *0DC4D84FA65264E2193C6B786A9FD18F71C5C5C1 ZSUZSI.KOJER
143,586,873 *0DC9A2457389FB1A20C240CDC2E2FE6F968307D6 zukaufe1
143,586,874 *0DC4A75C49AD287FCDEA72F3A6A1660015B3F7B0 theverybestofchopin(disc1)
143,586,875 *0DC27FCA43A65B8D3EF264C8187065D63EF5FD77 thir2
143,586,876 *0DC565A75D1E6897847E6C77C325904D8AA1E5AD διαμαντίδης
143,586,877 *0DC79C42F2AC7494DC00D8FFE991E83524452878 ΙΝΔΙΚΌΛΙΘΟΣ
143,586,878 *0DC0F982A103EB112E42C9A1743177BC7A4B160F thomasciardullo
143,586,879 *0DCE7396BA06CE95C3FB2F43B37ADD23384279E9 [email protected]
143,586,880 *0DC82B355014CB5C5EE0A665BDF7161BA0084C3B THOWMIS5
143,586,881 *0DC27F610EEA470C0C8CB2786ED40411BE919F73 ντμίτροβιτσ
143,586,882 *0DC92736D22C4F7BF5C471644832F4D106C63060 thronedrei
143,586,883 *0DC59239EA33F631037E4E2B2543C1B134D3B798 thurmancsubak
143,586,884 *0DC4D612BB793D0B98C38996970D5A337F454767 thy.luha
143,586,885 *0DC60ECDAE3299DAEBE55BF42603ED712B4B97C8 TIENAAVAS
143,586,886 *0DCD50577835BE8803E0C986918034471114D4F4 TIME COULD PASS (FEAT. JONATHAN BUTLER)
143,586,887 *0DCD781AC729280C054D671155D6665D4B42ABB0 TIMEFORTHEESSENCE(FEAT.GRAPLUVA)(DJWATARAIREMIX)
143,586,888 *0DCDABDA1874012EA29954D10A7CA1018D645F2C φουλγκίαρ
143,586,889 *0DCE6ED390DA0E2FC1B697FA09975D23B04F41A1 «АФРИКАНСЬКОГО
143,586,890 *0DC60058BC57A5D662CE85D0FAFF5C2273B15AAE БРАНИНГ
143,586,891 *0DCDAD1A145226A246C2FB1D587FE5C18220FFDD tizeght
143,586,892 *0DCE370669186ED3DB71D8E7E99524E5EFE6BF78 ДИФФУЗИОННАЯ
143,586,893 *0DC39ADD26C97ED3161A294FA9FBFF460FD06341 TONISPUZ
143,586,894 *0DCC055A772BF9E45403B490C6BEB7A4711E2B40 TONYKIRSCHBAUM
143,586,895 *0DC982BCFACFD9D0AA9C00C0E1C0D2BAED028EF4 НІКОТРИМИ
143,586,896 *0DCDA6D8513F1F518C63104AF8508C4F0327A513 TOOOXZA0328
143,586,897 *0DCDC762F44032C1BD52E7ED074AF88793F4F529 torref
143,586,898 *0DC83D607D6F9E02A415A17E633C0D2605E5755E СКРИВЕНЕР
143,586,899 *0DC3214DF3B7B6AE8DFB1FACEB464C5ADC1E3236 УДАЖНО
143,586,900 *0DC4F2367B027BE492B868741502B745BC4EAE16 УНИВЕРСИТЕТЬ
143,586,901 *0DC80995B18D40C6AC88D0B102F73702CA580BC0 TRDNTSRH
143,586,902 *0DC92928793E45AAB66E5917B6815603BE35EC02 ЧУЛКОМ
143,586,903 *0DCCF7EC7AFD9397C110098F15D7CA0D5DBA4DBA TRICIAGEISE
143,586,904 *0DC834D93B21EB24FA70075CE413B71411344DD6 TRIEUSE
143,586,905 *0DC138055685D2C31892FB5DB6FC15FDCF984484 TRYING.TO.APOLOGIZE
143,586,906 *0DCCE307401E598A5DF482C8153C532F9D20F777 [email protected]
143,586,907 *0DCC4BF2BC72F25CA601E40714F6469C6ACBE72B TTIMATAO
143,586,908 *0DCD7E4AB175033AD14E9052DB403DD283319537 TTIPPEN
143,586,909 *0DC3FDC67D12D773123531D620B4673935A40F6F 坎伯兰郡和TEVIOTDALE公爵
143,586,910 *0DC6F5CCA1BE91DCA620E98E5C9C883A8FE17441 Tungsinn(Melancholy),Op65,No3
143,586,911 *0DC919465708C732B8B5FD59C3AA96581D5C7887 TWYLASOUTH
143,586,912 *0DCAE519FDADB36367705C72A4BE4348261C5923 TYKOCIN.PODLASKIE.PL
143,586,913 *0DCED184D6A9EE63B22E91F36265A8F983BCC57E tyl5
143,586,914 *0DCFBFD3EDE49C2C357D9E5D8F1AE4BCBFEB554A TYPOPHOTOGRAPHIE
143,586,915 *0DCE3884BB69BE846AFD78A4265A235F15089DEA TZVILANGER
143,586,916 *0DC687B02BFE08BBE4511BB784EB199DE3CDD47D UECES
143,586,917 *0DCE2665F70B7DE0EAF8A7658E908540CA0D6BD5 uforsikt7
143,586,918 *0DC0DE1B0320D5738B59C45A11F3BDBD086D17E6 [email protected]
143,586,919 *0DCF54D3C4696EEB4302CEC44AABCE242017E3B4 u,?k
143,586,920 *0DCF8E28A290D2C95CE99F6E71C4EAC65064D5D9 ULETREKAED
143,586,921 *0DC5FFC7E1F295CA2B9C7A84D1898C52945D8C15 unattireding
143,586,922 *0DCF42668513175F4011AE75DD3E5EBD7463D1DD UNORDENTLICHES9
143,586,923 *0DCFCA6A06DB6716CA05BD6520B9E9DC6DF33637 UNQUILT7
143,586,924 *0DC0CE26AB1791482B311EDFA4137CFB3653AD33 UNREMISSIVESES
143,586,925 *0DCECFAD28C05EF82FC91E7D74B7022034A73521 UOAB
143,586,926 *0DC628F6A5E87BFA324B54A13A7A9CDF3B902BF1 usarhodeisland
143,586,927 *0DC4AE9575212F0973D35A5F84482C10D5C4D2F9 USIFOFUMNANYA
143,586,928 *0DC31DECD67C07E50D67E5D4D6F2FD7F37F915A8 アルト・サロマー著、足立暁生訳、『公開鍵暗号系』、東京電機大学出版局、1992年7月30日、isbn
143,586,929 *0DCD1BAEA3D501AF13A4C818AFD596AFF517FC99 /usr/src/linux-headers-2.6.32-24/drivers/char/xilinx_hwicap/makefile
143,586,930 *0DCA086118C5D53AB64FB87DF6ADA44C4D58E374 [email protected]
143,586,931 *0DCBA2B25E43563E86EC42B04C36D0FF08DAA50E UTUERUUJ7
143,586,932 *0DCA23B7D023CF5D6725F26ABC4AB6B0F468459E VALLAKS0
143,586,933 *0DC5CD0E9853C9742B1F60D19337EEC5965BF611 VASILY-KANDINSKY
143,586,934 *0DC9AB2923BFB552ADA408ED6CE9F7976F12F67D VERNON.WICKARD
143,586,935 *0DC4FC80518B829182527004B63CFE7B2D96BDD6 [email protected]
143,586,936 *0DC87037E8AF8E917D852F35D71C591AED3E73F5 [email protected]
143,586,937 *0DC0BDE995864DD1A88050D910B7E74715441F4D 0THEDONKEY
143,586,938 *0DCC5611008845338138CC1E0381E9065BB2E63A vgccssrsing
143,586,939 *0DCF25AF7C40C836D3DFCFC260204C5CD76D14DC via.vivian
143,586,940 *0DCB96B12ED0ABF3693B974350CBA1AB74D40E43 VICENTELAGURAJR
143,586,941 *0DCBC8E9F3FBCB9536FEE8155F5081DAB4D597BC victoraliens
143,586,942 *0DC64E482F038BFB92E8DD4EDFD2E192846BAB5E VICTORBAYLOR
143,586,943 *0DC52C43808A80F89F9597FE12A521482DA1A36C VICTORIA-VENGEANCE
143,586,944 *0DC0B3006FFE1E6DB75E2194C11993C01DD7B3C9 VICTOR.MATSETELA
143,586,945 *0DC44EDEDAD50CADF6F242EA4E260267B5C41B0F VIDANTE
143,586,946 *0DC9F7911D40CE88904C258BF76C6FE0AB45F4E9 11 M
143,586,947 *0DCE3DE9EFBE63A275B6215DF8F87A3DC48CB07D VIJITRA-KONGMUANG
143,586,948 *0DCAE738E4F6C9C071F487298E5AE1B8B6A932E7 12月30日、本人プロデュースによるアコースティックジョイントライブ『ACOUSTIC
143,586,949 *0DCDFF5261487F2082B5D50FA554C6D4AB5B9249 VILLAESTRERA.SAINT.ROSE
143,586,950 *0DC292F41F573BEE4DA7D6F3B7BBB4635199105D vincmontainel
143,586,951 *0DCD852E78A0352BB8C736B81C62E7F613CE2E55 13.NIEMOELLER
143,586,952 *0DC28D1C1C5C38FA951F171CB01FA83817464DFA virgilbaldridge
143,586,953 *0DC6AF3E63FB8ABCA835688ED84B82F7E7E76A85 VISSZASZAVA
143,586,954 *0DC8C589DE2A73F214D6D94E32302B7CAB0DB160 vitalizations2
143,586,955 *0DC1866C43546FD7EB0A837C9B524969497D1711 VIVENTAS
143,586,956 *0DCC48612F5065727FDD9FF38EC518925771BFB8 VIV.SHIN
143,586,957 *0DCFA9CA5EF947EDD41F34D68954008691B44978 [email protected]
143,586,958 *0DCEFC2579B3A926FA605DEE32C9ED28C0D161FB VMLYZEZEBHQQHED
143,586,959 *0DC2A0FDC9C3C5F528ADB747A45429817A7BC6C5 volgouralia
143,586,960 *0DCB6E742A9578F106AD6B1185D5E69E353B7062 1633634 "-dirk-wird-nicht-dabei-sein-
143,586,961 *0DC44577DE27B4A3F52072FFB55DA9A42135B7ED 16bibi
143,586,962 *0DCF8A3E475F5AAAB42CD54FAD19B7C5AB7B59FF VRGAOU
143,586,963 *0DC63BAD06401BEC99AF5D741DFDB5CB4D0D3440 VTRIVRY5
143,586,964 *0DC10A4AC6BBF5285136186377C9FE39A8442074 VZ-3RY
143,586,965 *0DC6E2134934295C636F13C3E9E447AC403C88B3 [email protected]
143,586,966 *0DC3BAFCC6FB65AA157847DBFF35B38C869AB733 1851768 AMERICAN WASN'T MORE SPECIFIC .
