List database


# MySQL hash MySQL password
593,890,001 *3D06001431A7357E9F3FA50D6F2A9D9C80B3B6C6 BuAkl
593,890,002 *3D0CA04BF7DB11852372E8776182462E9BE1A5F6 B_uAL
593,890,003 *3D0720BF7E87B9A1008C17C2A21D08A01A4442C4 BU)ap
593,890,004 *3D066B26D5507DDBFEB2D45C9EB9450534C65F65 Buarquo
593,890,005 *3D0367962C8F27C9C8D5BA7226B56A2CBFCEDCB7 BUawc
593,890,006 *3D0F52974756FD2CAC7155414448D5DDAB5804CC B;uB?
593,890,007 *3D0E6B2546F63F3A11CD22ECCF69F3F212AF744E B!u_B
593,890,008 *3D0512673BC122540671CF2F117D52EDB4FF7FAF B
593,890,009 *3D0AD4B587A5EE8F3ABF9F74562B0ADE94559ABF Bu
593,890,010 *3D0F9159561E5AFF9FCFE28FD16BB05BA5EA825E BUB5616
593,890,011 *3D027571CC1059E878414C0F7371E72F680F573B bub7777
593,890,012 *3D01B0C7C54D79316521169462C49E8CE2FB22AC buba5+id
593,890,013 *3D0C72B9611F2A37489E48C1029520E72A23BFD0 Bubalia3
593,890,014 *3D074EA4921AFE16D8E2FE62A8B9B1006E72AAC0 BUBAYPAU
593,890,015 *3D047856E5BFEE7EE4BC235B9EB9D20EF3AF0C37 BUBBA1034
593,890,016 *3D088BCA11B6A18D1FF45266C5261A4BF4C2DF6E Bubba1jasper
593,890,017 *3D03D1BDC0C06031D9C3C5FFFCC704011AFB1FBE Bubba1mookie
593,890,018 *3D00F6635EAD00E6C0A9E7E2B569C3DA4E08217A bubba2towns2
593,890,019 *3D0E99463BFB16AD5D048BE9AD26CF9C0072A849 BUBBA555
593,890,020 *3D0ADCF1480080E52E9DCB8460FB60D50CCC4827 BUBBABLACKIE
593,890,021 *3D066B0B7076187C5287CD973D1460CF873AAB4D Bubbatom9
593,890,022 *3D07D8A8C7F7633C51CDD2C373176F61553FCF52 BUBBLECHE1
593,890,023 *3D012F21BDC0D1057202DD839324494E5699811F Bubbleshes
593,890,024 *3D08C5D73896175052527F4E35AFC112BE4993E4 BUBBLESMOLLY1
593,890,025 *3D069CB06078A8F67850BFCB7E2E3022C488B521 bubblespinkxd123
593,890,026 *3D084AFFE8B17A5AC989F2B2E34A3E1C4308AEC7 BUBBLESWILLY
593,890,027 *3D04813B0F290EE769C5F7F4D6BA00AE0F8F9EEF Bubble Wrap
593,890,028 *3D04CA4474A629B7F0048E151234361953094AD3 bubbleを撃ち、同じ色のグループを作って消していく。ゲームの目的は全てのfrozen
593,890,029 *3D08CE0C49DDD74DF088074304C2052D5D0AEC06 BUBbLIEs
593,890,030 *3D0A754EC33DF67CF78CDAF0FB048F65B863CE88 bubbo1
593,890,031 *3D07615B68E3B52743BB878D5FBC7EE67A87B808 bubeuturmbhfao.svg
593,890,032 *3D08CAF36962CDC2B3EC1AC3622208D08E71BA21 BUBgw
593,890,033 *3D083C7B3248D1A4BE07A9C1655F09D6F13F183C Bubicsa
593,890,034 *3D0C4A58D4529F3C1B123B58CCCF2C01E224AF8D bubicu
593,890,035 *3D034BCA84D2048B073809ADA391BBF2B3571560 bubinlantang
593,890,036 *3D057E42F812943B8F91A5F67CE770A9C13D3576 bubird:x12yu3
593,890,037 *3D053F81785C929A9FB6B08BB2480CD83E4E7A27 BU!Bl
593,890,038 *3D0D92FCAFE4A4B693E6446A999DFFEECA0CB073 BU}Bl
593,890,039 *3D07891B03DC3F7D6232C93473A03F4111CD9F2A BUBno
593,890,040 *3D0C7EE12E3274FDB67E12605C7CC38A6CF1C997 B"UBs
593,890,041 *3D02F6DCDCF550EF728906AF69C95EB86928A295 B)ubU
593,890,042 *3D09382B9D635DCB35C38901A30124044145DA8B bubudak
593,890,043 *3D079931E38EE48BEA584FBDB667278454BB92A3 BUBUSONA
593,890,044 *3D06A5DA11299AF449EF30CAB6DAC2D6F8213920 bubuzmeurica1
593,890,045 *3D0CEA4D79661770E68833B78DFF735BB2D3E4CA BUBw$
593,890,046 *3D07B04F1ED45D219CFA6DA925BA3775325F761E B&u
593,890,047 *3D0DC11860FB18F89B6AB19FFF51B315045BB25D Buc1U
593,890,048 *3D04DF63D93BEF8A1BB9AEC63A998307AF8A0D63 BUC7R
593,890,049 *3D01B71A8D7BA7FDB44ACEFC1EA9D8D09651AA35 bucaioles
593,890,050 *3D0F599EDE0D7319DFA07DE14D5B597804A5B4AD BuCAL
593,890,051 *3D0B32A4AC4868A7AC48819C453F2DB810D1C815 bucaneti9
593,890,052 *3D07B5EB5C04289B019BF855760DFF2CCB0F6D3B buccinae1
593,890,053 *3D0983CB6ADEB9AAA864EC35BF66258A088BD2A4 B?uCd
593,890,054 *3D0290624B52130D8277BFBD10526199C39E76C1 Bucegiuri
593,890,055 *3D021C5E16F3B481FE9A209067F601061027CC6D Bucg0
593,890,056 *3D07DA68EE5AE82C890AFB944A8C686E0B39DB02 buch5t43bl1ch
593,890,057 *3D0A59A5AA9DBE4C08188C3DFB3E8FDD8E7ECFB1 Buchadas4
593,890,058 *3D0AFF12E155BB0AE7E21FA40C98FD9E11B1F6DB Buchanan12345
593,890,059 *3D0515490F9DEFE81807765A98DFAB85590CBA00 Buchanan&Greenfield
593,890,060 *3D03BA05DD40262C64E2CD37B82AF4CCD3B9D719 buchek's
593,890,061 *3D02685BB564901B348B041783108E01057586A7 buchführungsorganisation
593,890,062 *3D09412975775D05846B5F1326A5CA26C42B8F3D Buchmessenfrühling
593,890,063 *3D0826E6DC461D3BEE1D0A16CD7B26DF360434F4 Buchprüfungen
593,890,064 *3D0197262AAE77EC8E0E82322A81F7E370752309 Bucinavasi
593,890,065 *3D01BE0A86F0A9EF24DD515CD2BA444F2AD5FD98 buck+4il
593,890,066 *3D049434DD30BE231B0C8719A48C6399078A6204 BUCK7@I15
593,890,067 *3D0F8E02F05DE73A87F01085294831AA15EC8087 buck!ay
593,890,068 *3D0B0BA3820D0887FC8D0F9C3BC944CC7CD5E79D buck.barbe
593,890,069 *3D081481A4FD2278520C75742A25BABEFA1B7CA8 buckberg2
593,890,070 *3D0A318F7BA0AC8AA0723157AC26E7C3DDB4055A buck.bonaccorsi
593,890,071 *3D04310DE195DEB5FE0E970B588E049336F3A882 buck.broadhead
593,890,072 *3D02177137004C7DA2D4D7F62065F32AF08B8518 buck.clinard
593,890,073 *3D08311D4A494273126F51F805E38572F3F97E8B buck.coran
593,890,074 *3D0EA5DEE9AC7085EF255023F7CE85D4FB79B812 buck.deanhardt
593,890,075 *3D02069B90EEB04F59FF2C38ED4304D67C32C649 buck.dong
593,890,076 *3D04C03508CE55A3F604434D1A4F2569D48E57F8 Bückebergsandstein
593,890,077 *3D024C84E26BC50E088858E8EA7FE4754C6747F7 Bucker1234
593,890,078 *3D0769434E7C6D0F7323980AC0CD5127E46582A6 bucketdod@aol.com
593,890,079 *3D0DC7451D0FE5E766D30063B0BDB09868D3B08E buck.hedegaard
593,890,080 *3D04B1F5B774096D7E51B5D71DCE3EC4F76E42C1 buck.hickson
593,890,081 *3D063F327814ABC89BD9D2D96F8BEB0389047787 buck.huzzard
593,890,082 *3D07F267DC861AEF118D4B307ED01E7D4B1133ED buck.lan
593,890,083 *3D0C7EAE076248E36BE7993E31DF15DFC4F1D024 BUckled
593,890,084 *3D0D832D99052C98DE82CE4B47A968F0856CD6CC buck.magwire
593,890,085 *3D08A1F5AFBDEC4135F8A96D9197EED15DA12843 buck.parron
593,890,086 *3D0D246151165B08C9F27D49089CC72A99BC8A34 Buckphil9
593,890,087 *3D01273C3BD24AF35BE9ACC5A2FB0A9ECEC69221 bUckRam
593,890,088 *3D0B624E97A1CD383A4E7EDB74CE3DC8D021A23E buck.rudasill
593,890,089 *3D0465BED5CC5C5C4EE5DE7900DCD59088102002 bucksam2
593,890,090 *3D030F01BDA059D249FE8BFD912B0333C6CBCE83 buck.sanches
593,890,091 *3D0B01BBC39DB853374CC5CD13B158AB7127B07C Bucksburning
593,890,092 *3D00D5C7A8B1C9F454FC8D08B94CD99FEA0095ED Buckshit4
593,890,093 *3D024E607A121F9309D1303D9CD2821A11344B9B bucksten@aol.com
593,890,094 *3D05AADB6D0F5309DC29AC0449931CD9F74D0429 buck.stroy
593,890,095 *3D0C6A7D587DC7B73A1F3A1855D8E455C70B4619 buck</title
593,890,096 *3D02A5F75E9EA3BE63AF2DAD64C31A3DEB7EF4EB buck.tougas
593,890,097 *3D0E5B57E495E10C33A70E90FD525CFD60242774 BUCKWHEAT9
593,890,098 *3D0599443ED98EBC38D5B0A0ADCAA4051E6749CC BuCMW
593,890,099 *3D03E6EDB1BEF062DE3FE3A7BBB65A06BDF34A8D BUCo$
593,890,100 *3D03D4C43E107A4E051F71AFE6CE9288EDBCB435 Bucovinases
593,890,101 *3D0BD6F0A3FA39AE4826E667F5E5DEECE73BB6DF bucq@netvigator.com
593,890,102 *3D0E0247F75EAB66C37EE754FBFFDDEE2CCD0CAC BUCRANIUMS
593,890,103 *3D042216348212AD89F731EB7C4A565D7DAA65D4 bucs160
593,890,104 *3D02FB611E5E2DE365D48819E6E1336C707F9572 búcsukönnyeink
593,890,105 *3D0BAA31E0C905670B41C39FD7BB381808BD7271 „Búcsúszimfónia”
593,890,106 *3D018FB15D42B9C19FC4F925E995AC41F7EC2D74 BU:Cu
593,890,107 *3D0D176761E2A594CFF39770E60E0D9758C67D93 Buçuklu
593,890,108 *3D01F6CF6C9EE4FEEF9A5011AA56F89DA2C29F81 Bucumbura
593,890,109 *3D04E60E17AFCDCE79E88FE5B6159F406B821DC5 BuD+
593,890,110 *3D09DC07DD2ADC35EB24D525D12D358BBC47AF59 B,uD2
593,890,111 *3D0898D1BA82506BFFE72B7B1E9E3CD8D84C92A7 BUD)A
593,890,112 *3D063B1C7084C4F6D3C5841E9C81DD1D506BE52C budâ
593,890,113 *3D08FB1FC97984EA3B53DD88DD1C4B13F15F1C14 Budam
593,890,114 *3D089AF6FB9EE4DB7181D79282FAE5410369BB62 bud.atterson
593,890,115 *3D0ECED6D5CFB9A373C0DE528EBDBC9C3DB98B79 B?UDC
593,890,116 *3D084FFE073686AC0BA8210DC7C75FBB2A54D7A7 BUDCENTRAL
593,890,117 *3D053F9A6EC48B6F279E75DECC4289F92869645A Budd7
593,890,118 *3D084F0818BD58AC769F0B3E5858928B49FF3C78 büdddeschöööööön
593,890,119 *3D00A86FB369507A30A42B2C08DF36098B416237 budde@inet.uni2.dk
593,890,120 *3D0393C0B6D906817F4296F4448D1E7850D3E0BA budders!
593,890,121 *3D08FCA35D495580644AC1DB985046E30A300DB9 BUDDHAFUCKOFF
593,890,122 *3D054CF19F48D63D498F856D11D2F2A30B584665 buddhaviking
593,890,123 *3D0EE6515558C5EE1704EDE8FCD6461252A2B17B Buddhayah9
593,890,124 *3D0695FF639DC77EA07F90BAA57BD70E58476C70 buddhismshould
593,890,125 *3D0AFFA7E4B2585F25578EC38880C7215CCFF5E9 !Buddhist
593,890,126 *3D04EE05757C2D658E0A25E918831D5E341831E0 Buddieguard
593,890,127 *3D0EE0F038F6F3A0908782C3C73886882E3C773B buddnaq
593,890,128 *3D02A1774C7BF5188138E3BA2D7269CFD5565E00 bud.draughon
593,890,129 *3D0CA8193D98D721AB3007C38DB90811F19DC141 buddy.athas
593,890,130 *3D0FB68551CE21155BEFCB6FEF70A051506B4AD2 buddy.beisser
593,890,131 *3D051870FE39650C7C3F5C24C7284F8E9F5058CA buddy.borgmeyer
593,890,132 *3D0D4F529E8F7E1E82B06BFFAF69DA03E94DDAF6 buddy.brisban
593,890,133 *3D02610059BBCF1ACBB8316DB18F7C6A2E9C9A0F buddy.brumbley
593,890,134 *3D00572CD9E3F33326DC9DBDEE7461A5E14D310E buddy.capezzuto
593,890,135 *3D0462FE141FA6B665EDECFAC71FAE815AE0DD22 buddy.carroll
593,890,136 *3D06B86DDF25BE0FD7A9179AD44BEBDBBBBBF038 buddy.filice
593,890,137 *3D09F375DA3CB75822CD1AD0A0E168DF822AF1EA buddy.hake
593,890,138 *3D063F56528F51C305FCFCB2E79A90D328D27FEF buddy.honold
593,890,139 *3D0AC09B3172C3E19CA2757C4C0561F2672AB5C7 buddy.jeffryes
593,890,140 *3D05E4426BEB53F0BE5F3D7A2044D2B99953F0BC buddy.langmyer
593,890,141 *3D0D8A57FC9F2333506779E01245A3F110BC560C buddy.leavenworth
593,890,142 *3D0FE230AA45341DA6028879CC0C0DC5BC31E71F buddy.longshore
593,890,143 *3D03588026610BFD7207A6D9E9BF593F91A2479D BUDDYLOUIE
593,890,144 *3D0A29ADCB93B35449F3B0F9C33FD4D10A799770 buddy.maurey
593,890,145 *3D0E1F0D1CA6C650F4186C837E9956D111699F9A BuddyMeredith
593,890,146 *3D0468DF2B4CAF16E85394BD3CB31C7DBB451116 buddy.mojarro
593,890,147 *3D0BF3E0ACDA5140BA836C2DC33B9080CEA15C12 buddy.nadoff
593,890,148 *3D0BD573CA4C63ED2A1493C7EB1E3FE6A3D3BECB buddy.radziewicz
593,890,149 *3D005E59D84CDE728B8D5306ADA7E18C5AFFD6A1 buddy.russom
593,890,150 *3D0F541523F5BFAB7C514B0DEE96B3F75E0F4963 buddy.siwicki
593,890,151 *3D06F382908FE9464B4C8BCA773D6CD63D940C69 buddy.somani
593,890,152 *3D05F2E24BF69624BCC2BA60B408B474C7AE73C1 Buddysystem
593,890,153 *3D04AE7CE8EB7DBC8478A63A68BDF1E978DB3D70 buddy.tonneson
593,890,154 *3D03E9D9F82D1F9444CB641F5CAF7E687B5A4875 buddy.trevisone
593,890,155 *3D0531E6A87D419D991965336E47F4EFEAC1BD46 buddy.vasconez
593,890,156 *3D0E9CAABE7A725529220B9F3CC8814327E1F39C buddy.windes
593,890,157 *3D050D8108FA68649783FA7CB0A5AF9F719E83F7 bud.etulain
593,890,158 *3D0521F9301D4769B488961EF6746F3F7B0C5BDB bud.fagala
593,890,159 *3D0AE715DEE8DED524666629349C6EC0DCA3F153 bud.farruggio
593,890,160 *3D011BA374ABDBC9A145CF5888BBB8A86C2FE061 bud.farthing
593,890,161 *3D000C8E2A85C91C237F3EDFB5644B7E36B815B6 bud.fili
593,890,162 *3D0420014F8F0AD6CF71A96C499EC911EAC6E80C Budge$
593,890,163 *3D073D99CB9EA6AA0355DC84BAC3DD00BC106CE6 budge1920
593,890,164 *3D0CA1C2CB2397D97527885021A18764928A0DDC BUDGET1
593,890,165 *3D0769B8B5303E57AFC06BF4B6E2C7920977EF6D Budgetises4
593,890,166 *3D08ABF319DF24414236114386601DB20EF89A8E budgets.234
593,890,167 *3D0844A612A7075CAC97E97110F4CA1C8F363F8F budgetsewer.comwww
593,890,168 *3D0E7D8094D5760853B7ECA7637CD743164583E3 B%UDH
593,890,169 *3D0491401A17E10AC16295D37799884E763A70E5 budhist1
593,890,170 *3D03C855838FEB855B356189F6CD41E6DBD63647 budhistický
593,890,171 *3D04520A340E577410EC0F91C2AD61A166C5A905 B,uDi
593,890,172 *3D09E4513F6013A1058AF2C3F6815DB8C035B3FD budi alexander
593,890,173 *3D04B089C7AE6DAA0498703F490B09D7B574529F budi ku
593,890,174 *3D0DB665BF1F5221F9FB2CD096454A9CC4C54FBE Budionnowska
593,890,175 *3D01A6097B52367500A4FD4CDBA97C9D2E54FAB9 budiperdana
593,890,176 *3D05D5F2012CFEFC389D06B5C0AFA5CB6175BBA3 Budjettisivulta
593,890,177 *3D0F56A111B2F444ABD45E13201BC42D7E62F711 BU#Dk
593,890,178 *3D0925D4FECBEDA1D73A08CBE361B6D90D63552E bud.kalter
593,890,179 *3D0CC12D516AF965442E6EAFF732AFA7AA82229A bud.kuhner
593,890,180 *3D06382B6741D43A3A5FDDD16B318166AC74C498 Bu#Dl
593,890,181 *3D0ABE03A76A58A7D009C780F1BB24BD52B5A554 bud.luetmer
593,890,182 *3D02D776D889871381FC3262C41F12B224DDAB25 bud.moonsommy
593,890,183 *3D0B846179411664F5ADAF443710C1538762726D Budnikred
593,890,184 *3D0693B58FACED54E9616E2E9E58E84E6AC30ADF Budoara8
593,890,185 *3D069A44449012C02D2AE1F4802BC926E4914BF2 bud.pawley
593,890,186 *3D0F5F92914B54688FEB51EF57CA8F945D548ABA BUDPEBTAN20
593,890,187 *3D0088C0382ED8F5EF4A5474ADD4E1E693887D55 bud.popovich
593,890,188 *3D04FD304CC91C5FC07350A23B7B21B308A0051C BUdpY
593,890,189 *3D09F89925F8AEC26904F997B5625B403BD93336 Budreau5
593,890,190 *3D07D2F8D18A28E032992F722D5B246DA1F26824 budseye
593,890,191 *3D07A9E0CE7D28FBE5F3C585A42B5A29D81E3DAE bud.skorupski
593,890,192 *3D0B2F97BDE2126C6A441CAF0E5BFB215369C548 bud.strauss
593,890,193 *3D05B2285A2149A2526746BDC31CB6AE3FDFE0FD bud.szczepanek
593,890,194 *3D031F0DE96973ED5696CD2447D00268530EA907 Budt:
593,890,195 *3D0D3F01913D168BEF90BDED55C6341CA342E3BE BuDTP
593,890,196 *3D0A3094E9B9707DEFEECAF2C11EAB45EC03B428 bud.tuliau
593,890,197 *3D040AA00DFD194C0812F27B2C532C55B0165D0D budućeg
593,890,198 *3D0957159974255A77DC12EFDC5BEC8D5A3AB398 BUDV_
593,890,199 *3D0568E65D69F7301DD554954FFDFF53882933D9 bud.vause
593,890,200 *3D002F50EE371E7A90DE38D19EC612F91AE89455 bud.veal
593,890,201 *3D0E3FF191D19AD4CB1BD65D7AEA82B30BDBCF19 budwe1234
593,890,202 *3D08EAD12DCAE5A02296A82E3FE26F780EEA43FD BUDWEISER?
593,890,203 *3D0332B1FAA124170E3523AEA099F12DA00119DE budzily2
593,890,204 *3D0E2DCEEF213533E83F1ACB38F47012EE96532A B:U%e
593,890,205 *3D01348E61A30C5BC123262EFFF5D7B6D3E2E157 Bue3d
593,890,206 *3D055DE85046547DD453F4FA77B8A9CE8BF2EFB2 Buehneng6
593,890,207 *3D0433B377071693157859B674EA4A328D7BA554 buehnenses
593,890,208 *3D00BFC5319A35045A8E92CB0416C2AD51A863C4 buektxbbed
593,890,209 *3D036BDDC6894C857FFEAF5E460AD12C6BA248E8 Buestens
593,890,210 *3D0786EC7F755A9FB4DB20E5F1E6AA25CDE707DE Bueton
593,890,211 *3D04759D5B8C43898163927389BDB2833426852D BuEuZ
593,890,212 *3D07DA59C1811E26F9E6A563D5BCDAB113B74398 BUf,?
593,890,213 *3D0268F550A13F91F3BA83AA7A34620E72D10DB0 BUf%=
593,890,214 *3D0EF0C1F57AFF6C7BFD090F7501FD905DCAF318 B$uF:
593,890,215 *3D01B3E57AE16705D415C271C73E7B4DE594B20B B:u_f
593,890,216 *3D048FB529E47249FCAA087369184B14F233F41C *(buf_64+(index++))='=';
593,890,217 *3D01D4E187CF8747A3C8D042EBB4416620CC19F2 BUFA-ALDEBARRAN
593,890,218 *3D0827C03B4242A792C14946F5E0FB9115D63E41 Búfala
593,890,219 *3D09B0B511A4459DE30C1C474F5008174A57971E Bufalá
593,890,220 *3D05C59724E0EBEC03FD342BFA453569EB2AF06D BUF&f
593,890,221 *3D0FE0C8FA7F07506383E0E5BA397A736EB32F3C BUFF1DIF
593,890,222 *3D02DA0DFC39B12817B821191411039C892E2E10 buffalolake@pchome.com.tw
593,890,223 *3D0CE035EBB494C9534F3FD72F9A9E1105C5255B Buffalo'sBone
593,890,224 *3D07C16363BAEC05DCE4F8CCE55914DDC176EC91 buffdeed
593,890,225 *3D09217B7CA49ED87FA6BB8160AA5781C0FFAA4D buffering@netbig.com
593,890,226 *3D0D869C27158BF62CFDB80BB153BF7BFCB5C725 BUFFETED9
593,890,227 *3D03A36872DCA26B5092275AB2049FE459F2A44D Buffetform
593,890,228 *3D0F47328E2A04A2B2711C7B237E46FFCAFAA04C Buffetten7
593,890,229 *3D05FAD3B78328AE19B1C0F155BF105FF7E6FC77 bufflo@ts-user.he.cni
593,890,230 *3D02C2F296CCD74A14C279BB6E48577730F62F09 BUFFONA
593,890,231 *3D0393B8E6BC2E002C6F46D0EB72750252983E6D buffone1234
593,890,232 *3D0B5AE4107B1474203794D26D65095CF279A7C7 Buffybobcat
593,890,233 *3D0CFFF3A05A3C76589A910D47CE9CB6B9110396 Buffycarl2
593,890,234 *3D00690BF680E9C90080BAE869DDEDECF321F621 BUFFYROYALS
593,890,235 *3D07BFCD112976F7961F6CBBC537239457CFFD0A buffysun5
593,890,236 *3D04DFE0CE4B266CE7C1EE48144901776F7247E7 Bu?Fl
593,890,237 *3D02877897C1CEAA9F67F10880017CF520E2AB3F Buf_M
593,890,238 *3D0E10CD4229F6F5DD4A6BBB8CEF795D4C4822E5 buford.babey
593,890,239 *3D0B694FEAE1445CD045F5433EF3805134270847 buford.biddiscombe
593,890,240 *3D02F61B17812EB2A3F7C3317F5E37CFD1CD8706 buford.borgella
593,890,241 *3D07EF37A7DFF739E29ECD3BBAEF5019ABCDAFC6 buford.byam
593,890,242 *3D0E4BC8EBF0B699A7C0050DBEF2712E6051A7C1 buford.clowser
593,890,243 *3D0A481D6807DE37F9EC43A23F2072376AA034D2 buford.colop
593,890,244 *3D04FA0707EF42FE33FD7EB104D732FCD00DD088 buford.forsee
593,890,245 *3D0275766C21BAA0DCA88C963B5BA6A52D92863F buford.gillming
593,890,246 *3D0341A09C3A3C77943F47D2AD22179D99EDC709 buford.hallet
593,890,247 *3D050A64CE10120B6693806E80990E8DD7A21725 buford.hiner
593,890,248 *3D0BC9CA733BFC9BAC18B9F8384E206250671C72 buford.kishel
593,890,249 *3D0A17723BE9211CBE3E658151946E952B13D97A buford.mckoon
593,890,250 *3D0D879790C71EB768AA72EF336F88D75031A997 buford.odhner
593,890,251 *3D0B968153B6E9FF2BC0919F2F4D264926B79C19 buford.offenbacker
593,890,252 *3D011D1BFD90D307DA2E76CA59150B8875E501D7 buford.ost
593,890,253 *3D04A52A6F9EE2D9CDF4BA2255F958285FED2AB0 buford.rhymer
593,890,254 *3D07803C2DA6B1DE16216255691B1736E11AF75B buford.rothmiller
593,890,255 *3D0BF51084E9F209F96074909A134DE9D5D7997D buford.skutt
593,890,256 *3D0F22E530E211ABAA9455C00F17E6D457C9543F buford.swader
593,890,257 *3D086A4D6BBF519206965D79EC61563E93D65816 bufotenins
593,890,258 *3D0E36EF8B4DFE8ECBF3EF82095685E2F1323363 BUFQC
593,890,259 *3D0A2C34E23EDD5999FC333CF9BD7CA976284927 B"uFv
593,890,260 *3D0E381D6ADE1D228BDB62B07A9E95A8E217F930 BUFw
593,890,261 *3D05BD01E6DCC7F7210FA8B708A7138C01AD60C0 BUFWw
593,890,262 *3D08D99B19ABDCEB3B11697E10E33DA708BA808B BU+fZ
593,890,263 *3D0C3866C8168E4FF95EAAC8A200D8624860E5B0 Bug,"
593,890,264 *3D0D337A0826B846A179739387BA20F22A48126E bug4loo
593,890,265 *3D04E12D2CCDFE3D5523FA5572360C62BEC09306 BUg9k
593,890,266 *3D0763C16C6FF7675A7A3BF7DFE3DA3885260E0A bug-a-lug
593,890,267 *3D02A1667B15E0C2EE9A8D8559988394908621E5 bugasch1
593,890,268 *3D06060495D58CD775A95AE32CF457DB89D6E4DF Bu)GB
593,890,269 *3D04E553EB53EA68887820B9BA3307B9AA5592F2 bügelarms
593,890,270 *3D0B5483889CF844B669AE0ADD9063565BBD1C3F bugella@aol.com
593,890,271 *3D09E310DE399EB81328A8AB07F8F5429E0BB532 BUg$F
593,890,272 *3D0BFE706518A944EAE591DC6AB39379E5D62D48 bugger06tool
593,890,273 *3D020CF123DB01A4AAE616D7B8BBD1F1366E7998 buggery club
593,890,274 *3D05A4F18937E54D207B41AEAD95DB42B0032435 buggie technica (980814 earth mix)
593,890,275 *3D086AE435CE8CE831DDB9DF71A9ED4002CBB936 bugiweb
593,890,276 *3D01CDCEC3C323C64F833AA1AD03420AFC87D5EF BUGJUICE64
593,890,277 *3D0A0A5F94A1A17A2E7CA7BA0E3BDC7F14016FB8 bugnedes0
593,890,278 *3D0085C1A21D57278C2BD16A534B4DB61E313FFD Bugologi
593,890,279 *3D02C217AC35F151E98A8ABF76D86013A7C052C9 bug queen
593,890,280 *3D07194FA29B5A5EC543ECA69F201995304A77F0 bugsha8
593,890,281 *3D0AA8B39EB5263078DB05772B6841F64474CC3D bugsonne8
593,890,282 *3D03FF4273CD328CA86B82D3DAD4E8BFFF4F01D2 Bugtibsw8
593,890,283 *3D0BD73BA0376D4124190951F85A0F1D38886135 bugwort@pchome.com.tw
593,890,284 *3D0203EF8531A2466788DD6BACFC65DD635EC5C9 bugzilla9
593,890,285 *3D0F23EF73C2906BD228EAD139DC756CE69A497D B?-UH
593,890,286 *3D026F7E9E47E1C7DB81BDAFE8454E6448EC412E B&Uh)
593,890,287 *3D033DE73CC3C4DA2C17A4077DB280F6E75A1562 BU$h$
593,890,288 *3D04A9B5686E5D0803247B73B1D6B64FB723FC0F BUh?)
593,890,289 *3D05BBC9C4D6E835DDDF7F2034C4D08E5BA37F26 BUh21
593,890,290 *3D07D36E96924103BB8313202A4113FC3A8CEEB8 B%uh5
593,890,291 *3D042142C02BDD51D1A5936A8CAC47249F6EE16A Buh7Z
593,890,292 *3D0A162F585450AEE738AF5A7C7980CDB3709909 BUH$a
593,890,293 *3D0521461ACF7EEA2A05607A2E4C3A2469935E6E BuHbj
593,890,294 *3D0C26FEDC561A693484F7BF6D9A2A1EF8E4EED3 BUhj.
593,890,295 *3D0DE3E5E9C5B9D5A1CFA13F1C470BFE0C30F043 buhk@hotmail.com
593,890,296 *3D0DDBDF0108AD1040EF44AA684E64A40D718E5A Buhlenart
593,890,297 *3D007285B66E03D6437C1E69F5674A55E2F7A8A4 bühleria
593,890,298 *3D0F6E7E5A7DA89396B4D2FC6EDC93DCA8B22D48 Buh=O
593,890,299 *3D04FEECC76530EB905946B2B9E1CBC8404ADAEE Bu!hT
593,890,300 *3D0BB55763EB2EE28D761DFD4335CD2E75F942F4 BUhUQ
593,890,301 *3D051B406813FA422A49420C456062EF019E3FD6 B;U$i
593,890,302 *3D0C5BDD34B4B1C440A839B7DD865F3CCA6C6A94 Bu$I)
593,890,303 *3D01E8C74B39F25D001454FCAF7EF6BC40450E1F Bui/:
593,890,304 *3D0B9698FAC7AEF2AE8B222DCFE1ACEA1A8080AE BuI(3
593,890,305 *3D07673CFF1C4ABF4CB187A2E18E2EB770524C0A BuI3V
593,890,306 *3D05D7CDCDC94BE70F9773855D83968627CB4A10 BUi
593,890,307 *3D070952B85FCF376A030E265CC30B13BB4AA370 Buick.
593,890,308 *3D0FAAA02C07E513FC2151C68D71980700AB22EA buídhe
593,890,309 *3D011B1D6ADD8F56A346CABA96DB966AAF2D44DC Bu!If
593,890,310 *3D0BCE67C57C949E1C4E6AC162740A9BE84E2CF3 Buigbuigging
593,890,311 *3D0F1AC38B3942246A750DA639E872A34BE110FD BUILDEDST
593,890,312 *3D0A4F234150828B78C8F29E807C7DB19B783EB0 BuildingCodes
593,890,313 *3D000C268A8E472B855F749FC4F1E4FB6E9AF6D9 buildingcontrol-ni
593,890,314 *3D03014ED09BA2E8ECF0F19B8A190DBB39CD2ED6 buildSauce
593,890,315 *3D0382B59477656B9AF1DF859F93A98CD724EFB7 builtchicago.com
593,890,316 *3D0BA167144F294500E79E8405F5CF6272C5633B Buioeilsentier
593,890,317 *3D006D71B3123A526BCBE21D8D3C1F2D7D0C8562 BUIq;
593,890,318 *3D07592679F8A4E55653CF8300CCF237DB20300E BuIQM
593,890,319 *3D0899E67350770307CD967D0BE7FC7C825E5DCE Buitendien7
593,890,320 *3D01EEE268B732D1B6A85BF7813EEC6BF7F2077D Buithis5
593,890,321 *3D076D76F34352317CA4A9A53CC168314329EAE6 bui@unixg.ubc.ca
593,890,322 *3D01FB733B7DA021FA541F7E191F5AFEFD5757C9 BUIWR
593,890,323 *3D08122E151E16E2C8F38DA5052DA8D5A538B629 B.uj1
593,890,324 *3D0FB636DD869613F9ADF07B9DBF01CE59B3CC33 BUJANOVACO
593,890,325 *3D07F0983CDB162555B88DD247BABC2161DCF40B BUjD#
593,890,326 *3D0CDA573E1BCA4BD609D8DDCC2AA6468E80896B BujFj
593,890,327 *3D022FF6FE56C0F0B1F8877976AB261FA34BBE89 BujI%
593,890,328 *3D0CD9944ECC0E57312708D132858659EED08D37 Bu_ji
593,890,329 *3D02DB4F0A1270C70A97F71E7A12DFC2C317264C Bu(jj
593,890,330 *3D0353BDDB7231740F2B9D8D52E46145D24A6F13 BujM"
593,890,331 *3D0E4B9A0DD4A21C4256CEEF96E4F538F661EBAD BUjMW
593,890,332 *3D02D54B716BFF37DC21AD08995DB0A8F21CC028 BUjoH
593,890,333 *3D0187103C85A3F3D8FBBD2F788708C1C7398422 BujSM
593,890,334 *3D0CB999F6622E8BD0C76864A55048CEE63D9893 bujukderski
593,890,335 *3D011B9E0C5C4E8E2E9AA81A55FFA7B55E5AA5A8 B(;Uk
593,890,336 *3D0A12EF7BF87E5C64C0270C9CCEBF576CB26E75 BU/:k
593,890,337 *3D08D7BB7D16FC6C0AA659B2F85B446F11A8A293 B&-uK
593,890,338 *3D0182F478150CB67904F4A5FAEA22FEB77A4187 BuK3A
593,890,339 *3D07A61B54BAD3EEAE2903BE8F020CB291B9558F B&uK9
593,890,340 *3D09FE26CCCF4045DA33055DB1B51A36E2FFC72B bukahn@aol.com
593,890,341 *3D023BED7F67EADFE11B62E621FBDF33EA7E0FEE bukakkou4
593,890,342 *3D026062D9EE10C8209E13617399F9867A50C6B6 bukeparf
593,890,343 *3D0AAF4FC69CD26701F2F049CCFAC8C0F84D6692 BUKHa
593,890,344 *3D0F85B503A4930817DD71CD3556E3E7CC7BDFF8 Bukharaev9
593,890,345 *3D0A61EC9984426CD9AC1A4FDC721313BE96371D bukichjohn
593,890,346 *3D0DF100FAF64F797CBAAACC07A41C12AF333741 Bukići
593,890,347 *3D0E32354209FD86C52D7EAE92931050DF25A331 bukkehaugfestivalen
593,890,348 *3D069BE6B84F894869DD0CF736E32DAD1F56C5C5 bukningsing
593,890,349 *3D02C9269DB0E4E96968C0607F3356DAFBB0F09D Bukofzer5
593,890,350 *3D0C73D65AEAFAB27AD6C034E268655C81FD5F38 bukonjo
593,890,351 *3D0E8B810DA3BFB95852E75C0E632DA02FD89FD2 bùkrzëno
593,890,352 *3D057F4D9E7203B7E7110B1D59B66B79911498BC BuK%U
593,890,353 *3D020EA3662F3B43492D1C743CC4C84FBF805FF2 bukycute2000
593,890,354 *3D0A4C15FD9B1476909018175F14959E6B743EE6 bukzdqk1xju
593,890,355 *3D0D346AED31F507E75C132DA4496D314491DA69 BU,_L
593,890,356 *3D01AC0033C983DD2487A7F195CD747231541924 B?$uL
593,890,357 *3D082755FA4687BB7A7A109194864C76CA92B86A Bu(l=
593,890,358 *3D005D72F0F805A7869F09674D2CADCA3244D807 BUl8/
593,890,359 *3D03D838296F1881947FA97077C2E3C9FC7B133B Bul8t
593,890,360 *3D0C17B028B585408FC42ED00191C0238BFD3714 Bulamir
593,890,361 *3D04E1C33EDEB65AF7EB6A7DC5E4A64F90156E48 bulansabit12345
593,890,362 *3D0970F9604FA2DDB67E539E12CF31BE9622B867 Bulbidering
593,890,363 *3D062C12AFB3D274B2F36BC60335660606A05B40 bulbocodium123
593,890,364 *3D038A9D13422CDF6E217916D99F1048AFC6AE40 Bulbomembranouses
593,890,365 *3D0E3A5DE4295F2BFE1D03C7494881FE5BE43E27 bule77
593,890,366 *3D0F0C89873C938C54F8C9357D69693FBED35A68 Bülenwerder
593,890,367 *3D000B501BA90556FFC0EBB99017A074BF32A607 BULESS
593,890,368 *3D062ED56717EDE15547B8252298D80FB55963CB buleurum
593,890,369 *3D021DB055DC2F40E81ECB0536074FE0F0D009F4 Buleuterionu
593,890,370 *3D04F528F616F8C23E27275EAD0B578B9BDA0247 BUlg+
593,890,371 *3D066DC8A33F5A61134062C2D171BE9FB4A6BA53 bułgarzy”
593,890,372 *3D0479C553EF3658BB7B09B79B9CCC509F324EFA bulgarzy8
593,890,373 *3D073E579F6C4B31A11371638CBC2272D0528452 bulgerdegree
593,890,374 *3D0F0E37147C253A356264A53B4B6F1B43B5F20D bulGeRs
593,890,375 *3D06DA0E9AD72C885BFFCA642152EF3345A91236 BULGOKSAN
593,890,376 *3D0843F011FDD7088DD8A7204020001F74AD289D bulhead8
593,890,377 *3D070CD49CC037BB15D26507FA97E6254A63E34B BUliH
593,890,378 *3D068BCD0D67A8A229A07BDECF5E2CBDD0D63643 Bulimikere
593,890,379 *3D050EFEE12FE83159D1A3902CB633C5CB734D1A bulitka2
593,890,380 *3D053E26E4C14267ACF7C30A67B3D2939CA437A8 Bu(lj
593,890,381 *3D04665798D20F028E9DEA42A19CECFD4A7F65EF BULJE
593,890,382 *3D0D9D4C04F067A40186D0CC9C3202C5D70E7003 „Bulk“
593,890,383 *3D04BA1CF5FA95F42EAD0C3D8E23E0D3D57A38F0 Bulkabsws
593,890,384 *3D0297761583EDE0EAC3FE43F11C2BEDC8B7B02A bulkenomcom
593,890,385 *3D083F90665D27939FECDA081EF384DE4D68DD3F Bul&l
593,890,386 *3D0F11EEA2388B9F384BDED998894FF7AF749C6A bull750
593,890,387 *3D042BC9B48A5244A71CDF749D9773FB102AD6A0 Bulldemo
593,890,388 *3D0209860722B3AB9DFE50D31BDD79E99A096D10 bullDetails
593,890,389 *3D084B8D3F2AAA662BA4DEE0DD53CA73E667876F bulldog6974108
593,890,390 *3D09275A99632461A1E2CBEB1BCEF7B94A0DE552 bullet and a target
593,890,391 *3D08F241A91370A4089B0D2E5B5D6F7C42315504 bullethead@tom.com
593,890,392 *3D00C13E2EE51C2F65FA0EB18E866CE108DF9703 bulletinofmuseum74harv
593,890,393 *3D0B1DAFEC96FEE0B906149E13DA423239BF0D8A BulletinReseau
593,890,394 *3D0C46F588787CF73529E18F5BFB2B599B8CFF2D Bulletmookie
593,890,395 *3D06EC534C1936A57D5DBA4EDE7CF1EAFC5FCA96 bulletproof necktie
593,890,396 *3D099682F4824FF961FC982FC5BABEDAB8CDDD3E Bulletrufus
593,890,397 *3D0E30D34A12FDB9EB8E3E8135CCC027FF4E2FB6 bullette5
593,890,398 *3D012902280F8D7C0C6F7770078A035509F1CDEE bullfrog,alligatorundstechm
593,890,399 *3D024E2733D682B4D9B772E77C47410683ED6690 Bullido1
593,890,400 *3D0BA91B09635B52FFA730EB948AEDF0F8D0C288 Bullieraned
593,890,401 *3D0366F8024BA54A149EC03FBBA535C449287B03 bullies@sina.com.cn
593,890,402 *3D0A042E5F7F67740DA2D8871E3A125E1D5C1D98 Bulliman2
593,890,403 *3D09635A394C80346E2EE50898BA2621069ED278 Bullimy1
593,890,404 *3D0F13CB7669D239D2C26710283BC81A80FE0B28 bullioscopes
593,890,405 *3D05E842C600BC4B1B8E0CF5FBF56BB1EADE09E1 bullishing
593,890,406 *3D07CD84FD0611C53CA868C65DAD91C9DF45CB2A bullittcountytrainderailment
593,890,407 *3D0CF64776750B90049F258E1FCB59DA640AC6E2 Bullmastiff244
593,890,408 *3D050924A34B545218FF279B5DB851C5BA68BAA2 bullring5
593,890,409 *3D0312F535ED120D62B4A4E49F536DB463DCFBE4 bullroxying
593,890,410 *3D0D06B3BE228D3AF88E02A268EE5C696869B0D7 bull's-eyelantern
593,890,411 *3D028045CAF6C4099B2C03B040CE8A9ACA8A4B0F bullshiatting
593,890,412 *3D015E8BBD4A5FBF21BD5D81E26276B2E9A8F754 BULLY15
593,890,413 *3D030C43381FAD0A00D0ADAE8705ABFD5CBDBE2F Bullypyrite2
593,890,414 *3D08F5A4CD0E528A2770D2B5B425458CEDE2C0BF BULLYRA9$
593,890,415 *3D0F27FC46F12A843690690148A7600C15EA2806 bulmer66
593,890,416 *3D06D6F935337A3A7E5CCE8BAC45762550008426 Bulnesia6
593,890,417 *3D0D49104DE8A8312328C446FA662F72369B6E84 BULSHO
593,890,418 *3D062708C05744ADF7B8C5DEA68F924D589917E7 bultiger6
593,890,419 *3D08ADE14C91B1B659B02927BF5E0CAE573A500F bulunmuştu
593,890,420 *3D0C7A915482CFDEB924EABC279E1825C7A613D5 bulvri
593,890,421 *3D09820290617B2075C07271471E2AB3144B9960 bulwnkl64@aol.com
593,890,422 *3D04FF07E37D8A9D257CC94F99AA5D9B63958233 Bu/M#
593,890,423 *3D0B1C7EAF297BC4A5FA2694A359EB3E2D8F7C58 BUm3M
593,890,424 *3D01E329C76BDE8A1FDE273604EB9F34F4D26B08 BUm4(
593,890,425 *3D03B0E39F84988072F81EB598136DD5DD36C20E Bum95
593,890,426 *3D008BF2C2380AC3D801C7A8D1405F179AAA463A BuMa,
593,890,427 *3D02B76229421C3EB210D0443BA203F2BA48AA56 BUMAR-FAMBA
593,890,428 *3D0ED3689C39ACAC7CF0F00DD9AD0BC2CC96914B B/UMB
593,890,429 *3D06E60EA9362D5DF3F2C588DA017EFD3E8DC141 Bumbl3b335
593,890,430 *3D085721C4BC9351F022DD158096E6C69F6FCF1D Bumblebu7
593,890,431 *3D059F3B17F70EDF60EC59E32FB5CE5B3403CA67 bumbriing
593,890,432 *3D0E40FF0AFC15BA9BC95F97065FD9DD9CE49879 BuME-
593,890,433 *3D095F4BED06DB49ED6BE2BACFD4A49CA2939BBC bume40@aol.com
593,890,434 *3D04B4DDD59DF0FA0AECFCD9EBE6B9A4FF134622 BuMhD
593,890,435 *3D0F315C67CEC78B4A1C79AAAA66459FB4977759 BuMjP
593,890,436 *3D0210AD67FA8D9529C4058FE12B21C7DB12DF8C bumledes6
593,890,437 *3D0641A173EA7B41B49CA6F104CF03B8BF347DE5 BuMLM
593,890,438 *3D0A794B9ADCFE6D15023495FF0507440A5506C6 BumMc
593,890,439 *3D030F1234A3FF83B61CE9BD6BCC0B0FABA14417 BU&MO
593,890,440 *3D0B60CFE83F033817729A87F3F845D2A71367B7 bump and hustle music (luv 'n' haight)
593,890,441 *3D0FB0F736615F37552F2E72FDE4752D30FE0114 bumper(originalmix)
593,890,442 *3D0A727ED6A4A5DB3B504190188FC5C1C0E4C484 bUmpIeR
593,890,443 *3D0348A872792E85B5208FAC6CEFBBCCC5B57651 buMpiESt
593,890,444 *3D033F99CDD8074CBACAA25F2800FA1C3D733F2F !bumpy
593,890,445 *3D04C943A10FA33543A33C51F05F4FFA3CE6700F bumsi66
593,890,446 *3D075738506EC031FF507D50F0594FF41383757D BUMtu
593,890,447 *3D01CDBB615A38C2632A61699D52180692773291 B=UmU
593,890,448 *3D0EF988C59098601AB6DFFAB0D161E33238276B BuN2d
593,890,449 *3D033132D768B242CE92A545CC4CEA0C552A3673 Bu?n9
593,890,450 *3D020C6A18ECA9DA7103E99F92DD7A25C5B7AEAE bunda22cavalo
593,890,451 *3D04DA1273EC864B61607CCD4B85DF4A22A6068E bundenstag
593,890,452 *3D04BCF7A6E3F17CFC9A070B00FF9133815F74EC Bunderged
593,890,453 *3D045E03D19CD055548BF867A8B5F92CF3206E43 bundesbegriffs
593,890,454 *3D086419804B7782199F351050E6B5586F09C112 bundesgerischtsentscheid
593,890,455 *3D0E292805527EB65F0BCDE6ED4BF1A597827B13 Bundesliegamannschaft
593,890,456 *3D0664072778FDDC3D8E82986FE493F609C3333D Bundessced
593,890,457 *3D0F2ADFF98F091BBB039D39080026035971674E bundessteuer»
593,890,458 *3D0E9DEB81B4E58443AE2E9BF64051F8FE462D54 bundfald8
593,890,459 *3D06D8EC9B5FD45CEE381BCF938474E961F6BC49 bundfu
593,890,460 *3D03845128E6B870F2C30E0B27E8DD3908A7610C Bundgarn
593,890,461 *3D0F53C8BF2D76178D46C550D0235C70BDC31AA9 bund
593,890,462 *3D0FB5CF209BC07F60B209C3519B0648F4127A44 BunEd
593,890,463 *3D0D63FE2B7B6F182E4936DC6E7988E0F472F542 bungarum3
593,890,464 *3D02DB0B3868870A598CE8360FEDB28C9C85A4D5 bungaseroja
593,890,465 *3D05805D06CC0681B5A6DCA5D4312239A7CE84CD bungenvordemauftritt
593,890,466 *3D0035DF1E0A709B29CB4422096E7696916CA917 Bungern8
593,890,467 *3D0D95E7DF41380F99023C5CF0E4877ACDDFCE47 bunggeds
593,890,468 *3D095272DB94E45C961BAB45DF1AE7C1FADAFB79 Bungholed7
593,890,469 *3D0802899016A2179021D64D87AA8E325378109F Bungsawn8
593,890,470 *3D0AA0C75BDE887AC0ADD645818DC7754659818F buniadis7
593,890,471 *3D02A400FB02848A7A8473E17F34CE09EEF2C0F7 bunkh0u3
593,890,472 *3D0822CB1F7BEF1F71FC8868037F52EEE21C89DB bunkkeri9
593,890,473 *3D09733A4D7D03315BB7D66F1394E4CDFFAA474C bunkload@sinatown.com
593,890,474 *3D06AAECC751755EA55D2D6D9FF2C5838C3BEC78 BUNKM4+3$
593,890,475 *3D004016B0C82856FB3972C4ECD2159B07446682 BUnkOr
593,890,476 *3D092E80E09FDA27DEB6A8142D166055BB5B2150 bunmi bamiro
593,890,477 *3D06A761CCB6D13CDA8414E5BFCDD4E284AE9E4E BUNNEE_BABE
593,890,478 *3D082D774C04C2E7E847E37B87ED3C5511FB7938 bunniesa-star
593,890,479 *3D04C5389976DC649A2C343114168969B911A23A Bunnsdagsmandat
593,890,480 *3D0E0A35965BEBB8D7F2D5FB7A147C375DBE8417 Bunnyi
593,890,481 *3D07CEE3C59A63B034D0092926A704B80443BEA4 bunnyin82@aol.com
593,890,482 *3D0C2B76106AC1F770188F48D519402252A7332F bunnylee@hotmail.com
593,890,483 *3D00E4E99E8F73BA5CA109CDA6AE04C608575876 Bunnylov0
593,890,484 *3D0059F45EC20B0586350B7CFB68E908AAD1579C bunnyman3
593,890,485 *3D03396865D1F9B5C4D117F13A6336267CFED66A Bunoflying
593,890,486 *3D0DAB0D81161C8F71C6734E1DC0E623941ED341 Bunostomini
593,890,487 *3D0594FC9978385CF4AE7860323FA074C908C6D9 bunowwonub
593,890,488 *3D03C8B544760C1E579FA7F6C65D28C5E7F0429D Bunscha
593,890,489 *3D079B43661F71CEB82A01B547724757680EC469 bunshou8
593,890,490 *3D0D0ECB38CC4E80C910AF8DF03772BCC850BB74 buns & mustard - hot club of new orleans
593,890,491 *3D0A9D55F36735750B3C6E4C909BD7B26E0085BE buntal8
593,890,492 *3D035CB0ED43385DFB8BA45981F4256F9D95AF57 Buntcakes
593,890,493 *3D0AD0C0DD7C44EE7F281816955D5811DFAF689D BUnted
593,890,494 *3D00A48B1394989B3102F1B3C06A29E91FC0748D büntetőterületnél
593,890,495 *3D00328901D36222ABBA2F4DA421366F1E521A37 bunts2006
593,890,496 *3D0EDCDED1735CADBD9DC90AA6F7B2873BEA19CF BUN=U
593,890,497 *3D04AF488C8E4F2AF3C3E2E688C9A8ECF6EFF5FB B.Unu
593,890,498 *3D0048E11C4731A8AD6ABCE4D3DB538159459E74 BU(_o
593,890,499 *3D03DC2E56AFC54F9AFE32D5FEE3B6D8696B0B2D Buo8$
593,890,500 *3D058C40BEF4EDCB30A9F29396F75F7373C04342 BUo9H
593,890,501 *3D07921029B3B09C2EF384D789ACF653637E0FD3 BuOEm
593,890,502 *3D0FD6D0C038275EAC80F6C98367CDB67F6497FD BUo!K
593,890,503 *3D0E9789A1CA2C0FE90CDCF5E5F7FC752DBAFF2F Bu#OK
593,890,504 *3D0D27806B5DF1AD05FFD233DDBD7F3588F3A27A buon_giorno 'bw/O/n_'/dZ//O/Rn/O/
593,890,505 *3D096B0793067B1DAD86C9936D2F943962292A48 buonnarotti
593,890,506 *3D0B0E45C8E6182ED651499DA2AC6C613F90AEDD buonnatale,rat-man!
593,890,507 *3D01F4801A9AC7BD179E9AE676949C505EBBE2C3 BUONODORE
593,890,508 *3D01A6DCB8D09D2977B3806B09A86B076A1F1CEE Buonpastore
593,890,509 *3D085D91A5372E145D8F12068761149D4FBED35C buonuomes
593,890,510 *3D03C9A963C1CCDDA937CB6CD42042ABA91E6DB1 BuOr;
593,890,511 *3D0015E08F01F8DCEFE743DB416CFCB66C8787FE buosolja
593,890,512 *3D0E2B0CBA25263ACDC5FFF8824D2DCB7BBA9B49 bu-ot
593,890,513 *3D0A62E588CE4CDCBDF5C76E192E8039FD237A9A BuoUn
593,890,514 *3D06FDBC957368E1EDD914E42298E2983EF76B64 BuOV,
593,890,515 *3D0603B176AF2DFFD96B1D7352E7BAD99533138E BUP+
593,890,516 *3D04C5A78719E58C3DCD4D795EAEC93989C73D2E Bu!p+
593,890,517 *3D01EC9F581E1713BC58B3C177B90747FE9CC17C BU!P6
593,890,518 *3D0C63EDE34F2B76F356427F7E8C6B81D1F736C8 Bupb3
593,890,519 *3D055C8D4277B4389FFDFF91C766CB3042BCC5DF BUPC3
593,890,520 *3D0135074EF23A1D61F89F8A26C9603B386792A9 BuP%E
593,890,521 *3D0CC54FD5FE2476397867AA93465D2A8AF6EE3A BupFa
593,890,522 *3D0044D3C867D6847BF0C3356989F7A4F4B3C081 BUPLEURIFOLIOIDES
593,890,523 *3D076FE0F71CA781ED2C46EC02A5454E2FB9CAD2 BUPm7
593,890,524 *3D08E95DA3ECBE3B896B392CA58F1061BF77DE34 BupP:
593,890,525 *3D07C837A06041344326AF306C9C1553ABEF7738 BUpRf
593,890,526 *3D02F1CD80CDB57B952DC8184946991A638469D3 bupttime
593,890,527 *3D09F5236AAE31A734FF6FDBC0BEED9CF8C2E0F9 Bu%(q
593,890,528 *3D04272E81084DEADB25557FA5CDF2C4B6583306 Buq"
593,890,529 *3D0A5819BA8B261739196A2D5567FC45EDEF99C1 BUqAd
593,890,530 *3D022955042F2CE4ED36F5A023DE103F29423C74 Buqjslx9
593,890,531 *3D0831C09681E23BA11447C9856AA37B72C3EDFE BuQok
593,890,532 *3D0FB548DBEA5A38D5B5133ECE63D8F29C7C57D0 BUqQw
593,890,533 *3D081169ABD537B1326E22E6FA7D43146411DF9A BuQwE
593,890,534 *3D0CD3E10D389EF196DB3D0C8AA4C61FAD0BC6BB B&U"R
593,890,535 *3D0F4FD021A2AD4D83C6547108BB6E4D7ECBCBE8 B_U#r
593,890,536 *3D09FE99D0BB8DB2876AB69BF3C20348E2D48376 B:Ur"
593,890,537 *3D01E9539C83A36D750938D91D06DDA9C796863D buracıktadır
593,890,538 *3D0EEA6F110368A836CDBBF92476F5C8E53443FA Burakihs6
593,890,539 *3D0643F42F155427453D86F326C1081744A75A3A burakjmekerueu1
593,890,540 *3D0EE364CCEC4DB47F21C60ECA91DA32B7F57359 Burakki
593,890,541 *3D0DE80B3EAA99E3C3303B24D74735D04A49EC25 Burausing
593,890,542 *3D08B511CF844714443894ACCBB35D67F1A602FD burbeix@hotmail.com
593,890,543 *3D0387843BE7FDEDA645F158CE9185F81B807899 BuRBLERS
593,890,544 *3D0A123D8BFE180BB54601D3F0CE8C4F4553CC0C bURBLeRS
593,890,545 *3D0A8A33127AE4C894D4FC154AC8278CC2FFBEDA burbles2
593,890,546 *3D0F33C88890F267220DE45D0DC98DF9281415E2 burburinhastes123
593,890,547 *3D062AD2979D178103CF40F8C3A0FF3F99E8F5B9 burdensomely.
593,890,548 *3D0E2EDE20E49B10CB87C7161F0ED930C3401D77 burdeused
593,890,549 *3D04CEF4BA6FCFA70F8BA4EE510B7898221200F7 Burdiche3
593,890,550 *3D0E70136B0761C013A51877C58DC2756889C9AC BURE4UCR4+!C4LLY
593,890,551 *3D0CD60BA277E2B7D144A64942725885A67C22F8 bureaucra7!z!ng
593,890,552 *3D0585A0832CADCBF7666FE9ED3329D654F433ED BUREAU-INDIAN-AFFAIRS
593,890,553 *3D0399FDBC819CEC2A9DCB3E2BDFA35F0EC9A890 Burgaws7
593,890,554 *3D01F7E963E7C5CE3A5402C16FF44C7CF17B40EC BURGEMEESTERS9
593,890,555 *3D0A56141E8086BAEC73AB55725DC05C3F0E1CCE Burgenlandisches
593,890,556 *3D0399FC8D14E2173B93D34B7909C70848E90E2E burgens3
593,890,557 *3D00EB9E7B6BC2739A35689F1B01E0812010D6EB „bürgerbeteiligung“
593,890,558 *3D09FA83C7BC081DAE0BA239936B5C401E07DB7A burgerki1
593,890,559 *3D0FCE15BB4EBD461FCCF571135C2E89C14D26E0 Burgerlijker3
593,890,560 *3D087C53284899667B01DEE7099F539167FC81C3 burgerma0
593,890,561 *3D077C56075701B2D87D84FE8135ED91C7065002 bürgermeistermeisteramt
593,890,562 *3D0FAD01B90D63D2930FD75F4923C1DA8527AD19 Burgeroo2
593,890,563 *3D0F60ACEC2F475E336BC15970C6DAA027427BCB Burgess42
593,890,564 *3D06DC9B9014B9E54725010AFFEC06F95EE73E94 Burgondeg
593,890,565 *3D0BEADCAC7AA431A01D9E47DE135B83FAC91C53 buRGooS
593,890,566 *3D03D0D3EE511E10547F1E65BD496973144EAD78 burgraaf's
593,890,567 *3D06875267B20C0CE93B69F23C38193DD2ED93BF bürgü
593,890,568 *3D016F76BB9F4DBCC4B36C1B3E56CA74CFB91A30 burgunderrotem
593,890,569 *3D0F9932E13C0490D27949481097E8D5D3AD5B92 buriedlegacy
593,890,570 *3D0578D74C7AFB69517BD88F63AC581807D83A39 BUr!j
593,890,571 *3D0026DA93B32686EC5AD32BAFE26A4B0B3B3A37 burjudgl
593,890,572 *3D0C45DACF9B639647C984A73CB76E1222DC4C0C Burkhas4
593,890,573 *3D0368B64543E7153F89173348464C9262C31AEF burkhead0
593,890,574 *3D0483F86CBCC09582C737E7AB6C443C161D29FA burkholder1
593,890,575 *3D005DA00E6640E0A7B22F8D866ED8E7A99BB99D burkinabè
593,890,576 *3D079C23A88278157CAD324EB296242B1629D582 burkinafaso-geo-stub
593,890,577 *3D047F83407ED06D1F13592D04166CD0D32F4240 Burkleypped
593,890,578 *3D0318EAC232BDA51796EFACDD7728659C95057C burksautographs
593,890,579 *3D0BECC8613B581350CC593EE960263650825016 BURLANDER'S
593,890,580 *3D0F5EDF4AACAEAC51F710E74DE9834DDD5972E7 Burlaram
593,890,581 *3D040DF638E812C8460A327A48561279DDFECF2A burl.aranas
593,890,582 *3D0453B09AFA49B6F1C181A49F23802287D44CF5 burl.bahls
593,890,583 *3D0197746A942E0724F6B7DCB51A1BE2AA93C712 burl.bartron
593,890,584 *3D0E064ECD87F7EF276EE6AFEE6CA1BBC860DFC6 burl.benedetti
593,890,585 *3D0E03C9922AEF1AD648592FB6FAFE88BCB1B126 burl.clauss
593,890,586 *3D07725AF9DA71E57F75CB9DF934B3F2FE0F3AED burl.connery
593,890,587 *3D0BB19B32AB9584D4E1E9C54967CC116F766E0D burl.cubine
593,890,588 *3D0DD6ECA6FBC1C63A14C6C76CCE4697E04E454C burl.drock
593,890,589 *3D0B82289FA631CE35DCB7F48CA1DBFC03A08DDC burlefot2
593,890,590 *3D029C9744F89242F730425F432463FBE43A63ED BurLf
593,890,591 *3D085A3001509395EE5E3E4B5DC0FCC3C99B7450 burl.fioritto
593,890,592 *3D030D6BAB0784952200B4B3CFFB0895B9F8CD7D burl.gaeth
593,890,593 *3D0F342BA50FD6174CB80E5A02D9DFB0CC4546E8 burl.geesey
593,890,594 *3D09FFEC31A9F41F6EC1525973F19C453888C0EF burl.halcomb
593,890,595 *3D089E2EC5E00BF2ECD8B15F99B8988D49F559C8 burlieri2
593,890,596 *3D05C0ACC2DE998F6EA768289F1BF056BA12B237 burlinskaitė
593,890,597 *3D08A2DA7DAEF35D2DAA40B0A34F339F76ECEECA burl.konecny
593,890,598 *3D091BD28CB1C3A0BFB0A798E0FF223589FBB883 burl.marzett
593,890,599 *3D091A585540B097DD0468D0042E89599CBEC1FE burl.micheau
593,890,600 *3D0AF1674B3351755EDD2643E7C1AAD5D47A604B burl.mumm
593,890,601 *3D0B10ED94015EE5A84C01322562EF91CDF902F9 BURLO79
593,890,602 *3D09827F695F8BB1ED67FF894165E48053AD41BE Burlois
593,890,603 *3D0C4159288FF63828E971DFD7967CCBF0724614 burl.pates
593,890,604 *3D05195C0BD456A7DAF0F161936FAF3C6D9EF556 burl.pech
593,890,605 *3D07F9D2204C81A7B4DDC0DD8B1582EA7A61F8C5 burl.pitcher
593,890,606 *3D0E3A0A6A88350F3B9E7250AD9FDE09859473B8 burl.reinsch
593,890,607 *3D06BB854405E29A1A7B18158F4E90739A44B815 burl.ruffo
593,890,608 *3D0D5E0FD32841DAA25307151ECD85A22272CEA4 burl.scheiner
593,890,609 *3D023BBF3C872A8BC30FF8E87938A8E5C4980B6F burl.sipe
593,890,610 *3D059CF2195CBED56955638B44F73D21C661B931 burl.vallance
593,890,611 *3D09B75E512C42E27186423342965306BBE88C4D burl.wertheimer
593,890,612 *3D0837C3DB0A8613BA7718AFABAFC6A747AE1D06 burl.zackery
593,890,613 *3D09AC9066C5ADD1CD31990A124DA3D7DA8B5056 BURMA-POET-AND-WRITER-BURMA-PATRIOT
593,890,614 *3D0CFBD4344709A30CDF4B13A116732756F001B2 ˈburmʲistʃ
593,890,615 *3D039375C584F9DF1EFD5E7F0B88B47FA9D3A894 Burmystrova
593,890,616 *3D0C6B872B9451C30AB171ACBC62517E0E5FEF67 burnards9
593,890,617 *3D006D76EBDAF2F973BC43CE82D0DC874F114C72 BurnDownTown
593,890,618 *3D00CA5ABE6A9238EDE79B0C9E993F258ED8283B burner0718
593,890,619 *3D03C1FEF1F98AE16396E0EFA10E6D2186A00988 burner69469
593,890,620 *3D0310AF1D58FB011710E2B95D158C4E339A1CB2 Burneste7
593,890,621 *3D09673845E4C5F67231C27A11CABB3A7DF6F0A4 burnet2334
593,890,622 *3D01F0BD26D6C93B8FE539C6E033B6C597F2FE24 BURNHAM-MARKET-POSTMILL
593,890,623 *3D00E6942CE196254AEADF9506EDF9403F8F88A0 burning (mr roy's sezoo vocal mix)
593,890,624 *3D0B62DB0DB05EF448135D8391630E1E24BB4766 burningup(extendedmix)
593,890,625 *3D07EB58C7F5A45207219032611FD81343F9A5E2 burnin'paradise
593,890,626 *3D09D9C7A88DADBEB148F928D5AAC7BE4ED7D3DF Burnin' Up (feat. Missy Elliott)
593,890,627 *3D041F12289B176ED4BC4B8116ABFDB571971457 Burnsedn1
593,890,628 *3D011D84CCD9D0C03F6D85D70C754470DDC1DC8F būro
593,890,629 *3D0F5DEEE061F21AC8182A761907F17B2E316B6C burocr4cismos
593,890,630 *3D0AF0AAA81309DE6588A11DD1981A1C60FE4E00 burocr4tiz4ri4m
593,890,631 *3D03BC356B890BC93FE70D3FC6FC2C735B612429 Bürokratiemonster
593,890,632 *3D045E3A1F24F9FC2DD227DCAA7EEF11BE0AFDAC Burorised
593,890,633 *3D075964A6C76504AB6F47D2F1A1ABADC1680582 bürorräumen
593,890,634 *3D02C007C791607F716E9CA141687D80C2F21AB6 burpeemills
593,890,635 *3D099AF71B048986F7B007C99BC7C3F5D7177FAC burps@joymail.com
593,890,636 *3D0E381A053AF7E284BBF8CFEDC80A77A997CA32 BuRQ$
593,890,637 *3D0E2DBD14BBEBE3C720F6E9CA7BFC086DAFDDFF Burrandong
593,890,638 *3D0DC8D24786DDFC009C4EA05F081FACE382A64E Burrel-fly
593,890,639 *3D03B12C87F1ED3EAAE26A0290722A4A040039E3 burri2
593,890,640 *3D056AD724455A9631DC517272929AF55BA09676 BURRISS1
593,890,641 *3D0B65E541BFD47446B4475DC6EDDB16C4AA360B Burrofato1
593,890,642 *3D060776CAE68A33E6931620E3EA903CE8FF8137 BurrowsattheWinery
593,890,643 *3D0D2FE392800960425D5AE26FC035152F706254 burrows@biodiversitynet.org
593,890,644 *3D05C0A184845DFE89011749124098AF4E11F705 bursaensis
593,890,645 *3D0DC56FB4EC34EE7C9A3C3E23D025F4D7A6CCCC Burseràcia
593,890,646 *3D0C93C6CC13461FCC5F5514D0911C95B276A059 bursing3
593,890,647 *3D0E7E6CF0D37751AF4C50B75A6103E481ECA001 BurSting
593,890,648 *3D0497E2B72245E02531ACDC3CA5A44B352848DD bURStINg
593,890,649 *3D070FBDAF68A8641A2426A189CF85E4A32B5DD1 bURsTING
593,890,650 *3D08D7792A0395895204AE6C2EDC1608DEF734EF bursuries
593,890,651 *3D027C441B35FF958F748643FB4F79968AC109FF BuRt,
593,890,652 *3D0E09F1C9BA0A68ED9BAD79AC06D750DE43F4B7 burt.beisner
593,890,653 *3D01ED0B3EC6DBDCD9C346474E66357773259060 burt.bouchard
593,890,654 *3D0B9FE8373BA62DE0A67CFF6AF768E078E56426 burt.bounleut
593,890,655 *3D06212012355D628589EC136596E991475D2264 burt.cerasi
593,890,656 *3D04AD7978000C03BF395A243EF5B0A5CE789065 burt.civale
593,890,657 *3D0C6C4FE5F2748AA2F4BFC8BB16A889670E0273 burt.courtoy
593,890,658 *3D0D7FE9427BB7A52DD44DAB13252FDF6C78F4ED burtdeane@aol.com
593,890,659 *3D0C2BB26507C6A71C747FF5E95FBB98128BD105 burtfr01
593,890,660 *3D05FAEE5649B6068022FA6E45B065E4AE279502 burt.hadef
593,890,661 *3D0AE795B215716399DD6D4F646A6C76A835C0CC burt.hoffman
593,890,662 *3D0C8CF5826040712660E3D441DFE5E27E660709 burt.kebe
593,890,663 *3D0CAC28F62B439EFD9E97A71978DA876E37058A burt.krips
593,890,664 *3D0F6D0CA031233CDA288855F7F9121158A451E2 burt.lenci
593,890,665 *3D0CCC7483A749CBC6CC36ED076AA3F995009AE9 burt.matejek
593,890,666 *3D08EC82853D896F3E6937AF7A80F9CD1E2966E3 burt.mcadoo
593,890,667 *3D0A3B485612AB7AAD9B1525EDEAD13D4CF59D00 burt.mcbryar
593,890,668 *3D00AB7E48B69A31E48186C355E7E2C7716201A8 burt.mccausland
593,890,669 *3D01AB94FC86AA7E6D2EB95533EFD5AEF3E0F4A6 burton.aakre
593,890,670 *3D0BE5618FC0B5FFF08934C693C1FD082419CB9E burton.assing
593,890,671 *3D012B1519E4FCDFCB770549D1DFD1BC73CFB928 burtonboyz
593,890,672 *3D0A1CA20A09D95AA28B910D5B0F35E601F69B5C burton.breger
593,890,673 *3D0263FC30D9B78DC6FADC230E9C6C02B70BA823 burton.curl
593,890,674 *3D03CF67EE40BE2D2C646332E61C8FE006A0397E burton.degman
593,890,675 *3D0958C520CC6A9482A0AF96DEDE5E233DFE2441 burton.dopita
593,890,676 *3D0138EC5E007A5EEE06CE7333FF94B4E12FC3E5 burton.fallin
593,890,677 *3D082605A3F9711D060DB6526D58035498670FDE burton.gossom
593,890,678 *3D020691399C1E631E0488ADFCF9E4FDC3EC47FE burton.greiner
593,890,679 *3D0E87490EC80032C71A3A0BE24005E0127D1494 burton.kleier
593,890,680 *3D0026EFE521AE5C04B29DF9CB4C4A2CE904234F burton.kockler
593,890,681 *3D07913377156DE4C44951A7AD4BB72848AFB30C burton.krol
593,890,682 *3D0E76BA4EE0F890E57A1DB2C6DF58B71EE849B0 burton.lewan
593,890,683 *3D0DEAF68E02D1D18DE7A0627E0933DADDF6CA26 burton.lewison
593,890,684 *3D006DCECF7B16125BAD418F21A1919023E2B014 burton.lombard
593,890,685 *3D049475FFD23BDC3F548C55BB6532FFC69B5753 burton.moberly
593,890,686 *3D05DA8396E998D620632588E2432F9AB1DBFC21 burton.moors
593,890,687 *3D0DF9BEAA9EFF1A3DD5CA308DCED80F9C81F5E4 burton.olaes
593,890,688 *3D0F016E573BDDC54B70A8D7ABE2DE8C517E3A9C burton.paten
593,890,689 *3D09F35CFF3B4DF928AF44B69D1265E5302773A6 burton.poskey
593,890,690 *3D01FFAB539AC7DDB03A531AB495C5C7085F93C2 burton.putman
593,890,691 *3D0D0E22DB96C7E7D32438AAE4DB4C5F601063E9 burton.rattray
593,890,692 *3D06F54311B0D395F300D641B5C40D582D8E4A18 burton.regester
593,890,693 *3D0132A49BA2F47BCF46B5B488551EB911B21D06 burton.streeby
593,890,694 *3D08299749D0ED240968D1DA83803A114518B5BC burton.tweedle
593,890,695 *3D0D2B2B490C98ABEAE420BDD8A13374367CD265 burton.vanderschaege
593,890,696 *3D00862DF895563D7094234C249FCE8FC8062BC0 burton.weckhorst
593,890,697 *3D0CB009FC21FA70E6136C9241194ADB851AEE78 burt.pengra
593,890,698 *3D0608DD1A433E2BDA0A805ADE6E5B367A4720C6 burt.pilati
593,890,699 *3D09072B4432C39971827D36E281A40D31B59DD7 burt.schulke
593,890,700 *3D01CED833E354D180D75C378BC870B1A2C199B1 burt.shanholtz
593,890,701 *3D0540472A2A97153C0CA0E45DA1D54F042032B9 burt.silverberg
593,890,702 *3D0925B7A88AAA6192779F3F23E610514F8144AE burt.stavropoulos
593,890,703 *3D0147FD40D21ED80AE271CC2B67004B6140A6FE burttst
593,890,704 *3D03B12EFC7A72BBFCFB2F3A17D726DF587DB0EF burt.turcios
593,890,705 *3D06E02A5EF6EE6B818AA7193E5874FD49D02069 burt.uhm
593,890,706 *3D0EBD9033840261C3340FDEDF3483F3342D2FF2 burt.ulwelling
593,890,707 *3D063BB626212873493B2DB660FAF1ACBDB7157B B;UrU
593,890,708 *3D0C3F3E8C47473D816CABAFCDD2AA3781FC971C Burucoaed
593,890,709 *3D0916DB459198DC6576F82C6B1E90095645B312 buruglasögonfågel
593,890,710 *3D0CA0E63CB9DC12076B787E85DAF056460CBFC3 BUrXO
593,890,711 *3D039CBA15CD4D5734DC877E3E90E30837B8249E Bury!
593,890,712 *3D032FC3374F7C2397779EC712117E6E39AF2CEC Bury Yer Brother
593,890,713 *3D000F4D16702ED49D1B86F6D27BCE4606CBBEB4 B=US
593,890,714 *3D0E6995F4D1F74E7F602C71204F9EC69A12D759 Bu+S5
593,890,715 *3D046F4F1FFAD6596CD0831D844541F6EE5E395F BU!S6
593,890,716 *3D0C15BEF67134536B8A506A1111A722187BF338 BUs,8
593,890,717 *3D0B28C1A9092022943DCBFA097924A48AFC3E20 busantes
593,890,718 *3D0859CE3F525CC20D1A309B95F594B5CDFDCC94 „Busbahnhof“
593,890,719 *3D0F12BC6FADBCE5C9BFC10FF2F2E2CFBB34DF95 Busbg
593,890,720 *3D0C9730F4F95B849D65BB6CEADFA26D9B454014 BUSBIE'S
593,890,721 *3D00F04009C42E63E97CCABC07A143135C53BC50 buscão
593,890,722 *3D00AEB7F9951B800DFD9076850347040AA4E3C7 buscettan
593,890,723 *3D007DA6C39CC5E6A6225209A1B5CB2DACF8F280 „Buschgeusen“
593,890,724 *3D029E529E444539255F89D8E76A322A22387FCE busenju4
593,890,725 *3D09F19A2C1FDE25E0C0D737F6399B7E845AB8D4 buses.6
593,890,726 *3D05E15752625E9D8271BC88C58868D705130531 bush-dinner
593,890,727 *3D0F052A1CFB0287C791509351FCCEDC6213CFBB .bushee
593,890,728 *3D05354BD9BB7B462001FFD31729950FC1485A38 buSheR
593,890,729 *3D09813BBC0153323E8F68A1C0764923660D42C9 Bushfigh5
593,890,730 *3D07DA044837BDA6398C96DADABA4A5EE29BF72E BushGitter
593,890,731 *3D0E9166B5E0193E81B7F57F54B88940C70B7A60 bushiest1
593,890,732 *3D0D4519BDDB2025AA2608640E2FC5237C60F4E1 BUSHINgS
593,890,733 *3D0EB58BA15FC5F253F7EE23DF7848B163CC8BF9 bushires0
593,890,734 *3D0C5898C6D376A5DB031BFCA580BA1B49EE73AC bushregeringen
593,890,735 *3D019C6D89F7D6D09856F30D0487B0E41586A5A6 bush」、「the
593,890,736 *3D0EBF2790C477A6241D7C0D0B0B77B64C99CA83 BUshTits
593,890,737 *3D06410D3958A21392E944C71FB796F0ED66CFDC bush wood
593,890,738 *3D03FE5D6B0485ED68EB47E46E1B41B6456D65C6 BUSIEST3
593,890,739 *3D0865CB49A271CB1BE534E9CB398EAFB13B3C58 BUSiI
593,890,740 *3D035EF6F3E196AC2367C3FF9C27A9D6390CEF3A Busillis9
593,890,741 *3D08EB72E21083C5233BC1F1F5D995B221F09041 Business section
593,890,742 *3D0BAC430E8C5950C98E68C2CEBCAA57E53B64E3 businesssuite@yahoo.com
593,890,743 *3D0961C1F4D450794363611F5F56D36A0F675882 businessului
593,890,744 *3D07669794E12969B1FC33A596CE7FD7A027D3D7 business.vsnl.compra
593,890,745 *3D05C3792C9F5CC2BE1596FB7A8BC2718F165BBC businessweekdirtythrity
593,890,746 *3D0285D1B099EF3BAA4C83E66535E8474EF1B33E Buskinezia
593,890,747 *3D06C7876655FEA5E9B98A201BB3C7FF7CE9983F buskv
593,890,748 *3D068AEC4E9A97C8CD1A84D491ED5E48B417CEF6 Buslinje
593,890,749 *3D06CEE22FD847A7DB4145D6767ECE2F5E65734E busl@uol.com.mx
593,890,750 *3D0F3FD519B784EC3DFB6482DD63AB5D99524070 BuSmi
593,890,751 *3D03FD57966BE12D35CA128B4B8C8CA157351190 BU$SN
593,890,752 *3D010694DB0FA2FE901BF5C2A524F0E92EEF334E BU?SR
593,890,753 *3D0F7C20CD90B5D178CB1759BE795C66CC0DAC0E Bussard1234
593,890,754 *3D055517C4050A3EA3D9139A6AECAE4776B85982 busseranno0
593,890,755 *3D09C39720958BA2FD2A7D286AE5D6DE212BDE02 BUSSERESTIS
593,890,756 *3D014B62ABA9C277A8D8229AEBC95ADA463649A6 bussilasti
593,890,757 *3D084F77A73229FC5EB75255F8FF01A50764D719 buss@ti
593,890,758 *3D055B5FFADA9BB684CEB38836995ED9154F4B11 busstop90
593,890,759 *3D036A970ED0E92A689A30F6244501BF64980960 bustamanteieigenmann
593,890,760 *3D00C7639BE4FE605AD094AD751B6A539264B528 bustedshewantstobemecd
593,890,761 *3D0C614E0723A317B9527684259E9B12CA59F20C BUSTER\
593,890,762 *3D008E835F0631972CB4D44F1D94681736092C8B buster.alkins
593,890,763 *3D0A65D648808F15088CD9CBE510D765E4CDCD0D Busteramy8
593,890,764 *3D080E63AE3302A0A328F676B2937A6ABF458EAC buster.beish
593,890,765 *3D09DA81D3B9C563667798CF27E6169281811E29 BUSTERCLOWN40
593,890,766 *3D0973DE723A53877E72DA28F6D81B26C668E33C buster.drosick
593,890,767 *3D0F26CCEABE446F7EE3DCDFD186B3E115B1C58E buster.duett
593,890,768 *3D002C72CB7AFCA97CC82AD4785E5F66BD8189C0 buster.haaga
593,890,769 *3D030A7C50027D0AE0AD0CFC5CF0B4C0D051A0E3 buster.hoen
593,890,770 *3D004B5F9DE60E42EDFF54ADE18DF689F5D345E6 buster.ketchen
593,890,771 *3D0E3A6D7393D8B3C385B45BE251B5F7C549B1DE buster.kinnear
593,890,772 *3D0CE074370790D3459DAFF40468E0DB082B0458 buster.kister
593,890,773 *3D0B1D9F1EA9FD6EB92C6A46B407DC5DDC6511B4 buster.krzykowski
593,890,774 *3D00530A14244042E2BB0BD1C6390F56538066ED buster.muhl
593,890,775 *3D00B6776A7544179721A98D0BFFAD6F04EB8905 buster.pennypacker
593,890,776 *3D047B7DF6C090BB4232747BC47EE71D0371E5F5 buster.quidas
593,890,777 *3D0F42A03735A2A1E7F5C3D388823E420BDE5FDF buster.ralphs
593,890,778 *3D00D20001BE7CBA2128710D5F99D357A6AC8E4F buster.sias
593,890,779 *3D09145E74195CA1E8CBD392D5B6C332269D7620 buster.suther
593,890,780 *3D002FF04261D3F0094D05D01A348F432B8B4A4E buster.telkamp
593,890,781 *3D0B549A786D5EC0BA8871C1130445DC56F10AEF Busticing
593,890,782 *3D01B69616FF73E6E1EAF4A6D5D0632BF9141188 BUStV
593,890,783 *3D02137B02C36DAAB0BDAE8578237F0DDAC4687E busuyi aluko
593,890,784 *3D093342C1A4A3DD1B76CEB6EDB38E33ADB9F3EE busvisit
593,890,785 *3D06BABB3A8422C4C0F4B97A8A6CF2C093B52C93 busythumbs
593,890,786 *3D0FAA1C95E7ECEA8B7E07751520BDCB3AAB70F1 buszmann9
593,890,787 *3D03D05C0DDB9CA8BD756E04A1495D00E892A4F9 Buszshel8
593,890,788 *3D0155CC34E68F699EB604E85080D2BF6F595826 BUT
593,890,789 *3D02207721957A822237856241E699C09206E5A9 B-ut"
593,890,790 *3D02A343528AE4AB1413EEA76A9B7BD56CD43697 Bu!t?
593,890,791 *3D0FEC21AA4006D3320F26F954125AE8008AD3FB BuT65
593,890,792 *3D0569174ED8C7ADC94F9B0B0C4324D7757098D3 BUt/A
593,890,793 *3D0B7A78C318CCF0F60B82744739E11746376670 buta@headwaters.com
593,890,794 *3D02DA3D6749E96A59A27DAA635F9D25415E0274 butalsoin
593,890,795 *3D0E84F83FF4885D27087766C1978929C0CE8E3D butansyras
593,890,796 *3D03016C3E61FDE562B375F3BF54E6A594058E13 BuTc&
593,890,797 *3D0C540DC10056EB3898853E5F1AD84FE4CF337C ButCalifornia
593,890,798 *3D020E0D81EDDB1ED679997CD0B38DE2E84E320E butchamp
593,890,799 *3D02957E53FBB5D6236DB3A0EB697853B6AD3EFE butchdvs318
593,890,800 *3D04F7821BCE5211E32455EF87D88F22C600C5D1 buten 7 0
593,890,801 *3D055AF4091C67C551DFC136A854BFF55405E7CC BUTERTANK7
593,890,802 *3D02D5EB53B2B6C62B98DDB9635AA592722CD684 BUtf4
593,890,803 *3D02ACF253C2ACB0C29D4EF4CFC8EA23584D229E BUTIKI09
593,890,804 *3D0652DFF5AE62256F2937D36178600C92FBB798 butikk
593,890,805 *3D0D021E248B17D17F988E727A569275B15BA0C8 butiqbunda
593,890,806 *3D0E3F571E1745A9617E7AE2FEDABC3FC8B8D365 B$Utj
593,890,807 *3D024A8EE439ED394B404D0871506B7D8835636A BUTLEREAGLE1
593,890,808 *3D0CC2A9B8E533276B3F09DE9118363BF0BB0DDC BUTLERSPEECH
593,890,809 *3D0D9C57A0D24DA77FB1AEB3781391E0BA73CC50 Butloving
593,890,810 *3D0DAFC20C5AEB9C435EBDBE2B205BBD65786C79 Butme.bbs@bbs.secc.fju.edu.tw
593,890,811 *3D06B35383B539561A82254F71D3841E90B0A168 butmwznehselj
593,890,812 *3D05C700DB48AF2A79A241BF126C06F5ACB6F5C9 BUto4
593,890,813 *3D092588A0BB5E071AB1096CF910FCF180CF5874 BUTOREN.
593,890,814 *3D067A96B9B29B3181B39AB00B7F4C13786F610C BUTq?
593,890,815 *3D011313AD4D85CF9B9A7086F820C825EC912D9C BUtsk
593,890,816 *3D0E6EED12106774CE537E133520C2EBBE99F4B3 butsuryus
593,890,817 *3D0A60DEC614BD9DFF65DE1684C9ADB49E0916B2 buttenschřn
593,890,818 *3D0E46334D7C3CDDB753CC91386E9F00B4F252F6 butter314
593,890,819 *3D06A0C515FD94B48ED980FC6DBEB86DA68B4E8D BuTterEd
593,890,820 *3D0ADF2D690A44E24DEA2DB1FCC1DB0565CFE4B0 buttered_toast_yo
593,890,821 *3D07ED30ECAF5AAAB1069E5D4B3EE88C66020433 BUTTERFLY18CUTIE
593,890,822 *3D02DDD26F461F7B7D90B379DDA309DC0958B944 butterma5
593,890,823 *3D0A24597CF7781803B13BB37E984747ADC41996 buttermilk-drinking
593,890,824 *3D0244FD423E890EA3858A06295F31D249AAECDD buttfucker1234
593,890,825 *3D01211154CD1A674F67911CD401F2182A5BEC0F buttking
593,890,826 *3D0A265875121E003CE807D7792E1B44A9939BE9 buttoncommand
593,890,827 *3D0138346B29F8E6690EEC6D07AB36A47D47442D Buttoneing
593,890,828 *3D0E9A714215BB2D4CF931131034B7A5B936A646 buttonhole's@yahoo.com.hk
593,890,829 *3D0649026F5482B83733252657063000D5E11D76 BUTTONSNEWYORK
593,890,830 *3D007CE676E130E78FCAFBC52437B06CE4C87B5F BUTTSNAKE
593,890,831 *3D012580A436951C555B6D61F84A178EFEDD79F4 BUT,u
593,890,832 *3D04832BB948A86365914A3A40682F9C143BD2DA Buturirying
593,890,833 *3D00AAE1D273786F60F64013D282428178002537 B=utv
593,890,834 *3D084544561C2C71333EEA49A82DD84DE8BFF4F1 Butwiecing
593,890,835 *3D0B1704F073F568C3C41449C11B52D7EA02C4DC Butwuht9
593,890,836 *3D0B300ACA3603B8C186AC4D2B193CF3017E3FE5 butyronitri1e
593,890,837 *3D025F56A18C1A915F6E4F32614B8F5374F28F6D B.(Uu
593,890,838 *3D05B50409B75788FD10B89E3AE3A9710A16F6B4 B#Uu?
593,890,839 *3D0D1225E5403297D82BFB30B67C44D7D307C5DA Bu!u-
593,890,840 *3D0CACE2E0A8468E46D236D3042D0D215F9CAF8F BUUA&
593,890,841 *3D0710FD66E31AAD088AF10D0034132DA8A99322 BUu
593,890,842 *3D09CCDBBC38744C15462AB497CEE330A7281E07 BuuOv
593,890,843 *3D0384CD394546DB3CBE5DD2475B0FF97FBF096F buus4195
593,890,844 *3D0A0ED03CF46476B421B7EEE7BE07CA6F827F8B Buusniosed
593,890,845 *3D08DDE40D9A2623D69F08C6B3A89616F07A86AA B"uUv
593,890,846 *3D0DF019E41BB66174D6E8E09B8C0E9CA146E0B9 B?UUw
593,890,847 *3D0873B5C2EDB967BC7C8309B6C39BDB1A63D525 Buuynis2
593,890,848 *3D0098EFD4192731E0220F8EB0B8EB813E427DC5 BU:(V
593,890,849 *3D0199838C906F79F7EB144C9753C534112E1E4C B&&uV
593,890,850 *3D0582F88081B15FB19E0055B41AD33FAB1943E9 Buv0P
593,890,851 *3D012A9D58A8BDD5944B05A340E68F46B54BA274 Bu&vD
593,890,852 *3D0C932FDC037856C065D4282825F528275BBDF5 BUvDA
593,890,853 *3D07EDE22615B9937F6FF49A53EE2F09E46569FB buveruds
593,890,854 *3D0CB7FA314D3EF54FD0F345BF546D55FE6A6EE5 BUVEUSES8
593,890,855 *3D0F5C5FCF7C21E9436F360EF7CD740E9E7FB156 BuVjO
593,890,856 *3D03B90151B7F9B7DD614B1C1EC0B8129F191B0D BUvKA
593,890,857 *3D07DC24F4A8EB04FD25A9121AA3405B6966D0B3 Buvo.
593,890,858 *3D0A64463AC85553CF27C94CADC8D761B92FF974 BU/W_
593,890,859 *3D031332A95660CCFFC2FEE073B0C9A8FD154333 B,uW:
593,890,860 *3D04E0755C2FBE2B8EDDD208DBFC6925A7C4F69A Bu+%W
593,890,861 *3D05822EDB0CB2D1ED6B04B6EE7F4B37413B3263 B-u)w
593,890,862 *3D0D497EA8CADDEF6E6CAC4E940BD51F46F744DD B#u.w
593,890,863 *3D06BC0CB557A8B3B93B64786B4194BAA3B7483B Buw
593,890,864 *3D0DAC9076764BB975DA3831A3485D84BBE09F10 BuwE,
593,890,865 *3D0F11B241D31E5B29E3F400ED4E3E1E4BDB688E BuWf%
593,890,866 *3D0824B85F86645E34509F5AA5114D3B6F830623 BUWg7
593,890,867 *3D007E112611060E8149DF683DB97877FC30F8AF BuWoG
593,890,868 *3D05D3DECD3E2D9A2B89066813BF18A48542C44A BuWwX
593,890,869 *3D0AB282CCF1C4CEC050F1244C9AFF3FD0EDEC5B Bu()X
593,890,870 *3D0BF4569A78722D1119D61D2A1376AE9A8B3939 buxfg1
593,890,871 *3D0E930D43F0E5AFB545E97951ABA63C07C43D4F BUXi%
593,890,872 *3D0340C9E8D5739752818507A577CFCBF2C15686 B;uXp
593,890,873 *3D0C9BCA3A09BC4A2DE8A019C95D41E3B646C35C :Buxqyaix,
593,890,874 *3D0647BF72A6CB03AB41E74FDBB2F0278339A581 BuXVK
593,890,875 *3D009C2F1FC20909C2584D63CD8A62158CFD0B02 bUxVzaP
593,890,876 *3D01223200FA3D55D6E25CE481EA0159F1BD1E08 buxwarez@aol.com
593,890,877 *3D0D8758920E9848C9F16D9D23D1C10FED643A86 B&Uy
593,890,878 *3D02E99D846441E24D793AA1F87461E443AED16A buydens5
593,890,879 *3D0DD6B537764A5C6B16C3FF413274B6C08406EC buye@hotmail.com
593,890,880 *3D084FDE82301B080186167F882CCF74BF7D7C58 buyer.18
593,890,881 *3D0B18D9A9AB90A660A14CAEBD5FF787F28E3111 BuYgE
593,890,882 *3D00128DD9616FF081AE35C9F7408D09392BE840 BuYih
593,890,883 *3D0611AEE2A2FB83490E451B41BB8C5912A39B75 buy my snake oil
593,890,884 *3D0DD1A72E98CF73E8BB2B72C03DDC58148B45C8 buyrak
593,890,885 *3D0E5ACCF9BCBDCDDBAF5DC41A47EA0E82539C73 Buysshop1
593,890,886 *3D0CAC459E493CBC840D0D63819E92859559D7F9 buystampsonline
593,890,887 *3D09C386B1CBCA7E77BF5423E07C08ADC8681DD0 buythouthecottage
593,890,888 *3D0287F675B915017C6BD83215D64AAAE9BD9EFD buyyourword.comwww
593,890,889 *3D0829BEC29187D7D9F5BB4FF6B69BDDEFEA1DBC B=UZ=
593,890,890 *3D0F723732C6464807810FA5C4079B2587FC03DC Bu+Z
593,890,891 *3D0474519766E7FE39FB8B1D5737DBCE197510AD Buzdygon3
593,890,892 *3D0A85CC7C6E655DE59CF98319B27E0C71071DDE BUZ"l
593,890,893 *3D053E8790E8FC67FEC81F455DF9CF4082FA37FE B$UZV
593,890,894 *3D0B47EA22C11C7DD895599734EF6E11001DE21B buzz (blow fly club mix)
593,890,895 *3D02E8F8AFBA55909BE9BEB0E6D7F41BC20BE53B BUZZDIANE
593,890,896 *3D0E592BC06DDA3AEFEA19FB0546C2F2CFE11597 Buzzer2007
593,890,897 *3D09041C248AD15C96AA3840719CDC4466CCCB0D buzzful2
593,890,898 *3D035E18B79F3AE27F90DE4B00B722D4CA299379 buzzjim@aol.com
593,890,899 *3D0B78CA08859C3876C75009329E0A3D30FD5EEB buzzwig0
593,890,900 *3D0DD60A146A22A978B7FDF45C2761432060A03A B-:V#
593,890,901 *3D0BEE734786E5411DC5484462C20431E21B2504 B-?&V
593,890,902 *3D04E5571395045F501EC3835C6BD4EB44781206 B,\V
593,890,903 *3D0238B02400A2B1240CD2A2BBB6A122C8221389 B.!"V
593,890,904 *3D073A0C3EE0A4472C2FADE54A18743B85A7A407 B)_V=
593,890,905 *3D01EDFA4856D0A875B6F1A105E39FFB77F72AA4 B+V;%
593,890,906 *3D06C50BFE9D1A58DFFB7E9993239921446016EF B=:;v
593,890,907 *3D03590695F3BD5F3F7734CE3264A7EEDA5BE670 B;$v?
593,890,908 *3D0BB33CC9C997B0D6648F834845CC4CCB041751 B.v%0
593,890,909 *3D004BD0A2373F37674218040D1A5C8CEEBC7404 Bv0!!
593,890,910 *3D023A00902E8A5404ADDF7A688FC37D1ADC96BD Bv0%)
593,890,911 *3D0206431C0F2B1A041BF0B034175E76391DCFD4 Bv027
593,890,912 *3D012AEE90989E5B5ADDCCD14186C6215FB96C45 Bv09#
593,890,913 *3D04B0506169142E5D3667E961C71A02CFF0A9B1 BV0.d
593,890,914 *3D0A07BD9F75A40DA02A30D20D833370F44DF80C BV0Ii
593,890,915 *3D06C3B3C50C934D436E52583474D73B0E594AB1 BV0+j
593,890,916 *3D0A0E37AA11BAF8156F4D9996247807078AF3AE Bv0r.
593,890,917 *3D0D71767B9E98D3655C10FB048A418489327EEC BV-0v
593,890,918 *3D01B87DA0D94839E9564A86A0AB2C10850F6DFA B(V1#
593,890,919 *3D0157BBB7F2500EC7072232E445866B8A55EB7B B?$v1
593,890,920 *3D088DF6B765032104C6C69E0236D19E238D8A64 B$v-1
593,890,921 *3D0BAA36628253C5F3D2ACD9A7D4F1AB492D23E3 Bv1%4
593,890,922 *3D029C26B09C641653626D5716D344FB4DDEACD0 Bv1ij
593,890,923 *3D0EC73D9FC40F35027661D13108B3B9EBBFD1AC BV1QZ
593,890,924 *3D01FE74CCDB4F40EC0717DFF59763805D555780 Bv1V(
593,890,925 *3D0020B461405C48981CF90030FA8854C6BC8EB2 B$v!2
593,890,926 *3D046158F64407C9A269611EE9756CA620F6BABE Bv=,2
593,890,927 *3D089C8BFFD0BAA4F263C8512203DAD4F7A579A5 Bv2;"
593,890,928 *3D063B2E9FA22B35E5B4A4E5450BDAE87C1ED95D B=V26
593,890,929 *3D00305EA41461E037D61ED43BB64184A347BADC B%v2e
593,890,930 *3D07F10DCD3F9BB0CA67B6F925D8162D6F868EDA BV)2K
593,890,931 *3D0F63140E6B92F2FAC9E6D7A7FC554186D8BF77 BV2M.
593,890,932 *3D00EAF2FDF17BD68D0BF37A926FF026B286FD44 Bv2M
593,890,933 *3D036E17501C2E59ECD5249AAA291A08C6003685 BV2rq
593,890,934 *3D06DFC39D4093F08A5AEE374E6E1E86441B614C BV2!Y
593,890,935 *3D05361A0D3067D0AC809C12ADFD385D9AAC310D BV3!-
593,890,936 *3D01673AEFB254385AE4599AB9B11BEA5474003A Bv
593,890,937 *3D0F046EFEBA4D10F652B6FB5B6F276899A7A5AD BV3+D
593,890,938 *3D040DD8A25AA885301166301A738973C74CA902 BV.3H
593,890,939 *3D02A0C7D245F58E51AD3F329B5D82E46AD9B719 BV3jA
593,890,940 *3D018F98BA079A589748D616E1EF34C38B93CE50 Bv
593,890,941 *3D0B7455A0B6D304033B43116D0D0CDE8847C508 B%V$4
593,890,942 *3D0D94779FB290010D144D835E58A096FB5E4211 BV,4,
593,890,943 *3D041CE63DAD0499DD93F1BDBB5FAB5C9FD6D386 B:v4+
593,890,944 *3D0A7C6239C9C7DFC18918B94D58B13A704DD8A0 Bv4<
593,890,945 *3D0F0DFD213AB7105702A38B1A0AF1D922EFE908 Bv48.
593,890,946 *3D01A4E1838895ECB7FF960F29D35FA2F6E1A803 BV4a9
593,890,947 *3D00FED8170B0555056555C11CF064E1D9CB779C BV4LN
593,890,948 *3D0FD23F2479E3E91B33720FA80C980905F78647 B!v4lve$
593,890,949 *3D0BEA8578E7E98B0EF2317D6CA90327E051BA6F BV5EA
593,890,950 *3D0EAAA0902370337D22A7E537FB099539550D93 BV5$P
593,890,951 *3D0059F06A7730DFC28A0DC9B2E4244C62704BC8 BV5p0
593,890,952 *3D0CD3D59BFBC24272988DCB9127A1093852DC1C bv5reserved
593,890,953 *3D0311A5836B6E26997FF5E42FB93859737B5ABC BV5"v
593,890,954 *3D0D9DA0CFC4233B18C8016F56533F2CF2DC5F0D BV6.-
593,890,955 *3D030F2B8682DF3E8112E943F4B14EB11F5A5D14 B)v6&
593,890,956 *3D09F01FA44DA453DB382E82AC5956BEC8B91EFF Bv6}
593,890,957 *3D0C6946280BC40031B7854F1F75104798089552 Bv64a
593,890,958 *3D09D1A3061CE47D4A5BCB846746740A7B5AEFDB BV65e
593,890,959 *3D0E7160984E4E11213D5FD79A37324C12500A1E Bv65S
593,890,960 *3D045AFAFC3C96F0D334489C54E222E82264D49C BV6cn
593,890,961 *3D06DEDF4485BA907E69982C538868D7F43E2193 B?v6f
593,890,962 *3D0A348637BFB4CD6478AB14937F9D0989F72199 Bv6O;
593,890,963 *3D068EE682DCC14E3500B1DF3672D9059945B12D BV7B?
593,890,964 *3D0885AD8B07BC5E0A66A95121FA8E2CC5ABFE82 BV:7i
593,890,965 *3D0A0D2107B8BDE7149FDA5E4E4CF4BB5CFA622E BV7la
593,890,966 *3D0A1245AEEF737639E654FBB1E784D7EE74FE9E Bv7%O
593,890,967 *3D0B172A0D8D1C32EAEDB19C0B3FAE1875C0C838 Bv7P;
593,890,968 *3D039A4CC8247C9802A458D8702D884B0CE986BA BV7u,
593,890,969 *3D0B6C86AA0D563E2E21E822F27F8F16AEB7C6F5 B%V8&
593,890,970 *3D0D1E9D72087DD37231E00816AFB83A4EC98E74 BV%8h
593,890,971 *3D02547082A0E1D380FCDFC221FAA268274DB392 BV8;P
593,890,972 *3D00C8E6E2AB929457FCB999DABA965CACAEFA82 BV)8R
593,890,973 *3D0F83DBB362CB5CA2A3B8EA5122B364C926A2F5 Bv8Us
593,890,974 *3D01FAC0F0808648D918DED53E42D84678A348DA BV$/9
593,890,975 *3D099F922E186660C0FC174F3109486C0E78444F Bv9_e
593,890,976 *3D0AA33749AD545925F256BF44B5278348D8F566 BV!9g
593,890,977 *3D0728126B0338C2CE6679078E167892F7B2097C Bv
593,890,978 *3D094370C5E82F99B12C9E2A8A8190FD072908C8 B)V9T
593,890,979 *3D052A39CF4EDFD8203953F25D349476624ECBD8 Bv9uv
593,890,980 *3D034EB7156CF30B8EF272AA33EFF0AC61B2BD05 BV()A
593,890,981 *3D0A8E468936F4EFE731E80DDE55DE5AA822E6F2 BVa&-
593,890,982 *3D0AF684E8423D704670E2D2AEE3F4090F0EFF3E BVA3c
593,890,983 *3D0AAAE2A76CE735ACD2D600CF4CE297027837B5 BV;a6
593,890,984 *3D0DE4D0AB2C4CE2E3EE21A647AF21EB93C08546 B_VAF
593,890,985 *3D03F73F3FA33459327A4C4F059D5224071519BE BVAGQ
593,890,986 *3D0E617EA1CB9E239BDE2A240BE1DD63566556F1 BvAI
593,890,987 *3D02A16314C4F6025D812D9B15C074FA9368D45F Bva;N
593,890,988 *3D097D2A8DCD9AE5B287CEE17360612A766E52E2 bvanme2332
593,890,989 *3D028BFB631476382382BA84ECF20A301EFD2221 bvanzutphen123
593,890,990 *3D03899F94B62D3098E49D14AEB3F40A323FA0F1 BVap2
593,890,991 *3D082E521B5C0976540837F2FD72DF257DC5B610 BVb
593,890,992 *3D0F392C2F9FC4331E2A456E693E893A54EB0436 BvB*
593,890,993 *3D06EF8AAB4A6F1058F75F457703E811AEC528AA Bv))b
593,890,994 *3D01ED23C857E89675BD20A67C646F7700DF7528 BVb4K
593,890,995 *3D0179E6C321DE3267C684B92925912B7E7D7D76 BVB?C
593,890,996 *3D051586945194DC98E72B340209FC12C97D3F5D BVbd.
593,890,997 *3D03AA63960A8558109CB571BC051DEB05E7D1D5 BV!bG
593,890,998 *3D044B42A6CFAFC63F4093CA02D7B7C4ECF3B2BA BVbhc
593,890,999 *3D0AAE96696DF2BA0D7A21657D931A548337B9F4 BvbR&
593,891,000 *3D00CB05892B18F77F93E634E401C61904EC9AF3 BVbrr
593,891,001 *3D05073DCB09E11E95620F6741E9BB6011F62D9E BVBS"
593,891,002 *3D03E916F5E08F1E65064CB7A89C58014F583BF9 BvBw4
593,891,003 *3D071E41A3E0DA89B05B44F80369C0C3424DEDDB BvC+9
593,891,004 *3D036DCAA75354A93822B11D3DC424BF45498ABD BvcK9
593,891,005 *3D01B93EC027A22FE05E2F6994F8F90838AE52FE Bv-Co
593,891,006 *3D0C92A70BE404C55850B7F0E88695A4D57376C0 Bvcpbswed
593,891,007 *3D05775B041FBD573D0F8367D5DB42089DD1F704 BvC=q
593,891,008 *3D0CD5F59BF124B1683918608A58FF4E063BBFA6 BV,!D
593,891,009 *3D0998A964BA83554960D4D35CD2591617076AA3 bvd68
593,891,010 *3D0060A9756A8943609599A1154F1EF9CABF18C3 B-VD7
593,891,011 *3D0DE92A883CF48DCC31E5418D779CAAF684A74C BvD8$
593,891,012 *3D010731363C059DE9742AFA00AF012693650FEC BvDbH
593,891,013 *3D0B8836EF1684C58627F540BA7799322DA01955 BVDBt
593,891,014 *3D0A9D91927F45BCC34F745B3F752467E47A3799 BvDCo
593,891,015 *3D0706FCB9CDBCAB32D0ED47EDAE891B4479608B B+vdn
593,891,016 *3D046326E17F80ABD94A477F20F4C41E0DB4CCE9 BvE(=
593,891,017 *3D0121FDAFE5170431F14E5FEC32433A74596950 BV;ec
593,891,018 *3D0391DB489FE94C7CC09C675938D6520D4D7479 BVEF0
593,891,019 *3D0AFDFCDB1E45C78395EEEA97162B26499F3201 bvef@trall.almaden.ibm.com
593,891,020 *3D026B9021E430DFFFD6EE11DC3753EBE344B03E BvEIW
593,891,021 *3D0D6058AE33006B9A34D866D5198DE8F3448CB9 BVEj7
593,891,022 *3D031BF2D216670D2B36857C6A640AC0C1EF020D Bvelses5
593,891,023 *3D0336E037F28AFA21DC76C5F537AC41A49CED7B BvEPo
593,891,024 *3D06369A5AB8A880E47B946BB8799925988DA5A0 BVE+S
593,891,025 *3D0B6C9169A70DF5F38EF18DC19DEAE5B824B4B3 Bve:v
593,891,026 *3D015DE48C03255FF8E933E1C8F77BF7A5563F6E B:&vF
593,891,027 *3D0CEB5FB834E13400C1459841BCD99FE8CF6F0D B=+vf
593,891,028 *3D01452E7684D650030AD31CDC59DB503972A860 BV;fa
593,891,029 *3D002D85FCA5F764EA4F310954EF8CA7FAF678F6 BVF
593,891,030 *3D0E087CF30C81DA86E5638CDC936D62A52F5E0B bvfd1821@aol.com
593,891,031 *3D06675986ED7277166CDD77806D2CBFA18C7F86 Bvff1
593,891,032 *3D0A533E20A7433F1F37C1ED3162EED9686E3B98 B)vFM
593,891,033 *3D04A71BF2DA6F03971617553E19314E24E65FC7 BvFSN
593,891,034 *3D02533AD5693ABFD7F056F216173BFC73B1E790 B=V:G
593,891,035 *3D087E0AB21D003BD275B71D9318B7BAC7459F2A BVG-,
593,891,036 *3D07B5BF1491821FBB7BB5C794F05D22CD790D0C B&V:g
593,891,037 *3D06B48E8570666E815E2AC423644A1D0E3A5DE8 BV
593,891,038 *3D0E666191C3F4AD0CEFB3DD5AD6BA87D598059A B(Vg5
593,891,039 *3D02C9C639970FDDCBD67CBD9D10A943D7A8BA76 BvG5q
593,891,040 *3D0AB7292D6CE9D5AE0E8DCF48AF833E6015D9DC B"VG9
593,891,041 *3D0274A7C5407CEA8F5E89353325546ED315A650 BvGc9
593,891,042 *3D0CFD796F4B200DD0D6EBF50084E8C5347D1537 BvGdT
593,891,043 *3D01E8A2F1562DEA6D10672236D4797A577DA152 BV%GG
593,891,044 *3D0D0BE8BD1585284086D3F7A5F1DE116F22E8E4 Bvgi(
593,891,045 *3D0073802DAD7D58FE12C7950F04623F343C2BF0 BV&go
593,891,046 *3D08628A5EC8A5313F9E261B751A1AFAAB3B1C7D Bv
593,891,047 *3D063BCE30B160DD9E1F91DB0271734F8F7B61CC BVgwu
593,891,048 *3D0C7F241EE30EF1D0A50F81CE454D6CA9A49D1A Bv""H
593,891,049 *3D07AD289AD3F52633AB9E47AC8AEE8DA35DC758 Bv.?h
593,891,050 *3D0978AB951B22254A64DD04AA3DC31847662428 Bvh&2
593,891,051 *3D0C967077268B94D5B2599D1A9F2A41501E4E0C BVh4k
593,891,052 *3D029AB4C7EB6B9B7152F8909C135A1F89DA4E33 BvHa6
593,891,053 *3D0EB40AC5A6A640C28B08EC9A1A7C0BAF1FD9DF Bv;Hb
593,891,054 *3D06C2D14B4B0B628B2F93F192FB9FD6D924609E BvHdq
593,891,055 *3D0EE63A9B0FE54795B51A1F227BB66DD2C44C68 B=VHf
593,891,056 *3D0EE1C0D477348C11A53B6983C84771DABD7ADB BvHfT
593,891,057 *3D0B51BA2DCAA6B7E80E75A816E8237840C8C6B9 bv@hkonly.com
593,891,058 *3D0CC29E7A4F42F9D66891CFFE22D7814EF8F17A B.VhR
593,891,059 *3D0B13C3FFEBE8C6D86B143002C256FB350E21FC BVhr.
593,891,060 *3D0996CB8FF72A4559844E7488E4CEC240BBEE4D B#Vhs
593,891,061 *3D024133E191DDE8CFA0F149619FC20A06807D57 BvhY2
593,891,062 *3D07F2FC9C0947DBFACA97221B406CF5C82FCBAC BvhYc
593,891,063 *3D0D571B15812CCBA3E4FF68EA6F3DE5C1F20126 BVi";
593,891,064 *3D00473123FE031DA8473218AB12F3D226C703CF B="vi
593,891,065 *3D0088B7909493EC78B3FE7E24C383F59079A37D Bv)$i
593,891,066 *3D0F9C1D1190F1D4FFE9CC73E9A79A2FAB678D81 BVIBr
593,891,067 *3D03E6BBE2E9ECAF70F137403EB1B7F04EB3A17C B/VIH
593,891,068 *3D011A88BFD874FD9E95F46903ADC096A590FF03 BvIZ.
