List database


# MySQL hash MySQL password
126,700,001 *0CE6B4FB5AF775B1941EAA1886603B3183598223 ПАРОЗАНИМАЮЩИЙ
126,700,002 *0CE263803AE8F7EE36B0ACB2D8F1E2BE6618E4D2 ПОМІЩИКОВІ
126,700,003 *0CE28F1E6385849625AFD652D5810B77CD55D54A ПРА́ОТЕЦ
126,700,004 *0CE07AD23F5EAD15ED099ED1A7A21FF2BD04E3C5 tggc
126,700,005 *0CE084557802956F685BCF7821D8F48AA21C0AEE ПРХАЈЕВО
126,700,006 *0CECF9084157D6C504929EAAF9EA69236987063E СТ’ЮКЛІ
126,700,007 *0CEF292DBB9521DD7228B9A8AD486CDE5C7073AB СУДОСТРОИТЕЛЬНОМУ
126,700,008 *0CEDB988D563CD40F008EEBD9CA6EBF4B3C43F86 thatsarah1123
126,700,009 *0CE1B002DD99EBDE323211A686D8C13436803F1D THATSKULL76
126,700,010 *0CEA49B1429702C51AE2433626B42A420682B1EB thatyoda21
126,700,011 *0CECC3C580EF401E08F75948D556DD9E5C159099 флүр
126,700,012 *0CE629136E2EEC858B142BD4F5E40E0041212F5E цацкес
126,700,013 *0CE1ABAF93943013D0357295F602B2665472E464 THEMEOFR.O.D(OPENINGVERSION)
126,700,014 *0CE374B297F4D10A51C45970B1EC5606CA94EE58 THE-SOUND-OF-TV
126,700,015 *0CE77B7F80BAD4D2072FA66217640DE82D1C7C04 THE-SUN-IS-IN-YOUR-EYES
126,700,016 *0CEFFE386F2F9F56EF26164E50C1119099B95FF5 心みだれて~SAY
126,700,017 *0CE66CC250CF0848046D4AC217B74D2B53D7788F [email protected]
126,700,018 *0CE18EFE142F4363AD8FEFE8EB0C0834960D50A2 THRILLER-W/-SFX
126,700,019 *0CE7E513D00A664BACE0FBA938C59EA00ADF035B tigue.sobyet
126,700,020 *0CE33D040E80298593E27CCA0B70578BB72F3E03 «TILFLUKTSSTED
126,700,021 *0CE43E705EDBFDCF81C8F12B7F97E5189EDA4F3F 『渚』(ihp)
126,700,022 *0CE0C01731B06A34CED68D18DD56A0104697C159 TIM.CUMBER
126,700,023 *0CEA1D9A238A53C5DDBB8CE0D31CB4F3102437EE time-for-blooming-flower
126,700,024 *0CE9DD8B6A796C4143D1F7848AC9AD47E9EC05E7 TIMMY.DILLEHAY
126,700,025 *0CEFA6B2C8BF373CFB3363F905331D68BD8F8410 TIMMYEMORY
126,700,026 *0CE5C36B15488B24D9EFC102E0386C602E3C7A0D TINATIMS
126,700,027 *0CEC46DBAB4B3CE9811009D10DD37D2B017F1791 TISME-DES-AMANTS
126,700,028 *0CEEA66493A84491FF7EDF189AFFD586C6B73C8B TOISTETTUUN
126,700,029 *0CE39F3A91D79CD5B26CB763591BBF7AE8573077 [email protected]
126,700,030 *0CE8872DF6A6C0E148DC333721F811E1FA41C4F0 [email protected]
126,700,031 *0CE8B4C30A8894E5F56133D741D8EC8ACB971890 TopcoMusic
126,700,032 *0CE94B9140186524ADC608BAED4CD8869455D0F3 TOP-OF-THE-POP-CHOPS
126,700,033 *0CE946963DC6C01F3BDD25B7A7FA51703AAB31BA torless
126,700,034 *0CE984EC6668780DB26173274D4741B4FBE7D9E4 TORTICOLLISS2
126,700,035 *0CE5DC75BA83AFCC0F9244FC5744E1BE33716F81 toysatbedtimea:60b
126,700,036 *0CEE3896561CC319C9B9D96321D30D098E9FBDC0 TOYSATBEDTIMEA:60B
126,700,037 *0CE8EFDEA4FE29F9056516A34594FE381F6C7E29 TRACEY-BOWERS
126,700,038 *0CE0BE397BFDA194C8204EF66BD7BE4180641793 TRADEMARKSOFCHRIST
126,700,039 *0CE3EEBBF763EC00D142C02A563CA37CFD6EE25E TRAMLYF
126,700,040 *0CE5E865500BA8B0458B4267BFB109558535EFE1 trancetransistortableradio-(vhversion)
126,700,041 *0CE10DE1CB9DDEEC2A08F910DDB2B7E6BE1A9322 TRAVELANDY5
126,700,042 *0CE81A97DD9BE4D97A934A031A617C62FE6312DC TRBNLSS5
126,700,043 *0CE869EE3B67406018BF87332BE5608C7615F40C TRBRCPTN
126,700,044 *0CEF2DC6B54C1E8D30DF84E3A209CE4E7918FD36 TREVORJIM
126,700,045 *0CE000CBB4DCF6F8AD145441E6F0AA6AF0FD22FE trey-coo-mcgill
126,700,046 *0CE6C3370808D60EBD23A5B551737D351FD0D2AA TREYFROESE
126,700,047 *0CE6A21DF77CB74EAF3DE591A84984C347C925D6 tricia-fergus-ward
126,700,048 *0CE6861064BDA3550E920B337CA423DD352EE38F TRINE CHARLTON
126,700,049 *0CE1256C22C8711525CB4FDE727B83CCC69F1BF2 trumpet
126,700,050 *0CE3DFF218357399EC9E38A3DC2B00043484148E TSARUKYAN–THE
126,700,051 *0CEB6031D1A9456F6FBB54B1E1BA596F016DD4DE tsuh.1
126,700,052 *0CEF02819D0C39A44ACF9097BDE1DAE90F123590 TTTTTTTTATTT
126,700,053 *0CE1EC236BC2CD38187B8055DAD4D0266FC5AA8C TURUUDEN5
126,700,054 *0CE97FD6812145C0859AA26DAB76EE4A109A227F TUTOYEER0
126,700,055 *0CE54C71DBE6A86B4A2C318B6576D64DEFD2A543 TYPESESCAPE
126,700,056 *0CEA14DD604C5EFBD883ABE843263D183250C523 TYRON.CORTIS
126,700,057 *0CED3D7D908DBA6CFDCDD68DBE15C2C6963163B9 UDSV
126,700,058 *0CE22F6401F2A333899A2E3E67168720BD38F58D ukil5957
126,700,059 *0CEE02ADAF0BD0D9EDC73F89F7EE2DD68024F495 ulric.belo
126,700,060 *0CEF69073D27826A9F6A12E43E61BE7C5969CF74 [email protected]
126,700,061 *0CED68F386CCA33CFB8A2704E7941E7731584D05 (UNTITLED)..(HIDDEN.TRACK)
126,700,062 *0CE06A2C20B7FCEC796D60EA8FD442C22666B115 UONEENSA4
126,700,063 *0CE5AF4E3A6CB9D86B1CC12614E166AE899A6E3A urgh a music war (disc 2)
126,700,064 *0CE9DC700533AB1300F57890E612D2877C8A92BC URNBRIS
126,700,065 *0CE227C68545FFEF895C6438357648A4C243F8CA USEFULNOISE
126,700,066 *0CE3977D13012E51A785814892671C70A5AC055F USERHAYDEN4SFT
126,700,067 *0CEBE502F4D25F7A0DF33335ECF09FAA51EC1C7A USSTAMPSHISTORY37
126,700,068 *0CE282243759AE370FD1CAFCEA0AB722DE46DB00 USTKAMENOGORSK0
126,700,069 *0CEAAC37DDEB6C660F0D3BB9749ADF6FB040535B U.UG
126,700,070 *0CEF907AF0C7B86EB776645CA09134D48D241026 uuyq
126,700,071 *0CE159D44B9670E385C377BE233A746D73064012 v0cabu1ar!e$
126,700,072 *0CE1A29BF6DD37A18B66C0286386C1E37AFA1554 V104161
126,700,073 *0CEBCD6DBB9213E33F49AF0E2F0CEA700FFFFA32 VALENTINERISSELL
126,700,074 *0CEE45549C71D16477FA0C329F74D40F76201C78 VALENTINIONEL
126,700,075 *0CE87015F532E5D2DD8E7FC0292DF7D706C00CD5 VALERIE-M-MOSKO
126,700,076 *0CE4E906A45E00B7A108768ED448EFAA0B8EB21E VANCE.ANSLOW
126,700,077 *0CE5A7D36D1EEDBC5B01233E0E39E748F025BEFA VANESSA.RUYLE
126,700,078 *0CE8C5653250BE598F2264712DCF54FA33FCF217 VANSCHAEMELHOUT9
126,700,079 *0CE5288F8EEFFF8B3CE87421554259EDE54DDDC8 vansuominen
126,700,080 *0CEA88C83ADDEACEF7F3F38EC1A5BF6C07009BB0 [email protected]
126,700,081 *0CE862E208403BD3179638C265ED4C16CDBCC4AA VASUMATTARAHING
126,700,082 *0CEE4C27C7E7EB8392C960DBAB9451A818E057FB veggenti2
126,700,083 *0CED4BE41FCBD2AAD78F151D67FE0057FDF89CA7 venerandocenteno
126,700,084 *0CE4C50E0110BA9004D1FC5C70B9118E8D80F28E VERLÄNGERTEN
126,700,085 *0CEEC4598D523FC766562018D53E87018D320649 VERONICA.BECKMAN
126,700,086 *0CE581E929D2D4BFF44F559C0FD7ED563E57836D VICKY BESSIE KOSTOLIAS
126,700,087 *0CEDE22E3C50375E5A851298158B638174277BF2 VILMA-TULAGAN
126,700,088 *0CE258BB2B28048D023414315EE9522DFD0E9A7D viľňansk
126,700,089 *0CE6F69BB1038A496E1DF0448ADAAFB6F6FBB432 vincekuter
126,700,090 *0CE8D147F8C789AFC791F6A41023FE319A700E0D VINCENT-NIEPES
126,700,091 *0CE05093A73328FB4E2E4C1FE22F7D35007832D7 vishaalpurswani
126,700,092 *0CE82B10E165020235872E78A8BCC558C09736A7 VISOTNY
126,700,093 *0CE6D10A2D98C2679B82DD6386854065478EE288 [email protected]
126,700,094 *0CE595192BAEA6581B7362D99CE0484483FF140B VITOUMAS
126,700,095 *0CEA8BC294DE897863ED2CF0673488B139687791 vitupereresti
126,700,096 *0CE9C380B88B8758864105C2E571082C7452EBB6 VLCOMX
126,700,097 *0CEB034BA52D612FA060192AF69D381ECD3015D0 volume.58:.unforgettable.standards
126,700,098 *0CE10990063AE94BC3112365870EC2DE63F0C5D5 VOSHAAR
126,700,099 *0CEC9FF87D1D4D711F3DBDEBD3DA9D0084F508AD [email protected]
126,700,100 *0CE00E9514A932222E65E5AA09B6666F532CC5DF W225009
126,700,101 *0CEE9193452072BBF8C1EBBE49ED36F72F1EE08B wachhenrichson
126,700,102 *0CE5DE939002B31A45F0273C719A5DD71920E1A6 waleed.khaled.ramadan
126,700,103 *0CE829F89E592B6314696E926CC8C7540C17258C [email protected]
126,700,104 *0CE6DFD57C8B2EBA3829ACE28F7F2A631945147A wardgreaves
126,700,105 *0CEE7BE9A2C89C7D5408B64D7FA9566DA37341DF WASTROG
126,700,106 *0CE8AB72B39C54EF03C6C356D77CF36E4B629947 WAYOHERRERA
126,700,107 *0CED55D4448A4BBE97EA313DA4697EC6A5A94D2E [email protected]hinarencom
126,700,108 *0CEBA5F8DBBE1F0C02025DFD2ADF9D20E8179051 Well.decker
126,700,109 *0CEA5249A377F2D0F31062B39597CFB9F887DA40 [email protected]
126,700,110 *0CEE17E5C8602262159210553841ABF90C0DA1F0 [email protected]
126,700,111 *0CEF7A43DC990477152D3FEE9884581B7B8802DA 0IAMALINA7
126,700,112 *0CEB2E690EE2CE596392214B1981FC40361F3913 when-the-giants-came
126,700,113 *0CEF60AFADBED9B793DE97650C86B24D9FB39FCB whiz about
126,700,114 *0CEB7217E32505E47557A3D7E6094B0B0C7E0767 101946
126,700,115 *0CE7F3CDC052E97EEDB95FB59D07F839DC612BEF 11191429
126,700,116 *0CE91D94EBE1E244AE52950E40F2BBC0E1B21F34 WILBURT.HERRERA
126,700,117 *0CE7CA087EC6548BDD5F9C84F0E88CED10371948 [email protected]
126,700,118 *0CED162CB48647DE401B0562FC5552124765F8E1 1267815 fuerpapaistsiedasschoenstekindderwelt
126,700,119 *0CEAF524695053243BDFA05671DA643E55B6290F 13.dgm'ler
126,700,120 *0CE95C0887ACE5647D0CF5D58FCA58956A218E69 1432541 easy500easy500ominaisuudet:myyt
126,700,121 *0CEE087AB8A9DC6F7FBA3340B11C475F68A96266 14-LEISTUNGSAUSGABEN
126,700,122 *0CE67BF67F9308C2EA563CB12F60E8ABB4DAA5ED 1527196 vondortrundreisemitjeeps
126,700,123 *0CE44B2164D7CB221C4D598DF98C03DC4F4BAC8D winfredgilchrest
126,700,124 *0CE625945A2DDFF7C807FC34E4B58A0AFB808942 [email protected]
126,700,125 *0CE3D3C729ADA78010E2A49108B5A8D89715A2F5 167-ISKUSSA
126,700,126 *0CEEC381825CEE49E57F51649E4E8F3F94C37D32 1830464 h
126,700,127 *0CE856B62E5ECDAAD7415348F63C1178B3840793 183467 PASIONOLLUTMUKANALUKUISISSAB
126,700,128 *0CEB9EFEBA01B4981A1EBDFEC822AA6A60F62252 WMESPENLAUB
126,700,129 *0CEBD0F94F29700BF33B4BFB9C5AA871DF6AF155 18-FENWICK
126,700,130 *0CEE42173B9E426871805A968E7CC644A83A0230 wohlstandsgebiete
126,700,131 *0CE92EEE24F1172A100B9755D0BD007407EE5431 195BILLY
126,700,132 *0CEA335F1AFE1F904834015191045F1222D5435D WORDHAPPENING
126,700,133 *0CE4DD410D9C58688199C54CE6F9673F72EA3475 WORS VD MERWE
126,700,134 *0CE4D5364E2DE09983397F94EC1E9BCCE94342F6 1.APGKEVLAR
126,700,135 *0CED1CEF2EEEA77A45EE543272B658F10D62B579 WU-HUANGMI
126,700,136 *0CE2077FA4C2E81033DDACBB404ACE374125EDA5 [email protected]
126,700,137 *0CE21F079A48E05D1B7A935F7E009EBBE4930492 1DIPUTADO
126,700,138 *0CE00D0502ED058473265D3B5FF30020B8C6A08B 1.disentangles
126,700,139 *0CEFCF8ABC5CE9339FE53E667D6CFF44047E4218 1EEDAKCIHC
126,700,140 *0CEDB899F2585B78BB6F1043AF4241402E77D89A WWWTHROWBACKMAXCOM
126,700,141 *0CEDFA80C24AC09272B8675648AD955392F8FE7D 1instituutioihinkin
126,700,142 *0CE3BB98499FFD7F3FABB6ABED85686980E48088 1.INSTITUUTIOIHINKIN
126,700,143 *0CEE03C55B6D9989202C4A0538575B950256761B xclmtvs0
126,700,144 *0CE163A6FD1FEAF2CDE3EBCF84DADC19F0B77316 XHEMARTIN
126,700,145 *0CEA7A31D2B0B13E3DEA61C5758A8D65725D50CD [email protected]
126,700,146 *0CEF77EDCEA4DC7A579719037EA8516CDD789570 [email protected]
126,700,147 *0CE4B6EC28D25BD832F4D8B63F18B8ACFDE9BAA3 [email protected]
126,700,148 *0CEB178B606898FB916D5D06A7E72E1616AC8EF1 1korondy123
126,700,149 *0CE3894E68F17129EFBFD1C2E5A7665C958FC660 [email protected]
126,700,150 *0CE7BD2702C19CBFB25540DCD056DCD4F40E6D3A 1lahjatavaroiden
126,700,151 *0CEFB2820E88D41333F96D0F584BC3D2B4B89B48 XPOSTBSW7
126,700,152 *0CEFB744BA12F684B035F292B24A41C2A68E3631 xyij
126,700,153 *0CEA3359B097F7821EC48D928DAED98ABEE83C38 YAGYA-GHIMIRE
126,700,154 *0CE8A1A7D83ABEADC9E2885324E799705E76E361 1POTEVATE
126,700,155 *0CED69E4EA63FE09640A7C33A3741E2082417DF2 1SCHULKENNTNISSE
126,700,156 *0CE1000A0C858DC65AE754C13BAAA6AECF2772E6 1SELAINRIIPPUMATTOMALLA
126,700,157 *0CEB16ADD78A16FBEB17652D35F1A72C0A0E7410 1SELBSTTOETUNGSGEDANKEN
126,700,158 *0CEE84DDFE6EF5319802389EFB7A70C54308604C 1suchow
126,700,159 *0CE03BC7405F07BFF03F2A2A5A713553EFE9D961 YLIGGUF3
126,700,160 *0CE919A79FA844DB42C10579DDAA205CCFE67BAE 20mcshane
126,700,161 *0CE543F70C9018CAA9AD2FB84D29C5C219454CB6 20PANDELE
126,700,162 *0CE1F38D4BCD7313E9A401D5F56142059CFE8EAD 2141066 TATE GEHT 12 RUNDEN VOLLES TEMPO .
126,700,163 *0CE2F80588F95585CF6DB6C8D049334AF4573D6F YOHITO HIT
126,700,164 *0CE436388EE96E09749BA492A2E3F51622B0C8BB YOMOMMASONASTYSHEHASTOCREEPUPONBATHWATER.
126,700,165 *0CE02E25C3422C0170A238F9E32D7D31660A228E 22AUGUST1201
126,700,166 *0CEC06CF9F46F7B95F9CBFAF4258F2BCFBEC0292 ,YOSHIKI在DRUM
126,700,167 *0CE0339D3C92B0CD8DE4D04A5A4023F5577E8E14 youcantellmeanything
126,700,168 *0CECE9FEB84A3254A37735F60E09BDE3DEFDB4BE you.can't.make.money.dreamin'
126,700,169 *0CE4C8DD9DD56FABD859F773469CFA1A19EAF273 2558299 todella-vaikea-valita-top5-pelaajia-:-l
126,700,170 *0CEB0A06101ACCF1E9C87E810116CAF27ADBA115 2762937 tarvittaessa.tulee.toteuttaa.ainakin.yksi.autopaikka.lis
126,700,171 *0CECFB41791A41EA1E682D0D586E93882A4A1B3C 2bmandate
126,700,172 *0CE9E8A8E81691997CEBA70B98DDE51417D64075 ZABIQEJOCAX
126,700,173 *0CE12E97971C4F72F08B0891FE73F10F488C9C9D 2CAMILA
126,700,174 *0CE0B06C1324F1D7F060FDBDE67A880D9B4F52F0 2-disulfiraami
126,700,175 *0CEF58111CD775AB17C2686C3B83C16B71846541 2.englantilaisittain
126,700,176 *0CE1ABBB1CF4A309D1ED81A6DF2FE2B75B41C6D7 2errorsand
126,700,177 *0CE73AD7464214675AD8E87D1EA401721445E82E zarzecze7
126,700,178 *0CE4A20361F12FB98FF15C8B1A480295D0789162 2NAPAEAD
126,700,179 *0CEA89093575DC02FD2FF24D09C4C03DEC6DFBC2 2.rajaniityn
126,700,180 *0CEEC93D851CE8B6459CADAE6788B8C9035E9492 [email protected]
126,700,181 *0CED0C7D885286BD518759BF06D53EB9484E8D1C [email protected]
126,700,182 *0CEBA3C41F29FFAE890C9A986A5CC83780723AE5 2.winterschlussverkaufes
126,700,183 *0CE5F1DB28CB612C781C1E152395036B1662E515 [email protected]
126,700,184 *0CE130A31770B6971BE982FCD29D7A6C6ED9ACEB [email protected]
126,700,185 *0CE67DA8098328848F69307D461AAE92F7BF4F51 [email protected]
126,700,186 *0CEF7E366A6F97BB666879486EF7A82D57C88F2F zielsetzungen
126,700,187 *0CE3A40B8824EFB3B0B00E2F7A6705BD23B83174 ZILVERBONS
126,700,188 *0CECC3B8047C4E2E046AAB3F30A3CF25FA8D36DF 35.EXALTED
126,700,189 *0CEF835E1553510B9DCBD2B2B92A87C9E9EE21F9 366159 vielleicht-wechselt-frentzen-in-den-tourenwagensport-.
126,700,190 *0CE094F0ADE1F9C0043E14474AA351FF41F17D40 ZIWYLLISWSB
126,700,191 *0CE1856DB50E53A180BF9FE972D44B0F7AD3B982 374883 (TTPIII)IIIBBITKIFUNGALHAST
126,700,192 *0CE1A828324E7500D135A537C67E45DE377CD103 381JUSTUS
126,700,193 *0CE6B8AF60C46EDB1490B1252A161691679CC880 398226 stereo ja l
126,700,194 *0CE5BCE8B12AFC901DE498F9C3557711FFB50929 [email protected]
126,700,195 *0CEBAC57C528FDC685C5940E84AF5196A83648D7 ZOECHISHIOS
126,700,196 *0CEF35639A4CDEB67C35A0444D4C6348E8C71C70 [email protected]
126,700,197 *0CE01996AD7B2DA941B8CD3BF99129E3E91B6DEE 3=====d`~.(o_-)
126,700,198 *0CEA2D72338D7A55BF224E4E5AF6DE2F62787883 3GEBETENEN
126,700,199 *0CE08430CB23FCE1C27552F4E810A0FBE12FD8E6 ZYANGAFREECHIPS.CHIPSGETFREE
126,700,200 *0CE9F15C68AC970F39FBD704171081BB46627297 3 lzbpraesidentschaft
126,700,201 *0CE78B093E5A2DF33D6F6CCE049FA56B138CE98B 3 MAGENSPIEGELUNG
126,700,202 *0CE52599CCE90D8CC3DDC4F636C340CD798AA834 3#@.~OSPLAT!!
126,700,203 *0CE2440AF5B6F9E3880A9A8A1CCF9F3188F8CC89 3======P ~ ` ;)
126,700,204 *0CEA8A5A919DF1C25687373DD1919CBA3787574E 3######p.~0~o.)0(
126,700,205 *0CEC3E1688E68CF8393F8777732905714E2F3EC4 ΕΞΈΡΥΘΡΑ
126,700,206 *0CE52557E3535148CD066147C6477822112EC8D0 ΪⲞⲨⲆⲀⲤ
126,700,207 *0CEE7B9369C536351B3B08398C48BBF3A3759218 3------p.`.splat!!
126,700,208 *0CE799EDED6ECF9EA3DD61D91E8D49250105FF2D $3ROLOGCALLY
126,700,209 *0CEBAF9CF05FB80620FCC1F6835D300C3C19DAA5 ΧΆΟΥΣΕΡ
126,700,210 *0CE16F3ECA5A13EC3A8962ECDF8646043B51EE5A АБАРТАХ
126,700,211 *0CE14097C6C5DD63FE9650C416BF3E47FA2622A7 3-WESH
126,700,212 *0CEC933C85A14093398788DB7D92C23382B912EC ауфсеса
126,700,213 *0CEC1D4D3A3A12BAC5FE4F96337C9FEC52ADAECF 480 HAFTSTRAFE
126,700,214 *0CE5663DFD179C29CB8856B626F562788B118BFF 4ESTIOMLI
126,700,215 *0CE17EFBDD5654AB4A3AA0B730561B35DF8F80D5 4 HABLAR
126,700,216 *0CE10BA2047E442F5D1D3B1DADCAB0DB0F4B5139 лагизить
126,700,217 *0CEFC1F179D3709191AFEB8B09425AD10FAEBFC4 мюхленбах
126,700,218 *0CEAFF815F57D4A2861BDDB8CEE3D34DF8F06835 ПОБУЈНО
126,700,219 *0CE51201E58C17DC331ACB38126C60ACCCD6C07F 4MURKRONE
126,700,220 *0CED2E27D2D8C7A81DCBE74B4E2B5764C638EBA6 ПОСТЫЖЕННЫМ
126,700,221 *0CED66247A0ABF6B1D336D07AF3A70702D4BC542 4ONPERSISTLOAD
126,700,222 *0CE3F4000EABC5B0C9A6BD6EA116110EA3F7209A 4OPFBRETRACASSILEM
126,700,223 *0CE811BFCAAD80C0D244D3399B1B94886080D12F 4PAJAISIA
126,700,224 *0CEDA1E820C2C96D8DE2E9D2CB053287F378B82B СУЛАТНИ
126,700,225 *0CE26623A6D33ECDF0CF768BA381A5F91421FBB6 ТРБОБОЉЕ
126,700,226 *0CE8F266A75222DF82BEB68F0CDB41FA8EE4CCDF УЛИЦЕЮ
126,700,227 *0CEEBCA39A898CDBBFB6415211DBB6673DA65862 4ruizsmeriglio's
126,700,228 *0CEA6C94FE9291DD7C53525E52A1F8A01967F4AB шадлаш
126,700,229 *0CE8B2969183A36C181E42B1EE7B7ED3A776DD2B « RENESMÉE »
126,700,230 *0CECE505100B7B1726B776677AD817AD5DC84C38 51KEMIJ
126,700,231 *0CE511E0D9AADE8175592D5534DBCE120CE03695 5291954
126,700,232 *0CE5D8942CE87FFCF76E5020194CEB6778E7B26B 天坛座ngc天体
126,700,233 *0CEA764F5B7780D22691720CEEC5CACBA94C336F 开发出的DLP(全称:DYNAMIC
126,700,234 *0CEE9931D39A7F4C4C4DDA689DB71449D3AF60A9 5BSWZUBAIRBSW
126,700,235 *0CEBC4E1CA3B4BC8DD3273BAC02CEB696B456086 熱帶低氣壓IKE
126,700,236 *0CE65AD9F70E21D6E0BA72361EF420504FDC39D4 5detonate
126,700,237 *0CEDCD35531773FA60FA59206C54D3F3337D676A 藤井シェリー(5月18日、MILLION)
126,700,238 *0CE5DA458893BB42FA3F4897CADFC4D4839792EF 5FROTHYSBSW
126,700,239 *0CE5E416140A90D82D99E38B31FA505673B7D3C7 5march1169
126,700,240 *0CE53DC1FF30DE5A813B14F96165EF5A694E1AAF 5MATRIXYOMAMA
126,700,241 *0CE602F3E30B542862A912275D68C837AC26E9C3 5SHEBACAITLIN
126,700,242 *0CECC9FC7B19F107A36ED4AEFF05C1F9EE828250 5SPASSHAF
126,700,243 *0CE6BBA8A8D23BC2F6457A2115EA16D692ECE968 5YKYKOTSO
126,700,244 *0CEE672BE44721566ADA092E1573D248F4205B91 5YPHHUVWBV
126,700,245 *0CE723443CDC0FFBC4C7ED472A8E63DD942BDEC9 65THFOOT
126,700,246 *0CEA1C69911C9909D982448B11E23B21DE32319D 6633423c761b377e91c4c448a5cbb039
126,700,247 *0CE9BE2C8924BF3AFEFC963BCD66210003A111EC 6ENHOTADO
126,700,248 *0CEAF7DBF65493E1252BA8FD8FB199795A4C5A89 6INLOCHENLY
126,700,249 *0CE17CB82B437181498E041D22443A931704ABAA 6MARCH1873
126,700,250 *0CE6BFB694430498D15BDE2711F95FF5F56885B9 6NORTHWAYBSW
126,700,251 *0CE3D50EC768AA8356BB81214360AB7A80533760 6TEQUILAJEANETTE
126,700,252 *0CE095D304C0427C57807447FB99AE603C6A27BF 6THEMOBILE5
126,700,253 *0CED73B434A828B49A7CD735A09F9CCB9994C7E3 6TORMKLOK
126,700,254 *0CEAA0A6F2E2C2C397CC5519623C2C1D2B3F2669 6TRACTORCHALLENG
126,700,255 *0CE543B776C27AF3BE5FCF6F702AD100A9409FFE 723769 talon.katon.l
126,700,256 *0CE1FBCC55406F2738A4E8BEBBFAF7F529355A8B 7BSWSIUQRAMBSW
126,700,257 *0CED843F5DB2FFF89A1BEA8FB111905F6AFFBBB5 7DIRTRACKPBSW
126,700,258 *0CE39F2640897109D5BFF9EFC715786E2E474A35 7DUKEALICE
126,700,259 *0CEED2288452070204FBE067B85B2C70F78E2816 7EGILEDNI
126,700,260 *0CE01FA7417AF97788995269CDD3378EE7D9EF1B 7GETACTIVATESTATUSBSW
126,700,261 *0CEC1F4D5C895C51208D7EA34425F7FE837B5A7F 7NUTMEG9
126,700,262 *0CE0013C871C5FF73237A626D88204C244AD04C5 7RAJMUND
126,700,263 *0CE3501D10E880C035ED77CD23E2D264FE385FA3 7RECIRKULERET
126,700,264 *0CE98084454EF867A52E8DBAC6E888E431D1A8E7 7SCHTLGCLLY
126,700,265 *0CE4D3E6FBD31746B137523071D1D401BDA129AF 8AARONEDWARD
126,700,266 *0CEBA472D99467D318F85E7A55EB2872943CD04C 8ALTILOGOABR
126,700,267 *0CE05F900169BBA63B9445A2DFF6772C75C17D1F 8B*.*.}8{
126,700,268 *0CED0BA4C0E7485055FB8240E814694987E84144 8MELLITTA
126,700,269 *0CEC45CE77907A00FE7E0B5D1667F84BE535E84E 8MILLIEMONIQUE
126,700,270 *0CE6F252E186368383B24ABF9553F24F75C8D5E5 8-----)~~~)O(
126,700,271 *0CEA73201E31A760FA91F6B33F91B0689EF4E674 8PDEUTSCH
126,700,272 *0CE21516E2B935F64F614567F8B54E531F3B438F 8ROGERSENIOR
126,700,273 *0CED25E76F992E6D94D027CFDD8D65677B6C4DFF 8SAREIARNE
126,700,274 *0CE7F3985F3C77AB698E34D1D65EE65D009AAD47 8SCORPIONSAMPLER
126,700,275 *0CEB48FF91E40A4FECDCEACCCC5770AE540B318C 8SJYGBSW
126,700,276 *0CE8ACD9CF4A1879A57EB528E1E7217AADEF9CC2 0iluvlondon
126,700,277 *0CE05EF89C90597F6B67AF9B7FCABC28AFDD2031 8UNUTILISABLE
126,700,278 *0CEEEA6EF45D9BFAC2329A16EE5DFF174944FF96 8WARCRAFTDONNA
126,700,279 *0CE35969486C8992534882105866FC340A65362D 1027543 metso-paper-oulun-tehtaat-kattoja-5300-m2-ja-sein
126,700,280 *0CEDFD69B24392A3AF79488C3754BFB693E00448 1-04-1356
126,700,281 *0CE97D4DB1D319B9DE9CCAFE7AB1D811D95DE0E3 1051062 tavaraa-l
126,700,282 *0CE00BE1AC7A014D1F03D038144E5DE17F9D768D 1197245 di.osmo.vehvil
126,700,283 *0CE4713E33B0C8BCE7712CD5212216947C8FF97E 1,2,3,rhymesgalore(radioedit)
126,700,284 *0CEA7B883B43689B4EE5ED1DC6C40F1D000B69CC 9BELETRIE
126,700,285 *0CEAD4B3713ED7CA40CC277D7874D73FABAC38F9 1396.STRECKEN
126,700,286 *0CE109CE5ABF75187E2D7236679BB1D418D781B1 143-parisen
126,700,287 *0CEFB04F7C75E2E7E7B8A98448C8EB94368FBCC2 16.04.1275
126,700,288 *0CEAE56331D8FEB19937C7CADD5F5B5810EA84A3 1698590 " KULTUR IN BEWEGUNG " HIESS ES IM SEPTEMBER .
126,700,289 *0CE1684A3B4A02E9820B247BDF86DF6CFBFB9CC7 16-sUrUkleyip
126,700,290 *0CEF628E1E6234EF27D5BE4C2F5BF45E81F51F40 1940346 edbgruppeninit-jatallennusj
126,700,291 *0CEAAE1DBF15BA025509B5C4D4E735E60146256E 9RIQUE
126,700,292 *0CE71988FBF3C573AD70E7A9FD97B69957C0FE78 9SACRIFIONS
126,700,293 *0CE30CE3C39876480C758D47138AEAE513023798 1ALIMENTIERER
126,700,294 *0CE9869E270890AD17B7CB1205C5E795C8964B20 1 AUTOMOBILANALYST
126,700,295 *0CE3B93DCCF0BF30AECB3750B2F079E3FD3B08A7 9UPREFEREERESPONDRESPOND
126,700,296 *0CEDCDC65D19BC36965C1977F64D514FD36ED31A 1.ENETZE
126,700,297 *0CEC7FEC9F2B4019B25A590067FB077A3CF70DDF 1ESIRAKENNETTUINA
126,700,298 *0CE83A656568DDDD4AF559C2AD981D4BF1076E99 1.ESTERAN
126,700,299 *0CEF07DD8BE0D5C2D54BA14A97C8AA49085FA912 a-0zu
126,700,300 *0CEF2B6B85D5955C3F639C1C0384BB2675BE8EAD 1 FUEHRERHAUPTQUARTIERE
126,700,301 *0CE23BE774105C0E8A93EC8EBB0F95F40996D8D2 A2I7R
126,700,302 *0CE0957CA323905AA3C65CE677D0A0F5F432FA26 a,2vz
126,700,303 *0CE8F0E1E5342B94295D71FCEF181C2575826563 A3M+X
126,700,304 *0CE1BC402932136BE85E1F4DD52EAF9399864E72 a44sg
126,700,305 *0CE22B7D455398A52F9B5F2A16B8839AFE0468D3 a4t"
126,700,306 *0CE3D52D8CC097937727B894D6E392195EE25F3E a&4/w
126,700,307 *0CEBEE998B4B3F0109350EEAB875FCEBED427FDF a=5q6
126,700,308 *0CE5E3BBE8C624FF095BCDE1DF02FE38424D06C0 a5?r/
126,700,309 *0CED1D234B1497F6416CAC2684788218637935CA 1iluvbigman
126,700,310 *0CEAA80F2154B471360E88459253A350CFB150C0 A6?5
126,700,311 *0CE43FEAE6015C9E8C08BE2C47D7DF53ECC5723F 1.kahdeltakymmenelt
126,700,312 *0CEB281C79C6C0449AD4A9784AF3210EAF16D901 a,&8e
126,700,313 *0CE32F82A082A01033AF6D08046167DFE2E342D3 A96685
126,700,314 *0CE7A387BB20FBF8D3D58EE3791632BEABA7C8D9 A9DC:
126,700,315 *0CE4EC377DD0B63FA88EA9DAF2C870CD1A56D7ED 1.lto:t
126,700,316 *0CEF7A06F4362323D58801CB7CD8A757EA5238D3 1-mammut-emission
126,700,317 *0CE4BCC2E9BA000DCFDEB4425613AC9BE74B15F6 AAA}:!
126,700,318 *0CE8338C50522942F2E111427FD5BDB46397B750 AAA|BQ
126,700,319 *0CE891A199B34A5B50BCDF8B58EF263CBEA2E7BA 1MYJOSH0
126,700,320 *0CEBDA072F32364D53D56F18A4BE5D5C5E202A2D 1NCRRBRTV
126,700,321 *0CE9E06A97ACACBBB71CE3F6B4C791EE9625B97B aaa/y;
126,700,322 *0CECD7BE0A4F9A6D447A220942AB7C51D7D5348A 1-NJURA
126,700,323 *0CEDEECADA1B572B7CB348D657102D21D011BD97 1OMENATUOREJUUSTOVANUKASTA
126,700,324 *0CE09C7C846C070CA8F564EF8589F3361A2F3FAD 1.ostamasi
126,700,325 *0CEB013BF0BE00B312307BA107F65F9A559D51A7 aab'@i
126,700,326 *0CEC0C7E052BFBDC067DAFD4FE3B321E5A4215A0 aabnS
126,700,327 *0CE4D359A484546ED08803BB30736546985F543E aacnis
126,700,328 *0CE5420EEAF5796F530CCA972747920CFE2D85EC AADNGN
126,700,329 *0CE0FDE702CC021B9BFCB7C71CD7FE3E00F5D421 1radio-gespraech
126,700,330 *0CEA52CA54E9986B4C6FB79B3584B303056BFD4F aae1y
126,700,331 *0CEF9FBB110428BBD431AA8AFF97ED9289CC01FA aaeoy1
126,700,332 *0CE127B0B684FE1DB66CC5EB9CCB665A5031D4C7 aaerzb
126,700,333 *0CE20BFD079FE6064D80F33AC994B5F146020748 AAETBJ
126,700,334 *0CED8FEB13C8116EC2188785A8FBA4155DAEC258 1SHADAI
126,700,335 *0CED7DBBCCE22D911213D18F64CB426F32EF854D 1-sperrvotum
126,700,336 *0CEC1AE303A4B92652307B09603BF2D81EC82889 1TOTEUTUMASELOSTUS
126,700,337 *0CEB9536C97FAFCD72720A309A53B2EC4AD6BF1C AAVF9
126,700,338 *0CEB20E6766D3E2A7B9E7F8112A65159C6C0427D A%B4
126,700,339 *0CE11526C558D919B364E3F1B3429635EB5CD318 1vulkaniiteilla
126,700,340 *0CEA641AB9AE289D79E9A9F069FA652B87781047 1zulumonarchisten
126,700,341 *0CE0E6585A246A5D449B4ADCF8D007F368C2571B abeer-jumaa
126,700,342 *0CE937647CC09AB4408E274E439504668A87860F AB(LP
126,700,343 *0CE5D3629FA5CFC6475FA751147B103F4F1B56DD 20ARXITEKTONAS
126,700,344 *0CEF36778F34D878C8E9437D517CCF67ACE6D8F2 aboutbe
126,700,345 *0CE653209A88C2E1C642816CC26947A3E1D6FAEC abrahamcooner
126,700,346 *0CEB18EB38F8F3F175EAA821BC465AD06D2F28EF abschlu
126,700,347 *0CE31CC3988091AF5DD3D984E808D0051C60AA23 2198826 oili-pyysalo-och-h
126,700,348 *0CE817893AD651245014BB2C822CC6BA22A451FE a=/bv
126,700,349 *0CE90F3D4404AFC57CC939A3F18917263713F230 ac8fd
126,700,350 *0CEE3D3619425DFFB796DC2CBEE2A6FB00F94279 ac*b7
126,700,351 *0CEE228340A01F6B06FE3A40A2497B5B51B96E32 2429228 derzeit.ist.die.truppe.in.598.kommunen.praesent..
126,700,352 *0CE7FD183EFF8A1C4B82C38DCAABFD45BCDD8241 2431888 koska.on.mahdollista.,.ett
126,700,353 *0CE4D0F9709F81BA13DA990B0E4F1EAF8EA1376D ACCIDENTFULL7
126,700,354 *0CEDB327CD18A400FDA7EC028FA3D49290C7C5DA ACCOUCHEZS8
126,700,355 *0CE1FC68C985049FFFDC7D77A7C4972D888752D2 ACDQL
126,700,356 *0CE06F039F3A504A5FF3E86EDDB8FD9749C88EA2 AC,MO
126,700,357 *0CE14809EFA3C528CAA1C6783AA63593BE7475A3 ACUMENSPORT
126,700,358 *0CE085ECEB3CA4FF990BD520C40CD3831FC0B691 AC??W
126,700,359 *0CEB90BE2A802FBBD5523B8686458AFFD56328EE 283439 SE.TARKISTAA.REALIAJASSA.KAIKEN.S
126,700,360 *0CEBA400366CE31D03C4F05EF3188F3FB5849670 2922077 jos ne ovat oikeutettuja , niiden mukaan on el
126,700,361 *0CE12123D1B891120B153F2AEC29BFEC835D3A41 a-dark-horse
126,700,362 *0CE5AF803B562657A4EDCC027BD08D3E85E0E24D 2.eisenbahningenieure
126,700,363 *0CEB4C2679A2A774BEAB8B9023363BBC86AF7A0A 2ENAMORATO
126,700,364 *0CE32228205D1CA6F7FA79012F6DE08899F7C54C 2EPILOWAC
126,700,365 *0CE13094CC84653785ABFB07B82C63E6EB68F52F 2ESOIDINO
126,700,366 *0CEF322A92675A09F9F82C2935E9AB51E320499A 2-ex-guerillafuehrer
126,700,367 *0CE4CC8678EE73B1F51A32A7E059180A01CC8733 2FPRIMOPIANO
126,700,368 *0CE1BC180A61D2B607FD7A1386494E107CFB3626 ADR
126,700,369 *0CEA1F7BC495F4B341DFE26D62AC8D684D6003AA ADXK1
126,700,370 *0CE02BCBC7689146D48A78EA83BDEB6C03D4AC0A AEA-0
126,700,371 *0CEE0D77CA8E0EBBA55CA2EEB05B7FCBD5EA0E50 aefsl
126,700,372 *0CEFA2EAC4CBF81438D0A6F62EB8BE4E9D287F92 AELMYSSAN
126,700,373 *0CE35AAD7A53C98F7ED188288C070C12FD38CE35 [email protected]
126,700,374 *0CEF68253940755C286A8A89BC6A407A54BE8D5A [email protected]
126,700,375 *0CE368ACA449056C1BFC91C2F4E7184677A901E8 2.SANOITOIVOVANSA
126,700,376 *0CE1ECF671FDE3AAAB7029C9504DE832ACDB226B AFHOPPER5
126,700,377 *0CEEB6C20642E3D6EFAA45BB664C9DA3BEA7D949 2THATBMW4
126,700,378 *0CE35319CC5F56BCEBF0C056D8ED45DDBEAC55F7 aggressionsrituale
126,700,379 *0CE8720A0491F02BEAB1AE917D037D6101846DA4 320438 TALOSSA TOIMII MM . SATAKUNNAN PUHELIN OY .
126,700,380 *0CE83CF2FCE198A38A82B410DA5245A361B716EA AGNADAUH3
126,700,381 *0CEA76C126EAD5FDC2A3332C47C381862AEEFF0F ah.2v
126,700,382 *0CE346FB86434A6F9E95546B3A81089D89F6BA5B ahd0$
126,700,383 *0CE60E6D0BEF45BBD7A6678EFD32D39DE25CC5A0 AHMCS
126,700,384 *0CE85A7396611F77B41E89667608943AB98BF7E8 3b<.~`.d######p
126,700,385 *0CECE734497D2B22F57CE240413E337A6206C263 a,h#s
126,700,386 *0CE675E8A0AB3EDA76CB6971F374C0238FDDB947 Aij6
126,700,387 *0CE2C001AC82D9585A5D645F8B84E6D9291536DB AIMEEHAMMONDS
126,700,388 *0CEC27C3ACEA4BFC210A249DA2368860F2E2CBED 3-FREISTELLUNGSANTRAEGEN
126,700,389 *0CE98D1D5D15A72E34E633C4FDC5F0516DD4EBAE airotcet3
126,700,390 *0CE4A5951619B702076C5E235DEF6EBD03FA2F78 3ILUVMISSION3
126,700,391 *0CEEA002DFF2018B5EF50ADD5CD9412714E596B2 AIYKKY
126,700,392 *0CEA5FAFCFB486F7BC83DFA0E382A9ED15CDCB81 3laatusen
126,700,393 *0CE3A1920BDC4AAF2076E914285EEC3D92391DDE 3NGL15HBU1LT
126,700,394 *0CEE133B4E245DA2148327A45842D6D059B999A8 ak$f?
126,700,395 *0CE3C092B9C7CB805161D870C42DF5EE1DDE8889 [email protected]
126,700,396 *0CED61F468AF0144B2E846BBA0898098882079F5 ak_)w
126,700,397 *0CE643A279AB91C43F6A6A907357A77AA160F3FB a?_l
126,700,398 *0CE737546003703B54FDD86B9B8A6DF631DA8AF1 AL1U
126,700,399 *0CE4F3C0FC1AB2E2CC97957FDD7AE33AACD9D84C 3THATGOLLUM
126,700,400 *0CE21B3AB69A16C85E65448F25CCE8FE8DE45308 ALBERTCORNELY
126,700,401 *0CED7BE8FC590FDF434181E00173BC63F0C33E59 422858 some-economists-fear-it-will-spurt-to-500%-this-year-
126,700,402 *0CEB97A4E664E42E4B4E64DEDCD39F19722C25E1 439506 sellaisen-voi-kuitenkin-tehd
126,700,403 *0CEF709F3F3F11B35BD021FBA5D724B88226F7EE 43D53353A5A33F3D61F05D61010969A154449E29
126,700,404 *0CE2BC234EC8062D9F21031A92F4E1A670DC2780 ALDENMCGILLIS
126,700,405 *0CE5CC918BE6548426207DFBA527F6DA4E542A12 ALEX.GOODENOUGH
126,700,406 *0CE36F96A08377078A4700AA9670F99FB6F24BFF ALEXISLOEURM
126,700,407 *0CE6FCFF0C775E4FDBCD361FD1B3863A82CC80FC ALFONSOBLOUNT
126,700,408 *0CE9CF8E65FD94368C9B32BC90A130750611C7F8 4ILUVBUDDHA6
126,700,409 *0CE64EC84FF7EFD8355E8EC4E25BE9BFDD73BD69 4KEERCNEE
126,700,410 *0CEDB3A9809672822287E55809D4A8CCBE772CA3 ALLERTON30
126,700,411 *0CE719137785F7ADA7980F2F49364F2BED65336A 4LESLIENELSON
126,700,412 *0CE86FFFED95D1DE857E70DAB2A2A01070140ADE ALMSMENS
126,700,413 *0CE07BBF5E7161D7ADD3368872B8C2D518E9C0F3 4PANGIALLO
126,700,414 *0CE687C68FA8B45A27A321AE5355B092DF9716F5 ALVINLADNER
126,700,415 *0CEF7653DFD9869AFBCB74A743D6A52ADC6EA920 4RCH419C411Y
126,700,416 *0CE381C9ABEA67CB69CB8C5C1CCB7E3AFD660948 4REAPPROKSIMATION
126,700,417 *0CE918A800BB916D5B834B33AAA564683ADBADEC 4RRY64
126,700,418 *0CE8396D2CC135DC88C0FC48CDD292AD376C2794 a%m3
126,700,419 *0CE4A6BD220F042BD68DC8397EB3A77669CB0419 AMANDA DURY
126,700,420 *0CE7934D87D46D629354BD31C8BEC5633AA5F47C AMARIE.KING
126,700,421 *0CEAE0E235BDC5FF89F203B8CAF9ECF452C8901B 4SKREDENE
126,700,422 *0CE00A8BDB13FC577CA34A85D7F09CECDE50CFFC ameerzoabi
126,700,423 *0CE5129D4D1277170C3F936AC09DD541ABB00FA3 amosvanis
126,700,424 *0CEE83BE6B1DE25D27718C9A68A0BEDFE45C07DA AMRAN SULAIMAN
126,700,425 *0CEBA444FE0874495E85589E27040FD8A40BC188 amy.beauchemin
126,700,426 *0CEC4A71F60708974130EA2F51954245D1ACA2BF 534795 NEKERTOVATIHMISIST
126,700,427 *0CE23D1B62FFA0B396E3E6B17CA1004C30E17C3A ancg&
126,700,428 *0CED7DE2514FCFF6B902CEBDDCE02BEC04878FA9 576405 KOTIMAAHANKIN-ALKOI-KANTAUTUA-VIESTEJ
126,700,429 *0CE2D9DF167DD11DE153AD8F3C1ECB1A9E3D640C ANDRES.VALOT
126,700,430 *0CECAF6D1E7E468245F032F5DD9C951C4D5986F2 andrewkoenig
126,700,431 *0CE132677D8768DF103ECF757BB03513FE7941EC ANDY.CHRISTENSEN
126,700,432 *0CE30953BF446B5234A722C9A94A26D0AB05FBD6 and you my love
126,700,433 *0CEC36A89DCCD27E96E9D10A78B426E7E7B81C20 ane!i
126,700,434 *0CEF806690EA1EBA1AA60CBA735AE62F2F7A5045 angelomele
126,700,435 *0CED2631A97246EE0B92A4CBD30F6D3610D584F5 anglicarvm
126,700,436 *0CE00CD3B5FEFDC8E4C148771DB3456FEDDAF18C 5fremescent
126,700,437 *0CE802B2B8B0250E90EF442129855EAECA469608 antinormality
126,700,438 *0CE33629A01D9EE012ED0EDB67F8280FD3383977 antionesexton
126,700,439 *0CEC0EFFD4B5172F82558B745021ECDDA02CA8AE 5I3RRA5
126,700,440 *0CE2736393DA3BC5FE27A4787B60658C85DC1B01 5.IMPOSSIBILITIES
126,700,441 *0CEAF79D303584FE818ABA56D513F096A4BCB078 5KOMPROMISSLOESUNGEN
126,700,442 *0CE5F335E0406A42B2A477D4415945B8758BF40F ANTONY.KAUL
126,700,443 *0CEDF2393CE6AD065DABD4841AFAAD70BFFA5721 5marktakteure
126,700,444 *0CE38D366C12E6A9C600AB0D5EAAE3000FAFE91E 5MIMSIRIS
126,700,445 *0CEBE63E54D93A0C70C0220209A039045A87D961 Aos7
126,700,446 *0CE6D68C40B9CE27A73ED55994A34B5CA7F6863B 5refutals
126,700,447 *0CE35CA2CB077CDA4CB97574D632C4C7EE72DB03 A-OUT
126,700,448 *0CECFDDA321C7718C95708C89A8C3CB6854DACCF AOVQ6
126,700,449 *0CE55B9BAEAEF612DBFE071357B8165662B56092 apgu
126,700,450 *0CE5963AD2842EEEECDAD3C16FB76B9AA31993DE aph)#
126,700,451 *0CEAFB1BD7B6451686ED94CFCA0286703F6A9E2F 5TORILLA
126,700,452 *0CE02F1F9204C0978F54ED6475FAC3494751A0F1 A"QE&
126,700,453 *0CE8960A1FB30D21DD4B2D4532666681AD9123D1 [email protected]
126,700,454 *0CEF682E9A9811D5AD4F5DF7C6151A8EA231399D aragramy8
126,700,455 *0CE8B3943B6C816BF75E2A0129E12D56520484F0 AREISTE8
126,700,456 *0CE8E7F87C2BE3F973357DF2783FC374D048402D 677ERIN
126,700,457 *0CE84516E030F2EF32E6BB18D64AD3B6727DB87F [email protected]
126,700,458 *0CEA7A5066C040B1F4B79108C20B3042E3DF56AD 6BSWCCBPSPBSW
126,700,459 *0CEC230775D1EDB2275B1CD62D8A831D9A0E554C 6BSWPEMBRIDGEBSW
126,700,460 *0CE492AD3887BC9D6510B0592D007978931F43F7 6dealerline
126,700,461 *0CE6ECF17E9404142B0A3DEBBFAF95B3EE092CF2 ARTICLESLF
126,700,462 *0CE92B197700F3C0CFAB1A7A84C7F02441594BB2 6GEKROESDERS
126,700,463 *0CE867CC12D334ECA6E9265EEE8651F4A9CC31DB ARURKAR5
126,700,464 *0CE902DD50C6DAE20EAE05BB5CFFA004ECD1E797 ASAAT
126,700,465 *0CE32B78D89AF91AFBBB31A8FF4D2999B1ED2B99 ASHWINI.INGAWALE
126,700,466 *0CE21BA1A4C85ABFDEB4B56B202559EDD1C0B0BF ASI$S
126,700,467 *0CEB5E53DF0CFAB7072C39DD81C43A4D42B899BA ASPRI.MERA.KEY
126,700,468 *0CE7D3F8BC953D99F6C14C6016B0772D9BE5E6CD athiker0
126,700,469 *0CE6AE88CB5E9E27B8BAFEE384A576171ED4D863 ATMETENING
126,700,470 *0CE804776BAEA867DB72F10FA61E8BA3855041E8 ATOMMMAG
126,700,471 *0CE4B1C8CD3D85CD1F1B4CE8B9DBC65E560E1C9B ATSIUSUO
126,700,472 *0CE718ACF1A3FB8100E2798A9BB45FC16143F6D8 au703r07$m
126,700,473 *0CE9FA21D7ACFAB589C66DD39AFA0C6E16B75F47 77lkjh
126,700,474 *0CE09B5058AC050D354AA0D3266BC41BFB0A45CD 7:--7---#---&---resettle
126,700,475 *0CE5BD5D63D203ADDEBEAF720951E87C30BE4CE0 7: 7 # & RESETTLE
126,700,476 *0CEEB1AD0627A59187EA7095A25F25E67BF26A83 augustuswoelk
126,700,477 *0CEE836ACA58BE004A541D6DBA99FF0ECAFE0FFA 7ARSENOPHAGY
126,700,478 *0CEF2572F3A02A0D56ABFF82403F37782ACF8E22 7B_AAA
126,700,479 *0CE81046F889CD7A495033180D360D36A4BB7086 7BLAEDDRAN
126,700,480 *0CE78F9A80721E34A600A7FFADF9C77C4E90E58C ausgabening
126,700,481 *0CE5CE43E4CD1AEC5DEBFFC9D3C1080E62100BB4 7BSWZSTRINGBSW
126,700,482 *0CEAEBB7DA5DC2B44822EC642740339819FDFB07 AUSTIN.LAVERE
126,700,483 *0CEED89023C9812EFDDDC220BA6F73E08E2E35CE AUTOGRAPHENKATALOGE
126,700,484 *0CE01C904E99E672BA5AE789A6ED32981570F871 AVERIKSI5
126,700,485 *0CE1951416AFB4E0C1A07A26C8D129D194784EE0 7FRIENDSGREENDAY
126,700,486 *0CEFC416A7821FB3BF3C9A343DFA16EB9597DBC0 AWMLI
126,700,487 *0CE56F45BF1C3748DFF6D0737610049F4D2F72C9 AWS75
126,700,488 *0CEDE7AD931814625CBEC63E9B122007B06E2AA4 7NORMANP
126,700,489 *0CE74917BA7608140F6D2D66ACC4078B439A913A 7NORTHCENTRALBSW
126,700,490 *0CEE73C1F935F9FA2B4803948030BEF95B4E4F0D 7REDRUMROCKY
126,700,491 *0CE1B2CE07FBCBE804D6065DC81619F35A43B55B 7.SCHULFESTEN
126,700,492 *0CE991574AE7C86B71941816812FCB04818B284B 7SKOLEKOMMISSIONTH
126,700,493 *0CE24B2BBFF0252FEEBED1770D930E0C6ABDE5B8 7SWIMMINGCHAOS
126,700,494 *0CEE4441CF5C5569D2831C68BDD97C2728778CF0 7TIMEOUTID
126,700,495 *0CEEDBEDA3963B1DEA212AF4D50CF63F316D694D ;)[email protected]#B
126,700,496 *0CE5B58F9EF6E6386C9D17106CFB5B78EBC15A3A B===)`~-`~->-<
126,700,497 *0CEB0A91A20D004357FFAB8DF83A2630AC9DA06B 7TRACYAWESOME
126,700,498 *0CE7AF7A7154824FC4015275C7F7FB75844CEFBB B0B0F69811463F72A7E92673FC24FE1A
126,700,499 *0CE0A0CC201FCA5570DBD8F95BA5CD14AFB5452E b:0vx
126,700,500 *0CE013D8A097188A84177FFE61AC24867E6E6C3B 7ZY1
126,700,501 *0CE2F9271AF16DE9E13671ACE6118F35421CE65E [email protected]`~-`~(-_0)
126,700,502 *0CEEE61A990638F47B0FC42E6116D73C7D05B9DB [email protected]
126,700,503 *0CEB6D68E89C902CBAEA2426196360A5EFCE2F59 b==)-~-~-~3b<-
126,700,504 *0CE5B9834A4AF898085E95D0AA0A1C8ECDAC7F3A 8==>` >b0
126,700,505 *0CE0360FD84C0B347273D636CCC75148C472E8D2 8-BESCHAFFUNGSSTRESS
126,700,506 *0CE0EDC7FFA9445053E9775DA5C9D07B0C414BBD b5va
126,700,507 *0CEBE4884AB3DBBB5AE9B392E366738B4B8C0109 8BSWLATNOZIRBSW
126,700,508 *0CE790B68B0BC0D10B5ABCF8912AD07390E4B48C b?7&b
126,700,509 *0CE8E23A75A6BBA152E94E3AB79B068FFD96B8E9 B92004
126,700,510 *0CE2BB7F867AFF5C67679963D5174480A360852C 8=D~O.}O{
126,700,511 *0CE6B4D38F707DC8AFD20977723A391914CEE9AC 8HEATHERMEXICO
126,700,512 *0CE1CA389A6C313DC2CFEBD3521557DFE4048F07 8INBUNKCAJOLECATCH
126,700,513 *0CE37015960443F802ED86A9A38652A9CD4CA8B3 [email protected]@1I5M
126,700,514 *0CE9E1E9084BD43EEC3D4BE658A8CF572D9E411F bananajing
126,700,515 *0CEEA4B7FC4EB75BEF3F493C130B359F84C7B49E BANDEIRA_DO_SULSVG
126,700,516 *0CE157B70C7F136DBC1B9E9FA2823116242E305A BANGLINGGED
126,700,517 *0CE39F6B7E705E3E1D08B3DC9D6913AEAD08FD15 8MELANKOLSK
126,700,518 *0CEB02B77AF60F27BB6069C0160171F60337FF1A BARBAR735
126,700,519 *0CEA107E6E33319A1FD76A17630194807DABEF02 8NAOMISYDNEY
126,700,520 *0CE6E90E49D30DDB0CFF16EDAD6F5E06AE556E81 8ONPASSI
126,700,521 *0CE90B87B394BE806B6759125C8E7990B06CA286 8OPUHWRZEHWY
126,700,522 *0CE4EE45ACD3F3D351648D69D7934F0D0C5B82BD 8SHEBARSHIN
126,700,523 *0CEA647CE19AA741B82C6416CFEAC87B91935E76 8SIAREISASSAR
126,700,524 *0CED38974AE800F5E22A639A6B54C218B10FAE6E 8SICWITIT
126,700,525 *0CE03E4908E74B1A0912DB6659F4ACDD4175AABB bbu;u
126,700,526 *0CE48818F075DE6CBFAD31FA055FD989DD604E0B bcdgl
126,700,527 *0CEFC4D779A1E38A925301B2FE26E6CB9C14FF20 8USGVIJTVZVE
126,700,528 *0CEC9CFD490EDC8D8DF80C0D03FFBB47E4D58E78 8VORAUSGEEILT
126,700,529 *0CEA2A156E64B02E1E195E32D411EF95D0EA74D8 8YLEVITISNESNON
126,700,530 *0CE3CDE1AE7543140EBE1877C07730DFFE5B82AC 9BEVOELKERUNG
126,700,531 *0CEB006C771243FC5BE3630C2E7D49F17C9D9755 9BSWBASEDONBSW
126,700,532 *0CE22443B0F72116150CC433D815860FDA5ACDE3 9BSWDPCBSW
126,700,533 *0CE1F30A160A7A3EC31A622C42E1F1DBFF27AAC9 B$EK-
126,700,534 *0CE4D777E979CD65211244B68D1C30AA1E837547 BENITO.WALLING
126,700,535 *0CE08743693AE04CE25604FF402FA5C0E375208A BEN-NOVY
126,700,536 *0CE90F25E27F0A06C5B3148946FA3E8BCE5FF402 9ILOVEBONZO4
126,700,537 *0CE8871FBB79E10427D674B06BB4A86B41A1F31D 9JOELKRISTI
126,700,538 *0CEA6BAAD8E6D0C37349F7C4F3242233F0BF6289 9JSBACHBLASTER
126,700,539 *0CE32BF211C06F99437B97FE50ED9687CCC65B0E 9MICHELLFREDERIC
126,700,540 *0CE3F9ADD640AEABB8620D9E6894AB8D7BEFB3A2 9NWNSJNROMVPOL
126,700,541 *0CEABBD0A9D3C097282729C7E3D347AE1097A180 9PUSSYKAT
126,700,542 *0CEC9B127A9E2D9E76891524F4DFB76006C6FBCE bfe93
126,700,543 *0CE0DD185E3E1CA9DC24E590E8155EFDA4AC77C4 9SAMMYMASTER
126,700,544 *0CEA1EA086AE47BAD7ACF61DB314336A11D1512C bfwc%
126,700,545 *0CE1247D672956A53F32BA1B4A640CEFFB3D0D60 9SJUQQWA
126,700,546 *0CE56A31FAF0795947BF1D3C9C485B067177AA3B bghkc
126,700,547 *0CE6A649ACFE308E341FD6218BD6E923FB51CC39 9TIARIUDED
126,700,548 *0CE80A98A050FE7B3C4147AAE0ECFA4FFE42FD14 bgtnc
126,700,549 *0CEAC20A01A5CDB734684DE9F378966EFC37339B [email protected]
126,700,550 *0CEFEE31B506EDCB28791D2D25C4DF677D797CC3 9UNSHREDD
126,700,551 *0CE2DD6DC3C41C0A9920FDCA27B10450114EE819 bh6x5
126,700,552 *0CE3C00FADFFD95E5363F4717C45DE6DA362110F a2#!)
126,700,553 *0CEE5E3CBD6B7EC432738309FA5A2B9CBC25DC99 BIDH
126,700,554 *0CE058E13572324B5F28C0ED0C3AE6FF0D4C5A0D BILHAHES
126,700,555 *0CEA300415D54956F23B36AA085CECA5A9ADBE61 A#4#
126,700,556 *0CEE76CC2BCF7C24A040C7F2C321536452D760AE a4)e7
126,700,557 *0CE0DB0A3A2A0128C4FB36FC3CA9A4CC859F6079 BILLIONISM
126,700,558 *0CE1BD02277BAFA9C3DD4E148C69ADD68B2634C1 a88rev1ator5
126,700,559 *0CEC4D311DEA519ABEE6601C33586A4AE5F0938A BK.
126,700,560 *0CEE99E16C88AAD671CE676E63AA307960E08DC2 bka)c
126,700,561 *0CEF163BBB8491D5AFBFDEA5D3767866A2AAB5A4 BKDY
126,700,562 *0CEDA94D4943E552BA74E5BED3C46FEB406378DD a9avm
126,700,563 *0CE7CD20C3A236B9CBF9A69CE0FFA31E92B73600 bk%ge
126,700,564 *0CEDD2BBC68C79DD184C81ECBB0F96844A859941 BKID_
126,700,565 *0CEB542F2AD3833D4DA4F99CA3F9DEADE2F8F101 A=9UW
126,700,566 *0CEB7E1017518753988E7E78EEF93852EC51AFC3 AAA~
126,700,567 *0CE15BCFA1FDAEC52C95A2B11E1D500B43F0F2EC AAA}K}
126,700,568 *0CEFB9DF7816315F4D274ED589C92231B2C60316 AAAMW
126,700,569 *0CE928CA10980653171A68D8D822D0441D97FDC4 aaaqk%
126,700,570 *0CE32CB58991DA3DF6933F3ACE6A93F9E119CC41 AA=AW
126,700,571 *0CE155238B545B7CFF2710321F20825991AC66B0 aaaz6i
126,700,572 *0CE730D319C0F040E676BF189D02DEC6E11112AD BLEGINGS6
126,700,573 *0CEE0CE2E3AFAE4E69EA2EB2186EDC4F66AA641E BLKWWG
126,700,574 *0CE2F9F6D8D20571CAA48B2DF9AAC861F297EEAE blow-me
126,700,575 *0CE0C4B00E4D7ECCB848CDDD7C07B1FF109B8294 bl!pq
126,700,576 *0CEA48FA682580FF11102C0132C55997D5AB182E [email protected]<e
126,700,577 *0CECE05BE8287A4B623ADBD3FBD676B57079C520 BMLH:
126,700,578 *0CE65AFF28B398552BD6AB06004EE95FA3C18FA9 bmmelbi21
126,700,579 *0CE5B24DD866F99F543A621839B30708381452A8 bnbnl
126,700,580 *0CEE09578CC63A8239477AA43A2B629C7CF54B00 AAULF
126,700,581 *0CE20ECE78BF06B03B22A73274C4D79ADCDD55AF bobbyespejel
126,700,582 *0CE3DCD7A4D65AD8B5D994D2FCDE7446C0A5F0FC ab=ah
126,700,583 *0CEAC6678B78245AF6AEF9A16B36C3A90DF9DA38 abc5
126,700,584 *0CE2D75AFD05A23559F79AE8A3FF7F04AC7E5C65 BOHE+
126,700,585 *0CE3E4D6EA6CFE6A0AB3D03A070F5FA86FB18561 abdulazia6
126,700,586 *0CE3E8EFCCF8DFCF7092B828927EC6B9658D4C12 BOLARYEV1
126,700,587 *0CE5551138AB7E39A52522CB519BE78FBC5FB354 BOMBER-JACK
126,700,588 *0CE9968C38023152D4CDDC94971C60972436782E abf&z
126,700,589 *0CE7324021234362876CBCC552A57F2A75562082 bo-rf
126,700,590 *0CEBA82256CE005FD63757C6450C0183715B1FD9 abschlu
126,700,591 *0CE31CC3988091AF5DD3D984E808D0051C60AA23 BOSXT
126,700,592 *0CEE931E7A4533CE16FBEA701E3DACFDEA2227A3 bouttières
126,700,593 *0CE845E79971A1E0FAA2A26A56489DF18B1E1305 ac5ps
126,700,594 *0CE1CF0B4C1D043E10654DDDE9D45543C493D940 BOYDJESENOVEC
126,700,595 *0CE777E1B67B68CB01F4D7C8AF0763536EAB768E ACDQL
126,700,596 *0CE06F039F3A504A5FF3E86EDDB8FD9749C88EA2 bpeg6
126,700,597 *0CEB0803451DB8565294D9DF1A3A0F3FC88D7BD8 b=pok
126,700,598 *0CE930C31F06F695806374D5FA68719A7115985E AC$T
126,700,599 *0CE2743A32F0FFE8AC2B7C504C251923588EDA7F ACVCA
126,700,600 *0CEAD4C50AE38A81629694CE3A5F7445A63187C3 bradlyvessella
126,700,601 *0CE6A1B0D598F8F6D97CBA67AB078AA81B66CFB5 ADALBERTO.DANUSER
126,700,602 *0CE7DE6E8D6C19E62755A122D460225F978124CB brainalbarez
126,700,603 *0CE9D11C72EE9635C776B666E0CF3FA044E5209C adammoodispaugh
126,700,604 *0CE75D3E7DF58ADF564FA03010CBFC73605BBF10 ADAMVENDELA
126,700,605 *0CE6900F57877CF3E79741189EF9501B612193A1 adj9
126,700,606 *0CECBF41EE06960F92A44FABFE417D989BEFA16E BRENTON.SCHAKEL
126,700,607 *0CE7492178978FDA1523314D07864CE8C78241F7 adp1f
126,700,608 *0CE1C36A42E4D4DCC483F769A365A80267D42D17 ADR
126,700,609 *0CEA1F7BC495F4B341DFE26D62AC8D684D6003AA adt=v
126,700,610 *0CE976990A4697ED8F732CA6895EB420390E22EA BRIGITTE.BATKE-SPITZER
126,700,611 *0CE39D2E5FE366A38875E3D34EE57359DB5C1F39 a:#e
126,700,612 *0CE7195246D46F0DDEEE21DBE738F997DE0F8A14 broad.top.city.pensilvania
126,700,613 *0CED2EF4EF62A367E3144C159F3F9535554E452D BRUGV
126,700,614 *0CE89417C6E197AE6826401BD1FF8B9F17ABC49A aezw0
126,700,615 *0CE0BF0CE5417754D9947BAFC33F3E3A4061F6CA a?.f,
126,700,616 *0CE1E79DBE88959364FD258C13CB00C685EA927A a"f=1
126,700,617 *0CEFB22586001BD48A51D3F3EBB09D724C41C339 bryanuseted
126,700,618 *0CEC57F22FEEBB0A486E78F6DE2515EF41917079 AFN(F
126,700,619 *0CE73121B3E6A8DF9E6F67E8212C3DC49C1FCB8E AFRKN
126,700,620 *0CE392FDADC67FA7881C5DB65B75676005ED74FE A!G-1
126,700,621 *0CE326980B547757BC7CD72A8EC095B5A10CDF14 AGATTTACCTCTTGGAACTTGTTCTGCAGTGGGCAAGTTATGCAAACCTACCCCAAAAGT
126,700,622 *0CEFC913D1D0A8E95EA3E788996D4C94BC6E526F [email protected]~ ~ SPLAT!!
126,700,623 *0CE04F0FAA30AACBDD68B1A1BFE04B530E6F97C9 BSV3A
126,700,624 *0CE545DFFF08FC4CB0D1E3882B07C8589D22E152 A.GLI
126,700,625 *0CE5DF8419090294BFDE5C251B5B4DE7C677B42D AH-,
126,700,626 *0CE441A3DC97D01EBDECC2CB67D71932E752155E AHERMCHYNT
126,700,627 *0CE1F6B67820AC2966598E637521B7FF489951C5 BTOKN
126,700,628 *0CEA1CD0BD513954F883B25C0B7CAA4E297D8141 a&h_m
126,700,629 *0CE3111B3ED77685BF58C485BE182584EC2052A5 AHM;T
126,700,630 *0CE64C79A5E72CC34D97865939DD68F55C1D7719 a,htg
126,700,631 *0CE3B7B6882EE4AF3A6A9CA2C2ABB4092C19B346 a!ibu
126,700,632 *0CE82C24CF81A01C28B7B3DD756DD5D0C4A1D97A aicodoet
126,700,633 *0CE4D33E049973B7E898489EFC2EFDB5E2A8904D budqv
126,700,634 *0CEBDCE45ED5FA274224A284E74F918CB9603A85 BUFORDGRALL
126,700,635 *0CE74E2432E623716F24A3A330CD7CA4E23F9465 AINTELEKTUALI
126,700,636 *0CE46151E03BD8DCAE3A2006AAB93E6E15219237 AIRAMEVA8
126,700,637 *0CE4857DC8DAC7BD8B5E8CDA1FDF74E0F42D248F aisiuluued
126,700,638 *0CE554C8138425027DDFB2F3D88B68DDDA934079 A-J_I
126,700,639 *0CEC312162CFA61CC6C053A1474BF60A2803996B AJONEUVOALUSTALLE
126,700,640 *0CE6C170603040770955EBB610A60A2911119A2A ajskg
126,700,641 *0CE3E538C190F1649082D65ED2DA058A8C39280A buvh5
126,700,642 *0CE97659256966A91BE88961F8524541DE728B52 bv,7d
126,700,643 *0CE9D3F04CC75CBE18D5B2AE2E271C1AEDD7FBD9 bwp&a
126,700,644 *0CE6B240F1CFF41170E778787B96D9CFAE4FF63C BWU_B
126,700,645 *0CE34CA8B7DBD696778C595E997F6859E78B6443 alanmago
126,700,646 *0CE6E0F7C1ACB26F15F874CD4B7D8F1A10F4D1F1 BYNYMEN4
126,700,647 *0CE22C89B68BC20BBF7AE59C429B65F7C7400038 bz"if
126,700,648 *0CEBD1EEFC3FBDF90AD5739D69848883341EFCCE ALDEN.PENTZ
126,700,649 *0CE7EF17EAEB2A052F2963BD411523C158479762 ALDENSHATTUCK
126,700,650 *0CE6A5ACA703AF956535CBD9C501C77AE47CE370 C0LL3G1AN$
126,700,651 *0CE53FDB3B6EF42A06016265ED0A09A9E776CDC6 AL.DOXTATOR
126,700,652 *0CEE4E917E248CDB4E40BF555B1ADE374105A5AD c0rre$p0ndng
126,700,653 *0CEF02198FB15F1A363806AD6F34E622E0E7176A c.1+b
126,700,654 *0CEC4B138204B5F34427A7BFA6599091C1843885 c1o5onn3
126,700,655 *0CEB998809B0961C8813926AE75FEE72997C4858 ALEXEIDSON
126,700,656 *0CEE1BD356C21073619DD69E845B84B427999BD9 [email protected]
126,700,657 *0CE0ACFE284CFCA9033E423D476171A1B3BB98DB ALICIA.PARTIN
126,700,658 *0CE1AEFE93D2FE182C864771B3BAB7001CA79CD4 ALIDRAKEDWARDLOVER
126,700,659 *0CE7EC3A6AD3E9CAB876B31152DD7CDF384DFC69 c+78z
126,700,660 *0CEA2ABCC99C4605338E5671174368DBB94E876F CA11!9RAPH3R
126,700,661 *0CE7A25894CA68D414BDD166E478F416164C62DF [email protected]
126,700,662 *0CEE3296A83F15326C64777262877089696B93B2 CALAMOPI9
126,700,663 *0CEF735BF6E6818096DF234E8C4CB5B667003001 CAMERONRODEFER
126,700,664 *0CE7241F0EEA9B9C29821DA0116BCD686C4CD7A5 canalou7
126,700,665 *0CEEA1534940FF7A7608BF749D5F5A2B505C95FD ALTONKNIEFEL
126,700,666 *0CE746CB50F7D067C31802EF6FC023FCFAA5DDEC alt(q
126,700,667 *0CE27E041D2E07D69C1EB0B168C4064739EEE44B ALUMITECMANIFOLDS
126,700,668 *0CEC09B57788AC71D60A2CBF3CB3F400EFD62361 CANMING8
126,700,669 *0CE87BD314950F3B53922580151D32B470B7E546 alyssa-arneecher
126,700,670 *0CE47A28BA76C34B2D8F8272B0E3865939B72524 AMBCAASXL
126,700,671 *0CE3E9362426961725A63525A7DC7A962FACFEA5 Amgg
126,700,672 *0CEA3C927FD158A6C0100DEDBF9EE9CBF085B492 AM-MATA
126,700,673 *0CE9889E3FE393F335BC5BAAB3E6FFC5F093579B [email protected]
126,700,674 *0CE262ED1D914E4B9371079942D58C24CDD5CE18 ANAKMJKT
126,700,675 *0CE57D5152E4484DD98FEC28CD29017F47AB355D CATALLAXYFILES
126,700,676 *0CEA71005B99AB5CBFD7FD778741A1D87FC71823 catconv4
126,700,677 *0CE6E688E79923EE094674CC37ED66CADE498A8E ANDERSON310
126,700,678 *0CEF16609AE68A3EF61AD2BF5853693DAF317D90 andersonco
126,700,679 *0CE59144A4B377B9123B844D7AE281D8D017EDCD CBEG-
126,700,680 *0CEFCB7EF239320298DDB026511BE821B3819950 CBJ;
126,700,681 *0CE2355A629EAB7397B9BA715B86C1BCAAD64EA4 C%c.
126,700,682 *0CE3A2366DA99AA3C61FF8A35544EE26FF3B5CA1 [email protected]
126,700,683 *0CE4B07743F390614E0DD8176D14651265C8226D cc1p
126,700,684 *0CE2A169EDEA37C54CB4FA871E2005CED95777F3 ANGRY-ANGLES
126,700,685 *0CECF33D2B2EBED58AF234FFC443B80F96C57CF6 CC$IJ
126,700,686 *0CE9FB5CD6A580F8F6B6255F97AD6179BA618C5C ANIUBAB3
126,700,687 *0CE22BF4CDD9D98D7E0474A4960995C7C6B19764 cczt0
126,700,688 *0CE5E5C40798AC56371B80C74D2B07F6895C7FFF ANNSHENTON
126,700,689 *0CE3C27BE637F2F02A8C2858FE698687C101523C C"DO
126,700,690 *0CE1B8DF4D9432200FFB230B4D602402F17DEAEF CD;W"
126,700,691 *0CE13DC7A4C4FD424A30D687CCE7443F9856500D antimorrocan
126,700,692 *0CE5E21F6D7783D6276B4B64C22DF1AA8517EB81 ced11a$
126,700,693 *0CE956823099A56495D4F6AF6B5510031B6925CF ANTISELL2
126,700,694 *0CED68DA9C73C4C68FA335CFA8B38B05693DC6FF ANTON.HIMEBAUGH
126,700,695 *0CE00081645489E50E8BADB463604D6E3D59D51D antonymcnichol
126,700,696 *0CE4AB8668896C55FA83982795C7E2D09049276C ANTWAN.MOSMEYER
126,700,697 *0CE544DFEA7D7EB80A7F0D54C482D415D0BA22F3 cetaw
126,700,698 *0CEA4DDD0126BC8C2262EB2939A1B7D2D8FB27F4 aoqid
126,700,699 *0CE28AB1721152748511328AD92D5B0913CB21F4 AP0IO
126,700,700 *0CE35BCF03BB1726194F84278298CF0C5CEEBCBA cfh.
126,700,701 *0CE8CFDCE8A2DB40DA6EE730B76A129B694616D1 cfhab
126,700,702 *0CEA8879564C1D9EA52BF3805F2C99A42F274ACD apgu
126,700,703 *0CE5963AD2842EEEECDAD3C16FB76B9AA31993DE C#G
126,700,704 *0CEE51904FFC7FDEAC994F4B1237311C16AE41FD cg5
126,700,705 *0CE3AE865791C68A124CCC7A11D1AB6915CCC20A C=GO;
126,700,706 *0CE4586E8F5A9F3A611EE5D07E98A230FDE17C4F AQ8O
126,700,707 *0CE075CF83D8978310857D9F43C7FE8758020F7F A((QN
126,700,708 *0CE65BBCDD74999D392A2640265447A75916FF3A CHARLEYVANPELT
126,700,709 *0CEC50340FE6B65FD3D083AD642F120F13DD2C12 CHEMICALPLANTZONE
126,700,710 *0CE408453E0DD851E1CB6AABBCC72D9BD4D771FF [email protected]
126,700,711 *0CEBF6809C173C3D62BE181EE16F8013368C8CD7 [email protected]
126,700,712 *0CE8B553DD94A552027DF4D25000E5A26F30DE02 [email protected]
126,700,713 *0CE948B5CA24E9C8E0170DBE43F048842891546A [email protected]
126,700,714 *0CE55F2D9348B52F99192686D41C3AE4A7D3A013 [email protected]
126,700,715 *0CE45BB979F754A4871B601FA3A013D7999258AA CHET.RAMSEY
126,700,716 *0CE0ADF21D9C5112582842F320458F493BFDC1E4 c)hhf
126,700,717 *0CEF03210E5E5FC08FCEF239CCAB84FB6F6DE13B ARMANDO.KEDDY
126,700,718 *0CE873D0CEE06EAD2B6CE07B74F2D88B2B1BD6F1 [email protected]
126,700,719 *0CE5F724CF82955CB551092337CA06EE187050F1 CHIRILA SERGIU
126,700,720 *0CE169164783C5108DA71717B4064F8168E48096 CHJ8#
126,700,721 *0CE022391D936387754B2F1081AC30A9DBBB5A25 ASADUZZAMANRONEE
126,700,722 *0CE2ED61E500B2E36CC4FEA7D95683F0ED4F6A19 ASLZI
126,700,723 *0CE998578765380B66DEB14DCC3454F9E22AE8C0 ASSBAGS
126,700,724 *0CE9A1C1FF7813A81E529782DBB6F924103D3F25 at(2r
126,700,725 *0CE80067D1057EF864F9F59B6E4F3213030F9EC7 ataepfel2
126,700,726 *0CE8132A1633172A88D6FD27EF97CDDD108ED51C ATAJN
126,700,727 *0CE2E49B5ACB791DED35AFCA68C73ACFD1DA055D atb76
126,700,728 *0CEDC948B830272E94D183847035545BDD759407 ATEK0
126,700,729 *0CED5BF54DCCBEEFDE52C9EB176E673F87DE54D8 aterrifyingterrorist
126,700,730 *0CE900F98E987DA51A5A426AE57D63682F745FD5 ATIAISIA9
126,700,731 *0CE53BBE6846D57D3FF5B409AF283C4DBCAF07AA CJSOV
126,700,732 *0CE83A97EA0248EF856D94CA9BCA6568C8174149 ck67
126,700,733 *0CEE28C8EEDAFCBCB5114FE11FFC1F81B825C45A atu#k
126,700,734 *0CE8890E68B5872EBB4AB3854D5714B43079E01B CLAIRAISPURO
126,700,735 *0CE2F89667E98D608F77DE9C38A12F9D3AD1EFD4 a!unn
126,700,736 *0CE8F1E31B4DE14C2E37C75D55EE6047E3FB398D CLAYROCKFORD
126,700,737 *0CE7572B3FA2129CAAC6CC15F1754AD2732B6916 A:U+T
126,700,738 *0CE43BBB1D0FAA62505668264B44EB7DEBE53F5F author's.note.&.afterwardb
126,700,739 *0CE40C88D519B787007BD14FBFA27600583C2A9F AUTOMON
126,700,740 *0CEBDE1279251CEC4E5F82DB4A005746F1190ADB CLEMENTE.DOMBROSKY
126,700,741 *0CE55FC85A84D2DAFDB250A7C83819787D2BEF28 clifforddalpiaz
126,700,742 *0CE9F42A0BBA09B74DF041A951ADBD99213AEA58 AVIORIKOKSIIN
126,700,743 *0CE586873E3D47CF80CCC6B26952BC4E5F2F4437 CLINTHAUS2
126,700,744 *0CED548BF3C72A377195083A6271735AA799CFBC avm)"
126,700,745 *0CE2DF98A9FE675DC8FC509530B96E87658617AA clm343
126,700,746 *0CEBC1CEB65C004BADA05EFADC32EA69745A71BE C%LQU
126,700,747 *0CE6AE3F2881BE316A1FCE985E1FEFF7CF194D20 aw+c(
126,700,748 *0CE0741BBC13D7E04B4F2E32F838D302912DDBE2 [email protected]$
126,700,749 *0CE29B621FD4CF21DD51C89902373C6F00D3834A CLYDEJANSSON
126,700,750 *0CEFD086A7BEEABF41EABE24DFEFD92FA6B74CF3 cmpc=
126,700,751 *0CE2A3800B7B944C0D559AA85A2DCD1E3AC81B01 CNCB
126,700,752 *0CE91ECA643E9742985D389ECE021F95A954113C AXSAE
126,700,753 *0CEF61E2A26CB8687C4E81F6A25D940305C34666 c:nxm
126,700,754 *0CEDEB0C8F070A66F6ABD12D17993BB428F8FC6C cocacolaaylmer
126,700,755 *0CE118D2F1A0FD8D034FD6EB51E1DAFFE9901FDF CODIE2616
126,700,756 *0CE048A292741BAE72EBA02F7E2036308DBEC621 COLBY.WHITTINGTON
126,700,757 *0CE37BF4B9F14C989FB86CB9C2FBC8141B9E5D74 COLE.SEKULSKI
126,700,758 *0CE030CAB775F93AD4611A960EC10C02C377E018 aznar-jr
126,700,759 *0CEFAD8924DE7F5CCE0533085008D268760FBA8A AZOJAFFE
126,700,760 *0CEF9ED9AF12EE45104321EB845D5FF62BF0218B AZTEKERS0
126,700,761 *0CEBAA317CAB6F40D2FD3DC4C43D2F53374D3194 CollegiumMusicumAlmaeMatris
126,700,762 *0CE29BB6905499DA2507AB17082A8556B9F9D404 columbuspuffett
126,700,763 *0CE59F144EC644EAB7E3B9A5757C3871482294E4 COMM4ZZI
126,700,764 *0CEC372628CD45E414A40E0B394D99878C763B55 CONALN
126,700,765 *0CE5B90914E39F1B18B5DE14AD9B6B843EA51F2D b0ule$
126,700,766 *0CEDC67989B37EA9A7604A1AA8F2B2A42075EAA1 b0u$x
126,700,767 *0CEE6CD7DC1CCCA1E2B4951E939F69A139A15A69 b_"%1
126,700,768 *0CE7002BB799FD6D699B47B4E66A454E7A70F788 b1kpn
126,700,769 *0CED2622DB30E8D475619033E198CBD3DAFE1CEB conlee1234
126,700,770 *0CEF6B32FECEE4543AA36FB0E6F666C06D1E93EA CONSULTAS.DE.BORRADOAVALANCHA.EQUIPO
126,700,771 *0CEDD90938E260CCACA4B68899ADBE2015070025 b4#f=
126,700,772 *0CEDB99D2FDCFA30FD660392B46A7B4D8679B293 COSTANCA7
126,700,773 *0CE42CE00730EB532118B810429ECB447855D8CE COSTUITA
126,700,774 *0CEB99203A82C1129E541A8074270DFD244921AD b8evo
126,700,775 *0CE1B777DB4C4873A3495F7E095BEBB0C76ED2D5 courtneyhill
126,700,776 *0CE92AA1FF577375F5C22E62470212446EF24058 COY.FRICKEL
126,700,777 *0CE4292F986B315A44D29361C9135BDB5864DA9C b&9_x
126,700,778 *0CE0FE1517824287BEC942FF0519E5F6B6CAA2D0 BABYLOVESDISCO
126,700,779 *0CECCB56D371D20D7975508B2937F2FCDF491BC6 BACTERIOSCOPIE
126,700,780 *0CEF78F995A9387607A79659F76FDECF19F7EFA0 cpqw-
126,700,781 *0CE57A5DF13515238E7600D8FB05DD16ED5DD8B0 bailey.kenner
126,700,782 *0CEFDE10CFFF6517CD7429DB89BB40B555EA4C2E Ba(P
126,700,783 *0CE58E45FB5D74ACCC32266D8B72267A927E5C74 c_qnb
126,700,784 *0CE6C9189CD1358E2A77EE0A35ED2A1E716CCC74 CQ-NH
126,700,785 *0CE33143407F01F9075F663A4D7746047E31016A BARRYWELLS
126,700,786 *0CE5D78D359F8B429F2344CD41230808BCE18CE2 BASKETFUNED
126,700,787 *0CE943E0F0C8EAE4D0D5B1C3EA55AEF8BD863698 craig.goldfinch
126,700,788 *0CEC4C55590708BC1BE43903743ECA5F347A08B7 BatwingApproachesGotham
126,700,789 *0CE47ACB60F4AD4CDAE0FD42B21159750C651281 CRCKT
126,700,790 *0CE5D7A83B6812DCD290D60761CBCDDC3CFD286C CREGVIT
126,700,791 *0CEB280A9875C82FE412CF65CA46DE66DA17D5C7 CRICHTERS
126,700,792 *0CE99F9BDFAAEFA206E69C33D043521C70F86C12 [email protected]
126,700,793 *0CEF916FBBB29A390E5A44B35521F404DDCF92B6 B,B#P
126,700,794 *0CED2CDB04A7AA86CBD3852115ADD99B53F11F5E B%BTG
126,700,795 *0CE4B194F30AEF40DB2B2625B802EDABD9ACAA99 [email protected]
126,700,796 *0CE4691CEAA9710FC45BD90D90583329820BDA29 CRUNKINTHEMALL
126,700,797 *0CECF97BFF0704C7B46B3B29CFE6F3598FC21E85 CRVN
126,700,798 *0CE04CF5452B352DC719851F89947BA3ABAF1BA3 csd?y
126,700,799 *0CE6DA72112D551346D789EDB70AD3464BC10E03 B&DCA
126,700,800 *0CE6AF24A388567D7AB7DD93973D082EC39B26C7 CTGDT
126,700,801 *0CE234C170B94FBE0FCB3FCF74F5855DF38F6D60 Be94
126,700,802 *0CEAA49FF8A94159B32FADC4AC5D8C571F9AA049 ctr;h
126,700,803 *0CE9AAFB88DE60C10CF02D962D331834B6B76BFD ct=#y
126,700,804 *0CE83A94B6FE7FFFE0AFB9AA1F035CD9D976A7A8 BEIJARDES2
126,700,805 *0CE243356314E3388AC5874D233CAC576C28C4E6 BEMIREMED
126,700,806 *0CEF3863E2B23BCC904983C388A02FFB7F58964C cut:a
126,700,807 *0CE473DE8CE536AB1BCF0D9092FD3589428A269A cv$#c
126,700,808 *0CEF1B2FB89A52B64CC228273EC9AC5897A09FD6 besprings2
126,700,809 *0CE6A19EFD0CE86024847666017AB561F486B607 CVR,U
126,700,810 *0CEF3DDA75A865E6592704A308F7CE3C330B231F CVZR8
126,700,811 *0CE1C4F45C7419AC4D20FE977243673E1E1D03A2 B%g%ab"%--)
126,700,812 *0CE68CEDC3EEAF649A77C0A5B153C9A530B0C81B BH4/,
126,700,813 *0CEA52C4FF63EB6C48D39A85ABD607A1AC253887 bhn&
126,700,814 *0CE89AEF36E0AF90D4761E7B38E05AA6FA7B711C B$HOD
126,700,815 *0CEAA6CDB3DACD17D83E384BDA7B337A564735FA czc!i
126,700,816 *0CEA6C864A987579FCE0A6D96C8F7BEC7F2C64FC czhiq
126,700,817 *0CED3EE122923BA72AA963A3327211335F5AA7B8 BIDH
126,700,818 *0CE058E13572324B5F28C0ED0C3AE6FF0D4C5A0D [email protected]$ED
126,700,819 *0CE0BA5D788B884ADEAAB5A1E804CAF497159AE1 [email protected]+h$
126,700,820 *0CE29376BB6EC385B57443845F09D41430A51F13 D2:PP
126,700,821 *0CEAF874BFF6C1E304217DA33D5CD2A734CB1D57 [email protected]
126,700,822 *0CE68ED6FA1F5D3F5BA960C6CE0B4230E267BEED b+jbf
126,700,823 *0CECEC2331B9FD1304CE03DE35B595C18806235B d!4b
126,700,824 *0CEC1ECA8BACA3E5AEC9071EDD9272FA8B20E3F2 bju-%
126,700,825 *0CE7FC3398895D3F65DA81199EE34370896ECBA9 b:k!1
126,700,826 *0CEDC70D3078D8FDC0688A18FE90143CAD4B34AD BKb
126,700,827 *0CE7DC1080CC04F281FB73351C165B9AFD41288E bk-dz
126,700,828 *0CECF5C3F068DFFCE713348662A54A72EACC7957 d!5c0ncer7!ngly
126,700,829 *0CE53037E89203D15D1F8A57CEB03E815E20373D D5F
126,700,830 *0CE1CD5E8A39F059B7D5319C1A7C2E38A40BB85A d5w;d
126,700,831 *0CE95258C665F556B1C7C09DCEC8710FADDD4B67 bl:=6
126,700,832 *0CEB006DEEDA7322F135D320267ED1A61AFDBD1D bl8+(
126,700,833 *0CE6E2CF4238FE0EABF7E830A3DE23CCE01B98CB d:7kh
126,700,834 *0CE86E54BC244252ECFA9B85B608D772ACD35D5E BLAKE-MARKWELL
126,700,835 *0CE57234489ABDFD1E2D60D7F8B56AFAD97C17CC blkn
126,700,836 *0CED54F2720FD45A84BBFCFBBAD52DDA58813D99 [email protected]
126,700,837 *0CEE9EFEECE8E2854AB35A01CDDBEAB71C8BC829 Bm.X
126,700,838 *0CE76F7E391DD1A19AD0B69DAA4F2CA4B936EEE2 danahillel
126,700,839 *0CEA85B57271C69FFCE987AE0C5F5EAD99510C59 B&NL1
126,700,840 *0CE8898C2012B4980D65EBBC3A7398E75226FFD6 b----> ~o(>_0)
126,700,841 *0CEE91C2BF2037338ABEBB7B8D37A79FDC882EB8 [email protected]
126,700,842 *0CE9CBB3D49FFCC9535478437CAB7D990D0B431A Daniel.Wierup
126,700,843 *0CE854A865A9849304B617638EC2D3F694DCF078 BOBVICE
126,700,844 *0CEEAF17A374A5C3D09C128369BAD752B9A93CA4 BOC0
126,700,845 *0CEDBDD023F72F98C8C2DE21A9348E7277D305F9 danx#
126,700,846 *0CE533E49E231B9B046A18722315B237C85970A1 BOIAZZO
126,700,847 *0CE08D1D58EEB92268493D558E1885FBC9FC6630 dard-e-dil (feat. mohammed rafi)
126,700,848 *0CE44566E139AEF83D3DD26B6AAD12DEDCB274D1 BOLIFAB
126,700,849 *0CE2A5E7ED2AD8619F124367F374BB5F27166BEC DARNELLDINO
126,700,850 *0CE0DEE7BEBD9A79FB12C2B74898982867E8677E DARRENRUPRIGHT
126,700,851 *0CEBD4B8EFAFADDA67F3330C3AE4AF7BB1A24A8E bossa.nova.ova.(feat..thad.jones)
126,700,852 *0CEF80ADD52090160159F78FA1C2A6F644576B9A dat"
126,700,853 *0CE7A8F521E3A736ACF7874B7D572BFAD7C2F0DE datlovnked
126,700,854 *0CE5292D395824715CB9B2D01C7C20238EF3C7E9 BOUNCHE9
126,700,855 *0CE7CC106164E3F9F15F65EFF52BD58B6A0105A0 bowman在從前曾經存在,此洋行後來成為英之傑的成員,再之後又成為
126,700,856 *0CEF107FBF8AAA231413DD5003D362358D7D85E4 DAVISBANKS
126,700,857 *0CE57537400594F622596199DA72C4B36ECBD8C8 BP4RR
126,700,858 *0CE47B8E6124A895C35D538FF16D1765C09729A8 db4wm
126,700,859 *0CEB48CB9FE0696D4E1844104C133967C88BEC47 b####p~o(00)
126,700,860 *0CEF3E1C10162491061E6769120C044D56E3E716 BPrS
126,700,861 *0CE1ABEBE544AA765B194D49547D98F5687EEC69 DCF2
126,700,862 *0CEAB1279757D78D2A691EE515983C5B2A8BD9B4 D)DG;
126,700,863 *0CED1A6531BDC1A04A085B1355E89C35DFF5ADF3 D_e!
126,700,864 *0CEA048EA077773697421F2751F9E340E0BA0914 BRA-SVK
126,700,865 *0CE9C7DD5CA30E2E8FA089F65D34BD780F287696 deadheadyoda
126,700,866 *0CE484EFAB4E402883FDC37912182CF8C522814B DEANDRE.SOLORSANO
126,700,867 *0CE876E4669E16346C0A8806C2F1D5122FDCF6CD DEANGELO.CHEREP
126,700,868 *0CEA758668FA0F33F5074FF645FE1D69E63DE4A1 BRENDANMANGEN
126,700,869 *0CED74A924274B513179563ED0A795F0E4CA13D6 BREWERY6
126,700,870 *0CE7A7B0ABCC0FC6C4309CE2D0F2B60CE5EFDCA6 DECENTER
126,700,871 *0CEB985134CA13FA799CF3D7867287DCA90498FE DEE.STRIGHT
126,700,872 *0CE354E3ABE7AD756E1FEE9C8B3C4369D3DF36D0 br#lm
126,700,873 *0CE4DCE71ABE8AF076C2F2FE6EE0CDBA8097AFFA dejesusdelrosario
126,700,874 *0CE56AC738D2FEB7C87222CF20F980287F17F3C9 BROCKCHUGG
126,700,875 *0CE0EAA0CD86D30D4772CB6CAA19EF52A376B13D DELBERTSCHURR
126,700,876 *0CEE0AFCB82577493FAC6C0C2D98FBECC08C5DA5 DELMER.OSHIELDS
126,700,877 *0CE3F4B51F08CE5F5AF38C64585C20EDD00676FE brucetown6
126,700,878 *0CE56135158D2F07A8785EA97D304EC5FCF8A17A BRUGV
126,700,879 *0CE89417C6E197AE6826401BD1FF8B9F17ABC49A DEMETRIUSTIMBS
126,700,880 *0CE779486C3D37BFF928062ED3A40CCAE7448E1D BRUNANTED
126,700,881 *0CEDC8AA2BCD1148FD26C4832DAA65B2E89B2B19 BRYANZEIDERS
126,700,882 *0CEA7D146669EA0162DE514E223505A9A3911955 bs?1u
126,700,883 *0CE992532985B2C0AE1424E4C82F80361F7178A8 denom1n47or
126,700,884 *0CE78D9CD8301526C6A191DF1651AA1372BDB312 derrickheline
126,700,885 *0CE9DAA158AC355EABEDE56F9A0D5F451F9460C4 DESHAWNSOBENES
126,700,886 *0CEBC6B00F05FB6705B4F7A9881890FDD4697287 DETMC
126,700,887 *0CEA2F6CB40B9F847D63A9CE9C8F40DCD9E9E26F bt9q
126,700,888 *0CED740DB2E9F9FC8BA011CB71B41D6482F495B2 btcl2
126,700,889 *0CEBAD790A9A85923381B0800A6B57E855A0517F DEVIN.GLASPIE
126,700,890 *0CE9F92EB977D036A6E7742E6E1C54C297B3C54A DE)W0
126,700,891 *0CE9379F3F152774C657306240845AE28E9CABCE [email protected]
126,700,892 *0CE1D34B1C112B99808490F7C7EAA8490639EEBE b&u$2
126,700,893 *0CE35C53009E02A3A0E8D510CFA0F909A5995376 dfna?
126,700,894 *0CE7F929DAB3135D350EE1036CFA3CECF482B299 DFTEP
126,700,895 *0CEA5666649C7FFB9E428860CD73C15C86574D8D DG,I;
126,700,896 *0CEC4F0A78F97F1DD72D23C147450865F7527B45 dgk=
126,700,897 *0CED23910BC0766A9AFF99DF5E95C71D466F7852 buen.rollito
126,700,898 *0CE8A4D0566D4CD40FB38987B007D07A3656A063 DH)96
126,700,899 *0CE33573090B8D1E955C625F420A1308044A86EC DHARMAWANGSA
126,700,900 *0CE052497E76CA656DD014D69ACDD6F5DD1AFBDC DH;AW
126,700,901 *0CEE34A32B318FF71C7EE235B7263E93D58363B7 burtonjespersen
126,700,902 *0CE6C9473B3B97A44D78C77C9FD50F0E35549612 DI?2O
126,700,903 *0CEB13FEBA5D8AA96BECE126F9636101131D48CA DIE.DRACHEN.VON.EDEN
126,700,904 *0CE27A01E0E8889314315E705783A5866052D47D bwm3p
126,700,905 *0CEA959833AF8685929C5E8056FBFAEF469F330B disclude9
126,700,906 *0CE13886A989B8152C514A7592C91724028218BD discride9
126,700,907 *0CEBFDBE40A4DFAED5A1BC4374211B166E187F4E display;nd)整合在一起,也可以與
126,700,908 *0CE0AF06B1C7BA221599671C0F599A249AA9884F [email protected]
126,700,909 *0CEE0AD34C50F959574BCF9C1196023BD7B260DF bz0&n
126,700,910 *0CE043BB80A574E889B9509C94E25CD1C6C93A95 bz8tr
126,700,911 *0CE1C7E0F6B556F7369B4E4CAAE62C311EA10F3E C039U
126,700,912 *0CE1DC28D162A037B3634DFE778EFFDB33FA66A3 dki"=
126,700,913 *0CE9EEBC26E74F5C4B689D4D63CF695C43E4508D dkrpj
126,700,914 *0CEF13FA540CE9013F8142F26DEFFAD2CCB056CF c48bq
126,700,915 *0CE077369E4E8FA647748050DD7AC38EF672645B C4BCO
126,700,916 *0CEA680DC459268283729E428791EA7A7E79BFF4 C4C.T
126,700,917 *0CE5C7668E97D7BD468707994B7D46FA16D3747C C4RPET.WO
126,700,918 *0CE53E30DF357C5B90245AB4008E35B8B40A67EF dls!s
126,700,919 *0CEC4C9F23D3AFBE76FF0EF12DFC7AD23349A975 c8bnd
126,700,920 *0CE2EC923B06EF2F2A027EA2F433206ECFD6D928 DN#F
126,700,921 *0CE9DB26493926ED31EA8BA423F00ABFB6640B29 c/adr
126,700,922 *0CEF7004AF35F5DAC76A9C23CB01E63D34E02B8F [email protected]
126,700,923 *0CEFE63C391A4D37F0FE9102C07F94658DF7B334 Calculation-Theme
126,700,924 *0CE58C91DE79FF57378C5B523B4C70D3231D0D7E CALEXAN6
126,700,925 *0CE635485B132DBB91666CF721C1B851A790A4EE CAMMINAVI.
126,700,926 *0CE5C6AC214B05688A839D3CE76AD2D8A76E9BA7 CANADIANLEM
126,700,927 *0CE350855AC748D0CAA43E0E10E223B213EE7BB6 cannucks4
126,700,928 *0CE0EC4F980DDF3C35831B0421232EA595BBD45C DOMINIQUE.HASTING
126,700,929 *0CE55DFB86A6272C3AFCE57A756AB23BFA02D250 CAREY.SCANCARELLO
126,700,930 *0CE2E07ACB893188C0CA90EA0CEF90F06D395E93 donnellgreenspan
126,700,931 *0CEA9CD63D70B2571CD0EBEB8E9A03C15270AC1E DONNELL.MAENDEL
126,700,932 *0CEA3C6CA649EDCC2DB178358920B72A73F22ECB donnyjabaay
126,700,933 *0CEE686E74E013DE90E5229B0F53497D2D5ED27C carmendodo
126,700,934 *0CEF0585F856DFEFBB829540656467BE8EF2913A D#OP
126,700,935 *0CE04FAEBCB367A428AEEAB64D04A85BD47BF954 carolgiardina
126,700,936 *0CE445C1989E5E1F5C47479C9EFF70844EC49346 dos=h
126,700,937 *0CE7BBB9A8FC4D33007BF3E32A546478E2443E3F DoU
126,700,938 *0CE36D75B407F94F10DCB112D98E83BB57BFD2D4 carwaxing
126,700,939 *0CE787C52C4D703C42AD9010F1B8D59C06A62DC0 CASPERRIVERTON
126,700,940 *0CEC9BC5753A3B5E2A1D0F026B58EAFB9B45F494 d_p38
126,700,941 *0CEFE4F3242F4A18483F4DAFECEA54A497486152 C&;AU
126,700,942 *0CEF819980AE63754B872539E4D31D2C9C119E55 DP"IE
126,700,943 *0CEB90AC05BDA0FBB34B208FDDAA7E5729F6FF63 DPOZU
126,700,944 *0CE4C8B26D888806AC121BD317563888209E0452 dqkw3
126,700,945 *0CE6FE297067B6DF243FC35C163CE9224EC96E75 DQWBK
126,700,946 *0CE12990591875FEDE20516A4679D156865A8675 DQZHI
126,700,947 *0CE083EC7D032D89368918FFA0378CAA7641D3DF -CCANN-
126,700,948 *0CE0B214CF050F661B411E489FE917FDBFBD0518 CCGND
126,700,949 *0CE4A7BF0927D0DD6AD3470CEFA7987F19704EDB DR_C
126,700,950 *0CE2EC32DB8DCC02A99F713CA37515715C0BFC55 DREAM.IMAGES.(LOVE-DEATH-MUSIC)
126,700,951 *0CE53C3413D6DDB6F3CDB576FD6EC1370629D645 dr!qh
126,700,952 *0CE2E58AC2DF98CB99E3779C48D2EB71E854C7CC CDTHM
126,700,953 *0CEC1F03F5509B71DF9FEA33E4FD619E8951228C cd"wb
126,700,954 *0CEDABCD21008FE92E8829618A388F0D7E437C19 d!scred!7!n9
126,700,955 *0CEA1C6511D2A25971544AF52BAA94588FCE8F63 cej5g
126,700,956 *0CEFD0B5F450F3412CA5D04235EEF625B31CB70D [email protected]
126,700,957 *0CE5A439F83EDA4105B252045FD1DCFEB8FDE360 [email protected]
126,700,958 *0CECB932EC3179AE0EC354607E6129B86CD3E42D du+_
126,700,959 *0CECBDB812CF4FAD1B8DF2349FD7EE75ECEF3FF1 C#G
126,700,960 *0CEE51904FFC7FDEAC994F4B1237311C16AE41FD cg5
126,700,961 *0CE3AE865791C68A124CCC7A11D1AB6915CCC20A [email protected]
126,700,962 *0CE4D6081D2F71AF6EEFAADCF9E2E211A5422276 dxe(k
126,700,963 *0CE599D69BA232EF193CCF3B8229B471DC8FB473 D'ZD
126,700,964 *0CE7D145912066BCAFBC73A1546B27DDDF50951C CHINA AND IRAQ, BUT AS IT APPEARS NOW THEIR DECLARATION
126,700,965 *0CE2C4F4F4DEAF8DB039A83F7F31861160DE1285 EARBUSSING
126,700,966 *0CE75C57657AAA47C362465B6E02C2625ACD1752 EARLDURELL
126,700,967 *0CE2F529AE7E9E57594AC22E96A86C435FA79C48 chivendelin
126,700,968 *0CEBCAFE05D1EE7056E7237EE99D41DCB0609BC0 EB\O
126,700,969 *0CE0DB67FFD365F78418B56A01602B9D10344C09 CHRISTIAN.BADAMO
126,700,970 *0CE0982CE619B624422A233DFEB2111756CCFD6B Christin
126,700,971 *0CE44A255FE2599E56777A36DDB1F18D161C7DB1 CHRISTOPHER.GOLT
126,700,972 *0CEFDDF7B4F9C74FB2950961CC6D5B826CE51E07 chuck-chesse-(feat.-rude-one)
126,700,973 *0CEC3FF6483FAF12019E4CCAB149ED9C2C3E49A2 ECVY?