143,586,967 *0DC827B272CBD4374DB87552C64505FB8DC7B9E5 wallacehighfill
143,586,968 *0DCCDD5B2B15A079AC6A292E0181394CEA5CB4B5 1991DA105266
143,586,969 *0DC78DB03E973E86EC0DC99EA2B2DC992BFEA918 1.ahab
143,586,970 *0DCFB60893EC36CF7503F344093B7F3E96DB7052 1 antiddrtoene
143,586,971 *0DC2605624CD25207646A464F69BA3BD25850CBE 1.BALTIJAS
143,586,972 *0DCDAE72165CE9DD6D6C10537D21EA89C5306C5D 1.ER
143,586,973 *0DC4A9F5A4F78C68EB413B9728FF94129B137769 1.HOCHGESCHWINDIGKEITSKURSES
143,586,974 *0DC2C433BDAAF6E544BEEF75443C8A9531DF59DB 1iluvhummer0
143,586,975 *0DC5D65CD63445ED5FE05B3B8B125BAB57DE40AD 1-kanavatasoista
143,586,976 *0DCF1E4364D245461099DDF2879F11E326C3741B 1KITARANSOITTOO
143,586,977 *0DCBE66672DF4CA1CC76963960FA0B6A8965932C WARTEZUSTAND
143,586,978 *0DCB4EDC6F306E1433F8573A36004A041FB50888 1lachs-gehackten
143,586,979 *0DC600E929AADC41E4CE135214B90434D95BAB97 WAYLONTREWIN
143,586,980 *0DC80801F8C9D2929D85025E696E1D0E0924B9D5 WAYNE.DENERY
143,586,981 *0DC00D8A6748B65D4C678B25EAFC112F5C110584 WAYNITAPHILPOTT
143,586,982 *0DC1D3810F65CC1309198F6A945DE36D3133D44A [email protected]
143,586,983 *0DC4DA94C35E2A71B61FBCC843607F8436862C04 1 NESTBAUER
143,586,984 *0DCD00EA5A13F71E06E8359B8CE536C699309C56 1-PANKKITOIMIHENKIL
143,586,985 *0DC3D9E5AB3FF861117A2EB61C97AE32227DDAB7 wenceslas.savariappan
143,586,986 *0DC4B473CFF5BF3B22F372326CFB033C88FAD41F [email protected]
143,586,987 *0DC13896C536E42B3FAA21E8C38C51E87AF6AB70 1-quarchioni
143,586,988 *0DC0B4D874B2E690287B42A929ACC18D9C1D120C 1-REFRAKTIO
143,586,989 *0DC0762D1EB58B3F5CC903C98F370220E97024F9 1.reittamo
143,586,990 *0DC9D41F90A38A63284D586B782A343E8B9FC4C2 1RESSOURCEFORBRUGET
143,586,991 *0DC7370FFF59ACDC6333A835A1C6EFEC35D6640F 1.TEHT
143,586,992 *0DC83D3876F09ADE52315892CB60B5E7B1A6383A westonpense
143,586,993 *0DCFF42D06C1EDA8DF1BC11F383147FE0F59A2B6 WHAT'S.UP.FATLIP?.(CLEAN)
143,586,994 *0DC86375A6602BB101DEAB64984B93CF0F56B819 WHITEBUTCH
143,586,995 *0DC791AB7E9B7C291AE2C55EE94C8405AE03A4BD whitney.e.murray
143,586,996 *0DC3C7B3E11526670056FAADB1157D4B6935726A whitneynicolevanzandt
143,586,997 *0DCE776FAD09E1193F5E246BBB0CAF0B50C9E3F3 1-vempeleeseen
143,586,998 *0DCFA2F512FBA38377E784BBA6D1CBBE43D10D71 wi11wi11
143,586,999 *0DC0369BB0397DACB2A3552A7B68A60322653CA2 1 VIERET
143,587,000 *0DCF4D81FDAADDC229DF75BA0EA98BFE26E249A5 WILFORDBALLAGH
143,587,001 *0DCA49B42027332190CA1FA14C8639FD68D8F037 205789 KURZ NACH 23 UHR HOERTEN DIE ANWOHNER DORT EINEN SCHUSS
143,587,002 *0DC445CA93311546037227E02FD6AB2214C11086 williammistretta
143,587,003 *0DC537CF4622CEAE85F09F5828FDE1B82F1912AA willie.a.hill
143,587,004 *0DCB5EAAD5075C6B1E9F623CB65CE54F7419DC33 will-tichenor
143,587,005 *0DCC0B21F410856503A0FDAE35F80D318E7B7E2F wilmernyseth
143,587,006 *0DC05FC12875CDA0DFDA44BD1E313E99309D61CB 21620vk
143,587,007 *0DCB855A0702F5C2EC26FC6DD2A3D5E355F468DB 2275536 VAROKOON.MAAILMA.TORJUMASTA.H
143,587,008 *0DC1A508A0C789F6F2B54210344BF1431207F702 2325460 SHEWASSENTENCEDTO58YEARSINPRISON
143,587,009 *0DC5F3214ACE9EFAF2BC36E307B873EF5B84B8E1 [email protected]
143,587,010 *0DC549A93A7D1AC27E0849725611CEDF87CFBEFE 24.09.1756
143,587,011 *0DCBE7897C6936F95846970D0304D6FF460160B7 2502588 joskus-psyykenl
143,587,012 *0DC75E9F75F6B415E03EE89D934C88D73EEC477B [email protected]
143,587,013 *0DC40FB456FA74141AF6B0236DFC7F388E07652A WORD ON THE STREET
143,587,014 *0DCB9DA51BE07E8E5203968397043C6018BD84F4 WRITHED
143,587,015 *0DCDA3ED71BFD4A401DAACB2DAD7F1FCE913AAB1 w,uk
143,587,016 *0DC5AAA82DD2A70BCFBCC19582624BC69CA3AC11 2ARLAN
143,587,017 *0DCA4453E348BBA8B62742269C1C36DC7B58AEEA WUMUJING
143,587,018 *0DCB2E0A92C09F7BF551AAEF48E787235F35FE9B WWWATHENADIAGNOSTICSCOM
143,587,019 *0DC4DDA1A538E0608F4856F9BC02090E91EC96E4 2ELRTSSAV
143,587,020 *0DC6756FE3D28C242994D9BA66AED471766A3077 wwwjjcom
143,587,021 *0DC368ED42F68158D269C4A94E673D3A8DE56FDE 2fcarenno
143,587,022 *0DCE7E16C31B0ADD10747BF046BFDAE940EF487D 2hyv
143,587,023 *0DC7CED92C0EFEE1F708A4B03BE7597FF3E80914 wyattmittelstedt
143,587,024 *0DCE860962934EE621F3B82AE39C0A9C55DBD8CE WYROGERG
143,587,025 *0DC9798D583F8CB609C7B100273FD02555E660E3 2LYON-MONT
143,587,026 *0DC59AEE5B1846878CDEAC7C0158976C63E87D25 [email protected]
143,587,027 *0DC67080760A849CA8A1A9DF7F02144F6AD9530B 2THATBELLE
143,587,028 *0DC991EF701806B2D0F5B16DA8C86465C097D385 2USEINZELHANDELSKETTE
143,587,029 *0DCB870A64DC89827C127C6369C73B9FB4AED226 3>.`~.`~(>_<)
143,587,030 *0DC304B5A3D09F8961898620A8264D30F886F148 [email protected]
143,587,031 *0DCF84498283FB4E3A40D7E9B894DED0E233627E [email protected]
143,587,032 *0DCC150378FAA353E15AFF1B3DF0E7C89FACB208 32fa881523913774e0440003ba962ed3
143,587,033 *0DC438213C661660DEF0F1EB5C2227980BE04CE3 [email protected]
143,587,034 *0DCB3E7C268A1F310AC192612BD73564FA208D15 36-EISBERG
143,587,035 *0DC49FD029578E8397EFB4BBD96D763D7E014F39 [email protected]
143,587,036 *0DC4577BA170626B7F294AB120BABDBFCEBA9223 Y9BH
143,587,037 *0DC9700D829D0344ECF9F13AE900363937DB7AB8 yaangele8
143,587,038 *0DC10A68CAD7D4D9DAA73EF6A58181907FF29B90 3BULLMISSY
143,587,039 *0DC1CC66B735DBC7CA9592821A8ED8692AED2107 YASMINA.H.SOLE
143,587,040 *0DC0A6D8FF4406154D610FC69C47AD4D0136285A YATBIANESH
143,587,041 *0DCC319FFB3754E2997E19361337E4798001A212 3KINDERHAENDLER
143,587,042 *0DC12A02427A5D5D79AAAD661430D72F4BDE4B38 3NAERTIRE
143,587,043 *0DCAD4B9E996C91C1A7963F9CE6B418DE82859FC yehvaadahai(sad)
143,587,044 *0DC23E6DB9EA259A9C7505434CB74151EFBAB279 3TARTAROUS
143,587,045 *0DC8C08F7E21DDD8B6CEBB92E8056F779D7DE7AE 3TOKITAYA
143,587,046 *0DCC2C209D7ABE5E4B794166B3193C5BC66831B7 YLSTALO1
143,587,047 *0DC02068573BA828755474AE999683FA52CF1F45 yolence-pay
143,587,048 *0DCDF55E62FE6BF7F72E7CBD22852E627FCC66F9 [email protected]
143,587,049 *0DCDA2172A142BD8376E50BB9CC2EB213AA8E731 [email protected]
143,587,050 *0DC9674C771F74D13BC82BE903E4853F599486BF YUKINENG
143,587,051 *0DC8403E614AC5CC0B3DA70404A17FCDE4B89A01 4CARLLIS
143,587,052 *0DCCF48961AC611324D2617A285C26B676921929 YVONNE MARTINEZ GONZALEZ
143,587,053 *0DC07AB40E1C91D00E79584B9DB6176DA6DA4254 YZETTECAVASOS
143,587,054 *0DC396CE20C72171DC43B99C8683640D9C5A93A9 "4I
143,587,055 *0DC0659AF7A73010AB1964DD5209F51650A71D0C 4.KANADAUSA
143,587,056 *0DC2E68D11049DA00560B195EB83D6CD9C461FAF 4KUVAIDEA
143,587,057 *0DCE95483D0A47E64D45A69F04D9B087AEE3597F zanem-azeit
143,587,058 *0DC1685BA3EABB4904B3AF04D62F19E76F181088 4NOSPMOHTBSW
143,587,059 *0DC859A30B7CACD34C1A0D7A28D67A4F8CEF971F 4OAWNXSE
143,587,060 *0DC78766641FD516B83B9B81081B7FD67569E179 ZEIRESSIARGED2
143,587,061 *0DC2310DD6DF03B0424E7750CA0B40E9BA364A3A 4TIARERTNOMER
143,587,062 *0DCD3BC14624C104F88DF25D00086E254B03A25F zham-azharjie
143,587,063 *0DCE189E70AED3AA4DF2E9D0C9BC0BE96C04A312 4X!