593,891,069 *3D0CC09D408B3862874787B0AAA7A688AE519A47 B@VJ
593,891,070 *3D05FF0C1D9280D370ACA587ED24D4CDE377AD77 BVj+)
593,891,071 *3D0E743BBD501D7533573807F80A6DF818001323 BVj2r
593,891,072 *3D080C6E7B17720D9D6C7D1B6256EF54F07A0F1F BVjeo
593,891,073 *3D06EB3FF0915FEB8B8AD0AB68C2C8FDD001DF0E BvjGe
593,891,074 *3D0EDE1C5B8FEE71C340F3F0612F1AAFA30728FB Bv/jQ
593,891,075 *3D093851B0ED2D02BED9146D0F119CD25ED95798 BV-jv
593,891,076 *3D01EDB44F758C78C0055A9ACDB11A72C8A581A9 BV)K:
593,891,077 *3D04F711164B40517DE9FA6A906E76198EB68740 B|Vk
593,891,078 *3D05B7B1B883D8E86B54F281C1686FC8E231B91C B!+Vk
593,891,079 *3D0679B2915A0CC257294AC27F3023CB6484D358 BvK.=
593,891,080 *3D03BD2B930D9DC52285B53DEE9F902A936A3E0F B-vk#
593,891,081 *3D07463B5CAE2581327A9272BE9F7F3DC44BC855 BVK55
593,891,082 *3D0F2DAEFCFA3156EF9DE96BADD5D05153A86CC6 BVk6V
593,891,083 *3D0D10EF71DE50DF2CB17EB6E4EBBBAAC5B057DC B:vKb
593,891,084 *3D0D483C0DA28B231171F7DC286A496836955191 bvkc@netvigator.com
593,891,085 *3D0A51402AC5689E7D444D6C6B7E590B56750BFD BVkFD
593,891,086 *3D0FFD985B055785B4DC71FADB4FCE488C4502FA B;vKI
593,891,087 *3D0A552A5C343D5E0404638FC096E00A9B383C46 BVKk6
593,891,088 *3D05AC21BEE9724F15777B7A314B6ABAF48636BD b.v.klyuev
593,891,089 *3D02C96B3A2A4A00141AB2C41F0CF461C2C7DF83 BvkSZ
593,891,090 *3D01AA765C5E43D08E71AFC7504E7E023D229007 BVkVO
593,891,091 *3D0449FC4A61A33709EEE97FC62A16D7988D0A59 BVl!.
593,891,092 *3D068E32F198D1807716EC33B546058F2F521F72 B.v!l
593,891,093 *3D0C897A3A6364A75F1DBE98C88B077251D6E551 BvLeK
593,891,094 *3D0021B317227288FD829B6BE4F5DD25BE885247 BV?Lh
593,891,095 *3D0860D991FB5BCEFFC4FC7FDB75F96F83A4386E BVllN
593,891,096 *3D07182DAC8909A524601D500EF107637FDF09AD bvlngn
593,891,097 *3D07DC3364370B32ECD8F59ED72EEB148F834D46 BV(lw
593,891,098 *3D09313857E886C65DC48A491AB92AC0D456D1D3 B.vM:
593,891,099 *3D02F7DB5E558150571BB090F45FFAD0ECA1023F B?v?m
593,891,100 *3D03E301F616F91D501E799CDF1EE133358D60F6 B+VM0
593,891,101 *3D0C8E0D724F7AE56E3C1C82A23732C325558AF0 BVM)B
593,891,102 *3D054D3BD09FB55732567483FDD5B2970EA70FF7 B,VmF
593,891,103 *3D00CC24DDFB38195CC8D010B340A0951E268839 BVmhe
593,891,104 *3D00FA77961B101AD0562BAC2DF4CBCCF4F7A4FC BvMi$
593,891,105 *3D0F8653EC507C401C31CBA0C5A015FF5594182B Bvmrf
593,891,106 *3D0D9D9168C5013E7628193F02FD09971E46F72D BVMTa
593,891,107 *3D0A4B3B9CEF4216737807B0E2829610870D403D B=V
593,891,108 *3D0716584D70F1629309CF4D6BDC7BF35470436C B%VN
593,891,109 *3D00B7EF0450BBADC8D254F2DD679844D96FBDBC BVn:"
593,891,110 *3D0F5FABB89F15600CB95CF21575B2E45E597586 B//vN
593,891,111 *3D0B319CEFD58CC8A5376CE42C482D480424DED9 BVn0N
593,891,112 *3D0C4BE495975C7DCDB2D08387146A4C3563A81E B?vn3
593,891,113 *3D07367FB26D383CAFDE9B8C9723F027B40953B8 bvn81
593,891,114 *3D09BD85DA6791FA98CC8C466D80FC26D8E77B8B BVn93
593,891,115 *3D0F7790FA45472EF4430BDDD094A3428FBD1917 BV#nA
593,891,116 *3D015FF623D79BAE96B752650A0B993C1FF22445 BvNc:
593,891,117 *3D02FFBD4F983824CAA689CE45B60691FA40DE47 BVnE
593,891,118 *3D0E36D23B9A0A792BDC9C1C6C6C1A17CCD2576F Bvngal
593,891,119 *3D05B0005BD2F882A52C4705A7AB2C4576680743 BVnr
593,891,120 *3D0851C16FDF8BF48506130358DE835B2C5083AE BVN.s
593,891,121 *3D0A8E5269A1BDF711A8349A4D878C096AF4BB30 bvnschpns
593,891,122 *3D0EE37433F003E763A3BF3781B9AB72D16F5A40 BV_+O
593,891,123 *3D01C87D9B8D1BC6CD0E69605F37103441932947 BV
593,891,124 *3D027A5F9A079F4C4A5AC997AFBF7FE44159DED2 BV):o
593,891,125 *3D02BBB82C0A1AE9304AAFC4B6B70371B803598F Bvo"2
593,891,126 *3D0119692FBE644EF4275138DE9163245234C807 bvo24@39.net
593,891,127 *3D09BE0097EFA9F2DE4851F582267DCB42C5FD77 BVo4
593,891,128 *3D00C78AC86258033CD1396191920A5E84C3EAFF B/Vo8
593,891,129 *3D0F6554B39DDC4DCF376B3AEB9B828905EAA331 BVOAI
593,891,130 *3D061244D6BDDD651B9EE313194BCD13009FCF61 BvO"D
593,891,131 *3D076577DFF476DB1ED2AAC7065024CAA9BD7B25 BVo
593,891,132 *3D0F783BB9F76158DA86632573F657AB979C4311 BVogu
593,891,133 *3D01983D7C87F9769094BA176ACCC9C227F526B8 Bvolbsw7
593,891,134 *3D0217B6A69F93DDD4066F7A7DF1D16BFADEA862 bvoltmer@aol.com
593,891,135 *3D0ECF0D5611AF7DBB6639E5BF2798CDBE6B73C4 B,VOM
593,891,136 *3D0450ACDDE80C097C3A2FCD09361A3B34659DDE BvoR9
593,891,137 *3D0FCA1AFE624EDFD19B9784ECEA363A0358D667 BVOuS
593,891,138 *3D082ED8EFC5D04A6C6912B0D0C7DEF6D54AA675 BVoVlYV15
593,891,139 *3D07479C7E6E3EB3776876DFFAD429380BF7CEBB BVOvn
593,891,140 *3D0E30D3559C9CDFF46AA926F15E5CE444866A5C BVOXH
593,891,141 *3D02EA817E32611A9666B84E22A33FF8078765FD bvoxnovus.com
593,891,142 *3D0618EFD000D10D1F39794D2961EC0B4115F72F B_.VP
593,891,143 *3D09E6A9CFEA3626275E771621169642B5EF7B43 bvpatel@aol.com
593,891,144 *3D02FBABB0FCE35916D7606D40FDF7CAEB1D6C2E bvpiik2
593,891,145 *3D055801D99A1FFB1F153E813567BACF1FAFF18E BVPtZ
593,891,146 *3D05BD76BDBBA3357E53830A605E3360DF03ED08 BV`Q
593,891,147 *3D0E693977EB94FCC26D304ABB15DA628FE3C77A BvQ2W
593,891,148 *3D0F313FB4A58B8A01CD410DECC0D6D79B4E95FB BVQj-
593,891,149 *3D0DB79C6413F86868BB419A84E639BB25955F66 Bv?qr
593,891,150 *3D04E4EC25071BEFC129A721703E8CA360CB81A4 BVq#W
593,891,151 *3D01E617D683B1C86CD54A432D08990684B62FA5 BVq;Y
593,891,152 *3D0C33EE333FCC27647C169253BBFE05B63B6F4C B+V;R
593,891,153 *3D0358D408B83DC38C9B2F92C5BC3E9A9D30C288 B!)vR
593,891,154 *3D0D2BC9FAA9567998F2AEDDAE0886C3000DE95E B(v!R
593,891,155 *3D022015DDD2203757DE8658B5AC7DEF215D83D6 B
593,891,156 *3D0F7E7751C9D8F64EDB1BFA1DFD6695C129740F BvRa&
593,891,157 *3D0AF72855492BF78C3BDAB4DBE5878AA8CCEF5D Bvr?D
593,891,158 *3D0E59F65E122CED54E3D38CEC67639A97D1379D BvReT
593,891,159 *3D0C33D31A5965486FD2340C5C2D5D83C4CE24A4 BVrh;
593,891,160 *3D0247F06E482D433CEAFF394800FFCB24372DEF BVRI.
593,891,161 *3D0D500888E710E3F1F8448E00C4898CFFDC5268 BvrI3
593,891,162 *3D0C68609A31FEE5D231F8633D1B50C8BF052CB0 BVrIL
593,891,163 *3D066254B1438D05F33C805453C535478365D894 BVrSw
593,891,164 *3D0D7CCF368D1329CEF1D53C907CA8C2009D6DBD BvrU
593,891,165 *3D0B163ABCD9D8D1AB30F7B8999EB7BCBF86126A BV%S(
593,891,166 *3D0F4CECEF9C015BDFF6CE04D4B7E9AF145C4014 B"Vs&
593,891,167 *3D0766159EB5811D21B7F80927C66D713E056AC2 B$v"S
593,891,168 *3D03FD94F26097EBB7FCB7324BBCF1B97F70A27F Bvs0M
593,891,169 *3D02BB77C487813B0CDFE364634E60FE2591502E B$VS4
593,891,170 *3D09B57B696098C4FF76D72EFA6FB2943402A622 B:Vs9
593,891,171 *3D09D42E9342D313711F3FE382D1B2BAF7CA7D43 BVs9Z
593,891,172 *3D0D37F8E5FA646699A8C6238831763664A5F374 BV$SD
593,891,173 *3D020F5A28D70E25A8FD5558277444791C4FFAC0 BVSIO
593,891,174 *3D09B7DCFB3DDB22E92A522597C1FBA4611F8D0C B?vSK
593,891,175 *3D04C88913B450DB1891B6E0B468030E7E4B8FE0 Bvsl1
593,891,176 *3D054C4B54E1869F19CA0F3A94EF4B5E7B45FF84 BvSpL
593,891,177 *3D05D3F3421A3D2057F71A42F02325891E7B9B87 Bv"_t
593,891,178 *3D0937E9BFB59858E2AF7D27E4C2D217D00D436C BV
593,891,179 *3D03C34BEDA4851EBD89033DDBD993608A833F80 Bvtb$
593,891,180 *3D0704D41CCE640AF2AC44C18506604F73773BAA Bvt=D
593,891,181 *3D0B3CD19726A55392008B9D139FEC7E81BF1F12 BVTDi
593,891,182 *3D0C4FF2E2FD7CD870727E8B37D02FA02B1740BD bvtECmFE84
593,891,183 *3D0CF30C98011E459F2695E271638DB41FDEAA50 BVt)H
593,891,184 *3D0EB295E6A180E8C3DE6F29F1BEEB5ECE65B523 Bvt+h
593,891,185 *3D006FD8600643337D5B90B58F2FC561A7340946 bvtp@netvigator.com
593,891,186 *3D02A87BB69F0A363741F873027270C7842EEDA9 B,VU
593,891,187 *3D02E92C5FBA0C8D63C1DDE80629F44C31B9C455 Bv=,U
593,891,188 *3D01C326FD8ABBCA1E5B77389FC9EC239F923851 BvU1p
593,891,189 *3D0E5C092D2A3D64D7F924920E3EABD42CB4CC90 BVU50
593,891,190 *3D07297D64F99B020197CA7FFC130F267CD5F74C BVu&c
593,891,191 *3D0EE362E633D8FADE809E9A8DD3E3D67883EC8F BV+Ug
593,891,192 *3D084897E011659A404421A791E14467312CF97E BVURw
593,891,193 *3D047A7FAA5E15A6165996D5104E7D4E645F9070 BvUud
593,891,194 *3D017D833651A2FF61C41E1355595DCD0F4759E4 Bv.UY
593,891,195 *3D0537B829345165C8557B81004DCA16C2069559 BV.v!
593,891,196 *3D04579474AA5E142F1E7A9F6D8FB78D3F01606D BVv($
593,891,197 *3D0ADD403204BB64BEFCF74F35EEE29A36C766A2 BvV5Q
593,891,198 *3D029ABD664E02BAA772FC77A2CA2E4C03598304 BvV5q
593,891,199 *3D01DB60E10948114E0D57E4B9F74B1D2B42D4DF BVV6i
593,891,200 *3D0E92BADB4932C03AC763A027BEE5E9B6D5B4C3 BvVmj
593,891,201 *3D0AFB46E725FFE9FBF02F1B25463474A1D57054 BV!Vs
593,891,202 *3D0FF30021B5742B48A1E81F7D821B8176592CC8 Bvvsbwna
593,891,203 *3D0E91F9103C735A62E2BF30E45EF692648F4A2E BvW.,
593,891,204 *3D0C879FCD98B8131CC2EC0CEC086BA01620C145 Bv:w+
593,891,205 *3D02863543AA9A1AA2A1E987E555F1082249374B Bvw"4
593,891,206 *3D0F6BA8D627C149C10D68E4C43F8806730B7F46 Bv&wA
593,891,207 *3D0DF601C1A111E390F61A017EED8277F6EFE1FC BvWg6
593,891,208 *3D0BD5C6EB5DC89D6CF7BFEFBF3B8C38EBF6F138 BvWtN
593,891,209 *3D0216AD26715903A60195D904070A2090840B9F BVX\
593,891,210 *3D0ACA2AF5746B0992C95A9B87BE5B48AEBBC201 Bv;,X
593,891,211 *3D0B0D2DFF6B4B4F251F838EBB71FB75730BB794 Bv;X0
593,891,212 *3D0B3DAED54AC4086923433E4FEF308790D3A3C0 BVX=1
593,891,213 *3D0CA51CB4029669E540F38F1D901DFB2A08A53B Bv(X1
593,891,214 *3D0169B31DC7632C1F9ED6754BB2C152FD616211 BvX;b
593,891,215 *3D0274A15FFBE10DCBB361A3C5A3266E20F1BAF3 bvxh@hutchcity.com
593,891,216 *3D09167B156C239F47C27FB6D1714A567C90BC19 B$vXi
593,891,217 *3D07DD4C6C2DC22BDE9E4138D213FD73ED601641 B/vXM
593,891,218 *3D0BB23F58D3C21F8D7D542F2F424B104E70E35F BvXN(
593,891,219 *3D094FABDB8402087FB0593B1045155EBFE150C1 BVXNR
593,891,220 *3D079349DFA2B95A63B2B6E0998302A1732A094F BVXs%
593,891,221 *3D09BA38A12202AE88FAF7025FD50B34AA4A1723 B,VY+
593,891,222 *3D076A5D44543559993CDD47E42FF5B74664C764 BVY5C
593,891,223 *3D004B6C72860757341913519291A8111F3D9A4D BVYN-
593,891,224 *3D0585DA4A1FDCF8CCC23DAD80BDAADFA4389B17 BVYXh
593,891,225 *3D0E5F9FD663035DB38CC58E96B767460C05F6B6 B=.VZ
593,891,226 *3D0AC780952D2A3D21C297E60857E4ABCE9DC218 BV%-Z
593,891,227 *3D051AB5314BECE1DB6F7732BDCFA19EAF5B2AE3 BVZ,
593,891,228 *3D076039FCF8C713AF2DF66307C72A51D24C2923 BVZ3w
593,891,229 *3D085CB1BBD80D9E0CEB08A8288AA295FC0FD0CD BVZ5q
593,891,230 *3D0EC87C0BB905FE863C0339E59827BC36FA705D BVZ65
593,891,231 *3D0528042268BFFEFE814E75C7AAB8617F707D04 BV+Z7
593,891,232 *3D00E4765B2F426985CBC473A279BBF0624F08FA BvZCC
593,891,233 *3D0C825390B2717CD5835778066F558842FD884A bvzgbb
593,891,234 *3D09B3A38D6BCFAA89FF9AF2BCF6D865ABAF5A4F BVZWP
593,891,235 *3D03EC26D54AB7617BE205C682C2CDB775B040F2 B=W.?
593,891,236 *3D08FD74F83438265EBF2E4AEF723D5CEB4C19C0 B?W_#
593,891,237 *3D08A3E34C34DC4A896D5878BBDB3EDC075EF066 B
593,891,238 *3D06AAD07DA421D534EADAC9618580E5097D8C6E BW_!_
593,891,239 *3D0CC0EF430C3FA8B1CFBBE1072A6BA7E9596131 BW;&,
593,891,240 *3D0FCE7AA4AC9B8C4D97DA80D366CA75C76B61EF BW?_,
593,891,241 *3D03C42B840A03CFE5B49F91C94C0721ACEACB0A BW)=?
593,891,242 *3D0F4DBA5E1AE5C1F34679CB5F1D5CB57D9CF163 BW+%%
593,891,243 *3D01D2F282FD25E4A98173A5D6349EB6A7B6B52A BW
593,891,244 *3D06AC827024294327DE3160B57FE5171DF38518 B^$w
593,891,245 *3D0A1878875709097F3D2D39D4DB3F55DDFDF5F6 B_+&w
593,891,246 *3D0EEC1838D4CA684165EB9490119E7FB7B67BB7 B:
593,891,247 *3D00C3B257C6E92363B55CAB9DE1D28CD277EA6D B!w?&
593,891,248 *3D032FB48BB5F1F40F4EA5727326302BD81CE5D7 B?w$"
593,891,249 *3D0028A55B11A9663FEFD86E52C18655E79C3333 B/;w/
593,891,250 *3D0BE6A20B73D7F01108C99EDBF48E9F85726818 B.w--
593,891,251 *3D051A3591063ED59D413EC610D9F31D4D0498C3 B@)w
593,891,252 *3D0A2E11CA1CE6313339F4F27FF5A5F5EBD26A90 B%%)w
593,891,253 *3D058FFF31424B3F7439511DDC30DCE151538C85 Bw;:$
593,891,254 *3D088FDD47A7599DFF0B3488D4186331D72372C5 Bw;&?
593,891,255 *3D05FBE2E0D4776464EB9D7D5ABCAB97B476DC23 Bw/_+
593,891,256 *3D0DC4944007747480FDF6850853FAD089DD9EBF Bw+
593,891,257 *3D0A04A80849C4661D4E7AACCB3C64C3F0CE22B5 Bw04u
593,891,258 *3D09FB036657C4EB2032892BA6BA173D86D1D4A8 B,W0g
593,891,259 *3D0207D42257F9093B7352A9633813222AB2C023 Bw0G
593,891,260 *3D078248334DD373A809224397E51A62AE2B792B Bw0g+
593,891,261 *3D04FF192BFC525C71EBF0FE8C085DD291369951 BW0ja
593,891,262 *3D011B44DCA4E07311C8B1BA2C52FE6E3AA34F91 Bw0jU
593,891,263 *3D027C1DB5FCB298EEDE19ADB3E975A51B7CAE50 B?W0O
593,891,264 *3D06EC13971A6CE1843B2E3EB9812C35E97820E4 Bw0P.
593,891,265 *3D0A799F2B95AD754EB16DB22A1C9CB1B4644816 Bw!1"
593,891,266 *3D0BF8AA40E449710CC705C381D95BB9944B9984 BW,11
593,891,267 *3D068B5CF4794657F92363AAE3360ECA1322ECE8 BW1E)
593,891,268 *3D07FD006362C01358C8789B79995812F849A126 BW1eo
593,891,269 *3D0F6704089A2851E78C639C05B9C19A240D30C1 Bw?1j
593,891,270 *3D01C1DF01C6CE8750453AB35709DD02989EFBBC Bw1Ln
593,891,271 *3D0A91A9F0D0CDB86806F71A884FD92C615C2CFF Bw1M$
593,891,272 *3D0A443615A8D2FEDC6EBC83FD537FC67FCE8346 BW!1w
593,891,273 *3D04D2D2D2B6A3BDDD9CEF4D210179199F40C888 BW1wS
593,891,274 *3D02E0370CE524B28F5798A81BB2938757CE467B BW20090129
593,891,275 *3D03B962638219C467C7ED699CD464A206CAA5F5 BW24q
593,891,276 *3D0407F615BBBBDC93AC69199C00F611FFF98A1E B:w28
593,891,277 *3D07013A094F55FA78268E45D3243B42BF262487 Bw2$d
593,891,278 *3D00766E2751F0FFB3252CC3F8A23B264BCAAAE8 B/W2p
593,891,279 *3D0EE8C3081FE5A31E2CB35EE97FD123DBAB9A2F Bw2Qu
593,891,280 *3D05751CABE27DF8086D1D09A967F6A4F0139A92 Bw3f(
593,891,281 *3D0285D25EF61A8483CC2C8F721C37F2DEE17FD7 BW3FL
593,891,282 *3D07FC2F8EFF3384A2739DF9362AC4B3E71C6CB8 BW3HM
593,891,283 *3D053A4F128B4CA3767239EDC481B80B3F9192F0 Bw3hR
593,891,284 *3D0304F1104C4560B4FE031D6226765E5E2D87EA Bw(3n
593,891,285 *3D0F5AA33300FEE6BDD457EB73BB6FC89B310F73 BW45q
593,891,286 *3D07197EEAACD8C179275B138B48A2C03CD439D2 B/W4r
593,891,287 *3D0B35DFB91209379A0E346F02D186F22A66D24B Bw4:r
593,891,288 *3D05C795A26E4A977C9536F365C1E05B4DE8C602 BW;5/
593,891,289 *3D04436B037578D81EE0A7211D38F802C79ACB28 BW5)#
593,891,290 *3D040FD9DE2EB921EDB96D8B8A034CE5207FE5BD Bw517
593,891,291 *3D0FB6675EBB49F4D3C3B871C69C2DE12C3BA2EA Bw5d9
593,891,292 *3D0E62D775E12ADFCB2A340E760E6EB81D54DE4A BW5-H
593,891,293 *3D03C68553C80A1C690AE51615CDB13447E2C83B B;w5u
593,891,294 *3D0670B24A931D32F70BD1BE762211D183B188F1 BW6oU
593,891,295 *3D06EF60B1D01AFE5FC3E1D4972E550D58E5478C BW6VQ
593,891,296 *3D07EB9BB03520C7D9C2DF600B62D8A2FD9E87ED B_"W7
593,891,297 *3D070F6FB503D6F15CBFF2BF52F21AC78554011A BW7..
593,891,298 *3D0F95C108D3030FDC43D2281E190364F6C7FD05 Bw71S
593,891,299 *3D0C53BB308ED0F08D8A2D7A365615DA8F939B29 B;W74
593,891,300 *3D02FCE39990D8F9A6DDDED365B78E85935C3C88 Bw7IO
593,891,301 *3D08EB1C9B089CE606657359CC20EB6E1D6FEF12 BW7$L
593,891,302 *3D0FBF0248FEBD6C51112FD15E8509AF6706AB2F BW7!p
593,891,303 *3D0E6F10EF9EF3E2B9CB9E4440CD7D94D0949A2E BW7PS
593,891,304 *3D0E904224006DE8B9F13B1718493E521D899E66 B:w7u
593,891,305 *3D012D76355767E2D6845E963FCBCF2F3FE3D678 Bw!7V
593,891,306 *3D0FA361D6D71FF989A0715BFD870D0FF3829B35 B,w8#
593,891,307 *3D02E48047CB98E48FB2A4BC92FFE263ACB68A9A Bw$;8
593,891,308 *3D0B098FD7BB33CC05108DEDAC1F6905B19F042A BW8V4
593,891,309 *3D09BD85888B0C2C5D52339B80E68CA64659B29E BW938
593,891,310 *3D0B7E844008EBEF041B21C1E5B8C2EE07C06D53 Bw9K
593,891,311 *3D073000DA5C741277A128239E81E092A908400F bw9l45j4
593,891,312 *3D065114A6F2F40D0473A7B7736B493CCEF04CE2 B
593,891,313 *3D0028F93F0C8633D07D90DFA5C6686948E5C64C B=Wa0
593,891,314 *3D0F482C83FFADEBCA7253EE80A4A78ADF046B52 BwAIA
593,891,315 *3D0B727A6DAD0F2A0ED4D56A142EF4E0B942DD7C BwaN=
593,891,316 *3D0564D154A40C3B60D5CD0FE1B56622391C8DB3 BwAou
593,891,317 *3D0A43CC9140FCC9E20AF16F8D338591C48FC157 BWa=X
593,891,318 *3D030AB28BB36576A81E261DAF40AD2042C73579 BwAZ&
593,891,319 *3D09164A844F4407D6934983BDED4F131784DA69 B(!WB
593,891,320 *3D0AC93A712D1A2D61202A5151B43A4D853C8FC0 BWB6U
593,891,321 *3D017EA29205D90AB7A6DBCADBC144B5D2D91650 BwB8
593,891,322 *3D068C405777EAAE288B581334D3D813396BEDC5 BWB8G
593,891,323 *3D0A2D0EE5B6B61A4497D6803A0B5412DD7DE84F B+WbC
593,891,324 *3D006AD8D9DED5C1023C7C91BCA5D05C2F8F4723 Bw=BG
593,891,325 *3D03F712F0DE1BF178928B2CCB6F955A97340962 B!wBh
593,891,326 *3D099F863CB289A2C030C737F9A4808623359021 BWbK
593,891,327 *3D074F08313A9DF6949E211ED3ABAB07F9E2E17D Bwbootps
593,891,328 *3D0B7EB02A8506B156D58FC7E1225D198E2C8627 B(wbt
593,891,329 *3D01DE0EF3E951B92C41799412F7E7B1ED26CA6B BwbwBW
593,891,330 *3D038D9E26082E04E5420BB4957B202B2FC9AF55 B
593,891,331 *3D0B27FA1CBE976EC460398A5B6C66CA47E0154A bwcexh1bgw
593,891,332 *3D04C569FE30E139AB9A0B6667D58990B32F2964 Bwcfw
593,891,333 *3D03E8D8906EF478B2333784B202DFF4CD7D3AC1 Bwcg)
593,891,334 *3D0F173C06C0376E382E1EABEBB570FDCCC1F9D6 BWC!k
593,891,335 *3D0F3FFDC4699CB22AC0AAB3FB0E4FB1C7ADD68C B/WCQ
593,891,336 *3D0B2F4694F78596B103B99834B37EDDA2783FCC B#wcR
593,891,337 *3D0063EA5A276163453F97B187E3E63E3E940B0A BwCrw
593,891,338 *3D04DA0F57C94B5442B18C280D3ED936AD0002FB bwcxfink
593,891,339 *3D0E059A39C5FD8377C3A9D52517A765FC7ACEBD BwD_7
593,891,340 *3D0A8AAD7244A4B668924A3C49E3AB28984D6088 BWd8v
593,891,341 *3D03FD3DE65EC225654B412340A2802644148AB6 B_wDB
593,891,342 *3D023EF076E5E0F41C4E4957954D8917FB686EDC BwD;E
593,891,343 *3D0DC0B7DC6CD7B21346F42E4A10F5D776FD24B4 BWDf
593,891,344 *3D03215E1950F8FAF9AFB6341B1FD6D8397CFD36 bwdstrt0
593,891,345 *3D01433A34EB87562D71A07C299DAF2211F875FB B,WDV
593,891,346 *3D0AE0329026CC53B18E043298AE25FB2973DC3A Bwd:W
593,891,347 *3D0F3AB390CDC1FC489E7F039105A6FFF1E6F9B3 Bw;DZ
593,891,348 *3D03EF5608E8A4F9B0DEECF1510357BE0EB9F290 BWe|
593,891,349 *3D0BA5E6E90930BE90F0316819BAA6FEA76BC433 BwE?.
593,891,350 *3D0318DDA469692AF5B8F2E6F619E4F2EC28684F BWE68
593,891,351 *3D0D660C88AC673F7EA4A44D71B20628997C468E BWe6T
593,891,352 *3D02B16A8EFCC5415EDE3E70EA717EBC9CD8B48A BwEG_
593,891,353 *3D05055D2B1B611F4AA9DE9A8FE95F26FB4BEC74 Bw;EI
593,891,354 *3D09828874EE6C03E51F74367FB40094438F7962 BWe?j
593,891,355 *3D0CED3CF00478E85966C912D366D58942958601 BWEL3
593,891,356 *3D05478BAFFBC41ABACA0C25C313DFCD64D8B95A BWeme
593,891,357 *3D0EE9FABD29A440C617633E50CD1422DAC2B87F BwE;R
593,891,358 *3D0AE647A21B2ADD3852CBD65413068A2A32FF9D B-wew
593,891,359 *3D0A22E80444FB117D5EE3ED0EA686B5D0FA06B7 B+/WF
593,891,360 *3D0078869B61DF75DD6E26D755A6D06514023A34 BwF&)
593,891,361 *3D0BC80E683992F75D1B3B867FB45B353DB9CA15 B"wf+
593,891,362 *3D0107400C323CC5130D13B6457DEB5A8B179BF1 BW/f1
593,891,363 *3D03B06FA8E72239C0DE351B57AA9D75480A8831 BW;FD
593,891,364 *3D0E03352603653314A23DD8EA1AD3CC9D852E2E BW/FN
593,891,365 *3D069B6D7DB39A37B23EC21216B606F79534BBF5 BwFqK
593,891,366 *3D044EF3F8092B30BCD7F4CFC258FE20A3BEEDE1 Bwfr;
593,891,367 *3D0203C8315E18CA35DCFFBB9EBE7772AE0E346A B.WG.
593,891,368 *3D06115A459C2CF29932E5E79672512E6DF72CE1 Bwg0N
593,891,369 *3D07B5775927DC2D615711DEA1E01645F0CF89F8 BW)G1
593,891,370 *3D0FDF5B863E6FB9E5D4A1EF372A27ACCC12512B BW%g8
593,891,371 *3D0D1D1652BE385648939ABB9B7E4B04A80ACFBA BwGhj
593,891,372 *3D076F60B6AC3200BF90CAE9A2E89E53308CA616 BwG:M
593,891,373 *3D0726139531D6D317E212D215ED5FABAE301B8E BwGPe
593,891,374 *3D0D83BDC595D0CA35A0CE7D2CDD911F598713C4 Bwg#Q
593,891,375 *3D0B3AD32D1829E6A250BB2FD1933E0B590D2115 BWgTB
593,891,376 *3D02B55DCE7ED0D17EB47C59BB9E907174F9C2D7 BwGy
593,891,377 *3D0F2FE3DC8C9E930CDCE446D7874DB8492E8914 B$WH;
593,891,378 *3D0A7ACDBAD08E56FF8A5277B7211D0B35E2F1BE BW:H=
593,891,379 *3D0EA08A497E741FAA3183428760DD8AC72539DB BW#H:
593,891,380 *3D0C138767319AF7F2FCD44B16ACD938A0377726 B!wH)
593,891,381 *3D0C1C96FC4E871E87ACB8D91B1D278C262438DE B;WHC
593,891,382 *3D058D6BBCE1F453C7EF80925B00B529601EB4A0 B=Whh
593,891,383 *3D05906F621DDC273B42EAA0559A07D422B90E5D BwHHs
593,891,384 *3D09165BFD521E9B8979DD0DAFF9D5CE7379B3B5 BWH
593,891,385 *3D0C028552DEFF552B9424BAF2CF7F3C58A94085 BwhKu
593,891,386 *3D01028DC33B9F10C280270FF751C2E301A8BA9E Bwhoc
593,891,387 *3D09752F7AAEC65CCABE80F56E42D118E8727CCF BWhZ%
593,891,388 *3D0A33C41DE9010995D8AD490B5AF9116F551DBC B-WI"
593,891,389 *3D00D71E082BBAA5C7B9377EED0D3F78CE7274D7 BW&%i
593,891,390 *3D0D915499288E88697689A043163ADAED1F8A86 B(wI(
593,891,391 *3D0CAD0905715DF779062FAD2F70F03823DCFE9D Bwi7U
593,891,392 *3D0FAC312E950631EB8D2634437DA3258106829E BwI80
593,891,393 *3D0942318FC99E62E3999618B90C4E46471A8090 BWiHG
593,891,394 *3D02000F2B4DB3C7BEFF620CBC57324F1E61DDAF BwI"L
593,891,395 *3D0D98605FC139764B320F4D3AFCA9B3851B7DFE Bwillow7
593,891,396 *3D0A340BFE82F4AF5A317B9703A054D774085A73 B.wiP
593,891,397 *3D0D2BC5A1015336068F83EE9A0F5C914031E020 Bwipc
593,891,398 *3D015C4543534260DE99E6C49FB73D7B8F2E6534 BwIr+
593,891,399 *3D0C1C665B0D82998B98229728A4812939220F6B BWirj
593,891,400 *3D0C74B3FE02091B996FA29EA544B9F64BAC18C2 bwisdombuddhadorjeshugden
593,891,401 *3D02D4E20A77E44BA394953DBBA659DDFC7534F3 BWIUv
593,891,402 *3D0253DB2DE7EBCF6BA1A719E64F47E38EF97C60 Bwiw5
593,891,403 *3D0831EE232B7EB062CAB5B6576CA078D054BC38 B?W;j
593,891,404 *3D04EFF6AE0976D81F9D59CA1FC713B2A37B27D8 BWjBY
593,891,405 *3D05F797A062094AC438BE7842ABA2E448AFC4E2 BWj-C
593,891,406 *3D0DAB4EBC3D966303DBDFE3735B049B76E6DE3C B%wjM
593,891,407 *3D056896E8B9E47AB0B85200F4E70B9293C39410 BWjP-
593,891,408 *3D01444A432233FC6A48A177FA5B6BE14F3D2930 Bwj/U
593,891,409 *3D052C4FFB6ED5D0A453DF8FAF4736DC66E58E6C BW/.k
593,891,410 *3D0C20D794A2A1E104E65444D71A805C72E47CC7 BW"_k
593,891,411 *3D0643D4C7104AFCFD56092BFB3800D651E6A503 BW"k;
593,891,412 *3D022AB6866E50C2E24AA5DCB41F4A4DFE670CC4 B#!wK
593,891,413 *3D03E1BC6776F2ED34A49417291071F72FCD7F57 BWk)B
593,891,414 *3D04B4659295954CC192A33CEFFF99338173CCB6 BWkel
593,891,415 *3D0AEE18053746782A8562B814ABF1A92C707AB7 BWKfq
593,891,416 *3D0C4A1B6AE7C428F6FDF76625ACE96398170F2C BW)kI
593,891,417 *3D05F0F3A617547F7AE7E924EA2ED08BE52F4BB0 BWKkZ
593,891,418 *3D03E4C83FA7CEEAEE52327D27D74A5D521B47AB BWKl$
593,891,419 *3D0ED9C706F04F037F10852966D1B9DC7203D7B8 bwklano
593,891,420 *3D005EC7F4F4662E5E716227D61CE477FEA2D9F3 BwKmG
593,891,421 *3D08A4AE7D7DFF1CD3755F25CE46A9B75AD5D0D3 BwkN;
593,891,422 *3D0D73B3782A665A181E08FCB0D5804605A8D20E BWkS)
593,891,423 *3D01AE7520792906FB79EFAC5FF519CB32F3E251 BW#kZ
593,891,424 *3D0D1C7A90FDB34B76454C69652DF77BF461F9E0 Bwk!Z
593,891,425 *3D00FEBE3F1D291E8EB0A0282071D44E4C713648 BW.l;
593,891,426 *3D01797CBF955A5994848074E17CB54C62C942F0 BWljY
593,891,427 *3D035B421715558E5C0065D9883A2987A3476FCB BwlMR
593,891,428 *3D08DF7005270BE9E7800A28CEAAE8DAD7F24315 BWlt
593,891,429 *3D02CF0DC0AEB0112E22DA05CE4CF3AA742278A0 Bw&:m
593,891,430 *3D01A816297E42346EBFE0CCB763B14265D7471D BWm2
593,891,431 *3D021C5A750EF4DFD11C6C88E46B1ECACF532100 Bw;M6
593,891,432 *3D03B7B862CACB1A220116E00C662DE8FD003AF1 bwm61f5
593,891,433 *3D0C60B2345E26CA11DD01E7686F2524F48BAD5F BWm64
593,891,434 *3D0E82CFEACDB6EE854E9F89D97BA0C3FAE8176C BWmaW
593,891,435 *3D0A70470EBE31F7EDB72024E72D0AF77D1A0F95 BwMF+
593,891,436 *3D04B85C781E82C4A9C6B4D29EA6D9EB046A857C BwmF/
593,891,437 *3D0D00B55CCBB0CE9B44CD3CEA23353F66CB08B2 BwmlH
593,891,438 *3D09B173BB1B7D5F4DC22807AEFBCCFA85C1977D BwmVk
593,891,439 *3D09DCF35CAFDB76DEC5A1D8BE74BA9A7480B5D6 Bwmwn
593,891,440 *3D0554E2376E97AFBEFBCEE21BCCC52E64F8CF56 B$"Wn
593,891,441 *3D00109DD545DCB9702BBD5FAFB31FCD1F78DE7D Bwn0I
593,891,442 *3D0D99D503E7C1A6354678A7CA3637C1603E258D BWN1b
593,891,443 *3D0F060765556323DEEED47F603983FF30B4F2A2 B(wNa
593,891,444 *3D0BF7780421C09595CD4492A50E4A84E574309B BWN:d
593,891,445 *3D0622A8C50EEC7868670D6D3B4691AB9D22DC31 Bw(nD
593,891,446 *3D01FB7FB8CCDE3714FB920B45C1DD744A381708 Bwnetbsw5
593,891,447 *3D0FA69A7557E3FB9E5F59F27D8B5021A12CFA7B Bwnm1
593,891,448 *3D04DF0616E616CDE7A810CD9A2855A64733006E BWnSH
593,891,449 *3D0B26E40E75489D9BBF6FEE537D2B8B0D8DCC65 BWNXh
593,891,450 *3D0E030FCB19A5EEFC842ADF96B0B02670EEC11B bwny@headwaters.com
593,891,451 *3D0FA8003661BF66046F57C6FAADAE5B37C094CE BWO:!
593,891,452 *3D0B22DBDACBFCE3160182EC46F66A916811C961 BWo8f
593,891,453 *3D06DEBB7ADCDB4E19BED4960FE440A62A552A8E BW?oD
593,891,454 *3D01DCA08763B4542D81AF0DC556CE5230D1CC4C Bwoeq
593,891,455 *3D037A53FB7C9C2386F24CC9A9FB3DC16F5272F9 Bwollahsed
593,891,456 *3D0B53D79449D8A5210E89D80B48F30EE73B43CB BwOOG
593,891,457 *3D0DC7FE145E70030C5310E46853A6E618B4DD65 BwOOg
593,891,458 *3D05876D1D923CBDFFD12B05B567091A422B29D4 BwoPs
593,891,459 *3D04E60FC7795F4DE830F6EB81CFF14EF5D43D9E B
593,891,460 *3D000D2DE4B9FEC0F72808205726A8A72B3FBF7A BWO/s
593,891,461 *3D04874F2CB13F318762006BD4B478B78E228157 Bw!oS
593,891,462 *3D0BF4F778EB53C9B678A050CF4AEE0F7B11D288 bwowd@yeah.net
593,891,463 *3D039CD1EF81D26B1A28BACE2623065B4D2D3F0E B=wOZ
593,891,464 *3D0E96403AE540B950F93D5D9AE5D04EB657EE15 Bw
593,891,465 *3D0DB9018D588DBBC6B8E0496411A9B14ACD735C BwP8
593,891,466 *3D002DE0B695CD0991D7FBA5E053CB924EB68EC7 BwPA?
593,891,467 *3D0F6079DC432BFBEFDC8AB0EC5F913EFBD104D0 BWpb.
593,891,468 *3D0F7D9D2657822BBBE8D0E46B3B10DC1E06F994 BWPf,
593,891,469 *3D0BEA1F97620E88217ED9C9A3C79933CC44EB15 BWPħ
593,891,470 *3D03758F8421CCBEFF29C96C0662BB6E8150AAE9 BWP,I
593,891,471 *3D08D9B16B4929442590CAF5ADC1A10FC7913C5B BWPjd
593,891,472 *3D039BF1CAC4F8C964295CF988823AED3E50484E BWpQk
593,891,473 *3D0916EE7C2CC1E1854137C15034E14C57CE7CAB Bwpr=
593,891,474 *3D051890F80D46A971139840C1278BBEF3CFD019 BWP=V
593,891,475 *3D04179D46AA89BB22DF09048F3A49A73CC8AE37 BWpVh
593,891,476 *3D00B30B645AFEA3F33FF1CECAD4753A8A2941FA BwQ+!
593,891,477 *3D01CEBD764CEB699FCE69898BF1862F8CF90662 Bw)q
593,891,478 *3D0717935E82877CAB648C006A0999D7A893F794 Bwq9V
593,891,479 *3D009B4913715EB25D225AF3330864008BA09B8A BWq.A
593,891,480 *3D0B61C7B64EADD5CB579E37843EBAF2B1705140 BwQEQ
593,891,481 *3D034F22CB2FA5BD652AFBD863B25536B01358C8 BWqKl
593,891,482 *3D0EAB6C6F12DC4B66FDC6019DDB5FABB8A545E3 BWQPn
593,891,483 *3D0B2C5E98EF64929D6AAECD2832917BE0071108 BW(qU
593,891,484 *3D04687FADAD9DD59192702FE5E491A8D8A2FEE4 bwquq@yeah.net
593,891,485 *3D0A5659701EE57DAAD5E83303612640068C606C BWq
593,891,486 *3D0C7E9AD3EFEF63FDC97F3D78B007DB03A5AB14 Bw"RC
593,891,487 *3D0F313180A9BC2431243138E101C972D7325232 BwRF6
593,891,488 *3D00098EFA6E90D131A2C506F0D180601C9553CD BwRps
593,891,489 *3D03F029FDD8B8286DFA28247635C2476AA2179E BWr)v
593,891,490 *3D021B01723C574DBF4628B48FB86B0F4604DB6E B=ws6
593,891,491 *3D0069691F4DB80A5158D6ADAE388148C597D687 BwSBD
593,891,492 *3D02BCC54BEF4364089AFD5955F5F4F29DCBCE50 B;wSd
593,891,493 *3D09A34DEFE551C5BA2A505085D48B004540BC0C BWSeW
593,891,494 *3D0714D2ADC962A79CCD775BDB9A722C1B538FAD BWs-H
593,891,495 *3D0DB318FC4129B6F940448B3CB0D22366963789 BW+sI
593,891,496 *3D0A477E5B3DBD91A0BB1DE89F0A95F8F2F70DD7 BWs?n
593,891,497 *3D0E3A4AD84CB0E713AB6A3CA79DA3ED423F539A BwSo)
593,891,498 *3D0C315981F076A13FB54F1CA19AD13639C1259F BwSPI
593,891,499 *3D00B40C58C41F46289B1113A2AC0E2C6B24B5E5 BW:Ss
593,891,500 *3D092D912BEB564639691A2FD822E5BFF249B881 Bwsv$
593,891,501 *3D0B4F81EBDC8007F446EA4F3E2DED02D35722E6 B/W"T
593,891,502 *3D0FFE2B636341C474B345DE8A2E00006968BDD7 BWT+:
593,891,503 *3D0E41CEF0FE55F2EE87A1A43510E7F385B67DBE BWt";
593,891,504 *3D0BDA38AEF0AE34E1F496CB7780A6B264EDF4B2 BWT2&
593,891,505 *3D0630FB8E109C3C2FDF77B776DC297D1A1EC1C5 B.wt4
593,891,506 *3D09E07B2009CCCE25976C3A436E7C1D5A73BB55 BW
593,891,507 *3D0E6A60A77E7296F5FCB13979601F6B2FFA02E4 BWTARHAGXPUC
593,891,508 *3D05A0C70F9FC1B7C7ABB3F006E5B883157E0C3A BwTb4
593,891,509 *3D0210ABA8DBB5A475402158092B596583BF92ED BwTc?
593,891,510 *3D089C6655D5C3DCC846D40C7F61DF769532CCEC BWTgr
593,891,511 *3D0CAE7BA9CD6C3B0D454E673FBEFBBBC6137E94 BWTN2
593,891,512 *3D0D604839D43DACD8B4BAE1A03CDDFAFCD2EADC BW#Tu
593,891,513 *3D0AD15EB77D2519FECBC2D80F9E2CF464E35F54 B.=Wu
593,891,514 *3D0AA3442DCD3493E4526C1BB34003A3F070E89B B,w=u
593,891,515 *3D01DB631A20AAF003271DF39F5D9CA191F067CA B)w.u
593,891,516 *3D0A17951715251BCD7BC26876B283C6E19691FD Bw($u
593,891,517 *3D06AEA1E7F3D6AFDCF594B2FB2CBF40D0D09488 BwULW
593,891,518 *3D0C19D1DEB7561310D7DD6EC8318F3C4477D1B2 BwuVZ
593,891,519 *3D0DC7FF02A2331976012D6CE87BB30C94461A0F B)W#V
593,891,520 *3D073A00585079C535B4629B1693B5C84B8C1995 BWV:0
593,891,521 *3D083B748BFF0C660B833DC6B9B137DFA9B3EA40 B;wV1
593,891,522 *3D04DCFF4CFF5BCA91487A4C5CE78731B7E59B1D bwv577-gminor
593,891,523 *3D06811EC8DC5CF8B0EC4776CBBD56DFFE5CF6AD BwV=6
593,891,524 *3D011507732F92F38C35650A034473150FF6BA6D bwv 831 -- 2: courante
593,891,525 *3D0389D6607ACA29BF4574F15899DFE25ABA4396 BwV#c
593,891,526 *3D028BBC1EFC67EA269E3B9897B8CA31194209A1 B.wvN
593,891,527 *3D0091F22BB347195BA553CA715078AE27CF641B BWvpN
593,891,528 *3D0FE4298081D179EE89FBAEC620E80707853766 BWv/T
593,891,529 *3D0F8D13290D29F47309C4C55CFAAA355BE12384 BWvtM
593,891,530 *3D054F9CA640B54A313267CF6C83A9BF62461D58 BWvTX
593,891,531 *3D0E3223CF5FE7AF04B9D49E77174B2893739265 bwvtx@yeah.net
593,891,532 *3D04D837A28D801D88F109169DF0FB7451AC2F95 BW.(W
593,891,533 *3D0E7C6AA5B96A05E34A444CEC7DCBD873BBE882 BWwA:
593,891,534 *3D0F4D34726F51A4D2F4784C89EF5881BC3B6EA5 BWWd6
593,891,535 *3D0CBC5E9B9B13E1572F3A503D131A02DAF5FA63 Bwwde
593,891,536 *3D04C80C69F8FFDC3683DC99B0CDB09177D0A06E BWWml
593,891,537 *3D05C4807B0E81C1B9A0A3B7D4F3C3C4F04C9376 BWWnY
593,891,538 *3D0D21DA797B9011773BD3A97170F4D77FA42FAF BWWP,
593,891,539 *3D09A1E414238EEF19A21F7B53768D14096A2351 BwwsH
593,891,540 *3D0DBA8CBE358792B2AD7FFEC7BEDC428A8136B5 B$wWX
593,891,541 *3D04A274AB62ADA6F8B84EA6145B016999E5C6FB BWWXq
593,891,542 *3D08B8A0C1FB78DE45F5BDA45495A791ED932512 BwX"?
593,891,543 *3D0CB616FEEBF53597EE3005130987538B46421D BwX$+
593,891,544 *3D08CCDDE6D57ECEAE2D39FB96F6DB72AE2D3D3C BWX6g
593,891,545 *3D02DB43B2A7038B31BC914427D2E58DE8B7125C BWXDm
593,891,546 *3D0B01BA3C06590C99116EC0481ED5A8E5FC531A BWX-T
593,891,547 *3D0FBF0D4FF3D9C5934F53F78B161D28F7287318 BWXT1
593,891,548 *3D00F68DB3C9F8EA81A1EFFC1373FFD39E4B6484 bwxy@hutchcity.com
593,891,549 *3D0EB99AD2E9F389F1649EB931FD05ABA1E80DFD B!wY/
593,891,550 *3D086760F5B744F6D5A0921E556B9341C010DE4B B%w,Y
593,891,551 *3D01536F27E6987CE94C4B685DEC56CE52F260ED BWY:3
593,891,552 *3D00BDE547EE8D8CF1AA793211260055DB66539E BWY3X
593,891,553 *3D01EDB6A92B4FD8BE9DCF81B3F78F98A65E9382 B&wYg
593,891,554 *3D019C21A87C1E8160B81D4C9EE2694043C770E9 BW;Yj
593,891,555 *3D06BC3A2D57D18847D10904F55A1B275E03621B BW&Yr
593,891,556 *3D0530FC776E0A424EEB04EDFBB7F5B3DFCED53A BWYTA
593,891,557 *3D0FFF6D0EB839629D735C0A77EDF87C7F33AF9A B$W!Z
593,891,558 *3D064246A9F8C772AB005FCB6DC01FFCBE0E8274 Bw,Z?
593,891,559 *3D0C892B1A803BFCA87FCEDE7629B0A7D896CCB1 BwZ,"
593,891,560 *3D08FFB98C63D8D0DF4B8B8F8D9D1D8636585141 BW&Z9
593,891,561 *3D0D1AA5ABC6965570649FE027839E26B2EF403A BwZ,b
593,891,562 *3D0709493B01053E546E3D174A327B58C77A81FE BwZcI
593,891,563 *3D07BD43FC7E6BA595AD9DE189BCA7E322DA1EC5 BWZFP
593,891,564 *3D035F9F02F2E9973856DA6790DF28D794BE33A8 BwZOY
593,891,565 *3D0625776873A00D1CFC5948BEAF99D178340D37 BWZS$
593,891,566 *3D011929824301B7AC72FF2788FFD797B4DCFE56 B.:X&
593,891,567 *3D094B72773E67D8670CE258A5FAFDFD415BFDB5 B":"X
593,891,568 *3D08310D71AA7BD003E5AEE1AD2C5EA514719DF4 B#X:+
593,891,569 *3D089BBB688AD613D75C3B8959F8FC5FC9BCCA4A B#X!(
593,891,570 *3D04680DF566D0D3A637FF2D3DCA23E802F478C0 B#X()
593,891,571 *3D03E8231D9D5F3FD2B0757DC493C2BE1149A7E5 B#X&!
593,891,572 *3D089D2BBD3EFA71BAC81A73C6934C9BBA711244 B
593,891,573 *3D0961961F55A2805776F911C4DFFD1FE0520FD0 BX;/;
593,891,574 *3D03F79423B8C448A80196945E89D41476054544 b_.x
593,891,575 *3D07DE75F318083A59B1B65693D49BF0F4813E37 bʌx
593,891,576 *3D06CAF5A3B1EA2288A3AAD9159E30BC58C876EB BX0?"
593,891,577 *3D074F484447C8FC5A37FD0D000926FE95A1F848 BX0GI
593,891,578 *3D01F9083028E18207EDBABE76E94EBCF6D68252 BX16481
593,891,579 *3D029B6947D6259383064BA3E87407A7DE14EBA8 BX#1C
593,891,580 *3D06932DFB7685F930B08B89A6641319DCCAEBF4 B?X1N
593,891,581 *3D00ABC1CB24C8C6C1B27227420250063837E25F B-X2
593,891,582 *3D0D9330AD49584DB1A447C5FF85D487DD80290C BX2c0
593,891,583 *3D09E95D77151B7432E99AD6A72032DE6563D6CD B,X3?
593,891,584 *3D0912483D615165F526C1008DCC25464244E863 BX3,$
593,891,585 *3D028759E33EF330851156FC0C926C06141BFBFD BX35)
593,891,586 *3D0F537663E58D189D158B30051A57FC5DA882A6 BX3:d
593,891,587 *3D026A8E2BFE72F3A5B9E713971CBCE2009975C9 B#X3L
593,891,588 *3D0CAC30088E566DF904CE2CB573A3A0A5DEEACA BX$3n
593,891,589 *3D0F3984A80342D556153B1EA1F76D472682FA41 BX3ZP
593,891,590 *3D038FE2206D4FF1F704EE9B11C68C9A49A3B733 BX4Ba
593,891,591 *3D0B225DFBC921A833A967D66669992787F9167D Bx4c
593,891,592 *3D04D513849656793B28639505EB8504E2FCDE7C BX#4e
593,891,593 *3D0F6F3A3DA254ABB7C93DA502D04ABB7B9CC3CB BX5fv
593,891,594 *3D0A60F5C1A0AFFF3F10695263ABADBE0DB5BC2E BX5G_
593,891,595 *3D0DA7C423BCA46A24E975D22E5C6AACED3474FE BX6=#
593,891,596 *3D040A2CD9E29AE6516FCA2B70936BAAB663A026 BX6fD
593,891,597 *3D085A3316CA06890A491A9895A725C1B94E5A8A BX6TU
593,891,598 *3D004E75D7935EBC7581498357EA62D052149D1D BX7F,
593,891,599 *3D0BBABBBC827BE53D1C15EBC2A8EFF664E8515A BX8rK
593,891,600 *3D0967B09C4A074491F37604CE671AA408E17A13 BXa1S
593,891,601 *3D0AA13751B3C37E2F1FAF25CE46CB88A8A0D9F7 BXabB
593,891,602 *3D02B33694C5EB45566827B48ACB7880062CCCC4 BXaBP
593,891,603 *3D04A18FBDBB01F834A4A606BFD0D642A23312AF BX%ai
593,891,604 *3D0415E280DF3082314C659A973767AFA68BBA57 BXan(
593,891,605 *3D0A451E0BB5724792DFBD581281920D79F25DDC bxapt@yeah.net
593,891,606 *3D0304EDB1C821837FD2B1F8224DD4967A94B3D4 Bxavkmr5
593,891,607 *3D0810ACFF95F6E03354B2A31376F10B8A54B464 BX.Bg
593,891,608 *3D056105843323D0FEB8E59EFCE4651703292347 bxbgS
593,891,609 *3D0FADE631D62F4BE94D33BF9EBB1F6112BE0CBA BX(BL
593,891,610 *3D0B30522F9C1B27E0E3FFA7744B64AFFEB45A64 BX
593,891,611 *3D0C03EFAAFE378E40C2DBABBB7C111923B7B224 bxbvwjes
593,891,612 *3D07C3AEF1C8749343FE85302BA5014E6AA9E1B5 BXC;&
593,891,613 *3D0B27527C8F92EBE3BD88038889FC494D7DA049 BXC.
593,891,614 *3D0AF0DCE7BABFF35B133A4CDD7DB01463360DEC B.Xc"
593,891,615 *3D0389A0F752407878FD3CC37EA888A47D43F8B0 BXC8p
593,891,616 *3D0B873DA8C84364A63FC6BDB0D739FBB0C83767 BXcDW
593,891,617 *3D05F81B36A082F0C949B7C06F7DAC49AECF2903 B&Xcj
593,891,618 *3D01CF81F05CCD9A31D0DE1B22E6DFD15737CD0B B=Xcm
593,891,619 *3D0FB60FFC3F402CF5E775549450FBF6CF00B25C BX,Cu
593,891,620 *3D0BE45C09D537CEFB71A51C4771353F7B4D8506 BXc/v
593,891,621 *3D02B62B6296CADCD68A3DCC365BE5537A397523 BX,D+
593,891,622 *3D09DB5A7F68DD16B236C57E75080262594DBBEE B/XDm
593,891,623 *3D04473DCB590513C9185C68E7B7129541F0C6F3 BXDqo
593,891,624 *3D0480E431BFE497A9437111D605D3BAECC6F6B4 BX"dS
593,891,625 *3D058B26060C18768D3F6887D3ADF9696880A2C1 bxdso
593,891,626 *3D095512D138C8C3D6789F34765FDFD9D5DC6B87 BXE+/
593,891,627 *3D05650B69C59C7F30AE9CAF662DADF01A16A036 BXE5G
593,891,628 *3D0B365B71760CA94DB3C96739F494B5124A34C3 B&Xec
593,891,629 *3D0DD729D75334E61001703D72664879335755C6 BXeV$
593,891,630 *3D01A8A40C6E91D928A949AE3B3D19B055EB8A9E BXF=,
593,891,631 *3D09D3095BDC523F1BA20F575874EE87F5B0D3B9 BXF;8
593,891,632 *3D083E7D4EA36DD157E2C1E07B0BA671F52C90CD BXfC-
593,891,633 *3D00A07F11D098527C913455C78783E91400BFD1 BXfKt
593,891,634 *3D0AF1259DEBC9D5C26783AF574D7E571EDC7169 B%XfM
593,891,635 *3D048159AD655CDDA312A5B7F9B5949A2BD4591F bxfmw@yeah.net
593,891,636 *3D03243E6731C9B435B570CA20DD2CD2B9E914DC B=Xgf
593,891,637 *3D010D832DD0394E41DB5BB562DDDD5B939EB137 BXgFk
593,891,638 *3D0C83F7F940D1DBAF0F61E88F4C9617A6C354D3 BX=GV
593,891,639 *3D0BE2F9E0B01FF608A4EA5256BAB10E04588628 BXGZ+
593,891,640 *3D0448E57FF6F68D67DF9DBA824A524980F67BB3 B
593,891,641 *3D0058EFDF9F7AD6477064C5D27052D8C8D96952 BXHk;
593,891,642 *3D0AF243846347E37B55A7FB48C8E8F597A15182 BXhqn
593,891,643 *3D03EA86561A77981D07046A91635479F07E692A BXhU#
593,891,644 *3D05C5DB2D390FDEF77626B7DB702BB1D4C8903B B!X_i
593,891,645 *3D0D5B2AB51CE60F644D0627C23DA0761742B6B6 BXi77
593,891,646 *3D08A90A63AA48FA77317C6494ACA1D16329A9FE BXIdW
593,891,647 *3D0C920594380595041030681B2C4A9C83DEA7C3 BXi.k
593,891,648 *3D0E95B391858260581A67D0186D19BF6A1A25FF BXINK
593,891,649 *3D00F3069353B87F5ADFB2EF6D41F39DEEF6A99D BXIO!
593,891,650 *3D00D46F0773F6CA357FC334115463F197DF7AC1 BXItg
593,891,651 *3D0BC665C5D5B2E016F7BB159BC22F05605134D2 BXj";
593,891,652 *3D0E7C5B77DA2260114543DE1F8DF6E88966C81A BxJ-
593,891,653 *3D0CA676391410248A30F9DA7861C6F4D76FD1B7 B
593,891,654 *3D0A296CD65913F9D7FE9158FFFC8D84128A9A87 B#X;K
593,891,655 *3D0CE45ECDABC2A07A8FA655C6E1A530C8AF4D54 B!Xk
593,891,656 *3D082287CCC3322CAB3AA7A48648E38831E91153 BXk(!
593,891,657 *3D07492991C2D0312A7F4F6663F5104DA40EC7EE B.XKN
593,891,658 *3D0C798768EFC93BC014774895100033BB56A743 BXKw+
593,891,659 *3D0E22FAD7C2C39F4FDD60987943D665DD789D16 BXK"Z
593,891,660 *3D047DF00AEF394D33FC002ECCD30AAAF0F03EED BXL+f
593,891,661 *3D0E05CC356DB27502BAA92B33FCD64DB8735886 BXLgD
593,891,662 *3D06C653F1B46133F6713584B7F77FE01D6FE9F0 BXliw
593,891,663 *3D017E0E68228AAA4D50B0E80C076E4D9C3A791B BX_lq
593,891,664 *3D0FE18008F01C69834AF3962C254B029D45AA66 BXLrK
593,891,665 *3D06D98FF4476AD0BCFFF5162BD43B69FE4AA037 BXlS/
593,891,666 *3D084EFA5EECAF1A2CB73D937609E307AEB85BE6 BXlY-
593,891,667 *3D04586CA695DBC9ADD9B4F1AAAC80EF4C627957 B:Xm-
593,891,668 *3D02EDE5072D197F6ECCA43D0A7E0846200242B8 BXm%6
593,891,669 *3D0FD6594F731531C4C80668CBE067441501AE88 BXm!F
593,891,670 *3D050B94C38D3487533BFA720763C47C848D660B BX%MO
593,891,671 *3D0F11BE120A52F9810260774AB7A3CE1839A4A7 B)Xmp
593,891,672 *3D0F0C42E08EBE8A701892E0DE54A4A1551F24FE BX!mv
593,891,673 *3D0BAE2AF962950A185451297BE217AB7E6426E6 B./XN
593,891,674 *3D09699BC3D4BBF4B282EB2352C7EB6808B0008B BX?nc
593,891,675 *3D03FA99E81ED657388189211447E696FE2C26AC BXn#Q
593,891,676 *3D059E130AE3188DA782C3868D347F83FFE88789 B$XNS
593,891,677 *3D0C8A0CC373AAC5961C74870DD740103C777935 BXnZF
593,891,678 *3D03F5F8875586BA92B753130317F7CBF92B4EDD BXNZN
593,891,679 *3D05C78382E26A568439C332E6DFF68625CBCD37 BXO##
593,891,680 *3D0C2129D4C2797CB4D45FED8425400F73AF171D B%X/o
593,891,681 *3D064850D1735FA6F882DF9360266507D7548E2F B%X$o
593,891,682 *3D0040E38E04F76D5D9DAC51E77C0AB611058831 BXoC%
593,891,683 *3D032D5FFD67D60D7216BC0DD850C752EB89924F BXOpl
593,891,684 *3D0D9FB43E74C1901E2AC428704063D7B133D5BA B%Xor
593,891,685 *3D02BE5307E05B7234AC48B07B103D4295334664 BX_!P
593,891,686 *3D0DFC5E026539AF2A0922DF93A625607407F8CA B_Xpa
593,891,687 *3D01DC54081B05D91C302A68C4B99D561E4B3522 BXpk_
593,891,688 *3D0FA8FC12EB845FEB2526AFBA552AE294253EB3 BXPW/
593,891,689 *3D0052DF530D73A85A0CB9984AA5BBEA8E6DE99F BX_Q-
593,891,690 *3D0194EBAD8EE04D3CBA7F1996745C9B17ACB70C BXQh4
593,891,691 *3D05A2AEE61365BB031CE0D2842FB730FA1227AE BXQiX
593,891,692 *3D07A063357EC58A398575B398999AFA4002765A BXQN+
593,891,693 *3D08CD1D080B782E1A8143AE179F8D9421BCED87 bxqwu
593,891,694 *3D011846EF26FD54E06C925A0E0D020E1B7F4578 BXr(/
593,891,695 *3D0FD4DCD84E1186466F61E74A26FCBF27DBCA4E B-Xrw
593,891,696 *3D0EA0A7897CD924E32ED154C40C05440CE34856 BXrWG
593,891,697 *3D0AC12AAF97637ED5B3767410A9730D2C739A05 B-XS&
593,891,698 *3D0F16E7D1E6EBFA6F72A054A0F58ED13D84E6E3 BX&.S
593,891,699 *3D0BAAE49BC4C33AE02F297FB443E51359FBA903 BXs5O
593,891,700 *3D0AA0D5446D94A78B5EEB46D345E9D14F3D748C Bxsa
593,891,701 *3D0F8BF5C57131A942E2E0C9D09A631A15B6E775 BXSKI
593,891,702 *3D062BA7C2FFDE14610494FEE53380B1A7394C67 BXSv.
593,891,703 *3D039DFB982AC3F3068ED92A61475DD2DDAC54EA B/,XT
593,891,704 *3D0103A3FEFDF2F522D3D26556A79DFADF79F4E2 bxta@kimo.com.tw
593,891,705 *3D0B31F7D1871F4C2C0A5E1821557ABCD6761EFC BXtoC
593,891,706 *3D0CCAD1E9B39319D027F911E83916E405E78143 BX(U/
593,891,707 *3D0F4950921EA91BAF366F66B7B594D3E0601719 BXuCN
593,891,708 *3D0594FAE0D7775B4AB5A8DE8932147687BC64C6 BXUdQ
593,891,709 *3D0E9ADC510842099A3185B949CA2E1948E50A18 BX)?v
593,891,710 *3D098745B214FC81971E161BDB933C2FCE0647C4 bxv579
593,891,711 *3D0C766A392DD6B35B1FFF59C9CB6AB2BC47E12C BX,Vb
593,891,712 *3D03BB6884BB96F2F662B9F3FC056AE47E31B107 BXvb7
593,891,713 *3D08331F5ECA47182E0FAC65754B3509B8C30E99 BXVc5
593,891,714 *3D0D144C1045F1F5E8898EDFA96EE02F54799A14 B=XVj
593,891,715 *3D08941C7E98AE6E5D6528C4132BB7896152E9C7 BXVmP
593,891,716 *3D093A7C11B4655D662A8CF9921DB196CF16BCC4 BXvpn
593,891,717 *3D006AC40E32EDDDCB17DA1C846BE9BACB9A1E3D BXVu
593,891,718 *3D0D4E267EBC2D3C2D0AB75C30FA280173D23496 B!-XW
593,891,719 *3D05356F4C39CEF5323EAD442EBAC7E5C02C2E21 BXw7p
593,891,720 *3D0958FFF9CD8A1D703E766A87AE92AEF7A49E4E BX!W9
593,891,721 *3D01DFF4513EF16859CC1006E7352B130BA84BF6 BXwut
593,891,722 *3D0DDC9BAD33ED8D7C441FD3305BC590E8419AC4 BXX5G
593,891,723 *3D0E1A969ED8180B23E1D52F2FE2BE3D059AF570 BXXBG
593,891,724 *3D00F7E55D13C0A86655A3BA1AF943279180215B BX;Xp
593,891,725 *3D0E800904D316910EF4036A05A02FE221632A16 BXXVj
593,891,726 *3D0ABF9EC3300F93733FF7F374B309A0A85CEBF8 BX$Y5
593,891,727 *3D0F1CE078347F692482C92B0EC20BD110D06C68 B!XYU
593,891,728 *3D04206D946D1E0A27E9857E72CC96491EF5E123 BX%Z7
593,891,729 *3D08F07828CCF88655287BB59859C9514186DD84 BX
593,891,730 *3D04EAB483CF8AC8D829C3371DDCEBF6BEEF464F BXZo2
593,891,731 *3D01AAD92CFC1B93B54D966EDC430EFBFB9BE227 B)
593,891,732 *3D07AD222DAA7F150139C84C8370449AF9EAC560 B&?Y;
593,891,733 *3D04364E59AC0EAC9CDEA8589DFFD3CFBAC148E2 BY0)W
593,891,734 *3D0B17B38C8E849252D99FE7CC94D29FCFE69F7B B//Y1
593,891,735 *3D054D4FDCFA1FA87BE7FD8858F008B8402028F9 B+y1
593,891,736 *3D0DF36C29A9DD64F34CAB8C11142FCB055ECB3B by160sources
593,891,737 *3D083ACEC2EC61416E32192F8C208E36A5719A58 BY1(B
593,891,738 *3D03FD63BD85E5118420D540DE868A568192CB71 by1ng3
593,891,739 *3D0822832BDFD04F1BC9ABA30A13541C793A88BD BY1S?
593,891,740 *3D04B46CA7C060AB2492B34B9067E320754C4246 B,-Y2
593,891,741 *3D0421F68C27FF69796C7297DA6389BB437A5392 BY23+
593,891,742 *3D0CA23D327B12A01FC79EA1A1EF3E59E6A40AF5 BY2j0
593,891,743 *3D04387B5083CF0053352AEEBD94F125E2CEB2AA BY3.#
593,891,744 *3D0DF98A22D55B7BF527C1B80C6C73E34E2755A2 BY$3c
593,891,745 *3D07A30D5BA5C18BE526A5DFB7688BB0F8452081 BY,3W
593,891,746 *3D07CB92C6917A964F17749FEDF0E2818D80446C B^Y4
593,891,747 *3D0DDA8827DD9FF31CBB721B03CFD21F8A31ED6C BY=4=
593,891,748 *3D050CAF54604ECEE5F04904FCFFD415812A284D BY)-4
593,891,749 *3D0BF873AED26034C0C216D92BE30709B3A1ED4D BY/5,
593,891,750 *3D0626EC91EF8C014137410B220AA7093F0B1AC4 BY5"f
593,891,751 *3D0D734FE7E5E92E95198BB03137535D1BF6C4D5 BY5G
593,891,752 *3D01E941A6995D89B19BBD53BC1978E2559B8AF3 B.Y?6
593,891,753 *3D074E234C2CF1DC3F4399EBCACF797E445F7408 B&Y+6
593,891,754 *3D06174773DA70D43ED9D2551BE0F24C32CF824A BY6tg
593,891,755 *3D0E803B9350C80099D821FA4F009E78CE0A85A5 BY7+$
593,891,756 *3D0B9E4120E2C650BB5A73D80418DE7D18901A2F B;Y7k
593,891,757 *3D093ABA6FD75B0D527BD020E3270F6A708FD232 BY7#V
593,891,758 *3D039DADB34F3481ADD9BFD80542550FA44FA33C BY8QC
593,891,759 *3D0C726DDD57441D1CB5DE7F69973383AE6EA5D9 BY,-9
593,891,760 *3D002B01EDEE9DD66C67ED9B2573CF3077F0DCA2 BY90-
593,891,761 *3D048F699FA15E20A8C44D9BDBE82D2E568A8FC9 BY9Mu
593,891,762 *3D09F2A9C0FF4DC005392D4513FF4DB6BBB9FFBF BY?9V
593,891,763 *3D0261D81DA63211A3DF567A7164BD837EEF3B43 BY9x
593,891,764 *3D010164CDA3EA6135F8BB13227C1B845CF4F802 BYAdi
593,891,765 *3D01901CE11279C1F496EA257CF9A58C3A73194C BYa!m
593,891,766 *3D02EBC275BF93DDFD9571FAF44021BC099CB322 BYa/N
593,891,767 *3D0DF19DAEA07DFA0D6E08C5B376969B9FB5B00B BYANCARO
593,891,768 *3D0478B9DF08C894534F6BEC97F7A9BB714540CA byard-jonesu
593,891,769 *3D09A768E60E99255E61AA887DF16A7FA5CF5C48 BY_(b
593,891,770 *3D09FF8AF220760DDC31BF60B345F046B691B412 BY!BD
593,891,771 *3D05407EA135C0D216EA65F2BC228F74B9F30E97 bybeeeebyb
593,891,772 *3D0688011C827FB6D6B1603B02DC94E45D111168 BYbLW
593,891,773 *3D014ABED20064361B03C0A02B436A69FCD8D48F BYbqt
593,891,774 *3D0CBE1398793B1686C9BEEDD1A6BA5911C0C78A BYBY18
593,891,775 *3D0587F3940D496A2F42E14D58849DB9A7CEAC2B BY="C
593,891,776 *3D08845F0FC543EEE57B14FE6E852D75DA1CE3FF BY_?c
593,891,777 *3D041D6A0E7B6FE04DE038682756AAA26B2B9DE6 BYCORNE
593,891,778 *3D0140B2691C5C606B485423A376C11C46BE0A56 BYcvA
593,891,779 *3D01081DF4CB8ED69B0744ACCBBEC16CA11A7641 B
593,891,780 *3D0FB30E6838E88FA2E4A915A9ACAF04C228AE64 BY%;d
593,891,781 *3D0DC7E9B2C2FBCFC18A1BFA3F6B050A61D0DC68 BYD2N
593,891,782 *3D04F18F98FBC8A9B773050BAFD215D27A23EC14 BYD;8
593,891,783 *3D0DE25D9EFB05C1AA99BD02B6BAD589B3DA5721 BYd?A
593,891,784 *3D09AD6088BF07D7FC5954ECE0DD05DF09ED5A44 BYDcH
593,891,785 *3D050D9BEB55A29B9021295DEAEA46FA36F08C57 bydij@yeah.net
593,891,786 *3D013C4658EC5C7ABF0DE1F12615364FDA448EA0 BYDLr
593,891,787 *3D0242988F78CE6B5A29D5E68CB4FF0FDFAFC061 BYD?v
593,891,788 *3D053B1FE2F72CE06F4343F0EB5A9B2C6D4C76DB B-Y,e
593,891,789 *3D0074487230D8FD469FB6FB3486D95CC9638426 B)Ye8
593,891,790 *3D03453558764098CEBE55D0F07A09AB6BE35FAE BYEg=
593,891,791 *3D0F37932BBBD6A7E8B6E71E85FC3E0363168B95 B)Yej
593,891,792 *3D03DCAD4660107A536AFC8CF69D1D9B6963C862 byejunex
593,891,793 *3D0B5CE785866B00C62F97898E90868805B41563 BYE.K
593,891,794 *3D06125FF5D753B1422011D2BB536EC137866001 byepaths1
593,891,795 *3D0DD8EECD29F8F7AA625E643836C05C6F3B44B8 Byerleys0
593,891,796 *3D00CE7A0F6001C8565917ED5F481230651ECD04 byeung-kwan
593,891,797 *3D081D2C8271940D63865C62E7DCB06B5946C392 BYeWS
593,891,798 *3D015A858D59E8313ACFDAE8B9F366EBAF32E312 BYF%:
593,891,799 *3D0F657A85EFF6FDDCB6A5D3DE3F0C1D5EACE470 BYfD!
593,891,800 *3D002D2E94B678A09B2EDD050FADD2D15823FBEC BYFfH
593,891,801 *3D05702294A9D91583F6CC84C157125AFDDBE7BA BYF_k
593,891,802 *3D074D3E95FB7DBEC336B9B233ABACE37BFCC09B BY.Fr
593,891,803 *3D030F9502266DFBE962A47C8ECFBD62CB840B2D BYfUj
593,891,804 *3D06ADA2882506A13B7DFB715DCED6FBC568A408 BY=fw
593,891,805 *3D0D594FFBDB78699377FC3435AF9CC9F411A5B3 BY;;G
593,891,806 *3D05E0702221FECBA1ED9EBD5F01D4B3DE2E730F BYg5T
593,891,807 *3D0C54B0E4E0433FB9B51B254474FFD4D7C6F01E BYGDEBOK
593,891,808 *3D0E1B60223D375D3CF65EF804B9BD0FFB9C74D0 Bygeregte1
593,891,809 *3D08121BAF3AF508816F87FF60EB9F26BD80A02F Bygevejrs
593,891,810 *3D029776098BC7A5FA286DB3F5E9CE30130197C8 byggestoppspolitikk
593,891,811 *3D0EDF8217EFE9DAEC6220B70C98AD40B41D3234 byggkvalitén
593,891,812 *3D0E037C5C46C7B79898014D925AAEE96403E00D BYGjM
593,891,813 *3D02DA87FAD4C1E1BA02AFE4EB7906F65790022F BY/Gk
593,891,814 *3D0D8F773AB2BF717A342ECD66F6509152572F23 BYGK4
593,891,815 *3D03B3DED48901E0681E45134EA6878C4CB3C584 bygnings
593,891,816 *3D0951CC869BF59E1CDA24851506986BFFDDA81D BYGo-
593,891,817 *3D0E3A2FA2BC3430B06D61427E352815EA10E5D1 bygqe
593,891,818 *3D0993D77C2A1D41B0EB296E5470A0945232F2D2 bygraceredeemed
593,891,819 *3D04F7E23524E3F1CD2835933C19E20FE63525A2 BYg;t
593,891,820 *3D0970B4ED4400E81758E8C9F98071A9BA380063 BYGwB
593,891,821 *3D07A341E32D2ED5CD394F03ED27213D61877171 Bygwydd7
593,891,822 *3D025561C283FD659A84A3F05468B72041D8152D BYHC=
593,891,823 *3D060DC7602B94E44D66577898A6C5F04CC23017 BYh-c
593,891,824 *3D01B7D5D1B2B20AAEB2300A0BFEDC5FD7119F6B byhelde2
593,891,825 *3D0CDE4986A2CB01E28ADCCD9387F4363A2D8412 BYHMr
593,891,826 *3D039056A72176D40F1436C32D0ABA7F07C322C6 BYhs9
593,891,827 *3D07F7A2B7F66971525B7295200424599F21D54E B/Y$i
593,891,828 *3D090054F59FAAA1099629EF73BD550EDCDB16D3 BYi1A
593,891,829 *3D014DE29DE9B0CC1C241D10BBD853AFA714A738 B#YIH
593,891,830 *3D0A565F85AFBA047D4CB4F67A4834A01467A62F BYIk=
593,891,831 *3D06CD6A98107628FFDB1FCD96DC473FCE5B1487 BYImR
593,891,832 *3D059E6736FDFC0D8C85609EAA3E97DF6502ECCB BYiN.
593,891,833 *3D03802C3B0E0C50981A224CD69273D2D4E9B594 BYiTj
593,891,834 *3D0F4940932062944FEC813CAA5FFDE62CAC577E B!YiU
593,891,835 *3D035C611E8FA5E6556DA17EBD29052E79D9E148 BYi!W
593,891,836 *3D0BF52B8856F68924495579D8952549DB2AFBEE byjnm
593,891,837 *3D095517D8BF496615308B9D657BC9B0E2F39FB6 byjota@aol.com
593,891,838 *3D0DD52569EFF6A0DEFE7C9F369C303F3EC52F22 B.)YK
593,891,839 *3D0583602633418612F3260ECB17E9C7E75E42BF BYK3
593,891,840 *3D0C69EF3AE4551F009AA853EA17DFB7E605836B BY!K5
593,891,841 *3D0FC35BA369B5F584525A844E510BF031708D67 BYKg2
593,891,842 *3D07272069758024E64FA79B29EF0ECE72B6B488 BYKO!
593,891,843 *3D0147D7BA507ADAECA1F6A51C1F173424000A09 Bykosted
593,891,844 *3D0003873993FE5C9BC8E9648B79CF15FAFBD71E BY!kP
593,891,845 *3D0E99DB123AD029EA1AB57B5F686372B28B13A4 bykteca1
593,891,846 *3D098350CC4ABEABC1FA0D413E8E5E5FD50933FE BYKul
593,891,847 *3D086968FB3BFB4ECD0F292B7895FD292E07FA5B BYL1Y
593,891,848 *3D009AFB2C211537AEBE984092DF557B40BE9477 BY=L7
593,891,849 *3D0BCDE85B387FC765991633CD3965CD134D13F5 BYLaj
593,891,850 *3D013934A1D7253F1F7ED485E2CD632616DA3C3E BYLbv
593,891,851 *3D0D26279F2AEA2E03860FA7F8D483E49A12CEF9 byldensed
593,891,852 *3D0A71CBAA006637F1135E1EE54BC3677EEF5C24 bylicazilkusza
593,891,853 *3D094676C82F258F55C86F0BF77F6666CD3E4CAA bylija
593,891,854 *3D0D75EA509383CBCD1881628B311D118DF84A97 bylln@aol.com
593,891,855 *3D09B6F692C3FB3ABCD5C13E31A7E0A50BDD8EEB BYLsF
593,891,856 *3D0B617B17FDB97C4310C4B8632DD67C563EEB00 B,Y(m
593,891,857 *3D0AA395019AC61A0EAB68723C85909DB33BD0E6 BYm_2
593,891,858 *3D02471959636EBA81CF0A34AA5B39ED3FEC0542 B(Ym4
593,891,859 *3D04F7752615AF525FBEB3A7B3A282DE93F4B996 BYm6U
593,891,860 *3D03C8AEACD6DE4DD74CA1D948B8C38F57AEBD3F BYmWi
593,891,861 *3D024E8BA1F09BAA14471DF4FE1DA0CCF48D7B9D B!YN/
593,891,862 *3D0B688DB4F85616F5CF022E833F73E3D1F83809 BYN5Z
593,891,863 *3D065D59A32DE2CE18FFDF1855AD30BA9B00F07B bynaˈmust
593,891,864 *3D05834C7E02344FD21307BA7513309DE7633D98 BYNOw
593,891,865 *3D0F9A2774B55C5C95C3037D10D50AB0F85B356C B%YNs
593,891,866 *3D0F8EBAC71A0F70083762D03738C397097AB979 BY:NV
593,891,867 *3D02E778EBEA878FB260FCD6644A5F0463FEC466 BYN(V
593,891,868 *3D0AD02BAA8D9CAB67B8A1B9FEBC53968FD5E507 BYNWq
593,891,869 *3D0F98006804FBA3D0FE8A7D69C9F732CEF428D2 BYnXF
593,891,870 *3D028ADBD1DA714F9EA91AEA506FD6E63E069FCA B!;YO
593,891,871 *3D0E7D791DFD6BB6DF9512779C64F9ABAA502AD8 BYoeN
593,891,872 *3D008E0BEBA69385AF66340EEC1704F5ACDD4E33 BYOUNGKWAN
593,891,873 *3D028B2638720443C473BCBB1E6BE4E9E78EC8D5 BY+OY
593,891,874 *3D04BBCED3A93C2940A9666A9DD2D3838B399B21 BY?_P
593,891,875 *3D0FB5A0361E0FDF6C21189AA8D1B6E9DEF7030C BYp1_
593,891,876 *3D05F216BEB0DDF546E4914B4B476C6BA47F2E34 BYP9#
593,891,877 *3D0017191886ADE16EAB0E36B77D97385999AD51 BYpCY
593,891,878 *3D02C6ACEFA29ACAE28D996C1649369E4218229B B;YpK
593,891,879 *3D0F4119715AF47C251D5CE4133DAF9A4A0ECF06 BY+pl
593,891,880 *3D03E3D415106C1B32A5FFB80CF7941EE72672A7 bypladsen
593,891,881 *3D06A04C6083A5860AE22CDED3B3E353A1354B1F byp@uol.com.br
593,891,882 *3D0BDFA42401C1F78F6C177C0774254D4D5931E8 BY(pV
593,891,883 *3D01BB938B66CF54A25FD568A26A4E4CEF5B2BE8 BYPv4
593,891,884 *3D0801E43E752C0264461BFFCBCC34B5063E31F7 B%YQ(
593,891,885 *3D048D510E5A92375C5ABAD0788A6D9C9A47436D BYq:g
593,891,886 *3D0637773054A591B6058F8CA34D9AEF48224C4B BYqh
593,891,887 *3D06588DDD7DA1E63D0DC9EECDC01448D666DC45 BYqkQ
593,891,888 *3D098D416412A8AD2DCF80F5971C581D35FE814C BYQoI
593,891,889 *3D0B252AFBA0FB7E02F95761F51B0D79E9069C41 B#YqT
593,891,890 *3D03AE5684963783CAFE5C2A8ACE0F6FA987C40C BYqUT
593,891,891 *3D082708E4D41619A6D25ECD8E56E1F82F6B8D0B BY!qZ
593,891,892 *3D060627FF7664E56F90232B228C9F234EAF5B36 BYR
593,891,893 *3D03F48033CF2930446DA73CCC3E81F84B44AC87 byravan1
593,891,894 *3D0AE17ED168862933ABB6B7FEBBBE35B260B696 BYRDEFORDELING9
593,891,895 *3D08A027F46677F94F59FA770EB9C1776B6FB750 byrdias4
593,891,896 *3D0FED21BCE110371E41F460EB0DBCE482F280F3 byrds.2
593,891,897 *3D014F1F80AA3E11B7F20A9A2231FE110F973277 BY%rH
593,891,898 *3D0292C1BCB2F0BDCF6FD911AF493DB274DD444C byrnedale3
593,891,899 *3D0012C329795BC08EF39273268E6046AE0C37D2 BYRNES?
593,891,900 *3D09BAA8776E8514E8284AA58FF067444E68E28C Byrno
593,891,901 *3D0D1E5E32EC7B6D5A8E73FB48521E76C734BD41 byroad@sinaman.com
593,891,902 *3D00CAD51F91B5176215A753DE889009F9A15EDE byron706
593,891,903 *3D073AAEDD4241D3F41D801DCDB63A7AB4AA1917 byron.ananias
593,891,904 *3D043D3E4F1E1E69E7231CA878CCCA8DA3BF0A40 byron.andreassi
593,891,905 *3D04819620632AC5F165E49EB1968B6B0C60BB86 byron.bocchino
593,891,906 *3D0BF5528694AE7873BB79260761DD2BBF1D0814 byron.buser
593,891,907 *3D03C7B999EB33F87D0B1BD378A8BC8CC32166AB byron.chea
593,891,908 *3D0EB98E79F08879923C3F0E6B14E30671E0FBDD byron.degolier
593,891,909 *3D0E72D58AB7687519D56F40D3D1A01E1CD71185 byron.delahay
593,891,910 *3D0F587AA876CFF80BC4DC014F11E76D8E5C3169 byron.eerkes
593,891,911 *3D079D64C9008C36C8FB7D94BB5B4F9A4F6003B1 byron.eichel
593,891,912 *3D002A2D244F3757988AC53DA65934CB02D6A08E byron.fencl
593,891,913 *3D0322D138AFDA776950DA99774CA7AC7E26C434 byron.flaum
593,891,914 *3D0E14C001A9653E5866215F66D1F52C3D0CE0D2 byron.grahm
593,891,915 *3D037A75A85DD1CAA5A47EE8E23F6C88B3D9BE11 byron.gurrad
593,891,916 *3D0E37B0C502ED935B0E063FE03D8B354212E84A byron.hannum
593,891,917 *3D052E5CF22479D0ECEA20896156F91850C0E2CE byron.hosle
593,891,918 *3D0F90566DEC273CF9C8B192BD1E293893A263B1 byronises
593,891,919 *3D0A24355F9A8CB24A571A0F6985D1D886D8A0DA byron.klingen
593,891,920 *3D04BE48D3F42D0BA7DE515CBC1650EC7866CF87 byron.neumeyer
593,891,921 *3D05A7C07234B08DD74540324200A25F4D9386DD byron.quisenberry
593,891,922 *3D069F19C366EEB93761629B2D0D656260BBEC17 byron.setaro
593,891,923 *3D0D1FCCB11335701EEDEF5BA7C9C11858ADFEA7 byron.sewall
593,891,924 *3D0EA2A2B6A78A08E0006DB06B9EAE943D014D8C byron.shevlin
593,891,925 *3D0BDF5C1E4813FB741C749D68DE79F8D4FC488D byron.spreen
593,891,926 *3D0F6A641C84AE7DDEDA990BC5FEE97CE53D3A73 byron.twiggs
593,891,927 *3D045E2462F872DBCFC453D08046B57BCEF4C42B byron.visovsky
593,891,928 *3D088EF89B23B18FD5A22C3444795B1FC7853967 byron.watahomigie
593,891,929 *3D097F9B46F613CA9144DF792A7597946DAE673D B)Yrp
593,891,930 *3D049F68D8ACDE84E73BB75437883D3A6DCF1BC8 BYrQC
593,891,931 *3D079CE9086D7C878C0640C78E00A3C6F32743A3 BYS1
593,891,932 *3D0577B15DE2C8CD2CD9C8833DC480E153901A4D BY&s5
593,891,933 *3D02D624843AF858E25CD1359940A66CAC862B7E bysborna
593,891,934 *3D0518D70EB2CF4E234457C6684DC339FF74AABF byskogen
593,891,935 *3D0D6F2E0FCB633215CC11A1F72CF714E20231CC BYsMQ
593,891,936 *3D08CDCBA6BCB55ADE32AAFC23D35CC169DDCD3C Bysskims0
593,891,937 *3D0EAFA332918FFCEEDB2EF453C20DE9AF0C4B7A byt…
593,891,938 *3D08D29BF1E40282DDE421E8CDA150F04445EB94 BYTAQYCR92
593,891,939 *3D0F1852F404ACBF35BE4F78131F3582FBAA171F bytchywap00
593,891,940 *3D0E4E19E16777810C216C0AA3E829AD091D5D15 BYtd)
593,891,941 *3D0C8E6A93C9A8A7E08AD482445D46C01774A891 Bytebbs8
593,891,942 *3D0AC6B0904A9C8FAE1E6605BEA15C88C968C086 BYTEMEHOUSE
593,891,943 *3D04119C25AA28F27C552894EADC253CE32AE366 Bytesorted
593,891,944 *3D0F2F1ED5B127A00F7368A29EE3F1A8897C71B1 bytes,加3
593,891,945 *3D036709C6F8420AEC83DA779F9078CA1372C09A bythatyoumeanwhat?
593,891,946 *3D0D872C759FBE9B84FE1AF833744E1A07D66EE5 bythgofiadwy
593,891,947 *3D0C7D73A2C7197D7A8A2AC63CE9E345BC31BEFA Bytlath3
593,891,948 *3D02ACFCBC3332050438DDD1530CB396C13BF4F7 B#Ytn
593,891,949 *3D083ADE3BA0A12D42BF431A12AF4FE6AE9B0667 Bytoken8
593,891,950 *3D0AA45B2EB1DF66AC131DC68F6885488982F22C B)YtQ
593,891,951 *3D0400E1E912E3DF8C2A7C44EC51ED917DB03C49 BY/ts
593,891,952 *3D05CAAA35F1E22A61B4D72FD6B116C7C26584A3 BYuD8
593,891,953 *3D0B6228109D570D22C8DDAFB277064CB403216D BYulV
593,891,954 *3D08126DB21B8FB07889B0309415626D99FCF9D4 byungki8
593,891,955 *3D0376F49006F59E5A33FC4C2410B28BCC74E400 BYuoR
593,891,956 *3D05D6758B5DC818575DD41D0F88B774FCEC7C53 BYutN
593,891,957 *3D0550D684D2E137355998C0288D667CEB21555F BYuWg
593,891,958 *3D04CB1DFF6D01242B4631BA4866381E27F20A15 B,Y-V
593,891,959 *3D0BC407A1CDA72105A92F11916955B33BF4D7E1 B+Y&v
593,891,960 *3D09AEF429BBFB44B8D8ED70363D8B2E7CBF69B7 BY%"v
593,891,961 *3D0DDEA87700D5F1854C6BEF46EBDC13493F2C4B BYv$)
593,891,962 *3D02E85000A63A4E9462ECB56F6540E4CBB6FF24 BYvOY
593,891,963 *3D0314B03208CA422D5718400840C9F3A6A12AEC B)YVP
593,891,964 *3D01CD899AF2E8EB799FD902F93FB14E66CA3D0C BYW::
593,891,965 *3D0363FBC42B5F3A7A55050684304803BC800E51 B)YW4
593,891,966 *3D01A7F32F1D53D40A64330F07FEE27817295EC9 Bywaile6
593,891,967 *3D0C0356465CC10DE83B4F51B9802FF9272B8C1D BywaterMonteCaroloFront
593,891,968 *3D07A51C3AB36B1C0632AAA51285D14B995EF52E byways@39.net
593,891,969 *3D065805F73947FDB83F499C910EDA863B844B14 BYwCo
593,891,970 *3D0BAED9BB07B42E82D383437DAC8AEC86CEE6FE bywe1234
593,891,971 *3D03131E88B639D101676E280C918E78C6CFAF0A B-YWi
593,891,972 *3D031536AC95A2615256649C987C21991BC56D43 BYWmY
593,891,973 *3D07E13F7A9F9E060E5EFB6C5611D7C8F61BF09A bywna
593,891,974 *3D0DCA7A4ABD536190169A013E31B3CD5D95B25D B/YWQ
593,891,975 *3D0C9DBEDE1F99E0A2ADAF5438F733151BA09CAD BY
593,891,976 *3D06901A4D3681B85DD151FD1D056720A4977A83 B:YXB
593,891,977 *3D03B148EA82368BCF81BB1FB0BBE6733AC75B4E byxuy
593,891,978 *3D05254A2909F5CD5FB19F5F2102E4D49C5378B2 BYYA%
593,891,979 *3D047F62816AFAD2D6B8F110865453E91EFDCE24 Byykbzqg7
593,891,980 *3D07CDE8F01C8A435501B19DC802140DFF6EA716 ByYourSide(NightMusicedit)(feat.GenaDootson)
593,891,981 *3D01E732E964CDD1D1F5AE72FDF55522F77E848A Byyybxl6
593,891,982 *3D0422DE2AC550B01CCE6C886C3DCF216032B672 B:YZ.
593,891,983 *3D0FED9AF6A0FCCF067FB53002EE2C0930456A54 byzacjum
593,891,984 *3D02500C082A9EA994786EFBBE2807663B8B892A Byzantine»
593,891,985 *3D081CB6710C36B32E2D8F5279CF91AA9CED45F4 B:YZt
593,891,986 *3D0AD57D8857770C49901549B6A3A22A3209B2D6 BYZt/
593,891,987 *3D067544E300394CA311ACCCC51B58D612345DA0 BYZvm
593,891,988 *3D04477C998D6A08CB63E68C9155A69B5F0F51AA B=-/Z
593,891,989 *3D0C1F026347DAFB4BA8141C23295DC7311DD971 B_
593,891,990 *3D05D18DDD65E47B86C70D3C5118D5509CDF9A17 B?-+Z
593,891,991 *3D013BAEFD11DB0C2F7714559C5F94C969719024 B/!)Z
593,891,992 *3D086A7FBE622306CBFD940D3DD1871120356A47 B+!Z:
593,891,993 *3D09B01A45F5E5500A9B8DD088B4F96D28B3D06B BZ?,"
593,891,994 *3D06FBF561BEC33AC01D3D6CE6DA85B4323909ED BZ#"_
593,891,995 *3D05C629EC5AD1319B0D9747E5ECC57CF6E809F3 B/Z0(
593,891,996 *3D075B6963DD5DC68BF93D3B6697200A4D0D5AA2 B#Z1o
593,891,997 *3D080B1378A967E3962C25C65F6A313A1CA0BA14 BZ%&2
593,891,998 *3D0CB4F0503FDF9B9A8380A403F117D08E66779C B#Z2K
593,891,999 *3D047EFBF990A3EC22D7FA52C3995FFD8E81458A bz3ll3r
593,892,000 *3D0A448759EF6F9EEB7FAEEA2297D5218452CC92 BZ3w9
593,892,001 *3D09E79024B3EDBBE54328030B70B17B48CA2086 B+Z50
593,892,002 *3D0155216008DC9AEFFB6B666935464BD158A189 B"Z5H
593,892,003 *3D054C6FC6E9DBE7F3F4AC9875FF24F173787FFA BZ%5Y
593,892,004 *3D0561F613448C5B366B1E62860F8201115F853A B(Z-6
593,892,005 *3D0606CA944493BCEC7718DFEFFC29BE469E322F BZ6=j
593,892,006 *3D07CFFCE6B186DD3D68E9018CB1E5B2D0CD56F7 BZ+6T
593,892,007 *3D02D7BFEDE6CBC54FE0BCA30E23F8B36AEAC53A BZ6T!
593,892,008 *3D04C43F515DC8380A2C61A6C75790606EA60220 BZ8:G
593,892,009 *3D0AD99D957B2C68D2C3CE65F5A840118B24697D Bz8m9hwZ
593,892,010 *3D0A35CE59DCDDDF541BB39C1B568487E9FD4348 BZ8nL
593,892,011 *3D0899E4B5271EAF36F5E31D9642C96513DCB32B B/Z9;
593,892,012 *3D05DFD1F890E5983B2336D6C05049C4B6F6D431 BZ9YG
593,892,013 *3D0DC52F7379725EF3E5C92EF71F92F010137F2F B(Z.A
593,892,014 *3D023FD19DDC47E5CC7D0E0FD34FD39C67633FFF B#"ZA
593,892,015 *3D0F861067009A8DD26E242D5664C2D1D6E9830F BZ?:A
593,892,016 *3D0E041C2636E921AF753C1F6B2D862FD4DD3890 BZ?)A
593,892,017 *3D04877B55D46059702516EEF6322EE26BB17A03 B.Z_a
593,892,018 *3D0B024685943D40B34AB7906C91A54BD87581E2 B
593,892,019 *3D05A07C20CFC729D921340FB9409AD5B908D103 BZ$ah
593,892,020 *3D09C5FA76B49E8EED4305F5A35E3DD81766F575 BZ_AN
593,892,021 *3D01B72A80335B954D86D95EB88A1BE3EE831360 BZANQ
593,892,022 *3D047147B4B38CC6DAE13F4D834D04118FF2F061 BZAp
593,892,023 *3D09C6281C61942873E3D5C16EE2FBBEF634F763 bzaxn
593,892,024 *3D07D3C691A2EBA72249BA4C284269133D6F974B BZ,+B
593,892,025 *3D07D1C5D684F5BFB3BF725D6A6174E921D86748 BZ.(B
593,892,026 *3D03F858DB84C35E3908052BBBDBDAA36D4F1F82 BZ%
593,892,027 *3D0A2360D543D84076D3518C71BDC2FEE74D4837 BZ#b?
593,892,028 *3D0B14B361187723EFBC34A4B2F0443C8BD83109 BZbd-
593,892,029 *3D0A741F09849EEEAF9C5B44CF574A141A69648A BZbI6
593,892,030 *3D00D69442E944A9D887D18FCA12B07934536EB3 BZBKQ
593,892,031 *3D0B937C55E2F0B7E622F1B5B8AF0AE6B3D426E5 bzblmjugckq
593,892,032 *3D051322AAEF2622D699146C447AC679365B60B3 BZBO3
593,892,033 *3D0EBFC78F9A70C77CBE08870A2B8045453DAEA2 BZBUk
593,892,034 *3D0F897C7739463CDEA7930E96B94A0FDEF83962 B"ZC_
593,892,035 *3D06F718E06F306BE93038FC086A2C4991609FE2 BZ~C
593,892,036 *3D0AFC1AE09A89C519B68BA02990830A8095AC9D B%!Zc
593,892,037 *3D09E67A396967A44C2FEB1567462642021CFE5E BZC1)
593,892,038 *3D0F1FD818DA81F5D050C90010620DDA59B99259 bzccf
593,892,039 *3D09E0ACBE78B15D28349B1F261BE8E89AE7C3B5 BZ&Cg
593,892,040 *3D010B6A6B8A44E0F3921F216444A7C31199DAD2 bzchtgts
593,892,041 *3D03DD81D6B2E463B1344AFFD9C4AAE46E6FD95D BZCl4
593,892,042 *3D0A74CAEC4968674B52FF80D880685B0100711D BZcXM
593,892,043 *3D030928563E1D542F60C77258D24AA93CCEDA93 BZd7Z
593,892,044 *3D03905BC5609B7C4517D5CA7B01548F20FB6E5F B/ZDD
593,892,045 *3D0085B477A10B738EEB2E85F08577A02C9EFAD4 BZD
593,892,046 *3D0C3D2F07EF33DDF2688ADFAD1C9D1A916D53E9 B)=ZE
593,892,047 *3D08741A04B8CAE89354FCF1C9BFB81D6ABAB87A BZEAq
593,892,048 *3D0A9ABF6E4D25D051993D879CAAA491B5AA2116 bZEDAAAAIBAJ
593,892,049 *3D0B23D19D281A8ACF8094824A93FC39387CC605 Bzeeked0
593,892,050 *3D0C2D25071F471B7F8F8D23A102496EA3E85047 bzehr69
593,892,051 *3D035D262F4DEB41C5FC46A5C6FA46891A70A06F B_Z:f
593,892,052 *3D0F7DDA10D076FD485DD3C6BC019CB583D26220 bzfcbb
593,892,053 *3D0ADCC1DF6C3B92CED1074BB7BFD817FF6D02EE BZFM=
593,892,054 *3D045CBD8A96E665D864782B9DB3BAF71B112A1C BZ
593,892,055 *3D02FBBF527595DD1A0E65BEDC775EB4CB137B4D BZg/7
593,892,056 *3D01A48896C2ED28D64509E40449DF33ED3E4DC7 bzgr@pvnet.com.mx
593,892,057 *3D07B6B0D14808B4FA5293C5E181B27874338829 BZgwG
593,892,058 *3D020BD3D57B99CF7943AD8E0CC793CDB30F115E BZH$2
593,892,059 *3D096144176BFC936DE2A25C703DC2D12B26538C bzhci
593,892,060 *3D09AB9E334D96F2006C1EA3EB1FF9505A3FBB19 BZHV5
593,892,061 *3D0C534A51988130764D5D6672D431CC72E05F41 bzhw@cd-user.he.cninfo.net
593,892,062 *3D03DFA8E9ECC173B13ABAE5184D56D770EA9642 BZiBT
593,892,063 *3D0241DD4D3D5B9A22F989B44A01DC404790FB0E bzip-dom
593,892,064 *3D0AC6A1E7B0159465A32517B971BD92D5F63F3E BZi&R
593,892,065 *3D0570168AF3BFAEDA6D0A7C8B32C9FFC2EE8A95 B-Zj7
593,892,066 *3D0C2DBA015D5D697AAF2C52E086991968CE9818 BZ:K
593,892,067 *3D03706DDBF558375623C5EF07585F02DB8A131D BZk5E
593,892,068 *3D0673C3BFDEC649EF1FC415E4AD13E1043C4BB8 bzkbd@yeah.net
593,892,069 *3D0C08AE43AEB07C32A929CFF52786BDD1CAAF8B bzklooawm4
593,892,070 *3D0FF1195CFB42E46B50B6FADEF75992368D9047 B!ZkO
593,892,071 *3D0997746555BD18D5C29DEBEC569A23E0F79900 B/ZKv
593,892,072 *3D08D9885ACA050EB4831C2FE5855523F785D71D BZ.!l
593,892,073 *3D072AA4B39443822943792CE96E101ECC0D9FA0 BZlNi
593,892,074 *3D04247743BE5F7FEF26DADE0B1B80940B6CE9CC BZ=M%
593,892,075 *3D0A32B14EFB894679F6DF5684D20934B9741817 B^Zm
593,892,076 *3D092E6421C73FC7D2ABE97A59935DB0246BC5AD BZN_7
593,892,077 *3D09ABCD09783CE6866F4B4D5760748F42135246 Bznknqrj5
593,892,078 *3D03D02B0E12B859A171A6B2E3D5EBBE9693D779 B%Zo3
593,892,079 *3D018EF9E76D9EFB3B8D09097927B42AEC99087A BZo7%
593,892,080 *3D0F8F47CF9DE1FBC012B78477ECCE8EABA886C3 BZ%P(
593,892,081 *3D0AE0932325E94AA6D3AE77CBEA9491FD1EB71D BZPr.
593,892,082 *3D09B5FA9AADBE36DBED9169391AE73FCCF0EE4B B,ZPU
593,892,083 *3D0A257FB90E94F4E1A70785C4C7FEA8548FE5C9 BZPuE
593,892,084 *3D0341D9FDF15BD3C872CCFB7F04DC5DB1980EC7 B)ZQ-
593,892,085 *3D0E759B1EEFEAD317C51F53BD797A5A39324625 BZq,?
593,892,086 *3D04FC1977B265406F8C7159DAB27FC8F89C8C6F B(Zq6
593,892,087 *3D0693067AE4BB7C00EDCED00159C028E47C1C74 B_ZQI
593,892,088 *3D0FE7AFDB46D9D1AACF444AAE485CEA236495B1 BZ$qw
593,892,089 *3D0371564B181E2DB435657A6A11AFF2E6D0CBF3 B$Zr0
593,892,090 *3D073EEA24AA75D6C28DC41956E8B70C2C61DAB1 BZR8s
593,892,091 *3D0BF145BFE07CE7007A140395FC51C60706F66B BZrDN
593,892,092 *3D053C61B308ADC04696AF5747FC4A40BF34DCA5 B$ZrK
593,892,093 *3D0773DB222ABBDF4F0E858874115C0BC92098CA BZ"Sa
593,892,094 *3D00ACEB831467CF900AE252D4742B61851FDEB3 B:Zsf
593,892,095 *3D0679AEF07D6E6A53F25E6AF0D3381CF792FF3E BzSF
593,892,096 *3D07E0BC35022F886B14DDF219B24EF4552A7AD0 BZsG,
593,892,097 *3D04A16EDC336F4DAD2A3112B15BC8CD7E015B64 BZSP$
593,892,098 *3D063342AE8186EB7F6DF258A134008F4BC8FD97 bzsru
593,892,099 *3D01658CE799B1A04EB647321584DA0E386F4EAB BZSXs
593,892,100 *3D0793DCB587D40673740134C519046E22FA6253 BZT$
593,892,101 *3D07725158CBA8A522FA42BBC46798A02E49A86B BZ_?t
593,892,102 *3D0132D804314C6A2A94D41CD5F2BBD52192A660 BZT/8
593,892,103 *3D05E5229D7C23ABF8241875E8361027017182D7 Bzttngn
593,892,104 *3D0CFB2506B247555A3916BAF48A2CBF8EEF3858 BZ_)u
593,892,105 *3D02407476BE0754B70126C86F536CEC694CAC79 BZ:u&
593,892,106 *3D004D3253E1322A53DEF5F2614913EA37C99605 BZ(uf
593,892,107 *3D099C54D973CEB87A6148CEB18CD78FC9DD1BA6 BZ"Uk
593,892,108 *3D02481C8FD33F38E472C268A29F04E8DD4BFC12 Bzulesening
593,892,109 *3D0C3831C27A6971D9CEC8259B36AFDA771B7FEC bzupy@yeah.net
593,892,110 *3D0D9AE57C682B0C1B1FA734F2B34A64CFFF0275 BZu_v
593,892,111 *3D072FAF1666458AAC70DCF2B67E384923C308D4 bzv9383
593,892,112 *3D000C4B38D37A77152FC6265CF2A911A2999727 bzvbe@yeah.net
593,892,113 *3D0C1749C5964FEBBE2F7E96EC74D88E933F0811 BZvs%
593,892,114 *3D018BCD8311B1771A88902F7AC045222DA93EA0 BZvY!
593,892,115 *3D039CA37C9899406190B913FA99EA942E815C29 bzw659
593,892,116 *3D01A6573B143D648F2D17DD7FAC3554B5EC2E85 BZwb.
593,892,117 *3D03324D5974746D25672A83F02E532C657E6FC2 BZwkp
593,892,118 *3D0D8DDEB412D7120EB4DB697E611D530431C242 BZwtW
593,892,119 *3D0C1134DBBCA8F1AD1E4CB379D5D10B2437791A BZW-W
593,892,120 *3D01F4CDF340F87E58A92A36C2F3ABA4FA8B7349 B%ZX)
593,892,121 *3D0EC29022444C5DE02A88019721B8D2F3C7AD44 BZX6s
593,892,122 *3D069BCFB711918A165DBDF1D0A9D1D971B33914 BZX+M
593,892,123 *3D0FA6FEA55AD9E978EC0A2FA8A3F157B7DBFD8D BZXML
593,892,124 *3D0DF7D8601788080ACF561572CD8600AEE3FEE1 BZX+R
593,892,125 *3D0DA26D7F998B7E88680E02312D49ED45F0A3F1 BZXXE
593,892,126 *3D080FA0D04AFA6CF90EBF6F2440DD45389F4650 BZY&+
593,892,127 *3D0C0B801CFB8D83E37C3ACBF23D748318A44A12 bzysr@yeah.net
593,892,128 *3D054CD159E71541B66CCD5026EA5FC5DC6DC8FA BZYU8
593,892,129 *3D068DD1AF59B9CCB18506F0AD0B42BFBC695D7F bzyyq
593,892,130 *3D02AA976838C54E2EFBDD21BC60CA2F90985778 BZ&Z)
593,892,131 *3D0E316DA6F184B449494BE9C9A09D30A0D2D7CB BZZ4i
593,892,132 *3D035DFD4A73FAE27BC388CAFB1136907D4114CB b—фенилизопропил
593,892,133 *3D0911D5B289E29E34402C0CF0D9B46B1A5EE51B B、人はなぜ自己の存在価値を求めるのか?
593,892,134 *3D0B24C9F6DE99475186014CA2FC5412126C377C にコートニー・b・ヴァンスの代役としてキャストメンバー入りしたが、第6シーズンの制作が開始したところで
593,892,135 *3D0E4BDA7A49086E7698E3E129E6F812349D9B95 bホテル博多駅前
593,892,136 *3D015DFC65ABC40E1156517A5784EC30B5BD3D08 をもつものがB型であり、A、B、Hの各遺伝子はこれらの糖の転移
593,892,137 *3D083B4C7EAC71C794294536D3ECDA1FEE277400             Bリーグ  天理大、近畿大、大経大、大市大、大商大、神戸大、神商大、大外大
593,892,138 *3D091A4F379BFC21CFB539C30A4F907F1F1BAC68 Bを測定した後Aを測定したのとによって
593,892,139 *3D0AD8DA30E35C0C4FE235D4EB2DA4817AB9AEF9 bスポーツジムを設立、会長に就任。
593,892,140 *3D01CE5F3CAFEF4141B8B22A0934CE72F4C2EA8E Bは開催国セルビアが1位通過のため、2位
593,892,141 *3D052E329152BC0940E91590F5728708B209E11A C^:+
593,892,142 *3D0FE21024B8560B04F4973C8827D13B439F7F95 C=-)/
593,892,143 *3D0DD3B489567A7B393C0D3F485A05CB421F3D91 C_)(-
593,892,144 *3D0DD1F0DE4F8536CD24EC37CB48E6D73450D098 C_+?)
593,892,145 *3D03B54A82C4403719F7B0D257B3BEAA26EFBB80 C-;(-
593,892,146 *3D073D79F445CA7C1A7E3E5D8E3FCED77E8C3A47 C-
593,892,147 *3D07CB43266AA405793823BAFF95B758C78A9842 C,?_(
593,892,148 *3D0ED67DE050E1FD98F4EC6B9855AE1DB426740C C,(.!
593,892,149 *3D00C24CB171E631DD8D8D26FCE9CCC817DB2603 C,&:?