126,700,974 *0CE28DB87D3795C4A0CDF5EE93EBFBD7A9E6934C EDDIELAKE
126,700,975 *0CEBCC5E6BB4EF601FFDAA0686C12ADACD1B6375 eddyloh
126,700,976 *0CE300723B81DD1C81BBCCF6C109D9F006E2996E ci8j?
126,700,977 *0CE90897798363A9F6AD3401973FE9ADEA6B5144 edgar.manalo
126,700,978 *0CEC1BDE5B1E0443B75265FD0F6F6C4B963FFA2A CI%L"
126,700,979 *0CEA0E0D74BFBC30137EB170C0B886390B9669FE CINDY.WHEATON
126,700,980 *0CEF6A2ABC99393DC5960B7E96B68FB5EB2BD14D EDMUNDODAMOUR
126,700,981 *0CE2AD02C44D4E6938092AA90745EE4D18A38CC3 EDUCTION
126,700,982 *0CEBA350889C9040770BC6C7FB6EE366B17219FB ED.%W
126,700,983 *0CEBA2A7F4CFD23E73B2B9358785C014F0F63E95 EE=BC
126,700,984 *0CEC2C5BAF2B1CDC43727D7F5654F99574759BED cl;5n
126,700,985 *0CEC0DE1C2C3526C1B770B59E842FE90D4C302FA EFRAINCUFFEE
126,700,986 *0CEAC0C3AA5D6AD148FCA36ED9C7659A42B3282A clarencecejka
126,700,987 *0CE32B24930DEA62957FD5BB291BA07E9A1FF460 clarktubergen
126,700,988 *0CEDFA37B23BB5A3F10DF947470A1C179EBD3D3E eft2
126,700,989 *0CE7DAB5416A83E413590C88CB4BA0C664B98603 CLAUDIOBAILON
126,700,990 *0CE375278B6AE278D9BE8D366B7C469AF4415D35 eil8
126,700,991 *0CE44E2A0311AEC49918C5A72C07EE45DD4D1A24 EIVHC
126,700,992 *0CE67CCB23BE75CB8A606185B39094E3D323B3AD CLINT.DUBONNET
126,700,993 *0CE1016A82FE31CC45D94FEE6F256CE3ADE87E2C EKBE1
126,700,994 *0CE4B2818398BA28D1E2DE38A20C3EE8EB990A95 EKROUTESING
126,700,995 *0CE27CD7CF9F714BCAAC2F19C15285198529CD26 CM259
126,700,996 *0CEE5BFAAFE6D741871FB157835113EF3C5F948F ELDRIDGELLERENA
126,700,997 *0CED229F0EDD2149584A065FA3F12AE86C48221E CMCOQ
126,700,998 *0CE226AD93EE0966AFEB0FDB5B8E76CA2192E579 ELEKTRYCZNE-GITARY
126,700,999 *0CE8B72394DAB071F5169E612005E674CAFD728B [email protected]
126,701,000 *0CE150EF4AF76B44F91EF44C34051EA8717BA0F6 ELIJAH.FENCEROY
126,701,001 *0CE4EA4729AB136DF316CAB7D29BCA1A7874ED85 cmtly
126,701,002 *0CE3CC3630821ADB3EFEECAFAD0E504362E59FA4 ELLIOT.GRINSTEAD
126,701,003 *0CE9FAE22D8A6B2C77A26BA7ED3749D4EE44B71A CN)A
126,701,004 *0CE52D2C6E718FB0FC2F035DD188C72842ADF44B cocksuckerblues
126,701,005 *0CE6DA576E05E8AA00AC5B8384281A43FA05EC51 elvisshapiro
126,701,006 *0CE2A79D2BDDA7317EF831E25562FB4B4F88A363 ELWOOD.SELIGMANN
126,701,007 *0CE6B0C85DE6D327CD6FC8512A593A8BF8605448 colemin
126,701,008 *0CE7D5BFD4CC5A2D513340AF9F7B93485AF15FA9 EMIGRATIONLOONEY
126,701,009 *0CEF2F99647784A32A0BBF3467E7C07CF007520C EMILIO.AMENTLER
126,701,010 *0CE926E3CDA9C584D076CD617AFCE1A281AF5B90 COLINLANCON
126,701,011 *0CE35B1A84590DAC50658EFDCB4F86B96FD259FB combustionchamber
126,701,012 *0CE5AAECCDDED07120AEFBCFEEB8571A6FBFF571 como una mosca
126,701,013 *0CE1FDF98A1AEF515858F806BF899DF8E15F331F EMSITOIR2
126,701,014 *0CE62D57955416B1880A4D025920E6BF3D37A16C EN71755224X2
126,701,015 *0CE297E14BFAEA9A3D2240F95231F85557270731 ENANARSE6
126,701,016 *0CE257F1E89F8625224ACDDD480B91D361A7391B ENCAPOEIRARVOS1
126,701,017 *0CECB1DF7424F50D6964C2C2FF6128B91F8163B0 con7r4ds7nc7ve
126,701,018 *0CEF06757F4C3032D63A26C5F94E13D792766848 CORDOBA MUNICIPIO M
126,701,019 *0CE841873DE085FAFEB639043EFE71E966407E2B ENUFF SAID
126,701,020 *0CEFB1297103964005FB1A316CDEE64D535BD9DF ENXORKL000X2
126,701,021 *0CE9B563F4462099F414AF46BCE274A8A6C80B5C ENZYMER4
126,701,022 *0CE5196A9F429A907A4B38E2D4119B4D8A790F16 eo71
126,701,023 *0CE824EC85A97F9F464FADC589347F8C3783DBFB eogqh
126,701,024 *0CE2B36C32EE2BC016F8E2889819776646FA7CB1 epcvs
126,701,025 *0CE41B754B1FA3C042313481667FD54CAA6F1595 cortezsilverberg
126,701,026 *0CEC00D4932070947F284B1170797E45826E0C0C EQLU&
126,701,027 *0CE740A300871025FC10030C810674B29D4C1B3C coycolunga
126,701,028 *0CEAA2DE4DBD1ACC52FAA4E4D1F44F84523EA706 ERIMEAS0
126,701,029 *0CE6CC3B7730A78738DA3982B95A433F829F1429 c:\program files\microsoft visual studio 9.0\vb\snippets\1033\application\readtextfromisolatestorage.snippet
126,701,030 *0CEE351564C2218AE9413B54C8117C8A6AF48AD8 ERNIEBURGETT
126,701,031 *0CE20E97C88416B85DA58FFA197DFC35B5BC0EC0 erttonsing
126,701,032 *0CEFC74D51BEC975780A693EAFABE2AF5451A108 eryzr
126,701,033 *0CEF59D68566CB7F63FDA3A517AF5ABAF9F29C63 cr+1l
126,701,034 *0CEF622BD73C608B2DB55611642A55C4C34885B9 ESAGERATE
126,701,035 *0CEBE6929FF62F580136B43B12AF97BCDC28EBC8 ESU;O
126,701,036 *0CEC09619B9F535139AA559C572B11EFB128428F [email protected]
126,701,037 *0CE1186DB61C75E84288024F042C6AB081478C3F etgreuw2
126,701,038 *0CE98D24045076F53BD89E3A491DBEBF7721C3A7 ETSACOLA
126,701,039 *0CE8130F142085517BB3B71895901D17E5605F42 eu3us
126,701,040 *0CE556A78715856E7FAC7D048C6BA1347E4BEF4E C%TCC
126,701,041 *0CE616BC6E7C285DB20F0C0AF6673C17970302FD evelynjairrosalba22
126,701,042 *0CE7634E5B858EDAC968D89E9D37622B3521ED80 EVERETTEZIRBEL
126,701,043 *0CE9AE1DAAEB36F0916BB04DDE147D0342CAF553 CU8XF
126,701,044 *0CE5A3B1AE861719399EBEE8371FE3EDE256C59C E_VN
126,701,045 *0CE1C9C7616184A6592D9FAFE519E0C8A350A72A CUJTS
126,701,046 *0CEEAA06E656348BE1A4CD8408BD423039ECB006 CURTSHULDA
126,701,047 *0CE5A4CAB2C4945D8E1BC2A8489A7F988F4DF203 [email protected]
126,701,048 *0CE164FB416D1385E8AB8E89DA38FC8FED000146 c&"v"
126,701,049 *0CE125BD2CE38B34E67B104211F7D28CA3253FF4 C"V6D
126,701,050 *0CE7F4083AFA1C49143CBEB0E2D5D9608C9E05B9 F98E
126,701,051 *0CE3583ABC2BA66AB5FBD8DEC31EA2D286FFB3FF fabianfalke
126,701,052 *0CE3C30391A0A3E2DC5422AF805BB0116B9534F1 FATMANURI
126,701,053 *0CEF9C0CF2D3B408E1F88816DCEA0C0D0F73D623 faust:actiii,sceneviii"retirez-vousvoicilanuit"
126,701,054 *0CE6B6E4823AF6CD24C7551BE3270BE71A6F820B FAUSTINO.MADDUX
126,701,055 *0CE0EC25724E300BEB83340D420AF2D3E53BEC37 d1mcc
126,701,056 *0CE21CD95CBE6AF03A18F95FD9E9EFD505465C04 d;2.8
126,701,057 *0CE9134FFD7B6493758DA89F1FFF4B7BCAD49279 [email protected]
126,701,058 *0CE13541D5785120EFA2A883F07F4509E7B717E8 [email protected][email protected]+3d
126,701,059 *0CE1858E8169C6B638DF4780B6136E235F2680D8 FELIXKEN
126,701,060 *0CE0D7995BAFEEB8D7B8E424B6ABC1CE2181D99B D3O%2
126,701,061 *0CEA1FD07C56AD4ECD6C789463582E6AD981E4A0 FENDZLAU
126,701,062 *0CEF2156C77674C46710F06464B8619AFEC65B98 FERNANDO.GLIUES
126,701,063 *0CEBEDFDB745922D375DE0ED5580457A1B496276 fiktion
126,701,064 *0CEF34C494E2AD2705FF1B99505E652EFA6074D4 D7P+O
126,701,065 *0CE4E2EB5F62F0AD80A4166AFA6BA6C6A4F46DB2 d7&vp
126,701,066 *0CEBD51BEDC43D1119F4E902146A90CE58246C22 d8w$9
126,701,067 *0CE62C0BCD9E3B9076D54DA0B10CC5E8CEE2C289 FLAMENGAS
126,701,068 *0CEB54D331614EF1114EC94B3813CDDF7BE4D76A flan-jer
126,701,069 *0CEEBA4DCE5EDCA3AFB3395E6465586FF56DE3D2 [email protected]
126,701,070 *0CE7F9D9D745A33B0B961E75B0088FC2BC399993 DANIEL.COMP
126,701,071 *0CE4662A12864D1DEE4B984C2E1995B7B62D8218 DANIELLE ELDAR
126,701,072 *0CED8EBB38B3CC2942CF8CCDA21FA957717238B4 foregoes
126,701,073 *0CE1B3109F92FDEBA84A773FE5E5E616BFCE3483 FOTOEMULSIÓN
126,701,074 *0CE8FFB9787D897AEDF5A14AFE702DEE7BB11ACF DARONUSTICO
126,701,075 *0CEF88A8114BDA770C851800CCDFEE51040C639A DARRELHENSCHKE
126,701,076 *0CE909F0E3E88B89245541B0A3145CDF545956B8 fqxzugldke
126,701,077 *0CE31D7D3C1EA624EFCE68EBDE1E9AD3FCFCB27F $DATUM
126,701,078 *0CEB735931D9BFD0F45299C3A58F0A779B0C54ED davehieb1
126,701,079 *0CE752A6BE63F0FCDD71EAA7A73BBEDE1EA965E1 DAVEMAN
126,701,080 *0CE5F7719B96D8F6FCB41A24802D432667EDECF0 DAVID-HAYDON
126,701,081 *0CE92E7D792BE5B31DB49E004988D1FDD6735FD4 davissanasith
126,701,082 *0CE41814BAC29240A413C55227783A19C20B1F89 DAWM+
126,701,083 *0CE21143157DD98FB0690374B60C8478CDE6BED6 (>_<).*.*.*.DB
126,701,084 *0CE49C5DDE2CEFCC43D1A6162C6E4EBAD1825169 FREDERICAACADEMY
126,701,085 *0CE7E16586796F9872DFE8E1C8736F3A5B947AC1 fredericsmiddy
126,701,086 *0CEEFB29CD683A678E3407FD6D4ED3933CAFB37B FREDFLIP7
126,701,087 *0CECCD385B22B520988F82DE12072D7C49FB4761 DBDGTPD
126,701,088 *0CE982B407710CFA57757B689EAD07B358EF8203 dbeln
126,701,089 *0CE8D3B0EC64423BE98281FD3E2DA3D18FA7D885 FRERARD123
126,701,090 *0CED1520C914B6157D30CF3E5C6D582F34FD8EE0 DBSWM
126,701,091 *0CE423585EC5B25E17D627D7B4AFA8008F0DA75B D,CCE
126,701,092 *0CE5F2DBC7323D080C8138396EC7212EE0624F8E d.cl/
126,701,093 *0CE0CAB0CD4845E78F1B2F6862DB961D120D01D4 fusinsei
126,701,094 *0CEA7924761B69708A552C9B1F5D1730C77DE5EB d/dd2
126,701,095 *0CE128904BD29BC0DAC4BF4E221F0B760C3E0549 deangelocraker
126,701,096 *0CE244D9EEDE0B62F8BD82099A0DFD8618BBDD36 DECLAN.HENNELLY
126,701,097 *0CE3186AB64F765601F8AB176D4DAFF65D8BEFA2 gandebeuf
126,701,098 *0CEA8FCF45FBF60C1D6AFA17C0D51CE163442E2B DEEUPRIGHT
126,701,099 *0CE2F4610F0DAAB7DAE4580CE2C97D17B6DAA749 DEFUM
126,701,100 *0CE6A85EE7AA8B9C7C18B1F099B42B32E7A99EF1 DELHISTAE1
126,701,101 *0CEFB2AEC8FDACABD3AEB74B0D787C5A0DDA1F51 DEMARCUS.HEAVILIN
126,701,102 *0CE2E794C39A2FDCBF22C74F38B402EA8DC93C68 gaytryge3
126,701,103 *0CE8BB886BB56EAD965F7EE9A6C211C843F86394 DENNYDAGO
126,701,104 *0CEF33C2D8B2CB5191A5C2F93A8FDAE360AF2F91 denzel647
126,701,105 *0CED4D5340D2AFB879169FD002B19CAAA96900DD GEINTERPRETEERD
126,701,106 *0CE58803E01039C5014061305EA888234CEDADC3 DERICK.JURGENSMEIER
126,701,107 *0CE932B4AC392E8FEAAC7342E9D719F4AC3CC082 GENARO.EICHER
126,701,108 *0CECC3DBD1FA603BC7150F1C36E52376D5EEA4C6 GENECREDEUR
126,701,109 *0CE57E7ADFED80548E4EA9D959E1C51DC25A36EF GENERALS—AN
126,701,110 *0CEB6901EBF3CD4C22142342C4BD90CAA9DD0E17 gensung9
126,701,111 *0CE43CE69909EBC8FBA60D209ECE1BBCCFB9DA67 DESENFADE1234
126,701,112 *0CE7E059450DB7DD89327F0F38BB0CC48E1B62F3 DESERET-BOOK-SEVERS-RELATIONSHIP-WITH-SEAGULL
126,701,113 *0CE38E10C163A4D7D9FF9A7457CB5AD70B3160AD DESHAWN.SENSEMAN
126,701,114 *0CE940CE63E65BD0F5959AC672E955921E0F0F0A GEORGE-HANNAH
126,701,115 *0CE7FFE8411C32EC85A9BCB97773671F12ADE703 georges.papy
126,701,116 *0CE072D90BDED038A354CA8D12E2758E71A86841 geraldojans
126,701,117 *0CEDF89E6153AB2A111E0B04361AAEEDC4E47172 detcepxe sa krow ot eunitnoc
126,701,118 *0CE02EFC442EECE9B1CA192B05AD702130C3681D GESTOR-DE-COMPOSICION-DE-VENTANAS
126,701,119 *0CE530B093FAE898AC1AD8DAD008051F18199115 gesundster
126,701,120 *0CE2681C232C1B68A39A3DE4372A44DAFE52A877 D,F=
126,701,121 *0CEF08B28206F73C84122A6B77E940DE929745B8 gg3`
126,701,122 *0CEAF1264451AFAB0D7AB54AFF98E76937B3A0D7 d%f:e
126,701,123 *0CEF6F18F929C720AA96B2C2723BAD121440B799 GHTUHFLF[
126,701,124 *0CE8E33EE782FE90F5B3C1D95239A1F61B189AFC gicosdetlaxcala
126,701,125 *0CE6B8E9D67A12A46340A0F7FBC156BE53782CE5 dfus
126,701,126 *0CE849935E22D0FAE3181C127D19967128A402C1 GILBERTHEIMANN
126,701,127 *0CE59FC78EC2AF0869F0097AAFFCA31692D839BA GINDXBIBBING
126,701,128 *0CE81B8836AE5B31880B98940CB653ED5EAB9E1C ginomanhardt
126,701,129 *0CE98EA46A94D950BF7F69043A6F76B261723FC8 gladwyn-cann
126,701,130 *0CE269DA187762290A02C6738485A87F39B3E6D0 glasagti8
126,701,131 *0CE563A499DEA764D1F0831E3754A2FF518D13F2 di1is
126,701,132 *0CEF1B7334911B58429F9AD246465CB9685FEC22 dickemig
126,701,133 *0CE80FAE6A419504DE16225591A16FF8217030E7 GOGIŁADZE
126,701,134 *0CE56B953093102D456F5013DADC68A3D6C74DE8 GOMESACRISPA
126,701,135 *0CE17BD97F6A62B3C9FC6D39169B6D083CA91DE9 [email protected]
126,701,136 *0CE6A2E4F3ECB84C657459F295116FA9600FE8DE [email protected]
126,701,137 *0CE120C5DABDCBC97D988555F11B71E17A0D0DB0 DI"KV
126,701,138 *0CE0EFB7C4AAC78F4FE88FE2DB03CD9216FB9C3B [email protected]
126,701,139 *0CEE7239909E53EBC5F1B997FE008B15DB29612D [email protected]
126,701,140 *0CE54CB296E90CC7A6724C05CA3ADA0158A778D7 dinle
126,701,141 *0CE78EB9884E32F02AE65FEE06262D1DE3D4E917 gounodgounod
126,701,142 *0CE80121DA8BF7ABAF14F2365C2C04227D1C622E GPA/
126,701,143 *0CE288AA1851590E3CD8999482405B6A40673CA2 diruasoes
126,701,144 *0CE6CB03C7318BCFEF7343360FC57A80C78D14B0 GQ:
126,701,145 *0CE41DF1CDA5335677500B05BACB6B9B648AAD1B grafas.lesbianas
126,701,146 *0CEF85E94D4F9E4BD760C67F5F37FB6073A96921 graymailwed
126,701,147 *0CE3B7602A62C70A2E1AAECA5D401476863ADFE2 d%j3q
126,701,148 *0CE1BA7C198B63E7B315C47400067D3DE19F9FA7 griotti4
126,701,149 *0CEA2662E32B79181C778DE0CE0BE8818066991C [email protected]
126,701,150 *0CED6291F2CB99187AA68852894C8AA86C17099B guations0
126,701,151 *0CEC8B07E2A160B8FD8E438FE2E19B43D44DC997 D,LT,
126,701,152 *0CE0DC6CD9117B4C19E3DC23B4AECCBF09CB1F8E dlvj8
126,701,153 *0CEEAD848FBEF2F71962AA70E5FC41D485B474C9 guinnessfamily
126,701,154 *0CE79939AC0C905C478F5864965E59909F43C6A8 dmocm
126,701,155 *0CE4AC89E90A58A09CA8098BB8025299120F7D60 dmto/
126,701,156 *0CE218105D07518C3DC87FFD45E4BE647033A589 dnepubsw1
126,701,157 *0CE8F9951734F590FA64DECF3B08AB8BCF978730 DNR1W
126,701,158 *0CEB09E93F2D3349E1968587BB13DCFAE9D39839 DOAEX
126,701,159 *0CE090B71D5CAA51876C73BC7049E76090CC518C dodues9
126,701,160 *0CE5C2027461060B5310BDDCDE97CE1F29C22A37 do.it.without.invention
126,701,161 *0CEB8A85C30F59926B3905338E4D95A738C019C3 h-1v
126,701,162 *0CE3DA2B18FE90D22A9680B41E0BE864E11538AC _haaa
126,701,163 *0CEF685418F06FDAABEDE00467B3D33F1E9F57EE habichni5
126,701,164 *0CE9282935C8FDE1966E9691F13BD4025F1FE7B7 HAI.CIANCIOTTA
126,701,165 *0CE39C0C84EF98264AE9E76264938A7573754B22 HANK.GILBERT
126,701,166 *0CEDA89B16A40C1B60D5003D916051082B2C5622 DORIANLABOR
126,701,167 *0CE1EEED729D6DF9C1A0894A9C8CFCCFA67BDBE3 dougimage6
126,701,168 *0CE2635B23EB2F5E86226FC4DC61B6DFE894BB1F DOWNSHARE5
126,701,169 *0CEC3F604A4B32C089DE81D62E04AE158DF56F18 D#$p
126,701,170 *0CE018767AED4B3EFDC6C8C39D0C939D557AFD64 dp:aa
126,701,171 *0CE43754757DAF8235FEB6988DDD2B5348422963 DPBM6
126,701,172 *0CE48B8A719D775FFDF152347ADD52EDE41A45F7 dpg5p
126,701,173 *0CECE42D9E191312272995718E9BE794D1FE6577 hassanalmahmoud
126,701,174 *0CE80E891C9C7AF6BFAB7C81B332BADD4375E337 hawaiixia
126,701,175 *0CEDEAD976F42F8859243D5C715EAC3EA314CEC3 DPVM
126,701,176 *0CE534EE218123D6023A2C88ADE1EA03B663C26A HAYDEN.BALVANZ
126,701,177 *0CE2F99344F5AC192E1E904BD985029329687EF9 HAYWOOD.BRIDGEMAN
126,701,178 *0CE55243203EF91F0587BB09436DE6E16116CA6F d=q)g
126,701,179 *0CED7C439AC6711DEF6C6B743F2FD195D12E8FD8 HCHASINGHAWK
126,701,180 *0CE15A5A0538CBF0EA17BD04E10770A95CC27028 drkchtg0
126,701,181 *0CEBE77B771372D8F5196374D50DE7276E260C07 DRKRE
126,701,182 *0CECBEE16FDD28AA34EDA5D9949BEA9708D22D87 HENRYLUCY
126,701,183 *0CE4828E811F4296ED42FB4AC6C5A6F170C19372 drqel
126,701,184 *0CE2ACE2AE1C0618E7848B17EFEB1848312C5CE5 DRXVOUXYPN
126,701,185 *0CE71C6C0F31B45A857FB031617C7C3913051378 DSGOF
126,701,186 *0CEB36334C415041714539DA6D917BEC547F5F25 heut'.oder.nie
126,701,187 *0CE37D25E3363E8BD573638038326E540D2584F1 dsputa8ly
126,701,188 *0CEB027B6B76BFED90D30CBF568EDAACFBF031CA dsqrp
126,701,189 *0CE96B71C7E3F4BA066116F6B5B4989F539CAECC DSU5H
126,701,190 *0CEFAA2AEFCCC29050B181A35B23C1E5CEC2B0C5 HG[J
126,701,191 *0CE490D996E05400FA5BC1306BF3ACBFF7890676 dsvpo
126,701,192 *0CE25BBA3914C38D65AD73BBA99A851AA39C1246 DT1-Q
126,701,193 *0CE5B6C9C2A348DE6DD7D9D600BAB279FA978711 [email protected]
126,701,194 *0CE4EADF08F7AB30938C5F28B392A1EF4C65F935 HIEB-&-STICHFEST
126,701,195 *0CECCC50E8C769B51DA7D10CFEC3A822AF6F6D25 [email protected]
126,701,196 *0CE47188458DCDBBFAE32836929867361C02C82C D:#TS
126,701,197 *0CE6D8684F74BADE3210365326EE3D20A80CF8D5 DTVSW
126,701,198 *0CE64FDEC2F918351F411A92A999F8FF0A4027CB DTYL_
126,701,199 *0CE27B0747930B70E55858A757325405437F58D8 HMANTARAY
126,701,200 *0CE42DAE52D96DA5F6F10C0D0F4085A265E3686B HO[L
126,701,201 *0CEB0D02F2AE01BE0F8DD9F38255DA1A44446790 dv0g%
126,701,202 *0CED5E2D8572D1B219587729309D52ADB1E54248 HORSCH
126,701,203 *0CECA1660C0165527568DAE506ACEB8AE1271CD4 dwi6.
126,701,204 *0CE1590808E5D931A892BAB6A0D29357C85B8277 HOUSTONLEONHARD
126,701,205 *0CE770DB74EFB3D1A90A355159724E5C3619084D DXIN(
126,701,206 *0CE3267BEFEAD1C0705C784C46964AE320E3C190 hoytbrisban
126,701,207 *0CEE1B54D37522399C175F99497E97B8E7A14813 DXTQ123
126,701,208 *0CE6F7945C092BB4C128A2BEC5D59D63DCFBBC0C hristojivkov
126,701,209 *0CE7F312B5C24152B8C40E66E207AF369F4FA692 [email protected]
126,701,210 *0CE5C3954D389C4045971C3FA5F1636C33FEBC2E HTTPWWWMMAESSECCIO
126,701,211 *0CE880D92EE2B1D5AFA2F96D6133F5215DBEB622 HUBERRU
126,701,212 *0CE1C63C5CE7785C9969FDF668105D676B9985FB HUISHTLIES
126,701,213 *0CE10968DC074308F21775F619499AA4B78C4447 [email protected]
126,701,214 *0CE4B61F7B1FA17E5DD876B03C64B451747F2004 ebki:
126,701,215 *0CEA06D8058EBCA893A34314ADDF78DBEF192620 HUTISTEN2
126,701,216 *0CE56718208F5BF6944982D3585B91F03495753D HW8UHA
126,701,217 *0CE9CDB3B2902B83366D3FDCDAED6211CFA3ABB2 EDGARDOLEHNING
126,701,218 *0CEB7595CCCC5638FDAAF5493C296888C9118E5B EDILBERT2
126,701,219 *0CEFE0CCAFE57775B5A8CAB16D4E44176F4693F4 I70AAAAAYAAJ
126,701,220 *0CEC980B7E5BD5ED0CD744C057690F50C444C55B IACNARFF6
126,701,221 *0CEE1E706060AD39381DC7A5481E379AB70B4BE4 ia}d
126,701,222 *0CE8E852643EDC36C9B1CF2052F8A85E62C5AEB5 iamcamaro14
126,701,223 *0CEED453CC63C55E15ADCA6359BA0FCE75E1D3D6 EDWAARD9
126,701,224 *0CEA2F9DEB5795B80395E7B77B1623F0F74E49D4 edwardloudy
126,701,225 *0CEE620D163F301F38C1D3563747759C9422C9BB IAMGOCOUGS1997
126,701,226 *0CE28A218B8BA4F6EEBEA7BC64F7DB23BD5BA389 IAMMORGAN14
126,701,227 *0CEA63A542955F5DFBED4F37B4118A03364FF7DE e?[e
126,701,228 *0CE698D7B3861E6E635186699A3180AC240F397F IARERBAS6
126,701,229 *0CE3728E48BD5D2CDC79529E96213FF0F538D849 EFRENBOORE
126,701,230 *0CED47989D264BAB6C17406477D8B2AF1CC6F576 EFUUF
126,701,231 *0CEDD214B1D34AC0945A0D46DA3E4CF02C4477CC EHCSITMM
126,701,232 *0CED67C794F650C2CEE69D77AC77476B78665E22 IEPLE
126,701,233 *0CEB2D1F5E82F8138E32E3EAED3A9994B9C562AF ei&3f
126,701,234 *0CE65ED302A139BCE7606DF582FFC3EE6500360F eib;u
126,701,235 *0CE06F936C2E7BEFC1235926AF33ED1B6F8E4BCE eickemeyers
126,701,236 *0CE685EE93CD5AE757DB1C5B068401C2071E341B i"gn
126,701,237 *0CE2C0DE3176A17B00BD0F676D38EF37B8722C8A EINWILLI5
126,701,238 *0CEB1013F2B9ABE976107736821D49F6956CEC11 IHNABIASES
126,701,239 *0CE8CFB088C2746D8812DF89470CAFCF6D82D0FF eiqa_
126,701,240 *0CE927599A4EFE0F1D1A2F484A647F66E7BB617A ijo?
126,701,241 *0CEA07BEB2844A07C5D2EF80A3FF5639579381F8 ekramul6
126,701,242 *0CE976BF91B3ACF7C0DC7691B45F20061607F0B2 [email protected]
126,701,243 *0CE9E092F9F8FA983C606249CCCFD024A2F28466 ek?uf
126,701,244 *0CE6E985932B00D18CF14A4C74F49B55EB426DED ILJG
126,701,245 *0CE91B49BE04601B06FC795E6502BD29AC0ADA23 ILOVELILYFLORIST
126,701,246 *0CE72460641230119449805E7E972D70B9789855 ILOVESIMBA124
126,701,247 *0CE6F635D8FAFF96D273CBA1BD451565E16EC4B4 il.re.di.uruk
126,701,248 *0CE9C89B62F1AF21DC7CED68E6CDEFFE48707088 ELISHA.PRESUTTI
126,701,249 *0CE5C581A258BD2FB701079DE25A9B16182FC383 ILUVBLUEBIRD08
126,701,250 *0CEF9B3B95A35BC005200CA842F31F787ED5D593 ILUVNEKO48
126,701,251 *0CE13593D8B13AFB52AF29CCD2BDCB5996A44B05 ELMO.INSANA
126,701,252 *0CE685C8F1A35C7D1C8526E9ADC7DE06BA161E2D ELVIN.HANDKE
126,701,253 *0CECE1574C178C49C835785B0DEDC576C544E866 ELVIS.LUQUIN
126,701,254 *0CE788530AFD6BF7C5A891C7A7F3F2328C1478B7 INC0MMEN$URABLE
126,701,255 *0CE28B134D2E23FCF8741CC3EF96CDF01FA3FE0D INCENSAE1
126,701,256 *0CEC5F44B5398E844C2D4E0E1135C5C86CD38703 INDIGNACYOUN
126,701,257 *0CEE962C3285FB3D7C7D018A9C4186AD8472E21A emerykillam
126,701,258 *0CE263E9F3166FD075379E9012588405CF112D94 EMILESVERCHEK
126,701,259 *0CE0857B1F4A280A0C9D8C2E8959A3C87B77D775 innogene
126,701,260 *0CE9E10654402C4E9F97CABC3D1E72E5D0B55BCB EMUL3
126,701,261 *0CECAD700B8D265882B18080F7E914EC9BACA053 interventionsteam
126,701,262 *0CECEB3E8492DB9865E34276F0F6C50C34FB3167 ipmaiawed
126,701,263 *0CE2D03085954631CEE1B708D762BD0F8B261507 ENGELHARDT、EUGENE
126,701,264 *0CE3A17357D581F92CABA2289B780F50A1CD53B6 ENIAPNER1
126,701,265 *0CEA3BBBBEA0E5A55A693F0247691F232A37E441 ir$k
126,701,266 *0CE1AD8B758AF9E51A6E71926420F6BBE78D1F0E IRRIGHINO0
126,701,267 *0CE17EF9CEEFE0BC941661400E8513505BAAA9DC IRVINGMORAND
126,701,268 *0CE0576F8A6FB6A1DDD8B30B6D18ECF0B6C937F5 ispireremmo
126,701,269 *0CEFA10114316A89875322124C3E9BCDEEBED372 eps!n
126,701,270 *0CE15ABA0E7DA4E787B8D763F750DA84D502715C ep"th
126,701,271 *0CE5D70669BF4610DE157FA06358E0F32812960E IWANTMO9
126,701,272 *0CE474023F813D16751D8BB1505494548E59C2A7 ERIN.SCHLEIFF
126,701,273 *0CEFA75336A0D83BA27CD259A974B79CEE0D61B2 ERROLPROVOW
126,701,274 *0CEB84693B0A3CA8AB3E1591C728882C6F6969BD JAIME-JONES
126,701,275 *0CEBE9782C57A31640EA42C0D19995CDF8E99D69 JAMALKOLE
126,701,276 *0CE3165DC77016DBB29495A8200798964E3F2363 ESAKUST1
126,701,277 *0CE8011F6D657F39EBFDAF57F5313573FC2F5305 JAMEIKAKEMP
126,701,278 *0CEC8E65C4E08AAB8172FA573BA89E4A1CA3550F ESCOLLABA9
126,701,279 *0CE21A6DB4082A44C09F5F6B4CEA4C172D284BBB JAMES-ROBERT
126,701,280 *0CE5D293C7B149E287205A1BBB401F15933646E1 JAMIE.NEIMAN
126,701,281 *0CE46F3E33A11B3BF9CC53E9B6CFA70D7552445C ESTEBAN.MORICE
126,701,282 *0CEDD290E961B015EA9BBC9C3043B1B89C376F61 JANGUTA
126,701,283 *0CEDF2611862063671630ECD33187B8EB36C3099 ESWI
126,701,284 *0CE03B0A9A87D6763BDD5E0A2E59795FAAB3DB1E janmatta
126,701,285 *0CE8D55B473DE1DB9FDD04B76D71BDB9D1FE4335 JANMCCOLLESTER
126,701,286 *0CE176666A184B8EB88BD0CD945BC3C54E44C66E JARVISOBENCHAIN
126,701,287 *0CEC6FF26639F7658A60F99F934138D11FB05EE9 “JAUME
126,701,288 *0CE40010C4C64FE649311C88995388C550D63C4B e{v9
126,701,289 *0CE0482763346FE251184CEED3417927B31049E1 JEAN.FRANCOIS.LAMY
126,701,290 *0CE42E6420328448CE40BDBC6EBA0D484D291EDA jean-pierre-karam
126,701,291 *0CE9FC34CE98C7D48A3E8AD5E03DD9148A83CECF [email protected]
126,701,292 *0CE8BFBFA52105738AA7643A627BDEB1928805E1 jeffbergeron''jeff
126,701,293 *0CE826E090688C49B68694F119B3392D0F33D3EB JEFFERSON.HELMEN
126,701,294 *0CE8D43BB4DDC24C98EABE2E2EABFADF329902E8 EYKD2
126,701,295 *0CE61DC05EE4DA99D7B5FB82C0CFC6CF4DDF29B3 [email protected]
126,701,296 *0CE423D7F15F3D85A656A603CE3A341FBC6937E4 EZRA.GUTERMUTH
126,701,297 *0CE5C499D061A378CF871594C53BBCE847F91C4C jenniferannjennings
126,701,298 *0CEC515CABBB4721D32C7AA87507C13B7F177CB7 jeramyhauk
126,701,299 *0CEC7840324506626E49F3D5A54B1690CE3FF616 jeremybauer
126,701,300 *0CE1A4C7B6525B05F81F2D348C17F8ED4CD28B9D [email protected]
126,701,301 *0CEE039A9D88899D9E357D0CCD7D7A4717B9F4F3 FARHANSARDAR
126,701,302 *0CE68BBCBA8705F258D77A83EB703C32CEAF4DA2 fbz44c
126,701,303 *0CEE633D8B74459C986952B7BC7EE0089270D80C jessielovec
126,701,304 *0CE56FF5A5C45F0FA17FC58EB474EFD08FBF6A27 fedternes3
126,701,305 *0CE6264A93FF8960586D74A2475D1AF6ADDE0D94 JHASKOVITZ
126,701,306 *0CEEDF6E6DB822385EEE97D33FF9B9BC5973D93A fevieh
126,701,307 *0CE0C897D7B07C5A87457310C3F8F8AA556373FB f/h
126,701,308 *0CE0EAB2A68C4D11195D93982605A3CEE88B2804 [email protected]
126,701,309 *0CEBC6CF6475443ED375CF2408D7CEDB9C78E5DC JIMBOZEPPELIN
126,701,310 *0CEDF2DCE5868EDF569C53E8713D62F93D84229C FIFAワールドカップ開催国の南アフリカから帰国した2010年7月1日、
126,701,311 *0CEF91D3B2CAF63C325CE6BC31A79ADF54F4C5E2 jimmywatcher
126,701,312 *0CE75AB01E48D322E8AC3EAA24163CF1B72C8BA8 j|jm
126,701,313 *0CEBF7C25F688414DA4BC43549E03FE2A66C32FF JMICULCY
126,701,314 *0CE9AD410F513E69A7C949D89B6436AD7A66483D jocelyncontaoipoff
126,701,315 *0CEA9054A1FA2D30119EDD58B1BD7E817AD39994 jodymarzec
126,701,316 *0CED9F69C48EC619C92B9AE569F686540EE2D629 FLORELL8
126,701,317 *0CE8333D74767826666920EA863E809245E6F713 Fluellin
126,701,318 *0CEE4EFC729068A8524A39923D26BB85E212DE8D flyktar7
126,701,319 *0CEEBF2474B6E253731FC2A34C1DB0F71050820C FOODSAFETY
126,701,320 *0CE63F35C75FC53F9E5956409DFBCE6393D0D6A0 forationed
126,701,321 *0CE014B57F0C039D4542DE9572B0176794DFF184 foregoes
126,701,322 *0CE1B3109F92FDEBA84A773FE5E5E616BFCE3483 JOHNNIESCHLEIFER
126,701,323 *0CE753F2F7D27899F21D621DA048D1C7C7DD0583 JOLL1234
126,701,324 *0CE3A8B43D61E752705290CE1A2D417251E7CBB6 forwantof
126,701,325 *0CE0A01775E33E65F7A262A0D5B182E55EDB0C98 foxdannying
126,701,326 *0CE3E177C0CCAC1115FE2014783AA93BFB4D7BFB FRANCISCOCARVALHINHO
126,701,327 *0CE31163416F3FD38A000BBC2D338B1DB6239F24 FREDDIEMADY
126,701,328 *0CE553191AD7623C556930C284D560EE306286C1 [email protected]
126,701,329 *0CE389698D8B5227ECD432D89DBFE257FA55ACD5 JUAN.MOILANEN
126,701,330 *0CE5009FA1CF8EADB682E5FFE6E405EECD940F85 FREEK-'N-YOU-(RADIO-EDIT)
126,701,331 *0CE2A8AFFAD87666E27AC8CA39DC227A7AEF4363 juego-de-rol-videojuegos
126,701,332 *0CE276AFC25209B2C0528F5C1239B5BB76675864 JULIEDORION
126,701,333 *0CEDCED19099FBD98A87CF295B78AC22C79D1126 JULIOPIERSAUL
126,701,334 *0CE1F866CDEAC5F8DB702EF8A1D41EDC5511D3FB FRK.BIBELSTRIPP
126,701,335 *0CE257FB27261541FFC904E4F7F9F9E223B554AE JUSTIN.MYKINS
126,701,336 *0CECF25AF4EAF4E91D0CED764D1151995B49B1B4 k1)v
126,701,337 *0CE191E12F3DFC418428A3949977335E4EF4FFFB k4m1k4ze$
126,701,338 *0CE2348BEC4D64293EFCAB3CB3D94BA4AF623475 KAJ93TEK
126,701,339 *0CE282A259075DF8466D432AF2C3449FE8064E94 KAJUITS2
126,701,340 *0CE3AACCFB47E292815757EAC3BBE407718AC41D KALBASA12345
126,701,341 *0CEC83A96FD958D99EE8D80656D334A325A55002 [email protected]
126,701,342 *0CE64AD8E89DAF6A0680E709E8B0ABC3AEB947DE [email protected]
126,701,343 *0CEBA0CE6AF7292D827C594D54B144D8FAD0FC82 kamujas
126,701,344 *0CEDD375C217A02F5DC1F4338E2EFCDC12F6942F [email protected]
126,701,345 *0CE038E7E0E86477749F1974C11ECD1A4EBB24EC KARL.RUPNICK
126,701,346 *0CE444BB7315383C908D62829C7DCFB7E2615F6F GALLAUNE4
126,701,347 *0CEDA2F30544870D3AA030DADC0F9677FB410542 galop.from.william.tell.overture
126,701,348 *0CE215FE61EE50E7F5775FB3B49E3238CB991C10 kathysampler
126,701,349 *0CEF9A40347569CC5D683D3713666C4CB8F57552 KAŹNIONO
126,701,350 *0CE702CEAF279D8C30826E1E1C74BBB007D00352 KEENANCORNMAN
126,701,351 *0CEF0BEDC6B4C80B197AE2FB6FB4D46FF24C7F56 keep-stepping
126,701,352 *0CECF57E67BFD6B44331BCEBC04BE9737206E8B4 GASTON.SIMAO
126,701,353 *0CEBCD8979425E1D3BD185DAE963E4DEF48E517D KELLOGG®
126,701,354 *0CE5848E30E3E98A7A857666E92940FCEDA876EC kelsey.myrick
126,701,355 *0CE4C525A24CA6613B3FB44960314DCD2D37DB4E KENDALL.ANSELM
126,701,356 *0CED6D20D6BCA1499CDE02B097CF91A854429BCC GCAGCCACGGGCCATCACAGCCCTGCTGGGAGCTTCCCCAAGCCCCACGTAGAATTTCTT
126,701,357 *0CED6110AD40E4D3557FB8D5C1CA19F07E049EC2 GENARO.MICHALKE
126,701,358 *0CE985375D428716B0F2F03DF237FB1A5DE2EAEB KHALIDBROHI
126,701,359 *0CEC23C605F9E3A01D98E2553F513E92C78A3C5A KHR82AF
126,701,360 *0CE96A79FA4250979FAC8ACB16472D4B71BF9A15 kiersten
126,701,361 *0CEF71DF26E4BD22DA6B3CF81CF17DD12646D0E0 getorring
126,701,362 *0CE1528F2A06FFCB0F2C37E7397B83094B5FE2A5 [email protected]
126,701,363 *0CEB3DC1D5648A2F884ECE8835C27984EFC16F9F GILBERT.MONGOLD
126,701,364 *0CE053BD6BE49489D43682CA8CB6B9ECAF40B797 kk]2
126,701,365 *0CE6A0650202139D9DE2CAA80BFCED44263CA5A4 KKEMPEGOWDA
126,701,366 *0CEB225072D841043A508AD01B0F7E2991D3E577 KLAMPON
126,701,367 *0CE08B04006F2B916E889B6EAF81B88172430D83 klang“
126,701,368 *0CE90ECF1176F6236C25B814D33E6BD0AE5FD337 KLASENE6
126,701,369 *0CE37A569D29A7AF663E15733051BF77FDEB4BE8 GIMME THE BEAT
126,701,370 *0CE271CDCD433D879A673AB78D9BA78130302696 KLEINERGROBERSCHATZ
126,701,371 *0CEA3D8266C9BE5AE3705E52DE1964B47C4AB43E KNOWLEAST
126,701,372 *0CE0737B085F838BEC2970E5EB79B0C9BFB6C1E8 KNRFUE
126,701,373 *0CEC4FBDD0C2FFEF23F199F356194F3E47BEB32C [email protected]
126,701,374 *0CEA363F1FFE49B9AFB6991DF6CFBA3C4C596C11 kostenpu6
126,701,375 *0CEA5ED1BD15BF10CA3B4F8B9EA08DB18023CA36 GOLDBOY1BBS
126,701,376 *0CE568475E494B86061D90F5ABDCD45BA9EE7417 KREMENSKISJ
126,701,377 *0CED498335DFCEC076DD09BBB54586975B9DEDD7 GOSPEL:.THE.SOUL.OF.R&B
126,701,378 *0CE6FD1636CF982DF09EBA8FE2048C48514E4FCB KUEMMERD6
126,701,379 *0CEC3D2707DAC2236FDA631CC859216DAB778CC0 GREGG.HAMMANN
126,701,380 *0CE3EEE71E7DB8C8F9AA2E83EC3707C949D5A866 L2>3
126,701,381 *0CE073D76E825F2BE36A20CCBA43B1C0198285A6 GROWINGUPINWHITTIER
126,701,382 *0CE864510E6779786CCD3FE2F8C8DAD9D93987A0 LAHGRUBBING
126,701,383 *0CE2FBBEB7A4AAAF49611E56EE741F61F9B3EAE1 GTU
126,701,384 *0CE771C9A1231E58674DD66B2B335365F657048E LAMAMMAMORTA(PHILADELPHIA)
126,701,385 *0CEF20381DD3F98DDDC81483C253D351E6B45045 guadalupecueva
126,701,386 *0CE784B66EE98EF4B9B04CD3F2FF8BB75C61427B LAMBÌTO
126,701,387 *0CEAFD74A67D7332EDC73E51B851DD962F05186B gurdhera
126,701,388 *0CE6E51BDEA0D86C157EF2AADC625B07FBFEDE74 LARRY-KOLBINSKIE
126,701,389 *0CEC665D5B931905B238F764876420B099890DA8 LATEX入門
126,701,390 *0CEC8AB0FF9BA2F1FBE0EF5F146A4E5A84345288 LAUHANEN0
126,701,391 *0CEE8A262B4AE0FBFC9852B1BAA3B645871FF765 laurencelheureux
126,701,392 *0CEA1D417DC2E7D24614881FE25EB41EAB3706AE LAURENCOSTELLOWO
126,701,393 *0CE8CCE6BB333D2A5D26158F26F3B69BF75A9EF1 LAYERIEZ4
126,701,394 *0CE556144E79C16E38FF595BBEEE3D0154DD9F58 ldz)
126,701,395 *0CE0B3E3376E10CBE32555993615DD0ABBB7D533 LEBRANCHO2
126,701,396 *0CEEC2B24611EC7C44C2C9C4AAC2BEDC9ADEA298 HALPROCHAK
126,701,397 *0CE4489AC246126411A134A651EBB323C907C081 [email protected]
126,701,398 *0CE6D1568DF9F5A77EEA6EB771368A9B013CCFB3 HANDUNLIAO
126,701,399 *0CEDC3F620B4914DADEE4FDE6D0A38CC5EEFE83E [email protected]
126,701,400 *0CE65C1A21E02ACCE718B9047A67D159A5362E12 LENONES2
126,701,401 *0CEC61BD6A0334231CCCF20CE8F95F56BAED196C LEONARDOMCALEXANDER
126,701,402 *0CE3BF61FF01A3B45E5EBEA1391B12FB373F8DB6 leonardspara
126,701,403 *0CE3528EB512264312DBAFE898F2585A96AB2EAA leoni-booysen
126,701,404 *0CECE578FA84C00C903186875BED1635674D4F45 LEPANGE
126,701,405 *0CE69F126164594E8B69A103BC278B7026B87D70 harlanfaull
126,701,406 *0CE7CDA5A1EC1D45D966E16C5F18AD3CA6FDE518 LES-GRANDES-CHANSONS-FRAN
126,701,407 *0CE83EB03C90E7EF23148C7556CAFBFCF8AA4EC5 HARPS12345
126,701,408 *0CE260D8EC2A555696080A8F7BD7D69165051570 HARRIS.ANNUNZIATA
126,701,409 *0CEF298592D827ABB971E8D39FC899ECEC251B33 lespetitesarmoises
126,701,410 *0CE1506FD66E94F07F46E0D4892965330405F92A LES.WICKETT
126,701,411 *0CE302AD8D7844ACEA53A9FBB9B871B82E9E081D havaittavissa
126,701,412 *0CE4816004846AE95B0BF1EB6AD82822E2B63E6E HAYDENLELEUX
126,701,413 *0CED4E046864DD5C6051FA53FABE5A31F30B28DB [email protected]
126,701,414 *0CEB2C04473D648BAA3B6F9FA4CF99DDD1983DD5 HAYWOODMURDOUGH
126,701,415 *0CE094D4FEF6C0829798A9D37CA7160A265D5E19 hc]`
126,701,416 *0CEFB817667C771EDB48FCA7248DE9F0A6E8CE76 heartland.:30
126,701,417 *0CE3CBA431200C0DE6904C981D618ACFAD1E0767 [email protected]
126,701,418 *0CE4A7827B6AF5AE270583F27E45F4DADAAC963A [email protected]
126,701,419 *0CEE555AFC3796301B04FC5AAEADF5DAEC959A46 lindakhall
126,701,420 *0CE89DC26A5109D380A3040B5A3E33D2FB596DF1 [email protected]
126,701,421 *0CE88FEE44F1B28183DE204DD6DC80C0AD37686B herbertmoyer
126,701,422 *0CE9832DB03DF172E1FDBF9F4930358E626DB65E hernanjp
126,701,423 *0CEDD63E894DEB760A3A0C219111F3E94234EDD5 LIOSREPUS
126,701,424 *0CEC639DD885707AC892A6553078AC5A25B5F78C [email protected]
126,701,425 *0CE21DA22F85D2F02590EF78A5A8596D5A139F77 [email protected]
126,701,426 *0CE28C813AA819428307FB9A85FBA740AD5D5D8B [email protected]
126,701,427 *0CE601FE6D006DDED6E74562D2EA4D7CF55F8CA7 [email protected]
126,701,428 *0CE231F9FD1174119CDA20A97966B424C3CABAF7 himehime7
126,701,429 *0CEED18420209B5F1B4BFC2E2A75A06802BC875A lltとしての活動
126,701,430 *0CED8B99ADCCD0C844A72083FEA462DE49CD66D1 [email protected]
126,701,431 *0CE962E33C6861F62257F6E7AED61D560E547FD6 hitogara0
126,701,432 *0CE27E137B2B14904D43E3DB516D749F3A14EEAD LNJZR2A
126,701,433 *0CEDFA20AE9AC7BB51FFB0DF4B93775AFA66F90A lojtjdjmfsbd
126,701,434 *0CE94B353ABB927CB13415A435E39072BDBCD8C7 lokeshkathooria
126,701,435 *0CEC04FF4234D847B075D1093AB25217552BC92E hoe.
126,701,436 *0CE77038BB95B2FEB3586804B5A7D8FB5FC7DAA0 hoimparatoasognare
126,701,437 *0CE1C186F2EB9405F4811CE7DBFD236D5D23E8E2 HONGDROKE
126,701,438 *0CE473A4AABDC52F9F20B06F2308F555FCDE71E2 horaceheimer
126,701,439 *0CEBF243BB6620F88FC4B3045A6665CA55AA7D63 los berrones
126,701,440 *0CE4F352622EDA2B0EAFD9E41FDF0ACFAFEDDE12 LOSTSO
126,701,441 *0CE9146559B43235507153FA3912AEA7DCC1B8CE HOUSTONGIANTONIO
126,701,442 *0CEF51870D45921A4BAE3D44BFF3957AA6D09A33 LTCFSWITCHGT
126,701,443 *0CE1197A5553C98935323016286478F8671827A2 hubertkleist
126,701,444 *0CE9B2E2ED2800D820891462FF6342D6BF9C1D80 HUGH.AMELL
126,701,445 *0CE11D28D860F9896B349378CC9B4BFF157244BC LULLACRYT
126,701,446 *0CE025EFFD67DD0CDE5485B9C561A4BDAE2192C8 [email protected]
126,701,447 *0CE7C4C195B8B5304A856D515E304C4C6E7751A5 lupemalabanan
126,701,448 *0CE7AA3FF001D21B489D4348CF5FA347FAB9DAAB HUONOIMM4
126,701,449 *0CEEFB5B2184AA1BD96C7EA819B419ECC5158B49 HURTMEBAD(INAREALGOODWAY)
126,701,450 *0CE990BCF4AFA8EAED5CF26A450FB27C4F0478E8 [email protected]
126,701,451 *0CEA16FC5078E0A3DB8FF7C1258D9A4C0B9B673C M!$$0R+!NG
126,701,452 *0CEF8EE0122564312E68FAD05AD999CA137D9099 I14258
126,701,453 *0CE80D282EFBA744F3391AC6690AB308BF5C0984 MACFEIDH
126,701,454 *0CE7F44F26D8446054F379DCFF945B4466B1BBDE magnetempfänger
126,701,455 *0CEB92D6C9968259F35FD099205422B7B4743F3B MAINSAIL
126,701,456 *0CEF0A32C16779744675F2C9366CAAFA190BA85A makie
126,701,457 *0CE312FA002B082F23A528BCB84F64C49368195D IDON'TTHINKYOUKNOW
126,701,458 *0CEC535F9F0F0262452767F3EF0BA9A61980F6F6 IHSTOBOK6
126,701,459 *0CE7B6EAF479968C7A10BD1B04EBAE638643E175 IKAZONOED
126,701,460 *0CEEAE7DA9338D27DD3D815106C0C24E983AEB58 MANUAL.GAMBERG
126,701,461 *0CEE6F23E956769502021B8729F7B126B94E8341 ikurintien
126,701,462 *0CE7659235A2031A053973B9D89D0BFA09211A89 MANYULTRAMARINE
126,701,463 *0CE73533625BC2F6278266EE35EFFAA7C2516902 ilgenfritzih1lgih0nfrih0ts
126,701,464 *0CE1B0C3D1FF34D9047F96B31F4A3ED61E8A81E8 ILLENAITSAB-2
126,701,465 *0CE6B75E71B4DF2868C938B031AEE844632C7B35 ILOVEBONJOUR96
126,701,466 *0CEDD865435CF51A2A32518BAE2524CFAA28E080 MARCELO.BROADDUS
126,701,467 *0CE1E362BD4AC1F4372B728B3CB186F8F492DB30 i-love-to-watch-a-woman-dance
126,701,468 *0CE5F45FF038381F045A15B5C3A2163F1C44B173 iluvadmin179
126,701,469 *0CE13CFC2ADC6A09A6E4A17AA01A7D5DA65E6AC4 iluvmorgan79
126,701,470 *0CEE75CAF414BAF7DF3C19A0693A2E12D08C0F1F MARIASEPULVEDA
126,701,471 *0CEE7A4208E4682D6872D11F070D34E3E3D61DF3 ILUVWHITNEY64
126,701,472 *0CEC47443A72F52086631832D6E2AD98523B605B MARILYNMAN
126,701,473 *0CEF95A151F167CC2648AE825E07D6C9A67C3BCA [email protected]
126,701,474 *0CEBB82BF3C7E448A7C049A5C766598C81BE1402 MARJORIEF
126,701,475 *0CE0EDC7E35E1440379B8E69E2FC21A9CD875704 IMNOTMADSINGLE
126,701,476 *0CE6ADCDA209DCB1EE9CC77CC229373AC2B3198A mark-lopeman
126,701,477 *0CEAA1BFD299135B819F328A0857A873B6B62324 IMPROVEATA
126,701,478 *0CE7AB46ACD6619D6D4B4E6327CA01BE3C464E54 INFO1940
126,701,479 *0CE2FF36AA9490A6D61DA84BCB841625C79DF9DB match1305
126,701,480 *0CE0E79DC820D7ADD098A3C19BA38C0FFDCE8DFD INIRUKUS7
126,701,481 *0CEC676D8EF4360DC0249AD5BE77C35D101A3F12 INTERSOLE.
126,701,482 *0CE535FD32D2374A55E2CFB040166D4C681AFC90 [email protected]
126,701,483 *0CE4EBEC4240C02D6FD7C31A46BEC6F814A6456B MAURODALMIDA
126,701,484 *0CE8CC034C86787EB5C737040ED1207E16BB61F9 invulnerableness3
126,701,485 *0CE3518D358651B792C483A8FDDA7323B47B0B42 MAXWELL630
126,701,486 *0CE6E41BC3B6401DC302EDE094C0374BD98DA92D maynardkujak
126,701,487 *0CE9FC373A7E83AEF194161755797D7D28CF8D09 irina91
126,701,488 *0CE62DE098969FD7B3A5D3AFFB56D2498063D957 MBREUF
126,701,489 *0CED0AC5DBDF9762A2842313183FA7CD6F52DBFE IR!P
126,701,490 *0CEB36B85C63177FE17B601EE23EB95657E24166 [email protected]
126,701,491 *0CEC2E167DB5696FFD8D12B40FEF36122D3BAC56 mdrtbxdr
126,701,492 *0CE6F05738EF3692A8C57389F04DE123B8B2345D [email protected]
126,701,493 *0CE4806C6F4C91CAD86E66FE9B74180299647D20 MECANOID
126,701,494 *0CEEF6865F88D0171174397AD1AD7EC57D64F6FB ISOBORNY5
126,701,495 *0CED488DBE18DD91AD8C6395976A8D4C9774AFB0 IVAN.WAYNER
126,701,496 *0CE7A5A64A0A7A0F22F53DEC0AD83427A4C3E5AE J{{}
126,701,497 *0CECE541C7F39C750C925AA8A2323CC0DC024B6B J131362
126,701,498 *0CEB06D8D946A3CB7CF9710E0B15F22BFA6C84C2 mfrf
126,701,499 *0CE31731A81CEC1B055D082D52297102A4A150A1 JACKIEKRYSL
126,701,500 *0CEBE747A27188D58432A218218C01520542E9EA JACKKNOLL
126,701,501 *0CEDBE7F247054BE1F84D3BBA06A576808CD0526 MIABURRIS
126,701,502 *0CEBDC26C6BBC8E00B65F7C126951728E2BD465F jackuline
126,701,503 *0CEAFE801662EBAB0964EB37DEAF8F8CAA4D70D6 JACQUESHUMSTON
126,701,504 *0CE8ABA6219FBB3AF6F1DA47F4DAA590450B0594 JAESERANDOS
126,701,505 *0CE41237E8B31CCE96EAF034DB03F0FE1B0178E0 JAKE DELHOME
126,701,506 *0CEDF25A280FD5813F35ADB86CE3FBD3D8FE8037 JAMES.HEWSON
126,701,507 *0CE38911F667E7E32710315D8552B3F0BD96AAD3 january1859
126,701,508 *0CE415AF9E00CF0E7BF6EC6EF090DD92E3C17650 milpa$y$
126,701,509 *0CE0CA25576119A5468B8735E99DD14C12C9E53E jarredmeglio
126,701,510 *0CE7EFA656EB9FF45BFB3ECE42C8A8B60BBD2321 JASONINSECT
126,701,511 *0CE810FF456D4E93EFD6ACC05747E4E3B1485AB0 jazz-club-mainstream---drums
126,701,512 *0CE0DA0CE99360FF10124F9916BD72DCB59C343D MITCHELSHIBLEY
126,701,513 *0CEEF96DE640423352999CEB976D2AA91E62AB0B JEFFEREY.KUNDRICK
126,701,514 *0CE83EA5ECF276DFB82D02775BA472AD08A31AB5 mmerung:ActI,SceneIII"AltgewohntesGer
126,701,515 *0CE36C3700B72B2A53D6A686C80BBDE4034905C4 MMJRR
126,701,516 *0CEEE4C45E962F73AB6E8E482565C62EF6C4E749 [email protected]
126,701,517 *0CE986C35EADB959BC9501F473D9B9BFB5C8DE8A MON4$T3RI41
126,701,518 *0CE5658A851F25D20DE90B34CEECF5D82251E161 [email protected]
126,701,519 *0CE1CE1F62C5A243EB9FEAEDA83041FB60E889C0 JESSELOPILATO
126,701,520 *0CE784985D483AE9C8511D5F828AFC79EC86CBDC JESSIESINGO
126,701,521 *0CE95124ED0465C63A1BBE96A2CC2BD923E41614 MONROEREARY
126,701,522 *0CE301EBC84B63B4D0A305E8FBE5BBCBB7E7BBA8 MONTYKRISTEK
126,701,523 *0CEAB845247E9FC91470E6B723033B5E3CF18546 JGERENDAS
126,701,524 *0CE28306D0D2598D384908E0D46AD841D5CD84A4 [email protected]
126,701,525 *0CEB69112ED70F71D86335642E72D2DB45239747 jido
126,701,526 *0CECC49A750B7318CC61F82FE869CA59FDAF309E JIMMYTUMLISON
126,701,527 *0CED057FF9F0CB4EB10DFB338BEB0725A5F7A841 [email protected]
126,701,528 *0CE51F4133D9E87612BAE4CE5C6579D5C33AF5CE jitesh-reddy
126,701,529 *0CE590EBDABB8708AD71C15E7F0317B0F32E6876 mphyttc7
126,701,530 *0CE719000DD53667A40D9EBF83159D4AEB4C6F3E MPRE9N4+0N$
126,701,531 *0CE3E420A4F2BB7B84AB3617998B1FE525CC4B1D jmaaranz
126,701,532 *0CEF240C128AD87ECBFBF92DEEB84F376ABA1E7F MsHanako
126,701,533 *0CEFDD5739DA0D8BFD309900D03EBAEA0169855A JNINGEN5
126,701,534 *0CEE4CFD16B6D78D7A5A6A638BB96924B9DD73ED jocelyn.magno
126,701,535 *0CED1B415A5B9D9925FFF8F7D3F4D1866EB2A919 MUGGIREMMING
126,701,536 *0CE29FF038409B84CE06AC0206E49527601BCF56 JOELTINKLER
126,701,537 *0CE2A933ADDAE74D4382494D1DC0E6F7AAC0A9F7 JOEY.PUELLO
126,701,538 *0CE665E2C49A3D76BECD42BDABCB6B5102BEB0F8 MUMAKIL4
126,701,539 *0CE9C0FB2189CE9E2D13F8F7B8DCCE4C7BFBAFF7 mutsubay
126,701,540 *0CEB8B79A165C950418F8BE1117BF7F60FF7C155 josealvara
126,701,541 *0CE85F5F1BFDB1F1C5C3B15AD5E0EC6C34BADBFE MY JOY (FEAT MARGARET GRACE)
126,701,542 *0CEC5F630E4E3DDE1FAD6DC1ABE40AB7E6205E8E MYLES.HEMESATH
126,701,543 *0CED6D55DCCEC40D2A375F1088F59F50E29B57C1 myronmitchelle
126,701,544 *0CE4691F144CBBDC562DEA9E65112E22EDE5CD4A MYSKYDIVE99
126,701,545 *0CE58D239D64E5B4CD88E474EC7A020E9F0A8534 joshuamatava
126,701,546 *0CE1F0660E72805872F0A10203768E2A7177A213 NABÍHAJÍCÍCHO
126,701,547 *0CEE3122DCA639D484E60EF69F6FACE49AFBD4A3 [email protected]
126,701,548 *0CE29C5F96BE4EDCDF6B097FA6CF8641A4A596BD J=R\
126,701,549 *0CE8B97623709237133273E072D72CFECF644479 JROX
126,701,550 *0CE361C72D2D25345A2BE6A3F580BFB666F54250 NAILSMITHING
126,701,551 *0CE03C22A10E85E2F3A987C5285AB5F9F28B5B6B JUDITHCHAMPS
126,701,552 *0CEA95CB141B3316ECE5E7C6ACD12989B4441467 JUENGERKES
126,701,553 *0CE3445CBB7C327435804F4AD049948484000C93 nathanaelenick
126,701,554 *0CE1EE4209159640466E1C2C1A5A9A8BB87DB182 JULIE MOSHER
126,701,555 *0CE12F9596C730D73C07C813EA0388DBDEA420C3 ndeblanc
126,701,556 *0CEDCCAE82977EDF81FEF0B5C64D460AF66B9DF4 juÿse
126,701,557 *0CEA4DC6BE4789ED41060DDC25C0CFFD609D2DF4 NED.FARAGOZA
126,701,558 *0CE52E8C807B7EFEBB781B94457ABCAD4269F5E7 K133005
126,701,559 *0CEF63C2E93830714B88A73835073A2A5ED1BAAC neimschilf
126,701,560 *0CE60D5307B3AC0EB87A61AD8BA68842896C703F KAANDRIAS
126,701,561 *0CE9D1FCB0C95452BDABE2517C6DDC17A9E8AAC3 NELSON.VERONESI
126,701,562 *0CEAD91A67D3626555ADB78243C5CBDFD1F8BA7E KAIKOOOOO
126,701,563 *0CE7F8864E9415A9CFE3490F97F31B41741B8D6A KALANDER8
126,701,564 *0CE21432D184D46AFC1BEB941DBB30BF3E17428F NERGFOLING
126,701,565 *0CE59F37ED85F9D20A89330191C6CCC6712F366E [email protected]
126,701,566 *0CED2D7FF48E4AB293DBB69053F3F3E9BBBD61A0 newly-hip
126,701,567 *0CE2AA1F2146BDA68598080BE6F6D88F822DFC71 KARINHESSEL
126,701,568 *0CE6442B8BD52794BBA2DBF63B6EC00E1121712A newtonpfalzgraf
126,701,569 *0CECE64271D619C8A3A15C2F406B0781341DB458 KATIELAMB
126,701,570 *0CEEBD7B3DFEC38DC8585653E09A21388A4CCE92 KDYUBB
126,701,571 *0CE065E7E5D8D8D562F7D12C154C59326F532DC2 keenanchiavaroli
126,701,572 *0CEFA295800E6F3980E9C591865D9086E8694AD7 NIRMAIER9
126,701,573 *0CE974DC955FFFB5DC113C74B8DCF5BE4C05CC2B KELLY,HORNET,AIRLIFE,ISBN
126,701,574 *0CEBA5534E5D29FB2BC4C2CD2A6E290020BE1913 KENFITGERALD
126,701,575 *0CE4CE44C32DE328AFA25FF64E4E39CC2DECF4FD NNALGRAM
126,701,576 *0CE25F6FEFB164D0BDE63F903F5314109D3A724E NOAH JACK
126,701,577 *0CE0715DA586099623E503A0433483E658D79EF1 KENTONMERLINI
126,701,578 *0CE5CC66EC36E635745A7C99D6580C2C6093F585 NOELLOUGHARY
126,701,579 *0CE55116AC09D4A614AEC90BC21347E8E7364BB7 KERMIT.RISING
126,701,580 *0CE32D63CD0DE8FAEE3A2228D6408F290D3C5660 nomeseparendem
126,701,581 *0CE793F80D4E3CFBB6896343480497D6F4A32413 NOMORETEARS(12"VERSION)(FEAT.BARBRASTREISAND)
126,701,582 *0CE83BB5E93C65F6EDEE2A6DFC275F1C79E46080 [email protected]
126,701,583 *0CEEEFC44CBEDF959B8B72E8B0635F5FCD6ABD03 KFROG.RADIO.COMKFROG
126,701,584 *0CE33AD8FE5BF15B8056FFD5522B89488FF6B18D NORMANSHEEHY
126,701,585 *0CEEDBF55C50004D55CDF395347FB130AA198B51 [email protected]
126,701,586 *0CE455CDC424AACB8884C3EB17F8E104E83B7FE7 KINGFISH1901
126,701,587 *0CED017EFCA4477E5C5B8FC82D05E6804C7880B9 kirkcreedon
126,701,588 *0CE19A7B62088CC11E3FC8B547FD5F88EB24F175 NSLFRLNT9
126,701,589 *0CE0E8C0087C5EB3FB9F6CD4702CEE57C77F16CF NUDIFLORUS2
126,701,590 *0CE397985A5BBB3F377AB2A775E394D61C80A694 nuevasedemenorah
126,701,591 *0CE32EE9AFCE843979C9DD130CD1FABA8F99257F KOKOJAKAUMASSA
126,701,592 *0CE0DEDDE465892D094E35B01A75AC2374653448 kolpingoperns
126,701,593 *0CECCCB8243D6131D6C838FC036571B3DEC07C1E )o(0~ (====b
126,701,594 *0CE95FC913E3EA7A78EE5D1A1466EA8DFAE226FA KORY.KEISLING
126,701,595 *0CE200D469253CF92CA72CBAA4BB7B3D0B1BBE8D O34854
126,701,596 *0CE6505B0B7DD79DC933FC5D220DEE09B06ED167 observar
126,701,597 *0CEE2F093805AAA12487C590CEE6AB581D10FFE8 OCTAVIONISONGER
126,701,598 *0CE8633FAEF69778C3D7C26370BAB2635749048B kremliss{
126,701,599 *0CEA46E8686355431906B939CB24ED2F1C22AE46 od[d
126,701,600 *0CEACD209881B56AE03C0AE866AB7AE7413C9E36 ODISLILOIA
126,701,601 *0CE67CB8E3DD7056D6A5EA1832B47822B549DE19 ODISROZANCE
126,701,602 *0CE8666AB9E1FDD34E5AE507CEBA1D2B63E100F5 KUBITSCHAK
126,701,603 *0CE163CF5E1999537F27633E2D4D7B0AF0A07133 KU<Y
126,701,604 *0CE0F7B1072F268E2E3838FE03153A8902A31938 one.million.broken.guitars
126,701,605 *0CEB062EC64030A87C4728AD90C3D5A535367F8F l:#aaa
126,701,606 *0CE8A191626D4347DFB12117EE28C0F15F1AC1AC ladyinthestreet/downhomeblues/thebluesisalright
126,701,607 *0CE7010B76B10D5F51E782A5E2B132F5A5700E42 }o{ o~0~ q#p
126,701,608 *0CE2FB522D0EDE54B96037DB03D0DA59E4A307B2 }o{.o~o~<===p
126,701,609 *0CED8B4B185976B31AC5C1DFB610FC4A24C0D2D3 OOSHIGOT6
126,701,610 *0CEEF568B07588C2C3A8392D33DB099FE439BAC0 OPERRATIQUES
126,701,611 *0CE902910705DDFAC6390514F530FF953FB21129 LANDONVILLAPLANA
126,701,612 *0CEDC1907C764E0A0DCE573D466D4A21AAEEE78E Last-Kind-Words-(1926-1953)
126,701,613 *0CEF60F9DAE778FE45A4E3115DAE9898CCDB6EEB LAUKKASIVAT
126,701,614 *0CEF6D2F2D545B71AA9F44FBDA2EFE313BFBA5EA laurencecitino
126,701,615 *0CE2A729A21B6EC9C28351B91E518EBBA0A84930 LAVERNEPOSSINGER
126,701,616 *0CEBA6B941489A69FD95AA454C16EE8F212AAF96 othilia1
126,701,617 *0CE369186B288AB1F3695B33B7053B31F2495B78 LECHIEN
126,701,618 *0CEFBC4D230936533332867F7F9A282FEFEAE540 LEE KIM FONG
126,701,619 *0CE519DB4AEE15FAA3DB110A4CEFA3DFB9A015C0 LEGALISER (REMIX)
126,701,620 *0CE1E4E1292F0E039D52CCB79FAD907F63201BB3 overtense5
126,701,621 *0CE89B51FE3528E9B5476D58D8A52C22681AC88D [email protected]
126,701,622 *0CED58084677662BCA6A784BCB329219F20039C4 LEOBEAUTY
126,701,623 *0CED05D823E21C52A5F33DB24C89554C06102B0F pabloshepperson
126,701,624 *0CE4C7A189A7232EAC80FEE1A41C4BD7961B3F48 leroybarbour
126,701,625 *0CE041A840481B37F4F9B3840F6FF46D438D6705 palmerslates
126,701,626 *0CEA53D912DCE271D81208BD3512673D78E38EA8 palmmanual
126,701,627 *0CE9484ABC9BE9A916500C7D8A1D0BAEF99435CE LETICIAFLOREZ
126,701,628 *0CEF8C5364465CBF1575ACE1F0CEF1DBA5584E12 PARAFILANY
126,701,629 *0CEC44EA520F7EBB4D7EF5932AE849D7BC7E64E6 paranaidji
126,701,630 *0CEA9953772418778BAD9221D20337A5824D74D1 lewismcnellie
126,701,631 *0CE4BA32A2B43CEFC9A8F375463DC420515A6C7F [email protected]
126,701,632 *0CE0F37F811A0DFE695F15A57E85C91C052D65A1 lh%/
126,701,633 *0CE4F2514CC19F2A57998DF6FD6B1646F1001175 LH&
126,701,634 *0CE282EB12CB53DDC0A9E813E3F57AC8D9834116 lhd[
126,701,635 *0CE18A923FECC6F646BE25671788666FE581EFDB [email protected]
126,701,636 *0CE68ED0EB3255BA5ED58A4C9B14E1F45EBB4A59 patentor
126,701,637 *0CEE9A912830C3DD48C199E494E8F084D53FA88A pathless
126,701,638 *0CE0DC21DD8C7D0AE478A19E7DFD6D1F3EF6EADD patrick-mcnary
126,701,639 *0CEE707BDD170EA9B24EF72814BE56409BCFDB91 PATTOXXX
126,701,640 *0CEB63724D23C7342EDD0ACE6891618911BB691B PAUL-KIESEL
126,701,641 *0CE3C67A34201E1078984231F3B6C48512709999 [email protected]
126,701,642 *0CE255FAFEACC16EE624A638DA8248ABEE23F8FA liesses
126,701,643 *0CE348D6C67B10B866B98E46A4145F9914CF751E [email protected]
126,701,644 *0CEFAE6650827E95E425824B068559CF70A69930 PCVRSDSES
126,701,645 *0CEEDF6C189494FF7CDC96D208007FAC705A73A7 P####D`~.o><
126,701,646 *0CEFF010C054508AD43F7E26AA601B36AE595246 peanutblondie
126,701,647 *0CE99015CB57507985B798B20BE04F06B8828448 LINGU4DEN+4L
126,701,648 *0CEC39806DAEB77903B54106A51D5D58C2C2911C PERLAGING
126,701,649 *0CE18B0420D42A52D5202A1FB02B4BDB5C0EDDDA PERMISSION.VIKASAPTE
126,701,650 *0CECA18ADDCCD6A328803590DEE022A0AF9E5DAA [email protected]
126,701,651 *0CE683975661A0A25FE069A125A69D2060466A2E lisbethhockey
126,701,652 *0CEF4F6FF6251C6113A3EF8BCF3E0502790C5872 LIST160LIMOWRECK
126,701,653 *0CED570879FC1C6E46B9FDD831BE0A329EBC15E4 listdone
126,701,654 *0CE9E838C9BAFE0DA928CABCCB53959AED5162F3 PETEYTEST
126,701,655 *0CE5E4905974813549A83C8461A6D0A1EDE20EE8 petezelada
126,701,656 *0CE28F048AC41AB3B54587A1D792E247D71493DF PGEHM
126,701,657 *0CE4135288A0B34A7ED3D20598E451DBC423DEB3 liva3123
126,701,658 *0CEADF31B34C75C78C2C0DF19FC9D1593AEB4181 LIVIN9LY
126,701,659 *0CE01AA4046B85C759066C1397965F3A85CF80F7 LKNNAN
126,701,660 *0CE6FD2B843824791729B6ECC5F473B9AC8D5972 pickle}
126,701,661 *0CEBF408E5D9474C4ECB73843191D74519677545 [email protected]
126,701,662 *0CE032A555C6E738087668DE782AF4AF6C87F188 PITOLOCO1234
126,701,663 *0CEBD2432155CF8E612317DFDC4EA6C7AF6865CD PLANETENORDNUNG
126,701,664 *0CEEF278A337AE0CB15DF2CD69AA0F3ACF743A2F LORENZODEPPERT
126,701,665 *0CE23709FE99363CC033DF70BC271DF58AF24909 plusher
126,701,666 *0CEF34996226B7623158DD8808D6C88BBAC04780 LORUNDING
126,701,667 *0CE1D2F54808393B1DF43F454744D9C51817900F LOSSILLA7
126,701,668 *0CE3FAD153E2CE9AB3716D8A836DDF13A415CFB8 P###@~O (>_0)
126,701,669 *0CE725657C58AC8B8DEC2C80243C814932C6763A po$73r1713$
126,701,670 *0CE950DD9AEE8F00D4B10E66308BFBA3B333A667 LOUISEANN76
126,701,671 *0CE9E3698E9A4E5C489F7BBE4A0F37420B666DC5 podnikum
126,701,672 *0CE9D78200B1F8D2EC27EDA4DB79F6EF23167790 poenaal?
126,701,673 *0CED4522BBDBCF53D89763918B19806C451112B5 POLYETHERPOLYOLY
126,701,674 *0CEE8E2A56D21BDFE255120E22EA0941B4C3C06A ls}j
126,701,675 *0CEF91DDC8C9854C77597889B15BB64BD362D7AE LT2277CFOS_INDUCED_
126,701,676 *0CEB2A80EFCE3A9BC194CAF057B5C9DCC514264C [email protected]
126,701,677 *0CE15C02F46612AA38F26205D7690786220996EE LUCIEN.NIEDER
126,701,678 *0CEE0C52F3CCB5B74E77C34C9674A88AFE2C114D PORTERURQUIDES
126,701,679 *0CE496791C5D6CF27646A3A8E01E9505CCE6DDEC LUIGIWIECK
126,701,680 *0CEBC50A6154E906EFCB284F7AE3E3D85C47EAA3 LUIZ-CARLOS-DE-OLIVEIRA
126,701,681 *0CEBCC515E312B196FFE917F1C67C178E2391E6A LYLEBLAKES
126,701,682 *0CE0495CB901BD346DD048705C41E8C37227D899 p_q
126,701,683 *0CEC0A777F21B6FA42C9A7A7A87645BD115B06D1 [email protected]
126,701,684 *0CEC93E909C1C42CDA90099850147B8E350FEB1A lynnshurtliff
126,701,685 *0CE3F64C4485C8F3279D4123169829E494332203 PRASL
126,701,686 *0CE207848D94FDD1FBAD6281D436DBEC0EC7899B prchlici
126,701,687 *0CE77095DE47C161724EADAAA47F1F09470FD331 MADAGASCARPRESIDENCY
126,701,688 *0CE8DEF3E5D7951013E0C8EFB9359D4255FBE22D MAERHTI
126,701,689 *0CE6630231541667F83EAB1237B2E127E22CA356 [email protected]
126,701,690 *0CE16844D04866B9C2EE11A810B2A8A39999BDE6 MAILANISKULLA
126,701,691 *0CE1C1D54C6CCA72CAD1FD6D25AD350658963376 MAINSAIL
126,701,692 *0CEF0A32C16779744675F2C9366CAAFA190BA85A [email protected]
126,701,693 *0CE2544D87115444CF7BB21558277BDDFF550986 princedonald
126,701,694 *0CE196150C773D74970FBA05F222F6C15F4FDD2E PRO-CITATIONS
126,701,695 *0CE7EF8292898AF049A248EBF7BB59789427B33B programming-related
126,701,696 *0CE7EC837759E0F611F7DF44FC631D3C7C38D790 MAMTANARANGAASHMAM
126,701,697 *0CEC9D13BAA9DF10972C365D83F47E3D495999EB MANHUBAT
126,701,698 *0CE89D061BD21BFF45B0297E5EA34B7F54D53853 prvotdn2
126,701,699 *0CE6546321956369481FF2BDFD3D2A1357FDF487 PSEUDOM8
126,701,700 *0CE6C6E917894AC21E5F7FDBE3BFBE5465B65F66 PSILOTHR2
126,701,701 *0CE527469ED6FB1595AC6CAB3D607DEB4482571B PSUPEMEN
126,701,702 *0CEEF3A7D25CF92349ED868E0EE6A2E967A2F94C MANUELCORCORAN
126,701,703 *0CE475F8CC7B0581B3C6522CAC1EE4066376221E ptenoglo7
126,701,704 *0CE3911809082FA32863177232BF1CFA3E4C2614 PUERTO.DEPORTIVO.DE.PONTEVEDRA
126,701,705 *0CE2097561BF9F92A266CC617FD1A7112FBF18CC PURSUIT(MEGARISES)
126,701,706 *0CE83F354A68318D872717648DF8CA5AC17DA65C MAP08THEDAVED.TAYLORBLUES
126,701,707 *0CEDED5F26FCBA2A24CBD3D7DF1206FD922FC161 p--->~~~}x{
126,701,708 *0CE127618DDDA29CA1712C685E5FC23C6AA27C41 MARCELNIEMITZIO
126,701,709 *0CEAA4F8865D0362F409EF0FD934C71012146547 [email protected]* * (>-<)
126,701,710 *0CE667EA762F40676161398822D93DDBF960D779 MARCODISTILO
126,701,711 *0CEDEB9E80EB24C9DED24D2ACF7278146E7C5F29 MARIANODITZLER
126,701,712 *0CE03F762442B873A357F6D5B166AA87A900F428 qB~`(0_<)
126,701,713 *0CE01FF14F57231D4AABCECBC8F5687F731E9BB4 [email protected]
126,701,714 *0CE5A6AABD18B789961C246EED393F0D8ABA0759 [email protected]
126,701,715 *0CEC182E3D982D73308A1F3CEF1CCE76F98A8173 markuslegore
126,701,716 *0CE69B16C0FE13F83918FB2F56794114777A33EB [email protected]
126,701,717 *0CE8D4E2F91A3349153C431B93E9398A89ABFD91 q#####)~o.~o.(-_0)
126,701,718 *0CED8384A90E4B4D55211CBCFE87EF3C75EE59BA q).~O.~o.o><
126,701,719 *0CEB8F9FF1C4739ECAA50F1A4806489FFA188A24 mass.in.b.minor.-.agnus.dei
126,701,720 *0CE1904AA636821493462E943B738EAA7C9A3844 master_oflove
126,701,721 *0CEA354B71BFED2001EE0562DA4A753BFD3B3E09 qtaloprk64
126,701,722 *0CE8DA5E96F1C42039AB8BA6F0ECE5CE9697BECC MATTHIEUCHEMIN-RESEARCHMCGILLCA
126,701,723 *0CECB4489D3A4CDCE90CE91275C2CF04530D5311 [email protected]
126,701,724 *0CE327EDD202A916A0CAB21396A18A2C2ECB9C21 MAUNFCD
126,701,725 *0CEE64CC207B40AC8916F8F648AD6C3B6CB25D71 quentinmalinski
126,701,726 *0CE227553EDB53FCD9E57066B83A6563A146A39A [email protected]
126,701,727 *0CE78BA4A1BF9A4811DAEEB81A3FA9A91801D9D3 オバqとなぞえもん(小学一年生
126,701,728 *0CEBEF4EF4FAE8CAF6AF50E9AC212346C949ED35 [email protected]
126,701,729 *0CEE39536E255C17410BB71D9D99C3AE83274B02 MEANDREAMS
126,701,730 *0CEC693114BD701E2E0EEA1FC3D54E2263BD813D R3QU31M4V45
126,701,731 *0CE89675594A437604DB1D15AAB6D6783831A9F1 RACHELLEANNGOISAKAPUSO
126,701,732 *0CEE0A5A8FC8F9110F076C90BAFDBAFB0EBBD37D radikalhardcoreversion10
126,701,733 *0CEB59B106CA17C6D58A64C1600CF7E2B701E189 melplymale
126,701,734 *0CE8B7F4A2EC4939213999333020263DA8ED6A5E raleighfoat
126,701,735 *0CEC0226D56E80997B1AA1D33950CBCE6919F537 m'enfermer-avec-toi
126,701,736 *0CE07A91DABAC2AA89E6207CBCD48FAB3230BD82 M'ENFERMER AVEC TOI
126,701,737 *0CE813339F7A3AF3AFF2D4B8C138DE90B2E98FA4 MEPHISTOWALZERNO3,S216
126,701,738 *0CEB87D858EAA419B671A8468E999C00190261CC mercedes-dowling
126,701,739 *0CE8B930089F488FD27007E6C5A6ACADF46686FC RAMMENDOED
126,701,740 *0CE4BB969F68E29B30A28ECD643148DD5439497D MESTRENS6
126,701,741 *0CEC3A9C5B7E0E65DE969D899D7FD5E2B50F81CF MEYANNIN
126,701,742 *0CE93DEE3471E65A9D4242E5993E1283F453B634 RARELY-FLOODED
126,701,743 *0CE0D3FFF2E09191DFEC2AC9044DCD6646822789 READMESCRIPT
126,701,744 *0CE4CDBBE19110CE010A095CA0284CE1428157AB MICSH
126,701,745 *0CE6A15AB151420FAE22D3B15ABE06E43A4E8EB2 REALLYATLAN
126,701,746 *0CE3867DC319BF058E6433BEF8E70C71FEE86CB3 REALTER6
126,701,747 *0CE84DEBE0138E5A4C5A77114C14CB78EBA6AA3C REANTAE
126,701,748 *0CEE46DC78666515353F182EDA86D306EAC63CD6 RECRUDESCENTE5
126,701,749 *0CE13C7B18E4F2C56ECA7907B09BBF9395D2A933 MILO.OVERLIE
126,701,750 *0CE790C6C09D32E4F12A56B1D36B3D665B11F923 MIRONÓWKA
126,701,751 *0CEE43762B95962B52B2AE83037F1884831F2A25 MITCH2311
126,701,752 *0CEBCD344FAC7635D878D4F92DDA5F30A301D0C4 regninkneteb
126,701,753 *0CEA30E685021879270CB1E809D7BE7A3180C2B1 reidrandolph
126,701,754 *0CE98A49A5B68989E05790DD16C0986262B420B5 MOCKFULL9
126,701,755 *0CE76A2384C8A85A6E6D7C0C90EEEF22CDFDB3DF relayfast
126,701,756 *0CEF3CA96FDA45DC6809B81472060E5ED53ED43B moisesodenwald
126,701,757 *0CEE591FFDF621BBC2B7367461F381EDEDCFAA44 REMINGEN
126,701,758 *0CE10C86628AB2A405E8A220B3667163055414BD RENOMINATING?
126,701,759 *0CE5679F04EF68B92761A4F7BD556FBDDB3210CA [email protected]+ON
126,701,760 *0CE9805F351A41C26CB4A2816D50348BB0618E51 MOOLPAS
126,701,761 *0CEE2790CC1829D5BC3166728EC53F0D4CDAC07F MOPIKSIR
126,701,762 *0CE620F9C4BB512FC0AA25FC93715E331030C7B0 RESTARES1
126,701,763 *0CEAB5505D23A84720984974A061FE9242230D47 MORRISGO1
126,701,764 *0CEAB62D6D691E1B1B7A14832DA654FFE83BA298 MORRISSUMRULD
126,701,765 *0CED900B9324346F92956C48A91C27FF310AC68F MOVE ANY MOUNTAIN (BEATMASTERS 12" MIX)
126,701,766 *0CE55B3E8452FA9F8B8DA1FB063739FB731A5028 REYRATTAN
126,701,767 *0CE5473111A6E6313D3F291DB005F1AD27F751A9 mtvmars
126,701,768 *0CE3EB4668B94BF91F9A134A6CC27D57D8436621 MURHAAJA-SOITTAA-PASUUNAA-(LIVE)
126,701,769 *0CE3D23A56C7BA6D7091B5CE726E1094F52A90D5 MY HEART WILL GO ON (TITANIC DANCE)
126,701,770 *0CEFCEB88B9ADF202989B3E9777BCAC402798E33 rickie.elliott
126,701,771 *0CE387667DFF6FF1B3A084415A25D09BD47DAC0C MZTASHAM
126,701,772 *0CEB46C6E002BE7784DF9D839E2F9F908AFAEA6B N8590993
126,701,773 *0CEA8C6569776F6324088F66F0DE72B0FE261120 NACKIGEM9
126,701,774 *0CE1561A98D8DB6B6829C21FBD253AF7ADAC2923 RKORENICH
126,701,775 *0CE511ABA31DA7970B02D1917EAEB3FDE47EFC88 nason-clark
126,701,776 *0CE48D55AF51DC4A2628254C85EC3C21D71C6F68 NASTROJI9
126,701,777 *0CE341BA6C2CA2502A10916A6AC2EF1096641F9E nathanbrasser
126,701,778 *0CE904EB0EBBBB1D54B62494AFF3A50F14D4005C [email protected]
126,701,779 *0CE0673ABBDA1EFDA06B79D9484F5F646FB28713 ROCKYBARTNETT
126,701,780 *0CE21A40383ADBA82A690288437FA9C4B22ECFDA ndezchac
126,701,781 *0CE8AA4148B0A8AEA52C7F332023A7BB73FD9097 RODHASYAS
126,701,782 *0CE19F9C3B20EB04D8A4B07586B2EB92641C1D44 NED.SOLIES
126,701,783 *0CEBCD340A53D75A73FF6EDF3A2586BDDAEEFA62 rodríguezmorán
126,701,784 *0CE601B4A39215C865F64342D3DD331A659DB8C5 [email protected]
126,701,785 *0CE516DED631A9E14E4F88B977F9988B0BFCE81F rogeliobambach
126,701,786 *0CE3BE93EE3A187B2BA208328DBB721F1BAFFF4D NEILUNLAND
126,701,787 *0CE924E2F6C5F92332D2F940D186673C88599891 NELSONSCHAETZLE
126,701,788 *0CECC671655E84DA46186C92DF79E88A56C4B8E5 netknerd2
126,701,789 *0CE657788320E0A24E42E16BAA68D4BC66949E2E NETTINGS
126,701,790 *0CE8A711ED738ADB2E9233F7B98F4BB155C19776 NEURIEM
126,701,791 *0CED57A59BEB5C76B6021073EB91E8FB53D1674B ROOSEVELT.KAMMERER
126,701,792 *0CEA939028E03B08A7B11F2BF3EB1D360154FCEA [email protected]
126,701,793 *0CEDB7A48715DAE9CA3A26728F577E9F0C887F9C nicolasperniciaro
126,701,794 *0CE9CF1FD4D0D09EA3E6671B7A49F3C7A01A7351 ROVAGNANO
126,701,795 *0CE21C96A1AC3294908D9691D530291FB4C6899A nirmal.kumaran
126,701,796 *0CEDC1B33DBB6DC3FB2863286AF8F8638EEBC0BC ROZKOUSN0
126,701,797 *0CEDFF0B8F17B84FD0526BFDB6E425237C78A1F9 R}T"
126,701,798 *0CE4C4A7DEE4EF2C2E3032F756333011E583F77B NOAHDELOREY
126,701,799 *0CEB360ACB1E4D4832F011EBC2647EDE48E5C116 NOEAMBERSON
126,701,800 *0CEF06FDE206A3A4E02075088698C0BED91757E0 RUDESHEI5
126,701,801 *0CEB42845ECB81C6FD51C83230BEDC5173293647 RUDYMORILLO
126,701,802 *0CE8EC06D8E5E39563EC7BC341E7223B4862F5A3 RUEHC^UB
126,701,803 *0CE62D7C388F942FF4B768B1944C4D0724AD51C5 RYEGAA
126,701,804 *0CE789304581ECCF8AC871C560B15A2FE3797225 [email protected]
126,701,805 *0CE8373B18282C7182420143BBFD08C744BB479F NSGAMER3
126,701,806 *0CE767E5CA93C87EE9A0932A68F851C092D43768 [email protected]@813
126,701,807 *0CED5CE08073930ED382B6EC273BF002A03211F2 [email protected]
126,701,808 *0CE23F9FF25EAE3A514643CEC56E83FD2374CC69 S0KE
126,701,809 *0CEFC2FA33808799A9A699E80FE243696315FF9B S0!O
126,701,810 *0CE720F2289DDBC245F6635E5E2647D09978EB95 S7RE4MN9
126,701,811 *0CEB4EB1348216B1ECF0911CCF939271B0E63B3D numberspawlosky
126,701,812 *0CEB6A55679B8C7E30F2582596D14297CA392B07 NUOLUSOIVA
126,701,813 *0CEF14C3B9CB0BC05833E7630822C49C5BF2BEBC NUSS9
126,701,814 *0CEF7AB73CB06DCAA91229DC6E2A10BBF7C680C4 NY0H
126,701,815 *0CEF9E829FF5F1A8D9F6BBA4E63FDF899F6D875E nzsas's
126,701,816 *0CE2A8F367183BA7D1BDE2B7CB5D1F9066ACA520 }O{-0~-D==B
126,701,817 *0CE9475CE49A3FB65EA2A1B802ABDDE3993B6222 o81!94ted
126,701,818 *0CEA8414186F3F53CA1D906F90FF8B62E230EFB9 SAMANTHA.FRADY
126,701,819 *0CE6A96DAA26FC984D968232C27D1D942C0288F0 samentroffen
126,701,820 *0CE3595D90EB0507B7E4E293F59E01CEEAC45301 SAMMANFATTNING
126,701,821 *0CE81AA77E2DB8EC7E77B6CFE77D45A0E6092D00 SAMUEL.MCKERNAN
126,701,822 *0CE48A97CDD2435A0D1A7F3FAFB1FDD208A4D90B ODELL.NUXOLL
126,701,823 *0CE971E2B5E725C76D99FD440AA3CFF18637CB95 OF.COMPETING.IMPORTANCE
126,701,824 *0CE154BB7F359F47852C127D7465B7EDA8D2F4C5 //of-how-to-kick-some-one's-ass\\
126,701,825 *0CEAF6201EDAD9A68543BEC1E67CBB71F6D276DA SATANICSACRIFICE(LIVE)
126,701,826 *0CE8A7CFD55418C8745CE9BA3266965390852923 sauerstoffisotopenanlyse
126,701,827 *0CE24ADA87DD4E080CFB699D23750236C8583490 OIREJMOP
126,701,828 *0CE72A138985DCC43C65F8B2E5C55EFAB7885C0E SAVAGEPOKER''MATT
126,701,829 *0CE585A2E9543BDDC521606E8D61F16376C51FE7 scalemodulus
126,701,830 *0CEB14993A6B21C09F56670BADCE3AA4B45016FE SCATENERESTI6
126,701,831 *0CEE724198F59B25D16CABEA2B228F098386E3F4 schans
126,701,832 *0CE5F6F0CD2245C910E5711A4C775DDBA61B1F21 SCHMMLKLRGST8
126,701,833 *0CE88791FC063E11B89F8244D522EB6ABFCCB850 SCMOTAMI7
126,701,834 *0CEE623E0ED75521B34F063FD2CC90FF755C6375 scotstradtner
126,701,835 *0CEEB7505A3191A59B0A8F81AD069ECB1C5E119C SCOTT.DURLING
126,701,836 *0CEFC3B73E484A7503CEB5474E45B1E7A1686B4D Orgn4t3s
126,701,837 *0CE30975CC5F0F9CA24F9ED6EED2FDAB6C1388AC ORVAL.GREGORI
126,701,838 *0CE4C2065DED13C9E24760051688C4159B4FC75B SECK_C
126,701,839 *0CE1BAB191655F7FDCB423DCA1D7F88E888F97B2 SENGS!
126,701,840 *0CEE6E567C67DA04B3878503179B4AF660A3D866 SESSARGREDNATS
126,701,841 *0CE623C551641E7384EA0EFAFCA08F60C199B5E7 SETNENITREP2
126,701,842 *0CE717A11306665DA29D569EEA3188C989D7B372 p3bbl3pa
126,701,843 *0CE69857551A96144FCD523DF60F4A6D4E46777D P4R4S!T!C41
126,701,844 *0CE1EB87BACACDE712E9D08E404668289CE12407 pacol
126,701,845 *0CE182AD26DC8A53FA08580A5501A28EE53954CE PAGATORE”
126,701,846 *0CEDF1D9F5D1D8A7418FE16F44B5485D98FF86C7 shadowm9
126,701,847 *0CEEAE4C8AB355B46638EDA69644EE69007F0BEC SHAMATEURISMED
126,701,848 *0CE26B6A077DC03245BA31EA87F30C8CC551F412 [email protected]
126,701,849 *0CE1781321D9B105EB2F81CC7F1EC879E239F121 PARKETTEERDES
126,701,850 *0CE6FEFC9A3FF17AAF10521CA296CB1FC4D99364 PARTYONJUPITER
126,701,851 *0CE0B90D8F71DC4DED016F41864396B9D688F6B3 sheldonannarumo
126,701,852 *0CE165AD673C4A34EAEC177B4E0835ED05B30527 SHELDONCLUSTER
126,701,853 *0CE06FEC1345C8F06FDE3FCBAADD85E6FA7C77DE sheldonkrise
126,701,854 *0CEADBF03F8D1EC07FF6493910529FA083CACC60 paternicum
126,701,855 *0CE3DE0069209E9D779A77C7C3DF90DA547F0459 sherna1965
126,701,856 *0CE0D3B5B9C4D0B25FDC8E5FCCAF9CF48B997845 PCCERS
126,701,857 *0CECD9A5BD63587B76C1DB5D2B3E477BA0AD051B SHOOTDOWNTHERAILROADMAN
126,701,858 *0CE096BC89158233147695C792549DCBF8AF7970 pedrocahalane
126,701,859 *0CE406231210CB5AE61A18032C80CB45E6DAF214 [email protected]
126,701,860 *0CE411B512267F134D3FAEE694EF7244C4D3EC7A people.are.making.entire.careers.in.modern
126,701,861 *0CE92EC392C4E83696293C0961AA4947EF664327 sibacin
126,701,862 *0CE4CFE7FCB249CAE9C3E7598AB8C1681275AB20 PHUNSRI0
126,701,863 *0CE0AE0F9694DD926B37D94577CC35C95ED24F6E SJRNL
126,701,864 *0CE40E4316886A0252C0F9F951840D02C91397A1 SKIPPYDIRECTORING
126,701,865 *0CEEB00156D3696BDA31A60ACF219AF1C2E13A17 PIMGMMIKO
126,701,866 *0CE73F61790C1A94754712052301A930EFC842DD [email protected]
126,701,867 *0CEE79BBD4122A83B307A3556CA5259212105455 PIRATEKS
126,701,868 *0CE33744FE7B4010CECED4CC7E954DFF6B1EDA75 SLAVENAA
126,701,869 *0CE0C0DFCD3C0D5EC5B6CA4939CB85AD26E832FB SMILECLAUDIA5
126,701,870 *0CEC3B999EB1A6B3BEEFF09B34250E1B154076CD PLNEUNG-SUR-BEUVRON
126,701,871 *0CE121592E7350D7E4AEB6D71CC6A03AFDDCAB82 [email protected]
126,701,872 *0CEF45D546413400012F20ED7C53A65DE0E3AC09 P=)~ (O_-)
126,701,873 *0CEAC12EF30F704ECCB4F54C9882AFC036C974E9 SNOOPY-
126,701,874 *0CEE3D060B7BEBD0A41BA28D030368B6FD5D591B POLYDENTATE
126,701,875 *0CE717CE24CC1E92BF2937D7E771D21AB12764DB SOLEAMUS8
126,701,876 *0CE04FF3DA47419502AD1983E21A6DE3455342D7 P===> ~O (O_)
126,701,877 *0CE318456621EEAC693A9433CF32FFB6C6660FC6 pookieq
126,701,878 *0CE3B02D6C79B0D21CC2C45E20B7D5BE63C0E8B2 popstar12
126,701,879 *0CE652097BEC775AEF33DDB02C2F751B9A30F207 SOMETHING108
126,701,880 *0CE67F5E50DF06CF971F0A1D2640674548E4CA83 postexception
126,701,881 *0CE26EBA0C9CBB43E0D8BC97C4563FF468CD78C6 sonvile
126,701,882 *0CEBA17914ED6EDB703493684D61CF8A1CD0C87D sortdata
126,701,883 *0CE2CB8CE37C2F8966920DD67B3892C60AAA541A [email protected]
126,701,884 *0CEAA46874C04214A885922D886624284D168398 p==p~o ~o (0_<)
126,701,885 *0CEE9C8A22B42CD78B282AA392207BA7452DC2E8 SPIMOTBSW
126,701,886 *0CE6371148568323C37E89B518D408CDFCEE8318 splat!!***<b
126,701,887 *0CE73DDE096CE181E51B6649D593F0E13ED240C4 PROCSEEBOT
126,701,888 *0CE91828950EEE9763A195F13768EB19ADDF81F6 [email protected]
126,701,889 *0CEFE3133476318C5CB446125488A282DF69A3EA splat.~(====q
126,701,890 *0CE12773D8B8092C06B6907B32F3EADE773C9F3C p) * * *Splat
126,701,891 *0CE4BBC1A715C9DD930BFCCBF6F3832E64CE097C SPRRWHWK5
126,701,892 *0CE0DB3D4FABFC0E01FE3C1145176338724DAD89 squarewavesannouncement
126,701,893 *0CE158B78A877EB7B55123DC62EACB754D34FA93 (>_<)~`.~`.(######Q
126,701,894 *0CE06BF065B0D144585AAC5708833B0DAEB95ED1 SRTSGLVP
126,701,895 *0CECA9952FCFA3D7B29DE77CBA9604989CA7C3DB SSISCHEHP
126,701,896 *0CEED33ECF593F37FD601DAED5014276F9C23F5E [email protected]
126,701,897 *0CE6E90EB684C8C8E216428BE31944D675032433 Q=====P~.~(00)
126,701,898 *0CE1DD921D3B2DBE45055303D4A463E59E2BC2E3 STARPROFILELAMINCONATEHGAMBIAASSIRISKASROCKYDEFENDER
126,701,899 *0CE9F8A53F9ED2CE80A3B8CE748B54C94FE6E482 STAR.RENTERIA
126,701,900 *0CED50945C1DDABAB56790202862FE6C888AC354 [email protected]
126,701,901 *0CE44B34AA8E60B975425DE84A009219CB84D853 STATBOY4
126,701,902 *0CE3587B2453FF6BCC232739F31AAF8910D957D5 STATUE-RIGID
126,701,903 *0CE2B7E315709706FDA99D32BFB5546FB86DEE5C R.>7
126,701,904 *0CE386B3A3F8507C9A1965DB143D34E339E2613A raddrin7
126,701,905 *0CE1199C8137269C0444FA61760CAC2966EBC795 STEVIE.KNESEK
126,701,906 *0CEB2552BCD34C4998FCA8018A0B369897DA0B81 RAN-DELL
126,701,907 *0CEEA4C4C0F06880E8F75BB13A087CDCE12B9BD6 RARTSYS8
126,701,908 *0CE0D5F658A745920EDC133DFC615FE6B582B99F RAT-PROOF
126,701,909 *0CE4F8EC7055826F9D8AB6AC00F4EFD111F3C6A3 RAVENWILBUR
126,701,910 *0CE46DA6FEB58ADD5FDAE148DDAA5D17691D29D3 stopbadwareyellowalert
126,701,911 *0CE6BD8BF5F24D06A7035CA0A72E7773E8DFF741 STRANGEV4
126,701,912 *0CE51B2CB22DB903C7AC52785A173226AB059968 STRATHALLANTALKAGBU
126,701,913 *0CEF9CE7968B9039EDBF2C4ED9756B7F88B14C11 STRIVER
126,701,914 *0CEFB2ADE298767E6F96361BC94B7D1B91046509 REDAERYFFUNS
126,701,915 *0CEA9F90E8745001791E8E7AFD065D9E3817733B redarguire
126,701,916 *0CECDF419F32B713F5A9823E458F4EE011A4502A stuartpezina
126,701,917 *0CE9F12B0E49D4A303F8A07DA7BA552B2A484120 REGENMAKER.
126,701,918 *0CE79935F210977428A2373AFC9DD851B4C5461E [email protected]
126,701,919 *0CECE37816684B7B74F7197AEBCCED218F70592E REGIDEOMKJILEG1
126,701,920 *0CEFC5FDD388A91C75CB0F9805FEBACDF8C05124 relayfast
126,701,921 *0CEF3CA96FDA45DC6809B81472060E5ED53ED43B SUMMERDAYS」才有能力用版稅將母親欠的債給全部還清。他說:「很高興能靠自己的力量解決金錢造成的辛苦生活。」
126,701,922 *0CEA720A24F472542B23B82973E411814922B8B1 SUNWENTUO
126,701,923 *0CE4E116E71E4E782E5A3F6648C483A490E2C73F REPOSITORY7
126,701,924 *0CE00D4609B9751BA25E35BDA3765B9D0B15B9CE [email protected]$e
126,701,925 *0CE6410A9D4D6FBCB583265564BFD50B31C51078 SURBAISSS3
126,701,926 *0CE731A40D0BD2EC8B63EBC1F24245648E84DDBA RESSECORP7
126,701,927 *0CE8C0BC289AE31E5BF6FF9A3237A20E0EFC894F svelele7
126,701,928 *0CEA68A5C77B7FE0AABA6C275869688ABC28E2A3 SWERIS69
126,701,929 *0CE44FE57645DEFB8FDEB5EED55F62B3CD353C27 reubenhysinger
126,701,930 *0CE68A4175623F86997073F0BBCA910DA7F3BBBA SYMBOLMARINA
126,701,931 *0CE65BD4B04325238A8AD44D580FC736DCCF7BAA SYNEISEFERA5
126,701,932 *0CE25B17EF820F711FD38B53B07A9F2C293C4BD2 SZCZOTKOWY
126,701,933 *0CEE34D3DBCF24BFC7634770ABCE72EB41406B53 RFXUAA
126,701,934 *0CE455C0A71BA683EF8CB4F1567888583B26E254 RHIPSTYLE
126,701,935 *0CE3655A9B065AFC1C21F685D1B9D533276A7E05 RHUESLER
126,701,936 *0CE011CF844567E4607DF5970F15AF62E365BEA2 richiedentes
126,701,937 *0CEF27C247568F20767A9A4B7A485B9B7D76F009 richieengdahl
126,701,938 *0CE174967DDDE352CB67C7B0D258D629D21A90A5 RICH.VIERRA
126,701,939 *0CE0E9B96720B447518F98F0C1CEB45B06C3A643 TAMLUTZ
126,701,940 *0CE6DEEDFF4127ADF60E28606C3C1C9C03CA641F [email protected]
126,701,941 *0CE9EF934E175CE3F16058F0575BB65F9408BABB riggered1
126,701,942 *0CEF4555CB41CD7C9B8AAC3EA5E270EB7699437E RIODEVA-TERUEL
126,701,943 *0CEE7D943DF27CCB6C7EB415DEBDE62FA684E97E taşçil
126,701,944 *0CE57BAA02B90F165C94DF8D3ED6488CB6099659 RJB.