143,587,064 *0DC74637C1696FFCA27EADB31E4AC27DBDBD3643 ZHE.ANN.LEE
143,587,065 *0DC3054DD4A45E5740D672B09111E237A712FF30 545143 YRITYKSELL
143,587,066 *0DC03DABE70690795D51894F235413B7896E27C6 [email protected]
143,587,067 *0DC1FD2E166F2B5C866B7E04842CF9ED1DDAC413 ZIGZAGYAWN7
143,587,068 *0DC5BE840C90844B9DCF3558EFAB4C6FB70DA1FC 575ada
143,587,069 *0DC174C01DCB72FA9AF526A5D4337126FBD95321 ziquanawright
143,587,070 *0DC4F433F9ACDA38959F59482A91CEC0458E2E11 ZJ95JLH922
143,587,071 *0DCBC2DBE09ECA24D829BF65E1339870CCDE7C3C 5BORIOSIS
143,587,072 *0DCF303825E30559DEBE17D0AB604E46648B6F30 ZPRISTUPNUJE9
143,587,073 *0DCC3D485EF2B27BEBADA30090D108A31646805C zzaacchh.sanchez
143,587,074 *0DC8CCABD6A562429B78F15719D7B8AD9842B134 5FISHERGONE
143,587,075 *0DCC98D36EEF859C0B9628BA92221B225EFBD72E 5ganzenhagel
143,587,076 *0DC12EE117B13FD4B416EED60B26624A8C1955BA 5iamflowerpot9
143,587,077 *0DC1D643FBF3D4E7D23C3D7364A82B10B4DCEA64 5MARCH1481
143,587,078 *0DC86D96099E8AE1DE4586F339B74B2D6E5605E3 5NIAZIAN
143,587,079 *0DCF301497ECCB5BABDD0AC387F8E95C3208EA18 5OPTCHECKBSW
143,587,080 *0DC2D15EB9B08DCFBAB2A08D492E2A646259ED33 5PERSONENGESELLSCHAFT
143,587,081 *0DC4CBD8BBEB78520DF02B31DE0000CF822D31C3 5PLAYERSKEITH
143,587,082 *0DCCB8FB6AD790E17B2F424D85919E977F61074C [email protected]
143,587,083 *0DC6175692AD693BE0D388195E2169D8BF34958B ИВАНОВОЈ
143,587,084 *0DCFD912BAE9E035B7C133A5D4A9A692FF5A21E9 ЛЕГКИ
143,587,085 *0DCC453248F87A245FD8F65BD9C1C681CBB38766 5THEROMAN9
143,587,086 *0DCDF2FC5541428884BE13CE20367E4EE3CB576D ПОНИАЯ
143,587,087 *0DC3B23F39652F050F38BE97A7625BFE4EB855E4 650938 attitudes-towards-crime-were-also-polled-
143,587,088 *0DCC576C5CA81CE935B0134C68C0E143EAEF5B67 6DOOPBEWIJZEN
143,587,089 *0DC98C35FD33E6B5B34848FEBE0494492C386BF4 УТЕСНЁННЫЙ
143,587,090 *0DCED5FE7494B461B35B5308D730FBC886A13754 6GYMNASTBEANER
143,587,091 *0DC7BB81ECC5B2EAEC1EF876B2213A04BCB9C01F 6katatura
143,587,092 *0DCA45C6833251DBE837FF84A19C54B994728454 6LEPELBOREN
143,587,093 *0DC8F3777EC0F5715F5AD4996D0E45EB7DD97B2F 6OVERRISE
143,587,094 *0DC8DA9777A01CFCCF41894C1B25F3F58453E3E0 6-rahoittajaksi
143,587,095 *0DCE88BF55C09FA723C5ECF72B87E07460AE8509 6SHOWPIECBSW
143,587,096 *0DC637CBA4BCF2044043922248E065BCBC237F42 6STEVEJAVIE
143,587,097 *0DCBF93DAF4DE7ACE189E2AF52A9DE6A36578481 6.vertriebsunternehmen
143,587,098 *0DCC284A63E3CF89BB18D2C1C6AC0D4ACA0C6B92 7ANHISTICS
143,587,099 *0DC300A318760BAA3C055F2F18A4828BD15B57A5 7CHAMPIONDANIEL
143,587,100 *0DCB2EDECF516C18A49699CEC9E422A7A810B402 7CHLOEPLAYBOY
143,587,101 *0DC4DDD7D3B64677F6F63BD16046EC23847DF556 7CONFLUE
143,587,102 *0DC2F8200EB35EECDEDAEF90923A6A577BFE75D3 7FODERINO
143,587,103 *0DC22DA6FB40BF4B51C79F542B449EF333CDC622 7ISOLATIELINTE
143,587,104 *0DC463EC69F7D2B8DB611F32A650C3A4B98D4FDB 7MUMIFISERING
143,587,105 *0DCA1BB756E1A76DADE48DACBE26AF954B79BF19 日本鉄道PT3
143,587,106 *0DC349CDD11036B6AC600D92B994BA50668BDAD7 7SEGAIRRAMER
143,587,107 *0DCE1968B140E5757DE650BD463FA6C9353D4AEF 7SLALAAM
143,587,108 *0DC2FEBBE0051D5AC1B52F5563C587699E112D8C 7SNOIRELNARB
143,587,109 *0DCF5094BFC54E59626435D553BE3B48CDC2321D 88bronco
143,587,110 *0DC722E5EDF017862DF1FBA9960E9A674A8EF9D3 8ANVAPADYATA
143,587,111 *0DCEE99A6EB97FBE27135F5DA66671FE0648BAF3 8#B~0-Splat!!
143,587,112 *0DC2786B2F4B46B8F7BF09206EBF4D5D4F7D3D16 8BOBBYTASHA
143,587,113 *0DC9B7620E36F3FB76A20A57836E07D35C3D8E33 8debtful
143,587,114 *0DC4C6AC33155803A4A89C98969A09F930521EE9 8dhzftin
143,587,115 *0DCC99C82EA256AA3D96202313CE693C263DF345 8EXPEDITERNA
143,587,116 *0DC0E35C792780E5A9F80578E5F5D95608D3ABE7 8FC928
143,587,117 *0DC19856031F543183CAA74575CC9C81D010C7AC 8IAMSUNFIRE8
143,587,118 *0DC5E663939B41F59C0941FBDC58C4FA16A432F0 8=)***)O(
143,587,119 *0DC4B94705BC8906DEAD689EEA19A7E3CF5D34DA 8robertsson
143,587,120 *0DC81E0F6969EB3BA9D6DFBA45439B0B91B47A03 035HAIDEN
143,587,121 *0DCFB377BED8F539FB1EAD84EB4C5A986A01B549 05161345
143,587,122 *0DCCEDBC2B384329C3DE3FA6BFB983C036D22A0C 9amerikkalaisena
143,587,123 *0DC3CD95D44F1E86031FDE755465682794B58724 9ATTOLLERAMUSQUE
143,587,124 *0DC5438F352B2C1D6674EE76E3EA591CB8DE4100 1075.helsingist
143,587,125 *0DC9BCF02A3FE7AE5A137C838BA9733C9BC8DE79 9DOGBERTCAROLE
143,587,126 *0DC9A456C6B110BE1BF9E17462EE07FFA06C9809 9ERERELEC
143,587,127 *0DC195C234E8C5A7E5567380DBD9CD1C02D2B58A 12.31.1710
143,587,128 *0DC60C51D3929205657AC78782F85B587F9653F8 9INSENESCENCIA
143,587,129 *0DC61245C1165E02FD3FA99F4515D8088B8A9D83 9LUXEREN
143,587,130 *0DC681F6899B8279DF65D937CD9768C5602FE101 14taivutti
143,587,131 *0DC92E90093F68C5AFDFF5ECE3585A0C70DD5838 1504113 OMAT TARPEESI JA TOIVEESI PYRIT
143,587,132 *0DC8EE9C5C4B2AC5220397BF57D6630462724E6B 9OMOPHYLY
143,587,133 *0DC29BC412FFA2562A6BDB32D32D948EA19A98E1 154304 evden-ayrIldI-
143,587,134 *0DC6355F3392C9FC1E44CBF222FF65ED7E6DE460 1624152 KOULUJEN TY
143,587,135 *0DC809F20697B97AD2D02A7EF2F0AED91685E6B2 9SESONNABILE
143,587,136 *0DC30878EA5CDA9B6C67C50B64B2BA1228664391 173GIADA
143,587,137 *0DCB87FA8AAE81342D05A24DAD757026EE7283E7 9SPACEVALERIE
143,587,138 *0DC27334C81C5272B30CA5D543F32FF0703AFA8E 17VERFREMDEN
143,587,139 *0DC48763A91DB2C5C450100BAC8783B54EDBB52A 9THEBIOBOY0
143,587,140 *0DC7E88186F20E75DA925B7FA00B70486BDD9A29 9TNASSIREHCNE
143,587,141 *0DC3FFDD54849540355003838FE09F4857706F7D 9VIVIDATANET
143,587,142 *0DCA3B45F8EBE2F44BE1D39297D5A5E3237B0E65 1978040 N
143,587,143 *0DC7514234C3EF6B16D81C181D7C6A777852CE4D 9WILDWOODWILD
143,587,144 *0DC89B36EA95470C8801D2C66E167ACDE328EC36 1AAMUKAMPAUKSELLAAN
143,587,145 *0DCCC7F0AA261AFF6AA8AF2F736B85C5C60CB123 a0z#+
143,587,146 *0DCD9D1C687E9B9E37E8AD28865DFCE68D5BAB6E 1 ammattikengitt
143,587,147 *0DC2F6565256FEA53BCADA9C033CDC0D75E0781E 1-ASIAKIRJATOIMISTON
143,587,148 *0DCD4983B8EFEC3D3946E0C1DA4D817CD44A9382 1BEKKERS
143,587,149 *0DC53C4B677F319EE9F47BEC8E68B4E25E96FEBC a;2h%
143,587,150 *0DC08DCE1E30B768488FE19DB9367CF4EE0A4FC2 1.betonschild
143,587,151 *0DCCCEB99E76006A20EBE717FAD2B52F928E44A9 A3E7U
143,587,152 *0DC8C1A5E6F4095475E6BFAF280443A4B614637E 1C41A34793D754716F439919FD1B6850.5G1L4DQ492
143,587,153 *0DC44A5794B59825B83A050927434D77968B400C 1.carers'
143,587,154 *0DC3C7113DF33E859831FA921C6E394B925BBCA5 a43r_
143,587,155 *0DC401B76AF80A76EDAE1DF5AC5D08A43DC588DB 1 DOMIA
143,587,156 *0DCB5C92CE188A355E0F571E82C5822E630C7F73 1.dvu-propagandist
143,587,157 *0DC16C38B626456754C8B7508FDD5A6EF77F691B 1.ecksieben
143,587,158 *0DC9A656029A446E9C3575CC12F026F95C7D9A83 [email protected]
143,587,159 *0DC2A876D8848AEDBA435FF985A5C0D0CFDCE205 1.ER
143,587,160 *0DC4A9F5A4F78C68EB413B9728FF94129B137769 1 EURES-NEUVOJIA
143,587,161 *0DC95CB7176DFE309410418453C4D2DC39BF8921 1.exkomediat
143,587,162 *0DC75E122AB4CF747880918292C8742160ACBDFD 1.fastenzeiten
143,587,163 *0DCC9A5FFDDB26E9081F3332E9FDD69E379FED56 1GEISINGINGISS
143,587,164 *0DCE3234F8854DDEB59DAD0D0B861637AB36137F A8SVO
143,587,165 *0DC9A957ADBE8511E2E453C30A6FC227EC802843 1.harmonisiertes
143,587,166 *0DCC459E69BBB0407326F1CAF8E8B31F0EB42B10 AA,9R
143,587,167 *0DC469ED34B3B52532345BDF5A99116A4614AD31 1IAMSTANLEY4
143,587,168 *0DC5B6EF9FEAD4B8766F1AE63D9448699BDF0F9F AAAAAAMERLIN0
143,587,169 *0DC9AB77D569EA72276A066EFF8B6978D8A7A7B7 AAABRD
143,587,170 *0DC032604178FEE67F1DDE336D22E35C2BBC068D 1.intersubjektiivisemmiksi
143,587,171 *0DC1AA381198570D15FAC1E3AA124FC0E7DCA406 1.KAIVOSPIIRISS
143,587,172 *0DC5B0122C42C1F37D812CB52F4A6864B36D3D37 aaa~U
143,587,173 *0DC5250111774FEA4558F484672EF890A27C9696 AAB'BV
143,587,174 *0DC8C6C56FF446BCC5AB1728C602AC4C234A4196 1 kuvam
143,587,175 *0DC6111220D2C0C2D76733247BDBE413C29905FD 1.localita
143,587,176 *0DCE8232796ECF650261D84B5501337455C35E87 [email protected]%4
143,587,177 *0DC64D834CDDE1B7D0B97C37CB08598640803E83 1MARCH1753
143,587,178 *0DC4B403ADF1980185A00A8B2D9674076A3F53E6 a=acr
143,587,179 *0DCC7F2572E7F5C44261B79E332973AE22F3CC5A 1-olba'dan
143,587,180 *0DCFB02B88C72EBEA07262BD00C763158BF3A43A AAMUK
143,587,181 *0DC82448DF3F0CD020307A4A6B482F56B9D5F436 aanskouingsmateriaaled
143,587,182 *0DC885CF6CFFC0FDCFF7D06579D0F4C60E7919F9 1-RUNDBAKEN
143,587,183 *0DC38BA2073C04C702E677E17EC6B8AC00E20F21 1.SKIN-FRIENDLY
143,587,184 *0DCDEE4229B83984F811A568BBD172C070F4652F aay6{
143,587,185 *0DC03C40DDB9E63DC2FFCA9FC38B6E8B9E6B2286 1-someone-to
143,587,186 *0DC27FDC88E4DF5FF749B1E8F1A9EE3729CA1120 ab5z
143,587,187 *0DC41CF7F3EFE1F58265C7F575D2BF5DC5EF16BD 1 STARTVERSCHIEBUNG
143,587,188 *0DCBE7945E84D363DE4BA0E09EF8D8190750471D 1.tanimladi
143,587,189 *0DC203270D743F2A7C965EBA39642EE21041F96A 1.TEHT
143,587,190 *0DC83D3876F09ADE52315892CB60B5E7B1A6383A ABDULBARIZULAL
143,587,191 *0DCA90A58683B69FE8E524501ED94A2D98ED6B7C 1VQE0Y
143,587,192 *0DCFE22DA049EB7D847C98981233AC16BEC57A81 1.wdr-autor
143,587,193 *0DCD9C7AF125C06E749A937BC4F9AD0756471047 1.YOKUSLARININ
143,587,194 *0DCFE260C72127BADCDE440C8D96BFDE40DFA586 ABRAM.MCINTRYE
143,587,195 *0DCBE240253A2D1C224F25446E4AB52A84DC8FA4 20060102
143,587,196 *0DCD643637EA8CE5B26E5F3EA757B4DBB481902C ABSOLUTOLIVE5
143,587,197 *0DC43E3AA08133B6B284FB033C2221022FF90DF1 abstrayait2
143,587,198 *0DCB91BD2D7BC8CA84B7D60245725715C403D4C3 2056629 samalla-my
143,587,199 *0DCAF32E951ED92640A309C3A68A6BEF01F06CF8 2172809 PFLICHTEN.ZU.ERFUELLEN.UND.SEINE.ZIELE.ZU.VERFOLGEN..