593,892,150 *3D093DF85632F2D45BD23C93F964989ED2A50F23 C,#-#
593,892,151 *3D0E21FFC7A55B5FF3D4DE2DC31E18452F114A5D C,#/+
593,892,152 *3D00D830B6D4EB3836946FAE3133AA5C53E87F5F C,
593,892,153 *3D080B038E1DE072CA33304867D1BB51D271F474 C;/.#
593,892,154 *3D0FB4D670DA07625922526422375B837940E1B5 C:/#%
593,892,155 *3D0D582AABDE05A42AC3021AA47755C73F1E40D1 C!$#=
593,892,156 *3D0BC4B359EAFFB02FD72B54D70054C20C750D9A C!#%!
593,892,157 *3D01A4A6F061A8DC9BC546DD46612E68D890F005 C/;
593,892,158 *3D0B12777FEBFA1EEFD5FF21D3DE68D5C698E032 C/:()
593,892,159 *3D08EAF385EBDB20382A95BB4FE7E0B24C6CCE93 C/(:)
593,892,160 *3D03AC1DA1772B02F4E3815AA28C26700BBC0F55 C/&$#
593,892,161 *3D076322B8738BDFD48A26D9F2F5E2C97EB37A50 C/%$%
593,892,162 *3D0EE3A6ABB7C8B005358140A428971372C52B10 C.:$(
593,892,163 *3D00CAA3BC20E4F6482AEF96319BCA797A9CEFF0 C.(+(
593,892,164 *3D01878371970446E7324862700B4A1D8AE6A1BA C.)_/
593,892,165 *3D0A8EA12D66173655EC52F6F4ABA25152CA4116 C"?#%
593,892,166 *3D07B0AC79D8C7A97FE308D20580AB328053E6E0 C(|<
593,892,167 *3D04DFFAD2C3E1040D78EEF765DEE5B306BB593F C(">
593,892,168 *3D0E342BA71EB7294D3CE5496D175D59D7526DB1 C):
593,892,169 *3D09240A1DACC98147CE5F3DD8D09721C966CB1C C$,-!
593,892,170 *3D0020B3B971AAD2EB1B6F75748362FC4ECFC737 C*;^
593,892,171 *3D0721F1ED52B76657A66151A923E3D83F4235F8 C&="_
593,892,172 *3D0A914575B68391C4C516EF05EFF09D1C059891 C&=(_
593,892,173 *3D0F79E2D1AEE32DBC580FDB732ECE293E1B9376 C&_(;
593,892,174 *3D0D097BB91195E7D879B0863DEC13A5DA308362 C&(;;
593,892,175 *3D05D78F4A5BD407223C5EADA93B0E5E89737752 C&(:$
593,892,176 *3D0FE5DB6E191D06FA72793B8D6156E672750E55 C%_#.
593,892,177 *3D09D9B7545BDA8D0C11569B1347B8249A41C289 C%!#(
593,892,178 *3D09B4D65F15448F84C78F43B6D9AC200B14EBCA C+#:)
593,892,179 *3D0EB89D700896699C413CF478FDFD3FE7249CCF C
593,892,180 *3D0C99959D8AA055F4CC67A7EE61C416A9955811 C
593,892,181 *3D00655780CEEA7323F1D1960F4AC1AAF219D27F C
593,892,182 *3D06BEF902F5C1D484E484B048D49BE092571F8F C
593,892,183 *3D0529FC16DB533C19AEBCF0ADE91D3E397B7F81 C
593,892,184 *3D025A00DBF57DDF3ECCC04B9A301CDBE7F35D42 C
593,892,185 *3D0A6CAA4A0DD932965BA3218B4FD8534F9EBC19 c^.-
593,892,186 *3D090D53047CFE656B931E35669C49FF04DEDD77 c|||
593,892,187 *3D0BD1C12D448DDFBA90EF86037D6BF0947B43C6 c|$!
593,892,188 *3D05DDE977DABB654135931751C6A9720C26839D c_]'
593,892,189 *3D095FC5BDDBA9B0C27C98FF157366EEAB9170E2 c;]
593,892,190 *3D04D67AB0E104B819CA26AF2CC17D47326693C0 c?:*
593,892,191 *3D028912505F89C0C02558CE84E8C9EA118BCDA5 c$.#
593,892,192 *3D007231D4C2CBBCEACAAF88263C6205B3B25D77 C`0,
593,892,193 *3D0BADE529785615F318132FC1F2A4A99E370BED C/&0_
593,892,194 *3D044391EC89A011DD290413A3B8E1E1D92568D7 C.0=%
593,892,195 *3D092DD4145F2901A9E91D92DD2249DCEB3F638B C0:/,
593,892,196 *3D0AE0019D1FADA32BA5E9DD04B396A02F7D8C81 C0.$%
593,892,197 *3D036DFB0B1CBBA749DF53B731B58FED9A51C042 C0"((
593,892,198 *3D0841E9BF423DCE3677F36F5E07CB2B13058E8A C00/+
593,892,199 *3D0861A04C11B41EB2AA704C7789D2316F17232A C00kiemnstr
593,892,200 *3D0C0CAA4AFA8937FD3747390C8915341952F3A6 C0)0N
593,892,201 *3D0CC13F5E46ED458389550E60A6945C60E4E198 C00RDINA7I0N$
593,892,202 *3D0E670C8BDFD239E8B30EA922A5B4607A2A1937 C00;S
593,892,203 *3D06AFFF6DAA7DCE8A0F7CED879D3CB7A7A191C4 C00T$
593,892,204 *3D04784BD7B295A3A0A421BFEB688EAE29B3F010 C:0.1
593,892,205 *3D093EBD655AD496B2F60ED0CD67F6FF234108FE C01020303
593,892,206 *3D0700818D0CB31404E4A2BB4C104DDBBC5D906C C010n!a1!5m
593,892,207 *3D05A83A029681086C59F7F33AA3B0147CC585C4 C010ph0ny
593,892,208 *3D07FD136FE445B27122E08CF5B15955AC2767CF C010ring$
593,892,209 *3D09CC81B9A25AB92767C3CB9296C478497B4A90 C011E9!UMS
593,892,210 *3D0253AB3CD5F462DAB02E7724BFF626AE7C69C0 C0133n
593,892,211 *3D06B9FD3F2311DBE7FEF6A0994B2C6472C43290 C015=
593,892,212 *3D0C569C4CA218CD5DAD184E31BEC80E8C74AE41 C01d-pat3
593,892,213 *3D05DD03EC388C5E1EBB3484E679C1603B2507EB C$01H
593,892,214 *3D08FD81D0587EFDBA786DCD41BFA8DDC0DFEC98 C01Nw
593,892,215 *3D052361CCCD2659E3DE9842A9DC60F57DF94B83 C02Al
593,892,216 *3D0C5E9E071B2C4C4C9A1158F186AB3E4B89F08E C02CL
593,892,217 *3D0EE4E8F872E803517E5026BF10C34A9EEBC467 C02MP
593,892,218 *3D0EF1BC00C9AE25043E7AF391DB6A212FDF05F6 C03!#
593,892,219 *3D07993A4F48B419DB0CB9744AC9CEB12D4EA1F8 c031896
593,892,220 *3D0794E134C5EB832BF600D5A7F4BFE13108B819 C041sheds
593,892,221 *3D0293B25F18CB2EA76203A5D65B49C5D3227AFF C05:/
593,892,222 *3D095CF0F83A194B08D9E15E5B06AC80CAB6EDA4 C0&51
593,892,223 *3D06D8DBB7780B8553DFA9E88F711391B1A7B68E c0571234
593,892,224 *3D064C1BEEE3C366F3A40AB5301DDA5EF3BF6CED c057ic4127i146in0u5
593,892,225 *3D06A61C5BF7DA673FE76D5078D9FD6E801246C3 C05m0109i575
593,892,226 *3D08550148A2778F6322F9849541CA09FC11E4DD C05M090N1E5
593,892,227 *3D0A76AB1F6C56DFFF35125436E45850B5797343 C05+umin9
593,892,228 *3D0A79905B919E8733E04A7A7DDB2256D29151D5 c06121945
593,892,229 *3D004CA2D3F992B3CEE42217D0097F14ED9D0FE1 c06405748280
593,892,230 *3D03617F4947516CEED9299C0B2FAABCB576D506 C06Dp
593,892,231 *3D06550DABCB700FB4F39BFE84440FFDB06290F7 C06ZU
593,892,232 *3D03EFD3727632592832B22208C5BB6A596CFD54 C0:_7
593,892,233 *3D0B9A224B6238677EE78A934A8320A0B2BFB5E8 c0$713$$n3$$
593,892,234 *3D0190C30D850C690F9FCD55876298D73B60FA2B C072899
593,892,235 *3D03710DEAC199A7A4AE31034FC002FB75DE374D c07650800850
593,892,236 *3D0DEE63189CDDD4C7E769620902009246E6BA64 C07A-
593,892,237 *3D04B2D263E70294CD72D7D233DD4BE4BB5AA629 C08A
593,892,238 *3D033CB30E11AF92E38DF24B243CFE37B59D5162 c090@pchome.com.tw
593,892,239 *3D041CD680BFC53A8A454059A6719B140842F189 C0-9i
593,892,240 *3D033D0979C96FF4B0B76D4775918A57B097F8BC C09NI54NCE
593,892,241 *3D0077CFB8B827E5EDEC8B377F32D166F74878DA C09wS
593,892,242 *3D0639E4D2881B9203F7F107C99FD7157C516A7A C0-A!
593,892,243 *3D09EE8227F822B5EDCC50A74C8D3DC9BBF32859 C+0a)
593,892,244 *3D0D0E059BB612B7CC91F1CDCE034CD368F4CAEB C0A7!N9
593,892,245 *3D06710245D9BCBBDB53F0902609CFC68EE1B710 c
593,892,246 *3D0AE24C9CDEDAC680DAC25FCAFAB7061E4E21BB C)0aI
593,892,247 *3D09955FA522AAE32DC98251FFACB50876D70074 C0Asr
593,892,248 *3D02961AD1B6ACF4E5E8523B6F323DD0FC6091D1 C0(at
593,892,249 *3D04E0AF5BE137D0226611458F09D9D2167EA9AC C0at1ng$
593,892,250 *3D0B74F4336B6947B456A5152BCD1D103A42F179 C-&0B
593,892,251 *3D0BD1EFB80446A1089C0A3EC9113D70A3539019 C.0b:
593,892,252 *3D06DC7C5F82D6636AF9190BA8EA52618CFFC108 C$0-b
593,892,253 *3D0A4C444E5707BB114AA3FD5E60B60DB6D92669 C0b/$
593,892,254 *3D0CB5C9457C963C372379BE36F4734915318D36 C0BO5
593,892,255 *3D06EBEB793F61919B7BA401067701773D0E675D C0BtO
593,892,256 *3D0BF506750629D3522434036E5F2DA2CD9988C7 C0Bvr
593,892,257 *3D05A0060FA9385709FF105B26769281F07C3F30 C0BZh
593,892,258 *3D070F9591C230B083611B8D06A67C3BB247F247 C+0c(
593,892,259 *3D0C183C4EED749FFCA8F861960DE5DCE8942B87 C0c/h
593,892,260 *3D02B84949FF6E96355404D459CD1196537CA0B2 C0ckb04t
593,892,261 *3D06DEA1F45A708FFCB83A37AA4DCB51BD6B1C57 c0ckshying
593,892,262 *3D05DF6C85A9C14073B803FDE14C433095355E93 C0CL%
593,892,263 *3D048A0C7A17252171D96D21073686E6F34FCEE9 C0C.M
593,892,264 *3D08CD33B661909D6CCA071B084B19D7850A7848 C#0CS
593,892,265 *3D0881720B773CD8F148136668A60976B01C06FF C0?(D
593,892,266 *3D0C36134B37831C4679E7D6442F4381442FF1B9 C0%d
593,892,267 *3D02093C41DB9E5D76CF83642CF8C8B04C42D2C8 C?&0e
593,892,268 *3D07077B16912C8425960B493E4654AF02191374 C-0ee
593,892,269 *3D047119BC02BDA4380CB35F5658E8584A963E08 C0e&M
593,892,270 *3D0C26C862EED0870AA27D2E66E47352D705562F c0equ@1
593,892,271 *3D028641B90DDBCE7B7A2627566B43AA5FB0562F C0eto
593,892,272 *3D04755E033BCEE26EABD7A32C4B1A06DB3FBDA1 C_0f,
593,892,273 *3D0847CF108BB70CA54F9D1DBDDA14491EE27C90 C0f!:
593,892,274 *3D04140B0DD6AF0AA11A5B72DEAC6FF0B8D9C8D7 C0fng
593,892,275 *3D037434F904E2F9A040AB6ADC08438DEF19E30A c0g1t@bund0us
593,892,276 *3D030275281AB683CEF4278200D09A00920103D6 C0G-5
593,892,277 *3D07967FC19B41E729F01567CC194BBA8D644800 C0,gk
593,892,278 *3D0477D69E5437DE94E083FCCD6C68C1893E9B4C C0?gk
593,892,279 *3D08B29BDAE9650281D7093E56C17002128EF91D C0$!GN3R$
593,892,280 *3D04F9FF698F2ADEBCFBB5205A3052E8B9C60822 C0GpV
593,892,281 *3D0281F660AFEB10D86CCBA0F7CF534A6CED847A C0#Gs
593,892,282 *3D0BAA765D2A2205DF4413243E2BB3DF451BF005 C0.Gt
593,892,283 *3D09F1260B74B2C9D388FBD1F970D9DC395078EC C0@GU1@+I0NS
593,892,284 *3D0AEC07EBCEDAE8B3445C7B0CBCFC196C156E7F C0gw
593,892,285 *3D0941558C77CCDE9943C306C09805A075EC2153 C0gwhee1
593,892,286 *3D0751394672E26884769969138CDBF4805C9D0B C#0H%
593,892,287 *3D035BA0E3C03EFA0B50DE87C8F654A6EA3E1242 C0ħ?
593,892,288 *3D07B8FDF536B17CFBC06BBC8538FC8B30B59687 C0h.3
593,892,289 *3D04306FE00ADE08F4FCBF146D842195C4679625 C0H4B1T$
593,892,290 *3D04C0F1EF53F47A6E5E5AC92B10720C7CE05FBA C.0h9
593,892,291 *3D0A6ED487131D94C327E58A5418E2676CE826B5 C0hAg
593,892,292 *3D00C4567584878482E8FBBCB916A611147ECC22 C)%0i
593,892,293 *3D03CEF51ECD6AE1B12D8B063E5894F4833F2F03 C0&I0
593,892,294 *3D0819E3870333A0C84AB654F7CB032DD9E9818D C0IM:
593,892,295 *3D039BEEB45BBD851C4DE99D17619519242C6B43 C0jk)
593,892,296 *3D0D1FA6B6174BA7970AE66B836E9F146BCC87D5 C0jPB
593,892,297 *3D098B00B2328F340D3F468748AFD0BF081C6D00 C0kKB
593,892,298 *3D05ECA8C73B17F143CB0A58E7DE07468C5295CC C.0kn
593,892,299 *3D0A63F0634126070FA1DEB5971C23325368C7DD C_(0L
593,892,300 *3D0BFF05A9955D7A271D6C47E53C4215C972E1F2 c0l0rim3ry
593,892,301 *3D089974BCE6951CA3B8520230F7A2568FCCCA7F C0l4g
593,892,302 *3D01798BD17516DDB0D796A865E03AEB335B84C5 C0L74
593,892,303 *3D02C41F4A2FDA8E60B7876CA8C8E72892C8B7EA C0-lG
593,892,304 *3D043CB19280C2DD73A6B5CD45397D5ED08774B3 C0ll3c71v1z3d
593,892,305 *3D0D5D8D8E6E897B2A053AF4162CAD7260FE6ECE C0ll4b0r4t10n15t
593,892,306 *3D098154DAC4922B1141E402CC5E896F8CCEE437 c0ll4m3r
593,892,307 *3D093F9C1281E23A67E2DB4506B7D56CF9F12202 C0LL@93N$
593,892,308 *3D0C24193C83C86AA5C37CE6221C9B9E9B6F3FD3 c0lu8rif0rmes
593,892,309 *3D0B26255FE7574830AABE87C0E38B2D7B79E4B2 C0#lV
593,892,310 *3D00D199C804EADA60D48DD4C9D3AF6A17ED276D C0lZO
593,892,311 *3D05F3680BC3AB64553FBFA5234B1840B68C9699 C.0_m
593,892,312 *3D08F916AB4CDE87AE2F7536C6F60B1C10367479 C0$M3+0L0GI$+$
593,892,313 *3D08827ADDAE90F4196F3DD02547E4CFDFC5E64E C0M45T6HF6OJH130
593,892,314 *3D05E52D07A91EB3D54E455123945D88BBF6F174 C0M6l
593,892,315 *3D0B2E649A8E0206A46F6507D3E9E82B7261DB23 C0m8@t!ve1y
593,892,316 *3D011A0F175E38EBF18EB1D8BBD047F19F418465 C0M8U5+1V31Y
593,892,317 *3D0561780049B99E7779891A7A3C5D0070B6507B c0mbl3r3nt
593,892,318 *3D016F40FA285A25621E7E6F07F6A96359A549EC C0$me70l0gi$7
593,892,319 *3D0F4DCBD8EF73B0D15D596DCE29B3BFE0789734 C0mesti81e
593,892,320 *3D00E42FB8637E46E25D5AE7A3CEA5B1A4CA85F6 C-0mG
593,892,321 *3D09DA14FCA4ABA6BAAA0843F2EFEFE54DC07AE8 c0mm15eraed
593,892,322 *3D0D09158BC480E0957F4CF468D4463E3CA8696B C0MM3ND@+10NS
593,892,323 *3D0F34AB3F946AC573CD95272104B4F8BCB2B2B2 c0mm4nd3r3xp4nd3r
593,892,324 *3D0798AF59BB659FB2818B4325F242D5A2E75E47 C0mmi$er4
593,892,325 *3D0B3EAA97463585886C72B68E23CFF18DB8D720 c0mmuni0ni57
593,892,326 *3D00125F46CBA5E078FCE042550BD6F09287AE96 C0mp1!m3n+3d
593,892,327 *3D03C52AD2772D2FC7F2890C4438311B8FF4783D C0mp3ns@t1n9
593,892,328 *3D0A45C358F612EA71494B476A8D7B3589A2EDCB C0MP4+I8ILI+IE5
593,892,329 *3D04E1A3719EF71943623D252279D6BED8C2CE17 C0mpar3r$
593,892,330 *3D00E905629867380762AA949F01C8E6DA95A7C7 c0mpat1bl3n3
593,892,331 *3D04B02F067300BB306E0B933836B1D79711F305 C0MP@CTI0NS
593,892,332 *3D039598345A7F759E93357EF4F9E1E4EEAD13F0 C0MPL41$4NCE
593,892,333 *3D0245981B2E03C49ABFB55C9B9A7963EE94BC78 C0MPL4!$4N+LY
593,892,334 *3D0102F619BB0F386E84BB59332174443CE3534B c0mplacent
593,892,335 *3D0990066A9B38B9E2B8EC20A6D3960DC9DCDFEB C0MPR0MI$AB13
593,892,336 *3D046FF9CBD86FD6D918E852A938201F172DB107 C0mprehend$
593,892,337 *3D0BBA609F807E1BF907313C84CBFDDED6906490 C0MP@RTM3NTS
593,892,338 *3D0F8BC184BB54836FC466B3CC14E53C9AF53769 c0mpu4dd
593,892,339 *3D094FF0EB5A1AC8C36074EA49E8D79DB34A500B C0mUL
593,892,340 *3D0485C962DD424B1E81504B9690C0AF79E9DD49 C0MvP
593,892,341 *3D01F2C8DE11CE5ADCAE1125285C737782BA03F0 C0m-X
593,892,342 *3D0A3BA54FF2CCC444D9F28D17AB7A5D618CA672 c0n0n4n
593,892,343 *3D0C8D3507BF12F9D2B68BCD183FEED6A4A67093 c0n3mp0r4ri1y
593,892,344 *3D07BDEA1FE59C1248F77A8599BF7B506CA972D0 c0n4v1
593,892,345 *3D0A91E661F8DB7D91A81BCCE4630674C240AEC3 C0n50n@nce
593,892,346 *3D07B36102D26F9E0B4B6FD30A6F6FC6E7267633 C0N50R+ING
593,892,347 *3D02D9D19E40A52FF058F059027E6E896647419C c0n5+1+u+3
593,892,348 *3D01D93C530B6FCA7885C5F1F7742245425C42AE c0n53gu3mm3
593,892,349 *3D0E1420045FA40ACB225A1BE1372000418CF817 C0N5+3LLA+!0N
593,892,350 *3D02A102FA1263ECC09B86AE53DD36A80A2AF551 c0n53n5
593,892,351 *3D096670A04BE1883F90082923925A182BA6FC2E C0N5+ELL@+I0N5
593,892,352 *3D0EB71939AB6ED07B018503DE2A36A2D0F9F08E C0N74GI0US1Y
593,892,353 *3D063BD620A4749BC6CDEA26B7D6D26A4B7CED9D C0n7a910u51y
593,892,354 *3D074150D89F9C57CE67B2F76EB00D399E9C9B7F c0n7abu1arie
593,892,355 *3D088FB4B3C83CEC65E2D6EE88ACED58E4DCFB4C C0n7r0ll@8!l!7y
593,892,356 *3D025FD4B3679919FE0CACC78B581DA0280868C7 C0n7rad!c7!n9
593,892,357 *3D0830AE0188AC620696FD7568674FF95656F023 C0n9l0m3r4710n
593,892,358 *3D04752D0EDB32CC62D64981C59F7A68C45213E0 C0N+AM1NA+E$
593,892,359 *3D07849A5F124D08F1144318C131DE4BE8FD4F0C c0nc1l13r41
593,892,360 *3D044D4921D30254A3FB1EB6B8F1B4CDAAFF5689 C0nce1ebra+10n5
593,892,361 *3D08DBD4347C8EEB8388EFCE459379CFD32841F2 C0nd0min4
593,892,362 *3D0D1C4177AB04CF44E1AF6E5B3F8CD3FDF80F4E C0NDEN$IN9
593,892,363 *3D0B727D11BD5FF3D60DFD5762BB245A6AA6133D C0N+EMP1@+!VE
593,892,364 *3D014363990545A3B0FD8E7B9D1C870014963D6E C0N+EMP+!BLY
593,892,365 *3D03FFF008ABAAE179DB09ED14BF9AFF0F927D93 C0NF1DENT141NE55
593,892,366 *3D0A61A2E2A4C4F74F08554AA0860BD5D1450F1D c0nf3d3r4iv3
593,892,367 *3D0260FA13C53BB03D5524FBBE5BBCB7EB48AA36 c0nfe$$0ri
593,892,368 *3D06A51A8AA3E93B055E14FAEA84716396867332 c0nfl1ctd1n4m0
593,892,369 *3D02F5D89864D69A99B7112DED0C57E8113A29D9 C0NGENIA1ITY
593,892,370 *3D0B857BF7310B0503D483D43DC2F1CD9C8B66ED C0nGp
593,892,371 *3D01DC1DE9A86DFDB289D43967C1775B715EF3B1 c0nju9an
593,892,372 *3D0E14E4C04FBF8AE6B784549CA83C9B4D0A59A9 c0nnessi
593,892,373 *3D0AA27DA1D72B9C15408B7206C21DECC87285C2 C0No9
593,892,374 *3D092EBEA472EC1B08CA8B5A4ED709F7FCAD497D C0N$+RAINAB13
593,892,375 *3D0786553CA32536C8216B873315BA19D37071FB C0ns0l1d470r
593,892,376 *3D0AD7BA7575E7F43B7AB66F53F454B2169C9B22 c0ns1m11ate
593,892,377 *3D03D3B776041B872F125DD9F8DCE9C896EBD9BC C0ns74b13
593,892,378 *3D0C99A10A7F040C1ECA31FB9F702DBD100260D6 C0nt@1nm3nts
593,892,379 *3D05D1C27D614FF4A9FA3D83B01075B75E6F05B9 c0nt4ct4rd35
593,892,380 *3D0CC50B1B79C6815AA27C261D7B8535A2AF8420 C0NT4G!0US1Y
593,892,381 *3D02A2E659720F5EFA50E3A18DA5C0C8F88D556F C0NT@IN@BLE
593,892,382 *3D0B06E31BEEBC5107F44FE648BD89D0103D9EC9 c0nt@ngent1@1
593,892,383 *3D0CE696A6E54469AC28BF35323052CD971D1010 c0ntr34ll335
593,892,384 *3D04464B610482637C21F5673FB8F0F695D4DFFD c0ntr@r1ety
593,892,385 *3D051208704AC7AE52DEB4DB8ACC5F216CDFCDE8 c0nv135
593,892,386 *3D0A282DB1D18A836400BC97B58C15AD39582760 c0nv1rlh0
593,892,387 *3D0C69EBE600E65DE60D0F73281C94E46DFC8285 c0nv3n7i0n
593,892,388 *3D07FF0192EA6ED41D2E1A08600C6ADD74D44977 C0nven7!0n4l!ze
593,892,389 *3D0A947CF10251D5E9A1552AE0CEAEF659772EE6 C0NVER$4710N4LLY
593,892,390 *3D060AEBBB52934E205CD45313B297AE51B65F4B C0=NZ
593,892,391 *3D0ADAC7FB8EC571737C7F73E892F46A2768F5BF C0
593,892,392 *3D08B34AF9727FFFE66A3A07FFB794030FE51ED9 C0OC5
593,892,393 *3D0FC49E970CA5FE9BA703811BA38A23F60E398D C0O%d
593,892,394 *3D05388E9947E002066F70398D1EC78CACB4DDCB C0odh
593,892,395 *3D058609CD1E8DD8002D74CEEE345094B82FA88C C0Omk
593,892,396 *3D04B7B15710AE5A0AA4F359D758A42E76ECB561 C0omP
593,892,397 *3D0AB9E2D964397BEEB3DCBE8A51728AA6CFDBA2 C0oMY
593,892,398 *3D00A93775D80D813C287EB98010BA190B9607C6 C0(oN
593,892,399 *3D07044B03A27FCE9D5B783C9B3D4CF7F4FD60EB C0osZ
593,892,400 *3D0B5E917A86B03A3670832324DE83269616A1BE C??0P
593,892,401 *3D00AEBDAFB0E1A357BB91D9CC8379D3B7814631 C)0,P
593,892,402 *3D063E8069B84F881F50C95C7136518D94598B17 C0p!6
593,892,403 *3D05FBF0D230396F0E1CC0F817C41413C86C84F2 C0p6:
593,892,404 *3D0141DE1B6A8D6E820905552E729968F1601533 C0p$c
593,892,405 *3D05C63B26F27E4151F13A8760A599DCABC81F27 C0pEH
593,892,406 *3D029D07D31D8F9323FD4DDC75DE329EAF65530D C0Pi%
593,892,407 *3D0C6B2571B37AB3B44A39EDD34660BE0173A1A3 C0_pP
593,892,408 *3D0B2467EA647BDB07D283C5C5A2B9E5960390F9 C0pR=
593,892,409 *3D0382C3EDB7F05064ED8A10619458A6DF0A0A59 C0pr0cessin9
593,892,410 *3D0D216E3A349D6015DE6180AE13681B4528069F C0ps(
593,892,411 *3D035E97664C56951F96344ACFD9350209D90B0E c0PW
593,892,412 *3D03D011A05A8A5768A8887D05F805BDECEBE70C C0%Q(
593,892,413 *3D03F69FF1562E7348A314C677BAA3CCB909CEC1 C0Q6)
593,892,414 *3D0926A8558E93B62B2B04303015C309BF9970D2 C0qB8
593,892,415 *3D0B3BF2428B53DED31363B6F074130F7D05BAF1 C0Qbd
593,892,416 *3D01D69AAE692B897CBC303743344ACE6660B46A C0qqA
593,892,417 *3D079730312E531070F0D36907226F41824482CE C0q.Y
593,892,418 *3D052AAC28F929783E59F188432525C1993B6DF2 C
593,892,419 *3D06CE37396D44F05E66F1A3497D0AABE433F17D C0R0NA7!0N$
593,892,420 *3D0B9E3A8DC6B293FF116BC3C78F74FAFEAC0930 C0R0N@RIE5
593,892,421 *3D0EAE8839C27F6464027D420194E85EEC3593C5 c0r3 b0ri
593,892,422 *3D0DB554F6ECAE49B5D857AF18C91A5804FE7E05 C0r3id
593,892,423 *3D00C46260F756DCDEBF82721A3BFFDBA647D73C C0RAC1ES
593,892,424 *3D013791C0B31D996B3447423A0D24511066DDE3 c0ralfang3
593,892,425 *3D0D7A61D5431E2E001DE209ADFE2A19F77FCCD8 c0rev@aol.com
593,892,426 *3D08F66950CD03FC5C2FC006259F11E028BCD8D5 c0rg1l
593,892,427 *3D07BA78BF1A904347EA57E5D71E076B536E7A87 C0rjP
593,892,428 *3D0730891EAFC2878A527BCB089938CF04D1BA60 C0rkscr3q
593,892,429 *3D0D930E107E851A82266ECC31174231102171BE C0rnu4l
593,892,430 *3D0A3F897C4480788DF88FFC928DCF3104E73C4D C)0rR
593,892,431 *3D047787FFCB30B46E8A29A8D864D0AE9368C6D2 C0RR0B0RAT!V3LY
593,892,432 *3D0FC763252F132D276FC4CDCFF3E2FDAC9F53C9 C0RR31@+10N$
593,892,433 *3D0E3EB24B639398A6D4017386202ED4C6A44479 C0rrupt!8!l!t!3s
593,892,434 *3D09275E22A8DD6F20EE6CC9851B8B99627B1490 $c0rta$te
593,892,435 *3D0DC80D53121D0BAA4C1071ABAC3B0F4AC45B35 c0ryban+iasm
593,892,436 *3D09BA883D09EF9FFDDED1278D6E8712CB880AA8 C/0s&
593,892,437 *3D0BB20D00E7ADFA7202DBE836C5655CF9251700 C0sBh
593,892,438 *3D0274F46A886035923C082BD5687546B4072413 C0-Sf
593,892,439 *3D0A2E743962080AEBE831BD0DBB06B05EDB7904 C0sm0p011t4n1sm
593,892,440 *3D00425B2F5AA44ACD0C2B58AE2AA1B480C9F135 C0Sns
593,892,441 *3D0A4939AFEFF66B3705DA66938EE509550B3E18 C0su"
593,892,442 *3D09FAA6A70A1A9A93056C68A32133A21E2714CB C0%T;
593,892,443 *3D0094D778317C683C20586833936C11D4C8C535 c0$t0la
593,892,444 *3D08BE0F2EEB95EDA08B5EEE0B8DD6CBD60D4DD8 C0T9G
593,892,445 *3D0294311B223A4D2BCB174A60995E2DE47CF56E C"0tF
593,892,446 *3D085AE28BD47CDA95604D665587E4544360CA44 C?0TP
593,892,447 *3D012900550399A005764CCC59D1A8D74F3D4AB0 C0Ts3
593,892,448 *3D00CD4D6A1B1B025A9A5136A94FF987EA399FE1 C0t-t
593,892,449 *3D095D4711851ED535F6B3993A23705661C9520C C0!tU
593,892,450 *3D033527C8C091A15B81FFA0E17BDD6DDAC5EAD8 C0):U
593,892,451 *3D0CA08E305BC1647D5BDC5F51A0E42166D38420 c0$uit0r
593,892,452 *3D085DDB5A265CFB5CD3DB7B64095F45FFB348F2 C0UN7ERB4L4NC!N9
593,892,453 *3D0BE91729C0283E2B109B456E92248374866214 C0UN7ERC1A!M$
593,892,454 *3D0604EA4533647CB9BD6D94A39290EC4FDE1779 C0un7erinsur9en7
593,892,455 *3D017B06D59B0F18E5BA49371603BBE5DB306011 c0unt3rf01l
593,892,456 *3D0EAD291D1EAFC83E76A6CD69D3A2831CD07AFC C0UNT3RR3V01UT10NS
593,892,457 *3D0AA649EDB434054729A9842C519D4C32202B87 C0unt3r@tt@ck5
593,892,458 *3D0A23641F437373D9A7C598092B0F4495621094 C0unter$!gnature
593,892,459 *3D02C9C55F38DCDD2DE495575B40642101CAECCC c0ur4ger
593,892,460 *3D0936F0A2856F794D7ADF7DD33C0267E5DC59EA C0U#v
593,892,461 *3D078FF98323229867AF38C18C76F713FBD2E2E6 C0v2T
593,892,462 *3D083E73FE1DA8B7D70DA8B754AE2049E575F670 C0V3N@NT!N9
593,892,463 *3D0EAE6E773577B6DF57AEE4EEA5C848A3361D2B c0v3t0usl
593,892,464 *3D0635D46DC68FA360CA1E91C67C7D8E97CE4B2B C0V3T0USN3SS
593,892,465 *3D0A3D52A959534BD3D73C0C139A6DFE42CCF357 C0#V6
593,892,466 *3D06A8CF80DE595D80F3738A75D1939210812935 C0vIu
593,892,467 *3D0D62E678DFACAA58D5B2AAC6FBBE16A65CB49D C0v/j
593,892,468 *3D0B51A0BEAD363D754C4B051A543BB7D6969E8F C0v!ng$
593,892,469 *3D06B88FA3EA859AD541A6631CEEA34957C05014 C-&0W
593,892,470 *3D0D3CD675BE4BA8188C514CB33637766F13029C C)0W?
593,892,471 *3D015459128AD6DA6AA4088942EE90AD1C3F25D8 C?0(w
593,892,472 *3D00B2078CAF7BAD685EA269E16D71EB02C9A681 C0-w"
593,892,473 *3D06CA861175DAE6AA65E687D3069FA9E2AA3028 C
593,892,474 *3D058364289EC5C94E79F4C9D7F64F20B6ECAED4 C0w&G
593,892,475 *3D06BEE8C37011E6456654E41FA80A425B7E2132 C0WNH
593,892,476 *3D0C60242EE93FEBDCD608653A25D50AEB6E7571 C0".X
593,892,477 *3D02ADB3A492F896039965ED9B9BBC48577FB859 C0X8M
593,892,478 *3D0A386AA61B6BD0F3ED84939F64E9C90145883C c0Y(
593,892,479 *3D0702ACA8C36508F498A46A49A6729E2CE47047 C0YIP
593,892,480 *3D0ABA01155C1E2E3F3592B2F8647206D271390A C=1?!
593,892,481 *3D0A0EC0CDE7A4A63A64C17EBF84A746094BFB28 C?%1%
593,892,482 *3D0A28F9C2F1945681241E0EFAC0B0F37B44B319 C":1!
593,892,483 *3D0E1255DD20B14240E4E9311A65EEA9CC6E805B C)#!1
593,892,484 *3D0F5C28DB666D76598DAA648E22F24CF73E8D9E C1(..
593,892,485 *3D09E598952A4A06870F11BC693C963040B30799 C1%-#
593,892,486 *3D064F97EC65E979D67F4EAC072E09500E2CF9A4 C102605
593,892,487 *3D0F75F851C16E2811987ABC2A82D1FE890C4E19 c103580
593,892,488 *3D08DC191548B555E66571D951FA86197BDFF1DA c106468
593,892,489 *3D03DCC8A363015640787E2177EE1BA720385BEC c106549
593,892,490 *3D02A05863BD8E307B57B67FA47B593FBA395478 c10cca
593,892,491 *3D00745F5DFB9641A306040EAFDED22F33C60F18 C10pk
593,892,492 *3D068E308E343657B5D5BEE10B0DFFAD305C1147 C10WNERY
593,892,493 *3D0E369AC4514B9EDC105B7635FA753FE0B7BF32 C?1(1
593,892,494 *3D0D533D0BB2ABC6EAE5EE4E160E561FA520AD90 C11(_
593,892,495 *3D0FECE03445AAF385A3B1D0978F7EB4F5DD00C6 C11261983F
593,892,496 *3D06DAB415EB5CE97B90CBC377D1D80694356411 c115483
593,892,497 *3D0A2EAD2DE77EC17A5583BB67F1CB773BF35DE7 c11627ed
593,892,498 *3D0F1EAA655F4556131616EE177F385D928E6B02 c11759823
593,892,499 *3D0C08C87BCFAB59EB6C08A1F5F3A6748E5C1E3A C11b=
593,892,500 *3D06A88F6A9538DA91943C084E52901DB59D0B2B C11pO
593,892,501 *3D0D33DA0741C50FB09B7D878F6FC1C6D33FD2B4 c120677
593,892,502 *3D022D04DD793E116A04ED8799FBACB15D34486A c12101979
593,892,503 *3D0656BE5AED6EC56EAE11ED30568F68447851BB c121203
593,892,504 *3D0B5E01F9947AFB8EC611F9625BD9A8B6B7A87D c121226
593,892,505 *3D06AF41F94ABBD2C63AFC66C45BB769CBB49E9E c122279
593,892,506 *3D0886098F0ACE3588DA5D667DD78560ABF5A1DD c12267
593,892,507 *3D0087169D522E9FDE59A1BC105259E5C23FE07C c126313
593,892,508 *3D064269C557535CEBFD6B8A0009F7EB2D528BB4 c127684
593,892,509 *3D0323D4B16D272B81B763CC94092DA17CA07C16 c.12831350
593,892,510 *3D09D84CB3C62F5FA2BB5A32C53FB4F4AC1DD74D C129D
593,892,511 *3D0E69BF836D4CDBAEC2E49ABA9059F150D90DE4 C12G,
593,892,512 *3D05D0F165C95630EC76320D2239448FFF0A3C70 C_,13
593,892,513 *3D037C11841021300CDE52B33BB3D4F5E9E5AF55 c130763
593,892,514 *3D049593C50215061E8848DE5B53874D25CBB91F c137057
593,892,515 *3D0D4647BFFB238E1538F017295F5BED99874832 c137757
593,892,516 *3D089A0FD994838C45234D9133FBDF8FC6FB7D15 c13776888
593,892,517 *3D001583E11213F066C75EFBE97ABA40164E4AC4 C138I
593,892,518 *3D04010D8102ED3C806713A06463D566D27877F1 c139749
593,892,519 *3D08C89FFD94F5E179CC8A201368D5666BD8A5FE C141m3d
593,892,520 *3D0A5FD60F7D0A1E8D9657B459B7D387C87B67ED C143,
593,892,521 *3D001004A901649422F5DD83FA8A32A5E701BF87 c14551460
593,892,522 *3D00ED791220234592562F45B5A96555CDBE6FC7 c147157
593,892,523 *3D09523D753EE3D5796AA36245361CEC55C797BB c148302
593,892,524 *3D0D903AB4D2349099857529F53E5829EB98CA51 c148834
593,892,525 *3D0A7E713336A141EB374DB0D4EE47AC9A2FEA57 c14pp312dud630n
593,892,526 *3D0F2AEEB45A29237DC900A67AEA5E8558EDD613 C14Qw
593,892,527 *3D0F23B093DDAC8516F66C0564AF8D24BAD3F034 c14udie
593,892,528 *3D08F0035E61CCA1138C492399C7F9B2FCC2D6B9 C15&=
593,892,529 *3D06D9E045367539921559BD31B9BDC0207ADA1C c15176
593,892,530 *3D0E8913418B02B5EFC1A03B5D7E52FD77C51F88 c15.378.100.141.900
593,892,531 *3D0911DF1FF4A22D9104D572CE28AF98C2344A52 C156776
593,892,532 *3D0702AB0704FAA083A18B56CF304E1B7F0017F3 c158922
593,892,533 *3D0CD23BE234257D716020DED8329BBAD30B3C10 c159829
593,892,534 *3D09BDDDBDBC87F9A611211B6F2D3718ACC54B7B C15dj
593,892,535 *3D02395F58051EA1B37CA4773E337F9C9518E2D9 C15#F
593,892,536 *3D024952B4D4E62333B51400E2AA4BA665DAB1DE c15h10clf3n2o3
593,892,537 *3D05587A8C3E2B365247E5AD823F08529DEFFFE9 c15l16w4kc
593,892,538 *3D05187F7BB735ED813A6D5B92CBAF6C930F1498 C15Vd
593,892,539 *3D083687B54D795C45B9703B3D8F78238D222107 C160E39C541A4A2189A89182AF170A37
593,892,540 *3D00DE1E596659621794D10B3036B02F88F51E33 c162259
593,892,541 *3D01C3F247BE2FEF2B173D57D72982A267831410 c165041
593,892,542 *3D0CA11D47A4B34EFFA34CD90FAFB1D1E65C7601 C1;69
593,892,543 *3D0DC2B733EF021D09DBB25D391F867578E1B8BD C16M)
593,892,544 *3D0A1F8C54E623597D6DDB4F9B19E7BBF6A66766 C16p5
593,892,545 *3D03B63EBAFC126705E899BE41743E92D69D787C C1(71
593,892,546 *3D0ABAEF03E3C57BFE1EC2DBD9EC9497DD1F2BAC c17330
593,892,547 *3D0D756B437E22F49C45FF133086CE48771C3A21 C17M,
593,892,548 *3D09DF1DFEF9AFE6610FF07AEF475332D756EBE5 C1!7m
593,892,549 *3D0FAEA9D8999E8188B3489E294056FAEDBCC30A C1
593,892,550 *3D070A969AAAA4D88A15665B7B683EA97FE1AE16 C1&8!
593,892,551 *3D0F38158418545F0C4601BB196FC25933D8C56F c@1@83r
593,892,552 *3D0BE354E98F0C3710C660C9993D035491A02249 C(186
593,892,553 *3D00FEE70AA0ED6B0B6A34A31DDE90454FEE26B2 C18
593,892,554 *3D06EBC4288E40118FF0AE66B449932E310C0B25 c188220
593,892,555 *3D03B67A3E032B97C06AF5D67E47146D66A5CF78 C1_:9
593,892,556 *3D020A446105438F6A842A9278750F2049C3EBBA c19246099750
593,892,557 *3D0F283B5600D98F48CCF4FDC3F31B64BBE6C86E c19712000
593,892,558 *3D0FB8561E0DD644D5D8FE2A1E070652AF19EF42 c1992-2007
593,892,559 *3D0CA36B7C210D946DE9526F0859A35D0715B059 C19lV
593,892,560 *3D0E74160AF8C7F76137091D55DBF89AED064D68 C@$+19@+OR
593,892,561 *3D0A2213286084FA0C9868D1DE314F89173ED29A C1A(&
593,892,562 *3D06CDB355771D7C438229015B84C6543560C8B2 C1A1
593,892,563 *3D0CC6C0D414EAA25D41F5890FD1022B54C1A225 C1A5535
593,892,564 *3D010FC9FE5AED2337E80416E71A7B7285100950 c1,aaa
593,892,565 *3D0EE9F358EBEA8139230B8FDFEB78598D309E63 C1aBL
593,892,566 *3D0357B58D968138F21AB0CC872D7ADF2A858BEC C1AEw
593,892,567 *3D0CBCFC5361C4E402E7E0F09016AF8EC7BF5F7E C
593,892,568 *3D0E1730ED434E2648ADB5D6CC5370F1309485AF C1ai)
593,892,569 *3D0D07058799143694EDCA1B6D49475DE68E50CE C1akj
593,892,570 *3D06AE70FB4C8278A6AF67D3742F89A53D52DCCF C1ap
593,892,571 *3D0CCC75DF4355E316825692BE7397FBD415D418 C1aQp
593,892,572 *3D02092E8E03FAC8A957CBC8A1E45A2A460D12EF C1aTw
593,892,573 *3D0CE7F1E1B90A6AF3AE63A7876F93517765ACF6 C1Aui
593,892,574 *3D03603311A3BF621B9032538BA3DA71860102A0 C1avp
593,892,575 *3D03B22D76C93DD10D3B5C0D24DC803307CB4FF2 C1b2K
593,892,576 *3D0AC470406AA189F3AD1F5502B4E65158F848F0 C1Bbw
593,892,577 *3D0C2D2857C09DFCBB208EF9BDCF2F53018BE035 C1Bf3
593,892,578 *3D02A9E6B41F8A67315AF8B63F485165DC767305 C1%bj
593,892,579 *3D053A589757FB9836F6AC11D0E64A2B6EE5F904 C1)BM
593,892,580 *3D0DBF3407084330CB8CDF032E65909F3C472008 C1bpl
593,892,581 *3D0A32D4017074E4675D01A28FE00E45F12032D0 C1b=q
593,892,582 *3D08CED1379C49B2D50C293956EE534CE1696DE6 C1b"w
593,892,583 *3D0CA4C6AB520AFBBE7604766C0F21CB8F72B4F5 C1bwk
593,892,584 *3D09BA64894199968D464A19AA7BE24F0ACFEEF3 C$!1C
593,892,585 *3D0FD4EB255D56BE70B2385A72A6DCB69D7ACC61 C1.C%
593,892,586 *3D02312E1655677E01B66C386E73F5B10FD4F745 C1=c&
593,892,587 *3D0939F7A91341F3294798DDC1E0C571978EDF95 C1cA-
593,892,588 *3D0840F1D82CC32C52BBE69089009ED3E1DA5ACB C1c#B
593,892,589 *3D070DC877296259C2ED40FEF9B3BE246290930C C1c-F
593,892,590 *3D07B9C745853C9EBE6D9FB3745580C5B70BF82F C1Cs#
593,892,591 *3D0A2C75B0A722880A5A393165264E0A5B7B0CFF C1d&6
593,892,592 *3D000D12E1646F9426E0579F4CF7E16F4B6A64ED C1D-A
593,892,593 *3D0CC4C38798037737C3149E854262A7DFF0BE6F C_1Do
593,892,594 *3D0451778EAB339DE71D0C4AE7684002EF859C36 C1dt3
593,892,595 *3D06C33C42C760FDB23AD86827B231A7D6677BAC C1E),
593,892,596 *3D05C8CC7987B9770F71754F2DC82AB8E8CB76A7 c1e15d6266f98e33e081993278577035
593,892,597 *3D0FE20573F7BE8B4FEC937DD12D1E384DD46A64 C1?Ei
593,892,598 *3D06BEC67BA176CAA945C235F4BD236AD1553A38 C1eit
593,892,599 *3D0A67075542294A5C62E031C292D534DB2D85CC C1!eQ
593,892,600 *3D01527551884D0E49DD216DDF138092F81568F0 c1er1ca117
593,892,601 *3D08E7EEA15E8BB72E87F70B893B1B38B1B12860 c1ericatu
593,892,602 *3D0485BB29CB6702570DE6DF1FBA5FAA457F9984 C1eVv
593,892,603 *3D068A2341088A49208828F098FFCD336D5C5F22 C)1(f
593,892,604 *3D001BD8E01D5FE9FF1D1F523FED81017DC7565C C1Fd1
593,892,605 *3D0110FCA93DA93FD1FF6DD2A66C5D50AC532B84 C1fjr
593,892,606 *3D03318B4502846DB30989E186177FB68641A7B8 C%1/g
593,892,607 *3D070F40E0662E9BC0C51090FFDF9E8966B89424 c1g}
593,892,608 *3D03A1BFBCB4755487DD76899E34F90E505500A2 C1G:k
593,892,609 *3D08F0AAF21EA075235D636BCC77EF0BB01813A5 C1GQ3
593,892,610 *3D08EECCDE601045C70CA16B7790155391737809 C?1h.
593,892,611 *3D0DA11C61B9CE45ED7A5DD4E5D0F13A76ABCF09 C1":h
593,892,612 *3D033242A266F204CCFC33116CF0B09A9E1534AA C1h1h
593,892,613 *3D0E7008123E6E6E66FC42A5A19ECEF3BE4F8C73 C$1hd
593,892,614 *3D0858206591718B0B1E008CCA199A4CB65BABBE C1HWB
593,892,615 *3D00F251D1F225D882F1DF0DB19E42796A723670 C1"I9
593,892,616 *3D07CEA4B97B39EAE4FA79F05692DEEB902EF0F0 C1iC_
593,892,617 *3D0EAE3A10CB02EF8AF5C0926B1B3672FC901246 C1i(f
593,892,618 *3D0FEED7D858FA691A5E402CA42E110D99F41C9B C1Ij%
593,892,619 *3D0314B14121AB4E349296BCF00A5A6B32295731 C1I:k
593,892,620 *3D080490B268A87A6FC559AA55BC914CBC8F4646 C1ingie5t
593,892,621 *3D0C969926AE5D623B9832DA17D3E15FF250F776 C1Ipk
593,892,622 *3D08C918B9944E128C7DDE101AFDEACE91B1E9D4 C"1jB
593,892,623 *3D09266BF7FF86CA18A205504F16DFC6A3C38D7C C1;(k
593,892,624 *3D0159CE99B9FB05FD793CB7F103BBBA1ED51A19 C1LC"
593,892,625 *3D06673A73C7DAC7826D2CA16702C0D2CD946CCD C1LuD
593,892,626 *3D08CFD00AA257DE4AF110A4DEE5B809CA30F7D5 C1M20
593,892,627 *3D0F626EABA9F18B0FB7447D1C3F0346D1907975 C1m3=
593,892,628 *3D0CC6008CD3D69C15D3357756DCEC9638B27C36 C1MBI
593,892,629 *3D06C2D7B2A633E5D8FC8D7235B22B4D7D2A6C6D C@1@mi70u51y
593,892,630 *3D0C6F752959DDA075AD4F5D243577C29A2C2F2D C1ml2
593,892,631 *3D02BBE29079D58A07B3BB73E92867F562068D9D C1mRD
593,892,632 *3D0F1224CCF8CB435D339C896BC612F7133456C6 C1!m@t0ther@p!e$
593,892,633 *3D0973A667DB9E2FDC2FA32AEC54C7A197B4BF1F C1Mv1
593,892,634 *3D0AA9ED3820DD18CDF7ABB3D0F1A186D9CDFB45 C&/1N
593,892,635 *3D0E48C60671A1A1F64430C5C5D8A2C379E167E9 C1N!
593,892,636 *3D0ADCA71558F70B7A3E05DA308CC92885946EB5 C1!n&
593,892,637 *3D026A717539534D431CFD116E07D1099467AB2A c@1@n7h3
593,892,638 *3D086D95D85814B54B50F59603F0047DDDAE4B94 C1!N9!3S+
593,892,639 *3D09F7C84DDC680F7FE7BC09FD95A327E8BFE7F5 c1ngula7e
593,892,640 *3D07EC98999E37586752BCAED00BAE446C831A55 C.)1o
593,892,641 *3D07A983901941AF54663FB9BBC58EEBE994B4E6 C1O99I3$+
593,892,642 *3D0ACA01C8C7638490A70BCE2E13F11EA57008BA C1o99i3$+
593,892,643 *3D0D06AA2E5C1C7FD7C1F74E9832017614812F71 c1oakmaker
593,892,644 *3D0F816F34C7AE1C6204F184BE2DAD861D438A92 c1ockwise
593,892,645 *3D0551A8242C387E4DBE94E86A3782F9C145F895 C"1OF
593,892,646 *3D06D3FD27565721DAB57AC378311A775231453E C1/of
593,892,647 *3D0FDC15DD68F9D7DACABAB0AD634E953C13A66A C!,1p
593,892,648 *3D02194E11B6D0F496C52D1FA4FD6A4A9DC9E7B2 C1p=,
593,892,649 *3D0AB99AA3341C28BF996CDBB34DDD1FA4D112AA C1Pg3
593,892,650 *3D09F2E0B3A26528A73B895F04EC3C9BC2D37FD3 C1PIK
593,892,651 *3D0DAD607F0764A94B6E4A8F76BC4EAEA8131699 C1)Pn
593,892,652 *3D00CAE378036C41675A88FAB44B1A200D4CB3D2 c1-preview.prosites.com
593,892,653 *3D07B69356B0AC6BC428CA5358A7F92F0430125E C1Q?/
593,892,654 *3D0DE662694F30748A6486C58736E18E82D9BF99 C1q
593,892,655 *3D0A71C8098BD14B0CBC462496B75855C7562372 C)1Q0
593,892,656 *3D0532DFEB596A9D2B87FCDDB8A76DFFBAD858AD C1QcM
593,892,657 *3D03CAEE2662BDCB0AFB58FC71A482B5AB5C66D9 C1Qk.
593,892,658 *3D044A5292D45141BA5A6D4868D5658FD91AC42E C1qpQ
593,892,659 *3D057CFB700F4EF5CB70A97C94B33A612C73A300 C1qw/
593,892,660 *3D04A9BD77C74B57544E1607C4B92F8D4E514F26 C!1;R
593,892,661 *3D000F0D9988AB167D5DDD4A5B6EB82AEE9C2525 C1+/R
593,892,662 *3D021BEBC787342595C5AC4C29AF92A88CD86BB8 C:1r"
593,892,663 *3D0EB97C9791A0D2BFCF2004FC6E733A468CC6B1 c1r4ndm05
593,892,664 *3D03F23F6D86F62EB6761F7FD9101792FE2E2792 C1R7c
593,892,665 *3D0477B3D8435E8E04F2064DD584B7019B53431C C1RCUMF3R3NC3$
593,892,666 *3D0E09D9FB2D43991C60206385FB812AF163BB72 C1&ri
593,892,667 *3D0099D87ED99D0B34584558CED898561FA04495 C1RIu
593,892,668 *3D05C2352301040682B5B1C86019570AF801EA64 C1R:k
593,892,669 *3D00DFEA1AD8493C56ACAA1ADCAE91FDC520DA90 C1r:k
593,892,670 *3D00FB7B3049349B7F37DD9DA52902AD352860A2 C1:Rl
593,892,671 *3D078650A3D99B22E5AAF1230727415D3A44490E C1R;Q
593,892,672 *3D0425677C54776237BC9BCCC09A3C9D553D49AB C1rQ#
593,892,673 *3D0A497125184BED69276841A794C3CC35026CD3 C1RST
593,892,674 *3D03B94E7E2997460D94A2E8762A0C9ECFFE10B3 C1@!RVOY@NT1Y
593,892,675 *3D0F82144E98CAFA894C2C24B35EBF5FA3D35FD3 C(1+S
593,892,676 *3D06684BB87FE8F5AA4521B39831E1F2CA5D8621 C1!)S
593,892,677 *3D02C724470CB94775F534D67DFACC13BB2485BE C$1#s
593,892,678 *3D003F5808C5A929DF46880E68B3AF77932037CC C1,SI
593,892,679 *3D05755E3D1303F1C26CF777341C278BC3D52B8B C=1%T
593,892,680 *3D0FE20AA5C82F7A8E4F8D7E3D5735E2C57431E1 C:1tc
593,892,681 *3D025C4D3A0510FA77D9E6885857058F12D8262A C+1TI
593,892,682 *3D05339B9029972C67F2984D272EF1CF7AC3364D C1u):
593,892,683 *3D055ADE4079F8695EB446425669FCBDF8B40A0E C1u1)
593,892,684 *3D0D99108CEF5EBD62619FB7CE1E4EECF32D0E40 C1U&2
593,892,685 *3D00A3AC16B84A55F28ABEB5C0EF5B5C59FE3A9D C$-1uk3
593,892,686 *3D0F28900D7FE25395580767DBD2D8A12DE7391E C1uY"
593,892,687 *3D0F58917E1BD50093F72B7C2AF519795F7F3706 C1v111z@71on
593,892,688 *3D060EBCF99801622FA4954578F87B11737AA9B9 C1V5K
593,892,689 *3D07445490E30B71941CE31DD572D88C110070B1 C1V6W
593,892,690 *3D0220B753340A146CB54D3C2905E236E2BD1AF0 C1VAg
593,892,691 *3D02BD97F4C441ADA352929A240E4845257FAD59 C1vBm
593,892,692 *3D0D44DC7185046DBD48DEBE6D0E408E149095AC C1VM+
593,892,693 *3D040D5E00CA2A73C4B9F9BF628D8EEEF1FD6AE2 C1vrq
593,892,694 *3D029F65D97EB0CFAE6D155C590CE845E726DC9D C,1!W
593,892,695 *3D04FFE8E5BC640B4971852089AEB27ADD2E514B C_1w&
593,892,696 *3D013ECC556249CB1FFB47AAA0795EC7EEA9684D C#1$w
593,892,697 *3D0274D94D300A7803412CAB211435B2C25BF399 C1"w_
593,892,698 *3D03D3E361822AF243C91DD86CAFF8AF539FF923 C1W4m
593,892,699 *3D0752D83BAD59A98200A93552B6AB5E851A0DFE C)1wA
593,892,700 *3D033F66BC38E2527E0C94F688FBCCDEB51E71B2 C#1WC
593,892,701 *3D00D71A03AC40072485BDEF6F953F59900BE87F C1wCv
593,892,702 *3D04AB39EA7229CAE354774D0F7AA526857C5FF5 C;1WX
593,892,703 *3D0D0E958BF5E0A6B13EABF56C13ED904AE04352 C>1X
593,892,704 *3D0E7F749D3ED8A199F220FD5EF5ECFF56E531D2 C$1X_
593,892,705 *3D0AC14413A65EC2B4DD7CE664E6F82CD6A40C5F C1X6P
593,892,706 *3D0FE9A73CFACCDEF596684827205EDE0FE0B42A C1_Xb
593,892,707 *3D0AF5E948C3E02C1C4BFEA4E23AFC780126CD65 C1X#c
593,892,708 *3D0F2BFFD7017DF7D5C0B8FB1EC25F015052E53C C1X%l
593,892,709 *3D0A7EB2A37186DE2B2F4304E54D1E82CAEE55B1 C1X#q
593,892,710 *3D095E9E82960194880C74138B4D96BE5967D0F2 C1Xsg
593,892,711 *3D048486BBBF80C503CE82D611FD5546A3D94392 C1Xv1
593,892,712 *3D01A36A88B6C5E00763FFAAA4412EA4FF1271ED C1Y+0
593,892,713 *3D00B6C7ED20AE9CBAF054BAB5A928A9FC2BE5C7 C1Y/v
593,892,714 *3D0043A23F37B35643B547306FFECE414849D995 C1YWI
593,892,715 *3D05AE57331F5D7C8F1AE4DD5E4F43037C27CD39 C=1:Z
593,892,716 *3D03FADF9CE068B228729D3956BA890E15E16EDC C1Z;a
593,892,717 *3D06AA3946853A4BBAEF2B46C810B1769EC678CA C1ZQY
593,892,718 *3D034BAC063907BACA7DEC6F7FA96D0DC4EB67F6 C1ZR1OD
593,892,719 *3D049329B079F807B34F6BCCA5473623640494C5 C,2"$
593,892,720 *3D0B6456859B92FCB10BB1AC7389D1793898AE5A C;2%,
593,892,721 *3D0CE42A7DF08626C6FBD3771DC01748D1BCD9AF C"2&-
593,892,722 *3D0546D58B72CA5263948A66CF3B1D01FEC01C7B C)?&2
593,892,723 *3D021F6009F474773E716E3C8321C2E165FD4494 C2)-;
593,892,724 *3D0296CB88BEEE1F576AB69B3FD7C6F9EA1DF484 C$2!0
593,892,725 *3D0E00F5E6FFDDA38C09DD762AE90E6089DB12E4 c20070
593,892,726 *3D0739169CC3E240CBAFD90B12E8ED0E8AB03FD3 c203011
593,892,727 *3D03112318AFBAEA6D4F5A064EC27C620177061D C2)0M
593,892,728 *3D0872184C9944F4F97E5033A07A5F64D8768709 C20Np
593,892,729 *3D074C135735934F49BE252E142E8A4D3504ED23 C20系列
593,892,730 *3D0AD284C508B824601F35E4D76DAAA91F48924D C21"/
593,892,731 *3D09F5BE41CF75E55F284A75E72DE14ECD146632 c210987
593,892,732 *3D08A57ED9BD8B0FFA67C79AF74E92539D3FCE9F c21.739.793
593,892,733 *3D0C45F7F650069F7D02443B3A793351A2BB7C6F C22-7
593,892,734 *3D0CB4C72EC124616261F8B0FCAB553E0AC1D0A3 C22dF
593,892,735 *3D0605379FADC6C3C651FB428E70DA49306AB564 c22h26f3n3os
593,892,736 *3D02D1F1815AB6FC4F78F4F122AC843526CFA495 C235e
593,892,737 *3D0D5C675E08F969D2A85DE42228A48236139317 c-23691
593,892,738 *3D0E436E42F9E90405C03DD4A18AC3EF57AFA93B c238689
593,892,739 *3D09151FD09FB9072356F02777AEEA85BBB1ECC9 C2,3O
593,892,740 *3D07BE052FA9137F441FD51193852C8304949A48 C2#?4
593,892,741 *3D0FC600A273E37A793134055F35CA9DDE08AA3B c24687931
593,892,742 *3D04A783A865D0361DE63316C00232EB1B11A0FC C246r
593,892,743 *3D024DC19C7333372BDFBE582CD945A103CDEA9F C247s
593,892,744 *3D0EE0E031CFEA014C4CC9AC6D285699BD5A6AF8 c24802680
593,892,745 *3D081023403D73E3DF73CCA3ED3BB686FBEF7C7D C2+4E
593,892,746 *3D07429B712F8C51E7C6A94CAFFCFC6CB610CE5F c25880
593,892,747 *3D012AA9E0C173DDD8B04DF82ECA6815A56F89D6 C2(5b
593,892,748 *3D0D366DAA51CD3E4EE909B6A36F496CCB84164C c25h
593,892,749 *3D084BA142F3ADC0F12ADD668E61BEEF89BDBA08 C25;K
593,892,750 *3D00675EE2E9BAEFB3A0243F9ABD93572A1E7F53 C26Vq
593,892,751 *3D0D89420797A8A66FE37743C142824155DB8FBB C!$27
593,892,752 *3D0491072038A46A675357A52543A4595C9876C8 C2"7
593,892,753 *3D0FA93ABC2C9FC07B8A44BE4BBC0C616DD4837C C270THAR
593,892,754 *3D09B827F6693AAE1FD3C1ADD7C5C59E83985F59 c27q4634
593,892,755 *3D0193E80D969A96EE459FF8FA85D461A16D4F6D C27qs
593,892,756 *3D0264F5FD8C3B244DF885E28E370160B6CFD9C4 C27;W
593,892,757 *3D0AB6C62FA3C740F8BB69B77775CD54F19A0F8F C28-
593,892,758 *3D0CBF65D230D3827CFCFC5B06199ADCDE90254D c28041978
593,892,759 *3D03030786D51342FC365FD06BC225A866095DF0 C289b
593,892,760 *3D006FA34347F32082C6F63455EAD144E9836A2D C28ah
593,892,761 *3D0C02C9D2A62A8C38C4B459F53837C312371084 C28o#
593,892,762 *3D04B0EE7B104CE822A42971947B0DC8EA8B08D4 C2;8r
593,892,763 *3D0FF88BB692C63BD1CD1718299AEF7262CE18EB C28+V
593,892,764 *3D060546F75B1EB79708908FF959078E693C6E6F C29d=
593,892,765 *3D03E8C84CBC52A4DCE3A08B5A2D547293DD6D9F C2?9W
593,892,766 *3D01BAF4C53174BFB706F15026B737431E0863B0 C2AMI
593,892,767 *3D07194637DC74372227F99BBBF582CD61653E33 C2!aP
593,892,768 *3D07BC84EDEBB1623ED1939A8BA65C4E15EAA281 C2as7
593,892,769 *3D03CBECEC068BCC1F97BC6F536B9B1B35D46834 C2aZw
593,892,770 *3D07D389683D9DB8B771238D3E6C061680FC47AE C!2AZYG!!2L
593,892,771 *3D02C302F3E8CDA199ADEED5AD533145D504C28E C2bDB
593,892,772 *3D0D9BAA7CBAFD6178DB29889A37AD93ED740458 C2c+/
593,892,773 *3D05D8481E67DB3482C4C69317918589524B0217 C2c1?
593,892,774 *3D0E3ACE7343D909B9A2CEDFE943121350E5C600 C2CC.
593,892,775 *3D080F91AE57BC8F41211D38191AC58555D92E73 c2cl4o
593,892,776 *3D0F559BF162ADEA9AC694F56D2BD3592749A0A5 C2CmH
593,892,777 *3D0E0DAC613AC9E064A2C60BD6999EE497DC5105 C2co6
593,892,778 *3D0CABFC44EDE8F8174E18B4B6362843312AB7C1 C2-#D
593,892,779 *3D0542F68C561886484A525C55FBAD04ADF6525E C2D8Z
593,892,780 *3D0B73BF8185C5C26B29631AF7BF5AA6487711BF C2da;
593,892,781 *3D0FDE664C94E879DD5F6E21B695E134AFDF2BEC C2?e!
593,892,782 *3D0CF83D2A52236FFB877DBBD2C1799998CF9074 C2:e0
593,892,783 *3D0D777B5E41F356235C1D9B7659A09E3D0A4035 C2E6d
593,892,784 *3D0F397558DB5DCF934A61B1FCFA8C9C273FD81F C2Eb.
593,892,785 *3D0917EDB5B1261281A1117903F7E3CAADB1DD58 C2eiw
593,892,786 *3D00AF28A1C478D4157B8BD8656E019685797CC4 C2E$T
593,892,787 *3D06154FC6FFA12B77083D3351D6644908F9F3F8 C2e
593,892,788 *3D0F1FAB6EA12D20C6B42AED308E467D4E7768C6 C&2-f
593,892,789 *3D0A38A4546BAA03C987C2EC26E27087EB23D67B C2FOb
593,892,790 *3D0C0C405FCF724FFEACC77303FCF37123ED10CF C"2$g
593,892,791 *3D0E3AF17F66FDC541618C946DA0F021EED00369 C2G9?
593,892,792 *3D0C21D6DD569270CF39E7FE08E8E168689DF9B2 C2!ge
593,892,793 *3D0D02C38914EAD6A51D9C3BA62DBB5498DBF589 C2gg$
593,892,794 *3D0FE2BC50BBBB636CA7AE4DDC5B44F98556C05B C2gh=
593,892,795 *3D06626E309A5C5C47BBD9BCB5995BC33089457F C2grp
593,892,796 *3D0066C88E4ADD5F7F49AEF53635048268122DF7 c2h5o2pooc6h4no2
593,892,797 *3D06069C659B94CFE38F4B91C7A40F5A12BAF08E C2Hfo
593,892,798 *3D0DAD3269C76439985249F612F785D5D7BD82CF C2-hH
593,892,799 *3D0EDD1EE3F8226F85FAEDD15CFD8EA19880AA63 c2house@aol.com
593,892,800 *3D012FBD4684D0E4D24951C08D30A5AF9760056C C2hpv
593,892,801 *3D055C595E11546E1B27FD738D030D0535ED6459 C-2Hr
593,892,802 *3D01FFC71E860B46112BECE8AF122815C1CC15FC C)2i$
593,892,803 *3D0E18C5F5D5F0C493937D51CF2E5841FDD90A67 C2Iw3
593,892,804 *3D0918B641F64224B7D9D4EF0C376BC649435554 C2IZn
593,892,805 *3D0FFACCA064DE5DA541C48EB2B64A8A1FEF01F0 C_2j;
593,892,806 *3D0948E8DBA25E7B1262B1C112ED337F2AC2F1AA C2+j"
593,892,807 *3D08BF79B476BD41BAC272B9F356637375D97DDA C2jGX
593,892,808 *3D011EE471F30881DE85E993F85B51B4DD4FCC40 C2k+0
593,892,809 *3D052E9EB3B6814A9BBAC06B869C612CD728B8F3 C2k_f
593,892,810 *3D0C3C30AB4445789A975AEA67A891C1E53CF719 C_2ko
593,892,811 *3D09EF76625AD4C7A99EF72C506D9D6F3B0E050A C2Kv-
593,892,812 *3D080EE653A3CD2E435D49AB7223EAB4D3B409B2 C)2;l
593,892,813 *3D069BAC7150766C21349569E69D3C82EBCDAC6D C+2l_
593,892,814 *3D005815E8892DDF4C9EE3B7008368037B898C5D C2lA:
593,892,815 *3D051CA89480B8E874490B12DCB7397E219FF4ED C.2md
593,892,816 *3D07EA9157A9E8A28E190311615622D084FD9201 C2_md
593,892,817 *3D04DE9D4A730066822E9F22E57A9623CBF83FF8 C2mK5
593,892,818 *3D0E7A114042C981BF1891056A739583CC4E24E9 C"2_N
593,892,819 *3D067506A5F45F43A974E7EE0BE341A09A59C741 C2#_N
593,892,820 *3D01701C46EBBA31E4F9206CA49F13AE62EF322F C2N?3
593,892,821 *3D0A93961AE78ACB40537AE9079056954E763EB8 C2NQu
593,892,822 *3D02AA84088392BEF86C9B9E09F6E2E953CA1208 C2+;O
593,892,823 *3D0BA4050F7ED86C702CB2C530EF5E178287105F C2o."
593,892,824 *3D0E44F55F47D1EA65AFC866FED19A4296103831 C)2o1
593,892,825 *3D00EAF2186C0D0FF4426205C564986DE544DE52 C2o;h
593,892,826 *3D04E1C73CA24DFA4BB6F77414D128EF09664FE5 C2OXl
593,892,827 *3D0FD78595A96F537B487DAAFC114FAE66D441F7 C-2#p
593,892,828 *3D00A88C5EDC5D3432A4202280DD0CED49626971 C2p=$
593,892,829 *3D09473FDA2A2B3E7D88E6125168C9A2D1B0DE6D C,2P9
593,892,830 *3D09E69182050F7BC88CCAF99058A3275B699DEB C2pc2
593,892,831 *3D0C3C95C7EF580215E083335E3369E743F6213A C2pD?
593,892,832 *3D059078AEEA9433DB35C7ADB3626FA04FB53A84 C2P?p
593,892,833 *3D0E86A6CE0676C85B6C907715C5A82AF6984A65 C2PSI
593,892,834 *3D02789BEB911213DBB81B6507C5CE19F2323660 C
593,892,835 *3D0BF3556E097827D560F830B2DF74FFF1A6F571 C2q$=
593,892,836 *3D0D36CE774F8351717E6A46E41A8F12E050CFC6 C2q1Q
593,892,837 *3D06265916126AEC89E6FCB36BDDAFF4C314DE5B C2QAG
593,892,838 *3D0145D3959DC18178AAAC276ED7AFB51D0E46C1 C2qTW
593,892,839 *3D00290168B3371655785BF14D49D237751284DD C2QuI
593,892,840 *3D011615A7CD015A2FCD1F079FB93C1B0FEF676C C2QvT
593,892,841 *3D0FE70D33CBFF8E8C0FF38A40259A9DEDD1CB64 C+2QY
593,892,842 *3D0C2BE1BBFD1C50AE41EE8D46D700B2C5E9DB8B C2raW
593,892,843 *3D0B5BCD232B278972AEEB4EEC8EF7AC3B839F2C C2(rG
593,892,844 *3D057CB3696505D62BF311231CB0DCF33351D765 C2R_m
593,892,845 *3D0BCDD401EA67A9D5AF59D67B80F074B15CDC4C C2rnc
593,892,846 *3D0903481CF87310DC73B07A59047E3731FB0380 C2?
593,892,847 *3D0D25BA1EB364151070D08A2EC3B348E55FDDA0 C2S7n
593,892,848 *3D04012A5F1FC5B397F78BD03D30BEBD3AF64BEA C2Sb/
593,892,849 *3D0DFF223C018613EFE68303BE9BEA00D9C3CBE2 C2sC
593,892,850 *3D09E94C6DA604932E3F19C0B25D73A130FEE579 C2sD_
593,892,851 *3D00C19389E3EF9799EE1749E215A915D6656072 C+2So
593,892,852 *3D0E48EE15C4C6751729BD5BBEC635B54A8B30DF C2Ss#
593,892,853 *3D08764C7786A37F315EF07DBF02051ED69FA68F C;2T&
593,892,854 *3D0A0AABB4B50A48C8297197110F12AFC35F1F4E C2
593,892,855 *3D06D823644257B283F6DA9126AFADA57A2C2CAE C=2T7
593,892,856 *3D00934B066794252A732B9267A5D11E43633231 C2;t9
593,892,857 *3D0E446393DD63987EFF0B32A1C70635C4475637 C/(2u
593,892,858 *3D0702CF2776D40260C04E8259AE879DC7083FF6 C2
593,892,859 *3D0DD5024CCFB60F455389613361D573AEB09994 C2uEM
593,892,860 *3D0EDB430FBBF9F6E365145CC80C62869062A17F C2U"f
593,892,861 *3D07F05320D10F20B68DCDF43CB729DC6894ADF1 C2uju
593,892,862 *3D039F665FAA7A152F104C476A63FC969756B947 C2UT?
593,892,863 *3D0AE2E68A0D9535057522A1B7804FE8E52F966D C2uu7
593,892,864 *3D0598BAB3DC4199AD2F4ED3E16B376D99923ACC C2uUm
593,892,865 *3D064D8EBDB0A85F9E53150A2BAD6F7A9EB73B35 C-2
593,892,866 *3D04FB109D66802894E5270B977E0605C127B685 C+-2v
593,892,867 *3D026DC1A5FABDA22874E7BF16DCC92694B84C51 C
593,892,868 *3D0CECACAC65C84E04ACBD32BC95C6F236C6F950 C
593,892,869 *3D03FA899489B1663ADA955F5E21F6525FCC8CC1 C?2VN
593,892,870 *3D08895131D5CAC83422AC282C0FC3346C7ECB1A C"2wA
593,892,871 *3D05063DF2817BE330E0908B3917D24CE805D26F C2WCO
593,892,872 *3D065582998DA2E59F0025CFD3D7E8F523ECD2BE C2w=O
593,892,873 *3D0578A30B9154CCFE55388443EAB772B06BDCA0 C=2WP
593,892,874 *3D0860F8B12502088C9ED9EBF0AA3A60D2C0FC5F C2w;P
593,892,875 *3D003DBB123725CCD7B62441566F0D81E3295499 C2XL/
593,892,876 *3D03CE3E2E307B20F12931BAA7CAF5330885A0D6 C2XpK
593,892,877 *3D04F373428E846E4EA25AF99DED30189682E31C C2Xq.
593,892,878 *3D02B106DB2B1974E79A30AB04BF3E3E0FBAF2E9 C2XWs
593,892,879 *3D01B9F68559DE630F1CD96C25E7077C0C0CCC3E C2YaY
593,892,880 *3D08581D17A07B72352A69DCCC226A046F0F13F2 C2ZNo
593,892,881 *3D0E867BC5D4E48DFA6EAC1C9D721E4AD884E928 C_3#/
593,892,882 *3D0D19E4002F2614679A720FEB67B39CC719964C C-,_3
593,892,883 *3D02182E1AD4FDE3B13B0F86CEF0477184DABBA1 C$)(3
593,892,884 *3D06C2DB59933CC03759DFAF37DBD73523E4C564 C#((3
593,892,885 *3D0B52A3F94912EEA8781E15222F5C4B54922B4B C3;?+
593,892,886 *3D02801A0ECABB642B87ACD3AF3F5BCD0D43D667 C3:+=
593,892,887 *3D04BDFB3FA916B1D90225CDADF212D9BCD75E49 C3/,=
593,892,888 *3D0F52D0B47753497C8A236736E4A8F06A3AD459 C3//!
593,892,889 *3D06F9C98D3B44B5AFFFB384EF6575E95D41E080 C3(;$
593,892,890 *3D04E318D838D28871F1AA5B171504D422CE26DB c}%3
593,892,891 *3D0A6A79652DDC68FD0A501DD038D049E8729CCC c3001
593,892,892 *3D005DA6D081F06C23E9F1C0C713A804BE332E84 c30405060
593,892,893 *3D07D1CD2697C9F3687EC47558B66ACEF1359ADF c3061997
593,892,894 *3D055F908ECE0E83D5AF24D147F93329A9522327 C30
593,892,895 *3D0873C3CD9BE2C449E66D32D47E02CA903B3397 C30dN
593,892,896 *3D06C5CB5C6FCF497A9159DAE4B35690475AB31F C3&0P
593,892,897 *3D0EEDDFAFF459BD528381099BB18EEE12A00946 C3138R@T0R
593,892,898 *3D03132845D3695DFD9594DA99B8BCBA6D338A93 C313br4+i0ns
593,892,899 *3D005C608B6090BB1095CE109ACEA4D7A6C006C5 c3177ebac2572d43
593,892,900 *3D0B82FAE1AB32D5FB30A5CBA40D035797E5E5B2 C;31a
593,892,901 *3D08EA702B677E32559B1C974EBCF55B933745DF C3,1v
593,892,902 *3D009979DE729C59A5FC950523F7CAD9544B73A7 C!3(2
593,892,903 *3D0E97D862841DFE0F8BD62A2172060846DB61B2 C3$2%
593,892,904 *3D0AE94E9929390D23AA64BE2019ED36F10CAC7B C32%!
593,892,905 *3D0323667B7979A13B3FD52F3E1973228DF4465F C32tL
593,892,906 *3D080F74D10405DF37D7BF14F72896C955A0C257 C33!/
593,892,907 *3D087DDB6B0F9A30EC9A9922CE47C28B15D1B579 C33.$
593,892,908 *3D079EAC1A29D034D4185F789F14B180C6813242 C33
593,892,909 *3D0CED6EEA518A6E3B7B5FF09148C62EC7EAF5E2 C33"9
593,892,910 *3D0EBA5285E5268C5087E51F10B5CBBD5089C0A2 C33BO
593,892,911 *3D0967850B451E72B7FE0B56B9ADBC92BBC6C27F C,33D
593,892,912 *3D0678A589BF4FF5BAEAF5D2B9D7DE6F7485F663 C:33o
593,892,913 *3D009D5EB8872E3634D0329565F32E2B228D9177 C"33s
593,892,914 *3D0D1F0D92BDBCDF20226A16BB1D7B3F894CCE3E |C34
593,892,915 *3D0373B6CBF115F9EB6E1FFE0F566F2A664BCC32 C3-4;
593,892,916 *3D0788F128BBD173E6EDBA1E1B9F61A3FA211D8F C34
593,892,917 *3D05E4E7998C28562B86BEBF1AB4165A9E2CF5BE c341n4
593,892,918 *3D086735B2CABAF4EA174C0E6946142E546FA309 C34gq
593,892,919 *3D08EB5406398BC739D0F2E310DD9607A8BE66A9 C34kW
593,892,920 *3D0D32888303D24441452E4D306CE51B779D8510 c354108
593,892,921 *3D002BDD80A08D5FB3BE8A2CA0E9E0BA6085F481 c355arono
593,892,922 *3D0B3F7A601B46F215D2A8308B4AC62B8A08E4B1 C)36;
593,892,923 *3D0018C97A5FD0710856771E032BA833A8539330 C36'
593,892,924 *3D03535B1D855C88C3B8F3BF6112BAE020370669 C368Q
593,892,925 *3D0624DA83E6D04C1F68E5A7FA3C5E4896CBC9EA C36Bg
593,892,926 *3D071314B679F5A4F3D20C8529495E01FCD05102 C3;6j
593,892,927 *3D0033D3CA460FC7A367F23E5F2E9B5FFAB710ED C3;6K
593,892,928 *3D01BE89A76D2BB58F5F3F2C746EB14F64F4E04F C37."
593,892,929 *3D0349F6A85DAC299BBE0CD3DCF1A388748532C2 C37ac3an5
593,892,930 *3D01E73909640582788F6EBD98C48D6D2E6906ED c37@c3um
593,892,931 *3D015599C951C2172536EA590D9AD37029484997 c37R
593,892,932 *3D06563CE75467A160CAB9C6D79CE0E8466B7F98 c3875940929
593,892,933 *3D0813E024C89381B4E3E7C23259287C22E56F9F C
593,892,934 *3D094B2A304EB171CC4323C57E3529BEF62E4BC9 C39-7
593,892,935 *3D044A889632AA009F568E2A0F121A842E1A4FC3 C3$9P
593,892,936 *3D0ECF70A5FB63962AFF457A3623BFA6AFF3CA56 C3-A5
593,892,937 *3D06C896E0BC9AC9549FFB495EF360E13303CD8C C3A6v
593,892,938 *3D0FF5D246573CA4E2851332ACEE7D2B4C729CBC C3/al
593,892,939 *3D0E5F9223886B739538200899028BEA42469068 C3A.u
593,892,940 *3D07A3B5ABFB83F48244D56A769F20A8AE0BB42B C#;3b
593,892,941 *3D06E5A66FE0608D89EFF8DF067DD76F1CAD4AD4 c3b@963.net
593,892,942 *3D0B4D9B9383D97B452F32349AA38A5F70E59B1C C(3bE
593,892,943 *3D04A0C5199282A3B13B8AB52179F8B90D1B16ED C&3be
593,892,944 *3D04338B4489FCCAAA89A7C03CBC272E44E72EB6 C3B$n
593,892,945 *3D06D5C706F425AD2982A6CCEFC1C96EE4669ADA C?3C:
593,892,946 *3D0E304148FB084757876DAC6D646F655625AA32 c3c3l1a
593,892,947 *3D08982C769269D91B0C864485ACE8A119416006 C+3CF
593,892,948 *3D0D98253E908B78C74660ECCFF784EF1186128D C3CPQ
593,892,949 *3D08BC731757771D621E7C2E0D3B6BD67E913F0D C3CV&
593,892,950 *3D0B7806D47938471CBC54349D73D8574B440781 C!3/D
593,892,951 *3D04DB8CF7B74FC3A513E0A3FE7336C727B7CAA1 C3#"D
593,892,952 *3D04D0CF60B551AB95833346605A6C7A682F51D9 C3D#1
593,892,953 *3D0BB1D1292D9D01F184B38341F482FE52DDD486 c3d4r 3lm
593,892,954 *3D0DD8E37A8F37D02CC60AAD16F686571288D296 C3DAv
593,892,955 *3D06F683D680AB5E7939476D681AD7D67239EB5D C+3e=
593,892,956 *3D03DA81F22F84596FFC5EBEEE6319A0F2F28610 C3%)e
593,892,957 *3D0E175ED3AF17C6D200CE001C9F4734441A4F85 C3e2g
593,892,958 *3D07037C0089A03D2593CFB0D145A56A9C3A9A09 C=3EU
593,892,959 *3D0133430C7C69BA3BF7807E11792144243A5E00 C3&Eu
593,892,960 *3D0CFDBEBF0553DA6BAF74A93671EEA6AEA2335B C3/Ev
593,892,961 *3D0ED15B9E2A5B51B7263504A2F55DB653A25E99 C3
593,892,962 *3D0864925F21AC1EE5B8C6A373C3906AB3E2BDBF C-3(f
593,892,963 *3D0C36EEACCA1308AB2CCA57554048A6F947DE48 C3&f
593,892,964 *3D06E09C60ED10C5906D3C2377CF1626FF5C6559 C3F$7
593,892,965 *3D03FFB4020EF2D47EBDD1092B0A6A5F18CA1A3E C3FLH
593,892,966 *3D0F6B8D2A21A1D2970367AC9C5B5C3F59DD51F6 C3Fmo
593,892,967 *3D0C72C12DFBD4711578B9F540A797573F57C3E3 C3G/?
593,892,968 *3D06F49DAB6D251A31147A5194157E56B85890C1 C3G2b
593,892,969 *3D00986CDD72DF6DE36FFBD1A72A629140D9DBAF C3gMt
593,892,970 *3D0BAA8D064AA4B264E8EABCE4B6A495FD42617E C3gOt
593,892,971 *3D0E6AFB9F6A68F60D14616AE6933DADC2CAFC2E c3gumby@aol.com
593,892,972 *3D036374135C1FF41CB320E1FDDB6E4F7498ED42 C)3;h
593,892,973 *3D0BEFD94F6D7D55EC5215C1731054B10F13C5B4 C3ha9
593,892,974 *3D0F09B8D03FBC6F794BE164369D71100F125285 C3H_D
593,892,975 *3D00F1A7547E5A6DCFF1AC53C61F7A0DD7ABC8D0 C3HdR
593,892,976 *3D050C18C0AEB611EC88D1A94D9E60495FA041D5 C3hjs
593,892,977 *3D08C2EB70CA4A15F360A255BE21F946751D4E6D C(3hM
593,892,978 *3D0DEA3F7292EAECB7A6426B17509F644E324D38 C3H.O
593,892,979 *3D022AF7BA667B14DF2D876327AEDAB16F5C45E4 C3hs1
593,892,980 *3D0DFE0FC5FDD1675FA30313D827EB1A333C6E01 C3hTd
593,892,981 *3D09FB9298C170B50DFA2D69F7FD3E5D65C1ED37 C3?i_
593,892,982 *3D0287174EEE9DEF78F0FABEBF471DE5486F5948 C3"i
593,892,983 *3D0E891CC5D5B49891B63FD0940BCBE849E5629E C3iAo
593,892,984 *3D010D4C513D7DB11EAAAD319EABEA42B3674D91 C3iDI
593,892,985 *3D0690309D803BC13418BD27331DF8A27E5C8746 c3IF
593,892,986 *3D0DB552FF71D97FA04ADDDBC3048E33B97E0435 C3IKG
593,892,987 *3D0D097BF433CF075D45351597F02AF0379944E4 C$3IP
593,892,988 *3D03434B831BEA3384E48239A30FD60353FB3206 C3j)H
593,892,989 *3D096FD611BEA901C4FEC182F185AEB2277E1956 C3%jh
593,892,990 *3D0A9F37AB7EE06EBA26F34AD6E114E9571EAC47 C3"ji
593,892,991 *3D0E0A7F72DF3583FB40C2CDE80DD49158E25D0B C3jiB
593,892,992 *3D09C5DED955DB96046B4D326879C7ED09754CFD C3%jU
593,892,993 *3D0F68F76B6B455B58F47B470DE22AE12B91C3AD C3=jv
593,892,994 *3D0142C5062B1C5345E897ECD31FA6E2367FFD41 C&3k$
593,892,995 *3D0EB7C48E253C17ADEC73761B8E23E3E8229B7A C+3_k
593,892,996 *3D090822C7A1AA3CA2F2152A7859BC7AAA4F5966 C3=k=
593,892,997 *3D0B5BDAFCD9FEC71B97C083CE444CF2A54CB3E9 C3Kl)
593,892,998 *3D0A5D16D23B6FD81660B9C248C70D1B555ABCB5 C3Kvo
593,892,999 *3D0C77182AE5D515F6377F0AB817FA61DF9AD748 C3kWb
593,893,000 *3D06B28B130A4A3BF1CE42D352B5AC4C02DD49E6 C3/KZ
593,893,001 *3D0BEDAD1F405991369A2D51CF502D44FFBF40BA c3l1n3c3l1n
593,893,002 *3D01B78C598906591E6D8A50E2359B590CE8C557 c3l35t1t3
593,893,003 *3D0938B0B804D948816F49592958DEA8DC0A1A21 c3l3br4bisqu3
593,893,004 *3D0550E623ABA830132CA89294EEA922650EAED0 c3l4l4lt3
593,893,005 *3D0927ECBBAF6F121683E611B678138A3529E86B C3L9l
593,893,006 *3D002AECDE6CE881CC1ECED5850C7DCCF50D071D C3LM
593,893,007 *3D0F17E56236135461FF3EEC89C7C6487A66A740 C3lOj
593,893,008 *3D0304501359F955987A34F666A41C061F9205C4 C3lsa
593,893,009 *3D07C48ABD415CD33AC154F5037F8E81CAF46B22 C3LtB
593,893,010 *3D06C7B76BAE99F272C3D531AFBB0B1943E502A6 C3l:X
593,893,011 *3D0F4449E1C15353A2789471FEB545A3F277B851 C3LYg
593,893,012 *3D0C55C4BCA3A81B933D7F1FCF59A03DC3985C42 C3MEW
593,893,013 *3D057D78754C115C93D9B2039AD795661EDF5A8D C3M-s
593,893,014 *3D0B55D6914B63EF959ADAA046F54CCAA7034B32 C3n7im35
593,893,015 *3D0F25B2226228A5FFE62A3446E78A2AF957098A C3nfv
593,893,016 *3D088F0FE0A04AA3460E82C13B6EF99E5D44902B C3n.L
593,893,017 *3D023BC891D057A180F0B3EDBCD18D2BEE972389 c3nral1z1n9
593,893,018 *3D058C43FF2C49E200ED04B11B75513F87648D63 c3n+riscus
593,893,019 *3D0C44876A22CDC247797AADA7BC3B831BB0A61E C3ns3r b0
593,893,020 *3D06E999CFCF96794CB93B93129A409788980C29 C(3nu
593,893,021 *3D0F0B387A879F7F18BE768DE0541A29959F69A2 C3nUK
593,893,022 *3D0C55F4805E2BEC9BBA66FA2DCF765601E045A1 C)3;o
593,893,023 *3D0493BEE8028E89443D438C44E7F2E52B9961AF C3=o#
593,893,024 *3D0400720128A1020B2B8114FF77DE8D224C159A C3O+8
593,893,025 *3D0AD3D982A06A213B7E7B1234772C96E1687547 C3oCS
593,893,026 *3D0904720D09331FE599627183359EEAC7C8558A C3o.j
593,893,027 *3D0A6E431FC6B1D16F0D00CA9C339C83E4582842 C3oME
593,893,028 *3D0BEBD5B2A73A5D95DEC3EF0AC87D1EFEA6F5EF C3opw
593,893,029 *3D0C3355B2294B29CCE6647E6D7889930D2F2F6F C3OZZ
593,893,030 *3D01FFB2E0F5F54B3C6F8AF2E297AA5590CABEB6 C
593,893,031 *3D075D1DA838A97AC0330EC4F2DDFC9A22CF05E6 C3pbh
593,893,032 *3D006DBCC968ECF2B68F3758ED0A35B28212FA98 c3ph4l0t4c343
593,893,033 *3D02F46D13444549CB8B547EE1FBDE586A2BF1CE C3pmo
593,893,034 *3D03859DF50863C25E8A3CAA78AEB9046CFD21BA C3P+S
593,893,035 *3D06B0092C2589B4B06178050CE76FD2361D47C5 C3PSv
593,893,036 *3D0B208B57E113FF5944DDEB0F3B1A116FEBF515 C3q!
593,893,037 *3D0326CBE8060B84CEEFCAAB8CAAF0539E907BDB C$3qA
593,893,038 *3D06BFE6FE1DCD89169D20783E8FEB0AD1E736B6 C3qAr
593,893,039 *3D01FC895D4DB39D682A95EE40C9C65146982C44 C3qwP
593,893,040 *3D0644540C7122538C3E649F577AF87302D337F0 C_#3R
593,893,041 *3D041145C5CAF3C1309BA46590C86DD9D5F5D302 c3r05315
593,893,042 *3D06B6F1EEA9B4A9827DD42517838560249C5ED6 C3R3O
593,893,043 *3D0183FA15FE4ECCE49F606CF7FACE8866C83AA5 C3r7@!nn3ss
593,893,044 *3D06CBF0F9698A3F21AB404523727FAC82EAAD93 C%3r8
593,893,045 *3D08E5FFD327D0AE2D9821819A6D0F90DC6C7A83 C3r@m!c!5t5
593,893,046 *3D0081E2949DCE74D16D82F60E81E1DBCCBD1F4C c3rn3ntisqu3
593,893,047 *3D025E13CB30EBCCEF655323D3DA39964A03D63A C3rnj
593,893,048 *3D0581A720164C8DBBC9BDA6F43B75837801CCC6 C3RPr
593,893,049 *3D057E49A56DF98795158AA1EABD5F4B453B7683 C3!Rt
593,893,050 *3D0E7D5CB8D37679FAD41CFDCFF64C985DD2A2CE c3rt4b15
593,893,051 *3D03C454CF995CB7ACCC57BBA155DB27C948E281 C3r-W
593,893,052 *3D07FD41CDF43301095241F00026B7F9778F61F0 C&3SB
593,893,053 *3D0FEB290500AA712E1F13E8611FAD81B007D386 C3Sl)
593,893,054 *3D01A7449E1E4D48B06BD763CDD6D55F77CE8BE1 C3$T%
593,893,055 *3D0F7F18F284878EECA313564C196A18E85CD81A C3.t%
593,893,056 *3D03A4FF68344DFEA4E8DC02315E53CCD016DA22 c3t1hcr4
593,893,057 *3D090BFB5F9E3EF6694F5AE006C51E346B13B511 C3tlu
593,893,058 *3D0A281B0ECB391AECF7BC55EFBCD3AA7697483E C3T!v
593,893,059 *3D03011F2BDD3EB4A1F0CACC4AE1C107DC32F137 C3u7D
593,893,060 *3D0AA72545378E44A734941DC9C1CE7CECCE0D42 C3UII
593,893,061 *3D03F4AC686D2B259FE46A7593644D4BFC0CB9CB C3(Uw
593,893,062 *3D031EDAE5A6F3F97B7B29F9B3CB5F8AE48CA055 C3V&3
593,893,063 *3D038F22FF159D0C1BD24A230ECD300D7D2F6FAD C3Vr&
593,893,064 *3D098F23B701DD07BD918C225C653A3B85361349 C3vsY
593,893,065 *3D0364DB49AC98EB4B8CF85FC34D0DB94B0763FF C3vuY
593,893,066 *3D02A3C295BEA163548DB36113F6DC04CA1477A7 C3VY:
593,893,067 *3D0B45C89C989D085585A0A5401FEF5093C2C35E C?3W-
593,893,068 *3D077FBA872FB6DBFA6544043A2C69AA5F8611DA C&_3w
593,893,069 *3D03EEFF66D8B1BDA759C35FAAB2CB56C1855B24 C3w1
593,893,070 *3D0A6FBB34B799A9DA1C203525563851EBE0A204 c3Wj
593,893,071 *3D01D106E8524697F8102E7D60024E1152E81BE4 C3WPL
593,893,072 *3D0216FBF9D4736EB3E71CAA7806E1E5183F0F9A C=3+X
593,893,073 *3D03E086635CC9B5963385AB8C7916215471BC4C C3.YI
593,893,074 *3D02433D084B4F6738F94653A7F03486B5B1F865 C3Ync
593,893,075 *3D00530C866199BC30190A5E7BA3870D494F5CEF C3YTt
593,893,076 *3D0FE6A473EC8387BFBA99659FF06739C4926860 c3Zh
593,893,077 *3D08B178DC423EC85D1E2236AA67B529A62B9F52 c3zhfrqi
593,893,078 *3D0B7CB2A243F5DD99D908727A608F1F1066F766 C3/Zj
593,893,079 *3D062A34A47F521C91857AB9E59D58975106B12A c3との比較
593,893,080 *3D01194A2F837D51794E57E3209AABF99142AD4C C;;?4
593,893,081 *3D00517D62A5FE0C5F1D135B5C1512355C1CF087 C((4/
593,893,082 *3D021D6484FFE22B5A0F6B41D9DA6529D684B887 C&4"-
593,893,083 *3D000C4EE34767C82F0C0656E0EDA07981E40BC2 C+4;-
593,893,084 *3D074903AFC9D4A47858344EE370115520259EDD C4".=
593,893,085 *3D0B37116BFC191C968BFFC01E797B736B1561D3 C4
593,893,086 *3D0866BC2BD01BF80FE73F85A44A50FE84C1C63F C)40S
593,893,087 *3D0A2890F62BD3F556226E32B2635EF724985F28 C4110S1+Y
593,893,088 *3D07BA5C520E3812FCD0DCC76BA22D761448D74F $c413 r34
593,893,089 *3D055288A75B39FE80DF71000F86DBCB2CC0C11C C414BBAF
593,893,090 *3D0E931F847A1CAC3C056F4945EACB7B65125168 C414T
593,893,091 *3D02074BDE51A56F66B9E4AF6BF20FA576732857 c417900
593,893,092 *3D039300A012E4BE15F54446F51E4DF83FA5249C c41cemi4
593,893,093 *3D0299CAE02CD0BA197743204012D289E2993524 C41cu148!1!+!e$
593,893,094 *3D0CABEB5C9174AB60073581FA4D7D18F37D0E16 C4++1ER
593,893,095 *3D0BECF3C704EE0890CD917EF4183165E031E64B C41umni47i0n5
593,893,096 *3D0B26F99A4110FA2A1A16823472A724B0387DDF C4
593,893,097 *3D0F36E918A70D66B0AE3E2E0CA830A82A773557 C4,2b
593,893,098 *3D02B2E8C4E6BB7A135B075B63A7F7988077EE07 C42nX
593,893,099 *3D034E2DCD9844502F6AE1C2EA6304170C9217E3 C%43e
593,893,100 *3D06671AF8BD81FBBB67903A83A146DF3BFFF5B1 C43.G
593,893,101 *3D00689772EB485D630F23DD4CBACCF5D0487DE6 C.43X
593,893,102 *3D088E36A9A81B1436AC9EAEE4254FACEDA14503 C.44#
593,893,103 *3D0A7314303A8D3A8261BC8157D2E9D627AF640A C4#4a
593,893,104 *3D0B92A03A14462302664674BCBEFF978B589FFC C?44b
593,893,105 *3D0B682C9199A6572666FCC5EE228ED84EF669BE C4+4g0r13$
593,893,106 *3D02B3AA0D92B011BC7E27542F8B206401069EFC c4+4kinesis
593,893,107 *3D0C391C287E556697BC69F4021B9B55126F3E63 C44
593,893,108 *3D0C45CAA815EFC407F139F129974F72F18EB498 C
593,893,109 *3D06B3DBC7E4B607AB17DDD3A4EA93CC3FA07CF5 c4541@sinamail.com
593,893,110 *3D05D3019419BEB92003BCC85D69A50E60B33B66 C455j
593,893,111 *3D0DD33314F66D661718B19C232597B08B410298 C4571G47ORY
593,893,112 *3D0CE61B6983BC9E848146B1E351BFCCFAA011EA C458,
593,893,113 *3D03924349B3E222D9F5570891D739899BB66904 C46ok
593,893,114 *3D0E20DB9741EE94D33B98E65DA6F917A5B2BC79 C46qN
593,893,115 *3D0BAF14321BC937EF2460F6DC5FC6AB69CAE7CE C46T0
593,893,116 *3D0D1158E882C0002E33A428C2E38401AE298B7C C474b0l!z!n9
593,893,117 *3D07CC95550976022758BEC1455781F7ADB21EA1 C47aI
593,893,118 *3D01B9AFA212496D4920CBBCEA91A17257658DAF C47mX
593,893,119 *3D021460A82321E5F4391AFCDAB5AAAEDBEDB342 C4;7R
593,893,120 *3D047EEAF7021226AE3105995BFF975573535822 C4$8#
593,893,121 *3D09E6807554E1C0C94CD8F4B0C3ABCD1709665F C48574ND5
593,893,122 *3D073D1844D0F2FDAFF90E92361FC6E759E3639D C48c
593,893,123 *3D0A77EF93C0B98E26FC0E66D0FF378E3A3EA4EC C48WK
593,893,124 *3D005B3486631C93A043C1B1D393676B70390098 C/4&9
593,893,125 *3D08DDC48BCAE19659FA707CEB7F1E58CFB5FFBC C49CM
593,893,126 *3D01DA579F09452AB4EFFC7C663BA6E82CC884B2 C4A_=
593,893,127 *3D096333B8AE9EBE565B897462999A14A17FFFE2 C4a.
593,893,128 *3D037DE7F1EBFEBE3B9A660F7557481BB5A911BA C4AC"
593,893,129 *3D082E2D607ADC924EDCAD512DF8FDFAF8EB1D64 C4aD%
593,893,130 *3D0E50B54BB8AED2724BFD6C0D7739B09640BCFB C%4B"
593,893,131 *3D0F27C1218B15FBFD8FF4B0CEFBB05159A1A1DA C4b&1
593,893,132 *3D01AC261E294F5B2F9698A2963E849E908C1A43 c4b41771-a2df-3821-9e68-df6f13a7ef54
593,893,133 *3D0EA417E713CF6CB9DF2D79DB97FDF3D3381297 C4B9v
593,893,134 *3D0AEC6A4C66792D10879F7C7FE0DB3C92BB1220 C4BA"
593,893,135 *3D04C2B9518972D6446719DF0097A03AFD1CEA48 C4+BC
593,893,136 *3D0BA1FD5AC39DBCCC188B19244664AA02220020 c4bo4
593,893,137 *3D0A6136D07A4C51B1C3E0352347BC19DC255544 C"+4c
593,893,138 *3D07267D03A257B403A1C2AE48AD545175ED4D63 C4C)4
593,893,139 *3D046C4F3E2D004D4C30C717185CC2F7B090657B C4cg
593,893,140 *3D09FE7F5D86E3E9C1C220DEAB52B399FD53F1D8 C4CL2
593,893,141 *3D09AC0CC14DCD93F0D796905C1E36C5BCF62CCA C4CtO
593,893,142 *3D01546DE7D791EA59D99BB597FA4AFE5AE95EBF C4:D/
593,893,143 *3D0DC0B1AFEED0842452EBE236B16213B242AD82 c4d1nr4p1d
593,893,144 *3D0BAB0F01AADE16CF97EC022B58F5F41DC61BCF c4d1r4r4p1d
593,893,145 *3D02DD9BC89ACC5B5D632D5F6F82EACC821AB339 C4d3p
593,893,146 *3D0DCFEED1B800A862C3B1F3FEFE29837EF2F7BC C4Dcu
593,893,147 *3D01E9F614895C31557466B54218E1389BA05250 C$4DD
593,893,148 *3D09110BF6521D3EA8DAAAB604910E6C9348A2B9 C/4#E
593,893,149 *3D07C5E5F9797285733B815DDDFF50AF8BC58782 C4E,.
593,893,150 *3D0A4C85629968ADA96B6F7711ED3EA06B54EC57 C4e#.
593,893,151 *3D0A19055D836006624441AE8AE6D780359B5232 C4E01
593,893,152 *3D0B1C56BC5C64E16DB4DF3E787EABF6E97A0350 C4e3k
593,893,153 *3D068C752DA707AEDC72BF61D049E95283AD3817 C4eDC
593,893,154 *3D02207A4CA19BB0521EB76507450FB1652B75DE C4eoZ
593,893,155 *3D0BD5B6B903CBDB16A6222D6426424EAE48C199 C4er=
593,893,156 *3D061FF825F4C3C09456A66FDD10B0C0B95C7A02 C)4$f
593,893,157 *3D09DA5FB4454EF484422CE387BD9D3DD52B8BAD C4fo(
593,893,158 *3D0FE7D36E533D65F1F94D55F7F045FE2E9DEB28 C4fQ4
593,893,159 *3D03E134E8A642AFF7308BC96BBAD4D6F054D9BE C4%-G
593,893,160 *3D0B3C2255DD2A9A948EF99D845D318005440214 C4G?"
593,893,161 *3D0FACD79AFB7089E12ACEB94FC96DB9AF669CCA C(4Gd
593,893,162 *3D02D64D8357A2C550427F0183ADF8D47F098D7D c4gie7
593,893,163 *3D00393AD07675038FE332E2D91234E0E3069DB9 C4GnY
593,893,164 *3D02A80F62B2AAC81EC5EFDE81EF500681E21A6D C4Gq#
593,893,165 *3D025D250823196D16414761A23A825BDAE1EAAE C4GQ8
593,893,166 *3D095BDB2BB52C21A6E9C490C17692D174799961 C4gr=
593,893,167 *3D08825940E242740F85687D867D9C98100930B2 C4gVu
593,893,168 *3D0B0B16712749011100A0CC809B3FCDEC6F2CBE C.4h;
593,893,169 *3D05A1CB4B3AC398E63C07BFCAE24D5051FC4007 C4)!h
593,893,170 *3D0AF62CCEF1F8EC91CC31A0ED8B7795E51B1154 c4=h
593,893,171 *3D08A409AA0F7392B4A6AC86184C4F744290742E C4h%D
593,893,172 *3D024A8E94D7B8DF5E94BEEA9E3D14631D3A5176 C"4hd
593,893,173 *3D04A8A7569184EC1C90F1C566D8E1E8A8765464 C4hf!
593,893,174 *3D094121BD510E3A790DFC7B091A804EE92B0B75 C4HHP
593,893,175 *3D056CD544F39ACD0228D42942F5BCF19A7E2D0E C4HUa
593,893,176 *3D0407FCB096546A3B2E61B868CB10090A04525C C4INg
593,893,177 *3D0B9CD04599D206EABA0D61104AA9693D579CCC C4!_j
593,893,178 *3D0CF19D1E3037097728D6F543676A7986C7DB51 C4j32
593,893,179 *3D00DE278456E0DC822CB6917CD92F660DC4BC13 C4j/4
593,893,180 *3D080C77F52CD7A6BAD12F5737149971C363F210 C4jsL
593,893,181 *3D0FD739EBB5F33452666AC7346F8F7D8BC2F0C3 C%+4k
593,893,182 *3D05BF5776257E4F3DAC669C3689E15B4C10FDA1 C4K77CG8
593,893,183 *3D0752662268B44921BBD52B1F7BA92614A8D2BF C4kEi
593,893,184 *3D08F61FAA869E85A731C872FDFA7358010101B2 c4kx0oN
593,893,185 *3D0E670A37B7713EBF81E4405BBECE9149174796 C%,4L
593,893,186 *3D0F2448F7D93E631C14101E31BC9C9EC98CD1BC C4-$L
593,893,187 *3D02F77E9FFF244C62C51858126908979472A54D C4L1BR4T0RS
593,893,188 *3D081323F3975CE1D999807A29F1FAAA07CBAC7D c4l1mp0ng
593,893,189 *3D01DD248017F5570F34E369ABF3008C2E7B57AB c4l1nk4t
593,893,190 *3D0E80401D14DCE7145DA18C3FCDBD463147BDCB C4L3!
593,893,191 *3D0FB89AAEA0132BEEE99BAE3B2EF4A339E4E7DB C4L9G
593,893,192 *3D02A2C2C792C8228AE07FF41B6A7A050F3DE19A C4LIC03S
593,893,193 *3D0490C21534F5F9F9B03E5F400AD216725268CE C4LKC
593,893,194 *3D014AD4D0D6ECC68B1C79CEA1E691390D7D6595 C4LLO5!+!35
593,893,195 *3D0A5CD825C3A51F28A9E46C454645791E6A9B55 C4llou$3d
593,893,196 *3D04BD1EC8151ECF426C39F822555F578D528C22 C4,lQ
593,893,197 *3D0B9111C0E571E775BAA53EAB1080C350D584B1 C4lumn13$
593,893,198 *3D02FE5D6AFE304AA788752889BAB3177E4DD147 C4_m2
593,893,199 *3D09905193875A41F26923AA6A49AB51541F1E35 C4m7d
593,893,200 *3D039A71906657434CD1EA6D00BD4F6AED09B46A C4m)A
593,893,201 *3D01340BC0CE1FA6183F37BAE21C83FF751ABA4E C4MB
593,893,202 *3D0029DE9CFA1B32645A8AE2D0851441C99B7C9C c4mbr33d1n4m0
593,893,203 *3D0A33C2C35CD00DD1A476E2FC9E23A8FC491281 C+4mD
593,893,204 *3D054E0C8F3670EDB2A736A469EFE8DFEA68464D C4merling
593,893,205 *3D0316650060E8C5957882876372C8599739331B C4mjS
593,893,206 *3D0F36CA2A99BC1C4D09C97F8A7AB0283F26A605 C/4MK
593,893,207 *3D0D12C18C0D668C4070F872689242A1943AA200 C4MO9
593,893,208 *3D095B42AC36CA317DE7D40B0F803AC17FE5C2C9 c4mp4n01091ss
593,893,209 *3D0E4037BA0B5D4858847F2BC05B35A1EF522F8B C_4mS
593,893,210 *3D0E3BFD38E6249DA2656B9F81CFC0EE828BD001 C4M/X
593,893,211 *3D03D3AF715AE17F036BA99B99DF07E9E3B02B42 C4n==
593,893,212 *3D0D145E19510073BD1DFF883C654D38565E8C70 C4n?
593,893,213 *3D074DE877CD59DEE526EB9BD65C5FD34E767C65 C4n/0
593,893,214 *3D0419B74098374AE3E02FCAB95AEA7B9DB2D74A c4n54r31
593,893,215 *3D0D3C0AE04209B62EC47EE4C44D01D479FD963B c4nc3r4rs3
593,893,216 *3D0BE4519F1AB4A6356C5F2E80F38E588A2677CB C4nd?
593,893,217 *3D00F56ED697329FBAA45E0761721D14C1C02965 C4:Ng
593,893,218 *3D0B05DA0DC9F1A96EF34C39071FE17FF39DD517 C4NlG
593,893,219 *3D03C3351B85C497B6ED911E331DE67FDB6D9BB1 c4nnon me
593,893,220 *3D0967C9D7AB8368471A052B95C1D08B03D9C022 C4NQT
593,893,221 *3D0AC8AB1380314DB523EA3CDECED0F79C51DC55 c4nt4rol4r3is
593,893,222 *3D03A1206249AC93D23E760835447A0D90A9D4F0 C4nv4sets
593,893,223 *3D0147D6C2B07E7165324F1F4AAC2B17E9EA4938 C4?nX
593,893,224 *3D00634A91DE6265CF4918869AEE87108EFDB623 C4nY2
593,893,225 *3D0215D686507155741500ECE1713E6BF722E57F C4O?9
593,893,226 *3D0A08F5D47B4166119094C945EF653EF353B1EB C4oq?