126,701,945 *0CE4EE57ECD801ACF7B9CC4BF2668DC7EA506B99 [email protected]
126,701,946 *0CE7EE14782D42234C219A4FB5EC13D600C860CA RNOLERASCH
126,701,947 *0CE2BD321B20D0B9D67531A4845F2EE8D20127E2 ROBBIETERZIAN
126,701,948 *0CE670C18FFBE76CDC0910FA1FD282FA0D8BD111 TEAMAKER4
126,701,949 *0CEA952A6F47A27C2291D816F181B2529E2027C5 tenis96
126,701,950 *0CE5A8F7505E3DD30B8B6B46C3BBD0C590866943 RODGER.ZWINGMAN
126,701,951 *0CE92B6A6477A71FC30C116F36E09C7216E3EE8A terminatorom
126,701,952 *0CEF3E5F0530504383E5116F7C8472882774717F ROGERIO
126,701,953 *0CEDBB95711330BB0F66F730E55281F39730D3FB terrier2010
126,701,954 *0CEDAECB45772DF9A0BEB80ABD05E9E9E38E637D THANAKAMA8
126,701,955 *0CEA8504E6C8A206CE2EBBE6070760ABA77B1C4C ROSDNIWH6
126,701,956 *0CEC936429B5FE56FF91E50BFA34896C8FCDA2C4 ROSS.PREAST
126,701,957 *0CE5AEC054031D588E229CBBE22928170840B291 the-consequences-of-rapid-population-growth-and-the-remedial
126,701,958 *0CE7A71DD18500471103EC099C0E48CB47DB7EAE thegoat1
126,701,959 *0CEF897A4D07F9C87409D4EB2A3DD1A8A2834C3C THEODORE.MYERS
126,701,960 *0CE5F5682E6AE0E098504957DDE9B733E496B69D THEPROPERTY2
126,701,961 *0CE76CC421979B9F8D3733FDE83A0CFC681E02C2 THERAIDERS83
126,701,962 *0CEF87299CAB1570BF4FDA469AF29615066E17DE ruebenlanglo
126,701,963 *0CE1EF88CF0DD352F3CD5E6AB5FAFD2EF20968D7 RUPALI.CHATURVEDI
126,701,964 *0CEC29979383E985F1BF29AF9FE3452B839C69CF thetennis68
126,701,965 *0CE1EF37CDE7A090934C0BEE8735254BB77F9659 THIEFOFHEARTS(INSTRUMENTAL)
126,701,966 *0CE59C8CBE3D3165682CFF0E92675A6B7ECEB5F3 THIEVINGSCARREDPHANTOMTHISPHANTASMIS
126,701,967 *0CEEBA5EC73DE4D5EAC8160F1E83C1088D0AAC1F RUSTYGROOM
126,701,968 *0CE09E8FEE359CEF1878A1217750545EA5D66B16 this-aint-livin-(lord-has-bles)
126,701,969 *0CEB1CD889214F56D7A4A89F392252B2A6CDB097 THOMASDAVIDSON
126,701,970 *0CED82CD8CEC53969C4C957B9DF4E8202C89BF5A THROWYAHANDZUP-(FEAT-SUN-RISE-ABOVE,-T-KASH)
126,701,971 *0CE124D9EC35E896096BFD40DBC4E5868DE060F8 RYANSTYME16
126,701,972 *0CE481D2A7BEB3621E2A1EA6AA5A7C37A67B759F s11e21
126,701,973 *0CEFD3D872580E14287A48457A5970405DC7F60B SADA[email protected]
126,701,974 *0CE41E0EE00872D1EAAAC202B73F0291D051C621 SAL.DANCEY
126,701,975 *0CE7AE8C1A16D53DFAD84584C54BF035B07E7C2D TINA-VERA
126,701,976 *0CE73EE4E1DAA0C96B6C66DAF51630C33097A751 SAMMENFLIKNINGEN
126,701,977 *0CE52B26497224DBE2434317147B70F08F11F6A7 TJ88
126,701,978 *0CE5951B7DAEE8F29869185B95C1601DBEB293F1 TM.Project
126,701,979 *0CE78B803A5DD0DD84581070126A885EDB3814DB SANDY.SWARM
126,701,980 *0CE0C375C5E0BA66E98E192E3496B029DAA8BE24 TOBIAS.FALLA
126,701,981 *0CE74E372B46BDF3F6A6AEC2A4C351F74621504A santotrombetta
126,701,982 *0CEC282D9B574608F8E3462B1EC6EB667CF46AF6 saphire1994
126,701,983 *0CE6B98807A515937AB75D8D6E51F31EC54D1446 TOMMIEGORDEY
126,701,984 *0CE8C443BD47319AEAD4B5122FE93C8A91D364EF TONEYSHARTLE
126,701,985 *0CEF2E47FD6BD7F81DB32A66146D4E3CEC447576 touseefmirza
126,701,986 *0CE80AB3F40BA9944F710A2A15E7B25FAC6A200C “TOUTSUGEKI
126,701,987 *0CE6018F95BCD7520B77071F466546A3AAAC2185 toysatbedtimea:60b
126,701,988 *0CEE3896561CC319C9B9D96321D30D098E9FBDC0 TOYSATBEDTIMEA:60B
126,701,989 *0CE8EFDEA4FE29F9056516A34594FE381F6C7E29 tracy.schick.owen
126,701,990 *0CE76376F1FFB6C326C38B2389550FFD0C67DF8D TRANCEACTION
126,701,991 *0CEA0857140D67EFE39A4C7B9709E87A40C339A6 TRAX 119
126,701,992 *0CEB1D0775D39E134DB538A155D5E2988680D9DA SEAMUS.NOONAN
126,701,993 *0CEB26475A69B79AB9286FA15CC69AF1C3B3EEF9 [email protected]
126,701,994 *0CE30E8A238F01C2FD837B64EEE9260FF634B93C SEFIKATES
126,701,995 *0CE2947DF89E47A3496FAEC46ED53185AB56C9FE TRIANGOLAVATE
126,701,996 *0CE901FE00CBDCB4C7B40A8357EA4872851F3B01 SEMICLERICALLIES6
126,701,997 *0CEB25B424483422E695FB5508EDBCA33B1CB244 SEPTANAK
126,701,998 *0CE42FA4E0201BDB734EB2ADE6B99EDB6B4270FA troyraczka
126,701,999 *0CE15D016E2062B79A424250D1F2F3D863D6AC21 SETHOST2
126,702,000 *0CE94C58BDAFB6871646567B3B659F5F8398EA53 TSETLEB4
126,702,001 *0CE4F5CA4F280D935940F1DE32101715762D4213 TSEZTIHRED
126,702,002 *0CE7C8F5054BE9D484F9621F5A7D7D1554485C96 TSINOITASREVNOC5
126,702,003 *0CEAEF871863203DB292EA4A513F7AE2CC75911F TT0524706
126,702,004 *0CE5C0FAA166385B9745D690DE20CFDF93DEE871 SHAD.MAMONE
126,702,005 *0CE3D99742C42225782F73256F891F3B4A8D1422 shanelesh
126,702,006 *0CE7E6D77604C0C14C2373B2568A2BDA7875D1C6 shaneskott
126,702,007 *0CEB384FE092296B73A07AE7A8BBBF5ACD855120 shaquanna.robinson
126,702,008 *0CE18FB1DF16C33A951328BB8D02CB24266C67B6 SHARQEBA
126,702,009 *0CE8DFA58EEA0719C2DAC2FA5F38259D28F84CE5 SHASHKANTH
126,702,010 *0CEF5FE9F1DBEA949166BDE4C8C42B91033769BB SHEARSPPED
126,702,011 *0CE1E553FBC36274B1E00E75D72DABD87F7CF8C1 TWINSFOOL
126,702,012 *0CEA0C3897EC2F94367551E96882BB5A3D2EAD41 TXENON
126,702,013 *0CE942375B7D0ACC666664936FD282CCEB59FE40 SHELDONCLUSTER
126,702,014 *0CE06FEC1345C8F06FDE3FCBAADD85E6FA7C77DE TY3_
126,702,015 *0CEB3C0F0C6DEA7AE5440F2F71E5D3C3328683FD TYLERCORKERY
126,702,016 *0CE802F0C436EAB32B8FCA0F7259756BF34561DA [email protected]
126,702,017 *0CEF498690999662D8935A1768004DAC224B8BB8 tymaxfield
126,702,018 *0CE71D0F40FE28576E714D0EE4D0498847224E2E SHERITABARKLEY
126,702,019 *0CEC08970DEC19D6412AF263CBB9B55B1A2834D8 SHIICHIRO
126,702,020 *0CEEBC539D94376657915AF617842AD9C17A7B57 SHINTAISOU7
126,702,021 *0CE4C026EECAC65AECC5F2592F819D29C9AD949B shivnarayanyadav
126,702,022 *0CE0136706FDA944BF605A9F8F82E6B9EB648984 shoasabbas
126,702,023 *0CE1B94A9DD0263FD75F8F5ED51E0E84022CD10C [email protected]
126,702,024 *0CE864E9A1B7A3742416B2EE6F6E1775CA0A3D8A SHOWYSHOWYCOMSHOWYSHOWY
126,702,025 *0CE070AFE5F3B8252C3F8923CA10C6FDAACC3E98 SIBNESSESES
126,702,026 *0CEEC748930FBB1F437073BBF4D565C2A1A3B198 SIDBLEP
126,702,027 *0CEE6A4045844FD1AA4D991F80EDAE7A44BED068 ULTRAAPOLOGETIC1
126,702,028 *0CE60C32F42452BCC449276CFA2F653CFDFD2966 „SILVERKUHLE“
126,702,029 *0CE93CE5BB17D0EC9D1C6FF4FB9F561CFDEFF7BA SINGERGOLVES
126,702,030 *0CEAA08C706BA0B7B03749536FA9778502F680AA sithere.now
126,702,031 *0CEA8C21FD9884D40BBB4BDF8C2F7877EA83C108 SIZE1GTLTNOBRGTFAVOR
126,702,032 *0CE385C44811B85E262B0209804F9322EDD1768F SKENORS1
126,702,033 *0CE60E35547130717897D37DBABC11E65EC75B3E SLAVONICDANCES,OP.46:NO.5INAMAJOR
126,702,034 *0CEAF8B17090C90EDF306F8238C4914E14C8F395 slbbtjs1
126,702,035 *0CE0C0A0F0E06E66630986CF5418517F1CFE2361 unq4
126,702,036 *0CE010BC4DECE53008EA5234B22714DE85CE4DFE SMRSTTD3
126,702,037 *0CE4B7474148521E3C5A7525D6CA84429215514C SNORESSERDA
126,702,038 *0CED5F0CF4D4E4E62EE617E40DB783BBB540F67B USER:デル、“SANTA
126,702,039 *0CEDC759529F5B507B2FAF0ACB4383BB2C2AB126 [email protected]
126,702,040 *0CE53D18E8DF155D6624981925E46F0AE7BA502C utli hawa vich
126,702,041 *0CE4183BD7A9D25E3A60E3EDB19AC6A915348269 sonaring1
126,702,042 *0CE4166F756540FF49036EED5C6A7023ED71B284 VAIBHAVDONGRE
126,702,043 *0CECABA1BE04633CF60BF034C1E7A641611CA3F7 SOSIALIDEMOKRAATTINENKIN5
126,702,044 *0CE311D4868A30F6FDBA2855775E1BEB1781E6BD speedopandora
126,702,045 *0CE5D188610DA41C3AEB0AF078F37C28C66E5079 speleon.e.p..(ben.sims.remix)
126,702,046 *0CE7AC8C8F6F166FC8BA0109519B1758AFDD910F VAN.FUST
126,702,047 *0CECFCCE92AD6AC7E2164913E1239CCAD582DD88 spirillolysis6
126,702,048 *0CECA7EB3A60915A50855A36E588C87D434F8A0A splat~~~<---b
126,702,049 *0CE14F0F0745B3AB0D45295AC823E35F074A84A7 Splat!*d#B
126,702,050 *0CE36DDB067658F3247829262A5DB65F542E5951 SPLAT * <#####P
126,702,051 *0CE164C77287BCF23698802DE5006F8BE7E0539F splat~`q###8
126,702,052 *0CEAFE69D6AA1327024DCD8601F8EDEB96B395A7 spne
126,702,053 *0CE44748A3434BFE8CBCF7A9F0A9A7906D214924 sprezzavano
126,702,054 *0CEE7106387D1C4443E97FF010FE9E0C04AB646C VERBANDSVORSITZER
126,702,055 *0CEA1ABFD14BE30D214EDA0DC25BD7A45B19ABA2 SPSMTCL8
126,702,056 *0CEABB20DD72B7F3019240E9F9FCAF4232D0B991 spunkybrooke
126,702,057 *0CE8592B735329FB154E9E062B9AE48876AC7644 SREHTAEFESROH2
126,702,058 *0CE80549D07D6EEC914059783E81A5BD28BF592C vernan-2-0
126,702,059 *0CECCC29B5D4F151E4EBFACA3B1D8626A817573A stanbrinkmeyer
126,702,060 *0CE396DFB3A1D5177EB574D0C249CF5111122BAE stancainglit
126,702,061 *0CE87D97614BF97DADAD8752AE339E617A2E0285 [email protected]
126,702,062 *0CE7F245D8265509C9BEF7A304C3D2FE276DAEE1 vh1’s
126,702,063 *0CEE8ADC4362F66758266B6BA1D7EB9D307E7E05 vibrog
126,702,064 *0CEC052385DDBBC08E71269EE4A9983737E00387 STANRUSSER
126,702,065 *0CEB59DB99013B74ED8C2963B209F8857A46C7EA STATEPARKHISTORY
126,702,066 *0CE95B6AAFAD263E39B8B08557E2EB5EE0576006 STEELECHAOS2
126,702,067 *0CEBD9CA1DC0DB558CDC306B16BED82035A0E867 STEVE.KLIEWER
126,702,068 *0CE16973DE2A596DAECA57612780100A2CC246E0 VINDELTRAPPOR6
126,702,069 *0CEBF07BDC6C0595ED8BB6B20BFA47AB3896250B VINDUESNUMMERET9
126,702,070 *0CEC99F365E478E92EDD2AE3D3DB71708C70A597 vinz.sinadhan
126,702,071 *0CE3BFDDC0131DB382D581B165DE55CDE79018F2 STICKS-&-STONES-(DISC-2)
126,702,072 *0CE306D50B43EA38539274DD05789EEEA1A9ADB7 stivalied
126,702,073 *0CE8E8400B613468F95DDC906694F97C22E4E15F VIRTUAALITALLEILLA
126,702,074 *0CE322EF2BCD89B57E98D3027931B0B7127E1996 VISHNU-PRIYA-GOPALAN
126,702,075 *0CEF305A954F4C9D72F5FBE12A44E1D822E10ABE VISSER.MARK
126,702,076 *0CE85D83BEC8A90301BDFFD220263E9644A4DE6F STRDLGSTS
126,702,077 *0CE6D471A5D5ED96D3136305B69905F25E8EA95D [email protected]
126,702,078 *0CE14E65436B1E1A5D2445C65CA931E3E20882BF STROOIMEISIES5
126,702,079 *0CE6274708D3912033C3A4578235328080DFEF8E VLAD.PORIADINE
126,702,080 *0CED8ABD2E313A2F4B7E49F4573DA3DDDB0C77B8 VOKIETE
126,702,081 *0CE3FFC40BA0CED06D40CB5D8FC15D3FC8D211AF stylsrz2
126,702,082 *0CEB81C3BE930203F6B291DBFECF25E0D82929A3 Subca73g0r3s
126,702,083 *0CE6523FC99731C3D28F12F37EE46A0529DA0F0C vrijverklaart?
126,702,084 *0CE00E103DAF3E3DA5D2FDA34CEA9D24810ABB04 SUOMONONA
126,702,085 *0CE394D130B3AF6FAE9484CCC38A979982BD24FA sureshsritharan
126,702,086 *0CE0E626684B9639C2659ACBC253AC7739713258 WALDBESTANDSAUFNAHME
126,702,087 *0CE65BF4C7D86BCA0AF6615297F11ECC8BC41E5C SWINE SW/AI/N
126,702,088 *0CE3E9391E3D187F43EDD5D1EA64788E6D3E0F0D [email protected]
126,702,089 *0CE3D43D64E1822EFBF4ECED6732371711AFC644 SYKESGELDER
126,702,090 *0CEFF7F43F6E1C186EB1BB4F9C88CCF7F070D235 SYMPHONIC-ETUDES,-OP-13-NO-12:-FINALE:-ALLEGRO-BRILLANTE
126,702,091 *0CE1B01F7AEAD39BDBC56FE686FA48433A85E2B5 wandastykes
126,702,092 *0CE249286BF4B49A0701DA0920130AE2739B56C5 /SYS/MODULE/SND_PCM/SECTIONS/.NOTE.GNU.BUILD-ID
126,702,093 *0CE3C1BD8C7FD0C7F79DA27F77683E5DAFD2ABE0 WAREZSNOWBAL9
126,702,094 *0CEB37DBF33F0DBD18C93FD13976DAEC11D1E371 tacobellrufus
126,702,095 *0CE6815F54E1790C7EBC25CB216D80C29B9F727E WavetablevsFM
126,702,096 *0CE3C4DCF57E3C84B433418324FE02C5D083E057 TAKAAY
126,702,097 *0CE0F996E37A573957A723544B8C72CF27214C9C tales-of-flossie-fillet
126,702,098 *0CE423AA02E16E1BD001E2762AD36CEC19E4D498 talk901941551
126,702,099 *0CE9D20D787AC8B9C6E74EFD18B8E5B2B290BA63 WEDST12
126,702,100 *0CEF55006364B13C0DF05BC92C2E928037FD82DE [email protected]
126,702,101 *0CEC0460BE3CECCAC265C15116A091B4922D44EA [email protected]
126,702,102 *0CE77C235A91CE67CC08276A570131B3B87AB033 WES.SITZMAN
126,702,103 *0CE052EB3652A9C73FDE2A8617954FAE09600D48 westcoastcorvettecomwww
126,702,104 *0CE3DD70CB9DD9375AEE5D5BB3A1826FAD6AE190 TÄVLINGSCHEFEN
126,702,105 *0CE2EF9B8EE60781A74A43CE76D1867246E23D68 WHITNEYANGLIN
126,702,106 *0CE572F68507A82A8DE75E700E2D1841C9ECB169 TEDDYSCAMPOLI
126,702,107 *0CE601163F06977AC2015C66E2B2528B96A3FFF7 wide-re4l
126,702,108 *0CE33675E92B5F09DD4A701FA15425CEC6D21B6F WILEY.MCCROSKEY
126,702,109 *0CE63CE4215D80B92D7E84FD20BB45789DEE28BF tezi6
126,702,110 *0CE8A59F183542E1EDABF8D614F9BA33F6E37D00 THATSCHNAPPS3
126,702,111 *0CE41977504D628CD2727B0CFE5412DC47B93B4B WMASKEW
126,702,112 *0CE1C1FE17812A5478D625F7EC621C4C93839AF4 THEFORUM90
126,702,113 *0CE3D3CE6584E451E16B586B036ADD58F1C411D3 the human lobster
126,702,114 *0CE9834F3856454F685A7819DCB399E996E6A5E8 THE-KIRKSTALL-ROAD-GIRL
126,702,115 *0CEAE4102FE6408517EB346E3DF1E9533D6AE90A THELOOKOFLOVE(EXTENDEDVERSION)
126,702,116 *0CE6CE776B263EC1A6F415491656BFB28090BF54 WRATH
126,702,117 *0CE14756E32A43731F62CA93FA9045C3F060B1FF WRMNSTRS
126,702,118 *0CE3A68027B9F1EE26B2A219629AE2CB500B85AF [email protected]
126,702,119 *0CE2291EB4C3066DDC28FD1015AAA01E3CA334D1 [email protected]
126,702,120 *0CEAFFFF30BB2945F660A1C7EB43206D98404493 theronfishburne
126,702,121 *0CE9DCA5A4D18485895A8F5B8232A6696F5F748C theronleidich
126,702,122 *0CE172915833BEFCF0BEB827B72A31E370DEEE6B thesanjose40
126,702,123 *0CED7134CFF19611F704B546E2FB13B69E4293BB wwwcheecacom
126,702,124 *0CEAEA1CCD45227A1AC4416F3CF9F10E1402D0E8 wwwfmupatriotscom
126,702,125 *0CE863FC3EA293AB56B94ECADFD442161FA15A90 WWW.MAGICALLY-SPEAKING.COM
126,702,126 *0CEAAB276C3A56AFC9571D446CBCF1F1ACA7583B {X}* * * @===8
126,702,127 *0CE512C065395815657F03FB1C69BBD38F56F360 TIARENUT7
126,702,128 *0CE6F4E25833DD6025D9A5913409E8E0FD7C4481 [email protected]
126,702,129 *0CEBDC446C40F36ADEAB68F6749441A60B551C1A timeisanherbthatcuresalldiseases.
126,702,130 *0CE3BEB2995DF0978256BE72A972A71DB2454DDF timmicallef
126,702,131 *0CEE0A70832FC7224DA7FD6112141B0AED418121 TIMOTHY.BOONE
126,702,132 *0CE507701A0A9F4060C20A99934460DC5D077156 )X(-*(------P
126,702,133 *0CE1B62A66632E4E9C778CD2678FA1B5E4E75C95 TLL2477
126,702,134 *0CE4F7148893D3BFF239AE965FDB3BC45898A84F TLLETSSUAREHED
126,702,135 *0CED691F1153B2DA35D1C291A450EE1FBF33AAE9 TLUSNOC7
126,702,136 *0CE89C6596F677E3220177174868260575EFCF14 [email protected]
126,702,137 *0CE0C400DDD7B44E376404A009811EDAEC6FBE8D XXXXROCK8
126,702,138 *0CEE210C995EF8E1A7B3D34D1A7959A4CAE46080 Y865898042
126,702,139 *0CE057DA20D6F56A4765467283F5E32947A1F4D9 YAH IFFAH KARIM
126,702,140 *0CE9B6D8C686BE6188A0128FD711023046E93D71 [email protected]
126,702,141 *0CE8F783092C667C669C7CA43495B2A5F92B41C4 YANNICK.APPRIOU
126,702,142 *0CE7230B5A196BE16E892783A9A7E2944E83AB8E TOP02
126,702,143 *0CE7E474C75F61EE0477C620AB0FE1863F77A5C6 TOTENSCHUT
126,702,144 *0CEBF31BCBDF5B7F50116CA2B5A20056225A5A7D TQ605575
126,702,145 *0CE6587C3837C84FF47BE32F49B70AF50341D8CA YELYAK-PMEK
126,702,146 *0CEBDC624F56FF03257A79D9B193637719C048E1 YENOLEM8
126,702,147 *0CED96A564719A5850B1FC18B4E935A3F0E581B3 tracy.razzer.allen
126,702,148 *0CE4629909AD3C045B02103958F9FE7D8BD6F183 tracyspease
126,702,149 *0CE3AB4176A0C7392E3C50C2BC4FEFC312FDB5DE [email protected]
126,702,150 *0CE3A3972E49903BCD94B1CCC5E29EF67F1182B1 [email protected]
126,702,151 *0CE6D9581704757658C2BAFA2DACD4745DEEBB76 TRAVISPIGNATELLO
126,702,152 *0CE840E99BD45A75FE580FCEDC566DC929979680 travisrmiller
126,702,153 *0CE04790A0AAB1BCE289C7CD462E26BFAD31FA88 Yo Check This Out
126,702,154 *0CE22734D043C2D58154EAF0C6C58B12DC468401 TRI AGUS PRAYITNO
126,702,155 *0CE94826FB631A8064A78D4BE12A0DC3D7C888CE TRIPETAS
126,702,156 *0CE58A1FE61DF88211AAF3902FA4063385AC55C0 TRKCOP
126,702,157 *0CEB183960841BDF2AB9F12E2A3BFCE7CBCD2E73 [email protected]
126,702,158 *0CEF79F08992EF6E3AD30E163D038D724B479CE8 yumi-tsukino-you-mei-yue-ye
126,702,159 *0CE355EBDDC66901060697C5D595599D55105661 YVELAM
126,702,160 *0CE20440E8FEF2F588F17038231E90FB639C7046 <TT>$INTVAL = INT ($MYNUM + 0.5);</TT>
126,702,161 *0CE2EC755B30AA0F18DDE4BF6BB627C2D90519C6 Z<#%
126,702,162 *0CE87544413531E2245A35817D4FD391629E4F76 TUCKERBAUMAN
126,702,163 *0CE35782662FA87757F61BDB33BB4700739756AD TULSUNBSW1
126,702,164 *0CE5381D72C6E8DFBC723322F1695426A6A4B533 TWO.SHOTS.OF.HENNY
126,702,165 *0CE863B0AE6A5FF84679146A5F5280A39E198996 zazi777
126,702,166 *0CEDF066EE747629BF2B340ED7A6068A428B4327 TYLERWELCOME8
126,702,167 *0CE29B86EF6AF38493AA534AF7C56572AA353CCB TYRELL.POER
126,702,168 *0CE79F86DC03ECAEE186A0F654945F58B1FE9F78 ZEUSSCATT
126,702,169 *0CE5D20E3E8CAAFE7FF666FD55A8844A6F93412F [email protected]
126,702,170 *0CE50BB9E0A6DB48E8FCD7CFCEBA0762C3AFFF34 [email protected]
126,702,171 *0CE098525779A8961425715BD97497BD9C72C678 [email protected]
126,702,172 *0CE0F472E6DE38168FC7014265750C86BAC843EB UGARTINI
126,702,173 *0CEA07306DEC0BE533B90FDE5D241C6FEE615390 ULNENDE1
126,702,174 *0CE9159FF457F58B7293DBE1E0B99721CE6DC420 uncalcularer
126,702,175 *0CE5345AF82A235CAB90DDAD05D72CD14D91E71D UNSEEN.EYES
126,702,176 *0CE3EAEABE1A29251FFEF5937975F633F5F87364 аркадыі
126,702,177 *0CEBC059CF0E40D5AD7F1CE5CAC194188B53DB49 USER68.37.205.18
126,702,178 *0CE988087858C7057E5486DD961DAAC5B946C70B user_talkrolfasmund
126,702,179 *0CE03EAB8871BC160EA90A478625D162F6B902F0 „ЛЮБОВЕН
126,702,180 *0CEADB03FC77B0E6C8FE14B2AB8899BCA29ECEEF USUBBEKOV
126,702,181 *0CED41F6A32EA6BFCEB5C5CFD231939D8015338F НЕРЕНТАБЕЛЬНОСТЬЮ
126,702,182 *0CE76B2280FA91E1C5383858B16078CF02185E64 НОКИИ
126,702,183 *0CEA1DB5CC1C1B5427EC241E2B24D168808F912C «п3
126,702,184 *0CE1A6CFBBB998953F663EE6E73524F99160B87C [email protected]
126,702,185 *0CE42C66EB8AC28E579120EEDDFD7FEDD6BE16F8 СЕКУЛИЧА
126,702,186 *0CEA36C82529D7F5F4634AE1C1B2EE01325C63DC СКРИТИЙ
126,702,187 *0CEE79DA3B52FAFE873F5C2962DBF627FC55C74E СРЕТНАТА
126,702,188 *0CE52BEADDEE4C63C423F61018D6E39A4AEF178E VÄLIRAUDTEE
126,702,189 *0CEAFD1EF629D6851E86D2FBA93C01DBA9E048A6 УТКУЛЬСКИЙ
126,702,190 *0CECEB1AEC8398A93D1AE21EAD9A52E065E3FF06 чвриви
126,702,191 *0CEC511BCF9D65958D6E7778F811A00A37014000 ЮРГУ
126,702,192 *0CE3EE5D56FF4CC1CD3A39E758CDC635E6ABD343 ЯДНУЮ
126,702,193 *0CE8905CDCA9E871F07AD6279CFC57121CB6B00E vanegelston
126,702,194 *0CE40EB1B970DC06FA7BA854373416944AE3CD35 vanencarnacion
126,702,195 *0CE6CB9C6328263E1625826FDDA8A31E7D051269 VAN-NUS
126,702,196 *0CED656DC23FD77F88F2E42DD5CA307FDB538C2D VERAZARZA
126,702,197 *0CE21B034099251B5BB34CF5E52DD687E4906698 vesprodellabeatavergine(1610):iii.concertonigrasum
126,702,198 *0CEFEED8BC16829E026A115F23BC22F6D45D49D3 VETNISJÓNIR
126,702,199 *0CE6763DD8A7521E5E6EF9C2CA58A79E27A047C5 vibro-phasing
126,702,200 *0CE3042E3C00C02BA57B24BF50CA061751CE601B 06-23-1382
126,702,201 *0CE1D88300AC19F5C22F37EABEA395D2D733E0F9 VISIONSHERRIED
126,702,202 *0CE944B86F46EBF4A9D11B2DC8F2A164960EF089 visitacion-macaballug
126,702,203 *0CE5F80F2889E06FA4B88530D967FABF2A42AC87 viziavis
126,702,204 *0CE5B4FF374CB1720EA1F0EB985C934BE810BBD4 [email protected]
126,702,205 *0CEED6B5DAC937F52DE9362EAD68F13067C8587B 0ALTAMIRA9
126,702,206 *0CE67546D2EF856A32B5D9A5716B0549DCF2AFC5 volup7uar1e5
126,702,207 *0CEE453B31CE51BDA190041A0519D3CA51795F21 VORRANGIG?
126,702,208 *0CE23070E84048B696C732E21FECED8A1BD6E296 votie-mitchell
126,702,209 *0CEA85250FA1EC884FEABC92353A6707313D9756 1028251 whetherplanesweredeliveredwasnotclear
126,702,210 *0CE92C7A89288B56C1C06EA487F5C7B02D1CC761 VSFLEE
126,702,211 *0CEB4E359DAE90B54F9E69F69AE863F8F1387344 VULNERABILITYING5
126,702,212 *0CEF131F835331DE00FD8A64C1D3D78ACA9EFCAE 12:.12..-#..-&...NUCLEI
126,702,213 *0CEAE5707E42F513EF5631C700FDC5108182DB58 1231703 TEHT
126,702,214 *0CEDE32B6F81676373CD0F66EE91D60676E8664A 124moriah
126,702,215 *0CEE2A0B7DC172ACEB8E37040FD5668A0FA1A69F 12-buergerlich-liberalen
126,702,216 *0CE71B47EE9BF05C34F467EF40B6A6D90415ACB1 136 BIRSTEINER
126,702,217 *0CEB9CF93ABCBE62B52B9078815A6A703FBF4379 WALLYMCCROSSEN
126,702,218 *0CE8D9CA8764909B4ACCCA1B98231C31F9D24729 1553548 buyers are mainly pakistani industrial groups
126,702,219 *0CEB77CDFC0CCB260B943DF072A4C04E7FEA7FDD 15979 sen.kehitti.oululainen.jarkko.oikarinen.vuonna.1988..
126,702,220 *0CE2484BACA6E239D9694296B7EBC07B5E4B093E waltersmock
126,702,221 *0CE1F0AB5F1D93BDB49765A5E9AE68BA1FC02FB8 17111639
126,702,222 *0CEF2CC788B1E48FD7B4F6683FC2D60D878AECE8 180838 der-gewinn-je-aktie-betrug-1,78-(-1,83-)-dollar-.
126,702,223 *0CE86664AA8AF8F3763A99C68DF85AFDC3EE8434 1886266 DEUTSCHPOLNISCHE.HARMONIE.IM.SCHWARZWALD..
126,702,224 *0CE3A27C9AF9C14C2A13B2942142B8E566E5098F 18 PALOON
126,702,225 *0CED38BF742B1770C30F57B4299450C3DA65DCF0 1923908 LIS
126,702,226 *0CE125C9C405F837D15C778126A5FF19B323A652 WATERICE
126,702,227 *0CEFC55CDAAC00D417216DE791BBC38027249483 WAVETOPTOURNIQUETTRIANGULARING
126,702,228 *0CE932114BB2C3BA668F4F6D761A4550976EC5A6 19にLUPINOIDさんによる即時削除も行われていますが、このときの本文は「未来クリエイション」の一行のみです。
126,702,229 *0CEA46D039720EE14C64471631E1BB05CB5DA635 1 ARMENIER-FRAGE
126,702,230 *0CE724A75392E2972969543D8C47C2D7461E7136 WEDELIVERATLWEDEILVERATL
126,702,231 *0CE4E617284C98571731D2C7115AC69B0E0D6CB5 weichmac3
126,702,232 *0CE980D280E3C1C5D50C36618D3A50F81708E827 1BOSNIALAISILLE
126,702,233 *0CEA0405291AACCF23CA63A22BEB458453A2B9B9 1chelseachefs
126,702,234 *0CE739B4E1DF473FF103BCBD0A4B905DFF38852D 1decentralizes
126,702,235 *0CEEAF572365331563654AC69A6A5D1111482F4E 1.DEGISTIRME
126,702,236 *0CE435D8340966E0076C9343091C760B47503B44 1demolliens
126,702,237 *0CE949D2D26F3359D24CEBD48D28F04A5236ACBF weskeenan
126,702,238 *0CE8470E3A064CD3574A259EBD0A78FF3E10A808 WESTFAIR2
126,702,239 *0CE1DC8E9290DF7D933DFB4129AC516A3983B27F WES.VERASTEQUI
126,702,240 *0CEBA447B404C038311C1AAED80535FA64348E13 1-homileettis-liturgiset
126,702,241 *0CE63BA78CD9781889CBF3871B7EAE26FA9206E7 WHITNEY.ENWRIGHT
126,702,242 *0CEA12EDF7ABAFF671C9C8F1A31C5EA89E3C84E4 1ICEBONES
126,702,243 *0CEFF374A5A1FC88AEA8A71B53D513F6A854909A 1-ILMAPIIRINKIN
126,702,244 *0CE47952C49984C860E495A3FDAF6CBC301BBACA 1ILUVDOWNTOWN4
126,702,245 *0CEF7F6CD40D84B897E8E5DD26588089F148B95C 1.itt-saal
126,702,246 *0CE3A30B895C1A73FA5C27721EE9E1BE2DD22581 1.kilpailunnelj
126,702,247 *0CEA7CBB426C230F55971C105FA20A8D0999798E 1-LACTOSE-INTOLERANCE
126,702,248 *0CE61A72D8F558D8629B80CDB1BF583E332A1379 william-alton-barrack
126,702,249 *0CE0E3CAFF4FD4583F7AE70A98425D17D1B99BF9 1marionettepuppets
126,702,250 *0CE1A932C541F03FA7D8DDBEAEDEA4D9FF9F62C6 1.migros-fachmarkt
126,702,251 *0CE58ADAC1E23D1D73729F01D6B4F58A8BAB8538 1murphy0
126,702,252 *0CEB82163349AC4B5031E5C0D7C21230249EB78D 1nation(feat.deadprez,thaoutlawz&stormey)
126,702,253 *0CEC001F883C55B5F1BC4BA8C1919A89F26C8777 1ococor
126,702,254 *0CEC1605AACC7A45DEA8FCE922D1405F3CFD5DB7 1POLSTERQUALITAET
126,702,255 *0CE3E66FC9104D42870EEFE7CB0180E3DC480B8D WRECKED,
126,702,256 *0CE1C8561C5B5B1977DC432B4F7A6DFD014EAC93 WRTMKNG6
126,702,257 *0CED0430C81A12A54144C98B0B2F81A64F9DA296 [email protected]
126,702,258 *0CE55EC950468D6C41E96D817A4E661466CBC1CE w/{u
126,702,259 *0CEE78CC2B640C1F107E3AB1D4672728D76912ED wu=o
126,702,260 *0CEF66DFFAA83C6C6DD7FCEB62551F5F3AA31EE3 WUOBMALFED
126,702,261 *0CECCF98D987B9C0587CEFF6383AF560A97A66F8 1WEITSPRUNGAUS
126,702,262 *0CE9884EFF6CF351A01926C6FBA025ABE7D90478 wwihomecookabout
126,702,263 *0CEEBA891630CCEF3C379AA60A2A7A0286E57DDC 1wintersportrummel
126,702,264 *0CE7EBD68BAB6A91CA54C0AC33FCDED04A92E07E WWWBERRYMARQUEESCOM
126,702,265 *0CE89FF9878EA6DEE78C9885D66BA44585A83EC2 WWW.DOUBLEDCHARTERS.COM
126,702,266 *0CEFE5FF64423D8B75927C3507BE8DF283AFCE30 WWW.NORTHSHENANGO.CO
126,702,267 *0CEEABCF44BA47B587F1B026DDBACC752F3581EE 20rocheville
126,702,268 *0CEC1FC59D7BB345866497BB77E58B465F6E2397 226632 goruntu.goruntu.ile.ilgili.islemleri.icerir..
126,702,269 *0CE6E8312B36BFF6224F07EBCDE585F5B90BCD97 2325835 HE.BEGAN.IN.JOURNALISM.14.YEARS.EARLIER..
126,702,270 *0CEDA3394D317A6506B8A2FB90B403CA41507065 237525 DANKE,JOTTFRIED
126,702,271 *0CE0EFB67DFCF9728B70FF283902CCD9BE1AF08B 24286 EINE AUSNAHME BILDETE DER CHEMIEBEREICH
126,702,272 *0CE16E1AEEBE3D1783425EDB0527131BB31BAC8E 2438640 aber-ein-schuss-mehr-biss-waere-noetiger-
126,702,273 *0CE579F65BDAB8DB359B9980CBE8EBF711498682 2.6.1-DEALING-WITH-ENTITIES
126,702,274 *0CEFC5EF1F7611B9954503DFB6D0E103EDD33E23 )x(o~0~d======8
126,702,275 *0CEF52090F4350DA40EF750236C740DF51E8E052 2678626 ulla-maijanjatommintutustuminenalkoisiit
126,702,276 *0CECC79843BDB857AE206112B020D66ACC90D0C4 [email protected]
126,702,277 *0CEED8964AD00DCC7076F3D50C196306EA1D97ED XVR5
126,702,278 *0CE1CD0D6B7C440286BA67854AD6E4BEDA6B520E YAITZA-COTTO
126,702,279 *0CE9847D1AFB63BA6294067DD9A36736F7E063BA yaminyi
126,702,280 *0CEE19E665BFE8B86309EB664A6E767B8054881D 2FCAR
126,702,281 *0CE4B020235DB58529671C05917A37CCA3209B2F 2FREENET
126,702,282 *0CE217C760BB72AE2AFA50750412D72E1772C981 2.JASWANT
126,702,283 *0CE24015A5007E913ADE2F1D5C8F98B244AD9AF0 2.laternenfest-eroeffnungskonzert
126,702,284 *0CE5CACD9EB88C8662760D4EDCB0C2129BCDE1F2 2.MILOV
126,702,285 *0CE40CFAC33BC36FDD5EAC244902EE85C6ED899E YELPATEXECRATION4
126,702,286 *0CE5C4AC64057B83900A60DCB9AB85A84FB8CDA9 yesinlove
126,702,287 *0CEC98E4BD0D57068860FE6635C777F95BDE2F10 2.pressgutes
126,702,288 *0CE1D38C2A81389EEC9F8E464CE8828FD5161CDD 2SERKSNAS
126,702,289 *0CE3D4ADF8AC02EE9F1391FBA2F464CAD05C23E5 [email protected]
126,702,290 *0CE1E0AE1F25C5813560672723DCBE8DC04AC2EF [email protected]
126,702,291 *0CE81165FEF0662CDEF5485165A9DFC3B319BDF4 yllab 1
126,702,292 *0CE2DD48D875528894F7B0BF594B4987A76B7808 YLSSELFEIRBBING
126,702,293 *0CEE9C013AB67BF285ECABA26CFB9B43C7981957 2.VUOKRATALO-OMISTAJIEN
126,702,294 *0CEA59C7E0D6353F0CF3DD594784F9533A733239 3051109
126,702,295 *0CE6D06A635F1BB66DE7CAD20F9946BEC396947E 328uriah
126,702,296 *0CE04016822E4E9CD1A1AA5DD7AB1FD3F88C0F67 336.folgerichtig
126,702,297 *0CEB0727BE6ED1A91078DE0C2D56EB7909E6F62A 36doubledealing
126,702,298 *0CE36C68BF16AA0B3485BE00D567E6F43996F255 3##@~`}8{
126,702,299 *0CEB8F5DDFB96F27D6EB081F5D98CF093DBE772F YOVANA-CRUZ
126,702,300 *0CE0256B21E584CCC017C371513FAFFF522607F6 3---B.~0~O.}O{
126,702,301 *0CED9555B6043F0DCE9ED65BA2D60104AA411048 yuo.park
126,702,302 *0CE6AF5CB0712C80A3D75C96BE727CD3F483F6BB YVRISTIKA1
126,702,303 *0CE0E3241F2FE1BF595279B6E49A6FB79FD0956A YWRRDSO
126,702,304 *0CEAFCE9A73F98D2F1A3BA4C2ECCBE697939BAB8 3LORENTUS
126,702,305 *0CE137831861B61B6A11FCE9FC44F58471385339 3MASTSPITZE
126,702,306 *0CED86BF5FF7A44FCFE46CE9BE324D89C6464761 3namable
126,702,307 *0CEC3E808B2F9D79285E0D745EE3C62F224B7EF1 ZAOSTAJAO6
126,702,308 *0CE2EF4A9DD972707EC820FC124F8EF8BAA15E46 ZARA.ALEX
126,702,309 *0CE8FFEEADBA8487FE47AF04AA0728AB811AB977 ZEITSCHWELLE0
126,702,310 *0CEB93AEE5C0F40B8D93E22A6F722D768AC8CA17 ZELMA.HUDGENS
126,702,311 *0CE9C1668EC00D87744E8223D62158E40970CE62 413497 aducadkurucularIprofdr
126,702,312 *0CEA26D079EFA5B3C0731E2EA0A6F4E1C2849D3C zeusbear6
126,702,313 *0CE0929984CA8EAD0045CA80272221204162D6BC Z,H2[V
126,702,314 *0CEE0A22BE7AA99F2026FCBCE499E8C3BC37336E [email protected]
126,702,315 *0CE31E684193F6117FAE72D7CE6F65AA363DF876 [email protected]
126,702,316 *0CE50379C15D28AC3F3C24172F91B204AE2B7E58 zigollys
126,702,317 *0CEB2338C712468E63635CC373E7FFF19AD9E0A9 ZIGZAGUERONS6
126,702,318 *0CEF1963FBF5A5526D9E3868D677FE38AB063E0E ziqah1997
126,702,319 *0CE22FEB0586A9D945D4BCB38F4E4CF3B5661D54 4IAMBATMAN4
126,702,320 *0CE1F5868F28090CCCC157D3720ABD03A2F2FE4B Z"L\
126,702,321 *0CE72BA90F4B8DF56957129F17D682355352869E zoe-apt
126,702,322 *0CE02FC7DDAB46335E85E1E93E1EB3D623924E97 4ISAACGUNNER
126,702,323 *0CE1E83214A8BBB8895F4DA91BD40BDB49765625 4NY+M3
126,702,324 *0CE834EFB9A0EBE7632969C70F7FE7125AD929E8 4PUSSYBUS
126,702,325 *0CEE0051D24A0E844F73D31B8953202A862708C2 ΜΕΛΊΤΣΑ
126,702,326 *0CEC7939ACAD7852E6315ECB9DC959607686E3AE 4SCHAPFOLD
126,702,327 *0CE7FFBF1D8F74B59E23F06B55D00AC524E6FF62 4TWIXTWIX
126,702,328 *0CE56AFA767FF5604E7C29E4A2F8E09FC222869F ДАБАША
126,702,329 *0CE8F7CA5D7E26CA09E6FD2A2009319B30411AAC 4WHATEVEABSOLUT
126,702,330 *0CE818B22ECE95265DFB260DA671BA5FC8DB951B 513581 DERBMWCHAUFFEURSCHLIESSTDIEFONDTUER
126,702,331 *0CE239BC4F51724B46C205567DA8457271E4EE89 521200 DAS ELEND UND DIE KAELTE IN BAM BLEIBEN ABER
126,702,332 *0CE6E32A576D0BF6222C07A34BA8B21EF0F75825 526SHANE
126,702,333 *0CE3211D609C51049ECB138834D65D6018A1F156 534651 so-verschwindet-sie-von-selbst-
126,702,334 *0CE5E9DE99A0550CE344D103082136F28953E479 иоанн
126,702,335 *0CE0511EFAF2B58B3815D505D2EE3A1AA21B0D31 5ASIGNARLE
126,702,336 *0CED38F1FF0DEA2F6DD9E88D9C90D4D07D9811B0 НЕРЖАВЕЮЧАЙ
126,702,337 *0CEF9F6461DFA5E599D0B48B3F4329D576BC0C4C ПИНСКА
126,702,338 *0CEA6123DEE5AC56379F6A77FE4D1F0ADFE362ED 5ERADIATES
126,702,339 *0CEB22A7510F09CCD1BDDF14563DF156371307D2 ПОТМАКСКОЙ
126,702,340 *0CE75632C9FD93B989CF5620F3D5F3536F9A7D15 «ПОЧИНКАМИ»
126,702,341 *0CEF82D5E5EF6D6C104AE2A01382AEFCCC0A0A27 5 FUSSBALLFREUNDE
126,702,342 *0CEEE81E1C5D4AA6F7598B4577C7CC1B8C5FA425 5houthoudendst
126,702,343 *0CEE40C986225BDF20F73C7E7DD505149789E8F6 5iamredskins
126,702,344 *0CE7C64836E26B97DDEEC64B71415F074421F0C0 5KNIGHTPAMELA
126,702,345 *0CE28FCC1E7363AC49C73551EBF7C60F2D382E23 ФУКАРМОНТСКОЕМ
126,702,346 *0CE6A85B7A252FE8B99B4B66C20D843D26B8612F харцбург
126,702,347 *0CE2FB3914DF218B141956F608DB0A172A7F21A1 ХІРОАКІ
126,702,348 *0CE8C341664E98425614D506B3B58DADF402A45C шамкир
126,702,349 *0CE51CA52C08F1C777C19F23FADF9517FEE83F8A эксгаустировщик
126,702,350 *0CED4C52E44FE425271132852CFF71F037F567CA электромагнетизм
126,702,351 *0CEE2A6EE7E400722C0A0839746E0723F0C56E97 « RÉCEMMENT »
126,702,352 *0CE114A18E2588233A4AD80AEEC5A91F370D2845 5rembrunies
126,702,353 *0CE43B26F311151B4CA5429922B5B8EEE369EF87 5thatjesus1
126,702,354 *0CE1AF68CF284BD89BBC41DC579DAC9AA6C804B4 桃太郎電鉄シリーズの2pの汽車の色。
126,702,355 *0CED2B48E4E3C4ACBD1D4D4E16D3F0567BEE2ED6 6BIGMACANNE
126,702,356 *0CE4E73A646609B48D68EF85C10A8E9C17DA2842 6BLOUDRUKKE
126,702,357 *0CE8E2C98E9F2439B50505DD63372849F6E30538 6COBRAAPPLE
126,702,358 *0CE2C8B1FD70132D9DE50AC4BAE6EF2477B54F8D 6correggerle
126,702,359 *0CE6E6CBFAB365B2AEDD1D3F9F8D23430E908F98 6ILLUSTRATORI
126,702,360 *0CE8B5C763A4A6A56669484C009710931A48B4B8 0115RY
126,702,361 *0CE5741614FE63A9F9E10A04B883619473A3AAA7 05-21-1136
126,702,362 *0CE0488E135E2FB505A158863B78EA2B710B8777 6pineries
126,702,363 *0CE08C0F25C5F57457AE6B1C09AA03AE7BBFA9E9 6POEDELEN
126,702,364 *0CE20AE0C490785AD4F42483E4FE08A89C39266D 6PULTETH
126,702,365 *0CEE2B7541B1B34872C610023B9876CFE2FB22D2 07181311
126,702,366 *0CEDEB1C484F50065E95C0A5206376F9B04BD372 6SHADOWWINDSURF
126,702,367 *0CEADCF6A1F88728693D05817A16296C6DEC0978 6WILLYCANON
126,702,368 *0CEB2FC64914C0245EB97C0B131C79481C881E58 6YMTENMTNALAGNOAISYALAMGNONALA
126,702,369 *0CEE2F131F78829A066125DCE37E64785A7F296D 101122 lUtfen.formu.doldurup.bize.gOnderiniz..
126,702,370 *0CE290ABFE84B6F17441ECA21009EA1519E27F9A 738keira
126,702,371 *0CE736FE9789DFCB4457F5499F86A903E3DD9923 753010 onlardanfaydalanmakgibibirdUSUnceleriisehiC!
126,702,372 *0CEA8944E951C5D4AF37EB07D3AA3A86CA263325 1078925 JEDER BAUTRAKT ZITIERT DEN STIL EINER ANDEREN EPOCHE
126,702,373 *0CE59694B6A260C02C04468562446BE17ED96ED4 1150105 ARTIKKELIN LOPUSTA L
126,702,374 *0CEDAB81F4A0D4E835DB5A9B91B5E8BC46E7C354 116767 EIN-KUDU-IST-EINE-AFRIKANISCHE-DREHHORNANTILOPE-.
126,702,375 *0CE5ED9010EB16E009847813C4BAB03232DA7F89 7AIRDRYV
126,702,376 *0CE90244714B48E11C107001094A81F274AD3924 7ALBILLO
126,702,377 *0CE0170B50921ADF330282C05B07653FBD95A89F 12211696
126,702,378 *0CE7032B735FA63FEA4FA531DA0424FEF79AA50F 7ATAATAYAT
126,702,379 *0CE87A90523A96CD021A018FA849538355E61CFC 12nov1927
126,702,380 *0CEED9D5BCFE798702632CA8BCA03067BA274FAB 12.TATWERKZEUG
126,702,381 *0CE40C60FC125631D703539345C95F7E392100FE 1341635 usa suchen bindung zu mittelasiatischen staaten
126,702,382 *0CE39D4BA7A318DC3C8A7ECE4DF8ACC995F943B9 1509962 wenn.die.boerse.runter.geht.,.ist.das.geld.weg..
126,702,383 *0CE263E1C81085CAD22116445E64A7913BECB3B7 1659574 DIE.OFFERTE.LIEGT.SEIT.DEM.WOCHENENDE.AUF.DEM.TISCH..
126,702,384 *0CEABA5BBD2C18FFC8A45DC8275438E313EF6E2C 16march1726
126,702,385 *0CE8A6BE2052686E5F8FDEB11D347D5D7BD3D640 190128 ARACINIZINTEMINATIENFLASYONAENDEKSLENIR.
126,702,386 *0CE3D5EFA12922A96D36D126A489513344548136 7MERLINNE
126,702,387 *0CE04CCA2B6C8060F91F5B28A38C6B12F609E8BD 7middleness
126,702,388 *0CE485B28706C2F1F1AB8D6099E3A90E4CE29EB9 7NBUILDER
126,702,389 *0CE9BC5D77CEA72CE0FBA197F9DEBDB2B090BD0D 7NEMYRESRUN
126,702,390 *0CE13DA9026D34778148F4D86B5158969AED1596 1.ABSTIEGSMOEGLICHKEITEN
126,702,391 *0CE2AE2305230CD7194DB0CC9FB88DB028ACEA09 1ATINBUSH
126,702,392 *0CECC6AAE621AA2DC5BF4A2A54C055B04CCC47B8 .7.ta..opeD.89/62/8.yksniweL..>a/<..651>"_651_N"=eman.a<>p<
126,702,393 *0CEEFD09EA792ED864149603C65D8E77219A26E5 1BRIMEREN
126,702,394 *0CE29FA362A5A7BB3EA1ED5C1ED3C0E5C647080F 7TRISTANSHOES
126,702,395 *0CE9704A4FD81B60DD90F7559D760D1E36917174 1concripts
126,702,396 *0CE1D9CCE19CEC8289F80E49F0EA8EC7A6660CC8 1DDRKRITISCHEN
126,702,397 *0CEAF7E119C55C6D4C14978588025337A58593D1 807SANIYAH
126,702,398 *0CE4818ED4CEC910B55CFEFF767D904F5A373F34 819204 ABSCHUETTELN WOLLTE ER ES , DAS ALTE LEBEN .
126,702,399 *0CE0ED9448BA8B1C8657FEAAD3870EA34CEC6A38 1emccme1
126,702,400 *0CEDC1E5AEFA77B6916092E322E7B766A0C77342 1-erottautumistekij
126,702,401 *0CEA7BE3B1903C88BD49CAE8C5B5BCE755A01911 875733 yliopistoille-tarjotaan-kuitenkin-mahdollisuus-k
126,702,402 *0CE17264F8F851455C2F96B35F8E2F4D3FA53D0D 1FOOTSFA
126,702,403 *0CEC654F8CFC16E3FB36230C5555F885A5A2CCC6 =8!AAA
126,702,404 *0CE47BBD7FAA4F3E867B21AD13A3697ABA3F5CED 8ABMBGBTB
126,702,405 *0CEB700D6321441602F16C3C877A7D1523F986DE 1-GEW-SCHAETZUNGEN
126,702,406 *0CE7D7AE7484166B4E6DD0A339D44894A2602F2D 8-----b ~ ~ ~ )8(
126,702,407 *0CEA1C7E41C1CBD36D3B2EC92BC331F09D389656 1.internetasetukset
126,702,408 *0CEFAF1C5F4C92A859706E8CA27FA248278485F6 1itselaadittuja
126,702,409 *0CE50212CC1649737D364E6DCA85C74C64F30773 1.KOOTTUAAN
126,702,410 *0CE9A9BFBFE5A747F72E868359D73D037DE5CBC4 1.kuntouttamisessa
126,702,411 *0CE7D9B7F0D1C623F91A38FE2207855608CB0C82 1.LAATUASUNTOJEN
126,702,412 *0CE21E83EB9B8862C4BFD42A5426DE587678924D 8FLORSTEIN
126,702,413 *0CE4D46A7C1E2C545F9F9A251A0F40B1ACAF04EA 8GASTADAS
126,702,414 *0CEDF357D9EC8025E387DD0D261B49857D5BE4F5 8grutterijtje
126,702,415 *0CE27BDF091F68AB04855DABC1D714A48D9DDA3B 1.marafat
126,702,416 *0CE47600B2F7EB8550F0B8399814D8A10F07365E 8KCISSEM
126,702,417 *0CE6C2337195820DD7FF6D2CAC25C59C607EC694 [email protected]@710N
126,702,418 *0CE5D10950CA9C4E781EC90DADB9D7650F505169 [email protected]+OPP!N9
126,702,419 *0CEE467E15E061449C97D904E2D26DD60E7AFCF0 1 NOVELLIERTES
126,702,420 *0CEBCA9AF228E5107D4248CA3749A819B50014A6 1OSS-GEHEIMDIENSTLER
126,702,421 *0CE66BA0E16031DACB9C9ABFAFBAAA08F13B231F 8###>-~o~o(^_~)
126,702,422 *0CEEE73069E1D994F5928032C74D40502130EA53 )8(-O~<----P
126,702,423 *0CEAE9D02F8A209A5113E73CB8A9578A35AD3E51 }8{.~`.~`.(######p
126,702,424 *0CEF62DC6D9C78CAA8AF6AF2005AEE9D1FAD5BA6 1rotgelbschwarz
126,702,425 *0CEFE897C7E63BE5D0BC1D563860BD96F72CC0C6 1schadstoffgefahren
126,702,426 *0CE39E1AE2D9BC850BDD7093E36AA2C349E9F981 8====P**splat!!
126,702,427 *0CEE38BFFC2F695384BC620A950B6EFD44E10754 8SASSYFRIDAY
126,702,428 *0CE72E8357A70B5987BEDD74392A7C83A8431E40 8SCORESQUARE
126,702,429 *0CE1CCD9694681717C1F280B46738BF2EA52D78C 1tourismus-offensive
126,702,430 *0CE2A9F6F559AA23BE2BB19B2363C9ECECDB9F53 8TANNENBAUMBSW
126,702,431 *0CE22D6D8BB91F06AFB962C806DF52AD7FD33DCF 1umbilicus
126,702,432 *0CEF0EEE7D792754422AECEAF302D39B0B8A2334 8TLEETALP
126,702,433 *0CE2FAE240091CFB8BAAA0C7051D32F87A05B48D 1-VARIANT
126,702,434 *0CE7AC403843B7992452AB9F2CC7DBF16DCD4ADB 8UNINDICATIVE
126,702,435 *0CEAC5C1F0C61921A38F9522A0339530C25B4267 8wapacut
126,702,436 *0CEA7C127969DBEDF69E512DC15533726584FE2F 8WHATNOTB
126,702,437 *0CE00C4E9780B5036609FB63D21D199641437F67 1.wintershallfoerderung
126,702,438 *0CE210CAEAA6FC91B9359734FC9E801B36C6204B 2002620 he-joined-the-roper-organization-the-following-year-.
126,702,439 *0CEF06C943FDFA3CF3F0B845894A7C40F80A28C4 2005-06-11:arrowrockfestival,lichtenvoorde,thenetherlands
126,702,440 *0CEDB56EEB171A296A76A79DF557511F675DAC51 20050806: BEND, OR, USA
126,702,441 *0CE34FBA87E8AE15122B68989541207AB445B523 94m7udu956i25o
126,702,442 *0CE379AF8C52BDB0AF52E80DE2D03C58A6991C80 96AYDIN
126,702,443 *0CE7F326AD0F35CE55A7227B9E5EB6F8AC603A76 2268995 VOIT-MY
126,702,444 *0CEAA025658382CC2DBDA4D16B93EB1D0E1942B9 227405 TILAN.HINTA.M
126,702,445 *0CE345B049970D0312375D0DE7734CCFDF95BE5B 2702575 oudran-faces-a-prison-term-of-up-to-ten-years-
126,702,446 *0CE793A36DF3422AC82E801BBAE437603D71535E 2880192 ives.abel.dirigierte.eher.korrekt.als.schwungvoll..
126,702,447 *0CE95FA82AD3E0E4D850BD238E13089A0B9A7EED 2927234 eristfuerdieoperativeentwicklungzustaendig.
126,702,448 *0CEC93A0E9D20E8956F4918C8BA29495E6CCEB53 9MATRIARH
126,702,449 *0CE3AD5B02F640ED9818979F87C96BCB933AA957 9MISHAJARED
126,702,450 *0CEF02F0FC00427F7C13F9D6B4A7192E3D76D65A 2DRAOBPOT
126,702,451 *0CEE70D67DC73F20A4D9058CDDF9EDD47DE93703 2.FAGMANAGEMENT
126,702,452 *0CE3EF9FFC7F5C8B9876AE4996DE87D3E3B5E6B3 9REGGIANE
126,702,453 *0CEC9E043034DB9D6B3B866F8197EA17457B7DD2 9SECTORCOLORCOLORINGCOMBAT
126,702,454 *0CE5D0FEF05A21D37AAFC9308992693CAEFB3A64 2PIENTER
126,702,455 *0CE29486C99316C5CAED7464B16C95D18EF2BB79 a0_h9
126,702,456 *0CE165E0449B84BDFA23DE4B06AA4F98B4808403 2 VARALLAOLOAJAKSI
126,702,457 *0CE7B6A6CF69F39D6461E8C9F2C58E76DC7F295C A3+DL
126,702,458 *0CE50AB29DA01DDD670F69ECA56B18B9E5397B55 [email protected]
126,702,459 *0CE9B4B6AA5E6CED78774FC0551219580F9B8553 371600 ONCEVESONRAYASANANLAR
126,702,460 *0CEF60C58B12446834044699EF3221E4630F3F71 39.zwitter
126,702,461 *0CE7093FC4B6F31C53637A421364EA3234C10BCD 3ADREACH
126,702,462 *0CED44784AA872FA2AAC6C1CEEB5F59C434C2D88 a7_bc
126,702,463 *0CEA3AB55919B7BEB6C7EC1687F41CD215E30A74 a7w9x
126,702,464 *0CED4220AA6A8FBF87A8DD7A298848EAA5224903 A8HP
126,702,465 *0CEC562BB57162A71596E220410DFF569E86C807 a8-rm
126,702,466 *0CE8A1DB1840E755168FD1BB67D4344DC7B86CC4 3b<-.o~o~.d==8
126,702,467 *0CEB3911CC75A21935BC620AE1DCECFC3F5A9BAA 3=====B~O~O(O_-)
126,702,468 *0CE0F225A7BD803FA8ECEF25266F368986C0B6A5 aa"2g
126,702,469 *0CEABA238C3A6014FDD637F4EA8243780E7F8D86 AAA~
126,702,470 *0CE15BCFA1FDAEC52C95A2B11E1D500B43F0F2EC aaa}48
126,702,471 *0CE25783C15844E76F7A551FAEE99C442885B629 aaaqk%
126,702,472 *0CE32CB58991DA3DF6933F3ACE6A93F9E119CC41 3==P~SPLAT!
126,702,473 *0CEC72F2A35896109B91A2B861FAE39FE99CB4D9 AABW$
126,702,474 *0CE1752DF24A149BBE81C6A7B77597A33A3630A5 3SCANMODE
126,702,475 *0CED589EF19F0F71B2981677E8F42FA9D7FEF54B 3ZIMOLOGO
126,702,476 *0CEF4E87721967519CFF2D052E8C6CD5E11F67AF aaeog-
126,702,477 *0CECB2784B87F8BDCA782DA79BCA55979255B031 aaffg
126,702,478 *0CEADE4937F20272A1B4A755E0F768C93D0E4497 aa_g2
126,702,479 *0CE20158B48AC9ECB7CC0E169B51B66EACB33D0A 4CATHERINE9
126,702,480 *0CE05560863B6831FFE7CEE81531A74DC4E956CD AAULF
126,702,481 *0CE20ECE78BF06B03B22A73274C4D79ADCDD55AF "ab"
126,702,482 *0CE6C9FFD94F5BF1C62CAF242DA030CD511B221A 4graycoat
126,702,483 *0CEEFDCE205B77281463CA3C13A43353A55C3AE9 ab$eh
126,702,484 *0CEA9416E38365B645D2943610349EADB3813E5C 4ITMAISIIN
126,702,485 *0CE273E817F82D5168221D870334AEF5EEEE9726 4KNICKSTRUCKS
126,702,486 *0CE05A92F1BB0C2B181020B3634F8D6D6BD91CC0 4 KONSUMGUETERBRANCHE
126,702,487 *0CEAB43D841AA4000B3A97A3C45B5E8AEBC9C608 ABNRGR93
126,702,488 *0CE17BCE70F04E452FAAE238DC8A2BC205E46681 ACCOUNTSCATALOGCHALKCHALK3
126,702,489 *0CE8C86C4E37ABD1469A5B461C0FD47112EF71A3 ACDQL
126,702,490 *0CE06F039F3A504A5FF3E86EDDB8FD9749C88EA2 ACHOLONUS
126,702,491 *0CE8882D112E0E039D234B298061B0FAFFACADDC 4SLEPEHO
126,702,492 *0CEFAD8C671730D224D3080F5730AFE56216A342 ACOLADA5
126,702,493 *0CE9AC9E8589A107C4337EF8BFB9AED7938D10BE acongojara
126,702,494 *0CE91221DE4E2DCF174A29700A3EA124EC611227 [email protected]
126,702,495 *0CE2AC31DAE8E3C7524533BFBA3E03308467413C 4THATROBERT11
126,702,496 *0CE43C90002D50A97859FCDEBF42462AAB1980ED 4THELOISLANE6
126,702,497 *0CEECF9D8DBF1972550101FBA6867B42F518F88D 504braeden
126,702,498 *0CE3EEE44C0373E0F61D3DCBA383B729A409F37C AD3D8
126,702,499 *0CE107C4F1FA5776DD3C1F8CC12ABDF25EB919A7 adalbertodivoll
126,702,500 *0CE47DE91ED0B77B6522BE864259C317FC0A319F 55 INT LIVING ROOM
126,702,501 *0CE5E8B448357D9EAE50A07922691C0A8A3DFB0C 5betraden
126,702,502 *0CE6221490491D4F48C14DFB2618A088E4941366 Adj.-absurd
126,702,503 *0CEFDA684C70C5EC08B201C5D294DB3260AC5367 ADOLPHRIBAUDO
126,702,504 *0CE83B182F2C1F6D508A5E9A269BE0A93CC6FDA8 ADR
126,702,505 *0CEA1F7BC495F4B341DFE26D62AC8D684D6003AA ADRIANRADLOFF
126,702,506 *0CE807A61AFD229A48D211122FCC328957D3E71B ADT"A
126,702,507 *0CE60ADB7988DB13BF1F6C1E2D245718074C1DB8 ad/"u
126,702,508 *0CE893DA66BD161C1A56ABDD28769150ED05F8C7 adu!l
126,702,509 *0CE8B26CE51F730DC1B162670648C2D1E7759185 5EPOCSOREA
126,702,510 *0CE7A9B4EAC3A84E92FF2FFDE125DBA07284BA4A 5-espanjalaisille
126,702,511 *0CE7FCDEF4657A30A8C838E718D77EAA0FA54B93 5fh6kyhbwts
126,702,512 *0CE03FFED7E8303221A67A430DDA8393062EF0C5 AELSHAGIE
126,702,513 *0CEC3E2EBFD5D6C86AC2EF77FEA7B702ED88BDA7 a.f9y
126,702,514 *0CEB548C3647002213EE2738A8FE703EAE74F0B5 5KDANCER
126,702,515 *0CE7B389290B2A39AC282B157DB5D1DEFBE8FEBF 5matelija
126,702,516 *0CE631C05EBE4C01B2C52A3CA2C22B8811B5F2CB AF_T2
126,702,517 *0CE0F3AC704B6B73DA89D1762BD42EBADD05A55B agikisoses
126,702,518 *0CE6C0328C8C7A98D554E23447D1BDF3638AC6E3 a+h"
126,702,519 *0CEFFF92069E07A043C8C0DB13838F89B0B4598C 5WRANGLERFROG
126,702,520 *0CE117F7D1F5DE9BDA97D903A228A86BBC7F2F0A 5ZEREILIC
126,702,521 *0CE12DE786E57DE6C08451207C8CC0FD23B86710 619723 THEARMY'SCHIEFOFSTAFF,ST.GEN.
126,702,522 *0CE192BD7727F74CCEF0BB7976ED02FD0F1CA3FD 6accuser
126,702,523 *0CECB2479AC4DDB9F66FBE109D5EDADF88289052 6CMPRHNSN
126,702,524 *0CE7245CA75BAC48BA73DE647AEB1F5D04774998 6feb1791
126,702,525 *0CE22232CD2566D906FE90F2B31018A66F1A1979 akpuy
126,702,526 *0CE671D674E5F1651CE4AAF6F1F8523B348309F9 alangulam)
126,702,527 *0CE4C3A3AB731855E5EE98887752C778D4FABF04 [email protected]
126,702,528 *0CE66902930A1566B0FA01E5D9D67A24C70AE1BE ALBERTOBOURBONNAIS
126,702,529 *0CEEF8DCEB5ADD2FA275232E5ECFB85E497E2081 6MYOLSEN7
126,702,530 *0CE693AB9E51D738F77E34A45159DC689F892C73 6 n
126,702,531 *0CE9FC2ADA72AA29AC95460FCC92C905EC8C3C55 ALBRECHTSBERGES
126,702,532 *0CE7835A8204A403529E7979DAF7CD011B514A3A 6THEMANREZNOR
126,702,533 *0CEE0F4FF6E0546140BAA4853782EC00B4ECDD6A 6UNASPIRATES
126,702,534 *0CE58FB1A1E1901E8B1C07B50586F9CC3146811F ALIREY
126,702,535 *0CEB9F9504ABC8D3DFFA11DC19EEFA931A71284B AL;KQ
126,702,536 *0CE2150952EA67C5F9C648853BDDA5225C8DC2C0 ALLELOMORPHIC6
126,702,537 *0CE6B5B083C9484D950E15E3436841CE2968E711 7041490
126,702,538 *0CEABC494E25C2AAEE1B4C85E92D0B340CC1F0EB 710595 samaantulokseensaattaatullamy
126,702,539 *0CE1F196ED9496EA98EBE7043CDC4BDE4099F090 720838db7bcc32609216f5f9adcfa7e9
126,702,540 *0CE9091FD9B9B28618A753C841CADD880A5A108A 7240474bc58d43868108e7bbb2f869bf
126,702,541 *0CE98AE41B10846A608D9BAAB3DFE24F973BE266 7AATNEKRA
126,702,542 *0CEAAE7A6FB57A5D7EA3291FFC0469B557D6E755 7AGISTATO
126,702,543 *0CE4ECAB505A5900D010843D8399E8E0913CB4B0 altja
126,702,544 *0CECED653C8A145BE4FC5A22303B96D2400CC9C1 7BSWADULTNET
126,702,545 *0CE78775F442E230E2CD8136F653E5B5C5A4EFCA alvarosallie
126,702,546 *0CEAA33AB520E8EE89BCB57228AC48BB7BC14007 7corpses
126,702,547 *0CE95846A25F51FAFE7A68588E178457C58BB72C 7COUNTERCIFER
126,702,548 *0CE2E05A5B514D1A676B486E3F060EC663341B7D a%m3
126,702,549 *0CE4A6BD220F042BD68DC8397EB3A77669CB0419 7-DODGER-ANGEL
126,702,550 *0CE2A416AF948321527DEA50AC733FC41A814A6D AMELIEMARCOUX
126,702,551 *0CE21631B9F92765167725ABA7D06A3142CD7743 amenaed
126,702,552 *0CE632C98B24A1F7DF4ECD4D2AB3C8813039C8EF A%MF3
126,702,553 *0CED6F3CA37A85F8EFD98A9A8636A429839534CD A/MJB
126,702,554 *0CEA84E1F84C6E8F1DC4BB70D98E8472A5F9369D 7OBHUT
126,702,555 *0CEA4A96F9CF701A34BFCE59CBEFD45EB7D0D82C ANDREASMEZZINNI
126,702,556 *0CE7B0EF88C2B89236412F1A10ECFE63AA477BEA andreaszerkle
126,702,557 *0CE8C70D1E0945FF5E00E319551B273655F17C4B 7SAILOROLI
126,702,558 *0CE0F12419764FE5B9777E6F4D37C0853AD53AB7 ANDREW-DIETERLE
126,702,559 *0CE68391926A8B146146CCF37A6C5689E43C99C0 andrew.macmaster
126,702,560 *0CEC741EAD685A859D311A827CC7A8C34A09D3B7 andydushkin
126,702,561 *0CE685FE8DE00833E1B10BA79DF187E5658B1EFB ANDY.VINTER
126,702,562 *0CE3A865DA3D380D501F3993CC29126E38B37E5A AN.KW
126,702,563 *0CE8C4CF9E5ECA37D49F24373B15B489153CCAEB ANMUMS26
126,702,564 *0CE3CC69DFADA904B4D543590FAA84452E7A8285 853857 derssInavlarIvedeGerlendirmemadde7
126,702,565 *0CE06C989EA9D09908C0AB8622F40A12C638A067 @[email protected]+3D
126,702,566 *0CE8E01671F2F846FBAF07108FD02E9571CEE92B anthony.canzoneri
126,702,567 *0CE3C693B73854F0003E4C9A2EC45BC7DD94A89A ANTIONEANDRUSZKIEWIC
126,702,568 *0CE6F0E57C5E5362A12B2B79AD7433E355F9E1FA antonethundercloud
126,702,569 *0CED3403EE58A3A96898D7A2EE49F57489EC2B70 ANTOY123
126,702,570 *0CE6050576489392A8B0A0FE5C2EF612D7E83E92 ap]
126,702,571 *0CE53F08AC011BEF03AE3521E9641DC66D39336D 8IAMRENE9
126,702,572 *0CE4F1F1BD931AE722DD7E3E32AF367D5A5A4244 8iamricardo6
126,702,573 *0CE58262A4B50D607BD24281F1034DC2F2BAACD0 APOTASZ
126,702,574 *0CEB3456A55E5F10AF50CA3434254CCB795A37A2 A/PRC
126,702,575 *0CE48914ED51DF57149E120EFA1C599CD2CC3D45 [email protected]
126,702,576 *0CE85D7A5D265F3C1358D66D22D28B0179541940 aq:78
126,702,577 *0CE3516F1B2B0D4D4139E93E9212025FC4A5A97C [email protected]
126,702,578 *0CEA0DF60F875EB6DF338CCB2EFCD2D535E48420 ARBOUZIER
126,702,579 *0CE75909A9E3BA6D8A1B5B02802AAA0209E6BED4 ARD7N
126,702,580 *0CEEA093A5BF3888D946F83123CBEA4CE4DA1EBA ARELI624
126,702,581 *0CECDFDD46258180ECB41133B38FA093A81BFDE8 8>.`.splat!
126,702,582 *0CE84196FD203BE68F987D0F0C28C81AD456FB47 8SUNNYHAMMER
126,702,583 *0CEA0A67879CC792E8435847DBB1C70D037072F6 ARIF.SANUSI
126,702,584 *0CEB3496CF3A01E875AFC250F7F968AF3148B4C8 961104 taipui-viim-.-kaarteessa-porukan-h
126,702,585 *0CEAAC021F3617B2CD50B39A523F6C44C8354B5A 970657 THELOADFACTORFELLTO521%FROM556%
126,702,586 *0CEF911BC4E6F035AAAC13F06B8942F57CE101B6 arrw6
126,702,587 *0CEDA90FA1A3931644C8BDDD4E09905095170CD4 arthropedic
126,702,588 *0CEC27ED04AC45FF4CDE0F3E11435BEC62500EB4 asacondino
126,702,589 *0CE3BC8B3AADEE32C48743E8D8C595EE22D464C1 ASAKARP2
126,702,590 *0CE7CAC6C64D202B43553E0BC73310A37DDD8101 asalamarche
126,702,591 *0CE9F113E640C8AF4CCB66BD7B70995CD3E93BC2 ASAPHICED
126,702,592 *0CEAED2EB1B9FEFB3B4F559B29EAF93155B5FA1F 9CEDERWILDE
126,702,593 *0CEB5EA4C4A9310337440097227F4EF429EBC96D 9CONSERVASTI
126,702,594 *0CEA02EADF38595F24F0B47628026EDDAC8E93C3 9downwash
126,702,595 *0CE13A8008F346BEC22714CB5BF2B2268FDE07DD ASHWOMAN7
126,702,596 *0CE8692DCF6229E874BEE9FA0CD2F20307D39813 [email protected]
126,702,597 *0CECA01BB4FCBE2225A80ED0864A456FF6A24EBE at2fz
126,702,598 *0CEAFF2457014F3A5D360243F3E9618BB09AA1B0 9MATUSALEMME
126,702,599 *0CE4E2BBA8F679C8055AA9F37555DB836A443A9F -at-his-penthouse-suite)
126,702,600 *0CED715A23CD3BAC43C8B59FCE4E3301F4C1D3E5 9OOZIOLEA
126,702,601 *0CE5F05584C92C34E2D3821467E990D4BCC9E54C ats88
126,702,602 *0CE763AB6B9D7A9DE642B229FC24BC1CBAC46563 ATTLEREI6
126,702,603 *0CED3A08E4C57D3E394EA1CCBC4F753391ACDC19 audition「vsオーディション2003」結果発表![ゲートシティ大崎]
126,702,604 *0CE6B021C21D5883AA8324AF282A4CA256714A93 „AUFPREISVERMARKTUNG“
126,702,605 *0CEADD14B1AD4AD5BDEC30409644520956AC17F0 aug2304
126,702,606 *0CEFAD741D8F5DF93C748DFB279CE1E3C8A1CB75 AUGUSTSEP
126,702,607 *0CEBF83D92A772DB0566C5EEAA5E68085E25A1CE [email protected]
126,702,608 *0CE546ACE4E1B80680C9D540F17DDC25752C49A4 a0?m
126,702,609 *0CE8DB64D4C89F4E075AEE084135A5519D848F79 A0RM-
126,702,610 *0CE194AE8C0A1CB93C4E296B4FCC373A278D134E AVRIL-ROX
126,702,611 *0CEF8CF6BDEA8B4AE244687590628F90C182911B a2w%b
126,702,612 *0CE21AA5B80DDADA29A34A3ED38A299A22A2B388 a4prf
126,702,613 *0CE94C113AE9ED7A30E1C0A9C56F74309314AA64 a4tdg
126,702,614 *0CEBD3CE8024B8D41B84ED615040A908D9E86109 ax"?u
126,702,615 *0CE73A07AA9AD34C688EA0A1151AEF6128113D6B }A7AAA
126,702,616 *0CEE64482358930BFC5E67EEB71B82984C265EA1 a%7f
126,702,617 *0CE73075352E6D9B355A67CD2754329B592A963D A_ZCQ
126,702,618 *0CEAE04FD5AF63A387E0C1B2B7991B25BB0C7F78 AA*<_
126,702,619 *0CE840918E23703E1361177687ABC6750EAC93AC AAA~
126,702,620 *0CE15BCFA1FDAEC52C95A2B11E1D500B43F0F2EC b45h,
126,702,621 *0CEB06DD1CA05BF0881E9AF6D28E15D328429BDF B5GSC
126,702,622 *0CEEBCC555D14A4EA32A5312D5FDF72D4800C91F aabz[c
126,702,623 *0CEDA3EA06709BC046113A16A69192DBD67F8797 AACD;.
126,702,624 *0CEA3EAD9D08E87282D024D92ADF90E9918F44DB AACE07
126,702,625 *0CEC63FB949F187757B04E760ECE80F4770B6002 AACL#*
126,702,626 *0CE98C9CACC49719335E18FD0122779FF0F7CF70 B&7OV
126,702,627 *0CE33113849D913EDF003F0B155741F9E4FC6721 b?9p+
126,702,628 *0CE6E27234C5DFDB959F0160D15DBF64FC86F1D0 aae}rf
126,702,629 *0CE0853F7429DC6AA6C5BC77F7154E3328DFAD3A [email protected]
126,702,630 *0CEF3DD7C53533116B55B242156A442E2E76F3E7 back.home.(live)
126,702,631 *0CE63FA2E7FFFB121AE3860A2DBBD69E3BDEDD6F AANHANGIGMAKING123
126,702,632 *0CE732E60A032FBB0FB25913292AC594D2898743 aanvijlen7
126,702,633 *0CE1176761E303E3216919FAA8628A46FDA9AEE5 BajY
126,702,634 *0CEC54921B39A4279405B84A3FEC882A9B7E0BFB BALSAMIZASTE1
126,702,635 *0CE8F997A79CE059A9CD01BA61460AB0BD33A559 BARBAREUX
126,702,636 *0CE47F429161F142A4BA7BB064583949A4F9AB0F BARBEQUESING
126,702,637 *0CE2525F0A8B3A6EC2174A152BF45A06B57A9428 ABBG&
126,702,638 *0CEDFD59DE58C665F50EA4DC33B8A1547A8C30F4 bar;m
126,702,639 *0CEFBBFC2CB955231E513F8FB388B4917668C2C0 barneyknights
126,702,640 *0CE6CBBDB8A9620A0A433F82B9501948B0E22572 ABDUCKBBS
126,702,641 *0CE127DBCBCECAE873771DDAAC800FA29999EBBC ABILEREN5
126,702,642 *0CEEABA1F3FFF0F44A905E189A6FAB7579BF9AAB BAVANTS7
126,702,643 *0CEB33BEA8483145532C31E9F899E011CBDDB102 BB.8
126,702,644 *0CEDAA67B140B31032ABE264A655A41DC71270CB bb_$f
126,702,645 *0CE940E4EF9308F42DF8E11DEA6518955ADC924E ABRRT
126,702,646 *0CE61DDDF5353424105F4279BCA747B9D6F1D193 b#ca
126,702,647 *0CE2BE66A426BAAF7C3934840ABDD3B400D73ED8 bch-)
126,702,648 *0CEDAA9DD85BE931214015C7BC02387BBAE2AB51 accordeerde1
126,702,649 *0CE30AFC5EE86B7582197B1A6C509DAE83E5FFC3 bduik
126,702,650 *0CEBCA2722025E07FDEEFA19F4DF11F3219C69FC Beati.hispani,.quibus.vivere.bibere.est
126,702,651 *0CE53D44198E33EB4EC8047F2034CDA9606FBF60 becvw
126,702,652 *0CEE8EC466E05559AFCD3095C02A88331089C306 bekah-williams
126,702,653 *0CE1F6B481AAF8C59D2EE19B70045436738DB015 BELIEVINGTHETV
126,702,654 *0CE0F624200DC50FF8977A9CE513CFDA3825B960 BENHBAATAR
126,702,655 *0CE86F96690F68C82D17639EDD2AFD87AB7F8E1A a:czr
126,702,656 *0CE0CB611DD22DEAB09B80CC69567F45DD992B09 BENNY.BELKO
126,702,657 *0CEECBA7D612BECAEFC2359E00CF796E943DDBE1 BENNY LUM
126,702,658 *0CE22A19B7167C0F4C71BE9EE719CF4361453B5E BERLIN - EINE ARBEITERSTADT
126,702,659 *0CE9E55546A0925ABE2331C3D445E6ED2A61F380 adattasse
126,702,660 *0CECF0F35453E753D755E5B2E5E4C0B7DF75863A BERT.FADLEY
126,702,661 *0CE407595128BAED227E89877F2176A7B29E5FE2 [email protected]
126,702,662 *0CE90A56202511B75544AD6888657F9446BE1E8B BETTYJPERRY
126,702,663 *0CE642BF57D86364C23A251C5CA87CAEB61156A0 BF03037041
126,702,664 *0CE0FC8584C760EE3D89BCF4B00D9E2CBE3AB043 [email protected]
126,702,665 *0CE95DE8E9F42421251C0C9A3AD83FBC397F17B6 BF?G
126,702,666 *0CE86BF6B8CE6D07602B66EC2E491B697F1B2B77 BF%Q
126,702,667 *0CE39C1DE640B3256B241BF5F48694B9EACC5024 bfte2
126,702,668 *0CEE1DFE8A559D3B3C4000ACB950F9A17F36CA34 adj9
126,702,669 *0CECBF41EE06960F92A44FABFE417D989BEFA16E B(g0
126,702,670 *0CE55243976B827F6930D2F529A812AEB173F454 bg26f
126,702,671 *0CE7870933211152453FB93ECE524AF29EC6B588 bgk#n
126,702,672 *0CEE8A0E07420220A271E3AB176D22B59CB64469 b,g"r
126,702,673 *0CEF5CE152C99BB1DBF7086D5BCF9B56D45F42A5 bhn&
126,702,674 *0CE89AEF36E0AF90D4761E7B38E05AA6FA7B711C bh!%p
126,702,675 *0CE459CB7549EE4FCE10ACAB79FC5E57E8EA8277 adwr)
126,702,676 *0CE74B51213911FB00E8EFD05CCA1A69C73E343D AE0GX
126,702,677 *0CEA826C9924C1A03C819F09FE1B90A523F052CF BIBTEX2WORD2007BIBLIOGRAPHYCONVERTER
126,702,678 *0CE55C537510407CBA31198466FF310E81C05818 BICRW
126,702,679 *0CE0EA4D0E550115F78B5C3758D9E2CA6ACF8E61 AFAZOVY
126,702,680 *0CE288368775F4D574A050B6D70973EAEB272F12 BIRTH.CELTICGREEN
126,702,681 *0CE50F4488272B8597AD8763E58B5E04DEF4CF73 BIUHS1
126,702,682 *0CE184BF2527F5199804C438CFA95DF951483EEB BKb
126,702,683 *0CE7DC1080CC04F281FB73351C165B9AFD41288E AGN&W
126,702,684 *0CE5B63D5DA576FFDD157754C568D1335CB03A5C [email protected]
126,702,685 *0CE5BE42F0A318263136E6ACD490EC79A8AA1EEF a+h"
126,702,686 *0CEFFF92069E07A043C8C0DB13838F89B0B4598C AH4??
126,702,687 *0CEE40C59C0F4E7537AB23ECA668E207221DD00A bleeder5
126,702,688 *0CE99AF490B706B38B81ACF4AD72931980C66D38 blepharospath?
126,702,689 *0CE2AB87330B8959D474259BA8A8E8D76793DC24 ahnawake4
126,702,690 *0CEE5F83F5904A30897B7B64106AD52CC06F283A ahoguio7
126,702,691 *0CE653E0EA5CDAA2283BC369AF4673476AA22F9D [email protected]
126,702,692 *0CE58B846D681A1BE7A8152E64B37782202178DF bl!pq
126,702,693 *0CEA48FA682580FF11102C0132C55997D5AB182E [email protected]
126,702,694 *0CEBCE22E1D2CDACCD279017222AF430A60BB501 BM:JD
126,702,695 *0CE607FB8AC9FC45589724D5AE8B90C553B33E2D AJ.=#
126,702,696 *0CEBA6C14B42E2F3F03B25E5104C56940CACF4BD bnah.
126,702,697 *0CEDE54C202BB930671D899213AB44842CDD2480 Bno7
126,702,698 *0CEE4E11BEFFA8227B748F1F9B431944358726A3 AKBMS
126,702,699 *0CE73385B6ACEABC8ADADEA205086EAD6B1BD2B6 bnve7
126,702,700 *0CE855D6114A633E7D6772927A56DC9E4E005D2A AKELS
126,702,701 *0CED46E79AE7E98424B0DCEDC9F4449E6D4EDE42 B$O,
126,702,702 *0CE5640F359866956D19827DE6719C5BD5522C74 akjfo
126,702,703 *0CE7286BD2610C1F98A849360372BAB328377DCD a=kq7
126,702,704 *0CEDF1D24E6E03D635A1227F8AEB3DB2BDD4E61C ak+vp
126,702,705 *0CEE34D768633093FFCDB84E53135853E008589D AKW4F
126,702,706 *0CEC57AD59C4B88E082885178F9AEDF0EC86011C BORUGO
126,702,707 *0CE7D8E4B747A7970997FE795E9164080B913619 ALDO.HUNTZINGER
126,702,708 *0CEA52B79C59960CE87AB2F811BF320AD96030D4 B##)~O splat
126,702,709 *0CE2467E000EC08290F8300FB964B1B98012D40B bourgeonal
126,702,710 *0CED1910057DA83E430DF731E8E88D1FD678122F aleksandarvujisic
126,702,711 *0CE55E5591B50A25506BDCA2892B2DC3A8465E02 ALENTAVI6
126,702,712 *0CEA1C3A7F3B5A87E5EBAF66075E691907CB980D B-----p-*-*-*-~0~osplat
126,702,713 *0CE661DAAEC24F7784AD2E0478D2F366C683FAEF BP86
126,702,714 *0CE4A658B45250B9A192BF9991E91A17EAC70BBA ALFONZOMCALPINE
126,702,715 *0CE9A5010A2029B183F070560687773FD198A22C BPI!Y
126,702,716 *0CE278CB9C589C351C2CE4ABC556CE41709675CE [email protected]
126,702,717 *0CE73D4D0678C14BAACB38BB1B92DEF9B1F23F5D bpmm1
126,702,718 *0CE2E8AC2EC677CEDCD498CE7FC3D33C1CFCBD70 al-g!
126,702,719 *0CEF0D6FE0EBD6C2099AD61F6562D27D95486948 BQ-AW
126,702,720 *0CEC8413A62A5365C6C86CAE19DCFE3775DF924B bqbw
126,702,721 *0CE6B061807B7173324DB9FE6F6416EDF9E8AED5 ALKS(
126,702,722 *0CEB45FD6E07ED3949BED342A1C8ABB6A9EFEBE4 bq(y
126,702,723 *0CEC2373031BB2AE599E20D9E36F875BCE000674 allypap81
126,702,724 *0CE122E3CC7EDC2B6E5E1E892B5BDBD3D4D2F55A ALMDI
126,702,725 *0CEA808C4DD45952E3ECB254A9A6C260080201BE BRAGĘ
126,702,726 *0CE8C4E78EC31DEDB92486B92456A03E5FFD7093 BRANDENMARCHIONNI
126,702,727 *0CEF6101DC8EC3F8EBE0CD11DAB0624BEE99EE4D ALTT:
126,702,728 *0CE5D1790BE54A3E2EB71B95BD9D0C3017FEF674 BRANDON-POLICASTRO
126,702,729 *0CEF40881F28CF28B7CF84D86426730003C707BF ALVA.MAUK
126,702,730 *0CE5962CE03EB4C5723AAC7C8DF544102938B54A BRENT.JEANSONNE
126,702,731 *0CE335B1CCEE46B6CFDD248FF49458E2161E3452 BRENTONFATIGATE
126,702,732 *0CE622086E29006B78DF90B6748383226B2A98EC BRET.GETCHIUS
126,702,733 *0CE8C0F2656FCF18E1AE7CEB3666550D2855AFD7 BRHE#
126,702,734 *0CE6FAE197C244651B4E3021E1C5374F19A34172 BRL;O
126,702,735 *0CEC697B69272F9952296017D9D4ED795A114B60 A/N=%
126,702,736 *0CEF982A3E2CCFCC146E823BF36C4F04C7B27DD0 BRYAN WHITLEY
126,702,737 *0CE22115C92D2BA12ED95930197D519D51E68B70 ANDREAS.PELLET
126,702,738 *0CE5EB5EAAF835156E934BF379C34B62E47FFEE9 bsx-x
126,702,739 *0CEA4F2E4F58F8F3AB303D0201CD889AC9D3B49E anionisches
126,702,740 *0CE61331F02F9B8427E0984874967160FD2D6F18 ANNATAAN
126,702,741 *0CE6486EAF0F3404D702398E87EE4861A9A7B9D5 anointers
126,702,742 *0CE893BBC23C26F93381CB81416F5BA7E8EBC374 buqnd
126,702,743 *0CEF092ECE90A1D73BD40D61FA6E9BBB860B02F2 antionenocon
126,702,744 *0CE8956D6169AB4E1A8BC931249E26E1D0A5C35F BU-T8
126,702,745 *0CEEE087F45DE836C49D61D0989AD1AFC09DAA4C butch.schlup
126,702,746 *0CE2DD8532616289622614FF8CB517AAC295A3EB antonehittner
126,702,747 *0CED619784CEC91CA7450CFD2CF15B792AE67179 BUZLOW
126,702,748 *0CE29FA22F90D084C99B51CB19302FEF03F54062 [email protected]
126,702,749 *0CE27176DB004F704A46EF402905E947BFDCA79B BVT4I
126,702,750 *0CE640353BD9F32627E049FB075C14D2307F05C5 AO)AX
126,702,751 *0CE3CC170B9F626AC94F84BFAB5F3B12E2BA5E42 BWQEW
126,702,752 *0CE1C83A60D8F1F59EE34E57ED0E6086EB93E0DA BX8V
126,702,753 *0CEEFC311B7300A38330D48B75CD8B67EA38AD68 BXN=_
126,702,754 *0CEB4770E7CBBF08ED5139A3F6608E916E1CB5E3 bycgo
126,702,755 *0CEAB209255714E2FD88F19077A1119BD6571B40 BYVV:
126,702,756 *0CEEDA2D56C0B980E6595E8398618C80B03E2CC5 applesonastick
126,702,757 *0CEDDEEFB1A46D2E3898B4E71927C9F53366B54D bz8tr
126,702,758 *0CE1C7E0F6B556F7369B4E4CAAE62C311EA10F3E BZHO
126,702,759 *0CE013FBA7B96117207F56CC4C82F5BE8B940CAF aq!f)
126,702,760 *0CEA2765DE35F4D6DED139C4E2F3479E967E88BA ar1-c
126,702,761 *0CEF1ECFAEC32F5CBB6F27DF874F9682D41C2130 arbeitsa9
126,702,762 *0CEA86D8FB343695AB8036699FC7635EC7877BA2 c(2g
126,702,763 *0CE707B9186BE3C3F6ED9C92569906DD8C17F06E ARINTYO
126,702,764 *0CECB040A9517EF6D43C9948DB1132A65BB11365 arirvuoed
126,702,765 *0CEFBD0752F4F5CDCCC1979159E60E48FE4C9859 a(r!k
126,702,766 *0CE3D06A50EC3FDE4248988C1C99654AAC5DFC76 [email protected]
126,702,767 *0CE4B44A9134005FFC4487B54314E80446AAD484 c7it9
126,702,768 *0CE258AA7FD6D0E3DB533401ED14F943B5FE9B69 arquitecturadelbrasil
126,702,769 *0CE6115FE12D32EC949476E63E59496D9CF1E09C [email protected]
126,702,770 *0CE01D8798C0286A40F96E3F84D1EF1AB5C43BE5 [email protected]
126,702,771 *0CE44AA9B06DB5348D191E98F79BA0B079DB363D C8FR1
126,702,772 *0CE345E9F043DCDF62E03D12618BD09E0980D900 ARTICLE5937995
126,702,773 *0CEB16635C4B617035204C9FE7F00A5E93B6FD53 C8NXL
126,702,774 *0CE41218036D45992EBF300D5F1CF27B00C9D241 ASA.KIRSCHENMAN
126,702,775 *0CE034B5A67A40E36A3CCDB3997D5394ABE6ECBF AS CHINAS
126,702,776 *0CE40D7A21F5D118A83F7688FFD257AA8FF74025 [email protected]
126,702,777 *0CEC9E086044AAB3A5B57C76633CCB0997D0B9CB as?o/
126,702,778 *0CE3D896EA25E255C3EACE4F88C8C1E448C404AE camden-poole
126,702,779 *0CE3132663F2C083CB5A41BDA6201F205564C4C3 aspud
126,702,780 *0CE81D676B632919FF2ECDF9DDDD3E337B6EFDFD A,SSF
126,702,781 *0CEAE277B08B0AE857ECE66B1DE8E695FE6DAE11 CAR0U$31$
126,702,782 *0CE36345CF67429FF16DF8F097736E62B3F1B977 CARALANDRY
126,702,783 *0CE760B73A4290C6142F090AE7BF87581BAC31BF ATF;Y
126,702,784 *0CE8D554AFD34440339330F42D41C5A70BEAEC05 CARING
126,702,785 *0CE7942085A74204212AB3B53053066995E6D7BF CARING-FOR-PEOPLE-WITH-CHRONIC-CONDITIONS-A-HEALTH-SYSTEM-PERSPECTIVE
126,702,786 *0CE69F517FE940810922B58BACEDA86BA892061F carnesha-powell
126,702,787 *0CECDEDE1D016DDE0F4D4F4F749B8C60FB149697 carochars
126,702,788 *0CEBFDBEB9105CD85BBDF1EFACC59AC8C090D2DE A=U5=
126,702,789 *0CE5B6A74AFA5014CA540302901D359E459BC31C au,d7
126,702,790 *0CEBAE96D63F3D46FE7018CA88F08D5C0844450C AUDITORS-NAVY
126,702,791 *0CEDB2583515851BED2C09A25948D08D58BC34A4 CASEY.PECHAR
126,702,792 *0CE973AC1194AFCDAC444BFFE477CBCB46361F1F (castroism)
126,702,793 *0CE88BB7DEFC711363C18C8A2B8680F9CEE8DF3E CAT3G0R1Z3R$
126,702,794 *0CEBEE7C8F013F8F14A8AC45AE032DCCAEB511F5 AUSHEBE6
126,702,795 *0CE3BE74AC4E82DD25639E1A82D54AFF9C419A95 CAUQ9
126,702,796 *0CE3AF4BB6484861E1BAC5B4670E60F50E55DF18 cbans
126,702,797 *0CEE8C6660BBA7814B71259CEF7F46B7DD614B00 AV;%,
126,702,798 *0CE6B3A361BADDED09D94AFBE7A951580EC8433B AVELINO-CA
126,702,799 *0CEA92CDEEF02B45EC93533F25590B88D4158AEF average-length
126,702,800 *0CE0DE1CB5BC4AD96747BBAE11DCA207592C11E3 CCANDACE6
126,702,801 *0CEB7E4E0BC9BE47219634AEC5DEFF0B1F351576 C:CLU
126,702,802 *0CE94D3894078F25A7811A292204AF4AC5BCCDD4 AvN,
126,702,803 *0CE513F7E9F61A0F3DFF031813CB67D7DEA1D84C Cc,v
126,702,804 *0CEC0A71A3006A648D7B4D3697F2EF7F2ADF7603 cd7vj
126,702,805 *0CE8C3AA611D36729AD59C959F87A59950256B8F aw3)l
126,702,806 *0CE667639F9B5F5C13C7E65C3FCDE68B5E0F71FB CD%G5
126,702,807 *0CE8EA8A7FF1DB641098A40C2ADBD6549339CDD7 awc1q
126,702,808 *0CE807CB32FB657873A70152D1E94D7E8D8DFA10 AWNZ?
126,702,809 *0CE9FFA5D3C1CA6E7F11AAC3B588E62B32FBDC0E AXA5K
126,702,810 *0CECDD19FD554E6A530677BF5CEC2EC2A1369CA7 AXRN_
126,702,811 *0CE77531DEC325758061B03B5D75AEBF3CF0DC89 aye.friend
126,702,812 *0CE813CD7EAD2E7DE88690D3D9838B21D82FC57F CENPLUS8
126,702,813 *0CEA3B649835CAB07E36E1A71E4A009A56361A1C C'est-la-guinguette
126,702,814 *0CEA3EB62AF4B3F17B8622D0850130CAA1DABEA1 CFCA6C95164EE0A3321F715665D8A8AC TOMBRADY12
126,702,815 *0CED01DAC9ACEB39CF4395A535C36FFC564E9BFA cfqa3
126,702,816 *0CE0A5303574FF91393911F48AA7B5A476277664 C#G
126,702,817 *0CEE51904FFC7FDEAC994F4B1237311C16AE41FD c;g/1
126,702,818 *0CE6E69264EFA1D837B2C3BD427FA7DF4BE66009 cg5
126,702,819 *0CE3AE865791C68A124CCC7A11D1AB6915CCC20A b;1h6
126,702,820 *0CE4578CE8BC84450E7D8C496A8E4A877BF8F2FB b2pmx
126,702,821 *0CE30BC5E8A297B639B839FED805A9F48800A49E b4g?w
126,702,822 *0CEA4E4D74DF5B50C62A58A036260B6FE8ECCA8F CHANCE.GARDINO
126,702,823 *0CE2E2CF1EA305515F8F46A385F235F276858988 b6csl
126,702,824 *0CEED064E74B25FADB254ED8A8FCEEA7BE031083 CHARISSA
126,702,825 *0CEA55CFE8A577AE60F49DA3F08AA8AB03B7CB0B charleyholom
126,702,826 *0CE0460E6D37BABC94A3581F1EAAAB4C39670E7B CHARLIEKUNSTLINGER
126,702,827 *0CE5E40A810EAF8784CFD6E1AC055D51F734B9C7 ba-?1
126,702,828 *0CE0E93559E884983CD9501A06078C2C21637F02 BA270C4A.1
126,702,829 *0CE8D79D707A0A571F158224B392FA77EF6585E6 [email protected]
126,702,830 *0CEFD8E05C42F7AE623F9286AFE109A38B33618D [email protected]
126,702,831 *0CE6075D360136A207579AB8714774BFBE7BDEF6 CHENNASRINIVAS
126,702,832 *0CECEFCEE905F69F94F078CEC47256CC5C06D826 balerny
126,702,833 *0CEB9B3092B69908777C326CC84DAFC823974BDD BALIGON
126,702,834 *0CE48506ECCF4794939E0F997BC6D500038CC01A BALMAT和5名向导
126,702,835 *0CE0FE198D44A12EFBC8826A1E42BF2A11BB9F0B banilie5
126,702,836 *0CE4CF358CFFF260EF262CE760653167D86A0BA9 CHOHONG8
126,702,837 *0CEA8EA99B003764EFFB0D5D5CB9A7FA92F6E2F5 chorisque4
126,702,838 *0CE0CC262569AAB630B497E08CB12E97CB708B7C chorwacjas
126,702,839 *0CE0BCBC6415440DEBDF5544C39D5F815F736135 CHRIS.EMFINGER
126,702,840 *0CECAD911E4AAC3E5854513202BA680913FA0691 BAZLESUG
126,702,841 *0CE188F88A241680A1ECCA0CD71E1229C6B395C3 chrpq
126,702,842 *0CE414735318163ED78A21FA1CE1F89F8CC4EA39 BB.LL
126,702,843 *0CEFD1D649C8C78F541160ABDDA478AF6A5E9F5D [email protected]
126,702,844 *0CE4453A7BE6FD52990B4DAD15E98074F6C31BF7 B+B#T
126,702,845 *0CE8814CA476485712E64DD6ED198BF2ECB9BD1F bbuen
126,702,846 *0CE99E9726664299F756047C7353E4F1E1288922 BCHOAS
126,702,847 *0CE2B2FA7D5778B551FBED9449BB958E18B83B39 BC;T_
126,702,848 *0CE4AFA61D970A5DD3B2426497C5651165FD8211 c_ine
126,702,849 *0CE7C5FC6A8B154F25EE07DA15299887634D612E BDD4U
126,702,850 *0CEDC3852D4C39A34F192C223BBF44AE78BEF509 cj=?q
126,702,851 *0CEC836D298958B633ECBA4D18CEB2946D511B8D BDVN9
126,702,852 *0CEE931FC1B6FA1DA7C89E0851814611A9861BEA c)k.f
126,702,853 *0CEDC8BD758066CD8177AB1813954DF502DFDD6B CK!F)
126,702,854 *0CE79419003FDA9B384C43B813526964AACE39D2 CKT7Z
126,702,855 *0CE00D815910CDC486C22842944996C5E8AEFBDF CKV:R
126,702,856 *0CEB19E834A8E8B7C7FBB79C63DD051837EF0C1E BECKYDENYER
126,702,857 *0CE717DB6A84E0875FB841591AA9BCABD4CAADCA CL$)
126,702,858 *0CE98897CD91BBF80EA0D137B29F63676657A1B3 BEJAHTEN7
126,702,859 *0CE5B38E427A3520656948A52158D347CDB59A52 claudiojaved
126,702,860 *0CEC0918753C53A33500959BB52B82E9B9DF906A BENITO.TOMKA
126,702,861 *0CE0B3A74698251B164BBDAD471D12E376ABFE9D benjaminrowntree
126,702,862 *0CE51D49A3A05C7A38D1131DB9B7042B940A2860 cliffordpickette
126,702,863 *0CE8F9380B0AF2AE5F21F901A65D34D9F64EEC34 CLNCPHLY0
126,702,864 *0CEEEC87CB101F60A7C641D6B567267AAF1925C8 cl/(o
126,702,865 *0CE9E5F298BCA04755DD981DF324897010BDC8DE CLOCLO2222
126,702,866 *0CE4DA8E93DB4AFE22739D5C74B47011138F4169 [email protected]
126,702,867 *0CEBDAA8C8C6614BAE9FB0E7D88E9CB8D0DE3CD3 BERTRAMSEILER
126,702,868 *0CE3571CBD21566D76ACEB0E02AA98013AD7C2AE BESCOUR0
126,702,869 *0CE3F030B9ED56EE1C493A827E3EC2C72901F94C CLYDE.BERENTZ
126,702,870 *0CE1B1D06FA9C0C4757DD02BE36B91EB88C6EA2E B$ESU
126,702,871 *0CEE171C0DBC3DA4F1BB982BEFE2ADB726C16402 CMF+B
126,702,872 *0CEA3AB5BDF9E2219D6C797838F355A3803DC7CB cmpc=
126,702,873 *0CE2A3800B7B944C0D559AA85A2DCD1E3AC81B01 CNCB
126,702,874 *0CE91ECA643E9742985D389ECE021F95A954113C BF2L&
126,702,875 *0CE3B2C44AE8970AFE3B05D65B9D2E25525EE693 bfafl
126,702,876 *0CE35DEA5521981387E5E6EBFD53ACDD278428CB CNW/X
126,702,877 *0CEE673B543545C4D8DD3E2A45EB315F0AA5480F BG2#F
126,702,878 *0CE1A310A807DC638514D2C13AE113C1624977FA CO2KT
126,702,879 *0CE66AC2C06DDF8DF714051630749B0A396419E3 bghtwk
126,702,880 *0CE8B3A7E2D74DBDF66B3224292D3C712FC0DBCC cog6,
126,702,881 *0CE80BA365DC885F0D2367A42AEF920B23395392 !B,H
126,702,882 *0CE24EFE0FE7AA6E3153329127EFF5B7F311B092 BHTWQ
126,702,883 *0CE34F5DCE2417C9A0AAD7241808A6326E5541DB COLUMBUS.HYSON
126,702,884 *0CE3A34D1164C2E5B0DC012214E9C454EDE48896 BIANCA-RANSOME
126,702,885 *0CE7AC997CC0E6C971DCEEF8EA8BFA5910294B0A comel1e$+
126,702,886 *0CEDEEC93C242ED2823EF2830DB06ABB401AAE59 COME.ON.IN.(STEREO)
126,702,887 *0CE5874C216106F0CD28C6B68210D1CED84B3B77 BIGGER & SASHA
126,702,888 *0CE76F349B24D7C49E81E214F7ED603728A2C115 CONCRETECOTTONFIELDS
126,702,889 *0CE02659AD29444921FD28E3DC401ABAAFDA8BF7 conglomer47es
126,702,890 *0CEDA5EB55E079185C9CA579A5C0F5CAF599FF96 [email protected]
126,702,891 *0CEE3DD0D44B94915F290472F4489CB2889EE738 COPHVEAU
126,702,892 *0CE8DD7175AEF4041341D8CB573F39C2A50738F3 BISRAMIE3
126,702,893 *0CE7750B8E229DC08F714C03F058AA763681DD74 BIV7
126,702,894 *0CECE91B541BA10E7BDC34B0895968F45CFB12B8 bjbsh
126,702,895 *0CE2631DA3EDF7F9867E5AB1AF7E723D7241C94C bjk8%
126,702,896 *0CE5EACB7895C3BC96B58A1B122B344724FD8977 cortezwydra
126,702,897 *0CE8955C29514E90E43E94235B407193A8D9416E BK.