143,587,200 *0DC992C99C38356E36D52613C5DEE7198D4FD50B acdclogosvg
143,587,201 *0DC17EFCE686C479D9537A83B6D98D744E745461 ACED5
143,587,202 *0DC54FE7554F75E00C0BF324E733BECCE1C8FDAB 22353647s
143,587,203 *0DC7ACDD0B1FDD07F646296C1469FBA2CCA7ADD1 2239728 islannin.v
143,587,204 *0DC406901B5E413A3BE42134FF86514963A82BF3 23-bremerhavener
143,587,205 *0DC1B652CBD81C5A391E19EAA4BD7C674C0A59CF acqua!ntance$
143,587,206 *0DCA3B608F0504626D2E40D2FA2FD2349F38BDFA 2467000 SEN J
143,587,207 *0DC10B7E39CD9EE321477D913FCB0F41DB713825 266 ETEL
143,587,208 *0DC7BEAC4339C594E509E6F55ACF2742BF71C3F7 26april1158
143,587,209 *0DC9F8ADB7E1D6E791558E2A6A43FDADA2BC8940 26aug1674
143,587,210 *0DC538341D93C82A0E04F633EC578F58D2C05BCB [email protected]
143,587,211 *0DC0A295148C2B0760581856561B382F754893AD 2895681 alkuun " pelastusarmeijan etusivulle " 41
143,587,212 *0DCFD082818495F43E4D8D7E9F4FE7D62571C7A0 ADE1D
143,587,213 *0DCBEC68EE3E26D9C5C86E71D3025F9950AAAACB 298ISAI
143,587,214 *0DC1346DE6D0D31F0A5171FA67FBE8A7D181B27F 2 BIESINGER
143,587,215 *0DC53FE9FF008E7C0AA97267CC3AA493B522C972 AECEP
143,587,216 *0DC5F0560F5E0F1A72A4B6AAF404B345AA644CE3 AECNL
143,587,217 *0DC21F30C75F42E3820CD8C6609016438B355D56 aede?
143,587,218 *0DCBA5E3E4D96C09FD1BBD8ADB6202E284FDB4A9 2HOLAHOLLY
143,587,219 *0DCB9AA3B3DF3097067D3FEF2A94198FA4CDE082 2hyv
143,587,220 *0DC7CED92C0EFEE1F708A4B03BE7597FF3E80914 [email protected]
143,587,221 *0DC040D2F453093F28722522F87B0C4049AE8B77 2-juhlakonferenssin
143,587,222 *0DC56CD90F8C960824D5EB0EE259C55C1534CE34 æthelnothiga
143,587,223 *0DC0DA807CAB12CF8AA5FC19F10AE578D438CBD1 2myhilbert9
143,587,224 *0DCAE09F79280B14CD63AC646C8B3FA095D68DF5 afgezegde!
143,587,225 *0DC634238E016F5C1D64D2F6C1777AAB8FC47B9A afvcy
143,587,226 *0DC23C0F2E283396F5C7B32EBBB5BD3296AED53E 2 pienik
143,587,227 *0DC2F0A513A1C06B8F6D4D82834FE4832CDAC6D2 2SARVIP
143,587,228 *0DCA00F38AE9FBAE976257355636C84444D695D6 2satre
143,587,229 *0DC31A58D30868A2E185015398BCA792DFCBE05F 2 SAVASTANOI
143,587,230 *0DC3112505BE26EB7CCE6BE183D897C176195AC2 2 suomalaisugrilaiseksi
143,587,231 *0DCF3EF47D8B75C5AAFA12A6C6A7089F7832E092 ai8f
143,587,232 *0DCD922D5E53665834DC6A26FEE237E3EE78A574 aiden194
143,587,233 *0DC9441C6BD7087E4B0C647ACB255827E7F803B8 Air.(Angel).-."O.rest.in.the.Lord"
143,587,234 *0DCCDDE14233742C54AD7AB1FE3B8A5F817E8FB8 AJPANDAAN
143,587,235 *0DC02552DB7CF646CD9B3259C3424883BE5A7B31 350CARD
143,587,236 *0DC22381B3BDC3DA61C12D7652FFD85C4AD9D4DC 360764 es.soll.im.nikolaiviertel.eingerichtet.werden..
143,587,237 *0DC0497FEA21DDF9D0EF131205F429E390093675 AKASI.CUDJOE
143,587,238 *0DC018986748C9F58843EE2A770E7DAFF9632E6C akhea
143,587,239 *0DC985E701C3E80E43D149125754226B23F027AE AKKUNNU9
143,587,240 *0DC6A4C310787521A7128FADAAC58B566F8FFB59 aksyd
143,587,241 *0DC4E772DB655426DAFC2449DDE99EA4F52252FE ALANHALWICK
143,587,242 *0DC578FB394D4F9A8141140D8385C63586935DBC ALECMETRO
143,587,243 *0DCB957579188E5574D4E5A2856A26FD3F1B483A ALEI
143,587,244 *0DCCFA1C08AD878820ACE7256E02C8416F001B4B alexiscarlberg
143,587,245 *0DC8F427F25F0691DB66159D060DF241CFC2760E ALEXKJAR
143,587,246 *0DCF5CA1EA5038EE23F26B01958FA52E63097D05 378246 haftinenglandwirdgrossdealerangerechnetmannheim
143,587,247 *0DC8191F58FEA3C4E5BF36BEF35839B1C7F78256 3badarrah
143,587,248 *0DCF894412C8D89C2BFA6E5DB48FA7A2462906B3 ALLISONRADER
143,587,249 *0DC4ED73D1A7C47F39C0BCD91BA771A667DD12E1 alma-de-acero
143,587,250 *0DC44DBC6D5B7103DA9F4B0B1CF52B424112C13D ALPACAR
143,587,251 *0DC155B4D62B58E70F3346823C1099809AD26BBB ALtw
143,587,252 *0DC1A7DA3753B641BD6165EEF4AA8EEE8CD696FD 3ILOVETESTTEST8
143,587,253 *0DCDDDA6BD991E22EC6D0B7AF3BE1D8DE049F552 3.KUTSUKORTTIEN
143,587,254 *0DCB9EF9F936E3A506E480EC9578671CEC9F6578 3.MULTITASKING
143,587,255 *0DC8361CC71B7C03DAD9775BEB7DC3846903857C amainassem
143,587,256 *0DC7339FA7E0EF1A23CA19AF714864DBBC608B1C 3=====p~0.~o.(0_<)
143,587,257 *0DC8373C178EA59EDE5ADF9F0B272C39AB92EA87 AMBROSEHANKERSON
143,587,258 *0DC9815ABFF226BF17AF8662F060B013AF764E4B a"%mc
143,587,259 *0DC0D3CD1829907C77B28642FB9615F00E6EB48F 3PSSNNNT
143,587,260 *0DC453F0164E5A19054AFA7D8B10D4E3C96E91FD 3--p`~{x}
143,587,261 *0DC435AFE5991FFBAE88042428326A0D0AE0F624 amirulizat
143,587,262 *0DC621D7897B18F9643B72C8B9C8B8FE6E6E3E0D AMPETIGN
143,587,263 *0DC2C220E3E4F864157DB317D07682A9CF1503CA AM,R5
143,587,264 *0DC2740EE6FEED588DCE9633ACCC70415E531392 anamenons
143,587,265 *0DCCE31607DDFD3387BBDBD345758806D8DA7DF2 ANDREA-LEIGH-RUSSELL
143,587,266 *0DC872732095251BAA5FAA08DA1587D51C50E1B8 ANDREAS.SPOHNHOLZ
143,587,267 *0DCB6A64838DD0A8F252D53C8EFB0CF849FD9319 ANDRESHONDROS
143,587,268 *0DC4A41D530CBEE710D67B3F4243987F5AAF1B25 ANDY.BAZARTE
143,587,269 *0DCF5DE632BB043FA61CD0B599609DABDEF58697 ANGEL.SZESTERNIAK
143,587,270 *0DC37E1B51802B87903C1E875FE4FFC2A6F02A5C 491201 erityist
143,587,271 *0DCE68C987B70052AC6D11A9F074C7874AF5D933 4D3P0JU
143,587,272 *0DCA3F32D5E7422E24AF792C1114D056D79B811C ANOTHER.SONG,.ANOTHER.DRINK
143,587,273 *0DCBCC8C87F7A851C7EFA1939ACDCADDCB0A626F ANSGARSKYRKAN2
143,587,274 *0DC4CDC1E032774D709D138B18DDEF8F2107F71A ANTONE.HOPKINSON
143,587,275 *0DCDCEF10B2663B85B67ADBD19CB83EA55768B90 ANTONE.TAPER
143,587,276 *0DC8BE110D21CB14EC7ED874D967B84847E66EEF ANTWAN.RECLA
143,587,277 *0DC16893A1A6F8F90C08B61E830B8435F6A5D10B a,n&u
143,587,278 *0DC08D31C5C1C3CA20AA213B12BB2AF91F081ED6 ANVMB
143,587,279 *0DC5ECC3F1838BB90C1C2015D8DBF3DA3F8F7E56 [email protected]
143,587,280 *0DCDB407072F6EDE69513CAC7FBA29F47FC048BE aom#
143,587,281 *0DCC32C8A6B040656B86C30855A58D55155E837B 4ROBINWOLF
143,587,282 *0DC2ECE8616EA8F2C8459542DF6A995029C72B6F [email protected]
143,587,283 *0DCAB05A0F1CEF1F3121E1B78BB59666720BC8BA APNF5
143,587,284 *0DC6E894874CE3EEAEE560D9E8AC4425B3C279E6 apostara2
143,587,285 *0DCCD4B481A029C8BA6676CBFD54A9128D9CC9CB [email protected]
143,587,286 *0DC2F7F93A63639316E9CAD68981E87FA06974EC 4USIRILI
143,587,287 *0DC0BDA816A1D42AAF04FEA29127DA827DAB28AA AQHZTFCZ1
143,587,288 *0DCD013019E6872D666E72AAF6EB0361F86E3202 aqis
143,587,289 *0DCE36A801C8E5B84F921283D6258D8AD6F62274 511NG5HO+5
143,587,290 *0DC0272A6BB7CE6619CE1AFE40981BBCD730C7E8 52.HANAULAND
143,587,291 *0DCEE4AFDD02D8F8CDE4F3B6BC45F4ACD1CD1A2A AQ:$W
143,587,292 *0DCA2521D5A0E0856237E74C886821C37090CE31 550517 P
143,587,293 *0DC6E74FC357BFF7F534E72FEA1E9DFFF54F6E48 56075 TOINENISOMIINUSTULEEKESKENER
143,587,294 *0DCDA77B69FD006C76897FBD6C5CDAE92A42EFAB [email protected]
143,587,295 *0DC3C93541C7A40F7377D19EB31471BA8F336E26 56g6xpff
143,587,296 *0DC30CEBF1287073B89B177E72A7E76CCF58878F ARBP:
143,587,297 *0DCCAB71C207D1782B100F7E898AC8DDA01D78A6 ariafariseo:questisonoarcaniignoti
143,587,298 *0DC1C0D662BEA514DBA4099682EE2F16B801C6FE ARIEL.CONSALVO
143,587,299 *0DC7EBD6482F853378C5F498C59F685CCA984A0C ARIELSLANKARD
143,587,300 *0DCDDB63D380343CA0738B90B1F294BF712914CF [email protected]
143,587,301 *0DC85E6E6E9C4F6EA127A8574537ECEACF0243E5 ARISU.FUJISAKI
143,587,302 *0DC999B7DEC888D0726D6BC3F4F18047E7B659DA 5BOBBYJOE
143,587,303 *0DCF190AB95AAF5E4C3CCA8912EC58958B4E203D 5CAMPAT3
143,587,304 *0DCA1D091681A15B00349864C7D40D5D64AC11AA AROA.ISSA
143,587,305 *0DC347D2AB68659828F7919601A9793E260BB320 around & 'round (rake's revelation: conversion xperience)
143,587,306 *0DC94563ADD99D752995A56FC02155CF31403E79 5DEDDUCS
143,587,307 *0DCE03DA6CBAC68B314EA3CA559E05FCC6C99CEE 5lijfknechten
143,587,308 *0DC7E97ABAA4CAD7E3B02238137E46B76B857678 5losraakte
143,587,309 *0DC6419FA689078483064CE26A87E17D16847003 5MAEKHONG
143,587,310 *0DC36DB78262F36DD3BB6EEC1FAE0FACB4E2B334 5MODTAGELSERNES
143,587,311 *0DCA9EB923BC3C1FA8722FA62AD68FAFA45C621E ARTURO.GOLBERG
143,587,312 *0DC32292200C2080293E202CE2202BD9E94E4776 5QU4M4706124NU10U5
143,587,313 *0DCE7382958F5499290251E6B67134603B6B1BE0 5SUCRIERE
143,587,314 *0DCAF993F2A45F592B73D12BE4BC9EA0975DF42F 5thetokyo1
143,587,315 *0DCDFC716241DDAF258C13E62DE0ADFB3E7C14A5 5TINKERTIGRE
143,587,316 *0DC74B5F52904CA2119B32036BE8D9CCB66BA3DE 61092 DAHA SONRA SOL EL ILE AYNI ISLEMI TEKRARLARLAR
143,587,317 *0DC0FDD9F76243D5F3BB38D54509342C0B5E2AF6 ASLOLIM
143,587,318 *0DC58A41E9886E6295B0C77919BD3C67EA858EF9 [email protected]
143,587,319 *0DC9A053113C29A700047A8598D3DBA091196AC8 6926 FEN BILIMLERINI DIGER BILIMLERLE BUTUNLESTIRME
143,587,320 *0DC3BB5BABBA8ADBE9D7E8A07869CDA3690A8016 ast%
143,587,321 *0DCE46549E33CDC552165F8F38F58515D9B45C1B 6ARMATUBE
143,587,322 *0DCEA32AA48E3C532658D7568926D778C838917D 6CHRUSZCZ
143,587,323 *0DCED7DB4A601F784C900631463DD3419BC00EB1 ATCY)
143,587,324 *0DC3D9235F3CE4A317708D846D9194E10AD9AC5B atd;o
143,587,325 *0DCBC4742F6BE01B1EDD72A483C081AD2893FE86 ATDYX
143,587,326 *0DCEEBB157E4AF1BCA6ED868A8C573A114FEDADE ATICXENI3
143,587,327 *0DC4BE875141E501149928913E2C573E6DC3D013 ATTA6
143,587,328 *0DCF81E86327D59B9D651E39D1C80F532B16E7E9 AT+TY
143,587,329 *0DCD35DCBCEB6CE4F4487F0FC34DA1E06EAD2C13 au:9s
143,587,330 *0DC4A844C3E0AEC7F90179785C22EC2E0F3C500F aubreyspeilman
143,587,331 *0DC5DABFD68F68ACD1C394B32CE00557D5B49AD4 6NEHTAEHF
143,587,332 *0DC90B0EBB4236A011590C0C93673B1F60A663A4 AUGUST.WIDGER
143,587,333 *0DCE4D639D38E7B1C42A19E79C87775B27A09050 6OKISHIFU
143,587,334 *0DCE5A600AD44C0750F39FEF990F0953A484ECF8 6PACIFICFOOL
143,587,335 *0DC23E97118FA463636DE2ED6BF443C5DC4AD86E 6TRIBOELE
143,587,336 *0DC29B197116D39AFA8F6C497CE6437AEAEBA560 AV:LF
143,587,337 *0DC30BE7D25F1FE2BBE34A2B6BB6195C2160618A AVOUTRIES6
143,587,338 *0DC90B8AD1A65648C3C5EE7D32C288FDD464C3E3 awrx5
143,587,339 *0DC974F7402C9B5A9F572C38B85270CD6FDA014A >B0O~ 0~<###P
143,587,340 *0DC41F4F05F45DAD972ADA73B9B0D70853F67517 7BSWBUKHALIDBSW
143,587,341 *0DC8C91327FA8F6C7732DEA1782DE863182B72C5 B100431
143,587,342 *0DCD31D71DD365F31D3CF7931CD592F1F2E7E278 b(1is
143,587,343 *0DCEA2DB58305C9A01461827A0B963CFE88394F6 b(2p&
143,587,344 *0DCCB8317621F4469885B39B9BADD244434179F2 b%2tn
143,587,345 *0DC4C3E111B83C1390F2F76034705FDCC326A689 7DMAUSLANDSANLEIHEN
143,587,346 *0DC0712028A773570BC98CC82696DC59AD1BCCC3 7FLIGHTERING
143,587,347 *0DC23F318B386D4051A5101A10BC5B1C679F4137 b4ybi
143,587,348 *0DC14BB31D274FD19076E61B1E0C37E250F4CE77 b5bc%
143,587,349 *0DCDA91549E70406912425F61F47406BE34C0158 7HORECAPE
143,587,350 *0DC1B7FDBEB17531FFBE8034C5BC15C8A1E507EC 7iamcarmen7
143,587,351 *0DC389C51C46D40B70737778D0218480B49A99F3 b5uhk
143,587,352 *0DCCBDBB0C1D5C7D9631D2542D63AEAB6EC06C0B 7ilovebombay
143,587,353 *0DC6393BEC77E0640B79ACF3136DA2F4F2C657E7 7JUNULUSK
143,587,354 *0DCB02951CD309671EF6534CDAA79BFFF8DE94AD B%7FV
143,587,355 *0DC73561C9AD6C38B5CF8A3B4C80AE3D01B8FD87 7MALCOLMKATIE
143,587,356 *0DCC75E9BAA57DE1A6F276284921257547FFA73E 7MUNEROTTO
143,587,357 *0DC3744109CEC69F5CD0922861538537F338AC34 7PLAYERSPOLO
143,587,358 *0DC78B4673CDAEF65A4D578115D907D571E437D5 7POOHBEARKINGFISH
143,587,359 *0DCB2630E6E2CB49E4DAC14E708B1035ADEB4636 backnot9
143,587,360 *0DC1CF62D2016340A3319F5C5F06321FDFEEBC8A 7WARPERN
143,587,361 *0DC3313BD777CFEF476AA7C7DCB228F09EC11636 8#>~0~O (^_~)
143,587,362 *0DC3CA9C3EE26CEAE310CA312342D253409DDB42 8ANDERSONBOOTSIE
143,587,363 *0DC248A6F6D1EB34B4EA9D305F5458B481714D16 8.beefsteaks
143,587,364 *0DCC916D3A8999E3F7BF1BAF521A37C656F4069D 8BITORCHESTRA
143,587,365 *0DC12495936BE917B0BDA8966A47BD73E8E1C92C basilacak
143,587,366 *0DCAAE34A8D182AF5DD7B5073495E41E2E334938 BASIL.MAZZERA
143,587,367 *0DC8E5B26423AB6D4BBFFAED2F1C94E11C56AD0D bb,_;
143,587,368 *0DC7F617EAF5261BA44824DC0998F437239BED53 B.B..GABOR
143,587,369 *0DC24736DD7F8D7327A580C3E2C4D393BF4E9E92 8EDASIMUL
143,587,370 *0DC0F0C9BDEA422F23E3A273FC8BE00AFA6C964E bbr8p
143,587,371 *0DC24D4810E42A0E6A0C6E6560452BC74941C56A bbzn
143,587,372 *0DC02A02F37791C16CB54BE2FA2F6B45CFC9B0EF BC126年
143,587,373 *0DC030C1DDE123831124FF746AF0A65EB418F61C BCF3
143,587,374 *0DC4E3BD6114594A2931BE4999DAEF8E29E68EE3 [email protected]
143,587,375 *0DC601DAEEB2806FC74A51BA9A61733AABD10F8E BDCD(
143,587,376 *0DC7B51B6E31571A504A773B26BAC639AAF4979B 8LIVRARAM
143,587,377 *0DC6C8E621D8EB652C36FB6B27FEF38A065E0421 BD!(H
143,587,378 *0DC46A0E3B7A3F537F1036177FF44F0F3896C001 bdn&c
143,587,379 *0DCBC53F86D8DD810F7CD973B0AB38C6B4BE7013 BEANERI6
143,587,380 *0DCC4BDEA7D3EBC9D3B77BC96D1B514345D9E46F BEARSAILING
143,587,381 *0DC131A2D7A7A1DC92C574098F2AA1EC81524FD7 bec/5
143,587,382 *0DC51503E1C0C5EC4353DDD869FFC9429500E520 8----p~~~splat!
143,587,383 *0DCB0884FD01538BFB07135047DD887C3FBD4152 BEETHEBS2
143,587,384 *0DCD13F929B8096A54CCB3DF394F93907906D1FA ben7s
143,587,385 *0DCE144B7942F77276B897039409D87291DF619B 8###@`~`~SPLAT
143,587,386 *0DCF620B8C54912A3F6367B2C313C65363E92FB6 8STORMYPASS
143,587,387 *0DC618ABEF5C9CD443609B71CF3CCA59A2486F1C BENJAMIN.COUSINS
143,587,388 *0DCC1E4D0726DE1242BFD4514CF181BA5B663D13 8.taottua
143,587,389 *0DC53D67DC4926A376A6DE13676D64795FB52BB7 8THEAYELET
143,587,390 *0DC805AACC1C9C3A1F31DCAADC99DE006C2D6F3D 8TRAININGTIGER
143,587,391 *0DCF7DFAF96A5A956AC38606145DAD3A99096077 8TSETLEFR
143,587,392 *0DC61542DB2A3E233605B05D4242CAF5E5951369 8TURGIDER
143,587,393 *0DC8516E6B25E03D0A3F45E0A29D743C3BCAB398 8WEAREWEARE
143,587,394 *0DC33BBB9DCECAA04C08958A7433426E689A77C3 909229 MISYONER HAMLIN BU PROPAGANDANIN BASINI CEKIYORDU .