593,893,227 *3D0F1EBF8EBD8FDAB6F7B43DA3D5332F3A25E1A9 C,4P=
593,893,228 *3D0CE8A38B7D07CD5D592C5653A34DBACC6A1E68 C4$%P
593,893,229 *3D048FF6CC775C3ACAFE0C528C4CE37FE1C360AB C4p1+4l1z4+10n
593,893,230 *3D07BEB4DB4D2B379D1219B7DE763C21376EDD28 C4p4ci0u$n3$$
593,893,231 *3D094A02D965DF520070F4440F704AEDD362BE83 C4PAI
593,893,232 *3D019B35CA3116DB24AC560D8C6E243C7E864A81 C4p(M
593,893,233 *3D0D5BED6C1D0FFB6373495FEB766DCC28F8C28B c4porsche@aol.com
593,893,234 *3D07E38847A24982C04F493E9AC8809CBB2361F0 C4Q==
593,893,235 *3D0728BB585D55582EA4473F9BAAD16AC5BCD66B C,4q+
593,893,236 *3D0DE74D27BF6BF309557E3580DD09A9134A3D68 C:4qe
593,893,237 *3D03344E6DA5810B6BC10AF60C64975E41C97635 C4qej
593,893,238 *3D0A2B103596128A9E200DB3A0DA9E2BC1D767D9 C4qXo
593,893,239 *3D0DEE2D65FE6AEA4E26F7ABBB622EE148CCA572 c4r4mb0lm05
593,893,240 *3D0EC0B34CC0A789F0F0C4D149BBBFDEDFE60ADB C4r74ble
593,893,241 *3D04D173C6BFA86409D2FE69FE24A40A6760A431 C4R80N4+E5
593,893,242 *3D0AE9E5C3ABE26CABC4B18A1F7C90521E602E1E C4rbo$ili
593,893,243 *3D0303F6E104EECC058E4D4DEED0A7D85B67BA5D C4RD!OLO9!3S
593,893,244 *3D038281160F190E6E345DB5AD33D1495582B772 c4rimbloi4s
593,893,245 *3D0E7F131BB9A1A65D604828550E52F3E5240801 C4rl$on
593,893,246 *3D0FE957E3E3996A5EE849CE877AD160652CA5F1 C4rpet84g$
593,893,247 *3D03AF7FFF7BAFD02F6CD06512A01E9433A8278F C4R,q
593,893,248 *3D042E10E4AE791168AA830EC166180660D66A3C C4RrW
593,893,249 *3D0887FA66D4703635EFEA729406DBDF99789DF9 C4R%T
593,893,250 *3D05C23290148CE5A11B187010D77408A2FCECBB C4RT4GES
593,893,251 *3D04CD2F6419A2BA1EF4F9D1D4CA2C0FE760F870 c4rton4ndo
593,893,252 *3D0076AB73534680FA660452515953FE955012F3 c4runcul4t3d
593,893,253 *3D0995913FD61BC826722651A3800438F5CC704E C4#$S
593,893,254 *3D023B3C12D897E57574902185DFAA1527DA7F73 C4:s(
593,893,255 *3D0ED5CB5F51F3B2B069ED728CF949F6F49E2647 C(4s0
593,893,256 *3D0FCF649F9CE5CD2D16F56B36307945FA7984DB c4s3fy
593,893,257 *3D0E3E653FD06AA0EA6E1FD6AE40E89FD1578CB8 C4SE2
593,893,258 *3D0973ABDB731042962640E4C3E166E113D427A2 C4SHH
593,893,259 *3D098679ECD1991DC0E89711ABB20F3C46401E8F C4sp4ri4n
593,893,260 *3D053C928A609C6CE2ACD81129750734A29FD969 C4sPs
593,893,261 *3D0E6F559ADCFA61CED76E33624B5B5C9D9624C1 c4ss3tt4
593,893,262 *3D04BEFFC218438AAA8E9374A88B2EA313F86E8D C4=SV
593,893,263 *3D0C4BE836B899FE5897F402C9E90FEFB2C74041 C%4&t
593,893,264 *3D08A565ABB7B1472E2C2347E999BF5F5105D6A4 C4=(t
593,893,265 *3D049449E4DAC347CB456CE027E24B88463C6D66 C4T4L3P$I3$
593,893,266 *3D09697554612CD06A62AEE306A24CB394BD051F C4t4lep$!e$
593,893,267 *3D07FD21E97D321FB76711C8E21A56BFC596E9DD C4T5%
593,893,268 *3D0DD99B9956648B055F6FD4FA6262C03B0DC05F C4t:H
593,893,269 *3D05EC684A3B2C23453EECEB4961784E321B5269 C(4tv
593,893,270 *3D07341AD68D48A027BD6150B61FCDDB79D82C18 C4u-?
593,893,271 *3D05997F6FD41938E737B4B53F30F80530FDEBAD C4u5+1c1+y
593,893,272 *3D0AC87AD393272F16854A96338EE2E422DA7679 C4uRg
593,893,273 *3D05613B2D62CDC0C2A7FEF56DC9D588F9F9BC41 C4u!V
593,893,274 *3D0FE43EA060661A50D5E2D74A5CDD6F9FFE46BA C("4v
593,893,275 *3D0A4C4B4EA898CE3DBA4D1A96F6A382765C4692 C4V4i
593,893,276 *3D03E147D33A42B3543DC4881F933F0764B3ED83 C4VD+
593,893,277 *3D06FE8B1A250B5FA99B9F33C4069B2A105067BF C4v=g
593,893,278 *3D0463BD4EA3AC29554D9E78C65024EE9BECEE90 C4vHE
593,893,279 *3D08CC1A3425AD94D1712302F0A77E01247C883A C#;4W
593,893,280 *3D0A997F08A23052266FF2AE8E40E3DA856EC5DD C4-,W
593,893,281 *3D05B989D184445C4BECE6973DB4A450DD77C98D C4W/e
593,893,282 *3D095A55A48C2897FAD76A01CCAB968F3B1FE967 C4WIs
593,893,283 *3D0F767ECB2C842525B6F100939DBB3012261FCC C4Wlt
593,893,284 *3D0D96883BB368DF1E07E451733288AEC309CCCF C4Wpc
593,893,285 *3D06EDD9D80103003EC353CA8CAA663F0287818B C4wY.
593,893,286 *3D0A4BAAA9476560AC0EA331411C1B561040C301 C4Xgs
593,893,287 *3D02A812DF647603BF6DB47C82D83D10F8B90C91 C4"XM
593,893,288 *3D023D0E7701C18ABDBEC9EC10D3E7742B8BBB1B C4XX3
593,893,289 *3D0044674CB1877181C3DAEDC0F8ADC9728B7A70 C4Y/e
593,893,290 *3D0E83740EF5116D2D2A74FC5AB0E535817897C4 C4Ymv
593,893,291 *3D0C628DB89F058014E6B07748B6E28A2E037DC0 C&4$Z
593,893,292 *3D0A472254B350D0E481DBA5B3539D41271D0024 C4#&Z
593,893,293 *3D049ED2FD7261F24E832C4E753BDF9B7108A1D7 C4Z=$
593,893,294 *3D082C4B6EC74EAA307C3EB19B1D42B989E08D50 C#4Zq
593,893,295 *3D07DA07A28C79430CC043AB66B475BA6BC21E91 C4)ZY
593,893,296 *3D06AAA25BBC60826A0774F6D08CB016050B5875 C-_5%
593,893,297 *3D0A56F6C088AD210779C2512C27DCB162A4A118 C)=5(
593,893,298 *3D004378136999F7BA967A340B5329DEF98D9CCD C5)-%
593,893,299 *3D051996038515D8269F51560F52EF0131684A72 C5%_#
593,893,300 *3D09FA4A71B1051D6A8A0AC05E774B809E9A3668 c)%5
593,893,301 *3D09F5AAB3E67B0608AFE17666F7D8332BBC2382 c5,~
593,893,302 *3D00705794974402CFEA848E8E618286938D6041 C5.0-
593,893,303 *3D0CBEEC8A66BD5F265430C1695ACF903EA978FE C&503
593,893,304 *3D0FADA38BD717770B316D4E25F01870FCDBB707 C509d
593,893,305 *3D08BDB4E8A1F2B8FAA30843422A871DE3A8297F C50aq
593,893,306 *3D0AF52CADB83CFE86BE09302374DC22C4573B34 C50f$
593,893,307 *3D0E6EDE0EFB10CE6F798F0B3B2A57E8E6DE9D7D C50i"
593,893,308 *3D0ECF132B05A1B0D04948AFD46CD2EBFB892BF3 c50oyamago
593,893,309 *3D0D43D7E8018BDCC9A51C8A523D2A648E851E9F c50R
593,893,310 *3D0FE97D9682E6D6ACC627823078E0CBFF37CB18 C50
593,893,311 *3D014C06639C42A3FF6074B4A7D291D910ABD60B C51$1
593,893,312 *3D0B95A2D26AB5D3D3F7AF1F3D37660A204FA8E1 C5+1e
593,893,313 *3D0CAED505B25917AAC0B2B814E0A5D5F10BE70D C52NY
593,893,314 *3D0554F6DC073DDAE43DB100E78782AE4D790017 C52P%
593,893,315 *3D0E0AD5CF502C091E6E4A45C938931B99FD9F52 C52RI
593,893,316 *3D0160E9D8CA6477A4CEE072061429CE7A978A0E C52X,
593,893,317 *3D07C09A563C0BB5E871870BD5E1C791CC407EDC C53oQ
593,893,318 *3D0807523FCCB7A70F95FD7F19A5CB1E0DB408CE C!5+3RN@L
593,893,319 *3D0E4E62555CF5D479015F6CCED34D214D6B401D C5;:4
593,893,320 *3D0D143E38D8B8F0A7176F97C9FBB1BF8D31511C c547b
593,893,321 *3D082930F6FDCE661EEB1E909A757CAF04B2EAC4 C"55.
593,893,322 *3D0E3F59E38CBB562BF334E156E266396B0F6280 c556699
593,893,323 *3D084FB0A5320290EBACA94FA913BC272C0028C1 C55iR
593,893,324 *3D0170E05D442E4E137E34ABCF89AACEE344306F C&5-6
593,893,325 *3D09D7512B395FE0C20C6163D84523BBD434EEC3 C5?6_
593,893,326 *3D083B6542092C54BD271B1ED447F295F74DCF7D C568k
593,893,327 *3D0D57823F42F053B83E6B73A2F514D650DC383A C)56R
593,893,328 *3D048AC135B743B881CACB60D983EEE22C956544 C!.57
593,893,329 *3D04CD2545D05B6E27B8185A55669028989098D4 C$.57
593,893,330 *3D04FD3B3731B0BFD2FDEF68DE8E0EB06C5382DA C5$:7
593,893,331 *3D0205D1D6EFC9B00914E43F03267309040CCA7E C5+/7
593,893,332 *3D09B4DC6738A4C963336F512AA4DB47AB4FC8C9 C57484245
593,893,333 *3D07270E96D170ECDE907D86834BB85CB1488399 c57705
593,893,334 *3D0202E2755B03239368D3530C3D3AB92576E41B C57I-
593,893,335 *3D0BFF5C2828A74955DD1801FD7E880396046BAC C5%8,
593,893,336 *3D0B9F3227F7D1D417736DB8DE9A4B3952ED2631 C5$8E
593,893,337 *3D0F3C38B30C130758F382C7E97B128C67116F60 C597q
593,893,338 *3D007B6F385C2648FEAAC1017A1AA08DECF8B593 C5_9r
593,893,339 *3D0E3BD6D0B185694CBDDFB97270749EE096D87B C5a)#
593,893,340 *3D05F33887AB3415B1892814B59A0EA70641945D C5A82
593,893,341 *3D0DB60993E0B631A0AC37CD148B9AAD615C05B7 C5ABj
593,893,342 *3D0333078DD03583FAB35EA9D8EEB1DB330B6640 C5,aH
593,893,343 *3D08198645999BA0EF684A0191CFA8962388ACEC C5A?n
593,893,344 *3D0386E118AEFCA0E6A75C23A77B88C2784991D3 C5AtC
593,893,345 *3D05EEAE8441D4E4D9AE2EB00A692C99560115EC C5atl
593,893,346 *3D04044B33F695F23916DD9A6CF203975F7B411B C5=Aw
593,893,347 *3D0335A3457A1668FF27461337699DF459ED1AC0 C5%b"
593,893,348 *3D01D76E7599E2036173780EDB29286A83A6380B C5bin
593,893,349 *3D0D1427178E1A7A4F62177A7169D291FA8BEF00 C.(5C
593,893,350 *3D0F5CC2F6A1FD3D5C2F212827F58FA9A93CB402 C5%
593,893,351 *3D04819A2913C9792E924C49B4743E8897350461 C5CFt
593,893,352 *3D031C12821F0BCC3CE6246D36CDA2AD161805E7 C5cHZ
593,893,353 *3D078B80511D49E2944079513D31F2E557EB7013 C+5CL
593,893,354 *3D0E932836DA534B859A28D8971826783042D187 C5cuc
593,893,355 *3D0C9E116B86F9515B298CE95DFCD455CF723089 C5D%9
593,893,356 *3D0E11CF1D14EF26A4859E3D152C6D471414FF6F c5d9f1
593,893,357 *3D0BB0156693C4EA74767439D86134DD97FBDB09 C5DBq
593,893,358 *3D069FBA70724DD3BF93F435EFFF40E8304F09B5 C5d/L
593,893,359 *3D06B254F248EE2547CCBEA4260CF9B0B720A3A9 C5Dlr
593,893,360 *3D0509DD3EB5717F44D867D8B90AB705DEEFEB84 C5DmH
593,893,361 *3D02854412719620DABBC9E80A83C89A7E87EF8E C5DMQ
593,893,362 *3D0A3D285C9BB11073C21055A1849FC6F0FC787F C5ds
593,893,363 *3D01B6015AC50BA2CA96C50511CD371FC88475E9 C$:5e
593,893,364 *3D0202BE8BDA7C2A001EAB35A424780835587994 C5e.+
593,893,365 *3D040E67BAA9448C19639F335A8935D64D5FDC8C c5ef
593,893,366 *3D07C1CA15389C609FEFA1A951FBA9E5DBCF833F C!5eI
593,893,367 *3D0FF8C75F8488455BCCF08C2167465C2AA0478E C5eY-
593,893,368 *3D077925E1B2F25601273D3BB39A5511189FBACC C=5:f
593,893,369 *3D06B2F49BA650C22B90D169DC8E350DB72150CD C5f4u
593,893,370 *3D04EADE1445C7BC5CA2722BD354050678781364 C5?g_
593,893,371 *3D02FF17F2C9666786E0254A63FC9E74CCC2B4BC C5?G4
593,893,372 *3D0434AB4C4174B0E23BEB1FE871F73E5D2D35E7 C5GB1
593,893,373 *3D0A0714E181A0FBD85BCAE032FF58F2A03DCD00 C5,gN
593,893,374 *3D0D7BA97BE074B5D28503F02F04DC3EED960025 C5GVQROGFUWNHTJ
593,893,375 *3D02C5DE647BAFDFED199CFBB18D85F55790A14A C5gW/
593,893,376 *3D08CFC13D514CC110A25C6A7C5ED1E284ABDE6F C,,5H
593,893,377 *3D0AEEAA2E3EA8738F0AB6477601FEBC2C690442 C5h?"
593,893,378 *3D0464AD86FC29FB2E708A103C4B3F35EE40CFD5 C5HBP
593,893,379 *3D0AE6411ABDDC4A652F007F274A5D86D43B6B9F C5(hF
593,893,380 *3D0321EB5B270BC4D8A46BC1B6EAC30BC116DCD6 C5,Hi
593,893,381 *3D0DD84546A5323F5DB02FB0663D0ACBAE87243B C
593,893,382 *3D013C11463B340F248C167D5755C6E6DC43D011 C5Hn)
593,893,383 *3D0F96F5099069456D162AA20CE7F4885AF6BB1D C5H,Q
593,893,384 *3D02BEC3A2F0452C70A1EBBB8B607B7D96ED5E33 C_
593,893,385 *3D028CFD3669E6A6394225F9B3FBBBBF4191121C C,5i$
593,893,386 *3D014CBF7D31802E1C3DAF5821B2215AF44C2DD3 C5iKT
593,893,387 *3D0620BD90B6DFDE6F379923947D9341D27E5AA1 C5iPN
593,893,388 *3D05A5F7FAECCA563711A0EBEEBBCACC69EF3355 C/5:j
593,893,389 *3D04920367CA996968288A85C3612FA56EC1FA9A C5j#A
593,893,390 *3D016411736FC59F388F88E6970658DB3B8E0951 C#5jF
593,893,391 *3D0A8ECDC15E707DC6B1524E998484230F9001FC C5j/g
593,893,392 *3D04460A31D8C95C059464413EEB11AEC5748057 C5k1:
593,893,393 *3D0C34FC60223666D962A2DB1010AA3791AC0B16 C$5KO
593,893,394 *3D06074E68B72FF5D442DCF86348F33025D05224 C5kSg
593,893,395 *3D06DE1E30433AA450E3F6AB89D82E2855352B9C C5kST
593,893,396 *3D0B35D9E88A30772F5DBEB0D73B2FAC1ED4D9F4 C,5Ku
593,893,397 *3D04CFE22471C56509FF2E2B8CE3AC1F58EFD3BD C5:l/
593,893,398 *3D025F068AFFC475052CBE21140008F0F0C2CA6F C?5lb
593,893,399 *3D07A4DBD6B1FF80B1F1CD29789D3E843D2D1C52 C5LcP
593,893,400 *3D0F59DD4C472307F2624969FB6352D4E854F44F C5LD/
593,893,401 *3D032BB99DE9729BA45484470DC46360A2EB9D3C C5lLG
593,893,402 *3D0AFA11740C31332FE6BD68AE34601F8D18487D C5L/O
593,893,403 *3D0715D625A5B984C4C95017761832DAE53B740D C;5lP
593,893,404 *3D0BAEB9CD54DB5A9B478EB484BC377851C9FE65 C=+5M
593,893,405 *3D0BECA9CE62CE497E58669AE08E24C4B9F1D7AC C?5:M
593,893,406 *3D0569504BBA5F7C4DA069A3798E171D1CF76C85 C5+&M
593,893,407 *3D0B42B211D8E88CCA6F6201A3CB1E1E37FE077D C5M!,
593,893,408 *3D085737E02EC5787044B02C79C76FA0BC1C5D93 C5M1h
593,893,409 *3D0FE530229090F5837BA6DC2D6C41E7D7ED555C C5M6!
593,893,410 *3D085FE584535E06746E247BBEBE55697E313F47 C5MG$
593,893,411 *3D05A05EA0486AA6140BA7B010296EB88F5C31EC C5Mr&
593,893,412 *3D0B753F192C3DB11A21B3B9B9C1777260294C8E C-5MV
593,893,413 *3D0F4FA47D54CA7BD7F1F1A1EF1AD5451CD861B0 C5/N
593,893,414 *3D04A55EC1012836B75C5B0EBF4A6162880729BF C5$_N
593,893,415 *3D0CDC6201FAA532A3529FCE04A6671EBC2DEFE7 C5%"N
593,893,416 *3D065E62AC49421DFF6F0183D2E084D2B98B7CEC C5NK,
593,893,417 *3D07EFF986167B437F05332380DADAFD516D653C C5:-O
593,893,418 *3D09E2563D0BFD51A84676080CA08F36802EAC02 C5_o;
593,893,419 *3D01E3FD9DCD8370D5CA57B3C74D37F4944E9A39 C5ojb
593,893,420 *3D025C07DD35C3D35FE63C3C6D9ED6D69F0CFFB7 C:5On
593,893,421 *3D0E49D78244F814125CC75EEF2FB1080FBCCCBB C5O/u
593,893,422 *3D026ED4E3385965B679246BEC0CA959EDB1E803 C#5ou
593,893,423 *3D06DAB00A6D5C2FA6BBBB1A4E7FBB49F504E4B8 C5O=w
593,893,424 *3D01EFDFEFEA3007B3E44940AC9DC728A338CCF9 C"5P,
593,893,425 *3D0E99540D8834B0172E1857E8265D56B09BFCDA C5pIv
593,893,426 *3D08C51782BF15DA7B3C2CAB94710A37F28C050C C5PU)
593,893,427 *3D096738F5B5F510281DF5704F534C56629AB9C8 C5pXN
593,893,428 *3D0FC35844B03FCD4A66E1F00C0C0DE2D6905494 C=5&Q
593,893,429 *3D0C4A03688D8FE36AE98511B9AACB185236489A C5=q-
593,893,430 *3D0E106F80ED29209A369AE0D5EEBBCF83500508 C:5Qf
593,893,431 *3D0959B032C702108C85FF64F8D8CE6368B5F0C0 C5Qfm
593,893,432 *3D0C68E724DAA88D238F5856ECEDB7DE3E3A0D05 C5Q_H
593,893,433 *3D08586AEFA7CEED5C937892D661BD969789C4E8 C5QH2
593,893,434 *3D0E62A8E478989BA97EECE756ACAC2F0837CA5D C
593,893,435 *3D015DA6194FF2D799D933CC0DC3BAB2750BAB67 C5QYd
593,893,436 *3D001DA05E717E9F3260D70C57D9F31465CCB349 C5!R=
593,893,437 *3D08E4ECE9EDB2A4EAD20FD288AB088F2FC6F036 <C5<r
593,893,438 *3D0797FA6617D4BBF7E1F0BA41265FAB064292E6 C#
593,893,439 *3D020AFD9B048199E32351F2761FEFB3F551BBA0 C5r".
593,893,440 *3D041BC663E6F2086EBBC82EF31972B0F3686218 C5&RY
593,893,441 *3D015BE30EA92D7A4554D491A0129F48DF87D66B C5(S
593,893,442 *3D004E3702FBAA903926E5C86306D2C55AE71220 C"-5s
593,893,443 *3D05428B9616F42E0A545F3D0B6CEDCF3D742687 C5%S2
593,893,444 *3D06D5E95A3D842A2F5C27AD0B81D75E946170FB C5shE
593,893,445 *3D0193C698EC16F8F10A64BA5D80B2E7E64F5AFE C5_sl
593,893,446 *3D00D35BFFF5D0AA3921143ADA2EFEBF866B8FED C&5Sq
593,893,447 *3D07FD9CE3A3E6B0B50EDA40D2A51D6F10357C0B C;5T$
593,893,448 *3D08593E4A21C0954BB5368F5549BEF633AFEF90 C5"T:
593,893,449 *3D02D8085C751126BE4974B6FB37C2455519A5D6 C)5t
593,893,450 *3D0CA8A990AC14BB85871A017BD791F8670330AC C5T(0
593,893,451 *3D05B641ECB2F62A083C1FE6A0C87BA4E8F4BC19 C5t9w
593,893,452 *3D0110DBD4C38FA446EA79264F8B7B02CA5A7240 C=5TC
593,893,453 *3D0FD04BD7070C61AC9A69C09BEC4D4ECFA24D25 C5:TH
593,893,454 *3D05B247120A1384EF72516CAF91DB2E1EC0BA32 C5tr,
593,893,455 *3D07E5C5962E1199BAC96213A8E5BA795117DD35 C5#TX
593,893,456 *3D010B1D1800A9AD2D6E222C01C2F519369DFB11 C!_5U
593,893,457 *3D0D97BC7BB97E8B959C88CFD1C65D5E22874E34 C_5u?
593,893,458 *3D0C4C03A056D725F1C28EE8118AE3C43E43CF88 C5!u:
593,893,459 *3D073720228B8D6909191811D455AB5E37D98AE7 C5-
593,893,460 *3D0E22FE07036F356EE6001D3BEFD6B8A7C6CA54 C5V0;
593,893,461 *3D0A971F142A074B4F6B5571283F9D4F45742D01 C5Vet
593,893,462 *3D04C54FD81BB6B7FF21C676A1B8A3F59936F846 C5/)W
593,893,463 *3D06C746AF3479CEC3F29334C24B3187E0BC9572 C5W4g
593,893,464 *3D09009B0BEF25DAA9B36D2D6C895D435042CAC1 C5W$6
593,893,465 *3D0797D22632A37821816F2D9F0A747326C82A0A C5WGK
593,893,466 *3D0A96E3F446D87E17A408DCC014B76DCD27B86C C5W-P
593,893,467 *3D04167B11613B77FAF7747891E669F8518C9894 C5WQK
593,893,468 *3D08EC9754123279D466E4CA351B52B0F01BD169 C5XH2
593,893,469 *3D0D0B9A7A4D50A04DE55588A3264459AAAF21F4 C5Yvg
593,893,470 *3D0FF90D940E2C5CCBA8BB1632591357304E13EA C(-5Z
593,893,471 *3D049B4471D2FAB1735B5693D5696CDFD64EB8AD C5/Z#
593,893,472 *3D03B1B7069A001FBC5B71573AC5A17F7C2D23C7 C5ZwB
593,893,473 *3D019D560DD7F29CB0453451DA9B25F5BC19C839 C?6_.
593,893,474 *3D0FA6B87CC1F814A7C39C771DAFF585DD4063BE C"/"6
593,893,475 *3D051E5D850C698FDA594ED92F9282A243088B13 C(&6
593,893,476 *3D069CAEAE09C2AFFC4F13CF3AA73A0F0D10758A C))6?
593,893,477 *3D0FA844495389CA4E999D2A78E1D85604E5A81A C#6;+
593,893,478 *3D0692B444A4F93A86F0E95E68235CDFC0E4203F C%6"_
593,893,479 *3D0AB00F737205B77730D4C2375775917A73A317 C6=,$
593,893,480 *3D0F6D0457006CA6E0EBF4D946725B94B87B03EA C6-;,
593,893,481 *3D0FC5E1E212EE73D37F91543CE2B9E028E0AAC0 C6?%:
593,893,482 *3D017CFBE7F1C6DA0A67190516443898AD007C8D c.[6
593,893,483 *3D03489A64C49FDB102A1208B2251997EB27E8A1 C60;/
593,893,484 *3D06E7A4DED1DD9732E4DEC005EF3357F4EA33D1 c600–24
593,893,485 *3D04CD333BAA7831EF3521C09C29F71CE3588F3C c60043
593,893,486 *3D0020AD7ACA00E44E6EDC2B6673465D18F6F31C C60Mw
593,893,487 *3D051C68FA53507E004FA310794A8D409FFB7A46 C6:0Q
593,893,488 *3D02896D90ED6FBFEE1B8D482EAFBA6DC5F10CB7 C?612
593,893,489 *3D0D660F159E20D61F110D6BDD1F6B1BD95133F7 c6189
593,893,490 *3D07778AC8B1ED8686EFC6D2768A77B05F95D2E9 C%61F
593,893,491 *3D04960B5F3BF3249D94973D3CB524190E69C880 C61#K
593,893,492 *3D0F2E3B5EF2DECC477D5090B1615B48ACE9B210 c62172
593,893,493 *3D09A48F2B3A3D6EEC8ACE7408ED994553910609 C#62X
593,893,494 *3D00B6EE039FC28F86BFC5363AE2D77B3281C0FE C63B$
593,893,495 *3D0AC0F3FC6BB31F236162964CA0D4CF4385CEB5 C6464
593,893,496 *3D0E7A458C0C582CA2A4332E02897CCD60B7EC01 c647245f-20b2-3f2b-99c5-a75faca03675
593,893,497 *3D025497D3EB94E007BF21F852F87EF31E25BB58 C6+4I
593,893,498 *3D0979C28E332F15BC1633527426D0221231EDFD C64nf
593,893,499 *3D0110B2002860BA05C0C918C6B0222C8038C65C C6.5:
593,893,500 *3D0B4CD71E7CC8FB571A07B0C6445D13C8FFCF21 C6);5
593,893,501 *3D0BE60A9B3C1BF68C4AEF0269C7CB79721759C7 c6%5
593,893,502 *3D0AB11AE01BDCC64D44C96A4BE884A780C75554 C65aF
593,893,503 *3D0E0CE5023A063A6638F4D34E3ACFB520B40B07 C65
593,893,504 *3D0E83A517AB7D453EE9B027603F7682F353A60C C67&2
593,893,505 *3D03A7C13755D06223624018DD6EE8917B23DF63 c67714542
593,893,506 *3D0A9F6B60E6C413E40271B2DCBB977BBECB5EE5 c67927
593,893,507 *3D0B0B17C2E8022493C9DE518EF21FB38DACDE0C C67II
593,893,508 *3D0D59444BFACE4013F90B4519DA234C39B341D5 C67S=
593,893,509 *3D05D01F99BFDADE2BA18EBFBFF9B1B9674FDC62 C6_
593,893,510 *3D00FB0AE8F061B3DEBEEFE1CD40586B3E30A00D c68518
593,893,511 *3D032FE7E440603BC07DBF1A2B1037168BCA53B7 C68Gt
593,893,512 *3D0BFB6A9269B6B642C770744AA14FDD5B101337 C68vb
593,893,513 *3D02506AC195088B1CBC269914ECB488C53DF7E7 C6
593,893,514 *3D095C7ED42EE90B20BDBF83B4E390B58CD30B67 C_:6A
593,893,515 *3D0D203909E64EACE77FBD4E6A52A043153E819A C6A8C
593,893,516 *3D0B29032F1D5D9022A447A77D7731776F911E52 C6a99
593,893,517 *3D01A8C7F741C2D603C4EC6ECF7120D54335A29C C6B(?
593,893,518 *3D0A27721DC3685D4CEF00E29F5BDEDF6E70014D C6B?T
593,893,519 *3D02CD088283FE42394F654596161A8B43CFB244 C6B-U
593,893,520 *3D0F8B238FE741921EB54FF0BF0FCA787092F29D C6-cj
593,893,521 *3D00251D82BD72EDC1895C5E59B79398E0B52373 c6co
593,893,522 *3D0B75BB0268F1EF15F20043FE136CEAEFDC4BE5 C6CZe
593,893,523 *3D01F914FCCAA754C3E1836AAA4BE55F18E100E9 c{6D
593,893,524 *3D0E5B228BC1C8180C2782238A0BA9FB96A2892C C6D1W
593,893,525 *3D0DF8497185E70764B0B38A42D45068FE0BF90D C6DK#
593,893,526 *3D0949320E125A4AFCF1E7BD185361116BCB976F C6DXE
593,893,527 *3D0F9C6CA5B06F3F9827D77F6C55BAC2249851A9 C"6&e
593,893,528 *3D0D709D8D99C29013A86E8716971A2853DC603D C&6e%
593,893,529 *3D0E6A9C91E513B937D1A8F99BD3900373D4FA9B C6e)1
593,893,530 *3D095046352AB42F5F83F0FFEE421FCCD81B9568 c6e9b7
593,893,531 *3D09D2BC56E73D87A35E5C350001F791ED802D31 C6fk0
593,893,532 *3D0C032E2BCB6B3D2E4045E5AFA49DD9CB6025D2 C_6fM
593,893,533 *3D04ED90E47C7A9BFCA78AA2FB6628E8D1669DFD C6FnU
593,893,534 *3D0C223663D5956D91CF71A7D98D6CF308511A60 C=6
593,893,535 *3D0A1A5F2F79B4459D3DDD72A605B8B6D7FD3FF8 C"6g,
593,893,536 *3D06991FEE521DE723F714163D9A4431313E199D C6G6p
593,893,537 *3D02EDC98664C1C639752C45F3D55EB5563D3E1F C6gA9
593,893,538 *3D0DAE98A0BC557E5123702FB6E49E0A40EC6A13 C6GF5
593,893,539 *3D084D573744D6320372F4F82C533E9BB5280FE5 C6gW#
593,893,540 *3D09410B21E95CD83869F58A38B912BB554D7764 C6)_H
593,893,541 *3D07141B9C61BD3DB7C04547633B7C57D86A39C9 C6h/+
593,893,542 *3D08CC34EB1B4CA63F091F4CDFFEBAD109855DE7 C6H12N4
593,893,543 *3D01060273CFED55019CDF2C6E0422274E6C37C2 C
593,893,544 *3D0EF5D2BAABE5DC9A8E4086B717A86E2349C8AC C_6H5
593,893,545 *3D049808C1821AA34B2421EBC1CD65873CC9F83D C6H5;
593,893,546 *3D0235BB78CF468F86B87B15A7CD5F349DDDAC7B C6hhu
593,893,547 *3D0B68B23BBF79223E7551790B0A3B89E9C526FC C6HI
593,893,548 *3D046215EAE4F58397AACEB95A978787BA4307E1 C6H:S
593,893,549 *3D066E9DB66040D7478F4B5F574B7EA588CE582A C6hv(
593,893,550 *3D0F3A4B48B452D3BCEE98C18A56B340EF4294A2 C&6;i
593,893,551 *3D063A1DEC33936D7E0CF15A81B35AA2DE928864 C6i&#
593,893,552 *3D081C7A0EC8D98B781A5A6A5AA0121DEBF18EA0 C6/I5
593,893,553 *3D067A8BEA9863EAFF2D87FADF48A22DEBD35DED C6i6/
593,893,554 *3D0AEB68A741A654523B241111556A3764533163 C6iCB
593,893,555 *3D06036FC6145623BA4B0E52A510333A2157E6E0 C6i,e
593,893,556 *3D0F06981F0C937A0A0D9493DFBED3DCC2FAAB74 C6I_R
593,893,557 *3D078B729DE21F00E48DDBE429FCEF564A569AF8 C6%Iu
593,893,558 *3D0CDDCFBBEF479DF4AD786F53EC70E29502B789 C6_iW
593,893,559 *3D037D2BEE485CB3DC2BCA885C8FBD9D25EDD107 C6jDR
593,893,560 *3D0D09D87F91E456E365DFB4D2ADB2E3FA685555 C6j+K
593,893,561 *3D0D0E009DFCE94054B81BA71EF93093BE34D11D C6
593,893,562 *3D078B9023CC7DBAA7FCA12462FD9B62AE5EF021 C6kdI
593,893,563 *3D0EA3053A7DBA587747B63854D390A3A3796CBA C6K
593,893,564 *3D07910819DAD408CC42B0EB74F49A1A33756839 C6KkS
593,893,565 *3D040E255BFE5EA45F840811366B7E95C56B22F1 C6K)U
593,893,566 *3D0373DC7F2E21A39C357E83ADA7980A97D98443 C(6#l
593,893,567 *3D0FB31812AE96423B12B59C7770717CAF6602FE C!6l4
593,893,568 *3D0B611DAE1A881E6C42A3D5C069C71AF13F31CF C=6LB
593,893,569 *3D0D9EDED68019FFFE6B485B9B8D2CF4C8112FD0 C6lK0
593,893,570 *3D01C5FE1E3E44FEC5F178F18E224250159132F1 C6LXw
593,893,571 *3D0FAB8E3CB813A819241C3D30F2F838E3197E05 C(6.M
593,893,572 *3D0E1ECBCAC8FA0B6B7CD28D89BB149FE3EAB0D7 C6!m_
593,893,573 *3D0CA427965574B181A5BEF2501567A65599BA68 C6mmn
593,893,574 *3D0EE96A7B08AF4033E4404D0E068185C92ABBB5 C
593,893,575 *3D0EE88CD2FBAD4561C7A5C6AE716F94860416AD C6mXv
593,893,576 *3D0133C15010C120EE9CC91DE388C44EFB8702C8 C,6N/
593,893,577 *3D072AF65A03D8D5C6E0C20BDDC992A707325A64 C6%,n
593,893,578 *3D0FE0E230103F5D72FF61006896C60A4C325BE0 C!6N3
593,893,579 *3D062A6F8380949192332B07EB168B9911766767 C6NVj
593,893,580 *3D0FB15E10570E3A4023BF50E9EE4C306D7DB6A7 C6O-4
593,893,581 *3D094C2C8BE8971B32AC1F8DD49586811C7086FC C6O5;
593,893,582 *3D0653F1C8B5899A5F927FD8F7A02F97F68BD09F C6oBK
593,893,583 *3D0A0C60A89F081AED2D8D4D97DDF1CA6A864913 C6o!I
593,893,584 *3D071F4CC229E50FC51EA1278AB7543DAC6CAB0A C6(OK
593,893,585 *3D0219FF98602FFBC3591893326D3ABCB0BEE663 C6OMC
593,893,586 *3D0ABB337B6E22CA88E6BB180B631957B21A2CF7 C6ON#
593,893,587 *3D0828BACFC4636E3AE144B5DDB2179F95652CD0 C6oo"
593,893,588 *3D068BB924A458C6B2B50BD08B291C79C1273DB5 C6OU2
593,893,589 *3D058C738A892A7EFFE3D992E3C049FF82D6505B C6OXl
593,893,590 *3D019C216383B1FBAF531A29CD8CC34DFBE0C694 C;6(P
593,893,591 *3D0F11E0CB205F5E52CFF451E713783E5EC06E47 C.+6p
593,893,592 *3D0A10E075780E78E35845149F73EB3C5BB3C059 C6-p
593,893,593 *3D0F6DD1680529830858637BCE68ED978CB7D8D3 C6p-?
593,893,594 *3D05D496C68B27012515BE763C2537C7583AE54E C6P1f
593,893,595 *3D0A29620A2B436C8D31568916944A1AF97D7D93 C6pH=
593,893,596 *3D096476B12418AC110031EDE448B4166A7107BD C6PMF
593,893,597 *3D08AE31E23EFD22C6C5F482F5EA8CE043362303 C6pqZ
593,893,598 *3D0A4DA01BFDA4159DAD7D977382E89AD3780B70 C6pZ2
593,893,599 *3D06D53F84549E7C394FC3FD1C27A5DB8FB160D5 C!6-Q
593,893,600 *3D07859F1D309D74355B84013AB02AD3B0A3BF59 C6/=Q
593,893,601 *3D0F77E557D26F1A7699E642DC64F2006B8E2224 C6=q+
593,893,602 *3D0084496CD39C13DE836A56BEE75CF1606057DD C6q,:
593,893,603 *3D09ABC93BA0C6055063A4EB2B053FDC83A92373 C6qFH
593,893,604 *3D035FF0C906436750FFE5499EC0BA2EDBB6CB8A C6&QL
593,893,605 *3D0E8C6A1A0F126C4B87B9F679DEE8DD4E718607 C6qnt
593,893,606 *3D0FE0ADFF3AE122A3A26FE7A23F58A3436FEB99 C6(qV
593,893,607 *3D0008A748E23B6888781C044B2A08CFE53A12A8 C6r89
593,893,608 *3D023E2F0B55FA28272460F94749E10FB9ECE8CE C6$Ri
593,893,609 *3D0A844D11534A117C1729B9FF7FD31D1217AAD8 C6r=k
593,893,610 *3D03D938FF6B68ACB70BE9374BF900E9C22BD232 C6,rR
593,893,611 *3D01CE819F0DD0C211A9132B33923AA7B603A5F8 C.6rU
593,893,612 *3D067C7946CE3BD0FD6E574FD900ECAE31870BB3 C6)rV
593,893,613 *3D0D949819D044C2CBEF5E8DB102303C4BA07174 C6-)S
593,893,614 *3D01E028D330D5834F5D2B360FFFEA35AD22E37F C:!6s
593,893,615 *3D09FA69868085C4FBCE020A5FFCC0B0E61BDE5B C6ScS
593,893,616 *3D0B06AEEF4FF6B8AA4C239C93CB97B2E2F9D86C C6"sm
593,893,617 *3D0B924ACCD67112C6A997E3169EC1194C593DED C6sQp
593,893,618 *3D0352B226C1DAAACABA4FBCACB29B4F8C697CD4 C6t8l
593,893,619 *3D0DCD1D0233E7388E54CE881C10021E9CFE1A0E C$6Ta
593,893,620 *3D07EB5E32C445A6A26865A08FFB2741EE503AB7 C6TdK
593,893,621 *3D0A0113D82659CE8A2538F9FA38F73F5733DB42 C6-To
593,893,622 *3D0E0A0AADE3135FA64DD8E52EFE7560AE779A1C C"6u+
593,893,623 *3D01C19880D7359A1AE7084178DCDB13E05F2FA9 C6u?$
593,893,624 *3D089335B6884F76E822C7694D0C0787022F9109 C6Ut3
593,893,625 *3D09839C11AC0F1273A06D086DDABFF961AE9C6F C6V9t
593,893,626 *3D084F4E21269B4339F81AFF0E11D6050B372F1B C6vc+
593,893,627 *3D016577ED6BE6557D6F55C0CA752B89276682E1 C6vjH
593,893,628 *3D0E82973D4FCF811CF6B9E75BE92524F6DE5198 C6vnI
593,893,629 *3D01DED60B8BC6ACD4F2667DF07F3F9F8A0F501C C6?Vu
593,893,630 *3D0EA27D3B61D5FB2D09D9D3BC163B441168237D C6VYi
593,893,631 *3D0540711B18A33B143EF3CC00D5D12D62ABD993 C?"6W
593,893,632 *3D0B8DBECF4692F0B06453FD10F3B7DA7B04D120 C6w@
593,893,633 *3D0F83E2088EE386AA0B01DB2258A2967ABC91FE C6W(4
593,893,634 *3D062EC2C6B2F39FD5F4AD8653DE6A748B7247EF C6W62
593,893,635 *3D021435CBDF5F12C09FA86FF90EBD470D958CDA C6wav
593,893,636 *3D009722472A565A6056E8F0D153B07EA9D6D07E C6;wN
593,893,637 *3D07D04748733ABF9B19FB33C7DF5F4EEE3C256B C6wNA
593,893,638 *3D0BF0A2DBC9CFDC0BB7832C50B4E93D01177A9D C6Xd;
593,893,639 *3D074B4939637C3E1B7D53DD643B3768738B8A83 C6XKN
593,893,640 *3D051A8911A49EDE9775001A1A1B7E4F568B94C6 C:6=Y
593,893,641 *3D021A4E495BF40358A582DC2B69FB7FE4D4E51B C6Y/,
593,893,642 *3D05E318C62B787F17C13946D252CC08F1212DF1 C6Y!1
593,893,643 *3D09289D2365870E092879F42A4B02820110FDC6 c6Yx
593,893,644 *3D005C0C5265BFC9B8428E4EA7C5D529CF111ECC C!7#;
593,893,645 *3D0134B2F43B180B3995182AC8ADD73C7B880140 C(!
593,893,646 *3D0437B1193DE06575C67343A04B55A4ED0FE730 C)7_.
593,893,647 *3D09FED3B086E1C3026B5041BEF4F1D3EE175E73 C#%7-
593,893,648 *3D06253A77C964531E538F36542A1CA55F9A2AAE C7=$&
593,893,649 *3D02B691A5ACC465AD6244AE97ACC338FFF25F18 C7=+%
593,893,650 *3D0A8B87F071A087668DA61AFE273F38E7F16525 C7&!?
593,893,651 *3D01F8F53E397892102702A89CABA0B31B53ED25 c'7/
593,893,652 *3D03212DE08C6F66B40BA38FF23EBB300859B661 c7?]
593,893,653 *3D0B24EA355789BE685587CE7FDA8ED99CD4EF64 c7]:
593,893,654 *3D0BDD7D4CDA96669FC438BF3B46636E5D2A8E9A c7%\
593,893,655 *3D084386C61C5CD018B83D045E30590DD9B5BC19 C,&70
593,893,656 *3D03ED4701A4E62E8CDB90422A93B2A0EEDFA98D C7_.0
593,893,657 *3D001E9B4DED267742EE70B8BFE2350AE6F60447 C70G-
593,893,658 *3D01E0D948406C062D4218C6B78668AACE76C429 c@$70r1n
593,893,659 *3D011C4178425C2C78F96A6ABAA9EBFF9FF2F4EF C71AF
593,893,660 *3D00FDF1AB61BB9DE245D32D217EA3ED5F5B490B c72565
593,893,661 *3D0A69576ADF946499AD4E7D1F0FF308226F0E60 C7,2a
593,893,662 *3D0AEE665784FE6B0ABAE61EA9282C2B5C139D95 c]73
593,893,663 *3D0F001745F5C4FABEDC6F8FA3657FCD6E34F563 c73176
593,893,664 *3D01D955DB4EEDF2E333B1FCFC697D7A9F01F3DD c73d81f0-e34c-3a33-918b-ea0f8f4984c5
593,893,665 *3D075DC6176411FC08D77499B2C7C6ED4DC6FD12 C73=K
593,893,666 *3D079AC9C3884B5DF0D981477435108149060653 C$74
593,893,667 *3D0DE6E0D3F45C0D12767CDCE051FCF3473E3ABF c75789
593,893,668 *3D08B3E15E05E50D1975DD95D9DF0719E4F514C6 C?75T
593,893,669 *3D0DF8CA7581B58CF4FEFB7AB574F0D71B82DC88 C"76!
593,893,670 *3D060483D38716FD5C00790258C87D3F09ABC55E C(7(6
593,893,671 *3D01ECB7A24064BA4786E7626AC3BDC0CD70DDA1 C76QG
593,893,672 *3D0E54B5F58528DCEE6FB72E52A0D75A91011E74 C77F8
593,893,673 *3D07E64B4D74D0A34DB985409BA3FA3AFD00C731 C77LG
593,893,674 *3D055CD53D57B1A022A3C5EDE1FF45A3B7C3C5EE C77Q+
593,893,675 *3D0F314033131AF39898BDEBA2AB37173A2BD46A C77tG
593,893,676 *3D07C57876D346F5F500DA1940B4187E07E0C120 C785&
593,893,677 *3D02F8DE3EE75944A7BFF3CFC264A10E0F06E311 c7875
593,893,678 *3D0BF29AF15485AAAACB02137F5AB7B296C917A9 C
593,893,679 *3D090DCA7C9BA8AF1F7BF608FF3B4D3FC6D1F901 C78T(
593,893,680 *3D05632AEF9C445B620F28AA78D0FA4A0BEAF8A2 C%79%
593,893,681 *3D0B75C3D2326B716D64FC123BE2B453A960522C C7!$9
593,893,682 *3D0B3707A6860EC727099A4B5488D8E11EBDF516 C79,;
593,893,683 *3D02FB99B5656252935171D30E87EE21158C4A67 C79%I
593,893,684 *3D0889EB72BD7EC428E232439CDA84CD9F10199D C79N5
593,893,685 *3D000946A1E8FEFFA78AE73D4F92B078ABBB1D08 C&7Ak
593,893,686 *3D022870CC81450E5BD8FEEE0230B356B1BE317B C7ak
593,893,687 *3D05565ED1B1A870105673B7D219963D51E2F580 C7A"Q
593,893,688 *3D00D498DD165DDC8058133FE93ACEB2D9699AF3 C7B5X
593,893,689 *3D02E5DAAB9899275A16146700F8CFFFF89E89C6 C7BEX
593,893,690 *3D0C8390046E7838AE702F2B930A25C0C277E2F8 C7Bkj
593,893,691 *3D0763EF1F3AFDDC1337FCBBA30576D0338BF3C3 C7BNC
593,893,692 *3D0E480A2E91DF1E4D04B1341C89BFD7A7152019 C7:Bu
593,893,693 *3D04EC386C47C99E3AF4F58AC8D9FEB0CA65055A C=7:c
593,893,694 *3D05FB4FAE000E0F5D81AFA751D840298A2E654D c7c1195723211
593,893,695 *3D01F0CD490BD94698BB60E5A817171943FE4A65 C+7C3
593,893,696 *3D0B71A35E295C6BE0166F4281B31861F9786C83 C7cbi
593,893,697 *3D0E5F1068F4F416634EECC61CF4990FC828D3FC C7-cF
593,893,698 *3D003B6BA21622B615D7A9A38229FB3D889F1833 C7CG-
593,893,699 *3D044F0561B60272139537F8AD4B9C4D6D2D9CC8 C7cH&
593,893,700 *3D0BBB76E009403BAAB7A0779331FECA816D2FB6 C"7&D
593,893,701 *3D0A7D63C381D44635FCE644FF6F2D9EAFA8C7E9 C(7d=
593,893,702 *3D0CE7E01F5C1280374BB3ED698AA22D0DAB43E9 c7>D
593,893,703 *3D07E439EFDBF83B64A563A45A17D97E994CC809 C+7D2
593,893,704 *3D0842334532C4529B5561D4050AC992A50CBACB C7D.7
593,893,705 *3D0A16B91C8F9065F8A764738776992E1E2A2F0B C7D7e
593,893,706 *3D0F6AA46C7E7FF6099D0345C0643560CDDFCBB6 C7dA9
593,893,707 *3D0DC2783867D048DDEDFCB02980248416181FEC C7daI
593,893,708 *3D0CD7C7B5365A3251E854B01B101D14C8FFE964 C7DKS
593,893,709 *3D0067358BDFCF47B5131862B5DDAB48F1820338 C7D/O
593,893,710 *3D0FE11B4B7E72470567F68F1F433E6D65A95721 C7"dt
593,893,711 *3D08335349E7B2AE380F5642FF5A2186702C5F44 C)7dX
593,893,712 *3D04E6671A5FA44A26E1A84B53E7EE2D37F60906 C7;/E
593,893,713 *3D0A911A2029B37B4126F0DDC810EF1FBE41493E C7e/;
593,893,714 *3D084DDCD7F5EEFC29B9318EA87A70A71491C1AB C7e+(
593,893,715 *3D031AB49AA88AB8E0A155589F3D6360A3829D1F C7e8f
593,893,716 *3D09B1C154468E983DC9062A3B3C481E254306F7 C@7E90RIC@11Y
593,893,717 *3D021E5F3809CB3FD605676FA16B6CF508CCD7D3 C$7eG
593,893,718 *3D010167C594687B91882163C9E3437D2DFC7A71 C7eNp
593,893,719 *3D07B4D38508AF02F8201FAFFF4AE3E4AC0BF366 C7E/p
593,893,720 *3D0512E14489E214F8CF4BA7F618C00DED125471 C7$)F
593,893,721 *3D05EE92A7D7BC371A4B2753C11C54970BD3276B C7F(,
593,893,722 *3D078957EBDB90069D97AE53D91ADD58835C39FE c7f1fce5
593,893,723 *3D0893B56D24C008E7EC445354A6C533B0ABE3C8 C7f)j
593,893,724 *3D06B27DFADFC34EF598F49033E5C202F8CC47E9 C7FMK
593,893,725 *3D058086C8E6298FE2FDDFFB1EB4DA87FAF7CCDD C7FR3
593,893,726 *3D0C22C970966BE7148652EA69A31875B4A26369 C7fx
593,893,727 *3D09EEBA019B5A1DB5E0D1F564FD43C46C435C79 C_7G4
593,893,728 *3D01B081219408D0698150F37949E80528D9F01A C7GbY
593,893,729 *3D0B22455E6F0D7342C66101ABAB4E78193DD30C C7g,i
593,893,730 *3D03799CC7293660E6F72463A5BB38264212E844 C7GIf
593,893,731 *3D0341E7862B58BAE5D76CBA4098675BB0A44BCB C7GIL
593,893,732 *3D0F04041DE2DF596AF28E64E67C2AE642A32000 C7gr.
593,893,733 *3D04F2C70A0FE81ECAE04A98EEBB41C98DE7BE9D C7Guj
593,893,734 *3D041EACC0898D8B8B108DA2CE8B44734F246F5B C7gUY
593,893,735 *3D0983C1A8F0007F1BDE9965780AC868C41F1813 C.7H3
593,893,736 *3D04DDAA0547684EB05853E5537794A1BE71E0D5 C7"Hc
593,893,737 *3D09902DB84B250E2F8F42AAE45DF50ADCCD4445 C7hC%
593,893,738 *3D0CCB50577C64438370B18E43CFE3461D71ACBC C7-hG
593,893,739 *3D07B017E8857E3CB5F15AFF20FAD09F8D91BF63 C7hnP
593,893,740 *3D08F90D47E193050F32C6F10EBA9C1752A62317 C7ht4
593,893,741 *3D073BBBB76A8BF3846349E7024046A388FFDC45 C7HXc
593,893,742 *3D03530A1A0A019417E41CBBEBA16977C70C4C9C C7iBq
593,893,743 *3D00C1DA26510A6EA751E42ECD4C6D7D40C520C3 C7I/D
593,893,744 *3D04B1E69375BCA5EA721BC59C5D99E7B864D597 C7igh
593,893,745 *3D01F8F611E21AB2FB550E03EDF318BA9D90F017 C7inM
593,893,746 *3D03E35F8E39B44B38C3D694A05C0370E9ECB203 C7IoC
593,893,747 *3D0594F4FB62CC8455F3D2041D03DA393E6FCC0C C7i$v
593,893,748 *3D0637BA8E5E78E95A23B1EAF0D637DFE0DBED73 C7j,E
593,893,749 *3D05D0660CEEA4AE73ED016F8148CFF24BCD86B4 C7j=Z
593,893,750 *3D0A950CF3180D1E051DBFC4D0A86A8D3BD8D9F8 C7K(,
593,893,751 *3D0FB2E53F623CFB0684AD87D8A5B25F07081E49 C7k#3
593,893,752 *3D02F3B8AB6C713D54A7BF003F74433634F4ABEE C+7kg
593,893,753 *3D056F826472D2E2D2744D3D9722BE1161F9772E C7KiL
593,893,754 *3D0CEE50CCA20EC7CC37231D415C6EDAF5D45F3C C7kMX
593,893,755 *3D0DCF66C50334122F6DF597D89B278C6EBAD6F8 C7&kP
593,893,756 *3D045542C12A1C5C3C8B2299359857103AD0DEDF C/7.l
593,893,757 *3D03AD5BD4D6A81112967D430CDAB3F303D0EA8A c7L\
593,893,758 *3D04B1D75ECD232E636D95696B973462F3AB4E1B C7+L7
593,893,759 *3D0C1B32B313ACCA0B3386935A15BE693E2FA422 C7/LD
593,893,760 *3D0A6AB2694FEB2BDB849C6742B735454EE6DBEC C7M?0
593,893,761 *3D0961E5E213975AA31A50AAD9956AD82048DD87 C7mMq
593,893,762 *3D0F838A375F7A29B090842C587CC95A983D3CBB C7?mR
593,893,763 *3D0BF39B6205474567D6399EE001A823481C9659 C"#7N
593,893,764 *3D004FD158C1FA13CE29AC11783A9B66D52CF185 C7"N=
593,893,765 *3D05BF4826879D76F3EAC55455580DEBA3E2D01F C7nuv
593,893,766 *3D082B9011D071751F2CE7204391B8DCB15D0459 C7nVm
593,893,767 *3D023D867CD4DCCB0F69DF67D2F0FECB4D812F20 C7NVU
593,893,768 *3D08DF7A29B01E616E87D25EF6E42535F0683959 C,7O.
593,893,769 *3D036518D55C1F805262F403B8BA6638814D8571 C7_o&
593,893,770 *3D015F6C00BB9A0DCF9CAB94CE68F44D67CCBC92 C7-o&
593,893,771 *3D0D9509DDA137A23459923CC3CEB4484BB2F3AA C7)o9
593,893,772 *3D0DFC3582AA21156A040D6CBA74995D0654CEC5 C7Oci
593,893,773 *3D0882C091C9ACA27E01788E640886109AD1B39C C(7OG
593,893,774 *3D043E1E3DACD3DBE5596F7681AD4129CF994EDE C7o?g
593,893,775 *3D018D943CB2AB594BF3CB4E35F9882B90E9F77F C7"om
593,893,776 *3D0667EF6DBC93EA2BE375B088057E25D503FE42 C7oQ=
593,893,777 *3D0F9D62B36CEE3E39A92E2FAACFA9CDA3C9AAC4 C:7Os
593,893,778 *3D09A3D20D980888BD3F29305126F5815031B60D C7,Os
593,893,779 *3D046E4D6C77C967159B62AAA1CE01061E754980 C7OSI
593,893,780 *3D0502DE2E7A644BB4CB48DEF4DA93A446426706 C7P7#
593,893,781 *3D0FC6F9DA1087AA27961D690D27A0004D96C9E5 C7p.D
593,893,782 *3D08CE93AFE31FEE8FA70C080B15265FAD5B6124 C7PI0
593,893,783 *3D0F607BA263C2EF1F9C997F1205A925BDD3406E C7PrF
593,893,784 *3D0C2569D8B638CB3CF9B69DCDCB3176F060B44F C7P_v
593,893,785 *3D0EF48C545D00EC58804A440103151367A565EB C7Qi(
593,893,786 *3D05534B4BAC63AF78913E06F6EA62DBC8BC59D3 C=7QV
593,893,787 *3D05380D34D9618CC01C9BFAFE5136EEDB34FDA1 C7qWr
593,893,788 *3D018D2DFFA3B21BB6B9509E7E158993946A2F8F C);7R
593,893,789 *3D071F01BF220BF37B291908A2C743A6E7F2057D C7"RA
593,893,790 *3D0AA1481C143063DD12DA0673E9AA3DFC8CE4DB @c7ress
593,893,791 *3D0E78D572CBE2BB912AB1262840CC5A9B7F49B5 C7%rN
593,893,792 *3D0713DCC56B67EFD6E69E0E7ADE962D1B3010B0 C+7RQ
593,893,793 *3D0F0E71FDA911B9807231EC5421DAA128B59D02 C7.ru
593,893,794 *3D0D4EC4129E7CB01426C1DC5A6907CEEE23C667 C7
593,893,795 *3D097323E7AA7AA6AD828FFD74834697808A9250 C7rZ_
593,893,796 *3D01EEE7D6756BF3F94BBB5E2B016B53D658C260 C7SaY
593,893,797 *3D03C3D750C7DA4E1325930B490FEC4F9D430103 C7S;e
593,893,798 *3D0854008BF1CE2B2F638C552818B96A97FA6C35 C7Sh5
593,893,799 *3D0BCBBB2D03BEF1E79CC7DBCF2DBFC82E62456D C7sr.
593,893,800 *3D08FCD4F9839809AF2536032B36E6A7BF3C7901 C7SWq
593,893,801 *3D0FFFD799180FF6711EDE55BC388C26157EC3EA C7T1U
593,893,802 *3D054FB61ABDE742CE951CDC9C827AD16C4C8A7E C7t8E
593,893,803 *3D0563C7858BED478B90E305F47E61CED3739D0A C+7tf
593,893,804 *3D0FBAEC590CD7042E62F1570C435E2AA4CA7430 C?7_U
593,893,805 *3D0EC241FEE6EB24DBEE4CCC101CCE0D271B3E2E C7!U,
593,893,806 *3D060ED97C2F4F9B207707B924683AFA47F45849 C/7uc
593,893,807 *3D02657657BE128D204772652F5AC3F240394CA1 C7u/L
593,893,808 *3D0A98D09D1E56267C2CE81DAD7601236D061C9D C;7UO
593,893,809 *3D0E7BC87E009AC24F1DE1671AA066EEEDCF691A C7uOp
593,893,810 *3D02CBAAB9E6813223C4B2A543635A97DE971F8E C7up)
593,893,811 *3D09CFDAF0E083C5A9F04E9DF1D77B1BAEF40E92 C7U_r
593,893,812 *3D0F1AD256AE09393B6EC8BFF090909FE3BCFF9D C;7uV
593,893,813 *3D02CA12F365C8772C7BC8E32F0B8A3943687DAF C7$(v
593,893,814 *3D05DC7347B8E2DBABBB86F8F27A62B31C35A209 C7Vcp
593,893,815 *3D0219389A2E3EA5A6AEC00F8F43F2B253F70A96 C7Ve/
593,893,816 *3D0E183F6973CAED130BE7525815B19D76C9F98F C7,VL
593,893,817 *3D0AABB739DB3101ACAB547E72C6DF62DEBE28F9 C7vm#
593,893,818 *3D0B2C2BE8D34C9A4122DE027C913E79D79905FD C!7VS
593,893,819 *3D02C60F8DE2232D6938807F3EE6B7EFFE730CAA C7VYg
593,893,820 *3D0E89B293F72FBE57A134CCC6AB0327B7829977 C7vYs
593,893,821 *3D05E32FF2D4B2B720562DB162A8679F73E80331 C7Wkr
593,893,822 *3D0E7DEB76EBABBB11A581EEDD11597CA70AF8A4 C7Wp8
593,893,823 *3D0D6EDA399481A734AF9281BF31637584FC6C0B C#7Wu
593,893,824 *3D0137C8B6AA5A7DCF71D3BFE1B63E9298AEC483 C:7(X
593,893,825 *3D044D6210D22CD3F0B0BD5094E7B203141897A6 C7XD-
593,893,826 *3D084B1352DA40CF0BBDFBF95B7E0F8F1A6661CE C.7Xd
593,893,827 *3D03AE997BE645A737EB3052418C0F153D6FDC2F C7XEe
593,893,828 *3D01132BB31DB3CB36EAC91C020BA4D16B4B0607 C7ZDd
593,893,829 *3D0A2F4037BE83FBA769033DEFC52570B4E7FEE5 C7ZkG
593,893,830 *3D0D0D1D96385AE672406074F0F5FBC1FF1BEA95 )_C[8
593,893,831 *3D051078580A4DF2114F37A85A8B813FB8A46B0B C=8."
593,893,832 *3D0759A17DAF420F34A1A0AE61B46091E132D661 C-8.!
593,893,833 *3D06546D154D26FBACDA2A21DE52FAEEB03C3412 C-8#?
593,893,834 *3D0926C5A45B0FFB1BF0E9FCB924E34668203585 C?!%8
593,893,835 *3D013302C99F76CCA92BAB12F3428E60C1B94574 C/8$+
593,893,836 *3D02B342F73F78558A98CB73D96B560DEB028836 C.8-+
593,893,837 *3D0671D5F4490256DD2A7A2CBE9ED2BB8A529E96 C.8)
593,893,838 *3D0B4E0307E2C3D9BC2BE281BB35A57A2E8C0E80 C&8_/
593,893,839 *3D02E77A5D09B7E79C4C3A22CED81DF9D5FDA04D C#_8!
593,893,840 *3D094EF1973186C0F13D709794B788733FCF0659 C%=8.
593,893,841 *3D07F228ED9B398B94F39466A322BB0A6E4C71D0 C+8$,
593,893,842 *3D07908432DE821BE5B5BD116621524A5ACED07C C
593,893,843 *3D07171BABC9F4335FA171CC1FD0E8EEFD2EB03C C8!"
593,893,844 *3D09A3AF6EF2E316FE48AC84E4D4BB591A4205FD C8"+$
593,893,845 *3D03BEA9DA8A1A72E46D6920484703AB65B0E915 C80_?
593,893,846 *3D0B67F20B70A7CC51CA0AD95B3BC9ABADCE6B20 C$80a
593,893,847 *3D0D888AA00A9FBA83AFCAC349AA7F8F668F2B1B C80=a
593,893,848 *3D0849BF55BDC4539F37B99F6AF41D1053D4A998 C80PY
593,893,849 *3D0D157CE7D90379FAFFE06C9B1F52B06A5897B6 C80V_
593,893,850 *3D05950600E507660FCECA407F1F544403A28DD4 C80wl
593,893,851 *3D086157969E8322C9C18EF168FC042E8C703FCC c81009
593,893,852 *3D0B009A9758B603CD48791B48A7CBBBCEC6C5BB C81UC
593,893,853 *3D03103E94A673933239FB5CA72FCD862CB2DEA6 C81ZP
593,893,854 *3D0E882BD2BA188F420D377D365A2A74AD596794 C82(#
593,893,855 *3D099B44DFE5D27E9EF95B04B0CE1DF1F22F678C C824p
593,893,856 *3D03FF5775B2372C6B80A9675124DD0EE51D37B3 C828g
593,893,857 *3D092EC921FF8FBD91EE1A4DB83E79E57D6DF008 C8&2n
593,893,858 *3D0795CAF573692A4181A3C6855E9F2D9CCEE85D C:8:3
593,893,859 *3D06850F8E53E8829CE8D670954F56BDE1B9A45D C8;-3
593,893,860 *3D0BD1F1CC683FDD9563B87AA9FF4E4FE98C548D C8#3(
593,893,861 *3D0CC166198F719D36337B4CE74445B402A6CCD2 C84#;
593,893,862 *3D0A48220C2538FD05E226D7A65DC259B93EBF6D c84279
593,893,863 *3D00F67CCD3F68DD45DD1EA01E7B4B5BF8B6FAEA c84734
593,893,864 *3D0CAE5038290593AC475056F836E57522C48AA5 C85"F
593,893,865 *3D02AFDA843624AEB407CD5DB19EA4B77500733A C85Gc
593,893,866 *3D05FA7FE7CAB91EB7B7EB16EB5FD936A780A6B6 C8)5L
593,893,867 *3D0E315567A9CE6C4983A17DFE3DFF3C2D7B5380 C85vw
593,893,868 *3D00D37E7C8A33B885BA21D7F002B708A7A91E6B c86246
593,893,869 *3D062BCFF57B4ABD63FA83E333416A2D3CCF4666 C
593,893,870 *3D0B81BE3DAA0A8712B40E489B10B587CEAB1B62 C86h?
593,893,871 *3D0471B0F14EAF7955890FA65C84A84D63418D8F C8,6s
593,893,872 *3D030C62212351505FB2008D5C33C01B94D084C2 C87i"
593,893,873 *3D0F6DE79467AC50374FCD3780A81E51745E57EB C87,Q
593,893,874 *3D082679C00FCE1E19B87253AA01EF4BE2E30D88 C87qR
593,893,875 *3D019FEC2094FF2762190C30E63E3E86214E6164 c88k
593,893,876 *3D0E6F3A803EA71208E617EF20FBB17D7AAF6E72 C89;:
593,893,877 *3D06AA5E685D1454E573CDCBDE0FFBFAF99F6963 C89#"
593,893,878 *3D00F4550BA5C27435AAD9D9B8666E0D9DE64837 C898N
593,893,879 *3D02D565D0A5E6D73A07AC702F2F3F6E5E2D3389 c89fd23ad3d7abf8fba96829d2f6db0e
593,893,880 *3D01F9794208830C3218D31FE54A67D5799C90A2 C8;9U
593,893,881 *3D0C092921B2AE3B920AC230B747D14FABCDC7A7 C89wU
593,893,882 *3D03A3AB7726D42A195A07CF8880929C2EFA388F C8/:A
593,893,883 *3D0FE2DC1EC087FB95135B1FCD5D520E098AD8A3 C"8a
593,893,884 *3D0CD286BD0DB79A3F713E78D1D07629C848C270 C8
593,893,885 *3D07BE6651F704AD690B04BCB35DE944E3EEA664 C8aFt
593,893,886 *3D074F9FC5684F950D82D9D279F8CC566CB73CD0 C8a+r
593,893,887 *3D0B835134D6518C77041F9BC3633B10D122DE42 C8a#T
593,893,888 *3D005938DCDF880F20E724A580D20A1D0637A161 C8&AW
593,893,889 *3D0F79C7202E83C2AB785E881B24E8A46D58F25A C&8b
593,893,890 *3D093AA809AAC3192D6318E84E6A351D74C5FF29 C8B%i
593,893,891 *3D05D944DEE8B988AC1B6653CCCAAABA2DFEDC50 C$,8C
593,893,892 *3D0D5DF642042ADE6ACF1ACC1BA2743F1D673865 C+.8C
593,893,893 *3D0B4C794C1B7E67CA7C7491D8F62E389584B0F6 C8C()
593,893,894 *3D0A8FAD53FD852F0110E904089E6162543FA091 C;8c.
593,893,895 *3D03BDCCD8F86EF07B12732B65BD33B368D16B9A C(8c9
593,893,896 *3D08EE2FF223AA5F0F2FA549FEDA0EEDD8477D83 C$8cb
593,893,897 *3D08500E325D9D396370C9192031D4C7184B52B5 C8cD!
593,893,898 *3D01D7BD9008D2D85E91CF94B04F228349FEF660 C8c&E
593,893,899 *3D08636CF23194D8B21F83BF277407B15C626539 C8c$l
593,893,900 *3D0690041D88DE0BD4FBB33A3EB28B46D2645B62 C"8Co
593,893,901 *3D0B48E7600566CE7FA497943068CBBC7B211510 C.8cZ
593,893,902 *3D064901E584F419E985917F8461D609A2B2965D C;8D/
593,893,903 *3D06912C0211543539424492A642F6EB4CAFFB7F C)8_D
593,893,904 *3D0C2AF621A32BB08E69AA68497F4D256DD3BE56 C8#DA
593,893,905 *3D04A032D0E4CBF031FD06C4E725F644E36D91A9 C/8de
593,893,906 *3D0635999D4EDC8E5585CABF419252F0DFF3A009 C_8dH
593,893,907 *3D0B5B770B365E7D6461633A769D798B0433F3CF C8DK)
593,893,908 *3D0EA87F3983939C55FD8F376592E00B9B349807 C8drq
593,893,909 *3D065BAFF95B762D307E2CDE631F2E3E534ECD1D C8Eqa
593,893,910 *3D037DB644E310755FC867D547F2DE3912EF276A C8_$f
593,893,911 *3D086AE1DD52C88A94884CD8CE78380C6B869F74 C8#f/
593,893,912 *3D07C7A3455EE9BA045B128B3942E1874D2354CC C8)F2
593,893,913 *3D005F39E58673578859926C6B45F0BAD39B82DF C8f6
593,893,914 *3D03D1FCAE6ADC6D7D4A7A5E82D7BEED66543A39 C8FC7
593,893,915 *3D05B5D3BF344FA4BEAFF60DC89C520736705CFA C8FcT
593,893,916 *3D04E428713C54C3C366F1E773EBB01218744B14 C8fFY
593,893,917 *3D0ECCD93C425B851E542849E5C4AF6AE18901CD C8FIN
593,893,918 *3D047B5E26ECEED8A86D49C0FCA662CE992CA102 C!8fN
593,893,919 *3D0682ECF7B3A41F4A549830B5CC0390D3092142 C8fV7
593,893,920 *3D00EDD593F324970FA625281EED6256190F1495 C8fW.
593,893,921 *3D01E782677D3792A10148506243CCB3B601612B C8g6A
593,893,922 *3D0089B532F039A095D8638DA478CE97657F46A0 C8Gj
593,893,923 *3D0CE28E381085AA67408CC4E9088969BE34D505 C$8gK
593,893,924 *3D0801E13596F79DD9968561DD14978386E8764A C&8gt
593,893,925 *3D075483B0CA962D75C865925927512BF2DF3BB7 C8g_Y
593,893,926 *3D0CBE097F338028C2B1C9457B8A96D296A0761A C%8h/
593,893,927 *3D05527C931EB571F559C6A1EC968161E11CF2E6 C8
593,893,928 *3D01CA6AF7A26CB3C38FD532962C3DEB47F67BF4 C8hew
593,893,929 *3D0E67E4FD1722885F22604F83F21DADA1394F48 C8HK%
593,893,930 *3D0C8534A1B09200F85B215EB2647B6337929E5D C8hKC
593,893,931 *3D0D02B12200D1BC13F54ECDB5560BA9030E0171 C8i3$
593,893,932 *3D0DC8BE6121FFB2BA3DF75D3B577E1D5537E05C C8i4=
593,893,933 *3D0A50C44D20213ECD3EED7EED1459E5A630E49E C8ige
593,893,934 *3D0E3EEB9FC2F745EA3B4F1AD852C9E8C04C4DA4 C8IOS
593,893,935 *3D0D5C259633842B00B3233B0CC3484AA53C0DFA C/8Ip
593,893,936 *3D0B6D5B7B70C21FDDE8E809B616226AC98CC598 C/8It
593,893,937 *3D02802570C631033B18DBC2C2FD03FBE56A2675 C8Ivf
593,893,938 *3D00744E45FCE4133D7C3E9B80AEF213A8C158E6 C8,iW
593,893,939 *3D0E2B63066FB44B10D66D07065F9943B71CE06D C8i+w
593,893,940 *3D09D7077E987B0B8B307F18B3BC7D9ED38EA8D6 C8jP?
593,893,941 *3D0F040408DD993E9B0F77978DFF8C49198A50B8 C8K(:
593,893,942 *3D09820CF9A7C72BCCE0E49B8C3714478FFBDECA C8KBs
593,893,943 *3D0B8FF946869BA8D084D29FD142D0C43089C36A C8kVN
593,893,944 *3D0E2BE2B5578ABD56070639D10913DE8B35F4B1 C8_?L
593,893,945 *3D052D6D83DC79BA18AED3ECF1561836B99A1573 C:8l#
593,893,946 *3D0FB087930579E9CA02DF1BDE7ECD7214EC9AA4 C.!8l
593,893,947 *3D0249F06264B766DA5DAE3DE92A8CD9FFA90878 C8l20
593,893,948 *3D0E6B1AB5DD55ED4BD2692BB2E7FA896E36FEB6 C8l3?
593,893,949 *3D02C99CFEBD3E069CF0D2C8730AA76DA03473F3 C8l?b
593,893,950 *3D0E2E83181603081445A7CEDBDB2040A79A5658 C8L$R
593,893,951 *3D0186921F3FF93519F5E3256833EDE94A99304F C8LS!
593,893,952 *3D0C6B541FF17A8DA4C237C9E6B1CEFFFE3E0EEE C8L"X
593,893,953 *3D06E8D131A68AAE7FA467F7572F28E9DC356AC2 C8m3e
593,893,954 *3D0E541E62A0ADC659172502013C9868517F6DB3 C8m.B
593,893,955 *3D0A7244BC81E0C077C7C9102D4B2D91274C90B3 C8mId
593,893,956 *3D0813B06EA8D7015881AE4AAE84081D62675D93 C8mXB
593,893,957 *3D04472284456392E50D6CAA3E2213F67EB51667 C8N(a
593,893,958 *3D0E7271209B20511F41377E680849F0827A7DDE C-8NI
593,893,959 *3D0DA647ED46D1C0499285BA6C0AB6AD3DA49BA7 C8Nil
593,893,960 *3D0E9F2122D44C32AFCFA02A23EBA86E28EAB4A8 C8o3c
593,893,961 *3D05FBA06C12999F8B08C21CC712B4D8661EB7A7 C8onK
593,893,962 *3D0D8538BAAFCA3E32FE3540229EB5C8A5006C54 C8o:o
593,893,963 *3D02919DB9BD47F0A9B28FDED3208C0AEC6BDDEA C8OU(
593,893,964 *3D0DAA3CA9A9597AC5E5C2F9FD8397E82939F6CA C8:ov
593,893,965 *3D0A92EEF32FA1DB13E0F6B28F422913B71DBD99 C8OvB
593,893,966 *3D00DCCEAD29E60926F6DB60140833DD5563B55F C_8P#
593,893,967 *3D0E91FCAF6B99DC94AF73BB34223570D4BE709B C8?P!
593,893,968 *3D073A175C9E42EAAFC6E8CFC39F6C845EBDE9D9 C8+P_
593,893,969 *3D0BE444AC51646C58A4B38D1248269E6DCE103F C;8p:
593,893,970 *3D0775E1EC7C221339AECB53B99C86900966E7A8 C)$8p
593,893,971 *3D02C9702E91724677B3B7E602FC03F477FE06C4 C8P5%
593,893,972 *3D0440473C63ABCA081EB82B55ECC2FA9B44CA23 C8p-7
593,893,973 *3D0DC845BBF86F93702E8063384FDC73B84F3EAD C8Pg#
593,893,974 *3D04B538DC9550C93EBCB077EB10B3E9FA293A1C C8Pj/
593,893,975 *3D07801624E0869CFB3D179A15113345007CF709 C8pPk
593,893,976 *3D01A1728B7035C9BF17016DBABE2422F3228BFA C8;pq
593,893,977 *3D0AA8159F27E701E0DF80AA8905DD19958E00BB C=_8q
593,893,978 *3D001FDAC3B38749457AF60EEDE3CD58809D0D1F C8q10
593,893,979 *3D0851D8DA1429252467A1F9A9B57D35BE161949 C8q"2
593,893,980 *3D035312ED18F5AF3439C6156E5A75B0B39BCD53 C8qDv
593,893,981 *3D016AD4759D3D497D0CAAE07157218241E9CB83 C+8qI
593,893,982 *3D0B895CF3346DB213374BB075FDD98F35919078 C8Qk_
593,893,983 *3D0F4071763EDC894A3E973FFA763A2FF45C10A4 C8qN2
593,893,984 *3D03E4CAFFBE04997A4544FB362D68AA1E7BB4BF C-+8R
593,893,985 *3D0EA872D344E29A8D9C9445D59751630B1F7765 C)8R%
593,893,986 *3D0BD82AE4AA923609C02D9A03691AC89F0CCDE7 C8RDP
593,893,987 *3D06714ACCCE918B478EA546C65B0384127FBD10 C@8rio13ts
593,893,988 *3D0F458D35477B86E7332804C3ADE210865A21C5 C8rkt
593,893,989 *3D050FE9AE73BC64366F290674E7F5059241334B C8RN&
593,893,990 *3D096E7F10B70B5D88444F5A8678A9E8BDA559F7 C.8rn
593,893,991 *3D08CDED390E4F51346F175654203646233CCAA4 C8RnG
593,893,992 *3D05663A71F540E9A15780375E4A13FF15918709 C%8%s
593,893,993 *3D000A340FEAC3242B0370944D18563095747B55 C8;=s
593,893,994 *3D05D8B1FB11497B377D7C47B64BE78B2A77A068 C8:s.
593,893,995 *3D021D0BDB9CC8BBA84A5F2CA93DC3B9AEF41EBD C8S?6
593,893,996 *3D09363DB090ECA0A306D37331411B66DFC1350E C-8Sh
593,893,997 *3D0FE5AA245F64A7168ACF48ECE253DE9C1FF660 C8$SK
593,893,998 *3D096BA29373490C44D6092A8A0F31FDA6654A33 C8s;N
593,893,999 *3D044FE1DFF0EFB9E65CCB3EE2781A370CA008BF C8sv3
593,894,000 *3D0EAB1AD8395EE29AC26F78BBBCD270A4F5EC04 C8sZO
593,894,001 *3D0D2B319D18EFFB3BC0FDDEDCC49B6E4F6471E6 C8;=T
593,894,002 *3D02166F7E1CE8F4282C5E4314CC5005FBDA79B3 C8)T+
593,894,003 *3D02C7B1256AD8B4513C4D80EA39DBA0717783E8 C)8!t
593,894,004 *3D09092E2090CE040601E8CA1601F7B21D0A0068 C8T,0
593,894,005 *3D0844399F4449D226D84889A720B8C5E4C899C4 C8T0E
593,894,006 *3D0E8DE97437CB912E77CB449FE95EAA9B03C445 C8Ta3
593,894,007 *3D0B5FDB24698A2DC74BFB1442C230C7AD5B0A0F C8tcD
593,894,008 *3D0D4F6FDD12F2DF10656670A0D576E448FC7742 C8TfR
593,894,009 *3D0F562FA680275D828E6C7A0F30F46F48C22FE8 C8%tK
593,894,010 *3D04F5CE159E79E36A38929BC70F8077F7C61C0C C8,TN
593,894,011 *3D0AC2617C48A8E2647DB3AD39F4DE16AAEE68FC C8tR4
593,894,012 *3D0B6344B6C53D02FA4606B1096BD8CF4734FD03 C8t,t
593,894,013 *3D01594C72AB4BF5D912BE093E5EE993233BC8F5 C8:u
593,894,014 *3D0BF6E46AE75F509691FC624D5721487B45E039 C8&u
593,894,015 *3D09C420678216CD44B206CA95C76367015B2AAF C8UVo
593,894,016 *3D058C7FEBEAF7BE6EE5F42BB8CAA49C68CD0E8A c8V?
593,894,017 *3D017D56AA770A39F10F78AA7364C7A540234A00 C8Vc?
593,894,018 *3D03E25558237215CF47B960551167334D80C486 C8Vdn
593,894,019 *3D05DB8FA124C45DD59F4A7028CFED3ED33A630C c8vl8u
593,894,020 *3D0A735D0A0712AC5CE3EF095E2D96EB61E8DFFD C8-Vn
593,894,021 *3D0BF7BEA7D5F9DAC99CFD6B8EB81B1DB23F0E56 C8Vq
593,894,022 *3D0EE030856F35C8969167FC2CE77548BFB0822A C8W(2
593,894,023 *3D074B52956BD7D9E83FCCFD5792225D0C509FF5 C8wa
593,894,024 *3D0C1457B5D73035D24235175DCA6AE21D71BF77 C8wQ!
593,894,025 *3D08891B73577863D6063DE5716113241ADB2F43 C8wRq
593,894,026 *3D01ECE0C317CEA18CF35430680269C7640B98C8 C8W+v
593,894,027 *3D0F4313BB39E87393CB3D298BBAFA36CC9BCAA0 C/,8X
593,894,028 *3D074C160C09111D4913C2F0683B43E258769079 C8_x
593,894,029 *3D0A054CD874F078A716EB1D71C99DDD87294DD9 C8X2/
593,894,030 *3D0D770DA720660FD4A47699BE25F5A1AE253799 C8xa
593,894,031 *3D07F0C22C80979BA021D7A7A6D2CBCFEEA1E3BF C8XT
593,894,032 *3D04FEA16499691205466ADBD7B36AC494040AA5 C8Y,:
593,894,033 *3D04D97212F2C7E99F705F75219FFE3DF4AFB282 C8Y".
593,894,034 *3D09FBFD15E6D283FA378CE07FC1480F9C4FB22B C8ZjB
593,894,035 *3D08E7F26B113189659D9C3FC09EEEBC41F8BA1D C8Ztm
593,894,036 *3D031463C67ECC5986323F54840D7992CB2BB228 C~<9
593,894,037 *3D0137A1BC9D34D0143B843E50305E6924ED5CC8 C,"9$
593,894,038 *3D05DC25E1AB51DB6ECB464694EF8EF262293F0D C;.$9
593,894,039 *3D02EA80797C55536F5FEFD6759CE01C740F57EB C.:"9
593,894,040 *3D09DADDB3699CC01E5AA9A23A9C656BEB64D298 C9)"+
593,894,041 *3D0A167EF23F0405AD6F468721AE9C22E01E58F5 c9~`
593,894,042 *3D08B5E6C8205495D2F55784526CC8A3525BEB5C C_903
593,894,043 *3D0FCBCD73FDC8959ABF5A7AEA8C5ADF6505F650 C9=1-
593,894,044 *3D0A79C1B960871CFC60EA6E40973DD2999D5BF9 c91131411061985
593,894,045 *3D0CFDD93B7D8B870A913B947F383362C529ED76 C91f(
593,894,046 *3D0566098B47209297BBB92A6A82330B69F6DF67 C91-L
593,894,047 *3D055C7C2B20CC1C0ABDE110EEA850415697EE58 C91_o
593,894,048 *3D049106BF0A24712FFA0D0FE0F0C64B5F1CE9C3 C92M.
593,894,049 *3D005076DE85A64E6E9C78717E85259B5561BF37 c92n
593,894,050 *3D05148132C789777E6462987085EF6004940DF2 C92nl
593,894,051 *3D0F1B6F8C29F2F871C1D697BCFE8D3E07A8FA5D C
593,894,052 *3D0CC53561FBCEAD9F32884E6E110BA5ABA17A6C C92W
593,894,053 *3D091CE06F059EE1D9537039D4F6E0A64A7955A9 C%93
593,894,054 *3D0E1088F1FF018CD4680D30FF2D773DF093B403 C93B=
593,894,055 *3D0986DE8E9EF5155A0961C13C60939EFC8D1F00 C9(3C
593,894,056 *3D071FB5D1F0B67680F619EACF68EE7404E2EE3E C.93D
593,894,057 *3D0F6C37D053E98D3C2A853FFD3E3B742E0C18DA C93
593,894,058 *3D0EC69893298B20A8556012A7839080B0250505 C93wW
593,894,059 *3D03BF1A1B8246AC71C5FC568E40AE471CC6ED56 c947h0ph911id43
593,894,060 *3D053D8440A260F2833ABF266D810D1590D8E079 C94
593,894,061 *3D06E291FEFBD0D0B9D2DEF1B836CBD49B101928 C94If
593,894,062 *3D0DC1844E0701D897BC8A1A99565F540F211787 c95kc4u6
593,894,063 *3D0C42E5F342648587EBF38CB42D6015D81D7597 C9?7;
593,894,064 *3D0A26B49FDDADA519A7219ABF9843E5E89BCD2C C97b(
593,894,065 *3D0291C1168F521A96E452E329389D4CEA1DE491 C97ha
593,894,066 *3D038019B1CD2887C1ECC4627180C6439311C2E3 C9!8-
593,894,067 *3D08B5DC81723CC31341A0EACA57623C91E654A0 c984293e-38b9-3b3c-890b-b469e56a73fc
593,894,068 *3D0B834220B07F8EF20F30A2350B1EEA642304B4 C98A55DA
593,894,069 *3D0245032B2474D89EBA22E5BF1412115E00BDF8 C98Hk
593,894,070 *3D012DC21DE357727E4BE29CDFA859FD05AEC32E C98qw
593,894,071 *3D07378C5F468B36D3320990F896E198CCB3A90E C9)#9
593,894,072 *3D0FFE1C35DCA4AF5CED65C56A3A6E8515EB5853 c991512
593,894,073 *3D0173A61F0B24F7A38B1046AEA74D8CAA056D01 C9A2H
593,894,074 *3D061268A253EC2DD8D6CB55F3EF7F0CA06BDCC0 C9|aaa
593,894,075 *3D0EB6A46363B5C4934D4695D2ED27A0CBFD4C6A C9an=
593,894,076 *3D063DE6736CDE8467A8AC2C4BCAD5F2BB8DCA32 C9&at
593,894,077 *3D092845E90B8693D44AD7EC6782DC4F8A10E573 C9aV+
593,894,078 *3D097AF4799748BF1B039FF2FDF0581550804D7B C9Ba_
593,894,079 *3D0DE8F76612DC90F7D3E6B4AB4BE54560397538 C,;9c
593,894,080 *3D00488478E2B9BD7D97B8DA517794C3035EF503 C9Cel
593,894,081 *3D0890CFEF612C104060AAFAAF161EF9F4A0827D C9ct(
593,894,082 *3D0544580E7A8FBFFCD035B9DC6D779E870BD805 C9D0w
593,894,083 *3D082373DC558A4338816ECEFE64A12D12F89BD6 C9D51
593,894,084 *3D069CC5411C63F79556687E9A05E50D566D6BAB C9dk9
593,894,085 *3D0062CDD8F23DC8CBB47926F59B51EFC8468B3E C9DuK
593,894,086 *3D054DAC13C631FC6026DDFDF3D33A5F40C385D5 C:9E9
593,894,087 *3D04624C59BDB5738BDAD7C0A67A0A546353CFEB C9e;E
593,894,088 *3D0A4D57A11274A92A22572C5D1CE787B540BBC2 C9Egv
593,894,089 *3D014549ABD8D74ACCD57FF7309A46B0B4372D26 C;9f"
593,894,090 *3D0FBDAA75CCB1ED67518FF913425E514802F30B C9fht
593,894,091 *3D05CA32315E9864AC979ACB48948A3D1187C0B6 C9fKR
593,894,092 *3D022C455CC28C2A69C80EA266E066817E65C580 C:9Fm
593,894,093 *3D0C619FE785B9FAAE004F4D072EA60F9F1F4D72 C9g0k
593,894,094 *3D0BDA269D49C6C87341F98E535E74F1FE353F09 C9g9u
593,894,095 *3D0E890FCE26A4791F3574FE8772B6A9021AFD24 C9Gb&
593,894,096 *3D0EDCA34FAFC6EE363044C5C51C8052285B10AF C9gf
593,894,097 *3D0C53F0B49FC6A922A8BE7E9A565F48E255168F C9gLW
593,894,098 *3D0380AADD32695C8F15BE8286883041F2E0EFF4 C9goI
593,894,099 *3D0CC19014C29705D98E08CBC4952E4FE743BBA7 C9h&
593,894,100 *3D0DFC25AA3B4355C2BA15F69262E7EAC19C70A7 C9hAO
593,894,101 *3D0A4E55F8B8080CB26AEFC8D9665201327022FD C9h
593,894,102 *3D09D19CCFF477A876F3896689E1354FE12EB765 C#9hK
593,894,103 *3D0D55B1E2922729B1EC12EB5975B6070F858492 C9Hu/
593,894,104 *3D0DA35590F1D6731CFC073095CDA68E5D39C392 C%=9I
593,894,105 *3D0389C72335CE70FA20FAE135CA1871A503D4FB C9i%_
593,894,106 *3D06D846AA005BBCAE8BC0DF90416EBAE535EAFF C9I)1
593,894,107 *3D0622F45A0AA8C7729E7CA1A687548BA6E99651 C9i_m
593,894,108 *3D08A0E7F06A97C2C7D951DDB46931D4C2B509BE C9imP
593,894,109 *3D07987EC44170EE00C1789A579127E4121D567F C?9io
593,894,110 *3D02557685FEA86FEA7DB8FB101BAA4D1B70BFAA C!9j8
593,894,111 *3D0D1767CDB9C7B44AEBA355E35714217FAE95B6 c9jdiwas
593,894,112 *3D013AFD5DA6BA745E74E2DE7CEE7232BE1A749D C%9K
593,894,113 *3D0865ED0C458755DE40A6C5617FBE1E0B07DD40 C9K-%
593,894,114 *3D0FDBBED78314F814372AAC4778D7F6C768B2F2 C9L%4
593,894,115 *3D08A77A29F373FF0946D081B8E5A3736DEBB432 C9l6?
593,894,116 *3D0333B6F8338C7A35444D91FBF785179BF7CB35 C9!L9
593,894,117 *3D0CB235A1E73221D1837957B784C215D93525EA c9lgfoat6tj7ljkeqgasr
593,894,118 *3D07366074AFCA6AD761B0CFC14843D56F1147BB C9LhF
593,894,119 *3D0ECFE2A7F4769B264AAFA27B953C297DB97025 C9lMa
593,894,120 *3D0BDA4DE36FD1D1FB9D3EE5CAA7D4508AC80DBC C9?LO
593,894,121 *3D01CC74F9E3373DBDA71AF55A855D736DBFDC22 C9lodie
593,894,122 *3D08BA1999F5FC0099F281B69F47BA812C1BF887 C9L-T
593,894,123 *3D04F0CEB2903FCEA10E56A1E9E97698B0A70EAE C9LXH
593,894,124 *3D09FDDEDE83569333561BB40A0B8051C90E8FC8 C9=-M
593,894,125 *3D0F1AEDEF3CFB76650E288EB53EE63AF1DBBA54 C-:9m
593,894,126 *3D0B1FF5A2F9330D22F29B186BEF1940FB4E77E4 C9Mes
593,894,127 *3D034344258759E9E24D2D08D6805946D8ED996A C9mj2
593,894,128 *3D0AA65D0E72B6A40662DCCB1F09775C10091C33 C9MjW
593,894,129 *3D0DD3379EC7F350D8077EBDD694A2C4E5F879CB C9!MK
593,894,130 *3D09A7B18842C0E7BDD9E73761A557ABBFB1F0A5 C-9mm
593,894,131 *3D09B109340383186635366F6843D0C86ECB748F C9MPW
593,894,132 *3D0C3C7B532A0E56C5DD79CD16A223E5EDDF0027 C9N(
593,894,133 *3D0BDF41DB67510E78BC6FED53B09EB3CD7FDB28 C9N8=
593,894,134 *3D0126B319F38738F23D634391C33FCE49EAFD17 C9nPt
593,894,135 *3D013485569A792706B39FCBAFE98A0C361C4669 C9Nq6
593,894,136 *3D0A4DB36DE3681B302E373A67B7D2841A7E4903 C9NT_
593,894,137 *3D019E9A1C188692364968AA5B3BF4D4A48F328B C9Nwk
593,894,138 *3D0263C908BAF7E1F0B8F1239682B677F8598193 C9o5=
593,894,139 *3D0D58B084413283D936952BBDAE460221676E86 C9o#b
593,894,140 *3D01C3FB55B2417B03EAD5608A31B6F11C5BF99C C9ObG
593,894,141 *3D0511B6FA4DFEEC992D0EDA4ECED8FA20DBF014 C9OQI
593,894,142 *3D0C777D32531E8E23460E6CC38B14551AC79F7D C9OYW
593,894,143 *3D00650DE35B77BE1BE1FB29C0DD4215CDC30933 C9p&)
593,894,144 *3D0A5037BFEB94AF37AD7AB17E802DB14B67AF92 C9P&2
593,894,145 *3D0B85D445A3475E17AB3A605269FB6C0FB74CF1 C9P9S
593,894,146 *3D065F0EE28703C9D395FF91AB6D3921994FADC1 C9p
593,894,147 *3D00ED64F0F474F6D935551C2067FDF113AF36BC C9p?l
593,894,148 *3D0AD8314C0121BB83B469D45F584116FF5F1F6F C9PPG
593,894,149 *3D0E6C80C43618CAFB3105768BA4E5C2696D8D84 C9PZl
593,894,150 *3D01967ABB385164F86815C2347556B848BD0CD9 C+=9Q
593,894,151 *3D088612C9DEEC9839979D460DF9C13799CB0DF5 C9q69
593,894,152 *3D0666EFC1675C1B753D515D006611B30C8D5587 C9Qee
593,894,153 *3D05235A7FE949CB1961097559C86FC1A064A8B7 C9qM.
593,894,154 *3D0EA974FDA82668C0D7F027D7391739FCDE4346 C9QpK
593,894,155 *3D0141E120D79BC1E27D40ABC154CA0FA0022AA5 C9/Qt
593,894,156 *3D047DFB461BD76B541A59DBB91B142B7F3E20D3 C9Qv
593,894,157 *3D0792DDF8FD2DAB07E65475AFD3F40913C84981 C9?R)
593,894,158 *3D0BD223D9BADE603A8E8D47596EC6A5769713CA C9R
593,894,159 *3D0E44E33A81038D753E43FB8A5B61F8AE864B66 C9R
593,894,160 *3D0BEBB48B3C2855925E6EB044CD3F4407E31992 C:9r!
593,894,161 *3D0674F1933F8FE10E18DCB1478982CEC0E5A3C6 C9r1f
593,894,162 *3D088153AF475FFC633D78E0FD0B2DA4E5AD0BB1 C9rOD
593,894,163 *3D0E0E32045D0C85A19EBB01C92142936DE2EF89 C9$ST
593,894,164 *3D058123C0B3C3264A2DF8C4F8A33FAC9B12ADFC C9St8
593,894,165 *3D0BEA85C24C36A0CA76B15B0A972A53ADBB7422 C9S;u
593,894,166 *3D01AE521CFC3B2ECFEC6AFA87145C517FD93CBE C9suu
593,894,167 *3D04BE7C803A7DE93FF7904AB7A288472F924052 C9(!t
593,894,168 *3D01D60BD45C417EE4513A1F1B8430968D2FFE2B C9,T1
593,894,169 *3D0D3AFEBAAE7798255B55C714B61EC52BC0BCD2 C9tb_
593,894,170 *3D05C8D7579EAAB046BBE5A8E67F25878A4EAE81 C9tHD
593,894,171 *3D0AA9D24EEB34749A4459089811AC2AD4B9648A C9TKC
593,894,172 *3D0F54C0833C9DC2E9F6171E5FD31CA5640F0358 C9TXS
593,894,173 *3D078BE3760D5A025B978E98F5F17FA51B52BC61 C=9u!
593,894,174 *3D00E1A2BF533D89513C39A9064A338EADF6DA92 C,9?u
593,894,175 *3D086443C7B8D5934A923D582EB6ADD7017BFBFA C9u$"
593,894,176 *3D0EA6C3191804C4F1C9753BB363A721FA7AA86A C9U5=
593,894,177 *3D0BA6306CE4094FC0D273139EFCAF70DEB0926A C9UCF
593,894,178 *3D0F72EE2A4D06C93956A3ED2D68A9A5F1B4F073 C9uf,
593,894,179 *3D09A8F0C94EA86866684C998991B69659311089 C9uw.
593,894,180 *3D0621642D0B20927F50C2A2BF1F384B387A3270 C_)9v
593,894,181 *3D05D3DA81A6EAEDF7A04C4DEB1A6AE93A4407C5 C9v8:
593,894,182 *3D04F030FE562B64E5989C5303AE5F0E05EA7873 C9V8O
593,894,183 *3D0BE54F26E67E857880BB5C18BD520553E2909E C)9w?
593,894,184 *3D0C17E004652DA355DABB1A9173FBDBEB8967F0 C9W4(
593,894,185 *3D0B0797220ED6F312F74D48DD28A9E2BE2E34BB C9w57
593,894,186 *3D008A3C71F50FB1F58948ABB735D7300F6E2CAD C!9w9
593,894,187 *3D09B9211D14B017252D43B96876492464DC8083 C9W9K
593,894,188 *3D04F38783580DABECD380B50C8E3F15B480F5A8 C9Wa!
593,894,189 *3D02C38CD0B8807E59E08272704CADD749BADDF7 C9WCB
593,894,190 *3D068FF6E80A9632D75A8802214E4AB61F52E990 C&9WD
593,894,191 *3D00F6157128B4AFFB6F695ADD0A3B49B5885010 C9wR
593,894,192 *3D097354AB67C826A571F17A552247A7EB246B5C C9X0R
593,894,193 *3D0717EE41981D16A6CB0622B135940883F068EE C(9Xd
593,894,194 *3D0F5AC62CCCFBD51A6CEA21C17407E0127305D8 C(9Xl
593,894,195 *3D00352E6F1C165B85BCAAC3F060864E5F78B0DD C9=Y)
593,894,196 *3D0F3C2AF75C6669D713043E7D0B18E2F3133509 C9YgW
593,894,197 *3D02AE527A5CB448DE277A339269CC3EB24BC6A0 C9Yh_
593,894,198 *3D0132321BB407A1F073706367CCF32E51B46554 C9;Yn
593,894,199 *3D002030E46ABA763D30BB339549C3243D5BAF0E c9>Z
593,894,200 *3D0C06E46F72A6CB4002C8CAA1D08BEF76FC11DF ;C)A
593,894,201 *3D06D24AAA49887755C402F90FAC75D673F68D90 C-A&;
593,894,202 *3D0D0F95BE757E4EF1FC5CC360768B48E001E56A C;?A/
593,894,203 *3D023EAC0AB236530CD4B5E7CB0B29C4B6F4912A C!A.)
593,894,204 *3D0FF16A495C1466E617CFB75AE8A87481A5E1A3 C.A)$
593,894,205 *3D0D8559A78EA8F5326E764C4EF33F143FC9493C C]-A
593,894,206 *3D0179D266D9A6DCC2E871C95DC8EAA3B2CDC888 C&:A+
593,894,207 *3D0C9C9DD7FB242CE7E913C584FEA67F6B55946E C%")A
593,894,208 *3D04DEEC69CEFC2B87CC9518F872CD2D0B357C16 C+A:.
593,894,209 *3D057200F04B819C9F33E71E9E10A419ED50799C C
593,894,210 *3D06D393D12115B049159AA3B4998AF90CED7290 CA;))
593,894,211 *3D0B9980A7EE3AE76A6EE4BCE9308BF899156260 CA[=
593,894,212 *3D0701D5E2441384CFC43254E5984DE7CB24907C C!a%"
593,894,213 *3D0C641A1EEFDB0D721A60C7F3BB9FF717A9BEDE C?/#a
593,894,214 *3D0B1A16297B7E1680614AC7355DD6B2F4D3FFE2 C[=a
593,894,215 *3D07619EFDE0AFABB7B32B2375AE7400992018F8 C#.a;
593,894,216 *3D0489D91D9F836DCCF39AFA243CA982559DAB0A C#a{
593,894,217 *3D0205FACDDCBA8CC248D73FB8BCB215081F5C93 Ca+_&
593,894,218 *3D01A5980274685B3DD9EC27A7F25D84B0A08562 c~a#
593,894,219 *3D09C0DAD13FD04DDD71E51F652550FB42E8FD93 C:A:0
593,894,220 *3D0B67BAF42E3F3FDE38C34D750711B9FDA8A159 C!A0;
593,894,221 *3D0CFD3BD5ED48D2AA099776DC489B8B2B9F3136 Ca0$?
593,894,222 *3D0DC44044ADCEA0CBF9D7E9312BDD875CD66E6C CA+01
593,894,223 *3D08E8AAAE8D187301C1C1334429B838617C19EC ca02@hotmail.com
593,894,224 *3D02B7422BA4C44A4C1CECCDCDB1F4AA3C45FC5C C=A0f
593,894,225 *3D057256994B86B7CEE2A74BAB3AB38691B14B60 ca0mari@aol.com
593,894,226 *3D0275485CB71B79975270FAF1D8425570113319 CA11+
593,894,227 *3D033F250E2E5A7FE7F5B534171F1E3977F76C96 Ca11ou5ed
593,894,228 *3D01C162C568D60BDC1E2A46B6A2BEB079257525 ca.1601835
593,894,229 *3D0704B45DBB32B6748CAF5E8C750C5D299A7FEE ca18181296
593,894,230 *3D0844048603616F1BE3FBD354FF03B86FEA6844 CA1!8RA7!ON$
593,894,231 *3D08816B2F5940A93324569C980D777636E9E9D3 $ca1der
593,894,232 *3D059982B0B760585E8CBAC522E046EBFAD249FE Ca1ia
593,894,233 *3D0BA08F1769A829C24FDC601F48EDF875D8FBD4 CA,1m
593,894,234 *3D04711EB9BBCCF55C7810E8D3F1E5F1BCB70AE8 Ca1SD
593,894,235 *3D0C8A5462018F81597EBB0A81C799BA0122D3DC CA1u!
593,894,236 *3D0176FEA36B8E46774E011269DB5494C90DED91 Ca:(2
593,894,237 *3D0B6D1DE0F8D62F6B53507B9BE817284ACFD97C ca201090
593,894,238 *3D032CB6FEA264ACF6C39E212C91E9A0AA7C65EF CA20e
593,894,239 *3D0F4D8F2D868D48A331C4CB86CE25B5C00F839D ca2302
593,894,240 *3D04CBE18C2D1FAB339B99B2A9B4C2B4A738C961 CA2IT
593,894,241 *3D0544403ECC36A6713D761637037DBDB20716E3 CA2o
593,894,242 *3D0B7FD3785FACF8201D92A106C86F6BC79C083F C=a2R
593,894,243 *3D047FADC2894BBD59330D1B3CCAE11A329BE8F5 CA2:Y
593,894,244 *3D0F4BEB1F2AA00180480BD3B79F0EB0B2AA5072 C(+A3
593,894,245 *3D0D6D1A0B6C61E8B6560210EB35946D8ED71DEA C
593,894,246 *3D0C7DE692195CA186DD3C506B6028C32FE077F1 CA3%(
593,894,247 *3D0081543C2000A9BE14A968FD0F5B71E660B0D7 C&a3_
593,894,248 *3D0E6A4E151E8E56465D65D77A489B5C60E55BC1 ca312@taiwan.com
593,894,249 *3D09EB9F8220A1DCC8F59B426D85C22E79BFFC87 C,a3F
593,894,250 *3D0D57D0B29120F536384A367E842737B6785BB5 C/a$4
593,894,251 *3D0AF6A5F7718D9F2720904436681C363652CD6B Ca"4(
593,894,252 *3D0DA034B504ADE92DE340EA06C8EBC159AA1D7C Ca4($
593,894,253 *3D0CF7D42500E41D91FEC55F863938361467EB38 Ca4Bm
593,894,254 *3D0C475CF7DD2621BD16215F6AB36188000B38BB Ca4pF
593,894,255 *3D0DB5E57801BD80B639C212B2B1AA1F509EEC91 CA4tO
593,894,256 *3D0CFE3BB71D3E0A36127ECE5855F6446D503401 Ca53h
593,894,257 *3D0207EE0705D8F23E77CD7210BF333F79A20D1F CA5%S
593,894,258 *3D0FEA5F8E64A0DF7943ADBB4E909AE18418F8B8 CA?5v
593,894,259 *3D00013B7C8C8CA7DA34B011EDE35E3E6FA55A6F CA!5w
593,894,260 *3D0FE47B80FFF08966E16C4576B7042500E2EEAB CA_
593,894,261 *3D0178C1CE947171112959E3C49C6D4F30BD5B9E Ca6.?
593,894,262 *3D06313C9BF86ED5BF0D4F64E30E14307EB0DD7A ca6280093
593,894,263 *3D057CD72D8FA744E105AB3B0E8271BA8136B5FE CA6476596
593,894,264 *3D01438F49AB1D6FD35B5D03ED6C2AE81675AA62 Ca(6D
593,894,265 *3D063210AAD366249DE421F03E9BF636B59DBBE3 C,A6g
593,894,266 *3D05680B429D1B6246DBC6C568F839E44907CE38 CA6Lk
593,894,267 *3D03548EB61C5C865FB099E4814D11F9E63FBAAC Ca!6t
593,894,268 *3D033633AB24B5B1127FC2E6DF6977627A3BEDD6 Ca_7#
593,894,269 *3D01C657721105C4049706FF8EC0C21A5AFDC8D9 Ca7a9ori3s
593,894,270 *3D09E0C228A5F662468677A87C338681B9635154 CA7e0
593,894,271 *3D00E5BBE5B41B7BFCCE3291D63D6E98E0DC45A7 CA7EV
593,894,272 *3D02867B8A9BA01097676BB7C75CEE51E4113258 C/a7H
593,894,273 *3D02E7B51656B1D917B2406179BCAB862A5F7251 CA?7O
593,894,274 *3D06898D535320E949C1ECA671CC3D732E7B82A8 CA7P"
593,894,275 *3D0AF8EB03831DEB0089E2B29DEEA97495D76731 CA7TE
593,894,276 *3D06427BFE6B18F6C1C88CF4C46BF466A9C463A7 C/A#8
593,894,277 *3D0E3EFF2E14BAFF78C22A1CE03FD7BC12498EA1 CA8kK
593,894,278 *3D0D8FA1FDE15BD9781E443B6C1F5732392EEDDC Ca8$P
593,894,279 *3D0B3FAED7E72DD57E1790714837BAC48002D741 Ca90G
593,894,280 *3D0B1DBD9226FDB22B984A0AF0668A76F52280A6 Ca91q
593,894,281 *3D035EEC383EB7804CDEDB5D9B332C22809CB6F0 Ca9ev
593,894,282 *3D07E766824EF8EAAF49DF725D4E320C019BFCE4 CA9Hg
593,894,283 *3D0BEEEC032EDEF1E0E52DE4AF172ED11951CAD0 Ca+9Q
593,894,284 *3D0C909F6EED4E8496D787EB4BA40A18A1C738E0 C?Aa$
593,894,285 *3D099D68C4392D3CFB89A96C0D857551CF65E6E5 Ca(%A
593,894,286 *3D0A1D8DB2F403949130FE493A46ED69345D0CBB Ca+A(
593,894,287 *3D083F9F7C5F4053D9B1FD4465082F67B05740C4 C]?aa
593,894,288 *3D008C6499276E4AE7C8D6A5F8CBC78796D9183F c!:aa
593,894,289 *3D047A86AA61423B51EAD6EF9E5D755511CEE41A CA!A9
593,894,290 *3D0BF7593591FC0E7646532E99F79648EDE66166 @C)aaa
593,894,291 *3D06FCB2ECAC98D11BA53DCB8274C48655ABD02E C;$aaa
593,894,292 *3D05E191934F5E879379B75894F41C3E963895FD CaaAB
593,894,293 *3D001FB3FAF003C19C05716E6B8499BC3B095FA4 caacks@aol.com
593,894,294 *3D085FA69A0FB7EA153315FC194FA356CEB5CEE4 caagtgattcttctgcctcagcctcccgagtagctggaattacaggtgcgcactattacg
593,894,295 *3D0406C3ABFE3AD31236BB0409E66BC91E6A1137 Ca)aN
593,894,296 *3D00DAD76FDF127DFBBD8D59C97716DA7A7C6149 caânu
593,894,297 *3D09B180D417F07BE94978F069E14810E318F5B8 caatataaagagtcctgaagaatgcactaatttttacatgttattgtcaaccacttttca
593,894,298 *3D08266DDAB5157D759CAA95085496D805D9BBC6 caatingacerrado
593,894,299 *3D02FB1F7BBD06A7AFA93141E6D6208F299C6B1D CaatK
593,894,300 *3D04C3B1D51284A3DFBC9BD1A04042255F347174 caaug
593,894,301 *3D060106091B4DF693026B133E9B7F0DBCBC5ED3 C;AB+
593,894,302 *3D0BFE577C0CA0F0DB95F7D45555C2A9A8EF9DF9 CA%b/
593,894,303 *3D02A5D0F659427D2CA07E5C7FD76F3CA289312D CAB:4
593,894,304 *3D0161F181159847467DDF2A8E8842F22F85A853 Cabalar9
593,894,305 *3D0872A1B1F5797F3C44FA62E43E0CAA3FA4E126 CABALATAN-ALANG
593,894,306 *3D070CECECFFD7E6B4DB2CF8870C2C6BCAA7DFD2 cabalcada
593,894,307 *3D0EF8044639A2B38EEA118DF5894D17CA004AD4 ‘Cabale
593,894,308 *3D0EFB5CC63FB777CBDC94A14076D9F795A822DF Cabaliers
593,894,309 *3D0F63D4A96C0B2E63953C2E6E644FF4F10B5867 cabalistique3
593,894,310 *3D06845D9F560005A9AE3636E76C84589A6DA76E Cabannia9
593,894,311 *3D056853563A5F18350C3E4E6EC6A505EA10DBFA cabanzo4
593,894,312 *3D0CD5495B3A8507C9F787517C263086DC4ABB2C cabassa12
593,894,313 *3D0056BE96142675F9B22B364E6B66059E025F90 cabbagepatcholympics20042005
593,894,314 *3D090E49A62825584A01597A189656332A8FC499 cabbagesandkings.comwww
593,894,315 *3D078D181C4726374CB1303F9FE0F52BAC940D4C CABd=
593,894,316 *3D0D274D8424E727C1B0C994376774C5A181BE5D cabelinha1234
593,894,317 *3D002283ECC151C51697F7EAF3E7F5E42E900202 caber
593,894,318 *3D04D5CA17A4C1396BC8EBBA9B28A6A01BFA2595 Cabezadeestado
593,894,319 *3D0F769DD002A85BDC091A8B30C3114689EB0B06 CA+bF
593,894,320 *3D0B5AA2346A5EF1B4DD86B6DC3A39E8B78366B6 cabf08fy3
593,894,321 *3D02C0736E2233008B174D5A31463C96A6B4084B cabh@cnuninet.com
593,894,322 *3D04BE38DC97488121854752C3BDCD6314854C90 Cabilleses
593,894,323 *3D0C7399CC6BDF9C5EA59D23478022C2E7BD17A3 CABINETRY4
593,894,324 *3D0B1D4179EA6DC7D1B9FDE466874853834ECEA5 CABINS0
593,894,325 *3D0B6F4D556ED5D73A2CED142E0F0AB246151AFF «cabiria
593,894,326 *3D0742A926270A32AB48E3A1CA028A8C9455FF18 cabjljtjb
593,894,327 *3D0CEE5A78F600C64BCF11ABBF2967D359989AC6 CaBlB
593,894,328 *3D03D2DBF9A70D7256C5E8B0827FDB6C84F831E0 Cableguy1
593,894,329 *3D017D2B66DAEAECDA1ED63BC300D79E92D22B59 cableone32
593,894,330 *3D07EECF183091F9F3D770A0FB9FC69DFE696972 Cableposts
593,894,331 *3D0EC65433B4C0E4024554FA408E466CC74C1331 CaBn
593,894,332 *3D052E3A78C3179F2EB5101F3BB50E646FDF4C95 Cabobbing
593,894,333 *3D03CA5A7421AC9E578F338265B2CD20D0E0D2D6 caboclinhos: iii. 'baiao'
593,894,334 *3D04253BB8E6F6F4AD7E2960959F1469315E5602 Caboculo7
593,894,335 *3D00A4437CAEBE824BEC02626C81B901C1620661 Cabossesed
593,894,336 *3D0F10D855D6586129E5C033EE03560FE6A9091A cabotperkinsrussell
593,894,337 *3D0A9BAE09B9A2452B8EB8DDE82C359D47998EA6 cabraien5
593,894,338 *3D09C5DBFB069236D9D283B6E25484FA02B8DA57 cabrallist
593,894,339 *3D086BCC3D9A3A77C29F6E3DC746BB442EFCDE73 Cabr
593,894,340 *3D011419012DF9A45741A77785B2EC54F9C4FF9F cabrestinho
593,894,341 *3D0D60E43AD30A1684119BD8D6A77C16D08DC508 CABRET4
593,894,342 *3D0CBE03AADFB35DEAB0D7FB0C88408F78645761 cabrinas1
593,894,343 *3D0A9C48C24463F0C2A93EEB6BDCDE61C2CF7376 cabroada
593,894,344 *3D01B16DEBE2F4974A79E6C17B5ADFC42C54F186 C.abu
593,894,345 *3D00F43DCCDF83E0730CD53CFDA2FFA100E29E83 CABUl
593,894,346 *3D086B7A632D08A8AC8E7CDA2874B7A9FFE1360E C%&aC
593,894,347 *3D0C24C933FED677E5FB64546925CFE01BC1D050 Ca=C,
593,894,348 *3D0E63CDF6D517CEEE3C461365225366FA0B39FA CaC;!