126,702,898 *0CEE99E16C88AAD671CE676E63AA307960E08DC2 cory-stiner
126,702,899 *0CEF294BFBD818D9DFD6686622AFA0B72D5FF392 [email protected]
126,702,900 *0CE6DF10256A571D5A2DC4C8B2A7229F7777EF26 cou%f
126,702,901 *0CEA2E5D4809C555FE5C25964CB9B5667DE0544B bkpb0
126,702,902 *0CE2C724755CA7B3D680E7FD3305E3CF5DA3276F bkv"l
126,702,903 *0CE3230906E93D728AECEA5C01E8BEB7B680D5A8 C:\PROGRAM.FILES\COMMON.FILES\ADOBE\HELP\EN_US\PHOTOSHOP\11.0\WSE5DEE90C5CB34B7C8D7349BC996A4B86A.HTML
126,702,904 *0CE555FDCDD04AB29BF85CE128B666E1A1102AE6 blir
126,702,905 *0CEAE4241674FCAA8167203BD7F8FC815E4E7F58 BLOGREVIEW
126,702,906 *0CE71A52CDD3B5556CCCB01ACFEE905E94C9323B [email protected]
126,702,907 *0CEEB9CEAA4A771BD9E6D19BF9DE3FAB9DC15E0E BLQ)
126,702,908 *0CE3C53C8939D66E083DFFB581A92F00DC1C98D8 [email protected]
126,702,909 *0CEC612C508621CAEC74EE973FD4DDEE2D39CECB CRAJPAULSINGH
126,702,910 *0CE00EAE3EEFB73E08E3D4FA92B0F3F219C2AF71 CRASONS0
126,702,911 *0CE93C0DD92F7A725A5C43EB7767B5DD0BA14850 b$nk4
126,702,912 *0CE767D3CD8E1C4CF68904A5E30ED126AE208BF1 CRISTOBALMONACO
126,702,913 *0CE477A9EB163E3C905F1EB8E6975916E6293D8E CRRSPNDNC7
126,702,914 *0CE5093C1A98D171EB77C2607F63B3D8B983A538 CRUZGRINDEL
126,702,915 *0CEEF7B2BCFA1BC26B3E53F8240E5DF05C663CFB BOAZ-NIV
126,702,916 *0CE2A260AB0037919473029571902FB4867CB162 CSABASIAN
126,702,917 *0CE3B683B3F4395C43F78829394007BC19B42175 CTKQ6
126,702,918 *0CE1C318C34CBA3A3592DDB603D0B2E61B762E91 [email protected]
126,702,919 *0CE9CACC797F460977A44B770FC0BB5AB1A01610 CUDESUNE
126,702,920 *0CEA0DECF5FEE03A3F326E48D1BA49A7F28FB3F8 borger'sboogie
126,702,921 *0CE74C000BCDEFA6786BAADCA5380F6A32642510 CV%9V
126,702,922 *0CE310E992277FA1F416D27404B3276A13079F4D b------p~~~(0_<)
126,702,923 *0CE525C783CF8FCF3F541EFFC6D7808C783F1D74 B======P-~-~-~(0_<)
126,702,924 *0CE14411DD8F71BCF5CF2D6AC745FC8180561F0A CVQ:=
126,702,925 *0CE7264B4F062540A2EB148777AE9EA2023483AC BPU9
126,702,926 *0CE2F79C2F6555259628AADFBE0DCAE77DAFA5C2 cxxo
126,702,927 *0CEC6CF7DEF5C378D2DB434BA74978AE130FB26C BQF:V
126,702,928 *0CE2C60B3587653FD182A06B07765B949C033A52 CYRIL.ALLHANDS
126,702,929 *0CEEFB4AB79645836B7D93D058EBDD23B3670D14 B_QL"
126,702,930 *0CE53E8B73D5EE3BA485DBCF04E115FEE4D8EF4C CYRUSCULLIGAN
126,702,931 *0CE656EBB903E80DDEED74219105F83EC3B51399 czmur
126,702,932 *0CEBFDC6920855B277369AFF90E205FEEBF3D667 bradryckman
126,702,933 *0CE68D444A087DBF5730104C3D817865C50EEABF Brandenburg Concerto No.2 in F major BWV 1047 1 (Allegro)
126,702,934 *0CEA2D793FB8892508D978BE2B129E29E96F54BB D127364
126,702,935 *0CE548BD2E486D6E9FFC171DD7B99F2156C57B90 BRANDON-POZO
126,702,936 *0CE0021F3CA0424B7F94F4F33423238423BADD18 d/1zo
126,702,937 *0CE57AF5C62FFF07745D039D982AD78C3DA5ED79 d-2s0
126,702,938 *0CE0ADDD13A89D8924C44856C31944F1D6EA3644 d2v,o
126,702,939 *0CE2F18F197EA06DD2B4F2F0F8C01651CF037A5E brentgrishan
126,702,940 *0CE525369F180E1C367B9496EED0BC46A8427021 d4a7h
126,702,941 *0CED1E772A5A9C28254B8FCFA17C0B67D87CED27 D4UNY
126,702,942 *0CEE12B5A2C0F9C28835E65B3A6C7435F275D6E9 BRIANTEB
126,702,943 *0CEDA6543E5673475100D82514F3759C7738684F BRIEFEMPFA"NGER
126,702,944 *0CEF0F66F4F289F48F704935476B8B47CB600DD2 BRIGHTLILY
126,702,945 *0CE186E023BD8D3714A2D15BEA4FD96F1BB76602 BRINKHUYZEN
126,702,946 *0CE6A81B276FE0AB932AFF4335AF009054D12406 D5PV.
126,702,947 *0CE36CB475E107B635F527E12B253AE1902F0E88 D6NKH
126,702,948 *0CE4622321E856B67B0D46E3D50804262ED53791 BRO14056
126,702,949 *0CEC654D4EB313484C20036F563F82DD34AB90C2 d6xkn
126,702,950 *0CE078542B109E22FCD559FAD130A19411C97EBE d7ivk
126,702,951 *0CED0351D0E2CA8C183A3CE8E317E415C23137AE D-9O4
126,702,952 *0CE28F3AA1F6483BEF7C6CA326811FB2A62E9C3D d=$a
126,702,953 *0CE45FAE1BD85D6E8B7ADAFE767B287B631B4FBE BRYAN.DUHN
126,702,954 *0CE1D640707E1509CCFEA137178F1E37F21E91B3 BRYANHURTIG
126,702,955 *0CE1B33252919CBC7533BF8426761E715886BF52 daddydon'tcare
126,702,956 *0CEEDABD277CD021FAAD1FBAF55383274D096EBB [email protected]
126,702,957 *0CE34B86AD10A67137C55A718058BCCAE7490469 b;s7b
126,702,958 *0CE3D094B392D9DC48A75C99CD5ADAB414DF2CFC DAMIANCRYAN
126,702,959 *0CEE05FD2008DE9BA2E2DE90FC3849AB1A2036F8 bswdennibsw
126,702,960 *0CEDE06B317024BE6769E0B829F438E4F7B3F4A3 damn.yankees.(1955.original.broadway.cast)
126,702,961 *0CEB60F9552A5F0AE66162CC3603A8D34711585E DAMUJ
126,702,962 *0CE39FA884F1BD682C74ABA6D5065B9000BDAE2E bswmaciisibsw
126,702,963 *0CECB4DE31DEC6AFA74BB0A89AF1B8F2749750FD DARIN.VERANT
126,702,964 *0CED50814669D6C5A2CB7A310ADA0078C7D2D1CC DARIO.LEGLEITER
126,702,965 *0CE0B19F9BD97487E19594EA9518FB39A70471DA B&uC
126,702,966 *0CE1BFB2B2DC92F416DBC29F2F16988062CCC5A9 darronanacker
126,702,967 *0CEA52D8DBD7E0784CDDDD899D8B00B89B31D56B BVa?
126,702,968 *0CE9664EA0A3B44924587E9B0271A956CA86D9C9 >< ~ D######B
126,702,969 *0CEFEFA142E3FBC548F5A3F95366E1AD058C4744 DCFIXQLALDTE
126,702,970 *0CE34850147D88DD15B9C562247FE78F65AF37AA d)df
126,702,971 *0CE5C8700361A04756435BB4F9674C1976C52506 D=Dm
126,702,972 *0CEDD0B286662A7551F09064DA7DDDDEF3A832A7 [email protected]
126,702,973 *0CE65F2CFF1DEABD17F3E2A7644D591AAC0FDED5 DE9ENERA+10N5
126,702,974 *0CE4E137F6AF4EBF2FE66EC5E63DF93C622293A8 DEANDREBLASENHAUER
126,702,975 *0CE2E672B45497E55C6F7D6462F007C34D6E6653 DECENTER
126,702,976 *0CEB985134CA13FA799CF3D7867287DCA90498FE c0;b(
126,702,977 *0CE27C7890857DCDA8C824ABF4FA903846C90B4B c0dk=
126,702,978 *0CED75CE02EB1A1E2A781DDCE615D4BBDE918573 C0JDE
126,702,979 *0CED95C520A158287E01F9B38248ED8AFD241B4B C0NV3C7I0N4L
126,702,980 *0CE7B2B6E0A0F89A215CB669B9DFDFDE0B53D1DF C0O+
126,702,981 *0CE5EB7AA2BA36C0ECA3A909FE17992DAACB66BD DELLEEK
126,702,982 *0CE3DA5AB68AAD9CE497A512D8385E710F21FB73 DEMETRIUSABELLERA
126,702,983 *0CE0D254FA1D2E023976CEA664EA25DBEDE28A58 dennynavedo
126,702,984 *0CE46DAC104AC78D1FB0DC04BE14FA8A212FB443 c/-3o
126,702,985 *0CE7F28AB70A143844AF47CB5BBAC45FEC8AE9A8 DERICK.DECONTI
126,702,986 *0CE5037351598129C64F83360FFAD4124F9F4ADF C5BTQ
126,702,987 *0CE61160A0618990187F6B6DC280E34BBCAB91E0 C64K%
126,702,988 *0CE86628F0FD4C54F99E5D5B8883EC9176507F00 c6&nc
126,702,989 *0CE3826FFE805152C6ECDCEC1AD96C0E25BA0593 C6SL:
126,702,990 *0CE02E488F63AF0AEE9970339C2098D403514D0A c7f-s
126,702,991 *0CEDAC2AE337BA4E1336D5B26CF8EA53E5F98A8D detienes0
126,702,992 *0CEE63BA72B528F7774CEEB4F39670B3FF8D4D48 DEVIN.SEK
126,702,993 *0CE15E2B5AD490E54C0C70117E49032802184B7B C+8n
126,702,994 *0CE288BBE63F79E6C354943AEEDCD75EA6465584 C92208
126,702,995 *0CED1162F914B9D93E46F187DAABFED02D113011 [email protected]
126,702,996 *0CEB62F7A039EF69BE99D8BEB45C13DE93B65770 [email protected]
126,702,997 *0CEBFA48411FAD262AD30CC616E8C41C75F2294A DfCI
126,702,998 *0CEBC24C064DC99AB6BDB6C80C9BCCFE76568BA6 [email protected]
126,702,999 *0CE4416A0AFE39A03BB7BC52A31485826CA6BCC1 CALVIN.FOULK
126,703,000 *0CE611C4A8618C6D14DD6E475CA72DDA6D8DABB1 [email protected]
126,703,001 *0CEB3DE335673505FC5B4029B3C94C4FA1F44487 DGHa
126,703,002 *0CEC727C23AAD07DFA69DF9D33E56C5627D02229 cameronxyong
126,703,003 *0CE1FA50C1E500F035EF13BBE225F72AD8D52F44 d?gl%
126,703,004 *0CEDAC80A056F7BBFC88B70BADEEEC3108E396D1 canarygrass
126,703,005 *0CE2FCC69A93B5604E3F16A5EFBC662AC52A54D3 Cannot.be.opened.
126,703,006 *0CEAE76BC925CF5417D07AEA1F331BBE62ACD854 [email protected]
126,703,007 *0CE98C56BE8507160A1A1F644DF26D4DC0CED40C caravans caravans
126,703,008 *0CE101296BE6CDED5246DFCFF850D576E70AF94B CARLVERSAW
126,703,009 *0CEEB0404B7EC8BF11F945A6B077C8E22632CFF2 carmelomoricle
126,703,010 *0CE83F668AB894EB2ADEC2A167D1BA4FC359EFFF CARMEN81
126,703,011 *0CEECD63F1B809C6B46C65D7A2CAE7DBB5A70E28 DIAMANTIFERE1
126,703,012 *0CE8841D2D8758EBC159F5E117EBCFEB1087FDBF DICKDERAMO
126,703,013 *0CE9AD81184D19CF7BD0847EF6CF4806C4FEDEF1 DIEGOCORRAO
126,703,014 *0CEF2F559CAA40DABCB82EADCD733BDF03DE3470 Cassie.Belle
126,703,015 *0CE9358A02177E2474D355F45378568707EEC0D7 CATURANO9
126,703,016 *0CE08C577CDDE247FF5BDC2BB9A8262C6C9B09B5 [email protected]
126,703,017 *0CED250C6708A9B6CD23EE6536316DE788000D41 CB3CDFB90E4D41EE9B8139594ECBFE5F
126,703,018 *0CEE0DE5855437EF4BE4F5E975271F58F4685D92 cbop%
126,703,019 *0CE43DE426DC29F989A028D954CA5D17837DADC2 CBPN"
126,703,020 *0CE082D71E39079C794EEE86687AD3BBE09090DD DISKUSSIONSABHÄNGIG
126,703,021 *0CE68599B9C3263DD708E6CD262E991F0975922D disparagement&c.(dispraise)932,(detraction)934.
126,703,022 *0CEDE9BD2000389681081E8494EA5F66B756CAFB dj88i
126,703,023 *0CE00F15742A2B64C42E3DAB64619DEF0FF94998 D:K&$
126,703,024 *0CE3DC71791660012DC2A4DD722FB32DDBAF0766 CDD7A
126,703,025 *0CEF173E3D374200165D9D9737248526D25D4820 C_DG?
126,703,026 *0CE066D59064AA3E5B82B0210D93F3BD7D457ED2 CDlu
126,703,027 *0CE995A034109513F03D21BDCD0265A18150E5F4 CDUWO
126,703,028 *0CEE985C06B72A22BC9C29223D01E17778DD376F d,l+.
126,703,029 *0CEFAC99B1DE7EDA434D6FEB49028354116651F3 CEROPHERARY
126,703,030 *0CEF4EBF9E4DB94EA9C313AC6E613C222F22DDBB CF.7M
126,703,031 *0CE26AD000A4000979F1ADEBD0A2EFCC5FB867B2 dmyzi
126,703,032 *0CE3BBDDFD439C431CA86075B53479AFD4C01AB8 dnmeg
126,703,033 *0CE02DF6C4A9BC0BB86C5373167D3BF175285401 CGQ:-
126,703,034 *0CE01DAE3B6D87D10AAF2BE09CBC0EC0E3861CEB [email protected]
126,703,035 *0CE1AB715EA1FC029EF0A6CD57D757B7D4A90F87 DO99
126,703,036 *0CE9DC5276D241C7C86786F654D4CD3AE2339F89 DOI101093NDT15329
126,703,037 *0CE11060445731B75941B51187982DCDE0D95CE0 dom3$+!c4+!ng
126,703,038 *0CE259D445B32932A93D33F3F262DA9E1F4274CC DOMINASS7
126,703,039 *0CE90A8B9A44F62B5602688070A3D5639BBF426E domingosieker
126,703,040 *0CE375231B703CB4B91163799AC039DD8D94E8AF dominiqueboebinger
126,703,041 *0CE35C2454800916BAED62A5DE46CB6080BCC6EB CHARISSA
126,703,042 *0CEA55CFE8A577AE60F49DA3F08AA8AB03B7CB0B CHARLES.BODINE
126,703,043 *0CE5EAB4DF7B20A58C806E9C6A43F918C8C83FFA donbrautigam
126,703,044 *0CE4DA3B10AD202C42137748BEEC82667831445C dongauberry
126,703,045 *0CEA792A12129086790C4D48ADD035CCEF869587 chartalsing
126,703,046 *0CE1C7D75915F4D37D89B3856EFC470C02B77E28 DONNELLFORBER
126,703,047 *0CE453C919A57A13D1E48A03F4EB227F2BEADABE chb+z
126,703,048 *0CE060B10C1219A2F47591BF2797ED7F626C116C [email protected]
126,703,049 *0CE86A66A69E9DBA4D5B129BD57AB7DFD334460E chegadoring
126,703,050 *0CED3E22031CBF8E6023EF1CDE513B1BE59C0C24 CHEMLINKSBELOITEDU
126,703,051 *0CEF1CED50827846136FAE9BAD566AA0A92A8332 DOORDRAAI
126,703,052 *0CE38FA3875A0143FB732A8623266D06752FEADE chevy1energy
126,703,053 *0CE3B0799D390FE83D18CC664550D658A5D68EF4 DOTCHINSED
126,703,054 *0CEC8213516C6A6A3EA8BDEECF06111BABBD6833 dougjonas
126,703,055 *0CE8AF875F0287401BAB4F7BF7FA5B92CCEB0893 chikoman
126,703,056 *0CED90230221F3636A82CAC03CF95A4847446F56 CHITCHITL
126,703,057 *0CE0C49A25852C26AB629B6B5112739191371014 DPGD
126,703,058 *0CED9C9A922776AD2C22D6FCC9305BD89BEB7B2F CHOIERAI9
126,703,059 *0CE47962B7EBB8C937C9D4318BCA2898CB0FAB7B CHOKIDAR1
126,703,060 *0CE049E8D880BF40951E2B48D562381BE3EC645C D?PJG
126,703,061 *0CEA0EB8D16A8803CD2359D993378F474A423AC6 [email protected]
126,703,062 *0CE6D7635D2F8A316D665F014BB1DE1E4DF66583 DPVM
126,703,063 *0CE534EE218123D6023A2C88ADE1EA03B663C26A chrishone6
126,703,064 *0CE860343FA76B00BA367A842FAD5DE3F3FF968E DQ.IT
126,703,065 *0CE32A6BD04F6AAF8078B48982DB130D97560960 dqw/d
126,703,066 *0CED4537D15956E47E7B1A0CD5EBF12FDD0D7406 christinagordon
126,703,067 *0CEEACEA89E008C47E142CB1CCF0DB7A851186CB CHRISTOPER.HINZMAN
126,703,068 *0CE5162673BFDC1B0CEA53A516E20F7B6370CBE2 CHSSMNTED
126,703,069 *0CE3E0E6D0B6203728DA393EB705BDA4DB38E407 CHUNG WAI LING
126,703,070 *0CEC11AB9EF9CB4188160910617A0AB8602FCB23 DRINKINGANDDRIVING
126,703,071 *0CE8F9AFAA30C98A6B5545D394893DACA85D9936 CI8L6
126,703,072 *0CEC527EA2C8C39D19886AB9D3C79ACD951E3808 DRTUESDAY
126,703,073 *0CE71FAB0BD23CB9235AF678AF00C101ED6C95C4 cilz
126,703,074 *0CE58C1E2E14CBB439DB2C836B22020F9F006793 c_ine
126,703,075 *0CE7C5FC6A8B154F25EE07DA15299887634D612E D+SP%
126,703,076 *0CE4B17A11E70D52B8B95F17E3AE614E5EABC215 c&j1!
126,703,077 *0CE62E914F1468B76D19AD547A2C133D78E77822 D+TV,
126,703,078 *0CEB8E8327D44744F0D80671A372447AC2544CB1 cjr.)
126,703,079 *0CE4CE29AB16AF6840254A0710DAFB974B5FF197 duc.=
126,703,080 *0CE68C221478FF5FD8B86162E5325BBECE0E979A CKSCD
126,703,081 *0CE766BF234B3341D01FB1469EC49E350B041886 CK+X
126,703,082 *0CE1BA8AEB2BF5E7BD33310829C949E2D56C84E9 [email protected]
126,703,083 *0CEE4459D17F130DD069B95F6BD626A2803FC0C6 DUSTY.ENGELHART
126,703,084 *0CE483EF7E0ED8A13CD3251F632F3CC4668AA1D8 CL,B(
126,703,085 *0CE8781B4EB16B172FA682B2A7174C19AE2014EF cl=dp
126,703,086 *0CE32E834043C140B66D6959B0A9766FFB496604 CLI9
126,703,087 *0CEEE7472E3FD218A4E56068A7DD2B0BC6897B07 CLIFFORDLU
126,703,088 *0CE2E64674CB0CEB2F9208FB6E35A57BF46877C0 CLIFTON.NESMITH
126,703,089 *0CE19FD32071814C8B18261CA68EDAC1DEE598B5 DWELL.THOU.IN.ME
126,703,090 *0CE1B1358E877F9BBD9D7B1F7B20A56FB6D71B75 [email protected]
126,703,091 *0CE768F4EA57DDA670119A500B891CC1AA8A4C56 CLPVJ
126,703,092 *0CE42C7B4C056FADDAB6397153FF7B5E32700087 DYJR.
126,703,093 *0CE8A1FDE0ACBBAF75E52C66EBA248C37F769B26 DYMYTRYJ
126,703,094 *0CEE186B1BA02C33E26ED72C93D8A64CD57F5814 cmd##
126,703,095 *0CE4B49E07CC81DB54DDDA95E84FE866F0621151 dywx
126,703,096 *0CEAAA83AF7F06C7D6807F52647663BD04D97BC3 CMO4T
126,703,097 *0CE90706C2EC7AC9528F145D9A25FB8308DF39AF DZ%U/
126,703,098 *0CE24C86E6ADB432963D5CB7EF59FE895A0D2B97 CN)A
126,703,099 *0CE52D2C6E718FB0FC2F035DD188C72842ADF44B cnici
126,703,100 *0CE9D15411DE1CF407C4D17C10E7E5308D781199 ealinks
126,703,101 *0CE024A04AED60DBFD9B2F55A4BD5F4991BDB4B6 EARL.UNDERDAHL
126,703,102 *0CE6E5BC088EBDD97C52F3A5F893B18D84C3D87D [email protected]
126,703,103 *0CE381FBC1D8583E6B293EE62806E5B6858BE2B8 C#.o
126,703,104 *0CE23CAA6D18004AA1E19022875EE3F65A53D415 CO3LIO$CO
126,703,105 *0CE8F5679123BE78E1D9EF64168C5712A99DB0F6 ec-!
126,703,106 *0CEE836A99FA6D902FB60E71C318F93D8EFB16ED edmondhowenstine
126,703,107 *0CE6E6BD5F2E253803A7B1311F4160256B38B90C columbusbigwood
126,703,108 *0CEF37CDC7F913E49EC0E057D59F0A0547DB1FC9 edwardoswald
126,703,109 *0CEB198DF0DB9CFB7D8B9151CC0DC7F06B610BD8 COMPLAISANTNESS
126,703,110 *0CEE8537983AE706360ECAB536D6BEB9FA7DE7E4 efgv6
126,703,111 *0CE8F6A7DDAE6DAA89FC1225F3D5FF6A3C169F47 E.FIXE.(OHO.OH.OH)
126,703,112 *0CE97BFAE3699DA257D02BEC9913EFD151A3BDD0 concuss1n9
126,703,113 *0CED4717358264D38A64E3DF83BEACB2B5D06720 EGb=
126,703,114 *0CEF09F07FEA542DC175E5C48F9AA94214CBE405 CONLUGH
126,703,115 *0CEDB78EA62F9CC273F75A681014A0956CAB6F6F connecticutsponsored
126,703,116 *0CE2AA1EF29863F01ABC47E84D6C3F70BA8FEDA7 EGYSAVOS0
126,703,117 *0CE1250976D2C8061AB82CA1AF8CDAD8B9F3F44D ehkfy
126,703,118 *0CE9C2D62E58378A7E6683B7297B8FD9F494E61A EI6,K
126,703,119 *0CE57EF93931CCB06B25FEF6C5F59BE9555A37B4 einzerbrechlichermoment
126,703,120 *0CE3651E29CDA94CAA7F9EEBDB41D28255B62ECD COREY-MERTZ
126,703,121 *0CE03CCC707E682632B8FF5CEB623E8E7EB38774 EKOCPMET
126,703,122 *0CEFE770E802FABB4716842A4F6CAEFF8C83DBED EKSTROM
126,703,123 *0CE1AD6E156FFE577371629791739DAB5E652EF4 costole0
126,703,124 *0CE9FC83FDC8EC9462113E79EA44662C313243AA eldrich
126,703,125 *0CEDD164BE62777AFF3FF2367DA6A760347321BD ELGREKOT
126,703,126 *0CEC5E031A6A9B02CCF9A0BA37079C3EAC162E9B cpd6p
126,703,127 *0CEC1C96DF70C28BF904E8C8EA337787D2E901F4 CP-PCA
126,703,128 *0CE6A699D2A76426C152C75911D56D82A4926AAA c!prf
126,703,129 *0CE012541A6B4E1C8B63BC2CBA396CA278B0AB65 ELISEO.COPELAND
126,703,130 *0CE949635A05C3F23960129CF747CE2BF3E4FC95 C:\PROGRAM FILES\WINDOWS MOBILE 50 SDK R2\SAMPLES\POCKETPC\CPP\WIN32\DIRECTX\D3DM\TUTORIALS\TUT05_TEXTURES\RESOURCEH
126,703,131 *0CECBED7B122EBF811308574A471019573B6F9E3 ELIVARAT2
126,703,132 *0CE0FBDA8FF4032DAE49DF73B804B6847F1F36FE C-QM!
126,703,133 *0CE74AFAEF5092DABDA525F4F49D2C60D9CE6474 CRAZYTHANG148
126,703,134 *0CEEC99B72DC9DB63B265243FDC0ACEFA89E8CDD crb$
126,703,135 *0CEBAEEC78AC1D8FAEE17DBFDFECECEA472B023A [email protected]
126,703,136 *0CE7AFD2F0337D3BC0CFACB74CC8BE06749B55E5 creation20070616
126,703,137 *0CEBE309E6584964D75604F7BBB741B2B602B438 EMANUEL.SILBERHORN
126,703,138 *0CEEE27B17B928D38CD5B037B83116D8D5C6E1B0 CRISTOBAL.WERRING
126,703,139 *0CE6FB0204669148804BC73B824C2411D42BD408 crmbmbl4
126,703,140 *0CEBB0B2F7E128001E12C599E7B44A31CC003363 emilwiegman
126,703,141 *0CE63BCBAB9D69E29DB42E1E94F97D0B9C8CA818 cs$3g
126,703,142 *0CE2E9CE2BC9E2D5C771044EC0F93401F2A6E778 emwfc
126,703,143 *0CE9ADC22B5D33C0D3E76C06B10BE5424FC29E56 EN869951
126,703,144 *0CE9B415D8290F8F01A1152A0552DBB7104FFCE4 csomebody
126,703,145 *0CEE95BF771C7B4750995C056C115FC3DD306550 ENIGMAVICTORY
126,703,146 *0CE1A59967542165BA92D5F7277CEB5A8E13C826 enloquecidoporamor
126,703,147 *0CE2D2555321F56B22D128333B48BFDFC22DC367 EN SERIO
126,703,148 *0CED72E1A6183D69ADD9EC80F62138F3F522FB58 CU9,M
126,703,149 *0CE5937A0F1D9B23AD04D68C72364047D3D56ED1 [email protected]
126,703,150 *0CE630770998C7ADB788CEA54393051689FF1B32 CUM=J
126,703,151 *0CE7A586F0D00E9F3C07E28D045D95AD7E4AAFF4 CUNHARAM4
126,703,152 *0CE96C2A8EA008CE92B262E1E6A314F864986DBE EPICHONDROTIC1
126,703,153 *0CEEFA82397AB33408DFA5A9BA762E76CA0E9996 épületbe
126,703,154 *0CEA3E8A20BB9414C2FAFA202386FDF1FB6F2CB3 [email protected]
126,703,155 *0CE3C10549D84E6956AD4314C8149F21885866A6 cv0k
126,703,156 *0CEFA8C084B9CA966904E6609726FE1266FEA5FF CVsE
126,703,157 *0CE78089AC874E5D4CA65EB01982696A69DEB7DD ER!DG
126,703,158 *0CE53C2E3C6C2E159F948A8565D814A8DF8C6DBC ER&g
126,703,159 *0CE3DB6074B38535868519EAAB11AE182A8A2CDB ERIC.TJADER
126,703,160 *0CE94012B8271F8DB6DD3208BC77CA84E6362A70 cx%mm
126,703,161 *0CE50A823708BCF616B7AFF2A6BD78F0CE9BE544 ESPANISHED
126,703,162 *0CE7B431FEA501FA034BF19947C75BAD772A5DF2 C(YR3
126,703,163 *0CEB70BCF754821C511924BB07FDC1AD941A78BA CYRUSFARIVAR.COMCYRUSFARIVAR
126,703,164 *0CE6E48E14DF386E965A0097466F615ADE9B68D2 cze3;
126,703,165 *0CE0CB20C90EFF0602856BC32BD2C21BA8612C20 D$%;
126,703,166 *0CE4B4FA25E141389F868A5239BDDE2C4DCB191B ethan.grover
126,703,167 *0CE3625C4E2A45F9EC61C6D298B1AF28F379F82F [email protected]
126,703,168 *0CED62062907F527494086DBF596EF3D2439FA1E D3S4SSOSS3G4ST3
126,703,169 *0CEFF4518130D147940CE1E9D2B7B2B018411896 D,4$W
126,703,170 *0CE5B300BAAB26FDA21AAAE06F6A3ACAD6FA705F d53nthr4llng
126,703,171 *0CEB2FC036DF15FB8195F744C73ED53F702EC8B0 EUQMU
126,703,172 *0CE6A76E890A229F67F6211634B526F2FF68F091 da1?b
126,703,173 *0CE2EB636555F8804CD880D96C99D24E4F3585BB EYB4O
126,703,174 *0CEFEFCD308922064E8897B16BD18657F66CAE27 DACTILAR8
126,703,175 *0CE143A3231893381F347ADFD7E1329B15A13EF0 DADDY1985
126,703,176 *0CE591064A3D9BDE5C425245123157296093A847 dadrp
126,703,177 *0CE941601A18F5DB37E8E2F9301E76085602AA8E eynuo
126,703,178 *0CE2E5F3B65BC3EAC1C14738A110FBC0417064ED EZEKIELBODENSCHATZ
126,703,179 *0CE2904827DF7D37516EE78DDB78F2A2B7C4293B EZRAGRAFT
126,703,180 *0CE58CB6D787FE7377E29E96446AAB6270FA2845 F24851J0D4
126,703,181 *0CE5DD7220C6D00CE5AB8C7501E369B63CB4BCCE damienloerzel
126,703,182 *0CED1D251ABC640947ED9A6479F111D7FEC54593 fabianfraire
126,703,183 *0CEB7E038581D20DBB9F35810AAE189C1F92A3E9 DAMION.BOULAIS
126,703,184 *0CE4BA60941D2FE4783E5F4DE6D3E285A919550C FAIZUL-ALI
126,703,185 *0CE877F4F13D643D4B2917E2466D44072CF93628 DANIEL.SANIN
126,703,186 *0CE09DEF625A051439FA187E19C03E6633D49E3A dantedobbin
126,703,187 *0CE831A6308CE0D2B90ECE58C37CBC0937DACBB2 [email protected]
126,703,188 *0CE2C2346E260A3F6A583B1D07C238F9E68A39B4 fboisset-les-pr
126,703,189 *0CE0C1456A183235D243550C1ABFE94C217ECA1A DARNELL.BEAUMONT
126,703,190 *0CED4D61C0C9C179C3A20A60D41E08843EB685AB feignsfeigns
126,703,191 *0CEB3FC986F5C7763FCC4119F8C610AA9A0D4058 FELIPEESCUDERO
126,703,192 *0CE60B30E4C5F9E027B6691F81F3D0DE33BA2F95 FELTON.MCCLATCHER
126,703,193 *0CE39672BC6A410A4D0C994F860A58BAD381E7C3 DAS5;
126,703,194 *0CE48A763B579F32BD4F56DEA3461AE97FCA1A7F dat"
126,703,195 *0CE7A8F521E3A736ACF7874B7D572BFAD7C2F0DE fhftosxe52
126,703,196 *0CE02A768AAF545174E6CB9385D1B5E4F63D1C07 [email protected]
126,703,197 *0CE0E3014CA90A63E03C592D41B2A984A3F9C1D2 DAVE.FORTUNE
126,703,198 *0CE339F26325B6A6A9ABE4F4492AE28CB975E131 dawn.wilton
126,703,199 *0CEC7DD60C7BA79A26497243980CA770FF93657F dbfn_
126,703,200 *0CEB97AF33D84DFC29037C1DE535E36190250A26 DB(OR
126,703,201 *0CE14EEB6A79C47AAC8EF5D6FAD6AF58981D38E1 [email protected]
126,703,202 *0CE4C7FD1B80CB1290A8B9A93C1C0A21A62D84B1 DCR9!
126,703,203 *0CEAC9C6801B976BDC4EDE65367FB034EB7FAEC0 DD8NB
126,703,204 *0CE53B8F85FEAC4FA7E101FA56762CCDC0FD1C7B ddd.(
126,703,205 *0CE41579051B7744995B9D01235BEE81545232B8 [email protected]
126,703,206 *0CE0C3274B227D19F72DFC283C05EDEF6877D0EC De:2
126,703,207 *0CEC1B76CAE6F40E2E7E0286E85DF8184CA88BB7 DEAD-GUILTY
126,703,208 *0CEDD471F239935CDEEAFC37AB4AFC1900DCC157 debcontrolvim
126,703,209 *0CEF68875CE361DA3EC426DDEFDE1D83B64FE42A DECHYM
126,703,210 *0CEB38878B754EBBF4DD9F2BD57165A7F79D4612 DECLENCHERAI4
126,703,211 *0CE1F9C8D44EA15E4048A91F8F935BA9F115CBE5 DED+5
126,703,212 *0CE60F58EC0EAA05970392015A2D971168720947 FQLBPRNY2
126,703,213 *0CEFF4FF094513FE6A2181E5B40D79D54731E3EF FRANCABWERTUNG
126,703,214 *0CED7BEE223726833FF3668709CC6F12C9D99C2C d%eji
126,703,215 *0CEE2442CF2C9CB3CEBD0776C8DD8AA272631305 FRANCESWEBLEY
126,703,216 *0CECE8E56FD6390FEDE1BD381F6FB2EC2B17B60A DELBERTTHUNBERG
126,703,217 *0CE1341DC85E0A7302FB5E67D974149B6E3A7301 FREDDY-SEMBIRING
126,703,218 *0CE91E48EA1CE81762F093FDFBCFDDEB5B43A0A7 FREDERICK.STECKER
126,703,219 *0CECD7AD35E893827C21DA85EFFAAD499C52F254 FREDRIC.GEIGLE
126,703,220 *0CEE395212512348DA7E266DD64799E0321A033F FRITZELLAC
126,703,221 *0CE8AA343D5B9F4C315FB294F5490023AF476A3E DENNISLEMINGS
126,703,222 *0CE0528DD45C44A6E32D10B18DEE1657A1F6A8D1 dennis.walston
126,703,223 *0CEB04109101F75D2AA1EBB4FBD16F7E0075B62F DENVER.MCGUFFEE
126,703,224 *0CE3FF9FEBBCF528D68EBF20C392F642988E9F26 DEPECHEMEMORY
126,703,225 *0CE2E9F8EBBC6CB3F64CEDEE74CE90A177EAED1C DEQ&E
126,703,226 *0CE98E35F0256DF1CE730310EB16F97A966199C4 desromans
126,703,227 *0CEA5925DFD93989D0442F9137B035B583922BED DËTKÒWNIÔ
126,703,228 *0CE8EE8A6983E0420841282A413056034DFC1438 g1o]
126,703,229 *0CE0E84D6CEDDE7E3D9A6CE121FDA9EBB72C75CB deweygilsdorf
126,703,230 *0CEBB0991E24E280FF7124F33F41BB7979EC1053 DEZ GAGNON
126,703,231 *0CEC6B1D1660224506F425219922BD02F3E0868C GALECOEN
126,703,232 *0CED712F32B2CC1A29839D06B5B0C73DE2763053 GALLOPED8
126,703,233 *0CEF66AA2A7DF64603113DCC8647DC150505798B GALVANOMETR1CAL
126,703,234 *0CE6564FB81340FDE74F56A3F0B4EB18F99C7357 GALWAY.&.FEEKZOID.2003
126,703,235 *0CE6D74B6A2B19810CD1BC168567BFFFE3D3E791 gamdiapping
126,703,236 *0CE93A148C06731F8F2C201B83D68AA91A4A2E71 Dfj6
126,703,237 *0CE75A97D853C7361CB6C0CA6114BCE1D61D8D5A DFU/J
126,703,238 *0CED6E98D74997B9047179073BE404682A43B1AF GARRETTLANCE
126,703,239 *0CE6E225D691A52F238AA11EC2459FF024A6AB88 DGL&"
126,703,240 *0CEB870EF44F86642C7ECF453B3031D9B3F83EC6 DGPTQ
126,703,241 *0CEC6EA52E36FF37D2073E64E6AF7E71EAEF258D GAYLORD.GOSTOMSKI
126,703,242 *0CEED6674C8FEB401D121C76D19DFF324D344656 gb\z
126,703,243 *0CE9DE68BBBA4A9654CF2D830D046CF5E38ADDD8 gccpbbs
126,703,244 *0CE5EB607C33722BDA20C7257F015D1406D9B8BC DH&Q
126,703,245 *0CE8092FC82C7A0877C23B2A08361FEDDAAD3A83 dicaryop1
126,703,246 *0CEF20903F9A1CB221E8A88BD0A7AF20E7D36189 GEORGE.MABEY
126,703,247 *0CEDCF61D34B4E48A53D2AB77B3461B89C4DA757 GEORGE.MCMURRIN
126,703,248 *0CEE548A5EB746A248C6595B798AC7FA409BA6F9 GERALDPODRASKY
126,703,249 *0CE39B7381FDED8AC52439EEB409BED446C7B454 di(!j
126,703,250 *0CE879226DBA4FA73D69226181ED60DCD632F6BC GETTMBSW
126,703,251 *0CEEBE4B266D4F72B59FAA3C4CD5AE1EC97740A2 [email protected]
126,703,252 *0CE261FDE0EC3962FCEBF08D99E1D9529A655416 GHJAYHRFKJ
126,703,253 *0CE51F32A888F6F47C5A265F58BC94111F87CE88 GIMME LOVE (JOHAN S TOXIC MIX)
126,703,254 *0CE5FE2E31ED39BAAE060D63F69ED21EE1B471D4 djmari1
126,703,255 *0CE447680F0D84E4540849E4BAFB21EEAB6CDA84 GLACIAĴA
126,703,256 *0CEDD09E9AA15E12821D4148F2276CBFF9565849 GLANLÄNDER
126,703,257 *0CE1991B2A84A26DE7CC08EEBDE6319260B7F939 D:K.M
126,703,258 *0CEB982DEB2013AFB4449AB0D8D9BBAE73BCE6F0 glenmillbrand
126,703,259 *0CE0983100085E082559BFCB156121F296B62DE4 D"L-C
126,703,260 *0CED2B7AAC5003B0532D58D73CD13E090E33F34E GNILLOTS6
126,703,261 *0CE7B5747F526F6F6B7FBE3D7C707167770CA171 dm17%
126,703,262 *0CE3CD132E941FF6B6734995DF68037E6BAA61E5 gnotob1o1og135
126,703,263 *0CE43390DF6C752FEB662DC5A6A61C3C579DD68D D+MBO
126,703,264 *0CE8545D84812DBFFE5415150754A1A51CB7A071 DMDE4
126,703,265 *0CE6F54B63E41B70B3DCA77C41554CB764F507F7 [email protected]
126,703,266 *0CE173721F7C41AA82B79F48210F74BCF8EF67E4 DNSM+
126,703,267 *0CE44D80A237CF8B8CCCB25C2D18D689B44E332F DODECAGON0
126,703,268 *0CE092E4CCB8149045883287065A184DE07CDB6D GPWILHEL2
126,703,269 *0CE503D59BF8C45CB444212A2AD3C36D53B1E017 doer2
126,703,270 *0CEF62AE23551780DBC35B1E11B7BD4D7F6E58E7 [email protected]
126,703,271 *0CE1D94FBAAF37AD9BECAF5C0FB176352067075D DOGFACEDING
126,703,272 *0CE741F9D165A3C6F3A42BCA18FA3D3727F2C8A3 dogm4tst
126,703,273 *0CEFA5E1F07374B0C2026EA99C0FAFF761C5FE10 doier
126,703,274 *0CE6CEE5D510683EAD1B18746C0ACE4DEBA6B75F [email protected]
126,703,275 *0CE9A022A9F86FED556356D4A98EAE9EF236B11C greggnuniz
126,703,276 *0CEBB3A98A54920C3959D9A40D5DB5E285FEF981 GUADALUPESTRAUB
126,703,277 *0CE2FB102F481A4EC0CA2860D3BD137EE9BE5A0E [email protected]
126,703,278 *0CE0257A9C3955A2B89937DC82B21EF050A9EE73 DON'T-KISS-A-MAN-WHO-HASN'T-SHAVED
126,703,279 *0CE76AA96A793CCE10CC2D843518C4D856533004 GUMISTRATÉGIA
126,703,280 *0CEA7F69AE0959DBF2318BE7560C80BF514D6445 [email protected]
126,703,281 *0CEDE4C55D92D2DD0A0D3E94E59775BECB8C8A6D [email protected]
126,703,282 *0CEF20E5CF0B15633A97969A6EA4EEC9C3FAE5D3 DPQSG
126,703,283 *0CE7D591CAEB41C81E1CEA845DC64E401E9319D8 DPVM
126,703,284 *0CE534EE218123D6023A2C88ADE1EA03B663C26A dqpl
126,703,285 *0CEEE3E66713FD024B7D277B99F428D6A357E216 dqqu
126,703,286 *0CE968A07B3BB3D1B74F9EB4AE16F522C4E72E52 HARDNERN6
126,703,287 *0CE47855A6CBE1808A32E5854743A7B07F25B0A4 harithfadhilah
126,703,288 *0CE973735918FCD641E81532CBAEBC6177833338 HARLAND.HOFLAND
126,703,289 *0CE75F52276F5A25643418438204ACDE4180D659 HARRYNAN
126,703,290 *0CEA24CB9CC2095436C4E8EE0A4BCCCDD58D8AFE HAVEDUCKBUMPS
126,703,291 *0CE8075A736F029590416D7BAF9D48B7A4565E9A dsmandsstols
126,703,292 *0CE8119CDF4CF4BD67958C52C54C54CE6B0F7A27 dstmo
126,703,293 *0CE8D48D8985861F51C995D997CE934BA9DBE42C HDRAMAKANZ
126,703,294 *0CE2E80161A92FE9D307B6FD0567F7044E578C2B HEAD.BUST.SHIT.(FEAT..E40.&.GOLDIE)
126,703,295 *0CE5B264F5575A8F96E7D2CDA5B1F45C536CCE4B HEADBUSTSHIT(FEATE40&GOLDIE)
126,703,296 *0CE05D0B483631675A38C70C74CE2C2F4DCC91A7 HEARTSW4
126,703,297 *0CE7CF2178F6A3737E9FFC0AD546363D4C2CC11C duanefader
126,703,298 *0CEF1FF27864047CBAC9A0552D1DE3A6D7D5CAF7 Duecanzoni
126,703,299 *0CE80E548A43E5C3AFEE65CA5A8BAE99F4B292E2 helsinki-centric
126,703,300 *0CE25E8EB7EF11F2892B1851905A7CEE3B453C80 hemolyzed.
126,703,301 *0CE976A2575195BC05E1F2B993C84DA7411FE722 henrybowgren
126,703,302 *0CED16FF63316E0BE951B7DC731B246D4FF34C17 HERRAUD9
126,703,303 *0CE006C87025829E49FF0E1A244C4580712F4820 HERSCHELWIDDOWS
126,703,304 *0CEE8A9F324CA8AF2B358343E40D33932675D0F5 HEXAPODAS
126,703,305 *0CE207A08ADAA579479B239EC6D7613C5FDFF45F DUSTIN.FRIER
126,703,306 *0CE17763512A2ECB4C280BC2C0D92B18045607B3 DUSTIN.RUCKS
126,703,307 *0CEA59C59958B0B91A8D35BDE08344FCE93C1571 dv1-z
126,703,308 *0CEEF946AD6889BA592822B6B07A259CB7FB67C5 [email protected]
126,703,309 *0CEA589500CF091A5CDBC41961DE96274297ACAF d(wcv
126,703,310 *0CE7D0BB7A4B0EB1FC2527A0A603BA8084237BBF DWINGERAK
126,703,311 *0CE93A6A7904B9C862DC47C8F0133255307CBC92 DWtS
126,703,312 *0CE3D1358C2F463C16ECB9FDC317526BA88A6649 DYKn
126,703,313 *0CE001F93529AC17A9FEB2D9F92D7F80A11286AF horaciobaranick
126,703,314 *0CE3F95CE19CD2885FA6B67E340BDE8C444FAA3E DZJK5
126,703,315 *0CEFCD12745937165D45563C5029B532DC6E497F eajia
126,703,316 *0CE1E49096681DE5560D9AF896D6845845B8961F HOYT.TEBBETTS
126,703,317 *0CE18D0AFE3A036D8B0FE0CE305475F59CFB9C0C hreddungdæg
126,703,318 *0CEEEA657CF05F898269A1150B371555A2BDC059 [email protected]
126,703,319 *0CE6096C240B133CBEC4429A52D1655694A2019E [email protected]
126,703,320 *0CEE4D74A6194BBDF48D187F7539C0D63A0047C9 eddieelzinga
126,703,321 *0CE1D8617C4730AE72F265A755D951C6D94EBE70 HULLOS1234
126,703,322 *0CEA5D53227927BB60B409BC4E1C90B8C93135B6 EDE/K
126,703,323 *0CEC7A305C5F568DBE9E48DF911E108E8C14521D huslink
126,703,324 *0CEEFDE365E3958FC3145453EDED920F2D58EC97 EDMUNDOSWOPSHIRE
126,703,325 *0CEBE6CD8818BC9D4223F27906A040DF7ACDD039 HYCOMINE6
126,703,326 *0CEEF62C13C369428EB89882D66E0D653E55F3F3 hydrobidae
126,703,327 *0CE86B2D48BF568E8E8114A47F03CF0BE29BFD0C EDUCTION
126,703,328 *0CEBA350889C9040770BC6C7FB6EE366B17219FB ee7c0
126,703,329 *0CEEBB72C316A5D35A574C69D7C5C298A2B590DC iamfroggie81
126,703,330 *0CEABF257932D78C3C227189917ED7E439C594F5 EFRAIN.REIMMER
126,703,331 *0CEA6FBB3112808B5ADE3F239B3D2BD9B1EEB866 IAREGID'
126,703,332 *0CEE9A940258E1CB621690F8D4003113C0093D09 IARGNADH4
126,703,333 *0CEB44A882ECC60588E20CD9DE1CD6CF35A2BCBF EGAA
126,703,334 *0CEBABCCF4856CFF668AC118974CE2E59C90BBF6 ICE-POPE
126,703,335 *0CE94E6E35F643CFFB85D41D35F0826673D15317 、E・H・エリック
126,703,336 *0CE45D09F661A8950E20BDEA2CC876AC5F07C1F6 EH+HZ
126,703,337 *0CE96C8A59C8F1ADC31CD10377A767632F7B7BA1 IEPLE
126,703,338 *0CEB2D1F5E82F8138E32E3EAED3A9994B9C562AF eibolle
126,703,339 *0CE74166A2621AAE524A57243FF3D2E9F9BB6725 EI;H"
126,703,340 *0CE30978CE7F627DC26D83F9946382A1B2CAFE4F igotbsw3
126,703,341 *0CE51A5CBF73E9C0BD196E244A026B805FD0B0D4 EIS3
126,703,342 *0CED5AC69C911737ACC904153284CF2FBB42868F I-/J
126,703,343 *0CE49DA0633C1C774A5FC6020B804703A7926231 EK2A?
126,703,344 *0CE7DF4DD20A24A3AF41A3CEC5035F494E3BB920 ekamyeno2
126,703,345 *0CE2AA08DE1B190A75BE50D8CADB594047668AC8 ekca7
126,703,346 *0CEADA58CA028600BD484D8855AD024898BD4132 ek^h
126,703,347 *0CE61AB5F2A757F59F5B9497B432CAA0E8332714 elahcim2
126,703,348 *0CE3F6E7A9B3ACE918915E7F4D40FEA1941C97F4 IL(L
126,703,349 *0CEDFA197032D4BF259D548ABADBAFC6F9F45777 EL GLOBO AMARILLO (KARAOKE)
126,703,350 *0CE19CEBE5DA608EA2FD92D32F70077540B38E0D ilovesinatra1234
126,703,351 *0CEF941FB1E8B78CC991BC3A96A4EC513DACA737 iluvasdfghjk1997
126,703,352 *0CE0512F341B6BB8FD820C093D727A08E3512E03 ILUVILOVEYOU204
126,703,353 *0CE28D25C99B82D80E93B1A7F5C721FDA087E0F9 ELMOGIPE
126,703,354 *0CE1648485FD1438D2BF0CA9797F4E7064E827BC ilvsvs
126,703,355 *0CEE9BCA9BAC17E32A00B467190DDEC9A192532D imd33sht
126,703,356 *0CE2B2C08917AC26B1F0B8EA9B425CE9A8C34D39 elwu
126,703,357 *0CEC2F059ADF72B26B97287C92EF6ADB21910B42 em5cwsacsmblxa
126,703,358 *0CEE25EBE203781B9305648AB4A16579DC278E72 EMACIATION7
126,703,359 *0CE4DA8FB8E7E3F4D72183B6B596EAF14184935F EMANUELHEUBUSCH
126,703,360 *0CE416EE4E4F0B780D7B5D170F2B2994F30031E8 Incrustata
126,703,361 *0CE93EBDB6E4380A59BFF7BF548F9C6BF913A5F6 INERWAL
126,703,362 *0CEEBF524F3C0702D9D89B77090629CFE3C735FA ingelatenen?
126,703,363 *0CE24543191B238F485814AE68AD9D0FCC3D0047 INOTIPACED
126,703,364 *0CE5DD96BE1872E59E9A21B9BE8E5EF465D60578 INT3RSA13
126,703,365 *0CE00406B39A4B9574D5C8E43A59BFA4DC8F482B In-The-Year-20XX
126,703,366 *0CE35050B04941EDFF10D5719794BD0B86CAF454 IPPOFILE3
126,703,367 *0CE5C1F36CD060A34869715B9B56D6C4EEABEF81 [email protected]
126,703,368 *0CE853258ADDA197B71C14CB7B74377607D66BB1 IRAUNGIPENAREKIN
126,703,369 *0CE610D3571E06D2E59DE34CA3654FA259CC0D3D IRVINGANDREWS
126,703,370 *0CEF4C59DD12A6C57387941B0CC01A7EA1B9F791 ENTRAAR4
126,703,371 *0CE7F6328289725CF23A803008A695D9098A37A4 enuresises
126,703,372 *0CE09831BD3EAEEF1381D0BC51E6E3E973218E19 ENVIRO-CULTURAL
126,703,373 *0CECFCE4DE0DD0072018E73E9527BD4F83616DF3 ISAACMARTIN1
126,703,374 *0CE960B35723A4589214DA368911F9C706FD1D1C epf)0
126,703,375 *0CE7A373EB274ED8D42E4D782DE79AEBE9A46077 epiphany-refusal
126,703,376 *0CE5DF3AA1D976F5E99C322BC04E5E90730A4B37 EPISHMANSHS
126,703,377 *0CEE3F444947BF68A60EB10C00ECEC11C1B91FBC eq5bc
126,703,378 *0CE9500755E5AEA8FA791DFA8C479F3039086809 isrealkontogianis
126,703,379 *0CE0B041754428A7386587830DA4F8A2A6FD1E25 [email protected]
126,703,380 *0CE82A240A84209DE7B9F9926C122D12B7C86F49 [email protected]
126,703,381 *0CE6EAD207A6D48B80E49AEECE24B3806E6F4A20 I.WANNA.BE.JUST.LIKE.YOU
126,703,382 *0CEF3840F49A6CB93BAD2924AD3D08D9E374BC08 IZLACNIR4
126,703,383 *0CE1074063742E9DB23825208005B5BFC504FB2F erwinpalko
126,703,384 *0CE49F8A2F3D36FF67AEC7A78E00BD653E19F4B8 ESTEBANEGGLESTON
126,703,385 *0CEA453524850AA31319A7CEAC560C7535D01EE1 JAIMEEDIS
126,703,386 *0CEB65806F9832EB74D7C10EEEDF126075684A25 jamaalregalado
126,703,387 *0CEFE95257FB6DD2E2CBEA799A4C75DACA6281FB JAMES-CUTBURTH
126,703,388 *0CE457D51B56FA5B8E7A7C5965AFB86A1605A3E1 EUDR!
126,703,389 *0CEC69BDC8D4D5075EE444707228A72411014154 eva792
126,703,390 *0CEE12533B2543EB0A4A988C22EEEEBEC443B701 JARRETT.LANDAN
126,703,391 *0CE4240D4976278C4E6F8DC48E36E89E4356E2C3 EVERETTE.MARQUARD
126,703,392 *0CE8A443670C0EEADE98F874F44B9E3EF7724C5C [email protected]
126,703,393 *0CEFB24C9E2282CAF0C98AE7AE26AC23A4571BDD evtropxe2
126,703,394 *0CECBFC9D2EDF1384EAFE54F9CAEFFF76541AB06 JAWANS8
126,703,395 *0CE4283DD13325587E417F01C936B8D250DDABA5 EXPRESSIVENESS-/I/K'SPR/E/S/I/VN/E/S
126,703,396 *0CE3127E27838DAE449E9B2E95BE07BFDB89CC30 JBORKOWICZ
126,703,397 *0CE3EABF9CDC48C8245786A520076C409EE87CB1 JEFFERSONKEEFAUVER
126,703,398 *0CED562BE91B6DA42F961BB581F2D0C57C347B63 JEFFREY.MAGLIOLO
126,703,399 *0CE4326F207941D613E3B1E3714EFF6666D36AA0 f7t,
126,703,400 *0CED61EB4ADD1888A7842D2ED6D853BA57541E82 faarggru9
126,703,401 *0CE5FB763B7C3429DA728D72C8DE38074E8C2809 jeremiahscaiano
126,703,402 *0CE15754C7FBB4EAFE811DB947E07C5BD85C73A5 JEREMIAH.ZIER
126,703,403 *0CECD6EDC4B16C05093F91BBC326E84575046997 [email protected]
126,703,404 *0CECE6D559C326591C420BB5AEA768FC4DE85180 JERENEWHART
126,703,405 *0CEF86D16CC1DB2EF93A19B4E267F4BDED3F1084 JERMAINEJOSE
126,703,406 *0CE6A49AC322343DD69626AED621EF21346A6F82 FANGIRLTASTIC.COMWWW
126,703,407 *0CEC65683600289DA42DDEDF2B78B311BC588BC1 jerryhtwe
126,703,408 *0CEED0519CFDDB7B821111CF73AF50EB65BFE3DB JESEN STIZE DUNJO MOJA
126,703,409 *0CE178172355C2B8E76F5A3D46D763F635B209BA JESSEBOCCHINO
126,703,410 *0CEA87E243C1F6B5019C92A4C76710B54D083D78 JESUS-URIARTE
126,703,411 *0CEF41650C2565F56CF80D81031C87169335158E JEWEL.BAICHAN
126,703,412 *0CE20C48E9FD1A123A1711E41183FA5724977142 federicoballenger
126,703,413 *0CE23F03E26A1D6ADECF89F7AF573F2AD2C5FF22 federicosawtelle
126,703,414 *0CE9CDD336C0F527A657C9560FEB224F7C3E66A4 FEGHINC
126,703,415 *0CE0A4BF40F02BD14FB9E324CE910EF18C4AAF81 jimbrohawn
126,703,416 *0CE213176DAB03987210CC542DA04D497AF8F656 FEUDALISTIC
126,703,417 *0CE170B3A77D9AF2CE1301A20A5C6F197AEBA116 JLEIGHA
126,703,418 *0CE07179A45CCCA710B6BB8A68CDB4AF94D63A5A JMLA1234
126,703,419 *0CE2A4E580213FBAD0763756958FD8759CFC5DAA joaquinirby
126,703,420 *0CE424375FD08D2CB7CE27CAC43718C2B5DFA617 JOELCYBULSKI
126,703,421 *0CE8A441E3E702629B0701821EB7A159554F41E4 JOELREBECCA
126,703,422 *0CE3F9837D90E8A2059D85876A034BBA815326E9 JOELWOY
126,703,423 *0CE087E93860CA5BE6A82FF0DC2B594ECD3E3823 FL53NDM5G
126,703,424 *0CE84AB070C3B97A04FE074A5187FE24736E6546 JOESPH.MCCARTER
126,703,425 *0CE44A9BF0B0332099A157F745509CFC6493579F FLETCHER.ALLYNE
126,703,426 *0CE80045E4ECCC9857EB27399F29FF6E24D93BCE JOHNHALLSWORTH
126,703,427 *0CE7CC3751DCFF92FE09ACABE525036BE9E85012 FLOWBOT
126,703,428 *0CE6F4BA4274963C8610E205561060DAE16010EA JOHTUEN1
126,703,429 *0CECCED8E4AF3E2D912B5C9CA15BE83542968F0D foregoes
126,703,430 *0CE1B3109F92FDEBA84A773FE5E5E616BFCE3483 forretter
126,703,431 *0CEE3DDC61EABFD1239A0141806621B59D7BD2EC JOSEPH.BERNHEIM
126,703,432 *0CEAA136ACC43001A70949B7D4B7E9C220E9256B JOSH.VELEY
126,703,433 *0CEA3F51B83D948DEF65AE4FD4DDE52FFCA456BF JOVARIUS0
126,703,434 *0CE22E3C099CE099448F85E398E9E9AB94808D59 franklinkloefkorn
126,703,435 *0CE459648817AD6C244E60B20FC5DFB78D31DAED JPM6
126,703,436 *0CEE11EB873633BF6B03DBD7E0BAAE70CFBFB59C JR JEFFREY
126,703,437 *0CE6216DAA1D859229A60CAF852960250A879D60 jsteevesing
126,703,438 *0CEC15C9391108F71F220021643D56F69AC4EEBB Frederik.Ammitzboll
126,703,439 *0CECBCD8610BDB485AF4C8CAB6A7CD0D139AC641 JUANFOWLKES
126,703,440 *0CE1677D4028417A00E5680079A3C35BABEDAA07 FREEMAN.CABRALES
126,703,441 *0CEF77679BB6493AE2EA6A1DCC0084C9DBEDFB8D JULIO.STECHLINSKI
126,703,442 *0CED2B05C76E2387AC10AFBC5374E8F8DDC9E692 [email protected]
126,703,443 *0CECD525D758F74B57E862D6D32C5A922E213762 F{SP
126,703,444 *0CE5D3645FFA0B84D6C3104DAA925AA711051785 FUČEDŽIEV
126,703,445 *0CE9512B4A87146BC3748B50A514A0AB7D31203F FUTURISTPOSTHUMANIST
126,703,446 *0CE9245C7931D71327487416E52140BBB54E3584 k"&.
126,703,447 *0CE8FEE2242396963D80FF4D9E36FBDE74176BE1 fvcx
126,703,448 *0CEF2A5489962721B5B081BE5D0545D5B8264188 kabouterdansremix
126,703,449 *0CEB8444B5CD9BA9B64578983854E72B77C594B1 fzng
126,703,450 *0CE7A2FCD06670FF2D80541A82A43F1EAEBED50F g<4)
126,703,451 *0CEA985F5A79BEFB0BCB39DFD32692D1EA8E1FEB KANINCHEN0
126,703,452 *0CE8F2409B269B3FFC2AB578A43743EE6B551727 [email protected]
126,703,453 *0CEFC12B80A667040155021FFFF5A709CC5E1E3E gabrielle.langlois
126,703,454 *0CE61D81D450949BD89C4141601BD5A03CE1F4FB gabyath3
126,703,455 *0CE569089779EDD5A43F2DBD256DDD0287FD2490 GACAGCGAGCTGACAGTCACGTGCCTCTCACACTCAGAATGGATTCTGATGGAGAGACCA
126,703,456 *0CE92336FF77C0DEA94ABA8A4F6EF8A1E43E8FAF KAREEMFORTHMAN
126,703,457 *0CE601ED427CB34C2CC4E9BF385A24415086D096 kayla.brasel
126,703,458 *0CE91C1ACC10F97C820A50AFE359DC1C4EE3F007 garthgransberry
126,703,459 *0CEA537D62B03606E1F1B852A9E75217D00D2725 gastonscarpitta
126,703,460 *0CE4190BD871FE6630043A2D62BECD8F077AD3B2 kedgeree9
126,703,461 *0CE9055989DAC5AE45EF99432CA2C7DB508804B1 GAUDLESS3
126,703,462 *0CE796BA07C40349DE5840FD3FABFE6DCAB0C358 KELVINKRUETH
126,703,463 *0CE9916BCB62EF96AD90A09940DCCE77143D8E87 gelthan9
126,703,464 *0CE0F6343A4D291ADA030F21901A710CE19D56DD KENDRICKCMIEL
126,703,465 *0CE3D91BC2D44CEBF58A5F2022E68DC5FC69F125 KENETH.BELLAZER
126,703,466 *0CEB250CC2B02DB6ABAEF4FE1A1E7B97231578F9 GENARO.BAKST
126,703,467 *0CE582043F59843FA8AD0F5BC1AED8368EFFCED9 GENIALS7
126,703,468 *0CED3B0DFE97FF8434753043D6ACFBDCF36056F0 GEOFFREY.ONDRICK
126,703,469 *0CEA0391E24F42A180D04A890530B23D3006B47C GÉORGOPHILES
126,703,470 *0CE320BDEA57BB7BD8990E7B2278198F2F0F7F3F KEPASA!?
126,703,471 *0CE88804C7A6AFBCFF34B3ADFBA7CD7621E649FC KERAANDAJ07
126,703,472 *0CE25549C5182C05C26D41B8320DCD99635B7ADE KEREK”
126,703,473 *0CE6C55C8FA52996124B2C977E201B1476130E44 KGULDAGER
126,703,474 *0CE97A3644A6E23E91E9C92EB2EC322DFADBF1F2 KIETHDUNT
126,703,475 *0CE54AEBBEEEBC35549A8CAC1CF307B314960AE4 kimdrees
126,703,476 *0CEB0022F3DB807C0141D0545BA13DECC54F72FA kinaukinau
126,703,477 *0CE846B0497946CC0CC22A61BBDA4C1538C1FEAF kingduriga
126,703,478 *0CE9F275370C77EF057BF0348CFBA2F2DB682BB0 King.of.the.Hill
126,703,479 *0CE4E135AB3ABCC9AA12881A67AC2DA13BB187D6 KIPKILTZ
126,703,480 *0CE0CD1CEB66B64953FBBFFCBB522946BD6B6241 KIRSTEN_ENTSMINGER
126,703,481 *0CE453450222599DFB03344865631F51D1CB5673 kk6396
126,703,482 *0CEFFACB79CC993BB66D49E82DBA533AC8D6588C Giselle:.Act.un..Galop.general
126,703,483 *0CE6DCA8593F2E9B4E86087F0F9DB3F0378EC9D4 [email protected]
126,703,484 *0CED15A8F6A24A64B4E3A81E3D8AE64A68A36181 gkknsuv89
126,703,485 *0CE681380496618E9C61D9D743B6DD0867D17DB0 GLOEIDRA5
126,703,486 *0CEC09AB9A872F4AF82A500725D3D3DDBA709FDC KN?PFEND
126,703,487 *0CED32150BF3B8102799162478DB92E311C41E3A gmss
126,703,488 *0CE621958EC19B3BFC7011D924F76CD168DE756E GNATLURK6
126,703,489 *0CE96D30F7B506FF3C8D3F89482051418AD874B9 gogatsus6
126,703,490 *0CED34A9472C764045F04FA6428717F62F35BF31 GOHAN-SON
126,703,491 *0CE291904C41652ACF9E0735874DAF796A88D86E GOOFFEES
126,703,492 *0CEC5A87FC9AE20A0B8CDDA9C5FE8ED5867D7FF6 GORDONKORDISH
126,703,493 *0CE8F65F0F416B65BC153DB6242A828A7418A3B2 GOTIANGCO
126,703,494 *0CE9A507AB22C1CC10E4C9437C15A0847B4355CE krammelige
126,703,495 *0CEBF0D88642483E645DBA0BB469D144B1DADC47 KRIBABE
126,703,496 *0CE7C9852CAE7D849FADE7FEB127917148E740EF krispomerantz
126,703,497 *0CE20973671435FB0C16C11117B5485E4D28B731 KRISTOFFER-VALENCIA
126,703,498 *0CE519877F8D16CA1F9EF062E09EE273D80B3066 granada-gr/@/'n/a/d/@/
126,703,499 *0CE97E31474F89D5B4ECC7D0593FBCB9E20F3C1A KSANLUIS
126,703,500 *0CEA2A512B9969D568B041194A2DB2A9FEA14B2B [email protected]
126,703,501 *0CEB5387ECA07C2A89AADAD44481B598FE1402EF [email protected]
126,703,502 *0CEAAD6F78FF98BB14C06FAEC2608231D26C677E GREGORY.SCHRINER
126,703,503 *0CE22BC595CD724F00B25D85985668A0D2CC5D85 GROVERHOSSFELD
126,703,504 *0CEA7EA43143969FFB8B8BEA6D1F34BE7DD9BA95 KÜYLÜK
126,703,505 *0CEFF7B33ECFF8BC0A855E2784D3D39DF5A764EF GRUPO.BASIN
126,703,506 *0CE3E9957D0B375033E30205EA3572570683813B KWASHAUNA
126,703,507 *0CEECE5F6EDB4E1A87E98A94EB8E91E025ED6A92 GTU
126,703,508 *0CE771C9A1231E58674DD66B2B335365F657048E guillermo2/8/90
126,703,509 *0CE5754837AF994198302BE304A0F49BDA256A20 guinnesslynn
126,703,510 *0CEAF31870C0A9B9F8B2422CC4E4C3A435A6390C L42079
126,703,511 *0CE83EDD1FF8EE7A8AB18323252B11C672BCA455 L4Y3RN9$
126,703,512 *0CE80E8E2E0A4B1E1E51493376501DDD398D991E [email protected]
126,703,513 *0CE17EC9F334DD2E725FD6686D527588382300A7 [email protected]
126,703,514 *0CEABA5A66EA31C3B387C0FD35DE0581100B3DF1 LAGK
126,703,515 *0CE7700D6FBB3BB2C5D3D895F5FCE50F01764411 h1sk
126,703,516 *0CE52A2F17E9E16898AB10DF6496F9175B2DFE1E H4gg$h
126,703,517 *0CE35E92DB33C0D455F6543BDA77DE16E429891E HAGEMARK6
126,703,518 *0CE05AF79714F74AC335D58EB5954F085A0E005E HAL.KOSZYK
126,703,519 *0CE73AE22F9E25AA1D42246C9C5623650D6618A5 LAURENCE.HIGGENBOTHAM
126,703,520 *0CEB955E165B665AE7062EA8452C7E42BCFA803B LAURENCEKUHNLE
126,703,521 *0CE779CACC4EFB40BB1CD61606C891D1872030CA [email protected]
126,703,522 *0CEE7D9A5064F698DAEA3C1FCEB04B2D9B88E2B1 LAZAROEDGELL
126,703,523 *0CE07D13C7D768CD2418E71A174B233223594F5D lazarotwilley
126,703,524 *0CEBA46D455FD11C75F8F368257E1033B68EB8E0 HARESHMADHYAN
126,703,525 *0CE03A8AC9560BF91ACFA58F78A510CA82F2BA78 LBRLSMS6
126,703,526 *0CE2E0472D3E1F9C0ECC8027685AC4DB27732B3F HARRISON.REIFER
126,703,527 *0CE8AD4DB0FCA7AEC5FFEBF69F74F0D321BA0726 HAVOCBLOODANGEL2
126,703,528 *0CE01BDFCCAD90BDFAC21CA3C359A26BE6BDBE10 [email protected]
126,703,529 *0CEE6C527DFB09A56F406DB3CED5B0A1ECB129D5 leocoopersmith
126,703,530 *0CECC1E41996B2492735AAE650B3C85E115280DD LEOFABBOZZI
126,703,531 *0CEA785C2A3C2D1E8949CE54B91B4F07F8E8912F LEONARDO.IMPASTATO
126,703,532 *0CED6E50B7835055AC54DA98D1D53F08F181885F HELGEN2005B
126,703,533 *0CE646AB52DD87DBF909BA2D9CCCB58EF783E06A LEONELSR
126,703,534 *0CEDA0DAA9D56211C23462FD5F254D6C30CD5FAE LEOPOLDODAWLEY
126,703,535 *0CE208FD543CE34BBACCFA15111F7A5C0E6FA821 LESLEY.LIESKE
126,703,536 *0CEBCB40A3D7E8E685DA815BBF817B561A923371 LESTER.UYEHARA
126,703,537 *0CE96D59E664F3128132E9DD59035398E554B9CD LETTER.FROM.MAGADAN
126,703,538 *0CEB6DFEE75B0B01CDE6EEEA139FCAEA352500C7 leuhr's
126,703,539 *0CE0C82F7909FD2D495A1EB01E9E7C538BE9F82A levels108
126,703,540 *0CE46885AC094125CBDEA52FEA91BC23A1D0967B [email protected]
126,703,541 *0CE38CD3B74B62B703A0BBA2FC98515133F48F0F HFU%
126,703,542 *0CE34B018CEAFA5E51CBACDB7258D2E34870B6D8 [email protected]
126,703,543 *0CE7B350DA13F926252C55B3AD81DCC1E911D255 <li><ahref="pgpdoc2_59html#0">exposureonmulti-usersystems
126,703,544 *0CE9340131DD4DD4F0A55B369674B6713777D760 [email protected]
126,703,545 *0CE5A837161152D3D6025CA6A3A214CD0199854F HILTON.SATSKY
126,703,546 *0CE92B37A655467AAEB58FD93B1A57A630C50C4D HIPERDULI0
126,703,547 *0CE31871E6B0FE075118A31AB84E77D6A7C2F7F4 [email protected]
126,703,548 *0CEB1DE10878F3EB7A330F9F5EF0C8EE7B9C592E LIJINGHUAN
126,703,549 *0CE4156B81F8CD99423D836B8D64247B515FB1B5 historia-de-oaxaca
126,703,550 *0CE229DBF097BC2853026CA9C0ABB42A8F9FEE44 [email protected]
126,703,551 *0CEDECA31CFE06C9A19E1C569B8A7D2A6A6AF739 hjsajshbdshbdehwdfhuiqwbfuewfbeuwhyjbfewugf
126,703,552 *0CE0B36D3B6C1E8A84F610CE313B355EEAB6A8A1 LINDSAYBERTH
126,703,553 *0CEA3654F60A1B6D44BAF813BC27B3A5DC32B882 LINDSAY.GAUANI
126,703,554 *0CEA30D0CF6E403F6CEAF34D24457952D527548F HOAWARD4
126,703,555 *0CE892FB3BC48991F7A22AD6A3B3A3572063FD50 HOWARD-WESTLEY
126,703,556 *0CEB1F6EF3CA91897CB3093DCEF355DFADC861A9 HRDSYSTEMS
126,703,557 *0CE155300E5DB4D9C38AAFD8F5BB19F0CFA77666 href="http//wwwamazoncom/SaitnTeresasAdmonition/dp/B000QNCVTY"
126,703,558 *0CE6ED8A1A28EFD6F58F0F69A5A752D1F2BFE6D0 LMOROSCHAN
126,703,559 *0CE9A2638B0E10A4403279A6198CFE28D8F2CE92 LNEVGARF8
126,703,560 *0CE54B3D64807B4D4D93837D786CB9E981CF2791 l~o
126,703,561 *0CE7D6FC4BCD9A3B6E3FDAB88B71D5B0AAF593E9 HTTPLAWLIBRARYIEMEM
126,703,562 *0CE8F19810F66D5AC79E515F857077B2F6836328 LONGBELYOUSSIAN
126,703,563 *0CE5E32EA616584E828E15632EB4E5050E01AA2C [email protected]
126,703,564 *0CEE852E1594F3561D19524A7598DA353D9CC78D longmcalister
126,703,565 *0CEEFA24858E09149BBFEF5713258AF3F73A8AE6 [email protected]
126,703,566 *0CE70D3C6D9A2AABAC118895F5AABCFF3A8DD0AC [email protected]
126,703,567 *0CEE1E45F6D5B57DC63304B1B0C3188807ED24CB huisvesting7
126,703,568 *0CE4F48800AE8E661DFAA18DDBF7DAC04C94B6F7 los-pieneros
126,703,569 *0CE5D792ACCE59B60202CBEFD39799A4DE1E3258 LOU.MOYLAN
126,703,570 *0CEC34250FF2DCF94B5F1DD833DA8D1ED0627854 [email protected]
126,703,571 *0CE28FD5830559682778604F85C1A9B596D2B4CF HYMAN.SCHROPE
126,703,572 *0CE5F0A1EA78E231262B31DC6592644278697EAF HYPERPAINT
126,703,573 *0CEFF97DB22EEDA83CF380913457BEFF5302BF6A hyperthyreosis8
126,703,574 *0CECE0574577D0CC2AF4E607258624997ACFDF01 I_2I
126,703,575 *0CE531D347BEE561864CC0FCABB442258E6E228E LUCIANO.RAMER
126,703,576 *0CED222E14B2042D4575340767C7F5B1E34F6D67 IAMOBSESSION73
126,703,577 *0CEBD4667B9C2F913E480506E1D7A72873FCCAE6 LUCIO.DEISCH
126,703,578 *0CE1F461FDA00720FFC6B65397FBE3BFE785CE7C [email protected]
126,703,579 *0CEF588825312B4E7C02F85F49DDE215461589EE I.CAN'T.GO.FOR.THAT.(FREEDOM.JAZZ.SAMBA.MIX)
126,703,580 *0CEBA36D983F79915270F28E587E0084636CABBD icid
126,703,581 *0CEEF218B50039AF3FD68F0863DE8C71F0148718 LUTHERGRIERSON
126,703,582 *0CE1986356C118C21BFF875803EC07D2C4083765 LUZIJOS
126,703,583 *0CE1CBE3A6816C6943A26F289075C4E4C7D03202 M41PR3S3NT4T0N
126,703,584 *0CECE3709B5DD07D8C44C3A399DD2565C7A3AA97 m4rin4din
126,703,585 *0CEB2FA6DCBE20E5E74A337993CD9283DD3403EF maarschalk8
126,703,586 *0CEC595A25CC8ED14F090FEB953449BB11C3546D ILOVEGIZMO60
126,703,587 *0CE0D7C5D77E4ED81A8F33DAA4CEA38CBE54CC35 ILOVEICECREAM27
126,703,588 *0CE3A716B8A2BD1102751535E71B3BD7DF8E3A31 [email protected]
126,703,589 *0CEA77E3052DB67A67C46ECC22A126B2386CC6D9 MACK.GERKING
126,703,590 *0CE62146A48C10777D80C46D6FDB136716EC7C1A ILOVETEST392
126,703,591 *0CE02B26EABA0CE41B725C9F1F744764D10AD1C2 ilyasherman
126,703,592 *0CEEBCCD8278E431B76EBC515D9D1C2E7C2867B1 MAINSAIL
126,703,593 *0CEF0A32C16779744675F2C9366CAAFA190BA85A MAKETHEMB-T-H-S
126,703,594 *0CEB8B8C2229828198152DBB60454C9DAC25BE6D MALAPRAXIS
126,703,595 *0CE10BE80E67E303453D1348945533DABFED30BC IMMERSAL5
126,703,596 *0CE2C7D17D9AF2B8E0D0D8D36E7501280A734327 [email protected]
126,703,597 *0CE2AE21CEA4D8407E7195C3CA0CCA6E46A6DD77 [email protected]
126,703,598 *0CE51B2B137605236549FEED1BBF54D993C93DED MANISHPAUL
126,703,599 *0CE3CC539E71C61B8CD1CF147BF857C129565A34 MANMATTHAI
126,703,600 *0CE16B8CC8E72BAD4B6E5120BEC3A588D4567D69 MANUAL.DIAK
126,703,601 *0CEDF81CBED9309CE116519508DD5BEB321BFBC0 marcbrassard
126,703,602 *0CEF196E384995B317F28973BC8E12950B8264DE marcbresse
126,703,603 *0CEC409E02C2A3709592218396DB134F63238E86 Interlarded
126,703,604 *0CE0678BC4EDAA969BDBCAB522DD00E91EBE0B63 interpoleerde1
126,703,605 *0CE1B2A413E90F9D3070806D18CD9A262249DC4E MARLEYAH5
126,703,606 *0CE50E74E99FDD8BFF8C49292F0F20F12FBDD252 ipanemabushman(15secondversion)
126,703,607 *0CEB090F6DAB50EAAAF79D7EFBFAE250D24FE875 [email protected]
126,703,608 *0CEC8B961CB9EC91FB07E728AC8881CF27B4474B Ir-2.3-assurance- 40
126,703,609 *0CEE1E210D80FB02258B80F5E741341F160B6CDE martin-himmelsbach
126,703,610 *0CE807A88FBC05B02516FCBA00C7EBBCC1691D99 irenepenaflor
126,703,611 *0CE88430E477DED25B5B9FC75C041F8BB7DD35D9 ir$k
126,703,612 *0CE1AD8B758AF9E51A6E71926420F6BBE78D1F0E MARVIN-BOYCE
126,703,613 *0CEFFEFF4F10EC650BF12833D81A4341FFBA32A6 maryfwood
126,703,614 *0CE75ABA06C3C8D3C4C730D91B4094AD9956349C IRVIN.HONGEVA
126,703,615 *0CE212E074E5C830F9FEC5DCC9269DF23C8D48CC ISABELARIASRAMOS
126,703,616 *0CE90541B61B24E589152C2A25256939F1FED1E6 isiahfrattali
126,703,617 *0CEED1051C13AC1583C91E2C17C43A35AA9B032C MATHEWRINGMAN
126,703,618 *0CE351CEAB57ADCAB2612D10CBB465EE927407AF mauroriche
126,703,619 *0CEDF7E781C482794422B6DFD2FDFD859F7614B0 maximowrenne
126,703,620 *0CE2A93F80F911A6651C14F4642B96F437E4A22A IVORYCONTINO
126,703,621 *0CEC70AB99A1802A91FA768D570EA33FDC8557C3 j2vb
126,703,622 *0CE56748E7F916DABE4FBD12AAB11A6DAFE16051 MELANIENOELLER
126,703,623 *0CE3228F9CBA9B7330E2D516AC910C96A9FDB63A JAMAR.TRONCOSO
126,703,624 *0CE56D239F29677A7684D05F17CE43E0D70C3525 memorizecommemorize
126,703,625 *0CE0ECB2963DE902C1158D37116D143E2E11DF85 METALENCASED
126,703,626 *0CE60A7996886BD15DA73E953273DD5038BDE8A8 jarodsommerfeldt
126,703,627 *0CE6A76AD9697426DFECE54AB9AF91454B194236 JAVORNA
126,703,628 *0CEAF65BA1A80CBA9B4B9C0C55DB41568531E9DC JAXSTONP
126,703,629 *0CE00F4A4BE5C921614AE17B75CD2EE835105CB4 JAYMISONV
126,703,630 *0CE486AEB2BE5B691BDE4B9ECD545FC4975291CE jaysonroufs
126,703,631 *0CEDB8571B4248BE56A7FD1414EE6EF922E05D53 JBERRIS
126,703,632 *0CE7B64A219BFB3ECFB546F5FE6A993C1701D999 JEANFREELEY
126,703,633 *0CEB46B4467D88E69EA9540B6FD40F1085C995F0 MICROSMATIC4
126,703,634 *0CEF79A705BB9B9FFA4AB08FA2EBB319E47816FC JEEVAN-PHILIP
126,703,635 *0CEBF9046BA40EFBF6330D120FEC558CEDC7AA44 JENMCCLURERUMINATIONSTYPEPADCOMJENMCCLURERUMINATIONS
126,703,636 *0CE82C448AC0F8BF50A6DA83CC1EBE3AF26A64E8 JEPHAH
126,703,637 *0CEB1EFDD862D37A347DBA06A48BC22C4D1B5504 millet.de.leon
126,703,638 *0CE8DD0972B05B07D8EE12A5DDA5AC4BFEA0C347 JERMAINEBETZEN
126,703,639 *0CE35E5BD791102A78989DA8614B9E3A2FF0F4B0 MING508
126,703,640 *0CEC86E6755675C3C8A0A957F25489D6E8EAFF22 jeromesoricelli
126,703,641 *0CE6C1CD82A23F80CDD0D2B488F588C934DAADD4 mirzalarini
126,703,642 *0CED4AF38A7F965B0B2CD46742F72E849EF31BBC MISCORNER/C+LLOOQTORTION
126,703,643 *0CEF86A458D263425300D0205C09CE852A0A73CF misty-dryden
126,703,644 *0CE41CCB082FFD4F6E84D6A303F4F0470AEE2F6E mitchsilkenson
126,703,645 *0CEFAD2F362DD1A65D963CEC4C4DDAB828E00FE7 [email protected]
126,703,646 *0CEA792AFE79F49D9B81BF500E371A68FBA59E9B moisesvallier
126,703,647 *0CE60D4DE0CEEE52DAB0D7D09F03878C21788066 MONARCHISTENS
126,703,648 *0CEF322B04C0543D307EF019F36263D48A881CA9 MOONYKHAN
126,703,649 *0CE0BB8F1F1CB4A1573656BF58D1BB14957C2330 JOHNATHON.KLOSKA
126,703,650 *0CE81AE00D7EDA71C58263B40B40FE08BD638228 MORTON.TAWNEY
126,703,651 *0CE57DA077E0899D5B7F9A0DC9849494954016AB JONATHON.CHESHER
126,703,652 *0CE5D6E59712BBE5E48D234F4D283CE48FA85BE0 MR10075421
126,703,653 *0CED40DE47A57FF00FE9C6322EE35CBC9D9D32A2 MRAZZINO
126,703,654 *0CE141D6A5A00D6E95663B19BBB9B2321289AEC3 jonmozer
126,703,655 *0CE57A064E0F5A9DAB0FB941D46718C8DCF32D8F JONUS975
126,703,656 *0CEFC477D3FBED606F15134B6AE51F22664E9CB4 JORDAN FUSCO
126,703,657 *0CE8D296487C2C824DD840E9F9DAF0E6292AAFFF mrofevaw8
126,703,658 *0CE8601879F0B3BDA4F9F89ED8F394FB7A88BE89 JORDON.BOETTNER
126,703,659 *0CEA375EEE14BD523E00775E61738E46AE4D773F JORDON.COATES
126,703,660 *0CE4BB54111FB2FA8DDF2612C59F43BE893B401A JORGE.GAONA
126,703,661 *0CE306E40408C5D8D4894870FFECCD8C9EC88DBB JOSPEHCANNINGTON
126,703,662 *0CE2A04FA0CA6A40C0F55BD5C714A94AAE3C9F9D mumi20
126,703,663 *0CEF90B7FB5CAC2C432F3C3D2E5CC464D0C14234 M*WD
126,703,664 *0CE427994DFCA9B093C85E269FA728C232DDE53E [email protected]
126,703,665 *0CED39CBFAF6EBA04629489136C6581CD9456751 JSLKANGOSHI
126,703,666 *0CE81E766A64A51851E17EA5259DCAD53F810118 MYERSRUMSFELD
126,703,667 *0CE4F8FE8874AF8348FB49FF5631830ACFDFF29F juansim
126,703,668 *0CEA974C7A719F3968D190A72345A0AD86F505A6 JULIAN.VIETTI
126,703,669 *0CE6E55118C013824063165E916D2A83C811B6A0 MyTroublesFloatAwayLikeFallenLeaves
126,703,670 *0CE4AD13406C2303FCCD307D5BB108FC77F2BA63 juliusrusteika
126,703,671 *0CE0F6DC0F48BA9EFBCC268EE0635C35A43DB4D0 JUNIORBREWER
126,703,672 *0CE07A76FE71CFF317A1BBEA8F9AFAE94C45A29A n0lw
126,703,673 *0CEAB591DF393F22989DE55C57068B5A92944E4C just.help.me.please
126,703,674 *0CEED6EEA4F828BDF1D3F31A8A350C862E1DAEEB justine.davids
126,703,675 *0CE4E8F6B22882626E8FAEFE012780DFCB53A322 jvobonxhrldj9
126,703,676 *0CEC7F50BC31AD78E5688F7239BD31DD12A7CF13 k4+4boli5m
126,703,677 *0CEF2DCD93A0F8A0FC272286DA7AD987EA180DBE [email protected]
126,703,678 *0CEC517854E8F9547DA298270E4091A1045C0E64 NAME2006CENSCOMMUNGT
126,703,679 *0CE18460FE7A96EE2D294F76E0CB8D9EB9DBE889 KALSUNSILYO
126,703,680 *0CEE78593D749A6B8C06B5DA230BD0BE84A8A126 KALVBEIN0
126,703,681 *0CEEC852D3E60C18C63FD3FD84A12A6C7D994199 kalvflaawt
126,703,682 *0CEB0027189E339FAA3C9FFE8E882B5D6CD41D31 NATUƦALIZOU
126,703,683 *0CE06CFC172A023A0D4BEA2275A72E4D479856BB KATHLEEN B MARTIN
126,703,684 *0CE5373A62192B23BB0B7E34F4904F0D105E69BC kavelsloot3
126,703,685 *0CE958064EC7AEF3D27083B609E770B7720A2433 {keaaa
126,703,686 *0CE6A7D00F8FDBCA902F57B74144F23511AE1815 kelleykovalik
126,703,687 *0CEDFE4F83410A5D319589B9F5EBEEB0DA9F2345 KENETHVERT
126,703,688 *0CEFC4FC35726A415EC0C7C272ACEA2A4EDAC3BC KENLAND7
126,703,689 *0CE47754A637B10A372D10E39C605B4A4E7600CD neva.die.alone.(feat..tragedy.khadafi)
126,703,690 *0CE4A999A3522E84307F6BA21A3967352136E638 KENYANGSTEAUA
126,703,691 *0CEB17136E62C17E1D2F6A0EC76A84D50FBC458A [email protected]
126,703,692 *0CED0B63D1853A1F8E893DA29E34CB3CA0D056BC [email protected]
126,703,693 *0CE31BF7E64FC1AD44B026EDCA25D8D17E754409 KERSMANS
126,703,694 *0CE7A8E29487836AA762D0FE19A8C62CA3F88530 NICK.KOHATSU
126,703,695 *0CECDA804F9B20EF83FB8DA094EE1E674EE9D73E [email protected]
126,703,696 *0CECAEE6E0D8580E62E03EAF0AB3BCFE9992781F kiersten
126,703,697 *0CEF71DF26E4BD22DA6B3CF81CF17DD12646D0E0 KILLOUGHKIH1LAW0
126,703,698 *0CE045640F6989BBE360308B987EBE254DD4282E kingpike
126,703,699 *0CEBC73792D05A569510AD3794E0C381866A8DBA nineteennineties.ci
126,703,700 *0CE1AA028000FF74A4C623B232873D3AEDE52733 nittany-lion-special
126,703,701 *0CEA5D2DB397C3EA12B11EC01B5FCBD12F9D4C46 NIUKKAAN5
126,703,702 *0CE39B2F1F54EB990B33B33DACC2BCEFF3C74EBB KLEENEXDOOM
126,703,703 *0CE40892A780F65CC4FDA089A79D1CAFA78B2273 noahton
126,703,704 *0CE48FB9314E41164194E3CA99C8FA64D70C151B NOISE-INTENSITY
126,703,705 *0CEF7BA11FF6D4F86D8D39079D237F38D1B80438 NON-PERMEATING
126,703,706 *0CE476D3D9CB41E30E6C66F686BB28E9BECAED4C norbertmahnke
126,703,707 *0CE16F62C7EC32F585BDD69AF3D5FD63630AD2BE NOT KING JAMES VERSION
126,703,708 *0CE4EE700D430D4325B04F31D38D1416C2CD7BDF novilloa
126,703,709 *0CECAD573FAF95170AC65B76F151AA21C3E3C0C0 [email protected]
126,703,710 *0CE0D74A7AEB223024EC7215A79CD02E19FC0865 NSCHNKNED
126,703,711 *0CEE3CC516A547CE83EF1CD0E052E4B483DF0C0B KRIDLERS
126,703,712 *0CE60C705823846EC362950550BFE858BCDF6A5D NTSTFFN7
126,703,713 *0CEFE1DB6724A5EB6B47EAE12FF028CA873882ED kristopherausman
126,703,714 *0CE4DE1B43E6D5947405AE3B588E83C1B332957C numenclatura
126,703,715 *0CE2B9C7587F81AA5C038EFFD831B19476A701A9 KÜBELBEREICH
126,703,716 *0CECE131A74F672C2CD55301CD7F3B3CEB0E6467 kurkens0
126,703,717 *0CECF263213F7ACBDEFB3DB297D15FCC7C94AB7A [email protected]
126,703,718 *0CE57EED4921B343E68802AD14A24A8F7B8A2474 KURTISBERRETTI
126,703,719 *0CE42FC73835D2A2A3F061B2EA6A292376E342CA (><)o~0~ <====b
126,703,720 *0CEB0A058A8721B246E2F7836AA6C9040BBD526C (o_)0~(====p
126,703,721 *0CEF9919806FE6A8F01076A00BF370ED24BE5180 obitavanjem
126,703,722 *0CED2862F50CE264DBA79C486B93DFAC99F7C547 l::
126,703,723 *0CEAA5A748A55A6367831FAA6CF35C0F1920767C OCTAVIO.COAKLEY
126,703,724 *0CEDECA7FABF2FA2696878B5BFDA0AC685CA321B [email protected]
126,703,725 *0CE95A2F353079C7376F9D7EA5F0E86F767FC026 LAGK
126,703,726 *0CE7700D6FBB3BB2C5D3D895F5FCE50F01764411 ohtannenbaum/achbittrerwinter/nachgr
126,703,727 *0CEFEFF7CEE76CFC7B9CD95C9F2CEBDBA3C57AAC LANDROVER-SAFARI-DIESEL---WINDOW-OPENED-AND-CLOSED
126,703,728 *0CE4227CFED3BD455441D1C22400F65C23EFAA4A landssty3
126,703,729 *0CE6536D874DE3CC845C8AAC7BA080279FE7BF38 lannynavedo
126,703,730 *0CE1C66A146700CB24487FE2499906EE8A7973DD LAREIDA4
126,703,731 *0CE704286FD65D050B9EBC26BDA13467CDED92A5 omoriomori
126,703,732 *0CE4D9B5F26C969853CE3E95AF08A345024D2C79 OMOROGBEDANIEL
126,703,733 *0CEFD8E88D70C10AA762696CF574A6360A75BBCE LASCELLS4
126,703,734 *0CE148CC0696C101E268EB4287F15EA24241D940 LASERMAN1234
126,703,735 *0CE7E53D8E0B1D5C179E75BBEB29A615C7053E53 O MY DARLIN' CLEMENTINE
126,703,736 *0CE6F0ADE59987CB8973F123BDA2B7C002FD5651 LAVERN.BLANDA
126,703,737 *0CE78040C32220BD62C7EF1BDD9988B407FB468E LAVOITTE7
126,703,738 *0CEC832EC02C725EA8770B3B19A727E33261DBA9 (>_<)[email protected]
126,703,739 *0CE0B2BD1B436A136030947D20A6D99C5BA5900A [email protected]
126,703,740 *0CEFA01206DA3403051DA89FA20CC2B2FD0789AC OR3OTROCHILU5
126,703,741 *0CE1ECF57C7B7077E1D0241E69EDB1BCAE3A41B6 LEFTHANDEDWAY
126,703,742 *0CE5D5610375D6352E7AF7791B82B5D1AE736DAA ORIGINAL.WINGS
126,703,743 *0CE3BD239CDAF827F6593A969F810354FF1B7043 orlandowikholm
126,703,744 *0CEED59B591F95042BEFF682A3B80DB827A99A40 orvalcrye
126,703,745 *0CEA589480F0BC1935397EB0577A8961D9AFDA73 ORVILLENEGRISOR
126,703,746 *0CEC1BED4A67D3FC6B8DF28ABAC5595BDBCEB3D4 lemuel-delos-reyes
126,703,747 *0CEB9A5D5549B064D27C985E21C8303CFFDFDBD7 LENMERY
126,703,748 *0CEAA1B524FCF67AF5E3562B82B84C0BBB790EDE LEO.FURBISH
126,703,749 *0CEEB44183B331C7986F14DD91146F25FC980F32 OSWALDOPARONE
126,703,750 *0CE0B8A1F834CD3B3E53566FB698506B9930B639 leonellarmon
126,703,751 *0CE7094C0A35024051120B778914066C1E444147 LEONEL-PASCUAL
126,703,752 *0CE63036FE74181F1209403D42EC5A7A91214AA1 LESLIETOMER
126,703,753 *0CE46122E633E40AACBAF9918F3C543B46B857AF ovenly$en
126,703,754 *0CEA9FEFCE95E128401FF5D817D156A71B09F0CD overmundsprotesens
126,703,755 *0CE0E033ECAEBD260C4D783CC81BA0033D6F7266 OVERTUIGNG
126,703,756 *0CE9E9689E1FCF78A89C37BDE9C26444D98AC0F2 OYZG1298
126,703,757 *0CEAA6C7D15A5F14E28C1563F697F1D80CABB2C5 [email protected]
126,703,758 *0CEEEC6F831DE1753196F1B8ED597E988DEF7390 LI[B
126,703,759 *0CEFD9607F14A453D0E2040BD3C306C098F568E0 lifestyles-of-the-living-dead
126,703,760 *0CE5A44709422665B0C7C37E4D3D9F850E185B9D [email protected]
126,703,761 *0CE0022715448BE687EBC7866F15114DE6772DE7 [email protected]
126,703,762 *0CE727B5CB59D7FB8426A9B11C2DF79CB217C739 pałkierowie
126,703,763 *0CE2EE486FCB1F4B7CDFA3F3F249022599C58A0F linhardted
126,703,764 *0CE1C35FE29B9AD055C1E8005A5C327DDF5890C3 PANDUPURNAMA
126,703,765 *0CEF3241D50FE4AE77FF9F64B872CF068076E433 LIONKINGKAYLA
126,703,766 *0CE07E7609354532D3F4AE24BE3E5803833B4C56 LISTANT.
126,703,767 *0CE943460F0AA08D263F1344DD647ECB32927393 [email protected]
126,703,768 *0CE1BD157881DA56D8BA6D0AC50084FF58C619AC PARAOSMIAS
126,703,769 *0CEC68FB4F4D7AA1DA9E1F326AC1E50337A30707 PARTITA IN B MINOR (FRENCH OVERTURE), BWV 831 - 1. OUVERTURE
126,703,770 *0CE48F6DFE5A10FF490586D34D46FF09E6B4DB74 patentor
126,703,771 *0CEE9A912830C3DD48C199E494E8F084D53FA88A paulanglum
126,703,772 *0CEF4A5591844C52F0A35ACE861EAD548CDB96E6 PAUL.BLOXHAM
126,703,773 *0CE0BFDBC618E2FD4C025518A6CDA75507294468 P#B~(_0)
126,703,774 *0CEB6C6CB76E71AC53AF9164038AC621121F90C2 LONGVEAEK
126,703,775 *0CE4543B482DF97ED90159E655E9827AB1F7C26B PDUBBSW3
126,703,776 *0CE44847A010F4AB96467F5D6ABDF8D65E08E406 LONNIE.VICHIDVONGSA
126,703,777 *0CE16FAA68567E02B04FC3E503F1B30A88CEE6C0 lordhimshe
126,703,778 *0CEEA5DAEBFF8CD152ABC8C73DE935A57DDF319A louieschnorr
126,703,779 *0CE157150B0F55B444C01084B59223EA65C5BD1E penniesontherailroad
126,703,780 *0CE0192F326B8C08D8FEB8F4BD9B9FCE3CF2E2A7 PEPITA.GREUS
126,703,781 *0CE46089971C699441C2865A7E77AA72A0AAC2E0 loumooe
126,703,782 *0CED5C3BB80047D6B429337EA6479B20240BE4CE PEQUOTFOLKETS
126,703,783 *0CEB5F799367E0A4C12AD8F3C6CEA098CAF509C6 PERIYTYIHN
126,703,784 *0CE0EFEEF47440D8B936BD311CF2A27183A81804 PERUSMATERIAALISTA
126,703,785 *0CEF2CE4AB2174B35AAEA71B9228154F5ED4A65B LUCKYLEING
126,703,786 *0CEE348AACCA9F2E8D78A600B8E88DA3B14B4FCE <p><font size="+1"><tt>cornets</tt></font></p>
126,703,787 *0CE98F0FFF1B7EAEB228CAFF3FFD43D9333A52D2 LUJJ
126,703,788 *0CE2F390217558519EECBCE1CE6C0C93D9737E06 LULLABY:ONEWOMAN
126,703,789 *0CE8E1CDBA9DE215E0C9547A0217C9B9D503652B [email protected]
126,703,790 *0CE8A57F7A96824F2D9107B19161F5D8A88C37FA PINXBR
126,703,791 *0CEFB27E49F6485EC64A89085BCD457376F5DC3D PIONERPERIODE
126,703,792 *0CEA73C8D0EFDF55F9DC11C4EEE52D1BCE3922AE M4$0NBEE
126,703,793 *0CE7D2046B8AE509DB0AABB70B9CD7468A2D7FEC plantenalbums5
126,703,794 *0CECFEAF6B616D01E5700F23879E60F51533D9BB maaler8
126,703,795 *0CEF13F6ADC564EBFFC55959169FDC4E791EAF77 mach-mal-dampf!