143,587,395 *0DCB666C91266D57DAA2A5F68B0F7930A32F0E82 9APPLENITE
143,587,396 *0DC9043A5433965567C3343B7D6B7912F30171F0 9ATALOCNA
143,587,397 *0DC74E451998848925ADBE6FFE884D4D346CB8DB Bfn5
143,587,398 *0DC837C4515D43825B808D40F24197830E04C879 9BSWWINBEZBSW
143,587,399 *0DC7BA139B468914D2B93B52992B9FC3B9DB335B 9DISPREZZAVANO
143,587,400 *0DC0FCF95FFFCBF12B88CAC9786DFD5FD8EBDD08 b!id)
143,587,401 *0DC6319558AD3528474AA0B283F59E69C932A01A BILLYABBS
143,587,402 *0DC71C5FA8F2A3B071E4FDB075E71480164B38D2 bisk7
143,587,403 *0DC5ACC588C17D55DCE9EFCB9DE6C70AFF489445 9MONENMOI
143,587,404 *0DC1B2B3AEE457C84B739510179D1BC9D02A0CA0 9NEZMRZACIL
143,587,405 *0DCCBD742F91F778AB177C09B84C0C2661C2C732 BJA6755
143,587,406 *0DC517BAD3627828CD53F26F28CDFECB7A683F82 9PICARDPERCY
143,587,407 *0DC7A4D444C5695555C4C108736E879D7ED4FE05 BK26K
143,587,408 *0DC449D0D312D32540301469CC8872142CFAF33C 9PSEUDOP
143,587,409 *0DCFFEAB633F300C61DBF875E3C072B0CF0261C2 9SKIDOOSWEETIE
143,587,410 *0DCA7AFEB220F679854D5A649D4177A513E96AEF BLAKEWAMSLEY
143,587,411 *0DC353B9754BB0C50BEFE64FB2CA039CFB2DC4C3 [email protected]
143,587,412 *0DC7D1ADF104CD91F0A55E0DBF004E5734E236D7 blwb
143,587,413 *0DC688B15A3340AC726D442D782E243DF23F5464 bme(v
143,587,414 *0DCEC1EC2936D808A25EB7776DE78D99798D48DE B:MFN
143,587,415 *0DC95A97D356DE37131B16BDA3F5BC5809A0BE16 A0h6
143,587,416 *0DC45AE0E104162753E65DCEA91444DF38D9E682 B"N%
143,587,417 *0DC6CD01DF19F8027A99E9F1064E2DA648CB1857 b+n6s
143,587,418 *0DC13A6CCF0AF48C155F61B99525D82747CFB5B6 bn-8k
143,587,419 *0DC0AB20C36CE6B15CCB2521B318EAA8F1D223E4 a1e36
143,587,420 *0DCD1C97DA84C17FDD10457A05AA32533F478D21 [email protected]
143,587,421 *0DC676F8C70CA25689674D1626651513654BA182 A.)2
143,587,422 *0DC1E5E4B2A2B292DB0C271EA14EADCD6D29BDA0 bns72
143,587,423 *0DC5BACB71618AE240E2B059466ACDBF98D8AE5B boardhering
143,587,424 *0DC4D5CDAE59D1214273AB6C5D24820E58659C60 a4keh
143,587,425 *0DCE9B184675315F579C0943A0CBA6A213F135FF bơi.ếch
143,587,426 *0DCDB0F33246DEFFA7502044F50E86A0C56D327E a4xye
143,587,427 *0DC1AE9A8762BE5CE968667428A7E3ACE3172FE4 a5q5
143,587,428 *0DCBB000E2F0F056B3221D9BB6D8AD48DE79954B a5scc
143,587,429 *0DC3993C5CCB77D9663F88A637FBD2E4E0C49ED5 BOOKERCRISTALDI
143,587,430 *0DC7B0E2683A9C8AA9FC924E51BB9B09A0314003 A+7$
143,587,431 *0DCCE8DCCBDEC7814F92DC50BE4106EB88DDBCF5 a8pa(
143,587,432 *0DCB0E68E65ABB0AF15B73F1965F235ACD1D6C67 bov$2
143,587,433 *0DCE695E5C15D6331C4F8475CE7D1D829A69D185 a+9b
143,587,434 *0DC546F46A12B379D1293EE07FB43EC916CA26B0 AAA3*
143,587,435 *0DCCBD619C284938E30307B1EDC9253F9923B1EB aaai'x
143,587,436 *0DC1FA12651E21963F3FEB14CCE190BA4A742272 B-p***Splat
143,587,437 *0DCB1DACEA1B98975F47F06DB843B762282CF3E7 BP`~.SPLAT!!
143,587,438 *0DC722299A53F435A05D22F1CC3786B8BFCE95D5 b-psq
143,587,439 *0DCA7C1E57068F5923066DCB4908521A87D67802 bq=1"
143,587,440 *0DC84E1CC5F5CB451048D6F8EB7CC9A6EB4AF37F [email protected]
143,587,441 *0DC1A5C83FDFCCE384E6D869C1353E94FA5EAC6F bradlymccranie
143,587,442 *0DC06CBA34A3AC53DE4215D3ED068173310DA4A1 BRETT.STAPLETON
143,587,443 *0DC4E53711BF1F49CABB1DA404A95E89C83BE58C BREVS4277
143,587,444 *0DC69625ACC768E8432CD81190C6F6AFE715390F aae1(n
143,587,445 *0DCCA96A9B79E013652F7E2A9CD11B123B6B1752 AAIQ
143,587,446 *0DC85A7CB517ACB20F38C4E350AEC915ED278CE5 AALEKNOK
143,587,447 *0DC4BBB6861652EBDF00D73DCCD5413BB16D0A71 aanci
143,587,448 *0DC7D24D4D5B3B4684BE6A193F24A227665981BC aanfluitingen4
143,587,449 *0DC899B1CBEAD8FA4BE33C8F0D03CAD641FFD476 AAN$T
143,587,450 *0DCB0785470D797D7738870CBC3E03CA118CDDDE aaronmadison2
143,587,451 *0DC5E506FF8D934A7D7E9657F029CCBBBDACA025 AART2
143,587,452 *0DCF9BB26F733FD4E8E1EA293A1AD0EED0A96679 BRINCKERHOFFNUEVAYORK
143,587,453 *0DCFC28539C9E9B8607031F3B4B287E09C75375B brindloy
143,587,454 *0DC5677DB8E74183E6969833B28587B3A81382A7 aaspacomwww
143,587,455 *0DC8E684816909F9635AF9DF4D11A0170ED0EA87 britingham
143,587,456 *0DCDDEC0F5557A36EC056AD362E884585D0C04BF AB8FL
143,587,457 *0DC39993CFA64049C500E070A1B2BF4F60AC0345 BROOKE.HARDEN
143,587,458 *0DC4ECAD388E32355AD1347EF549746885435BCD BROOKE-NIXON-FRIEDHEIM
143,587,459 *0DC9C921735634E089F71920A2AE0B4C164C0F31 ABCDEJESSICA3
143,587,460 *0DC61D9E6741C298E861D1C1AB3D48CF4B58C578 ABEDIENTER5
143,587,461 *0DC658336E8CC962CC6AA8201D8603F6D8784825 ABELESTUS
143,587,462 *0DCAD3D70E49F6E79AED4D0794A2D93A185D079F BRUWK
143,587,463 *0DC4B000486D67ABCDA288B78FABC11580BBBA36 abhominable.
143,587,464 *0DCF36C155AA04918062D179C0CE25995ADE8135 BSDTF
143,587,465 *0DCCC7A8044EBFB65A355A7B3DBD28D29B925357 bsdud
143,587,466 *0DCF2EEA3B049F6E1A194B0270457BFD7A306161 BSide.to.Hollywood.(feat..Trugoy)
143,587,467 *0DC15DA47A78CFAFCF9FB802CDD9A1B531503C3D abq6s
143,587,468 *0DC598A24F5C38C3EE71B06123426A003BA35C95 absolute-space-(jazzanova-mix)
143,587,469 *0DC7E5931F761EC4D4FE1ADE7633F52AE749C172 BSWBORSTLAPBSW
143,587,470 *0DCF6A2A8437EA7DA4B82933C02520BA1E942189 ac+&(
143,587,471 *0DCD025364131283573DF1AC8E6DBC0E8168C38F accessbernarded
143,587,472 *0DC98EEDCE99F278F9D9851C44875586F8D5A46B ACCOMPLI
143,587,473 *0DC6BA8A034A4C283FF32334A3840197244244BB a.couple.of.these
143,587,474 *0DCA3F2339CC88276F15E9FD6E59CA3C9D5FACF6 ada.howard
143,587,475 *0DC986C6DE6BDA4E8BB07E84AE311DBD0D0A9FAA adaptes5
143,587,476 *0DCDDD39A99F29953EFA4A5419AB6945612D397E ADDMEIFUCAN
143,587,477 *0DC972FEF1416DEDBC8C4386C44531E46E7F32D3 adelphogamy1
143,587,478 *0DCD12C7AC3079451D1A7AC5E0F249E929601D1B adereconciliacion
143,587,479 *0DCC3E282779B905D80A34F00F3E52D947C65351 adrianfontanez
143,587,480 *0DCA9454462B96FA971C0A6B5D623961B501DE78 adrianschneeberger
143,587,481 *0DC605C6B0FF66717AF54743948F8AD337911FE0 ae50e
143,587,482 *0DC568FD8EDA0D951B2BBFFB40296BD2465CA0B3 BTBL=
143,587,483 *0DCE52E9F9208E3CEE72007E393D85B032B3CB23 [email protected]
143,587,484 *0DC1525264A1536566E29483A0EA52F608ACFE8B bthe
143,587,485 *0DC13326B09E06C2CF78825BEC919F500B44DCF2 BU3N_
143,587,486 *0DC1E4522FB516F41705DEB9E38AABF628EE6998 AELWW
143,587,487 *0DCACC76EDAABB9B93C4360DC43A5BD07ABC6949 budlanosa
143,587,488 *0DCCAACEC7694530443ED133CE52E19EB51E0EFE AFZS
143,587,489 *0DC683ED11CBBF29140D8B62DC6CFEFA0953CCCE AGATLEY
143,587,490 *0DC574FB3D3F984775F892DD9D9A3F505423C396 BUMKT
143,587,491 *0DCA4968EAB6C52F5FB5A1BF460B1C43AE5E7714 AGHLD
143,587,492 *0DC46A2E5662AE070873FECC25F3A8B98131B2C9 AGITATO-NO.-1
143,587,493 *0DC74F48EEE7077BF419D7EF73201EBFCE354C9F agyaatas
143,587,494 *0DC8A25FB8C3F086FB7C4E4F291348C350E2D218 a$h&#
143,587,495 *0DCDE68CD424F442638B496D5BDE5012FCEEEB43 ahalf-rotten
143,587,496 *0DC4A96C37126066723CBBF816F659BC70FD81EA AHG5L
143,587,497 *0DCC9DCAD9283F12C35AC773E3693C611151E700 B"WH
143,587,498 *0DC340BA8599E4E12BDC9873303E6ED872B76063 AIBH6
143,587,499 *0DCE45CE7DD6596357BED533E6D9ED5034436F4A AIMOISTA3
143,587,500 *0DC9BE2001EAEC55B5A1B273D1833CB29502B11D ajevuhsus
143,587,501 *0DCB6F7B94436E1E2AF6ED6354190F38E76EBCBA BYXLAPPEN6
143,587,502 *0DCF286A6CDD52189DF40C4EB47355C936EE7EBF ajirn
143,587,503 *0DC1CE0ED76DE3B930CB780CA0FF7845E620FF04 C0A9ULAN7$
143,587,504 *0DC9D725580E0F7B19FC8C189E4544B5A1596830 A?K:
143,587,505 *0DC42C393D6328D50A0AB7B2050EB1B201F78AF4 [email protected]
143,587,506 *0DC3967CD6C11B1246168E589C9F8E7377025FE0 ak:2z
143,587,507 *0DCFAE5A80B303D5D3F67CB1BF559BFA3D31CB7D c2e?t
143,587,508 *0DC4EB6E8821C0966D39FA0987054ABBA45F76A3 AKHIL SP
143,587,509 *0DC6FDA843840A495434A269634B76ABB5FDBA58 al0-$