593,894,349 *3D0BC3BF639165F66BA84903A1F7A0174ABEA664 cacadeen@aol.com
593,894,350 *3D0ACC4AA4FFCC4812CE1CA7766EEC2EF152C97B CACADU-DISTRIKSMUNISIPALITEIT
593,894,351 *3D0EDD242F9AB1F10FE5121FC71A27CF65016FF9 cacancerjournal.comwww
593,894,352 *3D03EF691CE242AAADB4B9DC42CA7C00CE738BEE CACAPIPICULO
593,894,353 *3D03DF0436B355BFC7FBDF3A0CCCD427819FDAC8 cacarejastes1
593,894,354 *3D06378EC73A59D85E043D73AF65A5B38C40FD30 cacatataaaaccatcagtttgcttttccatctttgatttacattttatgaatgccaatg
593,894,355 *3D012F72B763EA06E5F8A631D9A72ECF847F227F cacatlin@aol.com
593,894,356 *3D0BD8C822F9B26E92AC0DF5A0455326F855AD10 CacB:
593,894,357 *3D0FDFE04ACA63F36F2ABB18192BED51347C3129 CA#cc
593,894,358 *3D05406899DE8CA81C5C8F3CBABCEAE6A67BB272 cacciano7
593,894,359 *3D057B41C853F79E7B617ABD0ABF2C5E3E3B08F3 cacciasse.
593,894,360 *3D04531C58A458B9BAD1582942BEEC95B4CC0148 CaCEo
593,894,361 *3D03E9AF675D1244A72CB7637321B090DCB09E6E ca c'est rigolo (just a gigolo)
593,894,362 *3D097059BF24BBEA4B0211EDDC8EF49B402143C1 CaCgu
593,894,363 *3D066602D6CBB85B88EF465486C251725334A8B2 CACHECOUL
593,894,364 *3D0EA1F2BD39D22D31C7D6000984B59C34697019 cachectic@hutchcity.com
593,894,365 *3D0E6EB000AAEADF12DE712DE045CA3B778C7AAA Cachetais5
593,894,366 *3D0DC909ECF317AEE2E89FE3412118CA63CE312C cachetindia
593,894,367 *3D0D79DC4551CB6E39DC0844BB2FCC747528C5E0 cachetteert0
593,894,368 *3D08A2053B89BF26414E5CD77831F6C979A25C2C CACHEXY?
593,894,369 *3D08094A816976FA14E612AF6CB84F01FF7152BC cachín
593,894,370 *3D0DD92DA82C5076D8A0FDBC53BD05757BAFB6B6 Cachworde
593,894,371 *3D0FBDDC94A25A945BBCCA759971CD8A8EDF42E9 CACIBAUDA
593,894,372 *3D042800EF05F3A7152B7E6468F6B020BC08BC67 cacinkrapid
593,894,373 *3D021FE9607387DA5D997190BB036E66612A957E «caciotta»
593,894,374 *3D0AC8BC7EB7C65D692A0CD513F6F5500CFFAF03 CAC#m
593,894,375 *3D0F701F36B7E2853B1F8B0C65CC628F194C91F1 Cacnet-as
593,894,376 *3D0408E2DC4CC8F0B0ABBC360C1F63AE0E56F13D caconcpt
593,894,377 *3D0DF6AC72F7862F6040820B431AEB4649608F13 Caconya4
593,894,378 *3D00C66F74BA3BFAE4A81B0565D603B1125AE5DD CA;cr
593,894,379 *3D07CAF04705B21A9D8938C8B5F16FBA6C25B788 CAcs?
593,894,380 *3D067E5BC37118761C9443934040851DBC3E790B C-acU
593,894,381 *3D0FC337EF67D78BDD203FCD171054DA511D4470 C_ACV
593,894,382 *3D0EC74D18821C00142642D4D0FF4E39D01BFBBE C"AD$
593,894,383 *3D0793ACBBA1980F0F31718A80A714ED13DC8F36 C=!Ad
593,894,384 *3D083A0E3568112305DF86A060CA245807AEF263 CA_d+
593,894,385 *3D05A8DE49527E3F70999FA49462BC17BF720A51 cadastrais123
593,894,386 *3D072CFEFED0509E3A24586A6B58B901950D1AC1 cadaverisar
593,894,387 *3D05D6D5DF943758505B7317003A315F548F4278 cadburyhugh
593,894,388 *3D035FF67AF13BA2686B29A544E79C0A1F05192D Caddarics0
593,894,389 *3D054CDA09B2464F99C70BD98517C0F2410E2A46 caddyman76
593,894,390 *3D06B05F88ED16C5FC1925D8633344E9596CA97E cadeaguitar
593,894,391 *3D0342255376E1D5F164BDA40DC41697788FB757 Cadeau5
593,894,392 *3D0AD2D8477D5E63076FDB75B1BD8F509CFBCE84 cadecera
593,894,393 *3D0A59182D3B8709035D362097F05B32AE208D17 cadenaroja
593,894,394 *3D076C1FBF322AEA27D6F464620CEB7180C23E1B cadençasse
593,894,395 *3D0A4AEF384BECE1197EEEF6210D168181C0F37D CADENCE06
593,894,396 *3D0809E75CCBF34FAA2D5AF171907D9EF52E5078 cadenia1
593,894,397 *3D0F3E0139CE5CB7143FFC45012EEFA2D99053FD cadentially
593,894,398 *3D05BB6F2685BBACB667D94D30BE8F0894BF3B72 CADET'S
593,894,399 *3D0978880CB6E1C7994DD3592932E7683FC267D2 cadetumfer
593,894,400 *3D020F54D6FFC20374145B16F7C36CA205CE3E6D CA(Dg
593,894,401 *3D0E7EAE48067DF8D5B9BE962E9908854A873BB7 Cadgines4
593,894,402 *3D0839106DB46DEDD460D9F1CC48ABFBD792F28B Cadherin5
593,894,403 *3D034D85A93FFC857C68289D6CCD6CAAAB5293AE C$ADi
593,894,404 *3D0216CFB40ED93B81EFD40635AB259CCAF520CF CADIANCADIAN
593,894,405 *3D04FC0718E0261C5AD63E6D01B58548964C73A2 cadibarra
593,894,406 *3D08E3DA9D03402EC5E723260A3F5B92BD0105A5 cadiboba
593,894,407 *3D01C339497445C90D4C8BC1AF2D1D2B2126645F cadjster@aol.com
593,894,408 *3D029F8225518975EE3B159817C7E1ECED07C5E8 CaDK?
593,894,409 *3D0E8C164129DDB271601C12C2DA47DEBDDC62AB C:Adl
593,894,410 *3D0BCBCD3015AE0663B5331C06499A8298E7E4DF CadLB
593,894,411 *3D08E05FDB7D3D822B3114B658E7991DBE60A5BF cadlc@yeah.net
593,894,412 *3D03FF88C7F71DE1B73DCA8CFB0D9F8858863061 CADN2
593,894,413 *3D06D3C4296AE527C039E981B90B7B97D8AF086A CADp1
593,894,414 *3D0B2DD1BA144AF8B03E71B59C5ED721F56B6D20 CADRk
593,894,415 *3D0D5F3ABBBE7DF05A58C0B6C5E7114C1F4E81DF CAdS4
593,894,416 *3D07998209D726307AEC89C603A86F75DAC30B6C cadsa@yeah.net
593,894,417 *3D0941FBD22293573BC9870665671BFCB9705CCA cadsuper
593,894,418 *3D012023D98113E2FBBBFFA44362E7F0A7A7BC86 Caducaban2
593,894,419 *3D0498149CF28359E9B69BC10D12BF5065532394 caducarseiam1234
593,894,420 *3D092E4A9D86142454F79469D8EA1B94A6713F30 cady001
593,894,421 *3D00F78652DCFF4DED19C1E93F548A3399974D98 cadyb007
593,894,422 *3D028492529C6C5271E23408A0AC4E90C10BD92F CA.e,
593,894,423 *3D0DD0440A3545A676D77F4C967EB10A18287FCD cae4hits
593,894,424 *3D08B7EAE77A36D14436B72D045EC7BC47A763AC CaE8R
593,894,425 *3D0758070095608902A25845C2BBD34118D648C9 caecilia sherly natalia
593,894,426 *3D0F16B208226A02A93EA59F1065906849E53452 C(aeK
593,894,427 *3D0D42DD78D1800E15D82C0ED95521A1B3E147D3 caeldrom
593,894,428 *3D03A9F7C9B1B064182A69CB6ECB680A4C9A5043 CA.EM
593,894,429 *3D04AE863108F241CDB390C1099A97C51EB3D3F8 CaenI
593,894,430 *3D039BBF763A02002EF413854EED1C90F8A29FB5 caeninum123
593,894,431 *3D0905C41AA62BE85430E2DB0584FE723025853E caero@aol.com
593,894,432 *3D0EEFD75E8B2E24E02AE3909505621CC75BD430 Caeruleo1
593,894,433 *3D0D444ECB0FBDA2E9882C5888108AF61AADECE3 CaeSAR
593,894,434 *3D043A059827048F9CD50FD508CBACCE1FCC9A56 Caesar1313
593,894,435 *3D0C47463E28063B954765D08260F81D88422375 CAESARPEARLJAM
593,894,436 *3D08FE768B760056C2E3B96A7557A6635F5B9EF7 Caesarpepsi
593,894,437 *3D0527BE3558AADCDFD2B9A33DA16A4F73605831 caesfun@aol.com
593,894,438 *3D05A9BB14226AB1C2953B1E5472B69316565554 CAESURA4
593,894,439 *3D0DAE8D7E4135CF1B1566560C0F54B14ADA5FCA Caesuralses
593,894,440 *3D0159652D3F28A15209393905715538FDE08728 Caethiopped
593,894,441 *3D0D7A32BE129E95339319371ADBF1644EC402E6 CaeuQ
593,894,442 *3D0E149985589F9032393883EFFC6058ACF1B1A6 C-AF?
593,894,443 *3D0A93081E8F76CF2235B10E0B9226B70174F9A4 CA)"F
593,894,444 *3D0FEB0EFF80D851A2A99E265752B99E1C160382 caf5000系
593,894,445 *3D0EDB66E1D9DE2F0D74AB34007971EE86242860 CAF8802
593,894,446 *3D050A0216FA987B54C3A46C148D6BE4E4430315 CAFAECAF
593,894,447 *3D0EA7411E006A7B31F798F70EC80618F3927C24 Cafaecaf5
593,894,448 *3D0A0DC6A0039B2874FDBF20B659F4DE25321ABD cafechaed
593,894,449 *3D0F499B67663DE01EB8C61819574E25C7713E2A cafeinadas
593,894,450 *3D0468B3A2A7020D02FFBCFF84C2DFC204A9EBA7 cafetiers3
593,894,451 *3D08661012C69D506C5177418EA0AD3223C26B62 caffell1
593,894,452 *3D0E66E89F86FAD9771FC3F663A8B14B7C81CE96 caffey@hongkong.com
593,894,453 *3D03751C7C3A35AC27BF4BEBCB7A8EDA4CA1A0C4 CaFg+
593,894,454 *3D022E30B7493C6C728ACFE1219E45136F9BDAC3 CAfif
593,894,455 *3D0FEC9F8C7535189A150F0474DD8C77A3E57B95 Cafk-
593,894,456 *3D0724D63F7AF49210F1CEE744F8D5CA1573BA8B CaFM=
593,894,457 *3D027212EFB215878D6CC4A2C8F56324734E74BC CaF?O
593,894,458 *3D086624DD17666798A2B90578EE339AD8A27188 CAfQR
593,894,459 *3D0B6EBB66138EB299CD381E794E7FDD116A0CEE CaF,r
593,894,460 *3D073DFC50832744734FC541ACAD4E6A30745133 Ca=fS
593,894,461 *3D017889C701C506C39263E18A138B279AE12FF0 C+A,G
593,894,462 *3D07C5870814947A2761BCAF24B1CC05BC4BC713 cag@21cn.com
593,894,463 *3D0EE376C38A4FA1B4AF2AA3EBA78B2702B3C7AD CAg67
593,894,464 *3D04341A14ABC86FD89FB4E6CF99AA807A84B404 Cagallanes
593,894,465 *3D079352492FFB3920F843A9863D9914FD7623D3 cagarte123
593,894,466 *3D0E206AADC73C1928AC29981B083B7432277EEF CAgBo
593,894,467 *3D0346FAF1BD5A928400031CA62024D22162A8EA CAgD)
593,894,468 *3D0BC08311C199F3E7AC0D77FC72FA7A01C8764D CAgDk
593,894,469 *3D0268F7B1353D0738424FB42132C50459E15936 Cagelessed
593,894,470 *3D0404BE802393E2EF2134D9007FAC4F43D24D80 cagene1@aol.com
593,894,471 *3D0D933570BD75BA3B4F64EFD9BBBC3F66890D29 Cager7
593,894,472 *3D0D0899188210D716EB4E1F3AAFEA3CB8CEC28C Cagew
593,894,473 *3D035955C7946CF24A5F3B2F9444C0975994CCA7 CAGhu
593,894,474 *3D01798F1D8B59E4A269F3AB9AA28DF481F2B559 CAG:I
593,894,475 *3D0F908B5B1932B2A7C5B6AC16305CF4FE41AE23 çağındayken
593,894,476 *3D0B6495431F848998C56E86ABBE10B72882F988 CagKF
593,894,477 *3D052BA53C41C91089ED81D738590C93CDCEDF91 Cagneuse4
593,894,478 *3D03016A70DAE27977243BEA790B6044030C7754 cago@sinamail.com
593,894,479 *3D0BF088D69F76908DF11E6AA3557608585BC889 CA_Gq
593,894,480 *3D08477DF3CD3D21633792D37CD139EC525E9E10 CA=GR
593,894,481 *3D0E474261974F2DCE2DBD683F9BCBBE2D9A7816 CaG=r
593,894,482 *3D07E0F3DDD5D4FE59ECBB9DF090E09619B018B0 cagrido5
593,894,483 *3D04C767EE983EBD1522FBD137CB3E0F2802B2DF CAg!X
593,894,484 *3D0047A771CF252CE7B36E70F88AC0D72D098B2C CagYp
593,894,485 *3D09DF7DACBC6F7360BD0CA357DD0E7520E97803 CAH;+
593,894,486 *3D07F8F9D9C3953400324072671DB473D3DBF708 C"?ah
593,894,487 *3D0AB28FEFF8D83CAB72672120E6DA73A80F4782 Cah0O
593,894,488 *3D0528F5880359734C36D0D39A0E545A661440F1 CAh2Z
593,894,489 *3D0EBAD44C2E704D73FD414CA96926F8A5C6410D CAh80
593,894,490 *3D030B8AA30DD76F9DA322F349AA9BC4F7478F3D Cahalls2
593,894,491 *3D0E977E8B983A67F6597682590E0E49B16B35D1 cahanged7
593,894,492 *3D0DCF08FFA7D4C19402CB92FFA76631AECD8810 CAHBJV
593,894,493 *3D058E1756F2BB7F472C3413CA1BCE30E3B35DD7 CAhfq
593,894,494 *3D0A7D000BFA20C4DF2C489774E5316AF896A9CC Cahiern6
593,894,495 *3D0EA28387E5EB1A4EA5F31DEDED2F21F2DC6915 cahit berkay
593,894,496 *3D0AAD4CB89730F6CAD7B50DE11650DF23E38961 CahKU
593,894,497 *3D0CA193D65B76D0D249102DC1BBABC40A2A900A Cahorsain
593,894,498 *3D0CD4ECCD9560631EA7A0D19866BD8022978AB7 cahoursed
593,894,499 *3D085550C4C31D9766CFA739D6751629B3CF3BBE C:a:I
593,894,500 *3D0A62B2C661291F21BB5C5162DB40C55895C68A CaI.
593,894,501 *3D0000BF01FA724E08DDCA6E82437E1A2837CAB5 C?aI2
593,894,502 *3D005507B3BF2B0727864D14028EF4DAEDF85222 Caiacan1
593,894,503 *3D039F720B18C8C3810AD5707AFFEA7A38FE8F6C caialbertx@guiwang.com
593,894,504 *3D071D5E2FF2BDF1EEDA4686667D3D5F8F4867D4 caiangelav@btamail.net.cn
593,894,505 *3D0F2047C5D548CDDFE3F429BF55C4657DB4D1E7 caiangelb@xinhuanet.com
593,894,506 *3D0C7F9C7F755D586A306820681D4F6FAD4DA9E2 caicarolineb@chinaweb.com.cn
593,894,507 *3D0474DBF1969D365438F721336C78F4630FF171 caicarolinel@china1mail.com
593,894,508 *3D0995E8C0867A5ABB606163ACFCC0F13604ADD2 caiclarkd@gzyp21.net
593,894,509 *3D0F6AA5958913144CEBAE4EBC61209EA9685C30 C?aid
593,894,510 *3D0BBC3B8E5363D68098D8D60C72643F8FA4841D caidavide@cqcnc.com
593,894,511 *3D0B719D0ED9FC649FAAE5DFC377CC11CBF8448D Caiden959
593,894,512 *3D0DBE3E05BADB8CFD0122971E788DFDF0022A1B caid's
593,894,513 *3D0C2583D6DFC6F71CDDB576431C76DFB7BB2044 Caieg
593,894,514 *3D02F9BAAC5BF853C7686FCF825A1C16F3A43FD8 caiemillyr@363.net
593,894,515 *3D0FF86AA3EB33EFDCAA2956061A2413633FFD56 caierict@chinaweb.com.cn
593,894,516 *3D0BF2E8D370BE6F48A7F932853198C48C6B707A caigeorgez@wx88.net
593,894,517 *3D074E0CFE1A0A3BC30392D937D87092B5D854EB caiharrisonq@thelady.net
593,894,518 *3D0E88709DADBB8E9A05E6C331E132C00EE190FB caihuansai@telekbird.com.cn
593,894,519 *3D04627750EB6269E0B21B319F5C466F401B4BEF caijackn@ynet.com
593,894,520 *3D0F96FCDA71A55E9C8923748585F91962FCB319 caijefferyp@zjonline.com.cn
593,894,521 *3D011368FFBDFFD575F1EA2A094956F4FA81782C caijennyv@taikang.com
593,894,522 *3D08575C42E0EDBC64C9B09E715E5A0A0939A977 caijimi@8848.net
593,894,523 *3D0512E1FAA36507C3036E723273DED115D92A86 caijimmyr@focus.com.cn
593,894,524 *3D0A26F010A5519DEB0254B7E312BCC8581AE07C caijimmyt@cqcnc.com
593,894,525 *3D075105178CCD1539311AFA32E3DD11969F2D57 caijimmyu@focus.com.cn
593,894,526 *3D0CF23C8AD928F2D80806D4D61EFB569F9D7B8F caijimv@mail.china.com
593,894,527 *3D0720AACADE8CEBC32709A9FD2A0F8D5782FA20 caijosephf@citiz.net
593,894,528 *3D02C998A8DC2A52078C6815C690C8595A206540 caijoyced@8848.net
593,894,529 *3D042F1EB7A9698578D1CCA964D85F8AB174D741 CAIjQ
593,894,530 *3D076E1DAEB50649B18E1C61ADAA46BE037C0170 cailauraq@5415.com
593,894,531 *3D08382107E99A07ACAE68905A8E8C0241739A81 cailaurencee@0451.com
593,894,532 *3D08BF9F56028056F0C624D4E8ACF5909453B5A6 cailindad@wx88.net
593,894,533 *3D0E33D7BDCAC3EB4308342D160A8372C36E08B5 cailingji@263.net
593,894,534 *3D086199B7842EDAD91347F485DD3810B4384FC8 CaImn
593,894,535 *3D054DABA7CF28545EFE49171F76EF2F0A365869 CaiN%
593,894,536 *3D0FA214C72D052BF5914CC16BC7296AD3137045 Cainque4
593,894,537 *3D0C0EE200B1C893597858A3816D6BAECF08E523 CAinU
593,894,538 *3D09F4B0CD9A79DF0CC6C96DF6E245B6D16C0159 caipengweng
593,894,539 *3D05EA997A3BED75EE4CFCAD758C3198756722CB CaIq$
593,894,540 *3D0FD02B634751940F5D3FF67DDFC29BB8C000DA CairnTerrier860
593,894,541 *3D0E121AA6DCF8923CB408BAEB05E5A4F7ED9DCE caironaldq@ynet.com
593,894,542 *3D09EEADED132D228BE6D0506C5D2317B7F1C4CD cairosea@mail.china.com
593,894,543 *3D0261AFF47643AE6C698A2B4028D0A15542D81C cairosee@citiz.net
593,894,544 *3D0FC7621720F18E0BA8E82AB5AC2486B3A0DBA1 cairozoom
593,894,545 *3D0C5ECDC7EF213C9DDC4611A80E090821E40771 cairtBSW
593,894,546 *3D0D45F253541FBE86BAB8D6E4B146DC233310CB caisamueld@cnuninet.com
593,894,547 *3D0BA2C28A4229D43CA948EECB4BEA34E5EE285C caisandyi@km169.net
593,894,548 *3D01EE3C6084D72DA31E0762425F3B94B5990CCA caishuodeng@mail.777.net.cn
593,894,549 *3D0CB2277CAC572E8F0E9C93F37E65DC225811AD CAISSERONS1
593,894,550 *3D04E4C26396FCF0B59CA7F35DF14627F8ACF291 caitchan
593,894,551 *3D096988A2C035383F3302512EC9BE4EA011D622 caithfi9
593,894,552 *3D09FC755D91BCED6A7C5B816CE96C9417E7F1E2 caithomaso@soim.com
593,894,553 *3D0E25F6FE36B0243D71625AF22903A2F94A5257 caithughes
593,894,554 *3D07A48E51327384D3F6B2FDA8F4982120A3F828 caitianyong
593,894,555 *3D049D99FFC081AD832B4D2DAE48E26F270427BC CAITIKE16
593,894,556 *3D05A29D9C9093D88E37AE62DD264AFD32733C01 CAITLINDAVE
593,894,557 *3D01F326E42B8ED37C58B7EBD0AFD23D4149D7F4 caitlindraper
593,894,558 *3D0B0EC9733028B20BE31C45CA42D73BCD10BE5A caitlin ebersole
593,894,559 *3D054412878FE9D268EEBB51F802584BA3884310 Caitlinfisher
593,894,560 *3D061436C22CF1A3B1CF3E4488398EB3DF859D32 Caitlyn546
593,894,561 *3D0139993D8C889F0747C56A8509D09B98541088 caitrinses
593,894,562 *3D0D95A4EE77F06EB8815E4123A0271F23960157 CAIVB
593,894,563 *3D09887BCF9631F79301AEF3190EF2818C150FDE caiviviane@km169.net
593,894,564 *3D0CC613A8921FF0D070617143C93DDBDADC8B6A caivivianf@sy163.net
593,894,565 *3D0627EC082A07B464C1266EFBBDF2794E8282B8 caiwala@263.net
593,894,566 *3D094432390B5CA03B8FF3C3B7B773519F829BCD caiyunha
593,894,567 *3D0EB045F367A58D540A86026850A7216A419BA8 caizenglei@188.net
593,894,568 *3D0FA56B9A09079D021B2FF434EB0B94649F9DA5 C/!Aj
593,894,569 *3D09063B892FDDA8C542F0394BDE8C667A961983 Caj2a
593,894,570 *3D0BC4CE2C6B942ADCC938D4092785EB937A484C čajníka
593,894,571 *3D00DE9657F5AF7AFE1267DE50AF2248EAA85F2E CAJOLLED
593,894,572 *3D017B8FC004DE46026566110202CFC1A7734870 C?Ajs
593,894,573 *3D0A72F57FB04AFC057B5C159F96CFB23BF94308 CAjSk
593,894,574 *3D0CB07DEF7E340F7FFDEE1C0E2B0FC4AD93B128 cajuatux87
593,894,575 *3D0FBE2F8862A724B27E8C5518339F99153A9017 CA=K(
593,894,576 *3D096DB9FF07ADE0C16F676A1558066CD67E6BDA C)$aK
593,894,577 *3D0F7B83A85FDBC1AE41679E51C2CED8BA56A3CD CAk4C
593,894,578 *3D0F0A705ED5F84C8DAF8DF979206DDDAD0C3BFF CAk5(
593,894,579 *3D0D10D42087E08BCB69CDF8E77A597BA8D14277 CAk)6
593,894,580 *3D0DDC88980AB447BF671F6B4408D600A609FA31 CAKe;
593,894,581 *3D0D2D9DE1D9237F8F01702C1C67B8FC7D886A9D cake@100yi.com
593,894,582 *3D010FCBF1FB79EB361DD0442355742AF074E7E6 cake1cutter
593,894,583 *3D01251810F977F04434322DF7C59D6A41085133 Cake Walkin' Babies From Home
593,894,584 *3D0C65C1CD08FE3983CB5489B8854DA915272588 CAKEWALKS1
593,894,585 *3D0BF2CEDFA148334A6E2D68CDBC9C01774FC89F CAkfb
593,894,586 *3D0268B0646BB62EA6F56D0FC5F1D6EC5428A040 CaKH
593,894,587 *3D0CAB1B64FA425898FE11D0F8A561780FE94DAB CaKi.
593,894,588 *3D0ACC85CFD8D0A5288676D7983F591498A3A7CA CAkKv
593,894,589 *3D02C0524419E6E44142AE6AFF791F2E4C5178D4 Caksobsws
593,894,590 *3D03E9A796ECF11C4AC0FF74E79AD667348C4140 cakunha
593,894,591 *3D09764CD60600762B24BA9BECBFAB0CF0B6B6DC CaKVH
593,894,592 *3D0DCABB7BC933A005CEF9F14DC862D2C477A64E CAL?"
593,894,593 *3D09B64310458768130ECF0163FFD9B0C4BD363B C(a&l
593,894,594 *3D0B43FD1956EBAB860B36899E626EA575465A81 Ca=l
593,894,595 *3D06B42B7FC9698927969E87222D5D5BF4374B0D cal1dave@aol.com
593,894,596 *3D04B79374777FB4470AB7400EA376C410BCFA23 calaboços
593,894,597 *3D0EC202AC8ACBBA87ADD5688F8D0B1935584329 calaitas
593,894,598 *3D0E16BE2D68BEBE896CD64E21FDECADCF85577D calakmul9
593,894,599 *3D00F8591DFBAB7F2550D5FAF40B413D9F5E8C2A CALAMARIES
593,894,600 *3D0982BB8BF5765848F4FEACA95431B908E6971E Calambuco0
593,894,601 *3D013790EA2D47AA63056DA181D38AAB75896EA5 calamity(choir)
593,894,602 *3D0D4EFDF23CC86AECE9F04285DDA277B40E7F74 çalana
593,894,603 *3D0583469EB67E9BABCD38F68E0F0701D61C7F81 ‘calar’
593,894,604 *3D0D90A05AF47B72E6C3D3F17D40CEC3DEC5D687 Calarence5
593,894,605 *3D0D468AD6685C353ED79807090A348A7E2A9FF3 CALAVI8
593,894,606 *3D0126213DFEF9E99005C39082C0395967D36D07 calawtons
593,894,607 *3D09AEC365A94C4F06028C5A6AB4DC304BFF41E7 calcaising
593,894,608 *3D03851A33D063738986E1E6B899FA7437ABBDA6 CALCAREA?
593,894,609 *3D00B6C6A0776709D9911D56B715641AB4E81C51 Calcarino1
593,894,610 *3D0C56C1A4B3B820AEB2CBA7BEE71DE9EA17750D calcaron7
593,894,611 *3D0EA1355D02493AF75AD95474CA40F60BAB0AB9 Calcars1
593,894,612 *3D0BE41724A869AED7B0F8447B7DD432D8147092 calcforce
593,894,613 *3D0C56C2F340105C95A435079BE0BD75689BC865 calciocaed
593,894,614 *3D09F8DC9797D43438982240E286DF7253C8ACE3 calciopiacenza
593,894,615 *3D0B9C0AF0F16408B2ADF07D93A0C53A7F957C62 calcott2
593,894,616 *3D0E74E229E8EFE6033FB05F0B31A20165C3E8D4 calculable4ever
593,894,617 *3D0DCEF5D0C1A23EFE03B77E82089E9414F78794 Calculais.
593,894,618 *3D09F798CEDBAC85CC79F9D2D9C0D429DD2DBCC3 calculation--perhaps
593,894,619 *3D0101B3F38456E8504CC880B4AC1FF2BC5A1F69 CALCULATORIO
593,894,620 *3D05F7EA9DCCB3DDA0A3A4C2F9F3B5523F4B6BB3 CALCULATOR-SPELLABLE
593,894,621 *3D0B3540A9A4FC1393C86CB78DFAEA938BE5545D calculettepédia
593,894,622 *3D066B3B71EE2DC2E1C9B9C88BEE37B65A755B06 CAl
593,894,623 *3D078D58112B1D9DB76DC3DAB1D849BB5BBB7C54 cal!da
593,894,624 *3D017FE1CA3C3E57B9B1F9EC8436B2EFD07D1ECB caldak@aol.com
593,894,625 *3D0CE57B6CA28FE3D8912C9AED053A213D7EADD9 caldash0
593,894,626 *3D0C93216D5C292189C0D81ED5F2AF2201610766 calderclarence
593,894,627 *3D0C82F526459364A027869DE28D0A6C7845029B Caldicut
593,894,628 *3D0F018E4CFB5725957C845EA449524B813BF322 CALDWELL''-CLASS
593,894,629 *3D0E4DDAE43B2CDDE9CFF6AC16B85D97813E6011 caleb.altmire
593,894,630 *3D008B946E49E11BF1F09373D118884F8245E3C6 caleb.cederstrom
593,894,631 *3D0254525579A4B4F30B3793B95FEDD1DDB9CF5D caleb.czyz
593,894,632 *3D01EE039192ECF25626EDBEE7E667ED5F434B0D caleb doughty
593,894,633 *3D06A90D4C3C787823A034DC6A5566893ABC573A caleb.drechsler
593,894,634 *3D0F8E08402486E611CCA27AD99209CF487C6EAB caleb.glomski
593,894,635 *3D011F5F6D736EDB11C3252E6E671206D064F3E2 calebhasler
593,894,636 *3D0D0F9AC6215ADD3F93630B50EAF421F22729E9 caleb.nellums
593,894,637 *3D04EBCBE678A0EDA4B9409725A105BB6CEA92C9 caleb.newgard
593,894,638 *3D0057D802BE2EB44D79CDA339FCACC051B218DE caleb sanburn
593,894,639 *3D000BA72D1871EC93E7EAC5E5BCC7A0E0C6C273 caleb temple
593,894,640 *3D049B5AA0EEBA7B30855C6023287E0206B02729 caleb.torset
593,894,641 *3D0AFB10D97DD7C1E1315621B0EC3F76D581ED42 caleb.tsutsumi
593,894,642 *3D0C241AAAD81CDFE152425AB3E3F4F07A75B3D3 caleb.vigario
593,894,643 *3D07F1969A89FB27AE2F703A084C31B3C4B5A2A1 calelectricity4
593,894,644 *3D0CEF5B0165DF1B1EC2351415657ABE436762C2 Calemos5
593,894,645 *3D083732E5750DD7E8530B6D10B7749876D9E688 calendar—christmas
593,894,646 *3D0949C55B9B0DAAE4D21C707260534E3E733490 calendarday562
593,894,647 *3D0296361C292E3C086B319C1D653CC3FEA3C921 CALENDAR-STUDENT-SURVEY-RESULTS
593,894,648 *3D0BE8A07BB9EFB778292F5BD534B85CB49A3CFA Calendrier1
593,894,649 *3D0BAF2C7FD25A8ED36CEAF46DDE8C8EAB83B186 Calepina
593,894,650 *3D0F1DEB64464CBF74C5657FF797B8605779A647 calfessex
593,894,651 *3D0E9DBCD5623147BC2A1757B46F22D308C487A9 calgta@aol.com
593,894,652 *3D0C234D5D72097B9FA24CD98369F7733FB192A2 Cali427
593,894,653 *3D0B0B2521F5A1D8B04C12A37C5779C83C3A94D3 caliboy81
593,894,654 *3D02144FEC4598BE1EB8EAB4DB0949286AE3F8B8 calibrndoles
593,894,655 *3D0A55FC4B19ECB3C209075E462A067B9F4EBE09 calidissima
593,894,656 *3D0C5AE88318B4C1CDA9E3781E619D5C3BAA8559 califani2
593,894,657 *3D07A2195D57124BCD2080059E81FC7B8D9BE48B Califique0
593,894,658 *3D07513F7EDC8F4828253169F265246323BE2903 Californ444
593,894,659 *3D0A3E0884326365C98B61736BB045E604B6BAD3 Californf0
593,894,660 *3D052248F05B5B5B433C949AF403A67515B7000D californiakustom
593,894,661 *3D010D2D960BDF85766241BD012FEF8040110F1F California Lies
593,894,662 *3D07C1D6BF2DF3789FEED44746FC359E775601A8 californiastemcellreport.blogspot.com
593,894,663 *3D0A7F1B9BAF277BF054B179B12101A96861EC6C CALIFORNTHEATRE
593,894,664 *3D03E766096107C9213F6CD2280452B0B94EDCBF Caliguire2
593,894,665 *3D06C9F00BAB977713883B655DACF1CD5A357C9B calingabriel
593,894,666 *3D0DCAC0755F42DD51C0D365690B9D3D81CA1889 Calinosa2
593,894,667 *3D0C885AFAAE18890A421560110939A4B72CD0F7 calipso be
593,894,668 *3D030995337C3DEA952B2CDC86C324B4D6059417 cali reprusio
593,894,669 *3D0B87B00C4C3F3C3A9D969A4924A5738338C8E8 Calistining
593,894,670 *3D0277068CE3CD3E13D5B75CC529CFB1F213FA18 Calite4
593,894,671 *3D03677FA44080F53B7F10F888274D1EBBA3BF30 Callensburg5
593,894,672 *3D00193BC2A6616CBAD411D7B102F58CF786ABD8 CALLFORFREEDOM
593,894,673 *3D07280DC55925ECC7FA7441E42A6F915F33B16C call-for-second-iraq-medal-clasp
593,894,674 *3D03655F98F8B5384BD3D532664B23DD67EA4B84 Callicida4
593,894,675 *3D0D462F48491385BD5D15E522DFBB41E8FC8F27 Callie424
593,894,676 *3D04D742C8A56E2B86E75AC1E93B34545CF1166C calliopsised
593,894,677 *3D0B2B6922BFC75B6C445375B34E21C39DFBBE7A Callitala
593,894,678 *3D0E1F3138FF36CB86C9647BE37AFC2989387355 callmefromhigh
593,894,679 *3D001356156A50B65B170E9C459539DC880970D1 CallousKagathos
593,894,680 *3D034E1FB125496BAC2681126FEA973FCF156098 calls-for-citation
593,894,681 *3D0153DE1480065B89874F4BEE7ABB920737BAC1 Call slip
593,894,682 *3D0C15B2DE14421948CB095510236A42616C8E14 CalltotheDragon
593,894,683 *3D086889A933EDCF837A34FBA777E9DA543B1619 CALLUUM
593,894,684 *3D0F173B8E5B34924FBE32DCCA8E1FB42AD960D3 CALMEILLES
593,894,685 *3D047B91127CE6F6739EB90FCBB774B9C54E51BB CALO?
593,894,686 *3D0A768E93BB0163109AC21543DE292E9EC6E168 Calochortaceae과
593,894,687 *3D0C14E9A7BB0982D06C2259DC0B070713801C2F calonared
593,894,688 *3D0AB7D38EA889FDC801DB09BDD869FB5A10E7AE calorfica1234
593,894,689 *3D0C24C67E6E77ADD76D683B8D1C4BF67E43CB87 calosha1
593,894,690 *3D0B1516AB2D91310C219299EB3E32773AFD2CD7 całowno
593,894,691 *3D005F211FF033B99CBC1503A64706552459AB00 caloz@ezrz1.vmsmail.ethz.ch
593,894,692 *3D05A77DDCB7762A30D6DDA7D0372EE139FA5B7F calperri7
593,894,693 *3D0F519B4917ED6B06A046703843B10F5F6CCEC6 calpj@aol.com
593,894,694 *3D058ECB5B0F5262063BA9BB9B03868606756666 calters7
593,894,695 *3D074F90F56A7A8EA6FCF955394E46742A9C2C54 caltivated
593,894,696 *3D0ED6BB19E1A7D61848946D3E54936192DBAEEA caludiumee
593,894,697 *3D0C8A08EA0399649C48E3A7872E5BDB8D8BCE1F caluerd4
593,894,698 *3D04B3653C668BB881F3493FC4CDB36B26920662 Caluiale2
593,894,699 *3D04BA38AC1C2CE7D780F38A319AF71F4AD375EB CALUMN13$
593,894,700 *3D04F9C60541001273AB6BA361F128185EFDC4C1 caluniv8
593,894,701 *3D05997054D48F064AAE75A345DEA77BA08BF584 CALUTRON0
593,894,702 *3D0AFC7A413697F616AEAC6ED22851828BF6246F calvaram
593,894,703 *3D068F4C343863BAAD5CEF7DF7D858A10AE2804E calvezza
593,894,704 *3D0749B63057F9D3272A3A3BB751B404B44304E8 calvin.anderman
593,894,705 *3D0C111FEB8D4CD9C2685A41091BA9E04C54001E calvin.blatz
593,894,706 *3D05A5615870890ECA51B517B92B4E243A65E6ED calvin.borba
593,894,707 *3D0D61AD9E7F34BE1A145C377207B07EA6EF13A0 calvin.chadek
593,894,708 *3D0DB300ABBA68ED76AABBEBEB36366272F77CB7 calvin.derosia
593,894,709 *3D0A717D1E13D22AAED9ED9F29A1E8C2BD388ABA calvin.faltus
593,894,710 *3D09544141828BDF884E2DEC46A33DA6DBBC7FE8 calvin.hemmerling
593,894,711 *3D0DD44DC23E8C9761C6B4F153B461AAC57B33AE calvin.knerien
593,894,712 *3D0BDC12873FEAEBC3099428558C93F87A020B31 calvin.lidbom
593,894,713 *3D0EF79881EDF60853B82BF234018C4AFBB386FE calvin.mcelheny
593,894,714 *3D0E19A28BB88B23E04C42E84648970396DCFD40 calvin.minugh
593,894,715 *3D08C24956E69498EFD15840179148ACB627446A CALVINNCC1701D
593,894,716 *3D0E21392243E484332661B025C26B69CC3CBB7A calvin.plutt
593,894,717 *3D0CCF7A3FC38CF0E5CDD2BD57A497CF5EC3A72E calvin.porto
593,894,718 *3D0B254CF045BC32BC634D7D43ABEA409EFFC7DC calvinputra
593,894,719 *3D0C52FB6D93E127A8D954BEB50116AF64083D10 calvin.rebelo
593,894,720 *3D0B6A6731FE6605CDA88892087144E0409C42DC calvin.siewert
593,894,721 *3D062551234AAE2B92709646E103B639334BC1D3 calvin.stobbe
593,894,722 *3D00DAC552762A13E1B50FD61A260DB90F673A4E calvin tyson
593,894,723 *3D059D89560897A1BB8164FEB2C5431EF749FF46 calvinuserpizza1512u
593,894,724 *3D0910122144444BD61662EC3DD2FC0B9824DA45 Cal(w
593,894,725 *3D0478D265D579235D68D095583A7BC0856759C6 cal@x263.net
593,894,726 *3D09DF3818614198392B71EBEDB378ABFC20F32E čalykla
593,894,727 *3D0B48E1F6F51A44AF18BF28C95FB4DD7E10E1F5 calzá
593,894,728 *3D0C366379E987A9AA2F32C6E1D82D8F774F555F CALZASSI9
593,894,729 *3D08FA1AEB46FF48F5F08F6BE428E56F1D716A64 C.Am
593,894,730 *3D020C64B244E24493F41EAE933521A7F4E8A0A2 Ca
593,894,731 *3D0838FA7182791A92C93D36E69738754D21C2CD cam1997
593,894,732 *3D034DC3C2BDE99BE8129199FBC14D0DC225ACAE Cam8_
593,894,733 *3D08DF30AF24671FA68E73609CAAB12775CDE49A camachohowie
593,894,734 *3D06B4F6C6AF2A139BF0C2E31E8F51C2CFC8BAE5 CAMALEONESOFICIAL
593,894,735 *3D05F96BCDA02DC46BB31EAE361F05A7943B156A Camaquesi
593,894,736 *3D0676255C85E33F2DC38C843ED2131FD0E0AE2D camarata?
593,894,737 *3D05D911EA4526998C93910D2EB24E0F60445D54 CAMAROPASSION
593,894,738 *3D065D57AF480EE7AA8D2D37E81B01FD913226C0 camarthist
593,894,739 *3D04F886132CF2F7F73C1F0C4301AC3956B77813 camber thornhill
593,894,740 *3D067FCBF12980DFBCBAF415113630C8B85D44A2 “Cambios
593,894,741 *3D0588A63856D6035A2E18B7D3517432FFC4A424 cambodia12180n104320
593,894,742 *3D028F7F3EAE5D11EACFAACAA5E9383430851ECD cambodia12400n104590
593,894,743 *3D0A0A8873958A3DC1017DB808A5CA28C3463C4D cambodia13480n10350e
593,894,744 *3D021229BFBD996C394F3EF4228DD0E724993E62 Cambone1
593,894,745 *3D0C30D63B3D0AA9DD54FF40D3CBB52C8249B775 Cambrèze
593,894,746 *3D0D6C71B05BC87AF8C776D62713123FD31D09EB CambridgeshireParliamentaryConstituency2005Results
593,894,747 *3D0AECE452A816145177FA6C136A6824E0A25DEC cambridging
593,894,748 *3D00D816FD04F5096D77E81FD0BC38EB8515714C camburn@aol.com
593,894,749 *3D0CF649336859A56022265425D9D8230701B721 CaMd$
593,894,750 *3D0AA708D23C22339E3B2CEA89EDFF6D24E45940 camden@inetcall.com
593,894,751 *3D00AE1104D974F5387DEFD964396346C2094B3E CAMdh
593,894,752 *3D01E8D3FAF3914A01739C6C5ED025C905257904 cameleos
593,894,753 *3D029A54CCE1485FBE20D5D83A1BED8FE0F0359D cameliachira
593,894,754 *3D0E36292371B21D43A321634A8A38497B9DCCC3 camelia wong
593,894,755 *3D03CD9D091A4E1F57FCC194C578DA686E121E0D CaMeLLIA
593,894,756 *3D09375316A36359E60A2CBA669A9263267F2976 CAMELMAN2
593,894,757 *3D09811AC21CA48BBA2DC3D2D76DB27D14D631CB camelotartists
593,894,758 *3D0A3DB3242901AB472B2F22768A523CC3F645C0 Camels(videoedit)
593,894,759 *3D0DB9C766ECE32E22775A8D1231F433A6896FFE Cameoed!
593,894,760 *3D0FA0C5387BA7AD6A895D941C3CB9375EE4F6CD cameora9
593,894,761 *3D02C410936C1BAEDC31B23AFEFACDB7E223CA08 Cameral!5+
593,894,762 *3D04820709886020226DC62BDE92919740B4B260 CAMERA-PUS
593,894,763 *3D01E81B449E955713B5963FFD93169146118FA6 CAMERASAND
593,894,764 *3D06BCFE0FB2A782BC356AA5F40A1705326562ED camerasslrs
593,894,765 *3D012FD58C4AF1EA0296797D34E2014B1755C40B cameratalkasian
593,894,766 *3D055DED84831A3D93F13F4F62273A32C7A186EB Cameravanessa
593,894,767 *3D021CC5ECACE901A2061EA3260F9391B529FDEA camerenas
593,894,768 *3D07EACFC9E901B8C10B2404DEAD88EC6B96F8AE Cameroiiians
593,894,769 *3D06019D9BCA825E8651C95E28F3476E352CDA95 cameron.asper
593,894,770 *3D021B6882A04BFAD993AE2ECC7459FD2C2BAE81 cameron.bonk
593,894,771 *3D0AD6CD4263EF7A6D4DB4FCD80DB250DD80D1CF cameroncoverpoint
593,894,772 *3D002C3CB9C561BFDD1FDF21C93BA5A9B26BD3DA cameron.dredge
593,894,773 *3D0387FCF806B06BC713F35B25BB4E0C22DF3D76 cameron.guard
593,894,774 *3D0792CE52BECC1E3BBEB1823A2F4CF25B49492A cameron.jimerez
593,894,775 *3D0F6476B47129EF1AE8633B74B7C2843AE60896 cameron.lue
593,894,776 *3D00A1260510B9E1109334E074036F2569BE2557 cameron.mckenize
593,894,777 *3D0720581F8AD4EB63115F9730BA55E4ADC3B556 cameron.oz
593,894,778 *3D080D91028865E9B0C433E0FBC41564B3FB2257 cameron.panich
593,894,779 *3D0B406B5C1952DCC9532CF437B8408FCDEE3D53 cameron.paskiewicz
593,894,780 *3D0DDE79776532ADC7CDC0CD91CDDF66172A35F8 cameron.pelligrino
593,894,781 *3D0DF87710106C923A461865CD9D7B2D722DB1C2 cameron.peyser
593,894,782 *3D0B3FE2F1FC476DA5571AAE5532C01F75CED66C cameron.rank
593,894,783 *3D054C11EAC42CBF1D0787F12B11382376A6A30B cameron.reuer
593,894,784 *3D0A37F6D3F6ADA5307455CF491B767CB5DF9861 cameron.sainte
593,894,785 *3D0453112773F34A13E9A8DF036CCFD782C8C345 cameron.teno
593,894,786 *3D01F1D87A2112E6119ADA094E57E88B4A9C2534 cameron.torri
593,894,787 *3D08264435F10C3EEF9925489B329BD814EDAEAA cameron.treese
593,894,788 *3D0E987D5ADCC8DCE4A0F835A9DB4BD05F8A3BEC cameron.valderamo
593,894,789 *3D0D15A1DEACD866DE77C2BCD41AFF342D39350E cameron.wigman
593,894,790 *3D082BA8B8B9D2195A22805A8FEDE02EB79022AA cameron.willegal
593,894,791 *3D02E2FC8B72BEECFD708CDF857C879280E8E080 cameron.yokota
593,894,792 *3D04E999939AD51A4C792D2BABBFF5FD583CDBD3 Cametepd
593,894,793 *3D00F5E5DE3BA7ED931B4EA7C54873DE8A83ACD8 Camfl
593,894,794 *3D0660866EC66C7A62F68B153EC63D76973622BC Camhine5
593,894,795 *3D0DAD0F41CB05D50915CD58CF088153EC236330 Camiciaia9
593,894,796 *3D09A9D28F9715F58A5444DF4C0E20096110F8CB cami gheorghe
593,894,797 *3D0ACC144F8E0984CD8CD70B78328E9F05233B34 Camila716
593,894,798 *3D07BFDF3895D892848FE2EFCDEBD92F7594D0E8 CAMILEO
593,894,799 *3D0DDBA1FB22864A1E7AEDC5AD35A05606D29B5C camileparker
593,894,800 *3D07130B1530A8ABC23894EE4F11992155539AF1 camilla 'ami'
593,894,801 *3D04043DDADCB5781045E0E5C74AC66EB196CA25 camillamccormick
593,894,802 *3D01A4533E488F5D870C236210CBEBB9462EEC55 camille%
593,894,803 *3D071684400F9FAA7E79DD1198EDB0E3EE6067A3 camille.roberts
593,894,804 *3D0669DE91B5C760656470BEAF2D805300166255 CAMILLEROXANNE
593,894,805 *3D04BF2D8BC10171D2044691E2B220B389EC2B87 camillesantarin
593,894,806 *3D08761385F28EB44CA31A78D1B829165C6D7C60 camille villalobos
593,894,807 *3D0513DAEBE313911D640A014116AF3EC7A99BF5 camina1
593,894,808 *3D014629E12B10D7849FDC79FD4208EE44A7FE23 Caminabas2
593,894,809 *3D047263CFD111AEB6AFBCCDF8B18E36E282E942 Caminares5
593,894,810 *3D01CA19865E8EE56169C391BCFA0713A51437C6 Caminetto4
593,894,811 *3D01123B83F0C37B15B08EB57E771BB368D5F733 caminodesantiagotiempo
593,894,812 *3D0D34C86C33D62DB911E19366CB1948D43AEB73 CAMION*
593,894,813 *3D093B0FB0FAF0E07F59B69B4F687605A5A8D94D camitre5
593,894,814 *3D0C551992128D508230114EFE29EA613DCCBF15 CAMIYLUISMIX100PRE
593,894,815 *3D078AB32062174279094D156BF87552018D4F30 CAMLADY
593,894,816 *3D089412A8B2632F61749A739572871E635167AF Camluçois
593,894,817 *3D08A066BD40D95E2D944CD34041EAAB15652B43 CAMMILERI
593,894,818 *3D05C097C6D5895492D417477AFCF80364C975B9 CAM&MJM
593,894,819 *3D08E694F72104F15A3473C03176B84DAB8A0E2F cammore2
593,894,820 *3D0BCAE8ECED0B801270FBB1696117D3DD98EA22 C,amO
593,894,821 *3D0161BD1986AEDF2F49BC55BD3BCFD5545BE498 camoufleras4
593,894,822 *3D04D19B490D8170AA09071E7772FE23AA02A2DC čamová
593,894,823 *3D08513E4EC88ECA375ECD77D04CCCA14A650E1C CAM/P
593,894,824 *3D0EC6686596A7E9EAFA084459B4519AE091E4A5 campaduraga
593,894,825 *3D0F611663A16FEE927BE336C56FED2058BAFF3B campaniN
593,894,826 *3D083389C2365E125614F3B15C2AE63C640AF51E Campars7
593,894,827 *3D00A7FA47947508A226FA559F9869580D4616C9 Campaspe's
593,894,828 *3D0FE4E50960408E5854C7150C092622624A55F3 campavocampavo
593,894,829 *3D0FE28C7933053425105F7362D0AB357B646942 Campbell041
593,894,830 *3D05EAD27A16E38AD26AEDA10B2A89425157D2E7 campbell203
593,894,831 *3D037744E74697F70139519F0DC75A7FE708062A campbjw2
593,894,832 *3D008ADB577858D660ED67E5ACC7C05D6CFC6065 campeira”
593,894,833 *3D079F686CF5EA7AE16D964CC608AD7C81CEF46A camphany0
593,894,834 *3D0B9F0316D3E8312BB12520E17C877E7D0001DA CAMPHORATE1
593,894,835 *3D02EC85EF787B60AFAD13FDB8268B0DC8E46CA8 campiagners
593,894,836 *3D089DD47B71B10EC32EE89FAE67910CC19BC6AA Campillo’
593,894,837 *3D06CA03B15C572110153582B8510017A3F572AA Campion”では約1千万年前と記述
593,894,838 *3D0A61CB10C71EB8108E0B845AA2143FB3F3AF23 campmeta@aol.com
593,894,839 *3D0E64F6AA45C8EAD14FC67AFAF9C49D7959F89E campoamor's
593,894,840 *3D03E0338BE6DCB39218B84017B07575F2C40FBE campobellodimazara
593,894,841 *3D0BF9724FC6A5F8D37EEDE14ADFB1547C94C39B Campodei3
593,894,842 *3D0B715114A0A8905F6F8E6A4E2B99A4C531BEC2 campodos
593,894,843 *3D03BE2A3FAB94CD354ADD974384A98220902198 CAMPSDM
593,894,844 *3D0300E9182D40D4E1FE6054F26066778D7BBBDA Campson2
593,894,845 *3D0ECBF89D45EF82583AAE7612E22218193186EC campulitropal1
593,894,846 *3D0FF60F0C3DC740726234C7AB67084B81C178BF campus.78
593,894,847 *3D0D75455AC78A20B51A68CC12F182BBA2D83209 campusplus
593,894,848 *3D0DA413C4CD3431EBBAD2C9AA1C3B9E967CE097 campusware
593,894,849 *3D02D8E3D6DF113CED98A7F9EDC8C9989D8197C0 Campyloding
593,894,850 *3D0FCB1EF9DC9EDC20A7E04EA4D565B1CE6F70E8 campylosiphon
593,894,851 *3D0A181C8233D791AAE0CA9059FFD5C158429AF3 CAmS(
593,894,852 *3D026C97BD75E3D89962A4AEAD57396F48ED35C7 camsew@aol.com
593,894,853 *3D009125BF510EE1AE091A871441B967F1A66945 camsl@ibm.net
593,894,854 *3D0C6C001DF5C36D823ABEC0FD5031209FEADEE7 Camsoon
593,894,855 *3D04F9544EA6E9E62B7090839131CA7DE5C9804E Camthen
593,894,856 *3D0D2EF68D25A6FDCF45E93396645130A968C0E8 CAMUFFA.
593,894,857 *3D0A77CAD280FA7C4942603D5352E170FA1E0B5A camurati5
593,894,858 *3D05A1E98E100DE9A47C446146C2BACCC8E9D869 CAMURUSRECEIVESAPPROVALSTARTPHASEIITRIALCAM
593,894,859 *3D0CDB89EA4A0C50366424003B828DEB3FB0281E camus8
593,894,860 *3D07A8B7B368C8E24A57AE98B440A2E5DD59F553 Camuzos7
593,894,861 *3D0152E98E4051E36EB326ADB7FB1CFD4D80F6E1 camy2131
593,894,862 *3D071D4F75123FE6E3A1C4E4AEAD8FE11578EDB0 C_!An
593,894,863 *3D0DA50D0B97A84862AF013768860550FE543C1B C;A_n
593,894,864 *3D01D5F082DA09D47A2CE4E303291197729EB1BF CANADA,(416)
593,894,865 *3D06380D377B50E94CEE8FE5DDB6D1F9E0B5971E CANADABCMRIF
593,894,866 *3D0C82EED6FEB9A3529E54BF7CEB7CA01DB18015 CANADABUBBA1
593,894,867 *3D0EAA4928DEC535FF0C9FC15717237BF5DF746B canadacdsa
593,894,868 *3D07D4DFBB8EA33AD0BDDB9C53B202B432D181E4 canadahos
593,894,869 *3D067FC222657860988B73B786E2CBFFC14F65CA CANADA-OECS
593,894,870 *3D02C3006AA9B85355DD7B1E9E35A53453162217 canadaweather
593,894,871 *3D061F836C0A8C4BD4A733644D1A46FA77DC24CE Canadiam
593,894,872 *3D04BC9306563E1F1B48F60FE1214021EFB7E66C canadianbiodiversity.mcgill.cacanadianbiodiversity
593,894,873 *3D08C17EC21BFD5105D5B22892A240B1CCB7D1F3 canadian@netease.com
593,894,874 *3D0B73C891390F3A3A35A613C407CC07253D2299 canal77
593,894,875 *3D02F5D0CAAB3F2AD7D65113D46EEABFCA377F9E canalway8
593,894,876 *3D0DD69448BD2E018598D01B0C18C49BF8A59A1D Canalzoom
593,894,877 *3D05EE26D498CBE3052EF6A877DB1140F576319A canal﹐以及1827年落成的新法院﹐都有助哈密爾頓於1828
593,894,878 *3D0BA33770F39396310F83178F85006AFA661556 CANANDELABRUM0
593,894,879 *3D071F560A68572EC45E9D7AFEADEA88F5CB2676 cananews.com
593,894,880 *3D07C7A69BD6F18650DB9875C053FC6A28F9BC8B canapeetjes!
593,894,881 *3D0D42ABEEA6397747B38EE5BE14886E3F173668 “canardly”
593,894,882 *3D04BE67BE5429B31F987F8BC6AAE901DD8CB9C0 canarian_coalition
593,894,883 *3D0D7E328E4234CF6CB783BB6769540C06DD4442 CANARSIE!
593,894,884 *3D0B3A42EA34A92BF7F46C016FF0DA4C1D9C63DC Canced1953
593,894,885 *3D04ED06E1B1AB302C30641D475F9E082C5586EA Cancedjim3
593,894,886 *3D0E5EADE68D21E0FE642729D1A427EA7EC86343 CANCEDPACKER
593,894,887 *3D097D8A1313C22345E443EB7DE90C1878C11BE5 Cancedz8
593,894,888 *3D0FB1F2065249D46BA6618C4062FDDA1A29C1B6 CANCELLABILITY.
593,894,889 *3D008C701D47D28B52356A4066817A6357B254C9 Cancellárius
593,894,890 *3D0E4BAAFE2E387E082E146534F7514243DA992D canceranxiety
593,894,891 *3D02DBA6149B6C3E2C6E3CD7F0B64488F0E31522 canceration ,k/&/ns/@/'r/eI//S//@/n
593,894,892 *3D0AE0EA627B04FEDEA45356E317E0D09944BA9E Canchero2
593,894,893 *3D0709A075B3BF5F2208EA0C0C96FD496A42207C cancode
593,894,894 *3D085AD0097FA848A1FB31B26EA1525EF6C5B16E Cancroide8
593,894,895 *3D0D82BA248BAC58C22F1FA4AED25888A3193D65 CANDCMOISSANITE
593,894,896 *3D0159DAE3247DEA165063289E9B4D78454C1564 Candéan
593,894,897 *3D0FA81981136BDA7D8696EEF235EF0ABF7A59F7 candeck
593,894,898 *3D0B514A54FDF80DB2F2018A972C03F492043D79 cande murillo
593,894,899 *3D0EDCF62F842E3EDC6EBBBD76EB8E1457D4F88B cander3227@aol.com
593,894,900 *3D005434D111123B3D32B20976C0045D02D03924 candicebisson
593,894,901 *3D0B236C33E61A2E0F198518B2963868D8F24CC1 candice denney
593,894,902 *3D0B6BA6B7042BA0D5B2FFBFB16C06AC153390D1 candiceteh
593,894,903 *3D0E8E6AF072CE5522F2D240E2D76012CACA099C CANDIDAT
593,894,904 *3D03FB28691F306E173ECF3AA2381D01CB7EB8ED candidatesangus
593,894,905 *3D06B002812C7DC53789F9C0B97607F4DEE46C9E Candide2008
593,894,906 *3D028C761FBDD643B3931096083F5ED7ACB521AF Candid photograph
593,894,907 *3D033F9801170808EF58AB7CC6D18E904B3C6343 candidtunnel
593,894,908 *3D0B8BF31C281BA3E05FB60067BD82A2FB64D34E Candidu6
593,894,909 *3D0B99B9F99E11BE346C0641B1FB270A3E9E952A candieshopsopen
593,894,910 *3D0F91326BD5E5EEF744A01BE3923C2AC7F2EC9B Candisse1
593,894,911 *3D0C93AC51D7F80B796F704B47CC456DC4B08F96 CANDL35
593,894,912 *3D0740FBA1598DA2BB277ADC9A67A9ED7FC432B0 candor@dds.nl
593,894,913 *3D04A1E411A5D36B23B420A60D3EE70A4F5C3BA2 candybfi9
593,894,914 *3D0274B687524EF94EDD11A8AA7B72E6908C1497 Candyc
593,894,915 *3D0F9C5F153C1E22EB361CFCFCA887BCC5EA5F90 CANDYJENNY
593,894,916 *3D02B3A98032B95A0C6AB8C598E4DFA7A54F014F CaN_E
593,894,917 *3D0BE5A17A0E51790252899BE362D4E3DF51AAFA caneghem@tom.com
593,894,918 *3D0661A898754309DFFC80E7E080EB6087D919B9 CANEIROS
593,894,919 *3D074FC5EF25EF1DAFC7B1C6FFFE0FBFF41FFAC2 Caneladed
593,894,920 *3D0BCB7235FEDB47A92CC6290B07B91C40ED9C0F CANELALADDIE
593,894,921 *3D0C4620EE284262253D9485B922B93943CC6663 canes12345
593,894,922 *3D05D6D5F2603708CCA8BD8C6479C190CE2B1906 Canettiining
593,894,923 *3D07ADA6A8A54591CF3770EB140AAAD530A29C39 Canguritoed
593,894,924 *3D08B12684813CC75FF0FAE3A876BF0F90A8F6F2 can i come too
593,894,925 *3D0531C51038BB993A86D43B64D421499CE789E8 canicula7
593,894,926 *3D0099FCE61ECEEEF3471FF7665E4D8DA52B56DA Caniculaires2
593,894,927 *3D0D0CBA4755877514B553166C1A2C5E29B3F76F Čanik
593,894,928 *3D0A1E92A0B36F4F492C9C971050AD4A7AF11140 Canine517
593,894,929 *3D0556561D80C3D5DF5F3DD293F9B5BB69F2D419 caninel6
593,894,930 *3D067B9F5675F999B5A970F7A0A3AB94172E1ABE caninepartnersoftherockies.orgcaninepartnersoftherockies
593,894,931 *3D045500CBF1232F7204AED692FF56E39B14DCA7 Can It Be?
593,894,932 *3D0508B9FE68FBAE10A376AFE046931043FCF49A Cankaoxiaoxi123
593,894,933 *3D078FD424ECBEC24AF124A4420CFB996D5B91C9 Cankarem
593,894,934 *3D0B0FBAC2315F4EB0451C3201A8C186DE0B7D20 cankók
593,894,935 *3D08A9CA5ECC13A4ACF0BD22BCC06C686FE7468F cannarsi
593,894,936 *3D09847CDB6B9D9A524D1D2C807E50BF67E0F435 CANNES-JUST
593,894,937 *3D0C22AE988331FF5B63A3AF4DE7C336EE3FB6C6 Canningning
593,894,938 *3D0E4BC138217904FE3C177AC552BE6BD0D81FE0 cannobotrys
593,894,939 *3D0306763C331736D522A6FA52E5CBF125B2D771 cannon337
593,894,940 *3D0998B3FD6D3E03ACE8D3CAC5CBFE4B573E1FFE cannon388
593,894,941 *3D0E16DD9E595234646151F783B8818CE508FC62 Cannondajared
593,894,942 *3D0FEF5CC58254E627B9B26B0A5EDAAA2A7E465D Cannondasonny
593,894,943 *3D04B18E02AC04F91DB6FE66886778CB4494BC3C cannonier.
593,894,944 *3D0E7FDCAAA9C7D0CDD9781D2E9ADEBA3F3C8560 CANNOT.
593,894,945 *3D0DC4C714C24BD8B94CAF4A7CD5246022EB27AC CANNOT0
593,894,946 *3D0EEE22647EDD1C9644615905028D5A9EAD6199 canntainn
593,894,947 *3D01002707D8E47FF5F4B72EC188D1124CE09273 CaN+O
593,894,948 *3D0C1A2D5C9EA5CEC5C3E467B014B2BC4AEFDA63 CanonandGigue-Canon
593,894,949 *3D09D9532CEFBB467C302BD6611DE225BAD49CDC Canondon0
593,894,950 *3D07029DAFCD5C9E718EA19429439FE05789F7F0 Canongolves
593,894,951 *3D0700E2F9478C94E88D1C4C1CC8F9C658CB9D7C CanoninDmajor,T.337
593,894,952 *3D07BAA07E64770FBC12B2631325CD51E43AD12E Canonnier8
593,894,953 *3D08C93E0ACC51F36787F5A7357CDE2A75451F2E canonry@yahoo.com.hk
593,894,954 *3D05AF02F00D6C81E506BD907EC12547B032BAC5 CANONTRICIA
593,894,955 *3D04601B3C07833F4695344A010AC1D5DEBA4D2F canovae5
593,894,956 *3D00B048B68BE9F001C7D70CF3E47DF3632C231C Canrenon
593,894,957 *3D0DC1E6E6BEB88CD7A6706AADB7786A1D6DF47D cansaresed
593,894,958 *3D05342EA354686E383855A181FD883DDFCB8717 cansfield 1 0
593,894,959 *3D0DF248BD5F8359F210B6A8F520863A1D5DAC73 CaNt:
593,894,960 *3D0D4B05AAC220189941A48C7DB2F037B82EA3EB CANTABIELLO
593,894,961 *3D00D9C4401609A978A850E625A2DD2BFF507C49 càntabras
593,894,962 *3D07F96A0F95CE1156538CC430633249B5CD2FE6 cantabrion
593,894,963 *3D0619298DB87DBF38036CE3DEB577F756C8C2FD cantaora4
593,894,964 *3D01D656C5AB83BF038E4C753DF0FA6F23886F4D «cantar»
593,894,965 *3D0892D4BFBA794477AE5569F92A95D488C67FE4 Cantata"Ichhabegenug",BWV82:III.Aria:Schlummertein
593,894,966 *3D0F6375B639A4BF8D98A7D79833F40B1FC31538 CantataNo.208(HuntCantata):XI.Chorus:"Lebe,SonnedieserErden"
593,894,967 *3D019C4BA56F2BDC15A32BE312751F996F40FC12 cantata"siedi,amarillimia":ii.aria"siedi,amarillimia"
593,894,968 *3D040D1DA8CADC2E9C2FFD957C106A2086D252C7 can'tcatchtomorrow(goodshoeswon'tsaveyouthistime)
593,894,969 *3D0C1E2242741D9DA5F5E66CF46F04C2AF475BD0 Canteclere
593,894,970 *3D0AA433930EABD9C5B478CA802CFDDC4B6C895D cantele7
593,894,971 *3D0CD0521D011BCAD823CE9B2F9370A641C40DAE canterburytalkarchib
593,894,972 *3D01152F8DB3E902D0503A5AF65C5EE56C8C850E Cantereb2
593,894,973 *3D0A31C123D8000C0A70B9ECB088FBD177A6B734 Cantereising
593,894,974 *3D062C5F19D905EBC3264400220BFCB119DB8A61 Can't Get a Job Can't Get a Man
593,894,975 *3D0053C3959EF035D69B13C5A3A45AEE47342CC5 can'tletbeefgo
593,894,976 *3D09F3E8783E1E0D2105A2AACD2D65492E308735 Cantonnait6
593,894,977 *3D094B572A86E4103B6132CB41770EB47E994D32 Canto Popular De La Vida Y Muerte - DP
593,894,978 *3D0B512EF7D302DC703CF2CD5692E5465F8C1185 Cantornál
593,894,979 *3D0476F4CBAAC924C80C59F9A43F13C762BDA9AA cantorp4
593,894,980 *3D0FDB66C8B0B8352F6C5E6371AF49BB0F572B03 CANTOR-SCHR
593,894,981 *3D0275651B3266878298494A3037CD339FFC581A Cantpuah7
593,894,982 *3D0FD061A5E82F68FF416F162AA0FD3DE8D4AFB5 Can'tSayThatontheRadio
593,894,983 *3D0307F5A106228190926BAE9F090F0FF967002F can't tell me nothing (remix) (feat. lil' wayne & busta rhymes)
593,894,984 *3D0D32359D062F37DECB695E9DB6449A7F60B823 can't tell the difference
593,894,985 *3D09DA76B48F46164BB9478CB09E6EEFA27364A7 CANTUTA2
593,894,986 *3D087594567D02409991A3965BB319F56413074D canty_iljs@yahoo.com
593,894,987 *3D0F08E623AE801FD299C0887203CF65CEC431D3 CanUFeelthePower?
593,894,988 *3D04CC5104DC4A90D915195BC294F809CB229D38 canusina3
593,894,989 *3D05628E38B6EC97103EE971F60434EC2D2C1204 CANUTE7
593,894,990 *3D05BAEBA2CCE944F0BE42F9863B5B543D2AD599 Canutera2
593,894,991 *3D0CD64FA3E20134E639E1DD5A779D76FF80D570 canvas1792
593,894,992 *3D05842CB2489555E20A7E513273D085C4B88C69 CANVASADO2
593,894,993 *3D0CD0191B008DD0850604F9697DFDB238C07E17 canvas-the-basics
593,894,994 *3D08C0F7F4AA50A27AA8E4FC36854C8690A2A621 canwereale@aol.com
593,894,995 *3D0FABDF6B315CC9D6286E125C8244FE298B9316 Canwill7
593,894,996 *3D0ECBB4D4F8AFD2766AFC1100D0719889DE3CD0 canyc@igc.org
593,894,997 *3D021A8536FD7B0B50D76F033AEC1D58E9875A1F CANYONERNES
593,894,998 *3D0DD7FFAD3879409CD463366AD15C910E25B420 canzonaaed
593,894,999 *3D00E73C3A40F56801790CC3E570C90BF482BF3A CA!)o
593,895,000 *3D06557C070F7AB1E95D9FACCF788534531C695A Cao25
593,895,001 *3D073A2669DDDF2250FBD76977C790BAA14BF923 Cao6nha8q8
593,895,002 *3D0E82CFF17A228BD1F80B6101161CDC4A9B06F0 CAo7
593,895,003 *3D0D65222F12760777DFF37F5EFDCC309486250B C(ao8
593,895,004 *3D0D5164C04993495700122B94054BCB8BDCA163 caoalexz@fm365.com
593,895,005 *3D07BFA744733783DCB65865025AB2324C4F8276 caoandyh@wx88.net
593,895,006 *3D0C35D1B58DBDBA8C8FD63E93B8ED08DA72F0D9 caoarnoldc@km169.net
593,895,007 *3D0EFE80719B9C51ABCF3023ACDA97126B564BE5 caocalvinw@zg169.net
593,895,008 *3D063D0937B75141052A033A833D23BA58BDD16F caocarolinez@elong.com
593,895,009 *3D097C5B0F0CA4A8DB2BA1BB7382924C65AC8CC7 caocatherined@8848.net
593,895,010 *3D0FE8FD85A627EF95D3400651BD4A91724FBB69 Caochangdi
593,895,011 *3D042DBB8223A0D822E363D4F0EB7874A3A33270 caochenrong@263.net
593,895,012 *3D069A8E8CCD964283B23C327308345C2FC452F4 caoclarkr@963.net
593,895,013 *3D0CF58E18389A069B6113787394D176AC1B83EB caodenvert@zjonline.com.cn
593,895,014 *3D0C2A7BB0D0176D5D1BE9D55E13227D40CC4B70 caodianav@guiwang.com
593,895,015 *3D06FDB70DC611A4EE6B1EE5F074CA228951C960 caodianav@soim.com
593,895,016 *3D029C8A0CC5CB9BB82B120CE850E01BFC44473E caoemillyj@btamail.net.cn
593,895,017 *3D00AC521EF26B06BD790F24C11C21685122647B caofrancisz@chinaweb.com.cn
593,895,018 *3D0A623DBE5BD4AEF4BCC38248EC2F57BE1E5FD8 caofranke@fm365.com
593,895,019 *3D0F230F1D716D0D2372F2409C9ED476C338B689 caofranku@btamail.net.cn
593,895,020 *3D0EC3413445FA5EA928667840E72B54A04BB9D7 caohapeng@telekbird.com.cn
593,895,021 *3D08AD40DE69502F7AC411DF1895C945AC33421B caojanetv@chinaren.com
593,895,022 *3D0B9392111D671876A99362A70CC30E5DD2266A caojennyb@163.com
593,895,023 *3D07A2C775E519D5ECD9DFBEA2C73F9511A1DF4E caojiubiao
593,895,024 *3D05B5115FEF3177A98A9B2DBB86D4CB9BE120A1 caojohng@wz163.com
593,895,025 *3D08640A267358780FF29FA848B2C629043165D3 caojohnp@fm365.com
593,895,026 *3D0B19A0997C05DBC676D51D47875E2AA46A99E3 caojosephu@163.com
593,895,027 *3D0145D6C0BC84F82573DE54F70AAEA9B26BE319 caojuliaq@cqcnc.com
593,895,028 *3D03ECCC8F22A759529F104DAD4533A13C9A1B60 caolaurencef@thelady.net
593,895,029 *3D067BD66A7AE426CFCB5E4505879F6C8B12961F caolenghu
593,895,030 *3D07B31E59F6334398C061C9E01B58BCA1E71122 caolilyn@51.com
593,895,031 *3D02239453458DBDFEE0A60D1B4C8900305293B7 CA;Om
593,895,032 *3D0353D507133E60245238B43699109034EECF6C caomariaz@focus.com.cn
593,895,033 *3D06E70D1D2F81AC7494F4F51150BC2D80099F5D caomeicheng@263.net
593,895,034 *3D06EF61CFDBF1DB30B5EA375B58731E339B5C25 caomiaocun@263.net
593,895,035 *3D0CC803050748B0FE0A6501F98A9D587CBFC330 caonelsonm@gzyp21.net
593,895,036 *3D01DDBDB42C6C4BBBF38A826F1009C43C3A55D5 caopatrickg@china1mail.com
593,895,037 *3D064E636E3E90D3502995FEA82BC4E94CDC0687 caopatricku@mail.china.com
593,895,038 *3D09E42780AEE55A6E46536134437CEBBC13EF19 caopaulr@xinhuanet.com
593,895,039 *3D013B20EC55659834A288DB79A1D646E057E4F1 caopeterh@ejiajia.com
593,895,040 *3D0300EEC3B72FA64F16296E552756BF27621097 caoricharde@focus.com.cn
593,895,041 *3D0E2CBA51592DD3E7B18E5D39E04A54B0F88B7A caorichardz@china126.net
593,895,042 *3D037D76B06EC85990A5B719119DCAF900A21100 caosaofei@mail.777.net.cn
593,895,043 *3D03EB6BB41181890EAC41FBE2A21D1178CB7EF3 Caoscaosing
593,895,044 *3D09CF45F86608800C6D910FB90C01F83D56179D CAo#T
593,895,045 *3D07E92E4D0B0F8EEC30A3183ADAE8844239A6B7 caothomasz@cityhot.com
593,895,046 *3D07571B687BE1E0EC5A2399D05D7C328CBD5D18 caotommyx@963.net
593,895,047 *3D05CB600F639616500D78A0527F471D1BF1CC10 caoto@telekbird.com.cn
593,895,048 *3D03612A5687185478B0AFDF689A31F997B78050 caov12@aol.com
593,895,049 *3D0829D712E87301DFF98A14EFFD9F39EABBE965 caovivianq@5415.com
593,895,050 *3D00957A0AE750AD89B723D9F293AA270DDE382E caowhitneyk@email.com.cn
593,895,051 *3D0F179D715C489E45D163A5F4E580B4B50517D8 caowhitneyx@cn21th.com
593,895,052 *3D0E9B39E202BB36155599B0DA6232F0226D54B5 CA+p%
593,895,053 *3D000E0671742A5C289E56C9FCED6F195D0E597B CAp6M
593,895,054 *3D068DA0627A1AF40A76356A00DFEC44FE4C1558 capaciing
593,895,055 *3D02553845864A6E95256B5C04ACFEDDEB827924 Capacitor speaker
593,895,056 *3D07730241F5CC24357C5F5CDB7CC43AF1CEED40 capacitytalkcecil
593,895,057 *3D0E0CA6EA52D879B88A329280A776B4A61D0A3C Capalti
593,895,058 *3D0AFE0DD381F19AE8CB3335C9CDDD38AFB38932 capants9
593,895,059 *3D03CB3087FBE41E312CBD696BDCE4228D9B1A33 capbib
593,895,060 *3D0F7DCA7165DC7FFAF7F556A1DF5FC2ECC5E436 Capcases4
593,895,061 *3D0D255B379E897E0E57C29005588FCA600FA94A capehart4
593,895,062 *3D05FB0E12E89DFD501DE896BF4AC0134BA26512 capellettis
593,895,063 *3D0EE8027CF6DE50612B00D2DF86DFA6C2B61CCA capellodaniel
593,895,064 *3D0E332E1AF901678E5D9FA61736A894F71EFDCF capeloto6
593,895,065 *3D0D44692E64F4B078CFF490450DFBADCF7BFCB5 capetidescom
593,895,066 *3D0402BD87A4C25E8A10C21484ED8AFAB47A6EDA Capferrats
593,895,067 *3D0B1FC284563023900D6F3581755BA6A11359B9 cap_gutalk
593,895,068 *3D064C1314A81E1EA4295527EE176CB432A695BB CAPI7ALI$7$
593,895,069 *3D03F41CFADE9BBF73DE5677996FDC27E66EA347 capìata
593,895,070 *3D022EAB9DEB23221AD95368EFC50A53507C6D20 Capiparte4
593,895,071 *3D0D652F77B47302AB14FBD22F88101DEB89872E capisica8
593,895,072 *3D0A6DFF0A7254AE95C46136C084FF2964E3DD85 capitald4
593,895,073 *3D001DFC40A1D85C4A9F7BD6F719723B22D2C7EE capitalhill(3)
593,895,074 *3D07A335C49C52243952A8DDB1982ED0376C7970 Capitalisa0
593,895,075 *3D0D03F8C325CC3FA7DCE2233DA4795E354A1E50 capitaliselink
593,895,076 *3D02DFD4E644C9206F4F9788840E0111370A53CA CAPITALISERONS!
593,895,077 *3D0404A23FB7EF18788675F0C0EA91AE214A1936 CAPITALISERONT?
593,895,078 *3D0E3CEEEFF5025E9352DF80311654C7477CA47F capiteuse6
593,895,079 *3D058A3677A355F4D546C9724466F72E8CA35095 capitol50
593,895,080 *3D0783E08F8AA12127D3DE24802EFA22B42BCE4E capitolmississippi
593,895,081 *3D07175EC07B662C44225F7395FDE3F0CFBE7279 Capitose6
593,895,082 *3D0B969F72CDC630B430896370B3F8E7FA9805F9 CAPITULATIES.
593,895,083 *3D0C97C5C59CFB0F4C403BFFE17842DD5A62B7D6 Capivi1
593,895,084 *3D07F68BF3F2251A21E9E0E886603A813AA54542 CAP(K
593,895,085 *3D0563FE9FDA4E87D8B1637A3E3084BA17372CC8 CapKk
593,895,086 *3D05D564127DE8179BA4EBD81012FF792D1F24F6 CAPkQ
593,895,087 *3D019ABBE28D88E506A6CF0D14DAA2EF174786FA CAplG
593,895,088 *3D09831252F1618E904D35E3DB48BBDBAA006B20 capling?
593,895,089 *3D03FC3A4308F1149FD0B3BDB22064CCAD4FD651 caplins3
593,895,090 *3D0753C7396D114D121DF6B11EF06E0862B3E999 CaPlQ
593,895,091 *3D014B51BF23DB3644E4173687DCEB4F85ACAF7B cắp nắp
593,895,092 *3D01BD545D6B01A6AE568346ADB2507149128A9B Capoeiced
593,895,093 *3D063813E64D8835A14FD68633516F319286C192 CaPp4
593,895,094 *3D02645DE78C2B759D3152F02C86790EDCAA970A capp6
593,895,095 *3D0581A0F2CD785365A11DAFDE40DE3314A7634C capp@cdc.com
593,895,096 *3D08E60A904E1747E4F08A031C1E16715021E7CC cappe1eni
593,895,097 *3D0814BE72A3D04B51953EBA3D195873342C1988 capperottato
593,895,098 *3D07A6B14B1901FCE7B7B55E94F5974B8F210106 cappetto7
593,895,099 *3D06EFC649AFF255E301A002F6C6954F8C8721E1 cappra360
593,895,100 *3D05EBBEFA15CE10C96863A4DCC469F6488B5524 CAPRELL'S
593,895,101 *3D0BA6AC3B932778C23A686C4EAAF204C10E509F CAprf
593,895,102 *3D00622C8EC7B19F86F52FBE76A5E475CB7CF9D8 Caprhymes4
593,895,103 *3D0C959A1EE34FB2A5D5B1FD6183054B6778C925 CapriceNo.13
593,895,104 *3D0328D51B3A2ED75F8B4713E4A082B2851126E0 Caprifol7
593,895,105 *3D025DC45E2363619BA0F8E8212D5B452280D45D Caprius
593,895,106 *3D002D44C378B5D110B9902102462703814A7570 Capsisest8
593,895,107 *3D025599F2AF6F84B7CDC873587756C359C114BF Capstaff9
593,895,108 *3D062619D0E15DCCD4A344293581C93EE65EAD76 Capstan6
593,895,109 *3D0C41D4C7F579FECB0724CA3968F2ACDDF29840 capstans@yahoo.com.hk
593,895,110 *3D05F2195E1B60774EA4E133A5314917F1BBB0D0 CAPSULOPUPILLARY5
593,895,111 *3D0BAC6F4D770C9C6CCC991D3E3CA815243CA004 CAPT1VAT1N9
593,895,112 *3D00EED3528C6841BEC38649B5773ECD3D5D874F CaptainCarl
593,895,113 *3D0027B1055598AB1A35E294D6475502C8417028 CAPTAINDADDY2007
593,895,114 *3D0232F5D9EE24A2B5EA9DDEA0916E88D750F360 captaindevere(batcavedesifix)
593,895,115 *3D060C86919BB78756537FF30230AE1A8FD8B65A Captain's Diary
593,895,116 *3D0598D54DF29FC277D3529746D43298F6DDFB00 captdreamr
593,895,117 *3D036E22B1265D8613C52C64BA35FE2BE6A826BB captemus
593,895,118 *3D075A7214F8608D82F976B0697E6384E64A9DDB captiuis2
593,895,119 *3D000CF3E1BE072E683221493F9F3AB914909189 captivate123
593,895,120 *3D03FF7FCFFDA03EAECD2A8530450AE587A2C23B CAPTIVATED?
593,895,121 *3D0D7AAA8AE83B7B8A7874B2CA34D9ABFB5ED3D7 Capt!ou5n355
593,895,122 *3D03AC6258A542AC68BA0F7E80EFB75BE66B09C4 cap-trapper-selected
593,895,123 *3D0E35267C6A72F34B3DE31CBCE833842B5D3B49 captsnort
593,895,124 *3D08E164F47140EA26E42174ED19A073FCB3F48E captuavam
593,895,125 *3D0F11DC475EAAD288A15C5653FAB1882211E1DE Capturable4
593,895,126 *3D0AE5BF026AE39059E2F38CDB8B32445C8EDACA Cap$u1!ng
593,895,127 *3D06CE529B8B75898BFE836B236E6C3D9AAEA3BD CAPULLA78
593,895,128 *3D0159BC4AD6F2525320A4FA56078190DDB6E5C0 capullin7
593,895,129 *3D079CFEC912F3764F6737147C361CE2C9C81ED4 capul@pchome.com.tw
593,895,130 *3D08EA3089C88E9525C759B125B9B787CA96FF2C CApv"
593,895,131 *3D0A0633738144BF196692FCE315C374A0B314ED capwes
593,895,132 *3D0181A02BE3AB396C45AA65BD4AC8575F10E9A5 CAp/X
593,895,133 *3D0DD49DE537D00A6995D88BDA9AB3F416D43592 C+apX
593,895,134 *3D0A32E8E4C54FEDA194213C046A44C3009E0E06 CA=:q
593,895,135 *3D078403997C5883C7A5E524D41B15931EBCC05A Ca.:Q
593,895,136 *3D093AAF609ACCBF4F07CCB9392A9966A49BF8E0 CAq0/
593,895,137 *3D0896EAAE7B9686314C9D731A92065150FBF291 CAqAu
593,895,138 *3D0410FD22F8ED903F67DD3C82EF070685F12EE8 CAQed
593,895,139 *3D084A96A3AEEF69C314D766793AB1989B260D51 CaQU
593,895,140 *3D092EB165DD8FC5944E17749CE9509C9EE7D7A5 CAR+,
593,895,141 *3D078C8F00F18A0CADB0325F0B03A546D9DF216D C;Ar
593,895,142 *3D078C3B98E30904AB41C480A36C3A78FEE0453C C#aR
593,895,143 *3D05536B63EEBBA6FBD2B02EADDE2CBBA27E72A5 CaR3;
593,895,144 *3D0EF67D5B95E572232610C21F8A0FA60D69D4C5 C!Ar6
593,895,145 *3D0AEA562C48469E58BF4CB7754AB9CE72BB7B73 CA!Ra
593,895,146 *3D0F1F011F3AE62D06BA420F8EBE988D5FB42988 Cara177
593,895,147 *3D08D2A79DFC5F95CEAF4694AC38F037C8BFB96D carabeers
593,895,148 *3D08C26AD63AC33A2238871C571375C44011F791 Caraccan3
593,895,149 *3D0A98B227DEF6B91322A92CB0C1D9E3EF9A86FC cara dove
593,895,150 *3D0CC94A1CDFCD435898C6861AEDBFE7261C984B carakeel
593,895,151 *3D080EC9E178CB19D4978D79180B09BF343A07C9 caralin4
593,895,152 *3D072E4FF4FD7A6B0CB915B20814397E37B826C9 Carallee3
593,895,153 *3D0F0D7E49B68027B5295A01D042F72BD3496D9E carambaheim
593,895,154 *3D0E70A60E7EE45B5A122A72503F5210F37FB1D9 CARAMBOLEREN8
593,895,155 *3D06BE7E5F566485F135B1E6476D561613934DD0 caramélisés
593,895,156 *3D0C6692F05E59A1F4423FFC2BE642598CEA061E CARAMELOS22
593,895,157 *3D09673BA8728B62BB464545078907422E13BCB2 CaramelTart
593,895,158 *3D0E0BAC88B0981A800777BCBCD707E6322D20F0 caramelvanillahazeln
593,895,159 *3D02F5D6BF6BB0A8060FC104C52471651B61D84E Carangal3
593,895,160 *3D00CB82C306D89589DF7B378620DCF535F7C456 cara novak
593,895,161 *3D0D19F0BCD76AA5A5F4E684B5D0EB5DD84B76A2 cara shaffer
593,895,162 *3D0B58F74FBF00F2D698938E2558B3D401C6AC2F Carasuing
593,895,163 *3D07B1915393A96F5CE8E71206982CEF32D9B770 Caratcarat
593,895,164 *3D0341CF37278632EC6D659F6C71B6321C2A0231 caratermo23
593,895,165 *3D0682062F129D8687BA11C40A25C2673EFC01BA carbajl6
593,895,166 *3D01C3A9D45B6E82B9B4E4F5C97FF1113A94C91F carbazid2
593,895,167 *3D0CF29FE9ABE1A15B620794547AB639875B7119 CARBAZINE3
593,895,168 *3D0E829B3CBD93058E3840B184E4D09FD9281432 Carbetna2
593,895,169 *3D0DC34705B24EEEAD7B26C39AD0F18000145513 carbinea17@aol.com
593,895,170 *3D07B189CCEAE57B3901514BE5D5B46B6C55E6AD CARBISET-TR
593,895,171 *3D0389D99AF91E54E927A92CBF3064E3F2EAF392 carbochironomus
593,895,172 *3D0BFB26A143045FFEE4FD859F49B94D7304281D carbofastdirect.comwww
593,895,173 *3D06E4AB14EA20FF9798971FA399CBDCAC4AEEFC CARBONATER0
593,895,174 *3D02D859E3DBE9A12971B0661BFC5732A4E2BFC2 Carbonatite8
593,895,175 *3D0500DA36209DE9DAC217D6E32C0C9311701F9C CARBONVIEW
593,895,176 *3D06F3CE77568AAA25F1BBB60465E16DF29CACB2 carbouch@aol.com
593,895,177 *3D01B5606FFCE0C162788EB031000AD0B54AE557 CarboxylicAcidCatalyst
593,895,178 *3D011BFB0666E8CB8A902BCA9E57CAFF961A2E61 Carburosing
593,895,179 *3D05D53BFFA7F481ECEB22358115EDF885022215 Carcama8
593,895,180 *3D088B095A17FB5217085ED7143A21548995A7E2 carcamal1
593,895,181 *3D0633573BA58498B946292D7B3108F8CB239F7B CARCARR1
593,895,182 *3D086A14FB718B67E7AC7835A3D6DE101827DB48 carcasse6
593,895,183 *3D0A70C032DF23257025BCADF8B5E535DF51574B carcici
593,895,184 *3D0E81985B661EC88A138C6F33D975EB835C9059 Carcrash—s
593,895,185 *3D05AD5EB4F52795CE6DB775DD855B5D1AC180B1 carculá
593,895,186 *3D004AD8E3E02967A6C3674EF25D155367C7EFD9 CARD51
593,895,187 *3D00E638CA6C89BBFD379DF3D05806463038C3C5 Cardakli1
593,895,188 *3D0D2DABD913B0D4E32478F57E4A3225A9B62AF3 ‎cardamom
593,895,189 *3D0D55346AD34A944B54AD6361AFFB9A207E9009 cardenasiii
593,895,190 *3D0B693E79C221772BD194B6DF653BE4066AD213 Cárdenasinvitó
593,895,191 *3D0BC10A3603196EC1710CC5D60F7E3346910533 cardew8
593,895,192 *3D0AE31D23D1BFE8561C0CAC6D508B296640C39B cardimp
593,895,193 *3D0D1A0FB845A52E88A7EC4A35A0A377BE2F7DBF CARDINALAT35
593,895,194 *3D09202BF8C4A49DAFB425C73697BC6E43740842 CARDINALMAILMAN
593,895,195 *3D035CD7A0AA364976BB1D99F7741AAF29A8499E cardinal-tanager
593,895,196 *3D0C210343AB9415B2B966B24A3A57B1F5F788DA cardini5
593,895,197 *3D06CC4FF205921A85D25420D68CA468E0470ADC Cardioma4
593,895,198 *3D0A02E4C017510753D70F04D8F664344FF27079 cardiopyloriccardiopyloric
593,895,199 *3D075E7FB6011327F627246C9EC75680CCED249D Cardmake9
593,895,200 *3D0DEBAD7A3D7E509C8BB943BBCD0853B47CD9D5 cardmaster@100yi.com
593,895,201 *3D044509169B320AB3DCAB851AA11148D5DBA4A3 cardmedia
593,895,202 *3D051553F2983331BC854051814943AA9514E480 cardnet@netheaven.com
593,895,203 *3D0DCB6B09C37209513DFF89B0FEC201164B3618 Cardoria
593,895,204 *3D0D602D459220FB0273EF9FFEDA85FACD0B8C29 Cardoso2002
593,895,205 *3D0F2DEC7C2CF6ADAF0381141CD72A82C5D1B55A cardpro4
593,895,206 *3D0EE27D07F24653E88F1BA8292C230D5E2FA699 cards118
593,895,207 *3D0FD88F59BA633393119FBD5D52927A5161AE3C CARDSUIT
593,895,208 *3D0E84BBDE2A7B7415D46F1CA9E733761F371458 Cardtek1
593,895,209 *3D07F41ED079FC3904FC7EBBC1555461F191EB4A CARDY'S
593,895,210 *3D0C9BBD46C7E75F4BA06E07D3C9938CB3DF0017 care@canada.com
593,895,211 *3D0980A700AF1DD80F31E2573EE25B20315E74DA Çareer
593,895,212 *3D00BD051C9E1BA48EB719851A62A1B908D04C93 care.ever
593,895,213 *3D081F7904E8412E52B2CB6581F85DBCDEA21648 CarelessMan
593,895,214 *3D08DDECF265CEFF75014147BDF5A53A93DF7F23 CareneCarene
593,895,215 *3D043A196C095260A8E50E910D742530E481919C Carenerased
593,895,216 *3D079E8502D8A2E27ADF2EAC3D1EC8BA60A8F5D2 Carenero6
593,895,217 *3D0E9A0CE895A301468799E20603CDE6F2581C31 carenF
593,895,218 *3D0278EAB6A5EF07660E72AE87AD4A0FDDF50976 Carenini2
593,895,219 *3D0278B463A8C3AE3CCEC191EEB005C5752C3D9F carenleed
593,895,220 *3D02BB863D1551A9D66122AE1816950235B197AB carerra1
593,895,221 *3D07A8F67E2BAC4A466255D09848427B51A7A435 careshsuperior
593,895,222 *3D00A57A68060F60DC3F5BBF6D4ADE3EF2980F78 CARESSDACOW
593,895,223 *3D0EA46CF06F0B9E1016ADC033A9DF1A75B61B50 CARESSERIEZ5
593,895,224 *3D0214D213A3A35C6A7C4042C499E9347933D08A CAREVALE
593,895,225 *3D077B7677891A8A5EC3E807036717C6606891C4 carey.alesse
593,895,226 *3D0AC8F8EED14F110907CE9F660073E74CAD7B30 carey.alverez
593,895,227 *3D0407FCE38D14C087D5A6442DF959610F096D02 carey.balcerzak
593,895,228 *3D0875DBAEA4C4DE4389A21EFD0F50B056F97552 carey.copenhaver
593,895,229 *3D0992B42501256EE9AE9E0FC5A22787B5E8BA8F carey.dezell
593,895,230 *3D075B4C0285383D4670A1D7A65D66A9BD2A111C carey.dutter
593,895,231 *3D0F406A5971A26A806CBE95DFCA59E65340382A carey.gioacchini
593,895,232 *3D0AB7F3359A024CDF8720C504B03E21D07DCDB0 carey.gius
593,895,233 *3D00747A332037F416517E4C993777F743C679A4 carey.greisser
593,895,234 *3D0BA3C38F92BB76F4C69456B112D28FAF96BC5F carey.herbig
593,895,235 *3D0605C7004A8F8D2FD7F6FB503C43E5C8AECCD1 carey.hollenback
593,895,236 *3D0F1C285108FD898A66EC0BD6DA75EB1460C54F carey.iturralde
593,895,237 *3D0807D9C37DBDE99A2D342AB7884B8E52BA2319 carey.laroe
593,895,238 *3D03F673D5AED304A52C3AC9BE14D73333326669 carey.nuchols
593,895,239 *3D04315F05B3357549FDC9B5BFCADFD064B7274F carey.olivid
593,895,240 *3D07BAE7EE1EFF431F76EFFC153F0AEBE8B0104A carey.radics
593,895,241 *3D0D1729986C724C651FB899787B9969B5996B0D carey.rielly
593,895,242 *3D071759DC8A3638357D1027F50DFA3EFE183849 carey.rios
593,895,243 *3D0879A92EB15EB967877E6AE3323A3B0FF6A68D carey.singhisen
593,895,244 *3D004845964E2C77A3DDF2F1065D0241A0DC1E85 carey.swindle
593,895,245 *3D009F80143B104650A5D3C49D8DDA95DE6396B6 carey.vanostberg
593,895,246 *3D01387A29B59BB4D70594585E02A30714F1CF51 careywebber
593,895,247 *3D0E049AFF082BE7AB3820ED2DFEB000EF850C79 carey.wensky
593,895,248 *3D08634C4D4C4ADEE5C1FEC0A10EA29076039937 carey.zigich
593,895,249 *3D0E72AABF6D8C42F34E4BF9C5F98D1D3D8F2038 carezayzayem
593,895,250 *3D05633F21B75663282C6D6AFF6C158B06D11DA6 carfalo
593,895,251 *3D0E2E667E001FAEE2A4C4106992180B0726A9C5 CARFD
593,895,252 *3D04CFDFA0BFFAA6DED230FF80117EC8D3618CBB CaRgK
593,895,253 *3D05EF74873301B29BB19D9450FC1C4E4EC2F7F3 CARI124
593,895,254 *3D027EAD559310367FB60C286A8E866FE876787F cariado1234
593,895,255 *3D09833DA0BE78C4E17D41376AA819682E2C235E Cariani8
593,895,256 *3D0D3C7A9A7A34EF73042EE7005453BBDCCFCAA2 Caribeses9
593,895,257 *3D0B05F8E1595F81B421CA5FE38EF11B12BE126C caribnqn@aol.com
593,895,258 *3D0F6B3BB6D3213E3CE33339C9BBD645D3DDCBC4 caribrueckner
593,895,259 *3D0E18DF5A97CEBC247D0D2D6F15D9A4D9675ADB CARICAMENTO?
593,895,260 *3D0CD9C5CF4A10E720BAFB9126DAE649A3530B8E Caricatur
593,895,261 *3D04F247ADEC05118E38FAE8AB1A9276D4399841 caricetum@yahoo.com.hk
593,895,262 *3D091CE83080D1440635E60614DC35D1F75F77E6 Car+ilage5
593,895,263 *3D0545A03E330B941C44B8ACFA42F1471DB38C70 carina.asen@mailcity.com
593,895,264 *3D0094D8D76DEA9EE820413E6CCC411AE609ED10 cari nelsen
593,895,265 *3D07AE0716BAAA4F33518E06020EF8009A9D6C42 Carinho7
593,895,266 *3D051E1388186566218081420CD18D19F19DC06A CARINIOSA
593,895,267 *3D0A145B5555DABEC42BD1113823CCCC6A9D6710 carin jones
593,895,268 *3D0088184E1A889AAFAED745AFA50512CC0D2844 Carinosebenta
593,895,269 *3D0D23CC82DDF52C5F6F37E0E59A59C42BED0582 Cariocas9
593,895,270 *3D0818F33F55EA07F5C49C5CAF43D27F63219C86 Carioca-take2
593,895,271 *3D0189D84A446E1E9C1780A32E7FD677F58E924E carisabennett
593,895,272 *3D0C8CBCD915DC68F0303C0C2BCDAF7DC069F57F carissa elkins
593,895,273 *3D07714CF0E8B94FA8381FBFDAA5FA2548C6F0C0 carissa flores
593,895,274 *3D09B93C9B27FFD931F92DCB6A038F63A19E3F86 caristied
593,895,275 *3D0FCC264F92509B627512783B4209163F852D58 carjoju
593,895,276 *3D03760C6F22269024FA71752ECEB5BB5B858BA5 carknard7
593,895,277 *3D009D4244E4109C491247662FC31245F21965DA çarktır
593,895,278 *3D0EA8039DABBD9A164B63C4354414E7D1518955 CARLA!!!