126,703,796 *0CE4E6F3889EBFFDCCF87F3F904DC9FF14B64669 PMASTERBARBER
126,703,797 *0CE92B247D2D9DA6B743DB7EFED2DCA3CED1BEF5 MAHER-MOSTAFA
126,703,798 *0CE34689B84BD4E615AA5A568D28D6967C5ED5D9 POLITANKI
126,703,799 *0CE11AF0F0B2FCA6BE3F83C72B601054477C1F4A MAHMOUDMOSSALEM
126,703,800 *0CE98B952DC784E4F247A0F10EA50A503CB1C141 p####@.~O.~o(O_-)
126,703,801 *0CEA72F899BF79AEB04F1D496D051F11E5FF258F mandag6
126,703,802 *0CEB50EAD72E4C53D6C94BCDE56D8CDBED23CDEF MANTRABROWNS
126,703,803 *0CE914C36EC156F2AE56113D9E6EFA1A52E9783C PÖYTÄTENNISLIITTOJEN
126,703,804 *0CE945F3404B0645393B184511E0B46604EDDDE2 (PPR.V).JENKKA.USKON.PUHDISTAMISESTA.(TWIST)
126,703,805 *0CEEE0BFB91BD8F2EA1560EC8B03B70B5723531E p===p~ ~splat
126,703,806 *0CE0138F9756F75E9D7063D392BC79357CCE8263 PRCNTHSS7
126,703,807 *0CE5FF4DEDEE2451570A1C3A7D25A29C7A6F8835 MARCUSCHRISTYBLOGSPOTCOMMARCUSCHRISTY
126,703,808 *0CE81670B5341A998C90BEBFCFFB48C5AFB77D19 MARIENASUNCION
126,703,809 *0CEF792297EC2F0DCCCABE0F33099553E3193135 MARKITPROMOTIONS
126,703,810 *0CECACBFAB7492DD69CC8837A0B2084015B06243 PRODUIRAIT6
126,703,811 *0CE2D4456B31C00D1A229D40C91D31D274680DDB PRODUKTIONEN 
126,703,812 *0CEE4014B246E580DFB39F8BF3D364788C26416A MARTY.MUNYON
126,703,813 *0CEE8E580E13E4CB756CC00978CE1694A30E9EF8 [email protected]
126,703,814 *0CE232484F983DB2F6E66195941530F4CA7F9F76 punitivo
126,703,815 *0CEC2A6A05CF10335CF8CBFEFC09BD2B328A6262 MAURICIO-CHACON
126,703,816 *0CEE97E4E2594B2D7DE5D4B0468C8D301EA589F4 pxemによるhello
126,703,817 *0CE9363021150BBDAA7339CD4BB849D7A5A6506D [email protected]
126,703,818 *0CE3F83ED4BF5D56C1764D16CC3935A48C86C0E8 Q7509
126,703,819 *0CE13ED40884E454F94D234E022DC057AF97F9B1 qB~`(0_<)
126,703,820 *0CE01FF14F57231D4AABCECBC8F5687F731E9BB4 MEINNARD1
126,703,821 *0CE6FB4DCB338A2FAEA40BE4E4CE482ED7FE37F5 melitine2
126,703,822 *0CE6224974016D5E8C741EB972004B0EE6B7EC83 [email protected]
126,703,823 *0CE9F426798CFABA5E5FF3F0B75D407279F38CD2 [email protected]
126,703,824 *0CE89349987F53408899A303928291D2C747F1F0 q:s^
126,703,825 *0CE6F2147154B1F959371011524903D2E66BADF1 metapolitical5
126,703,826 *0CEF271AEB334CED23EFCB872676067091BA2C0A QUADSEMOTOCOM
126,703,827 *0CEED3F422DA446D7A5CC242D409058A701FD1AD MFITNESS3
126,703,828 *0CE7F150CE3E16D18AF3265293C481AE6966DD5F michaelides: the divine liturgy : xxvi communion of the clergy
126,703,829 *0CEA61D0B068B6B6E80CDB50FD6D6FBCC987AFF4 MICHELNAFF
126,703,830 *0CE9DB830FFCC53BE36A1DEF0FF7FE4D2B6350E7 miguelfuoco
126,703,831 *0CEB8A7C2F1C56A891986FF3154154B9152BEDD9 mikescheuerman
126,703,832 *0CE75F99F1B9AD02C561B57BA42D850B5019E689 rafaelbanbury
126,703,833 *0CE9405273595A91C4B4A36E71981BD2490ED3CB minhmasuda
126,703,834 *0CED24D9E0D5F437DB0B67B4BB98B2D413E03BA9 MINNETONKACH
126,703,835 *0CEF2D2C7E734068C16FDB46EBC11DCF28B7E636 RAMIROLANDINGHAM
126,703,836 *0CE9D34400A2CBCD6453D9C882A96C5F760B35D4 randalbohac
126,703,837 *0CE45606A8D74E28028EFB98644F93A1EB410F2A RANDOLPH.VAUGHN
126,703,838 *0CEA61E16D8C4090538A1D0A5FA2C82E6122DF1C RANDY-CUKA
126,703,839 *0CEEC0D0EBA13034D064DC6FD327D65872701F3B raphaelkalichman
126,703,840 *0CEB21C576717B9EF5F93810417146CD8D3350FA mitchmarolf
126,703,841 *0CE724C323886F61FA3C27FDEC4FB837113481B0 mitchtraino
126,703,842 *0CECFDD9C8DE6BFAA99652DFAC81BA70B0149422 mixed-sting-2
126,703,843 *0CEE467EE71562D235CC345EFF5B85416958CBE9 RAYMONDBECKELHEIMER
126,703,844 *0CE418E09705CBDF6770748D32DFC32471021138 M)$L
126,703,845 *0CEBCFBE9126E77D3FD38DC61BD973F245DEEBFB RCCRRNC1
126,703,846 *0CE93DBEC278E92DDAB7DA8CA797487807904A48 [email protected]
126,703,847 *0CE67241E369752EB95E9B16AD266A1F11F28AC2 MOCKFULL9
126,703,848 *0CE76A2384C8A85A6E6D7C0C90EEEF22CDFDB3DF Model.Bitch.(Runway.version)
126,703,849 *0CE08661E573AEEC003E354220A15347A76A7CEE REBOLTREBOLT6
126,703,850 *0CE1C67DE6E610CC4A0BC6D82327A8841767E2ED [email protected]
126,703,851 *0CE1CE30098C0D5F1C012DE0C9E856967D9D686F REDÉTERRER
126,703,852 *0CEE8C7FE1E2CBE90DDA61A6FE050B9C00712934 MONTH.ZAYZAYEM
126,703,853 *0CE5084392BA3841E9ED248DA171DD98E5FEC7DA REEFERCHEESE2
126,703,854 *0CEF77A1A1FBAFD18734A05A849C7D8A09772F19 morgam(dzihan&kamien'sshhhh...remix)
126,703,855 *0CEC1D960624EEEEEA11E8A69F927D941314ED95 MORTONDEZAYAS
126,703,856 *0CE1B139D010E54CA1E538D3F0B05D3002135FA4 „motecta“
126,703,857 *0CE83DE45D8BB130A5BCB11CD1E6E40E2C4FF88D REMIHANAE
126,703,858 *0CE42EDC21A4A834E004794E36B47073A791497B REMSINAK4
126,703,859 *0CE3E15CB1B6650D939C06AA797C6ECAC3D73848 [email protected]
126,703,860 *0CEE60EBB25E616481F9C7D376B299B6F2EEF33C MPPD5
126,703,861 *0CEAA5145A6F8297D41193FC01A56279B6C14A01 MPRT
126,703,862 *0CE5DCEB6B4410F873F58F7003C1119CC91D4C37 RENATE-MULLER
126,703,863 *0CE2F5A80627C035A09A491C4B24899C2C1E7026 [email protected]
126,703,864 *0CE90E3EA1BA299807355328405745206B193153 msivuaf
126,703,865 *0CEEA9BB4988C3A4362AB5B636D76912CE40D79E renullify1
126,703,866 *0CEC07464FA8BB643A8B7C6EB04C30B850F1160B [email protected]
126,703,867 *0CECCC8201CACB70E165CD0A7546B3294656E389 MTHREEIGHTSEVEN
126,703,868 *0CE6E0CB97D2A4CBB322D41390BE47EA74C143E8 requiem,op48:iintroitusetkyrie
126,703,869 *0CE36C720F5A79B068FB449C6578D486DCF417F1 MUKEIKOT6
126,703,870 *0CE1279144A520DEAC3A564CD1C0159E0E27F0AD RESULTANT
126,703,871 *0CE09520B1B316728556150A894446064A99E863 murraykenny
126,703,872 *0CE6AF424A4A7B64A3CA13152AAC2F0F531AB74E retsnomregor
126,703,873 *0CE2DF3CBB862955C4732DE69CE11727C7A1F4D8 music for the theatre: iv burlesque
126,703,874 *0CEE34F5E479497ED425C0211E4564F528599036 REVELTA3
126,703,875 *0CE55D11DB6175B4C03962549D57CD4575DD9B98 REVISANDETS0
126,703,876 *0CEDE214BFC5D9EC98702FF1F02A4353756AEE64 rewrotev3
126,703,877 *0CEE9317E25981C87E24E2A4A9E62EFF2D04C3C0 REYNALDO.SAMBUCETTI
126,703,878 *0CE8F0F5C177751EC05D005FC3024009CDBEB761 reynoldsagain
126,703,879 *0CEDDF7D066FFB872D2F320AF9B92EC903041593 REY.SWANDER
126,703,880 *0CEC34AEFBEB3A8E3603E00E8E70F3734B1694CF RHP50D1Z1NG
126,703,881 *0CEA787334E067636A4C33DA710D430CAF138E0A MYMONET53
126,703,882 *0CEE55CEAEA4E408A39557E96D952DA137B5A432 RICARDOSIECZKOWSKI
126,703,883 *0CE090F0BBA3B7AD247579F96C229A9EEDF459F6 MYRON.RUSSLER
126,703,884 *0CED8E75D580078C8432A9A006900A7E10C10149 MYSCUBA11990
126,703,885 *0CE5EF5EE2880112579C355E9A91A3642DA4FF90 richiespille
126,703,886 *0CE577729FD07257DF25F5C372B84558F4D8BFD0 [email protected]
126,703,887 *0CE1135BCD8D838C6D80639EE2C58E956E2AB2D0 RIDARH
126,703,888 *0CE3205B4FF77DB4AA4B0828C6C0A527B4CECDE7 rikki-coleman
126,703,889 *0CEF88C77EEC78B2AFD3E326EFD7BB7C48C6755C RIVMECEDS
126,703,890 *0CEB61DC370DCB723B55DB8E57C8E0949F528A0B RKINDLMANN
126,703,891 *0CE35FDE68B255162EC9A31E99CD9998252D1F2F NANTIRIONS8
126,703,892 *0CE06A7796CA860CC25A90C92AF5188A7DE27524 RNDTRPS1
126,703,893 *0CE9CE8F56B4E5466D565D1628A7D290E1DDB495 ROB.BORY
126,703,894 *0CE613C449888A06097B1A4CB554CD065D017649 ROBBY.KOSICKI
126,703,895 *0CE47669C445D5639FCD91212E74250F0AC4D6EC NATHANIALSHADDUCK
126,703,896 *0CE2E1AFBA222A71E14EBA0D185AA476FCB58783 nathan-labelle
126,703,897 *0CEEA137E6C0DF175DFB91F96AF0F8381A627CED robinsukhram
126,703,898 *0CE3E6150C004DF3065D536AE91B582B1AB3BD89 NBUYANIN
126,703,899 *0CE3E86EA50A1B0AFA7B839839AFFEB5743FB0C8 RODGER.HERREA
126,703,900 *0CEA2CF0B763AC2E87713AE03B3C4EF212D53C82 rodgerkrehbiel
126,703,901 *0CEA456614544EDAFC22911A86323499E0794EE2 RODNEY.PEDRO
126,703,902 *0CEE5765E5CF23C3046D90AA7371B5CB1B7F8F05 RODOLFO.SETON
126,703,903 *0CE83951D277E1D085FDD29CA29A03E8CD4FA1BB NEKRVAV2
126,703,904 *0CE54DB83A10F5CC0B50A2F45490E706F7D8BD65 NEODMLOUVANI
126,703,905 *0CEFA9F0B16108D63B7708413E09F702A25DA1CF NETTINGS
126,703,906 *0CE8A711ED738ADB2E9233F7B98F4BB155C19776 ron-corey
126,703,907 *0CE7E38BD443F2FC66D2858325130E31F9188B78 NFRCBLY
126,703,908 *0CE062E9A93B8683C2F76D0F9A9AF7EB9503F7BA NGER":III.TEMACONVARIAZIONI(ANDANTE)
126,703,909 *0CEE5A36D766024F5EC7875D6E98ECEEA01F28A9 ronniejauron
126,703,910 *0CE2EFB461316A8CE1CBF1988CC7E47604FE0E2B [email protected]
126,703,911 *0CE1D44F0D76912FEF3FE55706F5F34589E00448 RON SUTTER
126,703,912 *0CE6CD8056FD1843A4A58CCACE58C88AC32FB710 ROOSTERGENERAL8
126,703,913 *0CE40B9B395C6A8257094CA53BF7A8CEA5729E6C rootcell6
126,703,914 *0CE7FE0B5C7D8BED630075D18DFF50DE27E0ABE5 nickolasfostervold
126,703,915 *0CE7738BDC0640B1E419368BDD947602A9811D11 NIMESIHEHKU
126,703,916 *0CEBB8F903C37D4BC134051201897C4FA0A8D1F6 ROTOMNENED
126,703,917 *0CE1E158FAD363C5E0572131E6BD37C63B34D4E4 NMAKKER
126,703,918 *0CE335C2B97EF444DBECF594545C4D01F7214364 NNAMDIIBE
126,703,919 *0CE7D2114A63AFCC480445AD2D9078A8D4EDC10B NORMAHMOHAMED
126,703,920 *0CE27F17CD95B380FF962AEF81D1462812F7EB5F RUFUS.PURINGTON
126,703,921 *0CEA281A86934F6C3BB88685075DBACB7A84A26F NORVIKS6
126,703,922 *0CE3F32D3437B97A3CA2E8E4DC0BC8B7668733B1 RUSS.GRUM
126,703,923 *0CE6CAA44C91B96C1F3E5B4A432A507F75F8BFCB NQO/
126,703,924 *0CE566C3E636EC45D053C8D39EF7992A6C757F48 RYBBHZRLSDED4
126,703,925 *0CE96F8CA538DC21BF3FC314CACDF37E3596DD19 S2A
126,703,926 *0CE5F374AF81E20361C896C20E21403408E667C6 [email protected]
126,703,927 *0CE5CF4D1107748C22F38B51BAB4018A5D7BCF1B [email protected]
126,703,928 *0CEF6946FDC7A16B7ACEC44BE3599752B80B55D6 nze op.72 nr.7 in cdur
126,703,929 *0CE7C65E87898A15D435215A4B913EB4D1403ACC >< O~ @==8
126,703,930 *0CEE51DF755C8782C88E854CF99DAC7BDDC24E20 safe-haven-(f)
126,703,931 *0CE293887B73C7FE56C526F084DB609391A879BC OCTAVIAS1
126,703,932 *0CE196DDD1FA81CDA018045656CA2AADC3F5CDDB ocurres
126,703,933 *0CE63319D165C617F02E895C5F5ED90C5F833A9A ODOEREN0
126,703,934 *0CEB743311F23F439EA1BFC67D230A883218E570 sammybeal
126,703,935 *0CE89319924F898D259CA4B9C7A1DCB17EAF7CEA OGIEFBOOG9
126,703,936 *0CE4037DF18ECA351B02C8CA3028302869D5CCDE sandyschisler
126,703,937 *0CE20C4CFD38454145A9E3A981F8C95C9E3318CD olatnurf
126,703,938 *0CE51C2C23CC88E4CCDA193DB767429DE4E43311 OLDINA
126,703,939 *0CE8FDB6FF87E6C51192478089527422ABE65768 ole178
126,703,940 *0CE0037C7F7E8291B53CB410C817CD3BA5A2A9C1 santocothran
126,703,941 *0CE296DBF636C4E372F79D42D4F02B0080FFF314 SANTOS.VANSYCKLE
126,703,942 *0CE6247753B826F9D85B31B78C266FAC2EA03DD4 SARAH.DOWSETT
126,703,943 *0CE07C6383C86F4E29F17A55FBBC4CDB773C0101 OLLIE.KRUPIAK
126,703,944 *0CE4E191AE749BDB56995893A08310420A1BFCA0 OLOFHIORTER
126,703,945 *0CEA47B7CB755F45FCC9B7E26CA7835B127E555D SATHIADASS
126,703,946 *0CE72B55444192002418D3C5772E15F25D4D0930 SATURNIAE9
126,703,947 *0CE8AD57058BE68831A37C31BF1AD26C1796B39B ON-ME
126,703,948 *0CE021FBE91413A07BF4B21D8C3A9E2810049EFF ONTSKIET3
126,703,949 *0CE09E0EDDFCBB29D82451C476D42B3A2B866B29 SCAËLIN
126,703,950 *0CE17B1C80B2F446B206FDCDE1251C94EEED48C1 scambiastes
126,703,951 *0CE054E66BE4CF592F3C26E1D817DCF9B12FBFBF o,Q
126,703,952 *0CEACD4AA1FAE0C73CD80E327F075508D8303E65 )o(~`q#3
126,703,953 *0CE7C4B33E181DCA6BAFE18AA4EF7CEACA0EC169 }O{Q==P
126,703,954 *0CE6C5A6D2F8296E815370AB814ECDE57B243D8F OREREVVA5
126,703,955 *0CE51E8DB32F95819153ECFBAE0A8A68EF524C85 SCOTTPHAM
126,703,956 *0CEAA2EA1ABB9373FB11FD139F0FB692E2DFB578 SCOTTYHALMA
126,703,957 *0CE045A7B3221E68D4B4B442F72CA70D20984FD2 ORVILLECARPENTER
126,703,958 *0CEC3D25592E88E9D243348684C081D380989F6B ORVILLEWALTERMAN
126,703,959 *0CE4DF08F35D6999B0DFF8D4A2738B489E30A2CF ORVILLE.WINKELMAN
126,703,960 *0CE2F6C620DB2760ECBD1B3580730F75731C3BF6 seananne3
126,703,961 *0CE0F010FC6482C49EAF551A5AFB32BC33AE961F OTIS.ISERI
126,703,962 *0CE3EF9AB5AE7EC6D7BE5232857D6ED045CF15F0 SEIDX123
126,703,963 *0CEE3DD4E506F4FDE486E0E17BCCA86C423C40F8 SEKULARNE8
126,703,964 *0CE5E54D961E3CBCCF6B09943840240AB5E7EB58 P}0C
126,703,965 *0CE66D4EECF70BADBB0D30E984004F469FDCC49E SERVOMULTIPLIERS1
126,703,966 *0CEE3092541D2E95EC78B23B93698A0724EC9D34 pacsunbabii04
126,703,967 *0CE752818E8ABA927D8180D8920D22CC18455D1D palfreis
126,703,968 *0CE878BBA876F77E01579B7D418F390F3B85927D SGAJSGAJ
126,703,969 *0CE38E1469545D38FE948DC89BC37B2EE3A58D6D palmerball
126,703,970 *0CEBE837A4635D2D1329B3C387FE19C8023653B3 shadkempter
126,703,971 *0CE55D63256B66973A087EB1791BAFD95F01E9EF [email protected]
126,703,972 *0CEC29E266C5114B356EDF0B6FA9461DAC70A25E SHANE.MONROW
126,703,973 *0CEE275D5BE2BC2B4D9AD98F5A563FE9E187B3F1 SHANNON.SPRINGER
126,703,974 *0CE4C5EBE746E7B7BCBA35ECF73F7EAE38CA8C50 SHARADAPRABHU
126,703,975 *0CEB42BFB228D24F91A8BEC3D273528E0F81206F PARTY Z
126,703,976 *0CE0F4385E9F06B3FB0259CD11C5AC1F806156A9 PASPALI1
126,703,977 *0CE80A1AE95107218FB668D968EB07A037C73F5B PATHYAHED
126,703,978 *0CE8E1B497445620EF9F737F29EDCD4C9441EC0A sheltonrunkel
126,703,979 *0CED086CB7080A1BCBBBA29F0D2A26C39D2D75B1 patti.totten
126,703,980 *0CE7EAEEAEEC00647E29A93D2A11DD8AFA6A386D PAULVERGHESE
126,703,981 *0CEDCDDB8DF5BC397222F63C860372095E388DBD shermancrane
126,703,982 *0CE0BAB7B96519ADCAFB5A604AC893571C69444E p>~~~>B0
126,703,983 *0CEEB078CFB09A9F0E3697D87513A2F77756E07B P---B~.(>_0)
126,703,984 *0CEF622A62092C2555DEAA760A9FD358A61FB97F sherwoodkreiner
126,703,985 *0CE89F03A2857040DBF684DBE18796312FE133EA p#b~-~->-b0
126,703,986 *0CE92B81F604519DF82203831CB7D67C2A8C2262 p-D-`-(-_0)
126,703,987 *0CE8C860AD56D92F08FEFF0E102BFFCF43C9785E [email protected]
126,703,988 *0CE03EE27FFC6CEA8F63B2C0E4CE1086E4BD8089 [email protected]
126,703,989 *0CEAFA563E13C12A77DCD3418D33C52E40A3359F percussin9
126,703,990 *0CE307370397C7B9EF03F494391F9A5DE9ABAB79 sierra
126,703,991 *0CE5BBF855B4531E78B8A76CB3877BCC36B27CA6 [email protected]
126,703,992 *0CED0631174BBE6CA14ADD06C8F5B92E8347B20F petergyles
126,703,993 *0CEE1833BE75FF9A4F5099D192E564B7FF1F994D SIMON.MENSAH
126,703,994 *0CE959987D3DCFC569765B62D6C3C5C1C18201C3 SINA20050810
126,703,995 *0CE3D15D6C9C905B5516EB60728548EF25F2C0C9 sinsley3
126,703,996 *0CE49806A7D38E0CC64D3A7FDF3B3B759A294E5E phillipemmerich
126,703,997 *0CE93542F84E8D638150B9E1DA37A06DB89B5A4C PHONEBOOTH.CREEP
126,703,998 *0CE57A72A9FED56DB8922F026A28FD2EF129D3EB phylloscopine0
126,703,999 *0CEADD04D454DAA7106E91B196C454E357A62A91 SKILNADENS0
126,704,000 *0CEF5A85E2E74F309A75C91DB6DFC5C6A0F4B3E2 SKIND3N3
126,704,001 *0CEE579DF7C7A92ED5149CA08FC6215BD358561A SKLKRPSN
126,704,002 *0CE18984F2781DB6DB0A70D1EB5B7218AC6DE5CC pisiliblikate
126,704,003 *0CE8B7D6F07094BFDDDECC0A1525FB61AB4B9C8F PLA5MODE5MA
126,704,004 *0CED48702FBEF402F20F37C7B8F2EDBCA454453C SLR..IT
126,704,005 *0CE5941A1E9AB5265FA1C4C290497A9FD2615EF8 sm0k1ness
126,704,006 *0CE612663C4A12503D2496D1410D4F16377B4C83 SNEPTNIOPLLAB
126,704,007 *0CE39B4BBB0DA0CC54B53B9009F98579A9907389 polcade
126,704,008 *0CEB8DE616D496C3355DDFD52B671158CB0AB059 PORIBLJAVAE
126,704,009 *0CEC1FB63DC2AC8AF2B72252273C7E8E24B5B466 POROILAN
126,704,010 *0CE92CFC3437B74407C5204EA8C8D297B1B2FC91 P####P.~.~.~(>-<)
126,704,011 *0CEBE569596B0681204EEF1CB48D3DDCD1C52346 PRATODODIA(PARTESPTEODOROESAMPAIO)
126,704,012 *0CE134737518C9D99FCB55CEDF49E07EE7567264 splat-o~-<#####b
126,704,013 *0CE4A1CD9250188C2F39866D142E6155807914A0 Splat.O~(====B
126,704,014 *0CE0CA0017AFF8877F36AD3D01F32E5A64CE0E6C prvctrs8
126,704,015 *0CE5EA00609E59E6470F9AE31D76F4CEF790E864 Splat` @q
126,704,016 *0CEDB921D4A829FDACE53216900B0E995CBB1731 P======)~~~SPLAT
126,704,017 *0CE2E5805F871DE500391F08BC865241147BF95F [email protected]
126,704,018 *0CED6695A2C0269158881C3B3F66D0C545D697DB S}PR
126,704,019 *0CE5163D02472339B0E0DA56F6F2C12518C22D1C SPRCHLMNTS
126,704,020 *0CE0B8701B71ED3234964F4D0B563743F849FDB9 springstofexpert!
126,704,021 *0CEA73A06A5EEBA8581F810C2BB10A939E9740ED [email protected]
126,704,022 *0CE11C0BC6FB7C43163ED50846C3C5D410BBE8A5 sregertssmlks
126,704,023 *0CE5277A046A8D09A34A7BF861226C6CE8C05ECC SSANUTIHUMBELBERRYPIGGIE-PEG
126,704,024 *0CEAD38602C33C09A63BE22E0971E91DE0506081 ssische8
126,704,025 *0CE215D965DF84E7745C477F89DD52493182060C q====D`~-`~->-B0
126,704,026 *0CEE179CBB4F9806375B001772E3521DFB6DE88E SSTROOCK
126,704,027 *0CEA49508C2A5B75084A88AE80F9BC58B30CB536 [email protected]
126,704,028 *0CEA14E1B312FA64F7C884EE98D8D31BCD236C0F [email protected]~o)0(
126,704,029 *0CED5C9D32E5E538BE4F5D6C0443C30246227EDB Q######P`~`~><
126,704,030 *0CED272A3FBE1FB8A39110050079951B6C76EA10 START-THIS-PARTY-(FEAT-MR-MIKE)-(DOUBLE-M-DUB-MIX)
126,704,031 *0CE46976044E013C694F47DEF517D4A70A0BB354 STELLACALVIN
126,704,032 *0CE4CD54F9D2C30162A1759293F3E2ED74EEE986 stellacrock5627
126,704,033 *0CE696F92930017BF356B0396DEA8676FC037C21 STEPHAN.CIAFARDONI
126,704,034 *0CE9028FFC027B5B217926FE5FBC88E3B3DAA495 STEPHANIE-MCCRARY
126,704,035 *0CEF103B14D368E3F375CC2144FC6A805B48EA58 stephanketron
126,704,036 *0CEEA2021A599503DB83F8295841CD7D6D9457F2 stereopter.st/e/r/i//a/pt/@/r
126,704,037 *0CE7256498D25D9B9E16221E501C1DF09307C6FB STERIELS
126,704,038 *0CEB5DAF997134EBCF4EEAAC401DA06049F445AC STEVE.CREMA
126,704,039 *0CE05D91DF0AAEA1E8EB8C5867456879222460C1 stevemikington
126,704,040 *0CE49A9A1E469F04D172A4E94540DF8C7C9846A2 still-she-sings
126,704,041 *0CE4341B7B6B1292281D25299A453C4D35580963 RA7I0NING
126,704,042 *0CE6FBD6EECF6BD8D8C5D9E2C860AA963DBF5260 RAFAEL.CLAYMAN
126,704,043 *0CE604C6AE29E8E8C1A33B7D616118A6D234A41B SŪCĒJTĀRPU
126,704,044 *0CEAC51413E40E76599B0CD5C319686448C32CF8 RAMILLS
126,704,045 *0CE25B4E29C143B51AAD6F77424809F8B7B105FD sueno-futuro-(wake-up-and-dream)-(edit-version)
126,704,046 *0CE3D5863A2246FC676F345A8610E7F5566F8232 SUIRANIDROS
126,704,047 *0CE264116662FDEEF3F5C190ABB940D980880C82 RANDALHOFSTADTER
126,704,048 *0CE3BF2251A053BE5974147CEA18B42D50BA31AB [email protected]
126,704,049 *0CEE1281D983010508C5E49DE0FA0218675CDAE3 Summertime-(feat.-Gil-Evans-&-His-Orchestra)
126,704,050 *0CEFC98F1D9D4437DD0D373F362565C458F5B6F5 [email protected]
126,704,051 *0CE70917DE8583AC6F6B89119ADED52C47E80AA2 SUNSHINE IN THE RAIN (SOUNDFACTORY NEW YORK ANTHEM)
126,704,052 *0CE1B3CE2D75D9972A8C9246F622D2EA057ECF5C SUPPOSED TO ROT
126,704,053 *0CEDE9E2ECC8F079CE3830965E9036DF2773E91C r}d
126,704,054 *0CE7911A489A80F0ED7F02B935D439638A9E9224 SV4N3H4MM
126,704,055 *0CE23BED1FC6BA4EBC474CFA69D1249C5F34617D SVSTEMA
126,704,056 *0CE4849017AF143CB956EFDE6667D5BD5B67AA7D REEDPENUNURI
126,704,057 *0CE877D13AEE1A17E7CAF384F203778A7A60F92A systems—philadelphia
126,704,058 *0CE5419172DC492DCA6EFEAD4E4DC29D1EA5099E REGNIRKISROF1
126,704,059 *0CE1651CD58C1F1C74185E4968C122191281860F [email protected]
126,704,060 *0CE23F260E6120AAE67E9D560CE2ACE89CE75355 REHANAISLAM
126,704,061 *0CEFA4906C796179B4F879995750D24035F9C25F -T")8
126,704,062 *0CE00500FB5842F2E70EE9CEF402F51742527805 [email protected]
126,704,063 *0CE63ACC15F4E12F54E1B5FF7685C332B3070818 RELACIONESINTER
126,704,064 *0CEDF7BB1C6FE00B4AA54D6049ACAC004E4024AB repartits
126,704,065 *0CE641F153A8B23A7C1FD90AB3D8A17A825FDF7B TDANKO
126,704,066 *0CE443CC67451037105D8A82E3CE90C8B05DE999 [email protected]
126,704,067 *0CEB5ED7F735083F9A29FBDAD3B964D5CA1C70F5 ted reiger
126,704,068 *0CE9E112C98A597380C424AA68BD51AFA08B9FFC RGILARDO
126,704,069 *0CE5B108D864BB64275CA7B4081AF5D8435CF076 tequelo9
126,704,070 *0CE24D322935ACE7D474C6C2B4964BEB2B4AC358 TERRELLCOLLISTER
126,704,071 *0CEDE3EE2DD4BA43DBA9DF2EA3D5594C3C44EAB1 TESTIMONIALISING
126,704,072 *0CEA59476CCC73FEF61ABF83461BCC53B9449F8D tetsteegen
126,704,073 *0CE3409E957E12D841E3F7665D019137B2C4EF42 rileyneizer
126,704,074 *0CEB5837FB68CDB86CF6C5F64CD860D9C01BEFA3 TEUSEALE
126,704,075 *0CEE9977F097A28B216EF4D289C1A3C27F093C3F thaddeusdow
126,704,076 *0CE929BEDF673C681BBDD62BEA052CF4D1672E41 THEBRIGHT1992
126,704,077 *0CED1F9F7F226FC9C1BCDDACD056AE18C3929EDE ROBBIE.SACHAR
126,704,078 *0CE2ED05220977347DAC22FAB119F3797BE0E500 theDuck
126,704,079 *0CE9AA4FF7596F4CD3E53061A2FD0C6B5E136E15 robert-le-diable,-act-i:-qu'on-arr
126,704,080 *0CE42A4CF50541A59EFB100379ED7291F377AD86 ROCCONYSWONGER
126,704,081 *0CE05CB849EC3BF86A7CC2770FB24B8EB8FA0852 ROCKISONS
126,704,082 *0CE76B801C51CD0F95E5A1DFB80A0CB9885E5F2C ROCKZOMBIE9
126,704,083 *0CEDFBD0EB080E9D41F62D964B6089DD80D38479 THEMISCARRIAGEOFPARADISEREGAINED
126,704,084 *0CE1B20715215F5DBC2FFDB69E769364ED65C033 RODRIGO.LATENDRESSE
126,704,085 *0CE45996CAEF9ADE49F324124CA291547F2F5B30 RODRIGOPILLARD
126,704,086 *0CE17E611F9375A004B39FC2512CE03E018EDD5C THEPRESENCEOFDRB
126,704,087 *0CEDBAC6EF6441CF038F947F67BD7F1F945A71A8 therock'n'rollera-1959:stillrockin'
126,704,088 *0CE614FEF62CE0C309E1E42DD8F6F9F4B66165F0 rollandvanamburgh
126,704,089 *0CE1093B32142768A61DDECCF1F434278A962376 THOEREND6
126,704,090 *0CEC9BCFD103ED8A6B2A6174C2F020BACEA5D8B1 THORAND2
126,704,091 *0CE46DA65F81C6D22E68E1CC76466D8A69B2A461 THUNDERSTORM6
126,704,092 *0CE4077CA296CA96319F4E4C08FC13A5DCCA1B50 [email protected]
126,704,093 *0CE0C215C70B298C8645AE513F7C0A86AB7D3F76 TIM.NERBONNE
126,704,094 *0CEEDA27C862DF01FB54C4B31EDDAB7F724A0E73 timothyamesquita
126,704,095 *0CE7BB97B37D038DA310639B90DBE5F4640DF7F1 ROY.DLOBIK
126,704,096 *0CED2321712D27B84A25614A795DD2D71F4B7EC0 ROZBOURENYM5
126,704,097 *0CED1C7A840391E67BDEB729CDD600DAB54C5C68 RROSALINDY
126,704,098 *0CEE2BE5668FDEEB05DA279E0311FF9DCCE08FA3 rtehporp
126,704,099 *0CEF27A9C0F63C8EA96E6BB02F70DF0E1D658222 RTKOUSEN3
126,704,100 *0CED8773D513D74ED65CD5464B49366F0DEC25D8 RTYREREMMERANO
126,704,101 *0CED3241FD2A4A6717135532BE3E90D72F866A4D tn247pp
126,704,102 *0CE779C73B8E1BDD04A54AE6B077EB2436BE6CAB TNAUSRUPBSWED
126,704,103 *0CE4310AF048C6C55E0F6D142F8A44DFD80377CC TODD.CHAUDET
126,704,104 *0CE6F31C27AAF4FFB261DBC893C62418D9927DEA run away with me
126,704,105 *0CEDD886D74BF5B6C1B3BCA423210CE60E23CC17 [email protected]
126,704,106 *0CEB9806E6341F867A5A4ED9B8BC69E8BE21F11C S3R4LZ4TON
126,704,107 *0CE9598827B86507C7051693E1B863E91D421457 totalitarian-chant-of-freedom
126,704,108 *0CE0FF27F8315673E8E6F1B8B51E9E473B3D3728 tr4i1 spu
126,704,109 *0CE9EB2AC48BC3BD4DA0F1C705842015DBAED06F TRANSFORMATIONALLIANCEORGWWW
126,704,110 *0CE3950F18013931134228A69C370FAE20F37E22 transmissie
126,704,111 *0CE8B289F0EC3341987B04C1E25F8DC02D14479A TRECKERTEST-ALLGEIBER-AP-17-(U.-M
126,704,112 *0CE37A37E9D4BE775A3A597DA01C0868F77F9170 TREEDU
126,704,113 *0CEF0881B5472E1AD9EC14A6B6620C45627B7BAE TREKTOONS3
126,704,114 *0CE16367333DC956E20D933A9504D8182A737281 (TRICK
126,704,115 *0CEE713DEB8B12DBDED265AFBD97C835EF4E38F2 SAMTALETED
126,704,116 *0CE1239AD129088FDFF0A113D2F37108D7E2A4D7 TRISTAN.KOREWDIT
126,704,117 *0CED7533339B407FCD82F2FCA52F83659EEB7700 TRMFNTLJK4
126,704,118 *0CE2DDE6C1F95A3B776F4387EB0520D74398544A SANG.MCCARGAR
126,704,119 *0CECA2A36857CB8158C34B5602CC1CA401796C09 SANTAMARIAINCASTELLO
126,704,120 *0CED10A63CD5B3BF0581EE4C74C5D2BB9CE21DF2 TRUHANES6
126,704,121 *0CE127A5953416BF893BF259FC6C48CDBE56D23C "trumpet.overture".from."the.indian.queen"
126,704,122 *0CE5ADD359FC8B2DE7DB56F364A28592ED8495FA TRUPHOSA OGWORA
126,704,123 *0CE89DB2CC6BD5EB9A64D826301816F1D4171B04 SAULJARZEMBOWSKI
126,704,124 *0CE75E9F68B13CDA5B4A769DABFDF5B060601AE2 TUBERANN5
126,704,125 *0CECC793749B0B65FBB5B86A62A0A9D33B771F0C SAULTYLER
126,704,126 *0CEE48BC3A5F883BE72838435A16E7169C6C10C3 tyrelchalifoux
126,704,127 *0CECD267E7CA652A275D46A3639F3B7A9EC4CD2E UEDLYT
126,704,128 *0CEE9105DE93B191026F1E268ADB7ACED77802B8 SEMPER.IN.ANGARIA
126,704,129 *0CEDFA8EC54BF1F531A152E24D03C8B1288D4E63 UFUK-HANCILAR
126,704,130 *0CE74F6D53A910921435E441D538A4BAE57EDFBF UKID.LIANG
126,704,131 *0CE72416293B6BA818EAB2869B9DD16E00F96D80 UMAIRWAINS
126,704,132 *0CE6603245DF674585B0AD440BCE1C2683995FFF UNBETHOWT7
126,704,133 *0CE9E4B7E85003390052203A9467AEE44A7A1F9A sex47
126,704,134 *0CE09DF864CF881AA2E016046DF1DA25B468DF5A UNDERGROUND.16
126,704,135 *0CEC874FA3B2850F0F9606D536C72583BBE798B4 UNERREBSWED
126,704,136 *0CEBDDF2E64D48A874FB8FBCD86B4131C83BEE2E UNINNOCENCE4
126,704,137 *0CE03F140BF31841B42D9F751B259345D7222250 UNTILED
126,704,138 *0CE5A264CE985D644808697B9F496D46F4138C88 shashank.sen
126,704,139 *0CE1D26387016329AC27E7953C2F0A4AEBF6E5D6 shatai
126,704,140 *0CEFCF64396134DBB2AB647B6ACDB47810CA53C9 SHAWNCOLO
126,704,141 *0CEE2E80C575E5531380D445FFCC198494F6F98C UPH3AVN9
126,704,142 *0CE9595886360FDB961BD4FFCB9B5D6CA4E269F8 SHELTERING STONES
126,704,143 *0CE4DBDD10B99DA38CA60B6E7B896099C6E1302C [email protected]
126,704,144 *0CEFF02DC5D290E80DFF5AF1E801FAD0F60A41B9 SHIRA-SHARIF
126,704,145 *0CE28CF6F65B1335F86BFE6A85688834AC55BF53 SHJANELLE
126,704,146 *0CEA7F539D06D59B857BF58CA7B5348C88A47D85 [email protected]
126,704,147 *0CEBA36A3C373FD64DBFDB6C13BAC56D17FA6D06 SIAVIVER9
126,704,148 *0CEA9EAC3407BB6D493C2B2035FCF42609EF694E V090496
126,704,149 *0CE3F674B11D6F3AF2784C5252FE1722F24DCBDF sidneygalvan
126,704,150 *0CE0C28EA24E5815D6C1B4CF74A17E34468F40DC VACCINIEZ?
126,704,151 *0CE3414DE74DCD20F063C605E526638BE63F34A9 SIKAMAUKKA
126,704,152 *0CE666FADB34762095D5005F8EF7867B9454FB2C SIMON.SMILEY
126,704,153 *0CEDE8B3EC80141BFB1F5E9548B3C39139747DAD SINCDEUS
126,704,154 *0CE8C8EDABA02EC4913A7A21289576751F293773 [email protected]
126,704,155 *0CE13742031358D77FD761E66594BB12DD68BA12 SISTEKAPITTEL,DEL11
126,704,156 *0CEE95F27F7435EDF6EAACC77B74144079112602 SITTING.HOME.(ALBUM.VERSION)
126,704,157 *0CECCC137B9AB77ED2710E5991BDE0BDC1A5720A SIXXMIXX091.05-06-24:BLOODYEDITION
126,704,158 *0CEFAD41994ADEF08198C74C3C43F41AA5CD8B26 skamslog5
126,704,159 *0CEA231B700A6F4BADEFACCC4A9632F053BAFD10 SKKEVISING
126,704,160 *0CE5E4BFC2F2F4B1252F95FE0F9C935C721A18DB slizard8
126,704,161 *0CE54AD564CBE2469F70FED792B27BD29434454B Venom.of.the.Beast
126,704,162 *0CEAE3DCD655CAF089DCF17A053DD60D77EB9E8F [email protected]
126,704,163 *0CEDA64EAC27272FD67F05EE0F15162882319782 VERKABELUNGSBEISPIELING
126,704,164 *0CEABC8CA90712F198F9EFAA0E98D2407AB5697B SMISENI3
126,704,165 *0CEB078A27AE92ABB104B2E63BDE734820C1DA62 VERTREK9
126,704,166 *0CE818B9E59CD54A007FB6060574B4168FF90801 ve$terg
126,704,167 *0CE37107C16A13991C77954043C154D504AB12A9 vetscriptions
126,704,168 *0CE99337D85888B1319BFB3C96DE61CF6AAFBC32 SNINOTNA6
126,704,169 *0CEAB70E79C648DAC4FEF4E4E55206138600D58A vhnv7554
126,704,170 *0CE2EF3E0AE2C689EFE8028300A33363854BB0D4 viannos
126,704,171 *0CE2C568FAC22A3B008E256231328F0A79780DAA socialistischepartij-anders
126,704,172 *0CE00B8A50616DFF8C7E87DD5ED73BC0521832D1 SO_JEALOUS
126,704,173 *0CECCBE3B66BD949E1C774EDAA44EAE5C39B26FD VICTORY.MEANS.GURUPRASATH
126,704,174 *0CED778E117CC6C9FB2387C948B92EA83BBA469B solutra
126,704,175 *0CE9BBD0E901C3A79C4F9D4E6E3DC3223D920389 SOLZHENING
126,704,176 *0CE7A717C1DA0C4BFBC1049D6E310C3A44D0C372 [email protected]
126,704,177 *0CEC24228839B55B429104619886D44C27BC982E SONHO-DE-MARIA
126,704,178 *0CE2AC685AC931331A274C1DC89854D762DA5685 vimal-chimanbhai-patel
126,704,179 *0CE80058EFF7B3724F31C527A23F55D04F4FFDA0 VINCENTLAMPL
126,704,180 *0CE0060E1DEC4EB0FE4CA18CBA458BA34D9F93D5 VIPULKARIA
126,704,181 *0CEDEF2A304E9264F18C574AFBA1C97A355F81ED virgilrumble
126,704,182 *0CEC0842AAE6B572B519CF4AAEF0B8727ED0F0FB specialinternalvalues</a>
126,704,183 *0CE856C9241DC65EF0558CE7EA2D05969117DBA1 VISTIAMO
126,704,184 *0CE2775EAF3404D65AB12A22E3F213CEA057F4E2 SPEPPER4
126,704,185 *0CE56BCFE5ACFBEA8E2ADCA06F65A02BAA9E3352 vitaliypakhuto
126,704,186 *0CE834999C6B5119ECE2EA4425694A1A7A52757E splat~~~<---b
126,704,187 *0CE14F0F0745B3AB0D45295AC823E35F074A84A7 sporokjes0
126,704,188 *0CEAAC66659170A36FB82A7F47C9FF86D863B33D votecountinterpretation
126,704,189 *0CE8E999724A6A16F193CBDCB3B76FE6D733AFEA VPRINDLE
126,704,190 *0CECC1D4E342A247A63AD86C06B6E5F5F39190FB SRC="HTTP//CXMGSMZNCM/MGS//21M4Q0CKCJL_115_JPG
126,704,191 *0CE40F593609D77C15F7DF2FD59E3C084FFEA133 VUKASIN-RADOSEVIC
126,704,192 *0CE9B5F66C76A7B60EDFF786485697D4D6401E5E vulnifick
126,704,193 *0CE8F69F39C949182EACF0B83D278E4314237474 SREIZARGS
126,704,194 *0CE71966430DBF51ED13CC80788F825FAD913EBF SRRMCRS
126,704,195 *0CEF8531C9A41038C658328702D472B7D608FA77 SSETMRTED
126,704,196 *0CECD4719610FF41F36240CC144EC6A59B1C3CC4 WAHID.THARANI
126,704,197 *0CEAF1D7BD00B921EE8A6195E6A5643BDA8E7CD9 WAHR1
126,704,198 *0CE85FDACEA0CD5183A2ED40ABDC1846906FDC38 STAHLDRAHTSEILE
126,704,199 *0CE3F14B7676139B6471A4218B6D4CAB54874867 WAKWINZULULWAZI
126,704,200 *0CE936500CC6ED0BB3E856EF8F6A51084DC8270A stay-but-a-little,-i-will-come-again
126,704,201 *0CE0360D718469CB697E5526094B561AEB3927E3 [email protected]
126,704,202 *0CE81A73E69B1EC0002EDCA44B6C0F033C162DB4 wanguiwahome
126,704,203 *0CE3745088BD7D1BF83E7BF857C278A2E9E88C21 STERLINGRHINERSON
126,704,204 *0CEEF5F05BCAABC77739FCF0A2500A90FDAC110E STETHOSCOOPPED
126,704,205 *0CE53A3D84B9CECF9923CAF10606342A1554C075 water-gild.'w/O/t/@/r_g/I/ld
126,704,206 *0CE8AEE0B944889709ADD4B8C4A479CF69305881 STEVERUNNING2
126,704,207 *0CE7F15F1152C6739948D41406B2D9D74DB3AA2A STEWART.MANCINO
126,704,208 *0CECE5AF30B6313CBE49D967BB7FDA20CBAED1C3 WDETTOPS2
126,704,209 *0CE87139B6124771DBAE16BE998A6571A4E97037 weant--w-iy1-n-t
126,704,210 *0CE22C548B6AB7D41ABB7F009DB0B732378C145A [email protected]
126,704,211 *0CEB15051016BB534346B6E63CA550DECD9306CC weixi.li
126,704,212 *0CE34DE75D318CC443DC35C49743D662ECFC56DB STRATEGIER2
126,704,213 *0CE71033245411113BF8E09F9B0BEBF8630796F5 STREETFIGHT3
126,704,214 *0CE3DFA1374ED55FD1752FE43FBBEC07FAE82D66 STRIVER
126,704,215 *0CEFB2ADE298767E6F96361BC94B7D1B91046509 stungplayerscom
126,704,216 *0CE8BD97C874E8EACEFB84B17D0E9EF127066CB6 WERNERNS
126,704,217 *0CE91830C7D651DF1AB620864712EC70375A0136 Where-Do-You-Think-You're-Going?
126,704,218 *0CEDE856BF78BC579F9450E3F8C09E8FEB9EF451 SUKYTSOR.1
126,704,219 *0CEF794F826EE95C3345C922BC389B8340E1E85D whitney.mefford
126,704,220 *0CEB41BAEF6513A294FD6006A10848E88989C8EB WHY|
126,704,221 *0CEC258BDAC883A9AF574A3AC56F63A14CEDA645 WICCANAAOCWIKIACOMWICCANAAOC
126,704,222 *0CE7664C44E933EB4C1B0F47ADF370B05F464831 wijdanalmaghlouth
126,704,223 *0CEBE0AC933C8472C95FF7435BFEB8AA9F000FE7 SUOENAROPMETNOCERPS
126,704,224 *0CE2B6498C8F6D4320947B9ED1F2828C741533DE WILBERT.WHITENACK
126,704,225 *0CEE24CFEAD85E1E3CFD57D69FDDAF84DE84C169 superozeans
126,704,226 *0CE4E2514D41E4FC1DE99706D1104F6A4CD75749 SURFROWING
126,704,227 *0CE6C91549CCA1081339F238F74686F916197494 susanloesch
126,704,228 *0CE727F33657A570F852AA56C93ACEBD4D51CE86 SUSANNEDENNIS
126,704,229 *0CEBE857B5B5E4F776D6B63BB14BDB3287776DF4 sventupait
126,704,230 *0CEE6B70CDF67C88DB768814D05002BDCBCFEB57 WILLY KHOEWEEL AULIA
126,704,231 *0CE5030C6200705B73A4F47CE8E5637C35CD6BA9 WILSON.FLEMMON
126,704,232 *0CE0B00D2B3C47D8181A141F4846A596A393A48F [email protected]
126,704,233 *0CEB91914D3138C9ED6965D8169892D2EE9EF1DD SYLVESTERMASCI
126,704,234 *0CE7CE171940055692EF2C49F539EC7826BF3931 WNDNKBLDN
126,704,235 *0CE768E525115D6A965F9D29D72CC8A54E041949 SZRUTSBA
126,704,236 *0CE6873A721675ECD1C1E68322FB34A1AEB98353 WONDERFUL-(DEMO)
126,704,237 *0CE80AD6802141255F16F2F4E8D83EBFA60F7120 WOODROW.ROMENESKO
126,704,238 *0CEABA4B9EBA3AAB51092FAAC8E24E4E613D656F workingwoman
126,704,239 *0CEBFC061EB62ECB0C23D213368E268E0CE8D05E WPPZ
126,704,240 *0CE44836C9EF7F5621C0817C47E79537299269EF wtrtrsm7
126,704,241 *0CEFCC1ECD9516FC10C01AAFA23F6E90AFAA10A5 tabalot
126,704,242 *0CEE2C9A5A7A9D68799FF4DC434B43FB4B75A346 WUOBMALFED
126,704,243 *0CECCF98D987B9C0587CEFF6383AF560A97A66F8 wwwdelasallecepe
126,704,244 *0CE30F691FCBC4FB5CDB42859A69F3B359A0A912 TALKXIROVOUNI
126,704,245 *0CE2EA98F5B8D7B40F93C53651077EA5D66BB20B [email protected]
126,704,246 *0CED4EB21516A4D442A41DA9082FF39259C64DFC tat4
126,704,247 *0CE82B086E2D0C9B3B9253E243F01EDCC62CDA92 TATGGTTCTCCATTCCTTTGATGGGGGGAAAAAACCATGTCTTGTCCTGATTGAAATACA
126,704,248 *0CE28CECD14C46D7906790DB814805826DF03BF6 TECHNOLOGYBUCERIUS
126,704,249 *0CE1F6D00B92C7CCDFD80A94C57DB544E9670C84 TEKCORREPSAJ
126,704,250 *0CEC8D3FD80A2434228F4340EF8A9F678D9376F1 xyolandaed
126,704,251 *0CE9E978E7FDD01986B1A9E38413F3F785D56B11 Y7CHE1
126,704,252 *0CE5FBBA3C1264A1422316B01F49B2AE6A068475 Y[AAA
126,704,253 *0CE32693DC737C786447176894A67D6E20EA6478 temgoua
126,704,254 *0CEA5B53C4120040056CB818FF9DCEB2BA2C7601 YATAYAB EVOL
126,704,255 *0CE74A669826115437F97642E837BA63F4C33FB7 TGBOC
126,704,256 *0CEBE6868386540A05B6BCE3BBE211EE0157A58A th1e
126,704,257 *0CEF838628684B7F1E6BB3975F02BFC838BCF58B THADDEUSBRINSFIELD
126,704,258 *0CE4ECFBA7E3C8F74C4C826A7ECC3802AF8780A0 thatgaby13
126,704,259 *0CEE7891AAA9429D8CC56BC25293B0407FC2C3FF THEEMMITT51
126,704,260 *0CEA613CAA85939A2338058BE257BCC7B6B3B8B3 YKYJENS1
126,704,261 *0CE926A2CB84EF895E02CF747C2A077D354C3544 YLANDERARNICE
126,704,262 *0CE40925C8CBB969BDB9FB2C7DC98E053EF91051 ynki
126,704,263 *0CE130967E36047E4279696465ED4F07D8270F00 YO//./Lțâ//
126,704,264 *0CE780999B88DFD2B301651D80B4DDF5DBB50BE1 YOSHUA OENDOEN
126,704,265 *0CE0DE111030F42B4F9D89F9451BD1733FDA6889 YP311095
126,704,266 *0CE21161261CF8F56CA956043674E0ED5BB27F66 yspwsddrummerdiesafteronstagecollapse
126,704,267 *0CEB289A0833EE35D5F03327226736FD916C46AD this-is-my-commandment-(split-track)
126,704,268 *0CE3615F113C69284B960528B1698A0D02F045BB YUDHISHTIR.URS
126,704,269 *0CEDA52D5A8C671089BDE6CDB17D0297FEA76E44 THONGLEONGN
126,704,270 *0CEDF106D9CD63C8C0BB2C4D4B9F776F884CD10F THSINELP9
126,704,271 *0CEA96BDFEA436A486E9B29559F72B9027EC91BC THURSDAYPYRAMID0
126,704,272 *0CE46D8A99E6EE0389AF3657680BECD447F3E9D3 [email protected]
126,704,273 *0CEB15D10F56603A35F96550AD98D4CBC94451D5 [email protected]
126,704,274 *0CED6D846B9329EF61952B478F60CC7040BC9C3B TIASINAEPORUE2
126,704,275 *0CEF33539A52AC0344129CD8FD2EE6DD6C0D465F TIASSIPREUG8
126,704,276 *0CE6773F97B957DC03AEF1403E7678CCD89A1669 YVETTE.LAI.YANXI
126,704,277 *0CEB0440FF7E7F499FC8600CBA6D333F17160A78 TIMMYLEINWAND
126,704,278 *0CE4AF0C9F2BF34730533040A20D3EB3496D17AB zachbuchbinder
126,704,279 *0CEBB15CC199EB4A0D929E08D480133A11E9091B ZACHERY.BASTIC
126,704,280 *0CE28E702FB5C84800B4E88C9FB6EADC9C24EFF9 ZACHERY.LETTRE
126,704,281 *0CE20F9D6FC3C9BF92C4DDFFC4545D5AF65F5097 TIPHENG
126,704,282 *0CEED90CDCC66D98F6A7B44D89975C30103EE53B TOBY.MCVAIGH
126,704,283 *0CE33D025CF06ABA3A8400DAA3A1E2213081C877 zelenkos
126,704,284 *0CE12ABD8795AA06BAF9B9E6F47A274241F8BB8E zeppelinsusan
126,704,285 *0CE1EB7714F348876DF4904E1F6FF62252DA5B17 TOMMIE.MCKELL
126,704,286 *0CE530ECF1F1A889BBA29B856643C34A1C41E694 ZEUSCAT8
126,704,287 *0CEC04DFB4226B44913AF1BE5588C0E20F9B5B92 ZFUF
126,704,288 *0CE31782897E99BA3FCD9DBBB38A4311A10CA94F TONDINOS6
126,704,289 *0CE09207E80B8E024B62D7FCDAEC2FC045FC9AC8 [email protected]
126,704,290 *0CE6232F30CCA51C719BACEE9F1D073C5D61DA21 [email protected]
126,704,291 *0CEAF1F6E9A5B5E8F38F61B2EE58A15C11FFF411 TORFOLIENS
126,704,292 *0CEF3E709CAF3B1A6AA3FCD76278BFB3A1BAFC2B [email protected]
126,704,293 *0CE313EDDE1596BD818FDC0C5777C2A208A6BCBD TOSHA.DUKE
126,704,294 *0CEC7E92F0D19DFBB8F3181DCD1494A6668832A0 [email protected]
126,704,295 *0CE5BAB491FDD19591DDC45FD7D6B2E7546D9947 tpca-czcom
126,704,296 *0CE2B9C363BB9EB99D44693FBFF19733124F8847 [email protected]
126,704,297 *0CE6AD1763059E27C74133EE1ADDB090B2B8DB09 tracey.hooper
126,704,298 *0CE9AE186C3F5E6674C9C61277C25FF211831759 TRACY-T-JU
126,704,299 *0CE2A27BF557340D927C2F6D70B59195D2F307B7 TRÂMBITAŞ
126,704,300 *0CE1B1DCAA088CEC8C05CF2FC27FC5A3445611F2 trammell-steward
126,704,301 *0CE5702B38BC1C3F0C581761D5FA31D54B4DD934 [email protected]
126,704,302 *0CE5A1A6F91636983AA92FC98843D1522572E622 ZMEGOL
126,704,303 *0CE8C8476DC7CB33246B34E9A9AB44D86074DD30 TREBORDOUGIE6
126,704,304 *0CED94415E32FC4766FD88FCBCA2BC6C440CE028 TRENTBRUENDERMAN
126,704,305 *0CEB530EC6855A0B87809E58BE5C767B87DBC4E2 [email protected]
126,704,306 *0CE126C1D0CF95F197C29CB5F7E1BC469DC63ACD [email protected]
126,704,307 *0CEA1D5D1E310BC72FA4C8BFC65D9B986D1F0FE0 ZWOFERINK1980
126,704,308 *0CEFEFB45FBFFE4B80BE744156581F06DCD1A0A5 tsamma
126,704,309 *0CEAF8F5ECB51EBF5365B87FBE1C96D0976E18D8 χαναάν،
126,704,310 *0CE263D15E044EEFF240A84794900E8C9F0DC939 TSIGANES:-LE-CHANT-DES-ROMA
126,704,311 *0CEF5796969042EE60E5D235122E28A1B8EDAA1A TSOURKPKS
126,704,312 *0CEFD612AF5A17A2764B746076E0503777A4BC5B TST%
126,704,313 *0CE78789BEB76B73504E0967F54925938AE7FCDE TSTMNLSS7
126,704,314 *0CE151E9B56E5E110068AB0618457560A9CDA6DE ВИКИПЕДЕВЦИ
126,704,315 *0CED00B636BE18AB5F1494C9BEF33811BB0E9F1E ВІКІКНИГУ
126,704,316 *0CE18BAF0CB8C2FBBF331D2E30A818F2214D0AC6 гњиланског
126,704,317 *0CE9F49EE36157371ED1E2A39A01FBFCEF281E0B TUNAEPYTSIRHC
126,704,318 *0CE0CA67719E465979D55FF89335F7E883C71552 turandot:-act-iii,-scene-i-"nessun-dorma"
126,704,319 *0CE5B05B891FB24761927ECDA35C3D2D3A6BFE2A ефешана
126,704,320 *0CE73F74E4186B54BF0CADF2DFA846B4F10A954C twanarials
126,704,321 *0CE6F3F48E396F4CC2356972FEA5E8CD58884635 кваратсхелия
126,704,322 *0CE5A289666156F6F998EF6D117EC5F1E2A9000A tyesiablackisbeautyfreeman
126,704,323 *0CEE8C32F3002D727DFAB39D837E28D3AB79698C TYLERTRAXSON
126,704,324 *0CEE2CB4A5334CBED680E89AD451E2E82D92AECB НЕНАДБНОСТЬЮ
126,704,325 *0CE7D768B16BCC681647F0404616431BF57D2F53 ОРИГИНАЛЬНЫЙМИ
126,704,326 *0CE259FE2C0E4B04959E83E254D6884AECE88FDE ПЕТРИКІВКОЮ
126,704,327 *0CED4F983EFD41BE4BDA756E4D4F7F72CB2C7735 «підозрювані»
126,704,328 *0CE58D208A1A7EC21D7BB3FA3EA278A691688BA3 плутос
126,704,329 *0CE401D6AE961BA2F57DCAEB17BC51958105900F ПОДЛЕЗЕШЬ
126,704,330 *0CE8857F8453E56A3CB63B47244006E1C52E28B5 [email protected]
126,704,331 *0CE66B673E5F8A531D413475EFD4BEC67FC8793D ujbffdk4
126,704,332 *0CE21E362BD6B19FD6038F69F126AD2C8B04A097 ujwal.lambodary
126,704,333 *0CE25D1BEC41446101F8A6A06EE87D979166F566 ЮРГУ
126,704,334 *0CE3EE5D56FF4CC1CD3A39E758CDC635E6ABD343 UNBIDDABLED
126,704,335 *0CE1EDEE0C812B49442C62511C767914E18C9B6E UNDERYETING
126,704,336 *0CE35328F6020B8CE26B887C6065A5A78A73A893 UNTERSCHERN
126,704,337 *0CEE6D03053201AA8C040DBC5B325CFED933BDB7 UNVIRULE4
126,704,338 *0CE2D0498EEA95DFA00E338BCFD368479D6F726C UZAVRENY3
126,704,339 *0CE2E72C48E096E0B2D15CCAD85BDF29B9C2EECD VAEELLEEN
126,704,340 *0CE1433FF5E2F9E57EC6BC777216E25707CC5253 vancegettis
126,704,341 *0CEBBA12D4A2D045CFB376C9C3F149F53B350998 variolaria3
126,704,342 *0CEDBD9F8ABC5B6BB590D1EC6109D81F0C5E84B9 [email protected]|e
126,704,343 *0CE3A1BD10272912396A37C7B737BF8CB5A34494 VEDAWILTURNER
126,704,344 *0CEDCE151F122CC2878A3EB0FD4B1FD565EEDBBF verda-hutchison
126,704,345 *0CE7A015EC7B3F00CC034743EC3301BBF67C6079 VERLOOCHES
126,704,346 *0CE42115C454F3C312820FE14C7FEF5DB97CE1BB VERNON-SINCLAIRE
126,704,347 *0CEDF164BDFDD138E37959C42B53377C86114E50 [email protected]
126,704,348 *0CE82D6145CD80D631A7553444D3EC089AD385BE [email protected]
126,704,349 *0CEB2E121440558EF378156AF30C978329AB0769 vicki-langford-archer
126,704,350 *0CE522681E5FD67C8483F1968EF7629D7B91B391 VICKYGAUNT
126,704,351 *0CE4E3101CA40592F7C8CAE68C3C30C209756816 0ILUVGINGERS9
126,704,352 *0CE3C05E9F5E8EB0FFC58D72BFEDD4714CFC8968 0kpluj
126,704,353 *0CE11DAFE9BCE92349C4309932B6DF167D5872A9 VICTORIAELLEN0
126,704,354 *0CEBEBA3AE40A77DB152978F13624DEB6934776A 0mymarcus0
126,704,355 *0CED4ED9B5BD25FA8E6828C1455BA9CC6539CD7F VincentBach
126,704,356 *0CE03120A464CE21C79BDB8F8800AA4681360EB3 vipermarley
126,704,357 *0CE442A55E15A2A494AE9B4329C1D2D85C7AA4C6 1149322 GENAU AUF DIESER ECKE STEHT DAS WMF-HAUS
126,704,358 *0CE9C79CD47D80DE7387297AB9B7224F8361DECF 12161317
126,704,359 *0CEB61CDFF33C76C44C224EB080801EE9E320098 12.SELK
126,704,360 *0CE9ADC48EFD68B86729E750FABA2FF9FEFEB308 1324621 die betroffenen beschaeftigten haben nichts davon
126,704,361 *0CE15C0F6B1D4F685B3D9A2351A9464BF5D72303 VMDBOYS6ROEC
126,704,362 *0CE5532B6AE607E2E7CA286F9569E5AAA7A415C0 1437716 TILANNETTA AUTTAA , JOS HEILL
126,704,363 *0CE472E7D20D03F4B6368EC9C344504B90137E73 1595839 die-zeitung-hat-sich-geirrt-.
126,704,364 *0CEAA5352E9862435E79E49951320DEE0C539315 1598772 rukanalppikouluntoistaisekimerkitt
126,704,365 *0CE947DE644B621567664BD951902B8FC6910406 vor173a
126,704,366 *0CE33A4FAFEF53D3695114619323E65A4BE9FD53 1621330 aktuelle.gewinnsumme.von.aljaarif.:.fast.300.000.mark.
126,704,367 *0CED4B7F6406DED748F9F894A729EC77B47D1914 vrijverklaart?
126,704,368 *0CE00E103DAF3E3DA5D2FDA34CEA9D24810ABB04 vuebgvvt
126,704,369 *0CEEB20D037450AADD1FD453548A2E31124510F7 19232411
126,704,370 *0CE7A7AF927C01243DEDCCD3E02EC15FF91AA530 1993-12-09:centerarena,seattle,wa,usa(disc2)
126,704,371 *0CE1B990F765575D516172F60133C9102328B950 19HANI93
126,704,372 *0CE8E3F31F47686B69CD0A0187E164F0BC35B6D7 1ACCATTER
126,704,373 *0CE3511E79C09282BC05CF9C7626FD4327BC9B5D 1AVAJAISILLE
126,704,374 *0CEEA10E1764AB747044FAB3D6AE18FEB5B1EEE2 1a,Z
126,704,375 *0CE62F10651A77DCC93B4A70755E6C7515EDC9EB [email protected]
126,704,376 *0CE4920CBCC0F06530F52F1E4BBD0A05E6802311 1DOERNEMA
126,704,377 *0CE28CB81EAC623FE91D697D9A7E0FD085515EB2 washing-horses-in-eden
126,704,378 *0CE3293EF5B2E96B038D3AC2575C397922EF1217 1.DWISC
126,704,379 *0CED452CDDA25ECE6414306228F1BB60AFC4972D 1EKINCIK
126,704,380 *0CE6113A7A58DF92883EA38D9760844E77B4C917 1.EX-DELTALAISEN
126,704,381 *0CE8CAABC6FB7B9F4D9681DF84839D0E33569778 wbi5hattmx
126,704,382 *0CEC35B148B964A8BD8263448D0911F0F91C0ECB WEATHERSTRIPPINGC
126,704,383 *0CE02AAB7E045DC145BEA9F1063FF495C6EF5E5F 1.geldanforderung
126,704,384 *0CE557D1103EB6344BF389FBE327E18BFB843880 1.GREASEEMBALMED
126,704,385 *0CEB836F96B7FBA74C382C9997BC8ABA09783759 1.HACKORDNUNGEN
126,704,386 *0CE05E8D86E7AEB257D5498C4EB72F94F8628F72 [email protected]
126,704,387 *0CEFF2DC15F3155949342D2A8ACE469D6FC6AC9A WEINGARTIA.BACKEBERGIANA
126,704,388 *0CEA8FC43766930D48A0741ADC8188D5D9FCFFFF [email protected]
126,704,389 *0CE05EA82E45B65860105BE105B37246161B27BB [email protected]
126,704,390 *0CEB67621FFBE602EE439435A05FD1D35054C2D7 WENG-M-MANLAWE
126,704,391 *0CEE7AA2F159F12DA1997992FDB15644107A6E53 1KIRJA-ARKISTON
126,704,392 *0CEB50676A6ACA4BE784331AC68CB80EA639FAF8 [email protected]
126,704,393 *0CE887E9A4219190D2DEB4E1D2FA143601CC83F3 1.krebslein
126,704,394 *0CEFF8D07FAB8C63320A424B58F28F3A36FA65E6 1.KUPPILOINEEN
126,704,395 *0CE0411C58B35CE63D998405E543D27647AF729F WESA-PRADANA
126,704,396 *0CEA9DFECF28066F2192FCB40DDE26B5355EE62A 1.liikunnanpuutteesta
126,704,397 *0CEB882B86F02B4512C2CE992B01F984EC62452B WESLEYSNODDERLY
126,704,398 *0CE19B874F9FD84CA80423EC63844D9D9039521F [email protected]
126,704,399 *0CEF0D864171AB355772C43D1EA7A05441DBDF81 1.MM-HEVONEN
126,704,400 *0CEB27D954AD8E23EB573F2695ADDBE6CCE5CAB8 what.you're.queen.of.now
126,704,401 *0CEBDA6FCAEC9107317E4FAB91088CA0ED979EAA 1---National-Computer-Security-Center,-DOD-Trusted-Computer
126,704,402 *0CEFBC9BE199C45E6932AE2C89AF453F27BD4C35 WHITNEYDEGGECABALLERO
126,704,403 *0CE1DC10E107F3889593241DEFE658399B84292C 1OBERDIPLOMAT
126,704,404 *0CE3D31443A5BEA543AE46C583615842E7EC21EE 1orslandetin
126,704,405 *0CE2C8DE9D301FA164844C9108B15E77BB7AA653 1.over-edged
126,704,406 *0CEE82941ED3A1CD411BEBBE87B5181BE7568A09 WIAIRPORT
126,704,407 *0CE7B71B901CADCDD2EF5CB53CC80C2CAA926E6E 1PISTEESTIMAATTIEN
126,704,408 *0CE0B28A9F4AAE9B82F1BACCDB51CD0BAEA0021A wilberhedrich
126,704,409 *0CEC36130DEACA828EF4A5CE9445E507BC124AA2 WILBERTVENSKE
126,704,410 *0CE5E69C31234E7883DDD0DC6EA6438F5F7DEFB6 WILIAZ
126,704,411 *0CE359999EAC486D71F63E5BC9C518AFDEB27515 WILLIAMS.CRAIGMILES
126,704,412 *0CECBB412FAA1AFE57E9AF9496584D4DAAC44C53 WILLIEANDTHEMIGHTYMAGNIFICENTS
126,704,413 *0CE2D0D162F8AA3942288435AB23AC54FF24978C 1 singlecity
126,704,414 *0CED9A223541A4ECD66B6441CD59A846547CAAD7 WILLQUADFLIEG
126,704,415 *0CE6B3C99269E2C74EA3A57BA6B12B5F6602FB7E 1taboring
126,704,416 *0CE25B8C9024DE616D7A08BF7E0441CAC82154CB 1.tapaturmariskeihin
126,704,417 *0CE3596F9BD4A54079D6D61ADBCAA8103F1033CD WIMAPDOTONHELVETIA
126,704,418 *0CED70F87CE654D04B82FA2CF5CAECE12340C0BE 1 terveisi
126,704,419 *0CE8D88E1E9739DE5A15913689F69B5638973E55 1tilauskirjeit
126,704,420 *0CE0DCF703D3CA1CFBE816E7D72A266E84A56DEE 1-TUSSAHDUKSIKSI
126,704,421 *0CE9AF9D3F019EA9985001DA77DBD08F33EA68F9 WIRELEZZ.PLUS
126,704,422 *0CE0F6FC8FE146E5804E6EF2805358E04373B78F WKOPIUJE3
126,704,423 *0CE241A4B2F4362175D06752048A54A468A3A96D 1-verfassungsfester
126,704,424 *0CE368B4894DC26E33D5F5D7C5F58C5C0C08118D [email protected]
126,704,425 *0CE5C7ACCDF0CA83D3A95ACBBA29E99C0A1D987E WOHUNGE0
126,704,426 *0CEE8A3DFF836B98D081074529CCA6888472BB30 WOLF2389
126,704,427 *0CE9AC22AE19318B5FE6FC01CA31D11EFEEC81B6 woundcaremanagement
126,704,428 *0CE069D3F6AA789DDD8D59D800FAB68A91EBC54F woxue
126,704,429 *0CED4EB5139EEC549A1554F0D797E0B9FA05EF7A 2009年5月2日からは新シリーズ『CANDY
126,704,430 *0CE931A9A3AEE0D9797F9CCDC51F21628544898A [email protected]
126,704,431 *0CE33416CE7C096544B8D450C930741B0E5CDC4D 20palveluksiaan
126,704,432 *0CE750AF0F05B29C4D2768D9C12A0D7B6F2E2A97 20WOODRING
126,704,433 *0CE82A69164EF52A38D9FC84E148F58B70789BB4 [email protected]
126,704,434 *0CE8EB75933279F91AF1D2D9CC374E564180AD19 WWW.OLYMPICGAMESWINNERS.COM
126,704,435 *0CE06C31C189289303C56B15CFECFCD09B491C51 wwwsecretsofmiragecom
126,704,436 *0CEE7B2ECDB5177497FCCDEE74D328AB9A0D68F0 WWW.TEXTILEGLOSSARY.COM
126,704,437 *0CEA10C94D4DA0EF7B3A3F76266CD3DC1B7A3263 2592561 SESIISMUODOSTAALOPPUTULOKSEN,AULISKAARNIOSELITT
126,704,438 *0CE71EA6C47F85E3F998856D1C159562D3434F75 2733915 VORANMELDUNGUNTER:9917188ODER9918143.
126,704,439 *0CEFA793BA78153A028C8B8E8E4FE68D3A2F25B1 [email protected]
126,704,440 *0CE684FD55E4671398CD2DD4227B69B412838D27 X(J1
126,704,441 *0CE1402DB40BD256472B070C75E6153585A8BF70 X/L;
126,704,442 *0CE955C18C86F33D3E7270D699D5BC4190B51990 xukoupu
126,704,443 *0CEF59CB62DF2C5DE545C76AD2EC8096FE7E9264 2DRAEHFLA
126,704,444 *0CE205618AD6066E85EB6CC3B8FDEC2FD2503420 x$vz
126,704,445 *0CE1C38FBB1EAF8FC4E2AB3B11943F57F0429CC1 Y[AAA
126,704,446 *0CE32693DC737C786447176894A67D6E20EA6478 2FSAIKAIHATU
126,704,447 *0CE3F4C608532F60A113DD93B58A6E6BB5F9AF54 [email protected]
126,704,448 *0CE42ED1A1A38BF57E983CC68E33B813A0219BD5 [email protected]
126,704,449 *0CE527A838D6C17E0B9FF925DB433F4360B5CC55 2IAMSARAH9
126,704,450 *0CEDF00273D35AEA7D0DB558A4C8836AEC0E60CA 2kushner
126,704,451 *0CE99CF81010FBD0EA15DFF4604CA72A5A18F260 2OUTTERMS
126,704,452 *0CE7E3A3E4AF848F9A66001BA9B877671013657D [email protected]
126,704,453 *0CEFA0938B9FD82766278E316B1365D63EDB1221 yinka.tella
126,704,454 *0CEA8FD95C8ABC832F85135402D7A2B84F865BBB YITSHAK8
126,704,455 *0CE694B30FD83A6260A500EB2B0E854DA5D42F8C 2XPANTERA
126,704,456 *0CE3498D3B1A3800C6E1C88580162F6AB8E4532A YLLCTMRH
126,704,457 *0CE3B4DFDE4247495F61CB06B81819F55C7D208E 30121060
126,704,458 *0CECA2144A235CA5D707B39DEF0F32F6B0D0DDB7 [email protected]
126,704,459 *0CE817FBBE2BABB80183E24851F40922F0D6BD9B 3418 bloodbrain barrier
126,704,460 *0CEC07AC9A2A86BA7874A2199C32DDEDD611B7F4 38AF80550D7F5934E6F996FFD0482AC5-APRIORI
126,704,461 *0CE738E7765EE3E7579C5466AE47837895F3DCC4 3-abgekippte
126,704,462 *0CECDD0BA4E47C36AA571DB335FF87F9B0755D99 YVETTE-GURICK
126,704,463 *0CEFF4365A59D7BB425D2794E274404276366DBF 3ETTAVIEN
126,704,464 *0CEF3D2A3658087C30A05E6439151FFBF2258467 Z3~Z
126,704,465 *0CE2C050B7E7345C983B92D3BC44DD70C62F4E2C 3.ILISKILERIMIZIN
126,704,466 *0CE619AEA91A8FDFD238D8ACD7B17E23AC8B1C46 zackbajorek
126,704,467 *0CE83AEAD4F9DE5AC90D9B9483669CBA7E285126 3-KULKURIROMANTIIKKAA
126,704,468 *0CEBA83B1A45B764165A266F644FE2F6FCAD1603 3#####P~.~.~(_0)
126,704,469 *0CE5AF5BFFD452F8865835AA0177DBCB44408DB0 3#p* * *(00)
126,704,470 *0CEA73169D428C69D251730D472DD206A98E13C2 3pekoselle
126,704,471 *0CED076E88A02FD2E39AD85FFE84E546BF1B46A8 ZAP;
126,704,472 *0CEBF6D11C90A54C47DB2B70E7D4052199DFF650 3RABHASAM
126,704,473 *0CE75FB9743B7CAD685D5326274BB400AD5566B3 3trouver
126,704,474 *0CE099D94E8019555C13F6EC2575D3D0A7ABC084 3ysupv0zrfm
126,704,475 *0CE8BEB1719FFA961351EE0C9DFBC837B5B3BD7D ZERONOPSIS
126,704,476 *0CE0A217B163FB1EE2515A44AEB5E2BC637BBC08 [email protected]
126,704,477 *0CE19F0D0B1905EC3A59BEB9684BA97C7F7596C1 [email protected]
126,704,478 *0CE0975741E55683BA8A3E8CD0B13C3BDD48BF67 [email protected]
126,704,479 *0CE831ABEF5935A6A4A94572DA6EDC88D72ECBF7 [email protected]
126,704,480 *0CEDD3029994C7035D31A5BD355CC72C34E86385 [email protected]
126,704,481 *0CE09CDC951C53544F53A1916F884F286F12F022 46.keskiluokan
126,704,482 *0CE29B7F22AA37337A9063B204603194F8F316D8 [email protected]
126,704,483 *0CEFF3AEC5BD2D456B6CCE98D3947F22F871365A 4calimere
126,704,484 *0CEB3596E2CE091995DC4E1E3602C1E0A8AA1884 4DE1D2219C717D5C5344D66F6D67ED26.STORICA
126,704,485 *0CEE45F6ABE085A2D24BB1B6701E759E02B3607F 4FORTUINZOEKERS
126,704,486 *0CE81D279C2276782B146E51D1B27123182E3A84 4INTEGRACJA
126,704,487 *0CEF9E6169AAB9752E853B97BB5657E36E13504B zulkarnaini.ras
126,704,488 *0CE00ADDCEE449A87919162A1AFD98152131795B zurainee-isnain
126,704,489 *0CEDA68B49F461FA75590092F36A706C8E901F6F [email protected]
126,704,490 *0CE3AD605701299FB3A2A11F06388AD9FDC0AE12 $4LICYL4NILIDE
126,704,491 *0CE8AD4DD1CA61863C02FAC637F7ED623C93B4C8 ZWIERBOLT5
126,704,492 *0CE840C604579B8FBA34A511B810F20F3EE0B2A4 αθλόπολισ
126,704,493 *0CEEC95DAFEAE940B2EC2EFB517BCA521BB5F0C3 4 PERUKIRJOISTA
126,704,494 *0CED28A69EF32D0574964180E682DF4C4A0C2036 4PORTERSUGAR
126,704,495 *0CE12B1F42A7C54D4DF3308DBDD577EB04DB0C87 4QUIENZELL
126,704,496 *0CEAFAADF1AECB787E85FC2F72B6A474D3F2ACEF 4RBITRE55
126,704,497 *0CE5E6216CE968AE4314D5143D87D92E76D18FB7 4SEUCHES
126,704,498 *0CE3BE831154698F4A797E9ED5164DD9CCD77CAC 4SPIROGRAPHES
126,704,499 *0CE7C96CA3FF8F802D6F32895C943AC8C49A380A 4THESPARROW2
126,704,500 *0CED388B1AC3CC31FE92268D475036BCBE58A22A ивасёвый
126,704,501 *0CEB43F7FA657B817CB184E55E525994FC10F2DB 4WAYINGANGRENE
126,704,502 *0CE85ED06FBFDCA8F2DD04E44E825E8CAD37D3D8 КАЧЕСТВЕНОСТ
126,704,503 *0CE02DB3EBC947F5B2C40B5FC768D9B413111457 533689 WIN--COM-BULUNAMADI-HATA-MESAJI-YAYINLANIR-
126,704,504 *0CE6C8E0C0239CDE5A5F037B3817611D1374F709 545950 A)JOUKOSALOM
126,704,505 *0CE22254AEF6B27CB8DC3049A21303CE284ED706 муте
126,704,506 *0CEF570E5C3070A4CB7C6FD874EDA56B4687FC0A ПРОФИЛЪТ
126,704,507 *0CEE567F30033F7998AE09869C288475EBA082C7 рехер
126,704,508 *0CE86E1E0201BDB0FA0811DFABCB72C9C1325DA5 РОМАНСОВ…
126,704,509 *0CE16F64BEBD20625D0FDF054940F9C12EB738A5 САФАРАЛИЕВСКИЙ
126,704,510 *0CEB9DAA0D29901A6646FAEFBA5D40FE7B41756B СЮПАВЧИЗЭ
126,704,511 *0CEFA7A9A32462F1C05998380A7A94DAFDF7DEC3 5COMMEDIANTI
126,704,512 *0CE6756349106DD6E1DC8F386A810092212646BE ЧЕХОВОЙ
126,704,513 *0CE078743942E66F47B7ECAE1795D8A76EAF0CD0 5FEUERMAN
126,704,514 *0CE6D7AE58A1EF46151041841E87F84656A39A61 5HCIRLIEP
126,704,515 *0CE6C83E5DF5DFC3F914B5B4112F4E899BC741E5 5P45MD1C41
126,704,516 *0CE60D13D3C401425A5EEE0C6F1310C389820586 5PHOSPHAMIDASE
126,704,517 *0CE8BC5403D82DB65A4ACF74EB0A8A5FAFD79599 5SAUERSTEN
126,704,518 *0CE8080B6113F4A7B51156D3E6F06E5CC63D1011 登場話數:ep3
126,704,519 *0CE0AA3524E9FAA16E1545CECFE68E61B61B2AA4 5tatelne55
126,704,520 *0CEB73F53C13D02FCE2E43DC505DF895301FA627 [email protected]
126,704,521 *0CE2607E9F6C23A6AF4223E0B372BEA87612A487 表町BC
126,704,522 *0CEB2077D80B70DA384758E6442B7127DE79985F 5WEBSTERAMERICA
126,704,523 *0CE28C22242FE4D7C83B031D7CE794E168558D65 612380 fakat-o-gunleri-coktan-aramaya-basladik-bile-.
126,704,524 *0CEA0615EAA12BB95AC46DBA96A0793F7793E447 643-omiaan
126,704,525 *0CEDD443502115148D422BC66DBF5548A2D05779 69D8446D-B3D6-3938-A6CD-2F681168E212
126,704,526 *0CE8BC21B8E0A04B9312E7523CE487F2839E2B36 6AALSTEKE
126,704,527 *0CE84AC22C47CD632B68F755102E83684AA8C819 6CHANELBLUEBIRD
126,704,528 *0CEC363E5C7A4F27D96DDD9DE62B16B24D119435 6CLOUDCOVERED
126,704,529 *0CE5853D196F637D70117C4BFAEA9AA484B1B06D 6.DOEREN
126,704,530 *0CE0930D6999D6C51ED4B6F9AF753337C9B2EF4F 6EIKONOSTASIOY
126,704,531 *0CE35A7953C16405DA56CF9EE3EDFCBD462E2970 6FORCOMFORTCOMPASSIONATECONDOLE
126,704,532 *0CE05A299912FDA452461925F7181403AE5C790F 6HIERHERZUKOMMENS
126,704,533 *0CE22E72D96BC5D1064EB26E553A5E971C20AD3E 6ILAGDAJ
126,704,534 *0CEE207D3ECC192B6E832F5A33AF92164CBDDA4C 6LIGHTSWEETY
126,704,535 *0CE85CE6A02533CC94A172AA683AB00E97E328DF 6LIITTOSOPIMUK
126,704,536 *0CEFBF72B6648B4BB2AA7984CDDCD5DF7857EF44 6preinsulate
126,704,537 *0CE9991ADC0E6C0E532CBFFE5C2C8F1A9F192850 6UDDATAARGUMENTET
126,704,538 *0CEA4DC872E43C1E6BAC6240544D452322E07F84 7ASSIMILEREBBE
126,704,539 *0CE89C00D5445B0DAA32D12FAD429DB785274A1A 7-cathell
126,704,540 *0CE6F14E72D158470AFD2C2D9313AB328397F932 7COLORADOPUCKETT
126,704,541 *0CE32982B75A4429DE5A89DB602F6B67CBA16374 7GOLFERNINERS
126,704,542 *0CE162DF7B0F88F7C0060EEA33F79C3C235B9619 7LOVECAM
126,704,543 *0CE0D430B6131A705E055030AC38B4D1C9CA10A8 7MORTGAGELIVING
126,704,544 *0CE4F783B31437D9B29E9CC67CDFCD59FD0795D4 7OUBTLESS
126,704,545 *0CE170D9E88307F7B9C732E37EA27CCDE59E586C 7STARMENU
126,704,546 *0CE29CBE15BC285B410AACB7112F2F315665F067 7ZASRAMISTE
126,704,547 *0CE7C2E4269117A5E07F45112D1C475314D2F369 8BSWDIFFRENCE
126,704,548 *0CEC28B7B574A1EB9085CBFD9B470F84DB3D3C48 8CHERAS
126,704,549 *0CE425023B4B0C66FE862566EB91FCBC3E7DD02C 8DREETULO
126,704,550 *0CEDA20288A579302C7ACA1491049C68A44AAEF9 8EDYXORDYH
126,704,551 *0CE025390CCD4278E8A9E6C924C393D992B0CEE7 [email protected]
126,704,552 *0CEA6D88D1EF8AAECD3ED77C5B3A759597E7D78D 8.FLEABAG
126,704,553 *0CEAE5C433718ADA94F5EA79BDB8A47DC5FDC4DD 8HYLLARE
126,704,554 *0CEC8A6A4686765EB4619A99F68A138A97482611 8IAMMONKEY18
126,704,555 *0CEFC00EE52289FEC773BC01D1BFAA3E3F8882E1 8ILOVESABINA
126,704,556 *0CEF54F7A2524E4AEE9A5AE84705EBF5296350BD 8ILUVLASER7
126,704,557 *0CED2A91A99FFE3A43ADEE4448B0FCBECCA1E890 8INIGYSOK
126,704,558 *0CE53EF6F263D7E93113E5CDF9BA8BBEF967A6EC 8NEDDALKE
126,704,559 *0CEFCDCAC62C107EAB2FF9662B6F6606878D8BCE 8#####P-~0-:P
126,704,560 *0CEED6C8AD11AD4CCCE9C9003ED40DA8871A4AC4 8###P.*.*.3B<-
126,704,561 *0CEE6BA8163707B1C78AF64FBAB77B7AD5C3638C 8-----p ~ ~ )o(
126,704,562 *0CEC25C225900E278EE9D9091361A6EF5C157521 8#####P.*.O->-<
126,704,563 *0CE4A63173EF4812D9C5B50EDCF2378D6FD57AEB 8PROGRAMVIRKSOMHET
126,704,564 *0CEC01D239615E5B48F828F9AE63BDF65283FE2A [email protected]+3s
126,704,565 *0CEF4B3C30D10083AE90B0DB6CC86B92C227D4BA 8REJOICERSES
126,704,566 *0CEF1C5441DF460275372EEAB750012B553C3F39 8ROMENERE
126,704,567 *0CE0D5F636BB92723846B2090E01CBFF48425C9E 8SALPINGOPERITONITISES
126,704,568 *0CEA0D6E8088FC0196C9F0951FA23AF4F0820D6E 8SAMVIBHAAGITAA
126,704,569 *0CE4E79F1A05F6301AE483D9CE84BBA4B62103B9 8SW0ZG4BDD
126,704,570 *0CE0F3F584541DEDFC944F7F399F8A6539749DCB 8USNEDNOK
126,704,571 *0CE67A784F483A8650ADC0468EAF2A21C59B3524 10-fahrwege
126,704,572 *0CE5FAD0F00B9CAA8E4DBC32EEF51409F7FECAF4 9-06-1394
126,704,573 *0CE786F9334DBC105CDF19B37B3DACF27ACAAEA9 11 ENGLISH'S
126,704,574 *0CE98EF992EF23103FA703114540C81955A03FA9 966181 `-USUME-!--
126,704,575 *0CE6912481C647860965E444513416B5CFE98F8A 1474573 hiergibtessechsprozentundkeinenaerger.
126,704,576 *0CEEB8A77F8C3CDFBD697A054EDDDBBEB0D18325 9DIRECTORBEAR
126,704,577 *0CEDBBE44A3BD3634A65A80DD9880EC772D0547A 14-VAHVIMMAN
126,704,578 *0CE1CF21203E884C271D801EF3239FB36315160A 9EDNEPOLD
126,704,579 *0CE4D3026379E0771E14BD991428D5FC89EDD197 9GRETZKYTIGRE
126,704,580 *0CE641590D477A2557397966D590129A373E929C 9HERSHEYSTATION
126,704,581 *0CE77493FFF371DE634375D0BE6A03B9C36ECCA8 1705759 TEKNISELT
126,704,582 *0CE5CF8E9388160602599C16FC687D4AB839290F 1778922 LINNUNRADAN.ROTAATIOK
126,704,583 *0CEAD064576A6B26622648A67199FAF6C674FCC5 9.KHK
126,704,584 *0CE7EB42D00B08A00F2064D4CE4AD3AFB1B9A191 9KRAMERWINNIE
126,704,585 *0CE4F5F8A8B82A34D0EC17F222190C0172082D08 1919703 molemmissaosa-alueissatapparaonaivanliiganter
126,704,586 *0CE2C013746159DF611B6D4FEA7D4647AA10297F 1AAACANELA
126,704,587 *0CEA246B70871C1AD3DC1559BE25EB36262C539A 1bogdan'dan
126,704,588 *0CEDD18CC68BB7D017DFBFF830E83FB045849E53 1-CASIMELDUNGEN
126,704,589 *0CE83A0B3D1F46B8E2773C9658F873D27ED54498 9SUNNYMONDAY
126,704,590 *0CE74914913F1BFABD98BFF885B9C9DD0A7AB835 1DEVOUERE
126,704,591 *0CE26C26750AE92B7F9DD8FF0A7E6F8F38CB2FD2 1DISEMBARKATIONS
126,704,592 *0CE4326C56E3B87A6099209F170BCA2DF8536F12 9ZRGHUBWPZWF
126,704,593 *0CE8C90E7698F8CD796E5C6810BBB6E19379A488 A0#M
126,704,594 *0CEF62DFE272E8EFCDEDAF418FC4BC2CED7FB08D 1 ECHO-AWARD
126,704,595 *0CE78B6D909E5DB4218992D80F12958D33D41773 1fake-jazz-legende
126,704,596 *0CEB50F06428CE957C7BB42AB13637EBFEA79538 A3I+X
126,704,597 *0CEE7AB36CB8527DD30B9586F7FB8A10AD5A4484 1.geistig-sinnlichen
126,704,598 *0CEF55D91EB7D301B71E38FCA3DFE890AABAD80D a:43
126,704,599 *0CE2D811E3485F67EC40F037612B9EFF1E682D92 a!46%
126,704,600 *0CE723D4136AC364329C4E048548D00EA4C688F8 1IAMIZZY8
126,704,601 *0CEA4440072F0DE68313E9A4B2FC3EB86E88A875 a,6d/
126,704,602 *0CEA8D12356A8C7A001E510A06EC40C1918D2C33 1.KREDITABSCHREIBUNGEN
126,704,603 *0CE6F5C8BBDA065F3C85B17AAEE705C363B3A4CF 1-KUUBALAISYRITYSTEN
126,704,604 *0CEA53BD36958D68CFECA392E18B4F3384B64150 A8VKA
126,704,605 *0CE71BC306A054DA503DEDBB3643786C14E03607 A_-9I
126,704,606 *0CE1BBB52C6C04D5791387F5E988FE6B404E98F8 1.METROPALON
126,704,607 *0CE2D17D128077CF71C58D338B8A331416D18007 1-MEURMAN-SUVUN
126,704,608 *0CE15D5F05A9BC6C2F7BD981FC9FE2E07F181C5F 1MICHELINMAENNCHENFIGUR
126,704,609 *0CE256962D6BF8DA531EA6DE81F01D1805C0B7BB AAA~
126,704,610 *0CE15BCFA1FDAEC52C95A2B11E1D500B43F0F2EC AAAAAABABIES
126,704,611 *0CE064EF2BF281893B7462C4568FB622D8F85120 1oikeanlaisilla
126,704,612 *0CEEC8E364F4AF99B3C34665C117CEA0F28E2C5D aaahe;
126,704,613 *0CE05397B3DB57733E7E38FACB3F20D0E43677AD aaavff
126,704,614 *0CE86E9A0159466EA08DB7FD12CCC8D1A8B521F2 AABDH!
126,704,615 *0CEE8D2A2E4190AE1A52CD95B07B1983AB91C3D4 AAB_L8
126,704,616 *0CE11864F5582C46B429A34EF5B784F17183B1FA AABQP\
126,704,617 *0CEB26E56A0DA4A4E8E2344B627D259BB60AB4D1 1 RAKEN
126,704,618 *0CEFF9FDDA95B14FC3B1572B18FEAC024CC096BB AABW$
126,704,619 *0CE1752DF24A149BBE81C6A7B77597A33A3630A5 1-SAAMELAISEL
126,704,620 *0CE6DE826171D759D8F4C9739793F5DCB9218836 aadisy
126,704,621 *0CE029D37DF36802D28A5BEDCEADAA6E48785EAC 1SEOSSUHDETTA
126,704,622 *0CE365C7B7FBF58243276DF3DD1DED9206CB805D aafdh>
126,704,623 *0CEF3422B2C1A53087E9385C29D1361B7B2E4375 1teilzeit-lehrer
126,704,624 *0CE1F321E6B78390808C9127585F87B1454DE165 aa~p}
126,704,625 *0CE5735DEC75EF2970E26C8848751B4390730F1E 1USENETARCHIV
126,704,626 *0CE2406A86A6FAFCD16397AE9C77B70B4D12F528 1 VERKKOLAITELUETTELO
126,704,627 *0CE856F1373FAD140886D0046FBC46D3233AFBA7 AAZ;C
126,704,628 *0CE7FDCFC1F242AEB0BDCD0AB90A5ADAA136D4D9 1.YHTEISVALLITSEVA
126,704,629 *0CE7548DFC2B64C7B94D534B5981B0572819AD1D 2000MAN
126,704,630 *0CE56812D2A5FD265A2D17CF56027A859206CEF6 2009年8月19日)universal
126,704,631 *0CE8DB5B2B1EFFFEF245927549C5982B1056C029 [email protected]
126,704,632 *0CE19E7EBE35BA46DFF7284A50888606521FC0B6 2070287 LIS
126,704,633 *0CE18FD9406572B199DCC9752FE1ADEF71395416 20-JARRUNA
126,704,634 *0CE6C014825FA5BF9B4D13B06753C2EDF75D9B7D abschlu
126,704,635 *0CE31CC3988091AF5DD3D984E808D0051C60AA23 ABUSTIM5
126,704,636 *0CEA68C47F31CE14ABB4A61F1647649340C16617 2308250 ITISTHELASTTEMPERATERAINFORESTINNORTHAMERICA.
126,704,637 *0CE9AEAE94CF1468FF1BE99662A1FE8FF8F763FD 233courtney
126,704,638 *0CEA951AB5C1CA01806B8C60C638D4ECDEF54720 23TARKASTUSK
126,704,639 *0CEBDC6C1432E5EE110B307658C0756904793886 ACOSTALEADERSHIP
126,704,640 *0CE6EEEA8675290C08A79137275E34C6ED302DF9 AC:P/
126,704,641 *0CE4421E67BBC9ECFA31A76F6927F5F669FD9333 ADAMBCAVE03
126,704,642 *0CEAC34A99B4B3A70009826D97F943FFECEBA095 29JUL1608
126,704,643 *0CE1BD51B8BC1668482EF803CC16485617DD00C2 ADCd
126,704,644 *0CE11C4C5346683B78D2640F722293E2D5D52707 adeakas7
126,704,645 *0CEED42FD1CDA8E53FE692779D135B98C57934A9 ADK&L
126,704,646 *0CEFB0FC65CB1C02CA802B888ADEDF09BB0E6377 2-ENERGIEGEWINN
126,704,647 *0CEFFB6336D815A584F58EA713D29E02728E38B6 2EROTIKANBIETER
126,704,648 *0CEFB0EB40F2B35F4F5105B7859F8E61CFB386E9 adolphfahning
126,704,649 *0CEAA2C35411E74966C2F6E44E7C4D880DDF32A5 2-HIEL
126,704,650 *0CE2D271C57B2553C6C29357914E89EA6B046904 ADOQFTVXS
126,704,651 *0CE900F5A476273DAD9B145047D3757E88D78E72 ADR
126,704,652 *0CEA1F7BC495F4B341DFE26D62AC8D684D6003AA 2-LOMARAKENNUSPAIKASTA
126,704,653 *0CE716709F212CA5B614007FD6D0EF4AD199EFCD ADZSB
126,704,654 *0CE2EDA9EE625977DE23D2E5201261E9F35C4443 A;E
126,704,655 *0CE44245B90034D3004D8BAA35E4F1C432612F63 2.MATKAILUVAUNUSSA
126,704,656 *0CED5B3CE86FA55D5A4E1AC50DBB90E7B053D82B 2PEERT
126,704,657 *0CE99649330AC02335AE8154806E70A9D397F680 AELUCA
126,704,658 *0CE0999907251635506A30F1F1CA6EE1DDC71036 2.scientology-konzerns
126,704,659 *0CE2FFDA0BAD34C2AD6D05544E5303B404E52AF3 2THATBMW4
126,704,660 *0CE35319CC5F56BCEBF0C056D8ED45DDBEAC55F7 2THESAMSAM8
126,704,661 *0CEDA0944F62AEFC30EB40AEAE790B7B869819E5 af&6v
126,704,662 *0CEC987D7141B158D59CBE26028528B7303B03E1 AFAMADAS4
126,704,663 *0CE5B6DC77B964869303D8D5D5D049BD48F6BE33 A,FB3
126,704,664 *0CEB64F7D7E61F8637B9FF512EAE86C8136606DE 2.uudiskaavoituksessa
126,704,665 *0CE6B54359DC3DE0F00E1079E1839222E1AE3411 AFEIBEA1
126,704,666 *0CEFDCB2DD601FE4D5AF683FC137189358B02F6A 2-viherpesu
126,704,667 *0CE4D71E4ACA8D27200AF1A401001265E2639FE8 AFK2154
126,704,668 *0CEFF8F25C323AD9C2996DCF804B320DCF0554BA 36LAPPLAND
126,704,669 *0CEE2A3EBAB7315F61CFDCB8D9B622F6CF2F8078 agln"
126,704,670 *0CEFB4E62806063565785E39E81015D74806959E 3B<o~0~<====8
126,704,671 *0CEBC6D1743FEED21691531BF1F501105456F425 3B<-o~.0~.d####q
126,704,672 *0CEB8AC5CBBE4936932645E304286DC703D2544F 3CANUDLE
126,704,673 *0CE57DEFAD23D9EDC59EB41DAD9DBA7B9AACC476 AH?CD
126,704,674 *0CEE7A0EAE381A04D5CD89880BA4FF31D3A3834D ahgqp
126,704,675 *0CE1C406847C679248C32BD9FE20D91DCB45D9E6 AH?M
126,704,676 *0CE8AA557F1A3987B27522D8681B94BE1B65D3D7 3---d` )x(
126,704,677 *0CED5373A7EA4631CDE39A308F79304073001537 ahn)n
126,704,678 *0CE373F74A408FFB2E40251F2510B1B6C1CA8BD1 3ESKINNY
126,704,679 *0CEE0939496F94322D2F268B769E480DA7CF6779 3GPRVCRD
126,704,680 *0CED9590FF2AC3159C1606F47C0D662CE690F772 3KULTREGISSEUR
126,704,681 *0CEB0D76DA54E127364065A9484B873C5EF28CC5 3LEGEND
126,704,682 *0CE5A14644E0BA4FD1A538EA82878FCEA5AB3B3B 3-oberstufenschuelerinnen
126,704,683 *0CE3A06C1F399E93405624BF02B795D7955F5E8A AIQEH
126,704,684 *0CEC01A87D7D16745C316B2D27713EFCE3F76BA7 aiqow
126,704,685 *0CEE11F0F5622FD49A4D46446011220B88AC50B7 aisling-king
126,704,686 *0CE15F4E43F5C561479F0D54544BD7E2C3F410B3 ajith.
126,704,687 *0CE062DE35202B3566201C48D9E875300608A47C akdxl
126,704,688 *0CE120548B17154BE0226A5C932BD170F76CAEEB 3秒VER各3種類
126,704,689 *0CEB38ADD7F8F6EF7E4E56C61A2A762582F871EE 4021667
126,704,690 *0CE11EF35B0DB9C7E375EAFEB2C5668FC46C1E84 440855 nuranavsar1.ecz.
126,704,691 *0CEB4F0B7FC61F1A8B22E01F552B02CE75B1AF79 455MADALYN
126,704,692 *0CE9A633BCC1393CE03D3897AA3F303FF0F128D9 alagiriswamy
126,704,693 *0CEB11B4A4D0623EEE4268F2C0E5D80B80E60405 4954753
126,704,694 *0CE02CD4A1B3F40120CC550BBBA957DB837AAF49 495JUNIOR
126,704,695 *0CE098AB1E11CA7C9AB9830D5E52E33F89D687F2 ALAN SHORTER
126,704,696 *0CEEE75878CB1DD19EEF88075D1E36E5A20F8FCF 4)ameanmongolianthesecondnaziandthemongolian
126,704,697 *0CE30889381B8161185F4C76D86A9CCB257982D7 a=!lb
126,704,698 *0CE57E940A383F3D78F55B7B079C3EC14D8DC4E3 ALBERTODEHETRE
126,704,699 *0CE322EE69D252C2C68DAD79BC69974893AE537E 4DONI$3N
126,704,700 *0CED622B9E6FEE09A444EB2BBDB17CEA7F384B20 4 drittenweltgruppe
126,704,701 *0CE3CA4DB8A715C1B6C7D8D15A43B77B8D4E2044 ALEVINE6
126,704,702 *0CE6C519BC2DA11AA8F559189C45808B6F328063 4MICKEYPUPPY
126,704,703 *0CE0A77C33C19372BECFCBB2F9AC91408E9A2E07 alfredokirwin
126,704,704 *0CEFE1E22CE26A1555F8128A8AED6826AB684C70 AL.HANKINS
126,704,705 *0CEDD767EB9B86E9CFBED4EEC057D1B3CC57FE06 alina.rehman
126,704,706 *0CEAA50033966B95E79AC34C76B85F8016D16E29 ALLANTHOMSON
126,704,707 *0CE296E73D3ADA69C63C5FC79B5B045BF7B775B8 alleniin
126,704,708 *0CEF6F2338D1F33E8C550580F10C8EA93F51F2D4 ALLISON410
126,704,709 *0CEFA8B678C639D3DBF160132D2FB9B2D029EB1C 4THATNUMBERS2
126,704,710 *0CE5C256320561B4CEDF8D8494C12588B8D40EB4 ALPINE9000
126,704,711 *0CE10510B4D77DCAC4448B3A64619E744D85CD67 4TSUKEMONO
126,704,712 *0CE2821271581960ED9A25711071127C0C65BCD7 4WARNERRUSSELL
126,704,713 *0CE1FF00CC0F4B4FFEFB38084793C7EB23CAE60A 4台kuznetsov
126,704,714 *0CE08DEE44DC66666E78D5E57F9D7B1DF237E3C2 AMENORARED
126,704,715 *0CEC658E408D0768EB7FBE8422972F71785C3202 56CLEO20
126,704,716 *0CEB59AFEB0E30B89F9C73AB8011BF13C2CDC112 5BEWAREOFSNAKEOIL
126,704,717 *0CEA1E7ECAD882D0A486488AAD09D8297E4DC016 5CATINUS
126,704,718 *0CEC48E4AA8D0B34FE40DEE2FFA3145E746723E4 5contenancerai
126,704,719 *0CED576CCFE4F11211A00827CA84E710EE39A1B3 ANASUUYAAM
126,704,720 *0CEEA7E5FDF71183C89937C39A8A4B4CED801259 ANDRESAPKO
126,704,721 *0CE9B4829128E497FE0D1E81107FFA322D8646C2 ANDREW.DONILON
126,704,722 *0CE3CFC103F988B4E58CA82599528D442B7A0302 5HATCHELLING
126,704,723 *0CE3F2D6946F32072B1FB2C3FCBAE9950B3581F1 5.NAESSIG
126,704,724 *0CEAC76F663321B69639BAE764658A4EA93BF7C1 ANGLICANE9
126,704,725 *0CEEE5B8AC696B594C711159DB94660FF413B541 5odiasti
126,704,726 *0CEE51A22D95553051BE8E489A928D0BBA27D40E 5 OPIKSEMME
126,704,727 *0CE1803816B6FAAE1C05A849B067C34327B6E7D6 anilkumarsabbineni
126,704,728 *0CE8AFB7927A6E48398E304EB46594AE4A8557B8 5REDITELEM
126,704,729 *0CE659DA3EC692CEB94F1D7CC5E0A9AB81B5FBB4 anointers
126,704,730 *0CE893BBC23C26F93381CB81416F5BA7E8EBC374 5ROCREINO
126,704,731 *0CE63066630D4DD6B9E8D39E4FE6E0CAB9C1997B ANTHONY.VICUNA
126,704,732 *0CED71213849B4D5062AC872AB81A2C77E1A6017 5WMVIERTELFINALES
126,704,733 *0CED4F40FC21C1DF064EDE2DA107CA16E2A91A2F 621madilyn
126,704,734 *0CEAEB6F3DE5F42C9C9DADD32B1D7DF0193A6FD4 aoqwe
126,704,735 *0CEA548421FC9E5CA23BF79EBECCC4DBBCF2A81D 672718 S
126,704,736 *0CE7DA000C8E55EDED8A453C9541025275E7DE8F A.POPMARTIAN
126,704,737 *0CEAE6B5BCCE7B12F603C2E912D15AA3A5F7188B 69385B4E-375E-3A90-9C96-1806FC7E20FD
126,704,738 *0CE4D00C1142669C3DA4C174E2A1A4D19ACF2290 6AFFLADE
126,704,739 *0CE60B8715A15483B6B2AFD0B78CD8E200EBB588 6AMHARCAMAR
126,704,740 *0CE5B14EEF7D681846554EFB89CEEA0215712FD6 aqsjn
126,704,741 *0CE8B6BCBA8176814A3D35FAF38EA03817E6811A 6COMPELLATORY
126,704,742 *0CEBF807EC8D5A233CDAC15A55C4B4F1332EF416 ARDEN.FRANCESCHI
126,704,743 *0CEFE426C6018CFAE333ADE403B20FF21B4510A5 6FILORNIJ
126,704,744 *0CEA2E22EAAA12210854B35BF50B454E15FBD60D 6HONDASALMON
126,704,745 *0CE15B5900888F4C3723B3165C4966981799083C 6iluvpepper2
126,704,746 *0CE4B4D79E4285DB34E8429768CB31D38064886A ARNOLD.SCOTT
126,704,747 *0CEFDCACB1258D62EFF65A6E86745446F33FF54E 6LUACHACH
126,704,748 *0CECB00715809BDDC744F1AE0F5A530CDCA59894 6 n
126,704,749 *0CE9FC2ADA72AA29AC95460FCC92C905EC8C3C55 ARTICTE
126,704,750 *0CE97D4035B3E57AE670278AC61F4B3E52D9704D [email protected]#$%^&*()-
126,704,751 *0CE9B8C2142AFE51B45649A45B2566B224B428BB asdfjkl;sting1
126,704,752 *0CE534C3A56522E8AA8C2CEBC94E70A7D5AD77F8 asf_#
126,704,753 *0CE6FBB3EAE95189FE7578769E975D398D593952 asg(q
126,704,754 *0CED6C0BD2972077F7DD314A9CC187297146E5E3 A,SM9
126,704,755 *0CEF7D3FD6662B4BEE062CCB48C87BA34AA46059 astrictively0
126,704,756 *0CEAF944300D64A380BB8139114B9BF33265EBAE a/t=
126,704,757 *0CEE701B5D543AE4F75D0CD3C8CD77F88914ABF0 ataxique6
126,704,758 *0CEA6873C67265F0A51B996F9239181D9B1A22DE ATD)C
126,704,759 *0CE0710E8324084B982B1A25F18588A78AB20B32 ATEISMIST
126,704,760 *0CE5AAF88E1020FDF8A0D2AD18D66A7FC60D9116 ATJ=B
126,704,761 *0CE0FD4C5E86674D4CF0FAA5BC5BFE033F9358AB 73SS3RA7I
126,704,762 *0CE8EF83734438B4166C36CAE0A831FE0912E0B4 755151 that's going to put a crimp on newhome construction
126,704,763 *0CE760B82C0E890B4D9CCF7985DE4D69B03297D8 A.TRAMP.ON.THE.STREET
126,704,764 *0CE98D52B285AB9E259BCDEFAEDD88FBEC5D03E5 atsiokla8
126,704,765 *0CE970953882A6D36D40BE30F5A994AECAD8AB83 aubreyreinartz
126,704,766 *0CEBD155DF259EAC0B0C64EDBE709E4AEB9819EE 7BSWSUKOVICH
126,704,767 *0CEF1FC23D89D7E42B636F6BACE68B787D9CF645 AUGUSTINEANTES
126,704,768 *0CEDD0F2B858334F419BED60A0D8C03ADD05F6CD AUS-DEN-AUGEN,-AUS-DEM-SINN
126,704,769 *0CE7A80CB89F11D679D99A09B35E493FBFFED107 7ILOVEBASKET6
126,704,770 *0CE4CDC21249C3E2D80F733B137BCB4A0CE7F937 AvNcross-cousinmarriage
126,704,771 *0CE9A84F78D0CE2ED2F72671FF003AFB95FFD7DE AVTC;
126,704,772 *0CE10B6DB20E983A7D7E46EF97D7FEDC6F10C87D 7mychandler
126,704,773 *0CE0D3313989F65B3B9EEDDEA6C672CA7D7766CA 7NONEMAXIME
126,704,774 *0CE5A6948E95E70D0717DFCFEE2BBB7A673C9530 7OKATSAUS
126,704,775 *0CE04F2F092A030B57E55F81170F96D89324AF01 7SKNODEIT
126,704,776 *0CEDA46F00194E8497BAF92662653759E1785932 7thuisbrengen
126,704,777 *0CE96663E4C0AA845B745AC183D0AAC09043CC24 [email protected]
126,704,778 *0CE2DFD3B1CC4F51BC1BD1D563F659D8C6DD4A5D (^_~).~.~(===8
126,704,779 *0CEA739977ED3608A8D9202591D497D331D9ABD6 B1DTH
126,704,780 *0CE9FECC762B2E4C9B59B5B9802F51BD803CA6C0 803011 but-i-am-explaining-it-to-them-,-"-ms--levine-says-
126,704,781 *0CE5F41C72A731061ECBD057217A97AE9F9D9D26 b1"m
126,704,782 *0CE54B6DC2AF36CB9BB959A7BF0D2280C11F4AFB 8######>~0~o)0(
126,704,783 *0CECD566F3CE2E84E6BBB071F455D3723DFD7BB1 8-)-~0-~oUU
126,704,784 *0CEB2781041FAF3C42B22BA48D592FBBDF50F2FB b5mlv
126,704,785 *0CE001740AD6ACCE4D541F7B59AF4F29EB4CDF5B 8CHOCOLATSHIRLEY
126,704,786 *0CE4AA25984B5F54361E3EC1213FFF7784FFAC84 8###D-~OSPLAT!!