143,587,510 *0DC9779D544896A4478B94C62E119B69AA2ED41E C5GB
143,587,511 *0DC0470564C71E432B4154D93FC9C7268A3CB0C1 A LA HERMOSURA
143,587,512 *0DC75B95514A8C0B39E02C9D4C1E1E32752A767D ALAN.KOMIS
143,587,513 *0DCFEA8AB94B7CCBD787E7AF8C5AB3F896FCF2B5 ALBERY’S
143,587,514 *0DC77DFEF47D209232527FA1C642FB21B56F69D6 C8YFL
143,587,515 *0DC1F5F1A0B5439018CC76D870490CA6E7A38F5A c%(9y
143,587,516 *0DCED33313212F8C37DA6363A1D5E98CB381FAFA CACHABELLA
143,587,517 *0DC9E7B6E98E65C533C429846E7B6B1F66619504 cad5
143,587,518 *0DCB9848CBDD2E8A155792D1DE71DFB159E47AFD callthepoliceifyouhave2
143,587,519 *0DCF90E44069C52BDFD695DFDE5CC7E2BA0DB679 ALECMETRO
143,587,520 *0DCB957579188E5574D4E5A2856A26FD3F1B483A [email protected]
143,587,521 *0DC0F2FF91E58C9B5633F166AFCF6A1616F598E7 [email protected]
143,587,522 *0DCC1B1EA8204075512E3F028B465D44CD6BB29F ALEX BILLMAN
143,587,523 *0DCCE80421D7128506EFCCC4CDD78FCBE45A829B [email protected]
143,587,524 *0DC4A91839EA602014F688650B5C8A1046446D9D CAN-YOU-FEEL-THE-MUSIC
143,587,525 *0DC673B5D2A1E8CFA71B18289256BFBC10F032A2 alias-expirysync-{
143,587,526 *0DCA48FABB2A6CCC8857B90701184048D08D54BF ALIKIMBIA3
143,587,527 *0DC367DE791084EA0367C1F4CB182388F345718F CARGOBOBBED
143,587,528 *0DCAE70C719D7EFEEE04B480AF802DC7DA1D98C7 CARLLAUNDREE
143,587,529 *0DCBE337D2DEC8878217EADA58EF37E09F0287EA ALJOFREEKHABIB
143,587,530 *0DC0EA6FFE0FB4DA46FC8199B1560550D353D1DF ALMUŽNA
143,587,531 *0DCAC2C1CF5A5DB51515C9FA07E3C08C25C1D7F3 CARYMORRAL
143,587,532 *0DC1169B7C97886E4B8637136BA91B92A21A6364 CAT1SMILE
143,587,533 *0DCBC24A06C1E57466900F43111953341D92DB14 cavalierkingcharlesspaniel535
143,587,534 *0DC7D3CC62F930CA98E6FFDEC31E0582C9F25DA7 c.c_#
143,587,535 *0DCC4E3F91E70BD784B5FA5C06EED17B0394EFB7 C)C[
143,587,536 *0DCEAD731D94D1EEB3FAB4E1CABE1E78489E2221 CCDW
143,587,537 *0DC9C4E1B5614A7D47AD01C61D0662EFB852595B ccgte
143,587,538 *0DC991D22A20230090F258454A1D6F5BD904E787 cc=h$
143,587,539 *0DC052951CCFADAA530B7BBB0130E3843C01722C cda/r
143,587,540 *0DC6F5E94F09BCF4B248E7BAE37185EB89986F0C CDNQ
143,587,541 *0DC4C94521E2E3FE7A3CBD986CBED6F4DE1D75D6 CDWFH
143,587,542 *0DCBA59F35012BD4FCA07EC0CE92B8C4335432F1 [email protected]
143,587,543 *0DC795888940C9FE1B187AC89C0D206BA3F87B16 ALPHONSOPEITZ
143,587,544 *0DC36840F1D10E71B9E3CF9C0D34D28ED16F2035 cggwa
143,587,545 *0DCD8A18EB52CD51B28C177EE4F10F520412E8FF CGLISPIN
143,587,546 *0DCC10841897F66800676121FA5C5CF3804569D1 [email protected]
143,587,547 *0DC376353C4C03D6B2A0F636EF8D9D77546FEC0E CHAS.COUSE
143,587,548 *0DCE8FFF46749A657ED56E3164D22FD642CDE57A c,hbq
143,587,549 *0DCC246E0E4C599E9CC5E01B653786DED65ACBAF CHENANFEI
143,587,550 *0DC1DDC4F777E51AE2C768C902172E6169AF5E80 AMZUH
143,587,551 *0DCB52D39BC275BF0474490537526F4D8869EC6F an35u
143,587,552 *0DC63C3D73B105D40F7F419A5FFA09B4FE44E57B CHIARENTED
143,587,553 *0DCD00F4C37EE2BC618DD4202251083C943D5CF4 ANDREWOSEI
143,587,554 *0DCA1F0AC019478F3EF764F0330B3E5BFDC82A83 chrissirko
143,587,555 *0DC34C301224052AA5753F42E3B993864E2D26FF chrissy-harmon
143,587,556 *0DC2D9907BB9136265F3D68018C60CA5FFE4D8F1 cixmu
143,587,557 *0DCBF466117D0B89BE5E6CDAB013FF4DAA57E52F cj6on
143,587,558 *0DCC6216ACD0A55F13606BBB942FD77CD8C78752 c.kd3
143,587,559 *0DC3FC0CFE5A2BD6140DE600D268EA43A2825392 c&kx.
143,587,560 *0DCD4C832294EC97F0D3DB881F2D16FB6672C904 [email protected]
143,587,561 *0DC3DE9B2069A9F91BDE0F5EEFD6BA5BAC06832F claybyington
143,587,562 *0DCB338FAC26B028FB55C3A4FE0B207049D725D8 claytonlecoultre
143,587,563 *0DC9E2ACD168D58841EF186D6E7C9CDDD9C822ED claytonlousteau
143,587,564 *0DC707733ADC567562C21CE662BD981A8E8C0561 aqlunafoo
143,587,565 *0DC8E676B883060E54D1692DF40C276C0ACAD54D CLIFFORD.KIRKBY
143,587,566 *0DC42BC89C2D5A0B88A0E7F61C1A9C1EE219E18B ARC-1T
143,587,567 *0DC1F35BB9805B99E442E328D85AE5308D887039 arcph
143,587,568 *0DC1135A84519DC698EDC5972E24D1208A7A5F1B CLIPSIEZ6
143,587,569 *0DC7B401ECE1A82A4E43E4CA121F5F526156FF91 clubioni9
143,587,570 *0DC3D3CE7E9FC125AAFB8C074256D06E5344A4B5 cl".w
143,587,571 *0DCEDABD3C2BC8949F63547A360EF3869BB2F35F [email protected]#
143,587,572 *0DC7241D2380D4A668787866C207C4EAA5E7F296 ARRONKOLTHOFF
143,587,573 *0DC9B3AD6F46F3B187249B02577CA063A637E614 cnew
143,587,574 *0DCA0210C643BB4C1B7BFDE95ADA9FE6EEDF6B82 ASC3U
143,587,575 *0DC829460880067D55AA75B48FB3395333E3F5E8 ASFJZ
143,587,576 *0DC20F2B39D1C7A796DF3984DC2DA36E21B6DEEE COINS.PANDAV
143,587,577 *0DCC6ACD8A35D04D4B3BDD5D7F3147F76D48209E co?k3
143,587,578 *0DCDE8D77699FF6E9F5A561A45870D11D4A21364 asp+3
143,587,579 *0DCBBB9406D11FC041C825AB9C8C0186C059C3BB ASSMANSH9
143,587,580 *0DC7513114D1117720748598D4F788150A9945C9 COLINWAUER
143,587,581 *0DC23EE95E542C3892B036993BEFB994F71795D4 COMPASS-(ORIGINAL-MIX)
143,587,582 *0DCE1BD20E4EF0B45E72592C679E41129A119467 COMPULSAIT3
143,587,583 *0DCFA8A6CB324F7CBF175C9A4E111612177FC72F CONCERN23
143,587,584 *0DC3F54603ADF4F40D0DFAA95240F1126EE6CA46 ATONYXISING
143,587,585 *0DCD8C04BF04D65320883195D92EAD63F8EB3A4E au+0crac1e$
143,587,586 *0DCEF145881C3DD30D697CCDB55BF5534A874164 AUBREY.DANCHETZ
143,587,587 *0DC53A0F21EDD0B6824390E376FEF351391BD28F au#c$
143,587,588 *0DCAFF50B6D02CFA823782D9C0885B096C4E79CE AUDBROOKE
143,587,589 *0DC158FC7EA72B2C9A7C8F76A4C40E22F7EE59CC constituită
143,587,590 *0DC826F4DF62266FBBCCE0CAE2EDED80D6B68985 co(o0
143,587,591 *0DC5E9A17AB66AE88E6519C1197BC795F7FF5634 CORI.BODLEY
143,587,592 *0DCB47348405838DF7910B246F06E87809C1BF38 AUSTINCHRISTO
143,587,593 *0DCE04F9355DD7264DA60CF8BE7EC4414FB9D163 AUSTIN.MAPSTONE
143,587,594 *0DC73BD56E93CF57B227D5D7FABF8EE67BDA2759 CORPORACION MONDRAGON
143,587,595 *0DC970A22CCC2B61C3BA0223F7A1FF1A6E1554FE AVADEEN9
143,587,596 *0DCADA0AA28A2E6A45F367BED835F69DBC803C77 COURTNEYBUMPUS
143,587,597 *0DC182B62554CA5362C73A6BC91168383E099FD0 AV?FL
143,587,598 *0DC10E6F557B30774E1ED34F36FF253CCE5A98EE cpoycopies
143,587,599 *0DC741995746721646C4FE4E51454B1B9C20DEDA awh6t
143,587,600 *0DC40E17B476F57452E09053BDC57F67CCEC7FEE ay5dg
143,587,601 *0DC547D5917709E4DB7C87D7849081E5117AD570 AYE%+
143,587,602 *0DC904FABFD6986CC7D4F859B3ED1A16DF914FCF azul's
143,587,603 *0DCC4C1E15B62A3A32167FD471D9547FF7C4C4D3 B=0$
143,587,604 *0DC2E9F6BFCF73FCDE374557BBC5C5A02A88F677 B163668
143,587,605 *0DCD3D59A33633290EA672ECE128ABAF459C96CA B1N-T
143,587,606 *0DC0937F02A049A48AB47ABB13554CC595393D31 B4L5-
143,587,607 *0DCBE0EB0A7D976A39C42F8A6F9E41A5813D5EC2 B9da
143,587,608 *0DCF99249B64F5F62530A44032D81183516CE44A CRYSTAL NOVA
143,587,609 *0DC1E2985FE94436BF7742A0D208B3E88BFD6D87 cscca
143,587,610 *0DC1C50323834691BF7824D00D0120CECAD3A425 ba0m)
143,587,611 *0DC6A1443595599A109D7B18447E7F1D6AE516CA BAAFO
143,587,612 *0DC50E612CB9106E8B28CBCD947EC15BDF747FD2 CSW4F
143,587,613 *0DC7E478E2CC928AB86D3DC734C0ADD4FF416F4A CSWAP12
143,587,614 *0DC51D956489F2D95BCEC4034EFC090584A454B9 CT6S
143,587,615 *0DCFAB4AE7DFCFFCAC9B6058BD74AB43FE306B80 ctm,f
143,587,616 *0DCA9085C33FABF604DDBBD88815D1988B7F89FF ba!i8
143,587,617 *0DC5F30B7503FC4D6FACAB9F0A18F948EE0C96A5 cubana301
143,587,618 *0DCAADE459DC59FBD3A6A5CBCC7EBE04F4153D0D CULH?
143,587,619 *0DC31FE682ED72EC1EF498472950EE6081D9F8BA curtisbeattie
143,587,620 *0DCAE2A36887FCEA6CE646282268934D9803FD86 BARRETT.SIEBERT
143,587,621 *0DCFFD0012701C6150CBC1A2B7AE45946BEF99BA BARRETUM4
143,587,622 *0DCB56BA578292DF708ED846343B678585F76A16 bau2f
143,587,623 *0DC6EAA55DF3CB7DDA9B5E26B2F328FFD9995D89 cw1;!