593,895,279 *3D0A37A13DEC410024F202FFEDEB025154B55D30 carlaadorabila123
593,895,280 *3D0808251C38A8AA51E158887C2170B61B610F7D carlacar@aol.com
593,895,281 *3D00160CBD6655704273EB584466AFB6DA8F8929 carlamathis
593,895,282 *3D094FDB76519A1C6F5C03B9449C40C20357102C carlapeens
593,895,283 *3D0948D9C0FA597002521B3878B4130FE2895B5C carlaschwartz
593,895,284 *3D0E4C651B9014A997DB5E2E86CC5C76E6262053 CARLASCOTT
593,895,285 *3D0E38823E0B86B00941FC674A3BC1AF20B51287 carlazamudio
593,895,286 *3D01723B5885CC401DB5471D22FA675B5609D7FF CARLBABY
593,895,287 *3D042E838EBF07FFBA08EAE2F03872B42B9DA981 carl beason
593,895,288 *3D0DE7F8DBC43FD4F3042D5F16AFECFD888F4A4D carl.bubak
593,895,289 *3D08A88D75B930045A56E70D5466CF0764C1957E Carlburg5
593,895,290 *3D0483C0854656C134A4B04C0CC3480E3BDDCBC7 carl.coffee
593,895,291 *3D081413029C7160B64157CD615CCAD83103D62B carlcougar@aol.com
593,895,292 *3D0C5AEB5F51223518891C7E3A31EB8A8742793C carl.curbelo
593,895,293 *3D0D6DB251990637F48BC1212BB228E2B92552E2 carl.dalleva
593,895,294 *3D0592C0B35C5147C0FADFBE2603DD0FEAFF326F Carlee146
593,895,295 *3D0527B7500C5ABBC23A99FD50C10E2389F14C48 CARLENE6
593,895,296 *3D03D48CCACBF998924DC7797FC2EDB475723AAC carlerik2
593,895,297 *3D09D90052CE5A7FE6B88F65FC6DEF042B362929 carlesoned
593,895,298 *3D0FED817AF41AC51F5DC2282AA668E911BECAC8 Carleton1977
593,895,299 *3D055DBB6D8BD82E25EE4F7F65E11917BF2D885B carley353
593,895,300 *3D02EF88B51F383E4E3CDA2BA9D41260BCAB9E4E Carley650
593,895,301 *3D06EA75966A599BBC6B5CAC3F8A92F32D877EC4 Carley70
593,895,302 *3D0A6EFFDEDA3E11D05AE1F13E18A19BE38EBCA1 Carley872
593,895,303 *3D00D672BA9AD15533F31F009AB420CF1D5F6633 carleybrian
593,895,304 *3D0FEBC545BDF78926C4B325A9991F01649D0266 carl.ferjerang
593,895,305 *3D0FCA4E9E31484FA91130ABB0FEA260C1FDD595 carlfish7
593,895,306 *3D08F550E7068965944F48E2B323C6A00F7BD3D8 carl.galla
593,895,307 *3D0627C49DA6F30832B2B4D200B75EC258354D91 CarlGeorgEd
593,895,308 *3D0F173BC2BC66B2F8AC08331998FDFA4D1A6305 CARLHOFER
593,895,309 *3D0DDBAFF8E06EEFAA45DE78064A94C622CB7FCE carlie flanagan
593,895,310 *3D07431AFCD9E89203486FDF8B9210E69E0DFA81 carliegoff
593,895,311 *3D0D095CBE1E456983848A4B4DF26B1EA3886873 carliforniska
593,895,312 *3D0AF70AFDCB1FA295B55895F9AB3EDA675ADF56 CaRLInE
593,895,313 *3D0B4A53F6C6EEE808BF2259CD896953CB8E11D6 carlitos medina
593,895,314 *3D047C5CD3D46864771E1CE42F081AACEC02E583 carl-ix-grav
593,895,315 *3D07B6FB95ED664D3C10B09563380CB958CAC915 carl.janssen
593,895,316 *3D02DE95AB05F56B3A2B00C19B84E0A2A807FEDF carl.karas
593,895,317 *3D0D7F65317B4D97EA329C4B8BE970A06EEF0C3F carlkingsbury
593,895,318 *3D0E98907C550F0BA5DB99E992063CC3D52E8549 carl.lenters
593,895,319 *3D051B87B318E4B4CF3F33EF9172FEEAE01312D9 carl.mcgahen
593,895,320 *3D07E5FC7B64C97D9046BB4275D4B963F9AD81CA carl.metta
593,895,321 *3D027BD0B7A79437B12DF09A2EC75977DD513E3C Carlminou7
593,895,322 *3D0E1E085948BA6B51558C778D242459B5D1DEF6 carl.nickelston
593,895,323 *3D010766940F80F5DDFA4DA90A65BD14F055DC75 Carlnite1
593,895,324 *3D004FFE5B46A886658DA94CA9B7D5000F46A5BF carl.nogueda
593,895,325 *3D04033B994440422AC12BA37304F5A2047929AB Carlo911
593,895,326 *3D0D4AAB547060C9EE8D064A39A8CAC85EE1E3B5 carlo.almengor
593,895,327 *3D0C9ECFFE4FA6B73472CB793100C4D047C8D6C4 carlo.balowski
593,895,328 *3D0F21DE0A6004537E4F65307838771CAED6F22B carlo.begley
593,895,329 *3D0407639A6F1D98E8DED3A80221F4359757C9B3 carlo.borwig
593,895,330 *3D0820ED77B0C51AB7D94A4877B1FD274E839EE4 carlo.cataldo
593,895,331 *3D07A562D8D9EDF82E27081501DB041E4AEB60F9 carlochico
593,895,332 *3D06564F30770AA4793FF316E92A673A197049A4 carlodelia
593,895,333 *3D08FEBD3E170217664E0B7C1F75B996399AA3D0 carlo.egleston
593,895,334 *3D0470143E0C68E62F89A986CFA5B46490592BDB carlo.fiorillo
593,895,335 *3D00811D00FA260D40EB3BB0E38E29E4B1281982 carlo.gauwain
593,895,336 *3D018A21B52A9DA308CA4DB1D48A81121C1BEC40 carlo.girt
593,895,337 *3D0A96094259148876CAB20AFA5BE4BDB4EB19F4 carlo.grattan
593,895,338 *3D0263AAD96304ACAA889FAEEA90322FFAD7B502 carlo.hornbeak
593,895,339 *3D064591A0CD1CE83A60AB98B47D381E7279D8FE carlo lee
593,895,340 *3D0729659FB3AF393C87E2318B900A645CA6DE89 Carloline3
593,895,341 *3D062153CEEE02A7EE7F9CD752B8BB138F033D36 carlolyn1
593,895,342 *3D01EC17BC336A6CACAB278F83C206A173906E3E carlo.macleod
593,895,343 *3D0410215270B5D8294E0613A7067D4AA68907E2 carlo.mozier
593,895,344 *3D06321561E36C03B005C0F9888806C917AA95ED carlo.psomiades
593,895,345 *3D0D36371457D9885A1F7C1C9F5847BC8ED2A32D carlo.ravenel
593,895,346 *3D0B5E4E7C50668A435BA0FF0C20BD671F8608EC CarlOrff:InTrutina(fromCarminaBurana)
593,895,347 *3D0CFB9866C631261765F22C7486D54C911DA001 carlo.rouch
593,895,348 *3D063AA0E192FF307F28FD37B37C7076603464B7 carlos17061976
593,895,349 *3D02222746BAC96F6C84EBF43A16FDB0958BDC15 Carlos550
593,895,350 *3D0B1187F84A067E3096F508D92C713801080D3A CARLOS-ALBERTO-GUTI
593,895,351 *3D03925A05648B63EEC8FEA9ED89D8F98CAA20E8 carlosbee@hotmail.com
593,895,352 *3D0C54B58EEA9EB60251BDC39A5F3F8453AFAAC2 carloscapella
593,895,353 *3D09F00F55F3211B5639BA598CF82D32581C8BA7 carlos.carlo
593,895,354 *3D096B51D5120989567B9EBC0931B8F2A03801F1 carlos.currey
593,895,355 *3D001508B6D008BDFCA5F003EC525E94157F498B carlos.dziekan
593,895,356 *3D0A89E88D82A4FA1E1AA57459957C5AFAE91BFD carlosemano
593,895,357 *3D0ED97370EDF388B4B7C673E39A378BAF91B106 carlos.erisman
593,895,358 *3D0F042B832FDB392F186B6C1EF56E31CB02CE31 carlos.ernandez
593,895,359 *3D06A579815006CB359A07CDE9CA85964F8365A2 carlo.settlemire
593,895,360 *3D0092934E5920A8676308EEBA17B816DE5AEA8C carlosf1
593,895,361 *3D0BB72ABF25FE3D962D65A640248A9958925E52 carlos.federgreen
593,895,362 *3D0C5DAB8A1C53E540ABAA3810775F645093A45B carlos.granville
593,895,363 *3D0C3DCD9B57EA17970D70171BCB1A4CA1CC0DE0 carloshael@mail.ur.mx
593,895,364 *3D0CE71C6BF476AB7CFC91E37859B53BD120C022 carlo.shindledecker
593,895,365 *3D0DFD3DA52C15162EFA7C80E8C5E96EF0259397 carlos.howington
593,895,366 *3D05930221D3B3B37A948491093DB63F773706CA CarlosJean
593,895,367 *3D05736F58AD829450D2733806962AFFD38FD8EF carlos.lorna
593,895,368 *3D007C59F72BDA0FD0B0DC2BD3552BC818768D5E carlos.matar
593,895,369 *3D00408E4149DA8DA63B7234661E92497284D11D carlos mizrahi
593,895,370 *3D0B0E6340163249A9A184F84D2C728044A873FE carlos.morosco
593,895,371 *3D022B0D3F1F58D26A3C0FB3E95095848ACB8144 carlos.moudy
593,895,372 *3D05E391749854D03361D10D4D9CF8635C67F72F carlos.musil
593,895,373 *3D058FA6F764F8A1426CA36B4372FFCF96002A6C carlos.nichois
593,895,374 *3D071188A3998456529772537DC6CF522CC60437 carlos.rushin
593,895,375 *3D0D54EF6215037CDC829B0762CA564CD9C450B3 Carlossie2
593,895,376 *3D02019B1385EB0DD090C327A010972003824E44 carlos.sommerfeld
593,895,377 *3D00A6E35E49A3B2C10BFDC1B4C9C7EA750E78A5 carlos.strothman
593,895,378 *3D01E77ED54F636BFB9830BA1581408AD1F68876 carlos.swan
593,895,379 *3D0D04E35A37663BABF1E9305493CF76032A24D4 carlos.swart
593,895,380 *3D0BF02FB6F477085F937A17AC1A21B2331FA7DB carlos.wolcott
593,895,381 *3D015E1F898FF7437DEB1620177E43DB9221A6F6 carlos.zausch
593,895,382 *3D0CE011B1B95CEA7A92EDA84E325DE6A5EF1EE1 CARLOSZXCBB
593,895,383 *3D0E10B4DE5DA81761869CA7748645F7BCF83BDF carlo.talerico
593,895,384 *3D05A2E7DA8CBEE0E02D81D8EBCED624FB86EB1F carlo.tebeau
593,895,385 *3D05E17BBB7EEE4974C0DE3CBC177050196793CC carlo villania
593,895,386 *3D0CE7EABA136AB8428A23B60EDCA9A8AEE077E9 carl.pennel
593,895,387 *3D03A09284D157DDC9C8A4E36001A7A35C728A55 carl.rinehart
593,895,388 *3D05307B3EAE7833181457456FD9606B7A53DEB1 carl.roegge
593,895,389 *3D0E71E48915921DEC19FE543B1AAE5DAF90FBE5 carlsar
593,895,390 *3D0D3312857B70991C6E494CC111F686A2025A31 CarlsbadStormWater
593,895,391 *3D03A63EEB5393F0630D5F8579A9C1B1ABD8B96F carl@semiweb.com
593,895,392 *3D095D535922394486323E13420403E1568ADBC3 carl.shrider
593,895,393 *3D0B512C8AE67907B18E9B01839855D21A495ECC carl.standifer
593,895,394 *3D0897BB4542A1BFCE9A346D4E3ED23BB4711035 carl.tiberi
593,895,395 *3D0C1D4640DEE4495AD9F716464770024DB14D74 carlton.becze
593,895,396 *3D06D2C413FAE5651BCF3359AD64B70960F29803 carlton.billinghurst
593,895,397 *3D00608522C3B0BDAEBF6A0074D51C654DF8B881 carlton.cadenhead
593,895,398 *3D06767EE3074A0ED4F077E4C51A143D98172324 carlton.clavette
593,895,399 *3D0B9A14C8A214F0C9FE971B50484444FF72FAEC carlton.colas
593,895,400 *3D0F4DF231CE6621B1FC1040788A30F5F2D9AF99 carlton.corf
593,895,401 *3D06034DB296CD922ED6400B820ABC7EE8953D0C carlton.daltorio
593,895,402 *3D05308820CD07CB9945E9B462EE44BAD21BADBB carlton.digiovanni
593,895,403 *3D079B5B5F970D0A31AEBC15ED5B2983C8229DAB carlton.douse
593,895,404 *3D091084DE03EC3F237F5A975141C04FFD6FBE50 carlton.fallert
593,895,405 *3D00577B3EDDBEF385CDA4881BAC6FCEB93DE83A carlton.flander
593,895,406 *3D02786BCAC5EA2768730076C2882EEF704FAC3E carlton.geren
593,895,407 *3D00831A41A6A19FCA439857495A52593686E6C2 carlton.greiner
593,895,408 *3D0F9A1FD6F4E3B9BC6E719C76C1DE501584182C carlton.haerter
593,895,409 *3D01C28808FD642A2AEFA2C6B7A00613F731DCA1 carlton.hemmerling
593,895,410 *3D09FBFB42926EBA2A3A27BB39A7A43A296602A9 carlton.kahal
593,895,411 *3D01425841FF436FB7F602CDCE18E1894A74D9E6 carlton.maclauchlan
593,895,412 *3D0B0C591718CB7A9DA6531E3DBB1426FF9AFA42 carlton.ojanen
593,895,413 *3D0E66BB7BC27F406F1725AE631700FD01D08F62 carlton.perish
593,895,414 *3D0C9BC5D507ECB4AB22EA2204FF8D17A186F8C2 carlton.popoca
593,895,415 *3D02D91705B936A540B4937914AAC5CC21AD52A5 carlton.sharpes
593,895,416 *3D094CBF1F538B21A5BF8ACB8C4AFDE2E0A92945 carlton.stauss
593,895,417 *3D01FC736F36E3717942BCCECBBCF2F065C0C908 carlton.viney
593,895,418 *3D007E71E63D5A92006693493F8E0D8952024CAD carlton.walbrecht
593,895,419 *3D067804A4B1DA9EB8F75FEC1C25D67F80B4AF54 carl.wubbena
593,895,420 *3D0AF84236CA9EE934985DBD5C5C2E4158D2CB58 carly granato
593,895,421 *3D0F87F6B802E01A7AC5FAF0D4F089D1A87F7407 carlyhayman
593,895,422 *3D0FFC024B8A66A92E7B5EC214BD0678FDE7363D Carlysing
593,895,423 *3D0376AC485E1B3D4B4082CD4C3D2D09BC49E98C Carmacket
593,895,424 *3D06F5C4468310A91F5C48E96DA0C642C5EFC9F6 Carmacks7
593,895,425 *3D07829035FEC56A027ACEA911F33C4E3D2C1768 carmanoR
593,895,426 *3D08763A5A779520E737BA782C502FD4E7C28001 Carmatina6
593,895,427 *3D0BF7CE4A3755AA518D1CCF39CFC875E13BC0D5 carmelaang
593,895,428 *3D05902FD2BBDD6E69C38EAE5CF2C242B4DA11C7 carmelalewis
593,895,429 *3D035581465D69AC20F44A4C0EA9620DAEA16F5B carmelgiblin
593,895,430 *3D0D5A5662181F740504BF2A4F76712FD474AC8E carmel norris
593,895,431 *3D0F8D842FD88E9DB1DD2CEA210B3988BAD4B043 carmelo.avent
593,895,432 *3D07F6DC73A4FACB20CA98BE9FF544F767C72DB1 carmelo.derkach
593,895,433 *3D0F51CBC8F40CB0A56228647B5E8758B2DE9635 carmelo.dimmitt
593,895,434 *3D031903FB03495FE56F34CBA6719C0E590A94AB carmelo.dulatre
593,895,435 *3D054EB0F9CF61D1197AFB33805F7CD31ADCC00C carmelo.granzin
593,895,436 *3D014879613F7CF998A4E56B9A34659C28FB02AF carmelo.jacquemin
593,895,437 *3D06E95C3FAA834C3A0AFCBE1A2F572952726FC0 carmelo.keawe
593,895,438 *3D00F92E6A85DB1B5BDB8A5354186EB17FD310AB carmelo.kobialka
593,895,439 *3D05B43BB7CFCE0D2E93B5DCDADB12C597C37C4E carmelo.looney
593,895,440 *3D051D295F97C8DF0BEB7B575314266BD026E9DB carmelo.mccurtis
593,895,441 *3D040E8674C6FE16C13F3FEB89A8C01179FA5BAF carmelo.nestingen
593,895,442 *3D071EFE37D474704F03243E347B2DE7B522E4DE carmelo.planck
593,895,443 *3D0CAE10CAEA69332B88B6709696460F2ACC0790 carmelo.plock
593,895,444 *3D07CFDD0F6EA67A2BCA414509586827AFAD28D7 carmelo.schantz
593,895,445 *3D09F8E7F72C36C92A9A73DB0C57F9C8A236040D carmelo.tewes
593,895,446 *3D0C3D8E9095CD4A97D52116905154F75DB2C3F6 carmelo.theule
593,895,447 *3D0E00E1A77B45F357982A5E16F2B15E82986819 carmelo.tolen
593,895,448 *3D01811164809F897B93F84E9D4405EC16A9AAD3 carmelo.willinghurst
593,895,449 *3D0A6BDFEAE4EA2C5961C489F32F46516B5B4A39 carmelo.zmuda
593,895,450 *3D03D1690A3B9AA20851E76A6E58FBBF2FABC4D9 carmelo.zolinski
593,895,451 *3D0436657A7278778EC9679E0D7FD954D12F540A carmen381
593,895,452 *3D05E914577120D9F80A96CFAE44495DDCDFE625 carmen:acti."aveclagardemontante"(choeurdesgamins)
593,895,453 *3D0F6E035DDEB364611719A690E95546F4B67A19 carmen.arnhart
593,895,454 *3D0226DB6832BF1FF0BFFCF25034D67996493B5E carmen arvizu
593,895,455 *3D0A6CECF40BE72E28ED40895DA365A13729E471 carmen.braxton
593,895,456 *3D0CD90640EBBA20E45ABE172AB80DAA87CCCE51 carmen-calvo
593,895,457 *3D0682E35289923E9242994D1A4ACB0F38E907B7 carmen.codey
593,895,458 *3D02E1EDE9EF9048D080C0069CE95B57CAC67E02 carmen.dorie
593,895,459 *3D050B770EA1EE4138E71497C7E848F6A7ACFCAE carmen.doucet
593,895,460 *3D0329EEB5244B56CFA93C66FD47C1438127BC64 carmen doyle
593,895,461 *3D08FE8BA97225014471FDFC4466FCBBE6A06E57 carmen.gantz
593,895,462 *3D0DBC3E7DF6BDF1FC171E4129842ED975B86A3E carmen.gillins
593,895,463 *3D0925B11154F0EB6903E5EF4F1E55A93954B44F carmen.ginter
593,895,464 *3D084A17D463E6C0CCE07EDF296E7248F0FB68EE carmen.gorey
593,895,465 *3D0685B30D62910957754E27E938734B2DBB6B6C Carmen'Habanerana'
593,895,466 *3D0CBB0FE58A74A7BDFEF56DF0962D5D68DA6A70 carmen.halek
593,895,467 *3D0B1F7FC193F07EACAAF8C66EF17A5F82BE2073 carmen.harju
593,895,468 *3D07107E51120E2368C6A1B3A90C98CE846577E0 carmen.heare
593,895,469 *3D09A3F419C0D2BFBC2F488A88EE13812E1A3BF5 carmen.helmle
593,895,470 *3D05ADD7269F0EF050304722BC8C3FE1B586DCCB carmen.iha
593,895,471 *3D039F97A9EA1C15512E611F755015C1B3AD8311 carmen.koblick
593,895,472 *3D0CB8E0C40092EE7A47436B49A16C217BA02019 carmen.largay
593,895,473 *3D0254AE316477CABBC3575998ABE7FF6AACE5D8 carmen.martorano
593,895,474 *3D0A035D195EF9E6332461B42A9BB569EE27B9C2 carmen.mellos
593,895,475 *3D077CF0CC3296E74AF7D614136734A9F73B4E09 carmen.mulato
593,895,476 *3D0398EE0CF5DAD56561AD3C034AB6B09E968181 carmen.noon
593,895,477 *3D0D0240BD6104E648F5A21C42CD643C3C083E34 carmenpalma
593,895,478 *3D007E873090033785388A3DDC30B630D34E786D carmen.schnorr
593,895,479 *3D035C3E23738BCD323F40D50F4E19A01F824395 carmen.swander
593,895,480 *3D0B1B115B7250B6B59C1FA00632A7E0E64CF986 carmen.till
593,895,481 *3D0C24347395F8348DA0F866B45199ABEAF55BB4 carmenutza_ely
593,895,482 *3D09A02FB54E9235455950325C98674739782D09 carmen vilness
593,895,483 *3D016C016879C8F2C23CB5B0576DB57D12FFB4B7 carmenving
593,895,484 *3D093CD7F2F6643BBBC7274BB3B4D978F29A9404 carmen.wygant
593,895,485 *3D09353ECCF4EAFF631A1FA5406A26BB76D009F4 CarminaBurana:Fortunaimperatrixmundi:"OFortuna"
593,895,486 *3D077144F07A41A082D6752AB4425D3B64941D6A carmina delrosario
593,895,487 *3D0386C9ADC77050D04F0653802008D2625E6240 Carminati1234
593,895,488 *3D0F39B096F93E49D955B38CAF7BFABF1D24971B carmine.adragna
593,895,489 *3D0C1600768598A240D3BE8D3A105C0BE289DCCC carmine.alderink
593,895,490 *3D03AD72429C379A3086A9310C102CFCABBA336D carmine.beaudrie
593,895,491 *3D0F74E39BD59DB90E64EC952866F970FD115B1F carmine.chor
593,895,492 *3D0E9FF23EB98AC464F93CEF7EB183AA835D3D98 carmine.ducote
593,895,493 *3D0F4CB127441614E85035BCD1FFDB7941EE9896 carmine.krolikowski
593,895,494 *3D02779A53F097CDA6199E9DF2DEA1C095FF4E38 carmine.kuper
593,895,495 *3D0D9ABA5476EB0C58884466369A85ADCEA92D7D carmine.mcgillicuddy
593,895,496 *3D024FB555A4FD61BB671D825EEF6B16EB7CA5FE carmine.narciso
593,895,497 *3D0B2B2C61173C655C02F6FD4768D286D76A46A9 carmine.ryder
593,895,498 *3D0EA314CBA509529771147AF912D90921414C95 carmine.sczygiel
593,895,499 *3D01423BE150514608442931D41F3DE39AA525B8 carmine.spraggs
593,895,500 *3D0839FC5DD64169F61EE2E018B3F26D063BE540 carmine.stolze
593,895,501 *3D0D724BEC3F2CA3E2D8BEB1A1847002C12C601A carmine.thurgood
593,895,502 *3D02EC94716BB08BC4F7EB0DA388EA46150570E5 carmine.urtz
593,895,503 *3D091AC681CF106A2982F2F4BC1AF8D7D1ECFB01 carmine.wilhoit
593,895,504 *3D01A64EB778E532D2A11A98301B4F8C9CB747F0 Carmlita6
593,895,505 *3D062A4DE487E344B2417A2D41D3B17199C7CD8F carmond9
593,895,506 *3D093B5701521349567C9C8E751AB50ECC441504 Carmonte
593,895,507 *3D04B8CF7A85B31E798A7F5486B2142F695B18F7 Carnage Begins
593,895,508 *3D03023DDB99212AB2D3477B204AED7F19480E1B carnagerules123
593,895,509 *3D0C6FCAA8E6E7D7FAE4D97B8D33F571071C8349 Carnavis
593,895,510 *3D0BA3BBC2464877C3A4D0D486DE65A3C2D2FDDB Carnedd7
593,895,511 *3D0ED30BE235136796127CAE5FC42B5618180237 Carnelos9
593,895,512 *3D008CAE1CBC84D869C058842D4D164E6E8B7F5A Carneuss3
593,895,513 *3D08E07350E9C5612F2DB57EDC5785FECE733B2B carnike
593,895,514 *3D01CCAC5B60DB559E59ADB709A847DC810536B0 carnosilabium
593,895,515 *3D044F9CE9D0C4A2C15A9D06FFC0690B69A4E621 CAROL36
593,895,516 *3D070B46D0F91CC564247098C35002E47746C5CA carola guidi
593,895,517 *3D01C8AB25B95EE60431EB5A4ED774A4041A6860 carol.anand
593,895,518 *3D0902F3D3A56E89F36672BA30AEF45CA9C7C4A0 Carolan'sDevotionandMrs.Crofton
593,895,519 *3D040EECC33D3B9EB1C5F4388E686D66FBBB224C Carolan'sVariationsOnCockUpYourBeaver
593,895,520 *3D09F8BF95843A100CFDA2C3AD7811BC2B37D181 carolapisaturo
593,895,521 *3D05D0661D9F9AE91BE2CAE471E39C82780AE59D Carolaynes
593,895,522 *3D0C9BE5F93EADCEAEDCA56E7525841603232A2C carol bach
593,895,523 *3D07E942886F18E2B76A654962DB18774FE97510 carol.bb
593,895,524 *3D0862D6A11E70A32D31C2477D437A5DD5DC2FA8 carol blumberg
593,895,525 *3D0F685244177BF4E7EA688E6F86F9DD575E17FB carol.botticello
593,895,526 *3D06D53F5BA93FE79D44684DAA266573F1C4BC4D carol.brezinski
593,895,527 *3D02AE0352176C3C66DF6E84C0F301C1998C66BC carol.brits
593,895,528 *3D01A2A55D69FCEB87A9FD02C632F0F25C34DD69 carol.chiverton
593,895,529 *3D005DE590BA0FFAF33F7540F55035CF430CE9FB carol.deblasi
593,895,530 *3D0D73D98B817C8B213E08F943A4722C703E1490 carole caryn
593,895,531 *3D00DF9843DD4BAD676571A74F13A7D07B679B52 carol.entwisle
593,895,532 *3D0F20790864FF8AF32EEF2388271FDD3D1E9ABD carolers?
593,895,533 *3D064EB62D2F18AB0F0701A28C74F64AFBB51AD9 carol.fallie
593,895,534 *3D0C21C57EE6773E08E49309B7DD7EBE14096177 carol.frieden
593,895,535 *3D048AD23337D0266E7ABE5104B7D04449576FA7 carol.graza
593,895,536 *3D0567053C7B33E77CA4F1275E3A7B68DCA11496 carol halton
593,895,537 *3D027982908868A6AE483B6740A7A03C350F7A1F carol.hammers
593,895,538 *3D0D9B09BE6431606BCD896B1D00C2428D52CA53 carol.heartsill
593,895,539 *3D0CB9C6308CF3621136FBBA6EE55A3BCF459FCD carolianian
593,895,540 *3D079444280C2489F2828DD3E54028C7164E3FC1 !@Carolina
593,895,541 *3D0F694DB8708EBED056D7C87470340858C1BA95 cAROLInA
593,895,542 *3D06E3CB33686584C2110538563266786000D5DD carolinadanaher
593,895,543 *3D0E8D23A2CA41A202F5250B75281195133F74DE carolina dela cruz
593,895,544 *3D015C7401E322076F5089A0C929DEC71071F293 carolina febres
593,895,545 *3D0E7B260B602BF4628E565B57811288E86308E4 carolinamany
593,895,546 *3D0ADFB716B674B9D4524293DECF2A98612C6BF2 CAROLINARHODODENDRON
593,895,547 *3D0827117E8D06FF83D9359E73908C2115875D66 CAROLINE2001
593,895,548 *3D0AB86279488F56BE2FB0757B02A5958FCDEF32 carolinebuller
593,895,549 *3D04E775008F694FE98B5B9E10B57AEC99A4C36D carolinecomrade
593,895,550 *3D01E0BC8EB0D615E5D264C76DDAD0FC0F1D54DB carolinekeane
593,895,551 *3D04071983C9679527C73CE11CFF9947012CB929 carolinelayden
593,895,552 *3D0F7F8579ED17B4DD21A211AC341E6ADA248BD6 caroline mattson
593,895,553 *3D0822D91E137BCC9B5EE78C6BDD84E02B54E50B caroline quiroga
593,895,554 *3D096642B5C3975586D57EE9B5E502785E674E47 CAROLINERANKIN1308
593,895,555 *3D094EE856D16A062260999A57DEAA8C159EB2C8 carolinereck
593,895,556 *3D0926A2178DD75DD049AFCAA6DD458751623183 carolinestidham
593,895,557 *3D05C88A44448A5D8C41BF507C8EA722583236A4 carol j law
593,895,558 *3D060A3D55904C7D272BFF71DF03B958C7CD0F27 Caroljohnson05
593,895,559 *3D0B66E7769B75F7FD3F28B69E91016D5BEAF7C1 Carolkim1
593,895,560 *3D0E5289EA4C6FB4A52627AE646A4E22B9B8DBAD carol.kurohara
593,895,561 *3D05E228F581EA85F9EA331099E280C5335D5758 carol ligon
593,895,562 *3D03FDF9D2B72EA818584F221B11D0536C79B4BE carol littlewood
593,895,563 *3D09B7EB897D31B33B9F9BC68C356CF3FC96B641 Carollove5
593,895,564 *3D0B9B4BC38EC4E55EBBFFE692413364A6278F98 carol mcsharry
593,895,565 *3D04CA602029572B9BA31D484EDD638BEC5E1692 carolmotsch
593,895,566 *3D05FDC9FF759143C755A4F8046F8B19F95A865F carol.ochotorena
593,895,567 *3D0ADC54E4008A7C86FEDCEB4E8838B78C926153 carol.rapson
593,895,568 *3D07B4373F0045197D9CD2E95606ACE06CCE1E60 carol.roza
593,895,569 *3D0F9E3AC3807D5D3C94F6B925294166D968FA13 carol.sheikh
593,895,570 *3D03F643069F473C5BD0BF3163F170AF89DC93DB carol.springer
593,895,571 *3D01A8E126F4EDD723F32FBFC301C0E5E95CC0CB carol.sueda
593,895,572 *3D03932B7D9500C001465DB6B4A791BC56619FF5 Caroltam@36.com
593,895,573 *3D06892B1ACEE4629CDFCC16C05BEC092E3DC104 carol.tejada
593,895,574 *3D09D630E8C9B476B66CF4C98AF1DE529B8F3D41 carol tousley
593,895,575 *3D0CD347CCEED5A4727063DAF05973B296CB47BD carol.turchi
593,895,576 *3D00BE7FB35792F1093F1290CC027E37D720FF67 carolyn819
593,895,577 *3D0AB03229FE2284C33FA9569697831E8D9DCA5E carolyna1234
593,895,578 *3D07D6D106245DBB91701B5AF7D2B00361E84918 carolyncordell
593,895,579 *3D0E574D81C8553BE82D55F5358EE59F6AA966A9 carolyn korber
593,895,580 *3D0CFE515F54AD1A748E4745BF613E5E846C27F9 carolynlancewhitlock@yahoo.com
593,895,581 *3D0C9F1DC9E379F1181F4D4DCD23B8FE89313E6C carolyn ricketson
593,895,582 *3D0EEAA3024742F1D85F4F0EE16046F9AB8EB2C6 carolynrowse
593,895,583 *3D03C0FBB0442BCD2B509BB07653BFC267F9A5EC carolyn s hughes
593,895,584 *3D010F4ADB5527E5825FE9FC899E1408E0297625 carolyn whalen
593,895,585 *3D0EB559D67780E0A39AB82E2574E5412B54526F carolyon4
593,895,586 *3D09B36C91133EAF1348F07B2BEA9AAF5DD0D75F caronlee
593,895,587 *3D0031675A08FD455221BFBE12D64EFDA741B8DB Carotinemia3
593,895,588 *3D0E458FA06F91EFD99D7ED8329B112F76378E16 carouselfl.comwww
593,895,589 *3D0E876BCC2EE6F26B924EFF0DA7C9790EB1674F carow9@mail.ur.mx
593,895,590 *3D070884BA4D5A27532B8B44A879871FDF2759B9 CA%rp
593,895,591 *3D029D81943C27BF0FA90DB5C65483BFE267F738 carpeding
593,895,592 *3D077ACB397600DC5CBC671C47F2FBA138794276 CARPELLARY7
593,895,593 *3D02F8A244315911B99A2DC115B94E9DFF45EFE5 carpeted, carpeting, carpets
593,895,594 *3D0C86F1E80A7949A2960CC43F6CDB1D7A0BFD62 Carpet Sounds
593,895,595 *3D030646A36353B2CD2682E5E06B43F848685AE9 carpio)は大きく、強く、そして勇敢な巨人。彼は
593,895,596 *3D00C40C4CD1C7EEE13053B9D0785278C9821408 Carprock
593,895,597 *3D00092A0A094B9BA62B3762C1A64C2DA0766B6E carproject
593,895,598 *3D0EA17C5E15BABECA5ECDD4F8ED6805B85F5F1F carpsi
593,895,599 *3D0F7B28D5D51BC7D0B2DB78925F3FCF4773211E CARPTRACKER
593,895,600 *3D081FAE320B6BD776CFFB7C0C3FC02D8A34C14D carptshark
593,895,601 *3D0290F2A876270C4C9E496DA87A576B69989EF7 carq1d@mail.ur.mx
593,895,602 *3D06DBCFE29AD55424ED2474EA6F2ABFE08C7E1D carqby@uol.com.mx
593,895,603 *3D03A71DCCE5AC821E953A71EC5242F38B2F9426 carqpx
593,895,604 *3D05EB8F41D749E5E0149A2E34BA7E3944DDA4D8 carr09@televisa.com.mx
593,895,605 *3D08C28417C919DC8FEB5724094FE947E17A48D1 ca'''rr'''amba
593,895,606 *3D05868918F0EA5604FFD5C9C823540F20A13D20 carrancudo123
593,895,607 *3D0E3560F0233F9D15E2C6281B6556B041F11978 carraspe8
593,895,608 *3D05E60F450610A79FF5781448C8735D0BD1A506 Carrasque
593,895,609 *3D0922C4387BDD464FE17FD79B7FA20E493C04AB Carreados3
593,895,610 *3D0619DBAC6244C035B7AA8EFAB5244821E7A1C2 CARRELLS!
593,895,611 *3D07B1F7FF51C378159CCD91F97C58732298394F carrels@pchome.com.tw
593,895,612 *3D099822FA1A98C0D3AD060D7573E8138D335F65 carrerathccmc
593,895,613 *3D044B51EE436298B402719FEFEDE3D49DE8724A Carriagewrench
593,895,614 *3D02E2E2AACA7AA19851D206FFAE0E0A83073F2A Carrickillaunnascalp
593,895,615 *3D0AA3168B04E65711401A28601AF0EB42B0F11B [CARRIE
593,895,616 *3D084F0C5B60ACEE96645C8455731101E8E54772 carrie andrews
593,895,617 *3D02FDEF955EC2EBDC0E17C3CD5A4950B063984F carrie anne allen
593,895,618 *3D0124D3CF2107B7F27F250F6B88CACA1B53A97B carrieanne scott
593,895,619 *3D0161712C41E8A38540D2789AE7DA9663608E2B carrieem20
593,895,620 *3D0985EA6B672CF99BB08BBD21A97EC388C0BA10 carriegillispie
593,895,621 *3D0F6C732DE85FC81A3EE36602350F8EA3CADC1D carrierres
593,895,622 *3D038C8E7DBCF41589A89008DACD67F9CF7E4201 carrierrex
593,895,623 *3D099E9A8DB8ACEBC0BC318FB6B9FF5D921EEA7A carriertalkkorean
593,895,624 *3D032D11901F8D163ADB90BCCC1421E324B3B474 carrie.sh.che@ms47.hinet.net
593,895,625 *3D06D6F82560882CAB3913030077FFF091200EFE carrion wraith
593,895,626 *3D0D6768403969856F19E47AE9C11BA18748DCE9 carriscant's
593,895,627 *3D0048836E503DBE8C8C0EF869C15353DCC2C310 carrol.abare
593,895,628 *3D07F2D3B9AFD316331B3BCFD9A316DD97B8E503 carrol.aiyer
593,895,629 *3D0A6D9D09D1AD61A66EF7AB6D8521DFC68B91C3 carrol.besner
593,895,630 *3D0554BD2D11E45FC4D1780829351469248B2140 carrol.brunker
593,895,631 *3D0F1B7CF44B94391D4047E562174F921789CE7F carrol.chester
593,895,632 *3D09D2722F68EEE120CA9958897656A9325B1E49 carrol.chevrette
593,895,633 *3D036B1A7812B93F2C3A7DFEEF96A8A7B4204243 carrol.courteau
593,895,634 *3D0227C6D814C078F1E56C4F578BAB6D1D08F8CC carrol.crone
593,895,635 *3D0F52C820E0BE615F73FDB8188F8F7B84E3C626 carrol.drabek
593,895,636 *3D0CA0C6FA49BFF5E0DA59F87EC8541A5BEB39DB carrol.harrett
593,895,637 *3D0649B27FF951B847822AC6C5E7692E9359A444 carrol.hernon
593,895,638 *3D0956FEA7A91952D1650D81FCAFA30F93A61977 carrol.keams
593,895,639 *3D0586798A21690F98523844C3A7012D8068DD1D carrol.laduke
593,895,640 *3D0B56ADF4F7FD8B7D8B0C337A9B4351AA2CD075 carroll.blumenstein
593,895,641 *3D09C258E6F8F234DC3AE9DC2F0905B05E33C6C2 carroll.bogart
593,895,642 *3D0AD4EB9AC545690D8F306A0B30747C834D0C3F carroll.bralley
593,895,643 *3D0EBD739A57070886B8BDAA4C85DD9CBA81F8E5 carroll.contreras
593,895,644 *3D0542A664482A4CE60D2D4046139EF93A1822D0 carroll.dare
593,895,645 *3D0400F544EF2ADFFB7DD59C8B0D185F6068CB9C carroll.donigan
593,895,646 *3D09614B45AEE5839377171CECE06FA5BD415680 carroll.driskill
593,895,647 *3D0058902830807CEB7367B211A5BE1A67312E19 carrol.lefevre
593,895,648 *3D0C67CE6F89C9E5AAE6937433FD32B9480D4375 carroll.fiedler
593,895,649 *3D0FB100481FECF46C5284362A4F7BEB5715598C carroll.halliburton
593,895,650 *3D04050C0DB0E0B6F263F61CF3F198D75D872BE0 carroll.hollan
593,895,651 *3D04BBB0F3D871DA73F63FF349A2EB6F7D25FED2 carroll.jarva
593,895,652 *3D0101E452B9A710DA31C4E668808ACC69DC4F20 carroll.klingen
593,895,653 *3D0DC99446E627162247DC635A1807D7673D2DAA carroll l johnson
593,895,654 *3D003C018D062150D319B540BA35362B0EFD8F46 carroll.louthen
593,895,655 *3D0794B7D671438699ECA4775AA04E1886641D18 carroll.nethercutt
593,895,656 *3D02A9D00A70B8BFA7622FDA8AD87D8DB223AE46 carroll.peralta
593,895,657 *3D0DAC6C0BD6FAE072974DD6422A0AFAD5005522 carroll.prakash
593,895,658 *3D045312BF22004B605ED597F328BFBDDB0421C1 carroll.quirin
593,895,659 *3D090ABD678A40DDBE77402C4650F94CBF8E5CA3 carroll.roder
593,895,660 *3D06A4D4B747F23BC1E38487290384FFE9046926 Carroll’s
593,895,661 *3D0732965B6CEEFC4D5EDF85E3FB7C009A338182 carroll.schmoyer
593,895,662 *3D0458EE918A96F6ABAD1D4F9626B4A921AB96A1 carroll.siroka
593,895,663 *3D0B42FF3328344910E12A01D3BC5E728C8B3EF7 carroll.sisco
593,895,664 *3D0FF5F51C5AD880FAA1B6F9F4F26F3A98B4E3D9 carroll.smayda
593,895,665 *3D0144B108338B3BFB1D27AED5E5546F3C7BF217 carroll.stock
593,895,666 *3D0B3FFEF57A38E74CAE1B1AAA389B30AA95DD75 carroll.tuesburg
593,895,667 *3D0F221D3B75B7E3D782720709A1EC3A48091040 carroll.turomsha
593,895,668 *3D049FF9181EB39D83C2AE1874EB99C53A47B9F0 carroll.verley
593,895,669 *3D00F2CD852F8D2A136C0F2B4870A3506DDDA442 carroll.walper
593,895,670 *3D0F17461C437DDAD4D7065EC5D05A69D429A52A carroll.weiman
593,895,671 *3D043C0E022715BC2D4F45861930AE4D56326D7C carrol.mccluney
593,895,672 *3D0EB3A1542B5523D981F06D326999E39B0F45D8 carrol.newes
593,895,673 *3D0DC13120CE786A37C109F0187C0E119616D45B carrol.otega
593,895,674 *3D0783C8DAB9AF7DE59538546E74BBB7B49F1188 carrol.tierman
593,895,675 *3D03D50F4140B6FE791D3E279F820781B0B85D0D carrol.tyrance
593,895,676 *3D0987C97D4572422A91E86F2355320890B86CE3 carrol.wun
593,895,677 *3D0032D87BEB135E37BE16209E75B5E85B2B9132 carrol.wurth
593,895,678 *3D0E9D36EFA34C1560D5E270B5FE335D1BA51BA2 CARRON8
593,895,679 *3D03AF17F7ED12872DD3B41D40DCB087E60BEDF5 carrot@sh163.net
593,895,680 *3D03BE59546DA3A1A9878D789E775ADAE971A109 carrousel@yahoo.com
593,895,681 *3D02C3D40DBA1B88EDCE961E6E15CFD057A694ED carrrice
593,895,682 *3D0FBC79ACDA17256E36D57AE18BCD2A70B02CEF Carruggio6
593,895,683 *3D03015DA8298216D1546DDF7C41D346D45B3325 çarşak
593,895,684 *3D03A6ABB956D8A94B9AE9EF058155F07B2EDACA carsick.orgcarsick
593,895,685 *3D0B3C3A24811DE31FA983880902A9AD4FFADE7E carson.anderholm
593,895,686 *3D08129B13E0AC34FD65F84C0C95734CD0F90059 carson.balado
593,895,687 *3D013193E514F92BD93C62DBABCD5395907566E1 carson.bencosme
593,895,688 *3D0782619381054D77E8D2B51835AF2BAAA570AC carson.bitsui
593,895,689 *3D0DFDE6ECFA3D479C85DD52E839FCC39BE372B5 carson.bueno
593,895,690 *3D0463BB0F09EB64A6EEF78826FCAE9B3A4405AF carson.crosby
593,895,691 *3D0DC71DD399E6CBD53BC2A0700A04FB0ADABC9D carson.deman
593,895,692 *3D07C52C2756B0AB60531F0BC1B7033D1CCA9BC0 carson.depuy
593,895,693 *3D0E50C3A161ACA51E7B1E00B4EC08E6C114789F carson.dumond
593,895,694 *3D06E2B1EFF10F273AE5EC3EFDCFE7DAF0AC77F4 carson.finklestein
593,895,695 *3D0DC05592B708B07098CA6BEC9CA2DA1518C6FC carson.guidera
593,895,696 *3D027B78DB51114A5E9A7A2C4E611B027C6A78EF carson.heisse
593,895,697 *3D03BCCB616686152684F82206A0B6945D6739C2 carson.hermandez
593,895,698 *3D0D93EC08F5A29D906F10CF53081CD74656E35C CARSONING
593,895,699 *3D0B4AB4742F1DBC559CCC76E699234BE3B44012 carsonlam@hotmail.com
593,895,700 *3D0E492CDFF9A57380034BA7485A819B92FF207B carson.lash
593,895,701 *3D0A0CC1D03E0D8DCBA36979558A544B7314310A carson.lattner
593,895,702 *3D0FC06EBF871A88496013BEC2841F1A576C3ED8 carson.lobregat
593,895,703 *3D0A51428864733DF2D9A1D8379601C602ED72BE CARSONMCCULLERS
593,895,704 *3D0CDF770360F46D97AE956338A31F4C8D348BAE carson.obrecht
593,895,705 *3D030B699E4BD3F403F252CBB63ABC555988015B carson.penird
593,895,706 *3D00401CBCC63A98EFF36F4756EBB2560053CE19 carson.plantz
593,895,707 *3D0B6635526DEB1092773358ED0F6C1B8D6BFA65 carson.polemeni
593,895,708 *3D07F2DEEB2893A0C9B72AA8A9E227FDE99CAB29 carsonpoon
593,895,709 *3D033867DA8C90B961085F6A9A0E94F4D4C56499 carson.tilly
593,895,710 *3D0865B2BF177992F7E29161FE26602FBF2B00B2 carson.wayts
593,895,711 *3D098EA06BFC21757836C46B3FF66A92516FAA6C carson.wendt
593,895,712 *3D01A48F2FF2C796013D2E3A5380A5074A8DD8F8 carson.westlund
593,895,713 *3D0B32D4D2AF02F05A1573C7E2E5480182C7C560 carstennielsen
593,895,714 *3D07D751848FAA93794DA06765C9ED89BA8EABFA carstenweidling
593,895,715 *3D04D18E6F9E5D727888B727EE2FFCB511FFB3DA carswann@aol.com
593,895,716 *3D027C958FB40EE3DC97D0198F1FCCE51372FF51 Cartas desde el asilo
593,895,717 *3D0540789C188B231E6C89ABEA3ABDD9BBFF1163 cartaya8
593,895,718 *3D04A17F83286E9B918DE5746334D7CB74D12D36 Carte4
593,895,719 *3D04C1F871738293CB0B494575BC1251D6EDCC0C carteles.metropoligl
593,895,720 *3D0B803EEBB5C0CA46676200CD9D4D4F0020607B carter.branson
593,895,721 *3D0848D368C05F40AB84B41C2E1B200D274EBDE2 carter.brownlow
593,895,722 *3D0837277A42E0B6E52F11ECE3F128E4E9E74455 carter.cappiello
593,895,723 *3D0BC7AC446056DA543559B93B2890BFB7D088B7 carter.dokka
593,895,724 *3D0856DFE296ECE0576971637AC3367871E1361C carter.eckes
593,895,725 *3D0A99B00654C55E1B42090A0A68FB9AF8E04DB4 carter.eraso
593,895,726 *3D09C83DF7DEA917A4E5495F567C4CFB3A82384D carter.gedman
593,895,727 *3D037CB6154C16C5503C5B1F79FB29661C4EFC3D carter.hennessee
593,895,728 *3D0EE5CCA7D1764C5BA81FE3F57CD6CEAA790AFC carter ivey
593,895,729 *3D01ADB958E3A6111D032E7DBEC58B6FA944A128 carter.kokaly
593,895,730 *3D0DE03ADC71A582BE2EE8C3BDADF620BCFFAA89 carter kraus
593,895,731 *3D03C8ACDE37FFF44B5FAA084C02963BD56ECC3A carter.nosis
593,895,732 *3D0717450F25DD48CEF9AE8D415EA9858737C26C carter.phariss
593,895,733 *3D057D42E5754D713E1656CBBB20E93ED4BE74EF carter.poitra
593,895,734 *3D0284D46D247C912B65693536319919EC685AB8 carter.pugliares
593,895,735 *3D0BB4D7E9874803A533B607367A466F3AB3ADFD carter.ripley
593,895,736 *3D00F20548DCAA91ADE4BA2174DEB4BD7E89085F carter.stred
593,895,737 *3D0672DF9DE97B4812B7CF5E19BF27671181B491 Carterted
593,895,738 *3D0CB42393F7383605731959638C9EFD2FB72463 cartertől
593,895,739 *3D0AB604ECCAEB545EB9EBDE3AA3771B371A85D8 carter.viveiros
593,895,740 *3D01247CE65DE4547822D543F426F0970529381C Carter)的第二號弦樂四重奏運用相同的四重戲劇性的對話,便是深受艾伍士的影響。
593,895,741 *3D03F224570F087C66F5757E3105CF2C896BE44A Carthenia3
593,895,742 *3D0CE501B928368AD5BC74ED86A4141EEDDA8AA8 «cartillas»
593,895,743 *3D0A1F5728ED202A6A75047E1F61CC2D84DD88F9 cartions?
593,895,744 *3D0405F69976EAFE9C92AC353F4CC6CF7DCEDCAD Cârţişoara
593,895,745 *3D047CFBB897962D3C491544C57C4DBA9E4E07BC CARTLAND1234
593,895,746 *3D0B8AF6A95CDE4723405D556A5DB2AC16D0DE37 cartmaking5
593,895,747 *3D0F6ED435564AC604588E7EB9F60FC9287009F9 cartoonshbet
593,895,748 *3D086D55824C17C2CE0C93680C26AABD7F95F0F4 (cartridge)は必要とされる機能をまとめた交換可能な、または交換が容易な部品。
593,895,749 *3D013EF3FAEDC3644307C74B3EF27C236A843CCA Cartuges
593,895,750 *3D0B03B35C7196B3230FE9605E24A26DB18F5626 Carucks2
593,895,751 *3D0DDE533D5405F42FD12A447A69B6A3EA44821D carusmagnusBSW
593,895,752 *3D07DF566A61BD832CB6B1974A4BC48416AB1934 carutj
593,895,753 *3D08984BB207D115817BB9DF4D12EB9521CDC909 Carvaggia
593,895,754 *3D084A66124A6AD0DFB0CD557AF0CF2A2FCCBDBF Carvalko’s
593,895,755 *3D019F67F9E22A7DFBE2B172E03F3E13A4C5B135 carvcupw
593,895,756 *3D04E352AD4585CC19BA8A7E1A499CB550C4A422 carvelli9
593,895,757 *3D0B68C5518E12A2FD1AFED73AD154972574095B carvg3@uol.com.mx
593,895,758 *3D085FE70C0D527F382A3444D6B1520A5A13EEDF CaRW6
593,895,759 *3D011E67C29A2948783A9B9637C131FBF05A2F6C carwgx
593,895,760 *3D08696BC8EF9974D3DC488EEF848C891746098F Ca_rY
593,895,761 *3D0A1EAE7E3FACE61B5337374A756125F0EBE04D cary5r
593,895,762 *3D03D4D35B6E19CBCE99E64DC8A76973FAC21168 cary6s
593,895,763 *3D07CEEBD7CC161A0F9B919A0820B1976BDDDF3B Carya+!des
593,895,764 *3D01F046613AA761F9C2E2EC3514D0573BC5D838 cary.anania
593,895,765 *3D05CEB58C2B9110DF9D8981B5B33DD66C8B3AB2 cary.artez
593,895,766 *3D0D39CFC2445FF535B43519AFA566B041DEAD3D caryatiding
593,895,767 *3D054D68B59DCDF91CB556531EEF12C1C2CF2949 cary.balckburn
593,895,768 *3D089AFD300C2BF4C2FC7DFC87CE3294C0B1DED7 cary.beshore
593,895,769 *3D03C8B9E73609B98FB285893094E811F81A445C cary.bigwood
593,895,770 *3D00CDD9A5FF367A8CB94A6A3585131CE01112F2 cary.bochek
593,895,771 *3D0CC0BFCBD97D24460579E81C1A4E4F10B828C2 cary.brentari
593,895,772 *3D05846F0152ACE66FC2C8BFF4B525761FEA8724 cary.buckmeon
593,895,773 *3D07E0F430E58AD7A96C230F59074F928B3ECF03 cary.buddy
593,895,774 *3D0837A225BE0622B2F1E7C29FC2472C4DE5A695 cary.buris
593,895,775 *3D0E72599DB111BC71A30243DD9DA57168A7A444 cary.chabot
593,895,776 *3D00A960F3D623DD22730AB22911248F79D9A603 cary.chilcote
593,895,777 *3D04EA0481BB2BA44168B7D56FDBECF476B640E2 cary.detchon
593,895,778 *3D05FDBC6FCC74518FE53CC4D6B7C9357FEEB15A cary.dowlen
593,895,779 *3D0D6CCF0B58F802BA42894375C5798575732EF7 cary.eimer
593,895,780 *3D041667798B47F38BF472159E5A793254F36CE2 cary.figlar
593,895,781 *3D092631089200CF1D5D229FC504D103A09A58F7 cary.hargrow
593,895,782 *3D04F4E6596E2B2AB48E8AD72C538D91B586AC3F cary.havermale
593,895,783 *3D0447684290E74455F99C01A73763F4D554A88D cary.hee
593,895,784 *3D0C10C7BA6AE17E74425BBA5531067000339C4D cary.hewgley
593,895,785 *3D015E8E0020C7C8CED71223F79C9FFAA2D6E598 cary.holdren
593,895,786 *3D063A9FD82592870E439FE658513C5CC5695395 cary.krance
593,895,787 *3D0474B080422DD7BB72F4F869840B3C1BCB6590 cary.longman
593,895,788 *3D00F1853BFCF85F54436033ECD3072ED936961E cary.luczynski
593,895,789 *3D09C03D6B2D21514E5DF3F8CED9BFDDDC90EFFA cary.mcglumphy
593,895,790 *3D0E979AFFF8098EB0D9A1D4933DFE62DE4D11E4 cary.mcphearson
593,895,791 *3D0824270A7A796D025B2C1AF24F02B45CD5A8F8 cary.mirr
593,895,792 *3D0E75EFB044DF700B96379B50A125EC66084F97 cary.naasz
593,895,793 *3D09B6A1E4BA19653D23B8D4CFAB8E2D9932DF62 caryn hodges
593,895,794 *3D0260CAB7EA4A0CA6D2E1334EC0E2B5A17C3028 cary.orlove
593,895,795 *3D0A97AEB44EB44AD4A5E18492BC993B4628AE02 Caryotic7
593,895,796 *3D0B35E1F92C25BC1378200BA66D32E876D0821C cary.racina
593,895,797 *3D08645BBA7AA0D7F130958EBDB522CF4127B031 cary.sweley
593,895,798 *3D060825440B48A2002A9FCE782774579A0ECE5A cary.veno
593,895,799 *3D0926ECC85C69B550E0FC3666EC5ECFE6FC88E7 cary.warsager
593,895,800 *3D0F4C223595B8FF52089FB968FE2D67BD7DA0BC carz6x
593,895,801 *3D003E4A655B138995A5883F744FE1A2AEC52AA5 C.a-s
593,895,802 *3D08692ECC3F87BCD2B7BA475358E18728FA8216 časa«
593,895,803 *3D0ADC489A7157AA472F919D8549CC52A3370A21 casablanca.jacopoben
593,895,804 *3D044B50965F690ACF5CBEC3836187BDF8E03C29 CASALLASAC
593,895,805 *3D0ACF6CD6DC022AC7D7C09E9558182EDE7B29F4 casamancerivier
593,895,806 *3D0A447BAEEAB4B12CFB1FBC7C3907B1FB5B4B48 Casaretto8
593,895,807 *3D0BED68DF4DC3E686FE7AC602730DB90A697B0A casarezratliff
593,895,808 *3D09AFEB8E29B14BA1B0027AD1615DA4FDBC3D9A Cascadeeurope
593,895,809 *3D0B38D424043AED962DCF4101658BAABC137EA5 Cascadet4
593,895,810 *3D030F40F13D2886026519DBD02955E3D96747FC cascadite@sinagirl.com
593,895,811 *3D0027849CD7F479EA8D36688441C91E68FAFEC3 căscarea
593,895,812 *3D0637D54484391619806ECA79C617087B16804E cascaticce
593,895,813 *3D0EF664C17B891D14E25A3E617D783B98AA859D CAsCd
593,895,814 *3D0356F94E05E66490FD2161DAB99A59EE227A7F Caschiel4
593,895,815 *3D08BB7A4E5A9E19A22C8468785DAFD8723A498D CASCIAC
593,895,816 *3D07EF5DA5F01CDE65E4399DDF6AAA50FD054E14 cascol123
593,895,817 *3D067A114AA08E729CBFC70B8B303A3B5FC6AF92 casdacetech1
593,895,818 *3D0047BC7C77E15D332D483A7C51AAD94BC0B5CE CAsE%
593,895,819 *3D03C50A53A4F572D44750114C552EBB237226AC Caseebsw9
593,895,820 *3D0F2D6BDBC12DE8BCE44B84A12C52E235247593 casefiltercontestmax
593,895,821 *3D00C8E4BE844F904C249CC369AFC581ACFC2D66 casen@web.de
593,895,822 *3D06578AA974C0FEB9A2D4E879D402FA2C01E589 Caseourth
593,895,823 *3D02755B41818B624DCFDCE4D08D971593558DE5 case-polotet
593,895,824 *3D0DADC5202AC95461428226DDE093D13EA0FC20 Caserait3
593,895,825 *3D0957889AE42063EF9932657DA68D626270D48C Caseriez0
593,895,826 *3D058876B2CAEB2690E940A036B001A4C35BCE23 casetalkemerado
593,895,827 *3D016539C6F0995F7C497803BFD472889D0737B9 casey283
593,895,828 *3D00E41F5FCAD8DCAB3991068A998E18FE313170 casey.applegate
593,895,829 *3D00CECBBDDF870DCECA3BD2CB4F03EA939114FF casey.bonnes
593,895,830 *3D0C51F86E332DC869C72900EC4EE5785A6B0134 casey.briskey
593,895,831 *3D06B4F15CC19679733E8291B01C01796FDB6099 casey.cretsinger
593,895,832 *3D0254341C09E0BF82296AB70D27DDF324110B6A casey crimmins
593,895,833 *3D0A657A1E32D2E3171F1033093CC112E429EABF casey.despino
593,895,834 *3D0944B2DDB8DC5621E01D3F291FA63AE299502F casey.dux
593,895,835 *3D05BEACEB40F882CEB8E7002A82894A2E015B0F casey.eshleman
593,895,836 *3D0EA05886181AB9E3D884B3E30F7492EC819E94 casey.fosso
593,895,837 *3D008E8B7CEB0E58BCD0E39E00F5624EE1D46CEE casey.furton
593,895,838 *3D078EF6CB66D0C11ECC607CE8208E57DC3030D8 casey.goldstock
593,895,839 *3D004E7314E79FA8EDC06F740C34E64EEB29BE1B casey.gottron
593,895,840 *3D00E92054FD0DA4B68C665EA341142E775E5972 casey.grammatica
593,895,841 *3D078E31D54176E0124DB27AC91E9A104202C582 casey.grinnell
593,895,842 *3D03FB15FF969DB8928F85A7AC09F41F9C67270C casey.hoeke
593,895,843 *3D059DA0999F6861F622638127DAD252C371CD1C casey.holmes
593,895,844 *3D08F86D4FBD48B2BDB1AA3505C396AC5022EF1B caseyhussey
593,895,845 *3D06F6BED6BECECF5243A2564A78C06E8ECE5647 CASEYLAURA
593,895,846 *3D0BF9369B1C6D2E061EB76AED1C8CC772023223 casey.lorden
593,895,847 *3D0CE219F6708E96D8FE52C44D61739B003B8267 casey.louil
593,895,848 *3D0110E8541352D9C54CC15E805A22ABEA98A4F7 casey.manor
593,895,849 *3D075EAD8359DF3D025169DE0936C4F5DD5984D0 casey mciver
593,895,850 *3D00D4510D918BCF558EABC72528E41B56DE3671 casey.naifeh
593,895,851 *3D0437D7B2FD64E1FF91502D423869D70F6EB34F Caseynone3
593,895,852 *3D0F0AF331C8EAABF449A621A780B8764DE574EB casey.ostergard
593,895,853 *3D063EC8B5DE5A017A94C10199B03420DE506DEC casey.osterlund
593,895,854 *3D04DB9583A828DB99BF7D0944A7EA043B541F6A casey.pilarski
593,895,855 *3D07644FA05A75AFB930E284E50D6B23BC2B4B79 casey.pinena
593,895,856 *3D0D9C9E54A21D79B8C321531A545987765A8D4F casey.raynoso
593,895,857 *3D0AE52C9E30191A50F72DE60F0A10E9FF3501EA casey.reutzel
593,895,858 *3D041FF0DDD22CA0B94F71702E14B9EB06D450A0 casey.sobie
593,895,859 *3D0F60895102F533F473F130577D2FA2207286D6 casey.spagnoli
593,895,860 *3D0F5C697A2CB1F65549F0EB94B38B5EDB91D22E Caseysu8
593,895,861 *3D049324D28BA65E8CB0A1877D57F9D1E928ADC5 caseytim@xsite.net
593,895,862 *3D059A7C83A4C351B736778F27138497A24887FC casey.verduzco
593,895,863 *3D0139C8A707A350E6FBDD6D1880CA5BB2A3A6AE casey.wage
593,895,864 *3D0B581B7EC04477E26E17B58BAFDAEEFA8BAEFA CaSfo
593,895,865 *3D03C974CAFDB9111F2158B452A4B78F3E2BE54A C(ASg
593,895,866 *3D0590A8A49C1F4680C6E2336FCBDE4F3FA75FEE casgb@yeah.net
593,895,867 *3D03054B9AE2E5D85C05FC9B3FE76BAEBB21880E cashcat@hotmail.com
593,895,868 *3D04A97DCC5400A08599B76811CDC8C867FF614A cashcrop123
593,895,869 *3D058EBE36BFF70B3C8D88FE1813B5FA9C457CFD CasHW
593,895,870 *3D0F1DF95F44F330D863A5C2EBA7DDDC0A2814B8 casildas5
593,895,871 *3D074DE38C9D4385BAC201573454DB0345C09609 casiliya@sinagirl.com
593,895,872 *3D0B4974180755B32B6EB410978C1BD3CEF129B7 casimir321
593,895,873 *3D0BF1BD2602B14280193D9497B5346416F62B1B Casiobeering
593,895,874 *3D0ABE89910736E791541B49298112101E1DBBC3 casioherbert
593,895,875 *3D095616FC8605B70A3856BAD4A452A852DB51EC casiojkm9
593,895,876 *3D02571D0229B3A4CEC48E2DFBB8ED4C388A08F5 Casiorock0
593,895,877 *3D000E79AE2B8A644CA794C20DE2DABF55BF2133 casket.2223
593,895,878 *3D0867B86BD67DA2C96065A758616BECFCC41BCE casket casey
593,895,879 *3D0078F117A1ACA41833972A636485CD665580FA CASKETS?
593,895,880 *3D0D5D39E3CA7CA7EE8367CCBBE9CD594C3F1CF0 Caskets of Carnage
593,895,881 *3D0521B31ED4E48CC01A2C69BA36BBFF07C84BC0 Caskou
593,895,882 *3D0877C9F173F7A4F0F3797C3D456C1C6D436E04 caskycasky1234567
593,895,883 *3D0F4B5F45B561ADB3ACEA05A998902D9FBFA8E2 casmacins
593,895,884 *3D0ABBBC8A4EAD9114688F2A7855C5E3607A7A33 casmeyning
593,895,885 *3D0932E18AC38734D26294CADD3954FE57E4DBF6 casmreps
593,895,886 *3D03BE7A562F031B6AB82645501B0B861737A392 caso de
593,895,887 *3D0BB070BAF79C6A2A91FC5DC2D5E3F33747C5E3 Casper1934
593,895,888 *3D0F26E6FB786F69BFEAEE8E0711B9446EE6CB5B CASPER57
593,895,889 *3D0C1C9A8E9BA77467474909247C2FFE23DC8207 casper92000
593,895,890 *3D0A940DB693D52834FD2B3D1BDE142980AA72F7 casperair
593,895,891 *3D04ECDC9C5074BBCFA4C3D877CDBF013FE79798 casperkhalifa
593,895,892 *3D08E5CF7248A0C0E61162968546AC6F2CD77142 CASPERSON1309310
593,895,893 *3D066BEE491748565911F76105BF2AA91FC019EE CA,SQ
593,895,894 *3D0D63622625E7E6611D5CE45D2E94F283FA6180 CASQUIACOPADA
593,895,895 *3D014EA304F38FE10D494562ABC3A9B8EF56DDF9 CASqV
593,895,896 *3D01212A0C4BD30D2315E57B2503425DD860C084 C:aSR
593,895,897 *3D03D761D0F66B82B5E0DAD837C7E9E2725A4A8E Cassaba0
593,895,898 *3D0E11EFC4D57BBA8A65883CFB852CF5EA6ABC6E cassandra delorme
593,895,899 *3D0BACFFAFF010C15F273E0ADB4DCFF1549403E7 Cassatios
593,895,900 *3D08FE0E6F78E42F8B816443D3DE71E2195AE431 cassegra5
593,895,901 *3D0DAC47399773BA542790C7C5FF90BA507A75FE Casselty.
593,895,902 *3D060FACE4735276BE365737FA4634EB3B726A7D Cassens12
593,895,903 *3D0AA173E510CC33790D92317629B6555383C8DE casserley-locogrouping
593,895,904 *3D02D385CDC1A9A3E5C80137FE8CD8FC156774E5 Cassicansing
593,895,905 *3D0F605A7FB7475922F9C956DABF52E1D27D0999 Cassidy321
593,895,906 *3D04594335D9DCDC3408827FE79D260C4572FD1A cassidycraig
593,895,907 *3D0A04CA7431E92D1A3082EA76FED5A7FF75F726 cassidy griffin
593,895,908 *3D0388F22C4D180921B581418AEF9D3A6A2F8E2B CASSIDY-MIKE
593,895,909 *3D0FD7BB6298D5C6C244A06F789148FBDF2C9445 &cassie&
593,895,910 *3D021E517FF26E4DCB7F6A33961C6AFA61225CCF cassie025
593,895,911 *3D01289B78D90B9C46615D774F2005BAF771AECA cassie035
593,895,912 *3D066EF802F0C0AB7FF283FBF3F37694EDE4BBD3 CASSIE1907
593,895,913 *3D09EB6C8A0A0FF12179174128F8B01D18A16017 cassiebosse
593,895,914 *3D074AD97E82168F83E40070D627AA094749D50C cassie labounty
593,895,915 *3D0938B3551B4131ECC5E69F4E9D950C2F5BE648 cassiesandifer
593,895,916 *3D0F6033FCFF9AAF91F825A4A2F4162EDF1F4BDC cassiestirling
593,895,917 *3D008D5E0D6407C3B0A5AAFF940FA2C3E3916F04 cassihoward
593,895,918 *3D0A696C62D60A487FDBEEFBFE73E98B9F3DAE6D Cassino5
593,895,919 *3D0A66B95F0D4940F95BA050360F92B5BF18E2A9 cassmiller
593,895,920 *3D0B181060EFE5E6B2C49BD5C658C14741C5C57A CASSUMUNAR6
593,895,921 *3D0DDFED253021A7F57FE3FFEC3E8A1A2002D2BF CASSY32
593,895,922 *3D05A32422B4A676FF7500C58CA19125B327CB88 C=aSt
593,895,923 *3D01B13D44275D6C2E80646A50221497824D2C09 cast@curio-city.com
593,895,924 *3D0D947AB867A9E3DC89345997145B6C2B87002D Castdown Earthbound
593,895,925 *3D0EB25F6D6061D61A11D08D32F0CD251B2C9C06 častějí
593,895,926 *3D031055510849B29D93A7DFDD47D62FCC32CC12 Castellazzese
593,895,927 *3D0BC2D66C14CF551AA4544D03E3581C989F8C52 Castellottin
593,895,928 *3D0AEF262E7773643DD8192ACE2679EBB2991C9F Castevet0
593,895,929 *3D0C2B8C1BED6729D5AA58FBC9318A7CD6DB0A50 castigate@5415.com
593,895,930 *3D04AD29A8CF6C9BCC51784DDC69865D7D98FC1E CASTIGATOR3
593,895,931 *3D03B7E8071340837BD3CD35E8CEDF74DA345A76 CASTIGATORYA
593,895,932 *3D0C8506FBAC55D658CC69EAE05276E99991044C CASTILLON-LA-BATAILLE
593,895,933 *3D04BE4174E7690BD76857647FD739C8759E2C67 cas­tillos
593,895,934 *3D0CA42E4F4425899C45F3DFECA6A39B69EABE2D casting-a-historic-ballot
593,895,935 *3D070272F8C93315ED17D9B9A53DDC494A7E9A77 castle)は、
593,895,936 *3D082573F08E261B5D86CD18C30BA48AD2A220EC Castle1975
593,895,937 *3D07ABCA312B9392508D59443F6C2309B3FA9BE9 castle-amp
593,895,938 *3D05726D108415A2E9222EC7D92AF2DB007A0E6F castlehousewares
593,895,939 *3D0AEE9AAA771C9C65194742D9EF9E25E631CD0B Castlemax8
593,895,940 *3D014CA8B3C4D9C3B6AC4448D663E229ABF1030F CASTLESNAPPLE
593,895,941 *3D0898B4849B2BD3D8B9BF1ABDE298965F4A9A54 castle-waiting-vol-linda-medley
593,895,942 *3D003254D7EF0F2C4E9240079CD4F078FBBB30A2 castorraiders98
593,895,943 *3D0D6A8A1AC07F4C31845BAF81AFEF0C8612F818 Castrocalb
593,895,944 *3D06B0B3163CF4FB397C37DAFB5EF0C85186E9E2 castrol@sol.racsa.co.cr
593,895,945 *3D0284BAE855F83F98A8718E24CB08A2D9323B57 CASTRUM'S
593,895,946 *3D0CE44E88354BD1CA8C4031659D207458F3A20C CASUALLY-MADE
593,895,947 *3D0E9B707FB9102F537BA5720422EBF5DAA41FFE casusque2
593,895,948 *3D0C143AC95B0039E57F660944E26CBE88A02200 CaSv-
593,895,949 *3D08192F30B2304873701983F26D4ED1B298F245 CasW#
593,895,950 *3D0103ACDF67A9FB89B0BCC7FB54515DE74B94A1 CaSys
593,895,951 *3D0AD35CCDBFEFDDB872772E47C4808EAB25795A CAsZ.
593,895,952 *3D06858AF45DE623B33E2A6E2A69F75411292C2E CA$T/
593,895,953 *3D026943633A6DCD3DF15682B7039274CE818112 CaT!
593,895,954 *3D069C32DA94D0D8B6B40BBBCA47A87E1687430C CATABOLICA
593,895,955 *3D0E5E4FAB8199E07C84A4C045E7458C378E4352 cataboss)(*
593,895,956 *3D0A070F4063B2828A82620F7E51627B46C82C45 catactotoechus
593,895,957 *3D0ECCE50F72149916B2FF1068D9428C697544FE Catagda
593,895,958 *3D0C3015A51CB466C7717B684A254AE5E028C414 catagutacena1
593,895,959 *3D04CAAE4FC224A25515DCD51B09564199E8D0FE catakinomeric6
593,895,960 *3D0B86E6EEFA9CA589966D1A52A545BC88964849 cATaLina
593,895,961 *3D046230BB7FBC87031AB26121BF80EE61F6E353 catalina,1122
593,895,962 *3D05866CEFF8E631017B137E8A67C791C50DD042 catalinaely
593,895,963 *3D0C89263A00831B865E4BCABE9533F5B4246FE2 cataliseur
593,895,964 *3D05B54742BD1ACCAB25C6ADFA1CBD50D736F76B CATALOGCARL
593,895,965 *3D0DA5C9C78CF0B1AA4F461D1FD0FCB5AD811BA2 CATALOGSHEENA
593,895,966 *3D081F481252FA5D7B7480325923E3EFB1F29A15 catalogueofsansk01brituoft
593,895,967 *3D0F9184603EEF8B487435103137B96B66218925 CATALUFAS
593,895,968 *3D03982FB51F5682CAD96956E566C20FBA4AFB3E catalunya09
593,895,969 *3D050CEDB1A89DBF714B5A540EB24E2CE68F873F CatamarcaTotal
593,895,970 *3D08A2A249CF5BDB253F5A16C64DCC0D3E35A23C catamarqueсo
593,895,971 *3D086780AB6509A6D0567E469FDC467F9CC2FE65 Catanjas
593,895,972 *3D006E49383046ED176DDA5AA6515A98493EDBC9 catanoso6
593,895,973 *3D013E1A7A934A252B13FFCD7EAC15E55A0D133F catanzarO
593,895,974 *3D02A49C10823B46E2175A9D2544B966343E693D Catapult
593,895,975 *3D068DA144B670E724539C7A6BCA1D04D32DF39F catarijnesingel
593,895,976 *3D014B35CEE40CB342B2AB964E7AFA75D4855D71 catarrhs6
593,895,977 *3D0321F2715D807C4A2CFA2EFFBD6426A3E3BC43 Catastasing
593,895,978 *3D0654E0D1D56D9E76A5037047815234155A1C40 catastrficas
593,895,979 *3D0D5D9315B2A0A8145795EAC1FC6CA18CF753AB CATAVENTO
593,895,980 *3D043B5A8A2115BC9BF1D52C570CF372D2A999BC catbamiyan
593,895,981 *3D0A991DE13EB89C5E06DB39756EF21DD61C8D9D Catch a Break
593,895,982 *3D0EE2BAB124514B206A2027E2CD601DE5E7DF5F catchai6
593,895,983 *3D0834A3B940C4B661677F3A83733F704CF5E8F8 catch-all-deletion
593,895,984 *3D0F71157168D535B2DD15353731AE7FEBEFCD58 catch (boon)
593,895,985 *3D0E9C07EF1EE42779867B64B57C94CBCFF59CD5 Catch'emYoung
593,895,986 *3D04E7E63C0FC304AD02E3906B6BFDB744C36BB6 CATCHING-THE-COLOSSAL-SQUID
593,895,987 *3D0A517F74E6704D8172ECE747C468B402DCFD29 CATCHLEY
593,895,988 *3D0B624E82E37E80BC6A7607E5B2B518F0FC451C Catchpoleships
593,895,989 *3D0F19E44485D17F774FFBB55EF4C9DC99489795 catchupadvisoryboard
593,895,990 *3D030678060B59531775EB4BDCABC9423A0D9FFF CA!tD
593,895,991 *3D06735171707363E84EC6D72A1755E24520E310 CAt"d
593,895,992 *3D0C8FC2EA39AC28BC6C3680B95284A1FA705D87 catdallas-fort
593,895,993 *3D02AB8DA11980D09B182601146CD897DDE440E4 CATDX
593,895,994 *3D03BBAE232EE8D4967ADC75C080085B39611268 Catechis3
593,895,995 *3D0AFEDD830AF162003AACD3A591A197B236109F Catechisation.
593,895,996 *3D009FDB51B2E9687B78015176AAE9E2C1396D39 catechut1
593,895,997 *3D0F8D2EE76BE4121000EFFBBBC3CEE340B710DC Catecismo,CremeDentalEEu
593,895,998 *3D03EB9F8AB66A7E32A8F8B134F7D31EF9C4E429 CATEDRALDENOTREDAME
593,895,999 *3D077C385A8A11A7727BD85B3DA5449D11C1A702 catedratizasse123
593,896,000 *3D0D56489A52B78AC91227B02F8E7549AEBBFBDE categorieArt2
593,896,001 *3D088F000B2BEE0C1C556223A245D14954C6E164 categories32990s
593,896,002 *3D09D7DB803F79BC54AF3FCF66CDCCE03068ACC1 categories32almanac
593,896,003 *3D0AC80D11851AFB9C301248C8CA30CB454AFA10 categories32bathydra
593,896,004 *3D0FA6967031C85AE1BBB3706C0BE6979737C26C categories32cayugahi
593,896,005 *3D0F4F273D8957381E32D7E7C9B23EEE3E96A1CD categories32copernic
593,896,006 *3D054F9BF60B02D3D549CF9AA049B7CAC01CAEED categories32et
593,896,007 *3D03C9366225D761E487D406924FB97509CEDECD categories32ilam
593,896,008 *3D0CBA7D1B53A7DCAB27E6E0BDBB15DE4C1661BB categories32singers
593,896,009 *3D03225539178425C3EF06F49DD7E78EF6BDE533 categories32tcl
593,896,010 *3D0C39D02142476E4850CB5ED6565F48EE52F0A7 Catégorie 
593,896,011 *3D0BAA81F695D98DE72AFD26C4A74B4AF5D0BA88 categorischt3
593,896,012 *3D0FE9109A1577A56A98C84D3969ED41991B5D53 Categorisee4
593,896,013 *3D0F8C3DA9CB18886996AF66D34B14A48B3D82CF category2-2-4
593,896,014 *3D0FECBF622A0500F1AAF74010DE36399898CE82 categoryaken
593,896,015 *3D096EE2CA61CB6CCC52189D84B4D9A0D0DAA6D7 categoryasian_rivers
593,896,016 *3D01F378B939450C5AF1214B697C5FD517EEA32A categorybathing
593,896,017 *3D0F937E9DADE2AE0911022B03D8004E8E9FEB7C categorybielorusian
593,896,018 *3D08259E693E500148D6A4BDBB2F1AA57E9048DA categorybuteoninae
593,896,019 *3D0B024925E7149D17F9B164A081C52631131F4E categorycadillacs
593,896,020 *3D01F49AA593AECC8F65BA74DA295060319ED3CB categorycarmel
593,896,021 *3D0CD5BDEEE9EF808F4016A0E9B05E5A922C3A23 categorychakri_dynas
593,896,022 *3D0CA163CA3C1B3B57FAD1073924F09B14CA75AF categorychr
593,896,023 *3D08F37D6816A8D2FF2BDBA329348518ECD9264E categorydeep_forest_
593,896,024 *3D0DBCCB387645E338A1B88C1D440507F18D17FC categoryearthstar
593,896,025 *3D0F9BB59665EAF4A98D062C4F3AE840EF78855F categoryfauna_of_man
593,896,026 *3D079EE09ECD95C9815AFE958972CF4B3B67AFFA categoryfreak
593,896,027 *3D07D2B23C9DE5D900E3096FCE2CAE96FB5334D9 categorygadfly
593,896,028 *3D0F35F90DFF992E88B8327591F2362498B66F53 categorygeographic_p
593,896,029 *3D0568E9917B0589F079DBB08640B1FB2AC7D6C0 categoryhradec
593,896,030 *3D04229F532E25325F35789669E9F0DD33E587EA categorymaar
593,896,031 *3D0A5179CD25A172606CA62EDC660800723511B2 categorymel
593,896,032 *3D0DD65B5C46571F53A9B13F3802141298F69EC8 categoryneauphle-le-
593,896,033 *3D053E2650A30E63490D7E87860EFD5490D07565 category.nick
593,896,034 *3D0B21CABA2B7CA3E03A8FC1C4D273F663CCED70 categoryoubritenga
593,896,035 *3D07E9F23A416B87047FB9BC479EB158115EA53D categoryplesiadapifo
593,896,036 *3D05CCBF403799B79A9E496385E2E567119B8DB4 categoryreggaeton_mu
593,896,037 *3D0E24A16BF660DFD33EF92BE81B8110429E0AAE categoryregional_sin
593,896,038 *3D0541A0EC148BB042F5509B5AA4FDDF2720A4D3 categoryrhopalostyli
593,896,039 *3D067946EF30C76B3DE8C1CB7BB5F45BC36D7CD5 categorysmartism
593,896,040 *3D0380BBBB0B7A13310EAEDE18E50AE90D6D2030 categorysquamish-lil
593,896,041 *3D01E178D5F8645D1FD70CA91F56ACD038390C3D categorywaukegan
593,896,042 *3D0DA6646545658297DCE44535025CB1A039CD4D cater.bbs@bbs.im.cyut.edu.tw
593,896,043 *3D093B449326F4426BAAD735499D56B1350177D9 "catfish"
593,896,044 *3D0F974E81565EEDEF24FA487B8939B686015833 CATFISH2009
593,896,045 *3D074042671F40AD7C8454A41DC6E46B21A65A3F CATFISHBORIS
593,896,046 *3D01019023CFFECA4584A617522597882C995F1F catgirls.org.uk
593,896,047 *3D0671F14A192C5EC480346D736CA4FB4E75FE9D CATHANCE
593,896,048 *3D026093AF13519D51971E8FCC4327F45C150C08 catharine´s
593,896,049 *3D08765CD5329A2C7BF4D2CB381A0814FC6CDF62 CATHARPIN3
593,896,050 *3D092D7D4ABCE50AF2045D587043DC72B6B0A02D cathcartkruger
593,896,051 *3D06FCDCB446D6F57B2C48D6B75DA0CA881ED432 cathected7
593,896,052 *3D048F80F4569F1F8698F04CD88322FA16CDCB2D caThErIne
593,896,053 *3D0119516B9EC8F5EF3F15D019626D1785E24ADD catherine334
593,896,054 *3D04F5BA6E507844D2C0625C49F234C1DAD11EA4 catherine706
593,896,055 *3D0706FCB8DA0EFECF50F9965E8F564F1528F074 catherinebeers
593,896,056 *3D0C41EA545199ECDE3E9E469BFEFCD05FCB721B catherine_caldwell@yahoo.com
593,896,057 *3D0C1A1508B0DF79706AEB11C48B71EB5CFD7E6C catherinec@fdmgroup.com,
593,896,058 *3D0F5A04AFD0AD376AF65CE1972790EDF49C6CC7 catherinecrabill
593,896,059 *3D004A38F78B229ABD34245D85EF59B09536D2CF catherine kroon
593,896,060 *3D07B749F4AABF7D147CB95A4FE68BEBD086046E catherine kwong
593,896,061 *3D02D8264524E353583964CD7D9700EB52D57215 catherinelenox
593,896,062 *3D0B2E56128610C76EC47E32C852E257F8680AF1 catherinenyawira
593,896,063 *3D01C625A7BF5B5728941F10210A4AA34C7EA70F catherine pastrana
593,896,064 *3D002AA01021E0E259E5713BBBA81F45F05975F6 catherine stone
593,896,065 *3D01E9C572FB9AED1CE1811626CB3D8B39DF1A94 catherinetrautmann
593,896,066 *3D0D00B6EE1BBF041785166F8B28F2463AC52953 catherinewynne
593,896,067 *3D0E5CB35D4A89EBC516BBF99CCB2FFA8FF2DABB Catheterisatie3
593,896,068 *3D0ECF3F0490BAE5024B3A3F7C7D01E1028F6B93 cAthIE
593,896,069 *3D02CF0A29878AB50B547C1B4529A40F0ADB6F93 cathie cain
593,896,070 *3D02D84F40EF934A580BCE5455A5C47C409D4807 cathlady
593,896,071 *3D0CDEE388540CACF3B9AB1B88FD829C5A3CB550 CathPlazaChih1
593,896,072 *3D005B9B11F904D255BA38963ECECB4C3D6C4A4E CAthRin
593,896,073 *3D0D7F2B64C55C2C83C78B0FBD48AD63C0DA71AC cath.s
593,896,074 *3D0C0626736AE0784664FFFBDD5910546D6F608D cathy alter
593,896,075 *3D0C174253E61C0B22482089BDEBEBFF7160C5DB cathy chilcott
593,896,076 *3D0DFDD64058AC6909C17B82084301B4C7C3A2B9 cathychittenden
593,896,077 *3D0C7F1D066C455452B8648C69011B1CA919B762 cathy dam
593,896,078 *3D0CFF74568E396E2ED78477C612B5482E110CD6 cathy grubbs
593,896,079 *3D00B40CB4626A838F2C01AC54E6AA2633270992 cathyhillton
593,896,080 *3D0AE2F4A7146958EBE5B974425EFA4C16E0CB5C cathy radke
593,896,081 *3D0378DC6B405F260C6678D3E95746D0B0986BCA caticfj@china139.com
593,896,082 *3D065673089E1EDE72FF6783837B7AF34BDC3653 catic@xinhuanet.com
593,896,083 *3D0B5D590E8CF6D726543D0DA0566B8C9D7E4428 catid18
593,896,084 *3D02DB764E663185C546B607B8146F68A0794B1D CAT-ISN'T-DEAD
593,896,085 *3D0E9173495C3707F964A20C0142A2B8CDD936FB catjotbu
593,896,086 *3D0A6A249D674E8DA389A0B9D764EFE6B967C840 Catkidses
593,896,087 *3D0E75B5BF08068FE0F77BBC98B0B30A9124BDFA Catlainas8
593,896,088 *3D01C1E8ED0B2F6AFB39B50345AFFE824E8EA980 CatlN
593,896,089 *3D0B2B5A71F7646E235953DC48804B5F945B8980 catnach3
593,896,090 *3D0E4D71E272673B45FB702C37B1082A64393B5F CATNFLSUN
593,896,091 *3D04BFB995ECB6CD3D196013EE0623AEB269FE76 Catnip08
593,896,092 *3D04EF73122A55954528D0350D74892F2B53CB87 cat_n_mouse@yahoo.com
593,896,093 *3D03D3A7749185A5463C2F1392DDED29390C9752 CATOBLEPTA6
593,896,094 *3D0766F8EE7D56A602B447762DCA30A9AA5BEDEE (Catoire
593,896,095 *3D06D38712BA2E9AAE03C2538957527F22A7DFFC Căţoiu
593,896,096 *3D03ED0BDFB87A6CF10F4F9BE551E79D0369F625 CAtoL
593,896,097 *3D0029893A2087814BFEB0B063EC0ED55141229C catolfi7
593,896,098 *3D04DE83DC5A333F1D730A46D75A043874BE0538 catopias@aol.com
593,896,099 *3D0CD8F368A477532D41DDE930BB441D39B80071 Catqa
593,896,100 *3D0D44DF8A50927A12A32BCB2CFB2D1074E68439 catR
593,896,101 *3D06E881EA2042D1CBD74DFC795A69DD38B1D1D6 CATRINE19
593,896,102 *3D01FF5C6A4C475FCD9A00C63893D9AE6647A5C5 catrisha6
593,896,103 *3D0E7F4330424B2DA5172D8DA7322569CC98DFC3 CatrP
593,896,104 *3D030AC61FE855D9124D2BC9B17998795B02FAF4 çátru
593,896,105 *3D0F8E5C47BE49A9F8E0975CE73CA433E0531B1F Catsbear6
593,896,106 *3D046DB0481279EC3D3E3E66BD922950D31A7152 Catsgarnet
593,896,107 *3D0B85456EE80126A6439C40EFCCF75123C72ED8 CATSIZE9494
593,896,108 *3D074826548FAE4CC6988AEF6344F198FA787B90 cats@lycos.co.uk
593,896,109 *3D02119BF2F44B63E8E15B87266691FF49A4BC78 Catssassy0
593,896,110 *3D026B9DEF73DFDFBC600BECD20C18B494989350 CATSSOCCER1
593,896,111 *3D084B6A01DC90E9791E1957ED6F2A92CEE55C59 Cattolia
593,896,112 *3D05A2618FEB99143F3FA57A63CA843575DB4073 cattrillville
593,896,113 *3D098B088BAB086EB42D182544A4CB50A61EACB0 Catturassi7
593,896,114 *3D0E88BFB882BEE3B9288BCFBB7C39C3E3F301C9 caturdhā
593,896,115 *3D00D586372FC5C209C614993FD65898F340BE53 Ćatursana
593,896,116 *3D0A9CA414F439ECBB44CA2607F02BFB5B0FD38A CATWITTED
593,896,117 *3D0C8EF8EAD9097CF516E1AEB9F4A0ECC8E389EF catxxxsteaua1234
593,896,118 *3D0D48DD5CF551E57ABDEE183D813531445B6084 CATZERIE1
593,896,119 *3D0BC2B9F6E701412D693E027E263AB9A8F71FCB C,A?u
593,896,120 *3D0A573B2348CF4C99AA7FDD2FC71B4C3C11EEA3 Cau710u5ne55
593,896,121 *3D0F8BD5F8FD31E3BB1AA2C6BD4EEC81309C05E9 Caucher2
593,896,122 *3D0A8D91F256705DC5518A8A4B522768D25D2E46 cauchot7
593,896,123 *3D037477709A684B290CE5ECFE8B7CC104B6137E caucionarteias
593,896,124 *3D08F30E0F463570FDF6677CC59C6E48B01C6025 Ca:uD
593,896,125 *3D0B783D5362457FE301E15E9F5E62B75BEB18E1 caud0f3m0
593,896,126 *3D0C30BD6E47A458FD3AAC39999DF6E4131BBEA4 Caudal5
593,896,127 *3D02DFFFD9BC041995E9F488C141FCE59972AFF5 caudo7ibia1
593,896,128 *3D0948080FC066E83481FDB4C1208696AF1445E9 Cauesson8
593,896,129 *3D0A5D7008E3A334EC995FED2A9D63E48BEF7B4B cauffii
593,896,130 *3D002614D480FD6CC3A2772E7C09B47D7E84C049 caughtinajar
593,896,131 *3D029A9B8EE3E28868476809E77D1F86238769F7 Caught Smiling (feat. Mr. Mace)
593,896,132 *3D0A37E865E230B1CD01905A8F541C962B03CA13 CaUKd
593,896,133 *3D0D8BC1402B7874EF3E26189818B5B4C9288188 CAUKINS
593,896,134 *3D008B12D4B8B6F0DA97583D718509D50B26A95B CAuL;
593,896,135 *3D07F92B5B71A85BAD7811D572622C50E83E9A93 cauldness
593,896,136 *3D06DD7643AFDD065626AEE596B59BC00BF2FA36 Cauldrons0
593,896,137 *3D06E6F35F7D78B63F3E89C72B82746784E57ADA CAULDRONSES
593,896,138 *3D0D4BB42EB37E69AA9D98216DB102637916086B caulrh
593,896,139 *3D01CA55047C015D77DE4086CCDADDBA24EA9B58 CAumY
593,896,140 *3D0B9782516986A3B174C4B8CBEE38704BEA4653 cauovib6
593,896,141 *3D07A1177C262AC1EAC11F9F902DCFECDEF54D4C Causassimo9
593,896,142 *3D0AFD75C441C2B988FB551ABD2BDF3AC9178E5D causati9
593,896,143 *3D0CA1C6BD896B319F9F3A7E4BA956E1F2192C5E Causear9
593,896,144 *3D048E365F63CFAB0BC846875AB0A789594C62D9 causefull
593,896,145 *3D09AEC98A7B7B314E42181C5F5E3443FB6BFD68 CAUSEWAIED
593,896,146 *3D0F054E03DA8B53EDA7AA966C2C6DFA8DC7701E Causeyouareyoung
593,896,147 *3D040B89047FDA46824E1DCC8F9545B30D32973A Causied
593,896,148 *3D07003AF9777E9C53701D0322D4D9FCEF4515B0 CAUSTIQUE.
593,896,149 *3D00CA9BC16DC0835530CF7CDF8CE7927977D764 caustiques7
593,896,150 *3D05118558CEE7712A5BB38AA3C6485A9E9F602F CAUT10USNESS
593,896,151 *3D07377415B807029FD70AFF6F0C25115C737114 Cauteler0
593,896,152 *3D0091264C428CE4D335E2D26A6103B9688BBB30 CAUTERISERIEZ?
593,896,153 *3D008A8B74225F94E83CA92D2EA2B587C973C115 cautionnee0
593,896,154 *3D01F20191EEEA96231F85CE2A203C136766C18F CaU_u
593,896,155 *3D04ECFD4B9EC3E50EF72D6BBB2EA9FD1C2CA491 CauWa
593,896,156 *3D0B2AB313F0BCA5C6A74001BE7E8475371E1D14 C
593,896,157 *3D0F02F4A4409D97E8760454050B1278B98D03D9 CAv)%
593,896,158 *3D0909BB1B7524F828E87739AA67C9EBCE817183 C!a&V
593,896,159 *3D0112E6D3399185F79967E72B9D4E155189A31C cav01954
593,896,160 *3D035BECBED0964D8554D3A8D75C39A6A898A6F1 cavalesansissue
593,896,161 *3D072074BA25FC6E3FFE9C41EFB1D111C9CEFBC1 cavalgmos1
593,896,162 *3D0BD02F3A97F227668E2DAD2A0809C79B9CEBE0 CavalierKingCharlesSpaniel672
593,896,163 *3D0F5F66C8E2E8B874F6131BCA13202829EE11B9 Cavallista
593,896,164 *3D035D0D808D913549804373A5501BB829527312 Cavanish
593,896,165 *3D0A3DB3E431A50D2A3A9D699E9932E9FF82E57C cavarra2
593,896,166 *3D070A32C1D76FC53B4241471A2BE8E8D989B3E7 cavarzserani
593,896,167 *3D0BCCD7CE43C99FE7A3A043F8995125AB8DF5B6 C;AVb
593,896,168 *3D0CFB2830ABB976B10FC5DDFF57303538368475 CAv"D
593,896,169 *3D08A327B5F9E538FED8FC37F760AF76EBA36591 Ca#vd
593,896,170 *3D0DA8943915B3B5FE489B974EF858B455A83EC0 cavendish-blazing
593,896,171 *3D02D61F32A086B2A6381BCE44F4F9525A43CB79 CAVENOGH
593,896,172 *3D0AC48C337D2121D29F926817B060C0828441A1 Cavernouses
593,896,173 *3D0015CCE52F9B7778199A0556FD9D3F72DE4CC0 caveslong
593,896,174 *3D009B5BD4EDF45539116F5862134720FB76F327 CAv%g
593,896,175 *3D0482956E2608E1B2BF3EFAD54D271BEA656F26 CavHf
593,896,176 *3D02C1A707513D8FCD6E54A6132B13630D384673 Cavidan
593,896,177 *3D00EAA6E08CA7723655BF575E279FFE2B85B330 CAVIGLIE6
593,896,178 *3D05B2E884CB4E9A990D0DC2466E0358A467CE4F CAVILAR
593,896,179 *3D0E2CF88F5C6375043EF5E3391B2B4D29E9F4F9 cavilh1234
593,896,180 *3D03211E26DD1227A889058BE0FFCA8A891D2064 cavilhem
593,896,181 *3D0F4A33F3E85C646BF1859DAD1A1B693E36BC7B Ca
593,896,182 *3D08994DE80C9E62844A70EF20D257DFF94B5517 CAvnI
593,896,183 *3D0D6E63A3162E95B5FE45EFB83C16930BFB12E7 CaV$O
593,896,184 *3D073DBABA5ED690789BB6EA567EEAAA9F245D02 CaVoI
593,896,185 *3D0B2729EF2728094D6893A9E810B0AD94ED1B36 CAVOLINIIDAE
593,896,186 *3D0D97AB4EB07DEACBA30A73F14BFFC651A40F7D cavolising
593,896,187 *3D00C89DF3C947F1502F65F1D2B46576E21CB07F CAV#r
593,896,188 *3D0E402107D6816C842843929A1D4FD9F4DCD806 čavrić
593,896,189 *3D0C4645A216A9D5EA7CD8541E9647ABAC81ABB3 cavucavu0
593,896,190 *3D0D8B57271DD153FCDBC2F98F592761BF08A628 CaW;4
593,896,191 *3D0FF718DBA8F152A1445C37608133D28D2E03DF C?Aw6
593,896,192 *3D079AE12A654DE7DC60D4D7ABDDE6A9FAB95781 CaWCW
593,896,193 *3D0B869F4802582B77064204C320E8F1080C6DEA C_AwE
593,896,194 *3D012A75C5CA5A4D5BF948AA65C9C5B2015850FE CAwj5
593,896,195 *3D0ECD32ECB5481DD3FD5A9056CE075CC3DADDF2 CawL)
593,896,196 *3D0F6FC2098793F84A3032B8E3A82D0516846730 cawl1@aol.com
593,896,197 *3D067B87E1E210E3EC820991AC470770438CA57B cawnpore1
593,896,198 *3D0229F097A43CF9FF6E475B8B679F5431C0FBAF CaWQ!
593,896,199 *3D017E23530F2A720AC4180141AB06E8AF5D4257 CAW)r
593,896,200 *3D041915F1E5A48D0BCD1FBE4C4DA9DC97465A16 Cawrdav
593,896,201 *3D0E39745C409D2FD008AAC375C2FC5B6126D7D3 Cawthorne35
593,896,202 *3D02D721B5AE23CAE58BF2EE05A5673CD13E0498 CawU5
593,896,203 *3D0BCABEF4670281F1B3AEF5CE7A1CB9A34288C8 Ca&WW
593,896,204 *3D017C0A815D5773D54F405D773F37330480D4DB CawwQXr6QSmi6
593,896,205 *3D0AC1026B92458D488EAC0276D9F893A5D6EC48 CAX_+
593,896,206 *3D01114D78B1703831233008669C0542AA01CDDC CaX5&
593,896,207 *3D077BD7489685CD09D5659F0095899ED4129780 C
593,896,208 *3D0E634031CDD1E5381014B12C3138D66CEFD64D CaXKa
593,896,209 *3D0C10BFF379C0ECFF9F8A61E26AF9ED8C8C551C CaXV"
593,896,210 *3D0DAE58738FF4206B88BAAF2BEA6111AB3633A8 C
593,896,211 *3D0460850A19DB660D8155EDEF92CDC855C92D78 Ca$y
593,896,212 *3D0132841A6A4B629D4948E0677727452763E590 c?AY
593,896,213 *3D0F42BB26BC501961613ED432553C8383054F2B CAYAGAGA
593,896,214 *3D0892634FA6BB2B64F3F8CAC1DA25BC33894EDC cayden408
593,896,215 *3D0550D917DDCC946F11A08B2346F660D1FF784A cayinlikoyu
593,896,216 *3D030E54DAD7DE2D66BDC0A529BB58C78B4863A7 CAYLEEJO
593,896,217 *3D0AC8E14FFAD5962267C6E7CFC2A42AB843EBA3 C;AYN
593,896,218 *3D0B03FA6CDBEECF67EFC7DB9E48AFF5685C436B CAYQn
593,896,219 *3D072E6396A63044011D4438BE8EE198CD0AB9A8 CA/YR
593,896,220 *3D064246169107E6FC872A00DE685E0AA51A1EF0 cayuensis
593,896,221 *3D0DA31A1EA54EE3F770875A367B9C2106525EA9 cayugars
593,896,222 *3D02CAF5BCEF999F4B9A10A4E3320F49D63DB7C5 cayugov
593,896,223 *3D07F2631692E03ABD9D6075E55023B6C33CEAA2 C.:AZ
593,896,224 *3D0A1D3FF0B7785A6FEAF9335181CD97B9BCC31B CA;Z2
593,896,225 *3D02989875159EC7FF1D9743D678D46DFC7B0CA3 CAZADORES200
593,896,226 *3D0C7F7E2FFD66888CD980F067CC7BDEEAA287FC Cazarrecompenzas
593,896,227 *3D0823C22568850425EA6ED0EEA1C2F9BD3AC242 Cazinskimed
593,896,228 *3D0B5E089D8B112FB2276FB72FC399E854F6ED2D CaZo,
593,896,229 *3D06DA34B5DF7A83D6514FBC5CA0D759D33FE1AF CAZO69691234
593,896,230 *3D0ECED285B0C333CAE481BF9A9F9EAA1EB461CB CAZ.T
593,896,231 *3D0CDED6C8DC43151268CE668CE8040A6CEFB34F CaZt9
593,896,232 *3D0A30611F08244AE96095703CC380F061E3A308 cazy504
593,896,233 *3D0F1D6C5159F43CC9438362EEBD5F03F33C4D08 C-B;:
593,896,234 *3D09B5B1393000E84F2DBE4B11C8964068E0BA05 C..B=
593,896,235 *3D042F6B90C57F10E01F60B0C52832629F8C1831 C)B)+
593,896,236 *3D06656EDEF1B47EADCAFBABB57F2570B7E59351 C$B|
593,896,237 *3D0F9B93BCAE0390C07BD87AA3F54A4CE99B03BF C%)"B
593,896,238 *3D06D201E83B03F191DC16BA628F96D447AC50AC C
593,896,239 *3D00071554667EFF13DD8504F0661F335371DC21 C
593,896,240 *3D0CF757073FCB77F13F9477231E65528DB7C601 /Cb
593,896,241 *3D06A81A151DB2518F6494601374E38BFE24295F C_b.?
593,896,242 *3D0E988A5DEF6EDF5348D201FB942FF263343104 C-b
593,896,243 *3D0DDA3D7987A2ABFC86DAB4D4878A97F817237F C-==b
593,896,244 *3D04595487DF5B29007D1A8B9276A01D7CE535D9 C:+b_
593,896,245 *3D030689A84A28F03C6B485AFF09E02F3D75712A C$:b
593,896,246 *3D067BBA552764D62F65B45588F242783A9AEF41 C&(?b
593,896,247 *3D08152F4BDC845FCD3639BC65DE186C3FEAA596 C+b.)
593,896,248 *3D0DA8A8D24F6C2631DD8F9433BBCC1C96E7A1E1 Cb="-
593,896,249 *3D0014326E69FBA3A0A5B37ABFB46F4BE2E66958 c+b?
593,896,250 *3D0E89180AB62F20085EBAC7453CEA39E713A48D CB0$7
593,896,251 *3D0F809EB9358D4D75CF6248A30C56E2408EC072 Cb0Sl
593,896,252 *3D03B9CB10A6900D2A23F681B42624B613E3F9AC Cb1="
593,896,253 *3D024BB9A30E43C8ECADE7B61AF5A591B9F3278A ホンダ・CB1300スーパーボルドール(2006年式)
593,896,254 *3D0BFECFEB6CE5BEEB11A861DA53AB4B8A4553E5 C%B1G
593,896,255 *3D078D8951CD796741DFDBD20F0216D0E760D268 CB#1Q
593,896,256 *3D01D3CB18D4AAD9AE1DF221A7B1D84CA2CE452F CB1Qc
593,896,257 *3D0A9A3D64CC738A53B9D95F031BDF47EE7F3AF9 Cb2,4
593,896,258 *3D09E80E409B2A6EB77AB2479B2806A8C356848C Cb2F
593,896,259 *3D0778FB057AF8E660DB803BDB494744FFF5617C Cb=2I
593,896,260 *3D08B909B5A3A90B2811D2AAF80E3AA9BF4DE0D2 CB.2p
593,896,261 *3D07312ABDF8FEAE98C74E610E4BC96C14738D59 CB3")
593,896,262 *3D0DDF2AD1694B4F5914A3ED228794DB2850836C CB3VF
593,896,263 *3D01453E88B67CCD19FA00748F01C98501639C22 CB3X&
593,896,264 *3D0E8F0171256C218B81A5528835355D5396B7CE CB4
593,896,265 *3D0369F606D26EA964265C09D62BC35855689A54 Cb.4L
593,896,266 *3D04A007F2B8587ADC162A7213584BFBF21AB5A2 CB;
593,896,267 *3D09E27CACC493174A07205D3594090A5B5C61F7 C#b:5
593,896,268 *3D0A7F8E9C4665E89ECE30884E8183F2E325B141 Cb5)/
593,896,269 *3D02D701C186190D52C9FD84CB2DCF6E734E82EE Cb51?
593,896,270 *3D092AFAC54B5D54BBC8E76096D6482181E01141 CB52-
593,896,271 *3D0A78C0AF2B6253BA7C3D12259914936003066A Cb5eg
593,896,272 *3D059881B92B25FDFEB100C460378125E2EF6771 Cb5f,
593,896,273 *3D044BAAEB34F3548C298B79C7DDD88F0481D531 C=B5K
593,896,274 *3D09212D0DE129FDCFA5B750CAD9BE18E6400BF9 CB)5T
593,896,275 *3D038A4D8E1F2350ACB23821DAED57B7BC0D51BC CB"6_
593,896,276 *3D079394C130CBB663AA48AAE27FD5B5B7FE4C6E CB62e
593,896,277 *3D0C8A83691FB4504B9E80838BAF6293D3283412 CB6e9
593,896,278 *3D08D65E275977098E7A62790969BE46FFE7F63A Cb6hU
593,896,279 *3D0521FB8DB55B34E358CD8018E499508455EBCC c>B7
593,896,280 *3D046A9525872B4E8FF9257E0F5DB9590D64A06F CB7%2
593,896,281 *3D063DC0823B8FEC55C799158B9C6B2A8B36B9EB C/b77
593,896,282 *3D01008971F4F37C2571DEE9AF9CDEE95DDE073F CB79t
593,896,283 *3D036ACE28710E38C5674B80EC2575C426947ADA C?b7O
593,896,284 *3D0C578AB2B1F2E1251D833630AE7D6459065BF4 Cb7#S
593,896,285 *3D0C207147244D97C629C5773F57132481DEA5E3 Cb7Sc
593,896,286 *3D0E9045B7BE6CA9D033C8007BDDF620F4590886 CB8(:
593,896,287 *3D0090B75F92F88D3C19D4368547810D5CB28E0D CB8#
593,896,288 *3D0DF88B065DB19CBD41B9F82C4865D2A114CF35 C;b82
593,896,289 *3D01F33804D1F1A93220ECA6E2D615C7CE198068 Cb8)E
593,896,290 *3D0B9ACF03AD40091598E65BA364B2D82942C3B8 CB8EG
593,896,291 *3D05B9F01F2CE223CA84784D4E8AECDA83EB166E CB=8l
593,896,292 *3D06E93908E96B478893D5AF3DBF66BC11CA0C60 Cb8/M
593,896,293 *3D07EDBF68F642C9D10E52D6C87879D280A4327E Cb8)t
593,896,294 *3D0304D9DD32CC5CAF38A0A7A57885E1324F4524 Cb8TQ
593,896,295 *3D0524C4017B7C43375E3C279B12B952C904919E CB8WN
593,896,296 *3D0C9B7AB0A926179900585142C23924BE88085F C"?b9
593,896,297 *3D00DC73DDBE3BC93AE0D9AD6443CDAB1D265B8C Cb9%+
593,896,298 *3D0E061A296465F98D571B821555FFED86D4D15F CB,97
593,896,299 *3D0CA9CA1A6716743E1DC75A0AF7961735D3B534 Cb9j0
593,896,300 *3D05C99B385A3A00673F446428D7F15AF4CA3325 CB9Ot
593,896,301 *3D00903C422A6163AFA6E6155E1B56954C89D3E7 Cb9Qs
593,896,302 *3D0536E0611C896C1754C7178EE8702225522B69 CB9td
593,896,303 *3D0E3A645CC6D63A5661B5A08FEAAFA761A10B69 Cb?A"
593,896,304 *3D0CE63B6A4EF9C1A8EAADEB4155CD0D535A9193 C=Ba8
593,896,305 *3D0A0B7C07252AE690E0C6C8971CBAF65C6010C5 CB$AC
593,896,306 *3D02636E98013250C20D4F1F8E6EA71B8A663D1C CB+AL
593,896,307 *3D02DE7B64A178BD1B747FED87FD3CE4A8DFDE9E Cbaldwins
593,896,308 *3D035CDBF1872FD7F61D9A26183F243E4CBFD852 cballcyber
593,896,309 *3D08E13CE042622FD6306DD9378CBD790B8835CE cbaodiug
593,896,310 *3D0589B88420C1078562326DBC78BBDBB0CCEBD2 cbarnston@aol.com
593,896,311 *3D0B6715841EF4E4C32BD1E58B3513AD6F2C5B94 cbarwood@aol.com
593,896,312 *3D0114E228F68D3C82576E4C2F0E350C4D2DD881 CBA.S
593,896,313 *3D01E0FD3EFB94109F93B15173112986D4AB827B CBA?w
593,896,314 *3D0994A6D3A94F337BF6003BB01C06CDC351B24D CBb!(
593,896,315 *3D011317342B01F272C0186D2245CF1E0A98A019 C%Bb8
593,896,316 *3D0609ABCC5B7B540C5180074DD950AAF5E03918 @CBbaa
593,896,317 *3D0CA8D3324DE454214EE016F342E39F28E80613 CBBcO
593,896,318 *3D0543CCB6C42622500720A782680CBF107BACF6 C&BBM
593,896,319 *3D076AC20BFC9745DB5E7231C6B963620697097B CbBrD
593,896,320 *3D0C7CF7DF5F3CD674C85B1494FB9221391CCBED CBBUU
593,896,321 *3D02A4E7DC7E32190BF395073674B039AE69C0DA CBB%Z
593,896,322 *3D0689F903BEA11F9F76F8432B2735BA890F84B2 C"bC?
593,896,323 *3D020EA6FB437038D87A9039C060E5E4456914B4 C)Bc5
593,896,324 *3D0F3555CCC889DF4660768B521089278BA23259 CbC:8
593,896,325 *3D018B0CB378BF7BDC0077DD3634C3335D667F5E CB)Cc
593,896,326 *3D04AF73360882DF4462D3D020500AF9146CB0A4 CB!Cd
593,896,327 *3D0B2E7DBAE3FC6FE981EF6DDE2C259AC1369DF1 cbcdart
593,896,328 *3D0AB69AD1751E1E11ED89CA4E0045C8FF5C23E1 CbcDP
593,896,329 *3D00C604B997BFAB9E0A366AED5B6838B0502A2E CBCITY
593,896,330 *3D0FC2A327DD36F7D4AB9880D77949888862F8B2 cbckler
593,896,331 *3D039E59397C040EFF3854048647C9C68EA7B16C cbcurren
593,896,332 *3D07A7068EA0FA06F237559DC35DC274F85743FC cbcwh
593,896,333 *3D0B314957D1D5FCF5DDC3AEECCFDE417BF49EDF CBCWu
593,896,334 *3D06ECEB2C7B480AE5850BC7B9BE7F703C37A3AF C.%bd
593,896,335 *3D082C4AEEB510942A418789252B912F4571470D CbDDC
593,896,336 *3D0BCDEACE03BEE90C6D2B051C3D967E1B10AF32 cbdeafministry
593,896,337 *3D001902C26F83006245D751011FBE2372F1A37B cbdebodine@aol.com
593,896,338 *3D0E27E5DEBA1DC78FE9270ADE2BB67779D52109 Cbd"h
593,896,339 *3D0119E152EAAF4AD541932372CE7E6177471CB7 C!BDj
593,896,340 *3D098D248CDDA359FE524AC7AC701A8BD27E757D CBdk0
593,896,341 *3D0D844D06874571FE643E74945B58FF94F9C4FE CB?dm
593,896,342 *3D0478D79D6BF95077D06AC8109267F53F12A4BE CbDo3
593,896,343 *3D0DD9741B7CF413C847704C8B026F985E29C183 C
593,896,344 *3D03FD42C4139A83ABC33FC02DE8073E6E21097C CbDSq
593,896,345 *3D01A69781C3E0BD5258F1E1D67EB1059F90568C CBd:T
593,896,346 *3D05F87EB19D18878CC7DA45D5A2F55613262CB2 C/BDv
593,896,347 *3D0B85FEE1BBBB362CDB617D88079C81BC691843 CBe!?
593,896,348 *3D0A5D3675A3DF855160AC984805A0A1C6226D49 Cb
593,896,349 *3D0EE75362E2582C7E9C21E44516B22C05E55D62 CbeB
593,896,350 *3D05E6CECAFA1C2E713060C25337D4B299CBB2AE CBECb
593,896,351 *3D026055731025A9A37E335A5756366A3436C41E CBEcs
593,896,352 *3D06892E137DF6F3F39C9AC77130A3701459D4DC cbeddow561@aol.com
593,896,353 *3D023DC8755D5BF1AEEF7D8F34C344B087FF524B CB)eF
593,896,354 *3D06798F4A109F657A19840CC4EC959E7DD269A3 C_bEj
593,896,355 *3D04C97AECF5A853AB3727926197F66C9A8D4C6D CbEm&
593,896,356 *3D06DD269847619553910F7A3EF5FA3C6D813D06 cbenches0
593,896,357 *3D0CAE516C8FCFF66A61FCEB0688DFBC3156896D cbenn96969@aol.com
593,896,358 *3D09FE683AF440113924011E1500352A29715D02 CbEP8
593,896,359 *3D0A828348D72486C80FB45EE40B3ED0E218A54B CBEv"
593,896,360 *3D06D450EFA20C2F5FFDF6F2BB487D4EC2056634 CBeY3
593,896,361 *3D03E4EA24A4D7BAD172483B32F239E4CD20FA5C CBF/$
593,896,362 *3D0A028406FC76C39D19CD81D8EAA9BCCD49439D CBF&;
593,896,363 *3D097A4B7330B39B01FD461C7E2D0BFBA8FF9208 C,Bf=
593,896,364 *3D0913CCB9C230181B91D8D47B7ED9A1C67F3520 CB(:f
593,896,365 *3D0A9BC089CD2D97ECD4FA503ACC5D26D774AA24 cbf125
593,896,366 *3D084D091E3AB7C5445FF581F9EC163CCFA7DCB3 cbf1c3a9-0fbc-3db6-a908-35f30064be91
593,896,367 *3D067ADE983A9E8DFE1BCDDF14EE1A1269DB62DC CBf/5
593,896,368 *3D0A8411717E32F7C7EBABF3A06FF5F1AB393737 CbF:a
593,896,369 *3D0555B80E7D4FD84E900F1E27C3F31B9825480F CBffr
593,896,370 *3D03843F217344B7640233878D9A5BEA32E43E10 CBF!K
593,896,371 *3D0C70DD94A81FD60BF3343C3B0C9461446AD7AB CbFMb
593,896,372 *3D0B1FD7EDE60464033C48851B0C0CDC44506BDF cbfmw@yeah.net
593,896,373 *3D0226420BB1622250EAD7F0CBC8C845A4B130E0 Cb#fP
593,896,374 *3D093747FBB9B076D7AF81D85A5C3FBB50E2358E cbfqg
593,896,375 *3D01A5E5F27F3A003D78A0A6A8160DB71AB46E32 C&BFt
593,896,376 *3D0A04D8DCF79089FDF28B463DE78B80B006B2EE CBFv.
593,896,377 *3D0ACADEFE9C8091F8EEED40072FF335AC8D6D14 C/BFw
593,896,378 *3D0BD743D49C68EFD5AD1945F60BAC259C7273E8 Cb%fw
593,896,379 *3D0B03D30731673366C66AD6ADB5013AA510C103 CbfZ.
593,896,380 *3D054FC41A3FB3989EE73A2A5B2A74BBBC547365 CB=g=
593,896,381 *3D0917808ED522EF9F516B09A01AF018E4F60BE8 CbG/$
593,896,382 *3D06064243F836DC3AC0D3A583BF76C959BFA995 Cb?gb
593,896,383 *3D0C35E88A3AE03EFCCC37AD011A0D11DED6C526 CbG+E
593,896,384 *3D0BA6C58AEAA932F5A7B8E51ACC9B95D501796C CbG=F
593,896,385 *3D0480F6AC3E4507BFD10C2C5F37346850C9EB84 C=BGh
593,896,386 *3D03EBF307967703265B5657A7B141B25DF5503F CbG?o
593,896,387 *3D0CF19824AE7B424F55B7A73ED9783B68DE99FF C&BgU
593,896,388 *3D00F72E8F41C5683FC5FA1337E0D3965216C9D0 CBgvP
593,896,389 *3D007728AF38E87DAC52F70E08BE813174E46041 Cb-GX
593,896,390 *3D095236B2FF78F2A14E905CFD04DFF50929A26E CBh&"
593,896,391 *3D0F386A7E51620A59639FB25C7C7DA2FE84B27D C/bH(
593,896,392 *3D08523046ACE47C0CBAA459BCC6AC240B8516C0 CbHab
593,896,393 *3D022498CCA3068247A930F20DF129D2197A58AC CbH#B
593,896,394 *3D08D323E7AE41C25E7355F5199F4783974F0819 CBHIV
593,896,395 *3D0CC2B2965DCD06C2CB56D5CB9570273FCBA838 CB&HM
593,896,396 *3D08F5E6C9BCF0B04E2352C2C0AD2C50D9F92029 CbHMu
593,896,397 *3D075A100EE16A71F41B62FB3BA4568C63D509DC CbHRj
593,896,398 *3D070F5476B7674066271DDE7C9E5E09903F2742 Cb(HT
593,896,399 *3D0D3A678AE7907638D395310D0B7C02766DDD7D CB-Hv
593,896,400 *3D0ED3DF153D4ACAD0FFD47E4B398A9012704120 Cb_I&
593,896,401 *3D07BC604E2B603DD15D86E238C823114619FCEC CbI".
593,896,402 *3D0790A3A034312A719F72EC68A95C6BAE636990 C_-bi
593,896,403 *3D05E24CA99714CC63FD097CF478E499A2985B3B Cb
593,896,404 *3D0496C241DDC4A359A96324AFD3C3FD1A970119 CbIA-
593,896,405 *3D069A7805645A28D5E7B20154241854F9040B0C CbIc_
593,896,406 *3D0402FD04CDAB3EAC7E4C8B4C2405A0188A054F cbicq@yeah.net
593,896,407 *3D06F6092D08937760CB96447827B4C286C5669F CBId!
593,896,408 *3D08CDB40D9C6517152BF684086A527E094D557D CBiD?
593,896,409 *3D0F5564C05D872161FBB0BA728DF2C4C31BFF1D CB:iG
593,896,410 *3D0B8C884A566C7FBD3DB9A051128949DCDB845B CBiH,
593,896,411 *3D0BF7CC62FC25B411249D608C268D5C6D88E763 CbiK:
593,896,412 *3D0F82CD439C12BCCCEB85448FCB79C4FC58D521 C"bik
593,896,413 *3D0C0C3A6CF194CE8366E2912E08C0AFF5E09B91 cbilm@yeah.net
593,896,414 *3D0D04B314597EB5A398F32EC9763ABF7D1E9444 CBilZ
593,896,415 *3D025E6E0FC860F6C06852340EDDD9A18EE8A564 CbImT
593,896,416 *3D07EF17BE517CE304E5B8BFD3C2C52CCDD169AD CbI"q
593,896,417 *3D0B19315E5AB187FCDCD4D16C7D71743B9207C4 Cbiqb
593,896,418 *3D034329E6054AC0D6EB10EEA301FB9081979680 CBÍSlS
593,896,419 *3D02456020A7AB001A187C4EA910BF83BEBCAB80 Cb?iX
593,896,420 *3D03AD2384B5F395EB996079C3AF1567D561F447 Cb_"j
593,896,421 *3D03C57AC5A1B2D93BFD1018293E3CA5052BB5BD C(bjB
593,896,422 *3D027F59BEBA77FB89A39229147D35E3E5AE51E5 cbjbar
593,896,423 *3D0FE0BD6C5733221DE08C3697AA8BEB63E961D4 CBjIM
593,896,424 *3D03B0269BC3AFDBFAD189232420951BB74DDB79 CbjK%
593,896,425 *3D083AA8869F5CF1305832CE12E880B8B1D57684 Cbj/Z
593,896,426 *3D0C5D3A406AB151153E4427A0575934D91B1572 C$Bk%
593,896,427 *3D01C0E35A8304A1F5CB71361493C71FE0310BED C&b-K
593,896,428 *3D04635A03ADE700B5E5A1E7544BA7768FB7444F CBK3a
593,896,429 *3D0A5690204B1E17E61A9B2612172DF44C401EF6 CbK56
593,896,430 *3D05BB52E723CCC0C8B410C6445BC1C1AA53B23A CBk-7
593,896,431 *3D02F3E6B652FC7734EB427EEF120DCB8D887532 CBKa8
593,896,432 *3D0CA7A4EEA197BD264881CC816D48F0F2D98E45 cbkd@email.mot.com
593,896,433 *3D046EFE2C14C19531517775A905B4755B48187B cbke6629@aol.com
593,896,434 *3D0D5E957ABEC931C26F06441B8ADF1A3F56E5EB Cbk=G
593,896,435 *3D0874D49A2094859ABE373B0CCB342C65E17E60 Cbkjubsw6
593,896,436 *3D02A9DDF9A7CFCFEE2347EDE4845FE948532DED cbkk@sina.com.cn
593,896,437 *3D01245F12594A25984312F63745CFA63606B3EE CbKTt
593,896,438 *3D0D313840E4A653456C4A6C481892AE1183E473 CBk&w
593,896,439 *3D02C5BA73FEEEE5D158E47016B6D48F5EBB67B9 Cbl-
593,896,440 *3D0E70BD6C1206D36DC53336E4C88D01A508C1BD CBL;2
593,896,441 *3D0B45C3ABD35A6F9324E8F6C385262F3D12B43E Cbl7Z
593,896,442 *3D0D6A508AE4D775575236ACB53052FC7020F553 cblaha1219@aol.com
593,896,443 *3D04C3BBF480D30319A45F6EFF3285A2405AB4A6 CbLLU
593,896,444 *3D0CE5F37DFCFA50972152EE12E5B50D4CFB85E0 CBLQ4
593,896,445 *3D0AF0BDC0C8EED68A444BF621C445F1E3FEB20C CBlSp
593,896,446 *3D0167A52E422D09AFDEDF8B91D9FF9A2AB10633 CbLVZ
593,896,447 *3D0CEECE04C4278055B44699E73B674ED77DEEE1 CblZ0
593,896,448 *3D0F85D8F5568651D2B7BD92E5FCB5C6AAC515D0 C,%BM
593,896,449 *3D0D5AD72CD0280469A3B279FD98FEB02BD49492 C
593,896,450 *3D054F11394D955C63B241359EF69FC1BDE37C84 CB_m?