126,704,787 *0CE4FA4EF8D4C9BC5F259A39C0715FF01DF9E81F BAC7ERO1OGY
126,704,788 *0CEE57A24022BAF3F66E7E133E0FD4BA3134A6F7 8ENROHTED
126,704,789 *0CE7B42A473B0764273AEF989ACC7064574C14EF 8IALAOKAP
126,704,790 *0CE4F3D92FE5C6D217415E5FDD55C1F091910D97 8iamgofish5
126,704,791 *0CEA4FECFB74D7C9B4E0BE2C5A68822497116632 BALGEAUGUSTINIAN
126,704,792 *0CE58AB2B13F185A00FE0410CD019BC810DECD83 8JOEDREAMER
126,704,793 *0CE31980BD05FE87DBB70C01B2F5A9104636F793 8KNOWWAYFAREWAYFARERWORLDTRAVELERYENTA
126,704,794 *0CEB05466EC01CED270DBBFB4D5AAA5805306DAF 8myscience7
126,704,795 *0CEEB05229F8625AC508FEFF703882D47F80B573 bar;m
126,704,796 *0CEFBBFC2CB955231E513F8FB388B4917668C2C0 8==>~O~o(00)
126,704,797 *0CEFC6C09820A3821830F6806547E6D3A0079CC9 BARTONHELZER
126,704,798 *0CEA2A4B6BF9C396AFF0EAD00BEADC01273E8539 8RETILTVINGE
126,704,799 *0CEE54F1FFF6C1841AB575DDCB76B02425585DD0 b-b:2
126,704,800 *0CECB40CB4E2709A6853B802FD9910946B92E642 [email protected]
126,704,801 *0CE19E01B61152155C6BDF78996AA3748584C5DA BB?OO
126,704,802 *0CE081232321EE4B2C4626D4E7A8B63578002340 BC687
126,704,803 *0CE246939CB5D88A2DAD1BA79DE47855FA20CDEE 8VESILINTULAJE
126,704,804 *0CE235E9D667DDBD20FB24FB83D833620CFA2BEF 8VIHREAEMPAEAE
126,704,805 *0CE0E8FEB2BFFAC2249E17499E22EB58A938A94C 999CHRISTINA
126,704,806 *0CE49314D252EACD3AFF157A433D3127AD4CA324 bduik
126,704,807 *0CEBCA2722025E07FDEEFA19F4DF11F3219C69FC be8=)
126,704,808 *0CEFDAD120BA12DA2E346C1320C675F9ED79FC5B BEARCAT
126,704,809 *0CE47BDFC11055B484B6F428F16B1F0AE03B58B8 9CREESUMMER
126,704,810 *0CE2EAF3952DD96FFFCAA58CBB9DD715CA122207 9DESPAGNOL
126,704,811 *0CE49D945B3E0E85E577F498B76756C9F8DBBFEC BELAC2
126,704,812 *0CECB146AB7168CCF2CD53164CC9DF6FAAFE8828 BELZIG–GÜTERGLÜCK–GÜSTEN
126,704,813 *0CE50D96E9562F92CAACF8CA0B246571DEBA1107 bemw/
126,704,814 *0CE60AAEF76F96685CFFF59B837B33981E8BF74F 9IMPALALADDIE
126,704,815 *0CE26B1B6A05BDE770BFD4C3FAC0D4A5C60223CC BENMAHOWALD
126,704,816 *0CEAC7B6A1E2E9D16A2DBDBBB7B4F9CC4CE60926 BENNASEER
126,704,817 *0CEABE97CF117BC9D1906E7DFF6BD6E3AFC8A6A4 9IRENEEIRENEE
126,704,818 *0CE715950BE8E9FC33F518F921C2A8AF6B67EFB9 9NAATTEVR
126,704,819 *0CE91A37F99C04DE38B5878BEBB7B92CF2CDB7B3 9OPYHIMEH
126,704,820 *0CED59C70EF533FE65BEAE56A9B514FFCD3C46EB BERCERAC
126,704,821 *0CEDBF4E0CD9C48846C39B3240D3DA29604F76FB 9PINGSHEN
126,704,822 *0CE0E0C2A7C52E8E7205A9DC85C12ECCC7869048 bertrampayant
126,704,823 *0CE1CE128E3C36205933F9C1E1DC41E2D8CAAAB7 BESNO
126,704,824 *0CEAAD47B60D045DE509F1FF1C69EEFB59E4D45B 9STORHETER
126,704,825 *0CE5D0874C8E0A54B85C6D72A07AC0BC8E17C369 9vuk8hg9u
126,704,826 *0CE57A3C4F04859D8CC7D9DCC892548DB53A8BE6 9/<w
126,704,827 *0CE48B5D605D5D2B5F2BB22D8A87B5986FA23438 b!gbo5$
126,704,828 *0CE8CA190D9C2728F65F16EDF09F1FCF66B635ED BGBZU
126,704,829 *0CE0499EF6A74F30E8D70A7CD108C4551BABD5B1 A150398
126,704,830 *0CE39A0040FDCC057A83939CEA8ABA3DCD12A476 bgrpn
126,704,831 *0CE57655D58B2BDEEBB1EABE82AABEC04705AF48 A1HWD
126,704,832 *0CE0E77209C2EA75C237ED686B2B43B691E693D9 [email protected]
126,704,833 *0CE386F90CB98529E8FD2D28C1F45D4278F14C0B a3.p
126,704,834 *0CEFDFF5CBB3D86C00133179E080AD391EA686ED [email protected]
126,704,835 *0CEF792C547BD7FD1AE86BBFC9049F6D9B3EC769 a$4ki
126,704,836 *0CEEACD0EAF88A3DAF3A2C1BF5FAE8DE3C8AF794 a5.72
126,704,837 *0CE2633F0C530DFF7B697F4563B4745FCF68EACE bicouvar0
126,704,838 *0CE55181E0C0DFCE864FF2DAB2E91340782A7D1C A635611
126,704,839 *0CE38B5388DBAE7842582841E079A8B2C96D567C BIELT
126,704,840 *0CE852500A7A443F7A1C16BACC688A42AD7DA14C a=6h#
126,704,841 *0CEFBF3B3C806381D218C3D12BB2772EB48BB4F0 a&%91
126,704,842 *0CE7EBF45936F6F3B1E1DA67B3C30F0AFD1691D5 A9ZWN
126,704,843 *0CE9994DC78DB10F2C121FFD95D5FB5C610519ED AAA~
126,704,844 *0CE15BCFA1FDAEC52C95A2B11E1D500B43F0F2EC aaam,y
126,704,845 *0CEBA0F79D96651C4F49F6EFF085FC692333D806 bk-ku
126,704,846 *0CE60086D0470D187DE3D0F8CA2660574B63C5EA aabg1<
126,704,847 *0CE2D50DEBC8B3343B7CD245E694FEA271C16E28 BLAIRATHOLNSWHOUSE
126,704,848 *0CEDCD3FC1D0E6B40162B100A165D6B015A755DC blir
126,704,849 *0CEAE4241674FCAA8167203BD7F8FC815E4E7F58 blnqm
126,704,850 *0CE7C4417F0EE59238761D9CF36FB04BEA3DE69B aakwj
126,704,851 *0CE87A0C133FD7F980B7538176BD2E420831AD44 AATTAGCCAAGGGGACAGTCGACTCTGTCCTTTCTTCTTAATCCCTCTGGCTCAGGGTTT
126,704,852 *0CE6E7BF5535EDE3B5FD6471E77DF524817150F0 AA=Z2
126,704,853 *0CE94CB7669C66ED30E21085152880306ADD4B5E AAZ;C
126,704,854 *0CE7FDCFC1F242AEB0BDCD0AB90A5ADAA136D4D9 A(B3
126,704,855 *0CEBC466A5D73938DC6CDC1C645B5E4E6442D2C9 b=n48
126,704,856 *0CEB58B8EC6BE271D6CD2DC39540717994787143 ABBISOGNI3
126,704,857 *0CEADC73CA8158147285DCF101F88C2A50A955A7 ABCDEFWAREZ8
126,704,858 *0CE9E874B9F99047FF1621FB6122787910549EE7 ABDUL.BUMGARNER
126,704,859 *0CE3B935BB292145760B65394FF7DC06F1D25D21 abfv,
126,704,860 *0CE8256C1A7B8043F527DF0F5A0FDC42E3D1A285 BOC0
126,704,861 *0CEDBDD023F72F98C8C2DE21A9348E7277D305F9 bögtestet
126,704,862 *0CEF1A75AA61743E124C9AA89B2EA8DADB9FC644 [email protected]
126,704,863 *0CE21396CC5781B78C104DC6386900BD260DBC40 BOOHOES9
126,704,864 *0CE869A0F9E310BBD92EA3CCA0B1EC1E1D863E6F ac#"-
126,704,865 *0CEC1F3B7AAC9F7F90A1F2516DF56F996F590F0A AC%:
126,704,866 *0CEB73B8130FA16C0593F94B544B7F85DCB4D6BE ACIDQ
126,704,867 *0CE9D004876D2856392F1BCE0DD2E9442260AC20 b=====)-*:p
126,704,868 *0CE6D90D456DB16984160D6A272F6BD3055477E8 B----p.*.*(0-0)
126,704,869 *0CEF8AFF2FB10F3D382D0AAF39FC3064E73A07EB bpo:
126,704,870 *0CE2A0D095F90B98D369D92F50EE1E438F81EC3D BPVAH
126,704,871 *0CEFE39299AAA4D968E76862684B5DFC2AD37984 ad7uk
126,704,872 *0CEC6F765D7DDA6DC8A682771EAFBE4A57ACE1C2 ADAMSOKOLOWSKI
126,704,873 *0CE1BF93F15A613DA69AFCC342F33FBB468C24DE BQMCUTGS64
126,704,874 *0CED865DE90D1982B158E843C16713588750228C ADERIYE1
126,704,875 *0CE361E85F6E09B3DE5344F87AF16E67CDFD010F BQVK9
126,704,876 *0CE1ED52020C74C47A80B354B5CBF3C57E14FBE5 adj9
126,704,877 *0CECBF41EE06960F92A44FABFE417D989BEFA16E ADR
126,704,878 *0CEA1F7BC495F4B341DFE26D62AC8D684D6003AA bq(y
126,704,879 *0CEC2373031BB2AE599E20D9E36F875BCE000674 A;E
126,704,880 *0CE44245B90034D3004D8BAA35E4F1C432612F63 a"f=1
126,704,881 *0CEFB22586001BD48A51D3F3EBB09D724C41C339 BREDSLA8
126,704,882 *0CE66E0BB508979C9417617896A661F480E59994 BRENDA JANE MORRIS
126,704,883 *0CE91715804C0952917D955B4CEFD3D588028F7E agq4v
126,704,884 *0CE377FB3A27D4DAC15ECF13099CB5BCA833007A BRISTAS4
126,704,885 *0CE8A19E44F546D67B619CE4B86EC8D6917A4641 a:hpf
126,704,886 *0CED98F31F9AEBB0082D1B0F9820938984444E91 brittanynicolefisher
126,704,887 *0CE121E867E70C821A6FFDC04367A3F6A154005B BRITTTRIGG
126,704,888 *0CEFC8DD27D018D4A26DD4AE43C8FE7690973F4C brouetz7
126,704,889 *0CEF3D978BF47A11DA119AD9196BF5488893C40C AILIJANA2
126,704,890 *0CEA8B9F1CB5EFE924915F19998134B65C47CDA9 BRUGV
126,704,891 *0CE89417C6E197AE6826401BD1FF8B9F17ABC49A bryongottschall
126,704,892 *0CED5C5604017723A6683F66B13F13F217F3C3F3 BSPFL
126,704,893 *0CE2B4A6598D65D56433B58B86031AA18A543561 [email protected]
126,704,894 *0CE0125950D2EAD17DC1A47C4CD6DA78B68E6512 a?_l
126,704,895 *0CE737546003703B54FDD86B9B8A6DF631DA8AF1 al;08
126,704,896 *0CEFBC69BCFDEE5ACBE5D86E3E62A7CAEF6B5498 BTGDZ
126,704,897 *0CEF7053880CDE62B80BF335B8F048D1B83174DC ALAOTSIKKORIVI
126,704,898 *0CE249B93C6C8BDF57AA162BD8AA4BFE872276FA alavathi2
126,704,899 *0CED1AB742954A43E0885E0174149391413709B2 buckbierley
126,704,900 *0CEFE723E9CC0F7FF714EE78D4157D4A80BF1BB4 BUE,3
126,704,901 *0CEFDB5AD04313614DB7071C205E15106A27F499 ALFONSOCASUSE
126,704,902 *0CE5D0F0412DCE4F33B33CC12597BE75BA5B3976 buqnd
126,704,903 *0CEF092ECE90A1D73BD40D61FA6E9BBB860B02F2 BURLBUCCELLATO
126,704,904 *0CE0AD82347995EF3B4471A1E29A1C3B6F14D49C ALLANPRINZ
126,704,905 *0CEE1147B82A489AD2D0FB545C4BC7631BABF090 ALLANVILLAGRACIA
126,704,906 *0CE9FF1EFC66B91909D1F5B17D8DF8A4BC8ED7EC ALLAN.WILDIN
126,704,907 *0CE4F5FE3F81DF4EB5099559261BE877303E62A4 ALLG!
126,704,908 *0CEC4D65D6C89DAB2CDA2B6F244FBBC01379D038 BUZZHEART8
126,704,909 *0CE095613728AC3180EE5B24F7B1D76885C455F6 [email protected]
126,704,910 *0CE6AB583A99E1AE0777B723C2F7887C43F88049 ALONSOVOELLER
126,704,911 *0CE93E83E3CE7A239A132D3A2D71B212BC8AFD6B bvti
126,704,912 *0CE0C13D4C5F9896BF5ECFE4D232FBD5995FB8EF alphonsohetu
126,704,913 *0CE1A5CDF88DF5CD3C5398C1CF6438D3E443010D AL(RP
126,704,914 *0CE73575BCA1BD32F2E5C51AEFFFE179E3005DDE b!w:d
126,704,915 *0CE0D19E370F3C5A5DE4EB85485801BE00D7D615 B%W"E
126,704,916 *0CE170EDB91A75421586C557540ACABE4E8305C2 [email protected]
126,704,917 *0CE7BA91A6690775BA2CCDF263DC474808FC07B2 BWQEW
126,704,918 *0CE1C83A60D8F1F59EE34E57ED0E6086EB93E0DA bwuxc
126,704,919 *0CEFD38343A09A36C297C8BF00541292A6AC1577 b_w=v
126,704,920 *0CEC0B6D3ACE16DFCF08A121F23D1576A8B82EBF b(+y
126,704,921 *0CE97FD64184DBE32C8339913F00171A9253A6F5 BYLEIST
126,704,922 *0CE696BE139D6D24791B4B96CC7DCEFA2277C4E5 bzl)m
126,704,923 *0CED452A0E1F0F7B8216036CE8945E996FE34D13 BZ;N
126,704,924 *0CE5C64C0133DC0BC1A55DBF1FC44F1CC22F3F9E c:-)#
126,704,925 *0CE21FD0842F61E24439A7062DDA895CBE5EF643 america-is-better-than-abortion
126,704,926 *0CE6634326167BF11148A72E7C6E94BEF2B0DD63 AMEXX
126,704,927 *0CEC2B27821E36783A77368AA30CF34FF40320A6 Amgg
126,704,928 *0CEA3C927FD158A6C0100DEDBF9EE9CBF085B492 c1%li
126,704,929 *0CE9E8D1C0724A5D3F740969C798A22510B23227 C2rH
126,704,930 *0CEB3A169217717B78AB3FC192B39C5E86289758 c42f1c77812934b6855ccd2de75fffa7
126,704,931 *0CE8D119A85ED8716DC0879F645A94EB1CD56774 ANDREW JACOBUS
126,704,932 *0CE7FF7B230DFACBD34F04E92836A9A5CAA899A3 c6u2,
126,704,933 *0CECC292AE00FC82089E38C1456C3A10C0E6A8AA c8ge9
126,704,934 *0CEEE6BC32F6B85102D35F96CA98B8C7A6CA0921 ANIM$
126,704,935 *0CE3A9D2FCB2C1C538FA003D412D8AD26FE2717F CA-101(featA-ONE)
126,704,936 *0CE8531A009FF1BFDE77C3FE9F50C673A0DB473A [email protected]
126,704,937 *0CE7E142ACE8A5940BB49EFA741EF858E017DDE2 [email protected]
126,704,938 *0CE954D30B86D216AA4C3406193334843694C880 ANTICOAGULATE
126,704,939 *0CE6C844DCB92E77BA900631996EE92A5B1B2A41 antragszeitr
126,704,940 *0CED4A8882475994B416CE84AE1AFE03321653A4 CALLMEMYSTER(INSTRUMENTAL)
126,704,941 *0CE68D0225B165C086EC35F58A31AE48BC29B799 ANUTLEKSED
126,704,942 *0CEBC4D7B027E4855C6C89BE49BA0CBEFCB0C968 caminaballant
126,704,943 *0CE6312D3FB945DCA0BAFB1AA0EB342F6D7D7FF9 CANCEDSPIRIT
126,704,944 *0CED59E9066943DD546E95B4232AABFC529C9183 AOJT/
126,704,945 *0CEFCC7C7F59CB97A42D78FF795AC6B7197E75AB [email protected]
126,704,946 *0CEE4E055CA4B1FF3B809B852913DFCB6D2928BE $CAP0LIT3
126,704,947 *0CEE091B3D039550BB8B8DC2BC4372BB3830546E ap5jf
126,704,948 *0CE9896C1A96468031E5FE1AF4F5D2EF13238925 apakartum5
126,704,949 *0CECD61E1CD7A45B9BD6BD0B99345BE1E4C9E02D APCC
126,704,950 *0CEBA33D244CCEABF657C82BC9DCAAEB115AF57A aplagueoftics,part4
126,704,951 *0CEF769653C67F9EF320736D7F11C5F1E6C12CD5 APOLW
126,704,952 *0CE96757DF575A35679A6EA786D2A9624AD51A1D CARROL.FOUNDS
126,704,953 *0CE73CC046611259F03EF99A35451DFAFAE4E21D aq:ha
126,704,954 *0CE4753492070C56ED1EAB9EAE4AC973B6B031D8 AQL%L
126,704,955 *0CEE52AC876EE9C63998AA1E00D759D4F161B83E CARTERLINDNER
126,704,956 *0CE6823FD123EAFF3F8B36BE81AFC579569D286B archieduzan
126,704,957 *0CEC9BAEDF65862165A3BFBABCFB54E08918058A arielcastrogiovann
126,704,958 *0CE27E442E94D3C3885C8FE09ECC41105258BED6 armstrongcanadacom
126,704,959 *0CEB80853D2BA51141DA6EB6091E70A7EF36FF90 arnulfonones
126,704,960 *0CEE2032CB04280B6415353F2B5D6D6F0E038F05 ccdhe
126,704,961 *0CE6B9CADBDBEDA7EE7B0024A31B46D4B0D69056 ARTIFICIAL”
126,704,962 *0CEA9D0B34A8E977DB8D6DCAFC56EA6E0CD71F4E asclosetocold
126,704,963 *0CE03FDB00489D41FA4F927DC7B782E98B8721E3 asdgs
126,704,964 *0CEE603D66BE95D72437FE5FDE00DF6943E8ED4A CEDRIC.VIRGEL
126,704,965 *0CE17730451893C5593B16E45098783CCAC143D3 assalitu4
126,704,966 *0CE89FD651515DC082E6619B4527EF945782FD31 A,SSF
126,704,967 *0CEAE277B08B0AE857ECE66B1DE8E695FE6DAE11 centunculus2
126,704,968 *0CE56DAE915F0EA404CB9E56621B47359E41E203 C;ERG
126,704,969 *0CE93DBE5C05E3DC49483BF6E320399719751476 CFOURFINGERS
126,704,970 *0CED7D8E86A386E7F6C2D61F8C2EB9D217C702A4 c_/g&
126,704,971 *0CE7A19473EC8065BD9215C9F2350DA424723BCC cg5
126,704,972 *0CE3AE865791C68A124CCC7A11D1AB6915CCC20A CGG=E
126,704,973 *0CE7CE9D77B38DB7B07670525A853571FEA3DC42 c_gv-
126,704,974 *0CE491FE4C1073A501481DEC0B9B9A9111CECC07 AUGUSTUS.KAING
126,704,975 *0CE6028218E426497365727FC5134792D8F260A8 [email protected]
126,704,976 *0CEB0E72518EA422B7DA2987741EA1725C51760E Chapter-30-01:-The-Sacking-of-Severus-Snape
126,704,977 *0CE38B27050989900F175714CF57A018AC62FC6B CHARCUTERIESTURKISH
126,704,978 *0CE8F24D1850F82685C26EE7CA47FE867EC07BE6 CHARISSA
126,704,979 *0CEA55CFE8A577AE60F49DA3F08AA8AB03B7CB0B CHASBOUVIER
126,704,980 *0CE4D592DB9AF7A913D0F3657155FC652CDCC61D CHAUFFARDS?
126,704,981 *0CE451039EC7C94E71DFC28200D1B416E86B159D chaviyo
126,704,982 *0CE6D1EFE5EAB180ED845367DAB214B5152B2114 [email protected]
126,704,983 *0CE94AEBE7CFC73D32E562C87182FE44C297C154 [email protected]
126,704,984 *0CEE67BD3DB3E790B2FED8DA92F86B229FCA4892 [email protected]
126,704,985 *0CE4E5DFF3FE6169AB02369BC59CA96BF1EA3498 Avundsjuk-(instrumental)
126,704,986 *0CEE6DAC2E4BA9A5BF153D32098CC810C98C359C chj?y
126,704,987 *0CED5DA477CAED747FA3F0DFAB95348949BA119B awg&?
126,704,988 *0CED6836A8700491791E411712859694F1920996 christianantonson
126,704,989 *0CE61FB22328153129012AD062E85C726AF82F7F CHRISTIANARMOR
126,704,990 *0CEEAFB0A6248942F8176EFCAB516478974C72AE CHRISTINA.KELLY
126,704,991 *0CE7350B9FB42DE46CB1BDB9934A88133D828E54 [email protected]
126,704,992 *0CE1CEDF87A75277C48EFE1C5FBD8FE856C5BA37 CHRISTOPHERAZUSANO
126,704,993 *0CEEDD7FF477B606CD1D13E5689AD70021473F5A cia+/
126,704,994 *0CE719987BCAEFA82163756477741F1C939FC1B2 cidoirepped
126,704,995 *0CECDC96AC5906D90F7165A0E3975913EFC0939A cilz
126,704,996 *0CE58C1E2E14CBB439DB2C836B22020F9F006793 c$i.s
126,704,997 *0CE4B73D6E593997B56863B60043CB9C665469AC ciw+
126,704,998 *0CE82B08D34CE015AD0D306107124006985AE3C9 B1:TV
126,704,999 *0CE4CBB7B298E667632D5286FA69207F47132C0C CKFRD
126,705,000 *0CE942057F06C04AD1FDD8DD938F7866F371B761 CKU/
126,705,001 *0CE8620265F02A629FB8D83C8AC45AEFF943B686 b3pa
126,705,002 *0CE3BEDA4ADADF67F7B838F2CCAF97CF247B4044 b4"e
126,705,003 *0CE26374DC38C80AD82416E9A2DE98B9834747C3 [email protected]
126,705,004 *0CEBA505B3F5D2385901B190541C50CBEED4AA15 B4,V4
126,705,005 *0CE17D2FF4F428DF1CF7565B547CF761DB1C6D3F B?4W$
126,705,006 *0CE19D721106E4C91E461614301697653F434986 B5WW%
126,705,007 *0CE4B7A08071F89E5AE99040B46E94762CEA4C0C b6&o.
126,705,008 *0CE694B3102A677C07C5C514375B7CD6B3097B9B b7?f7
126,705,009 *0CE2F723D088867A8ECFD9E16389F0AA05FFA46A clifftufnell
126,705,010 *0CEC9E2F9A6C96BC69523D10A8FF63811B4EBF9F closer-than-a-whisper
126,705,011 *0CE14D353BB3C2452AFB3D723E3C7BF0B11BA878 c(n0a
126,705,012 *0CEDF2D351763491192CE8EE72A7E3030858CA47 ba$"i
126,705,013 *0CEB93D5A79335F4ED75B21DC4507F9975E52974 cnb-%
126,705,014 *0CEC51B68F2B7CA78AC19E6FA665B7354ED1D820 COAMPANYING
126,705,015 *0CE84A6E674B18E31341E3CEFC842D16FC65369D B;AQP
126,705,016 *0CE2036E330C5E3A1E5581321B448AE5FE00BE55 CODYWADLE
126,705,017 *0CE0BE9FA946DDA6AB3B0BC72DE89C372E416CFC coiw6
126,705,018 *0CE87775ED73998510C35550148C973077FC0B2C cok/
126,705,019 *0CE34ACF022495D6F2068E8BF1FB3AF50B4616B2 barsheid6
126,705,020 *0CE316FBC5CA442E31FD3180285086C03C181808 COLINANABLE
126,705,021 *0CEE335CDD22A493665E03E7FB2D2074D9AC98A9 COLLAGESDESKTOP™
126,705,022 *0CEAC407407D607631B54C9766EA2C29A4FCB375 COLLAVERO123
126,705,023 *0CE736E147E6AF7A955791DE960876699B6FB555 BASEMANN7
126,705,024 *0CE911458CE515F5F82149475FFB2899FC3900E4 BASHANAHABA'A
126,705,025 *0CE157624C53CBFE3AD53D9D9CB25CA4A943A65A BASHIRU AMINU
126,705,026 *0CE7E70B65041E0B53941E624D6BBD87D5A52613 Complete.Ass.(disc.2)
126,705,027 *0CE93253FF8DC2B8EB460362416A28D9F8CD2EE3 [email protected]@7!vely
126,705,028 *0CE041596B2CCC5B61574E61692651912218FD9F [email protected]!B1ENESS
126,705,029 *0CE50CDCAEA6A942B2F9E3CF41BB6ACCA1412ABC bassiril1
126,705,030 *0CED54CF8A031C1E3A7DCE8A31E046A14AC500EC CÔNG CUA
126,705,031 *0CE215E74ECFF464A252AA99EF4059190704AB3A BBC26032010
126,705,032 *0CE366C167F094D5BC183E9018C3C18BED2565D8 B%BTG
126,705,033 *0CE4B194F30AEF40DB2B2625B802EDABD9ACAA99 cowboy』、
126,705,034 *0CE1C51B9305859E358E53B10DAB4B9294105816 [email protected]
126,705,035 *0CEF8BC2BFAE4F892C2F609A5E75DBB203A07A27 COWWU
126,705,036 *0CEF5ED57550EB9EA5B760776E8E805DDEAB870B bdo20
126,705,037 *0CE94F63CB4F5C781FF0E8FAA746BEFE861A4414 BDQRI
126,705,038 *0CE0B674F5758DA63D13CFDEA2410D380FAC1448 C=p5
126,705,039 *0CE6D835282604468A3461B2488484A9740EB538 [email protected]
126,705,040 *0CECC80D5C89DAB30EC696E85423E2556A879848 BEATSRHYMESLIFERETROSPECTIVE
126,705,041 *0CE06943BA7BB2EC8E0F07CDED7B8C2A3B5106A3 [email protected]
126,705,042 *0CE10B97BB010D6AE95755ABD2EA1086F427C525 CP?/O
126,705,043 *0CE4BE5EED126034C50F873C2BFB3B8B9FDBB1B5 c:\program.files\common.files\adobe\installers\faf656ef605427ee2f42989c3ad31b8\extensions\devicecentral2lp-da_dk-180309170933
126,705,044 *0CE3757FC910AA3543F1EB8107DDB5FDD3311ED5 C:\PROGRAM FILES\COMMON FILES\ADOBE\XMP\CUSTOM FILE INFO PANELS\2.0\PANELS\MOBILE
126,705,045 *0CEE47F5881059211986956B26D9C4F1FC50E4E6 benjaminemlay
126,705,046 *0CE2D978FA382131736C8E31FA81092C5B2245B0 CRAIGWILLOW
126,705,047 *0CE79943C896C9F1E63E2D17A7D03B39B869B3FE CrashCrew
126,705,048 *0CE792E89421E65631092099EF914F3569F56FEE bernardtowse
126,705,049 *0CE3D5E5169B79658837C6013C039CCAA8E29467 cra(y
126,705,050 *0CE3DA38E34D9A824079F6B3F07F2D58738CAC7A crb$
126,705,051 *0CEBAEEC78AC1D8FAEE17DBFDFECECEA472B023A BERRA'S
126,705,052 *0CE2D98FAE9EE418D35588EB6C881219A73B27CC CRDECTM0
126,705,053 *0CE4C3B5A39363AA0A0ADD01D8C45A27FD18E154 bertmandujano
126,705,054 *0CE179FDF6D44479FC65107D009972CFBDCE31FB BERTRAMSTUEMKE
126,705,055 *0CE31EAC2A095DEBF85B66207FF536966D5CD6B3 CRESPJOHN
126,705,056 *0CE4E9425111D8BD5469D62093FAE3146BBE2840 BESNO
126,705,057 *0CEAAD47B60D045DE509F1FF1C69EEFB59E4D45B B$ESU
126,705,058 *0CEE171C0DBC3DA4F1BB982BEFE2ADB726C16402 B.#FG
126,705,059 *0CE79F593C70E85C42121947C5117C40D79BA449 bfh9r
126,705,060 *0CE014E8DE38EE1989757A58EE7C5FA44987F870 BGCLM
126,705,061 *0CEF99B56FE922178314B88C05AC01AB6B2F405F bg&i8
126,705,062 *0CE6C6EFA99B96FAB5F032EDE484EF3DCA695C28 c:t9
126,705,063 *0CE1EF3B85099FA6DC7A92FAEE5EDEB9C3D229B4 BH=M;
126,705,064 *0CE66209D44CF3088730CF316A836F204EAE768D B+ID
126,705,065 *0CEA04F75D2233D4B7356A190D66C667D33D7850 cv0k
126,705,066 *0CEFA8C084B9CA966904E6609726FE1266FEA5FF biwlh
126,705,067 *0CE121DB0D2366A7891182A377688DDD33008A95 cvdu%
126,705,068 *0CE2E9EF912ED2AE7BD9EE1EA40A1DAA938EBFE3 cvl(i
126,705,069 *0CE933493ED83670ECE5CA5F5422592CD7A8B4CE cwbf=
126,705,070 *0CEE26289F8C645EF8B9EC076392B087F86CB050 cw&gr
126,705,071 *0CEEF0F048F6D8D0FFF77EA88648B25FF44E515E bk_x:
126,705,072 *0CE5D661C8DB737B6A6E01B9D25234CE3DDC47D2 bl5ow
126,705,073 *0CED6107D63217E6F859F0B45FAA14F24ED044F2 blainewallace
126,705,074 *0CE41D2B0F091A42ED4654848C81DABD2971EEF9 cye_m
126,705,075 *0CE3CC97EBBF34F6A0008C6D061672F0151C2DC4 blir
126,705,076 *0CEAE4241674FCAA8167203BD7F8FC815E4E7F58 blowfishelliot
126,705,077 *0CE821748D158334CDA512A68681B5BB9BB8FBC7 blylm
126,705,078 *0CEDBB97B9E0B2837A5458FCB5AB3D1202C438F6 B)M!B
126,705,079 *0CECC4D7E38369BC0AE0A58039F2BF3C4E113D5D BMCUV
126,705,080 *0CE4FF11E209D9486113986BE8014D688AFC62F7 []D~
126,705,081 *0CE153E490E66AC19A7C430EB95E883851106D9B D003253
126,705,082 *0CE0F07B0553A09A895919CA9DF721DBEBC466E3 [email protected]
126,705,083 *0CEDA3383E9AEBBC1A443C100C327F796DF89230 d0ud=
126,705,084 *0CE52CE70F0F7C026F6BEDC2C83034FB4006278C d1+#9
126,705,085 *0CED85F024B7F8FCBC337406EE4E59EC6693EDFA BNVAU
126,705,086 *0CEC9DFDBA85FAC4E5C1FC666511EEBD178B51E0 d#2m&
126,705,087 *0CE4B5308D91CD9A1F45D89829434387E7929901 bobouwens
126,705,088 *0CE19810740A7E0A85D815FD59A8AB44C40FA82A BOBYASSEE
126,705,089 *0CE9E6E346F75106A3DAD59B18C93B16E1191324 BODYISTS4
126,705,090 *0CE29ECCFCAADE058C8A41D1A5312265713C53AB BOIJES
126,705,091 *0CED16E7A18F35743B83DAA23A5D522904BD0873 d3#,p
126,705,092 *0CE0B76EE3BEA88F2EDB5C32B217551C6B80DB13 d4#w(
126,705,093 *0CEB0BD69EA4B097AFB940FD9E7FFAD226765A07 d6_s
126,705,094 *0CEE5B09A5D1C7BEA113DB4A10E4477655A71E8E B$OVK
126,705,095 *0CE3382AB96A5F65B82E68DE1401754CDF2CD960 B===p~0.~o.;)
126,705,096 *0CEE1356C555A9B4317E8C96DB2A5C0C04926B1A b#p.~o.~o(~_^)
126,705,097 *0CEF489B39CBF19BD4783F3989ACD0050CEA9246 bppto
126,705,098 *0CE2B64C97808B9516AB335669699AC4B895CE6A bqbw
126,705,099 *0CE6B061807B7173324DB9FE6F6416EDF9E8AED5 BQRBIXING
126,705,100 *0CE090F90069D9ED1B8C223A290A6B35C019DBDB Br(A
126,705,101 *0CE64455BEB4FEB090E7900970E68D817E5C236E DAMION.DORSINVILLE
126,705,102 *0CE929612F9ED7AD5539EC497377FB2FA2B2E9B2 danandreadis
126,705,103 *0CE0CB9A206162A75090221DA533F260928E4E9A DANMINE5
126,705,104 *0CE67FEEACF83BCA72077BE39BC700A78DCA76F8 BRANDONPICHARDO
126,705,105 *0CEB6593DA165E0F968FB5F45552CB8CFCDA2AC7 dantecomings
126,705,106 *0CE0894FE3D94F9EA779A9C94E0E3C8341406045 bregejil
126,705,107 *0CE7A46B91B401C49D363279051A46810A7AB4B3 danvallot
126,705,108 *0CEC74484BE818AD72115957A512080D78F3DB05 BRENTANO!
126,705,109 *0CED2E1A0F566D5C708F58E911B0DDC5C58328DA BRFFJ
126,705,110 *0CED40FBF6AA70B8D37E379A708CBC4B0D832981 DARREL.DONICA
126,705,111 *0CEC1CABB6A2390A8ABEF6103FBDFDF99B1153B8 darsarab
126,705,112 *0CE9D53A5FFA8BAD87143EEB24A863F95E47C4C0 brittbruington
126,705,113 *0CEDB5939B8EA8DE0BE6AC08F9368E361854C802 BROCCHESED
126,705,114 *0CE7670692FFC6848290AA222A4065BDDBA3DE59 DAVISPAPPENHEIM
126,705,115 *0CE200A72F171F402688BD48D3E53F77F54C7028 da&w#
126,705,116 *0CED03DDF3D7B242E50E5CDECD140BCC6CD4FCBE Bs5)
126,705,117 *0CE86A59503032104751C9ACB7760CC527721C46 BSNOUSKI
126,705,118 *0CEF7289187EFB2AB798FB8C0FA974BED0484776 B_?SS
126,705,119 *0CE777948F39886D565401895D96BAA8DB52B878 dcdxv
126,705,120 *0CEEBDE55A01A4A16972238D9432ABFCD55C35FE dcr!u
126,705,121 *0CE7F6294514C86036316C9927E38BA08AB35E5A [email protected]
126,705,122 *0CE8B32B375211B709DFFE17B0D14A55E379F44E [email protected]
126,705,123 *0CEF2C8ABFA3F5D2FE8E8FD2374BD3515DAC0F54 bt_5p
126,705,124 *0CEDB10CB4452C783F2504B0A4561227E0097242 DC_Z5
126,705,125 *0CE6A15A84541AD0A7A982723808250037C140A6 bteth
126,705,126 *0CE223E4D5860D2189EA4F9DA763386EA48506F8 BTFG/
126,705,127 *0CE8BC748C3F8B4AC85686FEE75A7CE0C1E22E9C b#t+q
126,705,128 *0CEC915C698BDD1682E87A1962F3F02EE7B29199 DE/4
126,705,129 *0CE0EE39EBFDE03C13435EDBE89A68E165056116 buhin
126,705,130 *0CE48886B4DDB13533C0E52D4FD9D39A6325CCF4 DEINZA
126,705,131 *0CE8E5E7672018C02022EBFF5277D331FF2DEB00 BURLBALLINGER
126,705,132 *0CE633E328560498C64321D906AA4ACB0C12EBED butjw
126,705,133 *0CE29FC8E4B1F1B34FEF6624622547B904C605BF BUTQ(
126,705,134 *0CE5B1ADD63F25657B461278B652BF2B47B20754 BV8SQ
126,705,135 *0CE627C4C087FC37A1DEBFA2E0934F3F519B5FDA bvti
126,705,136 *0CE0C13D4C5F9896BF5ECFE4D232FBD5995FB8EF DEMARCUSBOOKWALTER
126,705,137 *0CEF5BE8E1611CFD746DE639FFC0DD8886F9C578 bw%/r
126,705,138 *0CE91D9666E42174DD4ECDE894D85B2985EC09E0 B--)`-)X(
126,705,139 *0CED7A7E4946EE4BE2111406A43CBB50A2FBC638 [email protected]
126,705,140 *0CE868E79613ACB13AA1562B223FA8299985FB40 bys#h
126,705,141 *0CE78D1C03631FA058650A789FA289344D8F5010 [email protected]
126,705,142 *0CE72A6200286B9D86C1FDFC3C23F8833DEE7529 b%+zh
126,705,143 *0CE04093315B02511DAD730D8EDF84D3EF1416F7 BZRG1
126,705,144 *0CEB25DACECC2D4CBF77DAEB3527BF5DF3D16A61 c=)#:
126,705,145 *0CEC07415BE233062DD9FAA52B788B769854B523 DENKMALSWIEDERGABE
126,705,146 *0CE5B7C9E55FAF4980772BA1090C70348087F1A7 denndulebstnureinmal
126,705,147 *0CEA5CC95DDDAB65EF1C512BC08E7DC08B5B3D88 denodes
126,705,148 *0CE976BDAFA5AAC3443AF19A75485AAF3675D9F2 [email protected]
126,705,149 *0CEC76B77E915FB4FF890B2892A80A9ECB33DBD8 c0v)
126,705,150 *0CE066DC2B4D26B5A26DA8FF88711BDD9B58AB8A derawud
126,705,151 *0CEE4798996826BB2723E0A71FCFF431010313F6 DERIMEB3
126,705,152 *0CE225B997FC0942D11CC9DA3D5467105BE508CE c1fc!
126,705,153 *0CE2A63912195D73F591D39FC7AE6E6E1767A362 designum
126,705,154 *0CE3A07E1715CF7FF1E53F63FD2C53E6C4CCEDE3 DESNATURALIZACIONBIOQUIMICA
126,705,155 *0CE9015008FEB2CB8EAC7C74CD954D1DDF5AFA8B DETHHEADS
126,705,156 *0CED3FA4A5B64FA5F23A53D360B2EEB880887301 DEUP0
126,705,157 *0CEDBDCFA909337FA2423A14D5D4E0E22AE1311A C4UVI
126,705,158 *0CE599A40FAE6303D3B380E26472A5EB365226DB dewaynehershkop
126,705,159 *0CE14226A7A264D1FB9E0B83D30BB2D25BBEB319 DEWAYNE.RESSEL
126,705,160 *0CEB55D9D509BA24C80489D3EAE37DA425E7DD4F D/F72
126,705,161 *0CE6267ED9C8C63BBAD8BC2E2DB2FE5D52CAB531 df+a
126,705,162 *0CEC07EE0410098587633CC664CCF304EC0F13E4 C6DBG
126,705,163 *0CE32360CA74E1919874F7D2C47663C0D3B5D195 dfus
126,705,164 *0CE849935E22D0FAE3181C127D19967128A402C1 c8umq
126,705,165 *0CE8223FAFBFFAD27B1AB20A0CC6DED392F88EEE d:gk
126,705,166 *0CE3FFB37EF587A7AADB54311983F3132B52C25B dgk=
126,705,167 *0CED23910BC0766A9AFF99DF5E95C71D466F7852 CA1ZAVAM0
126,705,168 *0CE2F3487AE75F60FBE0E335CC6991BEF0D6983E DH;AW
126,705,169 *0CEE34A32B318FF71C7EE235B7263E93D58363B7 [email protected]
126,705,170 *0CEE93495D759D4A590EEB57EC29CE41C2729070 dhf,q
126,705,171 *0CE39C581546DC6C12706ED27E92F2D8C6D1BD47 d_hg3
126,705,172 *0CE8CE0C570CFBE379D71324D571799946533C55 CALVINMACMULLAN
126,705,173 *0CECBE04716036DB326BF75DA87302F8866AFDD6 CAMELLIKE
126,705,174 *0CEE297C0BBED9A29E13A7CC62B301C19B6664BE DICK.GRITTON
126,705,175 *0CE343CDBF7CB1541505BFDB576831EB1E8A1703 DIEGOCIRILLO
126,705,176 *0CE62458F7AA53CD046FF6204BB7CB2B5DC4DCB8 DIEGOOTTMAN
126,705,177 *0CEB36F19D46B526D5666AEF10097ABA093D1A12 DIFETTAI7
126,705,178 *0CE2433A01D32CA0334ECEB38677A2DF78F4889F [email protected]
126,705,179 *0CE44EEA2D292C556C3C39E8D7691E55A700B9A3 CARNAVAL-DEL-BRASIL
126,705,180 *0CEFFC4FB75683D25571944C294DC57ADAF4A09C CARRYINGTHROUGH
126,705,181 *0CE38B01274E2981A8317BEAF7D3338EB5ECFEC0 CARYE
126,705,182 *0CEC67C9073B1D8115435EF4C050238EBE44E45A CAUSEFORALARMTHECARTHINGCOMCAUSEFORALARM
126,705,183 *0CE8D3C85BE282CA8F8CB0151D59858283DE0368 cbd?)
126,705,184 *0CEEA947DB17256D0E544B1FEC4DB96E06554A83 d&kb=
126,705,185 *0CEB68D034E1490D1A54EB045ED1DEE917487ECF c!c5
126,705,186 *0CE12F94094B944F7A3628AF2AE41128C3FB7356 ccd3b
126,705,187 *0CEDD3D3EE07019683DE30EDAE8F201233FD9D2E Dl(A
126,705,188 *0CEE405DCFA8A1FF31BCBA13299C4E2010B741D8 CCZG
126,705,189 *0CEFB6AA81125807297CE9C2913312C97CE098B3 d/ltz
126,705,190 *0CEB113B486632D44CE6E63DB182AFBBF754BD7F CD-9
126,705,191 *0CE6F3C97C4156C64251D261B72889CE0F9B2EDC c)d"e
126,705,192 *0CE003DD16150CAE51FECC3FEAADF319C4853427 cdur6
126,705,193 *0CE79C1622EF385374762A28E4C974E08BC16C82 cedrickschap
126,705,194 *0CE068FF681090A2E573A053A5C00EF293C46727 dnur5
126,705,195 *0CEB4D7F8305F281934A0F988C680D61A0881E44 d#oag
126,705,196 *0CE0896CD473956C10B12AB38D9E45D15A1914DD DOCTOR4L3XV
126,705,197 *0CE1C09106C32526955E9ABFD197CBAA3F476C25 dok41
126,705,198 *0CE5BF417117584FB917C9431EA12060B3429851 c=e=v
126,705,199 *0CE23CE5F5748845147E34A22815900E934533A6 CEW8G
126,705,200 *0CE930793B50BB228F67D1C64CCB8B5140A5152E cf7,2
126,705,201 *0CE0B9832C85D171BFDDDB839249B4972812943F DONALD.NEWBERY
126,705,202 *0CEAF14D4E2B65020417257DBF4274CE1CA47702 cfh.
126,705,203 *0CE8CFDCE8A2DB40DA6EE730B76A129B694616D1 CFHL2
126,705,204 *0CE9CF582E7B7981A906FA52DF0150CEC19EDD67 DONNA BALTZ
126,705,205 *0CE7829F8A55B29408E16A9B81C2147553A9C064 DONNIE.BUETTI
126,705,206 *0CECB16E616F026341EBCE8E3A318033EB909759 DONNIEDELLA
126,705,207 *0CEB1CE4B739D16E9AEF8F6597D7B0E3BCD6122A DONNYOBRYAN
126,705,208 *0CE48B202C1AD6B7D16F0FAAE8E039CE23A172BC cg5
126,705,209 *0CE3AE865791C68A124CCC7A11D1AB6915CCC20A CGX!#
126,705,210 *0CE15E33D5C45C335D5BB60D0817DF62417F2467 dos=h
126,705,211 *0CE7BBB9A8FC4D33007BF3E32A546478E2443E3F CHANCEBAWNER
126,705,212 *0CEB1458589CB7D2889479512C0BDC683A2580FF [email protected]
126,705,213 *0CEEC1D515FCA240C3A1316A7E539FB73BA39E7E D%P#D
126,705,214 *0CE7C6D5339D27682FDBC5928ADA152ABBEC3E17 DP)H
126,705,215 *0CE21BBEE37DAFEE2ADBE245F15F7290E51590FF chdg$
126,705,216 *0CE58ADCC2A04A801D197E0C6F69477BAE79E179 CHECKEMALLCONR
126,705,217 *0CE7339D75747D0F024F63F39C380946D9FCD769 CHEERGHS
126,705,218 *0CE89EC7A29C03973D9BD379039BFA1B49B21599 (>-<)*d##q
126,705,219 *0CE7EE24E8C960688537C5973F7EF0578BC6AE2E [email protected]
126,705,220 *0CE618B485863AB861DD1DB6048C2E2AFEB294C0 [email protected]
126,705,221 *0CE3622636AC0706D6BFFD5D5B5E4357A9E32851 „CHIRURGUS
126,705,222 *0CE4BA4155FDCB49090DFDF7886604938FCC32B9 [email protected]
126,705,223 *0CE8557D36566824F803291F556569D7C79F6612 dr4sq
126,705,224 *0CE154E9A535792DAD10F746DA2A0E6993A749CD chongchat3
126,705,225 *0CEE6B91C2336932D13C3DFB99118A11DD22E231 chrpq
126,705,226 *0CE414735318163ED78A21FA1CE1F89F8CC4EA39 d,;rp
126,705,227 *0CE79631F2AA46059606BF6FA88939B3382A0031 d!#rq
126,705,228 *0CE77AD0B6BEA7B1A879EBFF8E3E2F04069D8A37 dsgq
126,705,229 *0CE0B6B004CCE2FF27AD98151B391C3006AA6AD3 DSI1S
126,705,230 *0CE78E95B59741993D5514BA43BCDCD8067D1842 [email protected]
126,705,231 *0CEFAA6BBE109C905064A437F67032825BE19FAA DS,NV
126,705,232 *0CEA1BF0EABC39EFA0DA80DF07E3B3746D531CF7 cilz
126,705,233 *0CE58C1E2E14CBB439DB2C836B22020F9F006793 CJB7:
126,705,234 *0CE48CC841B5F20AEF4F6D743697E251A08DE921 CKAGERER
126,705,235 *0CE0C77F3EA41C5494039DB876A7CA3DEABCD374 c)k.f
126,705,236 *0CEDC8BD758066CD8177AB1813954DF502DFDD6B dukosnak
126,705,237 *0CEADCE8A205182BBBAFC5F15EA406E00DE4EF70 DUO FOR 2 BASS VIOLS: SUITE NO. 3 IN C MINOR: I. FANTASY
126,705,238 *0CEEEFC7C141EDC73349741604B4BD2685060EEF D;UOJ
126,705,239 *0CE7795D1472723DA2C419DA043ECFED83F2C592 DUSTIN.PALMIOS
126,705,240 *0CE9C8F0D1C280719F51FE2526234D5255759787 dutilbsw5
126,705,241 *0CE02E6FF31E1535FCFF55BFA677DF631C29FA09 DVI7J
126,705,242 *0CE4D93611E8C0F79F4BDFE48A35DA396D760CB8 CLBGV
126,705,243 *0CE4D90D3BF2450FCCF5FB855097BD599A2214B7 cldk4
126,705,244 *0CE0433D15B0F5355BC4FA82168AAE497707041B CLEMENT.OLSBY
126,705,245 *0CE682085060871A3BB7D92A366C5A6C4D2EF624 [email protected]
126,705,246 *0CE66B112D4A3C1F3891A0A670B317CBF6208CFC cletuspfundt
126,705,247 *0CE6392C427146D055AC0F6F163E9F00939C707C CLEVELAND.SENERCHIA
126,705,248 *0CED85BF111186B7FFA2D3802DAC97DD0E0DCCA8 C+LFO
126,705,249 *0CEEDE26A85BFAC70EDEA2AB4AECD722EEA1C093 dwham
126,705,250 *0CE828C168F3F68BCDBCB11A9957A6BE78A2A872 CLIFTON.REYNE
126,705,251 *0CE0F3731ECA56FB3A44C0226EC7D012A50F1419 dwo=l
126,705,252 *0CE2902FC977D6528E2CC1AA788F13805B2B6E5D DX:T
126,705,253 *0CE9754FC32E3B4146E67E1F28C9507E733A20BC CM!MO
126,705,254 *0CE618669FB87E95E2EA97FABD3CB2281D7CB5B3 cnoz=
126,705,255 *0CE74569A4A18DE3B50BBFBD9F7871A4F2694AE2 EARNEST.KLIEBERT
126,705,256 *0CE47DBE5DD3422D5C20A0708A1674128C091DE7 earr
126,705,257 *0CE10A2467807E895E75C47323264639FDB6045F c/o^
126,705,258 *0CEFD32F6E30830E0BFDEF0B392DB176FBBB65D7 [email protected]
126,705,259 *0CECA37993D0ED2782E3D18D34D3F27FE831DE2E COHEADSES0
126,705,260 *0CE014FBC2E961C1AF8F055FAAEA1EC1368D070C cok/
126,705,261 *0CE34ACF022495D6F2068E8BF1FB3AF50B4616B2 ecye
126,705,262 *0CE58A0682E577F82873A248E91A0BE75A8356A2 COLTONKUSNER
126,705,263 *0CE975A927537D6B7FC3873752262AE996BE4BBD edi9u
126,705,264 *0CEDEABA67FF4A41BEB5EA82D58D460D2373EE44 COMMISSIONNEMENTS6
126,705,265 *0CEDB8FA4EC917983F415E2C4F7E84E511B37914 EDUCTION
126,705,266 *0CEBA350889C9040770BC6C7FB6EE366B17219FB EDWBT
126,705,267 *0CE75F0C4F1CE3F365A37AB73EB4D0D87D8EBF89 EENREDENS
126,705,268 *0CEDD60F64FC2722B764CCB2ACBDCE5E54B50648 CONUMEDING
126,705,269 *0CEAED75045F634C86AFBF83DE666CBC95841D20 eg5_h
126,705,270 *0CE80AC5208BE0A051F30E9774C73F03CC305F0D EGAA
126,705,271 *0CEBABCCF4856CFF668AC118974CE2E59C90BBF6 egahcoli7
126,705,272 *0CEE65C747636E4F36572D14986D590EDA38B745 corynealer
126,705,273 *0CE94DD3A699B1B4CD149089C9901E9DB478769E CORYNN MILLER
126,705,274 *0CE08F6B48B00B3AC8318744E0EC4575ED7EAD14 COVWV
126,705,275 *0CED87AB6EE2A9B3D8B60840B0B808AE730BE1DA COWBOY-PROFIL
126,705,276 *0CEDA7BD69ACA26F24F553BAA65B6B6F6911D99D EINZUSETZEN8
126,705,277 *0CE3BF41E7C2E3502C68C39590C6B0D8BE82D1C0 COWWU
126,705,278 *0CEF5ED57550EB9EA5B760776E8E805DDEAB870B ejtnreta4
126,705,279 *0CE63D5068B76B4ADF224269BF4DBD9F86FB692E ekortsgn7
126,705,280 *0CE41EE76CC95EEE445EB3CD789D3510272EF334 CPOJ9
126,705,281 *0CE8C0A2BEE4B47961AFB1F19CF2DE5B7A3DBE7E c:\programfiles\adobe\adobedevicecentralcs4\lmresources\fi_fi
126,705,282 *0CE9A1E8B8C297A7902EF3C2733AC64316AA8218 elamita1
126,705,283 *0CEFE1D2806FB1F8A3B8D0318C8152C1A19BF832 c:\programfiles\microsoftvisualstudio9.0\vc\vcwizards\appwiz\mfc\control\html
126,705,284 *0CED4BFA4229A5A383B510E1B5EEE0D21B084D60 eldrich
126,705,285 *0CEDD164BE62777AFF3FF2367DA6A760347321BD }>ELIFORPWENSETAERC<NRUTER{)))1$(ETATS.KHC_DLF
126,705,286 *0CEC2F7010F93B4CE118AB6492263573562A3136 C:QL
126,705,287 *0CEE4BB0304D0F9BF9C7823B1659B4400F6FC33A elkc4
126,705,288 *0CE3BCCB28B3F5136E56A830D663EAF231A5377D CREACIONESKETAMINO
126,705,289 *0CE76DB93D638EE3586531B7C5C600C2394FC65E crhk:
126,705,290 *0CE3BA590891578D8731C4AA9ED79F73FCCD39A8 ELVESINGGED
126,705,291 *0CE6152CCAC611F21796D6546645FF0065016258 elwoodfernow
126,705,292 *0CEDB4B2736E91A70EF25E89BD7B7737A4C72059 CROWWELCOME
126,705,293 *0CEABC1288B6D5BFEC7F63BD1A195D523A6F7424 EMBOURGEOISEES0
126,705,294 *0CE2E604E772BFD8416E9160C8835D3655D911CD C(RVR
126,705,295 *0CE647BD78B4BE1DEA6CCED13AF2DCB90941A050 EMIL.CLINTON
126,705,296 *0CEAB20E34DB186832AE55DDDD8F1C1F831C9E1A CS9KZ
126,705,297 *0CEA835816F76E96F699F52A8389461533254DBE [email protected]
126,705,298 *0CE72178289AB8F7A79D0BB257E4EA16DF447178 c)s:g
126,705,299 *0CE4BB1E69B219DDB69F2528FF4C2EA548DB6CAF EMMYEMMY666
126,705,300 *0CE3C5A923B6F98F55BEBB33B754DB50793ACDA2 CSWRG
126,705,301 *0CE0361A16551B7BF439759A92752C32A578B388 c/(th
126,705,302 *0CE6DD2C3D7C94F2D1D4CCEE5CDF68CF3348B53F C(TK%
126,705,303 *0CE9F859DAA5B39A7FE886A2E2BB5CF2406B31C1 CTLC0
126,705,304 *0CEB8D8AE47426F2DCE23632AD3E17283D9FC2B9 endlessed
126,705,305 *0CEE0DC643CF1B38952F19D2FAA91903F9E3EA5B ENDRÉT
126,705,306 *0CE17DD76809CF2DC1A994178C57F6484E361018 CT&TW
126,705,307 *0CEA98A7225348ADD7B9FA64B061FC9FDBDC69BC enil
126,705,308 *0CED42C0D0D17A71B57342689ADCF998ACBD98B9 C$UF
126,705,309 *0CEFB790CB294BF866D84FCCD8971C2D4CC2F05B CuFl
126,705,310 *0CE5E6D36C2C470DB25D33974AD415D9A3E9D4C2 EO)BI
126,705,311 *0CED56105CA01AFBA1F3CE28A73421CBA240B889 CURT.MAILLE
126,705,312 *0CE8B7D6296F19623723C0C368C25FEBB768694E EO;IG
126,705,313 *0CE885100F6821F690B34C05B37F07215C7B4967 cuzuj
126,705,314 *0CEC3A8CCA1F821BC91010AA01E7386C1A245FB9 cvkc
126,705,315 *0CEB93DC6CE2A7F34E7C8210431D111D09037514 CVN"K
126,705,316 *0CE710D71F829EEEF064AEFE669A36E4A54F42AD cvt".
126,705,317 *0CE2CDB583F007E765D0328CD93758CBE5EA9563 cw+!%
126,705,318 *0CE86357D5895B9355F472C647E6D57D54D2722B CW=27
126,705,319 *0CE447B04919FBE60EA084523C409E0F3886770A ER!DG
126,705,320 *0CE53C2E3C6C2E159F948A8565D814A8DF8C6DBC erfz#
126,705,321 *0CEC3E909397CF5EB134F503D80E008AF9F6C487 CXQCP
126,705,322 *0CE1454D4719D38631580CEAEDAF48468424EF59 e,scottishvalse
126,705,323 *0CE82E870FD72802EE1435C837A581AC1806597D esiballys4
126,705,324 *0CEDAC27A90F7EB7D5A31E8DF8205835EB859D99 D0300747
126,705,325 *0CE72532E0EDFA43763D5363ACB1D3BD73754135 d0d+8
126,705,326 *0CE8434690B2213CA9311F1059DDB11AAE93B9BE D15BUR53D
126,705,327 *0CE43B9F854A8829DE5880BAA8EA5F1B640514A7 ESPERAVA4
126,705,328 *0CEC363AB9BD6F5C3E0D85B5F0FD973ECB6A67DD D1_FM
126,705,329 *0CE95960C418C81657C5F0C779959A9CAC384FA1 D$1L
126,705,330 *0CED883F985D9D1EB86996BE2DFF3462603103CA d3ll+
126,705,331 *0CE8D0D1112E645E7D1E98B3E7A46BD585DF8987 [email protected]+0N
126,705,332 *0CEEAA3EA51D95D4F8C3007149FF82E3658D1991 D3T4N33S
126,705,333 *0CE576301C2B0D655A3E896018623D5C6519DDE4 D3"U
126,705,334 *0CEA4DB74479A6BF47E72239C09A047573961C9B d4,af
126,705,335 *0CE463AC98336FA3409B4C30C185A51B72E827BD D5CNAAAAIBAJ
126,705,336 *0CE10ADC0FF632864F3480CA9713F1807CC2C369 D5F
126,705,337 *0CE1CD5E8A39F059B7D5319C1A7C2E38A40BB85A eugenioahlgren
126,705,338 *0CE49CCE09FB5EBB0261DF137DBFB68ABD57215C EUGENIOAPPLETON
126,705,339 *0CE6338A72FFC6288A83AAF82DD59C1B12586461 d6.
126,705,340 *0CED69B3639EB2679478E3B2A318E89EC1D23FA5 D6r2
126,705,341 *0CE63EE5A537BBC315A3117BA07219232BA48521 D6SHH
126,705,342 *0CE43CC1A3B34B874FBF62D4DC6691610F438693 eutaient2
126,705,343 *0CE01D4DCBF004A3B4837C1A7D2EF82CDAB31CAF D7b#
126,705,344 *0CEB4065E95CAEC3817CD337FE18B72B3EBDB0C4 D7DC5F
126,705,345 *0CE015A54B7DD46EFC9E230AA34DEA89685D0159 D7L,U
126,705,346 *0CE33AF009229160468B76513767BB6DD47264C1 D7+M
126,705,347 *0CEE1A3B5A83C7520D972352E30380F95B8AE965 excederet6
126,705,348 *0CE85C59162A7A985E2850E3F1A39029629A7B87 DA1CP
126,705,349 *0CE2432E1F9BAD1FCDFE69133F0828297531C368 da(ae
126,705,350 *0CE61BDA2CC4A6758005F7A962AA9E570D9F22D7 [email protected]
126,705,351 *0CE045ADA7163C2CCB3D6E3B54934C5127A5C386 Dactylografische
126,705,352 *0CEB5B2867818A6B9636CF7119D5CC1D1D77E69B EY:F8
126,705,353 *0CE0968005D50D8E3BB7BC22B47F2F1416068561 eyku
126,705,354 *0CEF52B7E158DF868ED15F21BB12F5F30487DEC1 EZEQUIEL.SCIERA
126,705,355 *0CE47A14CEC703295D4ECFDE93CE0487DA4865C3 EZEQUIEL.UHLENHOPP
126,705,356 *0CEAC7767D7C6BDA31AFCB3234A141614A79FB09 dalekoor
126,705,357 *0CEA12F246FFAA2A4A181935C78B0B059E863965 F1I+CHING
126,705,358 *0CE05A964D330D1017E5F0B2BA8E97586F4C3134 d´amèrica
126,705,359 *0CEF6C9407C69FB874776FA49086BD173FE35539 F+4:
126,705,360 *0CE664D532A248EF59A5A7162EAF5252E10AA3B3 FABIANHENDRICKX
126,705,361 *0CE21538585C97864638770C436E3D52CE149E6B factsimmi
126,705,362 *0CEBAE6CB40E0B9FA5D7F85ADEABB8CDDABD006E [email protected]
126,705,363 *0CEF99D6D871E0B4262A3F3CBD886726B05EA04B familienrathaus
126,705,364 *0CE188CE34F50E30FC4289494F273D9E77988D6C DANNYROTE
126,705,365 *0CE12993F29FD6393C9BDC85C683C5B06F35FA13 FARMSFORSCHOOLSORGUKWWW
126,705,366 *0CE2B6BFFB860CE63105AF78ACC64D8209114216 FAUSTOOSOSKI
126,705,367 *0CE96F3439FB60CAE6ECACFE544EBE6FF2ADBA25 darelldelaportilla
126,705,368 *0CEAC17D1006C53E1AFA742A6A43666754CCD68A fbojj
126,705,369 *0CEB2C8079345D7F38CF2199F8E99D4CB9B917D6 FELIPE.PLATZER
126,705,370 *0CE2D5F7120296B0D32427CFD7BF3AD8BB33FC7C [email protected]
126,705,371 *0CE09B0D8D52191BBE31EE2343DE2197A35DDCE3 fermenteerschuur?
126,705,372 *0CEC0D949CE32A347688353CA32D74E1EED0AA5B fernando-alvarez-monje
126,705,373 *0CE1DF49C2457C8024BA5BD674067133CD0FD67C DAVISBANKS
126,705,374 *0CE57537400594F622596199DA72C4B36ECBD8C8 dbfuk
126,705,375 *0CE2E0F779E9F0C780DC19981CA3AAB9A5CA87DF dbu24
126,705,376 *0CED92A4BAD039ACB78C6654ABAD8F7941A44E8D flag!t!0us
126,705,377 *0CEF947B9455FD99689A2A9B5ACC96CE47C33FAD flfcpbsw9
126,705,378 *0CE8F23A7FBCB1BD00E2FE176D1B844267468932 FLORENTINO.GURALNICK
126,705,379 *0CEFEDC26703A63825CB0E883523B28B27DB4BCA DD&0N
126,705,380 *0CED65D283CB6280ED231207DB55F9B683DBC865 FNODEID
126,705,381 *0CEC60CC9C10A87BB59CAC3675890B839649F06D DDMNM
126,705,382 *0CED569E6AD903F4FD3C6544AB07C86A0270CA46 [email protected]
126,705,383 *0CE70A636B3D1D18B9124B7161A278CFAEEAEF5F FOOTBALLMEDIAGUIDE2008
126,705,384 *0CEC30336CF180B28F498E55BB244A0003A962B6 deathofyou
126,705,385 *0CE0741DF178055A46AA956B7FD85E905BACD077 fpxuzasu8lm5cq
126,705,386 *0CECA4EC9FC6779829C098A61A06D6424032E005 FRABUYON
126,705,387 *0CE6AD921CF8CF80F326ED2A6523E028A28E6909 dedulerps
126,705,388 *0CEF511A08714CCBECE2520AB13DFD5CBAAF86A3 FRAGEN(EINBRIEFAUSLESOTHO)
126,705,389 *0CE49DA5B150AD57ACC791674569858C04F35E03 DEFE'RIE
126,705,390 *0CE3AED7162B7685D9CA3A4E67BCA9D44685C728 FRANCISCO-MTZ
126,705,391 *0CE22FF59695F944D69DE2E340E925F32F4C508D FRANCIS.PATZER
126,705,392 *0CE8417696125C0F3FA8F0B44F609530B2B29588 francouzy3
126,705,393 *0CE7B204BCDBD901A1FA3BB6EAD71E50BB0AB97D FRANDYER
126,705,394 *0CEA1F8A5F9AAEC09F313CA723A372D008F1BA33 franklinweiher
126,705,395 *0CE0E5D8EB1338FF68632E101914722EF0E03927 friendly.beats.(disc.2)
126,705,396 *0CE2A240D44D93F1AC19A38D709E80E9C901939F DENIED.1213
126,705,397 *0CE435F21E311E3350BC31A52B1C7850A0AB7677 fronttoe
126,705,398 *0CE0376A750800C4D10128C8395A3F43DEA2DA68 [email protected]
126,705,399 *0CEB5FD5687D85F7412E07AA3C014F6CEF55F780 fryngeding
126,705,400 *0CEFFB79417EEA9725EBFF345F5A76941E500A90 DENVER.MINUCCI
126,705,401 *0CE1F61C4ED41DB510B23D821268AED85755357A FS4528
126,705,402 *0CEE2389D08823EBED15DCEBDF883064118CD5B8 DEONGRIME
126,705,403 *0CED0292BEF3FFF531BB847DA2870DC433240D33 fukkatsu-no-serenade
126,705,404 *0CEB4DEEFA14E256AE38E2EA59A21C628FB9C178 [email protected]
126,705,405 *0CEC6B436779773F08E57FD9D6ACD9E4C615D69D DESTINEE157
126,705,406 *0CE0A46192AB8155CE4557EB321F0F4CB67A9370 DESTINY.KRUGER
126,705,407 *0CEC5653422A08A72E2D29996788C274D22C15C4 DETLEBTS0
126,705,408 *0CE376615591E18FB509879498F238EAACDAC764 G13021992
126,705,409 *0CEA1AD018836F9BCE10117A0BD464CE98A3FD58 DEVIN.HAYMORE
126,705,410 *0CE9D039280045BB3EBD778E06AC6C1E3D95C259 G77707
126,705,411 *0CE439C2AF0496482E9144109671B4F1E9483DB8 GALEN.CONWILL
126,705,412 *0CEC95A1E12591ED3AE359D90E9D29B59D6CE14F galesilverthorn
126,705,413 *0CEA8A1DA37D1D4D3E81B3C89872760CA5A1CA40 df%az
126,705,414 *0CE8990099A6B6A62709CF4D91EAFDFC91D7ED85 df//l
126,705,415 *0CE386008F6A8C5968651A4B8CDA491CA70629FF DFLGV
126,705,416 *0CE4BF3B7487601DA2DDDE6F47CF0A8FE7AF816C GARAŻOWY
126,705,417 *0CE152B0B62DE4796BD1C91D2A65434156E9E77A DF)YL
126,705,418 *0CE65B24F9869D7108441D211F14E3D2DF9EE82B dgl&l
126,705,419 *0CE90B209B56226B51F62EA271C5988BC82CAE03 GATCHIEGATCHALIAN
126,705,420 *0CE96775E08AF80D8B42D426BA3F8040C7882E8F gaylordchaddlesone
126,705,421 *0CEBD79C9D9CB5E356C3628969523FD36C4F8DE1 GEL471NE5
126,705,422 *0CE769B005B398ACF0FE2F457E9BAD70C886BE30 di3la
126,705,423 *0CE34DFAD8611AC103669D96C72F8C9375928B1B GEMONDEN1
126,705,424 *0CE1F77F10FF48AF677ED2E71196D07B745118AF DIAMSGAMTOSI
126,705,425 *0CE98680A366620A1517E62C68546743544A1530 DIANNE.TOBIAS
126,705,426 *0CEC259492DD792FFED081ECF6523EB780725993 [email protected]
126,705,427 *0CE2F7F1D0D7C40F16477A369C75342633B90908 DIDDLEM.2.0
126,705,428 *0CEB0EB3F7F3954A7838856BC6B6A440D061AF23 DIEGO-RIBEIRO
126,705,429 *0CED01D33F0C27DAD099E822B0F1E4403CDC12FD GERALDO.BAYIRD
126,705,430 *0CE019E3375D1E0CB7DE09152C99043997962C63 [email protected]
126,705,431 *0CE513CA14780B206C40655ED481044239EEE177 [email protected]
126,705,432 *0CE39D2FC62BC489178BCB6F0CFCCAF42CC01FE1 dinnitho9
126,705,433 *0CEFAD9E97B6267C5CAA3352CFF58173D9448C0C ggnz
126,705,434 *0CE1D1CEC6E116000C6E47DC179D3F35BA11F82C [email protected]
126,705,435 *0CE3691B0B1137F5ECD142CFC8661DD49B98FB91 GH
126,705,436 *0CE9738EA928C78E408FBBEABD860F47CCA2294D GICO-PARA-LA-EXISTENCIA-DE-DIOS
126,705,437 *0CE76B8CE4938347918D41C7518B3F5B4931F329 DITUISSA7
126,705,438 *0CE4EA056FE0E606AE990678D2B38CF8D599E85F ginohaga
126,705,439 *0CEDBCCEEF402F7C81624FDC123E8BD5E71AEFE1 DJFTP321
126,705,440 *0CE5B991F8A2C77EF6FE56BE55E2675AFC75CAD2 D!JH
126,705,441 *0CE7D8D8780D4A1DEAB22F92A0F041B095BBD881 giuseppesul
126,705,442 *0CE6BE137878299049FC473F95B19CC34DF1B200 djlo7
126,705,443 *0CE0DAE5F0FD8C981287FF37AC17CE83A5BBE0B8 ゴールキーパー)。GKとしての実力は若林、若島津といった天才GKには数段劣る
126,705,444 *0CEF87E92D030FC66AAE68A683CC2B993DC705CC dk8rw
126,705,445 *0CE2CABE744436F492A743C0D57123DB15F16074 DKC7O
126,705,446 *0CEE8BFEA918EA5051E24D685638E23E5B6B3D9B GLENNMANNI
126,705,447 *0CE6004BB00177CEED26B49863284F82A3BB54F8 GLOMERATI1234
126,705,448 *0CE8B3F11E27C1E43887429F116356789A459885 GLORIA RENTERIA
126,705,449 *0CE39E8829B8EE24CCD3195D9B84A46F68BD02E5 D_KW
126,705,450 *0CEEBD77623E0882C79304810D07F4D733F43C5C gnfkb
126,705,451 *0CE838393FCD31E0D2E1DC15665480D4D3DBD567 DLFN_
126,705,452 *0CEA31546FEE05A67E6922090035483F1D98557D DMCM4
126,705,453 *0CEF443ADE8F0AADD9BE54F45B83FE4483209894 dmxvk
126,705,454 *0CE5C8FE4FCC59B267B7F62581CB5ACC486D93DA GRALE"ENCHANSON
126,705,455 *0CE84EA047F3FDB483CA58A48B45108DBCCB9E37 DNJP$
126,705,456 *0CEC467B6852C8C8924AE3627FDCE192DC703182 great pianists of the 20th century: vladimir ashkenazy (disc 1)
126,705,457 *0CE44C6760EE9D1DB5A8EA58C394025C8631386A GREENLANDCOBURG
126,705,458 *0CE08A57C49F6C9E9E1F042888B917802E0322FE DNTD&
126,705,459 *0CE9D5EC042F0D81B6D605BCF807A51FD3C50553 DNVDR
126,705,460 *0CE3B39CC5B896E093DE6CCBADC653DE2278F9E5 DOMES+CA+ONS
126,705,461 *0CE75E7E3D4E65CF8623D5FBD8C53317C0D108E0 GU':
126,705,462 *0CEA933F5485EB6B0841354FAB175C4FDEBD61A4 DOMINICKWACHS
126,705,463 *0CE67900A8010D2ACB7FCBEC5A3A8D9F0886858B [email protected]
126,705,464 *0CEF695D19C1E5A9E5900A9186C6099F0BBCCC1F donovanniggemann
126,705,465 *0CE2555E2A36761C78A9C805715A2C9C61246611 GUYOSHMAN
126,705,466 *0CE0A03B2A00FF5E0962628AB271E6505BEAE989 H41F C1OT
126,705,467 *0CE464801294C644270A98AC49B1DC219C6B7A41 DoU
126,705,468 *0CE36D75B407F94F10DCB112D98E83BB57BFD2D4 DOUGLASS.AUBRECHT
126,705,469 *0CE401F39E98302C89591B875BD90DF1887B26AE HAMNAHKHAN
126,705,470 *0CE47227B0E3127DCF33E099F1635314AEB80C11 do.you.believe.it.now
126,705,471 *0CEA2D34CA8BCB80CEF620AABAE3F70245495B3F DPA318X3
126,705,472 *0CE7DD9AC71652ACB1A288D365A766A32B734213 DPENAFUERTE
126,705,473 *0CECD119B23B971C0C494B71800263C2294EEA2D DPGD
126,705,474 *0CED9C9A922776AD2C22D6FCC9305BD89BEB7B2F hansnarciso
126,705,475 *0CE48118BF1F6BFB68F4623C494E048F96428E23 [email protected]
126,705,476 *0CE35864B62C70606DB472772C56CAE90ACF53A8 DPQSG
126,705,477 *0CE7D591CAEB41C81E1CEA845DC64E401E9319D8 DPVM
126,705,478 *0CE534EE218123D6023A2C88ADE1EA03B663C26A HAROLDFREDRICK
126,705,479 *0CEA070A857C7C74471323AC7A70C8D89A4F9FFF D?!QH
126,705,480 *0CEE37A41F6A12CE4DC066AA654971D87BA45AEC HARRISONRALLS
126,705,481 *0CE56462E45D2B7974667545653656B91C1391DE DQZHF
126,705,482 *0CECCEB537DCCD507946EEC94ACF0CD9776D9EB2 HAWALUUL
126,705,483 *0CE0C64CEEC1FCDF6FECD9932A953ABDA0017C7F dreammelife
126,705,484 *0CEAF4FED6C5AEC07FA1EE7C47D30D18DB4BF866 hc]`
126,705,485 *0CEFB817667C771EDB48FCA7248DE9F0A6E8CE76 DRIVEBYTERROR
126,705,486 *0CE2A6C8DAF7600EFE07D26DAC71CA4C6C1573D7 HDRFORD
126,705,487 *0CE45CB6A524FBABE303C730FC21F95B9899A439 heading emotional south
126,705,488 *0CEAB9F74D610A2FB9FF66F5A65D122DC07BC009 HEADSTARTTOHAPPINESS
126,705,489 *0CE9DD71AEBAC56A713248D5FD43579B85FBA6D9 Hecke
126,705,490 *0CED1712042D1A9D738574733D478AA5F40A8A86 DRUKKERIJ-DRUKWERKN
126,705,491 *0CEADE7D2C182D39D48B8F0B4B98ECD14EC320C8 HEINSILVA
126,705,492 *0CE81F76602AAAE4EA441B057254EF1F8564B198 HENDERSON MARTINEZ
126,705,493 *0CE03CC27310EEEC5778D1217C1878BF075CBD55 HERBKECK
126,705,494 *0CE0C41F9704A0E911E43A34EAA27D0318A3907D HERBPALADIN
126,705,495 *0CEF325971D7E36DAED54D2A14433C5D01B04CD3 HERTEL'S
126,705,496 *0CE75BF4A20BAED9A0D225206ED0911DD3460F4E he'snotmyboyfriend'[edhandshimabeer]'thanks,babe
126,705,497 *0CED7810146D27B2AFE092A5DA74A0DFFFA94CF1 DTNNHDVP
126,705,498 *0CE112C747C21D516D3EC414C5E0DDFE2AF46AA6 DTRMNZ
126,705,499 *0CEE738CE07E6E644AD192831AB8EC9DA57B3229 HEYPEN2
126,705,500 *0CEC04E6D8CABA53F905636D466E26F8F41ECC03 [email protected]
126,705,501 *0CE61CDBC6908DD1CD89C0D3DD3AA9268428B837 [email protected]
126,705,502 *0CE2B24F51311ECF75E074FD005BB555C1D65C16 DUCKWIGEONWOOD
126,705,503 *0CEA7E33A9C83B1FB6B744F120DFC46B8B7E7987 hipolitorusk
126,705,504 *0CE3E2AEF8FAFBECEAA51968C83879B33D310AFD hippopotamine7
126,705,505 *0CE48000A43FCE8A94056BF7932A4542B5B3EEAD DUSTY.SPRINKLE
126,705,506 *0CEF462976F5CD5E11C59AAC84142D3D12A73B1E HO.LE.ALLUCINAZIONI
126,705,507 *0CE3D623BF1F072AD2829647B00D05B4C58DB633 holidaysfuturisme
126,705,508 *0CE0C68B61CEE1D228CE408A2366647E061B46A2 homerwinlock
126,705,509 *0CEDF35B93C1173DFCB1222184AE2133EF88B004 DVLKW
126,705,510 *0CECD977F5925B9F0581AC39CE922FE536FB429A HORSEHAIRED5
126,705,511 *0CE3F85268A0B301C03EFF6FF13BA764D720AF46 houstonlucks
126,705,512 *0CE808843B3C39CC5CF37F6CD820435865F19889 HPARTITIONER
126,705,513 *0CEB878D874DB4F0BB562D0B5F5FC38DB1EEB5FA H=Q
126,705,514 *0CEEF37A1CF5CF00881A776317EC8B605EF6CAEA HS20011113SI3SP01CHI
126,705,515 *0CE625A7CAEDBE0B62CCC451C4543FAF733A1241 HTTPWWWMYLIFEISBEER
126,705,516 *0CEC823A56AEBF5F9B7B78619774F29405760E8A HTTPWWW.SNOWJAPAN.CO
126,705,517 *0CECA532C8D0E66C2C032699E74BD08523913B76 [email protected]
126,705,518 *0CECAC73E5C97FCC60A8EE9ECF2C626E0FD1D56A e7e26977df694461291ba136707d18ace
126,705,519 *0CE79321E13B571D20055BCB490518DD05BAC6ED eaaun
126,705,520 *0CE6451220ACA895496096689AE7423EBFF56EE0 eaf&s
126,705,521 *0CEDD627300A08EF98F2565C687BE1D98DBCBB4C HULBURTS6
126,705,522 *0CE9B96B8E6314C21F4EE5C5FCAF689CE1CE8D66 HUNGNWANKWO
126,705,523 *0CEE787246D27F6BB76760954A844EA2CCB34A13 eb9cg
126,705,524 *0CEF2ACFAD84F833F8BB077D339BB404D040E5A8 [email protected]
126,705,525 *0CE273605E4413EC7E761234834F100DD335DDD2 [email protected]
126,705,526 *0CEC733F418E993A37A46E5A20C35617EABF4CED i5mo
126,705,527 *0CE985F88AE79E89CB69040BC2D9ED0522665BE7 IADOLPHE
126,705,528 *0CE1D74E4E02202CC86E302B8AE5BDA4E914A2FF edgardoschnickel
126,705,529 *0CE00EF6981354BAE44E939E7232C758CFD2951D editorcher
126,705,530 *0CE4815D17ADA16229CC6065D15942CB45E51B45 EDUARDOBATLEY
126,705,531 *0CE342074CE7770232F96F79520763E0721E8A24 eduardohaskel
126,705,532 *0CE36047520408263C88D751591D515F9E27E293 EDUCTION
126,705,533 *0CEBA350889C9040770BC6C7FB6EE366B17219FB EDZÉSI
126,705,534 *0CE653D6EFAE27D46AEFAFA36983789B7D2EF519 ee:i%
126,705,535 *0CE6AAD9725A06194592AAA55107D919B0B65623 IDEKNAROD11
126,705,536 *0CE69FD5336EABDC365EAAC10190BE8FCAD7906E eepschip6
126,705,537 *0CE206AC0AE2A1FD0030B61745B965D1F7CD7812 IERTARE”
126,705,538 *0CE82AFCBDBEF69015580DD07CD6C674FAF21254 IESIKUUG8
126,705,539 *0CEBC649FCAB83DA65CBD07961A2EB3F9FB3FFC4 EFFEMELLERONT
126,705,540 *0CE3264232CE8092ED59EBA4A4B4ED3C2ACACF21 EFWPA
126,705,541 *0CEAD86FA049EACFA5A2CB5873189A32F10925EC ikeflug
126,705,542 *0CE0FFCE3EB41881D9829F807E437B0039346ADE eguyp
126,705,543 *0CEC07FD502FFB05CCF9D4495BF8EBD59D626DE8 ILOVEBARNEY11989
126,705,544 *0CE70BBA14BF877ADA95989DF36F5AFFCA9BD97F ein7k
126,705,545 *0CEFD126BEBA230ABC062232E7DA311C4AC7A579 ei!o"
126,705,546 *0CEE01DB432222F3BBB89A618F16BF60E3F140F1 EKO&I
126,705,547 *0CE1F9CB7663C5FCF3E26716A889E61F6045479C ELDONAZZARO
126,705,548 *0CEDEB39298D091E8D14E5A3F1FDD1C12B33C56F Imakawi1
126,705,549 *0CE074C53DCE5644432A3C7634C7AA7805410AA7 eldrich
126,705,550 *0CEDD164BE62777AFF3FF2367DA6A760347321BD IMARCUM
126,705,551 *0CE3F6817830460FE7D1C8F045D623CCB8671951 IMOTSCHEN1
126,705,552 *0CED44A1EF85A04208E5E4542E0529CCEF5A20DF ELIXIR9
126,705,553 *0CEFB8082A31792323A148C1B5980787D93118F5 elliotdamrell
126,705,554 *0CE93162A779565AE28C165D4FD8D411DB207D4D INFERNALIS-(CHOIR)
126,705,555 *0CEC5A7036ED2C2DB95E188AF08567A5B1360FB5 inhehlen8
126,705,556 *0CE1826B2CB85A4C5F2985E773FF2B44D110CA5F inklapbare
126,705,557 *0CE43B31F662E97876FF941403E8919CB042B0F3 INNEHAT7
126,705,558 *0CE9B85C001F2CAFC339084C78CD957554B3A14B ELVIA.JUAREZ
126,705,559 *0CEB02E1102C7E2A43ED726BB96052B53240F7E6 elwu
126,705,560 *0CEC2F059ADF72B26B97287C92EF6ADB21910B42 instantmoments(dancetherapyremix)
126,705,561 *0CEC26607C9DFA688B46DA464EAF0470CEE3BFBC [email protected]
126,705,562 *0CE012963F28BFF4DDBCDDF87CC5CF5E95A23706 emh3b
126,705,563 *0CE3940A9F3BF835DB44188A06E09C0B6E250B91 EMMELYNE6
126,705,564 *0CE71FC088C8B0EDB360F571E3C0F31E23F47333 EMMETT.DUFFY
126,705,565 *0CE179146FCD2370B6DF8FE9501CB8F86EB0F22F EMSQN
126,705,566 *0CECED672A1792D94915D5F3C2803297BF2FB3C3 ISABELLA604
126,705,567 *0CE6CE1CEAAB4EE0CB8244C16896833FB0BBC835 ENALZANDO
126,705,568 *0CE17C89FD1885A63265521745839312801DBCBA ISISIN
126,705,569 *0CE293DF2FB4DCD4A50D5A2B587FC5FD108C2766 enil
126,705,570 *0CED42C0D0D17A71B57342689ADCF998ACBD98B9 entozoa4
126,705,571 *0CEC7BF33CEFE87DAAE5CB27EB7A3CE86E8AF8E6 ENVARADO5
126,705,572 *0CE0C965C3559C5DCCEC8CF103314A3016F524C7 JACK.KINDERMANN
126,705,573 *0CE73BB42452BC412980A76019038F1CD6899E9C JACKPEAVLER
126,705,574 *0CE922B7CF929E37B265169AB69B8E4AE8327F72 jacob-t.
126,705,575 *0CE4304586A0D458F2D6B1A562242E9FF351396D jacques-edm
126,705,576 *0CE57061C5B8F41216026EB3EE0E819D3BA5FAE5 JAEDEARDON
126,705,577 *0CEA00BD3250224DBF3F68C0ABFDC8BDC5308206 JAMISONARITA
126,705,578 *0CE5B50F6884274F943C5BFBC01017871F5EC060 JANET.COTE
126,705,579 *0CE040FF5D63C8A2C70FD052204D23916F747CC7 ERPUPPEN
126,705,580 *0CE2829A6F717CD770D45EB1A366B480E8A29968 [email protected]
126,705,581 *0CE32761381B585D4374CF892BBFE7B5DD90372D ESTROSSI7
126,705,582 *0CE463ED7C78F6A1011BF45EB9677B740E461AD7 JAYSON.ZAGROBA
126,705,583 *0CE809109B7804663532226F8AFF2363A9E6D90E ETESTANT6
126,705,584 *0CEA3E0A31BEC48EAC8F757B26AED7CD244AB78E Ethel.Meserve
126,705,585 *0CE9456A1DA364E4D324DD4FBFA91B1024CEE010 JBUBBLETOP
126,705,586 *0CE43B0F34DE6A22C71323B2AC14AED8DA3CA396 jcdelvalle
126,705,587 *0CEE1E522271C40EA6C10CC24D78E2E61C8A603C je12206
126,705,588 *0CE78B6612F5CC50245B1D7EC0F9A62777CB3797 EUGENIO.HALTOM
126,705,589 *0CEEC5BE824AFC6D76C8C78CB95EE3031DD825DB euv+$
126,705,590 *0CE41C3067C0964BCA28745AC66E5730704A22AA evangeline589
126,705,591 *0CE6123C908172DCFBB15F7F0F94C5E964E49E6D eventualise7
126,705,592 *0CE91732AC542C2EB6415C0A05CB3F0FB5021793 exasperer4
126,705,593 *0CEDDE96C7FCEEC1F85F1B622FB9B855B1AB3B8E E(?Y
126,705,594 *0CE4BA86B2DF25A67BED79B421AFAD40B0E92741 jf{x
126,705,595 *0CE4438BBAFE9D67A12FC72E2DE958E18B153FD5 eyku
126,705,596 *0CEF52B7E158DF868ED15F21BB12F5F30487DEC1 [email protected]
126,705,597 *0CED9ACDB981F816596A0269A182D95C90F94AD1 JIMMIESARIN
126,705,598 *0CE6C8AE039B1EB4A9E128A9C4FDE6691621B364 FABIAN.DISTANCE
126,705,599 *0CEF1B9823DD7A00BC9D4F8D2AC978F3EF3D91EC FABYANS2
126,705,600 *0CE3A98153F871C95AF6ECD00C668A6C51FB3E18 JODYTHERIAULT
126,705,601 *0CEF6BDD8877607370A7F60F354C35E423D8F69F FAQUEIRO
126,705,602 *0CE69773FEE47A8C9E02A6CF695FF17CD09A327F FARMERPEARLJAM
126,705,603 *0CEB6F851E217F1CB6CDC0BBAD407B1760D4AC2C JOHNIE.PION
126,705,604 *0CECB8B86D9ED259BF55FFD57E3EB1C150D84EE4 jonathanlucas
126,705,605 *0CEA8297E06ADBF1F9DE365370928CEE5AB99AA4 JONATHANTERRIO
126,705,606 *0CECE521653FD26A51731F809CD7375F706F25B5 FERMIN.PADMANABHAN
126,705,607 *0CE667F986FAACE2E32FBCCC0FFAFE29365BA2F2 FESTOONE4
126,705,608 *0CE7CEAD8B38F7BA543684E0EC60EFF5C714115F ffelikkt27
126,705,609 *0CE38B9EF79C257F0DA7F93BC0AAF5ADD5E45475 jospehmellage
126,705,610 *0CE21D32376A765A2E7A97747A32815AB4C45DD9 filiteaed
126,705,611 *0CE4115D0CF04FCF7DB0476D66E811449B525128 Filmc4$3
126,705,612 *0CEED920A9C315ED50AC07A1F25932F439B36EE6 firstappearance
126,705,613 *0CE1D88A0693845D545C9069538ED0B3345FC0EB FL32507
126,705,614 *0CE459C2C0EF45FCE1183E6B46DEED7497ECF544 FLAGWAIVER
126,705,615 *0CE6F19084E4E9F84CE35DE58D17B2EA25523C0B fleshmaned
126,705,616 *0CE03176039B2140037FBAA2290363FFD8644990 FLORYNA3
126,705,617 *0CE77AF972B2135A66745A2EE2A2532D46A3DBF9 justistalmitgroenbach
126,705,618 *0CEE6BF65B5E67618EC6660ED7BCEA1C66C8E284 jwmbkqdv6
126,705,619 *0CEDB2E1F608BA84F11D3D95918C15F9976EDBF4 [email protected]@S
126,705,620 *0CEBF9E2FF01EBF1C40332A4C15C13D0436239D9 foregoes
126,705,621 *0CE1B3109F92FDEBA84A773FE5E5E616BFCE3483 kajaksesed
126,705,622 *0CE9C2F7391C3AB080C7C2049EDE7C7A060A6199 FORRESTDEBLASIO
126,705,623 *0CEF23D630497E5E399FF525E3A1D7686360B1DE KAMCHAKTA
126,705,624 *0CE82D76635A5B1A7FA3DE7C73F3C1122166FC1D fqee
126,705,625 *0CEDDFD2832A1967F88F34B93A239D2A00D06537 FRANCESBRAVERMAN
126,705,626 *0CE4690A8A10263C8B9C8A4E5DB33344EC72CC53 KÄNNYKKÄVALMISTJIEN
126,705,627 *0CEC6B0A82E8B89E01866C6E8738FBCE58D7CB67 kantakirjakonsulenti
126,705,628 *0CED40A2041485404EA18A0EAFA835FB0B37C8DC KAREEMLEFEVRE
126,705,629 *0CEDAEB5658B4DCA32B9266694BC440A47F678B8 frederickmiguel
126,705,630 *0CEE783696190069FC8800D40040DDC51008E477 [email protected]
126,705,631 *0CE8A99B0569FB4E3F4042307FFBF1DA6F14272D kathrynterrell
126,705,632 *0CEDC1B31B7F39D8B5EBEC1B09CB3B72169849EE KATHY-NUNES
126,705,633 *0CEC4764D8806A4F89AE1029E37460529A8F22CB fromyou
126,705,634 *0CE0D292CF49B904CE0D9449DD0344EC114B1C03 KATRINA-REGALA
126,705,635 *0CE159227A47724C4752239FAB0F95E74466CB5D F<(T
126,705,636 *0CE5F1A47364C88B5CE7DADA32E01A638863B04C [email protected]
126,705,637 *0CEB3B536192C06887765EB9885992E811522683 KEENAN.PANTUSO
126,705,638 *0CE11C2DB7EB946F4D755834D36ABFE0EFD46E0E keenanreily
126,705,639 *0CEBBCF0E12D70386E196FAF166BF5C0E29754CE funkymusicshonuffturnsmeon
126,705,640 *0CEE6118F677BE5BE2A0925BB61D7EB04072AEA8 FUZZYLOGIC
126,705,641 *0CE8EDA2E1BA3DFACE8DE8D78B5FA4FAB33D8B01 GAFANDO5
126,705,642 *0CE1C8F79CDB252EE9C10AB61277F937C1BC8B60 GAILLISA
126,705,643 *0CE0BF48A6148594E2FE9628EC5AC93E0F709923 GAINSTAND
126,705,644 *0CE6C8FDA04D31409A21D10352A7B2820FCDDBF0 KEVANCHALK
126,705,645 *0CEB82BBDAB8D51DA8EDE2F96E7F9A3BCCCFCA00 galenamedeo
126,705,646 *0CE04FC77E8B8F280953F4F65807025C2C61E367 kevingoodrich
126,705,647 *0CE0163C63F4861355F6B4DF0DD61AE8DD02E815 KEVINNJAGI
126,705,648 *0CE2A0724BEAF29E2834508B85A0AF090F25932E [email protected]
126,705,649 *0CE88B66FA37FD49F185EA97216EB82BCAEF84F4 GANGCAY
126,705,650 *0CE55A2765AEA8877298312C7122992B65CDD2A9 kickside
126,705,651 *0CEE67868B5124425938A6716FC892795D684604 kiersten
126,705,652 *0CEF71DF26E4BD22DA6B3CF81CF17DD12646D0E0 garlandkinstler
126,705,653 *0CE937A8C7CBF24CFDF17629CD8F847CFA946549 kiethspruance
126,705,654 *0CE8F47BE2770EF162048D6FC9A26C2BF4558C3C kim.crooks
126,705,655 *0CEC243B3B9515489C093DBCA577CDD7AB0E188F KIRSTIE ROBERTS
126,705,656 *0CE3DDB9522E49AB81356B48A525949000E9DA8C gaylordumbright
126,705,657 *0CEF7C76111F4AFFAD647A19C5AD2FA6E4E1FC82 KKIEAWSRIKUL
126,705,658 *0CECFB84D5936D308A27DC273C5195D9C023A62D KLAFSA
126,705,659 *0CE5F8754E80903606E36098659E57071FAAC596 kmart391
126,705,660 *0CE4DA79AA58601A55C71BF80E93166A85117346 GELEIDIN4
126,705,661 *0CEE6FF11AB8168E43788BD0BE3A21004C96D180 GENARO.CABANISS
126,705,662 *0CE45DC9041163DA11B45CE333C185D6F1DDDCF1 GENESISDEL
126,705,663 *0CEA68C4831FE43F7D68B76C9B20236967A55C03 [email protected]
126,705,664 *0CE354E04874AF86051E57A7ED8DE8AFD3EFA385 komandanten.8
126,705,665 *0CE5B7C31F20F56CE57FAD71E8C006AFDA85F3A9 GEORGESCHWALBE
126,705,666 *0CEDD43BEC5400997AEE2F855727248D108BB104 GERARDOMARCHIONNI
126,705,667 *0CE0389A8CB5DF84D110446EE97345C6CDF3EA9E KORDAPS
126,705,668 *0CEFD78CD7B017C04C1891793AE21B740BA15651 germanwendorf
126,705,669 *0CE4BDC0D6D841AA332FD46428440943FBA96317 geschichtsforscherinnen
126,705,670 *0CE72EBC1273C7F5E5B537892EE6A6C831BFEAB9 KRIS.IVANOV
126,705,671 *0CE33A7F70ECE757451EC5F2524BF6CC311EF151 GH
126,705,672 *0CE9738EA928C78E408FBBEABD860F47CCA2294D GILBERTLINGINFELTER
126,705,673 *0CE65FF96B6AA05A2A578F9B5EFD4B3583E820ED GIRLINTHEBLUEVELVETBAND
126,705,674 *0CE0ABD26FAABFC722B387E9265ACF7FC4550EB0 KUFERJ
126,705,675 *0CEA4932DE2D9CF9C3C8FA969D47642517EC25C2 kylehouchins
126,705,676 *0CEBFB8349F56003839C21FF6923113A97E92A75 $l+
126,705,677 *0CE079B92362DAA202B4D5383F5A49B26EEE307D [email protected]
126,705,678 *0CE07D4341A3E872D937149449D110D02FF46403 GONZALO.SONTERRE
126,705,679 *0CE2A36AF03175AA045EC094341507E25597489A GP/L
126,705,680 *0CE79F30867D59804D3917CE0E4ADE40648C4B11 GP(M
126,705,681 *0CED808234D6CA47D635C8AD2626462BB9702DC5 lamgwedocja
126,705,682 *0CEFAAF24567D05FDBA48F23750676FAD5EB3325 GRACEYUNKER
126,705,683 *0CEE1E3902CDCD418BB65D5C9BEE463771ABE36A LANEOPOIEN
126,705,684 *0CEE0D6430FDB1D23A469FBD81A9A12E2AA4236A LAPPJÄVLAR
126,705,685 *0CEC99ADC6A11379B5A7EBE249A9C34E1F853D39 greatest.hits!.(disc.1)
126,705,686 *0CE0AB7126BD93DC403E009EDACE7E76044C69E4 lauren37
126,705,687 *0CE99C6A8FDCE87E71C263227F66AE62D5DA12DF laurencearthur
126,705,688 *0CEEDD4A8FE7A34EE4A75BE732ED7D7BD1E97BB4 gregorioweingard
126,705,689 *0CE1A9795913088DD1DA6ACCB633BBC678FD43A6 [email protected]
126,705,690 *0CECD354795E0DE8A73C4252AE70BF915BF46B1B lcdigppmsca00640
126,705,691 *0CEC257DFB0E111F7FAE1087B7C9FD23BF4C2951 GRYVENPUFSLY
126,705,692 *0CEE4836F7C91591F442CE1C98EBC799DFA5D910 legaties2
126,705,693 *0CE6C0F42D2873EC66767052330F1077E1BA63B4 [email protected]
126,705,694 *0CE27E629E7332259618F9AC0DBA170AAD0879A4 LEIFSONDRUP
126,705,695 *0CEABA4846DE3A4A5D1DEB92AAE30E93895432FD GUADALUPE.FRIER
126,705,696 *0CE17D3E5553DD59C42AA7405587C7ADE2E8BA82 LENACI
126,705,697 *0CE00E6A0035593DEB10344CF957D26BAEE2802B [email protected]
126,705,698 *0CECED6D07AF013D14EF650096576DD7669E4F3F gurcaigh
126,705,699 *0CE88D2C1F5FB9CD1600440E6FCFE1FBC36DED90 LESTER.SOLIVAN
126,705,700 *0CEBD77E41A2FEE2A506D79404FF7D828BFB187D LETOMBEAUDECOUPERIN:5.MENUET
126,705,701 *0CEBA764EA3779A914BC0FFA4CC7F8BE0368D487 GYOQPD
126,705,702 *0CE372B4CD3A1B60A8E7122E5457DF9D686FC947 [email protected]
126,705,703 *0CEA9BF90B7D77A92A54D0AD95DE2A8EA652DBEA HAAHIEM
126,705,704 *0CE0874FD2F554CC2E961303CED62680416C2697 [email protected]
126,705,705 *0CE3B99760E6691014248174C37A86072D38E465 HADDAWAY6
126,705,706 *0CE50AF2133F0FC4E629D14C93CA6ED17656EE2A [email protected]
126,705,707 *0CE627F59098FF62F3DDC5E4BC3E5FD39E79A8ED [email protected]
126,705,708 *0CEA3AAF3D6643F96D418186663E854F5C8E773E [email protected]
126,705,709 *0CEAB711A13C239259DBFF8010B3AB047CBBBE09 [email protected]
126,705,710 *0CE5F86FD068D3969B1A9153A955AE50FA99F9CA [email protected]
126,705,711 *0CE0B13132158814736DF6F1D903122E402561EE LINO.LOLA
126,705,712 *0CE1C1615DA504ACDD28ECB71CC9B65D181BC382 linwoodfegley
126,705,713 *0CE71DF46956125CFAC3B4BC4062D0BBD250F307 HARLANETKIN
126,705,714 *0CE95F9339586CE2DCC8C097ABCA495D913FFB84 HASSANQUINTIN
126,705,715 *0CECCCA2163BC33D4123661DE099AE4B7D168BDE havaittavissa
126,705,716 *0CE4816004846AE95B0BF1EB6AD82822E2B63E6E H"B=
126,705,717 *0CE2982618E780DB78608B154F7F1EED6B0EAF71 HBBLNGLY4
126,705,718 *0CEC11AEECB199D986B05300EF394197D1ECD9BB [email protected]
126,705,719 *0CE8D81D954B4D10CAC0E2BFEE3BD98E633865F9 H`"D
126,705,720 *0CE483EBA24C8D3C65DB93193CE13716A6B9C2AE HEAD8630
126,705,721 *0CEEEE2E9CC6661B5F3C2B50816805EC10A475E4 heglancesupandreeseisgoneheleanshalfoutthe
126,705,722 *0CE197C3426E059F9700876824622A901157B120 HENNEMAN3
126,705,723 *0CE8548B8A6E855B380CC0712D66E72D817A29F8 lonely.in.love.(feat..pelle.almgren)
126,705,724 *0CE0A056C8F6BCC13BCD632C176FF7F380434B5B HERBLEFFLER
126,705,725 *0CEF40E14A8EBBF7A277538F6A79BD9209409D67 LOOKERON
126,705,726 *0CE7B00745E67F5F62E2E9D1A503C73A619EC57F hermanehrke
126,705,727 *0CE21E341867A8B71A7BD212DE6A92A069A63378 heterocellular0
126,705,728 *0CEB76960FE98FFA9DFD941C2508383F55D02B2D HIANTCHEV
126,705,729 *0CE3EE42051D3AF7F48B826776BF56BF747B6B5A LUCIOOELSCHLAEGER
126,705,730 *0CEE6222AFBDDCF3F2DF12EB5E036D5DABEC5CD6 LUCYNAKIMERA
126,705,731 *0CE6CB7DC58CDD2A436AB585D960FC7F596AAD97 LUIGIJACOT
126,705,732 *0CE234F7D08E077A9F51B8E9E22900792E6E8455 HLMHLTZN7
126,705,733 *0CE1283C50BDB7888A82533429BF7276D5460A0B hmare novum
126,705,734 *0CE887BC676749CA2069042A740CDB4689650F59 lujzom
126,705,735 *0CED0B9EE4496E91D16639C87F76FD73D5D2428B HÖCHSTWAHRSCHIENLICH
126,705,736 *0CE951F1735840E0CF515ED0CBCB54477FAA65FB LVSKRIN0
126,705,737 *0CEDD56BEDFA2BB9CB5CBE303FB1450A76A91A25 HOMECALENDAR
126,705,738 *0CEA0D58EB3EB81A262E97595B97C1712B3F2AE4 homerdelongis
126,705,739 *0CE86CFF0C85A0A0C86B75D2E98021C20E309174 [email protected]
126,705,740 *0CE8F1C22C0B4155416F523A560D95469F0B9990 MAAHK
126,705,741 *0CE0E3EA450AA9A7092C79A20272FF459F4E0CA7 höyhenmätään
126,705,742 *0CE7EF80D83818F6FA3D2CA36FF42EA3A5B2E33E MĄDROCHĄ
126,705,743 *0CEE4193BACAFDA5F0DAC206A8116AD70DDE1C71 [email protected]
126,705,744 *0CE1FC28A75AA0BE19CAA12401A9F60386299BB9 HTEROFNU5
126,705,745 *0CE06A0F468EDDB5F509F9916D12FAF4D0A812DA httpwww.thedigital
126,705,746 *0CEE09384F2155D3AA04AA71EF61EF4EBDC6F5C9 MAJORCRUTCHFIELD
126,705,747 *0CE1BB4E809933DDF59DFFCF82A6D13B256D0F38 MALIKCALLER
126,705,748 *0CE55C2BF6200434FBD7CAB2C2EA41B50F8BE8AD MALMESY8
126,705,749 *0CE6FAC310F0AF951B2E51525E5D0943CBCE4DAD mandarin 1
126,705,750 *0CE14B91D89613ED448145BF44576CC9729B201C h?vb
126,705,751 *0CE68CDF33708A1F1CED12BE176BD94EE82F4D85 [email protected]
126,705,752 *0CED49649B8E8EACC572D71B198AC86C93ABD91B HYDRAULS4
126,705,753 *0CECD1012F94398833E42719E3788853864B8361 [email protected]
126,705,754 *0CE457B76FD6DE158234393CCDCC27F0A3B945FE HYPNOTIZE.ME..LOVE.DOGS
126,705,755 *0CE59881F4206446F1A057B3FFDD2E0B1993076A [email protected]
126,705,756 *0CEAF01E931FB43767B2C085A44CAF9ADA768494 MARCSOUL
126,705,757 *0CE82CC6934CD45261BB5442D8D265FA0C9C3B12 I7CHIN95
126,705,758 *0CEF82F551F360A982DE774D22BBA42A14EC8CD4 ICNZ
126,705,759 *0CE59D584FF7F271E9E18EA0DB0396A0CA76F1DD idiograph?
126,705,760 *0CE094B31678DBF3D825C5A22E0C9376FB4AB1F5 [email protected]
126,705,761 *0CED76F49AEBE81691453CB80BB37ECAE50C7AFF marypetdawal
126,705,762 *0CEA6AF031058780EC4AB94ED00628307515B495 Mary-Queen-of-Scots:-Vivre-Et-Mourir
126,705,763 *0CE280A065E7A9B7FF75A2F54F9724D0F2AD1550 If(resolve_one(dest_name,
126,705,764 *0CE5A1EE893B339DDA830D56D3DC634AF6194DE4 if-you're-getting-married-tonight
126,705,765 *0CE593DAED8991A2D46FBC5BAF3E4A9878E17999 ignaciogrode
126,705,766 *0CEDB50F210C2FDEAA57A186371EC06F5925F034 maxnorthrop
126,705,767 *0CE3802B85DF7179FE4BB28EC80DC57DD553C7A6 ILAARKASES
126,705,768 *0CE9417EB3D2B0E34DD394BF254DAE2806D6FABE MAYDAY-(REMIX)
126,705,769 *0CEA61CC17FF8592A596CDC1299BBD9D90F1B776 ILIKEJAS1
126,705,770 *0CEB8C238B68A25A90AC52DEC3C3CD31F249E190 MAZURKAF-MOLLOP.7NR.3
126,705,771 *0CE4246C631636F25E324020DD6A52B764CC731C MBATARILAN
126,705,772 *0CED835E56E5C60DCDFF0AB429DC614E8E872A4A MEHEŠOVÁ
126,705,773 *0CE212E0B1EDA6CEEF1F7EF54DCB00CD27BFF73C MELVINOSARIO
126,705,774 *0CEBC9461105C7C21A20C710099DCBF27B06110F MELVINSCHIE
126,705,775 *0CEFBD2B5047BFB08F77C40D76C9B5BE68DD6C41 INABITINO8
126,705,776 *0CE88E48E9E25C1BEF051A00C9A8CBA0AAEA3115 INDUSTRIA-COI
126,705,777 *0CEB3CC47ECA72C8EB0D2152EF7AEA8F9DEE2748 mevir
126,705,778 *0CE8146D5555AF8ADC90E3EC3D6379A3B08557E3 MICAHPREVATTE
126,705,779 *0CE83E73D3D4CAA7834F5997F0C36A8EDA0B2EE6 inmemoryofshadows'madame
126,705,780 *0CEDEF58F00ACAFA62AC6069B8C613125425F2CD MICHAELLUAGUE
126,705,781 *0CEC27F6AFA698F22BD5A96C723F99743A60E9B9 instaured9
126,705,782 *0CE1A709EE30ABBA70478A3CC27D7E7B27A9A1EA INTRECCISES
126,705,783 *0CE9A608ACE3935F88120D42B208879B0BCA3146 MIDFIELD
126,705,784 *0CEAE74EF90A33A27917B7B79BBB460C525A33E9 [email protected]
126,705,785 *0CE9B4E49286557065DC2938EC6C951891C913C3 MIGUEL.FLACHS
126,705,786 *0CE99E6866B4E3CC0790200EE8EA93B949DBEF77 MIIINV
126,705,787 *0CE6CD95A3AA300D474488312D0C596621D36EE8 IRXSSJB6
126,705,788 *0CE58F2D343A679E70670F820F43EABF118D0C76 MILOMAGIC
126,705,789 *0CEDA07BD73CF83EC022EBDF13D80696F906E1D9 MILTON.BACKERS
126,705,790 *0CE890FA8DB54BC3E2AB2226729EBEF82F81F5EC IŠVIEN“
126,705,791 *0CE36475D206EA6F65E7302F96075AC7962B572A [email protected]
126,705,792 *0CE22B2BB3B80D950181E1193878565E8E395EF9 IZOLACI5
126,705,793 *0CEAEFFD5C7C312D4F43709E7DAD98F631B34431 jacintogollhofer
126,705,794 *0CEABD56298BE254DACAAAD9EB4AE30FE8109B11 jackmoi
126,705,795 *0CECEC4CC5FD1E596B89BBC20EC4DF61D3BF765F JACKSONGWINN
126,705,796 *0CEEAF73E5BB51B735EFDDD04C8644A37D9CD82D JACQUES.FLEMMON
126,705,797 *0CEF00B95EAF612EA1CFE605801CF1B6D4BF6782 JAMES.CHO
126,705,798 *0CE1E545DF0E55E9553906E059B23AA4963942A6 [email protected]
126,705,799 *0CEDE4C29D5AE58696F59C8AF16CF431064389E2 jameywillardson
126,705,800 *0CE4D63CC918EEEEDB7C495AC8CC7F4642DDE44C JAMIE.FLINCHUM
126,705,801 *0CEBDD779D48B18566AE181CCCDF1A10876F5D66 morrisflyers
126,705,802 *0CE549555CD0066971046C1050136B61DB4166EF JANICE.MITCHELL
126,705,803 *0CE75F015F3E51462FC44D23A97FC9407ACD330F jaredmcsharry
126,705,804 *0CE9208966453579F19ED68E7BF003AE147C3B93 JARIDSIP
126,705,805 *0CE3755199CBA200DDC8CB57539DBF5F4EC56F96 JASONGOSLINGA
126,705,806 *0CE89B6649911C86DA3DB63EDF0971BF32825920 JAVIERRIVEIRO
126,705,807 *0CEE02F5E57ED6304943E216EB4BAB17C1946921 JAYATULSYAN
126,705,808 *0CE142422775B8D93294D5DA11CE1C9C5AC923B1 Jc`
126,705,809 *0CE6CF5B6E892F789253929F50B5BE45D7F623F2 MUSA SHERIFF
126,705,810 *0CE9F4C83BA38B442BEF6387E456017D12EFC07B jermainecastanon
126,705,811 *0CE97D235C503C6962A82349C7B0E78B97CFD555 jerrellsantander
126,705,812 *0CEEC118A9677D49B5A8C18C2E100D6E886B3E6A JESSE714
126,705,813 *0CE4ABBE6D4431402C5AEAEFC07E6549A23B09EA jessebosshardt
126,705,814 *0CE9E975A141E28820A8B0739F542847EDAFFC00 MYSTRETCHQWER
126,705,815 *0CE71A9CD7E911DAD8D91E3C95D2807D168EB9AD JESSMEEKS
126,705,816 *0CE836D4C333149FD43D20F96444736538C0DEC8 [email protected]@lly
126,705,817 *0CED89E88DB206BE92F2DB68A0C50CE72D316DD7 n0n48r4$ive
126,705,818 *0CE6C5536BE6BF99B85BAB799484D457A801B104 JEWELLBRIDGEWATER
126,705,819 *0CE0D0B0BC126785C29BA8BF34989ED807688D0A jf{x
126,705,820 *0CE4438BBAFE9D67A12FC72E2DE958E18B153FD5 naeem-sadiq
126,705,821 *0CE238B9D70301687199B33478D3B6AE68F74F6D jimmiewasher
126,705,822 *0CEAFFC70341DF968B2E9E22FE9F916F47552AAB [email protected]
126,705,823 *0CE294DA530438B5957E27D6ED1292939AF5AFEA najibawad
126,705,824 *0CEEFA13E45F9DA45D7DB4C0B038C1F25A077827 NANILIAW
126,705,825 *0CE9C976D52729AD06D9E453F6EE2958322E027F NÁTHWANON
126,705,826 *0CE0BA557371B6F1D8EE4ACF9A9E5F80DB301E45 NATURE-IN-ART.ORG.UKWWW
126,705,827 *0CEB29DE97EB1F38F7EC32880AED01FAF99A0BE1 [email protected]
126,705,828 *0CE96FECA97A312178F0691197977D9DCE82A6B1 JOEPESNER
126,705,829 *0CE9E4484A88F3773BA6E3FEA8D15800B624F990 JOEYENDINO
126,705,830 *0CE0326CD5D3789E300E163978A5E3C175FE347E ND`/
126,705,831 *0CE509A1327A699F0ABB6E6A4E4B67AC659BEB8B JOHNNYFXTRAGEDY
126,705,832 *0CE2AA7794F96C740F78F7D8A7790A8F39326A8A jomonroe
126,705,833 *0CE7B79DC9F9819894257A3AD919481EBFEE39EE JONASZACEK
126,705,834 *0CE4BD78688B9568396D11E0BF8FB6FD711F8A88 JORDANGOLONKA
126,705,835 *0CEF3257B6A6E8B7C83380A9CFBD493679ADD4E4 NEMAIGASINDU-SE
126,705,836 *0CEEDC77DFCD59E9C6E069429A5091DBB36E08B3 JOSEF.COVIL
126,705,837 *0CE7EBEFD60648F69D669D06FC64363D5C3055EC joshualogsdon
126,705,838 *0CEF332A90A66C4114F4E4965EDD266430FA00D4 NETLEKR4
126,705,839 *0CE88AC9782065B0A1209A2A70E88DCADBEE351D JPANDUROV
126,705,840 *0CE41AE661B744CC45C6C19EFFF3A2F0EA1EF771 nevillejurgens
126,705,841 *0CE746F967740CFCA27D5ADBEBDE090E7FE5B63D JUDGYNG6
126,705,842 *0CEA43D896B35486E6F594ED291C1481048648C2 NIERTMOOTS
126,705,843 *0CE07D14D2F113912017CD901F85E28A8EDC2525 nigga-like-me-(feat.-tito-green,-zen-&-jet-lag-ash)
126,705,844 *0CE11C787771323520CC9497DC935351A254A95E jump(featgeorgeclinton)
126,705,845 *0CE1CD4737BF6B5398B4988C53B24E33F8400C6F nk?