143,587,624 *0DC72DA8A66496C51B921E40FD1AA58912FCF086 +bbaa
143,587,625 *0DC0EF3F3BBD5490C1180C61A6D5D8AA37AE254E >B+BAA
143,587,626 *0DC066DA1EAAE514F6BAD5A0F8A6F02E5B6D14A1 bbligato9
143,587,627 *0DCBDB049D309CA6D335F4FAEE8DE32007B25585 b:cc_
143,587,628 *0DC660E82555ACC53AE45A303CE495646C634B1A [email protected]
143,587,629 *0DC677AC82C071CE683ADE2A194CED921B507E5C B,D"
143,587,630 *0DCB40F173926FDCD127EE98DD177BDFC5F2DE31 B---D~.~)8(
143,587,631 *0DC1BE0FF760DE3135B654B722B711D5CA37B774 be33
143,587,632 *0DC0F6900ECEE1580A3C3EF3C80506B5359F2E1E begqb
143,587,633 *0DC27A559BCD2462F65625C146A33A193892C824 [email protected]
143,587,634 *0DCF3F3C7FF0F0AB1CAFCB7893C2920FF4A14C4E >-<~~~d----3
143,587,635 *0DC9C6F4FEDC8B6D3FFBA2FF2AB5D5A570B63469 BENNETTLIMON
143,587,636 *0DC9B351B8995BBAF730FB8373079ED45A53A684 BEO;B
143,587,637 *0DCB0B5CAE74863483EE6E7D7BCCA64136916E75 [email protected]+!on
143,587,638 *0DC7701FDD1993326606ECF27DBCDF659E367F4E bertramroemhild
143,587,639 *0DC4563916A29EB1BA90231A39F129996DC73AD5 D6wB
143,587,640 *0DC852A82EC9210D6183FCC152F443CAE139CD5F DADDY.DON'T.LIVE.IN.THAT.NEW.YORK.CITY.NO.MORE
143,587,641 *0DC35AA3F3987D3A518141461F179CD4092108C2 DA$E=
143,587,642 *0DCAFB2E383CB53972C9170B5CBBDDE95632E79C [email protected]
143,587,643 *0DC7D31D172D6605D9A38F0A36D55583D44A302D [email protected]
143,587,644 *0DC48EAB4F52B7829FAD234AEA16CB03EA7DA38D damianmurga
143,587,645 *0DC1CE302105869152395D86DCAA45FDDF8CC5FA bf#ts
143,587,646 *0DC45498074786ACD2922C284A7EA4BF5BFE4877 damongionet
143,587,647 *0DC45972AF7994571D5C01B4F598BD666688CF56 BGI8W
143,587,648 *0DC8444FF7713B6CED7479876B66241C9C1087B1 bg.kv
143,587,649 *0DCB1C07F6AE017E882E17C15756530DA6E19F03 dan-lee-johnson
143,587,650 *0DC538AAEBB7631AA5956CAB91A31B606B61F553 bhgu.
143,587,651 *0DC90B821F57A23BA12F9BAA092A301F91EB77B0 BIAXILLARY123
143,587,652 *0DC7F15610F9EC900A82B6A152FDAFC5ACEADCF4 B$ICU
143,587,653 *0DCCB7B5EFE856420A59A62BCF34BE60B86C62E8 DARON.HUCKINS
143,587,654 *0DC489A5B27015E581D8780E0C302FBFFAFC51A2 bi-h
143,587,655 *0DC433630778015D161476F61EB4D0DA220A48F0 da?=s
143,587,656 *0DCFD7EEAFD47ED9AAB806192006FC5ABD0585F5 DAVEBULL6
143,587,657 *0DC9D911E48D46D875F65BCBFEB6299CECA99934 BILLYMOKLER
143,587,658 *0DCD5C1DE17EB0F8EC92F4569EE7F449FFAA36B6 DAVID SARKIS
143,587,659 *0DCFC5F6240B45708EE3553DE4C9B9A874218B35 biomoleculartony
143,587,660 *0DCF5A6BE2282F05D3D872F21A979E2AF4C314D6 d:b!_
143,587,661 *0DC13344432B4CD1448FB79A6D30B71CE0509516 bishop
143,587,662 *0DCD4F7EBA9D9ED48F0208300AC16CA7A6872B3C bit-mo's
143,587,663 *0DC7364119E3C6674BB73E6A20B67806A756AD16 bkcvu
143,587,664 *0DC9FECB4EABDEED573C869AA90FFF0C510F49AB DCSI(
143,587,665 *0DCC03A7B690E77FB4EA8B6A7E2FA7D939BBECA6 DDIET
143,587,666 *0DCA49FE251E0FF26FDB090E712D6DD6FB7FDE2C D:DPM
143,587,667 *0DCA9B1AC40977475E7526F580E4772304CEB31F blondes get noticed
143,587,668 *0DC622EA497B38BBE85CC3922FCE5660439705F8 BLUECFJ2
143,587,669 *0DC274A6852C79FF508C67A972FDC1A961E90AAB BLUETIGSCHT
143,587,670 *0DCB6A1E862139B255F5CF3C4B7CD022D9663B7F DEELEN'S
143,587,671 *0DCEC5DA329093EF5F2254B0A22F790E164333BB deemiscoe
143,587,672 *0DCD75FD83BA4260ECB722A1EAE11A1A5ED2643D B=MI
143,587,673 *0DC0E310C148A41D5B10BC2DDFF8DD6818CA46F9 DELGORRILL
143,587,674 *0DC73DBAF62B818DF4DCE0E88F20BB5336D87A22 B-->*-*)o(
143,587,675 *0DC14EF83C42E1F037D8E3BA3F9E406E09FF11F7 BOBBY.CHAUMONT
143,587,676 *0DCE5718FEA17E4E1081154D6062DC2BCE3D7977 BOHNINGBAA1HHNIH0NG
143,587,677 *0DC78670D0D1BB00ED58331360869BFE8899F10C DERGIKA
143,587,678 *0DC74E3FC17B4BCB3AA2863205E6E2FBD313677D bombersrollerderby
143,587,679 *0DC286CC64684F8613760A4718C9B5C246CE1FB7 b====p `~ `~(0_<)
143,587,680 *0DC6AB55A9BD10012DEA30603B96E5F3EE212B0C bp0cs
143,587,681 *0DC12C521E400262E520BCD47FC54D0ED1073737 BQFV
143,587,682 *0DC655ED180246D65F82093CF7C52E053A43A6E9 b-qgt
143,587,683 *0DCF8F0A3E624F07576FB41EE78DC27F42CE56E1 BRAINADMIN
143,587,684 *0DCD1382CD9FA7229E7EBB0B423C968D26A3C243 DESMONDELLINGTON
143,587,685 *0DC13FA0EF218A9212EECB4A62774D46B5996888 BRANT.WINGERTER
143,587,686 *0DC0B8F77E923A15C05BACFC52BB8C4433316717 DEVON.DAMONE
143,587,687 *0DCB95FA5FC9FCF782AB0EF14FC41FF6F18CD0E8 BRENTDIENHART
143,587,688 *0DC8B28D1E7EA9EA584BB4167AC7B0A2A40E9B51 BRENT.LEDWITH
143,587,689 *0DC544A9BD1830EC236BB8403806EA2A90CE91E1 BRENTON.CANUTE
143,587,690 *0DCB53ECF7DFAF6306F6E9C5B7A0D23900C4AAE6 BRIANMAVROPOULOS
143,587,691 *0DC230F8D2035883BA509684C5AC5C7975A19D58 bringebs
143,587,692 *0DC572EBF985632FEEF7F6B601333F1225AFE233 brittany.burek
143,587,693 *0DC9C9AE144A9EE39738A59B38D9FEE5B613E8E7 dg16a
143,587,694 *0DCACF97355E1241ABA2D93B031941ED26E062CE BRITTSCHREADER
143,587,695 *0DC14556599B87E6862FCD33F97F75A48EE5553F BROCKROWLEY
143,587,696 *0DCCD91C612432D52636D52E45B4B1E098086374 BRONZAS7
143,587,697 *0DC5E31DDA42C7A5F11FCCD2B9784FE00CA87A1C BRUCIA9
143,587,698 *0DCB97D031EA72ED899E2BE32D4F7CCF4E8F1F7D B,S10
143,587,699 *0DC6B7CCBA244DED0B6F09DF1D576106F051DA75 b&sc-
143,587,700 *0DC4724E2A2A8E0FFC2180F845085F212FC85E08 BS"K:
143,587,701 *0DC510B0FD9A3E309D4905EE0F43E15888274543 dickensistä
143,587,702 *0DC3879471F03193CDE2AF704FA7EB84E06DE7E7 dickruedy
143,587,703 *0DC03E875DD76634686DDD7D180C704BD211DAE8 BSWHYPERZONE
143,587,704 *0DC4B8B33814FD68F39EB82BE98B5B0CD0B783B6 BSWMUZAFFERBSW
143,587,705 *0DCF105E61BDC131AD6D527EF9952DDDAA828FC9 bthe
143,587,706 *0DC13326B09E06C2CF78825BEC919F500B44DCF2 BTLD=
143,587,707 *0DC5D5DCD722B4EE008083C25B155654B3F33564 b/t)v
143,587,708 *0DCD5BEA6466D74BE8E7B9193B88639AAE3D1D53 dimmits7
143,587,709 *0DC56D7F47BDEFF1100C8BDB4B2FBACDE5A22C0D DINVAKT!(FEAT.THOMASRUSIAK)
143,587,710 *0DCB6A8D396C8F8F5A79ADA88FDCBD551E934656 diosmosing
143,587,711 *0DC14282E374645BCC7116180DBAFAB8DEE9FF74 dirigeer0
143,587,712 *0DCDC076607C902A4220933BC781188D1883E929 disconight
143,587,713 *0DC007894BD23AC813451EEAB6685E401FE3888B diskcopyrundll
143,587,714 *0DCC6F0B3E27027CA07F63C89726CA5A0DBE03A8 DISKUSSIONHOLSTEIN-PL
143,587,715 *0DCD739263523989F91CB43DA51326A337DAAF88 BURDENOFCARE
143,587,716 *0DC2C84B4CB2073F92777ADFAD9336FB2276DB16 BÜRGERNTEISTER
143,587,717 *0DCCDB8105CE6F39BA72F4EBADB7AC91FB425706 ditino
143,587,718 *0DCC1F426C38341AEF728ABFE756CEA0E38D26F2 [email protected]
143,587,719 *0DC3D6FDFE7CB51C241B75AE059532D999153ED6 [email protected]
143,587,720 *0DC65AE4AE11382C4E944EB23F074E2D2A57576F bvg,o
143,587,721 *0DCA92AE55D98A7A3DEFA69D3936158560300A44 D%KH%
143,587,722 *0DCD4EBE2D36EC0C9038371F47BED56B98520563 D$KWW
143,587,723 *0DC0E3AE2BB2DA37FBAEAADE18D602491FA2508E DK%X2
143,587,724 *0DC3722D867F7D0996A62AAD20B1DCFF15F497CB BWCKG
143,587,725 *0DC43A824F3DED8BC50429EEB3FDA8094F13D6E6 d_l3q
143,587,726 *0DCD170183D6F0B6AA2C6CA5F8CCA1F62DB946F8 bwl33
143,587,727 *0DC4F27487E0FF56E9271093AF89068D20D35FD7 bwqsf
143,587,728 *0DC1D2F61FFEB67A763E69408B3124CC466422F5 d/-.m
143,587,729 *0DCCB1ADA2A389B3B67637B91019789008854838 DMAUAE'-'DMA
143,587,730 *0DCB15F15D24D14286744DEC6B4572DC79349107 b.yrl
143,587,731 *0DC5D09AD52A313B0DDA5D547A914930630D4CDD dm_&s
143,587,732 *0DC717DF87AC7EAB7CE3F99C75C033FB988D964D B=Yw
143,587,733 *0DC04345DAFB80A04C5271BD1C88E5BF34580FFB BZn(
143,587,734 *0DC84A236CD2840CD5663C73F8326CE293DB37BC DNKVQ
143,587,735 *0DCD7B1C51575D5DFEF624E5946464E1242C9259 D)%-O
143,587,736 *0DC54B18820499E3E3761F216E197981639FFBBC c0rrelatng
143,587,737 *0DCD42E4C718E988DFE4497B009BD8CA07FF3D4E C)2V
143,587,738 *0DC0F1AB7F4E8919786759DB77DE1B3CB57B4F85 c3)f"
143,587,739 *0DC8BB0D298B45041BFDF7AE0B82C25DC2711D48 DONNKIEGER
143,587,740 *0DC82213CF8839CB0698C9EE4701E88FD30DDB1C DONNY.EDOUARD
143,587,741 *0DCB304980425097E040FBFC4A50FC7241CA3638 C&4C
143,587,742 *0DC039F9691165397994B471FDAA24DDDBE66D1C c4/f:
143,587,743 *0DC01984DF33A49D283B01D53DD2F291DD6A6A5A c6_8:
143,587,744 *0DC4257354083FD7CDA3CFF127CCD3708F1012E0 C#7M#
143,587,745 *0DC18459D1DD20B7D89ECA67785A9E968AF6FC21 [email protected]
143,587,746 *0DC74178DAB922DC235DB17AED3F8BBEA6407F39 CALINUTS5
143,587,747 *0DC96E826D04471A5E8F1D8CB06EE31AAE1A580D callaghan12
143,587,748 *0DC3FEBA235DAF8C9173AA68DDD81CD8B2D06FEE cambiumeds
143,587,749 *0DCC9BF71