593,896,451 *3D0E5991AB351C41C0B0FF99C46D7D349AAA7C36 C/b-M
593,896,452 *3D0F2AD8D29878EB0B6CA04226E4FCACA638B1DD C.$bm
593,896,453 *3D00A337CC27179180D08EF1B810521A937D9419 Cb%#m
593,896,454 *3D047BE631D3C888D57D424B225FC9C4025B885D C!bM5
593,896,455 *3D0B8E92538CE11556302893A4CB211BD84FECF1 CbM.5
593,896,456 *3D0EBC22C44A606B2C57F1D10229AB04FB91200D CbMBY
593,896,457 *3D0516CD214EE6A00CD395E473C7B752B111A059 cbmiu@263.net
593,896,458 *3D03EBF6A56116DE29789401D1D462C4A606CB35 CbMjD
593,896,459 *3D0DB40A4C2C6123887F193D5E8AE7D011A34BA4 Cb?MP
593,896,460 *3D052B6449F0AA081BC6FFC903C3CDEA4FCED46A cbmsed@363.net
593,896,461 *3D0A188DE7D8612FD34D94A4963E4E733B46F994 CbMw#
593,896,462 *3D074DB730C9872EFFE7E167074A12E486BAA62C C,%BN
593,896,463 *3D0460370DFA2B3CE7DB70BA8D5A48E9EF2A571C CB_:N
593,896,464 *3D09417AA26725302B4262A5943A4923C8D4B8D0 C;/Bn
593,896,465 *3D0C881536A4E8191CE7F933CC23131580DD7023 Cb!=N
593,896,466 *3D0DFC1A4CE6CFF0217AEBBFD164AF576E352141 C:bn0
593,896,467 *3D051525B41F5677AB67082E33536DB2D3B45E85 CbN6P
593,896,468 *3D051A8C5D3727A8F58EB6A4C3F2F9ABAC4512AA cbnefrmj65
593,896,469 *3D086FD103122D39DFF24C77942F4564936777D6 CbNoA
593,896,470 *3D00A165281E2EF1D07B12E0A8A0D7A8E1B93D7A CbnPb
593,896,471 *3D04DB4EEFC1475D5DC1002E7F00F898F7197D3C cbnra@yeah.net
593,896,472 *3D042F8D4B4EAEC0590176EF1CBF4D825265CCA4 CbNT5
593,896,473 *3D056209AEE86F2A3A045F05A407A8B217E6AFDC CbnZM
593,896,474 *3D0238EDDCDF5457C53BB79C05CE1EA62A5431DC CB$o.
593,896,475 *3D0DB9C989F6D05BF74CC28268971C7ABCF58ABC Cbo4W
593,896,476 *3D01C9CA0F8D135C49AE5C896B7D1A84105AE9AE Cbo7Q
593,896,477 *3D0D56919220D7B56B181BBAF96E787133FA59DF CBO"A
593,896,478 *3D04A5CF80A28C073BD2D542D3F78EC9B72E6922 Cbo)A
593,896,479 *3D0F79904E1D2770CC9784F092DAA91D2B8B0F9A cboebsw0
593,896,480 *3D0A567A5849C1C369F5E17D6FFCB684F888EEC0 CboF!
593,896,481 *3D0B62D57AAB8A517582A699534B917A75FF5BC0 Cboo?
593,896,482 *3D0F5925A208A5D2C650946EB5C3CF8BB7F7E6BA cboss@aol.com
593,896,483 *3D0F72CA50822EAB7654241BA24818D6150425C1 cbotstatue1
593,896,484 *3D0C01F07E1EE05681B6BF1C656A5027E9462831 C#BOv
593,896,485 *3D03AC02EA49F24A4EF41B2420B603A0CE3A4C79 CbOw+
593,896,486 *3D08BAD6EC20E2F03E693D0BB40B71543B841EEE C?B-P
593,896,487 *3D0472C363026BD72C4C813FE306BDE9E6CB80F4 CB-P%
593,896,488 *3D0CA19C18C9D0741C572877D1F4EB1F3330DD23 C-Bp=
593,896,489 *3D0B6DE6698D9A32CD5894DF90FAE7C6BF91E338 C#B=p
593,896,490 *3D043FFED63101567841CAFC2DC688E6B4C98C56 Cb#"P
593,896,491 *3D0C3BC696BB4A24D00F617C3F9FE91638D018A8 C#b-p
593,896,492 *3D0915AE6FB4FEFCF189754EF63EAEFB79DC3F0A CBP1=
593,896,493 *3D0B76EDA3E50866784ABCB28D893FF2419F5827 CBP2N
593,896,494 *3D0F6864CFF3201880A3924569EC77D555E58F1F CB/Pd
593,896,495 *3D07988BBB104D8C67EEB85B06E852B94ADC5E1B C?bpI
593,896,496 *3D0924C3AEA541BC2C347AA5A71E7C10200073E9 CbPYi
593,896,497 *3D030F3603DC3B9AAF68E49B314539747A0AE1EA C
593,896,498 *3D0EE239C0FE741B81541776707C7ABDBC7E3A3F CbQ2O
593,896,499 *3D0C5BF449EDD2A1D3A54442927DF9F363C78E98 C(bq4
593,896,500 *3D045E636E276ED74DD61671F9590EF6DB95A04D CBqfO
593,896,501 *3D0B4E5B168A717EBDBCD0D6427AEDBBB969339E CBQ.K
593,896,502 *3D077DFE0709CEF5EDA72493463AE9935E19EB7F CBQ.L
593,896,503 *3D04BCE772A3CE953043DBA615357BFDBD275073 CBQ#p
593,896,504 *3D06D4EF58BFBFA83AC9CFCACFA41AF89B4FC77D CBqrR
593,896,505 *3D016F81E14198B44460021227AC10390ECF47C0 CBQve
593,896,506 *3D066A85346EA95B26D8B6FE00EA238BF69E2BC5 CBQZk
593,896,507 *3D0A2953F90EACE4CCDCE5A4E127006BBBC891DB C=;Br
593,896,508 *3D0C5C561356464532E6C444FC1AFD45ABA1BC73 C!
593,896,509 *3D05BE8ACD2816F76016287958BDABDDBE208889 CBR%2
593,896,510 *3D03AF44B9CC7F9FF0537834A502F6162A3079D9 C!bR2
593,896,511 *3D01359D934AD66250D3735C5ACA92E37348A29B C+bR3
593,896,512 *3D01E42D3B7C9A27F837D12864F32E816334A86A c.bradford
593,896,513 *3D085C8E245A4E7636ACF67EEC1B78F727523195 C#BRe
593,896,514 *3D0D5C2F6D1F4C94EB1D0DED16187615FD27F37A $c@bridulou$
593,896,515 *3D0928198F081DAEB879A77EC7FF5DF11DF04CF7 CBR=o
593,896,516 *3D039AEA306C8B2475927DB6B43B9AF8D1091DD9 Cbr&O
593,896,517 *3D03D568C55E6549CD460E3390AD65354B6E5321 cbrobe@aol.com
593,896,518 *3D0710729222C106CB748C11363ED85BE08BE89F cbrolina
593,896,519 *3D09B40E60F0DC83F0D496CEDD511AEB6F359A25 CBRou
593,896,520 *3D04AD15B2AEA393DF45B39F1AD258F39A984947 C/bRR
593,896,521 *3D0A2A0CD39E3A92860EBFF2A53CA788340332EF CB%rs
593,896,522 *3D07E788FE6BB8170E5AB4291754CE2A7F38AF06 CbrtK
593,896,523 *3D0A329694D9AF5E03F39C81897C9B9AF536DE51 CBRUR
593,896,524 *3D0B73665F2A050398C6365DE845454F02B88840 CbRZ6
593,896,525 *3D098F065E45F5EDBAAFB772FCE5BF7DE57FA282 Cb(S)
593,896,526 *3D02C3927786B7C5E2ECD14D4D9CEF41AD67CAB7 cbsは204のvhf(
593,896,527 *3D0963686517FBF635E37D24B31B8E0055F6C268 CBSao
593,896,528 *3D00366B9E7475C4450AB730EB41A0FE593DC917 C
593,896,529 *3D062238FE5D7A195B73FD53B6B2BEC28C3E2B88 CBS(D
593,896,530 *3D0D62D8F87156C8ED5D50F0881F9C9F04F2AB09 Cb$Sn
593,896,531 *3D0B56C1F92630198CB02B6A23C7070EC2F57B20 CbS"n
593,896,532 *3D00E0A0B2CCEDCE5D446AF6B485F857823150AF CBsyS6
593,896,533 *3D0BE8AAA78A01302C04F9D8A0E10E012F87FBA0 cbsywiki
593,896,534 *3D0A4D7443F3E84A6385180FE9F53DF27E899A31 C
593,896,535 *3D0DDD80573B93FADED93ABB22B867272A6BC4DF C;b!T
593,896,536 *3D0602F1D918B18DCFEA5F07D4D5C8786FB403C3 C"b#T
593,896,537 *3D03C9A5D96F8814DB768AC93F866B983B8DA1CD Cb?t
593,896,538 *3D022812B96567F9AE6CA510D1188A113ABC69FA CBT4e
593,896,539 *3D08AECD205144C8DF74959BBE92814D697128C5 CBT5b
593,896,540 *3D05BCD58D3CC85BC1130DB9FC100F3B587A4591 CBT9005
593,896,541 *3D06348618F33AAF0BC7A9B3FE5AE70E6D9D0F98 CbtC3
593,896,542 *3D0A8843486D4B8E20AF21AC1795D21A7F1232C2 CBu..
593,896,543 *3D0B51F409D811ACEB714BEFBD53E7F2521D0506 Cbu&)
593,896,544 *3D0350DEF51CF0B25B9BF753509F18E460AAFAC4 CBu26
593,896,545 *3D0FB4A272E1A261074ED635C8958537CE4F2AF3 CB!U5
593,896,546 *3D063B75ED51C67A2A15844D5C2BFE9DDF7EE271 Cbu7"
593,896,547 *3D01408FCA82484C6D235B7934124B871A000519 CbU8/
593,896,548 *3D0A974363A12A568A2332C41DA298D2B8C92EA7 CBUG+
593,896,549 *3D0771427A6CBBAE31E6D39EC24FE28C7F5CF94A cbuk@email.mot.com
593,896,550 *3D0AE0BB07F35BE10A90DA82A31CF5A896F79B44 CBUnr
593,896,551 *3D0FF1A4F8EAB645906E8AC0E5824B2CE64A0C6E C
593,896,552 *3D09EA81AB86EE74C8BF6A857AAC2A0B9C5F619E CbUTY
593,896,553 *3D00A9863467D989434F2574A301D3372D0A219B cbuzz38
593,896,554 *3D0AB33C411BDEA7FE0D5065C3317A876A9F70E5 C!BV;
593,896,555 *3D0ED0D3D860CCA3B0C8EEFBE6DA7EDF984C3411 C+Bv;
593,896,556 *3D00FCB92CC96A96FEBD493ADBF6AE0F1EA4ABFD CB.v(
593,896,557 *3D0F1E25D82E8146A5A2FF74FD980A59A7827EAC C,b,V
593,896,558 *3D0B7397CD9685C0C8E520613641EB1B6A8D8D72 Cb,v4
593,896,559 *3D0E70A0EF506C8F9AAFD7A79B77B8538E1B7017 CbVad
593,896,560 *3D0A825C764BCFB894150C5CC3D8E3595C9D3439 CbvDd
593,896,561 *3D0D02EDA7BBED23268580BC032BC602CF2C2B3C CBvrs
593,896,562 *3D0AA7FE6DAF86CC7708958DAFCA0E715E9471AC Cbv?U
593,896,563 *3D0058C3A58933D76AE1EF82525C09E0776FA946 Cb%vu
593,896,564 *3D01FE23BD38988A7983179B0F83686B657B10C1 CbVwO
593,896,565 *3D01D01BC74650E76A420D5040451069C3D79917 C:BW)
593,896,566 *3D07AC5EE3F99B5D3DDF6713F692211C0601BCB0 CB?W%
593,896,567 *3D09C83D1193908A3DADF4EDA62070994D8AB9FD C&Bw:
593,896,568 *3D0A61A715B0D55978E1AB55A608B45DF057CFCF Cb-W?
593,896,569 *3D0A59725BBE5DE2A2759BC07BDF8869808FF0B2 Cbw1D
593,896,570 *3D029C616584A089EB63ACFF94455C92E6FC35C0 Cbw+C
593,896,571 *3D05968204DC1F1461F2F66DFC82F05FF8469ADB CBWG)
593,896,572 *3D0E08B6D21E34968C2537A31B76598C432476D2 C_bwt
593,896,573 *3D01AD27CE77157483B2A60319395E7641E05BCD CBw
593,896,574 *3D03C6341295E12039FD62E912C7CB0F64745FF5 CB,X=
593,896,575 *3D0B5A581369F02368D32C2969CBB289A683EDC2 Cb.X/
593,896,576 *3D00143B2CF3AC70F8BCF7C1F514452DC647CBD0 C!bX1
593,896,577 *3D02CD3B7DDF7982F502C5BCE206499F07B7AEEF CbX1f
593,896,578 *3D0A024A30A0F1EC58C93F3C1CC4B57B388A9BC1 Cb/X4
593,896,579 *3D0F628022859BEE051F90EAB485C8E159CC57DD Cb-XG
593,896,580 *3D0025A8F15D9B979F1608EE782EA9E1FF8658C6 CBX.h
593,896,581 *3D030689DC19A88C90B30E7FD920E6D2D8DE55C5 CbXH0
593,896,582 *3D05032E62F41FEAB852C9167DE86031A1128D63 Cbxkbswed
593,896,583 *3D015A0BE0248A34B46EAE0B2A96C18CCC859357 CbXRv
593,896,584 *3D07B56956CA5D952D2F1DE07DCDEC9C35785782 C=BXV
593,896,585 *3D09BDF4D4114F90BE9FDCF360ABB78C4D9B76D7 C,B/Y
593,896,586 *3D01E724AB91DF8AA90671D861FE35B86261FE73 C.BY$
593,896,587 *3D0869D7FAF7011DAA7FEAC7D9A34DEDBA60E3B8 C?%bY
593,896,588 *3D0809AD828925B61DA634EB177ED0E78AFD49E4 CbY5=
593,896,589 *3D0C9F0B72940D65ACA1108A46D7AB805DA033C8 C+bY8
593,896,590 *3D0294A16B1DE4BEBB3CFC04B0ADAAB66B8793B0 CBY;e
593,896,591 *3D030273DF0D717F56589D43BF6682E200D9E67A CbYFX
593,896,592 *3D067B9CC9C21944CF60C755ABF0C0A22EBAF3C6 CBYjR
593,896,593 *3D0B50064FE8780EE67273C5138E782819D37F2D CbYQw
593,896,594 *3D002337F62699EC26D8A918E13B3F9E7C0DA334 cbysek@aol.com
593,896,595 *3D06724C3A1274AC16B4045F915F6C645A71BAED CbZCn
593,896,596 *3D0943B3FD458C6CB020AEB03F9037DB6F702EC0 Cb
593,896,597 *3D0425552A0C7ED14E2C53FFAB14034E6C204321 CbZOv
593,896,598 *3D0734973A531AF46592CDD6188CF065DDBCCBFA CB&ZW
593,896,599 *3D0477652A41BBC0D3A5546476C06AE465A17747 cbzy@elong.com
593,896,600 *3D0825A79EACFCAF792299E2D62AB040AD7E0230 C_,!C
593,896,601 *3D06CEE79F8018201506781955128D271AF29F54 C_,C,
593,896,602 *3D0C9491EA450D5826DAA86C739C6062C17A217F C;$C%
593,896,603 *3D078FE47A0A88E56B19F8EF30ADAE3249F566C7 C:C,,
593,896,604 *3D04E02B8995800F40CA5410A51D905FCA97F914 C!;,C
593,896,605 *3D0160BE74E18B6E40DE69BF8F0C9688CC827385 C?C/
593,896,606 *3D07030C5D584FF1151CDDC0D8EB31F5F8538174 C.C$"
593,896,607 *3D0875AD893E60858764F63D3873287F79F99184 C(C(/
593,896,608 *3D04D8E5A4C9292A145D30BD58B23D4E508C5F7A C
593,896,609 *3D049D499D7B16D75AA37ABCD741AE2D19FA3E2C C
593,896,610 *3D0FBB1385B861CD6916A51F3A5EDBFD2EB6ED01 C=c;#
593,896,611 *3D090D6F6E4600ED9AD37F14CA2595C866E3B496 C-c#;
593,896,612 *3D0478ABE858879089353C022C24CDC9FC73FC6E C-c
593,896,613 *3D005FF8D9FE38534F3D579E5A83963A11715768 C.c/%
593,896,614 *3D0DB6F194688F0B914E7D8D86BCA94D68C925D6 C#c%-
593,896,615 *3D09C0E6A3B37797874AC9AEA25B6F91CEA876E1 C%?c%
593,896,616 *3D0D0B48A265EFCA3A3CFF6DCD7F9462F098C410 C+=,c
593,896,617 *3D07ED981F29556026CB7D4869A76D6B6538D277 Cc"=:
593,896,618 *3D0CA1898B171FA979ECA3B6B44D71E644578AAE Cc)
593,896,619 *3D03DA794648F6C833B20FB10B5588D365EB360B C?C0$
593,896,620 *3D0BD0A2FF80E07F4373600D2679ADCB3FBF0C0C C$C0_
593,896,621 *3D001872B044F63CA5C0DD9237E01F8CDC8C7EC4 Cc".0
593,896,622 *3D0E73E48108A38E737C53A16F17CD54B4CD7D21 Cc07$
593,896,623 *3D0B512148DA0E0506CD7EF1A29E5833C56F1772 Cc0a_
593,896,624 *3D00364CC21E76FE726444CA09CD05816836F1FF C@+@c0m8
593,896,625 *3D068CCEE7A4A0264FC65085243E4B8BF2182422 @cc0rci@v@
593,896,626 *3D0BECD69F149D15AC5F89AA90FD3B956D1B8E84 C!c1=
593,896,627 *3D0E36631A0FD74CED61A4295ADFA00565958BE5 C#C10
593,896,628 *3D02F9970ABEAE2CA467EC310CCD302F5D4B9964 cc111111@aol.com
593,896,629 *3D0B89073A93D6CDA00B9E329DC323B44B00219D CC114145
593,896,630 *3D03C3F33AE59FAEBEE2E201C32FA33E45C5143C Cc(12
593,896,631 *3D029378D1113BF5C8BE943CE39B33873E8B1654 CC1?L
593,896,632 *3D0E055E550172BCAD7737F16A8A8D18CB78B814 Cc1m5
593,896,633 *3D06F549C4C972952CF2CAB53925565AB4D28E2C CC1sP
593,896,634 *3D09144A8435261B2363742FC8F0A4CC145F93E1 Cc)1u
593,896,635 *3D084846B6D4C4943A0E149906BA7623F3548626 C-C
593,896,636 *3D094BE4E78DD4577567CFBD519070A033368FD0 CC2+!
593,896,637 *3D09520D1873349B342D7FDF0D6B9A8C25BF8209 Cc27e
593,896,638 *3D0F5A6069324525A76A2A104943B8EB5DF37177 Cc2dL
593,896,639 *3D04428E9EF5EB51621CCA6E2947477602589F51 Cc2iS
593,896,640 *3D0E3BA5452F7EB31FA3050EE31A9254E1C5296E Cc2ko
593,896,641 *3D0DD01E91B1032A88DCFF4EAE716F1DFEB4C399 CC?2V
593,896,642 *3D024B3E152722AE50E1D3A2B23A25B6C75BE330 C?/C3
593,896,643 *3D0B46B81A71D6129CC0543E3BB51B9CA4C913A7 C"c(3
593,896,644 *3D0BEFE33FBDA7B8F1948AA463A81DA1A820A2AE cc372305
593,896,645 *3D02595F0C098DB1C8D389B60F0CB254440AB8C9 C.C3C
593,896,646 *3D08FD9B9A4CFBF1033BEFF4A5D792DD8D45FE65 CC3ds
593,896,647 *3D07006FE07E896C1D4213471F4AFDC76FE5234F C&C3F
593,896,648 *3D09F57D1C68ECF91BB69C1BB8E7BD9FD6C85CE5 Cc$3j
593,896,649 *3D0CC223E4E0F5662681CE07D63374F84E0433F8 Cc3_L
593,896,650 *3D0C53CB8E2B7C321E90A9ECD3CFE4F9699C2EE0 Cc3sw
593,896,651 *3D0F4C393347D23559725CD35512C94BC364E06B CC4_a
593,896,652 *3D06BA78B60309F9A7D878F247C108ACA20CE184 CC4Ab
593,896,653 *3D06F586F5BD14B4779C618D3C56AAD0DDA7A010 CC4M4
593,896,654 *3D0ECE6A970DA0B969E4966B605BFDDCC869D39C CC4o2
593,896,655 *3D033A8FB11119FD09FBFFCCD902F885B988980E Cc4Ql
593,896,656 *3D0E95B60B76F2DCF0D0F12008DF950A9D16734D C$c5
593,896,657 *3D06385333272CC72EE22BEB0665B6ED2FF1317F CC55#
593,896,658 *3D0B28015D0854088E600D77213F043BDD3D49E3 CC5H;
593,896,659 *3D0EDF762559EB2012FE980369442DC8D3B7557E CC+6i
593,896,660 *3D0270AF3B24CE071D164C18418C12DAD47BEF44 CC6!N
593,896,661 *3D0B7056BF61A4B3EB178D6F055FEE611435AFD5 C!+C7
593,896,662 *3D0E2E73EC9A4661E6FC2A2B55257BE1092609CE Cc7BP
593,896,663 *3D0F44117599393AF00DA6E4CA9BC98DB36D54DA Cc/8!
593,896,664 *3D03E245AA38B075833B5B1D4174F6556CDD6E88 Cc(8A
593,896,665 *3D0DD8BE8972124B4342C2AA5CF0BE99850E6878 Cc8l;
593,896,666 *3D0C2A16C0B0456162C5AE78F66D68766D431C5D C;C8o
593,896,667 *3D0FAE42FD1028D2E2E3E0F55E7B8DF7BCC675F7 Cc?8o
593,896,668 *3D075BD12C81327A1BC79155D60632545E606023 CC=8Q
593,896,669 *3D01CD69AAC3C8FB752DCCAFE5B7F735E8E6EC33 C%C8s
593,896,670 *3D0BAB325B0ADBF3BB6DBC192A618C315BCE8CEB C=C9-
593,896,671 *3D007FF38174DA7AEBC00A971A71BAC7C9E0934B C:C9(
593,896,672 *3D0ED33BC47BD1AC7DA45834F58B3D53E1FBD6D4 C$Ca
593,896,673 *3D0A8A92639207B0C92C06579CFCE67134B0359D CC.a)
593,896,674 *3D01A71D1F3858CD25559DE7375FD6FAE9E46180 C)cA;
593,896,675 *3D0165F8E250AC966FE4FFC0976BB8EBBA8DEF02 C#&cA
593,896,676 *3D01B7F74F73353DBAB5772050C236057C22FA07 CCA%5
593,896,677 *3D078BDFA3778A0947B28F224E98EC1CD3521806 ccaaagtgctgggattacaggcgtcagccactgcagacgctgctttgtaaggtggctagt
593,896,678 *3D087B4328A4C732E1AD7F86B8D1810FE688EBE5 CCaAg
593,896,679 *3D0AAE1284B74AB74D424B4B6EA9F59F082B9F89 CcA%H
593,896,680 *3D0ED8AEDD7E10ECA0DA5CDB53B5723F8419C6CF Ccampavi0
593,896,681 *3D0BB5E2233A4304E4118F5448411B6732D5E91B C!CaP
593,896,682 *3D0B2D059CF25819AF5AE6420FD0F4210E6246F0 Ccasper9
593,896,683 *3D0EE81E4C63574A0E9D0B43ABBABE9FE8C65E42 C
593,896,684 *3D0EFDF01DC11F7D707FA76DB8A9391D03F151A7 ccaxk
593,896,685 *3D0C663B430D955BF937DD4EBE56F3C2A88BE716 CcaXv
593,896,686 *3D033F9A86F82C11801D5961792A0B7ECADB3646 C$C.b
593,896,687 *3D06F25BB56C46DAC9207E0A5F93759385663473 C
593,896,688 *3D09109A30A4FFB163416C228C6C7279F438134C Cc;&B
593,896,689 *3D0DF95BBCB3094B048ED138416A6D0C2FBED7EF CcB3
593,896,690 *3D0699B6BBCB120AC85BD194E2DB33129F4C3E69 CCb3h
593,896,691 *3D086580388171D3FA76A389DA15B13D377F360F CcB4t
593,896,692 *3D07E06523EF00ECB8D9755A9023491CF2B48FEB CC:BC
593,896,693 *3D0510DF847E913B7FFA6366132ED2F59DF810B9 CC.Bi
593,896,694 *3D02879D949B99458DFE3790BF4B3C8E92FE3409 CcBI:
593,896,695 *3D04EB5CC445DAADE3E6CBA1DD8577B071E12B25 C=cbL
593,896,696 *3D01E01EF20848D0FDAEFEE9671410A909D2D776 ccbmn@yeah.net
593,896,697 *3D0F45968B2ADE73A1C5024A1B639A8BA2976934 CcBO%
593,896,698 *3D08257C3E80A556AC8C10A6D7066ACAB79EB957 CCbqH
593,896,699 *3D0EC3FF73779F5C5D61DE91DD70169CE7E0ACCA C#cBw
593,896,700 *3D0C2398974E1447FDDFD6D1878E1D2565EAC295 C==CC
593,896,701 *3D0F005E047D5CF9B07D578C2C73505757EF9CE0 C:&cC
593,896,702 *3D053028A818B0D0F76C7BF04576690EF122A148 C&cC
593,896,703 *3D0AFEA474181A7BF1BB7E896A65FDDAB55D85CE Cc-c;
593,896,704 *3D0CEC312DA31962EA6BBEA49D255D739D8EB78B CCC371685
593,896,705 *3D0C9C870A4784756F46158593FC5B38F1B2A5FB Cc=CA
593,896,706 *3D04D1A469001FB5A0DAD0F0B87AEB6270350BDB cccacaacttcaggacactcggcagccagcccacccgccttccctgtcacctctgagcaa
593,896,707 *3D0C7C8442B264EF3934A3198327F874FB0D2055 CCCC5
593,896,708 *3D0DD07BF5EB64EAFEC72E4A0AED46A697E314D8 CCCeA
593,896,709 *3D0D47568BA31E8B9EE26FDDBEA0953A95C439EB ccchiu.bbs@csie.nctu.edu.tw
593,896,710 *3D068F928B11188FB141D47A4C975997F3917839 CcCMb
593,896,711 *3D035FB59BC08CA5C3D8868D1441CA8DE62E6C48 cccm@ejiajia.com
593,896,712 *3D060D87D0912BE61909CA5668521FC85BF97127 C$cCw
593,896,713 *3D0A01D3FA05F9F0993CFC262F31228621F3C345 Cccxxxi2
593,896,714 *3D05D6EE7966EA181E897BB447FE870396E71838 cccy@51.com
593,896,715 *3D00F042EE6D79BB8523F4D1E28195E69395531E C$C!d
593,896,716 *3D0FE23BA78C2FFD4B6FB6B29316C8E1BAEDB813 C-cd+
593,896,717 *3D025FCBF85B25B591CCC4BF1EEA0972954C2C34 CCDEj
593,896,718 *3D078EC12C0E421198D9A3D7A8A8585BE754159B ccder44@aol.com
593,896,719 *3D07C7602153825909C5055C7D9FECB9D6E48046 C.C. DeVille
593,896,720 *3D0F47A320691C6A314F5F74B9DA5524BD1543BC Cc/dr
593,896,721 *3D03BA097E245B4AB7C696287459E64158876216 CcDsO
593,896,722 *3D097D0821E87BE795A872C89621CC73739D3498 CCDYM
593,896,723 *3D093E1C401716424EA9F02DC44B9941EE64A158 C,Ce
593,896,724 *3D09DD7BB044565E694EFD37ED8FD5A169CBE7AA Cc$$E
593,896,725 *3D03D8E80DF8A5C6E50749A66EB8B74921C3A1DE Cc;e(
593,896,726 *3D0C08A7A9EB3CB6ABC40E8F329FC0EDC707EFB6 CcE)1
593,896,727 *3D06610AD82DB1C69ABEDC997477888654CA53A4 CCe;7
593,896,728 *3D07B1EEB59896B36543F99A2F27E8574A368550 C/CE9
593,896,729 *3D0526D2697441FEF4737ED814147F9B800D0E14 CC#Eb
593,896,730 *3D0C83D49318F53DAFA51FA98F95B14875527F24 Cceb"
593,896,731 *3D0FF180789BE183D0E6462454736AA54F3D5A9F CCEf)
593,896,732 *3D088EEAFDEB810627267391B05FD76063195ACB Cc%ef
593,896,733 *3D02A00B72150B07AE5F9AED27394A5A29CE853C C(CeH
593,896,734 *3D0D95C643E576FEAF873551EF34335FFC556834 CcELo
593,896,735 *3D037ECBC2CD4FFD2E456B3FBFB6ECFBF08C3986 CceMd
593,896,736 *3D094C559094D87D76C5457BAA4FF53D39A66682 CCEN-
593,896,737 *3D0B6969766E271746C062C41105C033D967BC0B ccentrydoor
593,896,738 *3D04CE30D2D93D3B4D240F482F01937EB0745DDD CCESSIES
593,896,739 *3D05350A427F7E59FDADFF58EE401F259F5A18CF CCEuo
593,896,740 *3D025B4948CAD75D1C06FFC5A4CB91C475A6B2E1 CC#(F
593,896,741 *3D007A658FEE6808816B3DC5D265068BD0070620 CCFan
593,896,742 *3D07657A0BB6E2B13EAFA5AB314D414C84CA1D03 CCfeo
593,896,743 *3D0A87791F6FBCDADE86C5488DDB3082FF08426D ccftc
593,896,744 *3D05A396F42AF34BEA9626B76CF866844D517FC1 Ccfwo
593,896,745 *3D0983D1F571097131E9018CB2AB657DB0738CCC CcfY$
593,896,746 *3D087F62C3DB5C631D8D971F2E6D0B2893F7ED49 CCG(キャラクターカードゲーム)
593,896,747 *3D0B738715708BDEED994B75626360AE04D9C414 C&c&g
593,896,748 *3D0773D763DCB1CEC9A24BA7978C76843FF2276D CCG2n
593,896,749 *3D0D40E9A0E29624F413159E2CE2E87F43EF7D70 Cc%G8
593,896,750 *3D01DDE6B407BC8F60A130E1C8F7E2D66B1E7706 CC-gc
593,896,751 *3D0F854EFDC838462F3B5019EB04A9319D691639 Ccgqg
593,896,752 *3D0876B852F4D6D10E6C65995D6AAC3DDE9F584F C#:cH
593,896,753 *3D09E60A5F4E963DD1F9DA01402D115A042138FF CCH-A
593,896,754 *3D09D1AC5D18C91026AAE168C4848E3D2533B850 CCHbv
593,896,755 *3D09ECA6062EB3CA5002E513C67E119C7BADC89F C"ChG
593,896,756 *3D046D4D069756A742A0E4F9002B26B85023460B CChH2
593,896,757 *3D023A0C5740EDDA291508A90AFD8B81B0F9E443 CCHLA
593,896,758 *3D0E8010451D923650CB8CAC0032462EA28959A7 CCi3e
593,896,759 *3D0C21B81C9416A893BE06ADBEF33C5A12B7E1F0 ccibeqiano
593,896,760 *3D066010C095E3CA35AB218D04E9DC8A919E1583 C+CiL
593,896,761 *3D0A094C2E2931BD54E7AECD975BE2709DD02C88 cciogio
593,896,762 *3D07DB01858493249A1474AA784027F91A33A999 CCi:V
593,896,763 *3D010A79DE83AB04D8335ABF744EE161AB3B20EB C%CIY
593,896,764 *3D0550C8D8E31FC35CFB2556A9E12FFB68199DCC Ccj==
593,896,765 *3D0E380BAF94CF3CD375703475BCC02859D316E4 Ccj:/
593,896,766 *3D020A982B778A834D87B87C57CF57D787B627AC CcjEC
593,896,767 *3D0751E2D0B398A588F0B0C2605B766ABE77D232 CCji2
593,896,768 *3D099D6CD1788C8A7DEB777561D96E9E8E70F4F0 CC/jS
593,896,769 *3D0386C00E2319B25BED50312EC007AF4682FF2C CC:$K
593,896,770 *3D0FB80796C620EB701EBB9DED7A085A5B489B64 CCK=+
593,896,771 *3D00BD3B0BD969805A442A7124F5B216A30098C1 C//Ck
593,896,772 *3D077178BB4C68E794F512F95069D82582470AC3 Cc)K2
593,896,773 *3D0511249A8E7CFC573AFF1402D7D43357A8A2E4 CCk2b
593,896,774 *3D0000C4E2F23A8E581D202C7E6725E44E39AC3C Cckcrwses
593,896,775 *3D0A8424657733F6075269C54FE446AC01E37A17 CCkF6
593,896,776 *3D035F2F5A8370DA3C6611AB4D1F1181BAFF0BED C+Ckj
593,896,777 *3D0BCD7427EE97B355F7C766FB934FEDA3A20123 CcKtR
593,896,778 *3D0866FD55AC9F24E65513C83F569FE2A8B570AB CCkZk
593,896,779 *3D0AB2432366E8D763F02FEB774DCB17C0025BE4 C
593,896,780 *3D064A095C6FEF604EAAB7FAB1F40DFB2900D1D9 CC,#l
593,896,781 *3D023B6D5C7462BBDD371C8981DB9BA1A17B334C Ccl)=
593,896,782 *3D09AD1CC4D8F1BA272DFD5125D24FC23966D26F ccl0410@ms43.hinet.net
593,896,783 *3D03615A5B823FBFF54F3481E887C2C8727AB973 Ccl4F
593,896,784 *3D0152CA15462A8E13A6974C844980931911B64F C"CL6
593,896,785 *3D06973D4572C8A215DCC28A3F122EFB64FDB98D cclark3975
593,896,786 *3D05A9D4469CD0BB158B4F4C46DCB3FF629826A8 CCLAXBABY010
593,896,787 *3D0794130F43699957528B5265CF8BDAF2192B7F CCLB1
593,896,788 *3D099C39991681A911BA7AA9FB4229287A7592CB CCLBk
593,896,789 *3D068AD9A655E32380B9D928A78CE723815589E2 CcL;d
593,896,790 *3D0CD03C0E5A6009B8C2D31C8787AF20FBC25427 C+cle
593,896,791 *3D06EB9AACAC5DC85E327520D890670A8151EDA5 CClvQ
593,896,792 *3D047AE84476400D79B0BAA16AE0CDB104CA6F27 CC((M
593,896,793 *3D08B5B43193DDCACD42C037E8880FE8E52E56E3 C=cM&
593,896,794 *3D025D2C9C44B4E96B5ED0731AE77F2B7AAA307F Ccm%6
593,896,795 *3D0C2249A3B4A6C9E4A06D6FA5C6FBD91FE44C0C CcM8h
593,896,796 *3D09F2133A24399CBE5E098DDA2D3E3E8798379D CCMd%
593,896,797 *3D0EFE0E5FB0B65683791F5CAE713FEBE533FE77 CCMFi
593,896,798 *3D02BB1E46415D87A48430BE131B576BB61E2AB3 ccmgt
593,896,799 *3D0C9E1749105404135C5136B7F6220EB5C57E6D Ccmplssnt5
593,896,800 *3D0D56210B30937DB5AACF653F99B2C90E0B3D94 ccmpnmnt7
593,896,801 *3D04C1BF67AA024B9B93EB54B1843712A0B5CBB0 CC!mQ
593,896,802 *3D0D19E7290121B6E0B02837C7EF23E5D568C689 CCMQr
593,896,803 *3D0B6F46187B35D23447C2406321EAE6501A8B42 ccmstls1
593,896,804 *3D0A194236A6CCCAAA3BB150F21545AC2E358F88 ccmu1
593,896,805 *3D09E98D66F91BB3738B4BBBDB07C437FFBFF8F2 CcmWh
593,896,806 *3D07CA0F222C11BD31693A84ABAB2572078E0D2D c:CN
593,896,807 *3D040C13C9AA58774C0323B45F628E58D3DA23FE CCn2w
593,896,808 *3D0877410C99A835279768AA39EE9C11D0446DDE CcN3?
593,896,809 *3D045625230606BAAF0362B838F45017D0A5EC2D CC:nA
593,896,810 *3D045B14AF04B0BC76586F2767C928604443E35D CcNbd
593,896,811 *3D05675972481717C5D5684D3D0489F7738AB012 CC(nc
593,896,812 *3D0840682FCE1E144FDE4E28449FF5E058A46116 C,cNC
593,896,813 *3D0DFEC092F1CE03109DE3FDAA6F75C12C166ED8 CCNkO
593,896,814 *3D0EA57172E57CAB18E394D4A15799AB7BCD714A CCNOV6
593,896,815 *3D04A743725BE0A2EC937392CB7B50D80D77AF54 C-CNq
593,896,816 *3D0D475C9ECA36069108088C39AC2D4A41952C9D CC(nR
593,896,817 *3D017A38F0BE6F5903AEC863B69884248383BDCB CcnsQ
593,896,818 *3D0AC17D8EDABF73B349E6D605FC7AA1854D7B10 CcnuS
593,896,819 *3D0B02DF3C65E534E2B61D79571639ADD7C1D636 CC:)O
593,896,820 *3D009407439C0D0A8CC6166C64B865BAA10C2214 C-%Co
593,896,821 *3D067C41B33DE949FBC8FD6F2CC23911751761BB C#C:o
593,896,822 *3D077B83030FCE2D9C7617826273F5B1E5118284 CCo)-
593,896,823 *3D03C6B39FA512C9F756376915461295B85F854A CcO,=
593,896,824 *3D044EA40A76F7A11871016028E78DB5BF5ADBC9 C#co!
593,896,825 *3D029AF7EB290CE8AE1C9AEB14323A20D5E96297 Cco+;
593,896,826 *3D0439CC9B9804E1711A14928440B82265293EDB C$Co8
593,896,827 *3D026D63DB2924E209D85BE3FE41132CCF94DA86 C$cOa
593,896,828 *3D0EA12EB451EAD2979EFC1FD04D77FC496ECF32 C(coB
593,896,829 *3D06EBDEFE71ACDD75903CFA6EEE7AC640174E34 ccobb1
593,896,830 *3D053D694C3C04BD7BED5C227232F65D74666CD5 Ccoe4txqpqt8t
593,896,831 *3D0865BD4C85C0CC1418056A028D6146DE3A9F56 Cc?oG
593,896,832 *3D0F6E6158D31AE4BD71511760BF86B0ACC65EE9 CcOi#
593,896,833 *3D08590AB19E7DDAA5093F193E6E04390C779C58 Ccollpapata
593,896,834 *3D0D8841B6840EE6EBDA810F62092B8617AA2842 CC+Om
593,896,835 *3D0FE9E3496C37E7A2CB3D85A888771752322994 ccom@mail.c-com.com.tw
593,896,836 *3D0B700E52D053C2EE0D3AD645C3E897A7425B84 ccomp2075@aol.com
593,896,837 *3D049FDC1B1179C8E612E20F89B635C393B64176 Cconsider2
593,896,838 *3D0F62000705B2FDE704F4E4C2F5C4375C091DCC ccooke2681@aol.com
593,896,839 *3D008DE4FE47D574D91464AFD09D55AEFB86030C cco@pipex.ltd.uk,
593,896,840 *3D0EE37C2F6CFB774BB122AAA0EC315575541CCB CcOqh
593,896,841 *3D04A006A181AAF6B579EA4E396F98BD035856E5 CCOR3
593,896,842 *3D04782D657992C496CE4D58F93A3907C58B338A ccorey3060@aol.com
593,896,843 *3D019C0611A287FB567BAAA715CF8EAFAF1809DB Cc&os
593,896,844 *3D07AC0686E3BF3EC0C9611A87E83F7E00B327D5 C?COU
593,896,845 *3D01599BD27A891574019C0D2F609E60B465E2DE ccoyoted
593,896,846 *3D0D25E6A3D8F93DC999F529D1EA3C7262488E48 CcOZ=
593,896,847 *3D0C4B31D60CD9BD8337E46F7AA8ECCF72C70727 CC_P_
593,896,848 *3D0C9A9DEDA27CD56EB6C6F8FF66DF9A0A92559B C?%Cp
593,896,849 *3D010208D073D1A5536870B44C659C874642AAF3 C-c%P
593,896,850 *3D0BC9E23895E543BCD095C99AC680F3DAA25BEC CCp6v
593,896,851 *3D06F14369E9AC4B08364AFF3C7B7D669CDA96DB ccpa@email.mot.com
593,896,852 *3D040B1E875F55FE0256B796F913D81E2A937D02 CCPcd
593,896,853 *3D05FBE6E76278B18C2A6318F99B1407BA636F23 ccpl@hutchcity.com
593,896,854 *3D09C34B51A53ACE0BE00D0ACAE79F8CB4B54F2F CCpWE
593,896,855 *3D02B81F5D1290F00EBEE35ADD9D5C34883D105C CcpwR
593,896,856 *3D056F66C2D12192F0E8D00EF6BC8966F5072C86 Cc";q
593,896,857 *3D040EF0B2F51FC259493B3B7E4858473F140B87 CCq2U
593,896,858 *3D0E06DCAE59F01BD47D77B381F593217270737E CCqcf
593,896,859 *3D0C3D55C3F0F4C3CF1E9D058073E19A1C004C1C C,CQm
593,896,860 *3D0B1CFF7326775BEDB23832C1F2296A9022D424 ccqpy
593,896,861 *3D0781C326BBA27EED2D00B3ABAB7645455FEA6F CCqV%
593,896,862 *3D01E4D196B0B86071EFCC509B22DD199C5FAFF2 CCq&W
593,896,863 *3D09E5FBA5B3FB12971DDAA6890E37301E139C0E C(+CR
593,896,864 *3D017C1B31D8EA44762017DC140C7B450A51246A CCR=
593,896,865 *3D00FDD5FBA3EC0F998E33473348B72773F13FE8 CCr>
593,896,866 *3D06FD13F2A4BF745EC34B0BC16705AD2E91CF8A Ccr0j
593,896,867 *3D0BFC1D43319C2EA5FF255F52C41CB9B12FEF4B Cc$rc
593,896,868 *3D0487B60884DD1C87BF99C12EE1AD996CE3ABA9 CCRCHNG
593,896,869 *3D0AA957096C14B41678054FC0FBD5137AC0C5AF ccrcu
593,896,870 *3D07AA31949B393BE36DC8D45DADA0CAB11CDCFD Cc?RD
593,896,871 *3D01810DF443DB61742B2D643C417D403ED68066 CC_RE
593,896,872 *3D0157EA3B2D8596A87E7ED49F44B1E50DC230AC ccrénin
593,896,873 *3D0BEDF624D6BC764E414E6F8400AFC31B2FF07A Ccri2
593,896,874 *3D07076EC295558FFF07D09511A80D7624EDAE52 CCRIj
593,896,875 *3D09C964814E2F87F543F93B7E70C096B918F24A ccrow39731
593,896,876 *3D02CFA651895FC98B432EE9B649ECC32F3AC548 ccrowleied
593,896,877 *3D03AF844C5CAAF5AABE88B604CD529C29C7F63F CcrRV
593,896,878 *3D01778188D4A01C43C37075F612B5EA6019BD9B C)C!S
593,896,879 *3D0B9B6F2F708448A827EF81B38EA947179D29D6 CCS1$
593,896,880 *3D0361E193B58C6258001678182BC3169D6E66F7 CcS1&
593,896,881 *3D002B2D36619E7B0AE742D9D774951FE69AEDD2 CC,s7
593,896,882 *3D08810EC6E37AC70586648E249DABB31E042AE7 CCs
593,896,883 *3D090ACAB2D8038B1D464311F28AF978ECA5948D CCSANLUIS3
593,896,884 *3D0275A5C5599C28A343D330AC4679D7C91D35DA Ccs,C
593,896,885 *3D04BF983F3933AE36D05FDF7B5836FF3AD45096 ccscdo
593,896,886 *3D010120C459690AA9CD6542D8061B576ABB172E CC'SCOFFEE
593,896,887 *3D0330BD4541501582FC33DF351C9496B5A7C3F5 CCSdq
593,896,888 *3D0292C56E7DD4E78CA495287557D9541B622C0C CC%sg
593,896,889 *3D0FE76E997AE77A17EEAB43173CBA4DE8E8343F C!Csi
593,896,890 *3D0EAD3BB42EE0B7C4956B515855E3AF11D16EDE CcSn7
593,896,891 *3D05800333B643489AE0D798E83D53987BA27EF5 C)CsO
593,896,892 *3D092984D4AB4EA5E30AE38568A0FE672D0B5197 C+CSP
593,896,893 *3D0A0560569819C43CB8602713F7F65F82FFA857 CcSP%
593,896,894 *3D021E04B5348FA53DC6EFC47F388577575A9C7B CcsSp
593,896,895 *3D0C77D6E95597AD89D5E49CCA5F1D80CCB7A572 ccswz
593,896,896 *3D070B4F55A8B907754C721A5B6E20C6D4CFC46A C&Ct_
593,896,897 *3D068D2C38CD73F94E3FAF161C859CA0F94D64BC C(c,T
593,896,898 *3D04B009C2BADFBB0D1D41F043C3846CEFE8DD1A Cct,2
593,896,899 *3D0FB37B19E8A230B38DA2ACA64B2AA33A3776D9 cctes@yeah.net
593,896,900 *3D04D45A2E99E36DCE0E56F995A09ED0ADA3A941 cctgtaatctcagctactcaggaggctgaggcaggagaatcacttgaacccaggaggcag
593,896,901 *3D05F8ECA6E361FA75462C90015A30B4022FC2F2 CctHG
593,896,902 *3D0F2A0627C79F516591C481CC2EFC18D3E9BFAC C#CTl
593,896,903 *3D0D9324B786B9355DA41C7F677169C9EF8D38CC CcTT8
593,896,904 *3D0D7612DBE3813DA368C15393A48C9A3FC6E8D1 cctt@headwaters.com
593,896,905 *3D01590BF33B15701A7363FAABB707EE6CF764BB cctv1363
593,896,906 *3D0D6291D575C71590F484E9FD532F44F20A7070 cctv@canada.com
593,896,907 *3D04D62F9ED3447005EC9CC16197F51D7971A795 cctv@public.sj.he.cn
593,896,908 *3D05EC0EF04B28ABF2A55C78B1CABE22EC37CCCD CCtw:
593,896,909 *3D0CD9137F30FC5BDFDE48D6D1506031E0130C28 C"C)U
593,896,910 *3D0DA883B87D20C3AEE931FE271486947C80C609 C#C.U
593,896,911 *3D07F564C00109BA2B56A57BD5DBEB3D3FBF7B3A CCu)_
593,896,912 *3D06686C1EB114837FFDA78FB3DA10035848C63D Cc&u6
593,896,913 *3D06C59BC39F50656919BD6C86E96A8DCC92F894 CcU.g
593,896,914 *3D08FD6C2DB4F8D2BF628E429AC54B8637212875 CcuG
593,896,915 *3D0ECACB92C1DC29DDF0BBCCA8BBCE664078A3CB @ccultur1ze
593,896,916 *3D0ABF37F592A1D9C8E1D039F49E672FC4D18A79 CCUpV
593,896,917 *3D0FA352548636305FDBA1200C1EB994E00395FE CCUTOFF
593,896,918 *3D00854A9A43B5663974F5F59FD18AFDDA084631 C
593,896,919 *3D0B749125DDE36C0EB1FADECB5F9917E41E9245 CcV-,
593,896,920 *3D0A00B9FB261FAB3AD17443A60B61C677251C08 C_cv0
593,896,921 *3D007F3A752E86A1FC109ED8887D4EDAFAE1F843 Cc+V2
593,896,922 *3D05CF7382E7905445CD47FA269C6C847D06163E CCv7)
593,896,923 *3D06A123D535B052BFFE3EF04F689741D4F7BB88 ccvars
593,896,924 *3D0BD983EBA32113268FCDF76630DEA2AF8AC80D CCV"I
593,896,925 *3D015A7834D63DCDECE4F672078F53230E69B5CA Ccv&I
593,896,926 *3D011BB96027640D8E8F88CB730A3F0293E86608 CcvK)
593,896,927 *3D0A5DAEF97B9B3BC0EABF7A7C888FFF26F06175 CCVLV
593,896,928 *3D0ACB7A039DA3D87CFC44DE4989ACAE3A2E9EA0 C"CvN
593,896,929 *3D0272F377A994E7B78B13C2F1DE467E152312CB C-cvp
593,896,930 *3D0605BEA801F3A6F841962F2BD379FC702D9AB9 CCvpX
593,896,931 *3D03E3BE4C0D33E754CE7660E7B9587E7CB84CFA CcVqQ
593,896,932 *3D01BBC39B623163EE26C8E705F6D82E25EECA6E CC#Vv
593,896,933 *3D0202B8A850C3CC52F2D25BE59031252B7A861E CC,)w
593,896,934 *3D0B2F85E90C8028526747F3578FD4AE01EB6B11 CCw1"
593,896,935 *3D0DB1B08497D32542AE84A6BDCF5C97F4E86F66 CCw9C
593,896,936 *3D07D79C5A4C934002FB5B401BC663643B044B53 CC&wj
593,896,937 *3D0B0751DF7BFAE5CCD2DF5448E27EDCB358CC17 Ccwno
593,896,938 *3D0EE5B36BFF0E99602B4FB26A73A84A515C683E CCwR:
593,896,939 *3D0983E27C9639D5B7B793B8E849FD330B270762 CcWWk
593,896,940 *3D089BD61A6806143214992E4C023B903649BB25 C=:CX
593,896,941 *3D088866E27FD53CC9B24FBF838FE2DC32F47FDC ccxaslicggc
593,896,942 *3D015440A34213A9492EE60AD7DF749AE0DB5D49 C&CXP
593,896,943 *3D0C36E798559880435023AD8ECF2665500FB4B7 CCXRA
593,896,944 *3D097BB96427DE2E196C00485510C0BBAAC5B9FC C:CY/
593,896,945 *3D0DFF82663165A751266E32482EFFBF76194A8B c-cyachts
593,896,946 *3D0B3DED1E5428613FDA0938DCCA0F3AA39C68F2 CcY=c
593,896,947 *3D0AE7F685E770246AF767DE44FDBEFC5C2AF3CC CcYCe
593,896,948 *3D03FC52F944F361C9F841EC972E8BFF377104D6 Ccyclema2
593,896,949 *3D0C46DA455BEE2AA2138FFB45EC46961B5C74FB CCyH
593,896,950 *3D0517C96D71032D0B2368883FC3DD944BE1023E ccylong@371.com
593,896,951 *3D0F47D9D0C9599ABAB282B013E582C1E435346C CcYmM
593,896,952 *3D0E8A83AB0CD59005020E34B619B101F9997F39 C;cYr
593,896,953 *3D07C4D0BD5C5B8A9A7105EC9CAE558755416A97 C#cYu
593,896,954 *3D0ADF13B30B8289EECA033A0850CE1D004E38C4 CCYvv
593,896,955 *3D0A1923E214A456FACD7CD77BBFC7B060E77B19 CCZ";
593,896,956 *3D02E241D82D07249F48E5D24E28848F29C1FA68 Cc=Z
593,896,957 *3D01CCA25E5451D0146B68539A4D737387BF0685 Cc-Z"
593,896,958 *3D02D53090A814AF12E681EA890B5323307C7D4A Cc!ZC
593,896,959 *3D0B739F2690DB14C67839DB2CD07772BCC46212 C=cZd
593,896,960 *3D0885EB75B0640AE9AEBA4A91DA8FBA96C8674A CcZo1
593,896,961 *3D0D6AA7C91EE6A137970943EFB6FF531A079D4E Cc=ZR
593,896,962 *3D02EE09E15E8628D9C39E0AC68DE4A97C0D9D46 cczugek8
593,896,963 *3D0CF6C22051B0EB95FAE326A225E833DB431CC8 C=D=%
593,896,964 *3D0A1A972C73B24365CF688F66979F5DC23729EA C_$D;
593,896,965 *3D051F165FE1B99AF5EB4AFED1653CE4A15C67FF C!!D
593,896,966 *3D09B068A839615C8ED7AACCC445E0ED73831206 C)D$
593,896,967 *3D039C749DCD5BD329B944EC0EF5ACAE9C870174 C$.D$
593,896,968 *3D0991E4425FC8AE9B4B644524782EE3B49D1779 CD-.
593,896,969 *3D0343EA74B8C0D21D212BAA71F7C94C01A108F7 C-d+%
593,896,970 *3D036F54D1567B7BEFECAEFD8CE28FDF93538795 C:-+d
593,896,971 *3D04105060943674205FF7482816FF0FF3B97B07 C"_d:
593,896,972 *3D063F19E15C889178DDB0871196682E2151577F C$"d$
593,896,973 *3D044BEB828645DD31C232777209C3E4B9AC580D C#:%d
593,896,974 *3D07CC07563A19C41EE7C2C0F13A7DA8E32B21AF C%#&d
593,896,975 *3D01C48DFDDBB127582EE8242774ED649FB7400D Cd!-:
593,896,976 *3D0A39790A384F81018E35E5AE712AF032810E72 c%$D
593,896,977 *3D0799B728180206DE7F598E9B54FDB1A35D7C23 c!\d
593,896,978 *3D0F75D4E7C4BA68EF1152127AAEBCA1C283ECC1 Cd.0$
593,896,979 *3D08E9DAF1B7FE0A071CD6DF5BCE07BB312EEF5E C_d0E
593,896,980 *3D02EA6A89591EA15E7C73F6EBA4802406BDAA36 C.D0f
593,896,981 *3D02AFBA3D87E3BC3F779DF48C31057B289382A8 C!d0g
593,896,982 *3D05910B9645C55D4AF3BFB536E6F9882D012E53 Cd0HZ
593,896,983 *3D07E3AE67A776EE00B7C4AD5465505A3D3FB12E CD-0i
593,896,984 *3D0A231922A11BBCCE482A690069877DEB154855 CD0kc
593,896,985 *3D08FDB5F542CF7B6A16F2CB283B8449A2F95ED0 cd0vaaaaibaj
593,896,986 *3D0925B984D1B2311C0365D7B532B33D63B6F6F8 CD!11
593,896,987 *3D0E3CD30C10D25D33450F5E57CCCDEEA4BB2E4B CD
593,896,988 *3D0398EE03888FA299CFCB5444E8EA06C0E60195 CD/1f
593,896,989 *3D025D1467486B54686E0AA41F997F1641D31A3B CD1;g
593,896,990 *3D028CFE961CF031BD7EE704FAA2B137668FEEA6 Cd1+h
593,896,991 *3D03B4CE43E029D738A1DADF723659DC2B2D33E1 Cd1=n
593,896,992 *3D06FEA91F9A3F2645CE34DDA0CC10E6CC4DE674 CD1uo
593,896,993 *3D07A84867FF0E8F475FF36726BFDA12E2E5F0F4 Cd(2b
593,896,994 *3D0F66DA1505AC9E157D2D6DFCA7EE47CF2FB352 Cd2cI
593,896,995 *3D0D61CE614C9FA8C81285EA2AEC95B75CC85838 CD2%k
593,896,996 *3D0363A8AC851FD2121EF2E0F547AC7EEF16C1B8 Cd2l!
593,896,997 *3D0502D102DA197075B355AB836672B5B98102A2 C_d2q
593,896,998 *3D062A45B8E255BBD60B8BF2A7F6AEE5E2780DAB CD2T?
593,896,999 *3D004640162FAD079DEE2791276CB4EEF5548FB2 CD
593,897,000 *3D07E9DE6A2D69B6DEE4A48C20F39F874BCB6FC8 C-D3
593,897,001 *3D0A40AA0FAD7E3F59111368680DD1D86D5F5389 C?D3-
593,897,002 *3D060B0DD92A11564F2722B2D74A6026D0926BAF Cd3"
593,897,003 *3D09F11D8EB80EE73FDB431550A1ED20932EBC86 cd3040krag
593,897,004 *3D0F59FEAD95897AC9B02F7210EAB1EEFF32B199 cd30d3ae-283a-3762-ab9e-3d67ed5dfeae
593,897,005 *3D0A5850183233487A2918DCDF708A51D358B6DD CD33Z
593,897,006 *3D0C189B1BF3D7352D2340A0DD14009CE4EBB04C CD3aP
593,897,007 *3D0EAB332EF6ED024932836226D30893DA3D5539 Cd,3I
593,897,008 *3D0BDD9A7457FC861E5722DE83B469C13D5F6880 C#d3i
593,897,009 *3D0F9B3E208979AEA5FBB93C2575A92CB9EFE0DF C:D3M
593,897,010 *3D08CEA38D7A41DD70D1A5F0354C33F1ACB92964 C/D3w
593,897,011 *3D0FDB58F3303B5C94C64F8F0E764CBE1971A1AD Cd%4%
593,897,012 *3D03620D07748DE31F7447BF882DF479DF01BF52 Cd4Bv
593,897,013 *3D0996C323D4191988862040378C81B6B4C0F318 Cd4cN
593,897,014 *3D081822382CB7A8A9518D3F4CF191B095D6B4CD CD4H!
593,897,015 *3D09A8DC0330E4839F0584F01026C1A7741992EA CD4n_
593,897,016 *3D0DA8A886875CBA852D2A089AC97E3945257138 cd4u@163.com
593,897,017 *3D0C4FB03A50E35B6D97C500A4621B9B376DFF87 cd53d4
593,897,018 *3D0665CC4C5F86BC8EF9007EEBFBF7722991F45E CD54E
593,897,019 *3D0F210FB4859139398E3A6C03C377ACFAE52077 Cd5An
593,897,020 *3D09E575885973BBE264E88459313F25DDAAFD77 C,D5G
593,897,021 *3D02C6E205FA480B215A6D53E898BFDD6526F388 CD5i#
593,897,022 *3D07065B468D557FD848B9696D37A9F9FD1E70EC C=D6
593,897,023 *3D0A3B9EF389D03D38EF15EA0E54DCE32A480F5F C-D6a
593,897,024 *3D08A8ADD2A835289A75135D5398DBA7C79DE4C4 Cd)7-
593,897,025 *3D095A55411AC40982E02DC87A0BA789A71E124B Cd&?7
593,897,026 *3D05E10E45FA3A892DCC8B364CC5376EE1EF0B77 Cd7gI
593,897,027 *3D0704E06C4B20B031B1749E2602EF729B5088CA Cd,7h
593,897,028 *3D03653A98C095BAF4E3E38D740CA4587236069D Cd7,T
593,897,029 *3D04DF91134FFFC94B6F7F6535AB73B6C0B80075 C:D8,
593,897,030 *3D00C1360C986766637D12418F3512EED32A92D8 Cd=;8
593,897,031 *3D0F14289A5D4030211F2B1DCA69E790B1F27414 Cd8nf
593,897,032 *3D075852BFB24596F219A8F00AD61891FD9182D8 CD92U
593,897,033 *3D061F165FC5AAA64ED72399473A40B985D370FC CD9d1
593,897,034 *3D0F6C4705EBCFC1205A07E495E1C374929D582A Cd9&K
593,897,035 *3D002338FDEE7CE337E616A92E2275250B220021 CD!9O
593,897,036 *3D0317BDB3B15EF18738874F48631A5555A4D0F4 CD9vg
593,897,037 *3D07ED9BA28AAF3AAFBEFA52F20A7A11BC74684E C)-DA
593,897,038 *3D04E4D04AC9D7249010E9994D9F7E13E5D0562E C;da
593,897,039 *3D01D351D497DE8AD04C141170E60BF9D2DF2466 C?d(a
593,897,040 *3D03A2BFB7B7A81F931619D0756B5C82D72D3116 C.da#
593,897,041 *3D03672A2A7970BF01FB521A908F52DA3C1583C3 CDa17
593,897,042 *3D0BA68398E3100165A79ECB75AD70EA2BCFF8C1 CD;a2
593,897,043 *3D071AB0481A2B995966A9C1B3122E722D412893 CDA5R
593,897,044 *3D0BB67EA8F6D96525CDCB6A4E86B13934123DB0 CD%Aa
593,897,045 *3D03E7B6A6571DFA0758BA5A958599C13DD25B64 cdab2754-6fbc-31ed-9fe6-d5847a4da86c
593,897,046 *3D03BE85E2FD1AD501B9ECF97D5FA4B074315723 c.dadbidda
593,897,047 *3D083F4EBFE8EF0C59F7CEE5915C4D90E28710B5 cdaga09
593,897,048 *3D0B64B892E226DD3B175E365A841E8044B94D67 cdaiber@aol.com
593,897,049 *3D0C1C46D465D18CDD2F9C42D2AE6B85F73CBF6F cdaley54
593,897,050 *3D08F027F4DB57F961924785312A2F4C3577DA1E CDa&M
593,897,051 *3D0885CACB9E3C6AF8280C9A40B18754624807E0 cdamad
593,897,052 *3D097509053DDCF073ED9DEDA286ABA06CF38F57 Cdaminims
593,897,053 *3D0A9287FAB7FD6C2BBE9DDAAD0AF57121D8CD9D cdapers@aol.com
593,897,054 *3D09F4190FC7504D4A7851977A08945A97E726C8 CD.AR
593,897,055 *3D08F6FC64546D9D4A2E36EFFF5FBAE6BA7C0BE2 C+dar
593,897,056 *3D0C9D2DC9937622A2FE1B0C60D92AC732C524B5 C?D.b
593,897,057 *3D0153C4165F4DBAD99976C3D5B4BF1A30EAFBF3 Cdb0E
593,897,058 *3D01AFAC2163F8A37D4B534E2C6AED4940BF44AB C=dba
593,897,059 *3D0C3A0DD48E77D2A415FF52CD70059596ED65ED cdbh@sinagirl.com
593,897,060 *3D0393E950860E4CA7A83E7A5EC4E3020CC151C3 C%Dbi
593,897,061 *3D09CB14CD28E1558E227C0C73F7EC568FABB3CF CDbi&
593,897,062 *3D0B4AA0419031CD933EE6CEF0CE6B1E5AFA4A85 CDbiO
593,897,063 *3D0DE29BE42E9ECBE6916A7CCC03ABCCE1B1F88D CDb=K
593,897,064 *3D05DCAFFC5F0B890372D98FF093322119B9C871 CDBp1
593,897,065 *3D06DB743B53A5305C877C6DD80F131F29856AA3 C&DBS
593,897,066 *3D03CEF1084394CCECC29AA3CF52EC33EF89C12A CDBSG
593,897,067 *3D05CE02E83F6B48443093E592D7E90AADB57670 CDbT1
593,897,068 *3D0ED317063A06DAC63ACEE3D20B129CF89CF3AD CdBT6
593,897,069 *3D0D6E9D9D7A6AAEAC0B196370DCA9DB5C9FB8DA Cd+bV
593,897,070 *3D0507B33F40F3ADA7F2EF2D55D52093062CB6A0 CDC/-
593,897,071 *3D028C1BEC6B9384BA3CADF9219B16A7FC6414EA CDc6P
593,897,072 *3D063E1C748168EF8F8987923B9995B766DC9B9E cdcan106
593,897,073 *3D09630B94E8A14A7C54337A2839CA2B7D95DAA4 CdCiT
593,897,074 *3D0486490E48AB915BBA5CBD768E997F20270443 CDCjM
593,897,075 *3D09A79AC63323BDC077BB38E811DBC6E23396F0 CD)CM
593,897,076 *3D0BE1410B951D0F1B633C8CF3354DEFED4CEDA8 CDCqu
593,897,077 *3D05532509972FEDA77048A1910E2D0780008FCB C=d-D
593,897,078 *3D0F5CD8DFA72F53CD32DA58170699D0A6DE6B33 C(d(D
593,897,079 *3D0DA8D6F7FC98C4AC7833FEFCCDF8CB2EE415C1 Cd=/D
593,897,080 *3D0698C8414699C61430DBEE85F8B4D752F6EC3B C/dd!
593,897,081 *3D09C148A5DD6BE347C8505C175CFF254FCDD728 Cdd=_
593,897,082 *3D0CC1A6D0704520988E90E332C18FBA60B1134F Cd=DE
593,897,083 *3D0E1715544786546BAAD1EEF200171882C24F7D CDDh5
593,897,084 *3D0AB33F3E604C87D85B305CFE4F47D251261372 CddMb
593,897,085 *3D074629E16E3C24F41AAC315BD24623C1D71C8A CddN%
593,897,086 *3D063F994A5B6555FA01D60C143A4621259BB03E C
593,897,087 *3D0F08B322C9E00B5E18B2E2D54307DBC5B07D5E C?dDS
593,897,088 *3D007838A7AF0280EEFFA389CA9330EC61ADF5C7 Cd
593,897,089 *3D01F729E3559B155420D63E901AB8748BBBE589 C=De7
593,897,090 *3D09E6201C19E2718757A69976EE5249CF81E079 C?dej
593,897,091 *3D0AF98C76168F2CD925A8592FC87CB8A51F08A4 CdeMX
593,897,092 *3D0DC3B40F7EFBD1790326FE96A7DD1B780D8803 cdentt@aol.com
593,897,093 *3D007DB40EE8BBA0639AF92043D9761B83AF8813 C%DEQ
593,897,094 *3D0F787A74AF405761E1A3EEA6EF03811F94B20E CD/eQ
593,897,095 *3D0D1D50B2025CC3705B2B1695884AC2F3CCCBEE CdEqK
593,897,096 *3D069AA637022829097E81E745322F45BEB5FD23 Cd;ev
593,897,097 *3D07CDACB7A324D70B5E42359E2C4F7852CC58B7 CdEVa
593,897,098 *3D0AD934D1B76D3D8F3EF9807699CCE586B54859 CDEVGROUP
593,897,099 *3D0BF60C812FD033E02ECA241D04C076AE22E762 C=&Df
593,897,100 *3D0E0D0032F056E8191BE138F8C2773D2F88AFB1 Cdf$
593,897,101 *3D0BF41F831D2083262AC0303E9D2C26BDCF2706 C=Df8
593,897,102 *3D016B5541109772009FB4D68521CDF28CB61863 CDfg8
593,897,103 *3D07EA552A5E0E2AA83DDDB9191E9C38FB7DFC76 CDFH/
593,897,104 *3D0DE77249EFD0E06D0BBEE37577254855CBB03C CDFIS
593,897,105 *3D000116B7DABA653EE3F07982C68C3AE3280C61 CdFjW
593,897,106 *3D089393502BE387996C8B0CB520B499596EA577 cdfoxyb@aol.com
593,897,107 *3D0B72E9C85251954E9909C20C1431D8E87A5054 CDF/Q
593,897,108 *3D0EB31F7DAE193C6470BF8ED35ACA85A391840A CDf)r
593,897,109 *3D04C2B598EBAE5B499603DFBEB22E0AF09FA342 cdfsantamarta
593,897,110 *3D08A58B99F3F3DCBB1B9A3A575902087057AFB2 Cdfve
593,897,111 *3D0BDE4B351953B7B60E793C098CFAB6FFBFA9CB CD*G
593,897,112 *3D0A19F2C611B6118846591F4907C2C1098640F9 CdG7)
593,897,113 *3D0737B8C578E346DF9858762ADD52272B22196E cdgbiying
593,897,114 *3D046999500714B51B9617090775B461858F961D CdGhw
593,897,115 *3D07ECF7E38EEBC829A7162DEE085C16CAA74D54 CDgi)
593,897,116 *3D0CBAC462CD81E08AE56E391F3A58036ED7DF43 C%DGm
593,897,117 *3D0D64E71991D95E778D9792E9BB438F6A11A00B CDGPW
593,897,118 *3D0F2AF810AF7FADB99FD8EE25A435BA4B982F48 CDgpZ
593,897,119 *3D0B566A998EDF8EEE9C97052CAFAAED076516D2 CdgQq
593,897,120 *3D03367365E9E74B855C2900F38963A9A317FEE6 cdgtx
593,897,121 *3D08DAB38F78392175C14AC8FF80EEA7A83D7C36 Cdg,V
593,897,122 *3D0A68E00A6385CB521CBFD7546FEB7D068A8495 CD+=H
593,897,123 *3D0772D30C7F0ADDB55549E4AA656B7FD3F64548 C)/Dh
593,897,124 *3D0BF90323EB4892D3BC5BC03D11A16CF5E615AA Cd?H(
593,897,125 *3D06EED69AE8A047C525DE4E9F9B95E08EF26702 CDh0,
593,897,126 *3D0E4D8B52A53DF054A9B391BE475459270C6D0D CD"H1
593,897,127 *3D0723F76D8D4EA65B53143560F18BA6E6C7E2E5 CDh4U
593,897,128 *3D07B471BF95E9C994157FF45E159CB78E34827F CDH?C
593,897,129 *3D0BB136B9DD9D1BB679ACD86B96BDAFF882FB96 CDhd3
593,897,130 *3D01D1CA346897794A2526DAE9232BAB8227A1C8 CDH/I
593,897,131 *3D07AA5E5163B601D72BF14DA633384B8F7835C9 CdH!q
593,897,132 *3D00CE24D299E5E2530DF2C962A61CC7DBD309D4 CD.HS
593,897,133 *3D028DD2DB63D23B3A956B288BFC68499E9E51F8 C,.DI
593,897,134 *3D08DCE6E1ECBADFD1179B593964E2C3430A13D0 C+DI,
593,897,135 *3D0F98230CC11A9FC7EACBBA2364E9B20A4B84E6 CDI0n
593,897,136 *3D00471A49B90069F68DD0E94B49CEBAA197F683 CD"i6
593,897,137 *3D09FAF300757A5D72D24004CE10617D2D3999B9 C.dI9
593,897,138 *3D0A7ED43AFD86989911F716E30E3B385A5DC275 Cdiac9
593,897,139 *3D068F6F395A22B5095D3FEB469359541B0DA422 Cdiau
593,897,140 *3D0BF7EB84E0CF4B21C8C995B539A9CC9402884C cdiaz3@jcs1.jcstate.edu
593,897,141 *3D001353DE7CE2BF7AD8E423FBE21B2564067226 CDIOl
593,897,142 *3D02CC4F7390E803318C60995E409332027CF381 CDIp:
593,897,143 *3D0D390129E2C1B724DBD2364AD4D957765BE630 cdiqm@yeah.net
593,897,144 *3D067914238B6696A1AD97A840F2801F25194C1D C?DIv
593,897,145 *3D07E2A4D9C70D9B43351DBA34F0C006F13A2823 CDIY?
593,897,146 *3D06CEEB46199DCE4EA72945E2C934CC8D360418 C=%dj
593,897,147 *3D029CCF9761A78DE4EB2B26623DFC9319FF97A3 CDj5T
593,897,148 *3D042B7FD6D1B0B344AD121CC1B5B1B42090EE26 CDj9T
593,897,149 *3D03C9013F7AFC245F4C00059A464FDC87DBC072 Cdj?F
593,897,150 *3D0BF353CDACE8B5E3917F68E1BC0CBBDC713BDD Cd"jj
593,897,151 *3D0952DD69A4A6C80927C8986578B712BCD7D74E cdjkagslw
593,897,152 *3D0733F728C1FDBB47F082F6D8EAE275DFBF98BE CDJLR
593,897,153 *3D06D093F2EA519799A3B7ABB65FF5A8C8427661 CdjP"
593,897,154 *3D03C3CDB0EE738C9042D298291326696F36C1CF CDJTRI
593,897,155 *3D0A042CC9A6E90D9BF19F5853F1CA7B210517E9 CD#jw
593,897,156 *3D0D8A76CB9BE75AF8079AB2BBCE08D372CFC544 C=
593,897,157 *3D08005F7E84645FCD202E56B4949DE679C0C3C1 CdKH6
593,897,158 *3D05E2118704F5F9D8C7DD1BBED667599E6927E8 CDkH7
593,897,159 *3D0681EC8094D3ADB88362ED59F20190C6B2BFB5 CDK
593,897,160 *3D0FE5CA703448062D1861DD3CA8C9AD336B3BD7 CDk%N
593,897,161 *3D08C6E5BCDDD5C214445F996276AC7B597AEA15 C)dKp
593,897,162 *3D0E8C3AF1874BFEC52177DBA54CB6B19FBC7508 CDk:S
593,897,163 *3D0BE093C6310FF78664341F9E01F9FF68DEEE0E CD%kX
593,897,164 *3D0D6F5FBB914E766CF37589E097A875A4537358 C)D+l
593,897,165 *3D04A6C24F0D52C28D1EC7FA6EA300106695EB15 Cd+-l
593,897,166 *3D0167813C9D2050DA9C5B2CEA881C72704B65BB C:Dl0
593,897,167 *3D0E81991E2276CDFC2BA1FFE9CDAFC57C20B657 CD#L7
593,897,168 *3D0BC3BEAA01D87987E97FD256EA7A777599DEB0 Cd%lc
593,897,169 *3D025683118707012D8AA82C521B78C4ABE11042 CDld2
593,897,170 *3D0D648E48A8728E5E699395DEF34C12762C96DD C&dlE
593,897,171 *3D0661020913E19C0D4FFB34C20332D9F90E3E14 CdLok
593,897,172 *3D030051765A5A5A0B1974AE8F26A8B07AC68CCE CDLt.
593,897,173 *3D0B42E4515E9607746236340A8E30FF842F1CF4 CDlwo
593,897,174 *3D0CCDE3AA6143E2A4AC20BD4B381D6DFC887871 CDm1o
593,897,175 *3D033F77003CA016C05AC864044CA30F3D74FA6F cdma2000陣営はlteの前にrev
593,897,176 *3D0D4CB9CDD82AC7F41A5493C9E602C78838117A cdmanampsandtdma
593,897,177 *3D0FD86DB4ECC1E19D577C1F6592F1199EC5A5BF CdmEI
593,897,178 *3D0D498125E6FC3545BF0BD3031E5EB14FDB8D32 CDM"G
593,897,179 *3D07104903696798315483FDC5A6A220FCA0CA86 Cdm
593,897,180 *3D0CB3E9725FAC285F7CF06E14C79C173ED3271A CDmI$
593,897,181 *3D00AD6B652ABC37845A0A20BB55C80367AB9845 CdMI2
593,897,182 *3D03A20EAF15BDB54C61373CA64BBFEF9A0EF200 CdmiQ
593,897,183 *3D0D0ADAF71E1CDB52C2A704301AA19E132F3AB9 CDm-N
593,897,184 *3D0067A5809E9BA88F4D651C2AE26DD8740BCE4A CDmof
593,897,185 *3D07F41021ED80E916839A4DBB4C8F801FD2AD3B CDMP)
593,897,186 *3D002169833F91A3BE39186417CF7447DE8F94B5 C$DN%
593,897,187 *3D0F6F6D6474EC0932008A8857D21C8623C175D8 CDn";
593,897,188 *3D0295C6D3FC5680E4C11095806DDD111A3D7ED0 CdN8a
593,897,189 *3D08EB0C47F59215059CB2E19F0E9A8A0686A45D Cdn=a
593,897,190 *3D085EC3836D632EF6F4B9D04C3B254605817B82 cdnettles@aol.com
593,897,191 *3D0CD348B9184DE60B9DD67D9C580BB4FEBD7198 C,dNf
593,897,192 *3D011AE3DF19B3C78D893EB14A1F74EB5D6383C8 CdnIv
593,897,193 *3D0C1DEA7F9F663AD5B087A779D6457BB1065FE1 CDnk/
593,897,194 *3D0B8100DC94405518664C8397B629D38A2A242C Cd_nM
593,897,195 *3D0BA9B93A9289343BFF38AB13A02CC356283344 CDNMR
593,897,196 *3D01CF3D852453B9B8380F1B52248056D3694ED0 CDn&N
593,897,197 *3D03012E4B4133BDFAC5E1AA92A20BA5CF9E8D9F CDNqM
593,897,198 *3D0D1A73D5BC3C5A3F9F1EBF2E78CB2CD41CDAE2 CdNsQ
593,897,199 *3D0C7F1FA091C230C64F0E0A939626034AC32AEE CDNu4
593,897,200 *3D0D5915D40071659BFFA8CEE5377332FF33D63E CdnXg
593,897,201 *3D040F796AFE52BB9683E92EE01F73C3397743C3 CD_O,
593,897,202 *3D0EFF636F566071885A0D17A88C049891A1C417 CDO&"
593,897,203 *3D0619E20C9EBF90D697B209879A0DA22CF39D55 C?,Do
593,897,204 *3D06A4126742723EE88F7C84C2F82C888CEB240E Cd=$o
593,897,205 *3D0AF5E695FB9BB368FB32C5449CFD14674A6913 CDo2j
593,897,206 *3D0682557F9DF4E8AC9E8D66868F6A9F7FD1AF56 CDO5S
593,897,207 *3D0AEE83F35593AA9CA21753E29D429D48D34210 CDo8i
593,897,208 *3D0414FC1A041C7DFF849007EE3C6E8624DC479E c:\documents and settings\firexware\local settings\application data\google\chrome\user data\default\cache\index
593,897,209 *3D096C9989D262298ED83BAB0CF5D1017D98CB80 C:\Documents and Settings\FireXware\Local Settings\Application Data\Opera\Opera\icons\http%3A%2F%2Fredir.opera.com%2Ffavicons%2Fkayak%2Ffavicon.ico
593,897,210 *3D04AA57DED9FD7648E48A7C861B717C3AAB8934 c:\documents and settings\firexware\local settings\temporary internet files\content.ie5\jfdipfp0\omniunih[1].js
593,897,211 *3D0792480D4483386FACF607C49FBF684D357B59 CDo/F
593,897,212 *3D0D2CD63021B0778E89454AE9776585BA9819D6 CDo_f
593,897,213 *3D09CCCF2F77D863DBEB876E7FB8126BBE7B605E CdOH,
593,897,214 *3D077C071710E355EE5E00E6A0A34774A3CE5B4C cdoherted
593,897,215 *3D071F8FBD8B26D14106DFEE8FC53430A2D617F7 CDoLI
593,897,216 *3D07DF2759847F9A76148172B3C86CFB44962ED3 CdoOs
593,897,217 *3D0D6BAAC8AE3C59162166E4ACA32BC9C3B161AB C&DOq
593,897,218 *3D033E80037CF3885FA606BADA7F4ECFE8CA3886 cdot49
593,897,219 *3D0B480E5590F01C4726002CDA2FBAB04E07E87E Cdo
593,897,220 *3D01BC88D24217B93E05362493AC21223BE39818 cdoubuf
593,897,221 *3D060554DD7953DB256362E202CE32FCAC4EB485 cdoug84850
593,897,222 *3D0D1352A240917060656BA561B45A305E395F7D CDoZL
593,897,223 *3D0BA10648CD7E7A849A945FB6B6C6CA6ED73617 CDp
593,897,224 *3D0C1B25B78EA721BEEBFE5583FDE4F41E7E7533 C,d:P
593,897,225 *3D02F4CDF9B5B725371EAEB6F6361BD0B75F7143 CdP$_
593,897,226 *3D039D0C934917CFA41780FFBD4BB72B746906F0 C=dp$
593,897,227 *3D018C59AF2920CF0BA2EF2541146369BD9856C5 C"dp,
593,897,228 *3D0AF231268588696EFB5779D483BB45F07DB9FE C)/dp
593,897,229 *3D00ACE8DF9EDE45A8109D990452AE283F1EB5EE Cd"p?
593,897,230 *3D0B830ED089F89BEF0237F9318A67FEDAD062A1 CDP090286
593,897,231 *3D0AEC0EDA4C150FA10090B7034ACA68BB4F5504 CDP-ACILGLICEROLO
593,897,232 *3D08E19317DF06D245F5C3FA3832582EE7F00545 C?dpE
593,897,233 *3D0284E0728CB3210B9520FA36DC313C19FA4808 Cd$pe
593,897,234 *3D05B5135D0C6C7E135D10C0DCCD3E3CCDF8D640 CDPGc
593,897,235 *3D0621C5FB61B13E39AF5C39EAF5BBC58C5567A6 Cd"Pj
593,897,236 *3D093650B31B96B5BE96272840CAF10D5CB41529 CdpjX
593,897,237 *3D06D8F5397C417728E9DF346492B96A3AC6143B CDpQ+
593,897,238 *3D007D78D91AF3E6129D44A1C224C5D7D1FA74C7 cdpxw3i8@sinatown.com
593,897,239 *3D0DB48F4ED234437B9CC270DB8572FFE8BD9E05 Cdq3k
593,897,240 *3D00481153D58F81939028C12F26648C1CB3D1F3 Cd%Q4
593,897,241 *3D06C60024830420EEED7C315ADB8C07F55429A8 CdQ5Y
593,897,242 *3D04FA098EBBCC4E7FC08FB54D23AEA6C994C526 CdQE%
593,897,243 *3D037CCADF1165860B61CA9B93EF2CD2B9074824 Cdqu1
593,897,244 *3D053CF1B20FDAFCC4DD7A36EBCD58A18B2CADBD CdR_?
593,897,245 *3D0DC747F8B0E70ABAC7CC00A4C3A54B8EBF75EF Cd=R0
593,897,246 *3D0429094BAC1D6AE4430A7E09262D009ADE3537 CDr4B
593,897,247 *3D0993B2C992F422ADDDFC21F4FDC03194ADD154 CDR6518
593,897,248 *3D0F03E875BD9F3E36DDF9623F0F959C8174503A Cd-R80
593,897,249 *3D00BD31DB12AD67B61D7D134E243CA4DA13A11D Cdr8X
593,897,250 *3D0DEA745D64FCF5394D3A839E53D8050072641A CDRA1234
593,897,251 *3D0D9BF744B87258C23E23F80B8ED430D74EFE0B CdrBW
593,897,252 *3D0F9DD61D28DA9187820F1597C6D1B7B54769F2 C?Drn
593,897,253 *3D003F459BD59B5666C00B2F4FFA99E513A6773D CDrp!
593,897,254 *3D0D25CD34121E159D58E6C386DA60E1F1D91AB7 Cd$RT
593,897,255 *3D05CF1F8145EE84FB13A6FD32FD35E9779778C4 C-Dru
593,897,256 *3D026109A7F92F327010890F0679C9FEB20842E0 CD(
593,897,257 *3D07FB7178FC0D805DEB830C28E91575CCD6125C CDS’
593,897,258 *3D05F08364A9EDFA5107BA82406F639DE5853FDF CDS$2
593,897,259 *3D04D3A2F0ED764E191AF3120AB325B8DF598937 CDS3i
593,897,260 *3D00F1469A139D9628086979AE6FC3BAD053B229 CDS9f
593,897,261 *3D0D93687878D3D225A13BF2E50C06D5BA181251 CDSDUCEDSDLA
593,897,262 *3D0EE6FD7F42670D09574E9DD99321F929B63D6F cdsqg
593,897,263 *3D0730E19F1690EF63503C39745DCD78E89DDCD3 cdsvf@yeah.net
593,897,264 *3D09252D2BF4FD2E0C9DE11462B8036E5377EF95 C&+DT
593,897,265 *3D0B416891CE6607CEA9E50406FC82AF9E048D41 CDT6#
593,897,266 *3D06CC8504C47DC19C46EB4B9558417AB03CFD41 CdT6S
593,897,267 *3D0176487E14944D8659E3BDED7D5780B73014EA cdthisismypass1
593,897,268 *3D0319E93D3D9D7650CBBB94AC462A7E6E3490F4 CDTIQ
593,897,269 *3D033210C4030D7F03D561159E40B62D66D9E5A6 C%dtS
593,897,270 *3D050C58F10F3683E8CA4D4FB13698D231B2F448 CDtso
593,897,271 *3D0D1690C92140BC7C20A52BDA3886900ED27227 cdtwa
593,897,272 *3D0E7827AAF68389576C05134627099CC6676A27 CDu
593,897,273 *3D0DD1D7C20336351CC6E91ABA50ABCDDF07079F C+dU8
593,897,274 *3D06A98ADFD31241DC80F765AD95A5E1AB69B111 cduax@yeah.net
593,897,275 *3D0760D6ECD3502061F3C80B5F3CE52AC04C8D6E CduC/
593,897,276 *3D089F0BCBB949FCFF3334B41E485C62F7257DAD CDU(D
593,897,277 *3D08601B636591F4229F30C43615CD03BD1EB9B6 CdU;D
593,897,278 *3D058ECEFEC798EA57724783EC444B71CDCFD4DB Cd!Ue
593,897,279 *3D0589F5B1CBB4E76D9811A08980BFBBDE5B65E0 Cd"Uf
593,897,280 *3D09D11802A42F847963387E403B2E6471C39AFB CduG
593,897,281 *3D0AA8C94F1621A9252EC69B0D06AC52B8CE158D CDUS+
593,897,282 *3D06014B97C25179C9871203E378D294798C2674 cdutils
593,897,283 *3D049F4AE927277E11BE0A59C33781DFB5FEBF40 CduYk
593,897,284 *3D0AD9BD9B15402543AECEEFADAC20346BDBCE5C Cd-V;
593,897,285 *3D0CABAB05CA708352B7484B5671DCAEC474A2B0 c:DV
593,897,286 *3D0CB1AC6F3DFF19ED578EB7D252532FA084A1D7 Cdv4B
593,897,287 *3D08BE1F11EE0C9943C7FAC71704D8EEEC1B6FC1 Cd.V5
593,897,288 *3D0DD5C71D541566B6494E3B4F6D7C2F7E07C6FB Cdv8)
593,897,289 *3D0B091421D2BA6809E1AC3E6D6A499B28BFE181 CdVd?
593,897,290 *3D0D1F53F9A2BBC768A2675D5C10B97EC3D873BD Cd?vd
593,897,291 *3D01118D6141270397E56DA235172D94A7C7CACF C)dVj
593,897,292 *3D01E79EF553885DC5936558AAE132406B66AF5E CdVYO
593,897,293 *3D06386907F8902284E85E07B0CB2F976C35A962 Cd=w%
593,897,294 *3D01F6B0A66B9997A7C8A017E6BEDE1CD4F93A75 CDW1)
593,897,295 *3D08F227D9C4EACDE8A17AFD9C6E83B7043CFD56 CD!W8
593,897,296 *3D071B986FC155183B86C689FF83E14DBA12F1BE Cdwe-
593,897,297 *3D05DBAEB3C737ED77825761C0373C1B4DE3199E C;dWI
593,897,298 *3D09C14D98C5F66D1EA63DE0A41CEFFAB8A79514 cdwnk@yeah.net
593,897,299 *3D0AE1FC7BC48FA26ECBA9FE070A4EEA77E76B01 CDX95
593,897,300 *3D0A296DBA2597A0F7822BE0760E56E26F037663 CdXac
593,897,301 *3D09927A2A5C8001DA2068014845438B22C29BB6 CDXc%
593,897,302 *3D06F69E72287FD4F806A9C6E3A3CC0D6F0BCC2B CDXF8
593,897,303 *3D0D6811286C3803DCA7CAC2966E93BC93350D7F CDXOULX35
593,897,304 *3D0685EB7AB4CBC71D9C27ADFB19F34311A3B33D C-DXs
593,897,305 *3D03649C036C01EDC1E3D2BBFD2BDDF98ECE076B C.dYC
593,897,306 *3D011F992526F22C2BA83C2E3E1B56BCC79EFD32 C(DYG
593,897,307 *3D02AEF8061BBE76FFC4A589320BE21A2BEF4F9F cdzdh@yeah.net
593,897,308 *3D0C2CFCEC5D3BCFAB3EF5ADECC0E10CA372E31C CDZEH
593,897,309 *3D007B8D21890559346C9B98389F72EA8CEC6F55 CD,ZH
593,897,310 *3D0CD9B07D01CEDC4DB8BC29C01A6511A53ED297 CDZh?
593,897,311 *3D0D154F6001408A3F8E1D0A68713371FAECBB57 CdZkD
593,897,312 *3D053C10F2632FFC92EBFDDB5A6CCD9A601854CE cdデビュー前に音楽番組に出演したのは
593,897,313 *3D08B64387EC966E09632B18A7B9823BBD132802 バラエティドラマcd(深川りく)(asuka
593,897,314 *3D06E175D1CB0A4C0344D9599D084DF357610858 C,E,-
593,897,315 *3D0CA747E10D9CCF0430C2F49ABB9E81DADA79C2 C?=E#
593,897,316 *3D0FD2ABAE4ADE0CE5A9726FB8A12F5B3BD66056 C]E>
593,897,317 *3D0A336D1F32F507A1BFEE4E4B1F69BA2E2816C0 CE-.
593,897,318 *3D03F03D6F29765146E075E259025AABB96E9E50 CE&-
593,897,319 *3D091A7928932636A1D26196A3B92A4300561E42 C=/e+
593,897,320 *3D085A18344CB3EC8257BB3A06A46235469527A8 C-%!e
593,897,321 *3D09C78E46E361075AC51766098E02B75DC513AF C-e"(
593,897,322 *3D04EB330EBAF03888B064167B2828121823FBBC C?#?e
593,897,323 *3D08DCB166F49F444A7BD8F797B3067587D2D6ED C
593,897,324 *3D0FB9BC393392BFB21DF45BEF06C43B8BFFA11F Ce%
593,897,325 *3D0F16DF14952DB9D18612320B9CB2DDC92BF66C c|e@
593,897,326 *3D0EF8B9AE1D2D4ECC2C1F35F574FE29DE5A7385 Čė
593,897,327 *3D04F0836FDF2A02BD5F0AB766FA6ADF0A0572C9 CE0%0
593,897,328 *3D005E3C965C80F9B7E2A3C19822C26052E5F1C0 CE0d!
593,897,329 *3D0A498B9EAADE0FBA601C76561CC1FB10B7C4B1 Ce0Li
593,897,330 *3D02BC06FCF0C926055E9C1EA9A5A1D84C3A0B4B Ce0vi
593,897,331 *3D0296AAFD4CAF90C0B347C6A5C11A6A3D385E18 C)
593,897,332 *3D0DB1D00407C77C62D7AFF84345F1294B800C07 Ce$1=
593,897,333 *3D07DFBF160B7B71F1E6140ED513B5CB2ECC1497 Ce1##
593,897,334 *3D0F7DC5D2BCF6933DD2EDAB850A2D33EE37F20F Ce1+1
593,897,335 *3D0423B58190F8E17579FE6A042F3B2A42881CB7 Ce127
593,897,336 *3D068914F7B76E05F71F1B87BB0A4CD487D88A4B CE1D?
593,897,337 *3D06F36792104AA65F3714F872A471EE8C827037 ce1d13c6-affd-360c-94e7-afee665244e9
593,897,338 *3D085C696A5937B559EAC66D965C44B89E47ED8C C(E1h
593,897,339 *3D05FB9278F98D0F15830390A803F42D52EBB9F1 C%E1h
593,897,340 *3D034E13D9ABF1BA4209ECA16629B11A1C50B6CA CE+1h
593,897,341 *3D0FB77C03347911820D43E6F5B23A2DD04D7174 CE1v+
593,897,342 *3D01E40A6F66018407A4AABFACC03FBD4808F5C2 Ce2
593,897,343 *3D0E88449D7E6E7A692EF5C0D45D11B58D7BFC46 C:E29
593,897,344 *3D02CF3ABC5DCBDA935229D9E18D5C37140B40B8 Ce2DE
593,897,345 *3D0541E8AA23DEE410674DBEC1096421F926F900 CE2Lj
593,897,346 *3D02296CE736B74CD972D1BAB51824C95DD3FFB9 CE2q0
593,897,347 *3D055FFDD5E00AE51AA96B76FC057E09B11EB820 Ce2Rc
593,897,348 *3D0BB296001C5F1C63302313B7D987F515A281E1 CE2WP
593,897,349 *3D08836E5811D0875FEE98F0E639A1A88B3C356B Ce3bE
593,897,350 *3D0D885B794EE389F7D41DC0332843214BB1AD80 CE#3F
593,897,351 *3D08BEE0BBEF3D737E195020B6A4E2C26DC17C77 Ce3Ip
593,897,352 *3D0D307B77316A49C11C4B68DFA6E2617F47F5EB C;e4(
593,897,353 *3D0EFFCCC6724062FE83749196A1C4F336058FAE CE4247
593,897,354 *3D0BF10DCF6A435CDD74D302E4FEF6843AD89D63 C+E4h
593,897,355 *3D0E11680A299EAFF4CC6545C05ADE418EFF2B56 C&e4O
593,897,356 *3D03BE8B4CCFC3E053C90E20B9C052EF80016E3C Ce4Pp
593,897,357 *3D037272D36932BCB44ADC51992C244EB034919C Ce4vo
593,897,358 *3D031DBE1CBF4502B3D1502A6C8F10002437EA0A Ce4ZH
593,897,359 *3D0D1F9C9ED186D5D71B5E4B5EF6F53FB70D4D9C CE5"=
593,897,360 *3D016957E860A58E70405B57EBA742302D38DA23 C:&e5
593,897,361 *3D0F9F57895AB98692B6CA0918E2FB3EBE9B96F6 Ce52F
593,897,362 *3D0A249C18A6FDA10D8FDDE70CCA66385CE4E46E C=E5e
593,897,363 *3D0901ACA2AB626821FA27E3D67E053D9ED2E8FB CE+5u
593,897,364 *3D0F86B00D381DE81FEB07DF7F9D5282287D2D76 CE5Vi
593,897,365 *3D0E388B3C53928B6A33AE98F4FD21E2E81944B0 CE_(6
593,897,366 *3D06909D6A7BDA6F66CB7FDFFD7B5AFF78996441 CE##6
593,897,367 *3D0B42767682109D6458B187438537BFFA0C40CD CE67Z
593,897,368 *3D0C370F93ECEF06FE47EDEEC663FF06BF6D6B81 CE6.h
593,897,369 *3D076016BE4277E901EA233FF71FC8FC29B2791D CE6ts
593,897,370 *3D02181F3ACE764ECDE1E5999B273932159BFEAF Ce-6X
593,897,371 *3D0B6CC73EA026086F70F11B202A71BA58AECE4B Ce70I
593,897,372 *3D08DB41FDFFD0D9B0470517C6B1DFD9B9B658C3 CE7b/
593,897,373 *3D0A945C836B6ECDAF2816DF4EE371D9737477B7 Ce)7r
593,897,374 *3D0C560819324672646E5F70B9125648183A25FC C-e7X
593,897,375 *3D0B7610551D6278AC91FA0D56BACB9E8AD88153 CE7Zu
593,897,376 *3D033B67E110A541F4767E0E5842CB57EB37F200 C
593,897,377 *3D0A9D7BD8DEA62B2F5D62B1E5307F637887CCBE Ce8"!
593,897,378 *3D0A9AF56C9B7BE65FD6AEFDFD2705401DAD4BCE C_e87
593,897,379 *3D068B3CCF61F89E703B213934BA0C74560E142B Ce!8C
593,897,380 *3D04A2D40073A0E766D277F64503E5F1314921CD C)e8N
593,897,381 *3D0FEE6642AB611C9022848C3E143B0787AF0314 C_E$9
593,897,382 *3D045FC6C3D2F8FCAE44FC60B9BC76B725146FAF C
593,897,383 *3D082F458CD8E1E3559498311839D1787E24A67F CE-(9
593,897,384 *3D062BA99C970B92119E49751426FC231DEE2E6C Ce9AE
593,897,385 *3D002239A7E0BA561F07E91328AC58B09640DA87 CE9DY
593,897,386 *3D03A594101E705262DB9EDB0D97414530D492A4 C#e9h
593,897,387 *3D0C1B3C10B1B252FB18EA0390B5F52C9F34B98A C-"EA
593,897,388 *3D073B631E4342793697D4E294E5314183AA1C64 C+e$A
593,897,389 *3D0E8333970AFD454C6575656EA90FE81C1C3BA3 C%$ea
593,897,390 *3D0859B5897410A7F501B01EC7D2614DD31D3F7C Ce/a"
593,897,391 *3D0D6E0D3A9838436FBE27783B81C296F179A738 Ce*aaa
593,897,392 *3D0D55BB27C8E1BD642A12CD09DD99B22A216CAA Ceafb
593,897,393 *3D03649629B6D2176C0D1B2898DD7C43B5056B49 CeAi?
593,897,394 *3D0AE0287600FF982236212D200D4519A5C7E0A3 CeAi8
593,897,395 *3D07022FBC9A42D3EBF0E682E3DF908E11FBA428 cealboy1@aol.com
593,897,396 *3D0548BDBE8AD78405F791C5BD3BBE76CC7E1278 CE
593,897,397 *3D0F7C10EC21A5BE01776A57CE1E524EA78E2943 C$EaN
593,897,398 *3D01747041A1D46D6BBE1741B89E690DD740D7F9 ceanhurs
593,897,399 *3D0ABDA3F4AE4A5840AF4051B20171A37E6488BC CEAnM
593,897,400 *3D08DE41D0823F61D3EFF9028C71D3DCD7441FC8 ceaphed
593,897,401 *3D00D0E992A509600C19C972D609475D2C97B199 CeAQI
593,897,402 *3D0D548C3E0F8A8FF9ED37A79575014EF00F31A8 Cearcall a' Chuain
593,897,403 *3D027CF7C2111AE7F31DDE2C2C841B2920DD9FCE Cearista4
593,897,404 *3D015513052E20F3C4290EE12DFB29B99CE8E38C ce-as
593,897,405 *3D0622360B3B7F02F997CF2F46131E64FDB4B355 ceasar6095
593,897,406 *3D0A1BAA9A5290C5F7A5577D7C088EBE940CCCCF Ceasehostilities
593,897,407 *3D043771783C8D4D7C0B4327681A18F006424162 ceawc@yeah.net
593,897,408 *3D026E5F9CB2D19A06FACE20A29951B8D3F0B75C C"EB&
593,897,409 *3D0EBD99AF34B0F5F797AA3CA8AB12A62997646D CE:.B
593,897,410 *3D06ABE7D20A69DE47BE4F8C6E0758D5458826FE C?E?b
593,897,411 *3D0279B87D4C12426DEC9ADE3501B7E05F78793D CEb;(
593,897,412 *3D0ADF0DF04D4CF996920B214042A8A72612A5D8 CEB2133
593,897,413 *3D0971D18D5AB9CDF313DC5F0B11290C078B4711 Ceb2i
593,897,414 *3D091410B9E487783B90749DA8B4EBFADA0EFED8 C:Eb6
593,897,415 *3D0DB8046741FFECC88CD43705E6057C97B0B150 ĉebalatona
593,897,416 *3D0F78D14660C39539C8727B7AD3A02CA1C9F223 cebamiento7
593,897,417 *3D0249FB8486AAD6E54B6880993ADB5F066DF78E Cébazanoises
593,897,418 *3D037CC960FFE5F242F1D91DAD3FE7AB5A75CAFC CeBdq
593,897,419 *3D08BCC1684415DB629001AC25528BC2153389BD CebellCebell
593,897,420 *3D0C6748CF424B6A9A2583E0361B8CEBF72C5108 cebeo@yeah.net
593,897,421 *3D00A34DFD44190038942FB58FD2D3D5AA3B4831 Cebk8
593,897,422 *3D00F9E385E0D07EE561B74163B534B3AF6211BB Ceb-M
593,897,423 *3D0B88B88FA3D6F54CA8506EBC28F9E7343B349C cebola53
593,897,424 *3D05C8354558E4D1528EFA9094F802856A6F40F7 Ce!Br
593,897,425 *3D0C674DB05B0756C98B6F3A571D25B554690C44 C+ebr
593,897,426 *3D0B72910C4B4E38FBEB28BB5ED58C32747E2579 cebreiro5
593,897,427 *3D0487F39F952518169728FE89C7EF1998E4CCAB CEBt
593,897,428 *3D067A2256270F3E385E4B2291C765C7FD249DCE cebus137@aol.com
593,897,429 *3D002E2A8ECBD272AC170BE6946AEFC83A3EEDCB Ceb+v
593,897,430 *3D01464DC3F3E0CC91970668E7F97F60561C7810 CEc/%
593,897,431 *3D03D674647A18FA5EC7B12CE5C2BD1F0E59DA73 CeC):
593,897,432 *3D01A4F2FC418E8F8728BD4BAAD9D9F84008A751 CEC0+
593,897,433 *3D0022D615FE78F808BEC093556C7D09D42392A7 CEC41
593,897,434 *3D0E5906DCB23572BEDE3D63189757216B468E94 CeC7.
593,897,435 *3D0170D55C2EBBC709AE3D0BC45DDA8B2A9BE22C Cec97
593,897,436 *3D0C86711D5912F731C9CB5EC183049468A1EEE1 C_Ecc
593,897,437 *3D0789D8908CFFC05B53325AFC50F835FB5D5145 CECCARDI'S
593,897,438 *3D08C0A9F4CCACCB06E893D1A3CC10CF1BF0B32B CecD+
593,897,439 *3D011B2AAA403FA5BB1B42452A8B475F39A73C99 cecdiugs
593,897,440 *3D029FBBAAE1ECABA0232247E9834DDB3F06D82A cecelia960
593,897,441 *3D0357379656AEAF103383FCD70D0AB05546523F CECEPIZZA
593,897,442 *3D0FF1029B2270AE5D37C4A5DAB10F2F881E111E Ce_CF
593,897,443 *3D0DC62CB3C3B66BDFB91200A4105ED63C71D188 CEcFK
593,897,444 *3D00E7C68703F127D320AD70AE2B0820212B0E48 CEcGg
593,897,445 *3D04E0BE9CD3480C133632B47A607A5753D94151 Cechovyched
593,897,446 *3D0252312B2063F87946987CA17D53906F12489D cecil.bellas
593,897,447 *3D02325ACFFE91179019FA69CE277802E82E2E23 cecil.benevento
593,897,448 *3D09E964E59E2084BF6320BF0D481EFF7E2EA2D1 cecil.brookshaw
593,897,449 *3D0773D837C5CCECC8EB80D3226E9E45A8FF5C0F cecil.burgener
593,897,450 *3D08240F199CAC11F5AB7A4BF3FF596908E0753C cecil.dagesse
593,897,451 *3D09416616E5A8724CDDC859D2FC97C420856D40 cecil.driggers
593,897,452 *3D0A3F161011F69BB3A22580C52B79B1E4222BA1 cecil.durrani
593,897,453 *3D0C025C9FABB2C8F9A1E74831AFEEA9AB79386F cecil.edmondson
593,897,454 *3D008E3BA5EE92455481B931FA12ED01255D020E cecile garrett
593,897,455 *3D0A06116573D84BD5B95BBEEAA91655010F4724 cecil.fricke
593,897,456 *3D0518E9514C10497A8EC94C38080D148F401845 cecil.genberg
593,897,457 *3D0D1E3BD9815B64FF4EF4FF217DCB7DD4BD92E7 cecil.gingles
593,897,458 *3D034D11D3A933EF9FC2FE5921A29992E898F819 cecil.guererro
593,897,459 *3D034E77ED9A9D25FF6DD61E82F2309DDE8B3A5A cecil.hartnett
593,897,460 *3D09D4EA2366A3CD4AF8BA9BA7E20759960194DC cecil.hasselkus
593,897,461 *3D0849F875F42AD3684D936F1FBB6F2E9A90A096 Ceciliaen9
593,897,462 *3D06C17EFDE39BD52357F7436364E28BE4DB19D3 cecil.ketcham
593,897,463 *3D0FF79C6626A8492A573D21CF8972E789235DAE cecil.kudrna
593,897,464 *3D0D03EA4941FA35EE17E5EE1DC51BCF564BD08C cecil.newnam
593,897,465 *3D0617F1A96A69047F3ADD29FF857ABD1E12F5BC cecil.pickelsimer
593,897,466 *3D0C7104C089C65C6ABE88E9D01854428C8A6D96 cecil.poore
593,897,467 *3D01C289C9A45581A2DF1F259F1BC98641C8EC49 cecil.reinard
593,897,468 *3D06D43258492B43BA9E997D47F3358DD0AE91CE cecil.rons
593,897,469 *3D05FE8D0A120862F56587C807D6F39F1C0D7D24 cecil.shostak
593,897,470 *3D0E5E0867F11CF2676F8420AF33A0786BBC6753 cecil.vizcarrondo
593,897,471 *3D0D27559BC7F968AB65CA0742169AE017D53983 cecil.wohlford
593,897,472 *3D0FAAF9ACCB32882287944C783219542DE4EE49 cecil.yeo
593,897,473 *3D0C30D8C2755A49E913592BDE270B7489C75ECE cecily wu
593,897,474 *3D0F9F251103EDFA00023A2FDDA47CF31D21DC73 CeClf
593,897,475 *3D0D2E3700650299B7A630C6DCBB3A8080245738 CEcLo
593,897,476 *3D0ADC5B11B3BD008FFCA0983698006F6499309F CeCNT
593,897,477 *3D0CCFDD642C5A25A422B8C34CC577F0EACD07C0 cecograph@kimo.com.tw
593,897,478 *3D04EAA395963A3D2F22177E40BD0A5EBFBABB80 cecotto 3 0
593,897,479 *3D0FA2A6803923EEF19BBDD3A23876D9998207C0 cecsea@aol.com
593,897,480 *3D09966CC89475C62B177E7CD104C0A9D11F5F91 Ced!6
593,897,481 *3D0A6C361BFF7726979C11D6F024B27919B8A1A6 Ce%D9
593,897,482 *3D0BB560A1E79D9CCB8A9B877009CDC3ACA97F20 cedarroot
593,897,483 *3D0FEF1420B62C89985D9846D4A33863C935AC35 Cedbq
593,897,484 *3D0DEACF387487B8880D9C86FB5F0CDE56B38A90 cedc906b7b
593,897,485 *3D0B4992D6B3528BFD1BDF80D085AACC0287EA6E CeDcL
593,897,486 *3D0EBFEBFD4FA4C7106FBF300A01F96C66E783E8 CEDEBEC
593,897,487 *3D0EF1817D5F1FA97867120A1969F9FE40D1B6CD cédeselle
593,897,488 *3D0D56E4A0DC5497DC98A1680A2D92970BE4DAE0 CedGS
593,897,489 *3D0C3CEB43E3CC17154AEA67AF347937D633DD00 Cediccrow6
593,897,490 *3D0E27FE0E68BF758089585B17BE6A1A83A67370 CEDICSAMMY
593,897,491 *3D012DEAD38C635ABA6BCDD126F374F8B944E849 CedidEsr
593,897,492 *3D0CBBDE8AA2C04E2243FCF42B083CE3D20E52BA CeDj%
593,897,493 *3D0D03F9F683EAF8D61AA95E2FE74D7C9B2B47AF CE
593,897,494 *3D0C8798FCC591739597B6E3F1ECF0DA5678202B cedric.boylston
593,897,495 *3D0527A91A89DF7A21B79DA32CFB331BE4962050 cedric.brennon
593,897,496 *3D04C786A93B4B64E68879A0734A10065F04737F cedric.bueler
593,897,497 *3D0467CA81C79F95ECD72B381A0BD75B938C6E59 cedric.camarena
593,897,498 *3D000B41CB7A5D32E19B994104F96C0B4BD40F9A cedric.carl
593,897,499 *3D0C41DD73BE760B521B80F78AC514D28E78D714 cedric.dunlevy
593,897,500 *3D03C8EA1C79E15849795A8BE9E859C295C61EDE cedric.echoles
593,897,501 *3D0ED2C24403D0BA9D31A1D42C4244A0B84BCACF cedric.fuillet@wanadoo.fr
593,897,502 *3D0022514708258A73A20F6691518F2E40CB3BB4 cedric.griglen
593,897,503 *3D002F55D67165DBF422732B128D3A670CE69382 cedric.harten
593,897,504 *3D06E447591D6460E8627E9248E2290D898D3FA8 cedric.hatori
593,897,505 *3D00700303592FA7AB72EC65C6824F5626805749 cedric.hogston
593,897,506 *3D0C9C62B5853B1F5C3AB24ACD2506589345B4E4 cedric.hronick
593,897,507 *3D075F83E4324CD1A2D1AD598F438510A104B39B cedric.hugghins
593,897,508 *3D0E73ABC89EFE9232E5E5C1E885C45302483C53 cedric.jamon
593,897,509 *3D06A62B43744C961B5AF636F6A04BDD2626266C cedrick.connyer
593,897,510 *3D0C9FB3C32E2000C36DB67C2D4F3B43ABD7172F cedric.kehrer
593,897,511 *3D0DF80BDA5F9E9A3BFCA56B31910E410F6A4BBD cedrick erne
593,897,512 *3D051ED07B94AB79E7F297D1C514DA7C2428E0CC cedrick.erskin
593,897,513 *3D0617EC41CD680B042E3DF4DD43B519CDA8A146 cedrick.hendrickx
593,897,514 *3D0E90DD4E2A83759203228E3BF86AB3D871E302 cedrick.ismay
593,897,515 *3D08991842F3A083EA43E319BE9D043D5E81D563 cedrick.lantgen
593,897,516 *3D0AAAB5B8BA47E3D1BFFFA076D97E186C6BAD34 cedric.klyn
593,897,517 *3D0110FA34D2DF6F3FB4D5BE9D90ADF9967172AC cedrick.rosendo
593,897,518 *3D0651A9204A11F06EFF8B68AF660DBFAE8D7025 cedrick.ruddell
593,897,519 *3D08672F6F955280C00D8BF9A78BA0D940DBA566 cedrick.tegethoff
593,897,520 *3D03477ECC3CD2658608141F164B06D7C63400EE cedrick.vannette
593,897,521 *3D0CE6B4F73AC635C1AC2F041BB0E511F7FBF3BE cedrick.veltri
593,897,522 *3D02760D0246CEEC01D516C4E1FFDBBDFF4C99CE cedrick.westra
593,897,523 *3D077A3C2F5DCC1B744F67201985F14525C1701B cedric littleton
593,897,524 *3D0ADF7C2E37316F5CFB735FD0080CE39633B727 cedric.lobaugh
593,897,525 *3D0D08B2B9B78475136A148689B91BA0563E8947 cedric.luker
593,897,526 *3D09F50F951BB8BC455E5DDCC8A7061DE812EA68 cedric.pasquale
593,897,527 *3D0E1E9F4B73272FFE410D3B6E935A20562DDFD7 cedric.pasquin
593,897,528 *3D0F74B0F20FEE8B3590EBB079DCF6A04D898088 cedric.raeder
593,897,529 *3D0E67A749FDC813C9C4D26715619B4C3C29FC9D cedric.satterlund
593,897,530 *3D0AAECA5DF888B720D6B6B218546449A24860EB cedric.staner
593,897,531 *3D07BACC638FBF47EF94F8D1295CF2D3FD74DFF2 cedric.stike
593,897,532 *3D0308DDD64301E4134145A2079DB5D3D6F92FFA cedrinâ
593,897,533 *3D09188D5138B075103B90DB09037B855E9B377D cedtbswed
593,897,534 *3D0F472EFA9D55242B3519B0F777A4022EB29641 CEdV6
593,897,535 *3D05D7CD93081F8A2833234F74DBA678122A8EE1 C
593,897,536 *3D0B9BA4D223BFFF190A825A314119C017BCDA72 CEE8%
593,897,537 *3D0BA9852FA13A107EA100AB6AE19BBE1719C796 CeE9Q
593,897,538 *3D0C6A4C2DE70B4D73B8FCB9E346F49A9D85F7D4 ceeaace3
593,897,539 *3D03B527E543A951391BAE6F9EDE90463102AA99 CeECT
593,897,540 *3D00D207486B8593401C60A26DA71FFE2B1B5445 C)eeD
593,897,541 *3D048FA6BEE969781F58C67527AE62571488AE48 CEe
593,897,542 *3D04C573358D3A998222DC3F94A8F4CB2F39B9EC Ce+ei
593,897,543 *3D067EAF06A8E91D097F14B877B2966A886D5FC5 CeeiT
593,897,544 *3D0BFC0B1C907A218E4A5BC49A8D54178DE31675 C$EEK
593,897,545 *3D0744A774EA719034D137930B108BF33432EF70 CEe#l
593,897,546 *3D038BED5C61365E3C9A769A6574F36C504A3D70 CeeLe
593,897,547 *3D0C44AD44C6CB31576053E0BB7C40477E848003 CEEN;
593,897,548 *3D0F890BF95B2DFEAE7050CC708F51AF682DB741 CE-?F
593,897,549 *3D0C3E27D894898FC5E18B2528438BF80710A959 CEF()
593,897,550 *3D0EC5A46F8C8F7BB17674D9C1F6D425FF6912E2 C=e:f
593,897,551 *3D0D5D86F10EA32D9815235D1FD656C6031C25E4 Ce!F1
593,897,552 *3D0E482A095E8AFDA209AF92E59E4123C3114873 CEf,5
593,897,553 *3D0F6830C1290BB91363CD2E7B9EC9A6472CB234 CEFAh
593,897,554 *3D0993146247C1126C4D937CC2EB151E02A697B6 cefaloplegia
593,897,555 *3D0DD679297CC742EA584FEC7FE45E45C35AE11E ĉefanĝela
593,897,556 *3D0934627DAFD80BA3AC4BBC1883E288DE81A357 ĉefbilogo
593,897,557 *3D059D6088CA9BB7CB94F8A8DE74C9DC7D201D3C CeFCe
593,897,558 *3D0C50E8673E1A41651165BC88E6E1642826722D C:efE
593,897,559 *3D000D5C82B8414E3530584A1D53C565E3A97CA8 cefeme
593,897,560 *3D0AF70E6F91F7A212E9ED8EAE77AB2EF7C86F22 CefHV
593,897,561 *3D030D1A18FF3EFD148E183BD0008BDDD37D6F0D Cefises
593,897,562 *3D0D8830A522C01F40FC99BEBFD1F03A07AB51E0 ceformaBSW
593,897,563 *3D0A60B618FE48983E4438DD815BDA316418FE08 Cefornia4
593,897,564 *3D0A5086AB6CB997BB8C28F33D0DC6C68CBF9887 CE.%G
593,897,565 *3D0D1FE6869A85B1A731D05A0B11D1BC4E5697E5 CEG-#
593,897,566 *3D0AE8B5F26D7F4625B6124B1EDEC3E9A698640E CeG9E
593,897,567 *3D0088DAF6E7DE0EA63453257A4BDC98DD638C0F CegLT
593,897,568 *3D03C87F3ECA9E1AC4A15683D5D17A8504AF8580 C.egM
593,897,569 *3D0AE88A1E1592F939294BFB7D18A5FA53104DC7 CEg;T
593,897,570 *3D0A3F0DF968AAF36A0DB0E97DE2D78C2708BD88 Cegtc
593,897,571 *3D041DDA8AFD76822DD63081CC465D16356B236A CeG;u
593,897,572 *3D01FDAB47877403E63F9FDE2FEEB4526A26886A CegVV
593,897,573 *3D088C0CC7E50EC1C6CF128D6E1BC0292C723923 C/eH(
593,897,574 *3D032F63273556D2D90B57397B2022287EECBF50 Ceh)/
593,897,575 *3D01450D61E765E417F6291BE651D8B533358E79 Ceh1(
593,897,576 *3D0519B13630EB1D0DFBFFAF59E212F047FD01C8 CEH1890
593,897,577 *3D00E33B9DD2DC5345D02FFDF84FD18EC02CBA2F CEh1V
593,897,578 *3D0708376075FB2CCE30436BE394982B5253946B CeH9C
593,897,579 *3D055287D269FC0BF63A4DA8FF6E20E1D7B72338 CEHENNEM123
593,897,580 *3D08F358CE18F3F920930AD4D3F6F0CE4270B5A9 CeHGl
593,897,581 *3D02C1A749A005BA8AE9FEAA578A965F0F6B1329 cehjbb
593,897,582 *3D0D113F335A62EC2EBC1BBB47B38CDC2C242BC7 CEhm!