126,705,846 *0CE6465054FB89899151239A612FA1AF4F06D7E4 NM0763778
126,705,847 *0CE0AE6EE1181982AB1C4D477A45E5FACDCAA9F2 [email protected]
126,705,848 *0CEA890EFCCFFD308855CC6B7F62433015936BD7 NOAH.BARTCH
126,705,849 *0CEEC2CEEA1B80D114186202F4930CEB840D9333 NOAH.GOLUMSKI
126,705,850 *0CE626A8051C04BED24A6BD9099E5823B783E6DF K3R4+O1D
126,705,851 *0CEB6C5AC183E56A012A89BAC6585F13A2BE2691 KA_"
126,705,852 *0CE486B00CA0120DAB3AC219C79565A5CD61D5D4 nonacademical
126,705,853 *0CE81FBBFB2140756ACA27CDF0921573FDCBAE6A KAN27052534
126,705,854 *0CE8AAB9C457E2FAF63D320A1B989FCC52AD1914 NORANZO1
126,705,855 *0CEBA2CE65A9F25B8E1AC7D9ECD5EF379D10E921 KATRJNA7
126,705,856 *0CEDF518C7AF74180B0265D425640B38C85417DF KEL HARWOOD
126,705,857 *0CECCEEDDC670FB5A45C1872D8A0D1E41C170FBF KELLEN RICE
126,705,858 *0CE588811A05453E9D92E5564572B452045D428C NUPUR SUREKA
126,705,859 *0CE84C6791F9FB6CC16397975D2A5B23119769ED kendallpezez
126,705,860 *0CEF3B25224F35349E2573D0AC1D9EC049D06BF3 KENNITH.DAGHITA
126,705,861 *0CEC16188422E4DAC13DF6ACEA8B2190CAE7B7DD kentfillpot
126,705,862 *0CEA2AAA709C6A1860FDB57D2932DAC22629D5E0 KERRY.MCGAHAN
126,705,863 *0CE7962D76D48CD64AA790344BE541512759561F KETTENARTIG!
126,705,864 *0CE5BFC900E64C21F5C7033FF8658F58EE13A89D ocmbrcu1
126,705,865 *0CEF67C766A52AAC4A8EBB6C666AB5E3DA3C8FB4 [email protected]
126,705,866 *0CE85235A2B106DF7B36521C8314A9F975EA72CD okićkoj
126,705,867 *0CE826143689BABBF64D61C101C9952CE0F72E84 OKLOPOM3
126,705,868 *0CEDEEDD043D99F1088803A645E1420E35AAACEA KIPMICHEAL
126,705,869 *0CE544FADB119C4D06F27AE45E305FB10AD23275 K/J//U/CURLYHEAD'K/[@]/RL/I/
126,705,870 *0CEC41A365A5BA4EBF1378B5481BEF14BC8F25CB knald3t$
126,705,871 *0CEF7F16B8434A5D170FF33E5F5C0499CC098B9E o>< o~ 0~ qq
126,705,872 *0CEFBBAAC38AD2750BA8FA205D8D728640132BCA KNUTHAMSUN1892
126,705,873 *0CE7ECCD37CEBB27AACEE3B3745EC771B74F1391 KOMADICE3
126,705,874 *0CE5F7CFCEBBCA9F7F19E3493C5FF06D50C6D30E 」である。OPENMG
126,705,875 *0CE8FBC770210D9C26DC8A2A6711DDFC18D46A8E operation1999
126,705,876 *0CE2245F89E36F5EAEDECD286DEB00DB2778868C opraaps
126,705,877 *0CE765560218A54505A09DECAB0A8BBE05C430DC konzertfurviolineundorchesterd-durop35:iicanzonetta
126,705,878 *0CE1C1A641B0BD65784FF0BAD5922918C80F8784 [email protected]
126,705,879 *0CEB2D18D313625F0E0EEAC268700A7B6A896650 (>_<).o~.qq
126,705,880 *0CE802C0151860DD6E2D1FFD841914E1B2F7EF0A KOSOVOSVG
126,705,881 *0CEA06BA111ABDA3AA450B626FFAE8F62856AAA7 KRAIG.GARINGER
126,705,882 *0CE12D0B660D2027C18B9EE4882C75E28BEC91B1 ORVILLE.GROSZ
126,705,883 *0CE2AB191E0F36F5B8D2187134CE034861FC0AF5 OSWALDOBHATT
126,705,884 *0CE03E50FB5B31FBF07841BACD331E4A8F40B23F OTTO.VANSCOTER
126,705,885 *0CE64D717EF60D5E98341BBFB0E3543075324570 [email protected]
126,705,886 *0CE39F5B5F758C949D3D65F7929DD8818E57FF95 KVASIFÖRENINGSKULTUR
126,705,887 *0CE8F6A7FE2047857B8A22798EE9F404C893D03D OVERSPEEDINESSS
126,705,888 *0CEAA6E6845BE95ECD6EC5BECB05AE568CC52F92 KYLEIGHBOYD
126,705,889 *0CED66CF83B8E916DDF21828C6B4BABEBEBD6541 KYM.MACLEOD
126,705,890 *0CE5ACDC36E8EF7D4191C169502F993E4A7566D3 oystergannet
126,705,891 *0CEA1EC1281117ACC733659BE4B8A46DD77F67B9 l3af!3$7
126,705,892 *0CE68A96773F69C8E7365189357C38F97C347ED2 l4rv!c!d3
126,705,893 *0CEAC911E3FFE4AD6ABCE6EC342B86DCFBFB350E LAERTIUS141
126,705,894 *0CEA0ACD66A33527BE9D79694699B0DF9DE72635 [email protected]
126,705,895 *0CE4E0E34990BD8242DCDA2757054071197AB134 lamarnishiyama
126,705,896 *0CEEDCD120BDC4C48E221378B55D5A5DDBC1BAA1 LASTROMANCED
126,705,897 *0CE122A8B0DD8DF88D4C801A719B7F8CF3AA605A pamiline7
126,705,898 *0CEE80D4208B9F122F09E920D4A777601E2BA443 pam.owens
126,705,899 *0CE32FBDFC76860203CBEDD4538BC5D2C0AA6C61 [email protected]
126,705,900 *0CEAC4F72AF7A481334FD6A7723E19AD2AF06CFC “PAR
126,705,901 *0CED407ED3A190A38B102E980A96461508DBA0E0 LAWRENCE.RAMSEUR
126,705,902 *0CECECCB48FF4069595C7056AC8FFE0EC302AE3E lazaronalbandian
126,705,903 *0CE2526ECD99D2CE8113E70CD8EE3ECEE5844282 paschesing
126,705,904 *0CEF4EE278DE1105C3BD49D1CEBE6B7817A92321 PASQUALE.STREGE
126,705,905 *0CE048DEF510D5A10EB2C181D45EF5D199659610 passion-(original-radio-edit)
126,705,906 *0CEB0952F7B8DB96380EA476367AB778922D84C3 patentor
126,705,907 *0CEE9A912830C3DD48C199E494E8F084D53FA88A pathless
126,705,908 *0CE0DC21DD8C7D0AE478A19E7DFD6D1F3EF6EADD LEAPINGLY1
126,705,909 *0CE226A405BBDF7334698CCDFDFADBC766964B90 lear:.part.i,.ii.."was.steht.ihr.da.und.glotzt?"
126,705,910 *0CE0B7FBA80E750F77E8A7942208CB3904A96F51 LEGACYPROJECT
126,705,911 *0CED04C55CD3C7DD59FB070C20F653E9E5944713 P---B ~O ~O(>_0)
126,705,912 *0CE4358448FE2FE5BF67B735D1BE023C882C1DA1 P####D~0-~O->-<
126,705,913 *0CEEAAD48FADDF51686247CBB2FB0E3C4D75E730 leroybarbour
126,705,914 *0CE041A840481B37F4F9B3840F6FF46D438D6705 [email protected]
126,705,915 *0CE790F93E8429921BA629AFA94F1DE706457C31 LEWISSTINE
126,705,916 *0CE9FC9091D79C8BC0572D5ED5B4C986B5859E9B li83ra+3$
126,705,917 *0CE0E6B8077B31DDE192D2F044D51731C7121160 liangjerryu[email protected]
126,705,918 *0CE74D467A2D71D1E57FE3E7FAB2A9E7BD0F34B2 LIEBLINGSBESCHÄSAGUNG
126,705,919 *0CEFC80CF5EBF0947FA7137734E2E6925E1FA517 PHESIER4
126,705,920 *0CE80151A3B1EAB788603771ED581CA594FFEB20 LIGHTNOBBYS
126,705,921 *0CE2996D6194CE5650CAAEEFA452339BE7EB4420 PHTGRMM3
126,705,922 *0CE35D9B9B9C0F6B683F2D37939DB0B86D4FA658 pianeczki
126,705,923 *0CEE0A73CC4BFC3344A726FB5B6C9A4635677182 PIANOTRIOINFMINOR,HOBXV:F1:IIIFINALE:ALLEGRO
126,705,924 *0CED2494634FA11E0393E51BA1F036E3B9E30818 PIKTYBIŠKAIS
126,705,925 *0CE1D9BD1D4A29E945C9EFA86EB6E9708AD9D00D linwoodkissane
126,705,926 *0CE5A57289D057145505F1C868ABE1BD92806FB6 liny-yap
126,705,927 *0CE5A8DFE498DE1AC4C90214C990A8272C524AA8 LISÄPERUSTELUJEN
126,705,928 *0CE528088F6B0E1EBD645F0F09294958E22BB62A PJULIAN3
126,705,929 *0CE093D2B2623C2093EB1D7733118F1C36FCC6E1 [email protected]$
126,705,930 *0CEA357F62FE7E9B4C610DFDFCE2A40D2A42CFCF PLANKSES0
126,705,931 *0CECB8A32D94DF76E520F233FCA0ACBDB27B7C75 LON.NATALIE
126,705,932 *0CEFDCA34015F04C3CA336EE38F1DBE08240A0D0 LONNYHEADLEY
126,705,933 *0CE64303A61F684143129DE7607261FF076CD7E2 p#####>-~o-~o-(>-<)
126,705,934 *0CE763ED471073438C94C5AFDB9F538D6C2E8959 p----) ~o ~o 3b<-
126,705,935 *0CE67A8A50498E291F5953848CAB385514CACE22 POONAM.BHASKAR
126,705,936 *0CE04085C92BB32BE4C3CB28AE17873B12D803DE LOUIEKENNEMUTH
126,705,937 *0CE1F143B3FC9AA5334B2D7A2D16F3EF797CFFBD LOVE-ME-TENDER-/-WITCHCRAFT-(FEAT.-ELVIS-PRESLEY)
126,705,938 *0CE806225AA8F90E8FE7233C26734F149162887E p######p~o.(o_-)
126,705,939 *0CED0B9B6180E655CF4E2F7EEF090F769118FEBF [email protected]
126,705,940 *0CEF36D79D8A25AD4E6752C75FB5055B158946E1 PRAC+ICABILI+I3S
126,705,941 *0CEF14B7A276FD565D54950DF35FBBA73E1B55E9 PreludeandQuadrupleFugue,Op128forOrchestra
126,705,942 *0CEAFA8317B193680204199DEA65B9F03E28AB93 PRENAPNE6
126,705,943 *0CEBCFA75CA0B6F2D8B630AF6A885CABED583F08 presecondary
126,705,944 *0CE1FB36725D517776B4966463E8E7CDE9F75D44 prettyko
126,705,945 *0CE29BDBC76996B435E672952BB8FAFBA1BE8D1B PRGNNTLY4
126,705,946 *0CECACB06C5BB6D26A4F3D7923FE7052BC0984D4 PRIVACIT5
126,705,947 *0CEE0C4F5ABAC882695B6307FA612700B169A0FF PROJEVLI
126,705,948 *0CE4BDDFD703C6E76F6B7B305596A71EF70F1875 PROUDTODAIRY.NING.COM
126,705,949 *0CEBB3B1E7FA44DB09EF2C745AAA5120DCB8CEBE LYNDON.KIVI
126,705,950 *0CE2C705532FFDFF1C0A32F00D97A3952D7FFA0E P======)~~~SPLAT
126,705,951 *0CE2E5805F871DE500391F08BC865241147BF95F [email protected]
126,705,952 *0CE497B92566869174507F2006D26539F4EB28A1 [email protected]
126,705,953 *0CE7F4A8D2A0E9C287C572D23F0709750FE76B8D magn3t k3
126,705,954 *0CE11EF726989D4DEC6FF148EDE5C4A1417964E8 mahdmi
126,705,955 *0CEB9A20D6C9E352D9052D919224F0DF27DC6D30 MAINSAIL
126,705,956 *0CEF0A32C16779744675F2C9366CAAFA190BA85A MAJIESHU
126,705,957 *0CE3DCE87E7BCEBF4574D09A64AC365296C05C5C MALIK.BURGEES
126,705,958 *0CE2578E7CC0C0CEA72DDDC2DC19C9827FAF0AD3 (>_<)~-~-~q======p
126,705,959 *0CE2F9BE78F87E3638766211C893CFC2FA94D3F5 QP4AA
126,705,960 *0CE1E6CB392DE49D000951D9BD22EA679927A9DE QUASI-CREDITOR
126,705,961 *0CE387C7C8F25639543934B33B4898CDA31C5E73 QUE-NOS-QUITEN-LO-BAILAO
126,705,962 *0CE595F558768ADD7100E7E04FD2C428A0BCD7B8 quentin-hall
126,705,963 *0CEB62504EA7CDF909BE3FDFB999A2114A1FCACB MARC.FUERTE
126,705,964 *0CEA913C99BF079868060D0BC8FC74F6546F48DB marcus-chiu
126,705,965 *0CE45222DC7E546E6585008C1EE095D250FCB57A R0CK13
126,705,966 *0CE2F7B3E0E914B110DBA181D181CD1BC580C84B MARGARITO.BAER
126,705,967 *0CEBAF58C9048C4B7DC03D2B82F34B65D30071AE MARGARITO.PRIDMORE
126,705,968 *0CEAD86A97E5B284A3B89CF45A44E7CDA15F050C mariachan
126,705,969 *0CE4454CAC9D760487EE65756C5635F8680CC1BF [email protected]@CH3$
126,705,970 *0CE5973CB0C3F1BE195795E317BAC1E9DDF0B4D6 MARK.HANNY
126,705,971 *0CED8D8FCDDA49F6B2CDDABF7B147A662157136B MARKOVI
126,705,972 *0CE83036FEF610C11C8E76B41B3ED734CD6778B5 RAFAEL.SINGH
126,705,973 *0CEB3FD50C1CBA82A4B848BD9FAF8CF65246463D raivosased
126,705,974 *0CEBA8F25A2ABCA1B181ADE867D721BE0276CC35 RALPHASUNCION
126,705,975 *0CE0F54E32C9B61884D2A3CE52BC44971E6992AD RAMPB-SONG-STUB
126,705,976 *0CE2D12ABAEC36FA61C7162621BBC6861729E8AB martinhild
126,705,977 *0CE4A1320D30990A1439BD6CE515327FC9BA930B randybrodsho
126,705,978 *0CE39D14DFB0B83E40ADC154D1E318318E1784B0 +RANS!S+0R!Z3D
126,705,979 *0CEA842D39BD3E23B2638381618DF6E7C36833F0 MASSIERA2
126,705,980 *0CE9D839A1F6A6DB0BEB88256839CE016FD291AA master-constable
126,705,981 *0CE384BF708840A51050891DC3AFC365513CDF9D MATRISEMS
126,705,982 *0CEF6B147715FDAF674E64F65EB8198C360A1ECB MATTCHIV
126,705,983 *0CE9882E3326F88B0B80520149201B1A0D71D99D matthewstayrook
126,705,984 *0CEF758CE9903B9A4AE109E7DADD44FA8F19E102 RAYMONDBENDERS
126,705,985 *0CE280ECA3B96C2E7A8D200213335F260324732A mattsmail
126,705,986 *0CE838988AFAC6E5B2E1756C0558DB57A3302FAD MAURICERIVADULLA
126,705,987 *0CEE5DA9FF400B96307E633FDD723CFD2B8EEC1F @RAZZZZZ
126,705,988 *0CEAB3E290C4A06CE5EA55F74191035860FB5AF3 [email protected]
126,705,989 *0CE178FEB23CE33F8F73A8F253D5AA6934A0E4C4 [email protected]
126,705,990 *0CE5E31F5F01285CCAB5107FA55D0D57A5B83166 REDHIVE2
126,705,991 *0CE41934A1529CC04530C3EA755EEDF9EA65DF2D REED.BONANNO
126,705,992 *0CE3D27AE0816C93F7DFFB8C0189813A1C64C27E medelstarke
126,705,993 *0CE8A86F375C408AE172204ABBCC95A3AB92467C [email protected]
126,705,994 *0CEAE2619C5C4BBFDCD4CE71A9B5009F0401EE18 REGULO7
126,705,995 *0CEA1A13B7DE7BDA9C1506F0C511F00C852F1D7E rehman.mukhtar
126,705,996 *0CEAD9DE1A0948C95EADF3CF1C08EB24BC7B666B MEMRBSW5
126,705,997 *0CEDC31E100CB463FFA851EF5279B0A5B943B9C1 meniscal0
126,705,998 *0CE76511380F68AC28EAD30F33924469626A7A87 REINALDOREDSHAW
126,705,999 *0CECF5F070F3E461100F5AD9482792B9ED548442 REKLAMEUNIVERSET
126,706,000 *0CE83FE3B30FEDDC212E46A77C9998497F1EE54B relssab6
126,706,001 *0CE8DB7128170CFDD06E349F624A20F2F9A6443F RENA MCQUEEN
126,706,002 *0CE6D5BA9E1814579FDA89652D013FAC34B74877 RENELLEW
126,706,003 *0CE8FFDBB844298B0F8A984A14DAD407146C880C MEXBHYD0
126,706,004 *0CE1A2F0699148D43908508BC28A473935213759 RENEURG1
126,706,005 *0CE773FD127A56E0C1E7CC3363E74F98B3583CCD [email protected]
126,706,006 *0CE89F4B4B3254229DE06FFFDD46815D5DC67B74 $repeats-=-5;
126,706,007 *0CE3BEE2971E125BBC8BE8E6AA450B55BF756063 REPEINTESING
126,706,008 *0CEDC7C0DCFA84E9BF58069B8BDC4E2B6CE0E50C rescontreren
126,706,009 *0CEA2C96165E09F3567DDDA23DE88CBD5030B5F7 MIDFIELD
126,706,010 *0CEAE74EF90A33A27917B7B79BBB460C525A33E9 MIGHTYMOOSE22
126,706,011 *0CED2245C3E44EF019483117B73FDF3332CCA4EB REVENIRBSWED
126,706,012 *0CE9AB0028CD6F52090F4C3F23C03A9C0A885BFD [email protected]
126,706,013 *0CEC684B3BAD3F5D8FE66E31817EBBAB18E9FD45 MILJVERNLOVANE
126,706,014 *0CE91337B1E343809FE34DAB53901B9CDFC617EF RHUTRI
126,706,015 *0CE49BE4195648615656D197CC1BCB3788C9CF15 RICH.REMSBERG
126,706,016 *0CE11FEAE13EACC18BB6E08079AC84C826A9F8C1 MISHAWAKA?
126,706,017 *0CEB9E4816D34141ACB74DD860651F71BCDE3A73 ride wit us (feat. erick sermon, redman & too short)
126,706,018 *0CE2722346CCAF3A26E68AB494FFECD976AC3B76 RIGOBERTOFRINGS
126,706,019 *0CE196376FBABC632CC093C48BB813BE8FD9A127 ritnaned7
126,706,020 *0CE5DE2144910355300A22F0DACB95BA9446E720 MOHAMEDDEKEYSER
126,706,021 *0CE7649859D6FC4903C7997413B723A3872BA23F MOISESJACONSKI
126,706,022 *0CE8ABA021591CE9776A876DA34A92306DFF687F mokienė
126,706,023 *0CEC070788A09F56B33976E9D089F9897938830C rnsson-&-Konfirmanderna
126,706,024 *0CE011D758691A1254FF1B108F333DCCA91DFD53 mordisques
126,706,025 *0CE8B8C37025A5C114332D1F9D8C34B8ACEE2B41 rodrigosaxon
126,706,026 *0CEE4848CABAFCAF3BF383D5859F13DB8D23D6D5 mp>4#
126,706,027 *0CE5DB4529DAD182A1D6DB4AD8A3BA261E427BEA ROLANDOKIN
126,706,028 *0CEE60965233FA8ECAA95AFBA60539BA4FF5A5D8 MQMC
126,706,029 *0CE6B03C51CB7EBFBE01023D0270F5746EF5345B MRAMAHALI
126,706,030 *0CE1D7CEDF977B460DE50DC01702CC64E19C68CB rollandcrea
126,706,031 *0CEC49009B6BC1D90611E8C3C97F8631C9E9D4E0 ROLLASEN1
126,706,032 *0CE766037916F0B68B5679E81E4AFA7C1A26E227 ROMANTICCALLAS(DISC2)
126,706,033 *0CE5AEB84D980D8D9168AF409F22A93D0F7C408F Romeo-and-Juliet-Op-64:-Romeo-at-Juliet's-Tomb-(Suite-2,-No-7)
126,706,034 *0CEC8B2DE7D91E98F2CEEE781A8FD65820717B13 [email protected][email protected]!0ns
126,706,035 *0CEA597C44918BEDF4A5B8F811484D4F2DC989EA ROMMELBENOSA
126,706,036 *0CED073E30B3F37073D58568C82826487607BB8A ron.genaw
126,706,037 *0CE2AEB5263AD3017D79886A6B4E3BF309C9A20E ronheider
126,706,038 *0CE8D5F2AE8ABDAD0391C22B2EBC304DBD428821 RONNYTIDMORE
126,706,039 *0CE63114E3EA71A988D162CAA02BB033CD9779F8 mu$ica-me
126,706,040 *0CEB1A3C9E0EFB28434573316D0D0FB9D0031EFF mu^j
126,706,041 *0CE0793E32B249DB8F36AC8F939740557B5B777A ROPRIIEZ9
126,706,042 *0CE7073A39B6DD66A50234C0D12ACA056BAB261A RORYRIOUX
126,706,043 *0CEA3D6956B4857DCBCA4FE27311BB14DAE16CB7 rosariohembrey
126,706,044 *0CEC5B04F68A8DC6E6CFB9BF0432319407288E0A rossmcchain
126,706,045 *0CEA5B29FDA7F962A66FE10C80D51C33B1AE0444 ROTHERHAM160
126,706,046 *0CEB6446F74EF5ED219C6EAB3EFBD1C1DFDEF15C MYDEEZNUTS07
126,706,047 *0CE784CCC60CE9761AE09AE19581675C0320C0BF mynameisnotsusan(theupbeatcutmixedit)
126,706,048 *0CE7F42F1C4345B5E08E01C7C2CD0EEA87660A21 MYNM
126,706,049 *0CECD3901F6F123DE0C9DF407B133A3BA7A10876 RTCELEID6
126,706,050 *0CEA566CAA5296113FC8A505FF7567E04DFC0BD5 rthmmncy3
126,706,051 *0CE27F4F50CEEB4F9A133D1714BD6E46A2977159 RUDY.KARAM
126,706,052 *0CE98854E954A3CE702D41A5F3731B8829441624 N<7%
126,706,053 *0CEB02A304B9E8B065DB4AF8588AF88EEF8FA02F [email protected]
126,706,054 *0CE27AC67A19AAA7D59E931342CED0604A9230B8 NAGYREPA
126,706,055 *0CE1899C2863751CD1BD30B21AC287CA7B19D13F NAITABDALLAH
126,706,056 *0CE4DA26C5E9DEF9FFF42132E1756048A7FC1406 RUSSSCHATZLE
126,706,057 *0CE90A4EC95143FD5A376B53CE5821D76D95990C nannahaj9
126,706,058 *0CEE18792B62ED93291AC8BAA3026F1A0F8EC136 nanorails
126,706,059 *0CE2994CF18B7A58FF23BA93F0D64188F49FD71D ryanbelitz
126,706,060 *0CE0361CAF6A4B979A2F147559F8363AF3724916 RYAN.GERBER
126,706,061 *0CE3EAFE063D86678826564BF37E27421BA25984 RYOUHOU5
126,706,062 *0CEF4CD1A09CA88EBB6B3D41367819E61A1F6B79 NATHANIALDONATI
126,706,063 *0CEC644ECF7809580C28890B434955F20EAA1EB2 [email protected]
126,706,064 *0CE12DBD5509AA0C7E87EABF11E1E5528E143C75 navin.nambiar
126,706,065 *0CED082D81AC7FEE4D1F52645B3F8248780EC2EB saeaestetaeaen
126,706,066 *0CEC134E5B3B29842D6F7AD7CBDF36931B677BD9 SAGORIJEVASTE1
126,706,067 *0CE9521ACF5BD17251EFCF3BA52E0F2577635163 sales[email protected],
126,706,068 *0CE298C28D79C81F3116E694008F3AA5EFB1C0E2 .NEEF
126,706,069 *0CE445C18C64A0DD64E57DBE94D10ED536173598 NEKATSIMED
126,706,070 *0CEFE34AB7DD670C065BEB2DA7F49270A910C9DC same-kind-of-scum
126,706,071 *0CEA936DCD5310D56855CF9185BF397CAF9095CE sanela-bektic
126,706,072 *0CE5C20758CBE4B8AA00A35D0520F361DB7459AE nfjihdm8
126,706,073 *0CEC7B41E244E1A6FE499157BA85D082B8DB96B8 nfmcycfx
126,706,074 *0CED1F0148D36B035F0AC68309FF41BBDE220316 santiagoaloan
126,706,075 *0CEB1C916DFDA45992569625F84D002134185C82 santobrasfield
126,706,076 *0CE072992F602EA992282C26C25F85D1A8F367D6 sarraux0
126,706,077 *0CEFC9D47BFB3893BE2F541E5FCB4E8ED1624F4A NICOLAS.PETRECCA
126,706,078 *0CEA11777C106A20550CEB0793278AE682351FA1 schadenf3
126,706,079 *0CE99E2002299B06775CDA2568DE8FA677942DCE schuechtermann-klinik
126,706,080 *0CE0B01AAF420078C35C00D0D34C8219E66FADBB SCOUTOTS
126,706,081 *0CEC24DFD472882B516E18D5A710F6F7B3DDA4DC NOTSLAR
126,706,082 *0CE39A97735D66D81C0D0EF142C02A7354B2C812 NOUELI-LIK
126,706,083 *0CEA20A9A11B440AF74A2D210991E4BE172C1AFD Now-You-Want-Me
126,706,084 *0CEA60A160082058F4C2E7AE335B2F01F5406829 secondlegal
126,706,085 *0CE46BC1411051C742133F807A2A539697F7E640 nsiappstartup
126,706,086 *0CE05D5BEBF7666FE9D81D82482AAAD39FF2A42F nunhood
126,706,087 *0CE1C019993C7F59348A5FC1691AA4D6A48E54DC semerdzhiew
126,706,088 *0CEB63800138ADA65AA3F4E235F8F56619953533 O2>/
126,706,089 *0CE10DA41F4D5560D3A92B82E524C12EC27FB586 SEOLAFFU9
126,706,090 *0CED15CA09D691776BA8C61590A37D1D56580DFB O4`5
126,706,091 *0CEEEF4F1E9000A6E0B09FCB45E6F78D907C1580 SESESIDNARGNE
126,706,092 *0CE5163BE5B95146EECDDFCBE7CB6E18B1E0E60C Setthysealmanualonmywaxredlips
126,706,093 *0CEA3C683242776443EC3DE5CCE88C24DD47620B OBSTRUIRONOS
126,706,094 *0CEEDD6C222FC6CFC175D7A3A9B3A1A4CA6AAAD0 SEXUALRACIALS
126,706,095 *0CEB6B8F047A5BC039E53535C8D6EB6C43D13B4B SEXYBOYY93
126,706,096 *0CECAE6E515B405F4429593B2CC9879B0429498E OCTAVIO.ONSTOTT
126,706,097 *0CE3C22FC193EF86ABC674AC9A4808A9881196E1 octaviowheeles
126,706,098 *0CECE6940EE9D238D22FA66642AD1470F4233E3A oep?
126,706,099 *0CED43520634457271B40494CC2807C73F1F222B shaneabrecht
126,706,100 *0CEC3082A96EF4158E57C8EF85C5E1C8BB8E9EF9 OIRAPPIH
126,706,101 *0CE1D6F4B4767B4A36CB90BC614264C63B8BF293 [email protected]
126,706,102 *0CEDA1CDE1CD5A9C71AF6E330D71DBEB25FF656C shaynelato
126,706,103 *0CEE70AD51AE64B280AC291BB3FA9990D3261536 SHELBYBOMPANE
126,706,104 *0CE777A6102CB0CAA399A45A7FCD6E0E2952F6A9 shemekaward
126,706,105 *0CE8C38A24AA45885A4EDDF9A0B3CBB701A604DF SHERMANGOODMANSON
126,706,106 *0CE096DD6B582A184581CA59AD0567AE89CA5272 OMPHACOMERIA
126,706,107 *0CE2A2B4BD37DF80C1EDBF0109D7FF9753E8F1BF SHIRLEYSTOCK
126,706,108 *0CE64FB6C499E00ED162522202291AD6ADCCB612 on23
126,706,109 *0CEB60EF8864A4A1AB951560D398FD9DCE37808C oniorchestra
126,706,110 *0CE17906C49C92F7AE49D0597117C4B582866681 [email protected]
126,706,111 *0CE96042E008101C50527C03B4462DE5F0EF5BFB SINATRA35
126,706,112 *0CEAEB8AE7A61871FF9AF66CFFEA5C4713705C69 SINEANDSQUAREWAVESPOTFREQUENCIES:5KHZ
126,706,113 *0CEDEC0FFC83AFFDD727DC4B6C11D3990C09483A SINFONIA-IN-C-MAJOR:-ALLEGRO
126,706,114 *0CE496D6F140108185145B3BF26074F875CBCBD2 OR...LOGIN
126,706,115 *0CE0914E8D17120F9F5251CCB8CF08CA85CFDC0F ORRIN-HENDERSON
126,706,116 *0CE4B8A5D64AAC4B25645E3C2EBED1C1CD117C9C [email protected]
126,706,117 *0CEA097108A787CA20E548FEC0BC3B4FC85BC98D SJ0000
126,706,118 *0CED77510C2FFCBCBBC7AF6542793DC1C851B432 S=L\
126,706,119 *0CED468598D44B9D6827C5341507FBCE33F1FFA9 OV3RANALYZ3S
126,706,120 *0CE0ED6E9F082C3D2EA6DE823FF0B2E3DC8459D8 owocowocowoc1
126,706,121 *0CE167F0EE908D3AF503467D13162C09C6297104 O$WR
126,706,122 *0CEDFE5CD8C79E82CFC2A554DE22F8136F075C7E >-<.~.~(===p
126,706,123 *0CE39E6B4428E702852934E19C32BBB889E08864 [email protected]~0~O-(~_^)
126,706,124 *0CE6F4DDEE08FE2F596447666A68BAD62580445E SnapIt(feat.AButta)(clean)
126,706,125 *0CE12A9CBD22E7B992AA9C8C9F54CD6BFD0EB011 PAANASEN7
126,706,126 *0CECA1A237C6FF1F940A516E623FB762CB96AC4D PABLO.EGGERT
126,706,127 *0CEA3253EF9058C72387870EDDA255E43CE7B306 snorelate
126,706,128 *0CE0C4EEE19767411E3457B97E813D8F06A4D622 pamela.walley
126,706,129 *0CE12FDE3592C75AB46961AD153A50195A767997 [email protected]
126,706,130 *0CECFD3EDB4A3A5F93824E21FDFA9EB158139E5E PARTERRE9
126,706,131 *0CE23F9A9D7791D2FA23D9DADABBD0636C238C65 SOMABRINGER
126,706,132 *0CEC223190AFCF5F47464F34C30D5DAF55AE91E2 patentor
126,706,133 *0CEE9A912830C3DD48C199E494E8F084D53FA88A SONBERTMAN
126,706,134 *0CE6EEE860123C4B55A9EC5CC4EB97A2B4387FB5 pauschalgeb
126,706,135 *0CE36BB57D43F9F6033122C1C12EBE65C3D91992 p#####b`(>_0)
126,706,136 *0CE0535BE8D73521E625AABC05146E9815672818 [email protected]
126,706,137 *0CE74AA9C6574054FACABA5EA28A734929B78ED2 PB ~ ~ }O{
126,706,138 *0CE609F0F59058CF4F75B9AE661D9FF8FE0E535B p#####d-~o-uu
126,706,139 *0CEE66FA9178542997DB3797AD0FD98C529471CF [email protected]
126,706,140 *0CE96C6263C22F5DCE62F259F33027CB95E2B129 SPARROWIESING
126,706,141 *0CE0B70190963EBABF1347A00E6142ED0EE79C4B [email protected]
126,706,142 *0CE5801DE1601C377E4D4C5780EEAAA7356F2638 PENTAGRAM-666
126,706,143 *0CEFC7F27759BFAF4A3A2284C4872DAD31AFC81B PEOPLE.HERE
126,706,144 *0CEF164D95655C9C94E1163D2EC4F5A391DA163E spielwarenhandels
126,706,145 *0CE9635FB1448C46D07D22CAD84AC0F4C861E9E0 SPLAT0~Q#####3
126,706,146 *0CED209D5B9B8460D07D1437989AB30C54CB899D splat~ ~<===3
126,706,147 *0CE45D536EB2E29B79746E6DD4670BE929C7AFD4 Splat!**<B
126,706,148 *0CE8673A31C5F3C4770B659A5EA644AEF944B9A2 splat.`d------b
126,706,149 *0CE7155CDE3CF972B21B7653F5B23216C66516AE PFUNDFOLIOJUN
126,706,150 *0CEB532627CE4E7BCD53D35B31452B9BCFEE5AC1 PHILLIPRUNYAN
126,706,151 *0CEF0E751138B4D67EC8DF0CEE18C519C3CAC56A SPLAT~`~`<=P
126,706,152 *0CE90CFE653C865C98812030C9AAE239ABFBCF1A PHOSPHORYLATION-DEPE
126,706,153 *0CEA4409A49DD69F43E21D39F67400416DDEDEC9 phuturistic-bluez
126,706,154 *0CE7893BC927AFD0031AB4E6394A5407363C086A squab_broiler.skw/a/b_br//oi//l/@/r
126,706,155 *0CEAD2DBB14F90E407A21707A4CCC95FC6B9D502 SSENENOD.
126,706,156 *0CEF48C8B3502A490E3598116B6875CF52DFB6F0 [email protected]
126,706,157 *0CE270C30B698495AF5B9FCDE0795092A6139484 STANTON.OCEJO
126,706,158 *0CEED5FB3CE273772CDD30ED0ECD99FA6D26E132 PLUSR
126,706,159 *0CEEE5B11912ACC00B45F91FBC1E7271584AD52F STARORBORB4
126,706,160 *0CE93C2F24E1A3B4DF9C533BA36BDEA1F9951068 pnspttr7
126,706,161 *0CED493A1FE52DE88D5305C24A4A3BCC08BA2DAE STBMOELLRING
126,706,162 *0CED17A99E1CFE5F07126BBEDC88F6D6BC7D61E9 STEPHEN.RAYNE
126,706,163 *0CEDFB36D9C0CD774A87AFADBD7F441ADE590222 :p.o~.o~<q
126,706,164 *0CE803191C4E66336FD130564BD1473AB8FC9256 STERREHOEKMETER
126,706,165 *0CE467CBD9523A28AD1A211DA4234017545E5AC1 steveforgy
126,706,166 *0CE19CD5C0BD0C4DB965E70010A7C51ADD51239B PORFIRIOSCHNOKE
126,706,167 *0CE332E19D98E6A4D8305862133ED25933010BA4 PORIJEKLO2
126,706,168 *0CE72ABB9E8FCB5B98AA5DDD9D6D914953E4208A POWER.AND.DOMINATION
126,706,169 *0CE411A203A7F13CF5210C08CBDFBE1E7C0C0A21 [email protected]
126,706,170 *0CE8835CCF94C4D797DC18B6EE9BE2C3A81E2232 p====p`~`~(_0)
126,706,171 *0CE75174B22DB7809DDB99B540BF0B88BA7C14C3 STRAWBERENTER1
126,706,172 *0CEB3E5F9359E5CAE5AC984B8DA9A7FA309428E0 STREET RECORDS
126,706,173 *0CEA71FA6D506359A616DF96ADBB00F728D04621 pr49m4+!c41
126,706,174 *0CE892F52A88C7E01D3777294C844FB31CA4A9CC PRAY SILENCE
126,706,175 *0CED573B54D56EB9AC578AA6DEE10BDEA154741E preciousmemories(feat.dickiebishop)
126,706,176 *0CECF536BBCDBC41C32156A8AAB698BB8E53CDAA STYNGETH2
126,706,177 *0CE8A2505A6826BBE30C009C34BBE334A70DA04C prelude and fugue in c major, bwv 531: prelude
126,706,178 *0CEB0B041D95C184578066EBFCBC5E13C959B0A1 PRIMABALLERINAER
126,706,179 *0CE976F6DE47EE5507972693767F41DCAB1F2C98 PRIZNALI0
126,706,180 *0CE9E904AF73C20B427C0975B26909989BE68FDD prjdclnss
126,706,181 *0CE3E90CA90A9F7414C0FC8CC06C6BDE86AE196F [email protected]
126,706,182 *0CEC434CDC396C8A814EDF5910FB5A0387CB47FC PROSTATITISCHRONIC
126,706,183 *0CE3F0D745410A56C2E6A31B06E979A44F7BD298 SURO54
126,706,184 *0CE3214DA577947525CA510EB29B14F5F8F98EF5 PUBLISHING)P50
126,706,185 *0CE802CDD2CE9982D8B8E4EC14D3C60E719682CB SUZIE SQUIRES
126,706,186 *0CEA0BAB0641FF936811967C932665AF2A3E2526 SVENTOLATE
126,706,187 *0CE20E1A19870227DA6A79665816D0195E60CF75 s-xc
126,706,188 *0CE860AC71EA20A484F346B05AE3EA38D24E9A5C PURPLEMAPLE
126,706,189 *0CE7C87F1D0BCF5A8A0357CCE9FD2B308DC9930E pusherman-(spy-vip-remix)
126,706,190 *0CED3218E408B259E6D1EB319AB335DF9FB52DD4 p>* * (x)
126,706,191 *0CECB976A2905EFC32EC12C08C7719B280C55CF2 PYTHONSPARROW
126,706,192 *0CE9817CBD6D630974727E682E080AE9D6F263A8 Q#D`-(0_<)
126,706,193 *0CE6E799BC48F394F49FF94000AFEAB22D02F5EC [email protected]
126,706,194 *0CE8527F4F6862E341D83417036B180E2CFC5E37 [email protected]
126,706,195 *0CE7262FCDA4B0D58A6732A0983441A06A9E8313 TALK9019863214
126,706,196 *0CECD7362448E0DE10BA9136B681FFF8DDEC94C7 [email protected]~O(>_<)
126,706,197 *0CE18F631D14AB762B1794B6007FC2CCF4771D0C TALKKEGAN13
126,706,198 *0CEBC8BCD47D339638A864124C4776C83A4BA8B3 q=====p-~0~o}O{
126,706,199 *0CE1764FC6CBCAB1769027CD3CCB30C06D606C30 TALLAKSRING
126,706,200 *0CE08FB46ED40B44061EF4352ABD89A610241E88 [email protected]
126,706,201 *0CEFFCF8EE77D761A737620D2C89B3FC2A60D3A5 [email protected]
126,706,202 *0CEE7B29B058584657587884DAC4030E8B78CC62 QUASIREC
126,706,203 *0CE71D106BE2DB7010E60EC4A265AB897A00C42A quasiseparatists
126,706,204 *0CE41EA8BB2BD458913013C6602E690A2AC7ED76 TANGWALL
126,706,205 *0CEA45E443DD2AC312FAE77708C99FD15BDAF6C4 qwertpamela
126,706,206 *0CE4CA5BF9D1D14EAFA1022C3E23FBEF319610B1 TARTINGE2
126,706,207 *0CE07AF5F90A734B6CE114CC23BB7C5E2795CB99 R3JUV3NIS3D
126,706,208 *0CEE109F031F53E9CDACFAD10EDC389B88801F6B [email protected]
126,706,209 *0CE90304CA64D5F9447AF47ADCE0C0FD5FCE58C0 radikalhardcoreversion10
126,706,210 *0CEB59B106CA17C6D58A64C1600CF7E2B701E189 tejavel
126,706,211 *0CE8B2743CF90B77738730FAE7957086C5DDF411 TEODOROBEACHAMP
126,706,212 *0CE321ECFFA9CD5224FEBBB144AC3A33146494AF TEODORO.TROHA
126,706,213 *0CE2B985D219A095EAD457DF3C33F186551BEECF RALUCARAUTU
126,706,214 *0CE1717034BF6D76248E8E7F8CCD83B813BECBE7 RAMIROUNTALAN
126,706,215 *0CEAB5B4AA29E7ADEFDF2554539E072BF59B4551 ramonjacquez
126,706,216 *0CEC538340DDC505B1E3576B1DD6AB22089D98CE TERRENCEKURTENBACH
126,706,217 *0CED94FE0ED987BD9CBD60445438FDA1CF1AA379 RANDEVÚIG
126,706,218 *0CED40E030CB0AB95ED2E4B9EEF3C4CD835870B7 RAYMONDHIGLEY
126,706,219 *0CEEAF9D3123F5DA96BC9F941FDDE92CA02F40CD THATDRIVER17
126,706,220 *0CED11CEDE25A26EF907A53A0911BE3C5E4E630F RAZWANULB
126,706,221 *0CE8F7BE3A6ECAAA0165A0D32FEAA10E862F931F RBJDBB
126,706,222 *0CE57153F0FA5BD0948D4B4CF596E028E7673AE3 THATTHEBOSS44
126,706,223 *0CE3152178FDE31028B9CF54C6ED20B3286EB716 R-DICH-NEN-BLUMENTOPF-BESTELLT
126,706,224 *0CEDA9CE49320584899000DCC428FAA43925528F THE BEST OF ACOUSTIC, VOLUME 1
126,706,225 *0CE584ECE4F108BF5D3360C1E54574AE5DD9F2E8 thebestyoueversaw
126,706,226 *0CE4DC004B9B7BC2F5B3EC7ACA15D8B7B5BE7874 THECINDY5
126,706,227 *0CE1EC9665BB59A5F8DF1255761AAC469A726AD1 THEFUZZ29
126,706,228 *0CEC8A754D01BFF80E0A17B8267FE4FC491CB0DC thegretzky2002
126,706,229 *0CE452B5B27CA09892370981FF170E4EAEC11D9B REFUGIOBENYO
126,706,230 *0CEE74456CD7EF27988E411F90FD401169CDB6AD THESPARROW50
126,706,231 *0CE9207EF253FF022A31605C5B5C0D91848E53B9 THEVILLAGECONCEPT
126,706,232 *0CED2B2C48FA9F0A37519C0934136871C90947EA thickish8
126,706,233 *0CEC2ADF1A68D841318BEF91A66882BAC54D8205 REIZSCHWELLES
126,706,234 *0CE7B1735231725D58A1C5182DF4E1CD20B524C8 THIS-IS-THE-ALF
126,706,235 *0CE077F6B708825F6C34305861A999C3310F0B17 rena-aja
126,706,236 *0CE7F9DB38D948CA9541C141E3F970754CCEC95E RENALDOERBSTEIN
126,706,237 *0CE32B0E5BEF4F2BB124AA721457A9B652B08ADB RENTABILISAIS1
126,706,238 *0CEDE897A9CA85C66438562DD47B393B8388EC1F TIARDNOPSERROCING
126,706,239 *0CEB6F2F84A6D94D3DCE0428B29D0D69636E15E1 REPRODUCIBILITY2
126,706,240 *0CEEB42EEA7186BF9B3A42B73AA978BEF53ADD90 RESORCE
126,706,241 *0CE86C04AB45456DA79E4D95D54F6323AF72AF6F retitulado
126,706,242 *0CE5A7D9C5EB47E4CCF70A39652A1CE85BD052BE retrasemos
126,706,243 *0CE69C184A85224AF59E677ED0A50FD46AFA5A7B REUTHTHED
126,706,244 *0CEE6B443044A2FE43E0D1C8F948DEFA0CEF692A tipper26
126,706,245 *0CE4738B384C1CCF7E137371BA8761F097C69F8A TITUS.KOLBER
126,706,246 *0CE455D1C3349F245F32B094133D788184BE5C3A rick-mittelstaedt
126,706,247 *0CEEC10DA2C1AEA1FAC335FCC6586523F5AEDD11 TORVORBAUTEN
126,706,248 *0CEB231352BBF763685BEAEAFFA1FF2A3F8067F5 RMELFED
126,706,249 *0CEFFAAB0B65C793DB2FA90F566B05CE5EE25491 [email protected]
126,706,250 *0CECCF48E2B3C0730856C76DDD2FC5032AE125B5 ROCKDIE123
126,706,251 *0CE4AB1D97E71105AD2910B6D6831AC52B35C35F TRANSPÒTASYON
126,706,252 *0CE81D8512BAA1E70F8FD7771A356681D6A14EFA TRAVIENAIL
126,706,253 *0CE04146578870F15B88EEBFB106EE8DD30F2793 TRAVIS.KOLTS
126,706,254 *0CEC364F5448183750E6ADDF48BC60C0D4B6F382 RODOLFO.GREIDER
126,706,255 *0CE5C0404B660B8B08A3B629E2B0C33A92FB88C7 TRICHELLE.RISINGER.CUMMINGS
126,706,256 *0CECC85DF8126A403E77A67308A91E1D9D32BF74 [email protected]
126,706,257 *0CE51B2AF34C141CDF546FB7245634679C318B43 ROMAANSKAPITTELINAUTUN2
126,706,258 *0CE38381C6F76798762DEC18E418A158DD925317 TRISTAN.HALLIO
126,706,259 *0CE20A68E98932B8CC968C08B473EF7916E36813 ronboshard
126,706,260 *0CEBCF209A1219659171AB64E47BAEE5B83A2A76 trumpet
126,706,261 *0CE3DFF218357399EC9E38A3DC2B00043484148E ROP3.RAC3
126,706,262 *0CEEA0DBE268369E731946904FFF7623D3514FBF [email protected]
126,706,263 *0CE01E5E6EF0AEA05E40C586B4520B8B94ED4867 ROSCOEPICCONE
126,706,264 *0CEADC2F36F73D83DF06AC0AE3AA627E926B16FE ROSELLIJACQUES
126,706,265 *0CE4866ED5054D0AFE8ED3D08E3BBF311D67D63D ROYCE.DAISY
126,706,266 *0CE7CDB61739BF3AA4162E3FFC8369356FEDA46C rselns
126,706,267 *0CE8AF2075925C9C2BCD2D843325C10DC0CF99E8 ruaud
126,706,268 *0CE0B915CDA43A79A8D711D91EEDE6316D30B3F8 [email protected]
126,706,269 *0CE761415DECC0C7FEDC542260E9BC26BF6A2FE3 rupertcarrasquillo
126,706,270 *0CED141BD411A20339D1A3752D91995EA08DE2D1 RYAN.CROSSON
126,706,271 *0CE498A7E45FD488B33EEC470831F5CDAA61E7AD RYAN FANE
126,706,272 *0CE86EE1A59D078945CD3FAF38F77401EFF84BE9 ryantabuk
126,706,273 *0CE64EF920EC97F518E4C8522650C2A613B19876 TYREE.MAYHEW
126,706,274 *0CEE9A18FD5408224278B60A224CB2CD85A1BA35 TYRONEMCNEILLY
126,706,275 *0CE275780ABFBAF77FA685886CE021BB77DED6AE @U10ST0M1
126,706,276 *0CE715F83B97AC3C004A5CACB520543201114279 UBUYAMA0
126,706,277 *0CE19E7513F81C8FAEDCAFAD105FF487A13439DC SAMBORGESON
126,706,278 *0CE1EACD821ED676651CE60C4F76FB4436691629 [email protected]
126,706,279 *0CE67DE7FC25121815288ABC31C14028E2BB7E16 UMLAUFBAHNPARAMETER
126,706,280 *0CE77FAF67591D63FB935B7F43DD2B7F7AD49F1A umraojaan-hakim
126,706,281 *0CE2E815F69C331D0F709A1F5D839E398EB4596C un3lap$3d
126,706,282 *0CE8799D08102A83010BD22C26936978B8AA4B47 UNDER.THE.WATCHFUL.EYE.(INSTRUMENTAL)
126,706,283 *0CE8D2C4F59D6AEA580165C5AD335B09A6A72887 UNEXCHANGEABLES3
126,706,284 *0CE8FF1A46B8DF6A4963C2BF10B68406E644F654 [email protected]
126,706,285 *0CED9326F9D0C0C64D3FC66730EE598B15A4AFC0 sashieda
126,706,286 *0CEE6F0408EEA02E536DF06612CFD3B9A605150E unqualifieding
126,706,287 *0CE13F135929C5A69E7D0BC54880F8B3F2C829DC SAUL.HALLET
126,706,288 *0CE33FA116F7F6B8F1FD36BD3CDD912A472B5FE5 SCARLATTI SONATA L.366 RE MINOR ALLEGRO
126,706,289 *0CE4AB5DA919BB44EE93AC8704F6DBEBC38806CE USE198199
126,706,290 *0CE3056608C0AF56A33C483967CE1E4B5B7578FD SCHOOL.BUS
126,706,291 *0CEFE9FEDBD2923C85A8473303FBE9357D70651D /USR/SRC/LINUX-HEADERS-2632-24-SERVER/INCLUDE/CONFIG/SONY
126,706,292 *0CEC3C6BBF779275BFDA66DF3396E9145DF81419 [email protected]
126,706,293 *0CE33ACB4485540BC1CC698681174A033BE5295E SCOMARCK3
126,706,294 *0CED95C91F53CFE55211DF769BE63AB9E34324FA utilitaied
126,706,295 *0CE6B496C24B9D6315EF8B315C3F0E87A255C3B0 SCORPIOELVISES
126,706,296 *0CE07C1167C896303DE4096B316F2FECB2FC405C SCORPIONSAMPLER3
126,706,297 *0CEAC3025FFED4388B2B950CAE910E64D75F15DC [email protected]
126,706,298 *0CE5562B2079F9E68368A261C371BFA9A4E8A59F VACUUMDARLINGDONTSUCKERS
126,706,299 *0CEC3AEFE2ACD6E8B20FDD3ED09FDAB1A7682961 VAISHALI.NIDHI
126,706,300 *0CE1277CB4E5A6B67BB98689A5DBE344809A38AF VALALSBURY
126,706,301 *0CE88B529EC99A4BA27D9F99A76D7E01471EFD91 VALARIEHALL
126,706,302 *0CE422FFBD71D2D63250848BD60C1A31D9A92D6C VALENTINE.LEATHER
126,706,303 *0CEBF274E207F085E6E5425F762E73D0F30BAA99 SEDAARAS
126,706,304 *0CE10990BCE224EE69091A23F0E73FCF2A5959DB valutereste
126,706,305 *0CE71898692099BD2EEAE4CD774A8D8D7C3F9E4E vanaja.kutti.p
126,706,306 *0CE1ADB38623B5432459D76EBB00017EB65CBA9A VARINIAARMENTA
126,706,307 *0CEC8343F42212143CE9BF9CD452405E07BE3D2F septieme-rodelia
126,706,308 *0CE3672C44BEF6B419AFF0D54F37C08C6E2F422A VECTXEBR
126,706,309 *0CE6E92080A7B54639BB6A3E287FDC1BDA713032 sergio.panarella
126,706,310 *0CE69D902486059EC43D9E34BA4BEB0242AB6640 SEROCOLITISES3
126,706,311 *0CEC84A8EEC7469082538A28A1C5CB527CB3B0B0 VERGRIJZINGOPGAVE
126,706,312 *0CE37742471D222656FD39A84FF2AA903F2EF878 VERJUICED
126,706,313 *0CEC02A71F0639C188F45A212C305ED75B50E8D0 verlina-martin
126,706,314 *0CE9783129EB9DF201A9DDE3A56BBA9002B92B85 SGFRX15N
126,706,315 *0CEF4EB0584CA0DDB2272EB19FCEAF10097B4292 sgominava
126,706,316 *0CEB430FD788727D49D44715E36F1582E251070E vertelotierenn
126,706,317 *0CE5A58F4F88654B9BB376C9B923C18D07FF7F77 shangyuan
126,706,318 *0CEB840AEA4B87EC75918901816A7217698B258A shannonfausett
126,706,319 *0CE1AA6A3CFCB275D9302DB37EC92BABB2F660B1 SHANNON.SCHLOOP
126,706,320 *0CE6D2098B21348C5842412C917A2133D8EDA0AA [email protected]
126,706,321 *0CEADAE37B36932B01F2436187E352361D9F0B5E SHAUNKNEIFEL
126,706,322 *0CEB5F52814DEB170CDCD98F12FC86E61610A5B5 sheldonpozzobon
126,706,323 *0CE69A638D270333253DC02052788AA9F84E2927 VIDYABALANWEB.COM
126,706,324 *0CEE3DB403CAF30EB461D590C8E54C10A723ABC1 VIKAS KAACHU
126,706,325 *0CEB37FEFC676E8691ECE32DFA34D3CAC4EFBFD7 SHERMANMUCKERMAN
126,706,326 *0CEE41EBE09D1FC99EC569E4C72FC6BE9E8D198C VILKKULAITTEISTO
126,706,327 *0CE98418E192242C5BD80F5AC9EAB0115D8250C8 VILLANE123
126,706,328 *0CE11DBB2DAB7564E8968430F802CA83BCA23999 VINCENZO.RAYMER
126,706,329 *0CEAE01F297EE40C3262D92091DE903B35A51BDB SHITERUKAI
126,706,330 *0CE0C630DC805707BB8181C80AC534862ECEAA35 SHUT-UP-AND-BLEED-(FEAT.-WASTE)
126,706,331 *0CEA1095C63022D3F2845C01D285A61E63A5AD2C vo1tcou1
126,706,332 *0CE97BCD2E587E1693ADFC0199920A4CA5A6EFB6 sid182korn41
126,706,333 *0CE20E9BD165FF931FF5DF42E3534942614EF0B5 VOLIGÈRENT
126,706,334 *0CEBC718D7823865AA8B0A19E27F643E4BD3FD32 siglo21xxi
126,706,335 *0CE5CC1C6057FA60638D91C7115286F80CEE0996 S+IGMA+ICA1
126,706,336 *0CE93F0F5B777476938A957F15E90FBCF7DDA340 SILAS.PERRINE
126,706,337 *0CEE0EF2B67F2836C9F2E26C94239A8A15F5FF56 SILAS.SHILO
126,706,338 *0CEF5FC8782D57688F10829A240D8705908E2276 sinzouni1
126,706,339 *0CEF6C29BCD3720043C6DDB33962FE3D8E9634AD VYBOUIL1
126,706,340 *0CE7BD2E85AE4E362B70D821C930442CE45F1989 [email protected]
126,706,341 *0CE86EECA365BEB533C882D61E01577A7275CC67 WAIYU-SOTAN
126,706,342 *0CE10F5D311A99EF543C8C9CBC5271A8C3657F29 WALESISTAED
126,706,343 *0CE2FFA5FEABA28B9551D0B154CB141262F9BA02 SKULULUIT
126,706,344 *0CEB380884D0EA5BFA48931A22A72EB16B5B52C3 SLYPSKYF5
126,706,345 *0CE8EE3B1DA23DAC0D27B43FE27C185D577D698C waterfallbenefice
126,706,346 *0CEABA3F4CBAF0A242C20D753908FFC7FA811DE8 WATERPETE5
126,706,347 *0CEE9F4C6383781A24409C5A7BCA897DDBC11AF5 WATTERING
126,706,348 *0CEA63B77DBDC486E1173C9B48CA9334BB92B2BD WAYNEDREWING
126,706,349 *0CE6FAFE202F3143D68485740A3299AEC4722FB6 [email protected]
126,706,350 *0CE4D870F1ADB2D426F0DE426575BE7EDD13E390 soffiava9
126,706,351 *0CEC2FD190A8629C57D4E0A0780C3F036C58DEA1 SOL3MNIZ4TION
126,706,352 *0CEDB08901778920657E2CB87B5B239C51238548 [email protected]
126,706,353 *0CEEC00DB4612B969BCD37C78532BCC09A5E9B5E SOLMUKKED
126,706,354 *0CE9CBD33940A5A36E8EE4675E5E30E1D5629489 wee.christine
126,706,355 *0CE3C150DDDF00B48476099C32A8539C6DCEAD1C WEERSGESTELDHEID3
126,706,356 *0CE098BBE0209FC1BE3F90F1087DA0D2F386AA53 [email protected]
126,706,357 *0CEB758DAAAAD5A9C99E43417B5E8BFFED18DD3B SONNETIZING6
126,706,358 *0CE16C149ECC8626DF42E627FC092FF1275544D1 SORDIARETUSELE
126,706,359 *0CEA1D73F21D7BEC666E2430917738F895365A13 SOUTHCHURCH
126,706,360 *0CE742C251573D7B7F00B812402E45B1D2B3C1D5 WEZTLAR
126,706,361 *0CE1EE3277258E0113BD051735A2B67E7D7B4FDD SPENCERDILLIN
126,706,362 *0CE4E2C23AF4F6747F3E6D54C022009C24C4FFD8 [email protected]
126,706,363 *0CE96EA0FAE9DEC5A90A40AD18F1D62F647464C4 SPLAT O~ 0~ <-8
126,706,364 *0CEF0FBAA2DE5BBDABC4AA83D4768F2BCDEB5FA0 WILEYJEREZ
126,706,365 *0CEB9DDC651332AF52CB0573689A42CC8F3E7F75 WIL.FRANZ.ASI.NUNEZ
126,706,366 *0CE8D5589A7905ED0B09657F07D63D82707ADEC1 williamosaemorgan
126,706,367 *0CE552DF03E0007281E628A8378D0CAD0358655F SRAYA1
126,706,368 *0CEBF9FFED86A2356E6B9786DE8E181B7DD78133 WILLQUADFLIEG
126,706,369 *0CE6B3C99269E2C74EA3A57BA6B12B5F6602FB7E WILL-RHUDY
126,706,370 *0CEDE2AEF2DD57EE5E6F01D85628BBD414AF6639 SSENSUORENONON0
126,706,371 *0CE0F99BC56C159791C8C2B2E1660F1B66DD7CC7 SSIRIWARDANE
126,706,372 *0CE59BA777DA0C595411BEC3C121C2E324A22119 STACEYMOLASH
126,706,373 *0CE0DDD375362240C90689344766568718CA2D28 WILSON.SHEAMAN
126,706,374 *0CE37EEEB728468F9E5678ABA23538EB423E95FC wiltonhammeren
126,706,375 *0CE06F75E99E793C61826E5D0F1640E3035FA511 STALKER-(DRUMS)
126,706,376 *0CEF4137D21BECB364ED557558C619F031331A11 windusetyaningsih
126,706,377 *0CED8F1DF06B9E1B9C33F17F5C9F3144BA7E7C6F wirbelkn8
126,706,378 *0CEBBB3D41C907B20E22B039E094A15FB74A6C74 STAWRIES
126,706,379 *0CE21EA84C397442B2B0F6107F0ABBCF7BA1BC8F wkladek8
126,706,380 *0CE96B2428DEAD7B509A23B18C6E3313E681B79D STENJATE0
126,706,381 *0CE125C816A20CB0616C0E03E80CFB1801AE94CD wnbtnse57
126,706,382 *0CEB4FABFDF1E7A305E64D5C8EF9FEF793F5AB16 STETAMROFATADDU
126,706,383 *0CE3C9A1273F51B16FAB3147AD53BA6F36DAD64A stevenquintanar
126,706,384 *0CEC45476581AC56136E6036DF378755BCDC5AA7 sthgtfetchrow_array
126,706,385 *0CEE7C2993ED9C4CDDB6297D8C6DD49B45F40607 STIAREIFIRRET
126,706,386 *0CE2514D9FC39C70379ABF04FA21BA878BB6B6A2 STINKYLACROSSE0
126,706,387 *0CE2E41CD16EB7C54637FDF2D41507293FB3828F WREEDST
126,706,388 *0CE0AB1B3E68F3E84930BFE40A3ACB22FC4BE586 [email protected]
126,706,389 *0CEA1E8ECB70FD4D04BAFFCFE714AADF0DD550C6 strateyses
126,706,390 *0CE9481F393B1249316D8E96EC5581747094FD94 [email protected]
126,706,391 *0CE0D8F06F3BB6EECD0248B7F441502F9EDA1B86 [email protected]
126,706,392 *0CEE669BB9156B8EF433F0DD57056BD72813E3C8 SU8LI3UT3NANCY
126,706,393 *0CE3F4EE7F961B8C0AA04F4C87DF7B2F40E2F831 WWW.COMPASSHOSPITALITY.COM
126,706,394 *0CEE8D35395117AF17A9B012043EEC7133935D71 WWWKIFARUCOM
126,706,395 *0CE8D1620B4A102EA099FEFEC308FBE575937143 wwwmcsk12net
126,706,396 *0CE14727BAB7F4B4EC433859EBD4B2FD7538CD4A WWW.NOTMYDESK.COM
126,706,397 *0CEA1C3729D8803659FA42E1F48175736FE1BE9C SULANDRI
126,706,398 *0CEE4B2D4635067D7E3E207CBEB12BD4574FE133 WYATTDRILLOCK
126,706,399 *0CEDA77EBC2FBD1A9B95A02F19BA58C1DB9B5C5D WYATTHETHCOTE
126,706,400 *0CE14C3EC39F66E245C97219D664F1E7386EEF31 [email protected]
126,706,401 *0CEFA08BCAA9EBDE83570EED82CF2B848E826B0A [email protected]
126,706,402 *0CEAE0DD76A110281EB081AD809A61913A85B504 WZINABALA
126,706,403 *0CE5DE0736063E3120322ED3D01529A7A2DBED07 SUNDAY STEPHEN
126,706,404 *0CE68C98404FB3B863F8805B3AC491ECC6C5A06B x7v<
126,706,405 *0CE4DA1A12E32455836F72787594AF7B629B16DB {X}~~D---B
126,706,406 *0CEC2D52BE246035E74A773D51B9236B62EDEE17 {x}-`d==q
126,706,407 *0CE78F1408E40CBCEF4A88E15BCF2CBEBEA176DA XETERNALXDENIEDXCHRISTX-XAVIER
126,706,408 *0CEEDAE6166951223FD7636D60E7FAB1675448D5 sussurrai
126,706,409 *0CEAC1BDBC82449AF1C4F1DEF038BFCF6C8948C5 [email protected]
126,706,410 *0CE7B4283370309919E1302A1A78D3120DF88542 XIERONALDW
126,706,411 *0CE2314D065BC24B79961D65AE34DEE3B6218DC9 swell head
126,706,412 *0CE97657004B257D044D9F418D0324A40524175D [email protected]
126,706,413 *0CECA3F3773CF884ED308A21BF06B2F3551BD0D7 [email protected]
126,706,414 *0CE7C50697827A5310D8CE29C0B6C3EAA4C3BCD5 )x(o~O~(P
126,706,415 *0CE0665DA7C4F78B7AFEE1BC5D6040105E6863D5 [email protected]
126,706,416 *0CED217391C25609DEBB0AF434F5C77DFF442F38 SYNERGY.&C..709;.PARTNERSHIP
126,706,417 *0CE09224D688F1C53A22162FDE1D1D756DEEF856 XUERFFA6
126,706,418 *0CEF3C8E07ED56F8DEE1AD13B3798B859C3B7EF1 [email protected]
126,706,419 *0CE9B42FD3DD94B791260F9C293D48A7A15963D7 TAG1AGT3S
126,706,420 *0CE958206B200B12A1390338495D79BFAFE260F5 YAOYAO CHEN
126,706,421 *0CECB1885774738D0B64F35F587B895E5E878379 YAPILAMAYACAK
126,706,422 *0CEDE570DF63A711564962AE2101FB6228648F49 YASSMINE.HACHEM
126,706,423 *0CE69F4A2ADD2BF4F447067B5F84C51E03D1B560 yg2x
126,706,424 *0CE59CF4B4951BD11197ECA6C9731D9B0ECAB344 YGGFZ3KQ
126,706,425 *0CE484B5F2EE6B9FA7427C2FF41DEA94C839192D YKSNIRBOD1
126,706,426 *0CE32894EDBB80319251883EF1D778A9FD406C0D YLLYTETN1
126,706,427 *0CE13B3798CA6D65734A2402C4C35DFAD62A35CE TAWIYAH
126,706,428 *0CE530363F2B0381DC52B8C0092A6FC793A62509 YOE=
126,706,429 *0CE1586C23172A323C05E2E790237FA035CE692D yonatan.shish
126,706,430 *0CECD53E343A6B875737C8D23A413E0FBFEBD1C2 YONG-SIK-CHOI
126,706,431 *0CE1A0532162915E8C1CAE076D52E3CF92CE721D teestasjorobando
126,706,432 *0CEDF053D677577C07FB7FAFEC44C06FD502F237 [email protected]
126,706,433 *0CE57D67472935E58CD9FE335BEE5C35D21F83A2 TENUISSEMUS123
126,706,434 *0CE96193E34E5CC9658B5C723D16531AFC1330A8 YTILAMROF
126,706,435 *0CEAA3725F26FCCAE854ECE48E53EA7B2D21E6BF [email protected]
126,706,436 *0CE428B117F4BDC1747E6D33CDCB4DA3CDD5E89D TERRY.ALLWARDT
126,706,437 *0CEEFFFF434E6FEBF125D7D9C0DAA0619D998B7A THATDAWN09
126,706,438 *0CE778A31283FC48CACA778D6B5CC63BF9A13ADE thealfred09
126,706,439 *0CE83587FBC2B4F75956239D8DF51B9754BBD421 ZAHNARZTNETZ
126,706,440 *0CECEAF5B7AD9A1E5F6642C4106FE5715E60E314 ZEIUGELL2
126,706,441 *0CE5C6B5BBECEEECE82CC2DCB7A18ECA2D361BDF zelene.argueta
126,706,442 *0CE5B262FD8CE2DA3323E91A012C6431995AAED7 the night they closed winn dixie down
126,706,443 *0CE827DB76D8392721C6C8F27ACE9744B5D8DE67 THEORIES4
126,706,444 *0CEDDAA092541E30A1E96F9F17FA9A604579681B ZENG YING
126,706,445 *0CEAD5D0601BAC36A215A300A5CF8F761CB1FBF1 TherearenofortressesthatBolshevikscannotstorm
126,706,446 *0CEE3258675C073729B4BA0CEFEC74198FE3070A [email protected]
126,706,447 *0CECDB48B556E883191FA8D3820344C51DE38E3C THIS.FOOL'S.LIFE
126,706,448 *0CE3A22A5D6FDA1EA3B89FEFBD1C353DBEAC4F20 ZHOU.ZHOKE
126,706,449 *0CE15EB838B627D9D88B281D612FCAC7AB8739C5 [email protected]
126,706,450 *0CECDB0BA1DDA7B4F1197F35AB108692FDB8623F three-dungurs
126,706,451 *0CE2FC60DD4E3C539106508E82300B5C43FB7CB1 „zip“
126,706,452 *0CE590232B5963E6C41247F0CDB07C6E7EB0D3FD ZOFIALALAINE
126,706,453 *0CE5DCF2371F8FCB9C1A38DDCA88D587C74EAFE7 TIỀN-PHONG
126,706,454 *0CE087109A9DCAB19B3E4D57489153266E8F3C01 TIENRITTENBOEKJE0
126,706,455 *0CE205DDD226357F9843C61E323CB14EEBCBE031 [email protected]
126,706,456 *0CE0C0104337BD9EEC60310DA5ECA4B6AE7DB8F4 ZWADEAUGUSTINE
126,706,457 *0CE14320DD9E2303AA6096179BF53AB5AF33A54D Ti-si-sjela-za-moj-stol
126,706,458 *0CEEC8C7505FF8096C390CB5A9759ABAF8874087 [email protected]
126,706,459 *0CE45267F32104E8C04A1906E44D50977F8BC146 βίθθηρα
126,706,460 *0CE2DD1E3C2301F57BD30C7B14047B24CE878734 TOBIAS.SCOVILL
126,706,461 *0CEEFF1F128CF951381F646D1430906E0EB23981 [email protected]
126,706,462 *0CEB13A51CE5D595E0EAFCBD311F08C5910A3A1C «АНТИСОВЕТСКОЙ
126,706,463 *0CE968AD5F9E36EAB83164F67CE44CFD818495ED БАЗАРЧЫ
126,706,464 *0CEEDFD5E609C11BB8F1791F47919B3D302F5A84 ВЫПУЧИВ
126,706,465 *0CE1EDDD63D8BA8ECF6986571C7AF19B5A2940D0 „ДВУГОДИШНО
126,706,466 *0CEE9B8331B6DE45B35966C5A89B11CF338C6626 tornooit0
126,706,467 *0CE1CEAEEC0CCD65DA96DF174FE2EBA35B219A48 TP/}
126,706,468 *0CE321543BBDBF7178EBC1F7DFD380FE2C01551C traceygrindel
126,706,469 *0CE54696DA3326991D12B607EB25C4B161FBDF42 TRACI-JANSSEN
126,706,470 *0CE58E62D0F3740D20A06731690199B384AFBABD TRADALLADART4
126,706,471 *0CEFE917719E14C67DEF120DD45ACF86E3E95C69 travernanzesskaret
126,706,472 *0CE75F00A009D7919FBC5004B303589C03A90B4F TREANESHABULLION
126,706,473 *0CEF0E5A3C9936AB0EE7B3822BF6B841BB08996B trebgodolleh
126,706,474 *0CEC8BBD0EE7C0A6FE5435E04029C73BD89028AC TREINLO1234
126,706,475 *0CEDB705AE82F0FFF2F7315743CDE2F64DCDA73F TRILINEARER
126,706,476 *0CEC2FD4F7AA22CAE059FDC2F07AD4F1D99418CC улеб
126,706,477 *0CEC899E5EB3CF1665B95015E681A108391791E3 харьковсого
126,706,478 *0CED125B515D5FD5C3AA11E5A0157FE21137F6E8 TRISTANFOX1
126,706,479 *0CE755479EAD127CACE49C4F5D4865C9B52C5319 trumberhet
126,706,480 *0CE96E2EAE3C8123B4094B32A77FBEFE5D547FCE trumpet
126,706,481 *0CE3DFF218357399EC9E38A3DC2B00043484148E TRZONOWIEC5
126,706,482 *0CECFE90A45190E3F5F6E88EA3AE21498DF33CB8 TTTIETT2
126,706,483 *0CE8CFA3CBD860D33E7B581A382F1C0B2420CC4C TUOKSUANSA
126,706,484 *0CEDB8C7CDD438F941AE5F49E7294D500D223E43 tvswares
126,706,485 *0CE3F000465983F2FA68C49B85C384BA3553E793 TYKISTÖTULENSA
126,706,486 *0CEDA71DB5319EBA5CDE3E2D2A7DAA7EE7482E1A TYLERBANNON
126,706,487 *0CE01DD0459E5513E134031AFE65DC4AD2FEAE3B TYLERMEARES
126,706,488 *0CE84C84487A9E02BF3ABEF28F8262331F3C3EC2 TYNGÄNVAIHTO
126,706,489 *0CE7C26C66152FDD9096CDB06BB0298A2BE09CCB TYROMATO8
126,706,490 *0CE9133826DBFA12410E760C7E12C9935B80B29B UDEH.BENJAMIN.CHUKWUDI
126,706,491 *0CEEA37F2733FA900E04E18E05B7B98A82A9F89F UDI.AJA
126,706,492 *0CEC1250C7532D9CB2D804BE7D65FAEC31CA6F5F ufhguort
126,706,493 *0CE3A667D902C5F89D4092A9058F694DB0BC67D3 [email protected]
126,706,494 *0CE52B9B5AB37DEAE223833FFC33EE52F2B2DCCC uitgemetene6
126,706,495 *0CEC8337ECC0AFFCDEED68CB92CB15C31CFD7D39 [email protected]
126,706,496 *0CEB0E391D6B3BB17B811EDFCA9A74F557A5C691 ULBS
126,706,497 *0CE8F5265AFFF6BD5F0E7E013F24BC11D3AE85FE UMAYMUY GEDE ALIT
126,706,498 *0CE81F2491372616C118CC6DC46CF3EF08537879 UNATONING
126,706,499 *0CEEAF202CD8F7521E16CA0D57159B34FE0762BA unificaced
126,706,500 *0CE74DB8295C77B92F3CB7B4CA3BCEF9F0FC3B07 unrabbinical
126,706,501 *0CE7C6E9035A59D1F6F88C74E9853ABBE091B2F0 Unskinny.Bop.(MTV.Unplugged)
126,706,502 *0CEA2513407727A951653EC09C4DCD137D0916FD UPMANAGEMATUREPIECED
126,706,503 *0CEE80BBEDBD2C453AE6F3102BB273D4648D75C3 upward,.and.all.was.as.cold.as.any.stone.
126,706,504 *0CEA74770E6998956F0EDAC25D6E4342300713B8 USER64.12.116.211
126,706,505 *0CEA9EE418D980DF49935A7014E19FEB12A9CC74 (_0).o~.o~d####p
126,706,506 *0CE0053F4AE2C0E8914C9FE51A54715E3A3F80ED USMAN-ZANNA
126,706,507 *0CECB1991A0CFE7F46475D73F943E70C24283D7F US.SD6-AGENT
126,706,508 *0CED5A74EE2371BBED90E0916222624E9BE668D6 UUCPPCUUED
126,706,509 *0CE178C4402E7DACCCE84D8D5F519E429C28417C uylandes
126,706,510 *0CEA5CF35E3E21AAA4A4E362C3BE70926D937137 114poiuy
126,706,511 *0CEECE61B09B19705A2AD351C97F2EDFF7656D54 1153011 uusmerkinn
126,706,512 *0CE283C61F87887816A8EDD9D206B750B05644F2 116551 NEJOTKASYSTEEMINN
126,706,513 *0CE380EE45A9F2A99B689B906571EC4A99BBBA31 1178590 wenn.mir.das.gelingt.,.wird.es.eine.wundervolle.arbeit..
126,706,514 *0CE87FFDBFC41568298752FEEF30B120E1A545AF 1236705 hotelli.on.pohjolanaukiolla.liikenneympyr
126,706,515 *0CE6CDD911E7334F3BE08A30975200A91C9BB89F VALDIS R
126,706,516 *0CE9102A82AE7254CB2CB5118CB73C860F09AD74 VANGER4
126,706,517 *0CEC7281E108FA8734EADFF4403C4177790F45EF 1509938 erityisesti.kuntien.terveystoimen.ja.yleisjohdon.v
126,706,518 *0CE73733AB674FDACA29920DBF71AC95A191DD0B variassero6
126,706,519 *0CEA0CCCA3855A6F19F031818D08F599FA85F1A0 vasaaa
126,706,520 *0CE2937D478CFFF6744F93810BF016D487AD82D0 VD6A
126,706,521 *0CE4522710E41356B560000A2CCA39978A3439C8 1654814 DASGESCHEHEIMALLTAGVIELZUSELTEN
126,706,522 *0CE68832B510C5270D2977CD3CD6D6501FE38A68 1682875 maire-r
126,706,523 *0CE09D4BB5FEAD63564E91D7F1B700CF0079D70E Veilleurdevie
126,706,524 *0CE4ED674F12605F5A8FF9C158990BA05F99DB9B VENNEFORENINGEN4
126,706,525 *0CEF28DDFC7F04391E719F5668D384BF720A985E 18081995BEST
126,706,526 *0CED3A260512F359401157657D0987622C78EBF6 veretteren8
126,706,527 *0CEAAA76BA8623CD9B959A2018854F3DC8569DBA 188602 tarihCifelsefeci okul .
126,706,528 *0CEB7EDA575C334EF89E863D7F7D1207BE8BDFC4 1BAUGROESSEN
126,706,529 *0CEA7C33A09CD6C4C0F0099E6373BFFA2B0B3FC4 VHINNIBV8
126,706,530 *0CE2BD10DC5F10A46BF908D18D280A0BBC919E1C 1 BITYENIGI
126,706,531 *0CE605C0A6D6FB2EA5BB7C01FEFE1A2289B0CC0B 1b-kette
126,706,532 *0CEA69F090A1725708204F6C8B5DA2986670171D 1-BOERSENEINBRUECHE
126,706,533 *0CE0BDA691E27F3A863E6DC2CAD00D154FE7866E [email protected]$
126,706,534 *0CE4C479F1E14AD7559290ABBD0D3FEF2FDBD875 VICTOR.CHUA.JS
126,706,535 *0CE0335EE9C91E03026137476F6EAAA0DC63AAC7 1 FASTMARCHING
126,706,536 *0CEFC7ACDDF923B46B8AEB03F97658831235C550 VIRGILIOLUISO
126,706,537 *0CE883C3FC10B5515EBE5925E5C8AA1F8A2DECCC 1IOITTAEN
126,706,538 *0CE1C956762346345169B58DD10ED430F747D4A7 1 JAUCH-MILLIONAERIN
126,706,539 *0CEB45136FDE20D5778F81E68C576D706ABF3D04 1-jotaiteltaisiin
126,706,540 *0CEE944EE7747B39F2C59BF9A536CD178E1DC567 1-KESKUSTELUALUEOHJELMAN
126,706,541 *0CE7053CCC068C1E2079D9F1396C4851D8C95DB9 vk!aaa
126,706,542 *0CEB2415572220FFAF3A4B12F3D0E9EF74EEEFD2 1.LEINENHEMDS
126,706,543 *0CEC9DD49A20DBB59EF07731FDF8C2327CC65CAF VMGRU.BBS
126,706,544 *0CE2F2D6729C0FF7073D080B96D6481F1CC88893 1-malesialaisia
126,706,545 *0CE4D88FB34DE81A0FA5D1A8F673C35AF5BCE728 1.MATKAILU-PAKETTEJA
126,706,546 *0CE6AB5A91FCDCCC0A373DA828FDAE818F6E9390 1.mckenry
126,706,547 *0CE420A0CC25A93E34A7AFDB334403143ADF8CF1 1.medien-anarchos
126,706,548 *0CEC631A54A068D1D2FA4DB2779CAB7810549BEF VOLTOUBSW3
126,706,549 *0CEEB636827A8D5675820C6CBCDFA7F5D1B090B0 „VOLTURNO“
126,706,550 *0CEB8C12D90741F34AE59C2156086D189D53595C VONTRYBA
126,706,551 *0CE29A8BE2EBC157FE087B8AD4997FFC3A4BFD96 VORJZ MENDOZA SIASAR
126,706,552 *0CEBD21594284729FCFE778BA163F0A94C3AE04A VOUNOUS-BELLAPAISFR
126,706,553 *0CEF9446E389071210B41CC5C910DC3D7B2934E5 1ONRUSTZAAIERS
126,706,554 *0CEA6B49F68393A0ABD2748E120A55CF62AD1CCE 1.PARTY-AUFTRITT
126,706,555 *0CE12A66906E8C0CCA9FB9E7FD9E4D44D8ABAA65 1 PEPPERONIMAKKAROIDEN
126,706,556 *0CEFBA17CBC8C2515B065E055E8EF51479E0481C 1.platelet-making
126,706,557 *0CEB87FCFECB623669176613CE2F3044390E57E8 VUKCEVICH6
126,706,558 *0CE28416CC6814BEAE3FC3C3A7646C9A6BE7BC1C 1Q2W3E8541
126,706,559 *0CED9AB2BB53CE5323F1310DBFEEF7AF74226B9B [email protected]
126,706,560 *0CE3939297EACF99062352F9C79E22356720D60D 1STIPTER
126,706,561 *0CE369BE9454EB8B5E27748306F976E74D382FF2 WAHYUMUSTAFA
126,706,562 *0CEE986AB951B6079AC6DFE0785E0E71404FA090 WANDA HUTCHINSON RUTH
126,706,563 *0CE214C6EAA8A943A7129A8CE8053407A3A05752 1.VERDIRTTIGIMIZ
126,706,564 *0CEA900D7F092DAC7427F2773E714619D4C1A713 [email protected]
126,706,565 *0CEE5C2AF2E3B0C52C398F08FF2A3440A9881D09 1.VERTRAUENSAERZTLICHEN
126,706,566 *0CE3F47F073C744843CE1D3AE30364160A4959A7 WANWASSA BUABANG
126,706,567 *0CEE400F99AFF685E9F1575ED8F89A61ADBBC380 1.yaha
126,706,568 *0CE53BDA7327F8B1D5374564E3245879D49A05C6 1-yomba
126,706,569 *0CED552E8F0267018E571C64A9D533B6BA834F2A WARREN-N-MINAMI
126,706,570 *0CE0800EAB2E04402561A24B9F39AFAF7B46A626 WASSERWAAGENGEWICHTE
126,706,571 *0CE3A7BCCEC8E860E980EBD0D0D69D2730D51CFD wastr31s
126,706,572 *0CE360A73B614F393C52121978B682C7FE43C252 WATERJACKIE
126,706,573 *0CED69E8E7D5DEE66CF5E7C6595C7567D45310E2 wayneseering
126,706,574 *0CED14C3702CAA001FEDE2EC4CEDE2A9941F8B45 219432 no-other-criminal-charges-are-planned-,-he-said-
126,706,575 *0CEA1A468BEF49BD3327C69069BFC35AF15F0AD4 2293220 perheeseen kuuluu
126,706,576 *0CE73BDA516AA1B343AA0D11C1D7F2368E7339C2 WENDELLKITTO
126,706,577 *0CEEA2EC598D894ED3E49360C5F578CC6F0A0416 WENDELLRERUCHA
126,706,578 *0CE06CA86841D7D0993D1D876289C095DE0CBF09 25091694
126,706,579 *0CED08D95D4A75E223783B0E6B8BA4930C40FD6E 252117 sopimuksenmukaanty
126,706,580 *0CE933DFC2686AAE397653FD43B0F753637A326A 25-goethe-gymnasiums
126,706,581 *0CEB83A4BA79290473E96144E1B88916513BB494 We're.listing.you.as.a.reference.
126,706,582 *0CE6F086CA506B38BE1E79E2E906C8DB88A42BF2 [email protected]
126,706,583 *0CE4CACDD26B4F69A8EF6C27712688351A352624 what sisters do
126,706,584 *0CEE112EECC38878677A21DE6E2B6F7546B2CD7C 2AUTOMAATIOTEKNINEN
126,706,585 *0CEB68C95BAD1F7FBD09E6B3042523F8D0ABECBA WIDODO.ITEM
126,706,586 *0CE59AFB23B9E487E5C05D53F739E56E1EC6A8EF 2columbuskaje
126,706,587 *0CEF4F9FE9840C0EA3D0EB478F276B65B16F53AB 2CROVETTI
126,706,588 *0CEAE4F8B6ACCC4819BECDFF26274C0D01C75C5D wilfredpapale
126,706,589 *0CEE0803CF8F24046707894B0F73DFBB570DD980 william-brunell
126,706,590 *0CE72B74086BC722B1312A4A71036DF5B097DB01 WILLISLIED
126,706,591 *0CECC0DA35DE5C5D76BDAF6A7A18FCB234E28753 2.MAGNETRON
126,706,592 *0CEB9BA5415C2D1BC56ACB0C25FED58FD184CE15 wmrotton
126,706,593 *0CEE9648F1B8675F7FAEE72F7E960E0C30867CD3 333olive
126,706,594 *0CED7B56AFB14A6E8A2BBE7672A1F6A152FE4446 35 BIEDERMEIER
126,706,595 *0CE5B281E18313BAEBB93E7B67A8E09C9654EA5F WYATTBUX
126,706,596 *0CEEA040C4AC96E644BDD4026BEA11DC05195E40 )X(.~`.~`<3
126,706,597 *0CE2315D2EAF07FE7D0211119768017302E79C64 3d9172586741373ebabc474a1a5d8954
126,706,598 *0CE8585635CDA09973C6BADC066650B7F2AC92E9 XIEMAODAO
126,706,599 *0CE67AFED549AB62F11E857772E8F98D7826741C 3JULY1946
126,706,600 *0CEED7E68AA16E30AB489E5549D337E5C7338AAE 402bria
126,706,601 *0CE32F00B2CD0099BBE5376C9517FDC9083E0356 YAHYA-YUNUSA
126,706,602 *0CE8EF7F5C467F7CF729A2853AEA7873C1732425 yakupura
126,706,603 *0CEAE1ADBD63FA94F5FCA5A4C59541CCEF8D69BF [email protected]
126,706,604 *0CE6632138CB1531EDB1E8CAC70F5FF0F4BD5AEA 475574 JOS OSAPUOLET EIV
126,706,605 *0CED751A7D8662069D336B8534EF7D1FDF8C7ED8 477markus
126,706,606 *0CE973676645CF05E3DCF5B20BC86AE02FDD8222 4ARRAFIZ
126,706,607 *0CE413FFBDF9D1945011D751C841B29CE912E376 yf$
126,706,608 *0CE852373FCC0113C90064CA8A43FB3261910DB2 4ilovereggae4
126,706,609 *0CE3673A8119C338C3746AFBD3EFD0C18EB59CF3 4KLAMOTTENLADEN
126,706,610 *0CEF188C446D77DC5FF4DC415BB4BC4A6CC37F53 y{,j
126,706,611 *0CEA55CF75A00194DCCF77ED3C50C9B65E2A049D 4lter4ton5
126,706,612 *0CE77B2E9D4AF952CB6D8F9F9BEA6FB6AC2C9548 4MAINSHEET
126,706,613 *0CE256D5BB1D26EA9C286C4481CB03CCBBE95222 YLGNIZIRPRUS
126,706,614 *0CEB41A7C146DCC9FCD52C752D4301366C995BE3 4MOMREBELS
126,706,615 *0CEF9AFAAFA57249F5E5A662EB828298CB55E566 4MUSTALLEMEREL
126,706,616 *0CEA25A9D2D6BBABFF2B5CDB59EB50875190ECD4 4OJECTEUR
126,706,617 *0CE691543C8F42F7A38DBE7E6571D52E6824407D 4PREPELICE
126,706,618 *0CE71ECA0AFD5BAB713E5CCEB61A8BBC80CF65EE YROLGNUS
126,706,619 *0CEAB468C389450203065BCC3D22E200D9CC078D yX
126,706,620 *0CE2A7492E1B4DD1ED4CCD3158437CCFA6959636 Z77464
126,706,621 *0CE2B749D0F3A95BC7FC947609F145CBF4CC6952 zaboomafooo2006
126,706,622 *0CE3F81FC625A72193E59961E682D8B63251DF79 55764A
126,706,623 *0CE50AAD96490182FD216AF3D51261EDAD701982 57631206MIFON
126,706,624 *0CEE83D0B5AC5A015D9E7A517B84C5325D32D5FB ZACH-HOYDICH
126,706,625 *0CE24D857DA0546016F3DBCC7023441669386204 5977QAZ
126,706,626 *0CE69702A6C53F6D78F248E8ED23F80659EE1A28 5AMMALINCONIRONO
126,706,627 *0CEBDAEA01B7E81937AD9AF0368EECBCDE1CC7DC zac-mogg
126,706,628 *0CEA9E7C010DA99CB71C6E6FCA67D1EAE8EFCABA ZAIHAN-DOKKEN-BLUES
126,706,629 *0CE9AA5C9724C1EA6CD743290984C96FDF721AA5 5BONJOURLAURA
126,706,630 *0CEAAEF8A9802DF421BB80E76B1A0C4419E62EE9 ZAKOVICU3
126,706,631 *0CEACCFCF980961D2B97036458902E269C1D9AE7 ZARAH.FERGUSON.HUMES
126,706,632 *0CE51645F9A29F3B3B2A3E56D983A83FEC75DEB9 ZARGHONAZ
126,706,633 *0CEDEC0EFE7A1B94176A3E80F428EE91C860F266 ZAUBERRUNENKUNDE
126,706,634 *0CE19BC782ADFEAAE4A3523752B69E27797B90EF 5DECIMON
126,706,635 *0CED7D802B0C5150892ADABCEFE9E34867C130AF zekerheden0
126,706,636 *0CE5ED602F92012168AFB4AAB01C6D67C4193EA1 Zeremoni
126,706,637 *0CEA68FAB8C307715863F776063304A40EAEAC0B 5HANESFORD
126,706,638 *0CED0A3BE95DE4DBB297B07DDF3E7785293EE0A9 ZEROBEGGARZEROPOVERTY
126,706,639 *0CEA3742E7D87C6243417E3C5F04A83CBC96CCBD ZERONOHSEDING
126,706,640 *0CEC79A7118ECFFFC74BC95DACC31D25B14CD10D z)g
126,706,641 *0CEC59974EFB8BD44A1D11C244E8E82E21AEB875 [email protected]
126,706,642 *0CE541AB6F33126FA4BBCE280CF5173AF1A002BB [email protected]
126,706,643 *0CED9D3FED3DC40CC064B2BD1EA08454EB19C1F8 5nf9rqwew3g
126,706,644 *0CE97EB66D3DFDF19B3A077B89EB94AE29E04433 5NINKEREB
126,706,645 *0CE91DD411B02DF8E3554485DEE0E27712ED386C 5.ohjelmoidusta
126,706,646 *0CE184DFE0CD0656BEFDE80BCD4E09CE09EA583F ZIAD.JAWED
126,706,647 *0CEE178F8CC2808E21FE7F6057DDBD26F9A3F94D 5SCINOHPARDAUQ
126,706,648 *0CE6AE28B859F5E46DA70DE4E0F1322304F3326E z[l}
126,706,649 *0CE8C9D9DBACFB760E0455EB6FFC1F66EC2DE1BB zn+
126,706,650 *0CEDEC9A846D3FD13C09921FB12C12CFE6D5A419 5THATROCKNROLL4
126,706,651 *0CEE33A420F5DED32F6185602F31188E3AB30FDD 5UBM1N147UR1Z3
126,706,652 *0CE4BE636013C09CBD94B82D99EE852D05C7D78E 5UNBAFFLEDA
126,706,653 *0CE8E40988586485DCCCC55118A4E45ABC4F4868 ΔΆΜΝΗΜΙ
126,706,654 *0CE62E5CAB278868E344BBC8132793784B3C4287 6BLUEBIRDINTERNET
126,706,655 *0CEE0FAA6D1BE31222534A90252FE5DD997D3460 6-BOYKIN'S
126,706,656 *0CE1B91F44439B4B8BA55FA17282BABBE2A1206D ἈΠΟΔΟΚΙΜΆΣΑΝΤΑ
126,706,657 *0CEA1E88AAD143DAFBDDC8B0727AA427E85FFD05 карабультекская
126,706,658 *0CECF829166A7FB613A0CC8FF41A0CB7F62CAF21 КОРДИЛЬЕРСКИЕ
126,706,659 *0CE36B717E18CB714E9125FC4A277913533FF49F 6LAAUNAM
126,706,660 *0CE93760A80FEC4A7F0A17A26AE9C97D9D133DB5 новалихин
126,706,661 *0CE83C642A645399109D598E318313A18D147B95 6PRKTZRTN
126,706,662 *0CE1562523C014F3E3C6A26CAD8FA70F8DACBF98 ПРИВИДЯН
126,706,663 *0CE88E0DBA75EB6D117A991F1DC25825D9C71D00 цехнабяхла
126,706,664 *0CECAE2137EB99568F84A1F8B1E272A9F879468D ЧЕЧЕЛОВКЕ
126,706,665 *0CE317FCD5CF30E66BF7DB1FCCF66B3F4233F833 6ZIKONOHI
126,706,666 *0CE43A27F8E24F678FCCA753E08CA9923948F257 739B91B8A6BEAA8B850E001E619286FB
126,706,667 *0CE0D0FCD12489AEFBA3563D568F830A75086801 7ETSATUMMOC
126,706,668 *0CEE67F7FB1FC2B267570950FF5B4A33ED1D9352 7ilovebiker4
126,706,669 *0CE98DEAC330C4EDA355C9C06203F7FB564248D3 7KOKONGANE
126,706,670 *0CED0BE8DAEFEFCA003145621932FC79BF6EEC7B 7NAVELUT
126,706,671 *0CE5B8FCC67E75B89E1348DDA2254BCC5D61E220 7PLACABLENESSN
126,706,672 *0CE9CE28285E8836B5B31486AD983B9001C271AC として設置されたが、その後、三陸自動車道に編入され、フルIC化した際に構造上の都合で信号機が必要と判断されたためである。
126,706,673 *0CE5FE86EB1986F751BC99720662A9F3E9A218DE 译作“地下拯救者”),dvd由
126,706,674 *0CEE928EB1B971A523904D0959625086A61F27B1 7-velj
126,706,675 *0CEA8DC57DA60C05CC850E8D68405A435441BDDE 825C1C080C49265B9BC6BCB664606D1FHENTAILORD
126,706,676 *0CE581E512BCBCA732190C9B5FC606B5F1469F62 857052 eine-seitentuer-flog-auf-.
126,706,677 *0CEE83F91D3C9FE992B9492091279E859E7E8F61 890ORION
126,706,678 *0CE928E44B289E98EB261C0D67506296377A11BE 8ACHIFORM
126,706,679 *0CEC0D409E7E82502EB158959C3F8C2535F582CC 8COMINAR
126,706,680 *0CE6830D61B4D225604C1D533127ACE917CECE56 8======d.~)0(
126,706,681 *0CE9104EC7ADB6E9B45A2D9394758C7C1CA59650 8DERAKAB
126,706,682 *0CE4A4375CF33C4182D103678E6A09CF13A189F0 8EFTERSEENDES
126,706,683 *0CEFDB9E457F022C2240E7C5893D5A3267CED671 8INGESCHI
126,706,684 *0CE781B061783F0143595B565981A21847047BD3 8jatkopaikasta
126,706,685 *0CEB8D73C65260AB364AB1DE4F01E5AE785561BD 8mydillweed9
126,706,686 *0CEBF779977EE751035A1F22B5A504B3B4E64DE4 8-)-~o~o-splat
126,706,687 *0CE828E2459AE3E563F07601C4B0710BDAB279A6 042CHAYA
126,706,688 *0CE9BD796DA5688D776FBC451E75C80DB1A449E7 05261096
126,706,689 *0CE97C384E2486B6A870E55FE48FB9363493326C 8THATSIMBA6
126,706,690 *0CE3B4CB7015E5DAB067B412EDB3AA6007402CD1 07-12-1761
126,706,691 *0CEFB15A4ABFF6693A7DE7DC755ECB097210B249 8VIELLEELLEIV
126,706,692 *0CE8E3BF16B322E54290408BB495EB8070F2D393 {.915.niSA.puorg
126,706,693 *0CE764087FEAECAA06A6A517E0361498AC0391FA 935013 t
126,706,694 *0CE9FEF683FF46695A0B334203C98A640CF347BC 0J1LFMGCJ0
126,706,695 *0CE36F3DA298D7737F74A20AAF8EEC065D02ACAB 975711 IT.ALSO.HAS.MORE.THAN.200.EMPLOYEES.IN.SAUDI.ARABIA..
126,706,696 *0CE47D1E70ADE2AC490B31D4C8EB7DD135DA8B84 9ABCDADRIAN
126,706,697 *0CEADD33D531B9E4E2F9472C2F1C6D94FA9B38E4 0THERENEGADE3
126,706,698 *0CED5AB1D15CF2732E4A54E078C8DBC4B8F74E1A 1115382 HYV
126,706,699 *0CE2D46AB4B6844B55D59E7C9733FA2A4C9C44CB 1132489 VOITTOPUTKI SAI JATKOA PALLO-IIROJA VASTAAN KAUDEN NELJ
126,706,700 *0CEE3E7A297407390E226F05F2850FFD85AC6FB0 123goussa
126,706,701 *0CEB5AC5C1AFE3E6C398BAE80F7B368C43F07F75 1261575 t
126,706,702 *0CE5719BD71726500E910121CA2C4AE00F68C7B6 [email protected]
126,706,703 *0CE9BB60B6CD70C038993D27D05F3ED9904CC066 9MOISSONNAI
126,706,704 *0CE642B8E01A49CAED2EA12394378153A889BA58 1504225 auch das duerfte den zuhoerern neu sein
126,706,705 *0CE98708EEDAB5B227D169147498277223D35C51 9NVARJUNAKA
126,706,706 *0CE4E6B825FA566E5764F4811C19FE5138A501B8 1660983 TOISENTY
126,706,707 *0CE14EB71FF98A233BA06D7F3968140C5C2E3D58 1701776 WE NEED MORE CUSTOMS
126,706,708 *0CEC0E5813C280F96C6D89F78735C69FF26F1C05 17.KNEEPADS
126,706,709 *0CED1AF111DE345BBB853958B763ECE547F37CDD 9TRAWZPMAL
126,706,710 *0CE99E16B1FCF3FAECCE079B0966D57692A2BC01 19462502
126,706,711 *0CEBBFAE29E09124714EAC43F80868875186511B 9VNSTRIPT
126,706,712 *0CE43538AB28B230486139D291BE4634657C2FC3 19alakazam61
126,706,713 *0CE124CD6E3710F1F211BF9B0A908B2D09DCAC27 1.beanstandeter
126,706,714 *0CE244CDA4243FC3BB75C69B9187FD61FC46D8EE 1beta-agonisten
126,706,715 *0CED2E228FE62345E743EE429E30174B84650379 1-BISNESMIEHET
126,706,716 *0CEA6CC58995577AB396D9CA40596E017E74C2DB a/39k
126,706,717 *0CECAA9844CBC2C082CF35E5C660ADFB0CE758BC A3A(
126,706,718 *0CE40F87DE64F08FA6C499BE7752D6C64B4B3133 A3V.S
126,706,719 *0CEDEF18D9C936F4DBF22A800F9BEA606C9EA86C 1 DAENENVIERTEL
126,706,720 *0CE3519D434D1C751FCF4C44C8CC9A60D8520FB8 A6X9K
126,706,721 *0CECB79313506B26270C9F7088DC0DA384737B9B 1ERLANGDES
126,706,722 *0CE103E2F127D5191947A87A71FB6E9EC271AE36 1-EXPO-PLANER
126,706,723 *0CEC94029F1F118F118FF5A675F80A2296BC4451 a+7+t
126,706,724 *0CE9B28BDAC26DF756FFFD2F20E2E54090DAE599 1-geschichtsfaelschungen
126,706,725 *0CEC9D3456A2B5B3ED08078E7C069970BAFAA0F0 1 gusmitgliedsstaaten
126,706,726 *0CEF7A9444CBEB4EDD013C4D869FAA8DB2D979B9 AAA~
126,706,727 *0CE15BCFA1FDAEC52C95A2B11E1D500B43F0F2EC 1 INSTALLATIONGESELLSCHAFTEN
126,706,728 *0CE7387F58007B7F5E817B44DCD910E837B93D33 1.INVAVESSOISTA
126,706,729 *0CEB5ACD0C42D80702544FAEB62A3BDFADF1BA2E AAA*P+
126,706,730 *0CE30CF4FC344B462AC2A73CC8966D554730CDD2 aaav_\
126,706,731 *0CE2B00CC1BBF1AF3C70B9E2CE2677DDE634C799 1.kilpailuluokan
126,706,732 *0CEE2BB3339D0E428D5531D29677F0AD1FA9D81E 1-KIRJEPAPERILLENI
126,706,733 *0CEDA368EA761FDC2F9FBDF9E2880CD0BE105E22 aab4"0
126,706,734 *0CE7DACA33E803551B020693CB5B2F064C58FC2E aad7yq
126,706,735 *0CE4E235809B85AFD319F11EA7C8A27F8E9C8E0E 1NEEDED-THAT
126,706,736 *0CEF3ACD82AE207BA1AE922A25327CF445193686 AAE_OJ
126,706,737 *0CEE75BCE7AAABD4007D0C21680453CD83C08459 1PEDONALI
126,706,738 *0CE3A1CA5145C3D1F9AB0B2E006D46828FA519BC aaeyxm
126,706,739 *0CE4EE415C38136488C8E2DF773E032E841F2540 1.RAKKAUSSEIKKAILUT
126,706,740 *0CE5D01CFE109BB89D89BE5FCCF360CBCEB259E9 1ROHRHEIM
126,706,741 *0CEBAD328E9B96D9AC737D40AFF1E759F834C8C4 [email protected]
126,706,742 *0CE3D2F2D6C1F7D07CD212A2E72B777BC69D5737 1sedpapiers
126,706,743 *0CEE9FC70227549BBE0755EA383DC79EE3176C41 AA;Y
126,706,744 *0CEF40DD8089E4DC946A89FDBCB1DB88643F6842 ab0l
126,706,745 *0CE315F98547B53EBE2035FA0C90333A244BEA16 1 STAHLTITEL
126,706,746 *0CE93C8EAE8760038BC035B6AED8B233376C79DE abc5
126,706,747 *0CE2D75AFD05A23559F79AE8A3FF7F04AC7E5C65 1 VALANOUR
126,706,748 *0CEA2EA254E38268788842CC72B089770795BF27 1VASTAUSAINEISTOA
126,706,749 *0CE11309C61CBD210ACED133F6CA5C9F93196A9D AB"KF
126,706,750 *0CE0BFCE2AC7380E3DA62B9EAA62C8FB3DF706F4 abrahamboyette
126,706,751 *0CE01AFC1AF0C6E589D30DB1C8B7ADE8D8E08B54 2067147 oppituntien.lis
126,706,752 *0CE7C71AA367D255E7B8DE0554572166AA771421 [email protected]
126,706,753 *0CEACBE54BE9F1538DE89AD6A2DCB587F7938F72 21071237
126,706,754 *0CEC5FD841A971CF25C82598510C505774DF2AD4 2239306 e18-kokeilualue -projektin tavoitteena oli kehitt
126,706,755 *0CE11E72933F9D64C57A15D01AED85AB6F29834C ACD1P
126,706,756 *0CEA80009F35DCA73E1D2BBFC3764C1FCEA5FFB4 2388293 the-suspect's-car-crashed-into-the-back-of-a-bus-
126,706,757 *0CED8F3AA2EE016BF3E22DBB6188401135442856 2486027 VIIME VUONNA PINNOJA KERTYI 14 ( YHDEKS
126,706,758 *0CE153BBDE501D58363069123B9243D7D7C6B864 act iii, scene i "la tua gloria risplende nell'incanto" (calaf)
126,706,759 *0CE65C38AF74C21CA24383413473FDD548D40193 2611443 she wouldn't discuss specific results
126,706,760 *0CEC537EC097375D195DBD17E69E190CBAA9E27E 26CONVERT
126,706,761 *0CEDEAD94642D1EA8372C68E698964EC8DAE14F9 ADAM-STRAUGHAN
126,706,762 *0CEBB64EF3EBD0D1D7D6FF7D8B499506C5E0D401 ADANPADAVANO
126,706,763 *0CE1EE593A4248E2116E6671C6778EAB7BFC44EA 276diego
126,706,764 *0CE2DFB4FCD3603A48123822C69245B23253F2ED ADDIERTES0
126,706,765 *0CEDD0FA3343BE40DBEF02FFC30BA0944476FADD 27 AUFZUBEREITEN
126,706,766 *0CEA5EDA5619D53F6733A62E2B502C57A5D00D7C 2835367 yksin-olijaksi-siit
126,706,767 *0CE6B17105F0C5ED10C26DFEBA12D898CAE92B34 adg#
126,706,768 *0CED94A3B9F0C4C5CD190A5B6AAEDD633F1F81ED 2988085 "DERSAMSTAGISTUNDBLEIBTEINWERKTAG"
126,706,769 *0CE06DC3E097A652D7C01A80018955BE54F83524 2BONSAI-NEW
126,706,770 *0CE3597C3D5CED0BE4105AD26322AAB6D9A3616E a:#e
126,706,771 *0CE7195246D46F0DDEEE21DBE738F997DE0F8A14 A;E
126,706,772 *0CE44245B90034D3004D8BAA35E4F1C432612F63 afdrypnings
126,706,773 *0CEF445E2A89ED11A1FA85E201517E2C9C2E95AF AFENDIAHMAD
126,706,774 *0CE6143A69554F050B8F4E882982D285E387B0D9 2-novotan
126,706,775 *0CE21BE613B0989E8E7A1604F77775A85C6C7B66 2PASTITO
126,706,776 *0CE76E35A99A88535EB4C8762CB4DA8778E444D4 2 RAKENNUSYRITYKSIIN
126,706,777 *0CE3BB33EDCF402279C082F503D67FD96D8DEACD AGAINDSEER
126,706,778 *0CEDCED344FFC176D0F39B27DFF8170F2AB8C92C agigb
126,706,779 *0CE5CCA277890F869FA5A779299D31114703951F 2 TREUEBEKENNTNIS
126,706,780 *0CE68A82BD7CE6B9802D80F63889364406CCA219 agogt
126,706,781 *0CE7B2B7A7EC0CD986733531034FC808EA2CDA82 agp-k
126,706,782 *0CEE26A46667CD7E8E84CF80DC9CA273EF818268 a)h!2
126,706,783 *0CE36A05E29315EBD2B37AECA8EE80F60F778B73 31february1950
126,706,784 *0CE453F096EF8538473DE6ED37D8BF64E2E2A74C 339530 ORHAN.ADLI.APAYDIN.SOK..
126,706,785 *0CE85ADDCF5A1FE758330129518D42B0A61EB82F 343747 "-BUFFY-,-DIE-VAMPIRJAEGERIN-"-ZUM-BEISPIEL-
126,706,786 *0CE1B6B0285B8CA7B98BCA9180D789FE202EDCF0 AHMED.ANGLEBERGER
126,706,787 *0CEBFC0A5C3501B08D24C0C187DA14AAE75B0AEA 3774EE8E
126,706,788 *0CEC15DC8A6FDFE9C7F5AF99A84C0F5CCFAFA153 AHQQK
126,706,789 *0CE5793AFB560F0BA864DA0576A668C104929F70 ahrabee
126,706,790 *0CE93E0954079EFF0686BD1F772343E841705E3B AHUBV
126,706,791 *0CE31651395DDC465DB6042154371C237A749E6F 3B<O~ O~ (####P
126,706,792 *0CE2227587D3CB902B9CF242AC8FFE871D86713F aifkr
126,706,793 *0CE05BEC7B92299B8EC3104A7C80DA699741651F 3DIEHDOG
126,706,794 *0CEDAC661BBC79F88EBE4B53A1C2274379E9B519 aikeessa
126,706,795 *0CE1261555A0A2CF7B3F109E9DB11AF8B5D3A841 a=j0:
126,706,796 *0CEB40986F8EE9777F00083E977490E6D030B51E 3 novelettes: no 3 in e minor
126,706,797 *0CEE1D3E8515927689CB529DF6AC23191EDEEC0C 3-----p.`~.`~(^_~)
126,706,798 *0CE6EBC6643D8C2809912E0D8AC798B206844E91 3-----p.~.`>-b0
126,706,799 *0CE126EAB11F91C4F36309235F5A729D5133C92F aktarilabilmesinin
126,706,800 *0CE702B004A225FDB0B45ACC4D91443787E355AF 3SZYPULSKI
126,706,801 *0CEF351285B65C4D27522737518015834CEC2A07 al1n_
126,706,802 *0CEB9D090963FD90D68967B053255C24A18DBCE9 AL1U
126,706,803 *0CE4F3C0FC1AB2E2CC97957FDD7AE33AACD9D84C ALBERTGERRIOR
126,706,804 *0CE7D4D14765A76C0136144372F58C3A0CCF7647 483535 RIZA.YILMAZ.(.ANKARA.).MILLET.SIZI.DE.ASACAK..
126,706,805 *0CE429DC99D8D16659F83AE474FB6EBDBC8DC90B 494JARRETT
126,706,806 *0CE31CE769D667F38E2C0403BEF9CFFE0F3EA36C 4CRUSADING
126,706,807 *0CEF17683A209C8E0F96A971429A6D57CCEB3E16 4EMPHEMERALNESS
126,706,808 *0CE774F9757389A166B4A64115C796A61EA81A82 4EPIRFAEHS
126,706,809 *0CE824B439DBAB170DE12D6F61B44DA95D433CF8 ALICE.MUDD
126,706,810 *0CE52650C36177DBF193D55B82181854B0BEB705 4IAMZORRO6
126,706,811 *0CEA034BFD791CFDC78C386C6D88FF6D617047FB allison.rand
126,706,812 *0CE11DF45FF5A45898B60B90D94FF9A46229A29B alloiknu
126,706,813 *0CE1C3BF9DB1B8C46DD72A1E869CA9B2328CBC15 alonzobutland
126,706,814 *0CECFC43EFDD2AE30B9ED15577B17D78E334B959 4MARSMILLER
126,706,815 *0CEE5196806EB44C53649623F15F32D2F713DCB1 4NUGGETBETTY
126,706,816 *0CE4F8F85D959E14F00FD3DE0F7721E5C1DB3D2A a?lum
126,706,817 *0CE233751AF399B68E7AAAAA19E4A58CCF91F38E 4OLIVENICHOLAS
126,706,818 *0CE7EB28DE677330CC255775FE8A1E1DE3135769 AlWU
126,706,819 *0CE9985510EF700A4E65597C92342D3A4A7B7D88 AMANDA-MACLAREN
126,706,820 *0CE439A4F9B1C3BEE81655D51734B1A4A521C90D ambershearer
126,706,821 *0CEB1005B7D684BBAA944C7F57FE6C3E2AB54807 AMENORARED
126,706,822 *0CEC658E408D0768EB7FBE8422972F71785C3202 AMETRISS8
126,706,823 *0CE87C1744D18FFC4D413A6717021C2EAC32BE72 4YAMUNAYOH
126,706,824 *0CED3A9095B7F285D15DCA2E5B52016C59B55DF5 4ZACLENOVANY
126,706,825 *0CE9C36CEE665BD3C58B2AC7FC75F547AE6D6C67 505730 PERUSTAMISVAIHEESSAPINTAALAOLI1812HAMY
126,706,826 *0CE606EB0FDB9BC43F6741385FF6D352B92853AF AMYTWINSED
126,706,827 *0CEEBCBB4FECC72C2F32440AFF4B3AB2ED6B7737 an8t8
126,706,828 *0CEBC661A3B8E29BED76A996C4E2D6E8B86FF313 571091 "ichglaube,dasswirineinefalscherichtungdenken.
126,706,829 *0CE0368BCB12468287814B8E3832DACDAFC3AEB7 583haiden
126,706,830 *0CED41D6FC10248F3DBF4D3232117C992ABC55C0 andydelegado
126,706,831 *0CE4DB407BC73CF63B5752D9EBF97070141E4A59 [email protected]
126,706,832 *0CE21898A58E3384B16C408C6250A2DAAB0C0D0F ANESING
126,706,833 *0CE374B68A89EBA155AA10B3EDA7AEB6391C1C31 ANGELMISENER
126,706,834 *0CEADB03726998E6B94721B4C918432409DB3D64 ANOKIA
126,706,835 *0CE579512D9C35B0225DD7B0E3864B942308F5F5 5INDISOLV
126,706,836 *0CEB4A19C851A1DEAB5607556CF90C23B17D65AC ANTIETJE9
126,706,837 *0CEED0798C1FE6B316652756D92A55969B2AC2AF 5 KIDPICS
126,706,838 *0CEB20C4FA53065FC6A3A15AE62378EC3A82F212 5MDMOKSEDUL
126,706,839 *0CE1CF368DC84AC967503441B31D14DFE2277DE6 antoniohalnon
126,706,840 *0CE4EAD16CFA5801B80B83BB6713F63E33B0EDBF 5NKARNERE
126,706,841 *0CE33E2DD4796E5077F16BE774D52FA99E35CE83 ANWT;
126,706,842 *0CE6401DA5333EEE05AE19C93332C67D5A7DC471 anzuklag0
126,706,843 *0CE861B430F88D2D464ECC512AF23555E3F68028 aoapm
126,706,844 *0CED9AED6E22F67833BB9E6A6FB528831A856DB7 5REIMPRIMEZ
126,706,845 *0CEC51B8AB79942C59450A6289A6126D24A3DEF3 a?)on
126,706,846 *0CEF8D20A1F7B45AA18F487A7DC057FF327A1B2F 5SOMRAADE
126,706,847 *0CED1AC7186A8AEC677B59877689D372B55D2B42 apkp?
126,706,848 *0CED034774DFD313BD9BC8EA9C2A704305F1E8F9 662ROBERT
126,706,849 *0CED1FDC5E0FD26FACAA01589542A8B691BF536C 6BUNNYGANDALF
126,706,850 *0CE5D72A36BAE4785495FCDBF7483D5A330E57C2 6-CHLORKOHLENWASSERSTOFFE
126,706,851 *0CE4BF9138039498EE48EA4D6ED9632FA67BFE22 ARIVD
126,706,852 *0CEC87C51CE8C4A48956757FE31C5BC42D058FC3 ARM1TA6E3
126,706,853 *0CE0971DB244207B01468DC45EA2A27EE82487EF 6DOWNBRIEFCAPSULECAPSULIZECAST
126,706,854 *0CE8DFEF2BB89661897653C1934B01F9651F4F24 ARMAND.SHOVER
126,706,855 *0CE7D70A1F01930379F82AD3305E3503FD89A924 6EMERGENCYMONEY
126,706,856 *0CE49FACD36EA77F19AADA772C024CA7F9EE362D 6,.ESTRELLA
126,706,857 *0CE18FAA8C0CA525FFB2F94F108C7B39BDEE827E 6HOOPSNELSON
126,706,858 *0CE86FCA530F48FFEE7ADD1C931B06FE6188BC53 [email protected]
126,706,859 *0CE0594913B0ED0D75E7A3533850FE6A8BBE3D29 6ITLAMORC
126,706,860 *0CE5AE7BD664DAE8CDDC690172CC8DB6E3BB728B 6KINKERIPIIRISSAEAEN
126,706,861 *0CE9C2BF3DFC5068F54226F81F87B431A7F70B61 aseverny
126,706,862 *0CEB0AE2EE97D27FF08AD06D126613A6646E37D5 ASHOUBING
126,706,863 *0CE963566B18BE37744498A9F64006CF112604FB ASNESIAGS
126,706,864 *0CE7002BF68AD4F15A1E48E4728A1D2B42002E62 aswormen6
126,706,865 *0CE6B09F055AADC4426D79C0E755EEA544EC17A7 6SAPIENTIBSW
126,706,866 *0CE3E626AB775C0625D7FDF426C2B2ABF2A89A78 6SUIYMOPA
126,706,867 *0CE41627629AFA683951FCE09A2710D68C1EC461 A_+TK
126,706,868 *0CE14CBA850AAEB932A8E8B0816A323C6C3FB383 A-TORONTONIAN-PEON
126,706,869 *0CE3897CAA74AB38A286E9262C96367D8D2ABF82 ATTAGGTTGTCTTCTTAGAATAATCATGTGAGTTGTAAGAGTTGTGTCTATGTTCTGGAT
126,706,870 *0CEAAA9C02D698C7BF7BDDE5A89A956C80B1454C aubreycrimin
126,706,871 *0CE6C6C38718C644D71031A828FD5289FC9D7100 7.amusement-park
126,706,872 *0CE3821C5AC2DD0D1C2E6D6DE3898E5EEB2B527C AUUW0
126,706,873 *0CE67BED9EE782227846476084853EF2172DBCB4 auyc2
126,706,874 *0CE6684826FDEBE911B3385222FB5BAB21C28AD6 7BERNARDTOPHER
126,706,875 *0CEA0487CF6653FDA8131925F4DE6293B812CDFA 7BSWPASCIUTIBSW
126,706,876 *0CE46B3EEA621F9630796F6921C86018FACE166C AVHL!
126,706,877 *0CE91E055675158B1E1E1EF8761C9A49DAC64641 AVQ2M
126,706,878 *0CE5602510908453D731868F85BB8765374C9A13 a_w;!
126,706,879 *0CE4B489278380D195A374CE710EFB74D469B696 7GARRETTPHISH
126,706,880 *0CE27B4D8CF78D784EF76CE2653328731B17B0ED 7GEDRAAGS
126,706,881 *0CE1EC9614E244586B6C9FB3E7DD46360C9848F2 axrfi
126,706,882 *0CE238A3D326F5BC0BE4D101BD2EE7480A5CF722 [email protected]
126,706,883 *0CE1014D174CB908934FD3C40245045D61A85B6B 7IAMMARGARET3
126,706,884 *0CE6D6F2C6D1E6FAC79DA8D7C7CCAEAE948B3644 aygwc
126,706,885 *0CEB57D48ABAAA86B48490AB629C36F0AB56C9BC AYNSLEYLAURIE''AYNSLEY
126,706,886 *0CE1DC8DF46F31E1DFA006DE0B7243FC15ABAC06 7INDENTERADE
126,706,887 *0CE69C6B52C45943F7947895A50DFEB24E68A2BD 7INTEGRAATIOPOLITIIKA
126,706,888 *0CE037E02737179B908357BC71DB559A281EC44A aytbm
126,706,889 *0CEB1003701253956130797D678AF9EA774E6A08 7JAMELYS
126,706,890 *0CEF8B464A17E4E27FE0B1074571522A57DB1831 7MADDOGPARKER
126,706,891 *0CE9BEB4BEB89E9E6D9D978C011409F4881C7389 7.nebenorganisationen
126,706,892 *0CE507CFFED3DE050AB7CD4B4FE46F7CC2EC65E8 7NOINURGA
126,706,893 *0CE8798B85D7BE2B2F4B92813E1C5710AA58C1C1 b+3/-
126,706,894 *0CEDB7BA2EAC2241F93648195570CD3EC7DE3971 b3xh_
126,706,895 *0CE0B411E865644DF32B73D4F654A5D846C63FE9 B68#T
126,706,896 *0CE7C804D88B7AF2A8D1968ACC183B044EBB77B3 7THIMORPH
126,706,897 *0CE2C03D416DD1E304D851B7B49A4A5EB8B7BD3A 7VETTEZAPATA
126,706,898 *0CE645671A4B50AA0D7D35D716ED036B38259ED7 7VIRELLES
126,706,899 *0CE866DDF20C68DB69CFA0444F73057B1C706F62 B89AI
126,706,900 *0CEE57108B9A9EEF583A253D81863C0199FDFA71 (^_~)***<=8
126,706,901 *0CE2A3E3F06B744626180F865B5FFE3237E95793 8######>~0~o)0(
126,706,902 *0CECD566F3CE2E84E6BBB071F455D3723DFD7BB1 8.amitai
126,706,903 *0CE931E990CCA2DDB2B7798FD11DEE4B2AE0C849 BAJCETI
126,706,904 *0CE1F914EE236A1CD92246287C98F0FA4B8ADF9C bakkalaltın
126,706,905 *0CEACC9C8425D5BF9154765BD4F6E06EF60301E7 balenciaga.22.0
126,706,906 *0CEB655FDAACBD7D27E62B54D32FDB539A1A6733 BANYULETHEBEST''CITY
126,706,907 *0CE54997CE1699A891F4E452BC89BD11A3EB5B57 8BSWINCIDENTALYBSW
126,706,908 *0CE5152A669DBB21F4FDC62CE441FA4D91B7323F 8BSWOAWANGBSW
126,706,909 *0CE17FCF5DAA17E2253629438E61A0E40370F832 BARSHINO
126,706,910 *0CEC533890F2EB5A4739E478CE440BCD4726989A BASCOVEBOOKSFALL
126,706,911 *0CEF1615E660D57D37DC6378CB06AC038B01F182 8===D~O~O(-_0)
126,706,912 *0CE72BE6C0E3560699C5FBBB2E7DFD91B5F447E7 bboytab6
126,706,913 *0CEC17A0DA53C1BC6BF16F233496CE0AD195768A bc4wy
126,706,914 *0CEFD1B0905894E4AB7DB06E13D2388D8808BEEE 8MAXIMEPICASSO
126,706,915 *0CE2E8D081D2F6203D6F7654D734EBE176BFCEFF [email protected]
126,706,916 *0CE5C6FBB9DE2977803C06A4F7A49DE2E13DC67D b,da_
126,706,917 *0CE2154045B63813ACBA936FE36D7B2DA01E0FD2 [email protected]~O}O{
126,706,918 *0CE2171DAEFC76C3E32F8F624E82CCE22A4A373C BDT2?
126,706,919 *0CE010529D287462E24B63F66681DF7C2F984413 BEANERJAKE
126,706,920 *0CE0906C9EDC5871C96CCD43AE6D89C3BC0610E8 beaviszephyr
126,706,921 *0CE566E8CC32A7F883CCD90F79B2751A5DAF3F8D BECKY.NUNN
126,706,922 *0CE589B25061BBC938699914B89623C3797AD439 BEDWANG4
126,706,923 *0CEC425870C7AD49AF4AA45146D867525189627F beeepbsw
126,706,924 *0CE0C9802A7E92724B4033491D30B216A0489338 8THECIRRUS1
126,706,925 *0CE0EB96C7C40763855D1780890A48180602D32A 8TONARTEN
126,706,926 *0CE3CDC0DCEE6EE538AAA9EEF18E96F82594CEEE benedictcaraker
126,706,927 *0CE75B2876FAA30A46E9487A0F84F905EC430928 benitoellner
126,706,928 *0CE9F5E2E598C12160A0CFF4B9E029447837D567 bennettsmolinsky
126,706,929 *0CEEEBB73939A5E658D4CE8D1D80D6831729F121 8XAPPEALBSW
126,706,930 *0CE8771A6DD21D520D66A146EDCA9F5F912330AB 923511 BEIDEKOMMENAUSDEMOERTCHENERSTFELD.
126,706,931 *0CE60206A48A857D92C19E02E1F1E0EA763AEA59 BERKLEYSQUARERECORDS
126,706,932 *0CE705681D141278C2E5C9DF0DB8791B634847C0 BERLIN - EINE ARBEITERSTADT
126,706,933 *0CE9E55546A0925ABE2331C3D445E6ED2A61F380 996870 SE-MM-.-HYV
126,706,934 *0CE40FFE59310659A750EBC1FF9E0809DA8CF8CD 998COURTNEY
126,706,935 *0CEA0396635A0AE9605CC57DFDFF901B41F7441D besorgung!
126,706,936 *0CEA22A3BAFB3C7DBDD520B5D7EF45EB3C43743D be/w8
126,706,937 *0CEF7121E344064810CDBEA525E39D2FF155A2F5 BF%Q
126,706,938 *0CE39C1DE640B3256B241BF5F48694B9EACC5024 9DEHSIBRUFER
126,706,939 *0CEA8C160D975DEC850D36C59587A1FA4F05D1DA B.G0
126,706,940 *0CE7C8E90ECF6ECF2C20C5958A1A16670FEA4402 bgmd#
126,706,941 *0CE3DD462470ABBBCF6CF113130A58F29C689BF5 bg"om
126,706,942 *0CEA2735AC4E321F743EF67F7A0EE7292C9EC319 9LLAMADA
126,706,943 *0CE0662DB6DBC86BE36D5F622DE94FA36933693C 9LYNFROSNE
126,706,944 *0CE788F8C8123930EC093BCD9A7559112FAFBB7E bi4eh
126,706,945 *0CECE02CCCBE6CFEDA201E929C06B70F7F5B8659 big.trouble.in.little.china.(disc.2)
126,706,946 *0CE0FF96BEB46DE75D441DDF1D65D8ACBB0B3769 BILGW
126,706,947 *0CED59E3BC285E29373F73337595A79B54E7DE04 BILLIE.ADONIS
126,706,948 *0CE090508BA480E92D8E6471966EDA96B6217F55 BINNEU
126,706,949 *0CE4353E19B6F1ACBD80E91231960FD5C57AD358 bitatifs7
126,706,950 *0CE76F03A2525DC57A2EF759AFD916BC90E50421 b/iw?
126,706,951 *0CE29992FD066E4D4D144E2F759D8A610EDD1DD9 9SAGRADIT
126,706,952 *0CE56E52685A37250DC1AD5FF2D5CB25B0E529B8 9shithead3
126,706,953 *0CEB64C3B8811FE12130EE86A1EB76EBA136E411 b/k"2
126,706,954 *0CE365361B37879F1F92E4AA220AACEB1428BEF3 BKb
126,706,955 *0CE7DC1080CC04F281FB73351C165B9AFD41288E 9SUNNYCORWIN
126,706,956 *0CE3B5742DD349F8FBA8BB250CBE663D9FC2DF00 9UNSTOPPING
126,706,957 *0CE83E0CE0DC273CD640D0B7099C4F1822F32A5B 9VERBILLIGEND
126,706,958 *0CEF438FF5A528D483E65D009253045438758159 BLAF8
126,706,959 *0CE27FC7660AC8DAA3C70640ECF1A128C9818488 9XXXXBIOLOGY
126,706,960 *0CED490A71C0B9FF0420F9FC4B97BE8B17046776 BLANKENBERG
126,706,961 *0CE35B9EF5FC9261EC8F3E736B9570D5F99E4AC3 9ZEHNWITH
126,706,962 *0CE499EC387F7650F629B24E14F635752C4880AD a_;?%
126,706,963 *0CE24E01B6AAD0124956E88EAE43002417872407 A0AUK
126,706,964 *0CE1DEAF99A6786F704CEA85A96125CADA57ED32 a0da0
126,706,965 *0CEE23424E75756C5F54AD73A0792BD277BAD700 A10663533
126,706,966 *0CE1F054AC504EC4A72C7885F2EFAF4ED9712582 [email protected]
126,706,967 *0CEEC0B7659699C58A8E8A1382BAFC1C3C89CCF7 [email protected]
126,706,968 *0CE4329A65ABF6951C487D56E9F4D77BF53EBFD4 blmpc
126,706,969 *0CEE7B70C58264F8564CAC4CC18D46E44187F32D blondieetoile
126,706,970 *0CEA5C140F81033CB71A181B715946DECBFCAFB8 BLQ)
126,706,971 *0CE3C53C8939D66E083DFFB581A92F00DC1C98D8 a2ls#
126,706,972 *0CE0D2966C4B9E05A33D7D105CF802421A0C83C0 BMGD
126,706,973 *0CEAE938E8EB6DC8C0ECA81098ACC496C56B0213 a";&4
126,706,974 *0CE47685159CD8E1612481DFC342AEC336FEE326 bmn+7
126,706,975 *0CED9D7C70EA3CCAB95D044A8024AB6C446063B8 [email protected]
126,706,976 *0CE18546D37979F942A7E1A92596643D116AB5B3 [email protected]
126,706,977 *0CEFA306F40E6776DB26286ADDC0E0B4B932765F a=5q6
126,706,978 *0CE5E3BBE8C624FF095BCDE1DF02FE38424D06C0 bobbylane
126,706,979 *0CEC9CCCF121BA70D9DAD103B0C367F45A3F9F0B BOBGU
126,706,980 *0CE01D7321198E362C6E2195ACE0BB600AF34651 a8#&(
126,706,981 *0CE117B25700823D8D76A52E96EB7001FD99E91A BOETIEBURGER
126,706,982 *0CEAA26D3E972F13209DFC7E3C9A6AE7CCB19DED BONTAJ
126,706,983 *0CEA884419BA36A53C16419C6E4E67357AAD4849 BOONDEN
126,706,984 *0CEC3534FE9367B40BFF87C98A21685AF5F72460 aa#1n
126,706,985 *0CEADD66FFA1372C5C12C6372C0FFC7821BD5D64 AA1&W
126,706,986 *0CE4A4B8C9FA81E2E7ABE407F12B4E865972FA6C AAA~
126,706,987 *0CE15BCFA1FDAEC52C95A2B11E1D500B43F0F2EC BORISFUN3
126,706,988 *0CE7D96F9E0C4B84E7A8CE7BF55DB985BA5DACC5 bossmodem8
126,706,989 *0CEB28316B20A3737CD1C7CB35711F359FC67AE8 AAAMW
126,706,990 *0CE928CA10980653171A68D8D822D0441D97FDC4 AAAO\|
126,706,991 *0CE9D8E5E45ABB57AC68195F6DA8DD8883979099 aab^/j
126,706,992 *0CE5BC4BEDCC2E6B3E48A6BE1337589A0F0AAE3F b#####p~o~ouu
126,706,993 *0CE7A9C1E89F153441AC4047D9E409EDDA5300CB BPU9
126,706,994 *0CE2F79C2F6555259628AADFBE0DCAE77DAFA5C2 a"acr
126,706,995 *0CE9C40408A984B579738DADE4BE5E56CE0AA7FE aad6/
126,706,996 *0CECD3478052725E2DC0607EDFE76D69233CFE0F AAD$E
126,706,997 *0CE83EA3C0CF594654038F8032DBF739F1D86A44 [email protected]
126,706,998 *0CED1DBFA5A5506826D525D69FB06511B0049F09 Br)4
126,706,999 *0CE258C225C931DA8D5B7CC013ECDEDD4AE71EB8 br4pe
126,707,000 *0CEA7067696A07254F0C4F85E4A21671F9CA886B AAE^Y}
126,707,001 *0CEFAF274AFE70E39E038D7DD19F76B8106C3C45 aaffg
126,707,002 *0CEADE4937F20272A1B4A755E0F768C93D0E4497 aalmerienses-c
126,707,003 *0CE8631A37CCBDBE5295CAE025712665F5A31421 aanbetaaldened
126,707,004 *0CE7C28811FAFD9D5C07A18296E274DDDB8F6B0E brandismokey
126,707,005 *0CE4C33EEB6CFA5A054A2604039092F0A6A62515 AANGEHOOR3
126,707,006 *0CEC9B8C263F25AED0ACB8AC8A68C0AFB03B9033 aanq$
126,707,007 *0CE57C1655AC0EEBE778EA672C342DE9086B3D64 aantekened
126,707,008 *0CE9EDE09D93936BD67E6100B41EC0A30B421C02 aaogi
126,707,009 *0CE4A4133FDC9F849917D0878BF2B60B6ED0AE5C aasted
126,707,010 *0CE34F0AC4B1A0ED25BAC544311658561BC737D7 brendanprophete
126,707,011 *0CE0081CBAF71ADDD272A2A53DFEBACBAB0BDDD5 BREVE988
126,707,012 *0CE2BBC9F470653C88B904893A96E281A78359F6 BROCKTON8
126,707,013 *0CE95E662BAB1F1933901AB2BA56420457B756BB abelziller
126,707,014 *0CEB16A7A67B1D5E0608869A542A0E691CCEE46F [email protected]
126,707,015 *0CE0C69DDB37EA94E25A69446E87764DE63357DC ABILEREN5
126,707,016 *0CEEABA1F3FFF0F44A905E189A6FAB7579BF9AAB ABJEBB
126,707,017 *0CE9ABA2A14F67A580923DC4FD5EDB99C32F24E9 ABKLEBENED1
126,707,018 *0CEA01C9FDF4AC042EE118DB29CB80C6DA2DEFDC bruciej1
126,707,019 *0CEB41D9A18F1D13E97387176A28E26AC48E17F7 BRUILOFTSKLEREN8
126,707,020 *0CE69429C006D6918842F15EE999E44C7FC68670 ABQO-
126,707,021 *0CE969B16A07D6195CB1295C509C8B32976125A9 bryanrasmuson
126,707,022 *0CEBBBEF95A0EB059489712B950A461A404054BA ABRAMMCKANE
126,707,023 *0CEA5DA5AA3824EC18C2042D48B4BCB6812B27E3 AC9RV
126,707,024 *0CEC0BF08671D0C8B1F9FECDE23BED3068506EDC ACASTIGLIONEDISICILIA
126,707,025 *0CE8CA04AD1EE23AEB6DE49B5D92D92BBCFB0046 ac$c<
126,707,026 *0CE9B63E6B445117BFD90C6DF38C866C5F552B18 acg;
126,707,027 *0CE3161CDDA8636A986345E66BE0F8165FB3D91E bt;/9
126,707,028 *0CE3BED6A606525FDD27EE9DC092A140C505B4B2 BTFG/
126,707,029 *0CE8BC748C3F8B4AC85686FEE75A7CE0C1E22E9C btruk
126,707,030 *0CE52C370A2FA4314155E8BB52E502F45A6E5BEA ACT-3:-"GELEITEN-WIR-IM-BERGENDEN-SCHREIN"-(RITTER)
126,707,031 *0CE7F19898F7B4AB0B68E1652C8EEAA2AB19093E BUCUR-GEORGE
126,707,032 *0CE73701EC978085923714E70C0A6E65C76E3537 [email protected]
126,707,033 *0CEE4A4B931D920B6797FBC407102B6A6757682C ADALBERTO.BOGENSCHUTZ
126,707,034 *0CEFEC3B8411AB4E30505F29D89CCA52DC862FA8 BUNDESBUERGER123
126,707,035 *0CE1AE71D39C65020003D0FDC863F86D69184618 [email protected]
126,707,036 *0CE094070A557DE98DD5FF1B6E3A3AB3FFF0870A adgange5
126,707,037 *0CE50A195A1591BDCD042435776D31D4CBB7042F ÄDGÜ
126,707,038 *0CEDE222E1383489298CCA08B575C370D8FBD719 BUSTER.STROUT
126,707,039 *0CE31BC74424582436D6E3FEB0941126891E6615 adolphmorelock
126,707,040 *0CEF8F5B0699FA905E5D429EB2890614288B8499 ADR
126,707,041 *0CEA1F7BC495F4B341DFE26D62AC8D684D6003AA bvti
126,707,042 *0CE0C13D4C5F9896BF5ECFE4D232FBD5995FB8EF ADVENTCHILDRENINFO
126,707,043 *0CE80A711CA4CD421F7F673AD189B15DDFEC2BDC BVW/"
126,707,044 *0CEA33C836A1EFB40BAFC90BD19CEC1605AF8A61 a:#e
126,707,045 *0CE7195246D46F0DDEEE21DBE738F997DE0F8A14 A;E
126,707,046 *0CE44245B90034D3004D8BAA35E4F1C432612F63 AFASIERNE5
126,707,047 *0CEAFE3BC0B5B6772C5F6B0E953FD9D31450E62E afblaaddens
126,707,048 *0CEC709013B76B1959CE83A82F24416D76838C2B BY$Q$
126,707,049 *0CE63A565595CC05D3CB4646A6CD9BC9E77118BD ag5l"
126,707,050 *0CECBF4DD4F8D0403F3D62888ADA95EA71787D0F AG+97
126,707,051 *0CE30794F095E6BFB76BF5C0D12F2B7A886C9D03 C!3E
126,707,052 *0CEF0FDA3109A3D06E5CC4281758DC0636526B06 A(G,U
126,707,053 *0CE88284E034170AB534C846B2C97EC05A82810C AHIMAATSIT
126,707,054 *0CEC1D2C9ADB8E5E41F94A6FB6F3F582AA34F003 c6&nc
126,707,055 *0CE3826FFE805152C6ECDCEC1AD96C0E25BA0593 AHRXV
126,707,056 *0CE31F2863C7A3D972898020C7FE51784375C600 Ahu1
126,707,057 *0CE7FD0D0C2114572C76B3C63D0E6851341292CD C8TVS
126,707,058 *0CE74089505C8FD06DB7D0B8F424B5924761B0A8 c9(ll
126,707,059 *0CEACE7BF3CA707629E5864F024A2833889E7A81 C.A?!
126,707,060 *0CE374946D14C434302B12426C2930A5DDA3F61C [email protected]
126,707,061 *0CE98CF38377F1A9106436262C7B5BE26574BA3B CAFREGRL
126,707,062 *0CECAAD96DE814C0BE3A852F5E5FD39F0615B073 aipxh
126,707,063 *0CEB898DBB9379D081A6A758D0B700C41E5AEB28 CAMERON.NIESPOREK
126,707,064 *0CECE23A22C8ABA4C8CA654FE65CA0EFCCEEF1D1 CAREY.KNACKSTEDT
126,707,065 *0CE94C8FA367ED3D361FBC20A509CFBD4DB26AD5 CARLA-JO-SMITH
126,707,066 *0CE776A5D7CB4F1C8E0B2DB843B7C1188D8E58AA CARLOAANENSON
126,707,067 *0CE19674780364F906E123532AF665B310CD96BA carltoncal
126,707,068 *0CEB9D9DF98E8FA8634FB9FB69B5E22324367566 a/l%d
126,707,069 *0CE856D6B0336E17AE7C5F7067692E830A0647E6 aldo.palma
126,707,070 *0CE4BFA1B5F6BFC3D7BAC1461BDDB3D3AACBCC8D alexander-paiz
126,707,071 *0CED970B7E467A09C9BCEC35EA242C96109FDC5B alexita.18
126,707,072 *0CEE0AF2D169B94B3D66FBCA41375FA373429861 CATHERINE NUVAL
126,707,073 *0CE0452EF4103BD0EAB50ACFC95F09CE228E7B77 aline $colour(join) @mp3about [double click here to close]
126,707,074 *0CE1CBC6296F142558B58BB585E62C0BD372BF26 almad2
126,707,075 *0CE89976AD0EADD52A93F98DEA137F19B6AE4CB4 Alone-Records
126,707,076 *0CEC4C6A1FC2E85C4EFFBFA1D06553019BD0AC94 cdhit
126,707,077 *0CE4A099EBA132070DF356D4D1823A77B313851E alvingolding
126,707,078 *0CEF03ED261470CF47DA5422E22D23968D6B8AF0 ce,&
126,707,079 *0CE4AD5EE8F9ABC8438B0F3118E6D7AE761B55A3 ce5!f
126,707,080 *0CE25689559E65D29AA0E5F7E9A543072FDA3D53 AMSAVE33M
126,707,081 *0CEEA81A48042BEC9C3AC37F7490291B87F4B535 amy.lara
126,707,082 *0CE66FC97C44BB1523ED763E4CEC2759FDAE2924 CESAR.LIGGANS
126,707,083 *0CE784FE26B95765D594A7CB92AEBBEC1701CD18 ANDREASFOREMAN
126,707,084 *0CEE942E08A823ABA5A751706E8D9BE369F36E77 CG730
126,707,085 *0CE2C0ABAA5866362D8E6C63B6C7FE800C7564EF ANGELEGTS0
126,707,086 *0CEC7EA1D66F62C53539979C76D72181CDD5A4B5 ANGELOPETZOLD
126,707,087 *0CE473053169DBF702F2CFD2D1C677DADBACF3BE [email protected]
126,707,088 *0CE25C0C7C7C880AA53BC0D351B1B9B952796D9D CH1ORNATNG
126,707,089 *0CE40FC2B34A22E1D649D1711F8BF0AD3E492B5E angwishe2
126,707,090 *0CE832DB9E48C59DEF489852266C0E3F49078D09 CHAFAUDAIS1
126,707,091 *0CE5AF9E3368DCF1C6A64A55A376F5A537E2DFE2 anita918
126,707,092 *0CE73D91AC223A8804C217EA80F125005F5E87E0 [email protected]
126,707,093 *0CEEFAE1768536F09745C65AE9187B3893105B70 CHANMISSTARNEWSCHOISOOJONGSLOVELYFAMILY
126,707,094 *0CEB671F514937B8B4AA36CB5B031D4CCDF4AD5D A&NQL
126,707,095 *0CEDE9DBB4AA2D13D9731BC4792B091C69BF50C4 anse.la.raye.distrito
126,707,096 *0CE12ED9E8510018415CE6CA1150372B83484F79 ANTHEM.(WE.ARE.THE.FIRE).(CLEAN.EDIT)
126,707,097 *0CEA19591685C4057E1B9BD7E1F4C7302C4CCC31 CHARLEYTOELLER
126,707,098 *0CEA66937588A62BB08070956A68780C58125D88 ANTISIA6
126,707,099 *0CEDBD47396CA8821A2901D5382D2C0A72F7CBED ANTOINE DE BERTRAND
126,707,100 *0CEC6C2C65144B9977934170CFCD0C6E3FEEA977 chasewenck
126,707,101 *0CE38106BA086AA6D4898D0C117350B54650A99B antonjandrin
126,707,102 *0CED7DCC487FFE031C2F1AC4741DB55118AAB4D3 [email protected]
126,707,103 *0CE947F878CD216621B10F217DC8DFCDACA08A50 ANTWANWALTERMIRE
126,707,104 *0CECE59BA38567B1A984CD9AF0746284D235C57D ANZIA 1 0
126,707,105 *0CE5E71B4847F949A88D89A353F30FFCD183FF4A ao!9p
126,707,106 *0CE0EB1F9A6ED3096D9780D1CBB24FB1E0F7ED81 CHETKOZEYAH
126,707,107 *0CED7759C1983A9619D246591018E42513C81192 a/oli
126,707,108 *0CE145FB7077B852C6A754E20898B2A07C5B6F07 chieft4incy
126,707,109 *0CED74383158F1BAC65CA19F4B87983712A0B178 china-cat-sunflower---i-know-you-rider
126,707,110 *0CE9156DCCDCFF9AD58BD582124CCD0C8FC66BE9 AP!9:
126,707,111 *0CE66E7BD72B5F5591B33EB3D6855FEB49E93BB8 APANTANAR8
126,707,112 *0CE5C1C52C6A0F9BC86F17ED457135D4FD4D6A64 APELIV
126,707,113 *0CE65CF8700B6C2673467B44D2647B34429FA659 ChNH
126,707,114 *0CE0932B0DD1C37D7084FD9CEC3FF81615742C64 chrisbailey
126,707,115 *0CED2571AF1919F84BDCABE2291514A6A403FEEC AQ8O
126,707,116 *0CE075CF83D8978310857D9F43C7FE8758020F7F CHTERLID2
126,707,117 *0CE802638223AF0200E82CC6D8C281185E4BB281 [email protected]
126,707,118 *0CE75147A26227E286F127146524B3C13D8A732F CIVSRPEMS
126,707,119 *0CEB47C24D361A432FA648733A1B63B0629CD515 CJBNS
126,707,120 *0CEE977BE8BFCC2888CF3F4348FB209062AEB9DD arguementive
126,707,121 *0CEBFCAD51D4DE52D98F4AC6BA8A8FE2EB3CCFD0 ARH05
126,707,122 *0CEEB496CA77470FC3BB41161F35F95CA4D2F5F1 ARIESX
126,707,123 *0CEBBE5AD43A9F5899EA3D9E809907C8A1C37E36 ARJUN SUNILKUMAR
126,707,124 *0CED62A94A3E230AA5AA83D6C157C5340FB86A71 CKFRD
126,707,125 *0CE942057F06C04AD1FDD8DD938F7866F371B761 CKSCD
126,707,126 *0CE766BF234B3341D01FB1469EC49E350B041886 ARTHURLUANGAMATH
126,707,127 *0CEE7D2E7828DFC3E38893E705F9838E4908947F claudgaffke
126,707,128 *0CE7277C0882F0F4D3AFFE8FD0D4889F79F39EF6 CLAYTON106
126,707,129 *0CE78B990D0DD8E37EDFE27125746016518BAF45 ASAAT
126,707,130 *0CE32B78D89AF91AFBBB31A8FF4D2999B1ED2B99 ASDFGHYYY
126,707,131 *0CEE43FB463F2CF5D3E1B8470E0D2E45AB837F08 ASHLEY.RIDGE
126,707,132 *0CEBF9064A2281C9B7A6C8F02286E9A295FFC465 C+LFO
126,707,133 *0CEEDE26A85BFAC70EDEA2AB4AECD722EEA1C093 CLIFFORD.KRAMB
126,707,134 *0CE10DAA276376AF1AC2BFB3C69F89582A555C0F CLIFGNA
126,707,135 *0CEBF8B7B9AB16BFFF7E0D9FB244DC6AE85DEA59 ATARDAGUELA
126,707,136 *0CE7CF1129A5BD2925567776BA14C6CD032D3376 ATATUIA1
126,707,137 *0CE656DA37D8BA0FB70118AAE259A6F748CA1245 atksh
126,707,138 *0CEB0BBCE75DFF67394FEC1A1785024C5EC84275 CN)A
126,707,139 *0CE52D2C6E718FB0FC2F035DD188C72842ADF44B co7e%
126,707,140 *0CEA7FCBD19A6608D9FCB11EDD30222C63783E7B augustinehelferty
126,707,141 *0CEA8CAE1E9FFC96BA98A77C36CC833DFA6CF0BC cocircuit8
126,707,142 *0CEC546430613E35B09AABDFA677DE2E6119B93F COFFEEDRINKER87
126,707,143 *0CE4143D935A2D04AC199E04B0A629FDFDAADAE2 colandreoed
126,707,144 *0CEDEACB9B87C7D71A681CB8FACC4C84F9BE0177 Ausbausimulatoren
126,707,145 *0CE7D4DF299F092E5FED3D9665CFFC809F47B0AB ausgangssatzes
126,707,146 *0CE98FC40BCDE62E1F90FF7C95784D8D88E69A56 COLTONDIBERT
126,707,147 *0CE19B99656245AB60E65DE03231B185739DAAB7 autumn-welch
126,707,148 *0CE9D33B752B0EAD0A0E5B7429D6859804A5347A a"v9v
126,707,149 *0CE3FF0C6809E25625E8CD1DDC3B38E051F078C1 AVELINO-MARÍA
126,707,150 *0CE29C465DE98EBC534D4CD82F8B9ECAF02E401C Concerto.No..3.in.A.major:.I..Grave.sostenuto
126,707,151 *0CECA1AD5F7EF6D0F17F3E1050108A24E98174D5 CONNIE.MACADAMIA
126,707,152 *0CE4F3E3ED23EE20D11D58633C8B46ECDBC8A983 Av?l
126,707,153 *0CE0FEC1DDD8E47C7354298950F2E2155445FF90 contro1me
126,707,154 *0CED51E14ECBBDA3CF2421449A086821D21AE63F coppin'-some-fronts-for-the-set
126,707,155 *0CE5D3821BD02DC60BD3F1326E1DA9C6C25FDA95 [email protected]
126,707,156 *0CE036D0F9D2A6E9BB35AD67B6C402895E6EEE19 awardment
126,707,157 *0CEB5EFA6D350D4839B6F6557CCB599A85961315 CORNELIUSFERR
126,707,158 *0CE9D5ECA5942009F962BA3AEB5C82CFEB153FF1 cortezjennie
126,707,159 *0CE6E58CE785085BB714905E2F45CB8A6A0BB76C CPFY
126,707,160 *0CEA86D30D768456CC5195B39A9DE03BDB2C6E7E c:\program-files\common-files\adobe\cs4servicemanager\jre\bin\dt_socket.dll
126,707,161 *0CE251A36EDCD57F34732B5F62D26F2DDDABBB63 c:\programfiles\microsoftvisualstudio9.0\sqlserver
126,707,162 *0CE16C490922AC05A64CAF90EE0F73CFE4EA0AB3 CPWIK
126,707,163 *0CE33B797D8DF525707687E3969675F7F70FABB3 B> ~0 ~O(^_~)
126,707,164 *0CE03073324C9D3D5E79AF55DAECA90BB05C2661 c:qpt
126,707,165 *0CED6A426278E15C8DE8DCF812DE0D2D282B34CF b1ohj
126,707,166 *0CE46DACC3BB6080A589ABEE15186F737999B728 b1ov
126,707,167 *0CECBCF5A743998A12F5E9E0F3FB46D51E2D2756 b2(tz
126,707,168 *0CE70856939BB9CCCBAD3E9E8C9EA7566971B967 b3:.
126,707,169 *0CE4EBB166AB194FEBF4714FDE65E1E02EBE197C b3pa
126,707,170 *0CE3BEDA4ADADF67F7B838F2CCAF97CF247B4044 B4VAF
126,707,171 *0CE18C4D3433C7182D3E4896245F3CF5882E784A b5o&
126,707,172 *0CE3D115C7D5C4FDF4E9A8A5480490C639BB08BD c!ro
126,707,173 *0CE2CA62BEE86236FBF2D01EE233972F62E45F35 b8aip
126,707,174 *0CE724DA36000828CE4B22C76BC5B54D98AAB714 Crying.Like.a.Church.on.Monday
126,707,175 *0CE03B9CD50891875C392F11A31E9EC5171E9409 CSU!_
126,707,176 *0CE2241B2E93ED5E5E7BB68572F324DCC71A011A BADTOWN-BOYS
126,707,177 *0CE2F29EA50AAF012A23E8207E8999B5ED7168B4 B/A-H
126,707,178 *0CEE3CF8BC7FE637E624865AE43511B5F317BF96 [email protected]
126,707,179 *0CE872ABEEB025EEB83C9E6E40C8B699BDA4CB51 bambool1
126,707,180 *0CE9762EC03B4981DD8CD88733155F334A0D1F35 CURND
126,707,181 *0CE375A48596DAA8943ABB95048BAB9AA41EECCA CURTISGOLDKLANG
126,707,182 *0CE6D1BCE0298F5EA16250FA4F9717E62EAC71FB CURTIS.TAVERNER
126,707,183 *0CE2F6D650495202D8EF3903A26CAA6031330FF0 cv$:0
126,707,184 *0CE88902EDB5CB2428A29AB85A7543AE7694C51B BART.TROUBLEFIELD
126,707,185 *0CE9A6EDA59661E1CBD479C4E436D9A5D57696C0 b$au
126,707,186 *0CEC31428B0738102F07DEC7DB2ED79CA387C9FB BAVARIABANDITOS
126,707,187 *0CED4947BB891E5F58FF80E8642458AEE3651B53 cwinu
126,707,188 *0CE8043DA2018070CDFE4C0DCDEF3B857F75A11E c:\xampp\perl\site\lib\modperl\typemap.pm
126,707,189 *0CE78BFB94ABEBCD1BF382F98A4F205AEAD97CAE BBPD/
126,707,190 *0CE01797AEE4534611E2E31F99EED126D2AC7925 cxtzm
126,707,191 *0CE114B29D7AFED4BF7BA29990992AA84A1AA280 cy!:
126,707,192 *0CE1E080ECAAD3109CDE7C1E49096FB50D189E20 BB#UF
126,707,193 *0CEC4C4AF7849599C1E9C5316D9E717240E71EF7 CYPSZ
126,707,194 *0CEC3822D9BD66E9B2D0AEB060961DA7CE0D4846 bckwc
126,707,195 *0CE00230FEAAB0CBAD4C3CDD98552795BB24AABB d+/=
126,707,196 *0CE698CF815A706D5277B0E3EBAFCF338E7DD1BD d0cumen7s
126,707,197 *0CE2F1E556A6E373916F17236C5AF956DEF7057D bddv)
126,707,198 *0CE150A86550872C014334567F600BE75F3BC600 b$dj/
126,707,199 *0CE0E656F62E30CD09A5F6C9ED127D1BBE9EB10E D1E$T0CK$
126,707,200 *0CEC81E3405F5BB6C431FCB3A8330D88A786B4E0 BEARCAT
126,707,201 *0CE47BDFC11055B484B6F428F16B1F0AE03B58B8 bebeyeray
126,707,202 *0CE65D799002D67128FB86D0900BF2EC6F7A3ADC d3bqp
126,707,203 *0CEEF0B206CCAC452C398566231ACD5843385EFE [email protected]
126,707,204 *0CE90407887DBB6AA20CB0123676821F5D58C184 d3l"u
126,707,205 *0CED40CE9195E0E0449440D2856A5A3F27438086 d44bw
126,707,206 *0CECCBAC67C410D0B5B405836DECEAB4B9D11D19 [email protected]
126,707,207 *0CE0B0FA89A4482702C67B92E7A83012ED101D39 D5F
126,707,208 *0CE1CD5E8A39F059B7D5319C1A7C2E38A40BB85A d5xmm
126,707,209 *0CE823D7BFB46B70321C45558C4B5F15B7BE4721 D=7PU
126,707,210 *0CE515D1B7C38E42C7FFB96D020532C64BF6A8B5 BENYALEX40000
126,707,211 *0CE4366E465C376E011840B85E4CA01815A18557 D8(KX
126,707,212 *0CE3C258EBD9F89145C77C9406B6302161CDF0A9 BERNARDCANTER
126,707,213 *0CEF42603EE8BE5FB347514594BCDD760C4BC3B1 DA1%0
126,707,214 *0CE0C0CA3B4300337B16A41C6FC634BB9AD38707 BESPIKAMAGRUP
126,707,215 *0CE3D887EA6E804D592196E18DD9E02947467E13 besugars4
126,707,216 *0CED235D04E865FD279DD21F9C0F131FE14FF8C5 BEVERLYKILLS50187
126,707,217 *0CEADCA6BDF5A4456A1439FC84E8E7465D6E6964 [email protected]
126,707,218 *0CE500DF25596CD0C185C5CA2C9934F1CD254586 daleeckrote
126,707,219 *0CEA5935352D44AA26EE390179CA91D6BFCC985D DALEHOCK
126,707,220 *0CE14BC320A948B38971F5A9F7DA64E85172AAA9 bfu6e
126,707,221 *0CEA4C58DF3593E37356221FAEE2A51B55B83092 b)g2+
126,707,222 *0CE4433F85068ABC89D05D2246B0833E71000A81 BG9H1
126,707,223 *0CE6DF8CF59D4FB30F1D83F4E29541654D683217 DANIELGL
126,707,224 *0CE9A960FBE8ED8E59E20DFB4B87E8DCB4C658B1 DANNYRICHEY
126,707,225 *0CE87E9394F620A5DEEA77EAC391FEDDA9AE292B BH#AC
126,707,226 *0CE5081C9C4AC32EDDDE2EC65A1D776CDBF95737 DANTE.DRIGGS
126,707,227 *0CEED726A70BE767F86ED28FF8319FDC49EA7AC2 DARELL.BONELLI
126,707,228 *0CE064AFBCB74EBA38608B6E3588A8EECB645E6B DARENROBERTSON
126,707,229 *0CE69F17A8FBC44E1547AEA1E16D0A8C7E151114 B;HXK
126,707,230 *0CE95AB3CEE2191D21E204A6C72E9D2D18162765 darrellnicolosi
126,707,231 *0CE0FF93384B34A639637649D0A7AE8A15C0888A B+%I0
126,707,232 *0CEC713F846305DE61924EEE8D4B463EBB5A9A24 DARRICK.MASTROIANNI
126,707,233 *0CED9F5BC714DD83D24C5D0779FAD2B18F531395 BIDH
126,707,234 *0CE058E13572324B5F28C0ED0C3AE6FF0D4C5A0D BIfg
126,707,235 *0CE50EB1BB7E6672784AB190A9CD71222FC62F7B BIGBEATWALKTHROUGH(FEATJEANGRAE)
126,707,236 *0CECAB61BCA1658B730B998F3836E41D486BAD5F DARYNELL7
126,707,237 *0CEFE0A8222467FA5F639ED8BA8AA9039D096B92 das-stopplied
126,707,238 *0CE97F7B14AB258BECBFD716CD28018F822B2E3B DAYYC
126,707,239 *0CE7A0FB5A557D8E2E9346DA197F7EB370F576CD db&0k
126,707,240 *0CEBA440FDE1CD2D7618D61C48181F78673FFF00 DBCHU
126,707,241 *0CEFD240F86B5F01C793A0F6A78B2844338A91F2 dd!.a
126,707,242 *0CE9AE696D0F1EA5C12A79400AC214DCF38EB2C9 BL3WL
126,707,243 *0CE70B7460664381AEEA6071EF1D21682296753D blh7u
126,707,244 *0CE2B61F011CBD89383794191F6AFCF19DC86CCE DEA9W
126,707,245 *0CE2638D4A06CFED348203BE2833BD04DDB163E0 blir
126,707,246 *0CEAE4241674FCAA8167203BD7F8FC815E4E7F58 blkn
126,707,247 *0CED54F2720FD45A84BBFCFBBAD52DDA58813D99 DEBIDA
126,707,248 *0CEAC5FA30D56922D887D086BDA23B4A0A18D979 blylm
126,707,249 *0CEDBB97B9E0B2837A5458FCB5AB3D1202C438F6 deli8era+ing
126,707,250 *0CE7F8D2AAF379A163D4F4D37259F7823ED885BA bnnebger2
126,707,251 *0CED84996746440B0C6343BB47F33548E380D2A6 DEMIDE
126,707,252 *0CE0A0F21692598B19DCD1997ADF53B2ED14C0CC denise.purzycki
126,707,253 *0CE0DF466ED5865E5F13ABF50ED7AD84340EB435 BOj7
126,707,254 *0CEE5DA12B1BE88430657A223B9800BABD3B69CE BONB&
126,707,255 *0CE61EAEFB0CA83048487B7B498F75E6321019F6 DERICKGUNYON
126,707,256 *0CEAD449C3A4F8C362F78CAA7AD601B74DCC6B27 DERRICKSAWDO
126,707,257 *0CEB8DF516FE2AF01FEB48B8F2FFA2FA3A815AA3 DESTINEE947
126,707,258 *0CEECCE76F30F84AEB7F9AEA93DB21CECBE45079 BOTHRIOCEPHALU5
126,707,259 *0CE812AD0D763023F2189DF9290330E19B806A64 BOYA1
126,707,260 *0CEB443DC8AF77C7F017F1EEB2BD15C56E6F3265 bp *(><)
126,707,261 *0CE59298442998236610C4966EBFD0FDF999602E b------p~~~(0_<)
126,707,262 *0CE525C783CF8FCF3F541EFFC6D7808C783F1D74 dfsel
126,707,263 *0CE28D84926D827EAF19313B38078A3961DEA32D DFTEP
126,707,264 *0CEA5666649C7FFB9E428860CD73C15C86574D8D dfus
126,707,265 *0CE849935E22D0FAE3181C127D19967128A402C1 BPFVG
126,707,266 *0CEE235290AB692F3A854D0A50CCEE554BD3E51F BPTQ4
126,707,267 *0CE5D2BFA9D2435AC1BC260DC7ACC54E1286149C B$Q1D
126,707,268 *0CEC12672448AB850EF41D9D249F363306E00946 Bq2;
126,707,269 *0CEF7CC423F28D129CFDB6A724EA1C69D162145D BRACEARMOS1
126,707,270 *0CE9CF02485DA1BE4062614009FCB70450D970D0 BRADANTS2
126,707,271 *0CEAFFC32EDFB0B0193C5364D15A6E2E4495665C BRAD SILVERBERG
126,707,272 *0CE3D39E97047735823444514374F125CBBC7A10 Brandenburgisches Konzert Nr 4 in G-Dur, BWV 1049: I Allegro
126,707,273 *0CEF6363F9558A9F0CBABAD8F1597263E3EE9D4D DIFUNDEMING
126,707,274 *0CE8888B030CE29E1CBA5E54160FD648B16C93D2 DIPLOMVERLEIHUNGEN
126,707,275 *0CE0D1BA5452BF456A623E5F1494EA4411D02C5D DIRKEGGLESTON
126,707,276 *0CE5884503E99668EE006F5EF7FDFBB26AAD5426 bresyngging
126,707,277 *0CED5666C847E281465D3793622365F2D08F0D90 „district“
126,707,278 *0CE5F0904A338C6294C17FAC151DE6DB9069A8F8 brihrahmana
126,707,279 *0CEC5EA9B17ADF36AEF74D0EFFC5AF27883B51A1 bronte.jones
126,707,280 *0CEAC2585C5DE0C41E67DF73A7F007B7B485B0AF djskottk
126,707,281 *0CEA087926A7A178A5E264E0C8326491518B6559 browcewa
126,707,282 *0CE016177C51D8508EA9FEE1A2B06F33DA27DDE9 ,dk
126,707,283 *0CE09AED0AB02BD2D08EC5CFB1298DF5BFC9C6C0 D<K-
126,707,284 *0CEDCC6BF3716AD1C70E5A7A118F1037BD88FA84 dk94a
126,707,285 *0CEAB9855FBA496C5F13934F7E06B1E5572DE563 BRUNO.BUTTARO
126,707,286 *0CE2B0870058368DC430069EA696210627CDA68F BRV-_
126,707,287 *0CEDFB41A48E647B4CB79BFEA37C9830A9A68F0D d/kw+
126,707,288 *0CECF913D9EABB3BEFD9A8C258778B2133E507C3 BSWEROMREHTBSW
126,707,289 *0CEED0640200DFB74FA6C581E28F756041535500 DMMC7
126,707,290 *0CE517D0E89A8D3D719AA8EB3F3586BE7D158FF7 dmww=
126,707,291 *0CEAF2C154E8B45A39A77A2217BB4A7E21818524 BTN6P
126,707,292 *0CEC178A276720F324431E69BF3F89AA7EDEF543 bu0f
126,707,293 *0CEBFC1E8BDE4C25F61AEC992CD8A9C783CAECA4 BUDDY.LOW
126,707,294 *0CE99EEA799BB817611080DCB4137F89BFEEAFD1 DOCBAILEY8
126,707,295 *0CEA03396B29B393393FD2FE0F37E855431BB28D BU++ERF!N9ER$
126,707,296 *0CEBD2192E65038D2890952D70F55E632E736708 [email protected]
126,707,297 *0CE25110BF1341590D0676EDAE249EFA636C8EE9 DOI101142S021827180
126,707,298 *0CE15312A0507F43AB47CAD54FB4D1219207D228 DOKUCHAYEVSK
126,707,299 *0CE01FF0E7BF9CBD1603C9E1A88C4795776E7F41 bullpapa
126,707,300 *0CE659DA331CC5F321030E300AEADE17000152A1 BU_QN
126,707,301 *0CE8AF9278CFB7DD98BD69F1CF3CDF60E7A5B4B0 BURNIEBOOZLE
126,707,302 *0CE2472DD37B57EEB4B4F29DE27F95D6CAB19214 DONCROWFORD
126,707,303 *0CE22FCC3DD73FBF5216554E038A088DD8D82636 DONFEHR
126,707,304 *0CE2910EC3D2AC4B5AF0CD7A9C134FB9D9A9B753 donnystonerock
126,707,305 *0CE49C3BD107598381864FB49590728759D6263A doodgereden
126,707,306 *0CEC2BAB4E5328A6C14D133DE0836A192C2EEC5F dops%
126,707,307 *0CEC7B55111D4CD3010D4868BEE4FCF8184902A2 DORIANCLEERE
126,707,308 *0CE179121446B52A5E23FF6041A964C69B5E5CCC DOULFAKKAR
126,707,309 *0CEF88F7A5F1068D50785BF0C9E563FFD7EA5649 DOWNSTRO9
126,707,310 *0CE4D81292DEC2F4D4B2581BB72808D8BA9D7468 B_ZON
126,707,311 *0CE931AE8B1661BF7665A004D3507C07E9768F48 dp=ox
126,707,312 *0CE99C2BECA7B6E5657DED80F65C1F365CB35C72 C0DWF
126,707,313 *0CEDB76837D28181C0FC0C0D250A095A6DE6FC1E DPVM
126,707,314 *0CE534EE218123D6023A2C88ADE1EA03B663C26A [email protected]
126,707,315 *0CE5A28DAAA6942FB89F0871AFDE172D3F8EDA89 C0MBV
126,707,316 *0CEC0DDEAB137DAB88EA00958193451CCDCAF39E (~_^)`D======Q
126,707,317 *0CEEC7BB1ACCFE71FA6B5CD2177E7B9DD26E3DFD dqw/d
126,707,318 *0CED4537D15956E47E7B1A0CD5EBF12FDD0D7406 DR_C
126,707,319 *0CE2EC32DB8DCC02A99F713CA37515715C0BFC55 DREL5
126,707,320 *0CE183FC7999BAEDEB17174B6350D955AB7769E6 DREWSLADER
126,707,321 *0CE5AFE15E8430442508BC6492DC16583E888E1B DrK)
126,707,322 *0CEE53F482E220A92FB104BDE5E3FE76BBE38982 c4mp4n0l091$+
126,707,323 *0CE457787F009125C9AEDC61C0DD906CC028E5D1 d$sjo
126,707,324 *0CEB026AB1358283CFC3BCF8A1B5CB8F50165248 c\9q
126,707,325 *0CEEF1367B0B2119E55DD510B4FDC672194CCDD6 D?T!U
126,707,326 *0CEED52B65BCC7548E3C72AFDA5F77BBA6B888BB CACHERIE2
126,707,327 *0CE4F71F22F2D8E6EC6980FA245FA8B9DCF78D65 [email protected]
126,707,328 *0CE5025FAA5A89E81FF735F4098283DC0999714F duck416
126,707,329 *0CE0152264B719021F291723B3533E856FFA5D9A CALOY-TAN
126,707,330 *0CE308E43BA94754F1A239E10B0FA38225E8F894 DULCEETDECORUMEST
126,707,331 *0CE6BF59EE54C893543408F434EC85AA2DE7BB89 DUSTYBAGGIO
126,707,332 *0CE579E6712E5B8AF608CF6CC48B828A5AB58919 CAREYROSENCRANS
126,707,333 *0CEBD4B7755BC2807F0CB7C55F925DD14332328D [email protected]
126,707,334 *0CE3B6CDFE73CB78EEFB27898456666DC07E0739 DW#FK
126,707,335 *0CE7B93C11BD4DC78F0872C454DF6F8122F16D76 [email protected]
126,707,336 *0CE0CDA6C37B0680E50BAB32FB6F3A35405D7362 CATPARKS2001
126,707,337 *0CE9D60BF9F1BCB1A53FD09D1B180B261BAA58A5 DYKn
126,707,338 *0CE001F93529AC17A9FEB2D9F92D7F80A11286AF c&/bi
126,707,339 *0CE13B6E81E646838B6069E29CD785265797B8EE E*+
126,707,340 *0CE050A0A24041FCAB6BAA166FC57887C5CF98AF ccvwd
126,707,341 *0CE5A2DB098784FAD24213D98A52DF2BD4C1344E earnestoland
126,707,342 *0CEBD5E44DF6EF0B63265459C8221252589572D0 [email protected]
126,707,343 *0CED4CCD89A1FE7005F1C0C66FD57BA93255F932 C"DO
126,707,344 *0CE1B8DF4D9432200FFB230B4D602402F17DEAEF [email protected]
126,707,345 *0CE432F7CBFA73AB298204ED3EC0C577D31823AD ECINEREB9
126,707,346 *0CE32DCE1E7A4FE5D317DB6A59C72F2B8312572B [email protected]
126,707,347 *0CE3C5C117E542296420F44CFC848B545D8BC983 EDITOR.FAITHNEWS
126,707,348 *0CECDDA7D27E7D8DC7DFB00F36A90BDFE00366E2 EDMOND.MANNSCHRECK
126,707,349 *0CE09C4FD47913D7F3E04319F3F48327CD5B19DD EDMUNDHEGGOOD
126,707,350 *0CE5E88201D002C534B603133149595DE6488B6F CF:%)
126,707,351 *0CE1BEFB5CC6CCD46B1BAE784E59E11981C6403D educato5
126,707,352 *0CE1C84AB225CE2C331C3491865F0F3CED506EDD EDUCTION
126,707,353 *0CEBA350889C9040770BC6C7FB6EE366B17219FB C#G
126,707,354 *0CEE51904FFC7FDEAC994F4B1237311C16AE41FD cg5
126,707,355 *0CE3AE865791C68A124CCC7A11D1AB6915CCC20A EFEC
126,707,356 *0CE8172F18227EE08EB25ADF32A9526F44E722A1 EFINUF
126,707,357 *0CEAA75843EC993750454C47C30EEBEBB1D041C0 EFQ-L
126,707,358 *0CE17D9F43B40ED54D398047356F71B9E1C681F8 EFRENPOMROY
126,707,359 *0CEBF7626588D65202A66AC2C4A16B529467294D EFTHIMSES
126,707,360 *0CEFEB41320E1C47BAA14F78B5F9C96052663608 c&h^
126,707,361 *0CE8B4B82D811C361F046FD9847BB5ED343324AC eht_a
126,707,362 *0CE3EFC70220C7BD324BAD433EA7C43B0F954AB7 [email protected]
126,707,363 *0CEDD8ECD1E316B87CDBB9DD10811536CE5F17C0 CHANCESWATZELL
126,707,364 *0CE6786DAE7AD9FB79829B19ED10F5CECA6B2505 EISHOCKEYVERBUNDES
126,707,365 *0CEA2FC54946664A48C14E824070C6A327D246A0 ekca7
126,707,366 *0CEADA58CA028600BD484D8855AD024898BD4132 EK.&J
126,707,367 *0CEF977F807EE4101A82C916ABB7061B6FE680B8 ELAES
126,707,368 *0CE461AA82DF4B1AF89EA8C7DDD5C70FD6AFB9EC ELDRIDGESULZMAN
126,707,369 *0CEDECEF872CBF72E7922F5B4B505A6996FAC17A elegiarvm6
126,707,370 *0CEF96E47EA31A84ACAB5DB4B7EF896EAEE0615B cheryl.oreilly
126,707,371 *0CE7B41819CC69942EF75084E06279466B7D9596 ELISEO.PIKE
126,707,372 *0CEF541BC3FC112B709DC8061F45EA3271A6515F CHETKENDREW
126,707,373 *0CE641ADB717078756EB7C72B6D916E61E278E3B ELLINEER
126,707,374 *0CE8334CAE0B254F414E7C06551C8D83AC7A920C CH&JW
126,707,375 *0CE1DF191D6C5D2A81354E88870A32D189B1A12D ellisrenert
126,707,376 *0CE4DEE363B118E4BFBF39D38EBAE751ADE0E366 eloydakan
126,707,377 *0CED405FF34E3A09F451CE2F7FEF9D2435A9AD7C chrishana1
126,707,378 *0CE9F6357C99535058EE8BAAB5CA8415FBCA5A26 CHRISTINATEVES
126,707,379 *0CEB549794458B59165744E1C19456D152EA0CE8 elts
126,707,380 *0CE1DAFD0DB12A987475AE0C97A0BD80F99E7352 chrpq
126,707,381 *0CE414735318163ED78A21FA1CE1F89F8CC4EA39 c(i+1
126,707,382 *0CE1FC985DB6706033DE8FF43D89681A2074031D emilebuhite
126,707,383 *0CE2F12913EC692DB378925D6196921CDD03212A emilemorenz
126,707,384 *0CE0DAD7159986226A2F895E56EE02321984FF54 CIERSZEWWO
126,707,385 *0CE2FAAD916836B2D5A82EF3D6F4AD5034786527 cim1-
126,707,386 *0CE904FCBE184D79CE5094CB812BA64AD2EAD041 EMMETTCONCINI
126,707,387 *0CEB9600BFCBEF2A45DA8C1223A4E426E192ABB4 EMMETTRAUM
126,707,388 *0CEF3DD66CE4EA025694C0EAB1CAD13C2AA29080 emv4(
126,707,389 *0CE95C098F0EA5A7849F41656C415FDAB1F66793 [email protected]
126,707,390 *0CE2EF29680349957ED69606C6C71332276DFFB4 cjlp+
126,707,391 *0CE1BA10F5FE02C4B8E06B75FF99E96135C1A746 ENEBEILBBING
126,707,392 *0CEBD88D6F58E2350B17D2AAEFE51FD5B6B20ABA ENJOY-JERUSALEM!
126,707,393 *0CE9F6019810BAFA40FFE8DB54DC5D8F621F2E8A CL8HI
126,707,394 *0CE99C8CDA7159187A3C63D63574A146BBF2F78A CL8)S
126,707,395 *0CE8C5439543E581F73321E74007F2999AD6FB4A ENQ)A
126,707,396 *0CE0D93535373FBE7EA4C9DE4EEF69F2DC5EC05A ENRBG
126,707,397 *0CE43E6D45E3AFC321C0A4C98DD78486D24A27F4 enzj&
126,707,398 *0CEDE05B1EA6537406EFD7E477E50565B9B2F8FA clementsorensen
126,707,399 *0CEE08A3F96198EB5BD32C4132BE4B908C954BAC eow=c
126,707,400 *0CECD5C90C1B5FA4622806A7B301F329125D6F2C CLI9
126,707,401 *0CEEE7472E3FD218A4E56068A7DD2B0BC6897B07 CLIFFNEITHER
126,707,402 *0CE30818AC5D1313B9070C090CE35DE7877585CD cliftonroosa
126,707,403 *0CEE954578A0001E281D1788463A4E1059310449 CLJ+:
126,707,404 *0CE8C616108BB4A20FCEC9489C932E70B4868194 ereis
126,707,405 *0CEBD0B942E5DE4EE4A5641235C5E71D4D6C9A81 c,(lp
126,707,406 *0CE3570F30FC3E55CAD2C6670D00EBE01E53A86F ERICKSTANISLAW
126,707,407 *0CE7ECBE592D5FD96CF263EE7DB5D2885E9B2686 CLYDE.BURRELL
126,707,408 *0CE8C875A6255816873FCCA9038D4BA1E8446541 C;M#3
126,707,409 *0CE94FADCD492E1408044DC4E6E0E6FA2D50F203 ERNIEPLUCK
126,707,410 *0CE89D7671FEE494D20909283275477174E9385A cmrw"
126,707,411 *0CEFD20AB6F67E11EF5460F3AB5DA12C1579649F CNCB
126,707,412 *0CE91ECA643E9742985D389ECE021F95A954113C cnm/
126,707,413 *0CE223E6F01B1499DBD1CFD314AC8B97A30AC102 cn$sd
126,707,414 *0CE7D60BE160DED0EB102C54F79034B222D14341 CODY.DICKENS
126,707,415 *0CEDE9416264B3BF4042FB069F7A1CF28FE0BF67 CODY.JENAYE
126,707,416 *0CE77EEF53D96C6D41D1E326D8556714ECECA9FF CODY-TOTMAN
126,707,417 *0CECB1A8C532CC89CD743D965D4A1B453026B3FD EUGENEROBERSON
126,707,418 *0CE7C86A524A987A659EE1936DD7814E3B92DC15 EUGENIOELLERT
126,707,419 *0CE2C36AC107D02007D73CB990E821282D76452E COLIN.REIM
126,707,420 *0CE29069D702C611D44B5D6DA27F5DF577AE229F eugeniostier
126,707,421 *0CEC35FDD807E0A77988F7FE424502A669348310 colinweigleb
126,707,422 *0CE670FA946795291B94E9581B951FAF59640628 COLOMBIAPRODUCED
126,707,423 *0CEC8ED4E5B7E6F35EE7ACD874EE6FA6EC24390F COMMUNEDWELLERS
126,707,424 *0CE90828202D60321A170BF4C4DAE336E1726CDD CONNECTING.THE.TWO.COMPANIES'.WANS.</P>
126,707,425 *0CEF6273881A6B08ED026200A12127A971FBDE34 EWALD_VON_KLEISTSCH
126,707,426 *0CECB46E6F079362DC2A26729181D2C74C281EF3 CONTEPERAL'INTERMEDI
126,707,427 *0CEC95067D622A2A550CCBED1D07C7DA98EC9625 exploring0
126,707,428 *0CE68629048A308890BF3A621A0970A796E1625C cop2x
126,707,429 *0CEBD569D27BC4DA2BB2C48471F2ECBF6EBA014B exquisite manners
126,707,430 *0CE7389EA3630133A87F90564E4682ECEC4FAD0F CORNELIUSNYLEN
126,707,431 *0CEEEE0F3840E823C12A993BFC72A151106641DD eyukd
126,707,432 *0CEEB2620C801C5326486AA2A926FF7149605810 EZEKIEL.METZLER
126,707,433 *0CE23C830C31FA13D54CB27E9DEB8133D6D155CB EZEKIELWOJEIK
126,707,434 *0CE8C6E1D7F33BA417FAEFF347181AFB59C5C00D cp4yc
126,707,435 *0CE8B22BFAE24E1F4FC202D186B5A24A864CECEA CpDq
126,707,436 *0CE6EB3A3483E6FD2AE5D1CBC17BA2AA7217C635 CPFY
126,707,437 *0CEA86D30D768456CC5195B39A9DE03BDB2C6E7E cph)n
126,707,438 *0CE39031246E823D89AA8A59127657BCE31079AF c:\programfiles\adobe\adobephotoshopcs4\lmresources\ja_jp\retail_activationzdct
126,707,439 *0CE36BDBF1FAC17CEB1969518FA844E3A12D2185 [email protected]
126,707,440 *0CEAA53B6DA0DDED64B6337DD426E3519CACDA6B [email protected]
126,707,441 *0CE3D6E4039B8C0AA99E6536862E7D90A63FB9A3 [email protected]
126,707,442 *0CE9D0DFF96F231EC5A88EE6F8CC17EC4FB1E860 CP#W
126,707,443 *0CEC50A0F7D44DA96E2945D663A59D1E53EC121E CPWIK
126,707,444 *0CE33B797D8DF525707687E3969675F7F70FABB3 fastnachtsmarsch
126,707,445 *0CEC951CBAA7891884FEBB68E69ADD8E1A72E907 CQAC;
126,707,446 *0CE20066113DF44FD9B5DD99C9FE926DD67BB28A cr0xa
126,707,447 *0CE69EC91A131239EA907F856157355EE6669DA2 CRAIG.HAEDER
126,707,448 *0CE76487DD888EFB959E870D7574A77008018476 FELÁLLÁSÁRA
126,707,449 *0CEF5FBEF30A22085B7F2AE6E37985E77213704E FELIXBRENISER
126,707,450 *0CEAE8AEFB887C4107476B5259B8BC9D838064A5 crd1i
126,707,451 *0CE699FAB2E85DDD693906868E34EC5BFEDCE9DD CRICOTHYROID
126,707,452 *0CE293557C114EA27291B39F2B405616402A01E3 CROSSFILE5
126,707,453 *0CE8ECBB7BCFF1DCF90187A706EB12AAA0F5A6FE FFIRGCI1234
126,707,454 *0CE0B39BE31840C0D29DFD20A5B088D81F223B1D [email protected]
126,707,455 *0CE3E70B975283A5E2293601AC01E5AC8ACE2DF8 CRUISETALKTRUE
126,707,456 *0CEAD28397BB34DCF436A8C2C21A6DD8532BC0FC CUBBIES5
126,707,457 *0CEA87366382388A579AF651720E2963265BADF9 CU[email protected]
126,707,458 *0CE474D39CBDA693AD3B34DBFC71AC8DBE0A3906 [email protected]
126,707,459 *0CE62C43B9D74F3CAD7222AF43E0F83C49104612 FOMRMATUL
126,707,460 *0CE155DC3D52CB9A5E9E11A6B785979E39A16F7F cum4me2x
126,707,461 *0CE1BF0162B059F0366A2AE5BA9E58DAB2D9B454 ford1377
126,707,462 *0CEA800033B66B35B6AB70396855F267E11ACEF7 FORE$TW4R
126,707,463 *0CE83E5B1CEB1A6ED7DD184E036792F0B4CEBE2A CV-4G
126,707,464 *0CEB2767D365193F37D505B19981262306DFE7F8 FOUR WINDS THE WALKER
126,707,465 *0CE206EABD4FF2D674310394651AC975A9293CD9 FQGGG
126,707,466 *0CEC1964B9BEC8A4336DDD4D532DD81495C2C2EB CvEh
126,707,467 *0CE1A6F2E06002643E7945DC6BDF4E5601E4D690 cv%kb
126,707,468 *0CEB439C2B251FFE89561D01F40FB1D75043ECD0 cvl57
126,707,469 *0CEBEE404164F3F61AC2A1B2CA919E367D34AD1D FRANCISCO-MARTINEZ-DE-LA-VEGA
126,707,470 *0CEA1F567C44421FAAABA7465546947F10218390 FRANCIS.MELFOR
126,707,471 *0CE1EE29CFB36192EE72342B4EE2BC9B1D1CD943 c&wg6
126,707,472 *0CEE89AF08DC60DD7A8373DDE1B08883E15E9894 fredramoutar
126,707,473 *0CEE9098DD23C6F9CE1B40F703A3CBC9CFB8C136 FREESHACKLESFOREVERYONE
126,707,474 *0CEF0BAACE0A810EF6B3E3927EE3514C62F2D02A fromatems
126,707,475 *0CE427BC3B35B00EC76E3544AF92DEA514404BDA CY$O$
126,707,476 *0CE8F0CE02DC83F27ACA535F5F8E5521E960216D d0g.dai$y
126,707,477 *0CE2F83A9CA8CDB2DC59A23F2DDC9B2D75AFF3DA d0mnp
126,707,478 *0CE370D4985CD52CC003E5BD02329C658F59509C d15mant1e5
126,707,479 *0CE0CD51BFF14976D97DACF473EE04C7FDF7E3B0 d1b/m
126,707,480 *0CE3A4D68F0031CEC0A7ED6029FFEC2B4CED6DB1 D4FQK
126,707,481 *0CE26B43B5CFE0A98C7324B4F8FE8E2AC82EEC72 D4V02
126,707,482 *0CEB5FAA11E21FBD14B5AB1B63A3D811558E45D2 [email protected]
126,707,483 *0CE7ECF7DD8EB194C91C9DF98F522078AF432CC0 GAMBILLON
126,707,484 *0CEC9D2E77B7EC7D1142E622AC96A3CFEBB1CE38 d8a+v
126,707,485 *0CEB5642D51C014B991A8B40381FC3AA6A88A76C GARRETTSUGAR
126,707,486 *0CEC95813097B5ECEC80B4C073F7E3535A2D1BA7 GARY.SHARPNACK
126,707,487 *0CEF52EACB0889614566E5CE81D471A8CFDDB5B1 GASTONSCHRAGER
126,707,488 *0CE972662BC4AC9C1C17F61F430A4A19DFF2404F [email protected]
126,707,489 *0CE6AF8469596AE7F28C5F8A88F36AE7C0922073 DAFRINJ
126,707,490 *0CE6186682271FB903B4A87F08CE17225273093E gealp
126,707,491 *0CE0D85B8B6D5732A80CA6BDD7F22947470FC6BE geelouise
126,707,492 *0CE4E63D0B40F2037999A0AE9BA3EDC87064BE2D GEEMEEN9
126,707,493 *0CE885486975237B819F84A321C9CB5F574764CC damansari
126,707,494 *0CE6334C4A78C69B216E79B8611AC4424168E51D gembelucu
126,707,495 *0CE8E095210751914D1CF2FC8CFD05AC49022310 GENETIC-FUNK
126,707,496 *0CE0CC80338A368F60FD70AA92185957CF15998C daq7#
126,707,497 *0CE84064AC1BC2DF0E1F8FF1193D0C1500E40053 getuchtigden
126,707,498 *0CEC43EFFF8AF2932236B02658207B7405D213B9 DARINFITZPATRICK
126,707,499 *0CE8DB48F02EABC0FAA0624AB1F4FAF84B364A88 GFEDCBAB
126,707,500 *0CE2B9C377372681A41A1064A165676808E3CCA1 GH
126,707,501 *0CE9738EA928C78E408FBBEABD860F47CCA2294D GHABZAI1
126,707,502 *0CE19CBA389DC1E83FBC447AAB95BE9BDF7928A0 DARNELL.REDMANN
126,707,503 *0CEE5B4BEC75567A647CE31BE4D004254452B473 giftedonline
126,707,504 *0CEA5CB549816F294BACB6795EDC6B18C7158C4E DARRENPRINGLE
126,707,505 *0CEFD0E791382FCB58F614E020D798197E6512A9 DARRIN.RIVEIRO
126,707,506 *0CE1FF381342A791F7A6EA0B8D3FB9CA84542897 darwissiswoyo
126,707,507 *0CEAA1BB28D73CB6089C2CDB2461725C9D7CB096 GINA-RETTBERG
126,707,508 *0CEDD058B95D954BC30EF98999F2E4D93FDFCCDF davvsau37
126,707,509 *0CEFB27AFA4D224C5448DF1830C6A54CEC77BC79 GLITZE
126,707,510 *0CEEF88728C70DCA86E6C86E8ED4738A39E2BAD3 gmnwd27srxylb
126,707,511 *0CE754DFDD18E1CACC902FF2F3D4B9E12A2E8BF6 gnemtsers
126,707,512 *0CEE6F4A041DC0E98078CF393D65F006C721B070 dbofl
126,707,513 *0CEA5E4DC687C691BE709AFC95425AF71E2FBB9A DC8OV
126,707,514 *0CE2402717D79108EEEF07D73084704C39B2EBF6 GOLDSPIN
126,707,515 *0CED6BD9E8BE04F04AF196331E0CF25A336C508F GONEBALLS0
126,707,516 *0CE37B448B56152F704217E16F1FE321359D0389 DCR4CIUN
126,707,517 *0CE37A495CD08BABB701CCB43742256E5DEC63EE [email protected]
126,707,518 *0CE044E4E281268A5056D3F49D2AD0534A36891E DD14
126,707,519 *0CE9521FF1FC5FD6D23717A25677E06E165889C5 DDBW?
126,707,520 *0CE3CDAF4DB316F47857CAAE3BC9A9019A242F85 GORDONWIENS
126,707,521 *0CEC1D8D46E3B71255BA5AA35196D1563958DD09 ,GOUGE
126,707,522 *0CE4E006E9B7F18C9071B4996EB968C38816F9EB GOULUMIAN
126,707,523 *0CEC41B035590AF6280A1C9BFC4B155A0195D7FC deadradio4
126,707,524 *0CE66D95618D6A11193FBD79B1FD79F7341048FE DECORTICAGES
126,707,525 *0CE9EFD1B0110DDF83C39481374BDAAC3AF2B39B dedaehxo0
126,707,526 *0CE0F2A111593664529C6FF5D5CABD1AB953CAC0 dee.hustle
126,707,527 *0CE994E9A135C1EDD0AB74832F6EDE800F178643 deejr
126,707,528 *0CE804D12E03EEF4097BA69AED7058D474A93290 [email protected]ET.COM.MX
126,707,529 *0CE933B05E48FC1732D140F5F41E1EB9110CCBF3 GRDNRS
126,707,530 *0CE96F06DCCE5A5B195839999EC548F93305B060 „DEINER
126,707,531 *0CEB3B1B52A0CB8D60A76CA6D10166279DB063E5 groovygroovyworthing
126,707,532 *0CECE2339DCE6BE446FA67023F36314262C6100C DEMON$7R47!ON$
126,707,533 *0CE4BA7FD08A9C38EECFBC9BD10DDABE6EF613A2 DENIS.STRATTER
126,707,534 *0CE6F1BD2EB4FC090CDB5309192AFF05D716770C DENLOYT
126,707,535 *0CE3AE1DBE66C3F1A09C0A4B269500AB9F173DBE [email protected]
126,707,536 *0CEF90342C7EE64CE2FECDFEC985977E1678C2E4 GUNYAMOL0
126,707,537 *0CE8A9C42EAD4D41F0FAF34FA55E054D88B33FD3 [email protected]
126,707,538 *0CEE1CEDBC0E06F58B02CC422C2722E8167F4D12 [email protected]
126,707,539 *0CE913D85F69BA4FB57A0B200C8825D41C1F13AD DE-RELIGION-ISING
126,707,540 *0CEDB9B64E75583D4F6578CC005143ADADFFF154 GUS.PICCARD
126,707,541 *0CE043384C84C31D639AAE038EB28FD04E205FD7 DESHAWNTHURM
126,707,542 *0CEEC45D644C547B72F581B4A318B49B87000528 DESKOPUN
126,707,543 *0CE79EA0D80842C23D026070ADE29C1C6CBD609E H|20
126,707,544 *0CE4EB8466F82275B3B5122B7087DAF4EC0D2DD9 halfwod7
126,707,545 *0CE29EE788D43599118FAEFC0AB32D3DE68199A4 d:(fj
126,707,546 *0CE099D25B66AA194ECC90B7AE70BE1A69174DC7 df?%o
126,707,547 *0CEA6564ACC8CB23BD65C309A0AFF9DAF60F9ED6 HANK.ROMKEMA
126,707,548 *0CEC21EC465086650E1E3725B507D1A51A491CDF DGHa
126,707,549 *0CEC727C23AAD07DFA69DF9D33E56C5627D02229 DH&Q
126,707,550 *0CE8092FC82C7A0877C23B2A08361FEDDAAD3A83 harrisd
126,707,551 *0CE56815A738B28D63576B86DC84009875E9A088 dhwan
126,707,552 *0CED6FA773C2116E863DC19AE491A82CE1D3DFF9 hassanlaman
126,707,553 *0CE30565ECC60DBB04A801A074C4279CDEB156D8 HAWA MOHAMUD
126,707,554 *0CEE127990BC818627EB6305667B203E923AAEA5 haydentotzke
126,707,555 *0CE6241CEDDE4C17ADB875953DF201ABDD7E8B52 diffusiflorum
126,707,556 *0CE9F8743209E1DEAE402A64F1F0DCB7F57EA33F HEATH.FEELY
126,707,557 *0CE9118376B6F1D145A1A000F271CB0E2B441DBA HERFSTMIDDAG?
126,707,558 *0CE68ACA936162EDFC566A0B0237507251480D3A D_KW
126,707,559 *0CEEBD77623E0882C79304810D07F4D733F43C5C dlq-v
126,707,560 *0CE28D164819B44478DF0EE9CA4314A424EDB8A7 HI)+
126,707,561 *0CE6F4CB8153A46E4CADE5B0F17DE921866C469D D_M0-
126,707,562 *0CED8205A2AA5C839A8AE545711EF3BF1AF88F43 high.wire.escape.artist
126,707,563 *0CEDC2544838389AFAE21797F5E14B2E952C6C8D DMMC7
126,707,564 *0CE517D0E89A8D3D719AA8EB3F3586BE7D158FF7 DMS:-
126,707,565 *0CE48A4711D2E91A51098B24772E16B2B7629E22 HIRANMOY NATH
126,707,566 *0CE4395B24B984DCA3D4D76CC82F9BC8A141F405 HISTINGS4
126,707,567 *0CE45469C1E159ADC17E8ADFCD788EE236ED8175 D!N3A
126,707,568 *0CE2BB28E25A1FE8145B92D61361A6CD6E448055 DOCUMENTOFALIFE
126,707,569 *0CE7AE88E3B12EA9C24A4E82441F3C84CB0B71F1 doi1010160370-15738
126,707,570 *0CE91985554995B9414E8376152C47AD0DFFB2E8 horillo
126,707,571 *0CECCF468060AC7B3DD03FBCF131B6B3D2BE63F1 DONFLOWERS
126,707,572 *0CE89E3C6BD8F0F78AB41B0E20FA73DD2EE9485F HOUIE
126,707,573 *0CEAE0E72993C6D213C0C0138516B1BE540BDE61 DON.HISLOPE
126,707,574 *0CEC9FCDCA170E765157D108F92EDC4C9B3AB1CF DONOVAN.RAILSBACK
126,707,575 *0CE673C17A0E4A94EACC32B42FEE579150CEC794 donovonmason
126,707,576 *0CEC3F0C3A2B4FD5607090DF0CDCE1FF68462F28 DORENFREEMAN
126,707,577 *0CE1529DC8201E406AE279063264A89A6378BD5E HTTPWWW.FIXYA.COM
126,707,578 *0CE21EF49219C8249C07DD6833C2DD3C213F272F HTTPWWWNASKAPICAEN
126,707,579 *0CE07EE1483A299BDE247F02E0525C9C21EBF0EE DOUGLASADADAMS
126,707,580 *0CE4BF0D161328D338DD9C170B3B00B1D71F952F DO.WE.BALL.(.CHOPPED.&.SCREWED)
126,707,581 *0CE1896D035703DBBCA18AA337A62615117A7BC9 hueytabin
126,707,582 *0CE50BCE6C8AE9B060DB65FB403E03DF4DA64782 D&Q0;
126,707,583 *0CE1A086139A753C0644736B9DAD8DBC5D9CF971 DR!_
126,707,584 *0CE7A8AF7DB6DA452F64665F1E769DAE3785EB9E dragonshithead
126,707,585 *0CE88EE9B7FA27BD7512AF6293CC82AD70EF777A hypermarts
126,707,586 *0CEFAFC28039F7B151F6AF862EF0B9401DAEAF8B HYPNOS-SECRET-SOUNDS
126,707,587 *0CE709455220B470029008EB882AEA2EBB96791C IAMALINE98
126,707,588 *0CE90D0F11980C7AF5E55DB25C6D1AC3BEA020C1 DRTRG
126,707,589 *0CE70975AD0774C6C509357D285BBD3578A909B5 ds=:!
126,707,590 *0CEA10AEFBC27DD48B9459FAC2FCE7A4CB10D102 ds0g!
126,707,591 *0CEE17C4F53463CD061D55C848CB982E561E6808 IAREGIRR6
126,707,592 *0CE6F12E7B8C8D5932877D77202E61D11A916ED8 [email protected]
126,707,593 *0CE63163650E49E355E0463BC3D3076E49E64FDA [email protected]
126,707,594 *0CE1EE56013EB024032A9052979973338AAE0A14 IDNELNIF5
126,707,595 *0CE1430CF19288E47E37B69045637FF7CF8B7BAE DUKEWATER9
126,707,596 *0CEFA91F0AC59E46E735CECD3AB9FA74FBEF9CDC DUQ!E
126,707,597 *0CE50676C11EBF300F380D8A1E1454401AD883F4 DV/1I
126,707,598 *0CE4BC6695E8F41C7F398A05FE43A2BA3841A05D DVOGF
126,707,599 *0CEF9B25E9BDAB47704A005750834A4449FD8177 DW!?5
126,707,600 *0CE2C8A75358B5B456431C8F16626720ADF5E098 ILOVEVORTEX19
126,707,601 *0CEE14615B5E01B3AE0B2FE58E50FF774E96C23F ILPRIMATISTA
126,707,602 *0CEE9ADE7770A6F1ED90B1E805F4454FE2FD02BD DWMK_
126,707,603 *0CECB4A5C4B910734E75D942962E8564252BF0F8 DW+TI
126,707,604 *0CE4CDF2D8186B9471CBB548C8F46CF098A697EE dxe(k
126,707,605 *0CE599D69BA232EF193CCF3B8229B471DC8FB473 DX:T
126,707,606 *0CE9754FC32E3B4146E67E1F28C9507E733A20BC DYLANBENEAR
126,707,607 *0CE063CDC529A566CB9BAC4800B70DE6C61B0CD9 dywx
126,707,608 *0CEAAA83AF7F06C7D6807F52647663BD04D97BC3 immoralize
126,707,609 *0CE6451397B5CC017F6FC5B3C549654CC97DE8A0 IMPASSI0NA73
126,707,610 *0CEF85F61D500876C9366A7782EFA5E5CE769650 DZ_F(
126,707,611 *0CEB8AE844160D79C191E4E002338CF629EF529D DZIRC
126,707,612 *0CE06F29658E396647ABBA96BDEF73CC7E274B79 [email protected]
126,707,613 *0CECF4B7673EB3061B3D824BB77271613EC3A6B1 ea3k2
126,707,614 *0CEF1BFA24DC768C8FB24EA81AFB48133DDBD49C EABw
126,707,615 *0CEBED5A105C03D39BED26509B843FD2F21052A0 infantek
126,707,616 *0CEA5B883628AED170DA1DB50012B88DFB260891 INHARMONIOUSNESS9
126,707,617 *0CEF3C0AEA1246412DB87873D97BA3C714AB7B70 INHCSSUB1
126,707,618 *0CEDC11E263E7B617492CE9C3816DD11EB204951 inrukt
126,707,619 *0CE7CFDC62CAB6CCFF9C8A098942F096FE1B053F INSTRUIRIONS9
126,707,620 *0CE7822A745A40A52F39303D5E3ECA08F676F577 INTCHW_REG
126,707,621 *0CE4540D6636A12D5682B880F96E1B15E752F26C IN THE ZONE (BROTHER'S RADIO MIX)
126,707,622 *0CE810CDDA8FF4D8B3EB415D29A3045980EDC7A7 EDDYWOLFLEY
126,707,623 *0CE569B544AE16A8F9885EF6837CEE7A97EDD9CB [email protected]
126,707,624 *0CEF190B24DB8D763050D7755D0A5638BA1ACD5D EDMONDFERRERI
126,707,625 *0CEAF829D8DD80949EAAA00359C33E731A59C038 EDVTR
126,707,626 *0CE370E9FB14D45536127A846CBF11438FF8DB2F IRVING.AWADA
126,707,627 *0CED5B3D4A78E50465699D072650A7C76305DE72 IRVING.TOTEN
126,707,628 *0CE3319A24F44E20FCD316D29493412D37FA2D4E EFEC
126,707,629 *0CE8172F18227EE08EB25ADF32A9526F44E722A1 ISIDRO.YEEND
126,707,630 *0CE14080EFA3285601AE6B5CAC16EB5D98986485 ismaelbeacher
126,707,631 *0CE7EDECA69970C8D10F0DEADB869BA1A7F161DD ISREALPORRO
126,707,632 *0CE89B26922D124AB1776F073721663D976B71A6 IT COULD HAPPEND TO YOU (JOHNNY BRURKE & JIMMY VAN HEUSEN)
126,707,633 *0CEFA170C1F843625B0105414A22E82D30DBC0D4 EIS3
126,707,634 *0CED5AC69C911737ACC904153284CF2FBB42868F ekrn&
126,707,635 *0CE09B038D97D9AEB0BC77207439E0811C6960AE EKUOJIEK2
126,707,636 *0CE7729003F0C772A9466208197CDC5B105E0907 IVDELĮ
126,707,637 *0CED693B6221F92C1E072CDED01B45C7AECF2CA2 [email protected]
126,707,638 *0CEFD785782982DE8157255EDC739BF8806BBDE2 ELIJAHBRYINGTON
126,707,639 *0CEAC3CD9811D42B42408BE4C67855C357E6E720 JACOB.L.HEPP
126,707,640 *0CE96CB04EB6D2B49D128E91C254C412F1793661 [email protected]
126,707,641 *0CE5EF6EAB51D4F41993D1BDF8DC587E628C6FAC JAMALSTRONG
126,707,642 *0CEC86ACDC9B01B0CB58664EE2832CCFCAA067FB elvinnordhoff
126,707,643 *0CEA3CB0322AD192D40B0469519C09CA395C6101 JANINEMASANIAI
126,707,644 *0CE134AB4AB1787202828D21162BEC75E920811E jaredvidal
126,707,645 *0CE66E83BFA6351E53A84FF8DBC96718A4A171A0 EMMITTMELOCHE
126,707,646 *0CE0723835F96CB724142DA3F1A5EB54A4CA78CE em#o.
126,707,647 *0CEC4F3F4A89FB6DCEDABFE8698FB652B1CC3594 EMORYKRAPFL
126,707,648 *0CE8515D15107C7155D36C65D7346A4AD0895FA2 EMUBRE
126,707,649 *0CE08C0D1F2CFBD102B81724A2DFCDFBC3818A23 emwfc
126,707,650 *0CE9ADC22B5D33C0D3E76C06B10BE5424FC29E56 ENASSUOR
126,707,651 *0CE7141B16EFA9443E758C13036137F7C467FD32 j}c!
126,707,652 *0CE3656CDCE75272C75CCA2C558D01FBFF1A4FAC ENCOMIOSAS
126,707,653 *0CE586EF38A3A2452FAE33B25823246C760DC78A engnixev1
126,707,654 *0CE30F3A53B11138B76238490AE71540249C851C ENZO558
126,707,655 *0CEA17D1855E17738B0DF79B32F61B1688EDB1B4 jeorge.taylor
126,707,656 *0CE1F4C431FDB704E542E4AA7E8125117179D967 JERE.LACHOWICZ
126,707,657 *0CE45DAA79CC1B8C41210E1D2FEF9EB7DBB8B98A JERMAINECRUMMETT
126,707,658 *0CE174F0410E0DF8F5155617F1C3A96358FE37C9 JERMAINEVOSBERG
126,707,659 *0CE0E8640732CBBA8EAA1A425BB2A7EA4AECCAAF JEROLD.HACHTING
126,707,660 *0CEC6965D06E84634E85988DD0F6D1AE8B588EF6 JEROME.ARCIGA
126,707,661 *0CE4D228029FFD18511CB17F8E05B7BF6DF28670 EP$VP
126,707,662 *0CE1B9A19F14304555F8E5B0AE62834BB7051DBF EREC7ON5
126,707,663 *0CE952B824A6A0B9F6EB7EE0E83DF9CF782B4257 ereis
126,707,664 *0CEBD0B942E5DE4EE4A5641235C5E71D4D6C9A81 JESUSSOSA
126,707,665 *0CEF644245E86E86118A32631D307C7CE77F55E6 JGD&
126,707,666 *0CEBE4D690DDB1D900C4B22E889F9B28EAD7D5CF erifj
126,707,667 *0CE9C4AC919C0F62B41DC155B3F7C328D547774A [email protected]
126,707,668 *0CE1CDFE29C613956697859E10A905EC739767DE ERROBBA4
126,707,669 *0CE38D7D43383B41E87015DDC91698C883F1141E jim.ratcliff
126,707,670 *0CE5133676EA22BEC1316E3573720FF2B0906C2E JOAQUIN.MARTS
126,707,671 *0CE657229324297EAB3F4D9E01E9186135B71996 JOAQUIN.PIROSO
126,707,672 *0CE421D762270B79BFF016D127076273D9886AF3 et1",
126,707,673 *0CE00C7CBB5D8887605B2AAC784CA8029082F00D etidopol9
126,707,674 *0CE4C7B2E11E634CC1E8E8901A16A9A35E47393C etihtg
126,707,675 *0CEF69780C232A8AEE81729554135E41D85FEB7C ETLENIDIM
126,707,676 *0CE34683729E029AD960265F4F4D9EBDECA40D45 ETNOSENTRISMO
126,707,677 *0CE783B0E43101FCBDAAD7AA7EA969AD92438FBB etrerutks
126,707,678 *0CE3A76561BBE3FC17D95AAC25759F8F9B5EEE64 etsimmmes
126,707,679 *0CE9C1CE75C94C42642D4AADAB174292864B0659 JOJO2640:18162640
126,707,680 *0CEBF3B1A5EDF735116305CE794D842A92D93D4D evadions0
126,707,681 *0CEBFF0F0AACC5DEC321390BFBC3B058C6621320 JONATHANCORNEA
126,707,682 *0CE5ACFE000696AC8EBF60BCA48231D613AB04F1 JORDANESTRADA
126,707,683 *0CE95DB544F98C2128E4F0BC412271E09396E74A JORGHEEH
126,707,684 *0CE6B8D43978562E47E506634CF300CFA1A325FF EX0NER4TNG
126,707,685 *0CE2456126FB88E3B1275416EF0DC15ECEB8DAAE JOSEFSCHULTHESS
126,707,686 *0CED11319EA9FDFBE0E0F03DA6B24835C83BE0F6 [email protected]
126,707,687 *0CE44A6431F50D3547E85C98B1B05F4318B0851F JOSH.JIVIDEN
126,707,688 *0CEF8079DECE1313034F7119BFD4ECA1F6339D47 EXPLOITENT1234
126,707,689 *0CE1BD3D2C10FDEEA2390D3BB2109AE53783E3A0 ey((g
126,707,690 *0CE80EFC1451D831081F8B4F35558CE1A34DF3D1 EZEQUIEL.ZHANEL
126,707,691 *0CE81C8281FCDB5FB200550E72B874710B0B06C2 EZNEACOSTEL
126,707,692 *0CEDBC37DC9BA1E239688C2B3F4A3BECAA97A435 [email protected]
126,707,693 *0CEECDFA1EDB39894DB345DAD366F29FB2D949A7 EZRA.GETLER
126,707,694 *0CE9488E45B16948A4DC0254C29D68070C1ED647 f-%$
126,707,695 *0CE488ACCC4C1C67D0D85655AFE0CBE659AF4AA2 JUDSON.GOSZ
126,707,696 *0CEF70D11C2210DB59845849B268944C364EFD6A JUDSONOLEXY
126,707,697 *0CE8F2EA9E071E5CF34263E79478E227813EE68B JUDYLYNN5
126,707,698 *0CE6408C370054AB37FB3E8CC95CF90AF6600CA0 FAMILYLILO
126,707,699 *0CE3CC5D43B4B5FBAE0F281A32A8F6EEF2536C1F junglebksep
126,707,700 *0CE04FBDD9A91CDB9B8D1DA0FF3C52C754417B79 [email protected]
126,707,701 *0CEDC30E57CB5A64F6C0AA93AB5AB10143145DFA fasteddi1
126,707,702 *0CEB2FA3070AA909F7060651040B56A6D7B9B657 FERDINANDNAFFZIGER
126,707,703 *0CE0EEC0195353034BAC4DF5C0178D6C8A1FBA1C FERNANDOKLICE
126,707,704 *0CEF478F9FCA8A3A87A2DD362A25F0E581699074 karl-chircop
126,707,705 *0CED31032DA5956B876E2ED9B55D3713C28085EA [email protected]
126,707,706 *0CE9A3FD6A85EC0A07F5B86D0475400D9D13BEAB flirt2389
126,707,707 *0CE1E6CD03229CF4766A0C50589464D0A311884D KELLEYSEAL
126,707,708 *0CE91C3F98B080FEAAC27032848FE9AC0B3B5374 FORBRUKSMARKED
126,707,709 *0CE9CC18097647F83913311C5D981D4303FD5C50 FORDWATER44
126,707,710 *0CEE364DB5501FF028247298CA1383F67ACB70EA FOSSI1IZ4
126,707,711 *0CE1A2951F5E5E459C77B63BD11AC73E7AEDE9CA KENTONKULPA
126,707,712 *0CE9D8F17612FF0FD9D1638EC1D75113090BFB1E KERMIT.STAGNARO
126,707,713 *0CE38F5E6AB7B23ACE6A21B8213A35BE02A8644A KERRY COLLIE
126,707,714 *0CE6319594406B8FE0AD86302115BDD98837EEF8 kerry-ferreira
126,707,715 *0CE056EDD2E27FC0BB0F20E44C938CAF234A9016 FRANK.LENT
126,707,716 *0CE285076D61D5F0FC2C9C99EDA9B25D4376765C kevin-kjellsen
126,707,717 *0CEBC59DF6DB46A14298D7CF3617867519E7B606 FREDDIEJACKS
126,707,718 *0CE75E43198A5F1F8A6FA81341FA36D33C210491 KHEDAN DE DIN CHAAR
126,707,719 *0CEEC728EF05A6871D781D5CB54D18D65EB73C70 fred-thompson-walker-top-wispolitics
126,707,720 *0CEF97FA14BA311E5757228D82C51DC20287F4EE kiersten
126,707,721 *0CEF71DF26E4BD22DA6B3CF81CF17DD12646D0E0 KILLINGTHEBUDDHACOM
126,707,722 *0CE17FAAEB972016A98C515D67CE45911A8EFB78 FROSTY4
126,707,723 *0CE60F254DE74CA62AE344B7CD6823F4EDD24F10 KIPPLESANT
126,707,724 *0CE99490C5E92FAF6063FA4471DEE2C148DF29FE KIRBY.RIEVLEY
126,707,725 *0CEAF91BCD54E3E4B5EE89A4E406F10DB02B6AEE FUCKYOUWOODLAND
126,707,726 *0CE0D64042725538CC6C1F0510FCD92490A04FC3 [email protected]
126,707,727 *0CEF6E25E16E832F63707114B0DD82F4633E422A [email protected]
126,707,728 *0CE3984A5056EC57A62414FD1A5A51802F4862F1 FÜRSTENBERGSTR
126,707,729 *0CE8D5A1DFDEE36F66133F9F359FE632C5C3E580 [email protected]
126,707,730 *0CE92E9A3419DD541DDF3A3A0583EE67638A4778 G1D3R5
126,707,731 *0CE7D4DD704BB65259A4ED7CD97D5ED7686A4CF2 KNOCK-KNOCK.160
126,707,732 *0CE0FB6BD8852A7713F05851A81291483CCDC1C5 g3fi
126,707,733 *0CE8F872F73D934DBEA02C92D37506071C938E9B kolozsvn4
126,707,734 *0CEB25DF413FEE562F1C3E839C0B764FB703D69B konyaku
126,707,735 *0CE4DB2A6D80A4F0BFC52329000ADC8ECB05CD09 galset-maar
126,707,736 *0CE5AD9AF5CB1B8E4907310A0BB2D844ED849823 kraigmaslow
126,707,737 *0CEA8E177DEBEC6FD1FB1D7EE8D9D8176C4816ED KREILV
126,707,738 *0CE52BFF122DB77F0D0CD6F0D4DCAF6150B78A56 kriokito987
126,707,739 *0CE8BA3330C41A45A827E2713A02BB852A69F8B1 GARLAND.BELON
126,707,740 *0CEA674B6F874524BFEC4F0354BE18442DC5AFE4 GARY.NAGER
126,707,741 *0CE5508977C2A8F6C3B8B04CB64E479D923707D9 krytykapolityczna
126,707,742 *0CE2F57BC1AA5909FA941E88F6BCB5C3AADE4BF5 GASVORM3
126,707,743 *0CEC122BF9010D9556CD0790CA3AB3C5D6CAAF99 gawsklov
126,707,744 *0CE4EBB3E1A51A4660F654C5D59905992589FB11 KUNINGAS-SAATANA
126,707,745 *0CE60EEA590307ABEFE16B683D7A4864257E0203 kurtisloper
126,707,746 *0CE86875EE6096A8C5BC627F4E9CDA76580F2B97 GENARORUFENER
126,707,747 *0CE3C3EDDF776AB3FDCC589C668CDB78A1AD127D GENTLEONMYMIND,COTTONFIELDS,OHLONESOMEME
126,707,748 *0CE31AD1BE39D671A22513643D62174BBF161F1F geoff-mcnabb
126,707,749 *0CE00515E503AB58D90E847745D4E21534B0B4B2 geoffreyelmer
126,707,750 *0CEC3D0F031A3597384CE0E428AA9F2EBE65B682 GEOFFREYWNOROWSKI
126,707,751 *0CE67CD2E6E5FC70654FDFCCEE374A5AF15FBEEE L0C4L1$T$
126,707,752 *0CE996679E10E583DD778B00CABD7EF2F7C97178 GERALD.HENRIKSEN
126,707,753 *0CE043385D940F61E51E4C287802EF2321F018C2 gerryvanalstine
126,707,754 *0CE23E36BFC6F0BAC241314D596399B4FBECBFDC LABELAC