593,897,583 *3D000803EE359E8219A332629591694DC87BC61A CEh"O
593,897,584 *3D0A235EBAB930FE6564683F1E853E221E15E175 Cehozer8
593,897,585 *3D0AD5D8DF715B0F4B4B395B38F59A56A17EB032 Ce&hr
593,897,586 *3D084FB1430926EB7AA279DC1FCFA1092968378A céhrendszer
593,897,587 *3D0F88761EF792933E817252D141BD9E0076CDCC Cehrm
593,897,588 *3D0A223C99571C5FE861FA621EAFC35C88DE15A9 CEhRT
593,897,589 *3D046AC98B74C33B2E25C9E73249151C1F36C9C0 C
593,897,590 *3D0431DFDB7FD9915275920B3E8916C6D7F86474 CEH#t
593,897,591 *3D0A55978C97758FE8CCE3731FA8342870406298 CEh;T
593,897,592 *3D0F11AE79C19135D67616D96977D5636DEBC0FF cehui2000@mixmail.com
593,897,593 *3D0753332D57E24EFDC8AE7D103A781656DE206E CEhUL
593,897,594 *3D047D026817CA7F4D38ACBC08F15F743A3FD6B2 C;EI+
593,897,595 *3D002198F4279634F9E4BA4F591B061E4E5B6859 C";eI
593,897,596 *3D064B7DC9B1FA962B6E37AF5670032D69CAE2CB Ce"I9
593,897,597 *3D091866A876B671F1D2F3A69E804EF3B61B4E43 C_eIc
593,897,598 *3D0203E8E66B8860F743C4187C32C980C9707F4E Ceid
593,897,599 *3D00DC18EA13A5CE041E587057D25822D4AE14F9 CE)ig
593,897,600 *3D0480B64E1A811144A6BD4C1D813B745C40E602 C$eiG
593,897,601 *3D0A7C68EAC341EE7C7D3EA7128A2EA5C4851C16 CEiN=
593,897,602 *3D0F0A41667A86928C63F143CAFEBD93D3654179 ceinao@china.com
593,897,603 *3D09AEED743BEE6B3716D9A319B4D73AC2BF3C9C Ceintrer7
593,897,604 *3D063B4CEAF66AB642C5225E711DED5CB6F98FC9 Ce!iO
593,897,605 *3D0C7304C7EB2A78132297F61B3BF9C991934230 CEITF
593,897,606 *3D0ABBBDBF316679A9B3DF060588C4B38C1CE294 CEiVo
593,897,607 *3D09B158B9852238A4D3E06520ABECE232DFC4F5 CEj#+
593,897,608 *3D0F70675521F85B2A0851BB8DECD3442033216D CEj;0
593,897,609 *3D0C950948523B5FE967A4A4ABF9B094C87E5124 Cejando5
593,897,610 *3D036AEEF7C4FA0BFC5B0E645A7F33725A5EBDBC Cej=b
593,897,611 *3D02B569FB2E66732DBF90F5B3CDF2FA88A23233 cejedwards
593,897,612 *3D0CEE9F43EF244911C56A41BAFF63F164507A6A CejIL
593,897,613 *3D04F047D1420168F28725E628137F99DE9AB450 CEjP0
593,897,614 *3D0515160C1CA1DD8FF283892C9CFED48A7252B0 CEjPt
593,897,615 *3D0BC5E966C84C2E2111DA501B18AFC9769E776F cejxvyy
593,897,616 *3D02336552B2D566CFF861C95AC8E5F005F5ACE9 CE"jY
593,897,617 *3D0597BC5D2B63213E10C69C49D71DA6BC56E3DE C(EK!
593,897,618 *3D0D622CD5DEB4843925DA401EBA6CB6137CE1B8 CE;;K
593,897,619 *3D0B27C8BFB105C618164FFAC87D7054645254B4 CEK._
593,897,620 *3D0C9F47E0A69BBFEB307BEC032B1CF289BE9FCC CE?#k
593,897,621 *3D0AAE5E1FC5397AE66D57FD71038F6DD5DB4E08 Ce;%k
593,897,622 *3D0D111AEF8E8036391A7745BB86FF64118ED9A1 C-Ek7
593,897,623 *3D0CA15089558E175E910C78EF668E0B78308ACC Cekasy
593,897,624 *3D040D9FA6F1D60B2F3FD369D830D75160BD1BDB CeKhK
593,897,625 *3D07C17D64DD821B15DF28238B8F194B941755C0 cekho@hotmail.com
593,897,626 *3D054259766FED20761E3D55BC0DB16A9FAD937E Çekinilmek
593,897,627 *3D08E93C08437EF2ACEB5296F9171C107D86274F Cekişemeye
593,897,628 *3D023219C2A17D740D40143508673B72CB78AE84 Ce+Kk
593,897,629 *3D0BCEF0334136A2CBC3174D74DD5C760C2A0E81 CEkKm
593,897,630 *3D0ADC0B1B62B40C4E9E816CBF880DDCCFFE680A CEkYV
593,897,631 *3D0DA3B975CC0E22FAC6CADCB4ABAC9A6F27C0CC C-&eL
593,897,632 *3D04A25A03F6BF48331D57DF0087F0F3DA257D1C C:eL.
593,897,633 *3D0335A5E9C32645C1AC25086ED8B4A53E4881D8 Ce.L"
593,897,634 *3D03C58D4C8A36232D7BE7BF04CB675BE9E044B1 cel10dyn1a
593,897,635 *3D00AAE360C90D35AD7A5DB28111B2EE8A1A78F2 CEl3d
593,897,636 *3D01ACA5DBA59BE6A59DEE9E68C3DA2A2A4260BB CE"lD
593,897,637 *3D0AEDFB4644172D935F70E613765997612BF477 Celdonio5
593,897,638 *3D0B39C0B812EE43A6FFAA0CCC46F5D897017EE5 Celebic
593,897,639 *3D044C44ED8DFF55F33F89164DA0B3FCFCC5ECB1 celebrateinstyle2001
593,897,640 *3D0E13A0C1EA3872CD11D6C84DE9BB1EDCC398B3 celebration37
593,897,641 *3D096F41DAAF1E8F61647CC96ADF8A244B6D0A91 Celebration Jig
593,897,642 *3D00EECA9E25B8B4CC30269EFFD4FB76D86B08B2 CelebrationTwoAnd
593,897,643 *3D0EBBB3DF5866DD4481E05B43454F71D87E3968 Celebrions0
593,897,644 *3D0AA538CBC7DC1D937AD58F8BF415A1F0FB85B9 CELEBRITATI
593,897,645 *3D0F3B697EA43B3696B1CDF78A4C447E10B94B72 Celebroed
593,897,646 *3D0A43FAC7A9D3953959259C56DEAECD3F48C81A celedino1
593,897,647 *3D015C500A224BF69C5A650BB5DFD9BFDC211360 Celenka5
593,897,648 *3D082D372A5242E2DA1114B6DE2078EA63E666DB celereste9
593,897,649 *3D07E5A4BB3BAB68F076B1B7075D06C9E0AC49CC Celerrimo
593,897,650 *3D0587A01DB8F3438D0E70E38092E6C8B98ADEF1 celesteharpsichord
593,897,651 *3D0C590795574EF4AA463C7AB13A0E4AF63B0BC0 celeste montano
593,897,652 *3D037EDDA135270ECAC4B45B33B79095FCA4BBB8 Celestiną
593,897,653 *3D09806322809FD45F5829ECC9B11573DE3C1EEF celest sanchez
593,897,654 *3D0BFFBBD68FC872F70072FE00563B5D06944996 céleur
593,897,655 *3D0C5E4DD395A7E8F95AA177574AE1A25CE6F61F C(ELG
593,897,656 *3D04DB36F1214B8D4C0698569020551D33519691 celia_zhu@chinaren.com
593,897,657 *3D0A7041D09F5D59EAEEF502A4D41F75C0DDAEEC Celibatu1
593,897,658 *3D07B80576DAD01E1FDE96015B27208314940AD8 CELICA1957
593,897,659 *3D0EFC238D070C058D239E1A1C4779E8D37B0EDB Celicame6
593,897,660 *3D09DE342872A95416E91B14DDFD3500CDD8A638 celin@21cn.com
593,897,661 *3D0CB071A1A343C2B3AE0E86256312059F54BE29 celinapoetry
593,897,662 *3D0BE94827260259BB042465989934C278B5B5D3 Celine2004
593,897,663 *3D0AF0244F85BE99C81071A08B6953D51B58801C Celinee
593,897,664 *3D08EFE0BDCE7CBEA6567B331E8CDD7E8FA85FBD Celineoatmeal
593,897,665 *3D005970480A01C6B63EAAD4207D8027F58167F7 celineoed
593,897,666 *3D0FFFE0C92AA3AB39F973E1C7AB567729246D73 CELINEPLATO
593,897,667 *3D0DA4B4CBB2F85785C855C264CDCCEE07DB9532 CELINESHAWN
593,897,668 *3D006B7BE4A98E42CC35D848EBA052CADA624475 celinetteortiz
593,897,669 *3D010D22D53D3EEBEF245B80CA1411FB03D5775F CELINEWONDER
593,897,670 *3D0C67BB06D4B8F1AFEF4176A359313E3ED7039A Celiobsw6
593,897,671 *3D0DA2D14FFD40EF7DEF0B8003DFCFABBF8ECD4A CEL-j
593,897,672 *3D014E6744F4E8847FC86174C657E0FE84D48570 Čeljusnopodjezični
593,897,673 *3D0B5978031963472C12A3B53AD175A4A27229C5 çellero
593,897,674 *3D010403F9D434F8686098EC3F784422D429897B cellflex1989
593,897,675 *3D0B3F116ABB492982E32D820D00C07147EA22D6 cellistguitarist
593,897,676 *3D07F7A5FD01521412CFC3590F56366F6FB50162 cellline2
593,897,677 *3D002D3201B68588A7D8CE6D5EC2E50C5B434167 cello concerto in a minor, op. 129 - nicht zu schnell
593,897,678 *3D09232212A92342BC7821FE92807CEB6EF565A4 CelloDrop
593,897,679 *3D0174F11FB7DA3578F0C60D7FFCB7D6FF83A40A CelloSonataNo.2inFOp99:IV.AllegroMolto
593,897,680 *3D094F9A62917E19450DC7A7D3C61050B5A0345F çelloyla
593,897,681 *3D0C9301B9EA03F8CC1DCAFE59811D7836D3B137 cellrow.td
593,897,682 *3D07AE3F326258CED6EFCE47F1244092529255EE cells.1213
593,897,683 *3D0E4C7C16D3FC63990A482F3311E6F8672C8F29 cellsize9
593,897,684 *3D0BD7DF67C2DFA0911E75D26C4552A9FE153EE7 CELOi
593,897,685 *3D0CAC5E31ACF5C749A039464257DBAED954CFF4 Celosttnmu
593,897,686 *3D07F009400589EFC8DAE31ACDB8CECD7C8DB18D Ce
593,897,687 *3D0DC072939FC847AB15811F4C249B4FE68809A2 C(eLt
593,897,688 *3D0568682AB2380885ABC6F36E4A26105AC69283 Ce(lt
593,897,689 *3D073766B3DBCE0257E09539275621D228D029AE Celtech5
593,897,690 *3D00EE07866640D14B3ABA446B5C9375FB5A00D5 CelticCarol
593,897,691 *3D01D34EB6AE6E8A81A376BCA49BFCF42661E8C5 celticcymric1234
593,897,692 *3D0E8893D5727796FA8D6362C49F0C3F31A80F48 celticfieldsports
593,897,693 *3D03404C07883F6BE372A6154D9CF32A70EA5C48 Çəltikçi
593,897,694 *3D09F3CAAD4F335328CB3E84002EAAB3E9D092F0 celtoiberico
593,897,695 *3D0E1CC66D7073B1DCDF61B2D0FD8A7CBBE34FDE CELULOSES
593,897,696 *3D00FFFCA1444579C5E130BB213D2DB537C31272 célvontató
593,897,697 *3D033E58A7F345A285332D7B08EB3392DDC1B6D3 celynyn
593,897,698 *3D0C8BC04972D4AA65BDCC080BBF17740B58983F C%em&
593,897,699 *3D0F9246E16EE28550173A721891169DAAADD101 C+)em
593,897,700 *3D0319882E6094C55D7B351E15C426BCBE850A56 Ce.m!
593,897,701 *3D0B1208CDBDD281A619668B622E9A15D7BEDEF1 Ce&m
593,897,702 *3D03A69543A14E70C4E9C57F3D15CF6E369660A7 C=EM0
593,897,703 *3D09FE82FBBAA0C2E0B27775625E719A766E5F0C CE_M0
593,897,704 *3D023F330EF4D188D6F5433D27F01530C22E34A4 C%Em7
593,897,705 *3D0D01939651D41B1E51C2D54627F423CCF5CB93 CEm81
593,897,706 *3D0505EDE8721137B5540194E4DE60BF483CFDE1 CEmeG
593,897,707 *3D0FA7E7075B7900BE7E3E5484DFE69B4E5F80A6 cement4t0ry
593,897,708 *3D040EC83D5681818EF8604AA5B4C11BC3DF2D5F cementarios
593,897,709 *3D0F56865776AF7912542F5D09CDB5A146DDAD80 cementifica
593,897,710 *3D0B0A5913C497EDD0BB25EC7C991D72E439FF72 CeMnA
593,897,711 *3D09949FE8EBD859C644251599CBA34EF5186C4D CEMTAAAAYAAJ
593,897,712 *3D061E4E928CD417C2AC04A3DF4CB7A83FE0F7AC CEm&v
593,897,713 *3D04A65FCC5097388BE1DC1BA77830BA16A8F72D CEMVw
593,897,714 *3D031D2E19CE9A2A7646DAB43E133EF4FC472023 Ce:mw
593,897,715 *3D0092E5C38E9F9446485738E5D413D919D008CC Ce=mZ
593,897,716 *3D05C60EE6AD885EB93866ED266BB165F816637B CEn?&
593,897,717 *3D06B5B4A1314CA653CC30CAF0860BDD7F4CF992 C$eN:
593,897,718 *3D079E041FD29EF12C4C62E1B086C04382FFE4FB Ce$n?
593,897,719 *3D09732C9771FB5CEE43596835C25143CBECC04B CEN08ITE$
593,897,720 *3D08A7EC76047BF0ED21968652140286995D9489 c@en0lestes
593,897,721 *3D032AF367D36EF4937DFF53ECCCA22E3A70A2EA Cen$0r@81e
593,897,722 *3D0655FD5426E131D9D93752F8FD79D1CEA9568B C.eN1
593,897,723 *3D0649987E6631149DF031979EB1AB81A60F72FE Ce
593,897,724 *3D02465D048CE7208320C61335B09A0534C41F64 CENARTIC
593,897,725 *3D025809150879581337ED4A5678D6478F9F4B0F CENDRINO
593,897,726 *3D092AE86DEF35E782D77490F02867EA0C3607A3 cendy ledesma
593,897,727 *3D0F970A605D60FB38DD82227BC90773CF283D22 cendy liang
593,897,728 *3D0E2CD1C0656AB822166C3AEDAF844144B04ED0 Ceneerde2
593,897,729 *3D01525ACEB180FDDF9907CF59073EAFD6C371D2 CeN/F
593,897,730 *3D00E5CC04DE77B0F38B8F665B96AD9AC9FB7E9E C$ENg
593,897,731 *3D02C5E4190239965E95DE9B3AD2430B7C6BA1AE Cengarle
593,897,732 *3D0BAE935F2B1C36F40FFE4B021FB9EE2C2AD4E5 cengizyavuz
593,897,733 *3D04CBA9D8061C44524D22FD4BD4FFF921E3D9D9 CE_Nm
593,897,734 *3D078DA73488F6FC0532D37592E5C3D56C0B125E CE"Nm
593,897,735 *3D0B0DA421933EDF3A044572F345B2617DFE3ABA C+eNm
593,897,736 *3D0EF7FAC1962A6A0053D2A237C59897B7C7C3DF Cennammos
593,897,737 *3D05AECB492E1A8660CD8E588C5C76458E97EC4C cenomanium-vaihe
593,897,738 *3D0F16026B0618B88108422936603A0F1C90D015 Cenovyched
593,897,739 *3D0E40176216B80191D07F9D7BB763693B15F608 CEN+R!FU941!ZE
593,897,740 *3D0424A33AABD9DADAB9911B4D7CDE589E91E289 censed@netvigator.com
593,897,741 *3D09953768833697BD5CAF27F1ED9325E77F5D0B cense teo
593,897,742 *3D0F8FB8EB98A7BC25F2FE7DDC8B176DFF2FFACE cent-a-bushel
593,897,743 *3D014443FF78324C5B908B2CE69CB4BF99D007BC centaur»
593,897,744 *3D07185445A6407E94A76C633761A91BC8AFDEF4 CENTAURS?
593,897,745 *3D0C05B3E990CB91C4E29024C5AAEBD6A9C8E7C3 centelharas
593,897,746 *3D0682FE7891D69633BBA4CF870B339EF4E5770C Centelia2
593,897,747 *3D060EB99C73ECD7214021CB9601F3047A4CC64F CENTENNIALS?
593,897,748 *3D0FD583D729F6F421C8E895055CC10966ABD74A Centerofactivity
593,897,749 *3D002041BCF6D653997587973F47FEE4657FC6AA centerseekonk
593,897,750 *3D044378E8ABE18F56FF1930D5F87DDFC3325101 Center)のアップデート以後は画像・動画を選択して転送することが可能となった。
593,897,751 *3D0EB6BDB665F5BDC6829C54E86755BE87DE657E Centibel0
593,897,752 *3D0F5A91C6DC7E497AE261C92392F8F9483165CD centīgāk
593,897,753 *3D00FDCDAA3F8D38B192405FBF940BC13E745085 Centilitr8
593,897,754 *3D032044F54420369F2DEFD68AB981757681EA58 Centimeterm
593,897,755 *3D0B32FE2AAE4455DAC59BE5D042E3FA7A4EFB05 centnial
593,897,756 *3D0EDC09B4D724E3AFD6AF7A83B8B5DBC680F1D0 Centoquarantottesimo
593,897,757 *3D0FA463F24248747C8CE2C6DE768CF5B0A902C9 Centpaccr’s
593,897,758 *3D0B3FE9E0FEAA7C4624285D9C00528FF4FDEA78 Centr41!t!es
593,897,759 *3D036FAFD7BBB214652AC520FBADD54830441B48 centrabc7
593,897,760 *3D0370262EB9AC153F59AD64C8068F4BD10C46D3 „central
593,897,761 *3D025C76C3E2196808B8C5DB45503BB24F824516 centrālāfrika
593,897,762 *3D045E447D0010D5C3AA8792C3C36B50325CB51E centrally-themed
593,897,763 *3D0DBC7154104EBCDA619D01175FF56D6F5FA68A central_reserve_bank
593,897,764 *3D04E85BE4EAD1B660199C3053522FD475B874EF centralsteam
593,897,765 *3D00CC31333DD0287EA89E3E6CD7440DD92A0B17 centred.davkal
593,897,766 *3D074B10371E7C94830F5C30A72D2E0C0500F3A0 centrelink123
593,897,767 *3D0E1B6D9D3CB3B994EE82D8289486C74B6C7379 Centrerses
593,897,768 *3D06DDBACE726988E03DFF6D04342FE079687B91 Centribune
593,897,769 *3D076EC63FA31456FE857534C120ED1D785115B8 Centrifugalisation2
593,897,770 *3D0AC8ACA110F1D05CD67AD4DEB743C5706E5231 Centroslavija
593,897,771 *3D037F7D5A2C3E5CA7EB125E3DAB5DD9AC3A2184 CentsOfMine
593,897,772 *3D0C07C72E3CDC968CF02D25D7B650D489469AAA CENT-STAKE-OILSANDS-JOINT-VENTURE
593,897,773 *3D091A9AAF6416FA8FAA60B06E5CC03C41D92703 Centuries (Wine, Woman & King mix)
593,897,774 *3D0ACCC8EA11A3BC0E386DC6D65CD2E07C31188A centuri@tunku.uady.mx
593,897,775 *3D0E8753EAEB9DBBD306A319CDE832DC3971E230 century@netbig.com
593,897,776 *3D03E8C18978D793E248E631EB647B0C9CA60FF4 centurypainting.comwww
593,897,777 *3D00AF46960257D1DABEB9649A72EB30A573A0A0 cenyu@21cn.com
593,897,778 *3D0B898B013CA46AC3E8902350951626E9EAA5BC CENZOR
593,897,779 *3D045F7DE6F9B100C1E1A37DCCAC7AF8C14132DD Ce_O/
593,897,780 *3D08DEAC75A6D62758E984852715BA6EF2F524A5 CEoaN
593,897,781 *3D0F941CA907D7651F30B6CD79E638A5BDD75908 CEob5
593,897,782 *3D0F56572DE0A9460F55CB53085F2EECBF840250 Ce_Og
593,897,783 *3D058C6F93DA2069E97C791A3704AFB494CFEBF6 CEOND
593,897,784 *3D0C568C95F4016A9920F325F5F6EE0BDAC21C5D CeOO
593,897,785 *3D0EDD33408450EEDC9113318BEE4E6501CFF58F CeosW
593,897,786 *3D01289A0FB6DFD8C23693B654420EB9201E17B4 Ceou=
593,897,787 *3D04C2750F1B83F799D6FDBF0E71E1E154F4A33A となり、メイソンがCEOに就いた。1940年までメイソンはケルビネーターの市場シェアを伸ばし、ナッシュに利益をもたらし続けた。
593,897,788 *3D04F0D4C1D50AE4F0409A02084F2012C6CCBEBC C&(Ep
593,897,789 *3D0C30286AD040EFF56DD70E054636FEB189C20E C.eP-
593,897,790 *3D0170E7B9A9FB73E20BFDCE3CBD39768CB69E0E Ce?p.
593,897,791 *3D071C7823ABE090EF9F52A6B4D1EE4B7A639F24 Cep$
593,897,792 *3D09F394D4A5C69D930D8C51DA5645178805F554 Ce&p6
593,897,793 *3D0FB4A7FD24CEE7E740D826BCA8F1620A9D1AC4 C(EP8
593,897,794 *3D06D0A891E4872D54EAE4F3373E2D4651EFE20C CEPADIN06
593,897,795 *3D0716CEC8101F78F2D058B0CE412B3A04C19914 cepa@eyou.com
593,897,796 *3D041ABC7A6CB0DA1DAC1CFAFFFAD223BC13FBDA Cepetnau8
593,897,797 *3D08AE54D4689EA89ED0B74759E28264026463B6 ceph4lo5tyle
593,897,798 *3D0E886987DFE3BD9015A96101E4FF8D79B7952B Cephalocone2
593,897,799 *3D0CFB70FB24BDE1C16E22298D256B2D519CF8C1 cephalodymuscephalodymus
593,897,800 *3D0D51477160846D496956354018AA90934739CC Cephalofovea
593,897,801 *3D0FF5BC819B9E7CB89A3B71532C1F6A8F2A43FD C_ePi
593,897,802 *3D0806D03991257B0BFCECACA45189EF8F877056 cepifdkm
593,897,803 *3D03BC7A1C531F9F469DF00EBB88BD34801E999B CEpl5
593,897,804 *3D0915AA1D03E41BB5471F71CA24935566054DE3 CEP,M
593,897,805 *3D0EF4C459AEBDC87CCEF76DC76A780542D7F623 Ce Pow Pow Sings His Fun Song
593,897,806 *3D017439543FE84091F8B5B57A1F2BBBBF2F746A CEP-Q
593,897,807 *3D016119A243594112D142F86C6583587FCAF09E C!ePr
593,897,808 *3D0C59BA534064C08B12F10F0A2AA6CAB0BE3582 CEpvC
593,897,809 *3D05CF0FBB4A586C553547101CF8FEB56C47DF59 Ce_q$
593,897,810 *3D03946653A17D1E01D92C10908A3501F32C4C11 Ce:q/
593,897,811 *3D07D0D305DFBBDFA8271BA10675E6327E81A1EE CeQDi
593,897,812 *3D0A48D60AC84EB9272410FBEA4C45A4EFDAC318 CEQFG
593,897,813 *3D0E061E0F3EBA137E5A608B63611E79307CA194 CEqGG
593,897,814 *3D0165281CD0E1E860725528422E4B9740C3C258 CeqKC
593,897,815 *3D01F4B9D7034192DD541EAEC6E1B179B1963884 ceqmg@yeah.net
593,897,816 *3D0A2FBF453ED333DF422CA0E65DD92C2B8F0537 Ce.qN
593,897,817 *3D0BABDCEA029AB2EA6F0F6346A70DD21534C124 CEqn0
593,897,818 *3D01E09BC08881DC71318CF44A8FAFB6ED8E4854 CE-R%
593,897,819 *3D06F800073FA1A0DD80691741AF3419DED28FED CE?R(
593,897,820 *3D056A6AC6E9CB36C412E797B530354714BBACCF cer4todid4e
593,897,821 *3D0FA79F160FD72EA4BD17969B567F4B896CD56C CE;r5
593,897,822 *3D09CE8C8EE9A1BCE3D709645260AD258F420354 CEr7_
593,897,823 *3D0A7B4B06FEAE3BAD3DCFBA0BEC1C256E1A6FDE CeR99
593,897,824 *3D01BA9EC5DF3B443CDB8664EB52B37B234A56F4 Cerambux
593,897,825 *3D0E589984218A1208E484C737F557B720EA9626 cerambycoidea.com
593,897,826 *3D01C1F1E235BE77C4DBE8AA1F94EB3C940A7CF2 ceratophyta7
593,897,827 *3D0E3233ECA3173085DF588A2B49146B4779A1D5 cerbytkjvfqmtgfc
593,897,828 *3D014F32CD6331CB698C084233F008422A81A105 Cercane0
593,897,829 *3D0DDC11DD0E32812A84FEED41DD02C52810EF9D Cercioraramos
593,897,830 *3D0E7734CE7C90A0408D6D74EA411B0818427680 CERd-
593,897,831 *3D0EE53559EA2D553AC9B87AE189021E229058A0 CErd#
593,897,832 *3D01854E28C8F86478E90DAEBB4D0D917A8289B4 “Cerdanya”
593,897,833 *3D0AD4B82F2E73AAC65EF6246502654CA6258C07 CERdU
593,897,834 *3D0B95AB1598CF7FC9D1906AA13A635D8A9EED32 CERE8RA+I0N
593,897,835 *3D09FE2499B0062AF9F16DA86ADA3BCC165F27F9 Cerealina3
593,897,836 *3D08BD137ECD363308BA39A3C78CB9A36BAF2815 cerebellum@mail.apol.com.tw
593,897,837 *3D03D34B6C7ED56B76FD7B14201704022872FFB9 Cerebrálna
593,897,838 *3D0A75F93ECC766C555B2AB4A9A048A600476B28 cerebrasthen1a
593,897,839 *3D0AD4B8B3C9C58A946CF1D5F4EFC7DE92A40308 Ceremín
593,897,840 *3D093D268651E3DC8419F88562B43DF7093F19DB cerenkaleli
593,897,841 *3D0E14BE7D81C3C080D83548BD766828A2D5EF50 CErEswYh
593,897,842 *3D00F807015935374B08194B634F130A640EC695 Cerfbsw2
593,897,843 *3D0DFD66CF7F23583FF291643A8FB23E5D63CDC8 CeRhi
593,897,844 *3D08354E4BF4666890AF081108BAFAA85D364517 Cericault8
593,897,845 *3D0ED8743C297F615C1FBB5D5BFFC06157DEDC19 cerick1001
593,897,846 *3D048498F4173C4009818DF9C5ECEB0892B55804 ceridinu9
593,897,847 *3D0BF2935762CFEEE60EE8D79CAAC4F00D70DA2F cerífica
593,897,848 *3D023C23F385CD74AA4AE7389C18076A8B0FA881 cerisecerise
593,897,849 *3D05AD6D7EE07D3352B16D33542057BB249C2B59 cermis-patto
593,897,850 *3D08418A0C6D28D2575963435D52CC326F80AC70 Černokořán
593,897,851 *3D0AC42F974350F5A0015048D7E58601258C841C CErNu
593,897,852 *3D034AD08718620B30069A90C5F110CE701E09E1 Černychą
593,897,853 *3D0636E5CF479E37082EA2A496E5B7B55BA72A82 Cerotic!
593,897,854 *3D01F93A360F2953B8573466FC9B8125AE7EEEBB Cerqueir7
593,897,855 *3D09B6497FDEA68CF9A704E4CA96B66FBEBB0251 cerstved
593,897,856 *3D05DB10378C9A88528D1ADDDB5E97DA5A9A72AB cer@t0s@
593,897,857 *3D0A9F7830081AC2647F95871828789AD1F9BD51 CerT3
593,897,858 *3D08FE23C5F68B944B00BD57E1DB2A64DB42F778 cèrtains
593,897,859 *3D079CAA02A31699C15573A31226F103723D2325 certaintyinspections
593,897,860 *3D0A9E6867F7DD3284FE2CD734F21B0B67285756 certanturque123
593,897,861 *3D0EF3D57279788BBB43E24E68BB2BF5C0295EB6 certanus9
593,897,862 *3D0F8CF828B9EC95BA1B6E0E93770EFC1C5C1D02 Certarisque
593,897,863 *3D078F32E9A9EC3500A88485AA7FB0013A34FCAC Certatum3
593,897,864 *3D03E25C0D02E07FD1657600AD3A05F1EDED52A4 Certelles
593,897,865 *3D07D1EE88ED686D31FBC44E4B72151A198C775D Certilly
593,897,866 *3D0E30ADFCDA8E850E2CC8A7BD855C37940D50D3 certlit
593,897,867 *3D078CF6E96C57419065512AC132A12ED7C129D5 CE!rU
593,897,868 *3D01FD1411D4BD42B09656FD09209753C63D81D7 cerulean555
593,897,869 *3D09FF85535DEB23E9961243DAFBDD6C0130CBE9 cerulean64
593,897,870 *3D0D05EBE0A29B27AB2CFDF8874B9A8C0B6DBBB9 Cerullos
593,897,871 *3D067F162D8795530D3B6E8B6F882D55A2DFBFCD cerupset2
593,897,872 *3D0BEDC091108DE71ED42CE0CC0CB20D3B626F22 Cervenakiem
593,897,873 *3D0F003BB262EF9AB0B5E6DDE82466B0B34624C2 cervino1986
593,897,874 *3D0F51B8ED4FE9318D016CA929CB0DCDCA3F0358 červivějící
593,897,875 *3D0A32D94A9DEF3C96D4E5EF3559F192C82E860C C./Es
593,897,876 *3D07739395CAD234DA965ACDC7DA6134E8BCAB4E C?e=S
593,897,877 *3D06640A338AEBB762549D72D511BB08E43DBC3A C_e?s
593,897,878 *3D008715C2F6490191DDFA45361AFB84725E5045 ces88tir
593,897,879 *3D0B5C8880E2B0C0AC5C5B8E5116687AF9B4B94D cesaj@yeah.net
593,897,880 *3D0E003044AF792DFE3B47017382D606D773B055 cesar206
593,897,881 *3D0C0A89133E365FC6DDA2E2E85E02E7625CC655 cesar.barillari
593,897,882 *3D0DDBB5CD49D0E1ADAF03F8170C293A94339D4F cesar.budish
593,897,883 *3D01B73A52125F76CA252A1ECF0966B4AAAFF546 cesar.burket
593,897,884 *3D0F7ABB5264FC17E5BB1B21D9E16DB61A2B3B6D cesar.cadavid
593,897,885 *3D00F55BCF907AE203A1FA7011E6F23A2DB5A908 cesar.debrae
593,897,886 *3D0DBA2FC795BB2AAD102D8A4C51C429C16FFE58 cesar.decarmine
593,897,887 *3D07D142B69D61BEEE0B4913E802024E43B9AB46 cesar.gallow
593,897,888 *3D0099382CD5BD5FBE35D3AE5A5287E17A7EDD08 cesar.gauwain
593,897,889 *3D0E402E6CE54EA6F7FD30F3FB2E429D0E255602 cesar.gonzalez
593,897,890 *3D0D52ED3F7D0053D4729BE29ABC04A30A229C69 Cesargreenday
593,897,891 *3D0F8A91AA282307BFA06C43263B58BB008424D9 cesar.heidrick
593,897,892 *3D0D155252D67445405B56C6B27C8863DD2C7C72 cesar.helmick
593,897,893 *3D00488153D3BE6FC96EA00D789102FD9A80E889 cesar.koons
593,897,894 *3D02875779F1BE06D5973A14CC0C60057BC2E54B cesar lizarazo
593,897,895 *3D040AAC5929A163986CF0146E34C4840EF53013 cesarljf9
593,897,896 *3D025AAD2F72E27E0E250260B9A6C1FBB8F8BA05 cesar.mardis
593,897,897 *3D0A49D911D02E34A1FD9A53E50D43D48008B30F cesar.mccoy
593,897,898 *3D09D1898C95344C73FE8442154E3D23BEE1B7D1 cesar meireles
593,897,899 *3D06550183ED1F5EA360121967140BF0D84C78BC cesar.ricardi
593,897,900 *3D0854A44F2E31642BCA88F841587C955334FE12 cesarrotter
593,897,901 *3D0EF7E722D854A304960BDCFA1F1F1C449F9E99 cesar.skomo
593,897,902 *3D00F1DF5A7E89A346425F9832F79079C393939A cesar.stagles
593,897,903 *3D09EA55F2158008B9F1950646D0D7CE4F9E2339 cesar.taddonio
593,897,904 *3D0DDF5F6DB7C1BD21AA3E5C76C06D032147E7A1 Cesartoby0
593,897,905 *3D0C04170677762B0A77304571FB7411C09DF9D2 cesar.valenzula
593,897,906 *3D0EC718096B4EE9C459FF0490AD62A8FC63BCDC cesar.venegas
593,897,907 *3D0FEA1B955EC3CE48C89CC41C76A9942D848E34 cesar.wademan
593,897,908 *3D054BD29F955D49F18E370F5AA3FB65EF061C37 cesar.warsager
593,897,909 *3D0DF194BDD6C7D711C30AE85CC4F57937CDC6EE cesar.weant
593,897,910 *3D0D98C501ACCA9FA29885A0127EF4D1B95D10B8 cesar.yahna
593,897,911 *3D0FAE118B08837E09D3244961473C2168331C43 cesd77
593,897,912 *3D0D61DD1E4931714890CF20B8442FACF9CD471F CeSdE
593,897,913 *3D02AF2E3E3A694E150B6B2C3E4C9594836DC7CA CeSe/
593,897,914 *3D0B082F8A51A4871829C33DAC9642AEA87636AD cesem@ceibo.entelnet.bo
593,897,915 *3D08E0CC1E6A27A1F8DFF7375F8A4D8C37EDBD5F cesendello
593,897,916 *3D0EF49A941F88E503873092697B8CA464546331 cesitn@188.net
593,897,917 *3D0DDAAFC470C032A0B8EFFBD623604F622A4757 Českobrodsko
593,897,918 *3D0DD7BFF2C453EE6E4675FA5E3E6E5393E00370 cesl@giaspn01.vsnl.net.in
593,897,919 *3D0DAF71CD4EF9D7160F137352AC8A70EF96CBAC Cesnakasing
593,897,920 *3D026C79C1B1244451BF8F9D8E56584E3F858BF7 Cesnocnued
593,897,921 *3D02FE0BE2827661596E557B204360ABBEFC519B !@#cessation
593,897,922 *3D03903339581744D19AF575483C82F9B6117A01 cessat!on
593,897,923 *3D0B6039BCCD5BEE00F91CAEEFD9CFD0DC88C19C CESSAVA.
593,897,924 *3D05C4BC620D2A3D562FF1FD4A9D5DC10FA97060 CESSERAIT1
593,897,925 *3D0D8D03230DEB6300FA54F221231A7CB4878553 Cesseth0
593,897,926 *3D0AE73E4A466C766B9262E93246D3373427FED3 cessivas0
593,897,927 *3D08ED1EF6764A4407EC06CB6B79D7A7D78F8250 c'est clair
593,897,928 *3D0DADB70F90AE90DE9068A642D647EF7BDE8458 cestidae@tom.com
593,897,929 *3D051BE8FB9C47202D94A28475B9DAB84B6B5BC9 c'estlavie,cuicui
593,897,930 *3D0446B2E52B17F1F88DD4449F7F7025DB4E27EE Cestode5
593,897,931 *3D0B5FADB87196C34433FD65D17FCA2EF217EB74 C'est pas ta faute Moha (2000)
593,897,932 *3D0E2A104BCAD428BE3309A3B9FA90D134A05260 CESU"
593,897,933 *3D07C9AF96325A9EDF2117ECEF76477843875632 Cesvolst6
593,897,934 *3D0FF586AFDFAD549C988DA6063EB61414441EBD CE+T$
593,897,935 *3D030A0FCAD77C3BF7EE5D805485D4B453A89DAB Cet1R
593,897,936 *3D046D8139EF2333172FB0C665BF42E842ABB9F6 Cet5
593,897,937 *3D0028ACABB4D37617A65247EF393352B61DF896 cetaceous@sinaman.com
593,897,938 *3D03E1765D593D48CA3E27D6DA86AEFC24FCC891 Cetaphil8
593,897,939 *3D085FE47FC0C64EB3A72F5E85F411038715B642 CEt)b
593,897,940 *3D078127FB40DC6C968C97B0774FA335647F2E98 cetesh
593,897,941 *3D0D714D92CBC1AACD159641B4823A14C0C25349 CEt,H
593,897,942 *3D0E272F0C84E61BF3789E8BFB2A00DBC741F617 CEtHL
593,897,943 *3D06766DDBB616D5756DB527F164E4138E7F210B „Çetinkaya“
593,897,944 *3D0C0B9C12202798D5C7687EC66AE64D8DFC8B78 CeTM)
593,897,945 *3D0873F20FD921A5EF23654A357970BECD96EE30 cetmj@yeah.net
593,897,946 *3D04BC1C4A53858CF51DC839D72073F1587703F4 cetre0
593,897,947 *3D01628C0DA8E3288AECD0D2CC284413D6C917A5 Cetsnart6
593,897,948 *3D0F8511E73BA84DAB1753AABCAC3648144BE07B cettipaolo
593,897,949 *3D04A588603FF7F793CCC2B6FEB8F9A6E3463E6E CetVt
593,897,950 *3D0A9C790888A9F14AEAB661E46E08ED39F9AE4C CE
593,897,951 *3D04DCDA91146D5E2ABA56C447763876BA118AD3 cetzhtwzjd
593,897,952 *3D021B7CDE9BD42C845E7116E2962CA5B57E4074 Ce(.u
593,897,953 *3D089655B85636E4EDCB8570B6301F5593486B2E Ceŭ
593,897,954 *3D02A642CE71F84BDBA30F1437FA3930AF1F3816 Ceuc%
593,897,955 *3D0783B9A4DBD33023AE0A14F01C8C09903B2D99 CEUR-WS
593,897,956 *3D0C0020187C336FFEE9E0192F4CB6B142549EFF ceutát
593,897,957 *3D048B9100C6E0E07145FFB7B2ACDE4302F888C6 ceutorhyncus
593,897,958 *3D0F1FE50FF96E3911C0577B52252E6E36C1C503 CEUY,
593,897,959 *3D009AB187C0A6CCA684A7DE5FEEEACFFC847424 C-%EV
593,897,960 *3D07D2B0ACD304A4DEAE2785CDFDC7A7CF3E1A08 CE-$v
593,897,961 *3D0D745415A7780427F96B155F7D2FE7BF915CE1 Ce
593,897,962 *3D09C5D9A874253875CBAECF96928776D94AD7EB CEv;0
593,897,963 *3D0C4346B9757F4CF16614342317A17C5193D504 CeVh
593,897,964 *3D02E1A6D205112BDF3947BB9733D2B8C92658ED C=eVh
593,897,965 *3D02EAD68C438353A598D1B02848DDF2BDEA89EB çevirmələrdən
593,897,966 *3D065BCF51C36EBF6A33D11BF473D91166EA68E5 CEVITAMIC2
593,897,967 *3D0FC872034308308F3AAC9AEC9EF8035A3C42B9 cevj@sinaman.com
593,897,968 *3D0F1F9EB74A28F0EE22DD1B52547537759FDFC8 cevop5gauwyaa0
593,897,969 *3D02C85AE360641979604FBFEF7C49ABB7336075 CEVOX
593,897,970 *3D015C46ABFCEA78A7BA3E1A600DA7A03ECD9B16 çevreliyorsun
593,897,971 *3D0450F7106085CA244DEFB8908BC6D75264BE23 CEv&s
593,897,972 *3D0DE4B92FDA3E7A9EEC39547630158177C9A9A1 cevzh@yeah.net
593,897,973 *3D0007E6606EB2683E7D5B03487C107ADB7BE927 C.&EW
593,897,974 *3D01220417909DA0372EC34175A7BFBEEB8878A6 Ce)W_
593,897,975 *3D0BF47EECBC261BBEE52934A5E1B211CDC1C09A C_;ew
593,897,976 *3D05079A02890C7921C2D6EA4EE69CB1DD9484B7 CEw$4
593,897,977 *3D028769E496ECA0A061AB97742E508731DBFC20 Cewagenses
593,897,978 *3D07EFF7A3890160B28F3FA59E572640E0E44367 Ce-WC
593,897,979 *3D0D2C8F5F3F63DFAEE8CAF3DC770FFC2E33D742 CEwfA
593,897,980 *3D082BC8A277FC95C272BDC87AEC5A8DA2FA284D Cew&G
593,897,981 *3D08BE3439E84691432DA804A582D02A463DB592 CE
593,897,982 *3D03E6BD7FD9321E2838DD5DBB6FAEB6BF75C22D CeWjM
593,897,983 *3D0D8A0092BC2EB8638C211E102651C70E2CDC22 C/EWq
593,897,984 *3D03F770A0EADE8434140F5C065BF3FAB88C0450 Cew=Q
593,897,985 *3D0FE76E224938951449DBF718834A07B8472C30 CEw:Z
593,897,986 *3D067F797A45F5E7FFA9A281571DA35DE33A6705 CE!=X
593,897,987 *3D0647176917A06BB190DB9DF4DB170CD19AF1F5 CeX3u
593,897,988 *3D0FCDBEF9ADBBF4F8A6BC4E7F2756E7A8D439D6 CeXcX
593,897,989 *3D066830ED443235CFC302A30C328C94D3EFA250 cexpert1
593,897,990 *3D027DFE7B43EABEDD7AD6A46C025DC29C2AB65A CeXSL
593,897,991 *3D01683151764630A381242A82EEE8F5FE6BBBA5 cexzq
593,897,992 *3D00370ADA3A1761E09FA6ACA52ED82201F5D73F C+#EY
593,897,993 *3D0B1A92E4A20EFD72C54F835497D68B6EE0D531 CEY".
593,897,994 *3D0C2F32B25D05BCDAFA8C53CBB9729629741A38 CeYcF
593,897,995 *3D0B32753966E54985F0F78851523B78CA85847D C.eYD
593,897,996 *3D09C18948A81165A347F95B383F8B51A9EF1B14 ceylonba
593,897,997 *3D0326040CCB4E26CBF1B1FFB6F829BEDB1800D3 Ceyloningged
593,897,998 *3D0B9A27535F59B6F3656110BF5776B65CF6D433 CEYnN
593,897,999 *3D0A3C6D6B97D1AB3511E9C24788431D976A9579 ceyx7
593,898,000 *3D060296113051BAC80B7EACBB92B17E39C2C4CC CEZ$%
593,898,001 *3D0CC28124F4791070E04848605615C9BC0F47D2 cezbedilişi
593,898,002 *3D0F9285D2B6C9710E706F974FEEDDADF7266955 cezcbb
593,898,003 *3D0F0408F9BF2518F98FC4CF68A86CF048CF542D CEZl.
593,898,004 *3D0EE647AD23AF2C6459BDC7EB493817E2115146 CEZn&
593,898,005 *3D0ACADC6AD226FF2FD5E55785B7179B6745E2EA CEZP-
593,898,006 *3D0832E3C2C3948B946C9460AC780A28EF97BDE4 CEZXd
593,898,007 *3D0ACC9A227B575A0D9D922AE0F73CE567A0021B C)F$,
593,898,008 *3D03405938CE4B50D0EEAD9609A0B92E7A2E55BD C$.F+
593,898,009 *3D05B896838086116065F466C17B7571DD39C278 C&F*
593,898,010 *3D026DC249FD2283306480FB40F05E68CFDE55F6 C%%F(
593,898,011 *3D069249B5423AEE3535779C6191DE0E2E34163E CF=))
593,898,012 *3D0B844C969B0056DB9FA0B49BF32650F3C6C3F6 C,f;/
593,898,013 *3D0ABA4CA3787E764183144B662FA39F1B3DF135 C./f$
593,898,014 *3D01C416AA1885AFC429D0F0369EDD4F7A6773DC C%
593,898,015 *3D087218C03FF6030EE600471F893E472012B488 Cf(*
593,898,016 *3D08A3A4C6DE4F5A722E6F1B0908AD900B427562 c$F"
593,898,017 *3D03BF09CDF9128A9CFB1A8C2BBE5EC5A757E4BF Cf0ZN
593,898,018 *3D02D4877464744B1A372D8B94B7402BA2D6CCD2 CF$_1
593,898,019 *3D021BC5840FD9BE8EDCAA482D81314EEBC7072E cf125t-2
593,898,020 *3D0799EF337ECA4F56A0B3CE51951AB8AC90B8A8 CF1e6
593,898,021 *3D050CFA6F0EE7674DA821F5F128976C6AAB7783 Cf2$d
593,898,022 *3D0B312D03532683E23F91BBAB3BC72F4142036B Cf2IT
593,898,023 *3D07A3BF76A7A87F9A913FA47A67F8D3D92C4FBB CF2YL
593,898,024 *3D0EAD008BF3BB47D9A37ABECBF943CA85F5C815 C_f36
593,898,025 *3D00A0BE6BA53BACE787321856D4257F888CDFCC C;f36
593,898,026 *3D01998182C4C74F2397EA6C39A8BDBC6AA965C2 Cf3M2
593,898,027 *3D01F73BE38A5E5D2BA87632E8D9543720D9D739 CF3R&
593,898,028 *3D03AF07764FEEAE9357D5E3B2011C561DE78C9E CF4gX
593,898,029 *3D0C7973E95F13F72B01F28989C1C64F09F1E409 CF4ir
593,898,030 *3D010F2E7A5C20A3B9F18DCD69477FD936F8FD2B Cf4Q?
593,898,031 *3D02C7D189C0DB4D4FEC7AC56554FAD6137CA247 CF==5
593,898,032 *3D0E766AAE15B16426D2E63D8371DAC10EB6C7E0 Cf
593,898,033 *3D0C0332E550A5FFE02F59F2333BA60636916BCB CF5AK
593,898,034 *3D006077366ADC7ED5E270EEEFF5A7FE3FFBF7C4 CF5.D
593,898,035 *3D0E7C53BEFB0D01EC9DA3299CAB2009F90465F6 Cf5MD
593,898,036 *3D0BE82E22BF3E8F06A0F4E135DE7BDDF8BF9909 CF5Zr
593,898,037 *3D0E5E14DD82E7F2B545F97C7CD8CD44B77978D7 Cf.6f
593,898,038 *3D0AEB0FEACD1DAC411967AF4EA4C9B4FB5D8963 CF#6h
593,898,039 *3D04F7279FFA75FBB1BBA0F2A58B4A62BD439E57 CF6mH
593,898,040 *3D06C420757642B75CB14859BFD0BDD2E76EC84E Cf73B
593,898,041 *3D0A0BB7C3E463CAF9306494C78AA045FE8FE975 Cf7d7
593,898,042 *3D0CAFB59D8E2BF84BB7279285D187CE5911BDC1 Cf8-G
593,898,043 *3D06D5F8B07AD7F1D6C1BBE564E4FE6FE19E6F4F CF8
593,898,044 *3D0D10FB8A3601D4F9E5554D378C6E59D7B370E4 Cf8M1
593,898,045 *3D03464B4DA425B9478E9ACB3907BDE9EDE29C6E CF8Xc
593,898,046 *3D0FA060D97B51A8A0A22CD2371AE6E4808F5583 C+F9#
593,898,047 *3D09958DFD9B748DFB44E24087DA2FC2CD8F452B CF&9!
593,898,048 *3D047CAB5DF4EE4F88344A60731BACC2EEA55CA9 Cf;&9
593,898,049 *3D061DFC0811B372208A71F387CB58FE421D1013 CF9od
593,898,050 *3D00D5D672A5CA8211F6DE7F547A39950EFC1B08 CF9ZVKNY
593,898,051 *3D08CF5027F093F7A21704C345BA8FB594E741BC C/F-A
593,898,052 *3D0DD9F0EA868FF09BE3EB1A0166682BD7CC0EA1 CF=A;
593,898,053 *3D098D3A7C2F6B2CACC8B6F8B7CC82EB32942AC0 Cf(a:
593,898,054 *3D017F9D34D0DEB4432AD40B1BE1E5BAB3DEAE77 Cfa"=
593,898,055 *3D04372A28365826DD749D77CE9C097F556C5131 Cfa2G
593,898,056 *3D0C49D0EE7368527EC36DDDC3340DED4A8A357C CFa3B
593,898,057 *3D0D89ACDE582305A5EA86B34A2EC9AA88FBF70E CFa4_
593,898,058 *3D077492AC80F237ACA8162F86ACB50AC79FAC13 C&fa9
593,898,059 *3D06CA77CE77B4866142239391F16EC4435217A2 cfaak
593,898,060 *3D0432808F1A23566D0D012FEF74BEDB8BDE6A65 CFAc8
593,898,061 *3D01EF82F98D7B3A9A7434E819A4947C0B4F0490 CFAg2
593,898,062 *3D002151A7939945BF448FF122A8A3813E9CA40F cfaliens
593,898,063 *3D0AA8118506BA53B82E6A432CBD5E869E40DF47 CfamR
593,898,064 *3D03C1792CBF167147305B3F26DD03B7D94A7521 C(faq
593,898,065 *3D09E71201EE845ACC6517B7410CB3FDF8807928 CFAR#
593,898,066 *3D0AFD80AF51EE5A86CF23D1F2D561D0D03882D8 Cf@b
593,898,067 *3D09449252A4EF41F97D635E7F522CBA8E821D80 CFb0M
593,898,068 *3D0119A71CD7826326F5D5C783FF7431A7D477C3 C=fb9
593,898,069 *3D08A25C1B10E0CAE46329989F46D3860BE11287 CfbAH
593,898,070 *3D0B9DEDFC07AF916E610BA42E65DA0318C0AE35 CfBgn
593,898,071 *3D0FAE3D80C8389BD9B654F772E66584D33D9DBA CFbkr
593,898,072 *3D051A0D70E1C4C6E28B6D7BC3647E9725EBAA69 Cfbo_
593,898,073 *3D0CC2FE90B519808ACE122504DE75FEEC0BC213 CFBR$
593,898,074 *3D0C185340EAF1452CCB731FEDF52E9E1337A033 cfbvw@yeah.net
593,898,075 *3D01E599F7E429765341A93DD47C1AF659AF27D2 CfB;w
593,898,076 *3D044607912216715BF89AF03B10E9CBF1CFDAE1 C"Fc&
593,898,077 *3D02AC402F9D522512E51F86A364A1FF91D33B6D C%f:C
593,898,078 *3D0F49C7D30600F639DEDC28150397E8FC28F03D CfC08
593,898,079 *3D0F5F1F4EC62F2A73DD6C4014179720CFBA8784 Cf-C9
593,898,080 *3D02F94239770A91A585D648143116C0D25A567B C?FCc
593,898,081 *3D02A04D0EB1D33CFC60DCA8CF45E665A24C8099 CfCHn
593,898,082 *3D037984F48D349D7C21E3EA7ABEB06EF7B7DDEC C!fCs
593,898,083 *3D05FD1187546AA4C206D7B75451A2ED9D002B29 C++fd
593,898,084 *3D0F65A1EEBFB23B61FBA2B7261A157C4B09F8EB Cf+.d
593,898,085 *3D06721006C3356CE4AF9ECD39CBF6A1AFDFDFC3 C/FD5
593,898,086 *3D0C8236D024609A09F8BBE12D12CCE10F29DDBD cfdai
593,898,087 *3D028CE46BB428C5364A172D7E449DCDB3DC0775 cfda@netvigator.com
593,898,088 *3D02E18FA360162EA7262C3E3CC7C41743F4E665 C#FDD
593,898,089 *3D0308C2E0AB4A2A6C8880CEC1718AC4EBE603B7 CfDDr
593,898,090 *3D07D52F40DB350B2E97F34DB911938228629EC4 C,FDH
593,898,091 *3D04F9F016E03B913337BB585605680014CE8CBF C.Fdi
593,898,092 *3D0CD41342A05CBF7DE3FF15E7E9E30441B6DFC8 cfdiskfdisk
593,898,093 *3D0B0ABB282EA732CB0353381AB55E1E7169C4D6 C&fDM
593,898,094 *3D099E8ADF107871163B12BB5FC28FE5A45C5621 cfdqk@yeah.net
593,898,095 *3D0001A9B076AD3891457B329C93156A31330B45 CFdQX
593,898,096 *3D03F57655BB4E5ECD800ECC421DAF535CABF926 C/f.e
593,898,097 *3D091923C36857B457922F6A86E3AAC6BF4C481E Cf?%e
593,898,098 *3D0BC29CD71EDF17D18A8E31998E8884C6F22121 cfe@0335.net
593,898,099 *3D0B903B2CEDAA70F4C267C5C458155313CEFAD8 CfE3D
593,898,100 *3D0DD8D676913E4B97E57E771794B96297876689 CFE5&
593,898,101 *3D0ABB306AB64E83F6D716979C666D46B6A17993 C.fe9
593,898,102 *3D0975DC61089086962202FBC5E459BFBF45BFB9 cfeboom@aol.com
593,898,103 *3D0760810C760F2D74DB231C5D17D27CA7B04F66 CfEbv
593,898,104 *3D0F668F5586C5D74AF0E758B923CAD6F67A757E CFe)C
593,898,105 *3D0BD1847F761DD85FB7BDA712991B815673343A Cf?EF
593,898,106 *3D0DE5A1748ECAD8F23EAE7162BFC6718C2CD443 CFEt?
593,898,107 *3D03A06572933E55D7392C34A296343D0A86A818 CFEu
593,898,108 *3D0D8A25DEEC43E29510AF5DF885CB5CB0B31A0B C/Feu
593,898,109 *3D0E1E4B89F2DBB0CEEA6872C0A62335C94CC3E6 C,fEZ
593,898,110 *3D00E02239DD7DE9E0678756080DC8484BE556DE C=f.F
593,898,111 *3D0766776CB904B49FE6F1FC7E77BAF3D8D59338 Cff05
593,898,112 *3D0EA8ECF72E2F7084FE3138A602EF1D769F3DDA C%FF9
593,898,113 *3D01743B09756BC70BDA1EBD44B5C78C27368738 Cff#b
593,898,114 *3D0560CF1624D0D0F1549AEA56BFEE798F1998D8 Cfff)
593,898,115 *3D030554F3385EE8CE8A2350E5565E7866F95787 C+FFh
593,898,116 *3D06E3606B515A0C5112F24C9A271CDD2B1DC8C1 C=FfH
593,898,117 *3D03681E8B62CBC74DFA2ABE9759FC9285FDA217 CfFHc
593,898,118 *3D0EC0DF963D3DE3F0B6FD941B684A36C39B0F58 C+FfW
593,898,119 *3D0D732D443D78B48208C914B28379A569F88573 CF!GB
593,898,120 *3D0FEDFF2A124684CFAB532A3B539C75D827FF83 CFGBv
593,898,121 *3D0D3D1491CF8C4141E344F4C10FE8BC6F5542CA CFGcg
593,898,122 *3D0DD32E20E89ED3958DEF89F63FD292BF9A529C CfGDm
593,898,123 *3D07546DEE858A71EA6F0CBAE4D8C0223E96C923 cfgkb@yeah.net
593,898,124 *3D09048FDA7C3500BD3C1188AB95FF5D40B07AD3 CfGr5
593,898,125 *3D0C7D213B6A6DE323C0B82C85C0ECDEBFB6140C CF?gs
593,898,126 *3D04168ACF1C35F4F4ED63F505ECB8AC6C9F9DF2 CF"gT
593,898,127 *3D0886AF7CA50BE9090CE7542A51944AD3AD10FA CfgWf
593,898,128 *3D087A920983A402B8B8FFA8639B607BC70703E8 CfgZE
593,898,129 *3D0BC16A36E69FEE54934BF3B514140F9D2FA2A1 cfgz@sh163.net
593,898,130 *3D0DD73404AA62A31CD0EE9E1461680F8C09A146 C??FH
593,898,131 *3D09997C5053EF8E142CC3803C33FD3754B98300 C(F?H
593,898,132 *3D0A67D5B2C2FF083A05ABD0055025B3A9C754E8 C)f+h
593,898,133 *3D01B72056FA0CA8A8BC18416A467223DF162B0C C-FHB
593,898,134 *3D0538DF8FA29ECF1DE999BDA7F9183F536ED55F CFH_C
593,898,135 *3D05D1A486EA8B25C916DF14B6E4946F5F311C10 C;fHe
593,898,136 *3D09E3A53977F1BB8D5F4B34ECC818B185CDA117 cfherbs
593,898,137 *3D02BC2BFB3DB5609214DF1276492C2144CE7456 Cf:Hh
593,898,138 *3D01AF8304D79EAD4EB06409E99ECF8B9CCA1051 Cfh,n
593,898,139 *3D0216F49345E12FD3B4858C82508D67E2BC6451 Cfhr;
593,898,140 *3D01CAEF0DDD35D266C31F64FD51C694476CEACE CFhrb
593,898,141 *3D00E931D6A1507354C1366BC07C17134A8C5B8D C)fi0
593,898,142 *3D0EEFA2811B7FD19390CDA53F20020671ED321D Cfi!0
593,898,143 *3D0FE661ACE3F2C3FE7BC9E2BCD6C488010A62A6 CFI14
593,898,144 *3D0DF25651725B082DBAF4E84E8BD8A9D8908274 CF!I9
593,898,145 *3D0DA600D0477DC99D74DE1BC2022558416F769C Cfiballs6
593,898,146 *3D005474C8FC2F05CDBC49B226EC3FAC6633002C Cfibenoit8
593,898,147 *3D00BD5B277B73CC5CF3AD3D19F386C698E39482 CFIELD07
593,898,148 *3D0FA4188018AAD68B418705DAE55E3C8D5BE73F Cfifj
593,898,149 *3D0251A7C3B9683A44B75263C12F872F59DEFE13 CFILP
593,898,150 *3D06BE64B071A82609DF3CC5478CAF6DF45FDA83 Cfioliviaed
593,898,151 *3D0BE044EDF6D1985CA22919EF87B4648AF05EEF cfirobin3
593,898,152 *3D0A883C3F41D877C72A431B7055181D74DA4BA7 cfisbdc9
593,898,153 *3D0D6CD68C17C9FC8903AACA30057CAE7D16F2C8 Cfisummered
593,898,154 *3D0E90C796F08D24EEE21A2F6DA318C4E3E56D50 CF%IT
593,898,155 *3D0183CBF84ECB346AEFC5512D5716B4B08B6001 CfI$t
593,898,156 *3D0DBC0A8F53F7C66E3B30866A47D2A88DCBA4AF Cfitopcated
593,898,157 *3D0556791634A39F24D6F34A8971C4CD0E9ED7FD CF:j;
593,898,158 *3D0364B67F8E23B8BF87356A5876EEF2B2DB5DE0 C%fja
593,898,159 *3D08293EC805F63AF15034C6EDE0240E983C1F9D cfjdixiing
593,898,160 *3D0CE79770893075121713AAEF40F3AF21A68B8A Cfjguidos
593,898,161 *3D005CF94B3FC8CD24033BAB842C2DCC246A2356 cfjjulia1
593,898,162 *3D09A35EC545341514D56BD76BC0B83B0C31B9F3 CfjlY
593,898,163 *3D08E48C63DAB6C6843564FC3ADE48F9319E6335 Cfjmodemed
593,898,164 *3D02BD80AE9D636AC8391065B8C7F99763DA73B8 Cfjsendited
593,898,165 *3D00F3A1CBCA7AD53DF64B1DF7AC47C2956561C8 CFjsk
593,898,166 *3D090A7716346A9EB5D0FEE9818FE74F18C8A487 cfjwp
593,898,167 *3D0867F1B556FA8B3CF20337EED70F6118FEFF3E Cf;jX
593,898,168 *3D0D7DEFA0BE9E10CFDF74B517C7D23AAA1B4171 CFjYd
593,898,169 *3D08B27510F5BB4A2D8D77F75F00F46B5F3CE06A C
593,898,170 *3D06340D75432470C5F085C4A08FCA39463E5830 C!!fk
593,898,171 *3D06C8A3CEF43DD5DE33C611B648BD7E22521EE7 CF.kC
593,898,172 *3D007E5FB8185823BD6274EB4A12392034CD1A8F CFkfh
593,898,173 *3D01BAEDF1478EE275FAA10195CD815BEB7CE707 C!fKg
593,898,174 *3D0322DACFFB9B9EC03FE3F849D71BCA943B8810 cfkhc@yeah.net
593,898,175 *3D077CDB39E4D63DE11BD4521D8DA217C8AF6B5F CF(KI
593,898,176 *3D0FE51097F559672D1008DC2170D2DC7E01572D CfkNB
593,898,177 *3D0CAFBFB3C8FA992BC5B1A29424C22650E056C1 CFkQ7
593,898,178 *3D0AD28F323084BCFDF5C56926ED9F8F53FBD3FD CfKTo
593,898,179 *3D05B31B62AD6C4D584B297EA18433D3C6BF0623 CFKZ$
593,898,180 *3D0AADF60872258641AA7AB9B7FB87DBEE4EF8CE CfL1&
593,898,181 *3D010A43B7E5D7A0AC492A9CEAFDC2A960E66F52 C#FL2
593,898,182 *3D03FF794935C4E60963C89760B7D34EB3312636 Cfl4/
593,898,183 *3D0F1FDC89FB5B5C7469D82F34F8474DAC29285A CFl6h
593,898,184 *3D0684FFA0DA2E2D63F93D3BF0E8344A57983D4F CFL9b
593,898,185 *3D04256B16FD63E32159B908D365DE84BD9CFDEB C)Fla
593,898,186 *3D02748207CBCB0B054E276266C6E0A90A0F641A CFla5
593,898,187 *3D03A1A0D0459CB7D47B611434C8FB6ED4962647 C&Flg
593,898,188 *3D0776CAC68C1E333FD3DF358FE71A83D7E4DF44 CfLmR
593,898,189 *3D01A88B735BA9B1E63D521B86DF10BB49868A95 CFLMWML66
593,898,190 *3D09928C032ADDD2A82093E4E659286685B5DD08 CFL+O
593,898,191 *3D0D3F6EEE8141F3F92407185E9A0891614722B0 Cf
593,898,192 *3D037C844147C03EA0B9A1202A522BD49EB7685F C/flQ
593,898,193 *3D07BE10863D52212C644F4B836E2EDEF9BAA993 C//FM
593,898,194 *3D07CBD8DEDFC5B747F7A51AFBD2BA0792407D5B C)F$M
593,898,195 *3D0E8A138A7D0D98C1447804FECA8EF94EB985BB C?fM=
593,898,196 *3D04509CDC4A1654C4302DD26B2A644A52E1EB42 C+f/m
593,898,197 *3D0C889EC4DAE29242D734A14A55308F4C74AB9B Cf+m3
593,898,198 *3D090E9E532365C20998537E07E926530B4708C5 CF-m5
593,898,199 *3D0AD9609758FAE26A7ACD3412B25B9C49BC46D0 CFm6Z
593,898,200 *3D015810127E07C442CB25BF41428923BB10CF7B Cfm8%
593,898,201 *3D023F493D72A5B6D7E8D624DD64BBB626C15BD4 CF!m9
593,898,202 *3D02FE4FC4365B681711C1247C88E85602885E4B CFmE0
593,898,203 *3D0B6A46940DC39B164B0C135159EF64C6E2CA83 Cfme8
593,898,204 *3D0C86547C2D4E78B207E7A63006BA03FEF88260 CF"mK
593,898,205 *3D0218CB2311E5CA91BA2F19A66A1F4F6ACEB050 CFM"P
593,898,206 *3D0BEAA766E7DBC394A62F3DCC52852FE3496CA0 CF.mq
593,898,207 *3D0434A1E998E854378592714849F0DC62637355 CfmqP
593,898,208 *3D0A235774ED10B8D59A2D1C9DE21B3EE34B8392 C,Fmr
593,898,209 *3D0016017787DD128D575FE1FD51CE6ABE00C8D6 C+FmT
593,898,210 *3D07B1F18D04A2D6D2D33871C1D06F733DAB5B8F cfmubb
593,898,211 *3D0F34ABC981A88770A9C6CAC96EA570D1253088 CFN-_
593,898,212 *3D0076432ADD5BF34137A945E8383201890926B3 C?,Fn
593,898,213 *3D02670B7237CC4395FCF007CDE41FC5306AEB3A C,fN,
593,898,214 *3D01097653FC4ECCB03E2A3888C6C81EB14CB6A0 C.%fn
593,898,215 *3D06E5A05D62CB598BF399B4D8A181133C74BAE6 CfN0t
593,898,216 *3D07B6F7F1F956CAD1F5C0C7EE176C586522FD97 CfN&1
593,898,217 *3D04B6ACF44369038AF84231F74C6DF0A8BC9CBC C?Fnc
593,898,218 *3D032B045549A2943483D584078A7857E7DB8F0B cfnfyfc2
593,898,219 *3D0D3A1C8E821EE6A7573B1F10AE12A689F10EF9 C.FNi
593,898,220 *3D0DB940E8B309796E8DFE72C87AA6E4A41FF0FE CfNj!
593,898,221 *3D0467DEC9D57C102F8DC90BAA0A98021614F62C C,FO?
593,898,222 *3D07A9789AF6385101FF9EDB6F871C1D76E11EF7 C:Fo?
593,898,223 *3D0B78EF58A12E457FF1A6EFBA64C68AB8119281 C!F(o
593,898,224 *3D09DB31482E327BC8BA66DADE63B229E0767D65 Cf;O;
593,898,225 *3D05BA56EED3DC92ECD6E9ED3490C57131B99A7D CF
593,898,226 *3D0CBD23A57C12D1451C9B16C06767DC2A591E20 CFO,F
593,898,227 *3D03842B540FF0DD62BF7D56E90748BD352942F9 Cf!OH
593,898,228 *3D077CF6EF7AFAADFAF5DFF537F663AD46377A60 Cfoift
593,898,229 *3D0A7EEA8BE2B70B0C98DFC749CE2F9CF705C5F4 Cf=Ol
593,898,230 *3D009416A6197A482F93F4D9FA1AD3BDEC704C12 cforster.comwww
593,898,231 *3D06074AECA1443EF7C148ECD8FB34D9578552CC CfP0;
593,898,232 *3D0E62F07D2F9EA0B7C53C80A0CCCCBEDD3360CE cfparma@363.net
593,898,233 *3D0F79106D36466A70D8E63960A95B689D063ADB CfP;c
593,898,234 *3D0D9F965E3FFF5713B3AAEE3A894624C62B3526 C:fPe
593,898,235 *3D0346A007D51617609E58AC25E3BA610F2DC0F0 CF-PEI
593,898,236 *3D03E223ED216B90C16B6D26A99C00F8306165D3 C-FpG
593,898,237 *3D0CCD8B76606E6E7DE12F1218A418CA4AE9E0E8 CfpgL
593,898,238 *3D062ADBF0302BB3C8AEC7ECE6D9241525AD95AA Cf,pH
593,898,239 *3D0A39C5B44D723AF6CE95A2B1723F58BE685C21 cfpmike@aol.com
593,898,240 *3D0B4C1E8736E8832C3ED78AA6F22B2441DD4803 CfPn_
593,898,241 *3D078FE7C43BBB93096B5E973EDCB650D1F1E3E5 CFpQ(
593,898,242 *3D0D6174B63EF926EC4B1AFD13D37ACF7C2A5B4D Cfpqylh3
593,898,243 *3D072AE4D5A23CD3BF889505F6240E7E0136F5D6 Cf:pU
593,898,244 *3D046F9E8126B4D92F6956CF95D26CFA3488571A CFp#X
593,898,245 *3D0D2603040992CF740B1C2D6886F5A3E5AFC1BE CFP-Y
593,898,246 *3D0FF8F61A4CC388CF45A9F674946CEFE8FF6BB9 CfQ4g
593,898,247 *3D0DB75E031D6CA92F4BFF8040F20B1E63B60C65 CfQ8M
593,898,248 *3D0033DE40400045DBC9665C064CE426557A2710 CF+qa
593,898,249 *3D0E6EE6F78DDA2295B1C94999C8C1FDC9EBCF17 CF)qb
593,898,250 *3D03E8D0479BB0BE122424C9B73244270E1C9BA8 CfQE/
593,898,251 *3D07E0178239507177A7A739782AA112D6383D83 Cf&Qf
593,898,252 *3D076BA33879115BACE32FC1F78BB175194267D1 CFqG+
593,898,253 *3D08AA1ED39AC982A22978D917C27E6B3194740E CFQhC
593,898,254 *3D0BB1207569054D26665C728CD50911EEE02AE2 CFqhE
593,898,255 *3D0443FE9D26E7C6DCE2D31A1A75890A747ADD04 CFqi5
593,898,256 *3D02B0307AE2FFBF10CAAA861E7A3E8C083DF67C CfqN"
593,898,257 *3D0637B2321CC0C8604074D0F5795C23A646F611 CFQO0
593,898,258 *3D0BE69E607490CA00A4017DE44C4AAE9365C162 CF!QS
593,898,259 *3D095C98DC2D40B96029B754C5F4E286C77A7DF9 C-fqw
593,898,260 *3D061F8A8921911F1255C3A64259F8314F2A4092 CFQZK
593,898,261 *3D07DE08D35288471DD410206F8D394059C93B03 C$F:R
593,898,262 *3D0CC503177BB9AFD58A1E35391C9BBC31562EFF C-f$R
593,898,263 *3D09842C29C592E7BA1FA49727BEE0E97F490E80 C!f:R
593,898,264 *3D0F87A73F9B0C23F65939ADA59BD2B706395447 Cfr19
593,898,265 *3D02E9D8FBCCEABF11548893207FF46E3466FD6F CF=R2
593,898,266 *3D0A6E631531B06DD8EA87AD56CAADC0B4061042 CfRfS
593,898,267 *3D036783F9D4B8F70F0BBDA35449C9B43D9F8A1C CFRN-TV
593,898,268 *3D0DE939E9EF68831E08C318374A4C172DFBDC97 Cfrr3
593,898,269 *3D0CCBAE835A1E96567FEDEA8A5D94282D1637DB cfrxqyhldse
593,898,270 *3D05E333568FE12D7A1BB9FA8C4397E7D220DA56 C!F$S
593,898,271 *3D022841F9101D7BFE5596E1A41BEEA31B83B34F CF<s
593,898,272 *3D066BDC7ADDAA0BD00E1BB3C763C0BC245D6059 C"fS7
593,898,273 *3D03B38996F71EF4730878CB527FE1809A738E72 Cfs/B
593,898,274 *3D0334155F2BA1712B772F4F13D864DE96C11085 Cfsk0
593,898,275 *3D023AA64AC22A6C069F118459C2642BFE51FD89 CFskd
593,898,276 *3D00ED76C137C87A38F6B6270F1BB6B3C99E69AE Cfs-M
593,898,277 *3D054E987E4712CC80F927CAB0F7C0218219EA91 CFsX8
593,898,278 *3D0D440B3D39602E65B25F06AF6842E0D11DAE30 CFsXn
593,898,279 *3D03F42EBFFE30EFDB0147FBEB7EBCC58487BAE3 CfSXY
593,898,280 *3D05AAD8CA8FB9520344EC50FA2A3A31CD7DCD04 CF/$t
593,898,281 *3D0A7935B1CB1EFBFAF5B51640362BEA93C1497E CFTCB
593,898,282 *3D09EB0049C7ED386BB1FEE98FCDE78696887B25 CFTI/
593,898,283 *3D05BF4A7E262F9A83B03F9EDF605BEF57441106 C=FtL
593,898,284 *3D01F1F5696CFEA4ABCD16A0AE433C75E341F287 cftrbswed
593,898,285 *3D0B368010ADCA12983519D68D555A530A7C9A9A Cftt/
593,898,286 *3D050FA31ADA658DE4AEC6FDF836291F73685F6E C:fTV
593,898,287 *3D0F6D00F6E2311AAA8500039DC32096742F86C8 C($fU
593,898,288 *3D086EB7C1D57E52CD825E25EC243D383025914D C?f%u
593,898,289 *3D0608704C2A7A13FCBA77C7B2992674250DE119 CfU99
593,898,290 *3D039F000D03660371A9BEA7538D7B7D7F60B034 CfUCr
593,898,291 *3D0F5D75315A947313167C656494643795DACAB0 CFue=
593,898,292 *3D075AB5FF142E3AFEA4C31D87BC677EB0B9D4E4 CfU!i
593,898,293 *3D03D4ADB1B2E59B2117B65CA97A45A121F0857E CFuR(
593,898,294 *3D0F225F8BD18F1D3AE3C16F3D204F6A73F1EB0E C/fV,
593,898,295 *3D07A6DE116C13231EEA96CD759A99E33D90E654 Cfvc/
593,898,296 *3D03358618CB2D5815B7F4F32B07A77F47C966AC CFVG+
593,898,297 *3D0CACF36FF4210DAD6FDD15D82CD0550587853F CFvNK
593,898,298 *3D0E61B5AF918425C65DB2C32907FACDDF53932C CFVP6
593,898,299 *3D09E13275A0AACF27B7FB8D4D61443FB55C70C5 CfvPs
593,898,300 *3D092FA2DEF9149CDE1CAB7EF9653E788FB1D539 CFVTf
593,898,301 *3D068CA6E7727A3A16CFB00245AB12AC29C9240B CF
593,898,302 *3D0AFF3B9F19A188015D7B84A75B599D7D711574 CfW?;
593,898,303 *3D000F7AA23F9A441D68D758B30042205451CC84 Cf.W1
593,898,304 *3D045366C52AE475F6625F54339C2EC5B50C756B CF,W4
593,898,305 *3D04A22523A7C49C79658C5019CC2ECE2C70589A CFWG$
593,898,306 *3D01EA00A566FD66927FC11BE26AF56B7460861F CfW/Q
593,898,307 *3D0C68C0B47D16C220EC5E58A15A3A859597EA3E CfWs+
593,898,308 *3D08A16BD5F2D10BC5B3C0B8F0D909D9D40C6327 CfWSW
593,898,309 *3D09E236585D54FC9F4BB572BBEF0B15175121FF CFXHh
593,898,310 *3D07501810B76EEEAD088FE2298C408B3E6A2248 CfX%l
593,898,311 *3D088074E6F666E4010F9104CA994C31DEF34A64 CfXuV
593,898,312 *3D0DB71D12FDF8B63E5ACC058476A0A6AF371008 C!fY0
593,898,313 *3D028CE9667549DE86D5EE8383B47C23B0275647 CfYBT
593,898,314 *3D06AE79152960683C180D546EB586CFF71D41D1 CFYuB
593,898,315 *3D050979BBCAD1954219D41345B4A29813B07A90 CfYV!
593,898,316 *3D04F1E7B936F34F34D4FC422B90FD6967D7D10D C)+FZ
593,898,317 *3D0F1D9D30D677AA55840BCE03D1ECEB3EC09499 CFZ=_
593,898,318 *3D0EC58FEC26BB7CED978BBCD919688E34BB5F58 cfz891
593,898,319 *3D0993F3A129132A01565C0B326303AA4B375A0F CFZ-e
593,898,320 *3D031721E2AD585C0A39F7E360361C760B5F4A7A CFZj_
593,898,321 *3D025A8A012041F3A057F374FC7932497AECDFB7 CFZje
593,898,322 *3D055BDF715C1AF45E3571251ACBCEF8B61EE133 CFZu&
593,898,323 *3D020A4104441104A218FCE8BBB28A5EE9FD9E77 C=G
593,898,324 *3D071264AAE8B169423B0BB49BBBA8F2BCC74CF4 C/""G
593,898,325 *3D02EE0C81FF07F093C561567C8ABE48AC2C08BE C)G_/
593,898,326 *3D0100C3C9B2EDD2E9F90A538705804B699E2987 C)G%#
593,898,327 *3D0CF8BFADA3357BA789DDE6ABFF918DF8D40838 C)G
593,898,328 *3D0C6735BAB02B7CABB0A7F568F777AE7F52421B CG:(&
593,898,329 *3D0355FE5DBD88131BA2E4D0B8F598A576AD6BD7 C!_;g
593,898,330 *3D0A2F3A2FDA7BEB51FF80FC3327634B50C6628E Cg).?
593,898,331 *3D090371F3BF5C052CE666AB33ECF9BB0BEB0D98 Cg
593,898,332 *3D072F3CC7387BF2987471AA56EDA3E7B93B47F1 c!|G
593,898,333 *3D070A4082A809DC502D99829D22065F70202884 Cg06Y
593,898,334 *3D00BB9DB72C5EEE9FFCB1C14D36C978A2B3181F CG0_u
593,898,335 *3D03465978642AE76995E739BC6DE790808CDB3C C/G1,
593,898,336 *3D0DD8C93AAABC132FCFCBA56FD80B09EFFBB05F C#G1/
593,898,337 *3D067FA763E56854920ED8B28AB48B07EA89AFFA CG:)1
593,898,338 *3D019121ED13B64C382076FB9BE24BBE4D153E29 CG10q
593,898,339 *3D031126472E4A35A9859313436ACC536B57DB49 CG1994
593,898,340 *3D0AB6791FA0E4D98ED72EBA8B9194516B8C3017 CG1F/
593,898,341 *3D053C1854DD3E188FB2DA75B2D8DF358D7F7A80 Cg1G2
593,898,342 *3D0FBB5982A839C3CD2BC997D5D1BAD8C6229B7A Cg1Ge
593,898,343 *3D0F92566D41DE7CE94102F76203ED262F30A39F Cg1hq
593,898,344 *3D0756863B7E827DFC138B90495FA8CD73D77CD3 Cg1Mo
593,898,345 *3D03D4CC1F07A55E00D57FD83795196D10A3E1DB CG1Ra
593,898,346 *3D067B977A6CFF8D032790C19AC59C2F0B1D9D1D Cg+2-
593,898,347 *3D0AEEAA2A0D35A8997C21E53F56830C7D3139E9 CG29e
593,898,348 *3D07E16295131D04810900BBBF02DC37B82156F8 Cg2f!
593,898,349 *3D0C4D703B63D7F46248C4D55585E73C50C81C05 Cg2SU
593,898,350 *3D0515954725F6A59A4B968318F0CBBF2015E842 CG3).
593,898,351 *3D007D6D3B20FD65A9B207049343DBE3697A0DD4 CG:3d
593,898,352 *3D0840650BE4DE711A8576329718087A6B62FA9D Cg3n1
593,898,353 *3D067A9A468B75609A8F48FEA021F944FB9EE74D C;G3R
593,898,354 *3D09CB5CAFEBC06E26A5AE0FB5B81071F7BA16DB CG#3X
593,898,355 *3D00D4A9098085022BBE2B48A4601C2077EFC6E6 Cg4cY
593,898,356 *3D05538038165186ADEABB4BDBBEA1058E437262 C!g_5
593,898,357 *3D04546A1BFB9450187A01A8B5D4340CD857B613 CG5f=
593,898,358 *3D0ED3853A24880BA5D43E2BBB74716EAB02C549 Cg5lb
593,898,359 *3D0F5DA7A604C492B303FA96B48B6BF5C4E1748C C(G5q
593,898,360 *3D0523C799A11858AE50EFBC5B4680CDB3CCEBC4 CG5VM
593,898,361 *3D00E1A5F3746F9BE4E59EFF28A9EFACA76ABEA0 C+G6+
593,898,362 *3D0A4613460634FCBC09F02852C5A4D01E1E39F1 C,g6P
593,898,363 *3D0B3167580ABB37F860F9E76D2EAD33D77DB038 C:G75
593,898,364 *3D0FC6652F4DE870B7B39D98712AF6369ECBEA1D Cg7C.
593,898,365 *3D0082E1D03DB8F611826E98983F6512562F6AF0 Cg8!4
593,898,366 *3D0AB0F9A11BEDCC9BA3B296BEC6B53FEB95C9C5 CG8,K
593,898,367 *3D0C3B42646D225AA19D4636EF901BB87D99EEE9 Cg8%Q
593,898,368 *3D09526F2C679DA5DA0FFDF1773A8ED1A6B00E18 C!G9#
593,898,369 *3D028B8846AB6BB65838325197C40805B8050AF7 Cg&9.
593,898,370 *3D0A35BD7167E2EAB8DADC907AD30D10E9920F60 CG"9E
593,898,371 *3D06D1D3BEDF699BFF21DE4131231AB95094137D CG9pk
593,898,372 *3D0E09EE9560B37ECD4216F409AE2E0BE48E888F C&G9T
593,898,373 *3D0ADB7BC11A88433E62AD2AC2D8CEB632641D72 Cg9U;
593,898,374 *3D0378B0BA6135BB60E41B3CC2CE39BF4CAD94BC Cg9V;
593,898,375 *3D010F6422EFC9B42FB7DC5451C688FFE0DEF5B2 CG)_A
593,898,376 *3D0B01BB70156423BEA7BF692DAF591D2F046488 C/"gA
593,898,377 *3D059BCAC8AAD5C04AA165A04833C7DA5FE2952B Cga$,
593,898,378 *3D0D32D42C15460C73C4894E77186B9A30055FA4 Cga&#
593,898,379 *3D01F804D33FE81998B49EC2F172D382BE070891 Cga:3
593,898,380 *3D0CF6BEDF67AF3A83F08FEAD73E63A49BD78A1F CG%Ab
593,898,381 *3D0BDC552064FEED9371DDC6573ECACE030EFBB5 Cgafhbsw3
593,898,382 *3D06CE1A1FFA13353E4B647DFD0148D2FA7CC076 タイトルCG:AirCar
593,898,383 *3D0624F4A7C381A5C3B5AD60333C4F428B600C46 CGalp
593,898,384 *3D0541B3A9098A6344F33E8238A6D2B52E31CA95 C&gao
593,898,385 *3D043A8BD7E83703C924B59363F9EDED6800037F CGap=
593,898,386 *3D09D83F8E22118FE4AE4B4B5BFF27745FA35202 cgarciaeu
593,898,387 *3D04F72031AD8F4EE0E8E3DBED0AB105E7FFCD78 C.gat
593,898,388 *3D054F94CC8EA19DC7A5570CB0B027852AEE04BE CGAY7
593,898,389 *3D08D74317213E18EDD63562EA9663DEC7375BA8 C;"GB
593,898,390 *3D084D8F88E8DF3F2C8B549D218DDE26E1256B65 C!,GB
593,898,391 *3D0D489F2B338DCF1B8996A1D41F7C937E9F9233 CGb%
593,898,392 *3D0A5BF5530C9F5FBD0673A0DF25A7CBE28572BB Cg($b
593,898,393 *3D07C4FC388E3260DF201CF94707176DA940F727 cgbi@email.mot.com
593,898,394 *3D0478E4C2D9C3378B33A9B30C69EAC856A3F1E6 CgbR"
593,898,395 *3D0D7182AD451136514EEABE9791E137015E0524 cgbrahkg@hk.linkage.net
593,898,396 *3D0FCF8539101A3F4D4BD1CECBFB39FBBCAE11BE CGbt:
593,898,397 *3D07BFD3D4D4BE1C485172829485BB21F71F1FD3 Cg
593,898,398 *3D04A0CE1F3C50088BA859CFC248326732F9B903 CGc)7
593,898,399 *3D0DF4994738BC5D8F6B5973556745668C1A8366 CGcGq
593,898,400 *3D05D7EA0EA5C9A8923196A50693B97725BB8247 C/gCK
593,898,401 *3D01D4A1F653B70B621E64C6E611A1B787939804 CgCtl
593,898,402 *3D092E00031D50B0EF2CD0CD2EA4AF073611FCB5 C"GCW
593,898,403 *3D028445CE43197E462C3DCC8266759AF892817E CgCW0
593,898,404 *3D0A51536AAF3AA30F3F14BC11CFA0104784EBCA CG,(d
593,898,405 *3D01D09479CDB02735FA9EA3D6627F099A3C77DD C=gd0
593,898,406 *3D0FB7C3E25820A115153B8E8274C3D4DD900B4D CGd19
593,898,407 *3D0F72F53030AE6E109581DF8FCAB25628A373A8 CGD2
593,898,408 *3D0F2564CCAEB7B67207B6BDE7EBA109DBA5B70E Cg/D4
593,898,409 *3D0492C8FC0427218750CE8B02002697FA49DD46 CgDfg
593,898,410 *3D00C0424CF1343FB22BE1F8EB0F11970EC06A42 CGdh1
593,898,411 *3D0722777A78140D21E6CADA7700327BE146BB84 CGd?I
593,898,412 *3D0FF766564F80ED29FC130DF8E92E0D247265BE CGdl"
593,898,413 *3D0636262210828990848F65DA9750C812DD8A00 CGdlF
593,898,414 *3D0133A6B02BDA57A3FAC89BB43C5BE4664E325E CGDRAGO
593,898,415 *3D03921C2CD8763C4ACC5C33AB8E7AAC6DAE32A1 CG:dT
593,898,416 *3D028FA73BBB9F4235ADCDD3AE5A1AA894ABF442 CgDXL
593,898,417 *3D04C14603E1BADE64C763F118F30B9279D711B2 CG"+E
593,898,418 *3D03CABA12F9D1DC3538EDB7AD7388E470267595 Cg+.E
593,898,419 *3D016E481AC888A450C37999D7AA034F298AD07B Cg-e"
593,898,420 *3D02B3465F18B4CABDEE837D02FF23003CCE2F4D CG/e4
593,898,421 *3D00ECD6ABAFB9FEB4211863646DF28EEE07E3E4 CgE%a
593,898,422 *3D0EB4D9800473FF8CCF476AA590FC4BE1C523B3 Cge%d
593,898,423 *3D00FF4C594853E1253C5C4B0EE8928753425561 CGEkF
593,898,424 *3D03114B62E43B0E41F07BCC00AF4E01950159BA cgenius0
593,898,425 *3D062DA81EFEECFF2F805BE955F59AA91CF4C534 CgeOB
593,898,426 *3D079180310388839445E231640D80DD0F4FDE71 cgerard@aol.com
593,898,427 *3D0BA7300FCD2DF30660BF0DE92C5D1B93179FD3 CGeRI
593,898,428 *3D020964D2C7C805A62D6FADB163E76AD4245259 CG.:f
593,898,429 *3D07DFA84140717E16060433DBD753E5D27CCEE7 Cg!f
593,898,430 *3D05594FA8EB0F3FFA132EB26E77B6D3EFFEB333 C+GF5
593,898,431 *3D0FDCD79F814AEAA7042B3A3DF3C2EC00B3C7F8 C
593,898,432 *3D0477A670B77A0CFA812F2D5CF8038392292243 cgf90@aol.com
593,898,433 *3D0F6CB065F219E18D7A2D3A4255D278DF3F6F7B CG-fc
593,898,434 *3D0850063A4982889858CAD3F97416BB7FFFDDDA CGfHG
593,898,435 *3D07D96516E839C30A9BDFC83D2BFAA5A6D71469 CgFQ&
593,898,436 *3D09E18FDE367AFC35C09A5E701DDADF314C560E Cgfqs
593,898,437 *3D079A0A90A80C6848895685F24BA19FE073040B CGfvf
593,898,438 *3D02927F09281A8A5DBF7157E564F3DD099698F3 C
593,898,439 *3D06E118A655B0CBB80D584342C6598DE9063DDE C)g"G
593,898,440 *3D003B98CB4A464E37A46D3913A42C91A82C4CB7 CGGE
593,898,441 *3D0A2328ACF49723D8404978C0625F90191C4158 C#ggG
593,898,442 *3D08869C3EB6CC59A7C3B3A673EB979CE1DA381E CGGGr
593,898,443 *3D07453BB95C7689C32D9AA0D464A01E23910887 CGgIg
593,898,444 *3D0A46259E80805CFD9880BCCB15AA3B277DEDED Cggm?
593,898,445 *3D04667C48BE437D1E2906215EE13CDF5BA0762A CG"GV
593,898,446 *3D0467183A8A9B6D630732D5A2177695542AF55A CgGv:
593,898,447 *3D03698E20F38E29394EF0DA024629116C169865 CggW"
593,898,448 *3D022887EA4A424AC8AAE5CE41873EAD44FE9FB0 Cg%/h
593,898,449 *3D0938BA6BB274E81C46C76E1BCB9F3A8614E446 CGH7M
593,898,450 *3D09DA2D96DE9C0DD902E0605A4A808630556397 CG;Hc
593,898,451 *3D05DAF17D6F8A493BCA08B83046EA9969A33A89 C
593,898,452 *3D0DE4DF3871FA9428F24EAE783281B58C453F0D CGhhp
593,898,453 *3D0FCC308489D4B694FEB5ECE4ADA2DD1D2CE186 CghNI
593,898,454 *3D038048D3C944BB56E1F87908F7A3CB2492434A CGHQI
593,898,455 *3D06AE1C648080E251BFC5031992E3175FC1A37E cghtcght2
593,898,456 *3D0427FFD5ECBE1EC2F6D489C12978BA58B43E2E cghuxn1234
593,898,457 *3D04A85CA48654A0281E2AAB11EDC9526B55F681 CgHYS
593,898,458 *3D08314FA7368E50D8E6E684A6113904805517CB C_G(I
593,898,459 *3D04AE1DCDE6C90CD6B7AE1A90BB4F5BE2E5A197 C=g?i
593,898,460 *3D09ED1EF47D31D65B93A807009D15B8B6C37798 CGI)7
593,898,461 *3D0F6912CE6294C2DB39414D75F49D93A2141EF3 CGIH-
593,898,462 *3D05A2E36A93684E5E697093EE45B4E543831E9B CGiia
593,898,463 *3D0149D6DCE9255BA0CE8DF1AA7C9FF429E47786 CGiK#
593,898,464 *3D03AE468802778C4E5B1750FE3356123E511818 cgins2200@yahoo.com
593,898,465 *3D0F911D3A4AE07EF0B63702EED725A28D81214E CGIpO
593,898,466 *3D05429A72FE1DD4BA1465880A463222F90DB9AF CGiq,
593,898,467 *3D064C85ADB9785B381221DA2893373B65B30396 CgiYZ
593,898,468 *3D0E6F61E79DE0FB34DB14025763F08D07717011 CGIテクニカルディレクター:八木橋浩史
593,898,469 *3D06936E14002E01FB7AB2C3EDCA79EBE798BD1C CG,:j
593,898,470 *3D0903C4DB2DFFC487EC94AABD055BC44A9910B4 CG%j2
593,898,471 *3D0EC7EE53CED5CB6534C9B60CFEADD23F8E7C26 cgj42
593,898,472 *3D0FED5B97787DA6828ECE5E109E1E1BDA3518A4 C?gj9
593,898,473 *3D054AEC9154933B2CF21356D5062197AE722F59 cgja@hutchcity.com
593,898,474 *3D0C03E08E0DBDDBD5F3D900BE15E428FCC5885E cgjbozo1
593,898,475 *3D0E2312DDB2C56E05F468AFA80D86883D32305A Cgjguidos
593,898,476 *3D07740DB1DB6032D15748135FF57ED25A03CAB3 cgjh@elong.com
593,898,477 *3D0307E11299CC5D8CBA8FAFE3C721BFF4537C7E Cgjiguaning
593,898,478 *3D03C59AC113A3E68E44A2F1801E552662573383 cgjjojo7
593,898,479 *3D0968B7AB7712FE2FEBBB265259B974AB00EF4E Cgjjordans
593,898,480 *3D0BF3085403224946287445FF2898CA20C217CA CGjLU
593,898,481 *3D0CA54076A713ADC2EF1B2DA4D2C9FBD5583367 cgjqkblhjg
593,898,482 *3D037858F295F73DD438EA9D6AD7A393C9811BCC Cgjqwert6
593,898,483 *3D0DE8ED99398028656D1F66C5697F85BCF945BB Cgjracerx7
593,898,484 *3D00F5FECDFDA3F8A2AFC41E507E2A1CCBCA21C5 Cgjrusty3
593,898,485 *3D0BEAC2E647FAAD3A400926C456E4FE62D4EBAF C-Gk#
593,898,486 *3D03F3551C6B9C5025D1657FD444A8BC5B88B67C C-gk+
593,898,487 *3D034CDDC8DE190F8E8D7F7B9FA09D59F2864FD8 CG-k1
593,898,488 *3D055D764774FE6958CE2F6434706F869AEF15DF CgK9$
593,898,489 *3D0C24F6B9B43D037FB8153DD7D61ECFFB104010 CgkG6
593,898,490 *3D085B105C9C20C29E78229269E02C137C6EC51C CGKV%
593,898,491 *3D02E29E7721BC3C22E853A306C7FBCD33879867 CgkvQ
593,898,492 *3D0ACFCD612117F15273FAA89EBFF4C951015E35 CGl-/
593,898,493 *3D0E9675C3F8A9A7406CFA48A9D658F33DD1C8C7 C_gL1
593,898,494 *3D089E95F9CCA3987EB629E0B914CAA384E2CD9E Cgl4R
593,898,495 *3D0483C3936E6C8274A6208B88F9BD54A8628E86 C_gL5
593,898,496 *3D0E46EBFDAF75E1FAC5FC8F19C9A550DE43B44E CgL88
593,898,497 *3D0883839D260C8AF9EA838ABC1D1BFE6462A4FC Cglaube0
593,898,498 *3D01991330CA0B02963FE2AD20676542C1069F50 cglbi@yeah.net
593,898,499 *3D050E9EEE4F24FB8CE1DE29155C66CE41C9C5BE CGl_j
593,898,500 *3D0BA436518DCAC16977D075956E00A74EEE6D8E CGLKs
593,898,501 *3D035FF0FC6BB176D7F1071CE3172C547A7D6309 cgll@163.net
593,898,502 *3D086E388371488D1FDAB483B5EA6AF34DC3369C C-GlN
593,898,503 *3D0BFA3D4E335738D33725277AC88E56E6714BE8 cglobal@openway.com.co
593,898,504 *3D0481980DAB33B21FEE58CCABC82FCA5BC2A9DC CGl:p
593,898,505 *3D09F95732CEAECDFA6A3923F50D86121FEB2EA6 Cglqs
593,898,506 *3D0293A11794828E4F1E7E3F106CB3B616822B22 CgLYI
593,898,507 *3D0C7754B015E3B77A3774CF8F653F4F07D4F4D6 CG#LZ
593,898,508 *3D0C2902E101D3409E7C40B827B933562FBA3C2B CG&M6
593,898,509 *3D087BA7377E615911E47066EAD31414C7369F66 Cg)mB
593,898,510 *3D0FCAEB9785DEECDBFA2966BC89594D9CD80E2F CgmB9
593,898,511 *3D03BC4E48DB6F99C7A0531C1914D80F60F73EC7 Cgmgk
593,898,512 *3D046A50C3D3C81A710DEF318DF3A836C1906C0F CgMH0
593,898,513 *3D05BEA702702C847034AA0B5D2DDEBA9B59359E Cgm_K
593,898,514 *3D015F1A5275B2D8AED2692DBCA548B9D067B53D CgmK+
593,898,515 *3D08AE2204FFBED7CBD92F434A40AAC85E77590B cgmoe
593,898,516 *3D000C63CB461ED4E359AABF18522D970A0EDAEE C-G(n
593,898,517 *3D08729A8F12020C839B92BEDDAD2F3A8A027589 C%gN&
593,898,518 *3D01DF26E51DA6814E036124C9455746DCAD3351 CGn&6
593,898,519 *3D003DC284A29AEB991B0D9A9436F397242A09CE cgncgls6
593,898,520 *3D01AC39BDE7AC73889029F6807376024D35B4A9 CgnjA
593,898,521 *3D0BF33F146D997DC5FE272EC7C09703C214CC47 Cgn,K
593,898,522 *3D0C09A7FFFC9C439373799CC3CF11B958B391E4 C#gnM
593,898,523 *3D0656A9FB3465A87B12190416ABFDC48FE937EB CGNmw
593,898,524 *3D00F1DB876BE3F73222B9AFB44E9E8CB8C357FF CGNoG
593,898,525 *3D0D183A82663A2B0D701732417B5D8162F6656B Cgnph
593,898,526 *3D0387FDCD1C209DF0B79284394BB294A03C2A67 C)GNq
593,898,527 *3D0E1AAB1B34B4B15181C1B7AB6B5BF48BEF8FE3 CGnSU
593,898,528 *3D00C6DD48E2A3CECBC5F5F239FE5E62E3896F0B CgNU8
593,898,529 *3D016AD57F7A97F38ACC5B0D82652159D87072A5 CGnUF
593,898,530 *3D0AE5781D1D1B99BB55EC96E9E297F2BF10B9AC CGO0m
593,898,531 *3D0E5CB7DC4EB06E9B74C976949801A8A43AA6BB CGO&7
593,898,532 *3D0FF47ECA1765AC7326D3394445EA5FC9E168D3 Cgo?B
593,898,533 *3D0A17F359F2BBF0C50DD2C01D2A0A1615222926 CG_oD
593,898,534 *3D0E7097818F2F99567B40214F1142822D430663 CGofl
593,898,535 *3D07BFDD60E10662E511A5BD7ADC848A56B24D06 cgokfdnp
593,898,536 *3D0B2B677200546D7EFE42831AF2154929DD111D cgoochie
593,898,537 *3D042A0ECE54F290F33277A474C1497E5B362DB6 Cgo
593,898,538 *3D0E61238396FB28EB1694E7BFD1E633545D7308 CGOZd
593,898,539 *3D032548E38C194A4BC31FF5B21D8A525352DEC3 CG!p.
593,898,540 *3D04A31E65977A2766968A7754B1DF59DFD1569A Cg
593,898,541 *3D012257A98B829716494B11921DBF522E75D1C5 cgpath
593,898,542 *3D0DB91CD5C70825D186FB29FBDFD756AD74D683 CGPC=
593,898,543 *3D05538876EDCAFDA567CBB72B4E9027B766A458 CGPDM
593,898,544 *3D0321E4EC23C9DCC6AC4B08DF71BC51B731D2C3 CgPdr
593,898,545 *3D0559136AFB77132907B1C9DDB69E2AA14C1BAD CG.PE
593,898,546 *3D0B9CB02F6B1BED1C3AA06DEF60E10F7739E655 C:Gpf
593,898,547 *3D04DE08DBCB3E0E863C6C45A4DB05050CD1084D CgPhB
593,898,548 *3D0464A8B2873D94C299D5B39BB41A3EF1F67EE6 CGpi;
593,898,549 *3D0FC1F981FF6CEC2F85A75C0B29AE7C1A87D1F1 CG.pk
593,898,550 *3D046F8EBF6AD9417F1D7DD9674C62C335353802 Cg-pq
593,898,551 *3D0A0B5AF7E86C32F465B1EE3F91DBB5FA9DEFA5 CgPQs
593,898,552 *3D0C0F1D7C965E207B8D21FA9ACCB81A796ADFB8 CgpY%
593,898,553 *3D0568C6C0F80AD8448646A0B4B7DA67EB0A3F4F CG(.Q
593,898,554 *3D0CCB84F3F10ABCB84A3A018ABEE1459A51734C C,Gq:
593,898,555 *3D0E0A06F9843A61B8DC852AE72B59CC957F5691 Cg,Q#
593,898,556 *3D0CE656B38305BD64B5F264B748770DD409BFD0 Cg/Q4
593,898,557 *3D0B5D917FBA4A6A03ED67B26B10AAB623AC4BD2 CgQ7
593,898,558 *3D033DBDB83E2566B8E498898B4B9D1D545B381F C+Gq9
593,898,559 *3D0C15583C671EFBA3A9D52E3A611885CD8BE78E CGqew
593,898,560 *3D0C10F17BB74655A3D27EE6837FAA5FB38D6733 cgqs00s
593,898,561 *3D0F03EAD71F40CE7740A977C8CE6F81C2E825A0 Cgq%t
593,898,562 *3D0AFE26616BB8599BE271D97C3908876D1C6D43 CGqt7
593,898,563 *3D027BCC53B253EA1FB3A3A7B4E59786E05CD5FB C!GR
593,898,564 *3D0530B2CF1C6E8ECC0E1E661C8F4FB6B06601F9 CGr3A
593,898,565 *3D08657CEA8F1087E1CF2C9B88CD20EF75CA09AA CgRAa
593,898,566 *3D08A9F66CC1D43CB960DBE03E6F4193F93A57C1 cgrafton@aol.com
593,898,567 *3D01B7C9A29CA22778E6AF5BE9008AB5510B73E8 Cgraymail6
593,898,568 *3D082FA6FA15C639A0CD6F79B309DA243DBC72CE CGR!E
593,898,569 *3D029DC30085FF133F98CA43F0220658B05DF907 CgR+f
593,898,570 *3D074EE987948AB1E1CA2B6B21B123AA57780A1C CGrj_
593,898,571 *3D0E766EE1EE0644BF82C3058EFEF575B0A5A20E CGR+L
593,898,572 *3D0DF9E1C90C2DDA881EF37D041A615B2993E3CC Cg,rQ
593,898,573 *3D00A176F8BADADA081A5639666F7E3EDBC8B9B9 C+GRv
593,898,574 *3D04154E260441BB9FE7D8922E403577D1304EF0 CgrV8
593,898,575 *3D07AC6334C9260F0D7790AC05CC50334247D68C CGRvg
593,898,576 *3D04B08620DDD46922DA2190D73863017BBE0D6F C$Gsj
593,898,577 *3D0568AFC735DCC1FBD9A4ADB55C2F18B42AA12D CgS-k
593,898,578 *3D04BB458AC39EB6DCA33D16C1BD6FA504B246FC CGsKh
593,898,579 *3D09CFE32E12BFFFF52F20A4C5E274FFD11F82D1 CgSpS
593,898,580 *3D0179C13D423C74EF6301BF3B460DCFA77F4E7B CGSr2
593,898,581 *3D00FD94A4EB7A5951E3C2266CFC4920922BC0E7 CGsSe
593,898,582 *3D0F0FBF0DDA357798FDE7764B0EF309DF3A64DA C,gt-
593,898,583 *3D0EBC364C92B2BA378438A74BB06AC9EBD2C789 cgt05kb
593,898,584 *3D0922F3A49CB3A6FE9928F0F6338377241E2141 CGT8k
593,898,585 *3D0C490A72D253469ABAA880587A69F542E2444F CGTc(
593,898,586 *3D0D7D51C1E60C858A9DA467F3A5C476A3C22991 CGTfv
593,898,587 *3D08C7E5D0BBC8155E88C69157A58DF151C9B594 CG+Ti
593,898,588 *3D04192B85A1D93E746F3A3503D4825265FAC336 CGTR)
593,898,589 *3D05F181F6CAF8DFA85D7F5C6DADCD7686E33D81 Cg+tr
593,898,590 *3D02A2B274F8F8927465EC1F0C2DED979FBAB6FF C(GU.
593,898,591 *3D041AC7E91C007A2A5BC6B5E7428BE1643D7625 CGu"
593,898,592 *3D0DF5C60BBAF697BA8AC73F21D783DA7ECFC3A2 CGu%#
593,898,593 *3D06F5752B65DE0E9867F93217185378A5A8A436 CgU22
593,898,594 *3D012F7